Compare commits

...
4 Commits
Author SHA1 Message Date
Heng Li 79c9cc186b Release minimap2-2.30 (r1287) 2025-06-15 17:54:11 -04:00
Heng Li ea4c8935bd added one more example
This shows STAR doesn't try to match the GTR..YAG consensus.
2025-06-03 20:22:14 -04:00
Heng Li 3187782b1a r1285: better --spsc support 2025-05-26 15:47:14 -04:00
Heng Li 005c9a1f6b exoneval may skip terminal exons in aa mode 2025-05-17 23:06:41 -04:00
13 changed files with 80 additions and 16 deletions
+15
View File
@@ -1,3 +1,18 @@
Release 2.30-r1287 (15 June 2025)
---------------------------------
Notable changes:
* Improvement: consolidated `--spsc`.
* Deprecation: subcommands `splice2bed`, `gff2bed`, `gff2junc`, `junceval` and
`exoneval` in `paftools.js` are deprecated by minigff. They will remain
indefinitely for backward compatibility.
(2.30: 15 June 2025, r1287)
Release 2.29-r1283 (18 April 2025) Release 2.29-r1283 (18 April 2025)
---------------------------------- ----------------------------------
+2 -2
View File
@@ -77,8 +77,8 @@ Detailed evaluations are available from the [minimap2 paper][doi] or the
Minimap2 is optimized for x86-64 CPUs. You can acquire precompiled binaries from Minimap2 is optimized for x86-64 CPUs. You can acquire precompiled binaries from
the [release page][release] with: the [release page][release] with:
```sh ```sh
curl -L https://github.com/lh3/minimap2/releases/download/v2.29/minimap2-2.29_x64-linux.tar.bz2 | tar -jxvf - curl -L https://github.com/lh3/minimap2/releases/download/v2.30/minimap2-2.30_x64-linux.tar.bz2 | tar -jxvf -
./minimap2-2.29_x64-linux/minimap2 ./minimap2-2.30_x64-linux/minimap2
``` ```
If you want to compile from the source, you need to have a C compiler, GNU make If you want to compile from the source, you need to have a C compiler, GNU make
and zlib development files installed. Then type `make` in the source code and zlib development files installed. Then type `make` in the source code
+2 -2
View File
@@ -31,8 +31,8 @@ To acquire the data used in this cookbook and to install minimap2 and paftools,
please follow the command lines below: please follow the command lines below:
```sh ```sh
# install minimap2 executables # install minimap2 executables
curl -L https://github.com/lh3/minimap2/releases/download/v2.29/minimap2-2.29_x64-linux.tar.bz2 | tar jxf - curl -L https://github.com/lh3/minimap2/releases/download/v2.30/minimap2-2.30_x64-linux.tar.bz2 | tar jxf -
cp minimap2-2.29_x64-linux/{minimap2,k8,paftools.js} . # copy executables cp minimap2-2.30_x64-linux/{minimap2,k8,paftools.js} . # copy executables
export PATH="$PATH:"`pwd` # put the current directory on PATH export PATH="$PATH:"`pwd` # put the current directory on PATH
# download example datasets # download example datasets
curl -L https://github.com/lh3/minimap2/releases/download/v2.10/cookbook-data.tgz | tar zxf - curl -L https://github.com/lh3/minimap2/releases/download/v2.10/cookbook-data.tgz | tar zxf -
+8 -1
View File
@@ -967,7 +967,7 @@ typedef struct mm_idx_spsc_s {
uint64_t *a; // pos<<56 | score<<1 | acceptor uint64_t *a; // pos<<56 | score<<1 | acceptor
} mm_idx_spsc_t; } mm_idx_spsc_t;
int32_t mm_idx_spsc_read(mm_idx_t *idx, const char *fn, int32_t max_sc) int32_t mm_idx_spsc_read2(mm_idx_t *idx, const char *fn, int32_t max_sc, float scale)
{ {
gzFile fp; gzFile fp;
kstring_t str = {0,0,0}; kstring_t str = {0,0,0};
@@ -1007,6 +1007,8 @@ int32_t mm_idx_spsc_read(mm_idx_t *idx, const char *fn, int32_t max_sc)
} }
} }
