Files
minimap2/python
2017-09-16 22:52:52 -04:00
..
2017-09-16 11:14:01 -04:00
2017-09-16 20:09:17 -04:00
2017-09-16 22:52:52 -04:00

=======================
Minimap2 Python Binding
=======================

`Minimap2 <https://github.com/lh3/minimap2>`_ is a fast and accurate pairwise
aligner for genomic and transcribed nucleotide sequences. This module wraps
minimap2 and provides a convenient interface to calling minimap2 in Python.

Installation
------------

The minimap2 module can be installed directly with:

.. code:: shell

	git clone https://github.com/lh3/minimap2
	cd minimap2
	python setup.py install

or with `pip <https://en.wikipedia.org/wiki/Pip_(package_manager)>`_:

.. code:: shell

	pip install --user minimap2

Usage
-----

The following Python program shows the key functionality of this module:

.. code:: python

	import minimap2 as mm
	a = mm.Aligner("test/MT-human.fa")  # load or build index
	if not a: raise Exception("ERROR: failed to load/build index")
	for hit in a.map("GGTTAAATACAGACCAAGAGCCTTCAAAGCCCTCAGTAAGTTGCAATACTTAATTTCTGT"):
		print("{}\t{}\t{}\t{}".format(hit.ctg, hit.r_st, hit.r_en, hit.cigar_str))

It builds an index from the specified sequence file (or loads an index if a
pre-built index is specified), aligns a sequence against it, traverses each hit
and prints them out.

APIs
----

Class minimap2.Aligner
~~~~~~~~~~~~~~~~~~~~~~

.. code:: python

	Aligner(fn_idx_in, preset=None, ...)

Arguments:

* **fn_idx_in**: index or sequence file name. Minimap2 automatically tests the
  file type. If a sequence file is provided, minimap2 builds an index. The
  sequence file can be optionally gzip'd.

* **preset**: minimap2 preset. Currently, minimap2 supports the following
  presets: **sr** for single-end short reads; **map-pb** for PacBio
  read-to-reference mapping; **map-ont** for Oxford Nanopore read mapping;
  **splice** for long-read spliced alignment; **asm5** for assembly-to-assembly
  alignment; **asm10** for full genome alignment of closely related species. Note
  that the Python module does not support all-vs-all read overlapping.

* **k**: k-mer length, no larger than 28

* **w**: minimizer window size, no larger than 255

* **min_cnt**: mininum number of minimizers on a chain

* **min_chain_score**: minimum chaing score

* **bw**: chaining and alignment band width

* **best_n**: max number of alignments to return

* **n_threads**: number of indexing threads; 3 by default

* **fn_idx_out**: name of file to which the index is written

.. code:: python

	map(seq)

This method maps :code:`seq` against the index. It *yields* a generator,
generating a series of :code:`Alignment` objects.

Class minimap2.Alignment
~~~~~~~~~~~~~~~~~~~~~~~~

This class has the following properties:

* **ctg**: name of the reference sequence the query is mapped to

* **ctg_len**: total length of the reference sequence

* **r_st** and **r_en**: start and end positions on the reference

* **q_st** and **q_en**: start and end positions on the query

* **strand**: +1 if on the forward strand; -1 if on the reverse strand

* **mapq**: mapping quality

* **NM**: number of mismatches and gaps in the alignment

* **blen**: length of the alignment, including both alignment matches and gaps

* **trans_strand**: transcript strand. +1 if on the forward strand; -1 if on the
  reverse strand; 0 if unknown

* **is_primary**: if the alignment is primary (typically the best and the first
  to generate)

* **cigar_str**: CIGAR string

* **cigar**: CIGAR returned as an array of shape :code:`(n_cigar,2)`. The two
  numbers give the length and the operator of each CIGAR operation.

An :code:`Alignment` object can be converted to a string in the following format:

::

	q_st  q_en  strand  ctg  ctg_len  r_st  r_en  blen-NM  blen  mapq  cg:Z:cigar_str