mirror of
https://github.com/lh3/minimap2.git
synced 2026-09-25 19:48:12 +08:00
Compare commits
| Author | SHA1 | Date | |
|---|---|---|---|
|
|
ef3f7ea2f2 | ||
|
|
8b9f2aaf04 | ||
|
|
46e8b6a4f9 | ||
|
|
3c997ca016 | ||
|
|
101b8bb97d | ||
|
|
f4a71d447f | ||
|
|
6db9b7579c | ||
|
|
f50b9a14a7 | ||
|
|
33423e1568 | ||
|
|
aeb6b5eeb1 | ||
|
|
3d3fde8224 | ||
|
|
6f4cbf4f12 | ||
|
|
2a5d5b6f12 | ||
|
|
3d48516885 | ||
|
|
00416c76d1 | ||
|
|
2b8681ead7 | ||
|
|
0a3ebdc916 | ||
|
|
b97620afed | ||
|
|
743d26eab0 | ||
|
|
62535ecd7f | ||
|
|
40665d1083 | ||
|
|
4db1c0295c | ||
|
|
d4074874ee | ||
|
|
eccdb3a1ca | ||
|
|
a3c3db6b9b | ||
|
|
2641613686 | ||
|
|
5f96d851a8 | ||
|
|
bf8246f872 | ||
|
|
5cbd776651 | ||
|
|
0fe1a224ab | ||
|
|
240f6caaff | ||
|
|
b8bdac7e64 | ||
|
|
19e4b2aab0 | ||
|
|
ce859dbe1c | ||
|
|
a4c41f64a5 | ||
|
|
5ed2faf270 | ||
|
|
8058c85b72 | ||
|
|
993a2bb521 | ||
|
|
64c1389e1a | ||
|
|
81cff97208 | ||
|
|
bbb37d95f2 | ||
|
|
2cde8d257c | ||
|
|
b5f5929bf9 | ||
|
|
28f86688ab | ||
|
|
43506edbc5 | ||
|
|
bcfe00d2ad | ||
|
|
17c19e5819 | ||
|
|
61eef0575c | ||
|
|
53b3265d84 | ||
|
|
a23df2dc91 | ||
|
|
5a74088b74 | ||
|
|
d240318741 | ||
|
|
0f4c823b0c | ||
|
|
2d11aaa830 | ||
|
|
30b8cb4672 | ||
|
|
0c1760bc86 | ||
|
|
a99358bc3d | ||
|
|
163fa36ee6 | ||
|
|
c59b0781bc | ||
|
|
7429b12164 | ||
|
|
9e1125edda | ||
|
|
4db0d1034b | ||
|
|
3dbe23b34e | ||
|
|
6840370f3c | ||
|
|
7f9f659b6a | ||
|
|
1a7d782131 | ||
|
|
4badf2fcbf | ||
|
|
0137d0dfab | ||
|
|
5b10667967 | ||
|
|
bd1541dce1 | ||
|
|
1597f2b030 | ||
|
|
ce927d2aee | ||
|
|
8c2917b391 | ||
|
|
9fcf8b6315 | ||
|
|
3217178d4a | ||
|
|
b40598fa91 | ||
|
|
269b8661b9 | ||
|
|
890d7bbd5b | ||
|
|
1aca0d5098 | ||
|
|
68d99f0edb | ||
|
|
fd66ab5413 | ||
|
|
71f82759af | ||
|
|
648cdd8a3b | ||
|
|
7e231cfd3a | ||
|
|
95d3c30ae3 | ||
|
|
f57fd8c790 | ||
|
|
c70b20ee6d | ||
|
|
e8d00a8c8c | ||
|
|
ed4efd77bc | ||
|
|
295874ea30 | ||
|
|
9ec5f51afb | ||
|
|
28ab4d1f72 | ||
|
|
6c9390b54a | ||
|
|
9306299e4d | ||
|
|
0c563e1868 | ||
|
|
8b1e36c609 | ||
|
|
d933a263d7 | ||
|
|
7542b4b40a | ||
|
|
d6181de844 | ||
|
|
12cea727b8 | ||
|
|
cd105b47f2 | ||
|
|
35f232c3fa | ||
|
|
4c0713ee14 | ||
|
|
46de0fbdad | ||
|
|
9e09c1ae72 |
@@ -1,3 +1,5 @@
|
||||
.cproject
|
||||
.project
|
||||
.*.swp
|
||||
*.a
|
||||
*.o
|
||||
|
||||
@@ -0,0 +1,5 @@
|
||||
language: c
|
||||
compiler:
|
||||
- gcc
|
||||
- clang
|
||||
script: make
|
||||
@@ -1,15 +1,16 @@
|
||||
CC= gcc
|
||||
CFLAGS= -g -Wall -O2 -Wc++-compat
|
||||
CPPFLAGS= -DHAVE_KALLOC
|
||||
INCLUDES= -I.
|
||||
OBJS= kthread.o kalloc.o ksw2_extz2_sse.o ksw2_extd2_sse.o ksw2_ll_sse.o misc.o bseq.o \
|
||||
sketch.o sdust.o index.o chain.o align.o hit.o map.o format.o
|
||||
INCLUDES=
|
||||
OBJS= kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o index.o chain.o align.o hit.o map.o format.o ksw2_ll_sse.o
|
||||
PROG= minimap2
|
||||
PROG_EXTRA= sdust minimap2-lite
|
||||
LIBS= -lm -lz -lpthread
|
||||
|
||||
ifeq ($(sse2only),)
|
||||
CFLAGS+=-msse4
|
||||
OBJS+=ksw2_extz2_sse41.o ksw2_extd2_sse41.o ksw2_exts2_sse41.o ksw2_extz2_sse2.o ksw2_extd2_sse2.o ksw2_exts2_sse2.o ksw2_dispatch.o
|
||||
else
|
||||
OBJS+=ksw2_extz2_sse.o ksw2_extd2_sse.o ksw2_exts2_sse.o
|
||||
endif
|
||||
|
||||
.SUFFIXES:.c .o
|
||||
@@ -21,8 +22,8 @@ all:$(PROG)
|
||||
|
||||
extra:all $(PROG_EXTRA)
|
||||
|
||||
minimap2:main.o libminimap2.a
|
||||
$(CC) $(CFLAGS) $< -o $@ -L. -lminimap2 $(LIBS)
|
||||
minimap2:main.o getopt.o libminimap2.a
|
||||
$(CC) $(CFLAGS) main.o getopt.o -o $@ -L. -lminimap2 $(LIBS)
|
||||
|
||||
minimap2-lite:example.o libminimap2.a
|
||||
$(CC) $(CFLAGS) $< -o $@ -L. -lminimap2 $(LIBS)
|
||||
@@ -30,8 +31,29 @@ minimap2-lite:example.o libminimap2.a
|
||||
libminimap2.a:$(OBJS)
|
||||
$(AR) -csru $@ $(OBJS)
|
||||
|
||||
sdust:sdust.c kalloc.o kalloc.h kdq.h kvec.h kseq.h sdust.h
|
||||
$(CC) -D_SDUST_MAIN $(CFLAGS) $< kalloc.o -o $@ -lz
|
||||
sdust:sdust.c getopt.o kalloc.o kalloc.h kdq.h kvec.h kseq.h sdust.h
|
||||
$(CC) -D_SDUST_MAIN $(CFLAGS) $< getopt.o kalloc.o -o $@ -lz
|
||||
|
||||
ksw2_extz2_sse41.o:ksw2_extz2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_extz2_sse2.o:ksw2_extz2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_extd2_sse41.o:ksw2_extd2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_extd2_sse2.o:ksw2_extd2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_exts2_sse41.o:ksw2_exts2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_exts2_sse2.o:ksw2_exts2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_dispatch.o:ksw2_dispatch.c ksw2.h
|
||||
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||
|
||||
clean:
|
||||
rm -fr gmon.out *.o a.out $(PROG) $(PROG_EXTRA) *~ *.a *.dSYM session*
|
||||
@@ -45,14 +67,16 @@ align.o: minimap.h mmpriv.h bseq.h ksw2.h kalloc.h
|
||||
bseq.o: bseq.h kseq.h
|
||||
chain.o: minimap.h mmpriv.h bseq.h kalloc.h
|
||||
example.o: minimap.h kseq.h
|
||||
format.o: mmpriv.h minimap.h bseq.h
|
||||
format.o: kalloc.h mmpriv.h minimap.h bseq.h
|
||||
getopt.o: getopt.h
|
||||
hit.o: mmpriv.h minimap.h bseq.h kalloc.h
|
||||
index.o: kthread.h bseq.h minimap.h mmpriv.h kvec.h kalloc.h khash.h
|
||||
kalloc.o: kalloc.h
|
||||
ksw2_extd2_sse.o: ksw2.h kalloc.h
|
||||
ksw2_exts2_sse.o: ksw2.h kalloc.h
|
||||
ksw2_extz2_sse.o: ksw2.h kalloc.h
|
||||
ksw2_ll_sse.o: ksw2.h kalloc.h
|
||||
main.o: bseq.h minimap.h mmpriv.h
|
||||
main.o: bseq.h minimap.h mmpriv.h getopt.h
|
||||
map.o: kthread.h kvec.h kalloc.h sdust.h mmpriv.h minimap.h bseq.h
|
||||
misc.o: minimap.h ksort.h
|
||||
sdust.o: kalloc.h kdq.h kvec.h sdust.h
|
||||
|
||||
@@ -1,3 +1,64 @@
|
||||
Release 2.1.1-r341 (6 September 2017)
|
||||
-------------------------------------
|
||||
|
||||
This is a maintenance release that is expected to output identical alignment to
|
||||
v2.1. Detailed changes include:
|
||||
|
||||
* Support CPU dispatch. By default, minimap2 is compiled with both SSE2 and
|
||||
SSE4 based implementation of alignment and automatically chooses the right
|
||||
one at runtime. This avoids unexpected errors on older CPUs (#21).
|
||||
|
||||
* Improved Windows support as is requested by Oxford Nanopore (#19). Minimap2
|
||||
now avoids variable-length stacked arrays, eliminates alloca(), ships with
|
||||
getopt_long() and provides timing functions implemented with Windows APIs.
|
||||
|
||||
* Fixed a potential segmentation fault when specifying -k/-w/-H with
|
||||
multi-part index (#23).
|
||||
|
||||
* Fixed two memory leaks in example.c
|
||||
|
||||
(2.1.1: 6 September 2017, r341)
|
||||
|
||||
|
||||
|
||||
Release 2.1-r311 (25 August 2017)
|
||||
---------------------------------
|
||||
|
||||
This release adds spliced alignment for long noisy RNA-seq reads. On a SMRT
|
||||
Iso-Seq and a Oxford Nanopore data sets, minimap2 appears to outperform
|
||||
traditional mRNA aligners. For DNA alignment, this release gives almost
|
||||
identical output to v2.0. Other changes include:
|
||||
|
||||
* Added option `-R` to set the read group header line in SAM.
|
||||
|
||||
* Optionally output the `cs:Z` tag in PAF to encode both the query and the
|
||||
reference sequences in the alignment.
|
||||
|
||||
* Fixed an issue where DP alignment uses excessive memory.
|
||||
|
||||
The minimap2 technical report has been updated with more details and the
|
||||
evaluation of spliced alignment:
|
||||
|
||||
* Li, H. (2017). Minimap2: fast pairwise alignment for long nucleotide
|
||||
sequences. [arXiv:1708.01492v2](https://arxiv.org/abs/1708.01492v2).
|
||||
|
||||
(2.1: 25 August 2017, r311)
|
||||
|
||||
|
||||
|
||||
Release 2.0-r275 (8 August 2017)
|
||||
--------------------------------
|
||||
|
||||
This release is identical to version 2.0rc1, except the version number. It is
|
||||
described and evaluated in the following technical report:
|
||||
|
||||
* Li, H. (2017). Minimap2: fast pairwise alignment for long DNA sequences.
|
||||
[arXiv:1708.01492v1](https://arxiv.org/abs/1708.01492v1).
|
||||
|
||||
(2.0: 8 August 2017, r275)
|
||||
|
||||
|
||||
|
||||
Release 2.0rc1-r232 (30 July 2017)
|
||||
----------------------------------
|
||||
|
||||
|
||||
@@ -1,3 +1,4 @@
|
||||
[](https://travis-ci.org/lh3/minimap2)
|
||||
## Getting Started
|
||||
```sh
|
||||
git clone https://github.com/lh3/minimap2
|
||||
@@ -9,6 +10,8 @@ cd minimap2 && make
|
||||
./minimap2 -ax map10k MT-human.mmi test/MT-orang.fa > test.sam
|
||||
# long-read overlap (no test data)
|
||||
./minimap2 -x ava-pb your-reads.fa your-reads.fa > overlaps.paf
|
||||
# spliced alignment (no test data)
|
||||
./minimap2 -ax splice ref.fa rna-seq-reads.fa > spliced.sam
|
||||
# man page
|
||||
man ./minimap2.1
|
||||
```
|
||||
@@ -31,6 +34,10 @@ and [longISLND][longislnd]), better chaining and the ability to produce CIGAR
|
||||
with fast extension alignment (see also [libgaba][gaba] and [ksw2][ksw2]) and
|
||||
piece-wise affine gap cost.
|
||||
|
||||
If you use minimap2 in your work, please consider to cite:
|
||||
|
||||
> Li, H. (2017). Minimap2: fast pairwise alignment for long DNA sequences. [arXiv:1708.01492](https://arxiv.org/abs/1708.01492).
|
||||
|
||||
## Installation
|
||||
|
||||
For modern x86-64 CPUs, just type `make` in the source code directory. This
|
||||
|
||||
@@ -53,7 +53,7 @@ static int mm_check_zdrop(const uint8_t *qseq, const uint8_t *tseq, uint32_t n_c
|
||||
} else if (op == 1) {
|
||||
score -= q + e * len, j += len;
|
||||
if (test_zdrop_aux(score, i, j, &max, &max_i, &max_j, e, zdrop)) return 1;
|
||||
} else if (op == 2) {
|
||||
} else if (op == 2 || op == 3) {
|
||||
score -= q + e * len, i += len;
|
||||
if (test_zdrop_aux(score, i, j, &max, &max_i, &max_j, e, zdrop)) return 1;
|
||||
}
|
||||
@@ -64,11 +64,11 @@ static int mm_check_zdrop(const uint8_t *qseq, const uint8_t *tseq, uint32_t n_c
|
||||
static void mm_update_extra(mm_extra_t *p, const uint8_t *qseq, const uint8_t *tseq, const int8_t *mat, int8_t q, int8_t e)
|
||||
{
|
||||
uint32_t k, l, toff = 0, qoff = 0;
|
||||
int32_t s = 0, max = 0;
|
||||
int32_t s = 0, max = 0, n_gtag = 0, n_ctac = 0;
|
||||
if (p == 0) return;
|
||||
for (k = 0; k < p->n_cigar; ++k) {
|
||||
uint32_t op = p->cigar[k]&0xf, len = p->cigar[k]>>4;
|
||||
if (op == 0) {
|
||||
if (op == 0) { // match/mismatch
|
||||
for (l = 0; l < len; ++l) {
|
||||
int cq = qseq[qoff + l], ct = tseq[toff + l];
|
||||
if (ct > 3 || cq > 3) ++p->n_ambi;
|
||||
@@ -78,7 +78,7 @@ static void mm_update_extra(mm_extra_t *p, const uint8_t *qseq, const uint8_t *t
|
||||
else max = max > s? max : s;
|
||||
}
|
||||
toff += len, qoff += len, p->blen += len;
|
||||
} else if (op == 1) {
|
||||
} else if (op == 1) { // insertion
|
||||
int n_ambi = 0;
|
||||
for (l = 0; l < len; ++l)
|
||||
if (qseq[qoff + l] > 3) ++n_ambi;
|
||||
@@ -86,7 +86,7 @@ static void mm_update_extra(mm_extra_t *p, const uint8_t *qseq, const uint8_t *t
|
||||
p->n_ambi += n_ambi, p->n_diff += len - n_ambi;
|
||||
s -= q + e * len;
|
||||
if (s < 0) s = 0;
|
||||
} else if (op == 2) {
|
||||
} else if (op == 2) { // deletion
|
||||
int n_ambi = 0;
|
||||
for (l = 0; l < len; ++l)
|
||||
if (tseq[toff + l] > 3) ++n_ambi;
|
||||
@@ -94,9 +94,18 @@ static void mm_update_extra(mm_extra_t *p, const uint8_t *qseq, const uint8_t *t
|
||||
p->n_ambi += n_ambi, p->n_diff += len - n_ambi;
|
||||
s -= q + e * len;
|
||||
if (s < 0) s = 0;
|
||||
} else if (op == 3) { // intron
|
||||
uint8_t b[4];
|
||||
b[0] = tseq[toff], b[1] = tseq[toff+1];
|
||||
b[2] = tseq[toff+len-2], b[3] = tseq[toff+len-1];
|
||||
if (memcmp(b, "\2\3\0\2", 4) == 0) ++n_gtag;
|
||||
else if (memcmp(b, "\1\3\0\1", 4) == 0) ++n_ctac;
|
||||
toff += len, p->blen += len;
|
||||
}
|
||||
}
|
||||
p->dp_max = max;
|
||||
if (n_gtag > n_ctac) p->trans_strand = 1;
|
||||
else if (n_gtag < n_ctac) p->trans_strand = 2;
|
||||
}
|
||||
|
||||
static void mm_append_cigar(mm_reg1_t *r, uint32_t n_cigar, uint32_t *cigar) // TODO: this calls the libc realloc()
|
||||
@@ -129,10 +138,14 @@ static void mm_align_pair(void *km, const mm_mapopt_t *opt, int qlen, const uint
|
||||
if (mm_dbg_flag & MM_DBG_PRINT_ALN_SEQ) {
|
||||
int i;
|
||||
fprintf(stderr, "===> q=(%d,%d), e=(%d,%d), bw=%d, flag=%d, zdrop=%d <===\n", opt->q, opt->q2, opt->e, opt->e2, w, flag, opt->zdrop);
|
||||
for (i = 0; i < tlen; ++i) fputc("ACGTN"[tseq[i]], stderr); fputc('\n', stderr);
|
||||
for (i = 0; i < qlen; ++i) fputc("ACGTN"[qseq[i]], stderr); fputc('\n', stderr);
|
||||
for (i = 0; i < tlen; ++i) fputc("ACGTN"[tseq[i]], stderr);
|
||||
fputc('\n', stderr);
|
||||
for (i = 0; i < qlen; ++i) fputc("ACGTN"[qseq[i]], stderr);
|
||||
fputc('\n', stderr);
|
||||
}
|
||||
if (opt->q == opt->q2 && opt->e == opt->e2)
|
||||
if (opt->flag & MM_F_SPLICE)
|
||||
ksw_exts2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->noncan, opt->zdrop, flag, ez);
|
||||
else if (opt->q == opt->q2 && opt->e == opt->e2)
|
||||
ksw_extz2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, w, opt->zdrop, flag, ez);
|
||||
else
|
||||
ksw_extd2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->e2, w, opt->zdrop, flag, ez);
|
||||
@@ -159,8 +172,8 @@ static inline void mm_adjust_minier(const mm_idx_t *mi, uint8_t *const qseq0[2],
|
||||
c = mm_get_hplen_back(mi, a->x<<1>>33, (int32_t)a->x);
|
||||
*r = (int32_t)a->x + 1 - c;
|
||||
} else {
|
||||
*r = (int32_t)a->x + 1;
|
||||
*q = (int32_t)a->y + 1;
|
||||
*r = (int32_t)a->x - (mi->k>>1);
|
||||
*q = (int32_t)a->y - (mi->k>>1);
|
||||
}
|
||||
}
|
||||
|
||||
@@ -240,11 +253,11 @@ static void mm_fix_bad_ends(const mm_reg1_t *r, const mm128_t *a, int bw, int32_
|
||||
}
|
||||
}
|
||||
|
||||
static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, uint8_t *qseq0[2], mm_reg1_t *r, mm_reg1_t *r2, mm128_t *a, ksw_extz_t *ez)
|
||||
static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, uint8_t *qseq0[2], mm_reg1_t *r, mm_reg1_t *r2, mm128_t *a, ksw_extz_t *ez, int splice_flag)
|
||||
{
|
||||
int32_t rid = a[r->as].x<<1>>33, rev = a[r->as].x>>63, as1, cnt1;
|
||||
uint8_t *tseq, *qseq;
|
||||
int32_t i, l, bw, dropped = 0, rs0, re0, qs0, qe0;
|
||||
int32_t i, l, bw, dropped = 0, extra_flag = 0, rs0, re0, qs0, qe0;
|
||||
int32_t rs, re, qs, qe;
|
||||
int32_t rs1, qs1, re1, qe1;
|
||||
int8_t mat[25];
|
||||
@@ -254,11 +267,19 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
|
||||
bw = (int)(opt->bw * 1.5 + 1.);
|
||||
|
||||
r2->cnt = 0;
|
||||
mm_fix_bad_ends(r, a, opt->bw, &as1, &cnt1);
|
||||
if (!(opt->flag & MM_F_SPLICE))
|
||||
mm_fix_bad_ends(r, a, opt->bw, &as1, &cnt1);
|
||||
else as1 = r->as, cnt1 = r->cnt;
|
||||
mm_filter_bad_seeds(km, as1, cnt1, a, 10, 40, opt->max_gap>>1, 10);
|
||||
mm_adjust_minier(mi, qseq0, &a[as1], &rs, &qs);
|
||||
mm_adjust_minier(mi, qseq0, &a[as1 + cnt1 - 1], &re, &qe);
|
||||
|
||||
if (opt->flag & MM_F_SPLICE) {
|
||||
if (splice_flag & MM_F_SPLICE_FOR) extra_flag |= rev? KSW_EZ_SPLICE_REV : KSW_EZ_SPLICE_FOR;
|
||||
if (splice_flag & MM_F_SPLICE_REV) extra_flag |= rev? KSW_EZ_SPLICE_FOR : KSW_EZ_SPLICE_REV;
|
||||
if (splice_flag & MM_F_SPLICE_BOTH) extra_flag |= KSW_EZ_SPLICE_FOR|KSW_EZ_SPLICE_REV;
|
||||
}
|
||||
|
||||
// compute rs0 and qs0
|
||||
if (r->split && as1 > 0) {
|
||||
mm_adjust_minier(mi, qseq0, &a[as1-1], &rs0, &qs0);
|
||||
@@ -291,7 +312,7 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
|
||||
mm_idx_getseq(mi, rid, rs0, rs, tseq);
|
||||
mm_seq_rev(qs - qs0, qseq);
|
||||
mm_seq_rev(rs - rs0, tseq);
|
||||
mm_align_pair(km, opt, qs - qs0, qseq, rs - rs0, tseq, mat, bw, KSW_EZ_EXTZ_ONLY|KSW_EZ_RIGHT|KSW_EZ_REV_CIGAR, ez);
|
||||
mm_align_pair(km, opt, qs - qs0, qseq, rs - rs0, tseq, mat, bw, extra_flag|KSW_EZ_EXTZ_ONLY|KSW_EZ_RIGHT|KSW_EZ_REV_CIGAR, ez);
|
||||
if (ez->n_cigar > 0) {
|
||||
mm_append_cigar(r, ez->n_cigar, ez->cigar);
|
||||
r->p->dp_score += ez->max;
|
||||
@@ -313,9 +334,9 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
|
||||
bw1 = qe - qs > re - rs? qe - qs : re - rs;
|
||||
qseq = &qseq0[rev][qs];
|
||||
mm_idx_getseq(mi, rid, rs, re, tseq);
|
||||
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, mat, bw1, KSW_EZ_APPROX_MAX, ez);
|
||||
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, mat, bw1, extra_flag|KSW_EZ_APPROX_MAX, ez);
|
||||
if (mm_check_zdrop(qseq, tseq, ez->n_cigar, ez->cigar, mat, opt->q, opt->e, opt->zdrop))
|
||||
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, mat, bw1, 0, ez);
|
||||
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, mat, bw1, extra_flag, ez);
|
||||
if (ez->n_cigar > 0)
|
||||
mm_append_cigar(r, ez->n_cigar, ez->cigar);
|
||||
if (ez->zdropped) { // truncated by Z-drop; TODO: sometimes Z-drop kicks in because the next seed placement is wrong. This can be fixed in principle.
