mirror of
https://github.com/lh3/minimap2.git
synced 2026-09-28 13:38:11 +08:00
Compare commits
| Author | SHA1 | Date | |
|---|---|---|---|
|
|
eecc06086f | ||
|
|
dfea113f28 | ||
|
|
1842d7f5b5 | ||
|
|
f5cfd439ee | ||
|
|
248b43cc47 | ||
|
|
bf72969ab1 | ||
|
|
7b5a601d48 | ||
|
|
405d531100 | ||
|
|
e9607fcd9b | ||
|
|
a465a920ec | ||
|
|
b20839be77 | ||
|
|
209beb9955 | ||
|
|
cfe87f50c1 | ||
|
|
680b971bb0 | ||
|
|
6b0d3c1fa8 | ||
|
|
dc9e3dcf4a | ||
|
|
cc75c12905 | ||
|
|
f159e1c2d3 | ||
|
|
3a375d3436 | ||
|
|
626f10e0d0 | ||
|
|
b997578078 | ||
|
|
ce8a48d715 | ||
|
|
99879e9e75 | ||
|
|
c969d1a1ce | ||
|
|
fcac296c4a | ||
|
|
e420b17496 | ||
|
|
23a846c594 | ||
|
|
8995e2e078 | ||
|
|
ab345e600b | ||
|
|
d003a00d71 | ||
|
|
ae85dcde76 | ||
|
|
eb819c29e8 | ||
|
|
fb630de40a | ||
|
|
43960a8ca7 | ||
|
|
f6608fe99c | ||
|
|
98a6e52c06 | ||
|
|
824712a4ee | ||
|
|
0e42628ef6 | ||
|
|
98a999fe44 | ||
|
|
fec7bd713f | ||
|
|
2f693e8ca4 | ||
|
|
704ff9f4c6 | ||
|
|
68c63f2d68 | ||
|
|
76206f574f | ||
|
|
e575f884e1 | ||
|
|
571161d5a2 | ||
|
|
07d41efc2b | ||
|
|
984f7846c0 | ||
|
|
af1d6afba9 | ||
|
|
cbdb6c069f | ||
|
|
35b6d9f7d5 | ||
|
|
39a9666246 | ||
|
|
662d05dc02 | ||
|
|
379457c18b | ||
|
|
03169d590b | ||
|
|
8c8d446820 | ||
|
|
0ddb064f17 | ||
|
|
131cfc6938 | ||
|
|
2f463b1db0 | ||
|
|
3b518271ee | ||
|
|
481d8239e9 | ||
|
|
4f77b0c1ed | ||
|
|
d7a31e40e6 | ||
|
|
dd18cd75de | ||
|
|
99a2709913 | ||
|
|
032068a747 | ||
|
|
1cb0bf4bef | ||
|
|
422b43374e | ||
|
|
29a26e3eea | ||
|
|
a7b38f6900 | ||
|
|
e896c9ec05 | ||
|
|
98ba8928c6 | ||
|
|
bcf8462d20 | ||
|
|
c047c852ce | ||
|
|
b24d68ae9f | ||
|
|
65deedfa96 | ||
|
|
21a46ba652 | ||
|
|
1617b87ee1 | ||
|
|
2191ac58ad | ||
|
|
fa5a645ca5 | ||
|
|
c2b09356b8 | ||
|
|
a3f0aa1d5b | ||
|
|
52ffbc9e0c | ||
|
|
a9790c0f1d | ||
|
|
d0ac78ac08 | ||
|
|
22290db3e4 | ||
|
|
cd24dc8834 | ||
|
|
b8e758df0f | ||
|
|
311fa90030 | ||
|
|
fb8a1b5536 | ||
|
|
7f11f4c4d4 | ||
|
|
285eb0da05 | ||
|
|
192217a10c | ||
|
|
f22a94e868 | ||
|
|
79b0caca95 | ||
|
|
afc2f2e84b | ||
|
|
e6f66f2f3b | ||
|
|
70735098e2 | ||
|
|
d4b5dfc297 | ||
|
|
5acd709524 | ||
|
|
306e4541f8 | ||
|
|
1dd221ad82 | ||
|
|
c6b6392b70 | ||
|
|
dc37aee881 | ||
|
|
37e627aa98 | ||
|
|
beeb806829 | ||
|
|
be7f3c4ffe | ||
|
|
bd04372873 | ||
|
|
15ed0712c2 | ||
|
|
55dcbefe87 | ||
|
|
8abba332ad | ||
|
|
4683da2455 | ||
|
|
ffd953029f | ||
|
|
04cf4ebf5e | ||
|
|
25ffd72690 | ||
|
|
aa2d9d4e1b | ||
|
|
addb61bcb2 | ||
|
|
b24c9c90c7 | ||
|
|
adf6cd7f52 | ||
|
|
e6f525edaf | ||
|
|
858213d513 | ||
|
|
dea3b60918 | ||
|
|
7c555f9b7e | ||
|
|
2801ed9b4b | ||
|
|
27025c70a7 | ||
|
|
9bafbe4e70 | ||
|
|
ce06188203 | ||
|
|
9862a75cd3 | ||
|
|
3073f4a758 | ||
|
|
ba6ddda6b0 | ||
|
|
9364bc64d7 | ||
|
|
5498565157 | ||
|
|
65abdb8f3c | ||
|
|
7345621759 | ||
|
|
ca632f907b | ||
|
|
6c78a980b6 | ||
|
|
c217eecdb7 | ||
|
|
13b66aad4d | ||
|
|
46fa520db9 | ||
|
|
1e53610fb4 | ||
|
|
9396d9e11b | ||
|
|
198849a716 | ||
|
|
9fea4d16b3 | ||
|
|
f9415628a8 | ||
|
|
61e56c941d | ||
|
|
f150257a0d | ||
|
|
bf2d4f7aec | ||
|
|
47b86e765b | ||
|
|
56acf6ee28 | ||
|
|
4f6244bd4a | ||
|
|
c6384ed2c8 | ||
|
|
2833a9c255 | ||
|
|
de2fcc1bf3 | ||
|
|
e0baf1ad54 | ||
|
|
f266092699 | ||
|
|
9c5767f9ed | ||
|
|
ae2adf04d4 | ||
|
|
b839758335 | ||
|
|
f4a5d3a692 | ||
|
|
3ff6eda3a4 | ||
|
|
1a90bc8603 | ||
|
|
abf2a90363 | ||
|
|
5ab99eb26e | ||
|
|
7cc4f6f965 | ||
|
|
16e6e589a8 | ||
|
|
9aba11769c | ||
|
|
7d50e646dd | ||
|
|
1554149158 | ||
|
|
19c39e704f | ||
|
|
2581c44a21 | ||
|
|
5babf41a38 | ||
|
|
2a1e738a94 | ||
|
|
cf55c84056 | ||
|
|
841763ec24 | ||
|
|
95eb1dec36 | ||
|
|
0fd0f2aed1 | ||
|
|
ee9b2773a8 | ||
|
|
340483821e | ||
|
|
04fb2c2ec0 | ||
|
|
0d4ecd19ee | ||
|
|
0c63325985 | ||
|
|
2a554a92e9 | ||
|
|
935a6e6064 | ||
|
|
a13691d00d | ||
|
|
8301222174 | ||
|
|
9541052564 | ||
|
|
7e0d70bfd3 | ||
|
|
a349d85280 | ||
|
|
f611edf6f2 | ||
|
|
1b1dd0cd57 | ||
|
|
92ec8bd859 | ||
|
|
55d1e4f638 | ||
|
|
64c0ad6b35 | ||
|
|
9538c985aa | ||
|
|
8f25cfa36e | ||
|
|
81008dd371 | ||
|
|
3bb66e1ed3 | ||
|
|
a742f10164 | ||
|
|
f0951141a1 | ||
|
|
84bbc47152 | ||
|
|
5400191097 | ||
|
|
ef84e8b4e7 | ||
|
|
1c948e0d1d | ||
|
|
997011458c | ||
|
|
19d8eca3a1 | ||
|
|
9943e5fdd0 | ||
|
|
5b39a1b34b | ||
|
|
e3b5802b2e | ||
|
|
03d6894517 | ||
|
|
645db3350e | ||
|
|
75e6bbc9f6 | ||
|
|
7a9b4db874 | ||
|
|
4979e66ff0 | ||
|
|
a686461e83 | ||
|
|
fd14618e61 | ||
|
|
5caadc28b4 | ||
|
|
56014ba3db | ||
|
|
b99c22840f | ||
|
|
c04420698e | ||
|
|
fb1bcc0084 | ||
|
|
11081c6c27 | ||
|
|
60485790b4 | ||
|
|
ea5a0cd17d | ||
|
|
ffff953e2c | ||
|
|
48705e9bfa | ||
|
|
cf93e5c0a1 | ||
|
|
0b660c70e2 | ||
|
|
5715c423ff | ||
|
|
c8a019fae8 | ||
|
|
e9c57f6d8b | ||
|
|
3edf2a9130 | ||
|
|
89151b2588 | ||
|
|
cc0a538bd3 | ||
|
|
e9e86f5a48 | ||
|
|
c0779f0359 | ||
|
|
875ea06302 | ||
|
|
2c7007a11b | ||
|
|
fc87b767ba | ||
|
|
dba8b50ee9 | ||
|
|
d5012a1b17 | ||
|
|
eaaf53c9b8 | ||
|
|
ef46a8aed4 | ||
|
|
28fd3d63fd | ||
|
|
06b79c4a52 | ||
|
|
8cdaae0935 | ||
|
|
38aa9aa9a7 | ||
|
|
f8cb865ec5 | ||
|
|
1d90742b35 | ||
|
|
5103cea7d3 | ||
|
|
7da9a08a6f | ||
|
|
ddc2c6f279 | ||
|
|
7e98b18ba2 | ||
|
|
3544c60c71 | ||
|
|
6b66ec6167 | ||
|
|
cb7fb77bb9 | ||
|
|
322e5a16e5 | ||
|
|
10bd4079d1 | ||
|
|
b22703a354 | ||
|
|
7e34bea7ab | ||
|
|
c07f9f9a49 | ||
|
|
446bde214d | ||
|
|
5966e5d6e4 | ||
|
|
14b853499f | ||
|
|
75ff7ceec5 | ||
|
|
e2823d4aee | ||
|
|
eb00521d9b | ||
|
|
0f7455cefa | ||
|
|
4d3768bf26 | ||
|
|
47e9d76ca1 | ||
|
|
f4a8766283 | ||
|
|
6a82a21dee | ||
|
|
3c91d652dd | ||
|
|
1b44275802 | ||
|
|
2f2b11624a | ||
|
|
cb57bd6146 | ||
|
|
885db1233d | ||
|
|
2bf2f137dd | ||
|
|
8706f6bdf8 | ||
|
|
2028e8c266 | ||
|
|
0cc8d277ba | ||
|
|
14f0cce4e2 | ||
|
|
8ddbf7169f | ||
|
|
d7f2ac1d4f | ||
|
|
eea9e851d8 | ||
|
|
c7c3585531 | ||
|
|
87a278d06a | ||
|
|
59c822b722 | ||
|
|
f422175e4e | ||
|
|
709b6ec1f1 | ||
|
|
0031158936 | ||
|
|
ef3f7ea2f2 | ||
|
|
8b9f2aaf04 | ||
|
|
46e8b6a4f9 | ||
|
|
3c997ca016 | ||
|
|
f9ccc522cd | ||
|
|
101b8bb97d | ||
|
|
f4a71d447f | ||
|
|
6db9b7579c | ||
|
|
f50b9a14a7 | ||
|
|
33423e1568 | ||
|
|
aeb6b5eeb1 | ||
|
|
3d3fde8224 | ||
|
|
6f4cbf4f12 | ||
|
|
2a5d5b6f12 | ||
|
|
3d48516885 | ||
|
|
00416c76d1 | ||
|
|
2b8681ead7 | ||
|
|
0a3ebdc916 | ||
|
|
b97620afed | ||
|
|
743d26eab0 | ||
|
|
62535ecd7f | ||
|
|
40665d1083 | ||
|
|
4db1c0295c | ||
|
|
d4074874ee | ||
|
|
eccdb3a1ca | ||
|
|
a3c3db6b9b | ||
|
|
c4080aaf7e | ||
|
|
2641613686 | ||
|
|
5f96d851a8 | ||
|
|
bf8246f872 | ||
|
|
5cbd776651 | ||
|
|
0fe1a224ab | ||
|
|
240f6caaff | ||
|
|
b8bdac7e64 | ||
|
|
19e4b2aab0 | ||
|
|
ce859dbe1c | ||
|
|
a4c41f64a5 | ||
|
|
5ed2faf270 | ||
|
|
8058c85b72 | ||
|
|
993a2bb521 | ||
|
|
64c1389e1a | ||
|
|
81cff97208 | ||
|
|
bbb37d95f2 | ||
|
|
2cde8d257c | ||
|
|
b5f5929bf9 | ||
|
|
28f86688ab | ||
|
|
43506edbc5 | ||
|
|
bcfe00d2ad | ||
|
|
17c19e5819 | ||
|
|
61eef0575c | ||
|
|
53b3265d84 | ||
|
|
a23df2dc91 | ||
|
|
5a74088b74 | ||
|
|
d240318741 | ||
|
|
0f4c823b0c | ||
|
|
2d11aaa830 | ||
|
|
30b8cb4672 | ||
|
|
0c1760bc86 | ||
|
|
a99358bc3d | ||
|
|
163fa36ee6 | ||
|
|
c59b0781bc | ||
|
|
7429b12164 | ||
|
|
9e1125edda | ||
|
|
4db0d1034b | ||
|
|
3dbe23b34e | ||
|
|
6840370f3c | ||
|
|
7f9f659b6a | ||
|
|
1a7d782131 | ||
|
|
4badf2fcbf | ||
|
|
079ec0d283 | ||
|
|
0137d0dfab | ||
|
|
5b10667967 | ||
|
|
bd1541dce1 | ||
|
|
1597f2b030 | ||
|
|
ce927d2aee | ||
|
|
8c2917b391 | ||
|
|
9fcf8b6315 | ||
|
|
3217178d4a | ||
|
|
b40598fa91 | ||
|
|
269b8661b9 | ||
|
|
890d7bbd5b | ||
|
|
1aca0d5098 | ||
|
|
68d99f0edb | ||
|
|
fd66ab5413 | ||
|
|
71f82759af | ||
|
|
648cdd8a3b | ||
|
|
7e231cfd3a | ||
|
|
95d3c30ae3 | ||
|
|
f57fd8c790 | ||
|
|
c70b20ee6d | ||
|
|
e8d00a8c8c | ||
|
|
ed4efd77bc | ||
|
|
295874ea30 | ||
|
|
9ec5f51afb | ||
|
|
28ab4d1f72 | ||
|
|
6c9390b54a | ||
|
|
9306299e4d | ||
|
|
0c563e1868 | ||
|
|
8b1e36c609 | ||
|
|
d933a263d7 | ||
|
|
7542b4b40a | ||
|
|
d6181de844 | ||
|
|
12cea727b8 | ||
|
|
cd105b47f2 | ||
|
|
35f232c3fa | ||
|
|
4c0713ee14 | ||
|
|
46de0fbdad | ||
|
|
9e09c1ae72 | ||
|
|
d8d4d29b68 | ||
|
|
e51dfd0330 | ||
|
|
1f78e1ee53 | ||
|
|
5934d68772 | ||
|
|
fa99d28d34 | ||
|
|
d08b7a0c51 | ||
|
|
da3db3c095 | ||
|
|
783ead6f47 | ||
|
|
19d6ec885e | ||
|
|
120bebc290 | ||
|
|
5e3eecd6d4 | ||
|
|
2179e9e24b | ||
|
|
84922cfe41 | ||
|
|
ebbe9c1eb8 | ||
|
|
c672690564 | ||
|
|
f4fee60188 | ||
|
|
254280b8af | ||
|
|
fc965805f7 | ||
|
|
667b32a516 | ||
|
|
2c79580649 | ||
|
|
b927838495 | ||
|
|
371e20cc7c | ||
|
|
8b08a2ec41 | ||
|
|
9f728dd96a | ||
|
|
323293fbda | ||
|
|
bd33bed455 | ||
|
|
a01d758af6 | ||
|
|
e9dc1ce2b6 | ||
|
|
a8ad53ee81 | ||
|
|
00c6db5073 | ||
|
|
f2ef48878a | ||
|
|
21ca564112 | ||
|
|
215e92ed7b | ||
|
|
b530ade333 | ||
|
|
4bd7ebc39c | ||
|
|
f81f37fef1 |
@@ -1,4 +1,8 @@
|
|||||||
|
.cproject
|
||||||
|
.project
|
||||||
.*.swp
|
.*.swp
|
||||||
*.a
|
*.a
|
||||||
*.o
|
*.o
|
||||||
*.dSYM
|
*.dSYM
|
||||||
|
minimap2
|
||||||
|
mappy.c
|
||||||
|
|||||||
+20
@@ -0,0 +1,20 @@
|
|||||||
|
matrix:
|
||||||
|
include:
|
||||||
|
- language: c
|
||||||
|
compiler: gcc
|
||||||
|
script: make
|
||||||
|
- language: c
|
||||||
|
compiler: clang
|
||||||
|
script: make
|
||||||
|
- language: python
|
||||||
|
python: "2.7"
|
||||||
|
before_install: pip install cython
|
||||||
|
script: python setup.py build_ext
|
||||||
|
- language: python
|
||||||
|
python: "3.5"
|
||||||
|
before_install: pip install cython
|
||||||
|
script: python setup.py build_ext
|
||||||
|
- language: python
|
||||||
|
python: "3.6"
|
||||||
|
before_install: pip install cython
|
||||||
|
script: python setup.py build_ext
|
||||||
+11
@@ -0,0 +1,11 @@
|
|||||||
|
include *.h
|
||||||
|
include Makefile
|
||||||
|
include ksw2_dispatch.c
|
||||||
|
include getopt.c
|
||||||
|
include main.c
|
||||||
|
include README.md
|
||||||
|
include python/mappy.c
|
||||||
|
include python/cmappy.h
|
||||||
|
include python/cmappy.pxd
|
||||||
|
include python/mappy.pyx
|
||||||
|
include python/README.rst
|
||||||
@@ -1,17 +1,24 @@
|
|||||||
CC= gcc
|
|
||||||
CFLAGS= -g -Wall -O2 -Wc++-compat
|
CFLAGS= -g -Wall -O2 -Wc++-compat
|
||||||
CPPFLAGS= -DHAVE_KALLOC
|
CPPFLAGS= -DHAVE_KALLOC
|
||||||
INCLUDES= -I.
|
INCLUDES=
|
||||||
OBJS= kthread.o kalloc.o ksw2_extz2_sse.o ksw2_extd2_sse.o misc.o bseq.o \
|
OBJS= kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o index.o chain.o align.o hit.o map.o format.o pe.o esterr.o ksw2_ll_sse.o
|
||||||
sketch.o sdust.o index.o chain.o align.o hit.o map.o format.o
|
|
||||||
PROG= minimap2
|
PROG= minimap2
|
||||||
PROG_EXTRA= sdust minimap2-lite
|
PROG_EXTRA= sdust minimap2-lite
|
||||||
LIBS= -lm -lz -lpthread
|
LIBS= -lm -lz -lpthread
|
||||||
|
|
||||||
|
ifeq ($(arm_neon),)
|
||||||
ifeq ($(sse2only),)
|
ifeq ($(sse2only),)
|
||||||
CFLAGS+=-msse4
|
OBJS+=ksw2_extz2_sse41.o ksw2_extd2_sse41.o ksw2_exts2_sse41.o ksw2_extz2_sse2.o ksw2_extd2_sse2.o ksw2_exts2_sse2.o ksw2_dispatch.o
|
||||||
|
else
|
||||||
|
OBJS+=ksw2_extz2_sse.o ksw2_extd2_sse.o ksw2_exts2_sse.o
|
||||||
|
endif
|
||||||
|
else
|
||||||
|
OBJS+=ksw2_extz2_neon.o ksw2_extd2_neon.o ksw2_exts2_neon.o
|
||||||
|
CFLAGS+=-D_FILE_OFFSET_BITS=64 -mfpu=neon -fsigned-char
|
||||||
|
INCLUDES+=-I sse2neon
|
||||||
endif
|
endif
|
||||||
|
|
||||||
|
.PHONY:all extra clean depend
|
||||||
.SUFFIXES:.c .o
|
.SUFFIXES:.c .o
|
||||||
|
|
||||||
.c.o:
|
.c.o:
|
||||||
@@ -21,8 +28,8 @@ all:$(PROG)
|
|||||||
|
|
||||||
extra:all $(PROG_EXTRA)
|
extra:all $(PROG_EXTRA)
|
||||||
|
|
||||||
minimap2:main.o libminimap2.a
|
minimap2:main.o getopt.o libminimap2.a
|
||||||
$(CC) $(CFLAGS) $< -o $@ -L. -lminimap2 $(LIBS)
|
$(CC) $(CFLAGS) main.o getopt.o -o $@ -L. -lminimap2 $(LIBS)
|
||||||
|
|
||||||
minimap2-lite:example.o libminimap2.a
|
minimap2-lite:example.o libminimap2.a
|
||||||
$(CC) $(CFLAGS) $< -o $@ -L. -lminimap2 $(LIBS)
|
$(CC) $(CFLAGS) $< -o $@ -L. -lminimap2 $(LIBS)
|
||||||
@@ -30,11 +37,47 @@ minimap2-lite:example.o libminimap2.a
|
|||||||
libminimap2.a:$(OBJS)
|
libminimap2.a:$(OBJS)
|
||||||
$(AR) -csru $@ $(OBJS)
|
$(AR) -csru $@ $(OBJS)
|
||||||
|
|
||||||
sdust:sdust.c kalloc.o kalloc.h kdq.h kvec.h kseq.h sdust.h
|
sdust:sdust.c getopt.o kalloc.o kalloc.h kdq.h kvec.h kseq.h sdust.h
|
||||||
$(CC) -D_SDUST_MAIN $(CFLAGS) $< kalloc.o -o $@ -lz
|
$(CC) -D_SDUST_MAIN $(CFLAGS) $< getopt.o kalloc.o -o $@ -lz
|
||||||
|
|
||||||
|
# SSE-specific targets on x86/x86_64
|
||||||
|
|
||||||
|
ksw2_extz2_sse41.o:ksw2_extz2_sse.c ksw2.h kalloc.h
|
||||||
|
$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||||
|
|
||||||
|
ksw2_extz2_sse2.o:ksw2_extz2_sse.c ksw2.h kalloc.h
|
||||||
|
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
|
||||||
|
|
||||||
|
ksw2_extd2_sse41.o:ksw2_extd2_sse.c ksw2.h kalloc.h
|
||||||
|
$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||||
|
|
||||||
|
ksw2_extd2_sse2.o:ksw2_extd2_sse.c ksw2.h kalloc.h
|
||||||
|
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
|
||||||
|
|
||||||
|
ksw2_exts2_sse41.o:ksw2_exts2_sse.c ksw2.h kalloc.h
|
||||||
|
$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||||
|
|
||||||
|
ksw2_exts2_sse2.o:ksw2_exts2_sse.c ksw2.h kalloc.h
|
||||||
|
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
|
||||||
|
|
||||||
|
ksw2_dispatch.o:ksw2_dispatch.c ksw2.h
|
||||||
|
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||||
|
|
||||||
|
# NEON-specific targets on ARM
|
||||||
|
|
||||||
|
ksw2_extz2_neon.o:ksw2_extz2_sse.c ksw2.h kalloc.h
|
||||||
|
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_SSE2_ONLY -D__SSE2__ $(INCLUDES) $< -o $@
|
||||||
|
|
||||||
|
ksw2_extd2_neon.o:ksw2_extd2_sse.c ksw2.h kalloc.h
|
||||||
|
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_SSE2_ONLY -D__SSE2__ $(INCLUDES) $< -o $@
|
||||||
|
|
||||||
|
ksw2_exts2_neon.o:ksw2_exts2_sse.c ksw2.h kalloc.h
|
||||||
|
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_SSE2_ONLY -D__SSE2__ $(INCLUDES) $< -o $@
|
||||||
|
|
||||||
|
# other non-file targets
|
||||||
|
|
||||||
clean:
|
clean:
|
||||||
rm -fr gmon.out *.o a.out $(PROG) $(PROG_EXTRA) *~ *.a *.dSYM session*
|
rm -fr gmon.out *.o a.out $(PROG) $(PROG_EXTRA) *~ *.a *.dSYM build dist mappy.so mappy.c python/mappy.c mappy.egg*
|
||||||
|
|
||||||
depend:
|
depend:
|
||||||
(LC_ALL=C; export LC_ALL; makedepend -Y -- $(CFLAGS) $(CPPFLAGS) -- *.c)
|
(LC_ALL=C; export LC_ALL; makedepend -Y -- $(CFLAGS) $(CPPFLAGS) -- *.c)
|
||||||
@@ -42,17 +85,22 @@ depend:
|
|||||||
# DO NOT DELETE
|
# DO NOT DELETE
|
||||||
|
|
||||||
align.o: minimap.h mmpriv.h bseq.h ksw2.h kalloc.h
|
align.o: minimap.h mmpriv.h bseq.h ksw2.h kalloc.h
|
||||||
bseq.o: bseq.h kseq.h
|
bseq.o: bseq.h kvec.h kalloc.h kseq.h
|
||||||
chain.o: minimap.h mmpriv.h bseq.h kalloc.h
|
chain.o: minimap.h mmpriv.h bseq.h kalloc.h
|
||||||
|
esterr.o: mmpriv.h minimap.h bseq.h
|
||||||
example.o: minimap.h kseq.h
|
example.o: minimap.h kseq.h
|
||||||
format.o: mmpriv.h minimap.h bseq.h
|
format.o: kalloc.h mmpriv.h minimap.h bseq.h
|
||||||
hit.o: mmpriv.h minimap.h bseq.h kalloc.h
|
getopt.o: getopt.h
|
||||||
|
hit.o: mmpriv.h minimap.h bseq.h kalloc.h khash.h
|
||||||
index.o: kthread.h bseq.h minimap.h mmpriv.h kvec.h kalloc.h khash.h
|
index.o: kthread.h bseq.h minimap.h mmpriv.h kvec.h kalloc.h khash.h
|
||||||
kalloc.o: kalloc.h
|
kalloc.o: kalloc.h
|
||||||
ksw2_extd2_sse.o: ksw2.h kalloc.h
|
ksw2_extd2_sse.o: ksw2.h kalloc.h
|
||||||
|
ksw2_exts2_sse.o: ksw2.h kalloc.h
|
||||||
ksw2_extz2_sse.o: ksw2.h kalloc.h
|
ksw2_extz2_sse.o: ksw2.h kalloc.h
|
||||||
main.o: bseq.h minimap.h mmpriv.h
|
ksw2_ll_sse.o: ksw2.h kalloc.h
|
||||||
map.o: kthread.h kvec.h kalloc.h sdust.h mmpriv.h minimap.h bseq.h
|
main.o: bseq.h minimap.h mmpriv.h getopt.h
|
||||||
|
map.o: kthread.h kvec.h kalloc.h sdust.h mmpriv.h minimap.h bseq.h khash.h
|
||||||
misc.o: minimap.h ksort.h
|
misc.o: minimap.h ksort.h
|
||||||
|
pe.o: mmpriv.h minimap.h bseq.h kvec.h kalloc.h ksort.h
|
||||||
sdust.o: kalloc.h kdq.h kvec.h sdust.h
|
sdust.o: kalloc.h kdq.h kvec.h sdust.h
|
||||||
sketch.o: kvec.h kalloc.h minimap.h
|
sketch.o: kvec.h kalloc.h minimap.h
|
||||||
|
|||||||
@@ -0,0 +1,276 @@
|
|||||||
|
Release 2.7-r654 (9 January 2018)
|
||||||
|
---------------------------------
|
||||||
|
|
||||||
|
This release fixed a bug in the splice mode and added a few minor features:
|
||||||
|
|
||||||
|
* Fixed a bug that occasionally takes an intron as a long deletion in the
|
||||||
|
splice mode. This was caused by wrong backtracking at the last CIGAR
|
||||||
|
operator. The current fix eliminates the error, but it is not optimal in
|
||||||
|
that it often produces a wrong junction when the last operator is an intron.
|
||||||
|
A future version of minimap2 may improve upon this.
|
||||||
|
|
||||||
|
* Support high-end ARM CPUs that implement the NEON instruction set (#81).
|
||||||
|
This enables minimap2 to work on Raspberry Pi 3 and Odroid XU4.
|
||||||
|
|
||||||
|
* Added a C API to construct a minimizer index from a set of C strings (#80).
|
||||||
|
|
||||||
|
* Check scoring specified on the command line (#79). Due to the 8-bit limit,
|
||||||
|
excessively large score penalties fail minimap2.
|
||||||
|
|
||||||
|
For genomic sequences, minimap2 should give identical alignments to v2.6.
|
||||||
|
|
||||||
|
(2.7: 9 January 2018, r654)
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
|
Release 2.6-r623 (12 December 2017)
|
||||||
|
-----------------------------------
|
||||||
|
|
||||||
|
This release adds several features and fixes two minor bugs:
|
||||||
|
|
||||||
|
* Optionally build an index without sequences. This helps to reduce the
|
||||||
|
peak memory for read overlapping and is automatically applied when
|
||||||
|
base-level alignment is not requested.
|
||||||
|
|
||||||
|
* Approximately estimate per-base sequence divergence (i.e. 1-identity)
|
||||||
|
without performing base-level alignment, using a MashMap-like method. The
|
||||||
|
estimate is written to a new dv:f tag.
|
||||||
|
|
||||||
|
* Reduced the number of tiny terminal exons in RNA-seq alignment. The current
|
||||||
|
setting is conservative. Increase --end-seed-pen to drop more such exons.
|
||||||
|
|
||||||
|
* Reduced the peak memory when aligning long query sequences.
|
||||||
|
|
||||||
|
* Fixed a bug that is caused by HPC minimizers longer than 256bp. This should
|
||||||
|
have no effect in practice, but it is recommended to rebuild HPC indices if
|
||||||
|
possible.
|
||||||
|
|
||||||
|
* Fixed a bug when identifying identical hits (#71). This should only affect
|
||||||
|
artifactual reference consisting of near identical sequences.
|
||||||
|
|
||||||
|
For genomic sequences, minimap2 should give nearly identical alignments to
|
||||||
|
v2.5, except the new dv:f tag.
|
||||||
|
|
||||||
|
(2.6: 12 December 2017, r623)
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
|
Release 2.5-r572 (11 November 2017)
|
||||||
|
-----------------------------------
|
||||||
|
|
||||||
|
This release fixes several bugs and brings a couple of minor improvements:
|
||||||
|
|
||||||
|
* Fixed a severe bug that leads to incorrect mapping coordinates in rare
|
||||||
|
corner cases.
|
||||||
|
|
||||||
|
* Fixed underestimated mapping quality for chimeric alignments when the whole
|
||||||
|
query sequence contain many repetitive minimizers, and for chimeric
|
||||||
|
alignments caused by Z-drop.
|
||||||
|
|
||||||
|
* Fixed two bugs in Python binding: incorrect strand field (#57) and incorrect
|
||||||
|
sequence names for Python3 (#55).
|
||||||
|
|
||||||
|
* Improved mapping accuracy for highly overlapping paired ends.
|
||||||
|
|
||||||
|
* Added option -Y to use soft clipping for supplementary alignments (#56).
|
||||||
|
|
||||||
|
(2.5: 11 November 2017, r572)
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
|
Release 2.4-r555 (6 November 2017)
|
||||||
|
----------------------------------
|
||||||
|
|
||||||
|
As is planned, this release focuses on fine tuning the base algorithm. Notable
|
||||||
|
changes include
|
||||||
|
|
||||||
|
* Changed the mapping quality scale to match the scale of BWA-MEM. This makes
|
||||||
|
minimap2 and BWA-MEM achieve similar sensitivity-specificity balance on real
|
||||||
|
short-read data.
|
||||||
|
|
||||||
|
* Improved the accuracy of splice alignment by modeling one additional base
|
||||||
|
close to the GT-AG signal. This model is used by default with `-x splice`.
|
||||||
|
For SIRV control data, however, it is recommended to add `--splice-flank=no`
|
||||||
|
to disable this feature as the SIRV splice signals are slightly different.
|
||||||
|
|
||||||
|
* Tuned the parameters for Nanopore Direct RNA reads. The recommended command
|
||||||
|
line is `-axsplice -k14 -uf` (#46).
|
||||||
|
|
||||||
|
* Fixed a segmentation fault when aligning PacBio reads (#47 and #48). This
|
||||||
|
bug is very rare but it affects all versions of minimap2. It is also
|
||||||
|
recommended to re-index reference genomes created with `map-pb`. For human,
|
||||||
|
two minimizers in an old index are wrong.
|
||||||
|
|
||||||
|
* Changed option `-L` in sync with the final decision of hts-specs: a fake
|
||||||
|
CIGAR takes the form of `<readLen>S<refLen>N`. Note that `-L` only enables
|
||||||
|
future tools to recognize long CIGARs. It is not possible for older tools to
|
||||||
|
work with such alignments in BAM (#43 and #51).
|
||||||
|
|
||||||
|
* Fixed a tiny issue whereby minimap2 may waste 8 bytes per candidate
|
||||||
|
alignment.
|
||||||
|
|
||||||
|
The minimap2 technical note hosted at arXiv has also been updated to reflect
|
||||||
|
recent changes.
|
||||||
|
|
||||||
|
(2.4: 6 November 2017, r555)
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
|
Release 2.3-r531 (22 October 2017)
|
||||||
|
----------------------------------
|
||||||
|
|
||||||
|
This release come with many improvements and bug fixes:
|
||||||
|
|
||||||
|
* The **sr** preset now supports paired-end short-read alignment. Minimap2 is
|
||||||
|
3-4 times as fast as BWA-MEM, but is slightly less accurate on simulated
|
||||||
|
reads.
|
||||||
|
|
||||||
|
* Meticulous improvements to assembly-to-assembly alignment (special thanks to
|
||||||
|
Alexey Gurevich from the QUAST team): a) apply a small penalty to matches
|
||||||
|
between ambiguous bases; b) reduce missing alignments due to spurious
|
||||||
|
overlaps; c) introduce the short form of the `cs` tag, an improvement to the
|
||||||
|
SAM MD tag.
|
||||||
|
|
||||||
|
* Make sure gaps are always left-aligned.
|
||||||
|
|
||||||
|
* Recognize `U` bases from Oxford Nanopore Direct RNA-seq (#33).
|
||||||
|
|
||||||
|
* Fixed slightly wrong chaining score. Fixed slightly inaccurate coordinates
|
||||||
|
for split alignment.
|
||||||
|
|
||||||
|
* Fixed multiple reported bugs: 1) wrong reference name for inversion
|
||||||
|
alignment (#30); 2) redundant SQ lines when multiple query files are
|
||||||
|
specified (#39); 3) non-functioning option `-K` (#36).
|
||||||
|
|
||||||
|
This release has implemented all the major features I planned five months ago,
|
||||||
|
with the addition of spliced long-read alignment. The next couple of releases
|
||||||
|
will focus on fine tuning of the base algorithms.
|
||||||
|
|
||||||
|
(2.3: 22 October 2017, r531)
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
|
Release 2.2-r409 (17 September 2017)
|
||||||
|
------------------------------------
|
||||||
|
|
||||||
|
This is a feature release. It improves single-end short-read alignment and
|
||||||
|
comes with Python bindings. Detailed changes include:
|
||||||
|
|
||||||
|
* Added the **sr** preset for single-end short-read alignment. In this mode,
|
||||||
|
minimap2 runs faster than BWA-MEM, but is slightly less accurate on
|
||||||
|
simulated data sets. Paired-end alignment is not supported as of now.
|
||||||
|
|
||||||
|
* Improved mapping quality estimate with more accurate identification of
|
||||||
|
repetitive hits. This mainly helps short-read alignment.
|
||||||
|
|
||||||
|
* Implemented **mappy**, a Python binding for minimap2, which is available
|
||||||
|
from PyPI and can be installed with `pip install --user mappy`. Python users
|
||||||
|
can perform read alignment without the minimap2 executable.
|
||||||
|
|
||||||
|
* Restructured the indexing APIs and documented key minimap2 APIs in the
|
||||||
|
header file minimap.h. Updated example.c with the new APIs. Old APIs still
|
||||||
|
work but may become deprecated in future.
|
||||||
|
|
||||||
|
This release may output alignments different from the previous version, though
|
||||||
|
the overall alignment statistics, such as the number of aligned bases and long
|
||||||
|
gaps, remain close.
|
||||||
|
|
||||||
|
(2.2: 17 September 2017, r409)
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
|
Release 2.1.1-r341 (6 September 2017)
|
||||||
|
-------------------------------------
|
||||||
|
|
||||||
|
This is a maintenance release that is expected to output identical alignment to
|
||||||
|
v2.1. Detailed changes include:
|
||||||
|
|
||||||
|
* Support CPU dispatch. By default, minimap2 is compiled with both SSE2 and
|
||||||
|
SSE4 based implementation of alignment and automatically chooses the right
|
||||||
|
one at runtime. This avoids unexpected errors on older CPUs (#21).
|
||||||
|
|
||||||
|
* Improved Windows support as is requested by Oxford Nanopore (#19). Minimap2
|
||||||
|
now avoids variable-length stacked arrays, eliminates alloca(), ships with
|
||||||
|
getopt_long() and provides timing functions implemented with Windows APIs.
|
||||||
|
|
||||||
|
* Fixed a potential segmentation fault when specifying -k/-w/-H with
|
||||||
|
multi-part index (#23).
|
||||||
|
|
||||||
|
* Fixed two memory leaks in example.c
|
||||||
|
|
||||||
|
(2.1.1: 6 September 2017, r341)
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
|
Release 2.1-r311 (25 August 2017)
|
||||||
|
---------------------------------
|
||||||
|
|
||||||
|
This release adds spliced alignment for long noisy RNA-seq reads. On a SMRT
|
||||||
|
Iso-Seq and a Oxford Nanopore data sets, minimap2 appears to outperform
|
||||||
|
traditional mRNA aligners. For DNA alignment, this release gives almost
|
||||||
|
identical output to v2.0. Other changes include:
|
||||||
|
|
||||||
|
* Added option `-R` to set the read group header line in SAM.
|
||||||
|
|
||||||
|
* Optionally output the `cs:Z` tag in PAF to encode both the query and the
|
||||||
|
reference sequences in the alignment.
|
||||||
|
|
||||||
|
* Fixed an issue where DP alignment uses excessive memory.
|
||||||
|
|
||||||
|
The minimap2 technical report has been updated with more details and the
|
||||||
|
evaluation of spliced alignment:
|
||||||
|
|
||||||
|
* Li, H. (2017). Minimap2: fast pairwise alignment for long nucleotide
|
||||||
|
sequences. [arXiv:1708.01492v2](https://arxiv.org/abs/1708.01492v2).
|
||||||
|
|
||||||
|
(2.1: 25 August 2017, r311)
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
|
Release 2.0-r275 (8 August 2017)
|
||||||
|
--------------------------------
|
||||||
|
|
||||||
|
This release is identical to version 2.0rc1, except the version number. It is
|
||||||
|
described and evaluated in the following technical report:
|
||||||
|
|
||||||
|
* Li, H. (2017). Minimap2: fast pairwise alignment for long DNA sequences.
|
||||||
|
[arXiv:1708.01492v1](https://arxiv.org/abs/1708.01492v1).
|
||||||
|
|
||||||
|
(2.0: 8 August 2017, r275)
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
|
Release 2.0rc1-r232 (30 July 2017)
|
||||||
|
----------------------------------
|
||||||
|
|
||||||
|
This release improves the accuracy of long-read alignment and added several
|
||||||
|
minor features.
|
||||||
|
|
||||||
|
* Improved mapping quality estimate for short alignments containing few seed
|
||||||
|
hits.
|
||||||
|
|
||||||
|
* Fixed a minor bug that affects the chaining accuracy towards the ends of a
|
||||||
|
chain. Changed the gap cost for chaining to reduce false seeding.
|
||||||
|
|
||||||
|
* Skip potentially wrong seeding and apply dynamic programming more frequently.
|
||||||
|
This slightly increases run time, but greatly reduces false long gaps.
|
||||||
|
|
||||||
|
* Perform local alignment at Z-drop break point to recover potential inversion
|
||||||
|
alignment. Output the SA tag in the SAM format. Added scripts to evaluate
|
||||||
|
mapping accuracy for reads simulated with pbsim.
|
||||||
|
|
||||||
|
This release completes features intended for v2.0. No major features will be
|
||||||
|
added to the master branch before the final v2.0.
|
||||||
|
|
||||||
|
(2.0rc1: 30 July 2017, r232)
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
|
Release r191 (19 July 2017)
|
||||||
|
---------------------------
|
||||||
|
|
||||||
|
This is the first public release of minimap2, an aligner for long reads and
|
||||||
|
assemblies. This release has a few issues and is generally not recommended for
|
||||||
|
production uses.
|
||||||
|
|
||||||
|
(19 July 2017, r191)
|
||||||
@@ -1,62 +1,367 @@
|
|||||||
## Getting Started
|
[](https://github.com/lh3/minimap2/releases)
|
||||||
|
[](https://anaconda.org/bioconda/minimap2)
|
||||||
|
[](https://pypi.python.org/pypi/mappy)
|
||||||
|
[](https://travis-ci.org/lh3/minimap2)
|
||||||
|
## <a name="started"></a>Getting Started
|
||||||
```sh
|
```sh
|
||||||
git clone https://github.com/lh3/minimap2
|
git clone https://github.com/lh3/minimap2
|
||||||
cd minimap2 && make
|
cd minimap2 && make
|
||||||
# long reads against a reference genome
|
# long sequences against a reference genome
|
||||||
./minimap2 -ax map10k test/MT-human.fa test/MT-orang.fa > test.sam
|
./minimap2 -a test/MT-human.fa test/MT-orang.fa > test.sam
|
||||||
# create an index first and then map
|
# create an index first and then map
|
||||||
./minimap2 -x map10k -d MT-human.mmi test/MT-human.fa
|
./minimap2 -d MT-human.mmi test/MT-human.fa
|
||||||
./minimap2 -ax map10k MT-human.mmi test/MT-orang.fa > test.sam
|
./minimap2 -a MT-human.mmi test/MT-orang.fa > test.sam
|
||||||
# long-read overlap (no test data)
|
# use presets (no test data)
|
||||||
./minimap2 -x ava-pb your-reads.fa your-reads.fa > overlaps.paf
|
./minimap2 -ax map-pb ref.fa pacbio.fq.gz > aln.sam # PacBio genomic reads
|
||||||
# man page
|
./minimap2 -ax map-ont ref.fa ont.fq.gz > aln.sam # Oxford Nanopore genomic reads
|
||||||
|
./minimap2 -ax sr ref.fa read1.fa read2.fa > aln.sam # short genomic paired-end reads
|
||||||
|
./minimap2 -ax splice ref.fa rna-reads.fa > aln.sam # spliced long reads
|
||||||
|
./minimap2 -ax splice -k14 -uf ref.fa reads.fa > aln.sam # Nanopore Direct RNA-seq
|
||||||
|
./minimap2 -cx asm5 asm1.fa asm2.fa > aln.paf # intra-species asm-to-asm alignment
|
||||||
|
./minimap2 -x ava-pb reads.fa reads.fa > overlaps.paf # PacBio read overlap
|
||||||
|
./minimap2 -x ava-ont reads.fa reads.fa > overlaps.paf # Nanopore read overlap
|
||||||
|
# man page for detailed command line options
|
||||||
man ./minimap2.1
|
man ./minimap2.1
|
||||||
```
|
```
|
||||||
|
## Table of Contents
|
||||||
|
|
||||||
## Introduction
|
- [Getting Started](#started)
|
||||||
|
- [Users' Guide](#uguide)
|
||||||
|
- [Installation](#install)
|
||||||
|
- [General usage](#general)
|
||||||
|
- [Use cases](#cases)
|
||||||
|
- [Map long noisy genomic reads](#map-long-genomic)
|
||||||
|
- [Map long mRNA/cDNA reads](#map-long-splice)
|
||||||
|
- [Find overlaps between long reads](#long-overlap)
|
||||||
|
- [Map short accurate genomic reads](#short-genomic)
|
||||||
|
- [Full genome/assembly alignment](#full-genome)
|
||||||
|
- [Advanced features](#advanced)
|
||||||
|
- [Working with >65535 CIGAR operations](#long-cigar)
|
||||||
|
- [The cs optional tag](#cs)
|
||||||
|
- [Evaluation scripts](#eval)
|
||||||
|
- [Algorithm overview](#algo)
|
||||||
|
- [Getting help](#help)
|
||||||
|
- [Citing minimap2](#cite)
|
||||||
|
- [Developers' Guide](#dguide)
|
||||||
|
- [Limitations](#limit)
|
||||||
|
|
||||||
Minimap2 is a fast sequence mapping and alignment program that can find
|
## <a name="uguide"></a>Users' Guide
|
||||||
overlaps between long noisy reads, or map long reads or their assemblies to a
|
|
||||||
reference genome optionally with detailed alignment (i.e. CIGAR). At present,
|
|
||||||
it works efficiently with query sequences from a few kilobases to ~100
|
|
||||||
megabases in length at an error rate ~15%. Minimap2 outputs in the [PAF][paf] or
|
|
||||||
the [SAM format][sam]. On limited test data sets, minimap2 is over 20 times
|
|
||||||
faster than most other long-read aligners. It will replace BWA-MEM for long
|
|
||||||
reads and contig alignment.
|
|
||||||
|
|
||||||
Minimap2 is the successor of [minimap][minimap]. It uses a similar
|
Minimap2 is a versatile sequence alignment program that aligns DNA or mRNA
|
||||||
minimizer-based indexing and seeding algorithm, and improves the original
|
sequences against a large reference database. Typical use cases include: (1)
|
||||||
minimap with homopolyer-compressed k-mers (see also [SMARTdenovo][smartdenovo]
|
mapping PacBio or Oxford Nanopore genomic reads to the human genome; (2)
|
||||||
and [longISLND][longislnd]), better chaining and the ability to produce CIGAR
|
finding overlaps between long reads with error rate up to ~15%; (3)
|
||||||
with fast extension alignment (see also [libgaba][gaba] and [ksw2][ksw2]) and
|
splice-aware alignment of PacBio Iso-Seq or Nanopore cDNA or Direct RNA reads
|
||||||
piece-wise affine gap cost.
|
against a reference genome; (4) aligning Illumina single- or paired-end reads;
|
||||||
|
(5) assembly-to-assembly alignment; (6) full-genome alignment between two
|
||||||
|
closely related species with divergence below ~15%.
|
||||||
|
|
||||||
## Installation
|
For ~10kb noisy reads sequences, minimap2 is tens of times faster than
|
||||||
|
mainstream long-read mappers such as BLASR, BWA-MEM, NGMLR and GMAP. It is more
|
||||||
|
accurate on simulated long reads and produces biologically meaningful alignment
|
||||||
|
ready for downstream analyses. For >100bp Illumina short reads, minimap2 is
|
||||||
|
three times as fast as BWA-MEM and Bowtie2, and as accurate on simulated data.
|
||||||
|
Detailed evaluations are available from the [minimap2 preprint][preprint].
|
||||||
|
|
||||||
For modern x86-64 CPUs, just type `make` in the source code directory. This
|
### <a name="install"></a>Installation
|
||||||
will compile a binary `minimap2` which you can copy to your desired location.
|
|
||||||
If you see compilation errors, try `make sse2only=1` to disable SSE4. Minimap2
|
|
||||||
will run a little slower. At present, minimap2 does not work with non-x86 CPUs
|
|
||||||
or ancient CPUs that do not support SSE2. SSE2 is critical to the performance
|
|
||||||
of minimap2.
|
|
||||||
|
|
||||||
## Limitations
|
Minimap2 is optimized for x86-64 CPUs. You can acquire precompiled binaries from
|
||||||
|
the [release page][release] with:
|
||||||
|
```sh
|
||||||
|
curl -L https://github.com/lh3/minimap2/releases/download/v2.7/minimap2-2.7_x64-linux.tar.bz2 \
|
||||||
|
| tar -jxvf -
|
||||||
|
./minimap2-2.7_x64-linux/minimap2
|
||||||
|
```
|
||||||
|
If you want to compile from the source, you need to have a C compiler, GNU make
|
||||||
|
and zlib development files installed. Then type `make` in the source code
|
||||||
|
directory to compile. If you see compilation errors, try `make sse2only=1`
|
||||||
|
to disable SSE4 code, which will make minimap2 slightly slower.
|
||||||
|
|
||||||
* At the alignment phase, minimap2 performs global alignments between minimizer
|
Minimap2 also works with ARM CPUs supporting the NEON instruction sets. To
|
||||||
hits. If the positions of these minimizer hits are incorrect, the final
|
compile, use `make arm_neon=1`.
|
||||||
alignment may be suboptimal or unnecessarily fragmented.
|
|
||||||
|
|
||||||
* Minimap2 may produce poor alignments that may need post-filtering. We are
|
### <a name="general"></a>General usage
|
||||||
still exploring a reliable and consistent way to report good alignments.
|
|
||||||
|
|
||||||
* Minimap2 does not work well with Illumina short reads as of now.
|
Without any options, minimap2 takes a reference database and a query sequence
|
||||||
|
file as input and produce approximate mapping, without base-level alignment
|
||||||
|
(i.e. no CIGAR), in the [PAF format][paf]:
|
||||||
|
```sh
|
||||||
|
minimap2 ref.fa query.fq > approx-mapping.paf
|
||||||
|
```
|
||||||
|
You can ask minimap2 to generate CIGAR at the `cg` tag of PAF with:
|
||||||
|
```sh
|
||||||
|
minimap2 -c ref.fa query.fq > alignment.paf
|
||||||
|
```
|
||||||
|
or to output alignments in the [SAM format][sam]:
|
||||||
|
```sh
|
||||||
|
minimap2 -a ref.fa query.fq > alignment.sam
|
||||||
|
```
|
||||||
|
Minimap2 seamlessly works with gzip'd FASTA and FASTQ formats as input. You
|
||||||
|
don't need to convert between FASTA and FASTQ or decompress gzip'd files first.
|
||||||
|
|
||||||
* Minimap2 requires SSE2 instructions to compile. It is possible to add
|
For the human reference genome, minimap2 takes a few minutes to generate a
|
||||||
non-SSE2 support, but it would make minimap2 slower by several times.
|
minimizer index for the reference before mapping. To reduce indexing time, you
|
||||||
|
can optionally save the index with option **-d** and replace the reference
|
||||||
|
sequence file with the index file on the minimap2 command line:
|
||||||
|
```sh
|
||||||
|
minimap2 -d ref.mmi ref.fa # indexing
|
||||||
|
minimap2 -a ref.mmi reads.fq > alignment.sam # alignment
|
||||||
|
```
|
||||||
|
***Importantly***, it should be noted that once you build the index, indexing
|
||||||
|
parameters such as **-k**, **-w**, **-H** and **-I** can't be changed during
|
||||||
|
mapping. If you are running minimap2 for different data types, you will
|
||||||
|
probably need to keep multiple indexes generated with different parameters.
|
||||||
|
This makes minimap2 different from BWA which always uses the same index
|
||||||
|
regardless of query data types.
|
||||||
|
|
||||||
In general, minimap2 is a young project with most code written since June,
|
### <a name="cases"></a>Use cases
|
||||||
2017. It may have bugs and room for improvements. Bug reports and suggestions
|
|
||||||
are warmly welcomed.
|
Minimap2 uses the same base algorithm for all applications. However, due to the
|
||||||
|
different data types it supports (e.g. short vs long reads; DNA vs mRNA reads),
|
||||||
|
minimap2 needs to be tuned for optimal performance and accuracy. It is usually
|
||||||
|
recommended to choose a preset with option **-x**, which sets multiple
|
||||||
|
parameters at the same time. The default setting is the same as `map-ont`.
|
||||||
|
|
||||||
|
#### <a name="map-long-genomic"></a>Map long noisy genomic reads
|
||||||
|
|
||||||
|
```sh
|
||||||
|
minimap2 -ax map-pb ref.fa pacbio-reads.fq > aln.sam # for PacBio subreads
|
||||||
|
minimap2 -ax map-ont ref.fa ont-reads.fq > aln.sam # for Oxford Nanopore reads
|
||||||
|
```
|
||||||
|
The difference between `map-pb` and `map-ont` is that `map-pb` uses
|
||||||
|
homopolymer-compressed (HPC) minimizers as seeds, while `map-ont` uses ordinary
|
||||||
|
minimizers as seeds. Emperical evaluation suggests HPC minimizers improve
|
||||||
|
performance and sensitivity when aligning PacBio reads, but hurt when aligning
|
||||||
|
Nanopore reads.
|
||||||
|
|
||||||
|
#### <a name="map-long-splice"></a>Map long mRNA/cDNA reads
|
||||||
|
|
||||||
|
```sh
|
||||||
|
minimap2 -ax splice -uf ref.fa iso-seq.fq > aln.sam # PacBio Iso-seq/traditional cDNA
|
||||||
|
minimap2 -ax splice ref.fa nanopore-cdna.fa > aln.sam # Nanopore 2D cDNA-seq
|
||||||
|
minimap2 -ax splice -uf -k14 ref.fa direct-rna.fq > aln.sam # Nanopore Direct RNA-seq
|
||||||
|
minimap2 -ax splice --splice-flank=no SIRV.fa SIRV-seq.fa # mapping against SIRV control
|
||||||
|
```
|
||||||
|
There are different long-read RNA-seq technologies, including tranditional
|
||||||
|
full-length cDNA, EST, PacBio Iso-seq, Nanopore 2D cDNA-seq and Direct RNA-seq.
|
||||||
|
They produce data of varying quality and properties. By default, `-x splice`
|
||||||
|
assumes the read orientation relative to the transcript strand is unknown. It
|
||||||
|
tries two rounds of alignment to infer the orientation and write the strand to
|
||||||
|
the `ts` SAM/PAF tag if possible. For Iso-seq, Direct RNA-seq and tranditional
|
||||||
|
full-length cDNAs, it would be desired to apply `-u f` to force minimap2 to
|
||||||
|
consider the forward transcript strand only. This speeds up alignment with
|
||||||
|
slight improvement to accuracy. For noisy Nanopore Direct RNA-seq reads, it is
|
||||||
|
recommended to use a smaller k-mer size for increased sensitivity to the first
|
||||||
|
or the last exons.
|
||||||
|
|
||||||
|
Minimap2 rates an alignment by the score of the max-scoring sub-segment,
|
||||||
|
*excluding* introns, and marks the best alignment as primary in SAM. When a
|
||||||
|
spliced gene also has unspliced pseudogenes, minimap2 does not intentionally
|
||||||
|
prefer spliced alignment, though in practice it more often marks the spliced
|
||||||
|
alignment as the primary. By default, minimap2 outputs up to five secondary
|
||||||
|
alignments (i.e. likely pseudogenes in the context of RNA-seq mapping). This
|
||||||
|
can be tuned with option **-N**.
|
||||||
|
|
||||||
|
For long RNA-seq reads, minimap2 may produce chimeric alignments potentially
|
||||||
|
caused by gene fusions/structural variations or by an intron longer than the
|
||||||
|
max intron length **-G** (200k by default). For now, it is not recommended to
|
||||||
|
apply an excessively large **-G** as this slows down minimap2 and sometimes
|
||||||
|
leads to false alignments.
|
||||||
|
|
||||||
|
It is worth noting that by default `-x splice` prefers GT[A/G]..[C/T]AG
|
||||||
|
over GT[C/T]..[A/G]AG, and then over other splicing signals. Considering
|
||||||
|
one additional base improves the junction accuracy for noisy reads, but
|
||||||
|
reduces the accuracy when aligning against the widely used SIRV control data.
|
||||||
|
This is because SIRV does not honor the evolutionarily conservative splicing
|
||||||
|
signal. If you are studying SIRV, you may apply `--splice-flank=no` to let
|
||||||
|
minimap2 only model GT..AG, ignoring the additional base.
|
||||||
|
|
||||||
|
#### <a name="long-overlap"></a>Find overlaps between long reads
|
||||||
|
|
||||||
|
```sh
|
||||||
|
minimap2 -x ava-pb reads.fq reads.fq > ovlp.paf # PacBio read overlap
|
||||||
|
minimap2 -x ava-ont reads.fq reads.fq > ovlp.paf # Oxford Nanopore read overlap
|
||||||
|
```
|
||||||
|
Similarly, `ava-pb` uses HPC minimizers while `ava-ont` uses ordinary
|
||||||
|
minimizers. It is usually not recommended to perform base-level alignment in
|
||||||
|
the overlapping mode because it is slow and may produce false positive
|
||||||
|
overlaps. However, if performance is not a concern, you may try to add `-a` or
|
||||||
|
`-c` anyway.
|
||||||
|
|
||||||
|
#### <a name="short-genomic"></a>Map short accurate genomic reads
|
||||||
|
|
||||||
|
```sh
|
||||||
|
minimap2 -ax sr ref.fa reads-se.fq > aln.sam # single-end alignment
|
||||||
|
minimap2 -ax sr ref.fa read1.fq read2.fq > aln.sam # paired-end alignment
|
||||||
|
minimap2 -ax sr ref.fa reads-interleaved.fq > aln.sam # paired-end alignment
|
||||||
|
```
|
||||||
|
When two read files are specified, minimap2 reads from each file in turn and
|
||||||
|
merge them into an interleaved stream internally. Two reads are considered to
|
||||||
|
be paired if they are adjacent in the input stream and have the same name (with
|
||||||
|
the `/[0-9]` suffix trimmed if present). Single- and paired-end reads can be
|
||||||
|
mixed.
|
||||||
|
|
||||||
|
Minimap2 does not work well with short spliced reads. There are many capable
|
||||||
|
RNA-seq mappers for short reads.
|
||||||
|
|
||||||
|
#### <a name="full-genome"></a>Full genome/assembly alignment
|
||||||
|
|
||||||
|
```sh
|
||||||
|
minimap2 -ax asm5 ref.fa asm.fa > aln.sam # assembly to assembly/ref alignment
|
||||||
|
```
|
||||||
|
For cross-species full-genome alignment, the scoring system needs to be tuned
|
||||||
|
according to the sequence divergence.
|
||||||
|
|
||||||
|
### <a name="advanced"></a>Advanced features
|
||||||
|
|
||||||
|
#### <a name="long-cigar"></a>Working with >65535 CIGAR operations
|
||||||
|
|
||||||
|
Due to a design flaw, BAM does not work with CIGAR strings with >65535
|
||||||
|
operations (SAM and CRAM work). However, for ultra-long nanopore reads minimap2
|
||||||
|
may align ~1% of read bases with long CIGARs beyond the capability of BAM. If
|
||||||
|
you convert such SAM/CRAM to BAM, Picard and recent samtools will throw an
|
||||||
|
error and abort. Older samtools and other tools may create corrupted BAM.
|
||||||
|
|
||||||
|
To avoid this issue, you can add option `-L` at the minimap2 command line.
|
||||||
|
This option moves a long CIGAR to the `CG` tag and leaves a fully clipped CIGAR
|
||||||
|
at the SAM CIGAR column. Current tools that don't read CIGAR (e.g. merging and
|
||||||
|
sorting) still work with such BAM records; tools that read CIGAR will
|
||||||
|
effectively ignore these records. It has been decided that future tools will
|
||||||
|
will seamlessly recognize long-cigar records generated by option `-L`.
|
||||||
|
|
||||||
|
**TD;DR**: if you work with ultra-long reads and use tools that only process
|
||||||
|
BAM files, please add option `-L`.
|
||||||
|
|
||||||
|
#### <a name="cs"></a>The cs optional tag
|
||||||
|
|
||||||
|
The `cs` SAM/PAF tag encodes bases at mismatches and INDELs. It matches regular
|
||||||
|
expression `/(:[0-9]+|\*[a-z][a-z]|[=\+\-][A-Za-z]+)+/`. Like CIGAR, `cs`
|
||||||
|
consists of series of operations. Each leading character specifies the
|
||||||
|
operation; the following sequence is the one involved in the operation.
|
||||||
|
|
||||||
|
The `cs` tag is enabled by command line option `--cs`. The following alignment,
|
||||||
|
for example:
|
||||||
|
```txt
|
||||||
|
CGATCGATAAATAGAGTAG---GAATAGCA
|
||||||
|
|||||| |||||||||| |||| |||
|
||||||
|
CGATCG---AATAGAGTAGGTCGAATtGCA
|
||||||
|
```
|
||||||
|
is represented as `:6-ata:10+gtc:4*at:3`, where `:[0-9]+` represents an
|
||||||
|
identical block, `-ata` represents a deltion, `+gtc` an insertion and `*at`
|
||||||
|
indicates reference base `a` is substituted with a query base `t`. It is
|
||||||
|
similar to the `MD` SAM tag but is standalone and easier to parse.
|
||||||
|
|
||||||
|
If `--cs=long` is used, the `cs` string also contains identical sequences in
|
||||||
|
the alignment. The above example will become
|
||||||
|
`=CGATCG-ata=AATAGAGTAG+gtc=GAAT*at=GCA`. The long form of `cs` encodes both
|
||||||
|
reference and query sequences in one string.
|
||||||
|
|
||||||
|
#### <a name="eval"></a>Evaluation scripts
|
||||||
|
|
||||||
|
Minimap2 comes with several (java)scripts for evaluating the accuracy of
|
||||||
|
minimap2. These scripts require the [k8][k8] javascript shell to run.
|
||||||
|
Recent minimap2 binary release tar-balls contain a copy of k8 executable, a
|
||||||
|
single file. Here are a few examples on how to use these scripts:
|
||||||
|
|
||||||
|
```sh
|
||||||
|
# Generate reads from PBSIM alignment (truth encoded in read names)
|
||||||
|
k8 misc/sim-pbsim.js ref.fa.fai pbsim-aln.maf > pbsim-reads.fq
|
||||||
|
# Generate reads from mason2 alignment (not tested for simulated SVs)
|
||||||
|
k8 misc/sim-mason2.js mason2-aln.sam > mason2-reads.fq
|
||||||
|
# Evaluate mapping accuracy with ROC-like curve
|
||||||
|
k8 misc/sim-eval.js my-aln.sam.gz > result.txt
|
||||||
|
k8 misc/sim-eval.js my-aln.paf.gz > result.txt
|
||||||
|
# Collect alignment statistics
|
||||||
|
k8 misc/mapstat.js my-aln.sam > result.txt
|
||||||
|
# Compare spliced junctions to existing gene annotations
|
||||||
|
k8 misc/intron-eval.js anno.gtf my-spliced-aln.sam > result.txt
|
||||||
|
```
|
||||||
|
|
||||||
|
### <a name="algo"></a>Algorithm overview
|
||||||
|
|
||||||
|
In the following, minimap2 command line options have a dash ahead and are
|
||||||
|
highlighted in bold. The description may help to tune minimap2 parameters.
|
||||||
|
|
||||||
|
1. Read **-I** [=*4G*] reference bases, extract (**-k**,**-w**)-minimizers and
|
||||||
|
index them in a hash table.
|
||||||
|
|
||||||
|
2. Read **-K** [=*200M*] query bases. For each query sequence, do step 3
|
||||||
|
through 7:
|
||||||
|
|
||||||
|
3. For each (**-k**,**-w**)-minimizer on the query, check against the reference
|
||||||
|
index. If a reference minimizer is not among the top **-f** [=*2e-4*] most
|
||||||
|
frequent, collect its the occurrences in the reference, which are called
|
||||||
|
*seeds*.
|
||||||
|
|
||||||
|
4. Sort seeds by position in the reference. Chain them with dynamic
|
||||||
|
programming. Each chain represents a potential mapping. For read
|
||||||
|
overlapping, report all chains and then go to step 8. For reference mapping,
|
||||||
|
do step 5 through 7:
|
||||||
|
|
||||||
|
5. Let *P* be the set of primary mappings, which is an empty set initially. For
|
||||||
|
each chain from the best to the worst according to their chaining scores: if
|
||||||
|
on the query, the chain overlaps with a chain in *P* by **--mask-level**
|
||||||
|
[=*0.5*] or higher fraction of the shorter chain, mark the chain as
|
||||||
|
*secondary* to the chain in *P*; otherwise, add the chain to *P*.
|
||||||
|
|
||||||
|
6. Retain all primary mappings. Also retain up to **-N** [=*5*] top secondary
|
||||||
|
mappings if their chaining scores are higher than **-p** [=*0.8*] of their
|
||||||
|
corresponding primary mappings.
|
||||||
|
|
||||||
|
7. If alignment is requested, filter out an internal seed if it potentially
|
||||||
|
leads to both a long insertion and a long deletion. Extend from the
|
||||||
|
left-most seed. Perform global alignments between internal seeds. Split the
|
||||||
|
chain if the accumulative score along the global alignment drops by **-z**
|
||||||
|
[=*400*], disregarding long gaps. Extend from the right-most seed. Output
|
||||||
|
chains and their alignments.
|
||||||
|
|
||||||
|
8. If there are more query sequences in the input, go to step 2 until no more
|
||||||
|
queries are left.
|
||||||
|
|
||||||
|
9. If there are more reference sequences, reopen the query file from the start
|
||||||
|
and go to step 1; otherwise stop.
|
||||||
|
|
||||||
|
### <a name="help"></a>Getting help
|
||||||
|
|
||||||
|
Manpage [minimap2.1][manpage] provides detailed description of minimap2
|
||||||
|
command line options and optional tags. If you encounter bugs or have further
|
||||||
|
questions or requests, you can raise an issue at the [issue page][issue].
|
||||||
|
There is not a specific mailing list for the time being.
|
||||||
|
|
||||||
|
### <a name="cite"></a>Citing minimap2
|
||||||
|
|
||||||
|
If you use minimap2 in your work, please consider to cite:
|
||||||
|
|
||||||
|
> Li, H. (2017). Minimap2: fast pairwise alignment for long nucleotide sequences. [arXiv:1708.01492][preprint]
|
||||||
|
|
||||||
|
## <a name="dguide"></a>Developers' Guide
|
||||||
|
|
||||||
|
Minimap2 is not only a command line tool, but also a programming library.
|
||||||
|
It provides C APIs to build/load index and to align sequences against the
|
||||||
|
index. File [example.c](example.c) demonstrates typical uses of C APIs. Header
|
||||||
|
file [minimap.h](minimap.h) gives more detailed API documentation. Minimap2
|
||||||
|
aims to keep APIs in this header stable. File [mmpriv.h](mmpriv.h) contains
|
||||||
|
additional private APIs which may be subjected to changes frequently.
|
||||||
|
|
||||||
|
This repository also provides Python bindings to a subset of C APIs. File
|
||||||
|
[python/README.rst](python/README.rst) gives the full documentation;
|
||||||
|
[python/minimap2.py](python/minimap2.py) shows an example. This Python
|
||||||
|
extension, mappy, is also [available from PyPI][mappypypi] via `pip install
|
||||||
|
mappy` or [from BioConda][mappyconda] via `conda install -c bioconda mappy`.
|
||||||
|
|
||||||
|
## <a name="limit"></a>Limitations
|
||||||
|
|
||||||
|
* Minimap2 may produce suboptimal alignments through long low-complexity
|
||||||
|
regions where seed positions may be suboptimal. This should not be a big
|
||||||
|
concern because even the optimal alignment may be wrong in such regions.
|
||||||
|
|
||||||
|
* Minimap2 requires SSE2 instructions on x86 CPUs or NEON on ARM CPUs. It is
|
||||||
|
possible to add non-SIMD support, but it would make minimap2 slower by
|
||||||
|
several times.
|
||||||
|
|
||||||
|
In general, minimap2 is a young project with most code written since June, 2017.
|
||||||
|
It may have bugs and room for improvements. Bug reports and suggestions are
|
||||||
|
warmly welcomed.
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
@@ -67,3 +372,10 @@ are warmly welcomed.
|
|||||||
[longislnd]: https://www.ncbi.nlm.nih.gov/pubmed/27667791
|
[longislnd]: https://www.ncbi.nlm.nih.gov/pubmed/27667791
|
||||||
[gaba]: https://github.com/ocxtal/libgaba
|
[gaba]: https://github.com/ocxtal/libgaba
|
||||||
[ksw2]: https://github.com/lh3/ksw2
|
[ksw2]: https://github.com/lh3/ksw2
|
||||||
|
[preprint]: https://arxiv.org/abs/1708.01492
|
||||||
|
[release]: https://github.com/lh3/minimap2/releases
|
||||||
|
[mappypypi]: https://pypi.python.org/pypi/mappy
|
||||||
|
[mappyconda]: https://anaconda.org/bioconda/mappy
|
||||||
|
[issue]: https://github.com/lh3/minimap2/issues
|
||||||
|
[k8]: https://github.com/attractivechaos/k8
|
||||||
|
[manpage]: https://lh3.github.io/minimap2/minimap2.html
|
||||||
|
|||||||
@@ -1,5 +1,7 @@
|
|||||||
#include <assert.h>
|
#include <assert.h>
|
||||||
#include <string.h>
|
#include <string.h>
|
||||||
|
#include <stdlib.h>
|
||||||
|
#include <math.h>
|
||||||
#include "minimap.h"
|
#include "minimap.h"
|
||||||
#include "mmpriv.h"
|
#include "mmpriv.h"
|
||||||
#include "ksw2.h"
|
#include "ksw2.h"
|
||||||
@@ -53,7 +55,7 @@ static int mm_check_zdrop(const uint8_t *qseq, const uint8_t *tseq, uint32_t n_c
|
|||||||
} else if (op == 1) {
|
} else if (op == 1) {
|
||||||
score -= q + e * len, j += len;
|
score -= q + e * len, j += len;
|
||||||
if (test_zdrop_aux(score, i, j, &max, &max_i, &max_j, e, zdrop)) return 1;
|
if (test_zdrop_aux(score, i, j, &max, &max_i, &max_j, e, zdrop)) return 1;
|
||||||
} else if (op == 2) {
|
} else if (op == 2 || op == 3) {
|
||||||
score -= q + e * len, i += len;
|
score -= q + e * len, i += len;
|
||||||
if (test_zdrop_aux(score, i, j, &max, &max_i, &max_j, e, zdrop)) return 1;
|
if (test_zdrop_aux(score, i, j, &max, &max_i, &max_j, e, zdrop)) return 1;
|
||||||
}
|
}
|
||||||
@@ -61,42 +63,109 @@ static int mm_check_zdrop(const uint8_t *qseq, const uint8_t *tseq, uint32_t n_c
|
|||||||
return 0;
|
return 0;
|
||||||
}
|
}
|
||||||
|
|
||||||
static void mm_update_extra(mm_extra_t *p, const uint8_t *qseq, const uint8_t *tseq, const int8_t *mat, int8_t q, int8_t e)
|
static void mm_fix_cigar(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq, int *qshift, int *tshift)
|
||||||
|
{
|
||||||
|
mm_extra_t *p = r->p;
|
||||||
|
int32_t k, toff = 0, qoff = 0, to_shrink = 0;
|
||||||
|
*qshift = *tshift = 0;
|
||||||
|
if (p->n_cigar <= 1) return;
|
||||||
|
for (k = 0; k < p->n_cigar; ++k) { // indel left alignment
|
||||||
|
uint32_t op = p->cigar[k]&0xf, len = p->cigar[k]>>4;
|
||||||
|
if (len == 0) to_shrink = 1;
|
||||||
|
if (op == 0) {
|
||||||
|
toff += len, qoff += len;
|
||||||
|
} else if (op == 1 || op == 2) { // insertion or deletion
|
||||||
|
if (k > 0 && k < p->n_cigar - 1 && (p->cigar[k-1]&0xf) == 0 && (p->cigar[k+1]&0xf) == 0) {
|
||||||
|
int l, prev_len = p->cigar[k-1] >> 4;
|
||||||
|
if (op == 1) {
|
||||||
|
for (l = 0; l < prev_len; ++l)
|
||||||
|
if (qseq[qoff - 1 - l] != qseq[qoff + len - 1 - l])
|
||||||
|
break;
|
||||||
|
} else {
|
||||||
|
for (l = 0; l < prev_len; ++l)
|
||||||
|
if (tseq[toff - 1 - l] != tseq[toff + len - 1 - l])
|
||||||
|
break;
|
||||||
|
}
|
||||||
|
if (l > 0)
|
||||||
|
p->cigar[k-1] -= l<<4, p->cigar[k+1] += l<<4, qoff -= l, toff -= l;
|
||||||
|
if (l == prev_len) to_shrink = 1;
|
||||||
|
}
|
||||||
|
if (op == 1) qoff += len;
|
||||||
|
else toff += len;
|
||||||
|
} else if (op == 3) {
|
||||||
|
toff += len;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
assert(qoff == r->qe - r->qs && toff == r->re - r->rs);
|
||||||
|
if (to_shrink) { // squeeze out zero-length operations
|
||||||
|
int32_t l = 0;
|
||||||
|
for (k = 0; k < p->n_cigar; ++k) // squeeze out zero-length operations
|
||||||
|
if (p->cigar[k]>>4 != 0)
|
||||||
|
p->cigar[l++] = p->cigar[k];
|
||||||
|
p->n_cigar = l;
|
||||||
|
for (k = l = 0; k < p->n_cigar; ++k) // merge two adjacent operations if they are the same
|
||||||
|
if (k == p->n_cigar - 1 || (p->cigar[k]&0xf) != (p->cigar[k+1]&0xf))
|
||||||
|
p->cigar[l++] = p->cigar[k];
|
||||||
|
else p->cigar[k+1] += p->cigar[k]>>4<<4; // add length to the next CIGAR operator
|
||||||
|
p->n_cigar = l;
|
||||||
|
}
|
||||||
|
if ((p->cigar[0]&0xf) == 1 || (p->cigar[0]&0xf) == 2) { // get rid of leading I or D
|
||||||
|
int32_t l = p->cigar[0] >> 4;
|
||||||
|
if ((p->cigar[0]&0xf) == 1) {
|
||||||
|
if (r->rev) r->qe -= l;
|
||||||
|
else r->qs += l;
|
||||||
|
*qshift = l;
|
||||||
|
} else r->rs += l, *tshift = l;
|
||||||
|
--p->n_cigar;
|
||||||
|
memmove(p->cigar, p->cigar + 1, p->n_cigar * 4);
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
static void mm_update_extra(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq, const int8_t *mat, int8_t q, int8_t e)
|
||||||
{
|
{
|
||||||
uint32_t k, l, toff = 0, qoff = 0;
|
uint32_t k, l, toff = 0, qoff = 0;
|
||||||
int32_t s = 0, max = 0;
|
int32_t s = 0, max = 0, qshift, tshift;
|
||||||
|
mm_extra_t *p = r->p;
|
||||||
if (p == 0) return;
|
if (p == 0) return;
|
||||||
|
mm_fix_cigar(r, qseq, tseq, &qshift, &tshift);
|
||||||
|
qseq += qshift, tseq += tshift; // qseq and tseq may be shifted due to the removal of leading I/D
|
||||||
|
r->blen = r->mlen = 0;
|
||||||
for (k = 0; k < p->n_cigar; ++k) {
|
for (k = 0; k < p->n_cigar; ++k) {
|
||||||
uint32_t op = p->cigar[k]&0xf, len = p->cigar[k]>>4;
|
uint32_t op = p->cigar[k]&0xf, len = p->cigar[k]>>4;
|
||||||
if (op == 0) {
|
if (op == 0) { // match/mismatch
|
||||||
|
int n_ambi = 0, n_diff = 0;
|
||||||
for (l = 0; l < len; ++l) {
|
for (l = 0; l < len; ++l) {
|
||||||
int cq = qseq[qoff + l], ct = tseq[toff + l];
|
int cq = qseq[qoff + l], ct = tseq[toff + l];
|
||||||
if (ct > 3 || cq > 3) ++p->n_ambi;
|
if (ct > 3 || cq > 3) ++n_ambi;
|
||||||
else if (ct != cq) ++p->n_diff;
|
else if (ct != cq) ++n_diff;
|
||||||
s += mat[ct * 5 + cq];
|
s += mat[ct * 5 + cq];
|
||||||
if (s < 0) s = 0;
|
if (s < 0) s = 0;
|
||||||
else max = max > s? max : s;
|
else max = max > s? max : s;
|
||||||
}
|
}
|
||||||
toff += len, qoff += len, p->blen += len;
|
r->blen += len - n_ambi, r->mlen += len - (n_ambi + n_diff), p->n_ambi += n_ambi;
|
||||||
} else if (op == 1) {
|
toff += len, qoff += len;
|
||||||
|
} else if (op == 1) { // insertion
|
||||||
int n_ambi = 0;
|
int n_ambi = 0;
|
||||||
for (l = 0; l < len; ++l)
|
for (l = 0; l < len; ++l)
|
||||||
if (qseq[qoff + l] > 3) ++n_ambi;
|
if (qseq[qoff + l] > 3) ++n_ambi;
|
||||||
qoff += len, p->blen += len;
|
r->blen += len - n_ambi, p->n_ambi += n_ambi;
|
||||||
p->n_ambi += n_ambi, p->n_diff += len - n_ambi;
|
|
||||||
s -= q + e * len;
|
s -= q + e * len;
|
||||||
if (s < 0) s = 0;
|
if (s < 0) s = 0;
|
||||||
} else if (op == 2) {
|
qoff += len;
|
||||||
|
} else if (op == 2) { // deletion
|
||||||
int n_ambi = 0;
|
int n_ambi = 0;
|
||||||
for (l = 0; l < len; ++l)
|
for (l = 0; l < len; ++l)
|
||||||
if (tseq[toff + l] > 3) ++n_ambi;
|
if (tseq[toff + l] > 3) ++n_ambi;
|
||||||
toff += len, p->blen += len;
|
r->blen += len - n_ambi, p->n_ambi += n_ambi;
|
||||||
p->n_ambi += n_ambi, p->n_diff += len - n_ambi;
|
|
||||||
s -= q + e * len;
|
s -= q + e * len;
|
||||||
if (s < 0) s = 0;
|
if (s < 0) s = 0;
|
||||||
|
toff += len;
|
||||||
|
} else if (op == 3) { // intron
|
||||||
|
toff += len;
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
p->dp_max = max;
|
p->dp_max = max;
|
||||||
|
assert(qoff == r->qe - r->qs && toff == r->re - r->rs);
|
||||||
}
|
}
|
||||||
|
|
||||||
static void mm_append_cigar(mm_reg1_t *r, uint32_t n_cigar, uint32_t *cigar) // TODO: this calls the libc realloc()
|
static void mm_append_cigar(mm_reg1_t *r, uint32_t n_cigar, uint32_t *cigar) // TODO: this calls the libc realloc()
|
||||||
@@ -124,12 +193,30 @@ static void mm_append_cigar(mm_reg1_t *r, uint32_t n_cigar, uint32_t *cigar) //
|
|||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
static void mm_align_pair(void *km, const mm_mapopt_t *opt, int qlen, const uint8_t *qseq, int tlen, const uint8_t *tseq, const int8_t *mat, int w, int flag, ksw_extz_t *ez)
|
static void mm_align_pair(void *km, const mm_mapopt_t *opt, int qlen, const uint8_t *qseq, int tlen, const uint8_t *tseq, const int8_t *mat, int w, int end_bonus, int flag, ksw_extz_t *ez)
|
||||||
{
|
{
|
||||||
if (opt->q == opt->q2 && opt->e == opt->e2)
|
int zdrop = opt->zdrop;
|
||||||
ksw_extz2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, w, opt->zdrop, flag, ez);
|
if (mm_dbg_flag & MM_DBG_PRINT_ALN_SEQ) {
|
||||||
|
int i;
|
||||||
|
fprintf(stderr, "===> q=(%d,%d), e=(%d,%d), bw=%d, flag=%d, zdrop=%d <===\n", opt->q, opt->q2, opt->e, opt->e2, w, flag, opt->zdrop);
|
||||||
|
for (i = 0; i < tlen; ++i) fputc("ACGTN"[tseq[i]], stderr);
|
||||||
|
fputc('\n', stderr);
|
||||||
|
for (i = 0; i < qlen; ++i) fputc("ACGTN"[qseq[i]], stderr);
|
||||||
|
fputc('\n', stderr);
|
||||||
|
}
|
||||||
|
if (opt->flag & MM_F_SPLICE)
|
||||||
|
ksw_exts2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->noncan, zdrop, flag, ez);
|
||||||
|
else if (opt->q == opt->q2 && opt->e == opt->e2)
|
||||||
|
ksw_extz2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, w, zdrop, end_bonus, flag, ez);
|
||||||
else
|
else
|
||||||
ksw_extd2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->e2, w, opt->zdrop, flag, ez);
|
ksw_extd2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->e2, w, zdrop, end_bonus, flag, ez);
|
||||||
|
if (mm_dbg_flag & MM_DBG_PRINT_ALN_SEQ) {
|
||||||
|
int i;
|
||||||
|
fprintf(stderr, "score=%d, cigar=", ez->score);
|
||||||
|
for (i = 0; i < ez->n_cigar; ++i)
|
||||||
|
fprintf(stderr, "%d%c", ez->cigar[i]>>4, "MIDN"[ez->cigar[i]&0xf]);
|
||||||
|
fprintf(stderr, "\n");
|
||||||
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
static inline int mm_get_hplen_back(const mm_idx_t *mi, uint32_t rid, uint32_t x)
|
static inline int mm_get_hplen_back(const mm_idx_t *mi, uint32_t rid, uint32_t x)
|
||||||
@@ -143,7 +230,7 @@ static inline int mm_get_hplen_back(const mm_idx_t *mi, uint32_t rid, uint32_t x
|
|||||||
|
|
||||||
static inline void mm_adjust_minier(const mm_idx_t *mi, uint8_t *const qseq0[2], mm128_t *a, int32_t *r, int32_t *q)
|
static inline void mm_adjust_minier(const mm_idx_t *mi, uint8_t *const qseq0[2], mm128_t *a, int32_t *r, int32_t *q)
|
||||||
{
|
{
|
||||||
if (mi->is_hpc) {
|
if (mi->flag & MM_I_HPC) {
|
||||||
const uint8_t *qseq = qseq0[a->x>>63];
|
const uint8_t *qseq = qseq0[a->x>>63];
|
||||||
int i, c;
|
int i, c;
|
||||||
*q = (int32_t)a->y;
|
*q = (int32_t)a->y;
|
||||||
@@ -153,70 +240,265 @@ static inline void mm_adjust_minier(const mm_idx_t *mi, uint8_t *const qseq0[2],
|
|||||||
c = mm_get_hplen_back(mi, a->x<<1>>33, (int32_t)a->x);
|
c = mm_get_hplen_back(mi, a->x<<1>>33, (int32_t)a->x);
|
||||||
*r = (int32_t)a->x + 1 - c;
|
*r = (int32_t)a->x + 1 - c;
|
||||||
} else {
|
} else {
|
||||||
*r = (int32_t)a->x + 1;
|
*r = (int32_t)a->x - (mi->k>>1);
|
||||||
*q = (int32_t)a->y + 1;
|
*q = (int32_t)a->y - (mi->k>>1);
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
static void mm_filter_bad_seeds(int n, mm128_t *a, int max_space, int max_diff)
|
static void mm_filter_bad_seeds(void *km, int as1, int cnt1, mm128_t *a, int min_gap, int diff_thres, int max_ext_len, int max_ext_cnt)
|
||||||
{
|
{
|
||||||
int i;
|
int max_st, max_en, n, i, k, max, *K;
|
||||||
if (n < 3) return;
|
for (i = 1, n = 0; i < cnt1; ++i) { // count the number of gaps longer than min_gap
|
||||||
for (i = 0; i < n - 2; ++i) {
|
int gap = ((int32_t)a[as1 + i].y - a[as1 + i - 1].y) - ((int32_t)a[as1 + i].x - a[as1 + i - 1].x);
|
||||||
int32_t q[3], t[3], gap01, gap12, gap02;
|
if (gap < -min_gap || gap > min_gap) ++n;
|
||||||
t[0] = (int32_t)a[i].x, q[0] = (int32_t)a[i].y;
|
}
|
||||||
t[1] = (int32_t)a[i+1].x, q[1] = (int32_t)a[i+1].y;
|
if (n <= 1) return;
|
||||||
t[2] = (int32_t)a[i+2].x, q[2] = (int32_t)a[i+2].y;
|
K = (int*)kmalloc(km, n * sizeof(int));
|
||||||
if (t[2] - t[0] > max_space || q[2] - q[0] > max_space) continue;
|
for (i = 1, n = 0; i < cnt1; ++i) { // store the positions of long gaps
|
||||||
gap01 = (t[1] - t[0]) - (q[1] - q[0]), gap01 = gap01 > 0? gap01 : -gap01;
|
int gap = ((int32_t)a[as1 + i].y - a[as1 + i - 1].y) - ((int32_t)a[as1 + i].x - a[as1 + i - 1].x);
|
||||||
gap12 = (t[2] - t[1]) - (q[2] - q[1]), gap12 = gap12 > 0? gap12 : -gap12;
|
if (gap < -min_gap || gap > min_gap)
|
||||||
gap02 = (t[2] - t[0]) - (q[2] - q[0]), gap02 = gap02 > 0? gap02 : -gap02;
|
K[n++] = i;
|
||||||
if (gap01 + gap12 - gap02 > max_diff)
|
}
|
||||||
a[++i].y |= 1ULL << 41;
|
max = 0, max_st = max_en = -1;
|
||||||
|
for (k = 0;; ++k) { // traverse long gaps
|
||||||
|
int gap, l, n_ins = 0, n_del = 0, qs, rs, max_diff = 0, max_diff_l = -1;
|
||||||
|
if (k == n || k >= max_en) {
|
||||||
|
if (max_en > 0)
|
||||||
|
for (i = K[max_st]; i < K[max_en]; ++i)
|
||||||
|
a[as1 + i].y |= MM_SEED_IGNORE;
|
||||||
|
max = 0, max_st = max_en = -1;
|
||||||
|
if (k == n) break;
|
||||||
|
}
|
||||||
|
i = K[k];
|
||||||
|
gap = ((int32_t)a[as1 + i].y - a[as1 + i - 1].y) - ((int32_t)a[as1 + i].x - a[as1 + i - 1].x);
|
||||||
|
if (gap > 0) n_ins += gap;
|
||||||
|
else n_del += -gap;
|
||||||
|
qs = (int32_t)a[as1 + i - 1].y;
|
||||||
|
rs = (int32_t)a[as1 + i - 1].x;
|
||||||
|
for (l = k + 1; l < n && l <= k + max_ext_cnt; ++l) {
|
||||||
|
int j = K[l], diff;
|
||||||
|
if ((int32_t)a[as1 + j].y - qs > max_ext_len || (int32_t)a[as1 + j].x - rs > max_ext_len) break;
|
||||||
|
gap = ((int32_t)a[as1 + j].y - (int32_t)a[as1 + j - 1].y) - (a[as1 + j].x - a[as1 + j - 1].x);
|
||||||
|
if (gap > 0) n_ins += gap;
|
||||||
|
else n_del += -gap;
|
||||||
|
diff = n_ins + n_del - abs(n_ins - n_del);
|
||||||
|
if (max_diff < diff)
|
||||||
|
max_diff = diff, max_diff_l = l;
|
||||||
|
}
|
||||||
|
if (max_diff > diff_thres && max_diff > max)
|
||||||
|
max = max_diff, max_st = k, max_en = max_diff_l;
|
||||||
|
}
|
||||||
|
kfree(km, K);
|
||||||
|
}
|
||||||
|
|
||||||
|
static void mm_fix_bad_ends(const mm_reg1_t *r, const mm128_t *a, int bw, int32_t *as, int32_t *cnt)
|
||||||
|
{
|
||||||
|
int32_t i, l;
|
||||||
|
*as = r->as, *cnt = r->cnt;
|
||||||
|
if (r->cnt < 3) return;
|
||||||
|
l = a[r->as].y >> 32 & 0xff;
|
||||||
|
for (i = r->as + 1; i < r->as + r->cnt - 1; ++i) {
|
||||||
|
int32_t lq, lr, min, max;
|
||||||
|
lr = (int32_t)a[i].x - (int32_t)a[i-1].x;
|
||||||
|
lq = (int32_t)a[i].y - (int32_t)a[i-1].y;
|
||||||
|
min = lr < lq? lr : lq;
|
||||||
|
max = lr > lq? lr : lq;
|
||||||
|
if (max - min > l >> 1) *as = i;
|
||||||
|
l += min;
|
||||||
|
if (l >= bw << 1) break;
|
||||||
|
}
|
||||||
|
*cnt = r->as + r->cnt - *as;
|
||||||
|
l = a[r->as + r->cnt - 1].y >> 32 & 0xff;
|
||||||
|
for (i = r->as + r->cnt - 2; i > *as; --i) {
|
||||||
|
int32_t lq, lr, min, max;
|
||||||
|
lr = (int32_t)a[i+1].x - (int32_t)a[i].x;
|
||||||
|
lq = (int32_t)a[i+1].y - (int32_t)a[i].y;
|
||||||
|
min = lr < lq? lr : lq;
|
||||||
|
max = lr > lq? lr : lq;
|
||||||
|
if (max - min > l >> 1) *cnt = i + 1 - *as;
|
||||||
|
l += min;
|
||||||
|
if (l >= bw) break;
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, uint8_t *qseq0[2], mm_reg1_t *r, mm_reg1_t *r2, mm128_t *a, ksw_extz_t *ez)
|
static void mm_max_stretch(const mm_mapopt_t *opt, const mm_reg1_t *r, const mm128_t *a, int32_t *as, int32_t *cnt)
|
||||||
{
|
{
|
||||||
int32_t rid = a[r->as].x<<1>>33, rev = a[r->as].x>>63;
|
int32_t i, score, max_score, len, max_i, max_len;
|
||||||
|
|
||||||
|
*as = r->as, *cnt = r->cnt;
|
||||||
|
if (r->cnt < 2) return;
|
||||||
|
|
||||||
|
max_score = -1, max_i = -1, max_len = 0;
|
||||||
|
score = a[r->as].y >> 32 & 0xff, len = 1;
|
||||||
|
for (i = r->as + 1; i < r->as + r->cnt; ++i) {
|
||||||
|
int32_t lq, lr, q_span;
|
||||||
|
q_span = a[i].y >> 32 & 0xff;
|
||||||
|
lr = (int32_t)a[i].x - (int32_t)a[i-1].x;
|
||||||
|
lq = (int32_t)a[i].y - (int32_t)a[i-1].y;
|
||||||
|
if (lq == lr) {
|
||||||
|
score += lq < q_span? lq : q_span;
|
||||||
|
++len;
|
||||||
|
} else {
|
||||||
|
if (score > max_score)
|
||||||
|
max_score = score, max_len = len, max_i = i - len;
|
||||||
|
score = q_span, len = 1;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
if (score > max_score)
|
||||||
|
max_score = score, max_len = len, max_i = i - len;
|
||||||
|
*as = max_i, *cnt = max_len;
|
||||||
|
}
|
||||||
|
|
||||||
|
static int mm_seed_ext_score(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, const int8_t mat[25], int qlen, uint8_t *qseq0[2], const mm128_t *a)
|
||||||
|
{
|
||||||
|
uint8_t *qseq, *tseq;
|
||||||
|
int q_span = a->y>>32&0xff, qs, qe, rs, re, rid, score, q_off, t_off, ext_len = opt->anchor_ext_len;
|
||||||
|
void *qp;
|
||||||
|
rid = a->x<<1>>33;
|
||||||
|
re = (uint32_t)a->x + 1, rs = re - q_span;
|
||||||
|
qe = (uint32_t)a->y + 1, qs = qe - q_span;
|
||||||
|
rs = rs - ext_len > 0? rs - ext_len : 0;
|
||||||
|
qs = qs - ext_len > 0? qs - ext_len : 0;
|
||||||
|
re = re + ext_len < mi->seq[rid].len? re + ext_len : mi->seq[rid].len;
|
||||||
|
qe = qe + ext_len < qlen? qe + ext_len : qlen;
|
||||||
|
tseq = (uint8_t*)kmalloc(km, re - rs);
|
||||||
|
mm_idx_getseq(mi, rid, rs, re, tseq);
|
||||||
|
qseq = qseq0[a->x>>63] + qs;
|
||||||
|
qp = ksw_ll_qinit(km, 2, qe - qs, qseq, 5, mat);
|
||||||
|
score = ksw_ll_i16(qp, re - rs, tseq, opt->q, opt->e, &q_off, &t_off);
|
||||||
|
kfree(km, tseq);
|
||||||
|
kfree(km, qp);
|
||||||
|
return score;
|
||||||
|
}
|
||||||
|
|
||||||
|
static void mm_fix_bad_ends_splice(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, const mm_reg1_t *r, const int8_t mat[25], int qlen, uint8_t *qseq0[2], const mm128_t *a, int *as1, int *cnt1)
|
||||||
|
{ // this assumes a very crude k-mer based mode; it is not necessary to use a good model just for filtering bounary exons
|
||||||
|
int score;
|
||||||
|
double log_gap;
|
||||||
|
*as1 = r->as, *cnt1 = r->cnt;
|
||||||
|
if (r->cnt < 3) return;
|
||||||
|
log_gap = log((int32_t)a[r->as + 1].x - (int32_t)a[r->as].x);
|
||||||
|
if ((a[r->as].y>>32&0xff) < log_gap + opt->anchor_ext_shift) {
|
||||||
|
score = mm_seed_ext_score(km, opt, mi, mat, qlen, qseq0, &a[r->as]);
|
||||||
|
if ((double)score / mat[0] < log_gap + opt->anchor_ext_shift) // a more exact format is "score < log_4(gap) + shift"
|
||||||
|
++(*as1), --(*cnt1);
|
||||||
|
}
|
||||||
|
log_gap = log((int32_t)a[r->as + r->cnt - 1].x - (int32_t)a[r->as + r->cnt - 2].x);
|
||||||
|
if ((a[r->as + r->cnt - 1].y>>32&0xff) < log_gap + opt->anchor_ext_shift) {
|
||||||
|
score = mm_seed_ext_score(km, opt, mi, mat, qlen, qseq0, &a[r->as + r->cnt - 1]);
|
||||||
|
if ((double)score / mat[0] < log_gap + opt->anchor_ext_shift)
|
||||||
|
--(*cnt1);
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, uint8_t *qseq0[2], mm_reg1_t *r, mm_reg1_t *r2, int n_a, mm128_t *a, ksw_extz_t *ez, int splice_flag)
|
||||||
|
{
|
||||||
|
int is_sr = !!(opt->flag & MM_F_SR), is_splice = !!(opt->flag & MM_F_SPLICE);
|
||||||
|
int32_t rid = a[r->as].x<<1>>33, rev = a[r->as].x>>63, as1, cnt1;
|
||||||
uint8_t *tseq, *qseq;
|
uint8_t *tseq, *qseq;
|
||||||
int32_t i, l, bw, dropped = 0, rs0, re0, qs0, qe0;
|
int32_t i, l, bw, dropped = 0, extra_flag = 0, rs0, re0, qs0, qe0;
|
||||||
int32_t rs, re, qs, qe;
|
int32_t rs, re, qs, qe;
|
||||||
int32_t rs1, qs1, re1, qe1;
|
int32_t rs1, qs1, re1, qe1;
|
||||||
int8_t mat[25];
|
int8_t mat[25];
|
||||||
|
|
||||||
|
if (is_sr) assert(!(mi->flag & MM_I_HPC)); // HPC won't work with SR because with HPC we can't easily tell if there is a gap
|
||||||
|
|
||||||
|
r2->cnt = 0;
|
||||||
if (r->cnt == 0) return;
|
if (r->cnt == 0) return;
|
||||||
ksw_gen_simple_mat(5, mat, opt->a, opt->b);
|
ksw_gen_simple_mat(5, mat, opt->a, opt->b);
|
||||||
bw = (int)(opt->bw * 1.5 + 1.);
|
bw = (int)(opt->bw * 1.5 + 1.);
|
||||||
|
|
||||||
r2->cnt = 0;
|
if (is_sr && !(mi->flag & MM_I_HPC)) {
|
||||||
mm_adjust_minier(mi, qseq0, &a[r->as], &rs, &qs);
|
mm_max_stretch(opt, r, a, &as1, &cnt1);
|
||||||
mm_adjust_minier(mi, qseq0, &a[r->as + r->cnt - 1], &re, &qe);
|
rs = (int32_t)a[as1].x + 1 - (int32_t)(a[as1].y>>32&0xff);
|
||||||
mm_filter_bad_seeds(r->cnt, &a[r->as], opt->max_gap, 100);
|
qs = (int32_t)a[as1].y + 1 - (int32_t)(a[as1].y>>32&0xff);
|
||||||
|
re = (int32_t)a[as1+cnt1-1].x + 1;
|
||||||
// compute rs0 and qs0
|
qe = (int32_t)a[as1+cnt1-1].y + 1;
|
||||||
if (r->split && r->as > 0) {
|
|
||||||
mm_adjust_minier(mi, qseq0, &a[r->as-1], &rs0, &qs0);
|
|
||||||
} else {
|
} else {
|
||||||
if (qs > 0 && rs > 0) { // actually this is always true
|
if (is_splice) {
|
||||||
|
mm_fix_bad_ends_splice(km, opt, mi, r, mat, qlen, qseq0, a, &as1, &cnt1);
|
||||||
|
} else {
|
||||||
|
mm_fix_bad_ends(r, a, opt->bw, &as1, &cnt1);
|
||||||
|
}
|
||||||
|
mm_filter_bad_seeds(km, as1, cnt1, a, 10, 40, opt->max_gap>>1, 10);
|
||||||
|
mm_adjust_minier(mi, qseq0, &a[as1], &rs, &qs);
|
||||||
|
mm_adjust_minier(mi, qseq0, &a[as1 + cnt1 - 1], &re, &qe);
|
||||||
|
}
|
||||||
|
assert(cnt1 > 0);
|
||||||
|
|
||||||
|
if (is_splice) {
|
||||||
|
if (splice_flag & MM_F_SPLICE_FOR) extra_flag |= rev? KSW_EZ_SPLICE_REV : KSW_EZ_SPLICE_FOR;
|
||||||
|
if (splice_flag & MM_F_SPLICE_REV) extra_flag |= rev? KSW_EZ_SPLICE_FOR : KSW_EZ_SPLICE_REV;
|
||||||
|
if (opt->flag & MM_F_SPLICE_FLANK) extra_flag |= KSW_EZ_SPLICE_FLANK;
|
||||||
|
}
|
||||||
|
|
||||||
|
/* Look for the start and end of regions to perform DP. This sounds easy
|
||||||
|
* but is in fact tricky. Excessively small regions lead to unnecessary
|
||||||
|
* clippings and lose alignable sequences. Excessively large regions
|
||||||
|
* occasionally lead to large overlaps between two chains and may cause
|
||||||
|
* loss of alignments in corner cases. */
|
||||||
|
if (is_sr) {
|
||||||
|
qs0 = 0, qe0 = qlen;
|
||||||
|
l = qs;
|
||||||
|
l += l * opt->a + opt->end_bonus > opt->q? (l * opt->a + opt->end_bonus - opt->q) / opt->e : 0;
|
||||||
|
rs0 = rs - l > 0? rs - l : 0;
|
||||||
|
l = qlen - qe;
|
||||||
|
l += l * opt->a + opt->end_bonus > opt->q? (l * opt->a + opt->end_bonus - opt->q) / opt->e : 0;
|
||||||
|
re0 = re + l < mi->seq[rid].len? re + l : mi->seq[rid].len;
|
||||||
|
} else {
|
||||||
|
// compute rs0 and qs0
|
||||||
|
rs0 = (int32_t)a[r->as].x + 1 - (int32_t)(a[r->as].y>>32&0xff);
|
||||||
|
qs0 = (int32_t)a[r->as].y + 1 - (int32_t)(a[r->as].y>>32&0xff);
|
||||||
|
if (rs0 < 0) rs0 = 0; // this may happen when HPC is in use
|
||||||
|
assert(qs0 >= 0); // this should never happen, or it is logic error
|
||||||
|
rs1 = qs1 = 0;
|
||||||
|
for (i = r->as - 1, l = 0; i >= 0 && a[i].x>>32 == a[r->as].x>>32; --i) { // inspect nearby seeds
|
||||||
|
int32_t x = (int32_t)a[i].x + 1 - (int32_t)(a[i].y>>32&0xff);
|
||||||
|
int32_t y = (int32_t)a[i].y + 1 - (int32_t)(a[i].y>>32&0xff);
|
||||||
|
if (x < rs0 && y < qs0) {
|
||||||
|
if (++l > opt->min_cnt) {
|
||||||
|
l = rs0 - x > qs0 - y? rs0 - x : qs0 - y;
|
||||||
|
rs1 = rs0 - l, qs1 = qs0 - l;
|
||||||
|
break;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
if (qs > 0 && rs > 0) {
|
||||||
l = qs < opt->max_gap? qs : opt->max_gap;
|
l = qs < opt->max_gap? qs : opt->max_gap;
|
||||||
qs0 = qs - l;
|
qs1 = qs1 > qs - l? qs1 : qs - l;
|
||||||
|
qs0 = qs0 < qs1? qs0 : qs1; // at least include qs0
|
||||||
l += l * opt->a > opt->q? (l * opt->a - opt->q) / opt->e : 0;
|
l += l * opt->a > opt->q? (l * opt->a - opt->q) / opt->e : 0;
|
||||||
l = l < opt->max_gap? l : opt->max_gap;
|
l = l < opt->max_gap? l : opt->max_gap;
|
||||||
l = l < rs? l : rs;
|
l = l < rs? l : rs;
|
||||||
rs0 = rs - l;
|
rs1 = rs1 > rs - l? rs1 : rs - l;
|
||||||
|
rs0 = rs0 < rs1? rs0 : rs1;
|
||||||
} else rs0 = rs, qs0 = qs;
|
} else rs0 = rs, qs0 = qs;
|
||||||
|
|
||||||
}
|
|
||||||
// compute re0 and qe0
|
// compute re0 and qe0
|
||||||
|
re0 = (int32_t)a[r->as + r->cnt - 1].x + 1;
|
||||||
|
qe0 = (int32_t)a[r->as + r->cnt - 1].y + 1;
|
||||||
|
re1 = mi->seq[rid].len, qe1 = qlen;
|
||||||
|
for (i = r->as + r->cnt, l = 0; i < n_a && a[i].x>>32 == a[r->as].x>>32; ++i) { // inspect nearby seeds
|
||||||
|
int32_t x = (int32_t)a[i].x + 1;
|
||||||
|
int32_t y = (int32_t)a[i].y + 1;
|
||||||
|
if (x > re0 && y > qe0) {
|
||||||
|
if (++l > opt->min_cnt) {
|
||||||
|
l = x - re0 > y - qe0? x - re0 : y - qe0;
|
||||||
|
re1 = re0 + l, qe1 = qe0 + l;
|
||||||
|
break;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
if (qe < qlen && re < mi->seq[rid].len) {
|
if (qe < qlen && re < mi->seq[rid].len) {
|
||||||
l = qlen - qe < opt->max_gap? qlen - qe : opt->max_gap;
|
l = qlen - qe < opt->max_gap? qlen - qe : opt->max_gap;
|
||||||
qe0 = qe + l;
|
qe1 = qe1 < qe + l? qe1 : qe + l;
|
||||||
|
qe0 = qe0 > qe1? qe0 : qe1; // at least include qe0
|
||||||
l += l * opt->a > opt->q? (l * opt->a - opt->q) / opt->e : 0;
|
l += l * opt->a > opt->q? (l * opt->a - opt->q) / opt->e : 0;
|
||||||
l = l < opt->max_gap? l : opt->max_gap;
|
l = l < opt->max_gap? l : opt->max_gap;
|
||||||
l = l < mi->seq[rid].len - re? l : mi->seq[rid].len - re;
|
l = l < mi->seq[rid].len - re? l : mi->seq[rid].len - re;
|
||||||
re0 = re + l;
|
re1 = re1 < re + l? re1 : re + l;
|
||||||
|
re0 = re0 > re1? re0 : re1;
|
||||||
} else re0 = re, qe0 = qe;
|
} else re0 = re, qe0 = qe;
|
||||||
|
}
|
||||||
|
|
||||||
assert(re0 > rs0);
|
assert(re0 > rs0);
|
||||||
tseq = (uint8_t*)kmalloc(km, re0 - rs0);
|
tseq = (uint8_t*)kmalloc(km, re0 - rs0);
|
||||||
@@ -226,44 +508,57 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
|
|||||||
mm_idx_getseq(mi, rid, rs0, rs, tseq);
|
mm_idx_getseq(mi, rid, rs0, rs, tseq);
|
||||||
mm_seq_rev(qs - qs0, qseq);
|
mm_seq_rev(qs - qs0, qseq);
|
||||||
mm_seq_rev(rs - rs0, tseq);
|
mm_seq_rev(rs - rs0, tseq);
|
||||||
mm_align_pair(km, opt, qs - qs0, qseq, rs - rs0, tseq, mat, bw, KSW_EZ_EXTZ_ONLY|KSW_EZ_RIGHT|KSW_EZ_REV_CIGAR, ez);
|
mm_align_pair(km, opt, qs - qs0, qseq, rs - rs0, tseq, mat, bw, opt->end_bonus, extra_flag|KSW_EZ_EXTZ_ONLY|KSW_EZ_RIGHT|KSW_EZ_REV_CIGAR, ez);
|
||||||
if (ez->n_cigar > 0) {
|
if (ez->n_cigar > 0) {
|
||||||
mm_append_cigar(r, ez->n_cigar, ez->cigar);
|
mm_append_cigar(r, ez->n_cigar, ez->cigar);
|
||||||
r->p->dp_score += ez->max;
|
r->p->dp_score += ez->max;
|
||||||
}
|
}
|
||||||
rs1 = rs - (ez->max_t + 1);
|
rs1 = rs - (ez->reach_end? ez->mqe_t + 1 : ez->max_t + 1);
|
||||||
qs1 = qs - (ez->max_q + 1);
|
qs1 = qs - (ez->reach_end? qs - qs0 : ez->max_q + 1);
|
||||||
mm_seq_rev(qs - qs0, qseq);
|
mm_seq_rev(qs - qs0, qseq);
|
||||||
} else rs1 = rs, qs1 = qs;
|
} else rs1 = rs, qs1 = qs;
|
||||||
re1 = rs, qe1 = qs;
|
re1 = rs, qe1 = qs;
|
||||||
assert(qs1 >= 0 && rs1 >= 0);
|
assert(qs1 >= 0 && rs1 >= 0);
|
||||||
|
|
||||||
for (i = 1; i < r->cnt; ++i) { // gap filling
|
for (i = is_sr? cnt1 - 1 : 1; i < cnt1; ++i) { // gap filling
|
||||||
if (a[r->as+i].y>>41&1) continue;
|
if ((a[as1+i].y & (MM_SEED_IGNORE|MM_SEED_TANDEM)) && i != cnt1 - 1) continue;
|
||||||
mm_adjust_minier(mi, qseq0, &a[r->as + i], &re, &qe);
|
if (is_sr && !(mi->flag & MM_I_HPC)) {
|
||||||
|
re = (int32_t)a[as1 + i].x + 1;
|
||||||
|
qe = (int32_t)a[as1 + i].y + 1;
|
||||||
|
} else mm_adjust_minier(mi, qseq0, &a[as1 + i], &re, &qe);
|
||||||
re1 = re, qe1 = qe;
|
re1 = re, qe1 = qe;
|
||||||
if (i == r->cnt - 1 || (a[r->as+i].y>>40&1) || qe - qs >= opt->min_ksw_len || re - rs >= opt->min_ksw_len) {
|
if (i == cnt1 - 1 || (a[as1+i].y&MM_SEED_LONG_JOIN) || (qe - qs >= opt->min_ksw_len && re - rs >= opt->min_ksw_len)) {
|
||||||
int bw1 = bw;
|
int j, bw1 = bw;
|
||||||
if (a[r->as+i].y>>40&1)
|
if (a[as1+i].y & MM_SEED_LONG_JOIN)
|
||||||
bw1 = qe - qs > re - rs? qe - qs : re - rs;
|
bw1 = qe - qs > re - rs? qe - qs : re - rs;
|
||||||
qseq = &qseq0[rev][qs];
|
qseq = &qseq0[rev][qs];
|
||||||
mm_idx_getseq(mi, rid, rs, re, tseq);
|
mm_idx_getseq(mi, rid, rs, re, tseq);
|
||||||
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, mat, bw1, KSW_EZ_APPROX_MAX, ez);
|
if (is_sr) { // perform ungapped alignment
|
||||||
|
assert(qe - qs == re - rs);
|
||||||
|
ksw_reset_extz(ez);
|
||||||
|
for (j = 0, ez->score = 0; j < qe - qs; ++j) {
|
||||||
|
if (qseq[j] >= 4 || tseq[j] >= 4) ez->score += opt->e2;
|
||||||
|
else ez->score += qseq[j] == tseq[j]? opt->a : -opt->b;
|
||||||
|
}
|
||||||
|
ez->cigar = ksw_push_cigar(km, &ez->n_cigar, &ez->m_cigar, ez->cigar, 0, qe - qs);
|
||||||
|
} else { // perform normal gapped alignment
|
||||||
|
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, mat, bw1, -1, extra_flag|KSW_EZ_APPROX_MAX, ez); // first pass: with approximate Z-drop
|
||||||
|
}
|
||||||
if (mm_check_zdrop(qseq, tseq, ez->n_cigar, ez->cigar, mat, opt->q, opt->e, opt->zdrop))
|
if (mm_check_zdrop(qseq, tseq, ez->n_cigar, ez->cigar, mat, opt->q, opt->e, opt->zdrop))
|
||||||
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, mat, bw1, 0, ez);
|
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, mat, bw1, -1, extra_flag, ez); // second pass: lift approximate
|
||||||
if (ez->n_cigar > 0)
|
if (ez->n_cigar > 0)
|
||||||
mm_append_cigar(r, ez->n_cigar, ez->cigar);
|
mm_append_cigar(r, ez->n_cigar, ez->cigar);
|
||||||
if (ez->zdropped) { // truncated by Z-drop; TODO: sometimes Z-drop kicks in because the next seed placement is wrong. This can be fixed in principle.
|
if (ez->zdropped) { // truncated by Z-drop; TODO: sometimes Z-drop kicks in because the next seed placement is wrong. This can be fixed in principle.
|
||||||
int j;
|
|
||||||
for (j = i - 1; j >= 0; --j)
|
for (j = i - 1; j >= 0; --j)
|
||||||
if ((int32_t)a[r->as + j].x < re + ez->max_t)
|
if ((int32_t)a[as1 + j].x <= rs + ez->max_t)
|
||||||
break;
|
break;
|
||||||
dropped = 1;
|
dropped = 1;
|
||||||
|
if (j < 0) j = 0;
|
||||||
r->p->dp_score += ez->max;
|
r->p->dp_score += ez->max;
|
||||||
re1 = rs + (ez->max_t + 1);
|
re1 = rs + (ez->max_t + 1);
|
||||||
qe1 = qs + (ez->max_q + 1);
|
qe1 = qs + (ez->max_q + 1);
|
||||||
if (r->cnt - (j + 1) >= opt->min_cnt)
|
if (cnt1 - (j + 1) >= opt->min_cnt)
|
||||||
mm_split_reg(r, r2, j + 1, qlen, a);
|
mm_split_reg(r, r2, as1 + j + 1 - r->as, qlen, a);
|
||||||
break;
|
break;
|
||||||
} else r->p->dp_score += ez->score;
|
} else r->p->dp_score += ez->score;
|
||||||
rs = re, qs = qe;
|
rs = re, qs = qe;
|
||||||
@@ -273,13 +568,13 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
|
|||||||
if (!dropped && qe < qe0 && re < re0) { // right extension
|
if (!dropped && qe < qe0 && re < re0) { // right extension
|
||||||
qseq = &qseq0[rev][qe];
|
qseq = &qseq0[rev][qe];
|
||||||
mm_idx_getseq(mi, rid, re, re0, tseq);
|
mm_idx_getseq(mi, rid, re, re0, tseq);
|
||||||
mm_align_pair(km, opt, qe0 - qe, qseq, re0 - re, tseq, mat, bw, KSW_EZ_EXTZ_ONLY, ez);
|
mm_align_pair(km, opt, qe0 - qe, qseq, re0 - re, tseq, mat, bw, opt->end_bonus, extra_flag|KSW_EZ_EXTZ_ONLY, ez);
|
||||||
if (ez->n_cigar > 0) {
|
if (ez->n_cigar > 0) {
|
||||||
mm_append_cigar(r, ez->n_cigar, ez->cigar);
|
mm_append_cigar(r, ez->n_cigar, ez->cigar);
|
||||||
r->p->dp_score += ez->max;
|
r->p->dp_score += ez->max;
|
||||||
}
|
}
|
||||||
re1 = re + (ez->max_t + 1);
|
re1 = re + (ez->reach_end? ez->mqe_t + 1 : ez->max_t + 1);
|
||||||
qe1 = qe + (ez->max_q + 1);
|
qe1 = qe + (ez->reach_end? qe0 - qe : ez->max_q + 1);
|
||||||
}
|
}
|
||||||
assert(qe1 <= qlen);
|
assert(qe1 <= qlen);
|
||||||
|
|
||||||
@@ -290,42 +585,126 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
|
|||||||
assert(re1 - rs1 <= re0 - rs0);
|
assert(re1 - rs1 <= re0 - rs0);
|
||||||
if (r->p) {
|
if (r->p) {
|
||||||
mm_idx_getseq(mi, rid, rs1, re1, tseq);
|
mm_idx_getseq(mi, rid, rs1, re1, tseq);
|
||||||
mm_update_extra(r->p, &qseq0[r->rev][qs1], tseq, mat, opt->q, opt->e);
|
mm_update_extra(r, &qseq0[r->rev][qs1], tseq, mat, opt->q, opt->e);
|
||||||
|
if (rev && r->p->trans_strand)
|
||||||
|
r->p->trans_strand ^= 3; // flip to the read strand
|
||||||
}
|
}
|
||||||
|
|
||||||
kfree(km, tseq);
|
kfree(km, tseq);
|
||||||
}
|
}
|
||||||
|
|
||||||
|
static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, uint8_t *qseq0[2], const mm_reg1_t *r1, const mm_reg1_t *r2, mm_reg1_t *r_inv, ksw_extz_t *ez)
|
||||||
|
{
|
||||||
|
int tl, ql, score, ret = 0, q_off, t_off;
|
||||||
|
uint8_t *tseq, *qseq;
|
||||||
|
int8_t mat[25];
|
||||||
|
void *qp;
|
||||||
|
|
||||||
|
memset(r_inv, 0, sizeof(mm_reg1_t));
|
||||||
|
if (!(r1->split&1) || !(r2->split&2)) return 0;
|
||||||
|
if (r1->id != r1->parent && r1->parent != MM_PARENT_TMP_PRI) return 0;
|
||||||
|
if (r2->id != r2->parent && r2->parent != MM_PARENT_TMP_PRI) return 0;
|
||||||
|
if (r1->rid != r2->rid || r1->rev != r2->rev) return 0;
|
||||||
|
ql = r2->qs - r1->qe;
|
||||||
|
tl = r2->rs - r1->re;
|
||||||
|
if (ql < opt->min_chain_score || ql > opt->max_gap) return 0;
|
||||||
|
if (tl < opt->min_chain_score || tl > opt->max_gap) return 0;
|
||||||
|
|
||||||
|
ksw_gen_simple_mat(5, mat, opt->a, opt->b);
|
||||||
|
tseq = (uint8_t*)kmalloc(km, tl);
|
||||||
|
mm_idx_getseq(mi, r1->rid, r1->re, r2->rs, tseq);
|
||||||
|
qseq = &qseq0[!r1->rev][qlen - r2->qs];
|
||||||
|
|
||||||
|
mm_seq_rev(ql, qseq);
|
||||||
|
mm_seq_rev(tl, tseq);
|
||||||
|
qp = ksw_ll_qinit(km, 2, ql, qseq, 5, mat);
|
||||||
|
score = ksw_ll_i16(qp, tl, tseq, opt->q, opt->e, &q_off, &t_off);
|
||||||
|
kfree(km, qp);
|
||||||
|
mm_seq_rev(ql, qseq);
|
||||||
|
mm_seq_rev(tl, tseq);
|
||||||
|
if (score < opt->min_dp_max) goto end_align1_inv;
|
||||||
|
q_off = ql - (q_off + 1), t_off = tl - (t_off + 1);
|
||||||
|
mm_align_pair(km, opt, ql - q_off, qseq + q_off, tl - t_off, tseq + t_off, mat, (int)(opt->bw * 1.5), -1, KSW_EZ_EXTZ_ONLY, ez);
|
||||||
|
if (ez->n_cigar == 0) goto end_align1_inv; // should never be here
|
||||||
|
mm_append_cigar(r_inv, ez->n_cigar, ez->cigar);
|
||||||
|
r_inv->p->dp_score = ez->max;
|
||||||
|
r_inv->id = -1;
|
||||||
|
r_inv->parent = MM_PARENT_UNSET;
|
||||||
|
r_inv->inv = 1;
|
||||||
|
r_inv->rev = !r1->rev;
|
||||||
|
r_inv->rid = r1->rid;
|
||||||
|
r_inv->div = -1.0f;
|
||||||
|
r_inv->qs = r1->qe + q_off, r_inv->qe = r_inv->qs + ez->max_q + 1;
|
||||||
|
r_inv->rs = r1->re + t_off, r_inv->re = r_inv->rs + ez->max_t + 1;
|
||||||
|
mm_update_extra(r_inv, &qseq[q_off], &tseq[t_off], mat, opt->q, opt->e);
|
||||||
|
ret = 1;
|
||||||
|
end_align1_inv:
|
||||||
|
kfree(km, tseq);
|
||||||
|
return ret;
|
||||||
|
}
|
||||||
|
|
||||||
|
static inline mm_reg1_t *mm_insert_reg(const mm_reg1_t *r, int i, int *n_regs, mm_reg1_t *regs)
|
||||||
|
{
|
||||||
|
regs = (mm_reg1_t*)realloc(regs, (*n_regs + 1) * sizeof(mm_reg1_t));
|
||||||
|
if (i + 1 != *n_regs)
|
||||||
|
memmove(®s[i + 2], ®s[i + 1], sizeof(mm_reg1_t) * (*n_regs - i - 1));
|
||||||
|
regs[i + 1] = *r;
|
||||||
|
++*n_regs;
|
||||||
|
return regs;
|
||||||
|
}
|
||||||
|
|
||||||
mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a)
|
mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a)
|
||||||
{
|
{
|
||||||
extern unsigned char seq_nt4_table[256];
|
extern unsigned char seq_nt4_table[256];
|
||||||
int32_t i, r, n_regs = *n_regs_;
|
int32_t i, n_regs = *n_regs_, n_a;
|
||||||
uint8_t *qseq0[2];
|
uint8_t *qseq0[2];
|
||||||
ksw_extz_t ez;
|
ksw_extz_t ez;
|
||||||
|
|
||||||
// encode the query sequence
|
// encode the query sequence
|
||||||
qseq0[0] = (uint8_t*)kmalloc(km, qlen);
|
qseq0[0] = (uint8_t*)kmalloc(km, qlen * 2);
|
||||||
qseq0[1] = (uint8_t*)kmalloc(km, qlen);
|
qseq0[1] = qseq0[0] + qlen;
|
||||||
for (i = 0; i < qlen; ++i) {
|
for (i = 0; i < qlen; ++i) {
|
||||||
qseq0[0][i] = seq_nt4_table[(uint8_t)qstr[i]];
|
qseq0[0][i] = seq_nt4_table[(uint8_t)qstr[i]];
|
||||||
qseq0[1][qlen - 1 - i] = qseq0[0][i] < 4? 3 - qseq0[0][i] : 4;
|
qseq0[1][qlen - 1 - i] = qseq0[0][i] < 4? 3 - qseq0[0][i] : 4;
|
||||||
}
|
}
|
||||||
|
|
||||||
// align through seed hits
|
// align through seed hits
|
||||||
|
n_a = mm_squeeze_a(km, n_regs, regs, a);
|
||||||
memset(&ez, 0, sizeof(ksw_extz_t));
|
memset(&ez, 0, sizeof(ksw_extz_t));
|
||||||
for (r = 0; r < n_regs; ++r) {
|
for (i = 0; i < n_regs; ++i) {
|
||||||
mm_reg1_t r2;
|
mm_reg1_t r2;
|
||||||
mm_align1(km, opt, mi, qlen, qseq0, ®s[r], &r2, a, &ez);
|
if ((opt->flag&MM_F_SPLICE) && (opt->flag&MM_F_SPLICE_FOR) && (opt->flag&MM_F_SPLICE_REV)) { // then do two rounds of alignments for both strands
|
||||||
if (r2.cnt > 0) {
|
mm_reg1_t s[2], s2[2];
|
||||||
regs = (mm_reg1_t*)realloc(regs, (n_regs + 1) * sizeof(mm_reg1_t)); // this should be very rare
|
int which, trans_strand;
|
||||||
if (r + 1 != n_regs)
|
s[0] = s[1] = regs[i];
|
||||||
memmove(®s[r + 2], ®s[r + 1], sizeof(mm_reg1_t) * (n_regs - r - 1));
|
mm_align1(km, opt, mi, qlen, qseq0, &s[0], &s2[0], n_a, a, &ez, MM_F_SPLICE_FOR);
|
||||||
regs[r + 1] = r2;
|
mm_align1(km, opt, mi, qlen, qseq0, &s[1], &s2[1], n_a, a, &ez, MM_F_SPLICE_REV);
|
||||||
++n_regs;
|
if (s[0].p->dp_score > s[1].p->dp_score) which = 0, trans_strand = 1;
|
||||||
|
else if (s[0].p->dp_score < s[1].p->dp_score) which = 1, trans_strand = 2;
|
||||||
|
else trans_strand = 3, which = (qlen + s[0].p->dp_score) & 1; // randomly choose a strand, effectively
|
||||||
|
if (which == 0) {
|
||||||
|
regs[i] = s[0], r2 = s2[0];
|
||||||
|
free(s[1].p);
|
||||||
|
} else {
|
||||||
|
regs[i] = s[1], r2 = s2[1];
|
||||||
|
free(s[0].p);
|
||||||
|
}
|
||||||
|
regs[i].p->trans_strand = trans_strand;
|
||||||
|
} else { // one round of alignment
|
||||||
|
mm_align1(km, opt, mi, qlen, qseq0, ®s[i], &r2, n_a, a, &ez, opt->flag);
|
||||||
|
if (opt->flag&MM_F_SPLICE)
|
||||||
|
regs[i].p->trans_strand = opt->flag&MM_F_SPLICE_FOR? 1 : 2;
|
||||||
|
}
|
||||||
|
if (r2.cnt > 0) regs = mm_insert_reg(&r2, i, &n_regs, regs);
|
||||||
|
if (!(opt->flag&MM_F_SPLICE) && !(opt->flag&MM_F_SR) && i > 0) { // don't try inversion alignment for -xsplice or -xsr
|
||||||
|
if (mm_align1_inv(km, opt, mi, qlen, qseq0, ®s[i-1], ®s[i], &r2, &ez)) {
|
||||||
|
regs = mm_insert_reg(&r2, i, &n_regs, regs);
|
||||||
|
++i; // skip the inserted INV alignment
|
||||||
|
}
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
*n_regs_ = n_regs;
|
*n_regs_ = n_regs;
|
||||||
kfree(km, qseq0[0]); kfree(km, qseq0[1]);
|
kfree(km, qseq0[0]);
|
||||||
kfree(km, ez.cigar);
|
kfree(km, ez.cigar);
|
||||||
mm_filter_regs(km, opt, n_regs_, regs);
|
mm_filter_regs(km, opt, n_regs_, regs);
|
||||||
mm_hit_sort_by_dp(km, n_regs_, regs);
|
mm_hit_sort_by_dp(km, n_regs_, regs);
|
||||||
|
|||||||
@@ -1,16 +1,37 @@
|
|||||||
#include <zlib.h>
|
#include <zlib.h>
|
||||||
#include <stdio.h>
|
#include <stdio.h>
|
||||||
#include <stdlib.h>
|
#include <stdlib.h>
|
||||||
#include <string.h>
|
|
||||||
#include <assert.h>
|
#include <assert.h>
|
||||||
#include "bseq.h"
|
#include "bseq.h"
|
||||||
|
#include "kvec.h"
|
||||||
#include "kseq.h"
|
#include "kseq.h"
|
||||||
KSEQ_INIT(gzFile, gzread)
|
KSEQ_INIT2(, gzFile, gzread)
|
||||||
|
|
||||||
|
unsigned char seq_comp_table[256] = {
|
||||||
|
0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
|
||||||
|
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,
|
||||||
|
32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47,
|
||||||
|
48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63,
|
||||||
|
64, 'T', 'V', 'G', 'H', 'E', 'F', 'C', 'D', 'I', 'J', 'M', 'L', 'K', 'N', 'O',
|
||||||
|
'P', 'Q', 'Y', 'S', 'A', 'A', 'B', 'W', 'X', 'R', 'Z', 91, 92, 93, 94, 95,
|
||||||
|
64, 't', 'v', 'g', 'h', 'e', 'f', 'c', 'd', 'i', 'j', 'm', 'l', 'k', 'n', 'o',
|
||||||
|
'p', 'q', 'y', 's', 'a', 'a', 'b', 'w', 'x', 'r', 'z', 123, 124, 125, 126, 127,
|
||||||
|
128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143,
|
||||||
|
144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159,
|
||||||
|
160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175,
|
||||||
|
176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191,
|
||||||
|
192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207,
|
||||||
|
208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223,
|
||||||
|
224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239,
|
||||||
|
240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255
|
||||||
|
};
|
||||||
|
|
||||||
|
#define CHECK_PAIR_THRES 1000000
|
||||||
|
|
||||||
struct mm_bseq_file_s {
|
struct mm_bseq_file_s {
|
||||||
int is_eof;
|
|
||||||
gzFile fp;
|
gzFile fp;
|
||||||
kseq_t *ks;
|
kseq_t *ks;
|
||||||
|
mm_bseq1_t s;
|
||||||
};
|
};
|
||||||
|
|
||||||
mm_bseq_file_t *mm_bseq_open(const char *fn)
|
mm_bseq_file_t *mm_bseq_open(const char *fn)
|
||||||
@@ -32,33 +53,85 @@ void mm_bseq_close(mm_bseq_file_t *fp)
|
|||||||
free(fp);
|
free(fp);
|
||||||
}
|
}
|
||||||
|
|
||||||
mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int chunk_size, int with_qual, int *n_)
|
static inline void kseq2bseq(kseq_t *ks, mm_bseq1_t *s, int with_qual)
|
||||||
{
|
{
|
||||||
int size = 0, m, n;
|
int i;
|
||||||
mm_bseq1_t *seqs;
|
s->name = strdup(ks->name.s);
|
||||||
|
s->seq = strdup(ks->seq.s);
|
||||||
|
for (i = 0; i < ks->seq.l; ++i) // convert U to T
|
||||||
|
if (s->seq[i] == 'u' || s->seq[i] == 'U')
|
||||||
|
--s->seq[i];
|
||||||
|
s->qual = with_qual && ks->qual.l? strdup(ks->qual.s) : 0;
|
||||||
|
s->l_seq = ks->seq.l;
|
||||||
|
}
|
||||||
|
|
||||||
|
mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int frag_mode, int *n_)
|
||||||
|
{
|
||||||
|
int64_t size = 0;
|
||||||
|
kvec_t(mm_bseq1_t) a = {0,0,0};
|
||||||
kseq_t *ks = fp->ks;
|
kseq_t *ks = fp->ks;
|
||||||
m = n = 0; seqs = 0;
|
*n_ = 0;
|
||||||
|
if (fp->s.seq) {
|
||||||
|
kv_resize(mm_bseq1_t, 0, a, 256);
|
||||||
|
kv_push(mm_bseq1_t, 0, a, fp->s);
|
||||||
|
size = fp->s.l_seq;
|
||||||
|
memset(&fp->s, 0, sizeof(mm_bseq1_t));
|
||||||
|
}
|
||||||
while (kseq_read(ks) >= 0) {
|
while (kseq_read(ks) >= 0) {
|
||||||
mm_bseq1_t *s;
|
mm_bseq1_t *s;
|
||||||
assert(ks->seq.l <= INT32_MAX);
|
assert(ks->seq.l <= INT32_MAX);
|
||||||
if (n >= m) {
|
if (a.m == 0) kv_resize(mm_bseq1_t, 0, a, 256);
|
||||||
m = m? m<<1 : 256;
|
kv_pushp(mm_bseq1_t, 0, a, &s);
|
||||||
seqs = (mm_bseq1_t*)realloc(seqs, m * sizeof(mm_bseq1_t));
|
kseq2bseq(ks, s, with_qual);
|
||||||
|
size += s->l_seq;
|
||||||
|
if (size >= chunk_size) {
|
||||||
|
if (frag_mode && a.a[a.n-1].l_seq < CHECK_PAIR_THRES) {
|
||||||
|
while (kseq_read(ks) >= 0) {
|
||||||
|
kseq2bseq(ks, &fp->s, with_qual);
|
||||||
|
if (mm_qname_same(fp->s.name, a.a[a.n-1].name)) {
|
||||||
|
kv_push(mm_bseq1_t, 0, a, fp->s);
|
||||||
|
memset(&fp->s, 0, sizeof(mm_bseq1_t));
|
||||||
|
} else break;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
break;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
*n_ = a.n;
|
||||||
|
return a.a;
|
||||||
|
}
|
||||||
|
|
||||||
|
mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int chunk_size, int with_qual, int *n_)
|
||||||
|
{
|
||||||
|
return mm_bseq_read2(fp, chunk_size, with_qual, 0, n_);
|
||||||
|
}
|
||||||
|
|
||||||
|
mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int *n_)
|
||||||
|
{
|
||||||
|
int i;
|
||||||
|
int64_t size = 0;
|
||||||
|
kvec_t(mm_bseq1_t) a = {0,0,0};
|
||||||
|
*n_ = 0;
|
||||||
|
if (n_fp < 1) return 0;
|
||||||
|
while (1) {
|
||||||
|
for (i = 0; i < n_fp; ++i)
|
||||||
|
if (kseq_read(fp[i]->ks) < 0)
|
||||||
|
break;
|
||||||
|
if (i != n_fp) break; // some file reaches the end
|
||||||
|
if (a.m == 0) kv_resize(mm_bseq1_t, 0, a, 256);
|
||||||
|
for (i = 0; i < n_fp; ++i) {
|
||||||
|
mm_bseq1_t *s;
|
||||||
|
kv_pushp(mm_bseq1_t, 0, a, &s);
|
||||||
|
kseq2bseq(fp[i]->ks, s, with_qual);
|
||||||
|
size += s->l_seq;
|
||||||
}
|
}
|
||||||
s = &seqs[n];
|
|
||||||
s->name = strdup(ks->name.s);
|
|
||||||
s->seq = strdup(ks->seq.s);
|
|
||||||
s->qual = with_qual && ks->qual.l? strdup(ks->qual.s) : 0;
|
|
||||||
s->l_seq = ks->seq.l;
|
|
||||||
size += seqs[n++].l_seq;
|
|
||||||
if (size >= chunk_size) break;
|
if (size >= chunk_size) break;
|
||||||
}
|
}
|
||||||
if (size < chunk_size) fp->is_eof = 1;
|
*n_ = a.n;
|
||||||
*n_ = n;
|
return a.a;
|
||||||
return seqs;
|
|
||||||
}
|
}
|
||||||
|
|
||||||
int mm_bseq_eof(mm_bseq_file_t *fp)
|
int mm_bseq_eof(mm_bseq_file_t *fp)
|
||||||
{
|
{
|
||||||
return fp->is_eof;
|
return (ks_eof(fp->ks->f) && fp->s.seq == 0);
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -2,6 +2,7 @@
|
|||||||
#define MM_BSEQ_H
|
#define MM_BSEQ_H
|
||||||
|
|
||||||
#include <stdint.h>
|
#include <stdint.h>
|
||||||
|
#include <string.h>
|
||||||
|
|
||||||
#ifdef __cplusplus
|
#ifdef __cplusplus
|
||||||
extern "C" {
|
extern "C" {
|
||||||
@@ -17,10 +18,42 @@ typedef struct {
|
|||||||
|
|
||||||
mm_bseq_file_t *mm_bseq_open(const char *fn);
|
mm_bseq_file_t *mm_bseq_open(const char *fn);
|
||||||
void mm_bseq_close(mm_bseq_file_t *fp);
|
void mm_bseq_close(mm_bseq_file_t *fp);
|
||||||
|
mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int frag_mode, int *n_);
|
||||||
mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int chunk_size, int with_qual, int *n_);
|
mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int chunk_size, int with_qual, int *n_);
|
||||||
|
mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int *n_);
|
||||||
int mm_bseq_eof(mm_bseq_file_t *fp);
|
int mm_bseq_eof(mm_bseq_file_t *fp);
|
||||||
|
|
||||||
extern unsigned char seq_nt4_table[256];
|
extern unsigned char seq_nt4_table[256];
|
||||||
|
extern unsigned char seq_comp_table[256];
|
||||||
|
|
||||||
|
static inline int mm_qname_len(const char *s)
|
||||||
|
{
|
||||||
|
int l;
|
||||||
|
l = strlen(s);
|
||||||
|
return l >= 3 && s[l-1] >= '0' && s[l-1] <= '9' && s[l-2] == '/'? l - 2 : l;
|
||||||
|
}
|
||||||
|
|
||||||
|
static inline int mm_qname_same(const char *s1, const char *s2)
|
||||||
|
{
|
||||||
|
int l1, l2;
|
||||||
|
l1 = mm_qname_len(s1);
|
||||||
|
l2 = mm_qname_len(s2);
|
||||||
|
return (l1 == l2 && strncmp(s1, s2, l1) == 0);
|
||||||
|
}
|
||||||
|
|
||||||
|
static inline void mm_revcomp_bseq(mm_bseq1_t *s)
|
||||||
|
{
|
||||||
|
int i, t, l = s->l_seq;
|
||||||
|
for (i = 0; i < l>>1; ++i) {
|
||||||
|
t = s->seq[l - i - 1];
|
||||||
|
s->seq[l - i - 1] = seq_comp_table[(uint8_t)s->seq[i]];
|
||||||
|
s->seq[i] = seq_comp_table[t];
|
||||||
|
}
|
||||||
|
if (l&1) s->seq[l>>1] = seq_comp_table[(uint8_t)s->seq[l>>1]];
|
||||||
|
if (s->qual)
|
||||||
|
for (i = 0; i < l>>1; ++i)
|
||||||
|
t = s->qual[l - i - 1], s->qual[l - i - 1] = s->qual[i], s->qual[i] = t;
|
||||||
|
}
|
||||||
|
|
||||||
#ifdef __cplusplus
|
#ifdef __cplusplus
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -19,35 +19,52 @@ static inline int ilog2_32(uint32_t v)
|
|||||||
return (t = v>>8) ? 8 + LogTable256[t] : LogTable256[v];
|
return (t = v>>8) ? 8 + LogTable256[t] : LogTable256[v];
|
||||||
}
|
}
|
||||||
|
|
||||||
int mm_chain_dp(int max_dist, int bw, int max_skip, int min_cnt, int min_sc, int64_t n, mm128_t *a, uint64_t **_u, void *km)
|
mm128_t *mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int min_cnt, int min_sc, int is_cdna, int n_segs, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km)
|
||||||
{ // TODO: make sure this works when n has more than 32 bits
|
{ // TODO: make sure this works when n has more than 32 bits
|
||||||
int32_t st = 0, j, k, *f, *p, *t, *v, n_u, n_v;
|
int32_t k, *f, *p, *t, *v, n_u, n_v;
|
||||||
int64_t i;
|
int64_t i, j, st = 0;
|
||||||
uint64_t *u, *u2;
|
uint64_t *u, *u2, sum_qspan = 0;
|
||||||
|
float avg_qspan;
|
||||||
mm128_t *b, *w;
|
mm128_t *b, *w;
|
||||||
|
|
||||||
if (_u) *_u = 0;
|
if (_u) *_u = 0, *n_u_ = 0;
|
||||||
f = (int32_t*)kmalloc(km, n * 4);
|
f = (int32_t*)kmalloc(km, n * 4);
|
||||||
p = (int32_t*)kmalloc(km, n * 4);
|
p = (int32_t*)kmalloc(km, n * 4);
|
||||||
t = (int32_t*)kmalloc(km, n * 4);
|
t = (int32_t*)kmalloc(km, n * 4);
|
||||||
|
v = (int32_t*)kmalloc(km, n * 4);
|
||||||
memset(t, 0, n * 4);
|
memset(t, 0, n * 4);
|
||||||
|
|
||||||
|
for (i = 0; i < n; ++i) sum_qspan += a[i].y>>32&0xff;
|
||||||
|
avg_qspan = (float)sum_qspan / n;
|
||||||
|
|
||||||
// fill the score and backtrack arrays
|
// fill the score and backtrack arrays
|
||||||
for (i = 0; i < n; ++i) {
|
for (i = 0; i < n; ++i) {
|
||||||
uint64_t ri = a[i].x;
|
uint64_t ri = a[i].x;
|
||||||
|
int64_t max_j = -1;
|
||||||
int32_t qi = (int32_t)a[i].y, q_span = a[i].y>>32&0xff; // NB: only 8 bits of span is used!!!
|
int32_t qi = (int32_t)a[i].y, q_span = a[i].y>>32&0xff; // NB: only 8 bits of span is used!!!
|
||||||
int32_t max_f = -INT32_MAX, max_j = -1, n_skip = 0, min_d;
|
int32_t max_f = q_span, n_skip = 0, min_d;
|
||||||
while (st < i && ri - a[st].x > max_dist) ++st;
|
int32_t sidi = (a[i].y & MM_SEED_SEG_MASK) >> MM_SEED_SEG_SHIFT;
|
||||||
|
while (st < i && ri - a[st].x > max_dist_x) ++st;
|
||||||
for (j = i - 1; j >= st; --j) {
|
for (j = i - 1; j >= st; --j) {
|
||||||
int64_t dr = ri - a[j].x;
|
int64_t dr = ri - a[j].x;
|
||||||
int32_t dq = qi - (int32_t)a[j].y, dd, sc;
|
int32_t dq = qi - (int32_t)a[j].y, dd, sc, log_dd;
|
||||||
if (dr == 0 || dq <= 0 || dq > max_dist) continue;
|
int32_t sidj = (a[j].y & MM_SEED_SEG_MASK) >> MM_SEED_SEG_SHIFT;
|
||||||
|
if ((sidi == sidj && dr == 0) || dq <= 0) continue; // don't skip if an anchor is used by multiple segments; see below
|
||||||
|
if ((sidi == sidj && dq > max_dist_y) || dq > max_dist_x) continue;
|
||||||
dd = dr > dq? dr - dq : dq - dr;
|
dd = dr > dq? dr - dq : dq - dr;
|
||||||
if (dd > bw) continue;
|
if (sidi == sidj && dd > bw) continue;
|
||||||
|
if (n_segs > 1 && !is_cdna && sidi == sidj && dr > max_dist_y) continue;
|
||||||
min_d = dq < dr? dq : dr;
|
min_d = dq < dr? dq : dr;
|
||||||
sc = min_d > q_span? q_span : dq < dr? dq : dr;
|
sc = min_d > q_span? q_span : dq < dr? dq : dr;
|
||||||
sc -= dd? ilog2_32(dd) * 2 : 0;
|
log_dd = dd? ilog2_32(dd) : 0;
|
||||||
if (min_d > q_span) sc -= ilog2_32(min_d) / 2;
|
if (is_cdna || sidi != sidj) {
|
||||||
|
int c_log, c_lin;
|
||||||
|
c_lin = (int)(dd * .01 * avg_qspan);
|
||||||
|
c_log = log_dd;
|
||||||
|
if (sidi != sidj && dr == 0) ++sc; // possibly due to overlapping paired ends; give a minor bonus
|
||||||
|
else if (dr > dq || sidi != sidj) sc -= c_lin < c_log? c_lin : c_log;
|
||||||
|
else sc -= c_lin + (c_log>>1);
|
||||||
|
} else sc -= (int)(dd * .01 * avg_qspan) + (log_dd>>1);
|
||||||
sc += f[j];
|
sc += f[j];
|
||||||
if (sc > max_f) {
|
if (sc > max_f) {
|
||||||
max_f = sc, max_j = j;
|
max_f = sc, max_j = j;
|
||||||
@@ -58,8 +75,8 @@ int mm_chain_dp(int max_dist, int bw, int max_skip, int min_cnt, int min_sc, int
|
|||||||
}
|
}
|
||||||
if (p[j] >= 0) t[p[j]] = i;
|
if (p[j] >= 0) t[p[j]] = i;
|
||||||
}
|
}
|
||||||
if (max_j >= 0) f[i] = max_f, p[i] = max_j;
|
f[i] = max_f, p[i] = max_j;
|
||||||
else f[i] = q_span, p[i] = -1;
|
v[i] = max_j >= 0 && v[max_j] > max_f? v[max_j] : max_f; // v[] keeps the peak score up to i; f[] is the score ending at i, not always the peak
|
||||||
}
|
}
|
||||||
|
|
||||||
// find the ending positions of chains
|
// find the ending positions of chains
|
||||||
@@ -67,16 +84,21 @@ int mm_chain_dp(int max_dist, int bw, int max_skip, int min_cnt, int min_sc, int
|
|||||||
for (i = 0; i < n; ++i)
|
for (i = 0; i < n; ++i)
|
||||||
if (p[i] >= 0) t[p[i]] = 1;
|
if (p[i] >= 0) t[p[i]] = 1;
|
||||||
for (i = n_u = 0; i < n; ++i)
|
for (i = n_u = 0; i < n; ++i)
|
||||||
if (t[i] == 0 && f[i] >= min_sc)
|
if (t[i] == 0 && v[i] >= min_sc)
|
||||||
++n_u;
|
++n_u;
|
||||||
if (n_u == 0) {
|
if (n_u == 0) {
|
||||||
kfree(km, f); kfree(km, p); kfree(km, t);
|
kfree(km, a); kfree(km, f); kfree(km, p); kfree(km, t); kfree(km, v);
|
||||||
return 0;
|
return 0;
|
||||||
}
|
}
|
||||||
u = (uint64_t*)kmalloc(km, n_u * 8);
|
u = (uint64_t*)kmalloc(km, n_u * 8);
|
||||||
for (i = n_u = 0; i < n; ++i)
|
for (i = n_u = 0; i < n; ++i) {
|
||||||
if (t[i] == 0 && f[i] >= min_sc)
|
if (t[i] == 0 && v[i] >= min_sc) {
|
||||||
u[n_u++] = (uint64_t)f[i] << 32 | i;
|
j = i;
|
||||||
|
while (j >= 0 && f[j] < v[j]) j = p[j]; // find the peak that maximizes f[]
|
||||||
|
if (j < 0) j = i; // TODO: this should really be assert(j>=0)
|
||||||
|
u[n_u++] = (uint64_t)f[j] << 32 | j;
|
||||||
|
}
|
||||||
|
}
|
||||||
radix_sort_64(u, u + n_u);
|
radix_sort_64(u, u + n_u);
|
||||||
for (i = 0; i < n_u>>1; ++i) { // reverse, s.t. the highest scoring chain is the first
|
for (i = 0; i < n_u>>1; ++i) { // reverse, s.t. the highest scoring chain is the first
|
||||||
uint64_t t = u[i];
|
uint64_t t = u[i];
|
||||||
@@ -85,7 +107,6 @@ int mm_chain_dp(int max_dist, int bw, int max_skip, int min_cnt, int min_sc, int
|
|||||||
|
|
||||||
// backtrack
|
// backtrack
|
||||||
memset(t, 0, n * 4);
|
memset(t, 0, n * 4);
|
||||||
v = (int32_t*)kmalloc(km, n * 4);
|
|
||||||
for (i = n_v = k = 0; i < n_u; ++i) { // starting from the highest score
|
for (i = n_v = k = 0; i < n_u; ++i) { // starting from the highest score
|
||||||
int32_t n_v0 = n_v, k0 = k;
|
int32_t n_v0 = n_v, k0 = k;
|
||||||
j = (int32_t)u[i];
|
j = (int32_t)u[i];
|
||||||
@@ -101,9 +122,9 @@ int mm_chain_dp(int max_dist, int bw, int max_skip, int min_cnt, int min_sc, int
|
|||||||
}
|
}
|
||||||
if (k0 == k) n_v = n_v0; // no new chain added, reset
|
if (k0 == k) n_v = n_v0; // no new chain added, reset
|
||||||
}
|
}
|
||||||
n_u = k, *_u = u; // NB: note that u[] may not be sorted by score here
|
*n_u_ = n_u = k, *_u = u; // NB: note that u[] may not be sorted by score here
|
||||||
|
|
||||||
// free
|
// free temporary arrays
|
||||||
kfree(km, f); kfree(km, p); kfree(km, t);
|
kfree(km, f); kfree(km, p); kfree(km, t);
|
||||||
|
|
||||||
// write the result to b[]
|
// write the result to b[]
|
||||||
@@ -130,6 +151,7 @@ int mm_chain_dp(int max_dist, int bw, int max_skip, int min_cnt, int min_sc, int
|
|||||||
k += n;
|
k += n;
|
||||||
}
|
}
|
||||||
memcpy(u, u2, n_u * 8);
|
memcpy(u, u2, n_u * 8);
|
||||||
kfree(km, b); kfree(km, w); kfree(km, u2);
|
memcpy(b, a, k * sizeof(mm128_t)); // write _a_ to _b_ and deallocate _a_ because _a_ is oversized, sometimes a lot
|
||||||
return n_u;
|
kfree(km, a); kfree(km, w); kfree(km, u2);
|
||||||
|
return b;
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -0,0 +1,64 @@
|
|||||||
|
#include <math.h>
|
||||||
|
#include <stdio.h>
|
||||||
|
#include <stdlib.h>
|
||||||
|
#include <assert.h>
|
||||||
|
#include "mmpriv.h"
|
||||||
|
|
||||||
|
static inline int32_t get_for_qpos(int32_t qlen, const mm128_t *a)
|
||||||
|
{
|
||||||
|
int32_t x = (int32_t)a->y;
|
||||||
|
int32_t q_span = a->y>>32 & 0xff;
|
||||||
|
if (a->x>>63)
|
||||||
|
x = qlen - 1 - (x + 1 - q_span); // revert the position to the forward strand of query
|
||||||
|
return x;
|
||||||
|
}
|
||||||
|
|
||||||
|
static int get_mini_idx(int qlen, const mm128_t *a, int32_t n, const uint64_t *mini_pos)
|
||||||
|
{
|
||||||
|
int32_t x, L = 0, R = n - 1;
|
||||||
|
x = get_for_qpos(qlen, a);
|
||||||
|
while (L <= R) { // binary search
|
||||||
|
int32_t m = ((uint64_t)L + R) >> 1;
|
||||||
|
int32_t y = (int32_t)mini_pos[m];
|
||||||
|
if (y < x) L = m + 1;
|
||||||
|
else if (y > x) R = m - 1;
|
||||||
|
else return m;
|
||||||
|
}
|
||||||
|
return -1;
|
||||||
|
}
|
||||||
|
|
||||||
|
void mm_est_err(const mm_idx_t *mi, int qlen, int n_regs, mm_reg1_t *regs, const mm128_t *a, int32_t n, const uint64_t *mini_pos)
|
||||||
|
{
|
||||||
|
int i;
|
||||||
|
uint64_t sum_k = 0;
|
||||||
|
float avg_k;
|
||||||
|
|
||||||
|
if (n == 0) return;
|
||||||
|
for (i = 0; i < n; ++i)
|
||||||
|
sum_k += mini_pos[i] >> 32 & 0xff;
|
||||||
|
avg_k = (float)sum_k / n;
|
||||||
|
|
||||||
|
for (i = 0; i < n_regs; ++i) {
|
||||||
|
mm_reg1_t *r = ®s[i];
|
||||||
|
int32_t st, en, j, k, n_match, n_tot, l_ref;
|
||||||
|
r->div = -1.0f;
|
||||||
|
if (r->cnt == 0) continue;
|
||||||
|
st = en = get_mini_idx(qlen, r->rev? &a[r->as + r->cnt - 1] : &a[r->as], n, mini_pos);
|
||||||
|
if (st < 0) {
|
||||||
|
if (mm_verbose >= 2)
|
||||||
|
fprintf(stderr, "[WARNING] logic inconsistency in mm_est_err(). Please contact the developer.\n");
|
||||||
|
continue;
|
||||||
|
}
|
||||||
|
l_ref = mi->seq[r->rid].len;
|
||||||
|
for (k = 1, j = st + 1, n_match = 1; j < n && k < r->cnt; ++j) {
|
||||||
|
int32_t x;
|
||||||
|
x = get_for_qpos(qlen, r->rev? &a[r->as + r->cnt - 1 - k] : &a[r->as + k]);
|
||||||
|
if (x == (int32_t)mini_pos[j])
|
||||||
|
++k, en = j, ++n_match;
|
||||||
|
}
|
||||||
|
n_tot = en - st + 1;
|
||||||
|
if (r->qs > avg_k && r->rs > avg_k) ++n_tot;
|
||||||
|
if (qlen - r->qs > avg_k && l_ref - r->re > avg_k) ++n_tot;
|
||||||
|
r->div = logf((float)n_tot / n_match) / avg_k;
|
||||||
|
}
|
||||||
|
}
|
||||||
@@ -11,7 +11,13 @@ KSEQ_INIT(gzFile, gzread)
|
|||||||
|
|
||||||
int main(int argc, char *argv[])
|
int main(int argc, char *argv[])
|
||||||
{
|
{
|
||||||
|
mm_idxopt_t iopt;
|
||||||
|
mm_mapopt_t mopt;
|
||||||
|
int n_threads = 3;
|
||||||
|
|
||||||
mm_verbose = 2; // disable message output to stderr
|
mm_verbose = 2; // disable message output to stderr
|
||||||
|
mm_set_opt(0, &iopt, &mopt);
|
||||||
|
mopt.flag |= MM_F_CIGAR; // perform alignment
|
||||||
|
|
||||||
if (argc < 3) {
|
if (argc < 3) {
|
||||||
fprintf(stderr, "Usage: minimap2-lite <target.fa> <query.fa>\n");
|
fprintf(stderr, "Usage: minimap2-lite <target.fa> <query.fa>\n");
|
||||||
@@ -23,39 +29,33 @@ int main(int argc, char *argv[])
|
|||||||
assert(f);
|
assert(f);
|
||||||
kseq_t *ks = kseq_init(f);
|
kseq_t *ks = kseq_init(f);
|
||||||
|
|
||||||
// create index for target; we are creating one index for all target sequence
|
// open index reader
|
||||||
int n_threads = 4, w = 10, k = 15, is_hpc = 0;
|
mm_idx_reader_t *r = mm_idx_reader_open(argv[1], &iopt, 0);
|
||||||
mm_idx_t *mi = mm_idx_build(argv[1], w, k, is_hpc, n_threads);
|
mm_idx_t *mi;
|
||||||
assert(mi);
|
while ((mi = mm_idx_reader_read(r, n_threads)) != 0) { // traverse each part of the index
|
||||||
|
mm_mapopt_update(&mopt, mi); // this sets the maximum minimizer occurrence; TODO: set a better default in mm_mapopt_init()!
|
||||||
// mapping
|
|
||||||
mm_mapopt_t opt;
|
|
||||||
mm_mapopt_init(&opt); // initialize mapping parameters
|
|
||||||
mm_mapopt_update(&opt, mi); // this sets the maximum minimizer occurrence; TODO: set a better default in mm_mapopt_init()!
|
|
||||||
opt.flag |= MM_F_CIGAR; // perform alignment
|
|
||||||
mm_tbuf_t *tbuf = mm_tbuf_init(); // thread buffer; for multi-threading, allocate one tbuf for each thread
|
mm_tbuf_t *tbuf = mm_tbuf_init(); // thread buffer; for multi-threading, allocate one tbuf for each thread
|
||||||
while (kseq_read(ks) >= 0) { // each kseq_read() call reads one query sequence
|
while (kseq_read(ks) >= 0) { // each kseq_read() call reads one query sequence
|
||||||
const mm_reg1_t *reg;
|
mm_reg1_t *reg;
|
||||||
int j, i, n_reg;
|
int j, i, n_reg;
|
||||||
// get all hits for the query
|
reg = mm_map(mi, ks->seq.l, ks->seq.s, &n_reg, tbuf, &mopt, 0); // get all hits for the query
|
||||||
reg = mm_map(mi, ks->seq.l, ks->seq.s, &n_reg, tbuf, &opt, 0);
|
for (j = 0; j < n_reg; ++j) { // traverse hits and print them out
|
||||||
// traverse hits and print them out
|
mm_reg1_t *r = ®[j];
|
||||||
for (j = 0; j < n_reg; ++j) {
|
|
||||||
const mm_reg1_t *r = ®[j];
|
|
||||||
assert(r->p); // with MM_F_CIGAR, this should not be NULL
|
assert(r->p); // with MM_F_CIGAR, this should not be NULL
|
||||||
printf("%s\t%d\t%d\t%d\t%c\t", ks->name.s, ks->seq.l, r->qs, r->qe, "+-"[r->rev]);
|
printf("%s\t%d\t%d\t%d\t%c\t", ks->name.s, ks->seq.l, r->qs, r->qe, "+-"[r->rev]);
|
||||||
printf("%s\t%d\t%d\t%d\t%d\t%d\t%d\tcg:Z:", mi->seq[r->rid].name, mi->seq[r->rid].len, r->rs, r->re,
|
printf("%s\t%d\t%d\t%d\t%d\t%d\t%d\tcg:Z:", mi->seq[r->rid].name, mi->seq[r->rid].len, r->rs, r->re, r->mlen, r->blen, r->mapq);
|
||||||
r->p->blen - r->p->n_ambi - r->p->n_diff, r->p->blen, r->mapq);
|
|
||||||
for (i = 0; i < r->p->n_cigar; ++i) // IMPORTANT: this gives the CIGAR in the aligned regions. NO soft/hard clippings!
|
for (i = 0; i < r->p->n_cigar; ++i) // IMPORTANT: this gives the CIGAR in the aligned regions. NO soft/hard clippings!
|
||||||
printf("%d%c", r->p->cigar[i]>>4, "MIDSHN"[r->p->cigar[i]&0xf]);
|
printf("%d%c", r->p->cigar[i]>>4, "MIDSHN"[r->p->cigar[i]&0xf]);
|
||||||
putchar('\n');
|
putchar('\n');
|
||||||
|
free(r->p);
|
||||||
}
|
}
|
||||||
|
free(reg);
|
||||||
}
|
}
|
||||||
mm_tbuf_destroy(tbuf);
|
mm_tbuf_destroy(tbuf);
|
||||||
|
|
||||||
// deallocate index and close the query file
|
|
||||||
mm_idx_destroy(mi);
|
mm_idx_destroy(mi);
|
||||||
kseq_destroy(ks);
|
}
|
||||||
|
mm_idx_reader_close(r); // close the index reader
|
||||||
|
kseq_destroy(ks); // close the query file
|
||||||
gzclose(f);
|
gzclose(f);
|
||||||
return 0;
|
return 0;
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -1,9 +1,13 @@
|
|||||||
#include <stdarg.h>
|
#include <stdarg.h>
|
||||||
#include <stdlib.h>
|
#include <stdlib.h>
|
||||||
#include <string.h>
|
#include <string.h>
|
||||||
|
#include <assert.h>
|
||||||
#include <stdio.h>
|
#include <stdio.h>
|
||||||
|
#include "kalloc.h"
|
||||||
#include "mmpriv.h"
|
#include "mmpriv.h"
|
||||||
|
|
||||||
|
static char mm_rg_id[256];
|
||||||
|
|
||||||
static inline void str_enlarge(kstring_t *s, int l)
|
static inline void str_enlarge(kstring_t *s, int l)
|
||||||
{
|
{
|
||||||
if (s->l + l + 1 > s->m) {
|
if (s->l + l + 1 > s->m) {
|
||||||
@@ -39,6 +43,13 @@ static void mm_sprintf_lite(kstring_t *s, const char *fmt, ...)
|
|||||||
if (c < 0) buf[l++] = '-';
|
if (c < 0) buf[l++] = '-';
|
||||||
str_enlarge(s, l);
|
str_enlarge(s, l);
|
||||||
for (i = l - 1; i >= 0; --i) s->s[s->l++] = buf[i];
|
for (i = l - 1; i >= 0; --i) s->s[s->l++] = buf[i];
|
||||||
|
} else if (*p == 'u') {
|
||||||
|
int i, l = 0;
|
||||||
|
uint32_t x;
|
||||||
|
x = va_arg(ap, uint32_t);
|
||||||
|
do { buf[l++] = x%10 + '0'; x /= 10; } while (x > 0);
|
||||||
|
str_enlarge(s, l);
|
||||||
|
for (i = l - 1; i >= 0; --i) s->s[s->l++] = buf[i];
|
||||||
} else if (*p == 's') {
|
} else if (*p == 's') {
|
||||||
char *r = va_arg(ap, char*);
|
char *r = va_arg(ap, char*);
|
||||||
str_copy(s, r, r + strlen(r));
|
str_copy(s, r, r + strlen(r));
|
||||||
@@ -54,83 +65,331 @@ static void mm_sprintf_lite(kstring_t *s, const char *fmt, ...)
|
|||||||
s->s[s->l] = 0;
|
s->s[s->l] = 0;
|
||||||
}
|
}
|
||||||
|
|
||||||
static inline void write_tags(kstring_t *s, const mm_reg1_t *r)
|
static char *mm_escape(char *s)
|
||||||
{
|
{
|
||||||
mm_sprintf_lite(s, "\tcm:i:%d\ts1:i:%d", r->cnt, r->score);
|
char *p, *q;
|
||||||
if (r->parent == r->id) mm_sprintf_lite(s, "\ts2:i:%d", r->subsc);
|
for (p = q = s; *p; ++p) {
|
||||||
if (r->split) mm_sprintf_lite(s, "\tzd:i:%d", r->split);
|
if (*p == '\\') {
|
||||||
if (r->p) mm_sprintf_lite(s, "\tNM:i:%d\tms:i:%d\tAS:i:%d\tnn:i:%d", r->p->n_diff, r->p->dp_max, r->p->dp_score, r->p->n_ambi);
|
++p;
|
||||||
|
if (*p == 't') *q++ = '\t';
|
||||||
|
else if (*p == '\\') *q++ = '\\';
|
||||||
|
} else *q++ = *p;
|
||||||
|
}
|
||||||
|
*q = '\0';
|
||||||
|
return s;
|
||||||
}
|
}
|
||||||
|
|
||||||
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r)
|
static void sam_write_rg_line(kstring_t *str, const char *s)
|
||||||
|
{
|
||||||
|
char *p, *q, *r, *rg_line = 0;
|
||||||
|
memset(mm_rg_id, 0, 256);
|
||||||
|
if (s == 0) return;
|
||||||
|
if (strstr(s, "@RG") != s) {
|
||||||
|
if (mm_verbose >= 1) fprintf(stderr, "[ERROR] the read group line is not started with @RG\n");
|
||||||
|
goto err_set_rg;
|
||||||
|
}
|
||||||
|
if (strstr(s, "\t") != NULL) {
|
||||||
|
if (mm_verbose >= 1) fprintf(stderr, "[ERROR] the read group line contained literal <tab> characters -- replace with escaped tabs: \\t\n");
|
||||||
|
goto err_set_rg;
|
||||||
|
}
|
||||||
|
rg_line = strdup(s);
|
||||||
|
mm_escape(rg_line);
|
||||||
|
if ((p = strstr(rg_line, "\tID:")) == 0) {
|
||||||
|
if (mm_verbose >= 1) fprintf(stderr, "[ERROR] no ID within the read group line\n");
|
||||||
|
goto err_set_rg;
|
||||||
|
}
|
||||||
|
p += 4;
|
||||||
|
for (q = p; *q && *q != '\t' && *q != '\n'; ++q);
|
||||||
|
if (q - p + 1 > 256) {
|
||||||
|
if (mm_verbose >= 1) fprintf(stderr, "[ERROR] @RG:ID is longer than 255 characters\n");
|
||||||
|
goto err_set_rg;
|
||||||
|
}
|
||||||
|
for (q = p, r = mm_rg_id; *q && *q != '\t' && *q != '\n'; ++q)
|
||||||
|
*r++ = *q;
|
||||||
|
mm_sprintf_lite(str, "%s\n", rg_line);
|
||||||
|
|
||||||
|
err_set_rg:
|
||||||
|
free(rg_line);
|
||||||
|
}
|
||||||
|
|
||||||
|
void mm_write_sam_hdr(const mm_idx_t *idx, const char *rg, const char *ver, int argc, char *argv[])
|
||||||
|
{
|
||||||
|
kstring_t str = {0,0,0};
|
||||||
|
if (idx) {
|
||||||
|
uint32_t i;
|
||||||
|
for (i = 0; i < idx->n_seq; ++i)
|
||||||
|
printf("@SQ\tSN:%s\tLN:%d\n", idx->seq[i].name, idx->seq[i].len);
|
||||||
|
}
|
||||||
|
if (rg) sam_write_rg_line(&str, rg);
|
||||||
|
mm_sprintf_lite(&str, "@PG\tID:minimap2\tPN:minimap2");
|
||||||
|
if (ver) mm_sprintf_lite(&str, "\tVN:%s", ver);
|
||||||
|
if (argc > 1) {
|
||||||
|
int i;
|
||||||
|
mm_sprintf_lite(&str, "\tCL:minimap2");
|
||||||
|
for (i = 1; i < argc; ++i)
|
||||||
|
mm_sprintf_lite(&str, " %s", argv[i]);
|
||||||
|
}
|
||||||
|
mm_sprintf_lite(&str, "\n");
|
||||||
|
fputs(str.s, stdout);
|
||||||
|
free(str.s);
|
||||||
|
}
|
||||||
|
|
||||||
|
static void write_cs(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int no_iden)
|
||||||
|
{
|
||||||
|
extern unsigned char seq_nt4_table[256];
|
||||||
|
int i, q_off, t_off;
|
||||||
|
uint8_t *qseq, *tseq;
|
||||||
|
char *tmp;
|
||||||
|
if (r->p == 0) return;
|
||||||
|
mm_sprintf_lite(s, "\tcs:Z:");
|
||||||
|
qseq = (uint8_t*)kmalloc(km, r->qe - r->qs);
|
||||||
|
tseq = (uint8_t*)kmalloc(km, r->re - r->rs);
|
||||||
|
tmp = (char*)kmalloc(km, r->re - r->rs > r->qe - r->qs? r->re - r->rs + 1 : r->qe - r->qs + 1);
|
||||||
|
mm_idx_getseq(mi, r->rid, r->rs, r->re, tseq);
|
||||||
|
if (!r->rev) {
|
||||||
|
for (i = r->qs; i < r->qe; ++i)
|
||||||
|
qseq[i - r->qs] = seq_nt4_table[(uint8_t)t->seq[i]];
|
||||||
|
} else {
|
||||||
|
for (i = r->qs; i < r->qe; ++i) {
|
||||||
|
uint8_t c = seq_nt4_table[(uint8_t)t->seq[i]];
|
||||||
|
qseq[r->qe - i - 1] = c >= 4? 4 : 3 - c;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
for (i = q_off = t_off = 0; i < r->p->n_cigar; ++i) {
|
||||||
|
int j, op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
|
||||||
|
assert(op >= 0 && op <= 3);
|
||||||
|
if (op == 0) {
|
||||||
|
int l_tmp = 0;
|
||||||
|
for (j = 0; j < len; ++j) {
|
||||||
|
if (qseq[q_off + j] != tseq[t_off + j]) {
|
||||||
|
if (l_tmp > 0) {
|
||||||
|
if (!no_iden) {
|
||||||
|
tmp[l_tmp] = 0;
|
||||||
|
mm_sprintf_lite(s, "=%s", tmp);
|
||||||
|
} else mm_sprintf_lite(s, ":%d", l_tmp);
|
||||||
|
l_tmp = 0;
|
||||||
|
}
|
||||||
|
mm_sprintf_lite(s, "*%c%c", "acgtn"[tseq[t_off + j]], "acgtn"[qseq[q_off + j]]);
|
||||||
|
} else tmp[l_tmp++] = "ACGTN"[qseq[q_off + j]];
|
||||||
|
}
|
||||||
|
if (l_tmp > 0) {
|
||||||
|
if (!no_iden) {
|
||||||
|
tmp[l_tmp] = 0;
|
||||||
|
mm_sprintf_lite(s, "=%s", tmp);
|
||||||
|
} else mm_sprintf_lite(s, ":%d", l_tmp);
|
||||||
|
}
|
||||||
|
q_off += len, t_off += len;
|
||||||
|
} else if (op == 1) {
|
||||||
|
for (j = 0, tmp[len] = 0; j < len; ++j)
|
||||||
|
tmp[j] = "acgtn"[qseq[q_off + j]];
|
||||||
|
mm_sprintf_lite(s, "+%s", tmp);
|
||||||
|
q_off += len;
|
||||||
|
} else if (op == 2) {
|
||||||
|
for (j = 0, tmp[len] = 0; j < len; ++j)
|
||||||
|
tmp[j] = "acgtn"[tseq[t_off + j]];
|
||||||
|
mm_sprintf_lite(s, "-%s", tmp);
|
||||||
|
t_off += len;
|
||||||
|
} else {
|
||||||
|
assert(len >= 2);
|
||||||
|
mm_sprintf_lite(s, "~%c%c%d%c%c", "acgtn"[tseq[t_off]], "acgtn"[tseq[t_off+1]],
|
||||||
|
len, "acgtn"[tseq[t_off+len-2]], "acgtn"[tseq[t_off+len-1]]);
|
||||||
|
t_off += len;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
assert(t_off == r->re - r->rs && q_off == r->qe - r->qs);
|
||||||
|
kfree(km, qseq); kfree(km, tseq); kfree(km, tmp);
|
||||||
|
}
|
||||||
|
|
||||||
|
static inline void write_tags(kstring_t *s, const mm_reg1_t *r)
|
||||||
|
{
|
||||||
|
int type;
|
||||||
|
if (r->id == r->parent) type = r->inv? 'I' : 'P';
|
||||||
|
else type = r->inv? 'i' : 'S';
|
||||||
|
if (r->p) {
|
||||||
|
mm_sprintf_lite(s, "\tNM:i:%d\tms:i:%d\tAS:i:%d\tnn:i:%d", r->blen - r->mlen + r->p->n_ambi, r->p->dp_max, r->p->dp_score, r->p->n_ambi);
|
||||||
|
if (r->p->trans_strand == 1 || r->p->trans_strand == 2)
|
||||||
|
mm_sprintf_lite(s, "\tts:A:%c", "?+-?"[r->p->trans_strand]);
|
||||||
|
}
|
||||||
|
mm_sprintf_lite(s, "\ttp:A:%c\tcm:i:%d\ts1:i:%d", type, r->cnt, r->score);
|
||||||
|
if (r->parent == r->id) mm_sprintf_lite(s, "\ts2:i:%d", r->subsc);
|
||||||
|
if (r->div >= 0.0f && r->div <= 1.0f) {
|
||||||
|
char buf[8];
|
||||||
|
if (r->div == 0.0f) buf[0] = '0', buf[1] = 0;
|
||||||
|
else sprintf(buf, "%.4f", r->div);
|
||||||
|
mm_sprintf_lite(s, "\tdv:f:%s", buf);
|
||||||
|
}
|
||||||
|
if (r->split) mm_sprintf_lite(s, "\tzd:i:%d", r->split);
|
||||||
|
}
|
||||||
|
|
||||||
|
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int opt_flag)
|
||||||
{
|
{
|
||||||
s->l = 0;
|
s->l = 0;
|
||||||
mm_sprintf_lite(s, "%s\t%d\t%d\t%d\t%c\t", t->name, t->l_seq, r->qs, r->qe, "+-"[r->rev]);
|
mm_sprintf_lite(s, "%s\t%d\t%d\t%d\t%c\t", t->name, t->l_seq, r->qs, r->qe, "+-"[r->rev]);
|
||||||
if (mi->seq[r->rid].name) mm_sprintf_lite(s, "%s", mi->seq[r->rid].name);
|
if (mi->seq[r->rid].name) mm_sprintf_lite(s, "%s", mi->seq[r->rid].name);
|
||||||
else mm_sprintf_lite(s, "%d", r->rid);
|
else mm_sprintf_lite(s, "%d", r->rid);
|
||||||
mm_sprintf_lite(s, "\t%d\t%d\t%d", mi->seq[r->rid].len, r->rs, r->re);
|
mm_sprintf_lite(s, "\t%d\t%d\t%d", mi->seq[r->rid].len, r->rs, r->re);
|
||||||
if (r->p) mm_sprintf_lite(s, "\t%d\t%d", r->p->blen - r->p->n_ambi - r->p->n_diff, r->p->blen);
|
mm_sprintf_lite(s, "\t%d\t%d", r->mlen, r->blen);
|
||||||
else mm_sprintf_lite(s, "\t%d\t%d", r->fuzzy_mlen, r->fuzzy_blen);
|
|
||||||
mm_sprintf_lite(s, "\t%d", r->mapq);
|
mm_sprintf_lite(s, "\t%d", r->mapq);
|
||||||
write_tags(s, r);
|
write_tags(s, r);
|
||||||
if (r->p) {
|
if (r->p && (opt_flag & MM_F_OUT_CG)) {
|
||||||
uint32_t k;
|
uint32_t k;
|
||||||
mm_sprintf_lite(s, "\tcg:Z:");
|
mm_sprintf_lite(s, "\tcg:Z:");
|
||||||
for (k = 0; k < r->p->n_cigar; ++k)
|
for (k = 0; k < r->p->n_cigar; ++k)
|
||||||
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MID"[r->p->cigar[k]&0xf]);
|
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDN"[r->p->cigar[k]&0xf]);
|
||||||
}
|
}
|
||||||
|
if (r->p && (opt_flag & MM_F_OUT_CS))
|
||||||
|
write_cs(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG));
|
||||||
}
|
}
|
||||||
|
|
||||||
static char comp_tab[] = {
|
|
||||||
0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
|
|
||||||
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,
|
|
||||||
32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47,
|
|
||||||
48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63,
|
|
||||||
64, 'T', 'V', 'G', 'H', 'E', 'F', 'C', 'D', 'I', 'J', 'M', 'L', 'K', 'N', 'O',
|
|
||||||
'P', 'Q', 'Y', 'S', 'A', 'A', 'B', 'W', 'X', 'R', 'Z', 91, 92, 93, 94, 95,
|
|
||||||
64, 't', 'v', 'g', 'h', 'e', 'f', 'c', 'd', 'i', 'j', 'm', 'l', 'k', 'n', 'o',
|
|
||||||
'p', 'q', 'y', 's', 'a', 'a', 'b', 'w', 'x', 'r', 'z', 123, 124, 125, 126, 127
|
|
||||||
};
|
|
||||||
|
|
||||||
static void sam_write_sq(kstring_t *s, char *seq, int l, int rev, int comp)
|
static void sam_write_sq(kstring_t *s, char *seq, int l, int rev, int comp)
|
||||||
{
|
{
|
||||||
|
extern unsigned char seq_comp_table[256];
|
||||||
if (rev) {
|
if (rev) {
|
||||||
int i;
|
int i;
|
||||||
str_enlarge(s, l);
|
str_enlarge(s, l);
|
||||||
for (i = 0; i < l; ++i) {
|
for (i = 0; i < l; ++i) {
|
||||||
int c = seq[l - 1 - i];
|
int c = seq[l - 1 - i];
|
||||||
s->s[s->l + i] = c < 128 && comp? comp_tab[c] : c;
|
s->s[s->l + i] = c < 128 && comp? seq_comp_table[c] : c;
|
||||||
}
|
}
|
||||||
s->l += l;
|
s->l += l;
|
||||||
} else str_copy(s, seq, seq + l);
|
} else str_copy(s, seq, seq + l);
|
||||||
}
|
}
|
||||||
|
|
||||||
void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r)
|
static inline const mm_reg1_t *get_sam_pri(int n_regs, const mm_reg1_t *regs)
|
||||||
{
|
{
|
||||||
int flag = 0;
|
int i;
|
||||||
|
for (i = 0; i < n_regs; ++i)
|
||||||
|
if (regs[i].sam_pri)
|
||||||
|
return ®s[i];
|
||||||
|
assert(n_regs == 0);
|
||||||
|
return NULL;
|
||||||
|
}
|
||||||
|
|
||||||
|
static void write_sam_cigar(kstring_t *s, int sam_flag, int in_tag, int qlen, const mm_reg1_t *r, int opt_flag)
|
||||||
|
{
|
||||||
|
if (r->p == 0) {
|
||||||
|
mm_sprintf_lite(s, "*");
|
||||||
|
} else {
|
||||||
|
uint32_t k, clip_len[2];
|
||||||
|
clip_len[0] = r->rev? qlen - r->qe : r->qs;
|
||||||
|
clip_len[1] = r->rev? r->qs : qlen - r->qe;
|
||||||
|
if (in_tag) {
|
||||||
|
int clip_char = (sam_flag&0x800) && !(opt_flag&MM_F_SOFTCLIP)? 5 : 4;
|
||||||
|
mm_sprintf_lite(s, "\tCG:B:I");
|
||||||
|
if (clip_len[0]) mm_sprintf_lite(s, ",%u", clip_len[0]<<4|clip_char);
|
||||||
|
for (k = 0; k < r->p->n_cigar; ++k)
|
||||||
|
mm_sprintf_lite(s, ",%u", r->p->cigar[k]);
|
||||||
|
if (clip_len[1]) mm_sprintf_lite(s, ",%u", clip_len[1]<<4|clip_char);
|
||||||
|
} else {
|
||||||
|
int clip_char = (sam_flag&0x800) && !(opt_flag&MM_F_SOFTCLIP)? 'H' : 'S';
|
||||||
|
if (clip_len[0]) mm_sprintf_lite(s, "%d%c", clip_len[0], clip_char);
|
||||||
|
for (k = 0; k < r->p->n_cigar; ++k)
|
||||||
|
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDN"[r->p->cigar[k]&0xf]);
|
||||||
|
if (clip_len[1]) mm_sprintf_lite(s, "%d%c", clip_len[1], clip_char);
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regss, const mm_reg1_t *const* regss, void *km, int opt_flag)
|
||||||
|
{
|
||||||
|
const int max_bam_cigar_op = 65535;
|
||||||
|
int flag, n_regs = n_regss[seg_idx], cigar_in_tag = 0;
|
||||||
|
int this_rid = -1, this_pos = -1, this_rev = 0;
|
||||||
|
const mm_reg1_t *regs = regss[seg_idx], *r_prev = NULL, *r_next;
|
||||||
|
const mm_reg1_t *r = n_regs > 0 && reg_idx < n_regs && reg_idx >= 0? ®s[reg_idx] : NULL;
|
||||||
|
|
||||||
|
// find the primary of the previous and the next segments, if they are mapped
|
||||||
|
if (n_seg > 1) {
|
||||||
|
int i, next_sid = (seg_idx + 1) % n_seg;
|
||||||
|
r_next = get_sam_pri(n_regss[next_sid], regss[next_sid]);
|
||||||
|
if (n_seg > 2) {
|
||||||
|
for (i = 1; i <= n_seg - 1; ++i) {
|
||||||
|
int prev_sid = (seg_idx + n_seg - i) % n_seg;
|
||||||
|
if (n_regss[prev_sid] > 0) {
|
||||||
|
r_prev = get_sam_pri(n_regss[prev_sid], regss[prev_sid]);
|
||||||
|
break;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
} else r_prev = r_next;
|
||||||
|
} else r_prev = r_next = NULL;
|
||||||
|
|
||||||
|
// write QNAME
|
||||||
s->l = 0;
|
s->l = 0;
|
||||||
|
mm_sprintf_lite(s, "%s", t->name);
|
||||||
|
if (n_seg > 1) s->l = mm_qname_len(t->name); // trim the suffix like /1 or /2
|
||||||
|
|
||||||
|
// write flag
|
||||||
|
flag = n_seg > 1? 0x1 : 0x0;
|
||||||
|
if (r == 0) {
|
||||||
|
flag |= 0x4;
|
||||||
|
} else {
|
||||||
|
if (r->rev) flag |= 0x10;
|
||||||
|
if (r->parent != r->id) flag |= 0x100;
|
||||||
|
else if (!r->sam_pri) flag |= 0x800;
|
||||||
|
}
|
||||||
|
if (n_seg > 1) {
|
||||||
|
if (r && r->proper_frag) flag |= 0x2; // TODO: this doesn't work when there are more than 2 segments
|
||||||
|
if (seg_idx == 0) flag |= 0x40;
|
||||||
|
else if (seg_idx == n_seg - 1) flag |= 0x80;
|
||||||
|
if (r_next == NULL) flag |= 0x8;
|
||||||
|
else if (r_next->rev) flag |= 0x20;
|
||||||
|
}
|
||||||
|
mm_sprintf_lite(s, "\t%d", flag);
|
||||||
|
|
||||||
|
// write coordinate, MAPQ and CIGAR
|
||||||
|
if (r == 0) {
|
||||||
|
if (r_prev) {
|
||||||
|
this_rid = r_prev->rid, this_pos = r_prev->rs;
|
||||||
|
mm_sprintf_lite(s, "\t%s\t%d\t0\t*", mi->seq[this_rid].name, this_pos+1);
|
||||||
|
} else mm_sprintf_lite(s, "\t*\t0\t0\t*");
|
||||||
|
} else {
|
||||||
|
this_rid = r->rid, this_pos = r->rs, this_rev = r->rev;
|
||||||
|
mm_sprintf_lite(s, "\t%s\t%d\t%d\t", mi->seq[r->rid].name, r->rs+1, r->mapq);
|
||||||
|
if ((opt_flag & MM_F_LONG_CIGAR) && r->p && r->p->n_cigar > max_bam_cigar_op - 2) {
|
||||||
|
int n_cigar = r->p->n_cigar;
|
||||||
|
if (r->qs != 0) ++n_cigar;
|
||||||
|
if (r->qe != t->l_seq) ++n_cigar;
|
||||||
|
if (n_cigar > max_bam_cigar_op)
|
||||||
|
cigar_in_tag = 1;
|
||||||
|
}
|
||||||
|
if (cigar_in_tag) {
|
||||||
|
if (flag & 0x100) mm_sprintf_lite(s, "0S"); // secondary alignment
|
||||||
|
else if (flag & 0x800) mm_sprintf_lite(s, "%dS", r->re - r->rs); // supplementary alignment
|
||||||
|
else mm_sprintf_lite(s, "%dS", t->l_seq);
|
||||||
|
} else write_sam_cigar(s, flag, 0, t->l_seq, r, opt_flag);
|
||||||
|
}
|
||||||
|
|
||||||
|
// write mate positions
|
||||||
|
if (n_seg > 1) {
|
||||||
|
int tlen = 0;
|
||||||
|
if (this_rid >= 0 && r_next) {
|
||||||
|
if (this_rid == r_next->rid) {
|
||||||
|
int this_pos5 = r && r->rev? r->re - 1 : this_pos;
|
||||||
|
int next_pos5 = r_next->rev? r_next->re - 1 : r_next->rs;
|
||||||
|
tlen = next_pos5 - this_pos5;
|
||||||
|
mm_sprintf_lite(s, "\t=\t");
|
||||||
|
} else mm_sprintf_lite(s, "\t%s\t", mi->seq[r_next->rid].name);
|
||||||
|
mm_sprintf_lite(s, "%d\t", r_next->rs + 1);
|
||||||
|
} else if (r_next) { // && this_rid < 0
|
||||||
|
mm_sprintf_lite(s, "\t%s\t%d\t", mi->seq[r_next->rid].name, r_next->rs + 1);
|
||||||
|
} else if (this_rid >= 0) { // && r_next == NULL
|
||||||
|
int this_pos5 = this_rev? r->re - 1 : this_pos; // this_rev is only true when r != NULL
|
||||||
|
tlen = this_pos - this_pos5; // next_pos5 will be this_pos
|
||||||
|
mm_sprintf_lite(s, "\t=\t%d\t", this_pos + 1); // next segment will take r's coordinate
|
||||||
|
} else mm_sprintf_lite(s, "\t*\t0\t"); // neither has coordinates
|
||||||
|
if (tlen > 0) ++tlen;
|
||||||
|
else if (tlen < 0) --tlen;
|
||||||
|
mm_sprintf_lite(s, "%d\t", tlen);
|
||||||
|
} else mm_sprintf_lite(s, "\t*\t0\t0\t");
|
||||||
|
|
||||||
|
// write SEQ and QUAL
|
||||||
if (r == 0) {
|
if (r == 0) {
|
||||||
mm_sprintf_lite(s, "%s\t4\t*\t0\t0\t*\t*\t0\t0\t", t->name);
|
|
||||||
sam_write_sq(s, t->seq, t->l_seq, 0, 0);
|
sam_write_sq(s, t->seq, t->l_seq, 0, 0);
|
||||||
mm_sprintf_lite(s, "\t");
|
mm_sprintf_lite(s, "\t");
|
||||||
if (t->qual) sam_write_sq(s, t->qual, t->l_seq, 0, 0);
|
if (t->qual) sam_write_sq(s, t->qual, t->l_seq, 0, 0);
|
||||||
else mm_sprintf_lite(s, "*");
|
else mm_sprintf_lite(s, "*");
|
||||||
} else {
|
} else {
|
||||||
if (r->rev) flag |= 0x10;
|
if ((flag & 0x900) == 0 || (opt_flag & MM_F_SOFTCLIP)) {
|
||||||
if (r->parent != r->id) flag |= 0x100;
|
|
||||||
else if (!r->sam_pri) flag |= 0x800;
|
|
||||||
mm_sprintf_lite(s, "%s\t%d\t%s\t%d\t%d\t", t->name, flag, mi->seq[r->rid].name, r->rs+1, r->mapq);
|
|
||||||
if (r->p) { // TODO: using hard clippings
|
|
||||||
uint32_t k, clip_len = r->rev? t->l_seq - r->qe : r->qs;
|
|
||||||
int clip_char = (flag&0x800)? 'H' : 'S';
|
|
||||||
if (clip_len) mm_sprintf_lite(s, "%d%c", clip_len, clip_char);
|
|
||||||
for (k = 0; k < r->p->n_cigar; ++k)
|
|
||||||
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MID"[r->p->cigar[k]&0xf]);
|
|
||||||
clip_len = r->rev? r->qs : t->l_seq - r->qe;
|
|
||||||
if (clip_len) mm_sprintf_lite(s, "%d%c", clip_len, clip_char);
|
|
||||||
} else mm_sprintf_lite(s, "*");
|
|
||||||
mm_sprintf_lite(s, "\t*\t0\t0\t");
|
|
||||||
if ((flag & 0x900) == 0) {
|
|
||||||
sam_write_sq(s, t->seq, t->l_seq, r->rev, r->rev);
|
sam_write_sq(s, t->seq, t->l_seq, r->rev, r->rev);
|
||||||
mm_sprintf_lite(s, "\t");
|
mm_sprintf_lite(s, "\t");
|
||||||
if (t->qual) sam_write_sq(s, t->qual, t->l_seq, r->rev, 0);
|
if (t->qual) sam_write_sq(s, t->qual, t->l_seq, r->rev, 0);
|
||||||
@@ -143,7 +402,51 @@ void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const m
|
|||||||
if (t->qual) sam_write_sq(s, t->qual + r->qs, r->qe - r->qs, r->rev, 0);
|
if (t->qual) sam_write_sq(s, t->qual + r->qs, r->qe - r->qs, r->rev, 0);
|
||||||
else mm_sprintf_lite(s, "*");
|
else mm_sprintf_lite(s, "*");
|
||||||
}
|
}
|
||||||
write_tags(s, r);
|
|
||||||
}
|
}
|
||||||
|
|
||||||
|
// write tags
|
||||||
|
if (mm_rg_id[0]) mm_sprintf_lite(s, "\tRG:Z:%s", mm_rg_id);
|
||||||
|
if (n_seg > 2) mm_sprintf_lite(s, "\tFI:i:%d", seg_idx);
|
||||||
|
if (r) {
|
||||||
|
write_tags(s, r);
|
||||||
|
if (r->parent == r->id && r->p && n_regs > 1 && regs && r >= regs && r - regs < n_regs) { // supplementary aln may exist
|
||||||
|
int i, n_sa = 0; // n_sa: number of SA fields
|
||||||
|
for (i = 0; i < n_regs; ++i)
|
||||||
|
if (i != r - regs && regs[i].parent == regs[i].id && regs[i].p)
|
||||||
|
++n_sa;
|
||||||
|
if (n_sa > 0) {
|
||||||
|
mm_sprintf_lite(s, "\tSA:Z:");
|
||||||
|
for (i = 0; i < n_regs; ++i) {
|
||||||
|
const mm_reg1_t *q = ®s[i];
|
||||||
|
int l_M, l_I = 0, l_D = 0, clip5 = 0, clip3 = 0;
|
||||||
|
if (r == q || q->parent != q->id || q->p == 0) continue;
|
||||||
|
if (q->qe - q->qs < q->re - q->rs) l_M = q->qe - q->qs, l_D = (q->re - q->rs) - l_M;
|
||||||
|
else l_M = q->re - q->rs, l_I = (q->qe - q->qs) - l_M;
|
||||||
|
clip5 = q->rev? t->l_seq - q->qe : q->qs;
|
||||||
|
clip3 = q->rev? q->qs : t->l_seq - q->qe;
|
||||||
|
mm_sprintf_lite(s, "%s,%d,%c,", mi->seq[q->rid].name, q->rs+1, "+-"[q->rev]);
|
||||||
|
if (clip5) mm_sprintf_lite(s, "%dS", clip5);
|
||||||
|
if (l_M) mm_sprintf_lite(s, "%dM", l_M);
|
||||||
|
if (l_I) mm_sprintf_lite(s, "%dI", l_I);
|
||||||
|
if (l_D) mm_sprintf_lite(s, "%dD", l_D);
|
||||||
|
if (clip3) mm_sprintf_lite(s, "%dS", clip3);
|
||||||
|
mm_sprintf_lite(s, ",%d,%d;", q->mapq, q->blen - q->mlen + q->p->n_ambi);
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
if (r->p && (opt_flag & MM_F_OUT_CS))
|
||||||
|
write_cs(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG));
|
||||||
|
if (cigar_in_tag)
|
||||||
|
write_sam_cigar(s, flag, 1, t->l_seq, r, opt_flag);
|
||||||
|
}
|
||||||
|
|
||||||
s->s[s->l] = 0; // we always have room for an extra byte (see str_enlarge)
|
s->s[s->l] = 0; // we always have room for an extra byte (see str_enlarge)
|
||||||
}
|
}
|
||||||
|
|
||||||
|
void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int n_regs, const mm_reg1_t *regs)
|
||||||
|
{
|
||||||
|
int i;
|
||||||
|
for (i = 0; i < n_regs; ++i)
|
||||||
|
if (r == ®s[i]) break;
|
||||||
|
mm_write_sam2(s, mi, t, 0, i, 1, &n_regs, ®s, NULL, 0);
|
||||||
|
}
|
||||||
|
|||||||
@@ -0,0 +1,216 @@
|
|||||||
|
#include <stddef.h>
|
||||||
|
#include <stdio.h>
|
||||||
|
#include <string.h>
|
||||||
|
#include "getopt.h"
|
||||||
|
|
||||||
|
char *optarg;
|
||||||
|
int optind=1, opterr=1, optopt, __optpos, optreset=0;
|
||||||
|
|
||||||
|
#define optpos __optpos
|
||||||
|
|
||||||
|
static void __getopt_msg(const char *a, const char *b, const char *c, size_t l)
|
||||||
|
{
|
||||||
|
FILE *f = stderr;
|
||||||
|
#if !defined(WIN32) && !defined(_WIN32)
|
||||||
|
flockfile(f);
|
||||||
|
#endif
|
||||||
|
fputs(a, f);
|
||||||
|
fwrite(b, strlen(b), 1, f);
|
||||||
|
fwrite(c, 1, l, f);
|
||||||
|
fputc('\n', f);
|
||||||
|
#if !defined(WIN32) && !defined(_WIN32)
|
||||||
|
funlockfile(f);
|
||||||
|
#endif
|
||||||
|
}
|
||||||
|
|
||||||
|
int getopt(int argc, char * const argv[], const char *optstring)
|
||||||
|
{
|
||||||
|
int i, c, d;
|
||||||
|
int k, l;
|
||||||
|
char *optchar;
|
||||||
|
|
||||||
|
if (!optind || optreset) {
|
||||||
|
optreset = 0;
|
||||||
|
__optpos = 0;
|
||||||
|
optind = 1;
|
||||||
|
}
|
||||||
|
|
||||||
|
if (optind >= argc || !argv[optind])
|
||||||
|
return -1;
|
||||||
|
|
||||||
|
if (argv[optind][0] != '-') {
|
||||||
|
if (optstring[0] == '-') {
|
||||||
|
optarg = argv[optind++];
|
||||||
|
return 1;
|
||||||
|
}
|
||||||
|
return -1;
|
||||||
|
}
|
||||||
|
|
||||||
|
if (!argv[optind][1])
|
||||||
|
return -1;
|
||||||
|
|
||||||
|
if (argv[optind][1] == '-' && !argv[optind][2])
|
||||||
|
return optind++, -1;
|
||||||
|
|
||||||
|
if (!optpos) optpos++;
|
||||||
|
c = argv[optind][optpos], k = 1;
|
||||||
|
optchar = argv[optind]+optpos;
|
||||||
|
optopt = c;
|
||||||
|
optpos += k;
|
||||||
|
|
||||||
|
if (!argv[optind][optpos]) {
|
||||||
|
optind++;
|
||||||
|
optpos = 0;
|
||||||
|
}
|
||||||
|
|
||||||
|
if (optstring[0] == '-' || optstring[0] == '+')
|
||||||
|
optstring++;
|
||||||
|
|
||||||
|
i = 0;
|
||||||
|
d = 0;
|
||||||
|
do {
|
||||||
|
d = optstring[i], l = 1;
|
||||||
|
if (l>0) i+=l; else i++;
|
||||||
|
} while (l && d != c);
|
||||||
|
|
||||||
|
if (d != c) {
|
||||||
|
if (optstring[0] != ':' && opterr)
|
||||||
|
__getopt_msg(argv[0], ": unrecognized option: ", optchar, k);
|
||||||
|
return '?';
|
||||||
|
}
|
||||||
|
if (optstring[i] == ':') {
|
||||||
|
if (optstring[i+1] == ':') optarg = 0;
|
||||||
|
else if (optind >= argc) {
|
||||||
|
if (optstring[0] == ':') return ':';
|
||||||
|
if (opterr) __getopt_msg(argv[0],
|
||||||
|
": option requires an argument: ",
|
||||||
|
optchar, k);
|
||||||
|
return '?';
|
||||||
|
}
|
||||||
|
if (optstring[i+1] != ':' || optpos) {
|
||||||
|
optarg = argv[optind++] + optpos;
|
||||||
|
optpos = 0;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return c;
|
||||||
|
}
|
||||||
|
|
||||||
|
static void permute(char *const *argv, int dest, int src)
|
||||||
|
{
|
||||||
|
char **av = (char **)argv;
|
||||||
|
char *tmp = av[src];
|
||||||
|
int i;
|
||||||
|
for (i=src; i>dest; i--)
|
||||||
|
av[i] = av[i-1];
|
||||||
|
av[dest] = tmp;
|
||||||
|
}
|
||||||
|
|
||||||
|
static int __getopt_long_core(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx, int longonly)
|
||||||
|
{
|
||||||
|
optarg = 0;
|
||||||
|
if (longopts && argv[optind][0] == '-' &&
|
||||||
|
((longonly && argv[optind][1] && argv[optind][1] != '-') ||
|
||||||
|
(argv[optind][1] == '-' && argv[optind][2])))
|
||||||
|
{
|
||||||
|
int colon = optstring[optstring[0]=='+'||optstring[0]=='-']==':';
|
||||||
|
int i, cnt, match = -1;
|
||||||
|
char *opt;
|
||||||
|
for (cnt=i=0; longopts[i].name; i++) {
|
||||||
|
const char *name = longopts[i].name;
|
||||||
|
opt = argv[optind]+1;
|
||||||
|
if (*opt == '-') opt++;
|
||||||
|
for (; *name && *name == *opt; name++, opt++);
|
||||||
|
if (*opt && *opt != '=') continue;
|
||||||
|
match = i;
|
||||||
|
if (!*name) {
|
||||||
|
cnt = 1;
|
||||||
|
break;
|
||||||
|
}
|
||||||
|
cnt++;
|
||||||
|
}
|
||||||
|
if (cnt==1) {
|
||||||
|
i = match;
|
||||||
|
optind++;
|
||||||
|
optopt = longopts[i].val;
|
||||||
|
if (*opt == '=') {
|
||||||
|
if (!longopts[i].has_arg) {
|
||||||
|
if (colon || !opterr)
|
||||||
|
return '?';
|
||||||
|
__getopt_msg(argv[0],
|
||||||
|
": option does not take an argument: ",
|
||||||
|
longopts[i].name,
|
||||||
|
strlen(longopts[i].name));
|
||||||
|
return '?';
|
||||||
|
}
|
||||||
|
optarg = opt+1;
|
||||||
|
} else if (longopts[i].has_arg == required_argument) {
|
||||||
|
if (!(optarg = argv[optind])) {
|
||||||
|
if (colon) return ':';
|
||||||
|
if (!opterr) return '?';
|
||||||
|
__getopt_msg(argv[0],
|
||||||
|
": option requires an argument: ",
|
||||||
|
longopts[i].name,
|
||||||
|
strlen(longopts[i].name));
|
||||||
|
return '?';
|
||||||
|
}
|
||||||
|
optind++;
|
||||||
|
}
|
||||||
|
if (idx) *idx = i;
|
||||||
|
if (longopts[i].flag) {
|
||||||
|
*longopts[i].flag = longopts[i].val;
|
||||||
|
return 0;
|
||||||
|
}
|
||||||
|
return longopts[i].val;
|
||||||
|
}
|
||||||
|
if (argv[optind][1] == '-') {
|
||||||
|
if (!colon && opterr)
|
||||||
|
__getopt_msg(argv[0], cnt ?
|
||||||
|
": option is ambiguous: " :
|
||||||
|
": unrecognized option: ",
|
||||||
|
argv[optind]+2,
|
||||||
|
strlen(argv[optind]+2));
|
||||||
|
optind++;
|
||||||
|
return '?';
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return getopt(argc, argv, optstring);
|
||||||
|
}
|
||||||
|
|
||||||
|
static int __getopt_long(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx, int longonly)
|
||||||
|
{
|
||||||
|
int ret, skipped, resumed;
|
||||||
|
if (!optind || optreset) {
|
||||||
|
optreset = 0;
|
||||||
|
__optpos = 0;
|
||||||
|
optind = 1;
|
||||||
|
}
|
||||||
|
if (optind >= argc || !argv[optind]) return -1;
|
||||||
|
skipped = optind;
|
||||||
|
if (optstring[0] != '+' && optstring[0] != '-') {
|
||||||
|
int i;
|
||||||
|
for (i=optind; ; i++) {
|
||||||
|
if (i >= argc || !argv[i]) return -1;
|
||||||
|
if (argv[i][0] == '-' && argv[i][1]) break;
|
||||||
|
}
|
||||||
|
optind = i;
|
||||||
|
}
|
||||||
|
resumed = optind;
|
||||||
|
ret = __getopt_long_core(argc, argv, optstring, longopts, idx, longonly);
|
||||||
|
if (resumed > skipped) {
|
||||||
|
int i, cnt = optind-resumed;
|
||||||
|
for (i=0; i<cnt; i++)
|
||||||
|
permute(argv, skipped, optind-1);
|
||||||
|
optind = skipped + cnt;
|
||||||
|
}
|
||||||
|
return ret;
|
||||||
|
}
|
||||||
|
|
||||||
|
int getopt_long(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx)
|
||||||
|
{
|
||||||
|
return __getopt_long(argc, argv, optstring, longopts, idx, 0);
|
||||||
|
}
|
||||||
|
|
||||||
|
int getopt_long_only(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx)
|
||||||
|
{
|
||||||
|
return __getopt_long(argc, argv, optstring, longopts, idx, 1);
|
||||||
|
}
|
||||||
@@ -0,0 +1,53 @@
|
|||||||
|
/*
|
||||||
|
Copyright 2005-2014 Rich Felker, et al.
|
||||||
|
|
||||||
|
Permission is hereby granted, free of charge, to any person obtaining
|
||||||
|
a copy of this software and associated documentation files (the
|
||||||
|
"Software"), to deal in the Software without restriction, including
|
||||||
|
without limitation the rights to use, copy, modify, merge, publish,
|
||||||
|
distribute, sublicense, and/or sell copies of the Software, and to
|
||||||
|
permit persons to whom the Software is furnished to do so, subject to
|
||||||
|
the following conditions:
|
||||||
|
|
||||||
|
The above copyright notice and this permission notice shall be
|
||||||
|
included in all copies or substantial portions of the Software.
|
||||||
|
|
||||||
|
THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
|
||||||
|
EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
|
||||||
|
MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT.
|
||||||
|
IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY
|
||||||
|
CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT,
|
||||||
|
TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE
|
||||||
|
SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
|
||||||
|
*/
|
||||||
|
|
||||||
|
#ifndef _GETOPT_H
|
||||||
|
#define _GETOPT_H
|
||||||
|
|
||||||
|
#ifdef __cplusplus
|
||||||
|
extern "C" {
|
||||||
|
#endif
|
||||||
|
|
||||||
|
int getopt(int, char * const [], const char *);
|
||||||
|
extern char *optarg;
|
||||||
|
extern int optind, opterr, optopt, optreset;
|
||||||
|
|
||||||
|
struct option {
|
||||||
|
const char *name;
|
||||||
|
int has_arg;
|
||||||
|
int *flag;
|
||||||
|
int val;
|
||||||
|
};
|
||||||
|
|
||||||
|
int getopt_long(int, char *const *, const char *, const struct option *, int *);
|
||||||
|
int getopt_long_only(int, char *const *, const char *, const struct option *, int *);
|
||||||
|
|
||||||
|
#define no_argument 0
|
||||||
|
#define required_argument 1
|
||||||
|
#define optional_argument 2
|
||||||
|
|
||||||
|
#ifdef __cplusplus
|
||||||
|
}
|
||||||
|
#endif
|
||||||
|
|
||||||
|
#endif
|
||||||
@@ -1,20 +1,22 @@
|
|||||||
#include <string.h>
|
#include <string.h>
|
||||||
|
#include <stdlib.h>
|
||||||
#include <math.h>
|
#include <math.h>
|
||||||
#include "mmpriv.h"
|
#include "mmpriv.h"
|
||||||
#include "kalloc.h"
|
#include "kalloc.h"
|
||||||
|
#include "khash.h"
|
||||||
|
|
||||||
static inline void mm_cal_fuzzy_len(mm_reg1_t *r, const mm128_t *a)
|
static inline void mm_cal_fuzzy_len(mm_reg1_t *r, const mm128_t *a)
|
||||||
{
|
{
|
||||||
int i;
|
int i;
|
||||||
r->fuzzy_mlen = r->fuzzy_blen = 0;
|
r->mlen = r->blen = 0;
|
||||||
if (r->cnt <= 0) return;
|
if (r->cnt <= 0) return;
|
||||||
r->fuzzy_mlen = r->fuzzy_blen = a[r->as].y>>32&0xff;
|
r->mlen = r->blen = a[r->as].y>>32&0xff;
|
||||||
for (i = r->as + 1; i < r->as + r->cnt; ++i) {
|
for (i = r->as + 1; i < r->as + r->cnt; ++i) {
|
||||||
int span = a[i].y>>32&0xff;
|
int span = a[i].y>>32&0xff;
|
||||||
int tl = (int32_t)a[i].x - (int32_t)a[i-1].x;
|
int tl = (int32_t)a[i].x - (int32_t)a[i-1].x;
|
||||||
int ql = (int32_t)a[i].y - (int32_t)a[i-1].y;
|
int ql = (int32_t)a[i].y - (int32_t)a[i-1].y;
|
||||||
r->fuzzy_blen += tl > ql? tl : ql;
|
r->blen += tl > ql? tl : ql;
|
||||||
r->fuzzy_mlen += tl > span && ql > span? span : tl < ql? tl : ql;
|
r->mlen += tl > span && ql > span? span : tl < ql? tl : ql;
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -35,7 +37,19 @@ static inline void mm_reg_set_coor(mm_reg1_t *r, int32_t qlen, const mm128_t *a)
|
|||||||
mm_cal_fuzzy_len(r, a);
|
mm_cal_fuzzy_len(r, a);
|
||||||
}
|
}
|
||||||
|
|
||||||
mm_reg1_t *mm_gen_regs(void *km, int qlen, int n_u, uint64_t *u, mm128_t *a) // convert chains to hits
|
static inline uint64_t hash64(uint64_t key)
|
||||||
|
{
|
||||||
|
key = (~key + (key << 21));
|
||||||
|
key = key ^ key >> 24;
|
||||||
|
key = ((key + (key << 3)) + (key << 8));
|
||||||
|
key = key ^ key >> 14;
|
||||||
|
key = ((key + (key << 2)) + (key << 4));
|
||||||
|
key = key ^ key >> 28;
|
||||||
|
key = (key + (key << 31));
|
||||||
|
return key;
|
||||||
|
}
|
||||||
|
|
||||||
|
mm_reg1_t *mm_gen_regs(void *km, uint32_t hash, int qlen, int n_u, uint64_t *u, mm128_t *a) // convert chains to hits
|
||||||
{
|
{
|
||||||
mm128_t *z, tmp;
|
mm128_t *z, tmp;
|
||||||
mm_reg1_t *r;
|
mm_reg1_t *r;
|
||||||
@@ -46,7 +60,9 @@ mm_reg1_t *mm_gen_regs(void *km, int qlen, int n_u, uint64_t *u, mm128_t *a) //
|
|||||||
// sort by score
|
// sort by score
|
||||||
z = (mm128_t*)kmalloc(km, n_u * 16);
|
z = (mm128_t*)kmalloc(km, n_u * 16);
|
||||||
for (i = k = 0; i < n_u; ++i) {
|
for (i = k = 0; i < n_u; ++i) {
|
||||||
z[i].x = u[i] >> 32;
|
uint32_t h;
|
||||||
|
h = (uint32_t)hash64((hash64(a[k].x) + hash64(a[k].y)) ^ hash);
|
||||||
|
z[i].x = u[i] ^ h; // u[i] -- higher 32 bits: chain score; lower 32 bits: number of seeds in the chain
|
||||||
z[i].y = (uint64_t)k << 32 | (int32_t)u[i];
|
z[i].y = (uint64_t)k << 32 | (int32_t)u[i];
|
||||||
k += (int32_t)u[i];
|
k += (int32_t)u[i];
|
||||||
}
|
}
|
||||||
@@ -60,9 +76,11 @@ mm_reg1_t *mm_gen_regs(void *km, int qlen, int n_u, uint64_t *u, mm128_t *a) //
|
|||||||
mm_reg1_t *ri = &r[i];
|
mm_reg1_t *ri = &r[i];
|
||||||
ri->id = i;
|
ri->id = i;
|
||||||
ri->parent = MM_PARENT_UNSET;
|
ri->parent = MM_PARENT_UNSET;
|
||||||
ri->score = z[i].x;
|
ri->score = ri->score0 = z[i].x >> 32;
|
||||||
|
ri->hash = (uint32_t)z[i].x;
|
||||||
ri->cnt = (int32_t)z[i].y;
|
ri->cnt = (int32_t)z[i].y;
|
||||||
ri->as = z[i].y >> 32;
|
ri->as = z[i].y >> 32;
|
||||||
|
ri->div = -1.0f;
|
||||||
mm_reg_set_coor(ri, qlen, a);
|
mm_reg_set_coor(ri, qlen, a);
|
||||||
}
|
}
|
||||||
kfree(km, z);
|
kfree(km, z);
|
||||||
@@ -87,55 +105,86 @@ void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a)
|
|||||||
r->split |= 1, r2->split |= 2;
|
r->split |= 1, r2->split |= 2;
|
||||||
}
|
}
|
||||||
|
|
||||||
void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r) // and compute mm_reg1_t::subsc
|
void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r, int sub_diff) // and compute mm_reg1_t::subsc
|
||||||
{
|
{
|
||||||
int i, j, k, *w;
|
int i, j, k, *w;
|
||||||
|
uint64_t *cov;
|
||||||
if (n <= 0) return;
|
if (n <= 0) return;
|
||||||
for (i = 0; i < n; ++i) r[i].id = i;
|
for (i = 0; i < n; ++i) r[i].id = i;
|
||||||
|
cov = (uint64_t*)kmalloc(km, n * sizeof(uint64_t));
|
||||||
w = (int*)kmalloc(km, n * sizeof(int));
|
w = (int*)kmalloc(km, n * sizeof(int));
|
||||||
w[0] = 0, r[0].parent = 0;
|
w[0] = 0, r[0].parent = 0;
|
||||||
for (i = 1, k = 1; i < n; ++i) {
|
for (i = 1, k = 1; i < n; ++i) {
|
||||||
mm_reg1_t *ri = &r[i];
|
mm_reg1_t *ri = &r[i];
|
||||||
int si = ri->qs, ei = ri->qe;
|
int si = ri->qs, ei = ri->qe, n_cov = 0, uncov_len = 0;
|
||||||
for (j = 0; j < k; ++j) {
|
for (j = 0; j < k; ++j) { // traverse existing primary hits to find overlapping hits
|
||||||
mm_reg1_t *rp = &r[w[j]];
|
mm_reg1_t *rp = &r[w[j]];
|
||||||
int sj = rp->qs, ej = rp->qe;
|
int sj = rp->qs, ej = rp->qe;
|
||||||
int min = ej - sj < ei - si? ej - sj : ei - si;
|
if (ej <= si || sj >= ei) continue;
|
||||||
int ol = si < sj? (ei < sj? 0 : ei < ej? ei - sj : ej - sj) : (ej < si? 0 : ej < ei? ej - si : ei - si);
|
if (sj < si) sj = si;
|
||||||
if (ol > mask_level * min) {
|
if (ej > ei) ej = ei;
|
||||||
|
cov[n_cov++] = (uint64_t)sj<<32 | ej;
|
||||||
|
}
|
||||||
|
if (n_cov == 0) {
|
||||||
|
goto set_parent_test; // no overlapping primary hits; then i is a new primary hit
|
||||||
|
} else if (n_cov > 0) { // there are overlapping primary hits; find the length not covered by existing primary hits
|
||||||
|
int j, x = si;
|
||||||
|
radix_sort_64(cov, cov + n_cov);
|
||||||
|
for (j = 0; j < n_cov; ++j) {
|
||||||
|
if (cov[j]>>32 > x) uncov_len += (cov[j]>>32) - x;
|
||||||
|
x = (int32_t)cov[j] > x? (int32_t)cov[j] : x;
|
||||||
|
}
|
||||||
|
if (ei > x) uncov_len += ei - x;
|
||||||
|
}
|
||||||
|
for (j = 0; j < k; ++j) { // traverse existing primary hits again
|
||||||
|
mm_reg1_t *rp = &r[w[j]];
|
||||||
|
int sj = rp->qs, ej = rp->qe, min, max, ol;
|
||||||
|
if (ej <= si || sj >= ei) continue; // no overlap
|
||||||
|
min = ej - sj < ei - si? ej - sj : ei - si;
|
||||||
|
max = ej - sj > ei - si? ej - sj : ei - si;
|
||||||
|
ol = si < sj? (ei < sj? 0 : ei < ej? ei - sj : ej - sj) : (ej < si? 0 : ej < ei? ej - si : ei - si); // overlap length
|
||||||
|
if ((float)ol / min - (float)uncov_len / max > mask_level) {
|
||||||
|
int cnt_sub = 0;
|
||||||
ri->parent = rp->parent;
|
ri->parent = rp->parent;
|
||||||
rp->subsc = rp->subsc > ri->score? rp->subsc : ri->score;
|
rp->subsc = rp->subsc > ri->score? rp->subsc : ri->score;
|
||||||
if (rp->p && ri->p)
|
if (ri->cnt >= rp->cnt) cnt_sub = 1;
|
||||||
|
if (rp->p && ri->p && (rp->rid != ri->rid || rp->rs != ri->rs || rp->re != ri->re || ol != min)) { // the last condition excludes identical hits after DP
|
||||||
rp->p->dp_max2 = rp->p->dp_max2 > ri->p->dp_max? rp->p->dp_max2 : ri->p->dp_max;
|
rp->p->dp_max2 = rp->p->dp_max2 > ri->p->dp_max? rp->p->dp_max2 : ri->p->dp_max;
|
||||||
|
if (rp->p->dp_max - ri->p->dp_max <= sub_diff) cnt_sub = 1;
|
||||||
|
}
|
||||||
|
if (cnt_sub) ++rp->n_sub;
|
||||||
break;
|
break;
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
if (j == k) w[k++] = i, ri->parent = i;
|
set_parent_test:
|
||||||
|
if (j == k) w[k++] = i, ri->parent = i, ri->n_sub = 0;
|
||||||
}
|
}
|
||||||
|
kfree(km, cov);
|
||||||
kfree(km, w);
|
kfree(km, w);
|
||||||
}
|
}
|
||||||
|
|
||||||
void mm_hit_sort_by_dp(void *km, int *n_regs, mm_reg1_t *r)
|
void mm_hit_sort_by_dp(void *km, int *n_regs, mm_reg1_t *r)
|
||||||
{
|
{
|
||||||
int32_t i, n_aux, n = *n_regs;
|
int32_t i, n_aux, n = *n_regs;
|
||||||
uint64_t *aux;
|
mm128_t *aux;
|
||||||
mm_reg1_t *t;
|
mm_reg1_t *t;
|
||||||
|
|
||||||
if (n <= 1) return;
|
if (n <= 1) return;
|
||||||
aux = (uint64_t*)kmalloc(km, n * 8);
|
aux = (mm128_t*)kmalloc(km, n * 16);
|
||||||
t = (mm_reg1_t*)kmalloc(km, n * sizeof(mm_reg1_t));
|
t = (mm_reg1_t*)kmalloc(km, n * sizeof(mm_reg1_t));
|
||||||
for (i = n_aux = 0; i < n; ++i) {
|
for (i = n_aux = 0; i < n; ++i) {
|
||||||
if (r[i].cnt > 0) { // squeeze out elements with cnt==0 (soft deleted)
|
if (r[i].inv || r[i].cnt > 0) { // squeeze out elements with cnt==0 (soft deleted)
|
||||||
assert(r[i].p);
|
assert(r[i].p);
|
||||||
aux[n_aux++] = (uint64_t)r[i].p->dp_max << 32 | i;
|
aux[n_aux].x = (uint64_t)r[i].p->dp_max << 32 | r[i].hash;
|
||||||
|
aux[n_aux++].y = i;
|
||||||
} else if (r[i].p) {
|
} else if (r[i].p) {
|
||||||
kfree(km, r[i].p);
|
free(r[i].p);
|
||||||
r[i].p = 0;
|
r[i].p = 0;
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
radix_sort_64(aux, aux + n_aux);
|
radix_sort_128x(aux, aux + n_aux);
|
||||||
for (i = n_aux - 1; i >= 0; --i)
|
for (i = n_aux - 1; i >= 0; --i)
|
||||||
t[n_aux - 1 - i] = r[(int32_t)aux[i]];
|
t[n_aux - 1 - i] = r[aux[i].y];
|
||||||
memcpy(r, t, sizeof(mm_reg1_t) * n_aux);
|
memcpy(r, t, sizeof(mm_reg1_t) * n_aux);
|
||||||
*n_regs = n_aux;
|
*n_regs = n_aux;
|
||||||
kfree(km, aux);
|
kfree(km, aux);
|
||||||
@@ -177,14 +226,20 @@ void mm_sync_regs(void *km, int n_regs, mm_reg1_t *regs) // keep mm_reg1_t::{id,
|
|||||||
mm_set_sam_pri(n_regs, regs);
|
mm_set_sam_pri(n_regs, regs);
|
||||||
}
|
}
|
||||||
|
|
||||||
void mm_select_sub(void *km, float mask_level, float pri_ratio, int best_n, int *n_, mm_reg1_t *r)
|
void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int *n_, mm_reg1_t *r)
|
||||||
{
|
{
|
||||||
if (pri_ratio > 0.0f && *n_ > 0) {
|
if (pri_ratio > 0.0f && *n_ > 0) {
|
||||||
int i, k, n = *n_, n_2nd = 0;
|
int i, k, n = *n_, n_2nd = 0;
|
||||||
for (i = k = 0; i < n; ++i)
|
for (i = k = 0; i < n; ++i) {
|
||||||
if (r[i].parent == i) r[k++] = r[i];
|
int p = r[i].parent;
|
||||||
else if (r[i].score >= r[r[i].parent].score * pri_ratio && n_2nd++ < best_n) r[k++] = r[i];
|
if (p == i || r[i].inv) { // primary or inversion
|
||||||
|
r[k++] = r[i];
|
||||||
|
} else if ((r[i].score >= r[p].score * pri_ratio || r[i].score + min_diff >= r[p].score) && n_2nd < best_n) {
|
||||||
|
if (!(r[i].qs == r[p].qs && r[i].qe == r[p].qe && r[i].rid == r[p].rid && r[i].rs == r[p].rs && r[i].re == r[p].re)) // not identical hits
|
||||||
|
r[k++] = r[i], ++n_2nd;
|
||||||
else if (r[i].p) free(r[i].p);
|
else if (r[i].p) free(r[i].p);
|
||||||
|
} else if (r[i].p) free(r[i].p);
|
||||||
|
}
|
||||||
if (k != n) mm_sync_regs(km, k, r); // removing hits requires sync()
|
if (k != n) mm_sync_regs(km, k, r); // removing hits requires sync()
|
||||||
*n_ = k;
|
*n_ = k;
|
||||||
}
|
}
|
||||||
@@ -196,9 +251,9 @@ void mm_filter_regs(void *km, const mm_mapopt_t *opt, int *n_regs, mm_reg1_t *re
|
|||||||
for (i = k = 0; i < *n_regs; ++i) {
|
for (i = k = 0; i < *n_regs; ++i) {
|
||||||
mm_reg1_t *r = ®s[i];
|
mm_reg1_t *r = ®s[i];
|
||||||
int flt = 0;
|
int flt = 0;
|
||||||
if (r->cnt < opt->min_cnt) flt = 1;
|
if (!r->inv && !r->seg_split && r->cnt < opt->min_cnt) flt = 1;
|
||||||
if (r->p) {
|
if (r->p) {
|
||||||
if (r->p->blen - r->p->n_ambi - r->p->n_diff < opt->min_chain_score) flt = 1;
|
if (r->mlen < opt->min_chain_score) flt = 1;
|
||||||
else if (r->p->dp_max < opt->min_dp_max) flt = 1;
|
else if (r->p->dp_max < opt->min_dp_max) flt = 1;
|
||||||
if (flt) free(r->p);
|
if (flt) free(r->p);
|
||||||
}
|
}
|
||||||
@@ -265,7 +320,7 @@ void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs_, mm_r
|
|||||||
if (r1->re - r1->rs < max_gap>>1 || r1->qe - r1->qs < max_gap>>1) continue;
|
if (r1->re - r1->rs < max_gap>>1 || r1->qe - r1->qs < max_gap>>1) continue;
|
||||||
|
|
||||||
// all conditions satisfied; join
|
// all conditions satisfied; join
|
||||||
a[r1->as].y |= 1ULL<<40;
|
a[r1->as].y |= MM_SEED_LONG_JOIN;
|
||||||
r0->cnt += r1->cnt, r0->score += r1->score;
|
r0->cnt += r1->cnt, r0->score += r1->score;
|
||||||
mm_reg_set_coor(r0, qlen, a);
|
mm_reg_set_coor(r0, qlen, a);
|
||||||
r1->cnt = 0;
|
r1->cnt = 0;
|
||||||
@@ -287,19 +342,109 @@ void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs_, mm_r
|
|||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
void mm_set_mapq(int n_regs, mm_reg1_t *regs)
|
mm_seg_t *mm_seg_gen(void *km, uint32_t hash, int n_segs, const int *qlens, int n_regs0, const mm_reg1_t *regs0, int *n_regs, mm_reg1_t **regs, const mm128_t *a)
|
||||||
|
{
|
||||||
|
int s, i, j, acc_qlen[MM_MAX_SEG+1], qlen_sum = 0;
|
||||||
|
mm_seg_t *seg;
|
||||||
|
|
||||||
|
assert(n_segs <= MM_MAX_SEG);
|
||||||
|
for (s = 1, acc_qlen[0] = 0; s < n_segs; ++s)
|
||||||
|
acc_qlen[s] = acc_qlen[s-1] + qlens[s-1];
|
||||||
|
qlen_sum = acc_qlen[n_segs - 1] + qlens[n_segs - 1];
|
||||||
|
|
||||||
|
seg = (mm_seg_t*)kcalloc(km, n_segs, sizeof(mm_seg_t));
|
||||||
|
for (s = 0; s < n_segs; ++s) {
|
||||||
|
seg[s].u = (uint64_t*)kmalloc(km, n_regs0 * 8);
|
||||||
|
for (i = 0; i < n_regs0; ++i)
|
||||||
|
seg[s].u[i] = (uint64_t)regs0[i].score << 32;
|
||||||
|
}
|
||||||
|
for (i = 0; i < n_regs0; ++i) {
|
||||||
|
const mm_reg1_t *r = ®s0[i];
|
||||||
|
for (j = 0; j < r->cnt; ++j) {
|
||||||
|
int sid = (a[r->as + j].y&MM_SEED_SEG_MASK)>>MM_SEED_SEG_SHIFT;
|
||||||
|
++seg[sid].u[i];
|
||||||
|
++seg[sid].n_a;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
for (s = 0; s < n_segs; ++s) {
|
||||||
|
mm_seg_t *sr = &seg[s];
|
||||||
|
for (i = 0, sr->n_u = 0; i < n_regs0; ++i) // squeeze out zero-length per-segment chains
|
||||||
|
if ((int32_t)sr->u[i] != 0)
|
||||||
|
sr->u[sr->n_u++] = sr->u[i];
|
||||||
|
sr->a = (mm128_t*)kmalloc(km, sr->n_a * sizeof(mm128_t));
|
||||||
|
sr->n_a = 0;
|
||||||
|
}
|
||||||
|
|
||||||
|
for (i = 0; i < n_regs0; ++i) {
|
||||||
|
const mm_reg1_t *r = ®s0[i];
|
||||||
|
for (j = 0; j < r->cnt; ++j) {
|
||||||
|
int sid = (a[r->as + j].y&MM_SEED_SEG_MASK)>>MM_SEED_SEG_SHIFT;
|
||||||
|
mm128_t a1 = a[r->as + j];
|
||||||
|
// on reverse strand, the segment position is:
|
||||||
|
// x_for_cat = qlen_sum - 1 - (int32_t)a1.y - 1 + q_span
|
||||||
|
// (int32_t)new_a1.y = qlens[sid] - (x_for_cat - acc_qlen[sid] + 1 - q_span) - 1 = (int32_t)a1.y - (qlen_sum - (qlens[sid] + acc_qlen[sid]))
|
||||||
|
a1.y -= a1.x>>63? qlen_sum - (qlens[sid] + acc_qlen[sid]) : acc_qlen[sid];
|
||||||
|
seg[sid].a[seg[sid].n_a++] = a1;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
for (s = 0; s < n_segs; ++s) {
|
||||||
|
regs[s] = mm_gen_regs(km, hash, qlens[s], seg[s].n_u, seg[s].u, seg[s].a);
|
||||||
|
n_regs[s] = seg[s].n_u;
|
||||||
|
for (i = 0; i < n_regs[s]; ++i)
|
||||||
|
regs[s][i].seg_split = 1;
|
||||||
|
}
|
||||||
|
return seg;
|
||||||
|
}
|
||||||
|
|
||||||
|
void mm_seg_free(void *km, int n_segs, mm_seg_t *segs)
|
||||||
{
|
{
|
||||||
int i;
|
int i;
|
||||||
|
for (i = 0; i < n_segs; ++i) kfree(km, segs[i].u);
|
||||||
|
for (i = 0; i < n_segs; ++i) kfree(km, segs[i].a);
|
||||||
|
kfree(km, segs);
|
||||||
|
}
|
||||||
|
|
||||||
|
void mm_set_mapq(int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr)
|
||||||
|
{
|
||||||
|
static const float q_coef = 40.0f;
|
||||||
|
int64_t sum_sc = 0;
|
||||||
|
float uniq_ratio;
|
||||||
|
int i;
|
||||||
|
for (i = 0; i < n_regs; ++i)
|
||||||
|
if (regs[i].parent == regs[i].id)
|
||||||
|
sum_sc += regs[i].score;
|
||||||
|
uniq_ratio = (float)sum_sc / (sum_sc + rep_len);
|
||||||
for (i = 0; i < n_regs; ++i) {
|
for (i = 0; i < n_regs; ++i) {
|
||||||
mm_reg1_t *r = ®s[i];
|
mm_reg1_t *r = ®s[i];
|
||||||
if (r->parent == r->id) {
|
if (r->inv) {
|
||||||
int mapq;
|
r->mapq = 0;
|
||||||
|
} else if (r->parent == r->id) {
|
||||||
|
int mapq, subsc;
|
||||||
|
float pen_s1 = (r->score > 100? 1.0f : 0.01f * r->score) * uniq_ratio;
|
||||||
|
float pen_cm = r->cnt > 10? 1.0f : 0.1f * r->cnt;
|
||||||
|
pen_cm = pen_s1 < pen_cm? pen_s1 : pen_cm;
|
||||||
|
subsc = r->subsc > min_chain_sc? r->subsc : min_chain_sc;
|
||||||
if (r->p && r->p->dp_max2 > 0 && r->p->dp_max > 0) {
|
if (r->p && r->p->dp_max2 > 0 && r->p->dp_max > 0) {
|
||||||
float identity = (float)(r->p->blen - r->p->n_diff - r->p->n_ambi) / (r->p->blen - r->p->n_ambi);
|
float identity = (float)r->mlen / r->blen;
|
||||||
mapq = (int)(identity * 30.0 * (1. - (float)r->p->dp_max2 * r->subsc / r->p->dp_max / r->score) * logf(r->score));
|
float x = (float)r->p->dp_max2 * subsc / r->p->dp_max / r->score0;
|
||||||
} else mapq = (int)(30.0 * (1. - (float)r->subsc / r->score) * logf(r->score));
|
mapq = (int)(identity * pen_cm * q_coef * (1.0f - x * x) * logf((float)r->p->dp_max / match_sc));
|
||||||
|
if (!is_sr) {
|
||||||
|
int mapq_alt = (int)(6.02f * identity * identity * (r->p->dp_max - r->p->dp_max2) / match_sc + .499f); // BWA-MEM like mapQ, mostly for short reads
|
||||||
|
mapq = mapq < mapq_alt? mapq : mapq_alt; // in case the long-read heuristic fails
|
||||||
|
}
|
||||||
|
} else {
|
||||||
|
float x = (float)subsc / r->score0;
|
||||||
|
if (r->p) {
|
||||||
|
float identity = (float)r->mlen / r->blen;
|
||||||
|
mapq = (int)(identity * pen_cm * q_coef * (1.0f - x) * logf((float)r->p->dp_max / match_sc));
|
||||||
|
} else {
|
||||||
|
mapq = (int)(pen_cm * q_coef * (1.0f - x) * logf(r->score));
|
||||||
|
}
|
||||||
|
}
|
||||||
|
mapq -= (int)(4.343f * logf(r->n_sub + 1) + .499f);
|
||||||
mapq = mapq > 0? mapq : 0;
|
mapq = mapq > 0? mapq : 0;
|
||||||
r->mapq = mapq < 60? mapq : 60;
|
r->mapq = mapq < 60? mapq : 60;
|
||||||
|
if (r->p && r->p->dp_max > r->p->dp_max2 && r->mapq == 0) r->mapq = 1;
|
||||||
} else r->mapq = 0;
|
} else r->mapq = 0;
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -1,6 +1,10 @@
|
|||||||
#include <stdlib.h>
|
#include <stdlib.h>
|
||||||
#include <assert.h>
|
#include <assert.h>
|
||||||
|
#if defined(WIN32) || defined(_WIN32)
|
||||||
|
#include <io.h> // for open(2)
|
||||||
|
#else
|
||||||
#include <unistd.h>
|
#include <unistd.h>
|
||||||
|
#endif
|
||||||
#include <fcntl.h>
|
#include <fcntl.h>
|
||||||
#include <stdio.h>
|
#include <stdio.h>
|
||||||
#include "kthread.h"
|
#include "kthread.h"
|
||||||
@@ -17,14 +21,31 @@ typedef khash_t(idx) idxhash_t;
|
|||||||
|
|
||||||
#define kroundup64(x) (--(x), (x)|=(x)>>1, (x)|=(x)>>2, (x)|=(x)>>4, (x)|=(x)>>8, (x)|=(x)>>16, (x)|=(x)>>32, ++(x))
|
#define kroundup64(x) (--(x), (x)|=(x)>>1, (x)|=(x)>>2, (x)|=(x)>>4, (x)|=(x)>>8, (x)|=(x)>>16, (x)|=(x)>>32, ++(x))
|
||||||
|
|
||||||
mm_idx_t *mm_idx_init(int w, int k, int b, int is_hpc)
|
typedef struct mm_idx_bucket_s {
|
||||||
|
mm128_v a; // (minimizer, position) array
|
||||||
|
int32_t n; // size of the _p_ array
|
||||||
|
uint64_t *p; // position array for minimizers appearing >1 times
|
||||||
|
void *h; // hash table indexing _p_ and minimizers appearing once
|
||||||
|
} mm_idx_bucket_t;
|
||||||
|
|
||||||
|
void mm_idxopt_init(mm_idxopt_t *opt)
|
||||||
|
{
|
||||||
|
memset(opt, 0, sizeof(mm_idxopt_t));
|
||||||
|
opt->k = 15, opt->w = 10, opt->flag = 0;
|
||||||
|
opt->bucket_bits = 14;
|
||||||
|
opt->mini_batch_size = 50000000;
|
||||||
|
opt->batch_size = 4000000000ULL;
|
||||||
|
}
|
||||||
|
|
||||||
|
mm_idx_t *mm_idx_init(int w, int k, int b, int flag)
|
||||||
{
|
{
|
||||||
mm_idx_t *mi;
|
mm_idx_t *mi;
|
||||||
if (k*2 < b) b = k * 2;
|
if (k*2 < b) b = k * 2;
|
||||||
if (w < 1) w = 1;
|
if (w < 1) w = 1;
|
||||||
mi = (mm_idx_t*)calloc(1, sizeof(mm_idx_t));
|
mi = (mm_idx_t*)calloc(1, sizeof(mm_idx_t));
|
||||||
mi->w = w, mi->k = k, mi->b = b, mi->is_hpc = is_hpc;
|
mi->w = w, mi->k = k, mi->b = b, mi->flag = flag;
|
||||||
mi->B = (mm_idx_bucket_t*)calloc(1<<b, sizeof(mm_idx_bucket_t));
|
mi->B = (mm_idx_bucket_t*)calloc(1<<b, sizeof(mm_idx_bucket_t));
|
||||||
|
if (!(mm_dbg_flag & 1)) mi->km = km_init();
|
||||||
return mi;
|
return mi;
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -37,9 +58,12 @@ void mm_idx_destroy(mm_idx_t *mi)
|
|||||||
free(mi->B[i].a.a);
|
free(mi->B[i].a.a);
|
||||||
kh_destroy(idx, (idxhash_t*)mi->B[i].h);
|
kh_destroy(idx, (idxhash_t*)mi->B[i].h);
|
||||||
}
|
}
|
||||||
|
if (!mi->km) {
|
||||||
for (i = 0; i < mi->n_seq; ++i)
|
for (i = 0; i < mi->n_seq; ++i)
|
||||||
free(mi->seq[i].name);
|
free(mi->seq[i].name);
|
||||||
free(mi->seq); free(mi->B); free(mi->S); free(mi);
|
free(mi->seq);
|
||||||
|
} else km_destroy(mi->km);
|
||||||
|
free(mi->B); free(mi->S); free(mi);
|
||||||
}
|
}
|
||||||
|
|
||||||
const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n)
|
const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n)
|
||||||
@@ -65,7 +89,7 @@ void mm_idx_stat(const mm_idx_t *mi)
|
|||||||
{
|
{
|
||||||
int i, n = 0, n1 = 0;
|
int i, n = 0, n1 = 0;
|
||||||
uint64_t sum = 0, len = 0;
|
uint64_t sum = 0, len = 0;
|
||||||
fprintf(stderr, "[M::%s] kmer size: %d; skip: %d; is_HPC: %d; #seq: %d\n", __func__, mi->k, mi->w, mi->is_hpc, mi->n_seq);
|
fprintf(stderr, "[M::%s] kmer size: %d; skip: %d; is_hpc: %d; #seq: %d\n", __func__, mi->k, mi->w, mi->flag&MM_I_HPC, mi->n_seq);
|
||||||
for (i = 0; i < mi->n_seq; ++i)
|
for (i = 0; i < mi->n_seq; ++i)
|
||||||
len += mi->seq[i].len;
|
len += mi->seq[i].len;
|
||||||
for (i = 0; i < 1<<mi->b; ++i)
|
for (i = 0; i < 1<<mi->b; ++i)
|
||||||
@@ -96,13 +120,13 @@ int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, ui
|
|||||||
return en - st;
|
return en - st;
|
||||||
}
|
}
|
||||||
|
|
||||||
uint32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f)
|
int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f)
|
||||||
{
|
{
|
||||||
int i;
|
int i;
|
||||||
size_t n = 0;
|
size_t n = 0;
|
||||||
uint32_t thres;
|
uint32_t thres;
|
||||||
khint_t *a, k;
|
khint_t *a, k;
|
||||||
if (f <= 0.) return UINT32_MAX;
|
if (f <= 0.) return INT32_MAX;
|
||||||
for (i = 0; i < 1<<mi->b; ++i)
|
for (i = 0; i < 1<<mi->b; ++i)
|
||||||
if (mi->B[i].h) n += kh_size((idxhash_t*)mi->B[i].h);
|
if (mi->B[i].h) n += kh_size((idxhash_t*)mi->B[i].h);
|
||||||
a = (uint32_t*)malloc(n * 4);
|
a = (uint32_t*)malloc(n * 4);
|
||||||
@@ -172,7 +196,7 @@ static void worker_post(void *g, long i, int tid)
|
|||||||
assert(b->n == start_p);
|
assert(b->n == start_p);
|
||||||
|
|
||||||
// deallocate and clear b->a
|
// deallocate and clear b->a
|
||||||
free(b->a.a);
|
kfree(0, b->a.a);
|
||||||
b->a.n = b->a.m = 0, b->a.a = 0;
|
b->a.n = b->a.m = 0, b->a.a = 0;
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -190,7 +214,7 @@ static void mm_idx_post(mm_idx_t *mi, int n_threads)
|
|||||||
#include "bseq.h"
|
#include "bseq.h"
|
||||||
|
|
||||||
typedef struct {
|
typedef struct {
|
||||||
int mini_batch_size, keep_name;
|
int mini_batch_size;
|
||||||
uint64_t batch_size, sum_len;
|
uint64_t batch_size, sum_len;
|
||||||
mm_bseq_file_t *fp;
|
mm_bseq_file_t *fp;
|
||||||
mm_idx_t *mi;
|
mm_idx_t *mi;
|
||||||
@@ -222,14 +246,15 @@ static void *worker_pipeline(void *shared, int step, void *in)
|
|||||||
s->seq = mm_bseq_read(p->fp, p->mini_batch_size, 0, &s->n_seq); // read a mini-batch
|
s->seq = mm_bseq_read(p->fp, p->mini_batch_size, 0, &s->n_seq); // read a mini-batch
|
||||||
if (s->seq) {
|
if (s->seq) {
|
||||||
uint32_t old_m, m;
|
uint32_t old_m, m;
|
||||||
uint64_t sum_len, old_max_len, max_len;
|
|
||||||
assert((uint64_t)p->mi->n_seq + s->n_seq <= UINT32_MAX); // to prevent integer overflow
|
assert((uint64_t)p->mi->n_seq + s->n_seq <= UINT32_MAX); // to prevent integer overflow
|
||||||
// make room for p->mi->seq
|
// make room for p->mi->seq
|
||||||
old_m = p->mi->n_seq, m = p->mi->n_seq + s->n_seq;
|
old_m = p->mi->n_seq, m = p->mi->n_seq + s->n_seq;
|
||||||
kroundup32(m); kroundup32(old_m);
|
kroundup32(m); kroundup32(old_m);
|
||||||
if (old_m != m)
|
if (old_m != m)
|
||||||
p->mi->seq = (mm_idx_seq_t*)realloc(p->mi->seq, m * sizeof(mm_idx_seq_t));
|
p->mi->seq = (mm_idx_seq_t*)krealloc(p->mi->km, p->mi->seq, m * sizeof(mm_idx_seq_t));
|
||||||
// make room for p->mi->S
|
// make room for p->mi->S
|
||||||
|
if (!(p->mi->flag & MM_I_NO_SEQ)) {
|
||||||
|
uint64_t sum_len, old_max_len, max_len;
|
||||||
for (i = 0, sum_len = 0; i < s->n_seq; ++i) sum_len += s->seq[i].l_seq;
|
for (i = 0, sum_len = 0; i < s->n_seq; ++i) sum_len += s->seq[i].l_seq;
|
||||||
old_max_len = (p->sum_len + 7) / 8;
|
old_max_len = (p->sum_len + 7) / 8;
|
||||||
max_len = (p->sum_len + sum_len + 7) / 8;
|
max_len = (p->sum_len + sum_len + 7) / 8;
|
||||||
@@ -238,22 +263,25 @@ static void *worker_pipeline(void *shared, int step, void *in)
|
|||||||
p->mi->S = (uint32_t*)realloc(p->mi->S, max_len * 4);
|
p->mi->S = (uint32_t*)realloc(p->mi->S, max_len * 4);
|
||||||
memset(&p->mi->S[old_max_len], 0, 4 * (max_len - old_max_len));
|
memset(&p->mi->S[old_max_len], 0, 4 * (max_len - old_max_len));
|
||||||
}
|
}
|
||||||
|
}
|
||||||
// populate p->mi->seq
|
// populate p->mi->seq
|
||||||
for (i = 0; i < s->n_seq; ++i) {
|
for (i = 0; i < s->n_seq; ++i) {
|
||||||
mm_idx_seq_t *seq = &p->mi->seq[p->mi->n_seq];
|
mm_idx_seq_t *seq = &p->mi->seq[p->mi->n_seq];
|
||||||
uint32_t j;
|
uint32_t j;
|
||||||
if (p->keep_name) {
|
if (!(p->mi->flag & MM_I_NO_NAME)) {
|
||||||
assert(strlen(s->seq[i].name) <= 254); // a long query name breaks BAM
|
seq->name = (char*)kmalloc(p->mi->km, strlen(s->seq[i].name) + 1);
|
||||||
seq->name = strdup(s->seq[i].name);
|
strcpy(seq->name, s->seq[i].name);
|
||||||
} else seq->name = 0;
|
} else seq->name = 0;
|
||||||
seq->len = s->seq[i].l_seq;
|
seq->len = s->seq[i].l_seq;
|
||||||
seq->offset = p->sum_len;
|
seq->offset = p->sum_len;
|
||||||
// copy the sequence
|
// copy the sequence
|
||||||
|
if (!(p->mi->flag & MM_I_NO_SEQ)) {
|
||||||
for (j = 0; j < seq->len; ++j) { // TODO: this is not the fastest way, but let's first see if speed matters here
|
for (j = 0; j < seq->len; ++j) { // TODO: this is not the fastest way, but let's first see if speed matters here
|
||||||
uint64_t o = p->sum_len + j;
|
uint64_t o = p->sum_len + j;
|
||||||
int c = seq_nt4_table[(uint8_t)s->seq[i].seq[j]];
|
int c = seq_nt4_table[(uint8_t)s->seq[i].seq[j]];
|
||||||
mm_seq4_set(p->mi->S, o, c);
|
mm_seq4_set(p->mi->S, o, c);
|
||||||
}
|
}
|
||||||
|
}
|
||||||
// update p->sum_len and p->mi->n_seq
|
// update p->sum_len and p->mi->n_seq
|
||||||
p->sum_len += seq->len;
|
p->sum_len += seq->len;
|
||||||
s->seq[i].rid = p->mi->n_seq++;
|
s->seq[i].rid = p->mi->n_seq++;
|
||||||
@@ -264,7 +292,10 @@ static void *worker_pipeline(void *shared, int step, void *in)
|
|||||||
step_t *s = (step_t*)in;
|
step_t *s = (step_t*)in;
|
||||||
for (i = 0; i < s->n_seq; ++i) {
|
for (i = 0; i < s->n_seq; ++i) {
|
||||||
mm_bseq1_t *t = &s->seq[i];
|
mm_bseq1_t *t = &s->seq[i];
|
||||||
mm_sketch(0, t->seq, t->l_seq, p->mi->w, p->mi->k, t->rid, p->mi->is_hpc, &s->a);
|
if (t->l_seq > 0)
|
||||||
|
mm_sketch(0, t->seq, t->l_seq, p->mi->w, p->mi->k, t->rid, p->mi->flag&MM_I_HPC, &s->a);
|
||||||
|
else if (mm_verbose >= 2)
|
||||||
|
fprintf(stderr, "[WARNING] the length database sequence '%s' is 0\n", t->name);
|
||||||
free(t->seq); free(t->name);
|
free(t->seq); free(t->name);
|
||||||
}
|
}
|
||||||
free(s->seq); s->seq = 0;
|
free(s->seq); s->seq = 0;
|
||||||
@@ -272,21 +303,20 @@ static void *worker_pipeline(void *shared, int step, void *in)
|
|||||||
} else if (step == 2) { // dispatch sketch to buckets
|
} else if (step == 2) { // dispatch sketch to buckets
|
||||||
step_t *s = (step_t*)in;
|
step_t *s = (step_t*)in;
|
||||||
mm_idx_add(p->mi, s->a.n, s->a.a);
|
mm_idx_add(p->mi, s->a.n, s->a.a);
|
||||||
free(s->a.a); free(s);
|
kfree(0, s->a.a); free(s);
|
||||||
}
|
}
|
||||||
return 0;
|
return 0;
|
||||||
}
|
}
|
||||||
|
|
||||||
mm_idx_t *mm_idx_gen(mm_bseq_file_t *fp, int w, int k, int b, int is_hpc, int mini_batch_size, int n_threads, uint64_t batch_size, int keep_name)
|
mm_idx_t *mm_idx_gen(mm_bseq_file_t *fp, int w, int k, int b, int flag, int mini_batch_size, int n_threads, uint64_t batch_size)
|
||||||
{
|
{
|
||||||
pipeline_t pl;
|
pipeline_t pl;
|
||||||
|
if (fp == 0 || mm_bseq_eof(fp)) return 0;
|
||||||
memset(&pl, 0, sizeof(pipeline_t));
|
memset(&pl, 0, sizeof(pipeline_t));
|
||||||
pl.mini_batch_size = mini_batch_size < batch_size? mini_batch_size : batch_size;
|
pl.mini_batch_size = mini_batch_size < batch_size? mini_batch_size : batch_size;
|
||||||
pl.keep_name = keep_name;
|
|
||||||
pl.batch_size = batch_size;
|
pl.batch_size = batch_size;
|
||||||
pl.fp = fp;
|
pl.fp = fp;
|
||||||
if (pl.fp == 0) return 0;
|
pl.mi = mm_idx_init(w, k, b, flag);
|
||||||
pl.mi = mm_idx_init(w, k, b, is_hpc);
|
|
||||||
|
|
||||||
kt_pipeline(n_threads < 3? n_threads : 3, worker_pipeline, &pl, 3);
|
kt_pipeline(n_threads < 3? n_threads : 3, worker_pipeline, &pl, 3);
|
||||||
if (mm_verbose >= 3)
|
if (mm_verbose >= 3)
|
||||||
@@ -299,17 +329,60 @@ mm_idx_t *mm_idx_gen(mm_bseq_file_t *fp, int w, int k, int b, int is_hpc, int mi
|
|||||||
return pl.mi;
|
return pl.mi;
|
||||||
}
|
}
|
||||||
|
|
||||||
mm_idx_t *mm_idx_build(const char *fn, int w, int k, int is_hpc, int n_threads) // a simpler interface
|
mm_idx_t *mm_idx_build(const char *fn, int w, int k, int flag, int n_threads) // a simpler interface; deprecated
|
||||||
{
|
{
|
||||||
mm_bseq_file_t *fp;
|
mm_bseq_file_t *fp;
|
||||||
mm_idx_t *mi;
|
mm_idx_t *mi;
|
||||||
fp = mm_bseq_open(fn);
|
fp = mm_bseq_open(fn);
|
||||||
if (fp == 0) return 0;
|
if (fp == 0) return 0;
|
||||||
mi = mm_idx_gen(fp, w, k, MM_IDX_DEF_B, is_hpc, 1<<18, n_threads, UINT64_MAX, 1);
|
mi = mm_idx_gen(fp, w, k, 14, flag, 1<<18, n_threads, UINT64_MAX);
|
||||||
mm_bseq_close(fp);
|
mm_bseq_close(fp);
|
||||||
return mi;
|
return mi;
|
||||||
}
|
}
|
||||||
|
|
||||||
|
mm_idx_t *mm_idx_str(int w, int k, int is_hpc, int bucket_bits, int n, const char **seq, const char **name)
|
||||||
|
{
|
||||||
|
uint64_t sum_len = 0;
|
||||||
|
mm128_v a = {0,0,0};
|
||||||
|
mm_idx_t *mi;
|
||||||
|
int i, flag = 0;
|
||||||
|
if (n <= 0) return 0;
|
||||||
|
for (i = 0; i < n; ++i) // get the total length
|
||||||
|
sum_len += strlen(seq[i]);
|
||||||
|
if (is_hpc) flag |= MM_I_HPC;
|
||||||
|
if (name == 0) flag |= MM_I_NO_NAME;
|
||||||
|
if (bucket_bits < 0) bucket_bits = 14;
|
||||||
|
mi = mm_idx_init(w, k, bucket_bits, flag);
|
||||||
|
mi->n_seq = n;
|
||||||
|
mi->seq = (mm_idx_seq_t*)kcalloc(mi->km, n, sizeof(mm_idx_seq_t)); // ->seq is allocated from km
|
||||||
|
mi->S = (uint32_t*)calloc((sum_len + 7) / 8, 4);
|
||||||
|
for (i = 0, sum_len = 0; i < n; ++i) {
|
||||||
|
const char *s = seq[i];
|
||||||
|
mm_idx_seq_t *p = &mi->seq[i];
|
||||||
|
uint32_t j;
|
||||||
|
if (name && name[i]) {
|
||||||
|
p->name = (char*)kmalloc(mi->km, strlen(name[i]) + 1);
|
||||||
|
strcpy(p->name, name[i]);
|
||||||
|
}
|
||||||
|
p->offset = sum_len;
|
||||||
|
p->len = strlen(s);
|
||||||
|
for (j = 0; j < p->len; ++j) {
|
||||||
|
int c = seq_nt4_table[(uint8_t)s[j]];
|
||||||
|
uint64_t o = sum_len + j;
|
||||||
|
mm_seq4_set(mi->S, o, c);
|
||||||
|
}
|
||||||
|
sum_len += p->len;
|
||||||
|
if (p->len > 0) {
|
||||||
|
a.n = 0;
|
||||||
|
mm_sketch(0, s, p->len, w, k, i, is_hpc, &a);
|
||||||
|
mm_idx_add(mi, a.n, a.a);
|
||||||
|
}
|
||||||
|
}
|
||||||
|
free(a.a);
|
||||||
|
mm_idx_post(mi, 1);
|
||||||
|
return mi;
|
||||||
|
}
|
||||||
|
|
||||||
/*************
|
/*************
|
||||||
* index I/O *
|
* index I/O *
|
||||||
*************/
|
*************/
|
||||||
@@ -320,7 +393,7 @@ void mm_idx_dump(FILE *fp, const mm_idx_t *mi)
|
|||||||
uint32_t x[5];
|
uint32_t x[5];
|
||||||
int i;
|
int i;
|
||||||
|
|
||||||
x[0] = mi->w, x[1] = mi->k, x[2] = mi->b, x[3] = mi->n_seq, x[4] = mi->is_hpc;
|
x[0] = mi->w, x[1] = mi->k, x[2] = mi->b, x[3] = mi->n_seq, x[4] = mi->flag;
|
||||||
fwrite(MM_IDX_MAGIC, 1, 4, fp);
|
fwrite(MM_IDX_MAGIC, 1, 4, fp);
|
||||||
fwrite(x, 4, 5, fp);
|
fwrite(x, 4, 5, fp);
|
||||||
for (i = 0; i < mi->n_seq; ++i) {
|
for (i = 0; i < mi->n_seq; ++i) {
|
||||||
@@ -347,6 +420,7 @@ void mm_idx_dump(FILE *fp, const mm_idx_t *mi)
|
|||||||
fwrite(x, 8, 2, fp);
|
fwrite(x, 8, 2, fp);
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
if (!(mi->flag & MM_I_NO_SEQ))
|
||||||
fwrite(mi->S, 4, (sum_len + 7) / 8, fp);
|
fwrite(mi->S, 4, (sum_len + 7) / 8, fp);
|
||||||
fflush(fp);
|
fflush(fp);
|
||||||
}
|
}
|
||||||
@@ -364,12 +438,12 @@ mm_idx_t *mm_idx_load(FILE *fp)
|
|||||||
if (fread(x, 4, 5, fp) != 5) return 0;
|
if (fread(x, 4, 5, fp) != 5) return 0;
|
||||||
mi = mm_idx_init(x[0], x[1], x[2], x[4]);
|
mi = mm_idx_init(x[0], x[1], x[2], x[4]);
|
||||||
mi->n_seq = x[3];
|
mi->n_seq = x[3];
|
||||||
mi->seq = (mm_idx_seq_t*)calloc(mi->n_seq, sizeof(mm_idx_seq_t));
|
mi->seq = (mm_idx_seq_t*)kcalloc(mi->km, mi->n_seq, sizeof(mm_idx_seq_t));
|
||||||
for (i = 0; i < mi->n_seq; ++i) {
|
for (i = 0; i < mi->n_seq; ++i) {
|
||||||
uint8_t l;
|
uint8_t l;
|
||||||
mm_idx_seq_t *s = &mi->seq[i];
|
mm_idx_seq_t *s = &mi->seq[i];
|
||||||
fread(&l, 1, 1, fp);
|
fread(&l, 1, 1, fp);
|
||||||
s->name = (char*)malloc(l + 1);
|
s->name = (char*)kmalloc(mi->km, l + 1);
|
||||||
fread(s->name, 1, l, fp);
|
fread(s->name, 1, l, fp);
|
||||||
s->name[l] = 0;
|
s->name[l] = 0;
|
||||||
fread(&s->len, 4, 1, fp);
|
fread(&s->len, 4, 1, fp);
|
||||||
@@ -397,26 +471,75 @@ mm_idx_t *mm_idx_load(FILE *fp)
|
|||||||
kh_val(h, k) = x[1];
|
kh_val(h, k) = x[1];
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
if (!(mi->flag & MM_I_NO_SEQ)) {
|
||||||
mi->S = (uint32_t*)malloc((sum_len + 7) / 8 * 4);
|
mi->S = (uint32_t*)malloc((sum_len + 7) / 8 * 4);
|
||||||
fread(mi->S, 4, (sum_len + 7) / 8, fp);
|
fread(mi->S, 4, (sum_len + 7) / 8, fp);
|
||||||
|
}
|
||||||
return mi;
|
return mi;
|
||||||
}
|
}
|
||||||
|
|
||||||
int mm_idx_is_idx(const char *fn)
|
int64_t mm_idx_is_idx(const char *fn)
|
||||||
{
|
{
|
||||||
int fd, is_idx = 0;
|
int fd, is_idx = 0;
|
||||||
off_t ret;
|
off_t ret, off_end;
|
||||||
char magic[4];
|
char magic[4];
|
||||||
|
|
||||||
if (strcmp(fn, "-") == 0) return 0; // read from pipe; not an index
|
if (strcmp(fn, "-") == 0) return 0; // read from pipe; not an index
|
||||||
fd = open(fn, O_RDONLY);
|
fd = open(fn, O_RDONLY);
|
||||||
if (fd < 0) return -1; // error
|
if (fd < 0) return -1; // error
|
||||||
if ((ret = lseek(fd, 0, SEEK_END)) >= 4) {
|
if ((off_end = lseek(fd, 0, SEEK_END)) >= 4) {
|
||||||
lseek(fd, 0, SEEK_SET);
|
lseek(fd, 0, SEEK_SET);
|
||||||
ret = read(fd, magic, 4);
|
ret = read(fd, magic, 4);
|
||||||
if (ret == 4 && strncmp(magic, MM_IDX_MAGIC, 4) == 0)
|
if (ret == 4 && strncmp(magic, MM_IDX_MAGIC, 4) == 0)
|
||||||
is_idx = 1;
|
is_idx = 1;
|
||||||
}
|
}
|
||||||
close(fd);
|
close(fd);
|
||||||
return is_idx;
|
return is_idx? off_end : 0;
|
||||||
|
}
|
||||||
|
|
||||||
|
mm_idx_reader_t *mm_idx_reader_open(const char *fn, const mm_idxopt_t *opt, const char *fn_out)
|
||||||
|
{
|
||||||
|
int64_t is_idx;
|
||||||
|
mm_idx_reader_t *r;
|
||||||
|
is_idx = mm_idx_is_idx(fn);
|
||||||
|
if (is_idx < 0) return 0; // failed to open the index
|
||||||
|
r = (mm_idx_reader_t*)calloc(1, sizeof(mm_idx_reader_t));
|
||||||
|
r->is_idx = is_idx;
|
||||||
|
if (opt) r->opt = *opt;
|
||||||
|
else mm_idxopt_init(&r->opt);
|
||||||
|
if (r->is_idx) {
|
||||||
|
r->fp.idx = fopen(fn, "rb");
|
||||||
|
r->idx_size = is_idx;
|
||||||
|
} else r->fp.seq = mm_bseq_open(fn);
|
||||||
|
if (fn_out) r->fp_out = fopen(fn_out, "wb");
|
||||||
|
return r;
|
||||||
|
}
|
||||||
|
|
||||||
|
void mm_idx_reader_close(mm_idx_reader_t *r)
|
||||||
|
{
|
||||||
|
if (r->is_idx) fclose(r->fp.idx);
|
||||||
|
else mm_bseq_close(r->fp.seq);
|
||||||
|
if (r->fp_out) fclose(r->fp_out);
|
||||||
|
free(r);
|
||||||
|
}
|
||||||
|
|
||||||
|
mm_idx_t *mm_idx_reader_read(mm_idx_reader_t *r, int n_threads)
|
||||||
|
{
|
||||||
|
mm_idx_t *mi;
|
||||||
|
if (r->is_idx) {
|
||||||
|
mi = mm_idx_load(r->fp.idx);
|
||||||
|
if (mi && mm_verbose >= 2 && (mi->k != r->opt.k || mi->w != r->opt.w || (mi->flag&MM_I_HPC) != (r->opt.flag&MM_I_HPC)))
|
||||||
|
fprintf(stderr, "[WARNING]\033[1;31m Indexing parameters (-k, -w or -H) overridden by parameters used in the prebuilt index.\033[0m\n");
|
||||||
|
} else
|
||||||
|
mi = mm_idx_gen(r->fp.seq, r->opt.w, r->opt.k, r->opt.bucket_bits, r->opt.flag, r->opt.mini_batch_size, n_threads, r->opt.batch_size);
|
||||||
|
if (mi) {
|
||||||
|
if (r->fp_out) mm_idx_dump(r->fp_out, mi);
|
||||||
|
++r->n_parts;
|
||||||
|
}
|
||||||
|
return mi;
|
||||||
|
}
|
||||||
|
|
||||||
|
int mm_idx_reader_eof(const mm_idx_reader_t *r) // TODO: in extremely rare cases, mm_bseq_eof() might not work
|
||||||
|
{
|
||||||
|
return r->is_idx? (feof(r->fp.idx) || ftell(r->fp.idx) == r->idx_size) : mm_bseq_eof(r->fp.seq);
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -1,175 +1,144 @@
|
|||||||
#include <stdio.h>
|
#include <stdio.h>
|
||||||
#include <stdlib.h>
|
#include <stdlib.h>
|
||||||
#include <string.h>
|
#include <string.h>
|
||||||
#include <limits.h>
|
|
||||||
#include "kalloc.h"
|
#include "kalloc.h"
|
||||||
|
|
||||||
/* The whole thing is: ("@" for the kheader_t of the block, "-" for free
|
/* In kalloc, a *core* is a large chunk of contiguous memory. Each core is
|
||||||
* memory, and "+" for allocated memory. One char for one unit.)
|
* associated with a master header, which keeps the size of the current core
|
||||||
|
* and the pointer to next core. Kalloc allocates small *blocks* of memory from
|
||||||
|
* the cores and organizes free memory blocks in a circular single-linked list.
|
||||||
*
|
*
|
||||||
* This region is core 1. This region is core 2.
|
* In the following diagram, "@" stands for the header of a free block (of type
|
||||||
|
* header_t), "#" for the header of an allocated block (of type size_t), "-"
|
||||||
|
* for free memory, and "+" for allocated memory.
|
||||||
*
|
*
|
||||||
* @-------@++++++@++++++++++++@------------ @----------@++++++++++++@+++++++@------------
|
* master This region is core 1. master This region is core 2.
|
||||||
|
* | |
|
||||||
|
* *@-------#++++++#++++++++++++@-------- *@----------#++++++++++++#+++++++@------------
|
||||||
* | | | |
|
* | | | |
|
||||||
* p=p->ptr->ptr->ptr->ptr p->ptr p->ptr->ptr p->ptr->ptr->ptr
|
* p=p->ptr->ptr->ptr->ptr p->ptr p->ptr->ptr p->ptr->ptr->ptr
|
||||||
*/
|
*/
|
||||||
|
|
||||||
#define PTR(p) ((size_t*)((size_t*)p)[1])
|
#define MIN_CORE_SIZE 0x80000
|
||||||
|
|
||||||
typedef struct _allocated_t {
|
typedef struct header_t {
|
||||||
struct _allocated_t *next;
|
size_t size;
|
||||||
size_t *ptr;
|
struct header_t *ptr;
|
||||||
} allocated_t;
|
} header_t;
|
||||||
|
|
||||||
typedef struct {
|
typedef struct {
|
||||||
size_t base[2], *loop_head;
|
header_t base, *loop_head, *core_head; /* base is a zero-sized block always kept in the loop */
|
||||||
allocated_t list_head, *list_tail;
|
|
||||||
size_t total_allocated;
|
|
||||||
} kmem_t;
|
} kmem_t;
|
||||||
|
|
||||||
void *km_init()
|
static void panic(const char *s)
|
||||||
{
|
|
||||||
return calloc(1, sizeof(kmem_t));
|
|
||||||
}
|
|
||||||
|
|
||||||
static void kerror(const char *s)
|
|
||||||
{
|
{
|
||||||
fprintf(stderr, "%s\n", s);
|
fprintf(stderr, "%s\n", s);
|
||||||
exit(1);
|
abort();
|
||||||
}
|
}
|
||||||
|
|
||||||
static size_t *morecore(kmem_t *km, size_t nu)
|
void *km_init(void)
|
||||||
{
|
{
|
||||||
size_t rnu, *up;
|
return calloc(1, sizeof(kmem_t));
|
||||||
|
|
||||||
rnu = (nu + 0xfffff) & (~(size_t)0xfffff);
|
|
||||||
up = (size_t*)malloc(rnu * sizeof(size_t));
|
|
||||||
if (!up) { /* fail to allocate memory */
|
|
||||||
km_stat(km);
|
|
||||||
fprintf(stderr, "[morecore] %lu bytes requested but not available.\n", rnu * sizeof(size_t));
|
|
||||||
exit(1);
|
|
||||||
}
|
|
||||||
/* put the pointer in km->list_head */
|
|
||||||
if (km->list_tail == 0) km->list_tail = &km->list_head;
|
|
||||||
km->list_tail->ptr = up;
|
|
||||||
km->list_tail->next = (allocated_t*)calloc(1, sizeof(allocated_t));
|
|
||||||
km->list_tail = km->list_tail->next;
|
|
||||||
|
|
||||||
km->total_allocated += rnu * sizeof(size_t);
|
|
||||||
*up = rnu; /* the size of the current block, and in this case the block is the same as the new core */
|
|
||||||
kfree(km, up + 1); /* initialize the new "core" */
|
|
||||||
return km->loop_head;
|
|
||||||
}
|
}
|
||||||
|
|
||||||
void km_destroy(void *_km)
|
void km_destroy(void *_km)
|
||||||
{
|
{
|
||||||
kmem_t *km = (kmem_t*)_km;
|
kmem_t *km = (kmem_t*)_km;
|
||||||
allocated_t *p, *q;
|
header_t *p, *q;
|
||||||
if (km == 0) return;
|
if (km == NULL) return;
|
||||||
p = &km->list_head;
|
for (p = km->core_head; p != NULL;) {
|
||||||
do {
|
q = p->ptr;
|
||||||
q = p->next;
|
free(p);
|
||||||
free(p->ptr);
|
|
||||||
if (p != &km->list_head) free(p);
|
|
||||||
p = q;
|
p = q;
|
||||||
} while (p && p->next);
|
}
|
||||||
if (p != &km->list_head) free(p);
|
|
||||||
free(km);
|
free(km);
|
||||||
}
|
}
|
||||||
|
|
||||||
void kfree(void *_km, void *ap)
|
static header_t *morecore(kmem_t *km, size_t nu)
|
||||||
{
|
{
|
||||||
size_t *p, *q;
|
header_t *q;
|
||||||
|
size_t bytes, *p;
|
||||||
|
nu = (nu + 1 + (MIN_CORE_SIZE - 1)) / MIN_CORE_SIZE * MIN_CORE_SIZE; /* the first +1 for core header */
|
||||||
|
bytes = nu * sizeof(header_t);
|
||||||
|
q = (header_t*)malloc(bytes);
|
||||||
|
if (!q) panic("[morecore] insufficient memory");
|
||||||
|
q->ptr = km->core_head, q->size = nu, km->core_head = q;
|
||||||
|
p = (size_t*)(q + 1);
|
||||||
|
*p = nu - 1; /* the size of the free block; -1 because the first unit is used for the core header */
|
||||||
|
kfree(km, p + 1); /* initialize the new "core"; NB: the core header is not looped. */
|
||||||
|
return km->loop_head;
|
||||||
|
}
|
||||||
|
|
||||||
|
void kfree(void *_km, void *ap) /* kfree() also adds a new core to the circular list */
|
||||||
|
{
|
||||||
|
header_t *p, *q;
|
||||||
kmem_t *km = (kmem_t*)_km;
|
kmem_t *km = (kmem_t*)_km;
|
||||||
|
|
||||||
if (!ap) return;
|
if (!ap) return;
|
||||||
if (km == 0) {
|
if (km == NULL) {
|
||||||
free(ap);
|
free(ap);
|
||||||
return;
|
return;
|
||||||
}
|
}
|
||||||
p = (size_t*)ap - 1; /* *p is the size of the current block */
|
p = (header_t*)((size_t*)ap - 1);
|
||||||
|
p->size = *((size_t*)ap - 1);
|
||||||
/* Find the pointer that points to the block to be freed. The following loop can stop on two conditions:
|
/* Find the pointer that points to the block to be freed. The following loop can stop on two conditions:
|
||||||
*
|
*
|
||||||
* a) "p>q && p<q->ptr": @------@++++++++@+++++++@------- @---------------@+++++++@-------
|
* a) "p>q && p<q->ptr": @------#++++++++#+++++++@------- @---------------#+++++++@-------
|
||||||
* (can also be in | | | -> | |
|
* (can also be in | | | -> | |
|
||||||
* two cores) q p q->ptr q q->ptr
|
* two cores) q p q->ptr q q->ptr
|
||||||
*
|
*
|
||||||
* @-------- @+++++++++@-------- @-------- @------------------
|
* @-------- #+++++++++@-------- @-------- @------------------
|
||||||
* | | | -> | |
|
* | | | -> | |
|
||||||
* q p q->ptr q q->ptr
|
* q p q->ptr q q->ptr
|
||||||
*
|
*
|
||||||
* b) "q>=q->ptr && (p>q || p<q->ptr)": @-------@+++++ @--------@+++++++ @-------@+++++ @----------------
|
* b) "q>=q->ptr && (p>q || p<q->ptr)": @-------#+++++ @--------#+++++++ @-------#+++++ @----------------
|
||||||
* | | | -> | |
|
* | | | -> | |
|
||||||
* q->ptr q p q->ptr q
|
* q->ptr q p q->ptr q
|
||||||
*
|
*
|
||||||
* @+++++++@----- @++++++++@------- @------------- @++++++++@-------
|
* #+++++++@----- #++++++++@------- @------------- #++++++++@-------
|
||||||
* | | | -> | |
|
* | | | -> | |
|
||||||
* p q->ptr q q->ptr q
|
* p q->ptr q q->ptr q
|
||||||
*/
|
*/
|
||||||
for (q = km->loop_head; !(p > q && p < PTR(q)); q = PTR(q))
|
for (q = km->loop_head; !(p > q && p < q->ptr); q = q->ptr)
|
||||||
if (q >= PTR(q) && (p > q || p < PTR(q))) break;
|
if (q >= q->ptr && (p > q || p < q->ptr)) break;
|
||||||
if (p + (*p) == PTR(q)) { /* two adjacent blocks, merge p and q->ptr (the 2nd and 4th cases) */
|
if (p + p->size == q->ptr) { /* two adjacent blocks, merge p and q->ptr (the 2nd and 4th cases) */
|
||||||
*p += *PTR(q); /* this is the new q->ptr size */
|
p->size += q->ptr->size;
|
||||||
p[1] = (size_t)PTR(PTR(q)); /* this is the new q->ptr->ptr */
|
p->ptr = q->ptr->ptr;
|
||||||
/* p is actually the new q->ptr. The actual change happens a few lines below. */
|
} else if (p + p->size > q->ptr && q->ptr >= p) {
|
||||||
} else if (p + (*p) > PTR(q) && PTR(q) >= p) { /* the end of the allocated block is in the next free block */
|
panic("[kfree] The end of the allocated block enters a free block.");
|
||||||
kerror("[kfree] The end of the allocated block enters a free block.");
|
} else p->ptr = q->ptr; /* backup q->ptr */
|
||||||
} else p[1] = (size_t)PTR(q); /* backup q->ptr */
|
|
||||||
|
|
||||||
if (q + (*q) == p) { /* two adjacent blocks, merge q and p (the other two cases) */
|
if (q + q->size == p) { /* two adjacent blocks, merge q and p (the other two cases) */
|
||||||
*q += *p;
|
q->size += p->size;
|
||||||
q[1] = (size_t)PTR(p);
|
q->ptr = p->ptr;
|
||||||
km->loop_head = q;
|
km->loop_head = q;
|
||||||
} else if (q + (*q) > p && p >= q) { /* the end of a free block in the allocated block */
|
} else if (q + q->size > p && p >= q) {
|
||||||
kerror("[kfree] The end of a free block enters the allocated block.");
|
panic("[kfree] The end of a free block enters the allocated block.");
|
||||||
} else km->loop_head = p, q[1] = (size_t)p; /* in two cores, cannot be merged */
|
} else km->loop_head = p, q->ptr = p; /* in two cores, cannot be merged; create a new block in the list */
|
||||||
}
|
|
||||||
|
|
||||||
void *krealloc(void *_km, void *ap, size_t n_bytes)
|
|
||||||
{
|
|
||||||
kmem_t *km = (kmem_t*)_km;
|
|
||||||
size_t n_units, *p, *q;
|
|
||||||
|
|
||||||
if (n_bytes == 0) {
|
|
||||||
kfree(km, ap); return 0;
|
|
||||||
}
|
|
||||||
if (km == 0) return realloc(ap, n_bytes);
|
|
||||||
if (!ap) return kmalloc(km, n_bytes);
|
|
||||||
n_units = 1 + (n_bytes + sizeof(size_t) - 1) / sizeof(size_t);
|
|
||||||
p = (size_t*)ap - 1;
|
|
||||||
if (*p >= n_units) return ap; /* TODO: this prevents shrinking */
|
|
||||||
q = (size_t*)kmalloc(km, n_bytes);
|
|
||||||
memcpy(q, ap, (*p - 1) * sizeof(size_t));
|
|
||||||
kfree(km, ap);
|
|
||||||
return q;
|
|
||||||
}
|
}
|
||||||
|
|
||||||
void *kmalloc(void *_km, size_t n_bytes)
|
void *kmalloc(void *_km, size_t n_bytes)
|
||||||
{
|
{
|
||||||
kmem_t *km = (kmem_t*)_km;
|
kmem_t *km = (kmem_t*)_km;
|
||||||
size_t n_units, *p, *q;
|
size_t n_units;
|
||||||
|
header_t *p, *q;
|
||||||
|
|
||||||
if (n_bytes == 0) return 0;
|
if (n_bytes == 0) return 0;
|
||||||
if (km == 0) return malloc(n_bytes);
|
if (km == NULL) return malloc(n_bytes);
|
||||||
/* "n_units" means the number of units. The size of one unit equals to sizeof(kheader_t).
|
n_units = (n_bytes + sizeof(size_t) + sizeof(header_t) - 1) / sizeof(header_t) + 1;
|
||||||
* "1" is the kheader_t of a block, which is always required. */
|
|
||||||
n_units = 1 + (n_bytes + sizeof(size_t) - 1) / sizeof(size_t);
|
|
||||||
if (n_units&1) ++n_units; /* make n_units an even number, or it will segfault if only one unit remains */
|
|
||||||
|
|
||||||
if (!(q = km->loop_head)) { /* the first time when kmalloc() is called, intialization */
|
if (!(q = km->loop_head)) /* the first time when kmalloc() is called, intialize it */
|
||||||
km->base[1] = (size_t)(km->loop_head = q = km->base); *q = 0;
|
q = km->loop_head = km->base.ptr = &km->base;
|
||||||
}
|
for (p = q->ptr;; q = p, p = p->ptr) { /* search for a suitable block */
|
||||||
for (p = PTR(q);; q = p, p = PTR(p)) { /* search for a suitable block */
|
if (p->size >= n_units) { /* p->size if the size of current block. This line means the current block is large enough. */
|
||||||
if (*p >= n_units) { /* p->size if the size of current block. This line means the current block is large enough. */
|
if (p->size == n_units) q->ptr = p->ptr; /* no need to split the block */
|
||||||
if (*p == n_units) q[1] = (size_t)PTR(p); /* no need to split the block */
|
else { /* split the block. NB: memory is allocated at the end of the block! */
|
||||||
else { /* split the block */
|
p->size -= n_units; /* reduce the size of the free block */
|
||||||
/* memory is allocated at the end of the block */
|
p += p->size; /* p points to the allocated block */
|
||||||
*p -= n_units; /* reduce the size of the free block */
|
*(size_t*)p = n_units; /* set the size */
|
||||||
p += *p; /* skip to the kheader_t of the allocated block */
|
|
||||||
*p = n_units; /* set the size */
|
|
||||||
}
|
}
|
||||||
km->loop_head = q; /* set the end of chain */
|
km->loop_head = q; /* set the end of chain */
|
||||||
return p + 1; /* skip the kheader_t */
|
return (size_t*)p + 1;
|
||||||
}
|
}
|
||||||
if (p == km->loop_head) { /* then ask for more "cores" */
|
if (p == km->loop_head) { /* then ask for more "cores" */
|
||||||
if ((p = morecore(km, n_units)) == 0) return 0;
|
if ((p = morecore(km, n_units)) == 0) return 0;
|
||||||
@@ -182,33 +151,48 @@ void *kcalloc(void *_km, size_t count, size_t size)
|
|||||||
kmem_t *km = (kmem_t*)_km;
|
kmem_t *km = (kmem_t*)_km;
|
||||||
void *p;
|
void *p;
|
||||||
if (size == 0 || count == 0) return 0;
|
if (size == 0 || count == 0) return 0;
|
||||||
if (km == 0) return calloc(count, size);
|
if (km == NULL) return calloc(count, size);
|
||||||
p = kmalloc(km, count * size);
|
p = kmalloc(km, count * size);
|
||||||
memset(p, 0, count * size);
|
memset(p, 0, count * size);
|
||||||
return p;
|
return p;
|
||||||
}
|
}
|
||||||
|
|
||||||
void km_stat(const void *_km)
|
void *krealloc(void *_km, void *ap, size_t n_bytes) // TODO: this can be made more efficient in principle
|
||||||
{
|
{
|
||||||
kmem_t *km = (kmem_t*)_km;
|
kmem_t *km = (kmem_t*)_km;
|
||||||
unsigned n_blocks, n_units;
|
size_t n_units, *p, *q;
|
||||||
size_t max_block = 0, *p, *q;
|
|
||||||
float frag;
|
|
||||||
|
|
||||||
if (km == 0 || !(p = km->loop_head)) return;
|
if (n_bytes == 0) {
|
||||||
n_blocks = n_units = 0;
|
kfree(km, ap); return 0;
|
||||||
do {
|
}
|
||||||
q = PTR(p);
|
if (km == NULL) return realloc(ap, n_bytes);
|
||||||
if (*p > max_block) max_block = *p;
|
if (ap == NULL) return kmalloc(km, n_bytes);
|
||||||
n_units += *p;
|
n_units = (n_bytes + sizeof(size_t) + sizeof(header_t) - 1) / sizeof(header_t);
|
||||||
if (p + (*p) > q && q > p)
|
p = (size_t*)ap - 1;
|
||||||
kerror("[kr_stat] The end of a free block enters another free block.");
|
if (*p >= n_units) return ap; /* TODO: this prevents shrinking */
|
||||||
p = q;
|
q = (size_t*)kmalloc(km, n_bytes);
|
||||||
++n_blocks;
|
memcpy(q, ap, (*p - 1) * sizeof(header_t));
|
||||||
} while (p != km->loop_head);
|
kfree(km, ap);
|
||||||
|
return q;
|
||||||
|
}
|
||||||
|
|
||||||
--n_blocks;
|
void km_stat(const void *_km, km_stat_t *s)
|
||||||
frag = 1.0/1024.0 * n_units * sizeof(size_t) / n_blocks;
|
{
|
||||||
fprintf(stderr, "[kr_stat] tot=%lu, free=%lu, n_block=%u, max_block=%lu, frag_len=%.3fK\n",
|
kmem_t *km = (kmem_t*)_km;
|
||||||
km->total_allocated, n_units * sizeof(size_t), n_blocks, max_block * sizeof(size_t), frag);
|
header_t *p;
|
||||||
|
memset(s, 0, sizeof(km_stat_t));
|
||||||
|
if (km == NULL || km->loop_head == NULL) return;
|
||||||
|
for (p = km->loop_head;; p = p->ptr) {
|
||||||
|
s->available += p->size * sizeof(header_t);
|
||||||
|
if (p->size != 0) ++s->n_blocks; /* &kmem_t::base is always one of the cores. It is zero-sized. */
|
||||||
|
if (p->ptr > p && p + p->size > p->ptr)
|
||||||
|
panic("[km_stat] The end of a free block enters another free block.");
|
||||||
|
if (p->ptr == km->loop_head) break;
|
||||||
|
}
|
||||||
|
for (p = km->core_head; p != NULL; p = p->ptr) {
|
||||||
|
size_t size = p->size * sizeof(header_t);
|
||||||
|
++s->n_cores;
|
||||||
|
s->capacity += size;
|
||||||
|
s->largest = s->largest > size? s->largest : size;
|
||||||
|
}
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -1,14 +1,16 @@
|
|||||||
#ifndef _KALLOC_H_
|
#ifndef _KALLOC_H_
|
||||||
#define _KALLOC_H_
|
#define _KALLOC_H_
|
||||||
|
|
||||||
#include <stdlib.h>
|
#include <stddef.h> /* for size_t */
|
||||||
|
|
||||||
#define km_size(x) (*(((size_t*)(x))-1) * sizeof(size_t))
|
|
||||||
|
|
||||||
#ifdef __cplusplus
|
#ifdef __cplusplus
|
||||||
extern "C" {
|
extern "C" {
|
||||||
#endif
|
#endif
|
||||||
|
|
||||||
|
typedef struct {
|
||||||
|
size_t capacity, available, n_blocks, n_cores, largest;
|
||||||
|
} km_stat_t;
|
||||||
|
|
||||||
void *kmalloc(void *km, size_t size);
|
void *kmalloc(void *km, size_t size);
|
||||||
void *krealloc(void *km, void *ptr, size_t size);
|
void *krealloc(void *km, void *ptr, size_t size);
|
||||||
void *kcalloc(void *km, size_t count, size_t size);
|
void *kcalloc(void *km, size_t count, size_t size);
|
||||||
@@ -16,8 +18,7 @@ void kfree(void *km, void *ptr);
|
|||||||
|
|
||||||
void *km_init(void);
|
void *km_init(void);
|
||||||
void km_destroy(void *km);
|
void km_destroy(void *km);
|
||||||
|
void km_stat(const void *_km, km_stat_t *s);
|
||||||
void km_stat(const void *km); // TODO: return numbers instead of print to stderr
|
|
||||||
|
|
||||||
#ifdef __cplusplus
|
#ifdef __cplusplus
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -3,11 +3,12 @@
|
|||||||
|
|
||||||
#include <stdlib.h>
|
#include <stdlib.h>
|
||||||
#include <string.h>
|
#include <string.h>
|
||||||
|
#include <stdint.h>
|
||||||
#include "kalloc.h"
|
#include "kalloc.h"
|
||||||
|
|
||||||
#define __KDQ_TYPE(type) \
|
#define __KDQ_TYPE(type) \
|
||||||
typedef struct { \
|
typedef struct { \
|
||||||
size_t front:58, bits:6, count, mask; \
|
uint64_t front:58, bits:6, count, mask; \
|
||||||
type *a; \
|
type *a; \
|
||||||
void *km; \
|
void *km; \
|
||||||
} kdq_##type##_t;
|
} kdq_##type##_t;
|
||||||
|
|||||||
@@ -30,6 +30,7 @@
|
|||||||
|
|
||||||
#include <stdlib.h>
|
#include <stdlib.h>
|
||||||
#include <string.h>
|
#include <string.h>
|
||||||
|
#include <assert.h>
|
||||||
|
|
||||||
typedef struct {
|
typedef struct {
|
||||||
void *left, *right;
|
void *left, *right;
|
||||||
@@ -78,6 +79,7 @@ typedef const char *ksstr_t;
|
|||||||
#define KSORT_INIT_STR KSORT_INIT(str, ksstr_t, ks_lt_str)
|
#define KSORT_INIT_STR KSORT_INIT(str, ksstr_t, ks_lt_str)
|
||||||
|
|
||||||
#define RS_MIN_SIZE 64
|
#define RS_MIN_SIZE 64
|
||||||
|
#define RS_MAX_BITS 8
|
||||||
|
|
||||||
#define KRADIX_SORT_INIT(name, rstype_t, rskey, sizeof_key) \
|
#define KRADIX_SORT_INIT(name, rstype_t, rskey, sizeof_key) \
|
||||||
typedef struct { \
|
typedef struct { \
|
||||||
@@ -98,7 +100,8 @@ typedef const char *ksstr_t;
|
|||||||
{ \
|
{ \
|
||||||
rstype_t *i; \
|
rstype_t *i; \
|
||||||
int size = 1<<n_bits, m = size - 1; \
|
int size = 1<<n_bits, m = size - 1; \
|
||||||
rsbucket_##name##_t *k, b[size], *be = b + size; \
|
rsbucket_##name##_t *k, b[1<<RS_MAX_BITS], *be = b + size; \
|
||||||
|
assert(n_bits <= RS_MAX_BITS); \
|
||||||
for (k = b; k != be; ++k) k->b = k->e = beg; \
|
for (k = b; k != be; ++k) k->b = k->e = beg; \
|
||||||
for (i = beg; i != end; ++i) ++b[rskey(*i)>>s&m].e; \
|
for (i = beg; i != end; ++i) ++b[rskey(*i)>>s&m].e; \
|
||||||
for (k = b + 1; k != be; ++k) \
|
for (k = b + 1; k != be; ++k) \
|
||||||
@@ -127,7 +130,7 @@ typedef const char *ksstr_t;
|
|||||||
void radix_sort_##name(rstype_t *beg, rstype_t *end) \
|
void radix_sort_##name(rstype_t *beg, rstype_t *end) \
|
||||||
{ \
|
{ \
|
||||||
if (end - beg <= RS_MIN_SIZE) rs_insertsort_##name(beg, end); \
|
if (end - beg <= RS_MIN_SIZE) rs_insertsort_##name(beg, end); \
|
||||||
else rs_sort_##name(beg, end, 8, sizeof_key * 8 - 8); \
|
else rs_sort_##name(beg, end, RS_MAX_BITS, (sizeof_key - 1) * RS_MAX_BITS); \
|
||||||
}
|
}
|
||||||
|
|
||||||
#endif
|
#endif
|
||||||
|
|||||||
@@ -12,6 +12,9 @@
|
|||||||
#define KSW_EZ_APPROX_DROP 0x10 // approximate Z-drop; faster with sse
|
#define KSW_EZ_APPROX_DROP 0x10 // approximate Z-drop; faster with sse
|
||||||
#define KSW_EZ_EXTZ_ONLY 0x40 // only perform extension
|
#define KSW_EZ_EXTZ_ONLY 0x40 // only perform extension
|
||||||
#define KSW_EZ_REV_CIGAR 0x80 // reverse CIGAR in the output
|
#define KSW_EZ_REV_CIGAR 0x80 // reverse CIGAR in the output
|
||||||
|
#define KSW_EZ_SPLICE_FOR 0x100
|
||||||
|
#define KSW_EZ_SPLICE_REV 0x200
|
||||||
|
#define KSW_EZ_SPLICE_FLANK 0x400
|
||||||
|
|
||||||
#ifdef __cplusplus
|
#ifdef __cplusplus
|
||||||
extern "C" {
|
extern "C" {
|
||||||
@@ -24,6 +27,7 @@ typedef struct {
|
|||||||
int mte, mte_q; // max score when reaching the end of target
|
int mte, mte_q; // max score when reaching the end of target
|
||||||
int score; // max score reaching both ends; may be KSW_NEG_INF
|
int score; // max score reaching both ends; may be KSW_NEG_INF
|
||||||
int m_cigar, n_cigar;
|
int m_cigar, n_cigar;
|
||||||
|
int reach_end;
|
||||||
uint32_t *cigar;
|
uint32_t *cigar;
|
||||||
} ksw_extz_t;
|
} ksw_extz_t;
|
||||||
|
|
||||||
@@ -39,19 +43,27 @@ typedef struct {
|
|||||||
* @param mat m*m scoring mattrix in one-dimension array
|
* @param mat m*m scoring mattrix in one-dimension array
|
||||||
* @param gapo gap open penalty; a gap of length l cost "-(gapo+l*gape)"
|
* @param gapo gap open penalty; a gap of length l cost "-(gapo+l*gape)"
|
||||||
* @param gape gap extension penalty
|
* @param gape gap extension penalty
|
||||||
* @param w band width
|
* @param w band width (<0 to disable)
|
||||||
* @param zdrop off-diagonal drop-off to stop extension (positive)
|
* @param zdrop off-diagonal drop-off to stop extension (positive; <0 to disable)
|
||||||
* @param flag flag (see KSW_EZ_* macros)
|
* @param flag flag (see KSW_EZ_* macros)
|
||||||
* @param ez (out) scores and cigar
|
* @param ez (out) scores and cigar
|
||||||
*/
|
*/
|
||||||
void ksw_extz(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int flag, ksw_extz_t *ez);
|
void ksw_extz(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||||
void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int flag, ksw_extz_t *ez);
|
int8_t q, int8_t e, int w, int zdrop, int flag, ksw_extz_t *ez);
|
||||||
|
|
||||||
|
void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||||
|
int8_t q, int8_t e, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
|
||||||
|
|
||||||
void ksw_extd(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
void ksw_extd(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||||
int8_t gapo, int8_t gape, int8_t gapo2, int8_t gape2, int w, int zdrop, int flag, ksw_extz_t *ez);
|
int8_t gapo, int8_t gape, int8_t gapo2, int8_t gape2, int w, int zdrop, int flag, ksw_extz_t *ez);
|
||||||
|
|
||||||
void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||||
int8_t gapo, int8_t gape, int8_t gapo2, int8_t gape2, int w, int zdrop, int flag, ksw_extz_t *ez);
|
int8_t gapo, int8_t gape, int8_t gapo2, int8_t gape2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
|
||||||
|
|
||||||
|
void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||||
|
int8_t gapo, int8_t gape, int8_t gapo2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez);
|
||||||
|
|
||||||
|
void ksw_extf2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t mch, int8_t mis, int8_t e, int w, int xdrop, ksw_extz_t *ez);
|
||||||
|
|
||||||
/**
|
/**
|
||||||
* Global alignment
|
* Global alignment
|
||||||
@@ -67,6 +79,9 @@ int ksw_gg(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *ta
|
|||||||
int ksw_gg2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t gapo, int8_t gape, int w, int *m_cigar_, int *n_cigar_, uint32_t **cigar_);
|
int ksw_gg2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t gapo, int8_t gape, int w, int *m_cigar_, int *n_cigar_, uint32_t **cigar_);
|
||||||
int ksw_gg2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t gapo, int8_t gape, int w, int *m_cigar_, int *n_cigar_, uint32_t **cigar_);
|
int ksw_gg2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t gapo, int8_t gape, int w, int *m_cigar_, int *n_cigar_, uint32_t **cigar_);
|
||||||
|
|
||||||
|
void *ksw_ll_qinit(void *km, int size, int qlen, const uint8_t *query, int m, const int8_t *mat);
|
||||||
|
int ksw_ll_i16(void *q, int tlen, const uint8_t *target, int gapo, int gape, int *qe, int *te);
|
||||||
|
|
||||||
#ifdef __cplusplus
|
#ifdef __cplusplus
|
||||||
}
|
}
|
||||||
#endif
|
#endif
|
||||||
@@ -101,21 +116,33 @@ static inline uint32_t *ksw_push_cigar(void *km, int *n_cigar, int *m_cigar, uin
|
|||||||
// bit 0-2: which type gets the max - 0 for H, 1 for E, 2 for F, 3 for \tilde{E} and 4 for \tilde{F}
|
// bit 0-2: which type gets the max - 0 for H, 1 for E, 2 for F, 3 for \tilde{E} and 4 for \tilde{F}
|
||||||
// bit 3/0x08: 1 if a continuation on the E state (bit 5/0x20 for a continuation on \tilde{E})
|
// bit 3/0x08: 1 if a continuation on the E state (bit 5/0x20 for a continuation on \tilde{E})
|
||||||
// bit 4/0x10: 1 if a continuation on the F state (bit 6/0x40 for a continuation on \tilde{F})
|
// bit 4/0x10: 1 if a continuation on the F state (bit 6/0x40 for a continuation on \tilde{F})
|
||||||
static inline void ksw_backtrack(void *km, int is_rot, int is_rev, const uint8_t *p, const int *off, int n_col, int i0, int j0, int *m_cigar_, int *n_cigar_, uint32_t **cigar_)
|
static inline void ksw_backtrack(void *km, int is_rot, int is_rev, int min_intron_len, const uint8_t *p, const int *off, const int *off_end, int n_col, int i0, int j0,
|
||||||
|
int *m_cigar_, int *n_cigar_, uint32_t **cigar_)
|
||||||
{ // p[] - lower 3 bits: which type gets the max; bit
|
{ // p[] - lower 3 bits: which type gets the max; bit
|
||||||
int n_cigar = 0, m_cigar = *m_cigar_, i = i0, j = j0, r, state = 0;
|
int n_cigar = 0, m_cigar = *m_cigar_, i = i0, j = j0, r, state = 0;
|
||||||
uint32_t *cigar = *cigar_, tmp;
|
uint32_t *cigar = *cigar_, tmp;
|
||||||
while (i >= 0 && j >= 0) { // at the beginning of the loop, _state_ tells us which state to check
|
while (i >= 0 && j >= 0) { // at the beginning of the loop, _state_ tells us which state to check
|
||||||
if (is_rot) r = i + j, tmp = p[r * n_col + i - off[r]];
|
int force_state = -1;
|
||||||
else tmp = p[i * n_col + j - off[i]];
|
if (is_rot) {
|
||||||
|
r = i + j;
|
||||||
|
if (i < off[r]) force_state = 2;
|
||||||
|
if (off_end && i > off_end[r]) force_state = 1;
|
||||||
|
tmp = force_state < 0? p[r * n_col + i - off[r]] : 0;
|
||||||
|
} else {
|
||||||
|
if (j < off[i]) force_state = 2;
|
||||||
|
if (off_end && j > off_end[i]) force_state = 1;
|
||||||
|
tmp = force_state < 0? p[i * n_col + j - off[i]] : 0;
|
||||||
|
}
|
||||||
if (state == 0) state = tmp & 7; // if requesting the H state, find state one maximizes it.
|
if (state == 0) state = tmp & 7; // if requesting the H state, find state one maximizes it.
|
||||||
else if (!(tmp >> (state + 2) & 1)) state = 0; // if requesting other states, _state_ stays the same if it is a continuation; otherwise, set to H
|
else if (!(tmp >> (state + 2) & 1)) state = 0; // if requesting other states, _state_ stays the same if it is a continuation; otherwise, set to H
|
||||||
if (state == 0) state = tmp & 7; // TODO: probably this line can be merged into the "else if" line right above; not 100% sure
|
if (state == 0) state = tmp & 7; // TODO: probably this line can be merged into the "else if" line right above; not 100% sure
|
||||||
|
if (force_state >= 0) state = force_state;
|
||||||
if (state == 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 0, 1), --i, --j; // match
|
if (state == 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 0, 1), --i, --j; // match
|
||||||
else if (state == 1 || state == 3) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 2, 1), --i; // deletion
|
else if (state == 1 || (state == 3 && min_intron_len <= 0)) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 2, 1), --i; // deletion
|
||||||
|
else if (state == 3 && min_intron_len > 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 3, 1), --i; // intron
|
||||||
else cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 1, 1), --j; // insertion
|
else cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 1, 1), --j; // insertion
|
||||||
}
|
}
|
||||||
if (i >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 2, i + 1); // first deletion
|
if (i >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, min_intron_len > 0 && i >= min_intron_len? 3 : 2, i + 1); // first deletion
|
||||||
if (j >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 1, j + 1); // first insertion
|
if (j >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 1, j + 1); // first insertion
|
||||||
if (!is_rev)
|
if (!is_rev)
|
||||||
for (i = 0; i < n_cigar>>1; ++i) // reverse CIGAR
|
for (i = 0; i < n_cigar>>1; ++i) // reverse CIGAR
|
||||||
@@ -127,7 +154,7 @@ static inline void ksw_reset_extz(ksw_extz_t *ez)
|
|||||||
{
|
{
|
||||||
ez->max_q = ez->max_t = ez->mqe_t = ez->mte_q = -1;
|
ez->max_q = ez->max_t = ez->mqe_t = ez->mte_q = -1;
|
||||||
ez->max = 0, ez->score = ez->mqe = ez->mte = KSW_NEG_INF;
|
ez->max = 0, ez->score = ez->mqe = ez->mte = KSW_NEG_INF;
|
||||||
ez->n_cigar = 0, ez->zdropped = 0;
|
ez->n_cigar = 0, ez->zdropped = 0, ez->reach_end = 0;
|
||||||
}
|
}
|
||||||
|
|
||||||
static inline int ksw_apply_zdrop(ksw_extz_t *ez, int is_rot, int32_t H, int a, int b, int zdrop, int8_t e)
|
static inline int ksw_apply_zdrop(ksw_extz_t *ez, int is_rot, int32_t H, int a, int b, int zdrop, int8_t e)
|
||||||
@@ -147,5 +174,4 @@ static inline int ksw_apply_zdrop(ksw_extz_t *ez, int is_rot, int32_t H, int a,
|
|||||||
}
|
}
|
||||||
return 0;
|
return 0;
|
||||||
}
|
}
|
||||||
|
|
||||||
#endif
|
#endif
|
||||||
|
|||||||
@@ -0,0 +1,97 @@
|
|||||||
|
#ifdef KSW_CPU_DISPATCH
|
||||||
|
#include <stdlib.h>
|
||||||
|
#include "ksw2.h"
|
||||||
|
|
||||||
|
#define SIMD_SSE 0x1
|
||||||
|
#define SIMD_SSE2 0x2
|
||||||
|
#define SIMD_SSE3 0x4
|
||||||
|
#define SIMD_SSSE3 0x8
|
||||||
|
#define SIMD_SSE4_1 0x10
|
||||||
|
#define SIMD_SSE4_2 0x20
|
||||||
|
#define SIMD_AVX 0x40
|
||||||
|
#define SIMD_AVX2 0x80
|
||||||
|
#define SIMD_AVX512F 0x100
|
||||||
|
|
||||||
|
#ifndef _MSC_VER
|
||||||
|
// adapted from https://github.com/01org/linux-sgx/blob/master/common/inc/internal/linux/cpuid_gnu.h
|
||||||
|
void __cpuidex(int cpuid[4], int func_id, int subfunc_id)
|
||||||
|
{
|
||||||
|
#if defined(__x86_64__)
|
||||||
|
asm volatile ("cpuid"
|
||||||
|
: "=a" (cpuid[0]), "=b" (cpuid[1]), "=c" (cpuid[2]), "=d" (cpuid[3])
|
||||||
|
: "0" (func_id), "2" (subfunc_id));
|
||||||
|
#else // on 32bit, ebx can NOT be used as PIC code
|
||||||
|
asm volatile ("xchgl %%ebx, %1; cpuid; xchgl %%ebx, %1"
|
||||||
|
: "=a" (cpuid[0]), "=r" (cpuid[1]), "=c" (cpuid[2]), "=d" (cpuid[3])
|
||||||
|
: "0" (func_id), "2" (subfunc_id));
|
||||||
|
#endif
|
||||||
|
}
|
||||||
|
#endif
|
||||||
|
|
||||||
|
int x86_simd(void)
|
||||||
|
{
|
||||||
|
int flag = 0, cpuid[4], max_id;
|
||||||
|
__cpuidex(cpuid, 0, 0);
|
||||||
|
max_id = cpuid[0];
|
||||||
|
if (max_id == 0) return 0;
|
||||||
|
__cpuidex(cpuid, 1, 0);
|
||||||
|
if (cpuid[3]>>25&1) flag |= SIMD_SSE;
|
||||||
|
if (cpuid[3]>>26&1) flag |= SIMD_SSE2;
|
||||||
|
if (cpuid[2]>>0 &1) flag |= SIMD_SSE3;
|
||||||
|
if (cpuid[2]>>9 &1) flag |= SIMD_SSSE3;
|
||||||
|
if (cpuid[2]>>19&1) flag |= SIMD_SSE4_1;
|
||||||
|
if (cpuid[2]>>20&1) flag |= SIMD_SSE4_2;
|
||||||
|
if (cpuid[2]>>28&1) flag |= SIMD_AVX;
|
||||||
|
if (max_id >= 7) {
|
||||||
|
__cpuidex(cpuid, 7, 0);
|
||||||
|
if (cpuid[1]>>5 &1) flag |= SIMD_AVX2;
|
||||||
|
if (cpuid[1]>>16&1) flag |= SIMD_AVX512F;
|
||||||
|
}
|
||||||
|
return flag;
|
||||||
|
}
|
||||||
|
|
||||||
|
void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez)
|
||||||
|
{
|
||||||
|
extern void ksw_extz2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
|
||||||
|
extern void ksw_extz2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
|
||||||
|
unsigned simd;
|
||||||
|
simd = x86_simd();
|
||||||
|
if (simd & SIMD_SSE4_1)
|
||||||
|
ksw_extz2_sse41(km, qlen, query, tlen, target, m, mat, q, e, w, zdrop, end_bonus, flag, ez);
|
||||||
|
else if (simd & SIMD_SSE2)
|
||||||
|
ksw_extz2_sse2(km, qlen, query, tlen, target, m, mat, q, e, w, zdrop, end_bonus, flag, ez);
|
||||||
|
else abort();
|
||||||
|
}
|
||||||
|
|
||||||
|
void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||||
|
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez)
|
||||||
|
{
|
||||||
|
extern void ksw_extd2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||||
|
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
|
||||||
|
extern void ksw_extd2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||||
|
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
|
||||||
|
unsigned simd;
|
||||||
|
simd = x86_simd();
|
||||||
|
if (simd & SIMD_SSE4_1)
|
||||||
|
ksw_extd2_sse41(km, qlen, query, tlen, target, m, mat, q, e, q2, e2, w, zdrop, end_bonus, flag, ez);
|
||||||
|
else if (simd & SIMD_SSE2)
|
||||||
|
ksw_extd2_sse2(km, qlen, query, tlen, target, m, mat, q, e, q2, e2, w, zdrop, end_bonus, flag, ez);
|
||||||
|
else abort();
|
||||||
|
}
|
||||||
|
|
||||||
|
void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||||
|
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez)
|
||||||
|
{
|
||||||
|
extern void ksw_exts2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||||
|
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez);
|
||||||
|
extern void ksw_exts2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||||
|
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez);
|
||||||
|
unsigned simd;
|
||||||
|
simd = x86_simd();
|
||||||
|
if (simd & SIMD_SSE4_1)
|
||||||
|
ksw_exts2_sse41(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, flag, ez);
|
||||||
|
else if (simd & SIMD_SSE2)
|
||||||
|
ksw_exts2_sse2(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, flag, ez);
|
||||||
|
else abort();
|
||||||
|
}
|
||||||
|
#endif
|
||||||
+37
-36
@@ -1,16 +1,31 @@
|
|||||||
#include <string.h>
|
#include <string.h>
|
||||||
#include <stdio.h>
|
#include <stdio.h>
|
||||||
|
#include <assert.h>
|
||||||
#include "ksw2.h"
|
#include "ksw2.h"
|
||||||
|
|
||||||
#ifdef __SSE2__
|
#ifdef __SSE2__
|
||||||
#include <emmintrin.h>
|
#include <emmintrin.h>
|
||||||
|
|
||||||
|
#ifdef KSW_SSE2_ONLY
|
||||||
|
#undef __SSE4_1__
|
||||||
|
#endif
|
||||||
|
|
||||||
#ifdef __SSE4_1__
|
#ifdef __SSE4_1__
|
||||||
#include <smmintrin.h>
|
#include <smmintrin.h>
|
||||||
#endif
|
#endif
|
||||||
|
|
||||||
|
#ifdef KSW_CPU_DISPATCH
|
||||||
|
#ifdef __SSE4_1__
|
||||||
|
void ksw_extd2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||||
|
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez)
|
||||||
|
#else
|
||||||
|
void ksw_extd2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||||
|
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez)
|
||||||
|
#endif
|
||||||
|
#else
|
||||||
void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||||
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int flag, ksw_extz_t *ez)
|
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez)
|
||||||
|
#endif // ~KSW_CPU_DISPATCH
|
||||||
{
|
{
|
||||||
#define __dp_code_block1 \
|
#define __dp_code_block1 \
|
||||||
z = _mm_load_si128(&s[t]); \
|
z = _mm_load_si128(&s[t]); \
|
||||||
@@ -42,11 +57,11 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
|||||||
a2= _mm_sub_epi8(a2, tmp); \
|
a2= _mm_sub_epi8(a2, tmp); \
|
||||||
b2= _mm_sub_epi8(b2, tmp);
|
b2= _mm_sub_epi8(b2, tmp);
|
||||||
|
|
||||||
int r, t, qe = q + e, n_col_, *off = 0, tlen_, qlen_, last_st, last_en, wl, wr, max_sc, min_sc, long_thres, long_diff;
|
int r, t, qe = q + e, n_col_, *off = 0, *off_end = 0, tlen_, qlen_, last_st, last_en, wl, wr, max_sc, min_sc, long_thres, long_diff;
|
||||||
int with_cigar = !(flag&KSW_EZ_SCORE_ONLY), approx_max = !!(flag&KSW_EZ_APPROX_MAX);
|
int with_cigar = !(flag&KSW_EZ_SCORE_ONLY), approx_max = !!(flag&KSW_EZ_APPROX_MAX);
|
||||||
int32_t *H = 0, H0 = 0, last_H0_t = 0;
|
int32_t *H = 0, H0 = 0, last_H0_t = 0;
|
||||||
uint8_t *qr, *sf, *mem, *mem2 = 0;
|
uint8_t *qr, *sf, *mem, *mem2 = 0;
|
||||||
__m128i q_, q2_, qe_, qe2_, zero_, sc_mch_, sc_mis_, m1_;
|
__m128i q_, q2_, qe_, qe2_, zero_, sc_mch_, sc_mis_, m1_, sc_N_;
|
||||||
__m128i *u, *v, *x, *y, *x2, *y2, *s, *p = 0;
|
__m128i *u, *v, *x, *y, *x2, *y2, *s, *p = 0;
|
||||||
|
|
||||||
ksw_reset_extz(ez);
|
ksw_reset_extz(ez);
|
||||||
@@ -61,12 +76,14 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
|||||||
qe2_ = _mm_set1_epi8(q2 + e2);
|
qe2_ = _mm_set1_epi8(q2 + e2);
|
||||||
sc_mch_ = _mm_set1_epi8(mat[0]);
|
sc_mch_ = _mm_set1_epi8(mat[0]);
|
||||||
sc_mis_ = _mm_set1_epi8(mat[1]);
|
sc_mis_ = _mm_set1_epi8(mat[1]);
|
||||||
|
sc_N_ = _mm_set1_epi8(-e2);
|
||||||
m1_ = _mm_set1_epi8(m - 1); // wildcard
|
m1_ = _mm_set1_epi8(m - 1); // wildcard
|
||||||
|
|
||||||
if (w < 0) w = tlen > qlen? tlen : qlen;
|
if (w < 0) w = tlen > qlen? tlen : qlen;
|
||||||
wl = wr = w;
|
wl = wr = w;
|
||||||
tlen_ = (tlen + 15) / 16;
|
tlen_ = (tlen + 15) / 16;
|
||||||
n_col_ = ((w + 1 < tlen? (w + 1 < qlen? w + 1 : qlen): tlen) + 15) / 16 + 1;
|
n_col_ = qlen < tlen? qlen : tlen;
|
||||||
|
n_col_ = ((n_col_ < w + 1? n_col_ : w + 1) + 15) / 16 + 1;
|
||||||
qlen_ = (qlen + 15) / 16;
|
qlen_ = (qlen + 15) / 16;
|
||||||
for (t = 1, max_sc = mat[0], min_sc = mat[1]; t < m * m; ++t) {
|
for (t = 1, max_sc = mat[0], min_sc = mat[1]; t < m * m; ++t) {
|
||||||
max_sc = max_sc > mat[t]? max_sc : mat[t];
|
max_sc = max_sc > mat[t]? max_sc : mat[t];
|
||||||
@@ -96,7 +113,8 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
|||||||
if (with_cigar) {
|
if (with_cigar) {
|
||||||
mem2 = (uint8_t*)kmalloc(km, ((qlen + tlen - 1) * n_col_ + 1) * 16);
|
mem2 = (uint8_t*)kmalloc(km, ((qlen + tlen - 1) * n_col_ + 1) * 16);
|
||||||
p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4);
|
p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4);
|
||||||
off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int));
|
off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int) * 2);
|
||||||
|
off_end = off + qlen + tlen - 1;
|
||||||
}
|
}
|
||||||
|
|
||||||
for (t = 0; t < qlen; ++t) qr[t] = query[qlen - 1 - t];
|
for (t = 0; t < qlen; ++t) qr[t] = query[qlen - 1 - t];
|
||||||
@@ -105,7 +123,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
|||||||
for (r = 0, last_st = last_en = -1; r < qlen + tlen - 1; ++r) {
|
for (r = 0, last_st = last_en = -1; r < qlen + tlen - 1; ++r) {
|
||||||
int st = 0, en = tlen - 1, st0, en0, st_, en_;
|
int st = 0, en = tlen - 1, st0, en0, st_, en_;
|
||||||
int8_t x1, x21, v1;
|
int8_t x1, x21, v1;
|
||||||
uint8_t *qrr = qr + (qlen - 1 - r), p_en0 = 0;
|
uint8_t *qrr = qr + (qlen - 1 - r);
|
||||||
int8_t *u8 = (int8_t*)u, *v8 = (int8_t*)v, *x8 = (int8_t*)x, *x28 = (int8_t*)x2;
|
int8_t *u8 = (int8_t*)u, *v8 = (int8_t*)v, *x8 = (int8_t*)x, *x28 = (int8_t*)x2;
|
||||||
__m128i x1_, x21_, v1_;
|
__m128i x1_, x21_, v1_;
|
||||||
// find the boundaries
|
// find the boundaries
|
||||||
@@ -145,10 +163,11 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
|||||||
tmp = _mm_cmpeq_epi8(sq, st);
|
tmp = _mm_cmpeq_epi8(sq, st);
|
||||||
#ifdef __SSE4_1__
|
#ifdef __SSE4_1__
|
||||||
tmp = _mm_blendv_epi8(sc_mis_, sc_mch_, tmp);
|
tmp = _mm_blendv_epi8(sc_mis_, sc_mch_, tmp);
|
||||||
|
tmp = _mm_blendv_epi8(tmp, sc_N_, mask);
|
||||||
#else
|
#else
|
||||||
tmp = _mm_or_si128(_mm_andnot_si128(tmp, sc_mis_), _mm_and_si128(tmp, sc_mch_));
|
tmp = _mm_or_si128(_mm_andnot_si128(tmp, sc_mis_), _mm_and_si128(tmp, sc_mch_));
|
||||||
|
tmp = _mm_or_si128(_mm_andnot_si128(mask, tmp), _mm_and_si128(mask, sc_N_));
|
||||||
#endif
|
#endif
|
||||||
tmp = _mm_andnot_si128(mask, tmp);
|
|
||||||
_mm_storeu_si128((__m128i*)((int8_t*)s + t), tmp);
|
_mm_storeu_si128((__m128i*)((int8_t*)s + t), tmp);
|
||||||
}
|
}
|
||||||
} else {
|
} else {
|
||||||
@@ -160,6 +179,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
|||||||
x21_ = _mm_cvtsi32_si128((uint8_t)x21);
|
x21_ = _mm_cvtsi32_si128((uint8_t)x21);
|
||||||
v1_ = _mm_cvtsi32_si128((uint8_t)v1);
|
v1_ = _mm_cvtsi32_si128((uint8_t)v1);
|
||||||
st_ = st / 16, en_ = en / 16;
|
st_ = st / 16, en_ = en / 16;
|
||||||
|
assert(en_ - st_ + 1 <= n_col_);
|
||||||
if (!with_cigar) { // score only
|
if (!with_cigar) { // score only
|
||||||
for (t = st_; t <= en_; ++t) {
|
for (t = st_; t <= en_; ++t) {
|
||||||
__m128i z, a, b, a2, b2, xt1, x2t1, vt1, ut, tmp;
|
__m128i z, a, b, a2, b2, xt1, x2t1, vt1, ut, tmp;
|
||||||
@@ -199,18 +219,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
|||||||
}
|
}
|
||||||
} else if (!(flag&KSW_EZ_RIGHT)) { // gap left-alignment
|
} else if (!(flag&KSW_EZ_RIGHT)) { // gap left-alignment
|
||||||
__m128i *pr = p + r * n_col_ - st_;
|
__m128i *pr = p + r * n_col_ - st_;
|
||||||
off[r] = st;
|
off[r] = st, off_end[r] = en;
|
||||||
if (en0 < r && en0 < tlen - 1) { // to avoid backtracking out of the band; this assumes a fixed band
|
|
||||||
int8_t a, a2, z = ((uint8_t*)s)[en0];
|
|
||||||
a = x8[en0-1] + v8[en0-1];
|
|
||||||
p_en0 = a > z? 1 : 0;
|
|
||||||
z = a > z? a : z;
|
|
||||||
p_en0 |= a - (z - q) > 0? 1<<4 : 0;
|
|
||||||
a2 = x28[en0-1] + v8[en0-1];
|
|
||||||
p_en0 = a2 > z? 3 : p_en0;
|
|
||||||
z = a2 > z? a2 : z;
|
|
||||||
p_en0 |= a2 - (z - q2) > 0? 1<<6 : 0;
|
|
||||||
}
|
|
||||||
for (t = st_; t <= en_; ++t) {
|
for (t = st_; t <= en_; ++t) {
|
||||||
__m128i d, z, a, b, a2, b2, xt1, x2t1, vt1, ut, tmp;
|
__m128i d, z, a, b, a2, b2, xt1, x2t1, vt1, ut, tmp;
|
||||||
__dp_code_block1;
|
__dp_code_block1;
|
||||||
@@ -257,18 +266,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
|||||||
}
|
}
|
||||||
} else { // gap right-alignment
|
} else { // gap right-alignment
|
||||||
__m128i *pr = p + r * n_col_ - st_;
|
__m128i *pr = p + r * n_col_ - st_;
|
||||||
off[r] = st;
|
off[r] = st, off_end[r] = en;
|
||||||
if (en0 < r && en0 < tlen - 1) { // to avoid backtracking out of the band; this assumes a fixed band
|
|
||||||
int8_t a, a2, z = ((uint8_t*)s)[en0];
|
|
||||||
a = x8[en0-1] + v8[en0-1];
|
|
||||||
p_en0 = a >= z? 1 : 0;
|
|
||||||
z = a >= z? a : z;
|
|
||||||
p_en0 |= a - (z - q) >= 0? 1<<4 : 0;
|
|
||||||
a2 = x28[en0-1] + v8[en0-1];
|
|
||||||
p_en0 = a2 >= z? 3 : p_en0;
|
|
||||||
z = a2 >= z? a2 : z;
|
|
||||||
p_en0 |= a2 - (z - q2) >= 0? 1<<6 : 0;
|
|
||||||
}
|
|
||||||
for (t = st_; t <= en_; ++t) {
|
for (t = st_; t <= en_; ++t) {
|
||||||
__m128i d, z, a, b, a2, b2, xt1, x2t1, vt1, ut, tmp;
|
__m128i d, z, a, b, a2, b2, xt1, x2t1, vt1, ut, tmp;
|
||||||
__dp_code_block1;
|
__dp_code_block1;
|
||||||
@@ -314,7 +312,6 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
|||||||
_mm_store_si128(&pr[t], d);
|
_mm_store_si128(&pr[t], d);
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
if (with_cigar && en0 < r && en0 < tlen - 1) ((uint8_t*)(p + r * n_col_))[en0 - st] = p_en0;
|
|
||||||
if (!approx_max) { // find the exact max with a 32-bit score array
|
if (!approx_max) { // find the exact max with a 32-bit score array
|
||||||
int32_t max_H, max_t;
|
int32_t max_H, max_t;
|
||||||
// compute H[], max_H and max_t
|
// compute H[], max_H and max_t
|
||||||
@@ -383,10 +380,14 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
|||||||
if (!approx_max) kfree(km, H);
|
if (!approx_max) kfree(km, H);
|
||||||
if (with_cigar) { // backtrack
|
if (with_cigar) { // backtrack
|
||||||
int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
|
int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
|
||||||
if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY))
|
if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY)) {
|
||||||
ksw_backtrack(km, 1, rev_cigar, (uint8_t*)p, off, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||||
else if (ez->max_t >= 0 && ez->max_q >= 0)
|
} else if (!ez->zdropped && (flag&KSW_EZ_EXTZ_ONLY) && ez->mqe + end_bonus > ez->max) {
|
||||||
ksw_backtrack(km, 1, rev_cigar, (uint8_t*)p, off, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
ez->reach_end = 1;
|
||||||
|
ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, ez->mqe_t, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||||
|
} else if (ez->max_t >= 0 && ez->max_q >= 0) {
|
||||||
|
ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||||
|
}
|
||||||
kfree(km, mem2); kfree(km, off);
|
kfree(km, mem2); kfree(km, off);
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -0,0 +1,376 @@
|
|||||||
|
#include <string.h>
|
||||||
|
#include <stdio.h>
|
||||||
|
#include <assert.h>
|
||||||
|
#include "ksw2.h"
|
||||||
|
|
||||||
|
#ifdef __SSE2__
|
||||||
|
#include <emmintrin.h>
|
||||||
|
|
||||||
|
#ifdef KSW_SSE2_ONLY
|
||||||
|
#undef __SSE4_1__
|
||||||
|
#endif
|
||||||
|
|
||||||
|
#ifdef __SSE4_1__
|
||||||
|
#include <smmintrin.h>
|
||||||
|
#endif
|
||||||
|
|
||||||
|
#ifdef KSW_CPU_DISPATCH
|
||||||
|
#ifdef __SSE4_1__
|
||||||
|
void ksw_exts2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||||
|
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez)
|
||||||
|
#else
|
||||||
|
void ksw_exts2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||||
|
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez)
|
||||||
|
#endif
|
||||||
|
#else
|
||||||
|
void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||||
|
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez)
|
||||||
|
#endif // ~KSW_CPU_DISPATCH
|
||||||
|
{
|
||||||
|
#define __dp_code_block1 \
|
||||||
|
z = _mm_load_si128(&s[t]); \
|
||||||
|
xt1 = _mm_load_si128(&x[t]); /* xt1 <- x[r-1][t..t+15] */ \
|
||||||
|
tmp = _mm_srli_si128(xt1, 15); /* tmp <- x[r-1][t+15] */ \
|
||||||
|
xt1 = _mm_or_si128(_mm_slli_si128(xt1, 1), x1_); /* xt1 <- x[r-1][t-1..t+14] */ \
|
||||||
|
x1_ = tmp; \
|
||||||
|
vt1 = _mm_load_si128(&v[t]); /* vt1 <- v[r-1][t..t+15] */ \
|
||||||
|
tmp = _mm_srli_si128(vt1, 15); /* tmp <- v[r-1][t+15] */ \
|
||||||
|
vt1 = _mm_or_si128(_mm_slli_si128(vt1, 1), v1_); /* vt1 <- v[r-1][t-1..t+14] */ \
|
||||||
|
v1_ = tmp; \
|
||||||
|
a = _mm_add_epi8(xt1, vt1); /* a <- x[r-1][t-1..t+14] + v[r-1][t-1..t+14] */ \
|
||||||
|
ut = _mm_load_si128(&u[t]); /* ut <- u[t..t+15] */ \
|
||||||
|
b = _mm_add_epi8(_mm_load_si128(&y[t]), ut); /* b <- y[r-1][t..t+15] + u[r-1][t..t+15] */ \
|
||||||
|
x2t1= _mm_load_si128(&x2[t]); \
|
||||||
|
tmp = _mm_srli_si128(x2t1, 15); \
|
||||||
|
x2t1= _mm_or_si128(_mm_slli_si128(x2t1, 1), x21_); \
|
||||||
|
x21_= tmp; \
|
||||||
|
a2 = _mm_add_epi8(x2t1, vt1); \
|
||||||
|
a2a = _mm_add_epi8(a2, _mm_load_si128(&acceptor[t]));
|
||||||
|
|
||||||
|
#define __dp_code_block2 \
|
||||||
|
_mm_store_si128(&u[t], _mm_sub_epi8(z, vt1)); /* u[r][t..t+15] <- z - v[r-1][t-1..t+14] */ \
|
||||||
|
_mm_store_si128(&v[t], _mm_sub_epi8(z, ut)); /* v[r][t..t+15] <- z - u[r-1][t..t+15] */ \
|
||||||
|
tmp = _mm_sub_epi8(z, q_); \
|
||||||
|
a = _mm_sub_epi8(a, tmp); \
|
||||||
|
b = _mm_sub_epi8(b, tmp); \
|
||||||
|
a2= _mm_sub_epi8(a2, _mm_sub_epi8(z, q2_));
|
||||||
|
|
||||||
|
int r, t, qe = q + e, n_col_, *off = 0, *off_end = 0, tlen_, qlen_, last_st, last_en, max_sc, min_sc, long_thres, long_diff;
|
||||||
|
int with_cigar = !(flag&KSW_EZ_SCORE_ONLY), approx_max = !!(flag&KSW_EZ_APPROX_MAX);
|
||||||
|
int32_t *H = 0, H0 = 0, last_H0_t = 0;
|
||||||
|
uint8_t *qr, *sf, *mem, *mem2 = 0;
|
||||||
|
__m128i q_, q2_, qe_, zero_, sc_mch_, sc_mis_, sc_N_, m1_;
|
||||||
|
__m128i *u, *v, *x, *y, *x2, *s, *p = 0, *donor, *acceptor;
|
||||||
|
|
||||||
|
ksw_reset_extz(ez);
|
||||||
|
if (m <= 1 || qlen <= 0 || tlen <= 0 || q2 <= q + e) return;
|
||||||
|
|
||||||
|
zero_ = _mm_set1_epi8(0);
|
||||||
|
q_ = _mm_set1_epi8(q);
|
||||||
|
q2_ = _mm_set1_epi8(q2);
|
||||||
|
qe_ = _mm_set1_epi8(q + e);
|
||||||
|
sc_mch_ = _mm_set1_epi8(mat[0]);
|
||||||
|
sc_mis_ = _mm_set1_epi8(mat[1]);
|
||||||
|
sc_N_ = _mm_set1_epi8(-e);
|
||||||
|
m1_ = _mm_set1_epi8(m - 1); // wildcard
|
||||||
|
|
||||||
|
tlen_ = (tlen + 15) / 16;
|
||||||
|
n_col_ = ((qlen < tlen? qlen : tlen) + 15) / 16 + 1;
|
||||||
|
qlen_ = (qlen + 15) / 16;
|
||||||
|
for (t = 1, max_sc = mat[0], min_sc = mat[1]; t < m * m; ++t) {
|
||||||
|
max_sc = max_sc > mat[t]? max_sc : mat[t];
|
||||||
|
min_sc = min_sc < mat[t]? min_sc : mat[t];
|
||||||
|
}
|
||||||
|
if (-min_sc > 2 * (q + e)) return; // otherwise, we won't see any mismatches
|
||||||
|
|
||||||
|
long_thres = (q2 - q) / e - 1;
|
||||||
|
if (q2 > q + e + long_thres * e)
|
||||||
|
++long_thres;
|
||||||
|
long_diff = long_thres * e - (q2 - q);
|
||||||
|
|
||||||
|
mem = (uint8_t*)kcalloc(km, tlen_ * 9 + qlen_ + 1, 16);
|
||||||
|
u = (__m128i*)(((size_t)mem + 15) >> 4 << 4); // 16-byte aligned
|
||||||
|
v = u + tlen_, x = v + tlen_, y = x + tlen_, x2 = y + tlen_;
|
||||||
|
donor = x2 + tlen_, acceptor = donor + tlen_;
|
||||||
|
s = acceptor + tlen_, sf = (uint8_t*)(s + tlen_), qr = sf + tlen_ * 16;
|
||||||
|
memset(u, -q - e, tlen_ * 16 * 4); // this set u, v, x, y (because they are in the same array)
|
||||||
|
memset(x2, -q2, tlen_ * 16);
|
||||||
|
if (!approx_max) {
|
||||||
|
H = (int32_t*)kmalloc(km, tlen_ * 16 * 4);
|
||||||
|
for (t = 0; t < tlen_ * 16; ++t) H[t] = KSW_NEG_INF;
|
||||||
|
}
|
||||||
|
if (with_cigar) {
|
||||||
|
mem2 = (uint8_t*)kmalloc(km, ((qlen + tlen - 1) * n_col_ + 1) * 16);
|
||||||
|
p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4);
|
||||||
|
off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int) * 2);
|
||||||
|
off_end = off + qlen + tlen - 1;
|
||||||
|
}
|
||||||
|
|
||||||
|
for (t = 0; t < qlen; ++t) qr[t] = query[qlen - 1 - t];
|
||||||
|
memcpy(sf, target, tlen);
|
||||||
|
|
||||||
|
// set the donor and acceptor arrays. TODO: this assumes 0/1/2/3 encoding!
|
||||||
|
if (flag & (KSW_EZ_SPLICE_FOR|KSW_EZ_SPLICE_REV)) {
|
||||||
|
int semi_cost = flag&KSW_EZ_SPLICE_FLANK? -noncan/2 : 0; // GTr or yAG is worth 0.5 bit; see PMID:18688272
|
||||||
|
memset(donor, -noncan, tlen_ * 16);
|
||||||
|
for (t = 0; t < tlen - 4; ++t) {
|
||||||
|
int can_type = 0; // type of canonical site: 0=none, 1=GT/AG only, 2=GTr/yAG
|
||||||
|
if ((flag & KSW_EZ_SPLICE_FOR) && target[t+1] == 2 && target[t+2] == 3) can_type = 1; // GTr...
|
||||||
|
if ((flag & KSW_EZ_SPLICE_REV) && target[t+1] == 1 && target[t+2] == 3) can_type = 1; // CTr...
|
||||||
|
if (can_type && (target[t+3] == 0 || target[t+3] == 2)) can_type = 2;
|
||||||
|
if (can_type) ((int8_t*)donor)[t] = can_type == 2? 0 : semi_cost;
|
||||||
|
}
|
||||||
|
memset(acceptor, -noncan, tlen_ * 16);
|
||||||
|
for (t = 2; t < tlen; ++t) {
|
||||||
|
int can_type = 0;
|
||||||
|
if ((flag & KSW_EZ_SPLICE_FOR) && target[t-1] == 0 && target[t] == 2) can_type = 1; // ...yAG
|
||||||
|
if ((flag & KSW_EZ_SPLICE_REV) && target[t-1] == 0 && target[t] == 1) can_type = 1; // ...yAC
|
||||||
|
if (can_type && (target[t-2] == 1 || target[t-2] == 3)) can_type = 2;
|
||||||
|
if (can_type) ((int8_t*)acceptor)[t] = can_type == 2? 0 : semi_cost;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
for (r = 0, last_st = last_en = -1; r < qlen + tlen - 1; ++r) {
|
||||||
|
int st = 0, en = tlen - 1, st0, en0, st_, en_;
|
||||||
|
int8_t x1, x21, v1, *u8 = (int8_t*)u, *v8 = (int8_t*)v;
|
||||||
|
uint8_t *qrr = qr + (qlen - 1 - r);
|
||||||
|
__m128i x1_, x21_, v1_;
|
||||||
|
// find the boundaries
|
||||||
|
if (st < r - qlen + 1) st = r - qlen + 1;
|
||||||
|
if (en > r) en = r;
|
||||||
|
st0 = st, en0 = en;
|
||||||
|
st = st / 16 * 16, en = (en + 16) / 16 * 16 - 1;
|
||||||
|
// set boundary conditions
|
||||||
|
if (st > 0) {
|
||||||
|
if (st - 1 >= last_st && st - 1 <= last_en)
|
||||||
|
x1 = ((int8_t*)x)[st - 1], x21 = ((int8_t*)x2)[st - 1], v1 = v8[st - 1]; // (r-1,s-1) calculated in the last round
|
||||||
|
else x1 = -q - e, x21 = -q2, v1 = -q - e;
|
||||||
|
} else {
|
||||||
|
x1 = -q - e, x21 = -q2;
|
||||||
|
v1 = r == 0? -q - e : r < long_thres? -e : r == long_thres? long_diff : 0;
|
||||||
|
}
|
||||||
|
if (en >= r) {
|
||||||
|
((int8_t*)y)[r] = -q - e;
|
||||||
|
u8[r] = r == 0? -q - e : r < long_thres? -e : r == long_thres? long_diff : 0;
|
||||||
|
}
|
||||||
|
// loop fission: set scores first
|
||||||
|
if (!(flag & KSW_EZ_GENERIC_SC)) {
|
||||||
|
for (t = st0; t <= en0; t += 16) {
|
||||||
|
__m128i sq, st, tmp, mask;
|
||||||
|
sq = _mm_loadu_si128((__m128i*)&sf[t]);
|
||||||
|
st = _mm_loadu_si128((__m128i*)&qrr[t]);
|
||||||
|
mask = _mm_or_si128(_mm_cmpeq_epi8(sq, m1_), _mm_cmpeq_epi8(st, m1_));
|
||||||
|
tmp = _mm_cmpeq_epi8(sq, st);
|
||||||
|
#ifdef __SSE4_1__
|
||||||
|
tmp = _mm_blendv_epi8(sc_mis_, sc_mch_, tmp);
|
||||||
|
tmp = _mm_blendv_epi8(tmp, sc_N_, mask);
|
||||||
|
#else
|
||||||
|
tmp = _mm_or_si128(_mm_andnot_si128(tmp, sc_mis_), _mm_and_si128(tmp, sc_mch_));
|
||||||
|
tmp = _mm_or_si128(_mm_andnot_si128(mask, tmp), _mm_and_si128(mask, sc_N_));
|
||||||
|
#endif
|
||||||
|
_mm_storeu_si128((__m128i*)((int8_t*)s + t), tmp);
|
||||||
|
}
|
||||||
|
} else {
|
||||||
|
for (t = st0; t <= en0; ++t)
|
||||||
|
((uint8_t*)s)[t] = mat[sf[t] * m + qrr[t]];
|
||||||
|
}
|
||||||
|
// core loop
|
||||||
|
x1_ = _mm_cvtsi32_si128((uint8_t)x1);
|
||||||
|
x21_ = _mm_cvtsi32_si128((uint8_t)x21);
|
||||||
|
v1_ = _mm_cvtsi32_si128((uint8_t)v1);
|
||||||
|
st_ = st / 16, en_ = en / 16;
|
||||||
|
assert(en_ - st_ + 1 <= n_col_);
|
||||||
|
if (!with_cigar) { // score only
|
||||||
|
for (t = st_; t <= en_; ++t) {
|
||||||
|
__m128i z, a, b, a2, a2a, xt1, x2t1, vt1, ut, tmp;
|
||||||
|
__dp_code_block1;
|
||||||
|
#ifdef __SSE4_1__
|
||||||
|
z = _mm_max_epi8(z, a);
|
||||||
|
z = _mm_max_epi8(z, b);
|
||||||
|
z = _mm_max_epi8(z, a2a);
|
||||||
|
__dp_code_block2; // save u[] and v[]; update a, b and a2
|
||||||
|
_mm_store_si128(&x[t], _mm_sub_epi8(_mm_max_epi8(a, zero_), qe_));
|
||||||
|
_mm_store_si128(&y[t], _mm_sub_epi8(_mm_max_epi8(b, zero_), qe_));
|
||||||
|
tmp = _mm_load_si128(&donor[t]);
|
||||||
|
_mm_store_si128(&x2[t], _mm_sub_epi8(_mm_max_epi8(a2, tmp), q2_));
|
||||||
|
#else
|
||||||
|
tmp = _mm_cmpgt_epi8(a, z);
|
||||||
|
z = _mm_or_si128(_mm_andnot_si128(tmp, z), _mm_and_si128(tmp, a));
|
||||||
|
tmp = _mm_cmpgt_epi8(b, z);
|
||||||
|
z = _mm_or_si128(_mm_andnot_si128(tmp, z), _mm_and_si128(tmp, b));
|
||||||
|
tmp = _mm_cmpgt_epi8(a2a, z);
|
||||||
|
z = _mm_or_si128(_mm_andnot_si128(tmp, z), _mm_and_si128(tmp, a2a));
|
||||||
|
__dp_code_block2;
|
||||||
|
tmp = _mm_cmpgt_epi8(a, zero_);
|
||||||
|
_mm_store_si128(&x[t], _mm_sub_epi8(_mm_and_si128(tmp, a), qe_));
|
||||||
|
tmp = _mm_cmpgt_epi8(b, zero_);
|
||||||
|
_mm_store_si128(&y[t], _mm_sub_epi8(_mm_and_si128(tmp, b), qe_));
|
||||||
|
tmp = _mm_load_si128(&donor[t]); // TODO: check if this is correct
|
||||||
|
tmp = _mm_cmpgt_epi8(a2, tmp);
|
||||||
|
tmp = _mm_or_si128(_mm_andnot_si128(tmp, tmp), _mm_and_si128(tmp, a2));
|
||||||
|
_mm_store_si128(&x2[t], _mm_sub_epi8(tmp, q2_));
|
||||||
|
#endif
|
||||||
|
}
|
||||||
|
} else if (!(flag&KSW_EZ_RIGHT)) { // gap left-alignment
|
||||||
|
__m128i *pr = p + r * n_col_ - st_;
|
||||||
|
off[r] = st, off_end[r] = en;
|
||||||
|
for (t = st_; t <= en_; ++t) {
|
||||||
|
__m128i d, z, a, b, a2, a2a, xt1, x2t1, vt1, ut, tmp, tmp2;
|
||||||
|
__dp_code_block1;
|
||||||
|
#ifdef __SSE4_1__
|
||||||
|
d = _mm_and_si128(_mm_cmpgt_epi8(a, z), _mm_set1_epi8(1)); // d = a > z? 1 : 0
|
||||||
|
z = _mm_max_epi8(z, a);
|
||||||
|
d = _mm_blendv_epi8(d, _mm_set1_epi8(2), _mm_cmpgt_epi8(b, z)); // d = b > z? 2 : d
|
||||||
|
z = _mm_max_epi8(z, b);
|
||||||
|
d = _mm_blendv_epi8(d, _mm_set1_epi8(3), _mm_cmpgt_epi8(a2a, z)); // d = a2 > z? 3 : d
|
||||||
|
z = _mm_max_epi8(z, a2a);
|
||||||
|
#else // we need to emulate SSE4.1 intrinsics _mm_max_epi8() and _mm_blendv_epi8()
|
||||||
|
tmp = _mm_cmpgt_epi8(a, z);
|
||||||
|
d = _mm_and_si128(tmp, _mm_set1_epi8(1));
|
||||||
|
z = _mm_or_si128(_mm_andnot_si128(tmp, z), _mm_and_si128(tmp, a));
|
||||||
|
tmp = _mm_cmpgt_epi8(b, z);
|
||||||
|
d = _mm_or_si128(_mm_andnot_si128(tmp, d), _mm_and_si128(tmp, _mm_set1_epi8(2)));
|
||||||
|
z = _mm_or_si128(_mm_andnot_si128(tmp, z), _mm_and_si128(tmp, b));
|
||||||
|
tmp = _mm_cmpgt_epi8(a2a, z);
|
||||||
|
d = _mm_or_si128(_mm_andnot_si128(tmp, d), _mm_and_si128(tmp, _mm_set1_epi8(3)));
|
||||||
|
z = _mm_or_si128(_mm_andnot_si128(tmp, z), _mm_and_si128(tmp, a2a));
|
||||||
|
#endif
|
||||||
|
__dp_code_block2;
|
||||||
|
tmp = _mm_cmpgt_epi8(a, zero_);
|
||||||
|
_mm_store_si128(&x[t], _mm_sub_epi8(_mm_and_si128(tmp, a), qe_));
|
||||||
|
d = _mm_or_si128(d, _mm_and_si128(tmp, _mm_set1_epi8(0x08))); // d = a > 0? 1<<3 : 0
|
||||||
|
tmp = _mm_cmpgt_epi8(b, zero_);
|
||||||
|
_mm_store_si128(&y[t], _mm_sub_epi8(_mm_and_si128(tmp, b), qe_));
|
||||||
|
d = _mm_or_si128(d, _mm_and_si128(tmp, _mm_set1_epi8(0x10))); // d = b > 0? 1<<4 : 0
|
||||||
|
|
||||||
|
tmp2 = _mm_load_si128(&donor[t]);
|
||||||
|
tmp = _mm_cmpgt_epi8(a2, tmp2);
|
||||||
|
#ifdef __SSE4_1__
|
||||||
|
tmp2 = _mm_max_epi8(a2, tmp2);
|
||||||
|
#else
|
||||||
|
tmp2 = _mm_or_si128(_mm_andnot_si128(tmp, tmp2), _mm_and_si128(tmp, a2));
|
||||||
|
#endif
|
||||||
|
_mm_store_si128(&x2[t], _mm_sub_epi8(tmp2, q2_));
|
||||||
|
d = _mm_or_si128(d, _mm_and_si128(tmp, _mm_set1_epi8(0x20)));
|
||||||
|
_mm_store_si128(&pr[t], d);
|
||||||
|
}
|
||||||
|
} else { // gap right-alignment
|
||||||
|
__m128i *pr = p + r * n_col_ - st_;
|
||||||
|
off[r] = st, off_end[r] = en;
|
||||||
|
for (t = st_; t <= en_; ++t) {
|
||||||
|
__m128i d, z, a, b, a2, a2a, xt1, x2t1, vt1, ut, tmp, tmp2;
|
||||||
|
__dp_code_block1;
|
||||||
|
#ifdef __SSE4_1__
|
||||||
|
d = _mm_andnot_si128(_mm_cmpgt_epi8(z, a), _mm_set1_epi8(1)); // d = z > a? 0 : 1
|
||||||
|
z = _mm_max_epi8(z, a);
|
||||||
|
d = _mm_blendv_epi8(_mm_set1_epi8(2), d, _mm_cmpgt_epi8(z, b)); // d = z > b? d : 2
|
||||||
|
z = _mm_max_epi8(z, b);
|
||||||
|
d = _mm_blendv_epi8(_mm_set1_epi8(3), d, _mm_cmpgt_epi8(z, a2a)); // d = z > a2? d : 3
|
||||||
|
z = _mm_max_epi8(z, a2a);
|
||||||
|
#else // we need to emulate SSE4.1 intrinsics _mm_max_epi8() and _mm_blendv_epi8()
|
||||||
|
tmp = _mm_cmpgt_epi8(z, a);
|
||||||
|
d = _mm_andnot_si128(tmp, _mm_set1_epi8(1));
|
||||||
|
z = _mm_or_si128(_mm_and_si128(tmp, z), _mm_andnot_si128(tmp, a));
|
||||||
|
tmp = _mm_cmpgt_epi8(z, b);
|
||||||
|
d = _mm_or_si128(_mm_and_si128(tmp, d), _mm_andnot_si128(tmp, _mm_set1_epi8(2)));
|
||||||
|
z = _mm_or_si128(_mm_and_si128(tmp, z), _mm_andnot_si128(tmp, b));
|
||||||
|
tmp = _mm_cmpgt_epi8(z, a2a);
|
||||||
|
d = _mm_or_si128(_mm_and_si128(tmp, d), _mm_andnot_si128(tmp, _mm_set1_epi8(3)));
|
||||||
|
z = _mm_or_si128(_mm_and_si128(tmp, z), _mm_andnot_si128(tmp, a2a));
|
||||||
|
#endif
|
||||||
|
__dp_code_block2;
|
||||||
|
tmp = _mm_cmpgt_epi8(zero_, a);
|
||||||
|
_mm_store_si128(&x[t], _mm_sub_epi8(_mm_andnot_si128(tmp, a), qe_));
|
||||||
|
d = _mm_or_si128(d, _mm_andnot_si128(tmp, _mm_set1_epi8(0x08))); // d = a > 0? 1<<3 : 0
|
||||||
|
tmp = _mm_cmpgt_epi8(zero_, b);
|
||||||
|
_mm_store_si128(&y[t], _mm_sub_epi8(_mm_andnot_si128(tmp, b), qe_));
|
||||||
|
d = _mm_or_si128(d, _mm_andnot_si128(tmp, _mm_set1_epi8(0x10))); // d = b > 0? 1<<4 : 0
|
||||||
|
|
||||||
|
tmp2 = _mm_load_si128(&donor[t]);
|
||||||
|
tmp = _mm_cmpgt_epi8(tmp2, a2);
|
||||||
|
#ifdef __SSE4_1__
|
||||||
|
tmp2 = _mm_max_epi8(tmp2, a2);
|
||||||
|
#else
|
||||||
|
tmp2 = _mm_or_si128(_mm_andnot_si128(tmp, a2), _mm_and_si128(tmp, tmp2));
|
||||||
|
#endif
|
||||||
|
_mm_store_si128(&x2[t], _mm_sub_epi8(tmp2, q2_));
|
||||||
|
d = _mm_or_si128(d, _mm_andnot_si128(tmp, _mm_set1_epi8(0x20))); // d = a > 0? 1<<5 : 0
|
||||||
|
_mm_store_si128(&pr[t], d);
|
||||||
|
}
|
||||||
|
}
|
||||||
|
if (!approx_max) { // find the exact max with a 32-bit score array
|
||||||
|
int32_t max_H, max_t;
|
||||||
|
// compute H[], max_H and max_t
|
||||||
|
if (r > 0) {
|
||||||
|
int32_t HH[4], tt[4], en1 = st0 + (en0 - st0) / 4 * 4, i;
|
||||||
|
__m128i max_H_, max_t_;
|
||||||
|
max_H = H[en0] = en0 > 0? H[en0-1] + u8[en0] : H[en0] + v8[en0]; // special casing the last element
|
||||||
|
max_t = en0;
|
||||||
|
max_H_ = _mm_set1_epi32(max_H);
|
||||||
|
max_t_ = _mm_set1_epi32(max_t);
|
||||||
|
for (t = st0; t < en1; t += 4) { // this implements: H[t]+=v8[t]-qe; if(H[t]>max_H) max_H=H[t],max_t=t;
|
||||||
|
__m128i H1, tmp, t_;
|
||||||
|
H1 = _mm_loadu_si128((__m128i*)&H[t]);
|
||||||
|
t_ = _mm_setr_epi32(v8[t], v8[t+1], v8[t+2], v8[t+3]);
|
||||||
|
H1 = _mm_add_epi32(H1, t_);
|
||||||
|
_mm_storeu_si128((__m128i*)&H[t], H1);
|
||||||
|
t_ = _mm_set1_epi32(t);
|
||||||
|
tmp = _mm_cmpgt_epi32(H1, max_H_);
|
||||||
|
#ifdef __SSE4_1__
|
||||||
|
max_H_ = _mm_blendv_epi8(max_H_, H1, tmp);
|
||||||
|
max_t_ = _mm_blendv_epi8(max_t_, t_, tmp);
|
||||||
|
#else
|
||||||
|
max_H_ = _mm_or_si128(_mm_and_si128(tmp, H1), _mm_andnot_si128(tmp, max_H_));
|
||||||
|
max_t_ = _mm_or_si128(_mm_and_si128(tmp, t_), _mm_andnot_si128(tmp, max_t_));
|
||||||
|
#endif
|
||||||
|
}
|
||||||
|
_mm_storeu_si128((__m128i*)HH, max_H_);
|
||||||
|
_mm_storeu_si128((__m128i*)tt, max_t_);
|
||||||
|
for (i = 0; i < 4; ++i)
|
||||||
|
if (max_H < HH[i]) max_H = HH[i], max_t = tt[i] + i;
|
||||||
|
for (; t < en0; ++t) { // for the rest of values that haven't been computed with SSE
|
||||||
|
H[t] += (int32_t)v8[t];
|
||||||
|
if (H[t] > max_H)
|
||||||
|
max_H = H[t], max_t = t;
|
||||||
|
}
|
||||||
|
} else H[0] = v8[0] - qe, max_H = H[0], max_t = 0; // special casing r==0
|
||||||
|
// update ez
|
||||||
|
if (en0 == tlen - 1 && H[en0] > ez->mte)
|
||||||
|
ez->mte = H[en0], ez->mte_q = r - en;
|
||||||
|
if (r - st0 == qlen - 1 && H[st0] > ez->mqe)
|
||||||
|
ez->mqe = H[st0], ez->mqe_t = st0;
|
||||||
|
if (ksw_apply_zdrop(ez, 1, max_H, r, max_t, zdrop, 0)) break;
|
||||||
|
if (r == qlen + tlen - 2 && en0 == tlen - 1)
|
||||||
|
ez->score = H[tlen - 1];
|
||||||
|
} else { // find approximate max; Z-drop might be inaccurate, too.
