mirror of
https://github.com/lh3/minimap2.git
synced 2026-10-06 09:08:12 +08:00
renamed module name from minimap2 to mmappy
minimap2 clashed with minimap2 from conda
This commit is contained in:
+4
-4
@@ -4,8 +4,8 @@ include ksw2_dispatch.c
|
|||||||
include getopt.c
|
include getopt.c
|
||||||
include main.c
|
include main.c
|
||||||
include README.md
|
include README.md
|
||||||
include python/minimap2.c
|
include python/mmappy.c
|
||||||
include python/cminimap2.h
|
include python/cmmappy.h
|
||||||
include python/cminimap2.pxd
|
include python/cmmappy.pxd
|
||||||
include python/minimap2.pyx
|
include python/mmappy.pyx
|
||||||
include python/README.rst
|
include python/README.rst
|
||||||
|
|||||||
@@ -56,7 +56,7 @@ ksw2_dispatch.o:ksw2_dispatch.c ksw2.h
|
|||||||
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||||
|
|
||||||
clean:
|
clean:
|
||||||
rm -fr gmon.out *.o a.out $(PROG) $(PROG_EXTRA) *~ *.a *.dSYM build dist minimap2.so minimap2.c python/minimap2.c minimap2.egg*
|
rm -fr gmon.out *.o a.out $(PROG) $(PROG_EXTRA) *~ *.a *.dSYM build dist mmappy.so mmappy.c python/mmappy.c mmappy.egg*
|
||||||
|
|
||||||
depend:
|
depend:
|
||||||
(LC_ALL=C; export LC_ALL; makedepend -Y -- $(CFLAGS) $(CPPFLAGS) -- *.c)
|
(LC_ALL=C; export LC_ALL; makedepend -Y -- $(CFLAGS) $(CPPFLAGS) -- *.c)
|
||||||
|
|||||||
+6
-6
@@ -1,6 +1,6 @@
|
|||||||
=======================
|
===============================
|
||||||
Minimap2 Python Binding
|
Mmappy: Minimap2 Python Binding
|
||||||
=======================
|
===============================
|
||||||
|
|
||||||
`Minimap2 <https://github.com/lh3/minimap2>`_ is a fast and accurate pairwise
|
`Minimap2 <https://github.com/lh3/minimap2>`_ is a fast and accurate pairwise
|
||||||
aligner for genomic and transcribed nucleotide sequences. This module wraps
|
aligner for genomic and transcribed nucleotide sequences. This module wraps
|
||||||
@@ -21,7 +21,7 @@ or with `pip <https://en.wikipedia.org/wiki/Pip_(package_manager)>`_:
|
|||||||
|
|
||||||
.. code:: shell
|
.. code:: shell
|
||||||
|
|
||||||
pip install --user minimap2
|
pip install --user mmappy
|
||||||
|
|
||||||
Usage
|
Usage
|
||||||
-----
|
-----
|
||||||
@@ -30,7 +30,7 @@ The following Python program shows the key functionality of this module:
|
|||||||
|
|
||||||
.. code:: python
|
.. code:: python
|
||||||
|
|
||||||
import minimap2 as mm
|
import mmappy as mm
|
||||||
a = mm.Aligner("test/MT-human.fa") # load or build index
|
a = mm.Aligner("test/MT-human.fa") # load or build index
|
||||||
if not a: raise Exception("ERROR: failed to load/build index")
|
if not a: raise Exception("ERROR: failed to load/build index")
|
||||||
for hit in a.map("GGTTAAATACAGACCAAGAGCCTTCAAAGCCCTCAGTAAGTTGCAATACTTAATTTCTGT"):
|
for hit in a.map("GGTTAAATACAGACCAAGAGCCTTCAAAGCCCTCAGTAAGTTGCAATACTTAATTTCTGT"):
|
||||||
@@ -86,7 +86,7 @@ Arguments:
|
|||||||
This method maps :code:`seq` against the index. It *yields* a generator,
|
This method maps :code:`seq` against the index. It *yields* a generator,
|
||||||
generating a series of :code:`Alignment` objects.
|
generating a series of :code:`Alignment` objects.