|
||||
@@ -338,7 +359,7 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
|
||||
if (!dropped && qe < qe0 && re < re0) { // right extension
|
||||
qseq = &qseq0[rev][qe];
|
||||
mm_idx_getseq(mi, rid, re, re0, tseq);
|
||||
mm_align_pair(km, opt, qe0 - qe, qseq, re0 - re, tseq, mat, bw, KSW_EZ_EXTZ_ONLY, ez);
|
||||
mm_align_pair(km, opt, qe0 - qe, qseq, re0 - re, tseq, mat, bw, extra_flag|KSW_EZ_EXTZ_ONLY, ez);
|
||||
if (ez->n_cigar > 0) {
|
||||
mm_append_cigar(r, ez->n_cigar, ez->cigar);
|
||||
r->p->dp_score += ez->max;
|
||||
@@ -356,6 +377,8 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
|
||||
if (r->p) {
|
||||
mm_idx_getseq(mi, rid, rs1, re1, tseq);
|
||||
mm_update_extra(r->p, &qseq0[r->rev][qs1], tseq, mat, opt->q, opt->e);
|
||||
if (rev && r->p->trans_strand)
|
||||
r->p->trans_strand ^= 3; // flip to the read strand
|
||||
}
|
||||
|
||||
kfree(km, tseq);
|
||||
@@ -438,7 +461,28 @@ mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *m
|
||||
memset(&ez, 0, sizeof(ksw_extz_t));
|
||||
for (i = 0; i < n_regs; ++i) {
|
||||
mm_reg1_t r2;
|
||||
mm_align1(km, opt, mi, qlen, qseq0, ®s[i], &r2, a, &ez);
|
||||
if ((opt->flag&MM_F_SPLICE) && (opt->flag&MM_F_SPLICE_FOR) && (opt->flag&MM_F_SPLICE_REV)) {
|
||||
mm_reg1_t s[2], s2[2];
|
||||
int which, trans_strand;
|
||||
s[0] = s[1] = regs[i];
|
||||
mm_align1(km, opt, mi, qlen, qseq0, &s[0], &s2[0], a, &ez, MM_F_SPLICE_FOR);
|
||||
mm_align1(km, opt, mi, qlen, qseq0, &s[1], &s2[1], a, &ez, MM_F_SPLICE_REV);
|
||||
if (s[0].p->dp_score > s[1].p->dp_score) which = 0, trans_strand = 1;
|
||||
else if (s[0].p->dp_score < s[1].p->dp_score) which = 1, trans_strand = 2;
|
||||
else trans_strand = 3, which = (qlen + s[0].p->dp_score) & 1; // randomly choose a strand, effectively
|
||||
if (which == 0) {
|
||||
regs[i] = s[0], r2 = s2[0];
|
||||
free(s[1].p);
|
||||
} else {
|
||||
regs[i] = s[1], r2 = s2[1];
|
||||
free(s[0].p);
|
||||
}
|
||||
regs[i].p->trans_strand = trans_strand;
|
||||
} else {
|
||||
mm_align1(km, opt, mi, qlen, qseq0, ®s[i], &r2, a, &ez, opt->flag);
|
||||
if ((opt->flag&MM_F_SPLICE) && !(opt->flag&MM_F_SPLICE_BOTH))
|
||||
regs[i].p->trans_strand = opt->flag&MM_F_SPLICE_FOR? 1 : 2;
|
||||
}
|
||||
if (r2.cnt > 0) regs = mm_insert_reg(&r2, i, &n_regs, regs);
|
||||
if (i > 0 && mm_align1_inv(km, opt, mi, qlen, qseq0, ®s[i-1], ®s[i], &r2, &ez)) {
|
||||
regs = mm_insert_reg(&r2, i, &n_regs, regs);
|
||||
|
||||
@@ -8,7 +8,6 @@
|
||||
KSEQ_INIT(gzFile, gzread)
|
||||
|
||||
struct mm_bseq_file_s {
|
||||
int is_eof;
|
||||
gzFile fp;
|
||||
kseq_t *ks;
|
||||
};
|
||||
@@ -53,12 +52,11 @@ mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int chunk_size, int with_qual, int
|
||||
size += seqs[n++].l_seq;
|
||||
if (size >= chunk_size) break;
|
||||
}
|
||||
if (size < chunk_size) fp->is_eof = 1;
|
||||
*n_ = n;
|
||||
return seqs;
|
||||
}
|
||||
|
||||
int mm_bseq_eof(mm_bseq_file_t *fp)
|
||||
{
|
||||
return fp->is_eof;
|
||||
return ks_eof(fp->ks->f);
|
||||
}
|
||||
|
||||
@@ -19,7 +19,7 @@ static inline int ilog2_32(uint32_t v)
|
||||
return (t = v>>8) ? 8 + LogTable256[t] : LogTable256[v];
|
||||
}
|
||||
|
||||
int mm_chain_dp(int max_dist, int bw, int max_skip, int min_cnt, int min_sc, int64_t n, mm128_t *a, uint64_t **_u, void *km)
|
||||
int mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int min_cnt, int min_sc, int is_cdna, int64_t n, mm128_t *a, uint64_t **_u, void *km)
|
||||
{ // TODO: make sure this works when n has more than 32 bits
|
||||
int32_t st = 0, k, *f, *p, *t, *v, n_u, n_v;
|
||||
int64_t i, j;
|
||||
@@ -42,17 +42,23 @@ int mm_chain_dp(int max_dist, int bw, int max_skip, int min_cnt, int min_sc, int
|
||||
uint64_t ri = a[i].x;
|
||||
int32_t qi = (int32_t)a[i].y, q_span = a[i].y>>32&0xff; // NB: only 8 bits of span is used!!!
|
||||
int32_t max_f = q_span, max_j = -1, n_skip = 0, min_d, max_f_past = -INT32_MAX;
|
||||
while (st < i && ri - a[st].x > max_dist) ++st;
|
||||
while (st < i && ri - a[st].x > max_dist_x) ++st;
|
||||
for (j = i - 1; j >= st; --j) {
|
||||
int64_t dr = ri - a[j].x;
|
||||
int32_t dq = qi - (int32_t)a[j].y, dd, sc;
|
||||
if (dr == 0 || dq <= 0 || dq > max_dist) continue;
|
||||
if (dr == 0 || dq <= 0 || dq > max_dist_y) continue;
|
||||
dd = dr > dq? dr - dq : dq - dr;
|
||||
if (dd > bw) continue;
|
||||
max_f_past = max_f_past > f[j]? max_f_past : f[j];
|
||||
min_d = dq < dr? dq : dr;
|
||||
sc = min_d > q_span? q_span : dq < dr? dq : dr;
|
||||
sc -= (int)(dd * .01 * avg_qspan) + (ilog2_32(dd)>>1);
|
||||
if (is_cdna) {
|
||||
int c_log, c_lin;
|
||||
c_lin = (int)(dd * .01 * avg_qspan);
|
||||
c_log = ilog2_32(dd);
|
||||
if (dr > dq) sc -= c_lin < c_log? c_lin : c_log;
|
||||
else sc -= c_lin + (c_log>>1);
|
||||
} else sc -= (int)(dd * .01 * avg_qspan) + (ilog2_32(dd)>>1);
|
||||
sc += f[j];
|
||||
if (sc > max_f) {
|
||||
max_f = sc, max_j = j;
|
||||
|
||||
@@ -35,13 +35,13 @@ int main(int argc, char *argv[])
|
||||
opt.flag |= MM_F_CIGAR; // perform alignment
|
||||
mm_tbuf_t *tbuf = mm_tbuf_init(); // thread buffer; for multi-threading, allocate one tbuf for each thread
|
||||
while (kseq_read(ks) >= 0) { // each kseq_read() call reads one query sequence
|
||||
const mm_reg1_t *reg;
|
||||
mm_reg1_t *reg;
|
||||
int j, i, n_reg;
|
||||
// get all hits for the query
|
||||
reg = mm_map(mi, ks->seq.l, ks->seq.s, &n_reg, tbuf, &opt, 0);
|
||||
// traverse hits and print them out
|
||||
for (j = 0; j < n_reg; ++j) {
|
||||
const mm_reg1_t *r = ®[j];
|
||||
mm_reg1_t *r = ®[j];
|
||||
assert(r->p); // with MM_F_CIGAR, this should not be NULL
|
||||
printf("%s\t%d\t%d\t%d\t%c\t", ks->name.s, ks->seq.l, r->qs, r->qe, "+-"[r->rev]);
|
||||
printf("%s\t%d\t%d\t%d\t%d\t%d\t%d\tcg:Z:", mi->seq[r->rid].name, mi->seq[r->rid].len, r->rs, r->re,
|
||||
@@ -49,7 +49,9 @@ int main(int argc, char *argv[])
|
||||
for (i = 0; i < r->p->n_cigar; ++i) // IMPORTANT: this gives the CIGAR in the aligned regions. NO soft/hard clippings!
|
||||
printf("%d%c", r->p->cigar[i]>>4, "MIDSHN"[r->p->cigar[i]&0xf]);
|
||||
putchar('\n');
|
||||
free(r->p);
|
||||
}
|
||||
free(reg);
|
||||
}
|
||||
mm_tbuf_destroy(tbuf);
|
||||
|
||||
|
||||
@@ -1,9 +1,13 @@
|
||||
#include <stdarg.h>
|
||||
#include <stdlib.h>
|
||||
#include <string.h>
|
||||
#include <assert.h>
|
||||
#include <stdio.h>
|
||||
#include "kalloc.h"
|
||||
#include "mmpriv.h"
|
||||
|
||||
static char mm_rg_id[256];
|
||||
|
||||
static inline void str_enlarge(kstring_t *s, int l)
|
||||
{
|
||||
if (s->l + l + 1 > s->m) {
|
||||
@@ -54,16 +58,141 @@ static void mm_sprintf_lite(kstring_t *s, const char *fmt, ...)
|
||||
s->s[s->l] = 0;
|
||||
}
|
||||
|
||||
static char *mm_escape(char *s)
|
||||
{
|
||||
char *p, *q;
|
||||
for (p = q = s; *p; ++p) {
|
||||
if (*p == '\\') {
|
||||
++p;
|
||||
if (*p == 't') *q++ = '\t';
|
||||
else if (*p == '\\') *q++ = '\\';
|
||||
} else *q++ = *p;
|
||||
}
|
||||
*q = '\0';
|
||||
return s;
|
||||
}
|
||||
|
||||
static void sam_write_rg_line(kstring_t *str, const char *s)
|
||||
{
|
||||
char *p, *q, *r, *rg_line = 0;
|
||||
memset(mm_rg_id, 0, 256);
|
||||
if (s == 0) return;
|
||||
if (strstr(s, "@RG") != s) {
|
||||
if (mm_verbose >= 1) fprintf(stderr, "[ERROR] the read group line is not started with @RG\n");
|
||||
goto err_set_rg;
|
||||
}
|
||||
if (strstr(s, "\t") != NULL) {
|
||||
if (mm_verbose >= 1) fprintf(stderr, "[ERROR] the read group line contained literal <tab> characters -- replace with escaped tabs: \\t\n");
|
||||
goto err_set_rg;
|
||||
}
|
||||
rg_line = strdup(s);
|
||||
mm_escape(rg_line);
|
||||
if ((p = strstr(rg_line, "\tID:")) == 0) {
|
||||
if (mm_verbose >= 1) fprintf(stderr, "[ERROR] no ID within the read group line\n");
|
||||
goto err_set_rg;
|
||||
}
|
||||
p += 4;
|
||||
for (q = p; *q && *q != '\t' && *q != '\n'; ++q);
|
||||
if (q - p + 1 > 256) {
|
||||
if (mm_verbose >= 1) fprintf(stderr, "[ERROR] @RG:ID is longer than 255 characters\n");
|
||||
goto err_set_rg;
|
||||
}
|
||||
for (q = p, r = mm_rg_id; *q && *q != '\t' && *q != '\n'; ++q)
|
||||
*r++ = *q;
|
||||
mm_sprintf_lite(str, "%s\n", rg_line);
|
||||
|
||||
err_set_rg:
|
||||
free(rg_line);
|
||||
}
|
||||
|
||||
void mm_write_sam_hdr_no_SQ(const char *rg, const char *ver, int argc, char *argv[])
|
||||
{
|
||||
kstring_t str = {0,0,0};
|
||||
sam_write_rg_line(&str, rg);
|
||||
mm_sprintf_lite(&str, "@PG\tID:minimap2\tPN:minimap2");
|
||||
if (ver) mm_sprintf_lite(&str, "\tVN:%s", ver);
|
||||
if (argc > 1) {
|
||||
int i;
|
||||
mm_sprintf_lite(&str, "\tCL:minimap2");
|
||||
for (i = 1; i < argc; ++i)
|
||||
mm_sprintf_lite(&str, " %s", argv[i]);
|
||||
}
|
||||
mm_sprintf_lite(&str, "\n");
|
||||
fputs(str.s, stdout);
|
||||
free(str.s);
|
||||
}
|
||||
|
||||
static void write_cs(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r)
|
||||
{
|
||||
extern unsigned char seq_nt4_table[256];
|
||||
int i, q_off, t_off;
|
||||
uint8_t *qseq, *tseq;
|
||||
char *tmp;
|
||||
if (r->p == 0) return;
|
||||
mm_sprintf_lite(s, "\tcs:Z:");
|
||||
qseq = (uint8_t*)kmalloc(km, r->qe - r->qs);
|
||||
tseq = (uint8_t*)kmalloc(km, r->re - r->rs);
|
||||
tmp = (char*)kmalloc(km, r->re - r->rs > r->qe - r->qs? r->re - r->rs + 1 : r->qe - r->qs + 1);
|
||||
mm_idx_getseq(mi, r->rid, r->rs, r->re, tseq);
|
||||
if (!r->rev) {
|
||||
for (i = r->qs; i < r->qe; ++i)
|
||||
qseq[i - r->qs] = seq_nt4_table[(uint8_t)t->seq[i]];
|
||||
} else {
|
||||
for (i = r->qs; i < r->qe; ++i) {
|
||||
uint8_t c = seq_nt4_table[(uint8_t)t->seq[i]];
|
||||
qseq[r->qe - i - 1] = c >= 4? 4 : 3 - c;
|
||||
}
|
||||
}
|
||||
for (i = q_off = t_off = 0; i < r->p->n_cigar; ++i) {
|
||||
int j, op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
|
||||
assert(op >= 0 && op <= 2);
|
||||
if (op == 0) {
|
||||
int l_tmp = 0;
|
||||
for (j = 0; j < len; ++j) {
|
||||
if (qseq[q_off + j] != tseq[t_off + j]) {
|
||||
if (l_tmp > 0) {
|
||||
tmp[l_tmp] = 0;
|
||||
mm_sprintf_lite(s, "=%s", tmp);
|
||||
l_tmp = 0;
|
||||
}
|
||||
mm_sprintf_lite(s, "*%c%c", "acgtn"[tseq[t_off + j]], "acgtn"[qseq[q_off + j]]);
|
||||
} else tmp[l_tmp++] = "ACGTN"[qseq[q_off + j]];
|
||||
}
|
||||
if (l_tmp > 0) {
|
||||
tmp[l_tmp] = 0;
|
||||
mm_sprintf_lite(s, "=%s", tmp);
|
||||
}
|
||||
q_off += len, t_off += len;
|
||||
} else if (op == 1) {
|
||||
for (j = 0, tmp[len] = 0; j < len; ++j)
|
||||
tmp[j] = "acgtn"[qseq[q_off + j]];
|
||||
mm_sprintf_lite(s, "+%s", tmp);
|
||||
q_off += len;
|
||||
} else if (op == 2) {
|
||||
for (j = 0, tmp[len] = 0; j < len; ++j)
|
||||
tmp[j] = "acgtn"[tseq[t_off + j]];
|
||||
mm_sprintf_lite(s, "-%s", tmp);
|
||||
t_off += len;
|
||||
}
|
||||
}
|
||||
assert(t_off == r->re - r->rs && q_off == r->qe - r->qs);
|
||||
kfree(km, qseq); kfree(km, tseq); kfree(km, tmp);
|
||||
}
|
||||
|
||||
static inline void write_tags(kstring_t *s, const mm_reg1_t *r)
|
||||
{
|
||||
int type = r->inv? 'I' : r->id == r->parent? 'P' : 'S';
|
||||
mm_sprintf_lite(s, "\ttp:A:%c\tcm:i:%d\ts1:i:%d", type, r->cnt, r->score);
|
||||
if (r->parent == r->id) mm_sprintf_lite(s, "\ts2:i:%d", r->subsc);
|
||||
if (r->split) mm_sprintf_lite(s, "\tzd:i:%d", r->split);
|
||||
if (r->p) mm_sprintf_lite(s, "\tNM:i:%d\tms:i:%d\tAS:i:%d\tnn:i:%d", r->p->n_diff, r->p->dp_max, r->p->dp_score, r->p->n_ambi);
|
||||
if (r->p) {
|
||||
mm_sprintf_lite(s, "\tNM:i:%d\tms:i:%d\tAS:i:%d\tnn:i:%d", r->p->n_diff, r->p->dp_max, r->p->dp_score, r->p->n_ambi);
|
||||
if (r->p->trans_strand == 1 || r->p->trans_strand == 2)
|
||||
mm_sprintf_lite(s, "\tts:A:%c", "?+-?"[r->p->trans_strand]);
|
||||
}
|
||||
}
|
||||
|
||||
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r)
|
||||
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int opt_flag)
|
||||
{
|
||||
s->l = 0;
|
||||
mm_sprintf_lite(s, "%s\t%d\t%d\t%d\t%c\t", t->name, t->l_seq, r->qs, r->qe, "+-"[r->rev]);
|
||||
@@ -74,12 +203,14 @@ void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const m
|
||||
else mm_sprintf_lite(s, "\t%d\t%d", r->fuzzy_mlen, r->fuzzy_blen);
|
||||
mm_sprintf_lite(s, "\t%d", r->mapq);
|
||||
write_tags(s, r);
|
||||
if (r->p) {
|
||||
if (r->p && (opt_flag & MM_F_OUT_CG)) {
|
||||
uint32_t k;
|
||||
mm_sprintf_lite(s, "\tcg:Z:");
|
||||
for (k = 0; k < r->p->n_cigar; ++k)
|
||||
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MID"[r->p->cigar[k]&0xf]);
|
||||
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDN"[r->p->cigar[k]&0xf]);
|
||||
}
|
||||
if (r->p && (opt_flag & MM_F_OUT_CS))
|
||||
write_cs(km, s, mi, t, r);
|
||||
}
|
||||
|
||||
static char comp_tab[] = {
|
||||
@@ -93,6 +224,13 @@ static char comp_tab[] = {
|
||||
'p', 'q', 'y', 's', 'a', 'a', 'b', 'w', 'x', 'r', 'z', 123, 124, 125, 126, 127
|
||||
};
|
||||
|
||||
void mm_write_sam_SQ(const mm_idx_t *idx)
|
||||
{
|
||||
uint32_t i;
|
||||
for (i = 0; i < idx->n_seq; ++i)
|
||||
printf("@SQ\tSN:%s\tLN:%d\n", idx->seq[i].name, idx->seq[i].len);
|
||||
}
|
||||
|
||||
static void sam_write_sq(kstring_t *s, char *seq, int l, int rev, int comp)
|
||||
{
|
||||
if (rev) {
|
||||
@@ -126,7 +264,7 @@ void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const m
|
||||
int clip_char = (flag&0x800)? 'H' : 'S';
|
||||
if (clip_len) mm_sprintf_lite(s, "%d%c", clip_len, clip_char);
|
||||
for (k = 0; k < r->p->n_cigar; ++k)
|
||||
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MID"[r->p->cigar[k]&0xf]);
|
||||
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDN"[r->p->cigar[k]&0xf]);
|
||||
clip_len = r->rev? r->qs : t->l_seq - r->qe;
|
||||
if (clip_len) mm_sprintf_lite(s, "%d%c", clip_len, clip_char);
|
||||
} else mm_sprintf_lite(s, "*");
|
||||
@@ -145,6 +283,7 @@ void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const m
|
||||
else mm_sprintf_lite(s, "*");
|
||||
}
|
||||
write_tags(s, r);
|
||||
if (mm_rg_id[0]) mm_sprintf_lite(s, "\tRG:Z:%s", mm_rg_id);
|
||||
if (r->parent == r->id && r->p && n_regs > 1 && regs && r >= regs && r - regs < n_regs) { // supplementary aln may exist
|
||||
int i, n_sa = 0; // n_sa: number of SA fields
|
||||
for (i = 0; i < n_regs; ++i)
|
||||
|
||||
@@ -0,0 +1,216 @@
|
||||
#include <stddef.h>
|
||||
#include <stdio.h>
|
||||
#include <string.h>
|
||||
#include "getopt.h"
|
||||
|
||||
char *optarg;
|
||||
int optind=1, opterr=1, optopt, __optpos, optreset=0;
|
||||
|
||||
#define optpos __optpos
|
||||
|
||||
static void __getopt_msg(const char *a, const char *b, const char *c, size_t l)
|
||||
{
|
||||
FILE *f = stderr;
|
||||
#if !defined(WIN32) && !defined(_WIN32)
|
||||
flockfile(f);
|
||||
#endif
|
||||
fputs(a, f);
|
||||
fwrite(b, strlen(b), 1, f);
|
||||
fwrite(c, 1, l, f);
|
||||
fputc('\n', f);
|
||||
#if !defined(WIN32) && !defined(_WIN32)
|
||||
funlockfile(f);
|
||||
#endif
|
||||
}
|
||||
|
||||
int getopt(int argc, char * const argv[], const char *optstring)
|
||||
{
|
||||
int i, c, d;
|
||||
int k, l;
|
||||
char *optchar;
|
||||
|
||||
if (!optind || optreset) {
|
||||
optreset = 0;
|
||||
__optpos = 0;
|
||||
optind = 1;
|
||||
}
|
||||
|
||||
if (optind >= argc || !argv[optind])
|
||||
return -1;
|
||||
|
||||
if (argv[optind][0] != '-') {
|
||||
if (optstring[0] == '-') {
|
||||
optarg = argv[optind++];
|
||||
return 1;
|
||||
}
|
||||
return -1;
|
||||
}
|
||||
|
||||
if (!argv[optind][1])
|
||||
return -1;
|
||||
|
||||
if (argv[optind][1] == '-' && !argv[optind][2])
|
||||
return optind++, -1;
|
||||
|
||||
if (!optpos) optpos++;
|
||||
c = argv[optind][optpos], k = 1;
|
||||
optchar = argv[optind]+optpos;
|
||||
optopt = c;
|
||||
optpos += k;
|
||||
|
||||
if (!argv[optind][optpos]) {
|
||||
optind++;
|
||||
optpos = 0;
|
||||
}
|
||||
|
||||
if (optstring[0] == '-' || optstring[0] == '+')
|
||||
optstring++;
|
||||
|
||||
i = 0;
|
||||
d = 0;
|
||||
do {
|
||||
d = optstring[i], l = 1;
|
||||
if (l>0) i+=l; else i++;
|
||||
} while (l && d != c);
|
||||
|
||||
if (d != c) {
|
||||
if (optstring[0] != ':' && opterr)
|
||||
__getopt_msg(argv[0], ": unrecognized option: ", optchar, k);
|
||||
return '?';
|
||||
}
|
||||
if (optstring[i] == ':') {
|
||||
if (optstring[i+1] == ':') optarg = 0;
|
||||
else if (optind >= argc) {
|
||||
if (optstring[0] == ':') return ':';
|
||||
if (opterr) __getopt_msg(argv[0],
|
||||
": option requires an argument: ",
|
||||
optchar, k);
|
||||
return '?';
|
||||
}
|
||||
if (optstring[i+1] != ':' || optpos) {
|
||||
optarg = argv[optind++] + optpos;
|
||||
optpos = 0;
|
||||
}
|
||||
}
|
||||
return c;
|
||||
}
|
||||
|
||||
static void permute(char *const *argv, int dest, int src)
|
||||
{
|
||||
char **av = (char **)argv;
|
||||
char *tmp = av[src];
|
||||
int i;
|
||||
for (i=src; i>dest; i--)
|
||||
av[i] = av[i-1];
|
||||
av[dest] = tmp;
|
||||
}
|
||||
|
||||
static int __getopt_long_core(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx, int longonly)
|
||||
{
|
||||
optarg = 0;
|
||||
if (longopts && argv[optind][0] == '-' &&
|
||||
((longonly && argv[optind][1] && argv[optind][1] != '-') ||
|
||||
(argv[optind][1] == '-' && argv[optind][2])))
|
||||
{
|
||||
int colon = optstring[optstring[0]=='+'||optstring[0]=='-']==':';
|
||||
int i, cnt, match;
|
||||
char *opt;
|
||||
for (cnt=i=0; longopts[i].name; i++) {
|
||||
const char *name = longopts[i].name;
|
||||
opt = argv[optind]+1;
|
||||
if (*opt == '-') opt++;
|
||||
for (; *name && *name == *opt; name++, opt++);
|
||||
if (*opt && *opt != '=') continue;
|
||||
match = i;
|
||||
if (!*name) {
|
||||
cnt = 1;
|
||||
break;
|
||||
}
|
||||
cnt++;
|
||||
}
|
||||
if (cnt==1) {
|
||||
i = match;
|
||||
optind++;
|
||||
optopt = longopts[i].val;
|
||||
if (*opt == '=') {
|
||||
if (!longopts[i].has_arg) {
|
||||
if (colon || !opterr)
|
||||
return '?';
|
||||
__getopt_msg(argv[0],
|
||||
": option does not take an argument: ",
|
||||
longopts[i].name,
|
||||
strlen(longopts[i].name));
|
||||
return '?';
|
||||
}
|
||||
optarg = opt+1;
|
||||
} else if (longopts[i].has_arg == required_argument) {
|
||||
if (!(optarg = argv[optind])) {
|
||||
if (colon) return ':';
|
||||
if (!opterr) return '?';
|
||||
__getopt_msg(argv[0],
|
||||
": option requires an argument: ",
|
||||
longopts[i].name,
|
||||
strlen(longopts[i].name));
|
||||
return '?';
|
||||
}
|
||||
optind++;
|
||||
}
|
||||
if (idx) *idx = i;
|
||||
if (longopts[i].flag) {
|
||||
*longopts[i].flag = longopts[i].val;
|
||||
return 0;
|
||||
}
|
||||
return longopts[i].val;
|
||||
}
|
||||
if (argv[optind][1] == '-') {
|
||||
if (!colon && opterr)
|
||||
__getopt_msg(argv[0], cnt ?
|
||||
": option is ambiguous: " :
|
||||
": unrecognized option: ",
|
||||
argv[optind]+2,
|
||||
strlen(argv[optind]+2));
|
||||
optind++;
|
||||
return '?';
|
||||
}
|
||||
}
|
||||
return getopt(argc, argv, optstring);
|
||||
}
|
||||
|
||||
static int __getopt_long(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx, int longonly)
|
||||
{
|
||||
int ret, skipped, resumed;
|
||||
if (!optind || optreset) {
|
||||
optreset = 0;
|
||||
__optpos = 0;
|
||||
optind = 1;
|
||||
}
|
||||
if (optind >= argc || !argv[optind]) return -1;
|
||||
skipped = optind;
|
||||
if (optstring[0] != '+' && optstring[0] != '-') {
|
||||
int i;
|
||||
for (i=optind; ; i++) {
|
||||
if (i >= argc || !argv[i]) return -1;
|
||||
if (argv[i][0] == '-' && argv[i][1]) break;
|
||||
}
|
||||
optind = i;
|
||||
}
|
||||
resumed = optind;
|
||||
ret = __getopt_long_core(argc, argv, optstring, longopts, idx, longonly);
|
||||
if (resumed > skipped) {
|
||||
int i, cnt = optind-resumed;
|
||||
for (i=0; i<cnt; i++)
|
||||
permute(argv, skipped, optind-1);
|
||||
optind = skipped + cnt;
|
||||
}
|
||||
return ret;
|
||||
}
|
||||
|
||||
int getopt_long(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx)
|
||||
{
|
||||
return __getopt_long(argc, argv, optstring, longopts, idx, 0);
|
||||
}
|
||||
|
||||
int getopt_long_only(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx)
|
||||
{
|
||||
return __getopt_long(argc, argv, optstring, longopts, idx, 1);
|
||||
}
|
||||
@@ -0,0 +1,53 @@
|
||||
/*
|
||||
Copyright 2005-2014 Rich Felker, et al.
|
||||
|
||||
Permission is hereby granted, free of charge, to any person obtaining
|
||||
a copy of this software and associated documentation files (the
|
||||
"Software"), to deal in the Software without restriction, including
|
||||
without limitation the rights to use, copy, modify, merge, publish,
|
||||
distribute, sublicense, and/or sell copies of the Software, and to
|
||||
permit persons to whom the Software is furnished to do so, subject to
|
||||
the following conditions:
|
||||
|
||||
The above copyright notice and this permission notice shall be
|
||||
included in all copies or substantial portions of the Software.
|
||||
|
||||
THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
|
||||
EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
|
||||
MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT.
