renamed module name from minimap2 to mmappy

minimap2 clashed with minimap2 from conda
This commit is contained in:
Heng Li
2017-09-16 23:29:41 -04:00
parent 06b79c4a52
commit 28fd3d63fd
8 changed files with 43 additions and 43 deletions

View File

@@ -1,6 +1,6 @@
=======================
Minimap2 Python Binding
=======================
===============================
Mmappy: Minimap2 Python Binding
===============================
`Minimap2 <https://github.com/lh3/minimap2>`_ is a fast and accurate pairwise
aligner for genomic and transcribed nucleotide sequences. This module wraps
@@ -21,7 +21,7 @@ or with `pip <https://en.wikipedia.org/wiki/Pip_(package_manager)>`_:
.. code:: shell
pip install --user minimap2
pip install --user mmappy
Usage
-----
@@ -30,7 +30,7 @@ The following Python program shows the key functionality of this module:
.. code:: python
import minimap2 as mm
import mmappy as mm
a = mm.Aligner("test/MT-human.fa") # load or build index
if not a: raise Exception("ERROR: failed to load/build index")
for hit in a.map("GGTTAAATACAGACCAAGAGCCTTCAAAGCCCTCAGTAAGTTGCAATACTTAATTTCTGT"):
@@ -86,7 +86,7 @@ Arguments:
This method maps :code:`seq` against the index. It *yields* a generator,
generating a series of :code:`Alignment` objects.
Class minimap2.Alignment
Class mmappy.Alignment
~~~~~~~~~~~~~~~~~~~~~~~~
This class has the following properties: