r815: fixed a memory leak

Not sure if this is the right way. Apparently working.

.gitignore

@@ -1,4 +1,8 @@
+.cproject
+.project
 .*.swp
 *.a
 *.o
 *.dSYM
+minimap2
+mappy.c

.travis.yml

@@ -0,0 +1,20 @@
+matrix:
+  include:
+    - language: c
+      compiler: gcc
+      script: make
+    - language: c
+      compiler: clang
+      script: make
+    - language: python
+      python: "2.7"
+      before_install: pip install cython
+      script: python setup.py build_ext
+    - language: python
+      python: "3.5"
+      before_install: pip install cython
+      script: python setup.py build_ext
+    - language: python
+      python: "3.6"
+      before_install: pip install cython
+      script: python setup.py build_ext

MANIFEST.in

@@ -0,0 +1,11 @@
+include *.h
+include Makefile
+include ksw2_dispatch.c
+include getopt.c
+include main.c
+include README.md
+include python/mappy.c
+include python/cmappy.h
+include python/cmappy.pxd
+include python/mappy.pyx
+include python/README.rst

Makefile

@@ -1,17 +1,28 @@
-CC=			gcc
+CFLAGS=		-g -Wall -O2 -Wc++-compat #-Wextra
-CFLAGS=		-g -Wall -O2 -Wc++-compat
 CPPFLAGS=	-DHAVE_KALLOC
-INCLUDES=	-I.
+INCLUDES=
-OBJS=		kthread.o kalloc.o ksw2_extz2_sse.o ksw2_extd2_sse.o misc.o bseq.o \
+OBJS=		kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o options.o index.o chain.o align.o hit.o map.o format.o pe.o esterr.o splitidx.o ksw2_ll_sse.o
-			sketch.o sdust.o index.o chain.o align.o hit.o map.o format.o
 PROG=		minimap2
 PROG_EXTRA=	sdust minimap2-lite
 LIBS=		-lm -lz -lpthread
 
-ifeq ($(sse2only),)
+ifeq ($(arm_neon),) # if arm_neon is not defined
-	CFLAGS+=-msse4
+ifeq ($(sse2only),) # if sse2only is not defined
+	OBJS+=ksw2_extz2_sse41.o ksw2_extd2_sse41.o ksw2_exts2_sse41.o ksw2_extz2_sse2.o ksw2_extd2_sse2.o ksw2_exts2_sse2.o ksw2_dispatch.o
+else                # if sse2only is defined
+	OBJS+=ksw2_extz2_sse.o ksw2_extd2_sse.o ksw2_exts2_sse.o
+endif
+else				# if arm_neon is defined
+	OBJS+=ksw2_extz2_neon.o ksw2_extd2_neon.o ksw2_exts2_neon.o
+    INCLUDES+=-Isse2neon
+ifeq ($(aarch64),)	#if aarch64 is not defined
+	CFLAGS+=-D_FILE_OFFSET_BITS=64 -mfpu=neon -fsigned-char
+else				#if aarch64 is defined
+	CFLAGS+=-D_FILE_OFFSET_BITS=64 -fsigned-char
+endif
 endif
 
+.PHONY:all extra clean depend
 .SUFFIXES:.c .o
 
 .c.o:
@@ -21,8 +32,8 @@ all:$(PROG)
 
 extra:all $(PROG_EXTRA)
 
-minimap2:main.o libminimap2.a
+minimap2:main.o getopt.o libminimap2.a
-		$(CC) $(CFLAGS) $< -o $@ -L. -lminimap2 $(LIBS)
+		$(CC) $(CFLAGS) main.o getopt.o -o $@ -L. -lminimap2 $(LIBS)
 
 minimap2-lite:example.o libminimap2.a
 		$(CC) $(CFLAGS) $< -o $@ -L. -lminimap2 $(LIBS)
@@ -30,11 +41,52 @@ minimap2-lite:example.o libminimap2.a
 libminimap2.a:$(OBJS)
 		$(AR) -csru $@ $(OBJS)
 
-sdust:sdust.c kalloc.o kalloc.h kdq.h kvec.h kseq.h sdust.h
+sdust:sdust.c getopt.o kalloc.o kalloc.h kdq.h kvec.h kseq.h sdust.h
-		$(CC) -D_SDUST_MAIN $(CFLAGS) $< kalloc.o -o $@ -lz
+		$(CC) -D_SDUST_MAIN $(CFLAGS) $< getopt.o kalloc.o -o $@ -lz
+
+# SSE-specific targets on x86/x86_64
+
+ifeq ($(arm_neon),)   # if arm_neon is defined, compile this target with the default setting (i.e. no -msse2)
+ksw2_ll_sse.o:ksw2_ll_sse.c ksw2.h kalloc.h
+		$(CC) -c $(CFLAGS) -msse2 $(CPPFLAGS) $(INCLUDES) $< -o $@
+endif
+
+ksw2_extz2_sse41.o:ksw2_extz2_sse.c ksw2.h kalloc.h
+		$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
+
+ksw2_extz2_sse2.o:ksw2_extz2_sse.c ksw2.h kalloc.h
+		$(CC) -c $(CFLAGS) -msse2 -mno-sse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
+
+ksw2_extd2_sse41.o:ksw2_extd2_sse.c ksw2.h kalloc.h
+		$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
+
+ksw2_extd2_sse2.o:ksw2_extd2_sse.c ksw2.h kalloc.h
+		$(CC) -c $(CFLAGS) -msse2 -mno-sse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
+
+ksw2_exts2_sse41.o:ksw2_exts2_sse.c ksw2.h kalloc.h
+		$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
+
+ksw2_exts2_sse2.o:ksw2_exts2_sse.c ksw2.h kalloc.h
+		$(CC) -c $(CFLAGS) -msse2 -mno-sse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
+
+ksw2_dispatch.o:ksw2_dispatch.c ksw2.h
+		$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
+
+# NEON-specific targets on ARM
+
+ksw2_extz2_neon.o:ksw2_extz2_sse.c ksw2.h kalloc.h
+		$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_SSE2_ONLY -D__SSE2__ $(INCLUDES) $< -o $@
+
+ksw2_extd2_neon.o:ksw2_extd2_sse.c ksw2.h kalloc.h
+		$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_SSE2_ONLY -D__SSE2__ $(INCLUDES) $< -o $@
+
+ksw2_exts2_neon.o:ksw2_exts2_sse.c ksw2.h kalloc.h
+		$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_SSE2_ONLY -D__SSE2__ $(INCLUDES) $< -o $@
+
+# other non-file targets
 
 clean:
-		rm -fr gmon.out *.o a.out $(PROG) $(PROG_EXTRA) *~ *.a *.dSYM session*
+		rm -fr gmon.out *.o a.out $(PROG) $(PROG_EXTRA) *~ *.a *.dSYM build dist mappy*.so mappy.c python/mappy.c mappy.egg*
 
 depend:
 		(LC_ALL=C; export LC_ALL; makedepend -Y -- $(CFLAGS) $(CPPFLAGS) -- *.c)
@@ -42,17 +94,25 @@ depend:
 # DO NOT DELETE
 
 align.o: minimap.h mmpriv.h bseq.h ksw2.h kalloc.h
-bseq.o: bseq.h kseq.h
+bseq.o: bseq.h kvec.h kalloc.h kseq.h
 chain.o: minimap.h mmpriv.h bseq.h kalloc.h
+esterr.o: mmpriv.h minimap.h bseq.h
 example.o: minimap.h kseq.h
-format.o: mmpriv.h minimap.h bseq.h
+format.o: kalloc.h mmpriv.h minimap.h bseq.h
-hit.o: mmpriv.h minimap.h bseq.h kalloc.h
+getopt.o: getopt.h
+hit.o: mmpriv.h minimap.h bseq.h kalloc.h khash.h
 index.o: kthread.h bseq.h minimap.h mmpriv.h kvec.h kalloc.h khash.h
 kalloc.o: kalloc.h
 ksw2_extd2_sse.o: ksw2.h kalloc.h
+ksw2_exts2_sse.o: ksw2.h kalloc.h
 ksw2_extz2_sse.o: ksw2.h kalloc.h
-main.o: bseq.h minimap.h mmpriv.h
+ksw2_ll_sse.o: ksw2.h kalloc.h
-map.o: kthread.h kvec.h kalloc.h sdust.h mmpriv.h minimap.h bseq.h
+kthread.o: kthread.h
-misc.o: minimap.h ksort.h
+main.o: bseq.h minimap.h mmpriv.h getopt.h
+map.o: kthread.h kvec.h kalloc.h sdust.h mmpriv.h minimap.h bseq.h khash.h
+map.o: ksort.h
+misc.o: mmpriv.h minimap.h bseq.h ksort.h
+options.o: mmpriv.h minimap.h bseq.h
+pe.o: mmpriv.h minimap.h bseq.h kvec.h kalloc.h ksort.h
 sdust.o: kalloc.h kdq.h kvec.h sdust.h
-sketch.o: kvec.h kalloc.h minimap.h
+sketch.o: kvec.h kalloc.h mmpriv.h minimap.h bseq.h

NEWS.md

@@ -0,0 +1,430 @@
+Release 2.11-r797 (20 June 2018)
+--------------------------------
+
+Changes to minimap2:
+
+ * Improved alignment accuracy in low-complexity regions for SV calling. Thank
+   @armintoepfer for multiple offline examples.
+
+ * Added option --eqx to encode sequence match/mismatch with the =/X CIGAR
+   operators (#156, #157 and #175).
+
+ * When compiled with VC++, minimap2 generated wrong alignments due to a
+   comparison between a signed integer and an unsigned integer (#184). Also
+   fixed warnings reported by "clang -Wextra".
+
+ * Fixed incorrect anchor filtering due to a missing 64- to 32-bit cast.
+
+ * Fixed incorrect mapping quality for inversions (#148).
+
+ * Fixed incorrect alignment involving ambiguous bases (#155).
+
+ * Fixed incorrect presets: option `-r 2000` is intended to be used with
+   ava-ont, not ava-pb. The bug was introduced in 2.10.
+
+ * Fixed a bug when --for-only/--rev-only is used together with --sr or
+   --heap-sort=yes (#166).
+
+ * Fixed option -Y that was not working in the previous releases.
+
+ * Added option --lj-min-ratio to fine control the alignment of long gaps
+   found by the "long-join" heuristic (#128).
+
+ * Exposed `mm_idx_is_idx`, `mm_idx_load` and `mm_idx_dump` C APIs (#177).
+   Also fixed a bug when indexing without reference names (this feature is not
+   exposed to the command line).
+
+Changes to mappy:
+
+ * Added `__version__` (#165).
+
+ * Exposed the maximum fragment length parameter to mappy (#174).
+
+Changes to paftools:
+
+ * Don't crash when there is no "cg" tag (#153).
+
+ * Fixed wrong coverage report by "paftools.js call" (#145).
+
+This version may produce slightly different base-level alignment. The overall
+alignment statistics should remain similar.
+
+(2.11: 20 June 2018, r797)
+
+
+
+Release 2.10-r761 (27 March 2018)
+---------------------------------
+
+Changes to minimap2:
+
+ * Optionally output the MD tag for compatibility with existing tools (#63,
+   #118 and #137).
+
+ * Use SSE compiler flags more precisely to prevent compiling errors on certain
+   machines (#127).
+
+ * Added option --min-occ-floor to set a minimum occurrence threshold. Presets
+   intended for assembly-to-reference alignment set this option to 100. This
+   option alleviates issues with regions having high copy numbers (#107).
+
+ * Exit with non-zero code on file writing errors (e.g. disk full; #103 and
+   #132).
+
+ * Added option -y to copy FASTA/FASTQ comments in query sequences to the
+   output (#136).
+
+ * Added the asm20 preset for alignments between genomes at 5-10% sequence
+   divergence.
+
+ * Changed the band-width in the ava-ont preset from 500 to 2000. Oxford
+   Nanopore reads may contain long deletion sequencing errors that break
+   chaining.
+
+Changes to mappy, the Python binding:
+
+ * Fixed a typo in Align.seq() (#126).
+
+Changes to paftools.js, the companion script:
+
+ * Command sam2paf now converts the MD tag to cs.
+
+ * Support VCF output for assembly-to-reference variant calling (#109).
+
+This version should produce identical alignment for read overlapping, RNA-seq
+read mapping, and genomic read mapping. We have also added a cook book to show
+the variety uses of minimap2 on real datasets. Please see cookbook.md in the
+minimap2 source code directory.
+
+(2.10: 27 March 2017, r761)
+
+
+
+Release 2.9-r720 (23 February 2018)
+-----------------------------------
+
+This release fixed multiple minor bugs.
+
+* Fixed two bugs that lead to incorrect inversion alignment. Also improved the
+  sensitivity to small inversions by using double Z-drop cutoff (#112).
+
+* Fixed an issue that may cause the end of a query sequence unmapped (#104).
+
+* Added a mappy API to retrieve sequences from the index (#126) and to reverse
+  complement DNA sequences. Fixed a bug where the `best_n` parameter did not
+  work (#117).
+
+* Avoided segmentation fault given incorrect FASTQ input (#111).
+
+* Combined all auxiliary javascripts to paftools.js. Fixed several bugs in
+  these scripts at the same time.
+
+(2.9: 24 February 2018, r720)
+
+
+
+Release 2.8-r672 (1 February 2018)
+----------------------------------
+
+Notable changes in this release include:
+
+ * Speed up short-read alignment by ~10%. The overall mapping accuracy stays
+   the same, but the output alignments are not always identical to v2.7 due to
+   unstable sorting employed during chaining. Long-read alignment is not
+   affected by this change as the speedup is short-read specific.
+
+ * Mappy now supports paired-end short-read alignment (#87). Please see
+   python/README.rst for details.
+
+ * Added option --for-only and --rev-only to perform alignment against the
+   forward or the reverse strand of the reference genome only (#91).
+
+ * Alleviated the issue with undesired diagonal alignment in the self mapping
+   mode (#10). Even if the output is not ideal, it should not interfere with
+   other alignments. Fully resolving the issue is intricate and may require
+   additional heuristic thresholds.
+
+ * Enhanced error checking against incorrect input (#92 and #96).
+
+For long query sequences, minimap2 should output identical alignments to v2.7.
+
+(2.8: 1 February 2018, r672)
+
+
+
+Release 2.7-r654 (9 January 2018)
+---------------------------------
+
+This release fixed a bug in the splice mode and added a few minor features:
+
+ * Fixed a bug that occasionally takes an intron as a long deletion in the
+   splice mode. This was caused by wrong backtracking at the last CIGAR
+   operator. The current fix eliminates the error, but it is not optimal in
+   that it often produces a wrong junction when the last operator is an intron.
+   A future version of minimap2 may improve upon this.
+
+ * Support high-end ARM CPUs that implement the NEON instruction set (#81).
+   This enables minimap2 to work on Raspberry Pi 3 and Odroid XU4.
+
+ * Added a C API to construct a minimizer index from a set of C strings (#80).
+
+ * Check scoring specified on the command line (#79). Due to the 8-bit limit,
+   excessively large score penalties fail minimap2.
+
+For genomic sequences, minimap2 should give identical alignments to v2.6.
+
+(2.7: 9 January 2018, r654)
+
+
+
+Release 2.6-r623 (12 December 2017)
+-----------------------------------
+
+This release adds several features and fixes two minor bugs:
+
+ * Optionally build an index without sequences. This helps to reduce the
+   peak memory for read overlapping and is automatically applied when
+   base-level alignment is not requested.
+
+ * Approximately estimate per-base sequence divergence (i.e. 1-identity)
+   without performing base-level alignment, using a MashMap-like method. The
+   estimate is written to a new dv:f tag.
+
+ * Reduced the number of tiny terminal exons in RNA-seq alignment. The current
+   setting is conservative. Increase --end-seed-pen to drop more such exons.
+
+ * Reduced the peak memory when aligning long query sequences.
+
+ * Fixed a bug that is caused by HPC minimizers longer than 256bp. This should
+   have no effect in practice, but it is recommended to rebuild HPC indices if
+   possible.
+
+ * Fixed a bug when identifying identical hits (#71). This should only affect
+   artifactual reference consisting of near identical sequences.
+
+For genomic sequences, minimap2 should give nearly identical alignments to
+v2.5, except the new dv:f tag.
+
+(2.6: 12 December 2017, r623)
+
+
+
+Release 2.5-r572 (11 November 2017)
+-----------------------------------
+
+This release fixes several bugs and brings a couple of minor improvements:
+
+ * Fixed a severe bug that leads to incorrect mapping coordinates in rare
+   corner cases.
+
+ * Fixed underestimated mapping quality for chimeric alignments when the whole
+   query sequence contain many repetitive minimizers, and for chimeric
+   alignments caused by Z-drop.
+
+ * Fixed two bugs in Python binding: incorrect strand field (#57) and incorrect
+   sequence names for Python3 (#55).
+
+ * Improved mapping accuracy for highly overlapping paired ends.
+
+ * Added option -Y to use soft clipping for supplementary alignments (#56).
+
+(2.5: 11 November 2017, r572)
+
+
+
+Release 2.4-r555 (6 November 2017)
+----------------------------------
+
+As is planned, this release focuses on fine tuning the base algorithm. Notable
+changes include
+
+ * Changed the mapping quality scale to match the scale of BWA-MEM. This makes
+   minimap2 and BWA-MEM achieve similar sensitivity-specificity balance on real
+   short-read data.
+
+ * Improved the accuracy of splice alignment by modeling one additional base
+   close to the GT-AG signal. This model is used by default with `-x splice`.
+   For SIRV control data, however, it is recommended to add `--splice-flank=no`
+   to disable this feature as the SIRV splice signals are slightly different.
+
+ * Tuned the parameters for Nanopore Direct RNA reads. The recommended command
+   line is `-axsplice -k14 -uf` (#46).
+
+ * Fixed a segmentation fault when aligning PacBio reads (#47 and #48). This
+   bug is very rare but it affects all versions of minimap2. It is also
+   recommended to re-index reference genomes created with `map-pb`. For human,
+   two minimizers in an old index are wrong.
+
+ * Changed option `-L` in sync with the final decision of hts-specs: a fake
+   CIGAR takes the form of `<readLen>S<refLen>N`. Note that `-L` only enables
+   future tools to recognize long CIGARs. It is not possible for older tools to
+   work with such alignments in BAM (#43 and #51).
+
+ * Fixed a tiny issue whereby minimap2 may waste 8 bytes per candidate
+   alignment.
+
+The minimap2 technical note hosted at arXiv has also been updated to reflect
+recent changes.
+
+(2.4: 6 November 2017, r555)
+
+
+
+Release 2.3-r531 (22 October 2017)
+----------------------------------
+
+This release come with many improvements and bug fixes:
+
+ * The **sr** preset now supports paired-end short-read alignment. Minimap2 is
+   3-4 times as fast as BWA-MEM, but is slightly less accurate on simulated
+   reads.
+
+ * Meticulous improvements to assembly-to-assembly alignment (special thanks to
+   Alexey Gurevich from the QUAST team): a) apply a small penalty to matches
+   between ambiguous bases; b) reduce missing alignments due to spurious
+   overlaps; c) introduce the short form of the `cs` tag, an improvement to the
+   SAM MD tag.
+
+ * Make sure gaps are always left-aligned.
+
+ * Recognize `U` bases from Oxford Nanopore Direct RNA-seq (#33).
+
+ * Fixed slightly wrong chaining score. Fixed slightly inaccurate coordinates
+   for split alignment.
+
+ * Fixed multiple reported bugs: 1) wrong reference name for inversion
+   alignment (#30); 2) redundant SQ lines when multiple query files are
+   specified (#39); 3) non-functioning option `-K` (#36).
+
+This release has implemented all the major features I planned five months ago,
+with the addition of spliced long-read alignment. The next couple of releases
+will focus on fine tuning of the base algorithms.
+
+(2.3: 22 October 2017, r531)
+
+
+
+Release 2.2-r409 (17 September 2017)
+------------------------------------
+
+This is a feature release. It improves single-end short-read alignment and
+comes with Python bindings. Detailed changes include:
+
+ * Added the **sr** preset for single-end short-read alignment. In this mode,
+   minimap2 runs faster than BWA-MEM, but is slightly less accurate on
+   simulated data sets. Paired-end alignment is not supported as of now.
+
+ * Improved mapping quality estimate with more accurate identification of
+   repetitive hits. This mainly helps short-read alignment.
+
+ * Implemented **mappy**, a Python binding for minimap2, which is available
+   from PyPI and can be installed with `pip install --user mappy`. Python users
+   can perform read alignment without the minimap2 executable.
+
+ * Restructured the indexing APIs and documented key minimap2 APIs in the
+   header file minimap.h. Updated example.c with the new APIs. Old APIs still
+   work but may become deprecated in future.
+
+This release may output alignments different from the previous version, though
+the overall alignment statistics, such as the number of aligned bases and long
+gaps, remain close.
+
+(2.2: 17 September 2017, r409)
+
+
+
+Release 2.1.1-r341 (6 September 2017)
+-------------------------------------
+
+This is a maintenance release that is expected to output identical alignment to
+v2.1. Detailed changes include:
+
+ * Support CPU dispatch. By default, minimap2 is compiled with both SSE2 and
+   SSE4 based implementation of alignment and automatically chooses the right
+   one at runtime. This avoids unexpected errors on older CPUs (#21).
+
+ * Improved Windows support as is requested by Oxford Nanopore (#19). Minimap2
+   now avoids variable-length stacked arrays, eliminates alloca(), ships with
+   getopt_long() and provides timing functions implemented with Windows APIs.
+
+ * Fixed a potential segmentation fault when specifying -k/-w/-H with
+   multi-part index (#23).
+
+ * Fixed two memory leaks in example.c
+
+(2.1.1: 6 September 2017, r341)
+
+
+
+Release 2.1-r311 (25 August 2017)
+---------------------------------
+
+This release adds spliced alignment for long noisy RNA-seq reads. On a SMRT
+Iso-Seq and a Oxford Nanopore data sets, minimap2 appears to outperform
+traditional mRNA aligners. For DNA alignment, this release gives almost
+identical output to v2.0. Other changes include:
+
+ * Added option `-R` to set the read group header line in SAM.
+
+ * Optionally output the `cs:Z` tag in PAF to encode both the query and the
+   reference sequences in the alignment.
+
+ * Fixed an issue where DP alignment uses excessive memory.
+
+The minimap2 technical report has been updated with more details and the
+evaluation of spliced alignment:
+
+ * Li, H. (2017). Minimap2: fast pairwise alignment for long nucleotide
+   sequences. [arXiv:1708.01492v2](https://arxiv.org/abs/1708.01492v2).
+
+(2.1: 25 August 2017, r311)
+
+
+
+Release 2.0-r275 (8 August 2017)
+--------------------------------
+
+This release is identical to version 2.0rc1, except the version number. It is
+described and evaluated in the following technical report:
+
+ * Li, H. (2017). Minimap2: fast pairwise alignment for long DNA sequences.
+   [arXiv:1708.01492v1](https://arxiv.org/abs/1708.01492v1).
+
+(2.0: 8 August 2017, r275)
+
+
+
+Release 2.0rc1-r232 (30 July 2017)
+----------------------------------
+
+This release improves the accuracy of long-read alignment and added several
+minor features.
+
+ * Improved mapping quality estimate for short alignments containing few seed
+   hits.
+
+ * Fixed a minor bug that affects the chaining accuracy towards the ends of a
+   chain. Changed the gap cost for chaining to reduce false seeding.
+
+ * Skip potentially wrong seeding and apply dynamic programming more frequently.
+   This slightly increases run time, but greatly reduces false long gaps.
+
+ * Perform local alignment at Z-drop break point to recover potential inversion
+   alignment. Output the SA tag in the SAM format. Added scripts to evaluate
+   mapping accuracy for reads simulated with pbsim.
+
+This release completes features intended for v2.0. No major features will be
+added to the master branch before the final v2.0.
+
+(2.0rc1: 30 July 2017, r232)
+
+
+
+Release r191 (19 July 2017)
+---------------------------
+
+This is the first public release of minimap2, an aligner for long reads and
+assemblies. This release has a few issues and is generally not recommended for
+production uses.
+
+(19 July 2017, r191)

README.md

@@ -1,62 +1,357 @@
-## Getting Started
+[![GitHub Downloads](https://img.shields.io/github/downloads/lh3/minimap2/total.svg?style=social&logo=github&label=Download)](https://github.com/lh3/minimap2/releases)
+[![BioConda Install](https://img.shields.io/conda/dn/bioconda/minimap2.svg?style=flag&label=BioConda%20install)](https://anaconda.org/bioconda/minimap2)
+[![PyPI](https://img.shields.io/pypi/v/mappy.svg?style=flat)](https://pypi.python.org/pypi/mappy)
+[![Build Status](https://travis-ci.org/lh3/minimap2.svg?branch=master)](https://travis-ci.org/lh3/minimap2)
+## <a name="started"></a>Getting Started
 ```sh
 git clone https://github.com/lh3/minimap2
 cd minimap2 && make
-# long reads against a reference genome
+# long sequences against a reference genome
-./minimap2 -ax map10k test/MT-human.fa test/MT-orang.fa > test.sam
+./minimap2 -a test/MT-human.fa test/MT-orang.fa > test.sam
 # create an index first and then map
-./minimap2 -x map10k -d MT-human.mmi test/MT-human.fa
+./minimap2 -d MT-human.mmi test/MT-human.fa
-./minimap2 -ax map10k MT-human.mmi test/MT-orang.fa > test.sam
+./minimap2 -a MT-human.mmi test/MT-orang.fa > test.sam
-# long-read overlap (no test data)
+# use presets (no test data)
-./minimap2 -x ava-pb your-reads.fa your-reads.fa > overlaps.paf
+./minimap2 -ax map-pb ref.fa pacbio.fq.gz > aln.sam       # PacBio genomic reads
-# man page
+./minimap2 -ax map-ont ref.fa ont.fq.gz > aln.sam         # Oxford Nanopore genomic reads
+./minimap2 -ax sr ref.fa read1.fa read2.fa > aln.sam      # short genomic paired-end reads
+./minimap2 -ax splice ref.fa rna-reads.fa > aln.sam       # spliced long reads
+./minimap2 -ax splice -k14 -uf ref.fa reads.fa > aln.sam  # Nanopore Direct RNA-seq
+./minimap2 -cx asm5 asm1.fa asm2.fa > aln.paf             # intra-species asm-to-asm alignment
+./minimap2 -x ava-pb reads.fa reads.fa > overlaps.paf     # PacBio read overlap
+./minimap2 -x ava-ont reads.fa reads.fa > overlaps.paf    # Nanopore read overlap
+# man page for detailed command line options
 man ./minimap2.1
 ```
+## Table of Contents
 
-## Introduction
+- [Getting Started](#started)
+- [Users' Guide](#uguide)
+  - [Installation](#install)
+  - [General usage](#general)
+  - [Use cases](#cases)
+    - [Map long noisy genomic reads](#map-long-genomic)
+    - [Map long mRNA/cDNA reads](#map-long-splice)
+    - [Find overlaps between long reads](#long-overlap)
+    - [Map short accurate genomic reads](#short-genomic)
+    - [Full genome/assembly alignment](#full-genome)
+  - [Advanced features](#advanced)
+    - [Working with >65535 CIGAR operations](#long-cigar)
+    - [The cs optional tag](#cs)
+    - [Working with the PAF format](#paftools)
+  - [Algorithm overview](#algo)
+  - [Getting help](#help)
+  - [Citing minimap2](#cite)
+- [Developers' Guide](#dguide)
+- [Limitations](#limit)
 
-Minimap2 is a fast sequence mapping and alignment program that can find
+## <a name="uguide"></a>Users' Guide
-overlaps between long noisy reads, or map long reads or their assemblies to a
-reference genome optionally with detailed alignment (i.e. CIGAR). At present,
-it works efficiently with query sequences from a few kilobases to ~100
-megabases in length at an error rate ~15%. Minimap2 outputs in the [PAF][paf] or
-the [SAM format][sam]. On limited test data sets, minimap2 is over 20 times
-faster than most other long-read aligners. It will replace BWA-MEM for long
-reads and contig alignment.
 
-Minimap2 is the successor of [minimap][minimap]. It uses a similar
+Minimap2 is a versatile sequence alignment program that aligns DNA or mRNA
-minimizer-based indexing and seeding algorithm, and improves the original
+sequences against a large reference database. Typical use cases include: (1)
-minimap with homopolyer-compressed k-mers (see also [SMARTdenovo][smartdenovo]
+mapping PacBio or Oxford Nanopore genomic reads to the human genome; (2)
-and [longISLND][longislnd]), better chaining and the ability to produce CIGAR
+finding overlaps between long reads with error rate up to ~15%; (3)
-with fast extension alignment (see also [libgaba][gaba] and [ksw2][ksw2]) and
+splice-aware alignment of PacBio Iso-Seq or Nanopore cDNA or Direct RNA reads
-piece-wise affine gap cost.
+against a reference genome; (4) aligning Illumina single- or paired-end reads;
+(5) assembly-to-assembly alignment; (6) full-genome alignment between two
+closely related species with divergence below ~15%.
 
-## Installation
+For ~10kb noisy reads sequences, minimap2 is tens of times faster than
+mainstream long-read mappers such as BLASR, BWA-MEM, NGMLR and GMAP. It is more
+accurate on simulated long reads and produces biologically meaningful alignment
+ready for downstream analyses. For >100bp Illumina short reads, minimap2 is
+three times as fast as BWA-MEM and Bowtie2, and as accurate on simulated data.
+Detailed evaluations are available from the [minimap2 paper][doi] or the
+[preprint][preprint].
 
-For modern x86-64 CPUs, just type `make` in the source code directory. This
+### <a name="install"></a>Installation
-will compile a binary `minimap2` which you can copy to your desired location.
-If you see compilation errors, try `make sse2only=1` to disable SSE4. Minimap2
-will run a little slower. At present, minimap2 does not work with non-x86 CPUs
-or ancient CPUs that do not support SSE2. SSE2 is critical to the performance
-of minimap2.
 
-## Limitations
+Minimap2 is optimized for x86-64 CPUs. You can acquire precompiled binaries from
+the [release page][release] with:
+```sh
+curl -L https://github.com/lh3/minimap2/releases/download/v2.11/minimap2-2.11_x64-linux.tar.bz2 | tar -jxvf -
+./minimap2-2.11_x64-linux/minimap2
+```
+If you want to compile from the source, you need to have a C compiler, GNU make
+and zlib development files installed. Then type `make` in the source code
+directory to compile. If you see compilation errors, try `make sse2only=1`
+to disable SSE4 code, which will make minimap2 slightly slower.
 
-* At the alignment phase, minimap2 performs global alignments between minimizer
+Minimap2 also works with ARM CPUs supporting the NEON instruction sets. To
-  hits. If the positions of these minimizer hits are incorrect, the final
+compile for 32 bit ARM architectures (such as ARMv7), use `make arm_neon=1`. To compile for for 64 bit ARM architectures (such as ARMv8), use `make arm_neon=1 aarch64=1`.
-  alignment may be suboptimal or unnecessarily fragmented.
 
-* Minimap2 may produce poor alignments that may need post-filtering. We are
+### <a name="general"></a>General usage
-  still exploring a reliable and consistent way to report good alignments.
 
-* Minimap2 does not work well with Illumina short reads as of now.
+Without any options, minimap2 takes a reference database and a query sequence
+file as input and produce approximate mapping, without base-level alignment
+(i.e. no CIGAR), in the [PAF format][paf]:
+```sh
+minimap2 ref.fa query.fq > approx-mapping.paf
+```
+You can ask minimap2 to generate CIGAR at the `cg` tag of PAF with:
+```sh
+minimap2 -c ref.fa query.fq > alignment.paf
+```
+or to output alignments in the [SAM format][sam]:
+```sh
+minimap2 -a ref.fa query.fq > alignment.sam
+```
+Minimap2 seamlessly works with gzip'd FASTA and FASTQ formats as input. You
+don't need to convert between FASTA and FASTQ or decompress gzip'd files first.
 
-* Minimap2 requires SSE2 instructions to compile. It is possible to add
+For the human reference genome, minimap2 takes a few minutes to generate a
-  non-SSE2 support, but it would make minimap2 slower by several times.
+minimizer index for the reference before mapping. To reduce indexing time, you
+can optionally save the index with option **-d** and replace the reference
+sequence file with the index file on the minimap2 command line:
+```sh
+minimap2 -d ref.mmi ref.fa                     # indexing
+minimap2 -a ref.mmi reads.fq > alignment.sam   # alignment
+```
+***Importantly***, it should be noted that once you build the index, indexing
+parameters such as **-k**, **-w**, **-H** and **-I** can't be changed during
+mapping. If you are running minimap2 for different data types, you will
+probably need to keep multiple indexes generated with different parameters.
+This makes minimap2 different from BWA which always uses the same index
+regardless of query data types.
 
-In general, minimap2 is a young project with most code written since June,
+### <a name="cases"></a>Use cases
-2017. It may have bugs and room for improvements. Bug reports and suggestions
+
-are warmly welcomed.
+Minimap2 uses the same base algorithm for all applications. However, due to the
+different data types it supports (e.g. short vs long reads; DNA vs mRNA reads),
+minimap2 needs to be tuned for optimal performance and accuracy. It is usually
+recommended to choose a preset with option **-x**, which sets multiple
+parameters at the same time. The default setting is the same as `map-ont`.
+
+#### <a name="map-long-genomic"></a>Map long noisy genomic reads
+
+```sh
+minimap2 -ax map-pb  ref.fa pacbio-reads.fq > aln.sam   # for PacBio subreads
+minimap2 -ax map-ont ref.fa ont-reads.fq > aln.sam      # for Oxford Nanopore reads
+```
+The difference between `map-pb` and `map-ont` is that `map-pb` uses
+homopolymer-compressed (HPC) minimizers as seeds, while `map-ont` uses ordinary
+minimizers as seeds. Emperical evaluation suggests HPC minimizers improve
+performance and sensitivity when aligning PacBio reads, but hurt when aligning
+Nanopore reads.
+
+#### <a name="map-long-splice"></a>Map long mRNA/cDNA reads
+
+```sh
+minimap2 -ax splice -uf -C5 ref.fa iso-seq.fq > aln.sam      # PacBio Iso-seq/traditional cDNA
+minimap2 -ax splice ref.fa nanopore-cdna.fa > aln.sam        # Nanopore 2D cDNA-seq
+minimap2 -ax splice -uf -k14 ref.fa direct-rna.fq > aln.sam  # Nanopore Direct RNA-seq
+minimap2 -ax splice --splice-flank=no SIRV.fa SIRV-seq.fa    # mapping against SIRV control
+```
+There are different long-read RNA-seq technologies, including tranditional
+full-length cDNA, EST, PacBio Iso-seq, Nanopore 2D cDNA-seq and Direct RNA-seq.
+They produce data of varying quality and properties. By default, `-x splice`
+assumes the read orientation relative to the transcript strand is unknown. It
+tries two rounds of alignment to infer the orientation and write the strand to
+the `ts` SAM/PAF tag if possible. For Iso-seq, Direct RNA-seq and tranditional
+full-length cDNAs, it would be desired to apply `-u f` to force minimap2 to
+consider the forward transcript strand only. This speeds up alignment with
+slight improvement to accuracy. For noisy Nanopore Direct RNA-seq reads, it is
+recommended to use a smaller k-mer size for increased sensitivity to the first
+or the last exons.
+
+Minimap2 rates an alignment by the score of the max-scoring sub-segment,
+*excluding* introns, and marks the best alignment as primary in SAM. When a
+spliced gene also has unspliced pseudogenes, minimap2 does not intentionally
+prefer spliced alignment, though in practice it more often marks the spliced
+alignment as the primary. By default, minimap2 outputs up to five secondary
+alignments (i.e. likely pseudogenes in the context of RNA-seq mapping). This
+can be tuned with option **-N**.
+
+For long RNA-seq reads, minimap2 may produce chimeric alignments potentially
+caused by gene fusions/structural variations or by an intron longer than the
+max intron length **-G** (200k by default). For now, it is not recommended to
+apply an excessively large **-G** as this slows down minimap2 and sometimes
+leads to false alignments.
+
+It is worth noting that by default `-x splice` prefers GT[A/G]..[C/T]AG
+over GT[C/T]..[A/G]AG, and then over other splicing signals. Considering
+one additional base improves the junction accuracy for noisy reads, but
+reduces the accuracy when aligning against the widely used SIRV control data.
+This is because SIRV does not honor the evolutionarily conservative splicing
+signal. If you are studying SIRV, you may apply `--splice-flank=no` to let
+minimap2 only model GT..AG, ignoring the additional base.
+
+#### <a name="long-overlap"></a>Find overlaps between long reads
+
+```sh
+minimap2 -x ava-pb  reads.fq reads.fq > ovlp.paf    # PacBio read overlap
+minimap2 -x ava-ont reads.fq reads.fq > ovlp.paf    # Oxford Nanopore read overlap
+```
+Similarly, `ava-pb` uses HPC minimizers while `ava-ont` uses ordinary
+minimizers. It is usually not recommended to perform base-level alignment in
+the overlapping mode because it is slow and may produce false positive
+overlaps. However, if performance is not a concern, you may try to add `-a` or
+`-c` anyway.
+
+#### <a name="short-genomic"></a>Map short accurate genomic reads
+
+```sh
+minimap2 -ax sr ref.fa reads-se.fq > aln.sam           # single-end alignment
+minimap2 -ax sr ref.fa read1.fq read2.fq > aln.sam     # paired-end alignment
+minimap2 -ax sr ref.fa reads-interleaved.fq > aln.sam  # paired-end alignment
+```
+When two read files are specified, minimap2 reads from each file in turn and
+merge them into an interleaved stream internally. Two reads are considered to
+be paired if they are adjacent in the input stream and have the same name (with
+the `/[0-9]` suffix trimmed if present). Single- and paired-end reads can be
+mixed.
+
+Minimap2 does not work well with short spliced reads. There are many capable
+RNA-seq mappers for short reads.
+
+#### <a name="full-genome"></a>Full genome/assembly alignment
+
+```sh
+minimap2 -ax asm5 ref.fa asm.fa > aln.sam       # assembly to assembly/ref alignment
+```
+For cross-species full-genome alignment, the scoring system needs to be tuned
+according to the sequence divergence.
+
+### <a name="advanced"></a>Advanced features
+
+#### <a name="long-cigar"></a>Working with >65535 CIGAR operations
+
+Due to a design flaw, BAM does not work with CIGAR strings with >65535
+operations (SAM and CRAM work). However, for ultra-long nanopore reads minimap2
+may align ~1% of read bases with long CIGARs beyond the capability of BAM. If
+you convert such SAM/CRAM to BAM, Picard and recent samtools will throw an
+error and abort. Older samtools and other tools may create corrupted BAM.
+
+To avoid this issue, you can add option `-L` at the minimap2 command line.
+This option moves a long CIGAR to the `CG` tag and leaves a fully clipped CIGAR
+at the SAM CIGAR column. Current tools that don't read CIGAR (e.g. merging and
+sorting) still work with such BAM records; tools that read CIGAR will
+effectively ignore these records. It has been decided that future tools will
+will seamlessly recognize long-cigar records generated by option `-L`.
+
+**TL;DR**: if you work with ultra-long reads and use tools that only process
+BAM files, please add option `-L`.
+
+#### <a name="cs"></a>The cs optional tag
+
+The `cs` SAM/PAF tag encodes bases at mismatches and INDELs. It matches regular
+expression `/(:[0-9]+|\*[a-z][a-z]|[=\+\-][A-Za-z]+)+/`. Like CIGAR, `cs`
+consists of series of operations.  Each leading character specifies the
+operation; the following sequence is the one involved in the operation.
+
+The `cs` tag is enabled by command line option `--cs`. The following alignment,
+for example:
+```txt
+CGATCGATAAATAGAGTAG---GAATAGCA
+||||||   ||||||||||   |||| |||
+CGATCG---AATAGAGTAGGTCGAATtGCA
+```
+is represented as `:6-ata:10+gtc:4*at:3`, where `:[0-9]+` represents an
+identical block, `-ata` represents a deltion, `+gtc` an insertion and `*at`
+indicates reference base `a` is substituted with a query base `t`. It is
+similar to the `MD` SAM tag but is standalone and easier to parse.
+
+If `--cs=long` is used, the `cs` string also contains identical sequences in
+the alignment. The above example will become
+`=CGATCG-ata=AATAGAGTAG+gtc=GAAT*at=GCA`. The long form of `cs` encodes both
+reference and query sequences in one string. The `cs` tag also encodes intron
+positions and splicing signals (see the [minimap2 manpage][manpage-cs] for
+details).
+
+#### <a name="paftools"></a>Working with the PAF format
+
+Minimap2 also comes with a (java)script [paftools.js](misc/paftools.js) that
+processes alignments in the PAF format. It calls variants from
+assembly-to-reference alignment, lifts over BED files based on alignment,
+converts between formats and provides utilities for various evaluations. For
+details, please see [misc/README.md](misc/README.md).
+
+### <a name="algo"></a>Algorithm overview
+
+In the following, minimap2 command line options have a dash ahead and are
+highlighted in bold. The description may help to tune minimap2 parameters.
+
+1. Read **-I** [=*4G*] reference bases, extract (**-k**,**-w**)-minimizers and
+   index them in a hash table.
+
+2. Read **-K** [=*200M*] query bases. For each query sequence, do step 3
+   through 7:
+
+3. For each (**-k**,**-w**)-minimizer on the query, check against the reference
+   index. If a reference minimizer is not among the top **-f** [=*2e-4*] most
+   frequent, collect its the occurrences in the reference, which are called
+   *seeds*.
+
+4. Sort seeds by position in the reference. Chain them with dynamic
+   programming. Each chain represents a potential mapping. For read
+   overlapping, report all chains and then go to step 8. For reference mapping,
+   do step 5 through 7:
+
+5. Let *P* be the set of primary mappings, which is an empty set initially. For
+   each chain from the best to the worst according to their chaining scores: if
+   on the query, the chain overlaps with a chain in *P* by **--mask-level**
+   [=*0.5*] or higher fraction of the shorter chain, mark the chain as
+   *secondary* to the chain in *P*; otherwise, add the chain to *P*.
+
+6. Retain all primary mappings. Also retain up to **-N** [=*5*] top secondary
+   mappings if their chaining scores are higher than **-p** [=*0.8*] of their
+   corresponding primary mappings.
+
+7. If alignment is requested, filter out an internal seed if it potentially
+   leads to both a long insertion and a long deletion. Extend from the
+   left-most seed. Perform global alignments between internal seeds.  Split the
+   chain if the accumulative score along the global alignment drops by **-z**
+   [=*400*], disregarding long gaps. Extend from the right-most seed.  Output
+   chains and their alignments.
+
+8. If there are more query sequences in the input, go to step 2 until no more
+   queries are left.
+
+9. If there are more reference sequences, reopen the query file from the start
+   and go to step 1; otherwise stop.
+
+### <a name="help"></a>Getting help
+
+Manpage [minimap2.1][manpage] provides detailed description of minimap2
+command line options and optional tags. If you encounter bugs or have further
+questions or requests, you can raise an issue at the [issue page][issue].
+There is not a specific mailing list for the time being.
+
+### <a name="cite"></a>Citing minimap2
+
+If you use minimap2 in your work, please cite:
+
+> Li, H. (2018). Minimap2: pairwise alignment for nucleotide sequences.
+> Bioinformatics. [doi:10.1093/bioinformatics/bty191][doi]
+
+## <a name="dguide"></a>Developers' Guide
+
+Minimap2 is not only a command line tool, but also a programming library.
+It provides C APIs to build/load index and to align sequences against the
+index. File [example.c](example.c) demonstrates typical uses of C APIs. Header
+file [minimap.h](minimap.h) gives more detailed API documentation. Minimap2
+aims to keep APIs in this header stable. File [mmpriv.h](mmpriv.h) contains
+additional private APIs which may be subjected to changes frequently.
+
+This repository also provides Python bindings to a subset of C APIs. File
+[python/README.rst](python/README.rst) gives the full documentation;
+[python/minimap2.py](python/minimap2.py) shows an example. This Python
+extension, mappy, is also [available from PyPI][mappypypi] via `pip install
+mappy` or [from BioConda][mappyconda] via `conda install -c bioconda mappy`.
+
+## <a name="limit"></a>Limitations
+
+* Minimap2 may produce suboptimal alignments through long low-complexity
+  regions where seed positions may be suboptimal. This should not be a big
+  concern because even the optimal alignment may be wrong in such regions.
+
+* Minimap2 requires SSE2 instructions on x86 CPUs or NEON on ARM CPUs. It is
+  possible to add non-SIMD support, but it would make minimap2 slower by
+  several times.
+
+* Minimap2 does not work with a single query or database sequence ~2
+  billion bases or longer (2,147,483,647 to be exact). The total length of all
+  sequences can well exceed this threshold.
 
 
 
@@ -67,3 +362,12 @@ are warmly welcomed.
 [longislnd]: https://www.ncbi.nlm.nih.gov/pubmed/27667791
 [gaba]: https://github.com/ocxtal/libgaba
 [ksw2]: https://github.com/lh3/ksw2
+[preprint]: https://arxiv.org/abs/1708.01492
+[release]: https://github.com/lh3/minimap2/releases
+[mappypypi]: https://pypi.python.org/pypi/mappy
+[mappyconda]: https://anaconda.org/bioconda/mappy
+[issue]: https://github.com/lh3/minimap2/issues
+[k8]: https://github.com/attractivechaos/k8
+[manpage]: https://lh3.github.io/minimap2/minimap2.html
+[manpage-cs]: https://lh3.github.io/minimap2/minimap2.html#10
+[doi]: https://doi.org/10.1093/bioinformatics/bty191

align.c

@@ -1,21 +1,24 @@
 #include <assert.h>
 #include <string.h>
+#include <stdlib.h>
+#include <math.h>
 #include "minimap.h"
 #include "mmpriv.h"
 #include "ksw2.h"
 
-static void ksw_gen_simple_mat(int m, int8_t *mat, int8_t a, int8_t b)
+static void ksw_gen_simple_mat(int m, int8_t *mat, int8_t a, int8_t b, int8_t sc_ambi)
 {
 	int i, j;
 	a = a < 0? -a : a;
 	b = b > 0? -b : b;
+	sc_ambi = sc_ambi > 0? -sc_ambi : sc_ambi;
 	for (i = 0; i < m - 1; ++i) {
 		for (j = 0; j < m - 1; ++j)
 			mat[i * m + j] = i == j? a : b;
-		mat[i * m + m - 1] = 0;
+		mat[i * m + m - 1] = sc_ambi;
 	}
 	for (j = 0; j < m; ++j)
-		mat[(m - 1) * m + j] = 0;
+		mat[(m - 1) * m + j] = sc_ambi;
 }
 
 static inline void mm_seq_rev(uint32_t len, uint8_t *seq)
@@ -26,77 +29,169 @@ static inline void mm_seq_rev(uint32_t len, uint8_t *seq)
 		t = seq[i], seq[i] = seq[len - 1 - i], seq[len - 1 - i] = t;
 }
 
-static inline int test_zdrop_aux(int32_t score, int i, int j, int32_t *max, int *max_i, int *max_j, int e, int zdrop)
+static inline void update_max_zdrop(int32_t score, int i, int j, int32_t *max, int *max_i, int *max_j, int e, int *max_zdrop, int pos[2][2])
 {
 	if (score < *max) {
 		int li = i - *max_i;
 		int lj = j - *max_j;
 		int diff = li > lj? li - lj : lj - li;
-		if (*max - score > zdrop + diff * e)
+		int z = *max - score - diff * e;
-			return 1;
+		if (z > *max_zdrop) {
+			*max_zdrop = z;
+			pos[0][0] = *max_i, pos[0][1] = i + 1;
+			pos[1][0] = *max_j, pos[1][1] = j + 1;
+		}
 	} else *max = score, *max_i = i, *max_j = j;
-	return 0;
 }
 
-static int mm_check_zdrop(const uint8_t *qseq, const uint8_t *tseq, uint32_t n_cigar, uint32_t *cigar, const int8_t *mat, int8_t q, int8_t e, int zdrop)
+static int mm_test_zdrop(void *km, const mm_mapopt_t *opt, const uint8_t *qseq, const uint8_t *tseq, uint32_t n_cigar, uint32_t *cigar, const int8_t *mat)
 {
 	uint32_t k;
-	int32_t score = 0, max = 0, max_i = -1, max_j = -1, i = 0, j = 0;
+	int32_t score = 0, max = INT32_MIN, max_i = -1, max_j = -1, i = 0, j = 0, max_zdrop = 0;
-	for (k = 0; k < n_cigar; ++k) {
+	int pos[2][2] = {{-1, -1}, {-1, -1}}, q_len, t_len;
+
+	// find the score and the region where score drops most along diagonal
+	for (k = 0, score = 0; k < n_cigar; ++k) {
 		uint32_t l, op = cigar[k]&0xf, len = cigar[k]>>4;
 		if (op == 0) {
 			for (l = 0; l < len; ++l) {
 				score += mat[tseq[i + l] * 5 + qseq[j + l]];
-				if (test_zdrop_aux(score, i+l, j+l, &max, &max_i, &max_j, e, zdrop)) return 1;
+				update_max_zdrop(score, i+l, j+l, &max, &max_i, &max_j, opt->e, &max_zdrop, pos);
 			}
 			i += len, j += len;
-		} else if (op == 1) {
+		} else if (op == 1 || op == 2 || op == 3) {
-			score -= q + e * len, j += len;
+			score -= opt->q + opt->e * len;
-			if (test_zdrop_aux(score, i, j, &max, &max_i, &max_j, e, zdrop)) return 1;
+			if (op == 1) j += len; // insertion
-		} else if (op == 2) {
+			else i += len;         // deletion
-			score -= q + e * len, i += len;
+			update_max_zdrop(score, i, j, &max, &max_i, &max_j, opt->e, &max_zdrop, pos);
-			if (test_zdrop_aux(score, i, j, &max, &max_i, &max_j, e, zdrop)) return 1;
 		}
 	}
-	return 0;
-}
 
-static void mm_update_extra(mm_extra_t *p, const uint8_t *qseq, const uint8_t *tseq, const int8_t *mat, int8_t q, int8_t e)
+	// test if there is an inversion in the most dropped region
+	q_len = pos[1][1] - pos[1][0], t_len = pos[0][1] - pos[0][0];
+	if (!(opt->flag&(MM_F_SPLICE|MM_F_SR|MM_F_FOR_ONLY|MM_F_REV_ONLY)) && max_zdrop > opt->zdrop_inv && q_len < opt->max_gap && t_len < opt->max_gap) {
+		uint8_t *qseq2;
+		void *qp;
+		int q_off, t_off;
+		qseq2 = (uint8_t*)kmalloc(km, q_len);
+		for (i = 0; i < q_len; ++i) {
+			int c = qseq[pos[1][1] - i - 1];
+			qseq2[i] = c >= 4? 4 : 3 - c;
+		}
+		qp = ksw_ll_qinit(km, 2, q_len, qseq2, 5, mat);
+		score = ksw_ll_i16(qp, t_len, tseq + pos[0][0], opt->q, opt->e, &q_off, &t_off);
+		kfree(km, qseq2);
+		kfree(km, qp);
+		if (score >= opt->min_chain_score * opt->a && score >= opt->min_dp_max)
+			return 2; // there is a potential inversion
+	}
+	return max_zdrop > opt->zdrop? 1 : 0;
+}
+
+static void mm_fix_cigar(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq, int *qshift, int *tshift)
 {
-	uint32_t k, l, toff = 0, qoff = 0;
+	mm_extra_t *p = r->p;
-	int32_t s = 0, max = 0;
+	int32_t toff = 0, qoff = 0, to_shrink = 0;
+	uint32_t k;
+	*qshift = *tshift = 0;
+	if (p->n_cigar <= 1) return;
+	for (k = 0; k < p->n_cigar; ++k) { // indel left alignment
+		uint32_t op = p->cigar[k]&0xf, len = p->cigar[k]>>4;
+		if (len == 0) to_shrink = 1;
+		if (op == 0) {
+			toff += len, qoff += len;
+		} else if (op == 1 || op == 2) { // insertion or deletion
+			if (k > 0 && k < p->n_cigar - 1 && (p->cigar[k-1]&0xf) == 0 && (p->cigar[k+1]&0xf) == 0) {
+				int l, prev_len = p->cigar[k-1] >> 4;
+				if (op == 1) {
+					for (l = 0; l < prev_len; ++l)
+						if (qseq[qoff - 1 - l] != qseq[qoff + len - 1 - l])
+							break;
+				} else {
+					for (l = 0; l < prev_len; ++l)
+						if (tseq[toff - 1 - l] != tseq[toff + len - 1 - l])
+							break;
+				}
+				if (l > 0)
+					p->cigar[k-1] -= l<<4, p->cigar[k+1] += l<<4, qoff -= l, toff -= l;
+				if (l == prev_len) to_shrink = 1;
+			}
+			if (op == 1) qoff += len;
+			else toff += len;
+		} else if (op == 3) {
+			toff += len;
+		}
+	}
+	assert(qoff == r->qe - r->qs && toff == r->re - r->rs);
+	if (to_shrink) { // squeeze out zero-length operations
+		int32_t l = 0;
+		for (k = 0; k < p->n_cigar; ++k) // squeeze out zero-length operations
+			if (p->cigar[k]>>4 != 0)
+				p->cigar[l++] = p->cigar[k];
+		p->n_cigar = l;
+		for (k = l = 0; k < p->n_cigar; ++k) // merge two adjacent operations if they are the same
+			if (k == p->n_cigar - 1 || (p->cigar[k]&0xf) != (p->cigar[k+1]&0xf))
+				p->cigar[l++] = p->cigar[k];
+			else p->cigar[k+1] += p->cigar[k]>>4<<4; // add length to the next CIGAR operator
+		p->n_cigar = l;
+	}
+	if ((p->cigar[0]&0xf) == 1 || (p->cigar[0]&0xf) == 2) { // get rid of leading I or D
+		int32_t l = p->cigar[0] >> 4;
+		if ((p->cigar[0]&0xf) == 1) {
+			if (r->rev) r->qe -= l;
+			else r->qs += l;
+			*qshift = l;
+		} else r->rs += l, *tshift = l;
+		--p->n_cigar;
+		memmove(p->cigar, p->cigar + 1, p->n_cigar * 4);
+	}
+}
+
+static void mm_update_extra(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq, const int8_t *mat, int8_t q, int8_t e)
+{
+	uint32_t k, l;
+	int32_t s = 0, max = 0, qshift, tshift, toff = 0, qoff = 0;
+	mm_extra_t *p = r->p;
 	if (p == 0) return;
+	mm_fix_cigar(r, qseq, tseq, &qshift, &tshift);
+	qseq += qshift, tseq += tshift; // qseq and tseq may be shifted due to the removal of leading I/D
+	r->blen = r->mlen = 0;
 	for (k = 0; k < p->n_cigar; ++k) {
 		uint32_t op = p->cigar[k]&0xf, len = p->cigar[k]>>4;
-		if (op == 0) {
+		if (op == 0) { // match/mismatch
+			int n_ambi = 0, n_diff = 0;
 			for (l = 0; l < len; ++l) {
 				int cq = qseq[qoff + l], ct = tseq[toff + l];
-				if (ct > 3 || cq > 3) ++p->n_ambi;
+				if (ct > 3 || cq > 3) ++n_ambi;
-				else if (ct != cq) ++p->n_diff;
+				else if (ct != cq) ++n_diff;
 				s += mat[ct * 5 + cq];
 				if (s < 0) s = 0;
 				else max = max > s? max : s;
 			}
-			toff += len, qoff += len, p->blen += len;
+			r->blen += len - n_ambi, r->mlen += len - (n_ambi + n_diff), p->n_ambi += n_ambi;
-		} else if (op == 1) {
+			toff += len, qoff += len;
+		} else if (op == 1) { // insertion
 			int n_ambi = 0;
 			for (l = 0; l < len; ++l)
 				if (qseq[qoff + l] > 3) ++n_ambi;
-			qoff += len, p->blen += len;
+			r->blen += len - n_ambi, p->n_ambi += n_ambi;
-			p->n_ambi += n_ambi, p->n_diff += len - n_ambi;
 			s -= q + e * len;
 			if (s < 0) s = 0;
-		} else if (op == 2) {
+			qoff += len;
+		} else if (op == 2) { // deletion
 			int n_ambi = 0;
 			for (l = 0; l < len; ++l)
 				if (tseq[toff + l] > 3) ++n_ambi;
-			toff += len, p->blen += len;
+			r->blen += len - n_ambi, p->n_ambi += n_ambi;
-			p->n_ambi += n_ambi, p->n_diff += len - n_ambi;
 			s -= q + e * len;
 			if (s < 0) s = 0;
+			toff += len;
+		} else if (op == 3) { // intron
+			toff += len;
 		}
 	}
 	p->dp_max = max;
+	assert(qoff == r->qe - r->qs && toff == r->re - r->rs);
 }
 
 static void mm_append_cigar(mm_reg1_t *r, uint32_t n_cigar, uint32_t *cigar) // TODO: this calls the libc realloc()
@@ -104,12 +199,12 @@ static void mm_append_cigar(mm_reg1_t *r, uint32_t n_cigar, uint32_t *cigar) //
 	mm_extra_t *p;
 	if (n_cigar == 0) return;
 	if (r->p == 0) {
-		uint32_t capacity = n_cigar + sizeof(mm_extra_t);
+		uint32_t capacity = n_cigar + sizeof(mm_extra_t)/4;
 		kroundup32(capacity);
 		r->p = (mm_extra_t*)calloc(capacity, 4);
 		r->p->capacity = capacity;
-	} else if (r->p->n_cigar + n_cigar + sizeof(mm_extra_t) > r->p->capacity) {
+	} else if (r->p->n_cigar + n_cigar + sizeof(mm_extra_t)/4 > r->p->capacity) {
-		r->p->capacity = r->p->n_cigar + n_cigar + sizeof(mm_extra_t);
+		r->p->capacity = r->p->n_cigar + n_cigar + sizeof(mm_extra_t)/4;
 		kroundup32(r->p->capacity);
 		r->p = (mm_extra_t*)realloc(r->p, r->p->capacity * 4);
 	}
@@ -124,12 +219,100 @@ static void mm_append_cigar(mm_reg1_t *r, uint32_t n_cigar, uint32_t *cigar) //
 	}
 }
 
-static void mm_align_pair(void *km, const mm_mapopt_t *opt, int qlen, const uint8_t *qseq, int tlen, const uint8_t *tseq, const int8_t *mat, int w, int flag, ksw_extz_t *ez)
+static void mm_update_cigar_eqx(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq) // written by @armintoepfer
 {
-	if (opt->q == opt->q2 && opt->e == opt->e2)
+	uint32_t n_EQX = 0;
-		ksw_extz2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, w, opt->zdrop, flag, ez);
+	uint32_t k, l, m, cap, toff = 0, qoff = 0, n_M = 0;
+	mm_extra_t *p;
+	if (r->p == 0) return;
+	for (k = 0; k < r->p->n_cigar; ++k) {
+		uint32_t op = r->p->cigar[k]&0xf, len = r->p->cigar[k]>>4;
+		if (op == 0) {
+			while (len > 0) {
+				for (l = 0; l < len && qseq[qoff + l] == tseq[toff + l]; ++l) {} // run of "="; TODO: N<=>N is converted to "="
+				if (l > 0) { ++n_EQX; len -= l; toff += l; qoff += l; }
+
+				for (l = 0; l < len && qseq[qoff + l] != tseq[toff + l]; ++l) {} // run of "X"
+				if (l > 0) { ++n_EQX; len -= l; toff += l; qoff += l; }
+			}
+			++n_M;
+		} else if (op == 1) { // insertion
+			qoff += len;
+		} else if (op == 2) { // deletion
+			toff += len;
+		} else if (op == 3) { // intron
+			toff += len;
+		}
+	}
+	// update in-place if we can
+	if (n_EQX == n_M) {
+		for (k = 0; k < r->p->n_cigar; ++k) {
+			uint32_t op = r->p->cigar[k]&0xf, len = r->p->cigar[k]>>4;
+			if (op == 0) r->p->cigar[k] = len << 4 | 7;
+		}
+		return;
+	}
+	// allocate new storage
+	cap = r->p->n_cigar + (n_EQX - n_M) + sizeof(mm_extra_t);
+	kroundup32(cap);
+	p = (mm_extra_t*)calloc(cap, 4);
+	memcpy(p, r->p, sizeof(mm_extra_t));
+	p->capacity = cap;
+	// update cigar while copying
+	toff = qoff = m = 0;
+	for (k = 0; k < r->p->n_cigar; ++k) {
+		uint32_t op = r->p->cigar[k]&0xf, len = r->p->cigar[k]>>4;
+		if (op == 0) { // match/mismatch
+			while (len > 0) {
+				// match
+				for (l = 0; l < len && qseq[qoff + l] == tseq[toff + l]; ++l) {}
+				if (l > 0) p->cigar[m++] = l << 4 | 7;
+				len -= l;
+				toff += l, qoff += l;
+				// mismatch
+				for (l = 0; l < len && qseq[qoff + l] != tseq[toff + l]; ++l) {}
+				if (l > 0) p->cigar[m++] = l << 4 | 8;
+				len -= l;
+				toff += l, qoff += l;
+			}
+			continue;
+		} else if (op == 1) { // insertion
+			qoff += len;
+		} else if (op == 2) { // deletion
+			toff += len;
+		} else if (op == 3) { // intron
+			toff += len;
+		}
+		p->cigar[m++] = r->p->cigar[k];
+	}
+	p->n_cigar = m;
+	free(r->p);
+	r->p = p;
+}
+
+static void mm_align_pair(void *km, const mm_mapopt_t *opt, int qlen, const uint8_t *qseq, int tlen, const uint8_t *tseq, const int8_t *mat, int w, int end_bonus, int zdrop, int flag, ksw_extz_t *ez)
+{
+	if (mm_dbg_flag & MM_DBG_PRINT_ALN_SEQ) {
+		int i;
+		fprintf(stderr, "===> q=(%d,%d), e=(%d,%d), bw=%d, flag=%d, zdrop=%d <===\n", opt->q, opt->q2, opt->e, opt->e2, w, flag, opt->zdrop);
+		for (i = 0; i < tlen; ++i) fputc("ACGTN"[tseq[i]], stderr);
+		fputc('\n', stderr);
+		for (i = 0; i < qlen; ++i) fputc("ACGTN"[qseq[i]], stderr);
+		fputc('\n', stderr);
+	}
+	if (opt->flag & MM_F_SPLICE)
+		ksw_exts2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->noncan, zdrop, flag, ez);
+	else if (opt->q == opt->q2 && opt->e == opt->e2)
+		ksw_extz2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, w, zdrop, end_bonus, flag, ez);
 	else
-		ksw_extd2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->e2, w, opt->zdrop, flag, ez);
+		ksw_extd2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->e2, w, zdrop, end_bonus, flag, ez);
+	if (mm_dbg_flag & MM_DBG_PRINT_ALN_SEQ) {
+		int i;
+		fprintf(stderr, "score=%d, cigar=", ez->score);
+		for (i = 0; i < ez->n_cigar; ++i)
+			fprintf(stderr, "%d%c", ez->cigar[i]>>4, "MIDN"[ez->cigar[i]&0xf]);
+		fprintf(stderr, "\n");
+	}
 }
 
 static inline int mm_get_hplen_back(const mm_idx_t *mi, uint32_t rid, uint32_t x)
@@ -143,7 +326,7 @@ static inline int mm_get_hplen_back(const mm_idx_t *mi, uint32_t rid, uint32_t x
 
 static inline void mm_adjust_minier(const mm_idx_t *mi, uint8_t *const qseq0[2], mm128_t *a, int32_t *r, int32_t *q)
 {
-	if (mi->is_hpc) {
+	if (mi->flag & MM_I_HPC) {
 		const uint8_t *qseq = qseq0[a->x>>63];
 		int i, c;
 		*q = (int32_t)a->y;
@@ -153,70 +336,326 @@ static inline void mm_adjust_minier(const mm_idx_t *mi, uint8_t *const qseq0[2],
 		c = mm_get_hplen_back(mi, a->x<<1>>33, (int32_t)a->x);
 		*r = (int32_t)a->x + 1 - c;
 	} else {
-		*r = (int32_t)a->x + 1;
+		*r = (int32_t)a->x - (mi->k>>1);
-		*q = (int32_t)a->y + 1;
+		*q = (int32_t)a->y - (mi->k>>1);
 	}
 }
 
-static void mm_filter_bad_seeds(int n, mm128_t *a, int max_space, int max_diff)
+static int *collect_long_gaps(void *km, int as1, int cnt1, mm128_t *a, int min_gap, int *n_)
 {
-	int i;
+	int i, n, *K;
-	if (n < 3) return;
+	*n_ = 0;
-	for (i = 0; i < n - 2; ++i) {
+	for (i = 1, n = 0; i < cnt1; ++i) { // count the number of gaps longer than min_gap
-		int32_t q[3], t[3], gap01, gap12, gap02;
+		int gap = ((int32_t)a[as1 + i].y - a[as1 + i - 1].y) - ((int32_t)a[as1 + i].x - a[as1 + i - 1].x);
-		t[0] = (int32_t)a[i].x, q[0] = (int32_t)a[i].y;
+		if (gap < -min_gap || gap > min_gap) ++n;
-		t[1] = (int32_t)a[i+1].x, q[1] = (int32_t)a[i+1].y;
+	}
-		t[2] = (int32_t)a[i+2].x, q[2] = (int32_t)a[i+2].y;
+	if (n <= 1) return 0;
-		if (t[2] - t[0] > max_space || q[2] - q[0] > max_space) continue;
+	K = (int*)kmalloc(km, n * sizeof(int));
-		gap01 = (t[1] - t[0]) - (q[1] - q[0]), gap01 = gap01 > 0? gap01 : -gap01;
+	for (i = 1, n = 0; i < cnt1; ++i) { // store the positions of long gaps
-		gap12 = (t[2] - t[1]) - (q[2] - q[1]), gap12 = gap12 > 0? gap12 : -gap12;
+		int gap = ((int32_t)a[as1 + i].y - a[as1 + i - 1].y) - ((int32_t)a[as1 + i].x - a[as1 + i - 1].x);
-		gap02 = (t[2] - t[0]) - (q[2] - q[0]), gap02 = gap02 > 0? gap02 : -gap02;
+		if (gap < -min_gap || gap > min_gap)
-		if (gap01 + gap12 - gap02 > max_diff)
+			K[n++] = i;
-			a[++i].y |= 1ULL << 41;
+	}
+	*n_ = n;
+	return K;
+}
+
+static void mm_filter_bad_seeds(void *km, int as1, int cnt1, mm128_t *a, int min_gap, int diff_thres, int max_ext_len, int max_ext_cnt)
+{
+	int max_st, max_en, n, i, k, max, *K;
+	K = collect_long_gaps(km, as1, cnt1, a, min_gap, &n);
+	if (K == 0) return;
+	max = 0, max_st = max_en = -1;
+	for (k = 0;; ++k) { // traverse long gaps
+		int gap, l, n_ins = 0, n_del = 0, qs, rs, max_diff = 0, max_diff_l = -1;
+		if (k == n || k >= max_en) {
+			if (max_en > 0)
+				for (i = K[max_st]; i < K[max_en]; ++i)
+					a[as1 + i].y |= MM_SEED_IGNORE;
+			max = 0, max_st = max_en = -1;
+			if (k == n) break;
+		}
+		i = K[k];
+		gap = ((int32_t)a[as1 + i].y - (int32_t)a[as1 + i - 1].y) - (int32_t)(a[as1 + i].x - a[as1 + i - 1].x);
+		if (gap > 0) n_ins += gap;
+		else n_del += -gap;
+		qs = (int32_t)a[as1 + i - 1].y;
+		rs = (int32_t)a[as1 + i - 1].x;
+		for (l = k + 1; l < n && l <= k + max_ext_cnt; ++l) {
+			int j = K[l], diff;
+			if ((int32_t)a[as1 + j].y - qs > max_ext_len || (int32_t)a[as1 + j].x - rs > max_ext_len) break;
+			gap = ((int32_t)a[as1 + j].y - (int32_t)a[as1 + j - 1].y) - (int32_t)(a[as1 + j].x - a[as1 + j - 1].x);
+			if (gap > 0) n_ins += gap;
+			else n_del += -gap;
+			diff = n_ins + n_del - abs(n_ins - n_del);
+			if (max_diff < diff)
+				max_diff = diff, max_diff_l = l;
+		}
+		if (max_diff > diff_thres && max_diff > max)
+			max = max_diff, max_st = k, max_en = max_diff_l;
+	}
+	kfree(km, K);
+}
+
+static void mm_filter_bad_seeds_alt(void *km, int as1, int cnt1, mm128_t *a, int min_gap, int max_ext)
+{
+	int n, k, *K;
+	K = collect_long_gaps(km, as1, cnt1, a, min_gap, &n);
+	if (K == 0) return;
+	for (k = 0; k < n;) {
+		int i = K[k], l;
+		int gap1 = ((int32_t)a[as1 + i].y - (int32_t)a[as1 + i - 1].y) - ((int32_t)a[as1 + i].x - (int32_t)a[as1 + i - 1].x);
+		int re1 = (int32_t)a[as1 + i].x;
+		int qe1 = (int32_t)a[as1 + i].y;
+		gap1 = gap1 > 0? gap1 : -gap1;
+		for (l = k + 1; l < n; ++l) {
+			int j = K[l], gap2, q_span_pre, rs2, qs2, m;
+			if ((int32_t)a[as1 + j].y - qe1 > max_ext || (int32_t)a[as1 + j].x - re1 > max_ext) break;
+			gap2 = ((int32_t)a[as1 + j].y - (int32_t)a[as1 + j - 1].y) - (int32_t)(a[as1 + j].x - a[as1 + j - 1].x);
+			q_span_pre = a[as1 + j - 1].y >> 32 & 0xff;
+			rs2 = (int32_t)a[as1 + j - 1].x + q_span_pre;
+			qs2 = (int32_t)a[as1 + j - 1].x + q_span_pre;
+			m = rs2 - re1 < qs2 - qe1? rs2 - re1 : qs2 - qe1;
+			gap2 = gap2 > 0? gap2 : -gap2;
+			if (m > gap1 + gap2) break;
+			re1 = (int32_t)a[as1 + j].x;
+			qe1 = (int32_t)a[as1 + j].y;
+			gap1 = gap2;
+		}
+		if (l > k + 1) {
+			int j, end = K[l - 1];
+			for (j = K[k]; j < end; ++j)
+				a[as1 + j].y |= MM_SEED_IGNORE;
+			a[as1 + end].y |= MM_SEED_LONG_JOIN;
+		}
+		k = l;
+	}
+	kfree(km, K);
+}
+
+static void mm_fix_bad_ends(const mm_reg1_t *r, const mm128_t *a, int bw, int min_match, int32_t *as, int32_t *cnt)
+{
+	int32_t i, l, m;
+	*as = r->as, *cnt = r->cnt;
+	if (r->cnt < 3) return;
+	m = l = a[r->as].y >> 32 & 0xff;
+	for (i = r->as + 1; i < r->as + r->cnt - 1; ++i) {
+		int32_t lq, lr, min, max;
+		int32_t q_span = a[i].y >> 32 & 0xff;
+		if (a[i].y & MM_SEED_LONG_JOIN) break;
+		lr = (int32_t)a[i].x - (int32_t)a[i-1].x;
+		lq = (int32_t)a[i].y - (int32_t)a[i-1].y;
+		min = lr < lq? lr : lq;
+		max = lr > lq? lr : lq;
+		if (max - min > l >> 1) *as = i;
+		l += min;
+		m += min < q_span? min : q_span;
+		if (l >= bw << 1 || (m >= min_match && m >= bw) || m >= r->mlen >> 1) break;
+	}
+	*cnt = r->as + r->cnt - *as;
+	m = l = a[r->as + r->cnt - 1].y >> 32 & 0xff;
+	for (i = r->as + r->cnt - 2; i > *as; --i) {
+		int32_t lq, lr, min, max;
+		int32_t q_span = a[i+1].y >> 32 & 0xff;
+		if (a[i+1].y & MM_SEED_LONG_JOIN) break;
+		lr = (int32_t)a[i+1].x - (int32_t)a[i].x;
+		lq = (int32_t)a[i+1].y - (int32_t)a[i].y;
+		min = lr < lq? lr : lq;
+		max = lr > lq? lr : lq;
+		if (max - min > l >> 1) *cnt = i + 1 - *as;
+		l += min;
+		m += min < q_span? min : q_span;
+		if (l >= bw << 1 || (m >= min_match && m >= bw) || m >= r->mlen >> 1) break;
 	}
 }
 
-static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, uint8_t *qseq0[2], mm_reg1_t *r, mm_reg1_t *r2, mm128_t *a, ksw_extz_t *ez)
+static void mm_max_stretch(const mm_reg1_t *r, const mm128_t *a, int32_t *as, int32_t *cnt)
 {
-	int32_t rid = a[r->as].x<<1>>33, rev = a[r->as].x>>63;
+	int32_t i, score, max_score, len, max_i, max_len;
+
+	*as = r->as, *cnt = r->cnt;
+	if (r->cnt < 2) return;
+
+	max_score = -1, max_i = -1, max_len = 0;
+	score = a[r->as].y >> 32 & 0xff, len = 1;
+	for (i = r->as + 1; i < r->as + r->cnt; ++i) {
+		int32_t lq, lr, q_span;
+		q_span = a[i].y >> 32 & 0xff;
+		lr = (int32_t)a[i].x - (int32_t)a[i-1].x;
+		lq = (int32_t)a[i].y - (int32_t)a[i-1].y;
+		if (lq == lr) {
+			score += lq < q_span? lq : q_span;
+			++len;
+		} else {
+			if (score > max_score)
+				max_score = score, max_len = len, max_i = i - len;
+			score = q_span, len = 1;
+		}
+	}
+	if (score > max_score)
+		max_score = score, max_len = len, max_i = i - len;
+	*as = max_i, *cnt = max_len;
+}
+
+static int mm_seed_ext_score(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, const int8_t mat[25], int qlen, uint8_t *qseq0[2], const mm128_t *a)
+{
+	uint8_t *qseq, *tseq;
+	int q_span = a->y>>32&0xff, qs, qe, rs, re, rid, score, q_off, t_off, ext_len = opt->anchor_ext_len;
+	void *qp;
+	rid = a->x<<1>>33;
+	re = (uint32_t)a->x + 1, rs = re - q_span;
+	qe = (uint32_t)a->y + 1, qs = qe - q_span;
+	rs = rs - ext_len > 0? rs - ext_len : 0;
+	qs = qs - ext_len > 0? qs - ext_len : 0;
+	re = re + ext_len < (int32_t)mi->seq[rid].len? re + ext_len : mi->seq[rid].len;
+	qe = qe + ext_len < qlen? qe + ext_len : qlen;
+	tseq = (uint8_t*)kmalloc(km, re - rs);
+	mm_idx_getseq(mi, rid, rs, re, tseq);
+	qseq = qseq0[a->x>>63] + qs;
+	qp = ksw_ll_qinit(km, 2, qe - qs, qseq, 5, mat);
+	score = ksw_ll_i16(qp, re - rs, tseq, opt->q, opt->e, &q_off, &t_off);
+	kfree(km, tseq);
+	kfree(km, qp);
+	return score;
+}
+
+static void mm_fix_bad_ends_splice(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, const mm_reg1_t *r, const int8_t mat[25], int qlen, uint8_t *qseq0[2], const mm128_t *a, int *as1, int *cnt1)
+{ // this assumes a very crude k-mer based mode; it is not necessary to use a good model just for filtering bounary exons
+	int score;
+	double log_gap;
+	*as1 = r->as, *cnt1 = r->cnt;
+	if (r->cnt < 3) return;
+	log_gap = log((int32_t)a[r->as + 1].x - (int32_t)a[r->as].x);
+	if ((a[r->as].y>>32&0xff) < log_gap + opt->anchor_ext_shift) {
+		score = mm_seed_ext_score(km, opt, mi, mat, qlen, qseq0, &a[r->as]);
+		if ((double)score / mat[0] < log_gap + opt->anchor_ext_shift) // a more exact format is "score < log_4(gap) + shift"
+			++(*as1), --(*cnt1);
+	}
+	log_gap = log((int32_t)a[r->as + r->cnt - 1].x - (int32_t)a[r->as + r->cnt - 2].x);
+	if ((a[r->as + r->cnt - 1].y>>32&0xff) < log_gap + opt->anchor_ext_shift) {
+		score = mm_seed_ext_score(km, opt, mi, mat, qlen, qseq0, &a[r->as + r->cnt - 1]);
+		if ((double)score / mat[0] < log_gap + opt->anchor_ext_shift)
+			--(*cnt1);
+	}
+}
+
+static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, uint8_t *qseq0[2], mm_reg1_t *r, mm_reg1_t *r2, int n_a, mm128_t *a, ksw_extz_t *ez, int splice_flag)
+{
+	int is_sr = !!(opt->flag & MM_F_SR), is_splice = !!(opt->flag & MM_F_SPLICE);
+	int32_t rid = a[r->as].x<<1>>33, rev = a[r->as].x>>63, as1, cnt1;
 	uint8_t *tseq, *qseq;
-	int32_t i, l, bw, dropped = 0, rs0, re0, qs0, qe0;
+	int32_t i, l, bw, dropped = 0, extra_flag = 0, rs0, re0, qs0, qe0;
 	int32_t rs, re, qs, qe;
 	int32_t rs1, qs1, re1, qe1;
 	int8_t mat[25];
 
-	if (r->cnt == 0) return;
+	if (is_sr) assert(!(mi->flag & MM_I_HPC)); // HPC won't work with SR because with HPC we can't easily tell if there is a gap
-	ksw_gen_simple_mat(5, mat, opt->a, opt->b);
-	bw = (int)(opt->bw * 1.5 + 1.);
 
 	r2->cnt = 0;
-	mm_adjust_minier(mi, qseq0, &a[r->as], &rs, &qs);
+	if (r->cnt == 0) return;
-	mm_adjust_minier(mi, qseq0, &a[r->as + r->cnt - 1], &re, &qe);
+	ksw_gen_simple_mat(5, mat, opt->a, opt->b, opt->sc_ambi);
-	mm_filter_bad_seeds(r->cnt, &a[r->as], opt->max_gap, 100);
+	bw = (int)(opt->bw * 1.5 + 1.);
 
-	// compute rs0 and qs0
+	if (is_sr && !(mi->flag & MM_I_HPC)) {
-	if (r->split && r->as > 0) {
+		mm_max_stretch(r, a, &as1, &cnt1);
-		mm_adjust_minier(mi, qseq0, &a[r->as-1], &rs0, &qs0);
+		rs = (int32_t)a[as1].x + 1 - (int32_t)(a[as1].y>>32&0xff);
+		qs = (int32_t)a[as1].y + 1 - (int32_t)(a[as1].y>>32&0xff);
+		re = (int32_t)a[as1+cnt1-1].x + 1;
+		qe = (int32_t)a[as1+cnt1-1].y + 1;
 	} else {
-		if (qs > 0 && rs > 0) { // actually this is always true
+		if (is_splice) {
+			mm_fix_bad_ends_splice(km, opt, mi, r, mat, qlen, qseq0, a, &as1, &cnt1);
+		} else {
+			mm_fix_bad_ends(r, a, opt->bw, opt->min_chain_score * 2, &as1, &cnt1);
+		}
+		mm_filter_bad_seeds(km, as1, cnt1, a, 10, 40, opt->max_gap>>1, 10);
+		mm_filter_bad_seeds_alt(km, as1, cnt1, a, 30, opt->max_gap>>1);
+		mm_adjust_minier(mi, qseq0, &a[as1], &rs, &qs);
+		mm_adjust_minier(mi, qseq0, &a[as1 + cnt1 - 1], &re, &qe);
+	}
+	assert(cnt1 > 0);
+
+	if (is_splice) {
+		if (splice_flag & MM_F_SPLICE_FOR) extra_flag |= rev? KSW_EZ_SPLICE_REV : KSW_EZ_SPLICE_FOR;
+		if (splice_flag & MM_F_SPLICE_REV) extra_flag |= rev? KSW_EZ_SPLICE_FOR : KSW_EZ_SPLICE_REV;
+		if (opt->flag & MM_F_SPLICE_FLANK) extra_flag |= KSW_EZ_SPLICE_FLANK;
+	}
+
+	/* Look for the start and end of regions to perform DP. This sounds easy
+	 * but is in fact tricky. Excessively small regions lead to unnecessary
+	 * clippings and lose alignable sequences. Excessively large regions
+	 * occasionally lead to large overlaps between two chains and may cause
+	 * loss of alignments in corner cases. */
+	if (is_sr) {
+		qs0 = 0, qe0 = qlen;
+		l = qs;
+		l += l * opt->a + opt->end_bonus > opt->q? (l * opt->a + opt->end_bonus - opt->q) / opt->e : 0;
+		rs0 = rs - l > 0? rs - l : 0;
+		l = qlen - qe;
+		l += l * opt->a + opt->end_bonus > opt->q? (l * opt->a + opt->end_bonus - opt->q) / opt->e : 0;
+		re0 = re + l < (int32_t)mi->seq[rid].len? re + l : mi->seq[rid].len;
+	} else {
+		// compute rs0 and qs0
+		rs0 = (int32_t)a[r->as].x + 1 - (int32_t)(a[r->as].y>>32&0xff);
+		qs0 = (int32_t)a[r->as].y + 1 - (int32_t)(a[r->as].y>>32&0xff);
+		if (rs0 < 0) rs0 = 0; // this may happen when HPC is in use
+		assert(qs0 >= 0); // this should never happen, or it is logic error
+		rs1 = qs1 = 0;
+		for (i = r->as - 1, l = 0; i >= 0 && a[i].x>>32 == a[r->as].x>>32; --i) { // inspect nearby seeds
+			int32_t x = (int32_t)a[i].x + 1 - (int32_t)(a[i].y>>32&0xff);
+			int32_t y = (int32_t)a[i].y + 1 - (int32_t)(a[i].y>>32&0xff);
+			if (x < rs0 && y < qs0) {
+				if (++l > opt->min_cnt) {
+					l = rs0 - x > qs0 - y? rs0 - x : qs0 - y;
+					rs1 = rs0 - l, qs1 = qs0 - l;
+					break;
+				}
+			}
+		}
+		if (qs > 0 && rs > 0) {
 			l = qs < opt->max_gap? qs : opt->max_gap;
-			qs0 = qs - l;
+			qs1 = qs1 > qs - l? qs1 : qs - l;
+			qs0 = qs0 < qs1? qs0 : qs1; // at least include qs0
 			l += l * opt->a > opt->q? (l * opt->a - opt->q) / opt->e : 0;
 			l = l < opt->max_gap? l : opt->max_gap;
 			l = l < rs? l : rs;
-			rs0 = rs - l;
+			rs1 = rs1 > rs - l? rs1 : rs - l;
+			rs0 = rs0 < rs1? rs0 : rs1;
 		} else rs0 = rs, qs0 = qs;
-
-	}
 		// compute re0 and qe0
-	if (qe < qlen && re < mi->seq[rid].len) {
+		re0 = (int32_t)a[r->as + r->cnt - 1].x + 1;
+		qe0 = (int32_t)a[r->as + r->cnt - 1].y + 1;
+		re1 = mi->seq[rid].len, qe1 = qlen;
+		for (i = r->as + r->cnt, l = 0; i < n_a && a[i].x>>32 == a[r->as].x>>32; ++i) { // inspect nearby seeds
+			int32_t x = (int32_t)a[i].x + 1;
+			int32_t y = (int32_t)a[i].y + 1;
+			if (x > re0 && y > qe0) {
+				if (++l > opt->min_cnt) {
+					l = x - re0 > y - qe0? x - re0 : y - qe0;
+					re1 = re0 + l, qe1 = qe0 + l;
+					break;
+				}
+			}
+		}
+		if (qe < qlen && re < (int32_t)mi->seq[rid].len) {
 			l = qlen - qe < opt->max_gap? qlen - qe : opt->max_gap;
-		qe0 = qe + l;
+			qe1 = qe1 < qe + l? qe1 : qe + l;
+			qe0 = qe0 > qe1? qe0 : qe1; // at least include qe0
 			l += l * opt->a > opt->q? (l * opt->a - opt->q) / opt->e : 0;
 			l = l < opt->max_gap? l : opt->max_gap;
-		l = l < mi->seq[rid].len - re? l : mi->seq[rid].len - re;
+			l = l < (int32_t)mi->seq[rid].len - re? l : mi->seq[rid].len - re;
-		re0 = re + l;
+			re1 = re1 < re + l? re1 : re + l;
+			re0 = re0 > re1? re0 : re1;
 		} else re0 = re, qe0 = qe;
+	}
+	if (a[r->as].y & MM_SEED_SELF) {
+		int max_ext = r->qs > r->rs? r->qs - r->rs : r->rs - r->qs;
+		if (r->rs - rs0 > max_ext) rs0 = r->rs - max_ext;
+		if (r->qs - qs0 > max_ext) qs0 = r->qs - max_ext;
+		max_ext = r->qe > r->re? r->qe - r->re : r->re - r->qe;
+		if (re0 - r->re > max_ext) re0 = r->re + max_ext;
+		if (qe0 - r->qe > max_ext) qe0 = r->qe + max_ext;
+	}
 
 	assert(re0 > rs0);
 	tseq = (uint8_t*)kmalloc(km, re0 - rs0);
@@ -226,44 +665,62 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
 		mm_idx_getseq(mi, rid, rs0, rs, tseq);
 		mm_seq_rev(qs - qs0, qseq);
 		mm_seq_rev(rs - rs0, tseq);
-		mm_align_pair(km, opt, qs - qs0, qseq, rs - rs0, tseq, mat, bw, KSW_EZ_EXTZ_ONLY|KSW_EZ_RIGHT|KSW_EZ_REV_CIGAR, ez);
+		mm_align_pair(km, opt, qs - qs0, qseq, rs - rs0, tseq, mat, bw, opt->end_bonus, r->split_inv? opt->zdrop_inv : opt->zdrop, extra_flag|KSW_EZ_EXTZ_ONLY|KSW_EZ_RIGHT|KSW_EZ_REV_CIGAR, ez);
 		if (ez->n_cigar > 0) {
 			mm_append_cigar(r, ez->n_cigar, ez->cigar);
 			r->p->dp_score += ez->max;
 		}
-		rs1 = rs - (ez->max_t + 1);
+		rs1 = rs - (ez->reach_end? ez->mqe_t + 1 : ez->max_t + 1);
-		qs1 = qs - (ez->max_q + 1);
+		qs1 = qs - (ez->reach_end? qs - qs0 : ez->max_q + 1);
 		mm_seq_rev(qs - qs0, qseq);
 	} else rs1 = rs, qs1 = qs;
 	re1 = rs, qe1 = qs;
 	assert(qs1 >= 0 && rs1 >= 0);
 
-	for (i = 1; i < r->cnt; ++i) { // gap filling
+	for (i = is_sr? cnt1 - 1 : 1; i < cnt1; ++i) { // gap filling
-		if (a[r->as+i].y>>41&1) continue;
+		if ((a[as1+i].y & (MM_SEED_IGNORE|MM_SEED_TANDEM)) && i != cnt1 - 1) continue;
-		mm_adjust_minier(mi, qseq0, &a[r->as + i], &re, &qe);
+		if (is_sr && !(mi->flag & MM_I_HPC)) {
+			re = (int32_t)a[as1 + i].x + 1;
+			qe = (int32_t)a[as1 + i].y + 1;
+		} else mm_adjust_minier(mi, qseq0, &a[as1 + i], &re, &qe);
 		re1 = re, qe1 = qe;
-		if (i == r->cnt - 1 || (a[r->as+i].y>>40&1) || qe - qs >= opt->min_ksw_len || re - rs >= opt->min_ksw_len) {
+		if (i == cnt1 - 1 || (a[as1+i].y&MM_SEED_LONG_JOIN) || (qe - qs >= opt->min_ksw_len && re - rs >= opt->min_ksw_len)) {
-			int bw1 = bw;
+			int j, bw1 = bw, zdrop_code;
-			if (a[r->as+i].y>>40&1)
+			if (a[as1+i].y & MM_SEED_LONG_JOIN)
 				bw1 = qe - qs > re - rs? qe - qs : re - rs;
+			// perform alignment
 			qseq = &qseq0[rev][qs];
 			mm_idx_getseq(mi, rid, rs, re, tseq);
-			mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, mat, bw1, KSW_EZ_APPROX_MAX, ez);
+			if (is_sr) { // perform ungapped alignment
-			if (mm_check_zdrop(qseq, tseq, ez->n_cigar, ez->cigar, mat, opt->q, opt->e, opt->zdrop))
+				assert(qe - qs == re - rs);
-				mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, mat, bw1, 0, ez);
+				ksw_reset_extz(ez);
+				for (j = 0, ez->score = 0; j < qe - qs; ++j) {
+					if (qseq[j] >= 4 || tseq[j] >= 4) ez->score += opt->e2;
+					else ez->score += qseq[j] == tseq[j]? opt->a : -opt->b;
+				}
+				ez->cigar = ksw_push_cigar(km, &ez->n_cigar, &ez->m_cigar, ez->cigar, 0, qe - qs);
+			} else { // perform normal gapped alignment
+				mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, mat, bw1, -1, opt->zdrop, extra_flag|KSW_EZ_APPROX_MAX, ez); // first pass: with approximate Z-drop
+			}
+			// test Z-drop and inversion Z-drop
+			if ((zdrop_code = mm_test_zdrop(km, opt, qseq, tseq, ez->n_cigar, ez->cigar, mat)) != 0)
+				mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, mat, bw1, -1, zdrop_code == 2? opt->zdrop_inv : opt->zdrop, extra_flag, ez); // second pass: lift approximate
+			// update CIGAR
 			if (ez->n_cigar > 0)
 				mm_append_cigar(r, ez->n_cigar, ez->cigar);
 			if (ez->zdropped) { // truncated by Z-drop; TODO: sometimes Z-drop kicks in because the next seed placement is wrong. This can be fixed in principle.
-				int j;
 				for (j = i - 1; j >= 0; --j)
-					if ((int32_t)a[r->as + j].x < re + ez->max_t)
+					if ((int32_t)a[as1 + j].x <= rs + ez->max_t)
 						break;
 				dropped = 1;
+				if (j < 0) j = 0;
 				r->p->dp_score += ez->max;
 				re1 = rs + (ez->max_t + 1);
 				qe1 = qs + (ez->max_q + 1);
-				if (r->cnt - (j + 1) >= opt->min_cnt)
+				if (cnt1 - (j + 1) >= opt->min_cnt) {
-					mm_split_reg(r, r2, j + 1, qlen, a);
+					mm_split_reg(r, r2, as1 + j + 1 - r->as, qlen, a);
+					if (zdrop_code == 2) r2->split_inv = 1;
+				}
 				break;
 			} else r->p->dp_score += ez->score;
 			rs = re, qs = qe;
@@ -273,13 +730,13 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
 	if (!dropped && qe < qe0 && re < re0) { // right extension
 		qseq = &qseq0[rev][qe];
 		mm_idx_getseq(mi, rid, re, re0, tseq);
-		mm_align_pair(km, opt, qe0 - qe, qseq, re0 - re, tseq, mat, bw, KSW_EZ_EXTZ_ONLY, ez);
+		mm_align_pair(km, opt, qe0 - qe, qseq, re0 - re, tseq, mat, bw, opt->end_bonus, opt->zdrop, extra_flag|KSW_EZ_EXTZ_ONLY, ez);
 		if (ez->n_cigar > 0) {
 			mm_append_cigar(r, ez->n_cigar, ez->cigar);
 			r->p->dp_score += ez->max;
 		}
-		re1 = re + (ez->max_t + 1);
+		re1 = re + (ez->reach_end? ez->mqe_t + 1 : ez->max_t + 1);
-		qe1 = qe + (ez->max_q + 1);
+		qe1 = qe + (ez->reach_end? qe0 - qe : ez->max_q + 1);
 	}
 	assert(qe1 <= qlen);
 
@@ -290,44 +747,137 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
 	assert(re1 - rs1 <= re0 - rs0);
 	if (r->p) {
 		mm_idx_getseq(mi, rid, rs1, re1, tseq);
-		mm_update_extra(r->p, &qseq0[r->rev][qs1], tseq, mat, opt->q, opt->e);
+		mm_update_extra(r, &qseq0[r->rev][qs1], tseq, mat, opt->q, opt->e);
+		if (opt->flag & MM_F_EQX) mm_update_cigar_eqx(r, &qseq0[r->rev][qs1], tseq);
+		if (rev && r->p->trans_strand)
+			r->p->trans_strand ^= 3; // flip to the read strand
 	}
 
 	kfree(km, tseq);
 }
 
+static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, uint8_t *qseq0[2], const mm_reg1_t *r1, const mm_reg1_t *r2, mm_reg1_t *r_inv, ksw_extz_t *ez)
+{
+	int tl, ql, score, ret = 0, q_off, t_off;
+	uint8_t *tseq, *qseq;
+	int8_t mat[25];
+	void *qp;
+
+	memset(r_inv, 0, sizeof(mm_reg1_t));
+	if (!(r1->split&1) || !(r2->split&2)) return 0;
+	if (r1->id != r1->parent && r1->parent != MM_PARENT_TMP_PRI) return 0;
+	if (r2->id != r2->parent && r2->parent != MM_PARENT_TMP_PRI) return 0;
+	if (r1->rid != r2->rid || r1->rev != r2->rev) return 0;
+	ql = r1->rev? r1->qs - r2->qe : r2->qs - r1->qe;
+	tl = r2->rs - r1->re;
+	if (ql < opt->min_chain_score || ql > opt->max_gap) return 0;
+	if (tl < opt->min_chain_score || tl > opt->max_gap) return 0;
+
+	ksw_gen_simple_mat(5, mat, opt->a, opt->b, opt->sc_ambi);
+	tseq = (uint8_t*)kmalloc(km, tl);
+	mm_idx_getseq(mi, r1->rid, r1->re, r2->rs, tseq);
+	qseq = r1->rev? &qseq0[0][r2->qe] : &qseq0[1][qlen - r2->qs];
+
+	mm_seq_rev(ql, qseq);
+	mm_seq_rev(tl, tseq);
+	qp = ksw_ll_qinit(km, 2, ql, qseq, 5, mat);
+	score = ksw_ll_i16(qp, tl, tseq, opt->q, opt->e, &q_off, &t_off);
+	kfree(km, qp);
+	mm_seq_rev(ql, qseq);
+	mm_seq_rev(tl, tseq);
+	if (score < opt->min_dp_max) goto end_align1_inv;
+	q_off = ql - (q_off + 1), t_off = tl - (t_off + 1);
+	mm_align_pair(km, opt, ql - q_off, qseq + q_off, tl - t_off, tseq + t_off, mat, (int)(opt->bw * 1.5), -1, opt->zdrop, KSW_EZ_EXTZ_ONLY, ez);
+	if (ez->n_cigar == 0) goto end_align1_inv; // should never be here
+	mm_append_cigar(r_inv, ez->n_cigar, ez->cigar);
+	r_inv->p->dp_score = ez->max;
+	r_inv->id = -1;
+	r_inv->parent = MM_PARENT_UNSET;
+	r_inv->inv = 1;
+	r_inv->rev = !r1->rev;
+	r_inv->rid = r1->rid;
+	r_inv->div = -1.0f;
+	if (r_inv->rev == 0) {
+		r_inv->qs = r2->qe + q_off;
+		r_inv->qe = r_inv->qs + ez->max_q + 1;
+	} else {
+		r_inv->qe = r2->qs - q_off;
+		r_inv->qs = r_inv->qe - (ez->max_q + 1);
+	}
+	r_inv->rs = r1->re + t_off;
+	r_inv->re = r_inv->rs + ez->max_t + 1;
+	mm_update_extra(r_inv, &qseq[q_off], &tseq[t_off], mat, opt->q, opt->e);
+	if (opt->flag & MM_F_EQX) mm_update_cigar_eqx(r_inv, &qseq[q_off], &tseq[t_off]);
+	ret = 1;
+end_align1_inv:
+	kfree(km, tseq);
+	return ret;
+}
+
+static inline mm_reg1_t *mm_insert_reg(const mm_reg1_t *r, int i, int *n_regs, mm_reg1_t *regs)
+{
+	regs = (mm_reg1_t*)realloc(regs, (*n_regs + 1) * sizeof(mm_reg1_t));
+	if (i + 1 != *n_regs)
+		memmove(&regs[i + 2], &regs[i + 1], sizeof(mm_reg1_t) * (*n_regs - i - 1));
+	regs[i + 1] = *r;
+	++*n_regs;
+	return regs;
+}
+
 mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a)
 {
 	extern unsigned char seq_nt4_table[256];
-	int32_t i, r, n_regs = *n_regs_;
+	int32_t i, n_regs = *n_regs_, n_a;
 	uint8_t *qseq0[2];
 	ksw_extz_t ez;
 
 	// encode the query sequence
-	qseq0[0] = (uint8_t*)kmalloc(km, qlen);
+	qseq0[0] = (uint8_t*)kmalloc(km, qlen * 2);
-	qseq0[1] = (uint8_t*)kmalloc(km, qlen);
+	qseq0[1] = qseq0[0] + qlen;
 	for (i = 0; i < qlen; ++i) {
 		qseq0[0][i] = seq_nt4_table[(uint8_t)qstr[i]];
 		qseq0[1][qlen - 1 - i] = qseq0[0][i] < 4? 3 - qseq0[0][i] : 4;
 	}
 
 	// align through seed hits
+	n_a = mm_squeeze_a(km, n_regs, regs, a);
 	memset(&ez, 0, sizeof(ksw_extz_t));
-	for (r = 0; r < n_regs; ++r) {
+	for (i = 0; i < n_regs; ++i) {
 		mm_reg1_t r2;
-		mm_align1(km, opt, mi, qlen, qseq0, &regs[r], &r2, a, &ez);
+		if ((opt->flag&MM_F_SPLICE) && (opt->flag&MM_F_SPLICE_FOR) && (opt->flag&MM_F_SPLICE_REV)) { // then do two rounds of alignments for both strands
-		if (r2.cnt > 0) {
+			mm_reg1_t s[2], s2[2];
-			regs = (mm_reg1_t*)realloc(regs, (n_regs + 1) * sizeof(mm_reg1_t)); // this should be very rare
+			int which, trans_strand;
-			if (r + 1 != n_regs)
+			s[0] = s[1] = regs[i];
-				memmove(&regs[r + 2], &regs[r + 1], sizeof(mm_reg1_t) * (n_regs - r - 1));
+			mm_align1(km, opt, mi, qlen, qseq0, &s[0], &s2[0], n_a, a, &ez, MM_F_SPLICE_FOR);
-			regs[r + 1] = r2;
+			mm_align1(km, opt, mi, qlen, qseq0, &s[1], &s2[1], n_a, a, &ez, MM_F_SPLICE_REV);
-			++n_regs;
+			if (s[0].p->dp_score > s[1].p->dp_score) which = 0, trans_strand = 1;
+			else if (s[0].p->dp_score < s[1].p->dp_score) which = 1, trans_strand = 2;
+			else trans_strand = 3, which = (qlen + s[0].p->dp_score) & 1; // randomly choose a strand, effectively
+			if (which == 0) {
+				regs[i] = s[0], r2 = s2[0];
+				free(s[1].p);
+			} else {
+				regs[i] = s[1], r2 = s2[1];
+				free(s[0].p);
+			}
+			regs[i].p->trans_strand = trans_strand;
+		} else { // one round of alignment
+			mm_align1(km, opt, mi, qlen, qseq0, &regs[i], &r2, n_a, a, &ez, opt->flag);
+			if (opt->flag&MM_F_SPLICE)
+				regs[i].p->trans_strand = opt->flag&MM_F_SPLICE_FOR? 1 : 2;
+		}
+		if (r2.cnt > 0) regs = mm_insert_reg(&r2, i, &n_regs, regs);
+		if (i > 0 && regs[i].split_inv) {
+			if (mm_align1_inv(km, opt, mi, qlen, qseq0, &regs[i-1], &regs[i], &r2, &ez)) {
+				regs = mm_insert_reg(&r2, i, &n_regs, regs);
+				++i; // skip the inserted INV alignment
+			}
 		}
 	}
 	*n_regs_ = n_regs;
-	kfree(km, qseq0[0]); kfree(km, qseq0[1]);
+	kfree(km, qseq0[0]);
 	kfree(km, ez.cigar);
-	mm_filter_regs(km, opt, n_regs_, regs);
+	mm_filter_regs(opt, qlen, n_regs_, regs);
-	mm_hit_sort_by_dp(km, n_regs_, regs);
+	mm_hit_sort(km, n_regs_, regs);
 	return regs;
 }

bseq.c

@@ -1,16 +1,38 @@
 #include <zlib.h>
 #include <stdio.h>
 #include <stdlib.h>
-#include <string.h>
 #include <assert.h>
+#define __STDC_LIMIT_MACROS
 #include "bseq.h"
+#include "kvec.h"
 #include "kseq.h"
-KSEQ_INIT(gzFile, gzread)
+KSEQ_INIT2(, gzFile, gzread)
+
+unsigned char seq_comp_table[256] = {
+	  0,   1,	2,	 3,	  4,   5,	6,	 7,	  8,   9,  10,	11,	 12,  13,  14,	15,
+	 16,  17,  18,	19,	 20,  21,  22,	23,	 24,  25,  26,	27,	 28,  29,  30,	31,
+	 32,  33,  34,	35,	 36,  37,  38,	39,	 40,  41,  42,	43,	 44,  45,  46,	47,
+	 48,  49,  50,	51,	 52,  53,  54,	55,	 56,  57,  58,	59,	 60,  61,  62,	63,
+	 64, 'T', 'V', 'G', 'H', 'E', 'F', 'C', 'D', 'I', 'J', 'M', 'L', 'K', 'N', 'O',
+	'P', 'Q', 'Y', 'S', 'A', 'A', 'B', 'W', 'X', 'R', 'Z',	91,	 92,  93,  94,	95,
+	 64, 't', 'v', 'g', 'h', 'e', 'f', 'c', 'd', 'i', 'j', 'm', 'l', 'k', 'n', 'o',
+	'p', 'q', 'y', 's', 'a', 'a', 'b', 'w', 'x', 'r', 'z', 123, 124, 125, 126, 127,
+	128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143,
+	144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159,
+	160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175,
+	176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191,
+	192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207,
+	208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223,
+	224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239,
+	240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255
+};
+
+#define CHECK_PAIR_THRES 1000000
 
 struct mm_bseq_file_s {
-	int is_eof;
 	gzFile fp;
 	kseq_t *ks;
+	mm_bseq1_t s;
 };
 
 mm_bseq_file_t *mm_bseq_open(const char *fn)
@@ -32,33 +54,109 @@ void mm_bseq_close(mm_bseq_file_t *fp)
 	free(fp);
 }
 
-mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int chunk_size, int with_qual, int *n_)
+static inline char *kstrdup(const kstring_t *s)
 {
-	int size = 0, m, n;
+	char *t;
-	mm_bseq1_t *seqs;
+	t = (char*)malloc(s->l + 1);
+	memcpy(t, s->s, s->l + 1);
+	return t;
+}
+
+static inline void kseq2bseq(kseq_t *ks, mm_bseq1_t *s, int with_qual, int with_comment)
+{
+	int i;
+	s->name = kstrdup(&ks->name);
+	s->seq = kstrdup(&ks->seq);
+	for (i = 0; i < (int)ks->seq.l; ++i) // convert U to T
+		if (s->seq[i] == 'u' || s->seq[i] == 'U')
+			--s->seq[i];
+	s->qual = with_qual && ks->qual.l? kstrdup(&ks->qual) : 0;
+	s->comment = with_comment && ks->comment.l? kstrdup(&ks->comment) : 0;
+	s->l_seq = ks->seq.l;
+}
+
+mm_bseq1_t *mm_bseq_read3(mm_bseq_file_t *fp, int chunk_size, int with_qual, int with_comment, int frag_mode, int *n_)
+{
+	int64_t size = 0;
+	kvec_t(mm_bseq1_t) a = {0,0,0};
 	kseq_t *ks = fp->ks;
-	m = n = 0; seqs = 0;
+	*n_ = 0;
+	if (fp->s.seq) {
+		kv_resize(mm_bseq1_t, 0, a, 256);
+		kv_push(mm_bseq1_t, 0, a, fp->s);
+		size = fp->s.l_seq;
+		memset(&fp->s, 0, sizeof(mm_bseq1_t));
+	}
 	while (kseq_read(ks) >= 0) {
 		mm_bseq1_t *s;
 		assert(ks->seq.l <= INT32_MAX);
-		if (n >= m) {
+		if (a.m == 0) kv_resize(mm_bseq1_t, 0, a, 256);
-			m = m? m<<1 : 256;
+		kv_pushp(mm_bseq1_t, 0, a, &s);
-			seqs = (mm_bseq1_t*)realloc(seqs, m * sizeof(mm_bseq1_t));
+		kseq2bseq(ks, s, with_qual, with_comment);
+		size += s->l_seq;
+		if (size >= chunk_size) {
+			if (frag_mode && a.a[a.n-1].l_seq < CHECK_PAIR_THRES) {
+				while (kseq_read(ks) >= 0) {
+					kseq2bseq(ks, &fp->s, with_qual, with_comment);
+					if (mm_qname_same(fp->s.name, a.a[a.n-1].name)) {
+						kv_push(mm_bseq1_t, 0, a, fp->s);
+						memset(&fp->s, 0, sizeof(mm_bseq1_t));
+					} else break;
+				}
+			}
+			break;
+		}
+	}
+	*n_ = a.n;
+	return a.a;
+}
+
+mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int frag_mode, int *n_)
+{
+	return mm_bseq_read3(fp, chunk_size, with_qual, 0, frag_mode, n_);
+}
+
+mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int chunk_size, int with_qual, int *n_)
+{
+	return mm_bseq_read2(fp, chunk_size, with_qual, 0, n_);
+}
+
+mm_bseq1_t *mm_bseq_read_frag2(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int with_comment, int *n_)
+{
+	int i;
+	int64_t size = 0;
+	kvec_t(mm_bseq1_t) a = {0,0,0};
+	*n_ = 0;
+	if (n_fp < 1) return 0;
+	while (1) {
+		int n_read = 0;
+		for (i = 0; i < n_fp; ++i)
+			if (kseq_read(fp[i]->ks) >= 0)
+				++n_read;
+		if (n_read < n_fp) {
+			if (n_read > 0)
+				fprintf(stderr, "[W::%s]\033[1;31m query files have different number of records; extra records skipped.\033[0m\n", __func__);
+			break; // some file reaches the end
+		}
+		if (a.m == 0) kv_resize(mm_bseq1_t, 0, a, 256);
+		for (i = 0; i < n_fp; ++i) {
+			mm_bseq1_t *s;
+			kv_pushp(mm_bseq1_t, 0, a, &s);
+			kseq2bseq(fp[i]->ks, s, with_qual, with_comment);
+			size += s->l_seq;
 		}
-		s = &seqs[n];
-		s->name = strdup(ks->name.s);
-		s->seq = strdup(ks->seq.s);
-		s->qual = with_qual && ks->qual.l? strdup(ks->qual.s) : 0;
-		s->l_seq = ks->seq.l;
-		size += seqs[n++].l_seq;
 		if (size >= chunk_size) break;
 	}
-	if (size < chunk_size) fp->is_eof = 1;
+	*n_ = a.n;
-	*n_ = n;
+	return a.a;
-	return seqs;
+}
+
+mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int *n_)
+{
+	return mm_bseq_read_frag2(n_fp, fp, chunk_size, with_qual, 0, n_);
 }
 
 int mm_bseq_eof(mm_bseq_file_t *fp)
 {
-	return fp->is_eof;
+	return (ks_eof(fp->ks->f) && fp->s.seq == 0);
 }

bseq.h

@@ -2,6 +2,7 @@
 #define MM_BSEQ_H
 
 #include <stdint.h>
+#include <string.h>
 
 #ifdef __cplusplus
 extern "C" {
@@ -12,15 +13,49 @@ typedef struct mm_bseq_file_s mm_bseq_file_t;
 
 typedef struct {
 	int l_seq, rid;
-	char *name, *seq, *qual;
+	char *name, *seq, *qual, *comment;
 } mm_bseq1_t;
 
 mm_bseq_file_t *mm_bseq_open(const char *fn);
 void mm_bseq_close(mm_bseq_file_t *fp);
+mm_bseq1_t *mm_bseq_read3(mm_bseq_file_t *fp, int chunk_size, int with_qual, int with_comment, int frag_mode, int *n_);
+mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int frag_mode, int *n_);
 mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int chunk_size, int with_qual, int *n_);
+mm_bseq1_t *mm_bseq_read_frag2(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int with_comment, int *n_);
+mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int *n_);
 int mm_bseq_eof(mm_bseq_file_t *fp);
 
 extern unsigned char seq_nt4_table[256];
+extern unsigned char seq_comp_table[256];
+
+static inline int mm_qname_len(const char *s)
+{
+	int l;
+	l = strlen(s);
+	return l >= 3 && s[l-1] >= '0' && s[l-1] <= '9' && s[l-2] == '/'? l - 2 : l;
+}
+
+static inline int mm_qname_same(const char *s1, const char *s2)
+{
+	int l1, l2;
+	l1 = mm_qname_len(s1);
+	l2 = mm_qname_len(s2);
+	return (l1 == l2 && strncmp(s1, s2, l1) == 0);
+}
+
+static inline void mm_revcomp_bseq(mm_bseq1_t *s)
+{
+	int i, t, l = s->l_seq;
+	for (i = 0; i < l>>1; ++i) {
+		t = s->seq[l - i - 1];
+		s->seq[l - i - 1] = seq_comp_table[(uint8_t)s->seq[i]];
+		s->seq[i] = seq_comp_table[t];
+	}
+	if (l&1) s->seq[l>>1] = seq_comp_table[(uint8_t)s->seq[l>>1]];
+	if (s->qual)
+		for (i = 0; i < l>>1; ++i)
+			t = s->qual[l - i - 1], s->qual[l - i - 1] = s->qual[i], s->qual[i] = t;
+}
 
 #ifdef __cplusplus
 }

chain.c

@@ -19,35 +19,52 @@ static inline int ilog2_32(uint32_t v)
 	return (t = v>>8) ? 8 + LogTable256[t] : LogTable256[v];
 }
 
-int mm_chain_dp(int max_dist, int bw, int max_skip, int min_cnt, int min_sc, int64_t n, mm128_t *a, uint64_t **_u, void *km)
+mm128_t *mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int min_cnt, int min_sc, int is_cdna, int n_segs, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km)
 { // TODO: make sure this works when n has more than 32 bits
-	int32_t st = 0, j, k, *f, *p, *t, *v, n_u, n_v;
+	int32_t k, *f, *p, *t, *v, n_u, n_v;
-	int64_t i;
+	int64_t i, j, st = 0;
-	uint64_t *u, *u2;
+	uint64_t *u, *u2, sum_qspan = 0;
+	float avg_qspan;
 	mm128_t *b, *w;
 
-	if (_u) *_u = 0;
+	if (_u) *_u = 0, *n_u_ = 0;
 	f = (int32_t*)kmalloc(km, n * 4);
 	p = (int32_t*)kmalloc(km, n * 4);
 	t = (int32_t*)kmalloc(km, n * 4);
+	v = (int32_t*)kmalloc(km, n * 4);
 	memset(t, 0, n * 4);
 
+	for (i = 0; i < n; ++i) sum_qspan += a[i].y>>32&0xff;
+	avg_qspan = (float)sum_qspan / n;
+
 	// fill the score and backtrack arrays
 	for (i = 0; i < n; ++i) {
 		uint64_t ri = a[i].x;
+		int64_t max_j = -1;
 		int32_t qi = (int32_t)a[i].y, q_span = a[i].y>>32&0xff; // NB: only 8 bits of span is used!!!
-		int32_t max_f = -INT32_MAX, max_j = -1, n_skip = 0, min_d;
+		int32_t max_f = q_span, n_skip = 0, min_d;
-		while (st < i && ri - a[st].x > max_dist) ++st;
+		int32_t sidi = (a[i].y & MM_SEED_SEG_MASK) >> MM_SEED_SEG_SHIFT;
+		while (st < i && ri > a[st].x + max_dist_x) ++st;
 		for (j = i - 1; j >= st; --j) {
 			int64_t dr = ri - a[j].x;
-			int32_t dq = qi - (int32_t)a[j].y, dd, sc;
+			int32_t dq = qi - (int32_t)a[j].y, dd, sc, log_dd;
-			if (dr == 0 || dq <= 0 || dq > max_dist) continue;
+			int32_t sidj = (a[j].y & MM_SEED_SEG_MASK) >> MM_SEED_SEG_SHIFT;
+			if ((sidi == sidj && dr == 0) || dq <= 0) continue; // don't skip if an anchor is used by multiple segments; see below
+			if ((sidi == sidj && dq > max_dist_y) || dq > max_dist_x) continue;
 			dd = dr > dq? dr - dq : dq - dr;
-			if (dd > bw) continue;
+			if (sidi == sidj && dd > bw) continue;
+			if (n_segs > 1 && !is_cdna && sidi == sidj && dr > max_dist_y) continue;
 			min_d = dq < dr? dq : dr;
 			sc = min_d > q_span? q_span : dq < dr? dq : dr;
-			sc -= dd? ilog2_32(dd) * 2 : 0;
+			log_dd = dd? ilog2_32(dd) : 0;
-			if (min_d > q_span) sc -= ilog2_32(min_d) / 2;
+			if (is_cdna || sidi != sidj) {
+				int c_log, c_lin;
+				c_lin = (int)(dd * .01 * avg_qspan);
+				c_log = log_dd;
+				if (sidi != sidj && dr == 0) ++sc; // possibly due to overlapping paired ends; give a minor bonus
+				else if (dr > dq || sidi != sidj) sc -= c_lin < c_log? c_lin : c_log;
+				else sc -= c_lin + (c_log>>1);
+			} else sc -= (int)(dd * .01 * avg_qspan) + (log_dd>>1);
 			sc += f[j];
 			if (sc > max_f) {
 				max_f = sc, max_j = j;
@@ -58,8 +75,8 @@ int mm_chain_dp(int max_dist, int bw, int max_skip, int min_cnt, int min_sc, int
 			}
 			if (p[j] >= 0) t[p[j]] = i;
 		}
-		if (max_j >= 0) f[i] = max_f, p[i] = max_j;
+		f[i] = max_f, p[i] = max_j;
-		else f[i] = q_span, p[i] = -1;
+		v[i] = max_j >= 0 && v[max_j] > max_f? v[max_j] : max_f; // v[] keeps the peak score up to i; f[] is the score ending at i, not always the peak
 	}
 
 	// find the ending positions of chains
@@ -67,16 +84,21 @@ int mm_chain_dp(int max_dist, int bw, int max_skip, int min_cnt, int min_sc, int
 	for (i = 0; i < n; ++i)
 		if (p[i] >= 0) t[p[i]] = 1;
 	for (i = n_u = 0; i < n; ++i)
-		if (t[i] == 0 && f[i] >= min_sc)
+		if (t[i] == 0 && v[i] >= min_sc)
 			++n_u;
 	if (n_u == 0) {
-		kfree(km, f); kfree(km, p); kfree(km, t);
+		kfree(km, a); kfree(km, f); kfree(km, p); kfree(km, t); kfree(km, v);
 		return 0;
 	}
 	u = (uint64_t*)kmalloc(km, n_u * 8);
-	for (i = n_u = 0; i < n; ++i)
+	for (i = n_u = 0; i < n; ++i) {
-		if (t[i] == 0 && f[i] >= min_sc)
+		if (t[i] == 0 && v[i] >= min_sc) {
-			u[n_u++] = (uint64_t)f[i] << 32 | i;
+			j = i;
+			while (j >= 0 && f[j] < v[j]) j = p[j]; // find the peak that maximizes f[]
+			if (j < 0) j = i; // TODO: this should really be assert(j>=0)
+			u[n_u++] = (uint64_t)f[j] << 32 | j;
+		}
+	}
 	radix_sort_64(u, u + n_u);
 	for (i = 0; i < n_u>>1; ++i) { // reverse, s.t. the highest scoring chain is the first
 		uint64_t t = u[i];
@@ -85,7 +107,6 @@ int mm_chain_dp(int max_dist, int bw, int max_skip, int min_cnt, int min_sc, int
 
 	// backtrack
 	memset(t, 0, n * 4);
-	v = (int32_t*)kmalloc(km, n * 4);
 	for (i = n_v = k = 0; i < n_u; ++i) { // starting from the highest score
 		int32_t n_v0 = n_v, k0 = k;
 		j = (int32_t)u[i];
@@ -101,9 +122,9 @@ int mm_chain_dp(int max_dist, int bw, int max_skip, int min_cnt, int min_sc, int
 		}
 		if (k0 == k) n_v = n_v0; // no new chain added, reset
 	}
-	n_u = k, *_u = u; // NB: note that u[] may not be sorted by score here
+	*n_u_ = n_u = k, *_u = u; // NB: note that u[] may not be sorted by score here
 
-	// free
+	// free temporary arrays
 	kfree(km, f); kfree(km, p); kfree(km, t);
 
 	// write the result to b[]
@@ -130,6 +151,7 @@ int mm_chain_dp(int max_dist, int bw, int max_skip, int min_cnt, int min_sc, int
 		k += n;
 	}
 	memcpy(u, u2, n_u * 8);
-	kfree(km, b); kfree(km, w); kfree(km, u2);
+	memcpy(b, a, k * sizeof(mm128_t)); // write _a_ to _b_ and deallocate _a_ because _a_ is oversized, sometimes a lot
-	return n_u;
+	kfree(km, a); kfree(km, w); kfree(km, u2);
+	return b;
 }

cookbook.md

@@ -0,0 +1,243 @@
+## Table of Contents
+
+- [Introduction & Installation](#intro)
+- [Mapping Genomic Reads](#map-reads)
+  * [Mapping long reads](#map-pb)
+  * [Mapping Illumina paired-end reads](#map-sr)
+  * [Evaluating mapping accuracy with simulated reads (for developers)](#mapeval)
+- [Mapping Long RNA-seq Reads](#map-rna)
+  * [Mapping Nanopore 2D cDNA reads](#map-ont-cdna-2d)
+  * [Mapping Nanopore direct-RNA reads](#map-direct-rna)
+  * [Mapping PacBio Iso-seq reads](#map-iso-seq)
+- [Full-Genome Alignment](#genome-aln)
+  * [Intra-species assembly alignment](#asm-to-ref)
+  * [Cross-species full-genome alignment](#x-species)
+  * [Eyeballing alignment](#view-aln)
+  * [Calling variants from assembly-to-reference alignment](#asm-var)
+  * [Constructing self-homology map](#hom-map)
+  * [Lift Over (for developers)](#liftover)
+- [Read Overlap](#read-overlap)
+  * [Long-read overlap](#long-read-overlap)
+  * [Evaluating overlap sensitivity (for developers)](#ov-eval)
+
+## <a name="intro"></a>Introduction & Installation
+
+This cookbook walks you through a variety of applications of minimap2 and its
+companion script `paftools.js`. All data here are freely available from the
+minimap2 release page at version tag [v2.11][v2.11]. Some examples only work
+with v2.11 or later.
+
+To acquire the data used in this cookbook and to install minimap2 and paftools,
+please follow the command lines below:
+```sh
+# install minimap2 executables
+curl -L https://github.com/lh3/minimap2/releases/download/v2.11/minimap2-2.11_x64-linux.tar.bz2 | tar jxf -
+cp minimap2-2.11_x64-linux/{minimap2,k8,paftools.js} .  # copy executables
+export PATH="$PATH:"`pwd`                               # put the current directory on PATH
+# download example datasets
+curl -L https://github.com/lh3/minimap2/releases/download/v2.11/cookbook-data.tgz | tar zxf -
+```
+
+## <a name="map-reads"></a>Mapping Genomic Reads
+
+### <a name="map-pb"></a>Mapping long reads
+```sh
+minimap2 -ax map-pb -t4 ecoli_ref.fa ecoli_p6_25x_canu.fa > mapped.sam
+```
+Alternatively, you can create a minimap2 index first and then map:
+```sh
+minimap2 -x map-pb -d ecoli-pb.mmi ecoli_ref.fa                      # create an index
+minimap2 -ax map-pb ecoli-pb.mmi ecoli_p6_25x_canu.fa > mapped.sam
+```
+This will save you a couple of minutes when you map against the human genome.
+**HOWEVER**, key algorithm parameters such as the k-mer length and window
+size can't be changed after indexing. Minimap2 will give you a warning if
+parameters used in a pre-built index doesn't match parameters on the command
+line. **Please always make sure you are using an intended pre-built index.**
+
+### <a name="map-sr"></a>Mapping Illumina paired-end reads:
+```sh
+minimap2 -ax sr -t4 ecoli_ref.fa ecoli_mason_1.fq ecoli_mason_2.fq > mapped-sr.sam
+```
+
+### <a name="mapeval"></a>Evaluating mapping accuracy with simulated reads (for developers)
+```sh
+minimap2 -ax sr ecoli_ref.fa ecoli_mason_1.fq ecoli_mason_2.fq | paftools.js mapeval -
+```
+The output is:
+```
+Q       60      19712   0       0.000000000     19712
+Q       0       282     219     0.010953286     19994
+U       6
+```
+where a `U`-line gives the number of unmapped reads (for SAM input only); a
+`Q`-line gives:
+
+1. Mapping quality (mapQ) threshold
+2. Number of mapped reads between this threshold and the previous mapQ threshold.
+3. Number of wrong mappings in the same mapQ interval
+4. Accumulative mapping error rate
+5. Accumulative number of mappings
+
+For `paftools.js mapeval` to work, you need to encode the true read positions
+in read names in the right format. For [PBSIM][pbsim] and [mason2][mason2], we
+provide scripts to generate the right format. Simulated reads in this cookbook
+were created with the following command lines:
+```sh
+# in PBSIM source code directory:
+src/pbsim ../ecoli_ref.fa --depth 1 --sample-fastq sample/sample.fastq
+paftools.js pbsim2fq ../ecoli_ref.fa.fai sd_0001.maf > ../ecoli_pbsim.fa
+
+# mason2 simulation
+mason_simulator --illumina-prob-mismatch-scale 2.5 -ir ecoli_ref.fa -n 10000 -o tmp-l.fq -or tmp-r.fq -oa tmp.sam
+paftools.js mason2fq tmp.sam | seqtk seq -1 > ecoli_mason_1.fq
+paftools.js mason2fq tmp.sam | seqtk seq -2 > ecoli_mason_2.fq
+```
+
+
+
+## <a name="map-rna"></a>Mapping Long RNA-seq Reads
+
+### <a name="map-ont-cdna-2d"></a>Mapping Nanopore 2D cDNA reads
+```sh
+minimap2 -ax splice SIRV_E2.fa SIRV_ont-cdna.fa > aln.sam
+```
+You can compare the alignment to the true annotations with:
+```sh
+paftools.js junceval SIRV_E2C.gtf aln.sam
+```
+It gives the percentage of introns found in the annotation. For SIRV data, it
+is possible to achieve higher junction accuracy with
+```sh
+minimap2 -ax splice --splice-flank=no SIRV_E2.fa SIRV_ont-cdna.fa | paftools.js junceval SIRV_E2C.gtf
+```
+This is because minimap2 models one additional evolutionarily conserved base
+around a canonical junction, but SIRV doesn't honor this signal. Option
+`--splice-flank=no` asks minimap2 no to model this additional base.
+
+In the output a tag `ts:A:+` indicates that the read strand is the same as the
+transcript strand; `ts:A:-` indicates the read strand is opposite to the
+transcript strand. This tag is inferred from the GT-AG signal and is thus only
+available to spliced reads.
+
+### <a name="map-direct-rna"></a>Mapping Nanopore direct-RNA reads
+```sh
+minimap2 -ax splice -k14 -uf SIRV_E2.fa SIRV_ont-drna.fa > aln.sam
+```
+Direct-RNA reads are noisier, so we use a shorter k-mer for improved
+sensitivity. Here, option `-uf` forces minimap2 to map reads to the forward
+transcript strand only because direct-RNA reads are stranded. Again, applying
+`--splice-flank=no` helps junction accuracy for SIRV data.
+
+### <a name="map-iso-seq"></a>Mapping PacBio Iso-seq reads
+```sh
+minimap2 -ax splice -uf -C5 SIRV_E2.fa SIRV_iso-seq.fq > aln.sam
+```
+Option `-C5` reduces the penalty on non-canonical splicing sites. It helps
+to align such sites correctly for data with low error rate such as Iso-seq
+reads and traditional cDNAs. On this example, minimap2 makes one junction
+error. Applying `--splice-flank=no` fixes this alignment error.
+
+Note that the command line above is optimized for the final Iso-seq reads.
+PacBio's Iso-seq pipeline produces intermediate sequences at varying quality.
+For example, some intermediate reads are not stranded. For these reads, option
+`-uf` will lead to more errors. Please revise the minimap2 command line
+accordingly.
+
+
+
+## <a name="genome-aln"></a>Full-Genome Alignment
+
+### <a name="asm-to-ref"></a>Intra-species assembly alignment
+```sh
+# option "--cs" is recommended as paftools.js may need it
+minimap2 -cx asm5 --cs ecoli_ref.fa ecoli_canu.fa > ecoli_canu.paf
+```
+Here `ecoli_canu.fa` is the Canu assembly of `ecoli_p6_25x_canu.fa`. This
+command line outputs alignments in the [PAF format][paf]. Use `-a` instead of
+`-c` to get output in the SAM format.
+
+### <a name="x-species"></a>Cross-species full-genome alignment
+```sh
+minimap2 -cx asm20 --cs ecoli_ref.fa ecoli_O104:H4.fa > ecoli_O104:H4.paf
+sort -k6,6 -k8,8n ecoli_O104:H4.paf | paftools.js call -f ecoli_ref.fa -L10000 -l1000 - > out.vcf
+```
+Minimap2 has three presets for full-genome alignment: "asm5" for sequence
+divergence below 1%, "asm10" for divergence around a couple of percent and
+"asm20" for divergence not more than 10%. In theory, with the right setting,
+minimap2 should work for sequence pairs with sequence divergence up to ~15%,
+but this has not been carefully evaluated.
+
+### <a name="view-aln"></a>Eyeballing alignment
+```sh
+# option "--cs" required; minimap2-r741 or higher required for the "asm20" preset
+minimap2 -cx asm20 --cs ecoli_ref.fa ecoli_O104:H4.fa | paftools.js view - | less -S
+```
+This prints the alignment in a BLAST-like format.
+
+### <a name="asm-var"></a>Calling variants from assembly-to-reference alignment
+```sh
+# don't forget the "--cs" option; otherwise it doesn't work
+minimap2 -cx asm5 --cs ecoli_ref.fa ecoli_canu.fa \
+  | sort -k6,6 -k8,8n \
+  | paftools.js call -f ecoli_ref.fa - > out.vcf
+```
+Without option `-f`, `paftools.js call` outputs in a custom format. In this
+format, lines starting with `R` give the regions covered by one contig only.
+This information is not available in the VCF output.
+
+### <a name="hom-map"></a>Constructing self-homology map
+```sh
+minimap2 -DP -k19 -w19 -m200 ecoli_ref.fa ecoli_ref.fa > out.paf
+```
+Option `-D` asks minimap2 to ignore anchors from perfect self match and `-P`
+outputs all chains. For large nomes, we don't recommend to perform base-level
+alignment (with `-c`, `-a` or `--cs`) when `-P` is applied. This is because
+base-alignment is slow and occasionally gives wrong alignments close to the
+diagonal of a dotter plot. For E. coli, though, base-alignment is still fast.
+
+### <a name="liftover"></a>Lift over (for developers)
+```sh
+minimap2 -cx asm5 --cs ecoli_ref.fa ecoli_canu.fa > ecoli_canu.paf
+echo -e 'tig00000001\t200000\t300000' | paftools.js liftover ecoli_canu.paf -
+```
+This lifts over a region on query sequences to one or multiple regions on
+reference sequences. Note that this paftools.js command may not be efficient
+enough to lift millions of regions.
+
+
+
+## <a name="read-overlap"></a>Read Overlap
+
+### <a name="long-read-overlap"></a>Long read overlap
+```sh
+# For pacbio reads:
+minimap2 -x ava-pb ecoli_p6_25x_canu.fa ecoli_p6_25x_canu.fa > overlap.paf
+# For Nanopore reads (ava-ont also works with PacBio but not as good):
+minimap2 -x ava-ont -r 10000 ecoli_p6_25x_canu.fa ecoli_p6_25x_canu.fa > overlap.paf
+# If you have miniasm installed:
+miniasm -f ecoli_p6_25x_canu.fa overlap.paf > asm.gfa
+```
+Here we explicitly applied `-r 10000`. We are considering to set this as the
+default for the `ava-ont` mode as this seems to improve the contiguity for
+nanopore read assembly (Loman, personal communication).
+
+*Minimap2 doesn't work well with short-read overlap.*
+
+### <a name="ov-eval"></a>Evaluating overlap sensitivity (for developers)
+
+```sh
+# read to reference mapping
+minimap2 -cx map-pb ecoli_ref.fa ecoli_p6_25x_canu.fa > to-ref.paf
+# evaluate overlap sensitivity
+sort -k6,6 -k8,8n to-ref.paf | paftools.js ov-eval - overlap.paf
+```
+You can see that for PacBio reads, minimap2 achieves higher overlap sensitivity
+with `-x ava-pb` (99% vs 93% with `-x ava-ont`).
+
+
+
+[pbsim]: https://github.com/pfaucon/PBSIM-PacBio-Simulator
+[mason2]: https://github.com/seqan/seqan/tree/master/apps/mason2
+[paf]: https://github.com/lh3/miniasm/blob/master/PAF.md
+[v2.11]: https://github.com/lh3/minimap2/releases/tag/v2.11

esterr.c

@@ -0,0 +1,64 @@
+#include <math.h>
+#include <stdio.h>
+#include <stdlib.h>
+#include <assert.h>
+#include "mmpriv.h"
+
+static inline int32_t get_for_qpos(int32_t qlen, const mm128_t *a)
+{
+	int32_t x = (int32_t)a->y;
+	int32_t q_span = a->y>>32 & 0xff;
+	if (a->x>>63)
+		x = qlen - 1 - (x + 1 - q_span); // revert the position to the forward strand of query
+	return x;
+}
+
+static int get_mini_idx(int qlen, const mm128_t *a, int32_t n, const uint64_t *mini_pos)
+{
+	int32_t x, L = 0, R = n - 1;
+	x = get_for_qpos(qlen, a);
+	while (L <= R) { // binary search
+		int32_t m = ((uint64_t)L + R) >> 1;
+		int32_t y = (int32_t)mini_pos[m];
+		if (y < x) L = m + 1;
+		else if (y > x) R = m - 1;
+		else return m;
+	}
+	return -1;
+}
+
+void mm_est_err(const mm_idx_t *mi, int qlen, int n_regs, mm_reg1_t *regs, const mm128_t *a, int32_t n, const uint64_t *mini_pos)
+{
+	int i;
+	uint64_t sum_k = 0;
+	float avg_k;
+
+	if (n == 0) return;
+	for (i = 0; i < n; ++i)
+		sum_k += mini_pos[i] >> 32 & 0xff;
+	avg_k = (float)sum_k / n;
+
+	for (i = 0; i < n_regs; ++i) {
+		mm_reg1_t *r = &regs[i];
+		int32_t st, en, j, k, n_match, n_tot, l_ref;
+		r->div = -1.0f;
+		if (r->cnt == 0) continue;
+		st = en = get_mini_idx(qlen, r->rev? &a[r->as + r->cnt - 1] : &a[r->as], n, mini_pos);
+		if (st < 0) {
+			if (mm_verbose >= 2)
+				fprintf(stderr, "[WARNING] logic inconsistency in mm_est_err(). Please contact the developer.\n");
+			continue;
+		}
+		l_ref = mi->seq[r->rid].len;
+		for (k = 1, j = st + 1, n_match = 1; j < n && k < r->cnt; ++j) {
+			int32_t x;
+			x = get_for_qpos(qlen, r->rev? &a[r->as + r->cnt - 1 - k] : &a[r->as + k]);
+			if (x == (int32_t)mini_pos[j])
+				++k, en = j, ++n_match;
+		}
+		n_tot = en - st + 1;
+		if (r->qs > avg_k && r->rs > avg_k) ++n_tot;
+		if (qlen - r->qs > avg_k && l_ref - r->re > avg_k) ++n_tot;
+		r->div = logf((float)n_tot / n_match) / avg_k;
+	}
+}

example.c

@@ -11,7 +11,13 @@ KSEQ_INIT(gzFile, gzread)
 
 int main(int argc, char *argv[])
 {
+	mm_idxopt_t iopt;
+	mm_mapopt_t mopt;
+	int n_threads = 3;
+
 	mm_verbose = 2; // disable message output to stderr
+	mm_set_opt(0, &iopt, &mopt);
+	mopt.flag |= MM_F_CIGAR; // perform alignment
 
 	if (argc < 3) {
 		fprintf(stderr, "Usage: minimap2-lite <target.fa> <query.fa>\n");
@@ -23,39 +29,33 @@ int main(int argc, char *argv[])
 	assert(f);
 	kseq_t *ks = kseq_init(f);
 
-	// create index for target; we are creating one index for all target sequence
+	// open index reader
-	int n_threads = 4, w = 10, k = 15, is_hpc = 0;
+	mm_idx_reader_t *r = mm_idx_reader_open(argv[1], &iopt, 0);
-	mm_idx_t *mi = mm_idx_build(argv[1], w, k, is_hpc, n_threads);
+	mm_idx_t *mi;
-	assert(mi);
+	while ((mi = mm_idx_reader_read(r, n_threads)) != 0) { // traverse each part of the index
-
+		mm_mapopt_update(&mopt, mi); // this sets the maximum minimizer occurrence; TODO: set a better default in mm_mapopt_init()!
-	// mapping
-	mm_mapopt_t opt;
-	mm_mapopt_init(&opt); // initialize mapping parameters
-	mm_mapopt_update(&opt, mi); // this sets the maximum minimizer occurrence; TODO: set a better default in mm_mapopt_init()!
-	opt.flag |= MM_F_CIGAR; // perform alignment
 		mm_tbuf_t *tbuf = mm_tbuf_init(); // thread buffer; for multi-threading, allocate one tbuf for each thread
 		while (kseq_read(ks) >= 0) { // each kseq_read() call reads one query sequence
-		const mm_reg1_t *reg;
+			mm_reg1_t *reg;
 			int j, i, n_reg;
-		// get all hits for the query
+			reg = mm_map(mi, ks->seq.l, ks->seq.s, &n_reg, tbuf, &mopt, 0); // get all hits for the query
-		reg = mm_map(mi, ks->seq.l, ks->seq.s, &n_reg, tbuf, &opt, 0);
+			for (j = 0; j < n_reg; ++j) { // traverse hits and print them out
-		// traverse hits and print them out
+				mm_reg1_t *r = &reg[j];
-		for (j = 0; j < n_reg; ++j) {
-			const mm_reg1_t *r = &reg[j];
 				assert(r->p); // with MM_F_CIGAR, this should not be NULL
 				printf("%s\t%d\t%d\t%d\t%c\t", ks->name.s, ks->seq.l, r->qs, r->qe, "+-"[r->rev]);
-			printf("%s\t%d\t%d\t%d\t%d\t%d\t%d\tcg:Z:", mi->seq[r->rid].name, mi->seq[r->rid].len, r->rs, r->re,
+				printf("%s\t%d\t%d\t%d\t%d\t%d\t%d\tcg:Z:", mi->seq[r->rid].name, mi->seq[r->rid].len, r->rs, r->re, r->mlen, r->blen, r->mapq);
-				   r->p->blen - r->p->n_ambi - r->p->n_diff, r->p->blen, r->mapq);
 				for (i = 0; i < r->p->n_cigar; ++i) // IMPORTANT: this gives the CIGAR in the aligned regions. NO soft/hard clippings!
 					printf("%d%c", r->p->cigar[i]>>4, "MIDSHN"[r->p->cigar[i]&0xf]);
 				putchar('\n');
+				free(r->p);
 			}
+			free(reg);
 		}
 		mm_tbuf_destroy(tbuf);
-
-	// deallocate index and close the query file
 		mm_idx_destroy(mi);
-	kseq_destroy(ks);
+	}
+	mm_idx_reader_close(r); // close the index reader
+	kseq_destroy(ks); // close the query file
 	gzclose(f);
 	return 0;
 }

format.c

@@ -1,9 +1,13 @@
 #include <stdarg.h>
 #include <stdlib.h>
 #include <string.h>
+#include <assert.h>
 #include <stdio.h>
+#include "kalloc.h"
 #include "mmpriv.h"
 
+static char mm_rg_id[256];
+
 static inline void str_enlarge(kstring_t *s, int l)
 {
 	if (s->l + l + 1 > s->m) {
@@ -39,6 +43,13 @@ static void mm_sprintf_lite(kstring_t *s, const char *fmt, ...)
 				if (c < 0) buf[l++] = '-';
 				str_enlarge(s, l);
 				for (i = l - 1; i >= 0; --i) s->s[s->l++] = buf[i];
+			} else if (*p == 'u') {
+				int i, l = 0;
+				uint32_t x;
+				x = va_arg(ap, uint32_t);
+				do { buf[l++] = x%10 + '0'; x /= 10; } while (x > 0);
+				str_enlarge(s, l);
+				for (i = l - 1; i >= 0; --i) s->s[s->l++] = buf[i];
 			} else if (*p == 's') {
 				char *r = va_arg(ap, char*);
 				str_copy(s, r, r + strlen(r));
@@ -54,83 +65,372 @@ static void mm_sprintf_lite(kstring_t *s, const char *fmt, ...)
 	s->s[s->l] = 0;
 }
 
-static inline void write_tags(kstring_t *s, const mm_reg1_t *r)
+static char *mm_escape(char *s)
 {
-	mm_sprintf_lite(s, "\tcm:i:%d\ts1:i:%d", r->cnt, r->score);
+	char *p, *q;
-	if (r->parent == r->id) mm_sprintf_lite(s, "\ts2:i:%d", r->subsc);
+	for (p = q = s; *p; ++p) {
-	if (r->split) mm_sprintf_lite(s, "\tzd:i:%d", r->split);
+		if (*p == '\\') {
-	if (r->p) mm_sprintf_lite(s, "\tNM:i:%d\tms:i:%d\tAS:i:%d\tnn:i:%d", r->p->n_diff, r->p->dp_max, r->p->dp_score, r->p->n_ambi);
+			++p;
+			if (*p == 't') *q++ = '\t';
+			else if (*p == '\\') *q++ = '\\';
+		} else *q++ = *p;
+	}
+	*q = '\0';
+	return s;
 }
 
-void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r)
+static void sam_write_rg_line(kstring_t *str, const char *s)
+{
+	char *p, *q, *r, *rg_line = 0;
+	memset(mm_rg_id, 0, 256);
+	if (s == 0) return;
+	if (strstr(s, "@RG") != s) {
+		if (mm_verbose >= 1) fprintf(stderr, "[ERROR] the read group line is not started with @RG\n");
+		goto err_set_rg;
+	}
+	if (strstr(s, "\t") != NULL) {
+		if (mm_verbose >= 1) fprintf(stderr, "[ERROR] the read group line contained literal <tab> characters -- replace with escaped tabs: \\t\n");
+		goto err_set_rg;
+	}
+	rg_line = strdup(s);
+	mm_escape(rg_line);
+	if ((p = strstr(rg_line, "\tID:")) == 0) {
+		if (mm_verbose >= 1) fprintf(stderr, "[ERROR] no ID within the read group line\n");
+		goto err_set_rg;
+	}
+	p += 4;
+	for (q = p; *q && *q != '\t' && *q != '\n'; ++q);
+	if (q - p + 1 > 256) {
+		if (mm_verbose >= 1) fprintf(stderr, "[ERROR] @RG:ID is longer than 255 characters\n");
+		goto err_set_rg;
+	}
+	for (q = p, r = mm_rg_id; *q && *q != '\t' && *q != '\n'; ++q)
+		*r++ = *q;
+	mm_sprintf_lite(str, "%s\n", rg_line);
+
+err_set_rg:
+	free(rg_line);
+}
+
+void mm_write_sam_hdr(const mm_idx_t *idx, const char *rg, const char *ver, int argc, char *argv[])
+{
+	kstring_t str = {0,0,0};
+	if (idx) {
+		uint32_t i;
+		for (i = 0; i < idx->n_seq; ++i)
+			mm_sprintf_lite(&str, "@SQ\tSN:%s\tLN:%d\n", idx->seq[i].name, idx->seq[i].len);
+	}
+	if (rg) sam_write_rg_line(&str, rg);
+	mm_sprintf_lite(&str, "@PG\tID:minimap2\tPN:minimap2");
+	if (ver) mm_sprintf_lite(&str, "\tVN:%s", ver);
+	if (argc > 1) {
+		int i;
+		mm_sprintf_lite(&str, "\tCL:minimap2");
+		for (i = 1; i < argc; ++i)
+			mm_sprintf_lite(&str, " %s", argv[i]);
+	}
+	mm_err_puts(str.s);
+	free(str.s);
+}
+
+static void write_cs_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq, const mm_reg1_t *r, char *tmp, int no_iden)
+{
+	int i, q_off, t_off;
+	mm_sprintf_lite(s, "\tcs:Z:");
+	for (i = q_off = t_off = 0; i < (int)r->p->n_cigar; ++i) {
+		int j, op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
+		assert(op >= 0 && op <= 3);
+		if (op == 0) { // match
+			int l_tmp = 0;
+			for (j = 0; j < len; ++j) {
+				if (qseq[q_off + j] != tseq[t_off + j]) {
+					if (l_tmp > 0) {
+						if (!no_iden) {
+							tmp[l_tmp] = 0;
+							mm_sprintf_lite(s, "=%s", tmp);
+						} else mm_sprintf_lite(s, ":%d", l_tmp);
+						l_tmp = 0;
+					}
+					mm_sprintf_lite(s, "*%c%c", "acgtn"[tseq[t_off + j]], "acgtn"[qseq[q_off + j]]);
+				} else tmp[l_tmp++] = "ACGTN"[qseq[q_off + j]];
+			}
+			if (l_tmp > 0) {
+				if (!no_iden) {
+					tmp[l_tmp] = 0;
+					mm_sprintf_lite(s, "=%s", tmp);
+				} else mm_sprintf_lite(s, ":%d", l_tmp);
+			}
+			q_off += len, t_off += len;
+		} else if (op == 1) { // insertion to ref
+			for (j = 0, tmp[len] = 0; j < len; ++j)
+				tmp[j] = "acgtn"[qseq[q_off + j]];
+			mm_sprintf_lite(s, "+%s", tmp);
+			q_off += len;
+		} else if (op == 2) { // deletion from ref
+			for (j = 0, tmp[len] = 0; j < len; ++j)
+				tmp[j] = "acgtn"[tseq[t_off + j]];
+			mm_sprintf_lite(s, "-%s", tmp);
+			t_off += len;
+		} else { // intron
+			assert(len >= 2);
+			mm_sprintf_lite(s, "~%c%c%d%c%c", "acgtn"[tseq[t_off]], "acgtn"[tseq[t_off+1]],
+				len, "acgtn"[tseq[t_off+len-2]], "acgtn"[tseq[t_off+len-1]]);
+			t_off += len;
+		}
+	}
+	assert(t_off == r->re - r->rs && q_off == r->qe - r->qs);
+}
+
+static void write_MD_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq, const mm_reg1_t *r, char *tmp)
+{
+	int i, q_off, t_off, l_MD = 0;
+	mm_sprintf_lite(s, "\tMD:Z:");
+	for (i = q_off = t_off = 0; i < (int)r->p->n_cigar; ++i) {
+		int j, op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
+		assert(op >= 0 && op <= 2); // introns (aka reference skips) are not supported
+		if (op == 0) { // match
+			for (j = 0; j < len; ++j) {
+				if (qseq[q_off + j] != tseq[t_off + j]) {
+					mm_sprintf_lite(s, "%d%c", l_MD, "ACGTN"[tseq[t_off + j]]);
+					l_MD = 0;
+				} else ++l_MD;
+			}
+			q_off += len, t_off += len;
+		} else if (op == 1) { // insertion to ref
+			q_off += len;
+		} else if (op == 2) { // deletion from ref
+			for (j = 0, tmp[len] = 0; j < len; ++j)
+				tmp[j] = "ACGTN"[tseq[t_off + j]];
+			mm_sprintf_lite(s, "%d^%s", l_MD, tmp);
+			l_MD = 0;
+			t_off += len;
+		}
+	}
+	if (l_MD > 0) mm_sprintf_lite(s, "%d", l_MD);
+	assert(t_off == r->re - r->rs && q_off == r->qe - r->qs);
+}
+
+static void write_cs_or_MD(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int no_iden, int is_MD)
+{
+	extern unsigned char seq_nt4_table[256];
+	int i;
+	uint8_t *qseq, *tseq;
+	char *tmp;
+	if (r->p == 0) return;
+	qseq = (uint8_t*)kmalloc(km, r->qe - r->qs);
+	tseq = (uint8_t*)kmalloc(km, r->re - r->rs);
+	tmp = (char*)kmalloc(km, r->re - r->rs > r->qe - r->qs? r->re - r->rs + 1 : r->qe - r->qs + 1);
+	mm_idx_getseq(mi, r->rid, r->rs, r->re, tseq);
+	if (!r->rev) {
+		for (i = r->qs; i < r->qe; ++i)
+			qseq[i - r->qs] = seq_nt4_table[(uint8_t)t->seq[i]];
+	} else {
+		for (i = r->qs; i < r->qe; ++i) {
+			uint8_t c = seq_nt4_table[(uint8_t)t->seq[i]];
+			qseq[r->qe - i - 1] = c >= 4? 4 : 3 - c;
+		}
+	}
+	if (is_MD) write_MD_core(s, tseq, qseq, r, tmp);
+	else write_cs_core(s, tseq, qseq, r, tmp, no_iden);
+	kfree(km, qseq); kfree(km, tseq); kfree(km, tmp);
+}
+
+static inline void write_tags(kstring_t *s, const mm_reg1_t *r)
+{
+	int type;
+	if (r->id == r->parent) type = r->inv? 'I' : 'P';
+	else type = r->inv? 'i' : 'S';
+	if (r->p) {
+		mm_sprintf_lite(s, "\tNM:i:%d\tms:i:%d\tAS:i:%d\tnn:i:%d", r->blen - r->mlen + r->p->n_ambi, r->p->dp_max, r->p->dp_score, r->p->n_ambi);
+		if (r->p->trans_strand == 1 || r->p->trans_strand == 2)
+			mm_sprintf_lite(s, "\tts:A:%c", "?+-?"[r->p->trans_strand]);
+	}
+	mm_sprintf_lite(s, "\ttp:A:%c\tcm:i:%d\ts1:i:%d", type, r->cnt, r->score);
+	if (r->parent == r->id) mm_sprintf_lite(s, "\ts2:i:%d", r->subsc);
+	if (r->div >= 0.0f && r->div <= 1.0f) {
+		char buf[8];
+		if (r->div == 0.0f) buf[0] = '0', buf[1] = 0;
+		else sprintf(buf, "%.4f", r->div);
+		mm_sprintf_lite(s, "\tdv:f:%s", buf);
+	}
+	if (r->split) mm_sprintf_lite(s, "\tzd:i:%d", r->split);
+}
+
+void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int opt_flag)
 {
 	s->l = 0;
+	if (r == 0) {
+		mm_sprintf_lite(s, "%s\t%d", t->name, t->l_seq);
+		return;
+	}
 	mm_sprintf_lite(s, "%s\t%d\t%d\t%d\t%c\t", t->name, t->l_seq, r->qs, r->qe, "+-"[r->rev]);
 	if (mi->seq[r->rid].name) mm_sprintf_lite(s, "%s", mi->seq[r->rid].name);
 	else mm_sprintf_lite(s, "%d", r->rid);
 	mm_sprintf_lite(s, "\t%d\t%d\t%d", mi->seq[r->rid].len, r->rs, r->re);
-	if (r->p) mm_sprintf_lite(s, "\t%d\t%d", r->p->blen - r->p->n_ambi - r->p->n_diff, r->p->blen);
+	mm_sprintf_lite(s, "\t%d\t%d", r->mlen, r->blen);
-	else mm_sprintf_lite(s, "\t%d\t%d", r->fuzzy_mlen, r->fuzzy_blen);
 	mm_sprintf_lite(s, "\t%d", r->mapq);
 	write_tags(s, r);
-	if (r->p) {
+	if (r->p && (opt_flag & MM_F_OUT_CG)) {
 		uint32_t k;
 		mm_sprintf_lite(s, "\tcg:Z:");
 		for (k = 0; k < r->p->n_cigar; ++k)
-			mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MID"[r->p->cigar[k]&0xf]);
+			mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDNSHP=XB"[r->p->cigar[k]&0xf]);
 	}
+	if (r->p && (opt_flag & (MM_F_OUT_CS|MM_F_OUT_MD)))
+		write_cs_or_MD(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG), opt_flag&MM_F_OUT_MD);
+	if ((opt_flag & MM_F_COPY_COMMENT) && t->comment)
+		mm_sprintf_lite(s, "\t%s", t->comment);
 }
 
-static char comp_tab[] = {
-	  0,   1,	2,	 3,	  4,   5,	6,	 7,	  8,   9,  10,	11,	 12,  13,  14,	15,
-	 16,  17,  18,	19,	 20,  21,  22,	23,	 24,  25,  26,	27,	 28,  29,  30,	31,
-	 32,  33,  34,	35,	 36,  37,  38,	39,	 40,  41,  42,	43,	 44,  45,  46,	47,
-	 48,  49,  50,	51,	 52,  53,  54,	55,	 56,  57,  58,	59,	 60,  61,  62,	63,
-	 64, 'T', 'V', 'G', 'H', 'E', 'F', 'C', 'D', 'I', 'J', 'M', 'L', 'K', 'N', 'O',
-	'P', 'Q', 'Y', 'S', 'A', 'A', 'B', 'W', 'X', 'R', 'Z',	91,	 92,  93,  94,	95,
-	 64, 't', 'v', 'g', 'h', 'e', 'f', 'c', 'd', 'i', 'j', 'm', 'l', 'k', 'n', 'o',
-	'p', 'q', 'y', 's', 'a', 'a', 'b', 'w', 'x', 'r', 'z', 123, 124, 125, 126, 127
-};
-
 static void sam_write_sq(kstring_t *s, char *seq, int l, int rev, int comp)
 {
+	extern unsigned char seq_comp_table[256];
 	if (rev) {
 		int i;
 		str_enlarge(s, l);
 		for (i = 0; i < l; ++i) {
 			int c = seq[l - 1 - i];
-			s->s[s->l + i] = c < 128 && comp? comp_tab[c] : c;
+			s->s[s->l + i] = c < 128 && comp? seq_comp_table[c] : c;
 		}
 		s->l += l;
 	} else str_copy(s, seq, seq + l);
 }
 
-void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r)
+static inline const mm_reg1_t *get_sam_pri(int n_regs, const mm_reg1_t *regs)
 {
-	int flag = 0;
+	int i;
+	for (i = 0; i < n_regs; ++i)
+		if (regs[i].sam_pri)
+			return &regs[i];
+	assert(n_regs == 0);
+	return NULL;
+}
+
+static void write_sam_cigar(kstring_t *s, int sam_flag, int in_tag, int qlen, const mm_reg1_t *r, int opt_flag)
+{
+	if (r->p == 0) {
+		mm_sprintf_lite(s, "*");
+	} else {
+		uint32_t k, clip_len[2];
+		clip_len[0] = r->rev? qlen - r->qe : r->qs;
+		clip_len[1] = r->rev? r->qs : qlen - r->qe;
+		if (in_tag) {
+			int clip_char = (sam_flag&0x800) && !(opt_flag&MM_F_SOFTCLIP)? 5 : 4;
+			mm_sprintf_lite(s, "\tCG:B:I");
+			if (clip_len[0]) mm_sprintf_lite(s, ",%u", clip_len[0]<<4|clip_char);
+			for (k = 0; k < r->p->n_cigar; ++k)
+				mm_sprintf_lite(s, ",%u", r->p->cigar[k]);
+			if (clip_len[1]) mm_sprintf_lite(s, ",%u", clip_len[1]<<4|clip_char);
+		} else {
+			int clip_char = (sam_flag&0x800) && !(opt_flag&MM_F_SOFTCLIP)? 'H' : 'S';
+			if (clip_len[0]) mm_sprintf_lite(s, "%d%c", clip_len[0], clip_char);
+			for (k = 0; k < r->p->n_cigar; ++k)
+				mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDNSHP=XB"[r->p->cigar[k]&0xf]);
+			if (clip_len[1]) mm_sprintf_lite(s, "%d%c", clip_len[1], clip_char);
+		}
+	}
+}
+
+void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regss, const mm_reg1_t *const* regss, void *km, int opt_flag)
+{
+	const int max_bam_cigar_op = 65535;
+	int flag, n_regs = n_regss[seg_idx], cigar_in_tag = 0;
+	int this_rid = -1, this_pos = -1, this_rev = 0;
+	const mm_reg1_t *regs = regss[seg_idx], *r_prev = NULL, *r_next;
+	const mm_reg1_t *r = n_regs > 0 && reg_idx < n_regs && reg_idx >= 0? &regs[reg_idx] : NULL;
+
+	// find the primary of the previous and the next segments, if they are mapped
+	if (n_seg > 1) {
+		int i, next_sid = (seg_idx + 1) % n_seg;
+		r_next = get_sam_pri(n_regss[next_sid], regss[next_sid]);
+		if (n_seg > 2) {
+			for (i = 1; i <= n_seg - 1; ++i) {
+				int prev_sid = (seg_idx + n_seg - i) % n_seg;
+				if (n_regss[prev_sid] > 0) {
+					r_prev = get_sam_pri(n_regss[prev_sid], regss[prev_sid]);
+					break;
+				}
+			}
+		} else r_prev = r_next;
+	} else r_prev = r_next = NULL;
+
+	// write QNAME
 	s->l = 0;
+	mm_sprintf_lite(s, "%s", t->name);
+	if (n_seg > 1) s->l = mm_qname_len(t->name); // trim the suffix like /1 or /2
+
+	// write flag
+	flag = n_seg > 1? 0x1 : 0x0;
+	if (r == 0) {
+		flag |= 0x4;
+	} else {
+		if (r->rev) flag |= 0x10;
+		if (r->parent != r->id) flag |= 0x100;
+		else if (!r->sam_pri) flag |= 0x800;
+	}
+	if (n_seg > 1) {
+		if (r && r->proper_frag) flag |= 0x2; // TODO: this doesn't work when there are more than 2 segments
+		if (seg_idx == 0) flag |= 0x40;
+		else if (seg_idx == n_seg - 1) flag |= 0x80;
+		if (r_next == NULL) flag |= 0x8;
+		else if (r_next->rev) flag |= 0x20;
+	}
+	mm_sprintf_lite(s, "\t%d", flag);
+
+	// write coordinate, MAPQ and CIGAR
+	if (r == 0) {
+		if (r_prev) {
+			this_rid = r_prev->rid, this_pos = r_prev->rs;
+			mm_sprintf_lite(s, "\t%s\t%d\t0\t*", mi->seq[this_rid].name, this_pos+1);
+		} else mm_sprintf_lite(s, "\t*\t0\t0\t*");
+	} else {
+		this_rid = r->rid, this_pos = r->rs, this_rev = r->rev;
+		mm_sprintf_lite(s, "\t%s\t%d\t%d\t", mi->seq[r->rid].name, r->rs+1, r->mapq);
+		if ((opt_flag & MM_F_LONG_CIGAR) && r->p && r->p->n_cigar > max_bam_cigar_op - 2) {
+			int n_cigar = r->p->n_cigar;
+			if (r->qs != 0) ++n_cigar;
+			if (r->qe != t->l_seq) ++n_cigar;
+			if (n_cigar > max_bam_cigar_op)
+				cigar_in_tag = 1;
+		}
+		if (cigar_in_tag) {
+			if (flag & 0x100) mm_sprintf_lite(s, "0S"); // secondary alignment
+			else if (flag & 0x800) mm_sprintf_lite(s, "%dS", r->re - r->rs); // supplementary alignment
+			else mm_sprintf_lite(s, "%dS", t->l_seq);
+		} else write_sam_cigar(s, flag, 0, t->l_seq, r, opt_flag);
+	}
+
+	// write mate positions
+	if (n_seg > 1) {
+		int tlen = 0;
+		if (this_rid >= 0 && r_next) {
+			if (this_rid == r_next->rid) {
+				int this_pos5 = r && r->rev? r->re - 1 : this_pos;
+				int next_pos5 = r_next->rev? r_next->re - 1 : r_next->rs;
+				tlen = next_pos5 - this_pos5;
+				mm_sprintf_lite(s, "\t=\t");
+			} else mm_sprintf_lite(s, "\t%s\t", mi->seq[r_next->rid].name);
+			mm_sprintf_lite(s, "%d\t", r_next->rs + 1);
+		} else if (r_next) { // && this_rid < 0
+			mm_sprintf_lite(s, "\t%s\t%d\t", mi->seq[r_next->rid].name, r_next->rs + 1);
+		} else if (this_rid >= 0) { // && r_next == NULL
+			int this_pos5 = this_rev? r->re - 1 : this_pos; // this_rev is only true when r != NULL
+			tlen = this_pos - this_pos5; // next_pos5 will be this_pos
+			mm_sprintf_lite(s, "\t=\t%d\t", this_pos + 1); // next segment will take r's coordinate
+		} else mm_sprintf_lite(s, "\t*\t0\t"); // neither has coordinates
+		if (tlen > 0) ++tlen;
+		else if (tlen < 0) --tlen;
+		mm_sprintf_lite(s, "%d\t", tlen);
+	} else mm_sprintf_lite(s, "\t*\t0\t0\t");
+
+	// write SEQ and QUAL
 	if (r == 0) {
-		mm_sprintf_lite(s, "%s\t4\t*\t0\t0\t*\t*\t0\t0\t", t->name);
 		sam_write_sq(s, t->seq, t->l_seq, 0, 0);
 		mm_sprintf_lite(s, "\t");
 		if (t->qual) sam_write_sq(s, t->qual, t->l_seq, 0, 0);
 		else mm_sprintf_lite(s, "*");
 	} else {
-		if (r->rev) flag |= 0x10;
+		if ((flag & 0x900) == 0 || (opt_flag & MM_F_SOFTCLIP)) {
-		if (r->parent != r->id) flag |= 0x100;
-		else if (!r->sam_pri) flag |= 0x800;
-		mm_sprintf_lite(s, "%s\t%d\t%s\t%d\t%d\t", t->name, flag, mi->seq[r->rid].name, r->rs+1, r->mapq);
-		if (r->p) { // TODO: using hard clippings
-			uint32_t k, clip_len = r->rev? t->l_seq - r->qe : r->qs;
-			int clip_char = (flag&0x800)? 'H' : 'S';
-			if (clip_len) mm_sprintf_lite(s, "%d%c", clip_len, clip_char);
-			for (k = 0; k < r->p->n_cigar; ++k)
-				mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MID"[r->p->cigar[k]&0xf]);
-			clip_len = r->rev? r->qs : t->l_seq - r->qe;
-			if (clip_len) mm_sprintf_lite(s, "%d%c", clip_len, clip_char);
-		} else mm_sprintf_lite(s, "*");
-		mm_sprintf_lite(s, "\t*\t0\t0\t");
-		if ((flag & 0x900) == 0) {
 			sam_write_sq(s, t->seq, t->l_seq, r->rev, r->rev);
 			mm_sprintf_lite(s, "\t");
 			if (t->qual) sam_write_sq(s, t->qual, t->l_seq, r->rev, 0);
@@ -143,7 +443,54 @@ void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const m
 			if (t->qual) sam_write_sq(s, t->qual + r->qs, r->qe - r->qs, r->rev, 0);
 			else mm_sprintf_lite(s, "*");
 		}
-		write_tags(s, r);
 	}
+
+	// write tags
+	if (mm_rg_id[0]) mm_sprintf_lite(s, "\tRG:Z:%s", mm_rg_id);
+	if (n_seg > 2) mm_sprintf_lite(s, "\tFI:i:%d", seg_idx);
+	if (r) {
+		write_tags(s, r);
+		if (r->parent == r->id && r->p && n_regs > 1 && regs && r >= regs && r - regs < n_regs) { // supplementary aln may exist
+			int i, n_sa = 0; // n_sa: number of SA fields
+			for (i = 0; i < n_regs; ++i)
+				if (i != r - regs && regs[i].parent == regs[i].id && regs[i].p)
+					++n_sa;
+			if (n_sa > 0) {
+				mm_sprintf_lite(s, "\tSA:Z:");
+				for (i = 0; i < n_regs; ++i) {
+					const mm_reg1_t *q = &regs[i];
+					int l_M, l_I = 0, l_D = 0, clip5 = 0, clip3 = 0;
+					if (r == q || q->parent != q->id || q->p == 0) continue;
+					if (q->qe - q->qs < q->re - q->rs) l_M = q->qe - q->qs, l_D = (q->re - q->rs) - l_M;
+					else l_M = q->re - q->rs, l_I = (q->qe - q->qs) - l_M;
+					clip5 = q->rev? t->l_seq - q->qe : q->qs;
+					clip3 = q->rev? q->qs : t->l_seq - q->qe;
+					mm_sprintf_lite(s, "%s,%d,%c,", mi->seq[q->rid].name, q->rs+1, "+-"[q->rev]);
+					if (clip5) mm_sprintf_lite(s, "%dS", clip5);
+					if (l_M) mm_sprintf_lite(s, "%dM", l_M);
+					if (l_I) mm_sprintf_lite(s, "%dI", l_I);
+					if (l_D) mm_sprintf_lite(s, "%dD", l_D);
+					if (clip3) mm_sprintf_lite(s, "%dS", clip3);
+					mm_sprintf_lite(s, ",%d,%d;", q->mapq, q->blen - q->mlen + q->p->n_ambi);
+				}
+			}
+		}
+		if (r->p && (opt_flag & (MM_F_OUT_CS|MM_F_OUT_MD)))
+			write_cs_or_MD(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG), opt_flag&MM_F_OUT_MD);
+		if (cigar_in_tag)
+			write_sam_cigar(s, flag, 1, t->l_seq, r, opt_flag);
+	}
+
+	if ((opt_flag & MM_F_COPY_COMMENT) && t->comment)
+		mm_sprintf_lite(s, "\t%s", t->comment);
+
 	s->s[s->l] = 0; // we always have room for an extra byte (see str_enlarge)
 }
+
+void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int n_regs, const mm_reg1_t *regs)
+{
+	int i;
+	for (i = 0; i < n_regs; ++i)
+		if (r == &regs[i]) break;
+	mm_write_sam2(s, mi, t, 0, i, 1, &n_regs, &regs, NULL, 0);
+}

getopt.c

@@ -0,0 +1,216 @@
+#include <stddef.h>
+#include <stdio.h>
+#include <string.h>
+#include "getopt.h"
+
+char *optarg;
+int optind=1, opterr=1, optopt, __optpos, optreset=0;
+
+#define optpos __optpos
+
+static void __getopt_msg(const char *a, const char *b, const char *c, size_t l)
+{
+	FILE *f = stderr;
+#if !defined(WIN32) && !defined(_WIN32)
+	flockfile(f);
+#endif
+	fputs(a, f);
+	fwrite(b, strlen(b), 1, f);
+	fwrite(c, 1, l, f);
+	fputc('\n', f);
+#if !defined(WIN32) && !defined(_WIN32)
+	funlockfile(f);
+#endif
+}
+
+int getopt(int argc, char * const argv[], const char *optstring)
+{
+	int i, c, d;
+	int k, l;
+	char *optchar;
+
+	if (!optind || optreset) {
+		optreset = 0;
+		__optpos = 0;
+		optind = 1;
+	}
+
+	if (optind >= argc || !argv[optind])
+		return -1;
+
+	if (argv[optind][0] != '-') {
+		if (optstring[0] == '-') {
+			optarg = argv[optind++];
+			return 1;
+		}
+		return -1;
+	}
+
+	if (!argv[optind][1])
+		return -1;
+
+	if (argv[optind][1] == '-' && !argv[optind][2])
+		return optind++, -1;
+
+	if (!optpos) optpos++;
+	c = argv[optind][optpos], k = 1;
+	optchar = argv[optind]+optpos;
+	optopt = c;
+	optpos += k;
+
+	if (!argv[optind][optpos]) {
+		optind++;
+		optpos = 0;
+	}
+
+	if (optstring[0] == '-' || optstring[0] == '+')
+		optstring++;
+
+	i = 0;
+	d = 0;
+	do {
+		d = optstring[i], l = 1;
+		if (l>0) i+=l; else i++;
+	} while (l && d != c);
+
+	if (d != c) {
+		if (optstring[0] != ':' && opterr)
+			__getopt_msg(argv[0], ": unrecognized option: ", optchar, k);
+		return '?';
+	}
+	if (optstring[i] == ':') {
+		if (optstring[i+1] == ':') optarg = 0;
+		else if (optind >= argc) {
+			if (optstring[0] == ':') return ':';
+			if (opterr) __getopt_msg(argv[0],
+				": option requires an argument: ",
+				optchar, k);
+			return '?';
+		}
+		if (optstring[i+1] != ':' || optpos) {
+			optarg = argv[optind++] + optpos;
+			optpos = 0;
+		}
+	}
+	return c;
+}
+
+static void permute(char *const *argv, int dest, int src)
+{
+	char **av = (char **)argv;
+	char *tmp = av[src];
+	int i;
+	for (i=src; i>dest; i--)
+		av[i] = av[i-1];
+	av[dest] = tmp;
+}
+
+static int __getopt_long_core(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx, int longonly)
+{
+	optarg = 0;
+	if (longopts && argv[optind][0] == '-' &&
+		((longonly && argv[optind][1] && argv[optind][1] != '-') ||
+		 (argv[optind][1] == '-' && argv[optind][2])))
+	{
+		int colon = optstring[optstring[0]=='+'||optstring[0]=='-']==':';
+		int i, cnt, match = -1;
+		char *opt;
+		for (cnt=i=0; longopts[i].name; i++) {
+			const char *name = longopts[i].name;
+			opt = argv[optind]+1;
+			if (*opt == '-') opt++;
+			for (; *name && *name == *opt; name++, opt++);
+			if (*opt && *opt != '=') continue;
+			match = i;
+			if (!*name) {
+				cnt = 1;
+				break;
+			}
+			cnt++;
+		}
+		if (cnt==1) {
+			i = match;
+			optind++;
+			optopt = longopts[i].val;
+			if (*opt == '=') {
+				if (!longopts[i].has_arg) {
+					if (colon || !opterr)
+						return '?';
+					__getopt_msg(argv[0],
+						": option does not take an argument: ",
+						longopts[i].name,
+						strlen(longopts[i].name));
+					return '?';
+				}
+				optarg = opt+1;
+			} else if (longopts[i].has_arg == required_argument) {
+				if (!(optarg = argv[optind])) {
+					if (colon) return ':';
+					if (!opterr) return '?';
+					__getopt_msg(argv[0],
+						": option requires an argument: ",
+						longopts[i].name,
+						strlen(longopts[i].name));
+					return '?';
+				}
+				optind++;
+			}
+			if (idx) *idx = i;
+			if (longopts[i].flag) {
+				*longopts[i].flag = longopts[i].val;
+				return 0;
+			}
+			return longopts[i].val;
+		}
+		if (argv[optind][1] == '-') {
+			if (!colon && opterr)
+				__getopt_msg(argv[0], cnt ?
+					": option is ambiguous: " :
+					": unrecognized option: ",
+					argv[optind]+2,
+					strlen(argv[optind]+2));
+			optind++;
+			return '?';
+		}
+	}
+	return getopt(argc, argv, optstring);
+}
+
+static int __getopt_long(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx, int longonly)
+{
+	int ret, skipped, resumed;
+	if (!optind || optreset) {
+		optreset = 0;
+		__optpos = 0;
+		optind = 1;
+	}
+	if (optind >= argc || !argv[optind]) return -1;
+	skipped = optind;
+	if (optstring[0] != '+' && optstring[0] != '-') {
+		int i;
+		for (i=optind; ; i++) {
+			if (i >= argc || !argv[i]) return -1;
+			if (argv[i][0] == '-' && argv[i][1]) break;
+		}
+		optind = i;
+	}
+	resumed = optind;
+	ret = __getopt_long_core(argc, argv, optstring, longopts, idx, longonly);
+	if (resumed > skipped) {
+		int i, cnt = optind-resumed;
+		for (i=0; i<cnt; i++)
+			permute(argv, skipped, optind-1);
+		optind = skipped + cnt;
+	}
+	return ret;
+}
+
+int getopt_long(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx)
+{
+	return __getopt_long(argc, argv, optstring, longopts, idx, 0);
+}
+
+int getopt_long_only(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx)
+{
+	return __getopt_long(argc, argv, optstring, longopts, idx, 1);
+}

getopt.h

@@ -0,0 +1,53 @@
+/*
+  Copyright 2005-2014 Rich Felker, et al.
+  
+  Permission is hereby granted, free of charge, to any person obtaining
+  a copy of this software and associated documentation files (the
+  "Software"), to deal in the Software without restriction, including
+  without limitation the rights to use, copy, modify, merge, publish,
+  distribute, sublicense, and/or sell copies of the Software, and to
+  permit persons to whom the Software is furnished to do so, subject to
+  the following conditions:
+  
+  The above copyright notice and this permission notice shall be
+  included in all copies or substantial portions of the Software.
+  
+  THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
+  EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
+  MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT.
+  IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY
+  CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT,
+  TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE
+  SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
+*/
+
+#ifndef _GETOPT_H
+#define _GETOPT_H
+
+#ifdef __cplusplus
+extern "C" {
+#endif
+
+int getopt(int, char * const [], const char *);
+extern char *optarg;
+extern int optind, opterr, optopt, optreset;
+
+struct option {
+	const char *name;
+	int has_arg;
+	int *flag;
+	int val;
+};
+
+int getopt_long(int, char *const *, const char *, const struct option *, int *);
+int getopt_long_only(int, char *const *, const char *, const struct option *, int *);
+
+#define no_argument        0
+#define required_argument  1
+#define optional_argument  2
+
+#ifdef __cplusplus
+}
+#endif
+
+#endif

hit.c

@@ -1,20 +1,22 @@
 #include <string.h>
+#include <stdlib.h>
 #include <math.h>
 #include "mmpriv.h"
 #include "kalloc.h"
+#include "khash.h"
 
 static inline void mm_cal_fuzzy_len(mm_reg1_t *r, const mm128_t *a)
 {
 	int i;
-	r->fuzzy_mlen = r->fuzzy_blen = 0;
+	r->mlen = r->blen = 0;
 	if (r->cnt <= 0) return;
-	r->fuzzy_mlen = r->fuzzy_blen = a[r->as].y>>32&0xff;
+	r->mlen = r->blen = a[r->as].y>>32&0xff;
 	for (i = r->as + 1; i < r->as + r->cnt; ++i) {
 		int span = a[i].y>>32&0xff;
 		int tl = (int32_t)a[i].x - (int32_t)a[i-1].x;
 		int ql = (int32_t)a[i].y - (int32_t)a[i-1].y;
-		r->fuzzy_blen += tl > ql? tl : ql;
+		r->blen += tl > ql? tl : ql;
-		r->fuzzy_mlen += tl > span && ql > span? span : tl < ql? tl : ql;
+		r->mlen += tl > span && ql > span? span : tl < ql? tl : ql;
 	}
 }
 
@@ -35,7 +37,19 @@ static inline void mm_reg_set_coor(mm_reg1_t *r, int32_t qlen, const mm128_t *a)
 	mm_cal_fuzzy_len(r, a);
 }
 