|
||||||
|
if (r > 0) {
|
||||||
|
if (last_H0_t >= st0 && last_H0_t <= en0 && last_H0_t + 1 >= st0 && last_H0_t + 1 <= en0) {
|
||||||
|
int32_t d0 = v8[last_H0_t];
|
||||||
|
int32_t d1 = u8[last_H0_t + 1];
|
||||||
|
if (d0 > d1) H0 += d0;
|
||||||
|
else H0 += d1, ++last_H0_t;
|
||||||
|
} else if (last_H0_t >= st0 && last_H0_t <= en0) {
|
||||||
|
H0 += v8[last_H0_t];
|
||||||
|
} else {
|
||||||
|
++last_H0_t, H0 += u8[last_H0_t];
|
||||||
|
}
|
||||||
|
} else H0 = v8[0] - qe, last_H0_t = 0;
|
||||||
|
if ((flag & KSW_EZ_APPROX_DROP) && ksw_apply_zdrop(ez, 1, H0, r, last_H0_t, zdrop, 0)) break;
|
||||||
|
if (r == qlen + tlen - 2 && en0 == tlen - 1)
|
||||||
|
ez->score = H0;
|
||||||
|
}
|
||||||
|
last_st = st, last_en = en;
|
||||||
|
//for (t = st0; t <= en0; ++t) printf("(%d,%d)\t(%d,%d,%d,%d)\t%d\n", r, t, ((int8_t*)u)[t], ((int8_t*)v)[t], ((int8_t*)x)[t], ((int8_t*)y)[t], H[t]); // for debugging
|
||||||
|
}
|
||||||
|
kfree(km, mem);
|
||||||
|
if (!approx_max) kfree(km, H);
|
||||||
|
if (with_cigar) { // backtrack
|
||||||
|
int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
|
||||||
|
if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY))
|
||||||
|
ksw_backtrack(km, 1, rev_cigar, long_thres, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||||
|
else if (ez->max_t >= 0 && ez->max_q >= 0)
|
||||||
|
ksw_backtrack(km, 1, rev_cigar, long_thres, (uint8_t*)p, off, off_end, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||||
|
kfree(km, mem2); kfree(km, off);
|
||||||
|
}
|
||||||
|
}
|
||||||
|
#endif // __SSE2__
|
||||||
+35
-28
@@ -1,14 +1,27 @@
|
|||||||
#include <string.h>
|
#include <string.h>
|
||||||
|
#include <assert.h>
|
||||||
#include "ksw2.h"
|
#include "ksw2.h"
|
||||||
|
|
||||||
#ifdef __SSE2__
|
#ifdef __SSE2__
|
||||||
#include <emmintrin.h>
|
#include <emmintrin.h>
|
||||||
|
|
||||||
|
#ifdef KSW_SSE2_ONLY
|
||||||
|
#undef __SSE4_1__
|
||||||
|
#endif
|
||||||
|
|
||||||
#ifdef __SSE4_1__
|
#ifdef __SSE4_1__
|
||||||
#include <smmintrin.h>
|
#include <smmintrin.h>
|
||||||
#endif
|
#endif
|
||||||
|
|
||||||
void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int flag, ksw_extz_t *ez)
|
#ifdef KSW_CPU_DISPATCH
|
||||||
|
#ifdef __SSE4_1__
|
||||||
|
void ksw_extz2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez)
|
||||||
|
#else
|
||||||
|
void ksw_extz2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez)
|
||||||
|
#endif
|
||||||
|
#else
|
||||||
|
void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez)
|
||||||
|
#endif // ~KSW_CPU_DISPATCH
|
||||||
{
|
{
|
||||||
#define __dp_code_block1 \
|
#define __dp_code_block1 \
|
||||||
z = _mm_add_epi8(_mm_load_si128(&s[t]), qe2_); \
|
z = _mm_add_epi8(_mm_load_si128(&s[t]), qe2_); \
|
||||||
@@ -33,11 +46,11 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
|||||||
a = _mm_sub_epi8(a, z); \
|
a = _mm_sub_epi8(a, z); \
|
||||||
b = _mm_sub_epi8(b, z);
|
b = _mm_sub_epi8(b, z);
|
||||||
|
|
||||||
int r, t, qe = q + e, n_col_, *off = 0, tlen_, qlen_, last_st, last_en, wl, wr, max_sc, min_sc;
|
int r, t, qe = q + e, n_col_, *off = 0, *off_end = 0, tlen_, qlen_, last_st, last_en, wl, wr, max_sc, min_sc;
|
||||||
int with_cigar = !(flag&KSW_EZ_SCORE_ONLY), approx_max = !!(flag&KSW_EZ_APPROX_MAX);
|
int with_cigar = !(flag&KSW_EZ_SCORE_ONLY), approx_max = !!(flag&KSW_EZ_APPROX_MAX);
|
||||||
int32_t *H = 0, H0 = 0, last_H0_t = 0;
|
int32_t *H = 0, H0 = 0, last_H0_t = 0;
|
||||||
uint8_t *qr, *sf, *mem, *mem2 = 0;
|
uint8_t *qr, *sf, *mem, *mem2 = 0;
|
||||||
__m128i q_, qe2_, zero_, flag1_, flag2_, flag8_, flag16_, sc_mch_, sc_mis_, m1_, max_sc_;
|
__m128i q_, qe2_, zero_, flag1_, flag2_, flag8_, flag16_, sc_mch_, sc_mis_, sc_N_, m1_, max_sc_;
|
||||||
__m128i *u, *v, *x, *y, *s, *p = 0;
|
__m128i *u, *v, *x, *y, *s, *p = 0;
|
||||||
|
|
||||||
ksw_reset_extz(ez);
|
ksw_reset_extz(ez);
|
||||||
@@ -52,13 +65,15 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
|||||||
flag16_ = _mm_set1_epi8(0x10);
|
flag16_ = _mm_set1_epi8(0x10);
|
||||||
sc_mch_ = _mm_set1_epi8(mat[0]);
|
sc_mch_ = _mm_set1_epi8(mat[0]);
|
||||||
sc_mis_ = _mm_set1_epi8(mat[1]);
|
sc_mis_ = _mm_set1_epi8(mat[1]);
|
||||||
|
sc_N_ = _mm_set1_epi8(-e);
|
||||||
m1_ = _mm_set1_epi8(m - 1); // wildcard
|
m1_ = _mm_set1_epi8(m - 1); // wildcard
|
||||||
max_sc_ = _mm_set1_epi8(mat[0] + (q + e) * 2);
|
max_sc_ = _mm_set1_epi8(mat[0] + (q + e) * 2);
|
||||||
|
|
||||||
if (w < 0) w = tlen > qlen? tlen : qlen;
|
if (w < 0) w = tlen > qlen? tlen : qlen;
|
||||||
wl = wr = w;
|
wl = wr = w;
|
||||||
tlen_ = (tlen + 15) / 16;
|
tlen_ = (tlen + 15) / 16;
|
||||||
n_col_ = ((w + 1 < tlen? (w + 1 < qlen? w + 1 : qlen): tlen) + 15) / 16 + 1;
|
n_col_ = qlen < tlen? qlen : tlen;
|
||||||
|
n_col_ = ((n_col_ < w + 1? n_col_ : w + 1) + 15) / 16 + 1;
|
||||||
qlen_ = (qlen + 15) / 16;
|
qlen_ = (qlen + 15) / 16;
|
||||||
for (t = 1, max_sc = mat[0], min_sc = mat[1]; t < m * m; ++t) {
|
for (t = 1, max_sc = mat[0], min_sc = mat[1]; t < m * m; ++t) {
|
||||||
max_sc = max_sc > mat[t]? max_sc : mat[t];
|
max_sc = max_sc > mat[t]? max_sc : mat[t];
|
||||||
@@ -76,7 +91,8 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
|||||||
if (with_cigar) {
|
if (with_cigar) {
|
||||||
mem2 = (uint8_t*)kmalloc(km, ((qlen + tlen - 1) * n_col_ + 1) * 16);
|
mem2 = (uint8_t*)kmalloc(km, ((qlen + tlen - 1) * n_col_ + 1) * 16);
|
||||||
p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4);
|
p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4);
|
||||||
off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int));
|
off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int) * 2);
|
||||||
|
off_end = off + qlen + tlen - 1;
|
||||||
}
|
}
|
||||||
|
|
||||||
for (t = 0; t < qlen; ++t) qr[t] = query[qlen - 1 - t];
|
for (t = 0; t < qlen; ++t) qr[t] = query[qlen - 1 - t];
|
||||||
@@ -85,7 +101,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
|||||||
for (r = 0, last_st = last_en = -1; r < qlen + tlen - 1; ++r) {
|
for (r = 0, last_st = last_en = -1; r < qlen + tlen - 1; ++r) {
|
||||||
int st = 0, en = tlen - 1, st0, en0, st_, en_;
|
int st = 0, en = tlen - 1, st0, en0, st_, en_;
|
||||||
int8_t x1, v1;
|
int8_t x1, v1;
|
||||||
uint8_t *qrr = qr + (qlen - 1 - r), *u8 = (uint8_t*)u, *v8 = (uint8_t*)v, *x8 = (uint8_t*)x, p_en0 = 0;
|
uint8_t *qrr = qr + (qlen - 1 - r), *u8 = (uint8_t*)u, *v8 = (uint8_t*)v;
|
||||||
__m128i x1_, v1_;
|
__m128i x1_, v1_;
|
||||||
// find the boundaries
|
// find the boundaries
|
||||||
if (st < r - qlen + 1) st = r - qlen + 1;
|
if (st < r - qlen + 1) st = r - qlen + 1;
|
||||||
@@ -115,10 +131,11 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
|||||||
tmp = _mm_cmpeq_epi8(sq, st);
|
tmp = _mm_cmpeq_epi8(sq, st);
|
||||||
#ifdef __SSE4_1__
|
#ifdef __SSE4_1__
|
||||||
tmp = _mm_blendv_epi8(sc_mis_, sc_mch_, tmp);
|
tmp = _mm_blendv_epi8(sc_mis_, sc_mch_, tmp);
|
||||||
|
tmp = _mm_blendv_epi8(tmp, sc_N_, mask);
|
||||||
#else
|
#else
|
||||||
tmp = _mm_or_si128(_mm_andnot_si128(tmp, sc_mis_), _mm_and_si128(tmp, sc_mch_));
|
tmp = _mm_or_si128(_mm_andnot_si128(tmp, sc_mis_), _mm_and_si128(tmp, sc_mch_));
|
||||||
|
tmp = _mm_or_si128(_mm_andnot_si128(mask, tmp), _mm_and_si128(mask, sc_N_));
|
||||||
#endif
|
#endif
|
||||||
tmp = _mm_andnot_si128(mask, tmp);
|
|
||||||
_mm_storeu_si128((__m128i*)((uint8_t*)s + t), tmp);
|
_mm_storeu_si128((__m128i*)((uint8_t*)s + t), tmp);
|
||||||
}
|
}
|
||||||
} else {
|
} else {
|
||||||
@@ -129,6 +146,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
|||||||
x1_ = _mm_cvtsi32_si128(x1);
|
x1_ = _mm_cvtsi32_si128(x1);
|
||||||
v1_ = _mm_cvtsi32_si128(v1);
|
v1_ = _mm_cvtsi32_si128(v1);
|
||||||
st_ = st / 16, en_ = en / 16;
|
st_ = st / 16, en_ = en / 16;
|
||||||
|
assert(en_ - st_ + 1 <= n_col_);
|
||||||
if (!with_cigar) { // score only
|
if (!with_cigar) { // score only
|
||||||
for (t = st_; t <= en_; ++t) {
|
for (t = st_; t <= en_; ++t) {
|
||||||
__m128i z, a, b, xt1, vt1, ut, tmp;
|
__m128i z, a, b, xt1, vt1, ut, tmp;
|
||||||
@@ -152,14 +170,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
|||||||
}
|
}
|
||||||
} else if (!(flag&KSW_EZ_RIGHT)) { // gap left-alignment
|
} else if (!(flag&KSW_EZ_RIGHT)) { // gap left-alignment
|
||||||
__m128i *pr = p + r * n_col_ - st_;
|
__m128i *pr = p + r * n_col_ - st_;
|
||||||
off[r] = st;
|
off[r] = st, off_end[r] = en;
|
||||||
if (en0 < r && en0 < tlen - 1) { // to avoid backtracking out of the band; this assumes a fixed band
|
|
||||||
int8_t a, z = ((uint8_t*)s)[en0] + 2 * qe;
|
|
||||||
a = x8[en0-1] + v8[en0-1];
|
|
||||||
p_en0 = a > z? 1 : 0;
|
|
||||||
z = a > z? a : z;
|
|
||||||
p_en0 |= a - (z - q) > 0? 0x08 : 0;
|
|
||||||
}
|
|
||||||
for (t = st_; t <= en_; ++t) {
|
for (t = st_; t <= en_; ++t) {
|
||||||
__m128i d, z, a, b, xt1, vt1, ut, tmp;
|
__m128i d, z, a, b, xt1, vt1, ut, tmp;
|
||||||
__dp_code_block1;
|
__dp_code_block1;
|
||||||
@@ -185,14 +196,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
|||||||
}
|
}
|
||||||
} else { // gap right-alignment
|
} else { // gap right-alignment
|
||||||
__m128i *pr = p + r * n_col_ - st_;
|
__m128i *pr = p + r * n_col_ - st_;
|
||||||
off[r] = st;
|
off[r] = st, off_end[r] = en;
|
||||||
if (en0 < r && en0 < tlen - 1) {
|
|
||||||
int8_t a, z = ((uint8_t*)s)[en0] + 2 * qe;
|
|
||||||
a = x8[en0-1] + v8[en0-1];
|
|
||||||
p_en0 = a >= z? 1 : 0;
|
|
||||||
z = a >= z? a : z;
|
|
||||||
p_en0 |= a - (z - q) >= 0? 0x08 : 0;
|
|
||||||
}
|
|
||||||
for (t = st_; t <= en_; ++t) {
|
for (t = st_; t <= en_; ++t) {
|
||||||
__m128i d, z, a, b, xt1, vt1, ut, tmp;
|
__m128i d, z, a, b, xt1, vt1, ut, tmp;
|
||||||
__dp_code_block1;
|
__dp_code_block1;
|
||||||
@@ -217,7 +221,6 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
|||||||
_mm_store_si128(&pr[t], d);
|
_mm_store_si128(&pr[t], d);
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
if (with_cigar && en0 < r && en0 < tlen - 1) ((uint8_t*)(p + r * n_col_))[en0 - st] = p_en0;
|
|
||||||
if (!approx_max) { // find the exact max with a 32-bit score array
|
if (!approx_max) { // find the exact max with a 32-bit score array
|
||||||
int32_t max_H, max_t;
|
int32_t max_H, max_t;
|
||||||
// compute H[], max_H and max_t
|
// compute H[], max_H and max_t
|
||||||
@@ -288,10 +291,14 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
|||||||
if (!approx_max) kfree(km, H);
|
if (!approx_max) kfree(km, H);
|
||||||
if (with_cigar) { // backtrack
|
if (with_cigar) { // backtrack
|
||||||
int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
|
int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
|
||||||
if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY))
|
if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY)) {
|
||||||
ksw_backtrack(km, 1, rev_cigar, (uint8_t*)p, off, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||||
else if (ez->max_t >= 0 && ez->max_q >= 0)
|
} else if (!ez->zdropped && (flag&KSW_EZ_EXTZ_ONLY) && ez->mqe + end_bonus > ez->max) {
|
||||||
ksw_backtrack(km, 1, rev_cigar, (uint8_t*)p, off, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
ez->reach_end = 1;
|
||||||
|
ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, ez->mqe_t, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||||
|
} else if (ez->max_t >= 0 && ez->max_q >= 0) {
|
||||||
|
ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||||
|
}
|
||||||
kfree(km, mem2); kfree(km, off);
|
kfree(km, mem2); kfree(km, off);
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
|
|||||||
+147
@@ -0,0 +1,147 @@
|
|||||||
|
#include <stdlib.h>
|
||||||
|
#include <stdint.h>
|
||||||
|
#include <string.h>
|
||||||
|
#include <emmintrin.h>
|
||||||
|
#include "ksw2.h"
|
||||||
|
|
||||||
|
#ifdef __GNUC__
|
||||||
|
#define LIKELY(x) __builtin_expect((x),1)
|
||||||
|
#define UNLIKELY(x) __builtin_expect((x),0)
|
||||||
|
#else
|
||||||
|
#define LIKELY(x) (x)
|
||||||
|
#define UNLIKELY(x) (x)
|
||||||
|
#endif
|
||||||
|
|
||||||
|
typedef struct {
|
||||||
|
int qlen, slen;
|
||||||
|
uint8_t shift, mdiff, max, size;
|
||||||
|
__m128i *qp, *H0, *H1, *E, *Hmax;
|
||||||
|
} kswq_t;
|
||||||
|
|
||||||
|
/**
|
||||||
|
* Initialize the query data structure
|
||||||
|
*
|
||||||
|
* @param size Number of bytes used to store a score; valid valures are 1 or 2
|
||||||
|
* @param qlen Length of the query sequence
|
||||||
|
* @param query Query sequence
|
||||||
|
* @param m Size of the alphabet
|
||||||
|
* @param mat Scoring matrix in a one-dimension array
|
||||||
|
*
|
||||||
|
* @return Query data structure
|
||||||
|
*/
|
||||||
|
void *ksw_ll_qinit(void *km, int size, int qlen, const uint8_t *query, int m, const int8_t *mat)
|
||||||
|
{
|
||||||
|
kswq_t *q;
|
||||||
|
int slen, a, tmp, p;
|
||||||
|
|
||||||
|
size = size > 1? 2 : 1;
|
||||||
|
p = 8 * (3 - size); // # values per __m128i
|
||||||
|
slen = (qlen + p - 1) / p; // segmented length
|
||||||
|
q = (kswq_t*)kmalloc(km, sizeof(kswq_t) + 256 + 16 * slen * (m + 4)); // a single block of memory
|
||||||
|
q->qp = (__m128i*)(((size_t)q + sizeof(kswq_t) + 15) >> 4 << 4); // align memory
|
||||||
|
q->H0 = q->qp + slen * m;
|
||||||
|
q->H1 = q->H0 + slen;
|
||||||
|
q->E = q->H1 + slen;
|
||||||
|
q->Hmax = q->E + slen;
|
||||||
|
q->slen = slen; q->qlen = qlen; q->size = size;
|
||||||
|
// compute shift
|
||||||
|
tmp = m * m;
|
||||||
|
for (a = 0, q->shift = 127, q->mdiff = 0; a < tmp; ++a) { // find the minimum and maximum score
|
||||||
|
if (mat[a] < (int8_t)q->shift) q->shift = mat[a];
|
||||||
|
if (mat[a] > (int8_t)q->mdiff) q->mdiff = mat[a];
|
||||||
|
}
|
||||||
|
q->max = q->mdiff;
|
||||||
|
q->shift = 256 - q->shift; // NB: q->shift is uint8_t
|
||||||
|
q->mdiff += q->shift; // this is the difference between the min and max scores
|
||||||
|
// An example: p=8, qlen=19, slen=3 and segmentation:
|
||||||
|
// {{0,3,6,9,12,15,18,-1},{1,4,7,10,13,16,-1,-1},{2,5,8,11,14,17,-1,-1}}
|
||||||
|
if (size == 1) {
|
||||||
|
int8_t *t = (int8_t*)q->qp;
|
||||||
|
for (a = 0; a < m; ++a) {
|
||||||
|
int i, k, nlen = slen * p;
|
||||||
|
const int8_t *ma = mat + a * m;
|
||||||
|
for (i = 0; i < slen; ++i)
|
||||||
|
for (k = i; k < nlen; k += slen) // p iterations
|
||||||
|
*t++ = (k >= qlen? 0 : ma[query[k]]) + q->shift;
|
||||||
|
}
|
||||||
|
} else {
|
||||||
|
int16_t *t = (int16_t*)q->qp;
|
||||||
|
for (a = 0; a < m; ++a) {
|
||||||
|
int i, k, nlen = slen * p;
|
||||||
|
const int8_t *ma = mat + a * m;
|
||||||
|
for (i = 0; i < slen; ++i)
|
||||||
|
for (k = i; k < nlen; k += slen) // p iterations
|
||||||
|
*t++ = (k >= qlen? 0 : ma[query[k]]);
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return q;
|
||||||
|
}
|
||||||
|
|
||||||
|
int ksw_ll_i16(void *q_, int tlen, const uint8_t *target, int _gapo, int _gape, int *qe, int *te)
|
||||||
|
{
|
||||||
|
kswq_t *q = (kswq_t*)q_;
|
||||||
|
int slen, i, gmax = 0, qlen8;
|
||||||
|
__m128i zero, gapoe, gape, *H0, *H1, *E, *Hmax;
|
||||||
|
uint16_t *H8;
|
||||||
|
|
||||||
|
#define __max_8(ret, xx) do { \
|
||||||
|
(xx) = _mm_max_epi16((xx), _mm_srli_si128((xx), 8)); \
|
||||||
|
(xx) = _mm_max_epi16((xx), _mm_srli_si128((xx), 4)); \
|
||||||
|
(xx) = _mm_max_epi16((xx), _mm_srli_si128((xx), 2)); \
|
||||||
|
(ret) = _mm_extract_epi16((xx), 0); \
|
||||||
|
} while (0)
|
||||||
|
|
||||||
|
// initialization
|
||||||
|
*qe = *te = -1;
|
||||||
|
zero = _mm_set1_epi32(0);
|
||||||
|
gapoe = _mm_set1_epi16(_gapo + _gape);
|
||||||
|
gape = _mm_set1_epi16(_gape);
|
||||||
|
H0 = q->H0; H1 = q->H1; E = q->E; Hmax = q->Hmax;
|
||||||
|
slen = q->slen, qlen8 = slen * 8;
|
||||||
|
memset(E, 0, slen * sizeof(__m128i));
|
||||||
|
memset(H0, 0, slen * sizeof(__m128i));
|
||||||
|
memset(Hmax, 0, slen * sizeof(__m128i));
|
||||||
|
// the core loop
|
||||||
|
for (i = 0; i < tlen; ++i) {
|
||||||
|
int j, k, imax;
|
||||||
|
__m128i e, h, f = zero, max = zero, *S = q->qp + target[i] * slen; // s is the 1st score vector
|
||||||
|
h = _mm_load_si128(H0 + slen - 1); // h={2,5,8,11,14,17,-1,-1} in the above example
|
||||||
|
h = _mm_slli_si128(h, 2);
|
||||||
|
for (j = 0; LIKELY(j < slen); ++j) {
|
||||||
|
h = _mm_adds_epi16(h, *S++);
|
||||||
|
e = _mm_load_si128(E + j);
|
||||||
|
h = _mm_max_epi16(h, e);
|
||||||
|
h = _mm_max_epi16(h, f);
|
||||||
|
max = _mm_max_epi16(max, h);
|
||||||
|
_mm_store_si128(H1 + j, h);
|
||||||
|
h = _mm_subs_epu16(h, gapoe);
|
||||||
|
e = _mm_subs_epu16(e, gape);
|
||||||
|
e = _mm_max_epi16(e, h);
|
||||||
|
_mm_store_si128(E + j, e);
|
||||||
|
f = _mm_subs_epu16(f, gape);
|
||||||
|
f = _mm_max_epi16(f, h);
|
||||||
|
h = _mm_load_si128(H0 + j);
|
||||||
|
}
|
||||||
|
for (k = 0; LIKELY(k < 8); ++k) {
|
||||||
|
f = _mm_slli_si128(f, 2);
|
||||||
|
for (j = 0; LIKELY(j < slen); ++j) {
|
||||||
|
h = _mm_load_si128(H1 + j);
|
||||||
|
h = _mm_max_epi16(h, f);
|
||||||
|
_mm_store_si128(H1 + j, h);
|
||||||
|
h = _mm_subs_epu16(h, gapoe);
|
||||||
|
f = _mm_subs_epu16(f, gape);
|
||||||
|
if(UNLIKELY(!_mm_movemask_epi8(_mm_cmpgt_epi16(f, h)))) goto end_loop_i16;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
end_loop_i16:
|
||||||
|
__max_8(imax, max);
|
||||||
|
if (imax >= gmax) {
|
||||||
|
gmax = imax; *te = i;
|
||||||
|
memcpy(Hmax, H1, slen * sizeof(__m128i));
|
||||||
|
}
|
||||||
|
S = H1; H1 = H0; H0 = S;
|
||||||
|
}
|
||||||
|
for (i = 0, H8 = (uint16_t*)Hmax; i < qlen8; ++i)
|
||||||
|
if ((int)H8[i] == gmax) *qe = i / 8 + i % 8 * slen;
|
||||||
|
return gmax;
|
||||||
|
}
|
||||||
@@ -1,6 +1,11 @@
|
|||||||
#include <pthread.h>
|
#include <pthread.h>
|
||||||
#include <stdlib.h>
|
#include <stdlib.h>
|
||||||
#include <limits.h>
|
#include <limits.h>
|
||||||
|
#include <stdint.h>
|
||||||
|
|
||||||
|
#if (defined(WIN32) || defined(_WIN32)) && defined(_MSC_VER)
|
||||||
|
#define __sync_fetch_and_add(ptr, addend) _InterlockedExchangeAdd((void*)ptr, addend)
|
||||||
|
#endif
|
||||||
|
|
||||||
/************
|
/************
|
||||||
* kt_for() *
|
* kt_for() *
|
||||||
@@ -52,12 +57,13 @@ void kt_for(int n_threads, void (*func)(void*,long,int), void *data, long n)
|
|||||||
kt_for_t t;
|
kt_for_t t;
|
||||||
pthread_t *tid;
|
pthread_t *tid;
|
||||||
t.func = func, t.data = data, t.n_threads = n_threads, t.n = n;
|
t.func = func, t.data = data, t.n_threads = n_threads, t.n = n;
|
||||||
t.w = (ktf_worker_t*)alloca(n_threads * sizeof(ktf_worker_t));
|
t.w = (ktf_worker_t*)calloc(n_threads, sizeof(ktf_worker_t));
|
||||||
tid = (pthread_t*)alloca(n_threads * sizeof(pthread_t));
|
tid = (pthread_t*)calloc(n_threads, sizeof(pthread_t));
|
||||||
for (i = 0; i < n_threads; ++i)
|
for (i = 0; i < n_threads; ++i)
|
||||||
t.w[i].t = &t, t.w[i].i = i;
|
t.w[i].t = &t, t.w[i].i = i;
|
||||||
for (i = 0; i < n_threads; ++i) pthread_create(&tid[i], 0, ktf_worker, &t.w[i]);
|
for (i = 0; i < n_threads; ++i) pthread_create(&tid[i], 0, ktf_worker, &t.w[i]);
|
||||||
for (i = 0; i < n_threads; ++i) pthread_join(tid[i], 0);
|
for (i = 0; i < n_threads; ++i) pthread_join(tid[i], 0);
|
||||||
|
free(tid); free(t.w);
|
||||||
} else {
|
} else {
|
||||||
long j;
|
long j;
|
||||||
for (j = 0; j < n; ++j) func(data, j, 0);
|
for (j = 0; j < n; ++j) func(data, j, 0);
|
||||||
@@ -135,16 +141,17 @@ void kt_pipeline(int n_threads, void *(*func)(void*, int, void*), void *shared_d
|
|||||||
pthread_mutex_init(&aux.mutex, 0);
|
pthread_mutex_init(&aux.mutex, 0);
|
||||||
pthread_cond_init(&aux.cv, 0);
|
pthread_cond_init(&aux.cv, 0);
|
||||||
|
|
||||||
aux.workers = (ktp_worker_t*)alloca(n_threads * sizeof(ktp_worker_t));
|
aux.workers = (ktp_worker_t*)calloc(n_threads, sizeof(ktp_worker_t));
|
||||||
for (i = 0; i < n_threads; ++i) {
|
for (i = 0; i < n_threads; ++i) {
|
||||||
ktp_worker_t *w = &aux.workers[i];
|
ktp_worker_t *w = &aux.workers[i];
|
||||||
w->step = 0; w->pl = &aux; w->data = 0;
|
w->step = 0; w->pl = &aux; w->data = 0;
|
||||||
w->index = aux.index++;
|
w->index = aux.index++;
|
||||||
}
|
}
|
||||||
|
|
||||||
tid = (pthread_t*)alloca(n_threads * sizeof(pthread_t));
|
tid = (pthread_t*)calloc(n_threads, sizeof(pthread_t));
|
||||||
for (i = 0; i < n_threads; ++i) pthread_create(&tid[i], 0, ktp_worker, &aux.workers[i]);
|
for (i = 0; i < n_threads; ++i) pthread_create(&tid[i], 0, ktp_worker, &aux.workers[i]);
|
||||||
for (i = 0; i < n_threads; ++i) pthread_join(tid[i], 0);
|
for (i = 0; i < n_threads; ++i) pthread_join(tid[i], 0);
|
||||||
|
free(tid); free(aux.workers);
|
||||||
|
|
||||||
pthread_mutex_destroy(&aux.mutex);
|
pthread_mutex_destroy(&aux.mutex);
|
||||||
pthread_cond_destroy(&aux.cv);
|
pthread_cond_destroy(&aux.cv);
|
||||||
|
|||||||
@@ -1,35 +1,52 @@
|
|||||||
#include <getopt.h>
|
|
||||||
#include <stdlib.h>
|
#include <stdlib.h>
|
||||||
#include <stdio.h>
|
#include <stdio.h>
|
||||||
#include <string.h>
|
#include <string.h>
|
||||||
#include <sys/resource.h>
|
|
||||||
#include <sys/time.h>
|
|
||||||
#include "bseq.h"
|
#include "bseq.h"
|
||||||
#include "minimap.h"
|
#include "minimap.h"
|
||||||
#include "mmpriv.h"
|
#include "mmpriv.h"
|
||||||
|
#include "getopt.h"
|
||||||
|
|
||||||
#define MM_VERSION "2.0-r191-dirty"
|
#define MM_VERSION "2.7-r654"
|
||||||
|
|
||||||
|
#ifdef __linux__
|
||||||
|
#include <sys/resource.h>
|
||||||
|
#include <sys/time.h>
|
||||||
void liftrlimit()
|
void liftrlimit()
|
||||||
{
|
{
|
||||||
#ifdef __linux__
|
|
||||||
struct rlimit r;
|
struct rlimit r;
|
||||||
getrlimit(RLIMIT_AS, &r);
|
getrlimit(RLIMIT_AS, &r);
|
||||||
r.rlim_cur = r.rlim_max;
|
r.rlim_cur = r.rlim_max;
|
||||||
setrlimit(RLIMIT_AS, &r);
|
setrlimit(RLIMIT_AS, &r);
|
||||||
#endif
|
|
||||||
}
|
}
|
||||||
|
#else
|
||||||
|
void liftrlimit() {}
|
||||||
|
#endif
|
||||||
|
|
||||||
static struct option long_options[] = {
|
static struct option long_options[] = {
|
||||||
{ "bucket-bits", required_argument, 0, 0 },
|
{ "bucket-bits", required_argument, 0, 0 },
|
||||||
{ "mb-size", required_argument, 0, 'K' },
|
{ "mb-size", required_argument, 0, 'K' },
|
||||||
{ "int-rname", no_argument, 0, 0 },
|
{ "seed", required_argument, 0, 0 },
|
||||||
{ "no-kalloc", no_argument, 0, 0 },
|
{ "no-kalloc", no_argument, 0, 0 },
|
||||||
{ "print-qname", no_argument, 0, 0 },
|
{ "print-qname", no_argument, 0, 0 },
|
||||||
{ "no-self", no_argument, 0, 0 },
|
{ "no-self", no_argument, 0, 0 },
|
||||||
{ "print-seed", no_argument, 0, 0 },
|
{ "print-seeds", no_argument, 0, 0 },
|
||||||
{ "max-chain-skip", required_argument, 0, 0 },
|
{ "max-chain-skip", required_argument, 0, 0 },
|
||||||
{ "min-dp-len", required_argument, 0, 0 },
|
{ "min-dp-len", required_argument, 0, 0 },
|
||||||
|
{ "print-aln-seq", no_argument, 0, 0 },
|
||||||
|
{ "splice", no_argument, 0, 0 },
|
||||||
|
{ "cost-non-gt-ag", required_argument, 0, 'C' },
|
||||||
|
{ "no-long-join", no_argument, 0, 0 },
|
||||||
|
{ "sr", no_argument, 0, 0 },
|
||||||
|
{ "frag", optional_argument, 0, 0 },
|
||||||
|
{ "secondary", optional_argument, 0, 0 },
|
||||||
|
{ "cs", optional_argument, 0, 0 },
|
||||||
|
{ "end-bonus", required_argument, 0, 0 },
|
||||||
|
{ "no-pairing", no_argument, 0, 0 },
|
||||||
|
{ "splice-flank", optional_argument, 0, 0 },
|
||||||
|
{ "idx-no-seq", no_argument, 0, 0 },
|
||||||
|
{ "end-seed-pen", required_argument, 0, 0 }, // 21
|
||||||
|
{ "help", no_argument, 0, 'h' },
|
||||||
|
{ "max-intron-len", required_argument, 0, 'G' },
|
||||||
{ "version", no_argument, 0, 'V' },
|
{ "version", no_argument, 0, 'V' },
|
||||||
{ "min-count", required_argument, 0, 'n' },
|
{ "min-count", required_argument, 0, 'n' },
|
||||||
{ "min-chain-score",required_argument, 0, 'm' },
|
{ "min-chain-score",required_argument, 0, 'm' },
|
||||||
@@ -39,37 +56,63 @@ static struct option long_options[] = {
|
|||||||
{ 0, 0, 0, 0}
|
{ 0, 0, 0, 0}
|
||||||
};
|
};
|
||||||
|
|
||||||
|
static inline int64_t mm_parse_num(const char *str)
|
||||||
|
{
|
||||||
|
double x;
|
||||||
|
char *p;
|
||||||
|
x = strtod(optarg, &p);
|
||||||
|
if (*p == 'G' || *p == 'g') x *= 1e9;
|
||||||
|
else if (*p == 'M' || *p == 'm') x *= 1e6;
|
||||||
|
else if (*p == 'K' || *p == 'k') x *= 1e3;
|
||||||
|
return (int64_t)(x + .499);
|
||||||
|
}
|
||||||
|
|
||||||
int main(int argc, char *argv[])
|
int main(int argc, char *argv[])
|
||||||
{
|
{
|
||||||
|
const char *opt_str = "2aSw:k:K:t:r:f:Vv:g:G:I:d:XT:s:x:Hcp:M:n:z:A:B:O:E:m:N:Qu:R:hF:LC:";
|
||||||
mm_mapopt_t opt;
|
mm_mapopt_t opt;
|
||||||
int i, c, k = 15, w = -1, bucket_bits = MM_IDX_DEF_B, n_threads = 3, keep_name = 1, is_idx, is_hpc = 0, long_idx, idx_par_set = 0;
|
mm_idxopt_t ipt;
|
||||||
int minibatch_size = 200000000;
|
int i, c, n_threads = 3, long_idx;
|
||||||
uint64_t batch_size = 4000000000ULL;
|
char *fnw = 0, *rg = 0, *s;
|
||||||
mm_bseq_file_t *fp = 0;
|
FILE *fp_help = stderr;
|
||||||
char *fnw = 0, *s;
|
mm_idx_reader_t *idx_rdr;
|
||||||
FILE *fpr = 0, *fpw = 0;
|
mm_idx_t *mi;
|
||||||
|
|
||||||
|
mm_verbose = 3;
|
||||||
liftrlimit();
|
liftrlimit();
|
||||||
mm_realtime0 = realtime();
|
mm_realtime0 = realtime();
|
||||||
mm_mapopt_init(&opt);
|
mm_set_opt(0, &ipt, &opt);
|
||||||
|
|
||||||
while ((c = getopt_long(argc, argv, "aw:k:K:t:r:f:Vv:g:I:d:XT:s:x:Hcp:M:n:z:A:B:O:E:m:N:Q", long_options, &long_idx)) >= 0) {
|
while ((c = getopt_long(argc, argv, opt_str, long_options, &long_idx)) >= 0) // apply option -x/preset first
|
||||||
if (c == 'w') w = atoi(optarg), idx_par_set = 1;
|
if (c == 'x') {
|
||||||
else if (c == 'k') k = atoi(optarg), idx_par_set = 1;
|
if (mm_set_opt(optarg, &ipt, &opt) < 0) {
|
||||||
else if (c == 'H') is_hpc = 1, idx_par_set = 1;
|
fprintf(stderr, "[ERROR] unknown preset '%s'\n", optarg);
|
||||||
|
return 1;
|
||||||
|
}
|
||||||
|
break;
|
||||||
|
}
|
||||||
|
optreset = 1;
|
||||||
|
|
||||||
|
while ((c = getopt_long(argc, argv, opt_str, long_options, &long_idx)) >= 0) {
|
||||||
|
if (c == 'w') ipt.w = atoi(optarg);
|
||||||
|
else if (c == 'k') ipt.k = atoi(optarg);
|
||||||
|
else if (c == 'H') ipt.flag |= MM_I_HPC;
|
||||||
else if (c == 'd') fnw = optarg; // the above are indexing related options, except -I
|
else if (c == 'd') fnw = optarg; // the above are indexing related options, except -I
|
||||||
else if (c == 'r') opt.bw = atoi(optarg);
|
else if (c == 'r') opt.bw = (int)mm_parse_num(optarg);
|
||||||
else if (c == 'f') opt.mid_occ_frac = atof(optarg);
|
|
||||||
else if (c == 't') n_threads = atoi(optarg);
|
else if (c == 't') n_threads = atoi(optarg);
|
||||||
else if (c == 'v') mm_verbose = atoi(optarg);
|
else if (c == 'v') mm_verbose = atoi(optarg);
|
||||||
else if (c == 'g') opt.max_gap = atoi(optarg);
|
else if (c == 'g') opt.max_gap = (int)mm_parse_num(optarg);
|
||||||
|
else if (c == 'G') mm_mapopt_max_intron_len(&opt, (int)mm_parse_num(optarg));
|
||||||
|
else if (c == 'F') opt.max_frag_len = (int)mm_parse_num(optarg);
|
||||||
else if (c == 'N') opt.best_n = atoi(optarg);
|
else if (c == 'N') opt.best_n = atoi(optarg);
|
||||||
else if (c == 'p') opt.pri_ratio = atof(optarg);
|
else if (c == 'p') opt.pri_ratio = atof(optarg);
|
||||||
else if (c == 'M') opt.mask_level = atof(optarg);
|
else if (c == 'M') opt.mask_level = atof(optarg);
|
||||||
else if (c == 'c') opt.flag |= MM_F_CIGAR;
|
else if (c == 'c') opt.flag |= MM_F_OUT_CG | MM_F_CIGAR;
|
||||||
else if (c == 'X') opt.flag |= MM_F_AVA | MM_F_NO_SELF;
|
else if (c == 'X') opt.flag |= MM_F_AVA | MM_F_NO_SELF;
|
||||||
else if (c == 'a') opt.flag |= MM_F_OUT_SAM | MM_F_CIGAR;
|
else if (c == 'a') opt.flag |= MM_F_OUT_SAM | MM_F_CIGAR;
|
||||||
else if (c == 'Q') opt.flag |= MM_F_NO_QUAL;
|
else if (c == 'Q') opt.flag |= MM_F_NO_QUAL;
|
||||||
|
else if (c == 'Y') opt.flag |= MM_F_SOFTCLIP;
|
||||||
|
else if (c == 'L') opt.flag |= MM_F_LONG_CIGAR;
|
||||||
else if (c == 'T') opt.sdust_thres = atoi(optarg);
|
else if (c == 'T') opt.sdust_thres = atoi(optarg);
|
||||||
else if (c == 'n') opt.min_cnt = atoi(optarg);
|
else if (c == 'n') opt.min_cnt = atoi(optarg);
|
||||||
else if (c == 'm') opt.min_chain_score = atoi(optarg);
|
else if (c == 'm') opt.min_chain_score = atoi(optarg);
|
||||||
@@ -77,145 +120,188 @@ int main(int argc, char *argv[])
|
|||||||
else if (c == 'B') opt.b = atoi(optarg);
|
else if (c == 'B') opt.b = atoi(optarg);
|
||||||
else if (c == 'z') opt.zdrop = atoi(optarg);
|
else if (c == 'z') opt.zdrop = atoi(optarg);
|
||||||
else if (c == 's') opt.min_dp_max = atoi(optarg);
|
else if (c == 's') opt.min_dp_max = atoi(optarg);
|
||||||
else if (c == 0 && long_idx == 0) bucket_bits = atoi(optarg); // --bucket-bits
|
else if (c == 'C') opt.noncan = atoi(optarg);
|
||||||
else if (c == 0 && long_idx == 2) keep_name = 0; // --int-rname
|
else if (c == 'I') ipt.batch_size = mm_parse_num(optarg);
|
||||||
|
else if (c == 'K') opt.mini_batch_size = (int)mm_parse_num(optarg);
|
||||||
|
else if (c == 'R') rg = optarg;
|
||||||
|
else if (c == 'h') fp_help = stdout;
|
||||||
|
else if (c == '2') opt.flag |= MM_F_2_IO_THREADS;
|
||||||
|
else if (c == 0 && long_idx == 0) ipt.bucket_bits = atoi(optarg); // --bucket-bits
|
||||||
|
else if (c == 0 && long_idx == 2) opt.seed = atoi(optarg); // --seed
|
||||||
else if (c == 0 && long_idx == 3) mm_dbg_flag |= MM_DBG_NO_KALLOC; // --no-kalloc
|
else if (c == 0 && long_idx == 3) mm_dbg_flag |= MM_DBG_NO_KALLOC; // --no-kalloc
|
||||||
else if (c == 0 && long_idx == 4) mm_dbg_flag |= MM_DBG_PRINT_QNAME; // --print-qname
|
else if (c == 0 && long_idx == 4) mm_dbg_flag |= MM_DBG_PRINT_QNAME; // --print-qname
|
||||||
else if (c == 0 && long_idx == 5) opt.flag |= MM_F_NO_SELF; // --no-self
|
else if (c == 0 && long_idx == 5) opt.flag |= MM_F_NO_SELF; // --no-self
|
||||||
else if (c == 0 && long_idx == 6) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_SEED; // --print-seed
|
else if (c == 0 && long_idx == 6) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_SEED, n_threads = 1; // --print-seed
|
||||||
else if (c == 0 && long_idx == 7) opt.max_chain_skip = atoi(optarg); // --max-chain-skip
|
else if (c == 0 && long_idx == 7) opt.max_chain_skip = atoi(optarg); // --max-chain-skip
|
||||||
else if (c == 0 && long_idx == 8) opt.min_ksw_len = atoi(optarg); // --min-dp-len
|
else if (c == 0 && long_idx == 8) opt.min_ksw_len = atoi(optarg); // --min-dp-len
|
||||||
else if (c == 'V') {
|
else if (c == 0 && long_idx == 9) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_ALN_SEQ, n_threads = 1; // --print-aln-seq
|
||||||
|
else if (c == 0 && long_idx ==10) opt.flag |= MM_F_SPLICE; // --splice
|
||||||
|
else if (c == 0 && long_idx ==12) opt.flag |= MM_F_NO_LJOIN; // --no-long-join
|
||||||
|
else if (c == 0 && long_idx ==13) opt.flag |= MM_F_SR; // --sr
|
||||||
|
else if (c == 0 && long_idx ==17) opt.end_bonus = atoi(optarg); // --end-bonus
|
||||||
|
else if (c == 0 && long_idx ==18) opt.flag |= MM_F_INDEPEND_SEG; // --no-pairing
|
||||||
|
else if (c == 0 && long_idx ==20) ipt.flag |= MM_I_NO_SEQ; // --idx-no-seq
|
||||||
|
else if (c == 0 && long_idx ==21) opt.anchor_ext_shift = atoi(optarg); // --end-seed-pen
|
||||||
|
else if (c == 0 && long_idx == 14) { // --frag
|
||||||
|
if (optarg == 0 || strcmp(optarg, "yes") == 0 || strcmp(optarg, "y") == 0)
|
||||||
|
opt.flag |= MM_F_FRAG_MODE;
|
||||||
|
else opt.flag &= ~MM_F_FRAG_MODE;
|
||||||
|
} else if (c == 0 && long_idx == 15) { // --secondary
|
||||||
|
if (optarg == 0 || strcmp(optarg, "yes") == 0 || strcmp(optarg, "y") == 0)
|
||||||
|
opt.flag &= ~MM_F_NO_PRINT_2ND;
|
||||||
|
else opt.flag |= MM_F_NO_PRINT_2ND;
|
||||||
|
} else if (c == 0 && long_idx == 16) { // --cs
|
||||||
|
opt.flag |= MM_F_OUT_CS | MM_F_CIGAR;
|
||||||
|
if (optarg == 0 || strcmp(optarg, "short") == 0) {
|
||||||
|
opt.flag &= ~MM_F_OUT_CS_LONG;
|
||||||
|
} else if (strcmp(optarg, "long") == 0) {
|
||||||
|
opt.flag |= MM_F_OUT_CS_LONG;
|
||||||
|
} else if (strcmp(optarg, "none") == 0) {
|
||||||
|
opt.flag &= ~MM_F_OUT_CS;
|
||||||
|
} else if (mm_verbose >= 2) {
|
||||||
|
fprintf(stderr, "[WARNING]\033[1;31m --cs only takes 'short' or 'long'. Invalid values are assumed to be 'short'.\033[0m\n");
|
||||||
|
}
|
||||||
|
} else if (c == 0 && long_idx == 19) { // --splice-flank
|
||||||
|
if (optarg == 0 || strcmp(optarg, "yes") == 0 || strcmp(optarg, "y") == 0)
|
||||||
|
opt.flag |= MM_F_SPLICE_FLANK;
|
||||||
|
else opt.flag &= ~MM_F_SPLICE_FLANK;
|
||||||
|
} else if (c == 'S') {
|
||||||
|
opt.flag |= MM_F_OUT_CS | MM_F_CIGAR | MM_F_OUT_CS_LONG;
|
||||||
|
if (mm_verbose >= 2)
|
||||||
|
fprintf(stderr, "[WARNING]\033[1;31m option -S is deprecated and may be removed in future. Please use --cs=long instead.\033[0m\n");
|
||||||
|
} else if (c == 'V') {
|
||||||
puts(MM_VERSION);
|
puts(MM_VERSION);
|
||||||
return 0;
|
return 0;
|
||||||
|
} else if (c == 'f') {
|
||||||
|
double x;
|
||||||
|
char *p;
|
||||||
|
x = strtod(optarg, &p);
|
||||||
|
if (x < 1.0) opt.mid_occ_frac = x, opt.mid_occ = 0;
|
||||||
|
else opt.mid_occ = (int)(x + .499);
|
||||||
|
if (*p == ',') opt.max_occ = (int)(strtod(p+1, &p) + .499);
|
||||||
|
} else if (c == 'u') {
|
||||||
|
if (*optarg == 'b') opt.flag |= MM_F_SPLICE_FOR|MM_F_SPLICE_REV; // both strands
|
||||||
|
else if (*optarg == 'f') opt.flag |= MM_F_SPLICE_FOR, opt.flag &= ~MM_F_SPLICE_REV; // match GT-AG
|
||||||
|
else if (*optarg == 'r') opt.flag |= MM_F_SPLICE_REV, opt.flag &= ~MM_F_SPLICE_FOR; // match CT-AC (reverse complement of GT-AG)
|
||||||
|
else if (*optarg == 'n') opt.flag &= ~(MM_F_SPLICE_FOR|MM_F_SPLICE_REV); // don't try to match the GT-AG signal
|
||||||
|
else {
|
||||||
|
fprintf(stderr, "[ERROR]\033[1;31m unrecognized cDNA direction\033[0m\n");
|
||||||
|
return 1;
|
||||||
|
}
|
||||||
} else if (c == 'O') {
|
} else if (c == 'O') {
|
||||||
opt.q = opt.q2 = strtol(optarg, &s, 10);
|
opt.q = opt.q2 = strtol(optarg, &s, 10);
|
||||||
if (*s == ',') opt.q2 = strtol(s + 1, &s, 10);
|
if (*s == ',') opt.q2 = strtol(s + 1, &s, 10);
|
||||||
} else if (c == 'E') {
|
} else if (c == 'E') {
|
||||||
opt.e = opt.e2 = strtol(optarg, &s, 10);
|
opt.e = opt.e2 = strtol(optarg, &s, 10);
|
||||||
if (*s == ',') opt.e2 = strtol(s + 1, &s, 10);
|
if (*s == ',') opt.e2 = strtol(s + 1, &s, 10);
|
||||||
} else if (c == 'I' || c == 'K') {
|
}
|
||||||
double x;
|
}
|
||||||
char *p;
|
if ((opt.flag & MM_F_SPLICE) && (opt.flag & MM_F_FRAG_MODE)) {
|
||||||
x = strtod(optarg, &p);
|
fprintf(stderr, "[ERROR]\033[1;31m --splice and --frag should not be specified at the same time.\033[0m\n");
|
||||||
if (*p == 'G' || *p == 'g') x *= 1e9;
|
return 1;
|
||||||
else if (*p == 'M' || *p == 'm') x *= 1e6;
|
}
|
||||||
else if (*p == 'K' || *p == 'k') x *= 1e3;
|
if (!fnw && !(opt.flag&MM_F_CIGAR))
|
||||||
if (c == 'I') batch_size = (uint64_t)(x + .499);
|
ipt.flag |= MM_I_NO_SEQ;
|
||||||
else minibatch_size = (uint64_t)(x + .499);
|
if (mm_check_opt(&ipt, &opt) < 0)
|
||||||
} else if (c == 'x') {
|
return 1;
|
||||||
if (strcmp(optarg, "ava-ont") == 0) {
|
|
||||||
opt.flag |= MM_F_AVA | MM_F_NO_SELF;
|
if (argc == optind || fp_help == stdout) {
|
||||||
opt.min_chain_score = 100, opt.pri_ratio = 0.0f, opt.max_gap = 10000, opt.max_chain_skip = 25;
|
fprintf(fp_help, "Usage: minimap2 [options] <target.fa>|<target.idx> [query.fa] [...]\n");
|
||||||
minibatch_size = 500000000;
|
fprintf(fp_help, "Options:\n");
|
||||||
k = 15, w = 5;
|
fprintf(fp_help, " Indexing:\n");
|
||||||
} else if (strcmp(optarg, "ava-pb") == 0) {
|
fprintf(fp_help, " -H use homopolymer-compressed k-mer\n");
|
||||||
opt.flag |= MM_F_AVA | MM_F_NO_SELF;
|
fprintf(fp_help, " -k INT k-mer size (no larger than 28) [%d]\n", ipt.k);
|
||||||
opt.min_chain_score = 100, opt.pri_ratio = 0.0f, opt.max_gap = 10000, opt.max_chain_skip = 25;
|
fprintf(fp_help, " -w INT minizer window size [%d]\n", ipt.w);
|
||||||
minibatch_size = 500000000;
|
fprintf(fp_help, " -I NUM split index for every ~NUM input bases [4G]\n");
|
||||||
is_hpc = 1, k = 19, w = 5;
|
fprintf(fp_help, " -d FILE dump index to FILE []\n");
|
||||||
} else if (strcmp(optarg, "map10k") == 0 || strcmp(optarg, "map-pb") == 0) {
|
fprintf(fp_help, " Mapping:\n");
|
||||||
is_hpc = 1, k = 19;
|
fprintf(fp_help, " -f FLOAT filter out top FLOAT fraction of repetitive minimizers [%g]\n", opt.mid_occ_frac);
|
||||||
} else if (strcmp(optarg, "map-ont") == 0) {
|
fprintf(fp_help, " -g NUM stop chain enlongation if there are no minimizers in INT-bp [%d]\n", opt.max_gap);
|
||||||
is_hpc = 0, k = 15;
|
fprintf(fp_help, " -G NUM max intron length (effective with -xsplice; changing -r) [200k]\n");
|
||||||
} else if (strcmp(optarg, "asm5") == 0) {
|
fprintf(fp_help, " -F NUM max fragment length (effective with -xsr or in the fragment mode) [800]\n");
|
||||||
k = 19, w = 19;
|
fprintf(fp_help, " -r NUM bandwidth used in chaining and DP-based alignment [%d]\n", opt.bw);
|
||||||
opt.a = 1, opt.b = 19, opt.q = 39, opt.q2 = 81, opt.e = 3, opt.e2 = 1, opt.zdrop = 200;
|
fprintf(fp_help, " -n INT minimal number of minimizers on a chain [%d]\n", opt.min_cnt);
|
||||||
opt.min_dp_max = 200;
|
fprintf(fp_help, " -m INT minimal chaining score (matching bases minus log gap penalty) [%d]\n", opt.min_chain_score);
|
||||||
} else if (strcmp(optarg, "asm10") == 0) {
|
// fprintf(fp_help, " -T INT SDUST threshold; 0 to disable SDUST [%d]\n", opt.sdust_thres); // TODO: this option is never used; might be buggy
|
||||||
k = 19, w = 19;
|
fprintf(fp_help, " -X skip self and dual mappings (for the all-vs-all mode)\n");
|
||||||
opt.a = 1, opt.b = 9, opt.q = 16, opt.q2 = 41, opt.e = 2, opt.e2 = 1, opt.zdrop = 200;
|
fprintf(fp_help, " -p FLOAT min secondary-to-primary score ratio [%g]\n", opt.pri_ratio);
|
||||||
opt.min_dp_max = 200;
|
fprintf(fp_help, " -N INT retain at most INT secondary alignments [%d]\n", opt.best_n);
|
||||||
|
fprintf(fp_help, " Alignment:\n");
|
||||||
|
fprintf(fp_help, " -A INT matching score [%d]\n", opt.a);
|
||||||
|
fprintf(fp_help, " -B INT mismatch penalty [%d]\n", opt.b);
|
||||||
|
fprintf(fp_help, " -O INT[,INT] gap open penalty [%d,%d]\n", opt.q, opt.q2);
|
||||||
|
fprintf(fp_help, " -E INT[,INT] gap extension penalty; a k-long gap costs min{O1+k*E1,O2+k*E2} [%d,%d]\n", opt.e, opt.e2);
|
||||||
|
fprintf(fp_help, " -z INT Z-drop score [%d]\n", opt.zdrop);
|
||||||
|
fprintf(fp_help, " -s INT minimal peak DP alignment score [%d]\n", opt.min_dp_max);
|
||||||
|
fprintf(fp_help, " -u CHAR how to find GT-AG. f:transcript strand, b:both strands, n:don't match GT-AG [n]\n");
|
||||||
|
fprintf(fp_help, " Input/Output:\n");
|
||||||
|
fprintf(fp_help, " -a output in the SAM format (PAF by default)\n");
|
||||||
|
fprintf(fp_help, " -Q don't output base quality in SAM\n");
|
||||||
|
fprintf(fp_help, " -L write CIGAR with >65535 ops at the CG tag\n");
|
||||||
|
fprintf(fp_help, " -R STR SAM read group line in a format like '@RG\\tID:foo\\tSM:bar' []\n");
|
||||||
|
fprintf(fp_help, " -c output CIGAR in PAF\n");
|
||||||
|
fprintf(fp_help, " --cs[=STR] output the cs tag; STR is 'short' (if absent) or 'long' [none]\n");
|
||||||
|
fprintf(fp_help, " -Y use soft clipping for supplementary alignments\n");
|
||||||
|
fprintf(fp_help, " -t INT number of threads [%d]\n", n_threads);
|
||||||
|
fprintf(fp_help, " -K NUM minibatch size for mapping [500M]\n");
|
||||||
|
// fprintf(fp_help, " -v INT verbose level [%d]\n", mm_verbose);
|
||||||
|
fprintf(fp_help, " --version show version number\n");
|
||||||
|
fprintf(fp_help, " Preset:\n");
|
||||||
|
fprintf(fp_help, " -x STR preset (always applied before other options) []\n");
|
||||||
|
fprintf(fp_help, " map-pb: -Hk19 (PacBio vs reference mapping)\n");
|
||||||
|
fprintf(fp_help, " map-ont: -k15 (Oxford Nanopore vs reference mapping)\n");
|
||||||
|
fprintf(fp_help, " asm5: -k19 -w19 -A1 -B19 -O39,81 -E3,1 -s200 -z200 (asm to ref mapping; break at 5%% div.)\n");
|
||||||
|
fprintf(fp_help, " asm10: -k19 -w19 -A1 -B9 -O16,41 -E2,1 -s200 -z200 (asm to ref mapping; break at 10%% div.)\n");
|
||||||
|
fprintf(fp_help, " ava-pb: -Hk19 -w5 -Xp0 -m100 -g10000 --max-chain-skip 25 (PacBio read overlap)\n");
|
||||||
|
fprintf(fp_help, " ava-ont: -k15 -w5 -Xp0 -m100 -g10000 --max-chain-skip 25 (ONT read overlap)\n");
|
||||||
|
fprintf(fp_help, " splice: long-read spliced alignment (see minimap2.1 for details)\n");
|
||||||
|
fprintf(fp_help, " sr: short single-end reads without splicing (see minimap2.1 for details)\n");
|
||||||
|
fprintf(fp_help, "\nSee `man ./minimap2.1' for detailed description of command-line options.\n");
|
||||||
|
return fp_help == stdout? 0 : 1;
|
||||||
|
}
|
||||||
|
|
||||||
|
idx_rdr = mm_idx_reader_open(argv[optind], &ipt, fnw);
|
||||||
|
if (idx_rdr == 0) {
|
||||||
|
fprintf(stderr, "[ERROR] failed to open file '%s'\n", argv[optind]);
|
||||||
|
return 1;
|
||||||
|
}
|
||||||
|
if (!idx_rdr->is_idx && fnw == 0 && argc - optind < 2) {
|
||||||
|
fprintf(stderr, "[ERROR] missing input: please specify a query file to map or option -d to keep the index\n");
|
||||||
|
mm_idx_reader_close(idx_rdr);
|
||||||
|
return 1;
|
||||||
|
}
|
||||||
|
if (opt.best_n == 0 && (opt.flag&MM_F_CIGAR) && mm_verbose >= 2)
|
||||||
|
fprintf(stderr, "[WARNING]\033[1;31m `-N 0' reduces alignment accuracy. Please use --secondary=no to suppress secondary alignments.\033[0m\n");
|
||||||
|
while ((mi = mm_idx_reader_read(idx_rdr, n_threads)) != 0) {
|
||||||
|
if ((opt.flag & MM_F_CIGAR) && (mi->flag & MM_I_NO_SEQ)) {
|
||||||
|
fprintf(stderr, "[ERROR] the prebuilt index doesn't contain sequences.\n");
|
||||||
|
mm_idx_destroy(mi);
|
||||||
|
mm_idx_reader_close(idx_rdr);
|
||||||
|
return 1;
|
||||||
|
}
|
||||||
|
if ((opt.flag & MM_F_OUT_SAM) && idx_rdr->n_parts == 1) {
|
||||||
|
if (mm_idx_reader_eof(idx_rdr)) {
|
||||||
|
mm_write_sam_hdr(mi, rg, MM_VERSION, argc, argv);
|
||||||
} else {
|
} else {
|
||||||
fprintf(stderr, "[E::%s] unknown preset '%s'\n", __func__, optarg);
|
mm_write_sam_hdr(0, rg, MM_VERSION, argc, argv);
|
||||||
return 1;
|
if (mm_verbose >= 2)
|
||||||
|
fprintf(stderr, "[WARNING]\033[1;31m For a multi-part index, no @SQ lines will be outputted.\033[0m\n");
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
}
|
|
||||||
if (w < 0) w = (int)(.6666667 * k + .499);
|
|
||||||
|
|
||||||
if (argc == optind) {
|
|
||||||
fprintf(stderr, "Usage: minimap2 [options] <target.fa>|<target.idx> [query.fa] [...]\n");
|
|
||||||
fprintf(stderr, "Options:\n");
|
|
||||||
fprintf(stderr, " Indexing:\n");
|
|
||||||
fprintf(stderr, " -H use homopolymer-compressed k-mer\n");
|
|
||||||
fprintf(stderr, " -k INT k-mer size (no larger than 28) [%d]\n", k);
|
|
||||||
fprintf(stderr, " -w INT minizer window size [{-k}*2/3]\n");
|
|
||||||
fprintf(stderr, " -I NUM split index for every ~NUM input bases [4G]\n");
|
|
||||||
fprintf(stderr, " -d FILE dump index to FILE []\n");
|
|
||||||
fprintf(stderr, " Mapping:\n");
|
|
||||||
fprintf(stderr, " -f FLOAT filter out top FLOAT fraction of repetitive minimizers [%g]\n", opt.mid_occ_frac);
|
|
||||||
fprintf(stderr, " -g INT stop chain enlongation if there are no minimizers in INT-bp [%d]\n", opt.max_gap);
|
|
||||||
fprintf(stderr, " -r INT bandwidth used in chaining and DP-based alignment [%d]\n", opt.bw);
|
|
||||||
fprintf(stderr, " -n INT minimal number of minimizers on a chain [%d]\n", opt.min_cnt);
|
|
||||||
fprintf(stderr, " -m INT minimal chaining score (matching bases minus log gap penalty) [%d]\n", opt.min_chain_score);
|
|
||||||
// fprintf(stderr, " -T INT SDUST threshold; 0 to disable SDUST [%d]\n", opt.sdust_thres); // TODO: this option is never used; might be buggy
|
|
||||||
fprintf(stderr, " -X skip self and dual mappings (for the all-vs-all mode)\n");
|
|
||||||
fprintf(stderr, " -p FLOAT min secondary-to-primary score ratio [%g]\n", opt.pri_ratio);
|
|
||||||
fprintf(stderr, " -N INT retain at most INT secondary alignments [%d]\n", opt.best_n);
|
|
||||||
fprintf(stderr, " Alignment:\n");
|
|
||||||
fprintf(stderr, " -A INT matching score [%d]\n", opt.a);
|
|
||||||
fprintf(stderr, " -B INT mismatch penalty [%d]\n", opt.b);
|
|
||||||
fprintf(stderr, " -O INT[,INT] gap open penalty [%d,%d]\n", opt.q, opt.q2);
|
|
||||||
fprintf(stderr, " -E INT[,INT] gap extension penalty; a k-long gap costs min{O1+k*E1,O2+k*E2} [%d,%d]\n", opt.e, opt.e2);
|
|
||||||
fprintf(stderr, " -z INT Z-drop score [%d]\n", opt.zdrop);
|
|
||||||
fprintf(stderr, " -s INT minimal peak DP alignment score [%d]\n", opt.min_dp_max);
|
|
||||||
fprintf(stderr, " Input/Output:\n");
|
|
||||||
fprintf(stderr, " -Q ignore base quality in the input\n");
|
|
||||||
fprintf(stderr, " -a output in the SAM format (PAF by default)\n");
|
|
||||||
fprintf(stderr, " -c output CIGAR in PAF\n");
|
|
||||||
fprintf(stderr, " -t INT number of threads [%d]\n", n_threads);
|
|
||||||
fprintf(stderr, " -K NUM minibatch size [200M]\n");
|
|
||||||
// fprintf(stderr, " -v INT verbose level [%d]\n", mm_verbose);
|
|
||||||
fprintf(stderr, " -V show version number\n");
|
|
||||||
fprintf(stderr, " Preset:\n");
|
|
||||||
fprintf(stderr, " -x STR preset (recommended to be applied before other options) []\n");
|
|
||||||
fprintf(stderr, " map10k/map-pb: -Hk19 (PacBio/ONT vs reference mapping)\n");
|
|
||||||
fprintf(stderr, " map-ont: -k15 (slightly more sensitive than 'map10k' for ONT vs reference)\n");
|
|
||||||
fprintf(stderr, " asm5: -k19 -w19 -A1 -B19 -O39,81 -E3,1 -s200 -z200 (asm to ref mapping; break at 5%% div.)\n");
|
|
||||||
fprintf(stderr, " asm10: -k19 -w19 -A1 -B9 -O16,41 -E2,1 -s200 -z200 (asm to ref mapping; break at 10%% div.)\n");
|
|
||||||
fprintf(stderr, " ava-pb: -Hk19 -w5 -Xp0 -m100 -g10000 -K500m --max-chain-skip 25 (PacBio read overlap)\n");
|
|
||||||
fprintf(stderr, " ava-ont: -k15 -w5 -Xp0 -m100 -g10000 -K500m --max-chain-skip 25 (ONT read overlap)\n");
|
|
||||||
fprintf(stderr, "\nSee `man ./minimap2.1' for detailed description of command-line options.\n");
|
|
||||||
return 1;
|
|
||||||
}
|
|
||||||
|
|
||||||
is_idx = mm_idx_is_idx(argv[optind]);
|
|
||||||
if (is_idx < 0) {
|
|
||||||
fprintf(stderr, "[E::%s] failed to open file '%s'\n", __func__, argv[optind]);
|
|
||||||
return 1;
|
|
||||||
}
|
|
||||||
if (is_idx) fpr = fopen(argv[optind], "rb");
|
|
||||||
else fp = mm_bseq_open(argv[optind]);
|
|
||||||
if (fnw) fpw = fopen(fnw, "wb");
|
|
||||||
for (;;) {
|
|
||||||
mm_idx_t *mi = 0;
|
|
||||||
if (fpr) {
|
|
||||||
mi = mm_idx_load(fpr);
|
|
||||||
if (idx_par_set && mm_verbose >= 2 && (mi->k != k || mi->w != w || mi->is_hpc != mi->is_hpc))
|
|
||||||
fprintf(stderr, "[W::%s::%.3f*%.2f] Indexing parameters on the command line (-k/-w/-H) overridden by parameters in the prebuilt index.\n",
|
|
||||||
__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0));
|
|
||||||
} else if (!mm_bseq_eof(fp)) {
|
|
||||||
mi = mm_idx_gen(fp, w, k, bucket_bits, is_hpc, minibatch_size, n_threads, batch_size, keep_name);
|
|
||||||
}
|
|
||||||
if (mi == 0) break;
|
|
||||||
if (mm_verbose >= 3)
|
if (mm_verbose >= 3)
|
||||||
fprintf(stderr, "[M::%s::%.3f*%.2f] loaded/built the index for %d target sequence(s)\n",
|
fprintf(stderr, "[M::%s::%.3f*%.2f] loaded/built the index for %d target sequence(s)\n",
|
||||||
__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), mi->n_seq);
|
__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), mi->n_seq);
|
||||||
if (fpw) {
|
|
||||||
mm_idx_dump(fpw, mi);
|
|
||||||
if (mm_verbose >= 3)
|
|
||||||
fprintf(stderr, "[M::%s::%.3f*%.2f] dumpped the (partial) index to disk\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0));
|
|
||||||
}
|
|
||||||
if (argc != optind + 1) mm_mapopt_update(&opt, mi);
|
if (argc != optind + 1) mm_mapopt_update(&opt, mi);
|
||||||
if (mm_verbose >= 3) mm_idx_stat(mi);
|
if (mm_verbose >= 3) mm_idx_stat(mi);
|
||||||
|
if (!(opt.flag & MM_F_FRAG_MODE)) {
|
||||||
for (i = optind + 1; i < argc; ++i)
|
for (i = optind + 1; i < argc; ++i)
|
||||||
mm_map_file(mi, argv[i], &opt, n_threads, minibatch_size);
|
mm_map_file(mi, argv[i], &opt, n_threads);
|
||||||
|
} else {
|
||||||
|
mm_map_file_frag(mi, argc - (optind + 1), (const char**)&argv[optind + 1], &opt, n_threads);
|
||||||
|
}
|
||||||
mm_idx_destroy(mi);
|
mm_idx_destroy(mi);
|
||||||
}
|
}
|
||||||
if (fpw) fclose(fpw);
|
mm_idx_reader_close(idx_rdr);
|
||||||
if (fpr) fclose(fpr);
|
|
||||||
if (fp) mm_bseq_close(fp);
|
|
||||||
|
|
||||||
fprintf(stderr, "[M::%s] Version: %s\n", __func__, MM_VERSION);
|
fprintf(stderr, "[M::%s] Version: %s\n", __func__, MM_VERSION);
|
||||||
fprintf(stderr, "[M::%s] CMD:", __func__);
|
fprintf(stderr, "[M::%s] CMD:", __func__);
|
||||||
|
|||||||
@@ -7,18 +7,20 @@
|
|||||||
#include "sdust.h"
|
#include "sdust.h"
|
||||||
#include "mmpriv.h"
|
#include "mmpriv.h"
|
||||||
#include "bseq.h"
|
#include "bseq.h"
|
||||||
|
#include "khash.h"
|
||||||
|
|
||||||
void mm_mapopt_init(mm_mapopt_t *opt)
|
void mm_mapopt_init(mm_mapopt_t *opt)
|
||||||
{
|
{
|
||||||
memset(opt, 0, sizeof(mm_mapopt_t));
|
memset(opt, 0, sizeof(mm_mapopt_t));
|
||||||
opt->max_occ_frac = 1e-5f;
|
opt->seed = 11;
|
||||||
opt->mid_occ_frac = 2e-4f;
|
opt->mid_occ_frac = 2e-4f;
|
||||||
opt->sdust_thres = 0;
|
opt->sdust_thres = 0; // no SDUST masking
|
||||||
|
|
||||||
opt->min_cnt = 3;
|
opt->min_cnt = 3;
|
||||||
opt->min_chain_score = 40;
|
opt->min_chain_score = 40;
|
||||||
opt->bw = 500;
|
opt->bw = 500;
|
||||||
opt->max_gap = 5000;
|
opt->max_gap = 5000;
|
||||||
|
opt->max_gap_ref = -1;
|
||||||
opt->max_chain_skip = 25;
|
opt->max_chain_skip = 25;
|
||||||
|
|
||||||
opt->mask_level = 0.5f;
|
opt->mask_level = 0.5f;
|
||||||
@@ -31,31 +33,111 @@ void mm_mapopt_init(mm_mapopt_t *opt)
|
|||||||
|
|
||||||
opt->a = 2, opt->b = 4, opt->q = 4, opt->e = 2, opt->q2 = 24, opt->e2 = 1;
|
opt->a = 2, opt->b = 4, opt->q = 4, opt->e = 2, opt->q2 = 24, opt->e2 = 1;
|
||||||
opt->zdrop = 400;
|
opt->zdrop = 400;
|
||||||
opt->min_dp_max = opt->min_chain_score;
|
opt->end_bonus = -1;
|
||||||
|
opt->min_dp_max = opt->min_chain_score * opt->a;
|
||||||
opt->min_ksw_len = 200;
|
opt->min_ksw_len = 200;
|
||||||
|
opt->anchor_ext_len = 20, opt->anchor_ext_shift = 6;
|
||||||
|
opt->mini_batch_size = 500000000;
|
||||||
|
|
||||||
|
opt->pe_ori = 0; // FF
|
||||||
|
opt->pe_bonus = 33;
|
||||||
}
|
}
|
||||||
|
|
||||||
void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
|
void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
|
||||||
{
|
{
|
||||||
opt->max_occ = mm_idx_cal_max_occ(mi, opt->max_occ_frac);
|
if ((opt->flag & MM_F_SPLICE_FOR) && (opt->flag & MM_F_SPLICE_REV))
|
||||||
|
opt->flag |= MM_F_SPLICE;
|
||||||
|
if (opt->mid_occ <= 0)
|
||||||
opt->mid_occ = mm_idx_cal_max_occ(mi, opt->mid_occ_frac);
|
opt->mid_occ = mm_idx_cal_max_occ(mi, opt->mid_occ_frac);
|
||||||
if (mm_verbose >= 3)
|
if (mm_verbose >= 3)
|
||||||
fprintf(stderr, "[M::%s::%.3f*%.2f] mid_occ = %d; max_occ = %d\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0),
|
fprintf(stderr, "[M::%s::%.3f*%.2f] mid_occ = %d\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), opt->mid_occ);
|
||||||
opt->mid_occ, opt->max_occ);
|
}
|
||||||
|
|
||||||
|
void mm_mapopt_max_intron_len(mm_mapopt_t *opt, int max_intron_len)
|
||||||
|
{
|
||||||
|
if ((opt->flag & MM_F_SPLICE) && max_intron_len > 0)
|
||||||
|
opt->max_gap_ref = opt->bw = max_intron_len;
|
||||||
|
}
|
||||||
|
|
||||||
|
int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
|
||||||
|
{
|
||||||
|
if (preset == 0) {
|
||||||
|
mm_idxopt_init(io);
|
||||||
|
mm_mapopt_init(mo);
|
||||||
|
} else if (strcmp(preset, "ava-ont") == 0) {
|
||||||
|
io->flag = 0, io->k = 15, io->w = 5;
|
||||||
|
mo->flag |= MM_F_AVA | MM_F_NO_SELF;
|
||||||
|
mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_gap = 10000, mo->max_chain_skip = 25;
|
||||||
|
} else if (strcmp(preset, "ava-pb") == 0) {
|
||||||
|
io->flag |= MM_I_HPC, io->k = 19, io->w = 5;
|
||||||
|
mo->flag |= MM_F_AVA | MM_F_NO_SELF;
|
||||||
|
mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_gap = 10000, mo->max_chain_skip = 25;
|
||||||
|
} else if (strcmp(preset, "map10k") == 0 || strcmp(preset, "map-pb") == 0) {
|
||||||
|
io->flag |= MM_I_HPC, io->k = 19;
|
||||||
|
} else if (strcmp(preset, "map-ont") == 0) {
|
||||||
|
io->flag = 0, io->k = 15;
|
||||||
|
} else if (strcmp(preset, "asm5") == 0) {
|
||||||
|
io->flag = 0, io->k = 19, io->w = 19;
|
||||||
|
mo->a = 1, mo->b = 19, mo->q = 39, mo->q2 = 81, mo->e = 3, mo->e2 = 1, mo->zdrop = 200;
|
||||||
|
mo->min_dp_max = 200;
|
||||||
|
mo->best_n = 50;
|
||||||
|
} else if (strcmp(preset, "asm10") == 0) {
|
||||||
|
io->flag = 0, io->k = 19, io->w = 19;
|
||||||
|
mo->a = 1, mo->b = 9, mo->q = 16, mo->q2 = 41, mo->e = 2, mo->e2 = 1, mo->zdrop = 200;
|
||||||
|
mo->min_dp_max = 200;
|
||||||
|
mo->best_n = 50;
|
||||||
|
} else if (strcmp(preset, "short") == 0 || strcmp(preset, "sr") == 0) {
|
||||||
|
io->flag = 0, io->k = 21, io->w = 11;
|
||||||
|
mo->flag |= MM_F_SR | MM_F_FRAG_MODE | MM_F_NO_PRINT_2ND | MM_F_2_IO_THREADS;
|
||||||
|
mo->pe_ori = 0<<1|1; // FR
|
||||||
|
mo->a = 2, mo->b = 8, mo->q = 12, mo->e = 2, mo->q2 = 24, mo->e2 = 1;
|
||||||
|
mo->zdrop = 100;
|
||||||
|
mo->end_bonus = 10;
|
||||||
|
mo->max_frag_len = 800;
|
||||||
|
mo->max_gap = 100;
|
||||||
|
mo->bw = 100;
|
||||||
|
mo->pri_ratio = 0.5f;
|
||||||
|
mo->min_cnt = 2;
|
||||||
|
mo->min_chain_score = 25;
|
||||||
|
mo->min_dp_max = 40;
|
||||||
|
mo->best_n = 20;
|
||||||
|
mo->mid_occ = 1000;
|
||||||
|
mo->max_occ = 5000;
|
||||||
|
mo->mini_batch_size = 50000000;
|
||||||
|
} else if (strcmp(preset, "splice") == 0 || strcmp(preset, "cdna") == 0) {
|
||||||
|
io->flag = 0, io->k = 15, io->w = 5;
|
||||||
|
mo->flag |= MM_F_SPLICE | MM_F_SPLICE_FOR | MM_F_SPLICE_REV | MM_F_SPLICE_FLANK;
|
||||||
|
mo->max_gap = 2000, mo->max_gap_ref = mo->bw = 200000;
|
||||||
|
mo->a = 1, mo->b = 2, mo->q = 2, mo->e = 1, mo->q2 = 32, mo->e2 = 0;
|
||||||
|
mo->noncan = 9;
|
||||||
|
mo->zdrop = 200;
|
||||||
|
} else return -1;
|
||||||
|
return 0;
|
||||||
|
}
|
||||||
|
|
||||||
|
int mm_check_opt(const mm_idxopt_t *io, const mm_mapopt_t *mo)
|
||||||
|
{
|
||||||
|
if ((mo->q != mo->q2 || mo->e != mo->e2) && !(mo->e > mo->e2 && mo->q + mo->e < mo->q2 + mo->e2)) {
|
||||||
|
if (mm_verbose >= 1)
|
||||||
|
fprintf(stderr, "[ERROR]\033[1;31m dual gap penalties violating E1>E2 and O1+E1<O2+E2\033[0m\n");
|
||||||
|
return -2;
|
||||||
|
}
|
||||||
|
if ((mo->q + mo->e) + (mo->q2 + mo->e2) > 127) {
|
||||||
|
if (mm_verbose >= 1)
|
||||||
|
fprintf(stderr, "[ERROR]\033[1;31m scoring system violating ({-O}+{-E})+({-O2}+{-E2}) <= 127\033[0m\n");
|
||||||
|
return -1;
|
||||||
|
}
|
||||||
|
return 0;
|
||||||
}
|
}
|
||||||
|
|
||||||
typedef struct {
|
typedef struct {
|
||||||
uint32_t n:31, is_alloc:1;
|
uint32_t n;
|
||||||
uint32_t qpos;
|
uint32_t qpos;
|
||||||
union {
|
uint32_t seg_id;
|
||||||
const uint64_t *cr;
|
const uint64_t *cr;
|
||||||
uint64_t *r;
|
|
||||||
} x;
|
|
||||||
} mm_match_t;
|
} mm_match_t;
|
||||||
|
|
||||||
struct mm_tbuf_s {
|
struct mm_tbuf_s {
|
||||||
sdust_buf_t *sdb;
|
|
||||||
mm128_v mini;
|
|
||||||
void *km;
|
void *km;
|
||||||
};
|
};
|
||||||
|
|
||||||
@@ -64,27 +146,26 @@ mm_tbuf_t *mm_tbuf_init(void)
|
|||||||
mm_tbuf_t *b;
|
mm_tbuf_t *b;
|
||||||
b = (mm_tbuf_t*)calloc(1, sizeof(mm_tbuf_t));
|
b = (mm_tbuf_t*)calloc(1, sizeof(mm_tbuf_t));
|
||||||
if (!(mm_dbg_flag & 1)) b->km = km_init();
|
if (!(mm_dbg_flag & 1)) b->km = km_init();
|
||||||
b->sdb = sdust_buf_init(b->km);
|
|
||||||
return b;
|
return b;
|
||||||
}
|
}
|
||||||
|
|
||||||
void mm_tbuf_destroy(mm_tbuf_t *b)
|
void mm_tbuf_destroy(mm_tbuf_t *b)
|
||||||
{
|
{
|
||||||
if (b == 0) return;
|
if (b == 0) return;
|
||||||
kfree(b->km, b->mini.a);
|
|
||||||
sdust_buf_destroy(b->sdb);
|
|
||||||
km_destroy(b->km);
|
km_destroy(b->km);
|
||||||
free(b);
|
free(b);
|
||||||
}
|
}
|
||||||
|
|
||||||
static void mm_dust_minier(mm128_v *mini, int l_seq, const char *seq, int sdust_thres, sdust_buf_t *sdb)
|
static int mm_dust_minier(void *km, int n, mm128_t *a, int l_seq, const char *seq, int sdust_thres)
|
||||||
{
|
{
|
||||||
int n_dreg, j, k, u = 0;
|
int n_dreg, j, k, u = 0;
|
||||||
const uint64_t *dreg;
|
const uint64_t *dreg;
|
||||||
if (sdust_thres <= 0 || sdb == 0) return;
|
sdust_buf_t *sdb;
|
||||||
|
if (sdust_thres <= 0) return n;
|
||||||
|
sdb = sdust_buf_init(km);
|
||||||
dreg = sdust_core((const uint8_t*)seq, l_seq, sdust_thres, 64, &n_dreg, sdb);
|
dreg = sdust_core((const uint8_t*)seq, l_seq, sdust_thres, 64, &n_dreg, sdb);
|
||||||
for (j = k = 0; j < mini->n; ++j) { // squeeze out minimizers that significantly overlap with LCRs
|
for (j = k = 0; j < n; ++j) { // squeeze out minimizers that significantly overlap with LCRs
|
||||||
int32_t qpos = (uint32_t)mini->a[j].y>>1, span = mini->a[j].x&0xff;
|
int32_t qpos = (uint32_t)a[j].y>>1, span = a[j].x&0xff;
|
||||||
int32_t s = qpos - (span - 1), e = s + span;
|
int32_t s = qpos - (span - 1), e = s + span;
|
||||||
while (u < n_dreg && (uint32_t)dreg[u] <= s) ++u;
|
while (u < n_dreg && (uint32_t)dreg[u] <= s) ++u;
|
||||||
if (u < n_dreg && dreg[u]>>32 < e) {
|
if (u < n_dreg && dreg[u]>>32 < e) {
|
||||||
@@ -94,183 +175,235 @@ static void mm_dust_minier(mm128_v *mini, int l_seq, const char *seq, int sdust_
|
|||||||
int ee = e < (uint32_t)dreg[v]? e : (uint32_t)dreg[v];
|
int ee = e < (uint32_t)dreg[v]? e : (uint32_t)dreg[v];
|
||||||
l += ee - ss;
|
l += ee - ss;
|
||||||
}
|
}
|
||||||
if (l <= span>>1) mini->a[k++] = mini->a[j]; // keep the minimizer if less than half of it falls in masked region
|
if (l <= span>>1) a[k++] = a[j]; // keep the minimizer if less than half of it falls in masked region
|
||||||
|
} else a[k++] = a[j];
|
||||||
}
|
}
|
||||||
}
|
sdust_buf_destroy(sdb);
|
||||||
mini->n = k;
|
return k; // the new size
|
||||||
}
|
|
||||||
#if 0
|
|
||||||
int mm_pair_thin_core(mm_tbuf_t *b, uint64_t x, int radius, int rel, int st0, int n, const uint64_t *z, uint64_v *a)
|
|
||||||
{
|
|
||||||
int i, st = st0, en = n, mid = en - 1;
|
|
||||||
while (st < en) {
|
|
||||||
uint64_t y;
|
|
||||||
mid = st + ((en - st) >> 1);
|
|
||||||
y = z[mid];
|
|
||||||
if (y < x && (x - y)>>1 > radius) st = mid + 1;
|
|
||||||
else if (y >= x && (y - x)>>1 > radius) en = mid;
|
|
||||||
else break;
|
|
||||||
}
|
|
||||||
if (st < en) {
|
|
||||||
for (en = mid + 1; en < n; ++en)
|
|
||||||
if (z[en] > x && (z[en] - x)>>1 > radius)
|
|
||||||
break;
|
|
||||||
for (st = mid - 1; st >= st0; --st)
|
|
||||||
if (z[st] < x && (x - z[st])>>1 > radius)
|
|
||||||
break;
|
|
||||||
++st;
|
|
||||||
for (i = st; i < en; ++i) {
|
|
||||||
uint64_t y = z[i];
|
|
||||||
if (((x ^ y) & 1) == rel) {
|
|
||||||
// printf("* %d,%d\n", (uint32_t)x>>1, (uint32_t)y>>1);
|
|
||||||
kv_push(uint64_t, b->km, *a, y);
|
|
||||||
}
|
|
||||||
}
|
|
||||||
return en;
|
|
||||||
} else return st < n && z[st] < x? st + 1 : en;
|
|
||||||
}
|
}
|
||||||
|
|
||||||
void mm_pair_thin(mm_tbuf_t *b, int radius, mm_match_t *m1, mm_match_t *m2)
|
static void collect_minimizers(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, mm128_v *mv)
|
||||||
{
|
{
|
||||||
mm_match_t *m[2];
|
int i, j, n, sum = 0;
|
||||||
const uint64_t *z[2];
|
mv->n = 0;
|
||||||
uint64_v a[2];
|
for (i = n = 0; i < n_segs; ++i) {
|
||||||
int i, n[2], k[2], u = 0, rel = (m1->qpos ^ m2->qpos) & 1;
|
mm_sketch(km, seqs[i], qlens[i], mi->w, mi->k, i, mi->flag&MM_I_HPC, mv);
|
||||||
|
for (j = n; j < mv->n; ++j)
|
||||||
|
mv->a[j].y += sum << 1;
|
||||||
|
if (opt->sdust_thres > 0) // mask low-complexity minimizers
|
||||||
|
mv->n = n + mm_dust_minier(km, mv->n - n, mv->a + n, qlens[i], seqs[i], opt->sdust_thres);
|
||||||
|
sum += qlens[i], n = mv->n;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
m[0] = m1, m[1] = m2;
|
static mm128_t *collect_seed_hits(void *km, const mm_mapopt_t *opt, int max_occ, const mm_idx_t *mi, const char *qname, const mm128_v *mv, int qlen, int64_t *n_a, int *rep_len,
|
||||||
for (i = 0; i < 2; ++i) {
|
int *n_mini_pos, uint64_t **mini_pos)
|
||||||
n[i] = m[i]->n;
|
|
||||||
z[i] = m[i]->x.cr;
|
|
||||||
k[i] = 0;
|
|
||||||
kv_init(a[i]);
|
|
||||||
kv_resize(uint64_t, b->km, a[i], 256);
|
|
||||||
}
|
|
||||||
while (k[0] < n[0] && k[1] < n[1]) {
|
|
||||||
//printf("%d; %d,%d\n", u, k[0], k[1]);
|
|
||||||
int v = u^1, dist = (int)(m[v]->qpos>>1) - (int)(m[u]->qpos>>1);
|
|
||||||
uint64_t x = z[u][k[u]];
|
|
||||||
int uori = (x ^ m[u]->qpos) & 1, last;
|
|
||||||
int64_t tpos = x>>1 & 0x7fffffff;
|
|
||||||
tpos = uori == 0? tpos + dist : tpos - dist;
|
|
||||||
if (tpos < 0) tpos = 0;
|
|
||||||
x = x>>32<<32 | tpos<<1 | (x&1);
|
|
||||||
last = a[v].n;
|
|
||||||
k[v] = mm_pair_thin_core(b, x, radius, rel, k[v], n[v], z[v], &a[v]);
|
|
||||||
if (a[v].n > last) kv_push(uint64_t, b->km, a[u], z[u][k[u]]);
|
|
||||||
++k[u];
|
|
||||||
u ^= 1;
|
|
||||||
}
|
|
||||||
for (i = 0; i < 2; ++i)
|
|
||||||
m[i]->n = a[i].n, m[i]->x.r = a[i].a, m[i]->is_alloc = 1;
|
|
||||||
// printf("%d,%d; %d,%d\n", m[0]->qpos>>1, m[1]->qpos>>1, m[0]->n, m[1]->n);
|
|
||||||
}
|
|
||||||
#endif
|
|
||||||
mm_reg1_t *mm_map_frag(const mm_mapopt_t *opt, const mm_idx_t *mi, mm_tbuf_t *b, uint32_t m_st, uint32_t m_en, const char *qname, int qlen, const char *seq, int *n_regs)
|
|
||||||
{
|
{
|
||||||
int i, n = m_en - m_st, j, n_u;
|
int rep_st = 0, rep_en = 0, i;
|
||||||
int64_t n_a;
|
|
||||||
uint64_t *u;
|
|
||||||
mm_match_t *m;
|
mm_match_t *m;
|
||||||
mm128_t *a;
|
mm128_t *a;
|
||||||
mm_reg1_t *regs;
|
|
||||||
|
|
||||||
// convert to local representation
|
*n_mini_pos = 0;
|
||||||
m = (mm_match_t*)kmalloc(b->km, n * sizeof(mm_match_t));
|
*mini_pos = (uint64_t*)kmalloc(km, mv->n * sizeof(uint64_t));
|
||||||
for (i = 0; i < n; ++i) {
|
m = (mm_match_t*)kmalloc(km, mv->n * sizeof(mm_match_t));
|
||||||
|
for (i = 0; i < mv->n; ++i) {
|
||||||
int t;
|
int t;
|
||||||
mm128_t *p = &b->mini.a[i + m_st];
|
mm128_t *p = &mv->a[i];
|
||||||
m[i].is_alloc = 0;
|
|
||||||
m[i].qpos = (uint32_t)p->y;
|
m[i].qpos = (uint32_t)p->y;
|
||||||
m[i].x.cr = mm_idx_get(mi, p->x>>8, &t);
|
m[i].cr = mm_idx_get(mi, p->x>>8, &t);
|
||||||
m[i].n = t;
|
m[i].n = t;
|
||||||
|
m[i].seg_id = p->y >> 32;
|
||||||
}
|
}
|
||||||
#if 0
|
for (i = 0, *n_a = 0; i < mv->n; ++i) // find the length of a[]
|
||||||
int last = -1, last2 = -1;
|
if (m[i].n < max_occ) *n_a += m[i].n;
|
||||||
// pair k-mer thinning
|
a = (mm128_t*)kmalloc(km, *n_a * sizeof(mm128_t));
|
||||||
for (i = 0; i < n; ++i) {
|
for (i = *rep_len = 0, *n_a = 0; i < mv->n; ++i) {
|
||||||
if (m[i].n >= opt->mid_occ && m[i].n < opt->max_occ) {
|
mm128_t *p = &mv->a[i];
|
||||||
if (last2 < 0) last2 = i;
|
|
||||||
if (last < 0 || m[last].n < m[i].n) last = i;
|
|
||||||
if (last >= 0 && (m[last].qpos>>1) + (m[last].span>>1) <= m[i].qpos>>1) {
|
|
||||||
mm_pair_thin(b, opt->bw, &m[last], &m[i]);
|
|
||||||
last2 = last = -1;
|
|
||||||
} else if (last2 >= 0 && (m[last2].qpos>>1) + (m[last2].span>>1) <= m[i].qpos>>1) {
|
|
||||||
mm_pair_thin(b, opt->bw, &m[last2], &m[i]);
|
|
||||||
last2 = last = -1;
|
|
||||||
}
|
|
||||||
}
|
|
||||||
}
|
|
||||||
#endif
|
|
||||||
// fill the _a_ array
|
|
||||||
for (i = 0, n_a = 0; i < n; ++i) // find the length of a[]
|
|
||||||
if (m[i].n < opt->mid_occ) n_a += m[i].n;
|
|
||||||
a = (mm128_t*)kmalloc(b->km, n_a * sizeof(mm128_t));
|
|
||||||
for (i = j = 0; i < n; ++i) {
|
|
||||||
mm128_t *p = &b->mini.a[i + m_st];
|
|
||||||
mm_match_t *q = &m[i];
|
mm_match_t *q = &m[i];
|
||||||
const uint64_t *r = q->x.cr;
|
const uint64_t *r = q->cr;
|
||||||
int k, q_span = p->x & 0xff;
|
int k, q_span = p->x & 0xff, is_tandem = 0;
|
||||||
if (q->n >= opt->mid_occ) continue;
|
if (q->n >= max_occ) {
|
||||||
|
int en = (q->qpos>>1) + 1, st = en - q_span;
|
||||||
|
if (st > rep_en) {
|
||||||
|
*rep_len += rep_en - rep_st;
|
||||||
|
rep_st = st, rep_en = en;
|
||||||
|
} else rep_en = en;
|
||||||
|
continue;
|
||||||
|
}
|
||||||
|
(*mini_pos)[(*n_mini_pos)++] = (uint64_t)q_span<<32 | q->qpos>>1;
|
||||||
|
if (i > 0 && p->x>>8 == mv->a[i - 1].x>>8) is_tandem = 1;
|
||||||
|
if (i < mv->n - 1 && p->x>>8 == mv->a[i + 1].x>>8) is_tandem = 1;
|
||||||
for (k = 0; k < q->n; ++k) {
|
for (k = 0; k < q->n; ++k) {
|
||||||
const char *tname = mi->seq[r[k]>>32].name;
|
|
||||||
int32_t rpos = (uint32_t)r[k] >> 1;
|
int32_t rpos = (uint32_t)r[k] >> 1;
|
||||||
mm128_t *p;
|
mm128_t *p;
|
||||||
if (qname && (opt->flag&MM_F_NO_SELF) && strcmp(qname, tname) == 0 && rpos == (q->qpos>>1)) // avoid the diagonal
|
if (qname && (opt->flag&(MM_F_NO_SELF|MM_F_AVA))) {
|
||||||
|
const char *tname = mi->seq[r[k]>>32].name;
|
||||||
|
int cmp;
|
||||||
|
cmp = strcmp(qname, tname);
|
||||||
|
if ((opt->flag&MM_F_NO_SELF) && cmp == 0 && rpos == (q->qpos>>1)) // avoid the diagonal
|
||||||
continue;
|
continue;
|
||||||
if (qname && (opt->flag&MM_F_AVA) && strcmp(qname, tname) > 0) // all-vs-all mode: map once
|
if ((opt->flag&MM_F_AVA) && cmp > 0) // all-vs-all mode: map once
|
||||||
continue;
|
continue;
|
||||||
p = &a[j++];
|
}
|
||||||
|
p = &a[(*n_a)++];
|
||||||
if ((r[k]&1) == (q->qpos&1)) { // forward strand
|
if ((r[k]&1) == (q->qpos&1)) { // forward strand
|
||||||
p->x = (r[k]&0xffffffff00000000ULL) | (uint32_t)r[k]>>1;
|
p->x = (r[k]&0xffffffff00000000ULL) | rpos;
|
||||||
p->y = (uint64_t)q_span << 32 | q->qpos >> 1;
|
p->y = (uint64_t)q_span << 32 | q->qpos >> 1;
|
||||||
} else { // reverse strand
|
} else { // reverse strand
|
||||||
p->x = 1ULL<<63 | (r[k]&0xffffffff00000000ULL) | (uint32_t)r[k]>>1;
|
p->x = 1ULL<<63 | (r[k]&0xffffffff00000000ULL) | rpos;
|
||||||
p->y = (uint64_t)q_span << 32 | (qlen - ((q->qpos>>1) + 1 - q_span) - 1);
|
p->y = (uint64_t)q_span << 32 | (qlen - ((q->qpos>>1) + 1 - q_span) - 1);
|
||||||
}
|
}
|
||||||
|
p->y |= (uint64_t)q->seg_id << MM_SEED_SEG_SHIFT;
|
||||||
|
if (is_tandem) p->y |= MM_SEED_TANDEM;
|
||||||
}
|
}
|
||||||
}
|
}
|
||||||
n_a = j;
|
*rep_len += rep_en - rep_st;
|
||||||
radix_sort_128x(a, a + n_a);
|
kfree(km, m);
|
||||||
for (i = 0; i < n; ++i)
|
return a;
|
||||||
if (m[i].is_alloc) kfree(b->km, m[i].x.r);
|
}
|
||||||
kfree(b->km, m);
|
|
||||||
|
|
||||||
if (mm_dbg_flag & MM_DBG_PRINT_SEED)
|
static void chain_post(const mm_mapopt_t *opt, int max_chain_gap_ref, const mm_idx_t *mi, void *km, int qlen, int n_segs, const int *qlens, int *n_regs, mm_reg1_t *regs, mm128_t *a)
|
||||||
for (i = 0; i < n_a; ++i)
|
{
|
||||||
fprintf(stderr, "SD\t%s\t%d\t%c\t%d\t%d\n", mi->seq[a[i].x<<1>>33].name, (int32_t)a[i].x, "+-"[a[i].x>>63], (int32_t)a[i].y, (int32_t)(a[i].y>>32&0xff));
|
|
||||||
|
|
||||||
n_u = mm_chain_dp(opt->max_gap, opt->bw, opt->max_chain_skip, opt->min_cnt, opt->min_chain_score, n_a, a, &u, b->km);
|
|
||||||
regs = mm_gen_regs(b->km, qlen, n_u, u, a);
|
|
||||||
*n_regs = n_u;
|
|
||||||
if (!(opt->flag & MM_F_AVA)) { // don't choose primary mapping(s) for read overlap
|
if (!(opt->flag & MM_F_AVA)) { // don't choose primary mapping(s) for read overlap
|
||||||
mm_set_parent(b->km, opt->mask_level, *n_regs, regs);
|
mm_set_parent(km, opt->mask_level, *n_regs, regs, opt->a * 2 + opt->b);
|
||||||
mm_select_sub(b->km, opt->mask_level, opt->pri_ratio, opt->best_n, n_regs, regs);
|
if (n_segs <= 1) mm_select_sub(km, opt->pri_ratio, mi->k*2, opt->best_n, n_regs, regs);
|
||||||
mm_join_long(b->km, opt, qlen, n_regs, regs, a); // TODO: this can be applied to all-vs-all in principle
|
else mm_select_sub_multi(km, opt->pri_ratio, 0.2f, 0.7f, max_chain_gap_ref, mi->k*2, opt->best_n, n_segs, qlens, n_regs, regs);
|
||||||
|
if (!(opt->flag & MM_F_SPLICE) && !(opt->flag & MM_F_SR) && !(opt->flag & MM_F_NO_LJOIN))
|
||||||
|
mm_join_long(km, opt, qlen, n_regs, regs, a);
|
||||||
}
|
}
|
||||||
if (opt->flag & MM_F_CIGAR) {
|
}
|
||||||
regs = mm_align_skeleton(b->km, opt, mi, qlen, seq, n_regs, regs, a); // this calls mm_filter_regs()
|
|
||||||
|
static mm_reg1_t *align_regs(const mm_mapopt_t *opt, const mm_idx_t *mi, void *km, int qlen, const char *seq, const char *qual, int *n_regs, mm_reg1_t *regs, mm128_t *a)
|
||||||
|
{
|
||||||
|
if (!(opt->flag & MM_F_CIGAR)) return regs;
|
||||||
|
regs = mm_align_skeleton(km, opt, mi, qlen, seq, n_regs, regs, a); // this calls mm_filter_regs()
|
||||||
if (!(opt->flag & MM_F_AVA)) {
|
if (!(opt->flag & MM_F_AVA)) {
|
||||||
mm_set_parent(b->km, opt->mask_level, *n_regs, regs);
|
mm_set_parent(km, opt->mask_level, *n_regs, regs, opt->a * 2 + opt->b);
|
||||||
mm_select_sub(b->km, opt->mask_level, opt->pri_ratio, opt->best_n, n_regs, regs);
|
mm_select_sub(km, opt->pri_ratio, mi->k*2, opt->best_n, n_regs, regs);
|
||||||
mm_set_sam_pri(*n_regs, regs);
|
mm_set_sam_pri(*n_regs, regs);
|
||||||
}
|
}
|
||||||
}
|
|
||||||
mm_set_mapq(*n_regs, regs);
|
|
||||||
|
|
||||||
// free
|
|
||||||
kfree(b->km, a);
|
|
||||||
kfree(b->km, u);
|
|
||||||
return regs;
|
return regs;
|
||||||
}
|
}
|
||||||
|
|
||||||
mm_reg1_t *mm_map(const mm_idx_t *mi, int l_seq, const char *seq, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname)
|
void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, const char **quals, int *n_regs, mm_reg1_t **regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname)
|
||||||
|
{
|
||||||
|
int i, j, rep_len, qlen_sum, n_regs0, n_mini_pos;
|
||||||
|
int max_chain_gap_qry, max_chain_gap_ref, is_splice = !!(opt->flag & MM_F_SPLICE), is_sr = !!(opt->flag & MM_F_SR);
|
||||||
|
uint32_t hash;
|
||||||
|
int64_t n_a;
|
||||||
|
uint64_t *u, *mini_pos;
|
||||||
|
mm128_t *a;
|
||||||
|
mm128_v mv = {0,0,0};
|
||||||
|
mm_reg1_t *regs0;
|
||||||
|
km_stat_t kmst;
|
||||||
|
|
||||||
|
for (i = 0, qlen_sum = 0; i < n_segs; ++i)
|
||||||
|
qlen_sum += qlens[i], n_regs[i] = 0, regs[i] = 0;
|
||||||
|
|
||||||
|
if (qlen_sum == 0 || n_segs <= 0 || n_segs > MM_MAX_SEG) return;
|
||||||
|
|
||||||
|
hash = qname? __ac_X31_hash_string(qname) : 0;
|
||||||
|
hash ^= __ac_Wang_hash(qlen_sum) + __ac_Wang_hash(opt->seed);
|
||||||
|
hash = __ac_Wang_hash(hash);
|
||||||
|
|
||||||
|
collect_minimizers(b->km, opt, mi, n_segs, qlens, seqs, &mv);
|
||||||
|
a = collect_seed_hits(b->km, opt, opt->mid_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
|
||||||
|
radix_sort_128x(a, a + n_a);
|
||||||
|
|
||||||
|
if (mm_dbg_flag & MM_DBG_PRINT_SEED) {
|
||||||
|
fprintf(stderr, "RS\t%d\n", rep_len);
|
||||||
|
for (i = 0; i < n_a; ++i)
|
||||||
|
fprintf(stderr, "SD\t%s\t%d\t%c\t%d\t%d\t%d\n", mi->seq[a[i].x<<1>>33].name, (int32_t)a[i].x, "+-"[a[i].x>>63], (int32_t)a[i].y, (int32_t)(a[i].y>>32&0xff),
|
||||||
|
i == 0? 0 : ((int32_t)a[i].y - (int32_t)a[i-1].y) - ((int32_t)a[i].x - (int32_t)a[i-1].x));
|
||||||
|
}
|
||||||
|
|
||||||
|
// set max chaining gap on the query and the reference sequence
|
||||||
|
if (is_sr)
|
||||||
|
max_chain_gap_qry = qlen_sum > opt->max_gap? qlen_sum : opt->max_gap;
|
||||||
|
else max_chain_gap_qry = opt->max_gap;
|
||||||
|
if (opt->max_gap_ref > 0) {
|
||||||
|
max_chain_gap_ref = opt->max_gap_ref; // always honor mm_mapopt_t::max_gap_ref if set
|
||||||
|
} else if (opt->max_frag_len > 0) {
|
||||||
|
max_chain_gap_ref = opt->max_frag_len - qlen_sum;
|
||||||
|
if (max_chain_gap_ref < opt->max_gap) max_chain_gap_ref = opt->max_gap;
|
||||||
|
} else max_chain_gap_ref = opt->max_gap;
|
||||||
|
|
||||||
|
a = mm_chain_dp(max_chain_gap_ref, max_chain_gap_qry, opt->bw, opt->max_chain_skip, opt->min_cnt, opt->min_chain_score, is_splice, n_segs, n_a, a, &n_regs0, &u, b->km);
|
||||||
|
|
||||||
|
if (opt->max_occ > opt->mid_occ && rep_len > 0) {
|
||||||
|
int rechain = 0;
|
||||||
|
if (n_regs0 > 0) { // test if the best chain has all the segments
|
||||||
|
int n_chained_segs = 1, max = 0, max_i = -1, max_off = -1, off = 0;
|
||||||
|
for (i = 0; i < n_regs0; ++i) { // find the best chain
|
||||||
|
if (max < u[i]>>32) max = u[i]>>32, max_i = i, max_off = off;
|
||||||
|
off += (uint32_t)u[i];
|
||||||
|
}
|
||||||
|
for (i = 1; i < (uint32_t)u[max_i]; ++i) // count the number of segments in the best chain
|
||||||
|
if ((a[max_off+i].y&MM_SEED_SEG_MASK) != (a[max_off+i-1].y&MM_SEED_SEG_MASK))
|
||||||
|
++n_chained_segs;
|
||||||
|
if (n_chained_segs < n_segs)
|
||||||
|
rechain = 1;
|
||||||
|
} else rechain = 1;
|
||||||
|
if (rechain) { // redo chaining with a higher max_occ threshold
|
||||||
|
kfree(b->km, a);
|
||||||
|
kfree(b->km, u);
|
||||||
|
kfree(b->km, mini_pos);
|
||||||
|
a = collect_seed_hits(b->km, opt, opt->max_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
|
||||||
|
radix_sort_128x(a, a + n_a);
|
||||||
|
a = mm_chain_dp(max_chain_gap_ref, max_chain_gap_qry, opt->bw, opt->max_chain_skip, opt->min_cnt, opt->min_chain_score, is_splice, n_segs, n_a, a, &n_regs0, &u, b->km);
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
regs0 = mm_gen_regs(b->km, hash, qlen_sum, n_regs0, u, a);
|
||||||
|
|
||||||
|
if (mm_dbg_flag & MM_DBG_PRINT_SEED)
|
||||||
|
for (j = 0; j < n_regs0; ++j)
|
||||||
|
for (i = regs0[j].as; i < regs0[j].as + regs0[j].cnt; ++i)
|
||||||
|
fprintf(stderr, "CN\t%d\t%s\t%d\t%c\t%d\t%d\t%d\n", j, mi->seq[a[i].x<<1>>33].name, (int32_t)a[i].x, "+-"[a[i].x>>63], (int32_t)a[i].y, (int32_t)(a[i].y>>32&0xff),
|
||||||
|
i == regs0[j].as? 0 : ((int32_t)a[i].y - (int32_t)a[i-1].y) - ((int32_t)a[i].x - (int32_t)a[i-1].x));
|
||||||
|
|
||||||
|
chain_post(opt, max_chain_gap_ref, mi, b->km, qlen_sum, n_segs, qlens, &n_regs0, regs0, a);
|
||||||
|
if (!is_sr) mm_est_err(mi, qlen_sum, n_regs0, regs0, a, n_mini_pos, mini_pos);
|
||||||
|
|
||||||
|
if (n_segs == 1) { // uni-segment
|
||||||
|
regs0 = align_regs(opt, mi, b->km, qlens[0], seqs[0], quals? quals[0] : 0, &n_regs0, regs0, a);
|
||||||
|
mm_set_mapq(n_regs0, regs0, opt->min_chain_score, opt->a, rep_len, is_sr);
|
||||||
|
n_regs[0] = n_regs0, regs[0] = regs0;
|
||||||
|
} else { // multi-segment
|
||||||
|
mm_seg_t *seg;
|
||||||
|
seg = mm_seg_gen(b->km, hash, n_segs, qlens, n_regs0, regs0, n_regs, regs, a); // split fragment chain to separate segment chains
|
||||||
|
free(regs0);
|
||||||
|
for (i = 0; i < n_segs; ++i) {
|
||||||
|
mm_set_parent(b->km, opt->mask_level, n_regs[i], regs[i], opt->a * 2 + opt->b); // update mm_reg1_t::parent
|
||||||
|
regs[i] = align_regs(opt, mi, b->km, qlens[i], seqs[i], quals? quals[i] : 0, &n_regs[i], regs[i], seg[i].a);
|
||||||
|
mm_set_mapq(n_regs[i], regs[i], opt->min_chain_score, opt->a, rep_len, is_sr);
|
||||||
|
}
|
||||||
|
mm_seg_free(b->km, n_segs, seg);
|
||||||
|
if (n_segs == 2 && opt->pe_ori >= 0 && (opt->flag&MM_F_CIGAR))
|
||||||
|
mm_pair(b->km, max_chain_gap_ref, opt->pe_bonus, opt->a * 2 + opt->b, opt->a, qlens, n_regs, regs); // pairing
|
||||||
|
}
|
||||||
|
|
||||||
|
kfree(b->km, mv.a);
|
||||||
|
kfree(b->km, a);
|
||||||
|
kfree(b->km, u);
|
||||||
|
kfree(b->km, mini_pos);
|
||||||
|
|
||||||
|
if (b->km) {
|
||||||
|
km_stat(b->km, &kmst);
|
||||||
|
if (mm_dbg_flag & MM_DBG_PRINT_QNAME)
|
||||||
|
fprintf(stderr, "QM\t%s\t%d\tcap=%ld,nCore=%ld,largest=%ld\n", qname, qlen_sum, kmst.capacity, kmst.n_cores, kmst.largest);
|
||||||
|
assert(kmst.n_blocks == kmst.n_cores); // otherwise, there is a memory leak
|
||||||
|
if (kmst.largest > 1U<<28) {
|
||||||
|
km_destroy(b->km);
|
||||||
|
b->km = km_init();
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
mm_reg1_t *mm_map(const mm_idx_t *mi, int qlen, const char *seq, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname)
|
||||||
{
|
{
|
||||||
mm_reg1_t *regs;
|
mm_reg1_t *regs;
|
||||||
b->mini.n = 0;
|
mm_map_frag(mi, 1, &qlen, &seq, 0, n_regs, ®s, b, opt, qname);
|
||||||
mm_sketch(b->km, seq, l_seq, mi->w, mi->k, 0, mi->is_hpc, &b->mini);
|
|
||||||
if (opt->sdust_thres > 0)
|
|
||||||
mm_dust_minier(&b->mini, l_seq, seq, opt->sdust_thres, b->sdb);
|
|
||||||
regs = mm_map_frag(opt, mi, b, 0, b->mini.n, qname, l_seq, seq, n_regs);
|
|
||||||
return regs;
|
return regs;
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -279,39 +412,70 @@ mm_reg1_t *mm_map(const mm_idx_t *mi, int l_seq, const char *seq, int *n_regs, m
|
|||||||
**************************/
|
**************************/
|
||||||
|
|
||||||
typedef struct {
|
typedef struct {
|
||||||
int mini_batch_size, n_processed, n_threads;
|
int mini_batch_size, n_processed, n_threads, n_fp;
|
||||||
const mm_mapopt_t *opt;
|
const mm_mapopt_t *opt;
|
||||||
mm_bseq_file_t *fp;
|
mm_bseq_file_t **fp;
|
||||||
const mm_idx_t *mi;
|
const mm_idx_t *mi;
|
||||||
kstring_t str;
|
kstring_t str;
|
||||||
} pipeline_t;
|
} pipeline_t;
|
||||||
|
|
||||||
typedef struct {
|
typedef struct {
|
||||||
const pipeline_t *p;
|
const pipeline_t *p;
|
||||||
int n_seq;
|
int n_seq, n_frag;
|
||||||
mm_bseq1_t *seq;
|
mm_bseq1_t *seq;
|
||||||
int *n_reg;
|
int *n_reg, *seg_off, *n_seg;
|
||||||
mm_reg1_t **reg;
|
mm_reg1_t **reg;
|
||||||
mm_tbuf_t **buf;
|
mm_tbuf_t **buf;
|
||||||
} step_t;
|
} step_t;
|
||||||
|
|
||||||
static void worker_for(void *_data, long i, int tid) // kt_for() callback
|
static void worker_for(void *_data, long i, int tid) // kt_for() callback
|
||||||
{
|
{
|
||||||
step_t *step = (step_t*)_data;
|
step_t *s = (step_t*)_data;
|
||||||
|
int qlens[MM_MAX_SEG], j, off = s->seg_off[i], pe_ori = s->p->opt->pe_ori, is_sr = !!(s->p->opt->flag & MM_F_SR);
|
||||||
|
const char *qseqs[MM_MAX_SEG], *quals[MM_MAX_SEG];
|
||||||
|
mm_tbuf_t *b = s->buf[tid];
|
||||||
|
assert(s->n_seg[i] <= MM_MAX_SEG);
|
||||||
|
memset(quals, 0, sizeof(char*) * MM_MAX_SEG);
|
||||||
if (mm_dbg_flag & MM_DBG_PRINT_QNAME)
|
if (mm_dbg_flag & MM_DBG_PRINT_QNAME)
|
||||||
fprintf(stderr, "QR\t%s\t%d\n", step->seq[i].name, tid);
|
fprintf(stderr, "QR\t%s\t%d\t%d\n", s->seq[off].name, tid, s->seq[off].l_seq);
|
||||||
step->reg[i] = mm_map(step->p->mi, step->seq[i].l_seq, step->seq[i].seq, &step->n_reg[i], step->buf[tid], step->p->opt, step->seq[i].name);
|
for (j = 0; j < s->n_seg[i]; ++j) {
|
||||||
|
if (s->n_seg[i] == 2 && ((j == 0 && (pe_ori>>1&1)) || (j == 1 && (pe_ori&1))))
|
||||||
|
mm_revcomp_bseq(&s->seq[off + j]);
|
||||||
|
qlens[j] = s->seq[off + j].l_seq;
|
||||||
|
qseqs[j] = s->seq[off + j].seq;
|
||||||
|
quals[j] = is_sr? s->seq[off + j].qual : 0;
|
||||||
|
}
|
||||||
|
if (s->p->opt->flag & MM_F_INDEPEND_SEG) {
|
||||||
|
for (j = 0; j < s->n_seg[i]; ++j)
|
||||||
|
mm_map_frag(s->p->mi, 1, &qlens[j], &qseqs[j], &quals[j], &s->n_reg[off+j], &s->reg[off+j], b, s->p->opt, s->seq[off+j].name);
|
||||||
|
} else {
|
||||||
|
mm_map_frag(s->p->mi, s->n_seg[i], qlens, qseqs, quals, &s->n_reg[off], &s->reg[off], b, s->p->opt, s->seq[off].name);
|
||||||
|
}
|
||||||
|
for (j = 0; j < s->n_seg[i]; ++j) // flip the query strand and coordinate to the original read strand
|
||||||
|
if (s->n_seg[i] == 2 && ((j == 0 && (pe_ori>>1&1)) || (j == 1 && (pe_ori&1)))) {
|
||||||
|
int k, t;
|
||||||
|
mm_revcomp_bseq(&s->seq[off + j]);
|
||||||
|
for (k = 0; k < s->n_reg[off + j]; ++k) {
|
||||||
|
mm_reg1_t *r = &s->reg[off + j][k];
|
||||||
|
t = r->qs;
|
||||||
|
r->qs = qlens[j] - r->qe;
|
||||||
|
r->qe = qlens[j] - t;
|
||||||
|
r->rev = !r->rev;
|
||||||
|
}
|
||||||
|
}
|
||||||
}
|
}
|
||||||
|
|
||||||
static void *worker_pipeline(void *shared, int step, void *in)
|
static void *worker_pipeline(void *shared, int step, void *in)
|
||||||
{
|
{
|
||||||
int i, j;
|
int i, j, k;
|
||||||
pipeline_t *p = (pipeline_t*)shared;
|
pipeline_t *p = (pipeline_t*)shared;
|
||||||
if (step == 0) { // step 0: read sequences
|
if (step == 0) { // step 0: read sequences
|
||||||
int with_qual = (!!(p->opt->flag & MM_F_OUT_SAM) && !(p->opt->flag & MM_F_NO_QUAL));
|
int with_qual = (!!(p->opt->flag & MM_F_OUT_SAM) && !(p->opt->flag & MM_F_NO_QUAL));
|
||||||
|
int frag_mode = (p->n_fp > 1 || !!(p->opt->flag & MM_F_FRAG_MODE));
|
||||||
step_t *s;
|
step_t *s;
|
||||||
s = (step_t*)calloc(1, sizeof(step_t));
|
s = (step_t*)calloc(1, sizeof(step_t));
|
||||||
s->seq = mm_bseq_read(p->fp, p->mini_batch_size, with_qual, &s->n_seq);
|
if (p->n_fp > 1) s->seq = mm_bseq_read_frag(p->n_fp, p->fp, p->mini_batch_size, with_qual, &s->n_seq);
|
||||||
|
else s->seq = mm_bseq_read2(p->fp[0], p->mini_batch_size, with_qual, frag_mode, &s->n_seq);
|
||||||
if (s->seq) {
|
if (s->seq) {
|
||||||
s->p = p;
|
s->p = p;
|
||||||
for (i = 0; i < s->n_seq; ++i)
|
for (i = 0; i < s->n_seq; ++i)
|
||||||
@@ -319,36 +483,57 @@ static void *worker_pipeline(void *shared, int step, void *in)
|
|||||||
s->buf = (mm_tbuf_t**)calloc(p->n_threads, sizeof(mm_tbuf_t*));
|
s->buf = (mm_tbuf_t**)calloc(p->n_threads, sizeof(mm_tbuf_t*));
|
||||||
for (i = 0; i < p->n_threads; ++i)
|
for (i = 0; i < p->n_threads; ++i)
|
||||||
s->buf[i] = mm_tbuf_init();
|
s->buf[i] = mm_tbuf_init();
|
||||||
s->n_reg = (int*)calloc(s->n_seq, sizeof(int));
|
s->n_reg = (int*)calloc(3 * s->n_seq, sizeof(int));
|
||||||
|
s->seg_off = s->n_reg + s->n_seq; // seg_off and n_seg are allocated together with n_reg
|
||||||
|
s->n_seg = s->seg_off + s->n_seq;
|
||||||
s->reg = (mm_reg1_t**)calloc(s->n_seq, sizeof(mm_reg1_t*));
|
s->reg = (mm_reg1_t**)calloc(s->n_seq, sizeof(mm_reg1_t*));
|
||||||
|
for (i = 1, j = 0; i <= s->n_seq; ++i)
|
||||||
|
if (i == s->n_seq || !frag_mode || !mm_qname_same(s->seq[i-1].name, s->seq[i].name)) {
|
||||||
|
s->n_seg[s->n_frag] = i - j;
|
||||||
|
s->seg_off[s->n_frag++] = j;
|
||||||
|
j = i;
|
||||||
|
}
|
||||||
return s;
|
return s;
|
||||||
} else free(s);
|
} else free(s);
|
||||||
} else if (step == 1) { // step 1: map
|
} else if (step == 1) { // step 1: map
|
||||||
kt_for(p->n_threads, worker_for, in, ((step_t*)in)->n_seq);
|
kt_for(p->n_threads, worker_for, in, ((step_t*)in)->n_frag);
|
||||||
return in;
|
return in;
|
||||||
} else if (step == 2) { // step 2: output
|
} else if (step == 2) { // step 2: output
|
||||||
|
void *km = 0;
|
||||||
step_t *s = (step_t*)in;
|
step_t *s = (step_t*)in;
|
||||||
const mm_idx_t *mi = p->mi;
|
const mm_idx_t *mi = p->mi;
|
||||||
for (i = 0; i < p->n_threads; ++i) mm_tbuf_destroy(s->buf[i]);
|
for (i = 0; i < p->n_threads; ++i) mm_tbuf_destroy(s->buf[i]);
|
||||||
free(s->buf);
|
free(s->buf);
|
||||||
for (i = 0; i < s->n_seq; ++i) {
|
if ((p->opt->flag & MM_F_OUT_CS) && !(mm_dbg_flag & MM_DBG_NO_KALLOC)) km = km_init();
|
||||||
|
for (k = 0; k < s->n_frag; ++k) {
|
||||||
|
int seg_st = s->seg_off[k], seg_en = s->seg_off[k] + s->n_seg[k];
|
||||||
|
for (i = seg_st; i < seg_en; ++i) {
|
||||||
mm_bseq1_t *t = &s->seq[i];
|
mm_bseq1_t *t = &s->seq[i];
|
||||||
for (j = 0; j < s->n_reg[i]; ++j) {
|
for (j = 0; j < s->n_reg[i]; ++j) {
|
||||||
mm_reg1_t *r = &s->reg[i][j];
|
mm_reg1_t *r = &s->reg[i][j];
|
||||||
if (p->opt->flag & MM_F_OUT_SAM) mm_write_sam(&p->str, mi, t, r);
|
assert(!r->sam_pri || r->id == r->parent);
|
||||||
else mm_write_paf(&p->str, mi, t, r);
|
if ((p->opt->flag & MM_F_NO_PRINT_2ND) && r->id != r->parent)
|
||||||
|
continue;
|
||||||
|
if (p->opt->flag & MM_F_OUT_SAM)
|
||||||
|
mm_write_sam2(&p->str, mi, t, i - seg_st, j, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag);
|
||||||
|
else
|
||||||
|
mm_write_paf(&p->str, mi, t, r, km, p->opt->flag);
|
||||||
puts(p->str.s);
|
puts(p->str.s);
|
||||||
free(r->p);
|
|
||||||
}
|
}
|
||||||
if (s->n_reg[i] == 0 && (p->opt->flag & MM_F_OUT_SAM)) {
|
if (s->n_reg[i] == 0 && (p->opt->flag & MM_F_OUT_SAM)) {
|
||||||
mm_write_sam(&p->str, 0, t, 0);
|
mm_write_sam2(&p->str, mi, t, i - seg_st, -1, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag);
|
||||||
puts(p->str.s);
|
puts(p->str.s);
|
||||||
}
|
}
|
||||||
|
}
|
||||||
|
for (i = seg_st; i < seg_en; ++i) {
|
||||||
|
for (j = 0; j < s->n_reg[i]; ++j) free(s->reg[i][j].p);
|
||||||
free(s->reg[i]);
|
free(s->reg[i]);
|
||||||
free(s->seq[i].seq); free(s->seq[i].name);
|
free(s->seq[i].seq); free(s->seq[i].name);
|
||||||
if (s->seq[i].qual) free(s->seq[i].qual);
|
if (s->seq[i].qual) free(s->seq[i].qual);
|
||||||
}
|
}
|
||||||
free(s->reg); free(s->n_reg); free(s->seq);
|
}
|
||||||
|
free(s->reg); free(s->n_reg); free(s->seq); // seg_off and n_seg were allocated with reg; no memory leak here
|
||||||
|
km_destroy(km);
|
||||||
if (mm_verbose >= 3)
|
if (mm_verbose >= 3)
|
||||||
fprintf(stderr, "[M::%s::%.3f*%.2f] mapped %d sequences\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), s->n_seq);
|
fprintf(stderr, "[M::%s::%.3f*%.2f] mapped %d sequences\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), s->n_seq);
|
||||||
free(s);
|
free(s);
|
||||||
@@ -356,21 +541,38 @@ static void *worker_pipeline(void *shared, int step, void *in)
|
|||||||
return 0;
|
return 0;
|
||||||
}
|
}
|
||||||
|
|
||||||
int mm_map_file(const mm_idx_t *idx, const char *fn, const mm_mapopt_t *opt, int n_threads, int mini_batch_size)
|
int mm_map_file_frag(const mm_idx_t *idx, int n_segs, const char **fn, const mm_mapopt_t *opt, int n_threads)
|
||||||
{
|
{
|
||||||
|
int i, j, pl_threads;
|
||||||
pipeline_t pl;
|
pipeline_t pl;
|
||||||
|
if (n_segs < 1) return -1;
|
||||||
memset(&pl, 0, sizeof(pipeline_t));
|
memset(&pl, 0, sizeof(pipeline_t));
|
||||||
pl.fp = mm_bseq_open(fn);
|
pl.n_fp = n_segs;
|
||||||
if (pl.fp == 0) return -1;
|
pl.fp = (mm_bseq_file_t**)calloc(n_segs, sizeof(mm_bseq_file_t*));
|
||||||
pl.opt = opt, pl.mi = idx;
|
for (i = 0; i < n_segs; ++i) {
|
||||||
pl.n_threads = n_threads, pl.mini_batch_size = mini_batch_size;
|
pl.fp[i] = mm_bseq_open(fn[i]);
|
||||||
if (opt->flag & MM_F_OUT_SAM) {
|
if (pl.fp[i] == 0) {
|
||||||
uint32_t i;
|
if (mm_verbose >= 1)
|
||||||
for (i = 0; i < idx->n_seq; ++i)
|
fprintf(stderr, "ERROR: failed to open file '%s'\n", fn[i]);
|
||||||
printf("@SQ\tSN:%s\tLN:%d\n", idx->seq[i].name, idx->seq[i].len);
|
for (j = 0; j < i; ++j)
|
||||||
|
mm_bseq_close(pl.fp[j]);
|
||||||
|
free(pl.fp);
|
||||||
|
return -1;
|
||||||
}
|
}
|
||||||
kt_pipeline(n_threads == 1? 1 : 2, worker_pipeline, &pl, 3);
|
}
|
||||||
|
pl.opt = opt, pl.mi = idx;
|
||||||
|
pl.n_threads = n_threads > 1? n_threads : 1;
|
||||||
|
pl.mini_batch_size = opt->mini_batch_size;
|
||||||
|
pl_threads = n_threads == 1? 1 : (opt->flag&MM_F_2_IO_THREADS)? 3 : 2;
|
||||||
|
kt_pipeline(pl_threads, worker_pipeline, &pl, 3);
|
||||||
free(pl.str.s);
|
free(pl.str.s);
|
||||||
mm_bseq_close(pl.fp);
|
for (i = 0; i < n_segs; ++i)
|
||||||
|
mm_bseq_close(pl.fp[i]);
|
||||||
|
free(pl.fp);
|
||||||
return 0;
|
return 0;
|
||||||
}
|
}
|
||||||
|
|
||||||
|
int mm_map_file(const mm_idx_t *idx, const char *fn, const mm_mapopt_t *opt, int n_threads)
|
||||||
|
{
|
||||||
|
return mm_map_file_frag(idx, 1, &fn, opt, n_threads);
|
||||||
|
}
|
||||||
|
|||||||
@@ -5,35 +5,44 @@
|
|||||||
#include <stdio.h>
|
#include <stdio.h>
|
||||||
#include <sys/types.h>
|
#include <sys/types.h>
|
||||||
|
|
||||||
#define MM_IDX_DEF_B 14
|
#define MM_F_NO_SELF 0x001
|
||||||
|
#define MM_F_AVA 0x002
|
||||||
|
#define MM_F_CIGAR 0x004
|
||||||
|
#define MM_F_OUT_SAM 0x008
|
||||||
|
#define MM_F_NO_QUAL 0x010
|
||||||
|
#define MM_F_OUT_CG 0x020
|
||||||
|
#define MM_F_OUT_CS 0x040
|
||||||
|
#define MM_F_SPLICE 0x080 // splice mode
|
||||||
|
#define MM_F_SPLICE_FOR 0x100 // match GT-AG
|
||||||
|
#define MM_F_SPLICE_REV 0x200 // match CT-AC, the reverse complement of GT-AG
|
||||||
|
#define MM_F_NO_LJOIN 0x400
|
||||||
|
#define MM_F_OUT_CS_LONG 0x800
|
||||||
|
#define MM_F_SR 0x1000
|
||||||
|
#define MM_F_FRAG_MODE 0x2000
|
||||||
|
#define MM_F_NO_PRINT_2ND 0x4000
|
||||||
|
#define MM_F_2_IO_THREADS 0x8000
|
||||||
|
#define MM_F_LONG_CIGAR 0x10000
|
||||||
|
#define MM_F_INDEPEND_SEG 0x20000
|
||||||
|
#define MM_F_SPLICE_FLANK 0x40000
|
||||||
|
#define MM_F_SOFTCLIP 0x80000
|
||||||
|
|
||||||
#define MM_F_NO_SELF 0x01
|
#define MM_I_HPC 0x1
|
||||||
#define MM_F_AVA 0x02
|
#define MM_I_NO_SEQ 0x2
|
||||||
#define MM_F_CIGAR 0x04
|
#define MM_I_NO_NAME 0x4
|
||||||
#define MM_F_OUT_SAM 0x08
|
|
||||||
#define MM_F_NO_QUAL 0x10
|
|
||||||
|
|
||||||
#define MM_IDX_MAGIC "MMI\2"
|
#define MM_IDX_MAGIC "MMI\2"
|
||||||
|
|
||||||
|
#define MM_MAX_SEG 255
|
||||||
|
|
||||||
#ifdef __cplusplus
|
#ifdef __cplusplus
|
||||||
extern "C" {
|
extern "C" {
|
||||||
#endif
|
#endif
|
||||||
|
|
||||||
typedef struct {
|
// emulate 128-bit integers and arrays
|
||||||
uint64_t x, y;
|
typedef struct { uint64_t x, y; } mm128_t;
|
||||||
} mm128_t;
|
|
||||||
|
|
||||||
typedef struct { size_t n, m; mm128_t *a; } mm128_v;
|
typedef struct { size_t n, m; mm128_t *a; } mm128_v;
|
||||||
typedef struct { size_t n, m; uint64_t *a; } uint64_v;
|
|
||||||
typedef struct { size_t n, m; uint32_t *a; } uint32_v;
|
|
||||||
|
|
||||||
typedef struct {
|
|
||||||
mm128_v a; // (minimizer, position) array
|
|
||||||
int32_t n; // size of the _p_ array
|
|
||||||
uint64_t *p; // position array for minimizers appearing >1 times
|
|
||||||
void *h; // hash table indexing _p_ and minimizers appearing once
|
|
||||||
} mm_idx_bucket_t;
|
|
||||||
|
|
||||||
|
// minimap2 index
|
||||||
typedef struct {
|
typedef struct {
|
||||||
char *name; // name of the db sequence
|
char *name; // name of the db sequence
|
||||||
uint64_t offset; // offset in mm_idx_t::S
|
uint64_t offset; // offset in mm_idx_t::S
|
||||||
@@ -41,101 +50,249 @@ typedef struct {
|
|||||||
} mm_idx_seq_t;
|
} mm_idx_seq_t;
|
||||||
|
|
||||||
typedef struct {
|
typedef struct {
|
||||||
int32_t b, w, k, is_hpc;
|
int32_t b, w, k, flag;
|
||||||
uint32_t n_seq; // number of reference sequences
|
uint32_t n_seq; // number of reference sequences
|
||||||
mm_idx_seq_t *seq; // sequence name, length and offset
|
mm_idx_seq_t *seq; // sequence name, length and offset
|
||||||
uint32_t *S; // 4-bit packed sequence
|
uint32_t *S; // 4-bit packed sequence
|
||||||
mm_idx_bucket_t *B; // index
|
struct mm_idx_bucket_s *B; // index (hidden)
|
||||||
|
void *km;
|
||||||
} mm_idx_t;
|
} mm_idx_t;
|
||||||
|
|
||||||
|
// minimap2 alignment
|
||||||
typedef struct {
|
typedef struct {
|
||||||
uint32_t capacity;
|
uint32_t capacity; // the capacity of cigar[]
|
||||||
int32_t dp_score, dp_max, dp_max2;
|
int32_t dp_score, dp_max, dp_max2; // DP score; score of the max-scoring segment; score of the best alternate mappings
|
||||||
uint32_t blen;
|
uint32_t n_ambi:30, trans_strand:2; // number of ambiguous bases; transcript strand: 0 for unknown, 1 for +, 2 for -
|
||||||
uint32_t n_diff, n_ambi;
|
uint32_t n_cigar; // number of cigar operations in cigar[]
|
||||||
uint32_t n_cigar;
|
|
||||||
uint32_t cigar[];
|
uint32_t cigar[];
|
||||||
} mm_extra_t;
|
} mm_extra_t;
|
||||||
|
|
||||||
typedef struct {
|
typedef struct {
|
||||||
int32_t id;
|
int32_t id; // ID for internal uses (see also parent below)
|
||||||
uint32_t cnt:31, rev:1;
|
int32_t cnt; // number of minimizers; if on the reverse strand
|
||||||
uint32_t rid:31, rep:1;
|
int32_t rid; // reference index; if this is an alignment from inversion rescue
|
||||||
int32_t score;
|
int32_t score; // DP alignment score
|
||||||
int32_t qs, qe, rs, re;
|
int32_t qs, qe, rs, re; // query start and end; reference start and end
|
||||||
int32_t parent, subsc;
|
int32_t parent, subsc; // parent==id if primary; best alternate mapping score
|
||||||
int32_t as;
|
int32_t as; // offset in the a[] array (for internal uses only)
|
||||||
int32_t fuzzy_mlen, fuzzy_blen;
|
int32_t mlen, blen; // seeded exact match length; seeded alignment block length
|
||||||
uint32_t mapq:8, split:2, sam_pri:1, n_sub:21; // TODO: n_sub is not used for now
|
int32_t n_sub; // number of suboptimal mappings
|
||||||
|
int32_t score0; // initial chaining score (before chain merging/spliting)
|
||||||
|
uint32_t mapq:8, split:2, rev:1, inv:1, sam_pri:1, proper_frag:1, pe_thru:1, seg_split:1, dummy:16;
|
||||||
|
uint32_t hash;
|
||||||
|
float div;
|
||||||
mm_extra_t *p;
|
mm_extra_t *p;
|
||||||
} mm_reg1_t;
|
} mm_reg1_t;
|
||||||
|
|
||||||
|
// indexing and mapping options
|
||||||
typedef struct {
|
typedef struct {
|
||||||
float max_occ_frac;
|
short k, w, flag, bucket_bits;
|
||||||
float mid_occ_frac;
|
int mini_batch_size;
|
||||||
|
uint64_t batch_size;
|
||||||
|
} mm_idxopt_t;
|
||||||
|
|
||||||
|
typedef struct {
|
||||||
|
int seed;
|
||||||
int sdust_thres; // score threshold for SDUST; 0 to disable
|
int sdust_thres; // score threshold for SDUST; 0 to disable
|
||||||
int flag; // see MM_F_* macros
|
int flag; // see MM_F_* macros
|
||||||
|
|
||||||
int bw; // bandwidth
|
int bw; // bandwidth
|
||||||
int max_gap; // break a chain if there are no minimizers in a max_gap window
|
int max_gap, max_gap_ref; // break a chain if there are no minimizers in a max_gap window
|
||||||
|
int max_frag_len;
|
||||||
int max_chain_skip;
|
int max_chain_skip;
|
||||||
int min_cnt;
|
int min_cnt; // min number of minimizers on each chain
|
||||||
int min_chain_score;
|
int min_chain_score; // min chaining score
|
||||||
|
|
||||||
float mask_level;
|
float mask_level;
|
||||||
float pri_ratio;
|
float pri_ratio;
|
||||||
int best_n;
|
int best_n; // top best_n chains are subjected to DP alignment
|
||||||
|
|
||||||
int max_join_long, max_join_short;
|
int max_join_long, max_join_short;
|
||||||
int min_join_flank_sc;
|
int min_join_flank_sc;
|
||||||
|
|
||||||
int a, b, q, e, q2, e2; // matching score, mismatch, gap-open and gap-ext penalties
|
int a, b, q, e, q2, e2; // matching score, mismatch, gap-open and gap-ext penalties
|
||||||
int zdrop;
|
int noncan; // cost of non-canonical splicing sites
|
||||||
int min_dp_max;
|
int zdrop; // break alignment if alignment score drops too fast along the diagonal
|
||||||
|
int end_bonus;
|
||||||
|
int min_dp_max; // drop an alignment if the score of the max scoring segment is below this threshold
|
||||||
int min_ksw_len;
|
int min_ksw_len;
|
||||||
|
int anchor_ext_len, anchor_ext_shift;
|
||||||
|
|
||||||
int max_occ;
|
int pe_ori, pe_bonus;
|
||||||
int mid_occ;
|
|
||||||
|
float mid_occ_frac; // only used by mm_mapopt_update(); see below
|
||||||
|
int32_t mid_occ; // ignore seeds with occurrences above this threshold
|
||||||
|
int32_t max_occ;
|
||||||
|
int mini_batch_size; // size of a batch of query bases to process in parallel
|
||||||
} mm_mapopt_t;
|
} mm_mapopt_t;
|
||||||
|
|
||||||
extern int mm_verbose, mm_dbg_flag;
|
// index reader
|
||||||
extern double mm_realtime0;
|
typedef struct {
|
||||||
|
int is_idx, n_parts;
|
||||||
|
int64_t idx_size;
|
||||||
|
mm_idxopt_t opt;
|
||||||
|
FILE *fp_out;
|
||||||
|
union {
|
||||||
|
struct mm_bseq_file_s *seq;
|
||||||
|
FILE *idx;
|
||||||
|
} fp;
|
||||||
|
} mm_idx_reader_t;
|
||||||
|
|
||||||
struct mm_tbuf_s;
|
// memory buffer for thread-local storage during mapping
|
||||||
typedef struct mm_tbuf_s mm_tbuf_t;
|
typedef struct mm_tbuf_s mm_tbuf_t;
|
||||||
|
|
||||||
struct mm_bseq_file_s;
|
// global variables
|
||||||
|
extern int mm_verbose, mm_dbg_flag; // verbose level: 0 for no info, 1 for error, 2 for warning, 3 for message (default); debugging flag
|
||||||
|
extern double mm_realtime0; // wall-clock timer
|
||||||
|
|
||||||
#define mm_seq4_set(s, i, c) ((s)[(i)>>3] |= (uint32_t)(c) << (((i)&7)<<2))
|
/**
|
||||||
#define mm_seq4_get(s, i) ((s)[(i)>>3] >> (((i)&7)<<2) & 0xf)
|
* Set default or preset parameters
|
||||||
|
*
|
||||||
|
* @param preset NULL to set all parameters as default; otherwise apply preset to affected parameters
|
||||||
|
* @param io pointer to indexing parameters
|
||||||
|
* @param mo pointer to mapping parameters
|
||||||
|
*
|
||||||
|
* @return 0 if success; -1 if _present_ unknown
|
||||||
|
*/
|
||||||
|
int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo);
|
||||||
|
int mm_check_opt(const mm_idxopt_t *io, const mm_mapopt_t *mo);
|
||||||
|
|
||||||
// compute minimizers
|
/**
|
||||||
void mm_sketch(void *km, const char *str, int len, int w, int k, uint32_t rid, int is_hpc, mm128_v *p);
|
* Update mm_mapopt_t::mid_occ via mm_mapopt_t::mid_occ_frac
|
||||||
|
*
|
||||||
// minimizer indexing
|
* If mm_mapopt_t::mid_occ is 0, this function sets it to a number such that no
|
||||||
mm_idx_t *mm_idx_init(int w, int k, int b, int is_hpc);
|
* more than mm_mapopt_t::mid_occ_frac of minimizers in the index have a higher
|
||||||
void mm_idx_destroy(mm_idx_t *mi);
|
* occurrence.
|
||||||
mm_idx_t *mm_idx_gen(struct mm_bseq_file_s *fp, int w, int k, int b, int is_hpc, int mini_batch_size, int n_threads, uint64_t batch_size, int keep_name);
|
*
|
||||||
uint32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f);
|
* @param opt mapping parameters
|
||||||
void mm_idx_stat(const mm_idx_t *idx);
|
* @param mi minimap2 index
|
||||||
const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n);
|
*/
|
||||||
int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq);
|
|
||||||
|
|
||||||
mm_idx_t *mm_idx_build(const char *fn, int w, int k, int is_hpc, int n_threads);
|
|
||||||
int mm_idx_is_idx(const char *fn);
|
|
||||||
|
|
||||||
// minimizer index I/O
|
|
||||||
void mm_idx_dump(FILE *fp, const mm_idx_t *mi);
|
|
||||||
mm_idx_t *mm_idx_load(FILE *fp);
|
|
||||||
|
|
||||||
// mapping
|
|
||||||
void mm_mapopt_init(mm_mapopt_t *opt);
|
|
||||||
void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi);
|
void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi);
|
||||||
|
|
||||||
|
void mm_mapopt_max_intron_len(mm_mapopt_t *opt, int max_intron_len);
|
||||||
|
|
||||||
|
/**
|
||||||
|
* Initialize an index reader
|
||||||
|
*
|
||||||
|
* @param fn index or fasta/fastq file name (this function tests the file type)
|
||||||
|
* @param opt indexing parameters
|
||||||
|
* @param fn_out if not NULL, write built index to this file
|
||||||
|
*
|
||||||
|
* @return an index reader on success; NULL if fail to open _fn_
|
||||||
|
*/
|
||||||
|
mm_idx_reader_t *mm_idx_reader_open(const char *fn, const mm_idxopt_t *opt, const char *fn_out);
|
||||||
|
|
||||||
|
/**
|
||||||
|
* Read/build an index
|
||||||
|
*
|
||||||
|
* If the input file is an index file, this function reads one part of the
|
||||||
|
* index and returns. If the input file is a sequence file (fasta or fastq),
|
||||||
|
* this function constructs the index for about mm_idxopt_t::batch_size bases.
|
||||||
|
* Importantly, for a huge collection of sequences, this function may only
|
||||||
|
* return an index for part of sequences. It needs to be repeatedly called
|
||||||
|
* to traverse the entire index/sequence file.
|
||||||
|
*
|
||||||
|
* @param r index reader
|
||||||
|
* @param n_threads number of threads for constructing index
|
||||||
|
*
|
||||||
|
* @return an index on success; NULL if reaching the end of the input file
|
||||||
|
*/
|
||||||
|
mm_idx_t *mm_idx_reader_read(mm_idx_reader_t *r, int n_threads);
|
||||||
|
|
||||||
|
/**
|
||||||
|
* Destroy/deallocate an index reader
|
||||||
|
*
|
||||||
|
* @param r index reader
|
||||||
|
*/
|
||||||
|
void mm_idx_reader_close(mm_idx_reader_t *r);
|
||||||
|
|
||||||
|
int mm_idx_reader_eof(const mm_idx_reader_t *r);
|
||||||
|
|
||||||
|
/**
|
||||||
|
* Create an index from strings in memory
|
||||||
|
*
|
||||||
|
* @param w minimizer window size
|
||||||
|
* @param k minimizer k-mer size
|
||||||
|
* @param is_hpc use HPC k-mer if true
|
||||||
|
* @param bucket_bits number of bits for the first level of the hash table
|
||||||
|
* @param n number of sequences
|
||||||
|
* @param seq sequences in A/C/G/T
|
||||||
|
* @param name sequence names; could be NULL
|
||||||
|
*
|
||||||
|
* @return minimap2 index
|
||||||
|
*/
|
||||||
|
mm_idx_t *mm_idx_str(int w, int k, int is_hpc, int bucket_bits, int n, const char **seq, const char **name);
|
||||||
|
|
||||||
|
/**
|
||||||
|
* Print index statistics to stderr
|
||||||
|
*
|
||||||
|
* @param mi minimap2 index
|
||||||
|
*/
|
||||||
|
void mm_idx_stat(const mm_idx_t *idx);
|
||||||
|
|
||||||
|
/**
|
||||||
|
* Destroy/deallocate an index
|
||||||
|
*
|
||||||
|
* @param r minimap2 index
|
||||||
|
*/
|
||||||
|
void mm_idx_destroy(mm_idx_t *mi);
|
||||||
|
|
||||||
|
/**
|
||||||
|
* Initialize a thread-local buffer for mapping
|
||||||
|
*
|
||||||
|
* Each mapping thread requires a buffer specific to the thread (see mm_map()
|
||||||
|
* below). The primary purpose of this buffer is to reduce frequent heap
|
||||||
|
* allocations across threads. A buffer shall not be used by two or more
|
||||||
|
* threads.
|
||||||
|
*
|
||||||
|
* @return pointer to a thread-local buffer
|
||||||
|
*/
|
||||||
mm_tbuf_t *mm_tbuf_init(void);
|
mm_tbuf_t *mm_tbuf_init(void);
|
||||||
|
|
||||||
|
/**
|
||||||
|
* Destroy/deallocate a thread-local buffer for mapping
|
||||||
|
*
|
||||||
|
* @param b the buffer
|
||||||
|
*/
|
||||||
void mm_tbuf_destroy(mm_tbuf_t *b);
|
void mm_tbuf_destroy(mm_tbuf_t *b);
|
||||||
|
|
||||||
|
/**
|
||||||
|
* Align a query sequence against an index
|
||||||
|
*
|
||||||
|
* This function possibly finds multiple alignments of the query sequence.
|
||||||
|
* The returned array and the mm_reg1_t::p field of each element are allocated
|
||||||
|
* with malloc().
|
||||||
|
*
|
||||||
|
* @param mi minimap2 index
|
||||||
|
* @param l_seq length of the query sequence
|
||||||
|
* @param seq the query sequence
|
||||||
|
* @param n_regs number of hits (out)
|
||||||
|
* @param b thread-local buffer; two mm_map() calls shall not use one buffer at the same time!
|
||||||
|
* @param opt mapping parameters
|
||||||
|
* @param name query name, used for all-vs-all overlapping and debugging
|
||||||
|
*
|
||||||
|
* @return an array of hits which need to be deallocated with free() together
|
||||||
|
* with mm_reg1_t::p of each element. The size is written to _n_regs_.
|
||||||
|
*/
|
||||||
mm_reg1_t *mm_map(const mm_idx_t *mi, int l_seq, const char *seq, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *name);
|
mm_reg1_t *mm_map(const mm_idx_t *mi, int l_seq, const char *seq, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *name);
|
||||||
|
|
||||||
int mm_map_file(const mm_idx_t *idx, const char *fn, const mm_mapopt_t *opt, int n_threads, int tbatch_size);
|
/**
|
||||||
|
* Align a fasta/fastq file and print alignments to stdout
|
||||||
|
*
|
||||||
|
* @param idx minimap2 index
|
||||||
|
* @param fn fasta/fastq file name
|
||||||
|
* @param opt mapping parameters
|
||||||
|
* @param n_threads number of threads
|
||||||
|
*
|
||||||
|
* @return 0 on success; -1 if _fn_ can't be read
|
||||||
|
*/
|
||||||
|
int mm_map_file(const mm_idx_t *idx, const char *fn, const mm_mapopt_t *opt, int n_threads);
|
||||||
|
|
||||||
|
int mm_map_file_frag(const mm_idx_t *idx, int n_segs, const char **fn, const mm_mapopt_t *opt, int n_threads);
|
||||||
|
|
||||||
|
// deprecated APIs for backward compatibility
|
||||||
|
void mm_mapopt_init(mm_mapopt_t *opt);
|
||||||
|
mm_idx_t *mm_idx_build(const char *fn, int w, int k, int flag, int n_threads);
|
||||||
|
|
||||||
#ifdef __cplusplus
|
#ifdef __cplusplus
|
||||||
}
|
}
|
||||||
|
|||||||
+214
-48
@@ -1,4 +1,4 @@
|
|||||||
.TH minimap2 1 "19 July 2017" "minimap2-2.0-r190-dirty" "Bioinformatics tools"
|
.TH minimap2 1 "9 January 2018" "minimap2-2.7 (r654)" "Bioinformatics tools"
|
||||||
.SH NAME
|
.SH NAME
|
||||||
.PP
|
.PP
|
||||||
minimap2 - mapping and alignment between collections of DNA sequences
|
minimap2 - mapping and alignment between collections of DNA sequences
|
||||||
@@ -99,6 +99,14 @@ multiple times to map it against each batch of target sequences.
|
|||||||
may be ending with k/K/m/M/g/G. NB: mapping quality is incorrect given a
|
may be ending with k/K/m/M/g/G. NB: mapping quality is incorrect given a
|
||||||
multi-part index.
|
multi-part index.
|
||||||
.TP
|
.TP
|
||||||
|
.B --idx-no-seq
|
||||||
|
Don't store target sequences in the index. It saves disk space and memory but
|
||||||
|
the index generated with this option will not work with
|
||||||
|
.B -a
|
||||||
|
or
|
||||||
|
.BR -c .
|
||||||
|
When base-level alignment is not requested, this option is automatically applied.
|
||||||
|
.TP
|
||||||
.BI -d \ FILE
|
.BI -d \ FILE
|
||||||
Save the minimizer index of
|
Save the minimizer index of
|
||||||
.I target.fa
|
.I target.fa
|
||||||
@@ -126,7 +134,7 @@ Stop chain enlongation if there are no minimizers in
|
|||||||
[10000].
|
[10000].
|
||||||
.TP
|
.TP
|
||||||
.BI -r \ INT
|
.BI -r \ INT
|
||||||
Bandwidth used in chaining and DP-based alignment [1000]. This option
|
Bandwidth used in chaining and DP-based alignment [500]. This option
|
||||||
approximately controls the maximum gap size.
|
approximately controls the maximum gap size.
|
||||||
.TP
|
.TP
|
||||||
.BI -n \ INT
|
.BI -n \ INT
|
||||||
@@ -137,10 +145,8 @@ number of minimizers [3]
|
|||||||
.BI -m \ INT
|
.BI -m \ INT
|
||||||
Discard chains with chaining score
|
Discard chains with chaining score
|
||||||
.RI < INT
|
.RI < INT
|
||||||
[40]. Chaining score equals the approximate number of matching bases (exact if
|
[40]. Chaining score equals the approximate number of matching bases minus a
|
||||||
not using
|
concave gap penalty. It is computed with dynamic programming.
|
||||||
.BR -H )
|
|
||||||
minus base-2 logarithm gap penalty. It is computed with dynamic programming.
|
|
||||||
.TP
|
.TP
|
||||||
.B -X
|
.B -X
|
||||||
Perform all-vs-all mapping. In this mode, if the query sequence name is
|
Perform all-vs-all mapping. In this mode, if the query sequence name is
|
||||||
@@ -150,7 +156,7 @@ diagonal minimizer hits will also be suppressed.
|
|||||||
.TP
|
.TP
|
||||||
.BI -p \ FLOAT
|
.BI -p \ FLOAT
|
||||||
Minimal secondary-to-primary score ratio to output secondary mappings [0.8].
|
Minimal secondary-to-primary score ratio to output secondary mappings [0.8].
|
||||||
Between two chains overlaping over half of the shorter chain (controled by
|
Between two chains overlaping over half of the shorter chain (controlled by
|
||||||
.BR --mask-level ),
|
.BR --mask-level ),
|
||||||
the chain with a lower score is secondary to the chain with a higher score.
|
the chain with a lower score is secondary to the chain with a higher score.
|
||||||
If the ratio of the scores is below
|
If the ratio of the scores is below
|
||||||
@@ -164,6 +170,18 @@ secondary alignments [5]. This option has no effect when
|
|||||||
.B -X
|
.B -X
|
||||||
is applied.
|
is applied.
|
||||||
.TP
|
.TP
|
||||||
|
.BI -G \ NUM
|
||||||
|
Maximum gap on the reference (effective with
|
||||||
|
.BR -xsplice / --splice ).
|
||||||
|
This option also changes the chaining and alignment band width to
|
||||||
|
.IR NUM .
|
||||||
|
Increasing this option slows down spliced alignment. [200k]
|
||||||
|
.TP
|
||||||
|
.BI -F \ NUM
|
||||||
|
Maximum fragment length (aka insert size; effective with
|
||||||
|
.BR -xsr / --frag)
|
||||||
|
[800]
|
||||||
|
.TP
|
||||||
.BI --max-chain-skip \ INT
|
.BI --max-chain-skip \ INT
|
||||||
A heuristics that stops chaining early [50]. Minimap2 uses dynamic programming
|
A heuristics that stops chaining early [50]. Minimap2 uses dynamic programming
|
||||||
for chaining. The time complexity is quadratic in the number of seeds. This
|
for chaining. The time complexity is quadratic in the number of seeds. This
|
||||||
@@ -171,6 +189,23 @@ option makes minimap2 exits the inner loop if it repeatedly sees seeds already
|
|||||||
on chains. Set
|
on chains. Set
|
||||||
.I INT
|
.I INT
|
||||||
to a large number to switch off this heurstics.
|
to a large number to switch off this heurstics.
|
||||||
|
.TP
|
||||||
|
.B --no-long-join
|
||||||
|
Disable the long gap patching heuristic. When this option is applied, the
|
||||||
|
maximum alignment gap is mostly controlled by
|
||||||
|
.BR -r .
|
||||||
|
.TP
|
||||||
|
.B --splice
|
||||||
|
Enable the splice alignment mode.
|
||||||
|
.TP
|
||||||
|
.B --sr
|
||||||
|
Enable short-read alignment heuristics. In the short-read mode, minimap2
|
||||||
|
applies a second round of chaining with a higher minimizer occurrence threshold
|
||||||
|
if no good chain is found. In addition, minimap2 attempts to patch gaps between
|
||||||
|
seeds with ungapped alignment.
|
||||||
|
.TP
|
||||||
|
.BR --frag [= no | yes ]
|
||||||
|
Whether to enable the fragment mode [no]
|
||||||
.SS Alignment options
|
.SS Alignment options
|
||||||
.TP 10
|
.TP 10
|
||||||
.BI -A \ INT
|
.BI -A \ INT
|
||||||
@@ -190,6 +225,12 @@ Gap extension penalty [2,1]. A gap of length
|
|||||||
.I k
|
.I k
|
||||||
costs
|
costs
|
||||||
.RI min{ O1 + k * E1 , O2 + k * E2 }.
|
.RI min{ O1 + k * E1 , O2 + k * E2 }.
|
||||||
|
In the splice mode, the second gap penalties are not used.
|
||||||
|
.TP
|
||||||
|
.BI -C \ INT
|
||||||
|
Cost for a non-canonical GT-AG splicing (effective with
|
||||||
|
.BR --splice )
|
||||||
|
[0]
|
||||||
.TP
|
.TP
|
||||||
.BI -z \ INT
|
.BI -z \ INT
|
||||||
Break an alignment if the running score drops too quickly along the diagonal of
|
Break an alignment if the running score drops too quickly along the diagonal of
|
||||||
@@ -201,18 +242,94 @@ the contiguity of the alignment at the cost of poor alignment in the middle
|
|||||||
Minimal peak DP alignment score to output [40]. The peak score is computed from
|
Minimal peak DP alignment score to output [40]. The peak score is computed from
|
||||||
the final CIGAR. It is the score of the max scoring segment in the alignment
|
the final CIGAR. It is the score of the max scoring segment in the alignment
|
||||||
and may be different from the total alignment score.
|
and may be different from the total alignment score.
|
||||||
|
.TP
|
||||||
|
.BI -u \ CHAR
|
||||||
|
How to find canonical splicing sites GT-AG -
|
||||||
|
.BR f :
|
||||||
|
transcript strand;
|
||||||
|
.BR b :
|
||||||
|
both strands;
|
||||||
|
.BR n :
|
||||||
|
no attempt to match GT-AG [n]
|
||||||
|
.TP
|
||||||
|
.BI --end-bonus \ INT
|
||||||
|
Score bonus when alignment extends to the end of the query sequence [0].
|
||||||
|
.TP
|
||||||
|
.BR --splice-flank [= yes | no ]
|
||||||
|
Assume the next base to a
|
||||||
|
.B GT
|
||||||
|
donor site tends to be A/G (91% in human and 92% in mouse) and the preceding
|
||||||
|
base to a
|
||||||
|
.B AG
|
||||||
|
acceptor tends to be C/T [yes with
|
||||||
|
.BR --splice ].
|
||||||
|
This trend is evolutionarily conservative, all the way to S. cerevisiae
|
||||||
|
(PMID:18688272). Specifying this option generally leads to higher junction
|
||||||
|
accuracy by several percents, so it is applied by default with
|
||||||
|
.BR --splice .
|
||||||
|
However, the SIRV control does not honor this trend
|
||||||
|
(only ~60%). This option reduces accuracy. If you are benchmarking minimap2
|
||||||
|
on SIRV data, please add
|
||||||
|
.B --splice-flank=no
|
||||||
|
to the command line.
|
||||||
|
.TP
|
||||||
|
.BI --end-seed-pen \ INT
|
||||||
|
Drop a terminal anchor if
|
||||||
|
.IR s <log( g )+ INT ,
|
||||||
|
where
|
||||||
|
.I s
|
||||||
|
is the local alignment score around the anchor and
|
||||||
|
.I g
|
||||||
|
the length of the terminal gap in the chain. This option is only effective
|
||||||
|
with
|
||||||
|
.BR --splice .
|
||||||
|
It helps to avoid tiny terminal exons. [6]
|
||||||
.SS Input/output options
|
.SS Input/output options
|
||||||
.TP 10
|
.TP 10
|
||||||
.B -Q
|
|
||||||
Ignore base quality in the input file.
|
|
||||||
.TP
|
|
||||||
.B -a
|
.B -a
|
||||||
Generate CIGAR and output alignments in the SAM format. Minimap2 outputs in PAF
|
Generate CIGAR and output alignments in the SAM format. Minimap2 outputs in PAF
|
||||||
by default.
|
by default.
|
||||||
.TP
|
.TP
|
||||||
|
.B -Q
|
||||||
|
Ignore base quality in the input file.
|
||||||
|
.TP
|
||||||
|
.B -L
|
||||||
|
Write CIGAR with >65535 operators at the CG tag. Older tools are unable to
|
||||||
|
convert alignments with >65535 CIGAR ops to BAM. This option makes minimap2 SAM
|
||||||
|
compatible with older tools. Newer tools recognizes this tag and reconstruct
|
||||||
|
the real CIGAR in memory.
|
||||||
|
.TP
|
||||||
|
.BI -R \ STR
|
||||||
|
SAM read group line in a format like
|
||||||
|
.B @RG\\\\tID:foo\\\\tSM:bar
|
||||||
|
[].
|
||||||
|
.TP
|
||||||
.B -c
|
.B -c
|
||||||
Generate CIGAR. In PAF, the CIGAR is written to the `cg' custom tag.
|
Generate CIGAR. In PAF, the CIGAR is written to the `cg' custom tag.
|
||||||
.TP
|
.TP
|
||||||
|
.BI --cs[= STR ]
|
||||||
|
Output the
|
||||||
|
.B cs
|
||||||
|
tag.
|
||||||
|
.I STR
|
||||||
|
can be either
|
||||||
|
.I short
|
||||||
|
or
|
||||||
|
.IR long .
|
||||||
|
If no
|
||||||
|
.I STR
|
||||||
|
is given,
|
||||||
|
.I short
|
||||||
|
is assumed. [none]
|
||||||
|
.TP
|
||||||
|
.B -Y
|
||||||
|
In SAM output, use soft clipping for supplementary alignments.
|
||||||
|
.TP
|
||||||
|
.BI --seed \ INT
|
||||||
|
Integer seed for randomizing equally best hits. Minimap2 hashes
|
||||||
|
.I INT
|
||||||
|
and read name when choosing between equally best hits. [11]
|
||||||
|
.TP
|
||||||
.BI -t \ INT
|
.BI -t \ INT
|
||||||
Number of threads [3]. Minimap2 uses at most three threads when indexing target
|
Number of threads [3]. Minimap2 uses at most three threads when indexing target
|
||||||
sequences, and uses up to
|
sequences, and uses up to
|
||||||
@@ -220,21 +337,25 @@ sequences, and uses up to
|
|||||||
threads when mapping (the extra thread is for I/O, which is frequently idle and
|
threads when mapping (the extra thread is for I/O, which is frequently idle and
|
||||||
takes little CPU time).
|
takes little CPU time).
|
||||||
.TP
|
.TP
|
||||||
|
.B -2
|
||||||
|
Use two I/O threads during mapping. By default, minimap2 uses one I/O thread.
|
||||||
|
When I/O is slow (e.g. piping to gzip, or reading from a slow pipe), the I/O
|
||||||
|
thread may become the bottleneck. Apply this option to use one thread for input
|
||||||
|
and another thread for output, at the cost of increased peak RAM.
|
||||||
|
.TP
|
||||||
.BI -K \ NUM
|
.BI -K \ NUM
|
||||||
Number of bases loaded into memory to process in a mini-batch [200M].
|
Number of bases loaded into memory to process in a mini-batch [500M].
|
||||||
Similar to option
|
Similar to option
|
||||||
.BR -I ,
|
.BR -I ,
|
||||||
K/M/G/k/m/g suffix is accepted. A large
|
K/M/G/k/m/g suffix is accepted. A large
|
||||||
.I NUM
|
.I NUM
|
||||||
helps load balancing in the multi-threading mode, at the cost of increased
|
helps load balancing in the multi-threading mode, at the cost of increased
|
||||||
memory. Preset
|
memory.
|
||||||
.B ava-pb
|
|
||||||
and
|
|
||||||
.B ava-ont
|
|
||||||
use
|
|
||||||
.BR -K500m .
|
|
||||||
.TP
|
.TP
|
||||||
.B -V
|
.BR --secondary [= yes | no ]
|
||||||
|
Whether to output secondary alignments [yes]
|
||||||
|
.TP
|
||||||
|
.B --version
|
||||||
Print version number to stdout
|
Print version number to stdout
|
||||||
.SS Preset options
|
.SS Preset options
|
||||||
.TP 10
|
.TP 10
|
||||||
@@ -249,37 +370,66 @@ are:
|
|||||||
.RS
|
.RS
|
||||||
.TP 8
|
.TP 8
|
||||||
.B map-pb
|
.B map-pb
|
||||||
PacBio/Oxford Nanopore read to reference mapping (-Hk19)
|
PacBio/Oxford Nanopore read to reference mapping
|
||||||
.TP
|
.RB ( -Hk19 )
|
||||||
.B map10k
|
|
||||||
The same as
|
|
||||||
.B map-pb
|
|
||||||
(-Hk19)
|
|
||||||
.TP
|
.TP
|
||||||
.B map-ont
|
.B map-ont
|
||||||
Slightly more sensitive for Oxford Nanopore to reference mapping (-k15). For
|
Slightly more sensitive for Oxford Nanopore to reference mapping
|
||||||
PacBio reads, HPC minimizers consistently leads to faster performance and more
|
.RB ( -k15 ).
|
||||||
sensitive results in comparison to normal minimizers. For Oxford Nanopore data,
|
For PacBio reads, HPC minimizers consistently leads to faster performance and
|
||||||
normal minimizers are better, though not much. The effectiveness of HPC is
|
more sensitive results in comparison to normal minimizers. For Oxford Nanopore
|
||||||
determined by the sequencing error mode.
|
data, normal minimizers are better, though not much. The effectiveness of HPC
|
||||||
|
is determined by the sequencing error mode.
|
||||||
.TP
|
.TP
|
||||||
.B asm5
|
.B asm5
|
||||||
Long assembly to reference mapping (-k19 -w19 -A1 -B19 -O39,81 -E3,1 -s200 -z200).
|
Long assembly to reference mapping
|
||||||
|
.RB ( -k19
|
||||||
|
.B -w19 -A1 -B19 -O39,81 -E3,1 -s200
|
||||||
|
.BR -z200 ).
|
||||||
Typically, the alignment will not extend to regions with 5% or higher sequence
|
Typically, the alignment will not extend to regions with 5% or higher sequence
|
||||||
divergence. Only use this preset if the average divergence is far below 5%.
|
divergence. Only use this preset if the average divergence is far below 5%.
|
||||||
.TP
|
.TP
|
||||||
.B asm10
|
.B asm10
|
||||||
Long assembly to reference mapping (-k19 -w19 -A1 -B9 -O16,41 -E2,1 -s200 -z200). Up
|
Long assembly to reference mapping
|
||||||
to 10% sequence divergence.
|
.RB ( -k19
|
||||||
.TP 8
|
.B -w19 -A1 -B9 -O16,41 -E2,1 -s200
|
||||||
|
.BR -z200 ).
|
||||||
|
Up to 10% sequence divergence.
|
||||||
|
.TP
|
||||||
.B ava-pb
|
.B ava-pb
|
||||||
PacBio all-vs-all overlap mapping (-Hk19 -w5 -Xp0 -m100 -K500m -g10000 --max-chain-skip 25)
|
PacBio all-vs-all overlap mapping
|
||||||
.TP 8
|
.RB ( -Hk19
|
||||||
|
.B -w5 -Xp0 -m100 -g10000 --max-chain-skip
|
||||||
|
.BR 25 ).
|
||||||
|
.TP
|
||||||
.B ava-ont
|
.B ava-ont
|
||||||
Oxford Nanopore all-vs-all overlap mapping (-k15 -w5 -Xp0 -m100 -K500m -g10000
|
Oxford Nanopore all-vs-all overlap mapping
|
||||||
--max-chain-skip 25). Similarly, the major difference from
|
.RB ( -k15
|
||||||
|
.B -w5 -Xp0 -m100 -g10000 --max-chain-skip
|
||||||
|
.BR 25 ).
|
||||||
|
Similarly, the major difference from
|
||||||
.B ava-pb
|
.B ava-pb
|
||||||
is that this preset is not using HPC minimizers.
|
is that this preset is not using HPC minimizers.
|
||||||
|
.TP
|
||||||
|
.B splice
|
||||||
|
Long-read spliced alignment
|
||||||
|
.RB ( -k15
|
||||||
|
.B -w5 --splice -g2000 -G200k -A1 -B2 -O2,32 -E1,0 -C9 -z200 -ub
|
||||||
|
.BR --splice-flank=yes ).
|
||||||
|
In the splice mode, 1) long deletions are taken as introns and represented as
|
||||||
|
the
|
||||||
|
.RB ` N '
|
||||||
|
CIGAR operator; 2) long insertions are disabled; 3) deletion and insertion gap
|
||||||
|
costs are different during chaining; 4) the computation of the
|
||||||
|
.RB ` ms '
|
||||||
|
tag ignores introns to demote hits to pseudogenes.
|
||||||
|
.TP
|
||||||
|
.B sr
|
||||||
|
Short single-end reads without splicing
|
||||||
|
.RB ( -k21
|
||||||
|
.B -w11 --sr --frag -A2 -B8 -O12,32 -E2,1 -r50 -p.5 -N20 -f1000,5000 -n2 -m20
|
||||||
|
.B -s40 -g200 -2K50m
|
||||||
|
.BR --secondary=no ).
|
||||||
.RE
|
.RE
|
||||||
.SS Miscellaneous options
|
.SS Miscellaneous options
|
||||||
.TP 10
|
.TP 10
|
||||||
@@ -292,7 +442,7 @@ multi-threading mode.
|
|||||||
.B --print-qname
|
.B --print-qname
|
||||||
Print query names to stderr, mostly to see which query is crashing minimap2.
|
Print query names to stderr, mostly to see which query is crashing minimap2.
|
||||||
.TP
|
.TP
|
||||||
.B --print-seed
|
.B --print-seeds
|
||||||
Print seed positions to stderr, for debugging only.
|
Print seed positions to stderr, for debugging only.
|
||||||
.SH OUTPUT FORMAT
|
.SH OUTPUT FORMAT
|
||||||
.PP
|
.PP
|
||||||
@@ -331,6 +481,7 @@ cb | cb | cb
|
|||||||
r | c | l .
|
r | c | l .
|
||||||
Tag Type Description
|
Tag Type Description
|
||||||
_
|
_
|
||||||
|
tp A Type of aln: P/primary, S/secondary and I,i/inversion
|
||||||
cm i Number of minimizers on the chain
|
cm i Number of minimizers on the chain
|
||||||
s1 i Chaining score
|
s1 i Chaining score
|
||||||
s2 i Chaining score of the best secondary chain
|
s2 i Chaining score of the best secondary chain
|
||||||
@@ -338,22 +489,37 @@ NM i Total number of mismatches and gaps in the alignment
|
|||||||
AS i DP alignment score
|
AS i DP alignment score
|
||||||
ms i DP score of the max scoring segment in the alignment
|
ms i DP score of the max scoring segment in the alignment
|
||||||
nn i Number of ambiguous bases in the alignment
|
nn i Number of ambiguous bases in the alignment
|
||||||
|
ts A Transcript strand (splice mode only)
|
||||||
cg Z CIGAR string (only in PAF)
|
cg Z CIGAR string (only in PAF)
|
||||||
|
cs Z Difference string
|
||||||
|
.TE
|
||||||
|
|
||||||
|
.PP
|
||||||
|
The
|
||||||
|
.B cs
|
||||||
|
tag encodes difference sequences in the short form or the entire query
|
||||||
|
.I AND
|
||||||
|
reference sequences in the long form. It consists of a series of operations:
|
||||||
|
.TS
|
||||||
|
center box;
|
||||||
|
cb | cb |cb
|
||||||
|
r | l | l .
|
||||||
|
Op Regex Description
|
||||||
|
_
|
||||||
|
= [ACGTN]+ Identical sequence (long form)
|
||||||
|
: [0-9]+ Identical sequence length
|
||||||
|
* [acgtn][acgtn] Substitution: ref to query
|
||||||
|
+ [acgtn]+ Insertion to the reference
|
||||||
|
- [acgtn]+ Deletion from the reference
|
||||||
|
~ [acgtn]{2}[0-9]+[acgtn]{2} Intron length and splice signal
|
||||||
.TE
|
.TE
|
||||||
|
|
||||||
.SH LIMITATIONS
|
.SH LIMITATIONS
|
||||||
.TP 2
|
.TP 2
|
||||||
*
|
*
|
||||||
At the alignment phase, minimap2 performs global alignments between minimizer
|
Minimap2 may produce suboptimal alignments through long low-complexity regions
|
||||||
hits. If the positions of these minimizer hits are incorrect, the final
|
where seed positions may be suboptimal. This should not be a big concern
|
||||||
alignment may be suboptimal or unnecessarily fragmented.
|
because even the optimal alignment may be wrong in such regions.
|
||||||
.TP
|
|
||||||
*
|
|
||||||
Minimap2 may produce poor alignments that may need post-filtering. We are still
|
|
||||||
exploring a reliable and consistent way to report good alignments.
|
|
||||||
.TP
|
|
||||||
*
|
|
||||||
Minimap2 does not work well with Illumina short reads as of now.
|
|
||||||
.TP
|
.TP
|
||||||
*
|
*
|
||||||
Minimap2 requires SSE2 instructions to compile. It is possible to add
|
Minimap2 requires SSE2 instructions to compile. It is possible to add
|
||||||
|
|||||||
@@ -1,19 +1,104 @@
|
|||||||
#include <sys/resource.h>
|
|
||||||
#include <sys/time.h>
|
|
||||||
#include "minimap.h"
|
#include "minimap.h"
|
||||||
|
|
||||||
int mm_verbose = 3;
|
int mm_verbose = 1;
|
||||||
int mm_dbg_flag = 0;
|
int mm_dbg_flag = 0;
|
||||||
double mm_realtime0;
|
double mm_realtime0;
|
||||||
|
|
||||||
|
#if defined(WIN32) || defined(_WIN32)
|
||||||
|
#include <windows.h>
|
||||||
|
|
||||||
|
struct timezone
|
||||||
|
{
|
||||||
|
__int32 tz_minuteswest; /* minutes W of Greenwich */
|
||||||
|
int tz_dsttime; /* type of dst correction */
|
||||||
|
};
|
||||||
|
|
||||||
|
/*
|
||||||
|
* gettimeofday.c
|
||||||
|
* Win32 gettimeofday() replacement
|
||||||
|
* taken from PostgreSQL, according to
|
||||||
|
* https://stackoverflow.com/questions/1676036/what-should-i-use-to-replace-gettimeofday-on-windows
|
||||||
|
*
|
||||||
|
* src/port/gettimeofday.c
|
||||||
|
*
|
||||||
|
* Copyright (c) 2003 SRA, Inc.
|
||||||
|
* Copyright (c) 2003 SKC, Inc.
|
||||||
|
*
|
||||||
|
* Permission to use, copy, modify, and distribute this software and
|
||||||
|
* its documentation for any purpose, without fee, and without a
|
||||||
|
* written agreement is hereby granted, provided that the above
|
||||||
|
* copyright notice and this paragraph and the following two
|
||||||
|
* paragraphs appear in all copies.
|
||||||
|
*
|
||||||
|
* IN NO EVENT SHALL THE AUTHOR BE LIABLE TO ANY PARTY FOR DIRECT,
|
||||||
|
* INDIRECT, SPECIAL, INCIDENTAL, OR CONSEQUENTIAL DAMAGES, INCLUDING
|
||||||
|
* LOST PROFITS, ARISING OUT OF THE USE OF THIS SOFTWARE AND ITS
|
||||||
|
* DOCUMENTATION, EVEN IF THE UNIVERSITY OF CALIFORNIA HAS BEEN ADVISED
|
||||||
|
* OF THE POSSIBILITY OF SUCH DAMAGE.
|
||||||
|
*
|
||||||
|
* THE AUTHOR SPECIFICALLY DISCLAIMS ANY WARRANTIES, INCLUDING, BUT NOT
|
||||||
|
* LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR
|
||||||
|
* A PARTICULAR PURPOSE. THE SOFTWARE PROVIDED HEREUNDER IS ON AN "AS
|
||||||
|
* IS" BASIS, AND THE AUTHOR HAS NO OBLIGATIONS TO PROVIDE MAINTENANCE,
|
||||||
|
* SUPPORT, UPDATES, ENHANCEMENTS, OR MODIFICATIONS.
|
||||||
|
*/
|
||||||
|
|
||||||
|
/* FILETIME of Jan 1 1970 00:00:00. */
|
||||||
|
static const unsigned __int64 epoch = ((unsigned __int64) 116444736000000000ULL);
|
||||||
|
|
||||||
|
/*
|
||||||
|
* timezone information is stored outside the kernel so tzp isn't used anymore.
|
||||||
|
*
|
||||||
|
* Note: this function is not for Win32 high precision timing purpose. See
|
||||||
|
* elapsed_time().
|
||||||
|
*/
|
||||||
|
int gettimeofday(struct timeval * tp, struct timezone *tzp)
|
||||||
|
{
|
||||||
|
FILETIME file_time;
|
||||||
|
SYSTEMTIME system_time;
|
||||||
|
ULARGE_INTEGER ularge;
|
||||||
|
|
||||||
|
GetSystemTime(&system_time);
|
||||||
|
SystemTimeToFileTime(&system_time, &file_time);
|
||||||
|
ularge.LowPart = file_time.dwLowDateTime;
|
||||||
|
ularge.HighPart = file_time.dwHighDateTime;
|
||||||
|
|
||||||
|
tp->tv_sec = (long) ((ularge.QuadPart - epoch) / 10000000L);
|
||||||
|
tp->tv_usec = (long) (system_time.wMilliseconds * 1000);
|
||||||
|
|
||||||
|
return 0;
|
||||||
|
}
|
||||||
|
|
||||||
|
// taken from https://stackoverflow.com/questions/5272470/c-get-cpu-usage-on-linux-and-windows
|
||||||
double cputime()
|
double cputime()
|
||||||
|
{
|
||||||
|
HANDLE hProcess = GetCurrentProcess();
|
||||||
|
FILETIME ftCreation, ftExit, ftKernel, ftUser;
|
||||||
|
SYSTEMTIME stKernel;
|
||||||
|
SYSTEMTIME stUser;
|
||||||
|
|
||||||
|
GetProcessTimes(hProcess, &ftCreation, &ftExit, &ftKernel, &ftUser);
|
||||||
|
FileTimeToSystemTime(&ftKernel, &stKernel);
|
||||||
|
FileTimeToSystemTime(&ftUser, &stUser);
|
||||||
|
|
||||||
|
double kernelModeTime = ((stKernel.wHour * 60.) + stKernel.wMinute * 60.) + stKernel.wSecond * 1. + stKernel.wMilliseconds / 1000.;
|
||||||
|
double userModeTime = ((stUser.wHour * 60.) + stUser.wMinute * 60.) + stUser.wSecond * 1. + stUser.wMilliseconds / 1000.;
|
||||||
|
|
||||||
|
return kernelModeTime + userModeTime;
|
||||||
|
}
|
||||||
|
#else
|
||||||
|
#include <sys/resource.h>
|
||||||
|
#include <sys/time.h>
|
||||||
|
|
||||||
|
double cputime(void)
|
||||||
{
|
{
|
||||||
struct rusage r;
|
struct rusage r;
|
||||||
getrusage(RUSAGE_SELF, &r);
|
getrusage(RUSAGE_SELF, &r);
|
||||||
return r.ru_utime.tv_sec + r.ru_stime.tv_sec + 1e-6 * (r.ru_utime.tv_usec + r.ru_stime.tv_usec);
|
return r.ru_utime.tv_sec + r.ru_stime.tv_sec + 1e-6 * (r.ru_utime.tv_usec + r.ru_stime.tv_usec);
|
||||||
}
|
}
|
||||||
|
#endif /* WIN32 || _WIN32 */
|
||||||
|
|
||||||
double realtime()
|
double realtime(void)
|
||||||
{
|
{
|
||||||
struct timeval tp;
|
struct timeval tp;
|
||||||
struct timezone tzp;
|
struct timezone tzp;
|
||||||
|
|||||||
@@ -0,0 +1,28 @@
|
|||||||
|
The [K8 Javascript shell][k8] is needed to run Javascripts in this directory.
|
||||||
|
Precompiled k8 binaries for Mac and Linux can be found at the [K8 release
|
||||||
|
page][k8bin].
|
||||||
|
|
||||||
|
* [paf2aln.js](paf2aln.js): convert PAF to [MAF][maf] or BLAST-like output for
|
||||||
|
eyeballing. PAF has to be generated with minimap2 option `-S`, which writes
|
||||||
|
the aligned sequences to the `cs` tag. An example:
|
||||||
|
```sh
|
||||||
|
../minimap2 -S ../test/MT-*.fa | k8 paf2aln.js /dev/stdin
|
||||||
|
```
|
||||||
|
|
||||||
|
* [mapstat.js](mapstat.js): output basic statistics such as the number of
|
||||||
|
non-redundant mapped bases, number of split and secondary alignments and
|
||||||
|
number of long gaps. This scripts seamlessly works with both SAM and PAF.
|
||||||
|
|
||||||
|
* [sim-pbsim.js](sim-pbsim.js): convert reads simulated with [PBSIM][pbsim] to
|
||||||
|
FASTA and encode the true mapping positions to read names in a format like
|
||||||
|
`S1_33!chr1!225258409!225267761!-`.
|
||||||
|
|
||||||
|
* [sim-eval.js](sim-eval.js): evaluate mapping accuracy for FASTA generated
|
||||||
|
with [sim-pbsim.js](sim-pbsim.js) or [sim-mason2.js](sim-mason2.js).
|
||||||
|
|
||||||
|
* [sam2paf.js](sam2paf.js): convert SAM to PAF.
|
||||||
|
|
||||||
|
[k8]: https://github.com/attractivechaos/k8
|
||||||
|
[k8bin]: https://github.com/attractivechaos/k8/releases
|
||||||
|
[maf]: https://genome.ucsc.edu/FAQ/FAQformat#format5
|
||||||
|
[pbsim]: https://github.com/pfaucon/PBSIM-PacBio-Simulator
|
||||||
@@ -0,0 +1,258 @@
|
|||||||
|
/*******************************
|
||||||
|
* Command line option parsing *
|
||||||
|
*******************************/
|
||||||
|
|
||||||
|
var getopt = function(args, ostr) {
|
||||||
|
var oli; // option letter list index
|
||||||
|
if (typeof(getopt.place) == 'undefined')
|
||||||
|
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
|
||||||
|
if (getopt.place == -1) { // update scanning pointer
|
||||||
|
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
|
||||||
|
getopt.place = -1;
|
||||||
|
return null;
|
||||||
|
}
|
||||||
|
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
|
||||||
|
++getopt.ind;
|
||||||
|
getopt.place = -1;
|
||||||
|
return null;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
|
||||||
|
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
|
||||||
|
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
|
||||||
|
if (getopt.place < 0) ++getopt.ind;
|
||||||
|
return '?';
|
||||||
|
}
|
||||||
|
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
|
||||||
|
getopt.arg = null;
|
||||||
|
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
|
||||||
|
} else { // need an argument
|
||||||
|
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
|
||||||
|
getopt.arg = args[getopt.ind].substr(getopt.place);
|
||||||
|
else if (args.length <= ++getopt.ind) { // no arg
|
||||||
|
getopt.place = -1;
|
||||||
|
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
|
||||||
|
return '?';
|
||||||
|
} else getopt.arg = args[getopt.ind]; // white space
|
||||||
|
getopt.place = -1;
|
||||||
|
++getopt.ind;
|
||||||
|
}
|
||||||
|
return optopt;
|
||||||
|
}
|
||||||
|
|
||||||
|
/***********************
|
||||||
|
* Interval operations *
|
||||||
|
***********************/
|
||||||
|
|
||||||
|
Interval = {};
|
||||||
|
|
||||||
|
Interval.sort = function(a)
|
||||||
|
{
|
||||||
|
if (typeof a[0] == 'number')
|
||||||
|
a.sort(function(x, y) { return x - y });
|
||||||
|
else a.sort(function(x, y) { return x[0] != y[0]? x[0] - y[0] : x[1] - y[1] });
|
||||||
|
}
|
||||||
|
|
||||||
|
Interval.merge = function(a, sorted)
|
||||||
|
{
|
||||||
|
if (typeof sorted == 'undefined') sorted = true;
|
||||||
|
if (!sorted) Interval.sort(a);
|
||||||
|
var k = 0;
|
||||||
|
for (var i = 1; i < a.length; ++i) {
|
||||||
|
if (a[k][1] >= a[i][0])
|
||||||
|
a[k][1] = a[k][1] > a[i][1]? a[k][1] : a[i][1];
|
||||||
|
else a[++k] = a[i].slice(0);
|
||||||
|
}
|
||||||
|
a.length = k + 1;
|
||||||
|
}
|
||||||
|
|
||||||
|
Interval.dedup = function(a, sorted)
|
||||||
|
{
|
||||||
|
if (typeof sorted == 'undefined') sorted = true;
|
||||||
|
if (!sorted) Interval.sort(a);
|
||||||
|
var k = 0;
|
||||||
|
for (var i = 1; i < a.length; ++i)
|
||||||
|
if (a[k][0] != a[i][0] || a[k][1] != a[i][1])
|
||||||
|
a[++k] = a[i].slice(0);
|
||||||
|
a.length = k + 1;
|
||||||
|
}
|
||||||
|
|
||||||
|
Interval.index_end = function(a, sorted)
|
||||||
|
{
|
||||||
|
if (a.length == 0) return;
|
||||||
|
if (typeof sorted == 'undefined') sorted = true;
|
||||||
|
if (!sorted) Interval.sort(a);
|
||||||
|
a[0].push(0);
|
||||||
|
var k = 0, k_en = a[0][1];
|
||||||
|
for (var i = 1; i < a.length; ++i) {
|
||||||
|
if (k_en <= a[i][0]) {
|
||||||
|
for (++k; k < i; ++k)
|
||||||
|
if (a[k][1] > a[i][0])
|
||||||
|
break;
|
||||||
|
k_en = a[k][1];
|
||||||
|
}
|
||||||
|
a[i].push(k);
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
Interval.find_intv = function(a, x)
|
||||||
|
{
|
||||||
|
var left = -1, right = a.length;
|
||||||
|
if (typeof a[0] == 'number') {
|
||||||
|
while (right - left > 1) {
|
||||||
|
var mid = left + ((right - left) >> 1);
|
||||||
|
if (a[mid] > x) right = mid;
|
||||||
|
else if (a[mid] < x) left = mid;
|
||||||
|
else return mid;
|
||||||
|
}
|
||||||
|
} else {
|
||||||
|
while (right - left > 1) {
|
||||||
|
var mid = left + ((right - left) >> 1);
|
||||||
|
if (a[mid][0] > x) right = mid;
|
||||||
|
else if (a[mid][0] < x) left = mid;
|
||||||
|
else return mid;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return left;
|
||||||
|
}
|
||||||
|
|
||||||
|
Interval.find_ovlp = function(a, st, en)
|
||||||
|
{
|
||||||
|
if (a.length == 0 || st >= en) return [];
|
||||||
|
var l = Interval.find_intv(a, st);
|
||||||
|
var k = l < 0? 0 : a[l][a[l].length - 1];
|
||||||
|
var b = [];
|
||||||
|
for (var i = k; i < a.length; ++i) {
|
||||||
|
if (a[i][0] >= en) break;
|
||||||
|
else if (st < a[i][1])
|
||||||
|
b.push(a[i]);
|
||||||
|
}
|
||||||
|
return b;
|
||||||
|
}
|
||||||
|
|
||||||
|
/*****************
|
||||||
|
* Main function *
|
||||||
|
*****************/
|
||||||
|
|
||||||
|
function read_bed(fn, to_merge, to_dedup)
|
||||||
|
{
|
||||||
|
var file = new File(fn);
|
||||||
|
var buf = new Bytes();
|
||||||
|
var h = {};
|
||||||
|
while (file.readline(buf) >= 0) {
|
||||||
|
var t = buf.toString().split("\t");
|
||||||
|
if (h[t[0]] == null)
|
||||||
|
h[t[0]] = [];
|
||||||
|
var bst = parseInt(t[1]);
|
||||||
|
var ben = parseInt(t[2]);
|
||||||
|
if (t.length >= 12 && /^\d+$/.test(t[9])) {
|
||||||
|
t[9] = parseInt(t[9]);
|
||||||
|
var sz = t[10].split(",");
|
||||||
|
var st = t[11].split(",");
|
||||||
|
for (var i = 0; i < t[9]; ++i) {
|
||||||
|
st[i] = parseInt(st[i]);
|
||||||
|
sz[i] = parseInt(sz[i]);
|
||||||
|
h[t[0]].push([bst + st[i], bst + st[i] + sz[i], 0, 0, 0]);
|
||||||
|
}
|
||||||
|
} else {
|
||||||
|
h[t[0]].push([bst, ben, 0, 0, 0]);
|
||||||
|
}
|
||||||
|
}
|
||||||
|
buf.destroy();
|
||||||
|
file.close();
|
||||||
|
for (var chr in h) {
|
||||||
|
if (to_merge) Interval.merge(h[chr], false);
|
||||||
|
else if (to_dedup) Interval.dedup(h[chr], false);
|
||||||
|
else Interval.sort(h[chr]);
|
||||||
|
Interval.index_end(h[chr]);
|
||||||
|
}
|
||||||
|
return h;
|
||||||
|
}
|
||||||
|
|
||||||
|
function main(args)
|
||||||
|
{
|
||||||
|
var c, print_len = false, to_merge = true, to_dedup = false, fn_excl = null;
|
||||||
|
while ((c = getopt(args, "pde:")) != null) {
|
||||||
|
if (c == 'p') print_len = true;
|
||||||
|
else if (c == 'd') to_dedup = true, to_merge = false;
|
||||||
|
else if (c == 'e') fn_excl = getopt.arg;
|
||||||
|
}
|
||||||
|
|
||||||
|
if (args.length - getopt.ind < 2) {
|
||||||
|
print("Usage: k8 cnt-feat.js [options] <target.bed> <feature.bed>");
|
||||||
|
print("Options:");
|
||||||
|
print(" -e FILE exclude features overlapping regions in BED FILE []");
|
||||||
|
print(" -p print number of covered bases for each feature");
|
||||||
|
exit(1);
|
||||||
|
}
|
||||||
|
|
||||||
|
var excl = fn_excl != null? read_bed(fn_excl, true, false) : null;
|
||||||
|
var target = read_bed(args[getopt.ind], to_merge, to_dedup);
|
||||||
|
|
||||||
|
var file, buf = new Bytes();
|
||||||
|
var tot_len = 0, hit_len = 0;
|
||||||
|
file = args[getopt.ind+1] != '-'? new File(args[getopt.ind+1]) : new File();
|
||||||
|
while (file.readline(buf) >= 0) {
|
||||||
|
var t = buf.toString().split("\t");
|
||||||
|
var a = [];
|
||||||
|
var bst = parseInt(t[1]);
|
||||||
|
var ben = parseInt(t[2]);
|
||||||
|
if (t.length >= 12 && /^\d+$/.test(t[9])) { // BED12
|
||||||
|
t[9] = parseInt(t[9]);
|
||||||
|
var sz = t[10].split(",");
|
||||||
|
var st = t[11].split(",");
|
||||||
|
for (var i = 0; i < t[9]; ++i) {
|
||||||
|
st[i] = parseInt(st[i]);
|
||||||
|
sz[i] = parseInt(sz[i]);
|
||||||
|
a.push([bst + st[i], bst + st[i] + sz[i], false]);
|
||||||
|
}
|
||||||
|
} else a.push([bst, ben, false]); // 3-column BED
|
||||||
|
var feat_len = 0;
|
||||||
|
for (var i = 0; i < a.length; ++i) {
|
||||||
|
if (excl != null && excl[t[0]] != null) {
|
||||||
|
var oe = Interval.find_ovlp(excl[t[0]], a[i][0], a[i][1]);
|
||||||
|
if (oe.length > 0)
|
||||||
|
continue;
|
||||||
|
}
|
||||||
|
a[i][2] = true;
|
||||||
|
feat_len += a[i][1] - a[i][0];
|
||||||
|
}
|
||||||
|
tot_len += feat_len;
|
||||||
|
if (target[t[0]] == null) continue;
|
||||||
|
var b = [];
|
||||||
|
for (var i = 0; i < a.length; ++i) {
|
||||||
|
if (!a[i][2]) continue;
|
||||||
|
var o = Interval.find_ovlp(target[t[0]], a[i][0], a[i][1]);
|
||||||
|
for (var j = 0; j < o.length; ++j) {
|
||||||
|
var max_st = o[j][0] > a[i][0]? o[j][0] : a[i][0];
|
||||||
|
var min_en = o[j][1] < a[i][1]? o[j][1] : a[i][1];
|
||||||
|
b.push([max_st, min_en]);
|
||||||
|
o[j][2] += min_en - max_st;
|
||||||
|
++o[j][3];
|
||||||
|
if (max_st == o[j][0] && min_en == o[j][1])
|
||||||
|
++o[j][4];
|
||||||
|
}
|
||||||
|
}
|
||||||
|
// find the length covered
|
||||||
|
var feat_hit_len = 0;
|
||||||
|
if (b.length > 0) {
|
||||||
|
b.sort(function(a,b) {return a[0]-b[0]});
|
||||||
|
var st = b[0][0], en = b[0][1];
|
||||||
|
for (var i = 1; i < b.length; ++i) {
|
||||||
|
if (b[i][0] <= en) en = en > b[i][1]? en : b[i][1];
|
||||||
|
else feat_hit_len += en - st, st = b[i][0], en = b[i][1];
|
||||||
|
}
|
||||||
|
feat_hit_len += en - st;
|
||||||
|
}
|
||||||
|
hit_len += feat_hit_len;
|
||||||
|
if (print_len) print('F', t.slice(0, 4).join("\t"), feat_len, feat_hit_len);
|
||||||
|
}
|
||||||
|
file.close();
|
||||||
|
|
||||||
|
buf.destroy();
|
||||||
|
|
||||||
|
warn("# feature bases: " + tot_len);
|
||||||
|
warn("# feature bases overlapping targets: " + hit_len + ' (' + (100.0 * hit_len / tot_len).toFixed(2) + '%)');
|
||||||
|
}
|
||||||
|
|
||||||
|
main(arguments);
|
||||||
+150
@@ -0,0 +1,150 @@
|
|||||||
|
var getopt = function(args, ostr) {
|
||||||
|
var oli; // option letter list index
|
||||||
|
if (typeof(getopt.place) == 'undefined')
|
||||||
|
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
|
||||||
|
if (getopt.place == -1) { // update scanning pointer
|
||||||
|
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
|
||||||
|
getopt.place = -1;
|
||||||
|
return null;
|
||||||
|
}
|
||||||
|
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
|
||||||
|
++getopt.ind;
|
||||||
|
getopt.place = -1;
|
||||||
|
return null;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
|
||||||
|
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
|
||||||
|
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
|
||||||
|
if (getopt.place < 0) ++getopt.ind;
|
||||||
|
return '?';
|
||||||
|
}
|
||||||
|
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
|
||||||
|
getopt.arg = null;
|
||||||
|
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
|
||||||
|
} else { // need an argument
|
||||||
|
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
|
||||||
|
getopt.arg = args[getopt.ind].substr(getopt.place);
|
||||||
|
else if (args.length <= ++getopt.ind) { // no arg
|
||||||
|
getopt.place = -1;
|
||||||
|
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
|
||||||
|
return '?';
|
||||||
|
} else getopt.arg = args[getopt.ind]; // white space
|
||||||
|
getopt.place = -1;
|
||||||
|
++getopt.ind;
|
||||||
|
}
|
||||||
|
return optopt;
|
||||||
|
}
|
||||||
|
|
||||||
|
var c, fn_ucsc_fai = null, is_short = false;
|
||||||
|
while ((c = getopt(arguments, "u:s")) != null) {
|
||||||
|
if (c == 'u') fn_ucsc_fai = getopt.arg;
|
||||||
|
else if (c == 's') is_short = true;
|
||||||
|
}
|
||||||
|
|
||||||
|
if (getopt.ind == arguments.length) {
|
||||||
|
print("Usage: k8 gff2bed.js [-u ucsc-genome.fa.fai] <in.gff>");
|
||||||
|
exit(1);
|
||||||
|
}
|
||||||
|
|
||||||
|
var ens2ucsc = {};
|
||||||
|
if (fn_ucsc_fai != null) {
|
||||||
|
var buf = new Bytes();
|
||||||
|
var file = new File(fn_ucsc_fai);
|
||||||
|
while (file.readline(buf) >= 0) {
|
||||||
|
var t = buf.toString().split("\t");
|
||||||
|
var s = t[0];
|
||||||
|
if (/_(random|alt|decoy)$/.test(s)) {
|
||||||
|
s = s.replace(/_(random|alt|decoy)$/, '');
|
||||||
|
s = s.replace(/^chr\S+_/, '');
|
||||||
|
} else {
|
||||||
|
s = s.replace(/^chrUn_/, '');
|
||||||
|
}
|
||||||
|
s = s.replace(/v(\d+)/, ".$1");
|
||||||
|
if (s != t[0]) ens2ucsc[s] = t[0];
|
||||||
|
}
|
||||||
|
file.close();
|
||||||
|
buf.destroy();
|
||||||
|
}
|
||||||
|
|
||||||
|
var colors = {
|
||||||
|
'protein_coding':'0,128,255',
|
||||||
|
'lincRNA':'0,192,0',
|
||||||
|
'snRNA':'0,192,0',
|
||||||
|
'miRNA':'0,192,0',
|
||||||
|
'misc_RNA':'0,192,0'
|
||||||
|
};
|
||||||
|
|
||||||
|
function print_bed12(exons, cds_st, cds_en, is_short)
|
||||||
|
{
|
||||||
|
if (exons.length == 0) return;
|
||||||
|
var name = is_short? exons[0][7] + "|" + exons[0][5] : exons[0].slice(4, 7).join("|");
|
||||||
|
var a = exons.sort(function(a,b) {return a[1]-b[1]});
|
||||||
|
var sizes = [], starts = [], st, en;
|
||||||
|
st = a[0][1];
|
||||||
|
en = a[a.length - 1][2];
|
||||||
|
if (cds_st == 1<<30) cds_st = st;
|
||||||
|
if (cds_en == 0) cds_en = en;
|
||||||
|
if (cds_st < st || cds_en > en)
|
||||||
|
throw Error("inconsistent thick start or end for transcript " + a[0][4]);
|
||||||
|
for (var i = 0; i < a.length; ++i) {
|
||||||
|
sizes.push(a[i][2] - a[i][1]);
|
||||||
|
starts.push(a[i][1] - st);
|
||||||
|
}
|
||||||
|
var color = colors[a[0][5]];
|
||||||
|
if (color == null) color = '196,196,196';
|
||||||
|
print(a[0][0], st, en, name, 1000, a[0][3], cds_st, cds_en, color, a.length, sizes.join(",") + ",", starts.join(",") + ",");
|
||||||
|
}
|
||||||
|
|
||||||
|
var re_gtf = /(transcript_id|transcript_type|transcript_biotype|gene_name|transcript_name) "([^"]+)";/g;
|
||||||
|
var re_gff3 = /(transcript_id|transcript_type|transcript_biotype|gene_name|transcript_name)=([^;]+)/g;
|
||||||
|
var buf = new Bytes();
|
||||||
|
var file = new File(arguments[getopt.ind]);
|
||||||
|
|
||||||
|
var exons = [], cds_st = 1<<30, cds_en = 0, last_id = null;
|
||||||
|
while (file.readline(buf) >= 0) {
|
||||||
|
var t = buf.toString().split("\t");
|
||||||
|
if (t[0].charAt(0) == '#') continue;
|
||||||
|
if (t[2] != "CDS" && t[2] != "exon") continue;
|
||||||
|
t[3] = parseInt(t[3]) - 1;
|
||||||
|
t[4] = parseInt(t[4]);
|
||||||
|
var id = null, type = "", gname = "N/A", biotype = "", m, tname = "N/A";
|
||||||
|
while ((m = re_gtf.exec(t[8])) != null) {
|
||||||
|
if (m[1] == "transcript_id") id = m[2];
|
||||||
|
else if (m[1] == "transcript_type") type = m[2];
|
||||||
|
else if (m[1] == "transcript_biotype") biotype = m[2];
|
||||||
|
else if (m[1] == "gene_name") name = m[2];
|
||||||
|
else if (m[1] == "transcript_name") tname = m[2];
|
||||||
|
}
|
||||||
|
while ((m = re_gff3.exec(t[8])) != null) {
|
||||||
|
if (m[1] == "transcript_id") id = m[2];
|
||||||
|
else if (m[1] == "transcript_type") type = m[2];
|
||||||
|
else if (m[1] == "transcript_biotype") biotype = m[2];
|
||||||
|
else if (m[1] == "gene_name") name = m[2];
|
||||||
|
else if (m[1] == "transcript_name") tname = m[2];
|
||||||
|
}
|
||||||
|
if (type == "" && biotype != "") type = biotype;
|
||||||
|
if (id == null) throw Error("No transcript_id");
|
||||||
|
if (id != last_id) {
|
||||||
|
print_bed12(exons, cds_st, cds_en, is_short);
|
||||||
|
exons = [], cds_st = 1<<30, cds_en = 0;
|
||||||
|
last_id = id;
|
||||||
|
}
|
||||||
|
if (t[2] == "CDS") {
|
||||||
|
cds_st = cds_st < t[3]? cds_st : t[3];
|
||||||
|
cds_en = cds_en > t[4]? cds_en : t[4];
|
||||||
|
} else if (t[2] == "exon") {
|
||||||
|
if (fn_ucsc_fai != null) {
|
||||||
|
if (ens2ucsc[t[0]] != null)
|
||||||
|
t[0] = ens2ucsc[t[0]];
|
||||||
|
else if (/^[A-Z]+\d+\.\d+$/.test(t[0]))
|
||||||
|
t[0] = t[0].replace(/([A-Z]+\d+)\.(\d+)/, "chrUn_$1v$2");
|
||||||
|
}
|
||||||
|
exons.push([t[0], t[3], t[4], t[6], id, type, name, tname]);
|
||||||
|
}
|
||||||
|
}
|
||||||
|
if (last_id != null)
|
||||||
|
print_bed12(exons, cds_st, cds_en, is_short);
|
||||||
|
|
||||||
|
file.close();
|
||||||
|
buf.destroy();
|
||||||
@@ -0,0 +1,267 @@
|
|||||||
|
/*******************************
|
||||||
|
* Command line option parsing *
|
||||||
|
*******************************/
|
||||||
|
|
||||||
|
var getopt = function(args, ostr) {
|
||||||
|
var oli; // option letter list index
|
||||||
|
if (typeof(getopt.place) == 'undefined')
|
||||||
|
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
|
||||||
|
if (getopt.place == -1) { // update scanning pointer
|
||||||
|
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
|
||||||
|
getopt.place = -1;
|
||||||
|
return null;
|
||||||
|
}
|
||||||
|
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
|
||||||
|
++getopt.ind;
|
||||||
|
getopt.place = -1;
|
||||||
|
return null;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
|
||||||
|
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
|
||||||
|
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
|
||||||
|
if (getopt.place < 0) ++getopt.ind;
|
||||||
|
return '?';
|
||||||
|
}
|
||||||
|
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
|
||||||
|
getopt.arg = null;
|
||||||
|
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
|
||||||
|
} else { // need an argument
|
||||||
|
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
|
||||||
|
getopt.arg = args[getopt.ind].substr(getopt.place);
|
||||||
|
else if (args.length <= ++getopt.ind) { // no arg
|
||||||
|
getopt.place = -1;
|
||||||
|
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
|
||||||
|
return '?';
|
||||||
|
} else getopt.arg = args[getopt.ind]; // white space
|
||||||
|
getopt.place = -1;
|
||||||
|
++getopt.ind;
|
||||||
|
}
|
||||||
|
return optopt;
|
||||||
|
}
|
||||||
|
|
||||||
|
/***********************
|
||||||
|
* Interval operations *
|
||||||
|
***********************/
|
||||||
|
|
||||||
|
Interval = {};
|
||||||
|
|
||||||
|
Interval.sort = function(a)
|
||||||
|
{
|
||||||
|
if (typeof a[0] == 'number')
|
||||||
|
a.sort(function(x, y) { return x - y });
|
||||||
|
else a.sort(function(x, y) { return x[0] != y[0]? x[0] - y[0] : x[1] - y[1] });
|
||||||
|
}
|
||||||
|
|
||||||
|
Interval.merge = function(a, sorted)
|
||||||
|
{
|
||||||
|
if (typeof sorted == 'undefined') sorted = true;
|
||||||
|
if (!sorted) Interval.sort(a);
|
||||||
|
var k = 0;
|
||||||
|
for (var i = 1; i < a.length; ++i) {
|
||||||
|
if (a[k][1] >= a[i][0])
|
||||||
|
a[k][1] = a[k][1] > a[i][1]? a[k][1] : a[i][1];
|
||||||
|
else a[++k] = a[i].slice(0);
|
||||||
|
}
|
||||||
|
a.length = k + 1;
|
||||||
|
}
|
||||||
|
|
||||||
|
Interval.index_end = function(a, sorted)
|
||||||
|
{
|
||||||
|
if (a.length == 0) return;
|
||||||
|
if (typeof sorted == 'undefined') sorted = true;
|
||||||
|
if (!sorted) Interval.sort(a);
|
||||||
|
a[0].push(0);
|
||||||
|
var k = 0, k_en = a[0][1];
|
||||||
|
for (var i = 1; i < a.length; ++i) {
|
||||||
|
if (k_en <= a[i][0]) {
|
||||||
|
for (++k; k < i; ++k)
|
||||||
|
if (a[k][1] > a[i][0])
|
||||||
|
break;
|
||||||
|
k_en = a[k][1];
|
||||||
|
}
|
||||||
|
a[i].push(k);
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
Interval.find_intv = function(a, x)
|
||||||
|
{
|
||||||
|
var left = -1, right = a.length;
|
||||||
|
if (typeof a[0] == 'number') {
|
||||||
|
while (right - left > 1) {
|
||||||
|
var mid = left + ((right - left) >> 1);
|
||||||
|
if (a[mid] > x) right = mid;
|
||||||
|
else if (a[mid] < x) left = mid;
|
||||||
|
else return mid;
|
||||||
|
}
|
||||||
|
} else {
|
||||||
|
while (right - left > 1) {
|
||||||
|
var mid = left + ((right - left) >> 1);
|
||||||
|
if (a[mid][0] > x) right = mid;
|
||||||
|
else if (a[mid][0] < x) left = mid;
|
||||||
|
else return mid;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return left;
|
||||||
|
}
|
||||||
|
|
||||||
|
Interval.find_ovlp = function(a, st, en)
|
||||||
|
{
|
||||||
|
if (a.length == 0 || st >= en) return [];
|
||||||
|
var l = Interval.find_intv(a, st);
|
||||||
|
var k = l < 0? 0 : a[l][a[l].length - 1];
|
||||||
|
var b = [];
|
||||||
|
for (var i = k; i < a.length; ++i) {
|
||||||
|
if (a[i][0] >= en) break;
|
||||||
|
else if (st < a[i][1])
|
||||||
|
b.push(a[i]);
|
||||||
|
}
|
||||||
|
return b;
|
||||||
|
}
|
||||||
|
|
||||||
|
/*****************
|
||||||
|
* Main function *
|
||||||
|
*****************/
|
||||||
|
|
||||||
|
var c, l_fuzzy = 0, print_ovlp = false, print_err_only = false, first_only = false;
|
||||||
|
while ((c = getopt(arguments, "l:ep")) != null) {
|
||||||
|
if (c == 'l') l_fuzzy = parseInt(getopt.arg);
|
||||||
|
else if (c == 'e') print_err_only = print_ovlp = true;
|
||||||
|
else if (c == 'p') print_ovlp = true;
|
||||||
|
}
|
||||||
|
|
||||||
|
if (arguments.length - getopt.ind < 2) {
|
||||||
|
print("Usage: k8 intron-eval.js [options] <gene.gtf> <aln.sam>");
|
||||||
|
exit(1);
|
||||||
|
}
|
||||||
|
|
||||||
|
var file, buf = new Bytes();
|
||||||
|
|
||||||
|
var tr = {};
|
||||||
|
file = new File(arguments[getopt.ind]);
|
||||||
|
while (file.readline(buf) >= 0) {
|
||||||
|
var m, t = buf.toString().split("\t");
|
||||||
|
if (t[0].charAt(0) == '#') continue;
|
||||||
|
if (t[2] != 'exon') continue;
|
||||||
|
var st = parseInt(t[3]) - 1;
|
||||||
|
var en = parseInt(t[4]);
|
||||||
|
if ((m = /transcript_id "(\S+)"/.exec(t[8])) == null) continue;
|
||||||
|
var tid = m[1];
|
||||||
|
if (tr[tid] == null) tr[tid] = [t[0], t[6], 0, 0, []];
|
||||||
|
tr[tid][4].push([st, en]);
|
||||||
|
}
|
||||||
|
file.close();
|
||||||
|
|
||||||
|
var anno = {};
|
||||||
|
for (var tid in tr) {
|
||||||
|
var t = tr[tid];
|
||||||
|
Interval.sort(t[4]);
|
||||||
|
t[2] = t[4][0][0];
|
||||||
|
t[3] = t[4][t[4].length - 1][1];
|
||||||
|
if (anno[t[0]] == null) anno[t[0]] = [];
|
||||||
|
var s = t[4];
|
||||||
|
for (var i = 0; i < s.length - 1; ++i) {
|
||||||
|
if (s[i][1] >= s[i+1][0])
|
||||||
|
warn("WARNING: incorrect annotation for transcript "+tid+" ("+s[i][1]+" >= "+s[i+1][0]+")")
|
||||||
|
anno[t[0]].push([s[i][1], s[i+1][0]]);
|
||||||
|
}
|
||||||
|
}
|
||||||
|
tr = null;
|
||||||
|
|
||||||
|
for (var chr in anno) {
|
||||||
|
var e = anno[chr];
|
||||||
|
if (e.length == 0) continue;
|
||||||
|
Interval.sort(e);
|
||||||
|
var k = 0;
|
||||||
|
for (var i = 1; i < e.length; ++i) // dedup
|
||||||
|
if (e[i][0] != e[k][0] || e[i][1] != e[k][1])
|
||||||
|
e[++k] = e[i].slice(0);
|
||||||
|
e.length = k + 1;
|
||||||
|
Interval.index_end(e);
|
||||||
|
}
|
||||||
|
|
||||||
|
var n_pri = 0, n_unmapped = 0, n_mapped = 0;
|
||||||
|
var n_sgl = 0, n_splice = 0, n_splice_hit = 0, n_splice_novel = 0;
|
||||||
|
|
||||||
|
file = new File(arguments[getopt.ind+1]);
|
||||||
|
var last_qname = null;
|
||||||
|
var re_cigar = /(\d+)([MIDNSHX=])/g;
|
||||||
|
while (file.readline(buf) >= 0) {
|
||||||
|
var m, t = buf.toString().split("\t");
|
||||||
|
|
||||||
|
if (t[0].charAt(0) == '@') continue;
|
||||||
|
var flag = parseInt(t[1]);
|
||||||
|
if (flag&0x100) continue;
|
||||||
|
if (first_only && last_qname == t[0]) continue;
|
||||||
|
if (t[2] == '*') {
|
||||||
|
++n_unmapped;
|
||||||
|
continue;
|
||||||
|
} else {
|
||||||
|
++n_pri;
|
||||||
|
if (last_qname != t[0]) ++n_mapped;
|
||||||
|
}
|
||||||
|
|
||||||
|
var pos = parseInt(t[3]) - 1, intron = [];
|
||||||
|
while ((m = re_cigar.exec(t[5])) != null) {
|
||||||
|
var len = parseInt(m[1]), op = m[2];
|
||||||
|
if (op == 'N') {
|
||||||
|
intron.push([pos, pos + len]);
|
||||||
|
pos += len;
|
||||||
|
} else if (op == 'M' || op == 'X' || op == '=' || op == 'D') pos += len;
|
||||||
|
}
|
||||||
|
if (intron.length == 0) {
|
||||||
|
++n_sgl;
|
||||||
|
continue;
|
||||||
|
}
|
||||||
|
n_splice += intron.length;
|
||||||
|
|
||||||
|
var chr = anno[t[2]];
|
||||||
|
if (chr != null) {
|
||||||
|
for (var i = 0; i < intron.length; ++i) {
|
||||||
|
var o = Interval.find_ovlp(chr, intron[i][0], intron[i][1]);
|
||||||
|
if (o.length > 0) {
|
||||||
|
var hit = false;
|
||||||
|
for (var j = 0; j < o.length; ++j) {
|
||||||
|
var st_diff = intron[i][0] - o[j][0];
|
||||||
|
var en_diff = intron[i][1] - o[j][1];
|
||||||
|
if (st_diff < 0) st_diff = -st_diff;
|
||||||
|
if (en_diff < 0) en_diff = -en_diff;
|
||||||
|
if (st_diff <= l_fuzzy && en_diff <= l_fuzzy)
|
||||||
|
++n_splice_hit, hit = true;
|
||||||
|
if (hit) break;
|
||||||
|
}
|
||||||
|
if (print_ovlp) {
|
||||||
|
var type = hit? 'C' : 'P';
|
||||||
|
if (hit && print_err_only) continue;
|
||||||
|
var x = '[';
|
||||||
|
for (var j = 0; j < o.length; ++j) {
|
||||||
|
if (j) x += ', ';
|
||||||
|
x += '(' + o[j][0] + "," + o[j][1] + ')';
|
||||||
|
}
|
||||||
|
x += ']';
|
||||||
|
print(type, t[0], i+1, t[2], intron[i][0], intron[i][1], x);
|
||||||
|
}
|
||||||
|
} else {
|
||||||
|
++n_splice_novel;
|
||||||
|
if (print_ovlp)
|
||||||
|
print('N', t[0], i+1, t[2], intron[i][0], intron[i][1]);
|
||||||
|
}
|
||||||
|
}
|
||||||
|
} else {
|
||||||
|
n_splice_novel += intron.length;
|
||||||
|
}
|
||||||
|
last_qname = t[0];
|
||||||
|
}
|
||||||
|
file.close();
|
||||||
|
|
||||||
|
buf.destroy();
|
||||||
|
|
||||||
|
if (!print_ovlp) {
|
||||||
|
print("# unmapped reads: " + n_unmapped);
|
||||||
|
print("# mapped reads: " + n_mapped);
|
||||||
|
print("# primary alignments: " + n_pri);
|
||||||
|
print("# singletons: " + n_sgl);
|
||||||
|
print("# predicted introns: " + n_splice);
|
||||||
|
print("# non-overlapping introns: " + n_splice_novel);
|
||||||
|
print("# correct introns: " + n_splice_hit + " (" + (n_splice_hit / n_splice * 100).toFixed(2) + "%)");
|
||||||
|
}
|
||||||
+2
-2
@@ -94,7 +94,7 @@ while (file.readline(buf) >= 0) {
|
|||||||
ori_qlen = parseInt(t[1]);
|
ori_qlen = parseInt(t[1]);
|
||||||
} else { // SAM
|
} else { // SAM
|
||||||
var flag = parseInt(t[1]);
|
var flag = parseInt(t[1]);
|
||||||
if (flag & 4) continue;
|
if ((flag & 4) || t[2] == '*' || t[5] == '*') continue;
|
||||||
if (flag & 0x100) {
|
if (flag & 0x100) {
|
||||||
++n_2nd;
|
++n_2nd;
|
||||||
continue;
|
continue;
|
||||||
@@ -144,7 +144,7 @@ while (file.readline(buf) >= 0) {
|
|||||||
}
|
}
|
||||||
if (n_cigar > 65535) ++n_cigar_64k;
|
if (n_cigar > 65535) ++n_cigar_64k;
|
||||||
if (ql + sclip != aqlen)
|
if (ql + sclip != aqlen)
|
||||||
warn("WARNING: aligned query length is inconsistent with CIGAR at line " + lineno);
|
warn("WARNING: aligned query length is inconsistent with CIGAR at line " + lineno + " (" + (ql+sclip) + " != " + aqlen + ")");
|
||||||
if (atlen != null && atlen != tl)
|
if (atlen != null && atlen != tl)
|
||||||
warn("WARNING: aligned reference length is inconsistent with CIGAR at line " + lineno);
|
warn("WARNING: aligned reference length is inconsistent with CIGAR at line " + lineno);
|
||||||
if (is_sam) {
|
if (is_sam) {
|
||||||
|
|||||||
+105
@@ -0,0 +1,105 @@
|
|||||||
|
var getopt = function(args, ostr) {
|
||||||
|
var oli; // option letter list index
|
||||||
|
if (typeof(getopt.place) == 'undefined')
|
||||||
|
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
|
||||||
|
if (getopt.place == -1) { // update scanning pointer
|
||||||
|
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
|
||||||
|
getopt.place = -1;
|
||||||
|
return null;
|
||||||
|
}
|
||||||
|
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
|
||||||
|
++getopt.ind;
|
||||||
|
getopt.place = -1;
|
||||||
|
return null;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
|
||||||
|
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
|
||||||
|
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
|
||||||
|
if (getopt.place < 0) ++getopt.ind;
|
||||||
|
return '?';
|
||||||
|
}
|
||||||
|
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
|
||||||
|
getopt.arg = null;
|
||||||
|
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
|
||||||
|
} else { // need an argument
|
||||||
|
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
|
||||||
|
getopt.arg = args[getopt.ind].substr(getopt.place);
|
||||||
|
else if (args.length <= ++getopt.ind) { // no arg
|
||||||
|
getopt.place = -1;
|
||||||
|
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
|
||||||
|
return '?';
|
||||||
|
} else getopt.arg = args[getopt.ind]; // white space
|
||||||
|
getopt.place = -1;
|
||||||
|
++getopt.ind;
|
||||||
|
}
|
||||||
|
return optopt;
|
||||||
|
}
|
||||||
|
|
||||||
|
var c, min_ovlp = 2000, min_frac = 0.95, min_mapq = 10;
|
||||||
|
while ((c = getopt(arguments, "q:l:f:")) != null) {
|
||||||
|
if (c == 'q') min_mapq = parseInt(getopt.arg);
|
||||||
|
else if (c == 'l') min_ovlp = parseInt(getopt.arg);
|
||||||
|
else if (c == 'f') min_frac = parseFloat(getopt.arg);
|
||||||
|
}
|
||||||
|
if (arguments.length - getopt.ind < 2) {
|
||||||
|
print("Usage: sort -k6,6 -k8,8n to-ref.paf | k8 ov-eval.js [options] - <ovlp.paf>");
|
||||||
|
print("Options:");
|
||||||
|
print(" -l INT min overlap length [2000]");
|
||||||
|
print(" -q INT min mapping quality [10]");
|
||||||
|
print(" -f FLOAT min fraction of mapped length [0.95]");
|
||||||
|
exit(1);
|
||||||
|
}
|
||||||
|
|
||||||
|
var buf = new Bytes();
|
||||||
|
var file = arguments[getopt.ind] == '-'? new File() : new File(arguments[getopt.ind]);
|
||||||
|
var a = [], h = {};
|
||||||
|
while (file.readline(buf) >= 0) {
|
||||||
|
var t = buf.toString().split("\t");
|
||||||
|
var is_pri = false;
|
||||||
|
if (parseInt(t[11]) < min_mapq) continue;
|
||||||
|
for (var i = 12; i < t.length; ++i)
|
||||||
|
if (t[i] == 'tp:A:P')
|
||||||
|
is_pri = true;
|
||||||
|
if (!is_pri) continue;
|
||||||
|
for (var i = 1; i <= 3; ++i)
|
||||||
|
t[i] = parseInt(t[i]);
|
||||||
|
for (var i = 6; i <= 8; ++i)
|
||||||
|
t[i] = parseInt(t[i]);
|
||||||
|
if (t[3] - t[2] < min_ovlp || t[8] - t[7] < min_ovlp || (t[3] - t[2]) / t[1] < min_frac)
|
||||||
|
continue;
|
||||||
|
var ctg = t[5], st = t[7], en = t[8];
|
||||||
|
while (a.length > 0) {
|
||||||
|
if (a[0][0] == ctg && a[0][2] > st)
|
||||||
|
break;
|
||||||
|
else a.shift();
|
||||||
|
}
|
||||||
|
for (var j = 0; j < a.length; ++j) {
|
||||||
|
if (a[j][3] == t[0]) continue;
|
||||||
|
var len = (en > a[j][2]? a[j][2] : en) - st;
|
||||||
|
if (len >= min_ovlp) {
|
||||||
|
var key = a[j][3] < t[0]? a[j][3] + "\t" + t[0] : t[0] + "\t" + a[j][3];
|
||||||
|
h[key] = len;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
a.push([ctg, st, en, t[0]]);
|
||||||
|
}
|
||||||
|
file.close();
|
||||||
|
|
||||||
|
file = new File(arguments[getopt.ind + 1]);
|
||||||
|
while (file.readline(buf) >= 0) {
|
||||||
|
var t = buf.toString().split("\t");
|
||||||
|
var key = t[0] < t[5]? t[0] + "\t" + t[5] : t[5] + "\t" + t[0];
|
||||||
|
if (h[key] > 0) h[key] = -h[key];
|
||||||
|
}
|
||||||
|
file.close();
|
||||||
|
buf.destroy();
|
||||||
|
|
||||||
|
var n_ovlp = 0, n_missing = 0;
|
||||||
|
for (var key in h) {
|
||||||
|
++n_ovlp;
|
||||||
|
if (h[key] > 0) ++n_missing;
|
||||||
|
}
|
||||||
|
print(n_ovlp + " overlaps inferred from the reference mapping");
|
||||||
|
print(n_missing + " missed by the read overlapper");
|
||||||
|
print((100 * (1 - n_missing / n_ovlp)).toFixed(2) + "% sensitivity");
|
||||||
+196
@@ -0,0 +1,196 @@
|
|||||||
|
var getopt = function(args, ostr) {
|
||||||
|
var oli; // option letter list index
|
||||||
|
if (typeof(getopt.place) == 'undefined')
|
||||||
|
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
|
||||||
|
if (getopt.place == -1) { // update scanning pointer
|
||||||
|
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
|
||||||
|
getopt.place = -1;
|
||||||
|
return null;
|
||||||
|
}
|
||||||
|
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
|
||||||
|
++getopt.ind;
|
||||||
|
getopt.place = -1;
|
||||||
|
return null;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
|
||||||
|
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
|
||||||
|
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
|
||||||
|
if (getopt.place < 0) ++getopt.ind;
|
||||||
|
return '?';
|
||||||
|
}
|
||||||
|
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
|
||||||
|
getopt.arg = null;
|
||||||
|
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
|
||||||
|
} else { // need an argument
|
||||||
|
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
|
||||||
|
getopt.arg = args[getopt.ind].substr(getopt.place);
|
||||||
|
else if (args.length <= ++getopt.ind) { // no arg
|
||||||
|
getopt.place = -1;
|
||||||
|
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
|
||||||
|
return '?';
|
||||||
|
} else getopt.arg = args[getopt.ind]; // white space
|
||||||
|
getopt.place = -1;
|
||||||
|
++getopt.ind;
|
||||||
|
}
|
||||||
|
return optopt;
|
||||||
|
}
|
||||||
|
|
||||||
|
var c, line_len = 80, fmt = "aln";
|
||||||
|
while ((c = getopt(arguments, "f:l:")) != null) {
|
||||||
|
if (c == 'f') {
|
||||||
|
fmt = getopt.arg;
|
||||||
|
if (fmt != "aln" && fmt != "lastz-cigar" && fmt != "maf")
|
||||||
|
throw Error("format must be one of aln, lastz-cigar and maf");
|
||||||
|
} else if (c == 'l') line_len = parseInt(getopt.arg);
|
||||||
|
}
|
||||||
|
if (line_len == 0) line_len = 0x7fffffff;
|
||||||
|
|
||||||
|
if (getopt.ind == arguments.length) {
|
||||||
|
print("Usage: k8 paf2aln.js [options] <in.paf>");
|
||||||
|
print("Options:");
|
||||||
|
print(" -f STR output format: aln (BLAST-like), maf or lastz-cigar [aln]");
|
||||||
|
print(" -l INT line length in BLAST-like output [80]");
|
||||||
|
exit(1);
|
||||||
|
}
|
||||||
|
|
||||||
|
function padding_str(x, len, right)
|
||||||
|
{
|
||||||
|
var s = x.toString();
|
||||||
|
if (s.length < len) {
|
||||||
|
if (right) s += Array(len - s.length + 1).join(" ");
|
||||||
|
else s = Array(len - s.length + 1).join(" ") + s;
|
||||||
|
}
|
||||||
|
return s;
|
||||||
|
}
|
||||||
|
|
||||||
|
function update_aln(s_ref, s_qry, s_mid, type, seq, slen)
|
||||||
|
{
|
||||||
|
var l = type == '*'? 1 : seq.length;
|
||||||
|
if (type == '=' || type == ':') {
|
||||||
|
s_ref.set(seq);
|
||||||
|
s_qry.set(seq);
|
||||||
|
s_mid.set(Array(l+1).join("|"));
|
||||||
|
slen[0] += l, slen[1] += l;
|
||||||
|
} else if (type == '*') {
|
||||||
|
s_ref.set(seq.charAt(0));
|
||||||
|
s_qry.set(seq.charAt(1));
|
||||||
|
s_mid.set(' ');
|
||||||
|
slen[0] += 1, slen[1] += 1;
|
||||||
|
} else if (type == '+') {
|
||||||
|
s_ref.set(Array(l+1).join("-"));
|
||||||
|
s_qry.set(seq);
|
||||||
|
s_mid.set(Array(l+1).join(" "));
|
||||||
|
slen[1] += l;
|
||||||
|
} else if (type == '-') {
|
||||||
|
s_ref.set(seq);
|
||||||
|
s_qry.set(Array(l+1).join("-"));
|
||||||
|
s_mid.set(Array(l+1).join(" "));
|
||||||
|
slen[0] += l;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
function print_aln(rs, qs, strand, slen, elen, s_ref, s_qry, s_mid)
|
||||||
|
{
|
||||||
|
print(["Ref+:", padding_str(rs + slen[0] + 1, 10, false), s_ref.toString(), padding_str(rs + elen[0], 10, true)].join(" "));
|
||||||
|
print(" " + s_mid.toString());
|
||||||
|
var st, en;
|
||||||
|
if (strand == '+') st = qs + slen[1] + 1, en = qs + elen[1];
|
||||||
|
else st = qs - slen[1], en = qs - elen[1] + 1;
|
||||||
|
print(["Qry" + strand + ":", padding_str(st, 10, false), s_qry.toString(), padding_str(en, 10, true)].join(" "));
|
||||||
|
}
|
||||||
|
|
||||||
|
var s_ref = new Bytes(), s_qry = new Bytes(), s_mid = new Bytes(); // these are used to show padded alignment
|
||||||
|
var re_cs = /([:=\-\+\*])(\d+|[A-Za-z]+)/g;
|
||||||
|
var re_cg = /(\d+)([MIDNSH])/g;
|
||||||
|
|
||||||
|
var buf = new Bytes();
|
||||||
|
var file = arguments[getopt.ind] == "-"? new File() : new File(arguments[getopt.ind]);
|
||||||
|
var lineno = 0;
|
||||||
|
if (fmt == "maf") print("##maf version=1\n");
|
||||||
|
while (file.readline(buf) >= 0) {
|
||||||
|
var m, line = buf.toString();
|
||||||
|
var t = line.split("\t", 12);
|
||||||
|
++lineno;
|
||||||
|
s_ref.length = s_qry.length = s_mid.length = 0;
|
||||||
|
