Release minimap2-2.2 (r409)

can't get cython working...

.gitignore

@@ -1,4 +1,8 @@
+.cproject
+.project
 .*.swp
 *.a
 *.o
 *.dSYM
+minimap2
+mappy.c

.travis.yml

@@ -0,0 +1,24 @@
+matrix:
+  include:
+    - language: c
+      compiler: gcc
+      script: make
+    - language: c
+      compiler: clang
+      script: make
+    - language: python
+      python: "2.7"
+      before_install: pip install cython
+      script: python setup.py build_ext
+    - language: python
+      python: "3.3"
+      before_install: pip install cython
+      script: python setup.py build_ext
+    - language: python
+      python: "3.5"
+      before_install: pip install cython
+      script: python setup.py build_ext
+    - language: python
+      python: "3.6"
+      before_install: pip install cython
+      script: python setup.py build_ext

MANIFEST.in

@@ -0,0 +1,11 @@
+include *.h
+include Makefile
+include ksw2_dispatch.c
+include getopt.c
+include main.c
+include README.md
+include python/mappy.c
+include python/cmappy.h
+include python/cmappy.pxd
+include python/mappy.pyx
+include python/README.rst

Makefile

@@ -1,15 +1,15 @@
-CC=			gcc
 CFLAGS=		-g -Wall -O2 -Wc++-compat
 CPPFLAGS=	-DHAVE_KALLOC
-INCLUDES=	-I.
+INCLUDES=
-OBJS=		kthread.o kalloc.o ksw2_extz2_sse.o ksw2_extd2_sse.o ksw2_ll_sse.o misc.o bseq.o \
+OBJS=		kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o index.o chain.o align.o hit.o map.o format.o ksw2_ll_sse.o
-			sketch.o sdust.o index.o chain.o align.o hit.o map.o format.o
 PROG=		minimap2
 PROG_EXTRA=	sdust minimap2-lite
 LIBS=		-lm -lz -lpthread
 
 ifeq ($(sse2only),)
-	CFLAGS+=-msse4
+	OBJS+=ksw2_extz2_sse41.o ksw2_extd2_sse41.o ksw2_exts2_sse41.o ksw2_extz2_sse2.o ksw2_extd2_sse2.o ksw2_exts2_sse2.o ksw2_dispatch.o
+else
+	OBJS+=ksw2_extz2_sse.o ksw2_extd2_sse.o ksw2_exts2_sse.o
 endif
 
 .SUFFIXES:.c .o
@@ -21,8 +21,8 @@ all:$(PROG)
 
 extra:all $(PROG_EXTRA)
 
-minimap2:main.o libminimap2.a
+minimap2:main.o getopt.o libminimap2.a
-		$(CC) $(CFLAGS) $< -o $@ -L. -lminimap2 $(LIBS)
+		$(CC) $(CFLAGS) main.o getopt.o -o $@ -L. -lminimap2 $(LIBS)
 
 minimap2-lite:example.o libminimap2.a
 		$(CC) $(CFLAGS) $< -o $@ -L. -lminimap2 $(LIBS)
@@ -30,11 +30,32 @@ minimap2-lite:example.o libminimap2.a
 libminimap2.a:$(OBJS)
 		$(AR) -csru $@ $(OBJS)
 
-sdust:sdust.c kalloc.o kalloc.h kdq.h kvec.h kseq.h sdust.h
+sdust:sdust.c getopt.o kalloc.o kalloc.h kdq.h kvec.h kseq.h sdust.h
-		$(CC) -D_SDUST_MAIN $(CFLAGS) $< kalloc.o -o $@ -lz
+		$(CC) -D_SDUST_MAIN $(CFLAGS) $< getopt.o kalloc.o -o $@ -lz
+
+ksw2_extz2_sse41.o:ksw2_extz2_sse.c ksw2.h kalloc.h
+		$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
+
+ksw2_extz2_sse2.o:ksw2_extz2_sse.c ksw2.h kalloc.h
+		$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
+
+ksw2_extd2_sse41.o:ksw2_extd2_sse.c ksw2.h kalloc.h
+		$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
+
+ksw2_extd2_sse2.o:ksw2_extd2_sse.c ksw2.h kalloc.h
+		$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
+
+ksw2_exts2_sse41.o:ksw2_exts2_sse.c ksw2.h kalloc.h
+		$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
+
+ksw2_exts2_sse2.o:ksw2_exts2_sse.c ksw2.h kalloc.h
+		$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
+
+ksw2_dispatch.o:ksw2_dispatch.c ksw2.h
+		$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
 
 clean:
-		rm -fr gmon.out *.o a.out $(PROG) $(PROG_EXTRA) *~ *.a *.dSYM session*
+		rm -fr gmon.out *.o a.out $(PROG) $(PROG_EXTRA) *~ *.a *.dSYM build dist mappy.so mappy.c python/mappy.c mappy.egg*
 
 depend:
 		(LC_ALL=C; export LC_ALL; makedepend -Y -- $(CFLAGS) $(CPPFLAGS) -- *.c)
@@ -45,14 +66,16 @@ align.o: minimap.h mmpriv.h bseq.h ksw2.h kalloc.h
 bseq.o: bseq.h kseq.h
 chain.o: minimap.h mmpriv.h bseq.h kalloc.h
 example.o: minimap.h kseq.h
-format.o: mmpriv.h minimap.h bseq.h
+format.o: kalloc.h mmpriv.h minimap.h bseq.h
+getopt.o: getopt.h
 hit.o: mmpriv.h minimap.h bseq.h kalloc.h
 index.o: kthread.h bseq.h minimap.h mmpriv.h kvec.h kalloc.h khash.h
 kalloc.o: kalloc.h
 ksw2_extd2_sse.o: ksw2.h kalloc.h
+ksw2_exts2_sse.o: ksw2.h kalloc.h
 ksw2_extz2_sse.o: ksw2.h kalloc.h
 ksw2_ll_sse.o: ksw2.h kalloc.h
-main.o: bseq.h minimap.h mmpriv.h
+main.o: bseq.h minimap.h mmpriv.h getopt.h
 map.o: kthread.h kvec.h kalloc.h sdust.h mmpriv.h minimap.h bseq.h
 misc.o: minimap.h ksort.h
 sdust.o: kalloc.h kdq.h kvec.h sdust.h

NEWS.md

@@ -1,3 +1,93 @@
+Release 2.2-r409 (17 September 2017)
+------------------------------------
+
+This is a feature release. It improves single-end short-read alignment and
+comes with Python bindings. Detailed changes include:
+
+ * Added the **sr** preset for single-end short-read alignment. In this mode,
+   minimap2 runs faster than BWA-MEM, but is slightly less accurate on
+   simulated data sets. Paired-end alignment is not supported as of now.
+
+ * Improved mapping quality estimate with more accurate identification of
+   repetitive hits. This mainly helps short-read alignment.
+
+ * Implemented **mappy**, a Python binding for minimap2, which is available
+   from PyPI and can be installed with `pip install --user mappy`. Python users
+   can perform read alignment without the minimap2 executable.
+
+ * Restructured the indexing APIs and documented key minimap2 APIs in the
+   header file minimap.h. Updated example.c with the new APIs. Old APIs still
+   work but may become deprecated in future.
+
+This release may output alignments different from the previous version, though
+the overall alignment statistics, such as the number of aligned bases and long
+gaps, remain close.
+
+(2.2: 17 September 2017, r409)
+
+
+
+Release 2.1.1-r341 (6 September 2017)
+-------------------------------------
+
+This is a maintenance release that is expected to output identical alignment to
+v2.1. Detailed changes include:
+
+ * Support CPU dispatch. By default, minimap2 is compiled with both SSE2 and
+   SSE4 based implementation of alignment and automatically chooses the right
+   one at runtime. This avoids unexpected errors on older CPUs (#21).
+
+ * Improved Windows support as is requested by Oxford Nanopore (#19). Minimap2
+   now avoids variable-length stacked arrays, eliminates alloca(), ships with
+   getopt_long() and provides timing functions implemented with Windows APIs.
+
+ * Fixed a potential segmentation fault when specifying -k/-w/-H with
+   multi-part index (#23).
+
+ * Fixed two memory leaks in example.c
+
+(2.1.1: 6 September 2017, r341)
+
+
+
+Release 2.1-r311 (25 August 2017)
+---------------------------------
+
+This release adds spliced alignment for long noisy RNA-seq reads. On a SMRT
+Iso-Seq and a Oxford Nanopore data sets, minimap2 appears to outperform
+traditional mRNA aligners. For DNA alignment, this release gives almost
+identical output to v2.0. Other changes include:
+
+ * Added option `-R` to set the read group header line in SAM.
+
+ * Optionally output the `cs:Z` tag in PAF to encode both the query and the
+   reference sequences in the alignment.
+
+ * Fixed an issue where DP alignment uses excessive memory.
+
+The minimap2 technical report has been updated with more details and the
+evaluation of spliced alignment:
+
+ * Li, H. (2017). Minimap2: fast pairwise alignment for long nucleotide
+   sequences. [arXiv:1708.01492v2](https://arxiv.org/abs/1708.01492v2).
+
+(2.1: 25 August 2017, r311)
+
+
+
+Release 2.0-r275 (8 August 2017)
+--------------------------------
+
+This release is identical to version 2.0rc1, except the version number. It is
+described and evaluated in the following technical report:
+
+ * Li, H. (2017). Minimap2: fast pairwise alignment for long DNA sequences.
+   [arXiv:1708.01492v1](https://arxiv.org/abs/1708.01492v1).
+
+(2.0: 8 August 2017, r275)
+
+
+
 Release 2.0rc1-r232 (30 July 2017)
 ----------------------------------
 

README.md

@@ -1,3 +1,9 @@
+[![Release](https://img.shields.io/badge/Release-v2.1.1-blue.svg?style=flat)](https://github.com/lh3/minimap2/releases)
+[![BioConda](https://img.shields.io/conda/vn/bioconda/minimap2.svg?style=flat)](https://anaconda.org/bioconda/minimap2)
+[![PyPI](https://img.shields.io/pypi/v/mappy.svg?style=flat)](https://pypi.python.org/pypi/mappy)
+[![Python Version](https://img.shields.io/pypi/pyversions/mappy.svg?style=flat)](https://pypi.python.org/pypi/mappy)
+[![License](https://img.shields.io/badge/License-MIT-blue.svg?style=flat)](LICENSE.txt)
+[![Build Status](https://travis-ci.org/lh3/minimap2.svg?branch=master)](https://travis-ci.org/lh3/minimap2)
 ## Getting Started
 ```sh
 git clone https://github.com/lh3/minimap2
@@ -9,6 +15,8 @@ cd minimap2 && make
 ./minimap2 -ax map10k MT-human.mmi test/MT-orang.fa > test.sam
 # long-read overlap (no test data)
 ./minimap2 -x ava-pb your-reads.fa your-reads.fa > overlaps.paf
+# spliced alignment (no test data)
+./minimap2 -ax splice ref.fa rna-seq-reads.fa > spliced.sam
 # man page
 man ./minimap2.1
 ```
@@ -31,6 +39,10 @@ and [longISLND][longislnd]), better chaining and the ability to produce CIGAR
 with fast extension alignment (see also [libgaba][gaba] and [ksw2][ksw2]) and
 piece-wise affine gap cost.
 
+If you use minimap2 in your work, please consider to cite:
+
+> Li, H. (2017). Minimap2: fast pairwise alignment for long DNA sequences. [arXiv:1708.01492](https://arxiv.org/abs/1708.01492).
+
 ## Installation
 
 For modern x86-64 CPUs, just type `make` in the source code directory. This

align.c

@@ -53,7 +53,7 @@ static int mm_check_zdrop(const uint8_t *qseq, const uint8_t *tseq, uint32_t n_c
 		} else if (op == 1) {
 			score -= q + e * len, j += len;
 			if (test_zdrop_aux(score, i, j, &max, &max_i, &max_j, e, zdrop)) return 1;
-		} else if (op == 2) {
+		} else if (op == 2 || op == 3) {
 			score -= q + e * len, i += len;
 			if (test_zdrop_aux(score, i, j, &max, &max_i, &max_j, e, zdrop)) return 1;
 		}
@@ -64,11 +64,11 @@ static int mm_check_zdrop(const uint8_t *qseq, const uint8_t *tseq, uint32_t n_c
 static void mm_update_extra(mm_extra_t *p, const uint8_t *qseq, const uint8_t *tseq, const int8_t *mat, int8_t q, int8_t e)
 {
 	uint32_t k, l, toff = 0, qoff = 0;
-	int32_t s = 0, max = 0;
+	int32_t s = 0, max = 0, n_gtag = 0, n_ctac = 0;
 	if (p == 0) return;
 	for (k = 0; k < p->n_cigar; ++k) {
 		uint32_t op = p->cigar[k]&0xf, len = p->cigar[k]>>4;
-		if (op == 0) {
+		if (op == 0) { // match/mismatch
 			for (l = 0; l < len; ++l) {
 				int cq = qseq[qoff + l], ct = tseq[toff + l];
 				if (ct > 3 || cq > 3) ++p->n_ambi;
@@ -78,7 +78,7 @@ static void mm_update_extra(mm_extra_t *p, const uint8_t *qseq, const uint8_t *t
 				else max = max > s? max : s;
 			}
 			toff += len, qoff += len, p->blen += len;
-		} else if (op == 1) {
+		} else if (op == 1) { // insertion
 			int n_ambi = 0;
 			for (l = 0; l < len; ++l)
 				if (qseq[qoff + l] > 3) ++n_ambi;
@@ -86,7 +86,7 @@ static void mm_update_extra(mm_extra_t *p, const uint8_t *qseq, const uint8_t *t
 			p->n_ambi += n_ambi, p->n_diff += len - n_ambi;
 			s -= q + e * len;
 			if (s < 0) s = 0;
-		} else if (op == 2) {
+		} else if (op == 2) { // deletion
 			int n_ambi = 0;
 			for (l = 0; l < len; ++l)
 				if (tseq[toff + l] > 3) ++n_ambi;
@@ -94,9 +94,18 @@ static void mm_update_extra(mm_extra_t *p, const uint8_t *qseq, const uint8_t *t
 			p->n_ambi += n_ambi, p->n_diff += len - n_ambi;
 			s -= q + e * len;
 			if (s < 0) s = 0;
+		} else if (op == 3) { // intron
+			uint8_t b[4];
+			b[0] = tseq[toff], b[1] = tseq[toff+1];
+			b[2] = tseq[toff+len-2], b[3] = tseq[toff+len-1];
+			if (memcmp(b, "\2\3\0\2", 4) == 0) ++n_gtag;
+			else if (memcmp(b, "\1\3\0\1", 4) == 0) ++n_ctac;
+			toff += len, p->blen += len;
 		}
 	}
 	p->dp_max = max;
+	if (n_gtag > n_ctac) p->trans_strand = 1;
+	else if (n_gtag < n_ctac) p->trans_strand = 2;
 }
 
 static void mm_append_cigar(mm_reg1_t *r, uint32_t n_cigar, uint32_t *cigar) // TODO: this calls the libc realloc()
@@ -129,10 +138,18 @@ static void mm_align_pair(void *km, const mm_mapopt_t *opt, int qlen, const uint
 	if (mm_dbg_flag & MM_DBG_PRINT_ALN_SEQ) {
 		int i;
 		fprintf(stderr, "===> q=(%d,%d), e=(%d,%d), bw=%d, flag=%d, zdrop=%d <===\n", opt->q, opt->q2, opt->e, opt->e2, w, flag, opt->zdrop);
-		for (i = 0; i < tlen; ++i) fputc("ACGTN"[tseq[i]], stderr); fputc('\n', stderr);
+		for (i = 0; i < tlen; ++i) fputc("ACGTN"[tseq[i]], stderr);
-		for (i = 0; i < qlen; ++i) fputc("ACGTN"[qseq[i]], stderr); fputc('\n', stderr);
+		fputc('\n', stderr);
+		for (i = 0; i < qlen; ++i) fputc("ACGTN"[qseq[i]], stderr);
+		fputc('\n', stderr);
 	}
-	if (opt->q == opt->q2 && opt->e == opt->e2)
+	if (opt->flag & MM_F_APPROX_EXT) {
+		flag |= KSW_EZ_APPROX_MAX;
+		if (flag & KSW_EZ_EXTZ_ONLY) flag |= KSW_EZ_APPROX_DROP;
+	}
+	if (opt->flag & MM_F_SPLICE)
+		ksw_exts2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->noncan, opt->zdrop, flag, ez);
+	else if (opt->q == opt->q2 && opt->e == opt->e2)
 		ksw_extz2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, w, opt->zdrop, flag, ez);
 	else
 		ksw_extd2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->e2, w, opt->zdrop, flag, ez);
@@ -159,8 +176,8 @@ static inline void mm_adjust_minier(const mm_idx_t *mi, uint8_t *const qseq0[2],
 		c = mm_get_hplen_back(mi, a->x<<1>>33, (int32_t)a->x);
 		*r = (int32_t)a->x + 1 - c;
 	} else {
-		*r = (int32_t)a->x + 1;
+		*r = (int32_t)a->x - (mi->k>>1);
-		*q = (int32_t)a->y + 1;
+		*q = (int32_t)a->y - (mi->k>>1);
 	}
 }
 
@@ -240,11 +257,11 @@ static void mm_fix_bad_ends(const mm_reg1_t *r, const mm128_t *a, int bw, int32_
 	}
 }
 
-static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, uint8_t *qseq0[2], mm_reg1_t *r, mm_reg1_t *r2, mm128_t *a, ksw_extz_t *ez)
+static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, uint8_t *qseq0[2], mm_reg1_t *r, mm_reg1_t *r2, mm128_t *a, ksw_extz_t *ez, int splice_flag)
 {
 	int32_t rid = a[r->as].x<<1>>33, rev = a[r->as].x>>63, as1, cnt1;
 	uint8_t *tseq, *qseq;
-	int32_t i, l, bw, dropped = 0, rs0, re0, qs0, qe0;
+	int32_t i, l, bw, dropped = 0, extra_flag = 0, rs0, re0, qs0, qe0;
 	int32_t rs, re, qs, qe;
 	int32_t rs1, qs1, re1, qe1;
 	int8_t mat[25];
@@ -254,11 +271,19 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
 	bw = (int)(opt->bw * 1.5 + 1.);
 
 	r2->cnt = 0;
-	mm_fix_bad_ends(r, a, opt->bw, &as1, &cnt1);
+	if (!(opt->flag & MM_F_SPLICE))
+		mm_fix_bad_ends(r, a, opt->bw, &as1, &cnt1);
+	else as1 = r->as, cnt1 = r->cnt;
 	mm_filter_bad_seeds(km, as1, cnt1, a, 10, 40, opt->max_gap>>1, 10);
 	mm_adjust_minier(mi, qseq0, &a[as1], &rs, &qs);
 	mm_adjust_minier(mi, qseq0, &a[as1 + cnt1 - 1], &re, &qe);
 
+	if (opt->flag & MM_F_SPLICE) {
+		if (splice_flag & MM_F_SPLICE_FOR) extra_flag |= rev? KSW_EZ_SPLICE_REV : KSW_EZ_SPLICE_FOR;
+		if (splice_flag & MM_F_SPLICE_REV) extra_flag |= rev? KSW_EZ_SPLICE_FOR : KSW_EZ_SPLICE_REV;
+		if (splice_flag & MM_F_SPLICE_BOTH) extra_flag |= KSW_EZ_SPLICE_FOR|KSW_EZ_SPLICE_REV;
+	}
+
 	// compute rs0 and qs0
 	if (r->split && as1 > 0) {
 		mm_adjust_minier(mi, qseq0, &a[as1-1], &rs0, &qs0);
@@ -291,7 +316,7 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
 		mm_idx_getseq(mi, rid, rs0, rs, tseq);
 		mm_seq_rev(qs - qs0, qseq);
 		mm_seq_rev(rs - rs0, tseq);
-		mm_align_pair(km, opt, qs - qs0, qseq, rs - rs0, tseq, mat, bw, KSW_EZ_EXTZ_ONLY|KSW_EZ_RIGHT|KSW_EZ_REV_CIGAR, ez);
+		mm_align_pair(km, opt, qs - qs0, qseq, rs - rs0, tseq, mat, bw, extra_flag|KSW_EZ_EXTZ_ONLY|KSW_EZ_RIGHT|KSW_EZ_REV_CIGAR, ez);
 		if (ez->n_cigar > 0) {
 			mm_append_cigar(r, ez->n_cigar, ez->cigar);
 			r->p->dp_score += ez->max;
@@ -313,9 +338,9 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
 				bw1 = qe - qs > re - rs? qe - qs : re - rs;
 			qseq = &qseq0[rev][qs];
 			mm_idx_getseq(mi, rid, rs, re, tseq);
-			mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, mat, bw1, KSW_EZ_APPROX_MAX, ez);
+			mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, mat, bw1, extra_flag|KSW_EZ_APPROX_MAX, ez);
 			if (mm_check_zdrop(qseq, tseq, ez->n_cigar, ez->cigar, mat, opt->q, opt->e, opt->zdrop))
-				mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, mat, bw1, 0, ez);
+				mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, mat, bw1, extra_flag, ez);
 			if (ez->n_cigar > 0)
 				mm_append_cigar(r, ez->n_cigar, ez->cigar);
 			if (ez->zdropped) { // truncated by Z-drop; TODO: sometimes Z-drop kicks in because the next seed placement is wrong. This can be fixed in principle.
@@ -338,7 +363,7 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
 	if (!dropped && qe < qe0 && re < re0) { // right extension
 		qseq = &qseq0[rev][qe];
 		mm_idx_getseq(mi, rid, re, re0, tseq);
-		mm_align_pair(km, opt, qe0 - qe, qseq, re0 - re, tseq, mat, bw, KSW_EZ_EXTZ_ONLY, ez);
+		mm_align_pair(km, opt, qe0 - qe, qseq, re0 - re, tseq, mat, bw, extra_flag|KSW_EZ_EXTZ_ONLY, ez);
 		if (ez->n_cigar > 0) {
 			mm_append_cigar(r, ez->n_cigar, ez->cigar);
 			r->p->dp_score += ez->max;
@@ -356,6 +381,8 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
 	if (r->p) {
 		mm_idx_getseq(mi, rid, rs1, re1, tseq);
 		mm_update_extra(r->p, &qseq0[r->rev][qs1], tseq, mat, opt->q, opt->e);
+		if (rev && r->p->trans_strand)
+			r->p->trans_strand ^= 3; // flip to the read strand
 	}
 
 	kfree(km, tseq);
@@ -438,7 +465,28 @@ mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *m
 	memset(&ez, 0, sizeof(ksw_extz_t));
 	for (i = 0; i < n_regs; ++i) {
 		mm_reg1_t r2;
-		mm_align1(km, opt, mi, qlen, qseq0, &regs[i], &r2, a, &ez);
+		if ((opt->flag&MM_F_SPLICE) && (opt->flag&MM_F_SPLICE_FOR) && (opt->flag&MM_F_SPLICE_REV)) {
+			mm_reg1_t s[2], s2[2];
+			int which, trans_strand;
+			s[0] = s[1] = regs[i];
+			mm_align1(km, opt, mi, qlen, qseq0, &s[0], &s2[0], a, &ez, MM_F_SPLICE_FOR);
+			mm_align1(km, opt, mi, qlen, qseq0, &s[1], &s2[1], a, &ez, MM_F_SPLICE_REV);
+			if (s[0].p->dp_score > s[1].p->dp_score) which = 0, trans_strand = 1;
+			else if (s[0].p->dp_score < s[1].p->dp_score) which = 1, trans_strand = 2;
+			else trans_strand = 3, which = (qlen + s[0].p->dp_score) & 1; // randomly choose a strand, effectively
+			if (which == 0) {
+				regs[i] = s[0], r2 = s2[0];
+				free(s[1].p);
+			} else {
+				regs[i] = s[1], r2 = s2[1];
+				free(s[0].p);
+			}
+			regs[i].p->trans_strand = trans_strand;
+		} else {
+			mm_align1(km, opt, mi, qlen, qseq0, &regs[i], &r2, a, &ez, opt->flag);
+			if ((opt->flag&MM_F_SPLICE) && !(opt->flag&MM_F_SPLICE_BOTH))
+				regs[i].p->trans_strand = opt->flag&MM_F_SPLICE_FOR? 1 : 2;
+		}
 		if (r2.cnt > 0) regs = mm_insert_reg(&r2, i, &n_regs, regs);
 		if (i > 0 && mm_align1_inv(km, opt, mi, qlen, qseq0, &regs[i-1], &regs[i], &r2, &ez)) {
 			regs = mm_insert_reg(&r2, i, &n_regs, regs);

bseq.c

@@ -5,10 +5,9 @@
 #include <assert.h>
 #include "bseq.h"
 #include "kseq.h"
-KSEQ_INIT(gzFile, gzread)
+KSEQ_INIT2(, gzFile, gzread)
 
 struct mm_bseq_file_s {
-	int is_eof;
 	gzFile fp;
 	kseq_t *ks;
 };
@@ -53,12 +52,11 @@ mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int chunk_size, int with_qual, int
 		size += seqs[n++].l_seq;
 		if (size >= chunk_size) break;
 	}
-	if (size < chunk_size) fp->is_eof = 1;
 	*n_ = n;
 	return seqs;
 }
 
 int mm_bseq_eof(mm_bseq_file_t *fp)
 {
-	return fp->is_eof;
+	return ks_eof(fp->ks->f);
 }

chain.c

@@ -19,7 +19,7 @@ static inline int ilog2_32(uint32_t v)
 	return (t = v>>8) ? 8 + LogTable256[t] : LogTable256[v];
 }
 
-int mm_chain_dp(int max_dist, int bw, int max_skip, int min_cnt, int min_sc, int64_t n, mm128_t *a, uint64_t **_u, void *km)
+int mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int min_cnt, int min_sc, int is_cdna, int64_t n, mm128_t *a, uint64_t **_u, void *km)
 { // TODO: make sure this works when n has more than 32 bits
 	int32_t st = 0, k, *f, *p, *t, *v, n_u, n_v;
 	int64_t i, j;
@@ -42,17 +42,24 @@ int mm_chain_dp(int max_dist, int bw, int max_skip, int min_cnt, int min_sc, int
 		uint64_t ri = a[i].x;
 		int32_t qi = (int32_t)a[i].y, q_span = a[i].y>>32&0xff; // NB: only 8 bits of span is used!!!
 		int32_t max_f = q_span, max_j = -1, n_skip = 0, min_d, max_f_past = -INT32_MAX;
-		while (st < i && ri - a[st].x > max_dist) ++st;
+		while (st < i && ri - a[st].x > max_dist_x) ++st;
 		for (j = i - 1; j >= st; --j) {
 			int64_t dr = ri - a[j].x;
-			int32_t dq = qi - (int32_t)a[j].y, dd, sc;
+			int32_t dq = qi - (int32_t)a[j].y, dd, sc, log_dd;
-			if (dr == 0 || dq <= 0 || dq > max_dist) continue;
+			if (dr == 0 || dq <= 0 || dq > max_dist_y) continue;
 			dd = dr > dq? dr - dq : dq - dr;
 			if (dd > bw) continue;
 			max_f_past = max_f_past > f[j]? max_f_past : f[j];
 			min_d = dq < dr? dq : dr;
 			sc = min_d > q_span? q_span : dq < dr? dq : dr;
-			sc -= (int)(dd * .01 * avg_qspan) + (ilog2_32(dd)>>1);
+			log_dd = dd? ilog2_32(dd) : 0;
+			if (is_cdna) {
+				int c_log, c_lin;
+				c_lin = (int)(dd * .01 * avg_qspan);
+				c_log = log_dd;
+				if (dr > dq) sc -= c_lin < c_log? c_lin : c_log;
+				else sc -= c_lin + (c_log>>1);
+			} else sc -= (int)(dd * .01 * avg_qspan) + (log_dd>>1);
 			sc += f[j];
 			if (sc > max_f) {
 				max_f = sc, max_j = j;

example.c

@@ -11,51 +11,52 @@ KSEQ_INIT(gzFile, gzread)
 
 int main(int argc, char *argv[])
 {
+	mm_idxopt_t iopt;
+	mm_mapopt_t mopt;
+	int n_threads = 3;
+
 	mm_verbose = 2; // disable message output to stderr
+	mm_set_opt(0, &iopt, &mopt);
+	mopt.flag |= MM_F_CIGAR; // perform alignment
 
 	if (argc < 3) {
 		fprintf(stderr, "Usage: minimap2-lite <target.fa> <query.fa>\n");
 		return 1;
 	}
-	
+
 	// open query file for reading; you may use your favorite FASTA/Q parser
 	gzFile f = gzopen(argv[2], "r");
 	assert(f);
 	kseq_t *ks = kseq_init(f);
 
-	// create index for target; we are creating one index for all target sequence
+	// open index reader
-	int n_threads = 4, w = 10, k = 15, is_hpc = 0;
+	mm_idx_reader_t *r = mm_idx_reader_open(argv[1], &iopt, 0);
-	mm_idx_t *mi = mm_idx_build(argv[1], w, k, is_hpc, n_threads);
+	mm_idx_t *mi;
-	assert(mi);
+	while ((mi = mm_idx_reader_read(r, n_threads)) != 0) { // traverse each part of the index
-
+		mm_mapopt_update(&mopt, mi); // this sets the maximum minimizer occurrence; TODO: set a better default in mm_mapopt_init()!
-	// mapping
+		mm_tbuf_t *tbuf = mm_tbuf_init(); // thread buffer; for multi-threading, allocate one tbuf for each thread
-	mm_mapopt_t opt;
+		while (kseq_read(ks) >= 0) { // each kseq_read() call reads one query sequence
-	mm_mapopt_init(&opt); // initialize mapping parameters
+			mm_reg1_t *reg;
-	mm_mapopt_update(&opt, mi); // this sets the maximum minimizer occurrence; TODO: set a better default in mm_mapopt_init()!
+			int j, i, n_reg;
-	opt.flag |= MM_F_CIGAR; // perform alignment
+			reg = mm_map(mi, ks->seq.l, ks->seq.s, &n_reg, tbuf, &mopt, 0); // get all hits for the query
-	mm_tbuf_t *tbuf = mm_tbuf_init(); // thread buffer; for multi-threading, allocate one tbuf for each thread
+			for (j = 0; j < n_reg; ++j) { // traverse hits and print them out
-	while (kseq_read(ks) >= 0) { // each kseq_read() call reads one query sequence
+				mm_reg1_t *r = &reg[j];
-		const mm_reg1_t *reg;
+				assert(r->p); // with MM_F_CIGAR, this should not be NULL
-		int j, i, n_reg;
+				printf("%s\t%d\t%d\t%d\t%c\t", ks->name.s, ks->seq.l, r->qs, r->qe, "+-"[r->rev]);
-		// get all hits for the query
+				printf("%s\t%d\t%d\t%d\t%d\t%d\t%d\tcg:Z:", mi->seq[r->rid].name, mi->seq[r->rid].len, r->rs, r->re,
-		reg = mm_map(mi, ks->seq.l, ks->seq.s, &n_reg, tbuf, &opt, 0);
+						r->p->blen - r->p->n_ambi - r->p->n_diff, r->p->blen, r->mapq);
-		// traverse hits and print them out
+				for (i = 0; i < r->p->n_cigar; ++i) // IMPORTANT: this gives the CIGAR in the aligned regions. NO soft/hard clippings!
-		for (j = 0; j < n_reg; ++j) {
+					printf("%d%c", r->p->cigar[i]>>4, "MIDSHN"[r->p->cigar[i]&0xf]);
-			const mm_reg1_t *r = &reg[j];
+				putchar('\n');
-			assert(r->p); // with MM_F_CIGAR, this should not be NULL
+				free(r->p);
-			printf("%s\t%d\t%d\t%d\t%c\t", ks->name.s, ks->seq.l, r->qs, r->qe, "+-"[r->rev]);
+			}
-			printf("%s\t%d\t%d\t%d\t%d\t%d\t%d\tcg:Z:", mi->seq[r->rid].name, mi->seq[r->rid].len, r->rs, r->re,
+			free(reg);
-				   r->p->blen - r->p->n_ambi - r->p->n_diff, r->p->blen, r->mapq);
-			for (i = 0; i < r->p->n_cigar; ++i) // IMPORTANT: this gives the CIGAR in the aligned regions. NO soft/hard clippings!
-				printf("%d%c", r->p->cigar[i]>>4, "MIDSHN"[r->p->cigar[i]&0xf]);
-			putchar('\n');
 		}
+		mm_tbuf_destroy(tbuf);
+		mm_idx_destroy(mi);
 	}
-	mm_tbuf_destroy(tbuf);
+	mm_idx_reader_close(r); // close the index reader
-
+	kseq_destroy(ks); // close the query file
-	// deallocate index and close the query file
-	mm_idx_destroy(mi);
-	kseq_destroy(ks);
 	gzclose(f);
 	return 0;
 }

format.c

@@ -1,9 +1,13 @@
 #include <stdarg.h>
 #include <stdlib.h>
 #include <string.h>
+#include <assert.h>
 #include <stdio.h>
+#include "kalloc.h"
 #include "mmpriv.h"
 
+static char mm_rg_id[256];
+
 static inline void str_enlarge(kstring_t *s, int l)
 {
 	if (s->l + l + 1 > s->m) {
@@ -54,16 +58,141 @@ static void mm_sprintf_lite(kstring_t *s, const char *fmt, ...)
 	s->s[s->l] = 0;
 }
 
+static char *mm_escape(char *s)
+{
+	char *p, *q;
+	for (p = q = s; *p; ++p) {
+		if (*p == '\\') {
+			++p;
+			if (*p == 't') *q++ = '\t';
+			else if (*p == '\\') *q++ = '\\';
+		} else *q++ = *p;
+	}
+	*q = '\0';
+	return s;
+}
+
+static void sam_write_rg_line(kstring_t *str, const char *s)
+{
+	char *p, *q, *r, *rg_line = 0;
+	memset(mm_rg_id, 0, 256);
+	if (s == 0) return;
+	if (strstr(s, "@RG") != s) {
+		if (mm_verbose >= 1) fprintf(stderr, "[ERROR] the read group line is not started with @RG\n");
+		goto err_set_rg;
+	}
+	if (strstr(s, "\t") != NULL) {
+		if (mm_verbose >= 1) fprintf(stderr, "[ERROR] the read group line contained literal <tab> characters -- replace with escaped tabs: \\t\n");
+		goto err_set_rg;
+	}
+	rg_line = strdup(s);
+	mm_escape(rg_line);
+	if ((p = strstr(rg_line, "\tID:")) == 0) {
+		if (mm_verbose >= 1) fprintf(stderr, "[ERROR] no ID within the read group line\n");
+		goto err_set_rg;
+	}
+	p += 4;
+	for (q = p; *q && *q != '\t' && *q != '\n'; ++q);
+	if (q - p + 1 > 256) {
+		if (mm_verbose >= 1) fprintf(stderr, "[ERROR] @RG:ID is longer than 255 characters\n");
+		goto err_set_rg;
+	}
+	for (q = p, r = mm_rg_id; *q && *q != '\t' && *q != '\n'; ++q)
+		*r++ = *q;
+	mm_sprintf_lite(str, "%s\n", rg_line);
+
+err_set_rg:
+	free(rg_line);
+}
+
+void mm_write_sam_hdr_no_SQ(const char *rg, const char *ver, int argc, char *argv[])
+{
+	kstring_t str = {0,0,0};
+	sam_write_rg_line(&str, rg);
+	mm_sprintf_lite(&str, "@PG\tID:minimap2\tPN:minimap2");
+	if (ver) mm_sprintf_lite(&str, "\tVN:%s", ver);
+	if (argc > 1) {
+		int i;
+		mm_sprintf_lite(&str, "\tCL:minimap2");
+		for (i = 1; i < argc; ++i)
+			mm_sprintf_lite(&str, " %s", argv[i]);
+	}
+	mm_sprintf_lite(&str, "\n");
+	fputs(str.s, stdout);
+	free(str.s);
+}
+
+static void write_cs(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r)
+{
+	extern unsigned char seq_nt4_table[256];
+	int i, q_off, t_off;
+	uint8_t *qseq, *tseq;
+	char *tmp;
+	if (r->p == 0) return;
+	mm_sprintf_lite(s, "\tcs:Z:");
+	qseq = (uint8_t*)kmalloc(km, r->qe - r->qs);
+	tseq = (uint8_t*)kmalloc(km, r->re - r->rs);
+	tmp = (char*)kmalloc(km, r->re - r->rs > r->qe - r->qs? r->re - r->rs + 1 : r->qe - r->qs + 1);
+	mm_idx_getseq(mi, r->rid, r->rs, r->re, tseq);
+	if (!r->rev) {
+		for (i = r->qs; i < r->qe; ++i)
+			qseq[i - r->qs] = seq_nt4_table[(uint8_t)t->seq[i]];
+	} else {
+		for (i = r->qs; i < r->qe; ++i) {
+			uint8_t c = seq_nt4_table[(uint8_t)t->seq[i]];
+			qseq[r->qe - i - 1] = c >= 4? 4 : 3 - c;
+		}
+	}
+	for (i = q_off = t_off = 0; i < r->p->n_cigar; ++i) {
+		int j, op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
+		assert(op >= 0 && op <= 2);
+		if (op == 0) {
+			int l_tmp = 0;
+			for (j = 0; j < len; ++j) {
+				if (qseq[q_off + j] != tseq[t_off + j]) {
+					if (l_tmp > 0) {
+						tmp[l_tmp] = 0;
+						mm_sprintf_lite(s, "=%s", tmp);
+						l_tmp = 0;
+					}
+					mm_sprintf_lite(s, "*%c%c", "acgtn"[tseq[t_off + j]], "acgtn"[qseq[q_off + j]]);
+				} else tmp[l_tmp++] = "ACGTN"[qseq[q_off + j]];
+			}
+			if (l_tmp > 0) {
+				tmp[l_tmp] = 0;
+				mm_sprintf_lite(s, "=%s", tmp);
+			}
+			q_off += len, t_off += len;
+		} else if (op == 1) {
+			for (j = 0, tmp[len] = 0; j < len; ++j)
+				tmp[j] = "acgtn"[qseq[q_off + j]];
+			mm_sprintf_lite(s, "+%s", tmp);
+			q_off += len;
+		} else if (op == 2) {
+			for (j = 0, tmp[len] = 0; j < len; ++j)
+				tmp[j] = "acgtn"[tseq[t_off + j]];
+			mm_sprintf_lite(s, "-%s", tmp);
+			t_off += len;
+		}
+	}
+	assert(t_off == r->re - r->rs && q_off == r->qe - r->qs);
+	kfree(km, qseq); kfree(km, tseq); kfree(km, tmp);
+}
+
 static inline void write_tags(kstring_t *s, const mm_reg1_t *r)
 {
 	int type = r->inv? 'I' : r->id == r->parent? 'P' : 'S';
 	mm_sprintf_lite(s, "\ttp:A:%c\tcm:i:%d\ts1:i:%d", type, r->cnt, r->score);
 	if (r->parent == r->id) mm_sprintf_lite(s, "\ts2:i:%d", r->subsc);
 	if (r->split) mm_sprintf_lite(s, "\tzd:i:%d", r->split);
-	if (r->p) mm_sprintf_lite(s, "\tNM:i:%d\tms:i:%d\tAS:i:%d\tnn:i:%d", r->p->n_diff, r->p->dp_max, r->p->dp_score, r->p->n_ambi);
+	if (r->p) {
+		mm_sprintf_lite(s, "\tNM:i:%d\tms:i:%d\tAS:i:%d\tnn:i:%d", r->p->n_diff, r->p->dp_max, r->p->dp_score, r->p->n_ambi);
+		if (r->p->trans_strand == 1 || r->p->trans_strand == 2)
+			mm_sprintf_lite(s, "\tts:A:%c", "?+-?"[r->p->trans_strand]);
+	}
 }
 
-void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r)
+void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int opt_flag)
 {
 	s->l = 0;
 	mm_sprintf_lite(s, "%s\t%d\t%d\t%d\t%c\t", t->name, t->l_seq, r->qs, r->qe, "+-"[r->rev]);
@@ -74,12 +203,14 @@ void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const m
 	else mm_sprintf_lite(s, "\t%d\t%d", r->fuzzy_mlen, r->fuzzy_blen);
 	mm_sprintf_lite(s, "\t%d", r->mapq);
 	write_tags(s, r);
-	if (r->p) {
+	if (r->p && (opt_flag & MM_F_OUT_CG)) {
 		uint32_t k;
 		mm_sprintf_lite(s, "\tcg:Z:");
 		for (k = 0; k < r->p->n_cigar; ++k)
-			mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MID"[r->p->cigar[k]&0xf]);
+			mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDN"[r->p->cigar[k]&0xf]);
 	}
+	if (r->p && (opt_flag & MM_F_OUT_CS))
+		write_cs(km, s, mi, t, r);
 }
 
 static char comp_tab[] = {
@@ -93,6 +224,13 @@ static char comp_tab[] = {
 	'p', 'q', 'y', 's', 'a', 'a', 'b', 'w', 'x', 'r', 'z', 123, 124, 125, 126, 127
 };
 
+void mm_write_sam_SQ(const mm_idx_t *idx)
+{
+	uint32_t i;
+	for (i = 0; i < idx->n_seq; ++i)
+		printf("@SQ\tSN:%s\tLN:%d\n", idx->seq[i].name, idx->seq[i].len);
+}
+
 static void sam_write_sq(kstring_t *s, char *seq, int l, int rev, int comp)
 {
 	if (rev) {
@@ -126,7 +264,7 @@ void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const m
 			int clip_char = (flag&0x800)? 'H' : 'S';
 			if (clip_len) mm_sprintf_lite(s, "%d%c", clip_len, clip_char);
 			for (k = 0; k < r->p->n_cigar; ++k)
-				mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MID"[r->p->cigar[k]&0xf]);
+				mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDN"[r->p->cigar[k]&0xf]);
 			clip_len = r->rev? r->qs : t->l_seq - r->qe;
 			if (clip_len) mm_sprintf_lite(s, "%d%c", clip_len, clip_char);
 		} else mm_sprintf_lite(s, "*");
@@ -145,6 +283,7 @@ void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const m
 			else mm_sprintf_lite(s, "*");
 		}
 		write_tags(s, r);
+		if (mm_rg_id[0]) mm_sprintf_lite(s, "\tRG:Z:%s", mm_rg_id);
 		if (r->parent == r->id && r->p && n_regs > 1 && regs && r >= regs && r - regs < n_regs) { // supplementary aln may exist
 			int i, n_sa = 0; // n_sa: number of SA fields
 			for (i = 0; i < n_regs; ++i)

getopt.c

@@ -0,0 +1,216 @@
+#include <stddef.h>
+#include <stdio.h>
+#include <string.h>
+#include "getopt.h"
+
+char *optarg;
+int optind=1, opterr=1, optopt, __optpos, optreset=0;
+
+#define optpos __optpos
+
+static void __getopt_msg(const char *a, const char *b, const char *c, size_t l)
+{
+	FILE *f = stderr;
+#if !defined(WIN32) && !defined(_WIN32)
+	flockfile(f);
+#endif
+	fputs(a, f);
+	fwrite(b, strlen(b), 1, f);
+	fwrite(c, 1, l, f);
+	fputc('\n', f);
+#if !defined(WIN32) && !defined(_WIN32)
+	funlockfile(f);
+#endif
+}
+
+int getopt(int argc, char * const argv[], const char *optstring)
+{
+	int i, c, d;
+	int k, l;
+	char *optchar;
+
+	if (!optind || optreset) {
+		optreset = 0;
+		__optpos = 0;
+		optind = 1;
+	}
+
+	if (optind >= argc || !argv[optind])
+		return -1;
+
+	if (argv[optind][0] != '-') {
+		if (optstring[0] == '-') {
+			optarg = argv[optind++];
+			return 1;
+		}
+		return -1;
+	}
+
+	if (!argv[optind][1])
+		return -1;
+
+	if (argv[optind][1] == '-' && !argv[optind][2])
+		return optind++, -1;
+
+	if (!optpos) optpos++;
+	c = argv[optind][optpos], k = 1;
+	optchar = argv[optind]+optpos;
+	optopt = c;
+	optpos += k;
+
+	if (!argv[optind][optpos]) {
+		optind++;
+		optpos = 0;
+	}
+
+	if (optstring[0] == '-' || optstring[0] == '+')
+		optstring++;
+
+	i = 0;
+	d = 0;
+	do {
+		d = optstring[i], l = 1;
+		if (l>0) i+=l; else i++;
+	} while (l && d != c);
+
+	if (d != c) {
+		if (optstring[0] != ':' && opterr)
+			__getopt_msg(argv[0], ": unrecognized option: ", optchar, k);
+		return '?';
+	}
+	if (optstring[i] == ':') {
+		if (optstring[i+1] == ':') optarg = 0;
+		else if (optind >= argc) {
+			if (optstring[0] == ':') return ':';
+			if (opterr) __getopt_msg(argv[0],
+				": option requires an argument: ",
+				optchar, k);
+			return '?';
+		}
+		if (optstring[i+1] != ':' || optpos) {
+			optarg = argv[optind++] + optpos;
+			optpos = 0;
+		}
+	}
+	return c;
+}
+
+static void permute(char *const *argv, int dest, int src)
+{
+	char **av = (char **)argv;
+	char *tmp = av[src];
+	int i;
+	for (i=src; i>dest; i--)
+		av[i] = av[i-1];
+	av[dest] = tmp;
+}
+
+static int __getopt_long_core(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx, int longonly)
+{
+	optarg = 0;
+	if (longopts && argv[optind][0] == '-' &&
+		((longonly && argv[optind][1] && argv[optind][1] != '-') ||
+		 (argv[optind][1] == '-' && argv[optind][2])))
+	{
+		int colon = optstring[optstring[0]=='+'||optstring[0]=='-']==':';
+		int i, cnt, match = -1;
+		char *opt;
+		for (cnt=i=0; longopts[i].name; i++) {
+			const char *name = longopts[i].name;
+			opt = argv[optind]+1;
+			if (*opt == '-') opt++;
+			for (; *name && *name == *opt; name++, opt++);
+			if (*opt && *opt != '=') continue;
+			match = i;
+			if (!*name) {
+				cnt = 1;
+				break;
+			}
+			cnt++;
+		}
+		if (cnt==1) {
+			i = match;
+			optind++;
+			optopt = longopts[i].val;
+			if (*opt == '=') {
+				if (!longopts[i].has_arg) {
+					if (colon || !opterr)
+						return '?';
+					__getopt_msg(argv[0],
+						": option does not take an argument: ",
+						longopts[i].name,
+						strlen(longopts[i].name));
+					return '?';
+				}
+				optarg = opt+1;
+			} else if (longopts[i].has_arg == required_argument) {
+				if (!(optarg = argv[optind])) {
+					if (colon) return ':';
+					if (!opterr) return '?';
+					__getopt_msg(argv[0],
+						": option requires an argument: ",
+						longopts[i].name,
+						strlen(longopts[i].name));
+					return '?';
+				}
+				optind++;
+			}
+			if (idx) *idx = i;
+			if (longopts[i].flag) {
+				*longopts[i].flag = longopts[i].val;
+				return 0;
+			}
+			return longopts[i].val;
+		}
+		if (argv[optind][1] == '-') {
+			if (!colon && opterr)
+				__getopt_msg(argv[0], cnt ?
+					": option is ambiguous: " :
+					": unrecognized option: ",
+					argv[optind]+2,
+					strlen(argv[optind]+2));
+			optind++;
+			return '?';
+		}
+	}
+	return getopt(argc, argv, optstring);
+}
+
+static int __getopt_long(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx, int longonly)
+{
+	int ret, skipped, resumed;
+	if (!optind || optreset) {
+		optreset = 0;
+		__optpos = 0;
+		optind = 1;
+	}
+	if (optind >= argc || !argv[optind]) return -1;
+	skipped = optind;
+	if (optstring[0] != '+' && optstring[0] != '-') {
+		int i;
+		for (i=optind; ; i++) {
+			if (i >= argc || !argv[i]) return -1;
+			if (argv[i][0] == '-' && argv[i][1]) break;
+		}
+		optind = i;
+	}
+	resumed = optind;
+	ret = __getopt_long_core(argc, argv, optstring, longopts, idx, longonly);
+	if (resumed > skipped) {
+		int i, cnt = optind-resumed;
+		for (i=0; i<cnt; i++)
+			permute(argv, skipped, optind-1);
+		optind = skipped + cnt;
+	}
+	return ret;
+}
+
+int getopt_long(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx)
+{
+	return __getopt_long(argc, argv, optstring, longopts, idx, 0);
+}
+
+int getopt_long_only(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx)
+{
+	return __getopt_long(argc, argv, optstring, longopts, idx, 1);
+}

getopt.h

@@ -0,0 +1,53 @@
+/*
+  Copyright 2005-2014 Rich Felker, et al.
+  
+  Permission is hereby granted, free of charge, to any person obtaining
+  a copy of this software and associated documentation files (the
+  "Software"), to deal in the Software without restriction, including
+  without limitation the rights to use, copy, modify, merge, publish,
+  distribute, sublicense, and/or sell copies of the Software, and to
+  permit persons to whom the Software is furnished to do so, subject to
+  the following conditions:
+  
+  The above copyright notice and this permission notice shall be
+  included in all copies or substantial portions of the Software.
+  
+  THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
+  EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
+  MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT.
+  IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY
+  CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT,
+  TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE
+  SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
+*/
+
+#ifndef _GETOPT_H
+#define _GETOPT_H
+
+#ifdef __cplusplus
+extern "C" {
+#endif
+
+int getopt(int, char * const [], const char *);
+extern char *optarg;
+extern int optind, opterr, optopt, optreset;
+
+struct option {
+	const char *name;
+	int has_arg;
+	int *flag;
+	int val;
+};
+
+int getopt_long(int, char *const *, const char *, const struct option *, int *);
+int getopt_long_only(int, char *const *, const char *, const struct option *, int *);
+
+#define no_argument        0
+#define required_argument  1
+#define optional_argument  2
+
+#ifdef __cplusplus
+}
+#endif
+
+#endif

hit.c

@@ -87,7 +87,7 @@ void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a)
 	r->split |= 1, r2->split |= 2;
 }
 
