Compare commits

..
2 Commits
Author SHA1 Message Date
Heng Li de6ad4c1d9 added two more filters 2019-12-24 00:06:44 -05:00
Heng Li 43b0399991 added --idx-min-occ and --idx-max-occ 2019-12-23 22:58:44 -05:00
56 changed files with 1093 additions and 6031 deletions
-68
View File
@@ -1,68 +0,0 @@
name: CI
on:
push:
branches:
- master
pull_request:
jobs:
build-linux-x8664:
name: Linux x86_64
runs-on: ubuntu-latest
strategy:
matrix:
compiler: [gcc, clang]
steps:
- name: Checkout minimap2
uses: actions/checkout@v4
- name: Compile with ${{ matrix.compiler }}
run: |
make CC=${{ matrix.compiler }}
file minimap2 | grep x86-64
build-linux-aarch64:
name: Linux aarch64
runs-on: ubuntu-latest
strategy:
matrix:
compiler: [gcc]
steps:
- name: Checkout
uses: actions/checkout@v4
- name: Compile with ${{ matrix.compiler }}
uses: uraimo/run-on-arch-action@v3
with:
arch: aarch64
distro: ubuntu22.04
githubToken: ${{ github.token }}
dockerRunArgs: |
--volume "${PWD}:/minimap2"
install: |
apt-get update -q -y
apt-get install -q -y make ${{ matrix.compiler }} zlib1g-dev file
run: |
cd /minimap2
make CC=${{ matrix.compiler }} arm_neon=1 aarch64=1 -j
file minimap2 | grep aarch64
build-mac-arm64:
name: Mac ARM64
runs-on: macos-14
strategy:
matrix:
compiler: [clang]
steps:
- name: Checkout minimap2
uses: actions/checkout@v4
- name: Compile with ${{ matrix.compiler }}
run: |
make CC=${{ matrix.compiler }} arm_neon=1 aarch64=1 -j
file minimap2 | grep arm64
-3
View File
@@ -1,3 +0,0 @@
[submodule "lib/simde"]
path = lib/simde
url = https://github.com/nemequ/simde.git
+20
View File
@@ -0,0 +1,20 @@
matrix:
include:
- language: c
compiler: gcc
script: make
- language: c
compiler: clang
script: make
- language: python
python: "2.7"
before_install: pip install cython
script: python setup.py build_ext
- language: python
python: "3.5"
before_install: pip install cython
script: python setup.py build_ext
- language: python
python: "3.6"
before_install: pip install cython
script: python setup.py build_ext
+1 -1
View File
@@ -2,7 +2,7 @@
Without `-a`, `-c` or `--cs`, minimap2 only finds *approximate* mapping Without `-a`, `-c` or `--cs`, minimap2 only finds *approximate* mapping
locations without detailed base alignment. In particular, the start and end locations without detailed base alignment. In particular, the start and end
positions of the alignment are imprecise. With one of those options, minimap2 positions of the alignment are impricise. With one of those options, minimap2
will perform base alignment, which is generally more accurate but is much will perform base alignment, which is generally more accurate but is much
slower. slower.
+1
View File
@@ -4,6 +4,7 @@ include ksw2_dispatch.c
include main.c include main.c
include README.md include README.md
include sse2neon/emmintrin.h include sse2neon/emmintrin.h
include python/mappy.c
include python/cmappy.h include python/cmappy.h
include python/cmappy.pxd include python/cmappy.pxd
include python/mappy.pyx include python/mappy.pyx
+17 -36
View File
@@ -1,17 +1,11 @@
CFLAGS= -g -Wall -O2 -Wc++-compat #-Wextra CFLAGS= -g -Wall -O2 -Wc++-compat #-Wextra
CPPFLAGS= -DHAVE_KALLOC CPPFLAGS= -DHAVE_KALLOC
INCLUDES= INCLUDES=
OBJS= kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o options.o index.o \ OBJS= kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o options.o index.o chain.o align.o hit.o map.o format.o pe.o esterr.o splitidx.o ksw2_ll_sse.o
lchain.o align.o hit.o seed.o jump.o map.o format.o pe.o esterr.o splitidx.o \
ksw2_ll_sse.o
PROG= minimap2 PROG= minimap2
PROG_EXTRA= sdust minimap2-lite PROG_EXTRA= sdust minimap2-lite
LIBS= -lm -lz -lpthread LIBS= -lm -lz -lpthread
ifneq ($(aarch64),)
arm_neon=1
endif
ifeq ($(arm_neon),) # if arm_neon is not defined ifeq ($(arm_neon),) # if arm_neon is not defined
ifeq ($(sse2only),) # if sse2only is not defined ifeq ($(sse2only),) # if sse2only is not defined
OBJS+=ksw2_extz2_sse41.o ksw2_extd2_sse41.o ksw2_exts2_sse41.o ksw2_extz2_sse2.o ksw2_extd2_sse2.o ksw2_exts2_sse2.o ksw2_dispatch.o OBJS+=ksw2_extz2_sse41.o ksw2_extd2_sse41.o ksw2_exts2_sse41.o ksw2_extz2_sse2.o ksw2_extd2_sse2.o ksw2_exts2_sse2.o ksw2_dispatch.o
@@ -28,16 +22,6 @@ else #if aarch64 is defined
endif endif
endif endif
ifneq ($(asan),)
CFLAGS+=-fsanitize=address
LIBS+=-fsanitize=address -ldl
endif
ifneq ($(tsan),)
CFLAGS+=-fsanitize=thread
LIBS+=-fsanitize=thread -ldl
endif
.PHONY:all extra clean depend .PHONY:all extra clean depend
.SUFFIXES:.c .o .SUFFIXES:.c .o
@@ -102,36 +86,33 @@ ksw2_exts2_neon.o:ksw2_exts2_sse.c ksw2.h kalloc.h
# other non-file targets # other non-file targets
clean: clean:
rm -fr gmon.out *.o a.out $(PROG) $(PROG_EXTRA) *~ *.a *.dSYM build dist mappy*.so mappy.c python/mappy.c mappy.egg* .eggs rm -fr gmon.out *.o a.out $(PROG) $(PROG_EXTRA) *~ *.a *.dSYM build dist mappy*.so mappy.c python/mappy.c mappy.egg*
depend: depend:
(LC_ALL=C; export LC_ALL; makedepend -Y -- $(CFLAGS) $(CPPFLAGS) -- *.c) (LC_ALL=C; export LC_ALL; makedepend -Y -- $(CFLAGS) $(CPPFLAGS) -- *.c)
# DO NOT DELETE # DO NOT DELETE
align.o: minimap.h mmpriv.h bseq.h kseq.h ksw2.h kalloc.h align.o: minimap.h mmpriv.h bseq.h ksw2.h kalloc.h
bseq.o: bseq.h kvec.h kalloc.h kseq.h bseq.o: bseq.h kvec.h kalloc.h kseq.h
esterr.o: mmpriv.h minimap.h bseq.h kseq.h chain.o: minimap.h mmpriv.h bseq.h kalloc.h
esterr.o: mmpriv.h minimap.h bseq.h
example.o: minimap.h kseq.h example.o: minimap.h kseq.h
format.o: kalloc.h mmpriv.h minimap.h bseq.h kseq.h format.o: kalloc.h mmpriv.h minimap.h bseq.h
hit.o: mmpriv.h minimap.h bseq.h kseq.h kalloc.h khash.h hit.o: mmpriv.h minimap.h bseq.h kalloc.h khash.h
index.o: kthread.h bseq.h minimap.h mmpriv.h kseq.h ksw2.h kalloc.h kvec.h index.o: kthread.h bseq.h minimap.h mmpriv.h kvec.h kalloc.h khash.h
index.o: khash.h ksort.h
jump.o: mmpriv.h minimap.h bseq.h kseq.h
kalloc.o: kalloc.h kalloc.o: kalloc.h
ksw2_extd2_sse.o: ksw2.h kalloc.h ksw2_extd2_sse.o: ksw2.h kalloc.h
ksw2_exts2_sse.o: ksw2.h kalloc.h ksw2_exts2_sse.o: ksw2.h kalloc.h
ksw2_extz2_sse.o: ksw2.h kalloc.h ksw2_extz2_sse.o: ksw2.h kalloc.h
ksw2_ll_sse.o: ksw2.h kalloc.h ksw2_ll_sse.o: ksw2.h kalloc.h
kthread.o: kthread.h kthread.o: kthread.h
lchain.o: mmpriv.h minimap.h bseq.h kseq.h kalloc.h krmq.h main.o: bseq.h minimap.h mmpriv.h ketopt.h
main.o: bseq.h minimap.h mmpriv.h kseq.h ketopt.h map.o: kthread.h kvec.h kalloc.h sdust.h mmpriv.h minimap.h bseq.h khash.h
map.o: kthread.h kvec.h kalloc.h sdust.h mmpriv.h minimap.h bseq.h kseq.h map.o: ksort.h
map.o: khash.h ksort.h misc.o: mmpriv.h minimap.h bseq.h ksort.h
misc.o: mmpriv.h minimap.h bseq.h kseq.h ksort.h options.o: mmpriv.h minimap.h bseq.h
options.o: mmpriv.h minimap.h bseq.h kseq.h pe.o: mmpriv.h minimap.h bseq.h kvec.h kalloc.h ksort.h
pe.o: mmpriv.h minimap.h bseq.h kseq.h kvec.h kalloc.h ksort.h sdust.o: kalloc.h kdq.h kvec.h ketopt.h sdust.h
sdust.o: kalloc.h kdq.h kvec.h sdust.h sketch.o: kvec.h kalloc.h mmpriv.h minimap.h bseq.h
seed.o: mmpriv.h minimap.h bseq.h kseq.h kalloc.h ksort.h splitidx.o: mmpriv.h minimap.h bseq.h
sketch.o: kvec.h kalloc.h mmpriv.h minimap.h bseq.h kseq.h
splitidx.o: mmpriv.h minimap.h bseq.h kseq.h
-97
View File
@@ -1,97 +0,0 @@
CFLAGS= -g -Wall -O2 -Wc++-compat #-Wextra
CPPFLAGS= -DHAVE_KALLOC -DUSE_SIMDE -DSIMDE_ENABLE_NATIVE_ALIASES
INCLUDES= -Ilib/simde
OBJS= kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o options.o index.o lchain.o align.o hit.o map.o format.o pe.o seed.o esterr.o splitidx.o \
ksw2_extz2_simde.o ksw2_extd2_simde.o ksw2_exts2_simde.o ksw2_ll_simde.o
PROG= minimap2
PROG_EXTRA= sdust minimap2-lite
LIBS= -lm -lz -lpthread
ifneq ($(arm_neon),) # if arm_neon is defined
ifeq ($(aarch64),) #if aarch64 is not defined
CFLAGS+=-D_FILE_OFFSET_BITS=64 -mfpu=neon -fsigned-char
else #if aarch64 is defined
CFLAGS+=-D_FILE_OFFSET_BITS=64 -fsigned-char
endif
endif
ifneq ($(asan),)
CFLAGS+=-fsanitize=address
LIBS+=-fsanitize=address
endif
ifneq ($(tsan),)
CFLAGS+=-fsanitize=thread
LIBS+=-fsanitize=thread
endif
.PHONY:all extra clean depend
.SUFFIXES:.c .o
.c.o:
$(CC) -c $(CFLAGS) $(CPPFLAGS) $(INCLUDES) $< -o $@
all:$(PROG)
extra:all $(PROG_EXTRA)
minimap2:main.o libminimap2.a
$(CC) $(CFLAGS) main.o -o $@ -L. -lminimap2 $(LIBS)
minimap2-lite:example.o libminimap2.a
$(CC) $(CFLAGS) $< -o $@ -L. -lminimap2 $(LIBS)
libminimap2.a:$(OBJS)
$(AR) -csru $@ $(OBJS)
sdust:sdust.c kalloc.o kalloc.h kdq.h kvec.h kseq.h ketopt.h sdust.h
$(CC) -D_SDUST_MAIN $(CFLAGS) $< kalloc.o -o $@ -lz
ksw2_ll_simde.o:ksw2_ll_sse.c ksw2.h kalloc.h
$(CC) -c $(CFLAGS) -msse2 $(CPPFLAGS) $(INCLUDES) $< -o $@
ksw2_extz2_simde.o:ksw2_extz2_sse.c ksw2.h kalloc.h
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) $(INCLUDES) $< -o $@
ksw2_extd2_simde.o:ksw2_extd2_sse.c ksw2.h kalloc.h
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) $(INCLUDES) $< -o $@
ksw2_exts2_simde.o:ksw2_exts2_sse.c ksw2.h kalloc.h
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) $(INCLUDES) $< -o $@
# other non-file targets
clean:
rm -fr gmon.out *.o a.out $(PROG) $(PROG_EXTRA) *~ *.a *.dSYM build dist mappy*.so mappy.c python/mappy.c mappy.egg*
depend:
(LC_ALL=C; export LC_ALL; makedepend -Y -- $(CFLAGS) $(CPPFLAGS) -- *.c)
# DO NOT DELETE
align.o: minimap.h mmpriv.h bseq.h kseq.h ksw2.h kalloc.h
bseq.o: bseq.h kvec.h kalloc.h kseq.h
chain.o: minimap.h mmpriv.h bseq.h kseq.h kalloc.h
esterr.o: mmpriv.h minimap.h bseq.h kseq.h
example.o: minimap.h kseq.h
format.o: kalloc.h mmpriv.h minimap.h bseq.h kseq.h
hit.o: mmpriv.h minimap.h bseq.h kseq.h kalloc.h khash.h
index.o: kthread.h bseq.h minimap.h mmpriv.h kseq.h kvec.h kalloc.h khash.h
index.o: ksort.h
kalloc.o: kalloc.h
ksw2_extd2_sse.o: ksw2.h kalloc.h
ksw2_exts2_sse.o: ksw2.h kalloc.h
ksw2_extz2_sse.o: ksw2.h kalloc.h
ksw2_ll_sse.o: ksw2.h kalloc.h
kthread.o: kthread.h
main.o: bseq.h minimap.h mmpriv.h kseq.h ketopt.h
map.o: kthread.h kvec.h kalloc.h sdust.h mmpriv.h minimap.h bseq.h kseq.h
map.o: khash.h ksort.h
misc.o: mmpriv.h minimap.h bseq.h kseq.h ksort.h
options.o: mmpriv.h minimap.h bseq.h kseq.h
pe.o: mmpriv.h minimap.h bseq.h kseq.h kvec.h kalloc.h ksort.h
sdust.o: kalloc.h kdq.h kvec.h sdust.h
self-chain.o: minimap.h kseq.h
sketch.o: kvec.h kalloc.h mmpriv.h minimap.h bseq.h kseq.h
splitidx.o: mmpriv.h minimap.h bseq.h kseq.h
-406
View File
@@ -1,409 +1,3 @@
Release 2.31-r1302 (19 May 2026)
--------------------------------
Notable changes to minimap2:
* Bugfix: supplementary and secondary alignments were occasionally flagged
incorrectly.
* Bugfix: Smith-Waterman alignment for inversion alignment led to an
out-of-bound access in rare cases.
Changes to paftools.js:
* New feature: new `sim2bed` subcommand to get a BED file from simulated
reads.
* New feature: new `badread2fa` subcommand to format reads simulated by
the Badread simulator.
Change to the python binding:
* New feature: mappy optionally writes the `ds` tag.
* Bugfix: a use-after-free error (#1345)
The two bugs in minimap2 had existed for years. They were caught by Jeremy Wang
at UNC when he ported minimap2 to Rust. Due to the two bug fixes, this version
occasionally produces alignment different from the last version.
(2.31: 19 May 2026, r1302)
Release 2.30-r1287 (15 June 2025)
---------------------------------
Notable changes:
* Improvement: consolidated `--spsc`.
* Deprecation: subcommands `splice2bed`, `gff2bed`, `gff2junc`, `junceval` and
`exoneval` in `paftools.js` are deprecated by minigff. They will remain
indefinitely for backward compatibility.
(2.30: 15 June 2025, r1287)
Release 2.29-r1283 (18 April 2025)
----------------------------------
Notable changes to minimap2:
* New feature: added the `splice:sr` preset for short RNA-seq read alignment.
Users may use `-j` to specify known gene annotation to improve spliced
alignment close to the ends of short reads. Also added `--write-junc` and
`--pass1` for 2-pass short-read RNA-seq alignment.
* Experimental feature: read splice scores from a file specified by `--spsc`
and consider the scores during base alignment. The feature makes it possible
to apply advanced splice models and to improve spliced alignment.
* Change: adjusted the mapping quality calculation for spliced alignment.
* Bugfixes: a) missing overlap alignment when base alignment is requested
(#969); b) incorrect summary information for long genomes (#1192); c)
missing parameter check for `--score-N` (#1226).
* Improvement: a) warn about absent junction files (#1229); b) report an error
if a wrong preset prefixed with "splice" is specified (#589).
Notable changes to mappy:
* Improvement: allow passing read name (#1260)
* Improvement: exposed score for ambiguous bases (#1240)
Minimap2 now supports short/long genomic/RNA-seq read alignment along with
contig alignment and all-vs-all read overlapping. It produces identical genomic
long-read or contig alignment to v2.27. Short genomic read alignment and the
mapping quality of long RNA-seq read alignment may slightly differ in very rare
cases.
(2.29: 18 April 2025, r1283)
Release 2.28-r1209 (27 March 2024)
----------------------------------
Notable changes to minimap2:
* Bugfix: `--MD` was not working properly due to the addition of `--ds` in the
last release (#1181 and #1182).
* New feature: added an experimental preset `lq:hqae` for aligning accurate
long reads back to their assembly. It has been observed that `map-hifi` and
`lr:hq` may produce many wrong alignments around centromeres when accurate
long reads (PacBio HiFi or Nanopore duplex/Q20+) are mapped to a diploid
assembly constructed from them. This new preset produces much more accurate
alignment. It is still experimental and may be subjective to changes in
future.
* Change: reduced the default `--cap-kalloc` to 500m to lower the peak
memory consumption (#855).
Notable changes to mappy:
* Bugfix: mappy option struct was out of sync with minimap2 (#1177).
Minimap2 should output identical alignments to v2.27.
(2.28: 27 March 2024, r1209)
Release 2.27-r1193 (12 March 2024)
----------------------------------
Notable changes to minimap2:
* New feature: added the `lr:hq` preset for accurate long reads at ~1% error
rate. This was suggested by Oxford Nanopore developers (#1127). It is not
clear if this preset also works well for PacBio HiFi reads.
* New feature: added the `map-iclr` preset for Illumina Complete Long Reads
(#1069), provided by Illumina developers.
* New feature: added option `-b` to specify mismatch penalty for base
transitions (i.e. A-to-G or C-to-T changes).
* New feature: added option `--ds` to generate a new `ds:Z` tag that
indicates uncertainty in INDEL positions. It is an extension to `cs`. The
`mgutils-es6.js` script in minigraph parses `ds`.
* Bugfix: avoided a NULL pointer dereference (#1154). This would not have an
effect on most systems but would still be good to fix.
* Bugfix: reverted the value of `ms:i` to pre-2.22 versions (#1146). This was
an oversight. See fcd4df2 for details.
Notable changes to paftools.js and mappy:
* New feature: expose `bw_long` to mappy's Aligner class (#1124).
* Bugfix: fixed several compatibility issues with k8 v1.0 (#1161 and #1166).
Subcommands "call", "pbsim2fq" and "mason2fq" were not working with v1.0.
Minimap2 should output identical alignments to v2.26, except the ms tag.
(2.27: 12 March 2024, r1193)
Release 2.26-r1175 (29 April 2023)
----------------------------------
Fixed the broken Python package. This is the only change.
(2.26: 25 April 2023, r1173)
Release 2.25-r1173 (25 April 2023)
----------------------------------
Notable changes:
* Improvement: use the miniprot splice model for RNA-seq alignment by default.
This model considers non-GT-AG splice sites and leads to slightly higher
(<0.1%) accuracy and sensitivity on real human data.
* Change: increased the default `-I` to `8G` such that minimap2 would create a
uni-part index for a pair of mammalian genomes. This change may increase the
memory for all-vs-all read overlap alignment given large datasets.
* New feature: output the sequences in secondary alignments with option
`--secondary-seq` (#687).
* Bugfix: --rmq was not parsed correctly (#1010)
* Bugfix: possibly incorrect coordinate when applying end bonus to the target
sequence (#1025). This is a ksw2 bug. It does not affect minimap2 as
minimap2 is not using the affected feature.
* Improvement: incorporated several changes for better compatibility with
Windows (#1051) and for minimap2 integration at Oxford Nanopore Technologies
(#1048 and #1033).
* Improvement: output the HD-line in SAM output (#1019).
* Improvement: check minimap2 index file in mappy to prevent segmentation
fault for certain indices (#1008).
For genomic sequences, minimap2 should give identical output to v2.24.
Long-read RNA-seq alignment may occasionally differ from previous versions.
(2.25: 25 April 2023, r1173)
Release 2.24-r1122 (26 December 2021)
-------------------------------------
This release improves alignment around long poorly aligned regions. Older
minimap2 may chain through such regions in rare cases which may result in
missing alignments later. The issue has become worse since the the change of
the chaining algorithm in v2.19. v2.23 implements an incomplete remedy. This
release provides a better solution with a X-drop-like heuristic and by enabling
two-bandwidth chaining in the assembly mode.
(2.24: 26 December 2021, r1122)
Release 2.23-r1111 (18 November 2021)
-------------------------------------
Notable changes:
* Bugfix: fixed missing alignments around long inversions (#806 and #816).
This bug affected v2.19 through v2.22.
* Improvement: avoid extremely long mapping time for pathologic reads with
highly repeated k-mers not in the reference (#771). Use --q-occ-frac=0
to disable the new heuristic.
* Change: use --cap-kalloc=1g by default.
(2.23: 18 November 2021, r1111)
Release 2.22-r1101 (7 August 2021)
----------------------------------
When choosing the best alignment, this release uses logarithm gap penalty and
query-specific mismatch penalty. It improves the sensitivity to long INDELs in
repetitive regions.
Other notable changes:
* Bugfix: fixed an indirect memory leak that may waste a large amount of
memory given highly repetitive reference such as a 16S RNA database (#749).
All versions of minimap2 have this issue.
* New feature: added --cap-kalloc to reduce the peak memory. This option is
not enabled by default but may become the default in future releases.
Known issue:
* Minimap2 may take a long time to map a read (#771). So far it is not clear
if this happens to v2.18 and earlier versions.
(2.22: 7 August 2021, r1101)
Release 2.21-r1071 (6 July 2021)
--------------------------------
This release fixed a regression in short-read mapping introduced in v2.19
(#776). It also fixed invalid comparisons of uninitialized variables, though
these are harmless (#752). Long-read alignment should be identical to v2.20.
(2.21: 6 July 2021, r1071)
Release 2.20-r1061 (27 May 2021)
--------------------------------
This release fixed a bug in the Python module and improves the command-line
compatibiliity with v2.18. In v2.19, if `-r` is specified with an `asm*` preset,
users would get alignments more fragmented than v2.18. This could be an issue
for existing pipelines specifying `-r`. This release resolves this issue.
(2.20: 27 May 2021, r1061)
Release 2.19-r1057 (26 May 2021)
--------------------------------
This release includes a few important improvements backported from unimap:
* Improvement: more contiguous alignment through long INDELs. This is enabled
by the minigraph chaining algorithm. All `asm*` presets now use the new
algorithm. They can find INDELs up to 100kb and may be faster for
chromosome-long contigs. The default mode and `map*` presets use this
algorithm to replace the long-join heuristic.
* Improvement: better alignment in highly repetitive regions by rescuing
high-occurrence seeds. If the distance between two adjacent seeds is too
large, attempt to choose a fraction of high-occurrence seeds in-between.
Minimap2 now produces fewer clippings and alignment break points in long
satellite regions.
* Improvement: allow to specify an interval of k-mer occurrences with `-U`.
For repeat-rich genomes, the automatic k-mer occurrence threshold determined
by `-f` may be too large and makes alignment impractically slow. The new
option protects against such cases. Enabled for `asm*` and `map-hifi`.
* New feature: added the `map-hifi` preset for maping PacBio High-Fidelity
(HiFi) reads.
* Change to the default: apply `--cap-sw-mem=100m` for genomic alignment.
* Bugfix: minimap2 could not generate an index file with `-xsr` (#734).
This release represents the most signficant algorithmic change since v2.1 in
2017. With features backported from unimap, minimap2 now has similar power to
unimap for contig alignment. Unimap will remain an experimental project and is
no longer recommended over minimap2. Sorry for reverting the recommendation in
short time.
(2.19: 26 May 2021, r1057)
Release 2.18-r1015 (9 April 2021)
---------------------------------
This release fixes multiple rare bugs in minimap2 and adds additional
functionality to paftools.js.
Changes to minimap2:
* Bugfix: a rare segfault caused by an off-by-one error (#489)
* Bugfix: minimap2 segfaulted due to an uninitilized variable (#622 and #625).
* Bugfix: minimap2 parsed spaces as field separators in BED (#721). This led
to issues when the BED name column contains spaces.
* Bugfix: minimap2 `--split-prefix` did not work with long reference names
(#394).
* Bugfix: option `--junc-bonus` didn't work (#513)
* Bugfix: minimap2 didn't return 1 on I/O errors (#532)
* Bugfix: the `de:f` tag (sequence divergence) could be negative if there were
ambiguous bases
* Bugfix: fixed two undefined behaviors caused by calling memcpy() on
zero-length blocks (#443)
* Bugfix: there were duplicated SAM @SQ lines if option `--split-prefix` is in
use (#400 and #527)
* Bugfix: option -K had to be smaller than 2 billion (#491). This was caused
by a 32-bit integer overflow.
* Improvement: optionally compile against SIMDe (#597). Minimap2 should work
with IBM POWER CPUs, though this has not been tested. To compile with SIMDe,
please use `make -f Makefile.simde`.
* Improvement: more informative error message for I/O errors (#454) and for
FASTQ parsing errors (#510)
* Improvement: abort given malformatted RG line (#541)
* Improvement: better formula to estimate the `dv:f` tag (approximate sequence
divergence). See DOI:10.1101/2021.01.15.426881.
* New feature: added the `--mask-len` option to fine control the removal of
redundant hits (#659). The default behavior is unchanged.
Changes to mappy:
* Bugfix: mappy caused segmentation fault if the reference index is not
present (#413).
* Bugfix: fixed a memory leak via 238b6bb3
* Change: always require Cython to compile the mappy module (#723). Older
mappy packages at PyPI bundled the C source code generated by Cython such
that end users did not need to install Cython to compile mappy. However, as
Python 3.9 is breaking backward compatibility, older mappy does not work
with Python 3.9 anymore. We have to add this Cython dependency as a
workaround.
Changes to paftools.js:
* Bugfix: the "part10-" line from asmgene was wrong (#581)
* Improvement: compatibility with GTF files from GenBank (#422)
* New feature: asmgene also checks missing multi-copy genes
* New feature: added the misjoin command to evaluate large-scale misjoins and
megabase-long inversions.
Although given the many bug fixes and minor improvements, the core algorithm
stays the same. This version of minimap2 produces nearly identical alignments
to v2.17 except very rare corner cases.
Now unimap is recommended over minimap2 for aligning long contigs against a
reference genome. It often takes less wall-clock time and is much more
sensitive to long insertions and deletions.
(2.18: 9 April 2021, r1015)
Release 2.17-r941 (4 May 2019) Release 2.17-r941 (4 May 2019)
------------------------------ ------------------------------
+23 -74
View File
@@ -1,9 +1,8 @@
[![GitHub Downloads](https://img.shields.io/github/downloads/lh3/minimap2/total.svg?style=social&logo=github&label=Download)](https://github.com/lh3/minimap2/releases) [![GitHub Downloads](https://img.shields.io/github/downloads/lh3/minimap2/total.svg?style=social&logo=github&label=Download)](https://github.com/lh3/minimap2/releases)
[![BioConda Install](https://img.shields.io/conda/dn/bioconda/minimap2.svg?style=flag&label=BioConda%20install)](https://anaconda.org/bioconda/minimap2) [![BioConda Install](https://img.shields.io/conda/dn/bioconda/minimap2.svg?style=flag&label=BioConda%20install)](https://anaconda.org/bioconda/minimap2)
[![PyPI](https://img.shields.io/pypi/v/mappy.svg?style=flat)](https://pypi.python.org/pypi/mappy) [![PyPI](https://img.shields.io/pypi/v/mappy.svg?style=flat)](https://pypi.python.org/pypi/mappy)
[![Build Status](https://github.com/lh3/minimap2/actions/workflows/ci.yaml/badge.svg)](https://github.com/lh3/minimap2/actions) [![Build Status](https://travis-ci.org/lh3/minimap2.svg?branch=master)](https://travis-ci.org/lh3/minimap2)
## <a name="started"></a>Getting Started ## <a name="started"></a>Getting Started
**ALERT:** `minimap2.com` is a [phishing site](https://github.com/lh3/minimap2/issues/1316). Please don't use anything from that website.
```sh ```sh
git clone https://github.com/lh3/minimap2 git clone https://github.com/lh3/minimap2
cd minimap2 && make cd minimap2 && make
@@ -13,24 +12,19 @@ cd minimap2 && make
./minimap2 -x map-ont -d MT-human-ont.mmi test/MT-human.fa ./minimap2 -x map-ont -d MT-human-ont.mmi test/MT-human.fa
./minimap2 -a MT-human-ont.mmi test/MT-orang.fa > test.sam ./minimap2 -a MT-human-ont.mmi test/MT-orang.fa > test.sam
# use presets (no test data) # use presets (no test data)
./minimap2 -ax map-pb ref.fa pacbio.fq.gz > aln.sam # PacBio CLR genomic reads ./minimap2 -ax map-pb ref.fa pacbio.fq.gz > aln.sam # PacBio genomic reads
./minimap2 -ax map-ont ref.fa ont.fq.gz > aln.sam # Oxford Nanopore genomic reads ./minimap2 -ax map-ont ref.fa ont.fq.gz > aln.sam # Oxford Nanopore genomic reads
./minimap2 -ax map-hifi ref.fa pacbio-ccs.fq.gz > aln.sam # PacBio HiFi/CCS genomic reads (v2.19+) ./minimap2 -ax asm20 ref.fa pacbio-ccs.fq.gz > aln.sam # PacBio CCS genomic reads
./minimap2 -ax lr:hq ref.fa ont-Q20.fq.gz > aln.sam # Nanopore Q20 genomic reads (v2.27+)
./minimap2 -ax sr ref.fa read1.fa read2.fa > aln.sam # short genomic paired-end reads ./minimap2 -ax sr ref.fa read1.fa read2.fa > aln.sam # short genomic paired-end reads
./minimap2 -ax splice ref.fa rna-reads.fa > aln.sam # spliced long reads (strand unknown) ./minimap2 -ax splice ref.fa rna-reads.fa > aln.sam # spliced long reads (strand unknown)
./minimap2 -ax splice -uf -k14 ref.fa reads.fa > aln.sam # noisy Nanopore direct RNA-seq ./minimap2 -ax splice -uf -k14 ref.fa reads.fa > aln.sam # noisy Nanopore Direct RNA-seq
./minimap2 -ax splice:hq -uf ref.fa query.fa > aln.sam # PacBio Kinnex/Iso-seq (RNA-seq) ./minimap2 -ax splice:hq -uf ref.fa query.fa > aln.sam # Final PacBio Iso-seq or traditional cDNA
./minimap2 -ax splice --junc-bed=anno.bed12 ref.fa query.fa > aln.sam # use annotated junctions
./minimap2 -ax splice:sr ref.fa r1.fq r2.fq > aln.sam # short-read RNA-seq (v2.29+)
./minimap2 -ax splice:sr -j anno.bed12 ref.fa r1.fq r2.fq > aln.sam
./minimap2 -cx asm5 asm1.fa asm2.fa > aln.paf # intra-species asm-to-asm alignment ./minimap2 -cx asm5 asm1.fa asm2.fa > aln.paf # intra-species asm-to-asm alignment
./minimap2 -x ava-pb reads.fa reads.fa > overlaps.paf # PacBio read overlap ./minimap2 -x ava-pb reads.fa reads.fa > overlaps.paf # PacBio read overlap
./minimap2 -x ava-ont reads.fa reads.fa > overlaps.paf # Nanopore read overlap ./minimap2 -x ava-ont reads.fa reads.fa > overlaps.paf # Nanopore read overlap
# man page for detailed command line options # man page for detailed command line options
man ./minimap2.1 man ./minimap2.1
``` ```
## Table of Contents ## Table of Contents
- [Getting Started](#started) - [Getting Started](#started)
@@ -41,8 +35,7 @@ man ./minimap2.1
- [Map long noisy genomic reads](#map-long-genomic) - [Map long noisy genomic reads](#map-long-genomic)
- [Map long mRNA/cDNA reads](#map-long-splice) - [Map long mRNA/cDNA reads](#map-long-splice)
- [Find overlaps between long reads](#long-overlap) - [Find overlaps between long reads](#long-overlap)
- [Map short genomic reads](#short-genomic) - [Map short accurate genomic reads](#short-genomic)
- [Map short RNA-seq reads](#short-rna-seq)
- [Full genome/assembly alignment](#full-genome) - [Full genome/assembly alignment](#full-genome)
- [Advanced features](#advanced) - [Advanced features](#advanced)
- [Working with >65535 CIGAR operations](#long-cigar) - [Working with >65535 CIGAR operations](#long-cigar)
@@ -78,8 +71,8 @@ Detailed evaluations are available from the [minimap2 paper][doi] or the
Minimap2 is optimized for x86-64 CPUs. You can acquire precompiled binaries from Minimap2 is optimized for x86-64 CPUs. You can acquire precompiled binaries from
the [release page][release] with: the [release page][release] with:
```sh ```sh
curl -L https://github.com/lh3/minimap2/releases/download/v2.31/minimap2-2.31_x64-linux.tar.bz2 | tar -jxvf - curl -L https://github.com/lh3/minimap2/releases/download/v2.17/minimap2-2.17_x64-linux.tar.bz2 | tar -jxvf -
./minimap2-2.31_x64-linux/minimap2 ./minimap2-2.17_x64-linux/minimap2
``` ```
If you want to compile from the source, you need to have a C compiler, GNU make If you want to compile from the source, you need to have a C compiler, GNU make
and zlib development files installed. Then type `make` in the source code and zlib development files installed. Then type `make` in the source code
@@ -87,20 +80,13 @@ directory to compile. If you see compilation errors, try `make sse2only=1`
to disable SSE4 code, which will make minimap2 slightly slower. to disable SSE4 code, which will make minimap2 slightly slower.
Minimap2 also works with ARM CPUs supporting the NEON instruction sets. To Minimap2 also works with ARM CPUs supporting the NEON instruction sets. To
compile for 32 bit ARM architectures (such as ARMv7), use `make arm_neon=1`. To compile for 32 bit ARM architectures (such as ARMv7), use `make arm_neon=1`. To compile for for 64 bit ARM architectures (such as ARMv8), use `make arm_neon=1 aarch64=1`.
compile for for 64 bit ARM architectures (such as ARMv8), use `make arm_neon=1
aarch64=1`.
Minimap2 can use [SIMD Everywhere (SIMDe)][simde] library for porting
implementation to the different SIMD instruction sets. To compile using SIMDe,
use `make -f Makefile.simde`. To compile for ARM CPUs, use `Makefile.simde`
with the ARM related command lines given above.
### <a name="general"></a>General usage ### <a name="general"></a>General usage
Without any options, minimap2 takes a reference database and a query sequence Without any options, minimap2 takes a reference database and a query sequence
file as input and produce approximate mapping, without base-level alignment file as input and produce approximate mapping, without base-level alignment
(i.e. coordinates are only approximate and no CIGAR in output), in the [PAF format][paf]: (i.e. no CIGAR), in the [PAF format][paf]:
```sh ```sh
minimap2 ref.fa query.fq > approx-mapping.paf minimap2 ref.fa query.fq > approx-mapping.paf
``` ```
@@ -141,17 +127,14 @@ parameters at the same time. The default setting is the same as `map-ont`.
#### <a name="map-long-genomic"></a>Map long noisy genomic reads #### <a name="map-long-genomic"></a>Map long noisy genomic reads
```sh ```sh
minimap2 -ax map-pb ref.fa pacbio-reads.fq > aln.sam # for PacBio CLR reads minimap2 -ax map-pb ref.fa pacbio-reads.fq > aln.sam # for PacBio subreads
minimap2 -ax map-ont ref.fa ont-reads.fq > aln.sam # for Oxford Nanopore reads minimap2 -ax map-ont ref.fa ont-reads.fq > aln.sam # for Oxford Nanopore reads
minimap2 -ax map-iclr ref.fa iclr-reads.fq > aln.sam # for Illumina Complete Long Reads
``` ```
The difference between `map-pb` and `map-ont` is that `map-pb` uses The difference between `map-pb` and `map-ont` is that `map-pb` uses
homopolymer-compressed (HPC) minimizers as seeds, while `map-ont` uses ordinary homopolymer-compressed (HPC) minimizers as seeds, while `map-ont` uses ordinary
minimizers as seeds. Empirical evaluation suggests HPC minimizers improve minimizers as seeds. Emperical evaluation suggests HPC minimizers improve
performance and sensitivity when aligning PacBio CLR reads, but hurt when aligning performance and sensitivity when aligning PacBio reads, but hurt when aligning
Nanopore reads. `map-iclr` uses an adjusted alignment scoring matrix that Nanopore reads.
accounts for the low overall error rate in the reads, with transversion errors
being less frequent than transitions.
#### <a name="map-long-splice"></a>Map long mRNA/cDNA reads #### <a name="map-long-splice"></a>Map long mRNA/cDNA reads
@@ -175,8 +158,9 @@ or the last exons.
Minimap2 rates an alignment by the score of the max-scoring sub-segment, Minimap2 rates an alignment by the score of the max-scoring sub-segment,
*excluding* introns, and marks the best alignment as primary in SAM. When a *excluding* introns, and marks the best alignment as primary in SAM. When a
spliced gene also has unspliced pseudogenes, minimap2 slightly prefers spliced gene also has unspliced pseudogenes, minimap2 does not intentionally
the spliced alignment. By default, minimap2 outputs up to five secondary prefer spliced alignment, though in practice it more often marks the spliced
alignment as the primary. By default, minimap2 outputs up to five secondary
alignments (i.e. likely pseudogenes in the context of RNA-seq mapping). This alignments (i.e. likely pseudogenes in the context of RNA-seq mapping). This
can be tuned with option **-N**. can be tuned with option **-N**.
@@ -194,27 +178,10 @@ This is because SIRV does not honor the evolutionarily conservative splicing
signal. If you are studying SIRV, you may apply `--splice-flank=no` to let signal. If you are studying SIRV, you may apply `--splice-flank=no` to let
minimap2 only model GT..AG, ignoring the additional base. minimap2 only model GT..AG, ignoring the additional base.
Since v2.17, minimap2 can optionally take annotated genes as input and
prioritize on annotated splice junctions. To use this feature, you can
```sh
paftools.js gff2bed anno.gff > anno.bed
minimap2 -ax splice --junc-bed anno.bed ref.fa query.fa > aln.sam
```
Here, `anno.gff` is the gene annotation in the GTF or GFF3 format (`gff2bed`
automatically tests the format). The output of `gff2bed` is in the 12-column
BED format, or the BED12 format. With the `--junc-bed` option, minimap2 adds a
bonus score (tuned by `--junc-bonus`) if an aligned junction matches a junction
in the annotation. Option `--junc-bed` also takes 5-column BED, including the
strand field. In this case, each line indicates an oriented junction.
**Note:** `--junc-bed` is intended for long noisy RNA-seq reads only.
Applying the option to short RNA-seq reads would increase run time with little
improvement to junction accuracy.
#### <a name="long-overlap"></a>Find overlaps between long reads #### <a name="long-overlap"></a>Find overlaps between long reads
```sh ```sh
minimap2 -x ava-pb reads.fq reads.fq > ovlp.paf # PacBio CLR read overlap minimap2 -x ava-pb reads.fq reads.fq > ovlp.paf # PacBio read overlap
minimap2 -x ava-ont reads.fq reads.fq > ovlp.paf # Oxford Nanopore read overlap minimap2 -x ava-ont reads.fq reads.fq > ovlp.paf # Oxford Nanopore read overlap
``` ```
Similarly, `ava-pb` uses HPC minimizers while `ava-ont` uses ordinary Similarly, `ava-pb` uses HPC minimizers while `ava-ont` uses ordinary
@@ -223,7 +190,7 @@ the overlapping mode because it is slow and may produce false positive
overlaps. However, if performance is not a concern, you may try to add `-a` or overlaps. However, if performance is not a concern, you may try to add `-a` or
`-c` anyway. `-c` anyway.
#### <a name="short-genomic"></a>Map short genomic reads #### <a name="short-genomic"></a>Map short accurate genomic reads
```sh ```sh
minimap2 -ax sr ref.fa reads-se.fq > aln.sam # single-end alignment minimap2 -ax sr ref.fa reads-se.fq > aln.sam # single-end alignment
@@ -236,18 +203,8 @@ be paired if they are adjacent in the input stream and have the same name (with
the `/[0-9]` suffix trimmed if present). Single- and paired-end reads can be the `/[0-9]` suffix trimmed if present). Single- and paired-end reads can be
mixed. mixed.
#### <a name="short-rna-seq"></a>Map short RNA-seq reads Minimap2 does not work well with short spliced reads. There are many capable
RNA-seq mappers for short reads.
```sh
minimap2 -ax splice:sr ref.fa reads-se.fq.gz > aln.sam # single-end
minimap2 -ax splice:sr ref.fa r1.fq.gz r2.fq.gz > aln.sam # paired-end
minimap2 -ax splice:sr -j anno.bed ref.fa r1.fq r2.fq > aln.sam # use annotation
# 2-pass alignment
minimap2 -x splice:sr -j anno.bed --write-junc ref.fa r1.fq r2.fq > junc.bed
minimap2 -ax splice:sr -j anno.bed --pass1=junc.bed ref.fa r1.fq r2.fq > aln.sam
```
The new preset `splice:sr` was added in v2.29. It functions similarly to `sr`
except that it performs spliced alignment.
#### <a name="full-genome"></a>Full genome/assembly alignment #### <a name="full-genome"></a>Full genome/assembly alignment
@@ -271,7 +228,7 @@ To avoid this issue, you can add option `-L` at the minimap2 command line.
This option moves a long CIGAR to the `CG` tag and leaves a fully clipped CIGAR This option moves a long CIGAR to the `CG` tag and leaves a fully clipped CIGAR
at the SAM CIGAR column. Current tools that don't read CIGAR (e.g. merging and at the SAM CIGAR column. Current tools that don't read CIGAR (e.g. merging and
sorting) still work with such BAM records; tools that read CIGAR will sorting) still work with such BAM records; tools that read CIGAR will
effectively ignore these records. It has been decided that future tools effectively ignore these records. It has been decided that future tools will
will seamlessly recognize long-cigar records generated by option `-L`. will seamlessly recognize long-cigar records generated by option `-L`.
**TL;DR**: if you work with ultra-long reads and use tools that only process **TL;DR**: if you work with ultra-long reads and use tools that only process
@@ -292,7 +249,7 @@ CGATCGATAAATAGAGTAG---GAATAGCA
CGATCG---AATAGAGTAGGTCGAATtGCA CGATCG---AATAGAGTAGGTCGAATtGCA
``` ```
is represented as `:6-ata:10+gtc:4*at:3`, where `:[0-9]+` represents an is represented as `:6-ata:10+gtc:4*at:3`, where `:[0-9]+` represents an
identical block, `-ata` represents a deletion, `+gtc` an insertion and `*at` identical block, `-ata` represents a deltion, `+gtc` an insertion and `*at`
indicates reference base `a` is substituted with a query base `t`. It is indicates reference base `a` is substituted with a query base `t`. It is
similar to the `MD` SAM tag but is standalone and easier to parse. similar to the `MD` SAM tag but is standalone and easier to parse.
@@ -370,11 +327,6 @@ If you use minimap2 in your work, please cite:
> Li, H. (2018). Minimap2: pairwise alignment for nucleotide sequences. > Li, H. (2018). Minimap2: pairwise alignment for nucleotide sequences.
> *Bioinformatics*, **34**:3094-3100. [doi:10.1093/bioinformatics/bty191][doi] > *Bioinformatics*, **34**:3094-3100. [doi:10.1093/bioinformatics/bty191][doi]
and/or:
> Li, H. (2021). New strategies to improve minimap2 alignment accuracy.
> *Bioinformatics*, **37**:4572-4574. [doi:10.1093/bioinformatics/btab705][doi2]
## <a name="dguide"></a>Developers' Guide ## <a name="dguide"></a>Developers' Guide
Minimap2 is not only a command line tool, but also a programming library. Minimap2 is not only a command line tool, but also a programming library.
@@ -424,6 +376,3 @@ mappy` or [from BioConda][mappyconda] via `conda install -c bioconda mappy`.
