mirror of
https://github.com/lh3/minimap2.git
synced 2026-09-15 13:07:55 +08:00
this is embarrassing: rename again to mappy
This commit is contained in:
@@ -1,15 +1,15 @@
|
||||
===============================
|
||||
Mmappy: Minimap2 Python Binding
|
||||
===============================
|
||||
==============================
|
||||
Mappy: Minimap2 Python Binding
|
||||
==============================
|
||||
|
||||
`Minimap2 <https://github.com/lh3/minimap2>`_ is a fast and accurate pairwise
|
||||
aligner for genomic and transcribed nucleotide sequences. This module wraps
|
||||
minimap2 and provides a convenient interface to calling minimap2 in Python.
|
||||
aligner for genomic and transcribed nucleotide sequences. This Python extension
|
||||
provides a convenient interface to calling minimap2 in Python.
|
||||
|
||||
Installation
|
||||
------------
|
||||
|
||||
The mmappy module can be installed directly with:
|
||||
The mappy module can be installed directly with:
|
||||
|
||||
.. code:: shell
|
||||
|
||||
@@ -21,7 +21,7 @@ or with `pip <https://en.wikipedia.org/wiki/Pip_(package_manager)>`_:
|
||||
|
||||
.. code:: shell
|
||||
|
||||
pip install --user mmappy
|
||||
pip install --user mappy
|
||||
|
||||
Usage
|
||||
-----
|
||||
@@ -30,8 +30,8 @@ The following Python program shows the key functionality of this module:
|
||||
|
||||
.. code:: python
|
||||
|
||||
import mmappy as mm
|
||||
a = mm.Aligner("test/MT-human.fa") # load or build index
|
||||
import mappy as mp
|
||||
a = mp.Aligner("test/MT-human.fa") # load or build index
|
||||
if not a: raise Exception("ERROR: failed to load/build index")
|
||||
for hit in a.map("GGTTAAATACAGACCAAGAGCCTTCAAAGCCCTCAGTAAGTTGCAATACTTAATTTCTGT"):
|
||||
print("{}\t{}\t{}\t{}".format(hit.ctg, hit.r_st, hit.r_en, hit.cigar_str))
|
||||
@@ -43,7 +43,7 @@ and prints them out.
|
||||
APIs
|
||||
----
|
||||
|
||||
Class mmappy.Aligner
|
||||
Class mappy.Aligner
|
||||
~~~~~~~~~~~~~~~~~~~~~~
|
||||
|
||||
.. code:: python
|
||||
@@ -86,7 +86,7 @@ Arguments:
|
||||
This method maps :code:`seq` against the index. It *yields* a generator,
|
||||
generating a series of :code:`Alignment` objects.
|
||||
|
||||
Class mmappy.Alignment
|
||||
Class mappy.Alignment
|
||||
~~~~~~~~~~~~~~~~~~~~~~~~
|
||||
|
||||
This class has the following properties:
|
||||
|
||||
Reference in New Issue
Block a user