-void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r) // and compute mm_reg1_t::subsc
+void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r, int sub_diff) // and compute mm_reg1_t::subsc
 {
 	int i, j, k, *w;
 	if (n <= 0) return;
@@ -103,14 +103,19 @@ void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r) // and compu
 			int min = ej - sj < ei - si? ej - sj : ei - si;
 			int ol = si < sj? (ei < sj? 0 : ei < ej? ei - sj : ej - sj) : (ej < si? 0 : ej < ei? ej - si : ei - si);
 			if (ol > mask_level * min) {
+				int cnt_sub = 0;
 				ri->parent = rp->parent;
 				rp->subsc = rp->subsc > ri->score? rp->subsc : ri->score;
-				if (rp->p && ri->p)
+				if (ri->cnt >= rp->cnt) cnt_sub = 1;
+				if (rp->p && ri->p) {
 					rp->p->dp_max2 = rp->p->dp_max2 > ri->p->dp_max? rp->p->dp_max2 : ri->p->dp_max;
+					if (rp->p->dp_max - ri->p->dp_max <= sub_diff) cnt_sub = 1;
+				}
+				if (cnt_sub) ++rp->n_sub;
 				break;
 			}
 		}
-		if (j == k) w[k++] = i, ri->parent = i;
+		if (j == k) w[k++] = i, ri->parent = i, ri->n_sub = 0;
 	}
 	kfree(km, w);
 }
@@ -288,9 +293,9 @@ void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs_, mm_r
 	}
 }
 
-void mm_set_mapq(int n_regs, mm_reg1_t *regs, int min_chain_sc)
+void mm_set_mapq(int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len)
 {
-	static const float q_coef = 30.0f;
+	static const float q_coef = 40.0f;
 	int i;
 	for (i = 0; i < n_regs; ++i) {
 		mm_reg1_t *r = &regs[i];
@@ -298,12 +303,21 @@ void mm_set_mapq(int n_regs, mm_reg1_t *regs, int min_chain_sc)
 			r->mapq = 0;
 		} else if (r->parent == r->id) {
 			int mapq, subsc;
-			float pen_cm = r->cnt >= 10? 1.0f : 0.1f * r->cnt;
+			float pen_s1 = r->score > 100? 1.0f : 0.01f * r->score;
+			float pen_cm = r->cnt > 10? 1.0f : 0.1f * r->cnt;
+			if (r->score <= 100 && rep_len > 0) {
+				pen_s1 = 0.01f * (r->score - rep_len);
+				pen_s1 = pen_s1 > 0.1f? pen_s1 : 0.1f;
+			}
+			pen_cm = pen_s1 < pen_cm? pen_s1 : pen_cm;
 			subsc = r->subsc > min_chain_sc? r->subsc : min_chain_sc;
 			if (r->p && r->p->dp_max2 > 0 && r->p->dp_max > 0) {
 				float identity = (float)(r->p->blen - r->p->n_diff - r->p->n_ambi) / (r->p->blen - r->p->n_ambi);
-				mapq = (int)(identity * pen_cm * q_coef * (1. - (float)r->p->dp_max2 * subsc / r->p->dp_max / r->score) * logf(r->score));
+				int mapq_alt = (int)(6.02f * identity * identity * (r->p->dp_max - r->p->dp_max2) / match_sc + .499f); // BWA-MEM like mapQ, mostly for short reads
+				mapq = (int)(identity * pen_cm * q_coef * (1. - (float)r->p->dp_max2 * subsc / r->p->dp_max / r->score) * logf(r->score)); // more for long reads
+				mapq = mapq < mapq_alt? mapq : mapq_alt; // in case the long-read heuristic fails
 			} else mapq = (int)(pen_cm * q_coef * (1. - (float)subsc / r->score) * logf(r->score));
+			mapq -= (int)(4.343f * logf(r->n_sub + 1) + .499f);
 			mapq = mapq > 0? mapq : 0;
 			r->mapq = mapq < 60? mapq : 60;
 		} else r->mapq = 0;

index.c

@@ -1,6 +1,10 @@
 #include <stdlib.h>
 #include <assert.h>
+#if defined(WIN32) || defined(_WIN32)
+#include <io.h> // for open(2)
+#else
 #include <unistd.h>
+#endif
 #include <fcntl.h>
 #include <stdio.h>
 #include "kthread.h"
@@ -17,6 +21,22 @@ typedef khash_t(idx) idxhash_t;
 
 #define kroundup64(x) (--(x), (x)|=(x)>>1, (x)|=(x)>>2, (x)|=(x)>>4, (x)|=(x)>>8, (x)|=(x)>>16, (x)|=(x)>>32, ++(x))
 
+typedef struct mm_idx_bucket_s {
+	mm128_v a;   // (minimizer, position) array
+	int32_t n;   // size of the _p_ array
+	uint64_t *p; // position array for minimizers appearing >1 times
+	void *h;     // hash table indexing _p_ and minimizers appearing once
+} mm_idx_bucket_t;
+
+void mm_idxopt_init(mm_idxopt_t *opt)
+{
+	memset(opt, 0, sizeof(mm_idxopt_t));
+	opt->k = 15, opt->w = 10, opt->is_hpc = 0;
+	opt->bucket_bits = 14;
+	opt->mini_batch_size = 50000000;
+	opt->batch_size = 4000000000ULL;
+}
+
 mm_idx_t *mm_idx_init(int w, int k, int b, int is_hpc)
 {
 	mm_idx_t *mi;
@@ -100,13 +120,13 @@ int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, ui
 	return en - st;
 }
 
-uint32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f)
+int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f)
 {
 	int i;
 	size_t n = 0;
 	uint32_t thres;
 	khint_t *a, k;
-	if (f <= 0.) return UINT32_MAX;
+	if (f <= 0.) return INT32_MAX;
 	for (i = 0; i < 1<<mi->b; ++i)
 		if (mi->B[i].h) n += kh_size((idxhash_t*)mi->B[i].h);
 	a = (uint32_t*)malloc(n * 4);
@@ -285,12 +305,12 @@ static void *worker_pipeline(void *shared, int step, void *in)
 mm_idx_t *mm_idx_gen(mm_bseq_file_t *fp, int w, int k, int b, int is_hpc, int mini_batch_size, int n_threads, uint64_t batch_size, int keep_name)
 {
 	pipeline_t pl;
+	if (fp == 0 || mm_bseq_eof(fp)) return 0;
 	memset(&pl, 0, sizeof(pipeline_t));
 	pl.mini_batch_size = mini_batch_size < batch_size? mini_batch_size : batch_size;
 	pl.keep_name = keep_name;
 	pl.batch_size = batch_size;
 	pl.fp = fp;
-	if (pl.fp == 0) return 0;
 	pl.mi = mm_idx_init(w, k, b, is_hpc);
 
 	kt_pipeline(n_threads < 3? n_threads : 3, worker_pipeline, &pl, 3);
@@ -310,7 +330,7 @@ mm_idx_t *mm_idx_build(const char *fn, int w, int k, int is_hpc, int n_threads)
 	mm_idx_t *mi;
 	fp = mm_bseq_open(fn);
 	if (fp == 0) return 0;
-	mi = mm_idx_gen(fp, w, k, MM_IDX_DEF_B, is_hpc, 1<<18, n_threads, UINT64_MAX, 1);
+	mi = mm_idx_gen(fp, w, k, 14, is_hpc, 1<<18, n_threads, UINT64_MAX, 1);
 	mm_bseq_close(fp);
 	return mi;
 }
@@ -425,3 +445,43 @@ int mm_idx_is_idx(const char *fn)
 	close(fd);
 	return is_idx;
 }
+
+mm_idx_reader_t *mm_idx_reader_open(const char *fn, const mm_idxopt_t *opt, const char *fn_out)
+{
+	int is_idx;
+	mm_idx_reader_t *r;
+	is_idx = mm_idx_is_idx(fn);
+	if (is_idx < 0) return 0; // failed to open the index
+	r = (mm_idx_reader_t*)calloc(1, sizeof(mm_idx_reader_t));
+	r->is_idx = is_idx;
+	if (opt) r->opt = *opt;
+	else mm_idxopt_init(&r->opt);
+	if (r->is_idx) r->fp.idx = fopen(fn, "rb");
+	else r->fp.seq = mm_bseq_open(fn);
+	if (fn_out) r->fp_out = fopen(fn_out, "wb");
+	return r;
+}
+
+void mm_idx_reader_close(mm_idx_reader_t *r)
+{
+	if (r->is_idx) fclose(r->fp.idx);
+	else mm_bseq_close(r->fp.seq);
+	if (r->fp_out) fclose(r->fp_out);
+	free(r);
+}
+
+mm_idx_t *mm_idx_reader_read(mm_idx_reader_t *r, int n_threads)
+{
+	mm_idx_t *mi;
+	if (r->is_idx) {
+		mi = mm_idx_load(r->fp.idx);
+		if (mi && mm_verbose >= 2 && (mi->k != r->opt.k || mi->w != r->opt.w || mi->is_hpc != r->opt.is_hpc))
+			fprintf(stderr, "[WARNING] Indexing parameters (-k, -w or -H) overridden by parameters used in the prebuilt index.\n");
+	} else
+		mi = mm_idx_gen(r->fp.seq, r->opt.w, r->opt.k, r->opt.bucket_bits, r->opt.is_hpc, r->opt.mini_batch_size, n_threads, r->opt.batch_size, 1);
+	if (mi) {
+		if (r->fp_out) mm_idx_dump(r->fp_out, mi);
+		++r->n_parts;
+	}
+	return mi;
+}

kalloc.c

@@ -46,7 +46,7 @@ static size_t *morecore(kmem_t *km, size_t nu)
 	up = (size_t*)malloc(rnu * sizeof(size_t));
 	if (!up) { /* fail to allocate memory */
 		km_stat(km);
-		fprintf(stderr, "[morecore] %lu bytes requested but not available.\n", rnu * sizeof(size_t));
+		fprintf(stderr, "[morecore] %lu bytes requested but not available.\n", (unsigned long)rnu * sizeof(size_t));
 		exit(1);
 	}
 	/* put the pointer in km->list_head */
@@ -210,5 +210,5 @@ void km_stat(const void *_km)
 	--n_blocks;
 	frag = 1.0/1024.0 * n_units * sizeof(size_t) / n_blocks;
 	fprintf(stderr, "[kr_stat] tot=%lu, free=%lu, n_block=%u, max_block=%lu, frag_len=%.3fK\n",
-			km->total_allocated, n_units * sizeof(size_t), n_blocks, max_block * sizeof(size_t), frag);
+			(unsigned long)km->total_allocated, (unsigned long)n_units * sizeof(size_t), n_blocks, (unsigned long)max_block * sizeof(size_t), frag);
 }

kdq.h

@@ -3,11 +3,12 @@
 
 #include <stdlib.h>
 #include <string.h>
+#include <stdint.h>
 #include "kalloc.h"
 
 #define __KDQ_TYPE(type) \
 	typedef struct { \
-		size_t front:58, bits:6, count, mask; \
+		uint64_t front:58, bits:6, count, mask; \
 		type *a; \
 		void *km; \
 	} kdq_##type##_t;

ksort.h

@@ -30,6 +30,7 @@
 
 #include <stdlib.h>
 #include <string.h>
+#include <assert.h>
 
 typedef struct {
 	void *left, *right;
@@ -78,6 +79,7 @@ typedef const char *ksstr_t;
 #define KSORT_INIT_STR KSORT_INIT(str, ksstr_t, ks_lt_str)
 
 #define RS_MIN_SIZE 64
+#define RS_MAX_BITS 8
 
 #define KRADIX_SORT_INIT(name, rstype_t, rskey, sizeof_key) \
 	typedef struct { \
@@ -98,7 +100,8 @@ typedef const char *ksstr_t;
 	{ \
 		rstype_t *i; \
 		int size = 1<<n_bits, m = size - 1; \
-		rsbucket_##name##_t *k, b[size], *be = b + size; \
+		rsbucket_##name##_t *k, b[1<<RS_MAX_BITS], *be = b + size; \
+		assert(n_bits <= RS_MAX_BITS); \
 		for (k = b; k != be; ++k) k->b = k->e = beg; \
 		for (i = beg; i != end; ++i) ++b[rskey(*i)>>s&m].e; \
 		for (k = b + 1; k != be; ++k) \
@@ -127,7 +130,7 @@ typedef const char *ksstr_t;
 	void radix_sort_##name(rstype_t *beg, rstype_t *end) \
 	{ \
 		if (end - beg <= RS_MIN_SIZE) rs_insertsort_##name(beg, end); \
-		else rs_sort_##name(beg, end, 8, sizeof_key * 8 - 8); \
+		else rs_sort_##name(beg, end, RS_MAX_BITS, (sizeof_key - 1) * RS_MAX_BITS); \
 	}
 
 #endif

ksw2.h

@@ -12,6 +12,8 @@
 #define KSW_EZ_APPROX_DROP 0x10 // approximate Z-drop; faster with sse
 #define KSW_EZ_EXTZ_ONLY   0x40 // only perform extension
 #define KSW_EZ_REV_CIGAR   0x80 // reverse CIGAR in the output
+#define KSW_EZ_SPLICE_FOR  0x100
+#define KSW_EZ_SPLICE_REV  0x200
 
 #ifdef __cplusplus
 extern "C" {
@@ -53,6 +55,9 @@ void ksw_extd(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t
 void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
 				   int8_t gapo, int8_t gape, int8_t gapo2, int8_t gape2, int w, int zdrop, int flag, ksw_extz_t *ez);
 
+void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
+				   int8_t gapo, int8_t gape, int8_t gapo2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez);
+
 void ksw_extf2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t mch, int8_t mis, int8_t e, int w, int xdrop, ksw_extz_t *ez);
 
 /**
@@ -106,7 +111,8 @@ static inline uint32_t *ksw_push_cigar(void *km, int *n_cigar, int *m_cigar, uin
 //   bit 0-2: which type gets the max - 0 for H, 1 for E, 2 for F, 3 for \tilde{E} and 4 for \tilde{F}
 //   bit 3/0x08: 1 if a continuation on the E state (bit 5/0x20 for a continuation on \tilde{E})
 //   bit 4/0x10: 1 if a continuation on the F state (bit 6/0x40 for a continuation on \tilde{F})
-static inline void ksw_backtrack(void *km, int is_rot, int is_rev, const uint8_t *p, const int *off, const int *off_end, int n_col, int i0, int j0, int *m_cigar_, int *n_cigar_, uint32_t **cigar_)
+static inline void ksw_backtrack(void *km, int is_rot, int is_rev, int with_N, const uint8_t *p, const int *off, const int *off_end, int n_col, int i0, int j0,
+								 int *m_cigar_, int *n_cigar_, uint32_t **cigar_)
 { // p[] - lower 3 bits: which type gets the max; bit
 	int n_cigar = 0, m_cigar = *m_cigar_, i = i0, j = j0, r, state = 0;
 	uint32_t *cigar = *cigar_, tmp;
@@ -127,7 +133,8 @@ static inline void ksw_backtrack(void *km, int is_rot, int is_rev, const uint8_t
 		if (state == 0) state = tmp & 7; // TODO: probably this line can be merged into the "else if" line right above; not 100% sure
 		if (force_state >= 0) state = force_state;
 		if (state == 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 0, 1), --i, --j; // match
-		else if (state == 1 || state == 3) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 2, 1), --i; // deletion
+		else if (state == 1 || (state == 3 && !with_N)) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 2, 1), --i; // deletion
+		else if (state == 3 && with_N) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 3, 1), --i; // intron
 		else cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 1, 1), --j; // insertion
 	}
 	if (i >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 2, i + 1); // first deletion
@@ -162,5 +169,4 @@ static inline int ksw_apply_zdrop(ksw_extz_t *ez, int is_rot, int32_t H, int a,
 	}
 	return 0;
 }
-
 #endif

ksw2_dispatch.c

@@ -0,0 +1,97 @@
+#ifdef KSW_CPU_DISPATCH
+#include <stdlib.h>
+#include "ksw2.h"
+
+#define SIMD_SSE     0x1
+#define SIMD_SSE2    0x2
+#define SIMD_SSE3    0x4
+#define SIMD_SSSE3   0x8
+#define SIMD_SSE4_1  0x10
+#define SIMD_SSE4_2  0x20
+#define SIMD_AVX     0x40
+#define SIMD_AVX2    0x80
+#define SIMD_AVX512F 0x100
+
+#ifndef _MSC_VER
+// adapted from https://github.com/01org/linux-sgx/blob/master/common/inc/internal/linux/cpuid_gnu.h
+void __cpuidex(int cpuid[4], int func_id, int subfunc_id)
+{
+#if defined(__x86_64__)
+	asm volatile ("cpuid"
+			: "=a" (cpuid[0]), "=b" (cpuid[1]), "=c" (cpuid[2]), "=d" (cpuid[3])
+			: "0" (func_id), "2" (subfunc_id));
+#else // on 32bit, ebx can NOT be used as PIC code
+	asm volatile ("xchgl %%ebx, %1; cpuid; xchgl %%ebx, %1"
+			: "=a" (cpuid[0]), "=r" (cpuid[1]), "=c" (cpuid[2]), "=d" (cpuid[3])
+			: "0" (func_id), "2" (subfunc_id));
+#endif
+}
+#endif
+
+int x86_simd(void)
+{
+	int flag = 0, cpuid[4], max_id;
+	__cpuidex(cpuid, 0, 0);
+	max_id = cpuid[0];
+	if (max_id == 0) return 0;
+	__cpuidex(cpuid, 1, 0);
+	if (cpuid[3]>>25&1) flag |= SIMD_SSE;
+	if (cpuid[3]>>26&1) flag |= SIMD_SSE2;
+	if (cpuid[2]>>0 &1) flag |= SIMD_SSE3;
+	if (cpuid[2]>>9 &1) flag |= SIMD_SSSE3;
+	if (cpuid[2]>>19&1) flag |= SIMD_SSE4_1;
+	if (cpuid[2]>>20&1) flag |= SIMD_SSE4_2;
+	if (cpuid[2]>>28&1) flag |= SIMD_AVX;
+	if (max_id >= 7) {
+		__cpuidex(cpuid, 7, 0);
+		if (cpuid[1]>>5 &1) flag |= SIMD_AVX2;
+		if (cpuid[1]>>16&1) flag |= SIMD_AVX512F;
+	}
+	return flag;
+}
+
+void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int flag, ksw_extz_t *ez)
+{
+	extern void ksw_extz2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int flag, ksw_extz_t *ez);
+	extern void ksw_extz2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int flag, ksw_extz_t *ez);
+	unsigned simd;
+	simd = x86_simd();
+	if (simd & SIMD_SSE4_1)
+		ksw_extz2_sse41(km, qlen, query, tlen, target, m, mat, q, e, w, zdrop, flag, ez);
+	else if (simd & SIMD_SSE2)
+		ksw_extz2_sse2(km, qlen, query, tlen, target, m, mat, q, e, w, zdrop, flag, ez);
+	else abort();
+}
+
+void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
+				   int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int flag, ksw_extz_t *ez)
+{
+	extern void ksw_extd2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
+				   int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int flag, ksw_extz_t *ez);
+	extern void ksw_extd2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
+				   int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int flag, ksw_extz_t *ez);
+	unsigned simd;
+	simd = x86_simd();
+	if (simd & SIMD_SSE4_1)
+		ksw_extd2_sse41(km, qlen, query, tlen, target, m, mat, q, e, q2, e2, w, zdrop, flag, ez);
+	else if (simd & SIMD_SSE2)
+		ksw_extd2_sse2(km, qlen, query, tlen, target, m, mat, q, e, q2, e2, w, zdrop, flag, ez);
+	else abort();
+}
+
+void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
+				   int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez)
+{
+	extern void ksw_exts2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
+				   int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez);
+	extern void ksw_exts2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
+				   int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez);
+	unsigned simd;
+	simd = x86_simd();
+	if (simd & SIMD_SSE4_1)
+		ksw_exts2_sse41(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, flag, ez);
+	else if (simd & SIMD_SSE2)
+		ksw_exts2_sse2(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, flag, ez);
+	else abort();
+}
+#endif

ksw2_extd2_sse.c

@@ -1,16 +1,31 @@
 #include <string.h>
 #include <stdio.h>
+#include <assert.h>
 #include "ksw2.h"
 
 #ifdef __SSE2__
 #include <emmintrin.h>
 
+#ifdef KSW_SSE2_ONLY
+#undef __SSE4_1__
+#endif
+
 #ifdef __SSE4_1__
 #include <smmintrin.h>
 #endif
 
+#ifdef KSW_CPU_DISPATCH
+#ifdef __SSE4_1__
+void ksw_extd2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
+				   int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int flag, ksw_extz_t *ez)
+#else
+void ksw_extd2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
+				   int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int flag, ksw_extz_t *ez)
+#endif
+#else
 void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
 				   int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int flag, ksw_extz_t *ez)
+#endif // ~KSW_CPU_DISPATCH
 {
 #define __dp_code_block1 \
 	z = _mm_load_si128(&s[t]); \
@@ -66,7 +81,8 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
 	if (w < 0) w = tlen > qlen? tlen : qlen;
 	wl = wr = w;
 	tlen_ = (tlen + 15) / 16;
-	n_col_ = ((w + 1 < tlen? (w + 1 < qlen? w + 1 : qlen): tlen) + 15) / 16 + 1;
+	n_col_ = qlen < tlen? qlen : tlen;
+	n_col_ = ((n_col_ < w + 1? n_col_ : w + 1) + 15) / 16 + 1;
 	qlen_ = (qlen + 15) / 16;
 	for (t = 1, max_sc = mat[0], min_sc = mat[1]; t < m * m; ++t) {
 		max_sc = max_sc > mat[t]? max_sc : mat[t];
@@ -161,6 +177,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
 		x21_ = _mm_cvtsi32_si128((uint8_t)x21);
 		v1_  = _mm_cvtsi32_si128((uint8_t)v1);
 		st_ = st / 16, en_ = en / 16;
+		assert(en_ - st_ + 1 <= n_col_);
 		if (!with_cigar) { // score only
 			for (t = st_; t <= en_; ++t) {
 				__m128i z, a, b, a2, b2, xt1, x2t1, vt1, ut, tmp;
@@ -362,9 +379,9 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
 	if (with_cigar) { // backtrack
 		int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
 		if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY))
-			ksw_backtrack(km, 1, rev_cigar, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
+			ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
 		else if (ez->max_t >= 0 && ez->max_q >= 0)
-			ksw_backtrack(km, 1, rev_cigar, (uint8_t*)p, off, off_end, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
+			ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
 		kfree(km, mem2); kfree(km, off);
 	}
 }

ksw2_exts2_sse.c

@@ -0,0 +1,371 @@
+#include <string.h>
+#include <stdio.h>
+#include <assert.h>
+#include "ksw2.h"
+
+#ifdef __SSE2__
+#include <emmintrin.h>
+
+#ifdef KSW_SSE2_ONLY
+#undef __SSE4_1__
+#endif
+
+#ifdef __SSE4_1__
+#include <smmintrin.h>
+#endif
+
+#ifdef KSW_CPU_DISPATCH
+#ifdef __SSE4_1__
+void ksw_exts2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
+				   int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez)
+#else
+void ksw_exts2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
+				   int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez)
+#endif
+#else
+void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
+				   int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez)
+#endif // ~KSW_CPU_DISPATCH
+{
+#define __dp_code_block1 \
+	z = _mm_load_si128(&s[t]); \
+	xt1 = _mm_load_si128(&x[t]);                     /* xt1 <- x[r-1][t..t+15] */ \
+	tmp = _mm_srli_si128(xt1, 15);                   /* tmp <- x[r-1][t+15] */ \
+	xt1 = _mm_or_si128(_mm_slli_si128(xt1, 1), x1_); /* xt1 <- x[r-1][t-1..t+14] */ \
+	x1_ = tmp; \
+	vt1 = _mm_load_si128(&v[t]);                     /* vt1 <- v[r-1][t..t+15] */ \
+	tmp = _mm_srli_si128(vt1, 15);                   /* tmp <- v[r-1][t+15] */ \
+	vt1 = _mm_or_si128(_mm_slli_si128(vt1, 1), v1_); /* vt1 <- v[r-1][t-1..t+14] */ \
+	v1_ = tmp; \
+	a = _mm_add_epi8(xt1, vt1);                      /* a <- x[r-1][t-1..t+14] + v[r-1][t-1..t+14] */ \
+	ut = _mm_load_si128(&u[t]);                      /* ut <- u[t..t+15] */ \
+	b = _mm_add_epi8(_mm_load_si128(&y[t]), ut);     /* b <- y[r-1][t..t+15] + u[r-1][t..t+15] */ \
+	x2t1= _mm_load_si128(&x2[t]); \
+	tmp = _mm_srli_si128(x2t1, 15); \
+	x2t1= _mm_or_si128(_mm_slli_si128(x2t1, 1), x21_); \
+	x21_= tmp; \
+	a2  = _mm_add_epi8(x2t1, vt1); \
+	a2a = _mm_add_epi8(a2, _mm_load_si128(&acceptor[t]));
+
+#define __dp_code_block2 \
+	_mm_store_si128(&u[t], _mm_sub_epi8(z, vt1));    /* u[r][t..t+15] <- z - v[r-1][t-1..t+14] */ \
+	_mm_store_si128(&v[t], _mm_sub_epi8(z, ut));     /* v[r][t..t+15] <- z - u[r-1][t..t+15] */ \
+	tmp = _mm_sub_epi8(z, q_); \
+	a = _mm_sub_epi8(a, tmp); \
+	b = _mm_sub_epi8(b, tmp); \
+	a2= _mm_sub_epi8(a2, _mm_sub_epi8(z, q2_));
+
+	int r, t, qe = q + e, n_col_, *off = 0, *off_end = 0, tlen_, qlen_, last_st, last_en, max_sc, min_sc, long_thres, long_diff;
+	int with_cigar = !(flag&KSW_EZ_SCORE_ONLY), approx_max = !!(flag&KSW_EZ_APPROX_MAX);
+	int32_t *H = 0, H0 = 0, last_H0_t = 0;
+	uint8_t *qr, *sf, *mem, *mem2 = 0;
+	__m128i q_, q2_, qe_, zero_, sc_mch_, sc_mis_, m1_;
+	__m128i *u, *v, *x, *y, *x2, *s, *p = 0, *donor, *acceptor;
+
+	ksw_reset_extz(ez);
+	if (m <= 1 || qlen <= 0 || tlen <= 0 || q2 <= q + e) return;
+
+	zero_   = _mm_set1_epi8(0);
+	q_      = _mm_set1_epi8(q);
+	q2_     = _mm_set1_epi8(q2);
+	qe_     = _mm_set1_epi8(q + e);
+	sc_mch_ = _mm_set1_epi8(mat[0]);
+	sc_mis_ = _mm_set1_epi8(mat[1]);
+	m1_     = _mm_set1_epi8(m - 1); // wildcard
+
+	tlen_ = (tlen + 15) / 16;
+	n_col_ = ((qlen < tlen? qlen : tlen) + 15) / 16 + 1;
+	qlen_ = (qlen + 15) / 16;
+	for (t = 1, max_sc = mat[0], min_sc = mat[1]; t < m * m; ++t) {
+		max_sc = max_sc > mat[t]? max_sc : mat[t];
+		min_sc = min_sc < mat[t]? min_sc : mat[t];
+	}
+	if (-min_sc > 2 * (q + e)) return; // otherwise, we won't see any mismatches
+
+	long_thres = (q2 - q) / e - 1;
+	if (q2 > q + e + long_thres * e)
+		++long_thres;
+	long_diff = long_thres * e - (q2 - q);
+
+	mem = (uint8_t*)kcalloc(km, tlen_ * 9 + qlen_ + 1, 16);
+	u = (__m128i*)(((size_t)mem + 15) >> 4 << 4); // 16-byte aligned
+	v = u + tlen_, x = v + tlen_, y = x + tlen_, x2 = y + tlen_;
+	donor = x2 + tlen_, acceptor = donor + tlen_;
+	s = acceptor + tlen_, sf = (uint8_t*)(s + tlen_), qr = sf + tlen_ * 16;
+	memset(u,  -q - e,  tlen_ * 16 * 4); // this set u, v, x, y (because they are in the same array)
+	memset(x2, -q2,     tlen_ * 16);
+	if (!approx_max) {
+		H = (int32_t*)kmalloc(km, tlen_ * 16 * 4);
+		for (t = 0; t < tlen_ * 16; ++t) H[t] = KSW_NEG_INF;
+	}
+	if (with_cigar) {
+		mem2 = (uint8_t*)kmalloc(km, ((qlen + tlen - 1) * n_col_ + 1) * 16);
+		p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4);
+		off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int) * 2);
+		off_end = off + qlen + tlen - 1;
+	}
+
+	for (t = 0; t < qlen; ++t) qr[t] = query[qlen - 1 - t];
+	memcpy(sf, target, tlen);
+
+	// set the donor and acceptor arrays. TODO: this assumes 0/1/2/3 encoding!
+	if (flag & (KSW_EZ_SPLICE_FOR|KSW_EZ_SPLICE_REV)) {
+		memset(donor, -noncan, tlen_ * 16);
+		for (t = 0; t < tlen - 2; ++t) {
+			int is_can = 0; // is a canonical site
+			if ((flag & KSW_EZ_SPLICE_FOR) && target[t+1] == 2 && target[t+2] == 3) is_can = 1;
+			if ((flag & KSW_EZ_SPLICE_REV) && target[t+1] == 1 && target[t+2] == 3) is_can = 1;
+			if (is_can) ((int8_t*)donor)[t] = 0;
+		}
+		memset(acceptor, -noncan, tlen_ * 16);
+		for (t = 2; t < tlen; ++t) {
+			int is_can = 0;
+			if ((flag & KSW_EZ_SPLICE_FOR) && target[t-1] == 0 && target[t] == 2) is_can = 1;
+			if ((flag & KSW_EZ_SPLICE_REV) && target[t-1] == 0 && target[t] == 1) is_can = 1;
+			if (is_can) ((int8_t*)acceptor)[t] = 0;
+		}
+	}
+
+	for (r = 0, last_st = last_en = -1; r < qlen + tlen - 1; ++r) {
+		int st = 0, en = tlen - 1, st0, en0, st_, en_;
+		int8_t x1, x21, v1, *u8 = (int8_t*)u, *v8 = (int8_t*)v;
+		uint8_t *qrr = qr + (qlen - 1 - r);
+		__m128i x1_, x21_, v1_;
+		// find the boundaries
+		if (st < r - qlen + 1) st = r - qlen + 1;
+		if (en > r) en = r;
+		st0 = st, en0 = en;
+		st = st / 16 * 16, en = (en + 16) / 16 * 16 - 1;
+		// set boundary conditions
+		if (st > 0) {
+			if (st - 1 >= last_st && st - 1 <= last_en)
+				x1 = ((int8_t*)x)[st - 1], x21 = ((int8_t*)x2)[st - 1], v1 = v8[st - 1]; // (r-1,s-1) calculated in the last round
+			else x1 = -q - e, x21 = -q2, v1 = -q - e;
+		} else {
+			x1 = -q - e, x21 = -q2;
+			v1 = r == 0? -q - e : r < long_thres? -e : r == long_thres? long_diff : 0;
+		}
+		if (en >= r) {
+			((int8_t*)y)[r] = -q - e;
+			u8[r] = r == 0? -q - e : r < long_thres? -e : r == long_thres? long_diff : 0;
+		}
+		// loop fission: set scores first
+		if (!(flag & KSW_EZ_GENERIC_SC)) {
+			for (t = st0; t <= en0; t += 16) {
+				__m128i sq, st, tmp, mask;
+				sq = _mm_loadu_si128((__m128i*)&sf[t]);
+				st = _mm_loadu_si128((__m128i*)&qrr[t]);
+				mask = _mm_or_si128(_mm_cmpeq_epi8(sq, m1_), _mm_cmpeq_epi8(st, m1_));
+				tmp = _mm_cmpeq_epi8(sq, st);
+#ifdef __SSE4_1__
+				tmp = _mm_blendv_epi8(sc_mis_, sc_mch_, tmp);
+#else
+				tmp = _mm_or_si128(_mm_andnot_si128(tmp, sc_mis_), _mm_and_si128(tmp, sc_mch_));
+#endif
+				tmp = _mm_andnot_si128(mask, tmp);
+				_mm_storeu_si128((__m128i*)((int8_t*)s + t), tmp);
+			}
+		} else {
+			for (t = st0; t <= en0; ++t)
+				((uint8_t*)s)[t] = mat[sf[t] * m + qrr[t]];
+		}
+		// core loop
+		x1_  = _mm_cvtsi32_si128((uint8_t)x1);
+		x21_ = _mm_cvtsi32_si128((uint8_t)x21);
+		v1_  = _mm_cvtsi32_si128((uint8_t)v1);
+		st_ = st / 16, en_ = en / 16;
+		assert(en_ - st_ + 1 <= n_col_);
+		if (!with_cigar) { // score only
+			for (t = st_; t <= en_; ++t) {
+				__m128i z, a, b, a2, a2a, xt1, x2t1, vt1, ut, tmp;
+				__dp_code_block1;
+#ifdef __SSE4_1__
+				z = _mm_max_epi8(z, a);
+				z = _mm_max_epi8(z, b);
+				z = _mm_max_epi8(z, a2a);
+				__dp_code_block2; // save u[] and v[]; update a, b and a2
+				_mm_store_si128(&x[t],  _mm_sub_epi8(_mm_max_epi8(a,  zero_), qe_));
+				_mm_store_si128(&y[t],  _mm_sub_epi8(_mm_max_epi8(b,  zero_), qe_));
+				tmp = _mm_load_si128(&donor[t]);
+				_mm_store_si128(&x2[t], _mm_sub_epi8(_mm_max_epi8(a2, tmp), q2_));
+#else
+				tmp = _mm_cmpgt_epi8(a,  z);
+				z = _mm_or_si128(_mm_andnot_si128(tmp, z), _mm_and_si128(tmp, a));
+				tmp = _mm_cmpgt_epi8(b,  z);
+				z = _mm_or_si128(_mm_andnot_si128(tmp, z), _mm_and_si128(tmp, b));
+				tmp = _mm_cmpgt_epi8(a2a, z);
+				z = _mm_or_si128(_mm_andnot_si128(tmp, z), _mm_and_si128(tmp, a2a));
+				__dp_code_block2;
+				tmp = _mm_cmpgt_epi8(a, zero_);
+				_mm_store_si128(&x[t],  _mm_sub_epi8(_mm_and_si128(tmp, a),  qe_));
+				tmp = _mm_cmpgt_epi8(b, zero_);
+				_mm_store_si128(&y[t],  _mm_sub_epi8(_mm_and_si128(tmp, b),  qe_));
+				tmp = _mm_load_si128(&donor[t]); // TODO: check if this is correct
+				tmp = _mm_cmpgt_epi8(a2, tmp);
+				tmp = _mm_or_si128(_mm_andnot_si128(tmp, tmp), _mm_and_si128(tmp, a2));
+				_mm_store_si128(&x2[t], _mm_sub_epi8(tmp, q2_));
+#endif
+			}
+		} else if (!(flag&KSW_EZ_RIGHT)) { // gap left-alignment
+			__m128i *pr = p + r * n_col_ - st_;
+			off[r] = st, off_end[r] = en;
+			for (t = st_; t <= en_; ++t) {
+				__m128i d, z, a, b, a2, a2a, xt1, x2t1, vt1, ut, tmp, tmp2;
+				__dp_code_block1;
+#ifdef __SSE4_1__
+				d = _mm_and_si128(_mm_cmpgt_epi8(a, z), _mm_set1_epi8(1));       // d = a  > z? 1 : 0
+				z = _mm_max_epi8(z, a);
+				d = _mm_blendv_epi8(d, _mm_set1_epi8(2), _mm_cmpgt_epi8(b,  z)); // d = b  > z? 2 : d
+				z = _mm_max_epi8(z, b);
+				d = _mm_blendv_epi8(d, _mm_set1_epi8(3), _mm_cmpgt_epi8(a2a, z)); // d = a2 > z? 3 : d
+				z = _mm_max_epi8(z, a2a);
+#else // we need to emulate SSE4.1 intrinsics _mm_max_epi8() and _mm_blendv_epi8()
+				tmp = _mm_cmpgt_epi8(a,  z);
+				d = _mm_and_si128(tmp, _mm_set1_epi8(1));
+				z = _mm_or_si128(_mm_andnot_si128(tmp, z), _mm_and_si128(tmp, a));
+				tmp = _mm_cmpgt_epi8(b,  z);
+				d = _mm_or_si128(_mm_andnot_si128(tmp, d), _mm_and_si128(tmp, _mm_set1_epi8(2)));
+				z = _mm_or_si128(_mm_andnot_si128(tmp, z), _mm_and_si128(tmp, b));
+				tmp = _mm_cmpgt_epi8(a2a, z);
+				d = _mm_or_si128(_mm_andnot_si128(tmp, d), _mm_and_si128(tmp, _mm_set1_epi8(3)));
+				z = _mm_or_si128(_mm_andnot_si128(tmp, z), _mm_and_si128(tmp, a2a));
+#endif
+				__dp_code_block2;
+				tmp = _mm_cmpgt_epi8(a, zero_);
+				_mm_store_si128(&x[t],  _mm_sub_epi8(_mm_and_si128(tmp, a),  qe_));
+				d = _mm_or_si128(d, _mm_and_si128(tmp, _mm_set1_epi8(0x08))); // d = a > 0? 1<<3 : 0
+				tmp = _mm_cmpgt_epi8(b, zero_);
+				_mm_store_si128(&y[t],  _mm_sub_epi8(_mm_and_si128(tmp, b),  qe_));
+				d = _mm_or_si128(d, _mm_and_si128(tmp, _mm_set1_epi8(0x10))); // d = b > 0? 1<<4 : 0
+
+				tmp2 = _mm_load_si128(&donor[t]);
+				tmp = _mm_cmpgt_epi8(a2, tmp2);
+#ifdef __SSE4_1__
+				tmp2 = _mm_max_epi8(a2, tmp2);
+#else
+				tmp2 = _mm_or_si128(_mm_andnot_si128(tmp, tmp2), _mm_and_si128(tmp, a2));
+#endif
+				_mm_store_si128(&x2[t], _mm_sub_epi8(tmp2, q2_));
+				d = _mm_or_si128(d, _mm_and_si128(tmp, _mm_set1_epi8(0x20)));
+				_mm_store_si128(&pr[t], d);
+			}
+		} else { // gap right-alignment
+			__m128i *pr = p + r * n_col_ - st_;
+			off[r] = st, off_end[r] = en;
+			for (t = st_; t <= en_; ++t) {
+				__m128i d, z, a, b, a2, a2a, xt1, x2t1, vt1, ut, tmp, tmp2;
+				__dp_code_block1;
+#ifdef __SSE4_1__
+				d = _mm_andnot_si128(_mm_cmpgt_epi8(z, a), _mm_set1_epi8(1));    // d = z > a?  0 : 1
+				z = _mm_max_epi8(z, a);
+				d = _mm_blendv_epi8(_mm_set1_epi8(2), d, _mm_cmpgt_epi8(z, b));  // d = z > b?  d : 2
+				z = _mm_max_epi8(z, b);
+				d = _mm_blendv_epi8(_mm_set1_epi8(3), d, _mm_cmpgt_epi8(z, a2a)); // d = z > a2? d : 3
+				z = _mm_max_epi8(z, a2a);
+#else // we need to emulate SSE4.1 intrinsics _mm_max_epi8() and _mm_blendv_epi8()
+				tmp = _mm_cmpgt_epi8(z, a);
+				d = _mm_andnot_si128(tmp, _mm_set1_epi8(1));
+				z = _mm_or_si128(_mm_and_si128(tmp, z), _mm_andnot_si128(tmp, a));
+				tmp = _mm_cmpgt_epi8(z, b);
+				d = _mm_or_si128(_mm_and_si128(tmp, d), _mm_andnot_si128(tmp, _mm_set1_epi8(2)));
+				z = _mm_or_si128(_mm_and_si128(tmp, z), _mm_andnot_si128(tmp, b));
+				tmp = _mm_cmpgt_epi8(z, a2a);
+				d = _mm_or_si128(_mm_and_si128(tmp, d), _mm_andnot_si128(tmp, _mm_set1_epi8(3)));
+				z = _mm_or_si128(_mm_and_si128(tmp, z), _mm_andnot_si128(tmp, a2a));
+#endif
+				__dp_code_block2;
+				tmp = _mm_cmpgt_epi8(zero_, a);
+				_mm_store_si128(&x[t],  _mm_sub_epi8(_mm_andnot_si128(tmp, a),  qe_));
+				d = _mm_or_si128(d, _mm_andnot_si128(tmp, _mm_set1_epi8(0x08))); // d = a > 0? 1<<3 : 0
+				tmp = _mm_cmpgt_epi8(zero_, b);
+				_mm_store_si128(&y[t],  _mm_sub_epi8(_mm_andnot_si128(tmp, b),  qe_));
+				d = _mm_or_si128(d, _mm_andnot_si128(tmp, _mm_set1_epi8(0x10))); // d = b > 0? 1<<4 : 0
+
+				tmp2 = _mm_load_si128(&donor[t]);
+				tmp = _mm_cmpgt_epi8(tmp2, a2);
+#ifdef __SSE4_1__
+				tmp2 = _mm_max_epi8(tmp2, a2);
+#else
+				tmp2 = _mm_or_si128(_mm_andnot_si128(tmp, a2), _mm_and_si128(tmp, tmp2));
+#endif
+				_mm_store_si128(&x2[t], _mm_sub_epi8(tmp2, q2_));
+				d = _mm_or_si128(d, _mm_andnot_si128(tmp, _mm_set1_epi8(0x20))); // d = a > 0? 1<<5 : 0
+				_mm_store_si128(&pr[t], d);
+			}
+		}
+		if (!approx_max) { // find the exact max with a 32-bit score array
+			int32_t max_H, max_t;
+			// compute H[], max_H and max_t
+			if (r > 0) {
+				int32_t HH[4], tt[4], en1 = st0 + (en0 - st0) / 4 * 4, i;
+				__m128i max_H_, max_t_;
+				max_H = H[en0] = en0 > 0? H[en0-1] + u8[en0] : H[en0] + v8[en0]; // special casing the last element
+				max_t = en0;
+				max_H_ = _mm_set1_epi32(max_H);
+				max_t_ = _mm_set1_epi32(max_t);
+				for (t = st0; t < en1; t += 4) { // this implements: H[t]+=v8[t]-qe; if(H[t]>max_H) max_H=H[t],max_t=t;
+					__m128i H1, tmp, t_;
+					H1 = _mm_loadu_si128((__m128i*)&H[t]);
+					t_ = _mm_setr_epi32(v8[t], v8[t+1], v8[t+2], v8[t+3]);
+					H1 = _mm_add_epi32(H1, t_);
+					_mm_storeu_si128((__m128i*)&H[t], H1);
+					t_ = _mm_set1_epi32(t);
+					tmp = _mm_cmpgt_epi32(H1, max_H_);
+#ifdef __SSE4_1__
+					max_H_ = _mm_blendv_epi8(max_H_, H1, tmp);
+					max_t_ = _mm_blendv_epi8(max_t_, t_, tmp);
+#else
+					max_H_ = _mm_or_si128(_mm_and_si128(tmp, H1), _mm_andnot_si128(tmp, max_H_));
+					max_t_ = _mm_or_si128(_mm_and_si128(tmp, t_), _mm_andnot_si128(tmp, max_t_));
+#endif
+				}
+				_mm_storeu_si128((__m128i*)HH, max_H_);
+				_mm_storeu_si128((__m128i*)tt, max_t_);
+				for (i = 0; i < 4; ++i)
+					if (max_H < HH[i]) max_H = HH[i], max_t = tt[i] + i;
+				for (; t < en0; ++t) { // for the rest of values that haven't been computed with SSE
+					H[t] += (int32_t)v8[t];
+					if (H[t] > max_H)
+						max_H = H[t], max_t = t;
+				}
+			} else H[0] = v8[0] - qe, max_H = H[0], max_t = 0; // special casing r==0
+			// update ez
+			if (en0 == tlen - 1 && H[en0] > ez->mte)
+				ez->mte = H[en0], ez->mte_q = r - en;
+			if (r - st0 == qlen - 1 && H[st0] > ez->mqe)
+				ez->mqe = H[st0], ez->mqe_t = st0;
+			if (ksw_apply_zdrop(ez, 1, max_H, r, max_t, zdrop, 0)) break;
+			if (r == qlen + tlen - 2 && en0 == tlen - 1)
+				ez->score = H[tlen - 1];
+		} else { // find approximate max; Z-drop might be inaccurate, too.
+			if (r > 0) {
+				if (last_H0_t >= st0 && last_H0_t <= en0 && last_H0_t + 1 >= st0 && last_H0_t + 1 <= en0) {
+					int32_t d0 = v8[last_H0_t];
+					int32_t d1 = u8[last_H0_t + 1];
+					if (d0 > d1) H0 += d0;
+					else H0 += d1, ++last_H0_t;
+				} else if (last_H0_t >= st0 && last_H0_t <= en0) {
+					H0 += v8[last_H0_t];
+				} else {
+					++last_H0_t, H0 += u8[last_H0_t];
+				}
+			} else H0 = v8[0] - qe, last_H0_t = 0;
+			if ((flag & KSW_EZ_APPROX_DROP) && ksw_apply_zdrop(ez, 1, H0, r, last_H0_t, zdrop, 0)) break;
+			if (r == qlen + tlen - 2 && en0 == tlen - 1)
+				ez->score = H0;
+		}
+		last_st = st, last_en = en;
+		//for (t = st0; t <= en0; ++t) printf("(%d,%d)\t(%d,%d,%d,%d)\t%d\n", r, t, ((int8_t*)u)[t], ((int8_t*)v)[t], ((int8_t*)x)[t], ((int8_t*)y)[t], H[t]); // for debugging
+	}
+	kfree(km, mem);
+	if (!approx_max) kfree(km, H);
+	if (with_cigar) { // backtrack
+		int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
+		if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY))
+			ksw_backtrack(km, 1, rev_cigar, 1, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
+		else if (ez->max_t >= 0 && ez->max_q >= 0)
+			ksw_backtrack(km, 1, rev_cigar, 1, (uint8_t*)p, off, off_end, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
+		kfree(km, mem2); kfree(km, off);
+	}
+}
+#endif // __SSE2__

ksw2_extz2_sse.c

@@ -1,14 +1,27 @@
 #include <string.h>
+#include <assert.h>
 #include "ksw2.h"
 