|
||||||
|
|
||||||
Class minimap2.Alignment
|
Class mmappy.Alignment
|
||||||
~~~~~~~~~~~~~~~~~~~~~~~~
|
~~~~~~~~~~~~~~~~~~~~~~~~
|
||||||
|
|
||||||
This class has the following properties:
|
This class has the following properties:
|
||||||
|
|||||||
@@ -1,5 +1,5 @@
|
|||||||
#ifndef CMINIMAP2_H
|
#ifndef CMMAPPY_H
|
||||||
#define CMINIMAP2_H
|
#define CMMAPPY_H
|
||||||
|
|
||||||
#include <stdlib.h>
|
#include <stdlib.h>
|
||||||
#include "minimap.h"
|
#include "minimap.h"
|
||||||
@@ -62,7 +62,7 @@ cdef extern from "minimap.h":
|
|||||||
void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
|
void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
|
||||||
|
|
||||||
#
|
#
|
||||||
# Mapping (key struct defined in cminimap2.h below)
|
# Mapping (key struct defined in cmmappy.h below)
|
||||||
#
|
#
|
||||||
ctypedef struct mm_reg1_t:
|
ctypedef struct mm_reg1_t:
|
||||||
pass
|
pass
|
||||||
@@ -77,7 +77,7 @@ cdef extern from "minimap.h":
|
|||||||
#
|
#
|
||||||
# Helper header (because it is hard to expose mm_reg1_t with Cython
|
# Helper header (because it is hard to expose mm_reg1_t with Cython
|
||||||
#
|
#
|
||||||
cdef extern from "cminimap2.h":
|
cdef extern from "cmmappy.h":
|
||||||
ctypedef struct mm_hitpy_t:
|
ctypedef struct mm_hitpy_t:
|
||||||
const char *ctg
|
const char *ctg
|
||||||
int32_t ctg_start, ctg_end
|
int32_t ctg_start, ctg_end
|
||||||
+1
-1
@@ -1,7 +1,7 @@
|
|||||||
#!/usr/bin/env python
|
#!/usr/bin/env python
|
||||||
|
|
||||||
import sys, getopt
|
import sys, getopt
|
||||||
import minimap2 as mm
|
import mmappy as mm
|
||||||
|
|
||||||
def readfq(fp): # multi-line fasta/fastq parser
|
def readfq(fp): # multi-line fasta/fastq parser
|
||||||
last = None
|
last = None
|
||||||
|
|||||||
@@ -1,6 +1,6 @@
|
|||||||
from libc.stdint cimport uint8_t, int8_t
|
from libc.stdint cimport uint8_t, int8_t
|
||||||
from libc.stdlib cimport free
|
from libc.stdlib cimport free
|
||||||
cimport cminimap2
|
cimport cmmappy
|
||||||
|
|
||||||
cdef class Alignment:
|
cdef class Alignment:
|
||||||
cdef int _ctg_len, _r_st, _r_en
|
cdef int _ctg_len, _r_st, _r_en
|
||||||
@@ -69,23 +69,23 @@ cdef class Alignment:
|
|||||||
str(self._blen - self._NM), str(self._blen), str(self._mapq), "NM:i:" + str(self._NM), tp, "cg:Z:" + self.cigar_str])
|
str(self._blen - self._NM), str(self._blen), str(self._mapq), "NM:i:" + str(self._NM), tp, "cg:Z:" + self.cigar_str])
|
||||||
|
|
||||||
cdef class ThreadBuffer:
|
cdef class ThreadBuffer:
|
||||||
cdef cminimap2.mm_tbuf_t *_b
|
cdef cmmappy.mm_tbuf_t *_b
|
||||||
|
|
||||||
def __cinit__(self):
|
def __cinit__(self):
|
||||||
self._b = cminimap2.mm_tbuf_init()
|
self._b = cmmappy.mm_tbuf_init()
|
||||||
|
|
||||||
def __dealloc__(self):
|
def __dealloc__(self):
|
||||||
cminimap2.mm_tbuf_destroy(self._b)
|
cmmappy.mm_tbuf_destroy(self._b)
|
||||||
|
|
||||||
cdef class Aligner:
|
cdef class Aligner:
|
||||||
cdef cminimap2.mm_idx_t *_idx
|
cdef cmmappy.mm_idx_t *_idx
|
||||||
cdef cminimap2.mm_idxopt_t idx_opt
|
cdef cmmappy.mm_idxopt_t idx_opt
|
||||||
cdef cminimap2.mm_mapopt_t map_opt
|
cdef cmmappy.mm_mapopt_t map_opt
|
||||||
|
|
||||||
def __cinit__(self, fn_idx_in, preset=None, k=None, w=None, min_cnt=None, min_chain_score=None, min_dp_score=None, bw=None, best_n=None, n_threads=3, fn_idx_out=None):