var slen = [0, 0], elen = [0, 0];
|
||||||
|
if (fmt == "lastz-cigar") { // LASTZ-cigar output
|
||||||
|
var cg = (m = /\tcg:Z:(\S+)/.exec(line)) != null? m[1] : null;
|
||||||
|
if (cg == null) {
|
||||||
|
warn("WARNING: converting to LASTZ-cigar format requires the 'cg' tag, which is absent on line " + lineno);
|
||||||
|
continue;
|
||||||
|
}
|
||||||
|
var score = (m = /\tAS:i:(\d+)/.exec(line)) != null? m[1] : 0;
|
||||||
|
var out = ['cigar:', t[0], t[2], t[3], t[4], t[5], t[7], t[8], '+', score];
|
||||||
|
while ((m = re_cg.exec(cg)) != null)
|
||||||
|
out.push(m[2], m[1]);
|
||||||
|
print(out.join(" "));
|
||||||
|
} else if (fmt == "maf") { // MAF output
|
||||||
|
var cs = (m = /\tcs:Z:(\S+)/.exec(line)) != null? m[1] : null;
|
||||||
|
if (cs == null) {
|
||||||
|
warn("WARNING: converting to MAF requires the 'cs' tag, which is absent on line " + lineno);
|
||||||
|
continue;
|
||||||
|
}
|
||||||
|
while ((m = re_cs.exec(cs)) != null) {
|
||||||
|
if (m[1] == ':')
|
||||||
|
throw Error("converting to MAF only works with 'minimap2 --cs=long'");
|
||||||
|
update_aln(s_ref, s_qry, s_mid, m[1], m[2], elen);
|
||||||
|
}
|
||||||
|
var score = (m = /\tAS:i:(\d+)/.exec(line)) != null? parseInt(m[1]) : 0;
|
||||||
|
var len = t[0].length > t[5].length? t[0].length : t[5].length;
|
||||||
|
print("a " + score);
|
||||||
|
print(["s", padding_str(t[5], len, true), padding_str(t[7], 10, false), padding_str(parseInt(t[8]) - parseInt(t[7]), 10, false),
|
||||||
|
"+", padding_str(t[6], 10, false), s_ref.toString()].join(" "));
|
||||||
|
var qs, qe, ql = parseInt(t[1]);
|
||||||
|
if (t[4] == '+') {
|
||||||
|
qs = parseInt(t[2]);
|
||||||
|
qe = parseInt(t[3]);
|
||||||
|
} else {
|
||||||
|
qs = ql - parseInt(t[3]);
|
||||||
|
qe = ql - parseInt(t[2]);
|
||||||
|
}
|
||||||
|
print(["s", padding_str(t[0], len, true), padding_str(qs, 10, false), padding_str(qe - qs, 10, false),
|
||||||
|
t[4], padding_str(ql, 10, false), s_qry.toString()].join(" "));
|
||||||
|
print("");
|
||||||
|
} else { // BLAST-like output
|
||||||
|
var cs = (m = /\tcs:Z:(\S+)/.exec(line)) != null? m[1] : null;
|
||||||
|
if (cs == null) {
|
||||||
|
warn("WARNING: converting to BLAST-like alignment requires the 'cs' tag, which is absent on line " + lineno);
|
||||||
|
continue;
|
||||||
|
}
|
||||||
|
line = line.replace(/\tc[sg]:Z:\S+/g, ""); // get rid of cs or cg tags
|
||||||
|
print('>' + line);
|
||||||
|
var rs = parseInt(t[7]), qs = t[4] == '+'? parseInt(t[2]) : parseInt(t[3]);
|
||||||
|
var n_blocks = 0;
|
||||||
|
while ((m = re_cs.exec(cs)) != null) {
|
||||||
|
if (m[1] == ':') m[2] = Array(parseInt(m[2]) + 1).join("=");
|
||||||
|
var start = 0, rest = m[1] == '*'? 1 : m[2].length;
|
||||||
|
while (rest > 0) {
|
||||||
|
var l_proc;
|
||||||
|
if (s_ref.length + rest >= line_len) {
|
||||||
|
l_proc = line_len - s_ref.length;
|
||||||
|
update_aln(s_ref, s_qry, s_mid, m[1], m[1] == '*'? m[2] : m[2].substr(start, l_proc), elen);
|
||||||
|
if (n_blocks > 0) print("");
|
||||||
|
print_aln(rs, qs, t[4], slen, elen, s_ref, s_qry, s_mid);
|
||||||
|
++n_blocks;
|
||||||
|
s_ref.length = s_qry.length = s_mid.length = 0;
|
||||||
|
slen[0] = elen[0], slen[1] = elen[1];
|
||||||
|
} else {
|
||||||
|
l_proc = rest;
|
||||||
|
update_aln(s_ref, s_qry, s_mid, m[1], m[1] == '*'? m[2] : m[2].substr(start, l_proc), elen);
|
||||||
|
}
|
||||||
|
rest -= l_proc, start += l_proc;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
if (s_ref.length > 0) {
|
||||||
|
if (n_blocks > 0) print("");
|
||||||
|
print_aln(rs, qs, t[4], slen, elen, s_ref, s_qry, s_mid);
|
||||||
|
++n_blocks;
|
||||||
|
}
|
||||||
|
print("//");
|
||||||
|
}
|
||||||
|
}
|
||||||
|
file.close();
|
||||||
|
buf.destroy();
|
||||||
|
|
||||||
|
s_ref.destroy(); s_qry.destroy(); s_mid.destroy();
|
||||||
@@ -0,0 +1,188 @@
|
|||||||
|
var getopt = function(args, ostr) {
|
||||||
|
var oli; // option letter list index
|
||||||
|
if (typeof(getopt.place) == 'undefined')
|
||||||
|
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
|
||||||
|
if (getopt.place == -1) { // update scanning pointer
|
||||||
|
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
|
||||||
|
getopt.place = -1;
|
||||||
|
return null;
|
||||||
|
}
|
||||||
|
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
|
||||||
|
++getopt.ind;
|
||||||
|
getopt.place = -1;
|
||||||
|
return null;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
|
||||||
|
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
|
||||||
|
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
|
||||||
|
if (getopt.place < 0) ++getopt.ind;
|
||||||
|
return '?';
|
||||||
|
}
|
||||||
|
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
|
||||||
|
getopt.arg = null;
|
||||||
|
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
|
||||||
|
} else { // need an argument
|
||||||
|
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
|
||||||
|
getopt.arg = args[getopt.ind].substr(getopt.place);
|
||||||
|
else if (args.length <= ++getopt.ind) { // no arg
|
||||||
|
getopt.place = -1;
|
||||||
|
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
|
||||||
|
return '?';
|
||||||
|
} else getopt.arg = args[getopt.ind]; // white space
|
||||||
|
getopt.place = -1;
|
||||||
|
++getopt.ind;
|
||||||
|
}
|
||||||
|
return optopt;
|
||||||
|
}
|
||||||
|
|
||||||
|
var re_cs = /([:=*+-])(\d+|[A-Za-z]+)/g;
|
||||||
|
var c, min_cov_len = 10000, min_var_len = 50000, gap_thres = 50, min_mapq = 5;
|
||||||
|
while ((c = getopt(arguments, "l:L:g:q:")) != null) {
|
||||||
|
if (c == 'l') min_cov_len = parseInt(getopt.arg);
|
||||||
|
else if (c == 'L') min_var_len = parseInt(optarg.arg);
|
||||||
|
else if (c == 'g') gap_thres = parseInt(optarg.arg);
|
||||||
|
else if (c == 'q') min_mapq = parseInt(optarg.arg);
|
||||||
|
}
|
||||||
|
|
||||||
|
if (arguments.length == getopt.ind) {
|
||||||
|
print("Usage: k8 paf2diff.js [options] <with-cs.paf>");
|
||||||
|
print("Options:");
|
||||||
|
print(" -l INT min alignment length to compute coverage ["+min_cov_len+"]");
|
||||||
|
print(" -L INT min alignment length to call variants ["+min_var_len+"]");
|
||||||
|
print(" -q INT min mapping quality ["+min_mapq+"]");
|
||||||
|
print(" -g INT short/long gap threshold (for statistics only) ["+gap_thres+"]");
|
||||||
|
exit(1);
|
||||||
|
}
|
||||||
|
|
||||||
|
var file = new File(arguments[getopt.ind]);
|
||||||
|
var buf = new Bytes();
|
||||||
|
var tot_len = 0, n_sub = [0, 0, 0], n_ins = [0, 0, 0, 0], n_del = [0, 0, 0, 0];
|
||||||
|
|
||||||
|
function count_var(o)
|
||||||
|
{
|
||||||
|
if (o[3] > 1) return;
|
||||||
|
if (o[5] == '-' && o[6] == '-') return;
|
||||||
|
if (o[5] == '-') { // insertion
|
||||||
|
var l = o[6].length;
|
||||||
|
if (l == 1) ++n_ins[0];
|
||||||
|
else if (l == 2) ++n_ins[1];
|
||||||
|
else if (l < gap_thres) ++n_ins[2];
|
||||||
|
else ++n_ins[3];
|
||||||
|
} else if (o[6] == '-') { // deletion
|
||||||
|
var l = o[5].length;
|
||||||
|
if (l == 1) ++n_del[0];
|
||||||
|
else if (l == 2) ++n_del[1];
|
||||||
|
else if (l < gap_thres) ++n_del[2];
|
||||||
|
else ++n_del[3];
|
||||||
|
} else {
|
||||||
|
++n_sub[0];
|
||||||
|
var s = o[5] + o[6];
|
||||||
|
if (s == 'ag' || s == 'ga' || s == 'ct' || s == 'tc')
|
||||||
|
++n_sub[1];
|
||||||
|
else ++n_sub[2];
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
var a = [], out = [];
|
||||||
|
var c1_ctg = null, c1_start = 0, c1_end = 0, c1_counted = false, c1_len = 0;
|
||||||
|
while (file.readline(buf) >= 0) {
|
||||||
|
var line = buf.toString();
|
||||||
|
if (!/\ts2:i:/.test(line)) continue; // skip secondary alignments
|
||||||
|
var m, t = line.split("\t", 12);
|
||||||
|
for (var i = 6; i <= 11; ++i)
|
||||||
|
t[i] = parseInt(t[i]);
|
||||||
|
if (t[10] < min_cov_len || t[11] < min_mapq) continue;
|
||||||
|
var ctg = t[5], x = t[7], end = t[8];
|
||||||
|
// compute regions covered by 1 contig
|
||||||
|
if (ctg != c1_ctg || x >= c1_end) {
|
||||||
|
if (c1_counted && c1_end > c1_start) {
|
||||||
|
c1_len += c1_end - c1_start;
|
||||||
|
print('R', c1_ctg, c1_start, c1_end);
|
||||||
|
}
|
||||||
|
c1_ctg = ctg, c1_start = x, c1_end = end;
|
||||||
|
c1_counted = (t[10] >= min_var_len);
|
||||||
|
} else if (end > c1_end) { // overlap
|
||||||
|
if (c1_counted && x > c1_start) {
|
||||||
|
c1_len += x - c1_start;
|
||||||
|
print('R', c1_ctg, c1_start, x);
|
||||||
|
}
|
||||||
|
c1_start = c1_end, c1_end = end;
|
||||||
|
c1_counted = (t[10] >= min_var_len);
|
||||||
|
} else { // contained
|
||||||
|
if (c1_counted && x > c1_start) {
|
||||||
|
c1_len += x - c1_start;
|
||||||
|
print('R', c1_ctg, c1_start, x);
|
||||||
|
}
|
||||||
|
c1_start = end;
|
||||||
|
}
|
||||||
|
// output variants ahead of this alignment
|
||||||
|
while (out.length) {
|
||||||
|
if (out[0][0] != ctg || out[0][2] <= x) {
|
||||||
|
count_var(out[0]);
|
||||||
|
print('V', out[0].join("\t"));
|
||||||
|
out.shift();
|
||||||
|
} else break;
|
||||||
|
}
|
||||||
|
// update coverage
|
||||||
|
for (var i = 0; i < out.length; ++i)
|
||||||
|
if (out[i][1] >= x && out[i][2] <= end)
|
||||||
|
++out[i][3];
|
||||||
|
// drop alignments that don't overlap with the current one
|
||||||
|
var k = 0;
|
||||||
|
for (var i = 0; i < a.length; ++i)
|
||||||
|
if (a[0][0] == ctg && a[0][2] > x)
|
||||||
|
a[k++] = a[i];
|
||||||
|
a.length = k;
|
||||||
|
// core loop
|
||||||
|
if (t[10] >= min_var_len) {
|
||||||
|
if ((m = /\tcs:Z:(\S+)/.exec(line)) == null) continue; // no cs tag
|
||||||
|
var cs = m[1];
|
||||||
|
var blen = 0, n_diff = 0;
|
||||||
|
tot_len += t[10];
|
||||||
|
while ((m = re_cs.exec(cs)) != null) {
|
||||||
|
var cov = 1;
|
||||||
|
if (m[1] == '*' || m[1] == '+' || m[1] == '-')
|
||||||
|
for (var i = 0; i < a.length; ++i)
|
||||||
|
if (a[0][2] > x) ++cov;
|
||||||
|
if (m[1] == '=' || m[1] == ':') {
|
||||||
|
var l = m[1] == '='? m[2].length : parseInt(m[2]);
|
||||||
|
x += l, blen += l;
|
||||||
|
} else if (m[1] == '*') {
|
||||||
|
out.push([t[5], x, x+1, cov, t[11], m[2].charAt(0), m[2].charAt(1)]);
|
||||||
|
++x, ++blen, ++n_diff;
|
||||||
|
} else if (m[1] == '+') {
|
||||||
|
out.push([t[5], x, x, cov, t[11], '-', m[2]]);
|
||||||
|
++blen, ++n_diff;
|
||||||
|
} else if (m[1] == '-') {
|
||||||
|
out.push([t[5], x, x + m[2].length, cov, t[11], m[2], '-']);
|
||||||
|
x += m[2].length, ++blen, ++n_diff;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
a.push([t[5], t[7], t[8]]);
|
||||||
|
}
|
||||||
|
if (c1_counted && c1_end > c1_start) {
|
||||||
|
c1_len += c1_end - c1_start;
|
||||||
|
print('R', c1_ctg, c1_start, c1_end);
|
||||||
|
}
|
||||||
|
while (out.length) {
|
||||||
|
count_var(out[0]);
|
||||||
|
print('V', out[0].join("\t"));
|
||||||
|
out.shift();
|
||||||
|
}
|
||||||
|
|
||||||
|
//warn(tot_len + " alignment columns considered in calling");
|
||||||
|
warn(c1_len + " reference bases covered by exactly one contig");
|
||||||
|
warn(n_sub[0] + " substitutions; ts/tv = " + (n_sub[1]/n_sub[2]).toFixed(3));
|
||||||
|
warn(n_del[0] + " 1bp deletions");
|
||||||
|
warn(n_ins[0] + " 1bp insertions");
|
||||||
|
warn(n_del[1] + " 2bp deletions");
|
||||||
|
warn(n_ins[1] + " 2bp insertions");
|
||||||
|
warn(n_del[2] + " [3,"+gap_thres+") deletions");
|
||||||
|
warn(n_ins[2] + " [3,"+gap_thres+") insertions");
|
||||||
|
warn(n_del[3] + " >="+gap_thres+" deletions");
|
||||||
|
warn(n_ins[3] + " >="+gap_thres+" insertions");
|
||||||
|
|
||||||
|
buf.destroy();
|
||||||
|
file.close();
|
||||||
+114
@@ -0,0 +1,114 @@
|
|||||||
|
var getopt = function(args, ostr) {
|
||||||
|
var oli; // option letter list index
|
||||||
|
if (typeof(getopt.place) == 'undefined')
|
||||||
|
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
|
||||||
|
if (getopt.place == -1) { // update scanning pointer
|
||||||
|
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
|
||||||
|
getopt.place = -1;
|
||||||
|
return null;
|
||||||
|
}
|
||||||
|
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
|
||||||
|
++getopt.ind;
|
||||||
|
getopt.place = -1;
|
||||||
|
return null;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
|
||||||
|
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
|
||||||
|
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
|
||||||
|
if (getopt.place < 0) ++getopt.ind;
|
||||||
|
return '?';
|
||||||
|
}
|
||||||
|
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
|
||||||
|
getopt.arg = null;
|
||||||
|
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
|
||||||
|
} else { // need an argument
|
||||||
|
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
|
||||||
|
getopt.arg = args[getopt.ind].substr(getopt.place);
|
||||||
|
else if (args.length <= ++getopt.ind) { // no arg
|
||||||
|
getopt.place = -1;
|
||||||
|
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
|
||||||
|
return '?';
|
||||||
|
} else getopt.arg = args[getopt.ind]; // white space
|
||||||
|
getopt.place = -1;
|
||||||
|
++getopt.ind;
|
||||||
|
}
|
||||||
|
return optopt;
|
||||||
|
}
|
||||||
|
|
||||||
|
var c, pri_only = false;
|
||||||
|
while ((c = getopt(arguments, "p")) != null)
|
||||||
|
if (c == 'p') pri_only = true;
|
||||||
|
|
||||||
|
var file = arguments.length == getopt.ind? new File() : new File(arguments[getopt.ind]);
|
||||||
|
var buf = new Bytes();
|
||||||
|
var re = /(\d+)([MIDSHNX=])/g;
|
||||||
|
|
||||||
|
var len = {}, lineno = 0;
|
||||||
|
while (file.readline(buf) >= 0) {
|
||||||
|
var m, n_cigar = 0, line = buf.toString();
|
||||||
|
++lineno;
|
||||||
|
if (line.charAt(0) == '@') {
|
||||||
|
if (/^@SQ/.test(line)) {
|
||||||
|
var name = (m = /\tSN:(\S+)/.exec(line)) != null? m[1] : null;
|
||||||
|
var l = (m = /\tLN:(\d+)/.exec(line)) != null? parseInt(m[1]) : null;
|
||||||
|
if (name != null && l != null) len[name] = l;
|
||||||
|
}
|
||||||
|
continue;
|
||||||
|
}
|
||||||
|
var t = line.split("\t");
|
||||||
|
var flag = parseInt(t[1]);
|
||||||
|
if (t[9] != '*' && t[10] != '*' && t[9].length != t[10].length) throw Error("ERROR at line " + lineno + ": inconsistent SEQ and QUAL lengths - " + t[9].length + " != " + t[10].length);
|
||||||
|
if (t[2] == '*' || (flag&4)) continue;
|
||||||
|
if (pri_only && (flag&0x100)) continue;
|
||||||
|
var tlen = len[t[2]];
|
||||||
|
if (tlen == null) throw Error("ERROR at line " + lineno + ": can't find the length of contig " + t[2]);
|
||||||
|
var nn = (m = /\tnn:i:(\d+)/.exec(line)) != null? parseInt(m[1]) : 0;
|
||||||
|
var NM = (m = /\tNM:i:(\d+)/.exec(line)) != null? parseInt(m[1]) : null;
|
||||||
|
var have_NM = NM == null? false : true;
|
||||||
|
NM += nn;
|
||||||
|
var clip = [0, 0], I = [0, 0], D = [0, 0], M = 0, N = 0, ql = 0, tl = 0, mm = 0, ext_cigar = false;
|
||||||
|
while ((m = re.exec(t[5])) != null) {
|
||||||
|
var l = parseInt(m[1]);
|
||||||
|
if (m[2] == 'M') M += l, ql += l, tl += l, ext_cigar = false;
|
||||||
|
else if (m[2] == 'I') ++I[0], I[1] += l, ql += l;
|
||||||
|
else if (m[2] == 'D') ++D[0], D[1] += l, tl += l;
|
||||||
|
else if (m[2] == 'N') N += l, tl += l;
|
||||||
|
else if (m[2] == 'S') clip[M == 0? 0 : 1] = l, ql += l;
|
||||||
|
else if (m[2] == 'H') clip[M == 0? 0 : 1] = l;
|
||||||
|
else if (m[2] == '=') M += l, ql += l, tl += l, ext_cigar = true;
|
||||||
|
else if (m[2] == 'X') M += l, ql += l, tl += l, mm += l, ext_cigar = true;
|
||||||
|
++n_cigar;
|
||||||
|
}
|
||||||
|
if (n_cigar > 65535)
|
||||||
|
warn("WARNING at line " + lineno + ": " + n_cigar + " CIGAR operations");
|
||||||
|
if (tl + parseInt(t[3]) - 1 > tlen) {
|
||||||
|
warn("WARNING at line " + lineno + ": alignment end position larger than ref length; skipped");
|
||||||
|
continue;
|
||||||
|
}
|
||||||
|
if (t[9] != '*' && t[9].length != ql) {
|
||||||
|
warn("WARNING at line " + lineno + ": SEQ length inconsistent with CIGAR (" + t[9].length + " != " + ql + "); skipped");
|
||||||
|
continue;
|
||||||
|
}
|
||||||
|
if (!have_NM || ext_cigar) NM = I[1] + D[1] + mm;
|
||||||
|
if (NM < I[1] + D[1] + mm) {
|
||||||
|
warn("WARNING at line " + lineno + ": NM is less than the total number of gaps (" + NM + " < " + (I[1]+D[1]+mm) + ")");
|
||||||
|
NM = I[1] + D[1] + mm;
|
||||||
|
}
|
||||||
|
var extra = ["mm:i:"+(NM-I[1]-D[1]), "io:i:"+I[0], "in:i:"+I[1], "do:i:"+D[0], "dn:i:"+D[1]];
|
||||||
|
var match = M - (NM - I[1] - D[1]);
|
||||||
|
var blen = M + I[1] + D[1];
|
||||||
|
var qlen = M + I[1] + clip[0] + clip[1];
|
||||||
|
var qs, qe;
|
||||||
|
if (flag&16) qs = clip[1], qe = qlen - clip[0];
|
||||||
|
else qs = clip[0], qe = qlen - clip[1];
|
||||||
|
var ts = parseInt(t[3]) - 1, te = ts + M + D[1] + N;
|
||||||
|
var qname = t[0];
|
||||||
|
if ((flag&1) && (flag&0x40)) qname += '/1';
|
||||||
|
if ((flag&1) && (flag&0x80)) qname += '/2';
|
||||||
|
var a = [qname, qlen, qs, qe, flag&16? '-' : '+', t[2], tlen, ts, te, match, blen, t[4]];
|
||||||
|
print(a.join("\t"), extra.join("\t"));
|
||||||
|
}
|
||||||
|
|
||||||
|
buf.destroy();
|
||||||
|
file.close();
|
||||||
@@ -0,0 +1,193 @@
|
|||||||
|
var getopt = function(args, ostr) {
|
||||||
|
var oli; // option letter list index
|
||||||
|
if (typeof(getopt.place) == 'undefined')
|
||||||
|
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
|
||||||
|
if (getopt.place == -1) { // update scanning pointer
|
||||||
|
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
|
||||||
|
getopt.place = -1;
|
||||||
|
return null;
|
||||||
|
}
|
||||||
|
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
|
||||||
|
++getopt.ind;
|
||||||
|
getopt.place = -1;
|
||||||
|
return null;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
|
||||||
|
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
|
||||||
|
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
|
||||||
|
if (getopt.place < 0) ++getopt.ind;
|
||||||
|
return '?';
|
||||||
|
}
|
||||||
|
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
|
||||||
|
getopt.arg = null;
|
||||||
|
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
|
||||||
|
} else { // need an argument
|
||||||
|
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
|
||||||
|
getopt.arg = args[getopt.ind].substr(getopt.place);
|
||||||
|
else if (args.length <= ++getopt.ind) { // no arg
|
||||||
|
getopt.place = -1;
|
||||||
|
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
|
||||||
|
return '?';
|
||||||
|
} else getopt.arg = args[getopt.ind]; // white space
|
||||||
|
getopt.place = -1;
|
||||||
|
++getopt.ind;
|
||||||
|
}
|
||||||
|
return optopt;
|
||||||
|
}
|
||||||
|
|
||||||
|
var c, max_mapq = 60, mode = 0, err_out_q = 256, print_err = false, ovlp_ratio = 0.1, cap_short_mapq = false;
|
||||||
|
while ((c = getopt(arguments, "Q:r:m:c")) != null) {
|
||||||
|
if (c == 'Q') err_out_q = parseInt(getopt.arg), print_err = true;
|
||||||
|
else if (c == 'r') ovlp_ratio = parseFloat(getopt.arg);
|
||||||
|
else if (c == 'm') mode = parseInt(getopt.arg);
|
||||||
|
else if (c == 'c') cap_short_mapq = true;
|
||||||
|
}
|
||||||
|
|
||||||
|
var file = arguments.length == getopt.ind? new File() : new File(arguments[getopt.ind]);
|
||||||
|
var buf = new Bytes();
|
||||||
|
|
||||||
|
var tot = [], err = [];
|
||||||
|
for (var q = 0; q <= max_mapq; ++q)
|
||||||
|
tot[q] = err[q] = 0;
|
||||||
|
|
||||||
|
function is_correct(s, b)
|
||||||
|
{
|
||||||
|
if (s[0] != b[0] || s[3] != b[3]) return false;
|
||||||
|
var o, l;
|
||||||
|
if (s[1] < b[1]) {
|
||||||
|
if (s[2] <= b[1]) return false;
|
||||||
|
o = (s[2] < b[2]? s[2] : b[2]) - b[1];
|
||||||
|
l = (s[2] > b[2]? s[2] : b[2]) - s[1];
|
||||||
|
} else {
|
||||||
|
if (b[2] <= s[1]) return false;
|
||||||
|
o = (s[2] < b[2]? s[2] : b[2]) - s[1];
|
||||||
|
l = (s[2] > b[2]? s[2] : b[2]) - b[1];
|
||||||
|
}
|
||||||
|
return o/l > ovlp_ratio? true : false;
|
||||||
|
}
|
||||||
|
|
||||||
|
function count_err(qname, a, tot, err, mode)
|
||||||
|
{
|
||||||
|
if (a.length == 0) return;
|
||||||
|
|
||||||
|
var m, s;
|
||||||
|
if ((m = /^(\S+)!(\S+)!(\d+)!(\d+)!([\+\-])$/.exec(qname)) != null) { // pbsim single-end reads
|
||||||
|
s = [m[1], m[2], parseInt(m[3]), parseInt(m[4]), m[5]];
|
||||||
|
} else if ((m = /^(\S+)!(\S+)!(\d+)_(\d+)!(\d+)_(\d+)!([\+\-])([\+\-])\/([12])$/.exec(qname)) != null) { // mason2 paired-end reads
|
||||||
|
if (m[9] == '1') {
|
||||||
|
s = [m[1], m[2], parseInt(m[3]), parseInt(m[5]), m[7]];
|
||||||
|
} else {
|
||||||
|
s = [m[1], m[2], parseInt(m[4]), parseInt(m[6]), m[8]];
|
||||||
|
}
|
||||||
|
} else throw Error("Failed to parse simulated read names '" + qname + "'");
|
||||||
|
s.shift(); // skip the orginal read name
|
||||||
|
|
||||||
|
if (mode == 0 || mode == 1) { // longest only or first only
|
||||||
|
var max_i = 0;
|
||||||
|
if (mode == 0) { // longest only
|
||||||
|
var max = 0;
|
||||||
|
for (var i = 0; i < a.length; ++i)
|
||||||
|
if (a[i][5] > max)
|
||||||
|
max = a[i][5], max_i = i;
|
||||||
|
}
|
||||||
|
var mapq = a[max_i][4];
|
||||||
|
++tot[mapq];
|
||||||
|
if (!is_correct(s, a[max_i])) {
|
||||||
|
if (mapq >= err_out_q)
|
||||||
|
print('E', qname, a[max_i].join("\t"));
|
||||||
|
++err[mapq];
|
||||||
|
}
|
||||||
|
} else if (mode == 2) { // all primary mode
|
||||||
|
var max_err_mapq = -1, max_mapq = 0, max_err_i = -1;
|
||||||
|
if (cap_short_mapq) {
|
||||||
|
var max = 0, max_q = 0;
|
||||||
|
for (var i = 0; i < a.length; ++i)
|
||||||
|
if (a[i][5] > max)
|
||||||
|
max = a[i][5], max_q = a[i][4];
|
||||||
|
for (var i = 0; i < a.length; ++i)
|
||||||
|
a[i][4] = max_q < a[i][4]? max_q : a[i][4];
|
||||||
|
}
|
||||||
|
for (var i = 0; i < a.length; ++i) {
|
||||||
|
max_mapq = max_mapq > a[i][4]? max_mapq : a[i][4];
|
||||||
|
if (!is_correct(s, a[i]))
|
||||||
|
if (a[i][4] > max_err_mapq)
|
||||||
|
max_err_mapq = a[i][4], max_err_i = i;
|
||||||
|
}
|
||||||
|
if (max_err_mapq >= 0) {
|
||||||
|
++tot[max_err_mapq], ++err[max_err_mapq];
|
||||||
|
if (max_err_mapq >= err_out_q)
|
||||||
|
print('E', qname, a[max_err_i].join("\t"));
|
||||||
|
} else ++tot[max_mapq];
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
var lineno = 0, last = null, a = [], n_unmapped = null;
|
||||||
|
var re_cigar = /(\d+)([MIDSHN])/g;
|
||||||
|
while (file.readline(buf) >= 0) {
|
||||||
|
var m, line = buf.toString();
|
||||||
|
++lineno;
|
||||||
|
if (line[0] != '@') {
|
||||||
|
var t = line.split("\t");
|
||||||
|
if (t[4] == '+' || t[4] == '-') { // PAF
|
||||||
|
if (last != t[0]) {
|
||||||
|
if (last != null) count_err(last, a, tot, err, mode);
|
||||||
|
a = [], last = t[0];
|
||||||
|
}
|
||||||
|
if (/\ts1:i:\d+/.test(line) && !/\ts2:i:\d+/.test(line)) // secondary alignment in minimap2 PAF
|
||||||
|
continue;
|
||||||
|
var mapq = parseInt(t[11]);
|
||||||
|
if (mapq > max_mapq) mapq = max_mapq;
|
||||||
|
a.push([t[5], parseInt(t[7]), parseInt(t[8]), t[4], mapq, parseInt(t[9])]);
|
||||||
|
} else { // SAM
|
||||||
|
var flag = parseInt(t[1]);
|
||||||
|
var read_no = flag>>6&0x3;
|
||||||
|
var qname = t[0];
|
||||||
|
if (!/\/[12]$/.test(qname))
|
||||||
|
qname = read_no == 1 || read_no == 2? t[0] + '/' + read_no : t[0];
|
||||||
|
if (last != qname) {
|
||||||
|
if (last != null) count_err(last, a, tot, err, mode);
|
||||||
|
a = [], last = qname;
|
||||||
|
}
|
||||||
|
if (flag&0x100) continue; // secondary alignment
|
||||||
|
if ((flag&0x4) || t[2] == '*') { // unmapped
|
||||||
|
if (n_unmapped == null) n_unmapped = 0;
|
||||||
|
++n_unmapped;
|
||||||
|
continue;
|
||||||
|
}
|
||||||
|
var mapq = parseInt(t[4]);
|
||||||
|
if (mapq > max_mapq) mapq = max_mapq;
|
||||||
|
var pos = parseInt(t[3]) - 1, pos_end = pos;
|
||||||
|
var n_gap = 0, mlen = 0;
|
||||||
|
while ((m = re_cigar.exec(t[5])) != null) {
|
||||||
|
var len = parseInt(m[1]);
|
||||||
|
if (m[2] == 'M') pos_end += len, mlen += len;
|
||||||
|
else if (m[2] == 'I') n_gap += len;
|
||||||
|
else if (m[2] == 'D') n_gap += len, pos_end += len;
|
||||||
|
}
|
||||||
|
var score = pos_end - pos;
|
||||||
|
if ((m = /\tNM:i:(\d+)/.exec(line)) != null) {
|
||||||
|
var NM = parseInt(m[1]);
|
||||||
|
if (NM >= n_gap) score = mlen - (NM - n_gap);
|
||||||
|
}
|
||||||
|
a.push([t[2], pos, pos_end, (flag&16)? '-' : '+', mapq, score]);
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
if (last != null) count_err(last, a, tot, err, mode);
|
||||||
|
|
||||||
|
buf.destroy();
|
||||||
|
file.close();
|
||||||
|
|
||||||
|
var sum_tot = 0, sum_err = 0, q_out = -1, sum_tot2 = 0, sum_err2 = 0;
|
||||||
|
for (var q = max_mapq; q >= 0; --q) {
|
||||||
|
if (tot[q] == 0) continue;
|
||||||
|
if (q_out < 0 || err[q] > 0) {
|
||||||
|
if (q_out >= 0) print('Q', q_out, sum_tot, sum_err, (sum_err2/sum_tot2).toFixed(9), sum_tot2);
|
||||||
|
sum_tot = sum_err = 0, q_out = q;
|
||||||
|
}
|
||||||
|
sum_tot += tot[q], sum_err += err[q];
|
||||||
|
sum_tot2 += tot[q], sum_err2 += err[q];
|
||||||
|
}
|
||||||
|
print('Q', q_out, sum_tot, sum_err, (sum_err2/sum_tot2).toFixed(9), sum_tot2);
|
||||||
|
if (n_unmapped != null) print('U', n_unmapped);
|
||||||
@@ -0,0 +1,105 @@
|
|||||||
|
Bytes.prototype.reverse = function()
|
||||||
|
{
|
||||||
|
for (var i = 0; i < this.length>>1; ++i) {
|
||||||
|
var tmp = this[i];
|
||||||
|
this[i] = this[this.length - i - 1];
|
||||||
|
this[this.length - i - 1] = tmp;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// reverse complement a DNA string
|
||||||
|
Bytes.prototype.revcomp = function()
|
||||||
|
{
|
||||||
|
if (Bytes.rctab == null) {
|
||||||
|
var s1 = 'WSATUGCYRKMBDHVNwsatugcyrkmbdhvn';
|
||||||
|
var s2 = 'WSTAACGRYMKVHDBNwstaacgrymkvhdbn';
|
||||||
|
Bytes.rctab = [];
|
||||||
|
for (var i = 0; i < 256; ++i) Bytes.rctab[i] = 0;
|
||||||
|
for (var i = 0; i < s1.length; ++i)
|
||||||
|
Bytes.rctab[s1.charCodeAt(i)] = s2.charCodeAt(i);
|
||||||
|
}
|
||||||
|
for (var i = 0; i < this.length>>1; ++i) {
|
||||||
|
var tmp = this[this.length - i - 1];
|
||||||
|
this[this.length - i - 1] = Bytes.rctab[this[i]];
|
||||||
|
this[i] = Bytes.rctab[tmp];
|
||||||
|
}
|
||||||
|
if (this.length&1)
|
||||||
|
this[this.length>>1] = Bytes.rctab[this[this.length>>1]];
|
||||||
|
}
|
||||||
|
|
||||||
|
if (arguments.length == 0) {
|
||||||
|
print("Usage: k8 sim-mason2.js <mason.sam>");
|
||||||
|
exit(1);
|
||||||
|
}
|
||||||
|
|
||||||
|
function print_se(a)
|
||||||
|
{
|
||||||
|
print('@' + a.slice(0, 5).join("!") + " " + a[8]);
|
||||||
|
print(a[5]);
|
||||||
|
print("+");
|
||||||
|
print(a[6]);
|
||||||
|
}
|
||||||
|
|
||||||
|
var buf = new Bytes(), buf2 = new Bytes();
|
||||||
|
var file = new File(arguments[0]);
|
||||||
|
var re = /(\d+)([MIDSHN])/g;
|
||||||
|
var last = null;
|
||||||
|
while (file.readline(buf) >= 0) {
|
||||||
|
var t = buf.toString().split("\t");
|
||||||
|
if (t[0].charAt(0) == '@') continue;
|
||||||
|
var m, l_ref = 0;
|
||||||
|
while ((m = re.exec(t[5])) != null)
|
||||||
|
if (m[2] == 'D' || m[2] == 'M' || m[2] == 'N')
|
||||||
|
l_ref += parseInt(m[1]);
|
||||||
|
var flag = parseInt(t[1]);
|
||||||
|
var rev = !!(flag&16);
|
||||||
|
var seq, qual;
|
||||||
|
if (rev) {
|
||||||
|
buf2.length = 0;
|
||||||
|
buf2.set(t[9], 0);
|
||||||
|
buf2.revcomp();
|
||||||
|
seq = buf2.toString();
|
||||||
|
buf2.set(t[10], 0);
|
||||||
|
buf2.reverse();
|
||||||
|
qual = buf2.toString();
|
||||||
|
} else seq = t[9], qual = t[10];
|
||||||
|
var qname = t[0];
|
||||||
|
qname = qname.replace(/^simulated./, "");
|
||||||
|
var chr = t[2];
|
||||||
|
var pos = parseInt(t[3]) - 1;
|
||||||
|
var strand = (flag&16)? '-' : '+';
|
||||||
|
var read_no = flag&0xc0;
|
||||||
|
if (read_no == 0x40) read_no = 1;
|
||||||
|
else if (read_no == 0x80) read_no = 2;
|
||||||
|
else read_no = 0;
|
||||||
|
var err = 0, snp = 0, indel = 0;
|
||||||
|
for (var i = 11; i < t.length; ++i) {
|
||||||
|
if ((m = /^XE:i:(\d+)/.exec(t[i])) != null) err = m[1];
|
||||||
|
else if ((m = /^XS:i:(\d+)/.exec(t[i])) != null) snp = m[1];
|
||||||
|
else if ((m = /^XI:i:(\d+)/.exec(t[i])) != null) indel = m[1];
|
||||||
|
}
|
||||||
|
var comment = [err, snp, indel].join(":");
|
||||||
|
if (last == null) {
|
||||||
|
last = [qname, chr, pos, pos + l_ref, strand, seq, qual, read_no, comment];
|
||||||
|
} else if (last[0] != qname) {
|
||||||
|
print_se(last);
|
||||||
|
last = [qname, chr, pos, pos + l_ref, strand, seq, qual, read_no, comment];
|
||||||
|
} else {
|
||||||
|
if (read_no == 2) { // last[] is the first read
|
||||||
|
if (last[7] != 1) throw Error("ERROR: can't find read1");
|
||||||
|
var name = [qname, chr, last[2] + "_" + pos, last[3] + "_" + (pos + l_ref), last[4] + strand].join("!");
|
||||||
|
print('@' + name + '/1' + ' ' + last[8]); print(last[5]); print("+"); print(last[6]);
|
||||||
|
print('@' + name + '/2' + ' ' + comment); print(seq); print("+"); print(qual);
|
||||||
|
} else {
|
||||||
|
if (last[7] != 2) throw Error("ERROR: can't find read2");
|
||||||
|
var name = [qname, chr, pos + "_" + last[2], (pos + l_ref) + "_" + last[3], strand + last[4]].join("!");
|
||||||
|
print('@' + name + '/1' + ' ' + comment); print(seq); print("+"); print(qual);
|
||||||
|
print('@' + name + '/2' + ' ' + last[8]); print(last[5]); print("+"); print(last[6]);
|
||||||
|
}
|
||||||
|
last = null;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
if (last != null) print_se(last);
|
||||||
|
file.close();
|
||||||
|
buf.destroy();
|
||||||
|
buf2.destroy();
|
||||||
@@ -0,0 +1,81 @@
|
|||||||
|
Bytes.prototype.reverse = function()
|
||||||
|
{
|
||||||
|
for (var i = 0; i < this.length>>1; ++i) {
|
||||||
|
var tmp = this[i];
|
||||||
|
this[i] = this[this.length - i - 1];
|
||||||
|
this[this.length - i - 1] = tmp;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
// reverse complement a DNA string
|
||||||
|
Bytes.prototype.revcomp = function()
|
||||||
|
{
|
||||||
|
if (Bytes.rctab == null) {
|
||||||
|
var s1 = 'WSATUGCYRKMBDHVNwsatugcyrkmbdhvn';
|
||||||
|
var s2 = 'WSTAACGRYMKVHDBNwstaacgrymkvhdbn';
|
||||||
|
Bytes.rctab = [];
|
||||||
|
for (var i = 0; i < 256; ++i) Bytes.rctab[i] = 0;
|
||||||
|
for (var i = 0; i < s1.length; ++i)
|
||||||
|
Bytes.rctab[s1.charCodeAt(i)] = s2.charCodeAt(i);
|
||||||
|
}
|
||||||
|
for (var i = 0; i < this.length>>1; ++i) {
|
||||||
|
var tmp = this[this.length - i - 1];
|
||||||
|
this[this.length - i - 1] = Bytes.rctab[this[i]];
|
||||||
|
this[i] = Bytes.rctab[tmp];
|
||||||
|
}
|
||||||
|
if (this.length&1)
|
||||||
|
this[this.length>>1] = Bytes.rctab[this[this.length>>1]];
|
||||||
|
}
|
||||||
|
|
||||||
|
if (arguments.length < 2) {
|
||||||
|
print("Usage: k8 sim-pbsim.js <ref.fa.fai> <pbsim1.maf> [[pbsim2.maf] ...]");
|
||||||
|
exit(1);
|
||||||
|
}
|
||||||
|
|
||||||
|
var file, buf = new Bytes(), buf2 = new Bytes();
|
||||||
|
file = new File(arguments[0]);
|
||||||
|
var chr_list = [];
|
||||||
|
while (file.readline(buf) >= 0) {
|
||||||
|
var t = buf.toString().split(/\s+/);
|
||||||
|
chr_list.push(t[0]);
|
||||||
|
}
|
||||||
|
file.close();
|
||||||
|
|
||||||
|
for (var k = 1; k < arguments.length; ++k) {
|
||||||
|
var fn = arguments[k];
|
||||||
|
file = new File(fn);
|
||||||
|
var state = 0, reg;
|
||||||
|
while (file.readline(buf) >= 0) {
|
||||||
|
var line = buf.toString();
|
||||||
|
if (state == 0 && line.charAt(0) == 'a') {
|
||||||
|
state = 1;
|
||||||
|
} else if (state == 1 && line.charAt(0) == 's') {
|
||||||
|
var t = line.split(/\s+/);
|
||||||
|
var st = parseInt(t[2]);
|
||||||
|
reg = [st, st + parseInt(t[3])];
|
||||||
|
state = 2;
|
||||||
|
} else if (state == 2 && line.charAt(0) == 's') {
|
||||||
|
var m, t = line.split(/\s+/);
|
||||||
|
if ((m = /S(\d+)_\d+/.exec(t[1])) == null) throw Error("Failed to parse the read name");
|
||||||
|
var chr_id = parseInt(m[1]) - 1;
|
||||||
|
if (chr_id >= chr_list.length) throw Error("Index outside the chr list");
|
||||||
|
var name = [t[1], chr_list[chr_id], reg[0], reg[1], t[4]].join("!");
|
||||||
|
var seq = t[6].replace(/\-/g, "");
|
||||||
|
if (seq.length != parseInt(t[5])) throw Error("Inconsistent read length");
|
||||||
|
if (seq.indexOf("NN") < 0) {
|
||||||
|
if (t[4] == '-') {
|
||||||
|
buf2.set(seq, 0);
|
||||||
|
buf2.length = seq.length;
|
||||||
|
buf2.revcomp();
|
||||||
|
seq = buf2.toString();
|
||||||
|
}
|
||||||
|
print(">" + name);
|
||||||
|
print(seq);
|
||||||
|
}
|
||||||
|
state = 0;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
file.close();
|
||||||
|
}
|
||||||
|
buf.destroy();
|
||||||
|
buf2.destroy();
|
||||||
@@ -0,0 +1,148 @@
|
|||||||
|
var getopt = function(args, ostr) {
|
||||||
|
var oli; // option letter list index
|
||||||
|
if (typeof(getopt.place) == 'undefined')
|
||||||
|
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
|
||||||
|
if (getopt.place == -1) { // update scanning pointer
|
||||||
|
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
|
||||||
|
getopt.place = -1;
|
||||||
|
return null;
|
||||||
|
}
|
||||||
|
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
|
||||||
|
++getopt.ind;
|
||||||
|
getopt.place = -1;
|
||||||
|
return null;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
|
||||||
|
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
|
||||||
|
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
|
||||||
|
if (getopt.place < 0) ++getopt.ind;
|
||||||
|
return '?';
|
||||||
|
}
|
||||||
|
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
|
||||||
|
getopt.arg = null;
|
||||||
|
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
|
||||||
|
} else { // need an argument
|
||||||
|
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
|
||||||
|
getopt.arg = args[getopt.ind].substr(getopt.place);
|
||||||
|
else if (args.length <= ++getopt.ind) { // no arg
|
||||||
|
getopt.place = -1;
|
||||||
|
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
|
||||||
|
return '?';
|
||||||
|
} else getopt.arg = args[getopt.ind]; // white space
|
||||||
|
getopt.place = -1;
|
||||||
|
++getopt.ind;
|
||||||
|
}
|
||||||
|
return optopt;
|
||||||
|
}
|
||||||
|
|
||||||
|
var colors = ["0,128,255", "255,0,0", "0,192,0"];
|
||||||
|
|
||||||
|
function print_lines(a, fmt) {
|
||||||
|
if (a.length == 0) return;
|
||||||
|
if (fmt == "bed") {
|
||||||
|
var n_pri = 0;
|
||||||
|
for (var i = 0; i < a.length; ++i)
|
||||||
|
if (a[i][8] == 0) ++n_pri;
|
||||||
|
if (n_pri > 1) {
|
||||||
|
for (var i = 0; i < a.length; ++i)
|
||||||
|
if (a[i][8] == 0) a[i][8] = 1;
|
||||||
|
} else if (n_pri == 0) {
|
||||||
|
warn("Warning: " + a[0][3] + " doesn't have a primary alignment");
|
||||||
|
}
|
||||||
|
for (var i = 0; i < a.length; ++i) {
|
||||||
|
a[i][8] = colors[a[i][8]];
|
||||||
|
print(a[i].join("\t"));
|
||||||
|
}
|
||||||
|
}
|
||||||
|
a.length = 0;
|
||||||
|
}
|
||||||
|
|
||||||
|
function main(args) {
|
||||||
|
var re = /(\d+)([MIDNSH])/g;
|
||||||
|
var c, fmt = "bed", fn_name_conv = null;
|
||||||
|
while ((c = getopt(args, "f:n:")) != null) {
|
||||||
|
if (c == 'f') fmt = getopt.arg;
|
||||||
|
else if (c == 'n') fn_name_conv = getopt.arg;
|
||||||
|
}
|
||||||
|
if (getopt.ind == args.length) {
|
||||||
|
warn("Usage: k8 splice2bed.js <in.paf>");
|
||||||
|
exit(1);
|
||||||
|
}
|
||||||
|
|
||||||
|
var conv = null;
|
||||||
|
if (fn_name_conv != null) {
|
||||||
|
conv = new Map();
|
||||||
|
var file = new File(fn_name_conv);
|
||||||
|
var buf = new Bytes();
|
||||||
|
while (file.readline(buf) >= 0) {
|
||||||
|
var t = buf.toString().split("\t");
|
||||||
|
conv.put(t[0], t[1]);
|
||||||
|
}
|
||||||
|
buf.destroy();
|
||||||
|
file.close();
|
||||||
|
}
|
||||||
|
|
||||||
|
var file = new File(args[getopt.ind]);
|
||||||
|
var buf = new Bytes();
|
||||||
|
var a = [];
|
||||||
|
while (file.readline(buf) >= 0) {
|
||||||
|
var line = buf.toString();
|
||||||
|
if (line.charAt(0) == '@') continue; // skip SAM header lines
|
||||||
|
var t = line.split("\t");
|
||||||
|
var is_pri = false, cigar = null, a1;
|
||||||
|
var qname = conv != null? conv.get(t[0]) : null;
|
||||||
|
if (qname != null) t[0] = qname;
|
||||||
|
if (t.length >= 10 && t[4] != '+' && t[4] != '-' && /^\d+/.test(t[1])) { // SAM
|
||||||
|
var flag = parseInt(t[1]);
|
||||||
|
if (flag&1) t[0] += '/' + (flag>>6&3);
|
||||||
|
}
|
||||||
|
if (a.length && a[0][3] != t[0]) {
|
||||||
|
print_lines(a, fmt);
|
||||||
|
a = [];
|
||||||
|
}
|
||||||
|
if (t.length >= 12 && (t[4] == '+' || t[4] == '-')) { // PAF
|
||||||
|
for (var i = 12; i < t.length; ++i) {
|
||||||
|
if (t[i].substr(0, 5) == 'cg:Z:') {
|
||||||
|
cigar = t[i].substr(5);
|
||||||
|
} else if (t[i].substr(0, 5) == 's2:i:') {
|
||||||
|
is_pri = true;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
a1 = [t[5], t[7], t[8], t[0], Math.floor(t[9]/t[10]*1000), t[4]];
|
||||||
|
} else if (t.length >= 10) { // SAM
|
||||||
|
var flag = parseInt(t[1]);
|
||||||
|
if ((flag&4) || a[2] == '*') continue;
|
||||||
|
cigar = t[5];
|
||||||
|
is_pri = (flag&0x100)? false : true;
|
||||||
|
a1 = [t[2], parseInt(t[3])-1, null, t[0], 1000, (flag&16)? '-' : '+'];
|
||||||
|
} else {
|
||||||
|
throw Error("unrecognized input format");
|
||||||
|
}
|
||||||
|
if (cigar == null) throw Error("missing CIGAR");
|
||||||
|
var m, x0 = 0, x = 0, bs = [], bl = [];
|
||||||
|
while ((m = re.exec(cigar)) != null) {
|
||||||
|
if (m[2] == 'M' || m[2] == 'D') {
|
||||||
|
x += parseInt(m[1]);
|
||||||
|
} else if (m[2] == 'N') {
|
||||||
|
bs.push(x0);
|
||||||
|
bl.push(x - x0);
|
||||||
|
x += parseInt(m[1]);
|
||||||
|
x0 = x;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
bs.push(x0);
|
||||||
|
bl.push(x - x0);
|
||||||
|
// write the BED12 line
|
||||||
|
if (a1[2] == null) a1[2] = a1[1] + x;
|
||||||
|
a1.push(a1[1], a1[2]); // thick start/end is the same as start/end
|
||||||
|
a1.push(is_pri? 0 : 2, bs.length, bl.join(",")+",", bs.join(",")+",");
|
||||||
|
a.push(a1);
|
||||||
|
}
|
||||||
|
print_lines(a, fmt);
|
||||||
|
buf.destroy();
|
||||||
|
file.close();
|
||||||
|
if (conv != null) conv.destroy();
|
||||||
|
}
|
||||||
|
|
||||||
|
main(arguments);
|
||||||
@@ -11,11 +11,22 @@
|
|||||||
#define MM_DBG_NO_KALLOC 0x1
|
#define MM_DBG_NO_KALLOC 0x1
|
||||||
#define MM_DBG_PRINT_QNAME 0x2
|
#define MM_DBG_PRINT_QNAME 0x2
|
||||||
#define MM_DBG_PRINT_SEED 0x4
|
#define MM_DBG_PRINT_SEED 0x4
|
||||||
|
#define MM_DBG_PRINT_ALN_SEQ 0x8
|
||||||
|
|
||||||
|
#define MM_SEED_LONG_JOIN (1ULL<<40)
|
||||||
|
#define MM_SEED_IGNORE (1ULL<<41)
|
||||||
|
#define MM_SEED_TANDEM (1ULL<<42)
|
||||||
|
|
||||||
|
#define MM_SEED_SEG_SHIFT 48
|
||||||
|
#define MM_SEED_SEG_MASK (0xffULL<<(MM_SEED_SEG_SHIFT))
|
||||||
|
|
||||||
#ifndef kroundup32
|
#ifndef kroundup32
|
||||||
#define kroundup32(x) (--(x), (x)|=(x)>>1, (x)|=(x)>>2, (x)|=(x)>>4, (x)|=(x)>>8, (x)|=(x)>>16, ++(x))
|
#define kroundup32(x) (--(x), (x)|=(x)>>1, (x)|=(x)>>2, (x)|=(x)>>4, (x)|=(x)>>8, (x)|=(x)>>16, ++(x))
|
||||||
#endif
|
#endif
|
||||||
|
|
||||||
|
#define mm_seq4_set(s, i, c) ((s)[(i)>>3] |= (uint32_t)(c) << (((i)&7)<<2))
|
||||||
|
#define mm_seq4_get(s, i) ((s)[(i)>>3] >> (((i)&7)<<2) & 0xf)
|
||||||
|
|
||||||
#ifdef __cplusplus
|
#ifdef __cplusplus
|
||||||
extern "C" {
|
extern "C" {
|
||||||
#endif
|
#endif
|
||||||
@@ -28,6 +39,12 @@ typedef struct __kstring_t {
|
|||||||
} kstring_t;
|
} kstring_t;
|
||||||
#endif
|
#endif
|
||||||
|
|
||||||
|
typedef struct {
|
||||||
|
int n_u, n_a;
|
||||||
|
uint64_t *u;
|
||||||
|
mm128_t *a;
|
||||||
|
} mm_seg_t;
|
||||||
|
|
||||||
double cputime(void);
|
double cputime(void);
|
||||||
double realtime(void);
|
double realtime(void);
|
||||||
|
|
||||||
@@ -35,21 +52,38 @@ void radix_sort_128x(mm128_t *beg, mm128_t *end);
|
|||||||
void radix_sort_64(uint64_t *beg, uint64_t *end);
|
void radix_sort_64(uint64_t *beg, uint64_t *end);
|
||||||
uint32_t ks_ksmall_uint32_t(size_t n, uint32_t arr[], size_t kk);
|
uint32_t ks_ksmall_uint32_t(size_t n, uint32_t arr[], size_t kk);
|
||||||
|
|
||||||
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r);
|
void mm_sketch(void *km, const char *str, int len, int w, int k, uint32_t rid, int is_hpc, mm128_v *p);
|
||||||
void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r);
|
|
||||||
int mm_chain_dp(int max_dist, int bw, int max_skip, int min_cnt, int min_sc, int64_t n, mm128_t *a, uint64_t **_u, void *km);
|
void mm_write_sam_hdr(const mm_idx_t *mi, const char *rg, const char *ver, int argc, char *argv[]);
|
||||||
|
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int opt_flag);
|
||||||
|
void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int n_regs, const mm_reg1_t *regs);
|
||||||
|
void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regs, const mm_reg1_t *const* regs, void *km, int opt_flag);
|
||||||
|
|
||||||
|
void mm_idxopt_init(mm_idxopt_t *opt);
|
||||||
|
const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n);
|
||||||
|
int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq);
|
||||||
|
int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f);
|
||||||
|
mm128_t *mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int min_cnt, int min_sc, int is_cdna, int n_segs, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km);
|
||||||
mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a);
|
mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a);
|
||||||
|
|
||||||
mm_reg1_t *mm_gen_regs(void *km, int qlen, int n_u, uint64_t *u, mm128_t *a);
|
mm_reg1_t *mm_gen_regs(void *km, uint32_t hash, int qlen, int n_u, uint64_t *u, mm128_t *a);
|
||||||
void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a);
|
void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a);
|
||||||
void mm_sync_regs(void *km, int n_regs, mm_reg1_t *regs);
|
void mm_sync_regs(void *km, int n_regs, mm_reg1_t *regs);
|
||||||
|
int mm_squeeze_a(void *km, int n_regs, mm_reg1_t *regs, mm128_t *a);
|
||||||
int mm_set_sam_pri(int n, mm_reg1_t *r);
|
int mm_set_sam_pri(int n, mm_reg1_t *r);
|
||||||
void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r);
|
void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r, int sub_diff);
|
||||||
void mm_select_sub(void *km, float mask_level, float pri_ratio, int best_n, int *n_, mm_reg1_t *r);
|
void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int *n_, mm_reg1_t *r);
|
||||||
|
void mm_select_sub_multi(void *km, float pri_ratio, float pri1, float pri2, int max_gap_ref, int min_diff, int best_n, int n_segs, const int *qlens, int *n_, mm_reg1_t *r);
|
||||||
void mm_filter_regs(void *km, const mm_mapopt_t *opt, int *n_regs, mm_reg1_t *regs);
|
void mm_filter_regs(void *km, const mm_mapopt_t *opt, int *n_regs, mm_reg1_t *regs);
|
||||||
void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs, mm128_t *a);
|
void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs, mm128_t *a);
|
||||||
void mm_hit_sort_by_dp(void *km, int *n_regs, mm_reg1_t *r);
|
void mm_hit_sort_by_dp(void *km, int *n_regs, mm_reg1_t *r);
|
||||||
void mm_set_mapq(int n_regs, mm_reg1_t *regs);
|
void mm_set_mapq(int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr);
|
||||||
|
|
||||||
|
void mm_est_err(const mm_idx_t *mi, int qlen, int n_regs, mm_reg1_t *regs, const mm128_t *a, int32_t n, const uint64_t *mini_pos);
|
||||||
|
|
||||||
|
mm_seg_t *mm_seg_gen(void *km, uint32_t hash, int n_segs, const int *qlens, int n_regs0, const mm_reg1_t *regs0, int *n_regs, mm_reg1_t **regs, const mm128_t *a);
|
||||||
|
void mm_seg_free(void *km, int n_segs, mm_seg_t *segs);
|
||||||
|
void mm_pair(void *km, int max_gap_ref, int dp_bonus, int sub_diff, int match_sc, const int *qlens, int *n_regs, mm_reg1_t **regs);
|
||||||
|
|
||||||
#ifdef __cplusplus
|
#ifdef __cplusplus
|
||||||
}
|
}
|
||||||
|
|||||||
@@ -0,0 +1,177 @@
|
|||||||
|
#include <stdlib.h>
|
||||||
|
#include <math.h>
|
||||||
|
#include "mmpriv.h"
|
||||||
|
#include "kvec.h"
|
||||||
|
|
||||||
|
void mm_select_sub_multi(void *km, float pri_ratio, float pri1, float pri2, int max_gap_ref, int min_diff, int best_n, int n_segs, const int *qlens, int *n_, mm_reg1_t *r)
|
||||||
|
{
|
||||||
|
if (pri_ratio > 0.0f && *n_ > 0) {
|
||||||
|
int i, k, n = *n_, n_2nd = 0;
|
||||||
|
int max_dist = n_segs == 2? qlens[0] + qlens[1] + max_gap_ref : 0;
|
||||||
|
for (i = k = 0; i < n; ++i) {
|
||||||
|
int to_keep = 0;
|
||||||
|
if (r[i].parent == i) { // primary
|
||||||
|
to_keep = 1;
|
||||||
|
} else if (r[i].score + min_diff >= r[r[i].parent].score) {
|
||||||
|
to_keep = 1;
|
||||||
|
} else {
|
||||||
|
mm_reg1_t *p = &r[r[i].parent], *q = &r[i];
|
||||||
|
if (p->rev == q->rev && p->rid == q->rid && q->re - p->rs < max_dist && p->re - q->rs < max_dist) { // child and parent are close on the ref
|
||||||
|
if (q->score >= p->score * pri1)
|
||||||
|
to_keep = 1;
|
||||||
|
} else {
|
||||||
|
int is_par_both = (n_segs == 2 && p->qs < qlens[0] && p->qe > qlens[0]);
|
||||||
|
int is_chi_both = (n_segs == 2 && q->qs < qlens[0] && q->qe > qlens[0]);
|
||||||
|
if (is_chi_both || is_chi_both == is_par_both) {
|
||||||
|
if (q->score >= p->score * pri_ratio)
|
||||||
|
to_keep = 1;
|
||||||
|
} else { // the remaining case: is_chi_both == 0 && is_par_both == 1
|
||||||
|
if (q->score >= p->score * pri2)
|
||||||
|
to_keep = 1;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
if (to_keep && r[i].parent != i) {
|
||||||
|
if (n_2nd++ >= best_n) to_keep = 0; // don't keep if there are too many secondary hits
|
||||||
|
}
|
||||||
|
if (to_keep) r[k++] = r[i];
|
||||||
|
else if (r[i].p) free(r[i].p);
|
||||||
|
}
|
||||||
|
if (k != n) mm_sync_regs(km, k, r); // removing hits requires sync()
|
||||||
|
*n_ = k;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
void mm_set_pe_thru(const int *qlens, int *n_regs, mm_reg1_t **regs)
|
||||||
|
{
|
||||||
|
int s, i, n_pri[2], pri[2];
|
||||||
|
n_pri[0] = n_pri[1] = 0;
|
||||||
|
pri[0] = pri[1] = -1;
|
||||||
|
for (s = 0; s < 2; ++s)
|
||||||
|
for (i = 0; i < n_regs[s]; ++i)
|
||||||
|
if (regs[s][i].id == regs[s][i].parent)
|
||||||
|
++n_pri[s], pri[s] = i;
|
||||||
|
if (n_pri[0] == 1 && n_pri[1] == 1) {
|
||||||
|
mm_reg1_t *p = ®s[0][pri[0]];
|
||||||
|
mm_reg1_t *q = ®s[1][pri[1]];
|
||||||
|
if (p->rid == q->rid && p->rev == q->rev && abs(p->rs - q->rs) < 3 && abs(p->re - p->re) < 3
|
||||||
|
&& ((p->qs == 0 && qlens[1] - q->qe == 0) || (q->qs == 0 && qlens[0] - p->qe == 0)))
|
||||||
|
{
|
||||||
|
p->pe_thru = q->pe_thru = 1;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
#include "ksort.h"
|
||||||
|
|
||||||
|
typedef struct {
|
||||||
|
int s, rev;
|
||||||
|
uint64_t key;
|
||||||
|
mm_reg1_t *r;
|
||||||
|
} pair_arr_t;
|
||||||
|
|
||||||
|
#define sort_key_pair(a) ((a).key)
|
||||||
|
KRADIX_SORT_INIT(pair, pair_arr_t, sort_key_pair, 8)
|
||||||
|
|
||||||
|
void mm_pair(void *km, int max_gap_ref, int pe_bonus, int sub_diff, int match_sc, const int *qlens, int *n_regs, mm_reg1_t **regs)
|
||||||
|
{
|
||||||
|
int i, j, s, n, last[2], dp_thres, segs = 0, max_idx[2];
|
||||||
|
int64_t max;
|
||||||
|
pair_arr_t *a;
|
||||||
|
kvec_t(uint64_t) sc = {0,0,0};
|
||||||
|
|
||||||
|
a = (pair_arr_t*)kmalloc(km, (n_regs[0] + n_regs[1]) * sizeof(pair_arr_t));
|
||||||
|
for (s = n = 0, dp_thres = 0; s < 2; ++s) {
|
||||||
|
int max = 0;
|
||||||
|
for (i = 0; i < n_regs[s]; ++i) {
|
||||||
|
a[n].s = s;
|
||||||
|
a[n].r = ®s[s][i];
|
||||||
|
a[n].rev = a[n].r->rev;
|
||||||
|
a[n].key = (uint64_t)a[n].r->rid << 32 | a[n].r->rs<<1 | (s^a[n].rev);
|
||||||
|
max = max > a[n].r->p->dp_max? max : a[n].r->p->dp_max;
|
||||||
|
++n;
|
||||||
|
segs |= 1<<s;
|
||||||
|
}
|
||||||
|
dp_thres += max;
|
||||||
|
}
|
||||||
|
if (segs != 3) {
|
||||||
|
kfree(km, a); // only one end is mapped
|
||||||
|
return;
|
||||||
|
}
|
||||||
|
dp_thres -= pe_bonus;
|
||||||
|
if (dp_thres < 0) dp_thres = 0;
|
||||||
|
radix_sort_pair(a, a + n);
|
||||||
|
|
||||||
|
max = -1;
|
||||||
|
max_idx[0] = max_idx[1] = -1;
|
||||||
|
last[0] = last[1] = -1;
|
||||||
|
kv_resize(uint64_t, km, sc, n);
|
||||||
|
for (i = 0; i < n; ++i) {
|
||||||
|
if (a[i].key & 1) { // reverse first read or forward second read
|
||||||
|
mm_reg1_t *q, *r;
|
||||||
|
if (last[a[i].rev] < 0) continue;
|
||||||
|
r = a[i].r;
|
||||||
|
q = a[last[a[i].rev]].r;
|
||||||
|
if (r->rid != q->rid || r->rs - q->re > max_gap_ref) continue;
|
||||||
|
for (j = last[a[i].rev]; j >= 0; --j) {
|
||||||
|
int64_t score;
|
||||||
|
if (a[j].rev != a[i].rev || a[j].s == a[i].s) continue;
|
||||||
|
q = a[j].r;
|
||||||
|
if (r->rid != q->rid || r->rs - q->re > max_gap_ref) break;
|
||||||
|
if (r->p->dp_max + q->p->dp_max < dp_thres) continue;
|
||||||
|
score = (int64_t)(r->p->dp_max + q->p->dp_max) << 32 | (r->hash + q->hash);
|
||||||
|
if (score > max)
|
||||||
|
max = score, max_idx[a[j].s] = j, max_idx[a[i].s] = i;
|
||||||
|
kv_push(uint64_t, km, sc, score);
|
||||||
|
}
|
||||||
|
} else { // forward first read or reverse second read
|
||||||
|
last[a[i].rev] = i;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
if (sc.n > 1)
|
||||||
|
radix_sort_64(sc.a, sc.a + sc.n);
|
||||||
|
|
||||||
|
if (sc.n > 0 && max > 0) { // found at least one pair
|
||||||
|
int n_sub = 0, mapq_pe;
|
||||||
|
mm_reg1_t *r[2];
|
||||||
|
r[0] = a[max_idx[0]].r, r[1] = a[max_idx[1]].r;
|
||||||
|
r[0]->proper_frag = r[1]->proper_frag = 1;
|
||||||
|
for (s = 0; s < 2; ++s) {
|
||||||
|
if (r[s]->id != r[s]->parent) { // then lift to primary and update parent
|
||||||
|
mm_reg1_t *p = ®s[s][r[s]->parent];
|
||||||
|
for (i = 0; i < n_regs[s]; ++i)
|
||||||
|
if (regs[s][i].parent == p->id)
|
||||||
|
regs[s][i].parent = r[s]->id;
|
||||||
|
p->mapq = 0;
|
||||||
|
}
|
||||||
|
if (!r[s]->sam_pri) { // then sync sam_pri
|
||||||
|
for (i = 0; i < n_regs[s]; ++i)
|
||||||
|
regs[s][i].sam_pri = 0;
|
||||||
|
r[s]->sam_pri = 1;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
mapq_pe = r[0]->mapq > r[1]->mapq? r[0]->mapq : r[1]->mapq;
|
||||||
|
for (i = 0; i < sc.n; ++i)
|
||||||
|
if ((sc.a[i]>>32) + sub_diff >= max>>32)
|
||||||
|
++n_sub;
|
||||||
|
if (sc.n > 1) {
|
||||||
|
int mapq_pe_alt;
|
||||||
|
mapq_pe_alt = (int)(6.02f * ((max>>32) - (sc.a[sc.n - 2]>>32)) / match_sc - 4.343f * logf(n_sub)); // n_sub > 0 because it counts the optimal, too
|
||||||
|
mapq_pe = mapq_pe < mapq_pe_alt? mapq_pe : mapq_pe_alt;
|
||||||
|
}
|
||||||
|
if (r[0]->mapq < mapq_pe) r[0]->mapq = (int)(.2f * r[0]->mapq + .8f * mapq_pe + .499f);
|
||||||
|
if (r[1]->mapq < mapq_pe) r[1]->mapq = (int)(.2f * r[1]->mapq + .8f * mapq_pe + .499f);
|
||||||
|
if (sc.n == 1) {
|
||||||
|
if (r[0]->mapq < 2) r[0]->mapq = 2;
|
||||||
|
if (r[1]->mapq < 2) r[1]->mapq = 2;
|
||||||
|
} else if (max>>32 > sc.a[sc.n - 2]>>32) {
|
||||||
|
if (r[0]->mapq < 1) r[0]->mapq = 1;
|
||||||
|
if (r[1]->mapq < 1) r[1]->mapq = 1;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
|
||||||
|
kfree(km, a);
|
||||||
|
kfree(km, sc.a);
|
||||||
|
|
||||||
|
mm_set_pe_thru(qlens, n_regs, regs);
|
||||||
|
}
|
||||||
@@ -0,0 +1,145 @@
|
|||||||
|
==============================
|
||||||
|
Mappy: Minimap2 Python Binding
|
||||||
|
==============================
|
||||||
|
|
||||||
|
Mappy provides a convenient interface to `minimap2
|
||||||
|
<https://github.com/lh3/minimap2>`_, a fast and accurate C program to align
|
||||||
|
genomic and transcribe nucleotide sequences.
|
||||||
|
|
||||||
|
Installation
|
||||||
|
------------
|
||||||
|
|
||||||
|
Mappy depends on `zlib <http://zlib.net>`_. It can be installed with `pip
|
||||||
|
<https://en.wikipedia.org/wiki/Pip_(package_manager)>`_:
|
||||||
|
|
||||||
|
.. code:: shell
|
||||||
|
|
||||||
|
pip install --user mappy
|
||||||
|
|
||||||
|
or from the minimap2 github repo (`Cython <http://cython.org>`_ required):
|
||||||
|
|
||||||
|
.. code:: shell
|
||||||
|
|
||||||
|
git clone https://github.com/lh3/minimap2
|
||||||
|
cd minimap2
|
||||||
|
python setup.py install
|
||||||
|
|
||||||
|
Usage
|
||||||
|
-----
|
||||||
|
|
||||||
|
The following Python script demonstrates the key functionality of mappy:
|
||||||
|
|
||||||
|
.. code:: python
|
||||||
|
|
||||||
|
import mappy as mp
|
||||||
|
a = mp.Aligner("test/MT-human.fa") # load or build index
|
||||||
|
if not a: raise Exception("ERROR: failed to load/build index")
|
||||||
|
for name, seq, qual in mp.fastx_read("test/MT-orang.fa"): # read a fasta/q sequence
|
||||||
|
for hit in a.map(seq): # traverse alignments
|
||||||
|
print("{}\t{}\t{}\t{}".format(hit.ctg, hit.r_st, hit.r_en, hit.cigar_str))
|
||||||
|
|
||||||
|
APIs
|
||||||
|
----
|
||||||
|
|
||||||
|
Mappy implements two classes and one global function.
|
||||||
|
|
||||||
|
Class mappy.Aligner
|
||||||
|
~~~~~~~~~~~~~~~~~~~
|
||||||
|
|
||||||
|
.. code:: python
|
||||||
|
|
||||||
|
mappy.Aligner(fn_idx_in, preset=None, ...)
|
||||||
|
|
||||||
|
This constructor accepts the following arguments:
|
||||||
|
|
||||||
|
* **fn_idx_in**: index or sequence file name. Minimap2 automatically tests the
|
||||||
|
file type. If a sequence file is provided, minimap2 builds an index. The
|
||||||
|
sequence file can be optionally gzip'd.
|
||||||
|
|
||||||
|
* **preset**: minimap2 preset. Currently, minimap2 supports the following
|
||||||
|
presets: **sr** for single-end short reads; **map-pb** for PacBio
|
||||||
|
read-to-reference mapping; **map-ont** for Oxford Nanopore read mapping;
|
||||||
|
**splice** for long-read spliced alignment; **asm5** for assembly-to-assembly
|
||||||
|
alignment; **asm10** for full genome alignment of closely related species. Note
|
||||||
|
that the Python module does not support all-vs-all read overlapping.
|
||||||
|
|
||||||
|
* **k**: k-mer length, no larger than 28
|
||||||
|
|
||||||
|
* **w**: minimizer window size, no larger than 255
|
||||||
|
|
||||||
|
* **min_cnt**: mininum number of minimizers on a chain
|
||||||
|
|
||||||
|
* **min_chain_score**: minimum chaing score
|
||||||
|
|
||||||
|
* **bw**: chaining and alignment band width
|
||||||
|
|
||||||
|
* **best_n**: max number of alignments to return
|
||||||
|
|
||||||
|
* **n_threads**: number of indexing threads; 3 by default
|
||||||
|
|
||||||
|
* **fn_idx_out**: name of file to which the index is written
|
||||||
|
|
||||||
|
.. code:: python
|
||||||
|
|
||||||
|
mappy.Aligner.map(seq)
|
||||||
|
|
||||||
|
This method aligns :code:`seq` against the index. It is a generator, *yielding*
|
||||||
|
a series of :code:`mappy.Alignment` objects.
|
||||||
|
|
||||||
|
Class mappy.Alignment
|
||||||
|
~~~~~~~~~~~~~~~~~~~~~
|
||||||
|
|
||||||
|
This class describes an alignment. An object of this class has the following
|
||||||
|
properties:
|
||||||
|
|
||||||
|
* **ctg**: name of the reference sequence the query is mapped to
|
||||||
|
|
||||||
|
* **ctg_len**: total length of the reference sequence
|
||||||
|
|
||||||
|
* **r_st** and **r_en**: start and end positions on the reference
|
||||||
|
|
||||||
|
* **q_st** and **q_en**: start and end positions on the query
|
||||||
|
|
||||||
|
* **strand**: +1 if on the forward strand; -1 if on the reverse strand
|
||||||
|
|
||||||
|
* **mapq**: mapping quality
|
||||||
|
|
||||||
|
* **blen**: length of the alignment, including both alignment matches and gaps
|
||||||
|
but excluding ambiguous bases.
|
||||||
|
|
||||||
|
* **mlen**: length of the matching bases in the alignment, excluding ambiguous
|
||||||
|
base matches.
|
||||||
|
|
||||||
|
* **NM**: number of mismatches, gaps and ambiguous poistions in the alignment
|
||||||
|
|
||||||
|
* **trans_strand**: transcript strand. +1 if on the forward strand; -1 if on the
|
||||||
|
reverse strand; 0 if unknown
|
||||||
|
|
||||||
|
* **is_primary**: if the alignment is primary (typically the best and the first
|
||||||
|
to generate)
|
||||||
|
|
||||||
|
* **cigar_str**: CIGAR string
|
||||||
|
|
||||||
|
* **cigar**: CIGAR returned as an array of shape :code:`(n_cigar,2)`. The two
|
||||||
|
numbers give the length and the operator of each CIGAR operation.
|
||||||
|
|
||||||
|
An :code:`Alignment` object can be converted to a string with :code:`str()` in
|
||||||
|
the following format:
|
||||||
|
|
||||||
|
::
|
||||||
|
|
||||||
|
q_st q_en strand ctg ctg_len r_st r_en mlen blen mapq cg:Z:cigar_str
|
||||||
|
|
||||||
|
It is effectively the PAF format without the QueryName and QueryLength columns
|
||||||
|
(the first two columns in PAF).
|
||||||
|
|
||||||
|
Function mappy.fastx_read
|
||||||
|
~~~~~~~~~~~~~~~~~~~~~~~~~
|
||||||
|
|
||||||
|
.. code:: python
|
||||||
|
|
||||||
|
mappy.fastx_read(fn)
|
||||||
|
|
||||||
|
This generator function opens a FASTA/FASTQ file and *yields* a
|
||||||
|
:code:`(name,seq,qual)` tuple for each sequence entry. The input file may be
|
||||||
|
optionally gzip'd.
|
||||||
@@ -0,0 +1,71 @@
|
|||||||
|
#ifndef CMAPPY_H
|
||||||
|
#define CMAPPY_H
|
||||||
|
|
||||||
|
#include <stdlib.h>
|
||||||
|
#include <string.h>
|
||||||
|
#include <zlib.h>
|
||||||
|
#include "minimap.h"
|
||||||
|
#include "kseq.h"
|
||||||
|
KSEQ_DECLARE(gzFile)
|
||||||
|
|
||||||
|
typedef struct {
|
||||||
|
const char *ctg;
|
||||||
|
int32_t ctg_start, ctg_end;
|
||||||
|
int32_t qry_start, qry_end;
|
||||||
|
int32_t blen, mlen, NM, ctg_len;
|
||||||
|
uint8_t mapq, is_primary;
|
||||||
|
int8_t strand, trans_strand;
|
||||||
|
int32_t n_cigar32;
|
||||||
|
uint32_t *cigar32;
|
||||||
|
} mm_hitpy_t;
|
||||||
|
|
||||||
|
static inline void mm_reg2hitpy(const mm_idx_t *mi, mm_reg1_t *r, mm_hitpy_t *h)
|
||||||
|
{
|
||||||
|
h->ctg = mi->seq[r->rid].name;
|
||||||
|
h->ctg_len = mi->seq[r->rid].len;
|
||||||
|
h->ctg_start = r->rs, h->ctg_end = r->re;
|
||||||
|
h->qry_start = r->qs, h->qry_end = r->qe;
|
||||||
|
h->strand = r->rev? -1 : 1;
|
||||||
|
h->mapq = r->mapq;
|
||||||
|
h->mlen = r->mlen;
|
||||||
|
h->blen = r->blen;
|
||||||
|
h->NM = r->blen - r->mlen + r->p->n_ambi;
|
||||||
|
h->trans_strand = r->p->trans_strand == 1? 1 : r->p->trans_strand == 2? -1 : 0;
|
||||||
|
h->is_primary = (r->id == r->parent);
|
||||||
|
h->n_cigar32 = r->p->n_cigar;
|
||||||
|
h->cigar32 = r->p->cigar;
|
||||||
|
}
|
||||||
|
|
||||||
|
static inline void mm_free_reg1(mm_reg1_t *r)
|
||||||
|
{
|
||||||
|
free(r->p);
|
||||||
|
}
|
||||||
|
|
||||||
|
static inline kseq_t *mm_fastx_open(const char *fn)
|
||||||
|
{
|
||||||
|
gzFile fp;
|
||||||
|
fp = fn && strcmp(fn, "-") != 0? gzopen(fn, "r") : gzdopen(fileno(stdin), "r");
|
||||||
|
return kseq_init(fp);
|
||||||
|
}
|
||||||
|
|
||||||
|
static inline void mm_fastx_close(kseq_t *ks)
|
||||||
|
{
|
||||||
|
gzFile fp;
|
||||||
|
fp = ks->f->f;
|
||||||
|
kseq_destroy(ks);
|
||||||
|
gzclose(fp);
|
||||||
|
}
|
||||||
|
|
||||||
|
static inline int mm_verbose_level(int v)
|
||||||
|
{
|
||||||
|
if (v >= 0) mm_verbose = v;
|
||||||
|
return mm_verbose;
|
||||||
|
}
|
||||||
|
|
||||||
|
static inline void mm_reset_timer(void)
|
||||||
|
{
|
||||||
|
extern double realtime(void);
|
||||||
|
mm_realtime0 = realtime();
|
||||||
|
}
|
||||||
|
|
||||||
|
#endif
|
||||||
@@ -0,0 +1,118 @@
|
|||||||
|
from libc.stdint cimport int8_t, uint8_t, int32_t, int64_t, uint32_t, uint64_t
|
||||||
|
|
||||||
|
cdef extern from "minimap.h":
|
||||||
|
#
|
||||||
|
# Options
|
||||||
|
#
|
||||||
|
ctypedef struct mm_idxopt_t:
|
||||||
|
short k, w, flag, bucket_bits
|
||||||
|
int mini_batch_size
|
||||||
|
uint64_t batch_size
|
||||||
|
|
||||||
|
ctypedef struct mm_mapopt_t:
|
||||||
|
int seed
|
||||||
|
int sdust_thres
|
||||||
|
int flag
|
||||||
|
int bw
|
||||||
|
int max_gap, max_gap_ref
|
||||||
|
int max_frag_len
|
||||||
|
int max_chain_skip
|
||||||
|
int min_cnt
|
||||||
|
int min_chain_score
|
||||||
|
float mask_level
|
||||||
|
float pri_ratio
|
||||||
|
int best_n
|
||||||
|
int max_join_long, max_join_short
|
||||||
|
int min_join_flank_sc
|
||||||
|
int a, b, q, e, q2, e2
|
||||||
|
int noncan
|
||||||
|
int zdrop
|
||||||
|
int end_bonus
|
||||||
|
int min_dp_max
|
||||||
|
int min_ksw_len
|
||||||
|
int anchor_ext_len, anchor_ext_shift
|
||||||
|
int pe_ori, pe_bonus
|
||||||
|
float mid_occ_frac
|
||||||
|
int32_t mid_occ
|
||||||
|
int32_t max_occ
|
||||||
|
int mini_batch_size
|
||||||
|
|
||||||
|
int mm_set_opt(char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
|
||||||
|
int mm_verbose
|
||||||
|
|
||||||
|
#
|
||||||
|
# Indexing
|
||||||
|
#
|
||||||
|
ctypedef struct mm_idx_seq_t:
|
||||||
|
char *name
|
||||||
|
uint64_t offset
|
||||||
|
uint32_t len
|
||||||
|
|
||||||
|
ctypedef struct mm_idx_bucket_t:
|
||||||
|
pass
|
||||||
|
|
||||||
|
ctypedef struct mm_idx_t:
|
||||||
|
int32_t b, w, k, flag
|
||||||
|
uint32_t n_seq
|
||||||
|
mm_idx_seq_t *seq
|
||||||
|
uint32_t *S
|
||||||
|
mm_idx_bucket_t *B
|
||||||
|
void *km
|
||||||
|
|
||||||
|
ctypedef struct mm_idx_reader_t:
|
||||||
|
pass
|
||||||
|
|
||||||
|
mm_idx_reader_t *mm_idx_reader_open(const char *fn, const mm_idxopt_t *opt, const char *fn_out)
|
||||||
|
mm_idx_t *mm_idx_reader_read(mm_idx_reader_t *r, int n_threads)
|
||||||
|
void mm_idx_reader_close(mm_idx_reader_t *r)
|
||||||
|
void mm_idx_destroy(mm_idx_t *mi)
|
||||||
|
void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
|
||||||
|
|
||||||
|
#
|
||||||
|
# Mapping (key struct defined in cmappy.h below)
|
||||||
|
#
|
||||||
|
ctypedef struct mm_reg1_t:
|
||||||
|
pass
|
||||||
|
|
||||||
|
ctypedef struct mm_tbuf_t:
|
||||||
|
pass
|
||||||
|
|
||||||
|
mm_tbuf_t *mm_tbuf_init()
|
||||||
|
void mm_tbuf_destroy(mm_tbuf_t *b)
|
||||||
|
mm_reg1_t *mm_map(const mm_idx_t *mi, int l_seq, const char *seq, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *name)
|
||||||
|
|
||||||
|
#
|
||||||
|
# Helper header (because it is hard to expose mm_reg1_t with Cython)
|
||||||
|
#
|
||||||
|
cdef extern from "cmappy.h":
|
||||||
|
ctypedef struct mm_hitpy_t:
|
||||||
|
const char *ctg
|
||||||
|
int32_t ctg_start, ctg_end
|
||||||
|
int32_t qry_start, qry_end
|
||||||
|
int32_t blen, mlen, NM, ctg_len
|
||||||
|
uint8_t mapq, is_primary
|
||||||
|
int8_t strand, trans_strand
|
||||||
|
int32_t n_cigar32
|
||||||
|
uint32_t *cigar32
|
||||||
|
|
||||||
|
void mm_reg2hitpy(const mm_idx_t *mi, mm_reg1_t *r, mm_hitpy_t *h)
|
||||||
|
void mm_free_reg1(mm_reg1_t *r)
|
||||||
|
|
||||||
|
ctypedef struct kstring_t:
|
||||||
|
unsigned l, m
|
||||||
|
char *s
|
||||||
|
|
||||||
|
ctypedef struct kstream_t:
|
||||||
|
pass
|
||||||
|
|
||||||
|
ctypedef struct kseq_t:
|
||||||
|
kstring_t name, comment, seq, qual
|
||||||
|
int last_char
|
||||||
|
kstream_t *f
|
||||||
|
|
||||||
|
kseq_t *mm_fastx_open(const char *fn)
|
||||||
|
void mm_fastx_close(kseq_t *ks)
|
||||||
|
int kseq_read(kseq_t *seq)
|
||||||
|
|
||||||
|
int mm_verbose_level(int v)
|
||||||
|
void mm_reset_timer()
|
||||||
@@ -0,0 +1,163 @@
|
|||||||
|
from libc.stdint cimport uint8_t, int8_t
|
||||||
|
from libc.stdlib cimport free
|
||||||
|
cimport cmappy
|
||||||
|
|
||||||
|
cmappy.mm_reset_timer()
|
||||||
|
|
||||||
|
cdef class Alignment:
|
||||||
|
cdef int _ctg_len, _r_st, _r_en
|
||||||
|
cdef int _q_st, _q_en
|
||||||
|
cdef int _NM, _mlen, _blen
|
||||||
|
cdef int8_t _strand, _trans_strand
|
||||||
|
cdef uint8_t _mapq, _is_primary
|
||||||
|
cdef _ctg, _cigar # these are python objects
|
||||||
|
|
||||||
|
def __cinit__(self, ctg, cl, cs, ce, strand, qs, qe, mapq, cigar, is_primary, mlen, blen, NM, trans_strand):
|
||||||
|
self._ctg = ctg if isinstance(ctg, str) else ctg.decode()
|
||||||
|
self._ctg_len, self._r_st, self._r_en = cl, cs, ce
|
||||||
|
self._strand, self._q_st, self._q_en = strand, qs, qe
|
||||||
|
self._NM, self._mlen, self._blen = NM, mlen, blen
|
||||||
|
self._mapq = mapq
|
||||||
|
self._cigar = cigar
|
||||||
|
self._is_primary = is_primary
|
||||||
|
self._trans_strand = trans_strand
|
||||||
|
|
||||||
|
@property
|
||||||
|
def ctg(self): return self._ctg
|
||||||
|
|
||||||
|
@property
|
||||||
|
def ctg_len(self): return self._ctg_len
|
||||||
|
|
||||||
|
@property
|
||||||
|
def r_st(self): return self._r_st
|
||||||
|
|
||||||
|
@property
|
||||||
|
def r_en(self): return self._r_en
|
||||||
|
|
||||||
|
@property
|
||||||
|
def strand(self): return self._strand
|
||||||
|
|
||||||
|
@property
|
||||||
|
def trans_strand(self): return self._trans_strand
|
||||||
|
|
||||||
|
@property
|
||||||
|
def blen(self): return self._blen
|
||||||
|
|
||||||
|
@property
|
||||||
|
def mlen(self): return self._mlen
|
||||||
|
|
||||||
|
@property
|
||||||
|
def NM(self): return self._NM
|
||||||
|
|
||||||
|
@property
|
||||||
|
def is_primary(self): return (self._is_primary != 0)
|
||||||
|
|
||||||
|
@property
|
||||||
|
def q_st(self): return self._q_st
|
||||||
|
|
||||||
|
@property
|
||||||
|
def q_en(self): return self._q_en
|
||||||
|
|
||||||
|
@property
|
||||||
|
def mapq(self): return self._mapq
|
||||||
|
|
||||||
|
@property
|
||||||
|
def cigar(self): return self._cigar
|
||||||
|
|
||||||
|
@property
|
||||||
|
def cigar_str(self):
|
||||||
|
return "".join(map(lambda x: str(x[0]) + 'MIDNSH'[x[1]], self._cigar))
|
||||||
|
|
||||||
|
def __str__(self):
|
||||||
|
if self._strand > 0: strand = '+'
|
||||||
|
elif self._strand < 0: strand = '-'
|
||||||
|
else: strand = '?'
|
||||||
|
if self._is_primary != 0: tp = 'tp:A:P'
|
||||||
|
else: tp = 'tp:A:S'
|
||||||
|
if self._trans_strand > 0: ts = 'ts:A:+'
|
||||||
|
elif self._trans_strand < 0: ts = 'ts:A:-'
|
||||||
|
else: ts = 'ts:A:.'
|
||||||
|
return "\t".join([str(self._q_st), str(self._q_en), strand, self._ctg, str(self._ctg_len), str(self._r_st), str(self._r_en),
|
||||||
|
str(self._mlen), str(self._blen), str(self._mapq), tp, ts, "cg:Z:" + self.cigar_str])
|
||||||
|
|
||||||
|
cdef class ThreadBuffer:
|
||||||
|
cdef cmappy.mm_tbuf_t *_b
|
||||||
|
|
||||||
|
def __cinit__(self):
|
||||||
|
self._b = cmappy.mm_tbuf_init()
|
||||||
|
|
||||||
|
def __dealloc__(self):
|
||||||
|
cmappy.mm_tbuf_destroy(self._b)
|
||||||
|
|
||||||
|
cdef class Aligner:
|
||||||
|
cdef cmappy.mm_idx_t *_idx
|
||||||
|
cdef cmappy.mm_idxopt_t idx_opt
|
||||||
|
cdef cmappy.mm_mapopt_t map_opt
|
||||||
|
|
||||||
|
def __cinit__(self, fn_idx_in, preset=None, k=None, w=None, min_cnt=None, min_chain_score=None, min_dp_score=None, bw=None, best_n=None, n_threads=3, fn_idx_out=None):
|
||||||
|
cmappy.mm_set_opt(NULL, &self.idx_opt, &self.map_opt) # set the default options
|
||||||
|
if preset is not None:
|
||||||
|
cmappy.mm_set_opt(str.encode(preset), &self.idx_opt, &self.map_opt) # apply preset
|
||||||
|
self.map_opt.flag |= 4 # always perform alignment
|
||||||
|
self.idx_opt.batch_size = 0x7fffffffffffffffL # always build a uni-part index
|
||||||
|
if k is not None: self.idx_opt.k = k
|
||||||
|
if w is not None: self.idx_opt.w = w
|
||||||
|
if min_cnt is not None: self.map_opt.min_cnt = min_cnt
|
||||||
|
if min_chain_score is not None: self.map_opt.min_chain_score = min_chain_score
|
||||||
|
if min_dp_score is not None: self.map_opt.min_dp_max = min_dp_score
|
||||||
|
if bw is not None: self.map_opt.bw = bw
|
||||||
|
if best_n is not None: self.best_n = best_n
|
||||||
|
|
||||||
|
cdef cmappy.mm_idx_reader_t *r;
|
||||||
|
if fn_idx_out is None:
|
||||||
|
r = cmappy.mm_idx_reader_open(str.encode(fn_idx_in), &self.idx_opt, NULL)
|
||||||
|
else:
|
||||||
|
r = cmappy.mm_idx_reader_open(str.encode(fn_idx_in), &self.idx_opt, fn_idx_out)
|
||||||
|
if r is not NULL:
|
||||||
|
self._idx = cmappy.mm_idx_reader_read(r, n_threads) # NB: ONLY read the first part
|
||||||
|
cmappy.mm_idx_reader_close(r)
|
||||||
|
cmappy.mm_mapopt_update(&self.map_opt, self._idx)
|
||||||
|
|
||||||
|
def __dealloc__(self):
|
||||||
|
if self._idx is not NULL:
|
||||||
|
cmappy.mm_idx_destroy(self._idx)
|
||||||
|
|
||||||
|
def __bool__(self):
|
||||||
|
return (self._idx != NULL)
|
||||||
|
|
||||||
|
def map(self, seq, buf=None):
|
||||||
|
cdef cmappy.mm_reg1_t *regs
|
||||||
|
cdef cmappy.mm_hitpy_t h
|
||||||
|
cdef ThreadBuffer b
|
||||||
|
cdef int n_regs
|
||||||
|
|
||||||
|
if self._idx is NULL: return None
|
||||||
|
if buf is None: b = ThreadBuffer()
|
||||||
|
else: b = buf
|
||||||
|
regs = cmappy.mm_map(self._idx, len(seq), str.encode(seq), &n_regs, b._b, &self.map_opt, NULL)
|
||||||
|
|
||||||
|
for i in range(n_regs):
|
||||||
|
cmappy.mm_reg2hitpy(self._idx, ®s[i], &h)
|
||||||
|
cigar = []
|
||||||
|
for k in range(h.n_cigar32):
|
||||||
|
c = h.cigar32[k]
|
||||||
|
cigar.append([c>>4, c&0xf])
|
||||||
|
yield Alignment(h.ctg, h.ctg_len, h.ctg_start, h.ctg_end, h.strand, h.qry_start, h.qry_end, h.mapq, cigar, h.is_primary, h.mlen, h.blen, h.NM, h.trans_strand)
|
||||||
|
cmappy.mm_free_reg1(®s[i])
|
||||||
|
free(regs)
|
||||||
|
|
||||||
|
def fastx_read(fn):
|
||||||
|
cdef cmappy.kseq_t *ks
|
||||||
|
ks = cmappy.mm_fastx_open(str.encode(fn))
|
||||||
|
if ks is NULL: return None
|
||||||
|
while cmappy.kseq_read(ks) >= 0:
|
||||||
|
if ks.qual.l > 0: qual = ks.qual.s if isinstance(ks.qual.s, str) else ks.qual.s.decode()
|
||||||
|
else: qual = None
|
||||||
|
name = ks.name.s if isinstance(ks.name.s, str) else ks.name.s.decode()
|
||||||
|
seq = ks.seq.s if isinstance(ks.seq.s, str) else ks.seq.s.decode()
|
||||||
|
yield name, seq, qual
|
||||||
|
cmappy.mm_fastx_close(ks)
|
||||||
|
|
||||||
|
def verbose(v=None):
|
||||||
|
if v is None: v = -1
|
||||||
|
return cmappy.mm_verbose_level(v)
|
||||||
Executable
+35
@@ -0,0 +1,35 @@
|
|||||||
|
#!/usr/bin/env python
|
||||||
|
|
||||||
|
import sys, getopt
|
||||||
|
import mappy as mp
|
||||||
|
|
||||||
|
def main(argv):
|
||||||
|
opts, args = getopt.getopt(argv[1:], "x:n:m:k:w:r:")
|
||||||
|
if len(args) < 2:
|
||||||
|
print("Usage: minimap2.py [options] <ref.fa>|<ref.mmi> <query.fq>")
|
||||||
|
print("Options:")
|
||||||
|
print(" -x STR preset: sr, map-pb, map-ont, asm5, asm10 or splice")
|
||||||
|
print(" -n INT mininum number of minimizers")
|
||||||
|
print(" -m INT mininum chaining score")
|
||||||
|
print(" -k INT k-mer length")
|
||||||
|
print(" -w INT minimizer window length")
|
||||||
|
print(" -r INT band width")
|
||||||
|
sys.exit(1)
|
||||||
|
|
||||||
|
preset, min_cnt, min_sc, k, w, bw = None, None, None, None, None, None
|
||||||
|
for opt, arg in opts:
|
||||||
|
if opt == '-x': preset = arg
|
||||||
|
elif opt == '-n': min_cnt = int(arg)
|
||||||
|
elif opt == '-m': min_chain_score = int(arg)
|
||||||
|
elif opt == '-r': bw = int(arg)
|
||||||
|
elif opt == '-k': k = int(arg)
|
||||||
|
elif opt == '-w': w = int(arg)
|
||||||
|
|
||||||
|
a = mp.Aligner(args[0], preset=preset, min_cnt=min_cnt, min_chain_score=min_sc, k=k, w=w, bw=bw)
|
||||||
|
if not a: raise Exception("ERROR: failed to load/build index file '{}'".format(args[0]))
|
||||||
|
for name, seq, qual in mp.fastx_read(args[1]): # read one sequence
|
||||||
|
for h in a.map(seq): # traverse hits
|
||||||
|
print('{}\t{}\t{}'.format(name, len(seq), h))
|
||||||
|
|
||||||
|
if __name__ == "__main__":
|
||||||
|
main(sys.argv)
|
||||||
@@ -56,6 +56,7 @@ sdust_buf_t *sdust_buf_init(void *km)
|
|||||||
buf = (sdust_buf_t*)kcalloc(km, 1, sizeof(sdust_buf_t));
|
buf = (sdust_buf_t*)kcalloc(km, 1, sizeof(sdust_buf_t));
|
||||||
buf->km = km;
|
buf->km = km;
|
||||||
buf->w = kdq_init(int, buf->km);
|
buf->w = kdq_init(int, buf->km);
|
||||||
|
kdq_resize(int, buf->w, 8);
|
||||||
return buf;
|
return buf;
|
||||||
}
|
}
|
||||||
|
|
||||||
@@ -176,7 +177,7 @@ uint64_t *sdust(void *km, const uint8_t *seq, int l_seq, int T, int W, int *n)
|
|||||||
#ifdef _SDUST_MAIN
|
#ifdef _SDUST_MAIN
|
||||||
#include <zlib.h>
|
#include <zlib.h>
|
||||||
#include <stdio.h>
|
#include <stdio.h>
|
||||||
#include <unistd.h>
|
#include "getopt.h"
|
||||||
#include "kseq.h"
|
#include "kseq.h"
|
||||||
KSEQ_INIT(gzFile, gzread)
|
KSEQ_INIT(gzFile, gzread)
|
||||||
|
|
||||||
|
|||||||
@@ -0,0 +1,55 @@
|
|||||||
|
try:
|
||||||
|
from setuptools import setup, Extension
|
||||||
|
except ImportError:
|
||||||
|
from distutils.core import setup
|
||||||
|
from distutils.extension import Extension
|
||||||
|
|
||||||
|
cmdclass = {}
|
||||||
|
|
||||||
|
try:
|
||||||
|
from Cython.Build import build_ext
|
||||||
|
except ImportError: # without Cython
|
||||||
|
module_src = 'python/mappy.c'
|
||||||
|
else: # with Cython
|
||||||
|
module_src = 'python/mappy.pyx'
|
||||||
|
cmdclass['build_ext'] = build_ext
|
||||||
|
|
||||||
|
import sys
|
||||||
|
sys.path.append('python')
|
||||||
|
|
||||||
|
def readme():
|
||||||
|
with open('python/README.rst') as f:
|
||||||
|
return f.read()
|
||||||
|
|
||||||
|
setup(
|
||||||
|
name = 'mappy',
|
||||||
|
version = '2.7',
|
||||||
|
url = 'https://github.com/lh3/minimap2',
|
||||||
|
description = 'Minimap2 python binding',
|
||||||
|
long_description = readme(),
|
||||||
|
author = 'Heng Li',
|
||||||
|
author_email = 'lh3@me.com',
|
||||||
|
license = 'MIT',
|
||||||
|
keywords = 'sequence-alignment',
|
||||||
|
scripts = ['python/minimap2.py'],
|
||||||
|
ext_modules = [Extension('mappy',
|
||||||
|
sources = [module_src, 'align.c', 'bseq.c', 'chain.c', 'format.c', 'hit.c', 'index.c', 'pe.c',
|
||||||
|
'ksw2_extd2_sse.c', 'ksw2_exts2_sse.c', 'ksw2_extz2_sse.c', 'ksw2_ll_sse.c',
|
||||||
|
'kalloc.c', 'kthread.c', 'map.c', 'misc.c', 'sdust.c', 'sketch.c', 'esterr.c'],
|
||||||
|
depends = ['minimap.h', 'bseq.h', 'kalloc.h', 'kdq.h', 'khash.h', 'kseq.h', 'ksort.h',
|
||||||
|
'ksw2.h', 'kthread.h', 'kvec.h', 'mmpriv.h', 'sdust.h',
|
||||||
|
'python/cmappy.h', 'python/cmappy.pxd'],
|
||||||
|
extra_compile_args = ['-msse4'], # WARNING: ancient x86_64 CPUs don't have SSE4
|
||||||
|
include_dirs = ['.'],
|
||||||
|
libraries = ['z', 'm', 'pthread'])],
|
||||||
|
classifiers = [
|
||||||
|
'Development Status :: 4 - Beta',
|
||||||
|
'License :: OSI Approved :: MIT License',
|
||||||
|
'Operating System :: POSIX',
|
||||||
|
'Programming Language :: C',
|
||||||
|
'Programming Language :: Cython',
|
||||||
|
'Programming Language :: Python :: 2.7',
|
||||||
|
'Programming Language :: Python :: 3',
|
||||||
|
'Intended Audience :: Science/Research',
|
||||||
|
'Topic :: Scientific/Engineering :: Bio-Informatics'],
|
||||||
|
cmdclass = cmdclass)
|
||||||
@@ -11,9 +11,9 @@ unsigned char seq_nt4_table[256] = {
|
|||||||
4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
|
4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
|
||||||
4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
|
4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
|
||||||
4, 0, 4, 1, 4, 4, 4, 2, 4, 4, 4, 4, 4, 4, 4, 4,
|
4, 0, 4, 1, 4, 4, 4, 2, 4, 4, 4, 4, 4, 4, 4, 4,
|
||||||
4, 4, 4, 4, 3, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
|
4, 4, 4, 4, 3, 3, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
|
||||||
4, 0, 4, 1, 4, 4, 4, 2, 4, 4, 4, 4, 4, 4, 4, 4,
|
4, 0, 4, 1, 4, 4, 4, 2, 4, 4, 4, 4, 4, 4, 4, 4,
|
||||||
4, 4, 4, 4, 3, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
|
4, 4, 4, 4, 3, 3, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
|
||||||
4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
|
4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
|
||||||
4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
|
4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
|
||||||
4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
|
4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
|
||||||
@@ -77,11 +77,10 @@ void mm_sketch(void *km, const char *str, int len, int w, int k, uint32_t rid, i
|
|||||||
{
|
{
|
||||||
uint64_t shift1 = 2 * (k - 1), mask = (1ULL<<2*k) - 1, kmer[2] = {0,0};
|
uint64_t shift1 = 2 * (k - 1), mask = (1ULL<<2*k) - 1, kmer[2] = {0,0};
|
||||||
int i, j, l, buf_pos, min_pos, kmer_span = 0;
|
int i, j, l, buf_pos, min_pos, kmer_span = 0;
|
||||||
mm128_t *buf, min = { UINT64_MAX, UINT64_MAX };
|
mm128_t buf[256], min = { UINT64_MAX, UINT64_MAX };
|
||||||
tiny_queue_t tq;
|
tiny_queue_t tq;
|
||||||
|
|
||||||
assert(len > 0 && w > 0 && k > 0 && k <= 28); // 56 bits for k-mer; could use long k-mers, but 28 enough in practice
|
assert(len > 0 && (w > 0 && w < 256) && (k > 0 && k <= 28)); // 56 bits for k-mer; could use long k-mers, but 28 enough in practice
|
||||||
buf = (mm128_t*)alloca(w * 16);
|
|
||||||
memset(buf, 0xff, w * 16);
|
memset(buf, 0xff, w * 16);
|
||||||
memset(&tq, 0, sizeof(tiny_queue_t));
|
memset(&tq, 0, sizeof(tiny_queue_t));
|
||||||
kv_resize(mm128_t, km, *p, p->n + len/w);
|
kv_resize(mm128_t, km, *p, p->n + len/w);
|
||||||
@@ -102,34 +101,34 @@ void mm_sketch(void *km, const char *str, int len, int w, int k, uint32_t rid, i
|
|||||||
tq_push(&tq, skip_len);
|
tq_push(&tq, skip_len);
|
||||||
kmer_span += skip_len;
|
kmer_span += skip_len;
|
||||||
if (tq.count > k) kmer_span -= tq_shift(&tq);
|
if (tq.count > k) kmer_span -= tq_shift(&tq);
|
||||||
if (kmer_span >= 256) continue; // make sure $kmer_span does not take more than 8 bits
|
|
||||||
} else kmer_span = l + 1 < k? l + 1 : k;
|
} else kmer_span = l + 1 < k? l + 1 : k;
|
||||||
kmer[0] = (kmer[0] << 2 | c) & mask; // forward k-mer
|
kmer[0] = (kmer[0] << 2 | c) & mask; // forward k-mer
|
||||||
kmer[1] = (kmer[1] >> 2) | (3ULL^c) << shift1; // reverse k-mer
|
kmer[1] = (kmer[1] >> 2) | (3ULL^c) << shift1; // reverse k-mer
|
||||||
if (kmer[0] == kmer[1]) continue; // skip "symmetric k-mers" as we don't know it strand
|
if (kmer[0] == kmer[1]) continue; // skip "symmetric k-mers" as we don't know it strand
|
||||||
z = kmer[0] < kmer[1]? 0 : 1; // strand
|
z = kmer[0] < kmer[1]? 0 : 1; // strand
|
||||||
if (++l >= k) {
|
++l;
|
||||||
|
if (l >= k && kmer_span < 256) {
|
||||||
info.x = hash64(kmer[z], mask) << 8 | kmer_span;
|
info.x = hash64(kmer[z], mask) << 8 | kmer_span;
|
||||||
info.y = (uint64_t)rid<<32 | (uint32_t)i<<1 | z;
|
info.y = (uint64_t)rid<<32 | (uint32_t)i<<1 | z;
|
||||||
}
|
}
|
||||||
} else l = 0, tq.count = tq.front = 0, kmer_span = 0;
|
} else l = 0, tq.count = tq.front = 0, kmer_span = 0;
|
||||||
buf[buf_pos] = info; // need to do this here as appropriate buf_pos and buf[buf_pos] are needed below
|
buf[buf_pos] = info; // need to do this here as appropriate buf_pos and buf[buf_pos] are needed below
|
||||||
if (l == w + k - 1) { // special case for the first window - because identical k-mers are not stored yet
|
if (l == w + k - 1 && min.x != UINT64_MAX) { // special case for the first window - because identical k-mers are not stored yet
|
||||||
for (j = buf_pos + 1; j < w; ++j)
|
for (j = buf_pos + 1; j < w; ++j)
|
||||||
if (min.x == buf[j].x && buf[j].y != min.y) kv_push(mm128_t, km, *p, buf[j]);
|
if (min.x == buf[j].x && buf[j].y != min.y) kv_push(mm128_t, km, *p, buf[j]);
|
||||||
for (j = 0; j < buf_pos; ++j)
|
for (j = 0; j < buf_pos; ++j)
|
||||||
if (min.x == buf[j].x && buf[j].y != min.y) kv_push(mm128_t, km, *p, buf[j]);
|
if (min.x == buf[j].x && buf[j].y != min.y) kv_push(mm128_t, km, *p, buf[j]);
|
||||||
}
|
}
|
||||||
if (info.x <= min.x) { // a new minimum; then write the old min
|
if (info.x <= min.x) { // a new minimum; then write the old min
|
||||||
if (l >= w + k) kv_push(mm128_t, km, *p, min);
|
if (l >= w + k && min.x != UINT64_MAX) kv_push(mm128_t, km, *p, min);
|
||||||
min = info, min_pos = buf_pos;
|
min = info, min_pos = buf_pos;
|
||||||
} else if (buf_pos == min_pos) { // old min has moved outside the window
|
} else if (buf_pos == min_pos) { // old min has moved outside the window
|
||||||
if (l >= w + k - 1) kv_push(mm128_t, km, *p, min);
|
if (l >= w + k - 1 && min.x != UINT64_MAX) kv_push(mm128_t, km, *p, min);
|
||||||
for (j = buf_pos + 1, min.x = UINT64_MAX; j < w; ++j) // the two loops are necessary when there are identical k-mers
|
for (j = buf_pos + 1, min.x = UINT64_MAX; j < w; ++j) // the two loops are necessary when there are identical k-mers
|
||||||
if (min.x >= buf[j].x) min = buf[j], min_pos = j; // >= is important s.t. min is always the closest k-mer
|
if (min.x >= buf[j].x) min = buf[j], min_pos = j; // >= is important s.t. min is always the closest k-mer
|
||||||
for (j = 0; j <= buf_pos; ++j)
|
for (j = 0; j <= buf_pos; ++j)
|
||||||
if (min.x >= buf[j].x) min = buf[j], min_pos = j;
|
if (min.x >= buf[j].x) min = buf[j], min_pos = j;
|
||||||
if (l >= w + k - 1) { // write identical k-mers
|
if (l >= w + k - 1 && min.x != UINT64_MAX) { // write identical k-mers
|
||||||
for (j = buf_pos + 1; j < w; ++j) // these two loops make sure the output is sorted
|
for (j = buf_pos + 1; j < w; ++j) // these two loops make sure the output is sorted
|
||||||
if (min.x == buf[j].x && min.y != buf[j].y) kv_push(mm128_t, km, *p, buf[j]);
|
if (min.x == buf[j].x && min.y != buf[j].y) kv_push(mm128_t, km, *p, buf[j]);
|
||||||
for (j = 0; j <= buf_pos; ++j)
|
for (j = 0; j <= buf_pos; ++j)
|
||||||
|
|||||||
File diff suppressed because it is too large
Load Diff
@@ -0,0 +1,2 @@
|
|||||||
|
>q2
|
||||||
|
GGACATCCCGATGGTGCAGTCCTACCTGTACGAAAGGAC
|
||||||
@@ -0,0 +1,2 @@
|
|||||||
|
>t2
|
||||||
|
GGACATCCCGATGGTGCAGgtGCTATTAAAGGTTCGTTTGTTCAACGATTAAagTCCTACCTGTACGAAAGGAC
|
||||||
@@ -0,0 +1,21 @@
|
|||||||
|
.SUFFIXES: .gp .tex .eps .pdf .eps.gz
|
||||||
|
|
||||||
|
.eps.pdf:
|
||||||
|
epstopdf --outfile $@ $<
|
||||||
|
|
||||||
|
.eps.gz.pdf:
|
||||||
|
gzip -dc $< | epstopdf --filter > $@
|
||||||
|
|
||||||
|
.pdf.eps:
|
||||||
|
pdftops -eps $< $@
|
||||||
|
|
||||||
|
all:minimap2.pdf
|
||||||
|
|
||||||
|
roc-color.eps:roc.gp
|
||||||
|
gnuplot roc.gp
|
||||||
|
|
||||||
|
minimap2.pdf:minimap2.tex minimap2.bib roc-color.pdf
|
||||||
|
pdflatex minimap2; bibtex minimap2; pdflatex minimap2; pdflatex minimap2;
|
||||||
|
|
||||||
|
clean:
|
||||||
|
rm -fr *.toc *.aux *.bbl *.blg *.idx *.log *.out *~ minimap2.pdf
|
||||||
+930
@@ -0,0 +1,930 @@
|
|||||||
|
\newcommand\classname{bioinfo}
|
||||||
|
\newcommand\lastmodifieddate{2003/02/08}
|
||||||
|
\newcommand\versionnumber{0.1}
|
||||||
|
|
||||||
|
% Are we printing crop marks?