[manpage]: https://lh3.github.io/minimap2/minimap2.html [manpage]: https://lh3.github.io/minimap2/minimap2.html
[manpage-cs]: https://lh3.github.io/minimap2/minimap2.html#10 [manpage-cs]: https://lh3.github.io/minimap2/minimap2.html#10
[doi]: https://doi.org/10.1093/bioinformatics/bty191 [doi]: https://doi.org/10.1093/bioinformatics/bty191
[doi2]: https://doi.org/10.1093/bioinformatics/btab705
[simde]: https://github.com/nemequ/simde
[unimap]: https://github.com/lh3/unimap
+101 -308
View File
@@ -6,8 +6,6 @@
#include "mmpriv.h" #include "mmpriv.h"
#include "ksw2.h" #include "ksw2.h"
#define MM_MAX_QLEN_FLANK 100
static void ksw_gen_simple_mat(int m, int8_t *mat, int8_t a, int8_t b, int8_t sc_ambi) static void ksw_gen_simple_mat(int m, int8_t *mat, int8_t a, int8_t b, int8_t sc_ambi)
{ {
int i, j; int i, j;
@@ -23,18 +21,6 @@ static void ksw_gen_simple_mat(int m, int8_t *mat, int8_t a, int8_t b, int8_t sc
mat[(m - 1) * m + j] = sc_ambi; mat[(m - 1) * m + j] = sc_ambi;
} }
static void ksw_gen_ts_mat(int m, int8_t *mat, int8_t a, int8_t b, int8_t transition, int8_t sc_ambi)
{
assert(m == 5);
ksw_gen_simple_mat(m, mat, a, b, sc_ambi);
if (transition == 0 || transition == b) return;
transition = transition > 0? -transition : transition;
mat[0 * m + 2] = transition; // A->G
mat[1 * m + 3] = transition; // C->T
mat[2 * m + 0] = transition; // G->A
mat[3 * m + 1] = transition; // T->C
}
static inline void mm_seq_rev(uint32_t len, uint8_t *seq) static inline void mm_seq_rev(uint32_t len, uint8_t *seq)
{ {
uint32_t i; uint32_t i;
@@ -52,8 +38,8 @@ static inline void update_max_zdrop(int32_t score, int i, int j, int32_t *max, i
int z = *max - score - diff * e; int z = *max - score - diff * e;
if (z > *max_zdrop) { if (z > *max_zdrop) {
*max_zdrop = z; *max_zdrop = z;
pos[0][0] = *max_i, pos[0][1] = i; pos[0][0] = *max_i, pos[0][1] = i + 1;
pos[1][0] = *max_j, pos[1][1] = j; pos[1][0] = *max_j, pos[1][1] = j + 1;
} }
} else *max = score, *max_i = i, *max_j = j; } else *max = score, *max_i = i, *max_j = j;
} }
@@ -67,16 +53,16 @@ static int mm_test_zdrop(void *km, const mm_mapopt_t *opt, const uint8_t *qseq,
// find the score and the region where score drops most along diagonal // find the score and the region where score drops most along diagonal
for (k = 0, score = 0; k < n_cigar; ++k) { for (k = 0, score = 0; k < n_cigar; ++k) {
uint32_t l, op = cigar[k]&0xf, len = cigar[k]>>4; uint32_t l, op = cigar[k]&0xf, len = cigar[k]>>4;
if (op == MM_CIGAR_MATCH) { if (op == 0) {
for (l = 0; l < len; ++l) { for (l = 0; l < len; ++l) {
score += mat[tseq[i + l] * 5 + qseq[j + l]]; score += mat[tseq[i + l] * 5 + qseq[j + l]];
update_max_zdrop(score, i+l, j+l, &max, &max_i, &max_j, opt->e, &max_zdrop, pos); update_max_zdrop(score, i+l, j+l, &max, &max_i, &max_j, opt->e, &max_zdrop, pos);
} }
i += len, j += len; i += len, j += len;
} else if (op == MM_CIGAR_INS || op == MM_CIGAR_DEL || op == MM_CIGAR_N_SKIP) { } else if (op == 1 || op == 2 || op == 3) {
score -= opt->q + opt->e * len; score -= opt->q + opt->e * len;
if (op == MM_CIGAR_INS) j += len; if (op == 1) j += len; // insertion
else i += len; else i += len; // deletion
update_max_zdrop(score, i, j, &max, &max_i, &max_j, opt->e, &max_zdrop, pos); update_max_zdrop(score, i, j, &max, &max_i, &max_j, opt->e, &max_zdrop, pos);
} }
} }
@@ -112,12 +98,12 @@ static void mm_fix_cigar(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq,
for (k = 0; k < p->n_cigar; ++k) { // indel left alignment for (k = 0; k < p->n_cigar; ++k) { // indel left alignment
uint32_t op = p->cigar[k]&0xf, len = p->cigar[k]>>4; uint32_t op = p->cigar[k]&0xf, len = p->cigar[k]>>4;
if (len == 0) to_shrink = 1; if (len == 0) to_shrink = 1;
if (op == MM_CIGAR_MATCH) { if (op == 0) {
toff += len, qoff += len; toff += len, qoff += len;
} else if (op == MM_CIGAR_INS || op == MM_CIGAR_DEL) { } else if (op == 1 || op == 2) { // insertion or deletion
if (k > 0 && k < p->n_cigar - 1 && (p->cigar[k-1]&0xf) == 0 && (p->cigar[k+1]&0xf) == 0) { if (k > 0 && k < p->n_cigar - 1 && (p->cigar[k-1]&0xf) == 0 && (p->cigar[k+1]&0xf) == 0) {
int l, prev_len = p->cigar[k-1] >> 4; int l, prev_len = p->cigar[k-1] >> 4;
if (op == MM_CIGAR_INS) { if (op == 1) {
for (l = 0; l < prev_len; ++l) for (l = 0; l < prev_len; ++l)
if (qseq[qoff - 1 - l] != qseq[qoff + len - 1 - l]) if (qseq[qoff - 1 - l] != qseq[qoff + len - 1 - l])
break; break;
@@ -130,9 +116,9 @@ static void mm_fix_cigar(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq,
p->cigar[k-1] -= l<<4, p->cigar[k+1] += l<<4, qoff -= l, toff -= l; p->cigar[k-1] -= l<<4, p->cigar[k+1] += l<<4, qoff -= l, toff -= l;
if (l == prev_len) to_shrink = 1; if (l == prev_len) to_shrink = 1;
} }
if (op == MM_CIGAR_INS) qoff += len; if (op == 1) qoff += len;
else toff += len; else toff += len;
} else if (op == MM_CIGAR_N_SKIP) { } else if (op == 3) {
toff += len; toff += len;
} }
} }
@@ -142,13 +128,13 @@ static void mm_fix_cigar(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq,
uint32_t l, s[3] = {0,0,0}; uint32_t l, s[3] = {0,0,0};
for (l = k; l < p->n_cigar; ++l) { // count number of adjacent I and D for (l = k; l < p->n_cigar; ++l) { // count number of adjacent I and D
uint32_t op = p->cigar[l]&0xf; uint32_t op = p->cigar[l]&0xf;
if (op == MM_CIGAR_INS || op == MM_CIGAR_DEL || p->cigar[l]>>4 == 0) if (op == 1 || op == 2 || p->cigar[l]>>4 == 0)
s[op] += p->cigar[l] >> 4; s[op] += p->cigar[l] >> 4;
else break; else break;
} }
if (s[1] > 0 && s[2] > 0 && l - k > 2) { // turn to a single I and a single D if (s[1] > 0 && s[2] > 0 && l - k > 2) { // turn to a single I and a single D
p->cigar[k] = s[1]<<4|MM_CIGAR_INS; p->cigar[k] = s[1]<<4|1;
p->cigar[k+1] = s[2]<<4|MM_CIGAR_DEL; p->cigar[k+1] = s[2]<<4|2;
for (k += 2; k < l; ++k) for (k += 2; k < l; ++k)
p->cigar[k] &= 0xf; p->cigar[k] &= 0xf;
to_shrink = 1; to_shrink = 1;
@@ -168,9 +154,9 @@ static void mm_fix_cigar(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq,
else p->cigar[k+1] += p->cigar[k]>>4<<4; // add length to the next CIGAR operator else p->cigar[k+1] += p->cigar[k]>>4<<4; // add length to the next CIGAR operator
p->n_cigar = l; p->n_cigar = l;
} }
if ((p->cigar[0]&0xf) == MM_CIGAR_INS || (p->cigar[0]&0xf) == MM_CIGAR_DEL) { // get rid of leading I or D if ((p->cigar[0]&0xf) == 1 || (p->cigar[0]&0xf) == 2) { // get rid of leading I or D
int32_t l = p->cigar[0] >> 4; int32_t l = p->cigar[0] >> 4;
if ((p->cigar[0]&0xf) == MM_CIGAR_INS) { if ((p->cigar[0]&0xf) == 1) {
if (r->rev) r->qe -= l; if (r->rev) r->qe -= l;
else r->qs += l; else r->qs += l;
*qshift = l; *qshift = l;
@@ -188,7 +174,7 @@ static void mm_update_cigar_eqx(mm_reg1_t *r, const uint8_t *qseq, const uint8_t
if (r->p == 0) return; if (r->p == 0) return;
for (k = 0; k < r->p->n_cigar; ++k) { for (k = 0; k < r->p->n_cigar; ++k) {
uint32_t op = r->p->cigar[k]&0xf, len = r->p->cigar[k]>>4; uint32_t op = r->p->cigar[k]&0xf, len = r->p->cigar[k]>>4;
if (op == MM_CIGAR_MATCH) { if (op == 0) {
while (len > 0) { while (len > 0) {
for (l = 0; l < len && qseq[qoff + l] == tseq[toff + l]; ++l) {} // run of "="; TODO: N<=>N is converted to "=" for (l = 0; l < len && qseq[qoff + l] == tseq[toff + l]; ++l) {} // run of "="; TODO: N<=>N is converted to "="
if (l > 0) { ++n_EQX; len -= l; toff += l; qoff += l; } if (l > 0) { ++n_EQX; len -= l; toff += l; qoff += l; }
@@ -197,11 +183,11 @@ static void mm_update_cigar_eqx(mm_reg1_t *r, const uint8_t *qseq, const uint8_t
if (l > 0) { ++n_EQX; len -= l; toff += l; qoff += l; } if (l > 0) { ++n_EQX; len -= l; toff += l; qoff += l; }
} }
++n_M; ++n_M;
} else if (op == MM_CIGAR_INS) { } else if (op == 1) { // insertion
qoff += len; qoff += len;
} else if (op == MM_CIGAR_DEL) { } else if (op == 2) { // deletion
toff += len; toff += len;
} else if (op == MM_CIGAR_N_SKIP) { } else if (op == 3) { // intron
toff += len; toff += len;
} }
} }
@@ -209,7 +195,7 @@ static void mm_update_cigar_eqx(mm_reg1_t *r, const uint8_t *qseq, const uint8_t
if (n_EQX == n_M) { if (n_EQX == n_M) {
for (k = 0; k < r->p->n_cigar; ++k) { for (k = 0; k < r->p->n_cigar; ++k) {
uint32_t op = r->p->cigar[k]&0xf, len = r->p->cigar[k]>>4; uint32_t op = r->p->cigar[k]&0xf, len = r->p->cigar[k]>>4;
if (op == MM_CIGAR_MATCH) r->p->cigar[k] = len << 4 | MM_CIGAR_EQ_MATCH; if (op == 0) r->p->cigar[k] = len << 4 | 7;
} }
return; return;
} }
@@ -223,25 +209,25 @@ static void mm_update_cigar_eqx(mm_reg1_t *r, const uint8_t *qseq, const uint8_t
toff = qoff = m = 0; toff = qoff = m = 0;
for (k = 0; k < r->p->n_cigar; ++k) { for (k = 0; k < r->p->n_cigar; ++k) {
uint32_t op = r->p->cigar[k]&0xf, len = r->p->cigar[k]>>4; uint32_t op = r->p->cigar[k]&0xf, len = r->p->cigar[k]>>4;
if (op == MM_CIGAR_MATCH) { if (op == 0) { // match/mismatch
while (len > 0) { while (len > 0) {
// match // match
for (l = 0; l < len && qseq[qoff + l] == tseq[toff + l]; ++l) {} for (l = 0; l < len && qseq[qoff + l] == tseq[toff + l]; ++l) {}
if (l > 0) p->cigar[m++] = l << 4 | MM_CIGAR_EQ_MATCH; if (l > 0) p->cigar[m++] = l << 4 | 7;
len -= l; len -= l;
toff += l, qoff += l; toff += l, qoff += l;
// mismatch // mismatch
for (l = 0; l < len && qseq[qoff + l] != tseq[toff + l]; ++l) {} for (l = 0; l < len && qseq[qoff + l] != tseq[toff + l]; ++l) {}
if (l > 0) p->cigar[m++] = l << 4 | MM_CIGAR_X_MISMATCH; if (l > 0) p->cigar[m++] = l << 4 | 8;
len -= l; len -= l;
toff += l, qoff += l; toff += l, qoff += l;
} }
continue; continue;
} else if (op == MM_CIGAR_INS) { } else if (op == 1) { // insertion
qoff += len; qoff += len;
} else if (op == MM_CIGAR_DEL) { } else if (op == 2) { // deletion
toff += len; toff += len;
} else if (op == MM_CIGAR_N_SKIP) { } else if (op == 3) { // intron
toff += len; toff += len;
} }
p->cigar[m++] = r->p->cigar[k]; p->cigar[m++] = r->p->cigar[k];
@@ -251,19 +237,18 @@ static void mm_update_cigar_eqx(mm_reg1_t *r, const uint8_t *qseq, const uint8_t
r->p = p; r->p = p;
} }
static void mm_update_extra(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq, const int8_t *mat, int8_t q, int8_t e, int is_eqx, int log_gap) static void mm_update_extra(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq, const int8_t *mat, int8_t q, int8_t e, int is_eqx)
{ {
uint32_t k, l; uint32_t k, l;
int32_t qshift, tshift, toff = 0, qoff = 0; int32_t s = 0, max = 0, qshift, tshift, toff = 0, qoff = 0;
double s = 0.0, max = 0.0;
mm_extra_t *p = r->p; mm_extra_t *p = r->p;
if (p == 0) return; if (p == 0) return;
mm_fix_cigar(r, qseq, tseq, &qshift, &tshift); mm_fix_cigar(r, qseq, tseq, &qshift, &tshift);
qseq += qshift, tseq += tshift; // qseq and tseq may be shifted due to the removal of leading I/D qseq += qshift, tseq += tshift; // qseq and tseq may be shifted due to the removal of leading I/D
r->blen = r->mlen = 0, r->is_spliced = 0; r->blen = r->mlen = 0;
for (k = 0; k < p->n_cigar; ++k) { for (k = 0; k < p->n_cigar; ++k) {
uint32_t op = p->cigar[k]&0xf, len = p->cigar[k]>>4; uint32_t op = p->cigar[k]&0xf, len = p->cigar[k]>>4;
if (op == MM_CIGAR_MATCH) { if (op == 0) { // match/mismatch
int n_ambi = 0, n_diff = 0; int n_ambi = 0, n_diff = 0;
for (l = 0; l < len; ++l) { for (l = 0; l < len; ++l) {
int cq = qseq[qoff + l], ct = tseq[toff + l]; int cq = qseq[qoff + l], ct = tseq[toff + l];
@@ -275,35 +260,34 @@ static void mm_update_extra(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *ts
} }
r->blen += len - n_ambi, r->mlen += len - (n_ambi + n_diff), p->n_ambi += n_ambi; r->blen += len - n_ambi, r->mlen += len - (n_ambi + n_diff), p->n_ambi += n_ambi;
toff += len, qoff += len; toff += len, qoff += len;
} else if (op == MM_CIGAR_INS) { } else if (op == 1) { // insertion
int n_ambi = 0; int n_ambi = 0;
for (l = 0; l < len; ++l) for (l = 0; l < len; ++l)
if (qseq[qoff + l] > 3) ++n_ambi; if (qseq[qoff + l] > 3) ++n_ambi;
r->blen += len - n_ambi, p->n_ambi += n_ambi; r->blen += len - n_ambi, p->n_ambi += n_ambi;
if (log_gap) s -= q + (double)e * mg_log2(1.0 + len); s -= q + e * len;
else s -= q + e;
if (s < 0) s = 0; if (s < 0) s = 0;
qoff += len; qoff += len;
} else if (op == MM_CIGAR_DEL) { } else if (op == 2) { // deletion
int n_ambi = 0; int n_ambi = 0;
for (l = 0; l < len; ++l) for (l = 0; l < len; ++l)
if (tseq[toff + l] > 3) ++n_ambi; if (tseq[toff + l] > 3) ++n_ambi;
r->blen += len - n_ambi, p->n_ambi += n_ambi; r->blen += len - n_ambi, p->n_ambi += n_ambi;
if (log_gap) s -= q + (double)e * mg_log2(1.0 + len); s -= q + e * len;
else s -= q + e;
if (s < 0) s = 0; if (s < 0) s = 0;
toff += len; toff += len;
} else if (op == MM_CIGAR_N_SKIP) { } else if (op == 3) { // intron
r->is_spliced = 1, toff += len; toff += len;
} }
} }
p->dp_max = p->dp_max0 = (int32_t)(max + .499); p->dp_max = max;
assert(qoff == r->qe - r->qs && toff == r->re - r->rs); assert(qoff == r->qe - r->qs && toff == r->re - r->rs);
if (is_eqx) mm_update_cigar_eqx(r, qseq, tseq); // NB: it has to be called here as changes to qseq and tseq are not returned if (is_eqx) mm_update_cigar_eqx(r, qseq, tseq); // NB: it has to be called here as changes to qseq and tseq are not returned
} }
void mm_enlarge_cigar(mm_reg1_t *r, uint32_t n_cigar) // TODO: this calls the libc realloc() static void mm_append_cigar(mm_reg1_t *r, uint32_t n_cigar, uint32_t *cigar) // TODO: this calls the libc realloc()
{ {
mm_extra_t *p;
if (n_cigar == 0) return; if (n_cigar == 0) return;
if (r->p == 0) { if (r->p == 0) {
uint32_t capacity = n_cigar + sizeof(mm_extra_t)/4; uint32_t capacity = n_cigar + sizeof(mm_extra_t)/4;
@@ -315,13 +299,6 @@ void mm_enlarge_cigar(mm_reg1_t *r, uint32_t n_cigar) // TODO: this calls the li
kroundup32(r->p->capacity); kroundup32(r->p->capacity);
r->p = (mm_extra_t*)realloc(r->p, r->p->capacity * 4); r->p = (mm_extra_t*)realloc(r->p, r->p->capacity * 4);
} }
}
static void mm_append_cigar(mm_reg1_t *r, uint32_t n_cigar, const uint32_t *cigar)
{
mm_extra_t *p;
if (n_cigar == 0) return;
mm_enlarge_cigar(r, n_cigar);
p = r->p; p = r->p;
if (p->n_cigar > 0 && (p->cigar[p->n_cigar-1]&0xf) == (cigar[0]&0xf)) { // same CIGAR op at the boundary if (p->n_cigar > 0 && (p->cigar[p->n_cigar-1]&0xf) == (cigar[0]&0xf)) { // same CIGAR op at the boundary
p->cigar[p->n_cigar-1] += cigar[0]>>4<<4; p->cigar[p->n_cigar-1] += cigar[0]>>4<<4;
@@ -333,79 +310,34 @@ static void mm_append_cigar(mm_reg1_t *r, uint32_t n_cigar, const uint32_t *ciga
} }
} }
static void mm_align_pair(void *km, const mm_mapopt_t *opt, int qlen, const uint8_t *qseq, int tlen, const uint8_t *tseq, const uint8_t *junc, static void mm_align_pair(void *km, const mm_mapopt_t *opt, int qlen, const uint8_t *qseq, int tlen, const uint8_t *tseq, const uint8_t *junc, const int8_t *mat, int w, int end_bonus, int zdrop, int flag, ksw_extz_t *ez)
const int8_t *mat, int w, int end_bonus, int zdrop, int ksw_flag, ksw_extz_t *ez)
{ {
if (mm_dbg_flag & MM_DBG_PRINT_ALN_SEQ) { if (mm_dbg_flag & MM_DBG_PRINT_ALN_SEQ) {
int i; int i;
fprintf(stderr, "===> q=(%d,%d), e=(%d,%d), bw=%d, ksw_flag=%d, zdrop=%d, end_bonus=%d <===\n", opt->q, opt->q2, opt->e, opt->e2, w, ksw_flag, opt->zdrop, end_bonus); fprintf(stderr, "===> q=(%d,%d), e=(%d,%d), bw=%d, flag=%d, zdrop=%d <===\n", opt->q, opt->q2, opt->e, opt->e2, w, flag, opt->zdrop);
for (i = 0; i < tlen; ++i) fputc("ACGTN"[tseq[i]], stderr); for (i = 0; i < tlen; ++i) fputc("ACGTN"[tseq[i]], stderr);
fputc('\n', stderr); fputc('\n', stderr);
for (i = 0; i < qlen; ++i) fputc("ACGTN"[qseq[i]], stderr); for (i = 0; i < qlen; ++i) fputc("ACGTN"[qseq[i]], stderr);
fputc('\n', stderr); fputc('\n', stderr);
} }
if (opt->transition != 0 && opt->b != opt->transition) if (opt->max_sw_mat > 0 && (int64_t)tlen * qlen > opt->max_sw_mat) {
ksw_flag |= KSW_EZ_GENERIC_SC;
if (opt->max_sw_mat > 0 && (int64_t)tlen * qlen > opt->max_sw_mat) { // too much memory; skip alignment
ksw_reset_extz(ez); ksw_reset_extz(ez);
ez->zdropped = 1; ez->zdropped = 1;
} else if (opt->flag & MM_F_SPLICE) { // spliced alignment } else if (opt->flag & MM_F_SPLICE)
assert((ksw_flag & KSW_EZ_SPLICE_FOR) == 0 || (ksw_flag & KSW_EZ_SPLICE_REV) == 0); ksw_exts2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->noncan, zdrop, opt->junc_bonus, flag, junc, ez);
if (!(opt->flag & MM_F_SPLICE_OLD)) ksw_flag |= KSW_EZ_SPLICE_CMPLX; else if (opt->q == opt->q2 && opt->e == opt->e2)
ksw_exts2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->noncan, zdrop, end_bonus, opt->junc_bonus, opt->junc_pen, ksw_flag, junc, ez); ksw_extz2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, w, zdrop, end_bonus, flag, ez);
} else if (opt->q == opt->q2 && opt->e == opt->e2) { // affine gap else
ksw_extz2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, w, zdrop, end_bonus, ksw_flag, ez); ksw_extd2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->e2, w, zdrop, end_bonus, flag, ez);
} else { // dual affine gap
ksw_extd2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->e2, w, zdrop, end_bonus, ksw_flag, ez);
}
if (mm_dbg_flag & MM_DBG_PRINT_ALN_SEQ) { if (mm_dbg_flag & MM_DBG_PRINT_ALN_SEQ) {
int i; int i;
fprintf(stderr, "score=%d, cigar=", ez->score); fprintf(stderr, "score=%d, cigar=", ez->score);
for (i = 0; i < ez->n_cigar; ++i) for (i = 0; i < ez->n_cigar; ++i)
fprintf(stderr, "%d%c", ez->cigar[i]>>4, MM_CIGAR_STR[ez->cigar[i]&0xf]); fprintf(stderr, "%d%c", ez->cigar[i]>>4, "MIDN"[ez->cigar[i]&0xf]);
fprintf(stderr, "\n"); fprintf(stderr, "\n");
} }
} }
static int mm_align_sr_rna(void *km, const mm_mapopt_t *opt, int qlen, const uint8_t *qseq, int tlen, const uint8_t *tseq, const uint8_t *junc, uint8_t *tseq2, uint8_t *junc2,
const int8_t *mat, int w, int end_bonus, int zdrop, int ksw_flag, ksw_extz_t *ez)
{
int32_t ilen = opt->q2 * 2, tlen2 = qlen * 2 + ilen;
int32_t i, ll = 0, lr = 0, nn = 0, n_ins = 0;
if (!(opt->flag & MM_F_SPLICE)) return 0; // only for spliced alignment
if (qlen > MM_MAX_QLEN_FLANK || qlen * 2 + ilen > tlen) return 0; // the query sequence can't be too long and the target sequence must be long enough
for (i = 0; i < qlen; ++i) // exact match length from the left
if (qseq[i] == tseq[i] && qseq[i] < 4)
++ll;
for (i = 0; i < qlen; ++i) // exact match length from the right
if (qseq[qlen - 1 - i] == tseq[tlen - 1 - i] && qseq[qlen - 1 - i] < 4)
++lr;
if (qlen - (ll + lr) > 9) return 0; // qlen may be smaller than ll+lr
memcpy(tseq2, tseq, qlen);
memset(&tseq2[qlen], 4, ilen);
memcpy(&tseq2[qlen + ilen], &tseq[tlen - qlen], qlen);
if (junc) {
memcpy(junc2, junc, qlen);
memset(&junc2[qlen], 0, ilen);
memcpy(&junc2[qlen + ilen], &junc[tlen - qlen], qlen);
}
if (!(opt->flag & MM_F_SPLICE_OLD)) ksw_flag |= KSW_EZ_SPLICE_CMPLX;
ksw_exts2_sse(km, qlen, qseq, tlen2, tseq2, 5, mat, opt->q, opt->e, opt->q2, opt->noncan, zdrop, end_bonus, opt->junc_bonus, opt->junc_pen, ksw_flag, junc2, ez);
if (ez->zdropped) return 0;
if ((ez->cigar[0]&0xf) != KSW_CIGAR_MATCH || (ez->cigar[ez->n_cigar-1]&0xf) != KSW_CIGAR_MATCH) return 0;
for (i = 0; i < ez->n_cigar; ++i) { // count the number of introns in the alignment
if ((ez->cigar[i]&0xf) == KSW_CIGAR_N_SKIP)
++nn;
else if ((ez->cigar[i]&0xf) == KSW_CIGAR_INS)
++n_ins;
}
if (nn != 1 || n_ins > 0) return 0; // the heuristic only works when there is exactly one intron
for (i = 0; i < ez->n_cigar; ++i)
if ((ez->cigar[i]&0xf) == KSW_CIGAR_N_SKIP)
ez->cigar[i] += (tlen - tlen2) << 4;
return 1;
}
static inline int mm_get_hplen_back(const mm_idx_t *mi, uint32_t rid, uint32_t x) static inline int mm_get_hplen_back(const mm_idx_t *mi, uint32_t rid, uint32_t x)
{ {
int64_t i, off0 = mi->seq[rid].offset, off = off0 + x; int64_t i, off0 = mi->seq[rid].offset, off = off0 + x;
@@ -601,13 +533,8 @@ static int mm_seed_ext_score(void *km, const mm_mapopt_t *opt, const mm_idx_t *m
re = re + ext_len < (int32_t)mi->seq[rid].len? re + ext_len : mi->seq[rid].len; re = re + ext_len < (int32_t)mi->seq[rid].len? re + ext_len : mi->seq[rid].len;
qe = qe + ext_len < qlen? qe + ext_len : qlen; qe = qe + ext_len < qlen? qe + ext_len : qlen;
tseq = (uint8_t*)kmalloc(km, re - rs); tseq = (uint8_t*)kmalloc(km, re - rs);
if (opt->flag & MM_F_QSTRAND) { mm_idx_getseq(mi, rid, rs, re, tseq);
qseq = qseq0[0] + qs; qseq = qseq0[a->x>>63] + qs;
mm_idx_getseq2(mi, a->x>>63, rid, rs, re, tseq);
} else {
qseq = qseq0[a->x>>63] + qs;
mm_idx_getseq(mi, rid, rs, re, tseq);
}
qp = ksw_ll_qinit(km, 2, qe - qs, qseq, 5, mat); qp = ksw_ll_qinit(km, 2, qe - qs, qseq, 5, mat);
score = ksw_ll_i16(qp, re - rs, tseq, opt->q, opt->e, &q_off, &t_off); score = ksw_ll_i16(qp, re - rs, tseq, opt->q, opt->e, &q_off, &t_off);
kfree(km, tseq); kfree(km, tseq);
@@ -635,19 +562,12 @@ static void mm_fix_bad_ends_splice(void *km, const mm_mapopt_t *opt, const mm_id
} }
} }
static inline void mm_get_junc(const mm_idx_t *mi, int32_t ctg, int32_t st, int32_t en, int32_t rev, uint8_t *junc)
{
if (mi->spsc) mm_idx_spsc_get(mi, ctg, st, en, rev, junc);
else if (mi->I) mm_idx_bed_junc(mi, ctg, st, en, junc);
else memset(junc, 0, en - st);
}
static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, uint8_t *qseq0[2], mm_reg1_t *r, mm_reg1_t *r2, int n_a, mm128_t *a, ksw_extz_t *ez, int splice_flag) static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, uint8_t *qseq0[2], mm_reg1_t *r, mm_reg1_t *r2, int n_a, mm128_t *a, ksw_extz_t *ez, int splice_flag)
{ {
int is_sr = !!(opt->flag & MM_F_SR), is_splice = !!(opt->flag & MM_F_SPLICE), is_sr_rna = (!!(opt->flag & MM_F_SR_RNA) && is_splice); int is_sr = !!(opt->flag & MM_F_SR), is_splice = !!(opt->flag & MM_F_SPLICE);
int32_t rid = a[r->as].x<<1>>33, rev = a[r->as].x>>63, as1, cnt1; int32_t rid = a[r->as].x<<1>>33, rev = a[r->as].x>>63, as1, cnt1;
uint8_t *tseq, *qseq, *junc, *tseq2 = 0, *junc2 = 0; uint8_t *tseq, *qseq, *junc;
int32_t i, l, bw, bw_long, dropped = 0, ksw_flag = 0, rs0, re0, qs0, qe0; int32_t i, l, bw, dropped = 0, extra_flag = 0, rs0, re0, qs0, qe0;
int32_t rs, re, qs, qe; int32_t rs, re, qs, qe;
int32_t rs1, qs1, re1, qe1; int32_t rs1, qs1, re1, qe1;
int8_t mat[25]; int8_t mat[25];
@@ -656,10 +576,8 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
r2->cnt = 0; r2->cnt = 0;
if (r->cnt == 0) return; if (r->cnt == 0) return;
ksw_gen_ts_mat(5, mat, opt->a, opt->b, opt->transition, opt->sc_ambi); ksw_gen_simple_mat(5, mat, opt->a, opt->b, opt->sc_ambi);
bw = (int)(opt->bw * 1.5 + 1.); bw = (int)(opt->bw * 1.5 + 1.);
bw_long = (int)(opt->bw_long * 1.5 + 1.);
if (bw_long < bw) bw_long = bw;
if (is_sr && !(mi->flag & MM_I_HPC)) { if (is_sr && !(mi->flag & MM_I_HPC)) {
mm_max_stretch(r, a, &as1, &cnt1); mm_max_stretch(r, a, &as1, &cnt1);
@@ -682,10 +600,9 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
assert(cnt1 > 0); assert(cnt1 > 0);
if (is_splice) { if (is_splice) {
if (splice_flag & MM_F_SPLICE_FOR) ksw_flag |= rev? KSW_EZ_SPLICE_REV : KSW_EZ_SPLICE_FOR; if (splice_flag & MM_F_SPLICE_FOR) extra_flag |= rev? KSW_EZ_SPLICE_REV : KSW_EZ_SPLICE_FOR;
if (splice_flag & MM_F_SPLICE_REV) ksw_flag |= rev? KSW_EZ_SPLICE_FOR : KSW_EZ_SPLICE_REV; if (splice_flag & MM_F_SPLICE_REV) extra_flag |= rev? KSW_EZ_SPLICE_FOR : KSW_EZ_SPLICE_REV;
if (opt->flag & MM_F_SPLICE_FLANK) ksw_flag |= KSW_EZ_SPLICE_FLANK; if (opt->flag & MM_F_SPLICE_FLANK) extra_flag |= KSW_EZ_SPLICE_FLANK;
if (mi->spsc) ksw_flag |= KSW_EZ_SPLICE_SCORE;
} }
/* Look for the start and end of regions to perform DP. This sounds easy /* Look for the start and end of regions to perform DP. This sounds easy
@@ -770,25 +687,14 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
tseq = (uint8_t*)kmalloc(km, re0 - rs0); tseq = (uint8_t*)kmalloc(km, re0 - rs0);
junc = (uint8_t*)kmalloc(km, re0 - rs0); junc = (uint8_t*)kmalloc(km, re0 - rs0);
if (is_sr_rna) {
int32_t max_tlen2 = MM_MAX_QLEN_FLANK * 2 + opt->q2 * 2;
tseq2 = Kmalloc(km, uint8_t, max_tlen2 * 2);
junc2 = tseq2 + max_tlen2;
}
if (qs > 0 && rs > 0) { // left extension; probably the condition can be changed to "qs > qs0 && rs > rs0" if (qs > 0 && rs > 0) { // left extension; probably the condition can be changed to "qs > qs0 && rs > rs0"
if (opt->flag & MM_F_QSTRAND) { qseq = &qseq0[rev][qs0];
qseq = &qseq0[0][qs0]; mm_idx_getseq(mi, rid, rs0, rs, tseq);
mm_idx_getseq2(mi, rev, rid, rs0, rs, tseq); mm_idx_bed_junc(mi, rid, rs0, rs, junc);
} else {
qseq = &qseq0[rev][qs0];
mm_idx_getseq(mi, rid, rs0, rs, tseq);
}
mm_get_junc(mi, rid, rs0, rs, !!(ksw_flag&KSW_EZ_SPLICE_REV), junc);
mm_seq_rev(qs - qs0, qseq); mm_seq_rev(qs - qs0, qseq);
mm_seq_rev(rs - rs0, tseq); mm_seq_rev(rs - rs0, tseq);
mm_seq_rev(rs - rs0, junc); mm_seq_rev(rs - rs0, junc);
mm_align_pair(km, opt, qs - qs0, qseq, rs - rs0, tseq, junc, mat, bw, opt->end_bonus, r->split_inv? opt->zdrop_inv : opt->zdrop, ksw_flag|KSW_EZ_EXTZ_ONLY|KSW_EZ_RIGHT|KSW_EZ_REV_CIGAR, ez); mm_align_pair(km, opt, qs - qs0, qseq, rs - rs0, tseq, junc, mat, bw, opt->end_bonus, r->split_inv? opt->zdrop_inv : opt->zdrop, extra_flag|KSW_EZ_EXTZ_ONLY|KSW_EZ_RIGHT|KSW_EZ_REV_CIGAR, ez);
if (ez->n_cigar > 0) { if (ez->n_cigar > 0) {
mm_append_cigar(r, ez->n_cigar, ez->cigar); mm_append_cigar(r, ez->n_cigar, ez->cigar);
r->p->dp_score += ez->max; r->p->dp_score += ez->max;
@@ -800,59 +706,39 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
re1 = rs, qe1 = qs; re1 = rs, qe1 = qs;
assert(qs1 >= 0 && rs1 >= 0); assert(qs1 >= 0 && rs1 >= 0);
for (i = is_sr? cnt1 - 1 : 1; i < cnt1; ++i) { // gap filling; for short genomic reads, fill from the first seed to the last for (i = is_sr? cnt1 - 1 : 1; i < cnt1; ++i) { // gap filling
if ((a[as1+i].y & (MM_SEED_IGNORE|MM_SEED_TANDEM)) && i != cnt1 - 1) continue; if ((a[as1+i].y & (MM_SEED_IGNORE|MM_SEED_TANDEM)) && i != cnt1 - 1) continue;
if (is_sr && !(mi->flag & MM_I_HPC)) { if (is_sr && !(mi->flag & MM_I_HPC)) {
re = (int32_t)a[as1 + i].x + 1; re = (int32_t)a[as1 + i].x + 1;
qe = (int32_t)a[as1 + i].y + 1; qe = (int32_t)a[as1 + i].y + 1;
} else mm_adjust_minier(mi, qseq0, &a[as1 + i], &re, &qe); } else mm_adjust_minier(mi, qseq0, &a[as1 + i], &re, &qe);
re1 = re, qe1 = qe; re1 = re, qe1 = qe;
if (i == cnt1 - 1 || (a[as1+i].y&MM_SEED_LONG_JOIN) || (qe - qs >= opt->min_ksw_len && re - rs >= opt->min_ksw_len)) { // gap filling if (i == cnt1 - 1 || (a[as1+i].y&MM_SEED_LONG_JOIN) || (qe - qs >= opt->min_ksw_len && re - rs >= opt->min_ksw_len)) {
int j, bw1 = bw_long, zdrop_code; int j, bw1 = bw, zdrop_code;
if (a[as1+i].y & MM_SEED_LONG_JOIN) if (a[as1+i].y & MM_SEED_LONG_JOIN)
bw1 = qe - qs > re - rs? qe - qs : re - rs; bw1 = qe - qs > re - rs? qe - qs : re - rs;
// perform alignment // perform alignment
if (opt->flag & MM_F_QSTRAND) { qseq = &qseq0[rev][qs];
qseq = &qseq0[0][qs]; mm_idx_getseq(mi, rid, rs, re, tseq);
mm_idx_getseq2(mi, rev, rid, rs, re, tseq); mm_idx_bed_junc(mi, rid, rs, re, junc);
} else { if (is_sr) { // perform ungapped alignment
qseq = &qseq0[rev][qs];
mm_idx_getseq(mi, rid, rs, re, tseq);
}
mm_get_junc(mi, rid, rs, re, !!(ksw_flag&KSW_EZ_SPLICE_REV), junc);
if (is_sr || (is_sr_rna && qe - qs == re - rs)) { // perform ungapped alignment
int32_t max_gapped_score = (qe - qs - 2) * opt->a - 2 * (opt->q + opt->e);
assert(qe - qs == re - rs); assert(qe - qs == re - rs);
ksw_reset_extz(ez); ksw_reset_extz(ez);
for (j = 0, ez->score = 0; j < qe - qs; ++j) { for (j = 0, ez->score = 0; j < qe - qs; ++j) {
if (qseq[j] >= 4 || tseq[j] >= 4) ez->score += opt->sc_ambi > 0? -opt->sc_ambi : opt->sc_ambi; if (qseq[j] >= 4 || tseq[j] >= 4) ez->score += opt->e2;
else ez->score += qseq[j] == tseq[j]? opt->a : -opt->b; else ez->score += qseq[j] == tseq[j]? opt->a : -opt->b;
} }
if (ez->score > max_gapped_score) ez->cigar = ksw_push_cigar(km, &ez->n_cigar, &ez->m_cigar, ez->cigar, 0, qe - qs);
ez->cigar = ksw_push_cigar(km, &ez->n_cigar, &ez->m_cigar, ez->cigar, MM_CIGAR_MATCH, qe - qs);
else
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, junc, mat, bw1, -1, opt->zdrop, ksw_flag|KSW_EZ_APPROX_MAX, ez);
} else { // perform normal gapped alignment } else { // perform normal gapped alignment
int32_t skip_full = 0; mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, junc, mat, bw1, -1, opt->zdrop, extra_flag|KSW_EZ_APPROX_MAX, ez); // first pass: with approximate Z-drop
if (is_sr_rna)
skip_full = mm_align_sr_rna(km, opt, qe - qs, qseq, re - rs, tseq, junc, tseq2, junc2, mat, bw1, -1, opt->zdrop, ksw_flag|KSW_EZ_APPROX_MAX, ez);
if (!skip_full)
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, junc, mat, bw1, -1, opt->zdrop, ksw_flag|KSW_EZ_APPROX_MAX, ez); // first pass: with approximate Z-drop
} }
// test Z-drop and inversion Z-drop // test Z-drop and inversion Z-drop
if ((zdrop_code = mm_test_zdrop(km, opt, qseq, tseq, ez->n_cigar, ez->cigar, mat)) != 0) if ((zdrop_code = mm_test_zdrop(km, opt, qseq, tseq, ez->n_cigar, ez->cigar, mat)) != 0)
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, junc, mat, bw1, -1, zdrop_code == 2? opt->zdrop_inv : opt->zdrop, ksw_flag, ez); // second pass: lift approximate mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, junc, mat, bw1, -1, zdrop_code == 2? opt->zdrop_inv : opt->zdrop, extra_flag, ez); // second pass: lift approximate
// update CIGAR // update CIGAR
if (ez->n_cigar > 0) if (ez->n_cigar > 0)
mm_append_cigar(r, ez->n_cigar, ez->cigar); mm_append_cigar(r, ez->n_cigar, ez->cigar);
if (ez->zdropped) { // truncated by Z-drop; TODO: sometimes Z-drop kicks in because the next seed placement is wrong. This can be fixed in principle. if (ez->zdropped) { // truncated by Z-drop; TODO: sometimes Z-drop kicks in because the next seed placement is wrong. This can be fixed in principle.
if (!r->p) {
assert(ez->n_cigar == 0);
uint32_t capacity = sizeof(mm_extra_t)/4;
kroundup32(capacity);
r->p = (mm_extra_t*)calloc(capacity, 4);
r->p->capacity = capacity;
}
for (j = i - 1; j >= 0; --j) for (j = i - 1; j >= 0; --j)
if ((int32_t)a[as1 + j].x <= rs + ez->max_t) if ((int32_t)a[as1 + j].x <= rs + ez->max_t)
break; break;
@@ -862,7 +748,7 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
re1 = rs + (ez->max_t + 1); re1 = rs + (ez->max_t + 1);
qe1 = qs + (ez->max_q + 1); qe1 = qs + (ez->max_q + 1);
if (cnt1 - (j + 1) >= opt->min_cnt) { if (cnt1 - (j + 1) >= opt->min_cnt) {
mm_split_reg(r, r2, as1 + j + 1 - r->as, qlen, a, !!(opt->flag&MM_F_QSTRAND)); mm_split_reg(r, r2, as1 + j + 1 - r->as, qlen, a);
if (zdrop_code == 2) r2->split_inv = 1; if (zdrop_code == 2) r2->split_inv = 1;
} }
break; break;
@@ -872,15 +758,10 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
} }
if (!dropped && qe < qe0 && re < re0) { // right extension if (!dropped && qe < qe0 && re < re0) { // right extension
if (opt->flag & MM_F_QSTRAND) { qseq = &qseq0[rev][qe];
qseq = &qseq0[0][qe]; mm_idx_getseq(mi, rid, re, re0, tseq);
mm_idx_getseq2(mi, rev, rid, re, re0, tseq); mm_idx_bed_junc(mi, rid, re, re0, junc);
} else { mm_align_pair(km, opt, qe0 - qe, qseq, re0 - re, tseq, junc, mat, bw, opt->end_bonus, opt->zdrop, extra_flag|KSW_EZ_EXTZ_ONLY, ez);
qseq = &qseq0[rev][qe];
mm_idx_getseq(mi, rid, re, re0, tseq);
}
mm_get_junc(mi, rid, re, re0, !!(ksw_flag&KSW_EZ_SPLICE_REV), junc);
mm_align_pair(km, opt, qe0 - qe, qseq, re0 - re, tseq, junc, mat, bw, opt->end_bonus, opt->zdrop, ksw_flag|KSW_EZ_EXTZ_ONLY, ez);
if (ez->n_cigar > 0) { if (ez->n_cigar > 0) {
mm_append_cigar(r, ez->n_cigar, ez->cigar); mm_append_cigar(r, ez->n_cigar, ez->cigar);
r->p->dp_score += ez->max; r->p->dp_score += ez->max;
@@ -891,30 +772,23 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
assert(qe1 <= qlen); assert(qe1 <= qlen);
r->rs = rs1, r->re = re1; r->rs = rs1, r->re = re1;
if (!rev || (opt->flag & MM_F_QSTRAND)) r->qs = qs1, r->qe = qe1; if (rev) r->qs = qlen - qe1, r->qe = qlen - qs1;
else r->qs = qlen - qe1, r->qe = qlen - qs1; else r->qs = qs1, r->qe = qe1;
assert(re1 - rs1 <= re0 - rs0); assert(re1 - rs1 <= re0 - rs0);
if (r->p) { if (r->p) {
if (opt->flag & MM_F_QSTRAND) { mm_idx_getseq(mi, rid, rs1, re1, tseq);
mm_idx_getseq2(mi, r->rev, rid, rs1, re1, tseq); mm_update_extra(r, &qseq0[r->rev][qs1], tseq, mat, opt->q, opt->e, opt->flag & MM_F_EQX);
qseq = &qseq0[0][qs1];
} else {
mm_idx_getseq(mi, rid, rs1, re1, tseq);
qseq = &qseq0[r->rev][qs1];
}
mm_update_extra(r, qseq, tseq, mat, opt->q, opt->e, opt->flag & MM_F_EQX, !(is_sr || is_sr_rna));
if (rev && r->p->trans_strand) if (rev && r->p->trans_strand)
r->p->trans_strand ^= 3; // flip to the read strand r->p->trans_strand ^= 3; // flip to the read strand
} }
if (tseq2) kfree(km, tseq2);
kfree(km, tseq); kfree(km, tseq);
kfree(km, junc); kfree(km, junc);
} }
static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, uint8_t *qseq0[2], const mm_reg1_t *r1, const mm_reg1_t *r2, mm_reg1_t *r_inv, ksw_extz_t *ez) static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, uint8_t *qseq0[2], const mm_reg1_t *r1, const mm_reg1_t *r2, mm_reg1_t *r_inv, ksw_extz_t *ez)
{ // NB: this doesn't work with the qstrand mode {
int tl, ql, score, ret = 0, q_off, t_off; int tl, ql, score, ret = 0, q_off, t_off;
uint8_t *tseq, *qseq; uint8_t *tseq, *qseq;
int8_t mat[25]; int8_t mat[25];
@@ -930,7 +804,7 @@ static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, i
if (ql < opt->min_chain_score || ql > opt->max_gap) return 0; if (ql < opt->min_chain_score || ql > opt->max_gap) return 0;
if (tl < opt->min_chain_score || tl > opt->max_gap) return 0; if (tl < opt->min_chain_score || tl > opt->max_gap) return 0;
ksw_gen_ts_mat(5, mat, opt->a, opt->b, opt->transition, opt->sc_ambi); ksw_gen_simple_mat(5, mat, opt->a, opt->b, opt->sc_ambi);
tseq = (uint8_t*)kmalloc(km, tl); tseq = (uint8_t*)kmalloc(km, tl);
mm_idx_getseq(mi, r1->rid, r1->re, r2->rs, tseq); mm_idx_getseq(mi, r1->rid, r1->re, r2->rs, tseq);
qseq = r1->rev? &qseq0[0][r2->qe] : &qseq0[1][qlen - r2->qs]; qseq = r1->rev? &qseq0[0][r2->qe] : &qseq0[1][qlen - r2->qs];
@@ -963,7 +837,7 @@ static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, i
} }
r_inv->rs = r1->re + t_off; r_inv->rs = r1->re + t_off;
r_inv->re = r_inv->rs + ez->max_t + 1; r_inv->re = r_inv->rs + ez->max_t + 1;
mm_update_extra(r_inv, &qseq[q_off], &tseq[t_off], mat, opt->q, opt->e, opt->flag & MM_F_EQX, !(opt->flag & (MM_F_SR|MM_F_SR_RNA))); mm_update_extra(r_inv, &qseq[q_off], &tseq[t_off], mat, opt->q, opt->e, opt->flag & MM_F_EQX);
ret = 1; ret = 1;
end_align1_inv: end_align1_inv:
kfree(km, tseq); kfree(km, tseq);
@@ -980,71 +854,6 @@ static inline mm_reg1_t *mm_insert_reg(const mm_reg1_t *r, int i, int *n_regs, m
return regs; return regs;
} }
static inline void mm_count_gaps(const mm_reg1_t *r, int32_t *n_gap_, int32_t *n_gapo_)
{
uint32_t i;
int32_t n_gapo = 0, n_gap = 0;
*n_gap_ = *n_gapo_ = -1;
if (r->p == 0) return;
for (i = 0; i < r->p->n_cigar; ++i) {
int32_t op = r->p->cigar[i] & 0xf, len = r->p->cigar[i] >> 4;
if (op == MM_CIGAR_INS || op == MM_CIGAR_DEL)
++n_gapo, n_gap += len;
}
*n_gap_ = n_gap, *n_gapo_ = n_gapo;
}
double mm_event_identity(const mm_reg1_t *r)
{
int32_t n_gap, n_gapo;
if (r->p == 0) return -1.0f;
mm_count_gaps(r, &n_gap, &n_gapo);
return (double)r->mlen / (r->blen + r->p->n_ambi - n_gap + n_gapo);
}
static int32_t mm_recal_max_dp(const mm_reg1_t *r, double b2, int32_t match_sc)
{
uint32_t i;
int32_t n_gap = 0, n_mis;
double gap_cost = 0.0;
if (r->p == 0) return -1;
for (i = 0; i < r->p->n_cigar; ++i) {
int32_t op = r->p->cigar[i] & 0xf, len = r->p->cigar[i] >> 4;
if (op == MM_CIGAR_INS || op == MM_CIGAR_DEL) {
gap_cost += b2 + (double)mg_log2(1.0 + len);
n_gap += len;
}
}
n_mis = r->blen + r->p->n_ambi - r->mlen - n_gap;
return (int32_t)(match_sc * (r->mlen - b2 * n_mis - gap_cost) + .499);
}
void mm_update_dp_max(int qlen, int n_regs, mm_reg1_t *regs, float frac, int a, int b)
{
int32_t max = -1, max2 = -1, i, max_i = -1;
double div, b2;
if (n_regs < 2) return;
for (i = 0; i < n_regs; ++i) {
mm_reg1_t *r = &regs[i];
if (r->p == 0) continue;
if (r->p->dp_max > max) max2 = max, max = r->p->dp_max, max_i = i;
else if (r->p->dp_max > max2) max2 = r->p->dp_max;
}
if (max_i < 0 || max < 0 || max2 < 0) return;
if (regs[max_i].qe - regs[max_i].qs < (double)qlen * frac) return;
if (max2 < (double)max * frac) return;
div = 1. - mm_event_identity(&regs[max_i]);
if (div < 0.02) div = 0.02;
b2 = 0.5 / div; // max value: 25
if (b2 * a < b) b2 = (double)a / b;
for (i = 0; i < n_regs; ++i) {
mm_reg1_t *r = &regs[i];
if (r->p == 0) continue;
r->p->dp_max = mm_recal_max_dp(r, b2, a);
if (r->p->dp_max < 0) r->p->dp_max = 0;
}
}
mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a) mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a)
{ {
extern unsigned char seq_nt4_table[256]; extern unsigned char seq_nt4_table[256];
@@ -1064,43 +873,31 @@ mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *m
n_a = mm_squeeze_a(km, n_regs, regs, a); n_a = mm_squeeze_a(km, n_regs, regs, a);
memset(&ez, 0, sizeof(ksw_extz_t)); memset(&ez, 0, sizeof(ksw_extz_t));
for (i = 0; i < n_regs; ++i) { for (i = 0; i < n_regs; ++i) {
mm_reg1_t r2; // only used for inversion mm_reg1_t r2;
if ((opt->flag&MM_F_SPLICE) && (opt->flag&MM_F_SPLICE_FOR) && (opt->flag&MM_F_SPLICE_REV)) { // then do two rounds of alignments for both strands if ((opt->flag&MM_F_SPLICE) && (opt->flag&MM_F_SPLICE_FOR) && (opt->flag&MM_F_SPLICE_REV)) { // then do two rounds of alignments for both strands
mm_reg1_t s[2], s2[2], *r; mm_reg1_t s[2], s2[2];
int which, trans_strand;
s[0] = s[1] = regs[i]; s[0] = s[1] = regs[i];
mm_align1(km, opt, mi, qlen, qseq0, &s[0], &s2[0], n_a, a, &ez, MM_F_SPLICE_FOR); // assume the transcript is on the + strand of the genome mm_align1(km, opt, mi, qlen, qseq0, &s[0], &s2[0], n_a, a, &ez, MM_F_SPLICE_FOR);
if ((opt->flag&MM_F_SR_RNA) && regs[i].qe - regs[i].qs == regs[i].re - regs[i].rs && s[0].qe - s[0].qs == s[0].re - s[0].rs && s[0].qs == 0 && s[0].qe == qlen) { mm_align1(km, opt, mi, qlen, qseq0, &s[1], &s2[1], n_a, a, &ez, MM_F_SPLICE_REV);
if (s[0].p->dp_score > s[1].p->dp_score) which = 0, trans_strand = 1;
else if (s[0].p->dp_score < s[1].p->dp_score) which = 1, trans_strand = 2;
else trans_strand = 3, which = (qlen + s[0].p->dp_score) & 1; // randomly choose a strand, effectively
if (which == 0) {
regs[i] = s[0], r2 = s2[0]; regs[i] = s[0], r2 = s2[0];
regs[i].p->trans_strand = 0; free(s[1].p);
} else { } else {
int which, trans_strand; regs[i] = s[1], r2 = s2[1];
mm_align1(km, opt, mi, qlen, qseq0, &s[1], &s2[1], n_a, a, &ez, MM_F_SPLICE_REV); // assume the transcript on the - strand free(s[0].p);
if (s[0].p->dp_score > s[1].p->dp_score) which = 0, trans_strand = 1;
else if (s[0].p->dp_score < s[1].p->dp_score) which = 1, trans_strand = 2;
else trans_strand = 3, which = (qlen + s[0].p->dp_score) & 1; // randomly choose a strand, effectively
if (which == 0) {
regs[i] = s[0], r2 = s2[0];
free(s[1].p);
} else {
regs[i] = s[1], r2 = s2[1];
free(s[0].p);
}
r = &regs[i];
r->p->trans_strand = trans_strand;
if (r->is_spliced) {
if (trans_strand == 1 || trans_strand == 2) // this is an *approximate* way to tell if there are splice signals.
r->p->dp_max += (opt->a + opt->b) + ((opt->a + opt->b) >> 1);
else if (trans_strand == 3)
r->p->dp_max -= opt->a + opt->b;
}
} }
regs[i].p->trans_strand = trans_strand;
} else { // one round of alignment } else { // one round of alignment
mm_align1(km, opt, mi, qlen, qseq0, &regs[i], &r2, n_a, a, &ez, opt->flag); mm_align1(km, opt, mi, qlen, qseq0, &regs[i], &r2, n_a, a, &ez, opt->flag);
if (opt->flag&MM_F_SPLICE) if (opt->flag&MM_F_SPLICE)
regs[i].p->trans_strand = opt->flag&MM_F_SPLICE_FOR? 1 : 2; regs[i].p->trans_strand = opt->flag&MM_F_SPLICE_FOR? 1 : 2;
} }
if (r2.cnt > 0) regs = mm_insert_reg(&r2, i, &n_regs, regs); if (r2.cnt > 0) regs = mm_insert_reg(&r2, i, &n_regs, regs);
if (i > 0 && regs[i].split_inv && !(opt->flag & MM_F_NO_INV)) { if (i > 0 && regs[i].split_inv) {
if (mm_align1_inv(km, opt, mi, qlen, qseq0, &regs[i-1], &regs[i], &r2, &ez)) { if (mm_align1_inv(km, opt, mi, qlen, qseq0, &regs[i-1], &regs[i], &r2, &ez)) {
regs = mm_insert_reg(&r2, i, &n_regs, regs); regs = mm_insert_reg(&r2, i, &n_regs, regs);
++i; // skip the inserted INV alignment ++i; // skip the inserted INV alignment
@@ -1111,10 +908,6 @@ mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *m
kfree(km, qseq0[0]); kfree(km, qseq0[0]);
kfree(km, ez.cigar); kfree(km, ez.cigar);
mm_filter_regs(opt, qlen, n_regs_, regs); mm_filter_regs(opt, qlen, n_regs_, regs);
if (!(opt->flag&(MM_F_SR|MM_F_SR_RNA|MM_F_ALL_CHAINS)) && !opt->split_prefix && qlen >= opt->rank_min_len) { mm_hit_sort(km, n_regs_, regs);
mm_update_dp_max(qlen, *n_regs_, regs, opt->rank_frac, opt->a, opt->b);
mm_filter_regs(opt, qlen, n_regs_, regs);
}
mm_hit_sort(km, n_regs_, regs, opt->alt_drop);
return regs; return regs;
} }
+8 -10
View File
@@ -77,7 +77,7 @@ static inline void kseq2bseq(kseq_t *ks, mm_bseq1_t *s, int with_qual, int with_
s->l_seq = ks->seq.l; s->l_seq = ks->seq.l;
} }
mm_bseq1_t *mm_bseq_read3(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int with_comment, int frag_mode, int *n_) mm_bseq1_t *mm_bseq_read3(mm_bseq_file_t *fp, int chunk_size, int with_qual, int with_comment, int frag_mode, int *n_)
{ {
int64_t size = 0; int64_t size = 0;
int ret; int ret;
@@ -99,7 +99,7 @@ mm_bseq1_t *mm_bseq_read3(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual,
size += s->l_seq; size += s->l_seq;
if (size >= chunk_size) { if (size >= chunk_size) {
if (frag_mode && a.a[a.n-1].l_seq < CHECK_PAIR_THRES) { if (frag_mode && a.a[a.n-1].l_seq < CHECK_PAIR_THRES) {
while ((ret = kseq_read(ks)) >= 0) { while (kseq_read(ks) >= 0) {
kseq2bseq(ks, &fp->s, with_qual, with_comment); kseq2bseq(ks, &fp->s, with_qual, with_comment);
if (mm_qname_same(fp->s.name, a.a[a.n-1].name)) { if (mm_qname_same(fp->s.name, a.a[a.n-1].name)) {
kv_push(mm_bseq1_t, 0, a, fp->s); kv_push(mm_bseq1_t, 0, a, fp->s);
@@ -110,25 +110,23 @@ mm_bseq1_t *mm_bseq_read3(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual,
break; break;
} }
} }
if (ret < -1) { if (ret < -1)
if (a.n) fprintf(stderr, "[WARNING]\033[1;31m failed to parse the FASTA/FASTQ record next to '%s'. Continue anyway.\033[0m\n", a.a[a.n-1].name); fprintf(stderr, "[WARNING]\033[1;31m wrong FASTA/FASTQ record. Continue anyway.\033[0m\n");
else fprintf(stderr, "[WARNING]\033[1;31m failed to parse the first FASTA/FASTQ record. Continue anyway.\033[0m\n");
}
*n_ = a.n; *n_ = a.n;
return a.a; return a.a;
} }
mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int frag_mode, int *n_) mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int frag_mode, int *n_)
{ {
return mm_bseq_read3(fp, chunk_size, with_qual, 0, frag_mode, n_); return mm_bseq_read3(fp, chunk_size, with_qual, 0, frag_mode, n_);
} }
mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int *n_) mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int chunk_size, int with_qual, int *n_)
{ {
return mm_bseq_read2(fp, chunk_size, with_qual, 0, n_); return mm_bseq_read2(fp, chunk_size, with_qual, 0, n_);
} }
mm_bseq1_t *mm_bseq_read_frag2(int n_fp, mm_bseq_file_t **fp, int64_t chunk_size, int with_qual, int with_comment, int *n_) mm_bseq1_t *mm_bseq_read_frag2(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int with_comment, int *n_)
{ {
int i; int i;
int64_t size = 0; int64_t size = 0;
@@ -158,7 +156,7 @@ mm_bseq1_t *mm_bseq_read_frag2(int n_fp, mm_bseq_file_t **fp, int64_t chunk_size
return a.a; return a.a;
} }
mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int64_t chunk_size, int with_qual, int *n_) mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int *n_)
{ {
return mm_bseq_read_frag2(n_fp, fp, chunk_size, with_qual, 0, n_); return mm_bseq_read_frag2(n_fp, fp, chunk_size, with_qual, 0, n_);
} }
+5 -5
View File
@@ -18,11 +18,11 @@ typedef struct {
mm_bseq_file_t *mm_bseq_open(const char *fn); mm_bseq_file_t *mm_bseq_open(const char *fn);
void mm_bseq_close(mm_bseq_file_t *fp); void mm_bseq_close(mm_bseq_file_t *fp);
mm_bseq1_t *mm_bseq_read3(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int with_comment, int frag_mode, int *n_); mm_bseq1_t *mm_bseq_read3(mm_bseq_file_t *fp, int chunk_size, int with_qual, int with_comment, int frag_mode, int *n_);
mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int frag_mode, int *n_); mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int frag_mode, int *n_);
mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int *n_); mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int chunk_size, int with_qual, int *n_);
mm_bseq1_t *mm_bseq_read_frag2(int n_fp, mm_bseq_file_t **fp, int64_t chunk_size, int with_qual, int with_comment, int *n_); mm_bseq1_t *mm_bseq_read_frag2(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int with_comment, int *n_);
mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int64_t chunk_size, int with_qual, int *n_); mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int *n_);
int mm_bseq_eof(mm_bseq_file_t *fp); int mm_bseq_eof(mm_bseq_file_t *fp);
extern unsigned char seq_nt4_table[256]; extern unsigned char seq_nt4_table[256];
+162
View File
@@ -0,0 +1,162 @@
#include <stdint.h>
#include <string.h>
#include <stdio.h>
#include "minimap.h"
#include "mmpriv.h"
#include "kalloc.h"
static const char LogTable256[256] = {
#define LT(n) n, n, n, n, n, n, n, n, n, n, n, n, n, n, n, n
-1, 0, 1, 1, 2, 2, 2, 2, 3, 3, 3, 3, 3, 3, 3, 3,
LT(4), LT(5), LT(5), LT(6), LT(6), LT(6), LT(6),
LT(7), LT(7), LT(7), LT(7), LT(7), LT(7), LT(7), LT(7)
};
static inline int ilog2_32(uint32_t v)
{
uint32_t t, tt;
if ((tt = v>>16)) return (t = tt>>8) ? 24 + LogTable256[t] : 16 + LogTable256[tt];
return (t = v>>8) ? 8 + LogTable256[t] : LogTable256[v];
}
mm128_t *mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int max_iter, int min_cnt, int min_sc, int is_cdna, int n_segs, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km)
{ // TODO: make sure this works when n has more than 32 bits
int32_t k, *f, *p, *t, *v, n_u, n_v;
int64_t i, j, st = 0;
uint64_t *u, *u2, sum_qspan = 0;
float avg_qspan;
mm128_t *b, *w;
if (_u) *_u = 0, *n_u_ = 0;
if (n == 0 || a == 0) {
kfree(km, a);
return 0;
}
f = (int32_t*)kmalloc(km, n * 4);
p = (int32_t*)kmalloc(km, n * 4);
t = (int32_t*)kmalloc(km, n * 4);
v = (int32_t*)kmalloc(km, n * 4);
memset(t, 0, n * 4);
for (i = 0; i < n; ++i) sum_qspan += a[i].y>>32&0xff;
avg_qspan = (float)sum_qspan / n;
// fill the score and backtrack arrays
for (i = 0; i < n; ++i) {
uint64_t ri = a[i].x;
int64_t max_j = -1;
int32_t qi = (int32_t)a[i].y, q_span = a[i].y>>32&0xff; // NB: only 8 bits of span is used!!!
int32_t max_f = q_span, n_skip = 0, min_d;
int32_t sidi = (a[i].y & MM_SEED_SEG_MASK) >> MM_SEED_SEG_SHIFT;
while (st < i && ri > a[st].x + max_dist_x) ++st;
if (i - st > max_iter) st = i - max_iter;
for (j = i - 1; j >= st; --j) {
int64_t dr = ri - a[j].x;
int32_t dq = qi - (int32_t)a[j].y, dd, sc, log_dd;
int32_t sidj = (a[j].y & MM_SEED_SEG_MASK) >> MM_SEED_SEG_SHIFT;
if ((sidi == sidj && dr == 0) || dq <= 0) continue; // don't skip if an anchor is used by multiple segments; see below
if ((sidi == sidj && dq > max_dist_y) || dq > max_dist_x) continue;
dd = dr > dq? dr - dq : dq - dr;
if (sidi == sidj && dd > bw) continue;
if (n_segs > 1 && !is_cdna && sidi == sidj && dr > max_dist_y) continue;
min_d = dq < dr? dq : dr;
sc = min_d > q_span? q_span : dq < dr? dq : dr;
log_dd = dd? ilog2_32(dd) : 0;
if (is_cdna || sidi != sidj) {
int c_log, c_lin;
c_lin = (int)(dd * .01 * avg_qspan);
c_log = log_dd;
if (sidi != sidj && dr == 0) ++sc; // possibly due to overlapping paired ends; give a minor bonus
else if (dr > dq || sidi != sidj) sc -= c_lin < c_log? c_lin : c_log;
else sc -= c_lin + (c_log>>1);
} else sc -= (int)(dd * .01 * avg_qspan) + (log_dd>>1);
sc += f[j];
if (sc > max_f) {
max_f = sc, max_j = j;
if (n_skip > 0) --n_skip;
} else if (t[j] == i) {
if (++n_skip > max_skip)
break;
}
if (p[j] >= 0) t[p[j]] = i;
}
f[i] = max_f, p[i] = max_j;
v[i] = max_j >= 0 && v[max_j] > max_f? v[max_j] : max_f; // v[] keeps the peak score up to i; f[] is the score ending at i, not always the peak
}
// find the ending positions of chains
memset(t, 0, n * 4);
for (i = 0; i < n; ++i)
if (p[i] >= 0) t[p[i]] = 1;
for (i = n_u = 0; i < n; ++i)
if (t[i] == 0 && v[i] >= min_sc)
++n_u;
if (n_u == 0) {
kfree(km, a); kfree(km, f); kfree(km, p); kfree(km, t); kfree(km, v);
return 0;
}
u = (uint64_t*)kmalloc(km, n_u * 8);
for (i = n_u = 0; i < n; ++i) {
if (t[i] == 0 && v[i] >= min_sc) {
j = i;
while (j >= 0 && f[j] < v[j]) j = p[j]; // find the peak that maximizes f[]
if (j < 0) j = i; // TODO: this should really be assert(j>=0)
u[n_u++] = (uint64_t)f[j] << 32 | j;
}
}
radix_sort_64(u, u + n_u);
for (i = 0; i < n_u>>1; ++i) { // reverse, s.t. the highest scoring chain is the first
uint64_t t = u[i];
u[i] = u[n_u - i - 1], u[n_u - i - 1] = t;
}
// backtrack
memset(t, 0, n * 4);
for (i = n_v = k = 0; i < n_u; ++i) { // starting from the highest score
int32_t n_v0 = n_v, k0 = k;
j = (int32_t)u[i];
do {
v[n_v++] = j;
t[j] = 1;
j = p[j];
} while (j >= 0 && t[j] == 0);
if (j < 0) {
if (n_v - n_v0 >= min_cnt) u[k++] = u[i]>>32<<32 | (n_v - n_v0);
} else if ((int32_t)(u[i]>>32) - f[j] >= min_sc) {
if (n_v - n_v0 >= min_cnt) u[k++] = ((u[i]>>32) - f[j]) << 32 | (n_v - n_v0);
}
if (k0 == k) n_v = n_v0; // no new chain added, reset
}
*n_u_ = n_u = k, *_u = u; // NB: note that u[] may not be sorted by score here
// free temporary arrays
kfree(km, f); kfree(km, p); kfree(km, t);
// write the result to b[]
b = (mm128_t*)kmalloc(km, n_v * sizeof(mm128_t));
for (i = 0, k = 0; i < n_u; ++i) {
int32_t k0 = k, ni = (int32_t)u[i];
for (j = 0; j < ni; ++j)
b[k] = a[v[k0 + (ni - j - 1)]], ++k;
}
kfree(km, v);
// sort u[] and a[] by a[].x, such that adjacent chains may be joined (required by mm_join_long)
w = (mm128_t*)kmalloc(km, n_u * sizeof(mm128_t));
for (i = k = 0; i < n_u; ++i) {
w[i].x = b[k].x, w[i].y = (uint64_t)k<<32|i;
k += (int32_t)u[i];
}
radix_sort_128x(w, w + n_u);
u2 = (uint64_t*)kmalloc(km, n_u * 8);
for (i = k = 0; i < n_u; ++i) {
int32_t j = (int32_t)w[i].y, n = (int32_t)u[j];
u2[i] = u[j];
memcpy(&a[k], &b[w[i].y>>32], n * sizeof(mm128_t));
k += n;
}
if (n_u) memcpy(u, u2, n_u * 8);
if (k) memcpy(b, a, k * sizeof(mm128_t)); // write _a_ to _b_ and deallocate _a_ because _a_ is oversized, sometimes a lot
kfree(km, a); kfree(km, w); kfree(km, u2);
return b;
}
-30
View File
@@ -1,30 +0,0 @@
## Contributor Code of Conduct
As contributors and maintainers of this project, we pledge to respect all
people who contribute through reporting issues, posting feature requests,
updating documentation, submitting pull requests or patches, and other
activities.
We are committed to making participation in this project a harassment-free
experience for everyone, regardless of level of experience, gender, gender
identity and expression, sexual orientation, disability, personal appearance,
body size, race, age, or religion.
Examples of unacceptable behavior by participants include the use of sexual
language or imagery, derogatory comments or personal attacks, trolling, public
or private harassment, insults, or other unprofessional conduct.
Project maintainers have the right and responsibility to remove, edit, or
reject comments, commits, code, wiki edits, issues, and other contributions
that are not aligned to this Code of Conduct. Project maintainers or
contributors who do not follow the Code of Conduct may be removed from the
project team.
Instances of abusive, harassing, or otherwise unacceptable behavior may be
reported by opening an issue or contacting the maintainer via email.
This Code of Conduct is adapted from the [Contributor Covenant][cc], [version
1.0.0][v1].
[cc]: http://contributor-covenant.org/
[v1]: http://contributor-covenant.org/version/1/0/0/
+6 -6
View File
@@ -31,8 +31,8 @@ To acquire the data used in this cookbook and to install minimap2 and paftools,
please follow the command lines below: please follow the command lines below:
```sh ```sh
# install minimap2 executables # install minimap2 executables
curl -L https://github.com/lh3/minimap2/releases/download/v2.31/minimap2-2.31_x64-linux.tar.bz2 | tar jxf - curl -L https://github.com/lh3/minimap2/releases/download/v2.17/minimap2-2.17_x64-linux.tar.bz2 | tar jxf -
cp minimap2-2.31_x64-linux/{minimap2,k8,paftools.js} . # copy executables cp minimap2-2.17_x64-linux/{minimap2,k8,paftools.js} . # copy executables
export PATH="$PATH:"`pwd` # put the current directory on PATH export PATH="$PATH:"`pwd` # put the current directory on PATH
# download example datasets # download example datasets
curl -L https://github.com/lh3/minimap2/releases/download/v2.10/cookbook-data.tgz | tar zxf - curl -L https://github.com/lh3/minimap2/releases/download/v2.10/cookbook-data.tgz | tar zxf -
@@ -80,12 +80,12 @@ where a `U`-line gives the number of unmapped reads (for SAM input only); a
5. Accumulative number of mappings 5. Accumulative number of mappings
For `paftools.js mapeval` to work, you need to encode the true read positions For `paftools.js mapeval` to work, you need to encode the true read positions
in read names in the right format. For [pbsim2][pbsim] and [mason2][mason2], we in read names in the right format. For [PBSIM][pbsim] and [mason2][mason2], we
provide scripts to generate the right format. Simulated reads in this cookbook provide scripts to generate the right format. Simulated reads in this cookbook
were created with the following command lines: were created with the following command lines:
```sh ```sh
# in the pbsim2 source code directory: # in PBSIM source code directory:
src/pbsim --depth 1 --length-min 5000 --length-mean 20000 --accuracy-mean 0.95 --hmm_model data/R94.model ../ecoli_ref.fa src/pbsim ../ecoli_ref.fa --depth 1 --sample-fastq sample/sample.fastq
paftools.js pbsim2fq ../ecoli_ref.fa.fai sd_0001.maf > ../ecoli_pbsim.fa paftools.js pbsim2fq ../ecoli_ref.fa.fai sd_0001.maf > ../ecoli_pbsim.fa
# mason2 simulation # mason2 simulation
@@ -237,7 +237,7 @@ with `-x ava-pb` (99% vs 93% with `-x ava-ont`).