|
def __cinit__(self, fn_idx_in, preset=None, k=None, w=None, min_cnt=None, min_chain_score=None, min_dp_score=None, bw=None, best_n=None, n_threads=3, fn_idx_out=None):
|
||||||
cminimap2.mm_set_opt(NULL, &self.idx_opt, &self.map_opt) # set the default options
|
cmmappy.mm_set_opt(NULL, &self.idx_opt, &self.map_opt) # set the default options
|
||||||
if preset is not None:
|
if preset is not None:
|
||||||
cminimap2.mm_set_opt(str.encode(preset), &self.idx_opt, &self.map_opt) # apply preset
|
cmmappy.mm_set_opt(str.encode(preset), &self.idx_opt, &self.map_opt) # apply preset
|
||||||
self.map_opt.flag |= 4 # always perform alignment
|
self.map_opt.flag |= 4 # always perform alignment
|
||||||
self.idx_opt.batch_size = 0x7fffffffffffffffL # always build a uni-part index
|
self.idx_opt.batch_size = 0x7fffffffffffffffL # always build a uni-part index
|
||||||
if k is not None: self.idx_opt.k = k
|
if k is not None: self.idx_opt.k = k
|
||||||
@@ -96,40 +96,40 @@ cdef class Aligner:
|
|||||||
if bw is not None: self.map_opt.bw = bw
|
if bw is not None: self.map_opt.bw = bw
|
||||||
if best_n is not None: self.best_n = best_n
|
if best_n is not None: self.best_n = best_n
|
||||||
|
|
||||||
cdef cminimap2.mm_idx_reader_t *r;
|
cdef cmmappy.mm_idx_reader_t *r;
|
||||||
if fn_idx_out is None:
|
if fn_idx_out is None:
|
||||||
r = cminimap2.mm_idx_reader_open(str.encode(fn_idx_in), &self.idx_opt, NULL)
|
r = cmmappy.mm_idx_reader_open(str.encode(fn_idx_in), &self.idx_opt, NULL)
|
||||||
else:
|
else:
|
||||||
r = cminimap2.mm_idx_reader_open(str.encode(fn_idx_in), &self.idx_opt, fn_idx_out)
|
r = cmmappy.mm_idx_reader_open(str.encode(fn_idx_in), &self.idx_opt, fn_idx_out)
|
||||||
if r is not NULL:
|
if r is not NULL:
|
||||||
self._idx = cminimap2.mm_idx_reader_read(r, n_threads) # NB: ONLY read the first part
|
self._idx = cmmappy.mm_idx_reader_read(r, n_threads) # NB: ONLY read the first part
|
||||||
cminimap2.mm_idx_reader_close(r)
|
cmmappy.mm_idx_reader_close(r)
|
||||||
cminimap2.mm_mapopt_update(&self.map_opt, self._idx)
|
cmmappy.mm_mapopt_update(&self.map_opt, self._idx)
|
||||||
|
|
||||||
def __dealloc__(self):
|
def __dealloc__(self):
|
||||||
if self._idx is not NULL:
|
if self._idx is not NULL:
|
||||||
cminimap2.mm_idx_destroy(self._idx)
|
cmmappy.mm_idx_destroy(self._idx)
|
||||||
|
|
||||||
def __bool__(self):
|
def __bool__(self):
|
||||||
return (self._idx != NULL)
|
return (self._idx != NULL)
|
||||||
|
|
||||||
def map(self, seq, buf=None):
|
def map(self, seq, buf=None):
|
||||||
cdef cminimap2.mm_reg1_t *regs
|
cdef cmmappy.mm_reg1_t *regs
|
||||||
cdef cminimap2.mm_hitpy_t h
|
cdef cmmappy.mm_hitpy_t h
|
||||||
cdef ThreadBuffer b
|
cdef ThreadBuffer b
|
||||||
cdef int n_regs
|
cdef int n_regs
|
||||||
|
|
||||||
if self._idx is NULL: return None
|
if self._idx is NULL: return None
|
||||||
if buf is None: b = ThreadBuffer()
|
if buf is None: b = ThreadBuffer()
|
||||||
else: b = buf
|
else: b = buf
|
||||||
regs = cminimap2.mm_map(self._idx, len(seq), str.encode(seq), &n_regs, b._b, &self.map_opt, NULL)
|
regs = cmmappy.mm_map(self._idx, len(seq), str.encode(seq), &n_regs, b._b, &self.map_opt, NULL)
|
||||||
|
|
||||||
for i in range(n_regs):
|
for i in range(n_regs):
|
||||||
cminimap2.mm_reg2hitpy(self._idx, ®s[i], &h)
|