if (i < 4) continue; // not enough fields if (i < 4) continue; // not enough fields
if (scale > 0.0f && scale < 1.0f)
score = score > 0.0f? (int)(score * scale + .499) : (int)(score * scale - .499);
if (score > max_sc) score = max_sc; if (score > max_sc) score = max_sc;
if (score < -max_sc) score = -max_sc; if (score < -max_sc) score = -max_sc;
cid = mm_idx_name2id(idx, name); cid = mm_idx_name2id(idx, name);
@@ -1030,6 +1032,11 @@ int32_t mm_idx_spsc_read(mm_idx_t *idx, const char *fn, int32_t max_sc)
return 0; return 0;
} }
int32_t mm_idx_spsc_read(mm_idx_t *idx, const char *fn, int32_t max_sc)
{
return mm_idx_spsc_read2(idx, fn, max_sc, 1.0f);
}
static int32_t mm_idx_find_intv(int32_t n, const uint64_t *a, int64_t x) static int32_t mm_idx_find_intv(int32_t n, const uint64_t *a, int64_t x)
{ {
int32_t s = 0, e = n; int32_t s = 0, e = n;
+6 -2
View File
@@ -85,6 +85,8 @@ static ko_longopt_t long_options[] = {
{ "jump-min-match", ko_required_argument, 360 }, { "jump-min-match", ko_required_argument, 360 },
{ "write-junc", ko_no_argument, 361 }, { "write-junc", ko_no_argument, 361 },
{ "pass1", ko_required_argument, 362 }, { "pass1", ko_required_argument, 362 },
{ "spsc-scale", ko_required_argument, 363 },
{ "spsc0", ko_required_argument, 364 },
{ "dbg-seed-occ", ko_no_argument, 501 }, { "dbg-seed-occ", ko_no_argument, 501 },
{ "help", ko_no_argument, 'h' }, { "help", ko_no_argument, 'h' },
{ "max-intron-len", ko_required_argument, 'G' }, { "max-intron-len", ko_required_argument, 'G' },
@@ -134,6 +136,7 @@ int main(int argc, char *argv[])
mm_mapopt_t opt; mm_mapopt_t opt;
mm_idxopt_t ipt; mm_idxopt_t ipt;
int i, c, n_threads = 3, n_parts, old_best_n = -1; int i, c, n_threads = 3, n_parts, old_best_n = -1;
float spsc_scale = 0.7f;
char *fnw = 0, *rg = 0, *fn_bed_junc = 0, *fn_bed_jump = 0, *fn_bed_pass1 = 0, *fn_spsc = 0, *s, *alt_list = 0; char *fnw = 0, *rg = 0, *fn_bed_junc = 0, *fn_bed_jump = 0, *fn_bed_pass1 = 0, *fn_spsc = 0, *s, *alt_list = 0;
FILE *fp_help = stderr; FILE *fp_help = stderr;
mm_idx_reader_t *idx_rdr; mm_idx_reader_t *idx_rdr;
@@ -240,7 +243,6 @@ int main(int argc, char *argv[])
else if (c == 338) opt.max_qlen = mm_parse_num(o.arg); // --max-qlen else if (c == 338) opt.max_qlen = mm_parse_num(o.arg); // --max-qlen
else if (c == 340) fn_bed_junc = o.arg; // --junc-bed else if (c == 340) fn_bed_junc = o.arg; // --junc-bed
else if (c == 341) opt.junc_bonus = atoi(o.arg); // --junc-bonus else if (c == 341) opt.junc_bonus = atoi(o.arg); // --junc-bonus
else if (c == 358) opt.junc_pen = atoi(o.arg); // --junc-pen
else if (c == 342) opt.flag |= MM_F_SAM_HIT_ONLY; // --sam-hit-only else if (c == 342) opt.flag |= MM_F_SAM_HIT_ONLY; // --sam-hit-only
else if (c == 343) opt.chain_gap_scale = atof(o.arg); // --chain-gap-scale else if (c == 343) opt.chain_gap_scale = atof(o.arg); // --chain-gap-scale
else if (c == 351) opt.chain_skip_scale = atof(o.arg); // --chain-skip-scale else if (c == 351) opt.chain_skip_scale = atof(o.arg); // --chain-skip-scale
@@ -260,6 +262,8 @@ int main(int argc, char *argv[])
else if (c == 361) opt.flag |= MM_F_OUT_JUNC | MM_F_CIGAR; // --write-junc else if (c == 361) opt.flag |= MM_F_OUT_JUNC | MM_F_CIGAR; // --write-junc
else if (c == 362) fn_bed_pass1 = o.arg; // --jump-pass1 else if (c == 362) fn_bed_pass1 = o.arg; // --jump-pass1
else if (c == 501) mm_dbg_flag |= MM_DBG_SEED_FREQ; // --dbg-seed-occ else if (c == 501) mm_dbg_flag |= MM_DBG_SEED_FREQ; // --dbg-seed-occ
else if (c == 363) spsc_scale = atof(o.arg); // --spsc-scale
else if (c == 358 || c == 364) opt.junc_pen = atoi(o.arg); // --junc-pen or --spsc0
else if (c == 330) { else if (c == 330) {
fprintf(stderr, "[WARNING] \033[1;31m --lj-min-ratio has been deprecated.\033[0m\n"); fprintf(stderr, "[WARNING] \033[1;31m --lj-min-ratio has been deprecated.\033[0m\n");
} else if (c == 313) { // --sr } else if (c == 313) { // --sr
@@ -476,7 +480,7 @@ int main(int argc, char *argv[])
fprintf(stderr, "[WARNING] failed to load the pass-1 jump BED file\n"); fprintf(stderr, "[WARNING] failed to load the pass-1 jump BED file\n");
} }
if (fn_spsc) { if (fn_spsc) {
mm_idx_spsc_read(mi, fn_spsc, mm_max_spsc_bonus(&opt)); mm_idx_spsc_read2(mi, fn_spsc, mm_max_spsc_bonus(&opt), spsc_scale);
if (mi->spsc == 0 && mm_verbose >= 2) if (mi->spsc == 0 && mm_verbose >= 2)
fprintf(stderr, "[WARNING] failed to load the splice score file\n"); fprintf(stderr, "[WARNING] failed to load the splice score file\n");
} }
+4 -2
View File
@@ -5,7 +5,7 @@
#include <stdio.h> #include <stdio.h>
#include <sys/types.h> #include <sys/types.h>
#define MM_VERSION "2.29-r1283" #define MM_VERSION "2.30-r1287"
#define MM_F_NO_DIAG (0x001LL) // no exact diagonal hit #define MM_F_NO_DIAG (0x001LL) // no exact diagonal hit
#define MM_F_NO_DUAL (0x002LL) // skip pairs where query name is lexicographically larger than target name #define MM_F_NO_DUAL (0x002LL) // skip pairs where query name is lexicographically larger than target name
@@ -163,7 +163,8 @@ typedef struct {
int transition; // transition mismatch score (A:G, C:T) int transition; // transition mismatch score (A:G, C:T)
int sc_ambi; // score when one or both bases are "N" int sc_ambi; // score when one or both bases are "N"
int noncan; // cost of non-canonical splicing sites int noncan; // cost of non-canonical splicing sites
int junc_bonus, junc_pen; int junc_bonus; // bonus for a splice site in annotation
int junc_pen; // penalty for GT- or -AG not scored in --spsc
int zdrop, zdrop_inv; // break alignment if alignment score drops too fast along the diagonal int zdrop, zdrop_inv; // break alignment if alignment score drops too fast along the diagonal
int end_bonus; int end_bonus;
int min_dp_max; // drop an alignment if the score of the max scoring segment is below this threshold int min_dp_max; // drop an alignment if the score of the max scoring segment is below this threshold
@@ -420,6 +421,7 @@ int mm_idx_bed_junc(const mm_idx_t *mi, int32_t ctg, int32_t st, int32_t en, uin
int mm_max_spsc_bonus(const mm_mapopt_t *mo); int mm_max_spsc_bonus(const mm_mapopt_t *mo);
int32_t mm_idx_spsc_read(mm_idx_t *idx, const char *fn, int32_t max_sc); int32_t mm_idx_spsc_read(mm_idx_t *idx, const char *fn, int32_t max_sc);
int32_t mm_idx_spsc_read2(mm_idx_t *idx, const char *fn, int32_t max_sc, float scale);
int64_t mm_idx_spsc_get(const mm_idx_t *db, int32_t cid, int64_t st0, int64_t en0, int32_t rev, uint8_t *sc); int64_t mm_idx_spsc_get(const mm_idx_t *db, int32_t cid, int64_t st0, int64_t en0, int32_t rev, uint8_t *sc);
// deprecated APIs for backward compatibility // deprecated APIs for backward compatibility
+12 -3
View File
@@ -1,4 +1,4 @@
.TH minimap2 1 "18 April 2025" "minimap2-2.29 (r1283)" "Bioinformatics tools" .TH minimap2 1 "15 June 2025" "minimap2-2.30 (r1287)" "Bioinformatics tools"
.SH NAME .SH NAME
.PP .PP
minimap2 - mapping and alignment between collections of DNA sequences minimap2 - mapping and alignment between collections of DNA sequences
@@ -443,14 +443,23 @@ line corresponds to a donor site and `A' for an acceptor site.
A positive score suggests the junction is preferred and a negative score A positive score suggests the junction is preferred and a negative score
suggests the junction is not preferred. suggests the junction is not preferred.
.TP .TP
.BR --junc-pen \ INT .BR --spsc0 \ INT
Penalty for a position not in FILE specified by Penalty for positions not in
.I FILE
specified by
.B --spsc .B --spsc
[5]. Effective with [5]. Effective with
.B --spsc .B --spsc
but not but not
.BR --junc-bed . .BR --junc-bed .
.TP .TP
.BR --spsc-scale \ FLOAT
Scale splice scores in
.B --spsc
by
.IR FLOAT
rounded to the nearest integer [0.7].
.TP
.BR --junc-bed \ FILE .BR --junc-bed \ FILE
Junctions to prefer during base alignment []. Junctions to prefer during base alignment [].
Same format as Same format as
+9 -2
View File
@@ -1,6 +1,6 @@
#!/usr/bin/env k8 #!/usr/bin/env k8
var paftools_version = '2.29-r1283'; var paftools_version = '2.30-r1287';
/***************************** /*****************************
***** Library functions ***** ***** Library functions *****
@@ -2613,7 +2613,8 @@ function paf_junceval(args)
function paf_exoneval(args) // adapted from paf_junceval() function paf_exoneval(args) // adapted from paf_junceval()
{ {
var c, l_fuzzy = 0, print_ovlp = false, print_err_only = false, first_only = false, chr_only = false, aa = false, is_bed = false, use_cds = false, eval_base = false; var c, l_fuzzy = 0, print_ovlp = false, print_err_only = false, first_only = false, chr_only = false, aa = false, is_bed = false, use_cds = false, eval_base = false;
while ((c = getopt(args, "l:epcab1ds")) != null) { var skip_start = false, skip_last = false;
while ((c = getopt(args, "l:epcab1dsft")) != null) {
if (c == 'l') l_fuzzy = parseInt(getopt.arg); if (c == 'l') l_fuzzy = parseInt(getopt.arg);
else if (c == 'e') print_err_only = print_ovlp = true; else if (c == 'e') print_err_only = print_ovlp = true;
else if (c == 'p') print_ovlp = true; else if (c == 'p') print_ovlp = true;
@@ -2623,6 +2624,8 @@ function paf_exoneval(args) // adapted from paf_junceval()
else if (c == '1') first_only = true; else if (c == '1') first_only = true;
else if (c == 'd') use_cds = true; else if (c == 'd') use_cds = true;
else if (c == 's') eval_base = true; else if (c == 's') eval_base = true;
else if (c == 'f') skip_start = true;
else if (c == 't') skip_last = skip_start = true;
} }
if (args.length - getopt.ind < 1) { if (args.length - getopt.ind < 1) {
@@ -2635,6 +2638,8 @@ function paf_exoneval(args) // adapted from paf_junceval()
print(" -e print erroreous overlapping exons"); print(" -e print erroreous overlapping exons");
print(" -c only consider alignments to /^(chr)?([0-9]+|X|Y)$/"); print(" -c only consider alignments to /^(chr)?([0-9]+|X|Y)$/");
print(" -1 only process the first alignment of each query"); print(" -1 only process the first alignment of each query");
print(" -f skip the first exon in the miniprot mode");
print(" -t skip the first and the last exons");
print(" -b BED as input"); print(" -b BED as input");
print(" -s compute base Sn and Sp (more memory)"); print(" -s compute base Sn and Sp (more memory)");
exit(1); exit(1);
@@ -2764,6 +2769,8 @@ function paf_exoneval(args) // adapted from paf_junceval()
for (var i = tmp_exon.length - 1; i >= 0; --i) for (var i = tmp_exon.length - 1; i >= 0; --i)
exon.push([pos + (glen - tmp_exon[i][1]), pos + (glen - tmp_exon[i][0])]); exon.push([pos + (glen - tmp_exon[i][1]), pos + (glen - tmp_exon[i][0])]);
} }
if (skip_start) exon.shift();
if (skip_last) exon.pop();
} else { } else {
var tmp_st = pos; var tmp_st = pos;
while ((m = re_cigar.exec(cigar)) != null) { while ((m = re_cigar.exec(cigar)) != null) {
+1 -1
View File
@@ -3,7 +3,7 @@ from libc.stdlib cimport free
cimport cmappy cimport cmappy
import sys import sys
__version__ = '2.29' __version__ = '2.30'
cmappy.mm_reset_timer() cmappy.mm_reset_timer()
+1 -1
View File
@@ -23,7 +23,7 @@ def readme():
setup( setup(
name = 'mappy', name = 'mappy',
version = '2.29', version = '2.30',
url = 'https://github.com/lh3/minimap2', url = 'https://github.com/lh3/minimap2',
description = 'Minimap2 python binding', description = 'Minimap2 python binding',
long_description = readme(), long_description = readme(),
+5
View File
@@ -0,0 +1,5 @@
mm2: TGTTATCCCTAGGGTAACTTGTTCCGTTGGTCAAGTTATTGGATCAATTGAGTATAGTAGTGCACTCAC......................................................................................................................................CACTTGGAGCCATTCATACAGGTCCCTATTTAAGGAACAAGTGATTATGCTACCTTTGCACGGTT
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
ref: TGTTATCCCTAGGGTAACTTGTTCCGTTGGTCAAGTTATTGGATCAATTGAGTATAGTAGTGCACTCACctGCTTCGCTTTGACTGGTGAAGTCTTAGCATGTACTGCTCGGAGGTTGGGTTCTGCTCCGAGGTCGCCCCAACCGAAATTTTTAATGCAGGTTTGGTAGTTTAGGACCTGTGGGTTTGTTAGGCTAACCTCacCACTTGGAGCCATTCATACAGGTCCCTATTTAAGGAACAAGTGATTATGCTACCTTTGCACGGTT
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
sta: TGTTATCCCTAGGGTAACTTGTTCCGTTGGTCAAGTTATTGGATCAATTGAGTATAGTAGTGCA......................................................................................................................................CTCACCACTTGGAGCCATTCATACAGGTCCCTATTTAAGGAACAAGTGATTATGCTACCTTTGCACGGTT
+5
View File
@@ -0,0 +1,5 @@
>query
AACCGTGCAAAGGTAGCATAATCACTTGTTCCTTAAATAGGGACCTGTATGAATGGCTCC
AAGTG
GTGAGTGCA
CTACTATACTCAATTGATCCAATAACTTGACCAACGGAACAAGTTACCCTAGGGATAACA
+10
View File
@@ -0,0 +1,10 @@
>ref
TGATCCAACATCGAGGTCGTAAACCCTATTGTTGATATGGACTCTAGAATAGGATTGCGC
TGTTATCCCTAGGGTAACTTGTTCCGTTGGTCAAGTTATTGGATCAATTGAGTATAGTAG
TGCACTCAC
ctGCTTCGCTTTGACTGGTGAAGTCTTAGCATGTACTGCTCGGAGGTTGGGTTCTGCTCC
GAGGTCGCCCCAACCGAAATTTTTAATGCAGGTTTGGTAGTTTAGGACCTGTGGGTTTGT
TAGGCTAACCTCac
CACTTGGAGCCATTCATACAGGTCCCTATTTAAGGAACAAGTGATTATGCTACCTTTGCA
CGGTTAGGGTACCGCGGCCGTTAAACATGTGTCACTGGGCAGGCGGTGCCTCTAATACTG
GTGAT