|
||||||
|
\newif\if@cropmarkson \@cropmarksontrue
|
||||||
|
|
||||||
|
\NeedsTeXFormat{LaTeX2e}[2001/06/01]
|
||||||
|
\ProvidesClass{\classname}[\lastmodifieddate\space\versionnumber]
|
||||||
|
|
||||||
|
\setlength{\paperheight}{11truein}
|
||||||
|
\setlength{\paperwidth}{8.5truein}
|
||||||
|
|
||||||
|
\newif\if@final
|
||||||
|
|
||||||
|
\DeclareOption{draft}{\PassOptionsToPackage{draft}{graphicx}}
|
||||||
|
\DeclareOption{a4paper}{\PassOptionsToPackage{a4}{crop}}
|
||||||
|
\DeclareOption{centre}{\PassOptionsToPackage{center}{crop}}
|
||||||
|
\DeclareOption{crop}{\PassOptionsToPackage{cam}{crop}\global\@cropmarksontrue}
|
||||||
|
\DeclareOption{nocrop}{\PassOptionsToPackage{off}{crop}\global\@cropmarksonfalse}
|
||||||
|
\DeclareOption{info}{\PassOptionsToPackage{info}{crop}}
|
||||||
|
\DeclareOption{noinfo}{\PassOptionsToPackage{noinfo}{crop}}
|
||||||
|
\DeclareOption{final}{\global\@finaltrue}
|
||||||
|
|
||||||
|
\ExecuteOptions{a4paper,nocrop,centre,info}
|
||||||
|
|
||||||
|
\ProcessOptions
|
||||||
|
|
||||||
|
% Load all necessary packages
|
||||||
|
\RequirePackage{inputenc,crop,graphicx,amsmath,array,color,amssymb,flushend,stfloats,amsthm,chngpage,times}
|
||||||
|
%\RequirePackage[LY1]{fontenc}
|
||||||
|
%\RequirePackage[LY1,mtbold]{mathtime}
|
||||||
|
\def\authoraffliate{\fontfamily{phv}\selectfont}
|
||||||
|
\def\helvetica{\fontfamily{phv}\selectfont}
|
||||||
|
\def\helveticaitalic{\fontfamily{phv}\itshape\selectfont}
|
||||||
|
\def\helveticabold{\fontfamily{phv}\bfseries\selectfont}
|
||||||
|
\def\helveticabolditalic{\fontfamily{phv}\bfseries\itshape\selectfont}
|
||||||
|
|
||||||
|
% Not sure if needed.
|
||||||
|
\newcommand\@ptsize{0}
|
||||||
|
|
||||||
|
% Set twoside printing
|
||||||
|
\@twosidetrue
|
||||||
|
|
||||||
|
% Marginal notes are on the outside edge
|
||||||
|
\@mparswitchfalse
|
||||||
|
|
||||||
|
\reversemarginpar
|
||||||
|
|
||||||
|
\renewcommand\normalsize{%
|
||||||
|
\@setfontsize\normalsize{9}{11}%
|
||||||
|
\abovedisplayskip 10\p@ \@plus2\p@ \@minus5\p@
|
||||||
|
\abovedisplayshortskip \z@ \@plus3\p@
|
||||||
|
\belowdisplayshortskip 6\p@ \@plus3\p@ \@minus3\p@
|
||||||
|
\belowdisplayskip \abovedisplayskip
|
||||||
|
\let\@listi\@listI}
|
||||||
|
\normalsize
|
||||||
|
\let\@bls\baselineskip
|
||||||
|
|
||||||
|
\newcommand\small{%
|
||||||
|
\@setfontsize\small{9}{11}%
|
||||||
|
\abovedisplayskip 11\p@ minus 3\p@
|
||||||
|
\belowdisplayskip \abovedisplayskip
|
||||||
|
\abovedisplayshortskip \z@ plus 2\p@
|
||||||
|
\belowdisplayshortskip 4\p@ plus 2\p@ minus2\p@
|
||||||
|
\def\@listi{\topsep 4.5\p@ plus 2\p@ minus 1\p@
|
||||||
|
\itemsep \parsep
|
||||||
|
\topsep 4\p@ plus 2\p@ minus 2\p@}}
|
||||||
|
|
||||||
|
\newcommand\footnotesize{%
|
||||||
|
\@setfontsize\footnotesize{8}{10}%
|
||||||
|
\abovedisplayskip 6\p@ minus 3\p@
|
||||||
|
\belowdisplayskip\abovedisplayskip
|
||||||
|
\abovedisplayshortskip \z@ plus 3\p@
|
||||||
|
\belowdisplayshortskip 6\p@ plus 3\p@ minus 3\p@
|
||||||
|
\def\@listi{\topsep 3\p@ plus 1\p@ minus 1\p@
|
||||||
|
\parsep 2\p@ plus 1\p@ minus 1\p@\itemsep \parsep}}
|
||||||
|
|
||||||
|
\def\scriptsize{\@setfontsize\scriptsize{7pt}{9pt}}
|
||||||
|
\def\tiny{\@setfontsize\tiny{5pt}{7pt}}
|
||||||
|
\def\large{\@setfontsize\large{11.5pt}{12pt}}
|
||||||
|
\def\Large{\@setfontsize\Large{14pt}{16}}
|
||||||
|
\def\LARGE{\@setfontsize\LARGE{15pt}{17pt}}
|
||||||
|
\def\huge{\@setfontsize\huge{22pt}{22pt}}
|
||||||
|
\def\Huge{\@setfontsize\Huge{30pt}{30pt}}
|
||||||
|
|
||||||
|
\DeclareOldFontCommand{\rm}{\normalfont\rmfamily}{\mathrm}
|
||||||
|
\DeclareOldFontCommand{\sf}{\normalfont\sffamily}{\mathsf}
|
||||||
|
\DeclareOldFontCommand{\tt}{\normalfont\ttfamily}{\mathtt}
|
||||||
|
\DeclareOldFontCommand{\bf}{\normalfont\bfseries}{\mathbf}
|
||||||
|
\DeclareOldFontCommand{\it}{\normalfont\itshape}{\mathit}
|
||||||
|
\DeclareOldFontCommand{\sl}{\normalfont\slshape}{\@nomath\sl}
|
||||||
|
\DeclareOldFontCommand{\sc}{\normalfont\scshape}{\@nomath\sc}
|
||||||
|
|
||||||
|
% Line spacing
|
||||||
|
\setlength\lineskip{1\p@}
|
||||||
|
\setlength\normallineskip{1\p@}
|
||||||
|
\renewcommand\baselinestretch{}
|
||||||
|
|
||||||
|
% Paragraph dimensions and inter-para spacing
|
||||||
|
\setlength\parskip{0\p@}
|
||||||
|
\setlength\parindent{3mm}
|
||||||
|
|
||||||
|
% Set inter-para skips
|
||||||
|
\setlength\smallskipamount{3\p@ \@plus 1\p@ \@minus 1\p@}
|
||||||
|
\setlength\medskipamount{6\p@ \@plus 2\p@}
|
||||||
|
\setlength\bigskipamount{12\p@ \@plus 4\p@ \@minus 4\p@}
|
||||||
|
|
||||||
|
% Page break penalties
|
||||||
|
\@lowpenalty 51
|
||||||
|
\@medpenalty 151
|
||||||
|
\@highpenalty 301
|
||||||
|
|
||||||
|
% Disallow widows and orphans
|
||||||
|
\clubpenalty 10000
|
||||||
|
\widowpenalty 10000
|
||||||
|
|
||||||
|
% Disable page breaks before equations, allow pagebreaks after
|
||||||
|
% equations and discourage widow lines before equations.
|
||||||
|
\displaywidowpenalty 100
|
||||||
|
\predisplaypenalty 10000
|
||||||
|
\postdisplaypenalty 2500
|
||||||
|
|
||||||
|
% Allow breaking the page in the middle of a paragraph
|
||||||
|
\interlinepenalty 0
|
||||||
|
|
||||||
|
% Disallow breaking the page after a hyphenated line
|
||||||
|
\brokenpenalty 10000
|
||||||
|
|
||||||
|
% Hyphenation; don't split words into less than three characters
|
||||||
|
\lefthyphenmin=3
|
||||||
|
\righthyphenmin=3
|
||||||
|
|
||||||
|
%
|
||||||
|
% Set page layout dimensions
|
||||||
|
%
|
||||||
|
\setlength\headheight{16\p@} % height of running head
|
||||||
|
\setlength\topmargin{2.9pc} % head margin
|
||||||
|
\addtolength\topmargin{-1in} % subtract out the 1 inch driver margin
|
||||||
|
|
||||||
|
\setlength\topskip{10\p@} % height of first line of text
|
||||||
|
\setlength\headsep{19\p@} % space below running head --
|
||||||
|
|
||||||
|
\setlength\footskip{34\p@} % space above footer line
|
||||||
|
\setlength\maxdepth{.5\topskip} % pages can be short or deep by half a line?
|
||||||
|
|
||||||
|
\setlength\textwidth{42pc} % text measure excluding margins
|
||||||
|
|
||||||
|
\setlength\textheight{58\baselineskip} % 54 lines on a full page,
|
||||||
|
\addtolength\textheight{\topskip} % including the first
|
||||||
|
% line on the page
|
||||||
|
|
||||||
|
% Set the margins
|
||||||
|
\setlength\marginparsep{3\p@}
|
||||||
|
\setlength\marginparpush{3\p@}
|
||||||
|
\setlength\marginparwidth{35\p@}
|
||||||
|
|
||||||
|
\setlength\oddsidemargin{4.5pc}
|
||||||
|
\addtolength\oddsidemargin{-1in} % subtract out the 1 inch driver margin
|
||||||
|
\setlength\@tempdima{\paperwidth}
|
||||||
|
\addtolength\@tempdima{-\textwidth}
|
||||||
|
\addtolength\@tempdima{-4.5pc}
|
||||||
|
\setlength\evensidemargin{\@tempdima}
|
||||||
|
\addtolength\evensidemargin{-1in}
|
||||||
|
|
||||||
|
\setlength\columnsep{1.5pc} % space between columns for double-column text
|
||||||
|
\setlength\columnseprule{0\p@} % width of rule between two columns
|
||||||
|
|
||||||
|
% Footnotes
|
||||||
|
\setlength\footnotesep{9\p@} % space between footnotes
|
||||||
|
% space between text and footnote
|
||||||
|
\setlength{\skip\footins}{12\p@ \@plus 6\p@ \@minus 1\p@}
|
||||||
|
|
||||||
|
% Float placement parameters
|
||||||
|
|
||||||
|
% The total number of floats that can be allowed on a page.
|
||||||
|
\setcounter{totalnumber}{10}
|
||||||
|
% The maximum number of floats at the top and bottom of a page.
|
||||||
|
\setcounter{topnumber}{5}
|
||||||
|
\setcounter{bottomnumber}{5}
|
||||||
|
% The maximum part of the top or bottom of a text page that can be
|
||||||
|
% occupied by floats. This is set so that at least four lines of text
|
||||||
|
% fit on the page.
|
||||||
|
\renewcommand\topfraction{.9}
|
||||||
|
\renewcommand\bottomfraction{.9}
|
||||||
|
% The minimum amount of a text page that must be occupied by text.
|
||||||
|
% This should accomodate four lines of text.
|
||||||
|
\renewcommand\textfraction{.06}
|
||||||
|
% The minimum amount of a float page that must be occupied by floats.
|
||||||
|
\renewcommand\floatpagefraction{.94}
|
||||||
|
|
||||||
|
% The same parameters repeated for double column output
|
||||||
|
\renewcommand\dbltopfraction{.9}
|
||||||
|
\renewcommand\dblfloatpagefraction{.9}
|
||||||
|
|
||||||
|
% Space between floats
|
||||||
|
\setlength\floatsep {12\p@ \@plus 2\p@ \@minus 2\p@}
|
||||||
|
% Space between floats and text
|
||||||
|
\setlength\textfloatsep{20\p@ \@plus 2\p@ \@minus 4\p@}
|
||||||
|
% Space above and below an inline figure
|
||||||
|
\setlength\intextsep {18\p@ \@plus 2\p@ \@minus 2\p@}
|
||||||
|
|
||||||
|
% For double column floats
|
||||||
|
\setlength\dblfloatsep {12\p@ \@plus 2\p@ \@minus 2\p@}
|
||||||
|
\setlength\dbltextfloatsep{20\p@ \@plus 2\p@ \@minus 4\p@}
|
||||||
|
|
||||||
|
% Space left at top, bottom and inbetween floats on a float page.
|
||||||
|
\setlength\@fptop{0\p@} % no space above float page figures
|
||||||
|
\setlength\@fpsep{12\p@ \@plus 1fil}
|
||||||
|
\setlength\@fpbot{0\p@}
|
||||||
|
|
||||||
|
% The same for double column
|
||||||
|
\setlength\@dblfptop{0\p@}
|
||||||
|
\setlength\@dblfpsep{12\p@ \@plus 1fil}
|
||||||
|
\setlength\@dblfpbot{0\p@}
|
||||||
|
|
||||||
|
% Override settings in mathtime back to TeX defaults
|
||||||
|
\DeclareMathSizes{5} {5} {5} {5}
|
||||||
|
\DeclareMathSizes{6} {6} {5} {5}
|
||||||
|
\DeclareMathSizes{7} {7} {5} {5}
|
||||||
|
\DeclareMathSizes{8} {8} {6} {5}
|
||||||
|
\DeclareMathSizes{9} {9} {6.5} {5}
|
||||||
|
\DeclareMathSizes{10} {10} {7.5} {5}
|
||||||
|
\DeclareMathSizes{12} {12} {9} {7}
|
||||||
|
|
||||||
|
% Page styles
|
||||||
|
\def\ps@headings
|
||||||
|
{%
|
||||||
|
\def\@oddfoot{\vbox to 12.5\p@{\hbox{\rule{\textwidth}{0.5\p@}}\vss
|
||||||
|
\hbox to \textwidth{\hfill\helveticabold\small\thepage}%
|
||||||
|
}}%
|
||||||
|
\def\@evenfoot{\vbox to 12.5\p@{\rule{\textwidth}{0.5\p@}\vss
|
||||||
|
\hbox to \textwidth{\helveticabold\small\thepage\hfill}%
|
||||||
|
}}%
|
||||||
|
\def\@evenhead{\vbox{\hbox to \textwidth{\fontsize{8}{10}\selectfont
|
||||||
|
\helveticabold{\fontshape{it}\selectfont
|
||||||
|
\strut\leftmark}\hfill}\vspace{6.5\p@}\rule{\textwidth}{0.5\p@}}}%
|
||||||
|
\def\@oddhead{\vbox{\hbox to \textwidth{\hfill\fontsize{8}{10}\selectfont
|
||||||
|
\helveticabold{\fontshape{it}\selectfont\strut\rightmark}}%
|
||||||
|
\vspace{6.5\p@}\rule{\textwidth}{0.5\p@}}}%
|
||||||
|
\def\titlemark##1{\markboth{##1}{##1}}%
|
||||||
|
\def\authormark##1{\gdef\leftmark{##1}}%
|
||||||
|
}
|
||||||
|
|
||||||
|
\def\ps@opening
|
||||||
|
{%
|
||||||
|
\def\@oddfoot{\vbox to 13\p@{\hbox{\rule{\textwidth}{1\p@}}\vss
|
||||||
|
\hbox to \textwidth{\helvetica
|
||||||
|
\fontsize{7}{9}\fontshape{n}\selectfont%
|
||||||
|
\hfill\small\helveticabold\thepage}%
|
||||||
|
}}%
|
||||||
|
\def\@evenfoot{\vbox to 13\p@{\rule{\textwidth}\vss
|
||||||
|
\hbox to \textwidth{\helvetica\thepage\hfill
|
||||||
|
\fontsize{7}{9}\fontshape{n}\selectfont}%
|
||||||
|
}}%
|
||||||
|
\let\@evenhead\relax
|
||||||
|
\let\@oddhead\relax}
|
||||||
|
|
||||||
|
% Page range
|
||||||
|
\newif\iflastpagegiven \lastpagegivenfalse
|
||||||
|
\newcommand\firstpage[1]{%
|
||||||
|
\gdef\@firstpage{#1}%
|
||||||
|
\ifnum\@firstpage>\c@page
|
||||||
|
\setcounter{page}{#1}%
|
||||||
|
\ClassWarning{BIO}{Increasing pagenumber to \@firstpage}%
|
||||||
|
\else \ifnum\@firstpage<\c@page
|
||||||
|
\ClassWarning{BIO}{Firstpage lower than pagenumber}\fi\fi
|
||||||
|
\xdef\@firstpage{\the\c@page}%
|
||||||
|
}
|
||||||
|
\def\@firstpage{1}
|
||||||
|
\def\pagenumbering#1{%
|
||||||
|
\global\c@page \@ne
|
||||||
|
\gdef\thepage{\csname @#1\endcsname \c@page}%
|
||||||
|
\gdef\thefirstpage{%
|
||||||
|
\csname @#1\endcsname \@firstpage}%
|
||||||
|
\gdef\thelastpage{%
|
||||||
|
\csname @#1\endcsname \@lastpage}%
|
||||||
|
}
|
||||||
|
|
||||||
|
\newcommand\lastpage[1]{\xdef\@lastpage{#1}%
|
||||||
|
\global\lastpagegiventrue}
|
||||||
|
\def\@lastpage{0}
|
||||||
|
\def\setlastpage{\iflastpagegiven\else
|
||||||
|
\edef\@tempa{@lastpage@}%
|
||||||
|
\expandafter
|
||||||
|
\ifx \csname \@tempa \endcsname \relax
|
||||||
|
\gdef\@lastpage{0}%
|
||||||
|
\else
|
||||||
|
\xdef\@lastpage{\@nameuse{@lastpage@}}%
|
||||||
|
\fi
|
||||||
|
\fi }
|
||||||
|
\def\writelastpage{%
|
||||||
|
\iflastpagegiven \else
|
||||||
|
\immediate\write\@auxout%
|
||||||
|
{\string\global\string\@namedef{@lastpage@}{\the\c@page}}%
|
||||||
|
\fi
|
||||||
|
}
|
||||||
|
\def\thepagerange{%
|
||||||
|
\ifnum\@lastpage =0 {\ \bf ???} \else
|
||||||
|
\ifnum\@lastpage = \@firstpage \ \thefirstpage\else
|
||||||
|
\thefirstpage--\thelastpage \fi\fi}
|
||||||
|
|
||||||
|
\AtBeginDocument{\setlastpage
|
||||||
|
\pagenumbering{arabic}%
|
||||||
|
}
|
||||||
|
\AtEndDocument{%
|
||||||
|
\writelastpage
|
||||||
|
\if@final
|
||||||
|
\clearemptydoublepage
|
||||||
|
\else
|
||||||
|
\clearpage
|
||||||
|
\fi}
|
||||||
|
|
||||||
|
%
|
||||||
|
% Sectional units
|
||||||
|
%
|
||||||
|
|
||||||
|
% Counters
|
||||||
|
\newcounter{section}
|
||||||
|
\newcounter{subsection}[section]
|
||||||
|
\newcounter{subsubsection}[subsection]
|
||||||
|
\newcounter{paragraph}[subsubsection]
|
||||||
|
\newcounter{subparagraph}[paragraph]
|
||||||
|
\newcounter{figure}
|
||||||
|
\newcounter{table}
|
||||||
|
|
||||||
|
% Form of the numbers
|
||||||
|
\newcommand\thepage{\arabic{page}}
|
||||||
|
\renewcommand\thesection{\arabic{section}}
|
||||||
|
\renewcommand\thesubsection{{\thesection.\arabic{subsection}}}
|
||||||
|
\renewcommand\thesubsubsection{{\thesubsection.\arabic{subsubsection}}}
|
||||||
|
\renewcommand\theparagraph{\thesubsubsection.\arabic{paragraph}}
|
||||||
|
\renewcommand\thesubparagraph{\theparagraph.\arabic{subparagraph}}
|
||||||
|
\renewcommand\theequation{\arabic{equation}}
|
||||||
|
|
||||||
|
% Form of the words
|
||||||
|
\newcommand\contentsname{Contents}
|
||||||
|
\newcommand\listfigurename{List of Figures}
|
||||||
|
\newcommand\listtablename{List of Tables}
|
||||||
|
\newcommand\partname{Part}
|
||||||
|
\newcommand\appendixname{Appendix}
|
||||||
|
\newcommand\abstractname{Abstract}
|
||||||
|
\newcommand\refname{References}
|
||||||
|
\newcommand\bibname{References}
|
||||||
|
\newcommand\indexname{Index}
|
||||||
|
\newcommand\figurename{Fig.}
|
||||||
|
\newcommand\tablename{Table}
|
||||||
|
|
||||||
|
% Clearemptydoublepage should really clear the running heads too
|
||||||
|
\newcommand{\clearemptydoublepage}{\newpage{\pagestyle{empty}\cleardoublepage}}
|
||||||
|
|
||||||
|
% Frontmatter, mainmatter and backmatter
|
||||||
|
|
||||||
|
\newif\if@mainmatter \@mainmattertrue
|
||||||
|
|
||||||
|
\newcommand\frontmatter{%
|
||||||
|
\clearpage
|
||||||
|
\@mainmatterfalse
|
||||||
|
\pagenumbering{roman}}
|
||||||
|
|
||||||
|
\newcommand\mainmatter{%
|
||||||
|
\clearpage
|
||||||
|
\@mainmattertrue
|
||||||
|
\pagenumbering{arabic}}
|
||||||
|
|
||||||
|
\newcommand\backmatter{%
|
||||||
|
\clearpage
|
||||||
|
\@mainmatterfalse}
|
||||||
|
|
||||||
|
%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% TITLE %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%
|
||||||
|
\newlength{\dropfromtop}
|
||||||
|
\setlength{\dropfromtop}{\z@}
|
||||||
|
|
||||||
|
% Application Notes
|
||||||
|
\newif\if@appnotes
|
||||||
|
\newcommand{\application}{%
|
||||||
|
% \setlength{\dropfromtop}{-2.25pc}%
|
||||||
|
\global\@appnotestrue}
|
||||||
|
|
||||||
|
\long\def\title{\@ifnextchar[{\short@title}{\@@title}}
|
||||||
|
\def\short@title[#1]{\titlemark{#1}\@@@title}
|
||||||
|
\def\@@title#1{\authormark{#1}\@@@title{#1}}
|
||||||
|
\long\def\@@@title#1{\gdef\@title{#1}}
|
||||||
|
|
||||||
|
\long\def\author{\@ifnextchar[{\short@uthor}{\@uthor}}
|
||||||
|
\def\short@uthor[#1]{\authormark{#1}\@@author}
|
||||||
|
\def\@uthor#1{\authormark{#1}\@@author{#1}}
|
||||||
|
\long\def\@@author#1{\gdef\@author{#1}}
|
||||||
|
|
||||||
|
\def\vol#1{\global\def\@vol{#1}}
|
||||||
|
\def\issue#1{\global\def\@issue{#1}}
|
||||||
|
\def\address#1{\global\def\@issue{#1}}
|
||||||
|
\def\history#1{\global\def\@history{#1}}
|
||||||
|
\def\editor#1{\global\def\@editor{#1}}
|
||||||
|
\def\pubyear#1{\global\def\@pubyear{#1}}
|
||||||
|
\def\copyrightyear#1{\global\def\@copyrightyear{#1}}
|
||||||
|
\def\address#1{\global\def\@address{#1}}
|
||||||
|
\def\DOI#1{\global\def\@DOI{#1}}
|
||||||
|
|
||||||
|
\definecolor{gray}{cmyk}{0, 0, 0, 0.15}
|
||||||
|
\newlength{\extraspace}
|
||||||
|
\setlength{\extraspace}{\z@}
|
||||||
|
|
||||||
|
\newcommand\maketitle{\par
|
||||||
|
\begingroup
|
||||||
|
\renewcommand\thefootnote{\@fnsymbol\c@footnote}%
|
||||||
|
\def\@makefnmark{\rlap{\@textsuperscript{\normalfont\@thefnmark}}}%
|
||||||
|
\long\def\@makefntext##1{\parindent 3mm\noindent
|
||||||
|
% \@textsuperscript{\normalfont\@thefnmark}\raggedright##1}%
|
||||||
|
\@textsuperscript{\normalfont\@thefnmark}##1}%
|
||||||
|
\if@twocolumn
|
||||||
|
\ifnum \col@number=\@ne
|
||||||
|
\@maketitle
|
||||||
|
\else
|
||||||
|
\twocolumn[\@maketitle]%
|
||||||
|
\fi
|
||||||
|
\else
|
||||||
|
\newpage
|
||||||
|
\global\@topnum\z@ % Prevents figures from going at top of page.
|
||||||
|
\@maketitle
|
||||||
|
\fi
|
||||||
|
\thispagestyle{opening}\@thanks
|
||||||
|
\endgroup
|
||||||
|
\setcounter{footnote}{0}%
|
||||||
|
\global\let\thanks\relax
|
||||||
|
\global\let\maketitle\relax
|
||||||
|
\global\let\@maketitle\relax
|
||||||
|
\global\let\@address\@empty
|
||||||
|
\global\let\@history\@empty
|
||||||
|
\global\let\@editor\@empty
|
||||||
|
\global\let\@thanks\@empty
|
||||||
|
\global\let\@author\@empty
|
||||||
|
\global\let\@date\@empty
|
||||||
|
\global\let\@title\@empty
|
||||||
|
\global\let\@pubyear\@empty
|
||||||
|
\global\let\address\relax
|
||||||
|
\global\let\history\relax
|
||||||
|
\global\let\editor\relax
|
||||||
|
\global\let\title\relax
|
||||||
|
\global\let\author\relax
|
||||||
|
\global\let\date\relax
|
||||||
|
\global\let\pubyear\relax
|
||||||
|
\global\let\@copyrightline\@empty
|
||||||
|
\global\let\and\relax
|
||||||
|
\@afterindentfalse\@afterheading
|
||||||
|
}
|
||||||
|
|
||||||
|
\newlength{\aboveskipchk}%for checking oddpage or evenpage top skip
|
||||||
|
\setlength{\aboveskipchk}{\z@}%
|
||||||
|
|
||||||
|
\def\@maketitle{%
|
||||||
|
\let\footnote\thanks
|
||||||
|
\clearemptydoublepage
|
||||||
|
\checkoddpage\ifcpoddpage\setlength{\aboveskipchk}{-3pc}\else\setlength{\aboveskipchk}{-5pc}\fi%for checking oddpage or evenpage top skip%%
|
||||||
|
\vspace*{\aboveskipchk}%
|
||||||
|
\vspace{\dropfromtop}%
|
||||||
|
\hbox to \textwidth{%
|
||||||
|
{\helvetica\itshape\bfseries\fontsize{19}{12}\selectfont {\color{gray}TECHNICAL REPORT}
|
||||||
|
\hfil
|
||||||
|
\if@appnotes APPLICATIONS NOTE\hfil\fi
|
||||||
|
}%
|
||||||
|
\enskip \parbox[b]{11.3pc}{%
|
||||||
|
\helvetica
|
||||||
|
\flushright\fontsize{8}{10}\fontshape{it}\selectfont
|
||||||
|
\hfill
|
||||||
|
}}
|
||||||
|
\rule{\textwidth}{1\p@}\par%
|
||||||
|
\helvetica
|
||||||
|
\hbox to \textwidth{%
|
||||||
|
\parbox[t]{41pc}{%
|
||||||
|
\vspace*{1sp}
|
||||||
|
{\helveticabold\fontsize{16}{21}\selectfont\raggedright \@title \par}%
|
||||||
|
\vspace{4.5\p@}
|
||||||
|
{\authoraffliate\fontsize{11}{13}\selectfont\raggedright \@author \par}%
|
||||||
|
\vspace{4\p@}
|
||||||
|
{\authoraffliate\fontsize{9}{11}\selectfont\raggedright \@address \par}%
|
||||||
|
\vspace{4\p@}
|
||||||
|
%{\helvetica\fontsize{8}{10}\selectfont\raggedright \@history \par}
|
||||||
|
%\vspace{24\p@}
|
||||||
|
%{\helvetica\fontsize{10}{12}\selectfont\raggedright \@editor \par}
|
||||||
|
%\vspace{20\p@}
|
||||||
|
}%
|
||||||
|
}
|
||||||
|
\vspace{4.5\p@}%
|
||||||
|
\rule{\textwidth}{1\p@}%
|
||||||
|
\vspace{12\p@ plus 6\p@ minus 6\p@}%
|
||||||
|
\vspace{\extraspace}
|
||||||
|
}
|
||||||
|
%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%
|
||||||
|
|
||||||
|
%%%%%%%%%%%%%%%%%%%%%%%%%%%% Abstract %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%
|
||||||
|
\newcommand{\absection}[1]{%
|
||||||
|
\par\noindent{\bfseries #1}\space\ignorespaces}
|
||||||
|
|
||||||
|
\newenvironment{abstract}{%
|
||||||
|
\begingroup
|
||||||
|
\let\section\absection
|
||||||
|
\fontfamily{\sfdefault}\fontsize{8}{11}\sffamily\selectfont
|
||||||
|
{\fontseries{b}\selectfont ABSTRACT}\par}
|
||||||
|
{\endgroup\bigskip\@afterheading\@afterindentfalse\vskip 12pt plus 3pt minus 1pt}
|
||||||
|
|
||||||
|
% Section macros
|
||||||
|
|
||||||
|
% Lowest level heading that takes a number by default
|
||||||
|
\setcounter{secnumdepth}{3}
|
||||||
|
|
||||||
|
\renewcommand{\@seccntformat}[1]{\csname the#1\endcsname\quad}
|
||||||
|
|
||||||
|
\def\section{%
|
||||||
|
\@startsection{section}{1}{\z@}
|
||||||
|
{-22\p@ plus -3\p@}{3\p@}
|
||||||
|
{\reset@font\raggedright\helveticabold\fontsize{10}{12}\selectfont\MakeUppercase}}
|
||||||
|
|
||||||
|
\def\subsection{%
|
||||||
|
\@startsection{subsection}{2}{\z@}
|
||||||
|
{-11\p@ plus -2\p@}{3\p@}
|
||||||
|
{\reset@font\raggedright\mathversion{bold}\fontseries{b}\fontsize{10}{12}\selectfont}}
|
||||||
|
|
||||||
|
\def\subsubsection{%
|
||||||
|
\@startsection{subsubsection}{3}{\z@}
|
||||||
|
%{-11\p@ plus -1\p@}{-1em}
|
||||||
|
{-11\p@ plus -1\p@}{0.001em}
|
||||||
|
{\reset@font\normalfont\normalsize\itshape}}
|
||||||
|
|
||||||
|
\def\textcolon{\text{\rm :}}
|
||||||
|
|
||||||
|
\def\paragraph{%
|
||||||
|
\@startsection{paragraph}{4}{\z@}
|
||||||
|
{-6\p@}
|
||||||
|
{-.4em}
|
||||||
|
{\reset@font\itshape}}
|
||||||
|
|
||||||
|
% ********************
|
||||||
|
% Figures and tables *
|
||||||
|
% ********************
|
||||||
|
|
||||||
|
% Table and array parameters
|
||||||
|
\setlength\arraycolsep{.5em}
|
||||||
|
\setlength\tabcolsep{.5em}
|
||||||
|
\setlength\arrayrulewidth{.5pt}
|
||||||
|
\setlength\doublerulesep{2.5pt}
|
||||||
|
\setlength\extrarowheight{\z@}
|
||||||
|
\renewcommand\arraystretch{1}
|
||||||
|
|
||||||
|
\newlength{\abovecaptionskip}
|
||||||
|
\newlength{\belowcaptionskip}
|
||||||
|
\setlength{\abovecaptionskip}{13pt}
|
||||||
|
\setlength{\belowcaptionskip}{10.5pt}
|
||||||
|
|
||||||
|
\long\def\@makecaption#1#2{\vspace{\abovecaptionskip}%
|
||||||
|
\begingroup
|
||||||
|
\footnotesize
|
||||||
|
\textbf{#1.}\enskip{#2}\par
|
||||||
|
\endgroup}
|
||||||
|
|
||||||
|
\long\def\@tablecaption#1#2{%
|
||||||
|
\begingroup
|
||||||
|
\footnotesize
|
||||||
|
\textbf{#1.}\enskip{#2\strut\par}
|
||||||
|
\endgroup\vspace{\belowcaptionskip}}
|
||||||
|
|
||||||
|
% Table rules
|
||||||
|
\def\toprule{\noalign{\ifnum0=`}\fi\hrule \@height 0.5pt \hrule \@height 6pt \@width 0pt \futurelet
|
||||||
|
\@tempa\@xhline}
|
||||||
|
\def\midrule{\noalign{\ifnum0=`}\fi \hrule \@height 6.75pt \@width 0pt \hrule \@height 0.5pt
|
||||||
|
\hrule \@height 6pt \@width 0pt \futurelet \@tempa\@xhline}
|
||||||
|
\def\botrule{\noalign{\ifnum0=`}\fi \hrule \@height 5.75pt \@width 0pt \hrule \@height 0.5pt \futurelet
|
||||||
|
\@tempa\@xhline}
|
||||||
|
\def\hrulefill{\leavevmode\leaders\hrule height .5pt\hfill\kern\z@}
|
||||||
|
|
||||||
|
\def\thefigure{\@arabic\c@figure}
|
||||||
|
\def\fps@figure{tbp}
|
||||||
|
\def\ftype@figure{1}
|
||||||
|
\def\ext@figure{lof}
|
||||||
|
\def\fnum@figure{\figurename~\thefigure}
|
||||||
|
\def\figure{\@float{figure}}
|
||||||
|
\let\endfigure\end@float
|
||||||
|
\@namedef{figure*}{\@dblfloat{figure}}
|
||||||
|
\@namedef{endfigure*}{\end@dblfloat}
|
||||||
|
\def\thetable{\@arabic\c@table}
|
||||||
|
\def\fps@table{tbp}
|
||||||
|
\def\ftype@table{2}
|
||||||
|
\def\ext@table{lot}
|
||||||
|
\def\fnum@table{Table~\thetable}
|
||||||
|
\def\table{\let\@makecaption\@tablecaption\let\source\tablesource\@float{table}}
|
||||||
|
\def\endtable{\end@float}
|
||||||
|
\@namedef{table*}{\let\@makecaption\@tablecaption\@dblfloat{table}}
|
||||||
|
\@namedef{endtable*}{\end@dblfloat}
|
||||||
|
|
||||||
|
\newif\if@rotate \@rotatefalse
|
||||||
|
\newif\if@rotatecenter \@rotatecenterfalse
|
||||||
|
\def\rotatecenter{\global\@rotatecentertrue}
|
||||||
|
\def\rotateendcenter{\global\@rotatecenterfalse}
|
||||||
|
\def\rotate{\global\@rotatetrue}
|
||||||
|
\def\endrotate{\global\@rotatefalse}
|
||||||
|
\newdimen\rotdimen
|
||||||
|
\def\rotstart#1{\special{ps: gsave currentpoint currentpoint translate
|
||||||
|
#1 neg exch neg exch translate}}
|
||||||
|
\def\rotfinish{\special{ps: currentpoint grestore moveto}}
|
||||||
|
\def\rotl#1{\rotdimen=\ht#1\advance\rotdimen by \dp#1
|
||||||
|
\hbox to \rotdimen{\vbox to\wd#1{\vskip \wd#1
|
||||||
|
\rotstart{270 rotate}\box #1\vss}\hss}\rotfinish}
|
||||||
|
\def\rotr#1{\rotdimen=\ht #1\advance\rotdimen by \dp#1
|
||||||
|
\hbox to \rotdimen{\vbox to \wd#1{\vskip \wd#1
|
||||||
|
\rotstart{90 rotate}\box #1\vss}\hss}\rotfinish}
|
||||||
|
|
||||||
|
\newdimen\tempdime
|
||||||
|
\newbox\temptbox
|
||||||
|
|
||||||
|
% From ifmtarg.sty
|
||||||
|
% Copyright Peter Wilson and Donald Arseneau, 2000
|
||||||
|
\begingroup
|
||||||
|
\catcode`\Q=3
|
||||||
|
\long\gdef\@ifmtarg#1{\@xifmtarg#1QQ\@secondoftwo\@firstoftwo\@nil}
|
||||||
|
\long\gdef\@xifmtarg#1#2Q#3#4#5\@nil{#4}
|
||||||
|
\long\gdef\@ifnotmtarg#1{\@xifmtarg#1QQ\@firstofone\@gobble\@nil}
|
||||||
|
\endgroup
|
||||||
|
|
||||||
|
\def\tablesize{\@setfontsize\tablesize{8\p@}{10\p@}}
|
||||||
|
|
||||||
|
\newenvironment{processtable}[3]{\setbox\temptbox=\hbox{{\tablesize #2}}%
|
||||||
|
\tempdime\wd\temptbox\@processtable{#1}{#2}{#3}{\tempdime}}
|
||||||
|
{\relax}
|
||||||
|
|
||||||
|
\newcommand{\@processtable}[4]{%
|
||||||
|
\if@rotate
|
||||||
|
\setbox4=\vbox to \hsize{\vss\hbox to \textheight{%
|
||||||
|
\begin{minipage}{#4}%
|
||||||
|
\@ifmtarg{#1}{}{\caption{#1}}{\tablesize #2}%
|
||||||
|
\vskip7\p@\noindent
|
||||||
|
\parbox{#4}{\fontsize{7}{9}\selectfont #3\par}%
|
||||||
|
\end{minipage}}\vss}%
|
||||||
|
\rotr{4}
|
||||||
|
\else
|
||||||
|
\hbox to \hsize{\hss\begin{minipage}[t]{#4}%
|
||||||
|
\vskip2.9pt
|
||||||
|
\@ifmtarg{#1}{}{\caption{#1}}{\tablesize #2}%
|
||||||
|
\vskip6\p@\noindent
|
||||||
|
\parbox{#4}{\fontsize{7}{9}\selectfont #3\par}%
|
||||||
|
\end{minipage}\hss}\fi}%
|
||||||
|
|
||||||
|
\newcolumntype{P}[1]{>{\raggedright\let\\\@arraycr\hangindent1em}p{#1}}
|
||||||
|
|
||||||
|
% ******************************
|
||||||
|
% List numbering and lettering *
|
||||||
|
% ******************************
|
||||||
|
\def\labelenumi{{\rm\arabic{enumi}.}}
|
||||||
|
\def\theenumi{\arabic{enumi}}
|
||||||
|
\def\labelenumii{{\rm\alph{enumii}.}}
|
||||||
|
\def\theenumii{\alph{enumii}}
|
||||||
|
\def\p@enumii{\theenumi}
|
||||||
|
\def\labelenumiii{{\rm(\arabic{enumiii})}}
|
||||||
|
\def\theenumiii{\roman{enumiii}}
|
||||||
|
\def\p@enumiii{\theenumi(\theenumii)}
|
||||||
|
\def\labelenumiv{{\rm(\arabic{enumiv})}}
|
||||||
|
\def\theenumiv{\Alph{enumiv}}
|
||||||
|
\def\p@enumiv{\p@enumiii\theenumiii}
|
||||||
|
\def\labelitemi{{\small$\bullet$}}
|
||||||
|
\def\labelitemii{{\small$\bullet$}}
|
||||||
|
\def\labelitemiii{{\small$\bullet$}}
|
||||||
|
\def\labelitemiv{{\small$\bullet$}}
|
||||||
|
|
||||||
|
\def\@listI{\leftmargin\leftmargini \topsep\medskipamount}
|
||||||
|
\let\@listi\@listI
|
||||||
|
\@listi
|
||||||
|
\def\@listii{\topsep\z@\leftmargin\leftmarginii}
|
||||||
|
\def\@listiii{\leftmargin\leftmarginiii \topsep\z@}
|
||||||
|
\def\@listiv{\leftmargin\leftmarginiv \topsep\z@}
|
||||||
|
\def\@listv{\leftmargin\leftmarginv \topsep\z@}
|
||||||
|
\def\@listvi{\leftmargin\leftmarginvi \topsep\z@}
|
||||||
|
|
||||||
|
\setlength{\leftmargini}{3mm}
|
||||||
|
\setlength{\leftmarginii}{\z@}
|
||||||
|
\setlength{\leftmarginiii}{\z@}
|
||||||
|
\setlength{\leftmarginiv}{\z@}
|
||||||
|
|
||||||
|
% Changes to the list parameters for enumerate
|
||||||
|
\def\enumargs{%
|
||||||
|
\partopsep \z@
|
||||||
|
\itemsep 3\p@
|
||||||
|
\parsep \z@
|
||||||
|
\labelsep 0.5em
|
||||||
|
\listparindent \parindent
|
||||||
|
\itemindent \z@
|
||||||
|
\topsep 11\p@
|
||||||
|
}
|
||||||
|
|
||||||
|
\def\enumerate{%
|
||||||
|
\@ifnextchar[{\@numerate}{\@numerate[0]}}
|
||||||
|
|
||||||
|
\def\@numerate[#1]{%
|
||||||
|
\ifnum \@enumdepth >3 \@toodeep\else
|
||||||
|
\advance\@enumdepth \@ne
|
||||||
|
\edef\@enumctr{enum\romannumeral\the\@enumdepth}
|
||||||
|
\list{\csname label\@enumctr\endcsname}{%
|
||||||
|
\enumargs
|
||||||
|
\setlength{\leftmargin}{\csname leftmargin\romannumeral\the\@enumdepth\endcsname}
|
||||||
|
\usecounter{\@enumctr}
|
||||||
|
\settowidth\labelwidth{#1}
|
||||||
|
\addtolength{\leftmargin}{\labelwidth}
|
||||||
|
\addtolength{\leftmargin}{\labelsep}
|
||||||
|
\def\makelabel##1{\hss \llap{##1}}}%
|
||||||
|
\fi
|
||||||
|
}
|
||||||
|
\let\endenumerate\endlist
|
||||||
|
|
||||||
|
% Changes to the list parameters for itemize
|
||||||
|
\def\itemargs{%
|
||||||
|
\partopsep \z@
|
||||||
|
\itemsep 3\p@
|
||||||
|
\parsep \z@
|
||||||
|
\labelsep 0.5em
|
||||||
|
\rightmargin \z@
|
||||||
|
\listparindent \parindent
|
||||||
|
\itemindent \z@
|
||||||
|
\topsep11\p@
|
||||||
|
}
|
||||||
|
|
||||||
|
\def\itemize{%
|
||||||
|
\@ifnextchar[{\@itemize}{\@itemize[$\bullet$]}}
|
||||||
|
|
||||||
|
\def\@itemize[#1]{%
|
||||||
|
\ifnum \@itemdepth >3 \@toodeep\else
|
||||||
|
\advance\@itemdepth \@ne
|
||||||
|
\edef\@itemctr{item\romannumeral\the\@itemdepth}
|
||||||
|
\list{\csname label\@itemctr\endcsname}{%
|
||||||
|
\itemargs
|
||||||
|
\setlength{\leftmargin}{\csname leftmargin\romannumeral\the\@itemdepth\endcsname}
|
||||||
|
\settowidth\labelwidth{#1}
|
||||||
|
\addtolength{\leftmargin}{\labelwidth}
|
||||||
|
\addtolength{\leftmargin}{\labelsep}
|
||||||
|
\def\makelabel##1{\hss \llap{##1}}}%
|
||||||
|
\fi
|
||||||
|
}
|
||||||
|
\let\enditemize\endlist
|
||||||
|
|
||||||
|
\newenvironment{unlist}{%
|
||||||
|
\begin{list}{}%
|
||||||
|
{\setlength{\labelwidth}{\z@}%
|
||||||
|
\setlength{\labelsep}{\z@}%
|
||||||
|
\setlength{\topsep}{\medskipamount}%
|
||||||
|
\setlength{\itemsep}{3\p@}%
|
||||||
|
\setlength{\leftmargin}{2em}%
|
||||||
|
\setlength{\itemindent}{-2em}}}
|
||||||
|
{\end{list}}
|
||||||
|
|
||||||
|
|
||||||
|
% ***********************
|
||||||
|
% Quotes and Quotations *
|
||||||
|
% ***********************
|
||||||
|
\def\quotation{\par\begin{list}{}{
|
||||||
|
\setlength{\topsep}{\medskipamount}
|
||||||
|
\setlength{\leftmargin}{2em}%
|
||||||
|
\setlength{\rightmargin}{\z@}%
|
||||||
|
\setlength\labelwidth{0pt}%
|
||||||
|
\setlength\labelsep{0pt}%
|
||||||
|
\listparindent\parindent}%
|
||||||
|
\item[]}
|
||||||
|
\def\endquotation{\end{list}}
|
||||||
|
\let\quote\quotation
|
||||||
|
\let\endquote\endquotation
|
||||||
|
|
||||||
|
\skip\@mpfootins = \skip\footins
|
||||||
|
\fboxsep=6\p@
|
||||||
|
\fboxrule=1\p@
|
||||||
|
|
||||||
|
% *******************
|
||||||
|
% Table of contents *
|
||||||
|
% *******************
|
||||||
|
\newcommand\@pnumwidth{4em}
|
||||||
|
\newcommand\@tocrmarg{2.55em plus 1fil}
|
||||||
|
\newcommand\@dotsep{1000}
|
||||||
|
\setcounter{tocdepth}{4}
|
||||||
|
|
||||||
|
\def\numberline#1{\hbox to \@tempdima{{#1}}}
|
||||||
|
|
||||||
|
\def\@authortocline#1#2#3#4#5{%
|
||||||
|
\vskip 1.5\p@
|
||||||
|
\ifnum #1>\c@tocdepth \else
|
||||||
|
{\leftskip #2\relax \rightskip \@tocrmarg \parfillskip -\rightskip
|
||||||
|
\parindent #2\relax\@afterindenttrue
|
||||||
|
\interlinepenalty\@M
|
||||||
|
\leavevmode
|
||||||
|
\@tempdima #3\relax
|
||||||
|
\advance\leftskip \@tempdima \null\nobreak\hskip -\leftskip
|
||||||
|
{\itshape #4}\nobreak
|
||||||
|
\leaders\hbox{$\m@th
|
||||||
|
\mkern \@dotsep mu\hbox{.}\mkern \@dotsep
|
||||||
|
mu$}\hfill
|
||||||
|
\nobreak
|
||||||
|
\hb@xt@\@pnumwidth{\hfil}%
|
||||||
|
\par}%
|
||||||
|
\fi}
|
||||||
|
|
||||||
|
\newcommand*\l@author{\@authortocline{2}{0pt}{30pt}}
|
||||||
|
\newcommand*\l@section{\@dottedtocline{3}{11pt}{20pt}}
|
||||||
|
\newcommand*\l@subsection{\@dottedtocline{4}{31pt}{29pt}}
|
||||||
|
\newcommand*\l@subsubsection[2]{}
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
|
% ***********
|
||||||
|
% Footnotes *
|
||||||
|
% ***********
|
||||||
|
|
||||||
|
\def\footnoterule{\noindent\rule{\columnwidth}{0.5pt}}
|
||||||
|
\def\@makefnmark{\@textsuperscript{\normalfont\@thefnmark}}%
|
||||||
|
\newcommand\@makefntext[1]{\noindent{\@makefnmark}\enskip#1}
|
||||||
|
|
||||||
|
% ***********
|
||||||
|
% References *
|
||||||
|
% ***********
|
||||||
|
|
||||||
|
\providecommand{\newblock}{}
|
||||||
|
\newenvironment{thebibliography}{%
|
||||||
|
\section{\bibname}%
|
||||||
|
\begingroup
|
||||||
|
\small
|
||||||
|
\begin{list}{}{%
|
||||||
|
\setlength{\topsep}{\z@}%
|
||||||
|
\setlength{\labelsep}{\z@}%
|
||||||
|
\settowidth{\labelwidth}{\z@}%
|
||||||
|
\setlength{\leftmargin}{4mm}%
|
||||||
|
\setlength{\itemindent}{-4mm}}\small}
|
||||||
|
{\end{list}\endgroup}
|
||||||
|
|
||||||
|
\RequirePackage{natbib}
|
||||||
|
|
||||||
|
% **********
|
||||||
|
% Appendix *
|
||||||
|
% **********
|
||||||
|
\newif\ifappend % Are we in the Appendix?
|
||||||
|
\def\appendix{\par
|
||||||
|
\setcounter{section}{0}
|
||||||
|
\setcounter{subsection}{0}
|
||||||
|
\appendtrue
|
||||||
|
}
|
||||||
|
|
||||||
|
%Math parameters
|
||||||
|
|
||||||
|
\setlength{\jot}{5\p@}
|
||||||
|
\mathchardef\@m=1500 % adapted value
|
||||||
|
|
||||||
|
\def\frenchspacing{\sfcode`\.\@m \sfcode`\?\@m \sfcode`\!\@m
|
||||||
|
\sfcode`\:\@m \sfcode`\;\@m \sfcode`\,\@m}
|
||||||
|
|
||||||
|
% Theorems
|
||||||
|
\def\th@plain{%
|
||||||
|
%% \let\thm@indent\noindent % no indent
|
||||||
|
\thm@headfont{\quad\scshape}% heading font is bold
|
||||||
|
\thm@notefont{\upshape\mdseries}% same as heading font
|
||||||
|
\thm@headpunct{.}% no period after heading
|
||||||
|
\thm@headsep 5\p@ plus\p@ minus\p@\relax
|
||||||
|
%% \let\thm@swap\@gobble
|
||||||
|
%% \thm@preskip\topsep
|
||||||
|
%% \thm@postskip\theorempreskipamount
|
||||||
|
\itshape % body font
|
||||||
|
}
|
||||||
|
|
||||||
|
\vbadness=9999
|
||||||
|
\tolerance=9999
|
||||||
|
\doublehyphendemerits=10000
|
||||||
|
\doublehyphendemerits 640000 % corresponds to badness 800
|
||||||
|
\finalhyphendemerits 1000000 % corresponds to badness 1000
|
||||||
|
|
||||||
|
\flushbottom
|
||||||
|
\frenchspacing
|
||||||
|
\ps@headings
|
||||||
|
\twocolumn
|
||||||
|
|
||||||
|
% Screen PDF compatability
|
||||||
|
\newcommand{\medline}[1]{%
|
||||||
|
\unskip\unskip\ignorespaces}
|
||||||
|
|
||||||
|
|
||||||
|
%%%%for smaller size text
|
||||||
|
\newenvironment{methods}{%
|
||||||
|
\begingroup
|
||||||
|
\def\section{%
|
||||||
|
\@startsection{section}{1}{\z@}
|
||||||
|
{-24\p@ plus -3\p@}{4\p@}
|
||||||
|
{\reset@font\raggedright\helveticabold\fontsize{10}{12}\selectfont\MakeUppercase}}
|
||||||
|
\def\subsection{%
|
||||||
|
\@startsection{subsection}{2}{\z@}
|
||||||
|
{-5\p@ plus -2\p@}{4\p@}
|
||||||
|
{\reset@font\raggedright\mathversion{bold}\fontseries{b}\fontsize{10}{12}\selectfont}}
|
||||||
|
\def\subsubsection{%
|
||||||
|
\@startsection{subsubsection}{3}{\z@}
|
||||||
|
% {-6\p@ plus -1\p@}{-1em}
|
||||||
|
{-6\p@ plus -1\p@}{0.001em}
|
||||||
|
{\reset@font\normalfont\normalsize\itshape}}
|
||||||
|
\footnotesize
|
||||||
|
\par}
|
||||||
|
{\par\endgroup\bigskip\@afterheading\@afterindentfalse}
|
||||||
|
|
||||||
|
|
||||||
|
|
||||||
|
\graphicspath{{g:/artwork/oup/bioinfo/}}
|
||||||
|
|
||||||
|
\language=2
|
||||||
|
|
||||||
|
\hyphenation{Figure Table Figures Tables}
|
||||||
|
|
||||||
|
\newcommand{\href}[2]{#2}
|
||||||
|
|
||||||
|
\renewenvironment{proof}[1][\proofname]{\par
|
||||||
|
\normalfont \topsep6\p@\@plus6\p@\relax
|
||||||
|
\labelsep 0.5em
|
||||||
|
\trivlist
|
||||||
|
\item[\hskip\labelsep\hskip1em\textsc{#1}.]\ignorespaces
|
||||||
|
}{\endtrivlist\@endpefalse}
|
||||||
|
|
||||||
|
%%Different Bonds
|
||||||
|
|
||||||
|
\def\sbond{\ensuremath{\raise.25ex\hbox{${-}\!\!\!\!{-}$}}\kern -.9pt}
|
||||||
|
\def\dbond{\ensuremath{\raise.25ex\hbox{=$\!$=}}}
|
||||||
|
\def\tbond{\ensuremath{\raise.20ex\hbox{${\equiv}\!\!\!{\equiv}$}}}
|
||||||
|
|
||||||
|
% Author queries
|
||||||
|
%\fboxsep=4\p@
|
||||||
|
%\fboxrule=0.5\p@
|
||||||
|
\newcommand{\query}[2][0pt]{}%
|
||||||
|
% \marginpar{\vspace*{#1}%
|
||||||
|
% {\parbox{\marginparwidth}{%
|
||||||
|
% \raggedright\fontsize{6}{8}\selectfont
|
||||||
|
% #2}}}}
|
||||||
|
|
||||||
|
\renewcommand{\dag}{{\mathversion{normal}$^{\dagger}$}}
|
||||||
|
|
||||||
|
\endinput
|
||||||
@@ -0,0 +1,17 @@
|
|||||||
|
Q 60 32681 57 0.001744133
|
||||||
|
Q 39 3 1 0.001774569
|
||||||
|
Q 38 3 1 0.001804999
|
||||||
|
Q 35 5 1 0.001835311
|
||||||
|
Q 34 31 2 0.001894692
|
||||||
|
Q 20 11 2 0.001955154
|
||||||
|
Q 19 4 1 0.001985460
|
||||||
|
Q 15 29 5 0.002136296
|
||||||
|
Q 14 6 1 0.002166417
|
||||||
|
Q 10 11 1 0.002196193
|
||||||
|
Q 6 11 2 0.002256442
|
||||||
|
Q 5 1 1 0.002286864
|
||||||
|
Q 4 1 1 0.002317285
|
||||||
|
Q 3 36 15 0.002771602
|
||||||
|
Q 2 5 2 0.002832085
|
||||||
|
Q 1 12 9 0.003105023
|
||||||
|
Q 0 220 83 0.005594194
|
||||||
@@ -0,0 +1,28 @@
|
|||||||
|
Q 42 16872292 669 0.000039651 16872292
|
||||||
|
Q 40 835329 636 0.000073697 17707621
|
||||||
|
Q 31 6544 2 0.000073783 17714165
|
||||||
|
Q 30 8882 6 0.000074084 17723047
|
||||||
|
Q 27 68499 9 0.000074305 17791546
|
||||||
|
Q 26 132041 81 0.000078277 17923587
|
||||||
|
Q 25 129378 96 0.000083033 18052965
|
||||||
|
Q 24 92056 382 0.000103665 18145021
|
||||||
|
Q 23 14341 402 0.000125720 18159362
|
||||||
|
Q 22 132838 146 0.000132789 18292200
|
||||||
|
Q 21 122274 124 0.000138641 18414474
|
||||||
|
Q 18 112183 103 0.000143361 18526657
|
||||||
|
Q 17 126981 213 0.000153804 18653638
|
||||||
|
Q 16 16356 208 0.000164810 18669994
|
||||||
|
Q 15 42804 782 0.000206223 18712798
|
||||||
|
Q 14 16026 318 0.000223025 18728824
|
||||||
|
Q 12 170250 814 0.000264087 18899074
|
||||||
|
Q 11 48351 1409 0.000337777 18947425
|
||||||
|
Q 8 1843 311 0.000354156 18949268
|
||||||
|
Q 7 62266 4435 0.000586276 19011534
|
||||||
|
Q 6 413997 50057 0.003150647 19425531
|
||||||
|
Q 5 404 58 0.003153568 19425935
|
||||||
|
Q 4 704 154 0.003161381 19426639
|
||||||
|
Q 3 1473 681 0.003196193 19428112
|
||||||
|
Q 2 17541 16462 0.004039875 19445653
|
||||||
|
Q 1 534344 354879 0.021693547 19979997
|
||||||
|
Q 0 11939 9917 0.022176642 19991936
|
||||||
|
U 8064
|
||||||
@@ -0,0 +1,52 @@
|
|||||||
|
Q 60 18784147 3 0.000000160 18784147
|
||||||
|
Q 52 19002 1 0.000000213 18803149
|
||||||
|
Q 50 7152 2 0.000000319 18810301
|
||||||
|
Q 49 6797 1 0.000000372 18817098
|
||||||
|
Q 48 52188 2 0.000000477 18869286
|
||||||
|
Q 47 48775 3 0.000000634 18918061
|
||||||
|
Q 46 19447 2 0.000000739 18937508
|
||||||
|
Q 45 25983 3 0.000000896 18963491
|
||||||
|
Q 44 13455 1 0.000000949 18976946
|
||||||
|
Q 43 14573 2 0.000001053 18991519
|
||||||
|
Q 42 8697 4 0.000001263 19000216
|
||||||
|
Q 41 8645 2 0.000001368 19008861
|
||||||
|
Q 40 176603 75 0.000005264 19185464
|
||||||
|
Q 38 2503 2 0.000005368 19187967
|
||||||
|
Q 37 4117 3 0.000005523 19192084
|
||||||
|
Q 36 2924 16 0.000006356 19195008
|
||||||
|
Q 35 2323 8 0.000006772 19197331
|
||||||
|
Q 34 2344 10 0.000007292 19199675
|
||||||
|
Q 33 4279 6 0.000007603 19203954
|
||||||
|
Q 32 2092 4 0.000007810 19206046
|
||||||
|
Q 31 2625 11 0.000008382 19208671
|
||||||
|
Q 30 2828 13 0.000009057 19211499
|
||||||
|
Q 29 1581 1 0.000009108 19213080
|
||||||
|
Q 28 1543 6 0.000009420 19214623
|
||||||
|
Q 27 70916 223 0.000020948 19285539
|
||||||
|
Q 26 1288 16 0.000021777 19286827
|
||||||
|
Q 25 25551 122 0.000028065 19312378
|
||||||
|
Q 24 14345 84 0.000032390 19326723
|
||||||
|
Q 23 7308 87 0.000036878 19334031
|
||||||
|
Q 22 8358 125 0.000043325 19342389
|
||||||
|
Q 21 4836 71 0.000046983 19347225
|
||||||
|
Q 20 5888 123 0.000053325 19353113
|
||||||
|
Q 19 4656 83 0.000057600 19357769
|
||||||
|
Q 18 3948 87 0.000062081 19361717
|
||||||
|
Q 17 4418 114 0.000067954 19366135
|
||||||
|
Q 16 4226 131 0.000074702 19370361
|
||||||
|
Q 15 5760 164 0.000083144 19376121
|
||||||
|
Q 14 4697 257 0.000096384 19380818
|
||||||
|
Q 13 5246 313 0.000112503 19386064
|
||||||
|
Q 12 4170 241 0.000124908 19390234
|
||||||
|
Q 11 4095 304 0.000140557 19394329
|
||||||
|
Q 10 3857 360 0.000159087 19398186
|
||||||
|
Q 9 5300 438 0.000181617 19403486
|
||||||
|
Q 8 4206 572 0.000211050 19407692
|
||||||
|
Q 7 4676 787 0.000251541 19412368
|
||||||
|
Q 6 3923 688 0.000286924 19416291
|
||||||
|
Q 5 3294 708 0.000323333 19419585
|
||||||
|
Q 4 2936 693 0.000358965 19422521
|
||||||
|
Q 3 3928 816 0.000400897 19426449
|
||||||
|
Q 2 2613 810 0.000442533 19429062
|
||||||
|
Q 1 3515 1188 0.000503587 19432577
|
||||||
|
Q 0 567423 376636 0.019321100 20000000
|
||||||
@@ -0,0 +1,55 @@
|
|||||||
|
Q 60 31721 27 0.000851171
|
||||||
|
Q 59 54 4 0.000975610
|
||||||
|
Q 58 29 5 0.001131933
|
||||||
|
Q 57 21 2 0.001194030
|
||||||
|
Q 56 14 4 0.001319137
|
||||||
|
Q 55 22 6 0.001506544
|
||||||
|
Q 54 12 4 0.001631475
|
||||||
|
Q 53 16 3 0.001724733
|
||||||
|
Q 51 10 1 0.001755541
|
||||||
|
Q 50 10 1 0.001786330
|
||||||
|
Q 49 11 3 0.001879699
|
||||||
|
Q 47 8 2 0.001941869
|
||||||
|
Q 46 17 1 0.001972140
|
||||||
|
Q 44 8 3 0.002065534
|
||||||
|
Q 43 10 1 0.002096174
|
||||||
|
Q 42 13 1 0.002126595
|
||||||
|
Q 41 14 3 0.002219444
|
||||||
|
Q 40 13 2 0.002281036
|
||||||
|
Q 38 17 4 0.002404747
|
||||||
|
Q 37 15 4 0.002528484
|
||||||
|
Q 36 12 1 0.002558742
|
||||||
|
Q 35 19 3 0.002650783
|
||||||
|
Q 34 12 3 0.002743313
|
||||||
|
Q 33 7 1 0.002773882
|
||||||
|
Q 32 21 3 0.002865508
|
||||||
|
Q 31 11 2 0.002926799
|
||||||
|
Q 30 14 3 0.003018891
|
||||||
|
Q 29 17 1 0.003048401
|
||||||
|
Q 28 11 2 0.003109549
|
||||||
|
Q 27 20 5 0.003262998
|
||||||
|
Q 26 11 1 0.003292948
|
||||||
|
Q 25 14 4 0.003415725
|
||||||
|
Q 24 16 5 0.003569212
|
||||||
|
Q 23 43 6 0.003750426
|
||||||
|
Q 21 15 1 0.003779664
|
||||||
|
Q 20 29 7 0.003992943
|
||||||
|
Q 19 22 2 0.004052089
|
||||||
|
Q 18 28 4 0.004172204
|
||||||
|
Q 16 25 5 0.004323390
|
||||||
|
Q 15 24 5 0.004474480
|
||||||
|
Q 14 25 5 0.004625204
|
||||||
|
Q 13 23 3 0.004714365
|
||||||
|
Q 12 22 1 0.004741963
|
||||||
|
Q 11 32 11 0.005075674
|
||||||
|
Q 10 35 7 0.005285315
|
||||||
|
Q 9 32 12 0.005648503
|
||||||
|
Q 8 33 8 0.005888126
|
||||||
|
Q 7 39 7 0.006095506
|
||||||
|
Q 6 42 14 0.006515953
|
||||||
|
Q 5 38 15 0.006966725
|
||||||
|
Q 4 37 12 0.007325113
|
||||||
|
Q 3 49 18 0.007862737
|
||||||
|
Q 2 63 21 0.008486434
|
||||||
|
Q 1 55 27 0.009292156
|
||||||
|
Q 0 153 77 0.011576593
|
||||||
Executable
+33
@@ -0,0 +1,33 @@
|
|||||||
|
#!/usr/bin/perl
|
||||||
|
|
||||||
|
use strict;
|
||||||
|
use warnings;
|
||||||
|
use Getopt::Std;
|
||||||
|
|
||||||
|
my %opts = (n=>33088, s=>100);
|
||||||
|
getopts('n:', \%opts);
|
||||||
|
|
||||||
|
my $pseudo = .5;
|
||||||
|
my $tot = $pseudo;
|
||||||
|
my $err = $pseudo;
|
||||||
|
my $tot_last_out = -$opts{s};
|
||||||
|
my $state = 0;
|
||||||
|
my $mapq = 0;
|
||||||
|
while (<>) {
|
||||||
|
chomp;
|
||||||
|
if (/^Q\t(\d+)\t(\d+)\t(\d+)/) {
|
||||||
|
$tot += $2;
|
||||||
|
$err += $3;
|
||||||
|
if ($tot - $tot_last_out >= $opts{s}) {
|
||||||
|
print join("\t", $1, $err/$tot, $tot / $opts{n}), "\n";
|
||||||
|
$tot_last_out = $tot;
|
||||||
|
$state = 0;
|
||||||
|
} else {
|
||||||
|
$state = 1;
|
||||||
|
$mapq = $1;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
}
|
||||||
|
if ($state) {
|
||||||
|
print join("\t", $mapq, $err/$tot, $tot / $opts{n}), "\n";
|
||||||
|
}
|
||||||
@@ -0,0 +1,4 @@
|
|||||||
|
Q 40 31897 63 0.001975107
|
||||||
|
Q 3 423 267 0.010210396
|
||||||
|
Q 2 162 120 0.013853827
|
||||||
|
Q 1 188 172 0.019038874
|
||||||
@@ -0,0 +1,10 @@
|
|||||||
|
./pbsim --prefix pb-1 --depth 0.1 --sample-fastq m131017_060208_42213_c100579642550000001823095604021496_s1_p0.1.subreads.fastq --length-min 1000 --length-max 30000 --seed 11 hs38.fa
|
||||||
|
|
||||||
|
bin/mason_variator -ir hs38.fa -s 1 -ov hs38-s1.vcf --snp-rate 1e-3 --small-indel-rate 2e-4 --sv-indel-rate 0 --sv-inversion-rate 0 --sv-translocation-rate 0 --sv-duplication-rate 0 --max-small-indel-size 10
|
||||||
|
bin/mason_simulator -ir hs38.fa -iv hs38-s1.vcf -n 1000000 --seed 1 -o s1_1.fq -or s1_2.fq -oa s1.sam --illumina-prob-mismatch-scale 2.5
|
||||||
|
|
||||||
|
bin/mason_variator -ir hs38.fa -s 2 -ov hs38-s2.vcf --snp-rate 1e-3 --small-indel-rate 2e-4 --sv-indel-rate 0 --sv-inversion-rate 0 --sv-translocation-rate 0 --sv-duplication-rate 0 --max-small-indel-size 10
|
||||||
|
bin/mason_simulator -ir hs38.fa -iv hs38-s2.vcf -n 1000000 --seed 2 -o mason-s2_1.fq -or mason-s2_2.fq -oa mason-s2.sam --illumina-prob-mismatch-scale 2.5 --illumina-read-length 150
|
||||||
|
|
||||||
|
bin/mason_variator -ir hs38.fa -s 3 -ov hs38-s3.vcf --snp-rate 1e-3 --small-indel-rate 2e-4 --sv-indel-rate 0 --sv-inversion-rate 0 --sv-translocation-rate 0 --sv-duplication-rate 0 --max-small-indel-size 10
|
||||||
|
bin/mason_simulator -ir hs38.fa -iv hs38-s3.vcf -n 10000000 --seed 3 -o mason-s3_1.fq -or mason-s3_2.fq -oa mason-s3.sam --illumina-prob-mismatch-scale 2.5 --illumina-read-length 150
|
||||||
@@ -0,0 +1,49 @@
|
|||||||
|
Q 60 32070 190 0.005924540
|
||||||
|
Q 59 62 2 0.005975352
|
||||||
|
Q 58 37 5 0.006123908
|
||||||
|
Q 57 40 7 0.006333633
|
||||||
|
Q 56 39 6 0.006512032
|
||||||
|
Q 55 32 2 0.006567534
|
||||||
|
Q 54 54 2 0.006618420
|
||||||
|
Q 53 33 4 0.006735255
|
||||||
|
Q 52 39 2 0.006788866
|
||||||
|
Q 51 48 3 0.006871264
|
||||||
|
Q 50 34 2 0.006925634
|
||||||
|
Q 49 32 3 0.007011070
|
||||||
|
Q 48 35 2 0.007064967
|
||||||
|
Q 47 36 4 0.007179896
|
||||||
|
Q 46 23 1 0.007205495
|
||||||
|
Q 45 25 1 0.007230614
|
||||||
|
Q 44 17 3 0.007318716
|
||||||
|
Q 43 17 2 0.007376121
|
||||||
|
Q 42 31 5 0.007522016
|
||||||
|
Q 41 25 4 0.007638486
|
||||||
|
Q 40 26 4 0.007754541
|
||||||
|
Q 39 35 2 0.007807258
|
||||||
|
Q 37 18 4 0.007924896
|
||||||
|
Q 36 13 3 0.008013162
|
||||||
|
Q 35 15 2 0.008070411
|
||||||
|
Q 34 20 3 0.008156805
|
||||||
|
Q 33 11 1 0.008184501
|
||||||
|
Q 32 15 3 0.008272003
|
||||||
|
Q 31 25 1 0.008296107
|
||||||
|
Q 29 8 1 0.008324472
|
||||||
|
Q 28 7 2 0.008383452
|
||||||
|
Q 27 9 2 0.008441894
|
||||||
|
Q 26 30 2 0.008494888
|
||||||
|
Q 23 2 1 0.008524710
|
||||||
|
Q 22 11 3 0.008612846
|
||||||
|
Q 20 23 3 0.008697760
|
||||||
|
Q 19 6 1 0.008726479
|
||||||
|
Q 18 8 1 0.008754658
|
||||||
|
Q 16 6 1 0.008783354
|
||||||
|
Q 13 2 1 0.008813108
|
||||||
|
Q 12 4 2 0.008872604
|
||||||
|
Q 11 7 2 0.008931275
|
||||||
|
Q 10 4 3 0.009021009
|
||||||
|
Q 9 6 4 0.009140436
|
||||||
|
Q 8 6 3 0.009229559
|
||||||
|
Q 7 5 1 0.009258419
|
||||||
|
Q 6 8 3 0.009346925
|
||||||
|
Q 4 8 5 0.009495872
|
||||||
|
Q 3 17 8 0.009732801
|
||||||
@@ -0,0 +1,315 @@
|
|||||||
|
@article{Chaisson:2012aa,
|
||||||
|
Author = {Chaisson, Mark J and Tesler, Glenn},
|
||||||
|
Journal = {BMC Bioinformatics},
|
||||||
|
Pages = {238},
|
||||||
|
Title = {{Mapping single molecule sequencing reads using basic local alignment with successive refinement (BLASR): application and theory}},
|
||||||
|
Volume = {13},
|
||||||
|
Year = {2012}}
|
||||||
|
|
||||||
|
@article{Liu:2016ab,
|
||||||
|
Author = {Liu, Bo and others},
|
||||||
|
Journal = {Bioinformatics},
|
||||||
|
Pages = {1625-31},
|
||||||
|
Title = {{rHAT}: fast alignment of noisy long reads with regional hashing},
|
||||||
|
Volume = {32},
|
||||||
|
Year = {2016}}
|
||||||
|
|
||||||
|
@article{Liu:2017aa,
|
||||||
|
Author = {Liu, Bo and others},
|
||||||
|
Journal = {Bioinformatics},
|
||||||
|
Pages = {192-201},
|
||||||
|
Title = {{LAMSA}: fast split read alignment with long approximate matches},
|
||||||
|
Volume = {33},
|
||||||
|
Year = {2017}}
|
||||||
|
|
||||||
|
@article{Lin:2017aa,
|
||||||
|
Author = {Lin, Hsin-Nan and Hsu, Wen-Lian},
|
||||||
|
Journal = {Bioinformatics},
|
||||||
|
Title = {Kart: a divide-and-conquer algorithm for {NGS} read alignment},
|
||||||
|
Year = {2017}}
|
||||||
|
|
||||||
|
@article{Li:2013aa,
|
||||||
|
Author = {Li, Heng},
|
||||||
|
Journal = {arXiv:1303.3997},
|
||||||
|
Title = {Aligning sequence reads, clone sequences and assembly contigs with {BWA-MEM}},
|
||||||
|
archivePrefix = "arXiv",
|
||||||
|
eprint = {1303.3997},
|
||||||
|
primaryClass = "q-bio",
|
||||||
|
Year = {2013}}
|
||||||
|
|
||||||
|
@article{Sovic:2016aa,
|
||||||
|
Author = {Sovi{\'c}, Ivan and others},
|
||||||
|
Journal = {Nat Commun},
|
||||||
|
Pages = {11307},
|
||||||
|
Title = {Fast and sensitive mapping of nanopore sequencing reads with {GraphMap}},
|
||||||
|
Volume = {7},
|
||||||
|
Year = {2016}}
|
||||||
|
|
||||||
|
@article{Langmead:2012fk,
|
||||||
|
Author = {Langmead, Ben and Salzberg, Steven L},
|
||||||
|
Journal = {Nat Methods},
|
||||||
|
Pages = {357-9},
|
||||||
|
Title = {Fast gapped-read alignment with {Bowtie} 2},
|
||||||
|
Volume = {9},
|
||||||
|
Year = {2012}}
|
||||||
|
|
||||||
|
@article{Li:2016aa,
|
||||||
|
Author = {Li, Heng},
|
||||||
|
Journal = {Bioinformatics},
|
||||||
|
Pages = {2103-10},
|
||||||
|
Title = {Minimap and miniasm: fast mapping and de novo assembly for noisy long sequences},
|
||||||
|
Volume = {32},
|
||||||
|
Year = {2016}}
|
||||||
|
|
||||||
|
@misc{Suzuki:2016,
|
||||||
|
title = {Fast and accurate alignment tool for PacBio and Nanopore long reads},
|
||||||
|
author = {Hajime Suzuki},
|
||||||
|
journal = {Unpublished},
|
||||||
|
howpublished = {\href{https://github.com/ocxtal/minialign}{https://github.com/ocxtal/minialign}},
|
||||||
|
year = {2016}}
|
||||||
|
|
||||||
|
@misc{Ruan:2016,
|
||||||
|
title = {Ultra-fast de novo assembler using long noisy reads},
|
||||||
|
author = {Jue Ruan},
|
||||||
|
journal = {Unpulished},
|
||||||
|
howpublished = {\href{https://github.com/ruanjue/smartdenovo}{https://github.com/ruanjue/smartdenovo}},
|
||||||
|
year = {2016}}
|
||||||
|
|
||||||
|
@article{Miller:1988aa,
|
||||||
|
Author = {Miller, W and Myers, E W},
|
||||||
|
Journal = {Bull Math Biol},
|
||||||
|
Number = {2},
|
||||||
|
Pages = {97-120},
|
||||||
|
Title = {Sequence comparison with concave weighting functions},
|
||||||
|
Volume = {50},
|
||||||
|
Year = {1988}}
|
||||||
|
|
||||||
|
@article{Gotoh:1990aa,
|
||||||
|
Author = {Gotoh, O},
|
||||||
|
Journal = {Bull Math Biol},
|
||||||
|
Pages = {359-73},
|
||||||
|
Title = {Optimal sequence alignment allowing for long gaps},
|
||||||
|
Volume = {52},
|
||||||
|
Year = {1990}}
|
||||||
|
|
||||||
|
@article{Wu:1996aa,
|
||||||
|
Author = {Wu, Sun and others},
|
||||||
|
Journal = {Algorithmica},
|
||||||
|
Pages = {50-67},
|
||||||
|
Title = {A subquadratic algorithm for approximate limited expression matching},
|
||||||
|
Volume = {15},
|
||||||
|
Year = {1996}}
|
||||||
|
|
||||||
|
@article{Daily:2016aa,
|
||||||
|
Author = {Daily, Jeff},
|
||||||
|
Journal = {BMC Bioinformatics},
|
||||||
|
Month = {Feb},
|
||||||
|
Pages = {81},
|
||||||
|
Title = {Parasail: {SIMD C} library for global, semi-global, and local pairwise sequence alignments},
|
||||||
|
Volume = {17},
|
||||||
|
Year = {2016}}
|
||||||
|
|
||||||
|
@article{Sedlazeck169557,
|
||||||
|
author = {Sedlazeck, Fritz J and others},
|
||||||
|
title = {Accurate detection of complex structural variations using single molecule sequencing},
|
||||||
|
note = {doi:10.1101/169557},
|
||||||
|
journal = {bioRxiv},
|
||||||
|
year = {2017}}
|
||||||
|
|
||||||
|
@article{Altschul:1997vn,
|
||||||
|
Author = {Altschul, S F and others},
|
||||||
|
Journal = {Nucleic Acids Res},
|
||||||
|
Pages = {3389-402},
|
||||||
|
Title = {Gapped {BLAST} and {PSI-BLAST}: a new generation of protein database search programs},
|
||||||
|
Volume = {25},
|
||||||
|
Year = {1997}}
|
||||||
|
|
||||||
|
@article{Sosic:2017aa,
|
||||||
|
Author = {{\v S}o{\v s}i\'{c}, Martin and {\v S}ikic, Mile},
|
||||||
|
Journal = {Bioinformatics},
|
||||||
|
Pages = {1394-1395},
|
||||||
|
Title = {Edlib: a {C/C++} library for fast, exact sequence alignment using edit distance},
|
||||||
|
Volume = {33},
|
||||||
|
Year = {2017}}
|
||||||
|
|
||||||
|
@article{Abouelhoda:2005aa,
|
||||||
|
Author = {Mohamed Ibrahim Abouelhoda and Enno Ohlebusch},
|
||||||
|
Journal = {J. Discrete Algorithms},
|
||||||
|
Pages = {321-41},
|
||||||
|
Title = {Chaining algorithms for multiple genome comparison},
|
||||||
|
Volume = {3},
|
||||||
|
Year = {2005}}
|
||||||
|
|
||||||
|
@article{Ono:2013aa,
|
||||||
|
Author = {Ono, Yukiteru and others},
|
||||||
|
Journal = {Bioinformatics},
|
||||||
|
Pages = {119-21},
|
||||||
|
Title = {{PBSIM}: {PacBio} reads simulator--toward accurate genome assembly},
|
||||||
|
Volume = {29},
|
||||||
|
Year = {2013}}
|
||||||
|
|
||||||
|
@article {Jain128835,
|
||||||
|
author = {Jain, Miten and others},
|
||||||
|
title = {Nanopore sequencing and assembly of a human genome with ultra-long reads},
|
||||||
|
year = {2017},
|
||||||
|
note = {doi:10.1101/128835},
|
||||||
|
publisher = {Cold Spring Harbor Labs Journals},
|
||||||
|
journal = {bioRxiv}}
|
||||||
|
|
||||||
|
@article{Lau:2016aa,
|
||||||
|
Author = {Lau, Bayo and others},
|
||||||
|
Journal = {Bioinformatics},
|
||||||
|
Pages = {3829-3832},
|
||||||
|
Title = {{LongISLND}: in silico sequencing of lengthy and noisy datatypes},
|
||||||
|
Volume = {32},
|
||||||
|
Year = {2016}}
|
||||||
|
|
||||||
|
@article{Robinson:2011aa,
|
||||||
|
Author = {Robinson, James T and others},
|
||||||
|
Journal = {Nat Biotechnol},
|
||||||
|
Pages = {24-6},
|
||||||
|
Title = {Integrative genomics viewer},
|
||||||
|
Volume = {29},
|
||||||
|
Year = {2011}}
|
||||||
|
|
||||||
|
@article {Suzuki130633,
|
||||||
|
author = {Suzuki, Hajime and Kasahara, Masahiro},
|
||||||
|
title = {Acceleration Of Nucleotide Semi-Global Alignment With Adaptive Banded Dynamic Programming},
|
||||||
|
year = {2017},
|
||||||
|
note = {doi:10.1101/130633},
|
||||||
|
publisher = {Cold Spring Harbor Labs Journals},
|
||||||
|
journal = {bioRxiv}}
|
||||||
|
|
||||||
|
@article{Gotoh:1982aa,
|
||||||
|
Author = {Gotoh, O},
|
||||||
|
Journal = {J Mol Biol},
|
||||||
|
Pages = {705-8},
|
||||||
|
Title = {An improved algorithm for matching biological sequences},
|
||||||
|
Volume = {162},
|
||||||
|
Year = {1982}}
|
||||||
|
|
||||||
|
@article{Altschul:1986aa,
|
||||||
|
Author = {Altschul, S F and Erickson, B W},
|
||||||
|
Journal = {Bull Math Biol},
|
||||||
|
Pages = {603-16},
|
||||||
|
Title = {Optimal sequence alignment using affine gap costs},
|
||||||
|
Volume = {48},
|
||||||
|
Year = {1986}}
|
||||||
|
|
||||||
|
@article{Wu:2005vn,
|
||||||
|
Author = {Wu, Thomas D and Watanabe, Colin K},
|
||||||
|
Journal = {Bioinformatics},
|
||||||
|
Pages = {1859-75},
|
||||||
|
Title = {{GMAP}: a genomic mapping and alignment program for {mRNA} and {EST} sequences},
|
||||||
|
Volume = {21},
|
||||||
|
Year = {2005}}
|
||||||
|
|
||||||
|
@article{Iwata:2012aa,
|
||||||
|
Author = {Iwata, Hiroaki and Gotoh, Osamu},
|
||||||
|
Journal = {Nucleic Acids Res},
|
||||||
|
Pages = {e161},
|
||||||
|
Title = {Benchmarking spliced alignment programs including {Spaln2}, an extended version of {Spaln} that incorporates additional species-specific features},
|
||||||
|
Volume = {40},
|
||||||
|
Year = {2012}}
|
||||||
|
|
||||||
|
@article{Dobin:2013kx,
|
||||||
|
Author = {Dobin, Alexander and others},
|
||||||
|
Journal = {Bioinformatics},
|
||||||
|
Pages = {15-21},
|
||||||
|
Title = {{STAR}: ultrafast universal {RNA-seq} aligner},
|
||||||
|
Volume = {29},
|
||||||
|
Year = {2013}}
|
||||||
|
|
||||||
|
@article{Byrne:2017aa,
|
||||||
|
Author = {Byrne, Ashley and others},
|
||||||
|
Journal = {Nat Commun},
|
||||||
|
Pages = {16027},
|
||||||
|
Title = {Nanopore long-read {RNAseq} reveals widespread transcriptional variation among the surface receptors of individual {B} cells},
|
||||||
|
Volume = {8},
|
||||||
|
Year = {2017}}
|
||||||
|
|
||||||
|
@article{Roberts:2004fv,
|
||||||
|
Author = {Roberts, Michael and others},
|
||||||
|
Journal = {Bioinformatics},
|
||||||
|
Pages = {3363-9},
|
||||||
|
Title = {Reducing storage requirements for biological sequence comparison},
|
||||||
|
Volume = {20},
|
||||||
|
Year = {2004}}
|
||||||
|
|
||||||
|
@article{Zhang:2006aa,
|
||||||
|
Author = {Zhang, Miao and Gish, Warren},
|
||||||
|
Journal = {Bioinformatics},
|
||||||
|
Pages = {13-20},
|
||||||
|
Title = {Improved spliced alignment from an information theoretic approach},
|
||||||
|
Volume = {22},
|
||||||
|
Year = {2006}}
|
||||||
|
|
||||||
|
@article{Li:2007aa,
|
||||||
|
Author = {Li, Heng and others},
|
||||||
|
Journal = {BMC Bioinformatics},
|
||||||
|
Pages = {349},
|
||||||
|
Title = {A cross-species alignment tool {(CAT)}},
|
||||||
|
Volume = {8},
|
||||||
|
Year = {2007}}
|
||||||
|
|
||||||
|
@article{Farrar:2007hs,
|
||||||
|
Author = {Farrar, Michael},
|
||||||
|
Journal = {Bioinformatics},
|
||||||
|
Pages = {156-61},
|
||||||
|
Title = {{Striped Smith-Waterman speeds database searches six times over other SIMD implementations}},
|
||||||
|
Volume = {23},
|
||||||
|
Year = {2007}}
|
||||||
|
|
||||||
|
@techreport{Holtgrewe:2010aa,
|
||||||
|
Address = {Freie Universit{\"a}t Berlin},
|
||||||
|
Author = {Holtgrewe, M.},
|
||||||
|
Institution = {Institut f{\"u}r Mathematik und Informatik},
|
||||||
|
Number = {TR-B-10-06},
|
||||||
|
Title = {Mason -- a read simulator for second generation sequencing data},
|
||||||
|
Year = {2010}}
|
||||||
|
|
||||||
|
@article{Zaharia:2011aa,
|
||||||
|
Author = {Zaharia, Matei and others},
|
||||||
|
Journal = {arXiv:1111:5572},
|
||||||
|
Title = {Faster and More Accurate Sequence Alignment with {SNAP}},
|
||||||
|
Year = {2011}}
|
||||||
|
|
||||||
|
@article{Irimia:2008aa,
|
||||||
|
Author = {Irimia, Manuel and Roy, Scott William},
|
||||||
|
Journal = {PLoS Genet},
|
||||||
|
Pages = {e1000148},
|
||||||
|
Title = {Evolutionary convergence on highly-conserved 3' intron structures in intron-poor eukaryotes and insights into the ancestral eukaryotic genome},
|
||||||
|
Volume = {4},
|
||||||
|
Year = {2008}}
|
||||||
|
|
||||||
|
@article{Depristo:2011vn,
|
||||||
|
Author = {Depristo, Mark A and others},
|
||||||
|
Journal = {Nat Genet},
|
||||||
|
Pages = {491-8},
|
||||||
|
Title = {A framework for variation discovery and genotyping using next-generation {DNA} sequencing data},
|
||||||
|
Volume = {43},
|
||||||
|
Year = {2011}}
|
||||||
|
|
||||||
|
@article{Kurtz:2004zr,
|
||||||
|
Author = {Kurtz, Stefan and others},
|
||||||
|
Journal = {Genome Biol},
|
||||||
|
Pages = {R12},
|
||||||
|
Title = {Versatile and open software for comparing large genomes},
|
||||||
|
Volume = {5},
|
||||||
|
Year = {2004}}
|
||||||
|
|
||||||
|
@article {Li223297,
|
||||||
|
author = {Li, Heng and others},
|
||||||
|
title = {New synthetic-diploid benchmark for accurate variant calling evaluation},
|
||||||
|
year = {2017},
|
||||||
|
note = {doi:10.1101/223297},
|
||||||
|
journal = {bioRxiv}
|
||||||
|
}
|
||||||
|
|
||||||
|
@article{Berlin:2015xy,
|
||||||
|
Author = {Berlin, Konstantin and others},
|
||||||
|
Journal = {Nat Biotechnol},
|
||||||
|
Pages = {623-30},
|
||||||
|
Title = {Assembling large genomes with single-molecule sequencing and locality-sensitive hashing},
|
||||||
|
Volume = {33},
|
||||||
|
Year = {2015}}
|
||||||
@@ -0,0 +1,662 @@
|
|||||||
|
\documentclass{bioinfo}
|
||||||
|
\copyrightyear{2017}
|
||||||
|
\pubyear{2017}
|
||||||
|
|
||||||
|
\usepackage{graphicx}
|
||||||
|
\usepackage{hyperref}
|
||||||
|
\usepackage{url}
|
||||||
|
\usepackage{amsmath}
|
||||||
|
\usepackage[ruled,vlined]{algorithm2e}
|
||||||
|
\newcommand\mycommfont[1]{\footnotesize\rmfamily{\it #1}}
|
||||||
|
\SetCommentSty{mycommfont}
|
||||||
|
\SetKwComment{Comment}{$\triangleright$\ }{}
|
||||||
|
|
||||||
|
\usepackage{natbib}
|
||||||
|
\bibliographystyle{apalike}
|
||||||
|
|
||||||
|
\DeclareMathOperator*{\argmax}{argmax}
|
||||||
|
|
||||||
|
\begin{document}
|
||||||
|
\firstpage{1}
|
||||||
|
|
||||||
|
\title[Aligning nucleotide sequences with minimap2]{Minimap2: versatile pairwise alignment for nucleotide sequences}
|
||||||
|
\author[Li]{Heng Li}
|
||||||
|
\address{Broad Institute, 415 Main Street, Cambridge, MA 02142, USA}
|
||||||
|
|
||||||
|
\maketitle
|
||||||
|
|
||||||
|
\begin{abstract}
|
||||||
|
|
||||||
|
\section{Motivation:} Recent advances in sequencing technologies promise
|
||||||
|
ultra-long reads of $\sim$100 kilo bases (kb) in average, full-length mRNA or
|
||||||
|
cDNA reads in high throughput and genomic contigs over 100 mega bases (Mb) in
|
||||||
|
length. Existing alignment programs are unable or inefficient to process such data
|
||||||
|
at scale, which presses for the development of new alignment algorithms.
|
||||||
|
|
||||||
|
\section{Results:} Minimap2 is a general-purpose alignment program to map DNA or long
|
||||||
|
mRNA sequences against a large reference database. It works with accurate short
|
||||||
|
reads of $\ge$100bp in length, $\ge$1kb genomic reads at error rate $\sim$15\%,
|
||||||
|
full-length noisy Direct RNA or cDNA reads, and assembly contigs or closely
|
||||||
|
related full chromosomes of hundreds of megabases in length. Minimap2 does
|
||||||
|
split-read alignment, employs concave gap cost for long insertions and
|
||||||
|
deletions (INDELs) and introduces new heuristics to reduce spurious alignments.
|
||||||
|
It is 3--4 times faster than mainstream short-read mappers at comparable
|
||||||
|
accuracy and $\ge$30 times faster at higher accuracy for both genomic and mRNA
|
||||||
|
reads, surpassing most aligners specialized in one type of alignment.
|
||||||
|
|
||||||
|
\section{Availability and implementation:}
|
||||||
|
\href{https://github.com/lh3/minimap2}{https://github.com/lh3/minimap2}
|
||||||
|
|
||||||
|
\section{Contact:} hengli@broadinstitute.org
|
||||||
|
\end{abstract}
|
||||||
|
|
||||||
|
\section{Introduction}
|
||||||
|
|
||||||
|
Single Molecule Real-Time (SMRT) sequencing technology and Oxford Nanopore
|
||||||
|
technologies (ONT) produce reads over 10kbp in length at an error rate
|
||||||
|
$\sim$15\%. Several aligners have been developed for such
|
||||||
|
data~\citep{Chaisson:2012aa,Li:2013aa,Liu:2016ab,Sovic:2016aa,Liu:2017aa,Lin:2017aa,Sedlazeck169557}.
|
||||||
|
Most of them were five times as slow as mainstream short-read
|
||||||
|
aligners~\citep{Langmead:2012fk,Li:2013aa} in terms of the number of bases
|
||||||
|
mapped per second. We speculated there could be substantial room for speedup on
|
||||||
|
the thought that 10kb long sequences should be easier to map than 100bp reads
|
||||||
|
because we can more effectively skip repetitive regions, which are often the
|
||||||
|
bottleneck of short-read alignment. We confirmed our speculation by achieving
|
||||||
|
approximate mapping 50 times faster than BWA-MEM~\citep{Li:2016aa}.
|
||||||
|
\citet{Suzuki130633} extended our work with a fast and novel algorithm on
|
||||||
|
generating base-level alignment, which in turn inspired us to develop minimap2
|
||||||
|
with added functionality.
|
||||||
|
|
||||||
|
Both SMRT and ONT have been applied to the sequencing of spliced mRNAs (RNA-seq). While
|
||||||
|
traditional mRNA aligners work~\citep{Wu:2005vn,Iwata:2012aa}, they are not
|
||||||
|
optimized for long noisy sequence reads and are tens of times slower than
|
||||||
|
dedicated long-read aligners. When developing minimap2 initially for aligning
|
||||||
|
genomic DNA only, we realized minor modifications could enable the base
|
||||||
|
algorithm to map mRNAs as well. Minimap2 becomes a first RNA-seq aligner
|
||||||
|
specifically designed for long noisy reads. We have also extended the original
|
||||||
|
algorithm to map short reads at a speed faster than several mainstream
|
||||||
|
short-read mappers.
|
||||||
|
|
||||||
|
In this article, we will describe the minimap2 algorithm and its applications
|
||||||
|
to different types of input sequences. We will evaluate the performance and
|
||||||
|
accuracy of minimap2 on several simulated and real data sets and demonstrate
|
||||||
|
the versatility of minimap2.
|
||||||
|
|
||||||
|
\begin{methods}
|
||||||
|
\section{Methods}
|
||||||
|
|
||||||
|
Minimap2 follows a typical seed-chain-align procedure as is used by most
|
||||||
|
full-genome aligners. It collects minimizers~\citep{Roberts:2004fv} of the
|
||||||
|
reference sequences and indexes them in a hash table. Then for each query
|
||||||
|
sequence, minimap2 takes query minimizers as \emph{seeds}, finds matches to the
|
||||||
|
reference, and identifies sets of colinear seeds, which are called
|
||||||
|
\emph{chains}. If base-level alignment is requested, minimap2 applies dynamic
|
||||||
|
programming (DP) to extend from the ends of chains and to close unseeded
|
||||||
|
regions between adjacent seeds in chains.
|
||||||
|
|
||||||
|
Minimap2 uses indexing and seeding algorithms similar to
|
||||||
|
minimap~\citep{Li:2016aa}, and furthers the predecessor with more accurate
|
||||||
|
chaining, the ability to produce base-level alignment and the support of
|
||||||
|
spliced alignment.
|
||||||
|
|
||||||
|
\subsection{Chaining}
|
||||||
|
|
||||||
|
\subsubsection{Chaining}
|
||||||
|
An \emph{anchor} is a 3-tuple $(x,y,w)$, indicating interval $[x-w+1,x]$ on the
|
||||||
|
reference matching interval $[y-w+1,y]$ on the query. Given a list of anchors
|
||||||
|
sorted by ending reference position $x$, let $f(i)$ be the maximal chaining
|
||||||
|
score up to the $i$-th anchor in the list. $f(i)$ can be calculated with
|
||||||
|
dynamic programming:
|
||||||
|
\begin{equation}\label{eq:chain}
|
||||||
|
f(i)=\max\big\{\max_{i>j\ge 1} \{ f(j)+\alpha(j,i)-\beta(j,i) \},w_i\big\}
|
||||||
|
\end{equation}
|
||||||
|
where $\alpha(j,i)=\min\big\{\min\{y_i-y_j,x_i-x_j\},w_i\big\}$ is the number of
|
||||||
|
matching bases between the two anchors. $\beta(j,i)>0$ is the gap cost. It
|
||||||
|
equals $\infty$ if $y_j\ge y_i$ or $\max\{y_i-y_j,x_i-x_j\}>G$ (i.e. the
|
||||||
|
distance between two anchors is too large); otherwise
|
||||||
|
\begin{equation}\label{eq:chain-gap}
|
||||||
|
\beta(j,i)=\gamma_c\big((y_i-y_j)-(x_i-x_j)\big)
|
||||||
|
\end{equation}
|
||||||
|
In implementation, a gap of length $l$ costs
|
||||||
|
\[
|
||||||
|
\gamma_c(l)=0.01\cdot \bar{w}\cdot|l|+0.5\log_2|l|
|
||||||
|
\]
|
||||||
|
where $\bar{w}$ is the average seed length. For $m$ anchors, directly computing all $f(\cdot)$ with
|
||||||
|
Eq.~(\ref{eq:chain}) takes $O(m^2)$ time. Although theoretically faster
|
||||||
|
chaining algorithms exist~\citep{Abouelhoda:2005aa}, they
|
||||||
|
are inapplicable to generic gap cost, complex to implement and usually
|
||||||
|
associated with a large constant. We introduced a simple heuristic to
|
||||||
|
accelerate chaining.
|
||||||
|
|
||||||
|
We note that if anchor $i$ is chained to $j$, chaining $i$ to a predecessor
|
||||||
|
of $j$ is likely to yield a lower score. When evaluating Eq.~(\ref{eq:chain}),
|
||||||
|
we start from anchor $i-1$ and stop the process if we cannot find a better
|
||||||
|
score after up to $h$ iterations. This approach reduces the average time to
|
||||||
|
$O(h\cdot m)$. In practice, we can almost always find the optimal chain with
|
||||||
|
$h=50$; even if the heuristic fails, the optimal chain is often close.
|
||||||
|
|
||||||
|
\subsubsection{Backtracking}
|
||||||
|
Let $P(i)$ be the index of the best predecessor of anchor $i$. It equals 0 if
|
||||||
|
$f(i)=w_i$ or $\argmax_j\{f(j)+\alpha(j,i)-\beta(j,i)\}$ otherwise. For each
|
||||||
|
anchor $i$ in the descending order of $f(i)$, we apply $P(\cdot)$ repeatedly to
|
||||||
|
find its predecessor and mark each visited $i$ as `used', until $P(i)=0$ or we
|
||||||
|
reach an already `used' $i$. This way we find all chains with no anchors used
|
||||||
|
in more than one chains.
|
||||||
|
|
||||||
|
\subsubsection{Identifying primary chains}\label{sec:primary}
|
||||||
|
In the absence of copy number changes, each query segment should not be mapped
|
||||||
|
to two places in the reference. However, chains found at the previous step may
|
||||||
|
have significant or complete overlaps due to repeats in the reference.
|
||||||
|
Minimap2 used the following procedure to identify \emph{primary chains} that do
|
||||||
|
not greatly overlap on the query. Let $Q$ be an empty set initially. For each
|
||||||
|
chain from the best to the worst according to their chaining scores: if on the
|
||||||
|
query, the chain overlaps with a chain in $Q$ by 50\% or higher percentage of
|
||||||
|
the shorter chain, mark the chain as secondary to the chain in $Q$; otherwise,
|
||||||
|
add the chain to $Q$. In the end, $Q$ contains all the primary chains. We did
|
||||||
|
not choose a more sophisticated data structure (e.g. range tree or k-d tree)
|
||||||
|
because this step is not the performance bottleneck.
|
||||||
|
|
||||||
|
\subsubsection{Estimating per-base sequence divergence}
|
||||||
|
Suppose a query sequence harbors $n$ seeds of length $k$, $m$ of which are
|
||||||
|
present in a chain. We want to estimate the sequence divergence $\epsilon$
|
||||||
|
between the query and the reference sequences in the chain. This is useful
|
||||||
|
when base-level alignment is too expensive to perform.
|
||||||
|
|
||||||
|
If we model substitutions with a homogeneous Poisson process along the query
|
||||||
|
sequence, the probablity of seeing $k$ consecutive bases without substitutions
|
||||||
|
is $e^{-k\epsilon}$. On the assumption that all $k$-mers are independent of
|
||||||
|
each other, the likelihood function of $\epsilon$ is
|
||||||
|
\[
|
||||||
|
\mathcal{L}(\epsilon|n,m,k)=e^{-m\cdot k\epsilon}(1-e^{-k\epsilon})^{n-m}
|
||||||
|
\]
|
||||||
|
The maximum likelihood estimate of $\epsilon$ is
|
||||||
|
\[
|
||||||
|
\hat{\epsilon}=\frac{1}{k}\log\frac{n}{m}
|
||||||
|
\]
|
||||||
|
In reality, sequencing errors are sometimes clustered and $k$-mers are not
|
||||||
|
independent of each other, especially when we take minimizers as seeds. These
|
||||||
|
violate the assumptions in the derivation above. As a result, $\hat{\epsilon}$
|
||||||
|
is only approximate and can be biased. It also ignores long deletions from the
|
||||||
|
reference sequence. In practice, fortunately, $\hat{\epsilon}$ is often close
|
||||||
|
to and strongly correlated with the sequence divergence estimated from
|
||||||
|
base-level alignments. On the several datasets used in
|
||||||
|
Section~\ref{sec:long-genomic}, the Spearman correlation coefficient is around
|
||||||
|
$0.9$.
|
||||||
|
|
||||||
|
\subsubsection{Indexing with homopolymer compressed $k$-mers}
|
||||||
|
SmartDenovo
|
||||||
|
(\href{https://github.com/ruanjue/smartdenovo}{https://github.com/ruanjue/smartdenovo};
|
||||||
|
J Ruan, personal communication) indexes reads with homopolymer-compressed (HPC)
|
||||||
|
$k$-mers and finds the strategy improves overlap sensitivity for SMRT reads.
|
||||||
|
Minimap2 adopts the same heuristic.
|
||||||
|
|
||||||
|
The HPC string of a string $s$, denoted by ${\rm HPC}(s)$, is constructed by
|
||||||
|
contracting homopolymers in $s$ to a single base. An HPC $k$-mer of $s$ is a
|
||||||
|
$k$-long substring of ${\rm HPC}(s)$. For example, suppose $s={\tt GGATTTTCCA}$,
|
||||||
|
${\rm HPC}(s)={\tt GATCA}$ and the first HPC 4-mer is ${\tt GATC}$.
|
||||||
|
|
||||||
|
To demonstrate the effectiveness of HPC $k$-mers, we performed read overlapping
|
||||||
|
for the example {\it E. coli} SMRT reads from PBcR~\citep{Berlin:2015xy}, using
|
||||||
|
different types of $k$-mers. With normal 15bp minimizers per 5bp window,
|
||||||
|
minimap2 finds 90.9\% of $\ge$2kb overlaps inferred from the read-to-reference
|
||||||
|
alignment. With HPC 19-mers, minimap2 finds 97.4\% of overlaps. It achieves this
|
||||||
|
higher sensitivity by indexing 1/3 fewer minimizers, which further helps
|
||||||
|
performance. HPC-based indexing reduces the sensitivity for ONT reads, though.
|
||||||
|
|
||||||
|
\subsection{Aligning genomic DNA}\label{sec:genomic}
|
||||||
|
|
||||||
|
\subsubsection{Alignment with 2-piece affine gap cost}
|
||||||
|
|
||||||
|
Minimap2 performs DP-based global alignment between adjacent anchors in a
|
||||||
|
chain. It uses a 2-piece affine gap cost~\citep{Gotoh:1990aa}:
|
||||||
|
\begin{equation}\label{eq:2-piece}
|
||||||
|
\gamma_a(l)=\min\{q+|l|\cdot e,\tilde{q}+|l|\cdot\tilde{e}\}
|
||||||
|
\end{equation}
|
||||||
|
Without losing generality, we always assume $q+e<\tilde{q}+\tilde{e}$.
|
||||||
|
On the condition that $e>\tilde{e}$, it applies cost $q+|l|\cdot e$ to gaps
|
||||||
|
shorter than $\lceil(\tilde{q}-q)/(e-\tilde{e})\rceil$ and applies
|
||||||
|
$\tilde{q}+|l|\cdot\tilde{e}$ to longer gaps. This scheme helps to recover
|
||||||
|
longer insertions and deletions~(INDELs).