cmmappy.mm_reg2hitpy(self._idx, ®s[i], &h)
|
||||||
cigar = []
|
cigar = []
|
||||||
for k in range(h.n_cigar32):
|
for k in range(h.n_cigar32):
|
||||||
c = h.cigar32[k]
|
c = h.cigar32[k]
|
||||||
cigar.append([c>>4, c&0xf])
|
cigar.append([c>>4, c&0xf])
|
||||||
yield Alignment(h.ctg, h.ctg_len, h.ctg_start, h.ctg_end, h.strand, h.qry_start, h.qry_end, h.mapq, cigar, h.is_primary, h.blen, h.NM, h.trans_strand)
|
yield Alignment(h.ctg, h.ctg_len, h.ctg_start, h.ctg_end, h.strand, h.qry_start, h.qry_end, h.mapq, cigar, h.is_primary, h.blen, h.NM, h.trans_strand)
|
||||||
cminimap2.mm_free_reg1(®s[i])
|
cmmappy.mm_free_reg1(®s[i])
|
||||||
free(regs)
|
free(regs)
|
||||||
@@ -9,9 +9,9 @@ cmdclass = {}
|
|||||||
try:
|
try:
|
||||||
from Cython.Build import build_ext
|
from Cython.Build import build_ext
|
||||||
except ImportError: # without Cython
|
except ImportError: # without Cython
|
||||||
module_src = 'python/minimap2.c'
|
module_src = 'python/mmappy.c'
|
||||||
else: # with Cython
|
else: # with Cython
|
||||||
module_src = 'python/minimap2.pyx'
|
module_src = 'python/mmappy.pyx'
|
||||||
cmdclass['build_ext'] = build_ext
|
cmdclass['build_ext'] = build_ext
|
||||||
|
|
||||||
import sys
|
import sys
|
||||||
@@ -22,8 +22,8 @@ def readme():
|
|||||||
return f.read()
|
return f.read()
|
||||||
|
|
||||||
setup(
|
setup(
|
||||||
name = 'minimap2',
|
name = 'mmappy',
|
||||||
version = '2.2rc',
|
version = '2.2rc1',
|
||||||
url = 'https://github.com/lh3/minimap2',
|
url = 'https://github.com/lh3/minimap2',
|
||||||
description = 'Minimap2 python binding',
|
description = 'Minimap2 python binding',
|
||||||
long_description = readme(),
|
long_description = readme(),
|
||||||
@@ -31,13 +31,13 @@ setup(
|
|||||||
author_email = 'lh3@me.com',
|
author_email = 'lh3@me.com',
|
||||||
license = 'MIT',
|
license = 'MIT',
|
||||||
keywords = ['bioinformatics', 'sequence-alignment'],
|
keywords = ['bioinformatics', 'sequence-alignment'],
|
||||||
ext_modules = [Extension('minimap2',
|
ext_modules = [Extension('mmappy',
|
||||||
sources = [module_src, 'align.c', 'bseq.c', 'chain.c', 'format.c', 'hit.c', 'index.c',
|
sources = [module_src, 'align.c', 'bseq.c', 'chain.c', 'format.c', 'hit.c', 'index.c',
|
||||||
'ksw2_extd2_sse.c', 'ksw2_exts2_sse.c', 'ksw2_extz2_sse.c', 'ksw2_ll_sse.c',
|
'ksw2_extd2_sse.c', 'ksw2_exts2_sse.c', 'ksw2_extz2_sse.c', 'ksw2_ll_sse.c',
|
||||||
'kalloc.c', 'kthread.c', 'map.c', 'misc.c', 'sdust.c', 'sketch.c'],
|
'kalloc.c', 'kthread.c', 'map.c', 'misc.c', 'sdust.c', 'sketch.c'],
|
||||||
depends = ['minimap.h', 'bseq.h', 'kalloc.h', 'kdq.h', 'khash.h', 'kseq.h', 'ksort.h',
|
depends = ['minimap.h', 'bseq.h', 'kalloc.h', 'kdq.h', 'khash.h', 'kseq.h', 'ksort.h',
|
||||||
'ksw2.h', 'kthread.h', 'kvec.h', 'mmpriv.h', 'sdust.h',
|
'ksw2.h', 'kthread.h', 'kvec.h', 'mmpriv.h', 'sdust.h',
|
||||||
'python/cminimap2.h', 'python/cminimap2.pxd'],
|
'python/cmmappy.h', 'python/cmmappy.pxd'],
|
||||||
extra_compile_args = ['-msse4'], # WARNING: ancient x86_64 CPUs don't have SSE4
|
extra_compile_args = ['-msse4'], # WARNING: ancient x86_64 CPUs don't have SSE4
|
||||||
include_dirs = ['.'],
|
include_dirs = ['.'],
|
||||||
libraries = ['z', 'm', 'pthread'])],
|
libraries = ['z', 'm', 'pthread'])],
|
||||||
|
|||||||
Reference in New Issue
Block a user