mirror of
https://github.com/lh3/minimap2.git
synced 2026-09-15 21:17:54 +08:00
renamed module name from minimap2 to mmappy
minimap2 clashed with minimap2 from conda
This commit is contained in:
@@ -1,6 +1,6 @@
|
||||
=======================
|
||||
Minimap2 Python Binding
|
||||
=======================
|
||||
===============================
|
||||
Mmappy: Minimap2 Python Binding
|
||||
===============================
|
||||
|
||||
`Minimap2 <https://github.com/lh3/minimap2>`_ is a fast and accurate pairwise
|
||||
aligner for genomic and transcribed nucleotide sequences. This module wraps
|
||||
@@ -21,7 +21,7 @@ or with `pip <https://en.wikipedia.org/wiki/Pip_(package_manager)>`_:
|
||||
|
||||
.. code:: shell
|
||||
|
||||
pip install --user minimap2
|
||||
pip install --user mmappy
|
||||
|
||||
Usage
|
||||
-----
|
||||
@@ -30,7 +30,7 @@ The following Python program shows the key functionality of this module:
|
||||
|
||||
.. code:: python
|
||||
|
||||
import minimap2 as mm
|
||||
import mmappy as mm
|
||||
a = mm.Aligner("test/MT-human.fa") # load or build index
|
||||
if not a: raise Exception("ERROR: failed to load/build index")
|
||||
for hit in a.map("GGTTAAATACAGACCAAGAGCCTTCAAAGCCCTCAGTAAGTTGCAATACTTAATTTCTGT"):
|
||||
@@ -86,7 +86,7 @@ Arguments:
|
||||
This method maps :code:`seq` against the index. It *yields* a generator,
|
||||
generating a series of :code:`Alignment` objects.
|
||||
|
||||
Class minimap2.Alignment
|
||||
Class mmappy.Alignment
|
||||
~~~~~~~~~~~~~~~~~~~~~~~~
|
||||
|
||||
This class has the following properties:
|
||||
|
||||
@@ -1,5 +1,5 @@
|
||||
#ifndef CMINIMAP2_H
|
||||
#define CMINIMAP2_H
|
||||
#ifndef CMMAPPY_H
|
||||
#define CMMAPPY_H
|
||||
|
||||
#include <stdlib.h>
|
||||
#include "minimap.h"
|
||||
@@ -62,7 +62,7 @@ cdef extern from "minimap.h":
|
||||
void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
|
||||
|
||||
#
|
||||
# Mapping (key struct defined in cminimap2.h below)
|
||||
# Mapping (key struct defined in cmmappy.h below)
|
||||
#
|
||||
ctypedef struct mm_reg1_t:
|
||||
pass
|
||||
@@ -77,7 +77,7 @@ cdef extern from "minimap.h":
|
||||
#
|
||||
# Helper header (because it is hard to expose mm_reg1_t with Cython
|
||||
#
|
||||
cdef extern from "cminimap2.h":
|
||||
cdef extern from "cmmappy.h":
|
||||
ctypedef struct mm_hitpy_t:
|
||||
const char *ctg
|
||||
int32_t ctg_start, ctg_end
|
||||
@@ -1,7 +1,7 @@
|
||||
#!/usr/bin/env python
|
||||
|
||||
import sys, getopt
|
||||
import minimap2 as mm
|
||||
import mmappy as mm
|
||||
|
||||
def readfq(fp): # multi-line fasta/fastq parser
|
||||
last = None
|
||||
|
||||
@@ -1,6 +1,6 @@
|
||||
from libc.stdint cimport uint8_t, int8_t
|
||||
from libc.stdlib cimport free
|
||||
cimport cminimap2
|
||||
cimport cmmappy
|
||||
|
||||
cdef class Alignment:
|
||||
cdef int _ctg_len, _r_st, _r_en
|
||||
@@ -69,23 +69,23 @@ cdef class Alignment:
|
||||
str(self._blen - self._NM), str(self._blen), str(self._mapq), "NM:i:" + str(self._NM), tp, "cg:Z:" + self.cigar_str])
|
||||
|
||||
cdef class ThreadBuffer:
|
||||
cdef cminimap2.mm_tbuf_t *_b
|
||||
cdef cmmappy.mm_tbuf_t *_b
|
||||
|
||||
def __cinit__(self):
|
||||
self._b = cminimap2.mm_tbuf_init()
|
||||
self._b = cmmappy.mm_tbuf_init()
|
||||
|
||||
def __dealloc__(self):
|
||||
cminimap2.mm_tbuf_destroy(self._b)
|
||||
cmmappy.mm_tbuf_destroy(self._b)
|
||||
|
||||
cdef class Aligner:
|
||||
cdef cminimap2.mm_idx_t *_idx
|
||||
cdef cminimap2.mm_idxopt_t idx_opt
|
||||
cdef cminimap2.mm_mapopt_t map_opt
|
||||
cdef cmmappy.mm_idx_t *_idx
|
||||
cdef cmmappy.mm_idxopt_t idx_opt
|
||||
cdef cmmappy.mm_mapopt_t map_opt
|
||||
|
||||
def __cinit__(self, fn_idx_in, preset=None, k=None, w=None, min_cnt=None, min_chain_score=None, min_dp_score=None, bw=None, best_n=None, n_threads=3, fn_idx_out=None):
|
||||
cminimap2.mm_set_opt(NULL, &self.idx_opt, &self.map_opt) # set the default options
|
||||
cmmappy.mm_set_opt(NULL, &self.idx_opt, &self.map_opt) # set the default options
|
||||
if preset is not None:
|
||||
cminimap2.mm_set_opt(str.encode(preset), &self.idx_opt, &self.map_opt) # apply preset
|
||||
cmmappy.mm_set_opt(str.encode(preset), &self.idx_opt, &self.map_opt) # apply preset
|
||||
self.map_opt.flag |= 4 # always perform alignment
|
||||
self.idx_opt.batch_size = 0x7fffffffffffffffL # always build a uni-part index
|
||||
if k is not None: self.idx_opt.k = k
|
||||
@@ -96,40 +96,40 @@ cdef class Aligner:
|
||||
if bw is not None: self.map_opt.bw = bw
|
||||
if best_n is not None: self.best_n = best_n
|
||||
|
||||
cdef cminimap2.mm_idx_reader_t *r;
|
||||
cdef cmmappy.mm_idx_reader_t *r;
|
||||
if fn_idx_out is None:
|
||||
r = cminimap2.mm_idx_reader_open(str.encode(fn_idx_in), &self.idx_opt, NULL)
|
||||
r = cmmappy.mm_idx_reader_open(str.encode(fn_idx_in), &self.idx_opt, NULL)
|
||||
else:
|
||||
r = cminimap2.mm_idx_reader_open(str.encode(fn_idx_in), &self.idx_opt, fn_idx_out)
|
||||
r = cmmappy.mm_idx_reader_open(str.encode(fn_idx_in), &self.idx_opt, fn_idx_out)
|
||||
if r is not NULL:
|
||||
self._idx = cminimap2.mm_idx_reader_read(r, n_threads) # NB: ONLY read the first part
|
||||
cminimap2.mm_idx_reader_close(r)
|
||||
cminimap2.mm_mapopt_update(&self.map_opt, self._idx)
|
||||
self._idx = cmmappy.mm_idx_reader_read(r, n_threads) # NB: ONLY read the first part
|
||||
cmmappy.mm_idx_reader_close(r)
|
||||
cmmappy.mm_mapopt_update(&self.map_opt, self._idx)
|
||||
|
||||
def __dealloc__(self):
|
||||
if self._idx is not NULL:
|
||||
cminimap2.mm_idx_destroy(self._idx)
|
||||
cmmappy.mm_idx_destroy(self._idx)
|
||||
|
||||
def __bool__(self):
|
||||
return (self._idx != NULL)
|
||||
|
||||
def map(self, seq, buf=None):
|
||||
cdef cminimap2.mm_reg1_t *regs
|
||||
cdef cminimap2.mm_hitpy_t h
|
||||
cdef cmmappy.mm_reg1_t *regs
|
||||
cdef cmmappy.mm_hitpy_t h
|
||||
cdef ThreadBuffer b
|
||||
cdef int n_regs
|
||||
|
||||
if self._idx is NULL: return None
|
||||
if buf is None: b = ThreadBuffer()
|
||||
else: b = buf
|
||||
regs = cminimap2.mm_map(self._idx, len(seq), str.encode(seq), &n_regs, b._b, &self.map_opt, NULL)
|
||||
regs = cmmappy.mm_map(self._idx, len(seq), str.encode(seq), &n_regs, b._b, &self.map_opt, NULL)
|
||||
|
||||
for i in range(n_regs):
|
||||
cminimap2.mm_reg2hitpy(self._idx, ®s[i], &h)
|
||||
cmmappy.mm_reg2hitpy(self._idx, ®s[i], &h)
|
||||
cigar = []
|
||||
for k in range(h.n_cigar32):
|
||||
c = h.cigar32[k]
|
||||
cigar.append([c>>4, c&0xf])
|
||||
yield Alignment(h.ctg, h.ctg_len, h.ctg_start, h.ctg_end, h.strand, h.qry_start, h.qry_end, h.mapq, cigar, h.is_primary, h.blen, h.NM, h.trans_strand)
|
||||
cminimap2.mm_free_reg1(®s[i])
|
||||
cmmappy.mm_free_reg1(®s[i])
|
||||
free(regs)
|
||||
Reference in New Issue
Block a user