|
||||
IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY
|
||||
CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT,
|
||||
TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE
|
||||
SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
|
||||
*/
|
||||
|
||||
#ifndef _GETOPT_H
|
||||
#define _GETOPT_H
|
||||
|
||||
#ifdef __cplusplus
|
||||
extern "C" {
|
||||
#endif
|
||||
|
||||
int getopt(int, char * const [], const char *);
|
||||
extern char *optarg;
|
||||
extern int optind, opterr, optopt, optreset;
|
||||
|
||||
struct option {
|
||||
const char *name;
|
||||
int has_arg;
|
||||
int *flag;
|
||||
int val;
|
||||
};
|
||||
|
||||
int getopt_long(int, char *const *, const char *, const struct option *, int *);
|
||||
int getopt_long_only(int, char *const *, const char *, const struct option *, int *);
|
||||
|
||||
#define no_argument 0
|
||||
#define required_argument 1
|
||||
#define optional_argument 2
|
||||
|
||||
#ifdef __cplusplus
|
||||
}
|
||||
#endif
|
||||
|
||||
#endif
|
||||
@@ -1,6 +1,10 @@
|
||||
#include <stdlib.h>
|
||||
#include <assert.h>
|
||||
#if defined(WIN32) || defined(_WIN32)
|
||||
#include <io.h> // for open(2)
|
||||
#else
|
||||
#include <unistd.h>
|
||||
#endif
|
||||
#include <fcntl.h>
|
||||
#include <stdio.h>
|
||||
#include "kthread.h"
|
||||
@@ -285,12 +289,12 @@ static void *worker_pipeline(void *shared, int step, void *in)
|
||||
mm_idx_t *mm_idx_gen(mm_bseq_file_t *fp, int w, int k, int b, int is_hpc, int mini_batch_size, int n_threads, uint64_t batch_size, int keep_name)
|
||||
{
|
||||
pipeline_t pl;
|
||||
if (fp == 0 || mm_bseq_eof(fp)) return 0;
|
||||
memset(&pl, 0, sizeof(pipeline_t));
|
||||
pl.mini_batch_size = mini_batch_size < batch_size? mini_batch_size : batch_size;
|
||||
pl.keep_name = keep_name;
|
||||
pl.batch_size = batch_size;
|
||||
pl.fp = fp;
|
||||
if (pl.fp == 0) return 0;
|
||||
pl.mi = mm_idx_init(w, k, b, is_hpc);
|
||||
|
||||
kt_pipeline(n_threads < 3? n_threads : 3, worker_pipeline, &pl, 3);
|
||||
|
||||
@@ -46,7 +46,7 @@ static size_t *morecore(kmem_t *km, size_t nu)
|
||||
up = (size_t*)malloc(rnu * sizeof(size_t));
|
||||
if (!up) { /* fail to allocate memory */
|
||||
km_stat(km);
|
||||
fprintf(stderr, "[morecore] %lu bytes requested but not available.\n", rnu * sizeof(size_t));
|
||||
fprintf(stderr, "[morecore] %lu bytes requested but not available.\n", (unsigned long)rnu * sizeof(size_t));
|
||||
exit(1);
|
||||
}
|
||||
/* put the pointer in km->list_head */
|
||||
@@ -210,5 +210,5 @@ void km_stat(const void *_km)
|
||||
--n_blocks;
|
||||
frag = 1.0/1024.0 * n_units * sizeof(size_t) / n_blocks;
|
||||
fprintf(stderr, "[kr_stat] tot=%lu, free=%lu, n_block=%u, max_block=%lu, frag_len=%.3fK\n",
|
||||
km->total_allocated, n_units * sizeof(size_t), n_blocks, max_block * sizeof(size_t), frag);
|
||||
(unsigned long)km->total_allocated, (unsigned long)n_units * sizeof(size_t), n_blocks, (unsigned long)max_block * sizeof(size_t), frag);
|
||||
}
|
||||
|
||||
@@ -3,11 +3,12 @@
|
||||
|
||||
#include <stdlib.h>
|
||||
#include <string.h>
|
||||
#include <stdint.h>
|
||||
#include "kalloc.h"
|
||||
|
||||
#define __KDQ_TYPE(type) \
|
||||
typedef struct { \
|
||||
size_t front:58, bits:6, count, mask; \
|
||||
uint64_t front:58, bits:6, count, mask; \
|
||||
type *a; \
|
||||
void *km; \
|
||||
} kdq_##type##_t;
|
||||
|
||||
@@ -30,6 +30,7 @@
|
||||
|
||||
#include <stdlib.h>
|
||||
#include <string.h>
|
||||
#include <assert.h>
|
||||
|
||||
typedef struct {
|
||||
void *left, *right;
|
||||
@@ -78,6 +79,7 @@ typedef const char *ksstr_t;
|
||||
#define KSORT_INIT_STR KSORT_INIT(str, ksstr_t, ks_lt_str)
|
||||
|
||||
#define RS_MIN_SIZE 64
|
||||
#define RS_MAX_BITS 8
|
||||
|
||||
#define KRADIX_SORT_INIT(name, rstype_t, rskey, sizeof_key) \
|
||||
typedef struct { \
|
||||
@@ -98,7 +100,8 @@ typedef const char *ksstr_t;
|
||||
{ \
|
||||
rstype_t *i; \
|
||||
int size = 1<<n_bits, m = size - 1; \
|
||||
rsbucket_##name##_t *k, b[size], *be = b + size; \
|
||||
rsbucket_##name##_t *k, b[1<<RS_MAX_BITS], *be = b + size; \
|
||||
assert(n_bits <= RS_MAX_BITS); \
|
||||
for (k = b; k != be; ++k) k->b = k->e = beg; \
|
||||
for (i = beg; i != end; ++i) ++b[rskey(*i)>>s&m].e; \
|
||||
for (k = b + 1; k != be; ++k) \
|
||||
@@ -127,7 +130,7 @@ typedef const char *ksstr_t;
|
||||
void radix_sort_##name(rstype_t *beg, rstype_t *end) \
|
||||
{ \
|
||||
if (end - beg <= RS_MIN_SIZE) rs_insertsort_##name(beg, end); \
|
||||
else rs_sort_##name(beg, end, 8, sizeof_key * 8 - 8); \
|
||||
else rs_sort_##name(beg, end, RS_MAX_BITS, (sizeof_key - 1) * RS_MAX_BITS); \
|
||||
}
|
||||
|
||||
#endif
|
||||
|
||||
@@ -12,6 +12,8 @@
|
||||
#define KSW_EZ_APPROX_DROP 0x10 // approximate Z-drop; faster with sse
|
||||
#define KSW_EZ_EXTZ_ONLY 0x40 // only perform extension
|
||||
#define KSW_EZ_REV_CIGAR 0x80 // reverse CIGAR in the output
|
||||
#define KSW_EZ_SPLICE_FOR 0x100
|
||||
#define KSW_EZ_SPLICE_REV 0x200
|
||||
|
||||
#ifdef __cplusplus
|
||||
extern "C" {
|
||||
@@ -53,6 +55,9 @@ void ksw_extd(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t
|
||||
void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t gapo, int8_t gape, int8_t gapo2, int8_t gape2, int w, int zdrop, int flag, ksw_extz_t *ez);
|
||||
|
||||
void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t gapo, int8_t gape, int8_t gapo2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez);
|
||||
|
||||
void ksw_extf2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t mch, int8_t mis, int8_t e, int w, int xdrop, ksw_extz_t *ez);
|
||||
|
||||
/**
|
||||
@@ -106,7 +111,8 @@ static inline uint32_t *ksw_push_cigar(void *km, int *n_cigar, int *m_cigar, uin
|
||||
// bit 0-2: which type gets the max - 0 for H, 1 for E, 2 for F, 3 for \tilde{E} and 4 for \tilde{F}
|
||||
// bit 3/0x08: 1 if a continuation on the E state (bit 5/0x20 for a continuation on \tilde{E})
|
||||
// bit 4/0x10: 1 if a continuation on the F state (bit 6/0x40 for a continuation on \tilde{F})
|
||||
static inline void ksw_backtrack(void *km, int is_rot, int is_rev, const uint8_t *p, const int *off, const int *off_end, int n_col, int i0, int j0, int *m_cigar_, int *n_cigar_, uint32_t **cigar_)
|
||||
static inline void ksw_backtrack(void *km, int is_rot, int is_rev, int with_N, const uint8_t *p, const int *off, const int *off_end, int n_col, int i0, int j0,
|
||||
int *m_cigar_, int *n_cigar_, uint32_t **cigar_)
|
||||
{ // p[] - lower 3 bits: which type gets the max; bit
|
||||
int n_cigar = 0, m_cigar = *m_cigar_, i = i0, j = j0, r, state = 0;
|
||||
uint32_t *cigar = *cigar_, tmp;
|
||||
@@ -127,7 +133,8 @@ static inline void ksw_backtrack(void *km, int is_rot, int is_rev, const uint8_t
|
||||
if (state == 0) state = tmp & 7; // TODO: probably this line can be merged into the "else if" line right above; not 100% sure
|
||||
if (force_state >= 0) state = force_state;
|
||||
if (state == 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 0, 1), --i, --j; // match
|
||||
else if (state == 1 || state == 3) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 2, 1), --i; // deletion
|
||||
else if (state == 1 || (state == 3 && !with_N)) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 2, 1), --i; // deletion
|
||||
else if (state == 3 && with_N) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 3, 1), --i; // intron
|
||||
else cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 1, 1), --j; // insertion
|
||||
}
|
||||
if (i >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 2, i + 1); // first deletion
|
||||
@@ -162,5 +169,4 @@ static inline int ksw_apply_zdrop(ksw_extz_t *ez, int is_rot, int32_t H, int a,
|
||||
}
|
||||
return 0;
|
||||
}
|
||||
|
||||
#endif
|
||||
|
||||
@@ -0,0 +1,97 @@
|
||||
#ifdef KSW_CPU_DISPATCH
|
||||
#include <stdlib.h>
|
||||
#include "ksw2.h"
|
||||
|
||||
#define SIMD_SSE 0x1
|
||||
#define SIMD_SSE2 0x2
|
||||
#define SIMD_SSE3 0x4
|
||||
#define SIMD_SSSE3 0x8
|
||||
#define SIMD_SSE4_1 0x10
|
||||
#define SIMD_SSE4_2 0x20
|
||||
#define SIMD_AVX 0x40
|
||||
#define SIMD_AVX2 0x80
|
||||
#define SIMD_AVX512F 0x100
|
||||
|
||||
#ifndef _MSC_VER
|
||||
// adapted from https://github.com/01org/linux-sgx/blob/master/common/inc/internal/linux/cpuid_gnu.h
|
||||
void __cpuidex(int cpuid[4], int func_id, int subfunc_id)
|
||||
{
|
||||
#if defined(__x86_64__)
|
||||
asm volatile ("cpuid"
|
||||
: "=a" (cpuid[0]), "=b" (cpuid[1]), "=c" (cpuid[2]), "=d" (cpuid[3])
|
||||
: "0" (func_id), "2" (subfunc_id));
|
||||
#else // on 32bit, ebx can NOT be used as PIC code
|
||||
asm volatile ("xchgl %%ebx, %1; cpuid; xchgl %%ebx, %1"
|
||||
: "=a" (cpuid[0]), "=r" (cpuid[1]), "=c" (cpuid[2]), "=d" (cpuid[3])
|
||||
: "0" (func_id), "2" (subfunc_id));
|
||||
#endif
|
||||
}
|
||||
#endif
|
||||
|
||||
int x86_simd(void)
|
||||
{
|
||||
int flag = 0, cpuid[4], max_id;
|
||||
__cpuidex(cpuid, 0, 0);
|
||||
max_id = cpuid[0];
|
||||
if (max_id == 0) return 0;
|
||||
__cpuidex(cpuid, 1, 0);
|
||||
if (cpuid[3]>>25&1) flag |= SIMD_SSE;
|
||||
if (cpuid[3]>>26&1) flag |= SIMD_SSE2;
|
||||
if (cpuid[2]>>0 &1) flag |= SIMD_SSE3;
|
||||
if (cpuid[2]>>9 &1) flag |= SIMD_SSSE3;
|
||||
if (cpuid[2]>>19&1) flag |= SIMD_SSE4_1;
|
||||
if (cpuid[2]>>20&1) flag |= SIMD_SSE4_2;
|
||||
if (cpuid[2]>>28&1) flag |= SIMD_AVX;
|
||||
if (max_id >= 7) {
|
||||
__cpuidex(cpuid, 7, 0);
|
||||
if (cpuid[1]>>5 &1) flag |= SIMD_AVX2;
|
||||
if (cpuid[1]>>16&1) flag |= SIMD_AVX512F;
|
||||
}
|
||||
return flag;
|
||||
}
|
||||
|
||||
void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int flag, ksw_extz_t *ez)
|
||||
{
|
||||
extern void ksw_extz2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int flag, ksw_extz_t *ez);
|
||||
extern void ksw_extz2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int flag, ksw_extz_t *ez);
|
||||
unsigned simd;
|
||||
simd = x86_simd();
|
||||
if (simd & SIMD_SSE4_1)
|
||||
ksw_extz2_sse41(km, qlen, query, tlen, target, m, mat, q, e, w, zdrop, flag, ez);
|
||||
else if (simd & SIMD_SSE2)
|
||||
ksw_extz2_sse2(km, qlen, query, tlen, target, m, mat, q, e, w, zdrop, flag, ez);
|
||||
else abort();
|
||||
}
|
||||
|
||||
void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int flag, ksw_extz_t *ez)
|
||||
{
|
||||
extern void ksw_extd2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int flag, ksw_extz_t *ez);
|
||||
extern void ksw_extd2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int flag, ksw_extz_t *ez);
|
||||
unsigned simd;
|
||||
simd = x86_simd();
|
||||
if (simd & SIMD_SSE4_1)
|
||||
ksw_extd2_sse41(km, qlen, query, tlen, target, m, mat, q, e, q2, e2, w, zdrop, flag, ez);
|
||||
else if (simd & SIMD_SSE2)
|
||||
ksw_extd2_sse2(km, qlen, query, tlen, target, m, mat, q, e, q2, e2, w, zdrop, flag, ez);
|
||||
else abort();
|
||||
}
|
||||
|
||||
void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez)
|
||||
{
|
||||
extern void ksw_exts2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez);
|
||||
extern void ksw_exts2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez);
|
||||
unsigned simd;
|
||||
simd = x86_simd();
|
||||
if (simd & SIMD_SSE4_1)
|
||||
ksw_exts2_sse41(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, flag, ez);
|
||||
else if (simd & SIMD_SSE2)
|
||||
ksw_exts2_sse2(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, flag, ez);
|
||||
else abort();
|
||||
}
|
||||
#endif
|
||||
+20
-3
@@ -1,16 +1,31 @@
|
||||
#include <string.h>
|
||||
#include <stdio.h>
|
||||
#include <assert.h>
|
||||
#include "ksw2.h"
|
||||
|
||||
#ifdef __SSE2__
|
||||
#include <emmintrin.h>
|
||||
|
||||
#ifdef KSW_SSE2_ONLY
|
||||
#undef __SSE4_1__
|
||||
#endif
|
||||
|
||||
#ifdef __SSE4_1__
|
||||
#include <smmintrin.h>
|
||||
#endif
|
||||
|
||||
#ifdef KSW_CPU_DISPATCH
|
||||
#ifdef __SSE4_1__
|
||||
void ksw_extd2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int flag, ksw_extz_t *ez)
|
||||
#else
|
||||
void ksw_extd2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int flag, ksw_extz_t *ez)
|
||||
#endif
|
||||
#else
|
||||
void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int flag, ksw_extz_t *ez)
|
||||
#endif // ~KSW_CPU_DISPATCH
|
||||
{
|
||||
#define __dp_code_block1 \
|
||||
z = _mm_load_si128(&s[t]); \
|
||||
@@ -66,7 +81,8 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
if (w < 0) w = tlen > qlen? tlen : qlen;
|
||||
wl = wr = w;
|
||||
tlen_ = (tlen + 15) / 16;
|
||||
n_col_ = ((w + 1 < tlen? (w + 1 < qlen? w + 1 : qlen): tlen) + 15) / 16 + 1;
|
||||
n_col_ = qlen < tlen? qlen : tlen;
|
||||
n_col_ = ((n_col_ < w + 1? n_col_ : w + 1) + 15) / 16 + 1;
|
||||
qlen_ = (qlen + 15) / 16;
|
||||
for (t = 1, max_sc = mat[0], min_sc = mat[1]; t < m * m; ++t) {
|
||||
max_sc = max_sc > mat[t]? max_sc : mat[t];
|
||||
@@ -161,6 +177,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
x21_ = _mm_cvtsi32_si128((uint8_t)x21);
|
||||
v1_ = _mm_cvtsi32_si128((uint8_t)v1);
|
||||
st_ = st / 16, en_ = en / 16;
|
||||
assert(en_ - st_ + 1 <= n_col_);
|
||||
if (!with_cigar) { // score only
|
||||
for (t = st_; t <= en_; ++t) {
|
||||
__m128i z, a, b, a2, b2, xt1, x2t1, vt1, ut, tmp;
|
||||
@@ -362,9 +379,9 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
if (with_cigar) { // backtrack
|
||||
int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
|
||||
if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY))
|
||||
ksw_backtrack(km, 1, rev_cigar, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||
ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||
else if (ez->max_t >= 0 && ez->max_q >= 0)
|
||||
ksw_backtrack(km, 1, rev_cigar, (uint8_t*)p, off, off_end, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||
ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||
kfree(km, mem2); kfree(km, off);
|
||||
}
|
||||
}
|
||||
|
||||
@@ -0,0 +1,371 @@
|
||||
#include <string.h>
|
||||
#include <stdio.h>
|
||||
#include <assert.h>
|
||||
#include "ksw2.h"
|
||||
|
||||
#ifdef __SSE2__
|
||||
#include <emmintrin.h>
|
||||
|
||||
#ifdef KSW_SSE2_ONLY
|
||||
#undef __SSE4_1__
|
||||
#endif
|
||||
|
||||
#ifdef __SSE4_1__
|
||||
#include <smmintrin.h>
|
||||
#endif
|
||||
|
||||
#ifdef KSW_CPU_DISPATCH
|
||||
#ifdef __SSE4_1__
|
||||
void ksw_exts2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez)
|
||||
#else
|
||||
void ksw_exts2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez)
|
||||
#endif
|
||||
#else
|
||||
void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez)
|
||||
#endif // ~KSW_CPU_DISPATCH
|
||||
{
|
||||
#define __dp_code_block1 \
|
||||
z = _mm_load_si128(&s[t]); \
|
||||
xt1 = _mm_load_si128(&x[t]); /* xt1 <- x[r-1][t..t+15] */ \
|
||||
tmp = _mm_srli_si128(xt1, 15); /* tmp <- x[r-1][t+15] */ \
|
||||
xt1 = _mm_or_si128(_mm_slli_si128(xt1, 1), x1_); /* xt1 <- x[r-1][t-1..t+14] */ \
|
||||
x1_ = tmp; \
|
||||
vt1 = _mm_load_si128(&v[t]); /* vt1 <- v[r-1][t..t+15] */ \
|
||||
tmp = _mm_srli_si128(vt1, 15); /* tmp <- v[r-1][t+15] */ \
|
||||
vt1 = _mm_or_si128(_mm_slli_si128(vt1, 1), v1_); /* vt1 <- v[r-1][t-1..t+14] */ \
|
||||
v1_ = tmp; \
|
||||
a = _mm_add_epi8(xt1, vt1); /* a <- x[r-1][t-1..t+14] + v[r-1][t-1..t+14] */ \
|
||||
ut = _mm_load_si128(&u[t]); /* ut <- u[t..t+15] */ \
|
||||
b = _mm_add_epi8(_mm_load_si128(&y[t]), ut); /* b <- y[r-1][t..t+15] + u[r-1][t..t+15] */ \
|
||||
x2t1= _mm_load_si128(&x2[t]); \
|
||||
tmp = _mm_srli_si128(x2t1, 15); \
|
||||
x2t1= _mm_or_si128(_mm_slli_si128(x2t1, 1), x21_); \
|
||||
x21_= tmp; \
|
||||
a2 = _mm_add_epi8(x2t1, vt1); \
|
||||
a2a = _mm_add_epi8(a2, _mm_load_si128(&acceptor[t]));
|
||||
|
||||
#define __dp_code_block2 \
|
||||
_mm_store_si128(&u[t], _mm_sub_epi8(z, vt1)); /* u[r][t..t+15] <- z - v[r-1][t-1..t+14] */ \
|
||||
_mm_store_si128(&v[t], _mm_sub_epi8(z, ut)); /* v[r][t..t+15] <- z - u[r-1][t..t+15] */ \
|
||||
tmp = _mm_sub_epi8(z, q_); \
|
||||
a = _mm_sub_epi8(a, tmp); \
|
||||
b = _mm_sub_epi8(b, tmp); \
|
||||
a2= _mm_sub_epi8(a2, _mm_sub_epi8(z, q2_));
|
||||
|
||||
int r, t, qe = q + e, n_col_, *off = 0, *off_end = 0, tlen_, qlen_, last_st, last_en, max_sc, min_sc, long_thres, long_diff;
|
||||
int with_cigar = !(flag&KSW_EZ_SCORE_ONLY), approx_max = !!(flag&KSW_EZ_APPROX_MAX);
|
||||
int32_t *H = 0, H0 = 0, last_H0_t = 0;
|
||||
uint8_t *qr, *sf, *mem, *mem2 = 0;
|
||||
__m128i q_, q2_, qe_, zero_, sc_mch_, sc_mis_, m1_;
|
||||
__m128i *u, *v, *x, *y, *x2, *s, *p = 0, *donor, *acceptor;
|
||||
|
||||
ksw_reset_extz(ez);
|
||||
if (m <= 1 || qlen <= 0 || tlen <= 0 || q2 <= q + e) return;
|
||||
|
||||
zero_ = _mm_set1_epi8(0);
|
||||
q_ = _mm_set1_epi8(q);
|
||||
q2_ = _mm_set1_epi8(q2);
|
||||
qe_ = _mm_set1_epi8(q + e);
|
||||
sc_mch_ = _mm_set1_epi8(mat[0]);
|
||||
sc_mis_ = _mm_set1_epi8(mat[1]);
|
||||
m1_ = _mm_set1_epi8(m - 1); // wildcard
|
||||
|
||||
tlen_ = (tlen + 15) / 16;
|
||||
n_col_ = ((qlen < tlen? qlen : tlen) + 15) / 16 + 1;
|
||||
qlen_ = (qlen + 15) / 16;
|
||||
for (t = 1, max_sc = mat[0], min_sc = mat[1]; t < m * m; ++t) {
|
||||
max_sc = max_sc > mat[t]? max_sc : mat[t];
|
||||
min_sc = min_sc < mat[t]? min_sc : mat[t];
|
||||
}
|
||||
if (-min_sc > 2 * (q + e)) return; // otherwise, we won't see any mismatches
|
||||
|
||||
long_thres = (q2 - q) / e - 1;
|
||||
if (q2 > q + e + long_thres * e)
|
||||
++long_thres;
|
||||
long_diff = long_thres * e - (q2 - q);
|
||||
|
||||
mem = (uint8_t*)kcalloc(km, tlen_ * 9 + qlen_ + 1, 16);
|
||||
u = (__m128i*)(((size_t)mem + 15) >> 4 << 4); // 16-byte aligned
|
||||
v = u + tlen_, x = v + tlen_, y = x + tlen_, x2 = y + tlen_;
|
||||
donor = x2 + tlen_, acceptor = donor + tlen_;
|
||||
s = acceptor + tlen_, sf = (uint8_t*)(s + tlen_), qr = sf + tlen_ * 16;
|
||||
memset(u, -q - e, tlen_ * 16 * 4); // this set u, v, x, y (because they are in the same array)
|
||||
memset(x2, -q2, tlen_ * 16);
|
||||
if (!approx_max) {
|
||||
H = (int32_t*)kmalloc(km, tlen_ * 16 * 4);
|
||||
for (t = 0; t < tlen_ * 16; ++t) H[t] = KSW_NEG_INF;
|
||||
}
|
||||
if (with_cigar) {
|
||||
mem2 = (uint8_t*)kmalloc(km, ((qlen + tlen - 1) * n_col_ + 1) * 16);
|
||||
p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4);
|
||||
off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int) * 2);
|
||||
off_end = off + qlen + tlen - 1;
|
||||
}
|
||||
|
||||
for (t = 0; t < qlen; ++t) qr[t] = query[qlen - 1 - t];
|
||||
memcpy(sf, target, tlen);
|
||||
|
||||
// set the donor and acceptor arrays. TODO: this assumes 0/1/2/3 encoding!
|
||||
if (flag & (KSW_EZ_SPLICE_FOR|KSW_EZ_SPLICE_REV)) {
|
||||
memset(donor, -noncan, tlen_ * 16);
|
||||
for (t = 0; t < tlen - 2; ++t) {
|
||||
int is_can = 0; // is a canonical site
|
||||
if ((flag & KSW_EZ_SPLICE_FOR) && target[t+1] == 2 && target[t+2] == 3) is_can = 1;
|
||||
if ((flag & KSW_EZ_SPLICE_REV) && target[t+1] == 1 && target[t+2] == 3) is_can = 1;
|
||||
if (is_can) ((int8_t*)donor)[t] = 0;
|
||||
}
|
||||
memset(acceptor, -noncan, tlen_ * 16);
|
||||
for (t = 2; t < tlen; ++t) {
|
||||
int is_can = 0;
|
||||
if ((flag & KSW_EZ_SPLICE_FOR) && target[t-1] == 0 && target[t] == 2) is_can = 1;
|
||||
if ((flag & KSW_EZ_SPLICE_REV) && target[t-1] == 0 && target[t] == 1) is_can = 1;
|
||||
if (is_can) ((int8_t*)acceptor)[t] = 0;
|
||||
}
|
||||
}
|
||||
|
||||
for (r = 0, last_st = last_en = -1; r < qlen + tlen - 1; ++r) {
|
||||
int st = 0, en = tlen - 1, st0, en0, st_, en_;
|
||||
int8_t x1, x21, v1, *u8 = (int8_t*)u, *v8 = (int8_t*)v;
|
||||
uint8_t *qrr = qr + (qlen - 1 - r);
|
||||
__m128i x1_, x21_, v1_;
|
||||
// find the boundaries
|
||||
if (st < r - qlen + 1) st = r - qlen + 1;
|
||||
if (en > r) en = r;
|
||||
st0 = st, en0 = en;
|
||||
st = st / 16 * 16, en = (en + 16) / 16 * 16 - 1;
|
||||
// set boundary conditions
|
||||
if (st > 0) {
|
||||
if (st - 1 >= last_st && st - 1 <= last_en)
|
||||
x1 = ((int8_t*)x)[st - 1], x21 = ((int8_t*)x2)[st - 1], v1 = v8[st - 1]; // (r-1,s-1) calculated in the last round
|
||||
else x1 = -q - e, x21 = -q2, v1 = -q - e;
|
||||
} else {
|
||||
x1 = -q - e, x21 = -q2;
|
||||
v1 = r == 0? -q - e : r < long_thres? -e : r == long_thres? long_diff : 0;
|
||||
}
|
||||
if (en >= r) {
|
||||
((int8_t*)y)[r] = -q - e;
|
||||
u8[r] = r == 0? -q - e : r < long_thres? -e : r == long_thres? long_diff : 0;
|
||||
}
|
||||
// loop fission: set scores first
|
||||
if (!(flag & KSW_EZ_GENERIC_SC)) {
|
||||
for (t = st0; t <= en0; t += 16) {
|
||||
__m128i sq, st, tmp, mask;
|
||||
sq = _mm_loadu_si128((__m128i*)&sf[t]);
|
||||
st = _mm_loadu_si128((__m128i*)&qrr[t]);
|
||||
mask = _mm_or_si128(_mm_cmpeq_epi8(sq, m1_), _mm_cmpeq_epi8(st, m1_));
|
||||
tmp = _mm_cmpeq_epi8(sq, st);
|
||||
#ifdef __SSE4_1__
|
||||
tmp = _mm_blendv_epi8(sc_mis_, sc_mch_, tmp);
|
||||
#else
|
||||
tmp = _mm_or_si128(_mm_andnot_si128(tmp, sc_mis_), _mm_and_si128(tmp, sc_mch_));
|
||||
#endif
|
||||
tmp = _mm_andnot_si128(mask, tmp);
|
||||
_mm_storeu_si128((__m128i*)((int8_t*)s + t), tmp);
|
||||
}
|
||||
} else {
|
||||
for (t = st0; t <= en0; ++t)
|
||||
((uint8_t*)s)[t] = mat[sf[t] * m + qrr[t]];
|
||||
}
|
||||
// core loop
|
||||
x1_ = _mm_cvtsi32_si128((uint8_t)x1);
|
||||
x21_ = _mm_cvtsi32_si128((uint8_t)x21);
|
||||
v1_ = _mm_cvtsi32_si128((uint8_t)v1);
|
||||
st_ = st / 16, en_ = en / 16;
|
||||
assert(en_ - st_ + 1 <= n_col_);
|
||||
if (!with_cigar) { // score only
|
||||
for (t = st_; t <= en_; ++t) {
|
||||
__m128i z, a, b, a2, a2a, xt1, x2t1, vt1, ut, tmp;
|
||||
__dp_code_block1;
|
||||
#ifdef __SSE4_1__
|
||||
z = _mm_max_epi8(z, a);
|
||||
z = _mm_max_epi8(z, b);
|
||||
z = _mm_max_epi8(z, a2a);
|
||||
__dp_code_block2; // save u[] and v[]; update a, b and a2
|
||||
_mm_store_si128(&x[t], _mm_sub_epi8(_mm_max_epi8(a, zero_), qe_));
|
||||
_mm_store_si128(&y[t], _mm_sub_epi8(_mm_max_epi8(b, zero_), qe_));
|
||||
tmp = _mm_load_si128(&donor[t]);
|
||||
_mm_store_si128(&x2[t], _mm_sub_epi8(_mm_max_epi8(a2, tmp), q2_));
|
||||
#else
|
||||
tmp = _mm_cmpgt_epi8(a, z);
|
||||
z = _mm_or_si128(_mm_andnot_si128(tmp, z), _mm_and_si128(tmp, a));
|
||||
tmp = _mm_cmpgt_epi8(b, z);
|
||||
z = _mm_or_si128(_mm_andnot_si128(tmp, z), _mm_and_si128(tmp, b));
|
||||
tmp = _mm_cmpgt_epi8(a2a, z);
|
||||
z = _mm_or_si128(_mm_andnot_si128(tmp, z), _mm_and_si128(tmp, a2a));
|
||||
__dp_code_block2;
|
||||
tmp = _mm_cmpgt_epi8(a, zero_);
|
||||
_mm_store_si128(&x[t], _mm_sub_epi8(_mm_and_si128(tmp, a), qe_));
|
||||
tmp = _mm_cmpgt_epi8(b, zero_);
|
||||
_mm_store_si128(&y[t], _mm_sub_epi8(_mm_and_si128(tmp, b), qe_));
|
||||
tmp = _mm_load_si128(&donor[t]); // TODO: check if this is correct
|
||||
tmp = _mm_cmpgt_epi8(a2, tmp);
|
||||
tmp = _mm_or_si128(_mm_andnot_si128(tmp, tmp), _mm_and_si128(tmp, a2));
|
||||
_mm_store_si128(&x2[t], _mm_sub_epi8(tmp, q2_));
|
||||
#endif
|
||||
}
|
||||
} else if (!(flag&KSW_EZ_RIGHT)) { // gap left-alignment
|
||||
__m128i *pr = p + r * n_col_ - st_;
|
||||
off[r] = st, off_end[r] = en;
|
||||
for (t = st_; t <= en_; ++t) {
|
||||
__m128i d, z, a, b, a2, a2a, xt1, x2t1, vt1, ut, tmp, tmp2;
|
||||
__dp_code_block1;
|
||||
#ifdef __SSE4_1__
|
||||
d = _mm_and_si128(_mm_cmpgt_epi8(a, z), _mm_set1_epi8(1)); // d = a > z? 1 : 0
|
||||
z = _mm_max_epi8(z, a);
|
||||
d = _mm_blendv_epi8(d, _mm_set1_epi8(2), _mm_cmpgt_epi8(b, z)); // d = b > z? 2 : d
|
||||
z = _mm_max_epi8(z, b);
|
||||
d = _mm_blendv_epi8(d, _mm_set1_epi8(3), _mm_cmpgt_epi8(a2a, z)); // d = a2 > z? 3 : d
|
||||
z = _mm_max_epi8(z, a2a);
|
||||
#else // we need to emulate SSE4.1 intrinsics _mm_max_epi8() and _mm_blendv_epi8()
|
||||
tmp = _mm_cmpgt_epi8(a, z);
|
||||
d = _mm_and_si128(tmp, _mm_set1_epi8(1));
|
||||
z = _mm_or_si128(_mm_andnot_si128(tmp, z), _mm_and_si128(tmp, a));
|
||||
tmp = _mm_cmpgt_epi8(b, z);
|
||||
d = _mm_or_si128(_mm_andnot_si128(tmp, d), _mm_and_si128(tmp, _mm_set1_epi8(2)));
|
||||
z = _mm_or_si128(_mm_andnot_si128(tmp, z), _mm_and_si128(tmp, b));
|
||||
tmp = _mm_cmpgt_epi8(a2a, z);
|
||||
d = _mm_or_si128(_mm_andnot_si128(tmp, d), _mm_and_si128(tmp, _mm_set1_epi8(3)));
|
||||
z = _mm_or_si128(_mm_andnot_si128(tmp, z), _mm_and_si128(tmp, a2a));
|
||||
#endif
|
||||
__dp_code_block2;
|
||||
tmp = _mm_cmpgt_epi8(a, zero_);
|
||||
_mm_store_si128(&x[t], _mm_sub_epi8(_mm_and_si128(tmp, a), qe_));
|
||||
d = _mm_or_si128(d, _mm_and_si128(tmp, _mm_set1_epi8(0x08))); // d = a > 0? 1<<3 : 0
|
||||
tmp = _mm_cmpgt_epi8(b, zero_);
|
||||
_mm_store_si128(&y[t], _mm_sub_epi8(_mm_and_si128(tmp, b), qe_));
|
||||
d = _mm_or_si128(d, _mm_and_si128(tmp, _mm_set1_epi8(0x10))); // d = b > 0? 1<<4 : 0
|
||||
|
||||
tmp2 = _mm_load_si128(&donor[t]);
|
||||
tmp = _mm_cmpgt_epi8(a2, tmp2);
|
||||
#ifdef __SSE4_1__
|
||||
tmp2 = _mm_max_epi8(a2, tmp2);
|
||||
#else
|
||||
tmp2 = _mm_or_si128(_mm_andnot_si128(tmp, tmp2), _mm_and_si128(tmp, a2));
|
||||
#endif
|
||||
_mm_store_si128(&x2[t], _mm_sub_epi8(tmp2, q2_));
|
||||
d = _mm_or_si128(d, _mm_and_si128(tmp, _mm_set1_epi8(0x20)));
|
||||
_mm_store_si128(&pr[t], d);
|
||||
}
|
||||
} else { // gap right-alignment
|
||||
__m128i *pr = p + r * n_col_ - st_;
|
||||
off[r] = st, off_end[r] = en;
|
||||
for (t = st_; t <= en_; ++t) {
|
||||
__m128i d, z, a, b, a2, a2a, xt1, x2t1, vt1, ut, tmp, tmp2;
|
||||
__dp_code_block1;
|
||||
#ifdef __SSE4_1__
|
||||
d = _mm_andnot_si128(_mm_cmpgt_epi8(z, a), _mm_set1_epi8(1)); // d = z > a? 0 : 1
|
||||
z = _mm_max_epi8(z, a);
|
||||
d = _mm_blendv_epi8(_mm_set1_epi8(2), d, _mm_cmpgt_epi8(z, b)); // d = z > b? d : 2
|
||||
z = _mm_max_epi8(z, b);
|
||||
d = _mm_blendv_epi8(_mm_set1_epi8(3), d, _mm_cmpgt_epi8(z, a2a)); // d = z > a2? d : 3
|
||||
z = _mm_max_epi8(z, a2a);
|
||||
#else // we need to emulate SSE4.1 intrinsics _mm_max_epi8() and _mm_blendv_epi8()
|
||||
tmp = _mm_cmpgt_epi8(z, a);
|
||||
d = _mm_andnot_si128(tmp, _mm_set1_epi8(1));
|
||||
z = _mm_or_si128(_mm_and_si128(tmp, z), _mm_andnot_si128(tmp, a));
|
||||
tmp = _mm_cmpgt_epi8(z, b);
|
||||
d = _mm_or_si128(_mm_and_si128(tmp, d), _mm_andnot_si128(tmp, _mm_set1_epi8(2)));
|
||||
z = _mm_or_si128(_mm_and_si128(tmp, z), _mm_andnot_si128(tmp, b));
|
||||
tmp = _mm_cmpgt_epi8(z, a2a);
|
||||
d = _mm_or_si128(_mm_and_si128(tmp, d), _mm_andnot_si128(tmp, _mm_set1_epi8(3)));
|
||||
z = _mm_or_si128(_mm_and_si128(tmp, z), _mm_andnot_si128(tmp, a2a));
|
||||
#endif
|
||||
__dp_code_block2;
|
||||
tmp = _mm_cmpgt_epi8(zero_, a);
|
||||
_mm_store_si128(&x[t], _mm_sub_epi8(_mm_andnot_si128(tmp, a), qe_));
|
||||
d = _mm_or_si128(d, _mm_andnot_si128(tmp, _mm_set1_epi8(0x08))); // d = a > 0? 1<<3 : 0
|
||||
tmp = _mm_cmpgt_epi8(zero_, b);
|
||||
_mm_store_si128(&y[t], _mm_sub_epi8(_mm_andnot_si128(tmp, b), qe_));
|
||||
d = _mm_or_si128(d, _mm_andnot_si128(tmp, _mm_set1_epi8(0x10))); // d = b > 0? 1<<4 : 0
|
||||
|
||||
tmp2 = _mm_load_si128(&donor[t]);
|
||||
tmp = _mm_cmpgt_epi8(tmp2, a2);
|
||||
#ifdef __SSE4_1__
|
||||
tmp2 = _mm_max_epi8(tmp2, a2);
|
||||
#else
|
||||
tmp2 = _mm_or_si128(_mm_andnot_si128(tmp, a2), _mm_and_si128(tmp, tmp2));
|
||||
#endif
|
||||
_mm_store_si128(&x2[t], _mm_sub_epi8(tmp2, q2_));
|
||||
d = _mm_or_si128(d, _mm_andnot_si128(tmp, _mm_set1_epi8(0x20))); // d = a > 0? 1<<5 : 0
|
||||
_mm_store_si128(&pr[t], d);
|
||||
}
|
||||
}
|
||||
if (!approx_max) { // find the exact max with a 32-bit score array
|
||||
int32_t max_H, max_t;
|
||||
// compute H[], max_H and max_t
|
||||
if (r > 0) {
|
||||
int32_t HH[4], tt[4], en1 = st0 + (en0 - st0) / 4 * 4, i;
|
||||
__m128i max_H_, max_t_;
|
||||
max_H = H[en0] = en0 > 0? H[en0-1] + u8[en0] : H[en0] + v8[en0]; // special casing the last element
|
||||
max_t = en0;
|
||||
max_H_ = _mm_set1_epi32(max_H);
|
||||
max_t_ = _mm_set1_epi32(max_t);
|
||||
for (t = st0; t < en1; t += 4) { // this implements: H[t]+=v8[t]-qe; if(H[t]>max_H) max_H=H[t],max_t=t;
|
||||
__m128i H1, tmp, t_;
|
||||
H1 = _mm_loadu_si128((__m128i*)&H[t]);
|
||||
t_ = _mm_setr_epi32(v8[t], v8[t+1], v8[t+2], v8[t+3]);
|
||||
H1 = _mm_add_epi32(H1, t_);
|
||||
_mm_storeu_si128((__m128i*)&H[t], H1);
|
||||
t_ = _mm_set1_epi32(t);
|
||||
tmp = _mm_cmpgt_epi32(H1, max_H_);
|
||||
#ifdef __SSE4_1__
|
||||
max_H_ = _mm_blendv_epi8(max_H_, H1, tmp);
|
||||
max_t_ = _mm_blendv_epi8(max_t_, t_, tmp);
|
||||
#else
|
||||
max_H_ = _mm_or_si128(_mm_and_si128(tmp, H1), _mm_andnot_si128(tmp, max_H_));
|
||||
max_t_ = _mm_or_si128(_mm_and_si128(tmp, t_), _mm_andnot_si128(tmp, max_t_));
|
||||
#endif
|
||||
}
|
||||
_mm_storeu_si128((__m128i*)HH, max_H_);
|
||||
_mm_storeu_si128((__m128i*)tt, max_t_);
|
||||
for (i = 0; i < 4; ++i)
|
||||
if (max_H < HH[i]) max_H = HH[i], max_t = tt[i] + i;
|
||||
for (; t < en0; ++t) { // for the rest of values that haven't been computed with SSE
|
||||
H[t] += (int32_t)v8[t];
|
||||
if (H[t] > max_H)
|
||||
max_H = H[t], max_t = t;
|
||||
}
|
||||
} else H[0] = v8[0] - qe, max_H = H[0], max_t = 0; // special casing r==0
|
||||
// update ez
|
||||
if (en0 == tlen - 1 && H[en0] > ez->mte)
|
||||
ez->mte = H[en0], ez->mte_q = r - en;
|
||||
if (r - st0 == qlen - 1 && H[st0] > ez->mqe)
|
||||
ez->mqe = H[st0], ez->mqe_t = st0;
|
||||
if (ksw_apply_zdrop(ez, 1, max_H, r, max_t, zdrop, 0)) break;
|
||||
if (r == qlen + tlen - 2 && en0 == tlen - 1)
|
||||
ez->score = H[tlen - 1];
|
||||
} else { // find approximate max; Z-drop might be inaccurate, too.
|
||||
if (r > 0) {
|
||||
if (last_H0_t >= st0 && last_H0_t <= en0 && last_H0_t + 1 >= st0 && last_H0_t + 1 <= en0) {
|
||||
int32_t d0 = v8[last_H0_t];
|
||||
int32_t d1 = u8[last_H0_t + 1];
|
||||
if (d0 > d1) H0 += d0;
|
||||
else H0 += d1, ++last_H0_t;
|
||||
} else if (last_H0_t >= st0 && last_H0_t <= en0) {
|
||||
H0 += v8[last_H0_t];
|
||||
} else {
|
||||
++last_H0_t, H0 += u8[last_H0_t];
|
||||
}
|
||||
} else H0 = v8[0] - qe, last_H0_t = 0;
|
||||
if ((flag & KSW_EZ_APPROX_DROP) && ksw_apply_zdrop(ez, 1, H0, r, last_H0_t, zdrop, 0)) break;
|
||||
if (r == qlen + tlen - 2 && en0 == tlen - 1)
|
||||
ez->score = H0;
|
||||
}
|
||||
last_st = st, last_en = en;
|
||||
//for (t = st0; t <= en0; ++t) printf("(%d,%d)\t(%d,%d,%d,%d)\t%d\n", r, t, ((int8_t*)u)[t], ((int8_t*)v)[t], ((int8_t*)x)[t], ((int8_t*)y)[t], H[t]); // for debugging
|
||||
}
|
||||
kfree(km, mem);
|
||||
if (!approx_max) kfree(km, H);
|
||||
if (with_cigar) { // backtrack
|
||||
int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
|
||||
if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY))
|
||||
ksw_backtrack(km, 1, rev_cigar, 1, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||
else if (ez->max_t >= 0 && ez->max_q >= 0)
|
||||
ksw_backtrack(km, 1, rev_cigar, 1, (uint8_t*)p, off, off_end, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||
kfree(km, mem2); kfree(km, off);
|
||||
}
|
||||
}
|
||||
#endif // __SSE2__
|
||||
+18
-3
@@ -1,14 +1,27 @@
|
||||
#include <string.h>
|
||||
#include <assert.h>
|
||||
#include "ksw2.h"
|
||||
|
||||
#ifdef __SSE2__
|
||||
#include <emmintrin.h>
|
||||
|
||||
#ifdef KSW_SSE2_ONLY
|
||||
#undef __SSE4_1__
|
||||
#endif
|
||||
|
||||
#ifdef __SSE4_1__
|
||||
#include <smmintrin.h>
|
||||
#endif
|
||||
|
||||
#ifdef KSW_CPU_DISPATCH
|
||||
#ifdef __SSE4_1__
|
||||
void ksw_extz2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int flag, ksw_extz_t *ez)
|
||||
#else
|
||||
void ksw_extz2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int flag, ksw_extz_t *ez)
|
||||
#endif
|
||||
#else
|
||||
void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int flag, ksw_extz_t *ez)
|
||||
#endif // ~KSW_CPU_DISPATCH
|
||||
{
|
||||
#define __dp_code_block1 \
|
||||
z = _mm_add_epi8(_mm_load_si128(&s[t]), qe2_); \
|
||||
@@ -58,7 +71,8 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
if (w < 0) w = tlen > qlen? tlen : qlen;
|
||||
wl = wr = w;
|
||||
tlen_ = (tlen + 15) / 16;
|
||||
n_col_ = ((w + 1 < tlen? (w + 1 < qlen? w + 1 : qlen): tlen) + 15) / 16 + 1;
|
||||
n_col_ = qlen < tlen? qlen : tlen;
|
||||
n_col_ = ((n_col_ < w + 1? n_col_ : w + 1) + 15) / 16 + 1;
|
||||
qlen_ = (qlen + 15) / 16;
|
||||
for (t = 1, max_sc = mat[0], min_sc = mat[1]; t < m * m; ++t) {
|
||||
max_sc = max_sc > mat[t]? max_sc : mat[t];
|
||||
@@ -130,6 +144,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
x1_ = _mm_cvtsi32_si128(x1);
|
||||
v1_ = _mm_cvtsi32_si128(v1);
|
||||
st_ = st / 16, en_ = en / 16;
|
||||
assert(en_ - st_ + 1 <= n_col_);
|
||||
if (!with_cigar) { // score only
|
||||
for (t = st_; t <= en_; ++t) {
|
||||
__m128i z, a, b, xt1, vt1, ut, tmp;
|
||||
@@ -275,9 +290,9 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
if (with_cigar) { // backtrack
|
||||
int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
|
||||
if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY))
|
||||
ksw_backtrack(km, 1, rev_cigar, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||
ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||
else if (ez->max_t >= 0 && ez->max_q >= 0)
|
||||
ksw_backtrack(km, 1, rev_cigar, (uint8_t*)p, off, off_end, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||
ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||
kfree(km, mem2); kfree(km, off);
|
||||
}
|
||||
}
|
||||
|
||||
@@ -1,6 +1,11 @@
|
||||
#include <pthread.h>
|
||||
#include <stdlib.h>
|
||||
#include <limits.h>
|
||||
#include <stdint.h>
|
||||
|
||||
#if (defined(WIN32) || defined(_WIN32)) && defined(_MSC_VER)
|
||||
#define __sync_fetch_and_add(ptr, addend) _InterlockedExchangeAdd((void*)ptr, addend)
|
||||
#endif
|
||||
|
||||
/************
|
||||
* kt_for() *
|
||||
@@ -52,12 +57,13 @@ void kt_for(int n_threads, void (*func)(void*,long,int), void *data, long n)
|
||||
kt_for_t t;
|
||||
pthread_t *tid;
|
||||
t.func = func, t.data = data, t.n_threads = n_threads, t.n = n;
|
||||
t.w = (ktf_worker_t*)alloca(n_threads * sizeof(ktf_worker_t));
|
||||
tid = (pthread_t*)alloca(n_threads * sizeof(pthread_t));
|
||||
t.w = (ktf_worker_t*)calloc(n_threads, sizeof(ktf_worker_t));
|
||||
tid = (pthread_t*)calloc(n_threads, sizeof(pthread_t));
|
||||
for (i = 0; i < n_threads; ++i)
|
||||
t.w[i].t = &t, t.w[i].i = i;
|
||||
for (i = 0; i < n_threads; ++i) pthread_create(&tid[i], 0, ktf_worker, &t.w[i]);
|
||||
for (i = 0; i < n_threads; ++i) pthread_join(tid[i], 0);
|
||||
free(tid); free(t.w);
|
||||
} else {
|
||||
long j;
|
||||
for (j = 0; j < n; ++j) func(data, j, 0);
|
||||
@@ -135,16 +141,17 @@ void kt_pipeline(int n_threads, void *(*func)(void*, int, void*), void *shared_d
|
||||
pthread_mutex_init(&aux.mutex, 0);
|
||||
pthread_cond_init(&aux.cv, 0);
|
||||
|
||||
aux.workers = (ktp_worker_t*)alloca(n_threads * sizeof(ktp_worker_t));
|
||||
aux.workers = (ktp_worker_t*)calloc(n_threads, sizeof(ktp_worker_t));
|
||||
for (i = 0; i < n_threads; ++i) {
|
||||
ktp_worker_t *w = &aux.workers[i];
|
||||
w->step = 0; w->pl = &aux; w->data = 0;
|
||||
w->index = aux.index++;
|
||||
}
|
||||
|
||||
tid = (pthread_t*)alloca(n_threads * sizeof(pthread_t));
|
||||
tid = (pthread_t*)calloc(n_threads, sizeof(pthread_t));
|
||||
for (i = 0; i < n_threads; ++i) pthread_create(&tid[i], 0, ktp_worker, &aux.workers[i]);
|
||||
for (i = 0; i < n_threads; ++i) pthread_join(tid[i], 0);
|
||||
free(tid); free(aux.workers);
|
||||
|
||||
pthread_mutex_destroy(&aux.mutex);
|
||||
pthread_cond_destroy(&aux.cv);
|
||||
|
||||
@@ -1,24 +1,26 @@
|
||||
#include <getopt.h>
|
||||
#include <stdlib.h>
|
||||
#include <stdio.h>
|
||||
#include <string.h>
|
||||
#include <sys/resource.h>
|
||||
#include <sys/time.h>
|
||||
#include "bseq.h"
|
||||
#include "minimap.h"
|
||||
#include "mmpriv.h"
|
||||
#include "getopt.h"
|
||||
|
||||
#define MM_VERSION "2.0rc1-r232"
|
||||
#define MM_VERSION "2.1.1-r341"
|
||||
|
||||
#ifdef __linux__
|
||||
#include <sys/resource.h>
|
||||
#include <sys/time.h>
|
||||
void liftrlimit()
|
||||
{
|
||||
#ifdef __linux__
|
||||
struct rlimit r;
|
||||
getrlimit(RLIMIT_AS, &r);
|
||||
r.rlim_cur = r.rlim_max;
|
||||
setrlimit(RLIMIT_AS, &r);
|
||||
#endif
|
||||
}
|
||||
#else
|
||||
void liftrlimit() {}
|
||||
#endif
|
||||
|
||||
static struct option long_options[] = {
|
||||
{ "bucket-bits", required_argument, 0, 0 },
|
||||
@@ -31,6 +33,11 @@ static struct option long_options[] = {
|
||||
{ "max-chain-skip", required_argument, 0, 0 },
|
||||
{ "min-dp-len", required_argument, 0, 0 },
|
||||
{ "print-aln-seq", no_argument, 0, 0 },
|
||||
{ "splice", no_argument, 0, 0 },
|
||||
{ "cost-non-gt-ag", required_argument, 0, 0 },
|
||||
{ "no-sam-sq", no_argument, 0, 0 },
|
||||
{ "help", no_argument, 0, 'h' },
|
||||
{ "max-intron-len", required_argument, 0, 'G' },
|
||||
{ "version", no_argument, 0, 'V' },
|
||||
{ "min-count", required_argument, 0, 'n' },
|
||||
{ "min-chain-score",required_argument, 0, 'm' },
|
||||
@@ -40,34 +47,47 @@ static struct option long_options[] = {
|
||||
{ 0, 0, 0, 0}
|
||||
};
|
||||
|
||||
static inline int64_t mm_parse_num(const char *str)
|
||||
{
|
||||
double x;
|
||||
char *p;
|
||||
x = strtod(optarg, &p);
|
||||
if (*p == 'G' || *p == 'g') x *= 1e9;
|
||||
else if (*p == 'M' || *p == 'm') x *= 1e6;
|
||||
else if (*p == 'K' || *p == 'k') x *= 1e3;
|
||||
return (int64_t)(x + .499);
|
||||
}
|
||||
|
||||
int main(int argc, char *argv[])
|
||||
{
|
||||
mm_mapopt_t opt;
|
||||
int i, c, k = 15, w = -1, bucket_bits = MM_IDX_DEF_B, n_threads = 3, keep_name = 1, is_idx, is_hpc = 0, long_idx, idx_par_set = 0;
|
||||
int i, c, k = 15, w = -1, bucket_bits = MM_IDX_DEF_B, n_threads = 3, keep_name = 1, is_idx, is_hpc = 0, long_idx, idx_par_set = 0, max_intron_len = 0, n_idx_part = 0;
|
||||
int minibatch_size = 200000000;
|
||||
uint64_t batch_size = 4000000000ULL;
|
||||
mm_bseq_file_t *fp = 0;
|
||||
char *fnw = 0, *s;
|
||||
FILE *fpr = 0, *fpw = 0;
|
||||
char *fnw = 0, *rg = 0, *s;
|
||||
FILE *fpr = 0, *fpw = 0, *fp_help = stderr;
|
||||
|
||||
liftrlimit();
|
||||
mm_realtime0 = realtime();
|
||||
mm_mapopt_init(&opt);
|
||||
|
||||
while ((c = getopt_long(argc, argv, "aw:k:K:t:r:f:Vv:g:I:d:XT:s:x:Hcp:M:n:z:A:B:O:E:m:N:Q", long_options, &long_idx)) >= 0) {
|
||||
while ((c = getopt_long(argc, argv, "aSw:k:K:t:r:f:Vv:g:G:I:d:XT:s:x:Hcp:M:n:z:A:B:O:E:m:N:Qu:R:h", long_options, &long_idx)) >= 0) {
|
||||
if (c == 'w') w = atoi(optarg), idx_par_set = 1;
|
||||
else if (c == 'k') k = atoi(optarg), idx_par_set = 1;
|
||||
else if (c == 'H') is_hpc = 1, idx_par_set = 1;
|
||||
else if (c == 'd') fnw = optarg; // the above are indexing related options, except -I
|
||||
else if (c == 'r') opt.bw = atoi(optarg);
|
||||
else if (c == 'r') opt.bw = (int)mm_parse_num(optarg);
|
||||
else if (c == 'f') opt.mid_occ_frac = atof(optarg);
|
||||
else if (c == 't') n_threads = atoi(optarg);
|
||||
else if (c == 'v') mm_verbose = atoi(optarg);
|
||||
else if (c == 'g') opt.max_gap = atoi(optarg);
|
||||
else if (c == 'g') opt.max_gap = (int)mm_parse_num(optarg);
|
||||
else if (c == 'G') max_intron_len = (int)mm_parse_num(optarg);
|
||||
else if (c == 'N') opt.best_n = atoi(optarg);
|
||||
else if (c == 'p') opt.pri_ratio = atof(optarg);
|
||||
else if (c == 'M') opt.mask_level = atof(optarg);
|
||||
else if (c == 'c') opt.flag |= MM_F_CIGAR;
|
||||
else if (c == 'c') opt.flag |= MM_F_OUT_CG | MM_F_CIGAR;
|
||||
else if (c == 'S') opt.flag |= MM_F_OUT_CS | MM_F_CIGAR;
|
||||
else if (c == 'X') opt.flag |= MM_F_AVA | MM_F_NO_SELF;
|
||||
else if (c == 'a') opt.flag |= MM_F_OUT_SAM | MM_F_CIGAR;
|
||||
else if (c == 'Q') opt.flag |= MM_F_NO_QUAL;
|
||||
@@ -78,6 +98,10 @@ int main(int argc, char *argv[])
|
||||
else if (c == 'B') opt.b = atoi(optarg);
|
||||
else if (c == 'z') opt.zdrop = atoi(optarg);
|
||||
else if (c == 's') opt.min_dp_max = atoi(optarg);
|
||||
else if (c == 'I') batch_size = mm_parse_num(optarg);
|
||||
else if (c == 'K') minibatch_size = (int)mm_parse_num(optarg);
|
||||
else if (c == 'R') rg = optarg;
|
||||
else if (c == 'h') fp_help = stdout;
|
||||
else if (c == 0 && long_idx == 0) bucket_bits = atoi(optarg); // --bucket-bits
|
||||
else if (c == 0 && long_idx == 2) keep_name = 0; // --int-rname
|
||||
else if (c == 0 && long_idx == 3) mm_dbg_flag |= MM_DBG_NO_KALLOC; // --no-kalloc
|
||||
@@ -87,24 +111,28 @@ int main(int argc, char *argv[])
|
||||
else if (c == 0 && long_idx == 7) opt.max_chain_skip = atoi(optarg); // --max-chain-skip
|
||||
else if (c == 0 && long_idx == 8) opt.min_ksw_len = atoi(optarg); // --min-dp-len
|
||||
else if (c == 0 && long_idx == 9) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_ALN_SEQ; // --print-aln-seq
|
||||
else if (c == 0 && long_idx ==10) opt.flag |= MM_F_SPLICE; // --splice
|
||||
else if (c == 0 && long_idx ==11) opt.noncan = atoi(optarg); // --cost-non-gt-ag
|
||||
else if (c == 0 && long_idx ==12) opt.flag |= MM_F_NO_SAM_SQ; // --no-sam-sq
|
||||
else if (c == 'V') {
|
||||
puts(MM_VERSION);
|
||||
return 0;
|
||||
} else if (c == 'u') {
|
||||
if (*optarg == 'b') opt.flag |= MM_F_SPLICE_FOR|MM_F_SPLICE_REV;
|
||||
else if (*optarg == 'B') opt.flag |= MM_F_SPLICE_BOTH;
|
||||
else if (*optarg == 'f') opt.flag |= MM_F_SPLICE_FOR, opt.flag &= ~MM_F_SPLICE_REV;
|
||||
else if (*optarg == 'r') opt.flag |= MM_F_SPLICE_REV, opt.flag &= ~MM_F_SPLICE_FOR;
|
||||
else if (*optarg == 'n') opt.flag &= ~(MM_F_SPLICE_FOR|MM_F_SPLICE_REV);
|
||||
else {
|
||||
fprintf(stderr, "[E::%s] unrecognized cDNA direction\n", __func__);
|
||||
return 1;
|
||||
}
|
||||
} else if (c == 'O') {
|
||||
opt.q = opt.q2 = strtol(optarg, &s, 10);
|
||||
if (*s == ',') opt.q2 = strtol(s + 1, &s, 10);
|
||||
} else if (c == 'E') {
|
||||
opt.e = opt.e2 = strtol(optarg, &s, 10);
|
||||
if (*s == ',') opt.e2 = strtol(s + 1, &s, 10);
|
||||
} else if (c == 'I' || c == 'K') {
|
||||
double x;
|
||||
char *p;
|
||||
x = strtod(optarg, &p);
|
||||
if (*p == 'G' || *p == 'g') x *= 1e9;
|
||||
else if (*p == 'M' || *p == 'm') x *= 1e6;
|
||||
else if (*p == 'K' || *p == 'k') x *= 1e3;
|
||||
if (c == 'I') batch_size = (uint64_t)(x + .499);
|
||||
else minibatch_size = (uint64_t)(x + .499);
|
||||
} else if (c == 'x') {
|
||||
if (strcmp(optarg, "ava-ont") == 0) {
|
||||
opt.flag |= MM_F_AVA | MM_F_NO_SELF;
|
||||
@@ -128,6 +156,13 @@ int main(int argc, char *argv[])
|
||||
k = 19, w = 19;
|
||||
opt.a = 1, opt.b = 9, opt.q = 16, opt.q2 = 41, opt.e = 2, opt.e2 = 1, opt.zdrop = 200;
|
||||
opt.min_dp_max = 200;
|
||||
} else if (strcmp(optarg, "splice") == 0 || strcmp(optarg, "cdna") == 0) {
|
||||
k = 15, w = 5;
|
||||
opt.flag |= MM_F_SPLICE | MM_F_SPLICE_FOR | MM_F_SPLICE_REV;
|
||||
opt.max_gap = 2000, opt.max_gap_ref = opt.bw = 200000;
|
||||
opt.a = 1, opt.b = 2, opt.q = 2, opt.e = 1, opt.q2 = 32, opt.e2 = 0;
|
||||
opt.noncan = 5;
|
||||
opt.zdrop = 200;
|
||||
} else {
|
||||
fprintf(stderr, "[E::%s] unknown preset '%s'\n", __func__, optarg);
|
||||
return 1;
|
||||
@@ -135,72 +170,88 @@ int main(int argc, char *argv[])
|
||||
}
|
||||
}
|
||||
if (w < 0) w = (int)(.6666667 * k + .499);
|
||||
if ((opt.flag & MM_F_SPLICE) && max_intron_len > 0)
|
||||
opt.max_gap_ref = opt.bw = max_intron_len;
|
||||
|
||||
if (argc == optind) {
|
||||
fprintf(stderr, "Usage: minimap2 [options] <target.fa>|<target.idx> [query.fa] [...]\n");
|
||||
fprintf(stderr, "Options:\n");
|
||||
fprintf(stderr, " Indexing:\n");
|
||||
fprintf(stderr, " -H use homopolymer-compressed k-mer\n");
|
||||
fprintf(stderr, " -k INT k-mer size (no larger than 28) [%d]\n", k);
|
||||
fprintf(stderr, " -w INT minizer window size [{-k}*2/3]\n");
|
||||
fprintf(stderr, " -I NUM split index for every ~NUM input bases [4G]\n");
|
||||
fprintf(stderr, " -d FILE dump index to FILE []\n");
|
||||
fprintf(stderr, " Mapping:\n");
|
||||
fprintf(stderr, " -f FLOAT filter out top FLOAT fraction of repetitive minimizers [%g]\n", opt.mid_occ_frac);
|
||||
fprintf(stderr, " -g INT stop chain enlongation if there are no minimizers in INT-bp [%d]\n", opt.max_gap);
|
||||
fprintf(stderr, " -r INT bandwidth used in chaining and DP-based alignment [%d]\n", opt.bw);
|
||||
fprintf(stderr, " -n INT minimal number of minimizers on a chain [%d]\n", opt.min_cnt);
|
||||
fprintf(stderr, " -m INT minimal chaining score (matching bases minus log gap penalty) [%d]\n", opt.min_chain_score);
|
||||
// fprintf(stderr, " -T INT SDUST threshold; 0 to disable SDUST [%d]\n", opt.sdust_thres); // TODO: this option is never used; might be buggy
|
||||
fprintf(stderr, " -X skip self and dual mappings (for the all-vs-all mode)\n");
|
||||
fprintf(stderr, " -p FLOAT min secondary-to-primary score ratio [%g]\n", opt.pri_ratio);
|
||||
fprintf(stderr, " -N INT retain at most INT secondary alignments [%d]\n", opt.best_n);
|
||||
fprintf(stderr, " Alignment:\n");
|
||||
fprintf(stderr, " -A INT matching score [%d]\n", opt.a);
|
||||
fprintf(stderr, " -B INT mismatch penalty [%d]\n", opt.b);
|
||||
fprintf(stderr, " -O INT[,INT] gap open penalty [%d,%d]\n", opt.q, opt.q2);
|
||||
fprintf(stderr, " -E INT[,INT] gap extension penalty; a k-long gap costs min{O1+k*E1,O2+k*E2} [%d,%d]\n", opt.e, opt.e2);
|
||||
fprintf(stderr, " -z INT Z-drop score [%d]\n", opt.zdrop);
|
||||
fprintf(stderr, " -s INT minimal peak DP alignment score [%d]\n", opt.min_dp_max);
|
||||
fprintf(stderr, " Input/Output:\n");
|
||||
fprintf(stderr, " -Q ignore base quality in the input\n");
|
||||
fprintf(stderr, " -a output in the SAM format (PAF by default)\n");
|
||||
fprintf(stderr, " -c output CIGAR in PAF\n");
|
||||
fprintf(stderr, " -t INT number of threads [%d]\n", n_threads);
|
||||
fprintf(stderr, " -K NUM minibatch size [200M]\n");
|
||||
// fprintf(stderr, " -v INT verbose level [%d]\n", mm_verbose);
|
||||
fprintf(stderr, " -V show version number\n");
|
||||
fprintf(stderr, " Preset:\n");
|
||||
fprintf(stderr, " -x STR preset (recommended to be applied before other options) []\n");
|
||||
fprintf(stderr, " map10k/map-pb: -Hk19 (PacBio/ONT vs reference mapping)\n");
|
||||
fprintf(stderr, " map-ont: -k15 (slightly more sensitive than 'map10k' for ONT vs reference)\n");
|
||||
fprintf(stderr, " asm5: -k19 -w19 -A1 -B19 -O39,81 -E3,1 -s200 -z200 (asm to ref mapping; break at 5%% div.)\n");
|
||||
fprintf(stderr, " asm10: -k19 -w19 -A1 -B9 -O16,41 -E2,1 -s200 -z200 (asm to ref mapping; break at 10%% div.)\n");
|
||||
fprintf(stderr, " ava-pb: -Hk19 -w5 -Xp0 -m100 -g10000 -K500m --max-chain-skip 25 (PacBio read overlap)\n");
|
||||
fprintf(stderr, " ava-ont: -k15 -w5 -Xp0 -m100 -g10000 -K500m --max-chain-skip 25 (ONT read overlap)\n");
|
||||
fprintf(stderr, "\nSee `man ./minimap2.1' for detailed description of command-line options.\n");
|
||||
return 1;
|
||||
if (argc == optind || fp_help == stdout) {
|
||||
fprintf(fp_help, "Usage: minimap2 [options] <target.fa>|<target.idx> [query.fa] [...]\n");
|
||||
fprintf(fp_help, "Options:\n");
|
||||
fprintf(fp_help, " Indexing:\n");
|
||||
fprintf(fp_help, " -H use homopolymer-compressed k-mer\n");
|
||||
fprintf(fp_help, " -k INT k-mer size (no larger than 28) [%d]\n", k);
|
||||
fprintf(fp_help, " -w INT minizer window size [{-k}*2/3]\n");
|
||||
fprintf(fp_help, " -I NUM split index for every ~NUM input bases [4G]\n");
|
||||
fprintf(fp_help, " -d FILE dump index to FILE []\n");
|
||||
fprintf(fp_help, " Mapping:\n");
|
||||
fprintf(fp_help, " -f FLOAT filter out top FLOAT fraction of repetitive minimizers [%g]\n", opt.mid_occ_frac);
|
||||
fprintf(fp_help, " -g INT stop chain enlongation if there are no minimizers in INT-bp [%d]\n", opt.max_gap);
|
||||
fprintf(fp_help, " -r INT bandwidth used in chaining and DP-based alignment [%d]\n", opt.bw);
|
||||
fprintf(fp_help, " -n INT minimal number of minimizers on a chain [%d]\n", opt.min_cnt);
|
||||
fprintf(fp_help, " -m INT minimal chaining score (matching bases minus log gap penalty) [%d]\n", opt.min_chain_score);
|
||||
// fprintf(fp_help, " -T INT SDUST threshold; 0 to disable SDUST [%d]\n", opt.sdust_thres); // TODO: this option is never used; might be buggy
|
||||
fprintf(fp_help, " -X skip self and dual mappings (for the all-vs-all mode)\n");
|
||||
fprintf(fp_help, " -p FLOAT min secondary-to-primary score ratio [%g]\n", opt.pri_ratio);
|
||||
fprintf(fp_help, " -N INT retain at most INT secondary alignments [%d]\n", opt.best_n);
|
||||
fprintf(fp_help, " -G NUM max intron length (only effective following -x splice) [200k]\n");
|
||||
fprintf(fp_help, " Alignment:\n");
|
||||
fprintf(fp_help, " -A INT matching score [%d]\n", opt.a);
|
||||
fprintf(fp_help, " -B INT mismatch penalty [%d]\n", opt.b);
|
||||
fprintf(fp_help, " -O INT[,INT] gap open penalty [%d,%d]\n", opt.q, opt.q2);
|
||||
fprintf(fp_help, " -E INT[,INT] gap extension penalty; a k-long gap costs min{O1+k*E1,O2+k*E2} [%d,%d]\n", opt.e, opt.e2);
|
||||
fprintf(fp_help, " -z INT Z-drop score [%d]\n", opt.zdrop);
|
||||
fprintf(fp_help, " -s INT minimal peak DP alignment score [%d]\n", opt.min_dp_max);
|
||||
fprintf(fp_help, " -u CHAR how to find GT-AG. f:transcript strand, b:both strands, n:don't match GT-AG [n]\n");
|
||||
fprintf(fp_help, " Input/Output:\n");
|
||||
fprintf(fp_help, " -a output in the SAM format (PAF by default)\n");
|
||||
fprintf(fp_help, " -Q don't output base quality in SAM\n");
|
||||
fprintf(fp_help, " -R STR SAM read group line in a format like '@RG\\tID:foo\\tSM:bar' []\n");
|
||||
fprintf(fp_help, " -c output CIGAR in PAF\n");
|
||||
fprintf(fp_help, " -S output the cs tag in PAF (cs encodes both query and ref sequences)\n");
|
||||
fprintf(fp_help, " -t INT number of threads [%d]\n", n_threads);
|
||||
fprintf(fp_help, " -K NUM minibatch size [200M]\n");
|
||||
// fprintf(fp_help, " -v INT verbose level [%d]\n", mm_verbose);
|
||||
fprintf(fp_help, " --version show version number\n");
|
||||
fprintf(fp_help, " Preset:\n");
|
||||
fprintf(fp_help, " -x STR preset (recommended to be applied before other options) []\n");
|
||||
fprintf(fp_help, " map10k/map-pb: -Hk19 (PacBio/ONT vs reference mapping)\n");
|
||||
fprintf(fp_help, " map-ont: -k15 (slightly more sensitive than 'map10k' for ONT vs reference)\n");
|
||||
fprintf(fp_help, " asm5: -k19 -w19 -A1 -B19 -O39,81 -E3,1 -s200 -z200 (asm to ref mapping; break at 5%% div.)\n");
|
||||
fprintf(fp_help, " asm10: -k19 -w19 -A1 -B9 -O16,41 -E2,1 -s200 -z200 (asm to ref mapping; break at 10%% div.)\n");
|
||||
fprintf(fp_help, " ava-pb: -Hk19 -w5 -Xp0 -m100 -g10000 -K500m --max-chain-skip 25 (PacBio read overlap)\n");
|
||||
fprintf(fp_help, " ava-ont: -k15 -w5 -Xp0 -m100 -g10000 -K500m --max-chain-skip 25 (ONT read overlap)\n");
|
||||
fprintf(fp_help, " splice: long-read spliced alignment (see minimap2.1 for details)\n");
|
||||
fprintf(fp_help, "\nSee `man ./minimap2.1' for detailed description of command-line options.\n");
|
||||
return fp_help == stdout? 0 : 1;
|
||||
}
|
||||
|
||||
is_idx = mm_idx_is_idx(argv[optind]);
|
||||
if (is_idx < 0) {
|
||||
fprintf(stderr, "[E::%s] failed to open file '%s'\n", __func__, argv[optind]);
|
||||
fprintf(stderr, "[ERROR] failed to open file '%s'\n", argv[optind]);
|
||||
return 1;
|
||||
}
|
||||
if (!is_idx && fnw == 0 && argc - optind < 2) {
|
||||
fprintf(stderr, "[ERROR] missing input: please specify a query file to map or option -d to keep the index\n");
|
||||
return 1;
|
||||
}
|
||||
if (is_idx) fpr = fopen(argv[optind], "rb");
|
||||
else fp = mm_bseq_open(argv[optind]);
|
||||
if (fnw) fpw = fopen(fnw, "wb");
|
||||
if (opt.flag & MM_F_OUT_SAM)
|
||||
mm_write_sam_hdr_no_SQ(rg, MM_VERSION, argc, argv);
|
||||
for (;;) {
|
||||
mm_idx_t *mi = 0;
|
||||
mm_idx_t *mi;
|
||||
if (fpr) {
|
||||
mi = mm_idx_load(fpr);
|
||||
if (idx_par_set && mm_verbose >= 2 && (mi->k != k || mi->w != w || mi->is_hpc != mi->is_hpc))
|
||||
fprintf(stderr, "[W::%s::%.3f*%.2f] Indexing parameters on the command line (-k/-w/-H) overridden by parameters in the prebuilt index.\n",
|
||||
__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0));
|
||||
} else if (!mm_bseq_eof(fp)) {
|
||||
if (mi == 0) break;
|
||||
if (idx_par_set && mm_verbose >= 2 && (mi->k != k || mi->w != w || mi->is_hpc != is_hpc))
|
||||
fprintf(stderr, "[WARNING] \033[1;31mIndexing parameters on the command line (-k/-w/-H) overridden by parameters in the prebuilt index.\033[0m\n");
|
||||
} else {
|
||||
mi = mm_idx_gen(fp, w, k, bucket_bits, is_hpc, minibatch_size, n_threads, batch_size, keep_name);
|
||||
}
|
||||
if (mi == 0) break;
|
||||
++n_idx_part;
|
||||
if (mm_verbose >= 2 && n_idx_part > 1 && (opt.flag&MM_F_OUT_SAM) && !(opt.flag&MM_F_NO_SAM_SQ))
|
||||
fprintf(stderr, "[WARNING] \033[1;31mSAM output is malformated due to internal @SQ lines. Please add option --no-sam-sq or filter afterwards.\033[0m\n");
|
||||
if (mm_verbose >= 3)
|
||||
fprintf(stderr, "[M::%s::%.3f*%.2f] loaded/built the index for %d target sequence(s)\n",
|
||||
__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), mi->n_seq);
|
||||
|
||||
@@ -19,6 +19,7 @@ void mm_mapopt_init(mm_mapopt_t *opt)
|
||||
opt->min_chain_score = 40;
|
||||
opt->bw = 500;
|
||||
opt->max_gap = 5000;
|
||||
opt->max_gap_ref = -1;
|
||||
opt->max_chain_skip = 25;
|
||||
|
||||
opt->mask_level = 0.5f;
|
||||
@@ -37,6 +38,8 @@ void mm_mapopt_init(mm_mapopt_t *opt)
|
||||
|
||||
void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
|
||||
{
|
||||
if (opt->flag & MM_F_SPLICE_BOTH)
|
||||
opt->flag &= ~(MM_F_SPLICE_FOR|MM_F_SPLICE_REV);
|
||||
opt->max_occ = mm_idx_cal_max_occ(mi, opt->max_occ_frac);
|
||||
opt->mid_occ = mm_idx_cal_max_occ(mi, opt->mid_occ_frac);
|
||||
if (mm_verbose >= 3)
|
||||
@@ -167,7 +170,7 @@ void mm_pair_thin(mm_tbuf_t *b, int radius, mm_match_t *m1, mm_match_t *m2)
|
||||
#endif
|
||||
mm_reg1_t *mm_map_frag(const mm_mapopt_t *opt, const mm_idx_t *mi, mm_tbuf_t *b, uint32_t m_st, uint32_t m_en, const char *qname, int qlen, const char *seq, int *n_regs)
|
||||
{
|
||||
int i, n = m_en - m_st, j, n_u;
|
||||
int i, n = m_en - m_st, j, n_u, max_gap_ref;
|
||||
int64_t n_a;
|
||||
uint64_t *u;
|
||||
mm_match_t *m;
|
||||
@@ -243,7 +246,8 @@ mm_reg1_t *mm_map_frag(const mm_mapopt_t *opt, const mm_idx_t *mi, mm_tbuf_t *b,
|
||||
fprintf(stderr, "SD\t%s\t%d\t%c\t%d\t%d\t%d\n", mi->seq[a[i].x<<1>>33].name, (int32_t)a[i].x, "+-"[a[i].x>>63], (int32_t)a[i].y, (int32_t)(a[i].y>>32&0xff),
|
||||
i == 0? 0 : ((int32_t)a[i].y - (int32_t)a[i-1].y) - ((int32_t)a[i].x - (int32_t)a[i-1].x));
|
||||
|
||||
n_u = mm_chain_dp(opt->max_gap, opt->bw, opt->max_chain_skip, opt->min_cnt, opt->min_chain_score, n_a, a, &u, b->km);
|
||||
max_gap_ref = opt->max_gap_ref >= 0? opt->max_gap_ref : opt->max_gap;
|
||||
n_u = mm_chain_dp(max_gap_ref, opt->max_gap, opt->bw, opt->max_chain_skip, opt->min_cnt, opt->min_chain_score, !!(opt->flag&MM_F_SPLICE), n_a, a, &u, b->km);
|
||||
regs = mm_gen_regs(b->km, qlen, n_u, u, a);
|
||||
*n_regs = n_u;
|
||||
|
||||
@@ -256,7 +260,8 @@ mm_reg1_t *mm_map_frag(const mm_mapopt_t *opt, const mm_idx_t *mi, mm_tbuf_t *b,
|
||||
if (!(opt->flag & MM_F_AVA)) { // don't choose primary mapping(s) for read overlap
|
||||
mm_set_parent(b->km, opt->mask_level, *n_regs, regs);
|
||||
mm_select_sub(b->km, opt->mask_level, opt->pri_ratio, mi->k*2, opt->best_n, n_regs, regs);
|
||||
mm_join_long(b->km, opt, qlen, n_regs, regs, a); // TODO: this can be applied to all-vs-all in principle
|
||||
if (!(opt->flag & MM_F_SPLICE))
|
||||
mm_join_long(b->km, opt, qlen, n_regs, regs, a); // TODO: this can be applied to all-vs-all in principle
|
||||
}
|
||||
if (opt->flag & MM_F_CIGAR) {
|
||||
regs = mm_align_skeleton(b->km, opt, mi, qlen, seq, n_regs, regs, a); // this calls mm_filter_regs()
|
||||
@@ -338,16 +343,20 @@ static void *worker_pipeline(void *shared, int step, void *in)
|
||||
kt_for(p->n_threads, worker_for, in, ((step_t*)in)->n_seq);
|
||||
return in;
|
||||
} else if (step == 2) { // step 2: output
|
||||
void *km = 0;
|
||||
step_t *s = (step_t*)in;
|
||||
const mm_idx_t *mi = p->mi;
|
||||
for (i = 0; i < p->n_threads; ++i) mm_tbuf_destroy(s->buf[i]);
|
||||
free(s->buf);
|
||||
if ((p->opt->flag & MM_F_OUT_CS) && !(mm_dbg_flag & MM_DBG_NO_KALLOC)) km = km_init();
|
||||
for (i = 0; i < s->n_seq; ++i) {
|
||||
mm_bseq1_t *t = &s->seq[i];
|
||||
for (j = 0; j < s->n_reg[i]; ++j) {
|
||||
mm_reg1_t *r = &s->reg[i][j];
|
||||
if (p->opt->flag & MM_F_OUT_SAM) mm_write_sam(&p->str, mi, t, r, s->n_reg[i], s->reg[i]);
|
||||
else mm_write_paf(&p->str, mi, t, r);
|
||||
if (p->opt->flag & MM_F_OUT_SAM)
|
||||
mm_write_sam(&p->str, mi, t, r, s->n_reg[i], s->reg[i]);
|
||||
else
|
||||
mm_write_paf(&p->str, mi, t, r, km, p->opt->flag);
|
||||
puts(p->str.s);
|
||||
}
|
||||
if (s->n_reg[i] == 0 && (p->opt->flag & MM_F_OUT_SAM)) {
|
||||
@@ -360,6 +369,7 @@ static void *worker_pipeline(void *shared, int step, void *in)
|
||||
if (s->seq[i].qual) free(s->seq[i].qual);
|
||||
}
|
||||
free(s->reg); free(s->n_reg); free(s->seq);
|
||||
km_destroy(km);
|
||||
if (mm_verbose >= 3)
|
||||
fprintf(stderr, "[M::%s::%.3f*%.2f] mapped %d sequences\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), s->n_seq);
|
||||
free(s);
|
||||
@@ -372,14 +382,15 @@ int mm_map_file(const mm_idx_t *idx, const char *fn, const mm_mapopt_t *opt, int
|
||||
pipeline_t pl;
|
||||
memset(&pl, 0, sizeof(pipeline_t));
|
||||
pl.fp = mm_bseq_open(fn);
|
||||
if (pl.fp == 0) return -1;
|
||||
if (pl.fp == 0) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "ERROR: failed to open file '%s'\n", fn);
|
||||
return -1;
|
||||
}
|
||||
pl.opt = opt, pl.mi = idx;
|
||||
pl.n_threads = n_threads, pl.mini_batch_size = mini_batch_size;
|
||||
if (opt->flag & MM_F_OUT_SAM) {
|
||||
uint32_t i;
|
||||
for (i = 0; i < idx->n_seq; ++i)
|
||||
printf("@SQ\tSN:%s\tLN:%d\n", idx->seq[i].name, idx->seq[i].len);
|
||||
}
|
||||
if ((opt->flag & MM_F_OUT_SAM) && !(opt->flag & MM_F_NO_SAM_SQ))
|
||||
mm_write_sam_SQ(idx);
|
||||
kt_pipeline(n_threads == 1? 1 : 2, worker_pipeline, &pl, 3);
|
||||
free(pl.str.s);
|
||||
mm_bseq_close(pl.fp);
|
||||
|
||||
@@ -5,13 +5,20 @@
|
||||
#include <stdio.h>
|
||||
#include <sys/types.h>
|
||||
|
||||
#define MM_IDX_DEF_B 14
|
||||
#define MM_IDX_DEF_B 14
|
||||
|
||||
#define MM_F_NO_SELF 0x01
|
||||
#define MM_F_AVA 0x02
|
||||
#define MM_F_CIGAR 0x04
|
||||
#define MM_F_OUT_SAM 0x08
|
||||
#define MM_F_NO_QUAL 0x10
|
||||
#define MM_F_NO_SELF 0x001
|
||||
#define MM_F_AVA 0x002
|
||||
#define MM_F_CIGAR 0x004
|
||||
#define MM_F_OUT_SAM 0x008
|
||||
#define MM_F_NO_QUAL 0x010
|
||||
#define MM_F_OUT_CG 0x020
|
||||
#define MM_F_OUT_CS 0x040
|
||||
#define MM_F_SPLICE 0x080
|
||||
#define MM_F_SPLICE_FOR 0x100
|
||||
#define MM_F_SPLICE_REV 0x200
|
||||
#define MM_F_SPLICE_BOTH 0x400
|
||||
#define MM_F_NO_SAM_SQ 0x800
|
||||
|
||||
#define MM_IDX_MAGIC "MMI\2"
|
||||
|
||||
@@ -53,7 +60,8 @@ typedef struct {
|
||||
uint32_t capacity;
|
||||
int32_t dp_score, dp_max, dp_max2;
|
||||
uint32_t blen;
|
||||
uint32_t n_diff, n_ambi;
|
||||
uint32_t n_diff;
|
||||
uint32_t n_ambi:30, trans_strand:2;
|
||||
uint32_t n_cigar;
|
||||
uint32_t cigar[];
|
||||
} mm_extra_t;
|
||||
@@ -78,7 +86,7 @@ typedef struct {
|
||||
int flag; // see MM_F_* macros
|
||||
|
||||
int bw; // bandwidth
|
||||
int max_gap; // break a chain if there are no minimizers in a max_gap window
|
||||
int max_gap, max_gap_ref; // break a chain if there are no minimizers in a max_gap window
|
||||
int max_chain_skip;
|
||||
int min_cnt;
|
||||
int min_chain_score;
|
||||
@@ -91,6 +99,7 @@ typedef struct {
|
||||
int min_join_flank_sc;
|
||||
|
||||
int a, b, q, e, q2, e2; // matching score, mismatch, gap-open and gap-ext penalties
|
||||
int noncan;
|
||||
int zdrop;
|
||||
int min_dp_max;
|
||||
int min_ksw_len;
|
||||
|
||||
+75
-20
@@ -1,4 +1,4 @@
|
||||
.TH minimap2 1 "30 July 2017" "minimap2-2.0rc1-r232" "Bioinformatics tools"
|
||||
.TH minimap2 1 "6 September 2017" "minimap2-2.1.1-r341" "Bioinformatics tools"
|
||||
.SH NAME
|
||||
.PP
|
||||
minimap2 - mapping and alignment between collections of DNA sequences
|
||||
@@ -162,6 +162,12 @@ secondary alignments [5]. This option has no effect when
|
||||
.B -X
|
||||
is applied.