-mm_reg1_t *mm_gen_regs(void *km, int qlen, int n_u, uint64_t *u, mm128_t *a) // convert chains to hits
+static inline uint64_t hash64(uint64_t key)
+{
+	key = (~key + (key << 21));
+	key = key ^ key >> 24;
+	key = ((key + (key << 3)) + (key << 8));
+	key = key ^ key >> 14;
+	key = ((key + (key << 2)) + (key << 4));
+	key = key ^ key >> 28;
+	key = (key + (key << 31));
+	return key;
+}
+
+mm_reg1_t *mm_gen_regs(void *km, uint32_t hash, int qlen, int n_u, uint64_t *u, mm128_t *a) // convert chains to hits
 {
 	mm128_t *z, tmp;
 	mm_reg1_t *r;
@@ -46,7 +60,9 @@ mm_reg1_t *mm_gen_regs(void *km, int qlen, int n_u, uint64_t *u, mm128_t *a) //
 	// sort by score
 	z = (mm128_t*)kmalloc(km, n_u * 16);
 	for (i = k = 0; i < n_u; ++i) {
-		z[i].x = u[i] >> 32;
+		uint32_t h;
+		h = (uint32_t)hash64((hash64(a[k].x) + hash64(a[k].y)) ^ hash);
+		z[i].x = u[i] ^ h; // u[i] -- higher 32 bits: chain score; lower 32 bits: number of seeds in the chain
 		z[i].y = (uint64_t)k << 32 | (int32_t)u[i];
 		k += (int32_t)u[i];
 	}
@@ -60,9 +76,11 @@ mm_reg1_t *mm_gen_regs(void *km, int qlen, int n_u, uint64_t *u, mm128_t *a) //
 		mm_reg1_t *ri = &r[i];
 		ri->id = i;
 		ri->parent = MM_PARENT_UNSET;
-		ri->score = z[i].x;
+		ri->score = ri->score0 = z[i].x >> 32;
+		ri->hash = (uint32_t)z[i].x;
 		ri->cnt = (int32_t)z[i].y;
 		ri->as = z[i].y >> 32;
+		ri->div = -1.0f;
 		mm_reg_set_coor(ri, qlen, a);
 	}
 	kfree(km, z);
@@ -76,6 +94,7 @@ void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a)
 	r2->id = -1;
 	r2->sam_pri = 0;
 	r2->p = 0;
+	r2->split_inv = 0;
 	r2->cnt = r->cnt - n;
 	r2->score = (int32_t)(r->score * ((float)r2->cnt / r->cnt) + .499);
 	r2->as = r->as + n;
@@ -87,55 +106,92 @@ void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a)
 	r->split |= 1, r2->split |= 2;
 }
 
-void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r) // and compute mm_reg1_t::subsc
+void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r, int sub_diff) // and compute mm_reg1_t::subsc
 {
 	int i, j, k, *w;
+	uint64_t *cov;
 	if (n <= 0) return;
 	for (i = 0; i < n; ++i) r[i].id = i;
+	cov = (uint64_t*)kmalloc(km, n * sizeof(uint64_t));
 	w = (int*)kmalloc(km, n * sizeof(int));
 	w[0] = 0, r[0].parent = 0;
 	for (i = 1, k = 1; i < n; ++i) {
 		mm_reg1_t *ri = &r[i];
-		int si = ri->qs, ei = ri->qe;
+		int si = ri->qs, ei = ri->qe, n_cov = 0, uncov_len = 0;
-		for (j = 0; j < k; ++j) {
+		for (j = 0; j < k; ++j) { // traverse existing primary hits to find overlapping hits
 			mm_reg1_t *rp = &r[w[j]];
 			int sj = rp->qs, ej = rp->qe;
-			int min = ej - sj < ei - si? ej - sj : ei - si;
+			if (ej <= si || sj >= ei) continue;
-			int ol = si < sj? (ei < sj? 0 : ei < ej? ei - sj : ej - sj) : (ej < si? 0 : ej < ei? ej - si : ei - si);
+			if (sj < si) sj = si;
-			if (ol > mask_level * min) {
+			if (ej > ei) ej = ei;
+			cov[n_cov++] = (uint64_t)sj<<32 | ej;
+		}
+		if (n_cov == 0) {
+			goto set_parent_test; // no overlapping primary hits; then i is a new primary hit
+		} else if (n_cov > 0) { // there are overlapping primary hits; find the length not covered by existing primary hits
+			int j, x = si;
+			radix_sort_64(cov, cov + n_cov);
+			for (j = 0; j < n_cov; ++j) {
+				if ((int)(cov[j]>>32) > x) uncov_len += (cov[j]>>32) - x;
+				x = (int32_t)cov[j] > x? (int32_t)cov[j] : x;
+			}
+			if (ei > x) uncov_len += ei - x;
+		}
+		for (j = 0; j < k; ++j) { // traverse existing primary hits again
+			mm_reg1_t *rp = &r[w[j]];
+			int sj = rp->qs, ej = rp->qe, min, max, ol;
+			if (ej <= si || sj >= ei) continue; // no overlap
+			min = ej - sj < ei - si? ej - sj : ei - si;
+			max = ej - sj > ei - si? ej - sj : ei - si;
+			ol = si < sj? (ei < sj? 0 : ei < ej? ei - sj : ej - sj) : (ej < si? 0 : ej < ei? ej - si : ei - si); // overlap length; TODO: this can be simplified
+			if ((float)ol / min - (float)uncov_len / max > mask_level) {
+				int cnt_sub = 0;
 				ri->parent = rp->parent;
 				rp->subsc = rp->subsc > ri->score? rp->subsc : ri->score;
-				if (rp->p && ri->p)
+				if (ri->cnt >= rp->cnt) cnt_sub = 1;
+				if (rp->p && ri->p && (rp->rid != ri->rid || rp->rs != ri->rs || rp->re != ri->re || ol != min)) { // the last condition excludes identical hits after DP
 					rp->p->dp_max2 = rp->p->dp_max2 > ri->p->dp_max? rp->p->dp_max2 : ri->p->dp_max;
+					if (rp->p->dp_max - ri->p->dp_max <= sub_diff) cnt_sub = 1;
+				}
+				if (cnt_sub) ++rp->n_sub;
 				break;
 			}
 		}
-		if (j == k) w[k++] = i, ri->parent = i;
+set_parent_test:
+		if (j == k) w[k++] = i, ri->parent = i, ri->n_sub = 0;
 	}
+	kfree(km, cov);
 	kfree(km, w);
 }
 
-void mm_hit_sort_by_dp(void *km, int *n_regs, mm_reg1_t *r)
+void mm_hit_sort(void *km, int *n_regs, mm_reg1_t *r)
 {
-	int32_t i, n_aux, n = *n_regs;
+	int32_t i, n_aux, n = *n_regs, has_cigar = 0, no_cigar = 0;
-	uint64_t *aux;
+	mm128_t *aux;
 	mm_reg1_t *t;
 
 	if (n <= 1) return;
-	aux = (uint64_t*)kmalloc(km, n * 8);
+	aux = (mm128_t*)kmalloc(km, n * 16);
 	t = (mm_reg1_t*)kmalloc(km, n * sizeof(mm_reg1_t));
 	for (i = n_aux = 0; i < n; ++i) {
-		if (r[i].cnt > 0) { // squeeze out elements with cnt==0 (soft deleted)
+		if (r[i].inv || r[i].cnt > 0) { // squeeze out elements with cnt==0 (soft deleted)
-			assert(r[i].p);
+			if (r[i].p) {
-			aux[n_aux++] = (uint64_t)r[i].p->dp_max << 32 | i;
+				aux[n_aux].x = (uint64_t)r[i].p->dp_max << 32 | r[i].hash;
+				has_cigar = 1;
+			} else {
+				aux[n_aux].x = (uint64_t)r[i].score << 32 | r[i].hash;
+				no_cigar = 1;
+			}
+			aux[n_aux++].y = i;
 		} else if (r[i].p) {
-			kfree(km, r[i].p);
+			free(r[i].p);
 			r[i].p = 0;
 		}
 	}
-	radix_sort_64(aux, aux + n_aux);
+	assert(has_cigar + no_cigar == 1);
+	radix_sort_128x(aux, aux + n_aux);
 	for (i = n_aux - 1; i >= 0; --i)
-		t[n_aux - 1 - i] = r[(int32_t)aux[i]];
+		t[n_aux - 1 - i] = r[aux[i].y];
 	memcpy(r, t, sizeof(mm_reg1_t) * n_aux);
 	*n_regs = n_aux;
 	kfree(km, aux);
@@ -177,29 +233,36 @@ void mm_sync_regs(void *km, int n_regs, mm_reg1_t *regs) // keep mm_reg1_t::{id,
 	mm_set_sam_pri(n_regs, regs);
 }
 
-void mm_select_sub(void *km, float mask_level, float pri_ratio, int best_n, int *n_, mm_reg1_t *r)
+void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int *n_, mm_reg1_t *r)
 {
 	if (pri_ratio > 0.0f && *n_ > 0) {
 		int i, k, n = *n_, n_2nd = 0;
-		for (i = k = 0; i < n; ++i)
+		for (i = k = 0; i < n; ++i) {
-			if (r[i].parent == i) r[k++] = r[i];
+			int p = r[i].parent;
-			else if (r[i].score >= r[r[i].parent].score * pri_ratio && n_2nd++ < best_n) r[k++] = r[i];
+			if (p == i || r[i].inv) { // primary or inversion
+				r[k++] = r[i];
+			} else if ((r[i].score >= r[p].score * pri_ratio || r[i].score + min_diff >= r[p].score) && n_2nd < best_n) {
+				if (!(r[i].qs == r[p].qs && r[i].qe == r[p].qe && r[i].rid == r[p].rid && r[i].rs == r[p].rs && r[i].re == r[p].re)) // not identical hits
+					r[k++] = r[i], ++n_2nd;
 				else if (r[i].p) free(r[i].p);
+			} else if (r[i].p) free(r[i].p);
+		}
 		if (k != n) mm_sync_regs(km, k, r); // removing hits requires sync()
 		*n_ = k;
 	}
 }
 
-void mm_filter_regs(void *km, const mm_mapopt_t *opt, int *n_regs, mm_reg1_t *regs)
+void mm_filter_regs(const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs)
 { // NB: after this call, mm_reg1_t::parent can be -1 if its parent filtered out
 	int i, k;
 	for (i = k = 0; i < *n_regs; ++i) {
 		mm_reg1_t *r = &regs[i];
 		int flt = 0;
-		if (r->cnt < opt->min_cnt) flt = 1;
+		if (!r->inv && !r->seg_split && r->cnt < opt->min_cnt) flt = 1;
-		if (r->p) {
+		if (r->p) { // these filters are only applied when base-alignment is available
-			if (r->p->blen - r->p->n_ambi - r->p->n_diff < opt->min_chain_score) flt = 1;
+			if (r->mlen < opt->min_chain_score) flt = 1;
 			else if (r->p->dp_max < opt->min_dp_max) flt = 1;
+			else if (r->qs > qlen * opt->max_clip_ratio && qlen - r->qe > qlen * opt->max_clip_ratio) flt = 1;
 			if (flt) free(r->p);
 		}
 		if (!flt) {
@@ -247,7 +310,7 @@ void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs_, mm_r
 	for (i = n_aux - 1; i >= 1; --i) {
 		mm_reg1_t *r0 = &regs[(int32_t)aux[i-1]], *r1 = &regs[(int32_t)aux[i]];
 		mm128_t *a0e, *a1s;
-		int max_gap, min_gap, sc_thres;
+		int max_gap, min_gap, sc_thres, min_flank_len;
 
 		// test
 		if (r0->as + r0->cnt != r1->as) continue; // not adjacent in a[]
@@ -256,16 +319,17 @@ void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs_, mm_r
 		a1s = &a[r1->as];
 		if (a1s->x <= a0e->x || (int32_t)a1s->y <= (int32_t)a0e->y) continue; // keep colinearity
 		max_gap = min_gap = (int32_t)a1s->y - (int32_t)a0e->y;
-		max_gap = max_gap > a1s->x - a0e->x? max_gap : a1s->x - a0e->x;
+		max_gap = a0e->x + max_gap > a1s->x? max_gap : a1s->x - a0e->x;
-		min_gap = min_gap < a1s->x - a0e->x? min_gap : a1s->x - a0e->x;
+		min_gap = a0e->x + min_gap < a1s->x? min_gap : a1s->x - a0e->x;
 		if (max_gap > opt->max_join_long || min_gap > opt->max_join_short) continue;
 		sc_thres = (int)((float)opt->min_join_flank_sc / opt->max_join_long * max_gap + .499);
 		if (r0->score < sc_thres || r1->score < sc_thres) continue; // require good flanking chains
-		if (r0->re - r0->rs < max_gap>>1 || r0->qe - r0->qs < max_gap>>1) continue; // require enough flanking length
+		min_flank_len = (int)(max_gap * opt->min_join_flank_ratio);
-		if (r1->re - r1->rs < max_gap>>1 || r1->qe - r1->qs < max_gap>>1) continue;
+		if (r0->re - r0->rs < min_flank_len || r0->qe - r0->qs < min_flank_len) continue; // require enough flanking length
+		if (r1->re - r1->rs < min_flank_len || r1->qe - r1->qs < min_flank_len) continue;
 
 		// all conditions satisfied; join
-		a[r1->as].y |= 1ULL<<40;
+		a[r1->as].y |= MM_SEED_LONG_JOIN;
 		r0->cnt += r1->cnt, r0->score += r1->score;
 		mm_reg_set_coor(r0, qlen, a);
 		r1->cnt = 0;
@@ -282,24 +346,143 @@ void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs_, mm_r
 					r->parent = regs[r->parent].parent;
 			}
 		}
-		mm_filter_regs(km, opt, n_regs_, regs);
+		mm_filter_regs(opt, qlen, n_regs_, regs);
 		mm_sync_regs(km, *n_regs_, regs);
 	}
 }
 
-void mm_set_mapq(int n_regs, mm_reg1_t *regs)
+mm_seg_t *mm_seg_gen(void *km, uint32_t hash, int n_segs, const int *qlens, int n_regs0, const mm_reg1_t *regs0, int *n_regs, mm_reg1_t **regs, const mm128_t *a)
+{
+	int s, i, j, acc_qlen[MM_MAX_SEG+1], qlen_sum = 0;
+	mm_seg_t *seg;
+
+	assert(n_segs <= MM_MAX_SEG);
+	for (s = 1, acc_qlen[0] = 0; s < n_segs; ++s)
+		acc_qlen[s] = acc_qlen[s-1] + qlens[s-1];
+	qlen_sum = acc_qlen[n_segs - 1] + qlens[n_segs - 1];
+
+	seg = (mm_seg_t*)kcalloc(km, n_segs, sizeof(mm_seg_t));
+	for (s = 0; s < n_segs; ++s) {
+		seg[s].u = (uint64_t*)kmalloc(km, n_regs0 * 8);
+		for (i = 0; i < n_regs0; ++i)
+			seg[s].u[i] = (uint64_t)regs0[i].score << 32;
+	}
+	for (i = 0; i < n_regs0; ++i) {
+		const mm_reg1_t *r = &regs0[i];
+		for (j = 0; j < r->cnt; ++j) {
+			int sid = (a[r->as + j].y&MM_SEED_SEG_MASK)>>MM_SEED_SEG_SHIFT;
+			++seg[sid].u[i];
+			++seg[sid].n_a;
+		}
+	}
+	for (s = 0; s < n_segs; ++s) {
+		mm_seg_t *sr = &seg[s];
+		for (i = 0, sr->n_u = 0; i < n_regs0; ++i) // squeeze out zero-length per-segment chains
+			if ((int32_t)sr->u[i] != 0)
+				sr->u[sr->n_u++] = sr->u[i];
+		sr->a = (mm128_t*)kmalloc(km, sr->n_a * sizeof(mm128_t));
+		sr->n_a = 0;
+	}
+
+	for (i = 0; i < n_regs0; ++i) {
+		const mm_reg1_t *r = &regs0[i];
+		for (j = 0; j < r->cnt; ++j) {
+			int sid = (a[r->as + j].y&MM_SEED_SEG_MASK)>>MM_SEED_SEG_SHIFT;
+			mm128_t a1 = a[r->as + j];
+			// on reverse strand, the segment position is:
+			//   x_for_cat = qlen_sum - 1 - (int32_t)a1.y - 1 + q_span
+			//   (int32_t)new_a1.y = qlens[sid] - (x_for_cat - acc_qlen[sid] + 1 - q_span) - 1 = (int32_t)a1.y - (qlen_sum - (qlens[sid] + acc_qlen[sid]))
+			a1.y -= a1.x>>63? qlen_sum - (qlens[sid] + acc_qlen[sid]) : acc_qlen[sid];
+			seg[sid].a[seg[sid].n_a++] = a1;
+		}
+	}
+	for (s = 0; s < n_segs; ++s) {
+		regs[s] = mm_gen_regs(km, hash, qlens[s], seg[s].n_u, seg[s].u, seg[s].a);
+		n_regs[s] = seg[s].n_u;
+		for (i = 0; i < n_regs[s]; ++i) {
+			regs[s][i].seg_split = 1;
+			regs[s][i].seg_id = s;
+		}
+	}
+	return seg;
+}
+
+void mm_seg_free(void *km, int n_segs, mm_seg_t *segs)
 {
 	int i;
+	for (i = 0; i < n_segs; ++i) kfree(km, segs[i].u);
+	for (i = 0; i < n_segs; ++i) kfree(km, segs[i].a);
+	kfree(km, segs);
+}
+
+static void mm_set_inv_mapq(void *km, int n_regs, mm_reg1_t *regs)
+{
+	int i, n_aux;
+	mm128_t *aux;
+	if (n_regs < 3) return;
+	for (i = 0; i < n_regs; ++i)
+		if (regs[i].inv) break;
+	if (i == n_regs) return; // no inversion hits
+
+	aux = (mm128_t*)kmalloc(km, n_regs * 16);
+	for (i = n_aux = 0; i < n_regs; ++i)
+		if (regs[i].parent == i || regs[i].parent < 0)
+			aux[n_aux].y = i, aux[n_aux++].x = (uint64_t)regs[i].rid << 32 | regs[i].rs;
+	radix_sort_128x(aux, aux + n_aux);
+
+	for (i = 1; i < n_aux - 1; ++i) {
+		mm_reg1_t *inv = &regs[aux[i].y];
+		if (inv->inv) {
+			mm_reg1_t *l = &regs[aux[i-1].y];
+			mm_reg1_t *r = &regs[aux[i+1].y];
+			inv->mapq = l->mapq < r->mapq? l->mapq : r->mapq;
+		}
+	}
+	kfree(km, aux);
+}
+
+void mm_set_mapq(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr)
+{
+	static const float q_coef = 40.0f;
+	int64_t sum_sc = 0;
+	float uniq_ratio;
+	int i;
+	for (i = 0; i < n_regs; ++i)
+		if (regs[i].parent == regs[i].id)
+			sum_sc += regs[i].score;
+	uniq_ratio = (float)sum_sc / (sum_sc + rep_len);
 	for (i = 0; i < n_regs; ++i) {
 		mm_reg1_t *r = &regs[i];
-		if (r->parent == r->id) {
+		if (r->inv) {
-			int mapq;
+			r->mapq = 0;
+		} else if (r->parent == r->id) {
+			int mapq, subsc;
+			float pen_s1 = (r->score > 100? 1.0f : 0.01f * r->score) * uniq_ratio;
+			float pen_cm = r->cnt > 10? 1.0f : 0.1f * r->cnt;
+			pen_cm = pen_s1 < pen_cm? pen_s1 : pen_cm;
+			subsc = r->subsc > min_chain_sc? r->subsc : min_chain_sc;
 			if (r->p && r->p->dp_max2 > 0 && r->p->dp_max > 0) {
-				float identity = (float)(r->p->blen - r->p->n_diff - r->p->n_ambi) / (r->p->blen - r->p->n_ambi);
+				float identity = (float)r->mlen / r->blen;
-				mapq = (int)(identity * 30.0 * (1. - (float)r->p->dp_max2 * r->subsc / r->p->dp_max / r->score) * logf(r->score));
+				float x = (float)r->p->dp_max2 * subsc / r->p->dp_max / r->score0;
-			} else mapq = (int)(30.0 * (1. - (float)r->subsc / r->score) * logf(r->score));
+				mapq = (int)(identity * pen_cm * q_coef * (1.0f - x * x) * logf((float)r->p->dp_max / match_sc));
+				if (!is_sr) {
+					int mapq_alt = (int)(6.02f * identity * identity * (r->p->dp_max - r->p->dp_max2) / match_sc + .499f); // BWA-MEM like mapQ, mostly for short reads
+					mapq = mapq < mapq_alt? mapq : mapq_alt; // in case the long-read heuristic fails
+				}
+			} else {
+				float x = (float)subsc / r->score0;
+				if (r->p) {
+					float identity = (float)r->mlen / r->blen;
+					mapq = (int)(identity * pen_cm * q_coef * (1.0f - x) * logf((float)r->p->dp_max / match_sc));
+				} else {
+					mapq = (int)(pen_cm * q_coef * (1.0f - x) * logf(r->score));
+				}
+			}
+			mapq -= (int)(4.343f * logf(r->n_sub + 1) + .499f);
 			mapq = mapq > 0? mapq : 0;
 			r->mapq = mapq < 60? mapq : 60;
+			if (r->p && r->p->dp_max > r->p->dp_max2 && r->mapq == 0) r->mapq = 1;
 		} else r->mapq = 0;
 	}
+	mm_set_inv_mapq(km, n_regs, regs);
 }

index.c

@@ -1,8 +1,13 @@
 #include <stdlib.h>
 #include <assert.h>
+#if defined(WIN32) || defined(_WIN32)
+#include <io.h> // for open(2)
+#else
 #include <unistd.h>
+#endif
 #include <fcntl.h>
 #include <stdio.h>
+#define __STDC_LIMIT_MACROS
 #include "kthread.h"
 #include "bseq.h"
 #include "minimap.h"
@@ -15,31 +20,47 @@
 KHASH_INIT(idx, uint64_t, uint64_t, 1, idx_hash, idx_eq)
 typedef khash_t(idx) idxhash_t;
 
+KHASH_MAP_INIT_STR(str, uint32_t)
+
 #define kroundup64(x) (--(x), (x)|=(x)>>1, (x)|=(x)>>2, (x)|=(x)>>4, (x)|=(x)>>8, (x)|=(x)>>16, (x)|=(x)>>32, ++(x))
 
-mm_idx_t *mm_idx_init(int w, int k, int b, int is_hpc)
+typedef struct mm_idx_bucket_s {
+	mm128_v a;   // (minimizer, position) array
+	int32_t n;   // size of the _p_ array
+	uint64_t *p; // position array for minimizers appearing >1 times
+	void *h;     // hash table indexing _p_ and minimizers appearing once
+} mm_idx_bucket_t;
+
+mm_idx_t *mm_idx_init(int w, int k, int b, int flag)
 {
 	mm_idx_t *mi;
 	if (k*2 < b) b = k * 2;
 	if (w < 1) w = 1;
 	mi = (mm_idx_t*)calloc(1, sizeof(mm_idx_t));
-	mi->w = w, mi->k = k, mi->b = b, mi->is_hpc = is_hpc;
+	mi->w = w, mi->k = k, mi->b = b, mi->flag = flag;
 	mi->B = (mm_idx_bucket_t*)calloc(1<<b, sizeof(mm_idx_bucket_t));
+	if (!(mm_dbg_flag & 1)) mi->km = km_init();
 	return mi;
 }
 
 void mm_idx_destroy(mm_idx_t *mi)
 {
-	int i;
+	uint32_t i;
 	if (mi == 0) return;
-	for (i = 0; i < 1<<mi->b; ++i) {
+	if (mi->h) kh_destroy(str, (khash_t(str)*)mi->h);
+	if (mi->B) {
+		for (i = 0; i < 1U<<mi->b; ++i) {
 			free(mi->B[i].p);
 			free(mi->B[i].a.a);
 			kh_destroy(idx, (idxhash_t*)mi->B[i].h);
 		}
+	}
+	if (!mi->km) {
 		for (i = 0; i < mi->n_seq; ++i)
 			free(mi->seq[i].name);
-	free(mi->seq); free(mi->B); free(mi->S); free(mi);
+		free(mi->seq);
+	} else km_destroy(mi->km);
+	free(mi->B); free(mi->S); free(mi);
 }
 
 const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n)
@@ -63,14 +84,15 @@ const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n)
 
 void mm_idx_stat(const mm_idx_t *mi)
 {
-	int i, n = 0, n1 = 0;
+	int n = 0, n1 = 0;
+	uint32_t i;
 	uint64_t sum = 0, len = 0;
-	fprintf(stderr, "[M::%s] kmer size: %d; skip: %d; is_HPC: %d; #seq: %d\n", __func__, mi->k, mi->w, mi->is_hpc, mi->n_seq);
+	fprintf(stderr, "[M::%s] kmer size: %d; skip: %d; is_hpc: %d; #seq: %d\n", __func__, mi->k, mi->w, mi->flag&MM_I_HPC, mi->n_seq);
 	for (i = 0; i < mi->n_seq; ++i)
 		len += mi->seq[i].len;
-	for (i = 0; i < 1<<mi->b; ++i)
+	for (i = 0; i < 1U<<mi->b; ++i)
 		if (mi->B[i].h) n += kh_size((idxhash_t*)mi->B[i].h);
-	for (i = 0; i < 1<<mi->b; ++i) {
+	for (i = 0; i < 1U<<mi->b; ++i) {
 		idxhash_t *h = (idxhash_t*)mi->B[i].h;
 		khint_t k;
 		if (h == 0) continue;
@@ -84,6 +106,34 @@ void mm_idx_stat(const mm_idx_t *mi)
 			__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), n, 100.0*n1/n, (double)sum / n, (double)len / sum);
 }
 
+int mm_idx_index_name(mm_idx_t *mi)
+{
+	khash_t(str) *h;
+	uint32_t i;
+	int has_dup = 0, absent;
+	if (mi->h) return 0;
+	h = kh_init(str);
+	for (i = 0; i < mi->n_seq; ++i) {
+		khint_t k;
+		k = kh_put(str, h, mi->seq[i].name, &absent);
+		if (absent) kh_val(h, k) = i;
+		else has_dup = 1;
+	}
+	mi->h = h;
+	if (has_dup && mm_verbose >= 2)
+		fprintf(stderr, "[WARNING] some database sequences have identical sequence names\n");
+	return has_dup;
+}
+
+int mm_idx_name2id(const mm_idx_t *mi, const char *name)
+{
+	khash_t(str) *h = (khash_t(str)*)mi->h;
+	khint_t k;
+	if (h == 0) return -2;
+	k = kh_get(str, h, name);
+	return k == kh_end(h)? -1 : kh_val(h, k);
+}
+
 int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq)
 {
 	uint64_t i, st1, en1;
@@ -96,13 +146,13 @@ int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, ui
 	return en - st;
 }
 
-uint32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f)
+int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f)
 {
 	int i;
 	size_t n = 0;
 	uint32_t thres;
 	khint_t *a, k;
-	if (f <= 0.) return UINT32_MAX;
+	if (f <= 0.) return INT32_MAX;
 	for (i = 0; i < 1<<mi->b; ++i)
 		if (mi->B[i].h) n += kh_size((idxhash_t*)mi->B[i].h);
 	a = (uint32_t*)malloc(n * 4);
@@ -125,7 +175,8 @@ uint32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f)
 
 static void worker_post(void *g, long i, int tid)
 {
-	int j, start_a, start_p, n, n_keys;
+	int n, n_keys;
+	size_t j, start_a, start_p;
 	idxhash_t *h;
 	mm_idx_t *mi = (mm_idx_t*)g;
 	mm_idx_bucket_t *b = &mi->B[i];
@@ -153,7 +204,7 @@ static void worker_post(void *g, long i, int tid)
 			int absent;
 			mm128_t *p = &b->a.a[j-1];
 			itr = kh_put(idx, h, p->x>>8>>mi->b<<1, &absent);
-			assert(absent && j - start_a == n);
+			assert(absent && j == start_a + n);
 			if (n == 1) {
 				kh_key(h, itr) |= 1;
 				kh_val(h, itr) = p->y;
@@ -169,10 +220,10 @@ static void worker_post(void *g, long i, int tid)
 		} else ++n;
 	}
 	b->h = h;
-	assert(b->n == start_p);
+	assert(b->n == (int32_t)start_p);
 
 	// deallocate and clear b->a
-	free(b->a.a);
+	kfree(0, b->a.a);
 	b->a.n = b->a.m = 0, b->a.a = 0;
 }
  
@@ -190,7 +241,7 @@ static void mm_idx_post(mm_idx_t *mi, int n_threads)
 #include "bseq.h"
 
 typedef struct {
-	int mini_batch_size, keep_name;
+	int mini_batch_size;
 	uint64_t batch_size, sum_len;
 	mm_bseq_file_t *fp;
 	mm_idx_t *mi;
@@ -222,14 +273,15 @@ static void *worker_pipeline(void *shared, int step, void *in)
 		s->seq = mm_bseq_read(p->fp, p->mini_batch_size, 0, &s->n_seq); // read a mini-batch
 		if (s->seq) {
 			uint32_t old_m, m;
-			uint64_t sum_len, old_max_len, max_len;
 			assert((uint64_t)p->mi->n_seq + s->n_seq <= UINT32_MAX); // to prevent integer overflow
 			// make room for p->mi->seq
 			old_m = p->mi->n_seq, m = p->mi->n_seq + s->n_seq;
 			kroundup32(m); kroundup32(old_m);
 			if (old_m != m)
-				p->mi->seq = (mm_idx_seq_t*)realloc(p->mi->seq, m * sizeof(mm_idx_seq_t));
+				p->mi->seq = (mm_idx_seq_t*)krealloc(p->mi->km, p->mi->seq, m * sizeof(mm_idx_seq_t));
 			// make room for p->mi->S
+			if (!(p->mi->flag & MM_I_NO_SEQ)) {
+				uint64_t sum_len, old_max_len, max_len;
 				for (i = 0, sum_len = 0; i < s->n_seq; ++i) sum_len += s->seq[i].l_seq;
 				old_max_len = (p->sum_len + 7) / 8;
 				max_len = (p->sum_len + sum_len + 7) / 8;
@@ -238,22 +290,25 @@ static void *worker_pipeline(void *shared, int step, void *in)
 					p->mi->S = (uint32_t*)realloc(p->mi->S, max_len * 4);
 					memset(&p->mi->S[old_max_len], 0, 4 * (max_len - old_max_len));
 				}
+			}
 			// populate p->mi->seq
 			for (i = 0; i < s->n_seq; ++i) {
 				mm_idx_seq_t *seq = &p->mi->seq[p->mi->n_seq];
 				uint32_t j;
-				if (p->keep_name) {
+				if (!(p->mi->flag & MM_I_NO_NAME)) {
-					assert(strlen(s->seq[i].name) <= 254); // a long query name breaks BAM
+					seq->name = (char*)kmalloc(p->mi->km, strlen(s->seq[i].name) + 1);
-					seq->name = strdup(s->seq[i].name);
+					strcpy(seq->name, s->seq[i].name);
 				} else seq->name = 0;
 				seq->len = s->seq[i].l_seq;
 				seq->offset = p->sum_len;
 				// copy the sequence
+				if (!(p->mi->flag & MM_I_NO_SEQ)) {
 					for (j = 0; j < seq->len; ++j) { // TODO: this is not the fastest way, but let's first see if speed matters here
 						uint64_t o = p->sum_len + j;
 						int c = seq_nt4_table[(uint8_t)s->seq[i].seq[j]];
 						mm_seq4_set(p->mi->S, o, c);
 					}
+				}
 				// update p->sum_len and p->mi->n_seq
 				p->sum_len += seq->len;
 				s->seq[i].rid = p->mi->n_seq++;
@@ -264,7 +319,10 @@ static void *worker_pipeline(void *shared, int step, void *in)
         step_t *s = (step_t*)in;
 		for (i = 0; i < s->n_seq; ++i) {
 			mm_bseq1_t *t = &s->seq[i];
-			mm_sketch(0, t->seq, t->l_seq, p->mi->w, p->mi->k, t->rid, p->mi->is_hpc, &s->a);
+			if (t->l_seq > 0)
+				mm_sketch(0, t->seq, t->l_seq, p->mi->w, p->mi->k, t->rid, p->mi->flag&MM_I_HPC, &s->a);
+			else if (mm_verbose >= 2)
+				fprintf(stderr, "[WARNING] the length database sequence '%s' is 0\n", t->name);
 			free(t->seq); free(t->name);
 		}
 		free(s->seq); s->seq = 0;
@@ -272,21 +330,20 @@ static void *worker_pipeline(void *shared, int step, void *in)
     } else if (step == 2) { // dispatch sketch to buckets
         step_t *s = (step_t*)in;
 		mm_idx_add(p->mi, s->a.n, s->a.a);
-		free(s->a.a); free(s);
+		kfree(0, s->a.a); free(s);
 	}
     return 0;
 }
 
-mm_idx_t *mm_idx_gen(mm_bseq_file_t *fp, int w, int k, int b, int is_hpc, int mini_batch_size, int n_threads, uint64_t batch_size, int keep_name)
+mm_idx_t *mm_idx_gen(mm_bseq_file_t *fp, int w, int k, int b, int flag, int mini_batch_size, int n_threads, uint64_t batch_size)
 {
 	pipeline_t pl;
+	if (fp == 0 || mm_bseq_eof(fp)) return 0;
 	memset(&pl, 0, sizeof(pipeline_t));
-	pl.mini_batch_size = mini_batch_size < batch_size? mini_batch_size : batch_size;
+	pl.mini_batch_size = (uint64_t)mini_batch_size < batch_size? mini_batch_size : batch_size;
-	pl.keep_name = keep_name;
 	pl.batch_size = batch_size;
 	pl.fp = fp;
-	if (pl.fp == 0) return 0;
+	pl.mi = mm_idx_init(w, k, b, flag);
-	pl.mi = mm_idx_init(w, k, b, is_hpc);
 
 	kt_pipeline(n_threads < 3? n_threads : 3, worker_pipeline, &pl, 3);
 	if (mm_verbose >= 3)
@@ -299,17 +356,60 @@ mm_idx_t *mm_idx_gen(mm_bseq_file_t *fp, int w, int k, int b, int is_hpc, int mi
 	return pl.mi;
 }
 
-mm_idx_t *mm_idx_build(const char *fn, int w, int k, int is_hpc, int n_threads) // a simpler interface
+mm_idx_t *mm_idx_build(const char *fn, int w, int k, int flag, int n_threads) // a simpler interface; deprecated
 {
 	mm_bseq_file_t *fp;
 	mm_idx_t *mi;
 	fp = mm_bseq_open(fn);
 	if (fp == 0) return 0;
-	mi = mm_idx_gen(fp, w, k, MM_IDX_DEF_B, is_hpc, 1<<18, n_threads, UINT64_MAX, 1);
+	mi = mm_idx_gen(fp, w, k, 14, flag, 1<<18, n_threads, UINT64_MAX);
 	mm_bseq_close(fp);
 	return mi;
 }
 
+mm_idx_t *mm_idx_str(int w, int k, int is_hpc, int bucket_bits, int n, const char **seq, const char **name)
+{
+	uint64_t sum_len = 0;
+	mm128_v a = {0,0,0};
+	mm_idx_t *mi;
+	int i, flag = 0;
+	if (n <= 0) return 0;
+	for (i = 0; i < n; ++i) // get the total length
+		sum_len += strlen(seq[i]);
+	if (is_hpc) flag |= MM_I_HPC;
+	if (name == 0) flag |= MM_I_NO_NAME;
+	if (bucket_bits < 0) bucket_bits = 14;
+	mi = mm_idx_init(w, k, bucket_bits, flag);
+	mi->n_seq = n;
+	mi->seq = (mm_idx_seq_t*)kcalloc(mi->km, n, sizeof(mm_idx_seq_t)); // ->seq is allocated from km
+	mi->S = (uint32_t*)calloc((sum_len + 7) / 8, 4);
+	for (i = 0, sum_len = 0; i < n; ++i) {
+		const char *s = seq[i];
+		mm_idx_seq_t *p = &mi->seq[i];
+		uint32_t j;
+		if (name && name[i]) {
+			p->name = (char*)kmalloc(mi->km, strlen(name[i]) + 1);
+			strcpy(p->name, name[i]);
+		}
+		p->offset = sum_len;
+		p->len = strlen(s);
+		for (j = 0; j < p->len; ++j) {
+			int c = seq_nt4_table[(uint8_t)s[j]];
+			uint64_t o = sum_len + j;
+			mm_seq4_set(mi->S, o, c);
+		}
+		sum_len += p->len;
+		if (p->len > 0) {
+			a.n = 0;
+			mm_sketch(0, s, p->len, w, k, i, is_hpc, &a);
+			mm_idx_add(mi, a.n, a.a);
+		}
+	}
+	free(a.a);
+	mm_idx_post(mi, 1);
+	return mi;
+}
+
 /*************
  * index I/O *
  *************/
@@ -317,17 +417,20 @@ mm_idx_t *mm_idx_build(const char *fn, int w, int k, int is_hpc, int n_threads)
 void mm_idx_dump(FILE *fp, const mm_idx_t *mi)
 {
 	uint64_t sum_len = 0;
-	uint32_t x[5];
+	uint32_t x[5], i;
-	int i;
 
-	x[0] = mi->w, x[1] = mi->k, x[2] = mi->b, x[3] = mi->n_seq, x[4] = mi->is_hpc;
+	x[0] = mi->w, x[1] = mi->k, x[2] = mi->b, x[3] = mi->n_seq, x[4] = mi->flag;
 	fwrite(MM_IDX_MAGIC, 1, 4, fp);
 	fwrite(x, 4, 5, fp);
 	for (i = 0; i < mi->n_seq; ++i) {
-		uint8_t l;
+		if (mi->seq[i].name) {
-		l = strlen(mi->seq[i].name);
+			uint8_t l = strlen(mi->seq[i].name);
 			fwrite(&l, 1, 1, fp);
 			fwrite(mi->seq[i].name, 1, l, fp);
+		} else {
+			uint8_t l = 0;
+			fwrite(&l, 1, 1, fp);
+		}
 		fwrite(&mi->seq[i].len, 4, 1, fp);
 		sum_len += mi->seq[i].len;
 	}
@@ -347,15 +450,15 @@ void mm_idx_dump(FILE *fp, const mm_idx_t *mi)
 			fwrite(x, 8, 2, fp);
 		}
 	}
+	if (!(mi->flag & MM_I_NO_SEQ))
 		fwrite(mi->S, 4, (sum_len + 7) / 8, fp);
 	fflush(fp);
 }
 
 mm_idx_t *mm_idx_load(FILE *fp)
 {
-	int i;
 	char magic[4];
-	uint32_t x[5];
+	uint32_t x[5], i;
 	uint64_t sum_len = 0;
 	mm_idx_t *mi;
 
@@ -364,14 +467,16 @@ mm_idx_t *mm_idx_load(FILE *fp)
 	if (fread(x, 4, 5, fp) != 5) return 0;
 	mi = mm_idx_init(x[0], x[1], x[2], x[4]);
 	mi->n_seq = x[3];
-	mi->seq = (mm_idx_seq_t*)calloc(mi->n_seq, sizeof(mm_idx_seq_t));
+	mi->seq = (mm_idx_seq_t*)kcalloc(mi->km, mi->n_seq, sizeof(mm_idx_seq_t));
 	for (i = 0; i < mi->n_seq; ++i) {
 		uint8_t l;
 		mm_idx_seq_t *s = &mi->seq[i];
 		fread(&l, 1, 1, fp);
-		s->name = (char*)malloc(l + 1);
+		if (l) {
+			s->name = (char*)kmalloc(mi->km, l + 1);
 			fread(s->name, 1, l, fp);
 			s->name[l] = 0;
+		}
 		fread(&s->len, 4, 1, fp);
 		s->offset = sum_len;
 		sum_len += s->len;
@@ -397,26 +502,75 @@ mm_idx_t *mm_idx_load(FILE *fp)
 			kh_val(h, k) = x[1];
 		}
 	}
+	if (!(mi->flag & MM_I_NO_SEQ)) {
 		mi->S = (uint32_t*)malloc((sum_len + 7) / 8 * 4);
 		fread(mi->S, 4, (sum_len + 7) / 8, fp);
+	}
 	return mi;
 }
 
-int mm_idx_is_idx(const char *fn)
+int64_t mm_idx_is_idx(const char *fn)
 {
 	int fd, is_idx = 0;
-	off_t ret;
+	off_t ret, off_end;
 	char magic[4];
 
 	if (strcmp(fn, "-") == 0) return 0; // read from pipe; not an index
 	fd = open(fn, O_RDONLY);
 	if (fd < 0) return -1; // error
-	if ((ret = lseek(fd, 0, SEEK_END)) >= 4) {
+	if ((off_end = lseek(fd, 0, SEEK_END)) >= 4) {
 		lseek(fd, 0, SEEK_SET);
 		ret = read(fd, magic, 4);
 		if (ret == 4 && strncmp(magic, MM_IDX_MAGIC, 4) == 0)
 			is_idx = 1;
 	}
 	close(fd);
-	return is_idx;
+	return is_idx? off_end : 0;
+}
+
+mm_idx_reader_t *mm_idx_reader_open(const char *fn, const mm_idxopt_t *opt, const char *fn_out)
+{
+	int64_t is_idx;
+	mm_idx_reader_t *r;
+	is_idx = mm_idx_is_idx(fn);
+	if (is_idx < 0) return 0; // failed to open the index
+	r = (mm_idx_reader_t*)calloc(1, sizeof(mm_idx_reader_t));
+	r->is_idx = is_idx;
+	if (opt) r->opt = *opt;
+	else mm_idxopt_init(&r->opt);
+	if (r->is_idx) {
+		r->fp.idx = fopen(fn, "rb");
+		r->idx_size = is_idx;
+	} else r->fp.seq = mm_bseq_open(fn);
+	if (fn_out) r->fp_out = fopen(fn_out, "wb");
+	return r;
+}
+
+void mm_idx_reader_close(mm_idx_reader_t *r)
+{
+	if (r->is_idx) fclose(r->fp.idx);
+	else mm_bseq_close(r->fp.seq);
+	if (r->fp_out) fclose(r->fp_out);
+	free(r);
+}
+
+mm_idx_t *mm_idx_reader_read(mm_idx_reader_t *r, int n_threads)
+{
+	mm_idx_t *mi;
+	if (r->is_idx) {
+		mi = mm_idx_load(r->fp.idx);
+		if (mi && mm_verbose >= 2 && (mi->k != r->opt.k || mi->w != r->opt.w || (mi->flag&MM_I_HPC) != (r->opt.flag&MM_I_HPC)))
+			fprintf(stderr, "[WARNING]\033[1;31m Indexing parameters (-k, -w or -H) overridden by parameters used in the prebuilt index.\033[0m\n");
+	} else
+		mi = mm_idx_gen(r->fp.seq, r->opt.w, r->opt.k, r->opt.bucket_bits, r->opt.flag, r->opt.mini_batch_size, n_threads, r->opt.batch_size);
+	if (mi) {
+		if (r->fp_out) mm_idx_dump(r->fp_out, mi);
+		mi->index = r->n_parts++;
+	}
+	return mi;
+}
+
+int mm_idx_reader_eof(const mm_idx_reader_t *r) // TODO: in extremely rare cases, mm_bseq_eof() might not work
+{
+	return r->is_idx? (feof(r->fp.idx) || ftell(r->fp.idx) == r->idx_size) : mm_bseq_eof(r->fp.seq);
 }

kalloc.c

@@ -1,175 +1,144 @@
 #include <stdio.h>
 #include <stdlib.h>
 #include <string.h>
-#include <limits.h>
 #include "kalloc.h"
 
-/* The whole thing is: ("@" for the kheader_t of the block, "-" for free
+/* In kalloc, a *core* is a large chunk of contiguous memory. Each core is
- * memory, and "+" for allocated memory. One char for one unit.)
+ * associated with a master header, which keeps the size of the current core
+ * and the pointer to next core. Kalloc allocates small *blocks* of memory from
+ * the cores and organizes free memory blocks in a circular single-linked list.
  *
- *           This region is core 1.                             This region is core 2.
+ * In the following diagram, "@" stands for the header of a free block (of type
+ * header_t), "#" for the header of an allocated block (of type size_t), "-"
+ * for free memory, and "+" for allocated memory.
  *
- *   @-------@++++++@++++++++++++@------------           @----------@++++++++++++@+++++++@------------
+ * master        This region is core 1.          master           This region is core 2.
+ *      |                                             |
+ *      *@-------#++++++#++++++++++++@--------        *@----------#++++++++++++#+++++++@------------
  *       |                           |                 |                               |
  *       p=p->ptr->ptr->ptr->ptr     p->ptr            p->ptr->ptr                     p->ptr->ptr->ptr
  */
 
-#define PTR(p) ((size_t*)((size_t*)p)[1])
+#define MIN_CORE_SIZE 0x80000
 
-typedef struct _allocated_t {
+typedef struct header_t {
-	struct _allocated_t *next;
+	size_t size;
-	size_t *ptr;
+	struct header_t *ptr;
-} allocated_t;
+} header_t;
 
 typedef struct {
-	size_t base[2], *loop_head;
+	header_t base, *loop_head, *core_head; /* base is a zero-sized block always kept in the loop */
-	allocated_t list_head, *list_tail;
-	size_t total_allocated;
 } kmem_t;
 
-void *km_init()
+static void panic(const char *s)
-{
-	return calloc(1, sizeof(kmem_t));
-}
-
-static void kerror(const char *s)
 {
 	fprintf(stderr, "%s\n", s);
-	exit(1);
+	abort();
 }
 
-static size_t *morecore(kmem_t *km, size_t nu)
+void *km_init(void)
 {
-	size_t rnu, *up;
+	return calloc(1, sizeof(kmem_t));
-
-	rnu = (nu + 0xfffff) & (~(size_t)0xfffff);
-	up = (size_t*)malloc(rnu * sizeof(size_t));
-	if (!up) { /* fail to allocate memory */
-		km_stat(km);
-		fprintf(stderr, "[morecore] %lu bytes requested but not available.\n", rnu * sizeof(size_t));
-		exit(1);
-	}
-	/* put the pointer in km->list_head */
-	if (km->list_tail == 0) km->list_tail = &km->list_head;
-	km->list_tail->ptr = up;
-	km->list_tail->next = (allocated_t*)calloc(1, sizeof(allocated_t));
-	km->list_tail = km->list_tail->next;
-
-	km->total_allocated += rnu * sizeof(size_t);
-	*up = rnu; /* the size of the current block, and in this case the block is the same as the new core */
-	kfree(km, up + 1); /* initialize the new "core" */
-	return km->loop_head;
 }
 
 void km_destroy(void *_km)
 {
 	kmem_t *km = (kmem_t*)_km;
-	allocated_t *p, *q;
+	header_t *p, *q;
-	if (km == 0) return;
+	if (km == NULL) return;
-	p = &km->list_head;
+	for (p = km->core_head; p != NULL;) {
-	do {
+		q = p->ptr;
-		q = p->next;
+		free(p);
-		free(p->ptr);
-		if (p != &km->list_head) free(p);
 		p = q;
-	} while (p && p->next);
+	}
-	if (p != &km->list_head) free(p);
 	free(km);
 }
 
-void kfree(void *_km, void *ap)
+static header_t *morecore(kmem_t *km, size_t nu)
 {
-	size_t *p, *q;
+	header_t *q;
+	size_t bytes, *p;
+	nu = (nu + 1 + (MIN_CORE_SIZE - 1)) / MIN_CORE_SIZE * MIN_CORE_SIZE; /* the first +1 for core header */
+	bytes = nu * sizeof(header_t);
+	q = (header_t*)malloc(bytes);
+	if (!q) panic("[morecore] insufficient memory");
+	q->ptr = km->core_head, q->size = nu, km->core_head = q;
+	p = (size_t*)(q + 1);
+	*p = nu - 1; /* the size of the free block; -1 because the first unit is used for the core header */
+	kfree(km, p + 1); /* initialize the new "core"; NB: the core header is not looped. */
+	return km->loop_head;
+}
+
+void kfree(void *_km, void *ap) /* kfree() also adds a new core to the circular list */
+{
+	header_t *p, *q;
 	kmem_t *km = (kmem_t*)_km;
 	
 	if (!ap) return;
-	if (km == 0) {
+	if (km == NULL) {
 		free(ap);
 		return;
 	}
-	p = (size_t*)ap - 1; /* *p is the size of the current block */
+	p = (header_t*)((size_t*)ap - 1);
+	p->size = *((size_t*)ap - 1);
 	/* Find the pointer that points to the block to be freed. The following loop can stop on two conditions:
 	 *
-	 * a) "p>q && p<q->ptr": @------@++++++++@+++++++@-------    @---------------@+++++++@-------
+	 * a) "p>q && p<q->ptr": @------#++++++++#+++++++@-------    @---------------#+++++++@-------
 	 *    (can also be in    |      |                |        -> |                       |
 	 *     two cores)        q      p           q->ptr           q                  q->ptr
 	 *
-	 *                       @--------    @+++++++++@--------    @--------    @------------------
+	 *                       @--------    #+++++++++@--------    @--------    @------------------
 	 *                       |            |         |         -> |            |
 	 *                       q            p    q->ptr            q       q->ptr
 	 *
-	 * b) "q>=q->ptr && (p>q || p<q->ptr)":  @-------@+++++   @--------@+++++++     @-------@+++++   @----------------
+	 * b) "q>=q->ptr && (p>q || p<q->ptr)":  @-------#+++++   @--------#+++++++     @-------#+++++   @----------------
 	 *                                       |                |        |         -> |                |
 	 *                                  q->ptr                q        p       q->ptr                q
 	 *
-	 *                                       @+++++++@-----   @++++++++@-------     @-------------   @++++++++@-------
+	 *                                       #+++++++@-----   #++++++++@-------     @-------------   #++++++++@-------
 	 *                                       |       |                 |         -> |                         |
 	 *                                       p  q->ptr                 q       q->ptr                         q
 	 */
-	for (q = km->loop_head; !(p > q && p < PTR(q)); q = PTR(q))
+	for (q = km->loop_head; !(p > q && p < q->ptr); q = q->ptr)
-		if (q >= PTR(q) && (p > q || p < PTR(q))) break;
+		if (q >= q->ptr && (p > q || p < q->ptr)) break;
-	if (p + (*p) == PTR(q)) { /* two adjacent blocks, merge p and q->ptr (the 2nd and 4th cases) */
+	if (p + p->size == q->ptr) { /* two adjacent blocks, merge p and q->ptr (the 2nd and 4th cases) */
-		*p += *PTR(q); /* this is the new q->ptr size */
+		p->size += q->ptr->size;
-		p[1] = (size_t)PTR(PTR(q)); /* this is the new q->ptr->ptr */
+		p->ptr = q->ptr->ptr;
-		/* p is actually the new q->ptr. The actual change happens a few lines below. */
+	} else if (p + p->size > q->ptr && q->ptr >= p) {
-	} else if (p + (*p) > PTR(q) && PTR(q) >= p) { /* the end of the allocated block is in the next free block */
+		panic("[kfree] The end of the allocated block enters a free block.");
-		kerror("[kfree] The end of the allocated block enters a free block.");
+	} else p->ptr = q->ptr; /* backup q->ptr */
-	} else p[1] = (size_t)PTR(q); /* backup q->ptr */
 
-	if (q + (*q) == p) { /* two adjacent blocks, merge q and p (the other two cases) */
+	if (q + q->size == p) { /* two adjacent blocks, merge q and p (the other two cases) */
-		*q += *p;
+		q->size += p->size;
-		q[1] = (size_t)PTR(p);
+		q->ptr = p->ptr;
 		km->loop_head = q;
-	} else if (q + (*q) > p && p >= q) { /* the end of a free block in the allocated block */
+	} else if (q + q->size > p && p >= q) {
-		kerror("[kfree] The end of a free block enters the allocated block.");
+		panic("[kfree] The end of a free block enters the allocated block.");
-	} else km->loop_head = p, q[1] = (size_t)p; /* in two cores, cannot be merged */
+	} else km->loop_head = p, q->ptr = p; /* in two cores, cannot be merged; create a new block in the list */
-}
-
-void *krealloc(void *_km, void *ap, size_t n_bytes)
-{
-	kmem_t *km = (kmem_t*)_km;
-	size_t n_units, *p, *q;
-
-	if (n_bytes == 0) {
-		kfree(km, ap); return 0;
-	}
-	if (km == 0) return realloc(ap, n_bytes);
-	if (!ap) return kmalloc(km, n_bytes);
-	n_units = 1 + (n_bytes + sizeof(size_t) - 1) / sizeof(size_t);
-	p = (size_t*)ap - 1;
-	if (*p >= n_units) return ap; /* TODO: this prevents shrinking */
-	q = (size_t*)kmalloc(km, n_bytes);
-	memcpy(q, ap, (*p - 1) * sizeof(size_t));
-	kfree(km, ap);
-	return q;
 }
 
 void *kmalloc(void *_km, size_t n_bytes)
 {
 	kmem_t *km = (kmem_t*)_km;
-	size_t n_units, *p, *q;
+	size_t n_units;
+	header_t *p, *q;
 
 	if (n_bytes == 0) return 0;
-	if (km == 0) return malloc(n_bytes);
+	if (km == NULL) return malloc(n_bytes);
-	/* "n_units" means the number of units. The size of one unit equals to sizeof(kheader_t).
+	n_units = (n_bytes + sizeof(size_t) + sizeof(header_t) - 1) / sizeof(header_t) + 1;
-	 * "1" is the kheader_t of a block, which is always required. */
-	n_units = 1 + (n_bytes + sizeof(size_t) - 1) / sizeof(size_t);
-	if (n_units&1) ++n_units; /* make n_units an even number, or it will segfault if only one unit remains */
 
-	if (!(q = km->loop_head)) { /* the first time when kmalloc() is called, intialization */
+	if (!(q = km->loop_head)) /* the first time when kmalloc() is called, intialize it */
-		km->base[1] = (size_t)(km->loop_head = q = km->base); *q = 0;
+		q = km->loop_head = km->base.ptr = &km->base;
-	}
+	for (p = q->ptr;; q = p, p = p->ptr) { /* search for a suitable block */
-	for (p = PTR(q);; q = p, p = PTR(p)) { /* search for a suitable block */
+		if (p->size >= n_units) { /* p->size if the size of current block. This line means the current block is large enough. */
-		if (*p >= n_units) { /* p->size if the size of current block. This line means the current block is large enough. */
+			if (p->size == n_units) q->ptr = p->ptr; /* no need to split the block */
-			if (*p == n_units) q[1] = (size_t)PTR(p); /* no need to split the block */
+			else { /* split the block. NB: memory is allocated at the end of the block! */
-			else { /* split the block */
+				p->size -= n_units; /* reduce the size of the free block */
-				/* memory is allocated at the end of the block */
+				p += p->size; /* p points to the allocated block */
-				*p -= n_units; /* reduce the size of the free block */
+				*(size_t*)p = n_units; /* set the size */
-				p += *p; /* skip to the kheader_t of the allocated block */
-				*p = n_units; /* set the size */
 			}
 			km->loop_head = q; /* set the end of chain */
-			return p + 1; /* skip the kheader_t */
+			return (size_t*)p + 1;
 		}
 		if (p == km->loop_head) { /* then ask for more "cores" */
 			if ((p = morecore(km, n_units)) == 0) return 0;
@@ -182,33 +151,48 @@ void *kcalloc(void *_km, size_t count, size_t size)
 	kmem_t *km = (kmem_t*)_km;
 	void *p;
 	if (size == 0 || count == 0) return 0;
-	if (km == 0) return calloc(count, size);
+	if (km == NULL) return calloc(count, size);
 	p = kmalloc(km, count * size);
 	memset(p, 0, count * size);
 	return p;
 }
 
-void km_stat(const void *_km)
+void *krealloc(void *_km, void *ap, size_t n_bytes) // TODO: this can be made more efficient in principle
 {
 	kmem_t *km = (kmem_t*)_km;
-	unsigned n_blocks, n_units;
+	size_t n_units, *p, *q;
-	size_t max_block = 0, *p, *q;
-	float frag;
 
-	if (km == 0 || !(p = km->loop_head)) return;
+	if (n_bytes == 0) {
-	n_blocks = n_units = 0;
+		kfree(km, ap); return 0;
-	do {
+	}
-		q = PTR(p);
+	if (km == NULL) return realloc(ap, n_bytes);
-		if (*p > max_block) max_block = *p;
+	if (ap == NULL) return kmalloc(km, n_bytes);
-		n_units += *p;
+	n_units = (n_bytes + sizeof(size_t) + sizeof(header_t) - 1) / sizeof(header_t);
-		if (p + (*p) > q && q > p)
+	p = (size_t*)ap - 1;
-			kerror("[kr_stat] The end of a free block enters another free block.");
+	if (*p >= n_units) return ap; /* TODO: this prevents shrinking */
-		p = q;
+	q = (size_t*)kmalloc(km, n_bytes);
-		++n_blocks;
+	memcpy(q, ap, (*p - 1) * sizeof(header_t));
-	} while (p != km->loop_head);
+	kfree(km, ap);
+	return q;
+}
 
-	--n_blocks;
+void km_stat(const void *_km, km_stat_t *s)
-	frag = 1.0/1024.0 * n_units * sizeof(size_t) / n_blocks;
+{
-	fprintf(stderr, "[kr_stat] tot=%lu, free=%lu, n_block=%u, max_block=%lu, frag_len=%.3fK\n",
+	kmem_t *km = (kmem_t*)_km;
-			km->total_allocated, n_units * sizeof(size_t), n_blocks, max_block * sizeof(size_t), frag);
+	header_t *p;
+	memset(s, 0, sizeof(km_stat_t));
+	if (km == NULL || km->loop_head == NULL) return;
+	for (p = km->loop_head;; p = p->ptr) {
+		s->available += p->size * sizeof(header_t);
+		if (p->size != 0) ++s->n_blocks; /* &kmem_t::base is always one of the cores. It is zero-sized. */
+		if (p->ptr > p && p + p->size > p->ptr)
+			panic("[km_stat] The end of a free block enters another free block.");
+		if (p->ptr == km->loop_head) break;
+	}
+	for (p = km->core_head; p != NULL; p = p->ptr) {
+		size_t size = p->size * sizeof(header_t);
+		++s->n_cores;
+		s->capacity += size;
+		s->largest = s->largest > size? s->largest : size;
+	}
 }

kalloc.h

@@ -1,14 +1,16 @@
 #ifndef _KALLOC_H_
 #define _KALLOC_H_
 
-#include <stdlib.h>
+#include <stddef.h> /* for size_t */
-
-#define km_size(x) (*(((size_t*)(x))-1) * sizeof(size_t))
 
 #ifdef __cplusplus
 extern "C" {
 #endif
 
+typedef struct {
+	size_t capacity, available, n_blocks, n_cores, largest;
+} km_stat_t;
+
 void *kmalloc(void *km, size_t size);
 void *krealloc(void *km, void *ptr, size_t size);
 void *kcalloc(void *km, size_t count, size_t size);
@@ -16,8 +18,7 @@ void kfree(void *km, void *ptr);
 
 void *km_init(void);
 void km_destroy(void *km);
-
+void km_stat(const void *_km, km_stat_t *s);
-void km_stat(const void *km); // TODO: return numbers instead of print to stderr
 
 #ifdef __cplusplus
 }

kdq.h

@@ -3,11 +3,12 @@
 
 #include <stdlib.h>
 #include <string.h>
+#include <stdint.h>
 #include "kalloc.h"
 
 #define __KDQ_TYPE(type) \
 	typedef struct { \
-		size_t front:58, bits:6, count, mask; \
+		uint64_t front:58, bits:6, count, mask; \
 		type *a; \
 		void *km; \
 	} kdq_##type##_t;

ksort.h

@@ -30,6 +30,7 @@
 
 #include <stdlib.h>
 #include <string.h>
+#include <assert.h>
 
 typedef struct {
 	void *left, *right;
@@ -39,6 +40,23 @@ typedef struct {
 #define KSORT_SWAP(type_t, a, b) { register type_t t=(a); (a)=(b); (b)=t; }
 
 #define KSORT_INIT(name, type_t, __sort_lt) \
+	void ks_heapdown_##name(size_t i, size_t n, type_t l[]) \
+	{ \
+		size_t k = i; \
+		type_t tmp = l[i]; \
+		while ((k = (k << 1) + 1) < n) { \
+			if (k != n - 1 && __sort_lt(l[k], l[k+1])) ++k; \
+			if (__sort_lt(l[k], tmp)) break; \
+			l[i] = l[k]; i = k; \
+		} \
+		l[i] = tmp; \
+	} \
+	void ks_heapmake_##name(size_t lsize, type_t l[]) \
+	{ \
+		size_t i; \
+		for (i = (lsize >> 1) - 1; i != (size_t)(-1); --i) \
+			ks_heapdown_##name(i, lsize, l); \
+	} \
 	type_t ks_ksmall_##name(size_t n, type_t arr[], size_t kk)			\
 	{																	\
 		type_t *low, *high, *k, *ll, *hh, *mid;							\
@@ -78,6 +96,7 @@ typedef const char *ksstr_t;
 #define KSORT_INIT_STR KSORT_INIT(str, ksstr_t, ks_lt_str)
 
 #define RS_MIN_SIZE 64
+#define RS_MAX_BITS 8
 
 #define KRADIX_SORT_INIT(name, rstype_t, rskey, sizeof_key) \
 	typedef struct { \
@@ -98,7 +117,8 @@ typedef const char *ksstr_t;
 	{ \
 		rstype_t *i; \
 		int size = 1<<n_bits, m = size - 1; \
-		rsbucket_##name##_t *k, b[size], *be = b + size; \
+		rsbucket_##name##_t *k, b[1<<RS_MAX_BITS], *be = b + size; \
+		assert(n_bits <= RS_MAX_BITS); \
 		for (k = b; k != be; ++k) k->b = k->e = beg; \
 		for (i = beg; i != end; ++i) ++b[rskey(*i)>>s&m].e; \
 		for (k = b + 1; k != be; ++k) \
@@ -127,7 +147,7 @@ typedef const char *ksstr_t;
 	void radix_sort_##name(rstype_t *beg, rstype_t *end) \
 	{ \
 		if (end - beg <= RS_MIN_SIZE) rs_insertsort_##name(beg, end); \
-		else rs_sort_##name(beg, end, 8, sizeof_key * 8 - 8); \
+		else rs_sort_##name(beg, end, RS_MAX_BITS, (sizeof_key - 1) * RS_MAX_BITS); \
 	}
 
 #endif

ksw2.h

@@ -12,6 +12,9 @@
 #define KSW_EZ_APPROX_DROP 0x10 // approximate Z-drop; faster with sse
 #define KSW_EZ_EXTZ_ONLY   0x40 // only perform extension
 #define KSW_EZ_REV_CIGAR   0x80 // reverse CIGAR in the output
+#define KSW_EZ_SPLICE_FOR  0x100
+#define KSW_EZ_SPLICE_REV  0x200
+#define KSW_EZ_SPLICE_FLANK 0x400
 
 #ifdef __cplusplus
 extern "C" {
@@ -24,6 +27,7 @@ typedef struct {
 	int mte, mte_q;        // max score when reaching the end of target
 	int score;             // max score reaching both ends; may be KSW_NEG_INF
 	int m_cigar, n_cigar;
+	int reach_end;
 	uint32_t *cigar;
 } ksw_extz_t;
 
@@ -39,19 +43,27 @@ typedef struct {
  * @param mat       m*m scoring mattrix in one-dimension array
  * @param gapo      gap open penalty; a gap of length l cost "-(gapo+l*gape)"
  * @param gape      gap extension penalty
- * @param w         band width
+ * @param w         band width (<0 to disable)
- * @param zdrop     off-diagonal drop-off to stop extension (positive)
+ * @param zdrop     off-diagonal drop-off to stop extension (positive; <0 to disable)
  * @param flag      flag (see KSW_EZ_* macros)
  * @param ez        (out) scores and cigar
  */
-void ksw_extz(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int flag, ksw_extz_t *ez);
+void ksw_extz(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
-void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int flag, ksw_extz_t *ez);
+			  int8_t q, int8_t e, int w, int zdrop, int flag, ksw_extz_t *ez);
+
+void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
+				   int8_t q, int8_t e, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
 
 void ksw_extd(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
 			  int8_t gapo, int8_t gape, int8_t gapo2, int8_t gape2, int w, int zdrop, int flag, ksw_extz_t *ez);
 
 void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
-				   int8_t gapo, int8_t gape, int8_t gapo2, int8_t gape2, int w, int zdrop, int flag, ksw_extz_t *ez);
+				   int8_t gapo, int8_t gape, int8_t gapo2, int8_t gape2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
+
+void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
+				   int8_t gapo, int8_t gape, int8_t gapo2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez);
+
+void ksw_extf2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t mch, int8_t mis, int8_t e, int w, int xdrop, ksw_extz_t *ez);
 
 /**
  * Global alignment
@@ -67,6 +79,9 @@ int ksw_gg(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *ta
 int ksw_gg2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t gapo, int8_t gape, int w, int *m_cigar_, int *n_cigar_, uint32_t **cigar_);
 int ksw_gg2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t gapo, int8_t gape, int w, int *m_cigar_, int *n_cigar_, uint32_t **cigar_);
 
+void *ksw_ll_qinit(void *km, int size, int qlen, const uint8_t *query, int m, const int8_t *mat);
+int ksw_ll_i16(void *q, int tlen, const uint8_t *target, int gapo, int gape, int *qe, int *te);
+
 #ifdef __cplusplus
 }
 #endif
@@ -101,21 +116,33 @@ static inline uint32_t *ksw_push_cigar(void *km, int *n_cigar, int *m_cigar, uin
 //   bit 0-2: which type gets the max - 0 for H, 1 for E, 2 for F, 3 for \tilde{E} and 4 for \tilde{F}
 //   bit 3/0x08: 1 if a continuation on the E state (bit 5/0x20 for a continuation on \tilde{E})
 //   bit 4/0x10: 1 if a continuation on the F state (bit 6/0x40 for a continuation on \tilde{F})
-static inline void ksw_backtrack(void *km, int is_rot, int is_rev, const uint8_t *p, const int *off, int n_col, int i0, int j0, int *m_cigar_, int *n_cigar_, uint32_t **cigar_)
+static inline void ksw_backtrack(void *km, int is_rot, int is_rev, int min_intron_len, const uint8_t *p, const int *off, const int *off_end, int n_col, int i0, int j0,
+								 int *m_cigar_, int *n_cigar_, uint32_t **cigar_)
 { // p[] - lower 3 bits: which type gets the max; bit
 	int n_cigar = 0, m_cigar = *m_cigar_, i = i0, j = j0, r, state = 0;
 	uint32_t *cigar = *cigar_, tmp;
 	while (i >= 0 && j >= 0) { // at the beginning of the loop, _state_ tells us which state to check
-		if (is_rot) r = i + j, tmp = p[r * n_col + i - off[r]];
+		int force_state = -1;
-		else tmp = p[i * n_col + j - off[i]];
+		if (is_rot) {
+			r = i + j;
+			if (i < off[r]) force_state = 2;
+			if (off_end && i > off_end[r]) force_state = 1;
+			tmp = force_state < 0? p[(size_t)r * n_col + i - off[r]] : 0;
+		} else {
+			if (j < off[i]) force_state = 2;
+			if (off_end && j > off_end[i]) force_state = 1;
+			tmp = force_state < 0? p[(size_t)i * n_col + j - off[i]] : 0;
+		}
 		if (state == 0) state = tmp & 7; // if requesting the H state, find state one maximizes it.
 		else if (!(tmp >> (state + 2) & 1)) state = 0; // if requesting other states, _state_ stays the same if it is a continuation; otherwise, set to H
 		if (state == 0) state = tmp & 7; // TODO: probably this line can be merged into the "else if" line right above; not 100% sure
+		if (force_state >= 0) state = force_state;
 		if (state == 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 0, 1), --i, --j; // match
-		else if (state == 1 || state == 3) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 2, 1), --i; // deletion
+		else if (state == 1 || (state == 3 && min_intron_len <= 0)) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 2, 1), --i; // deletion
+		else if (state == 3 && min_intron_len > 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 3, 1), --i; // intron
 		else cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 1, 1), --j; // insertion
 	}
-	if (i >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 2, i + 1); // first deletion
+	if (i >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, min_intron_len > 0 && i >= min_intron_len? 3 : 2, i + 1); // first deletion
 	if (j >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 1, j + 1); // first insertion
 	if (!is_rev)
 		for (i = 0; i < n_cigar>>1; ++i) // reverse CIGAR
@@ -127,7 +154,7 @@ static inline void ksw_reset_extz(ksw_extz_t *ez)
 {
 	ez->max_q = ez->max_t = ez->mqe_t = ez->mte_q = -1;
 	ez->max = 0, ez->score = ez->mqe = ez->mte = KSW_NEG_INF;
-	ez->n_cigar = 0, ez->zdropped = 0;
+	ez->n_cigar = 0, ez->zdropped = 0, ez->reach_end = 0;
 }
 
 static inline int ksw_apply_zdrop(ksw_extz_t *ez, int is_rot, int32_t H, int a, int b, int zdrop, int8_t e)
@@ -147,5 +174,4 @@ static inline int ksw_apply_zdrop(ksw_extz_t *ez, int is_rot, int32_t H, int a,
 	}
 	return 0;
 }
-
 #endif

ksw2_dispatch.c

@@ -0,0 +1,97 @@
+#ifdef KSW_CPU_DISPATCH
+#include <stdlib.h>
+#include "ksw2.h"
+
+#define SIMD_SSE     0x1
+#define SIMD_SSE2    0x2
+#define SIMD_SSE3    0x4
+#define SIMD_SSSE3   0x8
+#define SIMD_SSE4_1  0x10
+#define SIMD_SSE4_2  0x20
+#define SIMD_AVX     0x40
+#define SIMD_AVX2    0x80
+#define SIMD_AVX512F 0x100
+
+#ifndef _MSC_VER
+// adapted from https://github.com/01org/linux-sgx/blob/master/common/inc/internal/linux/cpuid_gnu.h
+void __cpuidex(int cpuid[4], int func_id, int subfunc_id)
+{
+#if defined(__x86_64__)
+	asm volatile ("cpuid"
+			: "=a" (cpuid[0]), "=b" (cpuid[1]), "=c" (cpuid[2]), "=d" (cpuid[3])
+			: "0" (func_id), "2" (subfunc_id));
+#else // on 32bit, ebx can NOT be used as PIC code
+	asm volatile ("xchgl %%ebx, %1; cpuid; xchgl %%ebx, %1"
+			: "=a" (cpuid[0]), "=r" (cpuid[1]), "=c" (cpuid[2]), "=d" (cpuid[3])
+			: "0" (func_id), "2" (subfunc_id));
+#endif
+}
+#endif
+
+int x86_simd(void)
+{
+	int flag = 0, cpuid[4], max_id;
+	__cpuidex(cpuid, 0, 0);
+	max_id = cpuid[0];
+	if (max_id == 0) return 0;
+	__cpuidex(cpuid, 1, 0);
+	if (cpuid[3]>>25&1) flag |= SIMD_SSE;
+	if (cpuid[3]>>26&1) flag |= SIMD_SSE2;
+	if (cpuid[2]>>0 &1) flag |= SIMD_SSE3;
+	if (cpuid[2]>>9 &1) flag |= SIMD_SSSE3;
+	if (cpuid[2]>>19&1) flag |= SIMD_SSE4_1;
+	if (cpuid[2]>>20&1) flag |= SIMD_SSE4_2;
+	if (cpuid[2]>>28&1) flag |= SIMD_AVX;
+	if (max_id >= 7) {
+		__cpuidex(cpuid, 7, 0);
+		if (cpuid[1]>>5 &1) flag |= SIMD_AVX2;
+		if (cpuid[1]>>16&1) flag |= SIMD_AVX512F;
+	}
+	return flag;
+}
+
+void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez)
+{
+	extern void ksw_extz2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
+	extern void ksw_extz2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
+	unsigned simd;
+	simd = x86_simd();
+	if (simd & SIMD_SSE4_1)
+		ksw_extz2_sse41(km, qlen, query, tlen, target, m, mat, q, e, w, zdrop, end_bonus, flag, ez);
+	else if (simd & SIMD_SSE2)
+		ksw_extz2_sse2(km, qlen, query, tlen, target, m, mat, q, e, w, zdrop, end_bonus, flag, ez);
+	else abort();
+}
+
+void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
+				   int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez)
+{
+	extern void ksw_extd2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
+				   int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
+	extern void ksw_extd2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
+				   int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
+	unsigned simd;
+	simd = x86_simd();
+	if (simd & SIMD_SSE4_1)
+		ksw_extd2_sse41(km, qlen, query, tlen, target, m, mat, q, e, q2, e2, w, zdrop, end_bonus, flag, ez);
+	else if (simd & SIMD_SSE2)
+		ksw_extd2_sse2(km, qlen, query, tlen, target, m, mat, q, e, q2, e2, w, zdrop, end_bonus, flag, ez);
+	else abort();
+}
+
+void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
+				   int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez)
+{
+	extern void ksw_exts2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
+				   int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez);
+	extern void ksw_exts2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
+				   int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez);
+	unsigned simd;
+	simd = x86_simd();
+	if (simd & SIMD_SSE4_1)
+		ksw_exts2_sse41(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, flag, ez);
+	else if (simd & SIMD_SSE2)
+		ksw_exts2_sse2(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, flag, ez);
+	else abort();
+}
+#endif

ksw2_extd2_sse.c

@@ -1,16 +1,31 @@
 #include <string.h>
 #include <stdio.h>
+#include <assert.h>
 #include "ksw2.h"
 
 #ifdef __SSE2__
 #include <emmintrin.h>
 
+#ifdef KSW_SSE2_ONLY
+#undef __SSE4_1__
+#endif
+
 #ifdef __SSE4_1__
 #include <smmintrin.h>
 #endif
 
+#ifdef KSW_CPU_DISPATCH
+#ifdef __SSE4_1__
+void ksw_extd2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
+				   int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez)
+#else
+void ksw_extd2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
+				   int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez)
+#endif
+#else
 void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
-				   int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int flag, ksw_extz_t *ez)
+				   int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez)
+#endif // ~KSW_CPU_DISPATCH
 {
 #define __dp_code_block1 \
 	z = _mm_load_si128(&s[t]); \
@@ -42,11 +57,11 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
 	a2= _mm_sub_epi8(a2, tmp); \
 	b2= _mm_sub_epi8(b2, tmp);
 
-	int r, t, qe = q + e, n_col_, *off = 0, tlen_, qlen_, last_st, last_en, wl, wr, max_sc, min_sc, long_thres, long_diff;
+	int r, t, qe = q + e, n_col_, *off = 0, *off_end = 0, tlen_, qlen_, last_st, last_en, wl, wr, max_sc, min_sc, long_thres, long_diff;
 	int with_cigar = !(flag&KSW_EZ_SCORE_ONLY), approx_max = !!(flag&KSW_EZ_APPROX_MAX);
 	int32_t *H = 0, H0 = 0, last_H0_t = 0;
 	uint8_t *qr, *sf, *mem, *mem2 = 0;
-	__m128i q_, q2_, qe_, qe2_, zero_, sc_mch_, sc_mis_, m1_;
+	__m128i q_, q2_, qe_, qe2_, zero_, sc_mch_, sc_mis_, m1_, sc_N_;
 	__m128i *u, *v, *x, *y, *x2, *y2, *s, *p = 0;
 
 	ksw_reset_extz(ez);
@@ -61,12 +76,14 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
 	qe2_    = _mm_set1_epi8(q2 + e2);
 	sc_mch_ = _mm_set1_epi8(mat[0]);
 	sc_mis_ = _mm_set1_epi8(mat[1]);
+	sc_N_   = mat[m*m-1] == 0? _mm_set1_epi8(-e2) : _mm_set1_epi8(mat[m*m-1]);
 	m1_     = _mm_set1_epi8(m - 1); // wildcard
 
 	if (w < 0) w = tlen > qlen? tlen : qlen;
 	wl = wr = w;
 	tlen_ = (tlen + 15) / 16;
-	n_col_ = ((w + 1 < tlen? (w + 1 < qlen? w + 1 : qlen): tlen) + 15) / 16 + 1;
+	n_col_ = qlen < tlen? qlen : tlen;
+	n_col_ = ((n_col_ < w + 1? n_col_ : w + 1) + 15) / 16 + 1;
 	qlen_ = (qlen + 15) / 16;
 	for (t = 1, max_sc = mat[0], min_sc = mat[1]; t < m * m; ++t) {
 		max_sc = max_sc > mat[t]? max_sc : mat[t];
@@ -94,9 +111,10 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
 		for (t = 0; t < tlen_ * 16; ++t) H[t] = KSW_NEG_INF;
 	}
 	if (with_cigar) {
-		mem2 = (uint8_t*)kmalloc(km, ((qlen + tlen - 1) * n_col_ + 1) * 16);
+		mem2 = (uint8_t*)kmalloc(km, ((size_t)(qlen + tlen - 1) * n_col_ + 1) * 16);
 		p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4);
-		off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int));
+		off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int) * 2);
+		off_end = off + qlen + tlen - 1;
 	}
 
 	for (t = 0; t < qlen; ++t) qr[t] = query[qlen - 1 - t];
@@ -105,7 +123,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
 	for (r = 0, last_st = last_en = -1; r < qlen + tlen - 1; ++r) {
 		int st = 0, en = tlen - 1, st0, en0, st_, en_;
 		int8_t x1, x21, v1;
-		uint8_t *qrr = qr + (qlen - 1 - r), p_en0 = 0;
+		uint8_t *qrr = qr + (qlen - 1 - r);
 		int8_t *u8 = (int8_t*)u, *v8 = (int8_t*)v, *x8 = (int8_t*)x, *x28 = (int8_t*)x2;
 		__m128i x1_, x21_, v1_;
 		// find the boundaries
@@ -145,10 +163,11 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
 				tmp = _mm_cmpeq_epi8(sq, st);
 #ifdef __SSE4_1__
 				tmp = _mm_blendv_epi8(sc_mis_, sc_mch_, tmp);
+				tmp = _mm_blendv_epi8(tmp,     sc_N_,   mask);
 #else
 				tmp = _mm_or_si128(_mm_andnot_si128(tmp,  sc_mis_), _mm_and_si128(tmp,  sc_mch_));
+				tmp = _mm_or_si128(_mm_andnot_si128(mask, tmp),     _mm_and_si128(mask, sc_N_));
 #endif
-				tmp = _mm_andnot_si128(mask, tmp);
 				_mm_storeu_si128((__m128i*)((int8_t*)s + t), tmp);
 			}
 		} else {
@@ -160,6 +179,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
 		x21_ = _mm_cvtsi32_si128((uint8_t)x21);
 		v1_  = _mm_cvtsi32_si128((uint8_t)v1);
 		st_ = st / 16, en_ = en / 16;
+		assert(en_ - st_ + 1 <= n_col_);
 		if (!with_cigar) { // score only
 			for (t = st_; t <= en_; ++t) {
 				__m128i z, a, b, a2, b2, xt1, x2t1, vt1, ut, tmp;
@@ -198,19 +218,8 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
 #endif
 			}
 		} else if (!(flag&KSW_EZ_RIGHT)) { // gap left-alignment
-			__m128i *pr = p + r * n_col_ - st_;
+			__m128i *pr = p + (size_t)r * n_col_ - st_;
-			off[r] = st;
+			off[r] = st, off_end[r] = en;
-			if (en0 < r && en0 < tlen - 1) { // to avoid backtracking out of the band; this assumes a fixed band
-				int8_t a, a2, z = ((uint8_t*)s)[en0];
-				a = x8[en0-1] + v8[en0-1];
-				p_en0 = a > z? 1 : 0;
-				z = a > z? a : z;
-				p_en0 |= a - (z - q) > 0? 1<<4 : 0;
-				a2 = x28[en0-1] + v8[en0-1];
-				p_en0 = a2 > z? 3 : p_en0;
-				z = a2 > z? a2 : z;
-				p_en0 |= a2 - (z - q2) > 0? 1<<6 : 0;
-			}
 			for (t = st_; t <= en_; ++t) {
 				__m128i d, z, a, b, a2, b2, xt1, x2t1, vt1, ut, tmp;
 				__dp_code_block1;
@@ -256,19 +265,8 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
 				_mm_store_si128(&pr[t], d);
 			}
 		} else { // gap right-alignment
-			__m128i *pr = p + r * n_col_ - st_;
+			__m128i *pr = p + (size_t)r * n_col_ - st_;
-			off[r] = st;
+			off[r] = st, off_end[r] = en;
-			if (en0 < r && en0 < tlen - 1) { // to avoid backtracking out of the band; this assumes a fixed band
-				int8_t a, a2, z = ((uint8_t*)s)[en0];
-				a = x8[en0-1] + v8[en0-1];
-				p_en0 = a >= z? 1 : 0;
-				z = a >= z? a : z;
-				p_en0 |= a - (z - q) >= 0? 1<<4 : 0;
-				a2 = x28[en0-1] + v8[en0-1];
-				p_en0 = a2 >= z? 3 : p_en0;
-				z = a2 >= z? a2 : z;
-				p_en0 |= a2 - (z - q2) >= 0? 1<<6 : 0;
-			}
 			for (t = st_; t <= en_; ++t) {
 				__m128i d, z, a, b, a2, b2, xt1, x2t1, vt1, ut, tmp;
 				__dp_code_block1;
@@ -314,7 +312,6 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
 				_mm_store_si128(&pr[t], d);
 			}
 		}
-		if (with_cigar && en0 < r && en0 < tlen - 1) ((uint8_t*)(p + r * n_col_))[en0 - st] = p_en0;
 		if (!approx_max) { // find the exact max with a 32-bit score array
 			int32_t max_H, max_t;
 			// compute H[], max_H and max_t
@@ -383,10 +380,14 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
 	if (!approx_max) kfree(km, H);
 	if (with_cigar) { // backtrack
 		int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
-		if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY))
+		if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY)) {
-			ksw_backtrack(km, 1, rev_cigar, (uint8_t*)p, off, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
+			ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
-		else if (ez->max_t >= 0 && ez->max_q >= 0)
+		} else if (!ez->zdropped && (flag&KSW_EZ_EXTZ_ONLY) && ez->mqe + end_bonus > (int)ez->max) {
-			ksw_backtrack(km, 1, rev_cigar, (uint8_t*)p, off, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
+			ez->reach_end = 1;
+			ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, ez->mqe_t, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
+		} else if (ez->max_t >= 0 && ez->max_q >= 0) {
+			ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
+		}
 		kfree(km, mem2); kfree(km, off);
 	}
 }

ksw2_exts2_sse.c

@@ -0,0 +1,376 @@
+#include <string.h>
+#include <stdio.h>
+#include <assert.h>
+#include "ksw2.h"
+
+#ifdef __SSE2__
+#include <emmintrin.h>
+
+#ifdef KSW_SSE2_ONLY
+#undef __SSE4_1__
+#endif
+
+#ifdef __SSE4_1__
+#include <smmintrin.h>
+#endif
+
+#ifdef KSW_CPU_DISPATCH
+#ifdef __SSE4_1__
+void ksw_exts2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
+				   int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez)
+#else
+void ksw_exts2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
+				   int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez)
+#endif
+#else
+void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
+				   int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez)
+#endif // ~KSW_CPU_DISPATCH
+{
+#define __dp_code_block1 \
+	z = _mm_load_si128(&s[t]); \
+	xt1 = _mm_load_si128(&x[t]);                     /* xt1 <- x[r-1][t..t+15] */ \
+	tmp = _mm_srli_si128(xt1, 15);                   /* tmp <- x[r-1][t+15] */ \
+	xt1 = _mm_or_si128(_mm_slli_si128(xt1, 1), x1_); /* xt1 <- x[r-1][t-1..t+14] */ \
+	x1_ = tmp; \
+	vt1 = _mm_load_si128(&v[t]);                     /* vt1 <- v[r-1][t..t+15] */ \
+	tmp = _mm_srli_si128(vt1, 15);                   /* tmp <- v[r-1][t+15] */ \
+	vt1 = _mm_or_si128(_mm_slli_si128(vt1, 1), v1_); /* vt1 <- v[r-1][t-1..t+14] */ \
+	v1_ = tmp; \
+	a = _mm_add_epi8(xt1, vt1);                      /* a <- x[r-1][t-1..t+14] + v[r-1][t-1..t+14] */ \
+	ut = _mm_load_si128(&u[t]);                      /* ut <- u[t..t+15] */ \
+	b = _mm_add_epi8(_mm_load_si128(&y[t]), ut);     /* b <- y[r-1][t..t+15] + u[r-1][t..t+15] */ \
+	x2t1= _mm_load_si128(&x2[t]); \
+	tmp = _mm_srli_si128(x2t1, 15); \
+	x2t1= _mm_or_si128(_mm_slli_si128(x2t1, 1), x21_); \
+	x21_= tmp; \
+	a2  = _mm_add_epi8(x2t1, vt1); \
+	a2a = _mm_add_epi8(a2, _mm_load_si128(&acceptor[t]));
+
+#define __dp_code_block2 \
+	_mm_store_si128(&u[t], _mm_sub_epi8(z, vt1));    /* u[r][t..t+15] <- z - v[r-1][t-1..t+14] */ \
+	_mm_store_si128(&v[t], _mm_sub_epi8(z, ut));     /* v[r][t..t+15] <- z - u[r-1][t..t+15] */ \
+	tmp = _mm_sub_epi8(z, q_); \
+	a = _mm_sub_epi8(a, tmp); \
+	b = _mm_sub_epi8(b, tmp); \
+	a2= _mm_sub_epi8(a2, _mm_sub_epi8(z, q2_));
+
+	int r, t, qe = q + e, n_col_, *off = 0, *off_end = 0, tlen_, qlen_, last_st, last_en, max_sc, min_sc, long_thres, long_diff;
+	int with_cigar = !(flag&KSW_EZ_SCORE_ONLY), approx_max = !!(flag&KSW_EZ_APPROX_MAX);
+	int32_t *H = 0, H0 = 0, last_H0_t = 0;
+	uint8_t *qr, *sf, *mem, *mem2 = 0;
+	__m128i q_, q2_, qe_, zero_, sc_mch_, sc_mis_, sc_N_, m1_;
+	__m128i *u, *v, *x, *y, *x2, *s, *p = 0, *donor, *acceptor;
+
+	ksw_reset_extz(ez);
+	if (m <= 1 || qlen <= 0 || tlen <= 0 || q2 <= q + e) return;
+
+	zero_   = _mm_set1_epi8(0);
+	q_      = _mm_set1_epi8(q);
+	q2_     = _mm_set1_epi8(q2);
+	qe_     = _mm_set1_epi8(q + e);
+	sc_mch_ = _mm_set1_epi8(mat[0]);
+	sc_mis_ = _mm_set1_epi8(mat[1]);
+	sc_N_   = mat[m*m-1] == 0? _mm_set1_epi8(-e) : _mm_set1_epi8(mat[m*m-1]);
+	m1_     = _mm_set1_epi8(m - 1); // wildcard
+
+	tlen_ = (tlen + 15) / 16;
+	n_col_ = ((qlen < tlen? qlen : tlen) + 15) / 16 + 1;
+	qlen_ = (qlen + 15) / 16;
+	for (t = 1, max_sc = mat[0], min_sc = mat[1]; t < m * m; ++t) {
+		max_sc = max_sc > mat[t]? max_sc : mat[t];
+		min_sc = min_sc < mat[t]? min_sc : mat[t];
+	}
+	if (-min_sc > 2 * (q + e)) return; // otherwise, we won't see any mismatches
+
+	long_thres = (q2 - q) / e - 1;
+	if (q2 > q + e + long_thres * e)
+		++long_thres;
+	long_diff = long_thres * e - (q2 - q);
+
+	mem = (uint8_t*)kcalloc(km, tlen_ * 9 + qlen_ + 1, 16);
+	u = (__m128i*)(((size_t)mem + 15) >> 4 << 4); // 16-byte aligned
+	v = u + tlen_, x = v + tlen_, y = x + tlen_, x2 = y + tlen_;
+	donor = x2 + tlen_, acceptor = donor + tlen_;
+	s = acceptor + tlen_, sf = (uint8_t*)(s + tlen_), qr = sf + tlen_ * 16;
+	memset(u,  -q - e,  tlen_ * 16 * 4); // this set u, v, x, y (because they are in the same array)
+	memset(x2, -q2,     tlen_ * 16);
+	if (!approx_max) {
+		H = (int32_t*)kmalloc(km, tlen_ * 16 * 4);
+		for (t = 0; t < tlen_ * 16; ++t) H[t] = KSW_NEG_INF;
+	}
+	if (with_cigar) {
+		mem2 = (uint8_t*)kmalloc(km, ((qlen + tlen - 1) * n_col_ + 1) * 16);
+		p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4);
+		off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int) * 2);
+		off_end = off + qlen + tlen - 1;
+	}
+
+	for (t = 0; t < qlen; ++t) qr[t] = query[qlen - 1 - t];
+	memcpy(sf, target, tlen);
+
+	// set the donor and acceptor arrays. TODO: this assumes 0/1/2/3 encoding!
+	if (flag & (KSW_EZ_SPLICE_FOR|KSW_EZ_SPLICE_REV)) {
+		int semi_cost = flag&KSW_EZ_SPLICE_FLANK? -noncan/2 : 0; // GTr or yAG is worth 0.5 bit; see PMID:18688272
+		memset(donor, -noncan, tlen_ * 16);
+		for (t = 0; t < tlen - 4; ++t) {
+			int can_type = 0; // type of canonical site: 0=none, 1=GT/AG only, 2=GTr/yAG
+			if ((flag & KSW_EZ_SPLICE_FOR) && target[t+1] == 2 && target[t+2] == 3) can_type = 1; // GTr...
+			if ((flag & KSW_EZ_SPLICE_REV) && target[t+1] == 1 && target[t+2] == 3) can_type = 1; // CTr...
+			if (can_type && (target[t+3] == 0 || target[t+3] == 2)) can_type = 2;
+			if (can_type) ((int8_t*)donor)[t] = can_type == 2? 0 : semi_cost;
+		}
+		memset(acceptor, -noncan, tlen_ * 16);
+		for (t = 2; t < tlen; ++t) {
+			int can_type = 0;
+			if ((flag & KSW_EZ_SPLICE_FOR) && target[t-1] == 0 && target[t] == 2) can_type = 1; // ...yAG
+			if ((flag & KSW_EZ_SPLICE_REV) && target[t-1] == 0 && target[t] == 1) can_type = 1; // ...yAC
+			if (can_type && (target[t-2] == 1 || target[t-2] == 3)) can_type = 2;
+			if (can_type) ((int8_t*)acceptor)[t] = can_type == 2? 0 : semi_cost;
+		}
+	}
+
+	for (r = 0, last_st = last_en = -1; r < qlen + tlen - 1; ++r) {
+		int st = 0, en = tlen - 1, st0, en0, st_, en_;
+		int8_t x1, x21, v1, *u8 = (int8_t*)u, *v8 = (int8_t*)v;
+		uint8_t *qrr = qr + (qlen - 1 - r);
+		__m128i x1_, x21_, v1_;
+		// find the boundaries
+		if (st < r - qlen + 1) st = r - qlen + 1;
+		if (en > r) en = r;
+		st0 = st, en0 = en;
+		st = st / 16 * 16, en = (en + 16) / 16 * 16 - 1;
+		// set boundary conditions
+		if (st > 0) {
+			if (st - 1 >= last_st && st - 1 <= last_en)
+				x1 = ((int8_t*)x)[st - 1], x21 = ((int8_t*)x2)[st - 1], v1 = v8[st - 1]; // (r-1,s-1) calculated in the last round
+			else x1 = -q - e, x21 = -q2, v1 = -q - e;
+		} else {
+			x1 = -q - e, x21 = -q2;
+			v1 = r == 0? -q - e : r < long_thres? -e : r == long_thres? long_diff : 0;
+		}
+		if (en >= r) {
+			((int8_t*)y)[r] = -q - e;
+			u8[r] = r == 0? -q - e : r < long_thres? -e : r == long_thres? long_diff : 0;
+		}
+		// loop fission: set scores first
+		if (!(flag & KSW_EZ_GENERIC_SC)) {
+			for (t = st0; t <= en0; t += 16) {
+				__m128i sq, st, tmp, mask;
+				sq = _mm_loadu_si128((__m128i*)&sf[t]);
+				st = _mm_loadu_si128((__m128i*)&qrr[t]);
+				mask = _mm_or_si128(_mm_cmpeq_epi8(sq, m1_), _mm_cmpeq_epi8(st, m1_));
+				tmp = _mm_cmpeq_epi8(sq, st);
+#ifdef __SSE4_1__
+				tmp = _mm_blendv_epi8(sc_mis_, sc_mch_, tmp);
+				tmp = _mm_blendv_epi8(tmp,     sc_N_,   mask);
+#else
+				tmp = _mm_or_si128(_mm_andnot_si128(tmp,  sc_mis_), _mm_and_si128(tmp,  sc_mch_));
+				tmp = _mm_or_si128(_mm_andnot_si128(mask, tmp),     _mm_and_si128(mask, sc_N_));
+#endif
+				_mm_storeu_si128((__m128i*)((int8_t*)s + t), tmp);
+			}
+		} else {
+			for (t = st0; t <= en0; ++t)
+				((uint8_t*)s)[t] = mat[sf[t] * m + qrr[t]];
+		}
+		// core loop
+		x1_  = _mm_cvtsi32_si128((uint8_t)x1);
+		x21_ = _mm_cvtsi32_si128((uint8_t)x21);
+		v1_  = _mm_cvtsi32_si128((uint8_t)v1);
+		st_ = st / 16, en_ = en / 16;
+		assert(en_ - st_ + 1 <= n_col_);
+		if (!with_cigar) { // score only
+			for (t = st_; t <= en_; ++t) {
+				__m128i z, a, b, a2, a2a, xt1, x2t1, vt1, ut, tmp;
+				__dp_code_block1;
+#ifdef __SSE4_1__
+				z = _mm_max_epi8(z, a);
+				z = _mm_max_epi8(z, b);
+				z = _mm_max_epi8(z, a2a);
+				__dp_code_block2; // save u[] and v[]; update a, b and a2
+				_mm_store_si128(&x[t],  _mm_sub_epi8(_mm_max_epi8(a,  zero_), qe_));
+				_mm_store_si128(&y[t],  _mm_sub_epi8(_mm_max_epi8(b,  zero_), qe_));
+				tmp = _mm_load_si128(&donor[t]);
+				_mm_store_si128(&x2[t], _mm_sub_epi8(_mm_max_epi8(a2, tmp), q2_));
+#else
+				tmp = _mm_cmpgt_epi8(a,  z);
+				z = _mm_or_si128(_mm_andnot_si128(tmp, z), _mm_and_si128(tmp, a));
+				tmp = _mm_cmpgt_epi8(b,  z);
+				z = _mm_or_si128(_mm_andnot_si128(tmp, z), _mm_and_si128(tmp, b));
+				tmp = _mm_cmpgt_epi8(a2a, z);
+				z = _mm_or_si128(_mm_andnot_si128(tmp, z), _mm_and_si128(tmp, a2a));
+				__dp_code_block2;
+				tmp = _mm_cmpgt_epi8(a, zero_);
+				_mm_store_si128(&x[t],  _mm_sub_epi8(_mm_and_si128(tmp, a),  qe_));
+				tmp = _mm_cmpgt_epi8(b, zero_);
+				_mm_store_si128(&y[t],  _mm_sub_epi8(_mm_and_si128(tmp, b),  qe_));
+				tmp = _mm_load_si128(&donor[t]); // TODO: check if this is correct
+				tmp = _mm_cmpgt_epi8(a2, tmp);
+				tmp = _mm_or_si128(_mm_andnot_si128(tmp, tmp), _mm_and_si128(tmp, a2));
+				_mm_store_si128(&x2[t], _mm_sub_epi8(tmp, q2_));
+#endif
+			}
+		} else if (!(flag&KSW_EZ_RIGHT)) { // gap left-alignment
+			__m128i *pr = p + r * n_col_ - st_;
+			off[r] = st, off_end[r] = en;
+			for (t = st_; t <= en_; ++t) {
+				__m128i d, z, a, b, a2, a2a, xt1, x2t1, vt1, ut, tmp, tmp2;
+				__dp_code_block1;
+#ifdef __SSE4_1__
+				d = _mm_and_si128(_mm_cmpgt_epi8(a, z), _mm_set1_epi8(1));       // d = a  > z? 1 : 0
+				z = _mm_max_epi8(z, a);
+				d = _mm_blendv_epi8(d, _mm_set1_epi8(2), _mm_cmpgt_epi8(b,  z)); // d = b  > z? 2 : d
+				z = _mm_max_epi8(z, b);
+				d = _mm_blendv_epi8(d, _mm_set1_epi8(3), _mm_cmpgt_epi8(a2a, z)); // d = a2 > z? 3 : d
+				z = _mm_max_epi8(z, a2a);
+#else // we need to emulate SSE4.1 intrinsics _mm_max_epi8() and _mm_blendv_epi8()
+				tmp = _mm_cmpgt_epi8(a,  z);
+				d = _mm_and_si128(tmp, _mm_set1_epi8(1));
+				z = _mm_or_si128(_mm_andnot_si128(tmp, z), _mm_and_si128(tmp, a));
+				tmp = _mm_cmpgt_epi8(b,  z);
+				d = _mm_or_si128(_mm_andnot_si128(tmp, d), _mm_and_si128(tmp, _mm_set1_epi8(2)));
+				z = _mm_or_si128(_mm_andnot_si128(tmp, z), _mm_and_si128(tmp, b));
+				tmp = _mm_cmpgt_epi8(a2a, z);
+				d = _mm_or_si128(_mm_andnot_si128(tmp, d), _mm_and_si128(tmp, _mm_set1_epi8(3)));
+				z = _mm_or_si128(_mm_andnot_si128(tmp, z), _mm_and_si128(tmp, a2a));
+#endif
+				__dp_code_block2;
+				tmp = _mm_cmpgt_epi8(a, zero_);
+				_mm_store_si128(&x[t],  _mm_sub_epi8(_mm_and_si128(tmp, a),  qe_));
+				d = _mm_or_si128(d, _mm_and_si128(tmp, _mm_set1_epi8(0x08))); // d = a > 0? 1<<3 : 0
+				tmp = _mm_cmpgt_epi8(b, zero_);
+				_mm_store_si128(&y[t],  _mm_sub_epi8(_mm_and_si128(tmp, b),  qe_));
+				d = _mm_or_si128(d, _mm_and_si128(tmp, _mm_set1_epi8(0x10))); // d = b > 0? 1<<4 : 0
+
+				tmp2 = _mm_load_si128(&donor[t]);
+				tmp = _mm_cmpgt_epi8(a2, tmp2);
+#ifdef __SSE4_1__
+				tmp2 = _mm_max_epi8(a2, tmp2);
+#else
+				tmp2 = _mm_or_si128(_mm_andnot_si128(tmp, tmp2), _mm_and_si128(tmp, a2));
+#endif
+				_mm_store_si128(&x2[t], _mm_sub_epi8(tmp2, q2_));
+				d = _mm_or_si128(d, _mm_and_si128(tmp, _mm_set1_epi8(0x20)));
+				_mm_store_si128(&pr[t], d);
+			}
+		} else { // gap right-alignment
+			__m128i *pr = p + r * n_col_ - st_;
+			off[r] = st, off_end[r] = en;
+			for (t = st_; t <= en_; ++t) {
+				__m128i d, z, a, b, a2, a2a, xt1, x2t1, vt1, ut, tmp, tmp2;
+				__dp_code_block1;
+#ifdef __SSE4_1__
+				d = _mm_andnot_si128(_mm_cmpgt_epi8(z, a), _mm_set1_epi8(1));    // d = z > a?  0 : 1
+				z = _mm_max_epi8(z, a);
+				d = _mm_blendv_epi8(_mm_set1_epi8(2), d, _mm_cmpgt_epi8(z, b));  // d = z > b?  d : 2
+				z = _mm_max_epi8(z, b);
+				d = _mm_blendv_epi8(_mm_set1_epi8(3), d, _mm_cmpgt_epi8(z, a2a)); // d = z > a2? d : 3
+				z = _mm_max_epi8(z, a2a);
+#else // we need to emulate SSE4.1 intrinsics _mm_max_epi8() and _mm_blendv_epi8()
+				tmp = _mm_cmpgt_epi8(z, a);
+				d = _mm_andnot_si128(tmp, _mm_set1_epi8(1));
+				z = _mm_or_si128(_mm_and_si128(tmp, z), _mm_andnot_si128(tmp, a));
+				tmp = _mm_cmpgt_epi8(z, b);
+				d = _mm_or_si128(_mm_and_si128(tmp, d), _mm_andnot_si128(tmp, _mm_set1_epi8(2)));
+				z = _mm_or_si128(_mm_and_si128(tmp, z), _mm_andnot_si128(tmp, b));
+				tmp = _mm_cmpgt_epi8(z, a2a);
+				d = _mm_or_si128(_mm_and_si128(tmp, d), _mm_andnot_si128(tmp, _mm_set1_epi8(3)));
+				z = _mm_or_si128(_mm_and_si128(tmp, z), _mm_andnot_si128(tmp, a2a));
+#endif
+				__dp_code_block2;
+				tmp = _mm_cmpgt_epi8(zero_, a);
+				_mm_store_si128(&x[t],  _mm_sub_epi8(_mm_andnot_si128(tmp, a),  qe_));
+				d = _mm_or_si128(d, _mm_andnot_si128(tmp, _mm_set1_epi8(0x08))); // d = a > 0? 1<<3 : 0
+				tmp = _mm_cmpgt_epi8(zero_, b);
+				_mm_store_si128(&y[t],  _mm_sub_epi8(_mm_andnot_si128(tmp, b),  qe_));
+				d = _mm_or_si128(d, _mm_andnot_si128(tmp, _mm_set1_epi8(0x10))); // d = b > 0? 1<<4 : 0
+
+				tmp2 = _mm_load_si128(&donor[t]);
+				tmp = _mm_cmpgt_epi8(tmp2, a2);
+#ifdef __SSE4_1__
+				tmp2 = _mm_max_epi8(tmp2, a2);
+#else
+				tmp2 = _mm_or_si128(_mm_andnot_si128(tmp, a2), _mm_and_si128(tmp, tmp2));
+#endif
+				_mm_store_si128(&x2[t], _mm_sub_epi8(tmp2, q2_));
+				d = _mm_or_si128(d, _mm_andnot_si128(tmp, _mm_set1_epi8(0x20))); // d = a > 0? 1<<5 : 0
+				_mm_store_si128(&pr[t], d);
+			}
+		}
+		if (!approx_max) { // find the exact max with a 32-bit score array
+			int32_t max_H, max_t;
+			// compute H[], max_H and max_t
+			if (r > 0) {
+				int32_t HH[4], tt[4], en1 = st0 + (en0 - st0) / 4 * 4, i;
+				__m128i max_H_, max_t_;
+				max_H = H[en0] = en0 > 0? H[en0-1] + u8[en0] : H[en0] + v8[en0]; // special casing the last element
+				max_t = en0;
+				max_H_ = _mm_set1_epi32(max_H);
+				max_t_ = _mm_set1_epi32(max_t);
+				for (t = st0; t < en1; t += 4) { // this implements: H[t]+=v8[t]-qe; if(H[t]>max_H) max_H=H[t],max_t=t;
+					__m128i H1, tmp, t_;
+					H1 = _mm_loadu_si128((__m128i*)&H[t]);
+					t_ = _mm_setr_epi32(v8[t], v8[t+1], v8[t+2], v8[t+3]);
+					H1 = _mm_add_epi32(H1, t_);
+					_mm_storeu_si128((__m128i*)&H[t], H1);
+					t_ = _mm_set1_epi32(t);
+					tmp = _mm_cmpgt_epi32(H1, max_H_);
+#ifdef __SSE4_1__
+					max_H_ = _mm_blendv_epi8(max_H_, H1, tmp);
+					max_t_ = _mm_blendv_epi8(max_t_, t_, tmp);
+#else
+					max_H_ = _mm_or_si128(_mm_and_si128(tmp, H1), _mm_andnot_si128(tmp, max_H_));
+					max_t_ = _mm_or_si128(_mm_and_si128(tmp, t_), _mm_andnot_si128(tmp, max_t_));
+#endif
+				}
+				_mm_storeu_si128((__m128i*)HH, max_H_);
+				_mm_storeu_si128((__m128i*)tt, max_t_);
+				for (i = 0; i < 4; ++i)
+					if (max_H < HH[i]) max_H = HH[i], max_t = tt[i] + i;
+				for (; t < en0; ++t) { // for the rest of values that haven't been computed with SSE
+					H[t] += (int32_t)v8[t];
+					if (H[t] > max_H)
+						max_H = H[t], max_t = t;
+				}
+			} else H[0] = v8[0] - qe, max_H = H[0], max_t = 0; // special casing r==0
+			// update ez
+			if (en0 == tlen - 1 && H[en0] > ez->mte)
+				ez->mte = H[en0], ez->mte_q = r - en;
+			if (r - st0 == qlen - 1 && H[st0] > ez->mqe)
+				ez->mqe = H[st0], ez->mqe_t = st0;
+			if (ksw_apply_zdrop(ez, 1, max_H, r, max_t, zdrop, 0)) break;
+			if (r == qlen + tlen - 2 && en0 == tlen - 1)
+				ez->score = H[tlen - 1];
+		} else { // find approximate max; Z-drop might be inaccurate, too.
+			if (r > 0) {
+				if (last_H0_t >= st0 && last_H0_t <= en0 && last_H0_t + 1 >= st0 && last_H0_t + 1 <= en0) {
+					int32_t d0 = v8[last_H0_t];
+					int32_t d1 = u8[last_H0_t + 1];
+					if (d0 > d1) H0 += d0;
+					else H0 += d1, ++last_H0_t;
+				} else if (last_H0_t >= st0 && last_H0_t <= en0) {
+					H0 += v8[last_H0_t];
+				} else {
+					++last_H0_t, H0 += u8[last_H0_t];
+				}
+			} else H0 = v8[0] - qe, last_H0_t = 0;
+			if ((flag & KSW_EZ_APPROX_DROP) && ksw_apply_zdrop(ez, 1, H0, r, last_H0_t, zdrop, 0)) break;
+			if (r == qlen + tlen - 2 && en0 == tlen - 1)
+				ez->score = H0;
+		}
+		last_st = st, last_en = en;
+		//for (t = st0; t <= en0; ++t) printf("(%d,%d)\t(%d,%d,%d,%d)\t%d\n", r, t, ((int8_t*)u)[t], ((int8_t*)v)[t], ((int8_t*)x)[t], ((int8_t*)y)[t], H[t]); // for debugging
+	}
+	kfree(km, mem);
+	if (!approx_max) kfree(km, H);
+	if (with_cigar) { // backtrack
+		int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
+		if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY))
+			ksw_backtrack(km, 1, rev_cigar, long_thres, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
+		else if (ez->max_t >= 0 && ez->max_q >= 0)
+			ksw_backtrack(km, 1, rev_cigar, long_thres, (uint8_t*)p, off, off_end, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
+		kfree(km, mem2); kfree(km, off);
+	}
+}
+#endif // __SSE2__

ksw2_extz2_sse.c

@@ -1,14 +1,27 @@
 #include <string.h>
+#include <assert.h>
 #include "ksw2.h"
 
 #ifdef __SSE2__
 #include <emmintrin.h>
 
+#ifdef KSW_SSE2_ONLY
+#undef __SSE4_1__
+#endif
+
 #ifdef __SSE4_1__
 #include <smmintrin.h>
 #endif
 
-void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int flag, ksw_extz_t *ez)
+#ifdef KSW_CPU_DISPATCH
+#ifdef __SSE4_1__
+void ksw_extz2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez)
+#else
+void ksw_extz2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez)
+#endif
+#else
+void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez)
+#endif // ~KSW_CPU_DISPATCH
 {
 #define __dp_code_block1 \
 	z = _mm_add_epi8(_mm_load_si128(&s[t]), qe2_); \
@@ -33,11 +46,11 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
 	a = _mm_sub_epi8(a, z); \
 	b = _mm_sub_epi8(b, z);
 
-	int r, t, qe = q + e, n_col_, *off = 0, tlen_, qlen_, last_st, last_en, wl, wr, max_sc, min_sc;
+	int r, t, qe = q + e, n_col_, *off = 0, *off_end = 0, tlen_, qlen_, last_st, last_en, wl, wr, max_sc, min_sc;
 	int with_cigar = !(flag&KSW_EZ_SCORE_ONLY), approx_max = !!(flag&KSW_EZ_APPROX_MAX);
 	int32_t *H = 0, H0 = 0, last_H0_t = 0;
 	uint8_t *qr, *sf, *mem, *mem2 = 0;
-	__m128i q_, qe2_, zero_, flag1_, flag2_, flag8_, flag16_, sc_mch_, sc_mis_, m1_, max_sc_;
+	__m128i q_, qe2_, zero_, flag1_, flag2_, flag8_, flag16_, sc_mch_, sc_mis_, sc_N_, m1_, max_sc_;
 	__m128i *u, *v, *x, *y, *s, *p = 0;
 
 	ksw_reset_extz(ez);
@@ -52,13 +65,15 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
 	flag16_ = _mm_set1_epi8(0x10);
 	sc_mch_ = _mm_set1_epi8(mat[0]);
 	sc_mis_ = _mm_set1_epi8(mat[1]);
+	sc_N_   = mat[m*m-1] == 0? _mm_set1_epi8(-e) : _mm_set1_epi8(mat[m*m-1]);
 	m1_     = _mm_set1_epi8(m - 1); // wildcard
 	max_sc_ = _mm_set1_epi8(mat[0] + (q + e) * 2);
 
 	if (w < 0) w = tlen > qlen? tlen : qlen;
 	wl = wr = w;
 	tlen_ = (tlen + 15) / 16;
-	n_col_ = ((w + 1 < tlen? (w + 1 < qlen? w + 1 : qlen): tlen) + 15) / 16 + 1;
+	n_col_ = qlen < tlen? qlen : tlen;
+	n_col_ = ((n_col_ < w + 1? n_col_ : w + 1) + 15) / 16 + 1;
 	qlen_ = (qlen + 15) / 16;
 	for (t = 1, max_sc = mat[0], min_sc = mat[1]; t < m * m; ++t) {
 		max_sc = max_sc > mat[t]? max_sc : mat[t];
@@ -74,9 +89,10 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
 		for (t = 0; t < tlen_ * 16; ++t) H[t] = KSW_NEG_INF;
 	}
 	if (with_cigar) {
-		mem2 = (uint8_t*)kmalloc(km, ((qlen + tlen - 1) * n_col_ + 1) * 16);
+		mem2 = (uint8_t*)kmalloc(km, ((size_t)(qlen + tlen - 1) * n_col_ + 1) * 16);
 		p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4);
-		off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int));
+		off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int) * 2);
+		off_end = off + qlen + tlen - 1;
 	}
 
 	for (t = 0; t < qlen; ++t) qr[t] = query[qlen - 1 - t];
@@ -85,7 +101,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
 	for (r = 0, last_st = last_en = -1; r < qlen + tlen - 1; ++r) {
 		int st = 0, en = tlen - 1, st0, en0, st_, en_;
 		int8_t x1, v1;
-		uint8_t *qrr = qr + (qlen - 1 - r), *u8 = (uint8_t*)u, *v8 = (uint8_t*)v, *x8 = (uint8_t*)x, p_en0 = 0;
+		uint8_t *qrr = qr + (qlen - 1 - r), *u8 = (uint8_t*)u, *v8 = (uint8_t*)v;
 		__m128i x1_, v1_;
 		// find the boundaries
 		if (st < r - qlen + 1) st = r - qlen + 1;
@@ -115,10 +131,11 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
 				tmp = _mm_cmpeq_epi8(sq, st);
 #ifdef __SSE4_1__
 				tmp = _mm_blendv_epi8(sc_mis_, sc_mch_, tmp);
+				tmp = _mm_blendv_epi8(tmp,     sc_N_,   mask);
 #else
 				tmp = _mm_or_si128(_mm_andnot_si128(tmp,  sc_mis_), _mm_and_si128(tmp,  sc_mch_));
+				tmp = _mm_or_si128(_mm_andnot_si128(mask, tmp),     _mm_and_si128(mask, sc_N_));
 #endif
-				tmp = _mm_andnot_si128(mask, tmp);
 				_mm_storeu_si128((__m128i*)((uint8_t*)s + t), tmp);
 			}
 		} else {
@@ -129,6 +146,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
 		x1_ = _mm_cvtsi32_si128(x1);
 		v1_ = _mm_cvtsi32_si128(v1);
 		st_ = st / 16, en_ = en / 16;
+		assert(en_ - st_ + 1 <= n_col_);
 		if (!with_cigar) { // score only
 			for (t = st_; t <= en_; ++t) {
 				__m128i z, a, b, xt1, vt1, ut, tmp;
@@ -151,15 +169,8 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
 #endif
 			}
 		} else if (!(flag&KSW_EZ_RIGHT)) { // gap left-alignment
-			__m128i *pr = p + r * n_col_ - st_;
+			__m128i *pr = p + (size_t)r * n_col_ - st_;
-			off[r] = st;
+			off[r] = st, off_end[r] = en;
-			if (en0 < r && en0 < tlen - 1) { // to avoid backtracking out of the band; this assumes a fixed band
-				int8_t a, z = ((uint8_t*)s)[en0] + 2 * qe;
-				a = x8[en0-1] + v8[en0-1];
-				p_en0 = a > z? 1 : 0;
-				z = a > z? a : z;
-				p_en0 |= a - (z - q) > 0? 0x08 : 0;
-			}
 			for (t = st_; t <= en_; ++t) {
 				__m128i d, z, a, b, xt1, vt1, ut, tmp;
 				__dp_code_block1;
@@ -184,15 +195,8 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
 				_mm_store_si128(&pr[t], d);
 			}
 		} else { // gap right-alignment
-			__m128i *pr = p + r * n_col_ - st_;
+			__m128i *pr = p + (size_t)r * n_col_ - st_;
-			off[r] = st;
+			off[r] = st, off_end[r] = en;
-			if (en0 < r && en0 < tlen - 1) {
-				int8_t a, z = ((uint8_t*)s)[en0] + 2 * qe;
-				a = x8[en0-1] + v8[en0-1];
-				p_en0 = a >= z? 1 : 0;
-				z = a >= z? a : z;
-				p_en0 |= a - (z - q) >= 0? 0x08 : 0;
-			}
 			for (t = st_; t <= en_; ++t) {
 				__m128i d, z, a, b, xt1, vt1, ut, tmp;
 				__dp_code_block1;
@@ -217,7 +221,6 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
 				_mm_store_si128(&pr[t], d);
 			}
 		}
-		if (with_cigar && en0 < r && en0 < tlen - 1) ((uint8_t*)(p + r * n_col_))[en0 - st] = p_en0;
 		if (!approx_max) { // find the exact max with a 32-bit score array
 			int32_t max_H, max_t;
 			// compute H[], max_H and max_t
@@ -288,10 +291,14 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
 	if (!approx_max) kfree(km, H);
 	if (with_cigar) { // backtrack
 		int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
-		if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY))
+		if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY)) {
-			ksw_backtrack(km, 1, rev_cigar, (uint8_t*)p, off, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
+			ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
-		else if (ez->max_t >= 0 && ez->max_q >= 0)
+		} else if (!ez->zdropped && (flag&KSW_EZ_EXTZ_ONLY) && ez->mqe + end_bonus > (int)ez->max) {
-			ksw_backtrack(km, 1, rev_cigar, (uint8_t*)p, off, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
+			ez->reach_end = 1;
+			ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, ez->mqe_t, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
+		} else if (ez->max_t >= 0 && ez->max_q >= 0) {
+			ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
+		}
 		kfree(km, mem2); kfree(km, off);
 	}
 }

ksw2_ll_sse.c

@@ -0,0 +1,147 @@
+#include <stdlib.h>
+#include <stdint.h>
+#include <string.h>
+#include <emmintrin.h>
+#include "ksw2.h"
+
+#ifdef __GNUC__
+#define LIKELY(x) __builtin_expect((x),1)
+#define UNLIKELY(x) __builtin_expect((x),0)
+#else
+#define LIKELY(x) (x)
+#define UNLIKELY(x) (x)
+#endif
+
+typedef struct {
+	int qlen, slen;
+	uint8_t shift, mdiff, max, size;
+	__m128i *qp, *H0, *H1, *E, *Hmax;
+} kswq_t;
+
+/**
+ * Initialize the query data structure
+ *
+ * @param size   Number of bytes used to store a score; valid valures are 1 or 2
+ * @param qlen   Length of the query sequence
+ * @param query  Query sequence
+ * @param m      Size of the alphabet
+ * @param mat    Scoring matrix in a one-dimension array
+ *
+ * @return       Query data structure
+ */
+void *ksw_ll_qinit(void *km, int size, int qlen, const uint8_t *query, int m, const int8_t *mat)
+{
+	kswq_t *q;
+	int slen, a, tmp, p;
+
+	size = size > 1? 2 : 1;
+	p = 8 * (3 - size); // # values per __m128i
+	slen = (qlen + p - 1) / p; // segmented length
+	q = (kswq_t*)kmalloc(km, sizeof(kswq_t) + 256 + 16 * slen * (m + 4)); // a single block of memory
+	q->qp = (__m128i*)(((size_t)q + sizeof(kswq_t) + 15) >> 4 << 4); // align memory
+	q->H0 = q->qp + slen * m;
+	q->H1 = q->H0 + slen;
+	q->E  = q->H1 + slen;
+	q->Hmax = q->E + slen;
+	q->slen = slen; q->qlen = qlen; q->size = size;
+	// compute shift
+	tmp = m * m;
+	for (a = 0, q->shift = 127, q->mdiff = 0; a < tmp; ++a) { // find the minimum and maximum score
+		if (mat[a] < (int8_t)q->shift) q->shift = mat[a];
+		if (mat[a] > (int8_t)q->mdiff) q->mdiff = mat[a];
+	}
+	q->max = q->mdiff;
+	q->shift = 256 - q->shift; // NB: q->shift is uint8_t
+	q->mdiff += q->shift; // this is the difference between the min and max scores
+	// An example: p=8, qlen=19, slen=3 and segmentation:
+	//  {{0,3,6,9,12,15,18,-1},{1,4,7,10,13,16,-1,-1},{2,5,8,11,14,17,-1,-1}}
+	if (size == 1) {
+		int8_t *t = (int8_t*)q->qp;
+		for (a = 0; a < m; ++a) {
+			int i, k, nlen = slen * p;
+			const int8_t *ma = mat + a * m;
+			for (i = 0; i < slen; ++i)
+				for (k = i; k < nlen; k += slen) // p iterations
+					*t++ = (k >= qlen? 0 : ma[query[k]]) + q->shift;
+		}
+	} else {
+		int16_t *t = (int16_t*)q->qp;
+		for (a = 0; a < m; ++a) {
+			int i, k, nlen = slen * p;
+			const int8_t *ma = mat + a * m;
+			for (i = 0; i < slen; ++i)
+				for (k = i; k < nlen; k += slen) // p iterations
+					*t++ = (k >= qlen? 0 : ma[query[k]]);
+		}
+	}
+	return q;
+}
+
+int ksw_ll_i16(void *q_, int tlen, const uint8_t *target, int _gapo, int _gape, int *qe, int *te)
+{
+	kswq_t *q = (kswq_t*)q_;
+	int slen, i, gmax = 0, qlen8;
+	__m128i zero, gapoe, gape, *H0, *H1, *E, *Hmax;
+	uint16_t *H8;
+
+#define __max_8(ret, xx) do { \
+		(xx) = _mm_max_epi16((xx), _mm_srli_si128((xx), 8)); \
+		(xx) = _mm_max_epi16((xx), _mm_srli_si128((xx), 4)); \
+		(xx) = _mm_max_epi16((xx), _mm_srli_si128((xx), 2)); \
+		(ret) = _mm_extract_epi16((xx), 0); \
+	} while (0)
+
+	// initialization
+	*qe = *te = -1;
+	zero = _mm_set1_epi32(0);
+	gapoe = _mm_set1_epi16(_gapo + _gape);
+	gape = _mm_set1_epi16(_gape);
+	H0 = q->H0; H1 = q->H1; E = q->E; Hmax = q->Hmax;
+	slen = q->slen, qlen8 = slen * 8;
+	memset(E,    0, slen * sizeof(__m128i));
+	memset(H0,   0, slen * sizeof(__m128i));
+	memset(Hmax, 0, slen * sizeof(__m128i));
+	// the core loop
+	for (i = 0; i < tlen; ++i) {
+		int j, k, imax;
+		__m128i e, h, f = zero, max = zero, *S = q->qp + target[i] * slen; // s is the 1st score vector
+		h = _mm_load_si128(H0 + slen - 1); // h={2,5,8,11,14,17,-1,-1} in the above example
+		h = _mm_slli_si128(h, 2);
+		for (j = 0; LIKELY(j < slen); ++j) {
+			h = _mm_adds_epi16(h, *S++);
+			e = _mm_load_si128(E + j);
+			h = _mm_max_epi16(h, e);
+			h = _mm_max_epi16(h, f);
+			max = _mm_max_epi16(max, h);
+			_mm_store_si128(H1 + j, h);
+			h = _mm_subs_epu16(h, gapoe);
+			e = _mm_subs_epu16(e, gape);
+			e = _mm_max_epi16(e, h);
+			_mm_store_si128(E + j, e);
+			f = _mm_subs_epu16(f, gape);
+			f = _mm_max_epi16(f, h);
+			h = _mm_load_si128(H0 + j);
+		}
+		for (k = 0; LIKELY(k < 8); ++k) {
+			f = _mm_slli_si128(f, 2);
+			for (j = 0; LIKELY(j < slen); ++j) {
+				h = _mm_load_si128(H1 + j);
+				h = _mm_max_epi16(h, f);
+				_mm_store_si128(H1 + j, h);
+				h = _mm_subs_epu16(h, gapoe);
+				f = _mm_subs_epu16(f, gape);
+				if(UNLIKELY(!_mm_movemask_epi8(_mm_cmpgt_epi16(f, h)))) goto end_loop_i16;
+			}
+		}
+end_loop_i16:
+		__max_8(imax, max);
+		if (imax >= gmax) {
+			gmax = imax; *te = i;
+			memcpy(Hmax, H1, slen * sizeof(__m128i));
+		}
+		S = H1; H1 = H0; H0 = S;
+	}
+	for (i = 0, H8 = (uint16_t*)Hmax; i < qlen8; ++i)
+		if ((int)H8[i] == gmax) *qe = i / 8 + i % 8 * slen;
+	return gmax;
+}

kthread.c

@@ -1,6 +1,12 @@
 #include <pthread.h>
 #include <stdlib.h>
 #include <limits.h>
+#include <stdint.h>
+#include "kthread.h"
+
+#if (defined(WIN32) || defined(_WIN32)) && defined(_MSC_VER)
+#define __sync_fetch_and_add(ptr, addend)     _InterlockedExchangeAdd((void*)ptr, addend)
+#endif
 
 /************
  * kt_for() *
@@ -52,12 +58,13 @@ void kt_for(int n_threads, void (*func)(void*,long,int), void *data, long n)
 		kt_for_t t;
 		pthread_t *tid;
 		t.func = func, t.data = data, t.n_threads = n_threads, t.n = n;
-		t.w = (ktf_worker_t*)alloca(n_threads * sizeof(ktf_worker_t));
+		t.w = (ktf_worker_t*)calloc(n_threads, sizeof(ktf_worker_t));
-		tid = (pthread_t*)alloca(n_threads * sizeof(pthread_t));
+		tid = (pthread_t*)calloc(n_threads, sizeof(pthread_t));
 		for (i = 0; i < n_threads; ++i)
 			t.w[i].t = &t, t.w[i].i = i;
 		for (i = 0; i < n_threads; ++i) pthread_create(&tid[i], 0, ktf_worker, &t.w[i]);
 		for (i = 0; i < n_threads; ++i) pthread_join(tid[i], 0);
+		free(tid); free(t.w);
 	} else {
 		long j;
 		for (j = 0; j < n; ++j) func(data, j, 0);
@@ -135,16 +142,17 @@ void kt_pipeline(int n_threads, void *(*func)(void*, int, void*), void *shared_d
 	pthread_mutex_init(&aux.mutex, 0);
 	pthread_cond_init(&aux.cv, 0);
 
-	aux.workers = (ktp_worker_t*)alloca(n_threads * sizeof(ktp_worker_t));
+	aux.workers = (ktp_worker_t*)calloc(n_threads, sizeof(ktp_worker_t));
 	for (i = 0; i < n_threads; ++i) {
 		ktp_worker_t *w = &aux.workers[i];
 		w->step = 0; w->pl = &aux; w->data = 0;
 		w->index = aux.index++;
 	}
 
-	tid = (pthread_t*)alloca(n_threads * sizeof(pthread_t));
+	tid = (pthread_t*)calloc(n_threads, sizeof(pthread_t));
 	for (i = 0; i < n_threads; ++i) pthread_create(&tid[i], 0, ktp_worker, &aux.workers[i]);
 	for (i = 0; i < n_threads; ++i) pthread_join(tid[i], 0);
+	free(tid); free(aux.workers);
 
 	pthread_mutex_destroy(&aux.mutex);
 	pthread_cond_destroy(&aux.cv);

main.c

@@ -1,35 +1,69 @@
-#include <getopt.h>
 #include <stdlib.h>
 #include <stdio.h>
 #include <string.h>
-#include <sys/resource.h>
-#include <sys/time.h>
 #include "bseq.h"
 #include "minimap.h"
 #include "mmpriv.h"
+#ifdef HAVE_GETOPT
+#include <getopt.h>
+#else
+#include "getopt.h"
+#endif
 
-#define MM_VERSION "2.0-r191-dirty"
+#define MM_VERSION "2.11-r815-dirty"
 
+#ifdef __linux__
+#include <sys/resource.h>
+#include <sys/time.h>
 void liftrlimit()
 {
-#ifdef __linux__
 	struct rlimit r;
 	getrlimit(RLIMIT_AS, &r);
 	r.rlim_cur = r.rlim_max;
 	setrlimit(RLIMIT_AS, &r);
-#endif
 }
+#else
+void liftrlimit() {}
+#endif
 
 static struct option long_options[] = {
 	{ "bucket-bits",    required_argument, 0, 0 },
 	{ "mb-size",        required_argument, 0, 'K' },
-	{ "int-rname",      no_argument,       0, 0 },
+	{ "seed",           required_argument, 0, 0 },
 	{ "no-kalloc",      no_argument,       0, 0 },
 	{ "print-qname",    no_argument,       0, 0 },
-	{ "no-self",        no_argument,       0, 0 },
+	{ "no-self",        no_argument,       0, 'D' },
-	{ "print-seed",     no_argument,       0, 0 },
+	{ "print-seeds",    no_argument,       0, 0 },
 	{ "max-chain-skip", required_argument, 0, 0 },
 	{ "min-dp-len",     required_argument, 0, 0 },
+	{ "print-aln-seq",  no_argument,       0, 0 },
+	{ "splice",         no_argument,       0, 0 },
+	{ "cost-non-gt-ag", required_argument, 0, 'C' },
+	{ "no-long-join",   no_argument,       0, 0 },
+	{ "sr",             no_argument,       0, 0 },
+	{ "frag",           required_argument, 0, 0 },
+	{ "secondary",      required_argument, 0, 0 },
+	{ "cs",             optional_argument, 0, 0 },
+	{ "end-bonus",      required_argument, 0, 0 },
+	{ "no-pairing",     no_argument,       0, 0 },
+	{ "splice-flank",   required_argument, 0, 0 },
+	{ "idx-no-seq",     no_argument,       0, 0 },
+	{ "end-seed-pen",   required_argument, 0, 0 },   // 21
+	{ "for-only",       no_argument,       0, 0 },   // 22
+	{ "rev-only",       no_argument,       0, 0 },   // 23
+	{ "heap-sort",      required_argument, 0, 0 },   // 24
+	{ "all-chain",      no_argument,       0, 'P' },
+	{ "dual",           required_argument, 0, 0 },   // 26
+	{ "max-clip-ratio", required_argument, 0, 0 },   // 27
+	{ "min-occ-floor",  required_argument, 0, 0 },   // 28
+	{ "MD",             no_argument,       0, 0 },   // 29
+	{ "lj-min-ratio",   required_argument, 0, 0 },   // 30
+	{ "score-N",        required_argument, 0, 0 },   // 31
+	{ "eqx",            no_argument,       0, 0 },   // 32
+	{ "paf-no-hit",     no_argument,       0, 0 },   // 33
+	{ "split-prefix",   required_argument, 0, 0 },   // 34
+	{ "help",           no_argument,       0, 'h' },
+	{ "max-intron-len", required_argument, 0, 'G' },
 	{ "version",        no_argument,       0, 'V' },
 	{ "min-count",      required_argument, 0, 'n' },
 	{ "min-chain-score",required_argument, 0, 'm' },
@@ -39,188 +73,296 @@ static struct option long_options[] = {
 	{ 0, 0, 0, 0}
 };
 
+static inline int64_t mm_parse_num(const char *str)
+{
+	double x;
+	char *p;
+	x = strtod(str, &p);
+	if (*p == 'G' || *p == 'g') x *= 1e9;
+	else if (*p == 'M' || *p == 'm') x *= 1e6;
+	else if (*p == 'K' || *p == 'k') x *= 1e3;
+	return (int64_t)(x + .499);
+}
+
+static inline void yes_or_no(mm_mapopt_t *opt, int flag, int long_idx, const char *arg, int yes_to_set)
+{
+	if (yes_to_set) {
+		if (strcmp(arg, "yes") == 0 || strcmp(arg, "y") == 0) opt->flag |= flag;
+		else if (strcmp(arg, "no") == 0 || strcmp(arg, "n") == 0) opt->flag &= ~flag;
+		else fprintf(stderr, "[WARNING]\033[1;31m option '--%s' only accepts 'yes' or 'no'.\033[0m\n", long_options[long_idx].name);
+	} else {
+		if (strcmp(arg, "yes") == 0 || strcmp(arg, "y") == 0) opt->flag &= ~flag;
+		else if (strcmp(arg, "no") == 0 || strcmp(arg, "n") == 0) opt->flag |= flag;
+		else fprintf(stderr, "[WARNING]\033[1;31m option '--%s' only accepts 'yes' or 'no'.\033[0m\n", long_options[long_idx].name);
+	}
+}
+
 int main(int argc, char *argv[])
 {
+	const char *opt_str = "2aSDw:k:K:t:r:f:Vv:g:G:I:d:XT:s:x:Hcp:M:n:z:A:B:O:E:m:N:Qu:R:hF:LC:yY";
 	mm_mapopt_t opt;
-	int i, c, k = 15, w = -1, bucket_bits = MM_IDX_DEF_B, n_threads = 3, keep_name = 1, is_idx, is_hpc = 0, long_idx, idx_par_set = 0;
+	mm_idxopt_t ipt;
-	int minibatch_size = 200000000;
+	int i, c, n_threads = 3, n_parts, long_idx;
-	uint64_t batch_size = 4000000000ULL;
+	char *fnw = 0, *rg = 0, *s;
-	mm_bseq_file_t *fp = 0;
+	FILE *fp_help = stderr;
-	char *fnw = 0, *s;
+	mm_idx_reader_t *idx_rdr;
-	FILE *fpr = 0, *fpw = 0;
+	mm_idx_t *mi;
 
+	mm_verbose = 3;
 	liftrlimit();
 	mm_realtime0 = realtime();
-	mm_mapopt_init(&opt);
+	mm_set_opt(0, &ipt, &opt);
 
-	while ((c = getopt_long(argc, argv, "aw:k:K:t:r:f:Vv:g:I:d:XT:s:x:Hcp:M:n:z:A:B:O:E:m:N:Q", long_options, &long_idx)) >= 0) {
+	while ((c = getopt_long(argc, argv, opt_str, long_options, &long_idx)) >= 0) // apply option -x/preset first
-		if (c == 'w') w = atoi(optarg), idx_par_set = 1;
+		if (c == 'x') {
-		else if (c == 'k') k = atoi(optarg), idx_par_set = 1;
+			if (mm_set_opt(optarg, &ipt, &opt) < 0) {
-		else if (c == 'H') is_hpc = 1, idx_par_set = 1;
+				fprintf(stderr, "[ERROR] unknown preset '%s'\n", optarg);
+				return 1;
+			}
+			break;
+		}
+	optind = 0; // for musl getopt, optind=0 has the same effect as optreset=1; older libc doesn't have optreset
+
+	while ((c = getopt_long(argc, argv, opt_str, long_options, &long_idx)) >= 0) {
+		if (c == 'w') ipt.w = atoi(optarg);
+		else if (c == 'k') ipt.k = atoi(optarg);
+		else if (c == 'H') ipt.flag |= MM_I_HPC;
 		else if (c == 'd') fnw = optarg; // the above are indexing related options, except -I
-		else if (c == 'r') opt.bw = atoi(optarg);
+		else if (c == 'r') opt.bw = (int)mm_parse_num(optarg);
-		else if (c == 'f') opt.mid_occ_frac = atof(optarg);
 		else if (c == 't') n_threads = atoi(optarg);
 		else if (c == 'v') mm_verbose = atoi(optarg);
-		else if (c == 'g') opt.max_gap = atoi(optarg);
+		else if (c == 'g') opt.max_gap = (int)mm_parse_num(optarg);
+		else if (c == 'G') mm_mapopt_max_intron_len(&opt, (int)mm_parse_num(optarg));
+		else if (c == 'F') opt.max_frag_len = (int)mm_parse_num(optarg);
 		else if (c == 'N') opt.best_n = atoi(optarg);
 		else if (c == 'p') opt.pri_ratio = atof(optarg);
 		else if (c == 'M') opt.mask_level = atof(optarg);
-		else if (c == 'c') opt.flag |= MM_F_CIGAR;
+		else if (c == 'c') opt.flag |= MM_F_OUT_CG | MM_F_CIGAR;
-		else if (c == 'X') opt.flag |= MM_F_AVA | MM_F_NO_SELF;
+		else if (c == 'D') opt.flag |= MM_F_NO_DIAG;
+		else if (c == 'P') opt.flag |= MM_F_ALL_CHAINS;
+		else if (c == 'X') opt.flag |= MM_F_ALL_CHAINS | MM_F_NO_DIAG | MM_F_NO_DUAL | MM_F_NO_LJOIN; // -D -P --no-long-join --dual=no
 		else if (c == 'a') opt.flag |= MM_F_OUT_SAM | MM_F_CIGAR;
 		else if (c == 'Q') opt.flag |= MM_F_NO_QUAL;
+		else if (c == 'Y') opt.flag |= MM_F_SOFTCLIP;
+		else if (c == 'L') opt.flag |= MM_F_LONG_CIGAR;
+		else if (c == 'y') opt.flag |= MM_F_COPY_COMMENT;
 		else if (c == 'T') opt.sdust_thres = atoi(optarg);
 		else if (c == 'n') opt.min_cnt = atoi(optarg);
 		else if (c == 'm') opt.min_chain_score = atoi(optarg);
 		else if (c == 'A') opt.a = atoi(optarg);
 		else if (c == 'B') opt.b = atoi(optarg);
-		else if (c == 'z') opt.zdrop = atoi(optarg);
 		else if (c == 's') opt.min_dp_max = atoi(optarg);
-		else if (c == 0 && long_idx == 0) bucket_bits = atoi(optarg); // --bucket-bits
+		else if (c == 'C') opt.noncan = atoi(optarg);
-		else if (c == 0 && long_idx == 2) keep_name = 0; // --int-rname
+		else if (c == 'I') ipt.batch_size = mm_parse_num(optarg);
+		else if (c == 'K') opt.mini_batch_size = (int)mm_parse_num(optarg);
+		else if (c == 'R') rg = optarg;
+		else if (c == 'h') fp_help = stdout;
+		else if (c == '2') opt.flag |= MM_F_2_IO_THREADS;
+		else if (c == 0 && long_idx == 0) ipt.bucket_bits = atoi(optarg); // --bucket-bits
+		else if (c == 0 && long_idx == 2) opt.seed = atoi(optarg); // --seed
 		else if (c == 0 && long_idx == 3) mm_dbg_flag |= MM_DBG_NO_KALLOC; // --no-kalloc
 		else if (c == 0 && long_idx == 4) mm_dbg_flag |= MM_DBG_PRINT_QNAME; // --print-qname
-		else if (c == 0 && long_idx == 5) opt.flag |= MM_F_NO_SELF; // --no-self
+		else if (c == 0 && long_idx == 6) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_SEED, n_threads = 1; // --print-seed
-		else if (c == 0 && long_idx == 6) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_SEED; // --print-seed
 		else if (c == 0 && long_idx == 7) opt.max_chain_skip = atoi(optarg); // --max-chain-skip
 		else if (c == 0 && long_idx == 8) opt.min_ksw_len = atoi(optarg); // --min-dp-len
-		else if (c == 'V') {
+		else if (c == 0 && long_idx == 9) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_ALN_SEQ, n_threads = 1; // --print-aln-seq
+		else if (c == 0 && long_idx ==10) opt.flag |= MM_F_SPLICE; // --splice
+		else if (c == 0 && long_idx ==12) opt.flag |= MM_F_NO_LJOIN; // --no-long-join
+		else if (c == 0 && long_idx ==13) opt.flag |= MM_F_SR; // --sr
+		else if (c == 0 && long_idx ==17) opt.end_bonus = atoi(optarg); // --end-bonus
+		else if (c == 0 && long_idx ==18) opt.flag |= MM_F_INDEPEND_SEG; // --no-pairing
+		else if (c == 0 && long_idx ==20) ipt.flag |= MM_I_NO_SEQ; // --idx-no-seq
+		else if (c == 0 && long_idx ==21) opt.anchor_ext_shift = atoi(optarg); // --end-seed-pen
+		else if (c == 0 && long_idx ==22) opt.flag |= MM_F_FOR_ONLY; // --for-only
+		else if (c == 0 && long_idx ==23) opt.flag |= MM_F_REV_ONLY; // --rev-only
+		else if (c == 0 && long_idx ==27) opt.max_clip_ratio = atof(optarg); // --max-clip-ratio
+		else if (c == 0 && long_idx ==28) opt.min_mid_occ = atoi(optarg); // --min-occ-floor
+		else if (c == 0 && long_idx ==29) opt.flag |= MM_F_OUT_MD; // --MD
+		else if (c == 0 && long_idx ==30) opt.min_join_flank_ratio = atof(optarg); // --lj-min-ratio
+		else if (c == 0 && long_idx ==31) opt.sc_ambi = atoi(optarg); // --score-N
+		else if (c == 0 && long_idx ==32) opt.flag |= MM_F_EQX; // --eqx
+		else if (c == 0 && long_idx ==33) opt.flag |= MM_F_PAF_NO_HIT; // --paf-no-hit
+		else if (c == 0 && long_idx ==34) opt.split_prefix = optarg; // --split-prefix
+		else if (c == 0 && long_idx == 14) { // --frag
+			yes_or_no(&opt, MM_F_FRAG_MODE, long_idx, optarg, 1);
+		} else if (c == 0 && long_idx == 15) { // --secondary
+			yes_or_no(&opt, MM_F_NO_PRINT_2ND, long_idx, optarg, 0);
+		} else if (c == 0 && long_idx == 16) { // --cs
+			opt.flag |= MM_F_OUT_CS | MM_F_CIGAR;
+			if (optarg == 0 || strcmp(optarg, "short") == 0) {
+				opt.flag &= ~MM_F_OUT_CS_LONG;
+			} else if (strcmp(optarg, "long") == 0) {
+				opt.flag |= MM_F_OUT_CS_LONG;
+			} else if (strcmp(optarg, "none") == 0) {
+				opt.flag &= ~MM_F_OUT_CS;
+			} else if (mm_verbose >= 2) {
+				fprintf(stderr, "[WARNING]\033[1;31m --cs only takes 'short' or 'long'. Invalid values are assumed to be 'short'.\033[0m\n");
+			}
+		} else if (c == 0 && long_idx == 19) { // --splice-flank
+			yes_or_no(&opt, MM_F_SPLICE_FLANK, long_idx, optarg, 1);
+		} else if (c == 0 && long_idx == 24) { // --heap-sort
+			yes_or_no(&opt, MM_F_HEAP_SORT, long_idx, optarg, 1);
+		} else if (c == 0 && long_idx == 26) { // --dual
+			yes_or_no(&opt, MM_F_NO_DUAL, long_idx, optarg, 0);
+		} else if (c == 'S') {
+			opt.flag |= MM_F_OUT_CS | MM_F_CIGAR | MM_F_OUT_CS_LONG;
+			if (mm_verbose >= 2)
+				fprintf(stderr, "[WARNING]\033[1;31m option -S is deprecated and may be removed in future. Please use --cs=long instead.\033[0m\n");
+		} else if (c == 'V') {
 			puts(MM_VERSION);
 			return 0;
+		} else if (c == 'f') {
+			double x;
+			char *p;
+			x = strtod(optarg, &p);
+			if (x < 1.0) opt.mid_occ_frac = x, opt.mid_occ = 0;
+			else opt.mid_occ = (int)(x + .499);
+			if (*p == ',') opt.max_occ = (int)(strtod(p+1, &p) + .499);
+		} else if (c == 'u') {
+			if (*optarg == 'b') opt.flag |= MM_F_SPLICE_FOR|MM_F_SPLICE_REV; // both strands
+			else if (*optarg == 'f') opt.flag |= MM_F_SPLICE_FOR, opt.flag &= ~MM_F_SPLICE_REV; // match GT-AG
+			else if (*optarg == 'r') opt.flag |= MM_F_SPLICE_REV, opt.flag &= ~MM_F_SPLICE_FOR; // match CT-AC (reverse complement of GT-AG)
+			else if (*optarg == 'n') opt.flag &= ~(MM_F_SPLICE_FOR|MM_F_SPLICE_REV); // don't try to match the GT-AG signal
+			else {
+				fprintf(stderr, "[ERROR]\033[1;31m unrecognized cDNA direction\033[0m\n");
+				return 1;
+			}
+		} else if (c == 'z') {
+			opt.zdrop = opt.zdrop_inv = strtol(optarg, &s, 10);
+			if (*s == ',') opt.zdrop_inv = strtol(s + 1, &s, 10);
 		} else if (c == 'O') {
 			opt.q = opt.q2 = strtol(optarg, &s, 10);
 			if (*s == ',') opt.q2 = strtol(s + 1, &s, 10);
 		} else if (c == 'E') {
 			opt.e = opt.e2 = strtol(optarg, &s, 10);
 			if (*s == ',') opt.e2 = strtol(s + 1, &s, 10);
-		} else if (c == 'I' || c == 'K') {
+		}
-			double x;
+	}
-			char *p;
+	if ((opt.flag & MM_F_SPLICE) && (opt.flag & MM_F_FRAG_MODE)) {
-			x = strtod(optarg, &p);
+		fprintf(stderr, "[ERROR]\033[1;31m --splice and --frag should not be specified at the same time.\033[0m\n");
-			if (*p == 'G' || *p == 'g') x *= 1e9;
+		return 1;
-			else if (*p == 'M' || *p == 'm') x *= 1e6;
+	}
-			else if (*p == 'K' || *p == 'k') x *= 1e3;
+	if (!fnw && !(opt.flag&MM_F_CIGAR))
-			if (c == 'I') batch_size = (uint64_t)(x + .499);
+		ipt.flag |= MM_I_NO_SEQ;
-			else minibatch_size = (uint64_t)(x + .499);
+	if (mm_check_opt(&ipt, &opt) < 0)
-		} else if (c == 'x') {
+		return 1;
-			if (strcmp(optarg, "ava-ont") == 0) {
+
-				opt.flag |= MM_F_AVA | MM_F_NO_SELF;
+	if (argc == optind || fp_help == stdout) {
-				opt.min_chain_score = 100, opt.pri_ratio = 0.0f, opt.max_gap = 10000, opt.max_chain_skip = 25;
+		fprintf(fp_help, "Usage: minimap2 [options] <target.fa>|<target.idx> [query.fa] [...]\n");
-				minibatch_size = 500000000;
+		fprintf(fp_help, "Options:\n");
-				k = 15, w = 5;
+		fprintf(fp_help, "  Indexing:\n");
-			} else if (strcmp(optarg, "ava-pb") == 0) {
+		fprintf(fp_help, "    -H           use homopolymer-compressed k-mer (preferrable for PacBio)\n");
-				opt.flag |= MM_F_AVA | MM_F_NO_SELF;
+		fprintf(fp_help, "    -k INT       k-mer size (no larger than 28) [%d]\n", ipt.k);
-				opt.min_chain_score = 100, opt.pri_ratio = 0.0f, opt.max_gap = 10000, opt.max_chain_skip = 25;
+		fprintf(fp_help, "    -w INT       minizer window size [%d]\n", ipt.w);
-				minibatch_size = 500000000;
+		fprintf(fp_help, "    -I NUM       split index for every ~NUM input bases [4G]\n");
-				is_hpc = 1, k = 19, w = 5;
+		fprintf(fp_help, "    -d FILE      dump index to FILE []\n");
-			} else if (strcmp(optarg, "map10k") == 0 || strcmp(optarg, "map-pb") == 0) {
+		fprintf(fp_help, "  Mapping:\n");
-				is_hpc = 1, k = 19;
+		fprintf(fp_help, "    -f FLOAT     filter out top FLOAT fraction of repetitive minimizers [%g]\n", opt.mid_occ_frac);
-			} else if (strcmp(optarg, "map-ont") == 0) {
+		fprintf(fp_help, "    -g NUM       stop chain enlongation if there are no minimizers in INT-bp [%d]\n", opt.max_gap);
-				is_hpc = 0, k = 15;
+		fprintf(fp_help, "    -G NUM       max intron length (effective with -xsplice; changing -r) [200k]\n");
-			} else if (strcmp(optarg, "asm5") == 0) {
+		fprintf(fp_help, "    -F NUM       max fragment length (effective with -xsr or in the fragment mode) [800]\n");
-				k = 19, w = 19;
+		fprintf(fp_help, "    -r NUM       bandwidth used in chaining and DP-based alignment [%d]\n", opt.bw);
-				opt.a = 1, opt.b = 19, opt.q = 39, opt.q2 = 81, opt.e = 3, opt.e2 = 1, opt.zdrop = 200;
+		fprintf(fp_help, "    -n INT       minimal number of minimizers on a chain [%d]\n", opt.min_cnt);
-				opt.min_dp_max = 200;
+		fprintf(fp_help, "    -m INT       minimal chaining score (matching bases minus log gap penalty) [%d]\n", opt.min_chain_score);
-			} else if (strcmp(optarg, "asm10") == 0) {
+//		fprintf(fp_help, "    -T INT       SDUST threshold; 0 to disable SDUST [%d]\n", opt.sdust_thres); // TODO: this option is never used; might be buggy
-				k = 19, w = 19;
+		fprintf(fp_help, "    -X           skip self and dual mappings (for the all-vs-all mode)\n");
-				opt.a = 1, opt.b = 9, opt.q = 16, opt.q2 = 41, opt.e = 2, opt.e2 = 1, opt.zdrop = 200;
+		fprintf(fp_help, "    -p FLOAT     min secondary-to-primary score ratio [%g]\n", opt.pri_ratio);
-				opt.min_dp_max = 200;
+		fprintf(fp_help, "    -N INT       retain at most INT secondary alignments [%d]\n", opt.best_n);
+		fprintf(fp_help, "  Alignment:\n");
+		fprintf(fp_help, "    -A INT       matching score [%d]\n", opt.a);
+		fprintf(fp_help, "    -B INT       mismatch penalty [%d]\n", opt.b);
+		fprintf(fp_help, "    -O INT[,INT] gap open penalty [%d,%d]\n", opt.q, opt.q2);
+		fprintf(fp_help, "    -E INT[,INT] gap extension penalty; a k-long gap costs min{O1+k*E1,O2+k*E2} [%d,%d]\n", opt.e, opt.e2);
+		fprintf(fp_help, "    -z INT[,INT] Z-drop score and inversion Z-drop score [%d,%d]\n", opt.zdrop, opt.zdrop_inv);
+		fprintf(fp_help, "    -s INT       minimal peak DP alignment score [%d]\n", opt.min_dp_max);
+		fprintf(fp_help, "    -u CHAR      how to find GT-AG. f:transcript strand, b:both strands, n:don't match GT-AG [n]\n");
+		fprintf(fp_help, "  Input/Output:\n");
+		fprintf(fp_help, "    -a           output in the SAM format (PAF by default)\n");
+		fprintf(fp_help, "    -Q           don't output base quality in SAM\n");
+		fprintf(fp_help, "    -L           write CIGAR with >65535 ops at the CG tag\n");
+		fprintf(fp_help, "    -R STR       SAM read group line in a format like '@RG\\tID:foo\\tSM:bar' []\n");
+		fprintf(fp_help, "    -c           output CIGAR in PAF\n");
+		fprintf(fp_help, "    --cs[=STR]   output the cs tag; STR is 'short' (if absent) or 'long' [none]\n");
+		fprintf(fp_help, "    --MD         output the MD tag\n");
+		fprintf(fp_help, "    --eqx        write =/X CIGAR operators\n");
+		fprintf(fp_help, "    -Y           use soft clipping for supplementary alignments\n");
+		fprintf(fp_help, "    -t INT       number of threads [%d]\n", n_threads);
+		fprintf(fp_help, "    -K NUM       minibatch size for mapping [500M]\n");
+//		fprintf(fp_help, "    -v INT       verbose level [%d]\n", mm_verbose);
+		fprintf(fp_help, "    --version    show version number\n");
+		fprintf(fp_help, "  Preset:\n");
+		fprintf(fp_help, "    -x STR       preset (always applied before other options; see minimap2.1 for details) []\n");
+		fprintf(fp_help, "                 - map-pb/map-ont: PacBio/Nanopore vs reference mapping\n");
+		fprintf(fp_help, "                 - ava-pb/ava-ont: PacBio/Nanopore read overlap\n");
+		fprintf(fp_help, "                 - asm5/asm10/asm20: asm-to-ref mapping, for ~0.1/1/5%% sequence divergence\n");
+		fprintf(fp_help, "                 - splice: long-read spliced alignment\n");
+		fprintf(fp_help, "                 - sr: genomic short-read mapping\n");
+		fprintf(fp_help, "\nSee `man ./minimap2.1' for detailed description of command-line options.\n");
+		return fp_help == stdout? 0 : 1;
+	}
+
+	if ((opt.flag & MM_F_SR) && argc - optind > 3) {
+		fprintf(stderr, "[ERROR] incorrect input: in the sr mode, please specify no more than two query files.\n");
+		return 1;
+	}
+	idx_rdr = mm_idx_reader_open(argv[optind], &ipt, fnw);
+	if (idx_rdr == 0) {
+		fprintf(stderr, "[ERROR] failed to open file '%s'\n", argv[optind]);
+		return 1;
+	}
+	if (!idx_rdr->is_idx && fnw == 0 && argc - optind < 2) {
+		fprintf(stderr, "[ERROR] missing input: please specify a query file to map or option -d to keep the index\n");
+		mm_idx_reader_close(idx_rdr);
+		return 1;
+	}
+	if (opt.best_n == 0 && (opt.flag&MM_F_CIGAR) && mm_verbose >= 2)
+		fprintf(stderr, "[WARNING]\033[1;31m `-N 0' reduces alignment accuracy. Please use --secondary=no to suppress secondary alignments.\033[0m\n");
+	while ((mi = mm_idx_reader_read(idx_rdr, n_threads)) != 0) {
+		if ((opt.flag & MM_F_CIGAR) && (mi->flag & MM_I_NO_SEQ)) {
+			fprintf(stderr, "[ERROR] the prebuilt index doesn't contain sequences.\n");
+			mm_idx_destroy(mi);
+			mm_idx_reader_close(idx_rdr);
+			return 1;
+		}
+		if ((opt.flag & MM_F_OUT_SAM) && idx_rdr->n_parts == 1) {
+			if (mm_idx_reader_eof(idx_rdr)) {
+				mm_write_sam_hdr(mi, rg, MM_VERSION, argc, argv);
 			} else {
-				fprintf(stderr, "[E::%s] unknown preset '%s'\n", __func__, optarg);
+				mm_write_sam_hdr(0, rg, MM_VERSION, argc, argv);
-				return 1;
+				if (opt.split_prefix == 0 && mm_verbose >= 2)
+					fprintf(stderr, "[WARNING]\033[1;31m For a multi-part index, no @SQ lines will be outputted. Please use --split-prefix.\033[0m\n");
 			}
 		}
-	}
-	if (w < 0) w = (int)(.6666667 * k + .499);
-
-	if (argc == optind) {
-		fprintf(stderr, "Usage: minimap2 [options] <target.fa>|<target.idx> [query.fa] [...]\n");
-		fprintf(stderr, "Options:\n");
-		fprintf(stderr, "  Indexing:\n");
-		fprintf(stderr, "    -H           use homopolymer-compressed k-mer\n");
-		fprintf(stderr, "    -k INT       k-mer size (no larger than 28) [%d]\n", k);
-		fprintf(stderr, "    -w INT       minizer window size [{-k}*2/3]\n");
-		fprintf(stderr, "    -I NUM       split index for every ~NUM input bases [4G]\n");
-		fprintf(stderr, "    -d FILE      dump index to FILE []\n");
-		fprintf(stderr, "  Mapping:\n");
-		fprintf(stderr, "    -f FLOAT     filter out top FLOAT fraction of repetitive minimizers [%g]\n", opt.mid_occ_frac);
-		fprintf(stderr, "    -g INT       stop chain enlongation if there are no minimizers in INT-bp [%d]\n", opt.max_gap);
-		fprintf(stderr, "    -r INT       bandwidth used in chaining and DP-based alignment [%d]\n", opt.bw);
-		fprintf(stderr, "    -n INT       minimal number of minimizers on a chain [%d]\n", opt.min_cnt);
-		fprintf(stderr, "    -m INT       minimal chaining score (matching bases minus log gap penalty) [%d]\n", opt.min_chain_score);
-//		fprintf(stderr, "    -T INT       SDUST threshold; 0 to disable SDUST [%d]\n", opt.sdust_thres); // TODO: this option is never used; might be buggy
-		fprintf(stderr, "    -X           skip self and dual mappings (for the all-vs-all mode)\n");
-		fprintf(stderr, "    -p FLOAT     min secondary-to-primary score ratio [%g]\n", opt.pri_ratio);
-		fprintf(stderr, "    -N INT       retain at most INT secondary alignments [%d]\n", opt.best_n);
-		fprintf(stderr, "  Alignment:\n");
-		fprintf(stderr, "    -A INT       matching score [%d]\n", opt.a);
-		fprintf(stderr, "    -B INT       mismatch penalty [%d]\n", opt.b);
-		fprintf(stderr, "    -O INT[,INT] gap open penalty [%d,%d]\n", opt.q, opt.q2);
-		fprintf(stderr, "    -E INT[,INT] gap extension penalty; a k-long gap costs min{O1+k*E1,O2+k*E2} [%d,%d]\n", opt.e, opt.e2);
-		fprintf(stderr, "    -z INT       Z-drop score [%d]\n", opt.zdrop);
-		fprintf(stderr, "    -s INT       minimal peak DP alignment score [%d]\n", opt.min_dp_max);
-		fprintf(stderr, "  Input/Output:\n");
-		fprintf(stderr, "    -Q           ignore base quality in the input\n");
-		fprintf(stderr, "    -a           output in the SAM format (PAF by default)\n");
-		fprintf(stderr, "    -c           output CIGAR in PAF\n");
-		fprintf(stderr, "    -t INT       number of threads [%d]\n", n_threads);
-		fprintf(stderr, "    -K NUM       minibatch size [200M]\n");
-//		fprintf(stderr, "    -v INT       verbose level [%d]\n", mm_verbose);
-		fprintf(stderr, "    -V           show version number\n");
-		fprintf(stderr, "  Preset:\n");
-		fprintf(stderr, "    -x STR       preset (recommended to be applied before other options) []\n");
-		fprintf(stderr, "                 map10k/map-pb: -Hk19 (PacBio/ONT vs reference mapping)\n");
-		fprintf(stderr, "                 map-ont: -k15 (slightly more sensitive than 'map10k' for ONT vs reference)\n");
-		fprintf(stderr, "                 asm5: -k19 -w19 -A1 -B19 -O39,81 -E3,1 -s200 -z200 (asm to ref mapping; break at 5%% div.)\n");
-		fprintf(stderr, "                 asm10: -k19 -w19 -A1 -B9 -O16,41 -E2,1 -s200 -z200 (asm to ref mapping; break at 10%% div.)\n");
-		fprintf(stderr, "                 ava-pb: -Hk19 -w5 -Xp0 -m100 -g10000 -K500m --max-chain-skip 25 (PacBio read overlap)\n");
-		fprintf(stderr, "                 ava-ont: -k15 -w5 -Xp0 -m100 -g10000 -K500m --max-chain-skip 25 (ONT read overlap)\n");
-		fprintf(stderr, "\nSee `man ./minimap2.1' for detailed description of command-line options.\n");
-		return 1;
-	}
-
-	is_idx = mm_idx_is_idx(argv[optind]);
-	if (is_idx < 0) {
-		fprintf(stderr, "[E::%s] failed to open file '%s'\n", __func__, argv[optind]);
-		return 1;
-	}
-	if (is_idx) fpr = fopen(argv[optind], "rb");
-	else fp = mm_bseq_open(argv[optind]);
-	if (fnw) fpw = fopen(fnw, "wb");
-	for (;;) {
-		mm_idx_t *mi = 0;
-		if (fpr) {
-			mi = mm_idx_load(fpr);
-			if (idx_par_set && mm_verbose >= 2 && (mi->k != k || mi->w != w || mi->is_hpc != mi->is_hpc))
-				fprintf(stderr, "[W::%s::%.3f*%.2f] Indexing parameters on the command line (-k/-w/-H) overridden by parameters in the prebuilt index.\n",
-						__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0));
-		} else if (!mm_bseq_eof(fp)) {
-			mi = mm_idx_gen(fp, w, k, bucket_bits, is_hpc, minibatch_size, n_threads, batch_size, keep_name);
-		}
-		if (mi == 0) break;
 		if (mm_verbose >= 3)
 			fprintf(stderr, "[M::%s::%.3f*%.2f] loaded/built the index for %d target sequence(s)\n",
 					__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), mi->n_seq);
-		if (fpw) {
-			mm_idx_dump(fpw, mi);
-			if (mm_verbose >= 3)
-				fprintf(stderr, "[M::%s::%.3f*%.2f] dumpped the (partial) index to disk\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0));
-		}
 		if (argc != optind + 1) mm_mapopt_update(&opt, mi);
 		if (mm_verbose >= 3) mm_idx_stat(mi);
+		if (!(opt.flag & MM_F_FRAG_MODE)) {
 			for (i = optind + 1; i < argc; ++i)
-			mm_map_file(mi, argv[i], &opt, n_threads, minibatch_size);
+				mm_map_file(mi, argv[i], &opt, n_threads);
+		} else {
+			mm_map_file_frag(mi, argc - (optind + 1), (const char**)&argv[optind + 1], &opt, n_threads);
+		}
 		mm_idx_destroy(mi);
 	}
-	if (fpw) fclose(fpw);
+	n_parts = idx_rdr->n_parts;
-	if (fpr) fclose(fpr);
+	mm_idx_reader_close(idx_rdr);
-	if (fp)  mm_bseq_close(fp);
 
+	if (opt.split_prefix)
+		mm_split_merge(argc - (optind + 1), (const char**)&argv[optind + 1], &opt, n_parts);
+
+	if (fflush(stdout) == EOF) {
+		fprintf(stderr, "[ERROR] failed to write the results\n");
+		exit(EXIT_FAILURE);
+	}
+
+	if (mm_verbose >= 3) {
 		fprintf(stderr, "[M::%s] Version: %s\n", __func__, MM_VERSION);
 		fprintf(stderr, "[M::%s] CMD:", __func__);
 		for (i = 0; i < argc; ++i)
 			fprintf(stderr, " %s", argv[i]);
 		fprintf(stderr, "\n[M::%s] Real time: %.3f sec; CPU: %.3f sec\n", __func__, realtime() - mm_realtime0, cputime());
+	}
 	return 0;
 }

map.c

@@ -7,56 +7,11 @@
 #include "sdust.h"
 #include "mmpriv.h"
 #include "bseq.h"
-
+#include "khash.h"
-void mm_mapopt_init(mm_mapopt_t *opt)
-{
-	memset(opt, 0, sizeof(mm_mapopt_t));
-	opt->max_occ_frac = 1e-5f;
-	opt->mid_occ_frac = 2e-4f;
-	opt->sdust_thres = 0;
-
-	opt->min_cnt = 3;
-	opt->min_chain_score = 40;
-	opt->bw = 500;
-	opt->max_gap = 5000;
-	opt->max_chain_skip = 25;
-
-	opt->mask_level = 0.5f;
-	opt->pri_ratio = 0.8f;
-	opt->best_n = 5;
-
-	opt->max_join_long = 20000;
-	opt->max_join_short = 2000;
-	opt->min_join_flank_sc = 1000;
-
-	opt->a = 2, opt->b = 4, opt->q = 4, opt->e = 2, opt->q2 = 24, opt->e2 = 1;
-	opt->zdrop = 400;
-	opt->min_dp_max = opt->min_chain_score;
-	opt->min_ksw_len = 200;
-}
-
-void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
-{
-	opt->max_occ = mm_idx_cal_max_occ(mi, opt->max_occ_frac);
-	opt->mid_occ = mm_idx_cal_max_occ(mi, opt->mid_occ_frac);
-	if (mm_verbose >= 3)
-		fprintf(stderr, "[M::%s::%.3f*%.2f] mid_occ = %d; max_occ = %d\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0),
-				opt->mid_occ, opt->max_occ);
-}
-
-typedef struct {
-	uint32_t n:31, is_alloc:1;
-	uint32_t qpos;
-	union {
-		const uint64_t *cr;
-		uint64_t *r;
-	} x;
-} mm_match_t;
 
 struct mm_tbuf_s {
-	sdust_buf_t *sdb;
-	mm128_v mini;
 	void *km;
+	int rep_len, frag_gap;
 };
 
 mm_tbuf_t *mm_tbuf_init(void)
@@ -64,213 +19,371 @@ mm_tbuf_t *mm_tbuf_init(void)
 	mm_tbuf_t *b;
 	b = (mm_tbuf_t*)calloc(1, sizeof(mm_tbuf_t));
 	if (!(mm_dbg_flag & 1)) b->km = km_init();
-	b->sdb = sdust_buf_init(b->km);
 	return b;
 }
 
 void mm_tbuf_destroy(mm_tbuf_t *b)
 {
 	if (b == 0) return;
-	kfree(b->km, b->mini.a);
-	sdust_buf_destroy(b->sdb);
 	km_destroy(b->km);
 	free(b);
 }
 
-static void mm_dust_minier(mm128_v *mini, int l_seq, const char *seq, int sdust_thres, sdust_buf_t *sdb)
+static int mm_dust_minier(void *km, int n, mm128_t *a, int l_seq, const char *seq, int sdust_thres)
 {
 	int n_dreg, j, k, u = 0;
 	const uint64_t *dreg;
-	if (sdust_thres <= 0 || sdb == 0) return;
+	sdust_buf_t *sdb;
+	if (sdust_thres <= 0) return n;
+	sdb = sdust_buf_init(km);
 	dreg = sdust_core((const uint8_t*)seq, l_seq, sdust_thres, 64, &n_dreg, sdb);
-	for (j = k = 0; j < mini->n; ++j) { // squeeze out minimizers that significantly overlap with LCRs
+	for (j = k = 0; j < n; ++j) { // squeeze out minimizers that significantly overlap with LCRs
-		int32_t qpos = (uint32_t)mini->a[j].y>>1, span = mini->a[j].x&0xff;
+		int32_t qpos = (uint32_t)a[j].y>>1, span = a[j].x&0xff;
 		int32_t s = qpos - (span - 1), e = s + span;
-		while (u < n_dreg && (uint32_t)dreg[u] <= s) ++u;
+		while (u < n_dreg && (int32_t)dreg[u] <= s) ++u;
-		if (u < n_dreg && dreg[u]>>32 < e) {
+		if (u < n_dreg && (int32_t)(dreg[u]>>32) < e) {
 			int v, l = 0;
-			for (v = u; v < n_dreg && dreg[v]>>32 < e; ++v) { // iterate over LCRs overlapping this minimizer
+			for (v = u; v < n_dreg && (int32_t)(dreg[v]>>32) < e; ++v) { // iterate over LCRs overlapping this minimizer
-				int ss = s > dreg[v]>>32? s : dreg[v]>>32;
+				int ss = s > (int32_t)(dreg[v]>>32)? s : dreg[v]>>32;
-				int ee = e < (uint32_t)dreg[v]? e : (uint32_t)dreg[v];
+				int ee = e < (int32_t)dreg[v]? e : (uint32_t)dreg[v];
 				l += ee - ss;
 			}
-			if (l <= span>>1) mini->a[k++] = mini->a[j]; // keep the minimizer if less than half of it falls in masked region
+			if (l <= span>>1) a[k++] = a[j]; // keep the minimizer if less than half of it falls in masked region
+		} else a[k++] = a[j];
 	}
-	}
+	sdust_buf_destroy(sdb);
-	mini->n = k;
+	return k; // the new size
-}
-#if 0
-int mm_pair_thin_core(mm_tbuf_t *b, uint64_t x, int radius, int rel, int st0, int n, const uint64_t *z, uint64_v *a)
-{
-	int i, st = st0, en = n, mid = en - 1;
-	while (st < en) {
-		uint64_t y;
-		mid = st + ((en - st) >> 1);
-		y = z[mid];
-		if (y < x && (x - y)>>1 > radius) st = mid + 1;
-		else if (y >= x && (y - x)>>1 > radius) en = mid;
-		else break;
-	}
-	if (st < en) {
-		for (en = mid + 1; en < n; ++en)
-			if (z[en] > x && (z[en] - x)>>1 > radius)
-				break;
-		for (st = mid - 1; st >= st0; --st)
-			if (z[st] < x && (x - z[st])>>1 > radius)
-				break;
-		++st;
-		for (i = st; i < en; ++i) {
-			uint64_t y = z[i];
-			if (((x ^ y) & 1) == rel) {
-//				printf("* %d,%d\n", (uint32_t)x>>1, (uint32_t)y>>1);
-				kv_push(uint64_t, b->km, *a, y);
-			}
-		}
-		return en;
-	} else return st < n && z[st] < x? st + 1 : en;
 }
 
-void mm_pair_thin(mm_tbuf_t *b, int radius, mm_match_t *m1, mm_match_t *m2)
+static void collect_minimizers(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, mm128_v *mv)
 {
-	mm_match_t *m[2];
+	int i, n, sum = 0;
-	const uint64_t *z[2];
+	mv->n = 0;
-	uint64_v a[2];
+	for (i = n = 0; i < n_segs; ++i) {
-	int i, n[2], k[2], u = 0, rel = (m1->qpos ^ m2->qpos) & 1;
+		size_t j;
+		mm_sketch(km, seqs[i], qlens[i], mi->w, mi->k, i, mi->flag&MM_I_HPC, mv);
+		for (j = n; j < mv->n; ++j)
+			mv->a[j].y += sum << 1;
+		if (opt->sdust_thres > 0) // mask low-complexity minimizers
+			mv->n = n + mm_dust_minier(km, mv->n - n, mv->a + n, qlens[i], seqs[i], opt->sdust_thres);
+		sum += qlens[i], n = mv->n;
+	}
+}
 
-	m[0] = m1, m[1] = m2;
+#include "ksort.h"
-	for (i = 0; i < 2; ++i) {
+#define heap_lt(a, b) ((a).x > (b).x)
-		n[i] = m[i]->n;
+KSORT_INIT(heap, mm128_t, heap_lt)
-		z[i] = m[i]->x.cr;
+
-		k[i] = 0;
+typedef struct {
-		kv_init(a[i]);
+	uint32_t n;
-		kv_resize(uint64_t, b->km, a[i], 256);
+	uint32_t q_pos, q_span;
-	}
+	uint32_t seg_id:31, is_tandem:1;
-	while (k[0] < n[0] && k[1] < n[1]) {
+	const uint64_t *cr;
-		//printf("%d; %d,%d\n", u, k[0], k[1]);
+} mm_match_t;
-		int v = u^1, dist = (int)(m[v]->qpos>>1) - (int)(m[u]->qpos>>1);
+
-		uint64_t x = z[u][k[u]];
+static mm_match_t *collect_matches(void *km, int *_n_m, int max_occ, const mm_idx_t *mi, const mm128_v *mv, int64_t *n_a, int *rep_len, int *n_mini_pos, uint64_t **mini_pos)
-		int uori = (x ^ m[u]->qpos) & 1, last;
-		int64_t tpos = x>>1 & 0x7fffffff;
-		tpos = uori == 0? tpos + dist : tpos - dist;
-		if (tpos < 0) tpos = 0;
-		x = x>>32<<32 | tpos<<1 | (x&1);
-		last = a[v].n;
-		k[v] = mm_pair_thin_core(b, x, radius, rel, k[v], n[v], z[v], &a[v]);
-		if (a[v].n > last) kv_push(uint64_t, b->km, a[u], z[u][k[u]]);
-		++k[u];
-		u ^= 1;
-	}
-	for (i = 0; i < 2; ++i)
-		m[i]->n = a[i].n, m[i]->x.r = a[i].a, m[i]->is_alloc = 1;
-//	printf("%d,%d; %d,%d\n", m[0]->qpos>>1, m[1]->qpos>>1, m[0]->n, m[1]->n);
-}
-#endif
-mm_reg1_t *mm_map_frag(const mm_mapopt_t *opt, const mm_idx_t *mi, mm_tbuf_t *b, uint32_t m_st, uint32_t m_en, const char *qname, int qlen, const char *seq, int *n_regs)
 {
-	int i, n = m_en - m_st, j, n_u;
+	int rep_st = 0, rep_en = 0, n_m;
-	int64_t n_a;
+	size_t i;
-	uint64_t *u;
+	mm_match_t *m;
+	*n_mini_pos = 0;
+	*mini_pos = (uint64_t*)kmalloc(km, mv->n * sizeof(uint64_t));
+	m = (mm_match_t*)kmalloc(km, mv->n * sizeof(mm_match_t));
+	for (i = 0, n_m = 0, *rep_len = 0, *n_a = 0; i < mv->n; ++i) {
+		const uint64_t *cr;
+		mm128_t *p = &mv->a[i];
+		uint32_t q_pos = (uint32_t)p->y, q_span = p->x & 0xff;
+		int t;
+		cr = mm_idx_get(mi, p->x>>8, &t);
+		if (t >= max_occ) {
+			int en = (q_pos >> 1) + 1, st = en - q_span;
+			if (st > rep_en) {
+				*rep_len += rep_en - rep_st;
+				rep_st = st, rep_en = en;
+			} else rep_en = en;
+		} else {
+			mm_match_t *q = &m[n_m++];
+			q->q_pos = q_pos, q->q_span = q_span, q->cr = cr, q->n = t, q->seg_id = p->y >> 32;
+			q->is_tandem = 0;
+			if (i > 0 && p->x>>8 == mv->a[i - 1].x>>8) q->is_tandem = 1;
+			if (i < mv->n - 1 && p->x>>8 == mv->a[i + 1].x>>8) q->is_tandem = 1;
+			*n_a += q->n;
+			(*mini_pos)[(*n_mini_pos)++] = (uint64_t)q_span<<32 | q_pos>>1;
+		}
+	}
+	*rep_len += rep_en - rep_st;
+	*_n_m = n_m;
+	return m;
+}
+
+static inline int skip_seed(int flag, uint64_t r, const mm_match_t *q, const char *qname, int qlen, const mm_idx_t *mi, int *is_self)
+{
+	*is_self = 0;
+	if (qname && (flag & (MM_F_NO_DIAG|MM_F_NO_DUAL))) {
+		const mm_idx_seq_t *s = &mi->seq[r>>32];
+		int cmp;
+		cmp = strcmp(qname, s->name);
+		if ((flag&MM_F_NO_DIAG) && cmp == 0 && (int)s->len == qlen) {
+			if ((uint32_t)r>>1 == (q->q_pos>>1)) return 1; // avoid the diagnonal anchors
+			if ((r&1) == (q->q_pos&1)) *is_self = 1; // this flag is used to avoid spurious extension on self chain
+		}
+		if ((flag&MM_F_NO_DUAL) && cmp > 0) // all-vs-all mode: map once
+			return 1;
+	}
+	if (flag & (MM_F_FOR_ONLY|MM_F_REV_ONLY)) {
+		if ((r&1) == (q->q_pos&1)) { // forward strand
+			if (flag & MM_F_REV_ONLY) return 1;
+		} else {
+			if (flag & MM_F_FOR_ONLY) return 1;
+		}
+	}
+	return 0;
+}
+
+static mm128_t *collect_seed_hits_heap(void *km, const mm_mapopt_t *opt, int max_occ, const mm_idx_t *mi, const char *qname, const mm128_v *mv, int qlen, int64_t *n_a, int *rep_len,
+								  int *n_mini_pos, uint64_t **mini_pos)
+{
+	int i, n_m, heap_size = 0;
+	int64_t j, n_for = 0, n_rev = 0;
+	mm_match_t *m;
+	mm128_t *a, *heap;
+
+	m = collect_matches(km, &n_m, max_occ, mi, mv, n_a, rep_len, n_mini_pos, mini_pos);
+
+	heap = (mm128_t*)kmalloc(km, n_m * sizeof(mm128_t));
+	a = (mm128_t*)kmalloc(km, *n_a * sizeof(mm128_t));
+
+	for (i = 0, heap_size = 0; i < n_m; ++i) {
+		if (m[i].n > 0) {
+			heap[heap_size].x = m[i].cr[0];
+			heap[heap_size].y = (uint64_t)i<<32;
+			++heap_size;
+		}
+	}
+	ks_heapmake_heap(heap_size, heap);
+	while (heap_size > 0) {
+		mm_match_t *q = &m[heap->y>>32];
+		mm128_t *p;
+		uint64_t r = heap->x;
+		int32_t is_self, rpos = (uint32_t)r >> 1;
+		if (!skip_seed(opt->flag, r, q, qname, qlen, mi, &is_self)) {
+			if ((r&1) == (q->q_pos&1)) { // forward strand
+				p = &a[n_for++];
+				p->x = (r&0xffffffff00000000ULL) | rpos;
+				p->y = (uint64_t)q->q_span << 32 | q->q_pos >> 1;
+			} else { // reverse strand
+				p = &a[(*n_a) - (++n_rev)];
+				p->x = 1ULL<<63 | (r&0xffffffff00000000ULL) | rpos;
+				p->y = (uint64_t)q->q_span << 32 | (qlen - ((q->q_pos>>1) + 1 - q->q_span) - 1);
+			}
+			p->y |= (uint64_t)q->seg_id << MM_SEED_SEG_SHIFT;
+			if (q->is_tandem) p->y |= MM_SEED_TANDEM;
+			if (is_self) p->y |= MM_SEED_SELF;
+		}
+		// update the heap
+		if ((uint32_t)heap->y < q->n - 1) {
+			++heap[0].y;
+			heap[0].x = m[heap[0].y>>32].cr[(uint32_t)heap[0].y];
+		} else {
+			heap[0] = heap[heap_size - 1];
+			--heap_size;
+		}
+		ks_heapdown_heap(0, heap_size, heap);
+	}
+	kfree(km, m);
+	kfree(km, heap);
+
+	// reverse anchors on the reverse strand, as they are in the descending order
+	for (j = 0; j < n_rev>>1; ++j) {
+		mm128_t t = a[(*n_a) - 1 - j];
+		a[(*n_a) - 1 - j] = a[(*n_a) - (n_rev - j)];
+		a[(*n_a) - (n_rev - j)] = t;
+	}
+	if (*n_a > n_for + n_rev) {
+		memmove(a + n_for, a + (*n_a) - n_rev, n_rev * sizeof(mm128_t));
+		*n_a = n_for + n_rev;
+	}
+	return a;
+}
+
+static mm128_t *collect_seed_hits(void *km, const mm_mapopt_t *opt, int max_occ, const mm_idx_t *mi, const char *qname, const mm128_v *mv, int qlen, int64_t *n_a, int *rep_len,
+								  int *n_mini_pos, uint64_t **mini_pos)
+{
+	int i, n_m;
 	mm_match_t *m;
 	mm128_t *a;
-	mm_reg1_t *regs;
+	m = collect_matches(km, &n_m, max_occ, mi, mv, n_a, rep_len, n_mini_pos, mini_pos);
-
+	a = (mm128_t*)kmalloc(km, *n_a * sizeof(mm128_t));
-	// convert to local representation
+	for (i = 0, *n_a = 0; i < n_m; ++i) {
-	m = (mm_match_t*)kmalloc(b->km, n * sizeof(mm_match_t));
-	for (i = 0; i < n; ++i) {
-		int t;
-		mm128_t *p = &b->mini.a[i + m_st];
-		m[i].is_alloc = 0;
-		m[i].qpos = (uint32_t)p->y;
-		m[i].x.cr = mm_idx_get(mi, p->x>>8, &t);
-		m[i].n = t;
-	}
-#if 0
-	int last = -1, last2 = -1;
-	// pair k-mer thinning
-	for (i = 0; i < n; ++i) {
-		if (m[i].n >= opt->mid_occ && m[i].n < opt->max_occ) {
-			if (last2 < 0) last2 = i;
-			if (last < 0 || m[last].n < m[i].n) last = i;
-			if (last >= 0 && (m[last].qpos>>1) + (m[last].span>>1) <= m[i].qpos>>1) {
-				mm_pair_thin(b, opt->bw, &m[last], &m[i]);
-				last2 = last = -1;
-			} else if (last2 >= 0 && (m[last2].qpos>>1) + (m[last2].span>>1) <= m[i].qpos>>1) {
-				mm_pair_thin(b, opt->bw, &m[last2], &m[i]);
-				last2 = last = -1;
-			}
-		}
-	}
-#endif
-	// fill the _a_ array
-	for (i = 0, n_a = 0; i < n; ++i) // find the length of a[]
-		if (m[i].n < opt->mid_occ) n_a += m[i].n;
-	a = (mm128_t*)kmalloc(b->km, n_a * sizeof(mm128_t));
-	for (i = j = 0; i < n; ++i) {
-		mm128_t *p = &b->mini.a[i + m_st];
 		mm_match_t *q = &m[i];
-		const uint64_t *r = q->x.cr;
+		const uint64_t *r = q->cr;
-		int k, q_span = p->x & 0xff;
+		uint32_t k;
-		if (q->n >= opt->mid_occ) continue;
 		for (k = 0; k < q->n; ++k) {
-			const char *tname = mi->seq[r[k]>>32].name;
+			int32_t is_self, rpos = (uint32_t)r[k] >> 1;
-			int32_t rpos = (uint32_t)r[k] >> 1;
 			mm128_t *p;
-			if (qname && (opt->flag&MM_F_NO_SELF) && strcmp(qname, tname) == 0 && rpos == (q->qpos>>1)) // avoid the diagonal
+			if (skip_seed(opt->flag, r[k], q, qname, qlen, mi, &is_self)) continue;
-				continue;
+			p = &a[(*n_a)++];
-			if (qname && (opt->flag&MM_F_AVA) && strcmp(qname, tname) > 0) // all-vs-all mode: map once
+			if ((r[k]&1) == (q->q_pos&1)) { // forward strand
-				continue;
+				p->x = (r[k]&0xffffffff00000000ULL) | rpos;
-			p = &a[j++];
+				p->y = (uint64_t)q->q_span << 32 | q->q_pos >> 1;
-			if ((r[k]&1) == (q->qpos&1)) { // forward strand
-				p->x = (r[k]&0xffffffff00000000ULL) | (uint32_t)r[k]>>1;
-				p->y = (uint64_t)q_span << 32 | q->qpos >> 1;
 			} else { // reverse strand
-				p->x = 1ULL<<63 | (r[k]&0xffffffff00000000ULL) | (uint32_t)r[k]>>1;
+				p->x = 1ULL<<63 | (r[k]&0xffffffff00000000ULL) | rpos;
-				p->y = (uint64_t)q_span << 32 | (qlen - ((q->qpos>>1) + 1 - q_span) - 1);
+				p->y = (uint64_t)q->q_span << 32 | (qlen - ((q->q_pos>>1) + 1 - q->q_span) - 1);
+			}
+			p->y |= (uint64_t)q->seg_id << MM_SEED_SEG_SHIFT;
+			if (q->is_tandem) p->y |= MM_SEED_TANDEM;
+			if (is_self) p->y |= MM_SEED_SELF;
 		}
 	}
+	kfree(km, m);
+	radix_sort_128x(a, a + (*n_a));
+	return a;
 }
-	n_a = j;
-	radix_sort_128x(a, a + n_a);
-	for (i = 0; i < n; ++i)
-		if (m[i].is_alloc) kfree(b->km, m[i].x.r);
-	kfree(b->km, m);
 
-	if (mm_dbg_flag & MM_DBG_PRINT_SEED)
+static void chain_post(const mm_mapopt_t *opt, int max_chain_gap_ref, const mm_idx_t *mi, void *km, int qlen, int n_segs, const int *qlens, int *n_regs, mm_reg1_t *regs, mm128_t *a)
-		for (i = 0; i < n_a; ++i)
+{
-			fprintf(stderr, "SD\t%s\t%d\t%c\t%d\t%d\n", mi->seq[a[i].x<<1>>33].name, (int32_t)a[i].x, "+-"[a[i].x>>63], (int32_t)a[i].y, (int32_t)(a[i].y>>32&0xff));
+	if (!(opt->flag & MM_F_ALL_CHAINS)) { // don't choose primary mapping(s)
-
+		mm_set_parent(km, opt->mask_level, *n_regs, regs, opt->a * 2 + opt->b);
-	n_u = mm_chain_dp(opt->max_gap, opt->bw, opt->max_chain_skip, opt->min_cnt, opt->min_chain_score, n_a, a, &u, b->km);
+		if (n_segs <= 1) mm_select_sub(km, opt->pri_ratio, mi->k*2, opt->best_n, n_regs, regs);
-	regs = mm_gen_regs(b->km, qlen, n_u, u, a);
+		else mm_select_sub_multi(km, opt->pri_ratio, 0.2f, 0.7f, max_chain_gap_ref, mi->k*2, opt->best_n, n_segs, qlens, n_regs, regs);
-	*n_regs = n_u;
+		if (!(opt->flag & (MM_F_SPLICE|MM_F_SR|MM_F_NO_LJOIN))) // long join not working well without primary chains
-	if (!(opt->flag & MM_F_AVA)) { // don't choose primary mapping(s) for read overlap
+			mm_join_long(km, opt, qlen, n_regs, regs, a);
-		mm_set_parent(b->km, opt->mask_level, *n_regs, regs);
-		mm_select_sub(b->km, opt->mask_level, opt->pri_ratio, opt->best_n, n_regs, regs);
-		mm_join_long(b->km, opt, qlen, n_regs, regs, a); // TODO: this can be applied to all-vs-all in principle
 	}
-	if (opt->flag & MM_F_CIGAR) {
+}
-		regs = mm_align_skeleton(b->km, opt, mi, qlen, seq, n_regs, regs, a); // this calls mm_filter_regs()
+
-		if (!(opt->flag & MM_F_AVA)) {
+static mm_reg1_t *align_regs(const mm_mapopt_t *opt, const mm_idx_t *mi, void *km, int qlen, const char *seq, int *n_regs, mm_reg1_t *regs, mm128_t *a)
-			mm_set_parent(b->km, opt->mask_level, *n_regs, regs);
+{
-			mm_select_sub(b->km, opt->mask_level, opt->pri_ratio, opt->best_n, n_regs, regs);
+	if (!(opt->flag & MM_F_CIGAR)) return regs;
+	regs = mm_align_skeleton(km, opt, mi, qlen, seq, n_regs, regs, a); // this calls mm_filter_regs()
+	if (!(opt->flag & MM_F_ALL_CHAINS)) { // don't choose primary mapping(s)
+		mm_set_parent(km, opt->mask_level, *n_regs, regs, opt->a * 2 + opt->b);
+		mm_select_sub(km, opt->pri_ratio, mi->k*2, opt->best_n, n_regs, regs);
 		mm_set_sam_pri(*n_regs, regs);
 	}
-	}
-	mm_set_mapq(*n_regs, regs);
-
-	// free
-	kfree(b->km, a);
-	kfree(b->km, u);
 	return regs;
 }
 
-mm_reg1_t *mm_map(const mm_idx_t *mi, int l_seq, const char *seq, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname)
+void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, int *n_regs, mm_reg1_t **regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname)
+{
+	int i, j, rep_len, qlen_sum, n_regs0, n_mini_pos;
+	int max_chain_gap_qry, max_chain_gap_ref, is_splice = !!(opt->flag & MM_F_SPLICE), is_sr = !!(opt->flag & MM_F_SR);
+	uint32_t hash;
+	int64_t n_a;
+	uint64_t *u, *mini_pos;
+	mm128_t *a;
+	mm128_v mv = {0,0,0};
+	mm_reg1_t *regs0;
+	km_stat_t kmst;
+
+	for (i = 0, qlen_sum = 0; i < n_segs; ++i)
+		qlen_sum += qlens[i], n_regs[i] = 0, regs[i] = 0;
+
+	if (qlen_sum == 0 || n_segs <= 0 || n_segs > MM_MAX_SEG) return;
+
+	hash  = qname? __ac_X31_hash_string(qname) : 0;
+	hash ^= __ac_Wang_hash(qlen_sum) + __ac_Wang_hash(opt->seed);
+	hash  = __ac_Wang_hash(hash);
+
+	collect_minimizers(b->km, opt, mi, n_segs, qlens, seqs, &mv);
+	if (opt->flag & MM_F_HEAP_SORT) a = collect_seed_hits_heap(b->km, opt, opt->mid_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
+	else a = collect_seed_hits(b->km, opt, opt->mid_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
+
+	if (mm_dbg_flag & MM_DBG_PRINT_SEED) {
+		fprintf(stderr, "RS\t%d\n", rep_len);
+		for (i = 0; i < n_a; ++i)
+			fprintf(stderr, "SD\t%s\t%d\t%c\t%d\t%d\t%d\n", mi->seq[a[i].x<<1>>33].name, (int32_t)a[i].x, "+-"[a[i].x>>63], (int32_t)a[i].y, (int32_t)(a[i].y>>32&0xff),
+					i == 0? 0 : ((int32_t)a[i].y - (int32_t)a[i-1].y) - ((int32_t)a[i].x - (int32_t)a[i-1].x));
+	}
+
+	// set max chaining gap on the query and the reference sequence
+	if (is_sr)
+		max_chain_gap_qry = qlen_sum > opt->max_gap? qlen_sum : opt->max_gap;
+	else max_chain_gap_qry = opt->max_gap;
+	if (opt->max_gap_ref > 0) {
+		max_chain_gap_ref = opt->max_gap_ref; // always honor mm_mapopt_t::max_gap_ref if set
+	} else if (opt->max_frag_len > 0) {
+		max_chain_gap_ref = opt->max_frag_len - qlen_sum;
+		if (max_chain_gap_ref < opt->max_gap) max_chain_gap_ref = opt->max_gap;
+	} else max_chain_gap_ref = opt->max_gap;
+
+	a = mm_chain_dp(max_chain_gap_ref, max_chain_gap_qry, opt->bw, opt->max_chain_skip, opt->min_cnt, opt->min_chain_score, is_splice, n_segs, n_a, a, &n_regs0, &u, b->km);
+
+	if (opt->max_occ > opt->mid_occ && rep_len > 0) {
+		int rechain = 0;
+		if (n_regs0 > 0) { // test if the best chain has all the segments
+			int n_chained_segs = 1, max = 0, max_i = -1, max_off = -1, off = 0;
+			for (i = 0; i < n_regs0; ++i) { // find the best chain
+				if (max < (int)(u[i]>>32)) max = u[i]>>32, max_i = i, max_off = off;
+				off += (uint32_t)u[i];
+			}
+			for (i = 1; i < (int32_t)u[max_i]; ++i) // count the number of segments in the best chain
+				if ((a[max_off+i].y&MM_SEED_SEG_MASK) != (a[max_off+i-1].y&MM_SEED_SEG_MASK))
+					++n_chained_segs;
+			if (n_chained_segs < n_segs)
+				rechain = 1;
+		} else rechain = 1;
+		if (rechain) { // redo chaining with a higher max_occ threshold
+			kfree(b->km, a);
+			kfree(b->km, u);
+			kfree(b->km, mini_pos);
+			if (opt->flag & MM_F_HEAP_SORT) a = collect_seed_hits_heap(b->km, opt, opt->max_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
+			else a = collect_seed_hits(b->km, opt, opt->max_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
+			a = mm_chain_dp(max_chain_gap_ref, max_chain_gap_qry, opt->bw, opt->max_chain_skip, opt->min_cnt, opt->min_chain_score, is_splice, n_segs, n_a, a, &n_regs0, &u, b->km);
+		}
+	}
+	b->frag_gap = max_chain_gap_ref;
+	b->rep_len = rep_len;
+
+	regs0 = mm_gen_regs(b->km, hash, qlen_sum, n_regs0, u, a);
+
+	if (mm_dbg_flag & MM_DBG_PRINT_SEED)
+		for (j = 0; j < n_regs0; ++j)
+			for (i = regs0[j].as; i < regs0[j].as + regs0[j].cnt; ++i)
+				fprintf(stderr, "CN\t%d\t%s\t%d\t%c\t%d\t%d\t%d\n", j, mi->seq[a[i].x<<1>>33].name, (int32_t)a[i].x, "+-"[a[i].x>>63], (int32_t)a[i].y, (int32_t)(a[i].y>>32&0xff),
+						i == regs0[j].as? 0 : ((int32_t)a[i].y - (int32_t)a[i-1].y) - ((int32_t)a[i].x - (int32_t)a[i-1].x));
+
+	chain_post(opt, max_chain_gap_ref, mi, b->km, qlen_sum, n_segs, qlens, &n_regs0, regs0, a);
+	if (!is_sr) mm_est_err(mi, qlen_sum, n_regs0, regs0, a, n_mini_pos, mini_pos);
+
+	if (n_segs == 1) { // uni-segment
+		regs0 = align_regs(opt, mi, b->km, qlens[0], seqs[0], &n_regs0, regs0, a);
+		mm_set_mapq(b->km, n_regs0, regs0, opt->min_chain_score, opt->a, rep_len, is_sr);
+		n_regs[0] = n_regs0, regs[0] = regs0;
+	} else { // multi-segment
+		mm_seg_t *seg;
+		seg = mm_seg_gen(b->km, hash, n_segs, qlens, n_regs0, regs0, n_regs, regs, a); // split fragment chain to separate segment chains
+		free(regs0);
+		for (i = 0; i < n_segs; ++i) {
+			mm_set_parent(b->km, opt->mask_level, n_regs[i], regs[i], opt->a * 2 + opt->b); // update mm_reg1_t::parent
+			regs[i] = align_regs(opt, mi, b->km, qlens[i], seqs[i], &n_regs[i], regs[i], seg[i].a);
+			mm_set_mapq(b->km, n_regs[i], regs[i], opt->min_chain_score, opt->a, rep_len, is_sr);
+		}
+		mm_seg_free(b->km, n_segs, seg);
+		if (n_segs == 2 && opt->pe_ori >= 0 && (opt->flag&MM_F_CIGAR))
+			mm_pair(b->km, max_chain_gap_ref, opt->pe_bonus, opt->a * 2 + opt->b, opt->a, qlens, n_regs, regs); // pairing
+	}
+
+	kfree(b->km, mv.a);
+	kfree(b->km, a);
+	kfree(b->km, u);
+	kfree(b->km, mini_pos);
+
+	if (b->km) {
+		km_stat(b->km, &kmst);
+		if (mm_dbg_flag & MM_DBG_PRINT_QNAME)
+			fprintf(stderr, "QM\t%s\t%d\tcap=%ld,nCore=%ld,largest=%ld\n", qname, qlen_sum, kmst.capacity, kmst.n_cores, kmst.largest);
+		assert(kmst.n_blocks == kmst.n_cores); // otherwise, there is a memory leak
+		if (kmst.largest > 1U<<28) {
+			km_destroy(b->km);
+			b->km = km_init();
+		}
+	}
+}
+
+mm_reg1_t *mm_map(const mm_idx_t *mi, int qlen, const char *seq, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname)
 {
 	mm_reg1_t *regs;
-	b->mini.n = 0;
+	mm_map_frag(mi, 1, &qlen, &seq, n_regs, &regs, b, opt, qname);
-	mm_sketch(b->km, seq, l_seq, mi->w, mi->k, 0, mi->is_hpc, &b->mini);
-	if (opt->sdust_thres > 0)
-		mm_dust_minier(&b->mini, l_seq, seq, opt->sdust_thres, b->sdb);
-	regs = mm_map_frag(opt, mi, b, 0, b->mini.n, qname, l_seq, seq, n_regs);
 	return regs;
 }
 
@@ -279,39 +392,137 @@ mm_reg1_t *mm_map(const mm_idx_t *mi, int l_seq, const char *seq, int *n_regs, m
  **************************/
 
 typedef struct {
-	int mini_batch_size, n_processed, n_threads;
+	int mini_batch_size, n_processed, n_threads, n_fp;
 	const mm_mapopt_t *opt;
-	mm_bseq_file_t *fp;
+	mm_bseq_file_t **fp;
 	const mm_idx_t *mi;
 	kstring_t str;
+
+	int n_parts;
+	uint32_t *rid_shift;
+	FILE *fp_split, **fp_parts;
 } pipeline_t;
 
 typedef struct {
 	const pipeline_t *p;
-    int n_seq;
+    int n_seq, n_frag;
 	mm_bseq1_t *seq;
-	int *n_reg;
+	int *n_reg, *seg_off, *n_seg, *rep_len, *frag_gap;
 	mm_reg1_t **reg;
 	mm_tbuf_t **buf;
 } step_t;
 
 static void worker_for(void *_data, long i, int tid) // kt_for() callback
 {
-    step_t *step = (step_t*)_data;
+    step_t *s = (step_t*)_data;
+	int qlens[MM_MAX_SEG], j, off = s->seg_off[i], pe_ori = s->p->opt->pe_ori;
+	const char *qseqs[MM_MAX_SEG];
+	mm_tbuf_t *b = s->buf[tid];
+	assert(s->n_seg[i] <= MM_MAX_SEG);
 	if (mm_dbg_flag & MM_DBG_PRINT_QNAME)
-		fprintf(stderr, "QR\t%s\t%d\n", step->seq[i].name, tid);
+		fprintf(stderr, "QR\t%s\t%d\t%d\n", s->seq[off].name, tid, s->seq[off].l_seq);
-	step->reg[i] = mm_map(step->p->mi, step->seq[i].l_seq, step->seq[i].seq, &step->n_reg[i], step->buf[tid], step->p->opt, step->seq[i].name);
+	for (j = 0; j < s->n_seg[i]; ++j) {
+		if (s->n_seg[i] == 2 && ((j == 0 && (pe_ori>>1&1)) || (j == 1 && (pe_ori&1))))
+			mm_revcomp_bseq(&s->seq[off + j]);
+		qlens[j] = s->seq[off + j].l_seq;
+		qseqs[j] = s->seq[off + j].seq;
+	}
+	if (s->p->opt->flag & MM_F_INDEPEND_SEG) {
+		for (j = 0; j < s->n_seg[i]; ++j) {
+			mm_map_frag(s->p->mi, 1, &qlens[j], &qseqs[j], &s->n_reg[off+j], &s->reg[off+j], b, s->p->opt, s->seq[off+j].name);
+			s->rep_len[off + j] = b->rep_len;
+			s->frag_gap[off + j] = b->frag_gap;
+		}
+	} else {
+		mm_map_frag(s->p->mi, s->n_seg[i], qlens, qseqs, &s->n_reg[off], &s->reg[off], b, s->p->opt, s->seq[off].name);
+		for (j = 0; j < s->n_seg[i]; ++j) {
+			s->rep_len[off + j] = b->rep_len;
+			s->frag_gap[off + j] = b->frag_gap;
+		}
+	}
+	for (j = 0; j < s->n_seg[i]; ++j) // flip the query strand and coordinate to the original read strand
+		if (s->n_seg[i] == 2 && ((j == 0 && (pe_ori>>1&1)) || (j == 1 && (pe_ori&1)))) {
+			int k, t;
+			mm_revcomp_bseq(&s->seq[off + j]);
+			for (k = 0; k < s->n_reg[off + j]; ++k) {
+				mm_reg1_t *r = &s->reg[off + j][k];
+				t = r->qs;
+				r->qs = qlens[j] - r->qe;
+				r->qe = qlens[j] - t;
+				r->rev = !r->rev;
+			}
+		}
+}
+
+static void merge_hits(step_t *s)
+{
+	int f, i, k0, k, max_seg = 0, *n_reg_part, *rep_len_part, *frag_gap_part, *qlens;
+	void *km;
+	FILE **fp = s->p->fp_parts;
+	const mm_mapopt_t *opt = s->p->opt;
+
+	km = km_init();
+	for (f = 0; f < s->n_frag; ++f)
+		max_seg = max_seg > s->n_seg[f]? max_seg : s->n_seg[f];
+	qlens = CALLOC(int, max_seg + s->p->n_parts * 3);
+	n_reg_part = qlens + max_seg;
+	rep_len_part = n_reg_part + s->p->n_parts;
+	frag_gap_part = rep_len_part + s->p->n_parts;
+	for (f = 0, k = k0 = 0; f < s->n_frag; ++f) {
+		k0 = k;
+		for (i = 0; i < s->n_seg[f]; ++i, ++k) {
+			int j, l, t, rep_len = 0;
+			qlens[i] = s->seq[k].l_seq;
+			for (j = 0, s->n_reg[k] = 0; j < s->p->n_parts; ++j) {
+				mm_err_fread(&n_reg_part[j],    sizeof(int), 1, fp[j]);
+				mm_err_fread(&rep_len_part[j],  sizeof(int), 1, fp[j]);
+				mm_err_fread(&frag_gap_part[j], sizeof(int), 1, fp[j]);
+				s->n_reg[k] += n_reg_part[j];
+				if (rep_len < rep_len_part[j])
+					rep_len = rep_len_part[j];
+			}
+			s->reg[k] = CALLOC(mm_reg1_t, s->n_reg[k]);
+			for (j = 0, l = 0; j < s->p->n_parts; ++j) {
+				for (t = 0; t < n_reg_part[j]; ++t, ++l) {
+					mm_reg1_t *r = &s->reg[k][l];
+					uint32_t capacity;
+					mm_err_fread(r, sizeof(mm_reg1_t), 1, fp[j]);
+					r->rid += s->p->rid_shift[j];
+					if (opt->flag & MM_F_CIGAR) {
+						mm_err_fread(&capacity, 4, 1, fp[j]);
+						r->p = (mm_extra_t*)calloc(capacity, 4);
+						r->p->capacity = capacity;
+						mm_err_fread(r->p, r->p->capacity, 4, fp[j]);
+					}
+				}
+			}
+			mm_hit_sort(km, &s->n_reg[k], s->reg[k]);
+			mm_set_parent(km, opt->mask_level, s->n_reg[k], s->reg[k], opt->a * 2 + opt->b);
+			if (!(opt->flag & MM_F_ALL_CHAINS)) {
+				mm_select_sub(km, opt->pri_ratio, s->p->mi->k*2, opt->best_n, &s->n_reg[k], s->reg[k]);
+				mm_set_sam_pri(s->n_reg[k], s->reg[k]);
+			}
+			mm_set_mapq(km, s->n_reg[k], s->reg[k], opt->min_chain_score, opt->a, rep_len, !!(opt->flag & MM_F_SR));
+		}
+		if (s->n_seg[f] == 2 && opt->pe_ori >= 0 && (opt->flag&MM_F_CIGAR))
+			mm_pair(km, frag_gap_part[0], opt->pe_bonus, opt->a * 2 + opt->b, opt->a, qlens, &s->n_reg[k0], &s->reg[k0]);
+	}
+	free(qlens);
+	km_destroy(km);
 }
 
 static void *worker_pipeline(void *shared, int step, void *in)
 {
-	int i, j;
+	int i, j, k;
     pipeline_t *p = (pipeline_t*)shared;
     if (step == 0) { // step 0: read sequences
 		int with_qual = (!!(p->opt->flag & MM_F_OUT_SAM) && !(p->opt->flag & MM_F_NO_QUAL));
+		int with_comment = !!(p->opt->flag & MM_F_COPY_COMMENT);
+		int frag_mode = (p->n_fp > 1 || !!(p->opt->flag & MM_F_FRAG_MODE));
         step_t *s;
         s = (step_t*)calloc(1, sizeof(step_t));
-		s->seq = mm_bseq_read(p->fp, p->mini_batch_size, with_qual, &s->n_seq);
+		if (p->n_fp > 1) s->seq = mm_bseq_read_frag2(p->n_fp, p->fp, p->mini_batch_size, with_qual, with_comment, &s->n_seq);
+		else s->seq = mm_bseq_read3(p->fp[0], p->mini_batch_size, with_qual, with_comment, frag_mode, &s->n_seq);
 		if (s->seq) {
 			s->p = p;
 			for (i = 0; i < s->n_seq; ++i)
@@ -319,36 +530,76 @@ static void *worker_pipeline(void *shared, int step, void *in)
 			s->buf = (mm_tbuf_t**)calloc(p->n_threads, sizeof(mm_tbuf_t*));
 			for (i = 0; i < p->n_threads; ++i)
 				s->buf[i] = mm_tbuf_init();
-			s->n_reg = (int*)calloc(s->n_seq, sizeof(int));
+			s->n_reg = (int*)calloc(5 * s->n_seq, sizeof(int));
+			s->seg_off = s->n_reg + s->n_seq; // seg_off, n_seg, rep_len and frag_gap are allocated together with n_reg
+			s->n_seg = s->seg_off + s->n_seq;
+			s->rep_len = s->n_seg + s->n_seq;
+			s->frag_gap = s->rep_len + s->n_seq;
 			s->reg = (mm_reg1_t**)calloc(s->n_seq, sizeof(mm_reg1_t*));
+			for (i = 1, j = 0; i <= s->n_seq; ++i)
+				if (i == s->n_seq || !frag_mode || !mm_qname_same(s->seq[i-1].name, s->seq[i].name)) {
+					s->n_seg[s->n_frag] = i - j;
+					s->seg_off[s->n_frag++] = j;
+					j = i;
+				}
 			return s;
 		} else free(s);
     } else if (step == 1) { // step 1: map
-		kt_for(p->n_threads, worker_for, in, ((step_t*)in)->n_seq);
+		if (p->n_parts > 0) merge_hits((step_t*)in);
+		else kt_for(p->n_threads, worker_for, in, ((step_t*)in)->n_frag);
 		return in;
     } else if (step == 2) { // step 2: output
+		void *km = 0;
         step_t *s = (step_t*)in;
 		const mm_idx_t *mi = p->mi;
 		for (i = 0; i < p->n_threads; ++i) mm_tbuf_destroy(s->buf[i]);
 		free(s->buf);
-		for (i = 0; i < s->n_seq; ++i) {
+		if ((p->opt->flag & MM_F_OUT_CS) && !(mm_dbg_flag & MM_DBG_NO_KALLOC)) km = km_init();
+		for (k = 0; k < s->n_frag; ++k) {
+			int seg_st = s->seg_off[k], seg_en = s->seg_off[k] + s->n_seg[k];
+			for (i = seg_st; i < seg_en; ++i) {
 				mm_bseq1_t *t = &s->seq[i];
+				if (p->opt->split_prefix && p->n_parts == 0) { // then write to temporary files
+					mm_err_fwrite(&s->n_reg[i],    sizeof(int), 1, p->fp_split);
+					mm_err_fwrite(&s->rep_len[i],  sizeof(int), 1, p->fp_split);
+					mm_err_fwrite(&s->frag_gap[i], sizeof(int), 1, p->fp_split);
 					for (j = 0; j < s->n_reg[i]; ++j) {
 						mm_reg1_t *r = &s->reg[i][j];
-				if (p->opt->flag & MM_F_OUT_SAM) mm_write_sam(&p->str, mi, t, r);
+						mm_err_fwrite(r, sizeof(mm_reg1_t), 1, p->fp_split);
-				else mm_write_paf(&p->str, mi, t, r);
+						if (p->opt->flag & MM_F_CIGAR) {
-				puts(p->str.s);
+							mm_err_fwrite(&r->p->capacity, 4, 1, p->fp_split);
-				free(r->p);
+							mm_err_fwrite(r->p, r->p->capacity, 4, p->fp_split);
 						}
-			if (s->n_reg[i] == 0 && (p->opt->flag & MM_F_OUT_SAM)) {
-				mm_write_sam(&p->str, 0, t, 0);
-				puts(p->str.s);
 					}
+				} else if (s->n_reg[i] > 0) { // the query has at least one hit
+					for (j = 0; j < s->n_reg[i]; ++j) {
+						mm_reg1_t *r = &s->reg[i][j];
+						assert(!r->sam_pri || r->id == r->parent);
+						if ((p->opt->flag & MM_F_NO_PRINT_2ND) && r->id != r->parent)
+							continue;
+						if (p->opt->flag & MM_F_OUT_SAM)
+							mm_write_sam2(&p->str, mi, t, i - seg_st, j, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag);
+						else
+							mm_write_paf(&p->str, mi, t, r, km, p->opt->flag);
+						mm_err_puts(p->str.s);
+					}
+				} else if (p->opt->flag & (MM_F_OUT_SAM|MM_F_PAF_NO_HIT)) { // output an empty hit, if requested
+					if (p->opt->flag & MM_F_OUT_SAM)
+						mm_write_sam2(&p->str, mi, t, i - seg_st, -1, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag);
+					else
+						mm_write_paf(&p->str, mi, t, 0, 0, p->opt->flag);
+					mm_err_puts(p->str.s);
+				}
+			}
+			for (i = seg_st; i < seg_en; ++i) {
+				for (j = 0; j < s->n_reg[i]; ++j) free(s->reg[i][j].p);
 				free(s->reg[i]);
 				free(s->seq[i].seq); free(s->seq[i].name);
 				if (s->seq[i].qual) free(s->seq[i].qual);
 			}
-		free(s->reg); free(s->n_reg); free(s->seq);
+		}
+		free(s->reg); free(s->n_reg); free(s->seq); // seg_off, n_seg, rep_len and frag_gap were allocated with reg; no memory leak here
+		km_destroy(km);
 		if (mm_verbose >= 3)
 			fprintf(stderr, "[M::%s::%.3f*%.2f] mapped %d sequences\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), s->n_seq);
 		free(s);
@@ -356,21 +607,95 @@ static void *worker_pipeline(void *shared, int step, void *in)
     return 0;
 }
 
-int mm_map_file(const mm_idx_t *idx, const char *fn, const mm_mapopt_t *opt, int n_threads, int mini_batch_size)
+static mm_bseq_file_t **open_bseqs(int n, const char **fn)
 {
+	mm_bseq_file_t **fp;
+	int i, j;
+	fp = (mm_bseq_file_t**)calloc(n, sizeof(mm_bseq_file_t*));
+	for (i = 0; i < n; ++i) {
+		if ((fp[i] = mm_bseq_open(fn[i])) == 0) {
+			if (mm_verbose >= 1)
+				fprintf(stderr, "ERROR: failed to open file '%s'\n", fn[i]);
+			for (j = 0; j < i; ++j)
+				mm_bseq_close(fp[j]);
+			free(fp);
+			return 0;
+		}
+	}
+	return fp;
+}
+
+int mm_map_file_frag(const mm_idx_t *idx, int n_segs, const char **fn, const mm_mapopt_t *opt, int n_threads)
+{
+	int i, pl_threads;
 	pipeline_t pl;
+	if (n_segs < 1) return -1;
 	memset(&pl, 0, sizeof(pipeline_t));
-	pl.fp = mm_bseq_open(fn);
+	pl.n_fp = n_segs;
+	pl.fp = open_bseqs(pl.n_fp, fn);
 	if (pl.fp == 0) return -1;
 	pl.opt = opt, pl.mi = idx;
-	pl.n_threads = n_threads, pl.mini_batch_size = mini_batch_size;
+	pl.n_threads = n_threads > 1? n_threads : 1;
-	if (opt->flag & MM_F_OUT_SAM) {
+	pl.mini_batch_size = opt->mini_batch_size;
-		uint32_t i;
+	if (opt->split_prefix)
-		for (i = 0; i < idx->n_seq; ++i)
+		pl.fp_split = mm_split_init(opt->split_prefix, idx);
-			printf("@SQ\tSN:%s\tLN:%d\n", idx->seq[i].name, idx->seq[i].len);
+	pl_threads = n_threads == 1? 1 : (opt->flag&MM_F_2_IO_THREADS)? 3 : 2;
+	kt_pipeline(pl_threads, worker_pipeline, &pl, 3);
+
+	free(pl.str.s);
+	if (pl.fp_split) fclose(pl.fp_split);
+	for (i = 0; i < pl.n_fp; ++i)
+		mm_bseq_close(pl.fp[i]);
+	free(pl.fp);
+	return 0;
+}
+
+int mm_map_file(const mm_idx_t *idx, const char *fn, const mm_mapopt_t *opt, int n_threads)
+{
+	return mm_map_file_frag(idx, 1, &fn, opt, n_threads);
+}
+
+int mm_split_merge(int n_segs, const char **fn, const mm_mapopt_t *opt, int n_split_idx)
+{
+	int i;
+	pipeline_t pl;
+	mm_idx_t *mi;
+	if (n_segs < 1 || n_split_idx < 1) return -1;
+	memset(&pl, 0, sizeof(pipeline_t));
+	pl.n_fp = n_segs;
+	pl.fp = open_bseqs(pl.n_fp, fn);
+	if (pl.fp == 0) return -1;
+	pl.opt = opt;
+	pl.mini_batch_size = opt->mini_batch_size;
+
+	pl.n_parts = n_split_idx;
+	pl.fp_parts  = CALLOC(FILE*, pl.n_parts);
+	pl.rid_shift = CALLOC(uint32_t, pl.n_parts);
+	pl.mi = mi = mm_split_merge_prep(opt->split_prefix, n_split_idx, pl.fp_parts, pl.rid_shift);
+	if (pl.mi == 0) {
+		free(pl.fp_parts);
+		free(pl.rid_shift);
+		return -1;
 	}
-	kt_pipeline(n_threads == 1? 1 : 2, worker_pipeline, &pl, 3);
+	for (i = n_split_idx - 1; i > 0; --i)
+		pl.rid_shift[i] = pl.rid_shift[i - 1];
+	for (pl.rid_shift[0] = 0, i = 1; i < n_split_idx; ++i)
+		pl.rid_shift[i] += pl.rid_shift[i - 1];
+	if (opt->flag & MM_F_OUT_SAM)
+		for (i = 0; i < pl.mi->n_seq; ++i)
+			printf("@SQ\tSN:%s\tLN:%d\n", pl.mi->seq[i].name, pl.mi->seq[i].len);
+
+	kt_pipeline(2, worker_pipeline, &pl, 3);
+
 	free(pl.str.s);
-	mm_bseq_close(pl.fp);
+	mm_idx_destroy(mi);
+	free(pl.rid_shift);
+	for (i = 0; i < n_split_idx; ++i)
+		fclose(pl.fp_parts[i]);
+	free(pl.fp_parts);
+	for (i = 0; i < pl.n_fp; ++i)
+		mm_bseq_close(pl.fp[i]);
+	free(pl.fp);
+	mm_split_rm_tmp(opt->split_prefix, n_split_idx);
 	return 0;
 }

minimap.h

@@ -5,35 +5,52 @@
 #include <stdio.h>
 #include <sys/types.h>
 
-#define MM_IDX_DEF_B    14
+#define MM_F_NO_DIAG       0x001 // no exact diagonal hit
+#define MM_F_NO_DUAL       0x002 // skip pairs where query name is lexicographically larger than target name
+#define MM_F_CIGAR         0x004
+#define MM_F_OUT_SAM       0x008
+#define MM_F_NO_QUAL       0x010
+#define MM_F_OUT_CG        0x020
+#define MM_F_OUT_CS        0x040
+#define MM_F_SPLICE        0x080 // splice mode
+#define MM_F_SPLICE_FOR    0x100 // match GT-AG
+#define MM_F_SPLICE_REV    0x200 // match CT-AC, the reverse complement of GT-AG
+#define MM_F_NO_LJOIN      0x400
+#define MM_F_OUT_CS_LONG   0x800
+#define MM_F_SR            0x1000
+#define MM_F_FRAG_MODE     0x2000
+#define MM_F_NO_PRINT_2ND  0x4000
+#define MM_F_2_IO_THREADS  0x8000
+#define MM_F_LONG_CIGAR    0x10000
+#define MM_F_INDEPEND_SEG  0x20000
+#define MM_F_SPLICE_FLANK  0x40000
+#define MM_F_SOFTCLIP      0x80000
+#define MM_F_FOR_ONLY      0x100000
+#define MM_F_REV_ONLY      0x200000
+#define MM_F_HEAP_SORT     0x400000
+#define MM_F_ALL_CHAINS    0x800000
+#define MM_F_OUT_MD        0x1000000
+#define MM_F_COPY_COMMENT  0x2000000
+#define MM_F_EQX           0x4000000 // use =/X instead of M
+#define MM_F_PAF_NO_HIT    0x8000000 // output unmapped reads to PAF
 
-#define MM_F_NO_SELF   0x01
+#define MM_I_HPC          0x1
-#define MM_F_AVA       0x02
+#define MM_I_NO_SEQ       0x2
-#define MM_F_CIGAR     0x04
+#define MM_I_NO_NAME      0x4
-#define MM_F_OUT_SAM   0x08
-#define MM_F_NO_QUAL   0x10
 
 #define MM_IDX_MAGIC   "MMI\2"
 
+#define MM_MAX_SEG       255
+
 #ifdef __cplusplus
 extern "C" {
 #endif
 
-typedef struct {
+// emulate 128-bit integers and arrays
- 	uint64_t x, y;
+typedef struct { uint64_t x, y; } mm128_t;
-} mm128_t;
-
 typedef struct { size_t n, m; mm128_t *a; } mm128_v;
-typedef struct { size_t n, m; uint64_t *a; } uint64_v;
-typedef struct { size_t n, m; uint32_t *a; } uint32_v;
-
-typedef struct {
-	mm128_v a;   // (minimizer, position) array
-	int32_t n;   // size of the _p_ array
-	uint64_t *p; // position array for minimizers appearing >1 times
-	void *h;     // hash table indexing _p_ and minimizers appearing once
-} mm_idx_bucket_t;
 
+// minimap2 index
 typedef struct {
 	char *name;      // name of the db sequence
 	uint64_t offset; // offset in mm_idx_t::S
@@ -41,101 +58,293 @@ typedef struct {
 } mm_idx_seq_t;
 
 typedef struct {
-	int32_t b, w, k, is_hpc;
+	int32_t b, w, k, flag;
 	uint32_t n_seq;            // number of reference sequences
+	int32_t index;
 	mm_idx_seq_t *seq;         // sequence name, length and offset
 	uint32_t *S;               // 4-bit packed sequence
-	mm_idx_bucket_t *B; // index
+	struct mm_idx_bucket_s *B; // index (hidden)
+	void *km, *h;
 } mm_idx_t;
 
+// minimap2 alignment
 typedef struct {
-	uint32_t capacity;
+	uint32_t capacity;                  // the capacity of cigar[]
-	int32_t dp_score, dp_max, dp_max2;
+	int32_t dp_score, dp_max, dp_max2;  // DP score; score of the max-scoring segment; score of the best alternate mappings
-	uint32_t blen;
+	uint32_t n_ambi:30, trans_strand:2; // number of ambiguous bases; transcript strand: 0 for unknown, 1 for +, 2 for -
-	uint32_t n_diff, n_ambi;
+	uint32_t n_cigar;                   // number of cigar operations in cigar[]
-	uint32_t n_cigar;
 	uint32_t cigar[];
 } mm_extra_t;
 
 typedef struct {
-	int32_t id;
+	int32_t id;             // ID for internal uses (see also parent below)
-	uint32_t cnt:31, rev:1;
+	int32_t cnt;            // number of minimizers; if on the reverse strand
-	uint32_t rid:31, rep:1;
+	int32_t rid;            // reference index; if this is an alignment from inversion rescue
-	int32_t score;
+	int32_t score;          // DP alignment score
-	int32_t qs, qe, rs, re;
+	int32_t qs, qe, rs, re; // query start and end; reference start and end
-	int32_t parent, subsc;
+	int32_t parent, subsc;  // parent==id if primary; best alternate mapping score
-	int32_t as;
+	int32_t as;             // offset in the a[] array (for internal uses only)
-	int32_t fuzzy_mlen, fuzzy_blen;
+	int32_t mlen, blen;     // seeded exact match length; seeded alignment block length
-	uint32_t mapq:8, split:2, sam_pri:1, n_sub:21; // TODO: n_sub is not used for now
+	int32_t n_sub;          // number of suboptimal mappings
+	int32_t score0;         // initial chaining score (before chain merging/spliting)
+	uint32_t mapq:8, split:2, rev:1, inv:1, sam_pri:1, proper_frag:1, pe_thru:1, seg_split:1, seg_id:8, split_inv:1, dummy:7;
+	uint32_t hash;
+	float div;
 	mm_extra_t *p;
 } mm_reg1_t;
 
+// indexing and mapping options
 typedef struct {
-	float max_occ_frac;
+	short k, w, flag, bucket_bits;
-	float mid_occ_frac;
+	int mini_batch_size;
+	uint64_t batch_size;
+} mm_idxopt_t;
+
+typedef struct {
+	int seed;
 	int sdust_thres; // score threshold for SDUST; 0 to disable
 	int flag;        // see MM_F_* macros
 
 	int bw;          // bandwidth
-	int max_gap; // break a chain if there are no minimizers in a max_gap window
+	int max_gap, max_gap_ref; // break a chain if there are no minimizers in a max_gap window
+	int max_frag_len;
 	int max_chain_skip;
-	int min_cnt;
+	int min_cnt;         // min number of minimizers on each chain
-	int min_chain_score;
+	int min_chain_score; // min chaining score
 
 	float mask_level;
 	float pri_ratio;
-	int best_n;
+	int best_n;      // top best_n chains are subjected to DP alignment
 
 	int max_join_long, max_join_short;
 	int min_join_flank_sc;
+	float min_join_flank_ratio;
 
 	int a, b, q, e, q2, e2; // matching score, mismatch, gap-open and gap-ext penalties
-	int zdrop;
+	int sc_ambi; // score when one or both bases are "N"
-	int min_dp_max;
+	int noncan;      // cost of non-canonical splicing sites
+	int zdrop, zdrop_inv;   // break alignment if alignment score drops too fast along the diagonal
+	int end_bonus;
+	int min_dp_max;  // drop an alignment if the score of the max scoring segment is below this threshold
 	int min_ksw_len;
+	int anchor_ext_len, anchor_ext_shift;
+	float max_clip_ratio; // drop an alignment if BOTH ends are clipped above this ratio
 
-	int max_occ;
+	int pe_ori, pe_bonus;
-	int mid_occ;
+
+	float mid_occ_frac;  // only used by mm_mapopt_update(); see below
+	int32_t min_mid_occ;
+	int32_t mid_occ;     // ignore seeds with occurrences above this threshold
+	int32_t max_occ;
+	int mini_batch_size; // size of a batch of query bases to process in parallel
+
+	const char *split_prefix;
 } mm_mapopt_t;
 
-extern int mm_verbose, mm_dbg_flag;
+// index reader
-extern double mm_realtime0;
+typedef struct {
+	int is_idx, n_parts;
+	int64_t idx_size;
+	mm_idxopt_t opt;
+	FILE *fp_out;
+	union {
+		struct mm_bseq_file_s *seq;
+		FILE *idx;
+	} fp;
+} mm_idx_reader_t;
 
-struct mm_tbuf_s;
+// memory buffer for thread-local storage during mapping
 typedef struct mm_tbuf_s mm_tbuf_t;
 
-struct mm_bseq_file_s;
+// global variables
+extern int mm_verbose, mm_dbg_flag; // verbose level: 0 for no info, 1 for error, 2 for warning, 3 for message (default); debugging flag
+extern double mm_realtime0; // wall-clock timer
 
-#define mm_seq4_set(s, i, c) ((s)[(i)>>3] |= (uint32_t)(c) << (((i)&7)<<2))
+/**
-#define mm_seq4_get(s, i)    ((s)[(i)>>3] >> (((i)&7)<<2) & 0xf)
+ * Set default or preset parameters
+ *
+ * @param preset     NULL to set all parameters as default; otherwise apply preset to affected parameters
+ * @param io         pointer to indexing parameters
+ * @param mo         pointer to mapping parameters
+ *
+ * @return 0 if success; -1 if _present_ unknown
+ */
+int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo);
+int mm_check_opt(const mm_idxopt_t *io, const mm_mapopt_t *mo);
 
-// compute minimizers
+/**
-void mm_sketch(void *km, const char *str, int len, int w, int k, uint32_t rid, int is_hpc, mm128_v *p);
+ * Update mm_mapopt_t::mid_occ via mm_mapopt_t::mid_occ_frac
+ *
+ * If mm_mapopt_t::mid_occ is 0, this function sets it to a number such that no
+ * more than mm_mapopt_t::mid_occ_frac of minimizers in the index have a higher
+ * occurrence.
+ *
+ * @param opt        mapping parameters
+ * @param mi         minimap2 index
+ */
+void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi);
 
-// minimizer indexing
+void mm_mapopt_max_intron_len(mm_mapopt_t *opt, int max_intron_len);
-mm_idx_t *mm_idx_init(int w, int k, int b, int is_hpc);
-void mm_idx_destroy(mm_idx_t *mi);
-mm_idx_t *mm_idx_gen(struct mm_bseq_file_s *fp, int w, int k, int b, int is_hpc, int mini_batch_size, int n_threads, uint64_t batch_size, int keep_name);
-uint32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f);
-void mm_idx_stat(const mm_idx_t *idx);
-const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n);
-int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq);
 
-mm_idx_t *mm_idx_build(const char *fn, int w, int k, int is_hpc, int n_threads);
+/**
-int mm_idx_is_idx(const char *fn);
+ * Initialize an index reader
+ *
+ * @param fn         index or fasta/fastq file name (this function tests the file type)
+ * @param opt        indexing parameters
+ * @param fn_out     if not NULL, write built index to this file
+ *
+ * @return an index reader on success; NULL if fail to open _fn_
+ */
+mm_idx_reader_t *mm_idx_reader_open(const char *fn, const mm_idxopt_t *opt, const char *fn_out);
 
-// minimizer index I/O
+/**
-void mm_idx_dump(FILE *fp, const mm_idx_t *mi);
+ * Read/build an index
+ *
+ * If the input file is an index file, this function reads one part of the
+ * index and returns. If the input file is a sequence file (fasta or fastq),
+ * this function constructs the index for about mm_idxopt_t::batch_size bases.
+ * Importantly, for a huge collection of sequences, this function may only
+ * return an index for part of sequences. It needs to be repeatedly called
+ * to traverse the entire index/sequence file.
+ *
+ * @param r          index reader
+ * @param n_threads  number of threads for constructing index
+ *
+ * @return an index on success; NULL if reaching the end of the input file
+ */
+mm_idx_t *mm_idx_reader_read(mm_idx_reader_t *r, int n_threads);
+
+/**
+ * Destroy/deallocate an index reader
+ *
+ * @param r          index reader
+ */
+void mm_idx_reader_close(mm_idx_reader_t *r);
+
+int mm_idx_reader_eof(const mm_idx_reader_t *r);
+
+/**
+ * Check whether the file contains a minimap2 index
+ *
+ * @param fn         file name
+ *
+ * @return the file size if fn is an index file; 0 if fn is not.
+ */
+int64_t mm_idx_is_idx(const char *fn);
+
+/**
+ * Load a part of an index
+ *
+ * Given a uni-part index, this function loads the entire index into memory.
+ * Given a multi-part index, it loads one part only and places the file pointer
+ * at the end of that part.
+ *
+ * @param fp         pointer to FILE object
+ *
+ * @return minimap2 index read from fp
+ */
 mm_idx_t *mm_idx_load(FILE *fp);
 
-// mapping
+/**
-void mm_mapopt_init(mm_mapopt_t *opt);
+ * Append an index (or one part of a full index) to file
-void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi);
+ *
+ * @param fp         pointer to FILE object
+ * @param mi         minimap2 index
+ */
+void mm_idx_dump(FILE *fp, const mm_idx_t *mi);
+
+/**
+ * Create an index from strings in memory
+ *
+ * @param w            minimizer window size
+ * @param k            minimizer k-mer size
+ * @param is_hpc       use HPC k-mer if true
+ * @param bucket_bits  number of bits for the first level of the hash table
+ * @param n            number of sequences
+ * @param seq          sequences in A/C/G/T
+ * @param name         sequence names; could be NULL
+ *
+ * @return minimap2 index
+ */
+mm_idx_t *mm_idx_str(int w, int k, int is_hpc, int bucket_bits, int n, const char **seq, const char **name);
+
+/**
+ * Print index statistics to stderr
+ *
+ * @param mi         minimap2 index
+ */
+void mm_idx_stat(const mm_idx_t *idx);
+
+/**
+ * Destroy/deallocate an index
+ *
+ * @param r          minimap2 index
+ */
+void mm_idx_destroy(mm_idx_t *mi);
+
+/**
+ * Initialize a thread-local buffer for mapping
+ *
+ * Each mapping thread requires a buffer specific to the thread (see mm_map()
+ * below). The primary purpose of this buffer is to reduce frequent heap
+ * allocations across threads. A buffer shall not be used by two or more
+ * threads.
+ *
+ * @return pointer to a thread-local buffer
+ */
 mm_tbuf_t *mm_tbuf_init(void);
+
+/**
+ * Destroy/deallocate a thread-local buffer for mapping
+ *
+ * @param b          the buffer
+ */
 void mm_tbuf_destroy(mm_tbuf_t *b);
+
+/**
+ * Align a query sequence against an index
+ *
+ * This function possibly finds multiple alignments of the query sequence.
+ * The returned array and the mm_reg1_t::p field of each element are allocated
+ * with malloc().
+ *
+ * @param mi         minimap2 index
+ * @param l_seq      length of the query sequence
+ * @param seq        the query sequence
+ * @param n_regs     number of hits (out)
+ * @param b          thread-local buffer; two mm_map() calls shall not use one buffer at the same time!
+ * @param opt        mapping parameters
+ * @param name       query name, used for all-vs-all overlapping and debugging
+ *
+ * @return an array of hits which need to be deallocated with free() together
+ *         with mm_reg1_t::p of each element. The size is written to _n_regs_.
+ */
 mm_reg1_t *mm_map(const mm_idx_t *mi, int l_seq, const char *seq, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *name);
 
-int mm_map_file(const mm_idx_t *idx, const char *fn, const mm_mapopt_t *opt, int n_threads, int tbatch_size);
+void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, int *n_regs, mm_reg1_t **regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname);
+
+/**
+ * Align a fasta/fastq file and print alignments to stdout
+ *
+ * @param idx        minimap2 index
+ * @param fn         fasta/fastq file name
+ * @param opt        mapping parameters
+ * @param n_threads  number of threads
+ *
+ * @return 0 on success; -1 if _fn_ can't be read
+ */
+int mm_map_file(const mm_idx_t *idx, const char *fn, const mm_mapopt_t *opt, int n_threads);
+
+int mm_map_file_frag(const mm_idx_t *idx, int n_segs, const char **fn, const mm_mapopt_t *opt, int n_threads);
+
+// query sequence name and sequence in the minimap2 index
+int mm_idx_index_name(mm_idx_t *mi);
+int mm_idx_name2id(const mm_idx_t *mi, const char *name);
+int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq);
+
+// deprecated APIs for backward compatibility
+void mm_mapopt_init(mm_mapopt_t *opt);
+mm_idx_t *mm_idx_build(const char *fn, int w, int k, int flag, int n_threads);
 
 #ifdef __cplusplus
 }

minimap2.1

@@ -1,4 +1,4 @@
-.TH minimap2 1 "19 July 2017" "minimap2-2.0-r190-dirty" "Bioinformatics tools"
+.TH minimap2 1 "20 June 2018" "minimap2-2.11 (r797)" "Bioinformatics tools"
 .SH NAME
 .PP
 minimap2 - mapping and alignment between collections of DNA sequences
@@ -99,6 +99,14 @@ multiple times to map it against each batch of target sequences.
 may be ending with k/K/m/M/g/G. NB: mapping quality is incorrect given a
 multi-part index.
 .TP
+.B --idx-no-seq
+Don't store target sequences in the index. It saves disk space and memory but
+the index generated with this option will not work with
+.B -a
+or
+.BR -c .
+When base-level alignment is not requested, this option is automatically applied.
+.TP
 .BI -d \ FILE
 Save the minimizer index of
 .I target.fa
@@ -115,18 +123,35 @@ provided as the target sequences, options
 will be effectively overridden by the options stored in the index file.
 .SS Mapping options
 .TP 10
-.BI -f \ FLOAT
+.BI -f \ FLOAT | INT1 [, INT2 ]
-Ignore top
+If fraction, ignore top
 .I FLOAT
-fraction of most frequent minimizers [0.0002]
+fraction of most frequent minimizers [0.0002]. If integer,
+ignore minimizers occuring more than
+.I INT1
+times.
+.I INT2
+is only effective in the
+.B --sr
+or
+.B -xsr
+mode, which sets the threshold for a second round of seeding.
+.TP
+.BI --min-occ-floor \ INT
+Force minimap2 to always use k-mers occurring
+.I INT
+times or less [0]. In effect, the max occurrence threshold is set to
+the
+.RI max{ INT ,
+.BR -f }.
 .TP
 .BI -g \ INT
-Stop chain enlongation if there are no minimizers in
+Stop chain enlongation if there are no minimizers within
 .IR INT -bp
 [10000].
 .TP
 .BI -r \ INT
-Bandwidth used in chaining and DP-based alignment [1000]. This option
+Bandwidth used in chaining and DP-based alignment [500]. This option
 approximately controls the maximum gap size.
 .TP
 .BI -n \ INT
@@ -137,25 +162,45 @@ number of minimizers [3]
 .BI -m \ INT
 Discard chains with chaining score
 .RI < INT
-[40]. Chaining score equals the approximate number of matching bases (exact if
+[40]. Chaining score equals the approximate number of matching bases minus a
-not using
+concave gap penalty. It is computed with dynamic programming.
-.BR -H )
+.TP
-minus base-2 logarithm gap penalty. It is computed with dynamic programming.
+.B -D
+If query sequence name/length are identical to the target name/length, ignore
+diagonal anchors. This option also reduces DP-based extension along the
+diagonal.
+.TP
+.B -P
+Retain all chains and don't attempt to set primary chains. Options
+.B -p
+and
+.B -N
+have no effect when this option is in use.
+.TP
+.BR --dual = yes | no
+If
+.BR no ,
+skip query-target pairs wherein the query name is lexicographically greater
+than the target name [yes]
 .TP
 .B -X
-Perform all-vs-all mapping. In this mode, if the query sequence name is
+Equivalent to
-lexicographically larger than the target sequence name, the hits between them
+.RB ' -DP
-will be suppressed; if the query sequence name is the same as the target name,
+.BR --dual = no
-diagonal minimizer hits will also be suppressed.
+.BR --no-long-join '.
+Primarily used for all-vs-all read overlapping.
 .TP
 .BI -p \ FLOAT
 Minimal secondary-to-primary score ratio to output secondary mappings [0.8].
-Between two chains overlaping over half of the shorter chain (controled by
+Between two chains overlaping over half of the shorter chain (controlled by
 .BR --mask-level ),
 the chain with a lower score is secondary to the chain with a higher score.
 If the ratio of the scores is below
 .IR FLOAT ,
 the secondary chain will not be outputted or extended with DP alignment later.
+This option has no effect when
+.B -X
+is applied.
 .TP
 .BI -N \ INT
 Output at most
@@ -164,6 +209,23 @@ secondary alignments [5]. This option has no effect when
 .B -X
 is applied.
 .TP
+.BI -G \ NUM
+Maximum gap on the reference (effective with
+.BR -xsplice / --splice ).
+This option also changes the chaining and alignment band width to
+.IR NUM .
+Increasing this option slows down spliced alignment. [200k]
+.TP
+.BI -F \ NUM
+Maximum fragment length (aka insert size; effective with
+.BR -xsr / --frag = yes )
+[800]
+.TP
+.BI -M \ FLOAT
+Mark as secondary a chain that overlaps with a better chain by
+.I FLOAT
+or more of the shorter chain [0.5]
+.TP
 .BI --max-chain-skip \ INT
 A heuristics that stops chaining early [50]. Minimap2 uses dynamic programming
 for chaining. The time complexity is quadratic in the number of seeds. This
@@ -171,6 +233,42 @@ option makes minimap2 exits the inner loop if it repeatedly sees seeds already
 on chains. Set
 .I INT
 to a large number to switch off this heurstics.
+.TP
+.B --no-long-join
+Disable the long gap patching heuristic. When this option is applied, the
+maximum alignment gap is mostly controlled by
+.BR -r .
+.TP
+.BI --lj-min-ratio \ FLOAT
+Fraction of query sequence length required to bridge a long gap [0.5]. A
+smaller value helps to recover longer gaps, at the cost of more false gaps.
+.TP
+.B --splice
+Enable the splice alignment mode.
+.TP
+.B --sr
+Enable short-read alignment heuristics. In the short-read mode, minimap2
+applies a second round of chaining with a higher minimizer occurrence threshold
+if no good chain is found. In addition, minimap2 attempts to patch gaps between
+seeds with ungapped alignment.
+.TP
+.BI --split-prefix \ STR
+Prefix to create temporary files. Typically used for a multi-part index.
+.TP
+.BR --frag = no | yes
+Whether to enable the fragment mode [no]
+.TP
+.B --for-only
+Only map to the forward strand of the reference sequences. For paired-end
+reads in the forward-reverse orientation, the first read is mapped to forward
+strand of the reference and the second read to the reverse stand.
+.TP
+.B --rev-only
+Only map to the reverse complement strand of the reference sequences.
+.TP
+.BR --heap-sort = no | yes
+If yes, sort anchors with heap merge, instead of radix sort. Heap merge is
+faster for short reads, but slower for long reads. [no]
 .SS Alignment options
 .TP 10
 .BI -A \ INT
@@ -190,29 +288,133 @@ Gap extension penalty [2,1]. A gap of length
 .I k
 costs
 .RI min{ O1 + k * E1 , O2 + k * E2 }.
+In the splice mode, the second gap penalties are not used.
 .TP
-.BI -z \ INT
+.BI -C \ INT
-Break an alignment if the running score drops too quickly along the diagonal of
+Cost for a non-canonical GT-AG splicing (effective with
-the DP matrix (diagonal X-drop, or Z-drop) [400]. Increasing the value improves
+.BR --splice )
-the contiguity of the alignment at the cost of poor alignment in the middle
+[0]
-(e.g. caused by a long inversion).
+.TP
+.BI -z \ INT1[,INT2]
+Truncate an alignment if the running alignment score drops too quickly along
+the diagonal of the DP matrix (diagonal X-drop, or Z-drop) [400,200]. If the
+drop of score is above
+.IR INT2 ,
+minimap2 will reverse complement the query in the related region and align
+again to test small inversions. Minimap2 truncates alignment if there is an
+inversion or the drop of score is greater than
+.IR INT1 .
+Decrease
+.I INT2
+to find small inversions at the cost of performance and false positives.
+Increase
+.I INT1
+to improves the contiguity of alignment at the cost of poor alignment in the
+middle.
 .TP
 .BI -s \ INT
 Minimal peak DP alignment score to output [40]. The peak score is computed from
 the final CIGAR. It is the score of the max scoring segment in the alignment
 and may be different from the total alignment score.
+.TP
+.BI -u \ CHAR
+How to find canonical splicing sites GT-AG -
+.BR f :
+transcript strand;
+.BR b :
+both strands;
+.BR n :
+no attempt to match GT-AG [n]
+.TP
+.BI --end-bonus \ INT
+Score bonus when alignment extends to the end of the query sequence [0].
+.TP
+.BI --score-N \ INT
+Score of a mismatch involving ambiguous bases [1].
+.TP
+.BR --splice-flank = yes | no
+Assume the next base to a
+.B GT
+donor site tends to be A/G (91% in human and 92% in mouse) and the preceding
+base to a
+.B AG
+acceptor tends to be C/T [no].
+This trend is evolutionarily conservative, all the way to S. cerevisiae
+(PMID:18688272). Specifying this option generally leads to higher junction
+accuracy by several percents, so it is applied by default with
+.BR --splice .
+However, the SIRV control does not honor this trend
+(only ~60%). This option reduces accuracy. If you are benchmarking minimap2
+on SIRV data, please add
+.B --splice-flank=no
+to the command line.
+.TP
+.BI --end-seed-pen \ INT
+Drop a terminal anchor if
+.IR s <log( g )+ INT ,
+where
+.I s
+is the local alignment score around the anchor and
+.I g
+the length of the terminal gap in the chain. This option is only effective
+with
+.BR --splice .
+It helps to avoid tiny terminal exons. [6]
 .SS Input/output options
 .TP 10
-.B -Q
-Ignore base quality in the input file.
-.TP
 .B -a
 Generate CIGAR and output alignments in the SAM format. Minimap2 outputs in PAF
 by default.
 .TP
+.B -Q
+Ignore base quality in the input file.
+.TP
+.B -L
+Write CIGAR with >65535 operators at the CG tag. Older tools are unable to
+convert alignments with >65535 CIGAR ops to BAM. This option makes minimap2 SAM
+compatible with older tools. Newer tools recognizes this tag and reconstruct
+the real CIGAR in memory.
+.TP
+.BI -R \ STR
+SAM read group line in a format like
+.B @RG\\\\tID:foo\\\\tSM:bar
+[].
+.TP
+.B -y
+Copy input FASTA/Q comments to output.
+.TP
 .B -c
 Generate CIGAR. In PAF, the CIGAR is written to the `cg' custom tag.
 .TP
+.BI --cs[= STR ]
+Output the
+.B cs
+tag.
+.I STR
+can be either
+.I short
+or
+.IR long .
+If no
+.I STR
+is given,
+.I short
+is assumed. [none]
+.TP
+.B --MD
+Output the MD tag (see the SAM spec).
+.TP
+.B --eqx
+Output =/X CIGAR operators for sequence match/mismatch.
+.TP
+.B -Y
+In SAM output, use soft clipping for supplementary alignments.
+.TP
+.BI --seed \ INT
+Integer seed for randomizing equally best hits. Minimap2 hashes
+.I INT
+and read name when choosing between equally best hits. [11]
+.TP
 .BI -t \ INT
 Number of threads [3]. Minimap2 uses at most three threads when indexing target
 sequences, and uses up to
@@ -220,21 +422,25 @@ sequences, and uses up to
 threads when mapping (the extra thread is for I/O, which is frequently idle and
 takes little CPU time).
 .TP
+.B -2
+Use two I/O threads during mapping. By default, minimap2 uses one I/O thread.
+When I/O is slow (e.g. piping to gzip, or reading from a slow pipe), the I/O
+thread may become the bottleneck. Apply this option to use one thread for input
+and another thread for output, at the cost of increased peak RAM.
+.TP
 .BI -K \ NUM
-Number of bases loaded into memory to process in a mini-batch [200M].
+Number of bases loaded into memory to process in a mini-batch [500M].
 Similar to option
 .BR -I ,
 K/M/G/k/m/g suffix is accepted. A large
 .I NUM
 helps load balancing in the multi-threading mode, at the cost of increased
-memory. Preset
+memory.
-.B ava-pb
-and
-.B ava-ont
-use
-.BR -K500m .
 .TP
-.B -V
+.BR --secondary = yes | no
+Whether to output secondary alignments [yes]
+.TP
+.B --version
 Print version number to stdout
 .SS Preset options
 .TP 10
@@ -249,37 +455,73 @@ are:
 .RS
 .TP 8
 .B map-pb
-PacBio/Oxford Nanopore read to reference mapping (-Hk19)
+PacBio/Oxford Nanopore read to reference mapping
-.TP
+.RB ( -Hk19 )
-.B map10k
-The same as
-.B map-pb
-(-Hk19)
 .TP
 .B map-ont
-Slightly more sensitive for Oxford Nanopore to reference mapping (-k15). For
+Slightly more sensitive for Oxford Nanopore to reference mapping
-PacBio reads, HPC minimizers consistently leads to faster performance and more
+.RB ( -k15 ).
-sensitive results in comparison to normal minimizers. For Oxford Nanopore data,
+For PacBio reads, HPC minimizers consistently leads to faster performance and
-normal minimizers are better, though not much. The effectiveness of HPC is
+more sensitive results in comparison to normal minimizers. For Oxford Nanopore
-determined by the sequencing error mode.
+data, normal minimizers are better, though not much. The effectiveness of HPC
+is determined by the sequencing error mode.
 .TP
 .B asm5
-Long assembly to reference mapping (-k19 -w19 -A1 -B19 -O39,81 -E3,1 -s200 -z200).
+Long assembly to reference mapping
+.RB ( -k19
+.B -w19 -A1 -B19 -O39,81 -E3,1 -s200 -z200
+.BR --min-occ-floor=100 ).
 Typically, the alignment will not extend to regions with 5% or higher sequence
 divergence. Only use this preset if the average divergence is far below 5%.
 .TP
 .B asm10
-Long assembly to reference mapping (-k19 -w19 -A1 -B9 -O16,41 -E2,1 -s200 -z200). Up
+Long assembly to reference mapping
-to 10% sequence divergence.
+.RB ( -k19
-.TP 8
+.B -w19 -A1 -B9 -O16,41 -E2,1 -s200 -z200
+.BR --min-occ-floor=100 ).
+Up to 10% sequence divergence.
+.TP
+.B asm20
+Long assembly to reference mapping
+.RB ( -k19
+.B -w10 -A1 -B6 -O6,26 -E2,1 -s200 -z200
+.BR --min-occ-floor=100 ).
+Up to 20% sequence divergence.
+.TP
 .B ava-pb
-PacBio all-vs-all overlap mapping (-Hk19 -w5 -Xp0 -m100 -K500m -g10000 --max-chain-skip 25)
+PacBio all-vs-all overlap mapping
-.TP 8
+.RB ( -Hk19
+.B -Xw5 -m100 -g10000 --max-chain-skip
+.BR 25 ).
+.TP
 .B ava-ont
-Oxford Nanopore all-vs-all overlap mapping (-k15 -w5 -Xp0 -m100 -K500m -g10000
+Oxford Nanopore all-vs-all overlap mapping
---max-chain-skip 25). Similarly, the major difference from
+.RB ( -k15
+.B -Xw5 -m100 -g10000 -r2000 --max-chain-skip
+.BR 25 ).
+Similarly, the major difference from
 .B ava-pb
 is that this preset is not using HPC minimizers.
+.TP
+.B splice
+Long-read spliced alignment
+.RB ( -k15
+.B -w5 --splice -g2000 -G200k -A1 -B2 -O2,32 -E1,0 -C9 -z200 -ub
+.BR --splice-flank=yes ).
+In the splice mode, 1) long deletions are taken as introns and represented as
+the
+.RB ` N '
+CIGAR operator; 2) long insertions are disabled; 3) deletion and insertion gap
+costs are different during chaining; 4) the computation of the
+.RB ` ms '
+tag ignores introns to demote hits to pseudogenes.
+.TP
+.B sr
+Short single-end reads without splicing
+.RB ( -k21
+.B -w11 --sr --frag=yes -A2 -B8 -O12,32 -E2,1 -r50 -p.5 -N20 -f1000,5000 -n2 -m20
+.B -s40 -g200 -2K50m --heap-sort=yes
+.BR --secondary=no ).
 .RE
 .SS Miscellaneous options
 .TP 10
@@ -292,7 +534,7 @@ multi-threading mode.
 .B --print-qname
 Print query names to stderr, mostly to see which query is crashing minimap2.
 .TP
-.B --print-seed
+.B --print-seeds
 Print seed positions to stderr, for debugging only.
 .SH OUTPUT FORMAT
 .PP
@@ -331,33 +573,51 @@ cb | cb | cb
 r | c | l .
 Tag	Type	Description
 _
+tp	A	Type of aln: P/primary, S/secondary and I,i/inversion
 cm	i	Number of minimizers on the chain
 s1	i	Chaining score
 s2	i	Chaining score of the best secondary chain
 NM	i	Total number of mismatches and gaps in the alignment
+MD	Z	To generate the ref sequence in the alignment
 AS	i	DP alignment score
 ms	i	DP score of the max scoring segment in the alignment
 nn	i	Number of ambiguous bases in the alignment
+ts	A	Transcript strand (splice mode only)
 cg	Z	CIGAR string (only in PAF)
+cs	Z	Difference string
+dv	f	Approximate per-base sequence divergence
+.TE
+
+.PP
+The
+.B cs
+tag encodes difference sequences in the short form or the entire query
+.I AND
+reference sequences in the long form. It consists of a series of operations:
+.TS
+center box;
+cb | cb |cb
+r | l | l .
+Op	Regex	Description
+_
+ =	[ACGTN]+	Identical sequence (long form)
+ :	[0-9]+	Identical sequence length
+ *	[acgtn][acgtn]	Substitution: ref to query
+ +	[acgtn]+	Insertion to the reference
+ -	[acgtn]+	Deletion from the reference
+ ~	[acgtn]{2}[0-9]+[acgtn]{2}	Intron length and splice signal
 .TE
 
 .SH LIMITATIONS
 .TP 2
 *
-At the alignment phase, minimap2 performs global alignments between minimizer
+Minimap2 may produce suboptimal alignments through long low-complexity regions
-hits. If the positions of these minimizer hits are incorrect, the final
+where seed positions may be suboptimal. This should not be a big concern
-alignment may be suboptimal or unnecessarily fragmented.
+because even the optimal alignment may be wrong in such regions.
 .TP
 *
-Minimap2 may produce poor alignments that may need post-filtering. We are still
+Minimap2 requires SSE2 or NEON instructions to compile. It is possible to add
-exploring a reliable and consistent way to report good alignments.
+non-SSE2/NEON support, but it would make minimap2 slower by several times.
-.TP
-*
-Minimap2 does not work well with Illumina short reads as of now.
-.TP
-*
-Minimap2 requires SSE2 instructions to compile. It is possible to add
-non-SSE2 support, but it would make minimap2 slower by several times.
 .SH SEE ALSO
 .PP
 miniasm(1), minimap(1), bwa(1).

misc.c

@@ -1,19 +1,119 @@
-#include <sys/resource.h>
+#include <stdlib.h>
-#include <sys/time.h>
+#include "mmpriv.h"
-#include "minimap.h"
 
-int mm_verbose = 3;
+int mm_verbose = 1;
 int mm_dbg_flag = 0;
 double mm_realtime0;
 
+#if defined(WIN32) || defined(_WIN32)
+#include <windows.h>
+
+struct timezone
+{
+  __int32  tz_minuteswest; /* minutes W of Greenwich */
+  int  tz_dsttime;     /* type of dst correction */
+};
+
+/*
+ * gettimeofday.c
+ *    Win32 gettimeofday() replacement
+ *    taken from PostgreSQL, according to
+ *    https://stackoverflow.com/questions/1676036/what-should-i-use-to-replace-gettimeofday-on-windows
+ *
+ * src/port/gettimeofday.c
+ *
+ * Copyright (c) 2003 SRA, Inc.
+ * Copyright (c) 2003 SKC, Inc.
+ *
+ * Permission to use, copy, modify, and distribute this software and
+ * its documentation for any purpose, without fee, and without a
+ * written agreement is hereby granted, provided that the above
+ * copyright notice and this paragraph and the following two
+ * paragraphs appear in all copies.
+ *
+ * IN NO EVENT SHALL THE AUTHOR BE LIABLE TO ANY PARTY FOR DIRECT,
+ * INDIRECT, SPECIAL, INCIDENTAL, OR CONSEQUENTIAL DAMAGES, INCLUDING
+ * LOST PROFITS, ARISING OUT OF THE USE OF THIS SOFTWARE AND ITS
+ * DOCUMENTATION, EVEN IF THE UNIVERSITY OF CALIFORNIA HAS BEEN ADVISED
+ * OF THE POSSIBILITY OF SUCH DAMAGE.
+ *
+ * THE AUTHOR SPECIFICALLY DISCLAIMS ANY WARRANTIES, INCLUDING, BUT NOT
+ * LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR
+ * A PARTICULAR PURPOSE.  THE SOFTWARE PROVIDED HEREUNDER IS ON AN "AS
+ * IS" BASIS, AND THE AUTHOR HAS NO OBLIGATIONS TO PROVIDE MAINTENANCE,
+ * SUPPORT, UPDATES, ENHANCEMENTS, OR MODIFICATIONS.
+ */
+
+/* FILETIME of Jan 1 1970 00:00:00. */
+static const unsigned __int64 epoch = ((unsigned __int64) 116444736000000000ULL);
+
+/*
+ * timezone information is stored outside the kernel so tzp isn't used anymore.
+ *
+ * Note: this function is not for Win32 high precision timing purpose. See
+ * elapsed_time().
+ */
+int gettimeofday(struct timeval * tp, struct timezone *tzp)
+{
+    FILETIME    file_time;
+    SYSTEMTIME  system_time;
+    ULARGE_INTEGER ularge;
+
+    GetSystemTime(&system_time);
+    SystemTimeToFileTime(&system_time, &file_time);
+    ularge.LowPart = file_time.dwLowDateTime;
+    ularge.HighPart = file_time.dwHighDateTime;
+
+    tp->tv_sec = (long) ((ularge.QuadPart - epoch) / 10000000L);
+    tp->tv_usec = (long) (system_time.wMilliseconds * 1000);
+
+    return 0;
+}
+
+// taken from https://stackoverflow.com/questions/5272470/c-get-cpu-usage-on-linux-and-windows
 double cputime()
+{
+	HANDLE hProcess = GetCurrentProcess();
+	FILETIME ftCreation, ftExit, ftKernel, ftUser;
+	SYSTEMTIME stKernel;
+	SYSTEMTIME stUser;
+
+	GetProcessTimes(hProcess, &ftCreation, &ftExit, &ftKernel, &ftUser);
+	FileTimeToSystemTime(&ftKernel, &stKernel);
+	FileTimeToSystemTime(&ftUser, &stUser);
+
+	double kernelModeTime = ((stKernel.wHour * 60.) + stKernel.wMinute * 60.) + stKernel.wSecond * 1. + stKernel.wMilliseconds / 1000.;
+	double userModeTime = ((stUser.wHour * 60.) + stUser.wMinute * 60.) + stUser.wSecond * 1. + stUser.wMilliseconds / 1000.;
+
+	return kernelModeTime + userModeTime;
+}
+
+long peakrss(void) { return 0; }
+#else
+#include <sys/resource.h>
+#include <sys/time.h>
+
+double cputime(void)
 {
 	struct rusage r;
 	getrusage(RUSAGE_SELF, &r);
 	return r.ru_utime.tv_sec + r.ru_stime.tv_sec + 1e-6 * (r.ru_utime.tv_usec + r.ru_stime.tv_usec);
 }
 
-double realtime()
+long peakrss(void)
+{
+	struct rusage r;
+	getrusage(RUSAGE_SELF, &r);
+#ifdef __linux__
+	return r.ru_maxrss * 1024;
+#else
+	return r.ru_maxrss;
+#endif
+}
+
+#endif /* WIN32 || _WIN32 */
+
+double realtime(void)
 {
 	struct timeval tp;
 	struct timezone tzp;
@@ -21,6 +121,36 @@ double realtime()
 	return tp.tv_sec + tp.tv_usec * 1e-6;
 }
 
+void mm_err_puts(const char *str)
+{
+	int ret;
+	ret = puts(str);
+	if (ret == EOF) {
+		fprintf(stderr, "[ERROR] failed to write the results\n");
+		exit(EXIT_FAILURE);
+	}
+}
+
+void mm_err_fwrite(const void *p, size_t size, size_t nitems, FILE *fp)
+{
+	int ret;
+	ret = fwrite(p, size, nitems, fp);
+	if (ret == EOF) {
+		fprintf(stderr, "[ERROR] failed to write data\n");
+		exit(EXIT_FAILURE);
+	}
+}
+
+void mm_err_fread(void *p, size_t size, size_t nitems, FILE *fp)
+{
+	int ret;
+	ret = fread(p, size, nitems, fp);
+	if (ret == EOF) {
+		fprintf(stderr, "[ERROR] failed to read data\n");
+		exit(EXIT_FAILURE);
+	}
+}
+
 #include "ksort.h"
 
 #define sort_key_128x(a) ((a).x)

misc/README.md

@@ -0,0 +1,179 @@
+## <a name="started"></a>Getting Started
+
+```sh
+# install minimap2
+git clone https://github.com/lh3/minimap2
+cd minimap2 && make
+# install the k8 javascript shell
+curl -L https://github.com/attractivechaos/k8/releases/download/v0.2.4/k8-0.2.4.tar.bz2 | tar -jxf -
+cp k8-0.2.4/k8-`uname -s` k8              # or copy it to a directory on your $PATH
+# export PATH="$PATH:`pwd`:`pwd`/misc"    # run this if k8, minimap2 or paftools.js not on your $PATH
+minimap2 --cs test/MT-human.fa test/MT-orang.fa | paftools.js view -     # view alignment
+minimap2 -c test/MT-human.fa test/MT-orang.fa | paftools.js stat -       # basic alignment statistics
+minimap2 -c --cs test/MT-human.fa test/MT-orang.fa \
+  | sort -k6,6 -k8,8n | paftools.js call -L15000 -     # calling variants from asm-to-ref alignment
+minimap2 -c test/MT-human.fa test/MT-orang.fa \
+  | paftools.js liftover -l10000 - <(echo -e "MT_orang\t2000\t5000")     # liftOver
+# no test data for the following examples
+paftools.js junceval -e anno.gtf splice.sam > out.txt  # compare splice junctions to annotations
+paftools.js splice2bed anno.gtf > anno.bed             # convert GTF/GFF3 to BED12
+```
+
+## Table of Contents
+
+- [Getting Started](#started)
+- [Introduction](#intro)
+- [Evaluation](#eval)
+  - [Evaluating mapping accuracy with simulated reads](#mapeval)
+  - [Evaluating read overlap sensitivity](#oveval)
+- [Calling Variants from Assemblies](#asmvar)
+
+## <a name="intro"></a>Introduction
+
+paftools.js is a script that processes alignments in the [PAF format][paf],
+such as converting between formats, evaluating mapping accuracy, lifting over
+BED files based on alignment, and calling variants from assembly-to-assembly
+alignment. This script *requires* the [k8 Javascript shell][k8] to run. On
+Linux or Mac, you can download the precompiled k8 binary with:
+
+```sh
+curl -L https://github.com/attractivechaos/k8/releases/download/v0.2.4/k8-0.2.4.tar.bz2 | tar -jxf -
+cp k8-0.2.4/k8-`uname -s` $HOME/bin/k8  # assuming $HOME/bin in your $PATH
+```
+
+It is highly recommended to copy the executable `k8` to a directory on your
+`$PATH` such as `/usr/bin/env` can find it. Like python scripts, once you
+install `k8`, you can launch paftools.js in one of the two ways:
+
+```sh
+path/to/paftools.js             # only if k8 is on your $PATH
+k8 path/to/paftools.js
+```
+
+In a nutshell, paftools.js has the following commands:
+
+```
+Usage: paftools.js <command> [arguments]
+Commands:
+  view       convert PAF to BLAST-like (for eyeballing) or MAF
+  splice2bed convert spliced alignment in PAF/SAM to BED12
+  sam2paf    convert SAM to PAF
+  delta2paf  convert MUMmer's delta to PAF
+  gff2bed    convert GTF/GFF3 to BED12
+
+  stat       collect basic mapping information in PAF/SAM
+  liftover   simplistic liftOver
+  call       call variants from asm-to-ref alignment with the cs tag
+  bedcov     compute the number of bases covered
+
+  mapeval    evaluate mapping accuracy using mason2/PBSIM-simulated FASTQ
+  mason2fq   convert mason2-simulated SAM to FASTQ
+  pbsim2fq   convert PBSIM-simulated MAF to FASTQ
+  junceval   evaluate splice junction consistency with known annotations
+  ov-eval    evaluate read overlap sensitivity using read-to-ref mapping
+```
+
+paftools.js seamlessly reads both plain text files and gzip'd text files.
+
+## <a name="eval"></a>Evaluation
+
+### <a name="mapeval"></a>Evaluating mapping accuracy with simulated reads
+
+The **pbsim2fq** command of paftools.js converts the MAF output of [pbsim][pbsim]
+to FASTQ and encodes the true mapping position in the read name in a format like
+`S1_33!chr1!225258409!225267761!-`. Similarly, the **mason2fq** command
+converts [mason2][mason2] simulated SAM to FASTQ.
+
+Command **mapeval** evaluates mapped SAM/PAF. Here is example output:
+
+```
+Q       60      32478   0       0.000000000     32478
+Q       22      16      1       0.000030775     32494
+Q       21      43      1       0.000061468     32537
+Q       19      73      1       0.000091996     32610
+Q       14      66      1       0.000122414     32676
+Q       10      27      3       0.000214048     32703
+Q       8       14      1       0.000244521     32717
+Q       7       13      2       0.000305530     32730
+Q       6       46      1       0.000335611     32776
+Q       3       10      1       0.000366010     32786
+Q       2       20      2       0.000426751     32806
+Q       1       248     94      0.003267381     33054
+Q       0       31      17      0.003778147     33085
+U       3
+```
+
+where each Q-line gives the quality threshold, the number of reads mapped with
+mapping quality equal to or greater than the threshold, number of wrong
+mappings, accumulative mapping error rate and the accumulative number of
+mapped reads. The U-line, if present, gives the number of unmapped reads if
+they are present in the SAM file.
+
+Suppose the reported mapping coordinate overlap with the true coordinate like
+the following:
+
+```
+truth:   --------------------
+mapper:           ----------------------
+         |<- l1 ->|<-- o -->|<-- l2 -->|
+```
+
+Let `r=o/(l1+o+l2)`. The reported mapping is considered correct if `r>0.1` by
+default.
+
+### <a name="oveval"></a>Evaluating read overlap sensitivity
+
+Command **ov-eval** takes *sorted* read-to-reference alignment and read
+overlaps in PAF as input, and evaluates the sensitivity. For example:
+
+```sh
+minimap2 -cx map-pb ref.fa reads.fq.gz | sort -k6,6 -k8,8n > reads-to-ref.paf
+minimap2 -x ava-pb reads.fq.gz reads.fq.gz > ovlp.paf
+k8 ov-eval.js reads-to-ref.paf ovlp.paf
+```
+
+## <a name="asmvar"></a>Calling Variants from Haploid Assemblies
+
+The **call** command of paftools.js calls variants from coordinate-sorted
+assembly-to-reference alignment. It calls variants from the [cs tag][cs] and
+identifies confident/callable regions as those covered by exactly one contig.
+Here are example command lines:
+
+```sh
+minimap2 -cx asm5 -t8 --cs ref.fa asm.fa > asm.paf  # keeping this file is recommended; --cs required!
+sort -k6,6 -k8,8n asm.paf > asm.srt.paf             # sort by reference start coordinate
+k8 paftools.js call asm.srt.paf > asm.var.txt
+```
+
+Here is sample output:
+
+```
+V   chr1    2276040 2276041 1   60  c   g   LJII01000171.1  1217409 1217410 +
+V   chr1    2280409 2280410 1   60  a   g   LJII01000171.1  1221778 1221779 +
+V   chr1    2280504 2280505 1   60  a   g   LJII01000171.1  1221873 1221874 +
+R   chr1    2325140 2436340
+V   chr1    2325287 2325287 1   60  -   ct  LJII01000171.1  1272894 1272896 +
+V   chr1    2325642 2325644 1   60  tt  -   LJII01000171.1  1273251 1273251 +
+V   chr1    2326051 2326052 1   60  c   t   LJII01000171.1  1273658 1273659 +
+V   chr1    2326287 2326288 1   60  c   t   LJII01000171.1  1273894 1273895 +
+```
+
+where a line starting with `R` gives regions covered by one query contig, and a
+V-line encodes a variant in the following format: chr, start, end, query depth,
+mapping quality, REF allele, ALT allele, query name, query start, end and the
+query orientation. Generally, you should only look at variants where column 5
+is one.
+
+By default, when calling variants, "paftools.js call" ignores alignments 50kb
+or shorter; when deriving callable regions, it ignores alignments 10kb or
+shorter.  It uses two thresholds to avoid edge effects. These defaults are
+designed for long-read assemblies. For short reads, both should be reduced.
+
+
+
+[paf]: https://github.com/lh3/miniasm/blob/master/PAF.md
+[cs]: https://github.com/lh3/minimap2#cs
+[k8]: https://github.com/attractivechaos/k8
+[maf]: https://genome.ucsc.edu/FAQ/FAQformat#format5
+[pbsim]: https://github.com/pfaucon/PBSIM-PacBio-Simulator
+[mason2]: https://github.com/seqan/seqan/tree/master/apps/mason2

misc/mapstat.js

@@ -1,183 +0,0 @@
-var getopt = function(args, ostr) {
-	var oli; // option letter list index
-	if (typeof(getopt.place) == 'undefined')
-		getopt.ind = 0, getopt.arg = null, getopt.place = -1;
-	if (getopt.place == -1) { // update scanning pointer
-		if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
-			getopt.place = -1;
-			return null;
-		}
-		if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
-			++getopt.ind;
-			getopt.place = -1;
-			return null;
-		}
-	}
-	var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
-	if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
-		if (optopt == '-') return null; //  if the user didn't specify '-' as an option, assume it means null.
-		if (getopt.place < 0) ++getopt.ind;
-		return '?';
-	}
-	if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
-		getopt.arg = null;
-		if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
-	} else { // need an argument
-		if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
-			getopt.arg = args[getopt.ind].substr(getopt.place);
-		else if (args.length <= ++getopt.ind) { // no arg
-			getopt.place = -1;
-			if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
-			return '?';
-		} else getopt.arg = args[getopt.ind]; // white space
-		getopt.place = -1;
-		++getopt.ind;
-	}
-	return optopt;
-}
-
-var c, gap_out_len = null;
-while ((c = getopt(arguments, "l:")) != null)
-	if (c == 'l') gap_out_len = parseInt(getopt.arg);
-
-if (getopt.ind == arguments.length) {
-	print("Usage: k8 mapstat.js [-l gapOutLen] <in.sam>|<in.paf>");
-	exit(1);
-}
-
-var buf = new Bytes();
-var file = new File(arguments[getopt.ind]);
-var re = /(\d+)([MIDSHNX=])/g;
-
-var lineno = 0, n_pri = 0, n_2nd = 0, n_seq = 0, n_cigar_64k = 0, l_tot = 0, l_cov = 0;
-var n_gap = [[0, 0, 0, 0, 0, 0], [0, 0, 0, 0, 0, 0]];
-
-function cov_len(regs)
-{
-	regs.sort(function(a,b) {return a[0]-b[0]});
-	var st = regs[0][0], en = regs[0][1], l = 0;
-	for (var i = 1; i < regs.length; ++i) {
-		if (regs[i][0] < en)
-			en = en > regs[i][1]? en : regs[i][1];
-		else l += en - st, st = regs[i][0], en = regs[i][1];
-	}
-	l += en - st;
-	return l;
-}
-
-var last = null, last_qlen = null, regs = [];
-while (file.readline(buf) >= 0) {
-	var line = buf.toString();
-	++lineno;
-	if (line.charAt(0) != '@') {
-		var t = line.split("\t", 12);
-		var m, rs, cigar = null, is_pri = false, is_sam = false, is_rev = false, tname = null;
-		var atlen = null, aqlen, qs, qe, mapq, ori_qlen;
-		if (t[4] == '+' || t[4] == '-') { // PAF
-			if (!/\ts2:i:\d+/.test(line)) {
-				++n_2nd;
-				continue;
-			}
-			if ((m = /\tcg:Z:(\S+)/.exec(line)) != null)
-				cigar = m[1];
-			if (cigar == null) {
-				warn("WARNING: no CIGAR at line " + lineno);
-				continue;
-			}
-			tname = t[5];
-			qs = parseInt(t[2]), qe = parseInt(t[3]);
-			aqlen = qe - qs;
-			is_rev = t[4] == '+'? false : true;
-			rs = parseInt(t[7]);
-			atlen = parseInt(t[8]) - rs;
-			mapq = parseInt(t[11]);
-			ori_qlen = parseInt(t[1]);
-		} else { // SAM
-			var flag = parseInt(t[1]);
-			if (flag & 4) continue;
-			if (flag & 0x100) {
-				++n_2nd;
-				continue;
-			}
-			cigar = t[5];
-			tname = t[2];
-			rs = parseInt(t[3]) - 1;
-			mapq = parseInt(t[4]);
-			aqlen = t[9].length;
-			is_sam = true;
-			is_rev = !!(flag&0x10);
-		}
-		++n_pri;
-		if (last != t[0]) {
-			if (last != null) {
-				l_tot += last_qlen;
-				l_cov += cov_len(regs);
-			}
-			regs = [];
-			++n_seq, last = t[0];
-		}
-		var M = 0, tl = 0, ql = 0, clip = [0, 0], n_cigar = 0, sclip = 0;
-		while ((m = re.exec(cigar)) != null) {
-			var l = parseInt(m[1]);
-			++n_cigar;
-			if (m[2] == 'M' || m[2] == '=' || m[2] == 'X') {
-				tl += l, ql += l, M += l;
-			} else if (m[2] == 'I' || m[2] == 'D') {
-				var type;
-				if (l < 50) type = 0;
-				else if (l < 100) type = 1;
-				else if (l < 300) type = 2;
-				else if (l < 400) type = 3;
-				else if (l < 1000) type = 4;
-				else type = 5;
-				if (m[2] == 'I') ql += l, ++n_gap[0][type];
-				else tl += l, ++n_gap[1][type];
-				if (gap_out_len != null && l >= gap_out_len)
-					print(t[0], ql, is_rev? '-' : '+', tname, rs + tl, m[2], l);
-			} else if (m[2] == 'N') {
-				tl += l;
-			} else if (m[2] == 'S') {
-				clip[M == 0? 0 : 1] = l, sclip += l;
-			} else if (m[2] == 'H') {
-				clip[M == 0? 0 : 1] = l;
-			}
-		}
-		if (n_cigar > 65535) ++n_cigar_64k;
-		if (ql + sclip != aqlen)
-			warn("WARNING: aligned query length is inconsistent with CIGAR at line " + lineno);
-		if (atlen != null && atlen != tl)
-			warn("WARNING: aligned reference length is inconsistent with CIGAR at line " + lineno);
-		if (is_sam) {
-			qs = clip[is_rev? 1 : 0], qe = qs + ql;
-			ori_qlen = clip[0] + ql + clip[1];
-		}
-		regs.push([qs, qe]);
-		last_qlen = ori_qlen;
-	}
-}
-l_tot += last_qlen;
-l_cov += cov_len(regs);
-
-file.close();
-buf.destroy();
-
-if (gap_out_len == null) {
-	print("Number of mapped sequences: " + n_seq);
-	print("Number of primary alignments: " + n_pri);
-	print("Number of secondary alignments: " + n_2nd);
-	print("Number of primary alignments with >65535 CIGAR operations: " + n_cigar_64k);
-	print("Number of bases in mapped sequences: " + l_tot);
-	print("Number of mapped bases: " + l_cov);
-	print("Number of insertions in [0,50): " + n_gap[0][0]);
-	print("Number of insertions in [50,100): " + n_gap[0][1]);
-	print("Number of insertions in [100,300): " + n_gap[0][2]);
-	print("Number of insertions in [300,400): " + n_gap[0][3]);
-	print("Number of insertions in [400,1000): " + n_gap[0][4]);
-	print("Number of insertions in [1000,inf): " + n_gap[0][5]);
-	print("Number of deletions in [0,50): " + n_gap[1][0]);
-	print("Number of deletions in [50,100): " + n_gap[1][1]);
-	print("Number of deletions in [100,300): " + n_gap[1][2]);
-	print("Number of deletions in [300,400): " + n_gap[1][3]);
-	print("Number of deletions in [400,1000): " + n_gap[1][4]);
-	print("Number of deletions in [1000,inf): " + n_gap[1][5]);
-}

mmpriv.h

@@ -11,11 +11,26 @@
 #define MM_DBG_NO_KALLOC     0x1
 #define MM_DBG_PRINT_QNAME   0x2
 #define MM_DBG_PRINT_SEED    0x4
+#define MM_DBG_PRINT_ALN_SEQ 0x8
+
+#define MM_SEED_LONG_JOIN  (1ULL<<40)
+#define MM_SEED_IGNORE     (1ULL<<41)
+#define MM_SEED_TANDEM     (1ULL<<42)
+#define MM_SEED_SELF       (1ULL<<43)
+
+#define MM_SEED_SEG_SHIFT  48
+#define MM_SEED_SEG_MASK   (0xffULL<<(MM_SEED_SEG_SHIFT))
 
 #ifndef kroundup32
 #define kroundup32(x) (--(x), (x)|=(x)>>1, (x)|=(x)>>2, (x)|=(x)>>4, (x)|=(x)>>8, (x)|=(x)>>16, ++(x))
 #endif
 
+#define mm_seq4_set(s, i, c) ((s)[(i)>>3] |= (uint32_t)(c) << (((i)&7)<<2))
+#define mm_seq4_get(s, i)    ((s)[(i)>>3] >> (((i)&7)<<2) & 0xf)
+
+#define MALLOC(type, len) ((type*)malloc((len) * sizeof(type)))
+#define CALLOC(type, len) ((type*)calloc((len), sizeof(type)))
+
 #ifdef __cplusplus
 extern "C" {
 #endif
@@ -28,28 +43,60 @@ typedef struct __kstring_t {
 } kstring_t;
 #endif
 
+typedef struct {
+	int n_u, n_a;
+	uint64_t *u;
+	mm128_t *a;
+} mm_seg_t;
+
 double cputime(void);
 double realtime(void);
+long peakrss(void);
 
 void radix_sort_128x(mm128_t *beg, mm128_t *end);
 void radix_sort_64(uint64_t *beg, uint64_t *end);
 uint32_t ks_ksmall_uint32_t(size_t n, uint32_t arr[], size_t kk);
 
-void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r);
+void mm_sketch(void *km, const char *str, int len, int w, int k, uint32_t rid, int is_hpc, mm128_v *p);
-void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r);
+
-int mm_chain_dp(int max_dist, int bw, int max_skip, int min_cnt, int min_sc, int64_t n, mm128_t *a, uint64_t **_u, void *km);
+void mm_write_sam_hdr(const mm_idx_t *mi, const char *rg, const char *ver, int argc, char *argv[]);
+void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int opt_flag);
+void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int n_regs, const mm_reg1_t *regs);
+void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regs, const mm_reg1_t *const* regs, void *km, int opt_flag);
+
+void mm_idxopt_init(mm_idxopt_t *opt);
+const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n);
+int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f);
+mm128_t *mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int min_cnt, int min_sc, int is_cdna, int n_segs, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km);
 mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a);
 
-mm_reg1_t *mm_gen_regs(void *km, int qlen, int n_u, uint64_t *u, mm128_t *a);
+mm_reg1_t *mm_gen_regs(void *km, uint32_t hash, int qlen, int n_u, uint64_t *u, mm128_t *a);
 void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a);
 void mm_sync_regs(void *km, int n_regs, mm_reg1_t *regs);
+int mm_squeeze_a(void *km, int n_regs, mm_reg1_t *regs, mm128_t *a);
 int mm_set_sam_pri(int n, mm_reg1_t *r);
-void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r);
+void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r, int sub_diff);
-void mm_select_sub(void *km, float mask_level, float pri_ratio, int best_n, int *n_, mm_reg1_t *r);
+void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int *n_, mm_reg1_t *r);
-void mm_filter_regs(void *km, const mm_mapopt_t *opt, int *n_regs, mm_reg1_t *regs);
+void mm_select_sub_multi(void *km, float pri_ratio, float pri1, float pri2, int max_gap_ref, int min_diff, int best_n, int n_segs, const int *qlens, int *n_, mm_reg1_t *r);
+void mm_filter_regs(const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs);
 void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs, mm128_t *a);
-void mm_hit_sort_by_dp(void *km, int *n_regs, mm_reg1_t *r);
+void mm_hit_sort(void *km, int *n_regs, mm_reg1_t *r);
-void mm_set_mapq(int n_regs, mm_reg1_t *regs);
+void mm_set_mapq(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr);
+
+void mm_est_err(const mm_idx_t *mi, int qlen, int n_regs, mm_reg1_t *regs, const mm128_t *a, int32_t n, const uint64_t *mini_pos);
+
+mm_seg_t *mm_seg_gen(void *km, uint32_t hash, int n_segs, const int *qlens, int n_regs0, const mm_reg1_t *regs0, int *n_regs, mm_reg1_t **regs, const mm128_t *a);
+void mm_seg_free(void *km, int n_segs, mm_seg_t *segs);
+void mm_pair(void *km, int max_gap_ref, int dp_bonus, int sub_diff, int match_sc, const int *qlens, int *n_regs, mm_reg1_t **regs);
+
+FILE *mm_split_init(const char *prefix, const mm_idx_t *mi);
+mm_idx_t *mm_split_merge_prep(const char *prefix, int n_splits, FILE **fp, uint32_t *n_seq_part);
+int mm_split_merge(int n_segs, const char **fn, const mm_mapopt_t *opt, int n_split_idx);
+void mm_split_rm_tmp(const char *prefix, int n_splits);
+
+void mm_err_puts(const char *str);
+void mm_err_fwrite(const void *p, size_t size, size_t nitems, FILE *fp);
+void mm_err_fread(void *p, size_t size, size_t nitems, FILE *fp);
 
 #ifdef __cplusplus
 }

options.c

@@ -0,0 +1,173 @@
+#include <stdio.h>
+#include "mmpriv.h"
+
+void mm_idxopt_init(mm_idxopt_t *opt)
+{
+	memset(opt, 0, sizeof(mm_idxopt_t));
+	opt->k = 15, opt->w = 10, opt->flag = 0;
+	opt->bucket_bits = 14;
+	opt->mini_batch_size = 50000000;
+	opt->batch_size = 4000000000ULL;
+}
+
+void mm_mapopt_init(mm_mapopt_t *opt)
+{
+	memset(opt, 0, sizeof(mm_mapopt_t));
+	opt->seed = 11;
+	opt->mid_occ_frac = 2e-4f;
+	opt->sdust_thres = 0; // no SDUST masking
+
+	opt->min_cnt = 3;
+	opt->min_chain_score = 40;
+	opt->bw = 500;
+	opt->max_gap = 5000;
+	opt->max_gap_ref = -1;
+	opt->max_chain_skip = 25;
+
+	opt->mask_level = 0.5f;
+	opt->pri_ratio = 0.8f;
+	opt->best_n = 5;
+
+	opt->max_join_long = 20000;
+	opt->max_join_short = 2000;
+	opt->min_join_flank_sc = 1000;
+	opt->min_join_flank_ratio = 0.5f;
+
+	opt->a = 2, opt->b = 4, opt->q = 4, opt->e = 2, opt->q2 = 24, opt->e2 = 1;
+	opt->sc_ambi = 1;
+	opt->zdrop = 400, opt->zdrop_inv = 200;
+	opt->end_bonus = -1;
+	opt->min_dp_max = opt->min_chain_score * opt->a;
+	opt->min_ksw_len = 200;
+	opt->anchor_ext_len = 20, opt->anchor_ext_shift = 6;
+	opt->max_clip_ratio = 1.0f;
+	opt->mini_batch_size = 500000000;
+
+	opt->pe_ori = 0; // FF
+	opt->pe_bonus = 33;
+}
+
+void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
+{
+	if ((opt->flag & MM_F_SPLICE_FOR) || (opt->flag & MM_F_SPLICE_REV))
+		opt->flag |= MM_F_SPLICE;
+	if (opt->mid_occ <= 0)
+		opt->mid_occ = mm_idx_cal_max_occ(mi, opt->mid_occ_frac);
+	if (opt->mid_occ < opt->min_mid_occ)
+		opt->mid_occ = opt->min_mid_occ;
+	if (mm_verbose >= 3)
+		fprintf(stderr, "[M::%s::%.3f*%.2f] mid_occ = %d\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), opt->mid_occ);
+}
+
+void mm_mapopt_max_intron_len(mm_mapopt_t *opt, int max_intron_len)
+{
+	if ((opt->flag & MM_F_SPLICE) && max_intron_len > 0)
+		opt->max_gap_ref = opt->bw = max_intron_len;
+}
+
+int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
+{
+	if (preset == 0) {
+		mm_idxopt_init(io);
+		mm_mapopt_init(mo);
+	} else if (strcmp(preset, "ava-ont") == 0) {
+		io->flag = 0, io->k = 15, io->w = 5;
+		mo->flag |= MM_F_ALL_CHAINS | MM_F_NO_DIAG | MM_F_NO_DUAL | MM_F_NO_LJOIN;
+		mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_gap = 10000, mo->max_chain_skip = 25;
+		mo->bw = 2000;
+	} else if (strcmp(preset, "ava-pb") == 0) {
+		io->flag |= MM_I_HPC, io->k = 19, io->w = 5;
+		mo->flag |= MM_F_ALL_CHAINS | MM_F_NO_DIAG | MM_F_NO_DUAL | MM_F_NO_LJOIN;
+		mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_gap = 10000, mo->max_chain_skip = 25;
+	} else if (strcmp(preset, "map10k") == 0 || strcmp(preset, "map-pb") == 0) {
+		io->flag |= MM_I_HPC, io->k = 19;
+	} else if (strcmp(preset, "map-ont") == 0) {
+		io->flag = 0, io->k = 15;
+	} else if (strcmp(preset, "asm5") == 0) {
+		io->flag = 0, io->k = 19, io->w = 19;
+		mo->a = 1, mo->b = 19, mo->q = 39, mo->q2 = 81, mo->e = 3, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
+		mo->min_mid_occ = 100;
+		mo->min_dp_max = 200;
+		mo->best_n = 50;
+	} else if (strcmp(preset, "asm10") == 0) {
+		io->flag = 0, io->k = 19, io->w = 19;
+		mo->a = 1, mo->b = 9, mo->q = 16, mo->q2 = 41, mo->e = 2, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
+		mo->min_mid_occ = 100;
+		mo->min_dp_max = 200;
+		mo->best_n = 50;
+	} else if (strcmp(preset, "asm20") == 0) {
+		io->flag = 0, io->k = 19, io->w = 10;
+		mo->a = 1, mo->b = 4, mo->q = 6, mo->q2 = 26, mo->e = 2, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
+		mo->min_mid_occ = 100;
+		mo->min_dp_max = 200;
+		mo->best_n = 50;
+	} else if (strcmp(preset, "short") == 0 || strcmp(preset, "sr") == 0) {
+		io->flag = 0, io->k = 21, io->w = 11;
+		mo->flag |= MM_F_SR | MM_F_FRAG_MODE | MM_F_NO_PRINT_2ND | MM_F_2_IO_THREADS | MM_F_HEAP_SORT;
+		mo->pe_ori = 0<<1|1; // FR
+		mo->a = 2, mo->b = 8, mo->q = 12, mo->e = 2, mo->q2 = 24, mo->e2 = 1;
+		mo->zdrop = mo->zdrop_inv = 100;
+		mo->end_bonus = 10;
+		mo->max_frag_len = 800;
+		mo->max_gap = 100;
+		mo->bw = 100;
+		mo->pri_ratio = 0.5f;
+		mo->min_cnt = 2;
+		mo->min_chain_score = 25;
+		mo->min_dp_max = 40;
+		mo->best_n = 20;
+		mo->mid_occ = 1000;
+		mo->max_occ = 5000;
+		mo->mini_batch_size = 50000000;
+	} else if (strcmp(preset, "splice") == 0 || strcmp(preset, "cdna") == 0) {
+		io->flag = 0, io->k = 15, io->w = 5;
+		mo->flag |= MM_F_SPLICE | MM_F_SPLICE_FOR | MM_F_SPLICE_REV | MM_F_SPLICE_FLANK;
+		mo->max_gap = 2000, mo->max_gap_ref = mo->bw = 200000;
+		mo->a = 1, mo->b = 2, mo->q = 2, mo->e = 1, mo->q2 = 32, mo->e2 = 0;
+		mo->noncan = 9;
+		mo->zdrop = 200, mo->zdrop_inv = 100; // because mo->a is halved
+	} else return -1;
+	return 0;
+}
+
+int mm_check_opt(const mm_idxopt_t *io, const mm_mapopt_t *mo)
+{
+	if (io->k <= 0 || io->w <= 0) {
+		if (mm_verbose >= 1)
+			fprintf(stderr, "[ERROR]\033[1;31m -k and -w must be positive\033[0m\n");
+		return -5;
+	}
+	if (mo->best_n < 0) {
+		if (mm_verbose >= 1)
+			fprintf(stderr, "[ERROR]\033[1;31m -N must be no less than 0\033[0m\n");
+		return -4;
+	}
+	if (mo->best_n == 0 && mm_verbose >= 2)
+		fprintf(stderr, "[WARNING]\033[1;31m '-N 0' reduces mapping accuracy. Please use '--secondary=no' instead.\033[0m\n");
+	if (mo->pri_ratio < 0.0f || mo->pri_ratio > 1.0f) {
+		if (mm_verbose >= 1)
+			fprintf(stderr, "[ERROR]\033[1;31m -p must be within 0 and 1 (including 0 and 1)\033[0m\n");
+		return -4;
+	}
+	if ((mo->flag & MM_F_FOR_ONLY) && (mo->flag & MM_F_REV_ONLY)) {
+		if (mm_verbose >= 1)
+			fprintf(stderr, "[ERROR]\033[1;31m --for-only and --rev-only can't be applied at the same time\033[0m\n");
+		return -3;
+	}
+	if ((mo->q != mo->q2 || mo->e != mo->e2) && !(mo->e > mo->e2 && mo->q + mo->e < mo->q2 + mo->e2)) {
+		if (mm_verbose >= 1)
+			fprintf(stderr, "[ERROR]\033[1;31m dual gap penalties violating E1>E2 and O1+E1<O2+E2\033[0m\n");
+		return -2;
+	}
+	if ((mo->q + mo->e) + (mo->q2 + mo->e2) > 127) {
+		if (mm_verbose >= 1)
+			fprintf(stderr, "[ERROR]\033[1;31m scoring system violating ({-O}+{-E})+({-O2}+{-E2}) <= 127\033[0m\n");
+		return -1;
+	}
+	if (mo->zdrop < mo->zdrop_inv) {
+		if (mm_verbose >= 1)
+			fprintf(stderr, "[ERROR]\033[1;31m Z-drop should not be less than inversion-Z-drop\033[0m\n");
+		return -5;
+	}
+	return 0;
+}

pe.c

@@ -0,0 +1,177 @@
+#include <stdlib.h>
+#include <math.h>
+#include "mmpriv.h"
+#include "kvec.h"
+
+void mm_select_sub_multi(void *km, float pri_ratio, float pri1, float pri2, int max_gap_ref, int min_diff, int best_n, int n_segs, const int *qlens, int *n_, mm_reg1_t *r)
+{
+	if (pri_ratio > 0.0f && *n_ > 0) {
+		int i, k, n = *n_, n_2nd = 0;
+		int max_dist = n_segs == 2? qlens[0] + qlens[1] + max_gap_ref : 0;
+		for (i = k = 0; i < n; ++i) {
+			int to_keep = 0;
+			if (r[i].parent == i) { // primary
+				to_keep = 1;
+			} else if (r[i].score + min_diff >= r[r[i].parent].score) {
+				to_keep = 1;
+			} else {
+				mm_reg1_t *p = &r[r[i].parent], *q = &r[i];
+				if (p->rev == q->rev && p->rid == q->rid && q->re - p->rs < max_dist && p->re - q->rs < max_dist) { // child and parent are close on the ref
+					if (q->score >= p->score * pri1)
+						to_keep = 1;
+				} else {
+					int is_par_both = (n_segs == 2 && p->qs < qlens[0] && p->qe > qlens[0]);
+					int is_chi_both = (n_segs == 2 && q->qs < qlens[0] && q->qe > qlens[0]);
+					if (is_chi_both || is_chi_both == is_par_both) {
+						if (q->score >= p->score * pri_ratio)
+							to_keep = 1;
+					} else { // the remaining case: is_chi_both == 0 && is_par_both == 1
+						if (q->score >= p->score * pri2)
+							to_keep = 1;
+					}
+				}
+			}
+			if (to_keep && r[i].parent != i) {
+				if (n_2nd++ >= best_n) to_keep = 0; // don't keep if there are too many secondary hits
+			}
+			if (to_keep) r[k++] = r[i];
+			else if (r[i].p) free(r[i].p);
+		}
+		if (k != n) mm_sync_regs(km, k, r); // removing hits requires sync()
+		*n_ = k;
+	}
+}
+
+void mm_set_pe_thru(const int *qlens, int *n_regs, mm_reg1_t **regs)
+{
+	int s, i, n_pri[2], pri[2];
+	n_pri[0] = n_pri[1] = 0;
+	pri[0] = pri[1] = -1;
+	for (s = 0; s < 2; ++s)
+		for (i = 0; i < n_regs[s]; ++i)
+			if (regs[s][i].id == regs[s][i].parent)
+				++n_pri[s], pri[s] = i;
+	if (n_pri[0] == 1 && n_pri[1] == 1) {
+		mm_reg1_t *p = &regs[0][pri[0]];
+		mm_reg1_t *q = &regs[1][pri[1]];
+		if (p->rid == q->rid && p->rev == q->rev && abs(p->rs - q->rs) < 3 && abs(p->re - p->re) < 3
+			&& ((p->qs == 0 && qlens[1] - q->qe == 0) || (q->qs == 0 && qlens[0] - p->qe == 0)))
+		{
+			p->pe_thru = q->pe_thru = 1;
+		}
+	}
+}
+
+#include "ksort.h"
+
+typedef struct {
+	int s, rev;
+	uint64_t key;
+	mm_reg1_t *r;
+} pair_arr_t;
+
+#define sort_key_pair(a) ((a).key)
+KRADIX_SORT_INIT(pair, pair_arr_t, sort_key_pair, 8)
+
+void mm_pair(void *km, int max_gap_ref, int pe_bonus, int sub_diff, int match_sc, const int *qlens, int *n_regs, mm_reg1_t **regs)
+{
+	int i, j, s, n, last[2], dp_thres, segs = 0, max_idx[2];
+	int64_t max;
+	pair_arr_t *a;
+	kvec_t(uint64_t) sc = {0,0,0};
+
+	a = (pair_arr_t*)kmalloc(km, (n_regs[0] + n_regs[1]) * sizeof(pair_arr_t));
+	for (s = n = 0, dp_thres = 0; s < 2; ++s) {
+		int max = 0;
+		for (i = 0; i < n_regs[s]; ++i) {
+			a[n].s = s;
+			a[n].r = &regs[s][i];
+			a[n].rev = a[n].r->rev;
+			a[n].key = (uint64_t)a[n].r->rid << 32 | a[n].r->rs<<1 | (s^a[n].rev);
+			max = max > a[n].r->p->dp_max? max : a[n].r->p->dp_max;
+			++n;
+			segs |= 1<<s;
+		}
+		dp_thres += max;
+	}
+	if (segs != 3) {
+		kfree(km, a); // only one end is mapped
+		return;
+	}
+	dp_thres -= pe_bonus;
+	if (dp_thres < 0) dp_thres = 0;
+	radix_sort_pair(a, a + n);
+
+	max = -1;
+	max_idx[0] = max_idx[1] = -1;
+	last[0] = last[1] = -1;
+	kv_resize(uint64_t, km, sc, (size_t)n);
+	for (i = 0; i < n; ++i) {
+		if (a[i].key & 1) { // reverse first read or forward second read
+			mm_reg1_t *q, *r;
+			if (last[a[i].rev] < 0) continue;
+			r = a[i].r;
+			q = a[last[a[i].rev]].r;
+			if (r->rid != q->rid || r->rs - q->re > max_gap_ref) continue;
+			for (j = last[a[i].rev]; j >= 0; --j) {
+				int64_t score;
+				if (a[j].rev != a[i].rev || a[j].s == a[i].s) continue;
+				q = a[j].r;
+				if (r->rid != q->rid || r->rs - q->re > max_gap_ref) break;
+				if (r->p->dp_max + q->p->dp_max < dp_thres) continue;
+				score = (int64_t)(r->p->dp_max + q->p->dp_max) << 32 | (r->hash + q->hash);
+				if (score > max)
+					max = score, max_idx[a[j].s] = j, max_idx[a[i].s] = i;
+				kv_push(uint64_t, km, sc, score);
+			}
+		} else { // forward first read or reverse second read
+			last[a[i].rev] = i;
+		}
+	}
+	if (sc.n > 1)
+		radix_sort_64(sc.a, sc.a + sc.n);
+
+	if (sc.n > 0 && max > 0) { // found at least one pair
+		int n_sub = 0, mapq_pe;
+		mm_reg1_t *r[2];
+		r[0] = a[max_idx[0]].r, r[1] = a[max_idx[1]].r;
+		r[0]->proper_frag = r[1]->proper_frag = 1;
+		for (s = 0; s < 2; ++s) {
+			if (r[s]->id != r[s]->parent) { // then lift to primary and update parent
+				mm_reg1_t *p = &regs[s][r[s]->parent];
+				for (i = 0; i < n_regs[s]; ++i)
+					if (regs[s][i].parent == p->id)
+						regs[s][i].parent = r[s]->id;
+				p->mapq = 0;
+			}
+			if (!r[s]->sam_pri) { // then sync sam_pri
+				for (i = 0; i < n_regs[s]; ++i)
+					regs[s][i].sam_pri = 0;
+				r[s]->sam_pri = 1;
+			}
+		}
+		mapq_pe = r[0]->mapq > r[1]->mapq? r[0]->mapq : r[1]->mapq;
+		for (i = 0; i < (int)sc.n; ++i)
+			if ((sc.a[i]>>32) + sub_diff >= (uint64_t)max>>32)
+				++n_sub;
+		if (sc.n > 1) {
+			int mapq_pe_alt;
+			mapq_pe_alt = (int)(6.02f * ((max>>32) - (sc.a[sc.n - 2]>>32)) / match_sc - 4.343f * logf(n_sub)); // n_sub > 0 because it counts the optimal, too
+			mapq_pe = mapq_pe < mapq_pe_alt? mapq_pe : mapq_pe_alt;
+		}
+		if (r[0]->mapq < mapq_pe) r[0]->mapq = (int)(.2f * r[0]->mapq + .8f * mapq_pe + .499f);
+		if (r[1]->mapq < mapq_pe) r[1]->mapq = (int)(.2f * r[1]->mapq + .8f * mapq_pe + .499f);
+		if (sc.n == 1) {
+			if (r[0]->mapq < 2) r[0]->mapq = 2;
+			if (r[1]->mapq < 2) r[1]->mapq = 2;
+		} else if ((uint64_t)max>>32 > sc.a[sc.n - 2]>>32) {
+			if (r[0]->mapq < 1) r[0]->mapq = 1;
+			if (r[1]->mapq < 1) r[1]->mapq = 1;
+		}
+	}
+
+	kfree(km, a);
+	kfree(km, sc.a);
+
+	mm_set_pe_thru(qlens, n_regs, regs);
+}

python/README.rst

@@ -0,0 +1,170 @@
+==============================
+Mappy: Minimap2 Python Binding
+==============================
+
+Mappy provides a convenient interface to `minimap2
+<https://github.com/lh3/minimap2>`_, a fast and accurate C program to align
+genomic and transcribe nucleotide sequences.
+
+Installation
+------------
+
+Mappy depends on `zlib <http://zlib.net>`_. It can be installed with `pip
+<https://en.wikipedia.org/wiki/Pip_(package_manager)>`_:
+
+.. code:: shell
+
+	pip install --user mappy
+
+or from the minimap2 github repo (`Cython <http://cython.org>`_ required):
+
+.. code:: shell
+
+	git clone https://github.com/lh3/minimap2
+	cd minimap2
+	python setup.py install
+
+Usage
+-----
+
+The following Python script demonstrates the key functionality of mappy:
+
+.. code:: python
+
+	import mappy as mp
+	a = mp.Aligner("test/MT-human.fa")  # load or build index
+	if not a: raise Exception("ERROR: failed to load/build index")
+	s = a.seq("MT_human", 100, 200)     # retrieve a subsequence from the index
+	print(mp.revcomp(s))                # reverse complement
+	for name, seq, qual in mp.fastx_read("test/MT-orang.fa"): # read a fasta/q sequence
+		for hit in a.map(seq): # traverse alignments
+			print("{}\t{}\t{}\t{}".format(hit.ctg, hit.r_st, hit.r_en, hit.cigar_str))
+
+APIs
+----
+
+Mappy implements two classes and one global function.
+
+Class mappy.Aligner
+~~~~~~~~~~~~~~~~~~~
+
+.. code:: python
+
+	mappy.Aligner(fn_idx_in, preset=None, ...)
+
+This constructor accepts the following arguments:
+
+* **fn_idx_in**: index or sequence file name. Minimap2 automatically tests the
+  file type. If a sequence file is provided, minimap2 builds an index. The
+  sequence file can be optionally gzip'd.
+
+* **preset**: minimap2 preset. Currently, minimap2 supports the following
+  presets: **sr** for single-end short reads; **map-pb** for PacBio
+  read-to-reference mapping; **map-ont** for Oxford Nanopore read mapping;
+  **splice** for long-read spliced alignment; **asm5** for assembly-to-assembly
+  alignment; **asm10** for full genome alignment of closely related species. Note
+  that the Python module does not support all-vs-all read overlapping.
+
+* **k**: k-mer length, no larger than 28
+
+* **w**: minimizer window size, no larger than 255
+
+* **min_cnt**: mininum number of minimizers on a chain
+
+* **min_chain_score**: minimum chaing score
+
+* **bw**: chaining and alignment band width
+
+* **best_n**: max number of alignments to return
+
+* **n_threads**: number of indexing threads; 3 by default
+
+* **fn_idx_out**: name of file to which the index is written
+
+.. code:: python
+
+	mappy.Aligner.map(seq, seq2=None)
+
+This method aligns :code:`seq` against the index. It is a generator, *yielding*
+a series of :code:`mappy.Alignment` objects. If :code:`seq2` is present, mappy
+performs paired-end alignment, assuming the two ends are in the FR orientation.
+Alignments of the two ends can be distinguished by the :code:`read_num` field
+(see Class mappy.Alignment below).
+
+.. code:: python
+
+	mappy.Aligner.seq(name, start=0, end=0x7fffffff)
+
+This method retrieves a (sub)sequence from the index and returns it as a Python
+string. :code:`None` is returned if :code:`name` is not present in the index or
+the start/end coordinates are invalid.
+
+Class mappy.Alignment
+~~~~~~~~~~~~~~~~~~~~~
+
+This class describes an alignment. An object of this class has the following
+properties:
+
+* **ctg**: name of the reference sequence the query is mapped to
+
+* **ctg_len**: total length of the reference sequence
+
+* **r_st** and **r_en**: start and end positions on the reference
+
+* **q_st** and **q_en**: start and end positions on the query
+
+* **strand**: +1 if on the forward strand; -1 if on the reverse strand
+
+* **mapq**: mapping quality
+
+* **blen**: length of the alignment, including both alignment matches and gaps
+  but excluding ambiguous bases.
+
+* **mlen**: length of the matching bases in the alignment, excluding ambiguous
+  base matches.
+
+* **NM**: number of mismatches, gaps and ambiguous poistions in the alignment
+
+* **trans_strand**: transcript strand. +1 if on the forward strand; -1 if on the
+  reverse strand; 0 if unknown
+
+* **is_primary**: if the alignment is primary (typically the best and the first
+  to generate)
+
+* **read_num**: read number that the alignment corresponds to; 1 for the first
+  read and 2 for the second read
+
+* **cigar_str**: CIGAR string
+
+* **cigar**: CIGAR returned as an array of shape :code:`(n_cigar,2)`. The two
+  numbers give the length and the operator of each CIGAR operation.
+
+An :code:`Alignment` object can be converted to a string with :code:`str()` in
+the following format:
+
+::
+
+	q_st  q_en  strand  ctg  ctg_len  r_st  r_en  mlen  blen  mapq  cg:Z:cigar_str
+
+It is effectively the PAF format without the QueryName and QueryLength columns
+(the first two columns in PAF).
+
+Miscellaneous Functions
+~~~~~~~~~~~~~~~~~~~~~~~
+
+.. code:: python
+
+	mappy.fastx_read(fn, read_comment=False)
+
+This generator function opens a FASTA/FASTQ file and *yields* a
+:code:`(name,seq,qual)` tuple for each sequence entry. The input file may be
+optionally gzip'd. If :code:`read_comment` is True, this generator yields
+a :code:`(name,seq,qual,comment)` tuple instead.
+
+.. code:: python
+
+	mappy.revcomp(seq)
+
+Return the reverse complement of DNA string :code:`seq`. This function
+recognizes IUB code and preserves the letter cases. Uracil :code:`U` is
+complemented to :code:`A`.

python/cmappy.h

@@ -0,0 +1,140 @@
+#ifndef CMAPPY_H
+#define CMAPPY_H
+
+#include <stdlib.h>
+#include <string.h>
+#include <zlib.h>
+#include "minimap.h"
+#include "kseq.h"
+KSEQ_DECLARE(gzFile)
+
+typedef struct {
+	const char *ctg;
+	int32_t ctg_start, ctg_end;
+	int32_t qry_start, qry_end;
+	int32_t blen, mlen, NM, ctg_len;
+	uint8_t mapq, is_primary;
+	int8_t strand, trans_strand;
+	int32_t seg_id;
+	int32_t n_cigar32;
+	uint32_t *cigar32;
+} mm_hitpy_t;
+
+static inline void mm_reg2hitpy(const mm_idx_t *mi, mm_reg1_t *r, mm_hitpy_t *h)
+{
+	h->ctg = mi->seq[r->rid].name;
+	h->ctg_len = mi->seq[r->rid].len;
+	h->ctg_start = r->rs, h->ctg_end = r->re;
+	h->qry_start = r->qs, h->qry_end = r->qe;
+	h->strand = r->rev? -1 : 1;
+	h->mapq = r->mapq;
+	h->mlen = r->mlen;
+	h->blen = r->blen;
+	h->NM = r->blen - r->mlen + r->p->n_ambi;
+	h->trans_strand = r->p->trans_strand == 1? 1 : r->p->trans_strand == 2? -1 : 0;
+	h->is_primary = (r->id == r->parent);
+	h->seg_id = r->seg_id;
+	h->n_cigar32 = r->p->n_cigar;
+	h->cigar32 = r->p->cigar;
+}
+
+static inline void mm_free_reg1(mm_reg1_t *r)
+{
+	free(r->p);
+}
+
+static inline kseq_t *mm_fastx_open(const char *fn)
+{
+	gzFile fp;
+	fp = fn && strcmp(fn, "-") != 0? gzopen(fn, "r") : gzdopen(fileno(stdin), "r");
+	return kseq_init(fp);
+}
+
+static inline void mm_fastx_close(kseq_t *ks)
+{
+	gzFile fp;
+	fp = ks->f->f;
+	kseq_destroy(ks);
+	gzclose(fp);
+}
+
+static inline int mm_verbose_level(int v)
+{
+	if (v >= 0) mm_verbose = v;
+	return mm_verbose;
+}
+
+static inline void mm_reset_timer(void)
+{
+	extern double realtime(void);
+	mm_realtime0 = realtime();
+}
+
+extern unsigned char seq_comp_table[256];
+static inline mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char *seq1, const char *seq2, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt)
+{
+	mm_reg1_t *r;
+
+	Py_BEGIN_ALLOW_THREADS
+	if (seq2 == 0) {
+		r = mm_map(mi, strlen(seq1), seq1, n_regs, b, opt, NULL);
+	} else {
+		int _n_regs[2];
+		mm_reg1_t *regs[2];
+		char *seq[2];
+		int i, len[2];
+
+		len[0] = strlen(seq1);
+		len[1] = strlen(seq2);
+		seq[0] = (char*)seq1;
+		seq[1] = strdup(seq2);
+		for (i = 0; i < len[1]>>1; ++i) {
+			int t = seq[1][len[1] - i - 1];
+			seq[1][len[1] - i - 1] = seq_comp_table[(uint8_t)seq[1][i]];
+			seq[1][i] = seq_comp_table[t];
+		}
+		if (len[1]&1) seq[1][len[1]>>1] = seq_comp_table[(uint8_t)seq[1][len[1]>>1]];
+		mm_map_frag(mi, 2, len, (const char**)seq, _n_regs, regs, b, opt, NULL);
+		for (i = 0; i < _n_regs[1]; ++i)
+			regs[1][i].rev = !regs[1][i].rev;
+		*n_regs = _n_regs[0] + _n_regs[1];
+		regs[0] = (mm_reg1_t*)realloc(regs[0], sizeof(mm_reg1_t) * (*n_regs));
+		memcpy(&regs[0][_n_regs[0]], regs[1], _n_regs[1] * sizeof(mm_reg1_t));
+		free(regs[1]);
+		r = regs[0];
+	}
+	Py_END_ALLOW_THREADS
+
+	return r;
+}
+
+static inline char *mappy_revcomp(int len, const uint8_t *seq)
+{
+	int i;
+	char *rev;
+	rev = (char*)malloc(len + 1);
+	for (i = 0; i < len; ++i)
+		rev[len - i - 1] = seq_comp_table[seq[i]];
+	rev[len] = 0;
+	return rev;
+}
+
+static char *mappy_fetch_seq(const mm_idx_t *mi, const char *name, int st, int en, int *len)
+{
+	int i, rid;
+	char *s;
+	*len = 0;
+	rid = mm_idx_name2id(mi, name);
+	if (rid < 0) return 0;
+	if (st >= mi->seq[rid].len || st >= en) return 0;
+	if (en < 0 || en > mi->seq[rid].len)
+		en = mi->seq[rid].len;
+	s = (char*)malloc(en - st + 1);
+	*len = mm_idx_getseq(mi, rid, st, en, (uint8_t*)s);
+	for (i = 0; i < *len; ++i)
+		s[i] = "ACGTN"[(uint8_t)s[i]];
+	s[*len] = 0;
+	return s;
+}
+
+#endif

python/cmappy.pxd

@@ -0,0 +1,128 @@
+from libc.stdint cimport int8_t, uint8_t, int32_t, int64_t, uint32_t, uint64_t
+
+cdef extern from "minimap.h":
+	#
+	# Options
+	#
+	ctypedef struct mm_idxopt_t:
+		short k, w, flag, bucket_bits
+		int mini_batch_size
+		uint64_t batch_size
+
+	ctypedef struct mm_mapopt_t:
+		int seed
+		int sdust_thres
+		int flag
+		int bw
+		int max_gap, max_gap_ref
+		int max_frag_len
+		int max_chain_skip
+		int min_cnt
+		int min_chain_score
+		float mask_level
+		float pri_ratio
+		int best_n
+		int max_join_long, max_join_short
+		int min_join_flank_sc
+		float min_join_flank_ratio;
+		int a, b, q, e, q2, e2
+		int sc_ambi
+		int noncan
+		int zdrop, zdrop_inv
+		int end_bonus
+		int min_dp_max
+		int min_ksw_len
+		int anchor_ext_len, anchor_ext_shift
+		float max_clip_ratio
+		int pe_ori, pe_bonus
+		float mid_occ_frac
+		int32_t min_mid_occ
+		int32_t mid_occ
+		int32_t max_occ
+		int mini_batch_size
+
+	int mm_set_opt(char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
+	int mm_verbose
+
+	#
+	# Indexing
+	#
+	ctypedef struct mm_idx_seq_t:
+		char *name
+		uint64_t offset
+		uint32_t len
+
+	ctypedef struct mm_idx_bucket_t:
+		pass
+
+	ctypedef struct mm_idx_t:
+		int32_t b, w, k, flag
+		uint32_t n_seq
+		mm_idx_seq_t *seq
+		uint32_t *S
+		mm_idx_bucket_t *B
+		void *km
+		void *h
+
+	ctypedef struct mm_idx_reader_t:
+		pass
+
+	mm_idx_reader_t *mm_idx_reader_open(const char *fn, const mm_idxopt_t *opt, const char *fn_out)
+	mm_idx_t *mm_idx_reader_read(mm_idx_reader_t *r, int n_threads)
+	void mm_idx_reader_close(mm_idx_reader_t *r)
+	void mm_idx_destroy(mm_idx_t *mi)
+	void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
+
+	int mm_idx_index_name(mm_idx_t *mi)
+
+	#
+	# Mapping (key struct defined in cmappy.h below)
+	#
+	ctypedef struct mm_reg1_t:
+		pass
+
+	ctypedef struct mm_tbuf_t:
+		pass
+
+	mm_tbuf_t *mm_tbuf_init()
+	void mm_tbuf_destroy(mm_tbuf_t *b)
+
+#
+# Helper header (because it is hard to expose mm_reg1_t with Cython)
+#
+cdef extern from "cmappy.h":
+	ctypedef struct mm_hitpy_t:
+		const char *ctg
+		int32_t ctg_start, ctg_end
+		int32_t qry_start, qry_end
+		int32_t blen, mlen, NM, ctg_len
+		uint8_t mapq, is_primary
+		int8_t strand, trans_strand
+		int32_t seg_id
+		int32_t n_cigar32
+		uint32_t *cigar32
+
+	void mm_reg2hitpy(const mm_idx_t *mi, mm_reg1_t *r, mm_hitpy_t *h)
+	void mm_free_reg1(mm_reg1_t *r)
+	mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char *seq1, const char *seq2, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt)
+	char *mappy_fetch_seq(const mm_idx_t *mi, const char *name, int st, int en, int *l)
+
+	ctypedef struct kstring_t:
+		unsigned l, m
+		char *s
+
+	ctypedef struct kstream_t:
+		pass
+
+	ctypedef struct kseq_t:
+		kstring_t name, comment, seq, qual
+		int last_char
+		kstream_t *f
+
+	kseq_t *mm_fastx_open(const char *fn)
+	void mm_fastx_close(kseq_t *ks)
+	int kseq_read(kseq_t *seq)
+
+	char *mappy_revcomp(int l, const uint8_t *seq)
+	int mm_verbose_level(int v)
+	void mm_reset_timer()

python/mappy.pyx

@@ -0,0 +1,212 @@
+from libc.stdint cimport uint8_t, int8_t
+from libc.stdlib cimport free
+cimport cmappy
+import sys
+
+__version__ = '2.11'
+
+cmappy.mm_reset_timer()
+
+cdef class Alignment:
+	cdef int _ctg_len, _r_st, _r_en
+	cdef int _q_st, _q_en
+	cdef int _NM, _mlen, _blen
+	cdef int8_t _strand, _trans_strand
+	cdef uint8_t _mapq, _is_primary
+	cdef int _seg_id
+	cdef _ctg, _cigar # these are python objects
+
+	def __cinit__(self, ctg, cl, cs, ce, strand, qs, qe, mapq, cigar, is_primary, mlen, blen, NM, trans_strand, seg_id):
+		self._ctg = ctg if isinstance(ctg, str) else ctg.decode()
+		self._ctg_len, self._r_st, self._r_en = cl, cs, ce
+		self._strand, self._q_st, self._q_en = strand, qs, qe
+		self._NM, self._mlen, self._blen = NM, mlen, blen
+		self._mapq = mapq
+		self._cigar = cigar
+		self._is_primary = is_primary
+		self._trans_strand = trans_strand
+		self._seg_id = seg_id
+
+	@property
+	def ctg(self): return self._ctg
+
+	@property
+	def ctg_len(self): return self._ctg_len
+
+	@property
+	def r_st(self): return self._r_st
+
+	@property
+	def r_en(self): return self._r_en
+
+	@property
+	def strand(self): return self._strand
+
+	@property
+	def trans_strand(self): return self._trans_strand
+
+	@property
+	def blen(self): return self._blen
+
+	@property
+	def mlen(self): return self._mlen
+
+	@property
+	def NM(self): return self._NM
+
+	@property
+	def is_primary(self): return (self._is_primary != 0)
+
+	@property
+	def q_st(self): return self._q_st
+
+	@property
+	def q_en(self): return self._q_en
+
+	@property
+	def mapq(self): return self._mapq
+
+	@property
+	def cigar(self): return self._cigar
+
+	@property
+	def read_num(self): return self._seg_id + 1
+
+	@property
+	def cigar_str(self):
+		return "".join(map(lambda x: str(x[0]) + 'MIDNSH'[x[1]], self._cigar))
+
+	def __str__(self):
+		if self._strand > 0: strand = '+'
+		elif self._strand < 0: strand = '-'
+		else: strand = '?'
+		if self._is_primary != 0: tp = 'tp:A:P'
+		else: tp = 'tp:A:S'
+		if self._trans_strand > 0: ts = 'ts:A:+'
+		elif self._trans_strand < 0: ts = 'ts:A:-'
+		else: ts = 'ts:A:.'
+		return "\t".join([str(self._q_st), str(self._q_en), strand, self._ctg, str(self._ctg_len), str(self._r_st), str(self._r_en),
+				str(self._mlen), str(self._blen), str(self._mapq), tp, ts, "cg:Z:" + self.cigar_str])
+
+cdef class ThreadBuffer:
+	cdef cmappy.mm_tbuf_t *_b
+
+	def __cinit__(self):
+		self._b = cmappy.mm_tbuf_init()
+
+	def __dealloc__(self):
+		cmappy.mm_tbuf_destroy(self._b)
+
+cdef class Aligner:
+	cdef cmappy.mm_idx_t *_idx
+	cdef cmappy.mm_idxopt_t idx_opt
+	cdef cmappy.mm_mapopt_t map_opt
+
+	def __cinit__(self, fn_idx_in, preset=None, k=None, w=None, min_cnt=None, min_chain_score=None, min_dp_score=None, bw=None, best_n=None, n_threads=3, fn_idx_out=None, max_frag_len=None):
+		cmappy.mm_set_opt(NULL, &self.idx_opt, &self.map_opt) # set the default options
+		if preset is not None:
+			cmappy.mm_set_opt(str.encode(preset), &self.idx_opt, &self.map_opt) # apply preset
+		self.map_opt.flag |= 4 # always perform alignment
+		self.idx_opt.batch_size = 0x7fffffffffffffffL # always build a uni-part index
+		if k is not None: self.idx_opt.k = k
+		if w is not None: self.idx_opt.w = w
+		if min_cnt is not None: self.map_opt.min_cnt = min_cnt
+		if min_chain_score is not None: self.map_opt.min_chain_score = min_chain_score
+		if min_dp_score is not None: self.map_opt.min_dp_max = min_dp_score
+		if bw is not None: self.map_opt.bw = bw
+		if best_n is not None: self.map_opt.best_n = best_n
+		if max_frag_len is not None: self.map_opt.max_frag_len = max_frag_len
+
+		cdef cmappy.mm_idx_reader_t *r;
+		if fn_idx_out is None:
+			r = cmappy.mm_idx_reader_open(str.encode(fn_idx_in), &self.idx_opt, NULL)
+		else:
+			r = cmappy.mm_idx_reader_open(str.encode(fn_idx_in), &self.idx_opt, fn_idx_out)
+		if r is not NULL:
+			self._idx = cmappy.mm_idx_reader_read(r, n_threads) # NB: ONLY read the first part
+			cmappy.mm_idx_reader_close(r)
+			cmappy.mm_mapopt_update(&self.map_opt, self._idx)
+			cmappy.mm_idx_index_name(self._idx)
+
+	def __dealloc__(self):
+		if self._idx is not NULL:
+			cmappy.mm_idx_destroy(self._idx)
+
+	def __bool__(self):
+		return (self._idx != NULL)
+
+	def map(self, seq, seq2=None, buf=None, max_frag_len=None):
+		cdef cmappy.mm_reg1_t *regs
+		cdef cmappy.mm_hitpy_t h
+		cdef ThreadBuffer b
+		cdef int n_regs
+		cdef cmappy.mm_mapopt_t map_opt
+		map_opt = self.map_opt
+		if max_frag_len is not None: map_opt.max_frag_len = max_frag_len
+
+		if self._idx is NULL: return None
+		if buf is None: b = ThreadBuffer()
+		else: b = buf
+
+		_seq = seq if isinstance(seq, bytes) else seq.encode()
+		if seq2 is None:
+			regs = cmappy.mm_map_aux(self._idx, _seq, NULL,  &n_regs, b._b, &map_opt)
+		else:
+			_seq2 = seq2 if isinstance(seq2, bytes) else seq2.encode()
+			regs = cmappy.mm_map_aux(self._idx, _seq, _seq2, &n_regs, b._b, &map_opt)
+
+		for i in range(n_regs):
+			cmappy.mm_reg2hitpy(self._idx, &regs[i], &h)
+			cigar = []
+			for k in range(h.n_cigar32):
+				c = h.cigar32[k]
+				cigar.append([c>>4, c&0xf])
+			yield Alignment(h.ctg, h.ctg_len, h.ctg_start, h.ctg_end, h.strand, h.qry_start, h.qry_end, h.mapq, cigar, h.is_primary, h.mlen, h.blen, h.NM, h.trans_strand, h.seg_id)
+			cmappy.mm_free_reg1(&regs[i])
+		free(regs)
+
+	def seq(self, str name, int start=0, int end=0x7fffffff):
+		cdef int l
+		cdef char *s = cmappy.mappy_fetch_seq(self._idx, name.encode(), start, end, &l)
+		if l == 0: return None
+		r = s[:l] if isinstance(s, str) else s[:l].decode()
+		free(s)
+		return r
+
+	@property
+	def k(self): return self._idx.k
+
+	@property
+	def w(self): return self._idx.w
+
+	@property
+	def n_seq(self): return self._idx.n_seq
+
+def fastx_read(fn, read_comment=False):
+	cdef cmappy.kseq_t *ks
+	ks = cmappy.mm_fastx_open(str.encode(fn))
+	if ks is NULL: return None
+	while cmappy.kseq_read(ks) >= 0:
+		if ks.qual.l > 0: qual = ks.qual.s if isinstance(ks.qual.s, str) else ks.qual.s.decode()
+		else: qual = None
+		name = ks.name.s if isinstance(ks.name.s, str) else ks.name.s.decode()
+		seq = ks.seq.s if isinstance(ks.seq.s, str) else ks.seq.s.decode()
+		if read_comment:
+			if ks.comment.l > 0: comment = ks.comment.s if isinstance(ks.comment.s, str) else ks.comment.s.decode()
+			else: comment = None
+			yield name, seq, qual, comment
+		else:
+			yield name, seq, qual
+	cmappy.mm_fastx_close(ks)
+
+def revcomp(seq):
+	l = len(seq)
+	bseq = seq if isinstance(seq, bytes) else seq.encode()
+	cdef char *s = cmappy.mappy_revcomp(l, bseq)
+	r = s[:l] if isinstance(s, str) else s[:l].decode()
+	free(s)
+	return r
+
+def verbose(v=None):
+	if v is None: v = -1
+	return cmappy.mm_verbose_level(v)

python/minimap2.py

@@ -0,0 +1,35 @@
+#!/usr/bin/env python
+
+import sys, getopt
+import mappy as mp
+
+def main(argv):
+	opts, args = getopt.getopt(argv[1:], "x:n:m:k:w:r:")
+	if len(args) < 2:
+		print("Usage: minimap2.py [options] <ref.fa>|<ref.mmi> <query.fq>")
+		print("Options:")
+		print("  -x STR      preset: sr, map-pb, map-ont, asm5, asm10 or splice")
+		print("  -n INT      mininum number of minimizers")
+		print("  -m INT      mininum chaining score")
+		print("  -k INT      k-mer length")
+		print("  -w INT      minimizer window length")
+		print("  -r INT      band width")
+		sys.exit(1)
+
+	preset, min_cnt, min_sc, k, w, bw = None, None, None, None, None, None
+	for opt, arg in opts:
+		if opt == '-x': preset = arg
+		elif opt == '-n': min_cnt = int(arg)
+		elif opt == '-m': min_chain_score = int(arg)
+		elif opt == '-r': bw = int(arg)
+		elif opt == '-k': k = int(arg)
+		elif opt == '-w': w = int(arg)
+
+	a = mp.Aligner(args[0], preset=preset, min_cnt=min_cnt, min_chain_score=min_sc, k=k, w=w, bw=bw)
+	if not a: raise Exception("ERROR: failed to load/build index file '{}'".format(args[0]))
+	for name, seq, qual in mp.fastx_read(args[1]): # read one sequence
+		for h in a.map(seq): # traverse hits
+			print('{}\t{}\t{}'.format(name, len(seq), h))
+
+if __name__ == "__main__":
+	main(sys.argv)

sdust.c

@@ -56,6 +56,7 @@ sdust_buf_t *sdust_buf_init(void *km)
 	buf = (sdust_buf_t*)kcalloc(km, 1, sizeof(sdust_buf_t));
 	buf->km = km;
 	buf->w = kdq_init(int, buf->km);
+	kdq_resize(int, buf->w, 8);
 	return buf;
 }
 
@@ -69,10 +70,10 @@ void sdust_buf_destroy(sdust_buf_t *buf)
 static inline void shift_window(int t, kdq_t(int) *w, int T, int W, int *L, int *rw, int *rv, int *cw, int *cv)
 {
 	int s;
-	if (kdq_size(w) >= W - SD_WLEN + 1) { // TODO: is this right for SD_WLEN!=3?
+	if ((int)kdq_size(w) >= W - SD_WLEN + 1) { // TODO: is this right for SD_WLEN!=3?
 		s = *kdq_shift(int, w);
 		*rw -= --cw[s];
-		if (*L > kdq_size(w))
+		if (*L > (int)kdq_size(w))
 			--*L, *rv -= --cv[s];
 	}
 	kdq_push(int, w, t);
@@ -113,7 +114,7 @@ static void find_perfect(void *km, perf_intv_v *P, const kdq_t(int) *w, int T, i
 		r += c[t]++;
 		new_r = r, new_l = kdq_size(w) - i - 1;
 		if (new_r * 10 > T * new_l) {
-			for (j = 0; j < P->n && P->a[j].start >= i + start; ++j) { // find insertion position
+			for (j = 0; j < (int)P->n && P->a[j].start >= i + start; ++j) { // find insertion position
 				perf_intv_t *p = &P->a[j];
 				if (max_r == 0 || p->r * max_l > max_r * p->l)
 					max_r = p->r, max_l = p->l;
@@ -176,7 +177,7 @@ uint64_t *sdust(void *km, const uint8_t *seq, int l_seq, int T, int W, int *n)
 #ifdef _SDUST_MAIN
 #include <zlib.h>
 #include <stdio.h>
-#include <unistd.h>
+#include "getopt.h"
 #include "kseq.h"
 KSEQ_INIT(gzFile, gzread)
 

setup.py

@@ -0,0 +1,55 @@
+try:
+	from setuptools import setup, Extension
+except ImportError:
+	from distutils.core import setup
+	from distutils.extension import Extension
+
+cmdclass = {}
+
+try:
+	from Cython.Build import build_ext
+except ImportError: # without Cython
+	module_src = 'python/mappy.c'
+else: # with Cython
+	module_src = 'python/mappy.pyx'
+	cmdclass['build_ext'] = build_ext
+
+import sys
+sys.path.append('python')
+
+def readme():
+    with open('python/README.rst') as f:
+        return f.read()
+
+setup(
+	name = 'mappy',
+	version = '2.11',
+	url = 'https://github.com/lh3/minimap2',
+	description = 'Minimap2 python binding',
+	long_description = readme(),
+	author = 'Heng Li',
+	author_email = 'lh3@me.com',
+	license = 'MIT',
+	keywords = 'sequence-alignment',
+	scripts = ['python/minimap2.py'],
+    ext_modules = [Extension('mappy',
+		sources = [module_src, 'align.c', 'bseq.c', 'chain.c', 'format.c', 'hit.c', 'index.c', 'pe.c', 'options.c',
+				   'ksw2_extd2_sse.c', 'ksw2_exts2_sse.c', 'ksw2_extz2_sse.c', 'ksw2_ll_sse.c',
+				   'kalloc.c', 'kthread.c', 'map.c', 'misc.c', 'sdust.c', 'sketch.c', 'esterr.c'],
+		depends = ['minimap.h', 'bseq.h', 'kalloc.h', 'kdq.h', 'khash.h', 'kseq.h', 'ksort.h',
+				   'ksw2.h', 'kthread.h', 'kvec.h', 'mmpriv.h', 'sdust.h',
+				   'python/cmappy.h', 'python/cmappy.pxd'],
+		extra_compile_args = ['-DHAVE_KALLOC', '-msse4.1'], # WARNING: ancient x86_64 CPUs don't have SSE4
+		include_dirs = ['.'],
+		libraries = ['z', 'm', 'pthread'])],
+	classifiers = [
+		'Development Status :: 5 - Production/Stable',
+		'License :: OSI Approved :: MIT License',
+		'Operating System :: POSIX',
+		'Programming Language :: C',
+		'Programming Language :: Cython',
+		'Programming Language :: Python :: 2.7',
+		'Programming Language :: Python :: 3',
+		'Intended Audience :: Science/Research',
+		'Topic :: Scientific/Engineering :: Bio-Informatics'],
+	cmdclass = cmdclass)

sketch.c

@@ -2,8 +2,9 @@
 #include <stdlib.h>
 #include <assert.h>
 #include <string.h>
+#define __STDC_LIMIT_MACROS
 #include "kvec.h"
-#include "minimap.h"
+#include "mmpriv.h"
 
 unsigned char seq_nt4_table[256] = {
 	0, 1, 2, 3,  4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4,
@@ -11,9 +12,9 @@ unsigned char seq_nt4_table[256] = {
 	4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4,
 	4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4,
 	4, 0, 4, 1,  4, 4, 4, 2,  4, 4, 4, 4,  4, 4, 4, 4,
-	4, 4, 4, 4,  3, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4, 
+	4, 4, 4, 4,  3, 3, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4,
 	4, 0, 4, 1,  4, 4, 4, 2,  4, 4, 4, 4,  4, 4, 4, 4,
-	4, 4, 4, 4,  3, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4, 
+	4, 4, 4, 4,  3, 3, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4,
 	4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4,
 	4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4,
 	4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4,
@@ -77,11 +78,10 @@ void mm_sketch(void *km, const char *str, int len, int w, int k, uint32_t rid, i
 {
 	uint64_t shift1 = 2 * (k - 1), mask = (1ULL<<2*k) - 1, kmer[2] = {0,0};
 	int i, j, l, buf_pos, min_pos, kmer_span = 0;
-	mm128_t *buf, min = { UINT64_MAX, UINT64_MAX };
+	mm128_t buf[256], min = { UINT64_MAX, UINT64_MAX };
 	tiny_queue_t tq;
 
-	assert(len > 0 && w > 0 && k > 0 && k <= 28); // 56 bits for k-mer; could use long k-mers, but 28 enough in practice
+	assert(len > 0 && (w > 0 && w < 256) && (k > 0 && k <= 28)); // 56 bits for k-mer; could use long k-mers, but 28 enough in practice
-	buf = (mm128_t*)alloca(w * 16);
 	memset(buf, 0xff, w * 16);
 	memset(&tq, 0, sizeof(tiny_queue_t));
 	kv_resize(mm128_t, km, *p, p->n + len/w);
@@ -102,34 +102,34 @@ void mm_sketch(void *km, const char *str, int len, int w, int k, uint32_t rid, i
 				tq_push(&tq, skip_len);
 				kmer_span += skip_len;
 				if (tq.count > k) kmer_span -= tq_shift(&tq);
-				if (kmer_span >= 256) continue; // make sure $kmer_span does not take more than 8 bits
 			} else kmer_span = l + 1 < k? l + 1 : k;
 			kmer[0] = (kmer[0] << 2 | c) & mask;           // forward k-mer
 			kmer[1] = (kmer[1] >> 2) | (3ULL^c) << shift1; // reverse k-mer
 			if (kmer[0] == kmer[1]) continue; // skip "symmetric k-mers" as we don't know it strand
 			z = kmer[0] < kmer[1]? 0 : 1; // strand
-			if (++l >= k) {
+			++l;
+			if (l >= k && kmer_span < 256) {
 				info.x = hash64(kmer[z], mask) << 8 | kmer_span;
 				info.y = (uint64_t)rid<<32 | (uint32_t)i<<1 | z;
 			}
 		} else l = 0, tq.count = tq.front = 0, kmer_span = 0;
 		buf[buf_pos] = info; // need to do this here as appropriate buf_pos and buf[buf_pos] are needed below
-		if (l == w + k - 1) { // special case for the first window - because identical k-mers are not stored yet
+		if (l == w + k - 1 && min.x != UINT64_MAX) { // special case for the first window - because identical k-mers are not stored yet
 			for (j = buf_pos + 1; j < w; ++j)
 				if (min.x == buf[j].x && buf[j].y != min.y) kv_push(mm128_t, km, *p, buf[j]);
 			for (j = 0; j < buf_pos; ++j)
 				if (min.x == buf[j].x && buf[j].y != min.y) kv_push(mm128_t, km, *p, buf[j]);
 		}
 		if (info.x <= min.x) { // a new minimum; then write the old min
-			if (l >= w + k) kv_push(mm128_t, km, *p, min);
+			if (l >= w + k && min.x != UINT64_MAX) kv_push(mm128_t, km, *p, min);
 			min = info, min_pos = buf_pos;
 		} else if (buf_pos == min_pos) { // old min has moved outside the window
-			if (l >= w + k - 1) kv_push(mm128_t, km, *p, min);
+			if (l >= w + k - 1 && min.x != UINT64_MAX) kv_push(mm128_t, km, *p, min);
 			for (j = buf_pos + 1, min.x = UINT64_MAX; j < w; ++j) // the two loops are necessary when there are identical k-mers
 				if (min.x >= buf[j].x) min = buf[j], min_pos = j; // >= is important s.t. min is always the closest k-mer
 			for (j = 0; j <= buf_pos; ++j)
 				if (min.x >= buf[j].x) min = buf[j], min_pos = j;
-			if (l >= w + k - 1) { // write identical k-mers
+			if (l >= w + k - 1 && min.x != UINT64_MAX) { // write identical k-mers
 				for (j = buf_pos + 1; j < w; ++j) // these two loops make sure the output is sorted
 					if (min.x == buf[j].x && min.y != buf[j].y) kv_push(mm128_t, km, *p, buf[j]);
 				for (j = 0; j <= buf_pos; ++j)

splitidx.c

@@ -0,0 +1,80 @@
+#include <string.h>
+#include <assert.h>
+#include <stdlib.h>
+#include <stdio.h>
+#include "mmpriv.h"
+
+FILE *mm_split_init(const char *prefix, const mm_idx_t *mi)
+{
+	char *fn;
+	FILE *fp;
+	uint32_t i, k = mi->k;
+	fn = (char*)calloc(strlen(prefix) + 10, 1);
+	sprintf(fn, "%s.%.4d.tmp", prefix, mi->index);
+	fp = fopen(fn, "wb");
+	assert(fp);
+	mm_err_fwrite(&k, 4, 1, fp);
+	mm_err_fwrite(&mi->n_seq, 4, 1, fp);
+	for (i = 0; i < mi->n_seq; ++i) {
+		uint8_t l;
+		l = strlen(mi->seq[i].name);
+		mm_err_fwrite(&l, 1, 1, fp);
+		mm_err_fwrite(mi->seq[i].name, 1, l, fp);
+		mm_err_fwrite(&mi->seq[i].len, 4, 1, fp);
+	}
+	free(fn);
+	return fp;
+}
+
+mm_idx_t *mm_split_merge_prep(const char *prefix, int n_splits, FILE **fp, uint32_t *n_seq_part)
+{
+	mm_idx_t *mi = 0;
+	char *fn;
+	int i, j;
+
+	if (n_splits < 1) return 0;
+	fn = CALLOC(char, strlen(prefix) + 10);
+	for (i = 0; i < n_splits; ++i) {
+		sprintf(fn, "%s.%.4d.tmp", prefix, i);
+		if ((fp[i] = fopen(fn, "rb")) == 0) {
+			if (mm_verbose >= 1)
+				fprintf(stderr, "ERROR: failed to open temporary file '%s'\n", fn);
+			for (j = 0; j < i; ++j)
+				fclose(fp[j]);
+			free(fn);
+			return 0;
+		}
+	}
+	free(fn);
+
+	mi = CALLOC(mm_idx_t, 1);
+	for (i = 0; i < n_splits; ++i) {
+		mm_err_fread(&mi->k, 4, 1, fp[i]); // TODO: check if k is all the same
+		mm_err_fread(&n_seq_part[i], 4, 1, fp[i]);
+		mi->n_seq += n_seq_part[i];
+	}
+	mi->seq = CALLOC(mm_idx_seq_t, mi->n_seq);
+	for (i = j = 0; i < n_splits; ++i) {
+		uint32_t k;
+		for (k = 0; k < n_seq_part[i]; ++k, ++j) {
+			uint8_t l;
+			mm_err_fread(&l, 1, 1, fp[i]);
+			mi->seq[j].name = (char*)calloc(l + 1, 1);
+			mm_err_fread(mi->seq[j].name, 1, l, fp[i]);
+			mm_err_fread(&mi->seq[j].len, 4, 1, fp[i]);
+		}
+	}
+	return mi;
+}
+
+void mm_split_rm_tmp(const char *prefix, int n_splits)
+{
+	int i;
+	char *fn;
+	fn = CALLOC(char, strlen(prefix) + 10);
+	for (i = 0; i < n_splits; ++i) {
+		sprintf(fn, "%s.%.4d.tmp", prefix, i);
+		remove(fn);
+	}
+	free(fn);
+}

test/MT-orang.fa

@@ -1,4 +1,4 @@
->MT_orang
+>MT_orang co:Z:comment
 GTTTATGTAGCTTATTCTATCCAAAGCAATGCACTGAAAATGTCTCGACGGGCCCACACG
 CCCCATAAACAAATAGGTTTGGTCCTAGCCTTTCTATTAGCTCTTAGTGAGGTTACACAT
 GCAAGCATCCCCGCCCCAGTGAGTCGCCCTCCAAGTCACTCTGACTAAGAGGAGCAAGCA

test/q2.fa

@@ -0,0 +1,2 @@
+>q2
+GGACATCCCGATGGTGCAGTCCTACCTGTACGAAAGGAC

test/t-inv.fa

@@ -0,0 +1,127 @@
+>ref
+TGCGGAGGCTGAAGCAACTCCATCTTGGAAGCTAATCTACCATGTTGGCTTCTGATTAAC
+ATCAGTTCTGGGAAGGCTTGTAAGATTTCCTGTTTGTCTATTATTTCCTAGGTAAGAGCA
+GATACTTACTGTAAATCCTGCCCCTAGATTAAACAACCTTGGTGTTATCGTACTTCCATT
+GTCCTATACATCCCTTCGGAATCCCCCTTTCCCTATGGTCCTCAAGCCCTTGGTCTGGGG
+AGTAACAGCATAGGGATCAACCATCTCGTCTTGCCACTGCCCGAAATACAGACATGGCTT
+CTGTTCCTAAGTCCCTATTCAACTTTTCTTTCTAAGAAACTGGATTTGTCAGCCTCTTTC
+TTCACCTCTCAGCTTCCTTGGACTTTGGGGGTAGGTTTGCGTAGACATGCTCACCACAGA
+CACAATATCAGCTTCATTCTACAGATGAGGAAGGCAAGCCTTGGGGAGCTTAACCAACTT
+GTCGAGACTCATGTATATACCAACACTGAAAAGCAGATATTCCAGACTCCCAGTCATGCC
+ACAGGCACACCCCTCAGTGAGAGGTGGGGTTTGTAGTTGAGGCTATTTCCTGCCCAGGGA
+GCAGGGAGGCACTCTAGCTTCCCTGAGCTAACGTGGTTCTGCTTGTGTCTGACTTCCAGG
+TCTCTGCCCTTTCCAAGCTCACTAGGATGGGCTTCGGGTGTGTCAAATGCCTCAGACAGT
+ACAGATCCACACAGAATGGGCATATGCAACCAATCAGTGTCATAAAAAAGAAGGAAATGA
+CTCGGGCCCCCTGTGTGTTCAACATGTCGAAGGTATCTGTGCAGCAGAAGAAAGAGGGGC
+AAAAGCCCCCAGTGCCACAGGCCAGAGGCAGCAGCTTGGGCCCATGTGGGAGGGTTTGCT
+TTCCCCTGCCAAAGTGATGGGCTGCTGCAGCCTGGGGCTTGTGGGAATCCTTCCTGGGCC
+TGTGTGGGAAGTGTAGGCAGGGAGAGTGCTGCTTTCCCAAGCTCATCCCAGCTACAGCTA
+CCTTTGTGCTCTGGGATTCAGGACCCCCGAGGGGGCTGGCAGGAGAGTCTCTGTTCTCGG
+ATGGGTTGTCACCAGGGCATACATGGGAAGTGGGCTCTCTGGAGTCACCCTCCAGGGGAC
+AATGCCAATTCCAGACACATTTACTGGAACCCCTACACTGATGACCTTTTGTTGAGGGTT
+GAATTATGTCCCCAAAAAAGATACATTGAAGTCCAAACCTCTGGTGTCTATAAATGTGAT
+TTTATTTGAAAATGAGGTTTCTATGGACTAAATTGTGTCCCTCCCAAATTCATATTTTGA
+AGCCCTAGCCCCCAGTGTGACTATACCTAGAGACAGAGATCTTTAGGAGGTAATTAAGGT
+TCAATGAGGTCAGGTGGGTGGGGCCCTAAACCAACAGGAAGGACTGTGGCCTTACTAGAA
+AAGGAAGAAAAAGCATTTCCTCTCTTCTAGTATAAAAGGACACAGAAAGAAGGCAGATAT
+CTACAAGCCACGAAGAGAGACGTCACTGAGAACTGAATTTGTGTACATTGATCTGGAACT
+TCCAGCCTCCAGAACTTGAGAAATACATTTCTGTTGTTTATTTTTTTTTCATGTAATCAA
+TTCATTTATCATATATTTATTGAGTGCCTACTATGTGCCAGAGGATACAGCAGTAACAAA
+ACTAGGCAAAAATTGTGCCTAAAAGAGGGAAGATGACTTTTCTTAAAGTGTGGAATAAAG
+AAAAGTAAGATAGCGGATAGAAGCTTGAAGTGAAAGCAGGTTCACAGGAAGTTTCTTTGG
+TCATTTGTTTTGTTTTTAAATAGTGGAAAGATGTATATGTTTATGGAGAAAGATTGCCTT
+GAAGATGCAAGAGGAAGAGATGATCAAAATTCAAGAAGAAGCAGAAAGTGATAGAATAAA
+GAGCACAAGTGGAGAATTAGTGTTAATGAAAAGAAGGATGCTTCCTTTGATATGAAGTGA
+AGGAAGAGAGAATGAGTAAAGACCAAGACTTGAAGTCCCTAGTTTAATAGAGGGAGATTT
+CTTCTTTTGATAGCAACAATGGTATTCTGAATTATTTGAAGACATGTCATATTTCTCTTG
+TGCCATTTTCCTCCCAGTTTAAACATTCTCATAACCTCTATTCCTCACATGATGTTTTTC
+CAGGTCCTTTATTCTTTGGCACTCTCTTCTCTGGACACATTGTATTCTGTCATTGGTCCT
+AAAATTTAGATACCCACAATTGAACATACTCCTCTAGATATGGTCTAGCTAATGCAAAAG
+AACTGCTGCCTTCCAACTTGTTCAGACATCATATGTTTGTTGTCAAACGCTAAGTTGAGT
+TGTTATCTTTTAAGTTTTGTTTTTGTTTTTTTTTTTTTTTTTTAATTCCAAGAGGTGCCC
+ACGTTGGCTAAGTACCAAACAGGGTACTAGGGAATTTTACTTCTGAGTTAAATGCCATTC
+TAGTTGTTTTTTCTTCATCTCCAGTAAGGTTATCTTTATTCACCAGTTGTTACAATAGCT
+GTGGGTCTTGCTTCTCACAGTTTTATGCTGTCTGTGCTATTTTCTCTACTGATCATCACC
+ACAATCATTATTGCTTATCATAATTGTTATCTTTATTTTCTCCTTTAATCAAGAATCAGT
+CTTCCTTTATCTCATTATTCTCTTTTGCAGGCTTCAGGATAATTATGGTTGGAGTGCACT
+GGGGGAACCAGTGCAGCTAAGCTCTGACATCTTTGCATCCCTTTTCCATCTGCTGTTTTG
+GCACTCTGGTAGAATAGATAACCTAAAAACGACTTTAAAACATCTAGAAATTTTGGATAA
+AATATAACAAACATCCCTTTAAATGCACAACTGATCTTCCATGGAAGTCACAGAAATATA
+TAACGCCAAAAAGAAGGGAAGCTGAAACCCAGGGCTGTAAACATGAACATCATCTTCTCT
+CCCTTTTTCTTGTGACTTATCTTGTTTTTCTCAGCTTTGGTGCTACCAAGGCTTGACTTT
+AATAGGCATTTCCAATCAATGAGAGAATTTCTTTTGCTTTCATCAACAATTCAGTTATTG
+ATGTTAACATATATATCATTTGAGTACTTTTCTTTTTTTTATTATTATTATACTTTAAGT
+TTTAGGGTCCATGTGCACAATGTGCAGGTTAGTTACGTATGTATACATGTGCCATGCTGG
+TGTGCTGCACCCATTAACTCATCATTTAGCATTAGGTATATCTCCTAATGCTATCCCTTC
+CCCCTCTCCCCACCCCACAACAGTCCCCAGAGTGTTCCCCTTCCTGTGTCCATGTGTTCT
+CATTGTTCAATCCCCATCTATGAGTGAGAACATGCGGTGTTTGGTTTTTTGTCCTTGCAA
+TAGTTTACTGAGAATGATGATTTCTAATTTCATCCATGTCCCTAAAGAGCTTCTGCACAG
+CAAAAGAAACTACCATCAGAGTGAACAGGCAACCTACAAAATGGGAGAAAATTTTCACAA
+CCTGCTCATCTGACAAAGGGCTAATATCCAGAATCTACAATGAACTCAAACAAATTTACA
+AGAAAAAAACAAACAACCCCATCAAAAAGTGGGCAAAGGATATGAACAGACACTTCTCAA
+AAGAAGACATTTATGCAGCCAAAAGACACATGAAAAAATGCTCATCATCACTGGCCATCA
+GAGAAATGCAAACCAAAACCACAATGAGATACCATCTCACACCAGTTAAAATGGCAATCA
+TTAAAAAGTCAGGAAACAACAGGTGCTGGAGAGGATGTGGAGAAACAGGAACACTTTTAC
+ACTGTTGGTGGGACTGTAAACTAGTTCAACCATTGTGGAAGTCAGTGTGCTGATTCCTCA
+GGGATCTAGAACTAGAAATACCATTTGACCCAGCCATCCCATTACTGGGTATATACCCAA
+AGGACTATAAATCATGCTGCTATAAAGACACATGCACACGTATGTTTATTGCGGCACTAT
+TCACAATAGCAAAGACTTGGAACCAACCCAAATGTCCAACAATGATAGACTGGATTAAGA
+AAATGTGGCACATATACACCACGGAATACTGTGCAGCCATAAAAAATGATGAGTTCATGT
+CCTTTGTAGGGACACGGATGAAATTGGAAATCATTTCTGTTGTTTAAACCACGAAGTCTA
+TGGTATCTGGTTATGACAACCTGAGAATACTAACTCAAGGGTCTTTCGCAGATGTCATTA
+AGTTGTTAAAGTGAGGTCATTATGGTGGGTCCTAATCCAAGAGAAGAGATGCATGGACAG
+ACGTGCACAACGGGAGGACCAAGCCAAGACACACAGGGAGAATGGCCATGGGAAGATGGA
+GGCAGAGATCAAAGTGAGGCACCCACAAGCCAAGAAATGGCAGGAGCTACCAGCAGCTGG
+AAGATGCAGAGAAGCATTCCTTCTTAGAGGTTTCAGAGAGAGTATGGTGCTACTGACACC
+TTGATTTTGAACTTCTAGTCTCCAGAACTATGAGAGAATAAATTTCTGTTGGTTAAGCCA
+TCGAGTTTGTGTAAGTTTGTTATAAGAGCCCTAGGAAATAAACATATCCATTTATTCAGG
+AAAGCCTGCTAGAGTGCAAATATTTGGAAAAGATACTACTATGCAAATGTTTGAAAAAGA
+TATTGCTCTTGATTCTGCCTTATGGGTTTTTCATTTCTGTAAGCTATTCTCAAAGTTTTG
+TTCTTGGACTACTATTGGTAATTAAGACTGCAACATGTTTGGCAACATCAGTTGAGAACT
+GTTGCTCTGGGAACGTTTTCGGCAAGCCTCAGCCCTTCTTTTCCCTTGGCTTGCATTGAG
+GAGTTAGGTGATACTCTGCTGCTCAGGCCCAGCACCTTTATGGACCGTATTCCCCTGGTG
+GAATGACCATCTCTGCTTGCTCTGATTGGCTGTTGGGGTTTTCTAGCATGCCCTATTTAA
+TATGTATGATTTATCTCTTACTTCAGTTGGAAGGTACAGTTGCTCTGTAGTTGGCATGCA
+GTCATGGTGACTATGAAAATATAAAATAATGTTTTGGTTTACAGACACTTAGAAATAAGT
+TGTGTCTCAAAATTGGGTGACTATTCTAGTTATCTGCTACTCAATATCCTTGTGCGAGCC
+CTCTTTACCCAGAATCAAACTAAACCATGAGGGGCACTATAGAATGTCACCCCTGGGTCC
+AGGATACTATGGGGACTCAGAAGCCAAGCTCCCACTGGGGGATCTAGGGCATGCCCCCAA
+GGTAAGATTCCCACCTCTTTGTTCAGCAGGAAGCACCCATCACACAAGGAGGTAGGAATA
+AACAAGCATTCGTCAAGAACAAAAGATACAGATGTTCTGCTGGAGCTTGGATACATAGCA
+TAAGAGGGAACAGTTCTCACAGGTAAGAGTAAGTTTTCCTCTGGTGGTGACAGTGGGACC
+TGTGGGGGAGAGAATTGGGAGTACTGACAGGAAGGCAGAGTGGCTGTCCAAATGAACGGA
+TTGTTTGCACATGGCCTTTAGGGCACGTTGTGTTAGCCTTCCATTGCTGCTTATATTAGT
+CTGTTTTCACACTGCCCATAAATGCATACCTGAGACTGGATAATTTATAAAGAAAAAGAG
+CCTTAATGTACTCATAGTTGCATGTGGCTGGGGAGGCCTCACAATCATGGCAGAAGGTGA
+AAGGCACATCTTACATGGAAGCAGACAAGAGAGAATTGAGGACCAAGTGAAAGGGGTTTC
+CCCTTATAAAACCATCAGATCACATGAGACTTTTTCACCACCATGAGAACAGTAAGGGGA
+AAACTATGCTCATGATTCAATTGTCTCCCACTGGATTCCTCCCACAACACATAGGAATTA
+TGGGAGCTAAAATTCAAGATGAGATTTGGGTGAGGACACAGCCAAACCCTATCACTGCTG
+TAATCAATTCCCACCAACTTAGTGGCTCGAAACATCACAGATTTATGATCTTATGACGGT
+GGAGGTCCCCAAATGGATCTTCTAGGTCTAGAATCAAGGTATCAGCAGACCACTTCTTTT
+GGAGGCTCTGGTGGAGAAACCATTTCCTCGCCTTTTCCAGCTTCTAGAGGCTGCCCTTCT
+CATTCCTTGGTTCACGGCCACACTCATTTCCATCTCTGCTTCCACTGTGACAACTTCTCT
+GCCTCAGACCCTCCTGCTTTGCCTTTGTAAGGACCCTTGTGATGAGATCAGGCCCATCCA
+GGATTATCCCTCATCTCAAGACCTTTACCTTAATCACATTTGCAAGGTCTCTTCCACTGT
+GTCAGGTAACATTTTCACAGGTTCCAGGGATTAGGGTGTGGACATCTTGGGGAGCTGGAG
+GATATTATTTCATCTACCACACACATCTCTACCTTGTACAGGCAAGCACTTGCAAAGTGC
+AATGTGATCCTCTGGAGCCACTGTCCTCCCAGAGCTTATATATACTCTGAAAGTCAACTC
+TCAGACCACAGCCTCCTGTCCATGCACCACTCTCATCAACACCCCCACCCGAAACACTTT
+CACTCCACCCTCTTTGTCCCCTAACTCATGGAGAAGAAAATCTAATTAGTAGGAGTGGAA
+TTTGGCTTTCATCTTTACCAGTACTAGAAATATGGTGTGTGTCTTTTTGTAAAAATTCTC
+TCAACTAAATTGTTTTTATTAATTTCTGCAAAATGTGAACATCAACTCCCTTCATGTGAA
+TGTCAATAAGATTAAATGAGCTGTCTCAGCTCCTAGCCTGTGCAAGCTAACAGCTCAGGA
+GATGTTTATTTCTTTCCCTCTTCTTTCCTTAATGAAGCCCTCTCCTTTGACATCTTCAAT
+TCTGGAGCGCTTCTTTTCTGAGGCCTTGGCTCCCCCACATTGCCCACCCTTTTCCTGCTC
+GTCCACATTTCTGGCTTCTATTCTCTTGTCTTTACCATCTCCCTGAACAATGTTATCCGT
+TCCAATGACTTCAACAGTCTCTCCGCTTACATATGATGCCTCTCAAACTCTGATCTCCAA
+CTCTTCCAAAGAGCTCTGGACCTTTGTTCCAATTACCTGAAAAACATCTTCTTGGATGTC
+CCATTAGCACTGTTAAATCAAACAAGAATTTCCCTCCCTCCTGCCTTGCTGTAGTTCCCC
+TAGGGATTCGGTTGTGTGGGAAGATGTGTGGAGAGCTCTTAGTTGACTCCCTTCTCTGCA
+GTTCTACCTCTCTAGAGACTTGGAGGACCCACTGTTTCCGCCTCGCTTTTTCAGGCCTAG
+AGATTGCTCGCTCCTGGGCTGGCTGCTTCATAATTCCTTATTAGTAGTTTCCCAAGCTTA
+CATATCTGTAAATATTTACTTTAGTTAAATTCTCCCCAATTTCCACAATATGTTGGCTGC
+ACATGCTTTCTACTAGGAGTCACACAACTATGATAAGAACCAAGAAATATTAGTAAACGT
+TTTTTACCATTATTGGCCTATACCCTGGAATAGCCAACAATAACCTAGAACCTATGCAAC
+AAGAATATCCAACAAGAACCTAGAGACCTGTCAGTCTATAGGTGGGAACTACAGGATGAG
+A