[pbsim]: https://github.com/yukiteruono/pbsim2 [pbsim]: https://github.com/pfaucon/PBSIM-PacBio-Simulator
[mason2]: https://github.com/seqan/seqan/tree/master/apps/mason2 [mason2]: https://github.com/seqan/seqan/tree/master/apps/mason2
[paf]: https://github.com/lh3/miniasm/blob/master/PAF.md [paf]: https://github.com/lh3/miniasm/blob/master/PAF.md
[v2.10]: https://github.com/lh3/minimap2/releases/tag/v2.10 [v2.10]: https://github.com/lh3/minimap2/releases/tag/v2.10
+1 -1
View File
@@ -59,6 +59,6 @@ void mm_est_err(const mm_idx_t *mi, int qlen, int n_regs, mm_reg1_t *regs, const
n_tot = en - st + 1; n_tot = en - st + 1;
if (r->qs > avg_k && r->rs > avg_k) ++n_tot; if (r->qs > avg_k && r->rs > avg_k) ++n_tot;
if (qlen - r->qs > avg_k && l_ref - r->re > avg_k) ++n_tot; if (qlen - r->qs > avg_k && l_ref - r->re > avg_k) ++n_tot;
r->div = n_match >= n_tot? 0.0f : (float)(1.0 - pow((double)n_match / n_tot, 1.0 / avg_k)); r->div = logf((float)n_tot / n_match) / avg_k;
} }
} }
+1 -3
View File
@@ -35,8 +35,6 @@ int main(int argc, char *argv[])
while ((mi = mm_idx_reader_read(r, n_threads)) != 0) { // traverse each part of the index while ((mi = mm_idx_reader_read(r, n_threads)) != 0) { // traverse each part of the index
mm_mapopt_update(&mopt, mi); // this sets the maximum minimizer occurrence; TODO: set a better default in mm_mapopt_init()! mm_mapopt_update(&mopt, mi); // this sets the maximum minimizer occurrence; TODO: set a better default in mm_mapopt_init()!
mm_tbuf_t *tbuf = mm_tbuf_init(); // thread buffer; for multi-threading, allocate one tbuf for each thread mm_tbuf_t *tbuf = mm_tbuf_init(); // thread buffer; for multi-threading, allocate one tbuf for each thread
gzrewind(f);
kseq_rewind(ks);
while (kseq_read(ks) >= 0) { // each kseq_read() call reads one query sequence while (kseq_read(ks) >= 0) { // each kseq_read() call reads one query sequence
mm_reg1_t *reg; mm_reg1_t *reg;
int j, i, n_reg; int j, i, n_reg;
@@ -47,7 +45,7 @@ int main(int argc, char *argv[])
printf("%s\t%d\t%d\t%d\t%c\t", ks->name.s, ks->seq.l, r->qs, r->qe, "+-"[r->rev]); printf("%s\t%d\t%d\t%d\t%c\t", ks->name.s, ks->seq.l, r->qs, r->qe, "+-"[r->rev]);
printf("%s\t%d\t%d\t%d\t%d\t%d\t%d\tcg:Z:", mi->seq[r->rid].name, mi->seq[r->rid].len, r->rs, r->re, r->mlen, r->blen, r->mapq); printf("%s\t%d\t%d\t%d\t%d\t%d\t%d\tcg:Z:", mi->seq[r->rid].name, mi->seq[r->rid].len, r->rs, r->re, r->mlen, r->blen, r->mapq);
for (i = 0; i < r->p->n_cigar; ++i) // IMPORTANT: this gives the CIGAR in the aligned regions. NO soft/hard clippings! for (i = 0; i < r->p->n_cigar; ++i) // IMPORTANT: this gives the CIGAR in the aligned regions. NO soft/hard clippings!
printf("%d%c", r->p->cigar[i]>>4, MM_CIGAR_STR[r->p->cigar[i]&0xf]); printf("%d%c", r->p->cigar[i]>>4, "MIDNSH"[r->p->cigar[i]&0xf]);
putchar('\n'); putchar('\n');
free(r->p); free(r->p);
} }
+66 -201
View File
@@ -79,11 +79,11 @@ static char *mm_escape(char *s)
return s; return s;
} }
static int sam_write_rg_line(kstring_t *str, const char *s) static void sam_write_rg_line(kstring_t *str, const char *s)
{ {
char *p, *q, *r, *rg_line = 0; char *p, *q, *r, *rg_line = 0;
memset(mm_rg_id, 0, 256); memset(mm_rg_id, 0, 256);
if (s == 0) return 0; if (s == 0) return;
if (strstr(s, "@RG") != s) { if (strstr(s, "@RG") != s) {
if (mm_verbose >= 1) fprintf(stderr, "[ERROR] the read group line is not started with @RG\n"); if (mm_verbose >= 1) fprintf(stderr, "[ERROR] the read group line is not started with @RG\n");
goto err_set_rg; goto err_set_rg;
@@ -108,24 +108,20 @@ static int sam_write_rg_line(kstring_t *str, const char *s)
for (q = p, r = mm_rg_id; *q && *q != '\t' && *q != '\n'; ++q) for (q = p, r = mm_rg_id; *q && *q != '\t' && *q != '\n'; ++q)
*r++ = *q; *r++ = *q;
mm_sprintf_lite(str, "%s\n", rg_line); mm_sprintf_lite(str, "%s\n", rg_line);
return 0;
err_set_rg: err_set_rg:
free(rg_line); free(rg_line);
return -1;
} }
int mm_write_sam_hdr(const mm_idx_t *idx, const char *rg, const char *ver, int argc, char *argv[]) void mm_write_sam_hdr(const mm_idx_t *idx, const char *rg, const char *ver, int argc, char *argv[])
{ {
kstring_t str = {0,0,0}; kstring_t str = {0,0,0};
int ret = 0;
mm_sprintf_lite(&str, "@HD\tVN:1.6\tSO:unsorted\tGO:query\n");
if (idx) { if (idx) {
uint32_t i; uint32_t i;
for (i = 0; i < idx->n_seq; ++i) for (i = 0; i < idx->n_seq; ++i)
mm_sprintf_lite(&str, "@SQ\tSN:%s\tLN:%d\n", idx->seq[i].name, idx->seq[i].len); mm_sprintf_lite(&str, "@SQ\tSN:%s\tLN:%d\n", idx->seq[i].name, idx->seq[i].len);
} }
if (rg) ret = sam_write_rg_line(&str, rg); if (rg) sam_write_rg_line(&str, rg);
mm_sprintf_lite(&str, "@PG\tID:minimap2\tPN:minimap2"); mm_sprintf_lite(&str, "@PG\tID:minimap2\tPN:minimap2");
if (ver) mm_sprintf_lite(&str, "\tVN:%s", ver); if (ver) mm_sprintf_lite(&str, "\tVN:%s", ver);
if (argc > 1) { if (argc > 1) {
@@ -136,55 +132,16 @@ int mm_write_sam_hdr(const mm_idx_t *idx, const char *rg, const char *ver, int a
} }
mm_err_puts(str.s); mm_err_puts(str.s);
free(str.s); free(str.s);
return ret;
} }
static void write_indel_ds(kstring_t *str, int64_t len, const uint8_t *seq, int64_t ll, int64_t lr) // write an indel to ds; adapted from minigraph static void write_cs_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq, const mm_reg1_t *r, char *tmp, int no_iden, int write_tag)
{ {
int64_t i; int i, q_off, t_off;
if (ll + lr >= len) { if (write_tag) mm_sprintf_lite(s, "\tcs:Z:");
mm_sprintf_lite(str, "[");
for (i = 0; i < len; ++i)
mm_sprintf_lite(str, "%c", "acgtn"[seq[i]]);
mm_sprintf_lite(str, "]");
} else {
int64_t k = 0;
if (ll > 0) {
mm_sprintf_lite(str, "[");
for (i = 0; i < ll; ++i)
mm_sprintf_lite(str, "%c", "acgtn"[seq[k+i]]);
mm_sprintf_lite(str, "]");
k += ll;
}
for (i = 0; i < len - lr - ll; ++i)
mm_sprintf_lite(str, "%c", "acgtn"[seq[k+i]]);
k += len - lr - ll;
if (lr > 0) {
mm_sprintf_lite(str, "[");
for (i = 0; i < lr; ++i)
mm_sprintf_lite(str, "%c", "acgtn"[seq[k+i]]);
mm_sprintf_lite(str, "]");
}
}
}
static void write_cs_ds_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq, const mm_reg1_t *r, char *tmp, int no_iden, int is_ds, int write_tag)
{
int i, q_off, t_off, q_len = 0, t_len = 0;
if (write_tag) mm_sprintf_lite(s, "\t%cs:Z:", is_ds? 'd' : 'c');
for (i = 0; i < (int)r->p->n_cigar; ++i) {
int op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
if (op == MM_CIGAR_MATCH || op == MM_CIGAR_EQ_MATCH || op == MM_CIGAR_X_MISMATCH)
q_len += len, t_len += len;
else if (op == MM_CIGAR_INS)
q_len += len;
else if (op == MM_CIGAR_DEL || op == MM_CIGAR_N_SKIP)
t_len += len;
}
for (i = q_off = t_off = 0; i < (int)r->p->n_cigar; ++i) { for (i = q_off = t_off = 0; i < (int)r->p->n_cigar; ++i) {
int j, op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4; int j, op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
assert((op >= MM_CIGAR_MATCH && op <= MM_CIGAR_N_SKIP) || op == MM_CIGAR_EQ_MATCH || op == MM_CIGAR_X_MISMATCH); assert((op >= 0 && op <= 3) || op == 7 || op == 8);
if (op == MM_CIGAR_MATCH || op == MM_CIGAR_EQ_MATCH || op == MM_CIGAR_X_MISMATCH) { if (op == 0 || op == 7 || op == 8) { // match
int l_tmp = 0; int l_tmp = 0;
for (j = 0; j < len; ++j) { for (j = 0; j < len; ++j) {
if (qseq[q_off + j] != tseq[t_off + j]) { if (qseq[q_off + j] != tseq[t_off + j]) {
@@ -205,43 +162,15 @@ static void write_cs_ds_core(kstring_t *s, const uint8_t *tseq, const uint8_t *q
} else mm_sprintf_lite(s, ":%d", l_tmp); } else mm_sprintf_lite(s, ":%d", l_tmp);
} }
q_off += len, t_off += len; q_off += len, t_off += len;
} else if (op == MM_CIGAR_INS) { } else if (op == 1) { // insertion to ref
if (is_ds) { for (j = 0, tmp[len] = 0; j < len; ++j)
int z, ll, lr, y = q_off; tmp[j] = "acgtn"[qseq[q_off + j]];
for (z = 1; z <= len; ++z) mm_sprintf_lite(s, "+%s", tmp);
if (y - z < 0 || qseq[y + len - z] != qseq[y - z])
break;
lr = z - 1;
for (z = 0; z < len; ++z)
if (y + len + z >= q_len || qseq[y + len + z] != qseq[y + z])
break;
ll = z;
mm_sprintf_lite(s, "+");
write_indel_ds(s, len, &qseq[y], ll, lr);
} else {
for (j = 0, tmp[len] = 0; j < len; ++j)
tmp[j] = "acgtn"[qseq[q_off + j]];
mm_sprintf_lite(s, "+%s", tmp);
}
q_off += len; q_off += len;
} else if (op == MM_CIGAR_DEL) { } else if (op == 2) { // deletion from ref
if (is_ds) { for (j = 0, tmp[len] = 0; j < len; ++j)
int z, ll, lr, x = t_off; tmp[j] = "acgtn"[tseq[t_off + j]];
for (z = 1; z <= len; ++z) mm_sprintf_lite(s, "-%s", tmp);
if (x - z < 0 || tseq[x + len - z] != tseq[x - z])
break;
lr = z - 1;
for (z = 0; z < len; ++z)
if (x + len + z >= t_len || tseq[x + z] != tseq[x + len + z])
break;
ll = z;
mm_sprintf_lite(s, "-");
write_indel_ds(s, len, &tseq[x], ll, lr);
} else {
for (j = 0, tmp[len] = 0; j < len; ++j)
tmp[j] = "acgtn"[tseq[t_off + j]];
mm_sprintf_lite(s, "-%s", tmp);
}
t_off += len; t_off += len;
} else { // intron } else { // intron
assert(len >= 2); assert(len >= 2);
@@ -253,60 +182,14 @@ static void write_cs_ds_core(kstring_t *s, const uint8_t *tseq, const uint8_t *q
assert(t_off == r->re - r->rs && q_off == r->qe - r->qs); assert(t_off == r->re - r->rs && q_off == r->qe - r->qs);
} }
static inline void revcomp_splice(uint8_t s[2])
{
uint8_t c = s[1] < 4? 3 - s[1] : 4;
s[1] = s[0] < 4? 3 - s[0] : 4;
s[0] = c;
}
void mm_write_junc(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r)
{
int32_t i, t_off, swritten = 0;
s->l = 0;
if (!r->is_spliced || r->p == 0) return; // no junctions
if (r->p->trans_strand != 1 && r->p->trans_strand != 2) return; // no preferred strand
for (i = 0, t_off = r->rs; i < (int)r->p->n_cigar; ++i) {
int op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
if (op == MM_CIGAR_MATCH || op == MM_CIGAR_EQ_MATCH || op == MM_CIGAR_X_MISMATCH || op == MM_CIGAR_DEL) {
t_off += len;
} else if (op == MM_CIGAR_N_SKIP) { // intron
uint8_t donor[2], acceptor[2];
int32_t score1 = 0, score2 = 0, rev;
assert(len >= 2);
rev = (r->p->trans_strand == 2) ^ r->rev;
if (!rev) {
mm_idx_getseq(mi, r->rid, t_off, t_off + 2, donor);
mm_idx_getseq(mi, r->rid, t_off + len - 2, t_off + len, acceptor);
} else {
mm_idx_getseq(mi, r->rid, t_off, t_off + 2, acceptor);
mm_idx_getseq(mi, r->rid, t_off + len - 2, t_off + len, donor);
revcomp_splice(donor);
revcomp_splice(acceptor);
}
//fprintf(stderr, "%c%c-%c%c\n", "ACGTN"[donor[0]], "ACGTN"[donor[1]], "ACGTN"[acceptor[0]], "ACGTN"[acceptor[1]]);
if (donor[0] == 2 && donor[1] == 3) score1 = 3;
else if (donor[0] == 2 && donor[1] == 1) score1 = 2;
else if (donor[0] == 0 && donor[1] == 3) score1 = 1;
if (acceptor[0] == 0 && acceptor[1] == 2) score2 = 3;
else if (acceptor[0] == 0 && acceptor[1] == 1) score2 = 1;
if (swritten) mm_sprintf_lite(s, "\n");
else swritten = 1;
mm_sprintf_lite(s, "%s\t%d\t%d\t%s\t%d\t%c", mi->seq[r->rid].name, t_off, t_off + len, t->name, score1 + score2, "+-"[rev]);
t_off += len;
}
}
assert(t_off == r->re);
}
static void write_MD_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq, const mm_reg1_t *r, char *tmp, int write_tag) static void write_MD_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq, const mm_reg1_t *r, char *tmp, int write_tag)
{ {
int i, q_off, t_off, l_MD = 0; int i, q_off, t_off, l_MD = 0;
if (write_tag) mm_sprintf_lite(s, "\tMD:Z:"); if (write_tag) mm_sprintf_lite(s, "\tMD:Z:");
for (i = q_off = t_off = 0; i < (int)r->p->n_cigar; ++i) { for (i = q_off = t_off = 0; i < (int)r->p->n_cigar; ++i) {
int j, op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4; int j, op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
assert((op >= MM_CIGAR_MATCH && op <= MM_CIGAR_N_SKIP) || op == MM_CIGAR_EQ_MATCH || op == MM_CIGAR_X_MISMATCH); assert((op >= 0 && op <= 3) || op == 7 || op == 8);
if (op == MM_CIGAR_MATCH || op == MM_CIGAR_EQ_MATCH || op == MM_CIGAR_X_MISMATCH) { if (op == 0 || op == 7 || op == 8) { // match
for (j = 0; j < len; ++j) { for (j = 0; j < len; ++j) {
if (qseq[q_off + j] != tseq[t_off + j]) { if (qseq[q_off + j] != tseq[t_off + j]) {
mm_sprintf_lite(s, "%d%c", l_MD, "ACGTN"[tseq[t_off + j]]); mm_sprintf_lite(s, "%d%c", l_MD, "ACGTN"[tseq[t_off + j]]);
@@ -314,15 +197,15 @@ static void write_MD_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq
} else ++l_MD; } else ++l_MD;
} }
q_off += len, t_off += len; q_off += len, t_off += len;
} else if (op == MM_CIGAR_INS) { } else if (op == 1) { // insertion to ref
q_off += len; q_off += len;
} else if (op == MM_CIGAR_DEL) { } else if (op == 2) { // deletion from ref
for (j = 0, tmp[len] = 0; j < len; ++j) for (j = 0, tmp[len] = 0; j < len; ++j)
tmp[j] = "ACGTN"[tseq[t_off + j]]; tmp[j] = "ACGTN"[tseq[t_off + j]];
mm_sprintf_lite(s, "%d^%s", l_MD, tmp); mm_sprintf_lite(s, "%d^%s", l_MD, tmp);
l_MD = 0; l_MD = 0;
t_off += len; t_off += len;
} else if (op == MM_CIGAR_N_SKIP) { } else if (op == 3) { // reference skip
t_off += len; t_off += len;
} }
} }
@@ -330,7 +213,7 @@ static void write_MD_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq
assert(t_off == r->re - r->rs && q_off == r->qe - r->qs); assert(t_off == r->re - r->rs && q_off == r->qe - r->qs);
} }
static void write_cs_ds_or_MD(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int no_iden, int is_MD, int is_ds, int write_tag, int is_qstrand) static void write_cs_or_MD(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int no_iden, int is_MD, int write_tag)
{ {
extern unsigned char seq_nt4_table[256]; extern unsigned char seq_nt4_table[256];
int i; int i;
@@ -340,58 +223,54 @@ static void write_cs_ds_or_MD(void *km, kstring_t *s, const mm_idx_t *mi, const
qseq = (uint8_t*)kmalloc(km, r->qe - r->qs); qseq = (uint8_t*)kmalloc(km, r->qe - r->qs);
tseq = (uint8_t*)kmalloc(km, r->re - r->rs); tseq = (uint8_t*)kmalloc(km, r->re - r->rs);
tmp = (char*)kmalloc(km, r->re - r->rs > r->qe - r->qs? r->re - r->rs + 1 : r->qe - r->qs + 1); tmp = (char*)kmalloc(km, r->re - r->rs > r->qe - r->qs? r->re - r->rs + 1 : r->qe - r->qs + 1);
if (is_qstrand) { mm_idx_getseq(mi, r->rid, r->rs, r->re, tseq);
mm_idx_getseq2(mi, r->rev, r->rid, r->rs, r->re, tseq); if (!r->rev) {
for (i = r->qs; i < r->qe; ++i) for (i = r->qs; i < r->qe; ++i)
qseq[i - r->qs] = seq_nt4_table[(uint8_t)t->seq[i]]; qseq[i - r->qs] = seq_nt4_table[(uint8_t)t->seq[i]];
} else { } else {
mm_idx_getseq(mi, r->rid, r->rs, r->re, tseq); for (i = r->qs; i < r->qe; ++i) {
if (!r->rev) { uint8_t c = seq_nt4_table[(uint8_t)t->seq[i]];
for (i = r->qs; i < r->qe; ++i) qseq[r->qe - i - 1] = c >= 4? 4 : 3 - c;
qseq[i - r->qs] = seq_nt4_table[(uint8_t)t->seq[i]];
} else {
for (i = r->qs; i < r->qe; ++i) {
uint8_t c = seq_nt4_table[(uint8_t)t->seq[i]];
qseq[r->qe - i - 1] = c >= 4? 4 : 3 - c;
}
} }
} }
if (is_MD) write_MD_core(s, tseq, qseq, r, tmp, write_tag); if (is_MD) write_MD_core(s, tseq, qseq, r, tmp, write_tag);
else write_cs_ds_core(s, tseq, qseq, r, tmp, no_iden, is_ds, write_tag); else write_cs_core(s, tseq, qseq, r, tmp, no_iden, write_tag);
kfree(km, qseq); kfree(km, tseq); kfree(km, tmp); kfree(km, qseq); kfree(km, tseq); kfree(km, tmp);
} }
int mm_gen_cs_ds_or_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int is_MD, int is_ds, int no_iden, int is_qstrand) int mm_gen_cs_or_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int is_MD, int no_iden)
{ {
mm_bseq1_t t; mm_bseq1_t t;
kstring_t str; kstring_t str;
str.s = *buf, str.l = 0, str.m = *max_len; str.s = *buf, str.l = 0, str.m = *max_len;
t.l_seq = strlen(seq); t.l_seq = strlen(seq);
t.seq = (char*)seq; t.seq = (char*)seq;
write_cs_ds_or_MD(km, &str, mi, &t, r, no_iden, is_MD, is_ds, 0, is_qstrand); write_cs_or_MD(km, &str, mi, &t, r, no_iden, is_MD, 0);
*max_len = str.m; *max_len = str.m;
*buf = str.s; *buf = str.s;
return str.l; return str.l;
} }
int mm_gen_cs_or_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int is_MD, int no_iden, int is_qstrand)
{
return mm_gen_cs_ds_or_MD(km, buf, max_len, mi, r, seq, is_MD, 0, no_iden, is_qstrand);
}
int mm_gen_cs(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int no_iden) int mm_gen_cs(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int no_iden)
{ {
return mm_gen_cs_or_MD(km, buf, max_len, mi, r, seq, 0, no_iden, 0); return mm_gen_cs_or_MD(km, buf, max_len, mi, r, seq, 0, no_iden);
}
int mm_gen_ds(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int no_iden)
{
return mm_gen_cs_ds_or_MD(km, buf, max_len, mi, r, seq, 0, 1, no_iden, 0);
} }
int mm_gen_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq) int mm_gen_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq)
{ {
return mm_gen_cs_or_MD(km, buf, max_len, mi, r, seq, 1, 0, 0); return mm_gen_cs_or_MD(km, buf, max_len, mi, r, seq, 1, 0);
}
double mm_event_identity(const mm_reg1_t *r)
{
int32_t i, n_gapo = 0, n_gap = 0;
if (r->p == 0) return -1.0f;
for (i = 0; i < r->p->n_cigar; ++i) {
int32_t op = r->p->cigar[i] & 0xf, len = r->p->cigar[i] >> 4;
if (op == 1 || op == 2)
++n_gapo, n_gap += len;
}
return (double)r->mlen / (r->blen - n_gap + n_gapo);
} }
static inline void write_tags(kstring_t *s, const mm_reg1_t *r) static inline void write_tags(kstring_t *s, const mm_reg1_t *r)
@@ -400,7 +279,7 @@ static inline void write_tags(kstring_t *s, const mm_reg1_t *r)
if (r->id == r->parent) type = r->inv? 'I' : 'P'; if (r->id == r->parent) type = r->inv? 'I' : 'P';
else type = r->inv? 'i' : 'S'; else type = r->inv? 'i' : 'S';
if (r->p) { if (r->p) {
mm_sprintf_lite(s, "\tNM:i:%d\tms:i:%d\tAS:i:%d\tnn:i:%d", r->blen - r->mlen + r->p->n_ambi, r->p->dp_max0, r->p->dp_score, r->p->n_ambi); mm_sprintf_lite(s, "\tNM:i:%d\tms:i:%d\tAS:i:%d\tnn:i:%d", r->blen - r->mlen + r->p->n_ambi, r->p->dp_max, r->p->dp_score, r->p->n_ambi);
if (r->p->trans_strand == 1 || r->p->trans_strand == 2) if (r->p->trans_strand == 1 || r->p->trans_strand == 2)
mm_sprintf_lite(s, "\tts:A:%c", "?+-?"[r->p->trans_strand]); mm_sprintf_lite(s, "\tts:A:%c", "?+-?"[r->p->trans_strand]);
} }
@@ -422,25 +301,18 @@ static inline void write_tags(kstring_t *s, const mm_reg1_t *r)
if (r->split) mm_sprintf_lite(s, "\tzd:i:%d", r->split); if (r->split) mm_sprintf_lite(s, "\tzd:i:%d", r->split);
} }
void mm_write_paf4(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag, int rep_len, int n_seg, int seg_idx) void mm_write_paf3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int opt_flag, int rep_len)
{ {
s->l = 0; s->l = 0;
mm_sprintf_lite(s, "%s", t->name);
if ((opt_flag & MM_F_FRAG_MODE) && n_seg >= 2 && seg_idx >= 0)
mm_sprintf_lite(s, "/%d", seg_idx + 1);
if (r == 0) { if (r == 0) {
mm_sprintf_lite(s, "\t%d\t0\t0\t*\t*\t0\t0\t0\t0\t0\t0", t->l_seq); mm_sprintf_lite(s, "%s\t%d\t0\t0\t*\t*\t0\t0\t0\t0\t0\t0", t->name, t->l_seq);
if (rep_len >= 0) mm_sprintf_lite(s, "\trl:i:%d", rep_len); if (rep_len >= 0) mm_sprintf_lite(s, "\trl:i:%d", rep_len);
return; return;
} }
mm_sprintf_lite(s, "\t%d\t%d\t%d\t%c\t", t->l_seq, r->qs, r->qe, "+-"[r->rev]); mm_sprintf_lite(s, "%s\t%d\t%d\t%d\t%c\t", t->name, t->l_seq, r->qs, r->qe, "+-"[r->rev]);
if (mi->seq[r->rid].name) mm_sprintf_lite(s, "%s", mi->seq[r->rid].name); if (mi->seq[r->rid].name) mm_sprintf_lite(s, "%s", mi->seq[r->rid].name);
else mm_sprintf_lite(s, "%d", r->rid); else mm_sprintf_lite(s, "%d", r->rid);
mm_sprintf_lite(s, "\t%d", mi->seq[r->rid].len); mm_sprintf_lite(s, "\t%d\t%d\t%d", mi->seq[r->rid].len, r->rs, r->re);
if ((opt_flag & MM_F_QSTRAND) && r->rev)
mm_sprintf_lite(s, "\t%d\t%d", mi->seq[r->rid].len - r->re, mi->seq[r->rid].len - r->rs);
else
mm_sprintf_lite(s, "\t%d\t%d", r->rs, r->re);
mm_sprintf_lite(s, "\t%d\t%d", r->mlen, r->blen); mm_sprintf_lite(s, "\t%d\t%d", r->mlen, r->blen);
mm_sprintf_lite(s, "\t%d", r->mapq); mm_sprintf_lite(s, "\t%d", r->mapq);
write_tags(s, r); write_tags(s, r);
@@ -449,20 +321,15 @@ void mm_write_paf4(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const
uint32_t k; uint32_t k;
mm_sprintf_lite(s, "\tcg:Z:"); mm_sprintf_lite(s, "\tcg:Z:");
for (k = 0; k < r->p->n_cigar; ++k) for (k = 0; k < r->p->n_cigar; ++k)
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, MM_CIGAR_STR[r->p->cigar[k]&0xf]); mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDNSHP=XB"[r->p->cigar[k]&0xf]);
} }
if (r->p && (opt_flag & (MM_F_OUT_CS|MM_F_OUT_DS|MM_F_OUT_MD))) if (r->p && (opt_flag & (MM_F_OUT_CS|MM_F_OUT_MD)))
write_cs_ds_or_MD(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG), !!(opt_flag&MM_F_OUT_MD), !!(opt_flag&MM_F_OUT_DS), 1, !!(opt_flag&MM_F_QSTRAND)); write_cs_or_MD(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG), opt_flag&MM_F_OUT_MD, 1);
if ((opt_flag & MM_F_COPY_COMMENT) && t->comment) if ((opt_flag & MM_F_COPY_COMMENT) && t->comment)
mm_sprintf_lite(s, "\t%s", t->comment); mm_sprintf_lite(s, "\t%s", t->comment);
} }
void mm_write_paf3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag, int rep_len) void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int opt_flag)
{
mm_write_paf4(s, mi, t, r, km, opt_flag, rep_len, 0, 0);
}
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag)
{ {
mm_write_paf3(s, mi, t, r, km, opt_flag, -1); mm_write_paf3(s, mi, t, r, km, opt_flag, -1);
} }
@@ -491,7 +358,7 @@ static inline const mm_reg1_t *get_sam_pri(int n_regs, const mm_reg1_t *regs)
return NULL; return NULL;
} }
static void write_sam_cigar(kstring_t *s, int sam_flag, int in_tag, int qlen, const mm_reg1_t *r, int64_t opt_flag) static void write_sam_cigar(kstring_t *s, int sam_flag, int in_tag, int qlen, const mm_reg1_t *r, int opt_flag)
{ {
if (r->p == 0) { if (r->p == 0) {
mm_sprintf_lite(s, "*"); mm_sprintf_lite(s, "*");
@@ -500,30 +367,28 @@ static void write_sam_cigar(kstring_t *s, int sam_flag, int in_tag, int qlen, co
clip_len[0] = r->rev? qlen - r->qe : r->qs; clip_len[0] = r->rev? qlen - r->qe : r->qs;
clip_len[1] = r->rev? r->qs : qlen - r->qe; clip_len[1] = r->rev? r->qs : qlen - r->qe;
if (in_tag) { if (in_tag) {
int clip_char = (((sam_flag&0x800) || ((sam_flag&0x100) && (opt_flag&MM_F_SECONDARY_SEQ))) && int clip_char = (sam_flag&0x800) && !(opt_flag&MM_F_SOFTCLIP)? 5 : 4;
!(opt_flag&MM_F_SOFTCLIP)) ? 5 : 4;
mm_sprintf_lite(s, "\tCG:B:I"); mm_sprintf_lite(s, "\tCG:B:I");
if (clip_len[0]) mm_sprintf_lite(s, ",%u", clip_len[0]<<4|clip_char); if (clip_len[0]) mm_sprintf_lite(s, ",%u", clip_len[0]<<4|clip_char);
for (k = 0; k < r->p->n_cigar; ++k) for (k = 0; k < r->p->n_cigar; ++k)
mm_sprintf_lite(s, ",%u", r->p->cigar[k]); mm_sprintf_lite(s, ",%u", r->p->cigar[k]);
if (clip_len[1]) mm_sprintf_lite(s, ",%u", clip_len[1]<<4|clip_char); if (clip_len[1]) mm_sprintf_lite(s, ",%u", clip_len[1]<<4|clip_char);
} else { } else {
int clip_char = (((sam_flag&0x800) || ((sam_flag&0x100) && (opt_flag&MM_F_SECONDARY_SEQ))) && int clip_char = (sam_flag&0x800) && !(opt_flag&MM_F_SOFTCLIP)? 'H' : 'S';
!(opt_flag&MM_F_SOFTCLIP)) ? 'H' : 'S';
assert(clip_len[0] < qlen && clip_len[1] < qlen); assert(clip_len[0] < qlen && clip_len[1] < qlen);
if (clip_len[0]) mm_sprintf_lite(s, "%d%c", clip_len[0], clip_char); if (clip_len[0]) mm_sprintf_lite(s, "%d%c", clip_len[0], clip_char);
for (k = 0; k < r->p->n_cigar; ++k) for (k = 0; k < r->p->n_cigar; ++k)
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, MM_CIGAR_STR[r->p->cigar[k]&0xf]); mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDNSHP=XB"[r->p->cigar[k]&0xf]);
if (clip_len[1]) mm_sprintf_lite(s, "%d%c", clip_len[1], clip_char); if (clip_len[1]) mm_sprintf_lite(s, "%d%c", clip_len[1], clip_char);
} }
} }
} }
void mm_write_sam3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regss, const mm_reg1_t *const* regss, void *km, int64_t opt_flag, int rep_len) void mm_write_sam3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regss, const mm_reg1_t *const* regss, void *km, int opt_flag, int rep_len)
{ {
const int max_bam_cigar_op = 65535; const int max_bam_cigar_op = 65535;
int flag, n_regs = n_regss[seg_idx], cigar_in_tag = 0; int flag, n_regs = n_regss[seg_idx], cigar_in_tag = 0;
int this_rid = -1, this_pos = -1; int this_rid = -1, this_pos = -1, this_rev = 0;
const mm_reg1_t *regs = regss[seg_idx], *r_prev = NULL, *r_next; const mm_reg1_t *regs = regss[seg_idx], *r_prev = NULL, *r_next;
const mm_reg1_t *r = n_regs > 0 && reg_idx < n_regs && reg_idx >= 0? &regs[reg_idx] : NULL; const mm_reg1_t *r = n_regs > 0 && reg_idx < n_regs && reg_idx >= 0? &regs[reg_idx] : NULL;
@@ -572,7 +437,7 @@ void mm_write_sam3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
mm_sprintf_lite(s, "\t%s\t%d\t0\t*", mi->seq[this_rid].name, this_pos+1); mm_sprintf_lite(s, "\t%s\t%d\t0\t*", mi->seq[this_rid].name, this_pos+1);
} else mm_sprintf_lite(s, "\t*\t0\t0\t*"); } else mm_sprintf_lite(s, "\t*\t0\t0\t*");
} else { } else {
this_rid = r->rid, this_pos = r->rs; this_rid = r->rid, this_pos = r->rs, this_rev = r->rev;
mm_sprintf_lite(s, "\t%s\t%d\t%d\t", mi->seq[r->rid].name, r->rs+1, r->mapq); mm_sprintf_lite(s, "\t%s\t%d\t%d\t", mi->seq[r->rid].name, r->rs+1, r->mapq);
if ((opt_flag & MM_F_LONG_CIGAR) && r->p && r->p->n_cigar > max_bam_cigar_op - 2) { if ((opt_flag & MM_F_LONG_CIGAR) && r->p && r->p->n_cigar > max_bam_cigar_op - 2) {
int n_cigar = r->p->n_cigar; int n_cigar = r->p->n_cigar;
@@ -584,7 +449,7 @@ void mm_write_sam3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
if (cigar_in_tag) { if (cigar_in_tag) {
int slen; int slen;
if ((flag & 0x900) == 0 || (opt_flag & MM_F_SOFTCLIP)) slen = t->l_seq; if ((flag & 0x900) == 0 || (opt_flag & MM_F_SOFTCLIP)) slen = t->l_seq;
else if ((flag & 0x100) && !(opt_flag & MM_F_SECONDARY_SEQ)) slen = 0; else if (flag & 0x100) slen = 0;
else slen = r->qe - r->qs; else slen = r->qe - r->qs;
mm_sprintf_lite(s, "%dS%dN", slen, r->re - r->rs); mm_sprintf_lite(s, "%dS%dN", slen, r->re - r->rs);
} else write_sam_cigar(s, flag, 0, t->l_seq, r, opt_flag); } else write_sam_cigar(s, flag, 0, t->l_seq, r, opt_flag);
@@ -625,7 +490,7 @@ void mm_write_sam3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
mm_sprintf_lite(s, "\t"); mm_sprintf_lite(s, "\t");
if (t->qual) sam_write_sq(s, t->qual, t->l_seq, r->rev, 0); if (t->qual) sam_write_sq(s, t->qual, t->l_seq, r->rev, 0);
else mm_sprintf_lite(s, "*"); else mm_sprintf_lite(s, "*");
} else if ((flag & 0x100) && !(opt_flag & MM_F_SECONDARY_SEQ)){ } else if (flag & 0x100) {
mm_sprintf_lite(s, "*\t*"); mm_sprintf_lite(s, "*\t*");
} else { } else {
sam_write_sq(s, t->seq + r->qs, r->qe - r->qs, r->rev, r->rev); sam_write_sq(s, t->seq + r->qs, r->qe - r->qs, r->rev, r->rev);
@@ -665,8 +530,8 @@ void mm_write_sam3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
} }
} }
} }
if (r->p && (opt_flag & (MM_F_OUT_CS|MM_F_OUT_DS|MM_F_OUT_MD))) if (r->p && (opt_flag & (MM_F_OUT_CS|MM_F_OUT_MD)))
write_cs_ds_or_MD(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG), opt_flag&MM_F_OUT_MD, !!(opt_flag&MM_F_OUT_DS), 1, 0); write_cs_or_MD(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG), opt_flag&MM_F_OUT_MD, 1);
if (cigar_in_tag) if (cigar_in_tag)
write_sam_cigar(s, flag, 1, t->l_seq, r, opt_flag); write_sam_cigar(s, flag, 1, t->l_seq, r, opt_flag);
} }
@@ -678,7 +543,7 @@ void mm_write_sam3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
s->s[s->l] = 0; // we always have room for an extra byte (see str_enlarge) s->s[s->l] = 0; // we always have room for an extra byte (see str_enlarge)
} }
void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regss, const mm_reg1_t *const* regss, void *km, int64_t opt_flag) void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regss, const mm_reg1_t *const* regss, void *km, int opt_flag)
{ {
mm_write_sam3(s, mi, t, seg_idx, reg_idx, n_seg, n_regss, regss, km, opt_flag, -1); mm_write_sam3(s, mi, t, seg_idx, reg_idx, n_seg, n_regss, regss, km, opt_flag, -1);
} }
+91 -85
View File
@@ -20,14 +20,14 @@ static inline void mm_cal_fuzzy_len(mm_reg1_t *r, const mm128_t *a)
} }
} }
static inline void mm_reg_set_coor(mm_reg1_t *r, int32_t qlen, const mm128_t *a, int is_qstrand) static inline void mm_reg_set_coor(mm_reg1_t *r, int32_t qlen, const mm128_t *a)
{ // NB: r->as and r->cnt MUST BE set correctly for this function to work { // NB: r->as and r->cnt MUST BE set correctly for this function to work
int32_t k = r->as, q_span = (int32_t)(a[k].y>>32&0xff); int32_t k = r->as, q_span = (int32_t)(a[k].y>>32&0xff);
r->rev = a[k].x>>63; r->rev = a[k].x>>63;
r->rid = a[k].x<<1>>33; r->rid = a[k].x<<1>>33;
r->rs = (int32_t)a[k].x + 1 > q_span? (int32_t)a[k].x + 1 - q_span : 0; // NB: target span may be shorter, so this test is necessary r->rs = (int32_t)a[k].x + 1 > q_span? (int32_t)a[k].x + 1 - q_span : 0; // NB: target span may be shorter, so this test is necessary
r->re = (int32_t)a[k + r->cnt - 1].x + 1; r->re = (int32_t)a[k + r->cnt - 1].x + 1;
if (!r->rev || is_qstrand) { if (!r->rev) {
r->qs = (int32_t)a[k].y + 1 - q_span; r->qs = (int32_t)a[k].y + 1 - q_span;
r->qe = (int32_t)a[k + r->cnt - 1].y + 1; r->qe = (int32_t)a[k + r->cnt - 1].y + 1;
} else { } else {
@@ -49,13 +49,13 @@ static inline uint64_t hash64(uint64_t key)
return key; return key;
} }
mm_reg1_t *mm_gen_regs(void *km, uint32_t hash, int qlen, int n_u, uint64_t *u, mm128_t *a, int is_qstrand) // convert chains to hits mm_reg1_t *mm_gen_regs(void *km, uint32_t hash, int qlen, int n_u, uint64_t *u, mm128_t *a) // convert chains to hits
{ {
mm128_t *z, tmp; mm128_t *z, tmp;
mm_reg1_t *r; mm_reg1_t *r;
int i, k; int i, k;
if (n_u <= 0) return 0; if (n_u == 0) return 0;
// sort by score // sort by score
z = (mm128_t*)kmalloc(km, n_u * 16); z = (mm128_t*)kmalloc(km, n_u * 16);
@@ -81,29 +81,13 @@ mm_reg1_t *mm_gen_regs(void *km, uint32_t hash, int qlen, int n_u, uint64_t *u,
ri->cnt = (int32_t)z[i].y; ri->cnt = (int32_t)z[i].y;
ri->as = z[i].y >> 32; ri->as = z[i].y >> 32;
ri->div = -1.0f; ri->div = -1.0f;
mm_reg_set_coor(ri, qlen, a, is_qstrand); mm_reg_set_coor(ri, qlen, a);
} }
kfree(km, z); kfree(km, z);
return r; return r;
} }
void mm_mark_alt(const mm_idx_t *mi, int n, mm_reg1_t *r) void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a)
{
int i;
if (mi->n_alt == 0) return;
for (i = 0; i < n; ++i)
if (mi->seq[r[i].rid].is_alt)
r[i].is_alt = 1;
}
static inline int mm_alt_score(int score, float alt_diff_frac)
{
if (score < 0) return score;
score = (int)(score * (1.0 - alt_diff_frac) + .499);
return score > 0? score : 1;
}
void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a, int is_qstrand)
{ {
if (n <= 0 || n >= r->cnt) return; if (n <= 0 || n >= r->cnt) return;
*r2 = *r; *r2 = *r;
@@ -115,14 +99,14 @@ void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a, int
r2->score = (int32_t)(r->score * ((float)r2->cnt / r->cnt) + .499); r2->score = (int32_t)(r->score * ((float)r2->cnt / r->cnt) + .499);
r2->as = r->as + n; r2->as = r->as + n;
if (r->parent == r->id) r2->parent = MM_PARENT_TMP_PRI; if (r->parent == r->id) r2->parent = MM_PARENT_TMP_PRI;
mm_reg_set_coor(r2, qlen, a, is_qstrand); mm_reg_set_coor(r2, qlen, a);
r->cnt -= r2->cnt; r->cnt -= r2->cnt;
r->score -= r2->score; r->score -= r2->score;
mm_reg_set_coor(r, qlen, a, is_qstrand); mm_reg_set_coor(r, qlen, a);
r->split |= 1, r2->split |= 2; r->split |= 1, r2->split |= 2;
} }
void mm_set_parent(void *km, float mask_level, int mask_len, int n, mm_reg1_t *r, int sub_diff, int hard_mask_level, float alt_diff_frac) // and compute mm_reg1_t::subsc void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r, int sub_diff, int hard_mask_level) // and compute mm_reg1_t::subsc
{ {
int i, j, k, *w; int i, j, k, *w;
uint64_t *cov; uint64_t *cov;
@@ -162,16 +146,13 @@ skip_uncov:
min = ej - sj < ei - si? ej - sj : ei - si; min = ej - sj < ei - si? ej - sj : ei - si;
max = ej - sj > ei - si? ej - sj : ei - si; max = ej - sj > ei - si? ej - sj : ei - si;
ol = si < sj? (ei < sj? 0 : ei < ej? ei - sj : ej - sj) : (ej < si? 0 : ej < ei? ej - si : ei - si); // overlap length; TODO: this can be simplified ol = si < sj? (ei < sj? 0 : ei < ej? ei - sj : ej - sj) : (ej < si? 0 : ej < ei? ej - si : ei - si); // overlap length; TODO: this can be simplified
if ((float)ol / min - (float)uncov_len / max > mask_level && uncov_len <= mask_len) { // then this is a secondary hit if ((float)ol / min - (float)uncov_len / max > mask_level) {
int cnt_sub = 0, sci = ri->score; int cnt_sub = 0;
ri->parent = rp->parent; ri->parent = rp->parent;
if (!rp->is_alt && ri->is_alt) sci = mm_alt_score(sci, alt_diff_frac); rp->subsc = rp->subsc > ri->score? rp->subsc : ri->score;
rp->subsc = rp->subsc > sci? rp->subsc : sci;
if (ri->cnt >= rp->cnt) cnt_sub = 1; if (ri->cnt >= rp->cnt) cnt_sub = 1;
if (rp->p && ri->p && (rp->rid != ri->rid || rp->rs != ri->rs || rp->re != ri->re || ol != min)) { // the last condition excludes identical hits after DP if (rp->p && ri->p && (rp->rid != ri->rid || rp->rs != ri->rs || rp->re != ri->re || ol != min)) { // the last condition excludes identical hits after DP
sci = ri->p->dp_max; rp->p->dp_max2 = rp->p->dp_max2 > ri->p->dp_max? rp->p->dp_max2 : ri->p->dp_max;
if (!rp->is_alt && ri->is_alt) sci = mm_alt_score(sci, alt_diff_frac);
rp->p->dp_max2 = rp->p->dp_max2 > sci? rp->p->dp_max2 : sci;
if (rp->p->dp_max - ri->p->dp_max <= sub_diff) cnt_sub = 1; if (rp->p->dp_max - ri->p->dp_max <= sub_diff) cnt_sub = 1;
} }
if (cnt_sub) ++rp->n_sub; if (cnt_sub) ++rp->n_sub;
@@ -185,7 +166,7 @@ set_parent_test:
kfree(km, w); kfree(km, w);
} }
void mm_hit_sort(void *km, int *n_regs, mm_reg1_t *r, float alt_diff_frac) void mm_hit_sort(void *km, int *n_regs, mm_reg1_t *r)
{ {
int32_t i, n_aux, n = *n_regs, has_cigar = 0, no_cigar = 0; int32_t i, n_aux, n = *n_regs, has_cigar = 0, no_cigar = 0;
mm128_t *aux; mm128_t *aux;
@@ -196,11 +177,13 @@ void mm_hit_sort(void *km, int *n_regs, mm_reg1_t *r, float alt_diff_frac)
t = (mm_reg1_t*)kmalloc(km, n * sizeof(mm_reg1_t)); t = (mm_reg1_t*)kmalloc(km, n * sizeof(mm_reg1_t));
for (i = n_aux = 0; i < n; ++i) { for (i = n_aux = 0; i < n; ++i) {
if (r[i].inv || r[i].cnt > 0) { // squeeze out elements with cnt==0 (soft deleted) if (r[i].inv || r[i].cnt > 0) { // squeeze out elements with cnt==0 (soft deleted)
int score; if (r[i].p) {
if (r[i].p) score = r[i].p->dp_max, has_cigar = 1; aux[n_aux].x = (uint64_t)r[i].p->dp_max << 32 | r[i].hash;
else score = r[i].score, no_cigar = 1; has_cigar = 1;
if (r[i].is_alt) score = mm_alt_score(score, alt_diff_frac); } else {
aux[n_aux].x = (uint64_t)score << 32 | r[i].hash; aux[n_aux].x = (uint64_t)r[i].score << 32 | r[i].hash;
no_cigar = 1;
}
aux[n_aux++].y = i; aux[n_aux++].y = i;
} else if (r[i].p) { } else if (r[i].p) {
free(r[i].p); free(r[i].p);
@@ -252,52 +235,25 @@ void mm_sync_regs(void *km, int n_regs, mm_reg1_t *regs) // keep mm_reg1_t::{id,
mm_set_sam_pri(n_regs, regs); mm_set_sam_pri(n_regs, regs);
} }
void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int check_strand, int min_strand_sc, int *n_, mm_reg1_t *r) void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int *n_, mm_reg1_t *r)
{ {
if (pri_ratio > 0.0f && *n_ > 0) { if (pri_ratio > 0.0f && *n_ > 0) {
int i, k, n = *n_, n_2nd = 0; int i, k, n = *n_, n_2nd = 0;
uint8_t *keep = (uint8_t*)kmalloc(km, n); for (i = k = 0; i < n; ++i) {
for (i = 0; i < n; ++i) {
int p = r[i].parent; int p = r[i].parent;
keep[i] = 0;
if (p == i || r[i].inv) { // primary or inversion if (p == i || r[i].inv) { // primary or inversion
keep[i] = 1; r[k++] = r[i];
} else if ((r[i].score >= r[p].score * pri_ratio || r[i].score + min_diff >= r[p].score) && n_2nd < best_n) { } else if ((r[i].score >= r[p].score * pri_ratio || r[i].score + min_diff >= r[p].score) && n_2nd < best_n) {
if (!(r[i].qs == r[p].qs && r[i].qe == r[p].qe && r[i].rid == r[p].rid && r[i].rs == r[p].rs && r[i].re == r[p].re)) // not identical hits if (!(r[i].qs == r[p].qs && r[i].qe == r[p].qe && r[i].rid == r[p].rid && r[i].rs == r[p].rs && r[i].re == r[p].re)) // not identical hits
keep[i] = 1, ++n_2nd; r[k++] = r[i], ++n_2nd;
} else if (check_strand && n_2nd < best_n && r[i].score > min_strand_sc && r[i].rev != r[p].rev) { else if (r[i].p) free(r[i].p);
r[i].strand_retained = 1; } else if (r[i].p) free(r[i].p);
keep[i] = 1, ++n_2nd;
}
} }
for (i = k = 0; i < n; ++i) {
if (keep[i]) r[k++] = r[i];
else if (r[i].p) free(r[i].p);
}
kfree(km, keep);
if (k != n) mm_sync_regs(km, k, r); // removing hits requires sync() if (k != n) mm_sync_regs(km, k, r); // removing hits requires sync()
*n_ = k; *n_ = k;
} }
} }
int mm_filter_strand_retained(int n_regs, mm_reg1_t *r)
{
int i, k;
uint8_t *keep = (uint8_t*)malloc(n_regs);
for (i = 0; i < n_regs; ++i) {
int p = r[i].parent;
keep[i] = (!r[i].strand_retained || r[i].div < r[p].div * 5.0f || r[i].div < 0.01f);
}
for (i = k = 0; i < n_regs; ++i) {
if (keep[i]) {
if (k < i) r[k++] = r[i];
else ++k;
}
}
free(keep);
return k;
}
void mm_filter_regs(const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs) void mm_filter_regs(const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs)
{ // NB: after this call, mm_reg1_t::parent can be -1 if its parent filtered out { // NB: after this call, mm_reg1_t::parent can be -1 if its parent filtered out
int i, k; int i, k;
@@ -339,6 +295,64 @@ int mm_squeeze_a(void *km, int n_regs, mm_reg1_t *regs, mm128_t *a)
return as; return as;
} }
void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs_, mm_reg1_t *regs, mm128_t *a)
{
int i, n_aux, n_regs = *n_regs_, n_drop = 0;
uint64_t *aux;
if (n_regs < 2) return; // nothing to join
mm_squeeze_a(km, n_regs, regs, a);
aux = (uint64_t*)kmalloc(km, n_regs * 8);
for (i = n_aux = 0; i < n_regs; ++i)
if (regs[i].parent == i || regs[i].parent < 0)
aux[n_aux++] = (uint64_t)regs[i].as << 32 | i;
radix_sort_64(aux, aux + n_aux);
for (i = n_aux - 1; i >= 1; --i) {
mm_reg1_t *r0 = &regs[(int32_t)aux[i-1]], *r1 = &regs[(int32_t)aux[i]];
mm128_t *a0e, *a1s;
int max_gap, min_gap, sc_thres, min_flank_len;
// test
if (r0->as + r0->cnt != r1->as) continue; // not adjacent in a[]
if (r0->rid != r1->rid || r0->rev != r1->rev) continue; // make sure on the same target and strand
a0e = &a[r0->as + r0->cnt - 1];
a1s = &a[r1->as];
if (a1s->x <= a0e->x || (int32_t)a1s->y <= (int32_t)a0e->y) continue; // keep colinearity
max_gap = min_gap = (int32_t)a1s->y - (int32_t)a0e->y;
max_gap = a0e->x + max_gap > a1s->x? max_gap : a1s->x - a0e->x;
min_gap = a0e->x + min_gap < a1s->x? min_gap : a1s->x - a0e->x;
if (max_gap > opt->max_join_long || min_gap > opt->max_join_short) continue;
sc_thres = (int)((float)opt->min_join_flank_sc / opt->max_join_long * max_gap + .499);
if (r0->score < sc_thres || r1->score < sc_thres) continue; // require good flanking chains
min_flank_len = (int)(max_gap * opt->min_join_flank_ratio);
if (r0->re - r0->rs < min_flank_len || r0->qe - r0->qs < min_flank_len) continue; // require enough flanking length
if (r1->re - r1->rs < min_flank_len || r1->qe - r1->qs < min_flank_len) continue;
// all conditions satisfied; join
a[r1->as].y |= MM_SEED_LONG_JOIN;
r0->cnt += r1->cnt, r0->score += r1->score;
mm_reg_set_coor(r0, qlen, a);
r1->cnt = 0;
r1->parent = r0->id;
++n_drop;
}
kfree(km, aux);
if (n_drop > 0) { // then fix the hits hierarchy
for (i = 0; i < n_regs; ++i) { // adjust the mm_reg1_t::parent
mm_reg1_t *r = &regs[i];
if (r->parent >= 0 && r->id != r->parent) { // fix for secondary hits only
if (regs[r->parent].parent >= 0 && regs[r->parent].parent != r->parent)
r->parent = regs[r->parent].parent;
}
}
mm_filter_regs(opt, qlen, n_regs_, regs);
mm_sync_regs(km, *n_regs_, regs);
}
}
mm_seg_t *mm_seg_gen(void *km, uint32_t hash, int n_segs, const int *qlens, int n_regs0, const mm_reg1_t *regs0, int *n_regs, mm_reg1_t **regs, const mm128_t *a) mm_seg_t *mm_seg_gen(void *km, uint32_t hash, int n_segs, const int *qlens, int n_regs0, const mm_reg1_t *regs0, int *n_regs, mm_reg1_t **regs, const mm128_t *a)
{ {
int s, i, j, acc_qlen[MM_MAX_SEG+1], qlen_sum = 0; int s, i, j, acc_qlen[MM_MAX_SEG+1], qlen_sum = 0;
@@ -385,7 +399,7 @@ mm_seg_t *mm_seg_gen(void *km, uint32_t hash, int n_segs, const int *qlens, int
} }
} }
for (s = 0; s < n_segs; ++s) { for (s = 0; s < n_segs; ++s) {
regs[s] = mm_gen_regs(km, hash, qlens[s], seg[s].n_u, seg[s].u, seg[s].a, 0); regs[s] = mm_gen_regs(km, hash, qlens[s], seg[s].n_u, seg[s].u, seg[s].a);
n_regs[s] = seg[s].n_u; n_regs[s] = seg[s].n_u;
for (i = 0; i < n_regs[s]; ++i) { for (i = 0; i < n_regs[s]; ++i) {
regs[s][i].seg_split = 1; regs[s][i].seg_split = 1;
@@ -429,19 +443,16 @@ static void mm_set_inv_mapq(void *km, int n_regs, mm_reg1_t *regs)
kfree(km, aux); kfree(km, aux);
} }
void mm_set_mapq2(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr, int is_splice) void mm_set_mapq(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr)
{ {
static const float q_coef = 40.0f; static const float q_coef = 40.0f;
int64_t sum_sc = 0; int64_t sum_sc = 0;
float uniq_ratio; float uniq_ratio;
int i, n_2nd_splice = 0; int i;
if (n_regs == 0) return; if (n_regs == 0) return;
for (i = 0; i < n_regs; ++i) { for (i = 0; i < n_regs; ++i)
if (regs[i].parent == regs[i].id) if (regs[i].parent == regs[i].id)
sum_sc += regs[i].score; sum_sc += regs[i].score;
else if (regs[i].is_spliced)
++n_2nd_splice;
}
uniq_ratio = (float)sum_sc / (sum_sc + rep_len); uniq_ratio = (float)sum_sc / (sum_sc + rep_len);
for (i = 0; i < n_regs; ++i) { for (i = 0; i < n_regs; ++i) {
mm_reg1_t *r = &regs[i]; mm_reg1_t *r = &regs[i];
@@ -454,18 +465,13 @@ void mm_set_mapq2(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int m
pen_cm = pen_s1 < pen_cm? pen_s1 : pen_cm; pen_cm = pen_s1 < pen_cm? pen_s1 : pen_cm;
subsc = r->subsc > min_chain_sc? r->subsc : min_chain_sc; subsc = r->subsc > min_chain_sc? r->subsc : min_chain_sc;
if (r->p && r->p->dp_max2 > 0 && r->p->dp_max > 0) { if (r->p && r->p->dp_max2 > 0 && r->p->dp_max > 0) {
float x, identity = (float)r->mlen / r->blen; float identity = (float)r->mlen / r->blen;
if (is_sr && is_splice) float x = (float)r->p->dp_max2 * subsc / r->p->dp_max / r->score0;
x = (float)r->p->dp_max2 / r->p->dp_max; // ignore chaining score; for short RNA-seq reads, unspliced chaining score tends to be higher
else
x = (float)r->p->dp_max2 * subsc / r->p->dp_max / r->score0;
mapq = (int)(identity * pen_cm * q_coef * (1.0f - x * x) * logf((float)r->p->dp_max / match_sc)); mapq = (int)(identity * pen_cm * q_coef * (1.0f - x * x) * logf((float)r->p->dp_max / match_sc));
if (!is_sr) { if (!is_sr) {
int mapq_alt = (int)(6.02f * identity * identity * (r->p->dp_max - r->p->dp_max2) / match_sc + .499f); // BWA-MEM like mapQ, mostly for short reads int mapq_alt = (int)(6.02f * identity * identity * (r->p->dp_max - r->p->dp_max2) / match_sc + .499f); // BWA-MEM like mapQ, mostly for short reads
mapq = mapq < mapq_alt? mapq : mapq_alt; // in case the long-read heuristic fails mapq = mapq < mapq_alt? mapq : mapq_alt; // in case the long-read heuristic fails
} }
if (is_splice && is_sr && r->is_spliced && n_2nd_splice == 0)
mapq += 10;
} else { } else {
float x = (float)subsc / r->score0; float x = (float)subsc / r->score0;
if (r->p) { if (r->p) {
+54 -383
View File
@@ -1,4 +1,5 @@
#include <stdlib.h> #include <stdlib.h>
#include <limits.h>
#include <assert.h> #include <assert.h>
#if defined(WIN32) || defined(_WIN32) #if defined(WIN32) || defined(_WIN32)
#include <io.h> // for open(2) #include <io.h> // for open(2)
@@ -12,7 +13,6 @@
#include "bseq.h" #include "bseq.h"
#include "minimap.h" #include "minimap.h"
#include "mmpriv.h" #include "mmpriv.h"
#include "ksw2.h"
#include "kvec.h" #include "kvec.h"
#include "khash.h" #include "khash.h"
@@ -33,7 +33,7 @@ typedef struct mm_idx_bucket_s {
} mm_idx_bucket_t; } mm_idx_bucket_t;
typedef struct { typedef struct {
int32_t st, en, cnt; int32_t st, en, max; // max is not used for now
int32_t score:30, strand:2; int32_t score:30, strand:2;
} mm_idx_intv1_t; } mm_idx_intv1_t;
@@ -42,11 +42,6 @@ typedef struct mm_idx_intv_s {
mm_idx_intv1_t *a; mm_idx_intv1_t *a;
} mm_idx_intv_t; } mm_idx_intv_t;
typedef struct mm_idx_jjump_s {
int32_t n, m;
mm_idx_jjump1_t *a;
} mm_idx_jjump_t;
mm_idx_t *mm_idx_init(int w, int k, int b, int flag) mm_idx_t *mm_idx_init(int w, int k, int b, int flag)
{ {
mm_idx_t *mi; mm_idx_t *mi;
@@ -71,17 +66,11 @@ void mm_idx_destroy(mm_idx_t *mi)
kh_destroy(idx, (idxhash_t*)mi->B[i].h); kh_destroy(idx, (idxhash_t*)mi->B[i].h);
} }
} }
if (mi->spsc) free(mi->spsc);
if (mi->I) { if (mi->I) {
for (i = 0; i < mi->n_seq; ++i) for (i = 0; i < mi->n_seq; ++i)
free(mi->I[i].a); free(mi->I[i].a);
free(mi->I); free(mi->I);
} }
if (mi->J) {
for (i = 0; i < mi->n_seq; ++i)
free(mi->J[i].a);
free(mi->J);
}
if (!mi->km) { if (!mi->km) {
for (i = 0; i < mi->n_seq; ++i) for (i = 0; i < mi->n_seq; ++i)
free(mi->seq[i].name); free(mi->seq[i].name);
@@ -111,7 +100,7 @@ const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n)
void mm_idx_stat(const mm_idx_t *mi) void mm_idx_stat(const mm_idx_t *mi)
{ {
int64_t n = 0, n1 = 0; int n = 0, n1 = 0;
uint32_t i; uint32_t i;
uint64_t sum = 0, len = 0; uint64_t sum = 0, len = 0;
fprintf(stderr, "[M::%s] kmer size: %d; skip: %d; is_hpc: %d; #seq: %d\n", __func__, mi->k, mi->w, mi->flag&MM_I_HPC, mi->n_seq); fprintf(stderr, "[M::%s] kmer size: %d; skip: %d; is_hpc: %d; #seq: %d\n", __func__, mi->k, mi->w, mi->flag&MM_I_HPC, mi->n_seq);
@@ -129,8 +118,8 @@ void mm_idx_stat(const mm_idx_t *mi)
if (kh_key(h, k)&1) ++n1; if (kh_key(h, k)&1) ++n1;
} }
} }
fprintf(stderr, "[M::%s::%.3f*%.2f] distinct minimizers: %ld (%.2f%% are singletons); average occurrences: %.3lf; average spacing: %.3lf; total length: %ld\n", fprintf(stderr, "[M::%s::%.3f*%.2f] distinct minimizers: %d (%.2f%% are singletons); average occurrences: %.3lf; average spacing: %.3lf\n",
__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), (long)n, 100.0*n1/n, (double)sum / n, (double)len / sum, (long)len); __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), n, 100.0*n1/n, (double)sum / n, (double)len / sum);
} }
int mm_idx_index_name(mm_idx_t *mi) int mm_idx_index_name(mm_idx_t *mi)
@@ -173,28 +162,6 @@ int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, ui
return en - st; return en - st;
} }
int mm_idx_getseq_rev(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq)
{
uint64_t i, st1, en1;
const mm_idx_seq_t *s;
if (rid >= mi->n_seq || st >= mi->seq[rid].len) return -1;
s = &mi->seq[rid];
if (en > s->len) en = s->len;
st1 = s->offset + (s->len - en);
en1 = s->offset + (s->len - st);
for (i = st1; i < en1; ++i) {
uint8_t c = mm_seq4_get(mi->S, i);
seq[en1 - i - 1] = c < 4? 3 - c : c;
}
return en - st;
}
int mm_idx_getseq2(const mm_idx_t *mi, int is_rev, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq)
{
if (is_rev) return mm_idx_getseq_rev(mi, rid, st, en, seq);
else return mm_idx_getseq(mi, rid, st, en, seq);
}
int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f) int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f)
{ {
int i; int i;
@@ -204,7 +171,6 @@ int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f)
if (f <= 0.) return INT32_MAX; if (f <= 0.) return INT32_MAX;
for (i = 0; i < 1<<mi->b; ++i) for (i = 0; i < 1<<mi->b; ++i)
if (mi->B[i].h) n += kh_size((idxhash_t*)mi->B[i].h); if (mi->B[i].h) n += kh_size((idxhash_t*)mi->B[i].h);
if (n == 0) return INT32_MAX;
a = (uint32_t*)malloc(n * 4); a = (uint32_t*)malloc(n * 4);
for (i = n = 0; i < 1<<mi->b; ++i) { for (i = n = 0; i < 1<<mi->b; ++i) {
idxhash_t *h = (idxhash_t*)mi->B[i].h; idxhash_t *h = (idxhash_t*)mi->B[i].h;
@@ -223,12 +189,18 @@ int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f)
* Sort and generate hash tables * * Sort and generate hash tables *
*********************************/ *********************************/
typedef struct {
mm_idx_t *mi;
int min_occ, max_occ;
} idx_post_t;
static void worker_post(void *g, long i, int tid) static void worker_post(void *g, long i, int tid)
{ {
int n, n_keys; int n, n_keys;
size_t j, start_a, start_p; size_t j, start_a, start_p;
idxhash_t *h; idxhash_t *h;
mm_idx_t *mi = (mm_idx_t*)g; idx_post_t *o = (idx_post_t*)g;
mm_idx_t *mi = o->mi;
mm_idx_bucket_t *b = &mi->B[i]; mm_idx_bucket_t *b = &mi->B[i];
if (b->a.n == 0) return; if (b->a.n == 0) return;
@@ -238,8 +210,10 @@ static void worker_post(void *g, long i, int tid)
// count and preallocate // count and preallocate
for (j = 1, n = 1, n_keys = 0, b->n = 0; j <= b->a.n; ++j) { for (j = 1, n = 1, n_keys = 0, b->n = 0; j <= b->a.n; ++j) {
if (j == b->a.n || b->a.a[j].x>>8 != b->a.a[j-1].x>>8) { if (j == b->a.n || b->a.a[j].x>>8 != b->a.a[j-1].x>>8) {
++n_keys; if (n >= o->min_occ && n <= o->max_occ) {
if (n > 1) b->n += n; ++n_keys;
if (n > 1) b->n += n;
}
n = 1; n = 1;
} else ++n; } else ++n;
} }
@@ -253,18 +227,20 @@ static void worker_post(void *g, long i, int tid)
khint_t itr; khint_t itr;
int absent; int absent;
mm128_t *p = &b->a.a[j-1]; mm128_t *p = &b->a.a[j-1];
itr = kh_put(idx, h, p->x>>8>>mi->b<<1, &absent); if (n >= o->min_occ && n <= o->max_occ) {
assert(absent && j == start_a + n); itr = kh_put(idx, h, p->x>>8>>mi->b<<1, &absent);
if (n == 1) { assert(absent && j == start_a + n);
kh_key(h, itr) |= 1; if (n == 1) {
kh_val(h, itr) = p->y; kh_key(h, itr) |= 1;
} else { kh_val(h, itr) = p->y;
int k; } else {
for (k = 0; k < n; ++k) int k;
b->p[start_p + k] = b->a.a[start_a + k].y; for (k = 0; k < n; ++k)
radix_sort_64(&b->p[start_p], &b->p[start_p + n]); // sort by position; needed as in-place radix_sort_128x() is not stable b->p[start_p + k] = b->a.a[start_a + k].y;
kh_val(h, itr) = (uint64_t)start_p<<32 | n; radix_sort_64(&b->p[start_p], &b->p[start_p + n]); // sort by position; needed as in-place radix_sort_128x() is not stable
start_p += n; kh_val(h, itr) = (uint64_t)start_p<<32 | n;
start_p += n;
}
} }
start_a = j, n = 1; start_a = j, n = 1;
} else ++n; } else ++n;
@@ -277,9 +253,12 @@ static void worker_post(void *g, long i, int tid)
b->a.n = b->a.m = 0, b->a.a = 0; b->a.n = b->a.m = 0, b->a.a = 0;
} }
static void mm_idx_post(mm_idx_t *mi, int n_threads) static void mm_idx_post(mm_idx_t *mi, int n_threads, int min_occ, int max_occ)
{ {
kt_for(n_threads, worker_post, mi, 1<<mi->b); idx_post_t t;
if (max_occ <= 0 || max_occ < min_occ) max_occ = INT_MAX;
t.mi = mi, t.min_occ = min_occ, t.max_occ = max_occ;
kt_for(n_threads, worker_post, &t, 1<<mi->b);
} }
/****************** /******************
@@ -351,7 +330,6 @@ static void *worker_pipeline(void *shared, int step, void *in)
} else seq->name = 0; } else seq->name = 0;
seq->len = s->seq[i].l_seq; seq->len = s->seq[i].l_seq;
seq->offset = p->sum_len; seq->offset = p->sum_len;
seq->is_alt = 0;
// copy the sequence // copy the sequence
if (!(p->mi->flag & MM_I_NO_SEQ)) { if (!(p->mi->flag & MM_I_NO_SEQ)) {
for (j = 0; j < seq->len; ++j) { // TODO: this is not the fastest way, but let's first see if speed matters here for (j = 0; j < seq->len; ++j) { // TODO: this is not the fastest way, but let's first see if speed matters here
@@ -386,7 +364,7 @@ static void *worker_pipeline(void *shared, int step, void *in)
return 0; return 0;
} }
mm_idx_t *mm_idx_gen(mm_bseq_file_t *fp, int w, int k, int b, int flag, int mini_batch_size, int n_threads, uint64_t batch_size) mm_idx_t *mm_idx_gen2(mm_bseq_file_t *fp, int w, int k, int b, int flag, int mini_batch_size, int n_threads, uint64_t batch_size, int min_occ, int max_occ)
{ {
pipeline_t pl; pipeline_t pl;
if (fp == 0 || mm_bseq_eof(fp)) return 0; if (fp == 0 || mm_bseq_eof(fp)) return 0;
@@ -400,13 +378,18 @@ mm_idx_t *mm_idx_gen(mm_bseq_file_t *fp, int w, int k, int b, int flag, int mini
if (mm_verbose >= 3) if (mm_verbose >= 3)
fprintf(stderr, "[M::%s::%.3f*%.2f] collected minimizers\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0)); fprintf(stderr, "[M::%s::%.3f*%.2f] collected minimizers\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0));
mm_idx_post(pl.mi, n_threads); mm_idx_post(pl.mi, n_threads, min_occ, max_occ);
if (mm_verbose >= 3) if (mm_verbose >= 3)
fprintf(stderr, "[M::%s::%.3f*%.2f] sorted minimizers\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0)); fprintf(stderr, "[M::%s::%.3f*%.2f] sorted minimizers\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0));
return pl.mi; return pl.mi;
} }
mm_idx_t *mm_idx_gen(mm_bseq_file_t *fp, int w, int k, int b, int flag, int mini_batch_size, int n_threads, uint64_t batch_size)
{
return mm_idx_gen2(fp, w, k, b, flag, mini_batch_size, n_threads, batch_size, 0, INT_MAX);
}
mm_idx_t *mm_idx_build(const char *fn, int w, int k, int flag, int n_threads) // a simpler interface; deprecated mm_idx_t *mm_idx_build(const char *fn, int w, int k, int flag, int n_threads) // a simpler interface; deprecated
{ {
mm_bseq_file_t *fp; mm_bseq_file_t *fp;
@@ -450,7 +433,6 @@ mm_idx_t *mm_idx_str(int w, int k, int is_hpc, int bucket_bits, int n, const cha
} }
p->offset = sum_len; p->offset = sum_len;
p->len = strlen(s); p->len = strlen(s);
p->is_alt = 0;
for (j = 0; j < p->len; ++j) { for (j = 0; j < p->len; ++j) {
int c = seq_nt4_table[(uint8_t)s[j]]; int c = seq_nt4_table[(uint8_t)s[j]];
uint64_t o = sum_len + j; uint64_t o = sum_len + j;
@@ -464,7 +446,7 @@ mm_idx_t *mm_idx_str(int w, int k, int is_hpc, int bucket_bits, int n, const cha
} }
} }
free(a.a); free(a.a);
mm_idx_post(mi, 1); mm_idx_post(mi, 1, 0, 0);
return mi; return mi;
} }
@@ -537,7 +519,6 @@ mm_idx_t *mm_idx_load(FILE *fp)
} }
fread(&s->len, 4, 1, fp); fread(&s->len, 4, 1, fp);
s->offset = sum_len; s->offset = sum_len;
s->is_alt = 0;
sum_len += s->len; sum_len += s->len;
} }
for (i = 0; i < 1<<mi->b; ++i) { for (i = 0; i < 1<<mi->b; ++i) {
@@ -626,7 +607,7 @@ mm_idx_t *mm_idx_reader_read(mm_idx_reader_t *r, int n_threads)
if (mi && mm_verbose >= 2 && (mi->k != r->opt.k || mi->w != r->opt.w || (mi->flag&MM_I_HPC) != (r->opt.flag&MM_I_HPC))) if (mi && mm_verbose >= 2 && (mi->k != r->opt.k || mi->w != r->opt.w || (mi->flag&MM_I_HPC) != (r->opt.flag&MM_I_HPC)))
fprintf(stderr, "[WARNING]\033[1;31m Indexing parameters (-k, -w or -H) overridden by parameters used in the prebuilt index.\033[0m\n"); fprintf(stderr, "[WARNING]\033[1;31m Indexing parameters (-k, -w or -H) overridden by parameters used in the prebuilt index.\033[0m\n");
} else } else
mi = mm_idx_gen(r->fp.seq, r->opt.w, r->opt.k, r->opt.bucket_bits, r->opt.flag, r->opt.mini_batch_size, n_threads, r->opt.batch_size); mi = mm_idx_gen2(r->fp.seq, r->opt.w, r->opt.k, r->opt.bucket_bits, r->opt.flag, r->opt.mini_batch_size, n_threads, r->opt.batch_size, r->opt.min_occ, r->opt.max_occ);
if (mi) { if (mi) {
if (r->fp_out) mm_idx_dump(r->fp_out, mi); if (r->fp_out) mm_idx_dump(r->fp_out, mi);
mi->index = r->n_parts++; mi->index = r->n_parts++;
@@ -645,41 +626,10 @@ int mm_idx_reader_eof(const mm_idx_reader_t *r) // TODO: in extremely rare cases
#include "kseq.h" #include "kseq.h"
KSTREAM_DECLARE(gzFile, gzread) KSTREAM_DECLARE(gzFile, gzread)
int mm_idx_alt_read(mm_idx_t *mi, const char *fn)
{
int n_alt = 0;
gzFile fp;
kstream_t *ks;
kstring_t str = {0,0,0};
fp = fn && strcmp(fn, "-")? gzopen(fn, "r") : gzdopen(fileno(stdin), "r");
if (fp == 0) return -1;
ks = ks_init(fp);
if (mi->h == 0) mm_idx_index_name(mi);
while (ks_getuntil(ks, KS_SEP_LINE, &str, 0) >= 0) {
char *p;
int id;
for (p = str.s; *p && !isspace(*p); ++p) { }
*p = 0;
id = mm_idx_name2id(mi, str.s);
if (id >= 0) mi->seq[id].is_alt = 1, ++n_alt;
}
mi->n_alt = n_alt;
if (mm_verbose >= 3)
fprintf(stderr, "[M::%s] found %d ALT contigs\n", __func__, n_alt);
return n_alt;
}
/***************
* BED reading *
***************/
#define sort_key_bed(a) ((a).st) #define sort_key_bed(a) ((a).st)
KRADIX_SORT_INIT(bed, mm_idx_intv1_t, sort_key_bed, 4) KRADIX_SORT_INIT(bed, mm_idx_intv1_t, sort_key_bed, 4)
#define sort_key_end(a) ((a).en) mm_idx_intv_t *mm_idx_read_bed(const mm_idx_t *mi, const char *fn, int read_junc)
KRADIX_SORT_INIT(end, mm_idx_intv1_t, sort_key_end, 4)
static mm_idx_intv_t *mm_idx_bed_read_core(const mm_idx_t *mi, const char *fn, int read_junc, int min_sc)
{ {
gzFile fp; gzFile fp;
kstream_t *ks; kstream_t *ks;
@@ -688,7 +638,7 @@ static mm_idx_intv_t *mm_idx_bed_read_core(const mm_idx_t *mi, const char *fn, i
fp = fn && strcmp(fn, "-")? gzopen(fn, "r") : gzdopen(fileno(stdin), "r"); fp = fn && strcmp(fn, "-")? gzopen(fn, "r") : gzdopen(fileno(stdin), "r");
if (fp == 0) return 0; if (fp == 0) return 0;
I = CALLOC(mm_idx_intv_t, mi->n_seq); I = (mm_idx_intv_t*)calloc(mi->n_seq, sizeof(*I));
ks = ks_init(fp); ks = ks_init(fp);
while (ks_getuntil(ks, KS_SEP_LINE, &str, 0) >= 0) { while (ks_getuntil(ks, KS_SEP_LINE, &str, 0) >= 0) {
mm_idx_intv_t *r; mm_idx_intv_t *r;
@@ -696,7 +646,7 @@ static mm_idx_intv_t *mm_idx_bed_read_core(const mm_idx_t *mi, const char *fn, i
char *p, *q, *bl, *bs; char *p, *q, *bl, *bs;
int32_t i, id = -1, n_blk = 0; int32_t i, id = -1, n_blk = 0;
for (p = q = str.s, i = 0;; ++p) { for (p = q = str.s, i = 0;; ++p) {
if (*p == 0 || *p == '\t') { if (*p == 0 || isspace(*p)) {
int32_t c = *p; int32_t c = *p;
*p = 0; *p = 0;
if (i == 0) { // chr if (i == 0) { // chr
@@ -709,7 +659,7 @@ static mm_idx_intv_t *mm_idx_bed_read_core(const mm_idx_t *mi, const char *fn, i
t.en = atol(q); t.en = atol(q);
if (t.en < 0) break; if (t.en < 0) break;
} else if (i == 4) { // BED score } else if (i == 4) { // BED score
t.score = *q >= '0' && *q <= '9'? atol(q) : -1; t.score = atol(q);
} else if (i == 5) { // strand } else if (i == 5) { // strand
t.strand = *q == '+'? 1 : *q == '-'? -1 : 0; t.strand = *q == '+'? 1 : *q == '-'? -1 : 0;
} else if (i == 9) { } else if (i == 9) {
@@ -725,8 +675,7 @@ static mm_idx_intv_t *mm_idx_bed_read_core(const mm_idx_t *mi, const char *fn, i
++i, q = p + 1; ++i, q = p + 1;
} }
} }
if (id < 0 || t.st < 0 || t.st >= t.en) continue; // contig ID not found, or other problems if (id < 0 || t.st < 0 || t.st >= t.en) continue;
if (min_sc > 0 && t.score < min_sc) continue;
r = &I[id]; r = &I[id];
if (i >= 11 && read_junc) { // BED12 if (i >= 11 && read_junc) { // BED12
int32_t st, sz, en; int32_t st, sz, en;
@@ -759,44 +708,14 @@ static mm_idx_intv_t *mm_idx_bed_read_core(const mm_idx_t *mi, const char *fn, i
return I; return I;
} }
static mm_idx_intv_t *mm_idx_bed_read_merge(const mm_idx_t *mi, const char *fn, int read_junc, int min_sc)
{
long n = 0, n0 = 0;
int32_t i;
mm_idx_intv_t *I;
I = mm_idx_bed_read_core(mi, fn, read_junc, min_sc);
if (I == 0) return 0;
for (i = 0; i < mi->n_seq; ++i) {
int32_t j, j0, k;
mm_idx_intv_t *intv = &I[i];
n0 += intv->n;
radix_sort_bed(intv->a, intv->a + intv->n); // sort by st
for (j = 1, j0 = 0; j <= intv->n; ++j) { // sort by st and then by end
if (j == intv->n || intv->a[j].st != intv->a[j0].st) {
radix_sort_end(intv->a + j0, intv->a + j);
j0 = j;
}
}
for (j = 1, j0 = 0, k = 0; j <= intv->n; ++j) { // merge intervals with the same (st, en)
if (j == intv->n || intv->a[j].st != intv->a[j0].st || intv->a[j].en != intv->a[j0].en) {
intv->a[k] = intv->a[j0];
intv->a[k++].cnt = j - j0;
j0 = j;
}
}
intv->a = REALLOC(mm_idx_intv1_t, intv->a, k);
intv->n = intv->m = k;
n += k;
}
if (mm_verbose >= 3)
fprintf(stderr, "[%s] read %ld introns, %ld of which are non-redundant\n", __func__, n0, n);
return I;
}
int mm_idx_bed_read(mm_idx_t *mi, const char *fn, int read_junc) int mm_idx_bed_read(mm_idx_t *mi, const char *fn, int read_junc)
{ {
int32_t i;
if (mi->h == 0) mm_idx_index_name(mi); if (mi->h == 0) mm_idx_index_name(mi);
mi->I = mm_idx_bed_read_merge(mi, fn, read_junc, -1); mi->I = mm_idx_read_bed(mi, fn, read_junc);
if (mi->I == 0) return -1;
for (i = 0; i < mi->n_seq; ++i) // TODO: eliminate redundant intervals
radix_sort_bed(mi->I[i].a, mi->I[i].a + mi->I[i].n);
return 0; return 0;
} }
@@ -824,251 +743,3 @@ int mm_idx_bed_junc(const mm_idx_t *mi, int32_t ctg, int32_t st, int32_t en, uin
} }
return left; return left;
} }
/*********************************
* Reading junctions for jumping *
*********************************/
#define sort_key_jj(a) ((a).off)
KRADIX_SORT_INIT(jj, mm_idx_jjump1_t, sort_key_jj, 4)
#define sort_key_jj2(a) ((a).off2)
KRADIX_SORT_INIT(jj2, mm_idx_jjump1_t, sort_key_jj2, 4)
static void sort_jjump(mm_idx_jjump_t *jj2)
{
int32_t j0, j, k;
if (jj2 == 0 || jj2->n == 0) return;
radix_sort_jj(jj2->a, jj2->a + jj2->n);
for (j0 = 0, j = 1; j <= jj2->n; ++j) {
if (j == jj2->n || jj2->a[j0].off != jj2->a[j].off) {
radix_sort_jj2(jj2->a + j0, jj2->a + j);
j0 = j;
}
}
// the actual merge
for (j0 = 0, j = 1, k = 0; j <= jj2->n; ++j) {
if (j == jj2->n || jj2->a[j0].off != jj2->a[j].off || jj2->a[j0].off2 != jj2->a[j].off2) {
int32_t t, cnt = 0;
uint16_t flag = 0;
for (t = j0; t < j; ++t) cnt += jj2->a[t].cnt, flag |= jj2->a[t].flag;
jj2->a[k] = jj2->a[j0];
jj2->a[k].cnt = cnt;
jj2->a[k++].flag = flag;
j0 = j;
}
}
jj2->n = k;
jj2->a = REALLOC(mm_idx_jjump1_t, jj2->a, k);
}
static mm_idx_jjump_t *mm_idx_bed2jjump(const mm_idx_t *mi, const mm_idx_intv_t *I, uint16_t flag)
{
int32_t i;
mm_idx_jjump_t *J;
J = CALLOC(mm_idx_jjump_t, mi->n_seq);
for (i = 0; i < mi->n_seq; ++i) {
int32_t j, k;
const mm_idx_intv_t *intv = &I[i];
mm_idx_jjump_t *jj = &J[i];
jj->n = intv->n * 2;
jj->a = CALLOC(mm_idx_jjump1_t, jj->n);
for (j = k = 0; j < intv->n; ++j) {
jj->a[k].off = intv->a[j].st, jj->a[k].off2 = intv->a[j].en, jj->a[k].cnt = intv->a[j].cnt, jj->a[k].strand = intv->a[j].strand, jj->a[k++].flag = flag;
jj->a[k].off = intv->a[j].en, jj->a[k].off2 = intv->a[j].st, jj->a[k].cnt = intv->a[j].cnt, jj->a[k].strand = intv->a[j].strand, jj->a[k++].flag = flag;
}
sort_jjump(jj);
}
return J;
}
static mm_idx_jjump_t *mm_idx_jjump_merge(const mm_idx_t *mi, const mm_idx_jjump_t *J0, const mm_idx_jjump_t *J1)
{
int32_t i;
mm_idx_jjump_t *J2;
J2 = CALLOC(mm_idx_jjump_t, mi->n_seq);
for (i = 0; i < mi->n_seq; ++i) {
int32_t j, k;
const mm_idx_jjump_t *jj0 = &J0[i], *jj1 = &J1[i];
mm_idx_jjump_t *jj2 = &J2[i];
jj2->n = jj0->n + jj1->n;
jj2->a = CALLOC(mm_idx_jjump1_t, jj2->n);
for (j = k = 0; j < jj0->n; ++j) jj2->a[k++] = jj0->a[j];
for (j = 0; j < jj1->n; ++j) jj2->a[k++] = jj1->a[j];
sort_jjump(jj2);
}
return J2;
}
int mm_idx_jjump_read(mm_idx_t *mi, const char *fn, int flag, int min_sc)
{
int32_t i, j, n_anno = 0, n_misc = 0;
mm_idx_intv_t *I;
mm_idx_jjump_t *J;
if (mi->h == 0) mm_idx_index_name(mi);
I = mm_idx_bed_read_merge(mi, fn, 1, min_sc);
J = mm_idx_bed2jjump(mi, I, flag);
for (i = 0; i < mi->n_seq; ++i) free(I[i].a);
free(I);
if (mi->J) {
mm_idx_jjump_t *J2;
J2 = mm_idx_jjump_merge(mi, mi->J, J);
for (i = 0; i < mi->n_seq; ++i) {
free(mi->J[i].a); free(J[i].a);
}
free(mi->J); free(J);
mi->J = J2;
} else mi->J = J;
for (i = 0; i < mi->n_seq; ++i) {
for (j = 0; j < mi->J[i].n; ++j)
if (mi->J[i].a[j].flag & MM_JUNC_ANNO) ++n_anno;
else ++n_misc;
}
if (mm_verbose >= 3)
fprintf(stderr, "[%s] there are %d annotated and %d other splice positions in the index\n", __func__, n_anno, n_misc);
return 0;
}
static int32_t mm_idx_jump_get_core(int32_t n, const mm_idx_jjump1_t *a, int32_t x) // similar to mm_idx_find_intv()
{
int32_t s = 0, e = n;
if (n == 0) return -1;
if (x < a[0].off) return -1;
while (s < e) {
int32_t mid = s + (e - s) / 2;
if (x >= a[mid].off && (mid + 1 >= n || x < a[mid+1].off)) return mid;
else if (x < a[mid].off) e = mid;
else s = mid + 1;
}
assert(0);
}
const mm_idx_jjump1_t *mm_idx_jump_get(const mm_idx_t *db, int32_t cid, int32_t st, int32_t en, int32_t *n)
{
mm_idx_jjump_t *s;
int32_t l, r;
*n = 0;
if (cid >= db->n_seq || cid < 0 || db->J == 0) return 0;
if (en < 0 || en > db->seq[cid].len) en = db->seq[cid].len;
s = &db->J[cid];
if (s->n == 0) return 0;
l = mm_idx_jump_get_core(s->n, s->a, st);
r = mm_idx_jump_get_core(s->n, s->a, en);
*n = r - l;
return &s->a[l + 1];
}
/****************
* splice score *
****************/
typedef struct mm_idx_spsc_s {
uint32_t n, m;
uint64_t *a; // pos<<56 | score<<1 | acceptor
} mm_idx_spsc_t;
int32_t mm_idx_spsc_read2(mm_idx_t *idx, const char *fn, int32_t max_sc, float scale)
{
gzFile fp;
kstring_t str = {0,0,0};
kstream_t *ks;
int32_t dret, j;
int64_t n_read = 0;
fp = fn && strcmp(fn, "-") != 0? gzopen(fn, "rb") : gzdopen(0, "rb");
if (fp == 0) return -1;
if (idx->h == 0) mm_idx_index_name(idx);
if (max_sc > 63) max_sc = 63;
idx->spsc = Kcalloc(0, mm_idx_spsc_t, idx->n_seq * 2);
ks = ks_init(fp);
while (ks_getuntil(ks, KS_SEP_LINE, &str, &dret) >= 0) {
mm_idx_spsc_t *s;
char *p, *q, *name = 0;
int32_t i, type = -1, strand = 0, cid = -1, score = -1;
int64_t pos = -1;
for (i = 0, p = q = str.s;; ++p) {
if (*p == '\t' || *p == 0) {
int c = *p;
*p = 0;
if (i == 0) {
name = q;
} else if (i == 1) {
pos = atol(q);
} else if (i == 2) {
strand = *q == '+'? 1 : '-'? -1 : 0;
} else if (i == 3) {
type = *q == 'D'? 0 : *q == 'A'? 1 : -1;
} else if (i == 4) {
score = atoi(q);
break;
}
if (c == 0) break;
q = p + 1, ++i;
}
}
if (i < 4) continue; // not enough fields
if (scale > 0.0f && scale < 1.0f)
score = score > 0.0f? (int)(score * scale + .499) : (int)(score * scale - .499);
if (score > max_sc) score = max_sc;
if (score < -max_sc) score = -max_sc;
cid = mm_idx_name2id(idx, name);
if (cid < 0 || type < 0 || strand == 0 || pos < 0) continue; // FIXME: give a warning!
s = &idx->spsc[cid << 1 | (strand > 0? 0 : 1)];
Kgrow(0, uint64_t, s->a, s->n, s->m);
if (pos > 0 && pos < idx->seq[cid].len) { // ignore scores at the ends
s->a[s->n++] = (uint64_t)pos << 8 | (score + KSW_SPSC_OFFSET) << 1 | type;
++n_read;
}
}
ks_destroy(ks);
gzclose(fp);
for (j = 0; j < idx->n_seq * 2; ++j) {
mm_idx_spsc_t *s = &idx->spsc[j];
if (s->n > 0)
radix_sort_64(s->a, s->a + s->n);
}
if (mm_verbose >= 3)
fprintf(stderr, "[M::%s] read %ld splice scores\n", __func__, (long)n_read);
return 0;
}
int32_t mm_idx_spsc_read(mm_idx_t *idx, const char *fn, int32_t max_sc)
{
return mm_idx_spsc_read2(idx, fn, max_sc, 1.0f);
}
static int32_t mm_idx_find_intv(int32_t n, const uint64_t *a, int64_t x)
{
int32_t s = 0, e = n;
if (n == 0) return -1;
if (x < a[0]>>8) return -1;
while (s < e) {
int32_t mid = s + (e - s) / 2;
if (x >= a[mid]>>8 && (mid + 1 >= n || x < a[mid+1]>>8)) return mid;
else if (x < a[mid]>>8) e = mid;
else s = mid + 1;
}
assert(0);
}
int64_t mm_idx_spsc_get(const mm_idx_t *db, int32_t cid, int64_t st, int64_t en, int32_t rev, uint8_t *sc)
{
const mm_idx_spsc_t *s;
if (cid >= db->n_seq || cid < 0 || db->spsc == 0) return -1;
if (en < 0 || en > db->seq[cid].len) en = db->seq[cid].len;
memset(sc, 0xff, en - st);
s = &db->spsc[cid << 1 | (!!rev)];
if (s->n > 0) {
int32_t j, l, r;
l = mm_idx_find_intv(s->n, s->a, st);
r = mm_idx_find_intv(s->n, s->a, en);
for (j = l + 1; j <= r; ++j) {
int64_t x = (s->a[j]>>8) - st;
uint8_t score = s->a[j] & 0xff;
assert(x <= en - st);
if (x == en - st) continue;
if (sc[x] == 0xff || sc[x] < score) sc[x] = score;
}
}
return en - st;
}
-201
View File
@@ -1,201 +0,0 @@
#include <stdio.h>
#include "mmpriv.h"
#include "kalloc.h"
#define MM_MIN_EXON_LEN 20
static int32_t mm_jump_check(void *km, const mm_idx_t *mi, int32_t qlen, const uint8_t *qseq0, const mm_reg1_t *r, int32_t ext, int32_t is_left) // TODO: check close N
{
int32_t clip, clen, e = !r->rev ^ !is_left; // 0 for left of the alignment; 1 for right
uint32_t cigar;
if (!r->p || r->p->n_cigar <= 0) return -1; // only working with CIGAR
clip = e == 0? r->qs : qlen - r->qe;
cigar = r->p->cigar[is_left? 0 : r->p->n_cigar - 1];
clen = (cigar&0xf) == MM_CIGAR_MATCH? cigar>>4 : 0;
if (clen <= ext) return -1;
if (is_left) {
if (clip >= r->rs) return -1; // no space to jump
} else {
if (clip >= mi->seq[r->rid].len - r->re) return -1; // no space to jump
}
return 0;
}
static uint8_t *mm_jump_get_qseq_seq(void *km, int32_t qlen, const uint8_t *qseq0, const mm_reg1_t *r, int32_t is_left, int32_t ql0, uint8_t *qseq)
{
extern unsigned char seq_nt4_table[256];
int32_t i, k = 0;
if (!r->rev) {
if (is_left)
for (i = 0; i < ql0; ++i)
qseq[k++] = seq_nt4_table[(uint8_t)qseq0[i]];
else
for (i = qlen - ql0; i < qlen; ++i)
qseq[k++] = seq_nt4_table[(uint8_t)qseq0[i]];
} else {
if (is_left)
for (i = qlen - 1; i >= qlen - ql0; --i) {
uint8_t c = seq_nt4_table[(uint8_t)qseq0[i]];
qseq[k++] = c >= 4? c : 3 - c;
}
else
for (i = ql0 - 1; i >= 0; --i) {
uint8_t c = seq_nt4_table[(uint8_t)qseq0[i]];
qseq[k++] = c >= 4? c : 3 - c;
}
}
return qseq;
}
static void mm_jump_split_left(void *km, const mm_idx_t *mi, const mm_mapopt_t *opt, int32_t qlen, const uint8_t *qseq0, mm_reg1_t *r, int32_t ts_strand)
{
uint8_t *tseq = 0, *qseq = 0;
int32_t i, n, l, i0, m, mm0;
int32_t i0_anno = -1, n_anno = 0, mm0_anno = 0, i0_misc = -1, n_misc = 0, mm0_misc = 0;
int32_t ext = 1 + (opt->b + opt->a - 1) / opt->a + 1;
int32_t clip = !r->rev? r->qs : qlen - r->qe;
int32_t extt = clip < ext? clip : ext;
const mm_idx_jjump1_t *a;
if (mm_jump_check(km, mi, qlen, qseq0, r, ext + MM_MIN_EXON_LEN, 1) < 0) return;
a = mm_idx_jump_get(mi, r->rid, r->rs - extt, r->rs + ext, &n);
if (n == 0) return;
for (i = 0; i < n; ++i) { // traverse possible jumps
const mm_idx_jjump1_t *ai = &a[i];
int32_t tlen, tl1, j, mm1, mm2;
assert(ai->off >= r->rs - extt && ai->off <= r->rs + ext);
if (ts_strand * ai->strand < 0) continue; // wrong strand
if (ai->off2 >= ai->off) continue; // wrong direction
if (ai->off - ai->off2 < 6) continue; // intron too small
if (ai->off2 < clip + ext) continue; // not long enough
if (tseq == 0) {
tseq = Kcalloc(km, uint8_t, (clip + ext) * 2); // tseq and qseq are allocated together
qseq = tseq + clip + ext;
mm_jump_get_qseq_seq(km, qlen, qseq0, r, 1, clip + ext, qseq);
}
tl1 = clip + (ai->off - r->rs);
tlen = mm_idx_getseq2(mi, 0, r->rid, ai->off, r->rs + ext, &tseq[tl1]);
assert(tlen == r->rs + ext - ai->off);
tlen = mm_idx_getseq2(mi, 0, r->rid, ai->off2 - tl1, ai->off2, tseq);
assert(tlen == tl1);
for (j = 0, mm1 = 0; j < tl1; ++j)
if (qseq[j] != tseq[j] || qseq[j] > 3 || tseq[j] > 3)
++mm1;
for (mm2 = 0; j < clip + ext; ++j)
if (qseq[j] != tseq[j] || qseq[j] > 3 || tseq[j] > 3)
++mm2;
if (mm1 == 0 && mm2 <= 1) {
if (ai->flag & MM_JUNC_ANNO)
i0_anno = i, mm0_anno = mm1 + mm2, ++n_anno; // i0 points to the rightmost i
else
i0_misc = i, mm0_misc = mm1 + mm2, ++n_misc;
}
}
if (n_anno > 0) m = n_anno, i0 = i0_anno, mm0 = mm0_anno;
else m = n_misc, i0 = i0_misc, mm0 = mm0_misc;
kfree(km, tseq);
l = m > 0? a[i0].off - r->rs : 0; // may be negative
if (m == 1 && clip + l >= opt->jump_min_match) { // add one more exon
mm_enlarge_cigar(r, 2);
memmove(r->p->cigar + 2, r->p->cigar, r->p->n_cigar * 4);
r->p->cigar[0] = (clip + l) << 4 | MM_CIGAR_MATCH;
r->p->cigar[1] = (a[i0].off - a[i0].off2) << 4 | MM_CIGAR_N_SKIP;
r->p->cigar[2] = ((r->p->cigar[2]>>4) - l) << 4 | MM_CIGAR_MATCH;
r->p->n_cigar += 2;
r->rs = a[i0].off2 - (clip + l);
if (!r->rev) r->qs = 0;
else r->qe = qlen;
r->blen += clip, r->mlen += clip - mm0;
r->p->dp_max0 += (clip - mm0) * opt->a - mm0 * opt->b;
r->p->dp_max += (clip - mm0) * opt->a - mm0 * opt->b;
if (!r->is_spliced) r->is_spliced = 1, r->p->dp_max += (opt->a + opt->b) + ((opt->a + opt->b) >> 1);
} else if (m > 0 && a[i0].off > r->rs) { // trim by l; l is always positive
r->p->cigar[0] -= l << 4 | MM_CIGAR_MATCH;
r->rs += l;
if (!r->rev) r->qs += l;
else r->qe -= l;
}
}
static void mm_jump_split_right(void *km, const mm_idx_t *mi, const mm_mapopt_t *opt, int32_t qlen, const uint8_t *qseq0, mm_reg1_t *r, int32_t ts_strand)
{
uint8_t *tseq = 0, *qseq = 0;
int32_t i, n, l, i0, m, mm0;
int32_t i0_anno = -1, n_anno = 0, mm0_anno = 0, i0_misc = -1, n_misc = 0, mm0_misc = 0;
int32_t ext = 1 + (opt->b + opt->a - 1) / opt->a + 1;
int32_t clip = !r->rev? qlen - r->qe : r->qs;
int32_t extt = clip < ext? clip : ext;
const mm_idx_jjump1_t *a;
if (mm_jump_check(km, mi, qlen, qseq0, r, ext + MM_MIN_EXON_LEN, 0) < 0) return;
a = mm_idx_jump_get(mi, r->rid, r->re - ext, r->re + extt, &n);
if (n == 0) return;
for (i = 0; i < n; ++i) { // traverse possible jumps
const mm_idx_jjump1_t *ai = &a[i];
int32_t tlen, tl1, j, mm1, mm2;
assert(ai->off >= r->re - ext && ai->off <= r->re + extt);
if (ts_strand * ai->strand < 0) continue; // wrong strand
if (ai->off2 <= ai->off) continue; // wrong direction
if (ai->off2 - ai->off < 6) continue; // intron too small
if (ai->off2 + clip + ext > mi->seq[r->rid].len) continue; // not long enough
if (tseq == 0) {
tseq = Kcalloc(km, uint8_t, (clip + ext) * 2); // tseq and qseq are allocated together
qseq = tseq + clip + ext;
mm_jump_get_qseq_seq(km, qlen, qseq0, r, 0, clip + ext, qseq);
}
tl1 = clip + (r->re - ai->off);
tlen = mm_idx_getseq2(mi, 0, r->rid, r->re - ext, ai->off, tseq);
assert(tlen == ai->off - (r->re - ext));
tlen = mm_idx_getseq2(mi, 0, r->rid, ai->off2, ai->off2 + tl1, &tseq[clip + ext - tl1]);
assert(tlen == tl1);
for (j = 0, mm2 = 0; j < clip + ext - tl1; ++j)
if (qseq[j] != tseq[j] || qseq[j] > 3 || tseq[j] > 3)
++mm2;
for (mm1 = 0; j < clip + ext; ++j)
if (qseq[j] != tseq[j] || qseq[j] > 3 || tseq[j] > 3)
++mm1;
if (mm1 == 0 && mm2 <= 1) {
if (ai->flag & MM_JUNC_ANNO) {
if (i0_anno < 0) i0_anno = i, mm0_anno = mm1 + mm2;
++n_anno;
} else {
if (i0_misc < 0) i0_misc = i, mm0_misc = mm1 + mm2;
++n_misc;
}
}
}
if (n_anno > 0) m = n_anno, i0 = i0_anno, mm0 = mm0_anno;
else m = n_misc, i0 = i0_misc, mm0 = mm0_misc;
kfree(km, tseq);
l = m > 0? r->re - a[i0].off : 0; // may be negative
if (m == 1 && clip + l >= opt->jump_min_match) { // add one more exon
mm_enlarge_cigar(r, 2);
r->p->cigar[r->p->n_cigar - 1] = ((r->p->cigar[r->p->n_cigar - 1]>>4) - l) << 4 | MM_CIGAR_MATCH;
r->p->cigar[r->p->n_cigar] = (a[i0].off2 - a[i0].off) << 4 | MM_CIGAR_N_SKIP;
r->p->cigar[r->p->n_cigar + 1] = (clip + l) << 4 | MM_CIGAR_MATCH;
r->p->n_cigar += 2;
r->re = a[i0].off2 + (clip + l);
if (!r->rev) r->qe = qlen;
else r->qs = 0;
r->blen += clip, r->mlen += clip - mm0;
r->p->dp_max0 += (clip - mm0) * opt->a - mm0 * opt->b;
r->p->dp_max += (clip - mm0) * opt->a - mm0 * opt->b;
if (!r->is_spliced) r->is_spliced = 1, r->p->dp_max += (opt->a + opt->b) + ((opt->a + opt->b) >> 1);
} else if (m > 0 && r->re > a[i0].off) { // trim by l; l is always positive
r->p->cigar[r->p->n_cigar - 1] -= l << 4 | MM_CIGAR_MATCH;
r->re -= l;
if (!r->rev) r->qe -= l;
else r->qs += l;
}
}
void mm_jump_split(void *km, const mm_idx_t *mi, const mm_mapopt_t *opt, int32_t qlen, const uint8_t *qseq, mm_reg1_t *r, int32_t ts_strand)
{
assert((opt->flag & MM_F_EQX) == 0);
mm_jump_split_left(km, mi, opt, qlen, qseq, r, ts_strand);
mm_jump_split_right(km, mi, opt, qlen, qseq, r, ts_strand);
}
+1 -20
View File
@@ -40,8 +40,7 @@ void *km_init2(void *km_par, size_t min_core_size)
kmem_t *km; kmem_t *km;
km = (kmem_t*)kcalloc(km_par, 1, sizeof(kmem_t)); km = (kmem_t*)kcalloc(km_par, 1, sizeof(kmem_t));
km->par = km_par; km->par = km_par;
if (km_par) km->min_core_size = min_core_size > 0? min_core_size : ((kmem_t*)km_par)->min_core_size - 2; km->min_core_size = min_core_size > 0? min_core_size : 0x80000;
else km->min_core_size = min_core_size > 0? min_core_size : 0x80000;
return (void*)km; return (void*)km;
} }
@@ -184,16 +183,6 @@ void *krealloc(void *_km, void *ap, size_t n_bytes) // TODO: this can be made mo
return q; return q;
} }
void *krelocate(void *km, void *ap, size_t n_bytes)
{
void *p;
if (km == 0 || ap == 0) return ap;
p = kmalloc(km, n_bytes);
memcpy(p, ap, n_bytes);
kfree(km, ap);
return p;
}
void km_stat(const void *_km, km_stat_t *s) void km_stat(const void *_km, km_stat_t *s)
{ {
kmem_t *km = (kmem_t*)_km; kmem_t *km = (kmem_t*)_km;
@@ -214,11 +203,3 @@ void km_stat(const void *_km, km_stat_t *s)
s->largest = s->largest > size? s->largest : size; s->largest = s->largest > size? s->largest : size;
} }
} }
void km_stat_print(const void *km)
{
km_stat_t st;
km_stat(km, &st);
fprintf(stderr, "[km_stat] cap=%ld, avail=%ld, largest=%ld, n_core=%ld, n_block=%ld\n",
st.capacity, st.available, st.largest, st.n_blocks, st.n_cores);
}
-58
View File
@@ -13,7 +13,6 @@ typedef struct {
void *kmalloc(void *km, size_t size); void *kmalloc(void *km, size_t size);
void *krealloc(void *km, void *ptr, size_t size); void *krealloc(void *km, void *ptr, size_t size);
void *krelocate(void *km, void *ap, size_t n_bytes);
void *kcalloc(void *km, size_t count, size_t size); void *kcalloc(void *km, size_t count, size_t size);
void kfree(void *km, void *ptr); void kfree(void *km, void *ptr);
@@ -21,29 +20,11 @@ void *km_init(void);
void *km_init2(void *km_par, size_t min_core_size); void *km_init2(void *km_par, size_t min_core_size);
void km_destroy(void *km); void km_destroy(void *km);
void km_stat(const void *_km, km_stat_t *s); void km_stat(const void *_km, km_stat_t *s);
void km_stat_print(const void *km);
#ifdef __cplusplus #ifdef __cplusplus
} }
#endif #endif
#define Kmalloc(km, type, cnt) ((type*)kmalloc((km), (cnt) * sizeof(type)))
#define Kcalloc(km, type, cnt) ((type*)kcalloc((km), (cnt), sizeof(type)))
#define Krealloc(km, type, ptr, cnt) ((type*)krealloc((km), (ptr), (cnt) * sizeof(type)))
#define Kgrow(km, type, ptr, __i, __m) do { \
if ((__i) >= (__m)) { \
(__m) = (__i) + 1; \
(__m) += ((__m)>>1) + 16; \
(ptr) = Krealloc(km, type, ptr, (__m)); \
} \
} while (0)
#define Kexpand(km, type, a, m) do { \
(m) = (m) >= 4? (m) + ((m)>>1) : 16; \
(a) = Krealloc(km, type, (a), (m)); \
} while (0)
#define KMALLOC(km, ptr, len) ((ptr) = (__typeof__(ptr))kmalloc((km), (len) * sizeof(*(ptr)))) #define KMALLOC(km, ptr, len) ((ptr) = (__typeof__(ptr))kmalloc((km), (len) * sizeof(*(ptr))))
#define KCALLOC(km, ptr, len) ((ptr) = (__typeof__(ptr))kcalloc((km), (len), sizeof(*(ptr)))) #define KCALLOC(km, ptr, len) ((ptr) = (__typeof__(ptr))kcalloc((km), (len), sizeof(*(ptr))))
#define KREALLOC(km, ptr, len) ((ptr) = (__typeof__(ptr))krealloc((km), (ptr), (len) * sizeof(*(ptr)))) #define KREALLOC(km, ptr, len) ((ptr) = (__typeof__(ptr))krealloc((km), (ptr), (len) * sizeof(*(ptr))))
@@ -53,43 +34,4 @@ void km_stat_print(const void *km);
KREALLOC((km), (a), (m)); \ KREALLOC((km), (a), (m)); \
} while (0) } while (0)
#ifndef klib_unused
#if (defined __clang__ && __clang_major__ >= 3) || (defined __GNUC__ && __GNUC__ >= 3)
#define klib_unused __attribute__ ((__unused__))
#else
#define klib_unused
#endif
#endif /* klib_unused */
#define KALLOC_POOL_INIT2(SCOPE, name, kmptype_t) \
typedef struct { \
size_t cnt, n, max; \
kmptype_t **buf; \
void *km; \
} kmp_##name##_t; \
SCOPE kmp_##name##_t *kmp_init_##name(void *km) { \
kmp_##name##_t *mp; \
mp = Kcalloc(km, kmp_##name##_t, 1); \
mp->km = km; \
return mp; \
} \
SCOPE void kmp_destroy_##name(kmp_##name##_t *mp) { \
size_t k; \
for (k = 0; k < mp->n; ++k) kfree(mp->km, mp->buf[k]); \
kfree(mp->km, mp->buf); kfree(mp->km, mp); \
} \
SCOPE kmptype_t *kmp_alloc_##name(kmp_##name##_t *mp) { \
++mp->cnt; \
if (mp->n == 0) return (kmptype_t*)kcalloc(mp->km, 1, sizeof(kmptype_t)); \
return mp->buf[--mp->n]; \
} \
SCOPE void kmp_free_##name(kmp_##name##_t *mp, kmptype_t *p) { \
--mp->cnt; \
if (mp->n == mp->max) Kexpand(mp->km, kmptype_t*, mp->buf, mp->max); \
mp->buf[mp->n++] = p; \
}
#define KALLOC_POOL_INIT(name, kmptype_t) \
KALLOC_POOL_INIT2(static inline klib_unused, name, kmptype_t)
#endif #endif
-474
View File
@@ -1,474 +0,0 @@
/* The MIT License
Copyright (c) 2019 by Attractive Chaos <attractor@live.co.uk>
Permission is hereby granted, free of charge, to any person obtaining
a copy of this software and associated documentation files (the
"Software"), to deal in the Software without restriction, including
without limitation the rights to use, copy, modify, merge, publish,
distribute, sublicense, and/or sell copies of the Software, and to
permit persons to whom the Software is furnished to do so, subject to
the following conditions:
The above copyright notice and this permission notice shall be
included in all copies or substantial portions of the Software.
THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS
BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN
ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN
CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
SOFTWARE.
*/
/* An example:
#include <stdio.h>
#include <string.h>
#include <stdlib.h>
#include "krmq.h"
struct my_node {
char key;
KRMQ_HEAD(struct my_node) head;
};
#define my_cmp(p, q) (((q)->key < (p)->key) - ((p)->key < (q)->key))
KRMQ_INIT(my, struct my_node, head, my_cmp)
int main(void) {
const char *str = "MNOLKQOPHIA"; // from wiki, except a duplicate
struct my_node *root = 0;
int i, l = strlen(str);
for (i = 0; i < l; ++i) { // insert in the input order
struct my_node *q, *p = malloc(sizeof(*p));
p->key = str[i];
q = krmq_insert(my, &root, p, 0);
if (p != q) free(p); // if already present, free
}
krmq_itr_t(my) itr;
krmq_itr_first(my, root, &itr); // place at first
do { // traverse
const struct my_node *p = krmq_at(&itr);
putchar(p->key);
free((void*)p); // free node
} while (krmq_itr_next(my, &itr));
putchar('\n');
return 0;
}
*/
#ifndef KRMQ_H
#define KRMQ_H
#ifdef __STRICT_ANSI__
#define inline __inline__
#endif
#define KRMQ_MAX_DEPTH 64
#define krmq_size(head, p) ((p)? (p)->head.size : 0)
#define krmq_size_child(head, q, i) ((q)->head.p[(i)]? (q)->head.p[(i)]->head.size : 0)
#define KRMQ_HEAD(__type) \
struct { \
__type *p[2], *s; \
signed char balance; /* balance factor */ \
unsigned size; /* #elements in subtree */ \
}
#define __KRMQ_FIND(suf, __scope, __type, __head, __cmp) \
__scope __type *krmq_find_##suf(const __type *root, const __type *x, unsigned *cnt_) { \
const __type *p = root; \
unsigned cnt = 0; \
while (p != 0) { \
int cmp; \
cmp = __cmp(x, p); \
if (cmp >= 0) cnt += krmq_size_child(__head, p, 0) + 1; \
if (cmp < 0) p = p->__head.p[0]; \
else if (cmp > 0) p = p->__head.p[1]; \
else break; \
} \
if (cnt_) *cnt_ = cnt; \
return (__type*)p; \
} \
__scope __type *krmq_interval_##suf(const __type *root, const __type *x, __type **lower, __type **upper) { \
const __type *p = root, *l = 0, *u = 0; \
while (p != 0) { \
int cmp; \
cmp = __cmp(x, p); \
if (cmp < 0) u = p, p = p->__head.p[0]; \
else if (cmp > 0) l = p, p = p->__head.p[1]; \
else { l = u = p; break; } \
} \
if (lower) *lower = (__type*)l; \
if (upper) *upper = (__type*)u; \
return (__type*)p; \
}
#define __KRMQ_RMQ(suf, __scope, __type, __head, __cmp, __lt2) \
__scope __type *krmq_rmq_##suf(const __type *root, const __type *lo, const __type *up) { /* CLOSED interval */ \
const __type *p = root, *path[2][KRMQ_MAX_DEPTH], *min; \
int plen[2] = {0, 0}, pcmp[2][KRMQ_MAX_DEPTH], i, cmp, lca; \
if (root == 0) return 0; \
while (p) { \
cmp = __cmp(lo, p); \
path[0][plen[0]] = p, pcmp[0][plen[0]++] = cmp; \
if (cmp < 0) p = p->__head.p[0]; \
else if (cmp > 0) p = p->__head.p[1]; \
else break; \
} \
p = root; \
while (p) { \
cmp = __cmp(up, p); \
path[1][plen[1]] = p, pcmp[1][plen[1]++] = cmp; \
if (cmp < 0) p = p->__head.p[0]; \
else if (cmp > 0) p = p->__head.p[1]; \
else break; \
} \
for (i = 0; i < plen[0] && i < plen[1]; ++i) /* find the LCA */ \
if (path[0][i] == path[1][i] && pcmp[0][i] <= 0 && pcmp[1][i] >= 0) \
break; \
if (i == plen[0] || i == plen[1]) return 0; /* no elements in the closed interval */ \
lca = i, min = path[0][lca]; \
for (i = lca + 1; i < plen[0]; ++i) { \
if (pcmp[0][i] <= 0) { \
if (__lt2(path[0][i], min)) min = path[0][i]; \
if (path[0][i]->__head.p[1] && __lt2(path[0][i]->__head.p[1]->__head.s, min)) \
min = path[0][i]->__head.p[1]->__head.s; \
} \
} \
for (i = lca + 1; i < plen[1]; ++i) { \
if (pcmp[1][i] >= 0) { \
if (__lt2(path[1][i], min)) min = path[1][i]; \
if (path[1][i]->__head.p[0] && __lt2(path[1][i]->__head.p[0]->__head.s, min)) \
min = path[1][i]->__head.p[0]->__head.s; \
} \
} \
return (__type*)min; \
}
#define __KRMQ_ROTATE(suf, __type, __head, __lt2) \
/* */ \
static inline void krmq_update_min_##suf(__type *p, const __type *q, const __type *r) { \
p->__head.s = !q || __lt2(p, q->__head.s)? p : q->__head.s; \
p->__head.s = !r || __lt2(p->__head.s, r->__head.s)? p->__head.s : r->__head.s; \
} \
/* one rotation: (a,(b,c)q)p => ((a,b)p,c)q */ \
static inline __type *krmq_rotate1_##suf(__type *p, int dir) { /* dir=0 to left; dir=1 to right */ \
int opp = 1 - dir; /* opposite direction */ \
__type *q = p->__head.p[opp], *s = p->__head.s; \
unsigned size_p = p->__head.size; \
p->__head.size -= q->__head.size - krmq_size_child(__head, q, dir); \
q->__head.size = size_p; \
krmq_update_min_##suf(p, p->__head.p[dir], q->__head.p[dir]); \
q->__head.s = s; \
p->__head.p[opp] = q->__head.p[dir]; \
q->__head.p[dir] = p; \
return q; \
} \
/* two consecutive rotations: (a,((b,c)r,d)q)p => ((a,b)p,(c,d)q)r */ \
static inline __type *krmq_rotate2_##suf(__type *p, int dir) { \
int b1, opp = 1 - dir; \
__type *q = p->__head.p[opp], *r = q->__head.p[dir], *s = p->__head.s; \
unsigned size_x_dir = krmq_size_child(__head, r, dir); \
r->__head.size = p->__head.size; \
p->__head.size -= q->__head.size - size_x_dir; \
q->__head.size -= size_x_dir + 1; \
krmq_update_min_##suf(p, p->__head.p[dir], r->__head.p[dir]); \
krmq_update_min_##suf(q, q->__head.p[opp], r->__head.p[opp]); \
r->__head.s = s; \
p->__head.p[opp] = r->__head.p[dir]; \
r->__head.p[dir] = p; \
q->__head.p[dir] = r->__head.p[opp]; \
r->__head.p[opp] = q; \
b1 = dir == 0? +1 : -1; \
if (r->__head.balance == b1) q->__head.balance = 0, p->__head.balance = -b1; \
else if (r->__head.balance == 0) q->__head.balance = p->__head.balance = 0; \
else q->__head.balance = b1, p->__head.balance = 0; \
r->__head.balance = 0; \
return r; \
}
#define __KRMQ_INSERT(suf, __scope, __type, __head, __cmp, __lt2) \
__scope __type *krmq_insert_##suf(__type **root_, __type *x, unsigned *cnt_) { \
unsigned char stack[KRMQ_MAX_DEPTH]; \
__type *path[KRMQ_MAX_DEPTH]; \
__type *bp, *bq; \
__type *p, *q, *r = 0; /* _r_ is potentially the new root */ \
int i, which = 0, top, b1, path_len; \
unsigned cnt = 0; \
bp = *root_, bq = 0; \
/* find the insertion location */ \
for (p = bp, q = bq, top = path_len = 0; p; q = p, p = p->__head.p[which]) { \
int cmp; \
cmp = __cmp(x, p); \
if (cmp >= 0) cnt += krmq_size_child(__head, p, 0) + 1; \
if (cmp == 0) { \
if (cnt_) *cnt_ = cnt; \
return p; \
} \
if (p->__head.balance != 0) \
bq = q, bp = p, top = 0; \
stack[top++] = which = (cmp > 0); \
path[path_len++] = p; \
} \
if (cnt_) *cnt_ = cnt; \
x->__head.balance = 0, x->__head.size = 1, x->__head.p[0] = x->__head.p[1] = 0, x->__head.s = x; \
if (q == 0) *root_ = x; \
else q->__head.p[which] = x; \
if (bp == 0) return x; \
for (i = 0; i < path_len; ++i) ++path[i]->__head.size; \
for (i = path_len - 1; i >= 0; --i) { \
krmq_update_min_##suf(path[i], path[i]->__head.p[0], path[i]->__head.p[1]); \
if (path[i]->__head.s != x) break; \
} \
for (p = bp, top = 0; p != x; p = p->__head.p[stack[top]], ++top) /* update balance factors */ \
if (stack[top] == 0) --p->__head.balance; \
else ++p->__head.balance; \
if (bp->__head.balance > -2 && bp->__head.balance < 2) return x; /* no re-balance needed */ \
/* re-balance */ \
which = (bp->__head.balance < 0); \
b1 = which == 0? +1 : -1; \
q = bp->__head.p[1 - which]; \
if (q->__head.balance == b1) { \
r = krmq_rotate1_##suf(bp, which); \
q->__head.balance = bp->__head.balance = 0; \
} else r = krmq_rotate2_##suf(bp, which); \
if (bq == 0) *root_ = r; \
else bq->__head.p[bp != bq->__head.p[0]] = r; \
return x; \
}
#define __KRMQ_ERASE(suf, __scope, __type, __head, __cmp, __lt2) \
__scope __type *krmq_erase_##suf(__type **root_, const __type *x, unsigned *cnt_) { \
__type *p, *path[KRMQ_MAX_DEPTH], fake; \
unsigned char dir[KRMQ_MAX_DEPTH]; \
int i, d = 0, cmp; \
unsigned cnt = 0; \
fake = **root_, fake.__head.p[0] = *root_, fake.__head.p[1] = 0; \
if (cnt_) *cnt_ = 0; \
if (x) { \
for (cmp = -1, p = &fake; cmp; cmp = __cmp(x, p)) { \
int which = (cmp > 0); \
if (cmp > 0) cnt += krmq_size_child(__head, p, 0) + 1; \
dir[d] = which; \
path[d++] = p; \
p = p->__head.p[which]; \
if (p == 0) { \
if (cnt_) *cnt_ = 0; \
return 0; \
} \
} \
cnt += krmq_size_child(__head, p, 0) + 1; /* because p==x is not counted */ \
} else { \
for (p = &fake, cnt = 1; p; p = p->__head.p[0]) \
dir[d] = 0, path[d++] = p; \
p = path[--d]; \
} \
if (cnt_) *cnt_ = cnt; \
for (i = 1; i < d; ++i) --path[i]->__head.size; \
if (p->__head.p[1] == 0) { /* ((1,.)2,3)4 => (1,3)4; p=2 */ \
path[d-1]->__head.p[dir[d-1]] = p->__head.p[0]; \
} else { \
__type *q = p->__head.p[1]; \
if (q->__head.p[0] == 0) { /* ((1,2)3,4)5 => ((1)2,4)5; p=3,q=2 */ \
q->__head.p[0] = p->__head.p[0]; \
q->__head.balance = p->__head.balance; \
path[d-1]->__head.p[dir[d-1]] = q; \
path[d] = q, dir[d++] = 1; \
q->__head.size = p->__head.size - 1; \
} else { /* ((1,((.,2)3,4)5)6,7)8 => ((1,(2,4)5)3,7)8; p=6 */ \
__type *r; \
int e = d++; /* backup _d_ */\
for (;;) { \
dir[d] = 0; \
path[d++] = q; \
r = q->__head.p[0]; \
if (r->__head.p[0] == 0) break; \
q = r; \
} \
r->__head.p[0] = p->__head.p[0]; \
q->__head.p[0] = r->__head.p[1]; \
r->__head.p[1] = p->__head.p[1]; \
r->__head.balance = p->__head.balance; \
path[e-1]->__head.p[dir[e-1]] = r; \
path[e] = r, dir[e] = 1; \
for (i = e + 1; i < d; ++i) --path[i]->__head.size; \
r->__head.size = p->__head.size - 1; \
} \
} \
for (i = d - 1; i >= 0; --i) /* not sure why adding condition "path[i]->__head.s==p" doesn't work */ \
krmq_update_min_##suf(path[i], path[i]->__head.p[0], path[i]->__head.p[1]); \
while (--d > 0) { \
__type *q = path[d]; \
int which, other, b1 = 1, b2 = 2; \
which = dir[d], other = 1 - which; \
if (which) b1 = -b1, b2 = -b2; \
q->__head.balance += b1; \
if (q->__head.balance == b1) break; \
else if (q->__head.balance == b2) { \
__type *r = q->__head.p[other]; \
if (r->__head.balance == -b1) { \
path[d-1]->__head.p[dir[d-1]] = krmq_rotate2_##suf(q, which); \
} else { \
path[d-1]->__head.p[dir[d-1]] = krmq_rotate1_##suf(q, which); \
if (r->__head.balance == 0) { \
r->__head.balance = -b1; \
q->__head.balance = b1; \
break; \
} else r->__head.balance = q->__head.balance = 0; \
} \
} \
} \
*root_ = fake.__head.p[0]; \
return p; \
}
#define krmq_free(__type, __head, __root, __free) do { \
__type *_p, *_q; \
for (_p = __root; _p; _p = _q) { \
if (_p->__head.p[0] == 0) { \
_q = _p->__head.p[1]; \
__free(_p); \
} else { \
_q = _p->__head.p[0]; \
_p->__head.p[0] = _q->__head.p[1]; \
_q->__head.p[1] = _p; \
} \
} \
} while (0)
#define __KRMQ_ITR(suf, __scope, __type, __head, __cmp) \
struct krmq_itr_##suf { \
const __type *stack[KRMQ_MAX_DEPTH], **top; \
}; \
__scope void krmq_itr_first_##suf(const __type *root, struct krmq_itr_##suf *itr) { \
const __type *p; \
for (itr->top = itr->stack - 1, p = root; p; p = p->__head.p[0]) \
*++itr->top = p; \
} \
__scope int krmq_itr_find_##suf(const __type *root, const __type *x, struct krmq_itr_##suf *itr) { \
const __type *p = root; \
itr->top = itr->stack - 1; \
while (p != 0) { \
int cmp; \
*++itr->top = p; \
cmp = __cmp(x, p); \
if (cmp < 0) p = p->__head.p[0]; \
else if (cmp > 0) p = p->__head.p[1]; \
else break; \
} \
return p? 1 : 0; \
} \
__scope int krmq_itr_next_bidir_##suf(struct krmq_itr_##suf *itr, int dir) { \
const __type *p; \
if (itr->top < itr->stack) return 0; \
dir = !!dir; \
p = (*itr->top)->__head.p[dir]; \
if (p) { /* go down */ \
for (; p; p = p->__head.p[!dir]) \
*++itr->top = p; \
return 1; \
} else { /* go up */ \
do { \
p = *itr->top--; \
} while (itr->top >= itr->stack && p == (*itr->top)->__head.p[dir]); \
return itr->top < itr->stack? 0 : 1; \
} \
} \
/**
* Insert a node to the tree
*
* @param suf name suffix used in KRMQ_INIT()
* @param proot pointer to the root of the tree (in/out: root may change)
* @param x node to insert (in)
* @param cnt number of nodes smaller than or equal to _x_; can be NULL (out)
*
* @return _x_ if not present in the tree, or the node equal to x.
*/
#define krmq_insert(suf, proot, x, cnt) krmq_insert_##suf(proot, x, cnt)
/**
* Find a node in the tree
*
* @param suf name suffix used in KRMQ_INIT()
* @param root root of the tree
* @param x node value to find (in)
* @param cnt number of nodes smaller than or equal to _x_; can be NULL (out)
*
* @return node equal to _x_ if present, or NULL if absent
*/
#define krmq_find(suf, root, x, cnt) krmq_find_##suf(root, x, cnt)
#define krmq_interval(suf, root, x, lower, upper) krmq_interval_##suf(root, x, lower, upper)
#define krmq_rmq(suf, root, lo, up) krmq_rmq_##suf(root, lo, up)
/**
* Delete a node from the tree
*
* @param suf name suffix used in KRMQ_INIT()
* @param proot pointer to the root of the tree (in/out: root may change)
* @param x node value to delete; if NULL, delete the first node (in)
*
* @return node removed from the tree if present, or NULL if absent
*/
#define krmq_erase(suf, proot, x, cnt) krmq_erase_##suf(proot, x, cnt)
#define krmq_erase_first(suf, proot) krmq_erase_##suf(proot, 0, 0)
#define krmq_itr_t(suf) struct krmq_itr_##suf
/**
* Place the iterator at the smallest object
*
* @param suf name suffix used in KRMQ_INIT()
* @param root root of the tree
* @param itr iterator
*/
#define krmq_itr_first(suf, root, itr) krmq_itr_first_##suf(root, itr)
/**
* Place the iterator at the object equal to or greater than the query
*
* @param suf name suffix used in KRMQ_INIT()
* @param root root of the tree
* @param x query (in)
* @param itr iterator (out)
*
* @return 1 if find; 0 otherwise. krmq_at(itr) is NULL if and only if query is
* larger than all objects in the tree
*/
#define krmq_itr_find(suf, root, x, itr) krmq_itr_find_##suf(root, x, itr)
/**
* Move to the next object in order
*
* @param itr iterator (modified)
*
* @return 1 if there is a next object; 0 otherwise
*/
#define krmq_itr_next(suf, itr) krmq_itr_next_bidir_##suf(itr, 1)
#define krmq_itr_prev(suf, itr) krmq_itr_next_bidir_##suf(itr, 0)
/**
* Return the pointer at the iterator
*
* @param itr iterator
*
* @return pointer if present; NULL otherwise
*/
#define krmq_at(itr) ((itr)->top < (itr)->stack? 0 : *(itr)->top)
#define KRMQ_INIT2(suf, __scope, __type, __head, __cmp, __lt2) \
__KRMQ_FIND(suf, __scope, __type, __head, __cmp) \
__KRMQ_RMQ(suf, __scope, __type, __head, __cmp, __lt2) \
__KRMQ_ROTATE(suf, __type, __head, __lt2) \
__KRMQ_INSERT(suf, __scope, __type, __head, __cmp, __lt2) \
__KRMQ_ERASE(suf, __scope, __type, __head, __cmp, __lt2) \
__KRMQ_ITR(suf, __scope, __type, __head, __cmp)
#define KRMQ_INIT(suf, __type, __head, __cmp, __lt2) \
KRMQ_INIT2(suf,, __type, __head, __cmp, __lt2)
#endif
+1 -1
View File
@@ -89,7 +89,7 @@
#ifndef KSTRING_T #ifndef KSTRING_T
#define KSTRING_T kstring_t #define KSTRING_T kstring_t
typedef struct __kstring_t { typedef struct __kstring_t {
size_t l, m; unsigned l, m;
char *s; char *s;
} kstring_t; } kstring_t;
#endif #endif
+7 -18
View File
@@ -15,17 +15,6 @@
#define KSW_EZ_SPLICE_FOR 0x100 #define KSW_EZ_SPLICE_FOR 0x100
#define KSW_EZ_SPLICE_REV 0x200 #define KSW_EZ_SPLICE_REV 0x200
#define KSW_EZ_SPLICE_FLANK 0x400 #define KSW_EZ_SPLICE_FLANK 0x400
#define KSW_EZ_SPLICE_CMPLX 0x800 // use the miniprot splice model
#define KSW_EZ_SPLICE_SCORE 0x1000 // use splice score
// The subset of CIGAR operators used by ksw code.
// Use MM_CIGAR_* from minimap.h if you need the full list.
#define KSW_CIGAR_MATCH 0
#define KSW_CIGAR_INS 1
#define KSW_CIGAR_DEL 2
#define KSW_CIGAR_N_SKIP 3
#define KSW_SPSC_OFFSET 64
#ifdef __cplusplus #ifdef __cplusplus
extern "C" { extern "C" {
@@ -72,7 +61,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
int8_t gapo, int8_t gape, int8_t gapo2, int8_t gape2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez); int8_t gapo, int8_t gape, int8_t gapo2, int8_t gape2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t gapo, int8_t gape, int8_t gapo2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez); int8_t gapo, int8_t gape, int8_t gapo2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez);
void ksw_extf2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t mch, int8_t mis, int8_t e, int w, int xdrop, ksw_extz_t *ez); void ksw_extf2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t mch, int8_t mis, int8_t e, int w, int xdrop, ksw_extz_t *ez);
@@ -148,13 +137,13 @@ static inline void ksw_backtrack(void *km, int is_rot, int is_rev, int min_intro
else if (!(tmp >> (state + 2) & 1)) state = 0; // if requesting other states, _state_ stays the same if it is a continuation; otherwise, set to H else if (!(tmp >> (state + 2) & 1)) state = 0; // if requesting other states, _state_ stays the same if it is a continuation; otherwise, set to H
if (state == 0) state = tmp & 7; // TODO: probably this line can be merged into the "else if" line right above; not 100% sure if (state == 0) state = tmp & 7; // TODO: probably this line can be merged into the "else if" line right above; not 100% sure
if (force_state >= 0) state = force_state; if (force_state >= 0) state = force_state;
if (state == 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, KSW_CIGAR_MATCH, 1), --i, --j; if (state == 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 0, 1), --i, --j; // match
else if (state == 1 || (state == 3 && min_intron_len <= 0)) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, KSW_CIGAR_DEL, 1), --i; else if (state == 1 || (state == 3 && min_intron_len <= 0)) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 2, 1), --i; // deletion
else if (state == 3 && min_intron_len > 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, KSW_CIGAR_N_SKIP, 1), --i; else if (state == 3 && min_intron_len > 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 3, 1), --i; // intron
else cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, KSW_CIGAR_INS, 1), --j; else cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 1, 1), --j; // insertion
} }
if (i >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, min_intron_len > 0 && i >= min_intron_len? KSW_CIGAR_N_SKIP : KSW_CIGAR_DEL, i + 1); // first deletion if (i >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, min_intron_len > 0 && i >= min_intron_len? 3 : 2, i + 1); // first deletion
if (j >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, KSW_CIGAR_INS, j + 1); // first insertion if (j >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 1, j + 1); // first insertion
if (!is_rev) if (!is_rev)
for (i = 0; i < n_cigar>>1; ++i) // reverse CIGAR for (i = 0; i < n_cigar>>1; ++i) // reverse CIGAR
tmp = cigar[i], cigar[i] = cigar[n_cigar-1-i], cigar[n_cigar-1-i] = tmp; tmp = cigar[i], cigar[i] = cigar[n_cigar-1-i], cigar[n_cigar-1-i] = tmp;
+5 -5
View File
@@ -80,17 +80,17 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
} }
void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez) int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez)
{ {
extern void ksw_exts2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, extern void ksw_exts2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez); int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez);
extern void ksw_exts2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, extern void ksw_exts2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez); int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez);
if (ksw_simd < 0) ksw_simd = x86_simd(); if (ksw_simd < 0) ksw_simd = x86_simd();
if (ksw_simd & SIMD_SSE4_1) if (ksw_simd & SIMD_SSE4_1)
ksw_exts2_sse41(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, end_bonus, junc_bonus, junc_pen, flag, junc, ez); ksw_exts2_sse41(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, junc_bonus, flag, junc, ez);
else if (ksw_simd & SIMD_SSE2) else if (ksw_simd & SIMD_SSE2)
ksw_exts2_sse2(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, end_bonus, junc_bonus, junc_pen, flag, junc, ez); ksw_exts2_sse2(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, junc_bonus, flag, junc, ez);
else abort(); else abort();
} }
#endif #endif
+1 -9
View File
@@ -4,23 +4,15 @@
#include "ksw2.h" #include "ksw2.h"
#ifdef __SSE2__ #ifdef __SSE2__
#ifdef USE_SIMDE
#include <simde/x86/sse2.h>
#else
#include <emmintrin.h> #include <emmintrin.h>
#endif
#ifdef KSW_SSE2_ONLY #ifdef KSW_SSE2_ONLY
#undef __SSE4_1__ #undef __SSE4_1__
#endif #endif
#ifdef __SSE4_1__ #ifdef __SSE4_1__
#ifdef USE_SIMDE
#include <simde/x86/sse4.1.h>
#else
#include <smmintrin.h> #include <smmintrin.h>
#endif #endif
#endif
#ifdef KSW_CPU_DISPATCH #ifdef KSW_CPU_DISPATCH
#ifdef __SSE4_1__ #ifdef __SSE4_1__
@@ -358,7 +350,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
} else H[0] = v8[0] - qe, max_H = H[0], max_t = 0; // special casing r==0 } else H[0] = v8[0] - qe, max_H = H[0], max_t = 0; // special casing r==0
// update ez // update ez
if (en0 == tlen - 1 && H[en0] > ez->mte) if (en0 == tlen - 1 && H[en0] > ez->mte)
ez->mte = H[en0], ez->mte_q = r - en0; ez->mte = H[en0], ez->mte_q = r - en;
if (r - st0 == qlen - 1 && H[st0] > ez->mqe) if (r - st0 == qlen - 1 && H[st0] > ez->mqe)
ez->mqe = H[st0], ez->mqe_t = st0; ez->mqe = H[st0], ez->mqe_t = st0;
if (ksw_apply_zdrop(ez, 1, max_H, r, max_t, zdrop, e2)) break; if (ksw_apply_zdrop(ez, 1, max_H, r, max_t, zdrop, e2)) break;
+46 -103
View File
@@ -4,34 +4,27 @@
#include "ksw2.h" #include "ksw2.h"
#ifdef __SSE2__ #ifdef __SSE2__
#ifdef USE_SIMDE
#include <simde/x86/sse2.h>
#else
#include <emmintrin.h> #include <emmintrin.h>
#endif
#ifdef KSW_SSE2_ONLY #ifdef KSW_SSE2_ONLY
#undef __SSE4_1__ #undef __SSE4_1__
#endif #endif
#ifdef __SSE4_1__ #ifdef __SSE4_1__
#ifdef USE_SIMDE
#include <simde/x86/sse4.1.h>
#else
#include <smmintrin.h> #include <smmintrin.h>
#endif #endif
#endif
#ifdef KSW_CPU_DISPATCH #ifdef KSW_CPU_DISPATCH
#ifdef __SSE4_1__ #ifdef __SSE4_1__
void ksw_exts2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, void ksw_exts2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez) int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez)
#else #else
void ksw_exts2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, void ksw_exts2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez) int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez)
#endif #endif
#else #else
void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez) int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez)
#endif // ~KSW_CPU_DISPATCH #endif // ~KSW_CPU_DISPATCH
{ {
#define __dp_code_block1 \ #define __dp_code_block1 \
@@ -71,7 +64,6 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
ksw_reset_extz(ez); ksw_reset_extz(ez);
if (m <= 1 || qlen <= 0 || tlen <= 0 || q2 <= q + e) return; if (m <= 1 || qlen <= 0 || tlen <= 0 || q2 <= q + e) return;
assert((flag & KSW_EZ_SPLICE_FOR) == 0 || (flag & KSW_EZ_SPLICE_REV) == 0); // can't be both set
zero_ = _mm_set1_epi8(0); zero_ = _mm_set1_epi8(0);
q_ = _mm_set1_epi8(q); q_ = _mm_set1_epi8(q);
@@ -119,100 +111,55 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
// set the donor and acceptor arrays. TODO: this assumes 0/1/2/3 encoding! // set the donor and acceptor arrays. TODO: this assumes 0/1/2/3 encoding!
if (flag & (KSW_EZ_SPLICE_FOR|KSW_EZ_SPLICE_REV)) { if (flag & (KSW_EZ_SPLICE_FOR|KSW_EZ_SPLICE_REV)) {
const int sp0[4] = { 8, 15, 21, 30 }; int semi_cost = flag&KSW_EZ_SPLICE_FLANK? -noncan/2 : 0; // GTr or yAG is worth 0.5 bit; see PMID:18688272
int sp[4]; memset(donor, -noncan, tlen_ * 16);
if (flag & KSW_EZ_SPLICE_CMPLX) { memset(acceptor, -noncan, tlen_ * 16);
for (t = 0; t < 4; ++t)
sp[t] = (int)((double)sp0[t] / 3. + .499);
} else {
sp[0] = flag&KSW_EZ_SPLICE_FLANK? noncan / 2 : 0;
sp[1] = sp[2] = sp[3] = noncan;
}
memset(donor, -sp[3], tlen_ * 16);
memset(acceptor, -sp[3], tlen_ * 16);
if (!(flag & KSW_EZ_REV_CIGAR)) { if (!(flag & KSW_EZ_REV_CIGAR)) {
for (t = 0; t < tlen - 4; ++t) { for (t = 0; t < tlen - 4; ++t) {
int z = 3; int can_type = 0; // type of canonical site: 0=none, 1=GT/AG only, 2=GTr/yAG
if (flag & KSW_EZ_SPLICE_FOR) { if ((flag & KSW_EZ_SPLICE_FOR) && target[t+1] == 2 && target[t+2] == 3) can_type = 1; // GTr...
if (target[t+1] == 2 && target[t+2] == 3) // |GT. if ((flag & KSW_EZ_SPLICE_REV) && target[t+1] == 1 && target[t+2] == 3) can_type = 1; // CTr...
z = target[t+3] == 0 || target[t+3] == 2? -1 : 0; // |GTr or not if (can_type && (target[t+3] == 0 || target[t+3] == 2)) can_type = 2;
else if (target[t+1] == 2 && target[t+2] == 1) z = 1; // |GC. if (can_type) ((int8_t*)donor)[t] = can_type == 2? 0 : semi_cost;
else if (target[t+1] == 0 && target[t+2] == 3) z = 2; // |AT.
} else if (flag & KSW_EZ_SPLICE_REV) {
if (target[t+1] == 1 && target[t+2] == 3) // |CT. (revcomp of .AG|)
z = target[t+3] == 0 || target[t+3] == 2? -1 : 0;
else if (target[t+1] == 2 && target[t+2] == 3) z = 2; // |GT. (revcomp of .AC|)
}
((int8_t*)donor)[t] = z < 0? 0 : -sp[z];
} }
if (junc)
for (t = 0; t < tlen - 1; ++t)
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t+1]&1)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t+1]&8)))
((int8_t*)donor)[t] += junc_bonus;
for (t = 2; t < tlen; ++t) { for (t = 2; t < tlen; ++t) {
int z = 3; int can_type = 0;
if (flag & KSW_EZ_SPLICE_FOR) { if ((flag & KSW_EZ_SPLICE_FOR) && target[t-1] == 0 && target[t] == 2) can_type = 1; // ...yAG
if (target[t-1] == 0 && target[t] == 2) // .AG| if ((flag & KSW_EZ_SPLICE_REV) && target[t-1] == 0 && target[t] == 1) can_type = 1; // ...yAC
z = target[t-2] == 1 || target[t-2] == 3? -1 : 0; // yAG| or not if (can_type && (target[t-2] == 1 || target[t-2] == 3)) can_type = 2;
else if (target[t-1] == 0 && target[t] == 1) z = 2; // .AC| if (can_type) ((int8_t*)acceptor)[t] = can_type == 2? 0 : semi_cost;
} else if (flag & KSW_EZ_SPLICE_REV) {
if (target[t-1] == 0 && target[t] == 1) // .AC| (revcomp of |GT.)
z = target[t-2] == 1 || target[t-2] == 3? -1 : 0; // yAC| or not
else if (target[t-1] == 2 && target[t] == 1) z = 1; // .GC| (revcomp of |GC.)
else if (target[t-1] == 0 && target[t] == 3) z = 2; // .AT| (revcomp of |AT.)
}
((int8_t*)acceptor)[t] = z < 0? 0 : -sp[z];
} }
if (junc)
for (t = 0; t < tlen; ++t)
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t]&2)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t]&4)))
((int8_t*)acceptor)[t] += junc_bonus;
} else { } else {
for (t = 0; t < tlen - 4; ++t) { for (t = 0; t < tlen - 4; ++t) {
int z = 3; int can_type = 0; // type of canonical site: 0=none, 1=GT/AG only, 2=GTr/yAG
if (flag & KSW_EZ_SPLICE_FOR) { if ((flag & KSW_EZ_SPLICE_FOR) && target[t+1] == 2 && target[t+2] == 0) can_type = 1; // GAy...
if (target[t+1] == 2 && target[t+2] == 0) // |GA. (rev of .AG|) if ((flag & KSW_EZ_SPLICE_REV) && target[t+1] == 1 && target[t+2] == 0) can_type = 1; // CAy...
z = target[t+3] == 1 || target[t+3] == 3? -1 : 0; if (can_type && (target[t+3] == 1 || target[t+3] == 3)) can_type = 2;
else if (target[t+1] == 1 && target[t+2] == 0) z = 2; // |CA. (rev of .AC|) if (can_type) ((int8_t*)donor)[t] = can_type == 2? 0 : semi_cost;
} else if (flag & KSW_EZ_SPLICE_REV) {
if (target[t+1] == 1 && target[t+2] == 0) // |CA. (comp of |GT.)
z = target[t+3] == 1 || target[t+3] == 3? -1 : 0;
else if (target[t+1] == 1 && target[t+2] == 2) z = 1; // |CG. (comp of |GC.)
else if (target[t+1] == 3 && target[t+2] == 0) z = 2; // |TA. (comp of |AT.)
}
((int8_t*)donor)[t] = z < 0? 0 : -sp[z];
} }
if (junc)
for (t = 0; t < tlen - 1; ++t)
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t+1]&2)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t+1]&4)))
((int8_t*)donor)[t] += junc_bonus;
for (t = 2; t < tlen; ++t) { for (t = 2; t < tlen; ++t) {
int z = 3; int can_type = 0;
if (flag & KSW_EZ_SPLICE_FOR) { if ((flag & KSW_EZ_SPLICE_FOR) && target[t-1] == 3 && target[t] == 2) can_type = 1; // ...rTG
if (target[t-1] == 3 && target[t] == 2) // .TG| (rev of |GT.) if ((flag & KSW_EZ_SPLICE_REV) && target[t-1] == 3 && target[t] == 1) can_type = 1; // ...rTC
z = target[t-2] == 0 || target[t-2] == 2? -1 : 0; if (can_type && (target[t-2] == 0 || target[t-2] == 2)) can_type = 2;
else if (target[t-1] == 1 && target[t] == 2) z = 1; // .CG| (rev of |GC.) if (can_type) ((int8_t*)acceptor)[t] = can_type == 2? 0 : semi_cost;
else if (target[t-1] == 3 && target[t] == 0) z = 2; // .TA| (rev of |AT.)
} else if (flag & KSW_EZ_SPLICE_REV) {
if (target[t-1] == 3 && target[t] == 1) // .TC| (comp of .AG|)
z = target[t-2] == 0 || target[t-2] == 2? -1 : 0;
else if (target[t-1] == 3 && target[t] == 2) z = 2; // .TG| (comp of .AC|)
}
((int8_t*)acceptor)[t] = z < 0? 0 : -sp[z];
} }
} if (junc)
} for (t = 0; t < tlen; ++t)
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t]&1)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t]&8)))
if (junc && (flag & KSW_EZ_SPLICE_SCORE)) { // junc[] keeps the donor score ((int8_t*)acceptor)[t] += junc_bonus;
uint8_t donor_val = !!(flag & KSW_EZ_SPLICE_FOR) == !(flag & KSW_EZ_REV_CIGAR)? 0 : 1;
for (t = 0; t < tlen - 1; ++t)
((int8_t*)donor)[t] += junc[t+1] == 0xff || (junc[t+1]&1) != donor_val? -junc_pen : (int8_t)(junc[t+1]>>1) - (int8_t)KSW_SPSC_OFFSET;
for (t = 0; t < tlen - 1; ++t)
((int8_t*)acceptor)[t] += junc[t+1] == 0xff || (junc[t+1]&1) != !donor_val? -junc_pen : (int8_t)(junc[t+1]>>1) - (int8_t)KSW_SPSC_OFFSET;
//for (t = 0; t < tlen - 1; ++t) if (junc[t+1] != 0xff) fprintf(stderr, "Y2\t%d\t%d\t%c\t%d\n", ((int8_t*)donor)[t], ((int8_t*)acceptor)[t], "DA"[junc[t+1]&1], (int8_t)(junc[t+1]>>1) - (int8_t)KSW_SPSC_OFFSET);
} else if (junc) { // junc[] keeps the splice sites
if (!(flag & KSW_EZ_REV_CIGAR)) {
for (t = 0; t < tlen - 1; ++t)
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t+1]&1)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t+1]&8)))
((int8_t*)donor)[t] += junc_bonus;
for (t = 0; t < tlen; ++t)
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t]&2)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t]&4)))
((int8_t*)acceptor)[t] += junc_bonus;
} else {
for (t = 0; t < tlen - 1; ++t)
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t+1]&2)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t+1]&4)))
((int8_t*)donor)[t] += junc_bonus;
for (t = 0; t < tlen; ++t)
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t]&1)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t]&8)))
((int8_t*)acceptor)[t] += junc_bonus;
} }
} }
@@ -422,7 +369,7 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
} else H[0] = v8[0] - qe, max_H = H[0], max_t = 0; // special casing r==0 } else H[0] = v8[0] - qe, max_H = H[0], max_t = 0; // special casing r==0
// update ez // update ez
if (en0 == tlen - 1 && H[en0] > ez->mte) if (en0 == tlen - 1 && H[en0] > ez->mte)
ez->mte = H[en0], ez->mte_q = r - en0; ez->mte = H[en0], ez->mte_q = r - en;
if (r - st0 == qlen - 1 && H[st0] > ez->mqe) if (r - st0 == qlen - 1 && H[st0] > ez->mqe)
ez->mqe = H[st0], ez->mqe_t = st0; ez->mqe = H[st0], ez->mqe_t = st0;
if (ksw_apply_zdrop(ez, 1, max_H, r, max_t, zdrop, 0)) break; if (ksw_apply_zdrop(ez, 1, max_H, r, max_t, zdrop, 0)) break;
@@ -452,14 +399,10 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
if (!approx_max) kfree(km, H); if (!approx_max) kfree(km, H);
if (with_cigar) { // backtrack if (with_cigar) { // backtrack
int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR); int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY)) { if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY))
ksw_backtrack(km, 1, rev_cigar, long_thres, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar); ksw_backtrack(km, 1, rev_cigar, long_thres, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
} else if (!ez->zdropped && (flag&KSW_EZ_EXTZ_ONLY) && ez->mqe + end_bonus > (int)ez->max) { else if (ez->max_t >= 0 && ez->max_q >= 0)
ez->reach_end = 1;
ksw_backtrack(km, 1, rev_cigar, long_thres, (uint8_t*)p, off, off_end, n_col_*16, ez->mqe_t, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
} else if (ez->max_t >= 0 && ez->max_q >= 0) {
ksw_backtrack(km, 1, rev_cigar, long_thres, (uint8_t*)p, off, off_end, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar); ksw_backtrack(km, 1, rev_cigar, long_thres, (uint8_t*)p, off, off_end, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
}
kfree(km, mem2); kfree(km, off); kfree(km, mem2); kfree(km, off);
} }
} }
+1 -9
View File
@@ -3,23 +3,15 @@
#include "ksw2.h" #include "ksw2.h"
#ifdef __SSE2__ #ifdef __SSE2__
#ifdef USE_SIMDE
#include <simde/x86/sse2.h>
#else
#include <emmintrin.h> #include <emmintrin.h>
#endif
#ifdef KSW_SSE2_ONLY #ifdef KSW_SSE2_ONLY
#undef __SSE4_1__ #undef __SSE4_1__
#endif #endif
#ifdef __SSE4_1__ #ifdef __SSE4_1__
#ifdef USE_SIMDE
#include <simde/x86/sse4.1.h>
#else
#include <smmintrin.h> #include <smmintrin.h>
#endif #endif
#endif
#ifdef KSW_CPU_DISPATCH #ifdef KSW_CPU_DISPATCH
#ifdef __SSE4_1__ #ifdef __SSE4_1__
@@ -269,7 +261,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
} else H[0] = v8[0] - qe - qe, max_H = H[0], max_t = 0; // special casing r==0 } else H[0] = v8[0] - qe - qe, max_H = H[0], max_t = 0; // special casing r==0
// update ez // update ez
if (en0 == tlen - 1 && H[en0] > ez->mte) if (en0 == tlen - 1 && H[en0] > ez->mte)
ez->mte = H[en0], ez->mte_q = r - en0; ez->mte = H[en0], ez->mte_q = r - en;
if (r - st0 == qlen - 1 && H[st0] > ez->mqe) if (r - st0 == qlen - 1 && H[st0] > ez->mqe)
ez->mqe = H[st0], ez->mqe_t = st0; ez->mqe = H[st0], ez->mqe_t = st0;
if (ksw_apply_zdrop(ez, 1, max_H, r, max_t, zdrop, e)) break; if (ksw_apply_zdrop(ez, 1, max_H, r, max_t, zdrop, e)) break;
+3 -8
View File
@@ -1,13 +1,8 @@
#include <stdlib.h> #include <stdlib.h>
#include <stdint.h> #include <stdint.h>
#include <string.h> #include <string.h>
#include "ksw2.h"
#ifdef USE_SIMDE
#include <simde/x86/sse2.h>
#else
#include <emmintrin.h> #include <emmintrin.h>
#endif #include "ksw2.h"
#ifdef __GNUC__ #ifdef __GNUC__
#define LIKELY(x) __builtin_expect((x),1) #define LIKELY(x) __builtin_expect((x),1)
@@ -67,7 +62,7 @@ void *ksw_ll_qinit(void *km, int size, int qlen, const uint8_t *query, int m, co
const int8_t *ma = mat + a * m; const int8_t *ma = mat + a * m;
for (i = 0; i < slen; ++i) for (i = 0; i < slen; ++i)
for (k = i; k < nlen; k += slen) // p iterations for (k = i; k < nlen; k += slen) // p iterations
*t++ = (k >= qlen? -1 : ma[query[k]]) + q->shift; *t++ = (k >= qlen? 0 : ma[query[k]]) + q->shift;
} }
} else { } else {
int16_t *t = (int16_t*)q->qp; int16_t *t = (int16_t*)q->qp;
@@ -76,7 +71,7 @@ void *ksw_ll_qinit(void *km, int size, int qlen, const uint8_t *query, int m, co
const int8_t *ma = mat + a * m; const int8_t *ma = mat + a * m;
for (i = 0; i < slen; ++i) for (i = 0; i < slen; ++i)
for (k = i; k < nlen; k += slen) // p iterations for (k = i; k < nlen; k += slen) // p iterations
*t++ = (k >= qlen? -1 : ma[query[k]]); *t++ = (k >= qlen? 0 : ma[query[k]]);
} }
} }
return q; return q;
-368
View File
@@ -1,368 +0,0 @@
#include <stdint.h>
#include <string.h>
#include <stdio.h>
#include <assert.h>
#include "mmpriv.h"
#include "kalloc.h"
#include "krmq.h"
static int64_t mg_chain_bk_end(int32_t max_drop, const mm128_t *z, const int32_t *f, const int64_t *p, int32_t *t, int64_t k)
{
int64_t i = z[k].y, end_i = -1, max_i = i;
int32_t max_s = 0;
if (i < 0 || t[i] != 0) return i;
do {
int32_t s;
t[i] = 2;
end_i = i = p[i];
s = i < 0? z[k].x : (int32_t)z[k].x - f[i];
if (s > max_s) max_s = s, max_i = i;
else if (max_s - s > max_drop) break;
} while (i >= 0 && t[i] == 0);
for (i = z[k].y; i >= 0 && i != end_i; i = p[i]) // reset modified t[]
t[i] = 0;
return max_i;
}
uint64_t *mg_chain_backtrack(void *km, int64_t n, const int32_t *f, const int64_t *p, int32_t *v, int32_t *t, int32_t min_cnt, int32_t min_sc, int32_t max_drop, int32_t *n_u_, int32_t *n_v_)
{
mm128_t *z;
uint64_t *u;
int64_t i, k, n_z, n_v;
int32_t n_u;
*n_u_ = *n_v_ = 0;
for (i = 0, n_z = 0; i < n; ++i) // precompute n_z
if (f[i] >= min_sc) ++n_z;
if (n_z == 0) return 0;
z = Kmalloc(km, mm128_t, n_z);
for (i = 0, k = 0; i < n; ++i) // populate z[]
if (f[i] >= min_sc) z[k].x = f[i], z[k++].y = i;
radix_sort_128x(z, z + n_z);
memset(t, 0, n * 4);
for (k = n_z - 1, n_v = n_u = 0; k >= 0; --k) { // precompute n_u
if (t[z[k].y] == 0) {
int64_t n_v0 = n_v, end_i;
int32_t sc;
end_i = mg_chain_bk_end(max_drop, z, f, p, t, k);
for (i = z[k].y; i != end_i; i = p[i])
++n_v, t[i] = 1;
sc = i < 0? z[k].x : (int32_t)z[k].x - f[i];
if (sc >= min_sc && n_v > n_v0 && n_v - n_v0 >= min_cnt)
++n_u;
else n_v = n_v0;
}
}
u = Kmalloc(km, uint64_t, n_u);
memset(t, 0, n * 4);
for (k = n_z - 1, n_v = n_u = 0; k >= 0; --k) { // populate u[]
if (t[z[k].y] == 0) {
int64_t n_v0 = n_v, end_i;
int32_t sc;
end_i = mg_chain_bk_end(max_drop, z, f, p, t, k);
for (i = z[k].y; i != end_i; i = p[i])
v[n_v++] = i, t[i] = 1;
sc = i < 0? z[k].x : (int32_t)z[k].x - f[i];
if (sc >= min_sc && n_v > n_v0 && n_v - n_v0 >= min_cnt)
u[n_u++] = (uint64_t)sc << 32 | (n_v - n_v0);
else n_v = n_v0;
}
}
kfree(km, z);
assert(n_v < INT32_MAX);
*n_u_ = n_u, *n_v_ = n_v;
return u;
}
static mm128_t *compact_a(void *km, int32_t n_u, uint64_t *u, int32_t n_v, int32_t *v, mm128_t *a)
{
mm128_t *b, *w;
uint64_t *u2;
int64_t i, j, k;
// write the result to b[]
b = Kmalloc(km, mm128_t, n_v);
for (i = 0, k = 0; i < n_u; ++i) {
int32_t k0 = k, ni = (int32_t)u[i];
for (j = 0; j < ni; ++j)
b[k++] = a[v[k0 + (ni - j - 1)]];
}
kfree(km, v);
// sort u[] and a[] by the target position, such that adjacent chains may be joined
w = Kmalloc(km, mm128_t, n_u);
for (i = k = 0; i < n_u; ++i) {
w[i].x = b[k].x, w[i].y = (uint64_t)k<<32|i;
k += (int32_t)u[i];
}
radix_sort_128x(w, w + n_u);
u2 = Kmalloc(km, uint64_t, n_u);
for (i = k = 0; i < n_u; ++i) {
int32_t j = (int32_t)w[i].y, n = (int32_t)u[j];
u2[i] = u[j];
memcpy(&a[k], &b[w[i].y>>32], n * sizeof(mm128_t));
k += n;
}
memcpy(u, u2, n_u * 8);
memcpy(b, a, k * sizeof(mm128_t)); // write _a_ to _b_ and deallocate _a_ because _a_ is oversized, sometimes a lot
kfree(km, a); kfree(km, w); kfree(km, u2);
return b;
}
static inline int32_t comput_sc(const mm128_t *ai, const mm128_t *aj, int32_t max_dist_x, int32_t max_dist_y, int32_t bw, float chn_pen_gap, float chn_pen_skip, int is_cdna, int n_seg)
{
int32_t dq = (int32_t)ai->y - (int32_t)aj->y, dr, dd, dg, q_span, sc;
int32_t sidi = (ai->y & MM_SEED_SEG_MASK) >> MM_SEED_SEG_SHIFT;
int32_t sidj = (aj->y & MM_SEED_SEG_MASK) >> MM_SEED_SEG_SHIFT;
if (dq <= 0 || dq > max_dist_x) return INT32_MIN;
dr = (int32_t)(ai->x - aj->x);
if (sidi == sidj && (dr == 0 || dq > max_dist_y)) return INT32_MIN;
dd = dr > dq? dr - dq : dq - dr;
if (sidi == sidj && dd > bw) return INT32_MIN;
if (n_seg > 1 && !is_cdna && sidi == sidj && dr > max_dist_y) return INT32_MIN;
dg = dr < dq? dr : dq;
q_span = aj->y>>32&0xff;
sc = q_span < dg? q_span : dg;
if (dd || dg > q_span) {
float lin_pen, log_pen;
lin_pen = chn_pen_gap * (float)dd + chn_pen_skip * (float)dg;
log_pen = dd >= 1? mg_log2(dd + 1) : 0.0f; // mg_log2() only works for dd>=2
if (is_cdna || sidi != sidj) {
if (sidi != sidj && dr == 0) ++sc; // possibly due to overlapping paired ends; give a minor bonus
else if (dr > dq || sidi != sidj) sc -= (int)(lin_pen < log_pen? lin_pen : log_pen); // deletion or jump between paired ends
else sc -= (int)(lin_pen + .5f * log_pen);
} else sc -= (int)(lin_pen + .5f * log_pen);
}
return sc;
}
/* Input:
* a[].x: rev<<63 | tid<<32 | tpos
* a[].y: flags<<40 | q_span<<32 | q_pos
* Output:
* n_u: #chains
* u[]: score<<32 | #anchors (sum of lower 32 bits of u[] is the returned length of a[])
* input a[] is deallocated on return
*/
mm128_t *mg_lchain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int max_iter, int min_cnt, int min_sc, float chn_pen_gap, float chn_pen_skip,
int is_cdna, int n_seg, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km)
{ // TODO: make sure this works when n has more than 32 bits
int32_t *f, *t, *v, n_u, n_v, mmax_f = 0, max_drop = bw;
int64_t *p, i, j, max_ii, st = 0;
uint64_t *u;
if (_u) *_u = 0, *n_u_ = 0;
if (n == 0 || a == 0) {
kfree(km, a);
return 0;
}
if (max_dist_x < bw) max_dist_x = bw;
if (max_dist_y < bw && !is_cdna) max_dist_y = bw;
if (is_cdna) max_drop = INT32_MAX;
p = Kmalloc(km, int64_t, n);
f = Kmalloc(km, int32_t, n);
v = Kmalloc(km, int32_t, n);
t = Kcalloc(km, int32_t, n);
// fill the score and backtrack arrays
for (i = 0, max_ii = -1; i < n; ++i) {
int64_t max_j = -1, end_j;
int32_t max_f = a[i].y>>32&0xff, n_skip = 0;
while (st < i && (a[i].x>>32 != a[st].x>>32 || a[i].x > a[st].x + max_dist_x)) ++st;
if (i - st > max_iter) st = i - max_iter;
for (j = i - 1; j >= st; --j) {
int32_t sc;
sc = comput_sc(&a[i], &a[j], max_dist_x, max_dist_y, bw, chn_pen_gap, chn_pen_skip, is_cdna, n_seg);
if (sc == INT32_MIN) continue;
sc += f[j];
if (sc > max_f) {
max_f = sc, max_j = j;
if (n_skip > 0) --n_skip;
} else if (t[j] == (int32_t)i) {
if (++n_skip > max_skip)
break;
}
if (p[j] >= 0) t[p[j]] = i;
}
end_j = j;
if (max_ii < 0 || a[i].x - a[max_ii].x > (int64_t)max_dist_x) {
int32_t max = INT32_MIN;
max_ii = -1;
for (j = i - 1; j >= st; --j)
if (max < f[j]) max = f[j], max_ii = j;
}
if (max_ii >= 0 && max_ii < end_j) {
int32_t tmp;
tmp = comput_sc(&a[i], &a[max_ii], max_dist_x, max_dist_y, bw, chn_pen_gap, chn_pen_skip, is_cdna, n_seg);
if (tmp != INT32_MIN && max_f < tmp + f[max_ii])
max_f = tmp + f[max_ii], max_j = max_ii;
}
f[i] = max_f, p[i] = max_j;
v[i] = max_j >= 0 && v[max_j] > max_f? v[max_j] : max_f; // v[] keeps the peak score up to i; f[] is the score ending at i, not always the peak
if (max_ii < 0 || (a[i].x - a[max_ii].x <= (int64_t)max_dist_x && f[max_ii] < f[i]))
max_ii = i;
if (mmax_f < max_f) mmax_f = max_f;
//fprintf(stderr, "X1\t%ld\t%ld:%d\t%ld\t%ld:%d\t%ld\t%ld\n", (long)i, (long)(a[i].x>>32), (int32_t)a[i].x, (long)max_j, max_j<0?-1L:(long)(a[max_j].x>>32), max_j<0?-1:(int32_t)a[max_j].x, (long)max_f, (long)v[i]);
}
u = mg_chain_backtrack(km, n, f, p, v, t, min_cnt, min_sc, max_drop, &n_u, &n_v);
*n_u_ = n_u, *_u = u; // NB: note that u[] may not be sorted by score here
kfree(km, p); kfree(km, f); kfree(km, t);
if (n_u == 0) {
kfree(km, a); kfree(km, v);
return 0;
}
return compact_a(km, n_u, u, n_v, v, a);
}
typedef struct lc_elem_s {
int32_t y;
int64_t i;
double pri;
KRMQ_HEAD(struct lc_elem_s) head;
} lc_elem_t;
#define lc_elem_cmp(a, b) ((a)->y < (b)->y? -1 : (a)->y > (b)->y? 1 : ((a)->i > (b)->i) - ((a)->i < (b)->i))
#define lc_elem_lt2(a, b) ((a)->pri < (b)->pri)
KRMQ_INIT(lc_elem, lc_elem_t, head, lc_elem_cmp, lc_elem_lt2)
KALLOC_POOL_INIT(rmq, lc_elem_t)
static inline int32_t comput_sc_simple(const mm128_t *ai, const mm128_t *aj, float chn_pen_gap, float chn_pen_skip, int32_t *exact, int32_t *width)
{
int32_t dq = (int32_t)ai->y - (int32_t)aj->y, dr, dd, dg, q_span, sc;
dr = (int32_t)(ai->x - aj->x);
*width = dd = dr > dq? dr - dq : dq - dr;
dg = dr < dq? dr : dq;
q_span = aj->y>>32&0xff;
sc = q_span < dg? q_span : dg;
if (exact) *exact = (dd == 0 && dg <= q_span);
if (dd || dq > q_span) {
float lin_pen, log_pen;
lin_pen = chn_pen_gap * (float)dd + chn_pen_skip * (float)dg;
log_pen = dd >= 1? mg_log2(dd + 1) : 0.0f; // mg_log2() only works for dd>=2
sc -= (int)(lin_pen + .5f * log_pen);
}
return sc;
}
mm128_t *mg_lchain_rmq(int max_dist, int max_dist_inner, int bw, int max_chn_skip, int cap_rmq_size, int min_cnt, int min_sc, float chn_pen_gap, float chn_pen_skip,
int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km)
{
int32_t *f,*t, *v, n_u, n_v, mmax_f = 0, max_rmq_size = 0, max_drop = bw;
int64_t *p, i, i0, st = 0, st_inner = 0;
uint64_t *u;
lc_elem_t *root = 0, *root_inner = 0;
void *mem_mp = 0;
kmp_rmq_t *mp;
if (_u) *_u = 0, *n_u_ = 0;
if (n == 0 || a == 0) {
kfree(km, a);
return 0;
}
if (max_dist < bw) max_dist = bw;
if (max_dist_inner < 0) max_dist_inner = 0;
if (max_dist_inner > max_dist) max_dist_inner = max_dist;
p = Kmalloc(km, int64_t, n);
f = Kmalloc(km, int32_t, n);
t = Kcalloc(km, int32_t, n);
v = Kmalloc(km, int32_t, n);
mem_mp = km_init2(km, 0x10000);
mp = kmp_init_rmq(mem_mp);
// fill the score and backtrack arrays
for (i = i0 = 0; i < n; ++i) {
int64_t max_j = -1;
int32_t q_span = a[i].y>>32&0xff, max_f = q_span;
lc_elem_t s, *q, *r, lo, hi;
// add in-range anchors
if (i0 < i && a[i0].x != a[i].x) {
int64_t j;
for (j = i0; j < i; ++j) {
q = kmp_alloc_rmq(mp);
q->y = (int32_t)a[j].y, q->i = j, q->pri = -(f[j] + 0.5 * chn_pen_gap * ((int32_t)a[j].x + (int32_t)a[j].y));
krmq_insert(lc_elem, &root, q, 0);
if (max_dist_inner > 0) {
r = kmp_alloc_rmq(mp);
*r = *q;
krmq_insert(lc_elem, &root_inner, r, 0);
}
}
i0 = i;
}
// get rid of active chains out of range
while (st < i && (a[i].x>>32 != a[st].x>>32 || a[i].x > a[st].x + max_dist || krmq_size(head, root) > cap_rmq_size)) {
s.y = (int32_t)a[st].y, s.i = st;
if ((q = krmq_find(lc_elem, root, &s, 0)) != 0) {
q = krmq_erase(lc_elem, &root, q, 0);
kmp_free_rmq(mp, q);
}
++st;
}
if (max_dist_inner > 0) { // similar to the block above, but applied to the inner tree
while (st_inner < i && (a[i].x>>32 != a[st_inner].x>>32 || a[i].x > a[st_inner].x + max_dist_inner || krmq_size(head, root_inner) > cap_rmq_size)) {
s.y = (int32_t)a[st_inner].y, s.i = st_inner;
if ((q = krmq_find(lc_elem, root_inner, &s, 0)) != 0) {
q = krmq_erase(lc_elem, &root_inner, q, 0);
kmp_free_rmq(mp, q);
}
++st_inner;
}
}
// RMQ
lo.i = INT32_MAX, lo.y = (int32_t)a[i].y - max_dist;
hi.i = 0, hi.y = (int32_t)a[i].y;
if ((q = krmq_rmq(lc_elem, root, &lo, &hi)) != 0) {
int32_t sc, exact, width, n_skip = 0;
int64_t j = q->i;
assert(q->y >= lo.y && q->y <= hi.y);
sc = f[j] + comput_sc_simple(&a[i], &a[j], chn_pen_gap, chn_pen_skip, &exact, &width);
if (width <= bw && sc > max_f) max_f = sc, max_j = j;
if (!exact && root_inner && (int32_t)a[i].y > 0) {
lc_elem_t *lo, *hi;
s.y = (int32_t)a[i].y - 1, s.i = n;
krmq_interval(lc_elem, root_inner, &s, &lo, &hi);
if (lo) {
const lc_elem_t *q;
int32_t width;
krmq_itr_t(lc_elem) itr;
krmq_itr_find(lc_elem, root_inner, lo, &itr);
while ((q = krmq_at(&itr)) != 0) {
if (q->y < (int32_t)a[i].y - max_dist_inner) break;
j = q->i;
sc = f[j] + comput_sc_simple(&a[i], &a[j], chn_pen_gap, chn_pen_skip, 0, &width);
if (width <= bw) {
if (sc > max_f) {
max_f = sc, max_j = j;
if (n_skip > 0) --n_skip;
} else if (t[j] == (int32_t)i) {
if (++n_skip > max_chn_skip)
break;
}
if (p[j] >= 0) t[p[j]] = i;
}
if (!krmq_itr_prev(lc_elem, &itr)) break;
}
}
}
}
// set max
assert(max_j < 0 || (a[max_j].x < a[i].x && (int32_t)a[max_j].y < (int32_t)a[i].y));
f[i] = max_f, p[i] = max_j;
v[i] = max_j >= 0 && v[max_j] > max_f? v[max_j] : max_f; // v[] keeps the peak score up to i; f[] is the score ending at i, not always the peak
if (mmax_f < max_f) mmax_f = max_f;
if (max_rmq_size < krmq_size(head, root)) max_rmq_size = krmq_size(head, root);
}
km_destroy(mem_mp);
u = mg_chain_backtrack(km, n, f, p, v, t, min_cnt, min_sc, max_drop, &n_u, &n_v);
*n_u_ = n_u, *_u = u; // NB: note that u[] may not be sorted by score here
kfree(km, p); kfree(km, f); kfree(km, t);
if (n_u == 0) {
kfree(km, a); kfree(km, v);
return 0;
}
return compact_a(km, n_u, u, n_v, v, a);
}
+45 -163
View File
@@ -7,6 +7,8 @@
#include "mmpriv.h" #include "mmpriv.h"
#include "ketopt.h" #include "ketopt.h"
#define MM_VERSION "2.17-r954-dirty"
#ifdef __linux__ #ifdef __linux__
#include <sys/resource.h> #include <sys/resource.h>
#include <sys/time.h> #include <sys/time.h>
@@ -35,12 +37,12 @@ static ko_longopt_t long_options[] = {
{ "splice", ko_no_argument, 310 }, { "splice", ko_no_argument, 310 },
{ "cost-non-gt-ag", ko_required_argument, 'C' }, { "cost-non-gt-ag", ko_required_argument, 'C' },
{ "no-long-join", ko_no_argument, 312 }, { "no-long-join", ko_no_argument, 312 },
{ "sr", ko_optional_argument, 313 }, { "sr", ko_no_argument, 313 },
{ "frag", ko_required_argument, 314 }, { "frag", ko_required_argument, 314 },
{ "secondary", ko_required_argument, 315 }, { "secondary", ko_required_argument, 315 },
{ "cs", ko_optional_argument, 316 }, { "cs", ko_optional_argument, 316 },
{ "end-bonus", ko_required_argument, 317 }, { "end-bonus", ko_required_argument, 317 },
{ "no-pairing", ko_no_argument, 318 }, // deprecated but reserved for backward compatibility { "no-pairing", ko_no_argument, 318 },
{ "splice-flank", ko_required_argument, 319 }, { "splice-flank", ko_required_argument, 319 },
{ "idx-no-seq", ko_no_argument, 320 }, { "idx-no-seq", ko_no_argument, 320 },
{ "end-seed-pen", ko_required_argument, 321 }, { "end-seed-pen", ko_required_argument, 321 },
@@ -65,29 +67,10 @@ static ko_longopt_t long_options[] = {
{ "junc-bed", ko_required_argument, 340 }, { "junc-bed", ko_required_argument, 340 },
{ "junc-bonus", ko_required_argument, 341 }, { "junc-bonus", ko_required_argument, 341 },
{ "sam-hit-only", ko_no_argument, 342 }, { "sam-hit-only", ko_no_argument, 342 },
{ "chain-gap-scale",ko_required_argument, 343 }, { "idx-min-occ", ko_required_argument, 343 },
{ "alt", ko_required_argument, 344 }, { "idx-max-occ", ko_required_argument, 344 },
{ "alt-drop", ko_required_argument, 345 }, { "flt-max-dv", ko_required_argument, 345 },
{ "mask-len", ko_required_argument, 346 }, { "flt-min-blen", ko_required_argument, 346 },
{ "rmq", ko_optional_argument, 347 },
{ "qstrand", ko_no_argument, 348 },
{ "cap-kalloc", ko_required_argument, 349 },
{ "q-occ-frac", ko_required_argument, 350 },
{ "chain-skip-scale",ko_required_argument,351 },
{ "print-chains", ko_no_argument, 352 },
{ "no-hash-name", ko_no_argument, 353 },
{ "secondary-seq", ko_no_argument, 354 },
{ "ds", ko_no_argument, 355 },
{ "rmq-inner", ko_required_argument, 356 },
{ "spsc", ko_required_argument, 357 },
{ "junc-pen", ko_required_argument, 358 },
{ "pairing", ko_required_argument, 359 },
{ "jump-min-match", ko_required_argument, 360 },
{ "write-junc", ko_no_argument, 361 },
{ "pass1", ko_required_argument, 362 },
{ "spsc-scale", ko_required_argument, 363 },
{ "spsc0", ko_required_argument, 364 },
{ "dbg-seed-occ", ko_no_argument, 501 },
{ "help", ko_no_argument, 'h' }, { "help", ko_no_argument, 'h' },
{ "max-intron-len", ko_required_argument, 'G' }, { "max-intron-len", ko_required_argument, 'G' },
{ "version", ko_no_argument, 'V' }, { "version", ko_no_argument, 'V' },
@@ -99,24 +82,18 @@ static ko_longopt_t long_options[] = {
{ 0, 0, 0 } { 0, 0, 0 }
}; };
static inline int64_t mm_parse_num2(const char *str, char **q) static inline int64_t mm_parse_num(const char *str)
{ {
double x; double x;
char *p; char *p;
x = strtod(str, &p); x = strtod(str, &p);
if (*p == 'G' || *p == 'g') x *= 1e9, ++p; if (*p == 'G' || *p == 'g') x *= 1e9;
else if (*p == 'M' || *p == 'm') x *= 1e6, ++p; else if (*p == 'M' || *p == 'm') x *= 1e6;
else if (*p == 'K' || *p == 'k') x *= 1e3, ++p; else if (*p == 'K' || *p == 'k') x *= 1e3;
if (q) *q = p;
return (int64_t)(x + .499); return (int64_t)(x + .499);
} }
static inline int64_t mm_parse_num(const char *str) static inline void yes_or_no(mm_mapopt_t *opt, int flag, int long_idx, const char *arg, int yes_to_set)
{
return mm_parse_num2(str, 0);
}
static inline void yes_or_no(mm_mapopt_t *opt, int64_t flag, int long_idx, const char *arg, int yes_to_set)
{ {
if (yes_to_set) { if (yes_to_set) {
if (strcmp(arg, "yes") == 0 || strcmp(arg, "y") == 0) opt->flag |= flag; if (strcmp(arg, "yes") == 0 || strcmp(arg, "y") == 0) opt->flag |= flag;
@@ -131,13 +108,12 @@ static inline void yes_or_no(mm_mapopt_t *opt, int64_t flag, int long_idx, const
int main(int argc, char *argv[]) int main(int argc, char *argv[])
{ {
const char *opt_str = "2aSDw:k:K:t:r:f:Vv:g:G:I:d:XT:s:x:Hcp:M:n:z:A:B:b:O:E:m:N:Qu:R:hF:LC:yYPo:e:U:J:j:"; const char *opt_str = "2aSDw:k:K:t:r:f:Vv:g:G:I:d:XT:s:x:Hcp:M:n:z:A:B:O:E:m:N:Qu:R:hF:LC:yYPo:";
ketopt_t o = KETOPT_INIT; ketopt_t o = KETOPT_INIT;
mm_mapopt_t opt; mm_mapopt_t opt;
mm_idxopt_t ipt; mm_idxopt_t ipt;
int i, c, n_threads = 3, n_parts, old_best_n = -1; int i, c, n_threads = 3, n_parts, old_best_n = -1;
float spsc_scale = 0.7f; char *fnw = 0, *rg = 0, *junc_bed = 0, *s;
char *fnw = 0, *rg = 0, *fn_bed_junc = 0, *fn_bed_jump = 0, *fn_bed_pass1 = 0, *fn_spsc = 0, *s, *alt_list = 0;
FILE *fp_help = stderr; FILE *fp_help = stderr;
mm_idx_reader_t *idx_rdr; mm_idx_reader_t *idx_rdr;
mm_idx_t *mi; mm_idx_t *mi;
@@ -168,6 +144,7 @@ int main(int argc, char *argv[])
else if (c == 'k') ipt.k = atoi(o.arg); else if (c == 'k') ipt.k = atoi(o.arg);
else if (c == 'H') ipt.flag |= MM_I_HPC; else if (c == 'H') ipt.flag |= MM_I_HPC;
else if (c == 'd') fnw = o.arg; // the above are indexing related options, except -I else if (c == 'd') fnw = o.arg; // the above are indexing related options, except -I
else if (c == 'r') opt.bw = (int)mm_parse_num(o.arg);
else if (c == 't') n_threads = atoi(o.arg); else if (c == 't') n_threads = atoi(o.arg);
else if (c == 'v') mm_verbose = atoi(o.arg); else if (c == 'v') mm_verbose = atoi(o.arg);
else if (c == 'g') opt.max_gap = (int)mm_parse_num(o.arg); else if (c == 'g') opt.max_gap = (int)mm_parse_num(o.arg);
@@ -190,22 +167,14 @@ int main(int argc, char *argv[])
else if (c == 'm') opt.min_chain_score = atoi(o.arg); else if (c == 'm') opt.min_chain_score = atoi(o.arg);
else if (c == 'A') opt.a = atoi(o.arg); else if (c == 'A') opt.a = atoi(o.arg);
else if (c == 'B') opt.b = atoi(o.arg); else if (c == 'B') opt.b = atoi(o.arg);
else if (c == 'b') opt.transition = atoi(o.arg);
else if (c == 's') opt.min_dp_max = atoi(o.arg); else if (c == 's') opt.min_dp_max = atoi(o.arg);
else if (c == 'C') opt.noncan = atoi(o.arg); else if (c == 'C') opt.noncan = atoi(o.arg);
else if (c == 'I') ipt.batch_size = mm_parse_num(o.arg); else if (c == 'I') ipt.batch_size = mm_parse_num(o.arg);
else if (c == 'K') opt.mini_batch_size = mm_parse_num(o.arg); else if (c == 'K') opt.mini_batch_size = (int)mm_parse_num(o.arg);
else if (c == 'e') opt.occ_dist = mm_parse_num(o.arg);
else if (c == 'R') rg = o.arg; else if (c == 'R') rg = o.arg;
else if (c == 'h') fp_help = stdout; else if (c == 'h') fp_help = stdout;
else if (c == '2') opt.flag |= MM_F_2_IO_THREADS; else if (c == '2') opt.flag |= MM_F_2_IO_THREADS;
else if (c == 'j') fn_bed_jump = o.arg; else if (c == 'o') {
else if (c == 'J') {
int t;
t = atoi(o.arg);
if (t == 0) opt.flag |= MM_F_SPLICE_OLD;
else if (t == 1) opt.flag &= ~MM_F_SPLICE_OLD;
} else if (c == 'o') {
if (strcmp(o.arg, "-") != 0) { if (strcmp(o.arg, "-") != 0) {
if (freopen(o.arg, "wb", stdout) == NULL) { if (freopen(o.arg, "wb", stdout) == NULL) {
fprintf(stderr, "[ERROR]\033[1;31m failed to write the output to file '%s'\033[0m: %s\n", o.arg, strerror(errno)); fprintf(stderr, "[ERROR]\033[1;31m failed to write the output to file '%s'\033[0m: %s\n", o.arg, strerror(errno));
@@ -224,8 +193,9 @@ int main(int argc, char *argv[])
else if (c == 309) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_ALN_SEQ, n_threads = 1; // --print-aln-seq else if (c == 309) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_ALN_SEQ, n_threads = 1; // --print-aln-seq
else if (c == 310) opt.flag |= MM_F_SPLICE; // --splice else if (c == 310) opt.flag |= MM_F_SPLICE; // --splice
else if (c == 312) opt.flag |= MM_F_NO_LJOIN; // --no-long-join else if (c == 312) opt.flag |= MM_F_NO_LJOIN; // --no-long-join
else if (c == 313) opt.flag |= MM_F_SR; // --sr
else if (c == 317) opt.end_bonus = atoi(o.arg); // --end-bonus else if (c == 317) opt.end_bonus = atoi(o.arg); // --end-bonus
else if (c == 318) opt.flag |= MM_F_INDEPEND_SEG; // --no-pairing (deprecated) else if (c == 318) opt.flag |= MM_F_INDEPEND_SEG; // --no-pairing
else if (c == 320) ipt.flag |= MM_I_NO_SEQ; // --idx-no-seq else if (c == 320) ipt.flag |= MM_I_NO_SEQ; // --idx-no-seq
else if (c == 321) opt.anchor_ext_shift = atoi(o.arg); // --end-seed-pen else if (c == 321) opt.anchor_ext_shift = atoi(o.arg); // --end-seed-pen
else if (c == 322) opt.flag |= MM_F_FOR_ONLY; // --for-only else if (c == 322) opt.flag |= MM_F_FOR_ONLY; // --for-only
@@ -233,6 +203,7 @@ int main(int argc, char *argv[])
else if (c == 327) opt.max_clip_ratio = atof(o.arg); // --max-clip-ratio else if (c == 327) opt.max_clip_ratio = atof(o.arg); // --max-clip-ratio
else if (c == 328) opt.min_mid_occ = atoi(o.arg); // --min-occ-floor else if (c == 328) opt.min_mid_occ = atoi(o.arg); // --min-occ-floor
else if (c == 329) opt.flag |= MM_F_OUT_MD; // --MD else if (c == 329) opt.flag |= MM_F_OUT_MD; // --MD
else if (c == 330) opt.min_join_flank_ratio = atof(o.arg); // --lj-min-ratio
else if (c == 331) opt.sc_ambi = atoi(o.arg); // --score-N else if (c == 331) opt.sc_ambi = atoi(o.arg); // --score-N
else if (c == 332) opt.flag |= MM_F_EQX; // --eqx else if (c == 332) opt.flag |= MM_F_EQX; // --eqx
else if (c == 333) opt.flag |= MM_F_PAF_NO_HIT; // --paf-no-hit else if (c == 333) opt.flag |= MM_F_PAF_NO_HIT; // --paf-no-hit
@@ -241,43 +212,13 @@ int main(int argc, char *argv[])
else if (c == 336) opt.flag |= MM_F_HARD_MLEVEL; // --hard-mask-level else if (c == 336) opt.flag |= MM_F_HARD_MLEVEL; // --hard-mask-level
else if (c == 337) opt.max_sw_mat = mm_parse_num(o.arg); // --cap-sw-mat else if (c == 337) opt.max_sw_mat = mm_parse_num(o.arg); // --cap-sw-mat
else if (c == 338) opt.max_qlen = mm_parse_num(o.arg); // --max-qlen else if (c == 338) opt.max_qlen = mm_parse_num(o.arg); // --max-qlen
else if (c == 340) fn_bed_junc = o.arg; // --junc-bed else if (c == 340) junc_bed = o.arg; // --junc-bed
else if (c == 341) opt.junc_bonus = atoi(o.arg); // --junc-bonus
else if (c == 342) opt.flag |= MM_F_SAM_HIT_ONLY; // --sam-hit-only else if (c == 342) opt.flag |= MM_F_SAM_HIT_ONLY; // --sam-hit-only
else if (c == 343) opt.chain_gap_scale = atof(o.arg); // --chain-gap-scale else if (c == 343) ipt.min_occ = mm_parse_num(o.arg); // --idx-min-occ
else if (c == 351) opt.chain_skip_scale = atof(o.arg); // --chain-skip-scale else if (c == 344) ipt.max_occ = mm_parse_num(o.arg); // --idx-max-occ
else if (c == 344) alt_list = o.arg; // --alt else if (c == 345) opt.flt_max_dv = atof(o.arg); // --flt-max-dv
else if (c == 345) opt.alt_drop = atof(o.arg); // --alt-drop else if (c == 346) opt.flt_min_blen = mm_parse_num(o.arg); // --flt-min-blen
else if (c == 346) opt.mask_len = mm_parse_num(o.arg); // --mask-len else if (c == 314) { // --frag
else if (c == 348) opt.flag |= MM_F_QSTRAND | MM_F_NO_INV; // --qstrand
else if (c == 349) opt.cap_kalloc = mm_parse_num(o.arg); // --cap-kalloc
else if (c == 350) opt.q_occ_frac = atof(o.arg); // --q-occ-frac
else if (c == 352) mm_dbg_flag |= MM_DBG_PRINT_CHAIN; // --print-chains
else if (c == 353) opt.flag |= MM_F_NO_HASH_NAME; // --no-hash-name
else if (c == 354) opt.flag |= MM_F_SECONDARY_SEQ; // --secondary-seq
else if (c == 355) opt.flag |= MM_F_OUT_DS; // --ds
else if (c == 356) opt.rmq_inner_dist = mm_parse_num(o.arg); // --rmq-inner
else if (c == 357) fn_spsc = o.arg; // --spsc
else if (c == 360) opt.jump_min_match = mm_parse_num(o.arg); // --jump-min-match
else if (c == 361) opt.flag |= MM_F_OUT_JUNC | MM_F_CIGAR; // --write-junc
else if (c == 362) fn_bed_pass1 = o.arg; // --jump-pass1
else if (c == 501) mm_dbg_flag |= MM_DBG_SEED_FREQ; // --dbg-seed-occ
else if (c == 363) spsc_scale = atof(o.arg); // --spsc-scale
else if (c == 358 || c == 364) opt.junc_pen = atoi(o.arg); // --junc-pen or --spsc0
else if (c == 330) {
fprintf(stderr, "[WARNING] \033[1;31m --lj-min-ratio has been deprecated.\033[0m\n");
} else if (c == 313) { // --sr
if (o.arg == 0 || strcmp(o.arg, "dna") == 0) {
opt.flag |= MM_F_SR;
} else if (strcmp(o.arg, "rna") == 0) {
opt.flag |= MM_F_SR_RNA;
} else if (strcmp(o.arg, "no") == 0) {
opt.flag &= ~(uint64_t)(MM_F_SR|MM_F_SR_RNA);
} else if (mm_verbose >= 2) {
opt.flag |= MM_F_SR;
fprintf(stderr, "[WARNING]\033[1;31m --sr only takes 'dna' or 'rna'. Invalid values are assumed to be 'dna'.\033[0m\n");
}
} else if (c == 314) { // --frag
yes_or_no(&opt, MM_F_FRAG_MODE, o.longidx, o.arg, 1); yes_or_no(&opt, MM_F_FRAG_MODE, o.longidx, o.arg, 1);
} else if (c == 315) { // --secondary } else if (c == 315) { // --secondary
yes_or_no(&opt, MM_F_NO_PRINT_2ND, o.longidx, o.arg, 0); yes_or_no(&opt, MM_F_NO_PRINT_2ND, o.longidx, o.arg, 0);
@@ -298,17 +239,6 @@ int main(int argc, char *argv[])
yes_or_no(&opt, MM_F_HEAP_SORT, o.longidx, o.arg, 1); yes_or_no(&opt, MM_F_HEAP_SORT, o.longidx, o.arg, 1);
} else if (c == 326) { // --dual } else if (c == 326) { // --dual
yes_or_no(&opt, MM_F_NO_DUAL, o.longidx, o.arg, 0); yes_or_no(&opt, MM_F_NO_DUAL, o.longidx, o.arg, 0);
} else if (c == 347) { // --rmq
if (o.arg) yes_or_no(&opt, MM_F_RMQ, o.longidx, o.arg, 1);
else opt.flag |= MM_F_RMQ;
} else if (c == 359) { // --pairing
if (strcmp(o.arg, "no") == 0) opt.flag |= MM_F_INDEPEND_SEG;
else if (strcmp(o.arg, "weak") == 0) opt.flag |= MM_F_WEAK_PAIRING, opt.flag &= ~(uint64_t)MM_F_INDEPEND_SEG;
else {
if (strcmp(o.arg, "strong") != 0 && mm_verbose >= 2)
fprintf(stderr, "[WARNING]\033[1;31m unrecognized argument for --pairing; assuming 'strong'.\033[0m\n");
opt.flag &= ~(uint64_t)(MM_F_INDEPEND_SEG|MM_F_WEAK_PAIRING);
}
} else if (c == 'S') { } else if (c == 'S') {
opt.flag |= MM_F_OUT_CS | MM_F_CIGAR | MM_F_OUT_CS_LONG; opt.flag |= MM_F_OUT_CS | MM_F_CIGAR | MM_F_OUT_CS_LONG;
if (mm_verbose >= 2) if (mm_verbose >= 2)
@@ -316,12 +246,6 @@ int main(int argc, char *argv[])
} else if (c == 'V') { } else if (c == 'V') {
puts(MM_VERSION); puts(MM_VERSION);
return 0; return 0;
} else if (c == 'r') {
opt.bw = (int)mm_parse_num2(o.arg, &s);
if (*s == ',') opt.bw_long = (int)mm_parse_num2(s + 1, &s);
} else if (c == 'U') {
opt.min_mid_occ = strtol(o.arg, &s, 10);
if (*s == ',') opt.max_mid_occ = strtol(s + 1, &s, 10);
} else if (c == 'f') { } else if (c == 'f') {
double x; double x;
char *p; char *p;
@@ -349,6 +273,10 @@ int main(int argc, char *argv[])
if (*s == ',') opt.e2 = strtol(s + 1, &s, 10); if (*s == ',') opt.e2 = strtol(s + 1, &s, 10);
} }
} }
if ((opt.flag & MM_F_SPLICE) && (opt.flag & MM_F_FRAG_MODE)) {
fprintf(stderr, "[ERROR]\033[1;31m --splice and --frag should not be specified at the same time.\033[0m\n");
return 1;
}
if (!fnw && !(opt.flag&MM_F_CIGAR)) if (!fnw && !(opt.flag&MM_F_CIGAR))
ipt.flag |= MM_I_NO_SEQ; ipt.flag |= MM_I_NO_SEQ;
if (mm_check_opt(&ipt, &opt) < 0) if (mm_check_opt(&ipt, &opt) < 0)
@@ -365,14 +293,14 @@ int main(int argc, char *argv[])
fprintf(fp_help, " -H use homopolymer-compressed k-mer (preferrable for PacBio)\n"); fprintf(fp_help, " -H use homopolymer-compressed k-mer (preferrable for PacBio)\n");
fprintf(fp_help, " -k INT k-mer size (no larger than 28) [%d]\n", ipt.k); fprintf(fp_help, " -k INT k-mer size (no larger than 28) [%d]\n", ipt.k);
fprintf(fp_help, " -w INT minimizer window size [%d]\n", ipt.w); fprintf(fp_help, " -w INT minimizer window size [%d]\n", ipt.w);
fprintf(fp_help, " -I NUM split index for every ~NUM input bases [8G]\n"); fprintf(fp_help, " -I NUM split index for every ~NUM input bases [4G]\n");
fprintf(fp_help, " -d FILE dump index to FILE []\n"); fprintf(fp_help, " -d FILE dump index to FILE []\n");
fprintf(fp_help, " Mapping:\n"); fprintf(fp_help, " Mapping:\n");
fprintf(fp_help, " -f FLOAT filter out top FLOAT fraction of repetitive minimizers [%g]\n", opt.mid_occ_frac); fprintf(fp_help, " -f FLOAT filter out top FLOAT fraction of repetitive minimizers [%g]\n", opt.mid_occ_frac);
fprintf(fp_help, " -g NUM stop chain enlongation if there are no minimizers in INT-bp [%d]\n", opt.max_gap); fprintf(fp_help, " -g NUM stop chain enlongation if there are no minimizers in INT-bp [%d]\n", opt.max_gap);
fprintf(fp_help, " -G NUM max intron length (effective with -xsplice; changing -r) [200k]\n"); fprintf(fp_help, " -G NUM max intron length (effective with -xsplice; changing -r) [200k]\n");
fprintf(fp_help, " -F NUM max fragment length (effective with -xsr or in the fragment mode) [800]\n"); fprintf(fp_help, " -F NUM max fragment length (effective with -xsr or in the fragment mode) [800]\n");
fprintf(fp_help, " -r NUM[,NUM] chaining/alignment bandwidth and long-join bandwidth [%d,%d]\n", opt.bw, opt.bw_long); fprintf(fp_help, " -r NUM bandwidth used in chaining and DP-based alignment [%d]\n", opt.bw);
fprintf(fp_help, " -n INT minimal number of minimizers on a chain [%d]\n", opt.min_cnt); fprintf(fp_help, " -n INT minimal number of minimizers on a chain [%d]\n", opt.min_cnt);
fprintf(fp_help, " -m INT minimal chaining score (matching bases minus log gap penalty) [%d]\n", opt.min_chain_score); fprintf(fp_help, " -m INT minimal chaining score (matching bases minus log gap penalty) [%d]\n", opt.min_chain_score);
// fprintf(fp_help, " -T INT SDUST threshold; 0 to disable SDUST [%d]\n", opt.sdust_thres); // TODO: this option is never used; might be buggy // fprintf(fp_help, " -T INT SDUST threshold; 0 to disable SDUST [%d]\n", opt.sdust_thres); // TODO: this option is never used; might be buggy
@@ -381,14 +309,12 @@ int main(int argc, char *argv[])
fprintf(fp_help, " -N INT retain at most INT secondary alignments [%d]\n", opt.best_n); fprintf(fp_help, " -N INT retain at most INT secondary alignments [%d]\n", opt.best_n);
fprintf(fp_help, " Alignment:\n"); fprintf(fp_help, " Alignment:\n");
fprintf(fp_help, " -A INT matching score [%d]\n", opt.a); fprintf(fp_help, " -A INT matching score [%d]\n", opt.a);
fprintf(fp_help, " -B INT mismatch penalty (larger value for lower divergence) [%d]\n", opt.b); fprintf(fp_help, " -B INT mismatch penalty [%d]\n", opt.b);
fprintf(fp_help, " -O INT[,INT] gap open penalty [%d,%d]\n", opt.q, opt.q2); fprintf(fp_help, " -O INT[,INT] gap open penalty [%d,%d]\n", opt.q, opt.q2);
fprintf(fp_help, " -E INT[,INT] gap extension penalty; a k-long gap costs min{O1+k*E1,O2+k*E2} [%d,%d]\n", opt.e, opt.e2); fprintf(fp_help, " -E INT[,INT] gap extension penalty; a k-long gap costs min{O1+k*E1,O2+k*E2} [%d,%d]\n", opt.e, opt.e2);
fprintf(fp_help, " -z INT[,INT] Z-drop score and inversion Z-drop score [%d,%d]\n", opt.zdrop, opt.zdrop_inv); fprintf(fp_help, " -z INT[,INT] Z-drop score and inversion Z-drop score [%d,%d]\n", opt.zdrop, opt.zdrop_inv);
fprintf(fp_help, " -s INT minimal peak DP alignment score [%d]\n", opt.min_dp_max); fprintf(fp_help, " -s INT minimal peak DP alignment score [%d]\n", opt.min_dp_max);
fprintf(fp_help, " -u CHAR how to find GT-AG. f:transcript strand, b:both strands, n:don't match GT-AG [n]\n"); fprintf(fp_help, " -u CHAR how to find GT-AG. f:transcript strand, b:both strands, n:don't match GT-AG [n]\n");
fprintf(fp_help, " -J INT splice mode. 0: original minimap2 model; 1: miniprot model [1]\n");
fprintf(fp_help, " -j FILE junctions in BED12 to extend *short* RNA-seq alignment []\n");
fprintf(fp_help, " Input/Output:\n"); fprintf(fp_help, " Input/Output:\n");
fprintf(fp_help, " -a output in the SAM format (PAF by default)\n"); fprintf(fp_help, " -a output in the SAM format (PAF by default)\n");
fprintf(fp_help, " -o FILE output alignments to FILE [stdout]\n"); fprintf(fp_help, " -o FILE output alignments to FILE [stdout]\n");
@@ -396,24 +322,20 @@ int main(int argc, char *argv[])
fprintf(fp_help, " -R STR SAM read group line in a format like '@RG\\tID:foo\\tSM:bar' []\n"); fprintf(fp_help, " -R STR SAM read group line in a format like '@RG\\tID:foo\\tSM:bar' []\n");
fprintf(fp_help, " -c output CIGAR in PAF\n"); fprintf(fp_help, " -c output CIGAR in PAF\n");
fprintf(fp_help, " --cs[=STR] output the cs tag; STR is 'short' (if absent) or 'long' [none]\n"); fprintf(fp_help, " --cs[=STR] output the cs tag; STR is 'short' (if absent) or 'long' [none]\n");
fprintf(fp_help, " --ds output the ds tag, which is an extension to cs\n");
fprintf(fp_help, " --MD output the MD tag\n"); fprintf(fp_help, " --MD output the MD tag\n");
fprintf(fp_help, " --eqx write =/X CIGAR operators\n"); fprintf(fp_help, " --eqx write =/X CIGAR operators\n");
fprintf(fp_help, " -Y use soft clipping for supplementary alignments\n"); fprintf(fp_help, " -Y use soft clipping for supplementary alignments\n");
fprintf(fp_help, " -y copy FASTA/Q comments to output SAM\n");
fprintf(fp_help, " -t INT number of threads [%d]\n", n_threads); fprintf(fp_help, " -t INT number of threads [%d]\n", n_threads);
fprintf(fp_help, " -K NUM minibatch size for mapping [500M]\n"); fprintf(fp_help, " -K NUM minibatch size for mapping [500M]\n");
// fprintf(fp_help, " -v INT verbose level [%d]\n", mm_verbose); // fprintf(fp_help, " -v INT verbose level [%d]\n", mm_verbose);
fprintf(fp_help, " --version show version number\n"); fprintf(fp_help, " --version show version number\n");
fprintf(fp_help, " Preset:\n"); fprintf(fp_help, " Preset:\n");
fprintf(fp_help, " -x STR preset (always applied before other options; see minimap2.1 for details) []\n"); fprintf(fp_help, " -x STR preset (always applied before other options; see minimap2.1 for details) []\n");
fprintf(fp_help, " - lr:hq - accurate long reads (error rate <1%%) against a reference genome\n"); fprintf(fp_help, " - map-pb/map-ont: PacBio/Nanopore vs reference mapping\n");
fprintf(fp_help, " - splice/splice:hq - spliced alignment for long reads/accurate long reads\n"); fprintf(fp_help, " - ava-pb/ava-ont: PacBio/Nanopore read overlap\n");
fprintf(fp_help, " - splice:sr - spliced alignment for short RNA-seq reads\n"); fprintf(fp_help, " - asm5/asm10/asm20: asm-to-ref mapping, for ~0.1/1/5%% sequence divergence\n");
fprintf(fp_help, " - asm5/asm10/asm20 - asm-to-ref mapping, for ~0.1/1/5%% sequence divergence\n"); fprintf(fp_help, " - splice: long-read spliced alignment\n");
fprintf(fp_help, " - sr - short reads against a reference\n"); fprintf(fp_help, " - sr: genomic short-read mapping\n");
fprintf(fp_help, " - map-pb/map-hifi/map-ont/map-iclr - CLR/HiFi/Nanopore/ICLR vs reference mapping\n");
fprintf(fp_help, " - ava-pb/ava-ont - PacBio CLR/Nanopore read overlap\n");
fprintf(fp_help, "\nSee `man ./minimap2.1' for detailed description of these and other advanced command-line options.\n"); fprintf(fp_help, "\nSee `man ./minimap2.1' for detailed description of these and other advanced command-line options.\n");
return fp_help == stdout? 0 : 1; return fp_help == stdout? 0 : 1;
} }
@@ -435,7 +357,6 @@ int main(int argc, char *argv[])
if (opt.best_n == 0 && (opt.flag&MM_F_CIGAR) && mm_verbose >= 2) if (opt.best_n == 0 && (opt.flag&MM_F_CIGAR) && mm_verbose >= 2)
fprintf(stderr, "[WARNING]\033[1;31m `-N 0' reduces alignment accuracy. Please use --secondary=no to suppress secondary alignments.\033[0m\n"); fprintf(stderr, "[WARNING]\033[1;31m `-N 0' reduces alignment accuracy. Please use --secondary=no to suppress secondary alignments.\033[0m\n");
while ((mi = mm_idx_reader_read(idx_rdr, n_threads)) != 0) { while ((mi = mm_idx_reader_read(idx_rdr, n_threads)) != 0) {
int ret;
if ((opt.flag & MM_F_CIGAR) && (mi->flag & MM_I_NO_SEQ)) { if ((opt.flag & MM_F_CIGAR) && (mi->flag & MM_I_NO_SEQ)) {
fprintf(stderr, "[ERROR] the prebuilt index doesn't contain sequences.\n"); fprintf(stderr, "[ERROR] the prebuilt index doesn't contain sequences.\n");
mm_idx_destroy(mi); mm_idx_destroy(mi);
@@ -444,65 +365,26 @@ int main(int argc, char *argv[])
} }
if ((opt.flag & MM_F_OUT_SAM) && idx_rdr->n_parts == 1) { if ((opt.flag & MM_F_OUT_SAM) && idx_rdr->n_parts == 1) {
if (mm_idx_reader_eof(idx_rdr)) { if (mm_idx_reader_eof(idx_rdr)) {
if (opt.split_prefix == 0) mm_write_sam_hdr(mi, rg, MM_VERSION, argc, argv);
ret = mm_write_sam_hdr(mi, rg, MM_VERSION, argc, argv);
else
ret = mm_write_sam_hdr(0, rg, MM_VERSION, argc, argv);
} else { } else {
ret = mm_write_sam_hdr(0, rg, MM_VERSION, argc, argv); mm_write_sam_hdr(0, rg, MM_VERSION, argc, argv);
if (opt.split_prefix == 0 && mm_verbose >= 2) if (opt.split_prefix == 0 && mm_verbose >= 2)
fprintf(stderr, "[WARNING]\033[1;31m For a multi-part index, no @SQ lines will be outputted. Please use --split-prefix.\033[0m\n"); fprintf(stderr, "[WARNING]\033[1;31m For a multi-part index, no @SQ lines will be outputted. Please use --split-prefix.\033[0m\n");
} }
if (ret != 0) {
mm_idx_destroy(mi);
mm_idx_reader_close(idx_rdr);
return 1;
}
} }
if (mm_verbose >= 3) if (mm_verbose >= 3)
fprintf(stderr, "[M::%s::%.3f*%.2f] loaded/built the index for %d target sequence(s)\n", fprintf(stderr, "[M::%s::%.3f*%.2f] loaded/built the index for %d target sequence(s)\n",
__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), mi->n_seq); __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), mi->n_seq);
if (argc != o.ind + 1) mm_mapopt_update(&opt, mi); if (argc != o.ind + 1) mm_mapopt_update(&opt, mi);
if (mm_verbose >= 3) mm_idx_stat(mi); if (mm_verbose >= 3) mm_idx_stat(mi);
if (fn_bed_junc) { if (junc_bed) mm_idx_bed_read(mi, junc_bed, 1);
mm_idx_bed_read(mi, fn_bed_junc, 1);
if (mi->I == 0 && mm_verbose >= 2)
fprintf(stderr, "[WARNING] failed to load the junction BED file\n");
}
if (fn_bed_jump) {
mm_idx_jjump_read(mi, fn_bed_jump, MM_JUNC_ANNO, -1);
if (mi->J == 0 && mm_verbose >= 2)
fprintf(stderr, "[WARNING] failed to load the jump BED file\n");
}
if (fn_bed_pass1) {
mm_idx_jjump_read(mi, fn_bed_pass1, MM_JUNC_MISC, 5);
if (mi->J == 0 && mm_verbose >= 2)
fprintf(stderr, "[WARNING] failed to load the pass-1 jump BED file\n");
}
if (fn_spsc) {
mm_idx_spsc_read2(mi, fn_spsc, mm_max_spsc_bonus(&opt), spsc_scale);
if (mi->spsc == 0 && mm_verbose >= 2)
fprintf(stderr, "[WARNING] failed to load the splice score file\n");
}
if (alt_list) mm_idx_alt_read(mi, alt_list);
if (argc - (o.ind + 1) == 0) {
mm_idx_destroy(mi);
continue; // no query files
}
ret = 0;
if (!(opt.flag & MM_F_FRAG_MODE)) { if (!(opt.flag & MM_F_FRAG_MODE)) {
for (i = o.ind + 1; i < argc; ++i) { for (i = o.ind + 1; i < argc; ++i)
ret = mm_map_file(mi, argv[i], &opt, n_threads); mm_map_file(mi, argv[i], &opt, n_threads);
if (ret < 0) break;
}
} else { } else {
ret = mm_map_file_frag(mi, argc - (o.ind + 1), (const char**)&argv[o.ind + 1], &opt, n_threads); mm_map_file_frag(mi, argc - (o.ind + 1), (const char**)&argv[o.ind + 1], &opt, n_threads);
} }
mm_idx_destroy(mi); mm_idx_destroy(mi);
if (ret < 0) {
fprintf(stderr, "ERROR: failed to map the query file\n");
exit(EXIT_FAILURE);
}
} }
n_parts = idx_rdr->n_parts; n_parts = idx_rdr->n_parts;
mm_idx_reader_close(idx_rdr); mm_idx_reader_close(idx_rdr);
+91 -109
View File
@@ -10,6 +10,11 @@
#include "bseq.h" #include "bseq.h"
#include "khash.h" #include "khash.h"
struct mm_tbuf_s {
void *km;
int rep_len, frag_gap;
};
mm_tbuf_t *mm_tbuf_init(void) mm_tbuf_t *mm_tbuf_init(void)
{ {
mm_tbuf_t *b; mm_tbuf_t *b;
@@ -75,7 +80,49 @@ static void collect_minimizers(void *km, const mm_mapopt_t *opt, const mm_idx_t
#define heap_lt(a, b) ((a).x > (b).x) #define heap_lt(a, b) ((a).x > (b).x)
KSORT_INIT(heap, mm128_t, heap_lt) KSORT_INIT(heap, mm128_t, heap_lt)
static inline int skip_seed(int flag, uint64_t r, const mm_seed_t *q, const char *qname, int qlen, const mm_idx_t *mi, int *is_self) typedef struct {
uint32_t n;
uint32_t q_pos, q_span;
uint32_t seg_id:31, is_tandem:1;
const uint64_t *cr;
} mm_match_t;
static mm_match_t *collect_matches(void *km, int *_n_m, int max_occ, const mm_idx_t *mi, const mm128_v *mv, int64_t *n_a, int *rep_len, int *n_mini_pos, uint64_t **mini_pos)
{
int rep_st = 0, rep_en = 0, n_m;
size_t i;
mm_match_t *m;
*n_mini_pos = 0;
*mini_pos = (uint64_t*)kmalloc(km, mv->n * sizeof(uint64_t));
m = (mm_match_t*)kmalloc(km, mv->n * sizeof(mm_match_t));
for (i = 0, n_m = 0, *rep_len = 0, *n_a = 0; i < mv->n; ++i) {
const uint64_t *cr;
mm128_t *p = &mv->a[i];
uint32_t q_pos = (uint32_t)p->y, q_span = p->x & 0xff;
int t;
cr = mm_idx_get(mi, p->x>>8, &t);
if (t >= max_occ) {
int en = (q_pos >> 1) + 1, st = en - q_span;
if (st > rep_en) {
*rep_len += rep_en - rep_st;
rep_st = st, rep_en = en;
} else rep_en = en;
} else {
mm_match_t *q = &m[n_m++];
q->q_pos = q_pos, q->q_span = q_span, q->cr = cr, q->n = t, q->seg_id = p->y >> 32;
q->is_tandem = 0;
if (i > 0 && p->x>>8 == mv->a[i - 1].x>>8) q->is_tandem = 1;
if (i < mv->n - 1 && p->x>>8 == mv->a[i + 1].x>>8) q->is_tandem = 1;
*n_a += q->n;
(*mini_pos)[(*n_mini_pos)++] = (uint64_t)q_span<<32 | q_pos>>1;
}
}
*rep_len += rep_en - rep_st;
*_n_m = n_m;
return m;
}
static inline int skip_seed(int flag, uint64_t r, const mm_match_t *q, const char *qname, int qlen, const mm_idx_t *mi, int *is_self)
{ {
*is_self = 0; *is_self = 0;
if (qname && (flag & (MM_F_NO_DIAG|MM_F_NO_DUAL))) { if (qname && (flag & (MM_F_NO_DIAG|MM_F_NO_DUAL))) {
@@ -104,10 +151,10 @@ static mm128_t *collect_seed_hits_heap(void *km, const mm_mapopt_t *opt, int max
{ {
int i, n_m, heap_size = 0; int i, n_m, heap_size = 0;
int64_t j, n_for = 0, n_rev = 0; int64_t j, n_for = 0, n_rev = 0;
mm_seed_t *m; mm_match_t *m;
mm128_t *a, *heap; mm128_t *a, *heap;
m = mm_collect_matches(km, &n_m, qlen, max_occ, opt->max_max_occ, opt->occ_dist, mi, mv, n_a, rep_len, n_mini_pos, mini_pos); m = collect_matches(km, &n_m, max_occ, mi, mv, n_a, rep_len, n_mini_pos, mini_pos);
heap = (mm128_t*)kmalloc(km, n_m * sizeof(mm128_t)); heap = (mm128_t*)kmalloc(km, n_m * sizeof(mm128_t));
a = (mm128_t*)kmalloc(km, *n_a * sizeof(mm128_t)); a = (mm128_t*)kmalloc(km, *n_a * sizeof(mm128_t));
@@ -121,7 +168,7 @@ static mm128_t *collect_seed_hits_heap(void *km, const mm_mapopt_t *opt, int max
} }
ks_heapmake_heap(heap_size, heap); ks_heapmake_heap(heap_size, heap);
while (heap_size > 0) { while (heap_size > 0) {
mm_seed_t *q = &m[heap->y>>32]; mm_match_t *q = &m[heap->y>>32];
mm128_t *p; mm128_t *p;
uint64_t r = heap->x; uint64_t r = heap->x;
int32_t is_self, rpos = (uint32_t)r >> 1; int32_t is_self, rpos = (uint32_t)r >> 1;
@@ -169,12 +216,12 @@ static mm128_t *collect_seed_hits(void *km, const mm_mapopt_t *opt, int max_occ,
int *n_mini_pos, uint64_t **mini_pos) int *n_mini_pos, uint64_t **mini_pos)
{ {
int i, n_m; int i, n_m;
mm_seed_t *m; mm_match_t *m;
mm128_t *a; mm128_t *a;
m = mm_collect_matches(km, &n_m, qlen, max_occ, opt->max_max_occ, opt->occ_dist, mi, mv, n_a, rep_len, n_mini_pos, mini_pos); m = collect_matches(km, &n_m, max_occ, mi, mv, n_a, rep_len, n_mini_pos, mini_pos);
a = (mm128_t*)kmalloc(km, *n_a * sizeof(mm128_t)); a = (mm128_t*)kmalloc(km, *n_a * sizeof(mm128_t));
for (i = 0, *n_a = 0; i < n_m; ++i) { for (i = 0, *n_a = 0; i < n_m; ++i) {
mm_seed_t *q = &m[i]; mm_match_t *q = &m[i];
const uint64_t *r = q->cr; const uint64_t *r = q->cr;
uint32_t k; uint32_t k;
for (k = 0; k < q->n; ++k) { for (k = 0; k < q->n; ++k) {
@@ -185,13 +232,9 @@ static mm128_t *collect_seed_hits(void *km, const mm_mapopt_t *opt, int max_occ,
if ((r[k]&1) == (q->q_pos&1)) { // forward strand if ((r[k]&1) == (q->q_pos&1)) { // forward strand
p->x = (r[k]&0xffffffff00000000ULL) | rpos; p->x = (r[k]&0xffffffff00000000ULL) | rpos;
p->y = (uint64_t)q->q_span << 32 | q->q_pos >> 1; p->y = (uint64_t)q->q_span << 32 | q->q_pos >> 1;
} else if (!(opt->flag & MM_F_QSTRAND)) { // reverse strand and not in the query-strand mode } else { // reverse strand
p->x = 1ULL<<63 | (r[k]&0xffffffff00000000ULL) | rpos; p->x = 1ULL<<63 | (r[k]&0xffffffff00000000ULL) | rpos;
p->y = (uint64_t)q->q_span << 32 | (qlen - ((q->q_pos>>1) + 1 - q->q_span) - 1); p->y = (uint64_t)q->q_span << 32 | (qlen - ((q->q_pos>>1) + 1 - q->q_span) - 1);
} else { // reverse strand; query-strand
int32_t len = mi->seq[r[k]>>32].len;
p->x = 1ULL<<63 | (r[k]&0xffffffff00000000ULL) | (len - (rpos + 1 - q->q_span) - 1); // coordinate only accurate for non-HPC seeds
p->y = (uint64_t)q->q_span << 32 | q->q_pos >> 1;
} }
p->y |= (uint64_t)q->seg_id << MM_SEED_SEG_SHIFT; p->y |= (uint64_t)q->seg_id << MM_SEED_SEG_SHIFT;
if (q->is_tandem) p->y |= MM_SEED_TANDEM; if (q->is_tandem) p->y |= MM_SEED_TANDEM;
@@ -206,9 +249,11 @@ static mm128_t *collect_seed_hits(void *km, const mm_mapopt_t *opt, int max_occ,
static void chain_post(const mm_mapopt_t *opt, int max_chain_gap_ref, const mm_idx_t *mi, void *km, int qlen, int n_segs, const int *qlens, int *n_regs, mm_reg1_t *regs, mm128_t *a) static void chain_post(const mm_mapopt_t *opt, int max_chain_gap_ref, const mm_idx_t *mi, void *km, int qlen, int n_segs, const int *qlens, int *n_regs, mm_reg1_t *regs, mm128_t *a)
{ {
if (!(opt->flag & MM_F_ALL_CHAINS)) { // don't choose primary mapping(s) if (!(opt->flag & MM_F_ALL_CHAINS)) { // don't choose primary mapping(s)
mm_set_parent(km, opt->mask_level, opt->mask_len, *n_regs, regs, opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL, opt->alt_drop); mm_set_parent(km, opt->mask_level, *n_regs, regs, opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL);
if (n_segs <= 1) mm_select_sub(km, opt->pri_ratio, mi->k*2, opt->best_n, 1, opt->max_gap * 0.8, n_regs, regs); if (n_segs <= 1) mm_select_sub(km, opt->pri_ratio, mi->k*2, opt->best_n, n_regs, regs);
else mm_select_sub_multi(km, opt->pri_ratio, 0.2f, 0.7f, max_chain_gap_ref, mi->k*2, opt->best_n, n_segs, qlens, n_regs, regs); else mm_select_sub_multi(km, opt->pri_ratio, 0.2f, 0.7f, max_chain_gap_ref, mi->k*2, opt->best_n, n_segs, qlens, n_regs, regs);
if (!(opt->flag & (MM_F_SPLICE|MM_F_SR|MM_F_NO_LJOIN))) // long join not working well without primary chains
mm_join_long(km, opt, qlen, n_regs, regs, a);
} }
} }
@@ -217,17 +262,17 @@ static mm_reg1_t *align_regs(const mm_mapopt_t *opt, const mm_idx_t *mi, void *k
if (!(opt->flag & MM_F_CIGAR)) return regs; if (!(opt->flag & MM_F_CIGAR)) return regs;
regs = mm_align_skeleton(km, opt, mi, qlen, seq, n_regs, regs, a); // this calls mm_filter_regs() regs = mm_align_skeleton(km, opt, mi, qlen, seq, n_regs, regs, a); // this calls mm_filter_regs()
if (!(opt->flag & MM_F_ALL_CHAINS)) { // don't choose primary mapping(s) if (!(opt->flag & MM_F_ALL_CHAINS)) { // don't choose primary mapping(s)
mm_set_parent(km, opt->mask_level, opt->mask_len, *n_regs, regs, opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL, opt->alt_drop); mm_set_parent(km, opt->mask_level, *n_regs, regs, opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL);
mm_select_sub(km, opt->pri_ratio, mi->k*2, opt->best_n, 0, opt->max_gap * 0.8, n_regs, regs); mm_select_sub(km, opt->pri_ratio, mi->k*2, opt->best_n, n_regs, regs);
mm_set_sam_pri(*n_regs, regs); mm_set_sam_pri(*n_regs, regs);
} }
return regs; return regs;
} }
void mm_map_frag_core(const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, int *n_regs, mm_reg1_t **regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname) void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, int *n_regs, mm_reg1_t **regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname)
{ {
int i, j, rep_len, qlen_sum, n_regs0, n_mini_pos; int i, j, rep_len, qlen_sum, n_regs0, n_mini_pos;
int max_chain_gap_qry, max_chain_gap_ref, is_splice = !!(opt->flag & MM_F_SPLICE), is_sr = !!(opt->flag & MM_F_SR), is_sr_rna = !!(opt->flag & MM_F_SR_RNA); int max_chain_gap_qry, max_chain_gap_ref, is_splice = !!(opt->flag & MM_F_SPLICE), is_sr = !!(opt->flag & MM_F_SR);
uint32_t hash; uint32_t hash;
int64_t n_a; int64_t n_a;
uint64_t *u, *mini_pos; uint64_t *u, *mini_pos;
@@ -235,7 +280,6 @@ void mm_map_frag_core(const mm_idx_t *mi, int n_segs, const int *qlens, const ch
mm128_v mv = {0,0,0}; mm128_v mv = {0,0,0};
mm_reg1_t *regs0; mm_reg1_t *regs0;
km_stat_t kmst; km_stat_t kmst;
float chn_pen_gap, chn_pen_skip;
for (i = 0, qlen_sum = 0; i < n_segs; ++i) for (i = 0, qlen_sum = 0; i < n_segs; ++i)
qlen_sum += qlens[i], n_regs[i] = 0, regs[i] = 0; qlen_sum += qlens[i], n_regs[i] = 0, regs[i] = 0;
@@ -243,12 +287,11 @@ void mm_map_frag_core(const mm_idx_t *mi, int n_segs, const int *qlens, const ch
if (qlen_sum == 0 || n_segs <= 0 || n_segs > MM_MAX_SEG) return; if (qlen_sum == 0 || n_segs <= 0 || n_segs > MM_MAX_SEG) return;
if (opt->max_qlen > 0 && qlen_sum > opt->max_qlen) return; if (opt->max_qlen > 0 && qlen_sum > opt->max_qlen) return;
hash = qname && !(opt->flag & MM_F_NO_HASH_NAME)? __ac_X31_hash_string(qname) : 0; hash = qname? __ac_X31_hash_string(qname) : 0;
hash ^= __ac_Wang_hash(qlen_sum) + __ac_Wang_hash(opt->seed); hash ^= __ac_Wang_hash(qlen_sum) + __ac_Wang_hash(opt->seed);
hash = __ac_Wang_hash(hash); hash = __ac_Wang_hash(hash);
collect_minimizers(b->km, opt, mi, n_segs, qlens, seqs, &mv); collect_minimizers(b->km, opt, mi, n_segs, qlens, seqs, &mv);
if (opt->q_occ_frac > 0.0f) mm_seed_mz_flt(b->km, &mv, opt->mid_occ, opt->q_occ_frac);
if (opt->flag & MM_F_HEAP_SORT) a = collect_seed_hits_heap(b->km, opt, opt->mid_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos); if (opt->flag & MM_F_HEAP_SORT) a = collect_seed_hits_heap(b->km, opt, opt->mid_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
else a = collect_seed_hits(b->km, opt, opt->mid_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos); else a = collect_seed_hits(b->km, opt, opt->mid_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
@@ -270,27 +313,9 @@ void mm_map_frag_core(const mm_idx_t *mi, int n_segs, const int *qlens, const ch
if (max_chain_gap_ref < opt->max_gap) max_chain_gap_ref = opt->max_gap; if (max_chain_gap_ref < opt->max_gap) max_chain_gap_ref = opt->max_gap;
} else max_chain_gap_ref = opt->max_gap; } else max_chain_gap_ref = opt->max_gap;
chn_pen_gap = opt->chain_gap_scale * 0.01 * mi->k; a = mm_chain_dp(max_chain_gap_ref, max_chain_gap_qry, opt->bw, opt->max_chain_skip, opt->max_chain_iter, opt->min_cnt, opt->min_chain_score, is_splice, n_segs, n_a, a, &n_regs0, &u, b->km);
chn_pen_skip = opt->chain_skip_scale * 0.01 * mi->k;
if (opt->flag & MM_F_RMQ) {
a = mg_lchain_rmq(opt->max_gap, opt->rmq_inner_dist, opt->bw, opt->max_chain_skip, opt->rmq_size_cap, opt->min_cnt, opt->min_chain_score,
chn_pen_gap, chn_pen_skip, n_a, a, &n_regs0, &u, b->km);
} else {
a = mg_lchain_dp(max_chain_gap_ref, max_chain_gap_qry, opt->bw, opt->max_chain_skip, opt->max_chain_iter, opt->min_cnt, opt->min_chain_score,
chn_pen_gap, chn_pen_skip, is_splice, n_segs, n_a, a, &n_regs0, &u, b->km);
}
if (opt->bw_long > opt->bw && (opt->flag & (MM_F_SPLICE|MM_F_SR|MM_F_NO_LJOIN)) == 0 && n_segs == 1 && n_regs0 > 1) { // re-chain/long-join for long sequences if (opt->max_occ > opt->mid_occ && rep_len > 0) {
int32_t st = (int32_t)a[0].y, en = (int32_t)a[(int32_t)u[0] - 1].y;
if (qlen_sum - (en - st) > opt->rmq_rescue_size || en - st > qlen_sum * opt->rmq_rescue_ratio) {
int32_t i;
for (i = 0, n_a = 0; i < n_regs0; ++i) n_a += (int32_t)u[i];
kfree(b->km, u);
radix_sort_128x(a, a + n_a);
a = mg_lchain_rmq(opt->max_gap, opt->rmq_inner_dist, opt->bw_long, opt->max_chain_skip, opt->rmq_size_cap, opt->min_cnt, opt->min_chain_score,
chn_pen_gap, chn_pen_skip, n_a, a, &n_regs0, &u, b->km);
}
} else if (opt->max_occ > opt->mid_occ && rep_len > 0 && !(opt->flag & MM_F_RMQ)) { // re-chain, mostly for short reads
int rechain = 0; int rechain = 0;
if (n_regs0 > 0) { // test if the best chain has all the segments if (n_regs0 > 0) { // test if the best chain has all the segments
int n_chained_segs = 1, max = 0, max_i = -1, max_off = -1, off = 0; int n_chained_segs = 1, max = 0, max_i = -1, max_off = -1, off = 0;
@@ -310,44 +335,44 @@ void mm_map_frag_core(const mm_idx_t *mi, int n_segs, const int *qlens, const ch
kfree(b->km, mini_pos); kfree(b->km, mini_pos);
if (opt->flag & MM_F_HEAP_SORT) a = collect_seed_hits_heap(b->km, opt, opt->max_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos); if (opt->flag & MM_F_HEAP_SORT) a = collect_seed_hits_heap(b->km, opt, opt->max_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
else a = collect_seed_hits(b->km, opt, opt->max_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos); else a = collect_seed_hits(b->km, opt, opt->max_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
a = mg_lchain_dp(max_chain_gap_ref, max_chain_gap_qry, opt->bw, opt->max_chain_skip, opt->max_chain_iter, opt->min_cnt, opt->min_chain_score, a = mm_chain_dp(max_chain_gap_ref, max_chain_gap_qry, opt->bw, opt->max_chain_skip, opt->max_chain_iter, opt->min_cnt, opt->min_chain_score, is_splice, n_segs, n_a, a, &n_regs0, &u, b->km);
chn_pen_gap, chn_pen_skip, is_splice, n_segs, n_a, a, &n_regs0, &u, b->km);
} }
} }
b->frag_gap = max_chain_gap_ref; b->frag_gap = max_chain_gap_ref;
b->rep_len = rep_len; b->rep_len = rep_len;
regs0 = mm_gen_regs(b->km, hash, qlen_sum, n_regs0, u, a, !!(opt->flag&MM_F_QSTRAND)); regs0 = mm_gen_regs(b->km, hash, qlen_sum, n_regs0, u, a);
if (mi->n_alt) {
mm_mark_alt(mi, n_regs0, regs0);
mm_hit_sort(b->km, &n_regs0, regs0, opt->alt_drop); // this step can be merged into mm_gen_regs(); will do if this shows up in profile
}
if (mm_dbg_flag & (MM_DBG_PRINT_SEED|MM_DBG_PRINT_CHAIN)) if (mm_dbg_flag & MM_DBG_PRINT_SEED)
for (j = 0; j < n_regs0; ++j) for (j = 0; j < n_regs0; ++j)
for (i = regs0[j].as; i < regs0[j].as + regs0[j].cnt; ++i) for (i = regs0[j].as; i < regs0[j].as + regs0[j].cnt; ++i)
fprintf(stderr, "CN\t%d\t%s\t%d\t%c\t%d\t%d\t%d\n", j, mi->seq[a[i].x<<1>>33].name, (int32_t)a[i].x, "+-"[a[i].x>>63], (int32_t)a[i].y, (int32_t)(a[i].y>>32&0xff), fprintf(stderr, "CN\t%d\t%s\t%d\t%c\t%d\t%d\t%d\n", j, mi->seq[a[i].x<<1>>33].name, (int32_t)a[i].x, "+-"[a[i].x>>63], (int32_t)a[i].y, (int32_t)(a[i].y>>32&0xff),
i == regs0[j].as? 0 : ((int32_t)a[i].y - (int32_t)a[i-1].y) - ((int32_t)a[i].x - (int32_t)a[i-1].x)); i == regs0[j].as? 0 : ((int32_t)a[i].y - (int32_t)a[i-1].y) - ((int32_t)a[i].x - (int32_t)a[i-1].x));
chain_post(opt, max_chain_gap_ref, mi, b->km, qlen_sum, n_segs, qlens, &n_regs0, regs0, a); chain_post(opt, max_chain_gap_ref, mi, b->km, qlen_sum, n_segs, qlens, &n_regs0, regs0, a);
if (!is_sr && !(opt->flag&MM_F_QSTRAND)) { if (!is_sr) mm_est_err(mi, qlen_sum, n_regs0, regs0, a, n_mini_pos, mini_pos);
mm_est_err(mi, qlen_sum, n_regs0, regs0, a, n_mini_pos, mini_pos); if (!is_sr && n_segs == 1) {
n_regs0 = mm_filter_strand_retained(n_regs0, regs0); for (i = j = 0; i < n_regs0; ++i) {
mm_reg1_t *r = &regs0[i];
if (r->div > opt->flt_max_dv) continue;
if (r->blen < opt->flt_min_blen) continue;
regs0[j++] = regs0[i];
}
n_regs0 = j;
} }
if (n_segs == 1) { // uni-segment if (n_segs == 1) { // uni-segment
regs0 = align_regs(opt, mi, b->km, qlens[0], seqs[0], &n_regs0, regs0, a); regs0 = align_regs(opt, mi, b->km, qlens[0], seqs[0], &n_regs0, regs0, a);
regs0 = (mm_reg1_t*)realloc(regs0, sizeof(*regs0) * n_regs0); mm_set_mapq(b->km, n_regs0, regs0, opt->min_chain_score, opt->a, rep_len, is_sr);
mm_set_mapq2(b->km, n_regs0, regs0, opt->min_chain_score, opt->a, rep_len, is_sr || is_sr_rna, is_splice);
n_regs[0] = n_regs0, regs[0] = regs0; n_regs[0] = n_regs0, regs[0] = regs0;
} else { // multi-segment } else { // multi-segment
mm_seg_t *seg; mm_seg_t *seg;
seg = mm_seg_gen(b->km, hash, n_segs, qlens, n_regs0, regs0, n_regs, regs, a); // split fragment chain to separate segment chains seg = mm_seg_gen(b->km, hash, n_segs, qlens, n_regs0, regs0, n_regs, regs, a); // split fragment chain to separate segment chains
free(regs0); free(regs0);
for (i = 0; i < n_segs; ++i) { for (i = 0; i < n_segs; ++i) {
mm_set_parent(b->km, opt->mask_level, opt->mask_len, n_regs[i], regs[i], opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL, opt->alt_drop); // update mm_reg1_t::parent mm_set_parent(b->km, opt->mask_level, n_regs[i], regs[i], opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL); // update mm_reg1_t::parent
regs[i] = align_regs(opt, mi, b->km, qlens[i], seqs[i], &n_regs[i], regs[i], seg[i].a); regs[i] = align_regs(opt, mi, b->km, qlens[i], seqs[i], &n_regs[i], regs[i], seg[i].a);
mm_set_mapq2(b->km, n_regs[i], regs[i], opt->min_chain_score, opt->a, rep_len, is_sr || is_sr_rna, is_splice); mm_set_mapq(b->km, n_regs[i], regs[i], opt->min_chain_score, opt->a, rep_len, is_sr);
} }
mm_seg_free(b->km, n_segs, seg); mm_seg_free(b->km, n_segs, seg);
if (n_segs == 2 && opt->pe_ori >= 0 && (opt->flag&MM_F_CIGAR)) if (n_segs == 2 && opt->pe_ori >= 0 && (opt->flag&MM_F_CIGAR))
@@ -359,36 +384,18 @@ void mm_map_frag_core(const mm_idx_t *mi, int n_segs, const int *qlens, const ch
kfree(b->km, u); kfree(b->km, u);
kfree(b->km, mini_pos); kfree(b->km, mini_pos);
if (mi->J && n_segs == 1 && is_splice)
for (i = 0; i < n_regs0; ++i)
mm_jump_split(b->km, mi, opt, qlens[0], (const uint8_t*)seqs[0], &regs0[i], 0);
if (b->km) { if (b->km) {
km_stat(b->km, &kmst); km_stat(b->km, &kmst);
if (mm_dbg_flag & MM_DBG_PRINT_QNAME) if (mm_dbg_flag & MM_DBG_PRINT_QNAME)
fprintf(stderr, "QM\t%s\t%d\tcap=%ld,nCore=%ld,largest=%ld\n", qname, qlen_sum, kmst.capacity, kmst.n_cores, kmst.largest); fprintf(stderr, "QM\t%s\t%d\tcap=%ld,nCore=%ld,largest=%ld\n", qname, qlen_sum, kmst.capacity, kmst.n_cores, kmst.largest);
assert(kmst.n_blocks == kmst.n_cores); // otherwise, there is a memory leak assert(kmst.n_blocks == kmst.n_cores); // otherwise, there is a memory leak
if (kmst.largest > 1U<<28 || (opt->cap_kalloc > 0 && kmst.capacity > opt->cap_kalloc)) { if (kmst.largest > 1U<<28) {
if (mm_dbg_flag & MM_DBG_PRINT_QNAME)
fprintf(stderr, "[W::%s] reset thread-local memory after read %s\n", __func__, qname);
km_destroy(b->km); km_destroy(b->km);
b->km = km_init(); b->km = km_init();
} }
} }
} }
void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, int *n_regs, mm_reg1_t **regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname)
{
if ((opt->flag & MM_F_WEAK_PAIRING) && n_segs == 2 && opt->pe_ori >= 0 && (opt->flag&MM_F_CIGAR)) {
int i;
for (i = 0; i < n_segs; ++i)
mm_map_frag_core(mi, 1, &qlens[i], &seqs[i], &n_regs[i], &regs[i], b, opt, qname);
mm_pair(b->km, opt->max_gap_ref, opt->pe_bonus, opt->a * 2 + opt->b, opt->a, qlens, n_regs, regs);
} else {
mm_map_frag_core(mi, n_segs, qlens, seqs, n_regs, regs, b, opt, qname);
}
}
mm_reg1_t *mm_map(const mm_idx_t *mi, int qlen, const char *seq, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname) mm_reg1_t *mm_map(const mm_idx_t *mi, int qlen, const char *seq, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname)
{ {
mm_reg1_t *regs; mm_reg1_t *regs;
@@ -401,8 +408,7 @@ mm_reg1_t *mm_map(const mm_idx_t *mi, int qlen, const char *seq, int *n_regs, mm
**************************/ **************************/
typedef struct { typedef struct {
int n_processed, n_threads, n_fp; int mini_batch_size, n_processed, n_threads, n_fp;
int64_t mini_batch_size;
const mm_mapopt_t *opt; const mm_mapopt_t *opt;
mm_bseq_file_t **fp; mm_bseq_file_t **fp;
const mm_idx_t *mi; const mm_idx_t *mi;
@@ -427,13 +433,10 @@ static void worker_for(void *_data, long i, int tid) // kt_for() callback
step_t *s = (step_t*)_data; step_t *s = (step_t*)_data;
int qlens[MM_MAX_SEG], j, off = s->seg_off[i], pe_ori = s->p->opt->pe_ori; int qlens[MM_MAX_SEG], j, off = s->seg_off[i], pe_ori = s->p->opt->pe_ori;
const char *qseqs[MM_MAX_SEG]; const char *qseqs[MM_MAX_SEG];
double t = 0.0;
mm_tbuf_t *b = s->buf[tid]; mm_tbuf_t *b = s->buf[tid];
assert(s->n_seg[i] <= MM_MAX_SEG); assert(s->n_seg[i] <= MM_MAX_SEG);
if (mm_dbg_flag & MM_DBG_PRINT_QNAME) { if (mm_dbg_flag & MM_DBG_PRINT_QNAME)
fprintf(stderr, "QR\t%s\t%d\t%d\n", s->seq[off].name, tid, s->seq[off].l_seq); fprintf(stderr, "QR\t%s\t%d\t%d\n", s->seq[off].name, tid, s->seq[off].l_seq);
t = realtime();
}
for (j = 0; j < s->n_seg[i]; ++j) { for (j = 0; j < s->n_seg[i]; ++j) {
if (s->n_seg[i] == 2 && ((j == 0 && (pe_ori>>1&1)) || (j == 1 && (pe_ori&1)))) if (s->n_seg[i] == 2 && ((j == 0 && (pe_ori>>1&1)) || (j == 1 && (pe_ori&1))))
mm_revcomp_bseq(&s->seq[off + j]); mm_revcomp_bseq(&s->seq[off + j]);
@@ -463,14 +466,8 @@ static void worker_for(void *_data, long i, int tid) // kt_for() callback
r->qs = qlens[j] - r->qe; r->qs = qlens[j] - r->qe;
r->qe = qlens[j] - t; r->qe = qlens[j] - t;
r->rev = !r->rev; r->rev = !r->rev;
if (r->p) {
if (r->p->trans_strand == 1) r->p->trans_strand = 2;
else if (r->p->trans_strand == 2) r->p->trans_strand = 1;
}
} }
} }
if (mm_dbg_flag & MM_DBG_PRINT_QNAME)
fprintf(stderr, "QT\t%s\t%d\t%.6f\n", s->seq[off].name, tid, realtime() - t);
} }
static void merge_hits(step_t *s) static void merge_hits(step_t *s)
@@ -515,21 +512,13 @@ static void merge_hits(step_t *s)
} }
} }
} }
if (!(opt->flag&MM_F_SR) && s->seq[k].l_seq >= opt->rank_min_len) mm_hit_sort(km, &s->n_reg[k], s->reg[k]);
mm_update_dp_max(s->seq[k].l_seq, s->n_reg[k], s->reg[k], opt->rank_frac, opt->a, opt->b); mm_set_parent(km, opt->mask_level, s->n_reg[k], s->reg[k], opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL);
for (j = 0; j < s->n_reg[k]; ++j) {
mm_reg1_t *r = &s->reg[k][j];
if (r->p) r->p->dp_max2 = 0; // reset ->dp_max2 as mm_set_parent() doesn't clear it; necessary with mm_update_dp_max()
r->subsc = 0; // this may not be necessary
r->n_sub = 0; // n_sub will be an underestimate as we don't see all the chains now, but it can't be accurate anyway
}
mm_hit_sort(km, &s->n_reg[k], s->reg[k], opt->alt_drop);
mm_set_parent(km, opt->mask_level, opt->mask_len, s->n_reg[k], s->reg[k], opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL, opt->alt_drop);
if (!(opt->flag & MM_F_ALL_CHAINS)) { if (!(opt->flag & MM_F_ALL_CHAINS)) {
mm_select_sub(km, opt->pri_ratio, s->p->mi->k*2, opt->best_n, 0, opt->max_gap * 0.8, &s->n_reg[k], s->reg[k]); mm_select_sub(km, opt->pri_ratio, s->p->mi->k*2, opt->best_n, &s->n_reg[k], s->reg[k]);
mm_set_sam_pri(s->n_reg[k], s->reg[k]); mm_set_sam_pri(s->n_reg[k], s->reg[k]);
} }
mm_set_mapq2(km, s->n_reg[k], s->reg[k], opt->min_chain_score, opt->a, rep_len, !!(opt->flag & (MM_F_SR|MM_F_SR_RNA)), !!(opt->flag & MM_F_SPLICE)); mm_set_mapq(km, s->n_reg[k], s->reg[k], opt->min_chain_score, opt->a, rep_len, !!(opt->flag & MM_F_SR));
} }
if (s->n_seg[f] == 2 && opt->pe_ori >= 0 && (opt->flag&MM_F_CIGAR)) if (s->n_seg[f] == 2 && opt->pe_ori >= 0 && (opt->flag&MM_F_CIGAR))
mm_pair(km, frag_gap_part[0], opt->pe_bonus, opt->a * 2 + opt->b, opt->a, qlens, &s->n_reg[k0], &s->reg[k0]); mm_pair(km, frag_gap_part[0], opt->pe_bonus, opt->a * 2 + opt->b, opt->a, qlens, &s->n_reg[k0], &s->reg[k0]);
@@ -598,30 +587,23 @@ static void *worker_pipeline(void *shared, int step, void *in)
mm_err_fwrite(r->p, r->p->capacity, 4, p->fp_split); mm_err_fwrite(r->p, r->p->capacity, 4, p->fp_split);
} }
} }
} else if (p->opt->flag & MM_F_OUT_JUNC) { // extra logic for --write-junc
for (j = 0; j < s->n_reg[i]; ++j) {
const mm_reg1_t *r = &s->reg[i][j];
if (r->id != r->parent || r->mapq < 10) continue;
mm_write_junc(&p->str, mi, t, r);
if (p->str.l > 0) mm_err_puts(p->str.s);
}
} else if (s->n_reg[i] > 0) { // the query has at least one hit } else if (s->n_reg[i] > 0) { // the query has at least one hit
for (j = 0; j < s->n_reg[i]; ++j) { for (j = 0; j < s->n_reg[i]; ++j) {
const mm_reg1_t *r = &s->reg[i][j]; mm_reg1_t *r = &s->reg[i][j];
assert(!r->sam_pri || r->id == r->parent); assert(!r->sam_pri || r->id == r->parent);
if ((p->opt->flag & MM_F_NO_PRINT_2ND) && r->id != r->parent) if ((p->opt->flag & MM_F_NO_PRINT_2ND) && r->id != r->parent)
continue; continue;
if (p->opt->flag & MM_F_OUT_SAM) if (p->opt->flag & MM_F_OUT_SAM)
mm_write_sam3(&p->str, mi, t, i - seg_st, j, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag, s->rep_len[i]); mm_write_sam3(&p->str, mi, t, i - seg_st, j, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag, s->rep_len[i]);
else else
mm_write_paf4(&p->str, mi, t, r, km, p->opt->flag, s->rep_len[i], s->n_seg[k], i - seg_st); mm_write_paf3(&p->str, mi, t, r, km, p->opt->flag, s->rep_len[i]);
mm_err_puts(p->str.s); mm_err_puts(p->str.s);
} }
} else if ((p->opt->flag & MM_F_PAF_NO_HIT) || ((p->opt->flag & MM_F_OUT_SAM) && !(p->opt->flag & MM_F_SAM_HIT_ONLY))) { // output an empty hit, if requested } else if ((p->opt->flag & MM_F_PAF_NO_HIT) || ((p->opt->flag & MM_F_OUT_SAM) && !(p->opt->flag & MM_F_SAM_HIT_ONLY))) { // output an empty hit, if requested
if (p->opt->flag & MM_F_OUT_SAM) if (p->opt->flag & MM_F_OUT_SAM)
mm_write_sam3(&p->str, mi, t, i - seg_st, -1, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag, s->rep_len[i]); mm_write_sam3(&p->str, mi, t, i - seg_st, -1, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag, s->rep_len[i]);
else else
mm_write_paf4(&p->str, mi, t, 0, 0, p->opt->flag, s->rep_len[i], s->n_seg[k], i - seg_st); mm_write_paf3(&p->str, mi, t, 0, 0, p->opt->flag, s->rep_len[i]);
mm_err_puts(p->str.s); mm_err_puts(p->str.s);
} }
} }
+45 -95
View File
@@ -5,49 +5,37 @@
#include <stdio.h> #include <stdio.h>
#include <sys/types.h> #include <sys/types.h>
#define MM_VERSION "2.31-r1302" #define MM_F_NO_DIAG 0x001 // no exact diagonal hit
#define MM_F_NO_DUAL 0x002 // skip pairs where query name is lexicographically larger than target name
#define MM_F_NO_DIAG (0x001LL) // no exact diagonal hit #define MM_F_CIGAR 0x004
#define MM_F_NO_DUAL (0x002LL) // skip pairs where query name is lexicographically larger than target name #define MM_F_OUT_SAM 0x008
#define MM_F_CIGAR (0x004LL) #define MM_F_NO_QUAL 0x010
#define MM_F_OUT_SAM (0x008LL) #define MM_F_OUT_CG 0x020
#define MM_F_NO_QUAL (0x010LL) #define MM_F_OUT_CS 0x040
#define MM_F_OUT_CG (0x020LL) #define MM_F_SPLICE 0x080 // splice mode
#define MM_F_OUT_CS (0x040LL) #define MM_F_SPLICE_FOR 0x100 // match GT-AG
#define MM_F_SPLICE (0x080LL) // splice mode #define MM_F_SPLICE_REV 0x200 // match CT-AC, the reverse complement of GT-AG
#define MM_F_SPLICE_FOR (0x100LL) // match GT-AG #define MM_F_NO_LJOIN 0x400
#define MM_F_SPLICE_REV (0x200LL) // match CT-AC, the reverse complement of GT-AG #define MM_F_OUT_CS_LONG 0x800
#define MM_F_NO_LJOIN (0x400LL) #define MM_F_SR 0x1000
#define MM_F_OUT_CS_LONG (0x800LL) #define MM_F_FRAG_MODE 0x2000
#define MM_F_SR (0x1000LL) #define MM_F_NO_PRINT_2ND 0x4000
#define MM_F_FRAG_MODE (0x2000LL) #define MM_F_2_IO_THREADS 0x8000
#define MM_F_NO_PRINT_2ND (0x4000LL) #define MM_F_LONG_CIGAR 0x10000
#define MM_F_2_IO_THREADS (0x8000LL) #define MM_F_INDEPEND_SEG 0x20000
#define MM_F_LONG_CIGAR (0x10000LL) #define MM_F_SPLICE_FLANK 0x40000
#define MM_F_INDEPEND_SEG (0x20000LL) #define MM_F_SOFTCLIP 0x80000
#define MM_F_SPLICE_FLANK (0x40000LL) #define MM_F_FOR_ONLY 0x100000
#define MM_F_SOFTCLIP (0x80000LL) #define MM_F_REV_ONLY 0x200000
#define MM_F_FOR_ONLY (0x100000LL) #define MM_F_HEAP_SORT 0x400000
#define MM_F_REV_ONLY (0x200000LL) #define MM_F_ALL_CHAINS 0x800000
#define MM_F_HEAP_SORT (0x400000LL) #define MM_F_OUT_MD 0x1000000
#define MM_F_ALL_CHAINS (0x800000LL) #define MM_F_COPY_COMMENT 0x2000000
#define MM_F_OUT_MD (0x1000000LL) #define MM_F_EQX 0x4000000 // use =/X instead of M
#define MM_F_COPY_COMMENT (0x2000000LL) #define MM_F_PAF_NO_HIT 0x8000000 // output unmapped reads to PAF
#define MM_F_EQX (0x4000000LL) // use =/X instead of M #define MM_F_NO_END_FLT 0x10000000
#define MM_F_PAF_NO_HIT (0x8000000LL) // output unmapped reads to PAF #define MM_F_HARD_MLEVEL 0x20000000
#define MM_F_NO_END_FLT (0x10000000LL) #define MM_F_SAM_HIT_ONLY 0x40000000
#define MM_F_HARD_MLEVEL (0x20000000LL)
#define MM_F_SAM_HIT_ONLY (0x40000000LL)
#define MM_F_RMQ (0x80000000LL)
#define MM_F_QSTRAND (0x100000000LL)
#define MM_F_NO_INV (0x200000000LL)
#define MM_F_NO_HASH_NAME (0x400000000LL)
#define MM_F_SPLICE_OLD (0x800000000LL)
#define MM_F_SECONDARY_SEQ (0x1000000000LL) //output SEQ field for seqondary alignments using hard clipping
#define MM_F_OUT_DS (0x2000000000LL)
#define MM_F_WEAK_PAIRING (0x4000000000LL)
#define MM_F_SR_RNA (0x8000000000LL)
#define MM_F_OUT_JUNC (0x10000000000LL)
#define MM_I_HPC 0x1 #define MM_I_HPC 0x1
#define MM_I_NO_SEQ 0x2 #define MM_I_NO_SEQ 0x2
@@ -57,18 +45,6 @@
#define MM_MAX_SEG 255 #define MM_MAX_SEG 255
#define MM_CIGAR_MATCH 0
#define MM_CIGAR_INS 1
#define MM_CIGAR_DEL 2
#define MM_CIGAR_N_SKIP 3
#define MM_CIGAR_SOFTCLIP 4
#define MM_CIGAR_HARDCLIP 5
#define MM_CIGAR_PADDING 6
#define MM_CIGAR_EQ_MATCH 7
#define MM_CIGAR_X_MISMATCH 8
#define MM_CIGAR_STR "MIDNSHP=XB"
#ifdef __cplusplus #ifdef __cplusplus
extern "C" { extern "C" {
#endif #endif
@@ -82,20 +58,16 @@ typedef struct {
char *name; // name of the db sequence char *name; // name of the db sequence
uint64_t offset; // offset in mm_idx_t::S uint64_t offset; // offset in mm_idx_t::S
uint32_t len; // length uint32_t len; // length
uint32_t is_alt;
} mm_idx_seq_t; } mm_idx_seq_t;
typedef struct { typedef struct {
int32_t b, w, k, flag; int32_t b, w, k, flag;
uint32_t n_seq; // number of reference sequences uint32_t n_seq; // number of reference sequences
int32_t index; int32_t index;
int32_t n_alt;
mm_idx_seq_t *seq; // sequence name, length and offset mm_idx_seq_t *seq; // sequence name, length and offset
uint32_t *S; // 4-bit packed sequence uint32_t *S; // 4-bit packed sequence
struct mm_idx_bucket_s *B; // index (hidden) struct mm_idx_bucket_s *B; // index (hidden)
struct mm_idx_intv_s *I; // intervals (hidden) struct mm_idx_intv_s *I; // intervals (hidden)
struct mm_idx_spsc_s *spsc;// splice score (hidden)
struct mm_idx_jjump_s *J; // junctions to create jumps (hidden)
void *km, *h; void *km, *h;
} mm_idx_t; } mm_idx_t;
@@ -103,7 +75,6 @@ typedef struct {
typedef struct { typedef struct {
uint32_t capacity; // the capacity of cigar[] uint32_t capacity; // the capacity of cigar[]
int32_t dp_score, dp_max, dp_max2; // DP score; score of the max-scoring segment; score of the best alternate mappings int32_t dp_score, dp_max, dp_max2; // DP score; score of the max-scoring segment; score of the best alternate mappings
int32_t dp_max0; // DP score before mm_update_dp_max() adjustment
uint32_t n_ambi:30, trans_strand:2; // number of ambiguous bases; transcript strand: 0 for unknown, 1 for +, 2 for - uint32_t n_ambi:30, trans_strand:2; // number of ambiguous bases; transcript strand: 0 for unknown, 1 for +, 2 for -
uint32_t n_cigar; // number of cigar operations in cigar[] uint32_t n_cigar; // number of cigar operations in cigar[]
uint32_t cigar[]; uint32_t cigar[];
@@ -120,7 +91,7 @@ typedef struct {
int32_t mlen, blen; // seeded exact match length; seeded alignment block length int32_t mlen, blen; // seeded exact match length; seeded alignment block length
int32_t n_sub; // number of suboptimal mappings int32_t n_sub; // number of suboptimal mappings
int32_t score0; // initial chaining score (before chain merging/spliting) int32_t score0; // initial chaining score (before chain merging/spliting)
uint32_t mapq:8, split:2, rev:1, inv:1, sam_pri:1, proper_frag:1, pe_thru:1, seg_split:1, seg_id:8, split_inv:1, is_alt:1, strand_retained:1, is_spliced:1, dummy:4; uint32_t mapq:8, split:2, rev:1, inv:1, sam_pri:1, proper_frag:1, pe_thru:1, seg_split:1, seg_id:8, split_inv:1, dummy:7;
uint32_t hash; uint32_t hash;
float div; float div;
mm_extra_t *p; mm_extra_t *p;
@@ -129,7 +100,8 @@ typedef struct {
// indexing and mapping options // indexing and mapping options
typedef struct { typedef struct {
short k, w, flag, bucket_bits; short k, w, flag, bucket_bits;
int64_t mini_batch_size; int mini_batch_size;
int min_occ, max_occ;
uint64_t batch_size; uint64_t batch_size;
} mm_idxopt_t; } mm_idxopt_t;
@@ -140,31 +112,28 @@ typedef struct {
int max_qlen; // max query length int max_qlen; // max query length
int bw, bw_long; // bandwidth int bw; // bandwidth
int max_gap, max_gap_ref; // break a chain if there are no minimizers in a max_gap window int max_gap, max_gap_ref; // break a chain if there are no minimizers in a max_gap window
int max_frag_len; int max_frag_len;
int max_chain_skip, max_chain_iter; int max_chain_skip, max_chain_iter;
int min_cnt; // min number of minimizers on each chain int min_cnt; // min number of minimizers on each chain
int min_chain_score; // min chaining score int min_chain_score; // min chaining score
float chain_gap_scale;
float chain_skip_scale; float flt_max_dv;
int rmq_size_cap, rmq_inner_dist; int flt_min_blen;
int rmq_rescue_size;
float rmq_rescue_ratio;
float mask_level; float mask_level;
int mask_len;
float pri_ratio; float pri_ratio;
int best_n; // top best_n chains are subjected to DP alignment int best_n; // top best_n chains are subjected to DP alignment
float alt_drop; int max_join_long, max_join_short;
int min_join_flank_sc;
float min_join_flank_ratio;
int a, b, q, e, q2, e2; // matching score, mismatch, gap-open and gap-ext penalties int a, b, q, e, q2, e2; // matching score, mismatch, gap-open and gap-ext penalties
int transition; // transition mismatch score (A:G, C:T)
int sc_ambi; // score when one or both bases are "N" int sc_ambi; // score when one or both bases are "N"
int noncan; // cost of non-canonical splicing sites int noncan; // cost of non-canonical splicing sites
int junc_bonus; // bonus for a splice site in annotation int junc_bonus;
int junc_pen; // penalty for GT- or -AG not scored in --spsc
int zdrop, zdrop_inv; // break alignment if alignment score drops too fast along the diagonal int zdrop, zdrop_inv; // break alignment if alignment score drops too fast along the diagonal
int end_bonus; int end_bonus;
int min_dp_max; // drop an alignment if the score of the max scoring segment is below this threshold int min_dp_max; // drop an alignment if the score of the max scoring segment is below this threshold
@@ -172,21 +141,14 @@ typedef struct {
int anchor_ext_len, anchor_ext_shift; int anchor_ext_len, anchor_ext_shift;
float max_clip_ratio; // drop an alignment if BOTH ends are clipped above this ratio float max_clip_ratio; // drop an alignment if BOTH ends are clipped above this ratio
int rank_min_len;
float rank_frac;
int pe_ori, pe_bonus; int pe_ori, pe_bonus;
int32_t jump_min_match;
float mid_occ_frac; // only used by mm_mapopt_update(); see below float mid_occ_frac; // only used by mm_mapopt_update(); see below
float q_occ_frac; int32_t min_mid_occ;
int32_t min_mid_occ, max_mid_occ;
int32_t mid_occ; // ignore seeds with occurrences above this threshold int32_t mid_occ; // ignore seeds with occurrences above this threshold
int32_t max_occ, max_max_occ, occ_dist; int32_t max_occ;
int64_t mini_batch_size; // size of a batch of query bases to process in parallel int mini_batch_size; // size of a batch of query bases to process in parallel
int64_t max_sw_mat; int64_t max_sw_mat;
int64_t cap_kalloc;
const char *split_prefix; const char *split_prefix;
} mm_mapopt_t; } mm_mapopt_t;
@@ -204,11 +166,6 @@ typedef struct {
} mm_idx_reader_t; } mm_idx_reader_t;
// memory buffer for thread-local storage during mapping // memory buffer for thread-local storage during mapping
struct mm_tbuf_s {
void *km;
int rep_len, frag_gap;
};
typedef struct mm_tbuf_s mm_tbuf_t; typedef struct mm_tbuf_s mm_tbuf_t;
// global variables // global variables
@@ -408,7 +365,6 @@ int mm_map_file_frag(const mm_idx_t *idx, int n_segs, const char **fn, const mm_
* @return the length of cs * @return the length of cs
*/ */
int mm_gen_cs(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int no_iden); int mm_gen_cs(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int no_iden);
int mm_gen_ds(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int no_iden);
int mm_gen_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq); int mm_gen_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq);
// query sequence name and sequence in the minimap2 index // query sequence name and sequence in the minimap2 index
@@ -416,15 +372,9 @@ int mm_idx_index_name(mm_idx_t *mi);
int mm_idx_name2id(const mm_idx_t *mi, const char *name); int mm_idx_name2id(const mm_idx_t *mi, const char *name);
int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq); int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq);
int mm_idx_alt_read(mm_idx_t *mi, const char *fn);
int mm_idx_bed_read(mm_idx_t *mi, const char *fn, int read_junc); int mm_idx_bed_read(mm_idx_t *mi, const char *fn, int read_junc);
int mm_idx_bed_junc(const mm_idx_t *mi, int32_t ctg, int32_t st, int32_t en, uint8_t *s); int mm_idx_bed_junc(const mm_idx_t *mi, int32_t ctg, int32_t st, int32_t en, uint8_t *s);
int mm_max_spsc_bonus(const mm_mapopt_t *mo);
int32_t mm_idx_spsc_read(mm_idx_t *idx, const char *fn, int32_t max_sc);
int32_t mm_idx_spsc_read2(mm_idx_t *idx, const char *fn, int32_t max_sc, float scale);
int64_t mm_idx_spsc_get(const mm_idx_t *db, int32_t cid, int64_t st0, int64_t en0, int32_t rev, uint8_t *sc);
// deprecated APIs for backward compatibility // deprecated APIs for backward compatibility
void mm_mapopt_init(mm_mapopt_t *opt); void mm_mapopt_init(mm_mapopt_t *opt);
mm_idx_t *mm_idx_build(const char *fn, int w, int k, int flag, int n_threads); mm_idx_t *mm_idx_build(const char *fn, int w, int k, int flag, int n_threads);
+92 -252
View File
@@ -1,4 +1,4 @@
.TH minimap2 1 "19 May 2026" "minimap2-2.31 (r1302)" "Bioinformatics tools" .TH minimap2 1 "4 May 2019" "minimap2-2.17 (r941)" "Bioinformatics tools"
.SH NAME .SH NAME
.PP .PP
minimap2 - mapping and alignment between collections of DNA sequences minimap2 - mapping and alignment between collections of DNA sequences
@@ -77,7 +77,7 @@ SAM format.
Minimizer k-mer length [15] Minimizer k-mer length [15]
.TP .TP
.BI -w \ INT .BI -w \ INT
Minimizer window size [10]. A minimizer is the smallest k-mer Minimizer window size [2/3 of k-mer length]. A minimizer is the smallest k-mer
in a window of w consecutive k-mers. in a window of w consecutive k-mers.
.TP .TP
.B -H .B -H
@@ -88,17 +88,16 @@ on the HPC sequence.
.BI -I \ NUM .BI -I \ NUM
Load at most Load at most
.I NUM .I NUM
target bases into RAM for indexing [8G]. If there are more than target bases into RAM for indexing [4G]. If there are more than
.I NUM .I NUM
bases in bases in
.IR target.fa , .IR target.fa ,
minimap2 needs to read minimap2 needs to read
.I query.fa .I query.fa
multiple times to map it against each batch of target sequences. This would create a multi-part index. multiple times to map it against each batch of target sequences.
.I NUM .I NUM
may be ending with k/K/m/M/g/G. NB: mapping quality is incorrect given a may be ending with k/K/m/M/g/G. NB: mapping quality is incorrect given a
multi-part index. See also option multi-part index.
.BR --split-prefix .
.TP .TP
.B --idx-no-seq .B --idx-no-seq
Don't store target sequences in the index. It saves disk space and memory but Don't store target sequences in the index. It saves disk space and memory but
@@ -122,14 +121,6 @@ provided as the target sequences, options
.BR -w , .BR -w ,
.B -I .B -I
will be effectively overridden by the options stored in the index file. will be effectively overridden by the options stored in the index file.
.TP
.BI --alt \ FILE
List of ALT contigs [null]
.TP
.BI --alt-drop \ FLOAT
Drop ALT hits by
.I FLOAT
fraction when ranking and computing mapping quality [0.15]
.SS Mapping options .SS Mapping options
.TP 10 .TP 10
.BI -f \ FLOAT | INT1 [, INT2 ] .BI -f \ FLOAT | INT1 [, INT2 ]
@@ -146,38 +137,22 @@ or
.B -xsr .B -xsr
mode, which sets the threshold for a second round of seeding. mode, which sets the threshold for a second round of seeding.
.TP .TP
.BI -U \ INT1 [, INT2 ] .BI --min-occ-floor \ INT
Lower and upper bounds of k-mer occurrences [10,1000000]. The final k-mer occurrence threshold is Force minimap2 to always use k-mers occurring
.RI max{ INT1 ,\ min{ INT2 ,
.BR -f }}.
This option prevents excessively small or large
.B -f
estimated from the input reference. Available since r1034 and deprecating
.B --min-occ-floor
in earlier versions of minimap2.
.TP
.BI --q-occ-frac \ FLOAT
Discard a query minimizer if its occurrence is higher than
.I FLOAT
fraction of query minimizers and than the reference occurrence threshold
[0.01]. Set 0 to disable. Available since r1105.
.TP
.BI -e \ INT
Sample a high-frequency minimizer every
.I INT .I INT
basepairs [500]. times or less [0]. In effect, the max occurrence threshold is set to
the
.RI max{ INT ,
.BR -f }.
.TP .TP
.BI -g \ NUM .BI -g \ INT
Stop chain enlongation if there are no minimizers within Stop chain enlongation if there are no minimizers within
.IR NUM -bp .IR INT -bp
[10k]. [10000].
.TP .TP
.BI -r \ NUM1 [, NUM2 ] .BI -r \ INT
Bandwidth for chaining and base alignment [500,20k]. Bandwidth used in chaining and DP-based alignment [500]. This option
.I NUM1 approximately controls the maximum gap size.
is used for initial chaining and alignment extension;
.I NUM2
for RMQ-based re-chaining and closing gaps in alignments.
.TP .TP
.BI -n \ INT .BI -n \ INT
Discard chains consisting of Discard chains consisting of
@@ -251,26 +226,10 @@ Mark as secondary a chain that overlaps with a better chain by
.I FLOAT .I FLOAT
or more of the shorter chain [0.5] or more of the shorter chain [0.5]
.TP .TP
.BR --rmq = no | yes
Use the minigraph chaining algorithm [no]. The minigraph algorithm is better
for aligning contigs through long INDELs.
.TP
.BI --rmq-inner \ NUM
Apply full dynamic programming for anchors within distance
.I NUM
[1000].
.TP
.B --hard-mask-level .B --hard-mask-level
Honor option Honor option
.B -M .B -M
and disable a heurstic to save unmapped subsequences and disables and disable a heurstic to save unmapped subsequences.
.BR --mask-len .
.TP
.BI --mask-len \ NUM
Keep an alignment if dropping it leaves an unaligned region on query longer than
.IR INT
[inf]. Effective without
.BR --hard-mask-level .
.TP .TP
.BI --max-chain-skip \ INT .BI --max-chain-skip \ INT
A heuristics that stops chaining early [25]. Minimap2 uses dynamic programming A heuristics that stops chaining early [25]. Minimap2 uses dynamic programming
@@ -286,24 +245,23 @@ Check up to
partial chains during chaining [5000]. This is a heuristic to avoid quadratic partial chains during chaining [5000]. This is a heuristic to avoid quadratic
time complexity in the worst case. time complexity in the worst case.
.TP .TP
.BI --chain-gap-scale \ FLOAT
Scale of gap cost during chaining [1.0]
.TP
.B --no-long-join .B --no-long-join
Disable the long gap patching heuristic. When this option is applied, the Disable the long gap patching heuristic. When this option is applied, the
maximum alignment gap is mostly controlled by maximum alignment gap is mostly controlled by
.BR -r . .BR -r .
.TP .TP
.BI --lj-min-ratio \ FLOAT
Fraction of query sequence length required to bridge a long gap [0.5]. A
smaller value helps to recover longer gaps, at the cost of more false gaps.
.TP
.B --splice .B --splice
Enable the splice alignment mode. Enable the splice alignment mode.
.TP .TP
.BR --sr [= no | dna | rna ] .B --sr
Enable short-read alignment heuristics [no]. If this option is used with no argument, Enable short-read alignment heuristics. In the short-read mode, minimap2
.RB ` dna ' applies a second round of chaining with a higher minimizer occurrence threshold
is set. In the DNA short-read mode, minimap2 applies a second round of chaining if no good chain is found. In addition, minimap2 attempts to patch gaps between
with a higher minimizer occurrence threshold if no good chain is found. In seeds with ungapped alignment.
addition, minimap2 attempts to patch gaps between seeds with ungapped
alignment.
.TP .TP
.BI --split-prefix \ STR .BI --split-prefix \ STR
Prefix to create temporary files. Typically used for a multi-part index. Prefix to create temporary files. Typically used for a multi-part index.
@@ -323,8 +281,9 @@ Only map to the reverse complement strand of the reference sequences.
If yes, sort anchors with heap merge, instead of radix sort. Heap merge is If yes, sort anchors with heap merge, instead of radix sort. Heap merge is
faster for short reads, but slower for long reads. [no] faster for short reads, but slower for long reads. [no]
.TP .TP
.B --no-hash-name .B --no-pairing
Produce the same alignment for identical sequences regardless of their sequence names. Treat two reads in a pair as independent reads. The mate related fields in SAM
are still properly populated.
.SS Alignment options .SS Alignment options
.TP 10 .TP 10
.BI -A \ INT .BI -A \ INT
@@ -333,10 +292,6 @@ Matching score [2]
.BI -B \ INT .BI -B \ INT
Mismatching penalty [4] Mismatching penalty [4]
.TP .TP
.BI -b \ INT
Mismatching penalty for transitions [same as
.BR -B ].
.TP
.BI -O \ INT1[,INT2] .BI -O \ INT1[,INT2]
Gap open penalty [4,24]. If Gap open penalty [4,24]. If
.I INT2 .I INT2
@@ -350,28 +305,10 @@ costs
.RI min{ O1 + k * E1 , O2 + k * E2 }. .RI min{ O1 + k * E1 , O2 + k * E2 }.
In the splice mode, the second gap penalties are not used. In the splice mode, the second gap penalties are not used.
.TP .TP
.BI -J \ INT
Splice model [1]. 0 for the original minimap2 splice model that always penalizes non-GT-AG splicing;
1 for the miniprot model that considers non-GT-AG. Option
.B -C
has no effect with the default
.BR -J1 .
.TP
.BR -j \ FILE
Junctions used to extend alignment towards ends of reads [].
.I FILE
can be gene annotations in the BED12 format (aka 12-column BED), or intron
positions in 5-column BED with the strand column required. BED12 file can be
converted from GTF/GFF3 with `paftools.js gff2bed anno.gtf'. This option is
intended for short RNA-seq reads, while
.B --junc-bed
for long noisy RNA-seq reads.
.TP
.BI -C \ INT .BI -C \ INT
Cost for a non-canonical GT-AG splicing (effective with Cost for a non-canonical GT-AG splicing (effective with
.B --splice .BR --splice )
.BR -J0 ) [0]
[0].
.TP .TP
.BI -z \ INT1[,INT2] .BI -z \ INT1[,INT2]
Truncate an alignment if the running alignment score drops too quickly along Truncate an alignment if the running alignment score drops too quickly along
@@ -408,16 +345,7 @@ no attempt to match GT-AG [n]
Score bonus when alignment extends to the end of the query sequence [0]. Score bonus when alignment extends to the end of the query sequence [0].
.TP .TP
.BI --score-N \ INT .BI --score-N \ INT
Penalty of a mismatch involving ambiguous bases [1]. Score of a mismatch involving ambiguous bases [1].
.TP
.BR --pairing = strong | weak | no
How to pair paired-end reads [strong].
.RB ` no '
for aligning the two ends in a pair independently with no `properly paired' set.
.RB ` weak '
for aligning the two ends independently and then pairing the hits.
.RB ` strong '
for jointly aligning and pairing the two ends.
.TP .TP
.BR --splice-flank = yes | no .BR --splice-flank = yes | no
Assume the next base to a Assume the next base to a
@@ -436,49 +364,16 @@ on SIRV data, please add
.B --splice-flank=no .B --splice-flank=no
to the command line. to the command line.
.TP .TP
.BR --spsc \ FILE
Splice scores []. Each line consists of five fields: 1) contig, 2) offset, 3) `+' or `-', 4) `D' or `A', and 5) score,
where offset is the number of bases before a splice junction, `D' indicates the
line corresponds to a donor site and `A' for an acceptor site.
A positive score suggests the junction is preferred and a negative score
suggests the junction is not preferred.
.TP
.BR --spsc0 \ INT
Penalty for positions not in
.I FILE
specified by
.B --spsc
[5]. Effective with
.B --spsc
but not
.BR --junc-bed .
.TP
.BR --spsc-scale \ FLOAT
Scale splice scores in
.B --spsc
by
.IR FLOAT
rounded to the nearest integer [0.7].
.TP
.BR --junc-bed \ FILE .BR --junc-bed \ FILE
Junctions to prefer during base alignment []. Gene annotations in the BED12 format (aka 12-column BED), or intron positions
Same format as in 5-column BED. With this option, minimap2 prefers splicing in annotations.
.BR -j . BED12 file can be converted from GTF/GFF3 with `paftools.js gff2bed anno.gtf'
It is [].
.I NOT
recommended to apply this option to short RNA-seq reads. This would increase
run time with little improvement to junction accuracy.
.TP .TP
.BR --junc-bonus \ INT .BR --junc-bonus \ INT
Score bonus for a splice donor or acceptor found in annotation [9]. Effective with Score bonus for a splice donor or acceptor found in annotation (effective with
.B --junc-bed .BR --junc-bed )
but not [0].
.BR --spsc .
.TP
.BR --jump-min-match \ INT
Minimum matching length to create a jump [3]. Equivalent to
.B STAR
.BR --alignSJDBoverhangMin .
.TP .TP
.BI --end-seed-pen \ INT .BI --end-seed-pen \ INT
Drop a terminal anchor if Drop a terminal anchor if
@@ -499,12 +394,7 @@ alignment.
.BI --cap-sw-mem \ NUM .BI --cap-sw-mem \ NUM
Skip alignment if the DP matrix size is above Skip alignment if the DP matrix size is above
.IR NUM . .IR NUM .
Set 0 to disable [100m]. Set 0 to disable [0].
.TP
.BI --cap-kalloc \ NUM
Free thread-local kalloc memory reservoir if after the alignment the size of the reservoir above
.IR NUM .
Set 0 to disable [500m].
.SS Input/output options .SS Input/output options
.TP 10 .TP 10
.B -a .B -a
@@ -536,13 +426,20 @@ Copy input FASTA/Q comments to output.
.B -c .B -c
Generate CIGAR. In PAF, the CIGAR is written to the `cg' custom tag. Generate CIGAR. In PAF, the CIGAR is written to the `cg' custom tag.
.TP .TP
.BR --cs [= short | long ] .BI --cs[= STR ]
Output the Output the
.B cs .B cs
tag. tag.
If no argument is given, .I STR
.RB ` short ' can be either
is set. [none] .I short
or
.IR long .
If no
.I STR
is given,
.I short
is assumed. [none]
.TP .TP
.B --MD .B --MD
Output the MD tag (see the SAM spec). Output the MD tag (see the SAM spec).
@@ -553,29 +450,6 @@ Output =/X CIGAR operators for sequence match/mismatch.
.B -Y .B -Y
In SAM output, use soft clipping for supplementary alignments. In SAM output, use soft clipping for supplementary alignments.
.TP .TP
.B --secondary-seq
In SAM output, show query sequences for secondary alignments.
.TP
.B --write-junc
Output splice junctions in 6-column BED: contig name, start, end,
read name, score and strand. Score is the sum of donor and acceptor scores,
where GT gets 3, GC gets 2 and AT gets 1 at donor sites,
while AG gets 3 and AC gets 1 at acceptor sites.
Alignments with mapping quality below 10 are ignored.
.TP
.BI --pass1 \ FILE
Junctions BED file outputted by
.B --write-junc
[]. Rows with scores lower than 5 are ignored. When both
.B -j
and
.B --pass1
are present, junctions in
.B -j
are preferred over in
.BR --pass1
when there is ambiguity.
.TP
.BI --seed \ INT .BI --seed \ INT
Integer seed for randomizing equally best hits. Minimap2 hashes Integer seed for randomizing equally best hits. Minimap2 hashes
.I INT .I INT
@@ -631,75 +505,60 @@ Available
.I STR .I STR
are: are:
.RS .RS
.TP 10 .TP 8
.B map-ont
Align noisy long reads of ~10% error rate to a reference genome. This is the
default mode.
.TP
.B lr:hq
Align accurate long reads (error rate <1%) to a reference genome
.RB ( -k19
.B -w19 -U50,500
.BR -g10k ).
This was recommended by ONT developers for recent Nanopore reads
produced with chemistry v14 that can reach ~99% in accuracy.
It was shown to work better for accurate Nanopore reads
than
.BR map-hifi .
.TP
.B map-hifi
Align PacBio high-fidelity (HiFi) reads to a reference genome
.RB ( -xlr:hq
.B -A1 -B4 -O6,26 -E2,1
.BR -s200 ).
It differs from
.B lr:hq
only in scoring. It has not been tested whether
.B lr:hq
would work better for PacBio HiFi reads.
.TP
.B map-pb .B map-pb
Align older PacBio continuous long (CLR) reads to a reference genome PacBio/Oxford Nanopore read to reference mapping
.RB ( -Hk19 ). .RB ( -Hk19 )
Note that this data type is effectively deprecated by HiFi.
Unless you work on very old data, you probably want to use
.B map-hifi
or
.BR lr:hq .
.TP .TP
.B map-iclr .B map-ont
Align Illumina Complete Long Reads (ICLR) to a reference genome Slightly more sensitive for Oxford Nanopore to reference mapping
.RB ( -k19 .RB ( -k15 ).
.B -B6 -b4 For PacBio reads, HPC minimizers consistently leads to faster performance and
.BR -O10,50 ). more sensitive results in comparison to normal minimizers. For Oxford Nanopore
This was recommended by Illumina developers. data, normal minimizers are better, though not much. The effectiveness of HPC
is determined by the sequencing error mode.
.TP .TP
.B asm5 .B asm5
Long assembly to reference mapping Long assembly to reference mapping
.RB ( -k19 .RB ( -k19
.B -w19 -U50,500 --rmq -r1k,100k -g10k -A1 -B19 -O39,81 -E3,1 -s200 -z200 .B -w19 -A1 -B19 -O39,81 -E3,1 -s200 -z200 -N50
.BR -N50 ). .BR --min-occ-floor=100 ).
Typically, the alignment will not extend to regions with 5% or higher sequence Typically, the alignment will not extend to regions with 5% or higher sequence
divergence. Use this preset if the average divergence is not much higher than 0.1%. divergence. Only use this preset if the average divergence is far below 5%.
.TP .TP
.B asm10 .B asm10
Long assembly to reference mapping Long assembly to reference mapping
.RB ( -k19 .RB ( -k19
.B -w19 -U50,500 --rmq -r1k,100k -g10k -A1 -B9 -O16,41 -E2,1 -s200 -z200 .B -w19 -A1 -B9 -O16,41 -E2,1 -s200 -z200 -N50
.BR -N50 ). .BR --min-occ-floor=100 ).
Use this if the average divergence is around 1%. Up to 10% sequence divergence.
.TP .TP
.B asm20 .B asm20
Long assembly to reference mapping Long assembly to reference mapping
.RB ( -k19 .RB ( -k19
.B -w10 -U50,500 --rmq -r1k,100k -g10k -A1 -B4 -O6,26 -E2,1 -s200 -z200 .B -w10 -A1 -B4 -O6,26 -E2,1 -s200 -z200 -N50
.BR -N50 ). .BR --min-occ-floor=100 ).
Use this if the average divergence is around several percent. Up to 20% sequence divergence.
.TP
.B ava-pb
PacBio all-vs-all overlap mapping
.RB ( -Hk19
.B -Xw5 -m100 -g10000 --max-chain-skip
.BR 25 ).
.TP
.B ava-ont
Oxford Nanopore all-vs-all overlap mapping
.RB ( -k15
.B -Xw5 -m100 -g10000 -r2000 --max-chain-skip
.BR 25 ).
Similarly, the major difference from
.B ava-pb
is that this preset is not using HPC minimizers.
.TP .TP
.B splice .B splice
Long-read spliced alignment Long-read spliced alignment
.RB ( -k15 .RB ( -k15
.B -w5 --splice -g2k -G200k -A1 -B2 -O2,32 -E1,0 -C9 -z200 -ub --junc-bonus=9 --cap-sw-mem=0 .B -w5 --splice -g2000 -G200k -A1 -B2 -O2,32 -E1,0 -C9 -z200 -ub --junc-bonus=9
.BR --splice-flank=yes ). .BR --splice-flank=yes ).
In the splice mode, 1) long deletions are taken as introns and represented as In the splice mode, 1) long deletions are taken as introns and represented as
the the
@@ -710,35 +569,17 @@ costs are different during chaining; 4) the computation of the
tag ignores introns to demote hits to pseudogenes. tag ignores introns to demote hits to pseudogenes.
.TP .TP
.B splice:hq .B splice:hq
Spliced alignment for accurate long RNA-seq reads such as PacBio iso-seq Long-read splice alignment for PacBio CCS reads
.RB ( -xsplice .RB ( -xsplice
.B -C5 -O6,24 .B -C5 -O6,24
.BR -B4 ). .BR -B4 ).
.TP .TP
.B splice:sr
Spliced alignment for short RNA-seq reads
.RB ( -xsplice:hq
.B --frag=yes -m25 -s40 -2K100m --heap-sort=yes --pairing=weak --sr=rna --min-dp-len=20
.BR --secondary=no ).
.TP
.B sr .B sr
Short-read alignment without splicing Short single-end reads without splicing
.RB ( -k21 .RB ( -k21
.B -w11 --sr --frag=yes -A2 -B8 -O12,32 -E2,1 -r100 -p.5 -N20 -f1000,5000 -n2 -m25 .B -w11 --sr --frag=yes -A2 -B8 -O12,32 -E2,1 -r50 -p.5 -N20 -f1000,5000 -n2 -m20
.B -s40 -g100 -2K50m --heap-sort=yes .B -s40 -g200 -2K50m --heap-sort=yes
.BR --secondary=no ). .BR --secondary=no ).
.TP
.B ava-pb
PacBio CLR all-vs-all overlap mapping
.RB ( -Hk19
.B -Xw5 -e0
.BR -m100 ).
.TP
.B ava-ont
Oxford Nanopore all-vs-all overlap mapping
.RB ( -k15
.B -Xw5 -e0 -m100
.BR -r2k ).
.RE .RE
.SS Miscellaneous options .SS Miscellaneous options
.TP 10 .TP 10
@@ -797,7 +638,7 @@ s2 i Chaining score of the best secondary chain
NM i Total number of mismatches and gaps in the alignment NM i Total number of mismatches and gaps in the alignment
MD Z To generate the ref sequence in the alignment MD Z To generate the ref sequence in the alignment
AS i DP alignment score AS i DP alignment score
SA Z List of other supplementary alignments (with approximate CIGAR strings) SA Z List of other supplementary alignments
ms i DP score of the max scoring segment in the alignment ms i DP score of the max scoring segment in the alignment
nn i Number of ambiguous bases in the alignment nn i Number of ambiguous bases in the alignment
ts A Transcript strand (splice mode only) ts A Transcript strand (splice mode only)
@@ -806,7 +647,6 @@ cs Z Difference string
dv f Approximate per-base sequence divergence dv f Approximate per-base sequence divergence
de f Gap-compressed per-base sequence divergence de f Gap-compressed per-base sequence divergence
rl i Length of query regions harboring repetitive seeds rl i Length of query regions harboring repetitive seeds
zd i Alignment broken due to Z-drop; bit 1: left broken; bit 2: right broken
.TE .TE
.PP .PP
-1
View File
@@ -159,4 +159,3 @@ KRADIX_SORT_INIT(128x, mm128_t, sort_key_128x, 8)
KRADIX_SORT_INIT(64, uint64_t, sort_key_64, 8) KRADIX_SORT_INIT(64, uint64_t, sort_key_64, 8)
KSORT_INIT_GENERIC(uint32_t) KSORT_INIT_GENERIC(uint32_t)
KSORT_INIT_GENERIC(uint64_t)
+1 -2
View File
@@ -16,8 +16,7 @@ minimap2 -c test/MT-human.fa test/MT-orang.fa \
| paftools.js liftover -l10000 - <(echo -e "MT_orang\t2000\t5000") # liftOver | paftools.js liftover -l10000 - <(echo -e "MT_orang\t2000\t5000") # liftOver
# no test data for the following examples # no test data for the following examples
paftools.js junceval -e anno.gtf splice.sam > out.txt # compare splice junctions to annotations paftools.js junceval -e anno.gtf splice.sam > out.txt # compare splice junctions to annotations
paftools.js splice2bed splice.sam > splice.bed # convert PAF/SAM to BED12 paftools.js splice2bed anno.gtf > anno.bed # convert GTF/GFF3 to BED12
paftools.js gff2bed anno.gtf > anno.bed # convert GTF/GFF3 to BED12
``` ```
## Table of Contents ## Table of Contents
-241
View File
@@ -1,241 +0,0 @@
#!/usr/bin/env k8
"use strict";
Array.prototype.delete_at = function(i) {
for (let j = i; j < this.length - 1; ++j)
this[j] = this[j + 1];
--this.length;
}
function* getopt(argv, ostr, longopts) {
if (argv.length == 0) return;
let pos = 0, cur = 0;
while (cur < argv.length) {
let lopt = "", opt = "?", arg = "";
while (cur < argv.length) { // skip non-option arguments
if (argv[cur][0] == "-" && argv[cur].length > 1) {
if (argv[cur] == "--") cur = argv.length;
break;
} else ++cur;
}
if (cur == argv.length) break;
let a = argv[cur];
if (a[0] == "-" && a[1] == "-") { // a long option
pos = -1;
let c = 0, k = -1, tmp = "", o;
const pos_eq = a.indexOf("=");
if (pos_eq > 0) {
o = a.substring(2, pos_eq);
arg = a.substring(pos_eq + 1);
} else o = a.substring(2);
for (let i = 0; i < longopts.length; ++i) {
let y = longopts[i];
if (y[y.length - 1] == "=") y = y.substring(0, y.length - 1);
if (o.length <= y.length && o == y.substring(0, o.length)) {
k = i, tmp = y;
++c; // c is the number of matches
if (o == y) { // exact match
c = 1;
break;
}
}
}
if (c == 1) { // find a unique match
lopt = tmp;
if (pos_eq < 0 && longopts[k][longopts[k].length-1] == "=" && cur + 1 < argv.length) {
arg = argv[cur+1];
argv.delete_at(cur + 1);
}
}
} else { // a short option
if (pos == 0) pos = 1;
opt = a[pos++];
let k = ostr.indexOf(opt);
if (k < 0) {
opt = "?";
} else if (k + 1 < ostr.length && ostr[k+1] == ":") { // requiring an argument
if (pos >= a.length) {
arg = argv[cur+1];
argv.delete_at(cur + 1);
} else arg = a.substring(pos);
pos = -1;
}
}
if (pos < 0 || pos >= argv[cur].length) {
argv.delete_at(cur);
pos = 0;
}
if (lopt != "") yield { opt: `--${lopt}`, arg: arg };
else if (opt != "?") yield { opt: `-${opt}`, arg: arg };
else yield { opt: "?", arg: "" };
}
}
function* k8_readline(fn) {
let buf = new Bytes();
let file = new File(fn);
while (file.readline(buf) >= 0) {
yield buf.toString();
}
file.close();
buf.destroy();
}
function merge_hits(b) {
if (b.length == 1)
return { name1:b[0].name1, name2:b[0].name2, len1:b[0].len1, len2:b[0].len2, min_cov:b[0].min_cov, max_cov:b[0].max_cov, cov1:b[0].cov1, cov2:b[0].cov2, s1:b[0].s1, dv:b[0].dv };
b.sort(function(x, y) { return x.st1 - y.st1 });
let f = [], bt = [];
for (let i = 0; i < b.length; ++i)
f[i] = b[i].s1, bt[i] = -1;
for (let i = 0; i < b.length; ++i) {
for (let j = 0; j < i; ++j) {
if (b[j].st2 < b[i].st2) {
if (b[j].en1 >= b[i].en1) continue;
if (b[j].en2 >= b[i].en2) continue;
const ov1 = b[j].en1 <= b[i].st1? 0 : b[i].st1 - b[j].en1;
const li1 = b[i].en1 - b[i].st1;
const s11 = b[i].s1 / li1 * (li1 - ov1);
const ov2 = b[j].en2 <= b[i].st2? 0 : b[i].st2 - b[j].en2;
const li2 = b[i].en2 - b[i].st2;
const s12 = b[i].s1 / li2 * (li2 - ov2);
const s1 = s11 < s12? s11 : s12;
if (f[i] < f[j] + s1)
f[i] = f[j] + s1, bt[i] = j;
}
}
}
let max_i = -1, max_f = 0, d = [];
for (let i = 0; i < b.length; ++i)
if (max_f < f[i])
max_f = f[i], max_i = i;
for (let k = max_i; k >= 0; k = bt[k])
d.push(k);
d = d.reverse();
let dv = 0, tot = 0, cov1 = 0, cov2 = 0, st1 = 0, en1 = 0, st2 = 0, en2 = 0;
for (let k = 0; k < d.length; ++k) {
const i = d[k];
tot += b[i].blen;
dv += b[i].dv * b[i].blen;
if (b[i].st1 > en1) {
cov1 += en1 - st1;
st1 = b[i].st1, en1 = b[i].en1;
} else en1 = en1 > b[i].en1? en1 : b[i].en1;
if (b[i].st2 > en2) {
cov2 += en2 - st2;
st2 = b[i].st2, en2 = b[i].en2;
} else en2 = en2 > b[i].en2? en2 : b[i].en2;
}
dv /= tot;
cov1 = (cov1 + (en1 - st1)) / b[0].len1;
cov2 = (cov2 + (en2 - st2)) / b[0].len2;
const min_cov = cov1 < cov2? cov1 : cov2;
const max_cov = cov1 > cov2? cov1 : cov2;
//warn(d.length, b[0].name1, b[0].name2, min_cov, max_cov);
return { name1:b[0].name1, name2:b[0].name2, len1:b[0].len1, len2:b[0].len2, min_cov:min_cov, max_cov:max_cov, cov1:cov1, cov2:cov2, s1:max_f, dv:dv };
}
function main(args) {
let opt = { min_cov:.9, max_dv:.015, max_diff:20000 };
for (const o of getopt(args, "c:d:e:", [])) {
if (o.opt == '-c') opt.min_cov = parseFloat(o.arg);
else if (o.opt == '-d') opt.max_dv = parseFloat(o.arg);
else if (o.opt == '-e') opt.max_diff = parseFloat(o.arg);
}
if (args.length == 0) {
print("Usage: pafcluster.js [options] <ava.paf>");
print("Options:");
print(` -c FLOAT min coverage [${opt.min_cov}]`);
print(` -d FLOAT max divergence [${opt.max_dv}]`);
print(` -e FLOAT max difference [${opt.max_diff}]`);
return;
}
// read
let a = [], len = {}, name2len = {};
for (const line of k8_readline(args[0])) {
let m, t = line.split("\t");
if (t[4] != "+") continue;
for (let i = 1; i < 4; ++i) t[i] = parseInt(t[i]);
for (let i = 6; i < 11; ++i) t[i] = parseInt(t[i]);
const len1 = t[1], len2 = t[6];
let s1 = -1, dv = -1.0;
for (let i = 12; i < t.length; ++i) {
if ((m = /^(s1|dv):\S:(\S+)/.exec(t[i])) != null) {
if (m[1] == "s1") s1 = parseInt(m[2]);
else if (m[1] == "dv") dv = parseFloat(m[2]);
}
}
if (s1 < 0 || dv < 0) continue;
const cov1 = (parseInt(t[3]) - parseInt(t[2])) / len1;
const cov2 = (parseInt(t[8]) - parseInt(t[7])) / len2;
const min_cov = cov1 < cov2? cov1 : cov2;
const max_cov = cov1 > cov2? cov1 : cov2;
name2len[t[0]] = len1;
name2len[t[5]] = len2;
a.push({ name1:t[0], name2:t[5], len1:len1, len2:len2, min_cov:min_cov, max_cov:max_cov, s1:s1, dv:dv, cov1:cov1, cov2:cov2, st1:t[2], en1:t[3], st2:t[7], en2:t[8], blen:t[10] });
len[t[0]] = len1, len[t[5]] = len2;
}
warn(`Read ${a.length} hits`);
// merge duplicated hits
let h = {};
for (let i = 0; i < a.length; ++i) {
const key = `${a[i].name1}\t${a[i].name2}`;
if (h[key] == null) h[key] = [];
h[key].push(a[i]);
}
a = [];
for (const key in h)
a.push(merge_hits(h[key]));
// core loop
while (a.length > 1) {
// select the sequence with the highest sum of s1
let h = {};
for (let i = 0; i < a.length; ++i) {
if (h[a[i].name1] == null) h[a[i].name1] = 0;
h[a[i].name1] += a[i].s1;
}
let max_s1 = 0, max_name = "";
for (const name in h)
if (max_s1 < h[name])
max_s1 = h[name], max_name = name;
// find contigs in the same group
h = {};
h[max_name] = 1;
for (let i = 0; i < a.length; ++i) {
if (a[i].name1 != max_name && a[i].name2 != max_name)
continue;
const diff1 = a[i].len1 * (1.0 - a[i].cov1);
const diff2 = a[i].len2 * (1.0 - a[i].cov2);
if (a[i].min_cov >= opt.min_cov && a[i].dv <= opt.max_dv && diff1 <= opt.max_diff && diff2 <= opt.max_diff)
h[a[i].name1] = h[a[i].name2] = 1;
}
let n = 0;
for (const key in h) {
++n;
delete name2len[key];
}
print(`SD\t${max_name}\t${n}`);
for (const key in h) print(`CL\t${key}\t${len[key]}`);
print("//");
// filter out redundant hits
let b = [];
for (let i = 0; i < a.length; ++i)
if (h[a[i].name1] == null && h[a[i].name2] == null)
b.push(a[i]);
warn(`Reduced the number of hits from ${a.length} to ${b.length}`);
a = b;
}
// output remaining singletons
for (const key in name2len) {
print(`SD\t${key}\t1`);
print(`CL\t${key}\t${name2len[key]}`);
print(`//`);
}
}
main(arguments);
+90 -1384
View File
File diff suppressed because it is too large Load Diff
+21 -67
View File
@@ -4,7 +4,6 @@
#include <assert.h> #include <assert.h>
#include "minimap.h" #include "minimap.h"
#include "bseq.h" #include "bseq.h"
#include "kseq.h"
#define MM_PARENT_UNSET (-1) #define MM_PARENT_UNSET (-1)
#define MM_PARENT_TMP_PRI (-2) #define MM_PARENT_TMP_PRI (-2)
@@ -13,8 +12,6 @@
#define MM_DBG_PRINT_QNAME 0x2 #define MM_DBG_PRINT_QNAME 0x2
#define MM_DBG_PRINT_SEED 0x4 #define MM_DBG_PRINT_SEED 0x4
#define MM_DBG_PRINT_ALN_SEQ 0x8 #define MM_DBG_PRINT_ALN_SEQ 0x8
#define MM_DBG_PRINT_CHAIN 0x10
#define MM_DBG_SEED_FREQ 0x20
#define MM_SEED_LONG_JOIN (1ULL<<40) #define MM_SEED_LONG_JOIN (1ULL<<40)
#define MM_SEED_IGNORE (1ULL<<41) #define MM_SEED_IGNORE (1ULL<<41)
@@ -24,9 +21,6 @@
#define MM_SEED_SEG_SHIFT 48 #define MM_SEED_SEG_SHIFT 48
#define MM_SEED_SEG_MASK (0xffULL<<(MM_SEED_SEG_SHIFT)) #define MM_SEED_SEG_MASK (0xffULL<<(MM_SEED_SEG_SHIFT))
#define MM_JUNC_ANNO 0x1
#define MM_JUNC_MISC 0x2
#ifndef kroundup32 #ifndef kroundup32
#define kroundup32(x) (--(x), (x)|=(x)>>1, (x)|=(x)>>2, (x)|=(x)>>4, (x)|=(x)>>8, (x)|=(x)>>16, ++(x)) #define kroundup32(x) (--(x), (x)|=(x)>>1, (x)|=(x)>>2, (x)|=(x)>>4, (x)|=(x)>>8, (x)|=(x)>>16, ++(x))
#endif #endif
@@ -36,19 +30,18 @@
#define MALLOC(type, len) ((type*)malloc((len) * sizeof(type))) #define MALLOC(type, len) ((type*)malloc((len) * sizeof(type)))
#define CALLOC(type, len) ((type*)calloc((len), sizeof(type))) #define CALLOC(type, len) ((type*)calloc((len), sizeof(type)))
#define REALLOC(type, ptr, cnt) ((type*)realloc((ptr), (cnt) * sizeof(type)))
#ifdef __cplusplus #ifdef __cplusplus
extern "C" { extern "C" {
#endif #endif
typedef struct { #ifndef KSTRING_T
uint32_t n; #define KSTRING_T kstring_t
uint32_t q_pos; typedef struct __kstring_t {
uint32_t q_span:31, flt:1; unsigned l, m;
uint32_t seg_id:31, is_tandem:1; char *s;
const uint64_t *cr; } kstring_t;
} mm_seed_t; #endif
typedef struct { typedef struct {
int n_u, n_a; int n_u, n_a;
@@ -56,12 +49,6 @@ typedef struct {
mm128_t *a; mm128_t *a;
} mm_seg_t; } mm_seg_t;
typedef struct {
int32_t off, off2, cnt;
int16_t strand;
uint16_t flag;
} mm_idx_jjump1_t;
double cputime(void); double cputime(void);
double realtime(void); double realtime(void);
long peakrss(void); long peakrss(void);
@@ -72,52 +59,31 @@ uint32_t ks_ksmall_uint32_t(size_t n, uint32_t arr[], size_t kk);
void mm_sketch(void *km, const char *str, int len, int w, int k, uint32_t rid, int is_hpc, mm128_v *p); void mm_sketch(void *km, const char *str, int len, int w, int k, uint32_t rid, int is_hpc, mm128_v *p);
mm_seed_t *mm_collect_matches(void *km, int *_n_m, int qlen, int max_occ, int max_max_occ, int dist, const mm_idx_t *mi, const mm128_v *mv, int64_t *n_a, int *rep_len, int *n_mini_pos, uint64_t **mini_pos); void mm_write_sam_hdr(const mm_idx_t *mi, const char *rg, const char *ver, int argc, char *argv[]);
void mm_seed_mz_flt(void *km, mm128_v *mv, int32_t q_occ_max, float q_occ_frac); void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int opt_flag);
void mm_write_paf3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int opt_flag, int rep_len);
double mm_event_identity(const mm_reg1_t *r);
int mm_write_sam_hdr(const mm_idx_t *mi, const char *rg, const char *ver, int argc, char *argv[]);
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag);
void mm_write_paf3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag, int rep_len);
void mm_write_paf4(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag, int rep_len, int n_seg, int seg_idx);
void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int n_regs, const mm_reg1_t *regs); void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int n_regs, const mm_reg1_t *regs);
void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regs, const mm_reg1_t *const* regs, void *km, int64_t opt_flag); void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regs, const mm_reg1_t *const* regs, void *km, int opt_flag);
void mm_write_sam3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regss, const mm_reg1_t *const* regss, void *km, int64_t opt_flag, int rep_len); void mm_write_sam3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regss, const mm_reg1_t *const* regss, void *km, int opt_flag, int rep_len);
void mm_write_junc(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r);
// indexing related in index.c
void mm_idxopt_init(mm_idxopt_t *opt); void mm_idxopt_init(mm_idxopt_t *opt);
const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n); const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n);
int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f); int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f);
int mm_idx_getseq2(const mm_idx_t *mi, int is_rev, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq); mm128_t *mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int max_iter, int min_cnt, int min_sc, int is_cdna, int n_segs, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km);
mm_reg1_t *mm_gen_regs(void *km, uint32_t hash, int qlen, int n_u, uint64_t *u, mm128_t *a, int is_qstrand); mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a);
int mm_idx_bed_read(mm_idx_t *mi, const char *fn, int read_junc);
int mm_idx_jjump_read(mm_idx_t *mi, const char *fn, int flag, int min_sc);
const mm_idx_jjump1_t *mm_idx_jump_get(const mm_idx_t *db, int32_t cid, int32_t st, int32_t en, int32_t *n);
// chaining in lchain.c mm_reg1_t *mm_gen_regs(void *km, uint32_t hash, int qlen, int n_u, uint64_t *u, mm128_t *a);
mm128_t *mg_lchain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int max_iter, int min_cnt, int min_sc, float chn_pen_gap, float chn_pen_skip, void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a);
int is_cdna, int n_segs, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km);
mm128_t *mg_lchain_rmq(int max_dist, int max_dist_inner, int bw, int max_chn_skip, int cap_rmq_size, int min_cnt, int min_sc, float chn_pen_gap, float chn_pen_skip,
int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km);
void mm_mark_alt(const mm_idx_t *mi, int n, mm_reg1_t *r);
void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a, int is_qstrand);
void mm_sync_regs(void *km, int n_regs, mm_reg1_t *regs); void mm_sync_regs(void *km, int n_regs, mm_reg1_t *regs);
int mm_squeeze_a(void *km, int n_regs, mm_reg1_t *regs, mm128_t *a); int mm_squeeze_a(void *km, int n_regs, mm_reg1_t *regs, mm128_t *a);
int mm_set_sam_pri(int n, mm_reg1_t *r); int mm_set_sam_pri(int n, mm_reg1_t *r);
void mm_set_parent(void *km, float mask_level, int mask_len, int n, mm_reg1_t *r, int sub_diff, int hard_mask_level, float alt_diff_frac); void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r, int sub_diff, int hard_mask_level);
void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int check_strand, int min_strand_sc, int *n_, mm_reg1_t *r); void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int *n_, mm_reg1_t *r);
void mm_select_sub_multi(void *km, float pri_ratio, float pri1, float pri2, int max_gap_ref, int min_diff, int best_n, int n_segs, const int *qlens, int *n_, mm_reg1_t *r); void mm_select_sub_multi(void *km, float pri_ratio, float pri1, float pri2, int max_gap_ref, int min_diff, int best_n, int n_segs, const int *qlens, int *n_, mm_reg1_t *r);
int mm_filter_strand_retained(int n_regs, mm_reg1_t *r);
void mm_filter_regs(const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs); void mm_filter_regs(const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs);
void mm_hit_sort(void *km, int *n_regs, mm_reg1_t *r, float alt_diff_frac); void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs, mm128_t *a);
void mm_set_mapq2(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr, int is_splice); void mm_hit_sort(void *km, int *n_regs, mm_reg1_t *r);
void mm_update_dp_max(int qlen, int n_regs, mm_reg1_t *regs, float frac, int a, int b); void mm_set_mapq(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr);
void mm_jump_split(void *km, const mm_idx_t *mi, const mm_mapopt_t *opt, int32_t qlen, const uint8_t *qseq, mm_reg1_t *r, int32_t ts_strand);
mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a);
void mm_enlarge_cigar(mm_reg1_t *r, uint32_t n_cigar);
void mm_est_err(const mm_idx_t *mi, int qlen, int n_regs, mm_reg1_t *regs, const mm128_t *a, int32_t n, const uint64_t *mini_pos); void mm_est_err(const mm_idx_t *mi, int qlen, int n_regs, mm_reg1_t *regs, const mm128_t *a, int32_t n, const uint64_t *mini_pos);
@@ -125,8 +91,6 @@ mm_seg_t *mm_seg_gen(void *km, uint32_t hash, int n_segs, const int *qlens, int
void mm_seg_free(void *km, int n_segs, mm_seg_t *segs); void mm_seg_free(void *km, int n_segs, mm_seg_t *segs);
void mm_pair(void *km, int max_gap_ref, int dp_bonus, int sub_diff, int match_sc, const int *qlens, int *n_regs, mm_reg1_t **regs); void mm_pair(void *km, int max_gap_ref, int dp_bonus, int sub_diff, int match_sc, const int *qlens, int *n_regs, mm_reg1_t **regs);
void mm_jump_split(void *km, const mm_idx_t *mi, const mm_mapopt_t *opt, int32_t qlen, const uint8_t *qseq, mm_reg1_t *r, int32_t ts_strand);
FILE *mm_split_init(const char *prefix, const mm_idx_t *mi); FILE *mm_split_init(const char *prefix, const mm_idx_t *mi);
mm_idx_t *mm_split_merge_prep(const char *prefix, int n_splits, FILE **fp, uint32_t *n_seq_part); mm_idx_t *mm_split_merge_prep(const char *prefix, int n_splits, FILE **fp, uint32_t *n_seq_part);
int mm_split_merge(int n_segs, const char **fn, const mm_mapopt_t *opt, int n_split_idx); int mm_split_merge(int n_segs, const char **fn, const mm_mapopt_t *opt, int n_split_idx);
@@ -136,16 +100,6 @@ void mm_err_puts(const char *str);
void mm_err_fwrite(const void *p, size_t size, size_t nitems, FILE *fp); void mm_err_fwrite(const void *p, size_t size, size_t nitems, FILE *fp);
void mm_err_fread(void *p, size_t size, size_t nitems, FILE *fp); void mm_err_fread(void *p, size_t size, size_t nitems, FILE *fp);
static inline float mg_log2(float x) // NB: this doesn't work when x<2
{
union { float f; uint32_t i; } z = { x };
float log_2 = ((z.i >> 23) & 255) - 128;
z.i &= ~(255 << 23);
z.i += 127 << 23;
log_2 += (-0.34484843f * z.f + 2.02466578f) * z.f - 0.67487759f;
return log_2;
}
#ifdef __cplusplus #ifdef __cplusplus
} }
#endif #endif
+40 -120
View File
@@ -8,7 +8,8 @@ void mm_idxopt_init(mm_idxopt_t *opt)
opt->k = 15, opt->w = 10, opt->flag = 0; opt->k = 15, opt->w = 10, opt->flag = 0;
opt->bucket_bits = 14; opt->bucket_bits = 14;
opt->mini_batch_size = 50000000; opt->mini_batch_size = 50000000;
opt->batch_size = 8000000000ULL; opt->batch_size = 4000000000ULL;
opt->min_occ = 0, opt->max_occ = INT_MAX;
} }
void mm_mapopt_init(mm_mapopt_t *opt) void mm_mapopt_init(mm_mapopt_t *opt)
@@ -16,36 +17,29 @@ void mm_mapopt_init(mm_mapopt_t *opt)
memset(opt, 0, sizeof(mm_mapopt_t)); memset(opt, 0, sizeof(mm_mapopt_t));
opt->seed = 11; opt->seed = 11;
opt->mid_occ_frac = 2e-4f; opt->mid_occ_frac = 2e-4f;
opt->min_mid_occ = 10;
opt->max_mid_occ = 1000000;
opt->sdust_thres = 0; // no SDUST masking opt->sdust_thres = 0; // no SDUST masking
opt->q_occ_frac = 0.01f;
opt->min_cnt = 3; opt->min_cnt = 3;
opt->min_chain_score = 40; opt->min_chain_score = 40;
opt->bw = 500, opt->bw_long = 20000; opt->bw = 500;
opt->max_gap = 5000; opt->max_gap = 5000;
opt->max_gap_ref = -1; opt->max_gap_ref = -1;
opt->max_chain_skip = 25; opt->max_chain_skip = 25;
opt->max_chain_iter = 5000; opt->max_chain_iter = 5000;
opt->rmq_inner_dist = 1000;
opt->rmq_size_cap = 100000; opt->flt_max_dv = 1.0f;
opt->rmq_rescue_size = 1000; opt->flt_min_blen = 0;
opt->rmq_rescue_ratio = 0.1f;
opt->chain_gap_scale = 0.8f;
opt->chain_skip_scale = 0.0f;
opt->max_max_occ = 4095;
opt->occ_dist = 500;
opt->mask_level = 0.5f; opt->mask_level = 0.5f;
opt->mask_len = INT_MAX;
opt->pri_ratio = 0.8f; opt->pri_ratio = 0.8f;
opt->best_n = 5; opt->best_n = 5;
opt->alt_drop = 0.15f; opt->max_join_long = 20000;
opt->max_join_short = 2000;
opt->min_join_flank_sc = 1000;
opt->min_join_flank_ratio = 0.5f;
opt->a = 2, opt->b = 4, opt->q = 4, opt->e = 2, opt->q2 = 24, opt->e2 = 1; opt->a = 2, opt->b = 4, opt->q = 4, opt->e = 2, opt->q2 = 24, opt->e2 = 1;
opt->transition = 0;
opt->sc_ambi = 1; opt->sc_ambi = 1;
opt->zdrop = 400, opt->zdrop_inv = 200; opt->zdrop = 400, opt->zdrop_inv = 200;
opt->end_bonus = -1; opt->end_bonus = -1;
@@ -54,30 +48,19 @@ void mm_mapopt_init(mm_mapopt_t *opt)
opt->anchor_ext_len = 20, opt->anchor_ext_shift = 6; opt->anchor_ext_len = 20, opt->anchor_ext_shift = 6;
opt->max_clip_ratio = 1.0f; opt->max_clip_ratio = 1.0f;
opt->mini_batch_size = 500000000; opt->mini_batch_size = 500000000;
opt->max_sw_mat = 100000000;
opt->cap_kalloc = 500000000;
opt->rank_min_len = 500;
opt->rank_frac = 0.9f;
opt->pe_ori = 0; // FF opt->pe_ori = 0; // FF
opt->pe_bonus = 33; opt->pe_bonus = 33;
opt->jump_min_match = 3;
} }
void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi) void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
{ {
if ((opt->flag & MM_F_SPLICE_FOR) || (opt->flag & MM_F_SPLICE_REV)) if ((opt->flag & MM_F_SPLICE_FOR) || (opt->flag & MM_F_SPLICE_REV))
opt->flag |= MM_F_SPLICE; opt->flag |= MM_F_SPLICE;
if (opt->mid_occ <= 0) { if (opt->mid_occ <= 0)
opt->mid_occ = mm_idx_cal_max_occ(mi, opt->mid_occ_frac); opt->mid_occ = mm_idx_cal_max_occ(mi, opt->mid_occ_frac);
if (opt->mid_occ < opt->min_mid_occ) if (opt->mid_occ < opt->min_mid_occ)
opt->mid_occ = opt->min_mid_occ; opt->mid_occ = opt->min_mid_occ;
if (opt->max_mid_occ > opt->min_mid_occ && opt->mid_occ > opt->max_mid_occ)
opt->mid_occ = opt->max_mid_occ;
}
if (opt->bw_long < opt->bw) opt->bw_long = opt->bw;
if (mm_verbose >= 3) if (mm_verbose >= 3)
fprintf(stderr, "[M::%s::%.3f*%.2f] mid_occ = %d\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), opt->mid_occ); fprintf(stderr, "[M::%s::%.3f*%.2f] mid_occ = %d\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), opt->mid_occ);
} }
@@ -85,7 +68,7 @@ void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
void mm_mapopt_max_intron_len(mm_mapopt_t *opt, int max_intron_len) void mm_mapopt_max_intron_len(mm_mapopt_t *opt, int max_intron_len)
{ {
if ((opt->flag & MM_F_SPLICE) && max_intron_len > 0) if ((opt->flag & MM_F_SPLICE) && max_intron_len > 0)
opt->max_gap_ref = opt->bw = opt->bw_long = max_intron_len; opt->max_gap_ref = opt->bw = max_intron_len;
} }
int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo) int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
@@ -93,61 +76,37 @@ int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
if (preset == 0) { if (preset == 0) {
mm_idxopt_init(io); mm_idxopt_init(io);
mm_mapopt_init(mo); mm_mapopt_init(mo);
} else if (strcmp(preset, "lr") == 0 || strcmp(preset, "map-ont") == 0) { // this is the same as the default
} else if (strcmp(preset, "ava-ont") == 0) { } else if (strcmp(preset, "ava-ont") == 0) {
io->flag = 0, io->k = 15, io->w = 5; io->flag = 0, io->k = 15, io->w = 5;
mo->flag |= MM_F_ALL_CHAINS | MM_F_NO_DIAG | MM_F_NO_DUAL | MM_F_NO_LJOIN; mo->flag |= MM_F_ALL_CHAINS | MM_F_NO_DIAG | MM_F_NO_DUAL | MM_F_NO_LJOIN;
mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_chain_skip = 25; mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_gap = 10000, mo->max_chain_skip = 25;
mo->bw = mo->bw_long = 2000; mo->bw = 2000;
mo->occ_dist = 0;
} else if (strcmp(preset, "map10k") == 0 || strcmp(preset, "map-pb") == 0) {
io->flag |= MM_I_HPC, io->k = 19;
} else if (strcmp(preset, "ava-pb") == 0) { } else if (strcmp(preset, "ava-pb") == 0) {
io->flag |= MM_I_HPC, io->k = 19, io->w = 5; io->flag |= MM_I_HPC, io->k = 19, io->w = 5;
mo->flag |= MM_F_ALL_CHAINS | MM_F_NO_DIAG | MM_F_NO_DUAL | MM_F_NO_LJOIN; mo->flag |= MM_F_ALL_CHAINS | MM_F_NO_DIAG | MM_F_NO_DUAL | MM_F_NO_LJOIN;
mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_chain_skip = 25; mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_gap = 10000, mo->max_chain_skip = 25;
mo->bw_long = mo->bw; } else if (strcmp(preset, "map10k") == 0 || strcmp(preset, "map-pb") == 0) {
mo->occ_dist = 0; io->flag |= MM_I_HPC, io->k = 19;
} else if (strcmp(preset, "lr:hq") == 0 || strcmp(preset, "map-hifi") == 0 || strcmp(preset, "map-ccs") == 0) { } else if (strcmp(preset, "map-ont") == 0) {
io->flag = 0, io->k = 19, io->w = 19;
mo->max_gap = 10000;
mo->min_mid_occ = 50, mo->max_mid_occ = 500;
if (strcmp(preset, "map-hifi") == 0 || strcmp(preset, "map-ccs") == 0) {
mo->a = 1, mo->b = 4, mo->q = 6, mo->q2 = 26, mo->e = 2, mo->e2 = 1;
mo->min_dp_max = 200;
}
} else if (strcmp(preset, "lr:hqae") == 0) { // high-quality assembly evaluation
io->flag = 0, io->k = 25, io->w = 51;
mo->flag |= MM_F_RMQ;
mo->min_mid_occ = 50, mo->max_mid_occ = 500;
mo->rmq_inner_dist = 5000;
mo->occ_dist = 200;
mo->best_n = 100;
mo->chain_gap_scale = 5.0f;
} else if (strcmp(preset, "map-iclr-prerender") == 0) {
io->flag = 0, io->k = 15; io->flag = 0, io->k = 15;
mo->b = 6, mo->transition = 1; } else if (strcmp(preset, "asm5") == 0) {
mo->q = 10, mo->q2 = 50;
} else if (strcmp(preset, "map-iclr") == 0) {
io->flag = 0, io->k = 19;
mo->b = 6, mo->transition = 4;
mo->q = 10, mo->q2 = 50;
} else if (strncmp(preset, "asm", 3) == 0) {
io->flag = 0, io->k = 19, io->w = 19; io->flag = 0, io->k = 19, io->w = 19;
mo->bw = 1000, mo->bw_long = 100000; mo->a = 1, mo->b = 19, mo->q = 39, mo->q2 = 81, mo->e = 3, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
mo->max_gap = 10000; mo->min_mid_occ = 100;
mo->flag |= MM_F_RMQ; mo->min_dp_max = 200;
mo->min_mid_occ = 50, mo->max_mid_occ = 500; mo->best_n = 50;
} else if (strcmp(preset, "asm10") == 0) {
io->flag = 0, io->k = 19, io->w = 19;
mo->a = 1, mo->b = 9, mo->q = 16, mo->q2 = 41, mo->e = 2, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
mo->min_mid_occ = 100;
mo->min_dp_max = 200;
mo->best_n = 50;
} else if (strcmp(preset, "asm20") == 0) {
io->flag = 0, io->k = 19, io->w = 10;
mo->a = 1, mo->b = 4, mo->q = 6, mo->q2 = 26, mo->e = 2, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
mo->min_mid_occ = 100;
mo->min_dp_max = 200; mo->min_dp_max = 200;
mo->best_n = 50; mo->best_n = 50;
if (strcmp(preset, "asm5") == 0) {
mo->a = 1, mo->b = 19, mo->q = 39, mo->q2 = 81, mo->e = 3, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
} else if (strcmp(preset, "asm10") == 0) {
mo->a = 1, mo->b = 9, mo->q = 16, mo->q2 = 41, mo->e = 2, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
} else if (strcmp(preset, "asm20") == 0) {
mo->a = 1, mo->b = 4, mo->q = 6, mo->q2 = 26, mo->e = 2, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
io->w = 10;
} else return -1;
} else if (strcmp(preset, "short") == 0 || strcmp(preset, "sr") == 0) { } else if (strcmp(preset, "short") == 0 || strcmp(preset, "sr") == 0) {
io->flag = 0, io->k = 21, io->w = 11; io->flag = 0, io->k = 21, io->w = 11;
mo->flag |= MM_F_SR | MM_F_FRAG_MODE | MM_F_NO_PRINT_2ND | MM_F_2_IO_THREADS | MM_F_HEAP_SORT; mo->flag |= MM_F_SR | MM_F_FRAG_MODE | MM_F_NO_PRINT_2ND | MM_F_2_IO_THREADS | MM_F_HEAP_SORT;
@@ -157,7 +116,7 @@ int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
mo->end_bonus = 10; mo->end_bonus = 10;
mo->max_frag_len = 800; mo->max_frag_len = 800;
mo->max_gap = 100; mo->max_gap = 100;
mo->bw = mo->bw_long = 100; mo->bw = 100;
mo->pri_ratio = 0.5f; mo->pri_ratio = 0.5f;
mo->min_cnt = 2; mo->min_cnt = 2;
mo->min_chain_score = 25; mo->min_chain_score = 25;
@@ -166,51 +125,22 @@ int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
mo->mid_occ = 1000; mo->mid_occ = 1000;
mo->max_occ = 5000; mo->max_occ = 5000;
mo->mini_batch_size = 50000000; mo->mini_batch_size = 50000000;
} else if (strcmp(preset, "splice") == 0 || strcmp(preset, "splice:hq") == 0 || strcmp(preset, "splice:sr") == 0 || strcmp(preset, "cdna") == 0) { } else if (strncmp(preset, "splice", 6) == 0 || strcmp(preset, "cdna") == 0) {
io->flag = 0, io->k = 15, io->w = 5; io->flag = 0, io->k = 15, io->w = 5;
mo->flag |= MM_F_SPLICE | MM_F_SPLICE_FOR | MM_F_SPLICE_REV | MM_F_SPLICE_FLANK; mo->flag |= MM_F_SPLICE | MM_F_SPLICE_FOR | MM_F_SPLICE_REV | MM_F_SPLICE_FLANK;
mo->max_sw_mat = 0; mo->max_gap = 2000, mo->max_gap_ref = mo->bw = 200000;
mo->max_gap = 2000, mo->max_gap_ref = mo->bw = mo->bw_long = 200000;
mo->a = 1, mo->b = 2, mo->q = 2, mo->e = 1, mo->q2 = 32, mo->e2 = 0; mo->a = 1, mo->b = 2, mo->q = 2, mo->e = 1, mo->q2 = 32, mo->e2 = 0;
mo->noncan = 9; mo->noncan = 9;
mo->junc_bonus = 9; mo->junc_bonus = 9;
mo->junc_pen = 5;
mo->zdrop = 200, mo->zdrop_inv = 100; // because mo->a is halved mo->zdrop = 200, mo->zdrop_inv = 100; // because mo->a is halved
if (strcmp(preset, "splice:hq") == 0) { if (strcmp(preset, "splice:hq") == 0)
mo->noncan = 5, mo->b = 4, mo->q = 6, mo->q2 = 24; mo->junc_bonus = 5, mo->b = 4, mo->q = 6, mo->q2 = 24;
} else if (strcmp(preset, "splice:sr") == 0) {
mo->flag |= MM_F_NO_PRINT_2ND | MM_F_2_IO_THREADS | MM_F_HEAP_SORT | MM_F_FRAG_MODE | MM_F_WEAK_PAIRING | MM_F_SR_RNA;
mo->noncan = 5, mo->b = 4, mo->q = 6, mo->q2 = 24;
mo->min_chain_score = 25;
mo->min_dp_max = 40;
mo->min_ksw_len = 20;
mo->pe_ori = 0<<1|1; // FR
mo->best_n = 10;
mo->mini_batch_size = 100000000;
}
} else return -1; } else return -1;
return 0; return 0;
} }
int mm_max_spsc_bonus(const mm_mapopt_t *mo)
{
int max_sc = (mo->q2 + 1) / 2 - 1;
max_sc = max_sc > mo->q2 - mo->q? max_sc : mo->q2 - mo->q;
return max_sc;
}
int mm_check_opt(const mm_idxopt_t *io, const mm_mapopt_t *mo) int mm_check_opt(const mm_idxopt_t *io, const mm_mapopt_t *mo)
{ {
if (mo->bw > mo->bw_long) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m with '-rNUM1,NUM2', NUM1 (%d) can't be larger than NUM2 (%d)\033[0m\n", mo->bw, mo->bw_long);
return -8;
}
if ((mo->flag & MM_F_RMQ) && (mo->flag & (MM_F_SR|MM_F_SPLICE))) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m --rmq doesn't work with --sr or --splice\033[0m\n");
return -7;
}
if (mo->split_prefix && (mo->flag & (MM_F_OUT_CS|MM_F_OUT_MD))) { if (mo->split_prefix && (mo->flag & (MM_F_OUT_CS|MM_F_OUT_MD))) {
if (mm_verbose >= 1) if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m --cs or --MD doesn't work with --split-prefix\033[0m\n"); fprintf(stderr, "[ERROR]\033[1;31m --cs or --MD doesn't work with --split-prefix\033[0m\n");
@@ -253,11 +183,6 @@ int mm_check_opt(const mm_idxopt_t *io, const mm_mapopt_t *mo)
fprintf(stderr, "[ERROR]\033[1;31m scoring system violating ({-O}+{-E})+({-O2}+{-E2}) <= 127\033[0m\n"); fprintf(stderr, "[ERROR]\033[1;31m scoring system violating ({-O}+{-E})+({-O2}+{-E2}) <= 127\033[0m\n");
return -1; return -1;
} }
if (mo->sc_ambi < 0 || mo->sc_ambi >= mo->b) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m --score-N should be within [0,{-B})\033[0m\n");
return -1;
}
if (mo->zdrop < mo->zdrop_inv) { if (mo->zdrop < mo->zdrop_inv) {
if (mm_verbose >= 1) if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m Z-drop should not be less than inversion-Z-drop\033[0m\n"); fprintf(stderr, "[ERROR]\033[1;31m Z-drop should not be less than inversion-Z-drop\033[0m\n");
@@ -268,10 +193,5 @@ int mm_check_opt(const mm_idxopt_t *io, const mm_mapopt_t *mo)
fprintf(stderr, "[ERROR]\033[1;31m -X/-P and --secondary=no can't be applied at the same time\033[0m\n"); fprintf(stderr, "[ERROR]\033[1;31m -X/-P and --secondary=no can't be applied at the same time\033[0m\n");
return -5; return -5;
} }
if ((mo->flag & MM_F_QSTRAND) && ((mo->flag & (MM_F_OUT_SAM|MM_F_SPLICE|MM_F_FRAG_MODE)) || (io->flag & MM_I_HPC))) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m --qstrand doesn't work with -a, -H, --frag or --splice\033[0m\n");
return -5;
}
return 0; return 0;
} }
+2 -7
View File
@@ -8,8 +8,7 @@ void mm_select_sub_multi(void *km, float pri_ratio, float pri1, float pri2, int
if (pri_ratio > 0.0f && *n_ > 0) { if (pri_ratio > 0.0f && *n_ > 0) {
int i, k, n = *n_, n_2nd = 0; int i, k, n = *n_, n_2nd = 0;
int max_dist = n_segs == 2? qlens[0] + qlens[1] + max_gap_ref : 0; int max_dist = n_segs == 2? qlens[0] + qlens[1] + max_gap_ref : 0;
uint8_t *keep = (uint8_t*)kmalloc(km, n); for (i = k = 0; i < n; ++i) {
for (i = 0; i < n; ++i) {
int to_keep = 0; int to_keep = 0;
if (r[i].parent == i) { // primary if (r[i].parent == i) { // primary
to_keep = 1; to_keep = 1;
@@ -35,13 +34,9 @@ void mm_select_sub_multi(void *km, float pri_ratio, float pri1, float pri2, int
if (to_keep && r[i].parent != i) { if (to_keep && r[i].parent != i) {
if (n_2nd++ >= best_n) to_keep = 0; // don't keep if there are too many secondary hits if (n_2nd++ >= best_n) to_keep = 0; // don't keep if there are too many secondary hits
} }
keep[i] = to_keep; if (to_keep) r[k++] = r[i];
}
for (i = k = 0; i < n; ++i) {
if (keep[i]) r[k++] = r[i];
else if (r[i].p) free(r[i].p); else if (r[i].p) free(r[i].p);
} }
kfree(km, keep);
if (k != n) mm_sync_regs(km, k, r); // removing hits requires sync() if (k != n) mm_sync_regs(km, k, r); // removing hits requires sync()
*n_ = k; *n_ = k;
} }
-2
View File
@@ -1,2 +0,0 @@
[build-system]
requires = ["setuptools", "wheel", "Cython"]
+2 -4
View File
@@ -77,9 +77,7 @@ This constructor accepts the following arguments:
* **min_chain_score**: minimum chaing score * **min_chain_score**: minimum chaing score
* **bw**: chaining and alignment band width (initial chaining and extension) * **bw**: chaining and alignment band width
* **bw_long**: chaining and alignment band width (RMQ-based rechaining and closing gaps)
* **best_n**: max number of alignments to return * **best_n**: max number of alignments to return
@@ -146,7 +144,7 @@ properties:
* **mlen**: length of the matching bases in the alignment, excluding ambiguous * **mlen**: length of the matching bases in the alignment, excluding ambiguous
base matches. base matches.