|
||||
.TP
|
||||
.BI -G \ NUM
|
||||
Maximal intron length in the splice mode [200k]. This option also changes the
|
||||
bandwidth to
|
||||
.IR NUM .
|
||||
Increasing this option slows down spliced alignment.
|
||||
.TP
|
||||
.BI --max-chain-skip \ INT
|
||||
A heuristics that stops chaining early [50]. Minimap2 uses dynamic programming
|
||||
for chaining. The time complexity is quadratic in the number of seeds. This
|
||||
@@ -199,15 +205,32 @@ the contiguity of the alignment at the cost of poor alignment in the middle
|
||||
Minimal peak DP alignment score to output [40]. The peak score is computed from
|
||||
the final CIGAR. It is the score of the max scoring segment in the alignment
|
||||
and may be different from the total alignment score.
|
||||
.TP
|
||||
.BI -u \ CHAR
|
||||
How to find canonical splicing sites GT-AG -
|
||||
.BR f :
|
||||
transcript strand;
|
||||
.BR b :
|
||||
both strands;
|
||||
.BR n :
|
||||
no attempt to match GT-AG [n]
|
||||
.TP
|
||||
.BI --cost-non-gt-ag \ INT
|
||||
Cost of non-canonical splicing sites [0].
|
||||
.SS Input/output options
|
||||
.TP 10
|
||||
.B -Q
|
||||
Ignore base quality in the input file.
|
||||
.TP
|
||||
.B -a
|
||||
Generate CIGAR and output alignments in the SAM format. Minimap2 outputs in PAF
|
||||
by default.
|
||||
.TP
|
||||
.B -Q
|
||||
Ignore base quality in the input file.
|
||||
.TP
|
||||
.BI -R \ STR
|
||||
SAM read group line in a format like
|
||||
.B @RG\\\\tID:foo\\\\tSM:bar
|
||||
[].
|
||||
.TP
|
||||
.B -c
|
||||
Generate CIGAR. In PAF, the CIGAR is written to the `cg' custom tag.
|
||||
.TP
|
||||
@@ -232,8 +255,13 @@ and
|
||||
use
|
||||
.BR -K500m .
|
||||
.TP
|
||||
.B -V
|
||||
.B --version
|
||||
Print version number to stdout
|
||||
.TP
|
||||
.B --no-sam-hdr
|
||||
Don't output SAM header lines. Use this option if the index consists of
|
||||
multiple parts; otherwise the SAM output is malformated due to internal header
|
||||
lines.
|
||||
.SS Preset options
|
||||
.TP 10
|
||||
.BI -x \ STR
|
||||
@@ -247,37 +275,64 @@ are:
|
||||
.RS
|
||||
.TP 8
|
||||
.B map-pb
|
||||
PacBio/Oxford Nanopore read to reference mapping (-Hk19)
|
||||
PacBio/Oxford Nanopore read to reference mapping
|
||||
.RB ( -Hk19 )
|
||||
.TP
|
||||
.B map10k
|
||||
The same as
|
||||
.B map-pb
|
||||
(-Hk19)
|
||||
.RB ( -Hk19 )
|
||||
.TP
|
||||
.B map-ont
|
||||
Slightly more sensitive for Oxford Nanopore to reference mapping (-k15). For
|
||||
PacBio reads, HPC minimizers consistently leads to faster performance and more
|
||||
sensitive results in comparison to normal minimizers. For Oxford Nanopore data,
|
||||
normal minimizers are better, though not much. The effectiveness of HPC is
|
||||
determined by the sequencing error mode.
|
||||
Slightly more sensitive for Oxford Nanopore to reference mapping
|
||||
.RB ( -k15 ).
|
||||
For PacBio reads, HPC minimizers consistently leads to faster performance and
|
||||
more sensitive results in comparison to normal minimizers. For Oxford Nanopore
|
||||
data, normal minimizers are better, though not much. The effectiveness of HPC
|
||||
is determined by the sequencing error mode.
|
||||
.TP
|
||||
.B asm5
|
||||
Long assembly to reference mapping (-k19 -w19 -A1 -B19 -O39,81 -E3,1 -s200 -z200).
|
||||
Long assembly to reference mapping
|
||||
.RB ( -k19
|
||||
.B -w19 -A1 -B19 -O39,81 -E3,1 -s200
|
||||
.BR -z200 ).
|
||||
Typically, the alignment will not extend to regions with 5% or higher sequence
|
||||
divergence. Only use this preset if the average divergence is far below 5%.
|
||||
.TP
|
||||
.B asm10
|
||||
Long assembly to reference mapping (-k19 -w19 -A1 -B9 -O16,41 -E2,1 -s200 -z200). Up
|
||||
to 10% sequence divergence.
|
||||
.TP 8
|
||||
Long assembly to reference mapping
|
||||
.RB ( -k19
|
||||
.B -w19 -A1 -B9 -O16,41 -E2,1 -s200
|
||||
.BR -z200 ).
|
||||
Up to 10% sequence divergence.
|
||||
.TP
|
||||
.B ava-pb
|
||||
PacBio all-vs-all overlap mapping (-Hk19 -w5 -Xp0 -m100 -K500m -g10000 --max-chain-skip 25)
|
||||
.TP 8
|
||||
PacBio all-vs-all overlap mapping
|
||||
.RB ( -Hk19
|
||||
.B -w5 -Xp0 -m100 -K500m -g10000 --max-chain-skip
|
||||
.BR 25 ).
|
||||
.TP
|
||||
.B ava-ont
|
||||
Oxford Nanopore all-vs-all overlap mapping (-k15 -w5 -Xp0 -m100 -K500m -g10000
|
||||
--max-chain-skip 25). Similarly, the major difference from
|
||||
Oxford Nanopore all-vs-all overlap mapping
|
||||
.RB ( -k15
|
||||
.B -w5 -Xp0 -m100 -K500m -g10000 --max-chain-skip
|
||||
.BR 25 ).
|
||||
Similarly, the major difference from
|
||||
.B ava-pb
|
||||
is that this preset is not using HPC minimizers.
|
||||
.TP
|
||||
.B splice
|
||||
Long-read spliced alignment
|
||||
.RB ( -k15
|
||||
.B -w5 --splice -g2000 -G200k -A1 -B2 -O2,32 -E1,0 -z200 -ub --cost-non-gt-ag
|
||||
.BR 5 ).
|
||||
In the splice mode, 1) long deletions are taken as introns and represented as
|
||||
the
|
||||
.RB ` N '
|
||||
CIGAR operator; 2) long insertions are disabled; 3) deletion and insertion gap
|
||||
costs are different during chaining; 4) the computation of the
|
||||
.RB ` ms '
|
||||
tag ignores introns to demote hits to pseudogenes.
|
||||
.RE
|
||||
.SS Miscellaneous options
|
||||
.TP 10
|
||||
|
||||
@@ -1,17 +1,102 @@
|
||||
#include <sys/resource.h>
|
||||
#include <sys/time.h>
|
||||
#include "minimap.h"
|
||||
|
||||
int mm_verbose = 3;
|
||||
int mm_dbg_flag = 0;
|
||||
double mm_realtime0;
|
||||
|
||||
#if defined(WIN32) || defined(_WIN32)
|
||||
#include <windows.h>
|
||||
|
||||
struct timezone
|
||||
{
|
||||
__int32 tz_minuteswest; /* minutes W of Greenwich */
|
||||
int tz_dsttime; /* type of dst correction */
|
||||
};
|
||||
|
||||
/*
|
||||
* gettimeofday.c
|
||||
* Win32 gettimeofday() replacement
|
||||
* taken from PostgreSQL, according to
|
||||
* https://stackoverflow.com/questions/1676036/what-should-i-use-to-replace-gettimeofday-on-windows
|
||||
*
|
||||
* src/port/gettimeofday.c
|
||||
*
|
||||
* Copyright (c) 2003 SRA, Inc.
|
||||
* Copyright (c) 2003 SKC, Inc.
|
||||
*
|
||||
* Permission to use, copy, modify, and distribute this software and
|
||||
* its documentation for any purpose, without fee, and without a
|
||||
* written agreement is hereby granted, provided that the above
|
||||
* copyright notice and this paragraph and the following two
|
||||
* paragraphs appear in all copies.
|
||||
*
|
||||
* IN NO EVENT SHALL THE AUTHOR BE LIABLE TO ANY PARTY FOR DIRECT,
|
||||
* INDIRECT, SPECIAL, INCIDENTAL, OR CONSEQUENTIAL DAMAGES, INCLUDING
|
||||
* LOST PROFITS, ARISING OUT OF THE USE OF THIS SOFTWARE AND ITS
|
||||
* DOCUMENTATION, EVEN IF THE UNIVERSITY OF CALIFORNIA HAS BEEN ADVISED
|
||||
* OF THE POSSIBILITY OF SUCH DAMAGE.
|
||||
*
|
||||
* THE AUTHOR SPECIFICALLY DISCLAIMS ANY WARRANTIES, INCLUDING, BUT NOT
|
||||
* LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR
|
||||
* A PARTICULAR PURPOSE. THE SOFTWARE PROVIDED HEREUNDER IS ON AN "AS
|
||||
* IS" BASIS, AND THE AUTHOR HAS NO OBLIGATIONS TO PROVIDE MAINTENANCE,
|
||||
* SUPPORT, UPDATES, ENHANCEMENTS, OR MODIFICATIONS.
|
||||
*/
|
||||
|
||||
/* FILETIME of Jan 1 1970 00:00:00. */
|
||||
static const unsigned __int64 epoch = ((unsigned __int64) 116444736000000000ULL);
|
||||
|
||||
/*
|
||||
* timezone information is stored outside the kernel so tzp isn't used anymore.
|
||||
*
|
||||
* Note: this function is not for Win32 high precision timing purpose. See
|
||||
* elapsed_time().
|
||||
*/
|
||||
int gettimeofday(struct timeval * tp, struct timezone *tzp)
|
||||
{
|
||||
FILETIME file_time;
|
||||
SYSTEMTIME system_time;
|
||||
ULARGE_INTEGER ularge;
|
||||
|
||||
GetSystemTime(&system_time);
|
||||
SystemTimeToFileTime(&system_time, &file_time);
|
||||
ularge.LowPart = file_time.dwLowDateTime;
|
||||
ularge.HighPart = file_time.dwHighDateTime;
|
||||
|
||||
tp->tv_sec = (long) ((ularge.QuadPart - epoch) / 10000000L);
|
||||
tp->tv_usec = (long) (system_time.wMilliseconds * 1000);
|
||||
|
||||
return 0;
|
||||
}
|
||||
|
||||
// taken from https://stackoverflow.com/questions/5272470/c-get-cpu-usage-on-linux-and-windows
|
||||
double cputime()
|
||||
{
|
||||
HANDLE hProcess = GetCurrentProcess();
|
||||
FILETIME ftCreation, ftExit, ftKernel, ftUser;
|
||||
SYSTEMTIME stKernel;
|
||||
SYSTEMTIME stUser;
|
||||
|
||||
GetProcessTimes(hProcess, &ftCreation, &ftExit, &ftKernel, &ftUser);
|
||||
FileTimeToSystemTime(&ftKernel, &stKernel);
|
||||
FileTimeToSystemTime(&ftUser, &stUser);
|
||||
|
||||
double kernelModeTime = ((stKernel.wHour * 60.) + stKernel.wMinute * 60.) + stKernel.wSecond * 1. + stKernel.wMilliseconds / 1000.;
|
||||
double userModeTime = ((stUser.wHour * 60.) + stUser.wMinute * 60.) + stUser.wSecond * 1. + stUser.wMilliseconds / 1000.;
|
||||
|
||||
return kernelModeTime + userModeTime;
|
||||
}
|
||||
#else
|
||||
#include <sys/resource.h>
|
||||
#include <sys/time.h>
|
||||
|
||||
double cputime()
|
||||
{
|
||||
struct rusage r;
|
||||
getrusage(RUSAGE_SELF, &r);
|
||||
return r.ru_utime.tv_sec + r.ru_stime.tv_sec + 1e-6 * (r.ru_utime.tv_usec + r.ru_stime.tv_usec);
|
||||
}
|
||||
#endif /* WIN32 || _WIN32 */
|
||||
|
||||
double realtime()
|
||||
{
|
||||
|
||||
@@ -0,0 +1,28 @@
|
||||
The [K8 Javascript shell][k8] is needed to run Javascripts in this directory.
|
||||
Precompiled k8 binaries for Mac and Linux can be found at the [K8 release
|
||||
page][k8bin].
|
||||
|
||||
* [paf2aln.js](paf2aln.js): convert PAF to [MAF][maf] or BLAST-like output for
|
||||
eyeballing. PAF has to be generated with minimap2 option `-S`, which writes
|
||||
the aligned sequences to the `cs` tag. An example:
|
||||
```sh
|
||||
../minimap2 -S ../test/MT-*.fa | k8 paf2aln.js /dev/stdin
|
||||
```
|
||||
|
||||
* [mapstat.js](mapstat.js): output basic statistics such as the number of
|
||||
non-redundant mapped bases, number of split and secondary alignments and
|
||||
number of long gaps. This scripts seamlessly works with both SAM and PAF.
|
||||
|
||||
* [sim-pbsim.js](sim-pbsim.js): convert reads simulated with [PBSIM][pbsim] to
|
||||
FASTA and encode the true mapping positions to read names in a format like
|
||||
`S1_33!chr1!225258409!225267761!-`.
|
||||
|
||||
* [sim-eval.js](sim-eval.js): evaluate mapping accuracy for FASTA generated
|
||||
with [sim-pbsim.js](sim-pbsim.js) or [sim-mason2.js](sim-mason2.js).
|
||||
|
||||
* [sam2paf.js](sam2paf.js): convert SAM to PAF.
|
||||
|
||||
[k8]: https://github.com/attractivechaos/k8
|
||||
[k8bin]: https://github.com/attractivechaos/k8/releases
|
||||
[maf]: https://genome.ucsc.edu/FAQ/FAQformat#format5
|
||||
[pbsim]: https://github.com/pfaucon/PBSIM-PacBio-Simulator
|
||||
@@ -0,0 +1,266 @@
|
||||
/*******************************
|
||||
* Command line option parsing *
|
||||
*******************************/
|
||||
|
||||
var getopt = function(args, ostr) {
|
||||
var oli; // option letter list index
|
||||
if (typeof(getopt.place) == 'undefined')
|
||||
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
|
||||
if (getopt.place == -1) { // update scanning pointer
|
||||
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
|
||||
getopt.place = -1;
|
||||
return null;
|
||||
}
|
||||
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
|
||||
++getopt.ind;
|
||||
getopt.place = -1;
|
||||
return null;
|
||||
}
|
||||
}
|
||||
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
|
||||
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
|
||||
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
|
||||
if (getopt.place < 0) ++getopt.ind;
|
||||
return '?';
|
||||
}
|
||||
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
|
||||
getopt.arg = null;
|
||||
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
|
||||
} else { // need an argument
|
||||
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
|
||||
getopt.arg = args[getopt.ind].substr(getopt.place);
|
||||
else if (args.length <= ++getopt.ind) { // no arg
|
||||
getopt.place = -1;
|
||||
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
|
||||
return '?';
|
||||
} else getopt.arg = args[getopt.ind]; // white space
|
||||
getopt.place = -1;
|
||||
++getopt.ind;
|
||||
}
|
||||
return optopt;
|
||||
}
|
||||
|
||||
/***********************
|
||||
* Interval operations *
|
||||
***********************/
|
||||
|
||||
Interval = {};
|
||||
|
||||
Interval.sort = function(a)
|
||||
{
|
||||
if (typeof a[0] == 'number')
|
||||
a.sort(function(x, y) { return x - y });
|
||||
else a.sort(function(x, y) { return x[0] != y[0]? x[0] - y[0] : x[1] - y[1] });
|
||||
}
|
||||
|
||||
Interval.merge = function(a, sorted)
|
||||
{
|
||||
if (typeof sorted == 'undefined') sorted = true;
|
||||
if (!sorted) Interval.sort(a);
|
||||
var k = 0;
|
||||
for (var i = 1; i < a.length; ++i) {
|
||||
if (a[k][1] >= a[i][0])
|
||||
a[k][1] = a[k][1] > a[i][1]? a[k][1] : a[i][1];
|
||||
else a[++k] = a[i].slice(0);
|
||||
}
|
||||
a.length = k + 1;
|
||||
}
|
||||
|
||||
Interval.index_end = function(a, sorted)
|
||||
{
|
||||
if (a.length == 0) return;
|
||||
if (typeof sorted == 'undefined') sorted = true;
|
||||
if (!sorted) Interval.sort(a);
|
||||
a[0].push(0);
|
||||
var k = 0, k_en = a[0][1];
|
||||
for (var i = 1; i < a.length; ++i) {
|
||||
if (k_en <= a[i][0]) {
|
||||
for (++k; k < i; ++k)
|
||||
if (a[k][1] > a[i][0])
|
||||
break;
|
||||
k_en = a[k][1];
|
||||
}
|
||||
a[i].push(k);
|
||||
}
|
||||
}
|
||||
|
||||
Interval.find_intv = function(a, x)
|
||||
{
|
||||
var left = -1, right = a.length;
|
||||
if (typeof a[0] == 'number') {
|
||||
while (right - left > 1) {
|
||||
var mid = left + ((right - left) >> 1);
|
||||
if (a[mid] > x) right = mid;
|
||||
else if (a[mid] < x) left = mid;
|
||||
else return mid;
|
||||
}
|
||||
} else {
|
||||
while (right - left > 1) {
|
||||
var mid = left + ((right - left) >> 1);
|
||||
if (a[mid][0] > x) right = mid;
|
||||
else if (a[mid][0] < x) left = mid;
|
||||
else return mid;
|
||||
}
|
||||
}
|
||||
return left;
|
||||
}
|
||||
|
||||
Interval.find_ovlp = function(a, st, en)
|
||||
{
|
||||
if (a.length == 0 || st >= en) return [];
|
||||
var l = Interval.find_intv(a, st);
|
||||
var k = l < 0? 0 : a[l][a[l].length - 1];
|
||||
var b = [];
|
||||
for (var i = k; i < a.length; ++i) {
|
||||
if (a[i][0] >= en) break;
|
||||
else if (st < a[i][1])
|
||||
b.push(a[i]);
|
||||
}
|
||||
return b;
|
||||
}
|
||||
|
||||
/*****************
|
||||
* Main function *
|
||||
*****************/
|
||||
|
||||
var c, l_fuzzy = 0, print_ovlp = false, print_err_only = false, first_only = false;
|
||||
while ((c = getopt(arguments, "l:ep")) != null) {
|
||||
if (c == 'l') l_fuzzy = parseInt(getopt.arg);
|
||||
else if (c == 'e') print_err_only = print_ovlp = true;
|
||||
else if (c == 'p') print_ovlp = true;
|
||||
}
|
||||
|
||||
if (arguments.length - getopt.ind < 2) {
|
||||
print("Usage: k8 intron-eval.js [options] <gene.gtf> <aln.sam>");
|
||||
exit(1);
|
||||
}
|
||||
|
||||
var file, buf = new Bytes();
|
||||
|
||||
var tr = {};
|
||||
file = new File(arguments[getopt.ind]);
|
||||
while (file.readline(buf) >= 0) {
|
||||
var m, t = buf.toString().split("\t");
|
||||
if (t[0].charAt(0) == '#') continue;
|
||||
if (t[2] != 'exon') continue;
|
||||
var st = parseInt(t[3]) - 1;
|
||||
var en = parseInt(t[4]);
|
||||
if ((m = /transcript_id "(\S+)"/.exec(t[8])) == null) continue;
|
||||
var tid = m[1];
|
||||
if (tr[tid] == null) tr[tid] = [t[0], t[6], 0, 0, []];
|
||||
tr[tid][4].push([st, en]);
|
||||
}
|
||||
file.close();
|
||||
|
||||
var anno = {};
|
||||
for (var tid in tr) {
|
||||
var t = tr[tid];
|
||||
Interval.sort(t[4]);
|
||||
t[2] = t[4][0][0];
|
||||
t[3] = t[4][t[4].length - 1][1];
|
||||
if (anno[t[0]] == null) anno[t[0]] = [];
|
||||
var s = t[4];
|
||||
for (var i = 0; i < s.length - 1; ++i) {
|
||||
if (s[i][1] >= s[i+1][0]) throw Error("ERROR: wrong annotation!");
|
||||
anno[t[0]].push([s[i][1], s[i+1][0]]);
|
||||
}
|
||||
}
|
||||
tr = null;
|
||||
|
||||
for (var chr in anno) {
|
||||
var e = anno[chr];
|
||||
if (e.length == 0) continue;
|
||||
Interval.sort(e);
|
||||
var k = 0;
|
||||
for (var i = 1; i < e.length; ++i) // dedup
|
||||
if (e[i][0] != e[k][0] || e[i][1] != e[k][1])
|
||||
e[++k] = e[i].slice(0);
|
||||
e.length = k + 1;
|
||||
Interval.index_end(e);
|
||||
}
|
||||
|
||||
var n_pri = 0, n_unmapped = 0, n_mapped = 0;
|
||||
var n_sgl = 0, n_splice = 0, n_splice_hit = 0, n_splice_novel = 0;
|
||||
|
||||
file = new File(arguments[getopt.ind+1]);
|
||||
var last_qname = null;
|
||||
var re_cigar = /(\d+)([MIDNSHX=])/g;
|
||||
while (file.readline(buf) >= 0) {
|
||||
var m, t = buf.toString().split("\t");
|
||||
|
||||
if (t[0].charAt(0) == '@') continue;
|
||||
var flag = parseInt(t[1]);
|
||||
if (flag&0x100) continue;
|
||||
if (first_only && last_qname == t[0]) continue;
|
||||
if (t[2] == '*') {
|
||||
++n_unmapped;
|
||||
continue;
|
||||
} else {
|
||||
++n_pri;
|
||||
if (last_qname != t[0]) ++n_mapped;
|
||||
}
|
||||
|
||||
var pos = parseInt(t[3]) - 1, intron = [];
|
||||
while ((m = re_cigar.exec(t[5])) != null) {
|
||||
var len = parseInt(m[1]), op = m[2];
|
||||
if (op == 'N') {
|
||||
intron.push([pos, pos + len]);
|
||||
pos += len;
|
||||
} else if (op == 'M' || op == 'X' || op == '=' || op == 'D') pos += len;
|
||||
}
|
||||
if (intron.length == 0) {
|
||||
++n_sgl;
|
||||
continue;
|
||||
}
|
||||
n_splice += intron.length;
|
||||
|
||||
var chr = anno[t[2]];
|
||||
if (chr != null) {
|
||||
for (var i = 0; i < intron.length; ++i) {
|
||||
var o = Interval.find_ovlp(chr, intron[i][0], intron[i][1]);
|
||||
if (o.length > 0) {
|
||||
var hit = false;
|
||||
for (var j = 0; j < o.length; ++j) {
|
||||
var st_diff = intron[i][0] - o[j][0];
|
||||
var en_diff = intron[i][1] - o[j][1];
|
||||
if (st_diff < 0) st_diff = -st_diff;
|
||||
if (en_diff < 0) en_diff = -en_diff;
|
||||
if (st_diff <= l_fuzzy && en_diff <= l_fuzzy)
|
||||
++n_splice_hit, hit = true;
|
||||
if (hit) break;
|
||||
}
|
||||
if (print_ovlp) {
|
||||
var type = hit? 'C' : 'P';
|
||||
if (hit && print_err_only) continue;
|
||||
var x = '[';
|
||||
for (var j = 0; j < o.length; ++j) {
|
||||
if (j) x += ', ';
|
||||
x += '(' + o[j][0] + "," + o[j][1] + ')';
|
||||
}
|
||||
x += ']';
|
||||
print(type, t[0], i+1, t[2], intron[i][0], intron[i][1], x);
|
||||
}
|
||||
} else {
|
||||
++n_splice_novel;
|
||||
if (print_ovlp)
|
||||
print('N', t[0], i+1, t[2], intron[i][0], intron[i][1]);
|
||||
}
|
||||
}
|
||||
} else {
|
||||
n_splice_novel += intron.length;
|
||||
}
|
||||
last_qname = t[0];
|
||||
}
|
||||
file.close();
|
||||
|
||||
buf.destroy();
|
||||
|
||||
if (!print_ovlp) {
|
||||
print("# unmapped reads: " + n_unmapped);
|
||||
print("# mapped reads: " + n_mapped);
|
||||
print("# primary alignments: " + n_pri);
|
||||
print("# singletons: " + n_sgl);
|
||||
print("# predicted introns: " + n_splice);
|
||||
print("# non-overlapping introns: " + n_splice_novel);
|
||||
print("# correct introns: " + n_splice_hit + " (" + (n_splice_hit / n_splice * 100).toFixed(2) + "%)");
|
||||
}
|
||||
+1
-1
@@ -94,7 +94,7 @@ while (file.readline(buf) >= 0) {
|
||||
ori_qlen = parseInt(t[1]);
|
||||
} else { // SAM
|
||||
var flag = parseInt(t[1]);
|
||||
if (flag & 4) continue;
|
||||
if ((flag & 4) || t[2] == '*' || t[5] == '*') continue;
|
||||
if (flag & 0x100) {
|
||||
++n_2nd;
|
||||
continue;
|
||||
|
||||
+171
@@ -0,0 +1,171 @@
|
||||
var getopt = function(args, ostr) {
|
||||
var oli; // option letter list index
|
||||
if (typeof(getopt.place) == 'undefined')
|
||||
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
|
||||
if (getopt.place == -1) { // update scanning pointer
|
||||
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
|
||||
getopt.place = -1;
|
||||
return null;
|
||||
}
|
||||
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
|
||||
++getopt.ind;
|
||||
getopt.place = -1;
|
||||
return null;
|
||||
}
|
||||
}
|
||||
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
|
||||
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
|
||||
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
|
||||
if (getopt.place < 0) ++getopt.ind;
|
||||
return '?';
|
||||
}
|
||||
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
|
||||
getopt.arg = null;
|
||||
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
|
||||
} else { // need an argument
|
||||
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
|
||||
getopt.arg = args[getopt.ind].substr(getopt.place);
|
||||
else if (args.length <= ++getopt.ind) { // no arg
|
||||
getopt.place = -1;
|
||||
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
|
||||
return '?';
|
||||
} else getopt.arg = args[getopt.ind]; // white space
|
||||
getopt.place = -1;
|
||||
++getopt.ind;
|
||||
}
|
||||
return optopt;
|
||||
}
|
||||
|
||||
var c, maf_out = false, line_len = 80;
|
||||
while ((c = getopt(arguments, "ml:")) != null) {
|
||||
if (c == 'm') maf_out = true;
|
||||
else if (c == 'l') line_len = parseInt(getopt.arg); // TODO: not implemented yet
|
||||
}
|
||||
if (line_len == 0) line_len = 0x7fffffff;
|
||||
|
||||
if (getopt.ind == arguments.length) {
|
||||
print("Usage: k8 paf2aln.js [options] <with-cs.paf>");
|
||||
print("Options:");
|
||||
print(" -m MAF output (BLAST-like output by default)");
|
||||
print(" -l INT line length in BLAST-like output [80]");
|
||||
print("");
|
||||
print("Note: this script only works when minimap2 is run with option '-S'");
|
||||
exit(1);
|
||||
}
|
||||
|
||||
function padding_str(x, len, right)
|
||||
{
|
||||
var s = x.toString();
|
||||
if (s.length < len) {
|
||||
if (right) s += Array(len - s.length + 1).join(" ");
|
||||
else s = Array(len - s.length + 1).join(" ") + s;
|
||||
}
|
||||
return s;
|
||||
}
|
||||
|
||||