 #ifdef __SSE2__
 #include <emmintrin.h>
 
+#ifdef KSW_SSE2_ONLY
+#undef __SSE4_1__
+#endif
+
 #ifdef __SSE4_1__
 #include <smmintrin.h>
 #endif
 
+#ifdef KSW_CPU_DISPATCH
+#ifdef __SSE4_1__
+void ksw_extz2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int flag, ksw_extz_t *ez)
+#else
+void ksw_extz2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int flag, ksw_extz_t *ez)
+#endif
+#else
 void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int flag, ksw_extz_t *ez)
+#endif // ~KSW_CPU_DISPATCH
 {
 #define __dp_code_block1 \
 	z = _mm_add_epi8(_mm_load_si128(&s[t]), qe2_); \
@@ -58,7 +71,8 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
 	if (w < 0) w = tlen > qlen? tlen : qlen;
 	wl = wr = w;
 	tlen_ = (tlen + 15) / 16;
-	n_col_ = ((w + 1 < tlen? (w + 1 < qlen? w + 1 : qlen): tlen) + 15) / 16 + 1;
+	n_col_ = qlen < tlen? qlen : tlen;
+	n_col_ = ((n_col_ < w + 1? n_col_ : w + 1) + 15) / 16 + 1;
 	qlen_ = (qlen + 15) / 16;
 	for (t = 1, max_sc = mat[0], min_sc = mat[1]; t < m * m; ++t) {
 		max_sc = max_sc > mat[t]? max_sc : mat[t];
@@ -130,6 +144,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
 		x1_ = _mm_cvtsi32_si128(x1);
 		v1_ = _mm_cvtsi32_si128(v1);
 		st_ = st / 16, en_ = en / 16;
+		assert(en_ - st_ + 1 <= n_col_);
 		if (!with_cigar) { // score only
 			for (t = st_; t <= en_; ++t) {
 				__m128i z, a, b, xt1, vt1, ut, tmp;
@@ -275,9 +290,9 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
 	if (with_cigar) { // backtrack
 		int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
 		if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY))
-			ksw_backtrack(km, 1, rev_cigar, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
+			ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
 		else if (ez->max_t >= 0 && ez->max_q >= 0)
-			ksw_backtrack(km, 1, rev_cigar, (uint8_t*)p, off, off_end, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
+			ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
 		kfree(km, mem2); kfree(km, off);
 	}
 }

kthread.c

@@ -1,6 +1,11 @@
 #include <pthread.h>
 #include <stdlib.h>
 #include <limits.h>
+#include <stdint.h>
+
+#if (defined(WIN32) || defined(_WIN32)) && defined(_MSC_VER)
+#define __sync_fetch_and_add(ptr, addend)     _InterlockedExchangeAdd((void*)ptr, addend)
+#endif
 
 /************
  * kt_for() *
@@ -52,12 +57,13 @@ void kt_for(int n_threads, void (*func)(void*,long,int), void *data, long n)
 		kt_for_t t;
 		pthread_t *tid;
 		t.func = func, t.data = data, t.n_threads = n_threads, t.n = n;
-		t.w = (ktf_worker_t*)alloca(n_threads * sizeof(ktf_worker_t));
+		t.w = (ktf_worker_t*)calloc(n_threads, sizeof(ktf_worker_t));
-		tid = (pthread_t*)alloca(n_threads * sizeof(pthread_t));
+		tid = (pthread_t*)calloc(n_threads, sizeof(pthread_t));
 		for (i = 0; i < n_threads; ++i)
 			t.w[i].t = &t, t.w[i].i = i;
 		for (i = 0; i < n_threads; ++i) pthread_create(&tid[i], 0, ktf_worker, &t.w[i]);
 		for (i = 0; i < n_threads; ++i) pthread_join(tid[i], 0);
+		free(tid); free(t.w);
 	} else {
 		long j;
 		for (j = 0; j < n; ++j) func(data, j, 0);
@@ -135,16 +141,17 @@ void kt_pipeline(int n_threads, void *(*func)(void*, int, void*), void *shared_d
 	pthread_mutex_init(&aux.mutex, 0);
 	pthread_cond_init(&aux.cv, 0);
 
-	aux.workers = (ktp_worker_t*)alloca(n_threads * sizeof(ktp_worker_t));
+	aux.workers = (ktp_worker_t*)calloc(n_threads, sizeof(ktp_worker_t));
 	for (i = 0; i < n_threads; ++i) {
 		ktp_worker_t *w = &aux.workers[i];
 		w->step = 0; w->pl = &aux; w->data = 0;
 		w->index = aux.index++;
 	}
 
-	tid = (pthread_t*)alloca(n_threads * sizeof(pthread_t));
+	tid = (pthread_t*)calloc(n_threads, sizeof(pthread_t));
 	for (i = 0; i < n_threads; ++i) pthread_create(&tid[i], 0, ktp_worker, &aux.workers[i]);
 	for (i = 0; i < n_threads; ++i) pthread_join(tid[i], 0);
+	free(tid); free(aux.workers);
 
 	pthread_mutex_destroy(&aux.mutex);
 	pthread_cond_destroy(&aux.cv);

main.c

@@ -1,36 +1,44 @@
-#include <getopt.h>
 #include <stdlib.h>
 #include <stdio.h>
 #include <string.h>
-#include <sys/resource.h>
-#include <sys/time.h>
 #include "bseq.h"
 #include "minimap.h"
 #include "mmpriv.h"
+#include "getopt.h"
 
-#define MM_VERSION "2.0rc1-r232"
+#define MM_VERSION "2.2-r409"
 
+#ifdef __linux__
+#include <sys/resource.h>
+#include <sys/time.h>
 void liftrlimit()
 {
-#ifdef __linux__
 	struct rlimit r;
 	getrlimit(RLIMIT_AS, &r);
 	r.rlim_cur = r.rlim_max;
 	setrlimit(RLIMIT_AS, &r);
-#endif
 }
+#else
+void liftrlimit() {}
+#endif
 
 static struct option long_options[] = {
 	{ "bucket-bits",    required_argument, 0, 0 },
 	{ "mb-size",        required_argument, 0, 'K' },
-	{ "int-rname",      no_argument,       0, 0 },
+	{ "int-rname",      no_argument,       0, 0 }, // obsolete; kept as a placeholder
 	{ "no-kalloc",      no_argument,       0, 0 },
 	{ "print-qname",    no_argument,       0, 0 },
 	{ "no-self",        no_argument,       0, 0 },
-	{ "print-seed",     no_argument,       0, 0 },
+	{ "print-seeds",    no_argument,       0, 0 },
 	{ "max-chain-skip", required_argument, 0, 0 },
 	{ "min-dp-len",     required_argument, 0, 0 },
 	{ "print-aln-seq",  no_argument,       0, 0 },
+	{ "splice",         no_argument,       0, 0 },
+	{ "cost-non-gt-ag", required_argument, 0, 0 },
+	{ "no-sam-sq",      no_argument,       0, 0 },
+	{ "approx-ext",     no_argument,       0, 0 },
+	{ "help",           no_argument,       0, 'h' },
+	{ "max-intron-len", required_argument, 0, 'G' },
 	{ "version",        no_argument,       0, 'V' },
 	{ "min-count",      required_argument, 0, 'n' },
 	{ "min-chain-score",required_argument, 0, 'm' },
@@ -40,34 +48,47 @@ static struct option long_options[] = {
 	{ 0, 0, 0, 0}
 };
 
+static inline int64_t mm_parse_num(const char *str)
+{
+	double x;
+	char *p;
+	x = strtod(optarg, &p);
+	if (*p == 'G' || *p == 'g') x *= 1e9;
+	else if (*p == 'M' || *p == 'm') x *= 1e6;
+	else if (*p == 'K' || *p == 'k') x *= 1e3;
+	return (int64_t)(x + .499);
+}
+
 int main(int argc, char *argv[])
 {
 	mm_mapopt_t opt;
-	int i, c, k = 15, w = -1, bucket_bits = MM_IDX_DEF_B, n_threads = 3, keep_name = 1, is_idx, is_hpc = 0, long_idx, idx_par_set = 0;
+	mm_idxopt_t ipt;
-	int minibatch_size = 200000000;
+	int i, c, n_threads = 3, long_idx, max_intron_len = 0;
-	uint64_t batch_size = 4000000000ULL;
+	char *fnw = 0, *rg = 0, *s;
-	mm_bseq_file_t *fp = 0;
+	FILE *fp_help = stderr;
-	char *fnw = 0, *s;
+	mm_idx_reader_t *idx_rdr;
-	FILE *fpr = 0, *fpw = 0;
+	mm_idx_t *mi;
 
+	mm_verbose = 3;
 	liftrlimit();
 	mm_realtime0 = realtime();
-	mm_mapopt_init(&opt);
+	mm_set_opt(0, &ipt, &opt);
 
-	while ((c = getopt_long(argc, argv, "aw:k:K:t:r:f:Vv:g:I:d:XT:s:x:Hcp:M:n:z:A:B:O:E:m:N:Q", long_options, &long_idx)) >= 0) {
+	while ((c = getopt_long(argc, argv, "aSw:k:K:t:r:f:Vv:g:G:I:d:XT:s:x:Hcp:M:n:z:A:B:O:E:m:N:Qu:R:h", long_options, &long_idx)) >= 0) {
-		if (c == 'w') w = atoi(optarg), idx_par_set = 1;
+		if (c == 'w') ipt.w = atoi(optarg);
-		else if (c == 'k') k = atoi(optarg), idx_par_set = 1;
+		else if (c == 'k') ipt.k = atoi(optarg);
-		else if (c == 'H') is_hpc = 1, idx_par_set = 1;
+		else if (c == 'H') ipt.is_hpc = 1;
 		else if (c == 'd') fnw = optarg; // the above are indexing related options, except -I
-		else if (c == 'r') opt.bw = atoi(optarg);
+		else if (c == 'r') opt.bw = (int)mm_parse_num(optarg);
-		else if (c == 'f') opt.mid_occ_frac = atof(optarg);
 		else if (c == 't') n_threads = atoi(optarg);
 		else if (c == 'v') mm_verbose = atoi(optarg);
-		else if (c == 'g') opt.max_gap = atoi(optarg);
+		else if (c == 'g') opt.max_gap = (int)mm_parse_num(optarg);
+		else if (c == 'G') max_intron_len = (int)mm_parse_num(optarg);
 		else if (c == 'N') opt.best_n = atoi(optarg);
 		else if (c == 'p') opt.pri_ratio = atof(optarg);
 		else if (c == 'M') opt.mask_level = atof(optarg);
-		else if (c == 'c') opt.flag |= MM_F_CIGAR;
+		else if (c == 'c') opt.flag |= MM_F_OUT_CG | MM_F_CIGAR;
+		else if (c == 'S') opt.flag |= MM_F_OUT_CS | MM_F_CIGAR;
 		else if (c == 'X') opt.flag |= MM_F_AVA | MM_F_NO_SELF;
 		else if (c == 'a') opt.flag |= MM_F_OUT_SAM | MM_F_CIGAR;
 		else if (c == 'Q') opt.flag |= MM_F_NO_QUAL;
@@ -78,8 +99,11 @@ int main(int argc, char *argv[])
 		else if (c == 'B') opt.b = atoi(optarg);
 		else if (c == 'z') opt.zdrop = atoi(optarg);
 		else if (c == 's') opt.min_dp_max = atoi(optarg);
-		else if (c == 0 && long_idx == 0) bucket_bits = atoi(optarg); // --bucket-bits
+		else if (c == 'I') ipt.batch_size = mm_parse_num(optarg);
-		else if (c == 0 && long_idx == 2) keep_name = 0; // --int-rname
+		else if (c == 'K') ipt.mini_batch_size = (int)mm_parse_num(optarg);
+		else if (c == 'R') rg = optarg;
+		else if (c == 'h') fp_help = stdout;
+		else if (c == 0 && long_idx == 0) ipt.bucket_bits = atoi(optarg); // --bucket-bits
 		else if (c == 0 && long_idx == 3) mm_dbg_flag |= MM_DBG_NO_KALLOC; // --no-kalloc
 		else if (c == 0 && long_idx == 4) mm_dbg_flag |= MM_DBG_PRINT_QNAME; // --print-qname
 		else if (c == 0 && long_idx == 5) opt.flag |= MM_F_NO_SELF; // --no-self
@@ -87,137 +111,120 @@ int main(int argc, char *argv[])
 		else if (c == 0 && long_idx == 7) opt.max_chain_skip = atoi(optarg); // --max-chain-skip
 		else if (c == 0 && long_idx == 8) opt.min_ksw_len = atoi(optarg); // --min-dp-len
 		else if (c == 0 && long_idx == 9) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_ALN_SEQ; // --print-aln-seq
+		else if (c == 0 && long_idx ==10) opt.flag |= MM_F_SPLICE; // --splice
+		else if (c == 0 && long_idx ==11) opt.noncan = atoi(optarg); // --cost-non-gt-ag
+		else if (c == 0 && long_idx ==12) opt.flag |= MM_F_NO_SAM_SQ; // --no-sam-sq
+		else if (c == 0 && long_idx ==13) opt.flag |= MM_F_APPROX_EXT; // --approx-ext
 		else if (c == 'V') {
 			puts(MM_VERSION);
 			return 0;
+		} else if (c == 'f') {
+			double x;
+			x = atof(optarg);
+			if (x < 1.0) opt.mid_occ_frac = x, opt.mid_occ = 0;
+			else opt.mid_occ = (int)(x + .499);
+		} else if (c == 'u') {
+			if (*optarg == 'b') opt.flag |= MM_F_SPLICE_FOR|MM_F_SPLICE_REV;
+			else if (*optarg == 'B') opt.flag |= MM_F_SPLICE_BOTH;
+			else if (*optarg == 'f') opt.flag |= MM_F_SPLICE_FOR, opt.flag &= ~MM_F_SPLICE_REV;
+			else if (*optarg == 'r') opt.flag |= MM_F_SPLICE_REV, opt.flag &= ~MM_F_SPLICE_FOR;
+			else if (*optarg == 'n') opt.flag &= ~(MM_F_SPLICE_FOR|MM_F_SPLICE_REV);
+			else {
+				fprintf(stderr, "[E::%s] unrecognized cDNA direction\n", __func__);
+				return 1;
+			}
 		} else if (c == 'O') {
 			opt.q = opt.q2 = strtol(optarg, &s, 10);
 			if (*s == ',') opt.q2 = strtol(s + 1, &s, 10);
 		} else if (c == 'E') {
 			opt.e = opt.e2 = strtol(optarg, &s, 10);
 			if (*s == ',') opt.e2 = strtol(s + 1, &s, 10);
-		} else if (c == 'I' || c == 'K') {
-			double x;
-			char *p;
-			x = strtod(optarg, &p);
-			if (*p == 'G' || *p == 'g') x *= 1e9;
-			else if (*p == 'M' || *p == 'm') x *= 1e6;
-			else if (*p == 'K' || *p == 'k') x *= 1e3;
-			if (c == 'I') batch_size = (uint64_t)(x + .499);
-			else minibatch_size = (uint64_t)(x + .499);
 		} else if (c == 'x') {
-			if (strcmp(optarg, "ava-ont") == 0) {
+			if (mm_set_opt(optarg, &ipt, &opt) < 0) {
-				opt.flag |= MM_F_AVA | MM_F_NO_SELF;
-				opt.min_chain_score = 100, opt.pri_ratio = 0.0f, opt.max_gap = 10000, opt.max_chain_skip = 25;
-				minibatch_size = 500000000;
-				k = 15, w = 5;
-			} else if (strcmp(optarg, "ava-pb") == 0) {
-				opt.flag |= MM_F_AVA | MM_F_NO_SELF;
-				opt.min_chain_score = 100, opt.pri_ratio = 0.0f, opt.max_gap = 10000, opt.max_chain_skip = 25;
-				minibatch_size = 500000000;
-				is_hpc = 1, k = 19, w = 5;
-			} else if (strcmp(optarg, "map10k") == 0 || strcmp(optarg, "map-pb") == 0) {
-				is_hpc = 1, k = 19;
-			} else if (strcmp(optarg, "map-ont") == 0) {
-				is_hpc = 0, k = 15;
-			} else if (strcmp(optarg, "asm5") == 0) {
-				k = 19, w = 19;
-				opt.a = 1, opt.b = 19, opt.q = 39, opt.q2 = 81, opt.e = 3, opt.e2 = 1, opt.zdrop = 200;
-				opt.min_dp_max = 200;
-			} else if (strcmp(optarg, "asm10") == 0) {
-				k = 19, w = 19;
-				opt.a = 1, opt.b = 9, opt.q = 16, opt.q2 = 41, opt.e = 2, opt.e2 = 1, opt.zdrop = 200;
-				opt.min_dp_max = 200;
-			} else {
 				fprintf(stderr, "[E::%s] unknown preset '%s'\n", __func__, optarg);
 				return 1;
 			}
 		}
 	}
-	if (w < 0) w = (int)(.6666667 * k + .499);
+	if ((opt.flag & MM_F_SPLICE) && max_intron_len > 0)
+		opt.max_gap_ref = opt.bw = max_intron_len;
 
-	if (argc == optind) {
+	if (argc == optind || fp_help == stdout) {
-		fprintf(stderr, "Usage: minimap2 [options] <target.fa>|<target.idx> [query.fa] [...]\n");
+		fprintf(fp_help, "Usage: minimap2 [options] <target.fa>|<target.idx> [query.fa] [...]\n");
-		fprintf(stderr, "Options:\n");
+		fprintf(fp_help, "Options:\n");
-		fprintf(stderr, "  Indexing:\n");
+		fprintf(fp_help, "  Indexing:\n");
-		fprintf(stderr, "    -H           use homopolymer-compressed k-mer\n");
+		fprintf(fp_help, "    -H           use homopolymer-compressed k-mer\n");
-		fprintf(stderr, "    -k INT       k-mer size (no larger than 28) [%d]\n", k);
+		fprintf(fp_help, "    -k INT       k-mer size (no larger than 28) [%d]\n", ipt.k);
-		fprintf(stderr, "    -w INT       minizer window size [{-k}*2/3]\n");
+		fprintf(fp_help, "    -w INT       minizer window size [%d]\n", ipt.w);
-		fprintf(stderr, "    -I NUM       split index for every ~NUM input bases [4G]\n");
+		fprintf(fp_help, "    -I NUM       split index for every ~NUM input bases [4G]\n");
-		fprintf(stderr, "    -d FILE      dump index to FILE []\n");
+		fprintf(fp_help, "    -d FILE      dump index to FILE []\n");
-		fprintf(stderr, "  Mapping:\n");
+		fprintf(fp_help, "  Mapping:\n");
-		fprintf(stderr, "    -f FLOAT     filter out top FLOAT fraction of repetitive minimizers [%g]\n", opt.mid_occ_frac);
+		fprintf(fp_help, "    -f FLOAT     filter out top FLOAT fraction of repetitive minimizers [%g]\n", opt.mid_occ_frac);
-		fprintf(stderr, "    -g INT       stop chain enlongation if there are no minimizers in INT-bp [%d]\n", opt.max_gap);
+		fprintf(fp_help, "    -g INT       stop chain enlongation if there are no minimizers in INT-bp [%d]\n", opt.max_gap);
-		fprintf(stderr, "    -r INT       bandwidth used in chaining and DP-based alignment [%d]\n", opt.bw);
+		fprintf(fp_help, "    -r INT       bandwidth used in chaining and DP-based alignment [%d]\n", opt.bw);
-		fprintf(stderr, "    -n INT       minimal number of minimizers on a chain [%d]\n", opt.min_cnt);
+		fprintf(fp_help, "    -n INT       minimal number of minimizers on a chain [%d]\n", opt.min_cnt);
-		fprintf(stderr, "    -m INT       minimal chaining score (matching bases minus log gap penalty) [%d]\n", opt.min_chain_score);
+		fprintf(fp_help, "    -m INT       minimal chaining score (matching bases minus log gap penalty) [%d]\n", opt.min_chain_score);
-//		fprintf(stderr, "    -T INT       SDUST threshold; 0 to disable SDUST [%d]\n", opt.sdust_thres); // TODO: this option is never used; might be buggy
+//		fprintf(fp_help, "    -T INT       SDUST threshold; 0 to disable SDUST [%d]\n", opt.sdust_thres); // TODO: this option is never used; might be buggy
-		fprintf(stderr, "    -X           skip self and dual mappings (for the all-vs-all mode)\n");
+		fprintf(fp_help, "    -X           skip self and dual mappings (for the all-vs-all mode)\n");
-		fprintf(stderr, "    -p FLOAT     min secondary-to-primary score ratio [%g]\n", opt.pri_ratio);
+		fprintf(fp_help, "    -p FLOAT     min secondary-to-primary score ratio [%g]\n", opt.pri_ratio);
-		fprintf(stderr, "    -N INT       retain at most INT secondary alignments [%d]\n", opt.best_n);
+		fprintf(fp_help, "    -N INT       retain at most INT secondary alignments [%d]\n", opt.best_n);
-		fprintf(stderr, "  Alignment:\n");
+		fprintf(fp_help, "    -G NUM       max intron length (only effective following -x splice) [200k]\n");
-		fprintf(stderr, "    -A INT       matching score [%d]\n", opt.a);
+		fprintf(fp_help, "  Alignment:\n");
-		fprintf(stderr, "    -B INT       mismatch penalty [%d]\n", opt.b);
+		fprintf(fp_help, "    -A INT       matching score [%d]\n", opt.a);
-		fprintf(stderr, "    -O INT[,INT] gap open penalty [%d,%d]\n", opt.q, opt.q2);
+		fprintf(fp_help, "    -B INT       mismatch penalty [%d]\n", opt.b);
-		fprintf(stderr, "    -E INT[,INT] gap extension penalty; a k-long gap costs min{O1+k*E1,O2+k*E2} [%d,%d]\n", opt.e, opt.e2);
+		fprintf(fp_help, "    -O INT[,INT] gap open penalty [%d,%d]\n", opt.q, opt.q2);
-		fprintf(stderr, "    -z INT       Z-drop score [%d]\n", opt.zdrop);
+		fprintf(fp_help, "    -E INT[,INT] gap extension penalty; a k-long gap costs min{O1+k*E1,O2+k*E2} [%d,%d]\n", opt.e, opt.e2);
-		fprintf(stderr, "    -s INT       minimal peak DP alignment score [%d]\n", opt.min_dp_max);
+		fprintf(fp_help, "    -z INT       Z-drop score [%d]\n", opt.zdrop);
-		fprintf(stderr, "  Input/Output:\n");
+		fprintf(fp_help, "    -s INT       minimal peak DP alignment score [%d]\n", opt.min_dp_max);
-		fprintf(stderr, "    -Q           ignore base quality in the input\n");
+		fprintf(fp_help, "    -u CHAR      how to find GT-AG. f:transcript strand, b:both strands, n:don't match GT-AG [n]\n");
-		fprintf(stderr, "    -a           output in the SAM format (PAF by default)\n");
+		fprintf(fp_help, "  Input/Output:\n");
-		fprintf(stderr, "    -c           output CIGAR in PAF\n");
+		fprintf(fp_help, "    -a           output in the SAM format (PAF by default)\n");
-		fprintf(stderr, "    -t INT       number of threads [%d]\n", n_threads);
+		fprintf(fp_help, "    -Q           don't output base quality in SAM\n");
-		fprintf(stderr, "    -K NUM       minibatch size [200M]\n");
+		fprintf(fp_help, "    -R STR       SAM read group line in a format like '@RG\\tID:foo\\tSM:bar' []\n");
-//		fprintf(stderr, "    -v INT       verbose level [%d]\n", mm_verbose);
+		fprintf(fp_help, "    -c           output CIGAR in PAF\n");
-		fprintf(stderr, "    -V           show version number\n");
+		fprintf(fp_help, "    -S           output the cs tag in PAF (cs encodes both query and ref sequences)\n");
-		fprintf(stderr, "  Preset:\n");
+		fprintf(fp_help, "    -t INT       number of threads [%d]\n", n_threads);
-		fprintf(stderr, "    -x STR       preset (recommended to be applied before other options) []\n");
+		fprintf(fp_help, "    -K NUM       minibatch size for mapping [200M]\n");
-		fprintf(stderr, "                 map10k/map-pb: -Hk19 (PacBio/ONT vs reference mapping)\n");
+//		fprintf(fp_help, "    -v INT       verbose level [%d]\n", mm_verbose);
-		fprintf(stderr, "                 map-ont: -k15 (slightly more sensitive than 'map10k' for ONT vs reference)\n");
+		fprintf(fp_help, "    --version    show version number\n");
-		fprintf(stderr, "                 asm5: -k19 -w19 -A1 -B19 -O39,81 -E3,1 -s200 -z200 (asm to ref mapping; break at 5%% div.)\n");
+		fprintf(fp_help, "  Preset:\n");
-		fprintf(stderr, "                 asm10: -k19 -w19 -A1 -B9 -O16,41 -E2,1 -s200 -z200 (asm to ref mapping; break at 10%% div.)\n");
+		fprintf(fp_help, "    -x STR       preset (recommended to be applied before other options) []\n");
-		fprintf(stderr, "                 ava-pb: -Hk19 -w5 -Xp0 -m100 -g10000 -K500m --max-chain-skip 25 (PacBio read overlap)\n");
+		fprintf(fp_help, "                 map10k/map-pb: -Hk19 (PacBio/ONT vs reference mapping)\n");
-		fprintf(stderr, "                 ava-ont: -k15 -w5 -Xp0 -m100 -g10000 -K500m --max-chain-skip 25 (ONT read overlap)\n");
+		fprintf(fp_help, "                 map-ont: -k15 (slightly more sensitive than 'map10k' for ONT vs reference)\n");
-		fprintf(stderr, "\nSee `man ./minimap2.1' for detailed description of command-line options.\n");
+		fprintf(fp_help, "                 asm5: -k19 -w19 -A1 -B19 -O39,81 -E3,1 -s200 -z200 (asm to ref mapping; break at 5%% div.)\n");
-		return 1;
+		fprintf(fp_help, "                 asm10: -k19 -w19 -A1 -B9 -O16,41 -E2,1 -s200 -z200 (asm to ref mapping; break at 10%% div.)\n");
+		fprintf(fp_help, "                 ava-pb: -Hk19 -w5 -Xp0 -m100 -g10000 -K500m --max-chain-skip 25 (PacBio read overlap)\n");
+		fprintf(fp_help, "                 ava-ont: -k15 -w5 -Xp0 -m100 -g10000 -K500m --max-chain-skip 25 (ONT read overlap)\n");
+		fprintf(fp_help, "                 splice: long-read spliced alignment (see minimap2.1 for details)\n");
+		fprintf(fp_help, "                 sr: short single-end reads without splicing (see minimap2.1 for details)\n");
+		fprintf(fp_help, "\nSee `man ./minimap2.1' for detailed description of command-line options.\n");
+		return fp_help == stdout? 0 : 1;
 	}
 
-	is_idx = mm_idx_is_idx(argv[optind]);
+	idx_rdr = mm_idx_reader_open(argv[optind], &ipt, fnw);
-	if (is_idx < 0) {
+	if (idx_rdr == 0) {
-		fprintf(stderr, "[E::%s] failed to open file '%s'\n", __func__, argv[optind]);
+		fprintf(stderr, "[ERROR] failed to open file '%s'\n", argv[optind]);
 		return 1;
 	}
-	if (is_idx) fpr = fopen(argv[optind], "rb");
+	if (!idx_rdr->is_idx && fnw == 0 && argc - optind < 2) {
-	else fp = mm_bseq_open(argv[optind]);
+		fprintf(stderr, "[ERROR] missing input: please specify a query file to map or option -d to keep the index\n");
-	if (fnw) fpw = fopen(fnw, "wb");
+		return 1;
-	for (;;) {
+	}
-		mm_idx_t *mi = 0;
+	if (opt.flag & MM_F_OUT_SAM)
-		if (fpr) {
+		mm_write_sam_hdr_no_SQ(rg, MM_VERSION, argc, argv);
-			mi = mm_idx_load(fpr);
+	while ((mi = mm_idx_reader_read(idx_rdr, n_threads)) != 0) {
-			if (idx_par_set && mm_verbose >= 2 && (mi->k != k || mi->w != w || mi->is_hpc != mi->is_hpc))
+		if (mm_verbose >= 2 && idx_rdr->n_parts > 1 && (opt.flag&MM_F_OUT_SAM) && !(opt.flag&MM_F_NO_SAM_SQ))
-				fprintf(stderr, "[W::%s::%.3f*%.2f] Indexing parameters on the command line (-k/-w/-H) overridden by parameters in the prebuilt index.\n",
+			fprintf(stderr, "[WARNING] \033[1;31mSAM output is malformated due to internal @SQ lines. Please add option --no-sam-sq or filter afterwards.\033[0m\n");
-						__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0));
-		} else if (!mm_bseq_eof(fp)) {
-			mi = mm_idx_gen(fp, w, k, bucket_bits, is_hpc, minibatch_size, n_threads, batch_size, keep_name);
-		}
-		if (mi == 0) break;
 		if (mm_verbose >= 3)
 			fprintf(stderr, "[M::%s::%.3f*%.2f] loaded/built the index for %d target sequence(s)\n",
 					__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), mi->n_seq);
-		if (fpw) {
-			mm_idx_dump(fpw, mi);
-			if (mm_verbose >= 3)
-				fprintf(stderr, "[M::%s::%.3f*%.2f] dumpped the (partial) index to disk\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0));
-		}
 		if (argc != optind + 1) mm_mapopt_update(&opt, mi);
 		if (mm_verbose >= 3) mm_idx_stat(mi);
 		for (i = optind + 1; i < argc; ++i)
-			mm_map_file(mi, argv[i], &opt, n_threads, minibatch_size);
+			mm_map_file(mi, argv[i], &opt, n_threads);
 		mm_idx_destroy(mi);
 	}
-	if (fpw) fclose(fpw);
+	mm_idx_reader_close(idx_rdr);
-	if (fpr) fclose(fpr);
-	if (fp)  mm_bseq_close(fp);
 
 	fprintf(stderr, "[M::%s] Version: %s\n", __func__, MM_VERSION);
 	fprintf(stderr, "[M::%s] CMD:", __func__);

map.c

@@ -11,7 +11,6 @@
 void mm_mapopt_init(mm_mapopt_t *opt)
 {
 	memset(opt, 0, sizeof(mm_mapopt_t));
-	opt->max_occ_frac = 1e-5f;
 	opt->mid_occ_frac = 2e-4f;
 	opt->sdust_thres = 0;
 
@@ -19,6 +18,7 @@ void mm_mapopt_init(mm_mapopt_t *opt)
 	opt->min_chain_score = 40;
 	opt->bw = 500;
 	opt->max_gap = 5000;
+	opt->max_gap_ref = -1;
 	opt->max_chain_skip = 25;
 
 	opt->mask_level = 0.5f;
@@ -33,19 +33,72 @@ void mm_mapopt_init(mm_mapopt_t *opt)
 	opt->zdrop = 400;
 	opt->min_dp_max = opt->min_chain_score * opt->a;
 	opt->min_ksw_len = 200;
+	opt->mini_batch_size = 200000000;
 }
 
 void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
 {
-	opt->max_occ = mm_idx_cal_max_occ(mi, opt->max_occ_frac);
+	if (opt->flag & MM_F_SPLICE_BOTH)
-	opt->mid_occ = mm_idx_cal_max_occ(mi, opt->mid_occ_frac);
+		opt->flag &= ~(MM_F_SPLICE_FOR|MM_F_SPLICE_REV);
+	if (opt->mid_occ <= 0)
+		opt->mid_occ = mm_idx_cal_max_occ(mi, opt->mid_occ_frac);
 	if (mm_verbose >= 3)
-		fprintf(stderr, "[M::%s::%.3f*%.2f] mid_occ = %d; max_occ = %d\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0),
+		fprintf(stderr, "[M::%s::%.3f*%.2f] mid_occ = %d\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), opt->mid_occ);
-				opt->mid_occ, opt->max_occ);
+}
+
+int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
+{
+	if (preset == 0) {
+		mm_idxopt_init(io);
+		mm_mapopt_init(mo);
+	} else if (strcmp(preset, "ava-ont") == 0) {
+		io->is_hpc = 0, io->k = 15, io->w = 5;
+		mo->flag |= MM_F_AVA | MM_F_NO_SELF;
+		mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_gap = 10000, mo->max_chain_skip = 25;
+		mo->mini_batch_size = 500000000;
+	} else if (strcmp(preset, "ava-pb") == 0) {
+		io->is_hpc = 1, io->k = 19, io->w = 5;
+		mo->flag |= MM_F_AVA | MM_F_NO_SELF;
+		mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_gap = 10000, mo->max_chain_skip = 25;
+		mo->mini_batch_size = 500000000;
+	} else if (strcmp(preset, "map10k") == 0 || strcmp(preset, "map-pb") == 0) {
+		io->is_hpc = 1, io->k = 19;
+	} else if (strcmp(preset, "map-ont") == 0) {
+		io->is_hpc = 0, io->k = 15;
+	} else if (strcmp(preset, "asm5") == 0) {
+		io->is_hpc = 0, io->k = 19, io->w = 19;
+		mo->a = 1, mo->b = 19, mo->q = 39, mo->q2 = 81, mo->e = 3, mo->e2 = 1, mo->zdrop = 200;
+		mo->min_dp_max = 200;
+	} else if (strcmp(preset, "asm10") == 0) {
+		io->is_hpc = 0, io->k = 19, io->w = 19;
+		mo->a = 1, mo->b = 9, mo->q = 16, mo->q2 = 41, mo->e = 2, mo->e2 = 1, mo->zdrop = 200;
+		mo->min_dp_max = 200;
+	} else if (strcmp(preset, "short") == 0 || strcmp(preset, "sr") == 0) {
+		io->is_hpc = 0, io->k = 21, io->w = 11;
+		mo->flag |= MM_F_APPROX_EXT;
+		mo->a = 2, mo->b = 8, mo->q = 12, mo->e = 2, mo->q2 = 32, mo->e2 = 1;
+		mo->max_gap = 100;
+		mo->pri_ratio = 0.5f;
+		mo->min_cnt = 2;
+		mo->min_chain_score = 20;
+		mo->min_dp_max = 40;
+		mo->best_n = 20;
+		mo->bw = 50;
+		mo->mid_occ = 1000;
+		mo->mini_batch_size = 50000000;
+	} else if (strcmp(preset, "splice") == 0 || strcmp(preset, "cdna") == 0) {
+		io->is_hpc = 0, io->k = 15, io->w = 5;
+		mo->flag |= MM_F_SPLICE | MM_F_SPLICE_FOR | MM_F_SPLICE_REV;
+		mo->max_gap = 2000, mo->max_gap_ref = mo->bw = 200000;
+		mo->a = 1, mo->b = 2, mo->q = 2, mo->e = 1, mo->q2 = 32, mo->e2 = 0;
+		mo->noncan = 5;
+		mo->zdrop = 200;
+	} else return -1;
+	return 0;
 }
 
 typedef struct {
-	uint32_t n:31, is_alloc:1;
+	uint32_t n;
 	uint32_t qpos;
 	union {
 		const uint64_t *cr;
@@ -99,151 +152,88 @@ static void mm_dust_minier(mm128_v *mini, int l_seq, const char *seq, int sdust_
 	}
 	mini->n = k;
 }
-#if 0
-int mm_pair_thin_core(mm_tbuf_t *b, uint64_t x, int radius, int rel, int st0, int n, const uint64_t *z, uint64_v *a)
-{
-	int i, st = st0, en = n, mid = en - 1;
-	while (st < en) {
-		uint64_t y;
-		mid = st + ((en - st) >> 1);
-		y = z[mid];
-		if (y < x && (x - y)>>1 > radius) st = mid + 1;
-		else if (y >= x && (y - x)>>1 > radius) en = mid;
-		else break;
-	}
-	if (st < en) {
-		for (en = mid + 1; en < n; ++en)
-			if (z[en] > x && (z[en] - x)>>1 > radius)
-				break;
-		for (st = mid - 1; st >= st0; --st)
-			if (z[st] < x && (x - z[st])>>1 > radius)
-				break;
-		++st;
-		for (i = st; i < en; ++i) {
-			uint64_t y = z[i];
-			if (((x ^ y) & 1) == rel) {
-//				printf("* %d,%d\n", (uint32_t)x>>1, (uint32_t)y>>1);
-				kv_push(uint64_t, b->km, *a, y);
-			}
-		}
-		return en;
-	} else return st < n && z[st] < x? st + 1 : en;
-}
 
-void mm_pair_thin(mm_tbuf_t *b, int radius, mm_match_t *m1, mm_match_t *m2)
+mm_reg1_t *mm_map(const mm_idx_t *mi, int qlen, const char *seq, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname)
 {
-	mm_match_t *m[2];
+	int i, n, j, n_u, max_gap_ref, rep_st = 0, rep_en = 0, rep_len = 0;
-	const uint64_t *z[2];
-	uint64_v a[2];
-	int i, n[2], k[2], u = 0, rel = (m1->qpos ^ m2->qpos) & 1;
-
-	m[0] = m1, m[1] = m2;
-	for (i = 0; i < 2; ++i) {
-		n[i] = m[i]->n;
-		z[i] = m[i]->x.cr;
-		k[i] = 0;
-		kv_init(a[i]);
-		kv_resize(uint64_t, b->km, a[i], 256);
-	}
-	while (k[0] < n[0] && k[1] < n[1]) {
-		//printf("%d; %d,%d\n", u, k[0], k[1]);
-		int v = u^1, dist = (int)(m[v]->qpos>>1) - (int)(m[u]->qpos>>1);
-		uint64_t x = z[u][k[u]];
-		int uori = (x ^ m[u]->qpos) & 1, last;
-		int64_t tpos = x>>1 & 0x7fffffff;
-		tpos = uori == 0? tpos + dist : tpos - dist;
-		if (tpos < 0) tpos = 0;
-		x = x>>32<<32 | tpos<<1 | (x&1);
-		last = a[v].n;
-		k[v] = mm_pair_thin_core(b, x, radius, rel, k[v], n[v], z[v], &a[v]);
-		if (a[v].n > last) kv_push(uint64_t, b->km, a[u], z[u][k[u]]);
-		++k[u];
-		u ^= 1;
-	}
-	for (i = 0; i < 2; ++i)
-		m[i]->n = a[i].n, m[i]->x.r = a[i].a, m[i]->is_alloc = 1;
-//	printf("%d,%d; %d,%d\n", m[0]->qpos>>1, m[1]->qpos>>1, m[0]->n, m[1]->n);
-}
-#endif
-mm_reg1_t *mm_map_frag(const mm_mapopt_t *opt, const mm_idx_t *mi, mm_tbuf_t *b, uint32_t m_st, uint32_t m_en, const char *qname, int qlen, const char *seq, int *n_regs)
-{
-	int i, n = m_en - m_st, j, n_u;
 	int64_t n_a;
 	uint64_t *u;
 	mm_match_t *m;
 	mm128_t *a;
 	mm_reg1_t *regs;
 
+	// collect minimizers
+	b->mini.n = 0;
+	mm_sketch(b->km, seq, qlen, mi->w, mi->k, 0, mi->is_hpc, &b->mini);
+	n = b->mini.n;
+
+	if (opt->sdust_thres > 0)
+		mm_dust_minier(&b->mini, qlen, seq, opt->sdust_thres, b->sdb);
+
 	// convert to local representation
 	m = (mm_match_t*)kmalloc(b->km, n * sizeof(mm_match_t));
 	for (i = 0; i < n; ++i) {
 		int t;
-		mm128_t *p = &b->mini.a[i + m_st];
+		mm128_t *p = &b->mini.a[i];
-		m[i].is_alloc = 0;
 		m[i].qpos = (uint32_t)p->y;
 		m[i].x.cr = mm_idx_get(mi, p->x>>8, &t);
 		m[i].n = t;
 	}
-#if 0
+
-	int last = -1, last2 = -1;
-	// pair k-mer thinning
-	for (i = 0; i < n; ++i) {
-		if (m[i].n >= opt->mid_occ && m[i].n < opt->max_occ) {
-			if (last2 < 0) last2 = i;
-			if (last < 0 || m[last].n < m[i].n) last = i;
-			if (last >= 0 && (m[last].qpos>>1) + (m[last].span>>1) <= m[i].qpos>>1) {
-				mm_pair_thin(b, opt->bw, &m[last], &m[i]);
-				last2 = last = -1;
-			} else if (last2 >= 0 && (m[last2].qpos>>1) + (m[last2].span>>1) <= m[i].qpos>>1) {
-				mm_pair_thin(b, opt->bw, &m[last2], &m[i]);
-				last2 = last = -1;
-			}
-		}
-	}
-#endif
 	// fill the _a_ array
 	for (i = 0, n_a = 0; i < n; ++i) // find the length of a[]
 		if (m[i].n < opt->mid_occ) n_a += m[i].n;
 	a = (mm128_t*)kmalloc(b->km, n_a * sizeof(mm128_t));
 	for (i = j = 0; i < n; ++i) {
-		mm128_t *p = &b->mini.a[i + m_st];
+		mm128_t *p = &b->mini.a[i];
 		mm_match_t *q = &m[i];
 		const uint64_t *r = q->x.cr;
 		int k, q_span = p->x & 0xff, is_tandem = 0;
-		if (q->n >= opt->mid_occ) continue;
+		if (q->n >= opt->mid_occ) {
-		if (i > 0 && p->x>>8 == b->mini.a[m_st + i - 1].x>>8) is_tandem = 1;
+			int en = (q->qpos>>1) + 1, st = en - q_span;
-		if (i < n - 1 && p->x>>8 == b->mini.a[m_st + i + 1].x>>8) is_tandem = 1;
+			if (st > rep_en) {
+				rep_len += rep_en - rep_st;
+				rep_st = st, rep_en = en;
+			} else rep_en = en;
+			continue;
+		}
+		if (i > 0 && p->x>>8 == b->mini.a[i - 1].x>>8) is_tandem = 1;
+		if (i < n - 1 && p->x>>8 == b->mini.a[i + 1].x>>8) is_tandem = 1;
 		for (k = 0; k < q->n; ++k) {
-			const char *tname = mi->seq[r[k]>>32].name;
 			int32_t rpos = (uint32_t)r[k] >> 1;
 			mm128_t *p;
-			if (qname && (opt->flag&MM_F_NO_SELF) && strcmp(qname, tname) == 0 && rpos == (q->qpos>>1)) // avoid the diagonal
+			if (qname && (opt->flag&(MM_F_NO_SELF|MM_F_AVA))) {
-				continue;
+				const char *tname = mi->seq[r[k]>>32].name;
-			if (qname && (opt->flag&MM_F_AVA) && strcmp(qname, tname) > 0) // all-vs-all mode: map once
+				if ((opt->flag&MM_F_NO_SELF) && strcmp(qname, tname) == 0 && rpos == (q->qpos>>1)) // avoid the diagonal
-				continue;
+					continue;
+				if ((opt->flag&MM_F_AVA) && strcmp(qname, tname) > 0) // all-vs-all mode: map once
+					continue;
+			}
 			p = &a[j++];
 			if ((r[k]&1) == (q->qpos&1)) { // forward strand
-				p->x = (r[k]&0xffffffff00000000ULL) | (uint32_t)r[k]>>1;
+				p->x = (r[k]&0xffffffff00000000ULL) | rpos;
 				p->y = (uint64_t)q_span << 32 | q->qpos >> 1;
 			} else { // reverse strand
-				p->x = 1ULL<<63 | (r[k]&0xffffffff00000000ULL) | (uint32_t)r[k]>>1;
+				p->x = 1ULL<<63 | (r[k]&0xffffffff00000000ULL) | rpos;
 				p->y = (uint64_t)q_span << 32 | (qlen - ((q->qpos>>1) + 1 - q_span) - 1);
 			}
 			if (is_tandem) p->y |= MM_SEED_TANDEM;
 		}
 	}
+	rep_len += rep_en - rep_st;
 	n_a = j;
 	radix_sort_128x(a, a + n_a);
-	for (i = 0; i < n; ++i)
-		if (m[i].is_alloc) kfree(b->km, m[i].x.r);
 	kfree(b->km, m);
 
-	if (mm_dbg_flag & MM_DBG_PRINT_SEED)
+	if (mm_dbg_flag & MM_DBG_PRINT_SEED) {
+		fprintf(stderr, "RS\t%d\n", rep_len);
 		for (i = 0; i < n_a; ++i)
 			fprintf(stderr, "SD\t%s\t%d\t%c\t%d\t%d\t%d\n", mi->seq[a[i].x<<1>>33].name, (int32_t)a[i].x, "+-"[a[i].x>>63], (int32_t)a[i].y, (int32_t)(a[i].y>>32&0xff),
 					i == 0? 0 : ((int32_t)a[i].y - (int32_t)a[i-1].y) - ((int32_t)a[i].x - (int32_t)a[i-1].x));
+	}
 
-	n_u = mm_chain_dp(opt->max_gap, opt->bw, opt->max_chain_skip, opt->min_cnt, opt->min_chain_score, n_a, a, &u, b->km);
+	max_gap_ref = opt->max_gap_ref >= 0? opt->max_gap_ref : opt->max_gap;
+	n_u = mm_chain_dp(max_gap_ref, opt->max_gap, opt->bw, opt->max_chain_skip, opt->min_cnt, opt->min_chain_score, !!(opt->flag&MM_F_SPLICE), n_a, a, &u, b->km);
 	regs = mm_gen_regs(b->km, qlen, n_u, u, a);
 	*n_regs = n_u;
 
@@ -254,19 +244,20 @@ mm_reg1_t *mm_map_frag(const mm_mapopt_t *opt, const mm_idx_t *mi, mm_tbuf_t *b,
 						i == regs[j].as? 0 : ((int32_t)a[i].y - (int32_t)a[i-1].y) - ((int32_t)a[i].x - (int32_t)a[i-1].x));
 
 	if (!(opt->flag & MM_F_AVA)) { // don't choose primary mapping(s) for read overlap
-		mm_set_parent(b->km, opt->mask_level, *n_regs, regs);
+		mm_set_parent(b->km, opt->mask_level, *n_regs, regs, opt->a * 2 + opt->b);
 		mm_select_sub(b->km, opt->mask_level, opt->pri_ratio, mi->k*2, opt->best_n, n_regs, regs);
-		mm_join_long(b->km, opt, qlen, n_regs, regs, a); // TODO: this can be applied to all-vs-all in principle
+		if (!(opt->flag & MM_F_SPLICE))
+			mm_join_long(b->km, opt, qlen, n_regs, regs, a); // TODO: this can be applied to all-vs-all in principle
 	}
 	if (opt->flag & MM_F_CIGAR) {
 		regs = mm_align_skeleton(b->km, opt, mi, qlen, seq, n_regs, regs, a); // this calls mm_filter_regs()
 		if (!(opt->flag & MM_F_AVA)) {
-			mm_set_parent(b->km, opt->mask_level, *n_regs, regs);
+			mm_set_parent(b->km, opt->mask_level, *n_regs, regs, opt->a * 2 + opt->b);
 			mm_select_sub(b->km, opt->mask_level, opt->pri_ratio, mi->k*2, opt->best_n, n_regs, regs);
 			mm_set_sam_pri(*n_regs, regs);
 		}
 	}
-	mm_set_mapq(*n_regs, regs, opt->min_chain_score);
+	mm_set_mapq(*n_regs, regs, opt->min_chain_score, opt->a, rep_len);
 
 	// free
 	kfree(b->km, a);
@@ -274,17 +265,6 @@ mm_reg1_t *mm_map_frag(const mm_mapopt_t *opt, const mm_idx_t *mi, mm_tbuf_t *b,
 	return regs;
 }
 
-mm_reg1_t *mm_map(const mm_idx_t *mi, int l_seq, const char *seq, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname)
-{
-	mm_reg1_t *regs;
-	b->mini.n = 0;
-	mm_sketch(b->km, seq, l_seq, mi->w, mi->k, 0, mi->is_hpc, &b->mini);
-	if (opt->sdust_thres > 0)
-		mm_dust_minier(&b->mini, l_seq, seq, opt->sdust_thres, b->sdb);
-	regs = mm_map_frag(opt, mi, b, 0, b->mini.n, qname, l_seq, seq, n_regs);
-	return regs;
-}
-
 /**************************
  * Multi-threaded mapping *
  **************************/
@@ -338,16 +318,20 @@ static void *worker_pipeline(void *shared, int step, void *in)
 		kt_for(p->n_threads, worker_for, in, ((step_t*)in)->n_seq);
 		return in;
     } else if (step == 2) { // step 2: output
+		void *km = 0;
         step_t *s = (step_t*)in;
 		const mm_idx_t *mi = p->mi;
 		for (i = 0; i < p->n_threads; ++i) mm_tbuf_destroy(s->buf[i]);
 		free(s->buf);
+		if ((p->opt->flag & MM_F_OUT_CS) && !(mm_dbg_flag & MM_DBG_NO_KALLOC)) km = km_init();
 		for (i = 0; i < s->n_seq; ++i) {
 			mm_bseq1_t *t = &s->seq[i];
 			for (j = 0; j < s->n_reg[i]; ++j) {
 				mm_reg1_t *r = &s->reg[i][j];
-				if (p->opt->flag & MM_F_OUT_SAM) mm_write_sam(&p->str, mi, t, r, s->n_reg[i], s->reg[i]);
+				if (p->opt->flag & MM_F_OUT_SAM)
-				else mm_write_paf(&p->str, mi, t, r);
+					mm_write_sam(&p->str, mi, t, r, s->n_reg[i], s->reg[i]);
+				else
+					mm_write_paf(&p->str, mi, t, r, km, p->opt->flag);
 				puts(p->str.s);
 			}
 			if (s->n_reg[i] == 0 && (p->opt->flag & MM_F_OUT_SAM)) {
@@ -360,6 +344,7 @@ static void *worker_pipeline(void *shared, int step, void *in)
 			if (s->seq[i].qual) free(s->seq[i].qual);
 		}
 		free(s->reg); free(s->n_reg); free(s->seq);
+		km_destroy(km);
 		if (mm_verbose >= 3)
 			fprintf(stderr, "[M::%s::%.3f*%.2f] mapped %d sequences\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), s->n_seq);
 		free(s);
@@ -367,19 +352,20 @@ static void *worker_pipeline(void *shared, int step, void *in)
     return 0;
 }
 
-int mm_map_file(const mm_idx_t *idx, const char *fn, const mm_mapopt_t *opt, int n_threads, int mini_batch_size)
+int mm_map_file(const mm_idx_t *idx, const char *fn, const mm_mapopt_t *opt, int n_threads)
 {
 	pipeline_t pl;
 	memset(&pl, 0, sizeof(pipeline_t));
 	pl.fp = mm_bseq_open(fn);
-	if (pl.fp == 0) return -1;
+	if (pl.fp == 0) {
-	pl.opt = opt, pl.mi = idx;
+		if (mm_verbose >= 1)
-	pl.n_threads = n_threads, pl.mini_batch_size = mini_batch_size;
+			fprintf(stderr, "ERROR: failed to open file '%s'\n", fn);
-	if (opt->flag & MM_F_OUT_SAM) {
+		return -1;
-		uint32_t i;
-		for (i = 0; i < idx->n_seq; ++i)
-			printf("@SQ\tSN:%s\tLN:%d\n", idx->seq[i].name, idx->seq[i].len);
 	}
+	pl.opt = opt, pl.mi = idx;
+	pl.n_threads = n_threads, pl.mini_batch_size = opt->mini_batch_size;
+	if ((opt->flag & MM_F_OUT_SAM) && !(opt->flag & MM_F_NO_SAM_SQ))
+		mm_write_sam_SQ(idx);
 	kt_pipeline(n_threads == 1? 1 : 2, worker_pipeline, &pl, 3);
 	free(pl.str.s);
 	mm_bseq_close(pl.fp);

minimap.h

@@ -5,13 +5,19 @@
 #include <stdio.h>
 #include <sys/types.h>
 
-#define MM_IDX_DEF_B    14
+#define MM_F_NO_SELF     0x001
-
+#define MM_F_AVA         0x002
-#define MM_F_NO_SELF   0x01
+#define MM_F_CIGAR       0x004
-#define MM_F_AVA       0x02
+#define MM_F_OUT_SAM     0x008
-#define MM_F_CIGAR     0x04
+#define MM_F_NO_QUAL     0x010
-#define MM_F_OUT_SAM   0x08
+#define MM_F_OUT_CG      0x020
-#define MM_F_NO_QUAL   0x10
+#define MM_F_OUT_CS      0x040
+#define MM_F_SPLICE      0x080
+#define MM_F_SPLICE_FOR  0x100
+#define MM_F_SPLICE_REV  0x200
+#define MM_F_SPLICE_BOTH 0x400
+#define MM_F_NO_SAM_SQ   0x800
+#define MM_F_APPROX_EXT  0x1000
 
 #define MM_IDX_MAGIC   "MMI\2"
 
@@ -19,21 +25,11 @@
 extern "C" {
 #endif
 
-typedef struct {
+// emulate 128-bit integers and arrays
- 	uint64_t x, y;
+typedef struct { uint64_t x, y; } mm128_t;
-} mm128_t;
-
 typedef struct { size_t n, m; mm128_t *a; } mm128_v;
-typedef struct { size_t n, m; uint64_t *a; } uint64_v;
-typedef struct { size_t n, m; uint32_t *a; } uint32_v;
-
-typedef struct {
-	mm128_v a;   // (minimizer, position) array
-	int32_t n;   // size of the _p_ array
-	uint64_t *p; // position array for minimizers appearing >1 times
-	void *h;     // hash table indexing _p_ and minimizers appearing once
-} mm_idx_bucket_t;
 
+// minimap2 index
 typedef struct {
 	char *name;      // name of the db sequence
 	uint64_t offset; // offset in mm_idx_t::S
@@ -42,101 +38,216 @@ typedef struct {
 
 typedef struct {
 	int32_t b, w, k, is_hpc;
-	uint32_t n_seq;     // number of reference sequences
+	uint32_t n_seq;            // number of reference sequences
-	mm_idx_seq_t *seq;  // sequence name, length and offset
+	mm_idx_seq_t *seq;         // sequence name, length and offset
-	uint32_t *S;        // 4-bit packed sequence
+	uint32_t *S;               // 4-bit packed sequence
-	mm_idx_bucket_t *B; // index
+	struct mm_idx_bucket_s *B; // index (hidden)
 	void *km;
 } mm_idx_t;
 
+// minimap2 alignment
 typedef struct {
-	uint32_t capacity;
+	uint32_t capacity;                  // the capacity of cigar[]
-	int32_t dp_score, dp_max, dp_max2;
+	int32_t dp_score, dp_max, dp_max2;  // DP score; score of the max-scoring segment; score of the best alternate mappings
-	uint32_t blen;
+	uint32_t blen;                      // block length
-	uint32_t n_diff, n_ambi;
+	uint32_t n_diff;                    // number of differences, including ambiguous bases
-	uint32_t n_cigar;
+	uint32_t n_ambi:30, trans_strand:2; // number of ambiguous bases; transcript strand: 0 for unknown, 1 for +, 2 for -
+	uint32_t n_cigar;                   // number of cigar operations in cigar[]
 	uint32_t cigar[];
 } mm_extra_t;
 
 typedef struct {
-	int32_t id;
+	int32_t id;                     // ID for internal uses (see also parent below)
-	uint32_t cnt:31, rev:1;
+	uint32_t cnt:31, rev:1;         // number of minimizers; if on the reverse strand
-	uint32_t rid:31, inv:1;
+	uint32_t rid:31, inv:1;         // reference index; if this is an alignment from inversion rescue
-	int32_t score;
+	int32_t score;                  // DP alignment score
-	int32_t qs, qe, rs, re;
+	int32_t qs, qe, rs, re;         // query start and end; reference start and end
-	int32_t parent, subsc;
+	int32_t parent, subsc;          // parent==id if primary; best alternate mapping score
-	int32_t as;
+	int32_t as;                     // offset in the a[] array (for internal uses only)
-	int32_t fuzzy_mlen, fuzzy_blen;
+	int32_t fuzzy_mlen, fuzzy_blen; // seeded exact match length; seeded alignment block length (approximate)
-	uint32_t mapq:8, split:2, sam_pri:1, n_sub:21; // TODO: n_sub is not used for now
+	uint32_t mapq:8, split:2, sam_pri:1, n_sub:21; // mapQ; split pattern; if SAM primary; number of suboptimal mappings
 	mm_extra_t *p;
 } mm_reg1_t;
 
+// indexing and mapping options
 typedef struct {
-	float max_occ_frac;
+	short k, w, is_hpc, bucket_bits;
-	float mid_occ_frac;
+	int mini_batch_size;
-	int sdust_thres;  // score threshold for SDUST; 0 to disable
+	uint64_t batch_size;
-	int flag;    // see MM_F_* macros
+} mm_idxopt_t;
 
-	int bw;  // bandwidth
+typedef struct {
-	int max_gap; // break a chain if there are no minimizers in a max_gap window
+	int sdust_thres; // score threshold for SDUST; 0 to disable
+	int flag;        // see MM_F_* macros
+
+	int bw;          // bandwidth
+	int max_gap, max_gap_ref; // break a chain if there are no minimizers in a max_gap window
 	int max_chain_skip;
-	int min_cnt;
+	int min_cnt;         // min number of minimizers on each chain
-	int min_chain_score;
+	int min_chain_score; // min chaining score
 
 	float mask_level;
 	float pri_ratio;
-	int best_n;
+	int best_n;      // top best_n chains are subjected to DP alignment
 
 	int max_join_long, max_join_short;
 	int min_join_flank_sc;
 
 	int a, b, q, e, q2, e2; // matching score, mismatch, gap-open and gap-ext penalties
-	int zdrop;
+	int noncan;      // cost of non-canonical splicing sites
-	int min_dp_max;
+	int zdrop;       // break alignment if alignment score drops too fast along the diagonal
+	int min_dp_max;  // drop an alignment if the score of the max scoring segment is below this threshold
 	int min_ksw_len;
 
-	int max_occ;
+	float mid_occ_frac;  // only used by mm_mapopt_update(); see below
-	int mid_occ;
+	int32_t mid_occ;     // ignore seeds with occurrences above this threshold
+	int mini_batch_size; // size of a batch of query bases to process in parallel
 } mm_mapopt_t;
 
-extern int mm_verbose, mm_dbg_flag;
+// index reader
-extern double mm_realtime0;
+typedef struct {
+	int is_idx, n_parts;
+	mm_idxopt_t opt;
+	FILE *fp_out;
+	union {
+		struct mm_bseq_file_s *seq;
+		FILE *idx;
+	} fp;
+} mm_idx_reader_t;
 
-struct mm_tbuf_s;
+// memory buffer for thread-local storage during mapping
 typedef struct mm_tbuf_s mm_tbuf_t;
 
-struct mm_bseq_file_s;
+// global variables
+extern int mm_verbose, mm_dbg_flag; // verbose level: 0 for no info, 1 for error, 2 for warning, 3 for message (default); debugging flag
+extern double mm_realtime0; // wall-clock timer
 
-#define mm_seq4_set(s, i, c) ((s)[(i)>>3] |= (uint32_t)(c) << (((i)&7)<<2))
+/**
-#define mm_seq4_get(s, i)    ((s)[(i)>>3] >> (((i)&7)<<2) & 0xf)
+ * Set default or preset parameters
+ *
+ * @param preset     NULL to set all parameters as default; otherwise apply preset to affected parameters
+ * @param io         pointer to indexing parameters
+ * @param mo         pointer to mapping parameters
+ *
+ * @return 0 if success; -1 if _present_ unknown
+ */
+int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo);
 
-// compute minimizers
+/**
-void mm_sketch(void *km, const char *str, int len, int w, int k, uint32_t rid, int is_hpc, mm128_v *p);
+ * Update mm_mapopt_t::mid_occ via mm_mapopt_t::mid_occ_frac
-
+ *
-// minimizer indexing
+ * If mm_mapopt_t::mid_occ is 0, this function sets it to a number such that no
-mm_idx_t *mm_idx_init(int w, int k, int b, int is_hpc);
+ * more than mm_mapopt_t::mid_occ_frac of minimizers in the index have a higher
-void mm_idx_destroy(mm_idx_t *mi);
+ * occurrence.
-mm_idx_t *mm_idx_gen(struct mm_bseq_file_s *fp, int w, int k, int b, int is_hpc, int mini_batch_size, int n_threads, uint64_t batch_size, int keep_name);
+ *
-uint32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f);
+ * @param opt        mapping parameters
-void mm_idx_stat(const mm_idx_t *idx);
+ * @param mi         minimap2 index
-const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n);
+ */
-int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq);
-
-mm_idx_t *mm_idx_build(const char *fn, int w, int k, int is_hpc, int n_threads);
-int mm_idx_is_idx(const char *fn);
-
-// minimizer index I/O
-void mm_idx_dump(FILE *fp, const mm_idx_t *mi);
-mm_idx_t *mm_idx_load(FILE *fp);
-
-// mapping
-void mm_mapopt_init(mm_mapopt_t *opt);
 void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi);
+
+/**
+ * Initialize an index reader
+ *
+ * @param fn         index or fasta/fastq file name (this function tests the file type)
+ * @param opt        indexing parameters
+ * @param fn_out     if not NULL, write built index to this file
+ *
+ * @return an index reader on success; NULL if fail to open _fn_
+ */
+mm_idx_reader_t *mm_idx_reader_open(const char *fn, const mm_idxopt_t *opt, const char *fn_out);
+
+/**
+ * Read/build an index
+ *
+ * If the input file is an index file, this function reads one part of the
+ * index and returns. If the input file is a sequence file (fasta or fastq),
+ * this function constructs the index for about mm_idxopt_t::batch_size bases.
+ * Importantly, for a huge collection of sequences, this function may only
+ * return an index for part of sequences. It needs to be repeatedly called
+ * to traverse the entire index/sequence file.
+ *
+ * @param r          index reader
+ * @param n_threads  number of threads for constructing index
+ *
+ * @return an index on success; NULL if reaching the end of the input file
+ */
+mm_idx_t *mm_idx_reader_read(mm_idx_reader_t *r, int n_threads);
+
+/**
+ * Destroy/deallocate an index reader
+ *
+ * @param r          index reader
+ */
+void mm_idx_reader_close(mm_idx_reader_t *r);
+
+/**
+ * Print index statistics to stderr
+ *
+ * @param mi         minimap2 index
+ */
+void mm_idx_stat(const mm_idx_t *idx);
+
+/**
+ * Destroy/deallocate an index
+ *
+ * @param r          minimap2 index
+ */
+void mm_idx_destroy(mm_idx_t *mi);
+
+/**
+ * Initialize a thread-local buffer for mapping
+ *
+ * Each mapping thread requires a buffer specific to the thread (see mm_map()
+ * below). The primary purpose of this buffer is to reduce frequent heap
+ * allocations across threads. A buffer shall not be used by two or more
+ * threads.
+ *
+ * @return pointer to a thread-local buffer
+ */
 mm_tbuf_t *mm_tbuf_init(void);
+
+/**
+ * Destroy/deallocate a thread-local buffer for mapping
+ *
+ * @param b          the buffer
+ */
 void mm_tbuf_destroy(mm_tbuf_t *b);
+
+/**
+ * Align a query sequence against an index
+ *
+ * This function possibly finds multiple alignments of the query sequence.
+ * The returned array and the mm_reg1_t::p field of each element are allocated
+ * with malloc().
+ *
+ * @param mi         minimap2 index
+ * @param l_seq      length of the query sequence
+ * @param seq        the query sequence
+ * @param n_regs     number of hits (out)
+ * @param b          thread-local buffer; two mm_map() calls shall not use one buffer at the same time!
+ * @param opt        mapping parameters
+ * @param name       query name, used for all-vs-all overlapping and debugging
+ *
+ * @return an array of hits which need to be deallocated with free() together
+ *         with mm_reg1_t::p of each element. The size is written to _n_regs_.
+ */
 mm_reg1_t *mm_map(const mm_idx_t *mi, int l_seq, const char *seq, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *name);
 
-int mm_map_file(const mm_idx_t *idx, const char *fn, const mm_mapopt_t *opt, int n_threads, int tbatch_size);
+/**
+ * Align a fasta/fastq file and print alignments to stdout
+ *
+ * @param idx        minimap2 index
+ * @param fn         fasta/fastq file name
+ * @param opt        mapping parameters
+ * @param n_threads  number of threads
+ *
+ * @return 0 on success; -1 if _fn_ can't be read
+ */
+int mm_map_file(const mm_idx_t *idx, const char *fn, const mm_mapopt_t *opt, int n_threads);
+
+// deprecated APIs for backward compatibility
+void mm_mapopt_init(mm_mapopt_t *opt);
+mm_idx_t *mm_idx_build(const char *fn, int w, int k, int is_hpc, int n_threads);
 
 #ifdef __cplusplus
 }

minimap2.1

@@ -1,4 +1,4 @@
-.TH minimap2 1 "30 July 2017" "minimap2-2.0rc1-r232" "Bioinformatics tools"
+.TH minimap2 1 "17 September 2017" "minimap2-2.2 (r409)" "Bioinformatics tools"
 .SH NAME
 .PP
 minimap2 - mapping and alignment between collections of DNA sequences
@@ -162,6 +162,12 @@ secondary alignments [5]. This option has no effect when
 .B -X
 is applied.
 .TP
+.BI -G \ NUM
+Maximal intron length in the splice mode [200k]. This option also changes the
+bandwidth to
+.IR NUM .
+Increasing this option slows down spliced alignment.
+.TP
 .BI --max-chain-skip \ INT
 A heuristics that stops chaining early [50]. Minimap2 uses dynamic programming
 for chaining. The time complexity is quadratic in the number of seeds. This
@@ -199,15 +205,32 @@ the contiguity of the alignment at the cost of poor alignment in the middle
 Minimal peak DP alignment score to output [40]. The peak score is computed from
 the final CIGAR. It is the score of the max scoring segment in the alignment
 and may be different from the total alignment score.
+.TP
+.BI -u \ CHAR
+How to find canonical splicing sites GT-AG -
+.BR f :
+transcript strand;
+.BR b :
+both strands;
+.BR n :
+no attempt to match GT-AG [n]
+.TP
+.BI --cost-non-gt-ag \ INT
+Cost of non-canonical splicing sites [0].
 .SS Input/output options
 .TP 10
-.B -Q
-Ignore base quality in the input file.
-.TP
 .B -a
 Generate CIGAR and output alignments in the SAM format. Minimap2 outputs in PAF
 by default.
 .TP
+.B -Q
+Ignore base quality in the input file.
+.TP
+.BI -R \ STR
+SAM read group line in a format like
+.B @RG\\\\tID:foo\\\\tSM:bar
+[].
+.TP
 .B -c
 Generate CIGAR. In PAF, the CIGAR is written to the `cg' custom tag.
 .TP
@@ -232,8 +255,13 @@ and
 use
 .BR -K500m .
 .TP
-.B -V
+.B --version
 Print version number to stdout
+.TP
+.B --no-sam-hdr
+Don't output SAM header lines. Use this option if the index consists of
+multiple parts; otherwise the SAM output is malformated due to internal header
+lines.
 .SS Preset options
 .TP 10
 .BI -x \ STR
@@ -247,37 +275,70 @@ are:
 .RS
 .TP 8
 .B map-pb
-PacBio/Oxford Nanopore read to reference mapping (-Hk19)
+PacBio/Oxford Nanopore read to reference mapping
+.RB ( -Hk19 )
 .TP
 .B map10k
 The same as
 .B map-pb
-(-Hk19)
+.RB ( -Hk19 )
 .TP
 .B map-ont
-Slightly more sensitive for Oxford Nanopore to reference mapping (-k15). For
+Slightly more sensitive for Oxford Nanopore to reference mapping
-PacBio reads, HPC minimizers consistently leads to faster performance and more
+.RB ( -k15 ).
-sensitive results in comparison to normal minimizers. For Oxford Nanopore data,
+For PacBio reads, HPC minimizers consistently leads to faster performance and
-normal minimizers are better, though not much. The effectiveness of HPC is
+more sensitive results in comparison to normal minimizers. For Oxford Nanopore
-determined by the sequencing error mode.
+data, normal minimizers are better, though not much. The effectiveness of HPC
+is determined by the sequencing error mode.
 .TP
 .B asm5
-Long assembly to reference mapping (-k19 -w19 -A1 -B19 -O39,81 -E3,1 -s200 -z200).
+Long assembly to reference mapping
+.RB ( -k19
+.B -w19 -A1 -B19 -O39,81 -E3,1 -s200
+.BR -z200 ).
 Typically, the alignment will not extend to regions with 5% or higher sequence
 divergence. Only use this preset if the average divergence is far below 5%.
 .TP
 .B asm10
-Long assembly to reference mapping (-k19 -w19 -A1 -B9 -O16,41 -E2,1 -s200 -z200). Up
+Long assembly to reference mapping
-to 10% sequence divergence.
+.RB ( -k19
-.TP 8
+.B -w19 -A1 -B9 -O16,41 -E2,1 -s200
+.BR -z200 ).
+Up to 10% sequence divergence.
+.TP
 .B ava-pb
-PacBio all-vs-all overlap mapping (-Hk19 -w5 -Xp0 -m100 -K500m -g10000 --max-chain-skip 25)
+PacBio all-vs-all overlap mapping
-.TP 8
+.RB ( -Hk19
+.B -w5 -Xp0 -m100 -K500m -g10000 --max-chain-skip
+.BR 25 ).
+.TP
 .B ava-ont
-Oxford Nanopore all-vs-all overlap mapping (-k15 -w5 -Xp0 -m100 -K500m -g10000
+Oxford Nanopore all-vs-all overlap mapping
---max-chain-skip 25). Similarly, the major difference from
+.RB ( -k15
+.B -w5 -Xp0 -m100 -K500m -g10000 --max-chain-skip
+.BR 25 ).
+Similarly, the major difference from
 .B ava-pb
 is that this preset is not using HPC minimizers.
+.TP
+.B splice
+Long-read spliced alignment
+.RB ( -k15
+.B -w5 --splice -g2000 -G200k -A1 -B2 -O2,32 -E1,0 -z200 -ub --cost-non-gt-ag
+.BR 5 ).
+In the splice mode, 1) long deletions are taken as introns and represented as
+the
+.RB ` N '
+CIGAR operator; 2) long insertions are disabled; 3) deletion and insertion gap
+costs are different during chaining; 4) the computation of the
+.RB ` ms '
+tag ignores introns to demote hits to pseudogenes.
+.TP
+.B sr
+Short single-end reads without splicing
+.RB ( -k21
+.B -w11 -A2 -B8 -O12,32 -E2,1 -r50 -p.5 -N20 -f1000 -n2 -m20 -s40 -g100 -K50m
+.BR --approx-ext ).
 .RE
 .SS Miscellaneous options
 .TP 10
@@ -337,6 +398,7 @@ NM	i	Total number of mismatches and gaps in the alignment
 AS	i	DP alignment score
 ms	i	DP score of the max scoring segment in the alignment
 nn	i	Number of ambiguous bases in the alignment
+ts	A	Transcript strand (splice mode only)
 cg	Z	CIGAR string (only in PAF)
 .TE
 

misc.c

@@ -1,19 +1,104 @@
-#include <sys/resource.h>
-#include <sys/time.h>
 #include "minimap.h"
 
-int mm_verbose = 3;
+int mm_verbose = 1;
 int mm_dbg_flag = 0;
 double mm_realtime0;
 
+#if defined(WIN32) || defined(_WIN32)
+#include <windows.h>
+
+struct timezone
+{
+  __int32  tz_minuteswest; /* minutes W of Greenwich */
+  int  tz_dsttime;     /* type of dst correction */
+};
+
+/*
+ * gettimeofday.c
+ *    Win32 gettimeofday() replacement
+ *    taken from PostgreSQL, according to
+ *    https://stackoverflow.com/questions/1676036/what-should-i-use-to-replace-gettimeofday-on-windows
+ *
+ * src/port/gettimeofday.c
+ *
+ * Copyright (c) 2003 SRA, Inc.
+ * Copyright (c) 2003 SKC, Inc.
+ *
+ * Permission to use, copy, modify, and distribute this software and
+ * its documentation for any purpose, without fee, and without a
+ * written agreement is hereby granted, provided that the above
+ * copyright notice and this paragraph and the following two
+ * paragraphs appear in all copies.
+ *
+ * IN NO EVENT SHALL THE AUTHOR BE LIABLE TO ANY PARTY FOR DIRECT,
+ * INDIRECT, SPECIAL, INCIDENTAL, OR CONSEQUENTIAL DAMAGES, INCLUDING
+ * LOST PROFITS, ARISING OUT OF THE USE OF THIS SOFTWARE AND ITS
+ * DOCUMENTATION, EVEN IF THE UNIVERSITY OF CALIFORNIA HAS BEEN ADVISED
+ * OF THE POSSIBILITY OF SUCH DAMAGE.
+ *
+ * THE AUTHOR SPECIFICALLY DISCLAIMS ANY WARRANTIES, INCLUDING, BUT NOT
+ * LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR
+ * A PARTICULAR PURPOSE.  THE SOFTWARE PROVIDED HEREUNDER IS ON AN "AS
+ * IS" BASIS, AND THE AUTHOR HAS NO OBLIGATIONS TO PROVIDE MAINTENANCE,
+ * SUPPORT, UPDATES, ENHANCEMENTS, OR MODIFICATIONS.
+ */
+
+/* FILETIME of Jan 1 1970 00:00:00. */
+static const unsigned __int64 epoch = ((unsigned __int64) 116444736000000000ULL);
+
+/*
+ * timezone information is stored outside the kernel so tzp isn't used anymore.
+ *
+ * Note: this function is not for Win32 high precision timing purpose. See
+ * elapsed_time().
+ */
+int gettimeofday(struct timeval * tp, struct timezone *tzp)
+{
+    FILETIME    file_time;
+    SYSTEMTIME  system_time;
+    ULARGE_INTEGER ularge;
+
+    GetSystemTime(&system_time);
+    SystemTimeToFileTime(&system_time, &file_time);
+    ularge.LowPart = file_time.dwLowDateTime;
+    ularge.HighPart = file_time.dwHighDateTime;
+
+    tp->tv_sec = (long) ((ularge.QuadPart - epoch) / 10000000L);
+    tp->tv_usec = (long) (system_time.wMilliseconds * 1000);
+
+    return 0;
+}
+
+// taken from https://stackoverflow.com/questions/5272470/c-get-cpu-usage-on-linux-and-windows
 double cputime()
+{
+	HANDLE hProcess = GetCurrentProcess();
+	FILETIME ftCreation, ftExit, ftKernel, ftUser;
+	SYSTEMTIME stKernel;
+	SYSTEMTIME stUser;
+
+	GetProcessTimes(hProcess, &ftCreation, &ftExit, &ftKernel, &ftUser);
+	FileTimeToSystemTime(&ftKernel, &stKernel);
+	FileTimeToSystemTime(&ftUser, &stUser);
+
+	double kernelModeTime = ((stKernel.wHour * 60.) + stKernel.wMinute * 60.) + stKernel.wSecond * 1. + stKernel.wMilliseconds / 1000.;
+	double userModeTime = ((stUser.wHour * 60.) + stUser.wMinute * 60.) + stUser.wSecond * 1. + stUser.wMilliseconds / 1000.;
+
+	return kernelModeTime + userModeTime;
+}
+#else
+#include <sys/resource.h>
+#include <sys/time.h>
+
+double cputime(void)
 {
 	struct rusage r;
 	getrusage(RUSAGE_SELF, &r);
 	return r.ru_utime.tv_sec + r.ru_stime.tv_sec + 1e-6 * (r.ru_utime.tv_usec + r.ru_stime.tv_usec);
 }
+#endif /* WIN32 || _WIN32 */
 
-double realtime()
+double realtime(void)
 {
 	struct timeval tp;
 	struct timezone tzp;

misc/README.md

@@ -0,0 +1,28 @@
+The [K8 Javascript shell][k8] is needed to run Javascripts in this directory.
+Precompiled k8 binaries for Mac and Linux can be found at the [K8 release
+page][k8bin].
+
+* [paf2aln.js](paf2aln.js): convert PAF to [MAF][maf] or BLAST-like output for
+  eyeballing. PAF has to be generated with minimap2 option `-S`, which writes
+  the aligned sequences to the `cs` tag. An example:
+  ```sh
+  ../minimap2 -S ../test/MT-*.fa | k8 paf2aln.js /dev/stdin
+  ```
+
+* [mapstat.js](mapstat.js): output basic statistics such as the number of
+  non-redundant mapped bases, number of split and secondary alignments and
+  number of long gaps. This scripts seamlessly works with both SAM and PAF.
+
+* [sim-pbsim.js](sim-pbsim.js): convert reads simulated with [PBSIM][pbsim] to
+  FASTA and encode the true mapping positions to read names in a format like
+  `S1_33!chr1!225258409!225267761!-`.
+
+* [sim-eval.js](sim-eval.js): evaluate mapping accuracy for FASTA generated
+  with [sim-pbsim.js](sim-pbsim.js) or [sim-mason2.js](sim-mason2.js).
+
+* [sam2paf.js](sam2paf.js): convert SAM to PAF.
+
+[k8]: https://github.com/attractivechaos/k8
+[k8bin]: https://github.com/attractivechaos/k8/releases
+[maf]: https://genome.ucsc.edu/FAQ/FAQformat#format5
+[pbsim]: https://github.com/pfaucon/PBSIM-PacBio-Simulator

misc/intron-eval.js

@@ -0,0 +1,266 @@
+/*******************************
+ * Command line option parsing *
+ *******************************/
+
+var getopt = function(args, ostr) {
+	var oli; // option letter list index
+	if (typeof(getopt.place) == 'undefined')
+		getopt.ind = 0, getopt.arg = null, getopt.place = -1;
+	if (getopt.place == -1) { // update scanning pointer
+		if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
+			getopt.place = -1;
+			return null;
+		}
+		if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
+			++getopt.ind;
+			getopt.place = -1;
+			return null;
+		}
+	}
+	var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
+	if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
+		if (optopt == '-') return null; //  if the user didn't specify '-' as an option, assume it means null.
+		if (getopt.place < 0) ++getopt.ind;
+		return '?';
+	}
+	if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
+		getopt.arg = null;
+		if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
+	} else { // need an argument
+		if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
+			getopt.arg = args[getopt.ind].substr(getopt.place);
+		else if (args.length <= ++getopt.ind) { // no arg
+			getopt.place = -1;
+			if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
+			return '?';
+		} else getopt.arg = args[getopt.ind]; // white space
+		getopt.place = -1;
+		++getopt.ind;
+	}
+	return optopt;
+}
+
+/***********************
+ * Interval operations *
+ ***********************/
+
+Interval = {};
+
+Interval.sort = function(a)
+{
+	if (typeof a[0] == 'number')
+		a.sort(function(x, y) { return x - y });
+	else a.sort(function(x, y) { return x[0] != y[0]? x[0] - y[0] : x[1] - y[1] });
+}
+
+Interval.merge = function(a, sorted)
+{
+	if (typeof sorted == 'undefined') sorted = true;
+	if (!sorted) Interval.sort(a);
+	var k = 0;
+	for (var i = 1; i < a.length; ++i) {
+		if (a[k][1] >= a[i][0])
+			a[k][1] = a[k][1] > a[i][1]? a[k][1] : a[i][1];
+		else a[++k] = a[i].slice(0);
+	}
+	a.length = k + 1;
+}
+
+Interval.index_end = function(a, sorted)
+{
+	if (a.length == 0) return;
+	if (typeof sorted == 'undefined') sorted = true;
+	if (!sorted) Interval.sort(a);
+	a[0].push(0);
+	var k = 0, k_en = a[0][1];
+	for (var i = 1; i < a.length; ++i) {
+		if (k_en <= a[i][0]) {
+			for (++k; k < i; ++k)
+				if (a[k][1] > a[i][0])
+					break;
+			k_en = a[k][1];
+		}
+		a[i].push(k);
+	}
+}
+
+Interval.find_intv = function(a, x)
+{
+	var left = -1, right = a.length;
+	if (typeof a[0] == 'number') {
+		while (right - left > 1) {
+			var mid = left + ((right - left) >> 1);
+			if (a[mid] > x) right = mid;
+			else if (a[mid] < x) left = mid;
+			else return mid;
+		}
+	} else {
+		while (right - left > 1) {
+			var mid = left + ((right - left) >> 1);
+			if (a[mid][0] > x) right = mid;
+			else if (a[mid][0] < x) left = mid;
+			else return mid;
+		}
+	}
+	return left;
+}
+
+Interval.find_ovlp = function(a, st, en)
+{
+	if (a.length == 0 || st >= en) return [];
+	var l = Interval.find_intv(a, st);
+	var k = l < 0? 0 : a[l][a[l].length - 1];
+	var b = [];
+	for (var i = k; i < a.length; ++i) {
+		if (a[i][0] >= en) break;
+		else if (st < a[i][1])
+			b.push(a[i]);
+	}
+	return b;
+}
+
+/*****************
+ * Main function *
+ *****************/
+
+var c, l_fuzzy = 0, print_ovlp = false, print_err_only = false, first_only = false;
+while ((c = getopt(arguments, "l:ep")) != null) {
+	if (c == 'l') l_fuzzy = parseInt(getopt.arg);
+	else if (c == 'e') print_err_only = print_ovlp = true;
+	else if (c == 'p') print_ovlp = true;
+}
+
+if (arguments.length - getopt.ind < 2) {
+	print("Usage: k8 intron-eval.js [options] <gene.gtf> <aln.sam>");
+	exit(1);
+}
+
+var file, buf = new Bytes();
+
+var tr = {};
+file = new File(arguments[getopt.ind]);
+while (file.readline(buf) >= 0) {
+	var m, t = buf.toString().split("\t");
+	if (t[0].charAt(0) == '#') continue;
+	if (t[2] != 'exon') continue;
+	var st = parseInt(t[3]) - 1;
+	var en = parseInt(t[4]);
+	if ((m = /transcript_id "(\S+)"/.exec(t[8])) == null) continue;
+	var tid = m[1];
+	if (tr[tid] == null) tr[tid] = [t[0], t[6], 0, 0, []];
+	tr[tid][4].push([st, en]);
+}
+file.close();
+
+var anno = {};
+for (var tid in tr) {
+	var t = tr[tid];
+	Interval.sort(t[4]);
+	t[2] = t[4][0][0];
+	t[3] = t[4][t[4].length - 1][1];
+	if (anno[t[0]] == null) anno[t[0]] = [];
+	var s = t[4];
+	for (var i = 0; i < s.length - 1; ++i) {
+		if (s[i][1] >= s[i+1][0]) throw Error("ERROR: wrong annotation!");
+		anno[t[0]].push([s[i][1], s[i+1][0]]);
+	}
+}
+tr = null;
+
+for (var chr in anno) {
+	var e = anno[chr];
+	if (e.length == 0) continue;
+	Interval.sort(e);
+	var k = 0;
+	for (var i = 1; i < e.length; ++i) // dedup
+		if (e[i][0] != e[k][0] || e[i][1] != e[k][1])
+			e[++k] = e[i].slice(0);
+	e.length = k + 1;
+	Interval.index_end(e);
+}
+
+var n_pri = 0, n_unmapped = 0, n_mapped = 0;
+var n_sgl = 0, n_splice = 0, n_splice_hit = 0, n_splice_novel = 0;
+
+file = new File(arguments[getopt.ind+1]);
+var last_qname = null;
+var re_cigar = /(\d+)([MIDNSHX=])/g;
+while (file.readline(buf) >= 0) {
+	var m, t = buf.toString().split("\t");
+
+	if (t[0].charAt(0) == '@') continue;
+	var flag = parseInt(t[1]);
+	if (flag&0x100) continue;
+	if (first_only && last_qname == t[0]) continue;
+	if (t[2] == '*') {
+		++n_unmapped;
+		continue;
+	} else {
+		++n_pri;
+		if (last_qname != t[0]) ++n_mapped;
+	}
+
+	var pos = parseInt(t[3]) - 1, intron = [];
+	while ((m = re_cigar.exec(t[5])) != null) {
+		var len = parseInt(m[1]), op = m[2];
+		if (op == 'N') {
+			intron.push([pos, pos + len]);
+			pos += len;
+		} else if (op == 'M' || op == 'X' || op == '=' || op == 'D') pos += len;
+	}
+	if (intron.length == 0) {
+		++n_sgl;
+		continue;
+	}
+	n_splice += intron.length;
+
+	var chr = anno[t[2]];
+	if (chr != null) {
+		for (var i = 0; i < intron.length; ++i) {
+			var o = Interval.find_ovlp(chr, intron[i][0], intron[i][1]);
+			if (o.length > 0) {
+				var hit = false;
+				for (var j = 0; j < o.length; ++j) {
+					var st_diff = intron[i][0] - o[j][0];
+					var en_diff = intron[i][1] - o[j][1];
+					if (st_diff < 0) st_diff = -st_diff;
+					if (en_diff < 0) en_diff = -en_diff;
+					if (st_diff <= l_fuzzy && en_diff <= l_fuzzy)
+						++n_splice_hit, hit = true;
+					if (hit) break;
+				}
+				if (print_ovlp) {
+					var type = hit? 'C' : 'P';
+					if (hit && print_err_only) continue;
+					var x = '[';
+					for (var j = 0; j < o.length; ++j) {
+						if (j) x += ', ';
+						x += '(' + o[j][0] + "," + o[j][1] + ')';
+					}
+					x += ']';
+					print(type, t[0], i+1, t[2], intron[i][0], intron[i][1], x);
+				}
+			} else {
+				++n_splice_novel;
+				if (print_ovlp)
+					print('N', t[0], i+1, t[2], intron[i][0], intron[i][1]);
+			}
+		}
+	} else {
+		n_splice_novel += intron.length;
+	}
+	last_qname = t[0];
+}
+file.close();
+
+buf.destroy();
+
+if (!print_ovlp) {
+	print("# unmapped reads: " + n_unmapped);
+	print("# mapped reads: " + n_mapped);
+	print("# primary alignments: " + n_pri);
+	print("# singletons: " + n_sgl);
+	print("# predicted introns: " + n_splice);
+	print("# non-overlapping introns: " + n_splice_novel);
+	print("# correct introns: " + n_splice_hit + " (" + (n_splice_hit / n_splice * 100).toFixed(2) + "%)");
+}

misc/mapstat.js

@@ -94,7 +94,7 @@ while (file.readline(buf) >= 0) {
 			ori_qlen = parseInt(t[1]);
 		} else { // SAM
 			var flag = parseInt(t[1]);
-			if (flag & 4) continue;
+			if ((flag & 4) || t[2] == '*' || t[5] == '*') continue;
 			if (flag & 0x100) {
 				++n_2nd;
 				continue;

misc/paf2aln.js

@@ -0,0 +1,171 @@
+var getopt = function(args, ostr) {
+	var oli; // option letter list index
+	if (typeof(getopt.place) == 'undefined')
+		getopt.ind = 0, getopt.arg = null, getopt.place = -1;
+	if (getopt.place == -1) { // update scanning pointer
+		if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
+			getopt.place = -1;
+			return null;
+		}
+		if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
+			++getopt.ind;
+			getopt.place = -1;
+			return null;
+		}
+	}
+	var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
+	if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
+		if (optopt == '-') return null; //  if the user didn't specify '-' as an option, assume it means null.
+		if (getopt.place < 0) ++getopt.ind;
+		return '?';
+	}
+	if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
+		getopt.arg = null;
+		if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
+	} else { // need an argument
+		if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
+			getopt.arg = args[getopt.ind].substr(getopt.place);
+		else if (args.length <= ++getopt.ind) { // no arg
+			getopt.place = -1;
+			if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
+			return '?';
+		} else getopt.arg = args[getopt.ind]; // white space
+		getopt.place = -1;
+		++getopt.ind;
+	}
+	return optopt;
+}
+
+var c, maf_out = false, line_len = 80;
+while ((c = getopt(arguments, "ml:")) != null) {
+	if (c == 'm') maf_out = true;
+	else if (c == 'l') line_len = parseInt(getopt.arg); // TODO: not implemented yet
+}
+if (line_len == 0) line_len = 0x7fffffff;
+
+if (getopt.ind == arguments.length) {
+	print("Usage: k8 paf2aln.js [options] <with-cs.paf>");
+	print("Options:");
+	print("  -m        MAF output (BLAST-like output by default)");
+	print("  -l INT    line length in BLAST-like output [80]");
+	print("");
+	print("Note: this script only works when minimap2 is run with option '-S'");
+	exit(1);
+}
+
+function padding_str(x, len, right)
+{
+	var s = x.toString();
+	if (s.length < len) {
+		if (right) s += Array(len - s.length + 1).join(" ");
+		else s = Array(len - s.length + 1).join(" ") + s;
+	}
+	return s;
+}
+
+function update_aln(s_ref, s_qry, s_mid, type, seq, slen)
+{
+	var l = type == '*'? 1 : seq.length;
+	if (type == '=') {
+		s_ref.set(seq);
+		s_qry.set(seq);
+		s_mid.set(Array(l+1).join("|"));
+		slen[0] += l, slen[1] += l;
+	} else if (type == '*') {
+		s_ref.set(seq.charAt(0));
+		s_qry.set(seq.charAt(1));
+		s_mid.set(' ');
+		slen[0] += 1, slen[1] += 1;
+	} else if (type == '+') {
+		s_ref.set(Array(l+1).join("-"));
+		s_qry.set(seq);
+		s_mid.set(Array(l+1).join(" "));
+		slen[1] += l;
+	} else if (type == '-') {
+		s_ref.set(seq);
+		s_qry.set(Array(l+1).join("-"));
+		s_mid.set(Array(l+1).join(" "));
+		slen[0] += l;
+	}
+}
+
+function print_aln(rs, qs, strand, slen, elen, s_ref, s_qry, s_mid)
+{
+	print(["Ref+:", padding_str(rs + slen[0] + 1, 10, false), s_ref.toString(), padding_str(rs + elen[0], 10, true)].join(" "));
+	print("                 " + s_mid.toString());
+	var st, en;
+	if (strand == '+') st = qs + slen[1] + 1, en = qs + elen[1];
+	else st = qs - slen[1], en = qs - elen[1] + 1;
+	print(["Qry" + strand + ":", padding_str(st,               10, false), s_qry.toString(), padding_str(en          , 10, true)].join(" "));
+}
+
+var s_ref = new Bytes(), s_qry = new Bytes(), s_mid = new Bytes();
+var re = /([=\-\+\*])([A-Za-z]+)/g;
+
+var buf = new Bytes();
+var file = new File(arguments[getopt.ind]);
+if (maf_out) print("##maf version=1\n");
+while (file.readline(buf) >= 0) {
+	var m, line = buf.toString();
+	var t = line.split("\t", 12);
+	if ((m = /\tcs:Z:(\S+)/.exec(line)) == null) continue;
+	var cs = m[1];
+	s_ref.length = s_qry.length = s_mid.length = 0;
+	var slen = [0, 0], elen = [0, 0];
+	if (maf_out) {
+		while ((m = re.exec(cs)) != null)
+			update_aln(s_ref, s_qry, s_mid, m[1], m[2], elen);
+		if (maf_out) {
+			var score = (m = /\tAS:i:(\d+)/.exec(line)) != null? parseInt(m[1]) : 0;
+			var len = t[0].length > t[5].length? t[0].length : t[5].length;
+			print("a " + score);
+			print(["s", padding_str(t[5], len, true), padding_str(t[7], 10, false), padding_str(parseInt(t[8]) - parseInt(t[7]), 10, false),
+				   "+", padding_str(t[6], 10, false), s_ref.toString()].join(" "));
+			var qs, qe, ql = parseInt(t[1]);
+			if (t[4] == '+') {
+				qs = parseInt(t[2]);
+				qe = parseInt(t[3]);
+			} else {
+				qs = ql - parseInt(t[3]);
+				qe = ql - parseInt(t[2]);
+			}
+			print(["s", padding_str(t[0], len, true), padding_str(qs, 10, false), padding_str(qe - qs, 10, false),
+				   t[4], padding_str(ql, 10, false), s_qry.toString()].join(" "));
+			print("");
+		}
+	} else {
+		line = line.replace(/\tc[sg]:Z:\S+/g, "");
+		print('>' + line);
+		var rs = parseInt(t[7]), qs = t[4] == '+'? parseInt(t[2]) : parseInt(t[3]);
+		var n_blocks = 0;
+		while ((m = re.exec(cs)) != null) {
+			var start = 0, rest = m[1] == '*'? 1 : m[2].length;
+			while (rest > 0) {
+				var l_proc;
+				if (s_ref.length + rest >= line_len) {
+					l_proc = line_len - s_ref.length;
+					update_aln(s_ref, s_qry, s_mid, m[1], m[1] == '*'? m[2] : m[2].substr(start, l_proc), elen);
+					if (n_blocks > 0) print("");
+					print_aln(rs, qs, t[4], slen, elen, s_ref, s_qry, s_mid);
+					++n_blocks;
+					s_ref.length = s_qry.length = s_mid.length = 0;
+					slen[0] = elen[0], slen[1] = elen[1];
+				} else {
+					l_proc = rest;
+					update_aln(s_ref, s_qry, s_mid, m[1], m[1] == '*'? m[2] : m[2].substr(start, l_proc), elen);
+				}
+				rest -= l_proc, start += l_proc;
+			}
+		}
+		if (s_ref.length > 0) {
+			if (n_blocks > 0) print("");
+			print_aln(rs, qs, t[4], slen, elen, s_ref, s_qry, s_mid);
+			++n_blocks;
+		}
+		print("//");
+	}
+}
+file.close();
+buf.destroy();
+
+s_ref.destroy(); s_qry.destroy(); s_mid.destroy();

misc/sam2paf.js

@@ -0,0 +1,111 @@
+var getopt = function(args, ostr) {
+	var oli; // option letter list index
+	if (typeof(getopt.place) == 'undefined')
+		getopt.ind = 0, getopt.arg = null, getopt.place = -1;
+	if (getopt.place == -1) { // update scanning pointer
+		if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
+			getopt.place = -1;
+			return null;
+		}
+		if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
+			++getopt.ind;
+			getopt.place = -1;
+			return null;
+		}
+	}
+	var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
+	if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
+		if (optopt == '-') return null; //  if the user didn't specify '-' as an option, assume it means null.
+		if (getopt.place < 0) ++getopt.ind;
+		return '?';
+	}
+	if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
+		getopt.arg = null;
+		if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
+	} else { // need an argument
+		if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
+			getopt.arg = args[getopt.ind].substr(getopt.place);
+		else if (args.length <= ++getopt.ind) { // no arg
+			getopt.place = -1;
+			if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
+			return '?';
+		} else getopt.arg = args[getopt.ind]; // white space
+		getopt.place = -1;
+		++getopt.ind;
+	}
+	return optopt;
+}
+
+var c, pri_only = false;
+while ((c = getopt(arguments, "p")) != null)
+	if (c == 'p') pri_only = true;
+
+var file = arguments.length == getopt.ind? new File() : new File(arguments[getopt.ind]);
+var buf = new Bytes();
+var re = /(\d+)([MIDSHNX=])/g;
+
+var len = {}, lineno = 0;
+while (file.readline(buf) >= 0) {
+	var m, n_cigar = 0, line = buf.toString();
+	++lineno;
+	if (line.charAt(0) == '@') {
+		if (/^@SQ/.test(line)) {
+			var name = (m = /\tSN:(\S+)/.exec(line)) != null? m[1] : null;
+			var l = (m = /\tLN:(\d+)/.exec(line)) != null? parseInt(m[1]) : null;
+			if (name != null && l != null) len[name] = l;
+		}
+		continue;
+	}
+	var t = line.split("\t");
+	var flag = parseInt(t[1]);
+	if (t[9] != '*' && t[10] != '*' && t[9].length != t[10].length) throw Error("ERROR at line " + lineno + ": inconsistent SEQ and QUAL lengths - " + t[9].length + " != " + t[10].length);
+	if (t[2] == '*' || (flag&4)) continue;
+	if (pri_only && (flag&0x100)) continue;
+	var tlen = len[t[2]];
+	if (tlen == null) throw Error("ERROR at line " + lineno + ": can't find the length of contig " + t[2]);
+	var nn = (m = /\tnn:i:(\d+)/.exec(line)) != null? parseInt(m[1]) : 0;
+	var NM = (m = /\tNM:i:(\d+)/.exec(line)) != null? parseInt(m[1]) : null;
+	var have_NM = NM == null? false : true;
+	NM += nn;
+	var clip = [0, 0], I = [0, 0], D = [0, 0], M = 0, N = 0, ql = 0, tl = 0, mm = 0, ext_cigar = false;
+	while ((m = re.exec(t[5])) != null) {
+		var l = parseInt(m[1]);
+		if (m[2] == 'M') M += l, ql += l, tl += l, ext_cigar = false;
+		else if (m[2] == 'I') ++I[0], I[1] += l, ql += l;
+		else if (m[2] == 'D') ++D[0], D[1] += l, tl += l;
+		else if (m[2] == 'N') N += l, tl += l;
+		else if (m[2] == 'S') clip[M == 0? 0 : 1] = l, ql += l;
+		else if (m[2] == 'H') clip[M == 0? 0 : 1] = l;
+		else if (m[2] == '=') M += l, ql += l, tl += l, ext_cigar = true;
+		else if (m[2] == 'X') M += l, ql += l, tl += l, mm += l, ext_cigar = true;
+		++n_cigar;
+	}
+	if (n_cigar > 65535)
+		warn("WARNING at line " + lineno + ": " + n_cigar + " CIGAR operations");
+	if (tl + parseInt(t[3]) - 1 > tlen) {
+		warn("WARNING at line " + lineno + ": alignment end position larger than ref length; skipped");
+		continue;
+	}
+	if (t[9] != '*' && t[9].length != ql) {
+		warn("WARNING at line " + lineno + ": SEQ length inconsistent with CIGAR (" + t[9].length + " != " + ql + "); skipped");
+		continue;
+	}
+	if (!have_NM || ext_cigar) NM = I[1] + D[1] + mm;
+	if (NM < I[1] + D[1] + mm) {
+		warn("WARNING at line " + lineno + ": NM is less than the total number of gaps (" + NM + " < " + (I[1]+D[1]+mm) + ")");
+		NM = I[1] + D[1] + mm;
+	}
+	var extra = ["mm:i:"+(NM-I[1]-D[1]), "io:i:"+I[0], "in:i:"+I[1], "do:i:"+D[0], "dn:i:"+D[1]];
+	var match = M - (NM - I[1] - D[1]);
+	var blen = M + I[1] + D[1];
+	var qlen = M + I[1] + clip[0] + clip[1];
+	var qs, qe;
+	if (flag&16) qs = clip[1], qe = qlen - clip[0];
+	else qs = clip[0], qe = qlen - clip[1];
+	var ts = parseInt(t[3]) - 1, te = ts + M + D[1] + N;
+	var a = [t[0], qlen, qs, qe, flag&16? '-' : '+', t[2], tlen, ts, te, match, blen, t[4]];
+	print(a.join("\t"), extra.join("\t"));
+}
+
+buf.destroy();
+file.close();

misc/sim-eval.js

@@ -36,11 +36,12 @@ var getopt = function(args, ostr) {
 	return optopt;
 }
 
-var c, max_mapq = 60, mode = 0, err_out_q = 256, print_err = false, ovlp_ratio = 0.333;
+var c, max_mapq = 60, mode = 0, err_out_q = 256, print_err = false, ovlp_ratio = 0.1, cap_short_mapq = false;
-while ((c = getopt(arguments, "Q:r:m:")) != null) {
+while ((c = getopt(arguments, "Q:r:m:c")) != null) {
 	if (c == 'Q') err_out_q = parseInt(getopt.arg), print_err = true;
 	else if (c == 'r') ovlp_ratio = parseFloat(getopt.arg);
 	else if (c == 'm') mode = parseInt(getopt.arg);
+	else if (c == 'c') cap_short_mapq = true;
 }
 
 var file = arguments.length == getopt.ind? new File() : new File(arguments[getopt.ind]);
@@ -68,20 +69,27 @@ function is_correct(s, b)
 
 function count_err(qname, a, tot, err, mode)
 {
-	var s = qname.split("!");
 	if (a.length == 0) return;
-	if (s.length < 5 || (s[4] != '+' && s[4] != '-'))
+
-		throw Error("Failed to parse pbsim2fa read names '" + qname + "'");
+	var m, s;
-	s[2] = parseInt(s[2]);
+	if ((m = /^(\S+)!(\S+)!(\d+)!(\d+)!([\+\-])$/.exec(qname)) != null) { // pbsim single-end reads
-	s[3] = parseInt(s[3]);
+		s = [m[1], m[2], parseInt(m[3]), parseInt(m[4]), m[5]];
-	s.shift(); // skip pbsim orginal read name
+	} else if ((m = /^(\S+)!(\S+)!(\d+)_(\d+)!(\d+)_(\d+)!([\+\-])([\+\-])\/([12])$/.exec(qname)) != null) { // mason2 paired-end reads
+		if (m[9] == '1') {
+			s = [m[1], m[2], parseInt(m[3]), parseInt(m[5]), m[7]];
+		} else {
+			s = [m[1], m[2], parseInt(m[4]), parseInt(m[6]), m[8]];
+		}
+	} else throw Error("Failed to parse simulated read names '" + qname + "'");
+	s.shift(); // skip the orginal read name
+
 	if (mode == 0 || mode == 1) { // longest only or first only
 		var max_i = 0;
-		if (mode == 0) {
+		if (mode == 0) { // longest only
 			var max = 0;
 			for (var i = 0; i < a.length; ++i)
-				if (a[i][2] - a[i][1] > max)
+				if (a[i][5] > max)
-					max = a[i][2] - a[i][1], max_i = i;
+					max = a[i][5], max_i = i;
 		}
 		var mapq = a[max_i][4];
 		++tot[mapq];
@@ -92,6 +100,14 @@ function count_err(qname, a, tot, err, mode)
 		}
 	} else if (mode == 2) { // all primary mode
 		var max_err_mapq = -1, max_mapq = 0, max_err_i = -1;
+		if (cap_short_mapq) {
+			var max = 0, max_q = 0;
+			for (var i = 0; i < a.length; ++i)
+				if (a[i][5] > max)
+					max = a[i][5], max_q = a[i][4];
+			for (var i = 0; i < a.length; ++i)
+				a[i][4] = max_q < a[i][4]? max_q : a[i][4];
+		}
 		for (var i = 0; i < a.length; ++i) {
 			max_mapq = max_mapq > a[i][4]? max_mapq : a[i][4];
 			if (!is_correct(s, a[i]))
@@ -106,22 +122,53 @@ function count_err(qname, a, tot, err, mode)
 	}
 }
 
-var lineno = 0, last = null, a = [];
+var lineno = 0, last = null, a = [], n_unmapped = null;
+var re_cigar = /(\d+)([MIDSHN])/g;
 while (file.readline(buf) >= 0) {
-	var line = buf.toString();
+	var m, line = buf.toString();
 	++lineno;
 	if (line[0] != '@') {
 		var t = line.split("\t");
-		if (last != t[0]) {
-			if (last != null) count_err(last, a, tot, err, mode);
-			a = [], last = t[0];
-		}
 		if (t[4] == '+' || t[4] == '-') { // PAF
+			if (last != t[0]) {
+				if (last != null) count_err(last, a, tot, err, mode);
+				a = [], last = t[0];
+			}
 			if (/\ts1:i:\d+/.test(line) && !/\ts2:i:\d+/.test(line)) // secondary alignment in minimap2 PAF
 				continue;
 			var mapq = parseInt(t[11]);
 			if (mapq > max_mapq) mapq = max_mapq;
-			a.push([t[5], parseInt(t[7]), parseInt(t[8]), t[4], mapq]);
+			a.push([t[5], parseInt(t[7]), parseInt(t[8]), t[4], mapq, parseInt(t[9])]);
+		} else { // SAM
+			var flag = parseInt(t[1]);
+			var read_no = flag>>6&0x3;
+			var qname = read_no == 1 || read_no == 2? t[0] + '/' + read_no : t[0];
+			if (last != qname) {
+				if (last != null) count_err(last, a, tot, err, mode);
+				a = [], last = qname;
+			}
+			if (flag&0x100) continue; // secondary alignment
+			if ((flag&0x4) || t[2] == '*') { // unmapped
+				if (n_unmapped == null) n_unmapped = 0;
+				++n_unmapped;
+				continue;
+			}
+			var mapq = parseInt(t[4]);
+			if (mapq > max_mapq) mapq = max_mapq;
+			var pos = parseInt(t[3]) - 1, pos_end = pos;
+			var n_gap = 0, mlen = 0;
+			while ((m = re_cigar.exec(t[5])) != null) {
+				var len = parseInt(m[1]);
+				if (m[2] == 'M') pos_end += len, mlen += len;
+				else if (m[2] == 'I') n_gap += len;
+				else if (m[2] == 'D') n_gap += len, pos_end += len;
+			}
+			var score = pos_end - pos;
+			if ((m = /\tNM:i:(\d+)/.exec(line)) != null) {
+				var NM = parseInt(m[1]);
+				if (NM >= n_gap) score = mlen - (NM - n_gap);
+			}
+			a.push([t[2], pos, pos_end, (flag&16)? '-' : '+', mapq, score]);
 		}
 	}
 }
@@ -134,10 +181,11 @@ var sum_tot = 0, sum_err = 0, q_out = -1, sum_tot2 = 0, sum_err2 = 0;
 for (var q = max_mapq; q >= 0; --q) {
 	if (tot[q] == 0) continue;
 	if (q_out < 0 || err[q] > 0) {
-		if (q_out >= 0) print('Q', q_out, sum_tot, sum_err, (sum_err2/sum_tot2).toFixed(9));
+		if (q_out >= 0) print('Q', q_out, sum_tot, sum_err, (sum_err2/sum_tot2).toFixed(9), sum_tot2);
 		sum_tot = sum_err = 0, q_out = q;
 	}
 	sum_tot += tot[q], sum_err += err[q];
 	sum_tot2 += tot[q], sum_err2 += err[q];
 }
-print('Q', q_out, sum_tot, sum_err, (sum_err2/sum_tot2).toFixed(9));
+print('Q', q_out, sum_tot, sum_err, (sum_err2/sum_tot2).toFixed(9), sum_tot2);
+if (n_unmapped != null) print('U', n_unmapped);

misc/sim-mason2.js

@@ -0,0 +1,105 @@
+Bytes.prototype.reverse = function()
+{
+	for (var i = 0; i < this.length>>1; ++i) {
+		var tmp = this[i];
+		this[i] = this[this.length - i - 1];
+		this[this.length - i - 1] = tmp;
+	}
+}
+
+// reverse complement a DNA string
+Bytes.prototype.revcomp = function()
+{
+	if (Bytes.rctab == null) {
+		var s1 = 'WSATUGCYRKMBDHVNwsatugcyrkmbdhvn';
+		var s2 = 'WSTAACGRYMKVHDBNwstaacgrymkvhdbn';
+		Bytes.rctab = [];
+		for (var i = 0; i < 256; ++i) Bytes.rctab[i] = 0;
+		for (var i = 0; i < s1.length; ++i)
+			Bytes.rctab[s1.charCodeAt(i)] = s2.charCodeAt(i);
+	}
+	for (var i = 0; i < this.length>>1; ++i) {
+		var tmp = this[this.length - i - 1];
+		this[this.length - i - 1] = Bytes.rctab[this[i]];
+		this[i] = Bytes.rctab[tmp];
+	}
+	if (this.length&1)
+		this[this.length>>1] = Bytes.rctab[this[this.length>>1]];
+}
+
+if (arguments.length == 0) {
+	print("Usage: k8 sim-mason2.js <mason.sam>");
+	exit(1);
+}
+
+function print_se(a)
+{
+	print('@' + a.slice(0, 5).join("!") + " " + a[8]);
+	print(a[5]);
+	print("+");
+	print(a[6]);
+}
+
+var buf = new Bytes(), buf2 = new Bytes();
+var file = new File(arguments[0]);
+var re = /(\d+)([MIDSHN])/g;
+var last = null;
+while (file.readline(buf) >= 0) {
+	var t = buf.toString().split("\t");
+	if (t[0].charAt(0) == '@') continue;
+	var m, l_ref = 0;
+	while ((m = re.exec(t[5])) != null)
+		if (m[2] == 'D' || m[2] == 'M' || m[2] == 'N')
+			l_ref += parseInt(m[1]);
+	var flag = parseInt(t[1]);
+	var rev = !!(flag&16);
+	var seq, qual;
+	if (rev) {
+		buf2.length = 0;
+		buf2.set(t[9], 0);
+		buf2.revcomp();
+		seq = buf2.toString();
+		buf2.set(t[10], 0);
+		buf2.reverse();
+		qual = buf2.toString();
+	} else seq = t[9], qual = t[10];
+	var qname = t[0];
+	qname = qname.replace(/^simulated./, "");
+	var chr = t[2];
+	var pos = parseInt(t[3]) - 1;
+	var strand = (flag&16)? '-' : '+';
+	var read_no = flag&0xc0;
+	if (read_no == 0x40) read_no = 1;
+	else if (read_no == 0x80) read_no = 2;
+	else read_no = 0;
+	var err = 0, snp = 0, indel = 0;
+	for (var i = 11; i < t.length; ++i) {
+		if ((m = /^XE:i:(\d+)/.exec(t[i])) != null) err = m[1];
+		else if ((m = /^XS:i:(\d+)/.exec(t[i])) != null) snp = m[1];
+		else if ((m = /^XI:i:(\d+)/.exec(t[i])) != null) indel = m[1];
+	}
+	var comment = [err, snp, indel].join(":");
+	if (last == null) {
+		last = [qname, chr, pos, pos + l_ref, strand, seq, qual, read_no, comment];
+	} else if (last[0] != qname) {
+		print_se(last);
+		last = [qname, chr, pos, pos + l_ref, strand, seq, qual, read_no, comment];
+	} else {
+		if (read_no == 2) { // last[] is the first read
+			if (last[7] != 1) throw Error("ERROR: can't find read1");
+			var name = [qname, chr, last[2] + "_" + pos, last[3] + "_" + (pos + l_ref), last[4] + strand].join("!");
+			print('@' + name + '/1' + ' ' + last[8]); print(last[5]); print("+"); print(last[6]);
+			print('@' + name + '/2' + ' ' + comment); print(seq); print("+"); print(qual);
+		} else {
+			if (last[7] != 2) throw Error("ERROR: can't find read2");
+			var name = [qname, chr, pos + "_" + last[2], (pos + l_ref) + "_" + last[3], strand + last[4]].join("!");
+			print('@' + name + '/1' + ' ' + comment); print(seq); print("+"); print(qual);
+			print('@' + name + '/2' + ' ' + last[8]); print(last[5]); print("+"); print(last[6]);
+		}
+		last = null;
+	}
+}
+if (last != null) print_se(last);
+file.close();
+buf.destroy();
+buf2.destroy();

misc/sim-pbsim.js

@@ -28,7 +28,7 @@ Bytes.prototype.revcomp = function()
 }
 
 if (arguments.length < 2) {
-	print("Usage: k8 pbsim2paf.js <chr.list> <pbsim1.maf> [[pbsim2.maf] ...]");
+	print("Usage: k8 sim-pbsim.js <ref.fa.fai> <pbsim1.maf> [[pbsim2.maf] ...]");
 	exit(1);
 }
 

mmpriv.h

@@ -21,6 +21,9 @@
 #define kroundup32(x) (--(x), (x)|=(x)>>1, (x)|=(x)>>2, (x)|=(x)>>4, (x)|=(x)>>8, (x)|=(x)>>16, ++(x))
 #endif
 
+#define mm_seq4_set(s, i, c) ((s)[(i)>>3] |= (uint32_t)(c) << (((i)&7)<<2))
+#define mm_seq4_get(s, i)    ((s)[(i)>>3] >> (((i)&7)<<2) & 0xf)
+
 #ifdef __cplusplus
 extern "C" {
 #endif
@@ -40,21 +43,30 @@ void radix_sort_128x(mm128_t *beg, mm128_t *end);
 void radix_sort_64(uint64_t *beg, uint64_t *end);
 uint32_t ks_ksmall_uint32_t(size_t n, uint32_t arr[], size_t kk);
 
-void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r);
+void mm_sketch(void *km, const char *str, int len, int w, int k, uint32_t rid, int is_hpc, mm128_v *p);
+
+void mm_write_sam_SQ(const mm_idx_t *idx);
+void mm_write_sam_hdr_no_SQ(const char *rg, const char *ver, int argc, char *argv[]);
+void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int opt_flag);
 void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int n_regs, const mm_reg1_t *regs);
-int mm_chain_dp(int max_dist, int bw, int max_skip, int min_cnt, int min_sc, int64_t n, mm128_t *a, uint64_t **_u, void *km);
+
+void mm_idxopt_init(mm_idxopt_t *opt);
+const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n);
+int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq);
+int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f);
+int mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int min_cnt, int min_sc, int is_cdna, int64_t n, mm128_t *a, uint64_t **_u, void *km);
 mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a);
 
 mm_reg1_t *mm_gen_regs(void *km, int qlen, int n_u, uint64_t *u, mm128_t *a);
 void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a);
 void mm_sync_regs(void *km, int n_regs, mm_reg1_t *regs);
 int mm_set_sam_pri(int n, mm_reg1_t *r);
-void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r);
+void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r, int sub_diff);
 void mm_select_sub(void *km, float mask_level, float pri_ratio, int min_diff, int best_n, int *n_, mm_reg1_t *r);
 void mm_filter_regs(void *km, const mm_mapopt_t *opt, int *n_regs, mm_reg1_t *regs);
 void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs, mm128_t *a);
 void mm_hit_sort_by_dp(void *km, int *n_regs, mm_reg1_t *r);
-void mm_set_mapq(int n_regs, mm_reg1_t *regs, int min_chain_sc);
+void mm_set_mapq(int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len);
 
 #ifdef __cplusplus
 }

python/README.rst

@@ -0,0 +1,141 @@
+==============================
+Mappy: Minimap2 Python Binding
+==============================
+
+Mappy provides a convenient interface to `minimap2
+<https://github.com/lh3/minimap2>`_, a fast and accurate C program to align
+genomic and transcribe nucleotide sequences.
+
+Installation
+------------
+
+Mappy depends on `zlib <http://zlib.net>`_. It can be installed with `pip
+<https://en.wikipedia.org/wiki/Pip_(package_manager)>`_:
+
+.. code:: shell
+
+	pip install --user mappy
+
+or from the minimap2 github repo (`Cython <http://cython.org>`_ required):
+
+.. code:: shell
+
+	git clone https://github.com/lh3/minimap2
+	cd minimap2
+	python setup.py install
+
+Usage
+-----
+
+The following Python script demonstrates the key functionality of mappy:
+
+.. code:: python
+
+	import mappy as mp
+	a = mp.Aligner("test/MT-human.fa")  # load or build index
+	if not a: raise Exception("ERROR: failed to load/build index")
+	for name, seq, qual in mp.fastx_read("test/MT-orang.fa"): # read a fasta/q sequence
+		for hit in a.map(seq): # traverse alignments
+			print("{}\t{}\t{}\t{}".format(hit.ctg, hit.r_st, hit.r_en, hit.cigar_str))
+
+APIs
+----
+
+Mappy implements two classes and one global function.
+
+Class mappy.Aligner
+~~~~~~~~~~~~~~~~~~~
+
+.. code:: python
+
+	mappy.Aligner(fn_idx_in, preset=None, ...)
+
+This constructor accepts the following arguments:
+
+* **fn_idx_in**: index or sequence file name. Minimap2 automatically tests the
+  file type. If a sequence file is provided, minimap2 builds an index. The
+  sequence file can be optionally gzip'd.
+
+* **preset**: minimap2 preset. Currently, minimap2 supports the following
+  presets: **sr** for single-end short reads; **map-pb** for PacBio
+  read-to-reference mapping; **map-ont** for Oxford Nanopore read mapping;
+  **splice** for long-read spliced alignment; **asm5** for assembly-to-assembly
+  alignment; **asm10** for full genome alignment of closely related species. Note
+  that the Python module does not support all-vs-all read overlapping.
+
+* **k**: k-mer length, no larger than 28
+
+* **w**: minimizer window size, no larger than 255
+
+* **min_cnt**: mininum number of minimizers on a chain
+
+* **min_chain_score**: minimum chaing score
+
+* **bw**: chaining and alignment band width
+
+* **best_n**: max number of alignments to return
+
+* **n_threads**: number of indexing threads; 3 by default
+
+* **fn_idx_out**: name of file to which the index is written
+
+.. code:: python
+
+	mappy.Aligner.map(seq)
+
+This method aligns :code:`seq` against the index. It is a generator, *yielding*
+a series of :code:`mappy.Alignment` objects.
+
+Class mappy.Alignment
+~~~~~~~~~~~~~~~~~~~~~
+
+This class describes an alignment. An object of this class has the following
+properties:
+
+* **ctg**: name of the reference sequence the query is mapped to
+
+* **ctg_len**: total length of the reference sequence
+
+* **r_st** and **r_en**: start and end positions on the reference
+
+* **q_st** and **q_en**: start and end positions on the query
+
+* **strand**: +1 if on the forward strand; -1 if on the reverse strand
+
+* **mapq**: mapping quality
+
+* **NM**: number of mismatches and gaps in the alignment
+
+* **blen**: length of the alignment, including both alignment matches and gaps
+
+* **trans_strand**: transcript strand. +1 if on the forward strand; -1 if on the
+  reverse strand; 0 if unknown
+
+* **is_primary**: if the alignment is primary (typically the best and the first
+  to generate)
+
+* **cigar_str**: CIGAR string
+
+* **cigar**: CIGAR returned as an array of shape :code:`(n_cigar,2)`. The two
+  numbers give the length and the operator of each CIGAR operation.
+
+An :code:`Alignment` object can be converted to a string with :code:`str()` in
+the following format:
+
+::
+
+	q_st  q_en  strand  ctg  ctg_len  r_st  r_en  blen-NM  blen  mapq  cg:Z:cigar_str
+
+It is effectively the PAF format without the QueryName and QueryLength columns
+(the first two columns in PAF).
+
+Function mappy.fastx_read
+~~~~~~~~~~~~~~~~~~~~~~~~~
+
+.. code:: python
+
+	mappy.fastx_read(fn)
+
+This generator function opens a FASTA/FASTQ file and *yields* a
+:code:`(name,seq,qual)` tuple for each sequence entry. The input file may be
+optionally gzip'd.

python/cmappy.h

@@ -0,0 +1,70 @@
+#ifndef CMAPPY_H
+#define CMAPPY_H
+
+#include <stdlib.h>
+#include <string.h>
+#include <zlib.h>
+#include "minimap.h"
+#include "kseq.h"
+KSEQ_DECLARE(gzFile)
+
+typedef struct {
+	const char *ctg;
+	int32_t ctg_start, ctg_end;
+	int32_t qry_start, qry_end;
+	int32_t blen, NM, ctg_len;
+	uint8_t mapq, is_primary;
+	int8_t strand, trans_strand;
+	int32_t n_cigar32;
+	uint32_t *cigar32;
+} mm_hitpy_t;
+
+static inline void mm_reg2hitpy(const mm_idx_t *mi, mm_reg1_t *r, mm_hitpy_t *h)
+{
+	h->ctg = mi->seq[r->rid].name;
+	h->ctg_len = mi->seq[r->rid].len;
+	h->ctg_start = r->rs, h->ctg_end = r->re;
+	h->qry_start = r->qs, h->qry_end = r->qe;
+	h->strand = r->rev? -1 : 1;
+	h->mapq = r->mapq;
+	h->blen = r->p->blen;
+	h->NM = r->p->n_diff;
+	h->trans_strand = r->p->trans_strand == 1? 1 : r->p->trans_strand == 2? -1 : 0;
+	h->is_primary = (r->id == r->parent);
+	h->n_cigar32 = r->p->n_cigar;
+	h->cigar32 = r->p->cigar;
+}
+
+static inline void mm_free_reg1(mm_reg1_t *r)
+{
+	free(r->p);
+}
+
+static inline kseq_t *mm_fastx_open(const char *fn)
+{
+	gzFile fp;
+	fp = fn && strcmp(fn, "-") != 0? gzopen(fn, "r") : gzdopen(fileno(stdin), "r");
+	return kseq_init(fp);
+}
+
+static inline void mm_fastx_close(kseq_t *ks)
+{
+	gzFile fp;
+	fp = ks->f->f;
+	kseq_destroy(ks);
+	gzclose(fp);
+}
+
+static inline int mm_verbose_level(int v)
+{
+	if (v >= 0) mm_verbose = v;
+	return mm_verbose;
+}
+
+static inline void mm_reset_timer(void)
+{
+	extern double realtime(void);
+	mm_realtime0 = realtime();
+}
+
+#endif

python/cmappy.pxd

@@ -0,0 +1,112 @@
+from libc.stdint cimport int8_t, uint8_t, int32_t, int64_t, uint32_t, uint64_t
+
+cdef extern from "minimap.h":
+	#
+	# Options
+	#
+	ctypedef struct mm_idxopt_t:
+		short k, w, is_hpc, bucket_bits
+		int mini_batch_size
+		uint64_t batch_size
+
+	ctypedef struct mm_mapopt_t:
+		int sdust_thres
+		int flag
+		int bw
+		int max_gap, max_gap_ref
+		int max_chain_skip
+		int min_cnt
+		int min_chain_score
+		float mask_level
+		float pri_ratio
+		int best_n
+		int max_join_long, max_join_short
+		int min_join_flank_sc
+		int a, b, q, e, q2, e2
+		int noncan
+		int zdrop
+		int min_dp_max
+		int min_ksw_len
+		float mid_occ_frac
+		int32_t mid_occ
+		int mini_batch_size
+
+	int mm_set_opt(char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
+	int mm_verbose
+
+	#
+	# Indexing
+	#
+	ctypedef struct mm_idx_seq_t:
+		char *name
+		uint64_t offset
+		uint32_t len
+
+	ctypedef struct mm_idx_bucket_t:
+		pass
+
+	ctypedef struct mm_idx_t:
+		int32_t b, w, k, is_hpc
+		uint32_t n_seq
+		mm_idx_seq_t *seq
+		uint32_t *S
+		mm_idx_bucket_t *B
+		void *km
+
+	ctypedef struct mm_idx_reader_t:
+		pass
+
+	mm_idx_reader_t *mm_idx_reader_open(const char *fn, const mm_idxopt_t *opt, const char *fn_out)
+	mm_idx_t *mm_idx_reader_read(mm_idx_reader_t *r, int n_threads)
+	void mm_idx_reader_close(mm_idx_reader_t *r)
+	void mm_idx_destroy(mm_idx_t *mi)
+	void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
+
+	#
+	# Mapping (key struct defined in cmappy.h below)
+	#
+	ctypedef struct mm_reg1_t:
+		pass
+
+	ctypedef struct mm_tbuf_t:
+		pass
+
+	mm_tbuf_t *mm_tbuf_init()
+	void mm_tbuf_destroy(mm_tbuf_t *b)
+	mm_reg1_t *mm_map(const mm_idx_t *mi, int l_seq, const char *seq, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *name)
+
+#
+# Helper header (because it is hard to expose mm_reg1_t with Cython)
+#
+cdef extern from "cmappy.h":
+	ctypedef struct mm_hitpy_t:
+		const char *ctg
+		int32_t ctg_start, ctg_end
+		int32_t qry_start, qry_end
+		int32_t blen, NM, ctg_len
+		uint8_t mapq, is_primary
+		int8_t strand, trans_strand
+		int32_t n_cigar32
+		uint32_t *cigar32
+
+	void mm_reg2hitpy(const mm_idx_t *mi, mm_reg1_t *r, mm_hitpy_t *h)
+	void mm_free_reg1(mm_reg1_t *r)
+
+	ctypedef struct kstring_t:
+		unsigned l, m
+		char *s
+
+	ctypedef struct kstream_t:
+		pass
+
+	ctypedef struct kseq_t:
+		kstring_t name, comment, seq, qual
+		int last_char
+		kstream_t *f
+
+	kseq_t *mm_fastx_open(const char *fn)
+	void mm_fastx_close(kseq_t *ks)
+	int kseq_read(kseq_t *seq)
+
+	int mm_verbose_level(int v)
+	void mm_reset_timer()

python/mappy.pyx

@@ -0,0 +1,154 @@
+from libc.stdint cimport uint8_t, int8_t
+from libc.stdlib cimport free
+cimport cmappy
+
+cmappy.mm_reset_timer()
+
+cdef class Alignment:
+	cdef int _ctg_len, _r_st, _r_en
+	cdef int _q_st, _q_en
+	cdef int _NM, _blen
+	cdef int8_t _strand, _trans_strand
+	cdef uint8_t _mapq, _is_primary
+	cdef _ctg, _cigar # these are python objects
+
+	def __cinit__(self, ctg, cl, cs, ce, strand, qs, qe, mapq, cigar, is_primary, blen, NM, trans_strand):
+		self._ctg, self._ctg_len, self._r_st, self._r_en = str(ctg), cl, cs, ce
+		self._strand, self._q_st, self._q_en = strand, qs, qe
+		self._NM, self._blen = NM, blen
+		self._mapq = mapq
+		self._cigar = cigar
+		self._is_primary = is_primary
+		self._trans_strand = trans_strand
+
+	@property
+	def ctg(self): return self._ctg
+
+	@property
+	def ctg_len(self): return self._ctg_len
+
+	@property
+	def r_st(self): return self._r_st
+
+	@property
+	def r_en(self): return self._r_en
+
+	@property
+	def strand(self): return self.strand
+
+	@property
+	def trans_strand(self): return self._trans_strand
+
+	@property
+	def NM(self): return self._NM
+
+	@property
+	def is_primary(self): return (self._is_primary != 0)
+
+	@property
+	def q_st(self): return self._q_st
+
+	@property
+	def q_en(self): return self._q_en
+
+	@property
+	def mapq(self): return self._mapq
+
+	@property
+	def cigar(self): return self._cigar
+
+	@property
+	def cigar_str(self):
+		return "".join(map(lambda x: str(x[0]) + 'MIDNSH'[x[1]], self._cigar))
+
+	def __str__(self):
+		if self._strand > 0: strand = '+'
+		elif self._strand < 0: strand = '-'
+		else: strand = '?'
+		if self._is_primary != 0: tp = 'tp:A:P'
+		else: tp = 'tp:A:S'
+		if self._trans_strand > 0: ts = 'ts:A:+'
+		elif self._trans_strand < 0: ts = 'ts:A:-'
+		else: ts = 'ts:A:.'
+		return "\t".join([str(self._q_st), str(self._q_en), strand, self._ctg, str(self._ctg_len), str(self._r_st), str(self._r_en),
+				str(self._blen - self._NM), str(self._blen), str(self._mapq), tp, ts, "cg:Z:" + self.cigar_str])
+
+cdef class ThreadBuffer:
+	cdef cmappy.mm_tbuf_t *_b
+
+	def __cinit__(self):
+		self._b = cmappy.mm_tbuf_init()
+
+	def __dealloc__(self):
+		cmappy.mm_tbuf_destroy(self._b)
+
+cdef class Aligner:
+	cdef cmappy.mm_idx_t *_idx
+	cdef cmappy.mm_idxopt_t idx_opt
+	cdef cmappy.mm_mapopt_t map_opt
+
+	def __cinit__(self, fn_idx_in, preset=None, k=None, w=None, min_cnt=None, min_chain_score=None, min_dp_score=None, bw=None, best_n=None, n_threads=3, fn_idx_out=None):
+		cmappy.mm_set_opt(NULL, &self.idx_opt, &self.map_opt) # set the default options
+		if preset is not None:
+			cmappy.mm_set_opt(str.encode(preset), &self.idx_opt, &self.map_opt) # apply preset
+		self.map_opt.flag |= 4 # always perform alignment
+		self.idx_opt.batch_size = 0x7fffffffffffffffL # always build a uni-part index
+		if k is not None: self.idx_opt.k = k
+		if w is not None: self.idx_opt.w = w
+		if min_cnt is not None: self.map_opt.min_cnt = min_cnt
+		if min_chain_score is not None: self.map_opt.min_chain_score = min_chain_score
+		if min_dp_score is not None: self.map_opt.min_dp_max = min_dp_score
+		if bw is not None: self.map_opt.bw = bw
+		if best_n is not None: self.best_n = best_n
+
+		cdef cmappy.mm_idx_reader_t *r;
+		if fn_idx_out is None:
+			r = cmappy.mm_idx_reader_open(str.encode(fn_idx_in), &self.idx_opt, NULL)
+		else:
+			r = cmappy.mm_idx_reader_open(str.encode(fn_idx_in), &self.idx_opt, fn_idx_out)
+		if r is not NULL:
+			self._idx = cmappy.mm_idx_reader_read(r, n_threads) # NB: ONLY read the first part
+			cmappy.mm_idx_reader_close(r)
+			cmappy.mm_mapopt_update(&self.map_opt, self._idx)
+
+	def __dealloc__(self):
+		if self._idx is not NULL:
+			cmappy.mm_idx_destroy(self._idx)
+
+	def __bool__(self):
+		return (self._idx != NULL)
+
+	def map(self, seq, buf=None):
+		cdef cmappy.mm_reg1_t *regs
+		cdef cmappy.mm_hitpy_t h
+		cdef ThreadBuffer b
+		cdef int n_regs
+
+		if self._idx is NULL: return None
+		if buf is None: b = ThreadBuffer()
+		else: b = buf
+		regs = cmappy.mm_map(self._idx, len(seq), str.encode(seq), &n_regs, b._b, &self.map_opt, NULL)
+
+		for i in range(n_regs):
+			cmappy.mm_reg2hitpy(self._idx, &regs[i], &h)
+			cigar = []
+			for k in range(h.n_cigar32):
+				c = h.cigar32[k]
+				cigar.append([c>>4, c&0xf])
+			yield Alignment(h.ctg, h.ctg_len, h.ctg_start, h.ctg_end, h.strand, h.qry_start, h.qry_end, h.mapq, cigar, h.is_primary, h.blen, h.NM, h.trans_strand)
+			cmappy.mm_free_reg1(&regs[i])
+		free(regs)
+
+def fastx_read(fn):
+	cdef cmappy.kseq_t *ks
+	ks = cmappy.mm_fastx_open(str.encode(fn))
+	if ks is NULL: return None
+	while cmappy.kseq_read(ks) >= 0:
+		if ks.qual.l > 0: qual = str(ks.qual.s)
+		else: qual = None
+		yield str(ks.name.s), str(ks.seq.s), qual
+	cmappy.mm_fastx_close(ks)
+
+def verbose(v=None):
+	if v is None: v = -1
+	return cmappy.mm_verbose_level(v)

python/minimap2.py

@@ -0,0 +1,35 @@
+#!/usr/bin/env python
+
+import sys, getopt
+import mappy as mp
+
+def main(argv):
+	opts, args = getopt.getopt(argv[1:], "x:n:m:k:w:r:")
+	if len(args) < 2:
+		print("Usage: minimap2.py [options] <ref.fa>|<ref.mmi> <query.fq>")
+		print("Options:")
+		print("  -x STR      preset: sr, map-pb, map-ont, asm5, asm10 or splice")
+		print("  -n INT      mininum number of minimizers")
+		print("  -m INT      mininum chaining score")
+		print("  -k INT      k-mer length")
+		print("  -w INT      minimizer window length")
+		print("  -r INT      band width")
+		sys.exit(1)
+
+	preset, min_cnt, min_sc, k, w, bw = None, None, None, None, None, None
+	for opt, arg in opts:
+		if opt == '-x': preset = arg
+		elif opt == '-n': min_cnt = int(arg)
+		elif opt == '-m': min_chain_score = int(arg)
+		elif opt == '-r': bw = int(arg)
+		elif opt == '-k': k = int(arg)
+		elif opt == '-w': w = int(arg)
+
+	a = mp.Aligner(args[0], preset=preset, min_cnt=min_cnt, min_chain_score=min_sc, k=k, w=w, bw=bw)
+	if not a: raise Exception("ERROR: failed to load/build index file '{}'".format(args[0]))
+	for name, seq, qual in mp.fastx_read(args[1]): # read one sequence
+		for h in a.map(seq): # traverse hits
+			print('{}\t{}\t{}'.format(name, len(seq), h))
+
+if __name__ == "__main__":
+	main(sys.argv)

sdust.c

@@ -176,7 +176,7 @@ uint64_t *sdust(void *km, const uint8_t *seq, int l_seq, int T, int W, int *n)
 #ifdef _SDUST_MAIN
 #include <zlib.h>
 #include <stdio.h>
-#include <unistd.h>
+#include "getopt.h"
 #include "kseq.h"
 KSEQ_INIT(gzFile, gzread)
 

setup.py

@@ -0,0 +1,55 @@
+try:
+	from setuptools import setup, Extension
+except ImportError:
+	from distutils.core import setup
+	from distutils.extension import Extension
+
+cmdclass = {}
+
+try:
+	from Cython.Build import build_ext
+except ImportError: # without Cython
+	module_src = 'python/mappy.c'
+else: # with Cython
+	module_src = 'python/mappy.pyx'
+	cmdclass['build_ext'] = build_ext
+
+import sys
+sys.path.append('python')
+
+def readme():
+    with open('python/README.rst') as f:
+        return f.read()
+
+setup(
+	name = 'mappy',
+	version = '2.2',
+	url = 'https://github.com/lh3/minimap2',
+	description = 'Minimap2 python binding',
+	long_description = readme(),
+	author = 'Heng Li',
+	author_email = 'lh3@me.com',
+	license = 'MIT',
+	keywords = 'sequence-alignment',
+	scripts = ['python/minimap2.py'],
+    ext_modules = [Extension('mappy',
+		sources = [module_src, 'align.c', 'bseq.c', 'chain.c', 'format.c', 'hit.c', 'index.c',
+				   'ksw2_extd2_sse.c', 'ksw2_exts2_sse.c', 'ksw2_extz2_sse.c', 'ksw2_ll_sse.c',
+				   'kalloc.c', 'kthread.c', 'map.c', 'misc.c', 'sdust.c', 'sketch.c'],
+		depends = ['minimap.h', 'bseq.h', 'kalloc.h', 'kdq.h', 'khash.h', 'kseq.h', 'ksort.h',
+				   'ksw2.h', 'kthread.h', 'kvec.h', 'mmpriv.h', 'sdust.h',
+				   'python/cmappy.h', 'python/cmappy.pxd'],
+		extra_compile_args = ['-msse4'], # WARNING: ancient x86_64 CPUs don't have SSE4
+		include_dirs = ['.'],
+		libraries = ['z', 'm', 'pthread'])],
+	classifiers = [
+		'Development Status :: 4 - Beta',
+		'License :: OSI Approved :: MIT License',
+		'Operating System :: POSIX',
+		'Programming Language :: C',
+		'Programming Language :: Cython',
+		'Programming Language :: Python :: 2.7',
+		'Programming Language :: Python :: 3',
+		'Intended Audience :: Science/Research',
+		'Topic :: Scientific/Engineering :: Bio-Informatics'],
+	cmdclass = cmdclass)

sketch.c

@@ -77,11 +77,10 @@ void mm_sketch(void *km, const char *str, int len, int w, int k, uint32_t rid, i
 {
 	uint64_t shift1 = 2 * (k - 1), mask = (1ULL<<2*k) - 1, kmer[2] = {0,0};
 	int i, j, l, buf_pos, min_pos, kmer_span = 0;
-	mm128_t *buf, min = { UINT64_MAX, UINT64_MAX };
+	mm128_t buf[256], min = { UINT64_MAX, UINT64_MAX };
 	tiny_queue_t tq;
 
-	assert(len > 0 && w > 0 && k > 0 && k <= 28); // 56 bits for k-mer; could use long k-mers, but 28 enough in practice
+	assert(len > 0 && (w > 0 && w < 256) && (k > 0 && k <= 28)); // 56 bits for k-mer; could use long k-mers, but 28 enough in practice
-	buf = (mm128_t*)alloca(w * 16);
 	memset(buf, 0xff, w * 16);
 	memset(&tq, 0, sizeof(tiny_queue_t));
 	kv_resize(mm128_t, km, *p, p->n + len/w);

test/q2.fa

@@ -0,0 +1,2 @@
+>q2
+GGACATCCCGATGGTGCAGTCCTACCTGTACGAAAGGAC

test/t2.fa

@@ -0,0 +1,2 @@
+>t2
+GGACATCCCGATGGTGCAGgtGCTATTAAAGGTTCGTTTGTTCAACGATTAAagTCCTACCTGTACGAAAGGAC

tex/Makefile

@@ -0,0 +1,21 @@
+.SUFFIXES: .gp .tex .eps .pdf .eps.gz
+
+.eps.pdf:
+		epstopdf --outfile $@ $<
+
+.eps.gz.pdf:
+		gzip -dc $< | epstopdf --filter > $@
+
+.pdf.eps:
+		pdftops -eps $< $@
+
+all:minimap2.pdf
+
+roc-color.eps:roc.gp
+		gnuplot roc.gp
+
+minimap2.pdf:minimap2.tex minimap2.bib roc-color.pdf
+		pdflatex minimap2; bibtex minimap2; pdflatex minimap2; pdflatex minimap2;
+
+clean:
+		rm -fr *.toc *.aux *.bbl *.blg *.idx *.log *.out *~ minimap2.pdf

tex/bioinfo.cls

@@ -0,0 +1,930 @@
+\newcommand\classname{bioinfo}
+\newcommand\lastmodifieddate{2003/02/08}
+\newcommand\versionnumber{0.1}
+
+% Are we printing crop marks?
+\newif\if@cropmarkson \@cropmarksontrue
+
+\NeedsTeXFormat{LaTeX2e}[2001/06/01]
+\ProvidesClass{\classname}[\lastmodifieddate\space\versionnumber]
+
+\setlength{\paperheight}{11truein}
+\setlength{\paperwidth}{8.5truein}
+
+\newif\if@final
+
+\DeclareOption{draft}{\PassOptionsToPackage{draft}{graphicx}}
+\DeclareOption{a4paper}{\PassOptionsToPackage{a4}{crop}}
+\DeclareOption{centre}{\PassOptionsToPackage{center}{crop}}
+\DeclareOption{crop}{\PassOptionsToPackage{cam}{crop}\global\@cropmarksontrue}
+\DeclareOption{nocrop}{\PassOptionsToPackage{off}{crop}\global\@cropmarksonfalse}
+\DeclareOption{info}{\PassOptionsToPackage{info}{crop}}
+\DeclareOption{noinfo}{\PassOptionsToPackage{noinfo}{crop}}
+\DeclareOption{final}{\global\@finaltrue}
+
+\ExecuteOptions{a4paper,nocrop,centre,info}
+
+\ProcessOptions
+
+% Load all necessary packages
+\RequirePackage{inputenc,crop,graphicx,amsmath,array,color,amssymb,flushend,stfloats,amsthm,chngpage,times}
+%\RequirePackage[LY1]{fontenc}
+%\RequirePackage[LY1,mtbold]{mathtime}
+\def\authoraffliate{\fontfamily{phv}\selectfont}
+\def\helvetica{\fontfamily{phv}\selectfont}
+\def\helveticaitalic{\fontfamily{phv}\itshape\selectfont}
+\def\helveticabold{\fontfamily{phv}\bfseries\selectfont}
+\def\helveticabolditalic{\fontfamily{phv}\bfseries\itshape\selectfont}
+
+% Not sure if needed.
+\newcommand\@ptsize{0}
+
+% Set twoside printing
+\@twosidetrue
+
+% Marginal notes are on the outside edge
+\@mparswitchfalse
+
+\reversemarginpar
+
+\renewcommand\normalsize{%
+   \@setfontsize\normalsize{9}{11}%
+   \abovedisplayskip 10\p@ \@plus2\p@ \@minus5\p@
+   \abovedisplayshortskip \z@ \@plus3\p@
+   \belowdisplayshortskip 6\p@ \@plus3\p@ \@minus3\p@
+   \belowdisplayskip \abovedisplayskip
+   \let\@listi\@listI}
+\normalsize
+\let\@bls\baselineskip
+
+\newcommand\small{%
+    \@setfontsize\small{9}{11}%
+    \abovedisplayskip 11\p@ minus 3\p@
+    \belowdisplayskip \abovedisplayskip
+    \abovedisplayshortskip \z@ plus 2\p@
+    \belowdisplayshortskip 4\p@ plus 2\p@ minus2\p@
+    \def\@listi{\topsep 4.5\p@ plus 2\p@ minus 1\p@
+       \itemsep \parsep
+       \topsep 4\p@ plus 2\p@ minus 2\p@}}
+
+\newcommand\footnotesize{%
+    \@setfontsize\footnotesize{8}{10}%
+    \abovedisplayskip 6\p@ minus 3\p@
+    \belowdisplayskip\abovedisplayskip
+    \abovedisplayshortskip \z@ plus 3\p@
+    \belowdisplayshortskip 6\p@ plus 3\p@ minus 3\p@
+    \def\@listi{\topsep 3\p@ plus 1\p@ minus 1\p@
+       \parsep 2\p@ plus 1\p@ minus 1\p@\itemsep \parsep}}
+
+\def\scriptsize{\@setfontsize\scriptsize{7pt}{9pt}}
+\def\tiny{\@setfontsize\tiny{5pt}{7pt}}
+\def\large{\@setfontsize\large{11.5pt}{12pt}}
+\def\Large{\@setfontsize\Large{14pt}{16}}
+\def\LARGE{\@setfontsize\LARGE{15pt}{17pt}}
+\def\huge{\@setfontsize\huge{22pt}{22pt}}
+\def\Huge{\@setfontsize\Huge{30pt}{30pt}}
+
+\DeclareOldFontCommand{\rm}{\normalfont\rmfamily}{\mathrm}
+\DeclareOldFontCommand{\sf}{\normalfont\sffamily}{\mathsf}
+\DeclareOldFontCommand{\tt}{\normalfont\ttfamily}{\mathtt}
+\DeclareOldFontCommand{\bf}{\normalfont\bfseries}{\mathbf}
+\DeclareOldFontCommand{\it}{\normalfont\itshape}{\mathit}
+\DeclareOldFontCommand{\sl}{\normalfont\slshape}{\@nomath\sl}
+\DeclareOldFontCommand{\sc}{\normalfont\scshape}{\@nomath\sc}
+
+% Line spacing
+\setlength\lineskip{1\p@}
+\setlength\normallineskip{1\p@}
+\renewcommand\baselinestretch{}
+
+% Paragraph dimensions and inter-para spacing
+\setlength\parskip{0\p@}
+\setlength\parindent{3mm}
+
+% Set inter-para skips
+\setlength\smallskipamount{3\p@ \@plus 1\p@ \@minus 1\p@}
+\setlength\medskipamount{6\p@ \@plus 2\p@}
+\setlength\bigskipamount{12\p@ \@plus 4\p@ \@minus 4\p@}
+
+% Page break penalties
+\@lowpenalty   51
+\@medpenalty  151
+\@highpenalty 301
+
+% Disallow widows and orphans
+\clubpenalty 10000
+\widowpenalty 10000
+
+% Disable page breaks before equations, allow pagebreaks after
+% equations and discourage widow lines before equations.
+\displaywidowpenalty 100
+\predisplaypenalty   10000
+\postdisplaypenalty  2500
+
+% Allow breaking the page in the middle of a paragraph
+\interlinepenalty 0
+
+% Disallow breaking the page after a hyphenated line
+\brokenpenalty 10000
+
+% Hyphenation; don't split words into less than three characters
+\lefthyphenmin=3
+\righthyphenmin=3
+
+%
+% Set page layout dimensions
+%
+\setlength\headheight{16\p@}        % height of running head
+\setlength\topmargin{2.9pc}         % head margin
+\addtolength\topmargin{-1in}        % subtract out the 1 inch driver margin
+
+\setlength\topskip{10\p@}           % height of first line of text
+\setlength\headsep{19\p@}        %   space below running head --
+
+\setlength\footskip{34\p@}          % space above footer line
+\setlength\maxdepth{.5\topskip}     % pages can be short or deep by half a line?
+
+\setlength\textwidth{42pc}          % text measure excluding margins
+
+\setlength\textheight{58\baselineskip} % 54 lines on a full page,
+\addtolength\textheight{\topskip}      %   including the first
+                                       %   line on the page
+
+% Set the margins
+\setlength\marginparsep{3\p@}
+\setlength\marginparpush{3\p@}
+\setlength\marginparwidth{35\p@}
+
+\setlength\oddsidemargin{4.5pc}
+\addtolength\oddsidemargin{-1in}     % subtract out the 1 inch driver margin
+\setlength\@tempdima{\paperwidth}
+\addtolength\@tempdima{-\textwidth}
+\addtolength\@tempdima{-4.5pc}
+\setlength\evensidemargin{\@tempdima}
+\addtolength\evensidemargin{-1in}
+
+\setlength\columnsep{1.5pc}          % space between columns for double-column text
+\setlength\columnseprule{0\p@}       % width of rule between two columns
+
+% Footnotes
+\setlength\footnotesep{9\p@}      % space between footnotes
+% space between text and footnote
+\setlength{\skip\footins}{12\p@ \@plus 6\p@ \@minus 1\p@}
+
+% Float placement parameters
+
+% The total number of floats that can be allowed on a page.
+\setcounter{totalnumber}{10}
+% The maximum number of floats at the top and bottom of a page.
+\setcounter{topnumber}{5}
+\setcounter{bottomnumber}{5}
+% The maximum part of the top or bottom of a text page that can be
+% occupied by floats. This is set so that at least four lines of text
+% fit on the page.
+\renewcommand\topfraction{.9}
+\renewcommand\bottomfraction{.9}
+% The minimum amount of a text page that must be occupied by text.
+% This should accomodate four lines of text.
+\renewcommand\textfraction{.06}
+% The minimum amount of a float page that must be occupied by floats.
+\renewcommand\floatpagefraction{.94}
+
+% The same parameters repeated for double column output
+\renewcommand\dbltopfraction{.9}
+\renewcommand\dblfloatpagefraction{.9}
+
+% Space between floats
+\setlength\floatsep    {12\p@ \@plus 2\p@ \@minus 2\p@}
+% Space between floats and text
+\setlength\textfloatsep{20\p@ \@plus 2\p@ \@minus 4\p@}
+% Space above and below an inline figure
+\setlength\intextsep   {18\p@ \@plus 2\p@ \@minus 2\p@}
+
+% For double column floats
+\setlength\dblfloatsep    {12\p@ \@plus 2\p@ \@minus 2\p@}
+\setlength\dbltextfloatsep{20\p@ \@plus 2\p@ \@minus 4\p@}
+
+% Space left at top, bottom and inbetween floats on a float page.
+\setlength\@fptop{0\p@}         % no space above float page figures
+\setlength\@fpsep{12\p@ \@plus 1fil}
+\setlength\@fpbot{0\p@}
+
+% The same for double column
+\setlength\@dblfptop{0\p@}
+\setlength\@dblfpsep{12\p@ \@plus 1fil}
+\setlength\@dblfpbot{0\p@}
+
+% Override settings in mathtime back to TeX defaults
+\DeclareMathSizes{5}     {5}   {5}  {5}
+\DeclareMathSizes{6}     {6}   {5}  {5}
+\DeclareMathSizes{7}     {7}   {5}  {5}
+\DeclareMathSizes{8}     {8}   {6}  {5}
+\DeclareMathSizes{9}     {9}   {6.5}  {5}
+\DeclareMathSizes{10}   {10}   {7.5}  {5}
+\DeclareMathSizes{12}   {12}   {9}  {7}
+
+% Page styles
+\def\ps@headings
+  {%
+  \def\@oddfoot{\vbox to 12.5\p@{\hbox{\rule{\textwidth}{0.5\p@}}\vss
+        \hbox to \textwidth{\hfill\helveticabold\small\thepage}%
+        }}%
+  \def\@evenfoot{\vbox to 12.5\p@{\rule{\textwidth}{0.5\p@}\vss
+        \hbox to \textwidth{\helveticabold\small\thepage\hfill}%
+        }}%
+  \def\@evenhead{\vbox{\hbox to \textwidth{\fontsize{8}{10}\selectfont
+        \helveticabold{\fontshape{it}\selectfont
+        \strut\leftmark}\hfill}\vspace{6.5\p@}\rule{\textwidth}{0.5\p@}}}%
+  \def\@oddhead{\vbox{\hbox to \textwidth{\hfill\fontsize{8}{10}\selectfont
+        \helveticabold{\fontshape{it}\selectfont\strut\rightmark}}%
+        \vspace{6.5\p@}\rule{\textwidth}{0.5\p@}}}%
+  \def\titlemark##1{\markboth{##1}{##1}}%
+  \def\authormark##1{\gdef\leftmark{##1}}%
+  }
+
+\def\ps@opening
+  {%
+  \def\@oddfoot{\vbox to 13\p@{\hbox{\rule{\textwidth}{1\p@}}\vss
+        \hbox to \textwidth{\helvetica
+        \fontsize{7}{9}\fontshape{n}\selectfont%
+          \hfill\small\helveticabold\thepage}%
+        }}%
+  \def\@evenfoot{\vbox to 13\p@{\rule{\textwidth}\vss
+        \hbox to \textwidth{\helvetica\thepage\hfill
+          \fontsize{7}{9}\fontshape{n}\selectfont}%
+        }}%
+  \let\@evenhead\relax
+  \let\@oddhead\relax}
+
+% Page range
+\newif\iflastpagegiven   \lastpagegivenfalse
+\newcommand\firstpage[1]{%
+  \gdef\@firstpage{#1}%
+  \ifnum\@firstpage>\c@page
+    \setcounter{page}{#1}%
+    \ClassWarning{BIO}{Increasing pagenumber to \@firstpage}%
+  \else \ifnum\@firstpage<\c@page
+    \ClassWarning{BIO}{Firstpage lower than pagenumber}\fi\fi
+    \xdef\@firstpage{\the\c@page}%
+    }
+\def\@firstpage{1}
+\def\pagenumbering#1{%
+    \global\c@page \@ne
+    \gdef\thepage{\csname @#1\endcsname \c@page}%
+    \gdef\thefirstpage{%
+            \csname @#1\endcsname \@firstpage}%
+    \gdef\thelastpage{%
+            \csname @#1\endcsname \@lastpage}%
+    }
+
+\newcommand\lastpage[1]{\xdef\@lastpage{#1}%
+  \global\lastpagegiventrue}
+\def\@lastpage{0}
+\def\setlastpage{\iflastpagegiven\else
+    \edef\@tempa{@lastpage@}%
+    \expandafter
+    \ifx \csname \@tempa \endcsname \relax
+        \gdef\@lastpage{0}%
+    \else
+        \xdef\@lastpage{\@nameuse{@lastpage@}}%
+        \fi
+    \fi }
+\def\writelastpage{%
+    \iflastpagegiven \else
+    \immediate\write\@auxout%
+    {\string\global\string\@namedef{@lastpage@}{\the\c@page}}%
+    \fi
+    }
+\def\thepagerange{%
+  \ifnum\@lastpage =0 {\ \bf ???} \else
+  \ifnum\@lastpage = \@firstpage \ \thefirstpage\else
+  \thefirstpage--\thelastpage \fi\fi}
+
+\AtBeginDocument{\setlastpage
+     \pagenumbering{arabic}%
+   }
+\AtEndDocument{%
+    \writelastpage
+    \if@final
+    \clearemptydoublepage
+    \else
+    \clearpage
+    \fi}
+
+%
+% Sectional units
+%
+
+% Counters
+\newcounter{section}
+\newcounter{subsection}[section]
+\newcounter{subsubsection}[subsection]
+\newcounter{paragraph}[subsubsection]
+\newcounter{subparagraph}[paragraph]
+\newcounter{figure}
+\newcounter{table}
+
+% Form of the numbers
+\newcommand\thepage{\arabic{page}}
+\renewcommand\thesection{\arabic{section}}
+\renewcommand\thesubsection{{\thesection.\arabic{subsection}}}
+\renewcommand\thesubsubsection{{\thesubsection.\arabic{subsubsection}}}
+\renewcommand\theparagraph{\thesubsubsection.\arabic{paragraph}}
+\renewcommand\thesubparagraph{\theparagraph.\arabic{subparagraph}}
+\renewcommand\theequation{\arabic{equation}}
+
+% Form of the words
+\newcommand\contentsname{Contents}
+\newcommand\listfigurename{List of Figures}
+\newcommand\listtablename{List of Tables}
+\newcommand\partname{Part}
+\newcommand\appendixname{Appendix}
+\newcommand\abstractname{Abstract}
+\newcommand\refname{References}
+\newcommand\bibname{References}
+\newcommand\indexname{Index}
+\newcommand\figurename{Fig.}
+\newcommand\tablename{Table}
+
+% Clearemptydoublepage should really clear the running heads too
+\newcommand{\clearemptydoublepage}{\newpage{\pagestyle{empty}\cleardoublepage}}
+
+% Frontmatter, mainmatter and backmatter
+
+\newif\if@mainmatter \@mainmattertrue
+
+\newcommand\frontmatter{%
+  \clearpage
+  \@mainmatterfalse
+  \pagenumbering{roman}}
+
+\newcommand\mainmatter{%
+  \clearpage
+  \@mainmattertrue
+  \pagenumbering{arabic}}
+
+\newcommand\backmatter{%
+  \clearpage
+  \@mainmatterfalse}
+
+%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% TITLE %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%
+\newlength{\dropfromtop}
+\setlength{\dropfromtop}{\z@}
+
+% Application Notes
+\newif\if@appnotes
+\newcommand{\application}{%
+%  \setlength{\dropfromtop}{-2.25pc}%
+  \global\@appnotestrue}
+
+\long\def\title{\@ifnextchar[{\short@title}{\@@title}}
+\def\short@title[#1]{\titlemark{#1}\@@@title}
+\def\@@title#1{\authormark{#1}\@@@title{#1}}
+\long\def\@@@title#1{\gdef\@title{#1}}
+
+\long\def\author{\@ifnextchar[{\short@uthor}{\@uthor}}
+\def\short@uthor[#1]{\authormark{#1}\@@author}
+\def\@uthor#1{\authormark{#1}\@@author{#1}}
+\long\def\@@author#1{\gdef\@author{#1}}
+
+\def\vol#1{\global\def\@vol{#1}}
+\def\issue#1{\global\def\@issue{#1}}
+\def\address#1{\global\def\@issue{#1}}
+\def\history#1{\global\def\@history{#1}}
+\def\editor#1{\global\def\@editor{#1}}
+\def\pubyear#1{\global\def\@pubyear{#1}}
+\def\copyrightyear#1{\global\def\@copyrightyear{#1}}
+\def\address#1{\global\def\@address{#1}}
+\def\DOI#1{\global\def\@DOI{#1}}
+
+\definecolor{gray}{cmyk}{0, 0, 0, 0.15}
+\newlength{\extraspace}
+\setlength{\extraspace}{\z@}
+
+\newcommand\maketitle{\par
+  \begingroup
+    \renewcommand\thefootnote{\@fnsymbol\c@footnote}%
+    \def\@makefnmark{\rlap{\@textsuperscript{\normalfont\@thefnmark}}}%
+    \long\def\@makefntext##1{\parindent 3mm\noindent
+%      \@textsuperscript{\normalfont\@thefnmark}\raggedright##1}%
+      \@textsuperscript{\normalfont\@thefnmark}##1}%
+    \if@twocolumn
+      \ifnum \col@number=\@ne
+        \@maketitle
+      \else
+        \twocolumn[\@maketitle]%
+      \fi
+    \else
+      \newpage
+      \global\@topnum\z@   % Prevents figures from going at top of page.
+      \@maketitle
+    \fi
+    \thispagestyle{opening}\@thanks
+  \endgroup
+  \setcounter{footnote}{0}%
+  \global\let\thanks\relax
+  \global\let\maketitle\relax
+  \global\let\@maketitle\relax
+  \global\let\@address\@empty
+  \global\let\@history\@empty
+  \global\let\@editor\@empty
+  \global\let\@thanks\@empty
+  \global\let\@author\@empty
+  \global\let\@date\@empty
+  \global\let\@title\@empty
+  \global\let\@pubyear\@empty
+  \global\let\address\relax
+  \global\let\history\relax
+  \global\let\editor\relax
+  \global\let\title\relax
+  \global\let\author\relax
+  \global\let\date\relax
+  \global\let\pubyear\relax
+  \global\let\@copyrightline\@empty
+  \global\let\and\relax
+  \@afterindentfalse\@afterheading
+}
+
+\newlength{\aboveskipchk}%for checking oddpage or evenpage top skip
+\setlength{\aboveskipchk}{\z@}%
+
+\def\@maketitle{%
+  \let\footnote\thanks
+  \clearemptydoublepage
+    \checkoddpage\ifcpoddpage\setlength{\aboveskipchk}{-3pc}\else\setlength{\aboveskipchk}{-5pc}\fi%for checking oddpage or evenpage top skip%%
+  \vspace*{\aboveskipchk}%
+  \vspace{\dropfromtop}%
+  \hbox to \textwidth{%
+  {\helvetica\itshape\bfseries\fontsize{19}{12}\selectfont {\color{gray}TECHNICAL REPORT}
+    \hfil
+    \if@appnotes APPLICATIONS NOTE\hfil\fi
+    }%
+\enskip  \parbox[b]{11.3pc}{%
+    \helvetica
+    \flushright\fontsize{8}{10}\fontshape{it}\selectfont
+        \hfill
+  }}
+  \rule{\textwidth}{1\p@}\par%
+  \helvetica
+  \hbox to \textwidth{%
+  \parbox[t]{41pc}{%
+    \vspace*{1sp}
+    {\helveticabold\fontsize{16}{21}\selectfont\raggedright \@title \par}%
+    \vspace{4.5\p@}
+    {\authoraffliate\fontsize{11}{13}\selectfont\raggedright \@author \par}%
+        \vspace{4\p@}
+    {\authoraffliate\fontsize{9}{11}\selectfont\raggedright \@address \par}%
+    \vspace{4\p@}
+    %{\helvetica\fontsize{8}{10}\selectfont\raggedright \@history \par}
+    %\vspace{24\p@}
+    %{\helvetica\fontsize{10}{12}\selectfont\raggedright \@editor \par}
+    %\vspace{20\p@}
+    }%
+  }
+  \vspace{4.5\p@}%
+  \rule{\textwidth}{1\p@}%
+  \vspace{12\p@ plus 6\p@ minus 6\p@}%
+  \vspace{\extraspace}
+  }
+%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%
+
+%%%%%%%%%%%%%%%%%%%%%%%%%%%% Abstract %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%
+\newcommand{\absection}[1]{%
+  \par\noindent{\bfseries #1}\space\ignorespaces}
+
+\newenvironment{abstract}{%
+  \begingroup
+  \let\section\absection
+  \fontfamily{\sfdefault}\fontsize{8}{11}\sffamily\selectfont
+  {\fontseries{b}\selectfont ABSTRACT}\par}
+{\endgroup\bigskip\@afterheading\@afterindentfalse\vskip 12pt plus 3pt minus 1pt}
+
+% Section macros
+
+% Lowest level heading that takes a number by default
+\setcounter{secnumdepth}{3}
+
+\renewcommand{\@seccntformat}[1]{\csname the#1\endcsname\quad}
+
+\def\section{%
+  \@startsection{section}{1}{\z@}
+  {-22\p@ plus -3\p@}{3\p@}
+  {\reset@font\raggedright\helveticabold\fontsize{10}{12}\selectfont\MakeUppercase}}
+
+\def\subsection{%
+  \@startsection{subsection}{2}{\z@}
+  {-11\p@ plus -2\p@}{3\p@}
+  {\reset@font\raggedright\mathversion{bold}\fontseries{b}\fontsize{10}{12}\selectfont}}
+
+\def\subsubsection{%
+  \@startsection{subsubsection}{3}{\z@}
+  %{-11\p@ plus -1\p@}{-1em}
+  {-11\p@ plus -1\p@}{0.001em}
+  {\reset@font\normalfont\normalsize\itshape}}
+
+\def\textcolon{\text{\rm :}}
+
+ \def\paragraph{%
+   \@startsection{paragraph}{4}{\z@}
+   {-6\p@}
+   {-.4em}
+   {\reset@font\itshape}}
+
+% ********************
+% Figures and tables *
+% ********************
+
+% Table and array parameters
+\setlength\arraycolsep{.5em}
+\setlength\tabcolsep{.5em}
+\setlength\arrayrulewidth{.5pt}
+\setlength\doublerulesep{2.5pt}
+\setlength\extrarowheight{\z@}
+\renewcommand\arraystretch{1}
+
+\newlength{\abovecaptionskip}
+\newlength{\belowcaptionskip}
+\setlength{\abovecaptionskip}{13pt}
+\setlength{\belowcaptionskip}{10.5pt}
+
+\long\def\@makecaption#1#2{\vspace{\abovecaptionskip}%
+  \begingroup
+  \footnotesize
+  \textbf{#1.}\enskip{#2}\par
+  \endgroup}
+
+\long\def\@tablecaption#1#2{%
+  \begingroup
+  \footnotesize
+  \textbf{#1.}\enskip{#2\strut\par}
+  \endgroup\vspace{\belowcaptionskip}}
+
+% Table rules
+\def\toprule{\noalign{\ifnum0=`}\fi\hrule \@height 0.5pt \hrule \@height 6pt \@width 0pt \futurelet
+   \@tempa\@xhline}
+\def\midrule{\noalign{\ifnum0=`}\fi \hrule \@height 6.75pt \@width 0pt \hrule \@height 0.5pt
+    \hrule \@height 6pt \@width 0pt \futurelet \@tempa\@xhline}
+\def\botrule{\noalign{\ifnum0=`}\fi \hrule \@height 5.75pt \@width 0pt \hrule \@height 0.5pt \futurelet
+   \@tempa\@xhline}
+\def\hrulefill{\leavevmode\leaders\hrule height .5pt\hfill\kern\z@}
+
+\def\thefigure{\@arabic\c@figure}
+\def\fps@figure{tbp}
+\def\ftype@figure{1}
+\def\ext@figure{lof}
+\def\fnum@figure{\figurename~\thefigure}
+\def\figure{\@float{figure}}
+\let\endfigure\end@float
+\@namedef{figure*}{\@dblfloat{figure}}
+\@namedef{endfigure*}{\end@dblfloat}
+\def\thetable{\@arabic\c@table}
+\def\fps@table{tbp}
+\def\ftype@table{2}
+\def\ext@table{lot}
+\def\fnum@table{Table~\thetable}
+\def\table{\let\@makecaption\@tablecaption\let\source\tablesource\@float{table}}
+\def\endtable{\end@float}
+\@namedef{table*}{\let\@makecaption\@tablecaption\@dblfloat{table}}
+\@namedef{endtable*}{\end@dblfloat}
+
+\newif\if@rotate \@rotatefalse
+\newif\if@rotatecenter \@rotatecenterfalse
+\def\rotatecenter{\global\@rotatecentertrue}
+\def\rotateendcenter{\global\@rotatecenterfalse}
+\def\rotate{\global\@rotatetrue}
+\def\endrotate{\global\@rotatefalse}
+\newdimen\rotdimen
+\def\rotstart#1{\special{ps: gsave currentpoint currentpoint translate
+    #1 neg exch neg exch translate}}
+\def\rotfinish{\special{ps: currentpoint grestore moveto}}
+\def\rotl#1{\rotdimen=\ht#1\advance\rotdimen by \dp#1
+    \hbox to \rotdimen{\vbox to\wd#1{\vskip \wd#1
+    \rotstart{270 rotate}\box #1\vss}\hss}\rotfinish}
+\def\rotr#1{\rotdimen=\ht #1\advance\rotdimen by \dp#1
+    \hbox to \rotdimen{\vbox to \wd#1{\vskip \wd#1
+    \rotstart{90 rotate}\box #1\vss}\hss}\rotfinish}
+
+\newdimen\tempdime
+\newbox\temptbox
+
+% From ifmtarg.sty
+% Copyright Peter Wilson and Donald Arseneau, 2000
+\begingroup
+\catcode`\Q=3
+\long\gdef\@ifmtarg#1{\@xifmtarg#1QQ\@secondoftwo\@firstoftwo\@nil}
+\long\gdef\@xifmtarg#1#2Q#3#4#5\@nil{#4}
+\long\gdef\@ifnotmtarg#1{\@xifmtarg#1QQ\@firstofone\@gobble\@nil}
+\endgroup
+
+\def\tablesize{\@setfontsize\tablesize{8\p@}{10\p@}}
+
+\newenvironment{processtable}[3]{\setbox\temptbox=\hbox{{\tablesize #2}}%
+\tempdime\wd\temptbox\@processtable{#1}{#2}{#3}{\tempdime}}
+{\relax}
+
+\newcommand{\@processtable}[4]{%
+\if@rotate
+\setbox4=\vbox to \hsize{\vss\hbox to \textheight{%
+\begin{minipage}{#4}%
+\@ifmtarg{#1}{}{\caption{#1}}{\tablesize #2}%
+\vskip7\p@\noindent
+\parbox{#4}{\fontsize{7}{9}\selectfont #3\par}%
+\end{minipage}}\vss}%
+\rotr{4}
+\else
+\hbox to \hsize{\hss\begin{minipage}[t]{#4}%
+\vskip2.9pt
+\@ifmtarg{#1}{}{\caption{#1}}{\tablesize #2}%
+\vskip6\p@\noindent
+\parbox{#4}{\fontsize{7}{9}\selectfont #3\par}%
+\end{minipage}\hss}\fi}%
+
+\newcolumntype{P}[1]{>{\raggedright\let\\\@arraycr\hangindent1em}p{#1}}
+
+% ******************************
+% List numbering and lettering *
+% ******************************
+\def\labelenumi{{\rm\arabic{enumi}.}}
+\def\theenumi{\arabic{enumi}}
+\def\labelenumii{{\rm\alph{enumii}.}}
+\def\theenumii{\alph{enumii}}
+\def\p@enumii{\theenumi}
+\def\labelenumiii{{\rm(\arabic{enumiii})}}
+\def\theenumiii{\roman{enumiii}}
+\def\p@enumiii{\theenumi(\theenumii)}
+\def\labelenumiv{{\rm(\arabic{enumiv})}}
+\def\theenumiv{\Alph{enumiv}}
+\def\p@enumiv{\p@enumiii\theenumiii}
+\def\labelitemi{{\small$\bullet$}}
+\def\labelitemii{{\small$\bullet$}}
+\def\labelitemiii{{\small$\bullet$}}
+\def\labelitemiv{{\small$\bullet$}}
+
+\def\@listI{\leftmargin\leftmargini \topsep\medskipamount}
+\let\@listi\@listI
+\@listi
+\def\@listii{\topsep\z@\leftmargin\leftmarginii}
+\def\@listiii{\leftmargin\leftmarginiii \topsep\z@}
+\def\@listiv{\leftmargin\leftmarginiv \topsep\z@}
+\def\@listv{\leftmargin\leftmarginv \topsep\z@}
+\def\@listvi{\leftmargin\leftmarginvi \topsep\z@}
+
+\setlength{\leftmargini}{3mm}
+\setlength{\leftmarginii}{\z@}
+\setlength{\leftmarginiii}{\z@}
+\setlength{\leftmarginiv}{\z@}
+
+% Changes to the list parameters for enumerate
+\def\enumargs{%
+   \partopsep     \z@
+   \itemsep       3\p@
+   \parsep        \z@
+   \labelsep      0.5em
+   \listparindent \parindent
+   \itemindent    \z@
+   \topsep 11\p@
+}
+
+\def\enumerate{%
+    \@ifnextchar[{\@numerate}{\@numerate[0]}}
+
+\def\@numerate[#1]{%
+     \ifnum \@enumdepth >3 \@toodeep\else
+     \advance\@enumdepth \@ne
+     \edef\@enumctr{enum\romannumeral\the\@enumdepth}
+     \list{\csname label\@enumctr\endcsname}{%
+       \enumargs
+       \setlength{\leftmargin}{\csname leftmargin\romannumeral\the\@enumdepth\endcsname}
+       \usecounter{\@enumctr}
+       \settowidth\labelwidth{#1}
+       \addtolength{\leftmargin}{\labelwidth}
+       \addtolength{\leftmargin}{\labelsep}
+       \def\makelabel##1{\hss \llap{##1}}}%
+     \fi
+   }
+\let\endenumerate\endlist
+
+% Changes to the list parameters for itemize
+\def\itemargs{%
+   \partopsep     \z@
+   \itemsep       3\p@
+   \parsep        \z@
+   \labelsep      0.5em
+   \rightmargin   \z@
+   \listparindent \parindent
+   \itemindent    \z@
+   \topsep11\p@
+}
+
+\def\itemize{%
+    \@ifnextchar[{\@itemize}{\@itemize[$\bullet$]}}
+
+\def\@itemize[#1]{%
+     \ifnum \@itemdepth >3 \@toodeep\else
+     \advance\@itemdepth \@ne
+     \edef\@itemctr{item\romannumeral\the\@itemdepth}
+     \list{\csname label\@itemctr\endcsname}{%
+       \itemargs
+       \setlength{\leftmargin}{\csname leftmargin\romannumeral\the\@itemdepth\endcsname}
+       \settowidth\labelwidth{#1}
+       \addtolength{\leftmargin}{\labelwidth}
+       \addtolength{\leftmargin}{\labelsep}
+       \def\makelabel##1{\hss \llap{##1}}}%
+     \fi
+   }
+\let\enditemize\endlist
+
+\newenvironment{unlist}{%
+  \begin{list}{}%
+    {\setlength{\labelwidth}{\z@}%
+     \setlength{\labelsep}{\z@}%
+     \setlength{\topsep}{\medskipamount}%
+     \setlength{\itemsep}{3\p@}%
+     \setlength{\leftmargin}{2em}%
+     \setlength{\itemindent}{-2em}}}
+{\end{list}}
+
+
+% ***********************
+% Quotes and Quotations *
+% ***********************
+\def\quotation{\par\begin{list}{}{
+      \setlength{\topsep}{\medskipamount}
+      \setlength{\leftmargin}{2em}%
+      \setlength{\rightmargin}{\z@}%
+      \setlength\labelwidth{0pt}%
+      \setlength\labelsep{0pt}%
+      \listparindent\parindent}%
+  \item[]}
+\def\endquotation{\end{list}}
+\let\quote\quotation
+\let\endquote\endquotation
+
+\skip\@mpfootins = \skip\footins
+\fboxsep=6\p@
+\fboxrule=1\p@
+
+% *******************
+% Table of contents *
+% *******************
+\newcommand\@pnumwidth{4em}
+\newcommand\@tocrmarg{2.55em plus 1fil}
+\newcommand\@dotsep{1000}
+\setcounter{tocdepth}{4}
+
+\def\numberline#1{\hbox to \@tempdima{{#1}}}
+
+\def\@authortocline#1#2#3#4#5{%
+  \vskip 1.5\p@
+  \ifnum #1>\c@tocdepth \else
+    {\leftskip #2\relax \rightskip \@tocrmarg \parfillskip -\rightskip
+     \parindent #2\relax\@afterindenttrue
+     \interlinepenalty\@M
+     \leavevmode
+     \@tempdima #3\relax
+     \advance\leftskip \@tempdima \null\nobreak\hskip -\leftskip
+     {\itshape #4}\nobreak
+     \leaders\hbox{$\m@th
+        \mkern \@dotsep mu\hbox{.}\mkern \@dotsep
+        mu$}\hfill
+     \nobreak
+     \hb@xt@\@pnumwidth{\hfil}%
+     \par}%
+  \fi}
+
+\newcommand*\l@author{\@authortocline{2}{0pt}{30pt}}
+\newcommand*\l@section{\@dottedtocline{3}{11pt}{20pt}}
+\newcommand*\l@subsection{\@dottedtocline{4}{31pt}{29pt}}
+\newcommand*\l@subsubsection[2]{}
+
+
+
+% ***********
+% Footnotes *
+% ***********
+
+\def\footnoterule{\noindent\rule{\columnwidth}{0.5pt}}
+\def\@makefnmark{\@textsuperscript{\normalfont\@thefnmark}}%
+\newcommand\@makefntext[1]{\noindent{\@makefnmark}\enskip#1}
+
+% ***********
+% References *
+% ***********
+
+\providecommand{\newblock}{}
+\newenvironment{thebibliography}{%
+  \section{\bibname}%
+  \begingroup
+  \small
+  \begin{list}{}{%
+      \setlength{\topsep}{\z@}%
+      \setlength{\labelsep}{\z@}%
+      \settowidth{\labelwidth}{\z@}%
+      \setlength{\leftmargin}{4mm}%
+      \setlength{\itemindent}{-4mm}}\small}
+{\end{list}\endgroup}
+
+\RequirePackage{natbib}
+
+% **********
+% Appendix *
+% **********
+\newif\ifappend % Are we in the Appendix?
+\def\appendix{\par
+        \setcounter{section}{0}
+        \setcounter{subsection}{0}
+        \appendtrue
+}
+
+%Math parameters
+
+\setlength{\jot}{5\p@}
+\mathchardef\@m=1500   % adapted value
+
+\def\frenchspacing{\sfcode`\.\@m \sfcode`\?\@m \sfcode`\!\@m
+  \sfcode`\:\@m \sfcode`\;\@m \sfcode`\,\@m}
+
+% Theorems
+\def\th@plain{%
+%%  \let\thm@indent\noindent % no indent
+\thm@headfont{\quad\scshape}% heading font is bold
+\thm@notefont{\upshape\mdseries}% same as heading font
+\thm@headpunct{.}% no period after heading
+\thm@headsep 5\p@ plus\p@ minus\p@\relax
+%%  \let\thm@swap\@gobble
+%%  \thm@preskip\topsep
+%%  \thm@postskip\theorempreskipamount
+\itshape % body font
+}
+
+\vbadness=9999
+\tolerance=9999
+\doublehyphendemerits=10000
+\doublehyphendemerits 640000   % corresponds to badness 800
+\finalhyphendemerits  1000000  % corresponds to badness 1000
+
+\flushbottom
+\frenchspacing
+\ps@headings
+\twocolumn
+
+% Screen PDF compatability
+\newcommand{\medline}[1]{%
+  \unskip\unskip\ignorespaces}
+
+
+%%%%for smaller size text
+\newenvironment{methods}{%
+  \begingroup
+\def\section{%
+  \@startsection{section}{1}{\z@}
+  {-24\p@ plus -3\p@}{4\p@}
+  {\reset@font\raggedright\helveticabold\fontsize{10}{12}\selectfont\MakeUppercase}}
+ \def\subsection{%
+  \@startsection{subsection}{2}{\z@}
+  {-5\p@ plus -2\p@}{4\p@}
+  {\reset@font\raggedright\mathversion{bold}\fontseries{b}\fontsize{10}{12}\selectfont}}
+ \def\subsubsection{%
+  \@startsection{subsubsection}{3}{\z@}
+%  {-6\p@ plus -1\p@}{-1em}
+  {-6\p@ plus -1\p@}{0.001em}
+  {\reset@font\normalfont\normalsize\itshape}}
+\footnotesize
+  \par}
+{\par\endgroup\bigskip\@afterheading\@afterindentfalse}
+
+
+
+\graphicspath{{g:/artwork/oup/bioinfo/}}
+
+\language=2
+
+\hyphenation{Figure Table Figures Tables}
+
+\newcommand{\href}[2]{#2}
+
+\renewenvironment{proof}[1][\proofname]{\par
+  \normalfont \topsep6\p@\@plus6\p@\relax
+  \labelsep 0.5em
+  \trivlist
+  \item[\hskip\labelsep\hskip1em\textsc{#1}.]\ignorespaces
+}{\endtrivlist\@endpefalse}
+
+%%Different Bonds
+
+\def\sbond{\ensuremath{\raise.25ex\hbox{${-}\!\!\!\!{-}$}}\kern -.9pt}
+\def\dbond{\ensuremath{\raise.25ex\hbox{=$\!$=}}}
+\def\tbond{\ensuremath{\raise.20ex\hbox{${\equiv}\!\!\!{\equiv}$}}}
+
+% Author queries
+%\fboxsep=4\p@
+%\fboxrule=0.5\p@
+\newcommand{\query}[2][0pt]{}%
+%  \marginpar{\vspace*{#1}%
+%    {\parbox{\marginparwidth}{%
+%     \raggedright\fontsize{6}{8}\selectfont
+%         #2}}}}
+
+\renewcommand{\dag}{{\mathversion{normal}$^{\dagger}$}}
+
+\endinput

tex/blasr-mc.eval

@@ -0,0 +1,17 @@
+Q	60	32681	57	0.001744133
+Q	39	3	1	0.001774569
+Q	38	3	1	0.001804999
+Q	35	5	1	0.001835311
+Q	34	31	2	0.001894692
+Q	20	11	2	0.001955154
+Q	19	4	1	0.001985460
+Q	15	29	5	0.002136296
+Q	14	6	1	0.002166417
+Q	10	11	1	0.002196193
+Q	6	11	2	0.002256442
+Q	5	1	1	0.002286864
+Q	4	1	1	0.002317285
+Q	3	36	15	0.002771602
+Q	2	5	2	0.002832085
+Q	1	12	9	0.003105023
+Q	0	220	83	0.005594194

tex/bwa.eval

@@ -0,0 +1,55 @@
+Q	60	31721	27	0.000851171
+Q	59	54	4	0.000975610
+Q	58	29	5	0.001131933
+Q	57	21	2	0.001194030
+Q	56	14	4	0.001319137
+Q	55	22	6	0.001506544
+Q	54	12	4	0.001631475
+Q	53	16	3	0.001724733
+Q	51	10	1	0.001755541
+Q	50	10	1	0.001786330
+Q	49	11	3	0.001879699
+Q	47	8	2	0.001941869
+Q	46	17	1	0.001972140
+Q	44	8	3	0.002065534
+Q	43	10	1	0.002096174
+Q	42	13	1	0.002126595
+Q	41	14	3	0.002219444
+Q	40	13	2	0.002281036
+Q	38	17	4	0.002404747
+Q	37	15	4	0.002528484
+Q	36	12	1	0.002558742
+Q	35	19	3	0.002650783
+Q	34	12	3	0.002743313
+Q	33	7	1	0.002773882
+Q	32	21	3	0.002865508
+Q	31	11	2	0.002926799
+Q	30	14	3	0.003018891
+Q	29	17	1	0.003048401
+Q	28	11	2	0.003109549
+Q	27	20	5	0.003262998
+Q	26	11	1	0.003292948
+Q	25	14	4	0.003415725
+Q	24	16	5	0.003569212
+Q	23	43	6	0.003750426
+Q	21	15	1	0.003779664
+Q	20	29	7	0.003992943
+Q	19	22	2	0.004052089
+Q	18	28	4	0.004172204
+Q	16	25	5	0.004323390
+Q	15	24	5	0.004474480
+Q	14	25	5	0.004625204
+Q	13	23	3	0.004714365
+Q	12	22	1	0.004741963
+Q	11	32	11	0.005075674
+Q	10	35	7	0.005285315
+Q	9	32	12	0.005648503
+Q	8	33	8	0.005888126
+Q	7	39	7	0.006095506
+Q	6	42	14	0.006515953
+Q	5	38	15	0.006966725
+Q	4	37	12	0.007325113
+Q	3	49	18	0.007862737
+Q	2	63	21	0.008486434
+Q	1	55	27	0.009292156
+Q	0	153	77	0.011576593

tex/eval2roc.pl

@@ -0,0 +1,33 @@
+#!/usr/bin/perl
+
+use strict;
+use warnings;
+use Getopt::Std;
+
+my %opts = (n=>33088, s=>100);
+getopts('n:', \%opts);
+
+my $pseudo = .5;
+my $tot = $pseudo;
+my $err = $pseudo;
+my $tot_last_out = -$opts{s};
+my $state = 0;
+my $mapq = 0;
+while (<>) {
+	chomp;
+	if (/^Q\t(\d+)\t(\d+)\t(\d+)/) {
+		$tot += $2;
+		$err += $3;
+		if ($tot - $tot_last_out >= $opts{s}) {
+			print join("\t", $1, $err/$tot, $tot / $opts{n}), "\n";
+			$tot_last_out = $tot;
+			$state = 0;
+		} else {
+			$state = 1;
+			$mapq = $1;
+		}
+	}
+}
+if ($state) {
+	print join("\t", $mapq, $err/$tot, $tot / $opts{n}), "\n";
+}

tex/graphmap.eval

@@ -0,0 +1,4 @@
+Q	40	31897	63	0.001975107
+Q	3	423	267	0.010210396
+Q	2	162	120	0.013853827
+Q	1	188	172	0.019038874

tex/hs38-simu.sh

@@ -0,0 +1,4 @@
+./pbsim --prefix pb-1 --depth 0.1 --sample-fastq m131017_060208_42213_c100579642550000001823095604021496_s1_p0.1.subreads.fastq --length-min 1000 --length-max 30000 --seed 11 hs38.fa
+
+bin/mason_variator -ir hs38.fa -s 1 -ov hs38-s1.vcf --snp-rate 1e-3 --small-indel-rate 2e-4 --sv-indel-rate 0 --sv-inversion-rate 0 --sv-translocation-rate 0 --sv-duplication-rate 0 --max-small-indel-size 10
+bin/mason_simulator -ir hs38.fa -iv hs38-s1.vcf -n 1000000 --seed 1 -o s1_1.fq -or s1_2.fq -oa s1.sam --illumina-prob-mismatch-scale 2.5

tex/minialign.eval

@@ -0,0 +1,49 @@
+Q	60	32070	190	0.005924540
+Q	59	62	2	0.005975352
+Q	58	37	5	0.006123908
+Q	57	40	7	0.006333633
+Q	56	39	6	0.006512032
+Q	55	32	2	0.006567534
+Q	54	54	2	0.006618420
+Q	53	33	4	0.006735255
+Q	52	39	2	0.006788866
+Q	51	48	3	0.006871264
+Q	50	34	2	0.006925634
+Q	49	32	3	0.007011070
+Q	48	35	2	0.007064967
+Q	47	36	4	0.007179896
+Q	46	23	1	0.007205495
+Q	45	25	1	0.007230614
+Q	44	17	3	0.007318716
+Q	43	17	2	0.007376121
+Q	42	31	5	0.007522016
+Q	41	25	4	0.007638486
+Q	40	26	4	0.007754541
+Q	39	35	2	0.007807258
+Q	37	18	4	0.007924896
+Q	36	13	3	0.008013162
+Q	35	15	2	0.008070411
+Q	34	20	3	0.008156805
+Q	33	11	1	0.008184501
+Q	32	15	3	0.008272003
+Q	31	25	1	0.008296107
+Q	29	8	1	0.008324472
+Q	28	7	2	0.008383452
+Q	27	9	2	0.008441894
+Q	26	30	2	0.008494888
+Q	23	2	1	0.008524710
+Q	22	11	3	0.008612846
+Q	20	23	3	0.008697760
+Q	19	6	1	0.008726479
+Q	18	8	1	0.008754658
+Q	16	6	1	0.008783354
+Q	13	2	1	0.008813108
+Q	12	4	2	0.008872604
+Q	11	7	2	0.008931275
+Q	10	4	3	0.009021009
+Q	9	6	4	0.009140436
+Q	8	6	3	0.009229559
+Q	7	5	1	0.009258419
+Q	6	8	3	0.009346925
+Q	4	8	5	0.009495872
+Q	3	17	8	0.009732801

