mirror of
https://github.com/lh3/minimap2.git
synced 2026-09-15 13:07:55 +08:00
fixed a few typos
eh... a missing fix
This commit is contained in:
@@ -9,7 +9,7 @@ minimap2 and provides a convenient interface to calling minimap2 in Python.
|
||||
Installation
|
||||
------------
|
||||
|
||||
The minimap2 model can be installed directly with:
|
||||
The minimap2 module can be installed directly with:
|
||||
|
||||
.. code:: shell
|
||||
|
||||
@@ -31,13 +31,13 @@ The following Python program shows the key functionality of this module:
|
||||
.. code:: python
|
||||
|
||||
import minimap2 as mm
|
||||
a = mm.Aligner("test/MT-human.fa")
|
||||
a = mm.Aligner("test/MT-human.fa") # load or build index
|
||||
if not a: raise Exception("ERROR: failed to load/build index")
|
||||
for hit in a.map("GGTTAAATACAGACCAAGAGCCTTCAAAGCCCTCAGTAAGTTGCAATACTTAATTTCTGT"):
|
||||
print("{}\t{}\t{}\t{}".format(hit.ctg, hit.r_st, hit.r_en, hit.cigar_str))
|
||||
|
||||
It builds an index from the specified sequence file (or loads an index if a
|
||||
pre-built index is supplied), aligns a sequence against it, traverses each hit
|
||||
pre-built index is specified), aligns a sequence against it, traverses each hit
|
||||
and prints them out.
|
||||
|
||||
APIs
|
||||
@@ -81,9 +81,9 @@ Arguments:
|
||||
|
||||
.. code:: python
|
||||
|
||||
map(query_seq)
|
||||
map(seq)
|
||||
|
||||
This methods maps :code:`query_seq` against the index. It *yields* a generator,
|
||||
This method maps :code:`seq` against the index. It *yields* a generator,
|
||||
generating a series of :code:`Alignment` objects.
|
||||
|
||||
Class minimap2.Alignment
|
||||
@@ -118,7 +118,7 @@ This class has the following properties:
|
||||
* **cigar**: CIGAR returned as an array of shape :code:`(n_cigar,2)`. The two
|
||||
numbers give the length and the operator of each CIGAR operation.
|
||||
|
||||
An Alignment object can be converted to a string in the following format:
|
||||
An :code:`Alignment` object can be converted to a string in the following format:
|
||||
|
||||
::
|
||||
|
||||
|
||||
Reference in New Issue
Block a user