function update_aln(s_ref, s_qry, s_mid, type, seq, slen)
|
||||
{
|
||||
var l = type == '*'? 1 : seq.length;
|
||||
if (type == '=') {
|
||||
s_ref.set(seq);
|
||||
s_qry.set(seq);
|
||||
s_mid.set(Array(l+1).join("|"));
|
||||
slen[0] += l, slen[1] += l;
|
||||
} else if (type == '*') {
|
||||
s_ref.set(seq.charAt(0));
|
||||
s_qry.set(seq.charAt(1));
|
||||
s_mid.set(' ');
|
||||
slen[0] += 1, slen[1] += 1;
|
||||
} else if (type == '+') {
|
||||
s_ref.set(Array(l+1).join("-"));
|
||||
s_qry.set(seq);
|
||||
s_mid.set(Array(l+1).join(" "));
|
||||
slen[1] += l;
|
||||
} else if (type == '-') {
|
||||
s_ref.set(seq);
|
||||
s_qry.set(Array(l+1).join("-"));
|
||||
s_mid.set(Array(l+1).join(" "));
|
||||
slen[0] += l;
|
||||
}
|
||||
}
|
||||
|
||||
function print_aln(rs, qs, strand, slen, elen, s_ref, s_qry, s_mid)
|
||||
{
|
||||
print(["Ref+:", padding_str(rs + slen[0] + 1, 10, false), s_ref.toString(), padding_str(rs + elen[0], 10, true)].join(" "));
|
||||
print(" " + s_mid.toString());
|
||||
var st, en;
|
||||
if (strand == '+') st = qs + slen[1] + 1, en = qs + elen[1];
|
||||
else st = qs - slen[1], en = qs - elen[1] + 1;
|
||||
print(["Qry" + strand + ":", padding_str(st, 10, false), s_qry.toString(), padding_str(en , 10, true)].join(" "));
|
||||
}
|
||||
|
||||
var s_ref = new Bytes(), s_qry = new Bytes(), s_mid = new Bytes();
|
||||
var re = /([=\-\+\*])([A-Za-z]+)/g;
|
||||
|
||||
var buf = new Bytes();
|
||||
var file = new File(arguments[getopt.ind]);
|
||||
if (maf_out) print("##maf version=1\n");
|
||||
while (file.readline(buf) >= 0) {
|
||||
var m, line = buf.toString();
|
||||
var t = line.split("\t", 12);
|
||||
if ((m = /\tcs:Z:(\S+)/.exec(line)) == null) continue;
|
||||
var cs = m[1];
|
||||
s_ref.length = s_qry.length = s_mid.length = 0;
|
||||
var slen = [0, 0], elen = [0, 0];
|
||||
if (maf_out) {
|
||||
while ((m = re.exec(cs)) != null)
|
||||
update_aln(s_ref, s_qry, s_mid, m[1], m[2], elen);
|
||||
if (maf_out) {
|
||||
var score = (m = /\tAS:i:(\d+)/.exec(line)) != null? parseInt(m[1]) : 0;
|
||||
var len = t[0].length > t[5].length? t[0].length : t[5].length;
|
||||
print("a " + score);
|
||||
print(["s", padding_str(t[5], len, true), padding_str(t[7], 10, false), padding_str(parseInt(t[8]) - parseInt(t[7]), 10, false),
|
||||
"+", padding_str(t[6], 10, false), s_ref.toString()].join(" "));
|
||||
var qs, qe, ql = parseInt(t[1]);
|
||||
if (t[4] == '+') {
|
||||
qs = parseInt(t[2]);
|
||||
qe = parseInt(t[3]);
|
||||
} else {
|
||||
qs = ql - parseInt(t[3]);
|
||||
qe = ql - parseInt(t[2]);
|
||||
}
|
||||
print(["s", padding_str(t[0], len, true), padding_str(qs, 10, false), padding_str(qe - qs, 10, false),
|
||||
t[4], padding_str(ql, 10, false), s_qry.toString()].join(" "));
|
||||
print("");
|
||||
}
|
||||
} else {
|
||||
line = line.replace(/\tc[sg]:Z:\S+/g, "");
|
||||
print('>' + line);
|
||||
var rs = parseInt(t[7]), qs = t[4] == '+'? parseInt(t[2]) : parseInt(t[3]);
|
||||
var n_blocks = 0;
|
||||
while ((m = re.exec(cs)) != null) {
|
||||
var start = 0, rest = m[1] == '*'? 1 : m[2].length;
|
||||
while (rest > 0) {
|
||||
var l_proc;
|
||||
if (s_ref.length + rest >= line_len) {
|
||||
l_proc = line_len - s_ref.length;
|
||||
update_aln(s_ref, s_qry, s_mid, m[1], m[1] == '*'? m[2] : m[2].substr(start, l_proc), elen);
|
||||
if (n_blocks > 0) print("");
|
||||
print_aln(rs, qs, t[4], slen, elen, s_ref, s_qry, s_mid);
|
||||
++n_blocks;
|
||||
s_ref.length = s_qry.length = s_mid.length = 0;
|
||||
slen[0] = elen[0], slen[1] = elen[1];
|
||||
} else {
|
||||
l_proc = rest;
|
||||
update_aln(s_ref, s_qry, s_mid, m[1], m[1] == '*'? m[2] : m[2].substr(start, l_proc), elen);
|
||||
}
|
||||
rest -= l_proc, start += l_proc;
|
||||
}
|
||||
}
|
||||
if (s_ref.length > 0) {
|
||||
if (n_blocks > 0) print("");
|
||||
print_aln(rs, qs, t[4], slen, elen, s_ref, s_qry, s_mid);
|
||||
++n_blocks;
|
||||
}
|
||||
print("//");
|
||||
}
|
||||
}
|
||||
file.close();
|
||||
buf.destroy();
|
||||
|
||||
s_ref.destroy(); s_qry.destroy(); s_mid.destroy();
|
||||
+111
@@ -0,0 +1,111 @@
|
||||
var getopt = function(args, ostr) {
|
||||
var oli; // option letter list index
|
||||
if (typeof(getopt.place) == 'undefined')
|
||||
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
|
||||
if (getopt.place == -1) { // update scanning pointer
|
||||
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
|
||||
getopt.place = -1;
|
||||
return null;
|
||||
}
|
||||
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
|
||||
++getopt.ind;
|
||||
getopt.place = -1;
|
||||
return null;
|
||||
}
|
||||
}
|
||||
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
|
||||
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
|
||||
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
|
||||
if (getopt.place < 0) ++getopt.ind;
|
||||
return '?';
|
||||
}
|
||||
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
|
||||
getopt.arg = null;
|
||||
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
|
||||
} else { // need an argument
|
||||
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
|
||||
getopt.arg = args[getopt.ind].substr(getopt.place);
|
||||
else if (args.length <= ++getopt.ind) { // no arg
|
||||
getopt.place = -1;
|
||||
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
|
||||
return '?';
|
||||
} else getopt.arg = args[getopt.ind]; // white space
|
||||
getopt.place = -1;
|
||||
++getopt.ind;
|
||||
}
|
||||
return optopt;
|
||||
}
|
||||
|
||||
var c, pri_only = false;
|
||||
while ((c = getopt(arguments, "p")) != null)
|
||||
if (c == 'p') pri_only = true;
|
||||
|
||||
var file = arguments.length == getopt.ind? new File() : new File(arguments[getopt.ind]);
|
||||
var buf = new Bytes();
|
||||
var re = /(\d+)([MIDSHNX=])/g;
|
||||
|
||||
var len = {}, lineno = 0;
|
||||
while (file.readline(buf) >= 0) {
|
||||
var m, n_cigar = 0, line = buf.toString();
|
||||
++lineno;
|
||||
if (line.charAt(0) == '@') {
|
||||
if (/^@SQ/.test(line)) {
|
||||
var name = (m = /\tSN:(\S+)/.exec(line)) != null? m[1] : null;
|
||||
var l = (m = /\tLN:(\d+)/.exec(line)) != null? parseInt(m[1]) : null;
|
||||
if (name != null && l != null) len[name] = l;
|
||||
}
|
||||
continue;
|
||||
}
|
||||
var t = line.split("\t");
|
||||
var flag = parseInt(t[1]);
|
||||
if (t[9] != '*' && t[10] != '*' && t[9].length != t[10].length) throw Error("ERROR at line " + lineno + ": inconsistent SEQ and QUAL lengths - " + t[9].length + " != " + t[10].length);
|
||||
if (t[2] == '*' || (flag&4)) continue;
|
||||
if (pri_only && (flag&0x100)) continue;
|
||||
var tlen = len[t[2]];
|
||||
if (tlen == null) throw Error("ERROR at line " + lineno + ": can't find the length of contig " + t[2]);
|
||||
var nn = (m = /\tnn:i:(\d+)/.exec(line)) != null? parseInt(m[1]) : 0;
|
||||
var NM = (m = /\tNM:i:(\d+)/.exec(line)) != null? parseInt(m[1]) : null;
|
||||
var have_NM = NM == null? false : true;
|
||||
NM += nn;
|
||||
var clip = [0, 0], I = [0, 0], D = [0, 0], M = 0, N = 0, ql = 0, tl = 0, mm = 0, ext_cigar = false;
|
||||
while ((m = re.exec(t[5])) != null) {
|
||||
var l = parseInt(m[1]);
|
||||
if (m[2] == 'M') M += l, ql += l, tl += l, ext_cigar = false;
|
||||
else if (m[2] == 'I') ++I[0], I[1] += l, ql += l;
|
||||
else if (m[2] == 'D') ++D[0], D[1] += l, tl += l;
|
||||
else if (m[2] == 'N') N += l, tl += l;
|
||||
else if (m[2] == 'S') clip[M == 0? 0 : 1] = l, ql += l;
|
||||
else if (m[2] == 'H') clip[M == 0? 0 : 1] = l;
|
||||
else if (m[2] == '=') M += l, ql += l, tl += l, ext_cigar = true;
|
||||
else if (m[2] == 'X') M += l, ql += l, tl += l, mm += l, ext_cigar = true;
|
||||
++n_cigar;
|
||||
}
|
||||
if (n_cigar > 65535)
|
||||
warn("WARNING at line " + lineno + ": " + n_cigar + " CIGAR operations");
|
||||
if (tl + parseInt(t[3]) - 1 > tlen) {
|
||||
warn("WARNING at line " + lineno + ": alignment end position larger than ref length; skipped");
|
||||
continue;
|
||||
}
|
||||
if (t[9] != '*' && t[9].length != ql) {
|
||||
warn("WARNING at line " + lineno + ": SEQ length inconsistent with CIGAR (" + t[9].length + " != " + ql + "); skipped");
|
||||
continue;
|
||||
}
|
||||
if (!have_NM || ext_cigar) NM = I[1] + D[1] + mm;
|
||||
if (NM < I[1] + D[1] + mm) {
|
||||
warn("WARNING at line " + lineno + ": NM is less than the total number of gaps (" + NM + " < " + (I[1]+D[1]+mm) + ")");
|
||||
NM = I[1] + D[1] + mm;
|
||||
}
|
||||
var extra = ["mm:i:"+(NM-I[1]-D[1]), "io:i:"+I[0], "in:i:"+I[1], "do:i:"+D[0], "dn:i:"+D[1]];
|
||||
var match = M - (NM - I[1] - D[1]);
|
||||
var blen = M + I[1] + D[1];
|
||||
var qlen = M + I[1] + clip[0] + clip[1];
|
||||
var qs, qe;
|
||||
if (flag&16) qs = clip[1], qe = qlen - clip[0];
|
||||
else qs = clip[0], qe = qlen - clip[1];
|
||||
var ts = parseInt(t[3]) - 1, te = ts + M + D[1] + N;
|
||||
var a = [t[0], qlen, qs, qe, flag&16? '-' : '+', t[2], tlen, ts, te, match, blen, t[4]];
|
||||
print(a.join("\t"), extra.join("\t"));
|
||||
}
|
||||
|
||||
buf.destroy();
|
||||
file.close();
|
||||
@@ -36,11 +36,12 @@ var getopt = function(args, ostr) {
|
||||
return optopt;
|
||||
}
|
||||
|
||||
var c, max_mapq = 60, mode = 0, err_out_q = 256, print_err = false, ovlp_ratio = 0.333;
|
||||
while ((c = getopt(arguments, "Q:r:m:")) != null) {
|
||||
var c, max_mapq = 60, mode = 0, err_out_q = 256, print_err = false, ovlp_ratio = 0.1, cap_short_mapq = false;
|
||||
while ((c = getopt(arguments, "Q:r:m:c")) != null) {
|
||||
if (c == 'Q') err_out_q = parseInt(getopt.arg), print_err = true;
|
||||
else if (c == 'r') ovlp_ratio = parseFloat(getopt.arg);
|
||||
else if (c == 'm') mode = parseInt(getopt.arg);
|
||||
else if (c == 'c') cap_short_mapq = true;
|
||||
}
|
||||
|
||||
var file = arguments.length == getopt.ind? new File() : new File(arguments[getopt.ind]);
|
||||
@@ -68,20 +69,27 @@ function is_correct(s, b)
|
||||
|
||||
function count_err(qname, a, tot, err, mode)
|
||||
{
|
||||
var s = qname.split("!");
|
||||
if (a.length == 0) return;
|
||||
if (s.length < 5 || (s[4] != '+' && s[4] != '-'))
|
||||
throw Error("Failed to parse pbsim2fa read names '" + qname + "'");
|
||||
s[2] = parseInt(s[2]);
|
||||
s[3] = parseInt(s[3]);
|
||||
s.shift(); // skip pbsim orginal read name
|
||||
|
||||
var m, s;
|
||||
if ((m = /^(\S+)!(\S+)!(\d+)!(\d+)!([\+\-])$/.exec(qname)) != null) { // pbsim single-end reads
|
||||
s = [m[1], m[2], parseInt(m[3]), parseInt(m[4]), m[5]];
|
||||
} else if ((m = /^(\S+)!(\S+)!(\d+)_(\d+)!(\d+)_(\d+)!([\+\-])([\+\-])\/([12])$/.exec(qname)) != null) { // mason2 paired-end reads
|
||||
if (m[9] == '1') {
|
||||
s = [m[1], m[2], parseInt(m[3]), parseInt(m[5]), m[7]];
|
||||
} else {
|
||||
s = [m[1], m[2], parseInt(m[4]), parseInt(m[6]), m[8]];
|
||||
}
|
||||
} else throw Error("Failed to parse simulated read names '" + qname + "'");
|
||||
s.shift(); // skip the orginal read name
|
||||
|
||||
if (mode == 0 || mode == 1) { // longest only or first only
|
||||
var max_i = 0;
|
||||
if (mode == 0) {
|
||||
if (mode == 0) { // longest only
|
||||
var max = 0;
|
||||
for (var i = 0; i < a.length; ++i)
|
||||
if (a[i][2] - a[i][1] > max)
|
||||
max = a[i][2] - a[i][1], max_i = i;
|
||||
if (a[i][5] > max)
|
||||
max = a[i][5], max_i = i;
|
||||
}
|
||||
var mapq = a[max_i][4];
|
||||
++tot[mapq];
|
||||
@@ -92,6 +100,14 @@ function count_err(qname, a, tot, err, mode)
|
||||
}
|
||||
} else if (mode == 2) { // all primary mode
|
||||
var max_err_mapq = -1, max_mapq = 0, max_err_i = -1;
|
||||
if (cap_short_mapq) {
|
||||
var max = 0, max_q = 0;
|
||||
for (var i = 0; i < a.length; ++i)
|
||||
if (a[i][5] > max)
|
||||
max = a[i][5], max_q = a[i][4];
|
||||
for (var i = 0; i < a.length; ++i)
|
||||
a[i][4] = max_q < a[i][4]? max_q : a[i][4];
|
||||
}
|
||||
for (var i = 0; i < a.length; ++i) {
|
||||
max_mapq = max_mapq > a[i][4]? max_mapq : a[i][4];
|
||||
if (!is_correct(s, a[i]))
|
||||
@@ -106,22 +122,53 @@ function count_err(qname, a, tot, err, mode)
|
||||
}
|
||||
}
|
||||
|
||||
var lineno = 0, last = null, a = [];
|
||||
var lineno = 0, last = null, a = [], n_unmapped = null;
|
||||
var re_cigar = /(\d+)([MIDSHN])/g;
|
||||
while (file.readline(buf) >= 0) {
|
||||
var line = buf.toString();
|
||||
var m, line = buf.toString();
|
||||
++lineno;
|
||||
if (line[0] != '@') {
|
||||
var t = line.split("\t");
|
||||
if (last != t[0]) {
|
||||
if (last != null) count_err(last, a, tot, err, mode);
|
||||
a = [], last = t[0];
|
||||
}
|
||||
if (t[4] == '+' || t[4] == '-') { // PAF
|
||||
if (last != t[0]) {
|
||||
if (last != null) count_err(last, a, tot, err, mode);
|
||||
a = [], last = t[0];
|
||||
}
|
||||
if (/\ts1:i:\d+/.test(line) && !/\ts2:i:\d+/.test(line)) // secondary alignment in minimap2 PAF
|
||||
continue;
|
||||
var mapq = parseInt(t[11]);
|
||||
if (mapq > max_mapq) mapq = max_mapq;
|
||||
a.push([t[5], parseInt(t[7]), parseInt(t[8]), t[4], mapq]);
|
||||
a.push([t[5], parseInt(t[7]), parseInt(t[8]), t[4], mapq, parseInt(t[9])]);
|
||||
} else { // SAM
|
||||
var flag = parseInt(t[1]);
|
||||
var read_no = flag>>6&0x3;
|
||||
var qname = read_no == 1 || read_no == 2? t[0] + '/' + read_no : t[0];
|
||||
if (last != qname) {
|
||||
if (last != null) count_err(last, a, tot, err, mode);
|
||||
a = [], last = qname;
|
||||
}
|
||||
if (flag&0x100) continue; // secondary alignment
|
||||
if ((flag&0x4) || t[2] == '*') { // unmapped
|
||||
if (n_unmapped == null) n_unmapped = 0;
|
||||
++n_unmapped;
|
||||
continue;
|
||||
}
|
||||
var mapq = parseInt(t[4]);
|
||||
if (mapq > max_mapq) mapq = max_mapq;
|
||||
var pos = parseInt(t[3]) - 1, pos_end = pos;
|
||||
var n_gap = 0, mlen = 0;
|
||||
while ((m = re_cigar.exec(t[5])) != null) {
|
||||
var len = parseInt(m[1]);
|
||||
if (m[2] == 'M') pos_end += len, mlen += len;
|
||||
else if (m[2] == 'I') n_gap += len;
|
||||
else if (m[2] == 'D') n_gap += len, pos_end += len;
|
||||
}
|
||||
var score = pos_end - pos;
|
||||
if ((m = /\tNM:i:(\d+)/.exec(line)) != null) {
|
||||
var NM = parseInt(m[1]);
|
||||
if (NM >= n_gap) score = mlen - (NM - n_gap);
|
||||
}
|
||||
a.push([t[2], pos, pos_end, (flag&16)? '-' : '+', mapq, score]);
|
||||
}
|
||||
}
|
||||
}
|
||||
@@ -141,3 +188,4 @@ for (var q = max_mapq; q >= 0; --q) {
|
||||
sum_tot2 += tot[q], sum_err2 += err[q];
|
||||
}
|
||||
print('Q', q_out, sum_tot, sum_err, (sum_err2/sum_tot2).toFixed(9));
|
||||
if (n_unmapped != null) print('U', n_unmapped);
|
||||
@@ -0,0 +1,105 @@
|
||||
Bytes.prototype.reverse = function()
|
||||
{
|
||||
for (var i = 0; i < this.length>>1; ++i) {
|
||||
var tmp = this[i];
|
||||
this[i] = this[this.length - i - 1];
|
||||
this[this.length - i - 1] = tmp;
|
||||
}
|
||||
}
|
||||
|
||||
// reverse complement a DNA string
|
||||
Bytes.prototype.revcomp = function()
|
||||
{
|
||||
if (Bytes.rctab == null) {
|
||||
var s1 = 'WSATUGCYRKMBDHVNwsatugcyrkmbdhvn';
|
||||
var s2 = 'WSTAACGRYMKVHDBNwstaacgrymkvhdbn';
|
||||
Bytes.rctab = [];
|
||||
for (var i = 0; i < 256; ++i) Bytes.rctab[i] = 0;
|
||||
for (var i = 0; i < s1.length; ++i)
|
||||
Bytes.rctab[s1.charCodeAt(i)] = s2.charCodeAt(i);
|
||||
}
|
||||
for (var i = 0; i < this.length>>1; ++i) {
|
||||
var tmp = this[this.length - i - 1];
|
||||
this[this.length - i - 1] = Bytes.rctab[this[i]];
|
||||
this[i] = Bytes.rctab[tmp];
|
||||
}
|
||||
if (this.length&1)
|
||||
this[this.length>>1] = Bytes.rctab[this[this.length>>1]];
|
||||
}
|
||||
|
||||
if (arguments.length == 0) {
|
||||
print("Usage: k8 sim-mason2.js <mason.sam>");
|
||||
exit(1);
|
||||
}
|
||||
|
||||
function print_se(a)
|
||||
{
|
||||
print('@' + a.slice(0, 5).join("!") + " " + a[8]);
|
||||
print(a[5]);
|
||||
print("+");
|
||||
print(a[6]);
|
||||
}
|
||||
|
||||
var buf = new Bytes(), buf2 = new Bytes();
|
||||
var file = new File(arguments[0]);
|
||||
var re = /(\d+)([MIDSHN])/g;
|
||||
var last = null;
|
||||
while (file.readline(buf) >= 0) {
|
||||
var t = buf.toString().split("\t");
|
||||
if (t[0].charAt(0) == '@') continue;
|
||||
var m, l_ref = 0;
|
||||
while ((m = re.exec(t[5])) != null)
|
||||
if (m[2] == 'D' || m[2] == 'M' || m[2] == 'N')
|
||||
l_ref += parseInt(m[1]);
|
||||
var flag = parseInt(t[1]);
|
||||
var rev = !!(flag&16);
|
||||
var seq, qual;
|
||||
if (rev) {
|
||||
buf2.length = 0;
|
||||
buf2.set(t[9], 0);
|
||||
buf2.revcomp();
|
||||
seq = buf2.toString();
|
||||
buf2.set(t[10], 0);
|
||||
buf2.reverse();
|
||||
qual = buf2.toString();
|
||||
} else seq = t[9], qual = t[10];
|
||||
var qname = t[0];
|
||||
qname = qname.replace(/^simulated./, "");
|
||||
var chr = t[2];
|
||||
var pos = parseInt(t[3]) - 1;
|
||||
var strand = (flag&16)? '-' : '+';
|
||||
var read_no = flag&0xc0;
|
||||
if (read_no == 0x40) read_no = 1;
|
||||
else if (read_no == 0x80) read_no = 2;
|
||||
else read_no = 0;
|
||||
var err = 0, snp = 0, indel = 0;
|
||||
for (var i = 11; i < t.length; ++i) {
|
||||
if ((m = /^XE:i:(\d+)/.exec(t[i])) != null) err = m[1];
|
||||
else if ((m = /^XS:i:(\d+)/.exec(t[i])) != null) snp = m[1];
|
||||
else if ((m = /^XI:i:(\d+)/.exec(t[i])) != null) indel = m[1];
|
||||
}
|
||||
var comment = [err, snp, indel].join(":");
|
||||
if (last == null) {
|
||||
last = [qname, chr, pos, pos + l_ref, strand, seq, qual, read_no, comment];
|
||||
} else if (last[0] != qname) {
|
||||
print_se(last);
|
||||
last = [qname, chr, pos, pos + l_ref, strand, seq, qual, read_no, comment];
|
||||
} else {
|
||||
if (read_no == 2) { // last[] is the first read
|
||||
if (last[7] != 1) throw Error("ERROR: can't find read1");
|
||||
var name = [qname, chr, last[2] + "_" + pos, last[3] + "_" + (pos + l_ref), last[4] + strand].join("!");
|
||||
print('@' + name + '/1' + ' ' + last[8]); print(last[5]); print("+"); print(last[6]);
|
||||
print('@' + name + '/2' + ' ' + comment); print(seq); print("+"); print(qual);
|
||||
} else {
|
||||
if (last[7] != 2) throw Error("ERROR: can't find read2");
|
||||
var name = [qname, chr, pos + "_" + last[2], (pos + l_ref) + "_" + last[3], strand + last[4]].join("!");
|
||||
print('@' + name + '/1' + ' ' + comment); print(seq); print("+"); print(qual);
|
||||
print('@' + name + '/2' + ' ' + last[8]); print(last[5]); print("+"); print(last[6]);
|
||||
}
|
||||
last = null;
|
||||
}
|
||||
}
|
||||
if (last != null) print_se(last);
|
||||
file.close();
|
||||
buf.destroy();
|
||||
buf2.destroy();
|
||||
@@ -28,7 +28,7 @@ Bytes.prototype.revcomp = function()
|
||||
}
|
||||
|
||||
if (arguments.length < 2) {
|
||||
print("Usage: k8 pbsim2paf.js <chr.list> <pbsim1.maf> [[pbsim2.maf] ...]");
|
||||
print("Usage: k8 sim-pbsim.js <ref.fa.fai> <pbsim1.maf> [[pbsim2.maf] ...]");
|
||||
exit(1);
|
||||
}
|
||||
|
||||
@@ -40,9 +40,11 @@ void radix_sort_128x(mm128_t *beg, mm128_t *end);
|
||||
void radix_sort_64(uint64_t *beg, uint64_t *end);
|
||||
uint32_t ks_ksmall_uint32_t(size_t n, uint32_t arr[], size_t kk);
|
||||
|
||||
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r);
|
||||
void mm_write_sam_SQ(const mm_idx_t *idx);
|
||||
void mm_write_sam_hdr_no_SQ(const char *rg, const char *ver, int argc, char *argv[]);
|
||||
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int opt_flag);
|
||||
void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int n_regs, const mm_reg1_t *regs);
|
||||
int mm_chain_dp(int max_dist, int bw, int max_skip, int min_cnt, int min_sc, int64_t n, mm128_t *a, uint64_t **_u, void *km);
|
||||
int mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int min_cnt, int min_sc, int is_cdna, int64_t n, mm128_t *a, uint64_t **_u, void *km);
|
||||
mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a);
|
||||
|
||||
mm_reg1_t *mm_gen_regs(void *km, int qlen, int n_u, uint64_t *u, mm128_t *a);
|
||||
|
||||
@@ -176,7 +176,7 @@ uint64_t *sdust(void *km, const uint8_t *seq, int l_seq, int T, int W, int *n)
|
||||
#ifdef _SDUST_MAIN
|
||||
#include <zlib.h>
|
||||
#include <stdio.h>
|
||||
#include <unistd.h>
|
||||
#include "getopt.h"
|
||||
#include "kseq.h"
|
||||
KSEQ_INIT(gzFile, gzread)
|
||||
|
||||
|
||||
@@ -77,11 +77,10 @@ void mm_sketch(void *km, const char *str, int len, int w, int k, uint32_t rid, i
|
||||
{
|
||||
uint64_t shift1 = 2 * (k - 1), mask = (1ULL<<2*k) - 1, kmer[2] = {0,0};
|
||||
int i, j, l, buf_pos, min_pos, kmer_span = 0;
|
||||
mm128_t *buf, min = { UINT64_MAX, UINT64_MAX };
|
||||
mm128_t buf[256], min = { UINT64_MAX, UINT64_MAX };
|
||||
tiny_queue_t tq;
|
||||
|
||||
assert(len > 0 && w > 0 && k > 0 && k <= 28); // 56 bits for k-mer; could use long k-mers, but 28 enough in practice
|
||||
buf = (mm128_t*)alloca(w * 16);
|
||||
assert(len > 0 && (w > 0 && w < 256) && (k > 0 && k <= 28)); // 56 bits for k-mer; could use long k-mers, but 28 enough in practice
|
||||
memset(buf, 0xff, w * 16);
|
||||
memset(&tq, 0, sizeof(tiny_queue_t));
|
||||
kv_resize(mm128_t, km, *p, p->n + len/w);
|
||||
|
||||
@@ -0,0 +1,2 @@
|
||||
>q2
|
||||
GGACATCCCGATGGTGCAGTCCTACCTGTACGAAAGGAC
|
||||
@@ -0,0 +1,2 @@
|
||||
>t2
|
||||
GGACATCCCGATGGTGCAGgtGCTATTAAAGGTTCGTTTGTTCAACGATTAAagTCCTACCTGTACGAAAGGAC
|
||||
@@ -0,0 +1,21 @@
|
||||
.SUFFIXES: .gp .tex .eps .pdf .eps.gz
|
||||
|
||||
.eps.pdf:
|
||||
epstopdf --outfile $@ $<
|
||||
|
||||
.eps.gz.pdf:
|
||||
gzip -dc $< | epstopdf --filter > $@
|
||||
|
||||
.pdf.eps:
|
||||
pdftops -eps $< $@
|
||||
|
||||
all:minimap2.pdf
|
||||
|
||||
roc-color.eps:roc.gp
|
||||
gnuplot roc.gp
|
||||
|
||||
minimap2.pdf:minimap2.tex minimap2.bib roc-color.pdf
|
||||
pdflatex minimap2; bibtex minimap2; pdflatex minimap2; pdflatex minimap2;
|
||||
|
||||
clean:
|
||||
rm -fr *.toc *.aux *.bbl *.blg *.idx *.log *.out *~ minimap2.pdf
|
||||
+930
@@ -0,0 +1,930 @@
|
||||
\newcommand\classname{bioinfo}
|
||||
\newcommand\lastmodifieddate{2003/02/08}
|
||||
\newcommand\versionnumber{0.1}
|
||||
|
||||
% Are we printing crop marks?