tex/minimap2.bib

@@ -0,0 +1,261 @@
+@article{Chaisson:2012aa,
+	Author = {Chaisson, Mark J and Tesler, Glenn},
+	Journal = {BMC Bioinformatics},
+	Pages = {238},
+	Title = {{Mapping single molecule sequencing reads using basic local alignment with successive refinement (BLASR): application and theory}},
+	Volume = {13},
+	Year = {2012}}
+
+@article{Liu:2016ab,
+	Author = {Liu, Bo and others},
+	Journal = {Bioinformatics},
+	Pages = {1625-31},
+	Title = {{rHAT}: fast alignment of noisy long reads with regional hashing},
+	Volume = {32},
+	Year = {2016}}
+
+@article{Liu:2017aa,
+	Author = {Liu, Bo and others},
+	Journal = {Bioinformatics},
+	Pages = {192-201},
+	Title = {{LAMSA}: fast split read alignment with long approximate matches},
+	Volume = {33},
+	Year = {2017}}
+
+@article{Lin:2017aa,
+	Author = {Lin, Hsin-Nan and Hsu, Wen-Lian},
+	Journal = {Bioinformatics},
+	Title = {Kart: a divide-and-conquer algorithm for {NGS} read alignment},
+	Year = {2017}}
+
+@article{Li:2013aa,
+	Author = {Li, Heng},
+	Journal = {arXiv:1303.3997},
+	Title = {Aligning sequence reads, clone sequences and assembly contigs with {BWA-MEM}},
+	archivePrefix = "arXiv",
+	eprint = {1303.3997},
+	primaryClass = "q-bio",
+	Year = {2013}}
+
+@article{Sovic:2016aa,
+	Author = {Sovi{\'c}, Ivan and others},
+	Journal = {Nat Commun},
+	Pages = {11307},
+	Title = {Fast and sensitive mapping of nanopore sequencing reads with {GraphMap}},
+	Volume = {7},
+	Year = {2016}}
+
+@article{Langmead:2012fk,
+	Author = {Langmead, Ben and Salzberg, Steven L},
+	Journal = {Nat Methods},
+	Pages = {357-9},
+	Title = {Fast gapped-read alignment with {Bowtie} 2},
+	Volume = {9},
+	Year = {2012}}
+
+@article{Li:2016aa,
+	Author = {Li, Heng},
+	Journal = {Bioinformatics},
+	Pages = {2103-10},
+	Title = {Minimap and miniasm: fast mapping and de novo assembly for noisy long sequences},
+	Volume = {32},
+	Year = {2016}}
+
+@misc{Suzuki:2016,
+	title = {Fast and accurate alignment tool for PacBio and Nanopore long reads},
+	author = {Hajime Suzuki},
+	journal = {Unpublished},
+	howpublished = {\href{https://github.com/ocxtal/minialign}{https://github.com/ocxtal/minialign}},
+	year = {2016}}
+
+@misc{Ruan:2016,
+	title = {Ultra-fast de novo assembler using long noisy reads},
+	author = {Jue Ruan},
+	journal = {Unpulished},
+	howpublished = {\href{https://github.com/ruanjue/smartdenovo}{https://github.com/ruanjue/smartdenovo}},
+	year = {2016}}
+
+@article{Miller:1988aa,
+	Author = {Miller, W and Myers, E W},
+	Journal = {Bull Math Biol},
+	Number = {2},
+	Pages = {97-120},
+	Title = {Sequence comparison with concave weighting functions},
+	Volume = {50},
+	Year = {1988}}
+
+@article{Gotoh:1990aa,
+	Author = {Gotoh, O},
+	Journal = {Bull Math Biol},
+	Pages = {359-73},
+	Title = {Optimal sequence alignment allowing for long gaps},
+	Volume = {52},
+	Year = {1990}}
+
+@article{Wu:1996aa,
+	Author = {Wu, Sun and others},
+	Journal = {Algorithmica},
+	Pages = {50-67},
+	Title = {A subquadratic algorithm for approximate limited expression matching},
+	Volume = {15},
+	Year = {1996}}
+
+@article{Daily:2016aa,
+	Author = {Daily, Jeff},
+	Journal = {BMC Bioinformatics},
+	Month = {Feb},
+	Pages = {81},
+	Title = {Parasail: {SIMD C} library for global, semi-global, and local pairwise sequence alignments},
+	Volume = {17},
+	Year = {2016}}
+
+@article{Sedlazeck169557,
+	author = {Sedlazeck, Fritz J and others},
+	title = {Accurate detection of complex structural variations using single molecule sequencing},
+	note = {doi:10.1101/169557},
+	journal = {bioRxiv},
+	year = {2017}}
+
+@article{Altschul:1997vn,
+	Author = {Altschul, S F and others},
+	Journal = {Nucleic Acids Res},
+	Pages = {3389-402},
+	Title = {Gapped {BLAST} and {PSI-BLAST}: a new generation of protein database search programs},
+	Volume = {25},
+	Year = {1997}}
+
+@article{Sosic:2017aa,
+	Author = {{\v S}o{\v s}i\'{c}, Martin and {\v S}ikic, Mile},
+	Journal = {Bioinformatics},
+	Pages = {1394-1395},
+	Title = {Edlib: a {C/C++} library for fast, exact sequence alignment using edit distance},
+	Volume = {33},
+	Year = {2017}}
+
+@article{Abouelhoda:2005aa,
+	Author = {Mohamed Ibrahim Abouelhoda and Enno Ohlebusch},
+	Journal = {J. Discrete Algorithms},
+	Pages = {321-41},
+	Title = {Chaining algorithms for multiple genome comparison},
+	Volume = {3},
+	Year = {2005}}
+
+@article{Ono:2013aa,
+	Author = {Ono, Yukiteru and others},
+	Journal = {Bioinformatics},
+	Pages = {119-21},
+	Title = {{PBSIM}: {PacBio} reads simulator--toward accurate genome assembly},
+	Volume = {29},
+	Year = {2013}}
+
+@article {Jain128835,
+	author = {Jain, Miten and others},
+	title = {Nanopore sequencing and assembly of a human genome with ultra-long reads},
+	year = {2017},
+	note = {doi:10.1101/128835},
+	publisher = {Cold Spring Harbor Labs Journals},
+	journal = {bioRxiv}}
+
+@article{Lau:2016aa,
+	Author = {Lau, Bayo and others},
+	Journal = {Bioinformatics},
+	Pages = {3829-3832},
+	Title = {{LongISLND}: in silico sequencing of lengthy and noisy datatypes},
+	Volume = {32},
+	Year = {2016}}
+
+@article{Robinson:2011aa,
+	Author = {Robinson, James T and others},
+	Journal = {Nat Biotechnol},
+	Pages = {24-6},
+	Title = {Integrative genomics viewer},
+	Volume = {29},
+	Year = {2011}}
+
+@article {Suzuki130633,
+	author = {Suzuki, Hajime and Kasahara, Masahiro},
+	title = {Acceleration Of Nucleotide Semi-Global Alignment With Adaptive Banded Dynamic Programming},
+	year = {2017},
+	note = {doi:10.1101/130633},
+	publisher = {Cold Spring Harbor Labs Journals},
+	journal = {bioRxiv}}
+
+@article{Gotoh:1982aa,
+	Author = {Gotoh, O},
+	Journal = {J Mol Biol},
+	Pages = {705-8},
+	Title = {An improved algorithm for matching biological sequences},
+	Volume = {162},
+	Year = {1982}}
+
+@article{Altschul:1986aa,
+	Author = {Altschul, S F and Erickson, B W},
+	Journal = {Bull Math Biol},
+	Pages = {603-16},
+	Title = {Optimal sequence alignment using affine gap costs},
+	Volume = {48},
+	Year = {1986}}
+
+@article{Wu:2005vn,
+	Author = {Wu, Thomas D and Watanabe, Colin K},
+	Journal = {Bioinformatics},
+	Pages = {1859-75},
+	Title = {{GMAP}: a genomic mapping and alignment program for {mRNA} and {EST} sequences},
+	Volume = {21},
+	Year = {2005}}
+
+@article{Iwata:2012aa,
+	Author = {Iwata, Hiroaki and Gotoh, Osamu},
+	Journal = {Nucleic Acids Res},
+	Pages = {e161},
+	Title = {Benchmarking spliced alignment programs including {Spaln2}, an extended version of {Spaln} that incorporates additional species-specific features},
+	Volume = {40},
+	Year = {2012}}
+
+@article{Dobin:2013kx,
+	Author = {Dobin, Alexander and others},
+	Journal = {Bioinformatics},
+	Pages = {15-21},
+	Title = {{STAR}: ultrafast universal {RNA-seq} aligner},
+	Volume = {29},
+	Year = {2013}}
+
+@article{Byrne:2017aa,
+	Author = {Byrne, Ashley and others},
+	Journal = {Nat Commun},
+	Pages = {16027},
+	Title = {Nanopore long-read {RNAseq} reveals widespread transcriptional variation among the surface receptors of individual {B} cells},
+	Volume = {8},
+	Year = {2017}}
+
+@article{Roberts:2004fv,
+	Author = {Roberts, Michael and others},
+	Journal = {Bioinformatics},
+	Pages = {3363-9},
+	Title = {Reducing storage requirements for biological sequence comparison},
+	Volume = {20},
+	Year = {2004}}
+
+@article{Zhang:2006aa,
+	Author = {Zhang, Miao and Gish, Warren},
+	Journal = {Bioinformatics},
+	Pages = {13-20},
+	Title = {Improved spliced alignment from an information theoretic approach},
+	Volume = {22},
+	Year = {2006}}
+
+@article{Li:2007aa,
+	Author = {Li, Heng and others},
+	Journal = {BMC Bioinformatics},
+	Pages = {349},
+	Title = {A cross-species alignment tool {(CAT)}},
+	Volume = {8},
+	Year = {2007}}
+
+@article{Farrar:2007hs,
+	Author = {Farrar, Michael},
+	Journal = {Bioinformatics},
+	Pages = {156-61},
+	Title = {{Striped Smith-Waterman speeds database searches six times over other SIMD implementations}},
+	Volume = {23},
+	Year = {2007}}

tex/minimap2.tex

@@ -0,0 +1,509 @@
+\documentclass{bioinfo}
+\copyrightyear{2017}
+\pubyear{2017}
+
+\usepackage{graphicx}
+\usepackage{hyperref}
+\usepackage{url}
+\usepackage{amsmath}
+\usepackage[ruled,vlined]{algorithm2e}
+\newcommand\mycommfont[1]{\footnotesize\rmfamily{\it #1}}
+\SetCommentSty{mycommfont}
+\SetKwComment{Comment}{$\triangleright$\ }{}
+
+\usepackage{natbib}
+\bibliographystyle{apalike}
+\usepackage{hyperref}
+
+\DeclareMathOperator*{\argmax}{argmax}
+
+\begin{document}
+\firstpage{1}
+
+\title[Aligning long nucleotide sequences with minimap2]{Minimap2: fast pairwise alignment for long nucleotide sequences}
+\author[Li]{Heng Li}
+\address{Broad Institute, 415 Main Street, Cambridge, MA 02142, USA}
+
+\maketitle
+
+\begin{abstract}
+\section{Summary:} Minimap2 is a general-purpose mapper to align long noisy DNA
+or mRNA sequences against a large reference database. It targets query
+sequences of 1kb--100Mb in length with per-base divergence typically below
+25\%. For DNA sequence reads, minimap2 is $\sim$30 times faster than many
+mainstream long-read aligners and achieves higher accuracy on simulated data.
+It also employs concave gap cost and rescues inversions for improved alignment
+around potential structural variations. For real long RNA-seq reads, minimap2
+is $\sim$40 times faster than peers and produces alignment more consistent with
+existing gene annotations.
+
+\section{Availability and implementation:}
+\href{https://github.com/lh3/minimap2}{https://github.com/lh3/minimap2}
+
+\section{Contact:} hengli@broadinstitute.org
+\end{abstract}
+
+\section{Introduction}
+
+Single Molecule Real-Time (SMRT) sequencing technology and Oxford Nanopore
+technologies (ONT) produce reads over 10kbp in length at an error rate
+$\sim$15\%. Several aligners have been developed for such
+data~\citep{Chaisson:2012aa,Li:2013aa,Liu:2016ab,Sovic:2016aa,Liu:2017aa,Lin:2017aa,Sedlazeck169557}.
+Most of them were five times as slow as mainstream short-read
+aligners~\citep{Langmead:2012fk,Li:2013aa} in terms of the number of bases
+mapped per second. We speculated there could be substantial room for speedup on
+the thought that 10kb long sequences should be easier to map than 100bp reads
+because we can more effectively skip repetitive regions, which are often the
+bottleneck of short-read alignment. We confirmed our speculation by achieving
+approximate mapping 50 times faster than BWA-MEM~\citep{Li:2016aa}.
+\citet{Suzuki:2016} extended our work with a fast and novel algorithm on
+generating base-level alignment, which in turn inspired us to develop minimap2
+towards higher accuracy and more practical functionality.
+
+Both SMRT and ONT have been applied to sequence spliced mRNAs (RNA-seq). While
+traditional mRNA aligners work~\citep{Wu:2005vn,Iwata:2012aa}, they are not
+optimized for long noisy sequence reads and are tens of times slower than
+dedicated long-read aligners. When developing minimap2 initially for aligning
+genomic DNA only, we realized minor modifications could make it competitive for
+aligning mRNAs as well. Minimap2 is a first RNA-seq aligner specifically
+designed for long noisy reads.
+
+\begin{methods}
+\section{Methods}
+
+Minimap2 follows a typical seed-chain-align procedure as is used by most
+full-genome aligners. It collects minimizers~\citep{Roberts:2004fv} of the
+reference sequences and indexes them in a hash table. Then for each query
+sequence, minimap2 takes query minimizers as \emph{seeds}, finds matches to the
+reference, and identifies sets of colinear seeds, which are called
+\emph{chains}. If base-level alignment is requested, minimap2 applies dynamic
+programming (DP) to extend from the ends of chains and to close unseeded
+regions between adjacent seeds in chains.
+
+Minimap2 uses indexing and seeding algorithms similar to
+minimap~\citep{Li:2016aa}, and furthers the predecessor with more accurate
+chaining, the ability to produce base-level alignment and the support of
+spliced alignment.
+
+\subsection{Chaining}
+
+\subsubsection{Chaining}
+An \emph{anchor} is a 3-tuple $(x,y,w)$, indicating interval $[x-w+1,x]$ on the
+reference matching interval $[y-w+1,y]$ on the query. Given a list of anchors
+sorted by ending reference position $x$, let $f(i)$ be the maximal chaining
+score up to the $i$-th anchor in the list. $f(i)$ can be calculated with
+dynamic programming:
+\begin{equation}\label{eq:chain}
+f(i)=\max\big\{\max_{i>j\ge 1} \{ f(j)+\alpha(j,i)-\beta(j,i) \},w_i\big\}
+\end{equation}
+where $\alpha(j,i)=\min\big\{\min\{y_i-y_j,x_i-x_j\},w_i\big\}$ is the number of
+matching bases between the two anchors. $\beta(j,i)>0$ is the gap cost. It
+equals $\infty$ if $y_j\ge y_i$ or $\max\{y_i-y_j,x_i-x_j\}>G$ (i.e. the
+distance between two anchors is too large); otherwise
+\begin{equation}\label{eq:chain-gap}
+\beta(j,i)=\gamma_c\big((y_i-y_j)-(x_i-x_j)\big)
+\end{equation}
+In implementation, a gap of length $l$ costs $\gamma_c(l)=0.01\cdot \bar{w}\cdot
+|l|+0.5\log_2|l|$, where $\bar{w}$ is the average seed length. For $m$ anchors, directly computing all $f(\cdot)$ with
+Eq.~(\ref{eq:chain}) takes $O(m^2)$ time. Although theoretically faster
+chaining algorithms exist~\citep{Abouelhoda:2005aa}, they
+are inapplicable to generic gap cost, complex to implement and usually
+associated with a large constant. We introduced a simple heuristic to
+accelerate chaining.
+
+We note that if anchor $i$ is chained to $j$, chaining $i$ to a predecessor
+of $j$ is likely to yield a lower score. When evaluating Eq.~(\ref{eq:chain}),
+we start from anchor $i-1$ and stop the process if we cannot find a better
+score after up to $h$ iterations. This approach reduces the average time to
+$O(h\cdot m)$. In practice, we can almost always find the optimal chain with
+$h=50$; even if the heuristic fails, the optimal chain is often close.
+
+\subsubsection{Backtracking}
+Let $P(i)$ be the index of the best predecessor of anchor $i$. It equals 0 if
+$f(i)=w_i$ or $\argmax_j\{f(j)+\eta(j,i)-\gamma(j,i)\}$ otherwise. For each
+anchor $i$ in the descending order of $f(i)$, we apply $P(\cdot)$ repeatedly to
+find its predecessor and mark each visited $i$ as `used', until $P(i)=0$ or we
+reach an already `used' $i$. This way we find all chains with no anchors used
+in more than one chains.
+
+\subsubsection{Identifying primary chains}
+In the absence of copy number changes, each query segment should not be mapped
+to two places in the reference. However, chains found at the previous step may
+have significant or complete overlaps due to repeats in the reference.
+Minimap2 used the following procedure to identify \emph{primary chains} that do
+not greatly overlap on the query. Let $Q$ be an empty set initially. For each
+chain from the best to the worst according to their chaining scores: if on the
+query, the chain overlaps with a chain in $Q$ by 50\% or higher percentage of
+the shorter chain, mark the chain as secondary to the chain in $Q$; otherwise,
+add the chain to $Q$. In the end, $Q$ contains all the primary chains. We did
+not choose a more sophisticated data structure (e.g. range tree or k-d tree)
+because this step is not the performance bottleneck.
+
+\subsection{Aligning genomic DNA}
+
+\subsubsection{Alignment with 2-piece affine gap cost}
+
+Minimap2 performs DP-based global alignment between adjacent anchors in a
+chain. It uses a 2-piece affine gap cost~\citep{Gotoh:1990aa}:
+\begin{equation}\label{eq:2-piece}
+\gamma_a(l)=\min\{q+|l|\cdot e,\tilde{q}+|l|\cdot\tilde{e}\}
+\end{equation}
+Without losing generality, we always assume $q+e<\tilde{q}+\tilde{e}$.
+On the condition that $e>\tilde{e}$, it applies cost $q+|l|\cdot e$ to gaps
+shorter than $\lceil(\tilde{q}-q)/(e-\tilde{e})\rceil$ and applies
+$\tilde{q}+|l|\cdot\tilde{e}$ to longer gaps.  This scheme helps to recover
+longer insertions and deletions~(INDELs).
+
+The equation to compute the optimal alignment under $\gamma_a(\cdot)$ is
+\begin{equation}\label{eq:ae86}
+\left\{\begin{array}{l}
+H_{ij} = \max\{H_{i-1,j-1}+s(i,j),E_{ij},F_{ij},\tilde{E}_{ij},\tilde{F}_{ij}\}\\
+E_{i+1,j}= \max\{H_{ij}-q,E_{ij}\}-e\\
+F_{i,j+1}= \max\{H_{ij}-q,F_{ij}\}-e\\
+\tilde{E}_{i+1,j}= \max\{H_{ij}-\tilde{q},\tilde{E}_{ij}\}-\tilde{e}\\
+\tilde{F}_{i,j+1}= \max\{H_{ij}-\tilde{q},\tilde{F}_{ij}\}-\tilde{e}
+\end{array}\right.
+\end{equation}
+where $s(i,j)$ is the score between the $i$-th reference base and $j$-th query
+base. Eq.~(\ref{eq:ae86}) is a natural extension to the equation under affine
+gap cost~\citep{Gotoh:1982aa,Altschul:1986aa}.
+
+\subsubsection{Suzuki's formulation}
+
+When we allow gaps longer than several hundred base pairs, nucleotide-level
+alignment is much slower than chaining. SSE acceleration is critical to the
+performance of minimap2. Traditional SSE implementations~\citep{Farrar:2007hs}
+based on Eq.~(\ref{eq:ae86}) can achieve 16-way parallelization for short
+sequences, but only 4-way parallelization when the peak alignment score reaches
+32767. Long sequence alignment may exceed this threshold. Inspired by
+\citet{Wu:1996aa} and the following work, \citet{Suzuki:2016} proposed a
+difference-based formulation that lifted this limitation.
+In case of 2-piece gap cost, define
+\[
+\left\{\begin{array}{ll}
+u_{ij}\triangleq H_{ij}-H_{i-1,j} & v_{ij}\triangleq H_{ij}-H_{i,j-1} \\
+x_{ij}\triangleq E_{i+1,j}-H_{ij} & \tilde{x}_{ij}\triangleq \tilde{E}_{i+1,j}-\tilde{H}_{ij} \\
+y_{ij}\triangleq F_{i,j+1}-H_{ij} & \tilde{y}_{ij}\triangleq \tilde{F}_{i,j+1}-\tilde{H}_{ij}
+\end{array}\right.
+\]
+We can transform Eq.~(\ref{eq:ae86}) to
+\begin{equation}\label{eq:suzuki}
+\left\{\begin{array}{lll}
+z_{ij}&=&\max\{s(i,j),x_{i-1,j}+v_{i-1,j},y_{i,j-1}+u_{i,j-1},\\
+&&\tilde{x}_{i-1,j}+v_{i-1,j},\tilde{y}_{i,j-1}+u_{i,j-1}\}\\
+u_{ij}&=&z_{ij}-v_{i-1,j}\\
+v_{ij}&=&z_{ij}-u_{i,j-1}\\
+x_{ij}&=&\max\{0,x_{i-1,j}+v_{i-1,j}-z_{ij}+q\}-q-e\\
+y_{ij}&=&\max\{0,y_{i,j-1}+u_{i,j-1}-z_{ij}+q\}-q-e\\
+\tilde{x}_{ij}&=&\max\{0,\tilde{x}_{i-1,j}+v_{i-1,j}-z_{ij}+\tilde{q}\}-\tilde{q}-\tilde{e}\\
+\tilde{y}_{ij}&=&\max\{0,\tilde{y}_{i,j-1}+u_{i,j-1}-z_{ij}+\tilde{q}\}-\tilde{q}-\tilde{e}
+\end{array}\right.
+\end{equation}
+where $z_{ij}$ is a temporary variable that does not need to be stored.
+
+An important property of Eq.~(\ref{eq:suzuki}) is that all values are bounded
+by scoring parameters. To see that,
+\[
+x_{ij}=E_{i+1,j}-H_{ij}=\max\{-q,E_{ij}-H_{ij}\}-e
+\]
+With $E_{ij}\le H_{ij}$, we have
+\[
+-q-e\le x_{ij}\le\max\{-q,0\}-e=-e
+\]
+and similar inequations for $y_{ij}$, $\tilde{x}_{ij}$ and $\tilde{y}_{ij}$.
+In addition,
+\[
+u_{ij}=z_{ij}-v_{i-1,j}\ge\max\{x_{i-1,j},\tilde{x}_{i-1,j}\}\ge-q-e
+\]
+As the maximum value of $z_{ij}=H_{ij}-H_{i-1,j-1}$ is $M$, the maximal
+matching score, we can derive
+\[
+u_{ij}\le M-v_{i-1,j}\le M+q+e
+\]
+In conclusion, in Eq.~(\ref{eq:suzuki}), $x$ and $y$ are bounded by $[-q-e,-e]$,
+$\tilde{x}$ and $\tilde{y}$ by $[-\tilde{q}-\tilde{e},-\tilde{e}]$, and $u$ and
+$v$ by $[-q-e,M+q+e]$. When $-128\le-q-e<M+q+e\le127$, each of them can be stored as
+a 8-bit integer. This enables 16-way SSE vectorization regardless of the peak
+score of the alignment.
+
+For a more efficient SSE implementation, we transform the row-column coordinate
+to the diagonal-antidiagonal coordinate by letting $r\gets i+j$ and $t\gets i$.
+Eq.~(\ref{eq:suzuki}) becomes:
+\begin{equation*}
+\left\{\begin{array}{lll}
+z_{rt}&=&\max\{s(t,r-t),x_{r-1,t-1}+v_{r-1,t-1},y_{r-1,t}\\
+&&+u_{r-1,t},\tilde{x}_{r-1,t-1}+v_{r-1,t-1},\tilde{y}_{r-1,t}+u_{r-1,t}\}\\
+u_{rt}&=&z_{rt}-v_{r-1,t-1}\\
+v_{rt}&=&z_{rt}-u_{r-1,t}\\
+x_{rt}&=&\max\{0,x_{r-1,t-1}+v_{r-1,t-1}-z_{rt}+q\}-q-e\\
+y_{rt}&=&\max\{0,y_{r-1,t}+u_{r-1,t}-z_{rt}+q\}-q-e\\
+\tilde{x}_{rt}&=&\max\{0,\tilde{x}_{r-1,t-1}+v_{r-1,t-1}-z_{rt}+\tilde{q}\}-\tilde{q}-\tilde{e}\\
+\tilde{y}_{rt}&=&\max\{0,\tilde{y}_{r-1,t}+u_{r-1,t}-z_{rt}+\tilde{q}\}-\tilde{q}-\tilde{e}
+\end{array}\right.
+\end{equation*}
+In this formulation, cells with the same diagonal index $r$ are independent of
+each other. This allows us to fully vectorize the computation of all cells on
+the same anti-diagonal in one inner loop. It also simplifies banded alignment,
+which would be difficult with striped vectorization~\citep{Farrar:2007hs}.
+
+On the condition that $q+e<\tilde{q}+\tilde{e}$ and $e>\tilde{e}$, the initial
+values in the diagonal-antidiagonal formuation is
+\[
+\left\{\begin{array}{l}
+x_{r-1,-1}=y_{r-1,r}=-q-e\\
+\tilde{x}_{r-1,-1}=\tilde{y}_{r-1,r}=-\tilde{q}-\tilde{e}\\
+u_{r-1,r}=v_{r-1,-1}=\eta(r)\\
+\end{array}\right.
+\]
+where
+\[
+\eta(r)=\left\{\begin{array}{ll}
+-q-e & (r=0) \\
+-e & (r<\lceil\frac{\tilde{q}-q}{e-\tilde{e}}-1\rceil) \\
+r\cdot(e-\tilde{e})-(\tilde{q}-q)-\tilde{e} & (r=\lceil\frac{\tilde{q}-q}{e-\tilde{e}}-1\rceil) \\
+-\tilde{e} & (r>\lceil\frac{\tilde{q}-q}{e-\tilde{e}}-1\rceil)
+\end{array}\right.
+\]
+These can be derived from the initial values for Eq.~(\ref{eq:ae86}).
+
+In practice, our 16-way vectorized implementation of global alignment is three
+times as fast as Parasail's 4-way vectorization~\citep{Daily:2016aa}.  Without
+banding, our implementation is slower than Edlib~\citep{Sosic:2017aa}, but with
+a 1000bp band, it is considerably faster. When performing global alignment
+between anchors, we expect the alignment to stay close to the diagonal of the
+DP matrix. Banding is applicable most of time.
+
+\subsubsection{The Z-drop heuristic}
+
+With global alignment, minimap2 may force to align unrelated sequences between
+two adjacent anchors. To avoid such an artifact, we compute accumulative
+alignment score along the alignment path and break the alignment where the
+score drops too fast in the diagonal direction. More precisely, let $S(i,j)$ be
+the alignment score along the alignment path ending at cell $(i,j)$ in the DP
+matrix. We break the alignment if there exist $(i',j')$ and $(i,j)$, $i'<i$ and
+$j'<j$, such that
+\[
+S(i',j')-S(i,j)>Z+e\cdot|(i-i')-(j-j')|
+\]
+where $e$ is the gap extension cost and $Z$ is an arbitrary threshold.
+This strategy is first used in BWA-MEM. It is similar to X-drop employed in
+BLAST~\citep{Altschul:1997vn}, but unlike X-drop, it would not break the
+alignment in the presence of a single long gap.
+
+When minimap2 breaks a global alignment between two anchors, it performs local
+alignment between the two subsequences involved in the global alignment, but
+this time with the one subsequence reverse complemented. This additional
+alignment step may identify short inversions that are missed during chaining.
+
+\subsection{Aligning spliced sequences}
+
+The algorithm described above can be adapted to spliced alignment. In this
+mode, the chaining gap cost distinguishes insertions to and deletions from the
+reference: $\gamma_c(l)$ in Eq.~(\ref{eq:chain-gap}) takes the form of
+\[
+\gamma_c(l)=\left\{\begin{array}{ll}
+0.01\cdot\bar{w}\cdot l+0.5\log_2 l & (l>0) \\
+\min\{0.01\cdot\bar{w}\cdot|l|,\log_2|l|\} & (l<0)
+\end{array}\right.
+\]
+Similarly, the gap cost function used for DP-based alignment is changed to
+\[
+\gamma_a(l)=\left\{\begin{array}{ll}
+q+l\cdot e & (l>0) \\
+\min\{q+|l|\cdot e,\tilde{q}\} & (l<0)
+\end{array}\right.
+\]
+In alignment, a deletion no shorter than $\lceil(\tilde{q}-q)/e\rceil$ is
+regarded as an intron, which pays no cost to gap extensions.
+
+To pinpoint precise splicing junctions, minimap2 introduces reference-dependent
+cost to penalize non-canonical splicing:
+\begin{equation}\label{eq:splice}
+\left\{\begin{array}{l}
+H_{ij} = \max\{H_{i-1,j-1}+s(i,j),E_{ij},F_{ij},\tilde{E}_{ij}-a(i)\}\\
+E_{i+1,j}= \max\{H_{ij}-q,E_{ij}\}-e\\
+F_{i,j+1}= \max\{H_{ij}-q,F_{ij}\}-e\\
+\tilde{E}_{i+1,j}= \max\{H_{ij}-d(i)-\tilde{q},\tilde{E}_{ij}\}\\
+\end{array}\right.
+\end{equation}
+Let $T$ be the reference sequence. $d(i)$ is the cost of a non-canonical donor
+site, which takes 0 if $T[i+1,i+2]={\tt GT}$, or a positive number $p$
+otherwise. Similarly, $a(i)$ is the cost of a non-canonical acceptor site, which
+takes 0 if $T[i-1,i]={\tt AG}$, or $p$ otherwise. Eq.~(\ref{eq:splice}) is
+almost equivalent to the equation used by EXALIN~\citep{Zhang:2006aa} except
+that we allow insertions immediately followed by deletions and vice versa; in
+addition, we use Suzuki's diagonal formulation in actual implementation.
+
+%Given that $d_i$ and $a_i$
+%are a function of the reference sequence, it is possible to incorporate
+%splicing signals with more sophisticated models, such as positional weight
+%matrices. We have not tried this approach.
+
+If RNA-seq reads are not sequenced from stranded libraries, the read strand
+relative to the underlying transcript is unknown. By default, minimap2 aligns
+each chain twice, first assuming ${\tt GT}$--${\tt AG}$ as the splicing signal
+and then assuming ${\tt CT}$--${\tt AC}$, the reverse complement of ${\tt
+GT}$--${\tt AG}$, as the splicing signal. The alignment with a higher score is
+taken as the final alignment. This procedure also infers the relative strand of
+reads that span canonical splicing sites.
+
+In the spliced alignment mode, minimap2 further increases the density of
+minimizers and disables banded alignment. Together with the two-round DP-based
+alignment, spliced alignment is several times slower than DNA sequence
+alignment.
+
+\end{methods}
+
+\section{Results}
+
+\subsection{Aligning genomic reads}
+
+\begin{figure}[!tb]
+\centering
+\includegraphics[width=.5\textwidth]{roc-color.pdf}
+\caption{Evaluation on simulated SMRT reads aligned against human genome
+GRCh38.  33,088 $\ge$1000bp reads were simulated using pbsim~\citep{Ono:2013aa}
+with error profile sampled from file `m131017\_060208\_42213\_*.1.*' downloaded
+at \href{http://bit.ly/chm1p5c3}{http://bit.ly/chm1p5c3}. The N50 read length
+is 11,628. A read is considered correctly mapped if the true position overlaps
+with the best mapping position by 10\% of the read length. All aligners were
+run under the default setting for SMRT reads.  (a) ROC-like curve. Alignments
+are sorted by mapping quality in the descending order. For each mapping quality
+threshold, the fraction of alignments with mapping quality above the threshold
+and their error rate are plotted.  Kart outputted all alignments at mapping
+quality 60, so is not shown in the figure. It mapped nearly all reads with
+4.1\% of alignments being wrong, less accurate than others.  (b) Accumulative
+mapping error rate as a function of mapping quality.}\label{fig:eval}
+\end{figure}
+
+As a sanity check, we evaluated minimap2 on simulated human reads along with
+BLASR~(v1.MC.rc64; \citealp{Chaisson:2012aa}),
+BWA-MEM~(v0.7.15; \citealp{Li:2013aa}),
+GraphMap~(v0.5.2; \citealp{Sovic:2016aa}),
+Kart~(v2.2.5; \citealp{Lin:2017aa}),
+minialign~(v0.5.3; \citealp{Suzuki:2016}) and
+NGMLR~(v0.2.5; \citealp{Sedlazeck169557}). We excluded rHAT~\citep{Liu:2016ab}
+and LAMSA~\citep{Liu:2017aa} because they either
+crashed or produced malformatted output. In this evaluation, minimap2 has
+higher power to distinguish unique and repetitive hits, and achieves overall
+higher mapping accuracy (Fig.~\ref{fig:eval}a). It is still the most accurate
+even if we skip DP-based alignment (data not shown), confirming chaining alone
+is sufficient to achieve high accuracy for approximate mapping. Minimap2 and
+NGMLR provide better mapping quality estimate: they rarely give repetitive hits
+high mapping quality (Fig.~\ref{fig:eval}b).  Apparently, other aligners may
+occasionally miss close suboptimal hits and be overconfident in wrong mappings.
+On run time, minialign is slightly faster than minimap2 and Kart. They are over
+30 times faster than the rest.  Minimap2 consumed 6.1GB memory at the peak,
+more than BWA-MEM but less than others.
+
+On real human SMRT reads, the relative performance and sensitivity of
+these aligners are broadly similar to the metrics on simulated data. We are
+unable to provide a good estimate of mapping error rate due to the lack of the
+truth.  On ONT $\sim$100kb human reads~\citep{Jain128835}, BWA-MEM failed.
+Kart, minialign and minimap2 are over 70 times faster than others. We have also
+examined tens of $\ge$100bp INDELs in IGV~\citep{Robinson:2011aa} and can
+confirm the observation by~\citet{Sedlazeck169557} that BWA-MEM often breaks
+them into shorter gaps. The issue is much alleviated with minimap2, thanks
+to the 2-piece affine gap cost.
+
+\subsection{Aligning spliced reads}
+
+We evaluated minimap2 on SIRV control data~(AC:SRR5286959;
+\citealp{Byrne:2017aa}) where the truth is known. Minimap2 predicted 59\,916
+introns from 11\,017 reads. 93.0\% of splice juctions are precise. We examined
+wrongly predicted junctions and found the majority were caused by clustered
+splicing signals (e.g. two adjacent ${\tt GT}$ sites). When INDEL sequencing
+errors are frequent, it is difficult to find precise splicing sites in this
+case. If we allow up to 10bp distance from true splicing sites, 98.4\% of
+aligned introns are approximately correct.  Given this observation, we might be
+able to improve boundary detection by initializing $d(\cdot)$ and $a(\cdot)$ in
+Eq.~(\ref{eq:splice}) with position-specific scoring matrices or more
+sophisticated models. We have not tried this approach.
+
+\begin{table}[!tb]
+\processtable{Evaluation of junction accuracy on 2D ONT reads}
+{\footnotesize\label{tab:intron}
+\begin{tabular}{p{3.1cm}rrrr}
+\toprule
+& GMAP & minimap2 & SpAln & STAR\\
+\midrule
+Run time (CPU min) & 631 & 15.5 & 2\,076 & 33.9 \\
+Peak RAM (GByte) & 8.9 & 14.5 & 3.2 & 29.2\vspace{1em}\\
+\# aligned reads & 103\,669 & 103\,917 & 103\,711 & 26\,479\\
+\# chimeric alignments & 1\,904 & 1\,671 & 0 & 0\\
+\# non-spliced alignments & 15\,854 & 14\,483 & 17\,033 & 10\,545\vspace{1em}\\
+\# aligned introns & 692\,275 & 694\,237 & 692\,945 & 78\,603 \\
+\# novel introns & 11\,239 & 3\,217 & 8\,550 & 1\,214 \\
+\% exact introns & 83.8\% & 91.8\% & 87.9\% & 55.2\% \\
+\% approx. introns & 91.8\% & 96.5\% & 92.5\% & 82.4\% \\
+\botrule
+\end{tabular}
+}{Mouse reads (AC:SRR5286960) were mapped to the primary assembly of mouse
+genome GRCm38 with the following tools and command options: minimap2 (`-ax
+splice'); GMAP (`-n 0 --min-intronlength 30 --cross-species'); SpAln (`-Q7 -LS
+-S3'); STARlong (according to
+\href{http://bit.ly/star-pb}{http://bit.ly/star-pb}). The alignments were
+compared to the EnsEMBL gene annotation, release 89. A predicted intron
+is \emph{novel} if it has no overlaps with any annotated introns. An intron
+is \emph{exact} if it is identical to an annotated intron. An intron is
+\emph{approximate} if both its 5'- and 3'-end are within 10bp around the ends
+of an annotated intron.}
+\end{table}
+
+We next aligned real mouse reads~\citep{Byrne:2017aa} with GMAP~(v2017-06-20;
+\citealp{Wu:2005vn}), minimap2, SpAln~(v2.3.1; \citealp{Iwata:2012aa}) and
+STAR~(v2.5.3a; \citealp{Dobin:2013kx}). In general, minimap2 is more
+consistent with existing annotations (Table~\ref{tab:intron}): it finds
+more junctions with a higher percentage being exactly or approximately correct.
+Minimap2 is over 40 times faster than GMAP and SpAln. While STAR is close to
+minimap2 in speed, it does not work well with noisy reads.  We have also
+evaluated spliced aligners on public Iso-Seq data (human Alzheimer brain
+from \href{http://bit.ly/isoseqpub}{http://bit.ly/isoseqpub}). The observation
+is similar: minimap2 is faster at higher junction accuracy.
+
+We noted that GMAP and SpAln have not been optimized for noisy reads. We are
+showing the best setting we have experimented, but their developers should be
+able to improve their accuracy further.
+
+%\begin{table}[!tb]
+%\processtable{Evaluation of junction accuracy on SMRT Iso-Seq reads}
+%{\footnotesize
+%\begin{tabular}{lrrrr}
+%\toprule
+%& GMAP & minimap2 & SpAln & STAR\\
+%\midrule
+%Run time (CPU min) & & 243 & 2\,352 & 1\,647 \\
+%\# aligned reads & & 1\,123\,025 & 1\,094\,092 & 682\,452\\
+%\# chimeric alignments & & 33\,091 & 0 & 0\\
+%\# non-spliced alignments & & 339\,081 & 291\,447 & 272\,536\vspace{1em}\\
+%\# aligned introns & & 9\,071\,755 & 9\,208\,564 & 3\,029\,121 \\
+%\# novel introns & & 42\,773 & 82\,230 & 17\,791 \\
+%\% exact introns & & 94.9\% & 91.7\% & 84.7\% \\
+%\% approx. introns&& 96.9\% & 93.4\% & 93.8\% \\
+%\botrule
+%\end{tabular}
+%}{}
+%\end{table}
+
+
+\section{Conclusion}
+
+Minimap2 is a fast, accurate and versatile aligner for long nucleotide
+sequences.  In addition to reference-based read mapping, minimap2 inherits
+minimap's functionality to search against huge multi-species databases and to
+find read overlaps. On a few test data sets, minimap2 appears to yield slightly
+better miniasm assembly~\citep{Li:2016aa}. Minimap2 can also align similar
+genomes or different assemblies of the same species. However, full-genome
+alignment is an intricate research topic. More thorough evaluations would be
+necessary to justify the use of minimap2 for such applications.
+
+\section*{Acknowledgements}
+We owe a debt of gratitude to Hajime Suzuki for releasing his masterpiece and
+insightful notes before formal publication. We thank M. Schatz, P. Rescheneder
+and F.  Sedlazeck for pointing out the limitation of BWA-MEM. We are also
+grateful to early minimap2 testers who have greatly helped to suggest features
+and to fix various issues.
+
+\bibliography{minimap2}
+
+\end{document}

tex/mm2.approx.eval

@@ -0,0 +1,30 @@
+Q	60	32066	0	0.000000000
+Q	40	32	1	0.000031155
+Q	38	19	1	0.000062272
+Q	36	11	1	0.000093376
+Q	35	32	1	0.000124378
+Q	33	15	1	0.000155400
+Q	32	58	1	0.000186145
+Q	27	11	1	0.000217095
+Q	26	80	1	0.000247494
+Q	21	19	2	0.000309186
+Q	20	16	1	0.000339936
+Q	19	19	1	0.000370622
+Q	18	22	2	0.000432099
+Q	17	37	5	0.000585751
+Q	15	24	2	0.000646930
+Q	14	18	3	0.000738939
+Q	13	30	6	0.000922821
+Q	12	18	1	0.000953054
+Q	11	29	2	0.001013638
+Q	10	30	1	0.001043393
+Q	9	20	5	0.001196099
+Q	8	25	8	0.001440348
+Q	7	28	6	0.001622830
+Q	6	35	12	0.001988132
+Q	5	34	12	0.002352725
+Q	4	29	8	0.002594865
+Q	3	36	14	0.003018937
+Q	2	46	15	0.003471482
+Q	1	69	36	0.004558162
+Q	0	167	94	0.007377173

tex/mm2.eval

@@ -0,0 +1,17 @@
+Q	60	32072	0	0.000000000
+Q	43	206	1	0.000030981
+Q	27	201	1	0.000061578
+Q	15	59	1	0.000092200
+Q	12	25	1	0.000122839
+Q	11	16	1	0.000153473
+Q	10	24	1	0.000184032
+Q	9	17	2	0.000245248
+Q	8	27	3	0.000336938
+Q	7	23	1	0.000367309
+Q	6	20	1	0.000397675
+Q	5	18	4	0.000519751
+Q	4	17	1	0.000550038
+Q	3	29	5	0.000702204
+Q	2	32	4	0.000823522
+Q	1	54	6	0.001004872
+Q	0	234	106	0.004202697

tex/natbib.sty

@@ -0,0 +1,803 @@
+%%
+%% This is file `natbib.sty',
+%% generated with the docstrip utility.
+%%
+%% The original source files were:
+%%
+%% natbib.dtx  (with options: `package,all')
+%% =============================================
+%% IMPORTANT NOTICE:
+%% 
+%% This program can be redistributed and/or modified under the terms
+%% of the LaTeX Project Public License Distributed from CTAN
+%% archives in directory macros/latex/base/lppl.txt; either
+%% version 1 of the License, or any later version.
+%% 
+%% This is a generated file.
+%% It may not be distributed without the original source file natbib.dtx.
+%% 
+%% Full documentation can be obtained by LaTeXing that original file.
+%% Only a few abbreviated comments remain here to describe the usage.
+%% =============================================
+%% Copyright 1993-2000 Patrick W Daly
+%% Max-Planck-Institut f\"ur Aeronomie
+%% Max-Planck-Str. 2
+%% D-37191 Katlenburg-Lindau
+%% Germany
+%% E-mail: daly@linmpi.mpg.de
+\NeedsTeXFormat{LaTeX2e}[1995/06/01]
+\ProvidesPackage{natbib}
+        [2000/07/24 7.0a (PWD)]
+ % This package reimplements the LaTeX \cite command to be used for various
+ % citation styles, both author-year and numerical. It accepts BibTeX
+ % output intended for many other packages, and therefore acts as a
+ % general, all-purpose citation-style interface.
+ %
+ % With standard numerical .bst files, only numerical citations are
+ % possible. With an author-year .bst file, both numerical and
+ % author-year citations are possible.
+ %
+ % If author-year citations are selected, \bibitem must have one of the
+ %   following forms:
+ %   \bibitem[Jones et al.(1990)]{key}...
+ %   \bibitem[Jones et al.(1990)Jones, Baker, and Williams]{key}...
+ %   \bibitem[Jones et al., 1990]{key}...
+ %   \bibitem[\protect\citeauthoryear{Jones, Baker, and Williams}{Jones
+ %       et al.}{1990}]{key}...
+ %   \bibitem[\protect\citeauthoryear{Jones et al.}{1990}]{key}...
+ %   \bibitem[\protect\astroncite{Jones et al.}{1990}]{key}...
+ %   \bibitem[\protect\citename{Jones et al., }1990]{key}...
+ %   \harvarditem[Jones et al.]{Jones, Baker, and Williams}{1990}{key}...
+ %
+ % This is either to be made up manually, or to be generated by an
+ % appropriate .bst file with BibTeX.
+ %                            Author-year mode     ||   Numerical mode
+ % Then, \citet{key}  ==>>  Jones et al. (1990)    ||   Jones et al. [21]
+ %       \citep{key}  ==>> (Jones et al., 1990)    ||   [21]
+ % Multiple citations as normal:
+ % \citep{key1,key2}  ==>> (Jones et al., 1990; Smith, 1989) || [21,24]
+ %                           or  (Jones et al., 1990, 1991)  || [21,24]
+ %                           or  (Jones et al., 1990a,b)     || [21,24]
+ % \cite{key} is the equivalent of \citet{key} in author-year mode
+ %                         and  of \citep{key} in numerical mode
+ % Full author lists may be forced with \citet* or \citep*, e.g.
+ %       \citep*{key}      ==>> (Jones, Baker, and Williams, 1990)
+ % Optional notes as:
+ %   \citep[chap. 2]{key}    ==>> (Jones et al., 1990, chap. 2)
+ %   \citep[e.g.,][]{key}    ==>> (e.g., Jones et al., 1990)
+ %   \citep[see][pg. 34]{key}==>> (see Jones et al., 1990, pg. 34)
+ %  (Note: in standard LaTeX, only one note is allowed, after the ref.
+ %   Here, one note is like the standard, two make pre- and post-notes.)
+ %   \citealt{key}          ==>> Jones et al. 1990
+ %   \citealt*{key}         ==>> Jones, Baker, and Williams 1990
+ %   \citealp{key}          ==>> Jones et al., 1990
+ %   \citealp*{key}         ==>> Jones, Baker, and Williams, 1990
+ % Additional citation possibilities (both author-year and numerical modes)
+ %   \citeauthor{key}       ==>> Jones et al.
+ %   \citeauthor*{key}      ==>> Jones, Baker, and Williams
+ %   \citeyear{key}         ==>> 1990
+ %   \citeyearpar{key}      ==>> (1990)
+ %   \citetext{priv. comm.} ==>> (priv. comm.)
+ % Note: full author lists depends on whether the bib style supports them;
+ %       if not, the abbreviated list is printed even when full requested.
+ %
+ % For names like della Robbia at the start of a sentence, use
+ %   \Citet{dRob98}         ==>> Della Robbia (1998)
+ %   \Citep{dRob98}         ==>> (Della Robbia, 1998)
+ %   \Citeauthor{dRob98}    ==>> Della Robbia
+ %
+ %
+ % Citation aliasing is achieved with
+ %   \defcitealias{key}{text}
+ %   \citetalias{key}  ==>> text
+ %   \citepalias{key}  ==>> (text)
+ %
+ % Defining the citation style of a given bib style:
+ % Use \bibpunct (in the preamble only) with 6 mandatory arguments:
+ %    1. opening bracket for citation
+ %    2. closing bracket
+ %    3. citation separator (for multiple citations in one \cite)
+ %    4. the letter n for numerical styles, s for superscripts
+ %        else anything for author-year
+ %    5. punctuation between authors and date
+ %    6. punctuation between years (or numbers) when common authors missing
+ % One optional argument is the character coming before post-notes. It
+ %   appears in square braces before all other arguments. May be left off.
+ % Example (and default) \bibpunct[, ]{(}{)}{;}{a}{,}{,}
+ %
+ % To make this automatic for a given bib style, named newbib, say, make
+ % a local configuration file, natbib.cfg, with the definition
+ %   \newcommand{\bibstyle@newbib}{\bibpunct...}
+ % Then the \bibliographystyle{newbib} will cause \bibstyle@newbib to
+ % be called on THE NEXT LATEX RUN (via the aux file).
+ %
+ % Such preprogrammed definitions may be invoked in the text (preamble only)
+ %  by calling \citestyle{newbib}. This is only useful if the style specified
+ %  differs from that in \bibliographystyle.
+ %
+ % With \citeindextrue and \citeindexfalse, one can control whether the
+ % \cite commands make an automatic entry of the citation in the .idx
+ % indexing file. For this, \makeindex must also be given in the preamble.
+ %
+ % LaTeX2e Options: (for selecting punctuation)
+ %   round  -  round parentheses are used (default)
+ %   square -  square brackets are used   [option]
+ %   curly  -  curly braces are used      {option}
+ %   angle  -  angle brackets are used    <option>
+ %   colon  -  multiple citations separated by colon (default)
+ %   comma  -  separated by comma
+ %   authoryear - selects author-year citations (default)
+ %   numbers-  selects numerical citations
+ %   super  -  numerical citations as superscripts
+ %   sort   -  sorts multiple citations according to order in ref. list
+ %   sort&compress   -  like sort, but also compresses numerical citations
+ %   longnamesfirst  -  makes first citation full author list
+ %   sectionbib - puts bibliography in a \section* instead of \chapter*
+ % Punctuation so selected dominates over any predefined ones.
+ % LaTeX2e options are called as, e.g.
+ %        \usepackage[square,comma]{natbib}
+ % LaTeX the source file natbib.dtx to obtain more details
+ % or the file natnotes.tex for a brief reference sheet.
+ %-----------------------------------------------------------
+\@ifclassloaded{aguplus}{\PackageError{natbib}
+  {The aguplus class already includes natbib coding,\MessageBreak
+   so you should not add it explicitly}
+  {Type <Return> for now, but then later remove\MessageBreak
+   the command \protect\usepackage{natbib} from the document}
+  \endinput}{}
+\@ifclassloaded{nlinproc}{\PackageError{natbib}
+  {The nlinproc class already includes natbib coding,\MessageBreak
+   so you should not add it explicitly}
+  {Type <Return> for now, but then later remove\MessageBreak
+   the command \protect\usepackage{natbib} from the document}
+  \endinput}{}
+\@ifclassloaded{egs}{\PackageError{natbib}
+  {The egs class already includes natbib coding,\MessageBreak
+   so you should not add it explicitly}
+  {Type <Return> for now, but then later remove\MessageBreak
+   the command \protect\usepackage{natbib} from the document}
+  \endinput}{}
+ % Define citation punctuation for some author-year styles
+ % One may add and delete at this point
+ % Or put additions into local configuration file natbib.cfg
+\newcommand\bibstyle@chicago{\bibpunct{(}{)}{;}{a}{,}{,}}
+\newcommand\bibstyle@named{\bibpunct{[}{]}{;}{a}{,}{,}}
+\newcommand\bibstyle@agu{\bibpunct{[}{]}{;}{a}{,}{,~}}%Amer. Geophys. Union
+\newcommand\bibstyle@egs{\bibpunct{(}{)}{;}{a}{,}{,}}%Eur. Geophys. Soc.
+\newcommand\bibstyle@agsm{\bibpunct{(}{)}{,}{a}{}{,}\gdef\harvardand{\&}}
+\newcommand\bibstyle@kluwer{\bibpunct{(}{)}{,}{a}{}{,}\gdef\harvardand{\&}}
+\newcommand\bibstyle@dcu{\bibpunct{(}{)}{;}{a}{;}{,}\gdef\harvardand{and}}
+\newcommand\bibstyle@aa{\bibpunct{(}{)}{;}{a}{}{,}} %Astronomy & Astrophysics
+\newcommand\bibstyle@pass{\bibpunct{(}{)}{;}{a}{,}{,}}%Planet. & Space Sci
+\newcommand\bibstyle@anngeo{\bibpunct{(}{)}{;}{a}{,}{,}}%Annales Geophysicae
+\newcommand\bibstyle@nlinproc{\bibpunct{(}{)}{;}{a}{,}{,}}%Nonlin.Proc.Geophys.
+ % Define citation punctuation for some numerical styles
+\newcommand\bibstyle@cospar{\bibpunct{/}{/}{,}{n}{}{}%
+     \gdef\NAT@biblabelnum##1{##1.}}
+\newcommand\bibstyle@esa{\bibpunct{(Ref.~}{)}{,}{n}{}{}%
+     \gdef\NAT@biblabelnum##1{##1.\hspace{1em}}}
+\newcommand\bibstyle@nature{\bibpunct{}{}{,}{s}{}{\textsuperscript{,}}%
+     \gdef\NAT@biblabelnum##1{##1.}}
+ % The standard LaTeX styles
+\newcommand\bibstyle@plain{\bibpunct{[}{]}{,}{n}{}{,}}
+\let\bibstyle@alpha=\bibstyle@plain
+\let\bibstyle@abbrv=\bibstyle@plain
+\let\bibstyle@unsrt=\bibstyle@plain
+ % The author-year modifications of the standard styles
+\newcommand\bibstyle@plainnat{\bibpunct{[}{]}{,}{a}{,}{,}}
+\let\bibstyle@abbrvnat=\bibstyle@plainnat
+\let\bibstyle@unsrtnat=\bibstyle@plainnat
+\newif\ifNAT@numbers \NAT@numbersfalse
+\newif\ifNAT@super \NAT@superfalse
+\DeclareOption{numbers}{\NAT@numberstrue
+   \ExecuteOptions{square,comma,nobibstyle}}
+\DeclareOption{super}{\NAT@supertrue\NAT@numberstrue
+   \renewcommand\NAT@open{}\renewcommand\NAT@close{}
+   \ExecuteOptions{nobibstyle}}
+\DeclareOption{authoryear}{\NAT@numbersfalse
+   \ExecuteOptions{round,colon,bibstyle}}
+\DeclareOption{round}{%
+      \renewcommand\NAT@open{(} \renewcommand\NAT@close{)}
+   \ExecuteOptions{nobibstyle}}
+\DeclareOption{square}{%
+      \renewcommand\NAT@open{[} \renewcommand\NAT@close{]}
+   \ExecuteOptions{nobibstyle}}
+\DeclareOption{angle}{%
+      \renewcommand\NAT@open{$<$} \renewcommand\NAT@close{$>$}
+   \ExecuteOptions{nobibstyle}}
+\DeclareOption{curly}{%
+      \renewcommand\NAT@open{\{} \renewcommand\NAT@close{\}}
+   \ExecuteOptions{nobibstyle}}
+\DeclareOption{comma}{\renewcommand\NAT@sep{,}
+   \ExecuteOptions{nobibstyle}}
+\DeclareOption{colon}{\renewcommand\NAT@sep{;}
+   \ExecuteOptions{nobibstyle}}
+\DeclareOption{nobibstyle}{\let\bibstyle=\@gobble}
+\DeclareOption{bibstyle}{\let\bibstyle=\@citestyle}
+\newif\ifNAT@openbib \NAT@openbibfalse
+\DeclareOption{openbib}{\NAT@openbibtrue}
+\DeclareOption{sectionbib}{\def\NAT@sectionbib{on}}
+\def\NAT@sort{0}
+\DeclareOption{sort}{\def\NAT@sort{1}}
+\DeclareOption{sort&compress}{\def\NAT@sort{2}}
+\@ifpackageloaded{cite}{\PackageWarningNoLine{natbib}
+  {The `cite' package should not be used\MessageBreak
+   with natbib. Use option `sort' instead}\ExecuteOptions{sort}}{}
+\newif\ifNAT@longnames\NAT@longnamesfalse
+\DeclareOption{longnamesfirst}{\NAT@longnamestrue}
+\DeclareOption{nonamebreak}{\def\NAT@nmfmt#1{\mbox{\NAT@up#1}}}
+\def\NAT@nmfmt#1{{\NAT@up#1}}
+\renewcommand\bibstyle[1]{\@ifundefined{bibstyle@#1}{\relax}
+     {\csname bibstyle@#1\endcsname}}
+\AtBeginDocument{\global\let\bibstyle=\@gobble}
+\let\@citestyle\bibstyle
+\newcommand\citestyle[1]{\@citestyle{#1}\let\bibstyle\@gobble}
+\@onlypreamble{\citestyle}\@onlypreamble{\@citestyle}
+\newcommand\bibpunct[7][, ]%
+  {\gdef\NAT@open{#2}\gdef\NAT@close{#3}\gdef
+   \NAT@sep{#4}\global\NAT@numbersfalse\ifx #5n\global\NAT@numberstrue
+   \else
+   \ifx #5s\global\NAT@numberstrue\global\NAT@supertrue
+   \fi\fi
+   \gdef\NAT@aysep{#6}\gdef\NAT@yrsep{#7}%
+   \gdef\NAT@cmt{#1}%
+   \global\let\bibstyle\@gobble
+  }
+\@onlypreamble{\bibpunct}
+\newcommand\NAT@open{(} \newcommand\NAT@close{)}
+\newcommand\NAT@sep{;}
+\ProcessOptions
+\newcommand\NAT@aysep{,} \newcommand\NAT@yrsep{,}
+\newcommand\NAT@cmt{, }
+\newcommand\NAT@cite%
+    [3]{\ifNAT@swa\NAT@@open\if*#2*\else#2\ \fi
+        #1\if*#3*\else\NAT@cmt#3\fi\NAT@@close\else#1\fi\endgroup}
+\newcommand\NAT@citenum%
+    [3]{\ifNAT@swa\NAT@@open\if*#2*\else#2\ \fi
+        #1\if*#3*\else\NAT@cmt#3\fi\NAT@@close\else#1\fi\endgroup}
+\newcommand\NAT@citesuper[3]{\ifNAT@swa
+\unskip\hspace{1\p@}\textsuperscript{#1}%
+   \if*#3*\else\ (#3)\fi\else #1\fi\endgroup}
+\providecommand
+  \textsuperscript[1]{\mbox{$^{\mbox{\scriptsize#1}}$}}
+\providecommand\@firstofone[1]{#1}
+\newcommand\NAT@citexnum{}
+\def\NAT@citexnum[#1][#2]#3{%
+ \NAT@sort@cites{#3}%
+ \let\@citea\@empty
+  \@cite{\def\NAT@num{-1}\let\NAT@last@yr\relax\let\NAT@nm\@empty
+    \@for\@citeb:=\NAT@cite@list\do
+    {\edef\@citeb{\expandafter\@firstofone\@citeb}%
+     \if@filesw\immediate\write\@auxout{\string\citation{\@citeb}}\fi
+     \@ifundefined{b@\@citeb\@extra@b@citeb}{%
+       {\reset@font\bfseries?}
+        \NAT@citeundefined\PackageWarning{natbib}%
+       {Citation `\@citeb' on page \thepage \space undefined}}%
+     {\let\NAT@last@num\NAT@num\let\NAT@last@nm\NAT@nm
+      \NAT@parse{\@citeb}%
+      \ifNAT@longnames\@ifundefined{bv@\@citeb\@extra@b@citeb}{%
+        \let\NAT@name=\NAT@all@names
+        \global\@namedef{bv@\@citeb\@extra@b@citeb}{}}{}%
+      \fi
+      \ifNAT@full\let\NAT@nm\NAT@all@names\else
+        \let\NAT@nm\NAT@name\fi
+      \ifNAT@swa
+       \ifnum\NAT@ctype>1\relax\@citea
+        \hyper@natlinkstart{\@citeb\@extra@b@citeb}%
+            \ifnum\NAT@ctype=2\relax\NAT@test{\NAT@ctype}%
+            \else\NAT@alias
+            \fi\hyper@natlinkend\else
+       \ifnum\NAT@sort>1
+         \begingroup\catcode`\_=8
+            \ifcat _\ifnum\z@<0\NAT@num _\else A\fi
+              \global\let\NAT@nm=\NAT@num \else \gdef\NAT@nm{-2}\fi
+            \ifcat _\ifnum\z@<0\NAT@last@num _\else A\fi
+              \global\@tempcnta=\NAT@last@num \global\advance\@tempcnta by\@ne
+              \else \global\@tempcnta\m@ne\fi
+         \endgroup
+         \ifnum\NAT@nm=\@tempcnta
+           \ifx\NAT@last@yr\relax
+             \edef\NAT@last@yr{\@citea \mbox{\noexpand\citenumfont{\NAT@num}}}%
+           \else
+             \edef\NAT@last@yr{--\penalty\@m\mbox{\noexpand\citenumfont{\NAT@num}}}%
+           \fi
+         \else
+           \NAT@last@yr \@citea \mbox{\citenumfont{\NAT@num}}%
+           \let\NAT@last@yr\relax
+         \fi
+       \else
+         \@citea \mbox{\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
+           {\citenumfont{\NAT@num}}\hyper@natlinkend}%
+       \fi
+       \fi
+       \def\@citea{\NAT@sep\penalty\@m\NAT@space}%
+      \else
+        \ifcase\NAT@ctype\relax
+          \ifx\NAT@last@nm\NAT@nm \NAT@yrsep\penalty\@m\NAT@space\else
+          \@citea \NAT@test{1}\ \NAT@@open
+          \if*#1*\else#1\ \fi\fi \NAT@mbox{%
+          \hyper@natlinkstart{\@citeb\@extra@b@citeb}%
+          {\citenumfont{\NAT@num}}\hyper@natlinkend}%
+          \def\@citea{\NAT@@close\NAT@sep\penalty\@m\ }%
+        \or\@citea
+          \hyper@natlinkstart{\@citeb\@extra@b@citeb}%
+           \NAT@test{\NAT@ctype}\hyper@natlinkend
+          \def\@citea{\NAT@sep\penalty\@m\ }%
+        \or\@citea
+          \hyper@natlinkstart{\@citeb\@extra@b@citeb}%
+           \NAT@test{\NAT@ctype}\hyper@natlinkend
+          \def\@citea{\NAT@sep\penalty\@m\ }%
+        \or\@citea
+          \hyper@natlinkstart{\@citeb\@extra@b@citeb}%
+           \NAT@alias\hyper@natlinkend
+          \def\@citea{\NAT@sep\penalty\@m\ }%
+        \fi
+      \fi
+      }}%
+      \ifnum\NAT@sort>1\relax\NAT@last@yr\fi
+      \ifNAT@swa\else\ifnum\NAT@ctype=0\if*#2*\else
+      \NAT@cmt#2\fi \NAT@@close\fi\fi}{#1}{#2}}
+\newcommand\NAT@test[1]{\ifnum#1=1 \ifx\NAT@nm\NAT@noname
+  {\reset@font\bfseries(author?)}\PackageWarning{natbib}
+  {Author undefined for citation`\@citeb'
+   \MessageBreak
+   on page \thepage}\else \NAT@nm \fi
+  \else \if\relax\NAT@date\relax
+  {\reset@font\bfseries(year?)}\PackageWarning{natbib}
+  {Year undefined for citation`\@citeb'
+   \MessageBreak
+   on page \thepage}\else \NAT@date \fi \fi}
+\let\citenumfont=\relax
+\newcommand\NAT@citex{}
+\def\NAT@citex%
+  [#1][#2]#3{%
+  \NAT@sort@cites{#3}%
+  \let\@citea\@empty
+  \@cite{\let\NAT@nm\@empty\let\NAT@year\@empty
+    \@for\@citeb:=\NAT@cite@list\do
+    {\edef\@citeb{\expandafter\@firstofone\@citeb}%
+     \if@filesw\immediate\write\@auxout{\string\citation{\@citeb}}\fi
+     \@ifundefined{b@\@citeb\@extra@b@citeb}{\@citea%
+       {\reset@font\bfseries ?}\NAT@citeundefined
+                 \PackageWarning{natbib}%
+       {Citation `\@citeb' on page \thepage \space undefined}\def\NAT@date{}}%
+     {\let\NAT@last@nm=\NAT@nm\let\NAT@last@yr=\NAT@year
+     \NAT@parse{\@citeb}%
+      \ifNAT@longnames\@ifundefined{bv@\@citeb\@extra@b@citeb}{%
+        \let\NAT@name=\NAT@all@names
+        \global\@namedef{bv@\@citeb\@extra@b@citeb}{}}{}%
+      \fi
+     \ifNAT@full\let\NAT@nm\NAT@all@names\else
+       \let\NAT@nm\NAT@name\fi
+     \ifNAT@swa\ifcase\NAT@ctype
+       \if\relax\NAT@date\relax
+         \@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
+         \NAT@nmfmt{\NAT@nm}\NAT@date\hyper@natlinkend
+       \else
+         \ifx\NAT@last@nm\NAT@nm\NAT@yrsep
+            \ifx\NAT@last@yr\NAT@year
+              \hyper@natlinkstart{\@citeb\@extra@b@citeb}\NAT@exlab
+              \hyper@natlinkend
+            \else\unskip\
+              \hyper@natlinkstart{\@citeb\@extra@b@citeb}\NAT@date
+              \hyper@natlinkend
+            \fi
+         \else\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
+           \NAT@nmfmt{\NAT@nm}%
+           \hyper@natlinkbreak{\NAT@aysep\ }{\@citeb\@extra@b@citeb}%
+           \NAT@date\hyper@natlinkend
+         \fi
+       \fi
+     \or\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
+         \NAT@nmfmt{\NAT@nm}\hyper@natlinkend
+     \or\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
+         \NAT@date\hyper@natlinkend
+     \or\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
+         \NAT@alias\hyper@natlinkend
+     \fi \def\@citea{\NAT@sep\ }%
+     \else\ifcase\NAT@ctype
+        \if\relax\NAT@date\relax
+          \@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
+          \NAT@nmfmt{\NAT@nm}\hyper@natlinkend
+        \else
+         \ifx\NAT@last@nm\NAT@nm\NAT@yrsep
+            \ifx\NAT@last@yr\NAT@year
+              \hyper@natlinkstart{\@citeb\@extra@b@citeb}\NAT@exlab
+              \hyper@natlinkend
+            \else\unskip\
+              \hyper@natlinkstart{\@citeb\@extra@b@citeb}\NAT@date
+              \hyper@natlinkend
+            \fi
+         \else\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
+           \NAT@nmfmt{\NAT@nm}%
+           \hyper@natlinkbreak{\ \NAT@@open\if*#1*\else#1\ \fi}%
+              {\@citeb\@extra@b@citeb}%
+           \NAT@date\hyper@natlinkend\fi
+        \fi
+       \or\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
+         \NAT@nmfmt{\NAT@nm}\hyper@natlinkend
+       \or\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
+         \NAT@date\hyper@natlinkend
+       \or\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
+         \NAT@alias\hyper@natlinkend
+       \fi \if\relax\NAT@date\relax\def\@citea{\NAT@sep\ }%
+           \else\def\@citea{\NAT@@close\NAT@sep\ }\fi
+     \fi
+     }}\ifNAT@swa\else\if*#2*\else\NAT@cmt#2\fi
+     \if\relax\NAT@date\relax\else\NAT@@close\fi\fi}{#1}{#2}}
+\newif\ifNAT@par \NAT@partrue
+\newcommand\NAT@@open{\ifNAT@par\NAT@open\fi}
+\newcommand\NAT@@close{\ifNAT@par\NAT@close\fi}
+\newcommand\NAT@alias{\@ifundefined{al@\@citeb\@extra@b@citeb}{%
+  {\reset@font\bfseries(alias?)}\PackageWarning{natbib}
+  {Alias undefined for citation `\@citeb'
+  \MessageBreak on page \thepage}}{\@nameuse{al@\@citeb\@extra@b@citeb}}}
+\let\NAT@up\relax
+\newcommand\NAT@Up[1]{{\let\protect\@unexpandable@protect\let~\relax
+  \expandafter\NAT@deftemp#1}\expandafter\NAT@UP\NAT@temp}
+\newcommand\NAT@deftemp[1]{\xdef\NAT@temp{#1}}
+\newcommand\NAT@UP[1]{\let\@tempa\NAT@UP\ifcat a#1\MakeUppercase{#1}%
+  \let\@tempa\relax\else#1\fi\@tempa}
+\newcommand\shortcites[1]{%
+  \@bsphack\@for\@citeb:=#1\do
+  {\edef\@citeb{\expandafter\@firstofone\@citeb}%
+   \global\@namedef{bv@\@citeb\@extra@b@citeb}{}}\@esphack}
+\newcommand\NAT@biblabel[1]{\hfill}
+\newcommand\NAT@biblabelnum[1]{\bibnumfmt{#1}}
+\newcommand\bibnumfmt[1]{[#1]}
+\def\@tempa#1{[#1]}
+\ifx\@tempa\@biblabel\let\@biblabel\@empty\fi
+\newcommand\NAT@bibsetnum[1]{\settowidth\labelwidth{\@biblabel{#1}}%
+   \setlength{\leftmargin}{\labelwidth}\addtolength{\leftmargin}{\labelsep}%
+   \setlength{\itemsep}{\bibsep}\setlength{\parsep}{\z@}%
+   \ifNAT@openbib
+     \addtolength{\leftmargin}{4mm}%
+     \setlength{\itemindent}{-4mm}%
+     \setlength{\listparindent}{\itemindent}%
+     \setlength{\parsep}{0pt}%
+   \fi
+}
+\newlength{\bibhang}
+\setlength{\bibhang}{1em}
+\newlength{\bibsep}
+{\@listi \global\bibsep\itemsep \global\advance\bibsep by\parsep}
+
+\newcommand\NAT@bibsetup%
+   [1]{\setlength{\leftmargin}{\bibhang}\setlength{\itemindent}{-\leftmargin}%
+       \setlength{\itemsep}{\bibsep}\setlength{\parsep}{\z@}}
+\newcommand\NAT@set@cites{\ifNAT@numbers
+  \ifNAT@super \let\@cite\NAT@citesuper
+     \def\NAT@mbox##1{\unskip\nobreak\hspace{1\p@}\textsuperscript{##1}}%
+     \let\citeyearpar=\citeyear
+     \let\NAT@space\relax\else
+     \let\NAT@mbox=\mbox
+     \let\@cite\NAT@citenum \def\NAT@space{ }\fi
+  \let\@citex\NAT@citexnum
+  \ifx\@biblabel\@empty\let\@biblabel\NAT@biblabelnum\fi
+  \let\@bibsetup\NAT@bibsetnum
+  \def\natexlab##1{}%
+ \else
+  \let\@cite\NAT@cite
+  \let\@citex\NAT@citex
+  \let\@biblabel\NAT@biblabel
+  \let\@bibsetup\NAT@bibsetup
+  \def\natexlab##1{##1}%
+ \fi}
+\AtBeginDocument{\NAT@set@cites}
+\AtBeginDocument{\ifx\SK@def\@undefined\else
+\ifx\SK@cite\@empty\else
+  \SK@def\@citex[#1][#2]#3{\SK@\SK@@ref{#3}\SK@@citex[#1][#2]{#3}}\fi
+\ifx\SK@citeauthor\@undefined\def\HAR@checkdef{}\else
+  \let\citeauthor\SK@citeauthor
+  \let\citefullauthor\SK@citefullauthor
+  \let\citeyear\SK@citeyear\fi
+\fi}
+\AtBeginDocument{\@ifpackageloaded{hyperref}{%
+  \ifnum\NAT@sort=2\def\NAT@sort{1}\fi}{}}
+\newif\ifNAT@full\NAT@fullfalse
+\newif\ifNAT@swa
+\DeclareRobustCommand\citet
+   {\begingroup\NAT@swafalse\def\NAT@ctype{0}\NAT@partrue
+     \@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
+\newcommand\NAT@citetp{\@ifnextchar[{\NAT@@citetp}{\NAT@@citetp[]}}
+\newcommand\NAT@@citetp{}
+\def\NAT@@citetp[#1]{\@ifnextchar[{\@citex[#1]}{\@citex[][#1]}}
+\DeclareRobustCommand\citep
+   {\begingroup\NAT@swatrue\def\NAT@ctype{0}\NAT@partrue
+         \@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
+\DeclareRobustCommand\cite
+    {\begingroup\def\NAT@ctype{0}\NAT@partrue\NAT@swatrue
+      \@ifstar{\NAT@fulltrue\NAT@cites}{\NAT@fullfalse\NAT@cites}}
+\newcommand\NAT@cites{\@ifnextchar [{\NAT@@citetp}{%
+     \ifNAT@numbers\else
+     \NAT@swafalse
+     \fi
+    \NAT@@citetp[]}}
+\DeclareRobustCommand\citealt
+   {\begingroup\NAT@swafalse\def\NAT@ctype{0}\NAT@parfalse
+         \@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
+\DeclareRobustCommand\citealp
+   {\begingroup\NAT@swatrue\def\NAT@ctype{0}\NAT@parfalse
+         \@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
+\DeclareRobustCommand\citeauthor
+   {\begingroup\NAT@swafalse\def\NAT@ctype{1}\NAT@parfalse
+    \@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
+\DeclareRobustCommand\Citet
+   {\begingroup\NAT@swafalse\def\NAT@ctype{0}\NAT@partrue
+     \let\NAT@up\NAT@Up
+     \@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
+\DeclareRobustCommand\Citep
+   {\begingroup\NAT@swatrue\def\NAT@ctype{0}\NAT@partrue
+     \let\NAT@up\NAT@Up
+         \@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
+\DeclareRobustCommand\Citealt
+   {\begingroup\NAT@swafalse\def\NAT@ctype{0}\NAT@parfalse
+     \let\NAT@up\NAT@Up
+         \@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
+\DeclareRobustCommand\Citealp
+   {\begingroup\NAT@swatrue\def\NAT@ctype{0}\NAT@parfalse
+     \let\NAT@up\NAT@Up
+         \@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
+\DeclareRobustCommand\Citeauthor
+   {\begingroup\NAT@swafalse\def\NAT@ctype{1}\NAT@parfalse
+     \let\NAT@up\NAT@Up
+    \@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
+\DeclareRobustCommand\citeyear
+   {\begingroup\NAT@swafalse\def\NAT@ctype{2}\NAT@parfalse\NAT@citetp}
+\DeclareRobustCommand\citeyearpar
+   {\begingroup\NAT@swatrue\def\NAT@ctype{2}\NAT@partrue\NAT@citetp}
+\newcommand\citetext[1]{\NAT@open#1\NAT@close}
+\DeclareRobustCommand\citefullauthor
+   {\citeauthor*}
+\newcommand\defcitealias[2]{%
+   \@ifundefined{al@#1\@extra@b@citeb}{}
+   {\PackageWarning{natbib}{Overwriting existing alias for citation #1}}
+   \@namedef{al@#1\@extra@b@citeb}{#2}}
+\DeclareRobustCommand\citetalias{\begingroup
+   \NAT@swafalse\def\NAT@ctype{3}\NAT@parfalse\NAT@citetp}
+\DeclareRobustCommand\citepalias{\begingroup
+   \NAT@swatrue\def\NAT@ctype{3}\NAT@partrue\NAT@citetp}
+\renewcommand\nocite[1]{\@bsphack
+  \@for\@citeb:=#1\do{%
+    \edef\@citeb{\expandafter\@firstofone\@citeb}%
+    \if@filesw\immediate\write\@auxout{\string\citation{\@citeb}}\fi
+    \if*\@citeb\else
+    \@ifundefined{b@\@citeb\@extra@b@citeb}{%
+       \NAT@citeundefined \PackageWarning{natbib}%
+       {Citation `\@citeb' undefined}}{}\fi}%
+  \@esphack}
+\newcommand\NAT@parse[1]{{%
+     \let\protect=\@unexpandable@protect\let~\relax
+     \let\active@prefix=\@gobble
+     \xdef\NAT@temp{\csname b@#1\@extra@b@citeb\endcsname}}%
+     \expandafter\NAT@split\NAT@temp
+     \expandafter\NAT@parse@date\NAT@date??????@@%
+     \ifciteindex\NAT@index\fi
+}
+\newcommand\NAT@split[4]{%
+  \gdef\NAT@num{#1}\gdef\NAT@name{#3}\gdef\NAT@date{#2}%
+  \gdef\NAT@all@names{#4}%
+  \ifx\NAT@noname\NAT@all@names \gdef\NAT@all@names{#3}\fi}
+\newcommand\NAT@parse@date{}
+\def\NAT@parse@date#1#2#3#4#5#6@@{%
+  \ifnum\the\catcode`#1=11\def\NAT@year{}\def\NAT@exlab{#1}\else
+  \ifnum\the\catcode`#2=11\def\NAT@year{#1}\def\NAT@exlab{#2}\else
+  \ifnum\the\catcode`#3=11\def\NAT@year{#1#2}\def\NAT@exlab{#3}\else
+  \ifnum\the\catcode`#4=11\def\NAT@year{#1#2#3}\def\NAT@exlab{#4}\else
+    \def\NAT@year{#1#2#3#4}\def\NAT@exlab{{#5}}\fi\fi\fi\fi}
+\newcommand\NAT@index{}
+\let\NAT@makeindex=\makeindex
+\renewcommand\makeindex{\NAT@makeindex
+  \renewcommand\NAT@index{\@bsphack\begingroup
+     \def~{\string~}\@wrindex{\NAT@idxtxt}}}
+\newcommand\NAT@idxtxt{\NAT@name\ \NAT@open\NAT@date\NAT@close}
+\@ifundefined{@indexfile}{}{\let\NAT@makeindex\relax\makeindex}
+\newif\ifciteindex \citeindexfalse
+\newcommand\citeindextype{default}
+\newcommand\NAT@index@alt{{\let\protect=\noexpand\let~\relax
+  \xdef\NAT@temp{\NAT@idxtxt}}\expandafter\NAT@exp\NAT@temp\@nil}
+\newcommand\NAT@exp{}
+\def\NAT@exp#1\@nil{\mbox{}\index[\citeindextype]{#1}}
+
+\AtBeginDocument{%
+\@ifpackageloaded{index}{\let\NAT@index=\NAT@index@alt}{}}
+\newcommand\NAT@ifcmd{\futurelet\NAT@temp\NAT@ifxcmd}
+\newcommand\NAT@ifxcmd{\ifx\NAT@temp\relax\else\expandafter\NAT@bare\fi}
+\def\NAT@bare#1(#2)#3(@)#4\@nil#5{%
+  \if @#2
+  \expandafter\NAT@apalk#1, , \@nil{#5}\else
+  \stepcounter{NAT@ctr}%
+  \NAT@wrout{\arabic {NAT@ctr}}{#2}{#1}{#3}{#5}
+\fi
+}
+\newcommand\NAT@wrout[5]{%
+\if@filesw
+      {\let\protect\noexpand\let~\relax
+       \immediate
+       \write\@auxout{\string\bibcite{#5}{{#1}{#2}{{#3}}{{#4}}}}}\fi
+\ignorespaces}
+\def\NAT@noname{{}}
+\renewcommand\bibitem{%
+  \@ifnextchar[{\@lbibitem}{%
+    \global\NAT@stdbsttrue
+    \stepcounter{NAT@ctr}\@lbibitem[\arabic{NAT@ctr}]}}
+\def\@lbibitem[#1]#2{%
+  \if\relax\@extra@b@citeb\relax\else
+    \@ifundefined{br@#2\@extra@b@citeb}{}{%
+     \@namedef{br@#2}{\@nameuse{br@#2\@extra@b@citeb}}}\fi
+   \@ifundefined{b@#2\@extra@b@citeb}{\def\NAT@num{}}{\NAT@parse{#2}}%
+   \item[\hfil\hyper@natanchorstart{#2\@extra@b@citeb}\@biblabel{\NAT@num}%
+    \hyper@natanchorend]%
+    \NAT@ifcmd#1(@)(@)\@nil{#2}}
+\ifx\SK@lbibitem\@undefined\else
+   \let\SK@lbibitem\@lbibitem
+   \def\@lbibitem[#1]#2{%
+     \SK@lbibitem[#1]{#2}\SK@\SK@@label{#2}\ignorespaces}\fi
+\newif\ifNAT@stdbst \NAT@stdbstfalse
+
+\AtEndDocument
+  {\ifNAT@stdbst\if@filesw\immediate\write\@auxout{\string
+   \global\string\NAT@numberstrue}\fi\fi
+  }
+\providecommand\bibcite{}
+\renewcommand\bibcite[2]{\@ifundefined{b@#1\@extra@binfo}\relax
+     {\NAT@citemultiple
+      \PackageWarningNoLine{natbib}{Citation `#1' multiply defined}}%
+  \global\@namedef{b@#1\@extra@binfo}{#2}}
+\AtEndDocument{\NAT@swatrue\let\bibcite\NAT@testdef}
+\newcommand\NAT@testdef[2]{%
+  \def\NAT@temp{#2}\expandafter \ifx \csname b@#1\@extra@binfo\endcsname
+    \NAT@temp \else \ifNAT@swa \NAT@swafalse
+       \PackageWarningNoLine{natbib}{Citation(s) may have
+          changed.\MessageBreak
+          Rerun to get citations correct}\fi\fi}
+\newcommand\NAT@apalk{}
+\def\NAT@apalk#1, #2, #3\@nil#4{\if\relax#2\relax
+  \global\NAT@stdbsttrue
+  \NAT@wrout{#1}{}{}{}{#4}\else
+  \stepcounter{NAT@ctr}%
+  \NAT@wrout{\arabic {NAT@ctr}}{#2}{#1}{}{#4}\fi}
+\newcommand\citeauthoryear{}
+\def\citeauthoryear#1#2#3(@)(@)\@nil#4{\stepcounter{NAT@ctr}\if\relax#3\relax
+   \NAT@wrout{\arabic {NAT@ctr}}{#2}{#1}{}{#4}\else
+   \NAT@wrout{\arabic {NAT@ctr}}{#3}{#2}{#1}{#4}\fi}
+\newcommand\citestarts{\NAT@open}
+\newcommand\citeends{\NAT@close}
+\newcommand\betweenauthors{and}
+\newcommand\astroncite{}
+\def\astroncite#1#2(@)(@)\@nil#3{\stepcounter{NAT@ctr}\NAT@wrout{\arabic
+{NAT@ctr}}{#2}{#1}{}{#3}}
+\newcommand\citename{}
+\def\citename#1#2(@)(@)\@nil#3{\expandafter\NAT@apalk#1#2, \@nil{#3}}
+\newcommand\harvarditem[4][]%
+    {\if\relax#1\relax\bibitem[#2(#3)]{#4}\else
+        \bibitem[#1(#3)#2]{#4}\fi }
+\newcommand\harvardleft{\NAT@open}
+\newcommand\harvardright{\NAT@close}
+\newcommand\harvardyearleft{\NAT@open}
+\newcommand\harvardyearright{\NAT@close}
+\AtBeginDocument{\providecommand{\harvardand}{and}}
+\newcommand\harvardurl[1]{\textbf{URL:} \textit{#1}}
+\providecommand\bibsection{}
+\@ifundefined{chapter}%
+  {\renewcommand\bibsection{\section*{\refname
+    \@mkboth{\MakeUppercase{\refname}}{\MakeUppercase{\refname}}}}}
+  {\@ifundefined{NAT@sectionbib}%
+    {\renewcommand\bibsection{\chapter*{\bibname
+     \@mkboth{\MakeUppercase{\bibname}}{\MakeUppercase{\bibname}}}}}
+    {\renewcommand\bibsection{\section*{\bibname
+     \ifx\@mkboth\@gobbletwo\else\markright{\MakeUppercase{\bibname}}\fi}}}}
+\@ifclassloaded{amsart}%
+  {\renewcommand\bibsection{\section*{\refname}}}{}
+\@ifclassloaded{amsbook}%
+  {\renewcommand\bibsection{\chapter*{\bibname}}}{}
+\@ifundefined{bib@heading}{}{\let\bibsection\bib@heading}
+\newcounter{NAT@ctr}
+\renewenvironment{thebibliography}[1]{%
+ \bibsection
+ \vspace{1\p@}\parindent \z@\bibpreamble\bibfont\list
+   {\@biblabel{\arabic{NAT@ctr}}}{\@bibsetup{#1}%
+    \setcounter{NAT@ctr}{0}}%
+    \ifNAT@openbib
+      \renewcommand\newblock{\par}
+    \else
+      \renewcommand\newblock{\hskip .11em \@plus.33em \@minus.07em}%
+    \fi
+    \sloppy\clubpenalty4000\widowpenalty4000
+    \sfcode`\.=1000\relax
+    \let\citeN\cite \let\shortcite\cite
+    \let\citeasnoun\cite\fontsize{7}{9}\selectfont
+ }{\def\@noitemerr{%
+  \PackageWarning{natbib}
+     {Empty `thebibliography' environment}}%
+  \endlist\vskip-\lastskip}
+\let\bibfont\relax
+\let\bibpreamble\relax
+\providecommand\reset@font{\relax}
+\providecommand\bibname{Bibliography}
+\providecommand\refname{References}
+\newcommand\NAT@citeundefined{\gdef \NAT@undefined {%
+    \PackageWarningNoLine{natbib}{There were undefined citations}}}
+\let \NAT@undefined \relax
+\newcommand\NAT@citemultiple{\gdef \NAT@multiple {%
+    \PackageWarningNoLine{natbib}{There were multiply defined citations}}}
+\let \NAT@multiple \relax
+\AtEndDocument{\NAT@undefined\NAT@multiple}
+\providecommand\@mkboth[2]{}
+\providecommand\MakeUppercase{\uppercase}
+\providecommand{\@extra@b@citeb}{}
+\gdef\@extra@binfo{}
+\providecommand\hyper@natanchorstart[1]{}
+\providecommand\hyper@natanchorend{}
+\providecommand\hyper@natlinkstart[1]{}
+\providecommand\hyper@natlinkend{}
+\providecommand\hyper@natlinkbreak[2]{#1}
+\@ifundefined{bbl@redefine}{}{%
+ \bbl@redefine\nocite#1{%
+  \@safe@activestrue\org@nocite{#1}\@safe@activesfalse}%
+\bbl@redefine\@lbibitem[#1]#2{%
+  \@safe@activestrue\org@@lbibitem[#1]{#2}\@safe@activesfalse}%
+}
+\AtBeginDocument{\@ifundefined{bbl@redefine}{}{%
+\bbl@redefine\@citex[#1][#2]#3{%
+  \@safe@activestrue\org@@citex[#1][#2]{#3}\@safe@activesfalse}%
+\bbl@redefine\NAT@testdef#1#2{%
+  \@safe@activestrue\org@NAT@testdef{#1}{#2}\@safe@activesfalse}%
+\@ifundefined{org@@lbibitem}{%
+\bbl@redefine\@lbibitem[#1]#2{%
+  \@safe@activestrue\org@@lbibitem[#1]{#2}\@safe@activesfalse}}{}%
+}}
+\ifnum\NAT@sort>0
+\newcommand\NAT@sort@cites[1]{%
+\@tempcntb\m@ne
+\let\@celt\delimiter
+\def\NAT@num@list{}%
+\def\NAT@cite@list{}%
+\def\NAT@nonsort@list{}%
+\@for \@citeb:=#1\do{\NAT@make@cite@list}%
+\edef\NAT@cite@list{\NAT@cite@list\NAT@nonsort@list}%
+\edef\NAT@cite@list{\expandafter\NAT@xcom\NAT@cite@list @@}}
+\begingroup \catcode`\_=8
+\gdef\NAT@make@cite@list{%
+     \edef\@citeb{\expandafter\@firstofone\@citeb}%
+    \@ifundefined{b@\@citeb\@extra@b@citeb}{\def\NAT@num{A}}%
+    {\NAT@parse{\@citeb}}%
+      \ifcat _\ifnum\z@<0\NAT@num _\else A\fi
+       \@tempcnta\NAT@num \relax
+       \ifnum \@tempcnta>\@tempcntb
+          \edef\NAT@num@list{\NAT@num@list \@celt{\NAT@num}}%
+          \edef\NAT@cite@list{\NAT@cite@list\@citeb,}%
+          \@tempcntb\@tempcnta
+       \else
+          \let\NAT@@cite@list=\NAT@cite@list \def\NAT@cite@list{}%
+          \edef\NAT@num@list{\expandafter\NAT@num@celt \NAT@num@list \@gobble @}%
+          {\let\@celt=\NAT@celt\NAT@num@list}%
+       \fi
+    \else
+       \edef\NAT@nonsort@list{\NAT@nonsort@list\@citeb,}%
+ \fi}
+\endgroup
+\def\NAT@celt#1{\ifnum #1<\@tempcnta
+  \xdef\NAT@cite@list{\NAT@cite@list\expandafter\NAT@nextc\NAT@@cite@list @@}%
+  \xdef\NAT@@cite@list{\expandafter\NAT@restc\NAT@@cite@list}%
+ \else
+  \xdef\NAT@cite@list{\NAT@cite@list\@citeb,\NAT@@cite@list}\let\@celt\@gobble%
+ \fi}
+\def\NAT@num@celt#1#2{\ifx \@celt #1%
+     \ifnum #2<\@tempcnta
+        \@celt{#2}%
+        \expandafter\expandafter\expandafter\NAT@num@celt
+     \else
+        \@celt{\number\@tempcnta}\@celt{#2}%
+  \fi\fi}
+\def\NAT@nextc#1,#2@@{#1,}
+\def\NAT@restc#1,#2{#2}
+\def\NAT@xcom#1,@@{#1}
+\else
+ \newcommand\NAT@sort@cites[1]{\edef\NAT@cite@list{#1}}\fi
+\InputIfFileExists{natbib.cfg}
+       {\typeout{Local config file natbib.cfg used}}{}
+%% 
+%% <<<<< End of generated file <<<<<<
+%%
+%% End of file `natbib.sty'.

tex/ngmlr.eval

@@ -0,0 +1,38 @@
+Q	60	23616	0	0.000000000
+Q	45	3520	1	0.000036851
+Q	41	1840	1	0.000069023
+Q	37	328	2	0.000136500
+Q	36	276	1	0.000169033
+Q	35	480	1	0.000199601
+Q	33	375	2	0.000262855
+Q	31	178	2	0.000326659
+Q	30	153	5	0.000487551
+Q	29	200	1	0.000516696
+Q	27	100	3	0.000611601
+Q	26	93	3	0.000706056
+Q	25	75	2	0.000768393
+Q	24	82	1	0.000798314
+Q	23	80	6	0.000987387
+Q	22	71	6	0.001175835
+Q	21	76	7	0.001394921
+Q	20	63	9	0.001676897
+Q	19	55	4	0.001800322
+Q	18	62	8	0.002048987
+Q	17	55	7	0.002265718
+Q	16	60	10	0.002575539
+Q	15	82	9	0.002850877
+Q	14	67	7	0.003063745
+Q	13	62	11	0.003401042
+Q	12	64	13	0.003799084
+Q	11	56	5	0.003947900
+Q	10	58	17	0.004468303
+Q	9	70	22	0.005139796
+Q	8	23	9	0.005414604
+Q	7	41	17	0.005933068
+Q	6	42	18	0.006480881
+Q	5	33	9	0.006751757
+Q	4	29	9	0.007022948
+Q	3	27	15	0.007478764
+Q	2	23	10	0.007781024
+Q	1	9	2	0.007840364
+Q	0	13	8	0.008083105

tex/roc.gp

@@ -0,0 +1,52 @@
+set t po eps enh co so "Helvetica,26"
+
+set style line 1 lt 1 pt 1 lc rgb "#e41a1c" lw 2;
+set style line 2 lt 1 pt 2 lc rgb "#377eb8" lw 2;
+set style line 3 lt 1 pt 3 lc rgb "#4daf4a" lw 2;
+set style line 4 lt 1 pt 4 lc rgb "#984ea3" lw 2;
+set style line 5 lt 1 pt 6 lc rgb "#ff7f00" lw 2;
+set style line 6 lt 1 pt 8 lc rgb "#f781bf" lw 2;
+
+set out "roc-color.eps"
+
+set pointsize 2.0
+set size 1.59,1.04
+set multiplot layout 1,2
+
+set label "(a)" at graph -0.245,1.06 font "Helvetica-bold,40"
+set xlab "Error rate of mapped reads"
+set ylab "Fraction of mapped reads" off +1.8
+set ytics 0.02
+set yran [0.9:1]
+
+set size 0.8,1
+set log x
+set format x "10^{%L}"
+set key bot right
+plot "<./eval2roc.pl blasr-mc.eval" u 2:3 t "blasr-mc" w lp ls 4, \
+     "<./eval2roc.pl bwa.eval" u 2:3 t "bwa-mem" w lp ls 2, \
+     "<./eval2roc.pl graphmap.eval" u 2:3 t "graphmap" w lp ls 3, \
+     "<./eval2roc.pl minialign.eval" u 2:3 t "minialign" w lp ls 1, \
+     "<./eval2roc.pl mm2.eval" u 2:3 t "minimap2" w lp ls 6, \
+     "<./eval2roc.pl ngmlr.eval" u 2:3 t "ngm-lr" w lp ls 5
+unset label
+
+set origin 0.8,0
+set size 0.79,1
+set label "(b)" at graph -0.245,1.06 font "Helvetica-bold,40"
+unset log
+unset format
+unset key
+set log y
+set ylab "Accumulative mapping error rate" off +0
+set xlab "Mapping quality"
+set yran [1e-5:0.1]
+set ytics 1e-5,0.1
+set format y "10^{%L}"
+set xran [60:0] reverse
+plot "<./eval2roc.pl blasr-mc.eval" u 1:2 w lp ls 4, \
+     "<./eval2roc.pl bwa.eval" u 1:2 t "bwa-mem" w lp ls 2, \
+     "<./eval2roc.pl graphmap.eval" u 1:2 t "graphmap" w lp ls 3, \
+     "<./eval2roc.pl minialign.eval" u 1:2 t "minialign" w lp ls 1, \
+     "<./eval2roc.pl mm2.eval" u 1:2 t "minimap2" w lp ls 6, \
+     "<./eval2roc.pl ngmlr.eval" u 1:2 t "ngm-lr" w lp ls 5