mirror of
https://github.com/lh3/minimap2.git
synced 2026-10-05 00:58:12 +08:00
change to rst for PyPI
This commit is contained in:
+11
@@ -0,0 +1,11 @@
|
|||||||
|
include *.h
|
||||||
|
include Makefile
|
||||||
|
include ksw2_dispatch.c
|
||||||
|
include getopt.c
|
||||||
|
include main.c
|
||||||
|
include README.md
|
||||||
|
include python/minimap2.c
|
||||||
|
include python/cminimap2.h
|
||||||
|
include python/cminimap2.pxd
|
||||||
|
include python/minimap2.pyx
|
||||||
|
include python/README.md
|
||||||
@@ -1,43 +1,55 @@
|
|||||||
## Minimap2 Python Binding
|
=======================
|
||||||
|
Minimap2 Python Binding
|
||||||
|
=======================
|
||||||
|
|
||||||
[Minimap2][minimap2] is a fast and accurate pairwise aligner for genomic and
|
`Minimap2 <https://github.com/lh3/minimap2>` is a fast and accurate pairwise
|
||||||
transcribed nucleotide sequences. This module wraps minimap2 and provides a
|
aligner for genomic and transcribed nucleotide sequences. This module wraps
|
||||||
convenient interface to calling minimap2 in Python.
|
minimap2 and provides a convenient interface to calling minimap2 in Python.
|
||||||
|
|
||||||
### Installation
|
Installation
|
||||||
|
------------
|
||||||
|
|
||||||
The minimap2 model can be installed directly with:
|
The minimap2 model can be installed directly with:
|
||||||
```sh
|
|
||||||
git clone https://github.com/lh3/minimap2
|
|
||||||
cd minimap2
|
|
||||||
python setup.py install
|
|
||||||
```
|
|
||||||
or with [pip][pip]:
|
|
||||||
```sh
|
|
||||||
pip install --user minimap2
|
|
||||||
```
|
|
||||||
|
|
||||||
### Usage
|
.. code:: shell
|
||||||
|
|
||||||
|
git clone https://github.com/lh3/minimap2
|
||||||
|
cd minimap2
|
||||||
|
python setup.py install
|
||||||
|
|
||||||
|
or with pip:
|
||||||
|
|
||||||
|
.. code:: shell
|
||||||
|
|
||||||
|
pip install --user minimap2
|
||||||
|
|
||||||
|
Usage
|
||||||
|
-----
|
||||||
|
|
||||||
The following Python program shows the key functionality of this module:
|
The following Python program shows the key functionality of this module:
|
||||||
```python
|
|
||||||
import minimap2 as mm
|
.. code:: python
|
||||||
a = mm.Aligner("test/MT-human.fa")
|
|
||||||
if not a: raise Exception("ERROR: failed to load/build index")
|
import minimap2 as mm
|
||||||
for hit in a.map("GGTTAAATACAGACCAAGAGCCTTCAAAGCCCTCAGTAAGTTGCAATACTTAATTTCTGT"):
|
a = mm.Aligner("test/MT-human.fa")
|
||||||
print("{}\t{}\t{}\t{}".format(hit.ctg, hit.r_st, hit.r_en, hit.cigar_str))
|
if not a: raise Exception("ERROR: failed to load/build index")
|
||||||
```
|
for hit in a.map("GGTTAAATACAGACCAAGAGCCTTCAAAGCCCTCAGTAAGTTGCAATACTTAATTTCTGT"):
|
||||||
|
print("{}\t{}\t{}\t{}".format(hit.ctg, hit.r_st, hit.r_en, hit.cigar_str))
|
||||||
|
|
||||||
It builds an index from the specified sequence file (or loads an index if a
|
It builds an index from the specified sequence file (or loads an index if a
|
||||||
pre-built index is supplied), aligns a sequence against it, traverses each hit
|
pre-built index is supplied), aligns a sequence against it, traverses each hit
|
||||||
and prints them out.
|
and prints them out.
|
||||||
|
|
||||||
### APIs
|
APIs
|
||||||
|
----
|
||||||
|
|
||||||
#### Class minimap2.Aligner
|
Class minimap2.Aligner
|
||||||
|
~~~~~~~~~~~~~~~~~~~~~~
|
||||||
|
|
||||||
|
.. code:: python
|
||||||
|
|
||||||
|
Aligner(fn_idx_in, preset=None, ...)
|
||||||
|
|
||||||
```python
|
|
||||||
Aligner(fn_idx_in, preset=None, ...)
|
|
||||||
```
|
|
||||||
Arguments:
|
Arguments:
|
||||||
|
|
||||||
* `fn_idx_in`: index or sequence file name. Minimap2 automatically tests the
|
* `fn_idx_in`: index or sequence file name. Minimap2 automatically tests the
|
||||||
@@ -67,13 +79,15 @@ Arguments:
|
|||||||
|
|
||||||
* `fn_idx_out`: name of file to which the index is written
|
* `fn_idx_out`: name of file to which the index is written
|
||||||
|
|
||||||
```python
|
.. code:: python
|
||||||
map(query_seq)
|
|
||||||
```
|
map(query_seq)
|
||||||
|
|
||||||
This methods maps `query_seq` against the index. It *yields* a generator,
|
This methods maps `query_seq` against the index. It *yields* a generator,
|
||||||
generating a series of `Alignment` objects.