|
||||||
|
|
||||||
|
The equation to compute the optimal alignment under $\gamma_a(\cdot)$ is
|
||||||
|
\begin{equation}\label{eq:ae86}
|
||||||
|
\left\{\begin{array}{l}
|
||||||
|
H_{ij} = \max\{H_{i-1,j-1}+s(i,j),E_{ij},F_{ij},\tilde{E}_{ij},\tilde{F}_{ij}\}\\
|
||||||
|
E_{i+1,j}= \max\{H_{ij}-q,E_{ij}\}-e\\
|
||||||
|
F_{i,j+1}= \max\{H_{ij}-q,F_{ij}\}-e\\
|
||||||
|
\tilde{E}_{i+1,j}= \max\{H_{ij}-\tilde{q},\tilde{E}_{ij}\}-\tilde{e}\\
|
||||||
|
\tilde{F}_{i,j+1}= \max\{H_{ij}-\tilde{q},\tilde{F}_{ij}\}-\tilde{e}
|
||||||
|
\end{array}\right.
|
||||||
|
\end{equation}
|
||||||
|
where $s(i,j)$ is the score between the $i$-th reference base and $j$-th query
|
||||||
|
base. Eq.~(\ref{eq:ae86}) is a natural extension to the equation under affine
|
||||||
|
gap cost~\citep{Gotoh:1982aa,Altschul:1986aa}.
|
||||||
|
|
||||||
|
\subsubsection{The Suzuki-Kasahara formulation}
|
||||||
|
|
||||||
|
When we allow gaps longer than several hundred base pairs, nucleotide-level
|
||||||
|
alignment is much slower than chaining. SSE acceleration is critical to the
|
||||||
|
performance of minimap2. Traditional SSE implementations~\citep{Farrar:2007hs}
|
||||||
|
based on Eq.~(\ref{eq:ae86}) can achieve 16-way parallelization for short
|
||||||
|
sequences, but only 4-way parallelization when the peak alignment score reaches
|
||||||
|
32767. Long sequence alignment may exceed this threshold. Inspired by
|
||||||
|
\citet{Wu:1996aa} and the following work, \citet{Suzuki130633} proposed a
|
||||||
|
difference-based formulation that lifted this limitation.
|
||||||
|
In case of 2-piece gap cost, define
|
||||||
|
\[
|
||||||
|
\left\{\begin{array}{ll}
|
||||||
|
u_{ij}\triangleq H_{ij}-H_{i-1,j} & v_{ij}\triangleq H_{ij}-H_{i,j-1} \\
|
||||||
|
x_{ij}\triangleq E_{i+1,j}-H_{ij} & \tilde{x}_{ij}\triangleq \tilde{E}_{i+1,j}-\tilde{H}_{ij} \\
|
||||||
|
y_{ij}\triangleq F_{i,j+1}-H_{ij} & \tilde{y}_{ij}\triangleq \tilde{F}_{i,j+1}-\tilde{H}_{ij}
|
||||||
|
\end{array}\right.
|
||||||
|
\]
|
||||||
|
We can transform Eq.~(\ref{eq:ae86}) to
|
||||||
|
\begin{equation}\label{eq:suzuki}
|
||||||
|
\left\{\begin{array}{lll}
|
||||||
|
z_{ij}&=&\max\{s(i,j),x_{i-1,j}+v_{i-1,j},y_{i,j-1}+u_{i,j-1},\\
|
||||||
|
&&\tilde{x}_{i-1,j}+v_{i-1,j},\tilde{y}_{i,j-1}+u_{i,j-1}\}\\
|
||||||
|
u_{ij}&=&z_{ij}-v_{i-1,j}\\
|
||||||
|
v_{ij}&=&z_{ij}-u_{i,j-1}\\
|
||||||
|
x_{ij}&=&\max\{0,x_{i-1,j}+v_{i-1,j}-z_{ij}+q\}-q-e\\
|
||||||
|
y_{ij}&=&\max\{0,y_{i,j-1}+u_{i,j-1}-z_{ij}+q\}-q-e\\
|
||||||
|
\tilde{x}_{ij}&=&\max\{0,\tilde{x}_{i-1,j}+v_{i-1,j}-z_{ij}+\tilde{q}\}-\tilde{q}-\tilde{e}\\
|
||||||
|
\tilde{y}_{ij}&=&\max\{0,\tilde{y}_{i,j-1}+u_{i,j-1}-z_{ij}+\tilde{q}\}-\tilde{q}-\tilde{e}
|
||||||
|
\end{array}\right.
|
||||||
|
\end{equation}
|
||||||
|
where $z_{ij}$ is a temporary variable that does not need to be stored.
|
||||||
|
|
||||||
|
An important property of Eq.~(\ref{eq:suzuki}) is that all values are bounded
|
||||||
|
by scoring parameters. To see that,
|
||||||
|
\[
|
||||||
|
x_{ij}=E_{i+1,j}-H_{ij}=\max\{-q,E_{ij}-H_{ij}\}-e
|
||||||
|
\]
|
||||||
|
With $E_{ij}\le H_{ij}$, we have
|
||||||
|
\[
|
||||||
|
-q-e\le x_{ij}\le\max\{-q,0\}-e=-e
|
||||||
|
\]
|
||||||
|
and similar inequations for $y_{ij}$, $\tilde{x}_{ij}$ and $\tilde{y}_{ij}$.
|
||||||
|
In addition,
|
||||||
|
\[
|
||||||
|
u_{ij}=z_{ij}-v_{i-1,j}\ge\max\{x_{i-1,j},\tilde{x}_{i-1,j}\}\ge-q-e
|
||||||
|
\]
|
||||||
|
As the maximum value of $z_{ij}=H_{ij}-H_{i-1,j-1}$ is $M$, the maximal
|
||||||
|
matching score, we can derive
|
||||||
|
\[
|
||||||
|
u_{ij}\le M-v_{i-1,j}\le M+q+e
|
||||||
|
\]
|
||||||
|
In conclusion, in Eq.~(\ref{eq:suzuki}), $x$ and $y$ are bounded by $[-q-e,-e]$,
|
||||||
|
$\tilde{x}$ and $\tilde{y}$ by $[-\tilde{q}-\tilde{e},-\tilde{e}]$, and $u$ and
|
||||||
|
$v$ by $[-q-e,M+q+e]$. When $-128\le-q-e<M+q+e\le127$, each of them can be stored as
|
||||||
|
a 8-bit integer. This enables 16-way SSE vectorization regardless of the peak
|
||||||
|
score of the alignment.
|
||||||
|
|
||||||
|
For a more efficient SSE implementation, we transform the row-column coordinate
|
||||||
|
to the diagonal-antidiagonal coordinate by letting $r\gets i+j$ and $t\gets i$.
|
||||||
|
Eq.~(\ref{eq:suzuki}) becomes:
|
||||||
|
\begin{equation*}
|
||||||
|
\left\{\begin{array}{lll}
|
||||||
|
z_{rt}&=&\max\{s(t,r-t),x_{r-1,t-1}+v_{r-1,t-1},y_{r-1,t}\\
|
||||||
|
&&+u_{r-1,t},\tilde{x}_{r-1,t-1}+v_{r-1,t-1},\tilde{y}_{r-1,t}+u_{r-1,t}\}\\
|
||||||
|
u_{rt}&=&z_{rt}-v_{r-1,t-1}\\
|
||||||
|
v_{rt}&=&z_{rt}-u_{r-1,t}\\
|
||||||
|
x_{rt}&=&\max\{0,x_{r-1,t-1}+v_{r-1,t-1}-z_{rt}+q\}-q-e\\
|
||||||
|
y_{rt}&=&\max\{0,y_{r-1,t}+u_{r-1,t}-z_{rt}+q\}-q-e\\
|
||||||
|
\tilde{x}_{rt}&=&\max\{0,\tilde{x}_{r-1,t-1}+v_{r-1,t-1}-z_{rt}+\tilde{q}\}-\tilde{q}-\tilde{e}\\
|
||||||
|
\tilde{y}_{rt}&=&\max\{0,\tilde{y}_{r-1,t}+u_{r-1,t}-z_{rt}+\tilde{q}\}-\tilde{q}-\tilde{e}
|
||||||
|
\end{array}\right.
|
||||||
|
\end{equation*}
|
||||||
|
In this formulation, cells with the same diagonal index $r$ are independent of
|
||||||
|
each other. This allows us to fully vectorize the computation of all cells on
|
||||||
|
the same anti-diagonal in one inner loop. It also simplifies banded alignment,
|
||||||
|
which would be difficult with striped vectorization~\citep{Farrar:2007hs}.
|
||||||
|
|
||||||
|
On the condition that $q+e<\tilde{q}+\tilde{e}$ and $e>\tilde{e}$, the initial
|
||||||
|
values in the diagonal-antidiagonal formuation is
|
||||||
|
\[
|
||||||
|
\left\{\begin{array}{l}
|
||||||
|
x_{r-1,-1}=y_{r-1,r}=-q-e\\
|
||||||
|
\tilde{x}_{r-1,-1}=\tilde{y}_{r-1,r}=-\tilde{q}-\tilde{e}\\
|
||||||
|
u_{r-1,r}=v_{r-1,-1}=\eta(r)\\
|
||||||
|
\end{array}\right.
|
||||||
|
\]
|
||||||
|
where
|
||||||
|
\[
|
||||||
|
\eta(r)=\left\{\begin{array}{ll}
|
||||||
|
-q-e & (r=0) \\
|
||||||
|
-e & (r<\lceil\frac{\tilde{q}-q}{e-\tilde{e}}-1\rceil) \\
|
||||||
|
r\cdot(e-\tilde{e})-(\tilde{q}-q)-\tilde{e} & (r=\lceil\frac{\tilde{q}-q}{e-\tilde{e}}-1\rceil) \\
|
||||||
|
-\tilde{e} & (r>\lceil\frac{\tilde{q}-q}{e-\tilde{e}}-1\rceil)
|
||||||
|
\end{array}\right.
|
||||||
|
\]
|
||||||
|
These can be derived from the initial values for Eq.~(\ref{eq:ae86}).
|
||||||
|
|
||||||
|
In practice, our 16-way vectorized implementation of global alignment is three
|
||||||
|
times as fast as Parasail's 4-way vectorization~\citep{Daily:2016aa}. Without
|
||||||
|
banding, our implementation is slower than Edlib~\citep{Sosic:2017aa}, but with
|
||||||
|
a 1000bp band, it is considerably faster. When performing global alignment
|
||||||
|
between anchors, we expect the alignment to stay close to the diagonal of the
|
||||||
|
DP matrix. Banding is applicable most of time.
|
||||||
|
|
||||||
|
\subsubsection{The Z-drop heuristic}
|
||||||
|
|
||||||
|
With global alignment, minimap2 may force to align unrelated sequences between
|
||||||
|
two adjacent anchors. To avoid such an artifact, we compute accumulative
|
||||||
|
alignment score along the alignment path and break the alignment where the
|
||||||
|
score drops too fast in the diagonal direction. More precisely, let $S(i,j)$ be
|
||||||
|
the alignment score along the alignment path ending at cell $(i,j)$ in the DP
|
||||||
|
matrix. We break the alignment if there exist $(i',j')$ and $(i,j)$, $i'<i$ and
|
||||||
|
$j'<j$, such that
|
||||||
|
\[
|
||||||
|
S(i',j')-S(i,j)>Z+e\cdot|(i-i')-(j-j')|
|
||||||
|
\]
|
||||||
|
where $e$ is the gap extension cost and $Z$ is an arbitrary threshold.
|
||||||
|
This strategy is first used in BWA-MEM. It is similar to X-drop employed in
|
||||||
|
BLAST~\citep{Altschul:1997vn}, but unlike X-drop, it would not break the
|
||||||
|
alignment in the presence of a single long gap.
|
||||||
|
|
||||||
|
When minimap2 breaks a global alignment between two anchors, it performs local
|
||||||
|
alignment between the two subsequences involved in the global alignment, but
|
||||||
|
this time with the one subsequence reverse complemented. This additional
|
||||||
|
alignment step may identify short inversions that are missed during chaining.
|
||||||
|
|
||||||
|
\subsection{Aligning spliced sequences}
|
||||||
|
|
||||||
|
The algorithm described above can be adapted to spliced alignment. In this
|
||||||
|
mode, the chaining gap cost distinguishes insertions to and deletions from the
|
||||||
|
reference: $\gamma_c(l)$ in Eq.~(\ref{eq:chain-gap}) takes the form of
|
||||||
|
\[
|
||||||
|
\gamma_c(l)=\left\{\begin{array}{ll}
|
||||||
|
0.01\cdot\bar{w}\cdot l+0.5\log_2 l & (l>0) \\
|
||||||
|
\min\{0.01\cdot\bar{w}\cdot|l|,\log_2|l|\} & (l<0)
|
||||||
|
\end{array}\right.
|
||||||
|
\]
|
||||||
|
Similarly, the gap cost function used for DP-based alignment is changed to
|
||||||
|
\[
|
||||||
|
\gamma_a(l)=\left\{\begin{array}{ll}
|
||||||
|
q+l\cdot e & (l>0) \\
|
||||||
|
\min\{q+|l|\cdot e,\tilde{q}\} & (l<0)
|
||||||
|
\end{array}\right.
|
||||||
|
\]
|
||||||
|
In alignment, a deletion no shorter than $\lceil(\tilde{q}-q)/e\rceil$ is
|
||||||
|
regarded as an intron, which pays no cost to gap extensions.
|
||||||
|
|
||||||
|
To pinpoint precise splicing junctions, minimap2 introduces reference-dependent
|
||||||
|
cost to penalize non-canonical splicing:
|
||||||
|
\begin{equation}\label{eq:splice}
|
||||||
|
\left\{\begin{array}{l}
|
||||||
|
H_{ij} = \max\{H_{i-1,j-1}+s(i,j),E_{ij},F_{ij},\tilde{E}_{ij}-a(i)\}\\
|
||||||
|
E_{i+1,j}= \max\{H_{ij}-q,E_{ij}\}-e\\
|
||||||
|
F_{i,j+1}= \max\{H_{ij}-q,F_{ij}\}-e\\
|
||||||
|
\tilde{E}_{i+1,j}= \max\{H_{ij}-d(i)-\tilde{q},\tilde{E}_{ij}\}\\
|
||||||
|
\end{array}\right.
|
||||||
|
\end{equation}
|
||||||
|
Let $T$ be the reference sequence. $d(i)$ is computed as
|
||||||
|
\[d(i)=\left\{\begin{array}{ll}
|
||||||
|
0 & \mbox{if $T[i+1,i+3]$ is ${\tt GTA}$ or ${\tt GTG}$} \\
|
||||||
|
p/2 & \mbox{if $T[i+1,i+3]$ is ${\tt GTC}$ or ${\tt GTT}$} \\
|
||||||
|
p & \mbox{otherwise}
|
||||||
|
\end{array}\right.\]
|
||||||
|
where $T[i,j]$ extracts a substring of $T$ between $i$ and $j$ inclusively.
|
||||||
|
$d(i)$ penalizes non-canonical donor sites with $p$ and less frequent Eukayotic
|
||||||
|
splicing signal ${\tt GT[C/T]}$ with $p/2$~\citep{Irimia:2008aa}. Similarly,
|
||||||
|
\[a(i)=\left\{\begin{array}{ll}
|
||||||
|
0 & \mbox{if $T[i-2,i]$ is ${\tt CAG}$ or ${\tt TAG}$} \\
|
||||||
|
p/2 & \mbox{if $T[i-2,i]$ is ${\tt AAG}$ or ${\tt GAG}$} \\
|
||||||
|
p & \mbox{otherwise}
|
||||||
|
\end{array}\right.\]
|
||||||
|
models the acceptor signal. Eq.~(\ref{eq:splice}) is close to an equation in
|
||||||
|
\citet{Zhang:2006aa} except that we allow insertions immediately followed by
|
||||||
|
deletions and vice versa; in addition, we use the Suzuki-Kasahara diagonal
|
||||||
|
formulation in actual implementation.
|
||||||
|
|
||||||
|
If RNA-seq reads are not sequenced from stranded libraries, the read strand
|
||||||
|
relative to the underlying transcript is unknown. By default, minimap2 aligns
|
||||||
|
each chain twice, first assuming ${\tt GT}$--${\tt AG}$ as the splicing signal
|
||||||
|
and then assuming ${\tt CT}$--${\tt AC}$, the reverse complement of ${\tt
|
||||||
|
GT}$--${\tt AG}$, as the splicing signal. The alignment with a higher score is
|
||||||
|
taken as the final alignment. This procedure also infers the relative strand of
|
||||||
|
reads that span canonical splicing sites.
|
||||||
|
|
||||||
|
In the spliced alignment mode, minimap2 further increases the density of
|
||||||
|
minimizers and disables banded alignment. Together with the two-round DP-based
|
||||||
|
alignment, spliced alignment is several times slower than genomic DNA
|
||||||
|
alignment.
|
||||||
|
|
||||||
|
\subsection{Aligning short paired-end reads}
|
||||||
|
|
||||||
|
During chainging, minimap2 takes a pair of reads as one fragment with a gap of
|
||||||
|
unknown length in the middle. It applies a normal gap cost between seeds on the
|
||||||
|
same read but is a more permissive gap cost between seeds on different reads.
|
||||||
|
More precisely, the gap cost during chaining is:
|
||||||
|
\[
|
||||||
|
\gamma_c(l)=\left\{\begin{array}{ll}
|
||||||
|
0.01\cdot\bar{w}\cdot l+0.5\log_2 l & \mbox{if two seeds on the same read} \\
|
||||||
|
\min\{0.01\cdot\bar{w}\cdot|l|,\log_2|l|\} & \mbox{otherwise}
|
||||||
|
\end{array}\right.
|
||||||
|
\]
|
||||||
|
After identifying primary chains (Section~\ref{sec:primary}), we split each
|
||||||
|
fragment chain into two read chains and perform alignment for each read as in
|
||||||
|
Section~\ref{sec:genomic}. Finally, we pair hits of each read end to find
|
||||||
|
consistent paired-end alignments.
|
||||||
|
|
||||||
|
\end{methods}
|
||||||
|
|
||||||
|
\section{Results}
|
||||||
|
|
||||||
|
\subsection{Aligning long genomic reads}\label{sec:long-genomic}
|
||||||
|
|
||||||
|
\begin{figure}[!tb]
|
||||||
|
\centering
|
||||||
|
\includegraphics[width=.5\textwidth]{roc-color.pdf}
|
||||||
|
\caption{Evaluation on aligning simulated reads. Simulated reads were mapped
|
||||||
|
to the primary assembly of human genome GRCh38. A read is considered correctly
|
||||||
|
mapped if the true position overlaps with the best mapping position by 10\% of
|
||||||
|
the read length. Read alignments are sorted by mapping quality in the
|
||||||
|
descending order. For each mapping quality threshold, the fraction of
|
||||||
|
alignments with mapping quality above the threshold and their error rate are
|
||||||
|
plotted along the curve. (a) long-read alignment evaluation. 33,088 $\ge$1000bp
|
||||||
|
reads were simulated using pbsim~\citep{Ono:2013aa} with error profile sampled
|
||||||
|
from file `m131017\_060208\_42213\_*.1.*' downloaded at
|
||||||
|
\href{http://bit.ly/chm1p5c3}{http://bit.ly/chm1p5c3}. The N50 read length is
|
||||||
|
11,628. Aligners were run under the default setting for SMRT reads.
|
||||||
|
(b) short-read alignment evaluation. 10 million pairs of 150bp reads were
|
||||||
|
simulated using mason2~\citep{Holtgrewe:2010aa} with option
|
||||||
|
`\mbox{--illumina-prob-mismatch-scale 2.5}'. Short-read aligners were run under the
|
||||||
|
default setting except for changing the maximum fragment length to
|
||||||
|
800bp.}\label{fig:eval}
|
||||||
|
\end{figure}
|
||||||
|
|
||||||
|
As a sanity check, we evaluated minimap2 on simulated human reads along with
|
||||||
|
BLASR~(v1.MC.rc64; \citealp{Chaisson:2012aa}),
|
||||||
|
BWA-MEM~(v0.7.15; \citealp{Li:2013aa}),
|
||||||
|
GraphMap~(v0.5.2; \citealp{Sovic:2016aa}),
|
||||||
|
Kart~(v2.2.5; \citealp{Lin:2017aa}),
|
||||||
|
minialign~(v0.5.3; \citealp{Suzuki:2016}) and
|
||||||
|
NGMLR~(v0.2.5; \citealp{Sedlazeck169557}). We excluded rHAT~\citep{Liu:2016ab}
|
||||||
|
and LAMSA~\citep{Liu:2017aa} because they either
|
||||||
|
crashed or produced malformatted output. In this evaluation, minimap2 has
|
||||||
|
higher power to distinguish unique and repetitive hits, and achieves overall
|
||||||
|
higher mapping accuracy (Fig.~\ref{fig:eval}a). Minimap2 and
|
||||||
|
NGMLR provide better mapping quality estimate: they rarely give repetitive hits
|
||||||
|
high mapping quality. Apparently, other aligners may
|
||||||
|
occasionally miss close suboptimal hits and be overconfident in wrong mappings.
|
||||||
|
On run time, minialign is slightly faster than minimap2 and Kart. They are over
|
||||||
|
30 times faster than the rest. Minimap2 consumed 6.1GB memory at the peak,
|
||||||
|
more than BWA-MEM but less than others.
|
||||||
|
|
||||||
|
On real human SMRT reads, the relative performance and sensitivity of
|
||||||
|
these aligners are broadly similar to the metrics on simulated data. We are
|
||||||
|
unable to provide a good estimate of mapping error rate due to the lack of the
|
||||||
|
truth. On ONT $\sim$100kb human reads~\citep{Jain128835}, BWA-MEM failed.
|
||||||
|
Kart, minialign and minimap2 are over 70 times faster than others. We have also
|
||||||
|
examined tens of $\ge$100bp INDELs in IGV~\citep{Robinson:2011aa} and can
|
||||||
|
confirm the observation by~\citet{Sedlazeck169557} that BWA-MEM often breaks
|
||||||
|
them into shorter gaps. The issue is much alleviated with minimap2, thanks
|
||||||
|
to the 2-piece affine gap cost.
|
||||||
|
|
||||||
|
\subsection{Aligning long spliced reads}
|
||||||
|
|
||||||
|
We evaluated minimap2 on SIRV control data~(AC:SRR5286959;
|
||||||
|
\citealp{Byrne:2017aa}) where the truth is known. Minimap2 predicted 59\,918
|
||||||
|
introns from 11\,018 reads. 93.8\% of splice juctions are precise. We examined
|
||||||
|
wrongly predicted junctions and found the majority were caused by clustered
|
||||||
|
splicing signals (e.g. two adjacent ${\tt GT}$ sites). When INDEL sequencing
|
||||||
|
errors are frequent, it is difficult to find precise splicing sites in this
|
||||||
|
case. If we allow up to 10bp distance from true splicing sites, 98.4\% of
|
||||||
|
aligned introns are approximately correct. It is worth noting that for SIRV, we
|
||||||
|
asked minimap2 to model the ${\tt GT..AG}$ splicing signal only without extra
|
||||||
|
bases. This is because SIRV does not honor the evolutionarily prevalent signal
|
||||||
|
${\tt GT[A/G]..[C/T]AG}$~\citep{Irimia:2008aa}.
|
||||||
|
|
||||||
|
\begin{table}[!tb]
|
||||||
|
\processtable{Evaluation of junction accuracy on 2D ONT reads}
|
||||||
|
{\footnotesize\label{tab:intron}
|
||||||
|
\begin{tabular}{p{3.1cm}rrrr}
|
||||||
|
\toprule
|
||||||
|
& GMAP & minimap2 & SpAln & STAR\\
|
||||||
|
\midrule
|
||||||
|
Run time (CPU min) & 631 & 15.9 & 2\,076 & 33.9 \\
|
||||||
|
Peak RAM (GByte) & 8.9 & 14.5 & 3.2 & 29.2\vspace{1em}\\
|
||||||
|
\# aligned reads & 103\,669 & 104\,199 & 103\,711 & 26\,479 \\
|
||||||
|
\# chimeric alignments & 1\,904 & 1\,488 & 0 & 0 \\
|
||||||
|
\# non-spliced alignments & 15\,854 & 14\,798 & 17\,033 & 10\,545\vspace{1em}\\
|
||||||
|
\# aligned introns & 692\,275 & 693\,553 & 692\,945 & 78\,603 \\
|
||||||
|
\# novel introns & 11\,239 & 3\,113 & 8\,550 & 1\,214 \\
|
||||||
|
\% exact introns & 83.8\% & 94.0\% & 87.9\% & 55.2\% \\
|
||||||
|
\% approx. introns & 91.8\% & 96.9\% & 92.5\% & 82.4\% \\
|
||||||
|
\botrule
|
||||||
|
\end{tabular}
|
||||||
|
}{Mouse reads (AC:SRR5286960) were mapped to the primary assembly of mouse
|
||||||
|
genome GRCm38 with the following tools and command options: minimap2 (`-ax
|
||||||
|
splice'); GMAP (`-n 0 --min-intronlength 30 --cross-species'); SpAln (`-Q7 -LS
|
||||||
|
-S3'); STARlong (according to
|
||||||
|
\href{http://bit.ly/star-pb}{http://bit.ly/star-pb}). The alignments were
|
||||||
|
compared to the EnsEMBL gene annotation, release 89. A predicted intron
|
||||||
|
is \emph{novel} if it has no overlaps with any annotated introns. An intron
|
||||||
|
is \emph{exact} if it is identical to an annotated intron. An intron is
|
||||||
|
\emph{approximate} if both its 5'- and 3'-end are within 10bp around the ends
|
||||||
|
of an annotated intron.}
|
||||||
|
\end{table}
|
||||||
|
|
||||||
|
We next aligned real mouse reads~\citep{Byrne:2017aa} with GMAP~(v2017-06-20;
|
||||||
|
\citealp{Wu:2005vn}), minimap2, SpAln~(v2.3.1; \citealp{Iwata:2012aa}) and
|
||||||
|
STAR~(v2.5.3a; \citealp{Dobin:2013kx}). In general, minimap2 is more
|
||||||
|
consistent with existing annotations (Table~\ref{tab:intron}): it finds
|
||||||
|
more junctions with a higher percentage being exactly or approximately correct.
|
||||||
|
Minimap2 is over 40 times faster than GMAP and SpAln. While STAR is close to
|
||||||
|
minimap2 in speed, it does not work well with noisy reads.
|
||||||
|
|
||||||
|
We have also evaluated spliced aligners on a human Nanopore Direct RNA-seq
|
||||||
|
dataset (\href{http://bit.ly/na12878ont}{http://bit.ly/na12878ont}). Minimap2
|
||||||
|
aligned 10 million reads in $<$1 wall-clock hour using 16 CPU cores. 94.2\% of
|
||||||
|
aligned splice junctions consistent with gene annotations. In comparison,
|
||||||
|
GMAP under option `-k 14 -n 0 --min-intronlength 30 --cross-species' is 160
|
||||||
|
times slower; 68.7\% of GMAP junctions are found in known gene annotations. The
|
||||||
|
percentage increases to 84.1\% if an aligned junction within 10bp from an
|
||||||
|
annotated junction is considered to be correct. On a public Iso-Seq dataset
|
||||||
|
(human Alzheimer brain from
|
||||||
|
\href{http://bit.ly/isoseqpub}{http://bit.ly/isoseqpub}), minimap2 is also
|
||||||
|
faster at higher junction accuracy in comparison to other aligners in
|
||||||
|
Table~\ref{tab:intron}.
|
||||||
|
|
||||||
|
We noted that GMAP and SpAln have not been optimized for noisy reads. We are
|
||||||
|
showing the best setting we have experimented, but their developers should be
|
||||||
|
able to improve their accuracy further.
|
||||||
|
|
||||||
|
%\begin{table}[!tb]
|
||||||
|
%\processtable{Evaluation of junction accuracy on SMRT Iso-Seq reads}
|
||||||
|
%{\footnotesize
|
||||||
|
%\begin{tabular}{lrrrr}
|
||||||
|
%\toprule
|
||||||
|
% & GMAP & minimap2 & SpAln & STAR \\ % one GMAP thread took 14 days to align a tiny fraction of reads
|
||||||
|
%\midrule
|
||||||
|
%Run time (CPU min) & - & 243 & 2,352 & 1,647 \\
|
||||||
|
%\# aligned reads & 1,113,502 & 1,123,025 & 1,094,092 & 682,452 \\
|
||||||
|
%\# chimeric alignments & 48,927 & 33,091 & 0 & 0 \\
|
||||||
|
%\# non-spliced alignments & 334,097 & 339,081 & 291,447 & 272,536 \vspace{1em}\\
|
||||||
|
%\# aligned introns & 8,922,221 & 9,071,755 & 9,208,564 & 3,029,121 \\
|
||||||
|
%\# novel introns & 48,927 & 42,773 & 82,230 & 17,791 \\
|
||||||
|
%\% exact introns & 90.6\% & 94.9\% & 91.7\% & 84.7\% \\
|
||||||
|
%\% approx. introns & 94.0\% & 96.9\% & 93.4\% & 93.8\% \\
|
||||||
|
%\botrule
|
||||||
|
%\end{tabular}
|
||||||
|
%}{}
|
||||||
|
%\end{table}
|
||||||
|
|
||||||
|
\subsection{Aligning short genomic reads}
|
||||||
|
|
||||||
|
We evaluated minimap2 along with Bowtie2~(v2.3.3; \citealt{Langmead:2012fk}), BWA-MEM and
|
||||||
|
SNAP (v1.0beta23; \citealt{Zaharia:2011aa}). Minimap2 is 3--4 times as fast as Bowtie2 and
|
||||||
|
BWA-MEM, but is 1.3 times slower than SNAP. Minimap2 is more accurate on this
|
||||||
|
simulated data set than Bowtie2 and SNAP but less accurate than BWA-MEM
|
||||||
|
(Fig.~\ref{fig:eval}b). Closer investigation reveals that BWA-MEM achieves
|
||||||
|
a higher accuracy partly because it tries to locally align a read in a small
|
||||||
|
region close to its mate. If we disable this feature, BWA-MEM becomes slightly
|
||||||
|
less accurate than minimap2. We might consider to implement a similar heuristic
|
||||||
|
in minimap2 in future.
|
||||||
|
|
||||||
|
To evaluate the accuracy of minimap2 on real data, we aligned human reads
|
||||||
|
(AC:ERR1341796) with BWA-MEM and minimap2, and called SNPs and small INDELs
|
||||||
|
with GATK HaplotypeCaller v3.5~\citep{Depristo:2011vn}. This run was sequenced
|
||||||
|
from experimentally mixed CHM1 and CHM13 cell lines. Both of them are homozygous
|
||||||
|
across the whole genome and have been \emph{de novo} assembled with SMRT reads
|
||||||
|
to high quality. This allowed us to construct an independent truth variant
|
||||||
|
dataset~\citep{Li223297} for
|
||||||
|
ERR1341796. In this evaluation, minimap2 has higher SNP false negative rate
|
||||||
|
(FNR; 2.5\% of minimap2 vs 2.2\% of BWA-MEM), but fewer false positive SNPs per
|
||||||
|
million bases (FPPM; 3.0 vs 3.9), lower 2--50bp INDEL FNR (7.3\% vs 7.5\%) and
|
||||||
|
similar INDEL FPPM (both 1.0). Minimap2 is broadly similar to BWA-MEM in the
|
||||||
|
context of small variant calling.
|
||||||
|
|
||||||
|
\subsection{Other applications}
|
||||||
|
|
||||||
|
Minimap2 retains minimap's functionality to find overlaps between long reads
|
||||||
|
and to search against large multi-species databases such as \emph{nt} from
|
||||||
|
NCBI. Minimap2 can also align similar genomes or different assemblies of the
|
||||||
|
same species. It took 7 wall-clock minutes over 8 CPU cores to align a human
|
||||||
|
SMRT assembly (AC:GCA\_001297185.1) to GRCh38, over 20 times faster
|
||||||
|
MUMmer4~\citep{Kurtz:2004zr}.
|
||||||
|
|
||||||
|
\section{Discussions}
|
||||||
|
|
||||||
|
Minimap2 is a versatile mapper and pairwise aligner for nucleotide sequences.
|
||||||
|
It works with short reads, assembly contigs and long noisy genomic and RNA-seq
|
||||||
|
reads, and can be used as a read mapper, long-read overlapper or a full-genome
|
||||||
|
aligner. Minimap2 is also accurate and efficient, often outperforming other
|
||||||
|
domain-specific alignment tools in terms of both speed and accuracy.
|
||||||
|
|
||||||
|
The capability of minimap2 comes from a fast base-level alignment algorithm and
|
||||||
|
an accurate chaining algorithm. When aligning long query sequences, base-level
|
||||||
|
alignment is often the performance bottleneck. The Suzuki-Kasahara algorithm
|
||||||
|
greatly alleviates the bottleneck and enables DP-based splice alignment
|
||||||
|
involving $>$100kb introns, which was impractically slow ten years ago. The
|
||||||
|
minimap2 chaining algorithm is fast and highly accurate by itself. In fact,
|
||||||
|
chaining alone is more accurate than all the other long-read mappers in
|
||||||
|
Fig.~\ref{fig:eval}a (data not shown). This accuracy helps to reduce downstream
|
||||||
|
base-level alignment of candidate chains, which is still times slower than
|
||||||
|
chaining even with the Suzuki-Kasahara improvement. In addition, taking a
|
||||||
|
general form, minimap2 chaining can be adapted to non-typical data types such
|
||||||
|
spliced reads and multiple reads per fragment. This gives us the opportunity to
|
||||||
|
extend the same base algorithm to a variety of use cases.
|
||||||
|
|
||||||
|
Modern mainstream aligners often use a full-text index, such as suffix array or
|
||||||
|
FM-index, to index reference sequences. An advantage of this approach is that
|
||||||
|
we can use exact seeds of arbitrary lengths, which helps to increase seed
|
||||||
|
uniqueness and reduce unsuccessful extensions. Minimap2 indexes reference
|
||||||
|
k-mers with a hash table instead. Such fixed-length seeds are inferior to
|
||||||
|
variable-length seeds in theory, but can be computed much more efficiently in
|
||||||
|
practice. When a query sequence has multiple seed hits, we can afford to skip
|
||||||
|
highly repetitive seeds without affecting the final accuracy. This further
|
||||||
|
alleviates the concern with the uniqueness of seeds. Hash table is the ideal
|
||||||
|
data structure for mapping long query sequences.
|
||||||
|
|
||||||
|
\section*{Acknowledgements}
|
||||||
|
We owe a debt of gratitude to H. Suzuki and M. Kasahara for releasing their
|
||||||
|
masterpiece and insightful notes before formal publication. We thank M.
|
||||||
|
Schatz, P. Rescheneder and F. Sedlazeck for pointing out the limitation of
|
||||||
|
BWA-MEM. We are also grateful to minimap2 users who have greatly helped to
|
||||||
|
suggest features and to fix various issues.
|
||||||
|
|
||||||
|
\bibliography{minimap2}
|
||||||
|
|
||||||
|
\end{document}
|
||||||
@@ -0,0 +1,62 @@
|
|||||||
|
Q 60 18579866 27 0.000001453 18579866
|
||||||
|
Q 59 27087 4 0.000001666 18606953
|
||||||
|
Q 58 21435 1 0.000001718 18628388
|
||||||
|
Q 57 45663 3 0.000001874 18674051
|
||||||
|
Q 56 36031 2 0.000001978 18710082
|
||||||
|
Q 55 18499 2 0.000002082 18728581
|
||||||
|
Q 54 14754 2 0.000002187 18743335
|
||||||
|
Q 53 25541 2 0.000002291 18768876
|
||||||
|
Q 52 26397 5 0.000002554 18795273
|
||||||
|
Q 51 15090 3 0.000002711 18810363
|
||||||
|
Q 50 13425 11 0.000003294 18823788
|
||||||
|
Q 49 15175 2 0.000003397 18838963
|
||||||
|
Q 48 19407 4 0.000003606 18858370
|
||||||
|
Q 47 11538 16 0.000004452 18869908
|
||||||
|
Q 46 12558 17 0.000005349 18882466
|
||||||
|
Q 45 40362 28 0.000006817 18922828
|
||||||
|
Q 44 10465 13 0.000007500 18933293
|
||||||
|
Q 43 10098 20 0.000008552 18943391
|
||||||
|
Q 42 10682 19 0.000009549 18954073
|
||||||
|
Q 41 9823 11 0.000010125 18963896
|
||||||
|
Q 40 9685 16 0.000010963 18973581
|
||||||
|
Q 39 10273 18 0.000011905 18983854
|
||||||
|
Q 38 9515 18 0.000012847 18993369
|
||||||
|
Q 37 9474 27 0.000014261 19002843
|
||||||
|
Q 36 10430 25 0.000015568 19013273
|
||||||
|
Q 35 9241 34 0.000017348 19022514
|
||||||
|
Q 34 9162 31 0.000018968 19031676
|
||||||
|
Q 33 10164 49 0.000021532 19041840
|
||||||
|
Q 32 9152 55 0.000024408 19050992
|
||||||
|
Q 31 9252 35 0.000026233 19060244
|
||||||
|
Q 30 9872 55 0.000029103 19070116
|
||||||
|
Q 29 8938 65 0.000032496 19079054
|
||||||
|
Q 28 8951 73 0.000036306 19088005
|
||||||
|
Q 27 9949 95 0.000041261 19097954
|
||||||
|
Q 26 9784 97 0.000046316 19107738
|
||||||
|
Q 25 10126 97 0.000051366 19117864
|
||||||
|
Q 24 11260 123 0.000057765 19129124
|
||||||
|
Q 23 10047 114 0.000063691 19139171
|
||||||
|
Q 22 9661 123 0.000070083 19148832
|
||||||
|
Q 21 10339 168 0.000078813 19159171
|
||||||
|
Q 20 17928 193 0.000088804 19177099
|
||||||
|
Q 19 9842 193 0.000098817 19186941
|
||||||
|
Q 18 14737 247 0.000111605 19201678
|
||||||
|
Q 17 10218 238 0.000123934 19211896
|
||||||
|
Q 16 10271 242 0.000136457 19222167
|
||||||
|
Q 15 12241 333 0.000153683 19234408
|
||||||
|
Q 14 9189 336 0.000171070 19243597
|
||||||
|
Q 13 9493 515 0.000197734 19253090
|
||||||
|
Q 12 11502 743 0.000236185 19264592
|
||||||
|
Q 11 8211 507 0.000262390 19272803
|
||||||
|
Q 10 9133 606 0.000293695 19281936
|
||||||
|
Q 9 10014 931 0.000341801 19291950
|
||||||
|
Q 8 8436 698 0.000377816 19300386
|
||||||
|
Q 7 8443 705 0.000414163 19308829
|
||||||
|
Q 6 10203 944 0.000462808 19319032
|
||||||
|
Q 5 6936 756 0.000501760 19325968
|
||||||
|
Q 4 6732 843 0.000545190 19332700
|
||||||
|
Q 3 8215 1104 0.000602040 19340915
|
||||||
|
Q 2 21201 5440 0.000882342 19362116
|
||||||
|
Q 1 82328 22186 0.002019600 19444444
|
||||||
|
Q 0 553853 371953 0.020562901 19998297
|
||||||
|
U 1703
|
||||||
@@ -0,0 +1,12 @@
|
|||||||
|
Q 60 32084 0 0.000000000 32084
|
||||||
|
Q 24 318 2 0.000061725 32402
|
||||||
|
Q 11 98 2 0.000123077 32500
|
||||||
|
Q 8 37 2 0.000184405 32537
|
||||||
|
Q 7 37 3 0.000276294 32574
|
||||||
|
Q 6 40 3 0.000367940 32614
|
||||||
|
Q 5 34 2 0.000428816 32648
|
||||||
|
Q 4 37 5 0.000581306 32685
|
||||||
|
Q 3 28 6 0.000764222 32713
|
||||||
|
Q 2 38 6 0.000946536 32751
|
||||||
|
Q 1 50 21 0.001585318 32801
|
||||||
|
Q 0 286 150 0.006105117 33087
|
||||||
@@ -0,0 +1,13 @@
|
|||||||
|
Q 60 32477 0 0.000000000 32477
|
||||||
|
Q 22 16 1 0.000030776 32493
|
||||||
|
Q 21 44 1 0.000061468 32537
|
||||||
|
Q 19 73 1 0.000091996 32610
|
||||||
|
Q 14 66 1 0.000122414 32676
|
||||||
|
Q 10 26 3 0.000214054 32702
|
||||||
|
Q 8 14 1 0.000244529 32716
|
||||||
|
Q 7 13 2 0.000305539 32729
|
||||||
|
Q 6 47 1 0.000335611 32776
|
||||||
|
Q 3 10 1 0.000366010 32786
|
||||||
|
Q 2 20 2 0.000426751 32806
|
||||||
|
Q 1 248 94 0.003267381 33054
|
||||||
|
Q 0 31 17 0.003778147 33085
|
||||||
+1288
File diff suppressed because it is too large
Load Diff
+803
@@ -0,0 +1,803 @@
|
|||||||
|
%%
|
||||||
|
%% This is file `natbib.sty',
|
||||||
|
%% generated with the docstrip utility.
|
||||||
|
%%
|
||||||
|
%% The original source files were:
|
||||||
|
%%
|
||||||
|
%% natbib.dtx (with options: `package,all')
|
||||||
|
%% =============================================
|
||||||
|
%% IMPORTANT NOTICE:
|
||||||
|
%%
|
||||||
|
%% This program can be redistributed and/or modified under the terms
|
||||||
|
%% of the LaTeX Project Public License Distributed from CTAN
|
||||||
|
%% archives in directory macros/latex/base/lppl.txt; either
|
||||||
|
%% version 1 of the License, or any later version.
|
||||||
|
%%
|
||||||
|
%% This is a generated file.
|
||||||
|
%% It may not be distributed without the original source file natbib.dtx.
|
||||||
|
%%
|
||||||
|
%% Full documentation can be obtained by LaTeXing that original file.
|
||||||
|
%% Only a few abbreviated comments remain here to describe the usage.
|
||||||
|
%% =============================================
|
||||||
|
%% Copyright 1993-2000 Patrick W Daly
|
||||||
|
%% Max-Planck-Institut f\"ur Aeronomie
|
||||||
|
%% Max-Planck-Str. 2
|
||||||
|
%% D-37191 Katlenburg-Lindau
|
||||||
|
%% Germany
|
||||||
|
%% E-mail: daly@linmpi.mpg.de
|
||||||
|
\NeedsTeXFormat{LaTeX2e}[1995/06/01]
|
||||||
|
\ProvidesPackage{natbib}
|
||||||
|
[2000/07/24 7.0a (PWD)]
|
||||||
|
% This package reimplements the LaTeX \cite command to be used for various
|
||||||
|
% citation styles, both author-year and numerical. It accepts BibTeX
|
||||||
|
% output intended for many other packages, and therefore acts as a
|
||||||
|
% general, all-purpose citation-style interface.
|
||||||
|
%
|
||||||
|
% With standard numerical .bst files, only numerical citations are
|
||||||
|
% possible. With an author-year .bst file, both numerical and
|
||||||
|
% author-year citations are possible.
|
||||||
|
%
|
||||||
|
% If author-year citations are selected, \bibitem must have one of the
|
||||||
|
% following forms:
|
||||||
|
% \bibitem[Jones et al.(1990)]{key}...
|
||||||
|
% \bibitem[Jones et al.(1990)Jones, Baker, and Williams]{key}...
|
||||||
|
% \bibitem[Jones et al., 1990]{key}...
|
||||||
|
% \bibitem[\protect\citeauthoryear{Jones, Baker, and Williams}{Jones
|
||||||
|
% et al.}{1990}]{key}...
|
||||||
|
% \bibitem[\protect\citeauthoryear{Jones et al.}{1990}]{key}...
|
||||||
|
% \bibitem[\protect\astroncite{Jones et al.}{1990}]{key}...
|
||||||
|
% \bibitem[\protect\citename{Jones et al., }1990]{key}...
|
||||||
|
% \harvarditem[Jones et al.]{Jones, Baker, and Williams}{1990}{key}...
|
||||||
|
%
|
||||||
|
% This is either to be made up manually, or to be generated by an
|
||||||
|
% appropriate .bst file with BibTeX.
|
||||||
|
% Author-year mode || Numerical mode
|
||||||
|
% Then, \citet{key} ==>> Jones et al. (1990) || Jones et al. [21]
|
||||||
|
% \citep{key} ==>> (Jones et al., 1990) || [21]
|
||||||
|
% Multiple citations as normal:
|
||||||
|
% \citep{key1,key2} ==>> (Jones et al., 1990; Smith, 1989) || [21,24]
|
||||||
|
% or (Jones et al., 1990, 1991) || [21,24]
|
||||||
|
% or (Jones et al., 1990a,b) || [21,24]
|
||||||
|
% \cite{key} is the equivalent of \citet{key} in author-year mode
|
||||||
|
% and of \citep{key} in numerical mode
|
||||||
|
% Full author lists may be forced with \citet* or \citep*, e.g.
|
||||||
|
% \citep*{key} ==>> (Jones, Baker, and Williams, 1990)
|
||||||
|
% Optional notes as:
|
||||||
|
% \citep[chap. 2]{key} ==>> (Jones et al., 1990, chap. 2)
|
||||||
|
% \citep[e.g.,][]{key} ==>> (e.g., Jones et al., 1990)
|
||||||
|
% \citep[see][pg. 34]{key}==>> (see Jones et al., 1990, pg. 34)
|
||||||
|
% (Note: in standard LaTeX, only one note is allowed, after the ref.
|
||||||
|
% Here, one note is like the standard, two make pre- and post-notes.)
|
||||||
|
% \citealt{key} ==>> Jones et al. 1990
|
||||||
|
% \citealt*{key} ==>> Jones, Baker, and Williams 1990
|
||||||
|
% \citealp{key} ==>> Jones et al., 1990
|
||||||
|
% \citealp*{key} ==>> Jones, Baker, and Williams, 1990
|
||||||
|
% Additional citation possibilities (both author-year and numerical modes)
|
||||||
|
% \citeauthor{key} ==>> Jones et al.
|
||||||
|
% \citeauthor*{key} ==>> Jones, Baker, and Williams
|
||||||
|
% \citeyear{key} ==>> 1990
|
||||||
|
% \citeyearpar{key} ==>> (1990)
|
||||||
|
% \citetext{priv. comm.} ==>> (priv. comm.)
|
||||||
|
% Note: full author lists depends on whether the bib style supports them;
|
||||||
|
% if not, the abbreviated list is printed even when full requested.
|
||||||
|
%
|
||||||
|
% For names like della Robbia at the start of a sentence, use
|
||||||
|
% \Citet{dRob98} ==>> Della Robbia (1998)
|
||||||
|
% \Citep{dRob98} ==>> (Della Robbia, 1998)
|
||||||
|
% \Citeauthor{dRob98} ==>> Della Robbia
|
||||||
|
%
|
||||||
|
%
|
||||||
|
% Citation aliasing is achieved with
|
||||||
|
% \defcitealias{key}{text}
|
||||||
|
% \citetalias{key} ==>> text
|
||||||
|
% \citepalias{key} ==>> (text)
|
||||||
|
%
|
||||||
|
% Defining the citation style of a given bib style:
|
||||||
|
% Use \bibpunct (in the preamble only) with 6 mandatory arguments:
|
||||||
|
% 1. opening bracket for citation
|
||||||
|
% 2. closing bracket
|
||||||
|
% 3. citation separator (for multiple citations in one \cite)
|
||||||
|
% 4. the letter n for numerical styles, s for superscripts
|
||||||
|
% else anything for author-year
|
||||||
|
% 5. punctuation between authors and date
|
||||||
|
% 6. punctuation between years (or numbers) when common authors missing
|
||||||
|
% One optional argument is the character coming before post-notes. It
|
||||||
|
% appears in square braces before all other arguments. May be left off.
|
||||||
|
% Example (and default) \bibpunct[, ]{(}{)}{;}{a}{,}{,}
|
||||||
|
%
|
||||||
|
% To make this automatic for a given bib style, named newbib, say, make
|
||||||
|
% a local configuration file, natbib.cfg, with the definition
|
||||||
|
% \newcommand{\bibstyle@newbib}{\bibpunct...}
|
||||||
|
% Then the \bibliographystyle{newbib} will cause \bibstyle@newbib to
|
||||||
|
% be called on THE NEXT LATEX RUN (via the aux file).
|
||||||
|
%
|
||||||
|
% Such preprogrammed definitions may be invoked in the text (preamble only)
|
||||||
|
% by calling \citestyle{newbib}. This is only useful if the style specified
|
||||||
|
% differs from that in \bibliographystyle.
|
||||||
|
%
|
||||||
|
% With \citeindextrue and \citeindexfalse, one can control whether the
|
||||||
|
% \cite commands make an automatic entry of the citation in the .idx
|
||||||
|
% indexing file. For this, \makeindex must also be given in the preamble.
|
||||||
|
%
|
||||||
|
% LaTeX2e Options: (for selecting punctuation)
|
||||||
|
% round - round parentheses are used (default)
|
||||||
|
% square - square brackets are used [option]
|
||||||
|
% curly - curly braces are used {option}
|
||||||
|
% angle - angle brackets are used <option>
|
||||||
|
% colon - multiple citations separated by colon (default)
|
||||||
|
% comma - separated by comma
|
||||||
|
% authoryear - selects author-year citations (default)
|
||||||
|
% numbers- selects numerical citations
|
||||||
|
% super - numerical citations as superscripts
|
||||||
|
% sort - sorts multiple citations according to order in ref. list
|
||||||
|
% sort&compress - like sort, but also compresses numerical citations
|
||||||
|
% longnamesfirst - makes first citation full author list
|
||||||
|
% sectionbib - puts bibliography in a \section* instead of \chapter*
|
||||||
|
% Punctuation so selected dominates over any predefined ones.
|
||||||
|
% LaTeX2e options are called as, e.g.
|
||||||
|
% \usepackage[square,comma]{natbib}
|
||||||
|
% LaTeX the source file natbib.dtx to obtain more details
|
||||||
|
% or the file natnotes.tex for a brief reference sheet.
|
||||||
|
%-----------------------------------------------------------
|
||||||
|
\@ifclassloaded{aguplus}{\PackageError{natbib}
|
||||||
|
{The aguplus class already includes natbib coding,\MessageBreak
|
||||||
|
so you should not add it explicitly}
|
||||||
|
{Type <Return> for now, but then later remove\MessageBreak
|
||||||
|
the command \protect\usepackage{natbib} from the document}
|
||||||
|
\endinput}{}
|
||||||
|
\@ifclassloaded{nlinproc}{\PackageError{natbib}
|
||||||
|
{The nlinproc class already includes natbib coding,\MessageBreak
|
||||||
|
so you should not add it explicitly}
|
||||||
|
{Type <Return> for now, but then later remove\MessageBreak
|
||||||
|
the command \protect\usepackage{natbib} from the document}
|
||||||
|
\endinput}{}
|
||||||
|
\@ifclassloaded{egs}{\PackageError{natbib}
|
||||||
|
{The egs class already includes natbib coding,\MessageBreak
|
||||||
|
so you should not add it explicitly}
|
||||||
|
{Type <Return> for now, but then later remove\MessageBreak
|
||||||
|
the command \protect\usepackage{natbib} from the document}
|
||||||
|
\endinput}{}
|
||||||
|
% Define citation punctuation for some author-year styles
|
||||||
|
% One may add and delete at this point
|
||||||
|
% Or put additions into local configuration file natbib.cfg
|
||||||
|
\newcommand\bibstyle@chicago{\bibpunct{(}{)}{;}{a}{,}{,}}
|
||||||
|
\newcommand\bibstyle@named{\bibpunct{[}{]}{;}{a}{,}{,}}
|
||||||
|
\newcommand\bibstyle@agu{\bibpunct{[}{]}{;}{a}{,}{,~}}%Amer. Geophys. Union
|
||||||
|
\newcommand\bibstyle@egs{\bibpunct{(}{)}{;}{a}{,}{,}}%Eur. Geophys. Soc.
|
||||||
|
\newcommand\bibstyle@agsm{\bibpunct{(}{)}{,}{a}{}{,}\gdef\harvardand{\&}}
|
||||||
|
\newcommand\bibstyle@kluwer{\bibpunct{(}{)}{,}{a}{}{,}\gdef\harvardand{\&}}
|
||||||
|
\newcommand\bibstyle@dcu{\bibpunct{(}{)}{;}{a}{;}{,}\gdef\harvardand{and}}
|
||||||
|
\newcommand\bibstyle@aa{\bibpunct{(}{)}{;}{a}{}{,}} %Astronomy & Astrophysics
|
||||||
|
\newcommand\bibstyle@pass{\bibpunct{(}{)}{;}{a}{,}{,}}%Planet. & Space Sci
|
||||||
|
\newcommand\bibstyle@anngeo{\bibpunct{(}{)}{;}{a}{,}{,}}%Annales Geophysicae
|
||||||
|
\newcommand\bibstyle@nlinproc{\bibpunct{(}{)}{;}{a}{,}{,}}%Nonlin.Proc.Geophys.
|
||||||
|
% Define citation punctuation for some numerical styles
|
||||||
|
\newcommand\bibstyle@cospar{\bibpunct{/}{/}{,}{n}{}{}%
|
||||||
|
\gdef\NAT@biblabelnum##1{##1.}}
|
||||||
|
\newcommand\bibstyle@esa{\bibpunct{(Ref.~}{)}{,}{n}{}{}%
|
||||||
|
\gdef\NAT@biblabelnum##1{##1.\hspace{1em}}}
|
||||||
|
\newcommand\bibstyle@nature{\bibpunct{}{}{,}{s}{}{\textsuperscript{,}}%
|
||||||
|
\gdef\NAT@biblabelnum##1{##1.}}
|
||||||
|
% The standard LaTeX styles
|
||||||
|
\newcommand\bibstyle@plain{\bibpunct{[}{]}{,}{n}{}{,}}
|
||||||
|
\let\bibstyle@alpha=\bibstyle@plain
|
||||||
|
\let\bibstyle@abbrv=\bibstyle@plain
|
||||||
|
\let\bibstyle@unsrt=\bibstyle@plain
|
||||||
|
% The author-year modifications of the standard styles
|
||||||
|
\newcommand\bibstyle@plainnat{\bibpunct{[}{]}{,}{a}{,}{,}}
|
||||||
|
\let\bibstyle@abbrvnat=\bibstyle@plainnat
|
||||||
|
\let\bibstyle@unsrtnat=\bibstyle@plainnat
|
||||||
|
\newif\ifNAT@numbers \NAT@numbersfalse
|
||||||
|
\newif\ifNAT@super \NAT@superfalse
|
||||||
|
\DeclareOption{numbers}{\NAT@numberstrue
|
||||||
|
\ExecuteOptions{square,comma,nobibstyle}}
|
||||||
|
\DeclareOption{super}{\NAT@supertrue\NAT@numberstrue
|
||||||
|
\renewcommand\NAT@open{}\renewcommand\NAT@close{}
|
||||||
|
\ExecuteOptions{nobibstyle}}
|
||||||
|
\DeclareOption{authoryear}{\NAT@numbersfalse
|
||||||
|
\ExecuteOptions{round,colon,bibstyle}}
|
||||||
|
\DeclareOption{round}{%
|
||||||
|
\renewcommand\NAT@open{(} \renewcommand\NAT@close{)}
|
||||||
|
\ExecuteOptions{nobibstyle}}
|
||||||
|
\DeclareOption{square}{%
|
||||||
|
\renewcommand\NAT@open{[} \renewcommand\NAT@close{]}
|
||||||
|
\ExecuteOptions{nobibstyle}}
|
||||||
|
\DeclareOption{angle}{%
|
||||||
|
\renewcommand\NAT@open{$<$} \renewcommand\NAT@close{$>$}
|
||||||
|
\ExecuteOptions{nobibstyle}}
|
||||||
|
\DeclareOption{curly}{%
|
||||||
|
\renewcommand\NAT@open{\{} \renewcommand\NAT@close{\}}
|
||||||
|
\ExecuteOptions{nobibstyle}}
|
||||||
|
\DeclareOption{comma}{\renewcommand\NAT@sep{,}
|
||||||
|
\ExecuteOptions{nobibstyle}}
|
||||||
|
\DeclareOption{colon}{\renewcommand\NAT@sep{;}
|
||||||
|
\ExecuteOptions{nobibstyle}}
|
||||||
|
\DeclareOption{nobibstyle}{\let\bibstyle=\@gobble}
|
||||||
|
\DeclareOption{bibstyle}{\let\bibstyle=\@citestyle}
|
||||||
|
\newif\ifNAT@openbib \NAT@openbibfalse
|
||||||
|
\DeclareOption{openbib}{\NAT@openbibtrue}
|
||||||
|
\DeclareOption{sectionbib}{\def\NAT@sectionbib{on}}
|
||||||
|
\def\NAT@sort{0}
|
||||||
|
\DeclareOption{sort}{\def\NAT@sort{1}}
|
||||||
|
\DeclareOption{sort&compress}{\def\NAT@sort{2}}
|
||||||
|
\@ifpackageloaded{cite}{\PackageWarningNoLine{natbib}
|
||||||
|
{The `cite' package should not be used\MessageBreak
|
||||||
|
with natbib. Use option `sort' instead}\ExecuteOptions{sort}}{}
|
||||||
|
\newif\ifNAT@longnames\NAT@longnamesfalse
|
||||||
|
\DeclareOption{longnamesfirst}{\NAT@longnamestrue}
|
||||||
|
\DeclareOption{nonamebreak}{\def\NAT@nmfmt#1{\mbox{\NAT@up#1}}}
|
||||||
|
\def\NAT@nmfmt#1{{\NAT@up#1}}
|
||||||
|
\renewcommand\bibstyle[1]{\@ifundefined{bibstyle@#1}{\relax}
|
||||||
|
{\csname bibstyle@#1\endcsname}}
|
||||||
|
\AtBeginDocument{\global\let\bibstyle=\@gobble}
|
||||||
|
\let\@citestyle\bibstyle
|
||||||
|
\newcommand\citestyle[1]{\@citestyle{#1}\let\bibstyle\@gobble}
|
||||||
|
\@onlypreamble{\citestyle}\@onlypreamble{\@citestyle}
|
||||||
|
\newcommand\bibpunct[7][, ]%
|
||||||
|
{\gdef\NAT@open{#2}\gdef\NAT@close{#3}\gdef
|
||||||
|
\NAT@sep{#4}\global\NAT@numbersfalse\ifx #5n\global\NAT@numberstrue
|
||||||
|
\else
|
||||||
|
\ifx #5s\global\NAT@numberstrue\global\NAT@supertrue
|
||||||
|
\fi\fi
|
||||||
|
\gdef\NAT@aysep{#6}\gdef\NAT@yrsep{#7}%
|
||||||
|
\gdef\NAT@cmt{#1}%
|
||||||
|
\global\let\bibstyle\@gobble
|
||||||
|
}
|
||||||
|
\@onlypreamble{\bibpunct}
|
||||||
|
\newcommand\NAT@open{(} \newcommand\NAT@close{)}
|
||||||
|
\newcommand\NAT@sep{;}
|
||||||
|
\ProcessOptions
|
||||||
|
\newcommand\NAT@aysep{,} \newcommand\NAT@yrsep{,}
|
||||||
|
\newcommand\NAT@cmt{, }
|
||||||
|
\newcommand\NAT@cite%
|
||||||
|
[3]{\ifNAT@swa\NAT@@open\if*#2*\else#2\ \fi
|
||||||
|
#1\if*#3*\else\NAT@cmt#3\fi\NAT@@close\else#1\fi\endgroup}
|
||||||
|
\newcommand\NAT@citenum%
|
||||||
|
[3]{\ifNAT@swa\NAT@@open\if*#2*\else#2\ \fi
|
||||||
|
#1\if*#3*\else\NAT@cmt#3\fi\NAT@@close\else#1\fi\endgroup}
|
||||||
|
\newcommand\NAT@citesuper[3]{\ifNAT@swa
|
||||||
|
\unskip\hspace{1\p@}\textsuperscript{#1}%
|
||||||
|
\if*#3*\else\ (#3)\fi\else #1\fi\endgroup}
|
||||||
|
\providecommand
|
||||||
|
\textsuperscript[1]{\mbox{$^{\mbox{\scriptsize#1}}$}}
|
||||||
|
\providecommand\@firstofone[1]{#1}
|
||||||
|
\newcommand\NAT@citexnum{}
|
||||||
|
\def\NAT@citexnum[#1][#2]#3{%
|
||||||
|
\NAT@sort@cites{#3}%
|
||||||
|
\let\@citea\@empty
|
||||||
|
\@cite{\def\NAT@num{-1}\let\NAT@last@yr\relax\let\NAT@nm\@empty
|
||||||
|
\@for\@citeb:=\NAT@cite@list\do
|
||||||
|
{\edef\@citeb{\expandafter\@firstofone\@citeb}%
|
||||||
|
\if@filesw\immediate\write\@auxout{\string\citation{\@citeb}}\fi
|
||||||
|
\@ifundefined{b@\@citeb\@extra@b@citeb}{%
|
||||||
|
{\reset@font\bfseries?}
|
||||||
|
\NAT@citeundefined\PackageWarning{natbib}%
|
||||||
|
{Citation `\@citeb' on page \thepage \space undefined}}%
|
||||||
|
{\let\NAT@last@num\NAT@num\let\NAT@last@nm\NAT@nm
|
||||||
|
\NAT@parse{\@citeb}%
|
||||||
|
\ifNAT@longnames\@ifundefined{bv@\@citeb\@extra@b@citeb}{%
|
||||||
|
\let\NAT@name=\NAT@all@names
|
||||||
|
\global\@namedef{bv@\@citeb\@extra@b@citeb}{}}{}%
|
||||||
|
\fi
|
||||||
|
\ifNAT@full\let\NAT@nm\NAT@all@names\else
|
||||||
|
\let\NAT@nm\NAT@name\fi
|
||||||
|
\ifNAT@swa
|
||||||
|
\ifnum\NAT@ctype>1\relax\@citea
|
||||||
|
\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
|
||||||
|
\ifnum\NAT@ctype=2\relax\NAT@test{\NAT@ctype}%
|
||||||
|
\else\NAT@alias
|
||||||
|
\fi\hyper@natlinkend\else
|
||||||
|
\ifnum\NAT@sort>1
|
||||||
|
\begingroup\catcode`\_=8
|
||||||
|
\ifcat _\ifnum\z@<0\NAT@num _\else A\fi
|
||||||
|
\global\let\NAT@nm=\NAT@num \else \gdef\NAT@nm{-2}\fi
|
||||||
|
\ifcat _\ifnum\z@<0\NAT@last@num _\else A\fi
|
||||||
|
\global\@tempcnta=\NAT@last@num \global\advance\@tempcnta by\@ne
|
||||||
|
\else \global\@tempcnta\m@ne\fi
|
||||||
|
\endgroup
|
||||||
|
\ifnum\NAT@nm=\@tempcnta
|
||||||
|
\ifx\NAT@last@yr\relax
|
||||||
|
\edef\NAT@last@yr{\@citea \mbox{\noexpand\citenumfont{\NAT@num}}}%
|
||||||
|
\else
|
||||||
|
\edef\NAT@last@yr{--\penalty\@m\mbox{\noexpand\citenumfont{\NAT@num}}}%
|
||||||
|
\fi
|
||||||
|
\else
|
||||||
|
\NAT@last@yr \@citea \mbox{\citenumfont{\NAT@num}}%
|
||||||
|
\let\NAT@last@yr\relax
|
||||||
|
\fi
|
||||||
|
\else
|
||||||
|
\@citea \mbox{\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
|
||||||
|
{\citenumfont{\NAT@num}}\hyper@natlinkend}%
|
||||||
|
\fi
|
||||||
|
\fi
|
||||||
|
\def\@citea{\NAT@sep\penalty\@m\NAT@space}%
|
||||||
|
\else
|
||||||
|
\ifcase\NAT@ctype\relax
|
||||||
|
\ifx\NAT@last@nm\NAT@nm \NAT@yrsep\penalty\@m\NAT@space\else
|
||||||
|
\@citea \NAT@test{1}\ \NAT@@open
|
||||||
|
\if*#1*\else#1\ \fi\fi \NAT@mbox{%
|
||||||
|
\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
|
||||||
|
{\citenumfont{\NAT@num}}\hyper@natlinkend}%
|
||||||
|
\def\@citea{\NAT@@close\NAT@sep\penalty\@m\ }%
|
||||||
|
\or\@citea
|
||||||
|
\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
|
||||||
|
\NAT@test{\NAT@ctype}\hyper@natlinkend
|
||||||
|
\def\@citea{\NAT@sep\penalty\@m\ }%
|
||||||
|
\or\@citea
|
||||||
|
\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
|
||||||
|
\NAT@test{\NAT@ctype}\hyper@natlinkend
|
||||||
|
\def\@citea{\NAT@sep\penalty\@m\ }%
|
||||||
|
\or\@citea
|
||||||
|
\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
|
||||||
|
\NAT@alias\hyper@natlinkend
|
||||||
|
\def\@citea{\NAT@sep\penalty\@m\ }%
|
||||||
|
\fi
|
||||||
|
\fi
|
||||||
|
}}%
|
||||||
|
\ifnum\NAT@sort>1\relax\NAT@last@yr\fi
|
||||||
|
\ifNAT@swa\else\ifnum\NAT@ctype=0\if*#2*\else
|
||||||
|
\NAT@cmt#2\fi \NAT@@close\fi\fi}{#1}{#2}}
|
||||||
|
\newcommand\NAT@test[1]{\ifnum#1=1 \ifx\NAT@nm\NAT@noname
|
||||||
|
{\reset@font\bfseries(author?)}\PackageWarning{natbib}
|
||||||
|
{Author undefined for citation`\@citeb'
|
||||||
|
\MessageBreak
|
||||||
|
on page \thepage}\else \NAT@nm \fi
|
||||||
|
\else \if\relax\NAT@date\relax
|
||||||
|
{\reset@font\bfseries(year?)}\PackageWarning{natbib}
|
||||||
|
{Year undefined for citation`\@citeb'
|
||||||
|
\MessageBreak
|
||||||
|
on page \thepage}\else \NAT@date \fi \fi}
|
||||||
|
\let\citenumfont=\relax
|
||||||
|
\newcommand\NAT@citex{}
|
||||||
|
\def\NAT@citex%
|
||||||
|
[#1][#2]#3{%
|
||||||
|
\NAT@sort@cites{#3}%
|
||||||
|
\let\@citea\@empty
|
||||||
|
\@cite{\let\NAT@nm\@empty\let\NAT@year\@empty
|
||||||
|
\@for\@citeb:=\NAT@cite@list\do
|
||||||
|
{\edef\@citeb{\expandafter\@firstofone\@citeb}%
|
||||||
|
\if@filesw\immediate\write\@auxout{\string\citation{\@citeb}}\fi
|
||||||
|
\@ifundefined{b@\@citeb\@extra@b@citeb}{\@citea%
|
||||||
|
{\reset@font\bfseries ?}\NAT@citeundefined
|
||||||
|
\PackageWarning{natbib}%
|
||||||
|
{Citation `\@citeb' on page \thepage \space undefined}\def\NAT@date{}}%
|
||||||
|
{\let\NAT@last@nm=\NAT@nm\let\NAT@last@yr=\NAT@year
|
||||||
|
\NAT@parse{\@citeb}%
|
||||||
|
\ifNAT@longnames\@ifundefined{bv@\@citeb\@extra@b@citeb}{%
|
||||||
|
\let\NAT@name=\NAT@all@names
|
||||||
|
\global\@namedef{bv@\@citeb\@extra@b@citeb}{}}{}%
|
||||||
|
\fi
|
||||||
|
\ifNAT@full\let\NAT@nm\NAT@all@names\else
|
||||||
|
\let\NAT@nm\NAT@name\fi
|
||||||
|
\ifNAT@swa\ifcase\NAT@ctype
|
||||||
|
\if\relax\NAT@date\relax
|
||||||
|
\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
|
||||||
|
\NAT@nmfmt{\NAT@nm}\NAT@date\hyper@natlinkend
|
||||||
|
\else
|
||||||
|
\ifx\NAT@last@nm\NAT@nm\NAT@yrsep
|
||||||
|
\ifx\NAT@last@yr\NAT@year
|
||||||
|
\hyper@natlinkstart{\@citeb\@extra@b@citeb}\NAT@exlab
|
||||||
|
\hyper@natlinkend
|
||||||
|
\else\unskip\
|
||||||
|
\hyper@natlinkstart{\@citeb\@extra@b@citeb}\NAT@date
|
||||||
|
\hyper@natlinkend
|
||||||
|
\fi
|
||||||
|
\else\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
|
||||||
|
\NAT@nmfmt{\NAT@nm}%
|
||||||
|
\hyper@natlinkbreak{\NAT@aysep\ }{\@citeb\@extra@b@citeb}%
|
||||||
|
\NAT@date\hyper@natlinkend
|
||||||
|
\fi
|
||||||
|
\fi
|
||||||
|
\or\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
|
||||||
|
\NAT@nmfmt{\NAT@nm}\hyper@natlinkend
|
||||||
|
\or\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
|
||||||
|
\NAT@date\hyper@natlinkend
|
||||||
|
\or\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
|
||||||
|
\NAT@alias\hyper@natlinkend
|
||||||
|
\fi \def\@citea{\NAT@sep\ }%
|
||||||
|
\else\ifcase\NAT@ctype
|
||||||
|
\if\relax\NAT@date\relax
|
||||||
|
\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
|
||||||
|
\NAT@nmfmt{\NAT@nm}\hyper@natlinkend
|
||||||
|
\else
|
||||||
|
\ifx\NAT@last@nm\NAT@nm\NAT@yrsep
|
||||||
|
\ifx\NAT@last@yr\NAT@year
|
||||||
|
\hyper@natlinkstart{\@citeb\@extra@b@citeb}\NAT@exlab
|
||||||
|
\hyper@natlinkend
|
||||||
|
\else\unskip\
|
||||||
|
\hyper@natlinkstart{\@citeb\@extra@b@citeb}\NAT@date
|
||||||
|
\hyper@natlinkend
|
||||||
|
\fi
|
||||||
|
\else\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
|
||||||
|
\NAT@nmfmt{\NAT@nm}%
|
||||||
|
\hyper@natlinkbreak{\ \NAT@@open\if*#1*\else#1\ \fi}%
|
||||||
|
{\@citeb\@extra@b@citeb}%
|
||||||
|
\NAT@date\hyper@natlinkend\fi
|
||||||
|
\fi
|
||||||
|
\or\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
|
||||||
|
\NAT@nmfmt{\NAT@nm}\hyper@natlinkend
|
||||||
|
\or\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
|
||||||
|
\NAT@date\hyper@natlinkend
|
||||||
|
\or\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
|
||||||
|
\NAT@alias\hyper@natlinkend
|
||||||
|
\fi \if\relax\NAT@date\relax\def\@citea{\NAT@sep\ }%
|
||||||
|
\else\def\@citea{\NAT@@close\NAT@sep\ }\fi
|
||||||
|
\fi
|
||||||
|
}}\ifNAT@swa\else\if*#2*\else\NAT@cmt#2\fi
|
||||||
|
\if\relax\NAT@date\relax\else\NAT@@close\fi\fi}{#1}{#2}}
|
||||||
|
\newif\ifNAT@par \NAT@partrue
|
||||||
|
\newcommand\NAT@@open{\ifNAT@par\NAT@open\fi}
|
||||||
|
\newcommand\NAT@@close{\ifNAT@par\NAT@close\fi}
|
||||||
|
\newcommand\NAT@alias{\@ifundefined{al@\@citeb\@extra@b@citeb}{%
|
||||||
|
{\reset@font\bfseries(alias?)}\PackageWarning{natbib}
|
||||||
|
{Alias undefined for citation `\@citeb'
|
||||||
|
\MessageBreak on page \thepage}}{\@nameuse{al@\@citeb\@extra@b@citeb}}}
|
||||||
|
\let\NAT@up\relax
|
||||||
|
\newcommand\NAT@Up[1]{{\let\protect\@unexpandable@protect\let~\relax
|
||||||
|
\expandafter\NAT@deftemp#1}\expandafter\NAT@UP\NAT@temp}
|
||||||
|
\newcommand\NAT@deftemp[1]{\xdef\NAT@temp{#1}}
|
||||||
|
\newcommand\NAT@UP[1]{\let\@tempa\NAT@UP\ifcat a#1\MakeUppercase{#1}%
|
||||||
|
\let\@tempa\relax\else#1\fi\@tempa}
|
||||||
|
\newcommand\shortcites[1]{%
|
||||||
|
\@bsphack\@for\@citeb:=#1\do
|
||||||
|
{\edef\@citeb{\expandafter\@firstofone\@citeb}%
|
||||||
|
\global\@namedef{bv@\@citeb\@extra@b@citeb}{}}\@esphack}
|
||||||
|
\newcommand\NAT@biblabel[1]{\hfill}
|
||||||
|
\newcommand\NAT@biblabelnum[1]{\bibnumfmt{#1}}
|
||||||
|
\newcommand\bibnumfmt[1]{[#1]}
|
||||||
|
\def\@tempa#1{[#1]}
|
||||||
|
\ifx\@tempa\@biblabel\let\@biblabel\@empty\fi
|
||||||
|
\newcommand\NAT@bibsetnum[1]{\settowidth\labelwidth{\@biblabel{#1}}%
|
||||||
|
\setlength{\leftmargin}{\labelwidth}\addtolength{\leftmargin}{\labelsep}%
|
||||||
|
\setlength{\itemsep}{\bibsep}\setlength{\parsep}{\z@}%
|
||||||
|
\ifNAT@openbib
|
||||||
|
\addtolength{\leftmargin}{4mm}%
|
||||||
|
\setlength{\itemindent}{-4mm}%
|
||||||
|
\setlength{\listparindent}{\itemindent}%
|
||||||
|
\setlength{\parsep}{0pt}%
|
||||||
|
\fi
|
||||||
|
}
|
||||||
|
\newlength{\bibhang}
|
||||||
|
\setlength{\bibhang}{1em}
|
||||||
|
\newlength{\bibsep}
|
||||||
|
{\@listi \global\bibsep\itemsep \global\advance\bibsep by\parsep}
|
||||||
|
|
||||||
|
\newcommand\NAT@bibsetup%
|
||||||
|
[1]{\setlength{\leftmargin}{\bibhang}\setlength{\itemindent}{-\leftmargin}%
|
||||||
|
\setlength{\itemsep}{\bibsep}\setlength{\parsep}{\z@}}
|
||||||
|
\newcommand\NAT@set@cites{\ifNAT@numbers
|
||||||
|
\ifNAT@super \let\@cite\NAT@citesuper
|
||||||
|
\def\NAT@mbox##1{\unskip\nobreak\hspace{1\p@}\textsuperscript{##1}}%
|
||||||
|
\let\citeyearpar=\citeyear
|
||||||
|
\let\NAT@space\relax\else
|
||||||
|
\let\NAT@mbox=\mbox
|
||||||
|
\let\@cite\NAT@citenum \def\NAT@space{ }\fi
|
||||||
|
\let\@citex\NAT@citexnum
|
||||||
|
\ifx\@biblabel\@empty\let\@biblabel\NAT@biblabelnum\fi
|
||||||
|
\let\@bibsetup\NAT@bibsetnum
|
||||||
|
\def\natexlab##1{}%
|
||||||
|
\else
|
||||||
|
\let\@cite\NAT@cite
|
||||||
|
\let\@citex\NAT@citex
|
||||||
|
\let\@biblabel\NAT@biblabel
|
||||||
|
\let\@bibsetup\NAT@bibsetup
|
||||||
|
\def\natexlab##1{##1}%
|
||||||
|
\fi}
|
||||||
|
\AtBeginDocument{\NAT@set@cites}
|
||||||
|
\AtBeginDocument{\ifx\SK@def\@undefined\else
|
||||||
|
\ifx\SK@cite\@empty\else
|
||||||
|
\SK@def\@citex[#1][#2]#3{\SK@\SK@@ref{#3}\SK@@citex[#1][#2]{#3}}\fi
|
||||||
|
\ifx\SK@citeauthor\@undefined\def\HAR@checkdef{}\else
|
||||||
|
\let\citeauthor\SK@citeauthor
|
||||||
|
\let\citefullauthor\SK@citefullauthor
|
||||||
|
\let\citeyear\SK@citeyear\fi
|
||||||
|
\fi}
|
||||||
|
\AtBeginDocument{\@ifpackageloaded{hyperref}{%
|
||||||
|
\ifnum\NAT@sort=2\def\NAT@sort{1}\fi}{}}
|
||||||
|
\newif\ifNAT@full\NAT@fullfalse
|
||||||
|
\newif\ifNAT@swa
|
||||||
|
\DeclareRobustCommand\citet
|
||||||
|
{\begingroup\NAT@swafalse\def\NAT@ctype{0}\NAT@partrue
|
||||||
|
\@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
|
||||||
|
\newcommand\NAT@citetp{\@ifnextchar[{\NAT@@citetp}{\NAT@@citetp[]}}
|
||||||
|
\newcommand\NAT@@citetp{}
|
||||||
|
\def\NAT@@citetp[#1]{\@ifnextchar[{\@citex[#1]}{\@citex[][#1]}}
|
||||||
|
\DeclareRobustCommand\citep
|
||||||
|
{\begingroup\NAT@swatrue\def\NAT@ctype{0}\NAT@partrue
|
||||||
|
\@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
|
||||||
|
\DeclareRobustCommand\cite
|
||||||
|
{\begingroup\def\NAT@ctype{0}\NAT@partrue\NAT@swatrue
|
||||||
|
\@ifstar{\NAT@fulltrue\NAT@cites}{\NAT@fullfalse\NAT@cites}}
|
||||||
|
\newcommand\NAT@cites{\@ifnextchar [{\NAT@@citetp}{%
|
||||||
|
\ifNAT@numbers\else
|
||||||
|
\NAT@swafalse
|
||||||
|
\fi
|
||||||
|
\NAT@@citetp[]}}
|
||||||
|
\DeclareRobustCommand\citealt
|
||||||
|
{\begingroup\NAT@swafalse\def\NAT@ctype{0}\NAT@parfalse
|
||||||
|
\@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
|
||||||
|
\DeclareRobustCommand\citealp
|
||||||
|
{\begingroup\NAT@swatrue\def\NAT@ctype{0}\NAT@parfalse
|
||||||
|
\@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
|
||||||
|
\DeclareRobustCommand\citeauthor
|
||||||
|
{\begingroup\NAT@swafalse\def\NAT@ctype{1}\NAT@parfalse
|
||||||
|
\@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
|
||||||
|
\DeclareRobustCommand\Citet
|
||||||
|
{\begingroup\NAT@swafalse\def\NAT@ctype{0}\NAT@partrue
|
||||||
|
\let\NAT@up\NAT@Up
|
||||||
|
\@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
|
||||||
|
\DeclareRobustCommand\Citep
|
||||||
|
{\begingroup\NAT@swatrue\def\NAT@ctype{0}\NAT@partrue
|
||||||
|
\let\NAT@up\NAT@Up
|
||||||
|
\@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
|
||||||
|
\DeclareRobustCommand\Citealt
|
||||||
|
{\begingroup\NAT@swafalse\def\NAT@ctype{0}\NAT@parfalse
|
||||||
|
\let\NAT@up\NAT@Up
|
||||||
|
\@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
|
||||||
|
\DeclareRobustCommand\Citealp
|
||||||
|
{\begingroup\NAT@swatrue\def\NAT@ctype{0}\NAT@parfalse
|
||||||
|
\let\NAT@up\NAT@Up
|
||||||
|
\@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
|
||||||
|
\DeclareRobustCommand\Citeauthor
|
||||||
|
{\begingroup\NAT@swafalse\def\NAT@ctype{1}\NAT@parfalse
|
||||||
|
\let\NAT@up\NAT@Up
|
||||||
|
\@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
|
||||||
|
\DeclareRobustCommand\citeyear
|
||||||
|
{\begingroup\NAT@swafalse\def\NAT@ctype{2}\NAT@parfalse\NAT@citetp}
|
||||||
|
\DeclareRobustCommand\citeyearpar
|
||||||
|
{\begingroup\NAT@swatrue\def\NAT@ctype{2}\NAT@partrue\NAT@citetp}
|
||||||
|
\newcommand\citetext[1]{\NAT@open#1\NAT@close}
|
||||||
|
\DeclareRobustCommand\citefullauthor
|
||||||
|
{\citeauthor*}
|
||||||
|
\newcommand\defcitealias[2]{%
|
||||||
|
\@ifundefined{al@#1\@extra@b@citeb}{}
|
||||||
|
{\PackageWarning{natbib}{Overwriting existing alias for citation #1}}
|
||||||
|
\@namedef{al@#1\@extra@b@citeb}{#2}}
|
||||||
|
\DeclareRobustCommand\citetalias{\begingroup
|
||||||
|
\NAT@swafalse\def\NAT@ctype{3}\NAT@parfalse\NAT@citetp}
|
||||||
|
\DeclareRobustCommand\citepalias{\begingroup
|
||||||
|
\NAT@swatrue\def\NAT@ctype{3}\NAT@partrue\NAT@citetp}
|
||||||
|
\renewcommand\nocite[1]{\@bsphack
|
||||||
|
\@for\@citeb:=#1\do{%
|
||||||
|
\edef\@citeb{\expandafter\@firstofone\@citeb}%
|
||||||
|
\if@filesw\immediate\write\@auxout{\string\citation{\@citeb}}\fi
|
||||||
|
\if*\@citeb\else
|
||||||
|
\@ifundefined{b@\@citeb\@extra@b@citeb}{%
|
||||||
|
\NAT@citeundefined \PackageWarning{natbib}%
|
||||||
|
{Citation `\@citeb' undefined}}{}\fi}%
|
||||||
|
\@esphack}
|
||||||
|
\newcommand\NAT@parse[1]{{%
|
||||||
|
\let\protect=\@unexpandable@protect\let~\relax
|
||||||
|
\let\active@prefix=\@gobble
|
||||||
|
\xdef\NAT@temp{\csname b@#1\@extra@b@citeb\endcsname}}%
|
||||||
|
\expandafter\NAT@split\NAT@temp
|
||||||
|
\expandafter\NAT@parse@date\NAT@date??????@@%
|
||||||
|
\ifciteindex\NAT@index\fi
|
||||||
|
}
|
||||||
|
\newcommand\NAT@split[4]{%
|
||||||
|
\gdef\NAT@num{#1}\gdef\NAT@name{#3}\gdef\NAT@date{#2}%
|
||||||
|
\gdef\NAT@all@names{#4}%
|
||||||
|
\ifx\NAT@noname\NAT@all@names \gdef\NAT@all@names{#3}\fi}
|
||||||
|
\newcommand\NAT@parse@date{}
|
||||||
|
\def\NAT@parse@date#1#2#3#4#5#6@@{%
|
||||||
|
\ifnum\the\catcode`#1=11\def\NAT@year{}\def\NAT@exlab{#1}\else
|
||||||
|
\ifnum\the\catcode`#2=11\def\NAT@year{#1}\def\NAT@exlab{#2}\else
|
||||||
|
\ifnum\the\catcode`#3=11\def\NAT@year{#1#2}\def\NAT@exlab{#3}\else
|
||||||
|
\ifnum\the\catcode`#4=11\def\NAT@year{#1#2#3}\def\NAT@exlab{#4}\else
|
||||||
|
\def\NAT@year{#1#2#3#4}\def\NAT@exlab{{#5}}\fi\fi\fi\fi}
|
||||||
|
\newcommand\NAT@index{}
|
||||||
|
\let\NAT@makeindex=\makeindex
|
||||||
|
\renewcommand\makeindex{\NAT@makeindex
|
||||||
|
\renewcommand\NAT@index{\@bsphack\begingroup
|
||||||
|
\def~{\string~}\@wrindex{\NAT@idxtxt}}}
|
||||||
|
\newcommand\NAT@idxtxt{\NAT@name\ \NAT@open\NAT@date\NAT@close}
|
||||||
|
\@ifundefined{@indexfile}{}{\let\NAT@makeindex\relax\makeindex}
|
||||||
|
\newif\ifciteindex \citeindexfalse
|
||||||
|
\newcommand\citeindextype{default}
|
||||||
|
\newcommand\NAT@index@alt{{\let\protect=\noexpand\let~\relax
|
||||||
|
\xdef\NAT@temp{\NAT@idxtxt}}\expandafter\NAT@exp\NAT@temp\@nil}
|
||||||
|
\newcommand\NAT@exp{}
|
||||||
|
\def\NAT@exp#1\@nil{\mbox{}\index[\citeindextype]{#1}}
|
||||||
|
|
||||||
|
\AtBeginDocument{%
|
||||||
|
\@ifpackageloaded{index}{\let\NAT@index=\NAT@index@alt}{}}
|
||||||
|
\newcommand\NAT@ifcmd{\futurelet\NAT@temp\NAT@ifxcmd}
|
||||||
|
\newcommand\NAT@ifxcmd{\ifx\NAT@temp\relax\else\expandafter\NAT@bare\fi}
|
||||||
|
\def\NAT@bare#1(#2)#3(@)#4\@nil#5{%
|
||||||
|
\if @#2
|
||||||
|
\expandafter\NAT@apalk#1, , \@nil{#5}\else
|
||||||
|
\stepcounter{NAT@ctr}%
|
||||||
|
\NAT@wrout{\arabic {NAT@ctr}}{#2}{#1}{#3}{#5}
|
||||||
|
\fi
|
||||||
|
}
|
||||||
|
\newcommand\NAT@wrout[5]{%
|
||||||
|
\if@filesw
|
||||||
|
{\let\protect\noexpand\let~\relax
|
||||||
|
\immediate
|
||||||
|
\write\@auxout{\string\bibcite{#5}{{#1}{#2}{{#3}}{{#4}}}}}\fi
|
||||||
|
\ignorespaces}
|
||||||
|
\def\NAT@noname{{}}
|
||||||
|
\renewcommand\bibitem{%
|
||||||
|
\@ifnextchar[{\@lbibitem}{%
|
||||||
|
\global\NAT@stdbsttrue
|
||||||
|
\stepcounter{NAT@ctr}\@lbibitem[\arabic{NAT@ctr}]}}
|
||||||
|
\def\@lbibitem[#1]#2{%
|
||||||
|
\if\relax\@extra@b@citeb\relax\else
|
||||||
|
\@ifundefined{br@#2\@extra@b@citeb}{}{%
|
||||||
|
\@namedef{br@#2}{\@nameuse{br@#2\@extra@b@citeb}}}\fi
|
||||||
|
\@ifundefined{b@#2\@extra@b@citeb}{\def\NAT@num{}}{\NAT@parse{#2}}%
|
||||||
|
\item[\hfil\hyper@natanchorstart{#2\@extra@b@citeb}\@biblabel{\NAT@num}%
|
||||||
|
\hyper@natanchorend]%
|
||||||
|
\NAT@ifcmd#1(@)(@)\@nil{#2}}
|
||||||
|
\ifx\SK@lbibitem\@undefined\else
|
||||||
|
\let\SK@lbibitem\@lbibitem
|
||||||
|
\def\@lbibitem[#1]#2{%
|
||||||
|
\SK@lbibitem[#1]{#2}\SK@\SK@@label{#2}\ignorespaces}\fi
|
||||||
|
\newif\ifNAT@stdbst \NAT@stdbstfalse
|
||||||
|
|
||||||
|
\AtEndDocument
|
||||||
|
{\ifNAT@stdbst\if@filesw\immediate\write\@auxout{\string
|
||||||
|
\global\string\NAT@numberstrue}\fi\fi
|
||||||
|
}
|
||||||
|
\providecommand\bibcite{}
|
||||||
|
\renewcommand\bibcite[2]{\@ifundefined{b@#1\@extra@binfo}\relax
|
||||||
|
{\NAT@citemultiple
|
||||||
|
\PackageWarningNoLine{natbib}{Citation `#1' multiply defined}}%
|
||||||
|
\global\@namedef{b@#1\@extra@binfo}{#2}}
|
||||||
|
\AtEndDocument{\NAT@swatrue\let\bibcite\NAT@testdef}
|
||||||
|
\newcommand\NAT@testdef[2]{%
|
||||||
|
\def\NAT@temp{#2}\expandafter \ifx \csname b@#1\@extra@binfo\endcsname
|
||||||
|
\NAT@temp \else \ifNAT@swa \NAT@swafalse
|
||||||
|
\PackageWarningNoLine{natbib}{Citation(s) may have
|
||||||
|
changed.\MessageBreak
|
||||||
|
Rerun to get citations correct}\fi\fi}
|
||||||
|
\newcommand\NAT@apalk{}
|
||||||
|
\def\NAT@apalk#1, #2, #3\@nil#4{\if\relax#2\relax
|
||||||
|
\global\NAT@stdbsttrue
|
||||||
|
\NAT@wrout{#1}{}{}{}{#4}\else
|
||||||
|
\stepcounter{NAT@ctr}%
|
||||||
|
\NAT@wrout{\arabic {NAT@ctr}}{#2}{#1}{}{#4}\fi}
|
||||||
|
\newcommand\citeauthoryear{}
|
||||||
|
\def\citeauthoryear#1#2#3(@)(@)\@nil#4{\stepcounter{NAT@ctr}\if\relax#3\relax
|
||||||
|
\NAT@wrout{\arabic {NAT@ctr}}{#2}{#1}{}{#4}\else
|
||||||
|
\NAT@wrout{\arabic {NAT@ctr}}{#3}{#2}{#1}{#4}\fi}
|
||||||
|
\newcommand\citestarts{\NAT@open}
|
||||||
|
\newcommand\citeends{\NAT@close}
|
||||||
|
\newcommand\betweenauthors{and}
|
||||||
|
\newcommand\astroncite{}
|
||||||
|
\def\astroncite#1#2(@)(@)\@nil#3{\stepcounter{NAT@ctr}\NAT@wrout{\arabic
|
||||||
|
{NAT@ctr}}{#2}{#1}{}{#3}}
|
||||||
|
\newcommand\citename{}
|
||||||
|
\def\citename#1#2(@)(@)\@nil#3{\expandafter\NAT@apalk#1#2, \@nil{#3}}
|
||||||
|
\newcommand\harvarditem[4][]%
|
||||||
|
{\if\relax#1\relax\bibitem[#2(#3)]{#4}\else
|
||||||
|
\bibitem[#1(#3)#2]{#4}\fi }
|
||||||
|
\newcommand\harvardleft{\NAT@open}
|
||||||
|
\newcommand\harvardright{\NAT@close}
|
||||||
|
\newcommand\harvardyearleft{\NAT@open}
|
||||||
|
\newcommand\harvardyearright{\NAT@close}
|
||||||
|
\AtBeginDocument{\providecommand{\harvardand}{and}}
|
||||||
|
\newcommand\harvardurl[1]{\textbf{URL:} \textit{#1}}
|
||||||
|
\providecommand\bibsection{}
|
||||||
|
\@ifundefined{chapter}%
|
||||||
|
{\renewcommand\bibsection{\section*{\refname
|
||||||
|
\@mkboth{\MakeUppercase{\refname}}{\MakeUppercase{\refname}}}}}
|
||||||
|
{\@ifundefined{NAT@sectionbib}%
|
||||||
|
{\renewcommand\bibsection{\chapter*{\bibname
|
||||||
|
\@mkboth{\MakeUppercase{\bibname}}{\MakeUppercase{\bibname}}}}}
|
||||||
|
{\renewcommand\bibsection{\section*{\bibname
|
||||||
|
\ifx\@mkboth\@gobbletwo\else\markright{\MakeUppercase{\bibname}}\fi}}}}
|
||||||
|
\@ifclassloaded{amsart}%
|
||||||
|
{\renewcommand\bibsection{\section*{\refname}}}{}
|
||||||
|
\@ifclassloaded{amsbook}%
|
||||||
|
{\renewcommand\bibsection{\chapter*{\bibname}}}{}
|
||||||
|
\@ifundefined{bib@heading}{}{\let\bibsection\bib@heading}
|
||||||
|
\newcounter{NAT@ctr}
|
||||||
|
\renewenvironment{thebibliography}[1]{%
|
||||||
|
\bibsection
|
||||||
|
\vspace{1\p@}\parindent \z@\bibpreamble\bibfont\list
|
||||||
|
{\@biblabel{\arabic{NAT@ctr}}}{\@bibsetup{#1}%
|
||||||
|
\setcounter{NAT@ctr}{0}}%
|
||||||
|
\ifNAT@openbib
|
||||||
|
\renewcommand\newblock{\par}
|
||||||
|
\else
|
||||||
|
\renewcommand\newblock{\hskip .11em \@plus.33em \@minus.07em}%
|
||||||
|
\fi
|
||||||
|
\sloppy\clubpenalty4000\widowpenalty4000
|
||||||
|
\sfcode`\.=1000\relax
|
||||||
|
\let\citeN\cite \let\shortcite\cite
|
||||||
|
\let\citeasnoun\cite\fontsize{7}{9}\selectfont
|
||||||
|
}{\def\@noitemerr{%
|
||||||
|
\PackageWarning{natbib}
|
||||||
|
{Empty `thebibliography' environment}}%
|
||||||
|
\endlist\vskip-\lastskip}
|
||||||
|
\let\bibfont\relax
|
||||||
|
\let\bibpreamble\relax
|
||||||
|
\providecommand\reset@font{\relax}
|
||||||
|
\providecommand\bibname{Bibliography}
|
||||||
|
\providecommand\refname{References}
|
||||||
|
\newcommand\NAT@citeundefined{\gdef \NAT@undefined {%
|
||||||
|
\PackageWarningNoLine{natbib}{There were undefined citations}}}
|
||||||
|
\let \NAT@undefined \relax
|
||||||
|
\newcommand\NAT@citemultiple{\gdef \NAT@multiple {%
|
||||||
|
\PackageWarningNoLine{natbib}{There were multiply defined citations}}}
|
||||||
|
\let \NAT@multiple \relax
|
||||||
|
\AtEndDocument{\NAT@undefined\NAT@multiple}
|
||||||
|
\providecommand\@mkboth[2]{}
|
||||||
|
\providecommand\MakeUppercase{\uppercase}
|
||||||
|
\providecommand{\@extra@b@citeb}{}
|
||||||
|
\gdef\@extra@binfo{}
|
||||||
|
\providecommand\hyper@natanchorstart[1]{}
|
||||||
|
\providecommand\hyper@natanchorend{}
|
||||||
|
\providecommand\hyper@natlinkstart[1]{}
|
||||||
|
\providecommand\hyper@natlinkend{}
|
||||||
|
\providecommand\hyper@natlinkbreak[2]{#1}
|
||||||
|
\@ifundefined{bbl@redefine}{}{%
|
||||||
|
\bbl@redefine\nocite#1{%
|
||||||
|
\@safe@activestrue\org@nocite{#1}\@safe@activesfalse}%
|
||||||
|
\bbl@redefine\@lbibitem[#1]#2{%
|
||||||
|
\@safe@activestrue\org@@lbibitem[#1]{#2}\@safe@activesfalse}%
|
||||||
|
}
|
||||||
|
\AtBeginDocument{\@ifundefined{bbl@redefine}{}{%
|
||||||
|
\bbl@redefine\@citex[#1][#2]#3{%
|
||||||
|
\@safe@activestrue\org@@citex[#1][#2]{#3}\@safe@activesfalse}%
|
||||||
|
\bbl@redefine\NAT@testdef#1#2{%
|
||||||
|
\@safe@activestrue\org@NAT@testdef{#1}{#2}\@safe@activesfalse}%
|
||||||
|
\@ifundefined{org@@lbibitem}{%
|
||||||
|
\bbl@redefine\@lbibitem[#1]#2{%
|
||||||
|
\@safe@activestrue\org@@lbibitem[#1]{#2}\@safe@activesfalse}}{}%
|
||||||
|
}}
|
||||||
|
\ifnum\NAT@sort>0
|
||||||
|
\newcommand\NAT@sort@cites[1]{%
|
||||||
|
\@tempcntb\m@ne
|
||||||
|
\let\@celt\delimiter
|
||||||
|
\def\NAT@num@list{}%
|
||||||
|
\def\NAT@cite@list{}%
|
||||||
|
\def\NAT@nonsort@list{}%
|
||||||
|
\@for \@citeb:=#1\do{\NAT@make@cite@list}%
|
||||||
|
\edef\NAT@cite@list{\NAT@cite@list\NAT@nonsort@list}%
|
||||||
|
\edef\NAT@cite@list{\expandafter\NAT@xcom\NAT@cite@list @@}}
|
||||||
|
\begingroup \catcode`\_=8
|
||||||
|
\gdef\NAT@make@cite@list{%
|
||||||
|
\edef\@citeb{\expandafter\@firstofone\@citeb}%
|
||||||
|
\@ifundefined{b@\@citeb\@extra@b@citeb}{\def\NAT@num{A}}%
|
||||||
|
{\NAT@parse{\@citeb}}%
|
||||||
|
\ifcat _\ifnum\z@<0\NAT@num _\else A\fi
|
||||||
|
\@tempcnta\NAT@num \relax
|
||||||
|
\ifnum \@tempcnta>\@tempcntb
|
||||||
|
\edef\NAT@num@list{\NAT@num@list \@celt{\NAT@num}}%
|
||||||
|
\edef\NAT@cite@list{\NAT@cite@list\@citeb,}%
|
||||||
|
\@tempcntb\@tempcnta
|
||||||
|
\else
|
||||||
|
\let\NAT@@cite@list=\NAT@cite@list \def\NAT@cite@list{}%
|
||||||
|
\edef\NAT@num@list{\expandafter\NAT@num@celt \NAT@num@list \@gobble @}%
|
||||||
|
{\let\@celt=\NAT@celt\NAT@num@list}%
|
||||||
|
\fi
|
||||||
|
\else
|
||||||
|
\edef\NAT@nonsort@list{\NAT@nonsort@list\@citeb,}%
|
||||||
|
\fi}
|
||||||
|
\endgroup
|
||||||
|
\def\NAT@celt#1{\ifnum #1<\@tempcnta
|
||||||
|
\xdef\NAT@cite@list{\NAT@cite@list\expandafter\NAT@nextc\NAT@@cite@list @@}%
|
||||||
|
\xdef\NAT@@cite@list{\expandafter\NAT@restc\NAT@@cite@list}%
|
||||||
|
\else
|
||||||
|
\xdef\NAT@cite@list{\NAT@cite@list\@citeb,\NAT@@cite@list}\let\@celt\@gobble%
|
||||||
|
\fi}
|
||||||
|
\def\NAT@num@celt#1#2{\ifx \@celt #1%
|
||||||
|
\ifnum #2<\@tempcnta
|
||||||
|
\@celt{#2}%
|
||||||
|
\expandafter\expandafter\expandafter\NAT@num@celt
|
||||||
|
\else
|
||||||
|
\@celt{\number\@tempcnta}\@celt{#2}%
|
||||||
|
\fi\fi}
|
||||||
|
\def\NAT@nextc#1,#2@@{#1,}
|
||||||
|
\def\NAT@restc#1,#2{#2}
|
||||||
|
\def\NAT@xcom#1,@@{#1}
|
||||||
|
\else
|
||||||
|
\newcommand\NAT@sort@cites[1]{\edef\NAT@cite@list{#1}}\fi
|
||||||
|
\InputIfFileExists{natbib.cfg}
|
||||||
|
{\typeout{Local config file natbib.cfg used}}{}
|
||||||
|
%%
|
||||||
|
%% <<<<< End of generated file <<<<<<
|
||||||
|
%%
|
||||||
|
%% End of file `natbib.sty'.
|
||||||
@@ -0,0 +1,38 @@
|
|||||||
|
Q 60 23616 0 0.000000000
|
||||||
|
Q 45 3520 1 0.000036851
|
||||||
|
Q 41 1840 1 0.000069023
|
||||||
|
Q 37 328 2 0.000136500
|
||||||
|
Q 36 276 1 0.000169033
|
||||||
|
Q 35 480 1 0.000199601
|
||||||
|
Q 33 375 2 0.000262855
|
||||||
|
Q 31 178 2 0.000326659
|
||||||
|
Q 30 153 5 0.000487551
|
||||||
|
Q 29 200 1 0.000516696
|
||||||
|
Q 27 100 3 0.000611601
|
||||||
|
Q 26 93 3 0.000706056
|
||||||
|
Q 25 75 2 0.000768393
|
||||||
|
Q 24 82 1 0.000798314
|
||||||
|
Q 23 80 6 0.000987387
|
||||||
|
Q 22 71 6 0.001175835
|
||||||
|
Q 21 76 7 0.001394921
|
||||||
|
Q 20 63 9 0.001676897
|
||||||
|
Q 19 55 4 0.001800322
|
||||||
|
Q 18 62 8 0.002048987
|
||||||
|
Q 17 55 7 0.002265718
|
||||||
|
Q 16 60 10 0.002575539
|
||||||
|
Q 15 82 9 0.002850877
|
||||||
|
Q 14 67 7 0.003063745
|
||||||
|
Q 13 62 11 0.003401042
|
||||||
|
Q 12 64 13 0.003799084
|
||||||
|
Q 11 56 5 0.003947900
|
||||||
|
Q 10 58 17 0.004468303
|
||||||
|
Q 9 70 22 0.005139796
|
||||||
|
Q 8 23 9 0.005414604
|
||||||
|
Q 7 41 17 0.005933068
|
||||||
|
Q 6 42 18 0.006480881
|
||||||
|
Q 5 33 9 0.006751757
|
||||||
|
Q 4 29 9 0.007022948
|
||||||
|
Q 3 27 15 0.007478764
|
||||||
|
Q 2 23 10 0.007781024
|
||||||
|
Q 1 9 2 0.007840364
|
||||||
|
Q 0 13 8 0.008083105
|
||||||
+60
@@ -0,0 +1,60 @@
|
|||||||
|
set t po eps enh co so "Helvetica,26"
|
||||||
|
|
||||||
|
set style line 1 lt 1 pt 1 lc rgb "#e41a1c" lw 2;
|
||||||
|
set style line 2 lt 1 pt 2 lc rgb "#377eb8" lw 2;
|
||||||
|
set style line 3 lt 1 pt 3 lc rgb "#4daf4a" lw 2;
|
||||||
|
set style line 4 lt 1 pt 4 lc rgb "#984ea3" lw 2;
|
||||||
|
set style line 5 lt 1 pt 6 lc rgb "#ff7f00" lw 2;
|
||||||
|
set style line 6 lt 1 pt 8 lc rgb "#f781bf" lw 2;
|
||||||
|
|
||||||
|
set out "roc-color.eps"
|
||||||
|
|
||||||
|
set pointsize 2.0
|
||||||
|
set size 1.59,1.04
|
||||||
|
set multiplot layout 1,2
|
||||||
|
|
||||||
|
set label "(a)" at graph -0.245,1.06 font "Helvetica-bold,40"
|
||||||
|
set xlab "Error rate of mapped PacBio reads"
|
||||||
|
set ylab "Fraction of mapped reads" off +1.8
|
||||||
|
set ytics 0.02
|
||||||
|
set yran [0.9:1]
|
||||||
|
|
||||||
|
set size 0.8,1
|
||||||
|
set log x
|
||||||
|
set format x "10^{%L}"
|
||||||
|
set key bot right
|
||||||
|
plot "<./eval2roc.pl blasr-mc.eval" u 2:3 t "blasr-mc" w lp ls 4, \
|
||||||
|
"<./eval2roc.pl bwa.eval" u 2:3 t "bwa-mem" w lp ls 2, \
|
||||||
|
"<./eval2roc.pl graphmap.eval" u 2:3 t "graphmap" w lp ls 3, \
|
||||||
|
"<./eval2roc.pl minialign.eval" u 2:3 t "minialign" w lp ls 1, \
|
||||||
|
"<./eval2roc.pl mm2.eval" u 2:3 t "minimap2" w lp ls 6, \
|
||||||
|
"<./eval2roc.pl ngmlr.eval" u 2:3 t "ngm-lr" w lp ls 5
|
||||||
|
unset label
|
||||||
|
|
||||||
|
set origin 0.8,0
|
||||||
|
set size 0.79,1
|
||||||
|
set label "(b)" at graph -0.245,1.06 font "Helvetica-bold,40"
|
||||||
|
set xlab "Error rate of mapped short reads"
|
||||||
|
|
||||||
|
set key top left
|
||||||
|
plot "<./eval2roc.pl -n2e7 bowtie2-s3.sam.eval" u 2:3 t "bowtie2" w lp ls 5, \
|
||||||
|
"<./eval2roc.pl -n2e7 bwa-s3.sam.eval" u 2:3 t "bwa-mem" w lp ls 2, \
|
||||||
|
"<./eval2roc.pl -n2e7 mm2-s3.sam.eval" u 2:3 t "minimap2" w lp ls 6, \
|
||||||
|
"<./eval2roc.pl -n2e7 snap-s3.sam.eval" u 2:3 t "snap" w lp ls 3
|
||||||
|
|
||||||
|
#unset log
|
||||||
|
#unset format
|
||||||
|
#unset key
|
||||||
|
#set log y
|
||||||
|
#set ylab "Accumulative mapping error rate" off +0
|
||||||
|
#set xlab "Mapping quality"
|
||||||
|
#set yran [1e-5:0.1]
|
||||||
|
#set ytics 1e-5,0.1
|
||||||
|
#set format y "10^{%L}"
|
||||||
|
#set xran [60:0] reverse
|
||||||
|
#plot "<./eval2roc.pl blasr-mc.eval" u 1:2 w lp ls 4, \
|
||||||
|
# "<./eval2roc.pl bwa.eval" u 1:2 t "bwa-mem" w lp ls 2, \
|
||||||
|
# "<./eval2roc.pl graphmap.eval" u 1:2 t "graphmap" w lp ls 3, \
|
||||||
|
# "<./eval2roc.pl minialign.eval" u 1:2 t "minialign" w lp ls 1, \
|
||||||
|
# "<./eval2roc.pl mm2.eval" u 1:2 t "minimap2" w lp ls 6, \
|
||||||
|
# "<./eval2roc.pl ngmlr.eval" u 1:2 t "ngm-lr" w lp ls 5
|
||||||
@@ -0,0 +1,62 @@
|
|||||||
|
Q 60 18993268 10320 0.000543350 18993268
|
||||||
|
Q 59 33156 216 0.000553756 19026424
|
||||||
|
Q 58 29982 295 0.000568365 19056406
|
||||||
|
Q 57 9412 278 0.000582666 19065818
|
||||||
|
Q 56 11012 228 0.000594281 19076830
|
||||||
|
Q 55 9968 235 0.000606283 19086798
|
||||||
|
Q 54 8602 292 0.000621301 19095400
|
||||||
|
Q 53 6094 259 0.000634662 19101494
|
||||||
|
Q 52 5026 257 0.000647946 19106520
|
||||||
|
Q 51 4278 224 0.000659522 19110798
|
||||||
|
Q 50 3682 178 0.000668708 19114480
|
||||||
|
Q 49 2750 156 0.000676772 19117230
|
||||||
|
Q 48 2314 112 0.000682548 19119544
|
||||||
|
Q 47 2056 96 0.000687495 19121600
|
||||||
|
Q 46 1658 62 0.000690677 19123258
|
||||||
|
Q 45 1492 74 0.000694493 19124750
|
||||||
|
Q 44 1150 56 0.000697379 19125900
|
||||||
|
Q 43 1062 48 0.000699850 19126962
|
||||||
|
Q 42 976 60 0.000702951 19127938
|
||||||
|
Q 41 884 36 0.000704800 19128822
|
||||||
|
Q 40 708 52 0.000707493 19129530
|
||||||
|
Q 39 870 26 0.000708819 19130400
|
||||||
|
Q 38 598 26 0.000710156 19130998
|
||||||
|
Q 37 542 34 0.000711913 19131540
|
||||||
|
Q 36 846 50 0.000714495 19132386
|
||||||
|
Q 35 590 50 0.000717087 19132976
|
||||||
|
Q 34 550 42 0.000719261 19133526
|
||||||
|
Q 33 2174 66 0.000722628 19135700
|
||||||
|
Q 32 876 86 0.000727089 19136576
|
||||||
|
Q 31 638 104 0.000732500 19137214
|
||||||
|
Q 30 1718 196 0.000742675 19138932
|
||||||
|
Q 29 91022 968 0.000789497 19229954
|
||||||
|
Q 28 12864 781 0.000829556 19242818
|
||||||
|
Q 27 5806 427 0.000851489 19248624
|
||||||
|
Q 26 25274 728 0.000888144 19273898
|
||||||
|
Q 25 7418 680 0.000923070 19281316
|
||||||
|
Q 24 11800 701 0.000958839 19293116
|
||||||
|
Q 23 57328 3933 0.001159250 19350444
|
||||||
|
Q 22 7662 846 0.001202494 19358106
|
||||||
|
Q 21 5924 617 0.001233989 19364030
|
||||||
|
Q 20 4623 574 0.001263330 19368653
|
||||||
|
Q 19 4988 942 0.001311627 19373641
|
||||||
|
Q 18 3968 793 0.001352282 19377609
|
||||||
|
Q 17 3630 681 0.001387166 19381239
|
||||||
|
Q 16 2921 513 0.001413422 19384160
|
||||||
|
Q 15 2716 424 0.001435095 19386876
|
||||||
|
Q 14 2366 365 0.001453744 19389242
|
||||||
|
Q 13 2169 412 0.001474828 19391411
|
||||||
|
Q 12 2077 360 0.001493233 19393488
|
||||||
|
Q 11 2016 441 0.001515815 19395504
|
||||||
|
Q 10 2292 738 0.001553682 19397796
|
||||||
|
Q 9 4165 1832 0.001647772 19401961
|
||||||
|
Q 8 3963 1862 0.001743385 19405924
|
||||||
|
Q 7 3927 1793 0.001835408 19409851
|
||||||
|
Q 6 3572 1639 0.001919497 19413423
|
||||||
|
Q 5 3270 1533 0.001998126 19416693
|
||||||
|
Q 4 3046 1610 0.002080718 19419739
|
||||||
|
Q 3 251447 125550 0.008436553 19671186
|
||||||
|
Q 2 24390 13537 0.009113417 19695576
|
||||||
|
Q 1 124406 86780 0.013434624 19819982
|
||||||
|
Q 0 171254 153874 0.021016609 19991236
|
||||||
|
U 8764
|
||||||
Reference in New Issue
Block a user