* **NM**: number of mismatches, gaps and ambiguous positions in the alignment * **NM**: number of mismatches, gaps and ambiguous poistions in the alignment
* **trans_strand**: transcript strand. +1 if on the forward strand; -1 if on the * **trans_strand**: transcript strand. +1 if on the forward strand; -1 if on the
reverse strand; 0 if unknown reverse strand; 0 if unknown
+3 -3
View File
@@ -71,13 +71,13 @@ static inline void mm_reset_timer(void)
} }
extern unsigned char seq_comp_table[256]; extern unsigned char seq_comp_table[256];
static inline mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char* seqname, const char *seq1, const char *seq2, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt) static inline mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char *seq1, const char *seq2, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt)
{ {
mm_reg1_t *r; mm_reg1_t *r;
Py_BEGIN_ALLOW_THREADS Py_BEGIN_ALLOW_THREADS
if (seq2 == 0) { if (seq2 == 0) {
r = mm_map(mi, strlen(seq1), seq1, n_regs, b, opt, seqname); r = mm_map(mi, strlen(seq1), seq1, n_regs, b, opt, NULL);
} else { } else {
int _n_regs[2]; int _n_regs[2];
mm_reg1_t *regs[2]; mm_reg1_t *regs[2];
@@ -94,7 +94,7 @@ static inline mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char* seqname, con
seq[1][i] = seq_comp_table[t]; seq[1][i] = seq_comp_table[t];
} }
if (len[1]&1) seq[1][len[1]>>1] = seq_comp_table[(uint8_t)seq[1][len[1]>>1]]; if (len[1]&1) seq[1][len[1]>>1] = seq_comp_table[(uint8_t)seq[1][len[1]>>1]];
mm_map_frag(mi, 2, len, (const char**)seq, _n_regs, regs, b, opt, seqname); mm_map_frag(mi, 2, len, (const char**)seq, _n_regs, regs, b, opt, NULL);
for (i = 0; i < _n_regs[1]; ++i) for (i = 0; i < _n_regs[1]; ++i)
regs[1][i].rev = !regs[1][i].rev; regs[1][i].rev = !regs[1][i].rev;
*n_regs = _n_regs[0] + _n_regs[1]; *n_regs = _n_regs[0] + _n_regs[1];
+8 -29
View File
@@ -6,63 +6,43 @@ cdef extern from "minimap.h":
# #
ctypedef struct mm_idxopt_t: ctypedef struct mm_idxopt_t:
short k, w, flag, bucket_bits short k, w, flag, bucket_bits
int64_t mini_batch_size int mini_batch_size
uint64_t batch_size uint64_t batch_size
ctypedef struct mm_mapopt_t: ctypedef struct mm_mapopt_t:
int64_t flag int64_t flag
int seed int seed
int sdust_thres int sdust_thres
int max_qlen int max_qlen
int bw
int bw, bw_long
int max_gap, max_gap_ref int max_gap, max_gap_ref
int max_frag_len int max_frag_len
int max_chain_skip, max_chain_iter int max_chain_skip, max_chain_iter
int min_cnt int min_cnt
int min_chain_score int min_chain_score
float chain_gap_scale
float chain_skip_scale
int rmq_size_cap, rmq_inner_dist
int rmq_rescue_size
float rmq_rescue_ratio
float mask_level float mask_level
int mask_len
float pri_ratio float pri_ratio
int best_n int best_n
int max_join_long, max_join_short
float alt_drop int min_join_flank_sc
float min_join_flank_ratio
int a, b, q, e, q2, e2 int a, b, q, e, q2, e2
int transition
int sc_ambi int sc_ambi
int noncan int noncan
int junc_bonus, junc_pen int junc_bonus
int zdrop, zdrop_inv int zdrop, zdrop_inv
int end_bonus int end_bonus
int min_dp_max int min_dp_max
int min_ksw_len int min_ksw_len
int anchor_ext_len, anchor_ext_shift int anchor_ext_len, anchor_ext_shift
float max_clip_ratio float max_clip_ratio
int rank_min_len
float rank_frac
int pe_ori, pe_bonus int pe_ori, pe_bonus
int jump_min_match;
float mid_occ_frac float mid_occ_frac
float q_occ_frac
int32_t min_mid_occ int32_t min_mid_occ
int32_t mid_occ int32_t mid_occ
int32_t max_occ int32_t max_occ
int64_t mini_batch_size int mini_batch_size
int64_t max_sw_mat int64_t max_sw_mat
int64_t cap_kalloc
const char *split_prefix const char *split_prefix
int mm_set_opt(char *preset, mm_idxopt_t *io, mm_mapopt_t *mo) int mm_set_opt(char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
@@ -112,7 +92,6 @@ cdef extern from "minimap.h":
void mm_tbuf_destroy(mm_tbuf_t *b) void mm_tbuf_destroy(mm_tbuf_t *b)
void *mm_tbuf_get_km(mm_tbuf_t *b) void *mm_tbuf_get_km(mm_tbuf_t *b)
int mm_gen_cs(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int no_iden) int mm_gen_cs(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int no_iden)
int mm_gen_ds(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int no_iden)
int mm_gen_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq) int mm_gen_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq)
# #
@@ -132,7 +111,7 @@ cdef extern from "cmappy.h":
void mm_reg2hitpy(const mm_idx_t *mi, mm_reg1_t *r, mm_hitpy_t *h) void mm_reg2hitpy(const mm_idx_t *mi, mm_reg1_t *r, mm_hitpy_t *h)
void mm_free_reg1(mm_reg1_t *r) void mm_free_reg1(mm_reg1_t *r)
mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char* seqname, const char *seq1, const char *seq2, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt) mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char *seq1, const char *seq2, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt)
char *mappy_fetch_seq(const mm_idx_t *mi, const char *name, int st, int en, int *l) char *mappy_fetch_seq(const mm_idx_t *mi, const char *name, int st, int en, int *l)
mm_idx_t *mappy_idx_seq(int w, int k, int is_hpc, int bucket_bits, const char *seq, int l) mm_idx_t *mappy_idx_seq(int w, int k, int is_hpc, int bucket_bits, const char *seq, int l)
+14 -38
View File
@@ -3,7 +3,7 @@ from libc.stdlib cimport free
cimport cmappy cimport cmappy
import sys import sys
__version__ = '2.31' __version__ = '2.17'
cmappy.mm_reset_timer() cmappy.mm_reset_timer()
@@ -14,9 +14,9 @@ cdef class Alignment:
cdef int8_t _strand, _trans_strand cdef int8_t _strand, _trans_strand
cdef uint8_t _mapq, _is_primary cdef uint8_t _mapq, _is_primary
cdef int _seg_id cdef int _seg_id
cdef _ctg, _cigar, _cs, _ds, _MD # these are python objects cdef _ctg, _cigar, _cs, _MD # these are python objects
def __cinit__(self, ctg, cl, cs, ce, strand, qs, qe, mapq, cigar, is_primary, mlen, blen, NM, trans_strand, seg_id, cs_str, ds_str, MD_str): def __cinit__(self, ctg, cl, cs, ce, strand, qs, qe, mapq, cigar, is_primary, mlen, blen, NM, trans_strand, seg_id, cs_str, MD_str):
self._ctg = ctg if isinstance(ctg, str) else ctg.decode() self._ctg = ctg if isinstance(ctg, str) else ctg.decode()
self._ctg_len, self._r_st, self._r_en = cl, cs, ce self._ctg_len, self._r_st, self._r_en = cl, cs, ce
self._strand, self._q_st, self._q_en = strand, qs, qe self._strand, self._q_st, self._q_en = strand, qs, qe
@@ -27,7 +27,6 @@ cdef class Alignment:
self._trans_strand = trans_strand self._trans_strand = trans_strand
self._seg_id = seg_id self._seg_id = seg_id
self._cs = cs_str self._cs = cs_str
self._ds = ds_str
self._MD = MD_str self._MD = MD_str
@property @property
@@ -78,15 +77,12 @@ cdef class Alignment:
@property @property
def cs(self): return self._cs def cs(self): return self._cs
@property
def ds(self): return self._ds
@property @property
def MD(self): return self._MD def MD(self): return self._MD
@property @property
def cigar_str(self): def cigar_str(self):
return "".join(map(lambda x: str(x[0]) + 'MIDNSHP=XB'[x[1]], self._cigar)) return "".join(map(lambda x: str(x[0]) + 'MIDNSH'[x[1]], self._cigar))
def __str__(self): def __str__(self):
if self._strand > 0: strand = '+' if self._strand > 0: strand = '+'
@@ -100,8 +96,6 @@ cdef class Alignment:
a = [str(self._q_st), str(self._q_en), strand, self._ctg, str(self._ctg_len), str(self._r_st), str(self._r_en), a = [str(self._q_st), str(self._q_en), strand, self._ctg, str(self._ctg_len), str(self._r_st), str(self._r_en),
str(self._mlen), str(self._blen), str(self._mapq), tp, ts, "cg:Z:" + self.cigar_str] str(self._mlen), str(self._blen), str(self._mapq), tp, ts, "cg:Z:" + self.cigar_str]
if self._cs != "": a.append("cs:Z:" + self._cs) if self._cs != "": a.append("cs:Z:" + self._cs)
if self._ds != "": a.append("ds:Z:" + self._ds)
if self._MD != "": a.append("MD:Z:" + self._MD)
return "\t".join(a) return "\t".join(a)
cdef class ThreadBuffer: cdef class ThreadBuffer:
@@ -118,7 +112,7 @@ cdef class Aligner:
cdef cmappy.mm_idxopt_t idx_opt cdef cmappy.mm_idxopt_t idx_opt
cdef cmappy.mm_mapopt_t map_opt cdef cmappy.mm_mapopt_t map_opt
def __cinit__(self, fn_idx_in=None, preset=None, k=None, w=None, min_cnt=None, min_chain_score=None, min_dp_score=None, bw=None, bw_long=None, best_n=None, n_threads=3, fn_idx_out=None, max_frag_len=None, extra_flags=None, seq=None, scoring=None, sc_ambi=None, max_chain_skip=None): def __cinit__(self, fn_idx_in=None, preset=None, k=None, w=None, min_cnt=None, min_chain_score=None, min_dp_score=None, bw=None, best_n=None, n_threads=3, fn_idx_out=None, max_frag_len=None, extra_flags=None, seq=None, scoring=None):
self._idx = NULL self._idx = NULL
cmappy.mm_set_opt(NULL, &self.idx_opt, &self.map_opt) # set the default options cmappy.mm_set_opt(NULL, &self.idx_opt, &self.map_opt) # set the default options
if preset is not None: if preset is not None:
@@ -131,7 +125,6 @@ cdef class Aligner:
if min_chain_score is not None: self.map_opt.min_chain_score = min_chain_score if min_chain_score is not None: self.map_opt.min_chain_score = min_chain_score
if min_dp_score is not None: self.map_opt.min_dp_max = min_dp_score if min_dp_score is not None: self.map_opt.min_dp_max = min_dp_score
if bw is not None: self.map_opt.bw = bw if bw is not None: self.map_opt.bw = bw
if bw_long is not None: self.map_opt.bw_long = bw_long
if best_n is not None: self.map_opt.best_n = best_n if best_n is not None: self.map_opt.best_n = best_n
if max_frag_len is not None: self.map_opt.max_frag_len = max_frag_len if max_frag_len is not None: self.map_opt.max_frag_len = max_frag_len
if extra_flags is not None: self.map_opt.flag |= extra_flags if extra_flags is not None: self.map_opt.flag |= extra_flags
@@ -143,8 +136,6 @@ cdef class Aligner:
self.map_opt.q2, self.map_opt.e2 = scoring[4], scoring[5] self.map_opt.q2, self.map_opt.e2 = scoring[4], scoring[5]
if len(scoring) >= 7: if len(scoring) >= 7:
self.map_opt.sc_ambi = scoring[6] self.map_opt.sc_ambi = scoring[6]
if sc_ambi is not None: self.map_opt.sc_ambi = sc_ambi
if max_chain_skip is not None: self.map_opt.max_chain_skip = max_chain_skip
cdef cmappy.mm_idx_reader_t *r; cdef cmappy.mm_idx_reader_t *r;
@@ -170,7 +161,7 @@ cdef class Aligner:
def __bool__(self): def __bool__(self):
return (self._idx != NULL) return (self._idx != NULL)
def map(self, seq, seq2=None, name=None, buf=None, cs=False, ds=False, MD=False, max_frag_len=None, extra_flags=None): def map(self, seq, seq2=None, buf=None, cs=False, MD=False, max_frag_len=None, extra_flags=None):
cdef cmappy.mm_reg1_t *regs cdef cmappy.mm_reg1_t *regs
cdef cmappy.mm_hitpy_t h cdef cmappy.mm_hitpy_t h
cdef ThreadBuffer b cdef ThreadBuffer b
@@ -181,7 +172,6 @@ cdef class Aligner:
cdef cmappy.mm_mapopt_t map_opt cdef cmappy.mm_mapopt_t map_opt
if self._idx == NULL: return if self._idx == NULL: return
if ((self.map_opt.flag & 4) and (self._idx.flag & 2)): return
map_opt = self.map_opt map_opt = self.map_opt
if max_frag_len is not None: map_opt.max_frag_len = max_frag_len if max_frag_len is not None: map_opt.max_frag_len = max_frag_len
if extra_flags is not None: map_opt.flag |= extra_flags if extra_flags is not None: map_opt.flag |= extra_flags
@@ -189,44 +179,31 @@ cdef class Aligner:
if self._idx is NULL: return None if self._idx is NULL: return None
if buf is None: b = ThreadBuffer() if buf is None: b = ThreadBuffer()
else: b = buf else: b = buf
km = cmappy.mm_tbuf_get_km(b._b)
_seq = seq if isinstance(seq, bytes) else seq.encode() _seq = seq if isinstance(seq, bytes) else seq.encode()
if name is not None:
_name = name if isinstance(name, bytes) else name.encode()
if seq2 is None: if seq2 is None:
if name is None: regs = cmappy.mm_map_aux(self._idx, _seq, NULL, &n_regs, b._b, &map_opt)
regs = cmappy.mm_map_aux(self._idx, NULL, _seq, NULL, &n_regs, b._b, &map_opt)
else:
regs = cmappy.mm_map_aux(self._idx, _name, _seq, NULL, &n_regs, b._b, &map_opt)
else: else:
_seq2 = seq2 if isinstance(seq2, bytes) else seq2.encode() _seq2 = seq2 if isinstance(seq2, bytes) else seq2.encode()
if name is None: regs = cmappy.mm_map_aux(self._idx, _seq, _seq2, &n_regs, b._b, &map_opt)
regs = cmappy.mm_map_aux(self._idx, NULL, _seq, _seq2, &n_regs, b._b, &map_opt)
else:
regs = cmappy.mm_map_aux(self._idx, _name, _seq, _seq2, &n_regs, b._b, &map_opt)
try: try:
i = 0 i = 0
while i < n_regs: while i < n_regs:
cmappy.mm_reg2hitpy(self._idx, &regs[i], &h) cmappy.mm_reg2hitpy(self._idx, &regs[i], &h)
cigar, _cs, _ds, _MD = [], '', '', '' cigar, _cs, _MD = [], '', ''
for k in range(h.n_cigar32): # convert the 32-bit CIGAR encoding to Python array for k in range(h.n_cigar32): # convert the 32-bit CIGAR encoding to Python array
c = h.cigar32[k] c = h.cigar32[k]
cigar.append([c>>4, c&0xf]) cigar.append([c>>4, c&0xf])
if cs or ds or MD: # generate the cs/ds and/or the MD tag, if requested if cs or MD: # generate the cs and/or the MD tag, if requested
km = cmappy.mm_tbuf_get_km(b._b)
_cur_seq = _seq2 if h.seg_id > 0 and seq2 is not None else _seq
if cs: if cs:
l_cs_str = cmappy.mm_gen_cs(km, &cs_str, &m_cs_str, self._idx, &regs[i], _cur_seq, 1) l_cs_str = cmappy.mm_gen_cs(km, &cs_str, &m_cs_str, self._idx, &regs[i], _seq, 1)
_cs = cs_str[:l_cs_str] if isinstance(cs_str, str) else cs_str[:l_cs_str].decode() _cs = cs_str[:l_cs_str] if isinstance(cs_str, str) else cs_str[:l_cs_str].decode()
if ds:
l_cs_str = cmappy.mm_gen_ds(km, &cs_str, &m_cs_str, self._idx, &regs[i], _cur_seq, 1)
_ds = cs_str[:l_cs_str] if isinstance(cs_str, str) else cs_str[:l_cs_str].decode()
if MD: if MD:
l_cs_str = cmappy.mm_gen_MD(km, &cs_str, &m_cs_str, self._idx, &regs[i], _cur_seq) l_cs_str = cmappy.mm_gen_MD(km, &cs_str, &m_cs_str, self._idx, &regs[i], _seq)
_MD = cs_str[:l_cs_str] if isinstance(cs_str, str) else cs_str[:l_cs_str].decode() _MD = cs_str[:l_cs_str] if isinstance(cs_str, str) else cs_str[:l_cs_str].decode()
yield Alignment(h.ctg, h.ctg_len, h.ctg_start, h.ctg_end, h.strand, h.qry_start, h.qry_end, h.mapq, cigar, h.is_primary, h.mlen, h.blen, h.NM, h.trans_strand, h.seg_id, _cs, _ds, _MD) yield Alignment(h.ctg, h.ctg_len, h.ctg_start, h.ctg_end, h.strand, h.qry_start, h.qry_end, h.mapq, cigar, h.is_primary, h.mlen, h.blen, h.NM, h.trans_strand, h.seg_id, _cs, _MD)
cmappy.mm_free_reg1(&regs[i]) cmappy.mm_free_reg1(&regs[i])
i += 1 i += 1
finally: finally:
@@ -240,7 +217,6 @@ cdef class Aligner:
cdef int l cdef int l
cdef char *s cdef char *s
if self._idx == NULL: return if self._idx == NULL: return
if ((self.map_opt.flag & 4) and (self._idx.flag & 2)): return
s = cmappy.mappy_fetch_seq(self._idx, name.encode(), start, end, &l) s = cmappy.mappy_fetch_seq(self._idx, name.encode(), start, end, &l)
if l == 0: return None if l == 0: return None
r = s[:l] if isinstance(s, str) else s[:l].decode() r = s[:l] if isinstance(s, str) else s[:l].decode()
+3 -7
View File
@@ -5,7 +5,7 @@ import getopt
import mappy as mp import mappy as mp
def main(argv): def main(argv):
opts, args = getopt.getopt(argv[1:], "x:n:m:k:w:r:cdM") opts, args = getopt.getopt(argv[1:], "x:n:m:k:w:r:c")
if len(args) < 2: if len(args) < 2:
print("Usage: minimap2.py [options] <ref.fa>|<ref.mmi> <query.fq>") print("Usage: minimap2.py [options] <ref.fa>|<ref.mmi> <query.fq>")
print("Options:") print("Options:")
@@ -16,12 +16,10 @@ def main(argv):
print(" -w INT minimizer window length") print(" -w INT minimizer window length")
print(" -r INT band width") print(" -r INT band width")
print(" -c output the cs tag") print(" -c output the cs tag")
print(" -d output the ds tag")
print(" -M output the MD tag")
sys.exit(1) sys.exit(1)
preset = min_cnt = min_sc = k = w = bw = None preset = min_cnt = min_sc = k = w = bw = None
out_cs = out_ds = out_MD = False out_cs = False
for opt, arg in opts: for opt, arg in opts:
if opt == '-x': preset = arg if opt == '-x': preset = arg
elif opt == '-n': min_cnt = int(arg) elif opt == '-n': min_cnt = int(arg)
@@ -30,13 +28,11 @@ def main(argv):
elif opt == '-k': k = int(arg) elif opt == '-k': k = int(arg)
elif opt == '-w': w = int(arg) elif opt == '-w': w = int(arg)
elif opt == '-c': out_cs = True elif opt == '-c': out_cs = True
elif opt == '-d': out_ds = True
elif opt == '-M': out_MD = True
a = mp.Aligner(args[0], preset=preset, min_cnt=min_cnt, min_chain_score=min_sc, k=k, w=w, bw=bw) a = mp.Aligner(args[0], preset=preset, min_cnt=min_cnt, min_chain_score=min_sc, k=k, w=w, bw=bw)
if not a: raise Exception("ERROR: failed to load/build index file '{}'".format(args[0])) if not a: raise Exception("ERROR: failed to load/build index file '{}'".format(args[0]))
for name, seq, qual in mp.fastx_read(args[1]): # read one sequence for name, seq, qual in mp.fastx_read(args[1]): # read one sequence
for h in a.map(seq, cs=out_cs, ds=out_ds, MD=out_MD): # traverse hits for h in a.map(seq, cs=out_cs): # traverse hits
print('{}\t{}\t{}'.format(name, len(seq), h)) print('{}\t{}\t{}'.format(name, len(seq), h))
if __name__ == "__main__": if __name__ == "__main__":
-132
View File
@@ -1,132 +0,0 @@
#include "mmpriv.h"
#include "kalloc.h"
#include "ksort.h"
void mm_seed_mz_flt(void *km, mm128_v *mv, int32_t q_occ_max, float q_occ_frac)
{
mm128_t *a;
size_t i, j, st;
if (mv->n <= q_occ_max || q_occ_frac <= 0.0f || q_occ_max <= 0) return;
a = Kmalloc(km, mm128_t, mv->n);
for (i = 0; i < mv->n; ++i)
a[i].x = mv->a[i].x, a[i].y = i;
radix_sort_128x(a, a + mv->n);
for (st = 0, i = 1; i <= mv->n; ++i) {
if (i == mv->n || a[i].x != a[st].x) {
int32_t cnt = i - st;
if (cnt > q_occ_max && cnt > mv->n * q_occ_frac)
for (j = st; j < i; ++j)
mv->a[a[j].y].x = 0;
st = i;
}
}
kfree(km, a);
for (i = j = 0; i < mv->n; ++i)
if (mv->a[i].x != 0)
mv->a[j++] = mv->a[i];
mv->n = j;
}
mm_seed_t *mm_seed_collect_all(void *km, const mm_idx_t *mi, const mm128_v *mv, int32_t *n_m_)
{
mm_seed_t *m;
size_t i;
int32_t k;
m = (mm_seed_t*)kmalloc(km, mv->n * sizeof(mm_seed_t));
for (i = k = 0; i < mv->n; ++i) {
const uint64_t *cr;
mm_seed_t *q;
mm128_t *p = &mv->a[i];
uint32_t q_pos = (uint32_t)p->y, q_span = p->x & 0xff;
int t;
cr = mm_idx_get(mi, p->x>>8, &t);
if (t == 0) continue;
q = &m[k++];
q->q_pos = q_pos, q->q_span = q_span, q->cr = cr, q->n = t, q->seg_id = p->y >> 32;
q->is_tandem = q->flt = 0;
if (i > 0 && p->x>>8 == mv->a[i - 1].x>>8) q->is_tandem = 1;
if (i < mv->n - 1 && p->x>>8 == mv->a[i + 1].x>>8) q->is_tandem = 1;
}
*n_m_ = k;
return m;
}
#define MAX_MAX_HIGH_OCC 128
void mm_seed_select(int32_t n, mm_seed_t *a, int len, int max_occ, int max_max_occ, int dist)
{ // for high-occ minimizers, choose up to max_high_occ in each high-occ streak
extern void ks_heapdown_uint64_t(size_t i, size_t n, uint64_t*);
extern void ks_heapmake_uint64_t(size_t n, uint64_t*);
int32_t i, last0, m;
uint64_t b[MAX_MAX_HIGH_OCC]; // this is to avoid a heap allocation
if (n == 0 || n == 1) return;
for (i = m = 0; i < n; ++i)
if (a[i].n > max_occ) ++m;
if (m == 0) return; // no high-frequency k-mers; do nothing
for (i = 0, last0 = -1; i <= n; ++i) {
if (i == n || a[i].n <= max_occ) {
if (i - last0 > 1) {
int32_t ps = last0 < 0? 0 : (uint32_t)a[last0].q_pos>>1;
int32_t pe = i == n? len : (uint32_t)a[i].q_pos>>1;
int32_t j, k, st = last0 + 1, en = i;
int32_t max_high_occ = (int32_t)((double)(pe - ps) / dist + .499);
if (max_high_occ > 0) {
if (max_high_occ > MAX_MAX_HIGH_OCC)
max_high_occ = MAX_MAX_HIGH_OCC;
for (j = st, k = 0; j < en && k < max_high_occ; ++j, ++k)
b[k] = (uint64_t)a[j].n<<32 | j;
ks_heapmake_uint64_t(k, b); // initialize the binomial heap
for (; j < en; ++j) { // if there are more, choose top max_high_occ
if (a[j].n < (int32_t)(b[0]>>32)) { // then update the heap
b[0] = (uint64_t)a[j].n<<32 | j;
ks_heapdown_uint64_t(0, k, b);
}
}
for (j = 0; j < k; ++j) a[(uint32_t)b[j]].flt = 1;
}
for (j = st; j < en; ++j) a[j].flt ^= 1;
for (j = st; j < en; ++j)
if (a[j].n > max_max_occ)
a[j].flt = 1;
}
last0 = i;
}
}
}
mm_seed_t *mm_collect_matches(void *km, int *_n_m, int qlen, int max_occ, int max_max_occ, int dist, const mm_idx_t *mi, const mm128_v *mv, int64_t *n_a, int *rep_len, int *n_mini_pos, uint64_t **mini_pos)
{
int rep_st = 0, rep_en = 0, n_m, n_m0;
size_t i;
mm_seed_t *m;
*n_mini_pos = 0;
*mini_pos = (uint64_t*)kmalloc(km, mv->n * sizeof(uint64_t));
m = mm_seed_collect_all(km, mi, mv, &n_m0);
if (dist > 0 && max_max_occ > max_occ) {
mm_seed_select(n_m0, m, qlen, max_occ, max_max_occ, dist);
} else {
for (i = 0; i < n_m0; ++i)
if (m[i].n > max_occ)
m[i].flt = 1;
}
for (i = 0, n_m = 0, *rep_len = 0, *n_a = 0; i < n_m0; ++i) {
mm_seed_t *q = &m[i];
if (mm_dbg_flag & MM_DBG_SEED_FREQ)
fprintf(stderr, "SF\t%d\t%d\t%d\n", q->q_pos>>1, q->n, q->flt);
if (q->flt) {
int en = (q->q_pos >> 1) + 1, st = en - q->q_span;
if (st > rep_en) {
*rep_len += rep_en - rep_st;
rep_st = st, rep_en = en;
} else rep_en = en;
} else {
*n_a += q->n;
(*mini_pos)[(*n_mini_pos)++] = (uint64_t)q->q_span<<32 | q->q_pos>>1;
m[n_m++] = *q;
}
}
*rep_len += rep_en - rep_st;
*_n_m = n_m;
return m;
}
+14 -4
View File
@@ -4,6 +4,16 @@ except ImportError:
from distutils.core import setup from distutils.core import setup
from distutils.extension import Extension from distutils.extension import Extension
cmdclass = {}
try:
from Cython.Build import build_ext
except ImportError: # without Cython
module_src = 'python/mappy.c'
else: # with Cython
module_src = 'python/mappy.pyx'
cmdclass['build_ext'] = build_ext
import sys, platform import sys, platform
sys.path.append('python') sys.path.append('python')
@@ -23,7 +33,7 @@ def readme():
setup( setup(
name = 'mappy', name = 'mappy',
version = '2.31', version = '2.17',
url = 'https://github.com/lh3/minimap2', url = 'https://github.com/lh3/minimap2',
description = 'Minimap2 python binding', description = 'Minimap2 python binding',
long_description = readme(), long_description = readme(),
@@ -32,8 +42,8 @@ setup(
license = 'MIT', license = 'MIT',
keywords = 'sequence-alignment', keywords = 'sequence-alignment',
scripts = ['python/minimap2.py'], scripts = ['python/minimap2.py'],
ext_modules = [Extension('mappy', ext_modules = [Extension('mappy',
sources = ['python/mappy.pyx', 'align.c', 'bseq.c', 'lchain.c', 'seed.c', 'format.c', 'hit.c', 'index.c', 'pe.c', 'jump.c', 'options.c', sources = [module_src, 'align.c', 'bseq.c', 'chain.c', 'format.c', 'hit.c', 'index.c', 'pe.c', 'options.c',
'ksw2_extd2_sse.c', 'ksw2_exts2_sse.c', 'ksw2_extz2_sse.c', 'ksw2_ll_sse.c', 'ksw2_extd2_sse.c', 'ksw2_exts2_sse.c', 'ksw2_extz2_sse.c', 'ksw2_ll_sse.c',
'kalloc.c', 'kthread.c', 'map.c', 'misc.c', 'sdust.c', 'sketch.c', 'esterr.c', 'splitidx.c'], 'kalloc.c', 'kthread.c', 'map.c', 'misc.c', 'sdust.c', 'sketch.c', 'esterr.c', 'splitidx.c'],
depends = ['minimap.h', 'bseq.h', 'kalloc.h', 'kdq.h', 'khash.h', 'kseq.h', 'ksort.h', depends = ['minimap.h', 'bseq.h', 'kalloc.h', 'kdq.h', 'khash.h', 'kseq.h', 'ksort.h',
@@ -52,4 +62,4 @@ setup(
'Programming Language :: Python :: 3', 'Programming Language :: Python :: 3',
'Intended Audience :: Science/Research', 'Intended Audience :: Science/Research',
'Topic :: Scientific/Engineering :: Bio-Informatics'], 'Topic :: Scientific/Engineering :: Bio-Informatics'],
setup_requires=["cython"]) cmdclass = cmdclass)
-5
View File
@@ -1,5 +0,0 @@
mm2: TGTTATCCCTAGGGTAACTTGTTCCGTTGGTCAAGTTATTGGATCAATTGAGTATAGTAGTGCACTCAC......................................................................................................................................CACTTGGAGCCATTCATACAGGTCCCTATTTAAGGAACAAGTGATTATGCTACCTTTGCACGGTT
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
ref: TGTTATCCCTAGGGTAACTTGTTCCGTTGGTCAAGTTATTGGATCAATTGAGTATAGTAGTGCACTCACctGCTTCGCTTTGACTGGTGAAGTCTTAGCATGTACTGCTCGGAGGTTGGGTTCTGCTCCGAGGTCGCCCCAACCGAAATTTTTAATGCAGGTTTGGTAGTTTAGGACCTGTGGGTTTGTTAGGCTAACCTCacCACTTGGAGCCATTCATACAGGTCCCTATTTAAGGAACAAGTGATTATGCTACCTTTGCACGGTT
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
sta: TGTTATCCCTAGGGTAACTTGTTCCGTTGGTCAAGTTATTGGATCAATTGAGTATAGTAGTGCA......................................................................................................................................CTCACCACTTGGAGCCATTCATACAGGTCCCTATTTAAGGAACAAGTGATTATGCTACCTTTGCACGGTT
-5
View File
@@ -1,5 +0,0 @@
>query
AACCGTGCAAAGGTAGCATAATCACTTGTTCCTTAAATAGGGACCTGTATGAATGGCTCC
AAGTG
GTGAGTGCA
CTACTATACTCAATTGATCCAATAACTTGACCAACGGAACAAGTTACCCTAGGGATAACA
-10
View File
@@ -1,10 +0,0 @@
>ref
TGATCCAACATCGAGGTCGTAAACCCTATTGTTGATATGGACTCTAGAATAGGATTGCGC
TGTTATCCCTAGGGTAACTTGTTCCGTTGGTCAAGTTATTGGATCAATTGAGTATAGTAG
TGCACTCAC
ctGCTTCGCTTTGACTGGTGAAGTCTTAGCATGTACTGCTCGGAGGTTGGGTTCTGCTCC
GAGGTCGCCCCAACCGAAATTTTTAATGCAGGTTTGGTAGTTTAGGACCTGTGGGTTTGT
TAGGCTAACCTCac
CACTTGGAGCCATTCATACAGGTCCCTATTTAAGGAACAAGTGATTATGCTACCTTTGCA
CGGTTAGGGTACCGCGGCCGTTAAACATGTGTCACTGGGCAGGCGGTGCCTCTAATACTG
GTGAT
-120
View File
@@ -338,123 +338,3 @@
Title = {Introducing difference recurrence relations for faster semi-global alignment of long sequences}, Title = {Introducing difference recurrence relations for faster semi-global alignment of long sequences},
Volume = {19}, Volume = {19},
Year = {2018}} Year = {2018}}
@article{Li:2018ab,
Author = {Li, Heng},
Journal = {Bioinformatics},
Pages = {3094-3100},
Title = {Minimap2: pairwise alignment for nucleotide sequences},
Volume = {34},
Year = {2018}}
@article{Jain:2020aa,
Author = {Jain, Chirag and others},
Journal = {Bioinformatics},
Pages = {i111-i118},
Title = {Weighted minimizer sampling improves long read mapping},
Volume = {36},
Year = {2020}}
@article{Miga:2020aa,
Author = {Miga, Karen H and others},
Journal = {Nature},
Pages = {79-84},
Title = {Telomere-to-telomere assembly of a complete human {X} chromosome},
Volume = {585},
Year = {2020}}
@article {Jain2020.11.01.363887,
author = {Jain, Chirag and others},
title = {A long read mapping method for highly repetitive reference sequences},
elocation-id = {2020.11.01.363887},
year = {2020},
doi = {10.1101/2020.11.01.363887},
publisher = {Cold Spring Harbor Laboratory},
URL = {https://www.biorxiv.org/content/early/2020/11/02/2020.11.01.363887},
eprint = {https://www.biorxiv.org/content/early/2020/11/02/2020.11.01.363887.full.pdf},
journal = {bioRxiv}
}
@article{Li:2020aa,
Author = {Li, Heng and others},
Journal = {Genome Biol},
Pages = {265},
Title = {The design and construction of reference pangenome graphs with minigraph},
Volume = {21},
Year = {2020}}
@article{Ren:2021aa,
Author = {Ren, Jingwen and Chaisson, Mark J P},
Journal = {PLoS Comput Biol},
Pages = {e1009078},
Title = {lra: A long read aligner for sequences and contigs},
Volume = {17},
Year = {2021}}
@inproceedings{DBLP:conf/wabi/AbouelhodaO03,
Author = {Mohamed Ibrahim Abouelhoda and Enno Ohlebusch},
Booktitle = {Algorithms in Bioinformatics, Third International Workshop, {WABI} 2003, Budapest, Hungary, September 15-20, 2003, Proceedings},
Crossref = {DBLP:conf/wabi/2003},
Pages = {1--16},
Title = {A Local Chaining Algorithm and Its Applications in Comparative Genomics},
Year = {2003}}
@article{Ono:2021aa,
Author = {Ono, Yukiteru and others},
Journal = {Bioinformatics},
Pages = {589-595},
Title = {{PBSIM2}: a simulator for long-read sequencers with a novel generative model of quality scores},
Volume = {37},
Year = {2021}}
@article{Sedlazeck:2018ab,
Author = {Sedlazeck, Fritz J and others},
Journal = {Nat Methods},
Pages = {461-468},
Title = {Accurate detection of complex structural variations using single-molecule sequencing},
Volume = {15},
Year = {2018}}
@article{Jeffares:2017aa,
Author = {Jeffares, Daniel C and others},
Journal = {Nat Commun},
Pages = {14061},
Title = {Transient structural variations have strong effects on quantitative traits and reproductive isolation in fission yeast},
Volume = {8},
Year = {2017}}
@article{Zook:2020aa,
Author = {Zook, Justin M and others},
Journal = {Nat Biotechnol},
Pages = {1347-1355},
Title = {A robust benchmark for detection of germline large deletions and insertions},
Volume = {38},
Year = {2020}}
@article{Harpak:2017aa,
Author = {Harpak, Arbel and others},
Journal = {Proc Natl Acad Sci U S A},
Pages = {12779-12784},
Title = {Frequent nonallelic gene conversion on the human lineage and its effect on the divergence of gene duplicates},
Volume = {114},
Year = {2017}}
@article{Li:2018aa,
Author = {Li, Heng and others},
Journal = {Nat Methods},
Month = {Aug},
Number = {8},
Pages = {595-597},
Title = {A synthetic-diploid benchmark for accurate variant-calling evaluation},
Volume = {15},
Year = {2018}}
@article{Gu:1995wt,
author = {Gu, X and Li, W H},
journal = {J Mol Evol},
month = {Apr},
number = {4},
pages = {464-73},
title = {The size distribution of insertions and deletions in human and rodent pseudogenes suggests the logarithmic gap penalty for sequence alignment},
volume = {40},
year = {1995}}
-240
View File
@@ -1,240 +0,0 @@
\documentclass{bioinfo}
\copyrightyear{2021}
\pubyear{2021}
\usepackage{graphicx}
\usepackage{hyperref}
\usepackage{url}
\usepackage{amsmath}
\usepackage[ruled,vlined]{algorithm2e}
\newcommand\mycommfont[1]{\footnotesize\rmfamily{\it #1}}
\SetCommentSty{mycommfont}
\SetKwComment{Comment}{$\triangleright$\ }{}
\usepackage{natbib}
\bibliographystyle{apalike}
\DeclareMathOperator*{\argmax}{argmax}
\begin{document}
\firstpage{1}
\title[Improvements to minimap2]{New strategies to improve minimap2 alignment accuracy}
\author[Li]{Heng Li$^{1,2}$}
\address{$^1$Dana-Farber Cancer Institute, 450 Brookline Ave, Boston, MA 02215, USA,
$^2$Harvard Medical School, 10 Shattuck St, Boston, MA 02215, USA}
\maketitle
\begin{abstract}
\section{Summary:} We present several recent improvements to minimap2, a
versatile pairwise aligner for nucleotide sequences. Now minimap2 v2.22 can
more accurately map long reads to highly repetitive regions and align through
insertions or deletions up to 100kb by default, addressing major weakness in
minimap2 v2.18 or earlier.
\section{Availability and implementation:}
\href{https://github.com/lh3/minimap2}{https://github.com/lh3/minimap2}
\section{Contact:} hli@ds.dfci.harvard.edu
\end{abstract}
\section{Introduction}
Minimap2~\citep{Li:2018ab} is widely used for maping long sequence
reads and assembly contigs. \citet{Jain:2020aa} found minimap2 v2.18 or earlier occasionally
misaligned reads from highly repetitive regions as minimap2 ignored seeds of
high occurrence. They also noticed minimap2 may misplace reads with structural
variations (SVs) in such regions~\citep{Jain2020.11.01.363887}. These
misalignments have become a pressing issue in the advent of
temolere-to-telomore human assembly~\citep{Miga:2020aa}. Meanwhile, old minimap2
was unable to efficiently align long insertions/deletions (INDELs) and often
breaks an alignment around variable-number tandem repeats (VNTRs). This has
inspired new chaining algorithms~\citep{Li:2020aa,Ren:2021aa} which are not
integrated into minimap2. Here we will describe recent efforts implemented
in v2.19 through v2.22 to improve mapping results.
\begin{methods}
\section{Methods}
\subsection{Rescuing high-occurrence $k$-mers}\label{sec:high-occ}
Minimap2 keeps all $k$-mer minimizers~\citep{Roberts:2004fv} during indexing. Its original
implementation only selected low-occurrence minimizers during mapping. The
cutoff is a few hundred for mapping long reads against a human genome. If a
read habors only a few or even no low-occurrence minimizers, it will fail
chaining due to insufficient anchors.
To resolve this issue, we implemented a new heuristic to add additional
minimizers. Suppose we are looking at two adjacent low-occurence $k$-mers
located at position $x_1$ and $x_2$, respectively. If $|x_1-x_2|\ge L$,
minimap2 v2.22 additionally selects $\lfloor|x_1-x_2|/L\rfloor$ minimizers
of the lowest occurrence among minimizers between $x_1$ and $x_2$. Here
parameter $L$ controls the frequency of sampling. It defaults to 500.
This strategy adds necessary anchors at the cost of increasing total alignment
time by a few percent on real data.
\subsection{Aligning through longer INDELs}
The original minimap2 may fail to align long INDELs due to its chaining
heuristics. Briefly, minimap2 applies dynamic programming (DP) to chain
minimizer anchors. This is a quadratic algorithm, slow for chaining
contigs. For acceptable performance, the original minimap2 uses a 500bp band by
default, which means a gap longer than 500bp will stop chaining.
To align through longer gaps, older minimap2 implemented a long-join heurstic as follows.
If there is an INDEL longer than 500bp and the two chains around the INDEL
have no overlaps on either the query or the reference sequence, minimap2 may
join the two short chains later.
This heuristic may fail around VNTRs because short chains
often have overlaps in VNTRs. More subtly, minimap2 may escape the inner DP
loop early, again for performance, if the chaining result is not improved for
50 iterations. When there is a copy number change in a long segmental
duplication, the early escape may break around the event even if users
specify a large band.
In minigraph~\citep{Li:2020aa}, we developed a new chaining algorithm that
finds up to 1kb INDELs with DP-based chaining and goes through longer INDELs with a
subquadratic algorithm~\citep{DBLP:conf/wabi/AbouelhodaO03}. We ported the same
algorithm to minimap2 for contig mapping. For long-read mapping, the minigraph
algorithm is slower. Minimap2 v2.22 still uses the DP-based algorithm to
find short chains and then invokes the minigraph algorithm to rechain anchors in
these short chains. The rechaining step achieves the same goal as long-join
but is more reliable because it can resolve overlaps between short chains. The old
long-join heuristic has since been removed.
\subsection{Properly mapping long reads with SVs}
The original minimap2 ranks an alignment by its Smith-Waterman score and
outputs the best scoring alignment. However, when there are SVs on the read,
the best scoring alignment is sometimes not the correct alignment.
\citet{Jain2020.11.01.363887} resolved this dilemma by altering the mapping
algorithm.
In our view, this problem is rooted in inapropriate scoring: affine-gap penalty
over-penalizes a long INDEL that was often evolutionarily created in one event.
We should not penalize a SV by a function linear in the SV length. Minimap2 v2.22 instead rescores
an alignment with the following scoring function. Suppose an alignment consists
of $M$ matching bases, $N$ substitutions and $G$ gap opens, we empirically
score the alignment with
$$
S=M-\frac{N+G}{2d}-\sum_{i=1}^G\log_2(1+g_i)
$$
where $g_i\ge1$ is the length of the $i$-th gap and
$$
d=\max\left\{\frac{N+G}{M+N+G},0.02\right\}
$$
It approximates per-base sequence divergence except with the smallest value set
to 2\%. As an analogy to affine-gap scoring, the matching score in our scheme
is 1, the mismatch and gap open penalties are both $1/2d$ and the gap extension
penalty is a logarithm function of the gap length~\citep{Gu:1995wt}. Our scoring gives a long SV
a much milder penalty. In terms of time complexity, scoring an alignment is
linear in the length of the alignment. The time spent on rescoring is negligible in
practice.
%If we assume sequences evolve under a duplication-mutation model, we may have a
%better way to choose the best alignment. If a long read can be mapped to $n$
%loci, we can take the read as the template and build a
%pseudo-multi-sequence-alignment (pMSA) of $n+1$ sequences. In this pMSA, we say
%a site on the read is informative if the $n$ reference subsequences differ at
%the position.
\end{methods}
\section{Results}
\begin{table}
\processtable{Evaluation of minimap2 v2.22}
{\footnotesize\label{tab:1}\begin{tabular}{p{4.2cm}rrrr}
\toprule
$[$Benchmark$]$ Metric & v2.22 & v2.18 & Winno & lra \\
\midrule
$[$sim-map$]$ \% mapped reads at Q10 & 97.9 & 97.6 & {\bf 99.0}& 97.3 \\
$[$sim-map$]$ err. rate at Q10 (phredQ) & {\bf 52} & {\bf 52} & 38 & 24 \\
$[$winno-cmp$]$ rate of diff. (phredQ) & {\bf 41} & 37 & truth & 18 \\
$[$winno-cmp$]$ CPU time (hour) & {\bf 5.0} & 5.3 & 71.8 & 13.1 \\
$[$winno-cmp$]$ peak RAM (Gb) & 17.1 & 14.4 & {\bf 9.6} & 12.4 \\
$[$sim-sv$]$ \% false negative rate & {\bf 0.5} & 2.0 & {\bf 0.5} & 1.4 \\
$[$sim-sv$]$ \% false discovery rate & {\bf 0.0} & 0.1 & {\bf 0.0} & 0.1 \\
$[$real-sv-1k$]$ \% false negative rate & {\bf 7.3} & 20.0 & 13.0 & N/A \\
$[$real-sv-1k$]$ \% false discovery rate & 2.7 & {\bf 2.4} & 2.7 & N/A \\
\botrule
\end{tabular}}
{In $[$sim-map$]$, 152,713 reads were simulated from the CHM13 telomere-to-telomere assembly v1.1
(AC: GCA\_009914755.3) with pbsim2~\citep{Ono:2021aa}: ``pbsim2 -{}-hmm\_model R94.model -{}-length-min
5000 -{}-length-mean 20000 -{}-accuracy-mean 0.95''. Alignments of mapping quality
10 or higher were evaluated by ``paftools.js mapeval''. The mapping error rate
is measured in the phred scale: if the error rate is $e$, $-10\log_{10}e$ is
reported in the table. In $[$winno-cmp$]$, 1.39 million CHM13 HiFi reads from
SRR11292121 were mapped against the same CHM13 assembly. 99.3\% of them were mapped by Winnowmap2
at mapping quality 10 or higher and were taken as ground truth to evaluate
minimap2 and lra with ``paftools.js pafcmp''. $[$sim-sv$]$ simulated 1,000
50bp to 1000bp INDELs from chr8 in CHM13 using SURVIVOR~\citep{Jeffares:2017aa} and simulated Nanopore
reads at 30-fold coverage with the same pbsim2 command line. SVs were called with
``sniffles -q 10''~\citep{Sedlazeck:2018ab} and compared to the simulated truth with ``SURVIVOR eval
call.vcf truth.bed 50''. In $[$real-sv-1k$]$, small and long variants were
called by dipcall-0.3~\citep{Li:2018aa} for HG002 assemblies (AC: GCA\_018852605.1 and
GCA\_018852615.1) and compared to the GIAB truth~\citep{Zook:2020aa} using ``truvari -r 2000 -s
1000 -S 400 -{}-multimatch -{}-passonly'' which sets the minimum INDEL size to 1kb in evaluation. }
\end{table}
We evaluated minimap2 v2.22 along with v2.18, Winnowmap2 v2.03 and lra v1.3.2
(Table~\ref{tab:1}), using the default setting of each mapper according to the input data types.
Both versions of minimap2 achieved high mapping accuracy on
simulated Nanopore reads (sim-map). Winnowmap2 aligned more reads at mapping
quality 10 or higher (mapQ10). However, it may occasionally assign a high mapping
quality to a read with multiple identical best alignments. This reduced its
mapping accuracy.
In lack of groud truth for real data, we took Winnowmap2 mapping as ground
truth to evaluate other mappers (winno-cmp in Table~\ref{tab:1}). Out of 1,378,092 reads with mapQ10
alignments by Winnowmap2, minimap2 v2.22 could map all of them. 118 reads, less
than 0.01\% of all reads, were mapped differently by v2.22. 51 of them have
multiple identical best alignments. We believe these are more likely to be
Winnowmap2 errors. Most of the remaining 67 (=118-51) reads have multiple
highly similar but not identical alignments.
Minimap2 v2.18 is less consistent with 275 differences including 30 unmapped
reads mappable by both Winnowmap2 and v2.22.
For the minimizer rescuing parameter $L$ in Section~\ref{sec:high-occ},
we set its default to 500 such that v2.22 has comparable performance to v2.18 given simulated PacBio and Nanopore human reads.
To see the effect of this parameter on real data, we tried several different $L$ values.
v2.22 gave 99 mapping differences at $L=200$,
118 at $L=500$ (default), 167 at $L=750$ and 224 differences at $L=1000$ in comparison to Winnowmap2.
$L=200$ is 28\% slower than the default while $L=1000$ is 9\% faster.
Changing the default minimizer window size (option ``-w'')
and the initial minimizer occurrence cutoff (option ``-f'')
also affects performance and accuracy to a similar magnitude.
The two benchmarks above only evaluate read mappings when there are no variations between the reads and the reference.
To measure the mapping accuracy in the presence of SVs (sim-sv), we reproduced
the results by~\citep{Jain2020.11.01.363887}. Minimap2 v2.22 is as good as
Winnowmap2 now. Note that we were setting the Sniffles mapping quality
threshold to 10 in consistent with the benchmarks above. If we used the
default threshold 20, v2.22 would miss additional five SVs (accounting for
0.5\% of simulated SVs). For four out of these five missing SVs, minimap2 v2.22
mapped more variant reads than Winnowmap2. Sniffles did not call these SVs
because minimap2 tended to give them conservative mapping quality. It is worth
noting that the simulation here only considers a simple scenario in evolution.
Non-allelic gene conversions, which happen often in segmental
duplications~\citep{Harpak:2017aa}, would obscure the optimal mapping
strategies. How much such simple SV simulation informs real-world SV calling
remains a question.
To see if minimap2 v2.22 could improve long INDEL alignment, we ran dipcall on
contig-to-reference alignments and focused on INDELs longer than 1kb
(real-sv-1k). v2.22 is more sensitive at comparable specificity, confirming its
advantage in more contiguous alignment. We could not get dipcall to work well with lra,
so did not report the numbers.
Minimap2 spends most computing time on base alignment. As recent improvements
in v2.22 incur little additional computing and do not change the base alignment
algorithm, the new version has similar performance to older versions. It is
consistently faster than Winnowmap2 by several times. Sometimes simple
heuristics can be as effective as more sophisticated yet slower solutions.
\section*{Acknowledgements}
We thank Arang Rhie and Chirag Jain for providing motivating examples for which
older minimap2 underperforms.
\paragraph{Funding\textcolon} This work is funded by NHGRI grant R01HG010040.
\bibliography{minimap2}
\end{document}