test/t2.fa

@@ -0,0 +1,2 @@
+>t2
+GGACATCCCGATGGTGCAGgtGCTATTAAAGGTTCGTTTGTTCAACGATTAAagTCCTACCTGTACGAAAGGAC

tex/Makefile

@@ -0,0 +1,21 @@
+.SUFFIXES: .gp .tex .eps .pdf .eps.gz
+
+.eps.pdf:
+		epstopdf --outfile $@ $<
+
+.eps.gz.pdf:
+		gzip -dc $< | epstopdf --filter > $@
+
+.pdf.eps:
+		pdftops -eps $< $@
+
+all:minimap2.pdf
+
+roc-color.eps:roc.gp
+		gnuplot roc.gp
+
+minimap2.pdf:minimap2.tex minimap2.bib roc-color.pdf
+		pdflatex minimap2; bibtex minimap2; pdflatex minimap2; pdflatex minimap2;
+
+clean:
+		rm -fr *.toc *.aux *.bbl *.blg *.idx *.log *.out *~ minimap2.pdf

tex/bioinfo.cls

@@ -0,0 +1,930 @@
+\newcommand\classname{bioinfo}
+\newcommand\lastmodifieddate{2003/02/08}
+\newcommand\versionnumber{0.1}
+
+% Are we printing crop marks?
+\newif\if@cropmarkson \@cropmarksontrue
+
+\NeedsTeXFormat{LaTeX2e}[2001/06/01]
+\ProvidesClass{\classname}[\lastmodifieddate\space\versionnumber]
+
+\setlength{\paperheight}{11truein}
+\setlength{\paperwidth}{8.5truein}
+
+\newif\if@final
+
+\DeclareOption{draft}{\PassOptionsToPackage{draft}{graphicx}}
+\DeclareOption{a4paper}{\PassOptionsToPackage{a4}{crop}}
+\DeclareOption{centre}{\PassOptionsToPackage{center}{crop}}
+\DeclareOption{crop}{\PassOptionsToPackage{cam}{crop}\global\@cropmarksontrue}
+\DeclareOption{nocrop}{\PassOptionsToPackage{off}{crop}\global\@cropmarksonfalse}
+\DeclareOption{info}{\PassOptionsToPackage{info}{crop}}
+\DeclareOption{noinfo}{\PassOptionsToPackage{noinfo}{crop}}
+\DeclareOption{final}{\global\@finaltrue}
+
+\ExecuteOptions{a4paper,nocrop,centre,info}
+
+\ProcessOptions
+
+% Load all necessary packages
+\RequirePackage{inputenc,crop,graphicx,amsmath,array,color,amssymb,flushend,stfloats,amsthm,chngpage,times}
+%\RequirePackage[LY1]{fontenc}
+%\RequirePackage[LY1,mtbold]{mathtime}
+\def\authoraffliate{\fontfamily{phv}\selectfont}
+\def\helvetica{\fontfamily{phv}\selectfont}
+\def\helveticaitalic{\fontfamily{phv}\itshape\selectfont}
+\def\helveticabold{\fontfamily{phv}\bfseries\selectfont}
+\def\helveticabolditalic{\fontfamily{phv}\bfseries\itshape\selectfont}
+
+% Not sure if needed.
+\newcommand\@ptsize{0}
+
+% Set twoside printing
+\@twosidetrue
+
+% Marginal notes are on the outside edge
+\@mparswitchfalse
+
+\reversemarginpar
+
+\renewcommand\normalsize{%
+   \@setfontsize\normalsize{9}{11}%
+   \abovedisplayskip 10\p@ \@plus2\p@ \@minus5\p@
+   \abovedisplayshortskip \z@ \@plus3\p@
+   \belowdisplayshortskip 6\p@ \@plus3\p@ \@minus3\p@
+   \belowdisplayskip \abovedisplayskip
+   \let\@listi\@listI}
+\normalsize
+\let\@bls\baselineskip
+
+\newcommand\small{%
+    \@setfontsize\small{9}{11}%
+    \abovedisplayskip 11\p@ minus 3\p@
+    \belowdisplayskip \abovedisplayskip
+    \abovedisplayshortskip \z@ plus 2\p@
+    \belowdisplayshortskip 4\p@ plus 2\p@ minus2\p@
+    \def\@listi{\topsep 4.5\p@ plus 2\p@ minus 1\p@
+       \itemsep \parsep
+       \topsep 4\p@ plus 2\p@ minus 2\p@}}
+
+\newcommand\footnotesize{%
+    \@setfontsize\footnotesize{8}{10}%
+    \abovedisplayskip 6\p@ minus 3\p@
+    \belowdisplayskip\abovedisplayskip
+    \abovedisplayshortskip \z@ plus 3\p@
+    \belowdisplayshortskip 6\p@ plus 3\p@ minus 3\p@
+    \def\@listi{\topsep 3\p@ plus 1\p@ minus 1\p@
+       \parsep 2\p@ plus 1\p@ minus 1\p@\itemsep \parsep}}
+
+\def\scriptsize{\@setfontsize\scriptsize{7pt}{9pt}}
+\def\tiny{\@setfontsize\tiny{5pt}{7pt}}
+\def\large{\@setfontsize\large{11.5pt}{12pt}}
+\def\Large{\@setfontsize\Large{14pt}{16}}
+\def\LARGE{\@setfontsize\LARGE{15pt}{17pt}}
+\def\huge{\@setfontsize\huge{22pt}{22pt}}
+\def\Huge{\@setfontsize\Huge{30pt}{30pt}}
+
+\DeclareOldFontCommand{\rm}{\normalfont\rmfamily}{\mathrm}
+\DeclareOldFontCommand{\sf}{\normalfont\sffamily}{\mathsf}
+\DeclareOldFontCommand{\tt}{\normalfont\ttfamily}{\mathtt}
+\DeclareOldFontCommand{\bf}{\normalfont\bfseries}{\mathbf}
+\DeclareOldFontCommand{\it}{\normalfont\itshape}{\mathit}
+\DeclareOldFontCommand{\sl}{\normalfont\slshape}{\@nomath\sl}
+\DeclareOldFontCommand{\sc}{\normalfont\scshape}{\@nomath\sc}
+
+% Line spacing
+\setlength\lineskip{1\p@}
+\setlength\normallineskip{1\p@}
+\renewcommand\baselinestretch{}
+
+% Paragraph dimensions and inter-para spacing
+\setlength\parskip{0\p@}
+\setlength\parindent{3mm}
+
+% Set inter-para skips
+\setlength\smallskipamount{3\p@ \@plus 1\p@ \@minus 1\p@}
+\setlength\medskipamount{6\p@ \@plus 2\p@}
+\setlength\bigskipamount{12\p@ \@plus 4\p@ \@minus 4\p@}
+
+% Page break penalties
+\@lowpenalty   51
+\@medpenalty  151
+\@highpenalty 301
+
+% Disallow widows and orphans
+\clubpenalty 10000
+\widowpenalty 10000
+
+% Disable page breaks before equations, allow pagebreaks after
+% equations and discourage widow lines before equations.
+\displaywidowpenalty 100
+\predisplaypenalty   10000
+\postdisplaypenalty  2500
+
+% Allow breaking the page in the middle of a paragraph
+\interlinepenalty 0
+
+% Disallow breaking the page after a hyphenated line
+\brokenpenalty 10000
+
+% Hyphenation; don't split words into less than three characters
+\lefthyphenmin=3
+\righthyphenmin=3
+
+%
+% Set page layout dimensions
+%
+\setlength\headheight{16\p@}        % height of running head
+\setlength\topmargin{2.9pc}         % head margin
+\addtolength\topmargin{-1in}        % subtract out the 1 inch driver margin
+
+\setlength\topskip{10\p@}           % height of first line of text
+\setlength\headsep{19\p@}        %   space below running head --
+
+\setlength\footskip{34\p@}          % space above footer line
+\setlength\maxdepth{.5\topskip}     % pages can be short or deep by half a line?
+
+\setlength\textwidth{42pc}          % text measure excluding margins
+
+\setlength\textheight{58\baselineskip} % 54 lines on a full page,
+\addtolength\textheight{\topskip}      %   including the first
+                                       %   line on the page
+
+% Set the margins
+\setlength\marginparsep{3\p@}
+\setlength\marginparpush{3\p@}
+\setlength\marginparwidth{35\p@}
+
+\setlength\oddsidemargin{4.5pc}
+\addtolength\oddsidemargin{-1in}     % subtract out the 1 inch driver margin
+\setlength\@tempdima{\paperwidth}
+\addtolength\@tempdima{-\textwidth}
+\addtolength\@tempdima{-4.5pc}
+\setlength\evensidemargin{\@tempdima}
+\addtolength\evensidemargin{-1in}
+
+\setlength\columnsep{1.5pc}          % space between columns for double-column text
+\setlength\columnseprule{0\p@}       % width of rule between two columns
+
+% Footnotes
+\setlength\footnotesep{9\p@}      % space between footnotes
+% space between text and footnote
+\setlength{\skip\footins}{12\p@ \@plus 6\p@ \@minus 1\p@}
+
+% Float placement parameters
+
+% The total number of floats that can be allowed on a page.
+\setcounter{totalnumber}{10}
+% The maximum number of floats at the top and bottom of a page.
+\setcounter{topnumber}{5}
+\setcounter{bottomnumber}{5}
+% The maximum part of the top or bottom of a text page that can be
+% occupied by floats. This is set so that at least four lines of text
+% fit on the page.
+\renewcommand\topfraction{.9}
+\renewcommand\bottomfraction{.9}
+% The minimum amount of a text page that must be occupied by text.
+% This should accomodate four lines of text.
+\renewcommand\textfraction{.06}
+% The minimum amount of a float page that must be occupied by floats.
+\renewcommand\floatpagefraction{.94}
+
+% The same parameters repeated for double column output
+\renewcommand\dbltopfraction{.9}
+\renewcommand\dblfloatpagefraction{.9}
+
+% Space between floats
+\setlength\floatsep    {12\p@ \@plus 2\p@ \@minus 2\p@}
+% Space between floats and text
+\setlength\textfloatsep{20\p@ \@plus 2\p@ \@minus 4\p@}
+% Space above and below an inline figure
+\setlength\intextsep   {18\p@ \@plus 2\p@ \@minus 2\p@}
+
+% For double column floats
+\setlength\dblfloatsep    {12\p@ \@plus 2\p@ \@minus 2\p@}
+\setlength\dbltextfloatsep{20\p@ \@plus 2\p@ \@minus 4\p@}
+
+% Space left at top, bottom and inbetween floats on a float page.
+\setlength\@fptop{0\p@}         % no space above float page figures
+\setlength\@fpsep{12\p@ \@plus 1fil}
+\setlength\@fpbot{0\p@}
+
+% The same for double column
+\setlength\@dblfptop{0\p@}
+\setlength\@dblfpsep{12\p@ \@plus 1fil}
+\setlength\@dblfpbot{0\p@}
+
+% Override settings in mathtime back to TeX defaults
+\DeclareMathSizes{5}     {5}   {5}  {5}
+\DeclareMathSizes{6}     {6}   {5}  {5}
+\DeclareMathSizes{7}     {7}   {5}  {5}
+\DeclareMathSizes{8}     {8}   {6}  {5}
+\DeclareMathSizes{9}     {9}   {6.5}  {5}
+\DeclareMathSizes{10}   {10}   {7.5}  {5}
+\DeclareMathSizes{12}   {12}   {9}  {7}
+
+% Page styles
+\def\ps@headings
+  {%
+  \def\@oddfoot{\vbox to 12.5\p@{\hbox{\rule{\textwidth}{0.5\p@}}\vss
+        \hbox to \textwidth{\hfill\helveticabold\small\thepage}%
+        }}%
+  \def\@evenfoot{\vbox to 12.5\p@{\rule{\textwidth}{0.5\p@}\vss
+        \hbox to \textwidth{\helveticabold\small\thepage\hfill}%
+        }}%
+  \def\@evenhead{\vbox{\hbox to \textwidth{\fontsize{8}{10}\selectfont
+        \helveticabold{\fontshape{it}\selectfont
+        \strut\leftmark}\hfill}\vspace{6.5\p@}\rule{\textwidth}{0.5\p@}}}%
+  \def\@oddhead{\vbox{\hbox to \textwidth{\hfill\fontsize{8}{10}\selectfont
+        \helveticabold{\fontshape{it}\selectfont\strut\rightmark}}%
+        \vspace{6.5\p@}\rule{\textwidth}{0.5\p@}}}%
+  \def\titlemark##1{\markboth{##1}{##1}}%
+  \def\authormark##1{\gdef\leftmark{##1}}%
+  }
+
+\def\ps@opening
+  {%
+  \def\@oddfoot{\vbox to 13\p@{\hbox{\rule{\textwidth}{1\p@}}\vss
+        \hbox to \textwidth{\helvetica
+        \fontsize{7}{9}\fontshape{n}\selectfont%
+          \hfill\small\helveticabold\thepage}%
+        }}%
+  \def\@evenfoot{\vbox to 13\p@{\rule{\textwidth}\vss
+        \hbox to \textwidth{\helvetica\thepage\hfill
+          \fontsize{7}{9}\fontshape{n}\selectfont}%
+        }}%
+  \let\@evenhead\relax
+  \let\@oddhead\relax}
+
+% Page range
+\newif\iflastpagegiven   \lastpagegivenfalse
+\newcommand\firstpage[1]{%
+  \gdef\@firstpage{#1}%
+  \ifnum\@firstpage>\c@page
+    \setcounter{page}{#1}%
+    \ClassWarning{BIO}{Increasing pagenumber to \@firstpage}%
+  \else \ifnum\@firstpage<\c@page
+    \ClassWarning{BIO}{Firstpage lower than pagenumber}\fi\fi
+    \xdef\@firstpage{\the\c@page}%
+    }
+\def\@firstpage{1}
+\def\pagenumbering#1{%
+    \global\c@page \@ne
+    \gdef\thepage{\csname @#1\endcsname \c@page}%
+    \gdef\thefirstpage{%
+            \csname @#1\endcsname \@firstpage}%
+    \gdef\thelastpage{%
+            \csname @#1\endcsname \@lastpage}%
+    }
+
+\newcommand\lastpage[1]{\xdef\@lastpage{#1}%
+  \global\lastpagegiventrue}
+\def\@lastpage{0}
+\def\setlastpage{\iflastpagegiven\else
+    \edef\@tempa{@lastpage@}%
+    \expandafter
+    \ifx \csname \@tempa \endcsname \relax
+        \gdef\@lastpage{0}%
+    \else
+        \xdef\@lastpage{\@nameuse{@lastpage@}}%
+        \fi
+    \fi }
+\def\writelastpage{%
+    \iflastpagegiven \else
+    \immediate\write\@auxout%
+    {\string\global\string\@namedef{@lastpage@}{\the\c@page}}%
+    \fi
+    }
+\def\thepagerange{%
+  \ifnum\@lastpage =0 {\ \bf ???} \else
+  \ifnum\@lastpage = \@firstpage \ \thefirstpage\else
+  \thefirstpage--\thelastpage \fi\fi}
+
+\AtBeginDocument{\setlastpage
+     \pagenumbering{arabic}%
+   }
+\AtEndDocument{%
+    \writelastpage
+    \if@final
+    \clearemptydoublepage
+    \else
+    \clearpage
+    \fi}
+
+%
+% Sectional units
+%
+
+% Counters
+\newcounter{section}
+\newcounter{subsection}[section]
+\newcounter{subsubsection}[subsection]
+\newcounter{paragraph}[subsubsection]
+\newcounter{subparagraph}[paragraph]
+\newcounter{figure}
+\newcounter{table}
+
+% Form of the numbers
+\newcommand\thepage{\arabic{page}}
+\renewcommand\thesection{\arabic{section}}
+\renewcommand\thesubsection{{\thesection.\arabic{subsection}}}
+\renewcommand\thesubsubsection{{\thesubsection.\arabic{subsubsection}}}
+\renewcommand\theparagraph{\thesubsubsection.\arabic{paragraph}}
+\renewcommand\thesubparagraph{\theparagraph.\arabic{subparagraph}}
+\renewcommand\theequation{\arabic{equation}}
+
+% Form of the words
+\newcommand\contentsname{Contents}
+\newcommand\listfigurename{List of Figures}
+\newcommand\listtablename{List of Tables}
+\newcommand\partname{Part}
+\newcommand\appendixname{Appendix}
+\newcommand\abstractname{Abstract}
+\newcommand\refname{References}
+\newcommand\bibname{References}
+\newcommand\indexname{Index}
+\newcommand\figurename{Fig.}
+\newcommand\tablename{Table}
+
+% Clearemptydoublepage should really clear the running heads too
+\newcommand{\clearemptydoublepage}{\newpage{\pagestyle{empty}\cleardoublepage}}
+
+% Frontmatter, mainmatter and backmatter
+
+\newif\if@mainmatter \@mainmattertrue
+
+\newcommand\frontmatter{%
+  \clearpage
+  \@mainmatterfalse
+  \pagenumbering{roman}}
+
+\newcommand\mainmatter{%
+  \clearpage
+  \@mainmattertrue
+  \pagenumbering{arabic}}
+
+\newcommand\backmatter{%
+  \clearpage
+  \@mainmatterfalse}
+
+%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% TITLE %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%
+\newlength{\dropfromtop}
+\setlength{\dropfromtop}{\z@}
+
+% Application Notes
+\newif\if@appnotes
+\newcommand{\application}{%
+%  \setlength{\dropfromtop}{-2.25pc}%
+  \global\@appnotestrue}
+
+\long\def\title{\@ifnextchar[{\short@title}{\@@title}}
+\def\short@title[#1]{\titlemark{#1}\@@@title}
+\def\@@title#1{\authormark{#1}\@@@title{#1}}
+\long\def\@@@title#1{\gdef\@title{#1}}
+
+\long\def\author{\@ifnextchar[{\short@uthor}{\@uthor}}
+\def\short@uthor[#1]{\authormark{#1}\@@author}
+\def\@uthor#1{\authormark{#1}\@@author{#1}}
+\long\def\@@author#1{\gdef\@author{#1}}
+
+\def\vol#1{\global\def\@vol{#1}}
+\def\issue#1{\global\def\@issue{#1}}
+\def\address#1{\global\def\@issue{#1}}
+\def\history#1{\global\def\@history{#1}}
+\def\editor#1{\global\def\@editor{#1}}
+\def\pubyear#1{\global\def\@pubyear{#1}}
+\def\copyrightyear#1{\global\def\@copyrightyear{#1}}
+\def\address#1{\global\def\@address{#1}}
+\def\DOI#1{\global\def\@DOI{#1}}
+
+\definecolor{gray}{cmyk}{0, 0, 0, 0.15}
+\newlength{\extraspace}
+\setlength{\extraspace}{\z@}
+
+\newcommand\maketitle{\par
+  \begingroup
+    \renewcommand\thefootnote{\@fnsymbol\c@footnote}%
+    \def\@makefnmark{\rlap{\@textsuperscript{\normalfont\@thefnmark}}}%
+    \long\def\@makefntext##1{\parindent 3mm\noindent
+%      \@textsuperscript{\normalfont\@thefnmark}\raggedright##1}%
+      \@textsuperscript{\normalfont\@thefnmark}##1}%
+    \if@twocolumn
+      \ifnum \col@number=\@ne
+        \@maketitle
+      \else
+        \twocolumn[\@maketitle]%
+      \fi
+    \else
+      \newpage
+      \global\@topnum\z@   % Prevents figures from going at top of page.
+      \@maketitle
+    \fi
+    \thispagestyle{opening}\@thanks
+  \endgroup
+  \setcounter{footnote}{0}%
+  \global\let\thanks\relax
+  \global\let\maketitle\relax
+  \global\let\@maketitle\relax
+  \global\let\@address\@empty
+  \global\let\@history\@empty
+  \global\let\@editor\@empty
+  \global\let\@thanks\@empty
+  \global\let\@author\@empty
+  \global\let\@date\@empty
+  \global\let\@title\@empty
+  \global\let\@pubyear\@empty
+  \global\let\address\relax
+  \global\let\history\relax
+  \global\let\editor\relax
+  \global\let\title\relax
+  \global\let\author\relax
+  \global\let\date\relax
+  \global\let\pubyear\relax
+  \global\let\@copyrightline\@empty
+  \global\let\and\relax
+  \@afterindentfalse\@afterheading
+}
+
+\newlength{\aboveskipchk}%for checking oddpage or evenpage top skip
+\setlength{\aboveskipchk}{\z@}%
+
+\def\@maketitle{%
+  \let\footnote\thanks
+  \clearemptydoublepage
+    \checkoddpage\ifcpoddpage\setlength{\aboveskipchk}{-3pc}\else\setlength{\aboveskipchk}{-5pc}\fi%for checking oddpage or evenpage top skip%%
+  \vspace*{\aboveskipchk}%
+  \vspace{\dropfromtop}%
+  \hbox to \textwidth{%
+  {\helvetica\itshape\bfseries\fontsize{19}{12}\selectfont {\color{gray}TECHNICAL REPORT}
+    \hfil
+    \if@appnotes APPLICATIONS NOTE\hfil\fi
+    }%
+\enskip  \parbox[b]{11.3pc}{%
+    \helvetica
+    \flushright\fontsize{8}{10}\fontshape{it}\selectfont
+        \hfill
+  }}
+  \rule{\textwidth}{1\p@}\par%
+  \helvetica
+  \hbox to \textwidth{%
+  \parbox[t]{41pc}{%
+    \vspace*{1sp}
+    {\helveticabold\fontsize{16}{21}\selectfont\raggedright \@title \par}%
+    \vspace{4.5\p@}
+    {\authoraffliate\fontsize{11}{13}\selectfont\raggedright \@author \par}%
+        \vspace{4\p@}
+    {\authoraffliate\fontsize{9}{11}\selectfont\raggedright \@address \par}%
+    \vspace{4\p@}
+    %{\helvetica\fontsize{8}{10}\selectfont\raggedright \@history \par}
+    %\vspace{24\p@}
+    %{\helvetica\fontsize{10}{12}\selectfont\raggedright \@editor \par}
+    %\vspace{20\p@}
+    }%
+  }
+  \vspace{4.5\p@}%
+  \rule{\textwidth}{1\p@}%
+  \vspace{12\p@ plus 6\p@ minus 6\p@}%
+  \vspace{\extraspace}
+  }
+%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%
+
+%%%%%%%%%%%%%%%%%%%%%%%%%%%% Abstract %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%
+\newcommand{\absection}[1]{%
+  \par\noindent{\bfseries #1}\space\ignorespaces}
+
+\newenvironment{abstract}{%
+  \begingroup
+  \let\section\absection
+  \fontfamily{\sfdefault}\fontsize{8}{11}\sffamily\selectfont
+  {\fontseries{b}\selectfont ABSTRACT}\par}
+{\endgroup\bigskip\@afterheading\@afterindentfalse\vskip 12pt plus 3pt minus 1pt}
+
+% Section macros
+
+% Lowest level heading that takes a number by default
+\setcounter{secnumdepth}{3}
+
+\renewcommand{\@seccntformat}[1]{\csname the#1\endcsname\quad}
+
+\def\section{%
+  \@startsection{section}{1}{\z@}
+  {-22\p@ plus -3\p@}{3\p@}
+  {\reset@font\raggedright\helveticabold\fontsize{10}{12}\selectfont\MakeUppercase}}
+
+\def\subsection{%
+  \@startsection{subsection}{2}{\z@}
+  {-11\p@ plus -2\p@}{3\p@}
+  {\reset@font\raggedright\mathversion{bold}\fontseries{b}\fontsize{10}{12}\selectfont}}
+
+\def\subsubsection{%
+  \@startsection{subsubsection}{3}{\z@}
+  %{-11\p@ plus -1\p@}{-1em}
+  {-11\p@ plus -1\p@}{0.001em}
+  {\reset@font\normalfont\normalsize\itshape}}
+
+\def\textcolon{\text{\rm :}}
+
+ \def\paragraph{%
+   \@startsection{paragraph}{4}{\z@}
+   {-6\p@}
+   {-.4em}
+   {\reset@font\itshape}}
+
+% ********************
+% Figures and tables *
+% ********************
+
+% Table and array parameters
+\setlength\arraycolsep{.5em}
+\setlength\tabcolsep{.5em}
+\setlength\arrayrulewidth{.5pt}
+\setlength\doublerulesep{2.5pt}
+\setlength\extrarowheight{\z@}
+\renewcommand\arraystretch{1}
+
+\newlength{\abovecaptionskip}
+\newlength{\belowcaptionskip}
+\setlength{\abovecaptionskip}{13pt}
+\setlength{\belowcaptionskip}{10.5pt}
+
+\long\def\@makecaption#1#2{\vspace{\abovecaptionskip}%
+  \begingroup
+  \footnotesize
+  \textbf{#1.}\enskip{#2}\par
+  \endgroup}
+
+\long\def\@tablecaption#1#2{%
+  \begingroup
+  \footnotesize
+  \textbf{#1.}\enskip{#2\strut\par}
+  \endgroup\vspace{\belowcaptionskip}}
+
+% Table rules
+\def\toprule{\noalign{\ifnum0=`}\fi\hrule \@height 0.5pt \hrule \@height 6pt \@width 0pt \futurelet
+   \@tempa\@xhline}
+\def\midrule{\noalign{\ifnum0=`}\fi \hrule \@height 6.75pt \@width 0pt \hrule \@height 0.5pt
+    \hrule \@height 6pt \@width 0pt \futurelet \@tempa\@xhline}
+\def\botrule{\noalign{\ifnum0=`}\fi \hrule \@height 5.75pt \@width 0pt \hrule \@height 0.5pt \futurelet
+   \@tempa\@xhline}
+\def\hrulefill{\leavevmode\leaders\hrule height .5pt\hfill\kern\z@}
+
+\def\thefigure{\@arabic\c@figure}
+\def\fps@figure{tbp}
+\def\ftype@figure{1}
+\def\ext@figure{lof}
+\def\fnum@figure{\figurename~\thefigure}
+\def\figure{\@float{figure}}
+\let\endfigure\end@float
+\@namedef{figure*}{\@dblfloat{figure}}
+\@namedef{endfigure*}{\end@dblfloat}
+\def\thetable{\@arabic\c@table}
+\def\fps@table{tbp}
+\def\ftype@table{2}
+\def\ext@table{lot}
+\def\fnum@table{Table~\thetable}
+\def\table{\let\@makecaption\@tablecaption\let\source\tablesource\@float{table}}
+\def\endtable{\end@float}
+\@namedef{table*}{\let\@makecaption\@tablecaption\@dblfloat{table}}
+\@namedef{endtable*}{\end@dblfloat}
+
+\newif\if@rotate \@rotatefalse
+\newif\if@rotatecenter \@rotatecenterfalse
+\def\rotatecenter{\global\@rotatecentertrue}
+\def\rotateendcenter{\global\@rotatecenterfalse}
+\def\rotate{\global\@rotatetrue}
+\def\endrotate{\global\@rotatefalse}
+\newdimen\rotdimen
+\def\rotstart#1{\special{ps: gsave currentpoint currentpoint translate
+    #1 neg exch neg exch translate}}
+\def\rotfinish{\special{ps: currentpoint grestore moveto}}
+\def\rotl#1{\rotdimen=\ht#1\advance\rotdimen by \dp#1
+    \hbox to \rotdimen{\vbox to\wd#1{\vskip \wd#1
+    \rotstart{270 rotate}\box #1\vss}\hss}\rotfinish}
+\def\rotr#1{\rotdimen=\ht #1\advance\rotdimen by \dp#1
+    \hbox to \rotdimen{\vbox to \wd#1{\vskip \wd#1
+    \rotstart{90 rotate}\box #1\vss}\hss}\rotfinish}
+
+\newdimen\tempdime
+\newbox\temptbox
+
+% From ifmtarg.sty
+% Copyright Peter Wilson and Donald Arseneau, 2000
+\begingroup
+\catcode`\Q=3
+\long\gdef\@ifmtarg#1{\@xifmtarg#1QQ\@secondoftwo\@firstoftwo\@nil}
+\long\gdef\@xifmtarg#1#2Q#3#4#5\@nil{#4}
+\long\gdef\@ifnotmtarg#1{\@xifmtarg#1QQ\@firstofone\@gobble\@nil}
+\endgroup
+
+\def\tablesize{\@setfontsize\tablesize{8\p@}{10\p@}}
+
+\newenvironment{processtable}[3]{\setbox\temptbox=\hbox{{\tablesize #2}}%
+\tempdime\wd\temptbox\@processtable{#1}{#2}{#3}{\tempdime}}
+{\relax}
+
+\newcommand{\@processtable}[4]{%
+\if@rotate
+\setbox4=\vbox to \hsize{\vss\hbox to \textheight{%
+\begin{minipage}{#4}%
+\@ifmtarg{#1}{}{\caption{#1}}{\tablesize #2}%
+\vskip7\p@\noindent
+\parbox{#4}{\fontsize{7}{9}\selectfont #3\par}%
+\end{minipage}}\vss}%
+\rotr{4}
+\else
+\hbox to \hsize{\hss\begin{minipage}[t]{#4}%
+\vskip2.9pt
+\@ifmtarg{#1}{}{\caption{#1}}{\tablesize #2}%
+\vskip6\p@\noindent
+\parbox{#4}{\fontsize{7}{9}\selectfont #3\par}%
+\end{minipage}\hss}\fi}%
+
+\newcolumntype{P}[1]{>{\raggedright\let\\\@arraycr\hangindent1em}p{#1}}
+
+% ******************************
+% List numbering and lettering *
+% ******************************
+\def\labelenumi{{\rm\arabic{enumi}.}}
+\def\theenumi{\arabic{enumi}}
+\def\labelenumii{{\rm\alph{enumii}.}}
+\def\theenumii{\alph{enumii}}
+\def\p@enumii{\theenumi}
+\def\labelenumiii{{\rm(\arabic{enumiii})}}
+\def\theenumiii{\roman{enumiii}}
+\def\p@enumiii{\theenumi(\theenumii)}
+\def\labelenumiv{{\rm(\arabic{enumiv})}}
+\def\theenumiv{\Alph{enumiv}}
+\def\p@enumiv{\p@enumiii\theenumiii}
+\def\labelitemi{{\small$\bullet$}}
+\def\labelitemii{{\small$\bullet$}}
+\def\labelitemiii{{\small$\bullet$}}
+\def\labelitemiv{{\small$\bullet$}}
+
+\def\@listI{\leftmargin\leftmargini \topsep\medskipamount}
+\let\@listi\@listI
+\@listi
+\def\@listii{\topsep\z@\leftmargin\leftmarginii}
+\def\@listiii{\leftmargin\leftmarginiii \topsep\z@}
+\def\@listiv{\leftmargin\leftmarginiv \topsep\z@}
+\def\@listv{\leftmargin\leftmarginv \topsep\z@}
+\def\@listvi{\leftmargin\leftmarginvi \topsep\z@}
+
+\setlength{\leftmargini}{3mm}
+\setlength{\leftmarginii}{\z@}
+\setlength{\leftmarginiii}{\z@}
+\setlength{\leftmarginiv}{\z@}
+
+% Changes to the list parameters for enumerate
+\def\enumargs{%
+   \partopsep     \z@
+   \itemsep       3\p@
+   \parsep        \z@
+   \labelsep      0.5em
+   \listparindent \parindent
+   \itemindent    \z@
+   \topsep 11\p@
+}
+
+\def\enumerate{%
+    \@ifnextchar[{\@numerate}{\@numerate[0]}}
+
+\def\@numerate[#1]{%
+     \ifnum \@enumdepth >3 \@toodeep\else
+     \advance\@enumdepth \@ne
+     \edef\@enumctr{enum\romannumeral\the\@enumdepth}
+     \list{\csname label\@enumctr\endcsname}{%
+       \enumargs
+       \setlength{\leftmargin}{\csname leftmargin\romannumeral\the\@enumdepth\endcsname}
+       \usecounter{\@enumctr}
+       \settowidth\labelwidth{#1}
+       \addtolength{\leftmargin}{\labelwidth}
+       \addtolength{\leftmargin}{\labelsep}
+       \def\makelabel##1{\hss \llap{##1}}}%
+     \fi
+   }
+\let\endenumerate\endlist
+
+% Changes to the list parameters for itemize
+\def\itemargs{%
+   \partopsep     \z@
+   \itemsep       3\p@
+   \parsep        \z@
+   \labelsep      0.5em
+   \rightmargin   \z@
+   \listparindent \parindent
+   \itemindent    \z@
+   \topsep11\p@
+}
+
+\def\itemize{%
+    \@ifnextchar[{\@itemize}{\@itemize[$\bullet$]}}
+
+\def\@itemize[#1]{%
+     \ifnum \@itemdepth >3 \@toodeep\else
+     \advance\@itemdepth \@ne
+     \edef\@itemctr{item\romannumeral\the\@itemdepth}
+     \list{\csname label\@itemctr\endcsname}{%
+       \itemargs
+       \setlength{\leftmargin}{\csname leftmargin\romannumeral\the\@itemdepth\endcsname}
+       \settowidth\labelwidth{#1}
+       \addtolength{\leftmargin}{\labelwidth}
+       \addtolength{\leftmargin}{\labelsep}
+       \def\makelabel##1{\hss \llap{##1}}}%
+     \fi
+   }
+\let\enditemize\endlist
+
+\newenvironment{unlist}{%
+  \begin{list}{}%
+    {\setlength{\labelwidth}{\z@}%
+     \setlength{\labelsep}{\z@}%
+     \setlength{\topsep}{\medskipamount}%
+     \setlength{\itemsep}{3\p@}%
+     \setlength{\leftmargin}{2em}%
+     \setlength{\itemindent}{-2em}}}
+{\end{list}}
+
+
+% ***********************
+% Quotes and Quotations *
+% ***********************
+\def\quotation{\par\begin{list}{}{
+      \setlength{\topsep}{\medskipamount}
+      \setlength{\leftmargin}{2em}%
+      \setlength{\rightmargin}{\z@}%
+      \setlength\labelwidth{0pt}%
+      \setlength\labelsep{0pt}%
+      \listparindent\parindent}%
+  \item[]}
+\def\endquotation{\end{list}}
+\let\quote\quotation
+\let\endquote\endquotation
+
+\skip\@mpfootins = \skip\footins
+\fboxsep=6\p@
+\fboxrule=1\p@
+
+% *******************
+% Table of contents *
+% *******************
+\newcommand\@pnumwidth{4em}
+\newcommand\@tocrmarg{2.55em plus 1fil}
+\newcommand\@dotsep{1000}
+\setcounter{tocdepth}{4}
+
+\def\numberline#1{\hbox to \@tempdima{{#1}}}
+
+\def\@authortocline#1#2#3#4#5{%
+  \vskip 1.5\p@
+  \ifnum #1>\c@tocdepth \else
+    {\leftskip #2\relax \rightskip \@tocrmarg \parfillskip -\rightskip
+     \parindent #2\relax\@afterindenttrue
+     \interlinepenalty\@M
+     \leavevmode
+     \@tempdima #3\relax
+     \advance\leftskip \@tempdima \null\nobreak\hskip -\leftskip
+     {\itshape #4}\nobreak
+     \leaders\hbox{$\m@th
+        \mkern \@dotsep mu\hbox{.}\mkern \@dotsep
+        mu$}\hfill
+     \nobreak
+     \hb@xt@\@pnumwidth{\hfil}%
+     \par}%
+  \fi}
+
+\newcommand*\l@author{\@authortocline{2}{0pt}{30pt}}
+\newcommand*\l@section{\@dottedtocline{3}{11pt}{20pt}}
+\newcommand*\l@subsection{\@dottedtocline{4}{31pt}{29pt}}
+\newcommand*\l@subsubsection[2]{}
+
+
+
+% ***********
+% Footnotes *
+% ***********
+
+\def\footnoterule{\noindent\rule{\columnwidth}{0.5pt}}
+\def\@makefnmark{\@textsuperscript{\normalfont\@thefnmark}}%
+\newcommand\@makefntext[1]{\noindent{\@makefnmark}\enskip#1}
+
+% ***********
+% References *
+% ***********
+
+\providecommand{\newblock}{}
+\newenvironment{thebibliography}{%
+  \section{\bibname}%
+  \begingroup
+  \small
+  \begin{list}{}{%
+      \setlength{\topsep}{\z@}%
+      \setlength{\labelsep}{\z@}%
+      \settowidth{\labelwidth}{\z@}%
+      \setlength{\leftmargin}{4mm}%
+      \setlength{\itemindent}{-4mm}}\small}
+{\end{list}\endgroup}
+
+\RequirePackage{natbib}
+
+% **********
+% Appendix *
+% **********
+\newif\ifappend % Are we in the Appendix?
+\def\appendix{\par
+        \setcounter{section}{0}
+        \setcounter{subsection}{0}
+        \appendtrue
+}
+
+%Math parameters
+
+\setlength{\jot}{5\p@}
+\mathchardef\@m=1500   % adapted value
+
+\def\frenchspacing{\sfcode`\.\@m \sfcode`\?\@m \sfcode`\!\@m
+  \sfcode`\:\@m \sfcode`\;\@m \sfcode`\,\@m}
+
+% Theorems
+\def\th@plain{%
+%%  \let\thm@indent\noindent % no indent
+\thm@headfont{\quad\scshape}% heading font is bold
+\thm@notefont{\upshape\mdseries}% same as heading font
+\thm@headpunct{.}% no period after heading
+\thm@headsep 5\p@ plus\p@ minus\p@\relax
+%%  \let\thm@swap\@gobble
+%%  \thm@preskip\topsep
+%%  \thm@postskip\theorempreskipamount
+\itshape % body font
+}
+
+\vbadness=9999
+\tolerance=9999
+\doublehyphendemerits=10000
+\doublehyphendemerits 640000   % corresponds to badness 800
+\finalhyphendemerits  1000000  % corresponds to badness 1000
+
+\flushbottom
+\frenchspacing
+\ps@headings
+\twocolumn
+
+% Screen PDF compatability
+\newcommand{\medline}[1]{%
+  \unskip\unskip\ignorespaces}
+
+
+%%%%for smaller size text
+\newenvironment{methods}{%
+  \begingroup
+\def\section{%
+  \@startsection{section}{1}{\z@}
+  {-24\p@ plus -3\p@}{4\p@}
+  {\reset@font\raggedright\helveticabold\fontsize{10}{12}\selectfont\MakeUppercase}}
+ \def\subsection{%
+  \@startsection{subsection}{2}{\z@}
+  {-5\p@ plus -2\p@}{4\p@}
+  {\reset@font\raggedright\mathversion{bold}\fontseries{b}\fontsize{10}{12}\selectfont}}
+ \def\subsubsection{%
+  \@startsection{subsubsection}{3}{\z@}
+%  {-6\p@ plus -1\p@}{-1em}
+  {-6\p@ plus -1\p@}{0.001em}
+  {\reset@font\normalfont\normalsize\itshape}}
+\footnotesize
+  \par}
+{\par\endgroup\bigskip\@afterheading\@afterindentfalse}
+
+
+
+\graphicspath{{g:/artwork/oup/bioinfo/}}
+
+\language=2
+
+\hyphenation{Figure Table Figures Tables}
+
+\newcommand{\href}[2]{#2}
+
+\renewenvironment{proof}[1][\proofname]{\par
+  \normalfont \topsep6\p@\@plus6\p@\relax
+  \labelsep 0.5em
+  \trivlist
+  \item[\hskip\labelsep\hskip1em\textsc{#1}.]\ignorespaces
+}{\endtrivlist\@endpefalse}
+
+%%Different Bonds
+
+\def\sbond{\ensuremath{\raise.25ex\hbox{${-}\!\!\!\!{-}$}}\kern -.9pt}
+\def\dbond{\ensuremath{\raise.25ex\hbox{=$\!$=}}}
+\def\tbond{\ensuremath{\raise.20ex\hbox{${\equiv}\!\!\!{\equiv}$}}}
+
+% Author queries
+%\fboxsep=4\p@
+%\fboxrule=0.5\p@
+\newcommand{\query}[2][0pt]{}%
+%  \marginpar{\vspace*{#1}%
+%    {\parbox{\marginparwidth}{%
+%     \raggedright\fontsize{6}{8}\selectfont
+%         #2}}}}
+
+\renewcommand{\dag}{{\mathversion{normal}$^{\dagger}$}}
+
+\endinput

tex/blasr-mc.eval

@@ -0,0 +1,17 @@
+Q	60	32681	57	0.001744133
+Q	39	3	1	0.001774569
+Q	38	3	1	0.001804999
+Q	35	5	1	0.001835311
+Q	34	31	2	0.001894692
+Q	20	11	2	0.001955154
+Q	19	4	1	0.001985460
+Q	15	29	5	0.002136296
+Q	14	6	1	0.002166417
+Q	10	11	1	0.002196193
+Q	6	11	2	0.002256442
+Q	5	1	1	0.002286864
+Q	4	1	1	0.002317285
+Q	3	36	15	0.002771602
+Q	2	5	2	0.002832085
+Q	1	12	9	0.003105023
+Q	0	220	83	0.005594194

tex/bowtie2-s3.sam.eval

@@ -0,0 +1,28 @@
+Q	42	16872292	669	0.000039651	16872292
+Q	40	835329	636	0.000073697	17707621
+Q	31	6544	2	0.000073783	17714165
+Q	30	8882	6	0.000074084	17723047
+Q	27	68499	9	0.000074305	17791546
+Q	26	132041	81	0.000078277	17923587
+Q	25	129378	96	0.000083033	18052965
+Q	24	92056	382	0.000103665	18145021
+Q	23	14341	402	0.000125720	18159362
+Q	22	132838	146	0.000132789	18292200
+Q	21	122274	124	0.000138641	18414474
+Q	18	112183	103	0.000143361	18526657
+Q	17	126981	213	0.000153804	18653638
+Q	16	16356	208	0.000164810	18669994
+Q	15	42804	782	0.000206223	18712798
+Q	14	16026	318	0.000223025	18728824
+Q	12	170250	814	0.000264087	18899074
+Q	11	48351	1409	0.000337777	18947425
+Q	8	1843	311	0.000354156	18949268
+Q	7	62266	4435	0.000586276	19011534
+Q	6	413997	50057	0.003150647	19425531
+Q	5	404	58	0.003153568	19425935
+Q	4	704	154	0.003161381	19426639
+Q	3	1473	681	0.003196193	19428112
+Q	2	17541	16462	0.004039875	19445653
+Q	1	534344	354879	0.021693547	19979997
+Q	0	11939	9917	0.022176642	19991936
+U	8064

tex/bwa-s3.sam.eval

@@ -0,0 +1,52 @@
+Q	60	18784147	3	0.000000160	18784147
+Q	52	19002	1	0.000000213	18803149
+Q	50	7152	2	0.000000319	18810301
+Q	49	6797	1	0.000000372	18817098
+Q	48	52188	2	0.000000477	18869286
+Q	47	48775	3	0.000000634	18918061
+Q	46	19447	2	0.000000739	18937508
+Q	45	25983	3	0.000000896	18963491
+Q	44	13455	1	0.000000949	18976946
+Q	43	14573	2	0.000001053	18991519
+Q	42	8697	4	0.000001263	19000216
+Q	41	8645	2	0.000001368	19008861
+Q	40	176603	75	0.000005264	19185464
+Q	38	2503	2	0.000005368	19187967
+Q	37	4117	3	0.000005523	19192084
+Q	36	2924	16	0.000006356	19195008
+Q	35	2323	8	0.000006772	19197331
+Q	34	2344	10	0.000007292	19199675
+Q	33	4279	6	0.000007603	19203954
+Q	32	2092	4	0.000007810	19206046
+Q	31	2625	11	0.000008382	19208671
+Q	30	2828	13	0.000009057	19211499
+Q	29	1581	1	0.000009108	19213080
+Q	28	1543	6	0.000009420	19214623
+Q	27	70916	223	0.000020948	19285539
+Q	26	1288	16	0.000021777	19286827
+Q	25	25551	122	0.000028065	19312378
+Q	24	14345	84	0.000032390	19326723
+Q	23	7308	87	0.000036878	19334031
+Q	22	8358	125	0.000043325	19342389
+Q	21	4836	71	0.000046983	19347225
+Q	20	5888	123	0.000053325	19353113
+Q	19	4656	83	0.000057600	19357769
+Q	18	3948	87	0.000062081	19361717
+Q	17	4418	114	0.000067954	19366135
+Q	16	4226	131	0.000074702	19370361
+Q	15	5760	164	0.000083144	19376121
+Q	14	4697	257	0.000096384	19380818
+Q	13	5246	313	0.000112503	19386064
+Q	12	4170	241	0.000124908	19390234
+Q	11	4095	304	0.000140557	19394329
+Q	10	3857	360	0.000159087	19398186
+Q	9	5300	438	0.000181617	19403486
+Q	8	4206	572	0.000211050	19407692
+Q	7	4676	787	0.000251541	19412368
+Q	6	3923	688	0.000286924	19416291
+Q	5	3294	708	0.000323333	19419585
+Q	4	2936	693	0.000358965	19422521
+Q	3	3928	816	0.000400897	19426449
+Q	2	2613	810	0.000442533	19429062
+Q	1	3515	1188	0.000503587	19432577
+Q	0	567423	376636	0.019321100	20000000

tex/bwa.eval

@@ -0,0 +1,55 @@
+Q	60	31721	27	0.000851171
+Q	59	54	4	0.000975610
+Q	58	29	5	0.001131933
+Q	57	21	2	0.001194030
+Q	56	14	4	0.001319137
+Q	55	22	6	0.001506544
+Q	54	12	4	0.001631475
+Q	53	16	3	0.001724733
+Q	51	10	1	0.001755541
+Q	50	10	1	0.001786330
+Q	49	11	3	0.001879699
+Q	47	8	2	0.001941869
+Q	46	17	1	0.001972140
+Q	44	8	3	0.002065534
+Q	43	10	1	0.002096174
+Q	42	13	1	0.002126595
+Q	41	14	3	0.002219444
+Q	40	13	2	0.002281036
+Q	38	17	4	0.002404747
+Q	37	15	4	0.002528484
+Q	36	12	1	0.002558742
+Q	35	19	3	0.002650783
+Q	34	12	3	0.002743313
+Q	33	7	1	0.002773882
+Q	32	21	3	0.002865508
+Q	31	11	2	0.002926799
+Q	30	14	3	0.003018891
+Q	29	17	1	0.003048401
+Q	28	11	2	0.003109549
+Q	27	20	5	0.003262998
+Q	26	11	1	0.003292948
+Q	25	14	4	0.003415725
+Q	24	16	5	0.003569212
+Q	23	43	6	0.003750426
+Q	21	15	1	0.003779664
+Q	20	29	7	0.003992943
+Q	19	22	2	0.004052089
+Q	18	28	4	0.004172204
+Q	16	25	5	0.004323390
+Q	15	24	5	0.004474480
+Q	14	25	5	0.004625204
+Q	13	23	3	0.004714365
+Q	12	22	1	0.004741963
+Q	11	32	11	0.005075674
+Q	10	35	7	0.005285315
+Q	9	32	12	0.005648503
+Q	8	33	8	0.005888126
+Q	7	39	7	0.006095506
+Q	6	42	14	0.006515953
+Q	5	38	15	0.006966725
+Q	4	37	12	0.007325113
+Q	3	49	18	0.007862737
+Q	2	63	21	0.008486434
+Q	1	55	27	0.009292156
+Q	0	153	77	0.011576593

tex/eval2roc.pl

@@ -0,0 +1,33 @@
+#!/usr/bin/perl
+
+use strict;
+use warnings;
+use Getopt::Std;
+
+my %opts = (n=>33088, s=>100);
+getopts('n:', \%opts);
+
+my $pseudo = .5;
+my $tot = $pseudo;
+my $err = $pseudo;
+my $tot_last_out = -$opts{s};
+my $state = 0;
+my $mapq = 0;
+while (<>) {
+	chomp;
+	if (/^Q\t(\d+)\t(\d+)\t(\d+)/) {
+		$tot += $2;
+		$err += $3;
+		if ($tot - $tot_last_out >= $opts{s}) {
+			print join("\t", $1, $err/$tot, $tot / $opts{n}), "\n";
+			$tot_last_out = $tot;
+			$state = 0;
+		} else {
+			$state = 1;
+			$mapq = $1;
+		}
+	}
+}
+if ($state) {
+	print join("\t", $mapq, $err/$tot, $tot / $opts{n}), "\n";
+}

tex/graphmap.eval

@@ -0,0 +1,4 @@
+Q	40	31897	63	0.001975107
+Q	3	423	267	0.010210396
+Q	2	162	120	0.013853827
+Q	1	188	172	0.019038874

tex/hs38-simu.sh

@@ -0,0 +1,10 @@
+./pbsim --prefix pb-1 --depth 0.1 --sample-fastq m131017_060208_42213_c100579642550000001823095604021496_s1_p0.1.subreads.fastq --length-min 1000 --length-max 30000 --seed 11 hs38.fa
+
+bin/mason_variator -ir hs38.fa -s 1 -ov hs38-s1.vcf --snp-rate 1e-3 --small-indel-rate 2e-4 --sv-indel-rate 0 --sv-inversion-rate 0 --sv-translocation-rate 0 --sv-duplication-rate 0 --max-small-indel-size 10
+bin/mason_simulator -ir hs38.fa -iv hs38-s1.vcf -n 1000000 --seed 1 -o s1_1.fq -or s1_2.fq -oa s1.sam --illumina-prob-mismatch-scale 2.5
+
+bin/mason_variator -ir hs38.fa -s 2 -ov hs38-s2.vcf --snp-rate 1e-3 --small-indel-rate 2e-4 --sv-indel-rate 0 --sv-inversion-rate 0 --sv-translocation-rate 0 --sv-duplication-rate 0 --max-small-indel-size 10
+bin/mason_simulator -ir hs38.fa -iv hs38-s2.vcf -n 1000000 --seed 2 -o mason-s2_1.fq -or mason-s2_2.fq -oa mason-s2.sam --illumina-prob-mismatch-scale 2.5 --illumina-read-length 150
+
+bin/mason_variator -ir hs38.fa -s 3 -ov hs38-s3.vcf --snp-rate 1e-3 --small-indel-rate 2e-4 --sv-indel-rate 0 --sv-inversion-rate 0 --sv-translocation-rate 0 --sv-duplication-rate 0 --max-small-indel-size 10
+bin/mason_simulator -ir hs38.fa -iv hs38-s3.vcf -n 10000000 --seed 3 -o mason-s3_1.fq -or mason-s3_2.fq -oa mason-s3.sam --illumina-prob-mismatch-scale 2.5 --illumina-read-length 150

tex/minialign.eval

@@ -0,0 +1,49 @@
+Q	60	32070	190	0.005924540
+Q	59	62	2	0.005975352
+Q	58	37	5	0.006123908
+Q	57	40	7	0.006333633
+Q	56	39	6	0.006512032
+Q	55	32	2	0.006567534
+Q	54	54	2	0.006618420
+Q	53	33	4	0.006735255
+Q	52	39	2	0.006788866
+Q	51	48	3	0.006871264
+Q	50	34	2	0.006925634
+Q	49	32	3	0.007011070
+Q	48	35	2	0.007064967
+Q	47	36	4	0.007179896
+Q	46	23	1	0.007205495
+Q	45	25	1	0.007230614
+Q	44	17	3	0.007318716
+Q	43	17	2	0.007376121
+Q	42	31	5	0.007522016
+Q	41	25	4	0.007638486
+Q	40	26	4	0.007754541
+Q	39	35	2	0.007807258
+Q	37	18	4	0.007924896
+Q	36	13	3	0.008013162
+Q	35	15	2	0.008070411
+Q	34	20	3	0.008156805
+Q	33	11	1	0.008184501
+Q	32	15	3	0.008272003
+Q	31	25	1	0.008296107
+Q	29	8	1	0.008324472
+Q	28	7	2	0.008383452
+Q	27	9	2	0.008441894
+Q	26	30	2	0.008494888
+Q	23	2	1	0.008524710
+Q	22	11	3	0.008612846
+Q	20	23	3	0.008697760
+Q	19	6	1	0.008726479
+Q	18	8	1	0.008754658
+Q	16	6	1	0.008783354
+Q	13	2	1	0.008813108
+Q	12	4	2	0.008872604
+Q	11	7	2	0.008931275
+Q	10	4	3	0.009021009
+Q	9	6	4	0.009140436
+Q	8	6	3	0.009229559
+Q	7	5	1	0.009258419
+Q	6	8	3	0.009346925
+Q	4	8	5	0.009495872
+Q	3	17	8	0.009732801

tex/minimap2.bib

@@ -0,0 +1,340 @@
+@article{Chaisson:2012aa,
+	Author = {Chaisson, Mark J and Tesler, Glenn},
+	Journal = {BMC Bioinformatics},
+	Pages = {238},
+	Title = {{Mapping single molecule sequencing reads using basic local alignment with successive refinement (BLASR): application and theory}},
+	Volume = {13},
+	Year = {2012}}
+
+@article{Liu:2016ab,
+	Author = {Liu, Bo and others},
+	Journal = {Bioinformatics},
+	Pages = {1625-31},
+	Title = {{rHAT}: fast alignment of noisy long reads with regional hashing},
+	Volume = {32},
+	Year = {2016}}
+
+@article{Liu:2017aa,
+	Author = {Liu, Bo and others},
+	Journal = {Bioinformatics},
+	Pages = {192-201},
+	Title = {{LAMSA}: fast split read alignment with long approximate matches},
+	Volume = {33},
+	Year = {2017}}
+
+@article{Lin:2017aa,
+	Author = {Lin, Hsin-Nan and Hsu, Wen-Lian},
+	Journal = {Bioinformatics},
+	Title = {Kart: a divide-and-conquer algorithm for {NGS} read alignment},
+	Year = {2017}}
+
+@article{Li:2013aa,
+	Author = {Li, Heng},
+	Journal = {arXiv:1303.3997},
+	Title = {Aligning sequence reads, clone sequences and assembly contigs with {BWA-MEM}},
+	archivePrefix = "arXiv",
+	eprint = {1303.3997},
+	primaryClass = "q-bio",
+	Year = {2013}}
+
+@article{Sovic:2016aa,
+	Author = {Sovi{\'c}, Ivan and others},
+	Journal = {Nat Commun},
+	Pages = {11307},
+	Title = {Fast and sensitive mapping of nanopore sequencing reads with {GraphMap}},
+	Volume = {7},
+	Year = {2016}}
+
+@article{Langmead:2012fk,
+	Author = {Langmead, Ben and Salzberg, Steven L},
+	Journal = {Nat Methods},
+	Pages = {357-9},
+	Title = {Fast gapped-read alignment with {Bowtie} 2},
+	Volume = {9},
+	Year = {2012}}
+
+@article{Li:2016aa,
+	Author = {Li, Heng},
+	Journal = {Bioinformatics},
+	Pages = {2103-10},
+	Title = {Minimap and miniasm: fast mapping and de novo assembly for noisy long sequences},
+	Volume = {32},
+	Year = {2016}}
+
+@misc{Ruan:2016,
+	title = {Ultra-fast de novo assembler using long noisy reads},
+	author = {Jue Ruan},
+	journal = {Unpulished},
+	howpublished = {\href{https://github.com/ruanjue/smartdenovo}{https://github.com/ruanjue/smartdenovo}},
+	year = {2016}}
+
+@article{Miller:1988aa,
+	Author = {Miller, W and Myers, E W},
+	Journal = {Bull Math Biol},
+	Number = {2},
+	Pages = {97-120},
+	Title = {Sequence comparison with concave weighting functions},
+	Volume = {50},
+	Year = {1988}}
+
+@article{Gotoh:1990aa,
+	Author = {Gotoh, O},
+	Journal = {Bull Math Biol},
+	Pages = {359-73},
+	Title = {Optimal sequence alignment allowing for long gaps},
+	Volume = {52},
+	Year = {1990}}
+
+@article{Wu:1996aa,
+	Author = {Wu, Sun and others},
+	Journal = {Algorithmica},
+	Pages = {50-67},
+	Title = {A subquadratic algorithm for approximate limited expression matching},
+	Volume = {15},
+	Year = {1996}}
+
+@article{Daily:2016aa,
+	Author = {Daily, Jeff},
+	Journal = {BMC Bioinformatics},
+	Month = {Feb},
+	Pages = {81},
+	Title = {Parasail: {SIMD C} library for global, semi-global, and local pairwise sequence alignments},
+	Volume = {17},
+	Year = {2016}}
+
+@article{Sedlazeck169557,
+	author = {Sedlazeck, Fritz J and others},
+	title = {Accurate detection of complex structural variations using single molecule sequencing},
+	note = {doi:10.1101/169557},
+	journal = {bioRxiv},
+	year = {2017}}
+
+@article{Altschul:1997vn,
+	Author = {Altschul, S F and others},
+	Journal = {Nucleic Acids Res},
+	Pages = {3389-402},
+	Title = {Gapped {BLAST} and {PSI-BLAST}: a new generation of protein database search programs},
+	Volume = {25},
+	Year = {1997}}
+
+@article{Sosic:2017aa,
+	Author = {{\v S}o{\v s}i\'{c}, Martin and {\v S}ikic, Mile},
+	Journal = {Bioinformatics},
+	Pages = {1394-1395},
+	Title = {Edlib: a {C/C++} library for fast, exact sequence alignment using edit distance},
+	Volume = {33},
+	Year = {2017}}
+
+@article{Abouelhoda:2005aa,
+	Author = {Mohamed Ibrahim Abouelhoda and Enno Ohlebusch},
+	Journal = {J. Discrete Algorithms},
+	Pages = {321-41},
+	Title = {Chaining algorithms for multiple genome comparison},
+	Volume = {3},
+	Year = {2005}}
+
+@article{Ono:2013aa,
+	Author = {Ono, Yukiteru and others},
+	Journal = {Bioinformatics},
+	Pages = {119-21},
+	Title = {{PBSIM}: {PacBio} reads simulator--toward accurate genome assembly},
+	Volume = {29},
+	Year = {2013}}
+
+@article {Jain128835,
+	author = {Jain, Miten and others},
+	title = {Nanopore sequencing and assembly of a human genome with ultra-long reads},
+	year = {2017},
+	note = {doi:10.1101/128835},
+	publisher = {Cold Spring Harbor Labs Journals},
+	journal = {bioRxiv}}
+
+@article{Lau:2016aa,
+	Author = {Lau, Bayo and others},
+	Journal = {Bioinformatics},
+	Pages = {3829-3832},
+	Title = {{LongISLND}: in silico sequencing of lengthy and noisy datatypes},
+	Volume = {32},
+	Year = {2016}}
+
+@article{Robinson:2011aa,
+	Author = {Robinson, James T and others},
+	Journal = {Nat Biotechnol},
+	Pages = {24-6},
+	Title = {Integrative genomics viewer},
+	Volume = {29},
+	Year = {2011}}
+
+@article{Gotoh:1982aa,
+	Author = {Gotoh, O},
+	Journal = {J Mol Biol},
+	Pages = {705-8},
+	Title = {An improved algorithm for matching biological sequences},
+	Volume = {162},
+	Year = {1982}}
+
+@article{Altschul:1986aa,
+	Author = {Altschul, S F and Erickson, B W},
+	Journal = {Bull Math Biol},
+	Pages = {603-16},
+	Title = {Optimal sequence alignment using affine gap costs},
+	Volume = {48},
+	Year = {1986}}
+
+@article{Wu:2005vn,
+	Author = {Wu, Thomas D and Watanabe, Colin K},
+	Journal = {Bioinformatics},
+	Pages = {1859-75},
+	Title = {{GMAP}: a genomic mapping and alignment program for {mRNA} and {EST} sequences},
+	Volume = {21},
+	Year = {2005}}
+
+@article{Iwata:2012aa,
+	Author = {Iwata, Hiroaki and Gotoh, Osamu},
+	Journal = {Nucleic Acids Res},
+	Pages = {e161},
+	Title = {Benchmarking spliced alignment programs including {Spaln2}, an extended version of {Spaln} that incorporates additional species-specific features},
+	Volume = {40},
+	Year = {2012}}
+
+@article{Dobin:2013kx,
+	Author = {Dobin, Alexander and others},
+	Journal = {Bioinformatics},
+	Pages = {15-21},
+	Title = {{STAR}: ultrafast universal {RNA-seq} aligner},
+	Volume = {29},
+	Year = {2013}}
+
+@article{Byrne:2017aa,
+	Author = {Byrne, Ashley and others},
+	Journal = {Nat Commun},
+	Pages = {16027},
+	Title = {Nanopore long-read {RNAseq} reveals widespread transcriptional variation among the surface receptors of individual {B} cells},
+	Volume = {8},
+	Year = {2017}}
+
+@article{Roberts:2004fv,
+	Author = {Roberts, Michael and others},
+	Journal = {Bioinformatics},
+	Pages = {3363-9},
+	Title = {Reducing storage requirements for biological sequence comparison},
+	Volume = {20},
+	Year = {2004}}
+
+@article{Zhang:2006aa,
+	Author = {Zhang, Miao and Gish, Warren},
+	Journal = {Bioinformatics},
+	Pages = {13-20},
+	Title = {Improved spliced alignment from an information theoretic approach},
+	Volume = {22},
+	Year = {2006}}
+
+@article{Li:2007aa,
+	Author = {Li, Heng and others},
+	Journal = {BMC Bioinformatics},
+	Pages = {349},
+	Title = {A cross-species alignment tool {(CAT)}},
+	Volume = {8},
+	Year = {2007}}
+
+@article{Farrar:2007hs,
+	Author = {Farrar, Michael},
+	Journal = {Bioinformatics},
+	Pages = {156-61},
+	Title = {{Striped Smith-Waterman speeds database searches six times over other SIMD implementations}},
+	Volume = {23},
+	Year = {2007}}
+
+@techreport{Holtgrewe:2010aa,
+	Address = {Freie Universit{\"a}t Berlin},
+	Author = {Holtgrewe, M.},
+	Institution = {Institut f{\"u}r Mathematik und Informatik},
+	Number = {TR-B-10-06},
+	Title = {Mason -- a read simulator for second generation sequencing data},
+	Year = {2010}}
+
+@article{Zaharia:2011aa,
+	Author = {Zaharia, Matei and others},
+	Journal = {arXiv:1111:5572},
+	Title = {Faster and More Accurate Sequence Alignment with {SNAP}},
+	Year = {2011}}
+
+@article{Irimia:2008aa,
+	Author = {Irimia, Manuel and Roy, Scott William},
+	Journal = {PLoS Genet},
+	Pages = {e1000148},
+	Title = {Evolutionary convergence on highly-conserved 3' intron structures in intron-poor eukaryotes and insights into the ancestral eukaryotic genome},
+	Volume = {4},
+	Year = {2008}}
+
+@article{Depristo:2011vn,
+	Author = {Depristo, Mark A and others},
+	Journal = {Nat Genet},
+	Pages = {491-8},
+	Title = {A framework for variation discovery and genotyping using next-generation {DNA} sequencing data},
+	Volume = {43},
+	Year = {2011}}
+
+@article{Kurtz:2004zr,
+	Author = {Kurtz, Stefan and others},
+	Journal = {Genome Biol},
+	Pages = {R12},
+	Title = {Versatile and open software for comparing large genomes},
+	Volume = {5},
+	Year = {2004}}
+
+@article {Li223297,
+	author = {Li, Heng and others},
+	title = {New synthetic-diploid benchmark for accurate variant calling evaluation},
+	year = {2017},
+	note = {doi:10.1101/223297},
+	journal = {bioRxiv}
+}
+
+@article{Berlin:2015xy,
+	Author = {Berlin, Konstantin and others},
+	Journal = {Nat Biotechnol},
+	Pages = {623-30},
+	Title = {Assembling large genomes with single-molecule sequencing and locality-sensitive hashing},
+	Volume = {33},
+	Year = {2015}}
+
+@article{Gurevich:2013aa,
+	Author = {Gurevich, Alexey and others},
+	Journal = {Bioinformatics},
+	Pages = {1072-5},
+	Title = {{QUAST}: quality assessment tool for genome assemblies},
+	Volume = {29},
+	Year = {2013}}
+
+@article{Li:2010fk,
+	Author = {Li, Heng and Durbin, Richard},
+	Journal = {Bioinformatics},
+	Pages = {589-95},
+	Title = {Fast and accurate long-read alignment with {Burrows-Wheeler} transform},
+	Volume = {26},
+	Year = {2010}}
+
+@article{Marcais:2018aa,
+	Author = {Mar{\c c}ais, Guillaume and others},
+	Journal = {PLoS Comput Biol},
+	Pages = {e1005944},
+	Title = {{MUMmer4}: A fast and versatile genome alignment system},
+	Volume = {14},
+	Year = {2018}}
+
+@article{Li:2009ys,
+	Author = {Li, Heng and others},
+	Journal = {Bioinformatics},
+	Pages = {2078-9},
+	Title = {The {Sequence Alignment/Map format and SAMtools}},
+	Volume = {25},
+	Year = {2009}}
+
+@article{Suzuki:2018aa,
+	Author = {Suzuki, Hajime and Kasahara, Masahiro},
+	Journal = {BMC Bioinformatics},
+	Pages = {45},
+	Title = {Introducing difference recurrence relations for faster semi-global alignment of long sequences},
+	Volume = {19},
+	Year = {2018}}

tex/minimap2.tex

@@ -0,0 +1,724 @@
+\documentclass{bioinfo}
+\copyrightyear{2018}
+\pubyear{2018}
+
+\usepackage{graphicx}
+\usepackage{hyperref}
+\usepackage{url}
+\usepackage{amsmath}
+\usepackage[ruled,vlined]{algorithm2e}
+\newcommand\mycommfont[1]{\footnotesize\rmfamily{\it #1}}
+\SetCommentSty{mycommfont}
+\SetKwComment{Comment}{$\triangleright$\ }{}
+
+\usepackage{natbib}
+\bibliographystyle{apalike}
+
+\DeclareMathOperator*{\argmax}{argmax}
+
+\begin{document}
+\firstpage{1}
+
+\title[Aligning nucleotide sequences with minimap2]{Minimap2: pairwise alignment for nucleotide sequences}
+\author[Li]{Heng Li}
+\address{Broad Institute, 415 Main Street, Cambridge, MA 02142, USA}
+
+\maketitle
+
+\begin{abstract}
+
+\section{Motivation:} Recent advances in sequencing technologies promise
+ultra-long reads of $\sim$100 kilo bases (kb) in average, full-length mRNA or
+cDNA reads in high throughput and genomic contigs over 100 mega bases (Mb) in
+length. Existing alignment programs are unable or inefficient to process such data
+at scale, which presses for the development of new alignment algorithms.
+
+\section{Results:} Minimap2 is a general-purpose alignment program to map DNA or long
+mRNA sequences against a large reference database. It works with accurate short
+reads of $\ge$100bp in length, $\ge$1kb genomic reads at error rate $\sim$15\%,
+full-length noisy Direct RNA or cDNA reads, and assembly contigs or closely
+related full chromosomes of hundreds of megabases in length. Minimap2 does
+split-read alignment, employs concave gap cost for long insertions and
+deletions (INDELs) and introduces new heuristics to reduce spurious alignments.
+It is 3--4 times as fast as mainstream short-read mappers at comparable
+accuracy, and is $\ge$30 times faster than long-read genomic or cDNA
+mappers at higher accuracy, surpassing most aligners specialized in one type of
+alignment.
+
+\section{Availability and implementation:}
+\href{https://github.com/lh3/minimap2}{https://github.com/lh3/minimap2}
+
+\section{Contact:} hengli@broadinstitute.org
+\end{abstract}
+
+\section{Introduction}
+
+Single Molecule Real-Time (SMRT) sequencing technology and Oxford Nanopore
+technologies (ONT) produce reads over 10kbp in length at an error rate
+$\sim$15\%. Several aligners have been developed for such
+data~\citep{Chaisson:2012aa,Li:2013aa,Liu:2016ab,Sovic:2016aa,Liu:2017aa,Lin:2017aa,Sedlazeck169557}.
+Most of them were five times as slow as mainstream short-read
+aligners~\citep{Langmead:2012fk,Li:2013aa} in terms of the number of bases
+mapped per second. We speculated there could be substantial room for speedup on
+the thought that 10kb long sequences should be easier to map than 100bp reads
+because we can more effectively skip repetitive regions, which are often the
+bottleneck of short-read alignment. We confirmed our speculation by achieving
+approximate mapping 50 times faster than BWA-MEM~\citep{Li:2016aa}.
+\citet{Suzuki:2018aa} extended our work with a fast and novel algorithm on
+generating base-level alignment, which in turn inspired us to develop minimap2
+with added functionality.
+
+Both SMRT and ONT have been applied to the sequencing of spliced mRNAs (RNA-seq). While
+traditional mRNA aligners work~\citep{Wu:2005vn,Iwata:2012aa}, they are not
+optimized for long noisy sequence reads and are tens of times slower than
+dedicated long-read aligners. When developing minimap2 initially for aligning
+genomic DNA only, we realized minor modifications could enable the base
+algorithm to map mRNAs as well. Minimap2 becomes a first RNA-seq aligner
+specifically designed for long noisy reads. We have also extended the original
+algorithm to map short reads at a speed faster than several mainstream
+short-read mappers.
+
+In this article, we will describe the minimap2 algorithm and its applications
+to different types of input sequences. We will evaluate the performance and
+accuracy of minimap2 on several simulated and real data sets and demonstrate
+the versatility of minimap2.
+
+\begin{methods}
+\section{Methods}
+
+Minimap2 follows a typical seed-chain-align procedure as is used by most
+full-genome aligners. It collects minimizers~\citep{Roberts:2004fv} of the
+reference sequences and indexes them in a hash table, with the key being the
+hash of a minimizer and the value being a list of locations of the minimizer
+copies. Then for each query
+sequence, minimap2 takes query minimizers as \emph{seeds}, finds exact matches
+(i.e. \emph{anchors}) to the reference, and identifies sets of colinear anchors as
+\emph{chains}. If base-level alignment is requested, minimap2 applies dynamic
+programming (DP) to extend from the ends of chains and to close
+regions between adjacent anchors in chains.
+
+Minimap2 uses indexing and seeding algorithms similar to
+minimap~\citep{Li:2016aa}, and furthers the predecessor with more accurate
+chaining, the ability to produce base-level alignment and the support of
+spliced alignment.
+
+\subsection{Chaining}
+
+\subsubsection{Chaining}
+An \emph{anchor} is a 3-tuple $(x,y,w)$, indicating interval $[x-w+1,x]$ on the
+reference matching interval $[y-w+1,y]$ on the query. Given a list of anchors
+sorted by ending reference position $x$, let $f(i)$ be the maximal chaining
+score up to the $i$-th anchor in the list. $f(i)$ can be calculated with
+dynamic programming:
+\begin{equation}\label{eq:chain}
+f(i)=\max\big\{\max_{i>j\ge 1} \{ f(j)+\alpha(j,i)-\beta(j,i) \},w_i\big\}
+\end{equation}
+where $\alpha(j,i)=\min\big\{\min\{y_i-y_j,x_i-x_j\},w_i\big\}$ is the number of
+matching bases between the two anchors. $\beta(j,i)>0$ is the gap cost. It
+equals $\infty$ if $y_j\ge y_i$ or $\max\{y_i-y_j,x_i-x_j\}>G$ (i.e. the
+distance between two anchors is too large); otherwise
+\begin{equation}\label{eq:chain-gap}
+\beta(j,i)=\gamma_c\big((y_i-y_j)-(x_i-x_j)\big)
+\end{equation}
+In implementation, a gap of length $l$ costs
+\[
+\gamma_c(l)=\left\{\begin{array}{ll}
+0.01\cdot \bar{w}\cdot|l|+0.5\log_2|l| & (l\not=0) \\
+0 & (l=0)
+\end{array}\right.
+\]
+where $\bar{w}$ is the average seed length. For $N$ anchors, directly computing all $f(\cdot)$ with
+Eq.~(\ref{eq:chain}) takes $O(N^2)$ time. Although theoretically faster
+chaining algorithms exist~\citep{Abouelhoda:2005aa}, they
+are inapplicable to generic gap cost, complex to implement and usually
+associated with a large constant. We introduced a simple heuristic to
+accelerate chaining.
+
+We note that if anchor $i$ is chained to $j$, chaining $i$ to a predecessor
+of $j$ is likely to yield a lower score. When evaluating Eq.~(\ref{eq:chain}),
+we start from anchor $i-1$ and stop the process if we cannot find a better
+score after up to $h$ iterations. This approach reduces the average time to
+$O(hN)$. In practice, we can almost always find the optimal chain with
+$h=50$; even if the heuristic fails, the optimal chain is often close.
+
+\subsubsection{Backtracking}
+Let $P(i)$ be the index of the best predecessor of anchor $i$. It equals 0 if
+$f(i)=w_i$ or $\argmax_j\{f(j)+\alpha(j,i)-\beta(j,i)\}$ otherwise. For each
+anchor $i$ in the descending order of $f(i)$, we apply $P(\cdot)$ repeatedly to
+find its predecessor and mark each visited $i$ as `used', until $P(i)=0$ or we
+reach an already `used' $i$. This way we find all chains with no anchors used
+in more than one chains.
+
+\subsubsection{Identifying primary chains}\label{sec:primary}
+In the absence of copy number changes, each query segment should not be mapped
+to two places in the reference. However, chains found at the previous step may
+have significant or complete overlaps due to repeats in the reference~\citep{Li:2010fk}.
+Minimap2 used the following procedure to identify \emph{primary chains} that do
+not greatly overlap on the query.
+
+Let $Q$ be an empty set initially. For each
+chain from the best to the worst according to their chaining scores: if on the
+query, the chain overlaps with a chain in $Q$ by 50\% or higher percentage of
+the shorter chain, mark the chain as secondary to the chain in $Q$; otherwise,
+add the chain to $Q$. In the end, $Q$ contains all the primary chains. We did
+not choose a more sophisticated data structure (e.g. range tree or k-d tree)
+because this step is not the performance bottleneck.
+
+For each primary chain, minimap2 estimates its mapping quality with an
+empirical formula:
+\[
+{\rm mapQ}=40\cdot (1-f_2/f_1)\cdot\min\{1,m/10\}\cdot\log f_1
+\]
+where $\log$ denotes natural logarithm, $m$ is the number of anchors on the primary chain, $f_1$ is the chaining
+score, and $f_2\le f_1$ is the score of the best chain that is secondary to the
+primary chain. Intuitively, a chain is assigned to a higher mapping quality if
+it is long and its best secondary chain is weak.
+
+\subsubsection{Estimating per-base sequence divergence}
+Suppose a query sequence harbors $n$ seeds of length $k$, $m$ of which are
+present in a chain. We want to estimate the sequence divergence $\epsilon$
+between the query and the reference sequences in the chain. This is useful
+when base-level alignment is too expensive to perform.
+
+If we model substitutions with a homogeneous Poisson process along the query
+sequence, the probablity of seeing $k$ consecutive bases without substitutions
+is $e^{-k\epsilon}$. On the assumption that all $k$-mers are independent of
+each other, the likelihood function of $\epsilon$ is
+\[
+\mathcal{L}(\epsilon|n,m,k)=e^{-m\cdot k\epsilon}(1-e^{-k\epsilon})^{n-m}
+\]
+The maximum likelihood estimate of $\epsilon$ is
+\[
+\hat{\epsilon}=\frac{1}{k}\log\frac{n}{m}
+\]
+In reality, sequencing errors are sometimes clustered and $k$-mers are not
+independent of each other, especially when we take minimizers as seeds. These
+violate the assumptions in the derivation above. As a result, $\hat{\epsilon}$
+is only approximate and can be biased. It also ignores long deletions from the
+reference sequence. In practice, fortunately, $\hat{\epsilon}$ is often close
+to and strongly correlated with the sequence divergence estimated from
+base-level alignments. On the several datasets used in
+Section~\ref{sec:long-genomic}, the Spearman correlation coefficient is around
+$0.9$.
+
+\subsubsection{Indexing with homopolymer compressed $k$-mers}
+SmartDenovo
+(\href{https://github.com/ruanjue/smartdenovo}{https://github.com/ruanjue/smartdenovo};
+J. Ruan, personal communication) indexes reads with homopolymer-compressed (HPC)
+$k$-mers and finds the strategy improves overlap sensitivity for SMRT reads.
+Minimap2 adopts the same heuristic.
+
+The HPC string of a string $s$, denoted by ${\rm HPC}(s)$, is constructed by
+contracting homopolymers in $s$ to a single base.  An HPC $k$-mer of $s$ is a
+$k$-long substring of ${\rm HPC}(s)$. For example, suppose $s={\tt GGATTTTCCA}$,
+${\rm HPC}(s)={\tt GATCA}$ and the first HPC 4-mer is ${\tt GATC}$.
+
+To demonstrate the effectiveness of HPC $k$-mers, we performed read overlapping
+for the example {\it E. coli} SMRT reads from PBcR~\citep{Berlin:2015xy}, using
+different types of $k$-mers. With normal 15bp minimizers per 5bp window,
+minimap2 finds 90.9\% of $\ge$2kb overlaps inferred from the read-to-reference
+alignment. With HPC 19-mers per 5bp window, minimap2 finds 97.4\% of overlaps. It achieves this
+higher sensitivity by indexing 1/3 fewer minimizers, which further helps
+performance. HPC-based indexing reduces the sensitivity for current ONT reads, though.
+
+\subsection{Aligning genomic DNA}\label{sec:genomic}
+
+\subsubsection{Alignment with 2-piece affine gap cost}
+
+Minimap2 performs DP-based global alignment between adjacent anchors in a
+chain. It uses a 2-piece affine gap cost~\citep{Gotoh:1990aa}:
+\begin{equation}\label{eq:2-piece}
+\gamma_a(l)=\min\{q+|l|\cdot e,\tilde{q}+|l|\cdot\tilde{e}\}
+\end{equation}
+Without losing generality, we always assume $q+e<\tilde{q}+\tilde{e}$.
+On the condition that $e>\tilde{e}$, it applies cost $q+|l|\cdot e$ to gaps
+shorter than $\lceil(\tilde{q}-q)/(e-\tilde{e})\rceil$ and applies
+$\tilde{q}+|l|\cdot\tilde{e}$ to longer gaps.  This scheme helps to recover
+longer insertions and deletions~(INDELs).
+
+The equation to compute the optimal alignment under $\gamma_a(\cdot)$ is
+\begin{equation}\label{eq:ae86}
+\left\{\begin{array}{l}
+H_{ij} = \max\{H_{i-1,j-1}+s(i,j),E_{ij},F_{ij},\tilde{E}_{ij},\tilde{F}_{ij}\}\\
+E_{i+1,j}= \max\{H_{ij}-q,E_{ij}\}-e\\
+F_{i,j+1}= \max\{H_{ij}-q,F_{ij}\}-e\\
+\tilde{E}_{i+1,j}= \max\{H_{ij}-\tilde{q},\tilde{E}_{ij}\}-\tilde{e}\\
+\tilde{F}_{i,j+1}= \max\{H_{ij}-\tilde{q},\tilde{F}_{ij}\}-\tilde{e}
+\end{array}\right.
+\end{equation}
+where $s(i,j)$ is the score between the $i$-th reference base and $j$-th query
+base. Eq.~(\ref{eq:ae86}) is a natural extension to the equation under affine
+gap cost~\citep{Gotoh:1982aa,Altschul:1986aa}.
+
+\subsubsection{The Suzuki-Kasahara formulation}
+
+When we allow gaps longer than several hundred base pairs, nucleotide-level
+alignment is much slower than chaining. SSE acceleration is critical to the
+performance of minimap2. Traditional SSE implementations~\citep{Farrar:2007hs}
+based on Eq.~(\ref{eq:ae86}) can achieve 16-way parallelization for short
+sequences, but only 4-way parallelization when the peak alignment score reaches
+32767. Long sequence alignment may exceed this threshold. Inspired by
+\citet{Wu:1996aa} and the following work, \citet{Suzuki:2018aa} proposed a
+difference-based formulation that lifted this limitation.
+In case of 2-piece gap cost, define
+\[
+\left\{\begin{array}{ll}
+u_{ij}\triangleq H_{ij}-H_{i-1,j} & v_{ij}\triangleq H_{ij}-H_{i,j-1} \\
+x_{ij}\triangleq E_{i+1,j}-H_{ij} & \tilde{x}_{ij}\triangleq \tilde{E}_{i+1,j}-H_{ij} \\
+y_{ij}\triangleq F_{i,j+1}-H_{ij} & \tilde{y}_{ij}\triangleq \tilde{F}_{i,j+1}-H_{ij}
+\end{array}\right.
+\]
+We can transform Eq.~(\ref{eq:ae86}) to
+\begin{equation}\label{eq:suzuki}
+\left\{\begin{array}{lll}
+z_{ij}&=&\max\{s(i,j),x_{i-1,j}+v_{i-1,j},y_{i,j-1}+u_{i,j-1},\\
+&&\tilde{x}_{i-1,j}+v_{i-1,j},\tilde{y}_{i,j-1}+u_{i,j-1}\}\\
+u_{ij}&=&z_{ij}-v_{i-1,j}\\
+v_{ij}&=&z_{ij}-u_{i,j-1}\\
+x_{ij}&=&\max\{0,x_{i-1,j}+v_{i-1,j}-z_{ij}+q\}-q-e\\
+y_{ij}&=&\max\{0,y_{i,j-1}+u_{i,j-1}-z_{ij}+q\}-q-e\\
+\tilde{x}_{ij}&=&\max\{0,\tilde{x}_{i-1,j}+v_{i-1,j}-z_{ij}+\tilde{q}\}-\tilde{q}-\tilde{e}\\
+\tilde{y}_{ij}&=&\max\{0,\tilde{y}_{i,j-1}+u_{i,j-1}-z_{ij}+\tilde{q}\}-\tilde{q}-\tilde{e}
+\end{array}\right.
+\end{equation}
+where $z_{ij}$ is a temporary variable that does not need to be stored.
+
+An important property of Eq.~(\ref{eq:suzuki}) is that all values are bounded
+by scoring parameters. To see that,
+\[
+x_{ij}=E_{i+1,j}-H_{ij}=\max\{-q,E_{ij}-H_{ij}\}-e
+\]
+With $E_{ij}\le H_{ij}$, we have
+\[
+-q-e\le x_{ij}\le\max\{-q,0\}-e=-e
+\]
+and similar inequations for $y_{ij}$, $\tilde{x}_{ij}$ and $\tilde{y}_{ij}$.
+In addition,
+\[
+u_{ij}=z_{ij}-v_{i-1,j}\ge\max\{x_{i-1,j},\tilde{x}_{i-1,j}\}\ge-q-e
+\]
+As the maximum value of $z_{ij}=H_{ij}-H_{i-1,j-1}$ is $M$, the maximal
+matching score, we can derive
+\[
+u_{ij}\le M-v_{i-1,j}\le M+q+e
+\]
+In conclusion, in Eq.~(\ref{eq:suzuki}), $x$ and $y$ are bounded by $[-q-e,-e]$,
+$\tilde{x}$ and $\tilde{y}$ by $[-\tilde{q}-\tilde{e},-\tilde{e}]$, and $u$ and
+$v$ by $[-q-e,M+q+e]$. When $-128\le-q-e<M+q+e\le127$, each of them can be stored as
+a 8-bit integer. This enables 16-way SSE vectorization regardless of the peak
+score of the alignment.
+
+For a more efficient SSE implementation, we transform the row-column coordinate
+to the diagonal-antidiagonal coordinate by letting $r\gets i+j$ and $t\gets i$.
+Eq.~(\ref{eq:suzuki}) becomes:
+\begin{equation*}
+\left\{\begin{array}{lll}
+z_{rt}&=&\max\{s(t,r-t),x_{r-1,t-1}+v_{r-1,t-1},y_{r-1,t}\\
+&&+u_{r-1,t},\tilde{x}_{r-1,t-1}+v_{r-1,t-1},\tilde{y}_{r-1,t}+u_{r-1,t}\}\\
+u_{rt}&=&z_{rt}-v_{r-1,t-1}\\
+v_{rt}&=&z_{rt}-u_{r-1,t}\\
+x_{rt}&=&\max\{0,x_{r-1,t-1}+v_{r-1,t-1}-z_{rt}+q\}-q-e\\
+y_{rt}&=&\max\{0,y_{r-1,t}+u_{r-1,t}-z_{rt}+q\}-q-e\\
+\tilde{x}_{rt}&=&\max\{0,\tilde{x}_{r-1,t-1}+v_{r-1,t-1}-z_{rt}+\tilde{q}\}-\tilde{q}-\tilde{e}\\
+\tilde{y}_{rt}&=&\max\{0,\tilde{y}_{r-1,t}+u_{r-1,t}-z_{rt}+\tilde{q}\}-\tilde{q}-\tilde{e}
+\end{array}\right.
+\end{equation*}
+In this formulation, cells with the same diagonal index $r$ are independent of
+each other. This allows us to fully vectorize the computation of all cells on
+the same anti-diagonal in one inner loop. It also simplifies banded alignment (500bp band width by default),
+which would be difficult with striped vectorization~\citep{Farrar:2007hs}.
+
+On the condition that $q+e<\tilde{q}+\tilde{e}$ and $e>\tilde{e}$, the initial
+values in the diagonal-antidiagonal formuation are
+\[
+\left\{\begin{array}{l}
+x_{r-1,-1}=y_{r-1,r}=-q-e\\
+\tilde{x}_{r-1,-1}=\tilde{y}_{r-1,r}=-\tilde{q}-\tilde{e}\\
+u_{r-1,r}=v_{r-1,-1}=\eta(r)\\
+\end{array}\right.
+\]
+where
+\[
+\eta(r)=\left\{\begin{array}{ll}
+-q-e & (r=0) \\
+-e & (r<\lceil\frac{\tilde{q}-q}{e-\tilde{e}}-1\rceil) \\
+r\cdot(e-\tilde{e})-(\tilde{q}-q)-\tilde{e} & (r=\lceil\frac{\tilde{q}-q}{e-\tilde{e}}-1\rceil) \\
+-\tilde{e} & (r>\lceil\frac{\tilde{q}-q}{e-\tilde{e}}-1\rceil)
+\end{array}\right.
+\]
+These can be derived from the initial values for Eq.~(\ref{eq:ae86}).
+
+When performing global alignment, we do not need to compute $H_{rt}$ in each cell.
+We use 16-way vectorization throughout the alignment process. When extending
+alignments from ends of chains, we need to find the cell $(r,t)$ where $H_{rt}$
+reaches the maximum. We resort to 4-way vectorization to compute
+$H_{rt}=H_{r-1,t}+u_{rt}$. Because this computation is simple,
+Eq.~(\ref{eq:suzuki}) is still the dominant performance bottleneck.
+
+In practice, our 16-way vectorized implementation of global alignment is three
+times as fast as Parasail's 4-way vectorization~\citep{Daily:2016aa}.  Without
+banding, our implementation is slower than Edlib~\citep{Sosic:2017aa}, but with
+a 1000bp band, it is considerably faster. When performing global alignment
+between anchors, we expect the alignment to stay close to the diagonal of the
+DP matrix. Banding is applicable most of the time.
+
+\subsubsection{The Z-drop heuristic}
+
+With global alignment, minimap2 may force to align unrelated sequences between
+two adjacent anchors. To avoid such an artifact, we compute accumulative
+alignment score along the alignment path and break the alignment where the
+score drops too fast in the diagonal direction. More precisely, let $S(i,j)$ be
+the alignment score along the alignment path ending at cell $(i,j)$ in the DP
+matrix. We break the alignment if there exist $(i',j')$ and $(i,j)$, $i'<i$ and
+$j'<j$, such that
+\[
+S(i',j')-S(i,j)>Z+e\cdot|(i-i')-(j-j')|
+\]
+where $e$ is the gap extension cost and $Z$ is an arbitrary threshold.
+This strategy is first used in BWA-MEM. It is similar to X-drop employed in
+BLAST~\citep{Altschul:1997vn}, but unlike X-drop, it would not break the
+alignment in the presence of a single long gap.
+
+When minimap2 breaks a global alignment between two anchors, it performs local
+alignment between the two subsequences involved in the global alignment, but
+this time with the one subsequence reverse complemented. This additional
+alignment step may identify short inversions that are missed during chaining.
+
+\subsubsection{Filtering out misplaced anchors}
+Due to sequencing errors and local homology, some anchors in a chain may be
+wrong. If we blindly align regions between two misplaced anchors, we will
+produce a suboptimal alignment. To reduce this artifact, we filter out
+anchors that lead to a $>$10bp insertion and a $>$10bp deletion at the same
+time, and filter out terminal anchors that lead to a long gap towards the ends
+of a chain. These heuristics greatly alleviate the issues with misplaced
+anchors, but they are unable to fix all such errors. Local misalignment is a
+limitation of minimap2 which we hope to address in future.
+
+\subsection{Aligning spliced sequences}
+
+The algorithm described above can be adapted to spliced alignment. In this
+mode, the chaining gap cost distinguishes insertions to and deletions from the
+reference: $\gamma_c(l)$ in Eq.~(\ref{eq:chain-gap}) takes the form of
+\[
+\gamma_c(l)=\left\{\begin{array}{ll}
+0.01\cdot\bar{w}\cdot l+0.5\log_2 l & (l>0) \\
+\min\{0.01\cdot\bar{w}\cdot|l|,\log_2|l|\} & (l<0)
+\end{array}\right.
+\]
+Similarly, the gap cost function used for DP-based alignment is changed to
+\[
+\gamma_a(l)=\left\{\begin{array}{ll}
+q+l\cdot e & (l>0) \\
+\min\{q+|l|\cdot e,\tilde{q}\} & (l<0)
+\end{array}\right.
+\]
+In alignment, a deletion no shorter than $\lceil(\tilde{q}-q)/e\rceil$ is
+regarded as an intron, which pays no cost to gap extensions.
+
+To pinpoint precise splicing junctions, minimap2 introduces reference-dependent
+cost to penalize non-canonical splicing:
+\begin{equation}\label{eq:splice}
+\left\{\begin{array}{l}
+H_{ij} = \max\{H_{i-1,j-1}+s(i,j),E_{ij},F_{ij},\tilde{E}_{ij}-a(i)\}\\
+E_{i+1,j}= \max\{H_{ij}-q,E_{ij}\}-e\\
+F_{i,j+1}= \max\{H_{ij}-q,F_{ij}\}-e\\
+\tilde{E}_{i+1,j}= \max\{H_{ij}-d(i)-\tilde{q},\tilde{E}_{ij}\}\\
+\end{array}\right.
+\end{equation}
+Let $T$ be the reference sequence. $d(i)$ is computed as
+\[d(i)=\left\{\begin{array}{ll}
+0 & \mbox{if $T[i+1,i+3]$ is ${\tt GTA}$ or ${\tt GTG}$} \\
+p/2 & \mbox{if $T[i+1,i+3]$ is ${\tt GTC}$ or ${\tt GTT}$} \\
+p & \mbox{otherwise}
+\end{array}\right.\]
+where $T[i,j]$ extracts a substring of $T$ between $i$ and $j$ inclusively.
+$d(i)$ penalizes non-canonical donor sites with $p$ and less frequent Eukaryotic
+splicing signal ${\tt GT[C/T]}$ with $p/2$~\citep{Irimia:2008aa}. Similarly,
+\[a(i)=\left\{\begin{array}{ll}
+0 & \mbox{if $T[i-2,i]$ is ${\tt CAG}$ or ${\tt TAG}$} \\
+p/2 & \mbox{if $T[i-2,i]$ is ${\tt AAG}$ or ${\tt GAG}$} \\
+p & \mbox{otherwise}
+\end{array}\right.\]
+models the acceptor signal. Eq.~(\ref{eq:splice}) is close to an equation in
+\citet{Zhang:2006aa} except that we allow insertions immediately followed by
+deletions and vice versa; in addition, we use the Suzuki-Kasahara diagonal
+formulation in actual implementation.
+
+If RNA-seq reads are not sequenced from stranded libraries, the read strand
+relative to the underlying transcript is unknown. By default, minimap2 aligns
+each chain twice, first assuming ${\tt GT}$--${\tt AG}$ as the splicing signal
+and then assuming ${\tt CT}$--${\tt AC}$, the reverse complement of ${\tt
+GT}$--${\tt AG}$, as the splicing signal. The alignment with a higher score is
+taken as the final alignment. This procedure also infers the relative strand of
+reads that span canonical splicing sites.
+
+In the spliced alignment mode, minimap2 further increases the density of
+minimizers and disables banded alignment. Together with the two-round DP-based
+alignment, spliced alignment is several times slower than genomic DNA
+alignment.
+
+\subsection{Aligning short paired-end reads}
+
+During chaining, minimap2 takes a pair of reads as one fragment with a gap of
+unknown length in the middle. It applies a normal gap cost between seeds on the
+same read but is a more permissive gap cost between seeds on different reads.
+More precisely, the gap cost during chaining is ($l\not=0$):
+\[
+\gamma_c(l)=\left\{\begin{array}{ll}
+0.01\cdot\bar{w}\cdot |l|+0.5\log_2 |l| & \mbox{if two seeds on the same read} \\
+\min\{0.01\cdot\bar{w}\cdot|l|,\log_2|l|\} & \mbox{otherwise}
+\end{array}\right.
+\]
+After identifying primary chains (Section~\ref{sec:primary}), we split each
+fragment chain into two read chains and perform alignment for each read as in
+Section~\ref{sec:genomic}.  Finally, we pair hits of each read end to find
+consistent paired-end alignments.
+
+\end{methods}
+
+\section{Results}
+
+Minimap2 is implemented in the C programming language and comes with APIs in
+both C and Python. It is distributed under the MIT license, free to both
+commercial and academic uses. Minimap2 uses the same base algorithm for all
+applications, but it has to apply different sets of parameters depending on
+input data types. Similar to BWA-MEM, minimap2 introduces `presets' that
+modify multiple parameters with a simple invocation. Detailed settings
+and command-line options can be found in the minimap2 manpage. In addition to
+the applications evaluated in the following sections, minimap2 also retains
+minimap's functionality to find overlaps between long reads and to search
+against large multi-species databases such as \emph{nt} from NCBI.
+
+\subsection{Aligning long genomic reads}\label{sec:long-genomic}
+
+\begin{figure}[!tb]
+\centering
+\includegraphics[width=.5\textwidth]{roc-color.pdf}
+\caption{Evaluation on aligning simulated reads. Simulated reads were mapped 
+to the primary assembly of human genome GRCh38. A read is considered correctly
+mapped if its longest alignment overlaps with the true interval, and the
+overlap length is $\ge$10\% of the true interval length.  Read alignments are
+sorted by mapping quality in the descending order. For each mapping quality
+threshold, the fraction of alignments (out of the number of input reads) with
+mapping quality above the threshold and their error rate are
+plotted along the curve. (a) long-read alignment evaluation. 33,088 $\ge$1000bp
+reads were simulated using pbsim~\citep{Ono:2013aa} with error profile sampled
+from file `m131017\_060208\_42213\_*.1.*' downloaded at
+\href{http://bit.ly/chm1p5c3}{http://bit.ly/chm1p5c3}. The N50 read length is
+11,628. Aligners were run under the default setting for SMRT reads.
+Kart outputted all alignments at mapping quality 60, so is not shown in the
+figure. It mapped nearly all reads with 4.1\% of alignments being wrong, less
+accurate than others.  (b) short-read alignment evaluation. 10 million pairs of
+150bp reads were simulated using mason2~\citep{Holtgrewe:2010aa} with option
+`\mbox{--illumina-prob-mismatch-scale 2.5}'. Short-read aligners were run under
+the default setting except for changing the maximum fragment length to
+800bp.}\label{fig:eval}
+\end{figure}
+
+As a sanity check, we evaluated minimap2 on simulated human reads along with
+BLASR~(v1.MC.rc64; \citealp{Chaisson:2012aa}),
+BWA-MEM~(v0.7.15; \citealp{Li:2013aa}),
+GraphMap~(v0.5.2; \citealp{Sovic:2016aa}),
+Kart~(v2.2.5; \citealp{Lin:2017aa}),
+minialign~(v0.5.3; \href{https://github.com/ocxtal/minialign}{https://github.com/ocxtal/minialign}) and
+NGMLR~(v0.2.5; \citealp{Sedlazeck169557}). We excluded rHAT~\citep{Liu:2016ab}
+and LAMSA~\citep{Liu:2017aa} because they either
+crashed or produced malformatted output. In this evaluation, minimap2 has
+higher power to distinguish unique and repetitive hits, and achieves overall
+higher mapping accuracy (Fig.~\ref{fig:eval}a). Minimap2 and
+NGMLR provide better mapping quality estimate: they rarely give repetitive hits
+high mapping quality.  Apparently, other aligners may
+occasionally miss close suboptimal hits and be overconfident in wrong mappings.
+On run time, minimap2 took 200 CPU seconds, comparable to minialign and Kart, and is over
+30 times faster than the rest.  Minimap2 consumed 6.8GB memory at the peak,
+more than BWA-MEM (5.4GB), similar to NGMLR and less than others.
+
+On real human SMRT reads, the relative performance and fraction of mapped reads reported by
+these aligners are broadly similar to the metrics on simulated data. We are
+unable to provide a good estimate of mapping error rate due to the lack of the
+truth.  On ONT $\sim$100kb human reads~\citep{Jain128835}, BWA-MEM failed.
+Kart, minialign and minimap2 are over 70 times faster than others. We have also
+examined tens of $\ge$100bp INDELs in IGV~\citep{Robinson:2011aa} and can
+confirm the observation by~\citet{Sedlazeck169557} that BWA-MEM often breaks
+them into shorter gaps. The issue is much alleviated with minimap2, thanks
+to the 2-piece affine gap cost.
+
+\subsection{Aligning long spliced reads}
+
+We evaluated minimap2 on SIRV control data~(AC:SRR5286959;
+\citealp{Byrne:2017aa}) where the truth is known. Minimap2 predicted 59\,918
+introns from 11\,018 reads. 93.8\% of splice juctions are precise. We examined
+wrongly predicted junctions and found the majority were caused by clustered
+splicing signals (e.g. two adjacent ${\tt GT}$ sites). When INDEL sequencing
+errors are frequent, it is difficult to find precise splicing sites in this
+case. If we allow up to 10bp distance from true splicing sites, 98.4\% of
+aligned introns are approximately correct. It is worth noting that for SIRV, we
+asked minimap2 to model the ${\tt GT..AG}$ splicing signal only without extra
+bases. This is because SIRV does not honor the evolutionarily prevalent signal
+${\tt GT[A/G]..[C/T]AG}$~\citep{Irimia:2008aa}.
+
+\begin{table}[!tb]
+\processtable{Evaluation of junction accuracy on 2D ONT reads}
+{\footnotesize\label{tab:intron}
+\begin{tabular}{p{3.1cm}rrrr}
+\toprule
+& GMAP & minimap2 & SpAln & STAR\\
+\midrule
+Run time (CPU min)        & 631      & 15.9     & 2\,076   & 33.9 \\
+Peak RAM (GByte)          & 8.9      & 14.5     & 3.2      & 29.2\vspace{1em}\\
+\# aligned reads          & 103\,669 & 104\,199 & 103\,711 & 26\,479 \\
+\# chimeric alignments    & 1\,904   & 1\,488   & 0        & 0 \\
+\# non-spliced alignments & 15\,854  & 14\,798  & 17\,033  & 10\,545\vspace{1em}\\
+\# aligned introns        & 692\,275 & 693\,553 & 692\,945 & 78\,603 \\
+\# novel introns          & 11\,239  & 3\,113   & 8\,550   & 1\,214 \\
+\% exact introns          & 83.8\%   & 94.0\%   & 87.9\%   & 55.2\% \\
+\% approx. introns        & 91.8\%   & 96.9\%   & 92.5\%   & 82.4\% \\
+\botrule
+\end{tabular}
+}{Mouse cDNA reads (AC:SRR5286960; R9.4 chemistry) were mapped to the primary assembly of mouse
+genome GRCm38 with the following tools and command options: minimap2 (`-ax
+splice'); GMAP (`-n 0 --min-intronlength 30 --cross-species'); SpAln (`-Q7 -LS
+-S3'); STARlong (according to
+\href{http://bit.ly/star-pb}{http://bit.ly/star-pb}). The alignments were
+compared to the EnsEMBL gene annotation, release 89. A predicted intron
+is \emph{novel} if it has no overlaps with any annotated introns. An intron
+is \emph{exact} if it is identical to an annotated intron. An intron is
+\emph{approximate} if both its 5'- and 3'-end are within 10bp around the ends
+of an annotated intron. Chimeric alignments are defined in the SAM spec~\citep{Li:2009ys}.}
+\end{table}
+
+We next aligned real mouse reads~\citep{Byrne:2017aa} with GMAP~(v2017-06-20;
+\citealp{Wu:2005vn}), minimap2, SpAln~(v2.3.1; \citealp{Iwata:2012aa}) and
+STAR~(v2.5.3a; \citealp{Dobin:2013kx}). In general, minimap2 is more
+consistent with existing annotations (Table~\ref{tab:intron}): it finds
+more junctions with a higher percentage being exactly or approximately correct.
+Minimap2 is over 40 times faster than GMAP and SpAln. While STAR is close to
+minimap2 in speed, it does not work well with noisy reads.
+
+We have also evaluated spliced aligners on a human Nanopore Direct RNA-seq
+dataset (\href{http://bit.ly/na12878ont}{http://bit.ly/na12878ont}). Minimap2
+aligned 10 million reads in $<$1 wall-clock hour using 16 CPU cores. 94.2\% of
+aligned splice junctions consistent with gene annotations. In comparison,
+GMAP under option `-k 14 -n 0 --min-intronlength 30 --cross-species' is 160
+times slower; 68.7\% of GMAP junctions are found in known gene annotations. The
+percentage increases to 84.1\% if an aligned junction within 10bp from an
+annotated junction is considered to be correct. On a public Iso-Seq dataset
+(human Alzheimer brain from
+\href{http://bit.ly/isoseqpub}{http://bit.ly/isoseqpub}), minimap2 is also
+faster at higher junction accuracy in comparison to other aligners in
+Table~\ref{tab:intron}.
+
+We noted that GMAP and SpAln have not been optimized for noisy reads. We are
+showing the best setting we have experimented, but their developers should be
+able to improve their accuracy further.
+
+%\begin{table}[!tb]
+%\processtable{Evaluation of junction accuracy on SMRT Iso-Seq reads}
+%{\footnotesize
+%\begin{tabular}{lrrrr}
+%\toprule
+%                          &      GMAP &  minimap2 &     SpAln &      STAR \\ % one GMAP thread took 14 days to align a tiny fraction of reads
+%\midrule
+%Run time (CPU min)        &         - &       243 &     2,352 &     1,647 \\
+%\# aligned reads          & 1,113,502 & 1,123,025 & 1,094,092 &   682,452 \\
+%\# chimeric alignments    &    48,927 &    33,091 &         0 &         0 \\
+%\# non-spliced alignments &   334,097 &   339,081 &   291,447 &   272,536 \vspace{1em}\\
+%\# aligned introns        & 8,922,221 & 9,071,755 & 9,208,564 & 3,029,121 \\
+%\# novel introns          &    48,927 &    42,773 &    82,230 &    17,791 \\
+%\% exact introns          &    90.6\% &    94.9\% &    91.7\% &    84.7\% \\
+%\% approx. introns        &    94.0\% &    96.9\% &    93.4\% &    93.8\% \\
+%\botrule
+%\end{tabular}
+%}{}
+%\end{table}
+
+\subsection{Aligning short genomic reads}
+
+We evaluated minimap2 along with Bowtie2~(v2.3.3; \citealt{Langmead:2012fk}), BWA-MEM and
+SNAP (v1.0beta23; \citealt{Zaharia:2011aa}). Minimap2 is 3--4 times as fast as Bowtie2 and
+BWA-MEM, but is 1.3 times slower than SNAP. Minimap2 is more accurate on this
+simulated data set than Bowtie2 and SNAP but less accurate than BWA-MEM
+(Fig.~\ref{fig:eval}b). Closer investigation reveals that BWA-MEM achieves
+a higher accuracy partly because it tries to locally align a read in a small
+region close to its mate. If we disable this feature, BWA-MEM becomes slightly
+less accurate than minimap2. We might implement a similar heuristic
+in minimap2 in future.
+
+To evaluate the accuracy of minimap2 on real data, we aligned human reads
+(AC:ERR1341796) with BWA-MEM and minimap2, and called SNPs and small INDELs
+with GATK HaplotypeCaller v3.5~\citep{Depristo:2011vn}. This run was sequenced
+from experimentally mixed CHM1 and CHM13 cell lines. Both of them are homozygous
+across the whole genome and have been \emph{de novo} assembled with SMRT reads
+to high quality. This allowed us to construct an independent truth variant
+dataset~\citep{Li223297} for
+ERR1341796. In this evaluation, minimap2 has higher SNP false negative rate
+(FNR; 2.6\% of minimap2 vs 2.3\% of BWA-MEM), but fewer false positive SNPs per
+million bases (FPPM; 7.0 vs 8.8), similar INDEL FNR (11.2\% vs 11.3\%) and
+similar INDEL FPPM (6.4 vs 6.5). Minimap2 is broadly comparable to BWA-MEM in the
+context of small variant calling.
+
+\subsection{Aligning long-read assemblies}
+
+Minimap2 can align a SMRT assembly (AC:GCA\_001297185.1) against GRCh38 in 7
+minutes using 8 CPU cores, over 20 times faster than nucmer from
+MUMmer4~\citep{Marcais:2018aa}. With the paftools.js script from the minimap2
+package, we called 2.67 million single-base substitutions out of 2.78Gbp
+genomic regions. The transition-to-transversion ratio (ts/tv) is 2.01. In
+comparison, using MUMmer4's dnadiff pipeline, we called 2.86 million
+substitutions in 2.83Gbp at ts/tv=1.87. Given that ts/tv averaged across the
+human genome is about 2 but ts/tv averaged over random errors is 0.5, the
+minimap2 callset arguably has higher precision at lower sensitivity.
+
+The sample being assembled is a female. Minimap2 still called 201 substitutions
+on the Y chromosome. These substitutions all come from one contig aligned at
+96.8\% sequence identity. The contig could be a segmental duplication
+absent from GRCh38. In constrast, dnadiff called 9070 substitutions on the Y
+chromosome across 73 SMRT contigs. This again implies our minimap2-based
+pipeline has higher precision.
+
+\section{Discussions}
+
+Minimap2 is a versatile mapper and pairwise aligner for nucleotide sequences.
+It works with short reads, assembly contigs and long noisy genomic and RNA-seq
+reads, and can be used as a read mapper, long-read overlapper or a full-genome
+aligner. Minimap2 is also accurate and efficient, often outperforming other
+domain-specific alignment tools in terms of both speed and accuracy.
+
+The capability of minimap2 comes from a fast base-level alignment algorithm and
+an accurate chaining algorithm. When aligning long query sequences, base-level
+alignment is often the performance bottleneck. The Suzuki-Kasahara algorithm
+greatly alleviates the bottleneck and enables DP-based splice alignment
+involving $>$100kb introns, which was impractically slow ten years ago.  The
+minimap2 chaining algorithm is fast and highly accurate by itself.  In fact,
+chaining alone is more accurate than all the other long-read mappers in
+Fig.~\ref{fig:eval}a (data not shown). This accuracy helps to reduce downstream
+base-level alignment of candidate chains, which is still several times slower than
+chaining even with the Suzuki-Kasahara improvement. In addition, taking a
+general form, minimap2 chaining can be adapted to non-typical data types such as
+spliced reads and multiple reads per fragment. This gives us the opportunity to
+extend the same base algorithm to a variety of use cases.
+
+Modern mainstream aligners often use a full-text index, such as suffix array or
+FM-index, to index reference sequences. An advantage of this approach is that
+we can use exact seeds of arbitrary lengths, which helps to increase seed
+uniqueness and reduce unsuccessful extensions. Minimap2 indexes reference
+k-mers with a hash table instead. Such fixed-length seeds are inferior to
+variable-length seeds in theory, but can be computed much more efficiently in
+practice. When a query sequence has multiple seed hits, we can afford to skip
+highly repetitive seeds without affecting the final accuracy. This further
+alleviates the concern with the seeding uniqueness. At the same time, at low
+sequence identity, it is rare to see long seeds anyway. Hash table is the ideal
+data structure for mapping long noisy sequences.
+
+\section*{Acknowledgements}
+We owe a debt of gratitude to H. Suzuki and M. Kasahara for releasing their
+masterpiece and insightful notes before formal publication. We thank M.
+Schatz, P. Rescheneder and F. Sedlazeck for pointing out the limitation of
+BWA-MEM. We are also grateful to minimap2 users who have greatly helped to
+suggest features and to fix various issues.
+
+\paragraph{Funding\textcolon} NHGRI 1R01HG010040-01
+
+\bibliography{minimap2}
+
+\end{document}

tex/mm2-s3.sam.eval

@@ -0,0 +1,62 @@
+Q	60	18579866	27	0.000001453	18579866
+Q	59	27087	4	0.000001666	18606953
+Q	58	21435	1	0.000001718	18628388
+Q	57	45663	3	0.000001874	18674051
+Q	56	36031	2	0.000001978	18710082
+Q	55	18499	2	0.000002082	18728581
+Q	54	14754	2	0.000002187	18743335
+Q	53	25541	2	0.000002291	18768876
+Q	52	26397	5	0.000002554	18795273
+Q	51	15090	3	0.000002711	18810363
+Q	50	13425	11	0.000003294	18823788
+Q	49	15175	2	0.000003397	18838963
+Q	48	19407	4	0.000003606	18858370
+Q	47	11538	16	0.000004452	18869908
+Q	46	12558	17	0.000005349	18882466
+Q	45	40362	28	0.000006817	18922828
+Q	44	10465	13	0.000007500	18933293
+Q	43	10098	20	0.000008552	18943391
+Q	42	10682	19	0.000009549	18954073
+Q	41	9823	11	0.000010125	18963896
+Q	40	9685	16	0.000010963	18973581
+Q	39	10273	18	0.000011905	18983854
+Q	38	9515	18	0.000012847	18993369
+Q	37	9474	27	0.000014261	19002843
+Q	36	10430	25	0.000015568	19013273
+Q	35	9241	34	0.000017348	19022514
+Q	34	9162	31	0.000018968	19031676
+Q	33	10164	49	0.000021532	19041840
+Q	32	9152	55	0.000024408	19050992
+Q	31	9252	35	0.000026233	19060244
+Q	30	9872	55	0.000029103	19070116
+Q	29	8938	65	0.000032496	19079054
+Q	28	8951	73	0.000036306	19088005
+Q	27	9949	95	0.000041261	19097954
+Q	26	9784	97	0.000046316	19107738
+Q	25	10126	97	0.000051366	19117864
+Q	24	11260	123	0.000057765	19129124
+Q	23	10047	114	0.000063691	19139171
+Q	22	9661	123	0.000070083	19148832
+Q	21	10339	168	0.000078813	19159171
+Q	20	17928	193	0.000088804	19177099
+Q	19	9842	193	0.000098817	19186941
+Q	18	14737	247	0.000111605	19201678
+Q	17	10218	238	0.000123934	19211896
+Q	16	10271	242	0.000136457	19222167
+Q	15	12241	333	0.000153683	19234408
+Q	14	9189	336	0.000171070	19243597
+Q	13	9493	515	0.000197734	19253090
+Q	12	11502	743	0.000236185	19264592
+Q	11	8211	507	0.000262390	19272803
+Q	10	9133	606	0.000293695	19281936
+Q	9	10014	931	0.000341801	19291950
+Q	8	8436	698	0.000377816	19300386
+Q	7	8443	705	0.000414163	19308829
+Q	6	10203	944	0.000462808	19319032
+Q	5	6936	756	0.000501760	19325968
+Q	4	6732	843	0.000545190	19332700
+Q	3	8215	1104	0.000602040	19340915
+Q	2	21201	5440	0.000882342	19362116
+Q	1	82328	22186	0.002019600	19444444
+Q	0	553853	371953	0.020562901	19998297
+U	1703

tex/mm2.approx.eval

@@ -0,0 +1,12 @@
+Q	60	32084	0	0.000000000	32084
+Q	24	318	2	0.000061725	32402
+Q	11	98	2	0.000123077	32500
+Q	8	37	2	0.000184405	32537
+Q	7	37	3	0.000276294	32574
+Q	6	40	3	0.000367940	32614
+Q	5	34	2	0.000428816	32648
+Q	4	37	5	0.000581306	32685
+Q	3	28	6	0.000764222	32713
+Q	2	38	6	0.000946536	32751
+Q	1	50	21	0.001585318	32801
+Q	0	286	150	0.006105117	33087

tex/mm2.eval

@@ -0,0 +1,13 @@
+Q	60	32477	0	0.000000000	32477
+Q	22	16	1	0.000030776	32493
+Q	21	44	1	0.000061468	32537
+Q	19	73	1	0.000091996	32610
+Q	14	66	1	0.000122414	32676
+Q	10	26	3	0.000214054	32702
+Q	8	14	1	0.000244529	32716
+Q	7	13	2	0.000305539	32729
+Q	6	47	1	0.000335611	32776
+Q	3	10	1	0.000366010	32786
+Q	2	20	2	0.000426751	32806
+Q	1	248	94	0.003267381	33054
+Q	0	31	17	0.003778147	33085

tex/natbib.sty

@@ -0,0 +1,803 @@
+%%
+%% This is file `natbib.sty',
+%% generated with the docstrip utility.
+%%
+%% The original source files were:
+%%
+%% natbib.dtx  (with options: `package,all')
+%% =============================================
+%% IMPORTANT NOTICE:
+%% 
+%% This program can be redistributed and/or modified under the terms
+%% of the LaTeX Project Public License Distributed from CTAN
+%% archives in directory macros/latex/base/lppl.txt; either
+%% version 1 of the License, or any later version.
+%% 
+%% This is a generated file.
+%% It may not be distributed without the original source file natbib.dtx.
+%% 
+%% Full documentation can be obtained by LaTeXing that original file.
+%% Only a few abbreviated comments remain here to describe the usage.
+%% =============================================
+%% Copyright 1993-2000 Patrick W Daly
+%% Max-Planck-Institut f\"ur Aeronomie
+%% Max-Planck-Str. 2
+%% D-37191 Katlenburg-Lindau
+%% Germany
+%% E-mail: daly@linmpi.mpg.de
+\NeedsTeXFormat{LaTeX2e}[1995/06/01]
+\ProvidesPackage{natbib}
+        [2000/07/24 7.0a (PWD)]
+ % This package reimplements the LaTeX \cite command to be used for various
+ % citation styles, both author-year and numerical. It accepts BibTeX
+ % output intended for many other packages, and therefore acts as a
+ % general, all-purpose citation-style interface.
+ %
+ % With standard numerical .bst files, only numerical citations are
+ % possible. With an author-year .bst file, both numerical and
+ % author-year citations are possible.
+ %
+ % If author-year citations are selected, \bibitem must have one of the
+ %   following forms:
+ %   \bibitem[Jones et al.(1990)]{key}...
+ %   \bibitem[Jones et al.(1990)Jones, Baker, and Williams]{key}...
+ %   \bibitem[Jones et al., 1990]{key}...
+ %   \bibitem[\protect\citeauthoryear{Jones, Baker, and Williams}{Jones
+ %       et al.}{1990}]{key}...
+ %   \bibitem[\protect\citeauthoryear{Jones et al.}{1990}]{key}...
+ %   \bibitem[\protect\astroncite{Jones et al.}{1990}]{key}...
+ %   \bibitem[\protect\citename{Jones et al., }1990]{key}...
+ %   \harvarditem[Jones et al.]{Jones, Baker, and Williams}{1990}{key}...
+ %
+ % This is either to be made up manually, or to be generated by an
+ % appropriate .bst file with BibTeX.
+ %                            Author-year mode     ||   Numerical mode
+ % Then, \citet{key}  ==>>  Jones et al. (1990)    ||   Jones et al. [21]
+ %       \citep{key}  ==>> (Jones et al., 1990)    ||   [21]
+ % Multiple citations as normal:
+ % \citep{key1,key2}  ==>> (Jones et al., 1990; Smith, 1989) || [21,24]
+ %                           or  (Jones et al., 1990, 1991)  || [21,24]
+ %                           or  (Jones et al., 1990a,b)     || [21,24]
+ % \cite{key} is the equivalent of \citet{key} in author-year mode
+ %                         and  of \citep{key} in numerical mode
+ % Full author lists may be forced with \citet* or \citep*, e.g.
+ %       \citep*{key}      ==>> (Jones, Baker, and Williams, 1990)
+ % Optional notes as:
+ %   \citep[chap. 2]{key}    ==>> (Jones et al., 1990, chap. 2)
+ %   \citep[e.g.,][]{key}    ==>> (e.g., Jones et al., 1990)
+ %   \citep[see][pg. 34]{key}==>> (see Jones et al., 1990, pg. 34)
+ %  (Note: in standard LaTeX, only one note is allowed, after the ref.
+ %   Here, one note is like the standard, two make pre- and post-notes.)
+ %   \citealt{key}          ==>> Jones et al. 1990
+ %   \citealt*{key}         ==>> Jones, Baker, and Williams 1990
+ %   \citealp{key}          ==>> Jones et al., 1990
+ %   \citealp*{key}         ==>> Jones, Baker, and Williams, 1990
+ % Additional citation possibilities (both author-year and numerical modes)
+ %   \citeauthor{key}       ==>> Jones et al.
+ %   \citeauthor*{key}      ==>> Jones, Baker, and Williams
+ %   \citeyear{key}         ==>> 1990
+ %   \citeyearpar{key}      ==>> (1990)
+ %   \citetext{priv. comm.} ==>> (priv. comm.)
+ % Note: full author lists depends on whether the bib style supports them;
+ %       if not, the abbreviated list is printed even when full requested.
+ %
+ % For names like della Robbia at the start of a sentence, use
+ %   \Citet{dRob98}         ==>> Della Robbia (1998)
+ %   \Citep{dRob98}         ==>> (Della Robbia, 1998)
+ %   \Citeauthor{dRob98}    ==>> Della Robbia
+ %
+ %
+ % Citation aliasing is achieved with
+ %   \defcitealias{key}{text}
+ %   \citetalias{key}  ==>> text
+ %   \citepalias{key}  ==>> (text)
+ %
+ % Defining the citation style of a given bib style:
+ % Use \bibpunct (in the preamble only) with 6 mandatory arguments:
+ %    1. opening bracket for citation
+ %    2. closing bracket
+ %    3. citation separator (for multiple citations in one \cite)
+ %    4. the letter n for numerical styles, s for superscripts
+ %        else anything for author-year
+ %    5. punctuation between authors and date
+ %    6. punctuation between years (or numbers) when common authors missing
+ % One optional argument is the character coming before post-notes. It
+ %   appears in square braces before all other arguments. May be left off.
+ % Example (and default) \bibpunct[, ]{(}{)}{;}{a}{,}{,}
+ %
+ % To make this automatic for a given bib style, named newbib, say, make
+ % a local configuration file, natbib.cfg, with the definition
+ %   \newcommand{\bibstyle@newbib}{\bibpunct...}
+ % Then the \bibliographystyle{newbib} will cause \bibstyle@newbib to
+ % be called on THE NEXT LATEX RUN (via the aux file).
+ %
+ % Such preprogrammed definitions may be invoked in the text (preamble only)
+ %  by calling \citestyle{newbib}. This is only useful if the style specified
+ %  differs from that in \bibliographystyle.
+ %
+ % With \citeindextrue and \citeindexfalse, one can control whether the
+ % \cite commands make an automatic entry of the citation in the .idx
+ % indexing file. For this, \makeindex must also be given in the preamble.
+ %
+ % LaTeX2e Options: (for selecting punctuation)
+ %   round  -  round parentheses are used (default)
+ %   square -  square brackets are used   [option]
+ %   curly  -  curly braces are used      {option}
+ %   angle  -  angle brackets are used    <option>
+ %   colon  -  multiple citations separated by colon (default)
+ %   comma  -  separated by comma
+ %   authoryear - selects author-year citations (default)
+ %   numbers-  selects numerical citations
+ %   super  -  numerical citations as superscripts
+ %   sort   -  sorts multiple citations according to order in ref. list
+ %   sort&compress   -  like sort, but also compresses numerical citations
+ %   longnamesfirst  -  makes first citation full author list
+ %   sectionbib - puts bibliography in a \section* instead of \chapter*
+ % Punctuation so selected dominates over any predefined ones.
+ % LaTeX2e options are called as, e.g.
+ %        \usepackage[square,comma]{natbib}
+ % LaTeX the source file natbib.dtx to obtain more details
+ % or the file natnotes.tex for a brief reference sheet.
+ %-----------------------------------------------------------
+\@ifclassloaded{aguplus}{\PackageError{natbib}
+  {The aguplus class already includes natbib coding,\MessageBreak
+   so you should not add it explicitly}
+  {Type <Return> for now, but then later remove\MessageBreak
+   the command \protect\usepackage{natbib} from the document}
+  \endinput}{}
+\@ifclassloaded{nlinproc}{\PackageError{natbib}
+  {The nlinproc class already includes natbib coding,\MessageBreak
+   so you should not add it explicitly}
+  {Type <Return> for now, but then later remove\MessageBreak
+   the command \protect\usepackage{natbib} from the document}
+  \endinput}{}
+\@ifclassloaded{egs}{\PackageError{natbib}
+  {The egs class already includes natbib coding,\MessageBreak
+   so you should not add it explicitly}
+  {Type <Return> for now, but then later remove\MessageBreak
+   the command \protect\usepackage{natbib} from the document}
+  \endinput}{}
+ % Define citation punctuation for some author-year styles
+ % One may add and delete at this point
+ % Or put additions into local configuration file natbib.cfg
+\newcommand\bibstyle@chicago{\bibpunct{(}{)}{;}{a}{,}{,}}
+\newcommand\bibstyle@named{\bibpunct{[}{]}{;}{a}{,}{,}}
+\newcommand\bibstyle@agu{\bibpunct{[}{]}{;}{a}{,}{,~}}%Amer. Geophys. Union
+\newcommand\bibstyle@egs{\bibpunct{(}{)}{;}{a}{,}{,}}%Eur. Geophys. Soc.
+\newcommand\bibstyle@agsm{\bibpunct{(}{)}{,}{a}{}{,}\gdef\harvardand{\&}}
+\newcommand\bibstyle@kluwer{\bibpunct{(}{)}{,}{a}{}{,}\gdef\harvardand{\&}}
+\newcommand\bibstyle@dcu{\bibpunct{(}{)}{;}{a}{;}{,}\gdef\harvardand{and}}
+\newcommand\bibstyle@aa{\bibpunct{(}{)}{;}{a}{}{,}} %Astronomy & Astrophysics
+\newcommand\bibstyle@pass{\bibpunct{(}{)}{;}{a}{,}{,}}%Planet. & Space Sci
+\newcommand\bibstyle@anngeo{\bibpunct{(}{)}{;}{a}{,}{,}}%Annales Geophysicae
+\newcommand\bibstyle@nlinproc{\bibpunct{(}{)}{;}{a}{,}{,}}%Nonlin.Proc.Geophys.
+ % Define citation punctuation for some numerical styles
+\newcommand\bibstyle@cospar{\bibpunct{/}{/}{,}{n}{}{}%
+     \gdef\NAT@biblabelnum##1{##1.}}
+\newcommand\bibstyle@esa{\bibpunct{(Ref.~}{)}{,}{n}{}{}%
+     \gdef\NAT@biblabelnum##1{##1.\hspace{1em}}}
+\newcommand\bibstyle@nature{\bibpunct{}{}{,}{s}{}{\textsuperscript{,}}%
+     \gdef\NAT@biblabelnum##1{##1.}}
+ % The standard LaTeX styles
+\newcommand\bibstyle@plain{\bibpunct{[}{]}{,}{n}{}{,}}
+\let\bibstyle@alpha=\bibstyle@plain
+\let\bibstyle@abbrv=\bibstyle@plain
+\let\bibstyle@unsrt=\bibstyle@plain
+ % The author-year modifications of the standard styles
+\newcommand\bibstyle@plainnat{\bibpunct{[}{]}{,}{a}{,}{,}}
+\let\bibstyle@abbrvnat=\bibstyle@plainnat
+\let\bibstyle@unsrtnat=\bibstyle@plainnat
+\newif\ifNAT@numbers \NAT@numbersfalse
+\newif\ifNAT@super \NAT@superfalse
+\DeclareOption{numbers}{\NAT@numberstrue
+   \ExecuteOptions{square,comma,nobibstyle}}
+\DeclareOption{super}{\NAT@supertrue\NAT@numberstrue
+   \renewcommand\NAT@open{}\renewcommand\NAT@close{}
+   \ExecuteOptions{nobibstyle}}
+\DeclareOption{authoryear}{\NAT@numbersfalse
+   \ExecuteOptions{round,colon,bibstyle}}
+\DeclareOption{round}{%
+      \renewcommand\NAT@open{(} \renewcommand\NAT@close{)}
+   \ExecuteOptions{nobibstyle}}
+\DeclareOption{square}{%
+      \renewcommand\NAT@open{[} \renewcommand\NAT@close{]}
+   \ExecuteOptions{nobibstyle}}
+\DeclareOption{angle}{%
+      \renewcommand\NAT@open{$<$} \renewcommand\NAT@close{$>$}
+   \ExecuteOptions{nobibstyle}}
+\DeclareOption{curly}{%
+      \renewcommand\NAT@open{\{} \renewcommand\NAT@close{\}}
+   \ExecuteOptions{nobibstyle}}
+\DeclareOption{comma}{\renewcommand\NAT@sep{,}
+   \ExecuteOptions{nobibstyle}}
+\DeclareOption{colon}{\renewcommand\NAT@sep{;}
+   \ExecuteOptions{nobibstyle}}
+\DeclareOption{nobibstyle}{\let\bibstyle=\@gobble}
+\DeclareOption{bibstyle}{\let\bibstyle=\@citestyle}
+\newif\ifNAT@openbib \NAT@openbibfalse
+\DeclareOption{openbib}{\NAT@openbibtrue}
+\DeclareOption{sectionbib}{\def\NAT@sectionbib{on}}
+\def\NAT@sort{0}
+\DeclareOption{sort}{\def\NAT@sort{1}}
+\DeclareOption{sort&compress}{\def\NAT@sort{2}}
+\@ifpackageloaded{cite}{\PackageWarningNoLine{natbib}
+  {The `cite' package should not be used\MessageBreak
+   with natbib. Use option `sort' instead}\ExecuteOptions{sort}}{}
+\newif\ifNAT@longnames\NAT@longnamesfalse
+\DeclareOption{longnamesfirst}{\NAT@longnamestrue}
+\DeclareOption{nonamebreak}{\def\NAT@nmfmt#1{\mbox{\NAT@up#1}}}
+\def\NAT@nmfmt#1{{\NAT@up#1}}
+\renewcommand\bibstyle[1]{\@ifundefined{bibstyle@#1}{\relax}
+     {\csname bibstyle@#1\endcsname}}
+\AtBeginDocument{\global\let\bibstyle=\@gobble}
+\let\@citestyle\bibstyle
+\newcommand\citestyle[1]{\@citestyle{#1}\let\bibstyle\@gobble}
+\@onlypreamble{\citestyle}\@onlypreamble{\@citestyle}
+\newcommand\bibpunct[7][, ]%
+  {\gdef\NAT@open{#2}\gdef\NAT@close{#3}\gdef
+   \NAT@sep{#4}\global\NAT@numbersfalse\ifx #5n\global\NAT@numberstrue
+   \else
+   \ifx #5s\global\NAT@numberstrue\global\NAT@supertrue
+   \fi\fi
+   \gdef\NAT@aysep{#6}\gdef\NAT@yrsep{#7}%
+   \gdef\NAT@cmt{#1}%
+   \global\let\bibstyle\@gobble
+  }
+\@onlypreamble{\bibpunct}
+\newcommand\NAT@open{(} \newcommand\NAT@close{)}
+\newcommand\NAT@sep{;}
+\ProcessOptions
+\newcommand\NAT@aysep{,} \newcommand\NAT@yrsep{,}
+\newcommand\NAT@cmt{, }
+\newcommand\NAT@cite%
+    [3]{\ifNAT@swa\NAT@@open\if*#2*\else#2\ \fi
+        #1\if*#3*\else\NAT@cmt#3\fi\NAT@@close\else#1\fi\endgroup}
+\newcommand\NAT@citenum%
+    [3]{\ifNAT@swa\NAT@@open\if*#2*\else#2\ \fi
+        #1\if*#3*\else\NAT@cmt#3\fi\NAT@@close\else#1\fi\endgroup}
+\newcommand\NAT@citesuper[3]{\ifNAT@swa
+\unskip\hspace{1\p@}\textsuperscript{#1}%
+   \if*#3*\else\ (#3)\fi\else #1\fi\endgroup}
+\providecommand
+  \textsuperscript[1]{\mbox{$^{\mbox{\scriptsize#1}}$}}
+\providecommand\@firstofone[1]{#1}
+\newcommand\NAT@citexnum{}
+\def\NAT@citexnum[#1][#2]#3{%
+ \NAT@sort@cites{#3}%
+ \let\@citea\@empty
+  \@cite{\def\NAT@num{-1}\let\NAT@last@yr\relax\let\NAT@nm\@empty
+    \@for\@citeb:=\NAT@cite@list\do
+    {\edef\@citeb{\expandafter\@firstofone\@citeb}%
+     \if@filesw\immediate\write\@auxout{\string\citation{\@citeb}}\fi
+     \@ifundefined{b@\@citeb\@extra@b@citeb}{%
+       {\reset@font\bfseries?}
+        \NAT@citeundefined\PackageWarning{natbib}%
+       {Citation `\@citeb' on page \thepage \space undefined}}%
+     {\let\NAT@last@num\NAT@num\let\NAT@last@nm\NAT@nm
+      \NAT@parse{\@citeb}%
+      \ifNAT@longnames\@ifundefined{bv@\@citeb\@extra@b@citeb}{%
+        \let\NAT@name=\NAT@all@names
+        \global\@namedef{bv@\@citeb\@extra@b@citeb}{}}{}%
+      \fi
+      \ifNAT@full\let\NAT@nm\NAT@all@names\else
+        \let\NAT@nm\NAT@name\fi
+      \ifNAT@swa
+       \ifnum\NAT@ctype>1\relax\@citea
+        \hyper@natlinkstart{\@citeb\@extra@b@citeb}%
+            \ifnum\NAT@ctype=2\relax\NAT@test{\NAT@ctype}%
+            \else\NAT@alias
+            \fi\hyper@natlinkend\else
+       \ifnum\NAT@sort>1
+         \begingroup\catcode`\_=8
+            \ifcat _\ifnum\z@<0\NAT@num _\else A\fi
+              \global\let\NAT@nm=\NAT@num \else \gdef\NAT@nm{-2}\fi
+            \ifcat _\ifnum\z@<0\NAT@last@num _\else A\fi
+              \global\@tempcnta=\NAT@last@num \global\advance\@tempcnta by\@ne
+              \else \global\@tempcnta\m@ne\fi
+         \endgroup
+         \ifnum\NAT@nm=\@tempcnta
+           \ifx\NAT@last@yr\relax
+             \edef\NAT@last@yr{\@citea \mbox{\noexpand\citenumfont{\NAT@num}}}%
+           \else
+             \edef\NAT@last@yr{--\penalty\@m\mbox{\noexpand\citenumfont{\NAT@num}}}%
+           \fi
+         \else
+           \NAT@last@yr \@citea \mbox{\citenumfont{\NAT@num}}%
+           \let\NAT@last@yr\relax
+         \fi
+       \else
+         \@citea \mbox{\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
+           {\citenumfont{\NAT@num}}\hyper@natlinkend}%
+       \fi
+       \fi
+       \def\@citea{\NAT@sep\penalty\@m\NAT@space}%
+      \else
+        \ifcase\NAT@ctype\relax
+          \ifx\NAT@last@nm\NAT@nm \NAT@yrsep\penalty\@m\NAT@space\else
+          \@citea \NAT@test{1}\ \NAT@@open
+          \if*#1*\else#1\ \fi\fi \NAT@mbox{%
+          \hyper@natlinkstart{\@citeb\@extra@b@citeb}%
+          {\citenumfont{\NAT@num}}\hyper@natlinkend}%
+          \def\@citea{\NAT@@close\NAT@sep\penalty\@m\ }%
+        \or\@citea
+          \hyper@natlinkstart{\@citeb\@extra@b@citeb}%
+           \NAT@test{\NAT@ctype}\hyper@natlinkend
+          \def\@citea{\NAT@sep\penalty\@m\ }%
+        \or\@citea
+          \hyper@natlinkstart{\@citeb\@extra@b@citeb}%
+           \NAT@test{\NAT@ctype}\hyper@natlinkend
+          \def\@citea{\NAT@sep\penalty\@m\ }%
+        \or\@citea
+          \hyper@natlinkstart{\@citeb\@extra@b@citeb}%
+           \NAT@alias\hyper@natlinkend
+          \def\@citea{\NAT@sep\penalty\@m\ }%
+        \fi
+      \fi
+      }}%
+      \ifnum\NAT@sort>1\relax\NAT@last@yr\fi
+      \ifNAT@swa\else\ifnum\NAT@ctype=0\if*#2*\else
+      \NAT@cmt#2\fi \NAT@@close\fi\fi}{#1}{#2}}
+\newcommand\NAT@test[1]{\ifnum#1=1 \ifx\NAT@nm\NAT@noname
+  {\reset@font\bfseries(author?)}\PackageWarning{natbib}
+  {Author undefined for citation`\@citeb'
+   \MessageBreak
+   on page \thepage}\else \NAT@nm \fi
+  \else \if\relax\NAT@date\relax
+  {\reset@font\bfseries(year?)}\PackageWarning{natbib}
+  {Year undefined for citation`\@citeb'
+   \MessageBreak
+   on page \thepage}\else \NAT@date \fi \fi}
+\let\citenumfont=\relax
+\newcommand\NAT@citex{}
+\def\NAT@citex%
+  [#1][#2]#3{%
+  \NAT@sort@cites{#3}%
+  \let\@citea\@empty
+  \@cite{\let\NAT@nm\@empty\let\NAT@year\@empty
+    \@for\@citeb:=\NAT@cite@list\do
+    {\edef\@citeb{\expandafter\@firstofone\@citeb}%
+     \if@filesw\immediate\write\@auxout{\string\citation{\@citeb}}\fi
+     \@ifundefined{b@\@citeb\@extra@b@citeb}{\@citea%
+       {\reset@font\bfseries ?}\NAT@citeundefined
+                 \PackageWarning{natbib}%
+       {Citation `\@citeb' on page \thepage \space undefined}\def\NAT@date{}}%
+     {\let\NAT@last@nm=\NAT@nm\let\NAT@last@yr=\NAT@year
+     \NAT@parse{\@citeb}%
+      \ifNAT@longnames\@ifundefined{bv@\@citeb\@extra@b@citeb}{%
+        \let\NAT@name=\NAT@all@names
+        \global\@namedef{bv@\@citeb\@extra@b@citeb}{}}{}%
+      \fi
+     \ifNAT@full\let\NAT@nm\NAT@all@names\else
+       \let\NAT@nm\NAT@name\fi
+     \ifNAT@swa\ifcase\NAT@ctype
+       \if\relax\NAT@date\relax
+         \@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
+         \NAT@nmfmt{\NAT@nm}\NAT@date\hyper@natlinkend
+       \else
+         \ifx\NAT@last@nm\NAT@nm\NAT@yrsep
+            \ifx\NAT@last@yr\NAT@year
+              \hyper@natlinkstart{\@citeb\@extra@b@citeb}\NAT@exlab
+              \hyper@natlinkend
+            \else\unskip\
+              \hyper@natlinkstart{\@citeb\@extra@b@citeb}\NAT@date
+              \hyper@natlinkend
+            \fi
+         \else\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
+           \NAT@nmfmt{\NAT@nm}%
+           \hyper@natlinkbreak{\NAT@aysep\ }{\@citeb\@extra@b@citeb}%
+           \NAT@date\hyper@natlinkend
+         \fi
+       \fi
+     \or\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
+         \NAT@nmfmt{\NAT@nm}\hyper@natlinkend
+     \or\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
+         \NAT@date\hyper@natlinkend
+     \or\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
+         \NAT@alias\hyper@natlinkend
+     \fi \def\@citea{\NAT@sep\ }%
+     \else\ifcase\NAT@ctype
+        \if\relax\NAT@date\relax
+          \@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
+          \NAT@nmfmt{\NAT@nm}\hyper@natlinkend
+        \else
+         \ifx\NAT@last@nm\NAT@nm\NAT@yrsep
+            \ifx\NAT@last@yr\NAT@year
+              \hyper@natlinkstart{\@citeb\@extra@b@citeb}\NAT@exlab
+              \hyper@natlinkend
+            \else\unskip\
+              \hyper@natlinkstart{\@citeb\@extra@b@citeb}\NAT@date
+              \hyper@natlinkend
+            \fi
+         \else\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
+           \NAT@nmfmt{\NAT@nm}%
+           \hyper@natlinkbreak{\ \NAT@@open\if*#1*\else#1\ \fi}%
+              {\@citeb\@extra@b@citeb}%
+           \NAT@date\hyper@natlinkend\fi
+        \fi
+       \or\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
+         \NAT@nmfmt{\NAT@nm}\hyper@natlinkend
+       \or\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
+         \NAT@date\hyper@natlinkend
+       \or\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
+         \NAT@alias\hyper@natlinkend
+       \fi \if\relax\NAT@date\relax\def\@citea{\NAT@sep\ }%
+           \else\def\@citea{\NAT@@close\NAT@sep\ }\fi
+     \fi
+     }}\ifNAT@swa\else\if*#2*\else\NAT@cmt#2\fi
+     \if\relax\NAT@date\relax\else\NAT@@close\fi\fi}{#1}{#2}}
+\newif\ifNAT@par \NAT@partrue
+\newcommand\NAT@@open{\ifNAT@par\NAT@open\fi}
+\newcommand\NAT@@close{\ifNAT@par\NAT@close\fi}
+\newcommand\NAT@alias{\@ifundefined{al@\@citeb\@extra@b@citeb}{%
+  {\reset@font\bfseries(alias?)}\PackageWarning{natbib}
+  {Alias undefined for citation `\@citeb'
+  \MessageBreak on page \thepage}}{\@nameuse{al@\@citeb\@extra@b@citeb}}}
+\let\NAT@up\relax
+\newcommand\NAT@Up[1]{{\let\protect\@unexpandable@protect\let~\relax
+  \expandafter\NAT@deftemp#1}\expandafter\NAT@UP\NAT@temp}
+\newcommand\NAT@deftemp[1]{\xdef\NAT@temp{#1}}
+\newcommand\NAT@UP[1]{\let\@tempa\NAT@UP\ifcat a#1\MakeUppercase{#1}%
+  \let\@tempa\relax\else#1\fi\@tempa}
+\newcommand\shortcites[1]{%
+  \@bsphack\@for\@citeb:=#1\do
+  {\edef\@citeb{\expandafter\@firstofone\@citeb}%
+   \global\@namedef{bv@\@citeb\@extra@b@citeb}{}}\@esphack}
+\newcommand\NAT@biblabel[1]{\hfill}
+\newcommand\NAT@biblabelnum[1]{\bibnumfmt{#1}}
+\newcommand\bibnumfmt[1]{[#1]}
+\def\@tempa#1{[#1]}
+\ifx\@tempa\@biblabel\let\@biblabel\@empty\fi
+\newcommand\NAT@bibsetnum[1]{\settowidth\labelwidth{\@biblabel{#1}}%
+   \setlength{\leftmargin}{\labelwidth}\addtolength{\leftmargin}{\labelsep}%
+   \setlength{\itemsep}{\bibsep}\setlength{\parsep}{\z@}%
+   \ifNAT@openbib
+     \addtolength{\leftmargin}{4mm}%
+     \setlength{\itemindent}{-4mm}%
+     \setlength{\listparindent}{\itemindent}%
+     \setlength{\parsep}{0pt}%
+   \fi
+}
+\newlength{\bibhang}
+\setlength{\bibhang}{1em}
+\newlength{\bibsep}
+{\@listi \global\bibsep\itemsep \global\advance\bibsep by\parsep}
+
+\newcommand\NAT@bibsetup%
+   [1]{\setlength{\leftmargin}{\bibhang}\setlength{\itemindent}{-\leftmargin}%
+       \setlength{\itemsep}{\bibsep}\setlength{\parsep}{\z@}}
+\newcommand\NAT@set@cites{\ifNAT@numbers
+  \ifNAT@super \let\@cite\NAT@citesuper
+     \def\NAT@mbox##1{\unskip\nobreak\hspace{1\p@}\textsuperscript{##1}}%
+     \let\citeyearpar=\citeyear
+     \let\NAT@space\relax\else
+     \let\NAT@mbox=\mbox
+     \let\@cite\NAT@citenum \def\NAT@space{ }\fi
+  \let\@citex\NAT@citexnum
+  \ifx\@biblabel\@empty\let\@biblabel\NAT@biblabelnum\fi
+  \let\@bibsetup\NAT@bibsetnum
+  \def\natexlab##1{}%
+ \else
+  \let\@cite\NAT@cite
+  \let\@citex\NAT@citex
+  \let\@biblabel\NAT@biblabel
+  \let\@bibsetup\NAT@bibsetup
+  \def\natexlab##1{##1}%
+ \fi}
+\AtBeginDocument{\NAT@set@cites}
+\AtBeginDocument{\ifx\SK@def\@undefined\else
+\ifx\SK@cite\@empty\else
+  \SK@def\@citex[#1][#2]#3{\SK@\SK@@ref{#3}\SK@@citex[#1][#2]{#3}}\fi
+\ifx\SK@citeauthor\@undefined\def\HAR@checkdef{}\else
+  \let\citeauthor\SK@citeauthor
+  \let\citefullauthor\SK@citefullauthor
+  \let\citeyear\SK@citeyear\fi
+\fi}
+\AtBeginDocument{\@ifpackageloaded{hyperref}{%
+  \ifnum\NAT@sort=2\def\NAT@sort{1}\fi}{}}
+\newif\ifNAT@full\NAT@fullfalse
+\newif\ifNAT@swa
+\DeclareRobustCommand\citet
+   {\begingroup\NAT@swafalse\def\NAT@ctype{0}\NAT@partrue
+     \@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
+\newcommand\NAT@citetp{\@ifnextchar[{\NAT@@citetp}{\NAT@@citetp[]}}
+\newcommand\NAT@@citetp{}
+\def\NAT@@citetp[#1]{\@ifnextchar[{\@citex[#1]}{\@citex[][#1]}}
+\DeclareRobustCommand\citep
+   {\begingroup\NAT@swatrue\def\NAT@ctype{0}\NAT@partrue
+         \@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
+\DeclareRobustCommand\cite
+    {\begingroup\def\NAT@ctype{0}\NAT@partrue\NAT@swatrue
+      \@ifstar{\NAT@fulltrue\NAT@cites}{\NAT@fullfalse\NAT@cites}}
+\newcommand\NAT@cites{\@ifnextchar [{\NAT@@citetp}{%
+     \ifNAT@numbers\else
+     \NAT@swafalse
+     \fi
+    \NAT@@citetp[]}}
+\DeclareRobustCommand\citealt
+   {\begingroup\NAT@swafalse\def\NAT@ctype{0}\NAT@parfalse
+         \@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
+\DeclareRobustCommand\citealp
+   {\begingroup\NAT@swatrue\def\NAT@ctype{0}\NAT@parfalse
+         \@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
+\DeclareRobustCommand\citeauthor
+   {\begingroup\NAT@swafalse\def\NAT@ctype{1}\NAT@parfalse
+    \@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
+\DeclareRobustCommand\Citet
+   {\begingroup\NAT@swafalse\def\NAT@ctype{0}\NAT@partrue
+     \let\NAT@up\NAT@Up
+     \@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
+\DeclareRobustCommand\Citep
+   {\begingroup\NAT@swatrue\def\NAT@ctype{0}\NAT@partrue
+     \let\NAT@up\NAT@Up
+         \@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
+\DeclareRobustCommand\Citealt
+   {\begingroup\NAT@swafalse\def\NAT@ctype{0}\NAT@parfalse
+     \let\NAT@up\NAT@Up
+         \@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
+\DeclareRobustCommand\Citealp
+   {\begingroup\NAT@swatrue\def\NAT@ctype{0}\NAT@parfalse
+     \let\NAT@up\NAT@Up
+         \@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
+\DeclareRobustCommand\Citeauthor
+   {\begingroup\NAT@swafalse\def\NAT@ctype{1}\NAT@parfalse
+     \let\NAT@up\NAT@Up
+    \@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
+\DeclareRobustCommand\citeyear
+   {\begingroup\NAT@swafalse\def\NAT@ctype{2}\NAT@parfalse\NAT@citetp}
+\DeclareRobustCommand\citeyearpar
+   {\begingroup\NAT@swatrue\def\NAT@ctype{2}\NAT@partrue\NAT@citetp}
+\newcommand\citetext[1]{\NAT@open#1\NAT@close}
+\DeclareRobustCommand\citefullauthor
+   {\citeauthor*}
+\newcommand\defcitealias[2]{%
+   \@ifundefined{al@#1\@extra@b@citeb}{}
+   {\PackageWarning{natbib}{Overwriting existing alias for citation #1}}
+   \@namedef{al@#1\@extra@b@citeb}{#2}}
+\DeclareRobustCommand\citetalias{\begingroup
+   \NAT@swafalse\def\NAT@ctype{3}\NAT@parfalse\NAT@citetp}
+\DeclareRobustCommand\citepalias{\begingroup
+   \NAT@swatrue\def\NAT@ctype{3}\NAT@partrue\NAT@citetp}
+\renewcommand\nocite[1]{\@bsphack
+  \@for\@citeb:=#1\do{%
+    \edef\@citeb{\expandafter\@firstofone\@citeb}%
+    \if@filesw\immediate\write\@auxout{\string\citation{\@citeb}}\fi
+    \if*\@citeb\else
+    \@ifundefined{b@\@citeb\@extra@b@citeb}{%
+       \NAT@citeundefined \PackageWarning{natbib}%
+       {Citation `\@citeb' undefined}}{}\fi}%
+  \@esphack}
+\newcommand\NAT@parse[1]{{%
+     \let\protect=\@unexpandable@protect\let~\relax
+     \let\active@prefix=\@gobble
+     \xdef\NAT@temp{\csname b@#1\@extra@b@citeb\endcsname}}%
+     \expandafter\NAT@split\NAT@temp
+     \expandafter\NAT@parse@date\NAT@date??????@@%
+     \ifciteindex\NAT@index\fi
+}
+\newcommand\NAT@split[4]{%
+  \gdef\NAT@num{#1}\gdef\NAT@name{#3}\gdef\NAT@date{#2}%
+  \gdef\NAT@all@names{#4}%
+  \ifx\NAT@noname\NAT@all@names \gdef\NAT@all@names{#3}\fi}
+\newcommand\NAT@parse@date{}
+\def\NAT@parse@date#1#2#3#4#5#6@@{%
+  \ifnum\the\catcode`#1=11\def\NAT@year{}\def\NAT@exlab{#1}\else
+  \ifnum\the\catcode`#2=11\def\NAT@year{#1}\def\NAT@exlab{#2}\else
+  \ifnum\the\catcode`#3=11\def\NAT@year{#1#2}\def\NAT@exlab{#3}\else
+  \ifnum\the\catcode`#4=11\def\NAT@year{#1#2#3}\def\NAT@exlab{#4}\else
+    \def\NAT@year{#1#2#3#4}\def\NAT@exlab{{#5}}\fi\fi\fi\fi}
+\newcommand\NAT@index{}
+\let\NAT@makeindex=\makeindex
+\renewcommand\makeindex{\NAT@makeindex
+  \renewcommand\NAT@index{\@bsphack\begingroup
+     \def~{\string~}\@wrindex{\NAT@idxtxt}}}
+\newcommand\NAT@idxtxt{\NAT@name\ \NAT@open\NAT@date\NAT@close}
+\@ifundefined{@indexfile}{}{\let\NAT@makeindex\relax\makeindex}
+\newif\ifciteindex \citeindexfalse
+\newcommand\citeindextype{default}
+\newcommand\NAT@index@alt{{\let\protect=\noexpand\let~\relax
+  \xdef\NAT@temp{\NAT@idxtxt}}\expandafter\NAT@exp\NAT@temp\@nil}
+\newcommand\NAT@exp{}
+\def\NAT@exp#1\@nil{\mbox{}\index[\citeindextype]{#1}}
+
+\AtBeginDocument{%
+\@ifpackageloaded{index}{\let\NAT@index=\NAT@index@alt}{}}
+\newcommand\NAT@ifcmd{\futurelet\NAT@temp\NAT@ifxcmd}
+\newcommand\NAT@ifxcmd{\ifx\NAT@temp\relax\else\expandafter\NAT@bare\fi}
+\def\NAT@bare#1(#2)#3(@)#4\@nil#5{%
+  \if @#2
+  \expandafter\NAT@apalk#1, , \@nil{#5}\else
+  \stepcounter{NAT@ctr}%
+  \NAT@wrout{\arabic {NAT@ctr}}{#2}{#1}{#3}{#5}
+\fi
+}
+\newcommand\NAT@wrout[5]{%
+\if@filesw
+      {\let\protect\noexpand\let~\relax
+       \immediate
+       \write\@auxout{\string\bibcite{#5}{{#1}{#2}{{#3}}{{#4}}}}}\fi
+\ignorespaces}
+\def\NAT@noname{{}}
+\renewcommand\bibitem{%
+  \@ifnextchar[{\@lbibitem}{%
+    \global\NAT@stdbsttrue
+    \stepcounter{NAT@ctr}\@lbibitem[\arabic{NAT@ctr}]}}
+\def\@lbibitem[#1]#2{%
+  \if\relax\@extra@b@citeb\relax\else
+    \@ifundefined{br@#2\@extra@b@citeb}{}{%
+     \@namedef{br@#2}{\@nameuse{br@#2\@extra@b@citeb}}}\fi
+   \@ifundefined{b@#2\@extra@b@citeb}{\def\NAT@num{}}{\NAT@parse{#2}}%
+   \item[\hfil\hyper@natanchorstart{#2\@extra@b@citeb}\@biblabel{\NAT@num}%
+    \hyper@natanchorend]%
+    \NAT@ifcmd#1(@)(@)\@nil{#2}}
+\ifx\SK@lbibitem\@undefined\else
+   \let\SK@lbibitem\@lbibitem
+   \def\@lbibitem[#1]#2{%
+     \SK@lbibitem[#1]{#2}\SK@\SK@@label{#2}\ignorespaces}\fi
+\newif\ifNAT@stdbst \NAT@stdbstfalse
+
+\AtEndDocument
+  {\ifNAT@stdbst\if@filesw\immediate\write\@auxout{\string
+   \global\string\NAT@numberstrue}\fi\fi
+  }
+\providecommand\bibcite{}
+\renewcommand\bibcite[2]{\@ifundefined{b@#1\@extra@binfo}\relax
+     {\NAT@citemultiple
+      \PackageWarningNoLine{natbib}{Citation `#1' multiply defined}}%
+  \global\@namedef{b@#1\@extra@binfo}{#2}}
+\AtEndDocument{\NAT@swatrue\let\bibcite\NAT@testdef}
+\newcommand\NAT@testdef[2]{%
+  \def\NAT@temp{#2}\expandafter \ifx \csname b@#1\@extra@binfo\endcsname
+    \NAT@temp \else \ifNAT@swa \NAT@swafalse
+       \PackageWarningNoLine{natbib}{Citation(s) may have
+          changed.\MessageBreak
+          Rerun to get citations correct}\fi\fi}
+\newcommand\NAT@apalk{}
+\def\NAT@apalk#1, #2, #3\@nil#4{\if\relax#2\relax
+  \global\NAT@stdbsttrue
+  \NAT@wrout{#1}{}{}{}{#4}\else
+  \stepcounter{NAT@ctr}%
+  \NAT@wrout{\arabic {NAT@ctr}}{#2}{#1}{}{#4}\fi}
+\newcommand\citeauthoryear{}
+\def\citeauthoryear#1#2#3(@)(@)\@nil#4{\stepcounter{NAT@ctr}\if\relax#3\relax
+   \NAT@wrout{\arabic {NAT@ctr}}{#2}{#1}{}{#4}\else
+   \NAT@wrout{\arabic {NAT@ctr}}{#3}{#2}{#1}{#4}\fi}
+\newcommand\citestarts{\NAT@open}
+\newcommand\citeends{\NAT@close}
+\newcommand\betweenauthors{and}
+\newcommand\astroncite{}
+\def\astroncite#1#2(@)(@)\@nil#3{\stepcounter{NAT@ctr}\NAT@wrout{\arabic
+{NAT@ctr}}{#2}{#1}{}{#3}}
+\newcommand\citename{}
+\def\citename#1#2(@)(@)\@nil#3{\expandafter\NAT@apalk#1#2, \@nil{#3}}
+\newcommand\harvarditem[4][]%
+    {\if\relax#1\relax\bibitem[#2(#3)]{#4}\else
+        \bibitem[#1(#3)#2]{#4}\fi }
+\newcommand\harvardleft{\NAT@open}
+\newcommand\harvardright{\NAT@close}
+\newcommand\harvardyearleft{\NAT@open}
+\newcommand\harvardyearright{\NAT@close}
+\AtBeginDocument{\providecommand{\harvardand}{and}}
+\newcommand\harvardurl[1]{\textbf{URL:} \textit{#1}}
+\providecommand\bibsection{}
+\@ifundefined{chapter}%
+  {\renewcommand\bibsection{\section*{\refname
+    \@mkboth{\MakeUppercase{\refname}}{\MakeUppercase{\refname}}}}}
+  {\@ifundefined{NAT@sectionbib}%
+    {\renewcommand\bibsection{\chapter*{\bibname
+     \@mkboth{\MakeUppercase{\bibname}}{\MakeUppercase{\bibname}}}}}
+    {\renewcommand\bibsection{\section*{\bibname
+     \ifx\@mkboth\@gobbletwo\else\markright{\MakeUppercase{\bibname}}\fi}}}}
+\@ifclassloaded{amsart}%
+  {\renewcommand\bibsection{\section*{\refname}}}{}
+\@ifclassloaded{amsbook}%
+  {\renewcommand\bibsection{\chapter*{\bibname}}}{}
+\@ifundefined{bib@heading}{}{\let\bibsection\bib@heading}
+\newcounter{NAT@ctr}
+\renewenvironment{thebibliography}[1]{%
+ \bibsection
+ \vspace{1\p@}\parindent \z@\bibpreamble\bibfont\list
+   {\@biblabel{\arabic{NAT@ctr}}}{\@bibsetup{#1}%
+    \setcounter{NAT@ctr}{0}}%
+    \ifNAT@openbib
+      \renewcommand\newblock{\par}
+    \else
+      \renewcommand\newblock{\hskip .11em \@plus.33em \@minus.07em}%
+    \fi
+    \sloppy\clubpenalty4000\widowpenalty4000
+    \sfcode`\.=1000\relax
+    \let\citeN\cite \let\shortcite\cite
+    \let\citeasnoun\cite\fontsize{7}{9}\selectfont
+ }{\def\@noitemerr{%
+  \PackageWarning{natbib}
+     {Empty `thebibliography' environment}}%
+  \endlist\vskip-\lastskip}
+\let\bibfont\relax
+\let\bibpreamble\relax
+\providecommand\reset@font{\relax}
+\providecommand\bibname{Bibliography}
+\providecommand\refname{References}
+\newcommand\NAT@citeundefined{\gdef \NAT@undefined {%
+    \PackageWarningNoLine{natbib}{There were undefined citations}}}
+\let \NAT@undefined \relax
+\newcommand\NAT@citemultiple{\gdef \NAT@multiple {%
+    \PackageWarningNoLine{natbib}{There were multiply defined citations}}}
+\let \NAT@multiple \relax
+\AtEndDocument{\NAT@undefined\NAT@multiple}
+\providecommand\@mkboth[2]{}
+\providecommand\MakeUppercase{\uppercase}
+\providecommand{\@extra@b@citeb}{}
+\gdef\@extra@binfo{}
+\providecommand\hyper@natanchorstart[1]{}
+\providecommand\hyper@natanchorend{}
+\providecommand\hyper@natlinkstart[1]{}
+\providecommand\hyper@natlinkend{}
+\providecommand\hyper@natlinkbreak[2]{#1}
+\@ifundefined{bbl@redefine}{}{%
+ \bbl@redefine\nocite#1{%
+  \@safe@activestrue\org@nocite{#1}\@safe@activesfalse}%
+\bbl@redefine\@lbibitem[#1]#2{%
+  \@safe@activestrue\org@@lbibitem[#1]{#2}\@safe@activesfalse}%
+}
+\AtBeginDocument{\@ifundefined{bbl@redefine}{}{%
+\bbl@redefine\@citex[#1][#2]#3{%
+  \@safe@activestrue\org@@citex[#1][#2]{#3}\@safe@activesfalse}%
+\bbl@redefine\NAT@testdef#1#2{%
+  \@safe@activestrue\org@NAT@testdef{#1}{#2}\@safe@activesfalse}%
+\@ifundefined{org@@lbibitem}{%
+\bbl@redefine\@lbibitem[#1]#2{%
+  \@safe@activestrue\org@@lbibitem[#1]{#2}\@safe@activesfalse}}{}%
+}}
+\ifnum\NAT@sort>0
+\newcommand\NAT@sort@cites[1]{%
+\@tempcntb\m@ne
+\let\@celt\delimiter
+\def\NAT@num@list{}%
+\def\NAT@cite@list{}%
+\def\NAT@nonsort@list{}%
+\@for \@citeb:=#1\do{\NAT@make@cite@list}%
+\edef\NAT@cite@list{\NAT@cite@list\NAT@nonsort@list}%
+\edef\NAT@cite@list{\expandafter\NAT@xcom\NAT@cite@list @@}}
+\begingroup \catcode`\_=8
+\gdef\NAT@make@cite@list{%
+     \edef\@citeb{\expandafter\@firstofone\@citeb}%
+    \@ifundefined{b@\@citeb\@extra@b@citeb}{\def\NAT@num{A}}%
+    {\NAT@parse{\@citeb}}%
+      \ifcat _\ifnum\z@<0\NAT@num _\else A\fi
+       \@tempcnta\NAT@num \relax
+       \ifnum \@tempcnta>\@tempcntb
+          \edef\NAT@num@list{\NAT@num@list \@celt{\NAT@num}}%
+          \edef\NAT@cite@list{\NAT@cite@list\@citeb,}%
+          \@tempcntb\@tempcnta
+       \else
+          \let\NAT@@cite@list=\NAT@cite@list \def\NAT@cite@list{}%
+          \edef\NAT@num@list{\expandafter\NAT@num@celt \NAT@num@list \@gobble @}%
+          {\let\@celt=\NAT@celt\NAT@num@list}%
+       \fi
+    \else
+       \edef\NAT@nonsort@list{\NAT@nonsort@list\@citeb,}%
+ \fi}
+\endgroup
+\def\NAT@celt#1{\ifnum #1<\@tempcnta
+  \xdef\NAT@cite@list{\NAT@cite@list\expandafter\NAT@nextc\NAT@@cite@list @@}%
+  \xdef\NAT@@cite@list{\expandafter\NAT@restc\NAT@@cite@list}%
+ \else
+  \xdef\NAT@cite@list{\NAT@cite@list\@citeb,\NAT@@cite@list}\let\@celt\@gobble%
+ \fi}
+\def\NAT@num@celt#1#2{\ifx \@celt #1%
+     \ifnum #2<\@tempcnta
+        \@celt{#2}%
+        \expandafter\expandafter\expandafter\NAT@num@celt
+     \else
+        \@celt{\number\@tempcnta}\@celt{#2}%
+  \fi\fi}
+\def\NAT@nextc#1,#2@@{#1,}
+\def\NAT@restc#1,#2{#2}
+\def\NAT@xcom#1,@@{#1}
+\else
+ \newcommand\NAT@sort@cites[1]{\edef\NAT@cite@list{#1}}\fi
+\InputIfFileExists{natbib.cfg}
+       {\typeout{Local config file natbib.cfg used}}{}
+%% 
+%% <<<<< End of generated file <<<<<<
+%%
+%% End of file `natbib.sty'.

tex/ngmlr.eval

@@ -0,0 +1,38 @@
+Q	60	23616	0	0.000000000
+Q	45	3520	1	0.000036851
+Q	41	1840	1	0.000069023
+Q	37	328	2	0.000136500
+Q	36	276	1	0.000169033
+Q	35	480	1	0.000199601
+Q	33	375	2	0.000262855
+Q	31	178	2	0.000326659
+Q	30	153	5	0.000487551
+Q	29	200	1	0.000516696
+Q	27	100	3	0.000611601
+Q	26	93	3	0.000706056
+Q	25	75	2	0.000768393
+Q	24	82	1	0.000798314
+Q	23	80	6	0.000987387
+Q	22	71	6	0.001175835
+Q	21	76	7	0.001394921
+Q	20	63	9	0.001676897
+Q	19	55	4	0.001800322
+Q	18	62	8	0.002048987
+Q	17	55	7	0.002265718
+Q	16	60	10	0.002575539
+Q	15	82	9	0.002850877
+Q	14	67	7	0.003063745
+Q	13	62	11	0.003401042
+Q	12	64	13	0.003799084
+Q	11	56	5	0.003947900
+Q	10	58	17	0.004468303
+Q	9	70	22	0.005139796
+Q	8	23	9	0.005414604
+Q	7	41	17	0.005933068
+Q	6	42	18	0.006480881
+Q	5	33	9	0.006751757
+Q	4	29	9	0.007022948
+Q	3	27	15	0.007478764
+Q	2	23	10	0.007781024
+Q	1	9	2	0.007840364
+Q	0	13	8	0.008083105

tex/roc.gp

@@ -0,0 +1,60 @@
+set t po eps enh co so "Helvetica,26"
+
+set style line 1 lt 1 pt 1 lc rgb "#e41a1c" lw 2;
+set style line 2 lt 1 pt 2 lc rgb "#377eb8" lw 2;
+set style line 3 lt 1 pt 3 lc rgb "#4daf4a" lw 2;
+set style line 4 lt 1 pt 4 lc rgb "#984ea3" lw 2;
+set style line 5 lt 1 pt 6 lc rgb "#ff7f00" lw 2;
+set style line 6 lt 1 pt 8 lc rgb "#f781bf" lw 2;
+
+set out "roc-color.eps"
+
+set pointsize 2.0
+set size 1.59,1.04
+set multiplot layout 1,2
+
+set label "(a)" at graph -0.245,1.06 font "Helvetica-bold,40"
+set xlab "Error rate of mapped PacBio reads"
+set ylab "Fraction of mapped reads" off +1.8
+set ytics 0.02
+set yran [0.9:1]
+
+set size 0.8,1
+set log x
+set format x "10^{%L}"
+set key bot right
+plot "<./eval2roc.pl blasr-mc.eval" u 2:3 t "blasr-mc" w lp ls 4, \
+     "<./eval2roc.pl bwa.eval" u 2:3 t "bwa-mem" w lp ls 2, \
+     "<./eval2roc.pl graphmap.eval" u 2:3 t "graphmap" w lp ls 3, \
+     "<./eval2roc.pl minialign.eval" u 2:3 t "minialign" w lp ls 1, \
+     "<./eval2roc.pl mm2.eval" u 2:3 t "minimap2" w lp ls 6, \
+     "<./eval2roc.pl ngmlr.eval" u 2:3 t "ngm-lr" w lp ls 5
+unset label
+
+set origin 0.8,0
+set size 0.79,1
+set label "(b)" at graph -0.245,1.06 font "Helvetica-bold,40"
+set xlab "Error rate of mapped short reads"
+
+set key top left
+plot "<./eval2roc.pl -n2e7 bowtie2-s3.sam.eval" u 2:3 t "bowtie2" w lp ls 5, \
+	 "<./eval2roc.pl -n2e7 bwa-s3.sam.eval" u 2:3 t "bwa-mem" w lp ls 2, \
+	 "<./eval2roc.pl -n2e7 mm2-s3.sam.eval" u 2:3 t "minimap2" w lp ls 6, \
+	 "<./eval2roc.pl -n2e7 snap-s3.sam.eval" u 2:3 t "snap" w lp ls 3
+
+#unset log
+#unset format
+#unset key
+#set log y
+#set ylab "Accumulative mapping error rate" off +0
+#set xlab "Mapping quality"
+#set yran [1e-5:0.1]
+#set ytics 1e-5,0.1
+#set format y "10^{%L}"
+#set xran [60:0] reverse
+#plot "<./eval2roc.pl blasr-mc.eval" u 1:2 w lp ls 4, \
+#     "<./eval2roc.pl bwa.eval" u 1:2 t "bwa-mem" w lp ls 2, \
+#     "<./eval2roc.pl graphmap.eval" u 1:2 t "graphmap" w lp ls 3, \
+#     "<./eval2roc.pl minialign.eval" u 1:2 t "minialign" w lp ls 1, \
+#     "<./eval2roc.pl mm2.eval" u 1:2 t "minimap2" w lp ls 6, \
+#     "<./eval2roc.pl ngmlr.eval" u 1:2 t "ngm-lr" w lp ls 5

tex/snap-s3.sam.eval

@@ -0,0 +1,62 @@
+Q	60	18993268	10320	0.000543350	18993268
+Q	59	33156	216	0.000553756	19026424
+Q	58	29982	295	0.000568365	19056406
+Q	57	9412	278	0.000582666	19065818
+Q	56	11012	228	0.000594281	19076830
+Q	55	9968	235	0.000606283	19086798
+Q	54	8602	292	0.000621301	19095400
+Q	53	6094	259	0.000634662	19101494
+Q	52	5026	257	0.000647946	19106520
+Q	51	4278	224	0.000659522	19110798
+Q	50	3682	178	0.000668708	19114480
+Q	49	2750	156	0.000676772	19117230
+Q	48	2314	112	0.000682548	19119544
+Q	47	2056	96	0.000687495	19121600
+Q	46	1658	62	0.000690677	19123258
+Q	45	1492	74	0.000694493	19124750
+Q	44	1150	56	0.000697379	19125900
+Q	43	1062	48	0.000699850	19126962
+Q	42	976	60	0.000702951	19127938
+Q	41	884	36	0.000704800	19128822
+Q	40	708	52	0.000707493	19129530
+Q	39	870	26	0.000708819	19130400
+Q	38	598	26	0.000710156	19130998
+Q	37	542	34	0.000711913	19131540
+Q	36	846	50	0.000714495	19132386
+Q	35	590	50	0.000717087	19132976
+Q	34	550	42	0.000719261	19133526
+Q	33	2174	66	0.000722628	19135700
+Q	32	876	86	0.000727089	19136576
+Q	31	638	104	0.000732500	19137214
+Q	30	1718	196	0.000742675	19138932
+Q	29	91022	968	0.000789497	19229954
+Q	28	12864	781	0.000829556	19242818
+Q	27	5806	427	0.000851489	19248624
+Q	26	25274	728	0.000888144	19273898
+Q	25	7418	680	0.000923070	19281316
+Q	24	11800	701	0.000958839	19293116
+Q	23	57328	3933	0.001159250	19350444
+Q	22	7662	846	0.001202494	19358106
+Q	21	5924	617	0.001233989	19364030
+Q	20	4623	574	0.001263330	19368653
+Q	19	4988	942	0.001311627	19373641
+Q	18	3968	793	0.001352282	19377609
+Q	17	3630	681	0.001387166	19381239
+Q	16	2921	513	0.001413422	19384160
+Q	15	2716	424	0.001435095	19386876
+Q	14	2366	365	0.001453744	19389242
+Q	13	2169	412	0.001474828	19391411
+Q	12	2077	360	0.001493233	19393488
+Q	11	2016	441	0.001515815	19395504
+Q	10	2292	738	0.001553682	19397796
+Q	9	4165	1832	0.001647772	19401961
+Q	8	3963	1862	0.001743385	19405924
+Q	7	3927	1793	0.001835408	19409851
+Q	6	3572	1639	0.001919497	19413423
+Q	5	3270	1533	0.001998126	19416693
+Q	4	3046	1610	0.002080718	19419739
+Q	3	251447	125550	0.008436553	19671186
+Q	2	24390	13537	0.009113417	19695576
+Q	1	124406	86780	0.013434624	19819982
+Q	0	171254	153874	0.021016609	19991236
+U	8764