this is embarrassing: rename again to mappy

This commit is contained in:
Heng Li
2017-09-17 00:05:30 -04:00
parent eaaf53c9b8
commit d5012a1b17
8 changed files with 48 additions and 48 deletions

View File

@@ -1,15 +1,15 @@
===============================
Mmappy: Minimap2 Python Binding
===============================
==============================
Mappy: Minimap2 Python Binding
==============================
`Minimap2 <https://github.com/lh3/minimap2>`_ is a fast and accurate pairwise
aligner for genomic and transcribed nucleotide sequences. This module wraps
minimap2 and provides a convenient interface to calling minimap2 in Python.
aligner for genomic and transcribed nucleotide sequences. This Python extension
provides a convenient interface to calling minimap2 in Python.
Installation
------------
The mmappy module can be installed directly with:
The mappy module can be installed directly with:
.. code:: shell
@@ -21,7 +21,7 @@ or with `pip <https://en.wikipedia.org/wiki/Pip_(package_manager)>`_:
.. code:: shell
pip install --user mmappy
pip install --user mappy
Usage
-----
@@ -30,8 +30,8 @@ The following Python program shows the key functionality of this module:
.. code:: python
import mmappy as mm
a = mm.Aligner("test/MT-human.fa") # load or build index
import mappy as mp
a = mp.Aligner("test/MT-human.fa") # load or build index
if not a: raise Exception("ERROR: failed to load/build index")
for hit in a.map("GGTTAAATACAGACCAAGAGCCTTCAAAGCCCTCAGTAAGTTGCAATACTTAATTTCTGT"):
print("{}\t{}\t{}\t{}".format(hit.ctg, hit.r_st, hit.r_en, hit.cigar_str))
@@ -43,7 +43,7 @@ and prints them out.
APIs
----
Class mmappy.Aligner
Class mappy.Aligner
~~~~~~~~~~~~~~~~~~~~~~
.. code:: python
@@ -86,7 +86,7 @@ Arguments:
This method maps :code:`seq` against the index. It *yields* a generator,
generating a series of :code:`Alignment` objects.
Class mmappy.Alignment
Class mappy.Alignment
~~~~~~~~~~~~~~~~~~~~~~~~
This class has the following properties: