Compare commits

..
114 Commits
Author SHA1 Message Date
Heng Li bf8246f872 Release minimap2-2.1-r311 2017-08-25 13:35:55 +08:00
Heng Li 5cbd776651 test data for spliced alignment 2017-08-25 13:17:56 +08:00
Heng Li 0fe1a224ab r309: improved SAM header output 2017-08-25 10:35:58 +08:00
Heng Li 240f6caaff backup manuscript 2017-08-24 22:05:14 +08:00
Heng Li b8bdac7e64 backup 2017-08-22 17:45:01 +08:00
Heng Li 19e4b2aab0 backup 2017-08-20 22:10:03 +08:00
Heng Li ce859dbe1c evaluate introns
this simplies the metrics
2017-08-20 21:54:59 +08:00
Heng Li a4c41f64a5 the final version
to be replaced by intron-eval
2017-08-20 21:54:35 +08:00
Heng Li 5ed2faf270 minor tuning to the matching rules 2017-08-19 16:21:49 +08:00
Heng Li 8058c85b72 moved appendix to methods; detailed splice aln 2017-08-18 23:33:57 +08:00
Heng Li 993a2bb521 r301: separate introns from deletions
When an intron is adjacent to a deletion, the old code count both as introns,
which lead to an inaccurate exon boundary.
2017-08-18 15:31:15 +08:00
Heng Li 64c1389e1a Merge branch 'master' into splice 2017-08-17 23:39:27 +08:00
Heng Li 81cff97208 r299: support -h: output to stdout; return 0 2017-08-17 23:38:31 +08:00
Heng Li bbb37d95f2 support inserting RG lines 2017-08-17 23:34:09 +08:00
Heng Li 2cde8d257c r297: bidirectional RNA alignment 2017-08-17 06:02:44 -04:00
Heng Li b5f5929bf9 r296: expose splicing related options to CLI 2017-08-13 21:37:51 -04:00
Heng Li 28f86688ab r295: gap closure from the middle of non-HPC k
This WILL slightly affect the result of genomic mapping, but hopefully
in the good direction.
2017-08-12 23:48:43 -04:00
Heng Li 43506edbc5 backup: preliminary boundary alignment 2017-08-12 23:10:14 -04:00
Heng Li bcfe00d2ad minor formatting changes 2017-08-12 19:09:33 -04:00
Heng Li 17c19e5819 exts2 working 2017-08-12 19:06:59 -04:00
Heng Li 61eef0575c separate out spliced alignment; not right yet 2017-08-12 18:54:32 -04:00
Heng Li 53b3265d84 r290: in techrep, explain spliced alignment 2017-08-12 15:40:49 -04:00
Heng Li a23df2dc91 r289: changed CLI help only 2017-08-12 12:40:07 -04:00
Heng Li 5a74088b74 r288: changed max intron length to 200k 2017-08-12 12:39:21 -04:00
Heng Li d240318741 r287: refined CLI options and manpage 2017-08-12 12:26:04 -04:00
Heng Li 0f4c823b0c r286: ignore introns when computing max seg score 2017-08-12 10:58:16 -04:00
Heng Li 2d11aaa830 option to print all exons for debugging 2017-08-12 10:04:16 -04:00
Heng Li 30b8cb4672 option to print correct exons 2017-08-11 17:50:21 -04:00
Heng Li 0c1760bc86 bugfix; print errors; better rules 2017-08-11 16:28:52 -04:00
Heng Li a99358bc3d r282: reduced intron cost; added eval script 2017-08-11 00:06:01 -04:00
Heng Li 163fa36ee6 r281: don't open long gaps on query 2017-08-10 15:04:59 -04:00
Heng Li c59b0781bc r280: output introns as "N" in the cdna mode 2017-08-09 11:45:02 -04:00
Heng Li 7429b12164 Merge branch 'master' into cdna 2017-08-08 22:00:24 -04:00
Heng Li 9e1125edda r277: abort if query/-d missing (#11) 2017-08-08 21:46:15 -04:00
Heng Li 4db0d1034b Show travis CI status 2017-08-08 21:32:56 -04:00
Heng Li 3dbe23b34e Merge branch 'dev' 2017-08-08 21:30:32 -04:00
Heng Li 6840370f3c Release minimap2-2.0 (r275) 2017-08-08 21:16:25 -04:00
Heng Li 7f9f659b6a r274: CLI option to change max ref gap 2017-08-08 11:39:23 -04:00
Heng Li 1a7d782131 r273: cdna mapping mode for testing
Differences from the typical mapping mode:

* banded alignment disabled
* log gap cost during chaining
* zero long-gap extension during alignment
* up to 100kb (by default) reference gap
* bad seeding not filtered (to tune later)
2017-08-08 11:31:49 -04:00
Heng Li 4badf2fcbf avoid wasted memory allocation for backtrack 2017-08-08 11:29:46 -04:00
Heng Li 0137d0dfab command lines used for read simulation 2017-08-07 13:41:40 -04:00
Heng Li 5b10667967 sim-eval.js to support mason2 read names and SAM 2017-08-07 13:28:33 -04:00
Heng Li bd1541dce1 renamed simulation-related scripts 2017-08-07 13:26:25 -04:00
Heng Li 1597f2b030 convert mason2 SAM to fastq 2017-08-07 12:45:34 -04:00
Heng Li ce927d2aee Merge branch 'master' into dev 2017-08-07 12:44:07 -04:00
Heng Li 8c2917b391 Added citation. 2017-08-06 21:30:47 -04:00
Heng Li 9fcf8b6315 added basic travis CI 2017-08-04 15:33:40 -04:00
Heng Li 3217178d4a fixed k8 download page 2017-08-04 14:53:00 -04:00
Heng Li b40598fa91 added paf2aln.js example 2017-08-04 14:51:33 -04:00
Heng Li 269b8661b9 minor clarification 2017-08-04 14:49:25 -04:00
Heng Li 890d7bbd5b added README for misc scripts 2017-08-04 14:46:31 -04:00
Heng Li 1aca0d5098 copied sam2paf.js here for completeness 2017-08-04 14:44:37 -04:00
Heng Li 68d99f0edb Merge branch 'cs-tag' into dev 2017-08-04 14:31:46 -04:00
Heng Li fd66ab5413 blast-like output working 2017-08-04 14:31:21 -04:00
Heng Li 71f82759af convert paf to maf 2017-08-04 13:05:46 -04:00
Heng Li 648cdd8a3b minor wording changes 2017-08-04 10:21:10 -04:00
Heng Li 7e231cfd3a minor wording improvement 2017-08-03 21:28:01 -04:00
Heng Li 95d3c30ae3 rephrasing a bit to avoid the apparent TeX bug
Several hours sank into this. Damned...
2017-08-03 20:19:00 -04:00
Heng Li f57fd8c790 added one transition phrase
as there are no subsubsections now
2017-08-03 18:01:48 -04:00
Heng Li c70b20ee6d removed subsubsection
TeX Live 2016 doesn't work with section and content on the same line.
2017-08-03 17:58:36 -04:00
Heng Li e8d00a8c8c removed trailing ^M 2017-08-03 17:20:43 -04:00
Heng Li ed4efd77bc minor modifications
I will submit this version arXiv. There is definitely room for improvement, but
as a semi-formal technical report, it should be good for now.
2017-08-03 12:47:36 -04:00
Heng Li 295874ea30 spell check 2017-08-03 12:17:58 -04:00
Heng Li 9ec5f51afb the first draft 2017-08-03 12:12:55 -04:00
Heng Li 28ab4d1f72 backup 2017-08-02 22:59:58 -04:00
Heng Li 6c9390b54a backup 2017-08-02 19:52:31 -04:00
Heng Li 9306299e4d added benchmark results 2017-08-01 15:12:49 -04:00
Heng Li 0c563e1868 Merge branch 'dev' into tex 2017-08-01 13:53:16 -04:00
Heng Li 8b1e36c609 minor tweaks to the evaluation script 2017-08-01 13:52:29 -04:00
Heng Li d933a263d7 backup 2017-08-01 13:29:02 -04:00
Heng Li 7542b4b40a Makefile for TeX 2017-08-01 10:42:33 -04:00
Heng Li d6181de844 added tech notes 2017-08-01 10:38:33 -04:00
Heng Li 12cea727b8 r238: bugfix to cs - rev sequence not complemented 2017-08-01 10:33:21 -04:00
Heng Li cd105b47f2 r237: fixed a bug in outputting cs:Z 2017-07-31 14:49:39 -04:00
Heng Li 35f232c3fa r236: in cs tag, output differences in lowercase
for easy eyeballing
2017-07-31 12:17:48 -04:00
Heng Li 4c0713ee14 r235: optionally output tag cs in PAF
cs encodes the query, the reference sequence and CIGAR.
2017-07-31 12:06:49 -04:00
Heng Li 46de0fbdad Merge pull request #8 from rikuu/master
fix self-comparison in index parameter override check
2017-07-30 15:10:29 -04:00
Riku Walve 9e09c1ae72 fix self-comparison in index parameter override check 2017-07-30 21:46:25 +03:00
Heng Li d8d4d29b68 Release minimap2-2.0rc1-r232 2017-07-30 14:32:40 -04:00
Heng Li e51dfd0330 added NEWS 2017-07-30 14:20:03 -04:00
Heng Li 1f78e1ee53 r230: code formatting changes only 2017-07-30 12:31:40 -04:00
Heng Li 5934d68772 r229: a new way to prevent out-of-band backtrack 2017-07-29 23:52:30 -04:00
Heng Li fa99d28d34 r228: reduced unnecessary INV alignment 2017-07-29 20:21:53 -04:00
Heng Li d08b7a0c51 r227: use local alignment for INV alignment 2017-07-29 17:40:53 -04:00
Heng Li da3db3c095 r226: only try inv alignment for primary 2017-07-29 14:09:35 -04:00
Heng Li 783ead6f47 r225: removed a debugging line 2017-07-29 13:21:38 -04:00
Heng Li 19d6ec885e r224: inversion alignment around Z-drop break 2017-07-29 13:09:10 -04:00
Heng Li 120bebc290 ake 2017-07-29 11:01:49 -04:00
Heng Li 5e3eecd6d4 r222: no effective changes 2017-07-29 10:31:46 -04:00
Heng Li 2179e9e24b r221: output SA in the SAM output 2017-07-28 23:08:39 -04:00
Heng Li 84922cfe41 clarify that wrong seeding mainly occurs in LCRs 2017-07-28 14:33:15 -04:00
Heng Li ebbe9c1eb8 r219: fixed a bug caused by skipping tandem seeds 2017-07-28 14:06:56 -04:00
Heng Li c672690564 r218: increase the frequency of SW slightly 2017-07-28 13:30:42 -04:00
Heng Li f4fee60188 r217: ignore tandem seeds during alignment
This helps a tiny bit.
2017-07-28 12:26:56 -04:00
Heng Li 254280b8af r216: a bit cleanup; identical output to r215 2017-07-28 11:54:18 -04:00
Heng Li fc965805f7 r215: bring back a log gap component
Otherwise chaining may more often break a long gap into several gaps.
2017-07-28 00:17:19 -04:00
Heng Li 667b32a516 added algorithm overview 2017-07-27 18:50:39 -04:00
Heng Li 2c79580649 r213: more careful solution to wrong seeds
a little better, but not good enough!
2017-07-27 13:19:11 -04:00
Heng Li b927838495 r212: better heuristic to fix wrong seeding
but not good enough. Will explore more.
2017-07-27 11:24:51 -04:00
Heng Li 371e20cc7c r211: a better heurstic to reduce false seeds 2017-07-26 23:56:38 -04:00
Heng Li 8b08a2ec41 added first-only and all-primary modes to eval 2017-07-26 19:32:26 -04:00
Heng Li 9f728dd96a tunable overlap ratio 2017-07-26 18:30:29 -04:00
Heng Li 323293fbda changed the way mapq is counted 2017-07-26 14:20:31 -04:00
Heng Li bd33bed455 make output better 2017-07-26 12:03:42 -04:00
Heng Li a01d758af6 r206: mapq penalize short chains further
The old code penalized at the log() scale. Now added a linear-scaled factor. If
the chain consists of few minimizers, its quality is really not good.
2017-07-26 11:50:04 -04:00
Heng Li e9dc1ce2b6 r205: when computing mapq, consider min_chain_sc
Not doing this was a mistake.
2017-07-26 11:34:14 -04:00
Heng Li a8ad53ee81 evaluating read mapping for pbsim2fa reads
More functionality to be added later
2017-07-26 11:17:34 -04:00
Heng Li 00c6db5073 r203: check more subopt aln if score small 2017-07-25 20:02:44 -04:00
Heng Li f2ef48878a r202: trim bad chain ends before extension
This fixes a few more FP long INDELs towards the end of alignments.
2017-07-25 19:53:19 -04:00
Heng Li 21ca564112 r201: fixed a minor chaining issue
Chaining looked at the end of a chain, but the end may not be the best. We now
go back to find the max.
2017-07-25 18:26:51 -04:00
Heng Li 215e92ed7b r200: reduce long gaps in chaining
Every seed can initiate a chain.
2017-07-25 17:32:54 -04:00
Heng Li b530ade333 r199: changed to linear gap cost for chaining
The old cost doesn't penalize long gaps enough. Will also drop seeds close to
the edge in the next commit.
2017-07-25 15:35:10 -04:00
Heng Li 4bd7ebc39c convert pbsim .maf to fasta 2017-07-25 13:54:58 -04:00
Heng Li f81f37fef1 r197: allocate index seq names from kalloc
to reduce malloc() overhead.
2017-07-24 19:36:05 -04:00
46 changed files with 6484 additions and 310 deletions
+5
View File
@@ -0,0 +1,5 @@
language: c
compiler:
- gcc
- clang
script: make
+5 -3
View File
@@ -2,8 +2,8 @@ CC= gcc
CFLAGS= -g -Wall -O2 -Wc++-compat CFLAGS= -g -Wall -O2 -Wc++-compat
CPPFLAGS= -DHAVE_KALLOC CPPFLAGS= -DHAVE_KALLOC
INCLUDES= -I. INCLUDES= -I.
OBJS= kthread.o kalloc.o ksw2_extz2_sse.o ksw2_extd2_sse.o misc.o bseq.o \ OBJS= kthread.o kalloc.o ksw2_extz2_sse.o ksw2_extd2_sse.o ksw2_exts2_sse.o ksw2_ll_sse.o \
sketch.o sdust.o index.o chain.o align.o hit.o map.o format.o misc.o bseq.o sketch.o sdust.o index.o chain.o align.o hit.o map.o format.o
PROG= minimap2 PROG= minimap2
PROG_EXTRA= sdust minimap2-lite PROG_EXTRA= sdust minimap2-lite
LIBS= -lm -lz -lpthread LIBS= -lm -lz -lpthread
@@ -45,12 +45,14 @@ align.o: minimap.h mmpriv.h bseq.h ksw2.h kalloc.h
bseq.o: bseq.h kseq.h bseq.o: bseq.h kseq.h
chain.o: minimap.h mmpriv.h bseq.h kalloc.h chain.o: minimap.h mmpriv.h bseq.h kalloc.h
example.o: minimap.h kseq.h example.o: minimap.h kseq.h
format.o: mmpriv.h minimap.h bseq.h format.o: kalloc.h mmpriv.h minimap.h bseq.h
hit.o: mmpriv.h minimap.h bseq.h kalloc.h hit.o: mmpriv.h minimap.h bseq.h kalloc.h
index.o: kthread.h bseq.h minimap.h mmpriv.h kvec.h kalloc.h khash.h index.o: kthread.h bseq.h minimap.h mmpriv.h kvec.h kalloc.h khash.h
kalloc.o: kalloc.h kalloc.o: kalloc.h
ksw2_extd2_sse.o: ksw2.h kalloc.h ksw2_extd2_sse.o: ksw2.h kalloc.h
ksw2_exts2_sse.o: ksw2.h kalloc.h
ksw2_extz2_sse.o: ksw2.h kalloc.h ksw2_extz2_sse.o: ksw2.h kalloc.h
ksw2_ll_sse.o: ksw2.h kalloc.h
main.o: bseq.h minimap.h mmpriv.h main.o: bseq.h minimap.h mmpriv.h
map.o: kthread.h kvec.h kalloc.h sdust.h mmpriv.h minimap.h bseq.h map.o: kthread.h kvec.h kalloc.h sdust.h mmpriv.h minimap.h bseq.h
misc.o: minimap.h ksort.h misc.o: minimap.h ksort.h
+72
View File
@@ -0,0 +1,72 @@
Release 2.1-r311 (25 August 2017)
---------------------------------
This release adds spliced alignment for long noisy RNA-seq reads. On a SMRT
Iso-Seq and a Oxford Nanopore data sets, minimap2 appears to outperform
traditional mRNA aligners. For DNA alignment, this release gives almost
identical output to v2.0. Other changes include:
* Added option `-R` to set the read group header line in SAM.
* Optionally output the `cs:Z` tag in PAF to encode both the query and the
reference sequences in the alignment.
* Fixed an issue where DP alignment uses excessive memory.
The minimap2 technical report has been updated with more details and the
evaluation of spliced alignment:
* Li, H. (2017). Minimap2: fast pairwise alignment for long nucleotide
sequences. [arXiv:1708.01492v2](https://arxiv.org/abs/1708.01492v2).
(2.1: 25 August 2017, r311)
Release 2.0-r275 (8 August 2017)
--------------------------------
This release is identical to version 2.0rc1, except the version number. It is
described and evaluated in the following technical report:
* Li, H. (2017). Minimap2: fast pairwise alignment for long DNA sequences.
[arXiv:1708.01492v1](https://arxiv.org/abs/1708.01492v1).
(2.0: 8 August 2017, r275)
Release 2.0rc1-r232 (30 July 2017)
----------------------------------
This release improves the accuracy of long-read alignment and added several
minor features.
* Improved mapping quality estimate for short alignments containing few seed
hits.
* Fixed a minor bug that affects the chaining accuracy towards the ends of a
chain. Changed the gap cost for chaining to reduce false seeding.
* Skip potentially wrong seeding and apply dynamic programming more frequently.
This slightly increases run time, but greatly reduces false long gaps.
* Perform local alignment at Z-drop break point to recover potential inversion
alignment. Output the SA tag in the SAM format. Added scripts to evaluate
mapping accuracy for reads simulated with pbsim.
This release completes features intended for v2.0. No major features will be
added to the master branch before the final v2.0.
(2.0rc1: 30 July 2017, r232)
Release r191 (19 July 2017)
---------------------------
This is the first public release of minimap2, an aligner for long reads and
assemblies. This release has a few issues and is generally not recommended for
production uses.
(19 July 2017, r191)
+55 -9
View File
@@ -1,3 +1,4 @@
[![Build Status](https://travis-ci.org/lh3/minimap2.svg?branch=master)](https://travis-ci.org/lh3/minimap2)
## Getting Started ## Getting Started
```sh ```sh
git clone https://github.com/lh3/minimap2 git clone https://github.com/lh3/minimap2
@@ -31,6 +32,10 @@ and [longISLND][longislnd]), better chaining and the ability to produce CIGAR
with fast extension alignment (see also [libgaba][gaba] and [ksw2][ksw2]) and with fast extension alignment (see also [libgaba][gaba] and [ksw2][ksw2]) and
piece-wise affine gap cost. piece-wise affine gap cost.
If you use minimap2 in your work, please consider to cite:
> Li, H. (2017). Minimap2: fast pairwise alignment for long DNA sequences. [arXiv:1708.01492](https://arxiv.org/abs/1708.01492).
## Installation ## Installation
For modern x86-64 CPUs, just type `make` in the source code directory. This For modern x86-64 CPUs, just type `make` in the source code directory. This
@@ -40,23 +45,64 @@ will run a little slower. At present, minimap2 does not work with non-x86 CPUs
or ancient CPUs that do not support SSE2. SSE2 is critical to the performance or ancient CPUs that do not support SSE2. SSE2 is critical to the performance
of minimap2. of minimap2.
## Algorithm Overview
In the following, minimap2 command line options have a dash ahead and are
highlighted in bold.
1. Read **-I** [=*4G*] reference bases, extract (**-k**,**-w**)-minimizers and
index them in a hash table.
2. Read **-K** [=*200M*] query bases. For each query sequence, do step 3
through 7:
3. For each (**-k**,**-w**)-minimizer on the query, check against the reference
index. If a reference minimizer is not among the top **-f** [=*2e-4*] most
frequent, collect its the occurrences in the reference, which are called
*seeds*.
4. Sort seeds by position in the reference. Chain them with dynamic
programming. Each chain represents a potential mapping. For read
overlapping, report all chains and then go to step 8. For reference mapping,
do step 5 through 7:
5. Let *P* be the set of primary mappings, which is an empty set initially. For
each chain from the best to the worst according to their chaining scores: if
on the query, the chain overlaps with a chain in *P* by **--mask-level**
[=*0.5*] or higher fraction of the shorter chain, mark the chain as
*secondary* to the chain in *P*; otherwise, add the chain to *P*.
6. Retain all primary mappings. Also retain up to **-N** [=*5*] top secondary
mappings if their chaining scores are higher than **-p** [=*0.8*] of their
corresponding primary mappings.
7. If alignment is requested, filter out an internal seed if it potentially
leads to both a long insertion and a long deletion. Extend from the
left-most seed. Perform global alignments between internal seeds. Split the
chain if the accumulative score along the global alignment drops by **-z**
[=*400*], disregarding long gaps. Extend from the right-most seed. Output
chains and their alignments.
8. If there are more query sequences in the input, go to step 2 until no more
queries are left.
9. If there are more reference sequences, reopen the query file from the start
and go to step 1; otherwise stop.
## Limitations ## Limitations
* At the alignment phase, minimap2 performs global alignments between minimizer * Minimap2 may produce suboptimal alignments through long low-complexity
hits. If the positions of these minimizer hits are incorrect, the final regions where seed positions may be suboptimal. This should not be a big
alignment may be suboptimal or unnecessarily fragmented. concern because even the optimal alignment may be wrong in such regions.
* Minimap2 may produce poor alignments that may need post-filtering. We are
still exploring a reliable and consistent way to report good alignments.
* Minimap2 does not work well with Illumina short reads as of now. * Minimap2 does not work well with Illumina short reads as of now.
* Minimap2 requires SSE2 instructions to compile. It is possible to add * Minimap2 requires SSE2 instructions to compile. It is possible to add
non-SSE2 support, but it would make minimap2 slower by several times. non-SSE2 support, but it would make minimap2 slower by several times.
In general, minimap2 is a young project with most code written since June, In general, minimap2 is a young project with most code written since June, 2017.
2017. It may have bugs and room for improvements. Bug reports and suggestions It may have bugs and room for improvements. Bug reports and suggestions are
are warmly welcomed. warmly welcomed.
+213 -50
View File
@@ -53,7 +53,7 @@ static int mm_check_zdrop(const uint8_t *qseq, const uint8_t *tseq, uint32_t n_c
} else if (op == 1) { } else if (op == 1) {
score -= q + e * len, j += len; score -= q + e * len, j += len;
if (test_zdrop_aux(score, i, j, &max, &max_i, &max_j, e, zdrop)) return 1; if (test_zdrop_aux(score, i, j, &max, &max_i, &max_j, e, zdrop)) return 1;
} else if (op == 2) { } else if (op == 2 || op == 3) {
score -= q + e * len, i += len; score -= q + e * len, i += len;
if (test_zdrop_aux(score, i, j, &max, &max_i, &max_j, e, zdrop)) return 1; if (test_zdrop_aux(score, i, j, &max, &max_i, &max_j, e, zdrop)) return 1;
} }
@@ -64,11 +64,11 @@ static int mm_check_zdrop(const uint8_t *qseq, const uint8_t *tseq, uint32_t n_c
static void mm_update_extra(mm_extra_t *p, const uint8_t *qseq, const uint8_t *tseq, const int8_t *mat, int8_t q, int8_t e) static void mm_update_extra(mm_extra_t *p, const uint8_t *qseq, const uint8_t *tseq, const int8_t *mat, int8_t q, int8_t e)
{ {
uint32_t k, l, toff = 0, qoff = 0; uint32_t k, l, toff = 0, qoff = 0;
int32_t s = 0, max = 0; int32_t s = 0, max = 0, n_gtag = 0, n_ctac = 0;
if (p == 0) return; if (p == 0) return;
for (k = 0; k < p->n_cigar; ++k) { for (k = 0; k < p->n_cigar; ++k) {
uint32_t op = p->cigar[k]&0xf, len = p->cigar[k]>>4; uint32_t op = p->cigar[k]&0xf, len = p->cigar[k]>>4;
if (op == 0) { if (op == 0) { // match/mismatch
for (l = 0; l < len; ++l) { for (l = 0; l < len; ++l) {
int cq = qseq[qoff + l], ct = tseq[toff + l]; int cq = qseq[qoff + l], ct = tseq[toff + l];
if (ct > 3 || cq > 3) ++p->n_ambi; if (ct > 3 || cq > 3) ++p->n_ambi;
@@ -78,7 +78,7 @@ static void mm_update_extra(mm_extra_t *p, const uint8_t *qseq, const uint8_t *t
else max = max > s? max : s; else max = max > s? max : s;
} }
toff += len, qoff += len, p->blen += len; toff += len, qoff += len, p->blen += len;
} else if (op == 1) { } else if (op == 1) { // insertion
int n_ambi = 0; int n_ambi = 0;
for (l = 0; l < len; ++l) for (l = 0; l < len; ++l)
if (qseq[qoff + l] > 3) ++n_ambi; if (qseq[qoff + l] > 3) ++n_ambi;
@@ -86,7 +86,7 @@ static void mm_update_extra(mm_extra_t *p, const uint8_t *qseq, const uint8_t *t
p->n_ambi += n_ambi, p->n_diff += len - n_ambi; p->n_ambi += n_ambi, p->n_diff += len - n_ambi;
s -= q + e * len; s -= q + e * len;
if (s < 0) s = 0; if (s < 0) s = 0;
} else if (op == 2) { } else if (op == 2) { // deletion
int n_ambi = 0; int n_ambi = 0;
for (l = 0; l < len; ++l) for (l = 0; l < len; ++l)
if (tseq[toff + l] > 3) ++n_ambi; if (tseq[toff + l] > 3) ++n_ambi;
@@ -94,9 +94,18 @@ static void mm_update_extra(mm_extra_t *p, const uint8_t *qseq, const uint8_t *t
p->n_ambi += n_ambi, p->n_diff += len - n_ambi; p->n_ambi += n_ambi, p->n_diff += len - n_ambi;
s -= q + e * len; s -= q + e * len;
if (s < 0) s = 0; if (s < 0) s = 0;
} else if (op == 3) { // intron
uint8_t b[4];
b[0] = tseq[toff], b[1] = tseq[toff+1];
b[2] = tseq[toff+len-2], b[3] = tseq[toff+len-1];
if (memcmp(b, "\2\3\0\2", 4) == 0) ++n_gtag;
else if (memcmp(b, "\1\3\0\1", 4) == 0) ++n_ctac;
toff += len, p->blen += len;
} }
} }
p->dp_max = max; p->dp_max = max;
if (n_gtag > n_ctac) p->trans_strand = 1;
else if (n_gtag < n_ctac) p->trans_strand = 2;
} }
static void mm_append_cigar(mm_reg1_t *r, uint32_t n_cigar, uint32_t *cigar) // TODO: this calls the libc realloc() static void mm_append_cigar(mm_reg1_t *r, uint32_t n_cigar, uint32_t *cigar) // TODO: this calls the libc realloc()
@@ -126,7 +135,15 @@ static void mm_append_cigar(mm_reg1_t *r, uint32_t n_cigar, uint32_t *cigar) //
static void mm_align_pair(void *km, const mm_mapopt_t *opt, int qlen, const uint8_t *qseq, int tlen, const uint8_t *tseq, const int8_t *mat, int w, int flag, ksw_extz_t *ez) static void mm_align_pair(void *km, const mm_mapopt_t *opt, int qlen, const uint8_t *qseq, int tlen, const uint8_t *tseq, const int8_t *mat, int w, int flag, ksw_extz_t *ez)
{ {
if (opt->q == opt->q2 && opt->e == opt->e2) if (mm_dbg_flag & MM_DBG_PRINT_ALN_SEQ) {
int i;
fprintf(stderr, "===> q=(%d,%d), e=(%d,%d), bw=%d, flag=%d, zdrop=%d <===\n", opt->q, opt->q2, opt->e, opt->e2, w, flag, opt->zdrop);
for (i = 0; i < tlen; ++i) fputc("ACGTN"[tseq[i]], stderr); fputc('\n', stderr);
for (i = 0; i < qlen; ++i) fputc("ACGTN"[qseq[i]], stderr); fputc('\n', stderr);
}
if (opt->flag & MM_F_SPLICE)
ksw_exts2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->noncan, opt->zdrop, flag, ez);
else if (opt->q == opt->q2 && opt->e == opt->e2)
ksw_extz2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, w, opt->zdrop, flag, ez); ksw_extz2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, w, opt->zdrop, flag, ez);
else else
ksw_extd2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->e2, w, opt->zdrop, flag, ez); ksw_extd2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->e2, w, opt->zdrop, flag, ez);
@@ -153,34 +170,92 @@ static inline void mm_adjust_minier(const mm_idx_t *mi, uint8_t *const qseq0[2],
c = mm_get_hplen_back(mi, a->x<<1>>33, (int32_t)a->x); c = mm_get_hplen_back(mi, a->x<<1>>33, (int32_t)a->x);
*r = (int32_t)a->x + 1 - c; *r = (int32_t)a->x + 1 - c;
} else { } else {
*r = (int32_t)a->x + 1; *r = (int32_t)a->x - (mi->k>>1);
*q = (int32_t)a->y + 1; *q = (int32_t)a->y - (mi->k>>1);
} }
} }
static void mm_filter_bad_seeds(int n, mm128_t *a, int max_space, int max_diff) static void mm_filter_bad_seeds(void *km, int as1, int cnt1, mm128_t *a, int min_gap, int diff_thres, int max_ext_len, int max_ext_cnt)
{ {
int i; int max_st, max_en, n, i, k, max, *K;
if (n < 3) return; for (i = 1, n = 0; i < cnt1; ++i) { // count the number of gaps longer than min_gap
for (i = 0; i < n - 2; ++i) { int gap = ((int32_t)a[as1 + i].y - a[as1 + i - 1].y) - ((int32_t)a[as1 + i].x - a[as1 + i - 1].x);
int32_t q[3], t[3], gap01, gap12, gap02; if (gap < -min_gap || gap > min_gap) ++n;
t[0] = (int32_t)a[i].x, q[0] = (int32_t)a[i].y; }
t[1] = (int32_t)a[i+1].x, q[1] = (int32_t)a[i+1].y; if (n <= 1) return;
t[2] = (int32_t)a[i+2].x, q[2] = (int32_t)a[i+2].y; K = (int*)kmalloc(km, n * sizeof(int));
if (t[2] - t[0] > max_space || q[2] - q[0] > max_space) continue; for (i = 1, n = 0; i < cnt1; ++i) { // store the positions of long gaps
gap01 = (t[1] - t[0]) - (q[1] - q[0]), gap01 = gap01 > 0? gap01 : -gap01; int gap = ((int32_t)a[as1 + i].y - a[as1 + i - 1].y) - ((int32_t)a[as1 + i].x - a[as1 + i - 1].x);
gap12 = (t[2] - t[1]) - (q[2] - q[1]), gap12 = gap12 > 0? gap12 : -gap12; if (gap < -min_gap || gap > min_gap)
gap02 = (t[2] - t[0]) - (q[2] - q[0]), gap02 = gap02 > 0? gap02 : -gap02; K[n++] = i;
if (gap01 + gap12 - gap02 > max_diff) }
a[++i].y |= 1ULL << 41; max = 0, max_st = max_en = -1;
for (k = 0;; ++k) { // traverse long gaps
int gap, l, n_ins = 0, n_del = 0, qs, rs, max_diff = 0, max_diff_l = -1;
if (k == n || k >= max_en) {
if (max_en > 0)
for (i = K[max_st]; i < K[max_en]; ++i)
a[as1 + i].y |= MM_SEED_IGNORE;
max = 0, max_st = max_en = -1;
if (k == n) break;
}
i = K[k];
gap = ((int32_t)a[as1 + i].y - a[as1 + i - 1].y) - ((int32_t)a[as1 + i].x - a[as1 + i - 1].x);
if (gap > 0) n_ins += gap;
else n_del += -gap;
qs = (int32_t)a[as1 + i - 1].y;
rs = (int32_t)a[as1 + i - 1].x;
for (l = k + 1; l < n && l <= k + max_ext_cnt; ++l) {
int j = K[l], diff;
if ((int32_t)a[as1 + j].y - qs > max_ext_len || (int32_t)a[as1 + j].x - rs > max_ext_len) break;
gap = ((int32_t)a[as1 + j].y - (int32_t)a[as1 + j - 1].y) - (a[as1 + j].x - a[as1 + j - 1].x);
if (gap > 0) n_ins += gap;
else n_del += -gap;
diff = n_ins + n_del - abs(n_ins - n_del);
if (max_diff < diff)
max_diff = diff, max_diff_l = l;
}
if (max_diff > diff_thres && max_diff > max)
max = max_diff, max_st = k, max_en = max_diff_l;
}
kfree(km, K);
}
static void mm_fix_bad_ends(const mm_reg1_t *r, const mm128_t *a, int bw, int32_t *as, int32_t *cnt)
{
int32_t i, l;
*as = r->as, *cnt = r->cnt;
if (r->cnt < 3) return;
l = a[r->as].y >> 32 & 0xff;
for (i = r->as + 1; i < r->as + r->cnt - 1; ++i) {
int32_t lq, lr, min, max;
lr = (int32_t)a[i].x - (int32_t)a[i-1].x;
lq = (int32_t)a[i].y - (int32_t)a[i-1].y;
min = lr < lq? lr : lq;
max = lr > lq? lr : lq;
if (max - min > l >> 1) *as = i;
l += min;
if (l >= bw << 1) break;
}
*cnt = r->as + r->cnt - *as;
l = a[r->as + r->cnt - 1].y >> 32 & 0xff;
for (i = r->as + r->cnt - 2; i > *as; --i) {
int32_t lq, lr, min, max;
lr = (int32_t)a[i+1].x - (int32_t)a[i].x;
lq = (int32_t)a[i+1].y - (int32_t)a[i].y;
min = lr < lq? lr : lq;
max = lr > lq? lr : lq;
if (max - min > l >> 1) *cnt = i + 1 - *as;
l += min;
if (l >= bw) break;
} }
} }
static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, uint8_t *qseq0[2], mm_reg1_t *r, mm_reg1_t *r2, mm128_t *a, ksw_extz_t *ez) static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, uint8_t *qseq0[2], mm_reg1_t *r, mm_reg1_t *r2, mm128_t *a, ksw_extz_t *ez, int splice_flag)
{ {
int32_t rid = a[r->as].x<<1>>33, rev = a[r->as].x>>63; int32_t rid = a[r->as].x<<1>>33, rev = a[r->as].x>>63, as1, cnt1;
uint8_t *tseq, *qseq; uint8_t *tseq, *qseq;
int32_t i, l, bw, dropped = 0, rs0, re0, qs0, qe0; int32_t i, l, bw, dropped = 0, extra_flag = 0, rs0, re0, qs0, qe0;
int32_t rs, re, qs, qe; int32_t rs, re, qs, qe;
int32_t rs1, qs1, re1, qe1; int32_t rs1, qs1, re1, qe1;
int8_t mat[25]; int8_t mat[25];
@@ -190,13 +265,22 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
bw = (int)(opt->bw * 1.5 + 1.); bw = (int)(opt->bw * 1.5 + 1.);
r2->cnt = 0; r2->cnt = 0;
mm_adjust_minier(mi, qseq0, &a[r->as], &rs, &qs); if (!(opt->flag & MM_F_SPLICE))
mm_adjust_minier(mi, qseq0, &a[r->as + r->cnt - 1], &re, &qe); mm_fix_bad_ends(r, a, opt->bw, &as1, &cnt1);
mm_filter_bad_seeds(r->cnt, &a[r->as], opt->max_gap, 100); else as1 = r->as, cnt1 = r->cnt;
mm_filter_bad_seeds(km, as1, cnt1, a, 10, 40, opt->max_gap>>1, 10);
mm_adjust_minier(mi, qseq0, &a[as1], &rs, &qs);
mm_adjust_minier(mi, qseq0, &a[as1 + cnt1 - 1], &re, &qe);
if (opt->flag & MM_F_SPLICE) {
if (splice_flag & MM_F_SPLICE_FOR) extra_flag |= rev? KSW_EZ_SPLICE_REV : KSW_EZ_SPLICE_FOR;
if (splice_flag & MM_F_SPLICE_REV) extra_flag |= rev? KSW_EZ_SPLICE_FOR : KSW_EZ_SPLICE_REV;
if (splice_flag & MM_F_SPLICE_BOTH) extra_flag |= KSW_EZ_SPLICE_FOR|KSW_EZ_SPLICE_REV;
}
// compute rs0 and qs0 // compute rs0 and qs0
if (r->split && r->as > 0) { if (r->split && as1 > 0) {
mm_adjust_minier(mi, qseq0, &a[r->as-1], &rs0, &qs0); mm_adjust_minier(mi, qseq0, &a[as1-1], &rs0, &qs0);
} else { } else {
if (qs > 0 && rs > 0) { // actually this is always true if (qs > 0 && rs > 0) { // actually this is always true
l = qs < opt->max_gap? qs : opt->max_gap; l = qs < opt->max_gap? qs : opt->max_gap;
@@ -226,7 +310,7 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
mm_idx_getseq(mi, rid, rs0, rs, tseq); mm_idx_getseq(mi, rid, rs0, rs, tseq);
mm_seq_rev(qs - qs0, qseq); mm_seq_rev(qs - qs0, qseq);
mm_seq_rev(rs - rs0, tseq); mm_seq_rev(rs - rs0, tseq);
mm_align_pair(km, opt, qs - qs0, qseq, rs - rs0, tseq, mat, bw, KSW_EZ_EXTZ_ONLY|KSW_EZ_RIGHT|KSW_EZ_REV_CIGAR, ez); mm_align_pair(km, opt, qs - qs0, qseq, rs - rs0, tseq, mat, bw, extra_flag|KSW_EZ_EXTZ_ONLY|KSW_EZ_RIGHT|KSW_EZ_REV_CIGAR, ez);
if (ez->n_cigar > 0) { if (ez->n_cigar > 0) {
mm_append_cigar(r, ez->n_cigar, ez->cigar); mm_append_cigar(r, ez->n_cigar, ez->cigar);
r->p->dp_score += ez->max; r->p->dp_score += ez->max;
@@ -238,31 +322,31 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
re1 = rs, qe1 = qs; re1 = rs, qe1 = qs;
assert(qs1 >= 0 && rs1 >= 0); assert(qs1 >= 0 && rs1 >= 0);
for (i = 1; i < r->cnt; ++i) { // gap filling for (i = 1; i < cnt1; ++i) { // gap filling
if (a[r->as+i].y>>41&1) continue; if ((a[as1+i].y & (MM_SEED_IGNORE|MM_SEED_TANDEM)) && i != cnt1 - 1) continue;
mm_adjust_minier(mi, qseq0, &a[r->as + i], &re, &qe); mm_adjust_minier(mi, qseq0, &a[as1 + i], &re, &qe);
re1 = re, qe1 = qe; re1 = re, qe1 = qe;
if (i == r->cnt - 1 || (a[r->as+i].y>>40&1) || qe - qs >= opt->min_ksw_len || re - rs >= opt->min_ksw_len) { if (i == cnt1 - 1 || (a[as1+i].y&MM_SEED_LONG_JOIN) || (qe - qs >= opt->min_ksw_len && re - rs >= opt->min_ksw_len)) {
int bw1 = bw; int bw1 = bw;
if (a[r->as+i].y>>40&1) if (a[as1+i].y & MM_SEED_LONG_JOIN)
bw1 = qe - qs > re - rs? qe - qs : re - rs; bw1 = qe - qs > re - rs? qe - qs : re - rs;
qseq = &qseq0[rev][qs]; qseq = &qseq0[rev][qs];
mm_idx_getseq(mi, rid, rs, re, tseq); mm_idx_getseq(mi, rid, rs, re, tseq);
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, mat, bw1, KSW_EZ_APPROX_MAX, ez); mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, mat, bw1, extra_flag|KSW_EZ_APPROX_MAX, ez);
if (mm_check_zdrop(qseq, tseq, ez->n_cigar, ez->cigar, mat, opt->q, opt->e, opt->zdrop)) if (mm_check_zdrop(qseq, tseq, ez->n_cigar, ez->cigar, mat, opt->q, opt->e, opt->zdrop))
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, mat, bw1, 0, ez); mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, mat, bw1, extra_flag, ez);
if (ez->n_cigar > 0) if (ez->n_cigar > 0)
mm_append_cigar(r, ez->n_cigar, ez->cigar); mm_append_cigar(r, ez->n_cigar, ez->cigar);
if (ez->zdropped) { // truncated by Z-drop; TODO: sometimes Z-drop kicks in because the next seed placement is wrong. This can be fixed in principle. if (ez->zdropped) { // truncated by Z-drop; TODO: sometimes Z-drop kicks in because the next seed placement is wrong. This can be fixed in principle.
int j; int j;
for (j = i - 1; j >= 0; --j) for (j = i - 1; j >= 0; --j)
if ((int32_t)a[r->as + j].x < re + ez->max_t) if ((int32_t)a[as1 + j].x < re + ez->max_t)
break; break;
dropped = 1; dropped = 1;
r->p->dp_score += ez->max; r->p->dp_score += ez->max;
re1 = rs + (ez->max_t + 1); re1 = rs + (ez->max_t + 1);
qe1 = qs + (ez->max_q + 1); qe1 = qs + (ez->max_q + 1);
if (r->cnt - (j + 1) >= opt->min_cnt) if (cnt1 - (j + 1) >= opt->min_cnt)
mm_split_reg(r, r2, j + 1, qlen, a); mm_split_reg(r, r2, j + 1, qlen, a);
break; break;
} else r->p->dp_score += ez->score; } else r->p->dp_score += ez->score;
@@ -273,7 +357,7 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
if (!dropped && qe < qe0 && re < re0) { // right extension if (!dropped && qe < qe0 && re < re0) { // right extension
qseq = &qseq0[rev][qe]; qseq = &qseq0[rev][qe];
mm_idx_getseq(mi, rid, re, re0, tseq); mm_idx_getseq(mi, rid, re, re0, tseq);
mm_align_pair(km, opt, qe0 - qe, qseq, re0 - re, tseq, mat, bw, KSW_EZ_EXTZ_ONLY, ez); mm_align_pair(km, opt, qe0 - qe, qseq, re0 - re, tseq, mat, bw, extra_flag|KSW_EZ_EXTZ_ONLY, ez);
if (ez->n_cigar > 0) { if (ez->n_cigar > 0) {
mm_append_cigar(r, ez->n_cigar, ez->cigar); mm_append_cigar(r, ez->n_cigar, ez->cigar);
r->p->dp_score += ez->max; r->p->dp_score += ez->max;
@@ -291,15 +375,75 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
if (r->p) { if (r->p) {
mm_idx_getseq(mi, rid, rs1, re1, tseq); mm_idx_getseq(mi, rid, rs1, re1, tseq);
mm_update_extra(r->p, &qseq0[r->rev][qs1], tseq, mat, opt->q, opt->e); mm_update_extra(r->p, &qseq0[r->rev][qs1], tseq, mat, opt->q, opt->e);
if (rev && r->p->trans_strand)
r->p->trans_strand ^= 3; // flip to the read strand
} }
kfree(km, tseq); kfree(km, tseq);
} }
static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, uint8_t *qseq0[2], const mm_reg1_t *r1, const mm_reg1_t *r2, mm_reg1_t *r_inv, ksw_extz_t *ez)
{
int tl, ql, score, ret = 0, q_off, t_off;
uint8_t *tseq, *qseq;
int8_t mat[25];
void *qp;
memset(r_inv, 0, sizeof(mm_reg1_t));
if (!(r1->split&1) || !(r2->split&2)) return 0;
if (r1->id != r1->parent && r1->parent != MM_PARENT_TMP_PRI) return 0;
if (r2->id != r2->parent && r2->parent != MM_PARENT_TMP_PRI) return 0;
if (r1->rid != r2->rid || r1->rev != r2->rev) return 0;
ql = r2->qs - r1->qe;
tl = r2->rs - r1->re;
if (ql < opt->min_chain_score || ql > opt->max_gap) return 0;
if (tl < opt->min_chain_score || tl > opt->max_gap) return 0;
ksw_gen_simple_mat(5, mat, opt->a, opt->b);
tseq = (uint8_t*)kmalloc(km, tl);
mm_idx_getseq(mi, r1->rid, r1->re, r2->rs, tseq);
qseq = &qseq0[!r1->rev][qlen - r2->qs];
mm_seq_rev(ql, qseq);
mm_seq_rev(tl, tseq);
qp = ksw_ll_qinit(km, 2, ql, qseq, 5, mat);
score = ksw_ll_i16(qp, tl, tseq, opt->q, opt->e, &q_off, &t_off);
kfree(km, qp);
mm_seq_rev(ql, qseq);
mm_seq_rev(tl, tseq);
if (score < opt->min_dp_max) goto end_align1_inv;
q_off = ql - (q_off + 1), t_off = tl - (t_off + 1);
mm_align_pair(km, opt, ql - q_off, qseq + q_off, tl - t_off, tseq + t_off, mat, (int)(opt->bw * 1.5), KSW_EZ_EXTZ_ONLY, ez);
if (ez->n_cigar == 0) goto end_align1_inv; // should never be here
mm_append_cigar(r_inv, ez->n_cigar, ez->cigar);
r_inv->p->dp_score = ez->max;
mm_update_extra(r_inv->p, qseq + q_off, tseq + t_off, mat, opt->q, opt->e);
r_inv->id = -1;
r_inv->parent = MM_PARENT_UNSET;
r_inv->inv = 1;
r_inv->rev = !r1->rev;
r_inv->qs = r1->qe + q_off, r_inv->qe = r_inv->qs + ez->max_q + 1;
r_inv->rs = r1->re + t_off, r_inv->re = r_inv->rs + ez->max_t + 1;
ret = 1;
end_align1_inv:
kfree(km, tseq);
return ret;
}
static inline mm_reg1_t *mm_insert_reg(const mm_reg1_t *r, int i, int *n_regs, mm_reg1_t *regs)
{
regs = (mm_reg1_t*)realloc(regs, (*n_regs + 1) * sizeof(mm_reg1_t));
if (i + 1 != *n_regs)
memmove(&regs[i + 2], &regs[i + 1], sizeof(mm_reg1_t) * (*n_regs - i - 1));
regs[i + 1] = *r;
++*n_regs;
return regs;
}
mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a) mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a)
{ {
extern unsigned char seq_nt4_table[256]; extern unsigned char seq_nt4_table[256];
int32_t i, r, n_regs = *n_regs_; int32_t i, n_regs = *n_regs_;
uint8_t *qseq0[2]; uint8_t *qseq0[2];
ksw_extz_t ez; ksw_extz_t ez;
@@ -313,15 +457,34 @@ mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *m
// align through seed hits // align through seed hits
memset(&ez, 0, sizeof(ksw_extz_t)); memset(&ez, 0, sizeof(ksw_extz_t));
for (r = 0; r < n_regs; ++r) { for (i = 0; i < n_regs; ++i) {
mm_reg1_t r2; mm_reg1_t r2;
mm_align1(km, opt, mi, qlen, qseq0, &regs[r], &r2, a, &ez); if ((opt->flag&MM_F_SPLICE) && (opt->flag&MM_F_SPLICE_FOR) && (opt->flag&MM_F_SPLICE_REV)) {
if (r2.cnt > 0) { mm_reg1_t s[2], s2[2];
regs = (mm_reg1_t*)realloc(regs, (n_regs + 1) * sizeof(mm_reg1_t)); // this should be very rare int which, trans_strand;
if (r + 1 != n_regs) s[0] = s[1] = regs[i];
memmove(&regs[r + 2], &regs[r + 1], sizeof(mm_reg1_t) * (n_regs - r - 1)); mm_align1(km, opt, mi, qlen, qseq0, &s[0], &s2[0], a, &ez, MM_F_SPLICE_FOR);
regs[r + 1] = r2; mm_align1(km, opt, mi, qlen, qseq0, &s[1], &s2[1], a, &ez, MM_F_SPLICE_REV);
++n_regs; if (s[0].p->dp_score > s[1].p->dp_score) which = 0, trans_strand = 1;
else if (s[0].p->dp_score < s[1].p->dp_score) which = 1, trans_strand = 2;
else trans_strand = 3, which = (qlen + s[0].p->dp_score) & 1; // randomly choose a strand, effectively
if (which == 0) {
regs[i] = s[0], r2 = s2[0];
free(s[1].p);
} else {
regs[i] = s[1], r2 = s2[1];
free(s[0].p);
}
regs[i].p->trans_strand = trans_strand;
} else {
mm_align1(km, opt, mi, qlen, qseq0, &regs[i], &r2, a, &ez, opt->flag);
if ((opt->flag&MM_F_SPLICE) && !(opt->flag&MM_F_SPLICE_BOTH))
regs[i].p->trans_strand = opt->flag&MM_F_SPLICE_FOR? 1 : 2;
}
if (r2.cnt > 0) regs = mm_insert_reg(&r2, i, &n_regs, regs);
if (i > 0 && mm_align1_inv(km, opt, mi, qlen, qseq0, &regs[i-1], &regs[i], &r2, &ez)) {
regs = mm_insert_reg(&r2, i, &n_regs, regs);
++i; // skip the inserted INV alignment
} }
} }
*n_regs_ = n_regs; *n_regs_ = n_regs;
+1 -3
View File
@@ -8,7 +8,6 @@
KSEQ_INIT(gzFile, gzread) KSEQ_INIT(gzFile, gzread)
struct mm_bseq_file_s { struct mm_bseq_file_s {
int is_eof;
gzFile fp; gzFile fp;
kseq_t *ks; kseq_t *ks;
}; };
@@ -53,12 +52,11 @@ mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int chunk_size, int with_qual, int
size += seqs[n++].l_seq; size += seqs[n++].l_seq;
if (size >= chunk_size) break; if (size >= chunk_size) break;
} }
if (size < chunk_size) fp->is_eof = 1;
*n_ = n; *n_ = n;
return seqs; return seqs;
} }
int mm_bseq_eof(mm_bseq_file_t *fp) int mm_bseq_eof(mm_bseq_file_t *fp)
{ {
return fp->is_eof; return ks_eof(fp->ks->f);
} }
+34 -20
View File
@@ -7,9 +7,9 @@
static const char LogTable256[256] = { static const char LogTable256[256] = {
#define LT(n) n, n, n, n, n, n, n, n, n, n, n, n, n, n, n, n #define LT(n) n, n, n, n, n, n, n, n, n, n, n, n, n, n, n, n
-1, 0, 1, 1, 2, 2, 2, 2, 3, 3, 3, 3, 3, 3, 3, 3, -1, 0, 1, 1, 2, 2, 2, 2, 3, 3, 3, 3, 3, 3, 3, 3,
LT(4), LT(5), LT(5), LT(6), LT(6), LT(6), LT(6), LT(4), LT(5), LT(5), LT(6), LT(6), LT(6), LT(6),
LT(7), LT(7), LT(7), LT(7), LT(7), LT(7), LT(7), LT(7) LT(7), LT(7), LT(7), LT(7), LT(7), LT(7), LT(7), LT(7)
}; };
static inline int ilog2_32(uint32_t v) static inline int ilog2_32(uint32_t v)
@@ -19,35 +19,46 @@ static inline int ilog2_32(uint32_t v)
return (t = v>>8) ? 8 + LogTable256[t] : LogTable256[v]; return (t = v>>8) ? 8 + LogTable256[t] : LogTable256[v];
} }
int mm_chain_dp(int max_dist, int bw, int max_skip, int min_cnt, int min_sc, int64_t n, mm128_t *a, uint64_t **_u, void *km) int mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int min_cnt, int min_sc, int is_cdna, int64_t n, mm128_t *a, uint64_t **_u, void *km)
{ // TODO: make sure this works when n has more than 32 bits { // TODO: make sure this works when n has more than 32 bits
int32_t st = 0, j, k, *f, *p, *t, *v, n_u, n_v; int32_t st = 0, k, *f, *p, *t, *v, n_u, n_v;
int64_t i; int64_t i, j;
uint64_t *u, *u2; uint64_t *u, *u2, sum_qspan = 0;
float avg_qspan;
mm128_t *b, *w; mm128_t *b, *w;
if (_u) *_u = 0; if (_u) *_u = 0;
f = (int32_t*)kmalloc(km, n * 4); f = (int32_t*)kmalloc(km, n * 4);
p = (int32_t*)kmalloc(km, n * 4); p = (int32_t*)kmalloc(km, n * 4);
t = (int32_t*)kmalloc(km, n * 4); t = (int32_t*)kmalloc(km, n * 4);
v = (int32_t*)kmalloc(km, n * 4);
memset(t, 0, n * 4); memset(t, 0, n * 4);
for (i = 0; i < n; ++i) sum_qspan += a[i].y>>32&0xff;
avg_qspan = (float)sum_qspan / n;
// fill the score and backtrack arrays // fill the score and backtrack arrays
for (i = 0; i < n; ++i) { for (i = 0; i < n; ++i) {
uint64_t ri = a[i].x; uint64_t ri = a[i].x;
int32_t qi = (int32_t)a[i].y, q_span = a[i].y>>32&0xff; // NB: only 8 bits of span is used!!! int32_t qi = (int32_t)a[i].y, q_span = a[i].y>>32&0xff; // NB: only 8 bits of span is used!!!
int32_t max_f = -INT32_MAX, max_j = -1, n_skip = 0, min_d; int32_t max_f = q_span, max_j = -1, n_skip = 0, min_d, max_f_past = -INT32_MAX;
while (st < i && ri - a[st].x > max_dist) ++st; while (st < i && ri - a[st].x > max_dist_x) ++st;
for (j = i - 1; j >= st; --j) { for (j = i - 1; j >= st; --j) {
int64_t dr = ri - a[j].x; int64_t dr = ri - a[j].x;
int32_t dq = qi - (int32_t)a[j].y, dd, sc; int32_t dq = qi - (int32_t)a[j].y, dd, sc;
if (dr == 0 || dq <= 0 || dq > max_dist) continue; if (dr == 0 || dq <= 0 || dq > max_dist_y) continue;
dd = dr > dq? dr - dq : dq - dr; dd = dr > dq? dr - dq : dq - dr;
if (dd > bw) continue; if (dd > bw) continue;
max_f_past = max_f_past > f[j]? max_f_past : f[j];
min_d = dq < dr? dq : dr; min_d = dq < dr? dq : dr;
sc = min_d > q_span? q_span : dq < dr? dq : dr; sc = min_d > q_span? q_span : dq < dr? dq : dr;
sc -= dd? ilog2_32(dd) * 2 : 0; if (is_cdna) {
if (min_d > q_span) sc -= ilog2_32(min_d) / 2; int c_log, c_lin;
c_lin = (int)(dd * .01 * avg_qspan);
c_log = ilog2_32(dd);
if (dr > dq) sc -= c_lin < c_log? c_lin : c_log;
else sc -= c_lin + (c_log>>1);
} else sc -= (int)(dd * .01 * avg_qspan) + (ilog2_32(dd)>>1);
sc += f[j]; sc += f[j];
if (sc > max_f) { if (sc > max_f) {
max_f = sc, max_j = j; max_f = sc, max_j = j;
@@ -58,8 +69,7 @@ int mm_chain_dp(int max_dist, int bw, int max_skip, int min_cnt, int min_sc, int
} }
if (p[j] >= 0) t[p[j]] = i; if (p[j] >= 0) t[p[j]] = i;
} }
if (max_j >= 0) f[i] = max_f, p[i] = max_j; f[i] = max_f, p[i] = max_j, v[i] = max_f_past; // v[] keeps the max score in the previous chain
else f[i] = q_span, p[i] = -1;
} }
// find the ending positions of chains // find the ending positions of chains
@@ -67,16 +77,21 @@ int mm_chain_dp(int max_dist, int bw, int max_skip, int min_cnt, int min_sc, int
for (i = 0; i < n; ++i) for (i = 0; i < n; ++i)
if (p[i] >= 0) t[p[i]] = 1; if (p[i] >= 0) t[p[i]] = 1;
for (i = n_u = 0; i < n; ++i) for (i = n_u = 0; i < n; ++i)
if (t[i] == 0 && f[i] >= min_sc) if (t[i] == 0 && v[i] >= min_sc)
++n_u; ++n_u;
if (n_u == 0) { if (n_u == 0) {
kfree(km, f); kfree(km, p); kfree(km, t); kfree(km, f); kfree(km, p); kfree(km, t); kfree(km, v);
return 0; return 0;
} }
u = (uint64_t*)kmalloc(km, n_u * 8); u = (uint64_t*)kmalloc(km, n_u * 8);
for (i = n_u = 0; i < n; ++i) for (i = n_u = 0; i < n; ++i) {
if (t[i] == 0 && f[i] >= min_sc) if (t[i] == 0 && v[i] >= min_sc) {
u[n_u++] = (uint64_t)f[i] << 32 | i; j = i;
while (j >= 0 && f[j] < v[j]) j = p[j]; // find the point that maximizes f[]
if (j < 0) j = i; // TODO: this should really be assert(j>=0)
u[n_u++] = (uint64_t)f[j] << 32 | j;
}
}
radix_sort_64(u, u + n_u); radix_sort_64(u, u + n_u);
for (i = 0; i < n_u>>1; ++i) { // reverse, s.t. the highest scoring chain is the first for (i = 0; i < n_u>>1; ++i) { // reverse, s.t. the highest scoring chain is the first
uint64_t t = u[i]; uint64_t t = u[i];
@@ -85,7 +100,6 @@ int mm_chain_dp(int max_dist, int bw, int max_skip, int min_cnt, int min_sc, int
// backtrack // backtrack
memset(t, 0, n * 4); memset(t, 0, n * 4);
v = (int32_t*)kmalloc(km, n * 4);
for (i = n_v = k = 0; i < n_u; ++i) { // starting from the highest score for (i = n_v = k = 0; i < n_u; ++i) { // starting from the highest score
int32_t n_v0 = n_v, k0 = k; int32_t n_v0 = n_v, k0 = k;
j = (int32_t)u[i]; j = (int32_t)u[i];
+176 -11
View File
@@ -1,9 +1,13 @@
#include <stdarg.h> #include <stdarg.h>
#include <stdlib.h> #include <stdlib.h>
#include <string.h> #include <string.h>
#include <assert.h>
#include <stdio.h> #include <stdio.h>
#include "kalloc.h"
#include "mmpriv.h" #include "mmpriv.h"
static char mm_rg_id[256];
static inline void str_enlarge(kstring_t *s, int l) static inline void str_enlarge(kstring_t *s, int l)
{ {
if (s->l + l + 1 > s->m) { if (s->l + l + 1 > s->m) {
@@ -54,15 +58,141 @@ static void mm_sprintf_lite(kstring_t *s, const char *fmt, ...)
s->s[s->l] = 0; s->s[s->l] = 0;
} }
static inline void write_tags(kstring_t *s, const mm_reg1_t *r) static char *mm_escape(char *s)
{ {
mm_sprintf_lite(s, "\tcm:i:%d\ts1:i:%d", r->cnt, r->score); char *p, *q;
if (r->parent == r->id) mm_sprintf_lite(s, "\ts2:i:%d", r->subsc); for (p = q = s; *p; ++p) {
if (r->split) mm_sprintf_lite(s, "\tzd:i:%d", r->split); if (*p == '\\') {
if (r->p) mm_sprintf_lite(s, "\tNM:i:%d\tms:i:%d\tAS:i:%d\tnn:i:%d", r->p->n_diff, r->p->dp_max, r->p->dp_score, r->p->n_ambi); ++p;
if (*p == 't') *q++ = '\t';
else if (*p == '\\') *q++ = '\\';
} else *q++ = *p;
}
*q = '\0';
return s;
} }
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r) static void sam_write_rg_line(kstring_t *str, const char *s)
{
char *p, *q, *r, *rg_line = 0;
memset(mm_rg_id, 0, 256);
if (s == 0) return;
if (strstr(s, "@RG") != s) {
if (mm_verbose >= 1) fprintf(stderr, "[ERROR] the read group line is not started with @RG\n");
goto err_set_rg;
}
if (strstr(s, "\t") != NULL) {
if (mm_verbose >= 1) fprintf(stderr, "[ERROR] the read group line contained literal <tab> characters -- replace with escaped tabs: \\t\n");
goto err_set_rg;
}
rg_line = strdup(s);
mm_escape(rg_line);
if ((p = strstr(rg_line, "\tID:")) == 0) {
if (mm_verbose >= 1) fprintf(stderr, "[ERROR] no ID within the read group line\n");
goto err_set_rg;
}
p += 4;
for (q = p; *q && *q != '\t' && *q != '\n'; ++q);
if (q - p + 1 > 256) {
if (mm_verbose >= 1) fprintf(stderr, "[ERROR] @RG:ID is longer than 255 characters\n");
goto err_set_rg;
}
for (q = p, r = mm_rg_id; *q && *q != '\t' && *q != '\n'; ++q)
*r++ = *q;
mm_sprintf_lite(str, "%s\n", rg_line);
err_set_rg:
free(rg_line);
}
void mm_write_sam_hdr_no_SQ(const char *rg, const char *ver, int argc, char *argv[])
{
kstring_t str = {0,0,0};
sam_write_rg_line(&str, rg);
mm_sprintf_lite(&str, "@PG\tID:minimap2\tPN:minimap2");
if (ver) mm_sprintf_lite(&str, "\tVN:%s", ver);
if (argc > 1) {
int i;
mm_sprintf_lite(&str, "\tCL:minimap2");
for (i = 1; i < argc; ++i)
mm_sprintf_lite(&str, " %s", argv[i]);
}
mm_sprintf_lite(&str, "\n");
fputs(str.s, stdout);
free(str.s);
}
static void write_cs(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r)
{
extern unsigned char seq_nt4_table[256];
int i, q_off, t_off;
uint8_t *qseq, *tseq;
char *tmp;
if (r->p == 0) return;
mm_sprintf_lite(s, "\tcs:Z:");
qseq = (uint8_t*)kmalloc(km, r->qe - r->qs);
tseq = (uint8_t*)kmalloc(km, r->re - r->rs);
tmp = (char*)kmalloc(km, r->re - r->rs > r->qe - r->qs? r->re - r->rs + 1 : r->qe - r->qs + 1);
mm_idx_getseq(mi, r->rid, r->rs, r->re, tseq);
if (!r->rev) {
for (i = r->qs; i < r->qe; ++i)
qseq[i - r->qs] = seq_nt4_table[(uint8_t)t->seq[i]];
} else {
for (i = r->qs; i < r->qe; ++i) {
uint8_t c = seq_nt4_table[(uint8_t)t->seq[i]];
qseq[r->qe - i - 1] = c >= 4? 4 : 3 - c;
}
}
for (i = q_off = t_off = 0; i < r->p->n_cigar; ++i) {
int j, op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
assert(op >= 0 && op <= 2);
if (op == 0) {
int l_tmp = 0;
for (j = 0; j < len; ++j) {
if (qseq[q_off + j] != tseq[t_off + j]) {
if (l_tmp > 0) {
tmp[l_tmp] = 0;
mm_sprintf_lite(s, "=%s", tmp);
l_tmp = 0;
}
mm_sprintf_lite(s, "*%c%c", "acgtn"[tseq[t_off + j]], "acgtn"[qseq[q_off + j]]);
} else tmp[l_tmp++] = "ACGTN"[qseq[q_off + j]];
}
if (l_tmp > 0) {
tmp[l_tmp] = 0;
mm_sprintf_lite(s, "=%s", tmp);
}
q_off += len, t_off += len;
} else if (op == 1) {
for (j = 0, tmp[len] = 0; j < len; ++j)
tmp[j] = "acgtn"[qseq[q_off + j]];
mm_sprintf_lite(s, "+%s", tmp);
q_off += len;
} else if (op == 2) {
for (j = 0, tmp[len] = 0; j < len; ++j)
tmp[j] = "acgtn"[tseq[t_off + j]];
mm_sprintf_lite(s, "-%s", tmp);
t_off += len;
}
}
assert(t_off == r->re - r->rs && q_off == r->qe - r->qs);
kfree(km, qseq); kfree(km, tseq); kfree(km, tmp);
}
static inline void write_tags(kstring_t *s, const mm_reg1_t *r)
{
int type = r->inv? 'I' : r->id == r->parent? 'P' : 'S';
mm_sprintf_lite(s, "\ttp:A:%c\tcm:i:%d\ts1:i:%d", type, r->cnt, r->score);
if (r->parent == r->id) mm_sprintf_lite(s, "\ts2:i:%d", r->subsc);
if (r->split) mm_sprintf_lite(s, "\tzd:i:%d", r->split);
if (r->p) {
mm_sprintf_lite(s, "\tNM:i:%d\tms:i:%d\tAS:i:%d\tnn:i:%d", r->p->n_diff, r->p->dp_max, r->p->dp_score, r->p->n_ambi);
if (r->p->trans_strand == 1 || r->p->trans_strand == 2)
mm_sprintf_lite(s, "\tts:A:%c", "?+-?"[r->p->trans_strand]);
}
}
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int opt_flag)
{ {
s->l = 0; s->l = 0;
mm_sprintf_lite(s, "%s\t%d\t%d\t%d\t%c\t", t->name, t->l_seq, r->qs, r->qe, "+-"[r->rev]); mm_sprintf_lite(s, "%s\t%d\t%d\t%d\t%c\t", t->name, t->l_seq, r->qs, r->qe, "+-"[r->rev]);
@@ -73,12 +203,14 @@ void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const m
else mm_sprintf_lite(s, "\t%d\t%d", r->fuzzy_mlen, r->fuzzy_blen); else mm_sprintf_lite(s, "\t%d\t%d", r->fuzzy_mlen, r->fuzzy_blen);
mm_sprintf_lite(s, "\t%d", r->mapq); mm_sprintf_lite(s, "\t%d", r->mapq);
write_tags(s, r); write_tags(s, r);
if (r->p) { if (r->p && (opt_flag & MM_F_OUT_CG)) {
uint32_t k; uint32_t k;
mm_sprintf_lite(s, "\tcg:Z:"); mm_sprintf_lite(s, "\tcg:Z:");
for (k = 0; k < r->p->n_cigar; ++k) for (k = 0; k < r->p->n_cigar; ++k)
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MID"[r->p->cigar[k]&0xf]); mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDN"[r->p->cigar[k]&0xf]);
} }
if (r->p && (opt_flag & MM_F_OUT_CS))
write_cs(km, s, mi, t, r);
} }
static char comp_tab[] = { static char comp_tab[] = {
@@ -92,6 +224,13 @@ static char comp_tab[] = {
'p', 'q', 'y', 's', 'a', 'a', 'b', 'w', 'x', 'r', 'z', 123, 124, 125, 126, 127 'p', 'q', 'y', 's', 'a', 'a', 'b', 'w', 'x', 'r', 'z', 123, 124, 125, 126, 127
}; };
void mm_write_sam_SQ(const mm_idx_t *idx)
{
uint32_t i;
for (i = 0; i < idx->n_seq; ++i)
printf("@SQ\tSN:%s\tLN:%d\n", idx->seq[i].name, idx->seq[i].len);
}
static void sam_write_sq(kstring_t *s, char *seq, int l, int rev, int comp) static void sam_write_sq(kstring_t *s, char *seq, int l, int rev, int comp)
{ {
if (rev) { if (rev) {
@@ -105,7 +244,7 @@ static void sam_write_sq(kstring_t *s, char *seq, int l, int rev, int comp)
} else str_copy(s, seq, seq + l); } else str_copy(s, seq, seq + l);
} }
void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r) void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int n_regs, const mm_reg1_t *regs)
{ {
int flag = 0; int flag = 0;
s->l = 0; s->l = 0;
@@ -120,12 +259,12 @@ void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const m
if (r->parent != r->id) flag |= 0x100; if (r->parent != r->id) flag |= 0x100;
else if (!r->sam_pri) flag |= 0x800; else if (!r->sam_pri) flag |= 0x800;
mm_sprintf_lite(s, "%s\t%d\t%s\t%d\t%d\t", t->name, flag, mi->seq[r->rid].name, r->rs+1, r->mapq); mm_sprintf_lite(s, "%s\t%d\t%s\t%d\t%d\t", t->name, flag, mi->seq[r->rid].name, r->rs+1, r->mapq);
if (r->p) { // TODO: using hard clippings if (r->p) { // actually this should always be true for SAM output
uint32_t k, clip_len = r->rev? t->l_seq - r->qe : r->qs; uint32_t k, clip_len = r->rev? t->l_seq - r->qe : r->qs;
int clip_char = (flag&0x800)? 'H' : 'S'; int clip_char = (flag&0x800)? 'H' : 'S';
if (clip_len) mm_sprintf_lite(s, "%d%c", clip_len, clip_char); if (clip_len) mm_sprintf_lite(s, "%d%c", clip_len, clip_char);
for (k = 0; k < r->p->n_cigar; ++k) for (k = 0; k < r->p->n_cigar; ++k)
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MID"[r->p->cigar[k]&0xf]); mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDN"[r->p->cigar[k]&0xf]);
clip_len = r->rev? r->qs : t->l_seq - r->qe; clip_len = r->rev? r->qs : t->l_seq - r->qe;
if (clip_len) mm_sprintf_lite(s, "%d%c", clip_len, clip_char); if (clip_len) mm_sprintf_lite(s, "%d%c", clip_len, clip_char);
} else mm_sprintf_lite(s, "*"); } else mm_sprintf_lite(s, "*");
@@ -144,6 +283,32 @@ void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const m
else mm_sprintf_lite(s, "*"); else mm_sprintf_lite(s, "*");
} }
write_tags(s, r); write_tags(s, r);
if (mm_rg_id[0]) mm_sprintf_lite(s, "\tRG:Z:%s", mm_rg_id);
if (r->parent == r->id && r->p && n_regs > 1 && regs && r >= regs && r - regs < n_regs) { // supplementary aln may exist
int i, n_sa = 0; // n_sa: number of SA fields
for (i = 0; i < n_regs; ++i)
if (i != r - regs && regs[i].parent == regs[i].id && regs[i].p)
++n_sa;
if (n_sa > 0) {
mm_sprintf_lite(s, "\tSA:Z:");
for (i = 0; i < n_regs; ++i) {
const mm_reg1_t *q = &regs[i];
int l_M, l_I = 0, l_D = 0, clip5 = 0, clip3 = 0;
if (r == q || q->parent != q->id || q->p == 0) continue;
if (q->qe - q->qs < q->re - q->rs) l_M = q->qe - q->qs, l_D = (q->re - q->rs) - l_M;
else l_M = q->re - q->rs, l_I = (q->qe - q->qs) - l_M;
clip5 = q->rev? t->l_seq - q->qe : q->qs;
clip3 = q->rev? q->qs : t->l_seq - q->qe;
mm_sprintf_lite(s, "%s,%d,%c,", mi->seq[q->rid].name, q->rs+1, "+-"[q->rev]);
if (clip5) mm_sprintf_lite(s, "%dS", clip5);
if (l_M) mm_sprintf_lite(s, "%dM", l_M);
if (l_I) mm_sprintf_lite(s, "%dI", l_I);
if (l_D) mm_sprintf_lite(s, "%dD", l_D);
if (clip3) mm_sprintf_lite(s, "%dS", clip3);
mm_sprintf_lite(s, ",%d,%d;", q->mapq, q->p->n_diff);
}
}
}
} }
s->s[s->l] = 0; // we always have room for an extra byte (see str_enlarge) s->s[s->l] = 0; // we always have room for an extra byte (see str_enlarge)
} }
+17 -11
View File
@@ -125,11 +125,11 @@ void mm_hit_sort_by_dp(void *km, int *n_regs, mm_reg1_t *r)
aux = (uint64_t*)kmalloc(km, n * 8); aux = (uint64_t*)kmalloc(km, n * 8);
t = (mm_reg1_t*)kmalloc(km, n * sizeof(mm_reg1_t)); t = (mm_reg1_t*)kmalloc(km, n * sizeof(mm_reg1_t));
for (i = n_aux = 0; i < n; ++i) { for (i = n_aux = 0; i < n; ++i) {
if (r[i].cnt > 0) { // squeeze out elements with cnt==0 (soft deleted) if (r[i].inv || r[i].cnt > 0) { // squeeze out elements with cnt==0 (soft deleted)
assert(r[i].p); assert(r[i].p);
aux[n_aux++] = (uint64_t)r[i].p->dp_max << 32 | i; aux[n_aux++] = (uint64_t)r[i].p->dp_max << 32 | i;
} else if (r[i].p) { } else if (r[i].p) {
kfree(km, r[i].p); free(r[i].p);
r[i].p = 0; r[i].p = 0;
} }
} }
@@ -177,13 +177,14 @@ void mm_sync_regs(void *km, int n_regs, mm_reg1_t *regs) // keep mm_reg1_t::{id,
mm_set_sam_pri(n_regs, regs); mm_set_sam_pri(n_regs, regs);
} }
void mm_select_sub(void *km, float mask_level, float pri_ratio, int best_n, int *n_, mm_reg1_t *r) void mm_select_sub(void *km, float mask_level, float pri_ratio, int min_diff, int best_n, int *n_, mm_reg1_t *r)
{ {
if (pri_ratio > 0.0f && *n_ > 0) { if (pri_ratio > 0.0f && *n_ > 0) {
int i, k, n = *n_, n_2nd = 0; int i, k, n = *n_, n_2nd = 0;
for (i = k = 0; i < n; ++i) for (i = k = 0; i < n; ++i)
if (r[i].parent == i) r[k++] = r[i]; if (r[i].parent == i) r[k++] = r[i];
else if (r[i].score >= r[r[i].parent].score * pri_ratio && n_2nd++ < best_n) r[k++] = r[i]; else if ((r[i].score >= r[r[i].parent].score * pri_ratio || r[i].score + min_diff >= r[r[i].parent].score) && n_2nd++ < best_n)
r[k++] = r[i];
else if (r[i].p) free(r[i].p); else if (r[i].p) free(r[i].p);
if (k != n) mm_sync_regs(km, k, r); // removing hits requires sync() if (k != n) mm_sync_regs(km, k, r); // removing hits requires sync()
*n_ = k; *n_ = k;
@@ -196,7 +197,7 @@ void mm_filter_regs(void *km, const mm_mapopt_t *opt, int *n_regs, mm_reg1_t *re
for (i = k = 0; i < *n_regs; ++i) { for (i = k = 0; i < *n_regs; ++i) {
mm_reg1_t *r = &regs[i]; mm_reg1_t *r = &regs[i];
int flt = 0; int flt = 0;
if (r->cnt < opt->min_cnt) flt = 1; if (!r->inv && r->cnt < opt->min_cnt) flt = 1;
if (r->p) { if (r->p) {
if (r->p->blen - r->p->n_ambi - r->p->n_diff < opt->min_chain_score) flt = 1; if (r->p->blen - r->p->n_ambi - r->p->n_diff < opt->min_chain_score) flt = 1;
else if (r->p->dp_max < opt->min_dp_max) flt = 1; else if (r->p->dp_max < opt->min_dp_max) flt = 1;
@@ -265,7 +266,7 @@ void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs_, mm_r
if (r1->re - r1->rs < max_gap>>1 || r1->qe - r1->qs < max_gap>>1) continue; if (r1->re - r1->rs < max_gap>>1 || r1->qe - r1->qs < max_gap>>1) continue;
// all conditions satisfied; join // all conditions satisfied; join
a[r1->as].y |= 1ULL<<40; a[r1->as].y |= MM_SEED_LONG_JOIN;
r0->cnt += r1->cnt, r0->score += r1->score; r0->cnt += r1->cnt, r0->score += r1->score;
mm_reg_set_coor(r0, qlen, a); mm_reg_set_coor(r0, qlen, a);
r1->cnt = 0; r1->cnt = 0;
@@ -287,17 +288,22 @@ void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs_, mm_r
} }
} }
void mm_set_mapq(int n_regs, mm_reg1_t *regs) void mm_set_mapq(int n_regs, mm_reg1_t *regs, int min_chain_sc)
{ {
static const float q_coef = 30.0f;
int i; int i;
for (i = 0; i < n_regs; ++i) { for (i = 0; i < n_regs; ++i) {
mm_reg1_t *r = &regs[i]; mm_reg1_t *r = &regs[i];
if (r->parent == r->id) { if (r->inv) {
int mapq; r->mapq = 0;
} else if (r->parent == r->id) {
int mapq, subsc;
float pen_cm = r->cnt >= 10? 1.0f : 0.1f * r->cnt;
subsc = r->subsc > min_chain_sc? r->subsc : min_chain_sc;
if (r->p && r->p->dp_max2 > 0 && r->p->dp_max > 0) { if (r->p && r->p->dp_max2 > 0 && r->p->dp_max > 0) {
float identity = (float)(r->p->blen - r->p->n_diff - r->p->n_ambi) / (r->p->blen - r->p->n_ambi); float identity = (float)(r->p->blen - r->p->n_diff - r->p->n_ambi) / (r->p->blen - r->p->n_ambi);
mapq = (int)(identity * 30.0 * (1. - (float)r->p->dp_max2 * r->subsc / r->p->dp_max / r->score) * logf(r->score)); mapq = (int)(identity * pen_cm * q_coef * (1. - (float)r->p->dp_max2 * subsc / r->p->dp_max / r->score) * logf(r->score));
} else mapq = (int)(30.0 * (1. - (float)r->subsc / r->score) * logf(r->score)); } else mapq = (int)(pen_cm * q_coef * (1. - (float)subsc / r->score) * logf(r->score));
mapq = mapq > 0? mapq : 0; mapq = mapq > 0? mapq : 0;
r->mapq = mapq < 60? mapq : 60; r->mapq = mapq < 60? mapq : 60;
} else r->mapq = 0; } else r->mapq = 0;
+13 -8
View File
@@ -25,6 +25,7 @@ mm_idx_t *mm_idx_init(int w, int k, int b, int is_hpc)
mi = (mm_idx_t*)calloc(1, sizeof(mm_idx_t)); mi = (mm_idx_t*)calloc(1, sizeof(mm_idx_t));
mi->w = w, mi->k = k, mi->b = b, mi->is_hpc = is_hpc; mi->w = w, mi->k = k, mi->b = b, mi->is_hpc = is_hpc;
mi->B = (mm_idx_bucket_t*)calloc(1<<b, sizeof(mm_idx_bucket_t)); mi->B = (mm_idx_bucket_t*)calloc(1<<b, sizeof(mm_idx_bucket_t));
if (!(mm_dbg_flag & 1)) mi->km = km_init();
return mi; return mi;
} }
@@ -37,9 +38,12 @@ void mm_idx_destroy(mm_idx_t *mi)
free(mi->B[i].a.a); free(mi->B[i].a.a);
kh_destroy(idx, (idxhash_t*)mi->B[i].h); kh_destroy(idx, (idxhash_t*)mi->B[i].h);
} }
for (i = 0; i < mi->n_seq; ++i) if (!mi->km) {
free(mi->seq[i].name); for (i = 0; i < mi->n_seq; ++i)
free(mi->seq); free(mi->B); free(mi->S); free(mi); free(mi->seq[i].name);
free(mi->seq);
} else km_destroy(mi->km);
free(mi->B); free(mi->S); free(mi);
} }
const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n) const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n)
@@ -228,7 +232,7 @@ static void *worker_pipeline(void *shared, int step, void *in)
old_m = p->mi->n_seq, m = p->mi->n_seq + s->n_seq; old_m = p->mi->n_seq, m = p->mi->n_seq + s->n_seq;
kroundup32(m); kroundup32(old_m); kroundup32(m); kroundup32(old_m);
if (old_m != m) if (old_m != m)
p->mi->seq = (mm_idx_seq_t*)realloc(p->mi->seq, m * sizeof(mm_idx_seq_t)); p->mi->seq = (mm_idx_seq_t*)krealloc(p->mi->km, p->mi->seq, m * sizeof(mm_idx_seq_t));
// make room for p->mi->S // make room for p->mi->S
for (i = 0, sum_len = 0; i < s->n_seq; ++i) sum_len += s->seq[i].l_seq; for (i = 0, sum_len = 0; i < s->n_seq; ++i) sum_len += s->seq[i].l_seq;
old_max_len = (p->sum_len + 7) / 8; old_max_len = (p->sum_len + 7) / 8;
@@ -244,7 +248,8 @@ static void *worker_pipeline(void *shared, int step, void *in)
uint32_t j; uint32_t j;
if (p->keep_name) { if (p->keep_name) {
assert(strlen(s->seq[i].name) <= 254); // a long query name breaks BAM assert(strlen(s->seq[i].name) <= 254); // a long query name breaks BAM
seq->name = strdup(s->seq[i].name); seq->name = (char*)kmalloc(p->mi->km, strlen(s->seq[i].name) + 1);
strcpy(seq->name, s->seq[i].name);
} else seq->name = 0; } else seq->name = 0;
seq->len = s->seq[i].l_seq; seq->len = s->seq[i].l_seq;
seq->offset = p->sum_len; seq->offset = p->sum_len;
@@ -280,12 +285,12 @@ static void *worker_pipeline(void *shared, int step, void *in)
mm_idx_t *mm_idx_gen(mm_bseq_file_t *fp, int w, int k, int b, int is_hpc, int mini_batch_size, int n_threads, uint64_t batch_size, int keep_name) mm_idx_t *mm_idx_gen(mm_bseq_file_t *fp, int w, int k, int b, int is_hpc, int mini_batch_size, int n_threads, uint64_t batch_size, int keep_name)
{ {
pipeline_t pl; pipeline_t pl;
if (fp == 0 || mm_bseq_eof(fp)) return 0;
memset(&pl, 0, sizeof(pipeline_t)); memset(&pl, 0, sizeof(pipeline_t));
pl.mini_batch_size = mini_batch_size < batch_size? mini_batch_size : batch_size; pl.mini_batch_size = mini_batch_size < batch_size? mini_batch_size : batch_size;
pl.keep_name = keep_name; pl.keep_name = keep_name;
pl.batch_size = batch_size; pl.batch_size = batch_size;
pl.fp = fp; pl.fp = fp;
if (pl.fp == 0) return 0;
pl.mi = mm_idx_init(w, k, b, is_hpc); pl.mi = mm_idx_init(w, k, b, is_hpc);
kt_pipeline(n_threads < 3? n_threads : 3, worker_pipeline, &pl, 3); kt_pipeline(n_threads < 3? n_threads : 3, worker_pipeline, &pl, 3);
@@ -364,12 +369,12 @@ mm_idx_t *mm_idx_load(FILE *fp)
if (fread(x, 4, 5, fp) != 5) return 0; if (fread(x, 4, 5, fp) != 5) return 0;
mi = mm_idx_init(x[0], x[1], x[2], x[4]); mi = mm_idx_init(x[0], x[1], x[2], x[4]);
mi->n_seq = x[3]; mi->n_seq = x[3];
mi->seq = (mm_idx_seq_t*)calloc(mi->n_seq, sizeof(mm_idx_seq_t)); mi->seq = (mm_idx_seq_t*)kcalloc(mi->km, mi->n_seq, sizeof(mm_idx_seq_t));
for (i = 0; i < mi->n_seq; ++i) { for (i = 0; i < mi->n_seq; ++i) {
uint8_t l; uint8_t l;
mm_idx_seq_t *s = &mi->seq[i]; mm_idx_seq_t *s = &mi->seq[i];
fread(&l, 1, 1, fp); fread(&l, 1, 1, fp);
s->name = (char*)malloc(l + 1); s->name = (char*)kmalloc(mi->km, l + 1);
fread(s->name, 1, l, fp); fread(s->name, 1, l, fp);
s->name[l] = 0; s->name[l] = 0;
fread(&s->len, 4, 1, fp); fread(&s->len, 4, 1, fp);
+28 -6
View File
@@ -12,6 +12,8 @@
#define KSW_EZ_APPROX_DROP 0x10 // approximate Z-drop; faster with sse #define KSW_EZ_APPROX_DROP 0x10 // approximate Z-drop; faster with sse
#define KSW_EZ_EXTZ_ONLY 0x40 // only perform extension #define KSW_EZ_EXTZ_ONLY 0x40 // only perform extension
#define KSW_EZ_REV_CIGAR 0x80 // reverse CIGAR in the output #define KSW_EZ_REV_CIGAR 0x80 // reverse CIGAR in the output
#define KSW_EZ_SPLICE_FOR 0x100
#define KSW_EZ_SPLICE_REV 0x200
#ifdef __cplusplus #ifdef __cplusplus
extern "C" { extern "C" {
@@ -39,8 +41,8 @@ typedef struct {
* @param mat m*m scoring mattrix in one-dimension array * @param mat m*m scoring mattrix in one-dimension array
* @param gapo gap open penalty; a gap of length l cost "-(gapo+l*gape)" * @param gapo gap open penalty; a gap of length l cost "-(gapo+l*gape)"
* @param gape gap extension penalty * @param gape gap extension penalty
* @param w band width * @param w band width (<0 to disable)
* @param zdrop off-diagonal drop-off to stop extension (positive) * @param zdrop off-diagonal drop-off to stop extension (positive; <0 to disable)
* @param flag flag (see KSW_EZ_* macros) * @param flag flag (see KSW_EZ_* macros)
* @param ez (out) scores and cigar * @param ez (out) scores and cigar
*/ */
@@ -53,6 +55,11 @@ void ksw_extd(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t
void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t gapo, int8_t gape, int8_t gapo2, int8_t gape2, int w, int zdrop, int flag, ksw_extz_t *ez); int8_t gapo, int8_t gape, int8_t gapo2, int8_t gape2, int w, int zdrop, int flag, ksw_extz_t *ez);
void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t gapo, int8_t gape, int8_t gapo2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez);
void ksw_extf2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t mch, int8_t mis, int8_t e, int w, int xdrop, ksw_extz_t *ez);
/** /**
* Global alignment * Global alignment
* *
@@ -67,6 +74,9 @@ int ksw_gg(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *ta
int ksw_gg2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t gapo, int8_t gape, int w, int *m_cigar_, int *n_cigar_, uint32_t **cigar_); int ksw_gg2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t gapo, int8_t gape, int w, int *m_cigar_, int *n_cigar_, uint32_t **cigar_);
int ksw_gg2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t gapo, int8_t gape, int w, int *m_cigar_, int *n_cigar_, uint32_t **cigar_); int ksw_gg2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t gapo, int8_t gape, int w, int *m_cigar_, int *n_cigar_, uint32_t **cigar_);
void *ksw_ll_qinit(void *km, int size, int qlen, const uint8_t *query, int m, const int8_t *mat);
int ksw_ll_i16(void *q, int tlen, const uint8_t *target, int gapo, int gape, int *qe, int *te);
#ifdef __cplusplus #ifdef __cplusplus
} }
#endif #endif
@@ -101,18 +111,30 @@ static inline uint32_t *ksw_push_cigar(void *km, int *n_cigar, int *m_cigar, uin
// bit 0-2: which type gets the max - 0 for H, 1 for E, 2 for F, 3 for \tilde{E} and 4 for \tilde{F} // bit 0-2: which type gets the max - 0 for H, 1 for E, 2 for F, 3 for \tilde{E} and 4 for \tilde{F}
// bit 3/0x08: 1 if a continuation on the E state (bit 5/0x20 for a continuation on \tilde{E}) // bit 3/0x08: 1 if a continuation on the E state (bit 5/0x20 for a continuation on \tilde{E})
// bit 4/0x10: 1 if a continuation on the F state (bit 6/0x40 for a continuation on \tilde{F}) // bit 4/0x10: 1 if a continuation on the F state (bit 6/0x40 for a continuation on \tilde{F})
static inline void ksw_backtrack(void *km, int is_rot, int is_rev, const uint8_t *p, const int *off, int n_col, int i0, int j0, int *m_cigar_, int *n_cigar_, uint32_t **cigar_) static inline void ksw_backtrack(void *km, int is_rot, int is_rev, int with_N, const uint8_t *p, const int *off, const int *off_end, int n_col, int i0, int j0,
int *m_cigar_, int *n_cigar_, uint32_t **cigar_)
{ // p[] - lower 3 bits: which type gets the max; bit { // p[] - lower 3 bits: which type gets the max; bit
int n_cigar = 0, m_cigar = *m_cigar_, i = i0, j = j0, r, state = 0; int n_cigar = 0, m_cigar = *m_cigar_, i = i0, j = j0, r, state = 0;
uint32_t *cigar = *cigar_, tmp; uint32_t *cigar = *cigar_, tmp;
while (i >= 0 && j >= 0) { // at the beginning of the loop, _state_ tells us which state to check while (i >= 0 && j >= 0) { // at the beginning of the loop, _state_ tells us which state to check
if (is_rot) r = i + j, tmp = p[r * n_col + i - off[r]]; int force_state = -1;
else tmp = p[i * n_col + j - off[i]]; if (is_rot) {
r = i + j;
if (i < off[r]) force_state = 2;
if (off_end && i > off_end[r]) force_state = 1;
tmp = force_state < 0? p[r * n_col + i - off[r]] : 0;
} else {
if (j < off[i]) force_state = 2;
if (off_end && j > off_end[i]) force_state = 1;
tmp = force_state < 0? p[i * n_col + j - off[i]] : 0;
}
if (state == 0) state = tmp & 7; // if requesting the H state, find state one maximizes it. if (state == 0) state = tmp & 7; // if requesting the H state, find state one maximizes it.
else if (!(tmp >> (state + 2) & 1)) state = 0; // if requesting other states, _state_ stays the same if it is a continuation; otherwise, set to H else if (!(tmp >> (state + 2) & 1)) state = 0; // if requesting other states, _state_ stays the same if it is a continuation; otherwise, set to H
if (state == 0) state = tmp & 7; // TODO: probably this line can be merged into the "else if" line right above; not 100% sure if (state == 0) state = tmp & 7; // TODO: probably this line can be merged into the "else if" line right above; not 100% sure
if (force_state >= 0) state = force_state;
if (state == 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 0, 1), --i, --j; // match if (state == 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 0, 1), --i, --j; // match
else if (state == 1 || state == 3) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 2, 1), --i; // deletion else if (state == 1 || (state == 3 && !with_N)) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 2, 1), --i; // deletion
else if (state == 3 && with_N) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 3, 1), --i; // intron
else cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 1, 1), --j; // insertion else cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 1, 1), --j; // insertion
} }
if (i >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 2, i + 1); // first deletion if (i >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 2, i + 1); // first deletion
+12 -31
View File
@@ -1,5 +1,6 @@
#include <string.h> #include <string.h>
#include <stdio.h> #include <stdio.h>
#include <assert.h>
#include "ksw2.h" #include "ksw2.h"
#ifdef __SSE2__ #ifdef __SSE2__
@@ -42,7 +43,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
a2= _mm_sub_epi8(a2, tmp); \ a2= _mm_sub_epi8(a2, tmp); \
b2= _mm_sub_epi8(b2, tmp); b2= _mm_sub_epi8(b2, tmp);
int r, t, qe = q + e, n_col_, *off = 0, tlen_, qlen_, last_st, last_en, wl, wr, max_sc, min_sc, long_thres, long_diff; int r, t, qe = q + e, n_col_, *off = 0, *off_end = 0, tlen_, qlen_, last_st, last_en, wl, wr, max_sc, min_sc, long_thres, long_diff;
int with_cigar = !(flag&KSW_EZ_SCORE_ONLY), approx_max = !!(flag&KSW_EZ_APPROX_MAX); int with_cigar = !(flag&KSW_EZ_SCORE_ONLY), approx_max = !!(flag&KSW_EZ_APPROX_MAX);
int32_t *H = 0, H0 = 0, last_H0_t = 0; int32_t *H = 0, H0 = 0, last_H0_t = 0;
uint8_t *qr, *sf, *mem, *mem2 = 0; uint8_t *qr, *sf, *mem, *mem2 = 0;
@@ -66,7 +67,8 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
if (w < 0) w = tlen > qlen? tlen : qlen; if (w < 0) w = tlen > qlen? tlen : qlen;
wl = wr = w; wl = wr = w;
tlen_ = (tlen + 15) / 16; tlen_ = (tlen + 15) / 16;
n_col_ = ((w + 1 < tlen? (w + 1 < qlen? w + 1 : qlen): tlen) + 15) / 16 + 1; n_col_ = qlen < tlen? qlen : tlen;
n_col_ = ((n_col_ < w + 1? n_col_ : w + 1) + 15) / 16 + 1;
qlen_ = (qlen + 15) / 16; qlen_ = (qlen + 15) / 16;
for (t = 1, max_sc = mat[0], min_sc = mat[1]; t < m * m; ++t) { for (t = 1, max_sc = mat[0], min_sc = mat[1]; t < m * m; ++t) {
max_sc = max_sc > mat[t]? max_sc : mat[t]; max_sc = max_sc > mat[t]? max_sc : mat[t];
@@ -96,7 +98,8 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
if (with_cigar) { if (with_cigar) {
mem2 = (uint8_t*)kmalloc(km, ((qlen + tlen - 1) * n_col_ + 1) * 16); mem2 = (uint8_t*)kmalloc(km, ((qlen + tlen - 1) * n_col_ + 1) * 16);
p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4); p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4);
off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int)); off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int) * 2);
off_end = off + qlen + tlen - 1;
} }
for (t = 0; t < qlen; ++t) qr[t] = query[qlen - 1 - t]; for (t = 0; t < qlen; ++t) qr[t] = query[qlen - 1 - t];
@@ -105,7 +108,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
for (r = 0, last_st = last_en = -1; r < qlen + tlen - 1; ++r) { for (r = 0, last_st = last_en = -1; r < qlen + tlen - 1; ++r) {
int st = 0, en = tlen - 1, st0, en0, st_, en_; int st = 0, en = tlen - 1, st0, en0, st_, en_;
int8_t x1, x21, v1; int8_t x1, x21, v1;
uint8_t *qrr = qr + (qlen - 1 - r), p_en0 = 0; uint8_t *qrr = qr + (qlen - 1 - r);
int8_t *u8 = (int8_t*)u, *v8 = (int8_t*)v, *x8 = (int8_t*)x, *x28 = (int8_t*)x2; int8_t *u8 = (int8_t*)u, *v8 = (int8_t*)v, *x8 = (int8_t*)x, *x28 = (int8_t*)x2;
__m128i x1_, x21_, v1_; __m128i x1_, x21_, v1_;
// find the boundaries // find the boundaries
@@ -160,6 +163,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
x21_ = _mm_cvtsi32_si128((uint8_t)x21); x21_ = _mm_cvtsi32_si128((uint8_t)x21);
v1_ = _mm_cvtsi32_si128((uint8_t)v1); v1_ = _mm_cvtsi32_si128((uint8_t)v1);
st_ = st / 16, en_ = en / 16; st_ = st / 16, en_ = en / 16;
assert(en_ - st_ + 1 <= n_col_);
if (!with_cigar) { // score only if (!with_cigar) { // score only
for (t = st_; t <= en_; ++t) { for (t = st_; t <= en_; ++t) {
__m128i z, a, b, a2, b2, xt1, x2t1, vt1, ut, tmp; __m128i z, a, b, a2, b2, xt1, x2t1, vt1, ut, tmp;
@@ -199,18 +203,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
} }
} else if (!(flag&KSW_EZ_RIGHT)) { // gap left-alignment } else if (!(flag&KSW_EZ_RIGHT)) { // gap left-alignment
__m128i *pr = p + r * n_col_ - st_; __m128i *pr = p + r * n_col_ - st_;
off[r] = st; off[r] = st, off_end[r] = en;
if (en0 < r && en0 < tlen - 1) { // to avoid backtracking out of the band; this assumes a fixed band
int8_t a, a2, z = ((uint8_t*)s)[en0];
a = x8[en0-1] + v8[en0-1];
p_en0 = a > z? 1 : 0;
z = a > z? a : z;
p_en0 |= a - (z - q) > 0? 1<<4 : 0;
a2 = x28[en0-1] + v8[en0-1];
p_en0 = a2 > z? 3 : p_en0;
z = a2 > z? a2 : z;
p_en0 |= a2 - (z - q2) > 0? 1<<6 : 0;
}
for (t = st_; t <= en_; ++t) { for (t = st_; t <= en_; ++t) {
__m128i d, z, a, b, a2, b2, xt1, x2t1, vt1, ut, tmp; __m128i d, z, a, b, a2, b2, xt1, x2t1, vt1, ut, tmp;
__dp_code_block1; __dp_code_block1;
@@ -257,18 +250,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
} }
} else { // gap right-alignment } else { // gap right-alignment
__m128i *pr = p + r * n_col_ - st_; __m128i *pr = p + r * n_col_ - st_;
off[r] = st; off[r] = st, off_end[r] = en;
if (en0 < r && en0 < tlen - 1) { // to avoid backtracking out of the band; this assumes a fixed band
int8_t a, a2, z = ((uint8_t*)s)[en0];
a = x8[en0-1] + v8[en0-1];
p_en0 = a >= z? 1 : 0;
z = a >= z? a : z;
p_en0 |= a - (z - q) >= 0? 1<<4 : 0;
a2 = x28[en0-1] + v8[en0-1];
p_en0 = a2 >= z? 3 : p_en0;
z = a2 >= z? a2 : z;
p_en0 |= a2 - (z - q2) >= 0? 1<<6 : 0;
}
for (t = st_; t <= en_; ++t) { for (t = st_; t <= en_; ++t) {
__m128i d, z, a, b, a2, b2, xt1, x2t1, vt1, ut, tmp; __m128i d, z, a, b, a2, b2, xt1, x2t1, vt1, ut, tmp;
__dp_code_block1; __dp_code_block1;
@@ -314,7 +296,6 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
_mm_store_si128(&pr[t], d); _mm_store_si128(&pr[t], d);
} }
} }
if (with_cigar && en0 < r && en0 < tlen - 1) ((uint8_t*)(p + r * n_col_))[en0 - st] = p_en0;
if (!approx_max) { // find the exact max with a 32-bit score array if (!approx_max) { // find the exact max with a 32-bit score array
int32_t max_H, max_t; int32_t max_H, max_t;
// compute H[], max_H and max_t // compute H[], max_H and max_t
@@ -384,9 +365,9 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
if (with_cigar) { // backtrack if (with_cigar) { // backtrack
int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR); int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY)) if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY))
ksw_backtrack(km, 1, rev_cigar, (uint8_t*)p, off, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar); ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
else if (ez->max_t >= 0 && ez->max_q >= 0) else if (ez->max_t >= 0 && ez->max_q >= 0)
ksw_backtrack(km, 1, rev_cigar, (uint8_t*)p, off, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar); ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
kfree(km, mem2); kfree(km, off); kfree(km, mem2); kfree(km, off);
} }
} }
+357
View File
@@ -0,0 +1,357 @@
#include <string.h>
#include <stdio.h>
#include <assert.h>
#include "ksw2.h"
#ifdef __SSE2__
#include <emmintrin.h>
#ifdef __SSE4_1__
#include <smmintrin.h>
#endif
void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez)
{
#define __dp_code_block1 \
z = _mm_load_si128(&s[t]); \
xt1 = _mm_load_si128(&x[t]); /* xt1 <- x[r-1][t..t+15] */ \
tmp = _mm_srli_si128(xt1, 15); /* tmp <- x[r-1][t+15] */ \
xt1 = _mm_or_si128(_mm_slli_si128(xt1, 1), x1_); /* xt1 <- x[r-1][t-1..t+14] */ \
x1_ = tmp; \
vt1 = _mm_load_si128(&v[t]); /* vt1 <- v[r-1][t..t+15] */ \
tmp = _mm_srli_si128(vt1, 15); /* tmp <- v[r-1][t+15] */ \
vt1 = _mm_or_si128(_mm_slli_si128(vt1, 1), v1_); /* vt1 <- v[r-1][t-1..t+14] */ \
v1_ = tmp; \
a = _mm_add_epi8(xt1, vt1); /* a <- x[r-1][t-1..t+14] + v[r-1][t-1..t+14] */ \
ut = _mm_load_si128(&u[t]); /* ut <- u[t..t+15] */ \
b = _mm_add_epi8(_mm_load_si128(&y[t]), ut); /* b <- y[r-1][t..t+15] + u[r-1][t..t+15] */ \
x2t1= _mm_load_si128(&x2[t]); \
tmp = _mm_srli_si128(x2t1, 15); \
x2t1= _mm_or_si128(_mm_slli_si128(x2t1, 1), x21_); \
x21_= tmp; \
a2 = _mm_add_epi8(x2t1, vt1); \
a2a = _mm_add_epi8(a2, _mm_load_si128(&acceptor[t]));
#define __dp_code_block2 \
_mm_store_si128(&u[t], _mm_sub_epi8(z, vt1)); /* u[r][t..t+15] <- z - v[r-1][t-1..t+14] */ \
_mm_store_si128(&v[t], _mm_sub_epi8(z, ut)); /* v[r][t..t+15] <- z - u[r-1][t..t+15] */ \
tmp = _mm_sub_epi8(z, q_); \
a = _mm_sub_epi8(a, tmp); \
b = _mm_sub_epi8(b, tmp); \
a2= _mm_sub_epi8(a2, _mm_sub_epi8(z, q2_));
int r, t, qe = q + e, n_col_, *off = 0, *off_end = 0, tlen_, qlen_, last_st, last_en, max_sc, min_sc, long_thres, long_diff;
int with_cigar = !(flag&KSW_EZ_SCORE_ONLY), approx_max = !!(flag&KSW_EZ_APPROX_MAX);
int32_t *H = 0, H0 = 0, last_H0_t = 0;
uint8_t *qr, *sf, *mem, *mem2 = 0;
__m128i q_, q2_, qe_, zero_, sc_mch_, sc_mis_, m1_;
__m128i *u, *v, *x, *y, *x2, *s, *p = 0, *donor, *acceptor;
ksw_reset_extz(ez);
if (m <= 1 || qlen <= 0 || tlen <= 0 || q2 <= q + e) return;
zero_ = _mm_set1_epi8(0);
q_ = _mm_set1_epi8(q);
q2_ = _mm_set1_epi8(q2);
qe_ = _mm_set1_epi8(q + e);
sc_mch_ = _mm_set1_epi8(mat[0]);
sc_mis_ = _mm_set1_epi8(mat[1]);
m1_ = _mm_set1_epi8(m - 1); // wildcard
tlen_ = (tlen + 15) / 16;
n_col_ = ((qlen < tlen? qlen : tlen) + 15) / 16 + 1;
qlen_ = (qlen + 15) / 16;
for (t = 1, max_sc = mat[0], min_sc = mat[1]; t < m * m; ++t) {
max_sc = max_sc > mat[t]? max_sc : mat[t];
min_sc = min_sc < mat[t]? min_sc : mat[t];
}
if (-min_sc > 2 * (q + e)) return; // otherwise, we won't see any mismatches
long_thres = (q2 - q) / e - 1;
if (q2 > q + e + long_thres * e)
++long_thres;
long_diff = long_thres * e - (q2 - q);
mem = (uint8_t*)kcalloc(km, tlen_ * 9 + qlen_ + 1, 16);
u = (__m128i*)(((size_t)mem + 15) >> 4 << 4); // 16-byte aligned
v = u + tlen_, x = v + tlen_, y = x + tlen_, x2 = y + tlen_;
donor = x2 + tlen_, acceptor = donor + tlen_;
s = acceptor + tlen_, sf = (uint8_t*)(s + tlen_), qr = sf + tlen_ * 16;
memset(u, -q - e, tlen_ * 16 * 4); // this set u, v, x, y (because they are in the same array)
memset(x2, -q2, tlen_ * 16);
if (!approx_max) {
H = (int32_t*)kmalloc(km, tlen_ * 16 * 4);
for (t = 0; t < tlen_ * 16; ++t) H[t] = KSW_NEG_INF;
}
if (with_cigar) {
mem2 = (uint8_t*)kmalloc(km, ((qlen + tlen - 1) * n_col_ + 1) * 16);
p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4);
off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int) * 2);
off_end = off + qlen + tlen - 1;
}
for (t = 0; t < qlen; ++t) qr[t] = query[qlen - 1 - t];
memcpy(sf, target, tlen);
// set the donor and acceptor arrays. TODO: this assumes 0/1/2/3 encoding!
if (flag & (KSW_EZ_SPLICE_FOR|KSW_EZ_SPLICE_REV)) {
memset(donor, -noncan, tlen_ * 16);
for (t = 0; t < tlen - 2; ++t) {
int is_can = 0; // is a canonical site
if ((flag & KSW_EZ_SPLICE_FOR) && target[t+1] == 2 && target[t+2] == 3) is_can = 1;
if ((flag & KSW_EZ_SPLICE_REV) && target[t+1] == 1 && target[t+2] == 3) is_can = 1;
if (is_can) ((int8_t*)donor)[t] = 0;
}
memset(acceptor, -noncan, tlen_ * 16);
for (t = 2; t < tlen; ++t) {
int is_can = 0;
if ((flag & KSW_EZ_SPLICE_FOR) && target[t-1] == 0 && target[t] == 2) is_can = 1;
if ((flag & KSW_EZ_SPLICE_REV) && target[t-1] == 0 && target[t] == 1) is_can = 1;
if (is_can) ((int8_t*)acceptor)[t] = 0;
}
}
for (r = 0, last_st = last_en = -1; r < qlen + tlen - 1; ++r) {
int st = 0, en = tlen - 1, st0, en0, st_, en_;
int8_t x1, x21, v1, *u8 = (int8_t*)u, *v8 = (int8_t*)v;
uint8_t *qrr = qr + (qlen - 1 - r);
__m128i x1_, x21_, v1_;
// find the boundaries
if (st < r - qlen + 1) st = r - qlen + 1;
if (en > r) en = r;
st0 = st, en0 = en;
st = st / 16 * 16, en = (en + 16) / 16 * 16 - 1;
// set boundary conditions
if (st > 0) {
if (st - 1 >= last_st && st - 1 <= last_en)
x1 = ((int8_t*)x)[st - 1], x21 = ((int8_t*)x2)[st - 1], v1 = v8[st - 1]; // (r-1,s-1) calculated in the last round
else x1 = -q - e, x21 = -q2, v1 = -q - e;
} else {
x1 = -q - e, x21 = -q2;
v1 = r == 0? -q - e : r < long_thres? -e : r == long_thres? long_diff : 0;
}
if (en >= r) {
((int8_t*)y)[r] = -q - e;
u8[r] = r == 0? -q - e : r < long_thres? -e : r == long_thres? long_diff : 0;
}
// loop fission: set scores first
if (!(flag & KSW_EZ_GENERIC_SC)) {
for (t = st0; t <= en0; t += 16) {
__m128i sq, st, tmp, mask;
sq = _mm_loadu_si128((__m128i*)&sf[t]);
st = _mm_loadu_si128((__m128i*)&qrr[t]);
mask = _mm_or_si128(_mm_cmpeq_epi8(sq, m1_), _mm_cmpeq_epi8(st, m1_));
tmp = _mm_cmpeq_epi8(sq, st);
#ifdef __SSE4_1__
tmp = _mm_blendv_epi8(sc_mis_, sc_mch_, tmp);
#else
tmp = _mm_or_si128(_mm_andnot_si128(tmp, sc_mis_), _mm_and_si128(tmp, sc_mch_));
#endif
tmp = _mm_andnot_si128(mask, tmp);
_mm_storeu_si128((__m128i*)((int8_t*)s + t), tmp);
}
} else {
for (t = st0; t <= en0; ++t)
((uint8_t*)s)[t] = mat[sf[t] * m + qrr[t]];
}
// core loop
x1_ = _mm_cvtsi32_si128((uint8_t)x1);
x21_ = _mm_cvtsi32_si128((uint8_t)x21);
v1_ = _mm_cvtsi32_si128((uint8_t)v1);
st_ = st / 16, en_ = en / 16;
assert(en_ - st_ + 1 <= n_col_);
if (!with_cigar) { // score only
for (t = st_; t <= en_; ++t) {
__m128i z, a, b, a2, a2a, xt1, x2t1, vt1, ut, tmp;
__dp_code_block1;
#ifdef __SSE4_1__
z = _mm_max_epi8(z, a);
z = _mm_max_epi8(z, b);
z = _mm_max_epi8(z, a2a);
__dp_code_block2; // save u[] and v[]; update a, b and a2
_mm_store_si128(&x[t], _mm_sub_epi8(_mm_max_epi8(a, zero_), qe_));
_mm_store_si128(&y[t], _mm_sub_epi8(_mm_max_epi8(b, zero_), qe_));
tmp = _mm_load_si128(&donor[t]);
_mm_store_si128(&x2[t], _mm_sub_epi8(_mm_max_epi8(a2, tmp), q2_));
#else
tmp = _mm_cmpgt_epi8(a, z);
z = _mm_or_si128(_mm_andnot_si128(tmp, z), _mm_and_si128(tmp, a));
tmp = _mm_cmpgt_epi8(b, z);
z = _mm_or_si128(_mm_andnot_si128(tmp, z), _mm_and_si128(tmp, b));
tmp = _mm_cmpgt_epi8(a2a, z);
z = _mm_or_si128(_mm_andnot_si128(tmp, z), _mm_and_si128(tmp, a2a));
__dp_code_block2;
tmp = _mm_cmpgt_epi8(a, zero_);
_mm_store_si128(&x[t], _mm_sub_epi8(_mm_and_si128(tmp, a), qe_));
tmp = _mm_cmpgt_epi8(b, zero_);
_mm_store_si128(&y[t], _mm_sub_epi8(_mm_and_si128(tmp, b), qe_));
tmp = _mm_load_si128(&donor[t]); // TODO: check if this is correct
tmp = _mm_cmpgt_epi8(a2, tmp);
tmp = _mm_or_si128(_mm_andnot_si128(tmp, tmp), _mm_and_si128(tmp, a2));
_mm_store_si128(&x2[t], _mm_sub_epi8(tmp, q2_));
#endif
}
} else if (!(flag&KSW_EZ_RIGHT)) { // gap left-alignment
__m128i *pr = p + r * n_col_ - st_;
off[r] = st, off_end[r] = en;
for (t = st_; t <= en_; ++t) {
__m128i d, z, a, b, a2, a2a, xt1, x2t1, vt1, ut, tmp, tmp2;
__dp_code_block1;
#ifdef __SSE4_1__
d = _mm_and_si128(_mm_cmpgt_epi8(a, z), _mm_set1_epi8(1)); // d = a > z? 1 : 0
z = _mm_max_epi8(z, a);
d = _mm_blendv_epi8(d, _mm_set1_epi8(2), _mm_cmpgt_epi8(b, z)); // d = b > z? 2 : d
z = _mm_max_epi8(z, b);
d = _mm_blendv_epi8(d, _mm_set1_epi8(3), _mm_cmpgt_epi8(a2a, z)); // d = a2 > z? 3 : d
z = _mm_max_epi8(z, a2a);
#else // we need to emulate SSE4.1 intrinsics _mm_max_epi8() and _mm_blendv_epi8()
tmp = _mm_cmpgt_epi8(a, z);
d = _mm_and_si128(tmp, _mm_set1_epi8(1));
z = _mm_or_si128(_mm_andnot_si128(tmp, z), _mm_and_si128(tmp, a));
tmp = _mm_cmpgt_epi8(b, z);
d = _mm_or_si128(_mm_andnot_si128(tmp, d), _mm_and_si128(tmp, _mm_set1_epi8(2)));
z = _mm_or_si128(_mm_andnot_si128(tmp, z), _mm_and_si128(tmp, b));
tmp = _mm_cmpgt_epi8(a2a, z);
d = _mm_or_si128(_mm_andnot_si128(tmp, d), _mm_and_si128(tmp, _mm_set1_epi8(3)));
z = _mm_or_si128(_mm_andnot_si128(tmp, z), _mm_and_si128(tmp, a2a));
#endif
__dp_code_block2;
tmp = _mm_cmpgt_epi8(a, zero_);
_mm_store_si128(&x[t], _mm_sub_epi8(_mm_and_si128(tmp, a), qe_));
d = _mm_or_si128(d, _mm_and_si128(tmp, _mm_set1_epi8(0x08))); // d = a > 0? 1<<3 : 0
tmp = _mm_cmpgt_epi8(b, zero_);
_mm_store_si128(&y[t], _mm_sub_epi8(_mm_and_si128(tmp, b), qe_));
d = _mm_or_si128(d, _mm_and_si128(tmp, _mm_set1_epi8(0x10))); // d = b > 0? 1<<4 : 0
tmp2 = _mm_load_si128(&donor[t]);
tmp = _mm_cmpgt_epi8(a2, tmp2);
#ifdef __SSE4_1__
tmp2 = _mm_max_epi8(a2, tmp2);
#else
tmp2 = _mm_or_si128(_mm_andnot_si128(tmp, tmp2), _mm_and_si128(tmp, a2));
#endif
_mm_store_si128(&x2[t], _mm_sub_epi8(tmp2, q2_));
d = _mm_or_si128(d, _mm_and_si128(tmp, _mm_set1_epi8(0x20)));
_mm_store_si128(&pr[t], d);
}
} else { // gap right-alignment
__m128i *pr = p + r * n_col_ - st_;
off[r] = st, off_end[r] = en;
for (t = st_; t <= en_; ++t) {
__m128i d, z, a, b, a2, a2a, xt1, x2t1, vt1, ut, tmp, tmp2;
__dp_code_block1;
#ifdef __SSE4_1__
d = _mm_andnot_si128(_mm_cmpgt_epi8(z, a), _mm_set1_epi8(1)); // d = z > a? 0 : 1
z = _mm_max_epi8(z, a);
d = _mm_blendv_epi8(_mm_set1_epi8(2), d, _mm_cmpgt_epi8(z, b)); // d = z > b? d : 2
z = _mm_max_epi8(z, b);
d = _mm_blendv_epi8(_mm_set1_epi8(3), d, _mm_cmpgt_epi8(z, a2a)); // d = z > a2? d : 3
z = _mm_max_epi8(z, a2a);
#else // we need to emulate SSE4.1 intrinsics _mm_max_epi8() and _mm_blendv_epi8()
tmp = _mm_cmpgt_epi8(z, a);
d = _mm_andnot_si128(tmp, _mm_set1_epi8(1));
z = _mm_or_si128(_mm_and_si128(tmp, z), _mm_andnot_si128(tmp, a));
tmp = _mm_cmpgt_epi8(z, b);
d = _mm_or_si128(_mm_and_si128(tmp, d), _mm_andnot_si128(tmp, _mm_set1_epi8(2)));
z = _mm_or_si128(_mm_and_si128(tmp, z), _mm_andnot_si128(tmp, b));
tmp = _mm_cmpgt_epi8(z, a2a);
d = _mm_or_si128(_mm_and_si128(tmp, d), _mm_andnot_si128(tmp, _mm_set1_epi8(3)));
z = _mm_or_si128(_mm_and_si128(tmp, z), _mm_andnot_si128(tmp, a2a));
#endif
__dp_code_block2;
tmp = _mm_cmpgt_epi8(zero_, a);
_mm_store_si128(&x[t], _mm_sub_epi8(_mm_andnot_si128(tmp, a), qe_));
d = _mm_or_si128(d, _mm_andnot_si128(tmp, _mm_set1_epi8(0x08))); // d = a > 0? 1<<3 : 0
tmp = _mm_cmpgt_epi8(zero_, b);
_mm_store_si128(&y[t], _mm_sub_epi8(_mm_andnot_si128(tmp, b), qe_));
d = _mm_or_si128(d, _mm_andnot_si128(tmp, _mm_set1_epi8(0x10))); // d = b > 0? 1<<4 : 0
tmp2 = _mm_load_si128(&donor[t]);
tmp = _mm_cmpgt_epi8(tmp2, a2);
#ifdef __SSE4_1__
tmp2 = _mm_max_epi8(tmp2, a2);
#else
tmp2 = _mm_or_si128(_mm_andnot_si128(tmp, a2), _mm_and_si128(tmp, tmp2));
#endif
_mm_store_si128(&x2[t], _mm_sub_epi8(tmp2, q2_));
d = _mm_or_si128(d, _mm_andnot_si128(tmp, _mm_set1_epi8(0x20))); // d = a > 0? 1<<5 : 0
_mm_store_si128(&pr[t], d);
}
}
if (!approx_max) { // find the exact max with a 32-bit score array
int32_t max_H, max_t;
// compute H[], max_H and max_t
if (r > 0) {
int32_t HH[4], tt[4], en1 = st0 + (en0 - st0) / 4 * 4, i;
__m128i max_H_, max_t_;
max_H = H[en0] = en0 > 0? H[en0-1] + u8[en0] : H[en0] + v8[en0]; // special casing the last element
max_t = en0;
max_H_ = _mm_set1_epi32(max_H);
max_t_ = _mm_set1_epi32(max_t);
for (t = st0; t < en1; t += 4) { // this implements: H[t]+=v8[t]-qe; if(H[t]>max_H) max_H=H[t],max_t=t;
__m128i H1, tmp, t_;
H1 = _mm_loadu_si128((__m128i*)&H[t]);
t_ = _mm_setr_epi32(v8[t], v8[t+1], v8[t+2], v8[t+3]);
H1 = _mm_add_epi32(H1, t_);
_mm_storeu_si128((__m128i*)&H[t], H1);
t_ = _mm_set1_epi32(t);
tmp = _mm_cmpgt_epi32(H1, max_H_);
#ifdef __SSE4_1__
max_H_ = _mm_blendv_epi8(max_H_, H1, tmp);
max_t_ = _mm_blendv_epi8(max_t_, t_, tmp);
#else
max_H_ = _mm_or_si128(_mm_and_si128(tmp, H1), _mm_andnot_si128(tmp, max_H_));
max_t_ = _mm_or_si128(_mm_and_si128(tmp, t_), _mm_andnot_si128(tmp, max_t_));
#endif
}
_mm_storeu_si128((__m128i*)HH, max_H_);
_mm_storeu_si128((__m128i*)tt, max_t_);
for (i = 0; i < 4; ++i)
if (max_H < HH[i]) max_H = HH[i], max_t = tt[i] + i;
for (; t < en0; ++t) { // for the rest of values that haven't been computed with SSE
H[t] += (int32_t)v8[t];
if (H[t] > max_H)
max_H = H[t], max_t = t;
}
} else H[0] = v8[0] - qe, max_H = H[0], max_t = 0; // special casing r==0
// update ez
if (en0 == tlen - 1 && H[en0] > ez->mte)
ez->mte = H[en0], ez->mte_q = r - en;
if (r - st0 == qlen - 1 && H[st0] > ez->mqe)
ez->mqe = H[st0], ez->mqe_t = st0;
if (ksw_apply_zdrop(ez, 1, max_H, r, max_t, zdrop, 0)) break;
if (r == qlen + tlen - 2 && en0 == tlen - 1)
ez->score = H[tlen - 1];
} else { // find approximate max; Z-drop might be inaccurate, too.
if (r > 0) {
if (last_H0_t >= st0 && last_H0_t <= en0 && last_H0_t + 1 >= st0 && last_H0_t + 1 <= en0) {
int32_t d0 = v8[last_H0_t];
int32_t d1 = u8[last_H0_t + 1];
if (d0 > d1) H0 += d0;
else H0 += d1, ++last_H0_t;
} else if (last_H0_t >= st0 && last_H0_t <= en0) {
H0 += v8[last_H0_t];
} else {
++last_H0_t, H0 += u8[last_H0_t];
}
} else H0 = v8[0] - qe, last_H0_t = 0;
if ((flag & KSW_EZ_APPROX_DROP) && ksw_apply_zdrop(ez, 1, H0, r, last_H0_t, zdrop, 0)) break;
if (r == qlen + tlen - 2 && en0 == tlen - 1)
ez->score = H0;
}
last_st = st, last_en = en;
//for (t = st0; t <= en0; ++t) printf("(%d,%d)\t(%d,%d,%d,%d)\t%d\n", r, t, ((int8_t*)u)[t], ((int8_t*)v)[t], ((int8_t*)x)[t], ((int8_t*)y)[t], H[t]); // for debugging
}
kfree(km, mem);
if (!approx_max) kfree(km, H);
if (with_cigar) { // backtrack
int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY))
ksw_backtrack(km, 1, rev_cigar, 1, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
else if (ez->max_t >= 0 && ez->max_q >= 0)
ksw_backtrack(km, 1, rev_cigar, 1, (uint8_t*)p, off, off_end, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
kfree(km, mem2); kfree(km, off);
}
}
#endif // __SSE2__
+12 -23
View File
@@ -1,4 +1,5 @@
#include <string.h> #include <string.h>
#include <assert.h>
#include "ksw2.h" #include "ksw2.h"
#ifdef __SSE2__ #ifdef __SSE2__
@@ -33,7 +34,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
a = _mm_sub_epi8(a, z); \ a = _mm_sub_epi8(a, z); \
b = _mm_sub_epi8(b, z); b = _mm_sub_epi8(b, z);
int r, t, qe = q + e, n_col_, *off = 0, tlen_, qlen_, last_st, last_en, wl, wr, max_sc, min_sc; int r, t, qe = q + e, n_col_, *off = 0, *off_end = 0, tlen_, qlen_, last_st, last_en, wl, wr, max_sc, min_sc;
int with_cigar = !(flag&KSW_EZ_SCORE_ONLY), approx_max = !!(flag&KSW_EZ_APPROX_MAX); int with_cigar = !(flag&KSW_EZ_SCORE_ONLY), approx_max = !!(flag&KSW_EZ_APPROX_MAX);
int32_t *H = 0, H0 = 0, last_H0_t = 0; int32_t *H = 0, H0 = 0, last_H0_t = 0;
uint8_t *qr, *sf, *mem, *mem2 = 0; uint8_t *qr, *sf, *mem, *mem2 = 0;
@@ -58,7 +59,8 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
if (w < 0) w = tlen > qlen? tlen : qlen; if (w < 0) w = tlen > qlen? tlen : qlen;
wl = wr = w; wl = wr = w;
tlen_ = (tlen + 15) / 16; tlen_ = (tlen + 15) / 16;
n_col_ = ((w + 1 < tlen? (w + 1 < qlen? w + 1 : qlen): tlen) + 15) / 16 + 1; n_col_ = qlen < tlen? qlen : tlen;
n_col_ = ((n_col_ < w + 1? n_col_ : w + 1) + 15) / 16 + 1;
qlen_ = (qlen + 15) / 16; qlen_ = (qlen + 15) / 16;
for (t = 1, max_sc = mat[0], min_sc = mat[1]; t < m * m; ++t) { for (t = 1, max_sc = mat[0], min_sc = mat[1]; t < m * m; ++t) {
max_sc = max_sc > mat[t]? max_sc : mat[t]; max_sc = max_sc > mat[t]? max_sc : mat[t];
@@ -76,7 +78,8 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
if (with_cigar) { if (with_cigar) {
mem2 = (uint8_t*)kmalloc(km, ((qlen + tlen - 1) * n_col_ + 1) * 16); mem2 = (uint8_t*)kmalloc(km, ((qlen + tlen - 1) * n_col_ + 1) * 16);
p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4); p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4);
off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int)); off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int) * 2);
off_end = off + qlen + tlen - 1;
} }
for (t = 0; t < qlen; ++t) qr[t] = query[qlen - 1 - t]; for (t = 0; t < qlen; ++t) qr[t] = query[qlen - 1 - t];
@@ -85,7 +88,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
for (r = 0, last_st = last_en = -1; r < qlen + tlen - 1; ++r) { for (r = 0, last_st = last_en = -1; r < qlen + tlen - 1; ++r) {
int st = 0, en = tlen - 1, st0, en0, st_, en_; int st = 0, en = tlen - 1, st0, en0, st_, en_;
int8_t x1, v1; int8_t x1, v1;
uint8_t *qrr = qr + (qlen - 1 - r), *u8 = (uint8_t*)u, *v8 = (uint8_t*)v, *x8 = (uint8_t*)x, p_en0 = 0; uint8_t *qrr = qr + (qlen - 1 - r), *u8 = (uint8_t*)u, *v8 = (uint8_t*)v;
__m128i x1_, v1_; __m128i x1_, v1_;
// find the boundaries // find the boundaries
if (st < r - qlen + 1) st = r - qlen + 1; if (st < r - qlen + 1) st = r - qlen + 1;
@@ -129,6 +132,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
x1_ = _mm_cvtsi32_si128(x1); x1_ = _mm_cvtsi32_si128(x1);
v1_ = _mm_cvtsi32_si128(v1); v1_ = _mm_cvtsi32_si128(v1);
st_ = st / 16, en_ = en / 16; st_ = st / 16, en_ = en / 16;
assert(en_ - st_ + 1 <= n_col_);
if (!with_cigar) { // score only if (!with_cigar) { // score only
for (t = st_; t <= en_; ++t) { for (t = st_; t <= en_; ++t) {
__m128i z, a, b, xt1, vt1, ut, tmp; __m128i z, a, b, xt1, vt1, ut, tmp;
@@ -152,14 +156,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
} }
} else if (!(flag&KSW_EZ_RIGHT)) { // gap left-alignment } else if (!(flag&KSW_EZ_RIGHT)) { // gap left-alignment
__m128i *pr = p + r * n_col_ - st_; __m128i *pr = p + r * n_col_ - st_;
off[r] = st; off[r] = st, off_end[r] = en;
if (en0 < r && en0 < tlen - 1) { // to avoid backtracking out of the band; this assumes a fixed band
int8_t a, z = ((uint8_t*)s)[en0] + 2 * qe;
a = x8[en0-1] + v8[en0-1];
p_en0 = a > z? 1 : 0;
z = a > z? a : z;
p_en0 |= a - (z - q) > 0? 0x08 : 0;
}
for (t = st_; t <= en_; ++t) { for (t = st_; t <= en_; ++t) {
__m128i d, z, a, b, xt1, vt1, ut, tmp; __m128i d, z, a, b, xt1, vt1, ut, tmp;
__dp_code_block1; __dp_code_block1;
@@ -185,14 +182,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
} }
} else { // gap right-alignment } else { // gap right-alignment
__m128i *pr = p + r * n_col_ - st_; __m128i *pr = p + r * n_col_ - st_;
off[r] = st; off[r] = st, off_end[r] = en;
if (en0 < r && en0 < tlen - 1) {
int8_t a, z = ((uint8_t*)s)[en0] + 2 * qe;
a = x8[en0-1] + v8[en0-1];
p_en0 = a >= z? 1 : 0;
z = a >= z? a : z;
p_en0 |= a - (z - q) >= 0? 0x08 : 0;
}
for (t = st_; t <= en_; ++t) { for (t = st_; t <= en_; ++t) {
__m128i d, z, a, b, xt1, vt1, ut, tmp; __m128i d, z, a, b, xt1, vt1, ut, tmp;
__dp_code_block1; __dp_code_block1;
@@ -217,7 +207,6 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
_mm_store_si128(&pr[t], d); _mm_store_si128(&pr[t], d);
} }
} }
if (with_cigar && en0 < r && en0 < tlen - 1) ((uint8_t*)(p + r * n_col_))[en0 - st] = p_en0;
if (!approx_max) { // find the exact max with a 32-bit score array if (!approx_max) { // find the exact max with a 32-bit score array
int32_t max_H, max_t; int32_t max_H, max_t;
// compute H[], max_H and max_t // compute H[], max_H and max_t
@@ -289,9 +278,9 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
if (with_cigar) { // backtrack if (with_cigar) { // backtrack
int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR); int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY)) if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY))
ksw_backtrack(km, 1, rev_cigar, (uint8_t*)p, off, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar); ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
else if (ez->max_t >= 0 && ez->max_q >= 0) else if (ez->max_t >= 0 && ez->max_q >= 0)
ksw_backtrack(km, 1, rev_cigar, (uint8_t*)p, off, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar); ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
kfree(km, mem2); kfree(km, off); kfree(km, mem2); kfree(km, off);
} }
} }
+147
View File
@@ -0,0 +1,147 @@
#include <stdlib.h>
#include <stdint.h>
#include <string.h>
#include <emmintrin.h>
#include "ksw2.h"
#ifdef __GNUC__
#define LIKELY(x) __builtin_expect((x),1)
#define UNLIKELY(x) __builtin_expect((x),0)
#else
#define LIKELY(x) (x)
#define UNLIKELY(x) (x)
#endif
typedef struct {
int qlen, slen;
uint8_t shift, mdiff, max, size;
__m128i *qp, *H0, *H1, *E, *Hmax;
} kswq_t;
/**
* Initialize the query data structure
*
* @param size Number of bytes used to store a score; valid valures are 1 or 2
* @param qlen Length of the query sequence
* @param query Query sequence
* @param m Size of the alphabet
* @param mat Scoring matrix in a one-dimension array
*
* @return Query data structure
*/
void *ksw_ll_qinit(void *km, int size, int qlen, const uint8_t *query, int m, const int8_t *mat)
{
kswq_t *q;
int slen, a, tmp, p;
size = size > 1? 2 : 1;
p = 8 * (3 - size); // # values per __m128i
slen = (qlen + p - 1) / p; // segmented length
q = (kswq_t*)kmalloc(km, sizeof(kswq_t) + 256 + 16 * slen * (m + 4)); // a single block of memory
q->qp = (__m128i*)(((size_t)q + sizeof(kswq_t) + 15) >> 4 << 4); // align memory
q->H0 = q->qp + slen * m;
q->H1 = q->H0 + slen;
q->E = q->H1 + slen;
q->Hmax = q->E + slen;
q->slen = slen; q->qlen = qlen; q->size = size;
// compute shift
tmp = m * m;
for (a = 0, q->shift = 127, q->mdiff = 0; a < tmp; ++a) { // find the minimum and maximum score
if (mat[a] < (int8_t)q->shift) q->shift = mat[a];
if (mat[a] > (int8_t)q->mdiff) q->mdiff = mat[a];
}
q->max = q->mdiff;
q->shift = 256 - q->shift; // NB: q->shift is uint8_t
q->mdiff += q->shift; // this is the difference between the min and max scores
// An example: p=8, qlen=19, slen=3 and segmentation:
// {{0,3,6,9,12,15,18,-1},{1,4,7,10,13,16,-1,-1},{2,5,8,11,14,17,-1,-1}}
if (size == 1) {
int8_t *t = (int8_t*)q->qp;
for (a = 0; a < m; ++a) {
int i, k, nlen = slen * p;
const int8_t *ma = mat + a * m;
for (i = 0; i < slen; ++i)
for (k = i; k < nlen; k += slen) // p iterations
*t++ = (k >= qlen? 0 : ma[query[k]]) + q->shift;
}
} else {
int16_t *t = (int16_t*)q->qp;
for (a = 0; a < m; ++a) {
int i, k, nlen = slen * p;
const int8_t *ma = mat + a * m;
for (i = 0; i < slen; ++i)
for (k = i; k < nlen; k += slen) // p iterations
*t++ = (k >= qlen? 0 : ma[query[k]]);
}
}
return q;
}
int ksw_ll_i16(void *q_, int tlen, const uint8_t *target, int _gapo, int _gape, int *qe, int *te)
{
kswq_t *q = (kswq_t*)q_;
int slen, i, gmax = 0, qlen8;
__m128i zero, gapoe, gape, *H0, *H1, *E, *Hmax;
uint16_t *H8;
#define __max_8(ret, xx) do { \
(xx) = _mm_max_epi16((xx), _mm_srli_si128((xx), 8)); \
(xx) = _mm_max_epi16((xx), _mm_srli_si128((xx), 4)); \
(xx) = _mm_max_epi16((xx), _mm_srli_si128((xx), 2)); \
(ret) = _mm_extract_epi16((xx), 0); \
} while (0)
// initialization
*qe = *te = -1;
zero = _mm_set1_epi32(0);
gapoe = _mm_set1_epi16(_gapo + _gape);
gape = _mm_set1_epi16(_gape);
H0 = q->H0; H1 = q->H1; E = q->E; Hmax = q->Hmax;
slen = q->slen, qlen8 = slen * 8;
memset(E, 0, slen * sizeof(__m128i));
memset(H0, 0, slen * sizeof(__m128i));
memset(Hmax, 0, slen * sizeof(__m128i));
// the core loop
for (i = 0; i < tlen; ++i) {
int j, k, imax;
__m128i e, h, f = zero, max = zero, *S = q->qp + target[i] * slen; // s is the 1st score vector
h = _mm_load_si128(H0 + slen - 1); // h={2,5,8,11,14,17,-1,-1} in the above example
h = _mm_slli_si128(h, 2);
for (j = 0; LIKELY(j < slen); ++j) {
h = _mm_adds_epi16(h, *S++);
e = _mm_load_si128(E + j);
h = _mm_max_epi16(h, e);
h = _mm_max_epi16(h, f);
max = _mm_max_epi16(max, h);
_mm_store_si128(H1 + j, h);
h = _mm_subs_epu16(h, gapoe);
e = _mm_subs_epu16(e, gape);
e = _mm_max_epi16(e, h);
_mm_store_si128(E + j, e);
f = _mm_subs_epu16(f, gape);
f = _mm_max_epi16(f, h);
h = _mm_load_si128(H0 + j);
}
for (k = 0; LIKELY(k < 16); ++k) {
f = _mm_slli_si128(f, 2);
for (j = 0; LIKELY(j < slen); ++j) {
h = _mm_load_si128(H1 + j);
h = _mm_max_epi16(h, f);
_mm_store_si128(H1 + j, h);
h = _mm_subs_epu16(h, gapoe);
f = _mm_subs_epu16(f, gape);
if(UNLIKELY(!_mm_movemask_epi8(_mm_cmpgt_epi16(f, h)))) goto end_loop_i16;
}
}
end_loop_i16:
__max_8(imax, max);
if (imax >= gmax) {
gmax = imax; *te = i;
memcpy(Hmax, H1, slen * sizeof(__m128i));
}
S = H1; H1 = H0; H0 = S;
}
for (i = 0, H8 = (uint16_t*)Hmax; i < qlen8; ++i)
if ((int)H8[i] == gmax) *qe = i / 8 + i % 8 * slen;
return gmax;
}
+117 -67
View File
@@ -8,7 +8,7 @@
#include "minimap.h" #include "minimap.h"
#include "mmpriv.h" #include "mmpriv.h"
#define MM_VERSION "2.0-r191-dirty" #define MM_VERSION "2.1-r311"
void liftrlimit() void liftrlimit()
{ {
@@ -30,6 +30,12 @@ static struct option long_options[] = {
{ "print-seed", no_argument, 0, 0 }, { "print-seed", no_argument, 0, 0 },
{ "max-chain-skip", required_argument, 0, 0 }, { "max-chain-skip", required_argument, 0, 0 },
{ "min-dp-len", required_argument, 0, 0 }, { "min-dp-len", required_argument, 0, 0 },
{ "print-aln-seq", no_argument, 0, 0 },
{ "splice", no_argument, 0, 0 },
{ "cost-non-gt-ag", required_argument, 0, 0 },
{ "no-sam-sq", no_argument, 0, 0 },
{ "help", no_argument, 0, 'h' },
{ "max-intron-len", required_argument, 0, 'G' },
{ "version", no_argument, 0, 'V' }, { "version", no_argument, 0, 'V' },
{ "min-count", required_argument, 0, 'n' }, { "min-count", required_argument, 0, 'n' },
{ "min-chain-score",required_argument, 0, 'm' }, { "min-chain-score",required_argument, 0, 'm' },
@@ -39,34 +45,47 @@ static struct option long_options[] = {
{ 0, 0, 0, 0} { 0, 0, 0, 0}
}; };
static inline int64_t mm_parse_num(const char *str)
{
double x;
char *p;
x = strtod(optarg, &p);
if (*p == 'G' || *p == 'g') x *= 1e9;
else if (*p == 'M' || *p == 'm') x *= 1e6;
else if (*p == 'K' || *p == 'k') x *= 1e3;
return (int64_t)(x + .499);
}
int main(int argc, char *argv[]) int main(int argc, char *argv[])
{ {
mm_mapopt_t opt; mm_mapopt_t opt;
int i, c, k = 15, w = -1, bucket_bits = MM_IDX_DEF_B, n_threads = 3, keep_name = 1, is_idx, is_hpc = 0, long_idx, idx_par_set = 0; int i, c, k = 15, w = -1, bucket_bits = MM_IDX_DEF_B, n_threads = 3, keep_name = 1, is_idx, is_hpc = 0, long_idx, idx_par_set = 0, max_intron_len = 0, n_idx_part = 0;
int minibatch_size = 200000000; int minibatch_size = 200000000;
uint64_t batch_size = 4000000000ULL; uint64_t batch_size = 4000000000ULL;
mm_bseq_file_t *fp = 0; mm_bseq_file_t *fp = 0;
char *fnw = 0, *s; char *fnw = 0, *rg = 0, *s;
FILE *fpr = 0, *fpw = 0; FILE *fpr = 0, *fpw = 0, *fp_help = stderr;
liftrlimit(); liftrlimit();
mm_realtime0 = realtime(); mm_realtime0 = realtime();
mm_mapopt_init(&opt); mm_mapopt_init(&opt);
while ((c = getopt_long(argc, argv, "aw:k:K:t:r:f:Vv:g:I:d:XT:s:x:Hcp:M:n:z:A:B:O:E:m:N:Q", long_options, &long_idx)) >= 0) { while ((c = getopt_long(argc, argv, "aSw:k:K:t:r:f:Vv:g:G:I:d:XT:s:x:Hcp:M:n:z:A:B:O:E:m:N:Qu:R:h", long_options, &long_idx)) >= 0) {
if (c == 'w') w = atoi(optarg), idx_par_set = 1; if (c == 'w') w = atoi(optarg), idx_par_set = 1;
else if (c == 'k') k = atoi(optarg), idx_par_set = 1; else if (c == 'k') k = atoi(optarg), idx_par_set = 1;
else if (c == 'H') is_hpc = 1, idx_par_set = 1; else if (c == 'H') is_hpc = 1, idx_par_set = 1;
else if (c == 'd') fnw = optarg; // the above are indexing related options, except -I else if (c == 'd') fnw = optarg; // the above are indexing related options, except -I
else if (c == 'r') opt.bw = atoi(optarg); else if (c == 'r') opt.bw = (int)mm_parse_num(optarg);
else if (c == 'f') opt.mid_occ_frac = atof(optarg); else if (c == 'f') opt.mid_occ_frac = atof(optarg);
else if (c == 't') n_threads = atoi(optarg); else if (c == 't') n_threads = atoi(optarg);
else if (c == 'v') mm_verbose = atoi(optarg); else if (c == 'v') mm_verbose = atoi(optarg);
else if (c == 'g') opt.max_gap = atoi(optarg); else if (c == 'g') opt.max_gap = (int)mm_parse_num(optarg);
else if (c == 'G') max_intron_len = (int)mm_parse_num(optarg);
else if (c == 'N') opt.best_n = atoi(optarg); else if (c == 'N') opt.best_n = atoi(optarg);
else if (c == 'p') opt.pri_ratio = atof(optarg); else if (c == 'p') opt.pri_ratio = atof(optarg);
else if (c == 'M') opt.mask_level = atof(optarg); else if (c == 'M') opt.mask_level = atof(optarg);
else if (c == 'c') opt.flag |= MM_F_CIGAR; else if (c == 'c') opt.flag |= MM_F_OUT_CG | MM_F_CIGAR;
else if (c == 'S') opt.flag |= MM_F_OUT_CS | MM_F_CIGAR;
else if (c == 'X') opt.flag |= MM_F_AVA | MM_F_NO_SELF; else if (c == 'X') opt.flag |= MM_F_AVA | MM_F_NO_SELF;
else if (c == 'a') opt.flag |= MM_F_OUT_SAM | MM_F_CIGAR; else if (c == 'a') opt.flag |= MM_F_OUT_SAM | MM_F_CIGAR;
else if (c == 'Q') opt.flag |= MM_F_NO_QUAL; else if (c == 'Q') opt.flag |= MM_F_NO_QUAL;
@@ -77,6 +96,10 @@ int main(int argc, char *argv[])
else if (c == 'B') opt.b = atoi(optarg); else if (c == 'B') opt.b = atoi(optarg);
else if (c == 'z') opt.zdrop = atoi(optarg); else if (c == 'z') opt.zdrop = atoi(optarg);
else if (c == 's') opt.min_dp_max = atoi(optarg); else if (c == 's') opt.min_dp_max = atoi(optarg);
else if (c == 'I') batch_size = mm_parse_num(optarg);
else if (c == 'K') minibatch_size = (int)mm_parse_num(optarg);
else if (c == 'R') rg = optarg;
else if (c == 'h') fp_help = stdout;
else if (c == 0 && long_idx == 0) bucket_bits = atoi(optarg); // --bucket-bits else if (c == 0 && long_idx == 0) bucket_bits = atoi(optarg); // --bucket-bits
else if (c == 0 && long_idx == 2) keep_name = 0; // --int-rname else if (c == 0 && long_idx == 2) keep_name = 0; // --int-rname
else if (c == 0 && long_idx == 3) mm_dbg_flag |= MM_DBG_NO_KALLOC; // --no-kalloc else if (c == 0 && long_idx == 3) mm_dbg_flag |= MM_DBG_NO_KALLOC; // --no-kalloc
@@ -85,24 +108,29 @@ int main(int argc, char *argv[])
else if (c == 0 && long_idx == 6) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_SEED; // --print-seed else if (c == 0 && long_idx == 6) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_SEED; // --print-seed
else if (c == 0 && long_idx == 7) opt.max_chain_skip = atoi(optarg); // --max-chain-skip else if (c == 0 && long_idx == 7) opt.max_chain_skip = atoi(optarg); // --max-chain-skip
else if (c == 0 && long_idx == 8) opt.min_ksw_len = atoi(optarg); // --min-dp-len else if (c == 0 && long_idx == 8) opt.min_ksw_len = atoi(optarg); // --min-dp-len
else if (c == 0 && long_idx == 9) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_ALN_SEQ; // --print-aln-seq
else if (c == 0 && long_idx ==10) opt.flag |= MM_F_SPLICE; // --splice
else if (c == 0 && long_idx ==11) opt.noncan = atoi(optarg); // --cost-non-gt-ag
else if (c == 0 && long_idx ==12) opt.flag |= MM_F_NO_SAM_SQ; // --no-sam-sq
else if (c == 'V') { else if (c == 'V') {
puts(MM_VERSION); puts(MM_VERSION);
return 0; return 0;
} else if (c == 'u') {
if (*optarg == 'b') opt.flag |= MM_F_SPLICE_FOR|MM_F_SPLICE_REV;
else if (*optarg == 'B') opt.flag |= MM_F_SPLICE_BOTH;
else if (*optarg == 'f') opt.flag |= MM_F_SPLICE_FOR, opt.flag &= ~MM_F_SPLICE_REV;
else if (*optarg == 'r') opt.flag |= MM_F_SPLICE_REV, opt.flag &= ~MM_F_SPLICE_FOR;
else if (*optarg == 'n') opt.flag &= ~(MM_F_SPLICE_FOR|MM_F_SPLICE_REV);
else {
fprintf(stderr, "[E::%s] unrecognized cDNA direction\n", __func__);
return 1;
}
} else if (c == 'O') { } else if (c == 'O') {
opt.q = opt.q2 = strtol(optarg, &s, 10); opt.q = opt.q2 = strtol(optarg, &s, 10);
if (*s == ',') opt.q2 = strtol(s + 1, &s, 10); if (*s == ',') opt.q2 = strtol(s + 1, &s, 10);
} else if (c == 'E') { } else if (c == 'E') {
opt.e = opt.e2 = strtol(optarg, &s, 10); opt.e = opt.e2 = strtol(optarg, &s, 10);
if (*s == ',') opt.e2 = strtol(s + 1, &s, 10); if (*s == ',') opt.e2 = strtol(s + 1, &s, 10);
} else if (c == 'I' || c == 'K') {
double x;
char *p;
x = strtod(optarg, &p);
if (*p == 'G' || *p == 'g') x *= 1e9;
else if (*p == 'M' || *p == 'm') x *= 1e6;
else if (*p == 'K' || *p == 'k') x *= 1e3;
if (c == 'I') batch_size = (uint64_t)(x + .499);
else minibatch_size = (uint64_t)(x + .499);
} else if (c == 'x') { } else if (c == 'x') {
if (strcmp(optarg, "ava-ont") == 0) { if (strcmp(optarg, "ava-ont") == 0) {
opt.flag |= MM_F_AVA | MM_F_NO_SELF; opt.flag |= MM_F_AVA | MM_F_NO_SELF;
@@ -126,6 +154,13 @@ int main(int argc, char *argv[])
k = 19, w = 19; k = 19, w = 19;
opt.a = 1, opt.b = 9, opt.q = 16, opt.q2 = 41, opt.e = 2, opt.e2 = 1, opt.zdrop = 200; opt.a = 1, opt.b = 9, opt.q = 16, opt.q2 = 41, opt.e = 2, opt.e2 = 1, opt.zdrop = 200;
opt.min_dp_max = 200; opt.min_dp_max = 200;
} else if (strcmp(optarg, "splice") == 0 || strcmp(optarg, "cdna") == 0) {
k = 15, w = 5;
opt.flag |= MM_F_SPLICE | MM_F_SPLICE_FOR | MM_F_SPLICE_REV;
opt.max_gap = 2000, opt.max_gap_ref = opt.bw = 200000;
opt.a = 1, opt.b = 2, opt.q = 2, opt.e = 1, opt.q2 = 32, opt.e2 = 0;
opt.noncan = 5;
opt.zdrop = 200;
} else { } else {
fprintf(stderr, "[E::%s] unknown preset '%s'\n", __func__, optarg); fprintf(stderr, "[E::%s] unknown preset '%s'\n", __func__, optarg);
return 1; return 1;
@@ -133,72 +168,87 @@ int main(int argc, char *argv[])
} }
} }
if (w < 0) w = (int)(.6666667 * k + .499); if (w < 0) w = (int)(.6666667 * k + .499);
if ((opt.flag & MM_F_SPLICE) && max_intron_len > 0)
opt.max_gap_ref = opt.bw = max_intron_len;
if (argc == optind) { if (argc == optind || fp_help == stdout) {
fprintf(stderr, "Usage: minimap2 [options] <target.fa>|<target.idx> [query.fa] [...]\n"); fprintf(fp_help, "Usage: minimap2 [options] <target.fa>|<target.idx> [query.fa] [...]\n");
fprintf(stderr, "Options:\n"); fprintf(fp_help, "Options:\n");
fprintf(stderr, " Indexing:\n"); fprintf(fp_help, " Indexing:\n");
fprintf(stderr, " -H use homopolymer-compressed k-mer\n"); fprintf(fp_help, " -H use homopolymer-compressed k-mer\n");
fprintf(stderr, " -k INT k-mer size (no larger than 28) [%d]\n", k); fprintf(fp_help, " -k INT k-mer size (no larger than 28) [%d]\n", k);
fprintf(stderr, " -w INT minizer window size [{-k}*2/3]\n"); fprintf(fp_help, " -w INT minizer window size [{-k}*2/3]\n");
fprintf(stderr, " -I NUM split index for every ~NUM input bases [4G]\n"); fprintf(fp_help, " -I NUM split index for every ~NUM input bases [4G]\n");
fprintf(stderr, " -d FILE dump index to FILE []\n"); fprintf(fp_help, " -d FILE dump index to FILE []\n");
fprintf(stderr, " Mapping:\n"); fprintf(fp_help, " Mapping:\n");
fprintf(stderr, " -f FLOAT filter out top FLOAT fraction of repetitive minimizers [%g]\n", opt.mid_occ_frac); fprintf(fp_help, " -f FLOAT filter out top FLOAT fraction of repetitive minimizers [%g]\n", opt.mid_occ_frac);
fprintf(stderr, " -g INT stop chain enlongation if there are no minimizers in INT-bp [%d]\n", opt.max_gap); fprintf(fp_help, " -g INT stop chain enlongation if there are no minimizers in INT-bp [%d]\n", opt.max_gap);
fprintf(stderr, " -r INT bandwidth used in chaining and DP-based alignment [%d]\n", opt.bw); fprintf(fp_help, " -r INT bandwidth used in chaining and DP-based alignment [%d]\n", opt.bw);
fprintf(stderr, " -n INT minimal number of minimizers on a chain [%d]\n", opt.min_cnt); fprintf(fp_help, " -n INT minimal number of minimizers on a chain [%d]\n", opt.min_cnt);
fprintf(stderr, " -m INT minimal chaining score (matching bases minus log gap penalty) [%d]\n", opt.min_chain_score); fprintf(fp_help, " -m INT minimal chaining score (matching bases minus log gap penalty) [%d]\n", opt.min_chain_score);
// fprintf(stderr, " -T INT SDUST threshold; 0 to disable SDUST [%d]\n", opt.sdust_thres); // TODO: this option is never used; might be buggy // fprintf(fp_help, " -T INT SDUST threshold; 0 to disable SDUST [%d]\n", opt.sdust_thres); // TODO: this option is never used; might be buggy
fprintf(stderr, " -X skip self and dual mappings (for the all-vs-all mode)\n"); fprintf(fp_help, " -X skip self and dual mappings (for the all-vs-all mode)\n");
fprintf(stderr, " -p FLOAT min secondary-to-primary score ratio [%g]\n", opt.pri_ratio); fprintf(fp_help, " -p FLOAT min secondary-to-primary score ratio [%g]\n", opt.pri_ratio);
fprintf(stderr, " -N INT retain at most INT secondary alignments [%d]\n", opt.best_n); fprintf(fp_help, " -N INT retain at most INT secondary alignments [%d]\n", opt.best_n);
fprintf(stderr, " Alignment:\n"); fprintf(fp_help, " -G NUM max intron length (only effective following -x splice) [200k]\n");
fprintf(stderr, " -A INT matching score [%d]\n", opt.a); fprintf(fp_help, " Alignment:\n");
fprintf(stderr, " -B INT mismatch penalty [%d]\n", opt.b); fprintf(fp_help, " -A INT matching score [%d]\n", opt.a);
fprintf(stderr, " -O INT[,INT] gap open penalty [%d,%d]\n", opt.q, opt.q2); fprintf(fp_help, " -B INT mismatch penalty [%d]\n", opt.b);
fprintf(stderr, " -E INT[,INT] gap extension penalty; a k-long gap costs min{O1+k*E1,O2+k*E2} [%d,%d]\n", opt.e, opt.e2); fprintf(fp_help, " -O INT[,INT] gap open penalty [%d,%d]\n", opt.q, opt.q2);
fprintf(stderr, " -z INT Z-drop score [%d]\n", opt.zdrop); fprintf(fp_help, " -E INT[,INT] gap extension penalty; a k-long gap costs min{O1+k*E1,O2+k*E2} [%d,%d]\n", opt.e, opt.e2);
fprintf(stderr, " -s INT minimal peak DP alignment score [%d]\n", opt.min_dp_max); fprintf(fp_help, " -z INT Z-drop score [%d]\n", opt.zdrop);
fprintf(stderr, " Input/Output:\n"); fprintf(fp_help, " -s INT minimal peak DP alignment score [%d]\n", opt.min_dp_max);
fprintf(stderr, " -Q ignore base quality in the input\n"); fprintf(fp_help, " -u CHAR how to find GT-AG. f:transcript strand, b:both strands, n:don't match GT-AG [n]\n");
fprintf(stderr, " -a output in the SAM format (PAF by default)\n"); fprintf(fp_help, " Input/Output:\n");
fprintf(stderr, " -c output CIGAR in PAF\n"); fprintf(fp_help, " -a output in the SAM format (PAF by default)\n");
fprintf(stderr, " -t INT number of threads [%d]\n", n_threads); fprintf(fp_help, " -Q don't output base quality in SAM\n");
fprintf(stderr, " -K NUM minibatch size [200M]\n"); fprintf(fp_help, " -R STR SAM read group line in a format like '@RG\\tID:foo\\tSM:bar' []\n");
// fprintf(stderr, " -v INT verbose level [%d]\n", mm_verbose); fprintf(fp_help, " -c output CIGAR in PAF\n");
fprintf(stderr, " -V show version number\n"); fprintf(fp_help, " -S output the cs tag in PAF (cs encodes both query and ref sequences)\n");
fprintf(stderr, " Preset:\n"); fprintf(fp_help, " -t INT number of threads [%d]\n", n_threads);
fprintf(stderr, " -x STR preset (recommended to be applied before other options) []\n"); fprintf(fp_help, " -K NUM minibatch size [200M]\n");
fprintf(stderr, " map10k/map-pb: -Hk19 (PacBio/ONT vs reference mapping)\n"); // fprintf(fp_help, " -v INT verbose level [%d]\n", mm_verbose);
fprintf(stderr, " map-ont: -k15 (slightly more sensitive than 'map10k' for ONT vs reference)\n"); fprintf(fp_help, " --version show version number\n");
fprintf(stderr, " asm5: -k19 -w19 -A1 -B19 -O39,81 -E3,1 -s200 -z200 (asm to ref mapping; break at 5%% div.)\n"); fprintf(fp_help, " Preset:\n");
fprintf(stderr, " asm10: -k19 -w19 -A1 -B9 -O16,41 -E2,1 -s200 -z200 (asm to ref mapping; break at 10%% div.)\n"); fprintf(fp_help, " -x STR preset (recommended to be applied before other options) []\n");
fprintf(stderr, " ava-pb: -Hk19 -w5 -Xp0 -m100 -g10000 -K500m --max-chain-skip 25 (PacBio read overlap)\n"); fprintf(fp_help, " map10k/map-pb: -Hk19 (PacBio/ONT vs reference mapping)\n");
fprintf(stderr, " ava-ont: -k15 -w5 -Xp0 -m100 -g10000 -K500m --max-chain-skip 25 (ONT read overlap)\n"); fprintf(fp_help, " map-ont: -k15 (slightly more sensitive than 'map10k' for ONT vs reference)\n");
fprintf(stderr, "\nSee `man ./minimap2.1' for detailed description of command-line options.\n"); fprintf(fp_help, " asm5: -k19 -w19 -A1 -B19 -O39,81 -E3,1 -s200 -z200 (asm to ref mapping; break at 5%% div.)\n");
return 1; fprintf(fp_help, " asm10: -k19 -w19 -A1 -B9 -O16,41 -E2,1 -s200 -z200 (asm to ref mapping; break at 10%% div.)\n");
fprintf(fp_help, " ava-pb: -Hk19 -w5 -Xp0 -m100 -g10000 -K500m --max-chain-skip 25 (PacBio read overlap)\n");
fprintf(fp_help, " ava-ont: -k15 -w5 -Xp0 -m100 -g10000 -K500m --max-chain-skip 25 (ONT read overlap)\n");
fprintf(fp_help, " splice: long-read spliced alignment (see minimap2.1 for details)\n");
fprintf(fp_help, "\nSee `man ./minimap2.1' for detailed description of command-line options.\n");
return fp_help == stdout? 0 : 1;
} }
is_idx = mm_idx_is_idx(argv[optind]); is_idx = mm_idx_is_idx(argv[optind]);
if (is_idx < 0) { if (is_idx < 0) {
fprintf(stderr, "[E::%s] failed to open file '%s'\n", __func__, argv[optind]); fprintf(stderr, "[ERROR] failed to open file '%s'\n", argv[optind]);
return 1;
}
if (!is_idx && fnw == 0 && argc - optind < 2) {
fprintf(stderr, "[ERROR] missing input: please specify a query file to map or option -d to keep the index\n");
return 1; return 1;
} }
if (is_idx) fpr = fopen(argv[optind], "rb"); if (is_idx) fpr = fopen(argv[optind], "rb");
else fp = mm_bseq_open(argv[optind]); else fp = mm_bseq_open(argv[optind]);
if (fnw) fpw = fopen(fnw, "wb"); if (fnw) fpw = fopen(fnw, "wb");
if (opt.flag & MM_F_OUT_SAM)
mm_write_sam_hdr_no_SQ(rg, MM_VERSION, argc, argv);
for (;;) { for (;;) {
mm_idx_t *mi = 0; mm_idx_t *mi;
if (fpr) { if (fpr) {
mi = mm_idx_load(fpr); mi = mm_idx_load(fpr);
if (idx_par_set && mm_verbose >= 2 && (mi->k != k || mi->w != w || mi->is_hpc != mi->is_hpc)) if (idx_par_set && mm_verbose >= 2 && (mi->k != k || mi->w != w || mi->is_hpc != is_hpc))
fprintf(stderr, "[W::%s::%.3f*%.2f] Indexing parameters on the command line (-k/-w/-H) overridden by parameters in the prebuilt index.\n", fprintf(stderr, "[WARNING] \033[1;31mIndexing parameters on the command line (-k/-w/-H) overridden by parameters in the prebuilt index.\033[0m\n");
__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0)); } else {
} else if (!mm_bseq_eof(fp)) {
mi = mm_idx_gen(fp, w, k, bucket_bits, is_hpc, minibatch_size, n_threads, batch_size, keep_name); mi = mm_idx_gen(fp, w, k, bucket_bits, is_hpc, minibatch_size, n_threads, batch_size, keep_name);
} }
if (mi == 0) break; if (mi == 0) break;
++n_idx_part;
if (mm_verbose >= 2 && n_idx_part > 1 && (opt.flag&MM_F_OUT_SAM) && !(opt.flag&MM_F_NO_SAM_SQ))
fprintf(stderr, "[WARNING] \033[1;31mSAM output is malformated due to internal @SQ lines. Please add option --no-sam-sq or filter afterwards.\033[0m\n");
if (mm_verbose >= 3) if (mm_verbose >= 3)
fprintf(stderr, "[M::%s::%.3f*%.2f] loaded/built the index for %d target sequence(s)\n", fprintf(stderr, "[M::%s::%.3f*%.2f] loaded/built the index for %d target sequence(s)\n",
__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), mi->n_seq); __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), mi->n_seq);
+36 -18
View File
@@ -19,6 +19,7 @@ void mm_mapopt_init(mm_mapopt_t *opt)
opt->min_chain_score = 40; opt->min_chain_score = 40;
opt->bw = 500; opt->bw = 500;
opt->max_gap = 5000; opt->max_gap = 5000;
opt->max_gap_ref = -1;
opt->max_chain_skip = 25; opt->max_chain_skip = 25;
opt->mask_level = 0.5f; opt->mask_level = 0.5f;
@@ -31,12 +32,14 @@ void mm_mapopt_init(mm_mapopt_t *opt)
opt->a = 2, opt->b = 4, opt->q = 4, opt->e = 2, opt->q2 = 24, opt->e2 = 1; opt->a = 2, opt->b = 4, opt->q = 4, opt->e = 2, opt->q2 = 24, opt->e2 = 1;
opt->zdrop = 400; opt->zdrop = 400;
opt->min_dp_max = opt->min_chain_score; opt->min_dp_max = opt->min_chain_score * opt->a;
opt->min_ksw_len = 200; opt->min_ksw_len = 200;
} }
void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi) void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
{ {
if (opt->flag & MM_F_SPLICE_BOTH)
opt->flag &= ~(MM_F_SPLICE_FOR|MM_F_SPLICE_REV);
opt->max_occ = mm_idx_cal_max_occ(mi, opt->max_occ_frac); opt->max_occ = mm_idx_cal_max_occ(mi, opt->max_occ_frac);
opt->mid_occ = mm_idx_cal_max_occ(mi, opt->mid_occ_frac); opt->mid_occ = mm_idx_cal_max_occ(mi, opt->mid_occ_frac);
if (mm_verbose >= 3) if (mm_verbose >= 3)
@@ -167,7 +170,7 @@ void mm_pair_thin(mm_tbuf_t *b, int radius, mm_match_t *m1, mm_match_t *m2)
#endif #endif
mm_reg1_t *mm_map_frag(const mm_mapopt_t *opt, const mm_idx_t *mi, mm_tbuf_t *b, uint32_t m_st, uint32_t m_en, const char *qname, int qlen, const char *seq, int *n_regs) mm_reg1_t *mm_map_frag(const mm_mapopt_t *opt, const mm_idx_t *mi, mm_tbuf_t *b, uint32_t m_st, uint32_t m_en, const char *qname, int qlen, const char *seq, int *n_regs)
{ {
int i, n = m_en - m_st, j, n_u; int i, n = m_en - m_st, j, n_u, max_gap_ref;
int64_t n_a; int64_t n_a;
uint64_t *u; uint64_t *u;
mm_match_t *m; mm_match_t *m;
@@ -209,8 +212,10 @@ mm_reg1_t *mm_map_frag(const mm_mapopt_t *opt, const mm_idx_t *mi, mm_tbuf_t *b,
mm128_t *p = &b->mini.a[i + m_st]; mm128_t *p = &b->mini.a[i + m_st];
mm_match_t *q = &m[i]; mm_match_t *q = &m[i];
const uint64_t *r = q->x.cr; const uint64_t *r = q->x.cr;
int k, q_span = p->x & 0xff; int k, q_span = p->x & 0xff, is_tandem = 0;
if (q->n >= opt->mid_occ) continue; if (q->n >= opt->mid_occ) continue;
if (i > 0 && p->x>>8 == b->mini.a[m_st + i - 1].x>>8) is_tandem = 1;
if (i < n - 1 && p->x>>8 == b->mini.a[m_st + i + 1].x>>8) is_tandem = 1;
for (k = 0; k < q->n; ++k) { for (k = 0; k < q->n; ++k) {
const char *tname = mi->seq[r[k]>>32].name; const char *tname = mi->seq[r[k]>>32].name;
int32_t rpos = (uint32_t)r[k] >> 1; int32_t rpos = (uint32_t)r[k] >> 1;
@@ -227,6 +232,7 @@ mm_reg1_t *mm_map_frag(const mm_mapopt_t *opt, const mm_idx_t *mi, mm_tbuf_t *b,
p->x = 1ULL<<63 | (r[k]&0xffffffff00000000ULL) | (uint32_t)r[k]>>1; p->x = 1ULL<<63 | (r[k]&0xffffffff00000000ULL) | (uint32_t)r[k]>>1;
p->y = (uint64_t)q_span << 32 | (qlen - ((q->qpos>>1) + 1 - q_span) - 1); p->y = (uint64_t)q_span << 32 | (qlen - ((q->qpos>>1) + 1 - q_span) - 1);
} }
if (is_tandem) p->y |= MM_SEED_TANDEM;
} }
} }
n_a = j; n_a = j;
@@ -237,25 +243,35 @@ mm_reg1_t *mm_map_frag(const mm_mapopt_t *opt, const mm_idx_t *mi, mm_tbuf_t *b,
if (mm_dbg_flag & MM_DBG_PRINT_SEED) if (mm_dbg_flag & MM_DBG_PRINT_SEED)
for (i = 0; i < n_a; ++i) for (i = 0; i < n_a; ++i)
fprintf(stderr, "SD\t%s\t%d\t%c\t%d\t%d\n", mi->seq[a[i].x<<1>>33].name, (int32_t)a[i].x, "+-"[a[i].x>>63], (int32_t)a[i].y, (int32_t)(a[i].y>>32&0xff)); fprintf(stderr, "SD\t%s\t%d\t%c\t%d\t%d\t%d\n", mi->seq[a[i].x<<1>>33].name, (int32_t)a[i].x, "+-"[a[i].x>>63], (int32_t)a[i].y, (int32_t)(a[i].y>>32&0xff),
i == 0? 0 : ((int32_t)a[i].y - (int32_t)a[i-1].y) - ((int32_t)a[i].x - (int32_t)a[i-1].x));
n_u = mm_chain_dp(opt->max_gap, opt->bw, opt->max_chain_skip, opt->min_cnt, opt->min_chain_score, n_a, a, &u, b->km); max_gap_ref = opt->max_gap_ref >= 0? opt->max_gap_ref : opt->max_gap;
n_u = mm_chain_dp(max_gap_ref, opt->max_gap, opt->bw, opt->max_chain_skip, opt->min_cnt, opt->min_chain_score, !!(opt->flag&MM_F_SPLICE), n_a, a, &u, b->km);
regs = mm_gen_regs(b->km, qlen, n_u, u, a); regs = mm_gen_regs(b->km, qlen, n_u, u, a);
*n_regs = n_u; *n_regs = n_u;
if (mm_dbg_flag & MM_DBG_PRINT_SEED)
for (j = 0; j < n_u; ++j)
for (i = regs[j].as; i < regs[j].as + regs[j].cnt; ++i)
fprintf(stderr, "CN\t%d\t%s\t%d\t%c\t%d\t%d\t%d\n", j, mi->seq[a[i].x<<1>>33].name, (int32_t)a[i].x, "+-"[a[i].x>>63], (int32_t)a[i].y, (int32_t)(a[i].y>>32&0xff),
i == regs[j].as? 0 : ((int32_t)a[i].y - (int32_t)a[i-1].y) - ((int32_t)a[i].x - (int32_t)a[i-1].x));
if (!(opt->flag & MM_F_AVA)) { // don't choose primary mapping(s) for read overlap if (!(opt->flag & MM_F_AVA)) { // don't choose primary mapping(s) for read overlap
mm_set_parent(b->km, opt->mask_level, *n_regs, regs); mm_set_parent(b->km, opt->mask_level, *n_regs, regs);
mm_select_sub(b->km, opt->mask_level, opt->pri_ratio, opt->best_n, n_regs, regs); mm_select_sub(b->km, opt->mask_level, opt->pri_ratio, mi->k*2, opt->best_n, n_regs, regs);
mm_join_long(b->km, opt, qlen, n_regs, regs, a); // TODO: this can be applied to all-vs-all in principle if (!(opt->flag & MM_F_SPLICE))
mm_join_long(b->km, opt, qlen, n_regs, regs, a); // TODO: this can be applied to all-vs-all in principle
} }
if (opt->flag & MM_F_CIGAR) { if (opt->flag & MM_F_CIGAR) {
regs = mm_align_skeleton(b->km, opt, mi, qlen, seq, n_regs, regs, a); // this calls mm_filter_regs() regs = mm_align_skeleton(b->km, opt, mi, qlen, seq, n_regs, regs, a); // this calls mm_filter_regs()
if (!(opt->flag & MM_F_AVA)) { if (!(opt->flag & MM_F_AVA)) {
mm_set_parent(b->km, opt->mask_level, *n_regs, regs); mm_set_parent(b->km, opt->mask_level, *n_regs, regs);
mm_select_sub(b->km, opt->mask_level, opt->pri_ratio, opt->best_n, n_regs, regs); mm_select_sub(b->km, opt->mask_level, opt->pri_ratio, mi->k*2, opt->best_n, n_regs, regs);
mm_set_sam_pri(*n_regs, regs); mm_set_sam_pri(*n_regs, regs);
} }
} }
mm_set_mapq(*n_regs, regs); mm_set_mapq(*n_regs, regs, opt->min_chain_score);
// free // free
kfree(b->km, a); kfree(b->km, a);
@@ -327,28 +343,33 @@ static void *worker_pipeline(void *shared, int step, void *in)
kt_for(p->n_threads, worker_for, in, ((step_t*)in)->n_seq); kt_for(p->n_threads, worker_for, in, ((step_t*)in)->n_seq);
return in; return in;
} else if (step == 2) { // step 2: output } else if (step == 2) { // step 2: output
void *km = 0;
step_t *s = (step_t*)in; step_t *s = (step_t*)in;
const mm_idx_t *mi = p->mi; const mm_idx_t *mi = p->mi;
for (i = 0; i < p->n_threads; ++i) mm_tbuf_destroy(s->buf[i]); for (i = 0; i < p->n_threads; ++i) mm_tbuf_destroy(s->buf[i]);
free(s->buf); free(s->buf);
if ((p->opt->flag & MM_F_OUT_CS) && !(mm_dbg_flag & MM_DBG_NO_KALLOC)) km = km_init();
for (i = 0; i < s->n_seq; ++i) { for (i = 0; i < s->n_seq; ++i) {
mm_bseq1_t *t = &s->seq[i]; mm_bseq1_t *t = &s->seq[i];
for (j = 0; j < s->n_reg[i]; ++j) { for (j = 0; j < s->n_reg[i]; ++j) {
mm_reg1_t *r = &s->reg[i][j]; mm_reg1_t *r = &s->reg[i][j];
if (p->opt->flag & MM_F_OUT_SAM) mm_write_sam(&p->str, mi, t, r); if (p->opt->flag & MM_F_OUT_SAM)
else mm_write_paf(&p->str, mi, t, r); mm_write_sam(&p->str, mi, t, r, s->n_reg[i], s->reg[i]);
else
mm_write_paf(&p->str, mi, t, r, km, p->opt->flag);
puts(p->str.s); puts(p->str.s);
free(r->p);
} }
if (s->n_reg[i] == 0 && (p->opt->flag & MM_F_OUT_SAM)) { if (s->n_reg[i] == 0 && (p->opt->flag & MM_F_OUT_SAM)) {
mm_write_sam(&p->str, 0, t, 0); mm_write_sam(&p->str, 0, t, 0, 0, 0);
puts(p->str.s); puts(p->str.s);
} }
for (j = 0; j < s->n_reg[i]; ++j) free(s->reg[i][j].p);
free(s->reg[i]); free(s->reg[i]);
free(s->seq[i].seq); free(s->seq[i].name); free(s->seq[i].seq); free(s->seq[i].name);
if (s->seq[i].qual) free(s->seq[i].qual); if (s->seq[i].qual) free(s->seq[i].qual);
} }
free(s->reg); free(s->n_reg); free(s->seq); free(s->reg); free(s->n_reg); free(s->seq);
km_destroy(km);
if (mm_verbose >= 3) if (mm_verbose >= 3)
fprintf(stderr, "[M::%s::%.3f*%.2f] mapped %d sequences\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), s->n_seq); fprintf(stderr, "[M::%s::%.3f*%.2f] mapped %d sequences\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), s->n_seq);
free(s); free(s);
@@ -364,11 +385,8 @@ int mm_map_file(const mm_idx_t *idx, const char *fn, const mm_mapopt_t *opt, int
if (pl.fp == 0) return -1; if (pl.fp == 0) return -1;
pl.opt = opt, pl.mi = idx; pl.opt = opt, pl.mi = idx;
pl.n_threads = n_threads, pl.mini_batch_size = mini_batch_size; pl.n_threads = n_threads, pl.mini_batch_size = mini_batch_size;
if (opt->flag & MM_F_OUT_SAM) { if ((opt->flag & MM_F_OUT_SAM) && !(opt->flag & MM_F_NO_SAM_SQ))
uint32_t i; mm_write_sam_SQ(idx);
for (i = 0; i < idx->n_seq; ++i)
printf("@SQ\tSN:%s\tLN:%d\n", idx->seq[i].name, idx->seq[i].len);
}
kt_pipeline(n_threads == 1? 1 : 2, worker_pipeline, &pl, 3); kt_pipeline(n_threads == 1? 1 : 2, worker_pipeline, &pl, 3);
free(pl.str.s); free(pl.str.s);
mm_bseq_close(pl.fp); mm_bseq_close(pl.fp);
+19 -9
View File
@@ -5,13 +5,20 @@
#include <stdio.h> #include <stdio.h>
#include <sys/types.h> #include <sys/types.h>
#define MM_IDX_DEF_B 14 #define MM_IDX_DEF_B 14
#define MM_F_NO_SELF 0x01 #define MM_F_NO_SELF 0x001
#define MM_F_AVA 0x02 #define MM_F_AVA 0x002
#define MM_F_CIGAR 0x04 #define MM_F_CIGAR 0x004
#define MM_F_OUT_SAM 0x08 #define MM_F_OUT_SAM 0x008
#define MM_F_NO_QUAL 0x10 #define MM_F_NO_QUAL 0x010
#define MM_F_OUT_CG 0x020
#define MM_F_OUT_CS 0x040
#define MM_F_SPLICE 0x080
#define MM_F_SPLICE_FOR 0x100
#define MM_F_SPLICE_REV 0x200
#define MM_F_SPLICE_BOTH 0x400
#define MM_F_NO_SAM_SQ 0x800
#define MM_IDX_MAGIC "MMI\2" #define MM_IDX_MAGIC "MMI\2"
@@ -46,13 +53,15 @@ typedef struct {
mm_idx_seq_t *seq; // sequence name, length and offset mm_idx_seq_t *seq; // sequence name, length and offset
uint32_t *S; // 4-bit packed sequence uint32_t *S; // 4-bit packed sequence
mm_idx_bucket_t *B; // index mm_idx_bucket_t *B; // index
void *km;
} mm_idx_t; } mm_idx_t;
typedef struct { typedef struct {
uint32_t capacity; uint32_t capacity;
int32_t dp_score, dp_max, dp_max2; int32_t dp_score, dp_max, dp_max2;
uint32_t blen; uint32_t blen;
uint32_t n_diff, n_ambi; uint32_t n_diff;
uint32_t n_ambi:30, trans_strand:2;
uint32_t n_cigar; uint32_t n_cigar;
uint32_t cigar[]; uint32_t cigar[];
} mm_extra_t; } mm_extra_t;
@@ -60,7 +69,7 @@ typedef struct {
typedef struct { typedef struct {
int32_t id; int32_t id;
uint32_t cnt:31, rev:1; uint32_t cnt:31, rev:1;
uint32_t rid:31, rep:1; uint32_t rid:31, inv:1;
int32_t score; int32_t score;
int32_t qs, qe, rs, re; int32_t qs, qe, rs, re;
int32_t parent, subsc; int32_t parent, subsc;
@@ -77,7 +86,7 @@ typedef struct {
int flag; // see MM_F_* macros int flag; // see MM_F_* macros
int bw; // bandwidth int bw; // bandwidth
int max_gap; // break a chain if there are no minimizers in a max_gap window int max_gap, max_gap_ref; // break a chain if there are no minimizers in a max_gap window
int max_chain_skip; int max_chain_skip;
int min_cnt; int min_cnt;
int min_chain_score; int min_chain_score;
@@ -90,6 +99,7 @@ typedef struct {
int min_join_flank_sc; int min_join_flank_sc;
int a, b, q, e, q2, e2; // matching score, mismatch, gap-open and gap-ext penalties int a, b, q, e, q2, e2; // matching score, mismatch, gap-open and gap-ext penalties
int noncan;
int zdrop; int zdrop;
int min_dp_max; int min_dp_max;
int min_ksw_len; int min_ksw_len;
+81 -31
View File
@@ -1,4 +1,4 @@
.TH minimap2 1 "19 July 2017" "minimap2-2.0-r190-dirty" "Bioinformatics tools" .TH minimap2 1 "25 August 2017" "minimap2-2.1-r311" "Bioinformatics tools"
.SH NAME .SH NAME
.PP .PP
minimap2 - mapping and alignment between collections of DNA sequences minimap2 - mapping and alignment between collections of DNA sequences
@@ -137,10 +137,8 @@ number of minimizers [3]
.BI -m \ INT .BI -m \ INT
Discard chains with chaining score Discard chains with chaining score
.RI < INT .RI < INT
[40]. Chaining score equals the approximate number of matching bases (exact if [40]. Chaining score equals the approximate number of matching bases minus a
not using concave gap penalty. It is computed with dynamic programming.
.BR -H )
minus base-2 logarithm gap penalty. It is computed with dynamic programming.
.TP .TP
.B -X .B -X
Perform all-vs-all mapping. In this mode, if the query sequence name is Perform all-vs-all mapping. In this mode, if the query sequence name is
@@ -164,6 +162,12 @@ secondary alignments [5]. This option has no effect when
.B -X .B -X
is applied. is applied.
.TP .TP
.BI -G \ NUM
Maximal intron length in the splice mode [200k]. This option also changes the
bandwidth to
.IR NUM .
Increasing this option slows down spliced alignment.
.TP
.BI --max-chain-skip \ INT .BI --max-chain-skip \ INT
A heuristics that stops chaining early [50]. Minimap2 uses dynamic programming A heuristics that stops chaining early [50]. Minimap2 uses dynamic programming
for chaining. The time complexity is quadratic in the number of seeds. This for chaining. The time complexity is quadratic in the number of seeds. This
@@ -201,15 +205,32 @@ the contiguity of the alignment at the cost of poor alignment in the middle
Minimal peak DP alignment score to output [40]. The peak score is computed from Minimal peak DP alignment score to output [40]. The peak score is computed from
the final CIGAR. It is the score of the max scoring segment in the alignment the final CIGAR. It is the score of the max scoring segment in the alignment
and may be different from the total alignment score. and may be different from the total alignment score.
.TP
.BI -u \ CHAR
How to find canonical splicing sites GT-AG -
.BR f :
transcript strand;
.BR b :
both strands;
.BR n :
no attempt to match GT-AG [n]
.TP
.BI --cost-non-gt-ag \ INT
Cost of non-canonical splicing sites [0].
.SS Input/output options .SS Input/output options
.TP 10 .TP 10
.B -Q
Ignore base quality in the input file.
.TP
.B -a .B -a
Generate CIGAR and output alignments in the SAM format. Minimap2 outputs in PAF Generate CIGAR and output alignments in the SAM format. Minimap2 outputs in PAF
by default. by default.
.TP .TP
.B -Q
Ignore base quality in the input file.
.TP
.BI -R \ STR
SAM read group line in a format like
.B @RG\\\\tID:foo\\\\tSM:bar
[].
.TP
.B -c .B -c
Generate CIGAR. In PAF, the CIGAR is written to the `cg' custom tag. Generate CIGAR. In PAF, the CIGAR is written to the `cg' custom tag.
.TP .TP
@@ -234,8 +255,13 @@ and
use use
.BR -K500m . .BR -K500m .
.TP .TP
.B -V .B --version
Print version number to stdout Print version number to stdout
.TP
.B --no-sam-hdr
Don't output SAM header lines. Use this option if the index consists of
multiple parts; otherwise the SAM output is malformated due to internal header
lines.
.SS Preset options .SS Preset options
.TP 10 .TP 10
.BI -x \ STR .BI -x \ STR
@@ -249,37 +275,64 @@ are:
.RS .RS
.TP 8 .TP 8
.B map-pb .B map-pb
PacBio/Oxford Nanopore read to reference mapping (-Hk19) PacBio/Oxford Nanopore read to reference mapping
.RB ( -Hk19 )
.TP .TP
.B map10k .B map10k
The same as The same as
.B map-pb .B map-pb
(-Hk19) .RB ( -Hk19 )
.TP .TP
.B map-ont .B map-ont
Slightly more sensitive for Oxford Nanopore to reference mapping (-k15). For Slightly more sensitive for Oxford Nanopore to reference mapping
PacBio reads, HPC minimizers consistently leads to faster performance and more .RB ( -k15 ).
sensitive results in comparison to normal minimizers. For Oxford Nanopore data, For PacBio reads, HPC minimizers consistently leads to faster performance and
normal minimizers are better, though not much. The effectiveness of HPC is more sensitive results in comparison to normal minimizers. For Oxford Nanopore
determined by the sequencing error mode. data, normal minimizers are better, though not much. The effectiveness of HPC
is determined by the sequencing error mode.
.TP .TP
.B asm5 .B asm5
Long assembly to reference mapping (-k19 -w19 -A1 -B19 -O39,81 -E3,1 -s200 -z200). Long assembly to reference mapping
.RB ( -k19
.B -w19 -A1 -B19 -O39,81 -E3,1 -s200
.BR -z200 ).
Typically, the alignment will not extend to regions with 5% or higher sequence Typically, the alignment will not extend to regions with 5% or higher sequence
divergence. Only use this preset if the average divergence is far below 5%. divergence. Only use this preset if the average divergence is far below 5%.
.TP .TP
.B asm10 .B asm10
Long assembly to reference mapping (-k19 -w19 -A1 -B9 -O16,41 -E2,1 -s200 -z200). Up Long assembly to reference mapping
to 10% sequence divergence. .RB ( -k19
.TP 8 .B -w19 -A1 -B9 -O16,41 -E2,1 -s200
.BR -z200 ).
Up to 10% sequence divergence.
.TP
.B ava-pb .B ava-pb
PacBio all-vs-all overlap mapping (-Hk19 -w5 -Xp0 -m100 -K500m -g10000 --max-chain-skip 25) PacBio all-vs-all overlap mapping
.TP 8 .RB ( -Hk19
.B -w5 -Xp0 -m100 -K500m -g10000 --max-chain-skip
.BR 25 ).
.TP
.B ava-ont .B ava-ont
Oxford Nanopore all-vs-all overlap mapping (-k15 -w5 -Xp0 -m100 -K500m -g10000 Oxford Nanopore all-vs-all overlap mapping
--max-chain-skip 25). Similarly, the major difference from .RB ( -k15
.B -w5 -Xp0 -m100 -K500m -g10000 --max-chain-skip
.BR 25 ).
Similarly, the major difference from
.B ava-pb .B ava-pb
is that this preset is not using HPC minimizers. is that this preset is not using HPC minimizers.
.TP
.B splice
Long-read spliced alignment
.RB ( -k15
.B -w5 --splice -g2000 -G200k -A1 -B2 -O2,32 -E1,0 -z200 -ub --cost-non-gt-ag
.BR 5 ).
In the splice mode, 1) long deletions are taken as introns and represented as
the
.RB ` N '
CIGAR operator; 2) long insertions are disabled; 3) deletion and insertion gap
costs are different during chaining; 4) the computation of the
.RB ` ms '
tag ignores introns to demote hits to pseudogenes.
.RE .RE
.SS Miscellaneous options .SS Miscellaneous options
.TP 10 .TP 10
@@ -331,6 +384,7 @@ cb | cb | cb
r | c | l . r | c | l .
Tag Type Description Tag Type Description
_ _
tp A Type of aln: P/primary, S/secondary and I/inversion
cm i Number of minimizers on the chain cm i Number of minimizers on the chain
s1 i Chaining score s1 i Chaining score
s2 i Chaining score of the best secondary chain s2 i Chaining score of the best secondary chain
@@ -344,13 +398,9 @@ cg Z CIGAR string (only in PAF)
.SH LIMITATIONS .SH LIMITATIONS
.TP 2 .TP 2
* *
At the alignment phase, minimap2 performs global alignments between minimizer Minimap2 may produce suboptimal alignments through long low-complexity regions
hits. If the positions of these minimizer hits are incorrect, the final where seed positions may be suboptimal. This should not be a big concern
alignment may be suboptimal or unnecessarily fragmented. because even the optimal alignment may be wrong in such regions.
.TP
*
Minimap2 may produce poor alignments that may need post-filtering. We are still
exploring a reliable and consistent way to report good alignments.
.TP .TP
* *
Minimap2 does not work well with Illumina short reads as of now. Minimap2 does not work well with Illumina short reads as of now.
+28
View File
@@ -0,0 +1,28 @@
The [K8 Javascript shell][k8] is needed to run Javascripts in this directory.
Precompiled k8 binaries for Mac and Linux can be found at the [K8 release
page][k8bin].
* [paf2aln.js](paf2aln.js): convert PAF to [MAF][maf] or BLAST-like output for
eyeballing. PAF has to be generated with minimap2 option `-S`, which writes
the aligned sequences to the `cs` tag. An example:
```sh
../minimap2 -S ../test/MT-*.fa | k8 paf2aln.js /dev/stdin
```
* [mapstat.js](mapstat.js): output basic statistics such as the number of
non-redundant mapped bases, number of split and secondary alignments and
number of long gaps. This scripts seamlessly works with both SAM and PAF.
* [sim-pbsim.js](sim-pbsim.js): convert reads simulated with [PBSIM][pbsim] to
FASTA and encode the true mapping positions to read names in a format like
`S1_33!chr1!225258409!225267761!-`.
* [sim-eval.js](sim-eval.js): evaluate mapping accuracy for FASTA generated
with [sim-pbsim.js](sim-pbsim.js) or [sim-mason2.js](sim-mason2.js).
* [sam2paf.js](sam2paf.js): convert SAM to PAF.
[k8]: https://github.com/attractivechaos/k8
[k8bin]: https://github.com/attractivechaos/k8/releases
[maf]: https://genome.ucsc.edu/FAQ/FAQformat#format5
[pbsim]: https://github.com/pfaucon/PBSIM-PacBio-Simulator
+266
View File
@@ -0,0 +1,266 @@
/*******************************
* Command line option parsing *
*******************************/
var getopt = function(args, ostr) {
var oli; // option letter list index
if (typeof(getopt.place) == 'undefined')
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
if (getopt.place == -1) { // update scanning pointer
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
getopt.place = -1;
return null;
}
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
++getopt.ind;
getopt.place = -1;
return null;
}
}
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
if (getopt.place < 0) ++getopt.ind;
return '?';
}
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
getopt.arg = null;
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
} else { // need an argument
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
getopt.arg = args[getopt.ind].substr(getopt.place);
else if (args.length <= ++getopt.ind) { // no arg
getopt.place = -1;
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
return '?';
} else getopt.arg = args[getopt.ind]; // white space
getopt.place = -1;
++getopt.ind;
}
return optopt;
}
/***********************
* Interval operations *
***********************/
Interval = {};
Interval.sort = function(a)
{
if (typeof a[0] == 'number')
a.sort(function(x, y) { return x - y });
else a.sort(function(x, y) { return x[0] != y[0]? x[0] - y[0] : x[1] - y[1] });
}
Interval.merge = function(a, sorted)
{
if (typeof sorted == 'undefined') sorted = true;
if (!sorted) Interval.sort(a);
var k = 0;
for (var i = 1; i < a.length; ++i) {
if (a[k][1] >= a[i][0])
a[k][1] = a[k][1] > a[i][1]? a[k][1] : a[i][1];
else a[++k] = a[i].slice(0);
}
a.length = k + 1;
}
Interval.index_end = function(a, sorted)
{
if (a.length == 0) return;
if (typeof sorted == 'undefined') sorted = true;
if (!sorted) Interval.sort(a);
a[0].push(0);
var k = 0, k_en = a[0][1];
for (var i = 1; i < a.length; ++i) {
if (k_en <= a[i][0]) {
for (++k; k < i; ++k)
if (a[k][1] > a[i][0])
break;
k_en = a[k][1];
}
a[i].push(k);
}
}
Interval.find_intv = function(a, x)
{
var left = -1, right = a.length;
if (typeof a[0] == 'number') {
while (right - left > 1) {
var mid = left + ((right - left) >> 1);
if (a[mid] > x) right = mid;
else if (a[mid] < x) left = mid;
else return mid;
}
} else {
while (right - left > 1) {
var mid = left + ((right - left) >> 1);
if (a[mid][0] > x) right = mid;
else if (a[mid][0] < x) left = mid;
else return mid;
}
}
return left;
}
Interval.find_ovlp = function(a, st, en)
{
if (a.length == 0 || st >= en) return [];
var l = Interval.find_intv(a, st);
var k = l < 0? 0 : a[l][a[l].length - 1];
var b = [];
for (var i = k; i < a.length; ++i) {
if (a[i][0] >= en) break;
else if (st < a[i][1])
b.push(a[i]);
}
return b;
}
/*****************
* Main function *
*****************/
var c, l_fuzzy = 0, print_ovlp = false, print_err_only = false, first_only = false;
while ((c = getopt(arguments, "l:ep")) != null) {
if (c == 'l') l_fuzzy = parseInt(getopt.arg);
else if (c == 'e') print_err_only = print_ovlp = true;
else if (c == 'p') print_ovlp = true;
}
if (arguments.length - getopt.ind < 2) {
print("Usage: k8 intron-eval.js [options] <gene.gtf> <aln.sam>");
exit(1);
}
var file, buf = new Bytes();
var tr = {};
file = new File(arguments[getopt.ind]);
while (file.readline(buf) >= 0) {
var m, t = buf.toString().split("\t");
if (t[0].charAt(0) == '#') continue;
if (t[2] != 'exon') continue;
var st = parseInt(t[3]) - 1;
var en = parseInt(t[4]);
if ((m = /transcript_id "(\S+)"/.exec(t[8])) == null) continue;
var tid = m[1];
if (tr[tid] == null) tr[tid] = [t[0], t[6], 0, 0, []];
tr[tid][4].push([st, en]);
}
file.close();
var anno = {};
for (var tid in tr) {
var t = tr[tid];
Interval.sort(t[4]);
t[2] = t[4][0][0];
t[3] = t[4][t[4].length - 1][1];
if (anno[t[0]] == null) anno[t[0]] = [];
var s = t[4];
for (var i = 0; i < s.length - 1; ++i) {
if (s[i][1] >= s[i+1][0]) throw Error("ERROR: wrong annotation!");
anno[t[0]].push([s[i][1], s[i+1][0]]);
}
}
tr = null;
for (var chr in anno) {
var e = anno[chr];
if (e.length == 0) continue;
Interval.sort(e);
var k = 0;
for (var i = 1; i < e.length; ++i) // dedup
if (e[i][0] != e[k][0] || e[i][1] != e[k][1])
e[++k] = e[i].slice(0);
e.length = k + 1;
Interval.index_end(e);
}
var n_pri = 0, n_unmapped = 0, n_mapped = 0;
var n_sgl = 0, n_splice = 0, n_splice_hit = 0, n_splice_novel = 0;
file = new File(arguments[getopt.ind+1]);
var last_qname = null;
var re_cigar = /(\d+)([MIDNSHX=])/g;
while (file.readline(buf) >= 0) {
var m, t = buf.toString().split("\t");
if (t[0].charAt(0) == '@') continue;
var flag = parseInt(t[1]);
if (flag&0x100) continue;
if (first_only && last_qname == t[0]) continue;
if (t[2] == '*') {
++n_unmapped;
continue;
} else {
++n_pri;
if (last_qname != t[0]) ++n_mapped;
}
var pos = parseInt(t[3]) - 1, intron = [];
while ((m = re_cigar.exec(t[5])) != null) {
var len = parseInt(m[1]), op = m[2];
if (op == 'N') {
intron.push([pos, pos + len]);
pos += len;
} else if (op == 'M' || op == 'X' || op == '=' || op == 'D') pos += len;
}
if (intron.length == 0) {
++n_sgl;
continue;
}
n_splice += intron.length;
var chr = anno[t[2]];
if (chr != null) {
for (var i = 0; i < intron.length; ++i) {
var o = Interval.find_ovlp(chr, intron[i][0], intron[i][1]);
if (o.length > 0) {
var hit = false;
for (var j = 0; j < o.length; ++j) {
var st_diff = intron[i][0] - o[j][0];
var en_diff = intron[i][1] - o[j][1];
if (st_diff < 0) st_diff = -st_diff;
if (en_diff < 0) en_diff = -en_diff;
if (st_diff <= l_fuzzy && en_diff <= l_fuzzy)
++n_splice_hit, hit = true;
if (hit) break;
}
if (print_ovlp) {
var type = hit? 'C' : 'P';
if (hit && print_err_only) continue;
var x = '[';
for (var j = 0; j < o.length; ++j) {
if (j) x += ', ';
x += '(' + o[j][0] + "," + o[j][1] + ')';
}
x += ']';
print(type, t[0], i+1, t[2], intron[i][0], intron[i][1], x);
}
} else {
++n_splice_novel;
if (print_ovlp)
print('N', t[0], i+1, t[2], intron[i][0], intron[i][1]);
}
}
} else {
n_splice_novel += intron.length;
}
last_qname = t[0];
}
file.close();
buf.destroy();
if (!print_ovlp) {
print("# unmapped reads: " + n_unmapped);
print("# mapped reads: " + n_mapped);
print("# primary alignments: " + n_pri);
print("# singletons: " + n_sgl);
print("# predicted introns: " + n_splice);
print("# non-overlapping introns: " + n_splice_novel);
print("# correct introns: " + n_splice_hit + " (" + (n_splice_hit / n_splice * 100).toFixed(2) + "%)");
}
+2 -2
View File
@@ -94,7 +94,7 @@ while (file.readline(buf) >= 0) {
ori_qlen = parseInt(t[1]); ori_qlen = parseInt(t[1]);
} else { // SAM } else { // SAM
var flag = parseInt(t[1]); var flag = parseInt(t[1]);
if (flag & 4) continue; if ((flag & 4) || t[2] == '*' || t[5] == '*') continue;
if (flag & 0x100) { if (flag & 0x100) {
++n_2nd; ++n_2nd;
continue; continue;
@@ -144,7 +144,7 @@ while (file.readline(buf) >= 0) {
} }
if (n_cigar > 65535) ++n_cigar_64k; if (n_cigar > 65535) ++n_cigar_64k;
if (ql + sclip != aqlen) if (ql + sclip != aqlen)
warn("WARNING: aligned query length is inconsistent with CIGAR at line " + lineno); warn("WARNING: aligned query length is inconsistent with CIGAR at line " + lineno + " (" + (ql+sclip) + " != " + aqlen + ")");
if (atlen != null && atlen != tl) if (atlen != null && atlen != tl)
warn("WARNING: aligned reference length is inconsistent with CIGAR at line " + lineno); warn("WARNING: aligned reference length is inconsistent with CIGAR at line " + lineno);
if (is_sam) { if (is_sam) {
+171
View File
@@ -0,0 +1,171 @@
var getopt = function(args, ostr) {
var oli; // option letter list index
if (typeof(getopt.place) == 'undefined')
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
if (getopt.place == -1) { // update scanning pointer
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
getopt.place = -1;
return null;
}
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
++getopt.ind;
getopt.place = -1;
return null;
}
}
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
if (getopt.place < 0) ++getopt.ind;
return '?';
}
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
getopt.arg = null;
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
} else { // need an argument
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
getopt.arg = args[getopt.ind].substr(getopt.place);
else if (args.length <= ++getopt.ind) { // no arg
getopt.place = -1;
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
return '?';
} else getopt.arg = args[getopt.ind]; // white space
getopt.place = -1;
++getopt.ind;
}
return optopt;
}
var c, maf_out = false, line_len = 80;
while ((c = getopt(arguments, "ml:")) != null) {
if (c == 'm') maf_out = true;
else if (c == 'l') line_len = parseInt(getopt.arg); // TODO: not implemented yet
}
if (line_len == 0) line_len = 0x7fffffff;
if (getopt.ind == arguments.length) {
print("Usage: k8 paf2aln.js [options] <with-cs.paf>");
print("Options:");
print(" -m MAF output (BLAST-like output by default)");
print(" -l INT line length in BLAST-like output [80]");
print("");
print("Note: this script only works when minimap2 is run with option '-S'");
exit(1);
}
function padding_str(x, len, right)
{
var s = x.toString();
if (s.length < len) {
if (right) s += Array(len - s.length + 1).join(" ");
else s = Array(len - s.length + 1).join(" ") + s;
}
return s;
}
function update_aln(s_ref, s_qry, s_mid, type, seq, slen)
{
var l = type == '*'? 1 : seq.length;
if (type == '=') {
s_ref.set(seq);
s_qry.set(seq);
s_mid.set(Array(l+1).join("|"));
slen[0] += l, slen[1] += l;
} else if (type == '*') {
s_ref.set(seq.charAt(0));
s_qry.set(seq.charAt(1));
s_mid.set(' ');
slen[0] += 1, slen[1] += 1;
} else if (type == '+') {
s_ref.set(Array(l+1).join("-"));
s_qry.set(seq);
s_mid.set(Array(l+1).join(" "));
slen[1] += l;
} else if (type == '-') {
s_ref.set(seq);
s_qry.set(Array(l+1).join("-"));
s_mid.set(Array(l+1).join(" "));
slen[0] += l;
}
}
function print_aln(rs, qs, strand, slen, elen, s_ref, s_qry, s_mid)
{
print(["Ref+:", padding_str(rs + slen[0] + 1, 10, false), s_ref.toString(), padding_str(rs + elen[0], 10, true)].join(" "));
print(" " + s_mid.toString());
var st, en;
if (strand == '+') st = qs + slen[1] + 1, en = qs + elen[1];
else st = qs - slen[1], en = qs - elen[1] + 1;
print(["Qry" + strand + ":", padding_str(st, 10, false), s_qry.toString(), padding_str(en , 10, true)].join(" "));
}
var s_ref = new Bytes(), s_qry = new Bytes(), s_mid = new Bytes();
var re = /([=\-\+\*])([A-Za-z]+)/g;
var buf = new Bytes();
var file = new File(arguments[getopt.ind]);
if (maf_out) print("##maf version=1\n");
while (file.readline(buf) >= 0) {
var m, line = buf.toString();
var t = line.split("\t", 12);
if ((m = /\tcs:Z:(\S+)/.exec(line)) == null) continue;
var cs = m[1];
s_ref.length = s_qry.length = s_mid.length = 0;
var slen = [0, 0], elen = [0, 0];
if (maf_out) {
while ((m = re.exec(cs)) != null)
update_aln(s_ref, s_qry, s_mid, m[1], m[2], elen);
if (maf_out) {
var score = (m = /\tAS:i:(\d+)/.exec(line)) != null? parseInt(m[1]) : 0;
var len = t[0].length > t[5].length? t[0].length : t[5].length;
print("a " + score);
print(["s", padding_str(t[5], len, true), padding_str(t[7], 10, false), padding_str(parseInt(t[8]) - parseInt(t[7]), 10, false),
"+", padding_str(t[6], 10, false), s_ref.toString()].join(" "));
var qs, qe, ql = parseInt(t[1]);
if (t[4] == '+') {
qs = parseInt(t[2]);
qe = parseInt(t[3]);
} else {
qs = ql - parseInt(t[3]);
qe = ql - parseInt(t[2]);
}
print(["s", padding_str(t[0], len, true), padding_str(qs, 10, false), padding_str(qe - qs, 10, false),
t[4], padding_str(ql, 10, false), s_qry.toString()].join(" "));
print("");
}
} else {
line = line.replace(/\tc[sg]:Z:\S+/g, "");
print('>' + line);
var rs = parseInt(t[7]), qs = t[4] == '+'? parseInt(t[2]) : parseInt(t[3]);
var n_blocks = 0;
while ((m = re.exec(cs)) != null) {
var start = 0, rest = m[1] == '*'? 1 : m[2].length;
while (rest > 0) {
var l_proc;
if (s_ref.length + rest >= line_len) {
l_proc = line_len - s_ref.length;
update_aln(s_ref, s_qry, s_mid, m[1], m[1] == '*'? m[2] : m[2].substr(start, l_proc), elen);
if (n_blocks > 0) print("");
print_aln(rs, qs, t[4], slen, elen, s_ref, s_qry, s_mid);
++n_blocks;
s_ref.length = s_qry.length = s_mid.length = 0;
slen[0] = elen[0], slen[1] = elen[1];
} else {
l_proc = rest;
update_aln(s_ref, s_qry, s_mid, m[1], m[1] == '*'? m[2] : m[2].substr(start, l_proc), elen);
}
rest -= l_proc, start += l_proc;
}
}
if (s_ref.length > 0) {
if (n_blocks > 0) print("");
print_aln(rs, qs, t[4], slen, elen, s_ref, s_qry, s_mid);
++n_blocks;
}
print("//");
}
}
file.close();
buf.destroy();
s_ref.destroy(); s_qry.destroy(); s_mid.destroy();
+111
View File
@@ -0,0 +1,111 @@
var getopt = function(args, ostr) {
var oli; // option letter list index
if (typeof(getopt.place) == 'undefined')
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
if (getopt.place == -1) { // update scanning pointer
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
getopt.place = -1;
return null;
}
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
++getopt.ind;
getopt.place = -1;
return null;
}
}
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
if (getopt.place < 0) ++getopt.ind;
return '?';
}
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
getopt.arg = null;
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
} else { // need an argument
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
getopt.arg = args[getopt.ind].substr(getopt.place);
else if (args.length <= ++getopt.ind) { // no arg
getopt.place = -1;
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
return '?';
} else getopt.arg = args[getopt.ind]; // white space
getopt.place = -1;
++getopt.ind;
}
return optopt;
}
var c, pri_only = false;
while ((c = getopt(arguments, "p")) != null)
if (c == 'p') pri_only = true;
var file = arguments.length == getopt.ind? new File() : new File(arguments[getopt.ind]);
var buf = new Bytes();
var re = /(\d+)([MIDSHNX=])/g;
var len = {}, lineno = 0;
while (file.readline(buf) >= 0) {
var m, n_cigar = 0, line = buf.toString();
++lineno;
if (line.charAt(0) == '@') {
if (/^@SQ/.test(line)) {
var name = (m = /\tSN:(\S+)/.exec(line)) != null? m[1] : null;
var l = (m = /\tLN:(\d+)/.exec(line)) != null? parseInt(m[1]) : null;
if (name != null && l != null) len[name] = l;
}
continue;
}
var t = line.split("\t");
var flag = parseInt(t[1]);
if (t[9] != '*' && t[10] != '*' && t[9].length != t[10].length) throw Error("ERROR at line " + lineno + ": inconsistent SEQ and QUAL lengths - " + t[9].length + " != " + t[10].length);
if (t[2] == '*' || (flag&4)) continue;
if (pri_only && (flag&0x100)) continue;
var tlen = len[t[2]];
if (tlen == null) throw Error("ERROR at line " + lineno + ": can't find the length of contig " + t[2]);
var nn = (m = /\tnn:i:(\d+)/.exec(line)) != null? parseInt(m[1]) : 0;
var NM = (m = /\tNM:i:(\d+)/.exec(line)) != null? parseInt(m[1]) : null;
var have_NM = NM == null? false : true;
NM += nn;
var clip = [0, 0], I = [0, 0], D = [0, 0], M = 0, N = 0, ql = 0, tl = 0, mm = 0, ext_cigar = false;
while ((m = re.exec(t[5])) != null) {
var l = parseInt(m[1]);
if (m[2] == 'M') M += l, ql += l, tl += l, ext_cigar = false;
else if (m[2] == 'I') ++I[0], I[1] += l, ql += l;
else if (m[2] == 'D') ++D[0], D[1] += l, tl += l;
else if (m[2] == 'N') N += l, tl += l;
else if (m[2] == 'S') clip[M == 0? 0 : 1] = l, ql += l;
else if (m[2] == 'H') clip[M == 0? 0 : 1] = l;
else if (m[2] == '=') M += l, ql += l, tl += l, ext_cigar = true;
else if (m[2] == 'X') M += l, ql += l, tl += l, mm += l, ext_cigar = true;
++n_cigar;
}
if (n_cigar > 65535)
warn("WARNING at line " + lineno + ": " + n_cigar + " CIGAR operations");
if (tl + parseInt(t[3]) - 1 > tlen) {
warn("WARNING at line " + lineno + ": alignment end position larger than ref length; skipped");
continue;
}
if (t[9] != '*' && t[9].length != ql) {
warn("WARNING at line " + lineno + ": SEQ length inconsistent with CIGAR (" + t[9].length + " != " + ql + "); skipped");
continue;
}
if (!have_NM || ext_cigar) NM = I[1] + D[1] + mm;
if (NM < I[1] + D[1] + mm) {
warn("WARNING at line " + lineno + ": NM is less than the total number of gaps (" + NM + " < " + (I[1]+D[1]+mm) + ")");
NM = I[1] + D[1] + mm;
}
var extra = ["mm:i:"+(NM-I[1]-D[1]), "io:i:"+I[0], "in:i:"+I[1], "do:i:"+D[0], "dn:i:"+D[1]];
var match = M - (NM - I[1] - D[1]);
var blen = M + I[1] + D[1];
var qlen = M + I[1] + clip[0] + clip[1];
var qs, qe;
if (flag&16) qs = clip[1], qe = qlen - clip[0];
else qs = clip[0], qe = qlen - clip[1];
var ts = parseInt(t[3]) - 1, te = ts + M + D[1] + N;
var a = [t[0], qlen, qs, qe, flag&16? '-' : '+', t[2], tlen, ts, te, match, blen, t[4]];
print(a.join("\t"), extra.join("\t"));
}
buf.destroy();
file.close();
+191
View File
@@ -0,0 +1,191 @@
var getopt = function(args, ostr) {
var oli; // option letter list index
if (typeof(getopt.place) == 'undefined')
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
if (getopt.place == -1) { // update scanning pointer
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
getopt.place = -1;
return null;
}
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
++getopt.ind;
getopt.place = -1;
return null;
}
}
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
if (getopt.place < 0) ++getopt.ind;
return '?';
}
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
getopt.arg = null;
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
} else { // need an argument
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
getopt.arg = args[getopt.ind].substr(getopt.place);
else if (args.length <= ++getopt.ind) { // no arg
getopt.place = -1;
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
return '?';
} else getopt.arg = args[getopt.ind]; // white space
getopt.place = -1;
++getopt.ind;
}
return optopt;
}
var c, max_mapq = 60, mode = 0, err_out_q = 256, print_err = false, ovlp_ratio = 0.1, cap_short_mapq = false;
while ((c = getopt(arguments, "Q:r:m:c")) != null) {
if (c == 'Q') err_out_q = parseInt(getopt.arg), print_err = true;
else if (c == 'r') ovlp_ratio = parseFloat(getopt.arg);
else if (c == 'm') mode = parseInt(getopt.arg);
else if (c == 'c') cap_short_mapq = true;
}
var file = arguments.length == getopt.ind? new File() : new File(arguments[getopt.ind]);
var buf = new Bytes();
var tot = [], err = [];
for (var q = 0; q <= max_mapq; ++q)
tot[q] = err[q] = 0;
function is_correct(s, b)
{
if (s[0] != b[0] || s[3] != b[3]) return false;
var o, l;
if (s[1] < b[1]) {
if (s[2] <= b[1]) return false;
o = (s[2] < b[2]? s[2] : b[2]) - b[1];
l = (s[2] > b[2]? s[2] : b[2]) - s[1];
} else {
if (b[2] <= s[1]) return false;
o = (s[2] < b[2]? s[2] : b[2]) - s[1];
l = (s[2] > b[2]? s[2] : b[2]) - b[1];
}
return o/l > ovlp_ratio? true : false;
}
function count_err(qname, a, tot, err, mode)
{
if (a.length == 0) return;
var m, s;
if ((m = /^(\S+)!(\S+)!(\d+)!(\d+)!([\+\-])$/.exec(qname)) != null) { // pbsim single-end reads
s = [m[1], m[2], parseInt(m[3]), parseInt(m[4]), m[5]];
} else if ((m = /^(\S+)!(\S+)!(\d+)_(\d+)!(\d+)_(\d+)!([\+\-])([\+\-])\/([12])$/.exec(qname)) != null) { // mason2 paired-end reads
if (m[9] == '1') {
s = [m[1], m[2], parseInt(m[3]), parseInt(m[5]), m[7]];
} else {
s = [m[1], m[2], parseInt(m[4]), parseInt(m[6]), m[8]];
}
} else throw Error("Failed to parse simulated read names '" + qname + "'");
s.shift(); // skip the orginal read name
if (mode == 0 || mode == 1) { // longest only or first only
var max_i = 0;
if (mode == 0) { // longest only
var max = 0;
for (var i = 0; i < a.length; ++i)
if (a[i][5] > max)
max = a[i][5], max_i = i;
}
var mapq = a[max_i][4];
++tot[mapq];
if (!is_correct(s, a[max_i])) {
if (mapq >= err_out_q)
print('E', qname, a[max_i].join("\t"));
++err[mapq];
}
} else if (mode == 2) { // all primary mode
var max_err_mapq = -1, max_mapq = 0, max_err_i = -1;
if (cap_short_mapq) {
var max = 0, max_q = 0;
for (var i = 0; i < a.length; ++i)
if (a[i][5] > max)
max = a[i][5], max_q = a[i][4];
for (var i = 0; i < a.length; ++i)
a[i][4] = max_q < a[i][4]? max_q : a[i][4];
}
for (var i = 0; i < a.length; ++i) {
max_mapq = max_mapq > a[i][4]? max_mapq : a[i][4];
if (!is_correct(s, a[i]))
if (a[i][4] > max_err_mapq)
max_err_mapq = a[i][4], max_err_i = i;
}
if (max_err_mapq >= 0) {
++tot[max_err_mapq], ++err[max_err_mapq];
if (max_err_mapq >= err_out_q)
print('E', qname, a[max_err_i].join("\t"));
} else ++tot[max_mapq];
}
}
var lineno = 0, last = null, a = [], n_unmapped = null;
var re_cigar = /(\d+)([MIDSHN])/g;
while (file.readline(buf) >= 0) {
var m, line = buf.toString();
++lineno;
if (line[0] != '@') {
var t = line.split("\t");
if (t[4] == '+' || t[4] == '-') { // PAF
if (last != t[0]) {
if (last != null) count_err(last, a, tot, err, mode);
a = [], last = t[0];
}
if (/\ts1:i:\d+/.test(line) && !/\ts2:i:\d+/.test(line)) // secondary alignment in minimap2 PAF
continue;
var mapq = parseInt(t[11]);
if (mapq > max_mapq) mapq = max_mapq;
a.push([t[5], parseInt(t[7]), parseInt(t[8]), t[4], mapq, parseInt(t[9])]);
} else { // SAM
var flag = parseInt(t[1]);
var read_no = flag>>6&0x3;
var qname = read_no == 1 || read_no == 2? t[0] + '/' + read_no : t[0];
if (last != qname) {
if (last != null) count_err(last, a, tot, err, mode);
a = [], last = qname;
}
if (flag&0x100) continue; // secondary alignment
if ((flag&0x4) || t[2] == '*') { // unmapped
if (n_unmapped == null) n_unmapped = 0;
++n_unmapped;
continue;
}
var mapq = parseInt(t[4]);
if (mapq > max_mapq) mapq = max_mapq;
var pos = parseInt(t[3]) - 1, pos_end = pos;
var n_gap = 0, mlen = 0;
while ((m = re_cigar.exec(t[5])) != null) {
var len = parseInt(m[1]);
if (m[2] == 'M') pos_end += len, mlen += len;
else if (m[2] == 'I') n_gap += len;
else if (m[2] == 'D') n_gap += len, pos_end += len;
}
var score = pos_end - pos;
if ((m = /\tNM:i:(\d+)/.exec(line)) != null) {
var NM = parseInt(m[1]);
if (NM >= n_gap) score = mlen - (NM - n_gap);
}
a.push([t[2], pos, pos_end, (flag&16)? '-' : '+', mapq, score]);
}
}
}
if (last != null) count_err(last, a, tot, err, mode);
buf.destroy();
file.close();
var sum_tot = 0, sum_err = 0, q_out = -1, sum_tot2 = 0, sum_err2 = 0;
for (var q = max_mapq; q >= 0; --q) {
if (tot[q] == 0) continue;
if (q_out < 0 || err[q] > 0) {
if (q_out >= 0) print('Q', q_out, sum_tot, sum_err, (sum_err2/sum_tot2).toFixed(9));
sum_tot = sum_err = 0, q_out = q;
}
sum_tot += tot[q], sum_err += err[q];
sum_tot2 += tot[q], sum_err2 += err[q];
}
print('Q', q_out, sum_tot, sum_err, (sum_err2/sum_tot2).toFixed(9));
if (n_unmapped != null) print('U', n_unmapped);
+105
View File
@@ -0,0 +1,105 @@
Bytes.prototype.reverse = function()
{
for (var i = 0; i < this.length>>1; ++i) {
var tmp = this[i];
this[i] = this[this.length - i - 1];
this[this.length - i - 1] = tmp;
}
}
// reverse complement a DNA string
Bytes.prototype.revcomp = function()
{
if (Bytes.rctab == null) {
var s1 = 'WSATUGCYRKMBDHVNwsatugcyrkmbdhvn';
var s2 = 'WSTAACGRYMKVHDBNwstaacgrymkvhdbn';
Bytes.rctab = [];
for (var i = 0; i < 256; ++i) Bytes.rctab[i] = 0;
for (var i = 0; i < s1.length; ++i)
Bytes.rctab[s1.charCodeAt(i)] = s2.charCodeAt(i);
}
for (var i = 0; i < this.length>>1; ++i) {
var tmp = this[this.length - i - 1];
this[this.length - i - 1] = Bytes.rctab[this[i]];
this[i] = Bytes.rctab[tmp];
}
if (this.length&1)
this[this.length>>1] = Bytes.rctab[this[this.length>>1]];
}
if (arguments.length == 0) {
print("Usage: k8 sim-mason2.js <mason.sam>");
exit(1);
}
function print_se(a)
{
print('@' + a.slice(0, 5).join("!") + " " + a[8]);
print(a[5]);
print("+");
print(a[6]);
}
var buf = new Bytes(), buf2 = new Bytes();
var file = new File(arguments[0]);
var re = /(\d+)([MIDSHN])/g;
var last = null;
while (file.readline(buf) >= 0) {
var t = buf.toString().split("\t");
if (t[0].charAt(0) == '@') continue;
var m, l_ref = 0;
while ((m = re.exec(t[5])) != null)
if (m[2] == 'D' || m[2] == 'M' || m[2] == 'N')
l_ref += parseInt(m[1]);
var flag = parseInt(t[1]);
var rev = !!(flag&16);
var seq, qual;
if (rev) {
buf2.length = 0;
buf2.set(t[9], 0);
buf2.revcomp();
seq = buf2.toString();
buf2.set(t[10], 0);
buf2.reverse();
qual = buf2.toString();
} else seq = t[9], qual = t[10];
var qname = t[0];
qname = qname.replace(/^simulated./, "");
var chr = t[2];
var pos = parseInt(t[3]) - 1;
var strand = (flag&16)? '-' : '+';
var read_no = flag&0xc0;
if (read_no == 0x40) read_no = 1;
else if (read_no == 0x80) read_no = 2;
else read_no = 0;
var err = 0, snp = 0, indel = 0;
for (var i = 11; i < t.length; ++i) {
if ((m = /^XE:i:(\d+)/.exec(t[i])) != null) err = m[1];
else if ((m = /^XS:i:(\d+)/.exec(t[i])) != null) snp = m[1];
else if ((m = /^XI:i:(\d+)/.exec(t[i])) != null) indel = m[1];
}
var comment = [err, snp, indel].join(":");
if (last == null) {
last = [qname, chr, pos, pos + l_ref, strand, seq, qual, read_no, comment];
} else if (last[0] != qname) {
print_se(last);
last = [qname, chr, pos, pos + l_ref, strand, seq, qual, read_no, comment];
} else {
if (read_no == 2) { // last[] is the first read
if (last[7] != 1) throw Error("ERROR: can't find read1");
var name = [qname, chr, last[2] + "_" + pos, last[3] + "_" + (pos + l_ref), last[4] + strand].join("!");
print('@' + name + '/1' + ' ' + last[8]); print(last[5]); print("+"); print(last[6]);
print('@' + name + '/2' + ' ' + comment); print(seq); print("+"); print(qual);
} else {
if (last[7] != 2) throw Error("ERROR: can't find read2");
var name = [qname, chr, pos + "_" + last[2], (pos + l_ref) + "_" + last[3], strand + last[4]].join("!");
print('@' + name + '/1' + ' ' + comment); print(seq); print("+"); print(qual);
print('@' + name + '/2' + ' ' + last[8]); print(last[5]); print("+"); print(last[6]);
}
last = null;
}
}
if (last != null) print_se(last);
file.close();
buf.destroy();
buf2.destroy();
+81
View File
@@ -0,0 +1,81 @@
Bytes.prototype.reverse = function()
{
for (var i = 0; i < this.length>>1; ++i) {
var tmp = this[i];
this[i] = this[this.length - i - 1];
this[this.length - i - 1] = tmp;
}
}
// reverse complement a DNA string
Bytes.prototype.revcomp = function()
{
if (Bytes.rctab == null) {
var s1 = 'WSATUGCYRKMBDHVNwsatugcyrkmbdhvn';
var s2 = 'WSTAACGRYMKVHDBNwstaacgrymkvhdbn';
Bytes.rctab = [];
for (var i = 0; i < 256; ++i) Bytes.rctab[i] = 0;
for (var i = 0; i < s1.length; ++i)
Bytes.rctab[s1.charCodeAt(i)] = s2.charCodeAt(i);
}
for (var i = 0; i < this.length>>1; ++i) {
var tmp = this[this.length - i - 1];
this[this.length - i - 1] = Bytes.rctab[this[i]];
this[i] = Bytes.rctab[tmp];
}
if (this.length&1)
this[this.length>>1] = Bytes.rctab[this[this.length>>1]];
}
if (arguments.length < 2) {
print("Usage: k8 sim-pbsim.js <ref.fa.fai> <pbsim1.maf> [[pbsim2.maf] ...]");
exit(1);
}
var file, buf = new Bytes(), buf2 = new Bytes();
file = new File(arguments[0]);
var chr_list = [];
while (file.readline(buf) >= 0) {
var t = buf.toString().split(/\s+/);
chr_list.push(t[0]);
}
file.close();
for (var k = 1; k < arguments.length; ++k) {
var fn = arguments[k];
file = new File(fn);
var state = 0, reg;
while (file.readline(buf) >= 0) {
var line = buf.toString();
if (state == 0 && line.charAt(0) == 'a') {
state = 1;
} else if (state == 1 && line.charAt(0) == 's') {
var t = line.split(/\s+/);
var st = parseInt(t[2]);
reg = [st, st + parseInt(t[3])];
state = 2;
} else if (state == 2 && line.charAt(0) == 's') {
var m, t = line.split(/\s+/);
if ((m = /S(\d+)_\d+/.exec(t[1])) == null) throw Error("Failed to parse the read name");
var chr_id = parseInt(m[1]) - 1;
if (chr_id >= chr_list.length) throw Error("Index outside the chr list");
var name = [t[1], chr_list[chr_id], reg[0], reg[1], t[4]].join("!");
var seq = t[6].replace(/\-/g, "");
if (seq.length != parseInt(t[5])) throw Error("Inconsistent read length");
if (seq.indexOf("NN") < 0) {
if (t[4] == '-') {
buf2.set(seq, 0);
buf2.length = seq.length;
buf2.revcomp();
seq = buf2.toString();
}
print(">" + name);
print(seq);
}
state = 0;
}
}
file.close();
}
buf.destroy();
buf2.destroy();
+15 -8
View File
@@ -8,9 +8,14 @@
#define MM_PARENT_UNSET (-1) #define MM_PARENT_UNSET (-1)
#define MM_PARENT_TMP_PRI (-2) #define MM_PARENT_TMP_PRI (-2)
#define MM_DBG_NO_KALLOC 0x1 #define MM_DBG_NO_KALLOC 0x1
#define MM_DBG_PRINT_QNAME 0x2 #define MM_DBG_PRINT_QNAME 0x2
#define MM_DBG_PRINT_SEED 0x4 #define MM_DBG_PRINT_SEED 0x4
#define MM_DBG_PRINT_ALN_SEQ 0x8
#define MM_SEED_LONG_JOIN (1ULL<<40)
#define MM_SEED_IGNORE (1ULL<<41)
#define MM_SEED_TANDEM (1ULL<<42)
#ifndef kroundup32 #ifndef kroundup32
#define kroundup32(x) (--(x), (x)|=(x)>>1, (x)|=(x)>>2, (x)|=(x)>>4, (x)|=(x)>>8, (x)|=(x)>>16, ++(x)) #define kroundup32(x) (--(x), (x)|=(x)>>1, (x)|=(x)>>2, (x)|=(x)>>4, (x)|=(x)>>8, (x)|=(x)>>16, ++(x))
@@ -35,9 +40,11 @@ void radix_sort_128x(mm128_t *beg, mm128_t *end);
void radix_sort_64(uint64_t *beg, uint64_t *end); void radix_sort_64(uint64_t *beg, uint64_t *end);
uint32_t ks_ksmall_uint32_t(size_t n, uint32_t arr[], size_t kk); uint32_t ks_ksmall_uint32_t(size_t n, uint32_t arr[], size_t kk);
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r); void mm_write_sam_SQ(const mm_idx_t *idx);
void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r); void mm_write_sam_hdr_no_SQ(const char *rg, const char *ver, int argc, char *argv[]);
int mm_chain_dp(int max_dist, int bw, int max_skip, int min_cnt, int min_sc, int64_t n, mm128_t *a, uint64_t **_u, void *km); void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int opt_flag);
void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int n_regs, const mm_reg1_t *regs);
int mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int min_cnt, int min_sc, int is_cdna, int64_t n, mm128_t *a, uint64_t **_u, void *km);
mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a); mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a);
mm_reg1_t *mm_gen_regs(void *km, int qlen, int n_u, uint64_t *u, mm128_t *a); mm_reg1_t *mm_gen_regs(void *km, int qlen, int n_u, uint64_t *u, mm128_t *a);
@@ -45,11 +52,11 @@ void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a);
void mm_sync_regs(void *km, int n_regs, mm_reg1_t *regs); void mm_sync_regs(void *km, int n_regs, mm_reg1_t *regs);
int mm_set_sam_pri(int n, mm_reg1_t *r); int mm_set_sam_pri(int n, mm_reg1_t *r);
void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r); void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r);
void mm_select_sub(void *km, float mask_level, float pri_ratio, int best_n, int *n_, mm_reg1_t *r); void mm_select_sub(void *km, float mask_level, float pri_ratio, int min_diff, int best_n, int *n_, mm_reg1_t *r);
void mm_filter_regs(void *km, const mm_mapopt_t *opt, int *n_regs, mm_reg1_t *regs); void mm_filter_regs(void *km, const mm_mapopt_t *opt, int *n_regs, mm_reg1_t *regs);
void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs, mm128_t *a); void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs, mm128_t *a);
void mm_hit_sort_by_dp(void *km, int *n_regs, mm_reg1_t *r); void mm_hit_sort_by_dp(void *km, int *n_regs, mm_reg1_t *r);
void mm_set_mapq(int n_regs, mm_reg1_t *regs); void mm_set_mapq(int n_regs, mm_reg1_t *regs, int min_chain_sc);
#ifdef __cplusplus #ifdef __cplusplus
} }
+2
View File
@@ -0,0 +1,2 @@
>q2
GGACATCCCGATGGTGCAGTCCTACCTGTACGAAAGGAC
+2
View File
@@ -0,0 +1,2 @@
>t2
GGACATCCCGATGGTGCAGgtGCTATTAAAGGTTCGTTTGTTCAACGATTAAagTCCTACCTGTACGAAAGGAC
+21
View File
@@ -0,0 +1,21 @@
.SUFFIXES: .gp .tex .eps .pdf .eps.gz
.eps.pdf:
epstopdf --outfile $@ $<
.eps.gz.pdf:
gzip -dc $< | epstopdf --filter > $@
.pdf.eps:
pdftops -eps $< $@
all:minimap2.pdf
roc-color.eps:roc.gp
gnuplot roc.gp
minimap2.pdf:minimap2.tex minimap2.bib roc-color.pdf
pdflatex minimap2; bibtex minimap2; pdflatex minimap2; pdflatex minimap2;
clean:
rm -fr *.toc *.aux *.bbl *.blg *.idx *.log *.out *~ minimap2.pdf
+930
View File
@@ -0,0 +1,930 @@
\newcommand\classname{bioinfo}
\newcommand\lastmodifieddate{2003/02/08}
\newcommand\versionnumber{0.1}
% Are we printing crop marks?
\newif\if@cropmarkson \@cropmarksontrue
\NeedsTeXFormat{LaTeX2e}[2001/06/01]
\ProvidesClass{\classname}[\lastmodifieddate\space\versionnumber]
\setlength{\paperheight}{11truein}
\setlength{\paperwidth}{8.5truein}
\newif\if@final
\DeclareOption{draft}{\PassOptionsToPackage{draft}{graphicx}}
\DeclareOption{a4paper}{\PassOptionsToPackage{a4}{crop}}
\DeclareOption{centre}{\PassOptionsToPackage{center}{crop}}
\DeclareOption{crop}{\PassOptionsToPackage{cam}{crop}\global\@cropmarksontrue}
\DeclareOption{nocrop}{\PassOptionsToPackage{off}{crop}\global\@cropmarksonfalse}
\DeclareOption{info}{\PassOptionsToPackage{info}{crop}}
\DeclareOption{noinfo}{\PassOptionsToPackage{noinfo}{crop}}
\DeclareOption{final}{\global\@finaltrue}
\ExecuteOptions{a4paper,nocrop,centre,info}
\ProcessOptions
% Load all necessary packages
\RequirePackage{inputenc,crop,graphicx,amsmath,array,color,amssymb,flushend,stfloats,amsthm,chngpage,times}
%\RequirePackage[LY1]{fontenc}
%\RequirePackage[LY1,mtbold]{mathtime}
\def\authoraffliate{\fontfamily{phv}\selectfont}
\def\helvetica{\fontfamily{phv}\selectfont}
\def\helveticaitalic{\fontfamily{phv}\itshape\selectfont}
\def\helveticabold{\fontfamily{phv}\bfseries\selectfont}
\def\helveticabolditalic{\fontfamily{phv}\bfseries\itshape\selectfont}
% Not sure if needed.
\newcommand\@ptsize{0}
% Set twoside printing
\@twosidetrue
% Marginal notes are on the outside edge
\@mparswitchfalse
\reversemarginpar
\renewcommand\normalsize{%
\@setfontsize\normalsize{9}{11}%
\abovedisplayskip 10\p@ \@plus2\p@ \@minus5\p@
\abovedisplayshortskip \z@ \@plus3\p@
\belowdisplayshortskip 6\p@ \@plus3\p@ \@minus3\p@
\belowdisplayskip \abovedisplayskip
\let\@listi\@listI}
\normalsize
\let\@bls\baselineskip
\newcommand\small{%
\@setfontsize\small{9}{11}%
\abovedisplayskip 11\p@ minus 3\p@
\belowdisplayskip \abovedisplayskip
\abovedisplayshortskip \z@ plus 2\p@
\belowdisplayshortskip 4\p@ plus 2\p@ minus2\p@
\def\@listi{\topsep 4.5\p@ plus 2\p@ minus 1\p@
\itemsep \parsep
\topsep 4\p@ plus 2\p@ minus 2\p@}}
\newcommand\footnotesize{%
\@setfontsize\footnotesize{8}{10}%
\abovedisplayskip 6\p@ minus 3\p@
\belowdisplayskip\abovedisplayskip
\abovedisplayshortskip \z@ plus 3\p@
\belowdisplayshortskip 6\p@ plus 3\p@ minus 3\p@
\def\@listi{\topsep 3\p@ plus 1\p@ minus 1\p@
\parsep 2\p@ plus 1\p@ minus 1\p@\itemsep \parsep}}
\def\scriptsize{\@setfontsize\scriptsize{7pt}{9pt}}
\def\tiny{\@setfontsize\tiny{5pt}{7pt}}
\def\large{\@setfontsize\large{11.5pt}{12pt}}
\def\Large{\@setfontsize\Large{14pt}{16}}
\def\LARGE{\@setfontsize\LARGE{15pt}{17pt}}
\def\huge{\@setfontsize\huge{22pt}{22pt}}
\def\Huge{\@setfontsize\Huge{30pt}{30pt}}
\DeclareOldFontCommand{\rm}{\normalfont\rmfamily}{\mathrm}
\DeclareOldFontCommand{\sf}{\normalfont\sffamily}{\mathsf}
\DeclareOldFontCommand{\tt}{\normalfont\ttfamily}{\mathtt}
\DeclareOldFontCommand{\bf}{\normalfont\bfseries}{\mathbf}
\DeclareOldFontCommand{\it}{\normalfont\itshape}{\mathit}
\DeclareOldFontCommand{\sl}{\normalfont\slshape}{\@nomath\sl}
\DeclareOldFontCommand{\sc}{\normalfont\scshape}{\@nomath\sc}
% Line spacing
\setlength\lineskip{1\p@}
\setlength\normallineskip{1\p@}
\renewcommand\baselinestretch{}
% Paragraph dimensions and inter-para spacing
\setlength\parskip{0\p@}
\setlength\parindent{3mm}
% Set inter-para skips
\setlength\smallskipamount{3\p@ \@plus 1\p@ \@minus 1\p@}
\setlength\medskipamount{6\p@ \@plus 2\p@}
\setlength\bigskipamount{12\p@ \@plus 4\p@ \@minus 4\p@}
% Page break penalties
\@lowpenalty 51
\@medpenalty 151
\@highpenalty 301
% Disallow widows and orphans
\clubpenalty 10000
\widowpenalty 10000
% Disable page breaks before equations, allow pagebreaks after
% equations and discourage widow lines before equations.
\displaywidowpenalty 100
\predisplaypenalty 10000
\postdisplaypenalty 2500
% Allow breaking the page in the middle of a paragraph
\interlinepenalty 0
% Disallow breaking the page after a hyphenated line
\brokenpenalty 10000
% Hyphenation; don't split words into less than three characters
\lefthyphenmin=3
\righthyphenmin=3
%
% Set page layout dimensions
%
\setlength\headheight{16\p@} % height of running head
\setlength\topmargin{2.9pc} % head margin
\addtolength\topmargin{-1in} % subtract out the 1 inch driver margin
\setlength\topskip{10\p@} % height of first line of text
\setlength\headsep{19\p@} % space below running head --
\setlength\footskip{34\p@} % space above footer line
\setlength\maxdepth{.5\topskip} % pages can be short or deep by half a line?
\setlength\textwidth{42pc} % text measure excluding margins
\setlength\textheight{58\baselineskip} % 54 lines on a full page,
\addtolength\textheight{\topskip} % including the first
% line on the page
% Set the margins
\setlength\marginparsep{3\p@}
\setlength\marginparpush{3\p@}
\setlength\marginparwidth{35\p@}
\setlength\oddsidemargin{4.5pc}
\addtolength\oddsidemargin{-1in} % subtract out the 1 inch driver margin
\setlength\@tempdima{\paperwidth}
\addtolength\@tempdima{-\textwidth}
\addtolength\@tempdima{-4.5pc}
\setlength\evensidemargin{\@tempdima}
\addtolength\evensidemargin{-1in}
\setlength\columnsep{1.5pc} % space between columns for double-column text
\setlength\columnseprule{0\p@} % width of rule between two columns
% Footnotes
\setlength\footnotesep{9\p@} % space between footnotes
% space between text and footnote
\setlength{\skip\footins}{12\p@ \@plus 6\p@ \@minus 1\p@}
% Float placement parameters
% The total number of floats that can be allowed on a page.
\setcounter{totalnumber}{10}
% The maximum number of floats at the top and bottom of a page.
\setcounter{topnumber}{5}
\setcounter{bottomnumber}{5}
% The maximum part of the top or bottom of a text page that can be
% occupied by floats. This is set so that at least four lines of text
% fit on the page.
\renewcommand\topfraction{.9}
\renewcommand\bottomfraction{.9}
% The minimum amount of a text page that must be occupied by text.
% This should accomodate four lines of text.
\renewcommand\textfraction{.06}
% The minimum amount of a float page that must be occupied by floats.
\renewcommand\floatpagefraction{.94}
% The same parameters repeated for double column output
\renewcommand\dbltopfraction{.9}
\renewcommand\dblfloatpagefraction{.9}
% Space between floats
\setlength\floatsep {12\p@ \@plus 2\p@ \@minus 2\p@}
% Space between floats and text
\setlength\textfloatsep{20\p@ \@plus 2\p@ \@minus 4\p@}
% Space above and below an inline figure
\setlength\intextsep {18\p@ \@plus 2\p@ \@minus 2\p@}
% For double column floats
\setlength\dblfloatsep {12\p@ \@plus 2\p@ \@minus 2\p@}
\setlength\dbltextfloatsep{20\p@ \@plus 2\p@ \@minus 4\p@}
% Space left at top, bottom and inbetween floats on a float page.
\setlength\@fptop{0\p@} % no space above float page figures
\setlength\@fpsep{12\p@ \@plus 1fil}
\setlength\@fpbot{0\p@}
% The same for double column
\setlength\@dblfptop{0\p@}
\setlength\@dblfpsep{12\p@ \@plus 1fil}
\setlength\@dblfpbot{0\p@}
% Override settings in mathtime back to TeX defaults
\DeclareMathSizes{5} {5} {5} {5}
\DeclareMathSizes{6} {6} {5} {5}
\DeclareMathSizes{7} {7} {5} {5}
\DeclareMathSizes{8} {8} {6} {5}
\DeclareMathSizes{9} {9} {6.5} {5}
\DeclareMathSizes{10} {10} {7.5} {5}
\DeclareMathSizes{12} {12} {9} {7}
% Page styles
\def\ps@headings
{%
\def\@oddfoot{\vbox to 12.5\p@{\hbox{\rule{\textwidth}{0.5\p@}}\vss
\hbox to \textwidth{\hfill\helveticabold\small\thepage}%
}}%
\def\@evenfoot{\vbox to 12.5\p@{\rule{\textwidth}{0.5\p@}\vss
\hbox to \textwidth{\helveticabold\small\thepage\hfill}%
}}%
\def\@evenhead{\vbox{\hbox to \textwidth{\fontsize{8}{10}\selectfont
\helveticabold{\fontshape{it}\selectfont
\strut\leftmark}\hfill}\vspace{6.5\p@}\rule{\textwidth}{0.5\p@}}}%
\def\@oddhead{\vbox{\hbox to \textwidth{\hfill\fontsize{8}{10}\selectfont
\helveticabold{\fontshape{it}\selectfont\strut\rightmark}}%
\vspace{6.5\p@}\rule{\textwidth}{0.5\p@}}}%
\def\titlemark##1{\markboth{##1}{##1}}%
\def\authormark##1{\gdef\leftmark{##1}}%
}
\def\ps@opening
{%
\def\@oddfoot{\vbox to 13\p@{\hbox{\rule{\textwidth}{1\p@}}\vss
\hbox to \textwidth{\helvetica
\fontsize{7}{9}\fontshape{n}\selectfont%
\hfill\small\helveticabold\thepage}%
}}%
\def\@evenfoot{\vbox to 13\p@{\rule{\textwidth}\vss
\hbox to \textwidth{\helvetica\thepage\hfill
\fontsize{7}{9}\fontshape{n}\selectfont}%
}}%
\let\@evenhead\relax
\let\@oddhead\relax}
% Page range
\newif\iflastpagegiven \lastpagegivenfalse
\newcommand\firstpage[1]{%
\gdef\@firstpage{#1}%
\ifnum\@firstpage>\c@page
\setcounter{page}{#1}%
\ClassWarning{BIO}{Increasing pagenumber to \@firstpage}%
\else \ifnum\@firstpage<\c@page
\ClassWarning{BIO}{Firstpage lower than pagenumber}\fi\fi
\xdef\@firstpage{\the\c@page}%
}
\def\@firstpage{1}
\def\pagenumbering#1{%
\global\c@page \@ne
\gdef\thepage{\csname @#1\endcsname \c@page}%
\gdef\thefirstpage{%
\csname @#1\endcsname \@firstpage}%
\gdef\thelastpage{%
\csname @#1\endcsname \@lastpage}%
}
\newcommand\lastpage[1]{\xdef\@lastpage{#1}%
\global\lastpagegiventrue}
\def\@lastpage{0}
\def\setlastpage{\iflastpagegiven\else
\edef\@tempa{@lastpage@}%
\expandafter
\ifx \csname \@tempa \endcsname \relax
\gdef\@lastpage{0}%
\else
\xdef\@lastpage{\@nameuse{@lastpage@}}%
\fi
\fi }
\def\writelastpage{%
\iflastpagegiven \else
\immediate\write\@auxout%
{\string\global\string\@namedef{@lastpage@}{\the\c@page}}%
\fi
}
\def\thepagerange{%
\ifnum\@lastpage =0 {\ \bf ???} \else
\ifnum\@lastpage = \@firstpage \ \thefirstpage\else
\thefirstpage--\thelastpage \fi\fi}
\AtBeginDocument{\setlastpage
\pagenumbering{arabic}%
}
\AtEndDocument{%
\writelastpage
\if@final
\clearemptydoublepage
\else
\clearpage
\fi}
%
% Sectional units
%
% Counters
\newcounter{section}
\newcounter{subsection}[section]
\newcounter{subsubsection}[subsection]
\newcounter{paragraph}[subsubsection]
\newcounter{subparagraph}[paragraph]
\newcounter{figure}
\newcounter{table}
% Form of the numbers
\newcommand\thepage{\arabic{page}}
\renewcommand\thesection{\arabic{section}}
\renewcommand\thesubsection{{\thesection.\arabic{subsection}}}
\renewcommand\thesubsubsection{{\thesubsection.\arabic{subsubsection}}}
\renewcommand\theparagraph{\thesubsubsection.\arabic{paragraph}}
\renewcommand\thesubparagraph{\theparagraph.\arabic{subparagraph}}
\renewcommand\theequation{\arabic{equation}}
% Form of the words
\newcommand\contentsname{Contents}
\newcommand\listfigurename{List of Figures}
\newcommand\listtablename{List of Tables}
\newcommand\partname{Part}
\newcommand\appendixname{Appendix}
\newcommand\abstractname{Abstract}
\newcommand\refname{References}
\newcommand\bibname{References}
\newcommand\indexname{Index}
\newcommand\figurename{Fig.}
\newcommand\tablename{Table}
% Clearemptydoublepage should really clear the running heads too
\newcommand{\clearemptydoublepage}{\newpage{\pagestyle{empty}\cleardoublepage}}
% Frontmatter, mainmatter and backmatter
\newif\if@mainmatter \@mainmattertrue
\newcommand\frontmatter{%
\clearpage
\@mainmatterfalse
\pagenumbering{roman}}
\newcommand\mainmatter{%
\clearpage
\@mainmattertrue
\pagenumbering{arabic}}
\newcommand\backmatter{%
\clearpage
\@mainmatterfalse}
%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% TITLE %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%
\newlength{\dropfromtop}
\setlength{\dropfromtop}{\z@}
% Application Notes
\newif\if@appnotes
\newcommand{\application}{%
% \setlength{\dropfromtop}{-2.25pc}%
\global\@appnotestrue}
\long\def\title{\@ifnextchar[{\short@title}{\@@title}}
\def\short@title[#1]{\titlemark{#1}\@@@title}
\def\@@title#1{\authormark{#1}\@@@title{#1}}
\long\def\@@@title#1{\gdef\@title{#1}}
\long\def\author{\@ifnextchar[{\short@uthor}{\@uthor}}
\def\short@uthor[#1]{\authormark{#1}\@@author}
\def\@uthor#1{\authormark{#1}\@@author{#1}}
\long\def\@@author#1{\gdef\@author{#1}}
\def\vol#1{\global\def\@vol{#1}}
\def\issue#1{\global\def\@issue{#1}}
\def\address#1{\global\def\@issue{#1}}
\def\history#1{\global\def\@history{#1}}
\def\editor#1{\global\def\@editor{#1}}
\def\pubyear#1{\global\def\@pubyear{#1}}
\def\copyrightyear#1{\global\def\@copyrightyear{#1}}
\def\address#1{\global\def\@address{#1}}
\def\DOI#1{\global\def\@DOI{#1}}
\definecolor{gray}{cmyk}{0, 0, 0, 0.15}
\newlength{\extraspace}
\setlength{\extraspace}{\z@}
\newcommand\maketitle{\par
\begingroup
\renewcommand\thefootnote{\@fnsymbol\c@footnote}%
\def\@makefnmark{\rlap{\@textsuperscript{\normalfont\@thefnmark}}}%
\long\def\@makefntext##1{\parindent 3mm\noindent
% \@textsuperscript{\normalfont\@thefnmark}\raggedright##1}%
\@textsuperscript{\normalfont\@thefnmark}##1}%
\if@twocolumn
\ifnum \col@number=\@ne
\@maketitle
\else
\twocolumn[\@maketitle]%
\fi
\else
\newpage
\global\@topnum\z@ % Prevents figures from going at top of page.
\@maketitle
\fi
\thispagestyle{opening}\@thanks
\endgroup
\setcounter{footnote}{0}%
\global\let\thanks\relax
\global\let\maketitle\relax
\global\let\@maketitle\relax
\global\let\@address\@empty
\global\let\@history\@empty
\global\let\@editor\@empty
\global\let\@thanks\@empty
\global\let\@author\@empty
\global\let\@date\@empty
\global\let\@title\@empty
\global\let\@pubyear\@empty
\global\let\address\relax
\global\let\history\relax
\global\let\editor\relax
\global\let\title\relax
\global\let\author\relax
\global\let\date\relax
\global\let\pubyear\relax
\global\let\@copyrightline\@empty
\global\let\and\relax
\@afterindentfalse\@afterheading
}
\newlength{\aboveskipchk}%for checking oddpage or evenpage top skip
\setlength{\aboveskipchk}{\z@}%
\def\@maketitle{%
\let\footnote\thanks
\clearemptydoublepage
\checkoddpage\ifcpoddpage\setlength{\aboveskipchk}{-3pc}\else\setlength{\aboveskipchk}{-5pc}\fi%for checking oddpage or evenpage top skip%%
\vspace*{\aboveskipchk}%
\vspace{\dropfromtop}%
\hbox to \textwidth{%
{\helvetica\itshape\bfseries\fontsize{19}{12}\selectfont {\color{gray}TECHNICAL REPORT}
\hfil
\if@appnotes APPLICATIONS NOTE\hfil\fi
}%
\enskip \parbox[b]{11.3pc}{%
\helvetica
\flushright\fontsize{8}{10}\fontshape{it}\selectfont
\hfill
}}
\rule{\textwidth}{1\p@}\par%
\helvetica
\hbox to \textwidth{%
\parbox[t]{41pc}{%
\vspace*{1sp}
{\helveticabold\fontsize{16}{21}\selectfont\raggedright \@title \par}%
\vspace{4.5\p@}
{\authoraffliate\fontsize{11}{13}\selectfont\raggedright \@author \par}%
\vspace{4\p@}
{\authoraffliate\fontsize{9}{11}\selectfont\raggedright \@address \par}%
\vspace{4\p@}
%{\helvetica\fontsize{8}{10}\selectfont\raggedright \@history \par}
%\vspace{24\p@}
%{\helvetica\fontsize{10}{12}\selectfont\raggedright \@editor \par}
%\vspace{20\p@}
}%
}
\vspace{4.5\p@}%
\rule{\textwidth}{1\p@}%
\vspace{12\p@ plus 6\p@ minus 6\p@}%
\vspace{\extraspace}
}
%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%
%%%%%%%%%%%%%%%%%%%%%%%%%%%% Abstract %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%
\newcommand{\absection}[1]{%
\par\noindent{\bfseries #1}\space\ignorespaces}
\newenvironment{abstract}{%
\begingroup
\let\section\absection
\fontfamily{\sfdefault}\fontsize{8}{11}\sffamily\selectfont
{\fontseries{b}\selectfont ABSTRACT}\par}
{\endgroup\bigskip\@afterheading\@afterindentfalse\vskip 12pt plus 3pt minus 1pt}
% Section macros
% Lowest level heading that takes a number by default
\setcounter{secnumdepth}{3}
\renewcommand{\@seccntformat}[1]{\csname the#1\endcsname\quad}
\def\section{%
\@startsection{section}{1}{\z@}
{-22\p@ plus -3\p@}{3\p@}
{\reset@font\raggedright\helveticabold\fontsize{10}{12}\selectfont\MakeUppercase}}
\def\subsection{%
\@startsection{subsection}{2}{\z@}
{-11\p@ plus -2\p@}{3\p@}
{\reset@font\raggedright\mathversion{bold}\fontseries{b}\fontsize{10}{12}\selectfont}}
\def\subsubsection{%
\@startsection{subsubsection}{3}{\z@}
%{-11\p@ plus -1\p@}{-1em}
{-11\p@ plus -1\p@}{0.001em}
{\reset@font\normalfont\normalsize\itshape}}
\def\textcolon{\text{\rm :}}
\def\paragraph{%
\@startsection{paragraph}{4}{\z@}
{-6\p@}
{-.4em}
{\reset@font\itshape}}
% ********************
% Figures and tables *
% ********************
% Table and array parameters
\setlength\arraycolsep{.5em}
\setlength\tabcolsep{.5em}
\setlength\arrayrulewidth{.5pt}
\setlength\doublerulesep{2.5pt}
\setlength\extrarowheight{\z@}
\renewcommand\arraystretch{1}
\newlength{\abovecaptionskip}
\newlength{\belowcaptionskip}
\setlength{\abovecaptionskip}{13pt}
\setlength{\belowcaptionskip}{10.5pt}
\long\def\@makecaption#1#2{\vspace{\abovecaptionskip}%
\begingroup
\footnotesize
\textbf{#1.}\enskip{#2}\par
\endgroup}
\long\def\@tablecaption#1#2{%
\begingroup
\footnotesize
\textbf{#1.}\enskip{#2\strut\par}
\endgroup\vspace{\belowcaptionskip}}
% Table rules
\def\toprule{\noalign{\ifnum0=`}\fi\hrule \@height 0.5pt \hrule \@height 6pt \@width 0pt \futurelet
\@tempa\@xhline}
\def\midrule{\noalign{\ifnum0=`}\fi \hrule \@height 6.75pt \@width 0pt \hrule \@height 0.5pt
\hrule \@height 6pt \@width 0pt \futurelet \@tempa\@xhline}
\def\botrule{\noalign{\ifnum0=`}\fi \hrule \@height 5.75pt \@width 0pt \hrule \@height 0.5pt \futurelet
\@tempa\@xhline}
\def\hrulefill{\leavevmode\leaders\hrule height .5pt\hfill\kern\z@}
\def\thefigure{\@arabic\c@figure}
\def\fps@figure{tbp}
\def\ftype@figure{1}
\def\ext@figure{lof}
\def\fnum@figure{\figurename~\thefigure}
\def\figure{\@float{figure}}
\let\endfigure\end@float
\@namedef{figure*}{\@dblfloat{figure}}
\@namedef{endfigure*}{\end@dblfloat}
\def\thetable{\@arabic\c@table}
\def\fps@table{tbp}
\def\ftype@table{2}
\def\ext@table{lot}
\def\fnum@table{Table~\thetable}
\def\table{\let\@makecaption\@tablecaption\let\source\tablesource\@float{table}}
\def\endtable{\end@float}
\@namedef{table*}{\let\@makecaption\@tablecaption\@dblfloat{table}}
\@namedef{endtable*}{\end@dblfloat}
\newif\if@rotate \@rotatefalse
\newif\if@rotatecenter \@rotatecenterfalse
\def\rotatecenter{\global\@rotatecentertrue}
\def\rotateendcenter{\global\@rotatecenterfalse}
\def\rotate{\global\@rotatetrue}
\def\endrotate{\global\@rotatefalse}
\newdimen\rotdimen
\def\rotstart#1{\special{ps: gsave currentpoint currentpoint translate
#1 neg exch neg exch translate}}
\def\rotfinish{\special{ps: currentpoint grestore moveto}}
\def\rotl#1{\rotdimen=\ht#1\advance\rotdimen by \dp#1
\hbox to \rotdimen{\vbox to\wd#1{\vskip \wd#1
\rotstart{270 rotate}\box #1\vss}\hss}\rotfinish}
\def\rotr#1{\rotdimen=\ht #1\advance\rotdimen by \dp#1
\hbox to \rotdimen{\vbox to \wd#1{\vskip \wd#1
\rotstart{90 rotate}\box #1\vss}\hss}\rotfinish}
\newdimen\tempdime
\newbox\temptbox
% From ifmtarg.sty
% Copyright Peter Wilson and Donald Arseneau, 2000
\begingroup
\catcode`\Q=3
\long\gdef\@ifmtarg#1{\@xifmtarg#1QQ\@secondoftwo\@firstoftwo\@nil}
\long\gdef\@xifmtarg#1#2Q#3#4#5\@nil{#4}
\long\gdef\@ifnotmtarg#1{\@xifmtarg#1QQ\@firstofone\@gobble\@nil}
\endgroup
\def\tablesize{\@setfontsize\tablesize{8\p@}{10\p@}}
\newenvironment{processtable}[3]{\setbox\temptbox=\hbox{{\tablesize #2}}%
\tempdime\wd\temptbox\@processtable{#1}{#2}{#3}{\tempdime}}
{\relax}
\newcommand{\@processtable}[4]{%
\if@rotate
\setbox4=\vbox to \hsize{\vss\hbox to \textheight{%
\begin{minipage}{#4}%
\@ifmtarg{#1}{}{\caption{#1}}{\tablesize #2}%
\vskip7\p@\noindent
\parbox{#4}{\fontsize{7}{9}\selectfont #3\par}%
\end{minipage}}\vss}%
\rotr{4}
\else
\hbox to \hsize{\hss\begin{minipage}[t]{#4}%
\vskip2.9pt
\@ifmtarg{#1}{}{\caption{#1}}{\tablesize #2}%
\vskip6\p@\noindent
\parbox{#4}{\fontsize{7}{9}\selectfont #3\par}%
\end{minipage}\hss}\fi}%
\newcolumntype{P}[1]{>{\raggedright\let\\\@arraycr\hangindent1em}p{#1}}
% ******************************
% List numbering and lettering *
% ******************************
\def\labelenumi{{\rm\arabic{enumi}.}}
\def\theenumi{\arabic{enumi}}
\def\labelenumii{{\rm\alph{enumii}.}}
\def\theenumii{\alph{enumii}}
\def\p@enumii{\theenumi}
\def\labelenumiii{{\rm(\arabic{enumiii})}}
\def\theenumiii{\roman{enumiii}}
\def\p@enumiii{\theenumi(\theenumii)}
\def\labelenumiv{{\rm(\arabic{enumiv})}}
\def\theenumiv{\Alph{enumiv}}
\def\p@enumiv{\p@enumiii\theenumiii}
\def\labelitemi{{\small$\bullet$}}
\def\labelitemii{{\small$\bullet$}}
\def\labelitemiii{{\small$\bullet$}}
\def\labelitemiv{{\small$\bullet$}}
\def\@listI{\leftmargin\leftmargini \topsep\medskipamount}
\let\@listi\@listI
\@listi
\def\@listii{\topsep\z@\leftmargin\leftmarginii}
\def\@listiii{\leftmargin\leftmarginiii \topsep\z@}
\def\@listiv{\leftmargin\leftmarginiv \topsep\z@}
\def\@listv{\leftmargin\leftmarginv \topsep\z@}
\def\@listvi{\leftmargin\leftmarginvi \topsep\z@}
\setlength{\leftmargini}{3mm}
\setlength{\leftmarginii}{\z@}
\setlength{\leftmarginiii}{\z@}
\setlength{\leftmarginiv}{\z@}
% Changes to the list parameters for enumerate
\def\enumargs{%
\partopsep \z@
\itemsep 3\p@
\parsep \z@
\labelsep 0.5em
\listparindent \parindent
\itemindent \z@
\topsep 11\p@
}
\def\enumerate{%
\@ifnextchar[{\@numerate}{\@numerate[0]}}
\def\@numerate[#1]{%
\ifnum \@enumdepth >3 \@toodeep\else
\advance\@enumdepth \@ne
\edef\@enumctr{enum\romannumeral\the\@enumdepth}
\list{\csname label\@enumctr\endcsname}{%
\enumargs
\setlength{\leftmargin}{\csname leftmargin\romannumeral\the\@enumdepth\endcsname}
\usecounter{\@enumctr}
\settowidth\labelwidth{#1}
\addtolength{\leftmargin}{\labelwidth}
\addtolength{\leftmargin}{\labelsep}
\def\makelabel##1{\hss \llap{##1}}}%
\fi
}
\let\endenumerate\endlist
% Changes to the list parameters for itemize
\def\itemargs{%
\partopsep \z@
\itemsep 3\p@
\parsep \z@
\labelsep 0.5em
\rightmargin \z@
\listparindent \parindent
\itemindent \z@
\topsep11\p@
}
\def\itemize{%
\@ifnextchar[{\@itemize}{\@itemize[$\bullet$]}}
\def\@itemize[#1]{%
\ifnum \@itemdepth >3 \@toodeep\else
\advance\@itemdepth \@ne
\edef\@itemctr{item\romannumeral\the\@itemdepth}
\list{\csname label\@itemctr\endcsname}{%
\itemargs
\setlength{\leftmargin}{\csname leftmargin\romannumeral\the\@itemdepth\endcsname}
\settowidth\labelwidth{#1}
\addtolength{\leftmargin}{\labelwidth}
\addtolength{\leftmargin}{\labelsep}
\def\makelabel##1{\hss \llap{##1}}}%
\fi
}
\let\enditemize\endlist
\newenvironment{unlist}{%
\begin{list}{}%
{\setlength{\labelwidth}{\z@}%
\setlength{\labelsep}{\z@}%
\setlength{\topsep}{\medskipamount}%
\setlength{\itemsep}{3\p@}%
\setlength{\leftmargin}{2em}%
\setlength{\itemindent}{-2em}}}
{\end{list}}
% ***********************
% Quotes and Quotations *
% ***********************
\def\quotation{\par\begin{list}{}{
\setlength{\topsep}{\medskipamount}
\setlength{\leftmargin}{2em}%
\setlength{\rightmargin}{\z@}%
\setlength\labelwidth{0pt}%
\setlength\labelsep{0pt}%
\listparindent\parindent}%
\item[]}
\def\endquotation{\end{list}}
\let\quote\quotation
\let\endquote\endquotation
\skip\@mpfootins = \skip\footins
\fboxsep=6\p@
\fboxrule=1\p@
% *******************
% Table of contents *
% *******************
\newcommand\@pnumwidth{4em}
\newcommand\@tocrmarg{2.55em plus 1fil}
\newcommand\@dotsep{1000}
\setcounter{tocdepth}{4}
\def\numberline#1{\hbox to \@tempdima{{#1}}}
\def\@authortocline#1#2#3#4#5{%
\vskip 1.5\p@
\ifnum #1>\c@tocdepth \else
{\leftskip #2\relax \rightskip \@tocrmarg \parfillskip -\rightskip
\parindent #2\relax\@afterindenttrue
\interlinepenalty\@M
\leavevmode
\@tempdima #3\relax
\advance\leftskip \@tempdima \null\nobreak\hskip -\leftskip
{\itshape #4}\nobreak
\leaders\hbox{$\m@th
\mkern \@dotsep mu\hbox{.}\mkern \@dotsep
mu$}\hfill
\nobreak
\hb@xt@\@pnumwidth{\hfil}%
\par}%
\fi}
\newcommand*\l@author{\@authortocline{2}{0pt}{30pt}}
\newcommand*\l@section{\@dottedtocline{3}{11pt}{20pt}}
\newcommand*\l@subsection{\@dottedtocline{4}{31pt}{29pt}}
\newcommand*\l@subsubsection[2]{}
% ***********
% Footnotes *
% ***********
\def\footnoterule{\noindent\rule{\columnwidth}{0.5pt}}
\def\@makefnmark{\@textsuperscript{\normalfont\@thefnmark}}%
\newcommand\@makefntext[1]{\noindent{\@makefnmark}\enskip#1}
% ***********
% References *
% ***********
\providecommand{\newblock}{}
\newenvironment{thebibliography}{%
\section{\bibname}%
\begingroup
\small
\begin{list}{}{%
\setlength{\topsep}{\z@}%
\setlength{\labelsep}{\z@}%
\settowidth{\labelwidth}{\z@}%
\setlength{\leftmargin}{4mm}%
\setlength{\itemindent}{-4mm}}\small}
{\end{list}\endgroup}
\RequirePackage{natbib}
% **********
% Appendix *
% **********
\newif\ifappend % Are we in the Appendix?
\def\appendix{\par
\setcounter{section}{0}
\setcounter{subsection}{0}
\appendtrue
}
%Math parameters
\setlength{\jot}{5\p@}
\mathchardef\@m=1500 % adapted value
\def\frenchspacing{\sfcode`\.\@m \sfcode`\?\@m \sfcode`\!\@m
\sfcode`\:\@m \sfcode`\;\@m \sfcode`\,\@m}
% Theorems
\def\th@plain{%
%% \let\thm@indent\noindent % no indent
\thm@headfont{\quad\scshape}% heading font is bold
\thm@notefont{\upshape\mdseries}% same as heading font
\thm@headpunct{.}% no period after heading
\thm@headsep 5\p@ plus\p@ minus\p@\relax
%% \let\thm@swap\@gobble
%% \thm@preskip\topsep
%% \thm@postskip\theorempreskipamount
\itshape % body font
}
\vbadness=9999
\tolerance=9999
\doublehyphendemerits=10000
\doublehyphendemerits 640000 % corresponds to badness 800
\finalhyphendemerits 1000000 % corresponds to badness 1000
\flushbottom
\frenchspacing
\ps@headings
\twocolumn
% Screen PDF compatability
\newcommand{\medline}[1]{%
\unskip\unskip\ignorespaces}
%%%%for smaller size text
\newenvironment{methods}{%
\begingroup
\def\section{%
\@startsection{section}{1}{\z@}
{-24\p@ plus -3\p@}{4\p@}
{\reset@font\raggedright\helveticabold\fontsize{10}{12}\selectfont\MakeUppercase}}
\def\subsection{%
\@startsection{subsection}{2}{\z@}
{-5\p@ plus -2\p@}{4\p@}
{\reset@font\raggedright\mathversion{bold}\fontseries{b}\fontsize{10}{12}\selectfont}}
\def\subsubsection{%
\@startsection{subsubsection}{3}{\z@}
% {-6\p@ plus -1\p@}{-1em}
{-6\p@ plus -1\p@}{0.001em}
{\reset@font\normalfont\normalsize\itshape}}
\footnotesize
\par}
{\par\endgroup\bigskip\@afterheading\@afterindentfalse}
\graphicspath{{g:/artwork/oup/bioinfo/}}
\language=2
\hyphenation{Figure Table Figures Tables}
\newcommand{\href}[2]{#2}
\renewenvironment{proof}[1][\proofname]{\par
\normalfont \topsep6\p@\@plus6\p@\relax
\labelsep 0.5em
\trivlist
\item[\hskip\labelsep\hskip1em\textsc{#1}.]\ignorespaces
}{\endtrivlist\@endpefalse}
%%Different Bonds
\def\sbond{\ensuremath{\raise.25ex\hbox{${-}\!\!\!\!{-}$}}\kern -.9pt}
\def\dbond{\ensuremath{\raise.25ex\hbox{=$\!$=}}}
\def\tbond{\ensuremath{\raise.20ex\hbox{${\equiv}\!\!\!{\equiv}$}}}
% Author queries
%\fboxsep=4\p@
%\fboxrule=0.5\p@
\newcommand{\query}[2][0pt]{}%
% \marginpar{\vspace*{#1}%
% {\parbox{\marginparwidth}{%
% \raggedright\fontsize{6}{8}\selectfont
% #2}}}}
\renewcommand{\dag}{{\mathversion{normal}$^{\dagger}$}}
\endinput
+17
View File
@@ -0,0 +1,17 @@
Q 60 32681 57 0.001744133
Q 39 3 1 0.001774569
Q 38 3 1 0.001804999
Q 35 5 1 0.001835311
Q 34 31 2 0.001894692
Q 20 11 2 0.001955154
Q 19 4 1 0.001985460
Q 15 29 5 0.002136296
Q 14 6 1 0.002166417
Q 10 11 1 0.002196193
Q 6 11 2 0.002256442
Q 5 1 1 0.002286864
Q 4 1 1 0.002317285
Q 3 36 15 0.002771602
Q 2 5 2 0.002832085
Q 1 12 9 0.003105023
Q 0 220 83 0.005594194
+55
View File
@@ -0,0 +1,55 @@
Q 60 31721 27 0.000851171
Q 59 54 4 0.000975610
Q 58 29 5 0.001131933
Q 57 21 2 0.001194030
Q 56 14 4 0.001319137
Q 55 22 6 0.001506544
Q 54 12 4 0.001631475
Q 53 16 3 0.001724733
Q 51 10 1 0.001755541
Q 50 10 1 0.001786330
Q 49 11 3 0.001879699
Q 47 8 2 0.001941869
Q 46 17 1 0.001972140
Q 44 8 3 0.002065534
Q 43 10 1 0.002096174
Q 42 13 1 0.002126595
Q 41 14 3 0.002219444
Q 40 13 2 0.002281036
Q 38 17 4 0.002404747
Q 37 15 4 0.002528484
Q 36 12 1 0.002558742
Q 35 19 3 0.002650783
Q 34 12 3 0.002743313
Q 33 7 1 0.002773882
Q 32 21 3 0.002865508
Q 31 11 2 0.002926799
Q 30 14 3 0.003018891
Q 29 17 1 0.003048401
Q 28 11 2 0.003109549
Q 27 20 5 0.003262998
Q 26 11 1 0.003292948
Q 25 14 4 0.003415725
Q 24 16 5 0.003569212
Q 23 43 6 0.003750426
Q 21 15 1 0.003779664
Q 20 29 7 0.003992943
Q 19 22 2 0.004052089
Q 18 28 4 0.004172204
Q 16 25 5 0.004323390
Q 15 24 5 0.004474480
Q 14 25 5 0.004625204
Q 13 23 3 0.004714365
Q 12 22 1 0.004741963
Q 11 32 11 0.005075674
Q 10 35 7 0.005285315
Q 9 32 12 0.005648503
Q 8 33 8 0.005888126
Q 7 39 7 0.006095506
Q 6 42 14 0.006515953
Q 5 38 15 0.006966725
Q 4 37 12 0.007325113
Q 3 49 18 0.007862737
Q 2 63 21 0.008486434
Q 1 55 27 0.009292156
Q 0 153 77 0.011576593
+33
View File
@@ -0,0 +1,33 @@
#!/usr/bin/perl
use strict;
use warnings;
use Getopt::Std;
my %opts = (n=>33088, s=>100);
getopts('n:', \%opts);
my $pseudo = .5;
my $tot = $pseudo;
my $err = $pseudo;
my $tot_last_out = -$opts{s};
my $state = 0;
my $mapq = 0;
while (<>) {
chomp;
if (/^Q\t(\d+)\t(\d+)\t(\d+)/) {
$tot += $2;
$err += $3;
if ($tot - $tot_last_out >= $opts{s}) {
print join("\t", $1, $err/$tot, $tot / $opts{n}), "\n";
$tot_last_out = $tot;
$state = 0;
} else {
$state = 1;
$mapq = $1;
}
}
}
if ($state) {
print join("\t", $mapq, $err/$tot, $tot / $opts{n}), "\n";
}
+4
View File
@@ -0,0 +1,4 @@
Q 40 31897 63 0.001975107
Q 3 423 267 0.010210396
Q 2 162 120 0.013853827
Q 1 188 172 0.019038874
+4
View File
@@ -0,0 +1,4 @@
./pbsim --prefix pb-1 --depth 0.1 --sample-fastq m131017_060208_42213_c100579642550000001823095604021496_s1_p0.1.subreads.fastq --length-min 1000 --length-max 30000 --seed 11 hs38.fa
bin/mason_variator -ir hs38.fa -s 1 -ov hs38-s1.vcf --snp-rate 1e-3 --small-indel-rate 2e-4 --sv-indel-rate 0 --sv-inversion-rate 0 --sv-translocation-rate 0 --sv-duplication-rate 0 --max-small-indel-size 10
bin/mason_simulator -ir hs38.fa -iv hs38-s1.vcf -n 1000000 --seed 1 -o s1_1.fq -or s1_2.fq -oa s1.sam --illumina-prob-mismatch-scale 2.5
+49
View File
@@ -0,0 +1,49 @@
Q 60 32070 190 0.005924540
Q 59 62 2 0.005975352
Q 58 37 5 0.006123908
Q 57 40 7 0.006333633
Q 56 39 6 0.006512032
Q 55 32 2 0.006567534
Q 54 54 2 0.006618420
Q 53 33 4 0.006735255
Q 52 39 2 0.006788866
Q 51 48 3 0.006871264
Q 50 34 2 0.006925634
Q 49 32 3 0.007011070
Q 48 35 2 0.007064967
Q 47 36 4 0.007179896
Q 46 23 1 0.007205495
Q 45 25 1 0.007230614
Q 44 17 3 0.007318716
Q 43 17 2 0.007376121
Q 42 31 5 0.007522016
Q 41 25 4 0.007638486
Q 40 26 4 0.007754541
Q 39 35 2 0.007807258
Q 37 18 4 0.007924896
Q 36 13 3 0.008013162
Q 35 15 2 0.008070411
Q 34 20 3 0.008156805
Q 33 11 1 0.008184501
Q 32 15 3 0.008272003
Q 31 25 1 0.008296107
Q 29 8 1 0.008324472
Q 28 7 2 0.008383452
Q 27 9 2 0.008441894
Q 26 30 2 0.008494888
Q 23 2 1 0.008524710
Q 22 11 3 0.008612846
Q 20 23 3 0.008697760
Q 19 6 1 0.008726479
Q 18 8 1 0.008754658
Q 16 6 1 0.008783354
Q 13 2 1 0.008813108
Q 12 4 2 0.008872604
Q 11 7 2 0.008931275
Q 10 4 3 0.009021009
Q 9 6 4 0.009140436
Q 8 6 3 0.009229559
Q 7 5 1 0.009258419
Q 6 8 3 0.009346925
Q 4 8 5 0.009495872
Q 3 17 8 0.009732801
+261
View File
@@ -0,0 +1,261 @@
@article{Chaisson:2012aa,
Author = {Chaisson, Mark J and Tesler, Glenn},
Journal = {BMC Bioinformatics},
Pages = {238},
Title = {{Mapping single molecule sequencing reads using basic local alignment with successive refinement (BLASR): application and theory}},
Volume = {13},
Year = {2012}}
@article{Liu:2016ab,
Author = {Liu, Bo and others},
Journal = {Bioinformatics},
Pages = {1625-31},
Title = {{rHAT}: fast alignment of noisy long reads with regional hashing},
Volume = {32},
Year = {2016}}
@article{Liu:2017aa,
Author = {Liu, Bo and others},
Journal = {Bioinformatics},
Pages = {192-201},
Title = {{LAMSA}: fast split read alignment with long approximate matches},
Volume = {33},
Year = {2017}}
@article{Lin:2017aa,
Author = {Lin, Hsin-Nan and Hsu, Wen-Lian},
Journal = {Bioinformatics},
Title = {Kart: a divide-and-conquer algorithm for {NGS} read alignment},
Year = {2017}}
@article{Li:2013aa,
Author = {Li, Heng},
Journal = {arXiv:1303.3997},
Title = {Aligning sequence reads, clone sequences and assembly contigs with {BWA-MEM}},
archivePrefix = "arXiv",
eprint = {1303.3997},
primaryClass = "q-bio",
Year = {2013}}
@article{Sovic:2016aa,
Author = {Sovi{\'c}, Ivan and others},
Journal = {Nat Commun},
Pages = {11307},
Title = {Fast and sensitive mapping of nanopore sequencing reads with {GraphMap}},
Volume = {7},
Year = {2016}}
@article{Langmead:2012fk,
Author = {Langmead, Ben and Salzberg, Steven L},
Journal = {Nat Methods},
Pages = {357-9},
Title = {Fast gapped-read alignment with {Bowtie} 2},
Volume = {9},
Year = {2012}}
@article{Li:2016aa,
Author = {Li, Heng},
Journal = {Bioinformatics},
Pages = {2103-10},
Title = {Minimap and miniasm: fast mapping and de novo assembly for noisy long sequences},
Volume = {32},
Year = {2016}}
@misc{Suzuki:2016,
title = {Fast and accurate alignment tool for PacBio and Nanopore long reads},
author = {Hajime Suzuki},
journal = {Unpublished},
howpublished = {\href{https://github.com/ocxtal/minialign}{https://github.com/ocxtal/minialign}},
year = {2016}}
@misc{Ruan:2016,
title = {Ultra-fast de novo assembler using long noisy reads},
author = {Jue Ruan},
journal = {Unpulished},
howpublished = {\href{https://github.com/ruanjue/smartdenovo}{https://github.com/ruanjue/smartdenovo}},
year = {2016}}
@article{Miller:1988aa,
Author = {Miller, W and Myers, E W},
Journal = {Bull Math Biol},
Number = {2},
Pages = {97-120},
Title = {Sequence comparison with concave weighting functions},
Volume = {50},
Year = {1988}}
@article{Gotoh:1990aa,
Author = {Gotoh, O},
Journal = {Bull Math Biol},
Pages = {359-73},
Title = {Optimal sequence alignment allowing for long gaps},
Volume = {52},
Year = {1990}}
@article{Wu:1996aa,
Author = {Wu, Sun and others},
Journal = {Algorithmica},
Pages = {50-67},
Title = {A subquadratic algorithm for approximate limited expression matching},
Volume = {15},
Year = {1996}}
@article{Daily:2016aa,
Author = {Daily, Jeff},
Journal = {BMC Bioinformatics},
Month = {Feb},
Pages = {81},
Title = {Parasail: {SIMD C} library for global, semi-global, and local pairwise sequence alignments},
Volume = {17},
Year = {2016}}
@article{Sedlazeck169557,
author = {Sedlazeck, Fritz J and others},
title = {Accurate detection of complex structural variations using single molecule sequencing},
note = {doi:10.1101/169557},
journal = {bioRxiv},
year = {2017}}
@article{Altschul:1997vn,
Author = {Altschul, S F and others},
Journal = {Nucleic Acids Res},
Pages = {3389-402},
Title = {Gapped {BLAST} and {PSI-BLAST}: a new generation of protein database search programs},
Volume = {25},
Year = {1997}}
@article{Sosic:2017aa,
Author = {{\v S}o{\v s}i\'{c}, Martin and {\v S}ikic, Mile},
Journal = {Bioinformatics},
Pages = {1394-1395},
Title = {Edlib: a {C/C++} library for fast, exact sequence alignment using edit distance},
Volume = {33},
Year = {2017}}
@article{Abouelhoda:2005aa,
Author = {Mohamed Ibrahim Abouelhoda and Enno Ohlebusch},
Journal = {J. Discrete Algorithms},
Pages = {321-41},
Title = {Chaining algorithms for multiple genome comparison},
Volume = {3},
Year = {2005}}
@article{Ono:2013aa,
Author = {Ono, Yukiteru and others},
Journal = {Bioinformatics},
Pages = {119-21},
Title = {{PBSIM}: {PacBio} reads simulator--toward accurate genome assembly},
Volume = {29},
Year = {2013}}
@article {Jain128835,
author = {Jain, Miten and others},
title = {Nanopore sequencing and assembly of a human genome with ultra-long reads},
year = {2017},
note = {doi:10.1101/128835},
publisher = {Cold Spring Harbor Labs Journals},
journal = {bioRxiv}}
@article{Lau:2016aa,
Author = {Lau, Bayo and others},
Journal = {Bioinformatics},
Pages = {3829-3832},
Title = {{LongISLND}: in silico sequencing of lengthy and noisy datatypes},
Volume = {32},
Year = {2016}}
@article{Robinson:2011aa,
Author = {Robinson, James T and others},
Journal = {Nat Biotechnol},
Pages = {24-6},
Title = {Integrative genomics viewer},
Volume = {29},
Year = {2011}}
@article {Suzuki130633,
author = {Suzuki, Hajime and Kasahara, Masahiro},
title = {Acceleration Of Nucleotide Semi-Global Alignment With Adaptive Banded Dynamic Programming},
year = {2017},
note = {doi:10.1101/130633},
publisher = {Cold Spring Harbor Labs Journals},
journal = {bioRxiv}}
@article{Gotoh:1982aa,
Author = {Gotoh, O},
Journal = {J Mol Biol},
Pages = {705-8},
Title = {An improved algorithm for matching biological sequences},
Volume = {162},
Year = {1982}}
@article{Altschul:1986aa,
Author = {Altschul, S F and Erickson, B W},
Journal = {Bull Math Biol},
Pages = {603-16},
Title = {Optimal sequence alignment using affine gap costs},
Volume = {48},
Year = {1986}}
@article{Wu:2005vn,
Author = {Wu, Thomas D and Watanabe, Colin K},
Journal = {Bioinformatics},
Pages = {1859-75},
Title = {{GMAP}: a genomic mapping and alignment program for {mRNA} and {EST} sequences},
Volume = {21},
Year = {2005}}
@article{Iwata:2012aa,
Author = {Iwata, Hiroaki and Gotoh, Osamu},
Journal = {Nucleic Acids Res},
Pages = {e161},
Title = {Benchmarking spliced alignment programs including {Spaln2}, an extended version of {Spaln} that incorporates additional species-specific features},
Volume = {40},
Year = {2012}}
@article{Dobin:2013kx,
Author = {Dobin, Alexander and others},
Journal = {Bioinformatics},
Pages = {15-21},
Title = {{STAR}: ultrafast universal {RNA-seq} aligner},
Volume = {29},
Year = {2013}}
@article{Byrne:2017aa,
Author = {Byrne, Ashley and others},
Journal = {Nat Commun},
Pages = {16027},
Title = {Nanopore long-read {RNAseq} reveals widespread transcriptional variation among the surface receptors of individual {B} cells},
Volume = {8},
Year = {2017}}
@article{Roberts:2004fv,
Author = {Roberts, Michael and others},
Journal = {Bioinformatics},
Pages = {3363-9},
Title = {Reducing storage requirements for biological sequence comparison},
Volume = {20},
Year = {2004}}
@article{Zhang:2006aa,
Author = {Zhang, Miao and Gish, Warren},
Journal = {Bioinformatics},
Pages = {13-20},
Title = {Improved spliced alignment from an information theoretic approach},
Volume = {22},
Year = {2006}}
@article{Li:2007aa,
Author = {Li, Heng and others},
Journal = {BMC Bioinformatics},
Pages = {349},
Title = {A cross-species alignment tool {(CAT)}},
Volume = {8},
Year = {2007}}
@article{Farrar:2007hs,
Author = {Farrar, Michael},
Journal = {Bioinformatics},
Pages = {156-61},
Title = {{Striped Smith-Waterman speeds database searches six times over other SIMD implementations}},
Volume = {23},
Year = {2007}}
+508
View File
@@ -0,0 +1,508 @@
\documentclass{bioinfo}
\copyrightyear{2017}
\pubyear{2017}
\usepackage{graphicx}
\usepackage{hyperref}
\usepackage{url}
\usepackage{amsmath}
\usepackage[ruled,vlined]{algorithm2e}
\newcommand\mycommfont[1]{\footnotesize\rmfamily{\it #1}}
\SetCommentSty{mycommfont}
\SetKwComment{Comment}{$\triangleright$\ }{}
\usepackage{natbib}
\bibliographystyle{apalike}
\usepackage{hyperref}
\DeclareMathOperator*{\argmax}{argmax}
\begin{document}
\firstpage{1}
\title[Aligning long nucleotide sequences with minimap2]{Minimap2: fast pairwise alignment for long nucleotide sequences}
\author[Li]{Heng Li}
\address{Broad Institute, 415 Main Street, Cambridge, MA 02142, USA}
\maketitle
\begin{abstract}
\section{Summary:} Minimap2 is a general-purpose mapper to align long noisy DNA
or mRNA sequences against a large reference database. It targets query
sequences of 1kb--100Mb in length with per-base divergence typically below
25\%. For DNA sequence reads, minimap2 is $\sim$30 times faster than many
mainstream long-read aligners and achieves higher accuracy on simulated data.
It also employs concave gap cost and rescues inversions for improved alignment
around potential structural variations. For real long RNA-seq reads, minimap2
is $\sim$40 times faster than peers and produces alignment more consistent with
existing gene annotations.
\section{Availability and implementation:}
\href{https://github.com/lh3/minimap2}{https://github.com/lh3/minimap2}
\section{Contact:} hengli@broadinstitute.org
\end{abstract}
\section{Introduction}
Single Molecule Real-Time (SMRT) sequencing technology and Oxford Nanopore
technologies (ONT) produce reads over 10kbp in length at an error rate
$\sim$15\%. Several aligners have been developed for such
data~\citep{Chaisson:2012aa,Li:2013aa,Liu:2016ab,Sovic:2016aa,Liu:2017aa,Lin:2017aa,Sedlazeck169557}.
Most of them were five times as slow as mainstream short-read
aligners~\citep{Langmead:2012fk,Li:2013aa} in terms of the number of bases
mapped per second. We speculated there could be substantial room for speedup on
the thought that 10kb long sequences should be easier to map than 100bp reads
because we can more effectively skip repetitive regions, which are often the
bottleneck of short-read alignment. We confirmed our speculation by achieving
approximate mapping 50 times faster than BWA-MEM~\citep{Li:2016aa}.
\citet{Suzuki:2016} extended our work with a fast and novel algorithm on
generating base-level alignment, which in turn inspired us to develop minimap2
towards higher accuracy and more practical functionality.
Both SMRT and ONT have been applied to sequence spliced mRNAs (RNA-seq). While
traditional mRNA aligners work~\citep{Wu:2005vn,Iwata:2012aa}, they are not
optimized for long noisy sequence reads and are tens of times slower than
dedicated long-read aligners. When developing minimap2 initially for aligning
genomic DNA only, we realized minor modifications could make it competitive for
aligning mRNAs as well. Minimap2 is a first RNA-seq aligner specifically
designed for long noisy reads.
\begin{methods}
\section{Methods}
Minimap2 follows a typical seed-chain-align procedure as is used by most
full-genome aligners. It collects minimizers~\citep{Roberts:2004fv} of the
reference sequences and indexes them in a hash table. Then for each query
sequence, minimap2 takes query minimizers as \emph{seeds}, finds matches to the
reference, and identifies sets of colinear seeds, which are called
\emph{chains}. If base-level alignment is requested, minimap2 applies dynamic
programming (DP) to extend from the ends of chains and to close unseeded
regions between adjacent seeds in chains.
Minimap2 uses indexing and seeding algorithms similar to
minimap~\citep{Li:2016aa}, and furthers the predecessor with more accurate
chaining, the ability to produce base-level alignment and the support of
spliced alignment.
\subsection{Chaining}
\subsubsection{Chaining}
An \emph{anchor} is a 3-tuple $(x,y,w)$, indicating interval $[x-w+1,x]$ on the
reference matching interval $[y-w+1,y]$ on the query. Given a list of anchors
sorted by ending reference position $x$, let $f(i)$ be the maximal chaining
score up to the $i$-th anchor in the list. $f(i)$ can be calculated with
dynamic programming:
\begin{equation}\label{eq:chain}
f(i)=\max\big\{\max_{i>j\ge 1} \{ f(j)+\alpha(j,i)-\beta(j,i) \},w_i\big\}
\end{equation}
where $\alpha(j,i)=\min\big\{\min\{y_i-y_j,x_i-x_j\},w_i\big\}$ is the number of
matching bases between the two anchors. $\beta(j,i)>0$ is the gap cost. It
equals $\infty$ if $y_j\ge y_i$ or $\max\{y_i-y_j,x_i-x_j\}>G$ (i.e. the
distance between two anchors is too large); otherwise
\begin{equation}\label{eq:chain-gap}
\beta(j,i)=\gamma_c\big((y_i-y_j)-(x_i-x_j)\big)
\end{equation}
In implementation, a gap of length $l$ costs $\gamma_c(l)=0.01\cdot \bar{w}\cdot
|l|+0.5\log_2|l|$, where $\bar{w}$ is the average seed length. For $m$ anchors, directly computing all $f(\cdot)$ with
Eq.~(\ref{eq:chain}) takes $O(m^2)$ time. Although theoretically faster
chaining algorithms exist~\citep{Abouelhoda:2005aa}, they
are inapplicable to generic gap cost, complex to implement and usually
associated with a large constant. We introduced a simple heuristic to
accelerate chaining.
We note that if anchor $i$ is chained to $j$, chaining $i$ to a predecessor
of $j$ is likely to yield a lower score. When evaluating Eq.~(\ref{eq:chain}),
we start from anchor $i-1$ and stop the process if we cannot find a better
score after up to $h$ iterations. This approach reduces the average time to
$O(h\cdot m)$. In practice, we can almost always find the optimal chain with
$h=50$; even if the heuristic fails, the optimal chain is often close.
\subsubsection{Backtracking}
Let $P(i)$ be the index of the best predecessor of anchor $i$. It equals 0 if
$f(i)=w_i$ or $\argmax_j\{f(j)+\eta(j,i)-\gamma(j,i)\}$ otherwise. For each
anchor $i$ in the descending order of $f(i)$, we apply $P(\cdot)$ repeatedly to
find its predecessor and mark each visited $i$ as `used', until $P(i)=0$ or we
reach an already `used' $i$. This way we find all chains with no anchors used
in more than one chains.
\subsubsection{Identifying primary chains}
In the absence of copy number changes, each query segment should not be mapped
to two places in the reference. However, chains found at the previous step may
have significant or complete overlaps due to repeats in the reference.
Minimap2 used the following procedure to identify \emph{primary chains} that do
not greatly overlap on the query. Let $Q$ be an empty set initially. For each
chain from the best to the worst according to their chaining scores: if on the
query, the chain overlaps with a chain in $Q$ by 50\% or higher percentage of
the shorter chain, mark the chain as secondary to the chain in $Q$; otherwise,
add the chain to $Q$. In the end, $Q$ contains all the primary chains. We did
not choose a more sophisticated data structure (e.g. range tree or k-d tree)
because this step is not the performance bottleneck.
\subsection{Aligning genomic DNA}
\subsubsection{Alignment with 2-piece affine gap cost}
Minimap2 performs DP-based global alignment between adjacent anchors in a
chain. It uses a 2-piece affine gap cost~\citep{Gotoh:1990aa}:
\begin{equation}\label{eq:2-piece}
\gamma_a(l)=\min\{q+|l|\cdot e,\tilde{q}+|l|\cdot\tilde{e}\}
\end{equation}
Without losing generality, we always assume $q+e<\tilde{q}+\tilde{e}$.
On the condition that $e>\tilde{e}$, it applies cost $q+|l|\cdot e$ to gaps
shorter than $\lceil(\tilde{q}-q)/(e-\tilde{e})\rceil$ and applies
$\tilde{q}+|l|\cdot\tilde{e}$ to longer gaps. This scheme helps to recover
longer insertions and deletions~(INDELs).
The equation to compute the optimal alignment under $\gamma_a(\cdot)$ is
\begin{equation}\label{eq:ae86}
\left\{\begin{array}{l}
H_{ij} = \max\{H_{i-1,j-1}+s(i,j),E_{ij},F_{ij},\tilde{E}_{ij},\tilde{F}_{ij}\}\\
E_{i+1,j}= \max\{H_{ij}-q,E_{ij}\}-e\\
F_{i,j+1}= \max\{H_{ij}-q,F_{ij}\}-e\\
\tilde{E}_{i+1,j}= \max\{H_{ij}-\tilde{q},\tilde{E}_{ij}\}-\tilde{e}\\
\tilde{F}_{i,j+1}= \max\{H_{ij}-\tilde{q},\tilde{F}_{ij}\}-\tilde{e}
\end{array}\right.
\end{equation}
where $s(i,j)$ is the score between the $i$-th reference base and $j$-th query
base. Eq.~(\ref{eq:ae86}) is a natural extension to the equation under affine
gap cost~\citep{Gotoh:1982aa,Altschul:1986aa}.
\subsubsection{Suzuki's formulation}
When we allow gaps longer than several hundred base pairs, nucleotide-level
alignment is much slower than chaining. SSE acceleration is critical to the
performance of minimap2. Traditional SSE implementations~\citep{Farrar:2007hs}
based on Eq.~(\ref{eq:ae86}) can achieve 16-way parallelization for short
sequences, but only 4-way parallelization when the peak alignment score reaches
32767. Long sequence alignment may exceed this threshold. Inspired by
\citet{Wu:1996aa} and the following work, \citet{Suzuki:2016} proposed a
difference-based formulation that lifted this limitation. In case of 2-piece
gap cost, define
\[
\left\{\begin{array}{ll}
u_{ij}\triangleq H_{ij}-H_{i-1,j} & v_{ij}\triangleq H_{ij}-H_{i,j-1} \\
x_{ij}\triangleq E_{i+1,j}-H_{ij} & \tilde{x}_{ij}\triangleq \tilde{E}_{i+1,j}-\tilde{H}_{ij} \\
y_{ij}\triangleq F_{i,j+1}-H_{ij} & \tilde{y}_{ij}\triangleq \tilde{F}_{i,j+1}-\tilde{H}_{ij}
\end{array}\right.
\]
We can transform Eq.~(\ref{eq:ae86}) to
\begin{equation}\label{eq:suzuki}
\left\{\begin{array}{lll}
z_{ij}&=&\max\{s(i,j),x_{i-1,j}+v_{i-1,j},y_{i,j-1}+u_{i,j-1},\\
&&\tilde{x}_{i-1,j}+v_{i-1,j},\tilde{y}_{i,j-1}+u_{i,j-1}\}\\
u_{ij}&=&z_{ij}-v_{i-1,j}\\
v_{ij}&=&z_{ij}-u_{i,j-1}\\
x_{ij}&=&\max\{0,x_{i-1,j}+v_{i-1,j}-z_{ij}+q\}-q-e\\
y_{ij}&=&\max\{0,y_{i,j-1}+u_{i,j-1}-z_{ij}+q\}-q-e\\
\tilde{x}_{ij}&=&\max\{0,\tilde{x}_{i-1,j}+v_{i-1,j}-z_{ij}+\tilde{q}\}-\tilde{q}-\tilde{e}\\
\tilde{y}_{ij}&=&\max\{0,\tilde{y}_{i,j-1}+u_{i,j-1}-z_{ij}+\tilde{q}\}-\tilde{q}-\tilde{e}
\end{array}\right.
\end{equation}
where $z_{ij}$ is a temporary variable that does not need to be stored. An
important property of Eq.~(\ref{eq:suzuki}) is that all values are bounded. To
see that,
\[
x_{ij}=E_{i+1,j}-H_{ij}=\max\{-q,E_{ij}-H_{ij}\}-e
\]
With $E_{ij}\le H_{ij}$, we have
\[
-q-e\le x_{ij}\le\max\{-q,0\}-e=-e
\]
and similar inequations for $y_{ij}$, $\tilde{x}_{ij}$ and $\tilde{y}_{ij}$.
In addition,
\[
u_{ij}=z_{ij}-v_{i-1,j}\ge\max\{x_{i-1,j},\tilde{x}_{i-1,j}\}\ge-q-e
\]
As the maximum value of $z_{ij}=H_{ij}-H_{i-1,j-1}$ is $M$, the maximal
matching score, we can derive
\[
u_{ij}\le M-v_{i-1,j}\le M+q+e
\]
In conclusion, in Eq.~(\ref{eq:suzuki}), $x$ and $y$ are bounded by $[-q-e,-e]$,
$\tilde{x}$ and $\tilde{y}$ by $[-\tilde{q}-\tilde{e},-\tilde{e}]$, and $u$ and
$v$ by $[-q-e,M+q+e]$. When $-128\le-q-e<M+q+e\le127$, each of them can be stored as
a 8-bit integer. This enables 16-way SSE vectorization regardless of the peak
score of the alignment.
For a more efficient SSE implementation, we transform the row-column coordinate
to the diagonal-antidiagonal coordinate by letting $r\gets i+j$ and $t\gets i$.
Eq.~(\ref{eq:suzuki}) becomes:
\begin{equation*}
\left\{\begin{array}{lll}
z_{rt}&=&\max\{s(t,r-t),x_{r-1,t-1}+v_{r-1,t-1},y_{r-1,t}\\
&&+u_{r-1,t},\tilde{x}_{r-1,t-1}+v_{r-1,t-1},\tilde{y}_{r-1,t}+u_{r-1,t}\}\\
u_{rt}&=&z_{rt}-v_{r-1,t-1}\\
v_{rt}&=&z_{rt}-u_{r-1,t}\\
x_{rt}&=&\max\{0,x_{r-1,t-1}+v_{r-1,t-1}-z_{rt}+q\}-q-e\\
y_{rt}&=&\max\{0,y_{r-1,t}+u_{r-1,t}-z_{rt}+q\}-q-e\\
\tilde{x}_{rt}&=&\max\{0,\tilde{x}_{r-1,t-1}+v_{r-1,t-1}-z_{rt}+\tilde{q}\}-\tilde{q}-\tilde{e}\\
\tilde{y}_{rt}&=&\max\{0,\tilde{y}_{r-1,t}+u_{r-1,t}-z_{rt}+\tilde{q}\}-\tilde{q}-\tilde{e}
\end{array}\right.
\end{equation*}
In this formulation, cells with the same diagonal index $r$ are independent of
each other. This allows us to fully vectorize the computation of all cells on
the same anti-diagonal in one inner loop. It also simplifies banded alignment,
which would be difficult with striped vectorization~\citep{Farrar:2007hs}.
On the condition that $q+e<\tilde{q}+\tilde{e}$ and $e>\tilde{e}$, the boundary
condition of the equation above is
\[
\left\{\begin{array}{l}
x_{r-1,-1}=y_{r-1,r}=-q-e\\
\tilde{x}_{r-1,-1}=\tilde{y}_{r-1,r}=-\tilde{q}-\tilde{e}\\
u_{r-1,r}=v_{r-1,-1}=\eta(r)\\
\end{array}\right.
\]
where
\[
\eta(r)=\left\{\begin{array}{ll}
-q-e & (r=0) \\
-e & (r<\lceil\frac{\tilde{q}-q}{e-\tilde{e}}-1\rceil) \\
r\cdot(e-\tilde{e})-(\tilde{q}-q)-\tilde{e} & (r=\lceil\frac{\tilde{q}-q}{e-\tilde{e}}-1\rceil) \\
-\tilde{e} & (r>\lceil\frac{\tilde{q}-q}{e-\tilde{e}}-1\rceil)
\end{array}\right.
\]
These can be derived from the initial conditions of Eq.~(\ref{eq:ae86}).
In practice, our 16-way vectorized implementation of global alignment is three
times as fast as Parasail's 4-way vectorization~\citep{Daily:2016aa}. Without
banding, our implementation is slower than Edlib~\citep{Sosic:2017aa}, but with
a 1000bp band, it is considerably faster. When performing global alignment
between anchors, we expect the alignment to stay close to the diagonal of the
DP matrix. Banding is applicable most of time.
\subsubsection{The Z-drop heuristic}
With global alignment, minimap2 may force to align unrelated sequences between
two adjacent anchors. To avoid such an artifact, we compute accumulative
alignment score along the alignment path and break the alignment where the
score drops too fast in the diagonal direction. More precisely, let $S(i,j)$ be
the alignment score along the alignment path ending at cell $(i,j)$ in the DP
matrix. We break the alignment if there exist $(i',j')$ and $(i,j)$, $i'<i$ and
$j'<j$, such that
\[
S(i',j')-S(i,j)>Z+e\cdot|(i-i')-(j-j')|
\]
where $e$ is the gap extension cost and $Z$ is an arbitrary threshold.
This strategy is similar to X-drop employed in BLAST~\citep{Altschul:1997vn}.
However, unlike X-drop, it would not break the alignment in the presence of a
single long gap.
When minimap2 breaks a global alignment between two anchors, it performs local
alignment between the two subsequences involved in the global alignment, but
this time with the one subsequence reverse complemented. This additional
alignment step may identify short inversions that are missed during chaining.
\subsection{Aligning spliced sequences}
The algorithm described above can be adapted to spliced alignment. In this
mode, the chaining gap cost distinguishes insertions to and deletions from the
reference: $\gamma_c(l)$ in Eq.~(\ref{eq:chain-gap}) takes the form of
\[
\gamma_c(l)=\left\{\begin{array}{ll}
0.01\cdot\bar{w}\cdot l+0.5\log_2 l & (l>0) \\
\min\{0.01\cdot\bar{w}\cdot|l|,\log_2|l|\} & (l<0)
\end{array}\right.
\]
Similarly, the gap cost function used for DP-based alignment is changed to
\[
\gamma_a(l)=\left\{\begin{array}{ll}
q+l\cdot e & (l>0) \\
\min\{q+|l|\cdot e,\tilde{q}\} & (l<0)
\end{array}\right.
\]
In alignment, a deletion no shorter than $\lceil(\tilde{q}-q)/e\rceil$ is
regarded as an intron, which pays no cost to gap extensions.
To pinpoint precise splicing junctions, minimap2 introduces reference-dependent
cost to penalize non-canonical splicing:
\begin{equation}\label{eq:splice}
\left\{\begin{array}{l}
H_{ij} = \max\{H_{i-1,j-1}+s(i,j),E_{ij},F_{ij},\tilde{E}_{ij}-a(i)\}\\
E_{i+1,j}= \max\{H_{ij}-q,E_{ij}\}-e\\
F_{i,j+1}= \max\{H_{ij}-q,F_{ij}\}-e\\
\tilde{E}_{i+1,j}= \max\{H_{ij}-d(i)-\tilde{q},\tilde{E}_{ij}\}\\
\end{array}\right.
\end{equation}
Let $T$ be the reference sequence. $d(i)$ is the cost of a non-canonical donor
site, which takes 0 if $T[i+1,i+2]={\tt GT}$, or a postive number $p$
otherwise. Similarly, $a(i)$ is the cost of a non-canonical acceptor site, which
takes 0 if $T[i-1,i]={\tt AG}$, or $p$ otherwise. Eq.~(\ref{eq:splice}) is
almost equivalent to the equation used by EXALIN~\citep{Zhang:2006aa} except
that we allow insertions immediately followed by deletions and vice versa; in
addition, we use Suzuki's diagonal formulation in actual implementation.
%Given that $d_i$ and $a_i$
%are a function of the reference sequence, it is possible to incorporate
%splicing signals with more sophisticated models, such as positional weight
%matrices. We have not tried this approach.
If RNA-seq reads are not sequenced from stranded libraries, the read strand
relative to the underlying transcript is unknown. By default, minimap2 aligns
each chain twice, first assuming ${\tt GT}$--${\tt AG}$ as the splicing signal
and then assuming ${\tt CT}$--${\tt AC}$, the reverse complement of ${\tt
GT}$--${\tt AG}$, as the splicing signal. The alignment with a higher score is
taken as the final alignment. This procedure also infers the relative strand of
reads that span canonical splicing sites.
In the spliced alignment mode, minimap2 further increases the density of
minimizers and disables banded alignment. Together with the two-round DP-based
alignment, spliced alignment is several times slower than DNA sequence
alignment.
\end{methods}
\section{Results}
\subsection{Aligning genomic reads}
\begin{figure}[!tb]
\centering
\includegraphics[width=.5\textwidth]{roc-color.pdf}
\caption{Evaluation on simulated SMRT reads aligned against human genome
GRCh38. (a) ROC-like curve. Alignments are sorted by mapping quality in the
descending order. For each mapping quality threshold, the fraction of
alignments with mapping quality above the threshold and their error rate
are plotted. (b) Accumulative mapping error rate as a function of mapping
quality. 33,088 $\ge$1000bp reads were simulated using pbsim~\citep{Ono:2013aa}
with error profile sampled from file `m131017\_060208\_42213\_*.1.*' downloaded
at \href{http://bit.ly/chm1p5c3}{http://bit.ly/chm1p5c3}. The N50 read length
is 11,628. A read is considered correctly mapped if the true position overlaps
with the best mapping position by 10\% of the read length. All aligners were
run under the default setting for SMRT reads. Kart outputted all alignments at
mapping quality 60, so is not shown in the figure. It mapped nearly all reads
with 4.1\% of alignments being wrong, less accurate than others.}\label{fig:eval}
\end{figure}
As a sanity check, we evaluated minimap2 on simulated human reads along with
BLASR~(v1.MC.rc64; \citealp{Chaisson:2012aa}),
BWA-MEM~(v0.7.15; \citealp{Li:2013aa}),
GraphMap~(v0.5.2; \citealp{Sovic:2016aa}),
Kart~(v2.2.5; \citealp{Lin:2017aa}),
minialign~(v0.5.3; \citealp{Suzuki:2016}) and
NGMLR~(v0.2.5; \citealp{Sedlazeck169557}). We excluded rHAT~\citep{Liu:2016ab}
and LAMSA~\citep{Liu:2017aa} because they either
crashed or produced malformatted output. In this evaluation, Minimap2 has
higher power to distinguish unique and repetitive hits, and achieves overall
higher mapping accuracy (Fig.~\ref{fig:eval}a). It is still the most accurate
even if we skip DP-based alignment (data not shown), confirming chaining alone
is sufficient to achieve high accuracy for approximate mapping. Minimap2 and
NGMLR provide better mapping quality estimate: they rarely give repetitive hits
high mapping quality (Fig.~\ref{fig:eval}b). Apparently, other aligners may
occasionally miss close suboptimal hits and be overconfident in wrong mappings.
On run time, minialign is slightly faster than minimap2 and Kart. They are over
30 times faster than the rest. Minimap2 consumed 6.1GB memory at the peak,
more than BWA-MEM but less than others.
On real human SMRT reads, the relative performance and sensitivity of
these aligners are broadly similar to the metrics on simulated data. We are
unable to provide a good estimate of mapping error rate due to the lack of the
truth. On ONT $\sim$100kb human reads~\citep{Jain128835}, BWA-MEM failed.
Kart, minialign and minimap2 are over 70 times faster than others. We have also
examined tens of $\ge$100bp INDELs in IGV~\citep{Robinson:2011aa} and can
confirm the observation by~\citet{Sedlazeck169557} that BWA-MEM often breaks
them into shorter gaps. The issue is much alleviated with minimap2, thanks
to the 2-piece affine gap cost.
\subsection{Aligning spliced reads}
We evaluated minimap2 on SIRV control data~(AC:SRR5286959;
\citealp{Byrne:2017aa}) where the truth is known. Minimap2 predicted 59\,916
introns from 11\,017 reads. 93.0\% of splice juctions are precise. We examined
wrongly predicted junctions and found the majority were caused by clustered
splicing signals (e.g. two adjacent ${\tt GT}$ sites). When INDEL sequencing
errors are frequent, it is difficult to find precise splicing sites in this
case. If we allow up to 10bp distance from true splicing sites, 98.4\% of
aligned introns are approximately correct. Given this observation, we might be
able to improve boundary detection by initializing $d(\cdot)$ and $a(\cdot)$ in
Eq.~(\ref{eq:splice}) with position-specific scoring matrices or more
sophisticated models. We have not tried this approach.
\begin{table}[!tb]
\processtable{Evaluation of junction accuracy on 2D ONT reads}
{\footnotesize\label{tab:intron}
\begin{tabular}{p{3.1cm}rrrr}
\toprule
& GMAP & minimap2 & SpAln & STAR\\
\midrule
Run time (CPU min) & 631 & 15.5 & 2\,076 & 33.9 \\
Peak RAM (GByte) & 8.9 & 14.5 & 3.2 & 29.2\vspace{1em}\\
\# aligned reads & 103\,669 & 103\,917 & 103\,711 & 26\,479\\
\# chimeric alignments & 1\,904 & 1\,671 & 0 & 0\\
\# non-spliced alignments & 15\,854 & 14\,483 & 17\,033 & 10\,545\vspace{1em}\\
\# aligned introns & 692\,275 & 694\,237 & 692\,945 & 78\,603 \\
\# novel introns & 11\,239 & 3\,217 & 8\,550 & 1\,214 \\
\% exact introns & 83.8\% & 91.8\% & 87.9\% & 55.2\% \\
\% approx. introns & 91.8\% & 96.5\% & 92.5\% & 82.4\% \\
\botrule
\end{tabular}
}{Mouse reads (AC:SRR5286960) were mapped to the primary assembly of mouse
genome GRCm38 with the following tools and command options: minimap2 (`-ax
splice'); GMAP (`-n 0 --min-intronlength 30 --cross-species'); SpAln (`-Q7 -LS
-S3'); STARlong (according to
\href{http://bit.ly/star-pb}{http://bit.ly/star-pb}). The alignments were
compared to the EnsEMBL gene annotation, release 89. A predicted intron
is \emph{novel} if it has no overlaps with any annotated introns. An intron
is \emph{exact} if it is identical to an annotated intron. An intron is
\emph{approximate} if both its 5'- and 3'-end are within 10bp around the ends
of an annotated intron.}
\end{table}
We next aligned real mouse reads~\citep{Byrne:2017aa} with GMAP~(v2017-06-20;
\citealp{Wu:2005vn}), minimap2, SpAln~(v2.3.1; \citealp{Iwata:2012aa}) and
STAR~(v2.5.3a; \citealp{Dobin:2013kx}). In general, minimap2 is more
consistent with existing annotations (Table~\ref{tab:intron}): it finds
more junctions with a higher percentage being exactly or approximately correct.
Minimap2 is over 40 times faster than GMAP and SpAln. While STAR is close to
minimap2 in speed, it does not work well with noisy reads. We have also
evaluated spliced aligners on public Iso-Seq data (human Alzheimer brain
from \href{http://bit.ly/isoseqpub}{http://bit.ly/isoseqpub}). The observation
is similar: minimap2 is faster at higher junction accuracy.
We noted that GMAP and SpAln have not been optimized for noisy reads. We are
showing the best setting we have experimented, but their developers should be
able to improve their accuracy further.
%\begin{table}[!tb]
%\processtable{Evaluation of junction accuracy on SMRT Iso-Seq reads}
%{\footnotesize
%\begin{tabular}{lrrrr}
%\toprule
%& GMAP & minimap2 & SpAln & STAR\\
%\midrule
%Run time (CPU min) & & 243 & 2\,352 & 1\,647 \\
%\# aligned reads & & 1\,123\,025 & 1\,094\,092 & 682\,452\\
%\# chimeric alignments & & 33\,091 & 0 & 0\\
%\# non-spliced alignments & & 339\,081 & 291\,447 & 272\,536\vspace{1em}\\
%\# aligned introns & & 9\,071\,755 & 9\,208\,564 & 3\,029\,121 \\
%\# novel introns & & 42\,773 & 82\,230 & 17\,791 \\
%\% exact introns & & 94.9\% & 91.7\% & 84.7\% \\
%\% approx. introns&& 96.9\% & 93.4\% & 93.8\% \\
%\botrule
%\end{tabular}
%}{}
%\end{table}
\section{Conclusion}
Minimap2 is a fast, accurate and versatile aligner for long nucleotide
sequences. In addition to reference-based read mapping, minimap2 inherits
minimap's functionality to search against huge multi-species databases and to
find read overlaps. On a few test data sets, minimap2 appears to yield slightly
better miniasm assembly~\citep{Li:2016aa}. Minimap2 can also align similar
genomes or different assemblies of the same species. However, full-genome
alignment is an intricate research topic. More thorough evaluations would be
necessary to justify the use of minimap2 for such applications.
\section*{Acknowledgements}
We owe a debt of gratitude to Hajime Suzuki for releasing his masterpiece and
insightful notes before formal publication. We thank M. Schatz, P. Rescheneder
and F. Sedlazeck for pointing out the limitation of BWA-MEM. We are also
grateful to early minimap2 testers who have greatly helped to fix various
issues.
\bibliography{minimap2}
\end{document}
+30
View File
@@ -0,0 +1,30 @@
Q 60 32066 0 0.000000000
Q 40 32 1 0.000031155
Q 38 19 1 0.000062272
Q 36 11 1 0.000093376
Q 35 32 1 0.000124378
Q 33 15 1 0.000155400
Q 32 58 1 0.000186145
Q 27 11 1 0.000217095
Q 26 80 1 0.000247494
Q 21 19 2 0.000309186
Q 20 16 1 0.000339936
Q 19 19 1 0.000370622
Q 18 22 2 0.000432099
Q 17 37 5 0.000585751
Q 15 24 2 0.000646930
Q 14 18 3 0.000738939
Q 13 30 6 0.000922821
Q 12 18 1 0.000953054
Q 11 29 2 0.001013638
Q 10 30 1 0.001043393
Q 9 20 5 0.001196099
Q 8 25 8 0.001440348
Q 7 28 6 0.001622830
Q 6 35 12 0.001988132
Q 5 34 12 0.002352725
Q 4 29 8 0.002594865
Q 3 36 14 0.003018937
Q 2 46 15 0.003471482
Q 1 69 36 0.004558162
Q 0 167 94 0.007377173
+17
View File
@@ -0,0 +1,17 @@
Q 60 32072 0 0.000000000
Q 43 206 1 0.000030981
Q 27 201 1 0.000061578
Q 15 59 1 0.000092200
Q 12 25 1 0.000122839
Q 11 16 1 0.000153473
Q 10 24 1 0.000184032
Q 9 17 2 0.000245248
Q 8 27 3 0.000336938
Q 7 23 1 0.000367309
Q 6 20 1 0.000397675
Q 5 18 4 0.000519751
Q 4 17 1 0.000550038
Q 3 29 5 0.000702204
Q 2 32 4 0.000823522
Q 1 54 6 0.001004872
Q 0 234 106 0.004202697
+1288
View File
File diff suppressed because it is too large Load Diff
+803
View File
@@ -0,0 +1,803 @@
%%
%% This is file `natbib.sty',
%% generated with the docstrip utility.
%%
%% The original source files were:
%%
%% natbib.dtx (with options: `package,all')
%% =============================================
%% IMPORTANT NOTICE:
%%
%% This program can be redistributed and/or modified under the terms
%% of the LaTeX Project Public License Distributed from CTAN
%% archives in directory macros/latex/base/lppl.txt; either
%% version 1 of the License, or any later version.
%%
%% This is a generated file.
%% It may not be distributed without the original source file natbib.dtx.
%%
%% Full documentation can be obtained by LaTeXing that original file.
%% Only a few abbreviated comments remain here to describe the usage.
%% =============================================
%% Copyright 1993-2000 Patrick W Daly
%% Max-Planck-Institut f\"ur Aeronomie
%% Max-Planck-Str. 2
%% D-37191 Katlenburg-Lindau
%% Germany
%% E-mail: daly@linmpi.mpg.de
\NeedsTeXFormat{LaTeX2e}[1995/06/01]
\ProvidesPackage{natbib}
[2000/07/24 7.0a (PWD)]
% This package reimplements the LaTeX \cite command to be used for various
% citation styles, both author-year and numerical. It accepts BibTeX
% output intended for many other packages, and therefore acts as a
% general, all-purpose citation-style interface.
%
% With standard numerical .bst files, only numerical citations are
% possible. With an author-year .bst file, both numerical and
% author-year citations are possible.
%
% If author-year citations are selected, \bibitem must have one of the
% following forms:
% \bibitem[Jones et al.(1990)]{key}...
% \bibitem[Jones et al.(1990)Jones, Baker, and Williams]{key}...
% \bibitem[Jones et al., 1990]{key}...
% \bibitem[\protect\citeauthoryear{Jones, Baker, and Williams}{Jones
% et al.}{1990}]{key}...
% \bibitem[\protect\citeauthoryear{Jones et al.}{1990}]{key}...
% \bibitem[\protect\astroncite{Jones et al.}{1990}]{key}...
% \bibitem[\protect\citename{Jones et al., }1990]{key}...
% \harvarditem[Jones et al.]{Jones, Baker, and Williams}{1990}{key}...
%
% This is either to be made up manually, or to be generated by an
% appropriate .bst file with BibTeX.
% Author-year mode || Numerical mode
% Then, \citet{key} ==>> Jones et al. (1990) || Jones et al. [21]
% \citep{key} ==>> (Jones et al., 1990) || [21]
% Multiple citations as normal:
% \citep{key1,key2} ==>> (Jones et al., 1990; Smith, 1989) || [21,24]
% or (Jones et al., 1990, 1991) || [21,24]
% or (Jones et al., 1990a,b) || [21,24]
% \cite{key} is the equivalent of \citet{key} in author-year mode
% and of \citep{key} in numerical mode
% Full author lists may be forced with \citet* or \citep*, e.g.
% \citep*{key} ==>> (Jones, Baker, and Williams, 1990)
% Optional notes as:
% \citep[chap. 2]{key} ==>> (Jones et al., 1990, chap. 2)
% \citep[e.g.,][]{key} ==>> (e.g., Jones et al., 1990)
% \citep[see][pg. 34]{key}==>> (see Jones et al., 1990, pg. 34)
% (Note: in standard LaTeX, only one note is allowed, after the ref.
% Here, one note is like the standard, two make pre- and post-notes.)
% \citealt{key} ==>> Jones et al. 1990
% \citealt*{key} ==>> Jones, Baker, and Williams 1990
% \citealp{key} ==>> Jones et al., 1990
% \citealp*{key} ==>> Jones, Baker, and Williams, 1990
% Additional citation possibilities (both author-year and numerical modes)
% \citeauthor{key} ==>> Jones et al.
% \citeauthor*{key} ==>> Jones, Baker, and Williams
% \citeyear{key} ==>> 1990
% \citeyearpar{key} ==>> (1990)
% \citetext{priv. comm.} ==>> (priv. comm.)
% Note: full author lists depends on whether the bib style supports them;
% if not, the abbreviated list is printed even when full requested.
%
% For names like della Robbia at the start of a sentence, use
% \Citet{dRob98} ==>> Della Robbia (1998)
% \Citep{dRob98} ==>> (Della Robbia, 1998)
% \Citeauthor{dRob98} ==>> Della Robbia
%
%
% Citation aliasing is achieved with
% \defcitealias{key}{text}
% \citetalias{key} ==>> text
% \citepalias{key} ==>> (text)
%
% Defining the citation style of a given bib style:
% Use \bibpunct (in the preamble only) with 6 mandatory arguments:
% 1. opening bracket for citation
% 2. closing bracket
% 3. citation separator (for multiple citations in one \cite)
% 4. the letter n for numerical styles, s for superscripts
% else anything for author-year
% 5. punctuation between authors and date
% 6. punctuation between years (or numbers) when common authors missing
% One optional argument is the character coming before post-notes. It
% appears in square braces before all other arguments. May be left off.
% Example (and default) \bibpunct[, ]{(}{)}{;}{a}{,}{,}
%
% To make this automatic for a given bib style, named newbib, say, make
% a local configuration file, natbib.cfg, with the definition
% \newcommand{\bibstyle@newbib}{\bibpunct...}
% Then the \bibliographystyle{newbib} will cause \bibstyle@newbib to
% be called on THE NEXT LATEX RUN (via the aux file).
%
% Such preprogrammed definitions may be invoked in the text (preamble only)
% by calling \citestyle{newbib}. This is only useful if the style specified
% differs from that in \bibliographystyle.
%
% With \citeindextrue and \citeindexfalse, one can control whether the
% \cite commands make an automatic entry of the citation in the .idx
% indexing file. For this, \makeindex must also be given in the preamble.
%
% LaTeX2e Options: (for selecting punctuation)
% round - round parentheses are used (default)
% square - square brackets are used [option]
% curly - curly braces are used {option}
% angle - angle brackets are used <option>
% colon - multiple citations separated by colon (default)
% comma - separated by comma
% authoryear - selects author-year citations (default)
% numbers- selects numerical citations
% super - numerical citations as superscripts
% sort - sorts multiple citations according to order in ref. list
% sort&compress - like sort, but also compresses numerical citations
% longnamesfirst - makes first citation full author list
% sectionbib - puts bibliography in a \section* instead of \chapter*
% Punctuation so selected dominates over any predefined ones.
% LaTeX2e options are called as, e.g.
% \usepackage[square,comma]{natbib}
% LaTeX the source file natbib.dtx to obtain more details
% or the file natnotes.tex for a brief reference sheet.
%-----------------------------------------------------------
\@ifclassloaded{aguplus}{\PackageError{natbib}
{The aguplus class already includes natbib coding,\MessageBreak
so you should not add it explicitly}
{Type <Return> for now, but then later remove\MessageBreak
the command \protect\usepackage{natbib} from the document}
\endinput}{}
\@ifclassloaded{nlinproc}{\PackageError{natbib}
{The nlinproc class already includes natbib coding,\MessageBreak
so you should not add it explicitly}
{Type <Return> for now, but then later remove\MessageBreak
the command \protect\usepackage{natbib} from the document}
\endinput}{}
\@ifclassloaded{egs}{\PackageError{natbib}
{The egs class already includes natbib coding,\MessageBreak
so you should not add it explicitly}
{Type <Return> for now, but then later remove\MessageBreak
the command \protect\usepackage{natbib} from the document}
\endinput}{}
% Define citation punctuation for some author-year styles
% One may add and delete at this point
% Or put additions into local configuration file natbib.cfg
\newcommand\bibstyle@chicago{\bibpunct{(}{)}{;}{a}{,}{,}}
\newcommand\bibstyle@named{\bibpunct{[}{]}{;}{a}{,}{,}}
\newcommand\bibstyle@agu{\bibpunct{[}{]}{;}{a}{,}{,~}}%Amer. Geophys. Union
\newcommand\bibstyle@egs{\bibpunct{(}{)}{;}{a}{,}{,}}%Eur. Geophys. Soc.
\newcommand\bibstyle@agsm{\bibpunct{(}{)}{,}{a}{}{,}\gdef\harvardand{\&}}
\newcommand\bibstyle@kluwer{\bibpunct{(}{)}{,}{a}{}{,}\gdef\harvardand{\&}}
\newcommand\bibstyle@dcu{\bibpunct{(}{)}{;}{a}{;}{,}\gdef\harvardand{and}}
\newcommand\bibstyle@aa{\bibpunct{(}{)}{;}{a}{}{,}} %Astronomy & Astrophysics
\newcommand\bibstyle@pass{\bibpunct{(}{)}{;}{a}{,}{,}}%Planet. & Space Sci
\newcommand\bibstyle@anngeo{\bibpunct{(}{)}{;}{a}{,}{,}}%Annales Geophysicae
\newcommand\bibstyle@nlinproc{\bibpunct{(}{)}{;}{a}{,}{,}}%Nonlin.Proc.Geophys.
% Define citation punctuation for some numerical styles
\newcommand\bibstyle@cospar{\bibpunct{/}{/}{,}{n}{}{}%
\gdef\NAT@biblabelnum##1{##1.}}
\newcommand\bibstyle@esa{\bibpunct{(Ref.~}{)}{,}{n}{}{}%
\gdef\NAT@biblabelnum##1{##1.\hspace{1em}}}
\newcommand\bibstyle@nature{\bibpunct{}{}{,}{s}{}{\textsuperscript{,}}%
\gdef\NAT@biblabelnum##1{##1.}}
% The standard LaTeX styles
\newcommand\bibstyle@plain{\bibpunct{[}{]}{,}{n}{}{,}}
\let\bibstyle@alpha=\bibstyle@plain
\let\bibstyle@abbrv=\bibstyle@plain
\let\bibstyle@unsrt=\bibstyle@plain
% The author-year modifications of the standard styles
\newcommand\bibstyle@plainnat{\bibpunct{[}{]}{,}{a}{,}{,}}
\let\bibstyle@abbrvnat=\bibstyle@plainnat
\let\bibstyle@unsrtnat=\bibstyle@plainnat
\newif\ifNAT@numbers \NAT@numbersfalse
\newif\ifNAT@super \NAT@superfalse
\DeclareOption{numbers}{\NAT@numberstrue
\ExecuteOptions{square,comma,nobibstyle}}
\DeclareOption{super}{\NAT@supertrue\NAT@numberstrue
\renewcommand\NAT@open{}\renewcommand\NAT@close{}
\ExecuteOptions{nobibstyle}}
\DeclareOption{authoryear}{\NAT@numbersfalse
\ExecuteOptions{round,colon,bibstyle}}
\DeclareOption{round}{%
\renewcommand\NAT@open{(} \renewcommand\NAT@close{)}
\ExecuteOptions{nobibstyle}}
\DeclareOption{square}{%
\renewcommand\NAT@open{[} \renewcommand\NAT@close{]}
\ExecuteOptions{nobibstyle}}
\DeclareOption{angle}{%
\renewcommand\NAT@open{$<$} \renewcommand\NAT@close{$>$}
\ExecuteOptions{nobibstyle}}
\DeclareOption{curly}{%
\renewcommand\NAT@open{\{} \renewcommand\NAT@close{\}}
\ExecuteOptions{nobibstyle}}
\DeclareOption{comma}{\renewcommand\NAT@sep{,}
\ExecuteOptions{nobibstyle}}
\DeclareOption{colon}{\renewcommand\NAT@sep{;}
\ExecuteOptions{nobibstyle}}
\DeclareOption{nobibstyle}{\let\bibstyle=\@gobble}
\DeclareOption{bibstyle}{\let\bibstyle=\@citestyle}
\newif\ifNAT@openbib \NAT@openbibfalse
\DeclareOption{openbib}{\NAT@openbibtrue}
\DeclareOption{sectionbib}{\def\NAT@sectionbib{on}}
\def\NAT@sort{0}
\DeclareOption{sort}{\def\NAT@sort{1}}
\DeclareOption{sort&compress}{\def\NAT@sort{2}}
\@ifpackageloaded{cite}{\PackageWarningNoLine{natbib}
{The `cite' package should not be used\MessageBreak
with natbib. Use option `sort' instead}\ExecuteOptions{sort}}{}
\newif\ifNAT@longnames\NAT@longnamesfalse
\DeclareOption{longnamesfirst}{\NAT@longnamestrue}
\DeclareOption{nonamebreak}{\def\NAT@nmfmt#1{\mbox{\NAT@up#1}}}
\def\NAT@nmfmt#1{{\NAT@up#1}}
\renewcommand\bibstyle[1]{\@ifundefined{bibstyle@#1}{\relax}
{\csname bibstyle@#1\endcsname}}
\AtBeginDocument{\global\let\bibstyle=\@gobble}
\let\@citestyle\bibstyle
\newcommand\citestyle[1]{\@citestyle{#1}\let\bibstyle\@gobble}
\@onlypreamble{\citestyle}\@onlypreamble{\@citestyle}
\newcommand\bibpunct[7][, ]%
{\gdef\NAT@open{#2}\gdef\NAT@close{#3}\gdef
\NAT@sep{#4}\global\NAT@numbersfalse\ifx #5n\global\NAT@numberstrue
\else
\ifx #5s\global\NAT@numberstrue\global\NAT@supertrue
\fi\fi
\gdef\NAT@aysep{#6}\gdef\NAT@yrsep{#7}%
\gdef\NAT@cmt{#1}%
\global\let\bibstyle\@gobble
}
\@onlypreamble{\bibpunct}
\newcommand\NAT@open{(} \newcommand\NAT@close{)}
\newcommand\NAT@sep{;}
\ProcessOptions
\newcommand\NAT@aysep{,} \newcommand\NAT@yrsep{,}
\newcommand\NAT@cmt{, }
\newcommand\NAT@cite%
[3]{\ifNAT@swa\NAT@@open\if*#2*\else#2\ \fi
#1\if*#3*\else\NAT@cmt#3\fi\NAT@@close\else#1\fi\endgroup}
\newcommand\NAT@citenum%
[3]{\ifNAT@swa\NAT@@open\if*#2*\else#2\ \fi
#1\if*#3*\else\NAT@cmt#3\fi\NAT@@close\else#1\fi\endgroup}
\newcommand\NAT@citesuper[3]{\ifNAT@swa
\unskip\hspace{1\p@}\textsuperscript{#1}%
\if*#3*\else\ (#3)\fi\else #1\fi\endgroup}
\providecommand
\textsuperscript[1]{\mbox{$^{\mbox{\scriptsize#1}}$}}
\providecommand\@firstofone[1]{#1}
\newcommand\NAT@citexnum{}
\def\NAT@citexnum[#1][#2]#3{%
\NAT@sort@cites{#3}%
\let\@citea\@empty
\@cite{\def\NAT@num{-1}\let\NAT@last@yr\relax\let\NAT@nm\@empty
\@for\@citeb:=\NAT@cite@list\do
{\edef\@citeb{\expandafter\@firstofone\@citeb}%
\if@filesw\immediate\write\@auxout{\string\citation{\@citeb}}\fi
\@ifundefined{b@\@citeb\@extra@b@citeb}{%
{\reset@font\bfseries?}
\NAT@citeundefined\PackageWarning{natbib}%
{Citation `\@citeb' on page \thepage \space undefined}}%
{\let\NAT@last@num\NAT@num\let\NAT@last@nm\NAT@nm
\NAT@parse{\@citeb}%
\ifNAT@longnames\@ifundefined{bv@\@citeb\@extra@b@citeb}{%
\let\NAT@name=\NAT@all@names
\global\@namedef{bv@\@citeb\@extra@b@citeb}{}}{}%
\fi
\ifNAT@full\let\NAT@nm\NAT@all@names\else
\let\NAT@nm\NAT@name\fi
\ifNAT@swa
\ifnum\NAT@ctype>1\relax\@citea
\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
\ifnum\NAT@ctype=2\relax\NAT@test{\NAT@ctype}%
\else\NAT@alias
\fi\hyper@natlinkend\else
\ifnum\NAT@sort>1
\begingroup\catcode`\_=8
\ifcat _\ifnum\z@<0\NAT@num _\else A\fi
\global\let\NAT@nm=\NAT@num \else \gdef\NAT@nm{-2}\fi
\ifcat _\ifnum\z@<0\NAT@last@num _\else A\fi
\global\@tempcnta=\NAT@last@num \global\advance\@tempcnta by\@ne
\else \global\@tempcnta\m@ne\fi
\endgroup
\ifnum\NAT@nm=\@tempcnta
\ifx\NAT@last@yr\relax
\edef\NAT@last@yr{\@citea \mbox{\noexpand\citenumfont{\NAT@num}}}%
\else
\edef\NAT@last@yr{--\penalty\@m\mbox{\noexpand\citenumfont{\NAT@num}}}%
\fi
\else
\NAT@last@yr \@citea \mbox{\citenumfont{\NAT@num}}%
\let\NAT@last@yr\relax
\fi
\else
\@citea \mbox{\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
{\citenumfont{\NAT@num}}\hyper@natlinkend}%
\fi
\fi
\def\@citea{\NAT@sep\penalty\@m\NAT@space}%
\else
\ifcase\NAT@ctype\relax
\ifx\NAT@last@nm\NAT@nm \NAT@yrsep\penalty\@m\NAT@space\else
\@citea \NAT@test{1}\ \NAT@@open
\if*#1*\else#1\ \fi\fi \NAT@mbox{%
\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
{\citenumfont{\NAT@num}}\hyper@natlinkend}%
\def\@citea{\NAT@@close\NAT@sep\penalty\@m\ }%
\or\@citea
\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
\NAT@test{\NAT@ctype}\hyper@natlinkend
\def\@citea{\NAT@sep\penalty\@m\ }%
\or\@citea
\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
\NAT@test{\NAT@ctype}\hyper@natlinkend
\def\@citea{\NAT@sep\penalty\@m\ }%
\or\@citea
\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
\NAT@alias\hyper@natlinkend
\def\@citea{\NAT@sep\penalty\@m\ }%
\fi
\fi
}}%
\ifnum\NAT@sort>1\relax\NAT@last@yr\fi
\ifNAT@swa\else\ifnum\NAT@ctype=0\if*#2*\else
\NAT@cmt#2\fi \NAT@@close\fi\fi}{#1}{#2}}
\newcommand\NAT@test[1]{\ifnum#1=1 \ifx\NAT@nm\NAT@noname
{\reset@font\bfseries(author?)}\PackageWarning{natbib}
{Author undefined for citation`\@citeb'
\MessageBreak
on page \thepage}\else \NAT@nm \fi
\else \if\relax\NAT@date\relax
{\reset@font\bfseries(year?)}\PackageWarning{natbib}
{Year undefined for citation`\@citeb'
\MessageBreak
on page \thepage}\else \NAT@date \fi \fi}
\let\citenumfont=\relax
\newcommand\NAT@citex{}
\def\NAT@citex%
[#1][#2]#3{%
\NAT@sort@cites{#3}%
\let\@citea\@empty
\@cite{\let\NAT@nm\@empty\let\NAT@year\@empty
\@for\@citeb:=\NAT@cite@list\do
{\edef\@citeb{\expandafter\@firstofone\@citeb}%
\if@filesw\immediate\write\@auxout{\string\citation{\@citeb}}\fi
\@ifundefined{b@\@citeb\@extra@b@citeb}{\@citea%
{\reset@font\bfseries ?}\NAT@citeundefined
\PackageWarning{natbib}%
{Citation `\@citeb' on page \thepage \space undefined}\def\NAT@date{}}%
{\let\NAT@last@nm=\NAT@nm\let\NAT@last@yr=\NAT@year
\NAT@parse{\@citeb}%
\ifNAT@longnames\@ifundefined{bv@\@citeb\@extra@b@citeb}{%
\let\NAT@name=\NAT@all@names
\global\@namedef{bv@\@citeb\@extra@b@citeb}{}}{}%
\fi
\ifNAT@full\let\NAT@nm\NAT@all@names\else
\let\NAT@nm\NAT@name\fi
\ifNAT@swa\ifcase\NAT@ctype
\if\relax\NAT@date\relax
\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
\NAT@nmfmt{\NAT@nm}\NAT@date\hyper@natlinkend
\else
\ifx\NAT@last@nm\NAT@nm\NAT@yrsep
\ifx\NAT@last@yr\NAT@year
\hyper@natlinkstart{\@citeb\@extra@b@citeb}\NAT@exlab
\hyper@natlinkend
\else\unskip\
\hyper@natlinkstart{\@citeb\@extra@b@citeb}\NAT@date
\hyper@natlinkend
\fi
\else\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
\NAT@nmfmt{\NAT@nm}%
\hyper@natlinkbreak{\NAT@aysep\ }{\@citeb\@extra@b@citeb}%
\NAT@date\hyper@natlinkend
\fi
\fi
\or\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
\NAT@nmfmt{\NAT@nm}\hyper@natlinkend
\or\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
\NAT@date\hyper@natlinkend
\or\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
\NAT@alias\hyper@natlinkend
\fi \def\@citea{\NAT@sep\ }%
\else\ifcase\NAT@ctype
\if\relax\NAT@date\relax
\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
\NAT@nmfmt{\NAT@nm}\hyper@natlinkend
\else
\ifx\NAT@last@nm\NAT@nm\NAT@yrsep
\ifx\NAT@last@yr\NAT@year
\hyper@natlinkstart{\@citeb\@extra@b@citeb}\NAT@exlab
\hyper@natlinkend
\else\unskip\
\hyper@natlinkstart{\@citeb\@extra@b@citeb}\NAT@date
\hyper@natlinkend
\fi
\else\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
\NAT@nmfmt{\NAT@nm}%
\hyper@natlinkbreak{\ \NAT@@open\if*#1*\else#1\ \fi}%
{\@citeb\@extra@b@citeb}%
\NAT@date\hyper@natlinkend\fi
\fi
\or\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
\NAT@nmfmt{\NAT@nm}\hyper@natlinkend
\or\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
\NAT@date\hyper@natlinkend
\or\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
\NAT@alias\hyper@natlinkend
\fi \if\relax\NAT@date\relax\def\@citea{\NAT@sep\ }%
\else\def\@citea{\NAT@@close\NAT@sep\ }\fi
\fi
}}\ifNAT@swa\else\if*#2*\else\NAT@cmt#2\fi
\if\relax\NAT@date\relax\else\NAT@@close\fi\fi}{#1}{#2}}
\newif\ifNAT@par \NAT@partrue
\newcommand\NAT@@open{\ifNAT@par\NAT@open\fi}
\newcommand\NAT@@close{\ifNAT@par\NAT@close\fi}
\newcommand\NAT@alias{\@ifundefined{al@\@citeb\@extra@b@citeb}{%
{\reset@font\bfseries(alias?)}\PackageWarning{natbib}
{Alias undefined for citation `\@citeb'
\MessageBreak on page \thepage}}{\@nameuse{al@\@citeb\@extra@b@citeb}}}
\let\NAT@up\relax
\newcommand\NAT@Up[1]{{\let\protect\@unexpandable@protect\let~\relax
\expandafter\NAT@deftemp#1}\expandafter\NAT@UP\NAT@temp}
\newcommand\NAT@deftemp[1]{\xdef\NAT@temp{#1}}
\newcommand\NAT@UP[1]{\let\@tempa\NAT@UP\ifcat a#1\MakeUppercase{#1}%
\let\@tempa\relax\else#1\fi\@tempa}
\newcommand\shortcites[1]{%
\@bsphack\@for\@citeb:=#1\do
{\edef\@citeb{\expandafter\@firstofone\@citeb}%
\global\@namedef{bv@\@citeb\@extra@b@citeb}{}}\@esphack}
\newcommand\NAT@biblabel[1]{\hfill}
\newcommand\NAT@biblabelnum[1]{\bibnumfmt{#1}}
\newcommand\bibnumfmt[1]{[#1]}
\def\@tempa#1{[#1]}
\ifx\@tempa\@biblabel\let\@biblabel\@empty\fi
\newcommand\NAT@bibsetnum[1]{\settowidth\labelwidth{\@biblabel{#1}}%
\setlength{\leftmargin}{\labelwidth}\addtolength{\leftmargin}{\labelsep}%
\setlength{\itemsep}{\bibsep}\setlength{\parsep}{\z@}%
\ifNAT@openbib
\addtolength{\leftmargin}{4mm}%
\setlength{\itemindent}{-4mm}%
\setlength{\listparindent}{\itemindent}%
\setlength{\parsep}{0pt}%
\fi
}
\newlength{\bibhang}
\setlength{\bibhang}{1em}
\newlength{\bibsep}
{\@listi \global\bibsep\itemsep \global\advance\bibsep by\parsep}
\newcommand\NAT@bibsetup%
[1]{\setlength{\leftmargin}{\bibhang}\setlength{\itemindent}{-\leftmargin}%
\setlength{\itemsep}{\bibsep}\setlength{\parsep}{\z@}}
\newcommand\NAT@set@cites{\ifNAT@numbers
\ifNAT@super \let\@cite\NAT@citesuper
\def\NAT@mbox##1{\unskip\nobreak\hspace{1\p@}\textsuperscript{##1}}%
\let\citeyearpar=\citeyear
\let\NAT@space\relax\else
\let\NAT@mbox=\mbox
\let\@cite\NAT@citenum \def\NAT@space{ }\fi
\let\@citex\NAT@citexnum
\ifx\@biblabel\@empty\let\@biblabel\NAT@biblabelnum\fi
\let\@bibsetup\NAT@bibsetnum
\def\natexlab##1{}%
\else
\let\@cite\NAT@cite
\let\@citex\NAT@citex
\let\@biblabel\NAT@biblabel
\let\@bibsetup\NAT@bibsetup
\def\natexlab##1{##1}%
\fi}
\AtBeginDocument{\NAT@set@cites}
\AtBeginDocument{\ifx\SK@def\@undefined\else
\ifx\SK@cite\@empty\else
\SK@def\@citex[#1][#2]#3{\SK@\SK@@ref{#3}\SK@@citex[#1][#2]{#3}}\fi
\ifx\SK@citeauthor\@undefined\def\HAR@checkdef{}\else
\let\citeauthor\SK@citeauthor
\let\citefullauthor\SK@citefullauthor
\let\citeyear\SK@citeyear\fi
\fi}
\AtBeginDocument{\@ifpackageloaded{hyperref}{%
\ifnum\NAT@sort=2\def\NAT@sort{1}\fi}{}}
\newif\ifNAT@full\NAT@fullfalse
\newif\ifNAT@swa
\DeclareRobustCommand\citet
{\begingroup\NAT@swafalse\def\NAT@ctype{0}\NAT@partrue
\@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
\newcommand\NAT@citetp{\@ifnextchar[{\NAT@@citetp}{\NAT@@citetp[]}}
\newcommand\NAT@@citetp{}
\def\NAT@@citetp[#1]{\@ifnextchar[{\@citex[#1]}{\@citex[][#1]}}
\DeclareRobustCommand\citep
{\begingroup\NAT@swatrue\def\NAT@ctype{0}\NAT@partrue
\@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
\DeclareRobustCommand\cite
{\begingroup\def\NAT@ctype{0}\NAT@partrue\NAT@swatrue
\@ifstar{\NAT@fulltrue\NAT@cites}{\NAT@fullfalse\NAT@cites}}
\newcommand\NAT@cites{\@ifnextchar [{\NAT@@citetp}{%
\ifNAT@numbers\else
\NAT@swafalse
\fi
\NAT@@citetp[]}}
\DeclareRobustCommand\citealt
{\begingroup\NAT@swafalse\def\NAT@ctype{0}\NAT@parfalse
\@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
\DeclareRobustCommand\citealp
{\begingroup\NAT@swatrue\def\NAT@ctype{0}\NAT@parfalse
\@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
\DeclareRobustCommand\citeauthor
{\begingroup\NAT@swafalse\def\NAT@ctype{1}\NAT@parfalse
\@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
\DeclareRobustCommand\Citet
{\begingroup\NAT@swafalse\def\NAT@ctype{0}\NAT@partrue
\let\NAT@up\NAT@Up
\@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
\DeclareRobustCommand\Citep
{\begingroup\NAT@swatrue\def\NAT@ctype{0}\NAT@partrue
\let\NAT@up\NAT@Up
\@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
\DeclareRobustCommand\Citealt
{\begingroup\NAT@swafalse\def\NAT@ctype{0}\NAT@parfalse
\let\NAT@up\NAT@Up
\@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
\DeclareRobustCommand\Citealp
{\begingroup\NAT@swatrue\def\NAT@ctype{0}\NAT@parfalse
\let\NAT@up\NAT@Up
\@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
\DeclareRobustCommand\Citeauthor
{\begingroup\NAT@swafalse\def\NAT@ctype{1}\NAT@parfalse
\let\NAT@up\NAT@Up
\@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
\DeclareRobustCommand\citeyear
{\begingroup\NAT@swafalse\def\NAT@ctype{2}\NAT@parfalse\NAT@citetp}
\DeclareRobustCommand\citeyearpar
{\begingroup\NAT@swatrue\def\NAT@ctype{2}\NAT@partrue\NAT@citetp}
\newcommand\citetext[1]{\NAT@open#1\NAT@close}
\DeclareRobustCommand\citefullauthor
{\citeauthor*}
\newcommand\defcitealias[2]{%
\@ifundefined{al@#1\@extra@b@citeb}{}
{\PackageWarning{natbib}{Overwriting existing alias for citation #1}}
\@namedef{al@#1\@extra@b@citeb}{#2}}
\DeclareRobustCommand\citetalias{\begingroup
\NAT@swafalse\def\NAT@ctype{3}\NAT@parfalse\NAT@citetp}
\DeclareRobustCommand\citepalias{\begingroup
\NAT@swatrue\def\NAT@ctype{3}\NAT@partrue\NAT@citetp}
\renewcommand\nocite[1]{\@bsphack
\@for\@citeb:=#1\do{%
\edef\@citeb{\expandafter\@firstofone\@citeb}%
\if@filesw\immediate\write\@auxout{\string\citation{\@citeb}}\fi
\if*\@citeb\else
\@ifundefined{b@\@citeb\@extra@b@citeb}{%
\NAT@citeundefined \PackageWarning{natbib}%
{Citation `\@citeb' undefined}}{}\fi}%
\@esphack}
\newcommand\NAT@parse[1]{{%
\let\protect=\@unexpandable@protect\let~\relax
\let\active@prefix=\@gobble
\xdef\NAT@temp{\csname b@#1\@extra@b@citeb\endcsname}}%
\expandafter\NAT@split\NAT@temp
\expandafter\NAT@parse@date\NAT@date??????@@%
\ifciteindex\NAT@index\fi
}
\newcommand\NAT@split[4]{%
\gdef\NAT@num{#1}\gdef\NAT@name{#3}\gdef\NAT@date{#2}%
\gdef\NAT@all@names{#4}%
\ifx\NAT@noname\NAT@all@names \gdef\NAT@all@names{#3}\fi}
\newcommand\NAT@parse@date{}
\def\NAT@parse@date#1#2#3#4#5#6@@{%
\ifnum\the\catcode`#1=11\def\NAT@year{}\def\NAT@exlab{#1}\else
\ifnum\the\catcode`#2=11\def\NAT@year{#1}\def\NAT@exlab{#2}\else
\ifnum\the\catcode`#3=11\def\NAT@year{#1#2}\def\NAT@exlab{#3}\else
\ifnum\the\catcode`#4=11\def\NAT@year{#1#2#3}\def\NAT@exlab{#4}\else
\def\NAT@year{#1#2#3#4}\def\NAT@exlab{{#5}}\fi\fi\fi\fi}
\newcommand\NAT@index{}
\let\NAT@makeindex=\makeindex
\renewcommand\makeindex{\NAT@makeindex
\renewcommand\NAT@index{\@bsphack\begingroup
\def~{\string~}\@wrindex{\NAT@idxtxt}}}
\newcommand\NAT@idxtxt{\NAT@name\ \NAT@open\NAT@date\NAT@close}
\@ifundefined{@indexfile}{}{\let\NAT@makeindex\relax\makeindex}
\newif\ifciteindex \citeindexfalse
\newcommand\citeindextype{default}
\newcommand\NAT@index@alt{{\let\protect=\noexpand\let~\relax
\xdef\NAT@temp{\NAT@idxtxt}}\expandafter\NAT@exp\NAT@temp\@nil}
\newcommand\NAT@exp{}
\def\NAT@exp#1\@nil{\mbox{}\index[\citeindextype]{#1}}
\AtBeginDocument{%
\@ifpackageloaded{index}{\let\NAT@index=\NAT@index@alt}{}}
\newcommand\NAT@ifcmd{\futurelet\NAT@temp\NAT@ifxcmd}
\newcommand\NAT@ifxcmd{\ifx\NAT@temp\relax\else\expandafter\NAT@bare\fi}
\def\NAT@bare#1(#2)#3(@)#4\@nil#5{%
\if @#2
\expandafter\NAT@apalk#1, , \@nil{#5}\else
\stepcounter{NAT@ctr}%
\NAT@wrout{\arabic {NAT@ctr}}{#2}{#1}{#3}{#5}
\fi
}
\newcommand\NAT@wrout[5]{%
\if@filesw
{\let\protect\noexpand\let~\relax
\immediate
\write\@auxout{\string\bibcite{#5}{{#1}{#2}{{#3}}{{#4}}}}}\fi
\ignorespaces}
\def\NAT@noname{{}}
\renewcommand\bibitem{%
\@ifnextchar[{\@lbibitem}{%
\global\NAT@stdbsttrue
\stepcounter{NAT@ctr}\@lbibitem[\arabic{NAT@ctr}]}}
\def\@lbibitem[#1]#2{%
\if\relax\@extra@b@citeb\relax\else
\@ifundefined{br@#2\@extra@b@citeb}{}{%
\@namedef{br@#2}{\@nameuse{br@#2\@extra@b@citeb}}}\fi
\@ifundefined{b@#2\@extra@b@citeb}{\def\NAT@num{}}{\NAT@parse{#2}}%
\item[\hfil\hyper@natanchorstart{#2\@extra@b@citeb}\@biblabel{\NAT@num}%
\hyper@natanchorend]%
\NAT@ifcmd#1(@)(@)\@nil{#2}}
\ifx\SK@lbibitem\@undefined\else
\let\SK@lbibitem\@lbibitem
\def\@lbibitem[#1]#2{%
\SK@lbibitem[#1]{#2}\SK@\SK@@label{#2}\ignorespaces}\fi
\newif\ifNAT@stdbst \NAT@stdbstfalse
\AtEndDocument
{\ifNAT@stdbst\if@filesw\immediate\write\@auxout{\string
\global\string\NAT@numberstrue}\fi\fi
}
\providecommand\bibcite{}
\renewcommand\bibcite[2]{\@ifundefined{b@#1\@extra@binfo}\relax
{\NAT@citemultiple
\PackageWarningNoLine{natbib}{Citation `#1' multiply defined}}%
\global\@namedef{b@#1\@extra@binfo}{#2}}
\AtEndDocument{\NAT@swatrue\let\bibcite\NAT@testdef}
\newcommand\NAT@testdef[2]{%
\def\NAT@temp{#2}\expandafter \ifx \csname b@#1\@extra@binfo\endcsname
\NAT@temp \else \ifNAT@swa \NAT@swafalse
\PackageWarningNoLine{natbib}{Citation(s) may have
changed.\MessageBreak
Rerun to get citations correct}\fi\fi}
\newcommand\NAT@apalk{}
\def\NAT@apalk#1, #2, #3\@nil#4{\if\relax#2\relax
\global\NAT@stdbsttrue
\NAT@wrout{#1}{}{}{}{#4}\else
\stepcounter{NAT@ctr}%
\NAT@wrout{\arabic {NAT@ctr}}{#2}{#1}{}{#4}\fi}
\newcommand\citeauthoryear{}
\def\citeauthoryear#1#2#3(@)(@)\@nil#4{\stepcounter{NAT@ctr}\if\relax#3\relax
\NAT@wrout{\arabic {NAT@ctr}}{#2}{#1}{}{#4}\else
\NAT@wrout{\arabic {NAT@ctr}}{#3}{#2}{#1}{#4}\fi}
\newcommand\citestarts{\NAT@open}
\newcommand\citeends{\NAT@close}
\newcommand\betweenauthors{and}
\newcommand\astroncite{}
\def\astroncite#1#2(@)(@)\@nil#3{\stepcounter{NAT@ctr}\NAT@wrout{\arabic
{NAT@ctr}}{#2}{#1}{}{#3}}
\newcommand\citename{}
\def\citename#1#2(@)(@)\@nil#3{\expandafter\NAT@apalk#1#2, \@nil{#3}}
\newcommand\harvarditem[4][]%
{\if\relax#1\relax\bibitem[#2(#3)]{#4}\else
\bibitem[#1(#3)#2]{#4}\fi }
\newcommand\harvardleft{\NAT@open}
\newcommand\harvardright{\NAT@close}
\newcommand\harvardyearleft{\NAT@open}
\newcommand\harvardyearright{\NAT@close}
\AtBeginDocument{\providecommand{\harvardand}{and}}
\newcommand\harvardurl[1]{\textbf{URL:} \textit{#1}}
\providecommand\bibsection{}
\@ifundefined{chapter}%
{\renewcommand\bibsection{\section*{\refname
\@mkboth{\MakeUppercase{\refname}}{\MakeUppercase{\refname}}}}}
{\@ifundefined{NAT@sectionbib}%
{\renewcommand\bibsection{\chapter*{\bibname
\@mkboth{\MakeUppercase{\bibname}}{\MakeUppercase{\bibname}}}}}
{\renewcommand\bibsection{\section*{\bibname
\ifx\@mkboth\@gobbletwo\else\markright{\MakeUppercase{\bibname}}\fi}}}}
\@ifclassloaded{amsart}%
{\renewcommand\bibsection{\section*{\refname}}}{}
\@ifclassloaded{amsbook}%
{\renewcommand\bibsection{\chapter*{\bibname}}}{}
\@ifundefined{bib@heading}{}{\let\bibsection\bib@heading}
\newcounter{NAT@ctr}
\renewenvironment{thebibliography}[1]{%
\bibsection
\vspace{1\p@}\parindent \z@\bibpreamble\bibfont\list
{\@biblabel{\arabic{NAT@ctr}}}{\@bibsetup{#1}%
\setcounter{NAT@ctr}{0}}%
\ifNAT@openbib
\renewcommand\newblock{\par}
\else
\renewcommand\newblock{\hskip .11em \@plus.33em \@minus.07em}%
\fi
\sloppy\clubpenalty4000\widowpenalty4000
\sfcode`\.=1000\relax
\let\citeN\cite \let\shortcite\cite
\let\citeasnoun\cite\fontsize{7}{9}\selectfont
}{\def\@noitemerr{%
\PackageWarning{natbib}
{Empty `thebibliography' environment}}%
\endlist\vskip-\lastskip}
\let\bibfont\relax
\let\bibpreamble\relax
\providecommand\reset@font{\relax}
\providecommand\bibname{Bibliography}
\providecommand\refname{References}
\newcommand\NAT@citeundefined{\gdef \NAT@undefined {%
\PackageWarningNoLine{natbib}{There were undefined citations}}}
\let \NAT@undefined \relax
\newcommand\NAT@citemultiple{\gdef \NAT@multiple {%
\PackageWarningNoLine{natbib}{There were multiply defined citations}}}
\let \NAT@multiple \relax
\AtEndDocument{\NAT@undefined\NAT@multiple}
\providecommand\@mkboth[2]{}
\providecommand\MakeUppercase{\uppercase}
\providecommand{\@extra@b@citeb}{}
\gdef\@extra@binfo{}
\providecommand\hyper@natanchorstart[1]{}
\providecommand\hyper@natanchorend{}
\providecommand\hyper@natlinkstart[1]{}
\providecommand\hyper@natlinkend{}
\providecommand\hyper@natlinkbreak[2]{#1}
\@ifundefined{bbl@redefine}{}{%
\bbl@redefine\nocite#1{%
\@safe@activestrue\org@nocite{#1}\@safe@activesfalse}%
\bbl@redefine\@lbibitem[#1]#2{%
\@safe@activestrue\org@@lbibitem[#1]{#2}\@safe@activesfalse}%
}
\AtBeginDocument{\@ifundefined{bbl@redefine}{}{%
\bbl@redefine\@citex[#1][#2]#3{%
\@safe@activestrue\org@@citex[#1][#2]{#3}\@safe@activesfalse}%
\bbl@redefine\NAT@testdef#1#2{%
\@safe@activestrue\org@NAT@testdef{#1}{#2}\@safe@activesfalse}%
\@ifundefined{org@@lbibitem}{%
\bbl@redefine\@lbibitem[#1]#2{%
\@safe@activestrue\org@@lbibitem[#1]{#2}\@safe@activesfalse}}{}%
}}
\ifnum\NAT@sort>0
\newcommand\NAT@sort@cites[1]{%
\@tempcntb\m@ne
\let\@celt\delimiter
\def\NAT@num@list{}%
\def\NAT@cite@list{}%
\def\NAT@nonsort@list{}%
\@for \@citeb:=#1\do{\NAT@make@cite@list}%
\edef\NAT@cite@list{\NAT@cite@list\NAT@nonsort@list}%
\edef\NAT@cite@list{\expandafter\NAT@xcom\NAT@cite@list @@}}
\begingroup \catcode`\_=8
\gdef\NAT@make@cite@list{%
\edef\@citeb{\expandafter\@firstofone\@citeb}%
\@ifundefined{b@\@citeb\@extra@b@citeb}{\def\NAT@num{A}}%
{\NAT@parse{\@citeb}}%
\ifcat _\ifnum\z@<0\NAT@num _\else A\fi
\@tempcnta\NAT@num \relax
\ifnum \@tempcnta>\@tempcntb
\edef\NAT@num@list{\NAT@num@list \@celt{\NAT@num}}%
\edef\NAT@cite@list{\NAT@cite@list\@citeb,}%
\@tempcntb\@tempcnta
\else
\let\NAT@@cite@list=\NAT@cite@list \def\NAT@cite@list{}%
\edef\NAT@num@list{\expandafter\NAT@num@celt \NAT@num@list \@gobble @}%
{\let\@celt=\NAT@celt\NAT@num@list}%
\fi
\else
\edef\NAT@nonsort@list{\NAT@nonsort@list\@citeb,}%
\fi}
\endgroup
\def\NAT@celt#1{\ifnum #1<\@tempcnta
\xdef\NAT@cite@list{\NAT@cite@list\expandafter\NAT@nextc\NAT@@cite@list @@}%
\xdef\NAT@@cite@list{\expandafter\NAT@restc\NAT@@cite@list}%
\else
\xdef\NAT@cite@list{\NAT@cite@list\@citeb,\NAT@@cite@list}\let\@celt\@gobble%
\fi}
\def\NAT@num@celt#1#2{\ifx \@celt #1%
\ifnum #2<\@tempcnta
\@celt{#2}%
\expandafter\expandafter\expandafter\NAT@num@celt
\else
\@celt{\number\@tempcnta}\@celt{#2}%
\fi\fi}
\def\NAT@nextc#1,#2@@{#1,}
\def\NAT@restc#1,#2{#2}
\def\NAT@xcom#1,@@{#1}
\else
\newcommand\NAT@sort@cites[1]{\edef\NAT@cite@list{#1}}\fi
\InputIfFileExists{natbib.cfg}
{\typeout{Local config file natbib.cfg used}}{}
%%
%% <<<<< End of generated file <<<<<<
%%
%% End of file `natbib.sty'.
+38
View File
@@ -0,0 +1,38 @@
Q 60 23616 0 0.000000000
Q 45 3520 1 0.000036851
Q 41 1840 1 0.000069023
Q 37 328 2 0.000136500
Q 36 276 1 0.000169033
Q 35 480 1 0.000199601
Q 33 375 2 0.000262855
Q 31 178 2 0.000326659
Q 30 153 5 0.000487551
Q 29 200 1 0.000516696
Q 27 100 3 0.000611601
Q 26 93 3 0.000706056
Q 25 75 2 0.000768393
Q 24 82 1 0.000798314
Q 23 80 6 0.000987387
Q 22 71 6 0.001175835
Q 21 76 7 0.001394921
Q 20 63 9 0.001676897
Q 19 55 4 0.001800322
Q 18 62 8 0.002048987
Q 17 55 7 0.002265718
Q 16 60 10 0.002575539
Q 15 82 9 0.002850877
Q 14 67 7 0.003063745
Q 13 62 11 0.003401042
Q 12 64 13 0.003799084
Q 11 56 5 0.003947900
Q 10 58 17 0.004468303
Q 9 70 22 0.005139796
Q 8 23 9 0.005414604
Q 7 41 17 0.005933068
Q 6 42 18 0.006480881
Q 5 33 9 0.006751757
Q 4 29 9 0.007022948
Q 3 27 15 0.007478764
Q 2 23 10 0.007781024
Q 1 9 2 0.007840364
Q 0 13 8 0.008083105
+52
View File
@@ -0,0 +1,52 @@
set t po eps enh co so "Helvetica,26"
set style line 1 lt 1 pt 1 lc rgb "#e41a1c" lw 2;
set style line 2 lt 1 pt 2 lc rgb "#377eb8" lw 2;
set style line 3 lt 1 pt 3 lc rgb "#4daf4a" lw 2;
set style line 4 lt 1 pt 4 lc rgb "#984ea3" lw 2;
set style line 5 lt 1 pt 6 lc rgb "#ff7f00" lw 2;
set style line 6 lt 1 pt 8 lc rgb "#f781bf" lw 2;
set out "roc-color.eps"
set pointsize 2.0
set size 1.59,1.04
set multiplot layout 1,2
set label "(a)" at graph -0.245,1.06 font "Helvetica-bold,40"
set xlab "Error rate of mapped reads"
set ylab "Fraction of mapped reads" off +1.8
set ytics 0.02
set yran [0.9:1]
set size 0.8,1
set log x
set format x "10^{%L}"
set key bot right
plot "<./eval2roc.pl blasr-mc.eval" u 2:3 t "blasr-mc" w lp ls 4, \
"<./eval2roc.pl bwa.eval" u 2:3 t "bwa-mem" w lp ls 2, \
"<./eval2roc.pl graphmap.eval" u 2:3 t "graphmap" w lp ls 3, \
"<./eval2roc.pl minialign.eval" u 2:3 t "minialign" w lp ls 1, \
"<./eval2roc.pl mm2.eval" u 2:3 t "minimap2" w lp ls 6, \
"<./eval2roc.pl ngmlr.eval" u 2:3 t "ngm-lr" w lp ls 5
unset label
set origin 0.8,0
set size 0.79,1
set label "(b)" at graph -0.245,1.06 font "Helvetica-bold,40"
unset log
unset format
unset key
set log y
set ylab "Accumulative mapping error rate" off +0
set xlab "Mapping quality"
set yran [1e-5:0.1]
set ytics 1e-5,0.1
set format y "10^{%L}"
set xran [60:0] reverse
plot "<./eval2roc.pl blasr-mc.eval" u 1:2 w lp ls 4, \
"<./eval2roc.pl bwa.eval" u 1:2 t "bwa-mem" w lp ls 2, \
"<./eval2roc.pl graphmap.eval" u 1:2 t "graphmap" w lp ls 3, \
"<./eval2roc.pl minialign.eval" u 1:2 t "minialign" w lp ls 1, \
"<./eval2roc.pl mm2.eval" u 1:2 t "minimap2" w lp ls 6, \
"<./eval2roc.pl ngmlr.eval" u 1:2 t "ngm-lr" w lp ls 5