|
generating a series of `Alignment` objects.
|
||||||
|
|
||||||
#### Class minimap2.Alignment
|
Class minimap2.Alignment
|
||||||
|
~~~~~~~~~~~~~~~~~~~~~~~~
|
||||||
|
|
||||||
This class has the following properties:
|
This class has the following properties:
|
||||||
|
|
||||||
@@ -105,11 +119,7 @@ This class has the following properties:
|
|||||||
give the length and the operator of each CIGAR operation.
|
give the length and the operator of each CIGAR operation.
|
||||||
|
|
||||||
An Alignment object can be converted to a string in the following format:
|
An Alignment object can be converted to a string in the following format:
|
||||||
```
|
|
||||||
q_st q_en strand ctg ctg_len r_st r_en blen-NM blen mapq cg:Z:cigar_str
|
|
||||||
```
|
|
||||||
|
|
||||||
|
::
|
||||||
|
|
||||||
|
q_st q_en strand ctg ctg_len r_st r_en blen-NM blen mapq cg:Z:cigar_str
|
||||||
[minimap2]: https://github.com/lh3/minimap2
|
|
||||||
[pip]: https://pypi.python.org/pypi/pip
|
|
||||||
@@ -4,9 +4,17 @@ except ImportError:
|
|||||||
from distutils.core import setup
|
from distutils.core import setup
|
||||||
from distutils.extension import Extension
|
from distutils.extension import Extension
|
||||||
|
|
||||||
from Cython.Build import cythonize
|
cmdclass = {}
|
||||||
import sys
|
|
||||||
|
|
||||||
|
try:
|
||||||
|
from Cython.Build import build_ext
|
||||||
|
except ImportError: # without Cython
|
||||||
|
module_src = 'python/minimap2.c'
|
||||||
|
else: # with Cython
|
||||||
|
module_src = 'python/minimap2.pyx'
|
||||||
|
cmdclass['build_ext'] = build_ext
|
||||||
|
|
||||||
|
import sys
|
||||||
sys.path.append('python')
|
sys.path.append('python')
|
||||||
|
|
||||||
setup(
|
setup(
|
||||||
@@ -16,12 +24,16 @@ setup(
|
|||||||
description = 'Minimap2 python binding',
|
description = 'Minimap2 python binding',
|
||||||
author = 'Heng Li',
|
author = 'Heng Li',
|
||||||
author_email = 'lh3@me.com',
|
author_email = 'lh3@me.com',
|
||||||
|
license = 'MIT',
|
||||||
keywords = ['bioinformatics', 'sequence-alignment'],
|
keywords = ['bioinformatics', 'sequence-alignment'],
|
||||||
ext_modules = cythonize([Extension('minimap2',
|
ext_modules = [Extension('minimap2',
|
||||||
['python/minimap2.pyx', 'align.c', 'bseq.c', 'chain.c', 'format.c', 'hit.c', 'index.c', 'kalloc.c',
|
sources = [module_src, 'align.c', 'bseq.c', 'chain.c', 'format.c', 'hit.c', 'index.c',
|
||||||
'ksw2_extd2_sse.c', 'ksw2_exts2_sse.c', 'ksw2_extz2_sse.c', 'ksw2_ll_sse.c', 'kthread.c', 'map.c',
|
'ksw2_extd2_sse.c', 'ksw2_exts2_sse.c', 'ksw2_extz2_sse.c', 'ksw2_ll_sse.c',
|
||||||
'misc.c', 'sdust.c', 'sketch.c'],
|
'kalloc.c', 'kthread.c', 'map.c', 'misc.c', 'sdust.c', 'sketch.c'],
|
||||||
|
depends = ['minimap.h', 'bseq.h', 'kalloc.h', 'kdq.h', 'khash.h', 'kseq.h', 'ksort.h',
|
||||||
|
'ksw2.h', 'kthread.h', 'kvec.h', 'mmpriv.h', 'sdust.h',
|
||||||
|
'python/cminimap2.h', 'python/cminimap2.pxd'],
|
||||||
extra_compile_args = ['-msse4'], # WARNING: ancient x86_64 CPUs don't have SSE4
|
extra_compile_args = ['-msse4'], # WARNING: ancient x86_64 CPUs don't have SSE4
|
||||||
include_dirs = ['.'],
|
include_dirs = ['.'],
|
||||||
libraries = ['z', 'm', 'pthread'])])
|
libraries = ['z', 'm', 'pthread'])],
|
||||||
)
|
cmdclass = cmdclass)
|
||||||
|
|||||||
Reference in New Issue
Block a user