|
||||
\newif\if@cropmarkson \@cropmarksontrue
|
||||
|
||||
\NeedsTeXFormat{LaTeX2e}[2001/06/01]
|
||||
\ProvidesClass{\classname}[\lastmodifieddate\space\versionnumber]
|
||||
|
||||
\setlength{\paperheight}{11truein}
|
||||
\setlength{\paperwidth}{8.5truein}
|
||||
|
||||
\newif\if@final
|
||||
|
||||
\DeclareOption{draft}{\PassOptionsToPackage{draft}{graphicx}}
|
||||
\DeclareOption{a4paper}{\PassOptionsToPackage{a4}{crop}}
|
||||
\DeclareOption{centre}{\PassOptionsToPackage{center}{crop}}
|
||||
\DeclareOption{crop}{\PassOptionsToPackage{cam}{crop}\global\@cropmarksontrue}
|
||||
\DeclareOption{nocrop}{\PassOptionsToPackage{off}{crop}\global\@cropmarksonfalse}
|
||||
\DeclareOption{info}{\PassOptionsToPackage{info}{crop}}
|
||||
\DeclareOption{noinfo}{\PassOptionsToPackage{noinfo}{crop}}
|
||||
\DeclareOption{final}{\global\@finaltrue}
|
||||
|
||||
\ExecuteOptions{a4paper,nocrop,centre,info}
|
||||
|
||||
\ProcessOptions
|
||||
|
||||
% Load all necessary packages
|
||||
\RequirePackage{inputenc,crop,graphicx,amsmath,array,color,amssymb,flushend,stfloats,amsthm,chngpage,times}
|
||||
%\RequirePackage[LY1]{fontenc}
|
||||
%\RequirePackage[LY1,mtbold]{mathtime}
|
||||
\def\authoraffliate{\fontfamily{phv}\selectfont}
|
||||
\def\helvetica{\fontfamily{phv}\selectfont}
|
||||
\def\helveticaitalic{\fontfamily{phv}\itshape\selectfont}
|
||||
\def\helveticabold{\fontfamily{phv}\bfseries\selectfont}
|
||||
\def\helveticabolditalic{\fontfamily{phv}\bfseries\itshape\selectfont}
|
||||
|
||||
% Not sure if needed.
|
||||
\newcommand\@ptsize{0}
|
||||
|
||||
% Set twoside printing
|
||||
\@twosidetrue
|
||||
|
||||
% Marginal notes are on the outside edge
|
||||
\@mparswitchfalse
|
||||
|
||||
\reversemarginpar
|
||||
|
||||
\renewcommand\normalsize{%
|
||||
\@setfontsize\normalsize{9}{11}%
|
||||
\abovedisplayskip 10\p@ \@plus2\p@ \@minus5\p@
|
||||
\abovedisplayshortskip \z@ \@plus3\p@
|
||||
\belowdisplayshortskip 6\p@ \@plus3\p@ \@minus3\p@
|
||||
\belowdisplayskip \abovedisplayskip
|
||||
\let\@listi\@listI}
|
||||
\normalsize
|
||||
\let\@bls\baselineskip
|
||||
|
||||
\newcommand\small{%
|
||||
\@setfontsize\small{9}{11}%
|
||||
\abovedisplayskip 11\p@ minus 3\p@
|
||||
\belowdisplayskip \abovedisplayskip
|
||||
\abovedisplayshortskip \z@ plus 2\p@
|
||||
\belowdisplayshortskip 4\p@ plus 2\p@ minus2\p@
|
||||
\def\@listi{\topsep 4.5\p@ plus 2\p@ minus 1\p@
|
||||
\itemsep \parsep
|
||||
\topsep 4\p@ plus 2\p@ minus 2\p@}}
|
||||
|
||||
\newcommand\footnotesize{%
|
||||
\@setfontsize\footnotesize{8}{10}%
|
||||
\abovedisplayskip 6\p@ minus 3\p@
|
||||
\belowdisplayskip\abovedisplayskip
|
||||
\abovedisplayshortskip \z@ plus 3\p@
|
||||
\belowdisplayshortskip 6\p@ plus 3\p@ minus 3\p@
|
||||
\def\@listi{\topsep 3\p@ plus 1\p@ minus 1\p@
|
||||
\parsep 2\p@ plus 1\p@ minus 1\p@\itemsep \parsep}}
|
||||
|
||||
\def\scriptsize{\@setfontsize\scriptsize{7pt}{9pt}}
|
||||
\def\tiny{\@setfontsize\tiny{5pt}{7pt}}
|
||||
\def\large{\@setfontsize\large{11.5pt}{12pt}}
|
||||
\def\Large{\@setfontsize\Large{14pt}{16}}
|
||||
\def\LARGE{\@setfontsize\LARGE{15pt}{17pt}}
|
||||
\def\huge{\@setfontsize\huge{22pt}{22pt}}
|
||||
\def\Huge{\@setfontsize\Huge{30pt}{30pt}}
|
||||
|
||||
\DeclareOldFontCommand{\rm}{\normalfont\rmfamily}{\mathrm}
|
||||
\DeclareOldFontCommand{\sf}{\normalfont\sffamily}{\mathsf}
|
||||
\DeclareOldFontCommand{\tt}{\normalfont\ttfamily}{\mathtt}
|
||||
\DeclareOldFontCommand{\bf}{\normalfont\bfseries}{\mathbf}
|
||||
\DeclareOldFontCommand{\it}{\normalfont\itshape}{\mathit}
|
||||
\DeclareOldFontCommand{\sl}{\normalfont\slshape}{\@nomath\sl}
|
||||
\DeclareOldFontCommand{\sc}{\normalfont\scshape}{\@nomath\sc}
|
||||
|
||||
% Line spacing
|
||||
\setlength\lineskip{1\p@}
|
||||
\setlength\normallineskip{1\p@}
|
||||
\renewcommand\baselinestretch{}
|
||||
|
||||
% Paragraph dimensions and inter-para spacing
|
||||
\setlength\parskip{0\p@}
|
||||
\setlength\parindent{3mm}
|
||||
|
||||
% Set inter-para skips
|
||||
\setlength\smallskipamount{3\p@ \@plus 1\p@ \@minus 1\p@}
|
||||
\setlength\medskipamount{6\p@ \@plus 2\p@}
|
||||
\setlength\bigskipamount{12\p@ \@plus 4\p@ \@minus 4\p@}
|
||||
|
||||
% Page break penalties
|
||||
\@lowpenalty 51
|
||||
\@medpenalty 151
|
||||
\@highpenalty 301
|
||||
|
||||
% Disallow widows and orphans
|
||||
\clubpenalty 10000
|
||||
\widowpenalty 10000
|
||||
|
||||
% Disable page breaks before equations, allow pagebreaks after
|
||||
% equations and discourage widow lines before equations.
|
||||
\displaywidowpenalty 100
|
||||
\predisplaypenalty 10000
|
||||
\postdisplaypenalty 2500
|
||||
|
||||
% Allow breaking the page in the middle of a paragraph
|
||||
\interlinepenalty 0
|
||||
|
||||
% Disallow breaking the page after a hyphenated line
|
||||
\brokenpenalty 10000
|
||||
|
||||
% Hyphenation; don't split words into less than three characters
|
||||
\lefthyphenmin=3
|
||||
\righthyphenmin=3
|
||||
|
||||
%
|
||||
% Set page layout dimensions
|
||||
%
|
||||
\setlength\headheight{16\p@} % height of running head
|
||||
\setlength\topmargin{2.9pc} % head margin
|
||||
\addtolength\topmargin{-1in} % subtract out the 1 inch driver margin
|
||||
|
||||
\setlength\topskip{10\p@} % height of first line of text
|
||||
\setlength\headsep{19\p@} % space below running head --
|
||||
|
||||
\setlength\footskip{34\p@} % space above footer line
|
||||
\setlength\maxdepth{.5\topskip} % pages can be short or deep by half a line?
|
||||
|
||||
\setlength\textwidth{42pc} % text measure excluding margins
|
||||
|
||||
\setlength\textheight{58\baselineskip} % 54 lines on a full page,
|
||||
\addtolength\textheight{\topskip} % including the first
|
||||
% line on the page
|
||||
|
||||
% Set the margins
|
||||
\setlength\marginparsep{3\p@}
|
||||
\setlength\marginparpush{3\p@}
|
||||
\setlength\marginparwidth{35\p@}
|
||||
|
||||
\setlength\oddsidemargin{4.5pc}
|
||||
\addtolength\oddsidemargin{-1in} % subtract out the 1 inch driver margin
|
||||
\setlength\@tempdima{\paperwidth}
|
||||
\addtolength\@tempdima{-\textwidth}
|
||||
\addtolength\@tempdima{-4.5pc}
|
||||
\setlength\evensidemargin{\@tempdima}
|
||||
\addtolength\evensidemargin{-1in}
|
||||
|
||||
\setlength\columnsep{1.5pc} % space between columns for double-column text
|
||||
\setlength\columnseprule{0\p@} % width of rule between two columns
|
||||
|
||||
% Footnotes
|
||||
\setlength\footnotesep{9\p@} % space between footnotes
|
||||
% space between text and footnote
|
||||
\setlength{\skip\footins}{12\p@ \@plus 6\p@ \@minus 1\p@}
|
||||
|
||||
% Float placement parameters
|
||||
|
||||
% The total number of floats that can be allowed on a page.
|
||||
\setcounter{totalnumber}{10}
|
||||
% The maximum number of floats at the top and bottom of a page.
|
||||
\setcounter{topnumber}{5}
|
||||
\setcounter{bottomnumber}{5}
|
||||
% The maximum part of the top or bottom of a text page that can be
|
||||
% occupied by floats. This is set so that at least four lines of text
|
||||
% fit on the page.
|
||||
\renewcommand\topfraction{.9}
|
||||
\renewcommand\bottomfraction{.9}
|
||||
% The minimum amount of a text page that must be occupied by text.
|
||||
% This should accomodate four lines of text.
|
||||
\renewcommand\textfraction{.06}
|
||||
% The minimum amount of a float page that must be occupied by floats.
|
||||
\renewcommand\floatpagefraction{.94}
|
||||
|
||||
% The same parameters repeated for double column output
|
||||
\renewcommand\dbltopfraction{.9}
|
||||
\renewcommand\dblfloatpagefraction{.9}
|
||||
|
||||
% Space between floats
|
||||
\setlength\floatsep {12\p@ \@plus 2\p@ \@minus 2\p@}
|
||||
% Space between floats and text
|
||||
\setlength\textfloatsep{20\p@ \@plus 2\p@ \@minus 4\p@}
|
||||
% Space above and below an inline figure
|
||||
\setlength\intextsep {18\p@ \@plus 2\p@ \@minus 2\p@}
|
||||
|
||||
% For double column floats
|
||||
\setlength\dblfloatsep {12\p@ \@plus 2\p@ \@minus 2\p@}
|
||||
\setlength\dbltextfloatsep{20\p@ \@plus 2\p@ \@minus 4\p@}
|
||||
|
||||
% Space left at top, bottom and inbetween floats on a float page.
|
||||
\setlength\@fptop{0\p@} % no space above float page figures
|
||||
\setlength\@fpsep{12\p@ \@plus 1fil}
|
||||
\setlength\@fpbot{0\p@}
|
||||
|
||||
% The same for double column
|
||||
\setlength\@dblfptop{0\p@}
|
||||
\setlength\@dblfpsep{12\p@ \@plus 1fil}
|
||||
\setlength\@dblfpbot{0\p@}
|
||||
|
||||
% Override settings in mathtime back to TeX defaults
|
||||
\DeclareMathSizes{5} {5} {5} {5}
|
||||
\DeclareMathSizes{6} {6} {5} {5}
|
||||
\DeclareMathSizes{7} {7} {5} {5}
|
||||
\DeclareMathSizes{8} {8} {6} {5}
|
||||
\DeclareMathSizes{9} {9} {6.5} {5}
|
||||
\DeclareMathSizes{10} {10} {7.5} {5}
|
||||
\DeclareMathSizes{12} {12} {9} {7}
|
||||
|
||||
% Page styles
|
||||
\def\ps@headings
|
||||
{%
|
||||
\def\@oddfoot{\vbox to 12.5\p@{\hbox{\rule{\textwidth}{0.5\p@}}\vss
|
||||
\hbox to \textwidth{\hfill\helveticabold\small\thepage}%
|
||||
}}%
|
||||
\def\@evenfoot{\vbox to 12.5\p@{\rule{\textwidth}{0.5\p@}\vss
|
||||
\hbox to \textwidth{\helveticabold\small\thepage\hfill}%
|
||||
}}%
|
||||
\def\@evenhead{\vbox{\hbox to \textwidth{\fontsize{8}{10}\selectfont
|
||||
\helveticabold{\fontshape{it}\selectfont
|
||||
\strut\leftmark}\hfill}\vspace{6.5\p@}\rule{\textwidth}{0.5\p@}}}%
|
||||
\def\@oddhead{\vbox{\hbox to \textwidth{\hfill\fontsize{8}{10}\selectfont
|
||||
\helveticabold{\fontshape{it}\selectfont\strut\rightmark}}%
|
||||
\vspace{6.5\p@}\rule{\textwidth}{0.5\p@}}}%
|
||||
\def\titlemark##1{\markboth{##1}{##1}}%
|
||||
\def\authormark##1{\gdef\leftmark{##1}}%
|
||||
}
|
||||
|
||||
\def\ps@opening
|
||||
{%
|
||||
\def\@oddfoot{\vbox to 13\p@{\hbox{\rule{\textwidth}{1\p@}}\vss
|
||||
\hbox to \textwidth{\helvetica
|
||||
\fontsize{7}{9}\fontshape{n}\selectfont%
|
||||
\hfill\small\helveticabold\thepage}%
|
||||
}}%
|
||||
\def\@evenfoot{\vbox to 13\p@{\rule{\textwidth}\vss
|
||||
\hbox to \textwidth{\helvetica\thepage\hfill
|
||||
\fontsize{7}{9}\fontshape{n}\selectfont}%
|
||||
}}%
|
||||
\let\@evenhead\relax
|
||||
\let\@oddhead\relax}
|
||||
|
||||
% Page range
|
||||
\newif\iflastpagegiven \lastpagegivenfalse
|
||||
\newcommand\firstpage[1]{%
|
||||
\gdef\@firstpage{#1}%
|
||||
\ifnum\@firstpage>\c@page
|
||||
\setcounter{page}{#1}%
|
||||
\ClassWarning{BIO}{Increasing pagenumber to \@firstpage}%
|
||||
\else \ifnum\@firstpage<\c@page
|
||||
\ClassWarning{BIO}{Firstpage lower than pagenumber}\fi\fi
|
||||
\xdef\@firstpage{\the\c@page}%
|
||||
}
|
||||
\def\@firstpage{1}
|
||||
\def\pagenumbering#1{%
|
||||
\global\c@page \@ne
|
||||
\gdef\thepage{\csname @#1\endcsname \c@page}%
|
||||
\gdef\thefirstpage{%
|
||||
\csname @#1\endcsname \@firstpage}%
|
||||
\gdef\thelastpage{%
|
||||
\csname @#1\endcsname \@lastpage}%
|
||||
}
|
||||
|
||||
\newcommand\lastpage[1]{\xdef\@lastpage{#1}%
|
||||
\global\lastpagegiventrue}
|
||||
\def\@lastpage{0}
|
||||
\def\setlastpage{\iflastpagegiven\else
|
||||
\edef\@tempa{@lastpage@}%
|
||||
\expandafter
|
||||
\ifx \csname \@tempa \endcsname \relax
|
||||
\gdef\@lastpage{0}%
|
||||
\else
|
||||
\xdef\@lastpage{\@nameuse{@lastpage@}}%
|
||||
\fi
|
||||
\fi }
|
||||
\def\writelastpage{%
|
||||
\iflastpagegiven \else
|
||||
\immediate\write\@auxout%
|
||||
{\string\global\string\@namedef{@lastpage@}{\the\c@page}}%
|
||||
\fi
|
||||
}
|
||||
\def\thepagerange{%
|
||||
\ifnum\@lastpage =0 {\ \bf ???} \else
|
||||
\ifnum\@lastpage = \@firstpage \ \thefirstpage\else
|
||||
\thefirstpage--\thelastpage \fi\fi}
|
||||
|
||||
\AtBeginDocument{\setlastpage
|
||||
\pagenumbering{arabic}%
|
||||
}
|
||||
\AtEndDocument{%
|
||||
\writelastpage
|
||||
\if@final
|
||||
\clearemptydoublepage
|
||||
\else
|
||||
\clearpage
|
||||
\fi}
|
||||
|
||||
%
|
||||
% Sectional units
|
||||
%
|
||||
|
||||
% Counters
|
||||
\newcounter{section}
|
||||
\newcounter{subsection}[section]
|
||||
\newcounter{subsubsection}[subsection]
|
||||
\newcounter{paragraph}[subsubsection]
|
||||
\newcounter{subparagraph}[paragraph]
|
||||
\newcounter{figure}
|
||||
\newcounter{table}
|
||||
|
||||
% Form of the numbers
|
||||
\newcommand\thepage{\arabic{page}}
|
||||
\renewcommand\thesection{\arabic{section}}
|
||||
\renewcommand\thesubsection{{\thesection.\arabic{subsection}}}
|
||||
\renewcommand\thesubsubsection{{\thesubsection.\arabic{subsubsection}}}
|
||||
\renewcommand\theparagraph{\thesubsubsection.\arabic{paragraph}}
|
||||
\renewcommand\thesubparagraph{\theparagraph.\arabic{subparagraph}}
|
||||
\renewcommand\theequation{\arabic{equation}}
|
||||
|
||||
% Form of the words
|
||||
\newcommand\contentsname{Contents}
|
||||
\newcommand\listfigurename{List of Figures}
|
||||
\newcommand\listtablename{List of Tables}
|
||||
\newcommand\partname{Part}
|
||||
\newcommand\appendixname{Appendix}
|
||||
\newcommand\abstractname{Abstract}
|
||||
\newcommand\refname{References}
|
||||
\newcommand\bibname{References}
|
||||
\newcommand\indexname{Index}
|
||||
\newcommand\figurename{Fig.}
|
||||
\newcommand\tablename{Table}
|
||||
|
||||
% Clearemptydoublepage should really clear the running heads too
|
||||
\newcommand{\clearemptydoublepage}{\newpage{\pagestyle{empty}\cleardoublepage}}
|
||||
|
||||
% Frontmatter, mainmatter and backmatter
|
||||
|
||||
\newif\if@mainmatter \@mainmattertrue
|
||||
|
||||
\newcommand\frontmatter{%
|
||||
\clearpage
|
||||
\@mainmatterfalse
|
||||
\pagenumbering{roman}}
|
||||
|
||||
\newcommand\mainmatter{%
|
||||
\clearpage
|
||||
\@mainmattertrue
|
||||
\pagenumbering{arabic}}
|
||||
|
||||
\newcommand\backmatter{%
|
||||
\clearpage
|
||||
\@mainmatterfalse}
|
||||
|
||||
%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% TITLE %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%
|
||||
\newlength{\dropfromtop}
|
||||
\setlength{\dropfromtop}{\z@}
|
||||
|
||||
% Application Notes
|
||||
\newif\if@appnotes
|
||||
\newcommand{\application}{%
|
||||
% \setlength{\dropfromtop}{-2.25pc}%
|
||||
\global\@appnotestrue}
|
||||
|
||||
\long\def\title{\@ifnextchar[{\short@title}{\@@title}}
|
||||
\def\short@title[#1]{\titlemark{#1}\@@@title}
|
||||
\def\@@title#1{\authormark{#1}\@@@title{#1}}
|
||||
\long\def\@@@title#1{\gdef\@title{#1}}
|
||||
|
||||
\long\def\author{\@ifnextchar[{\short@uthor}{\@uthor}}
|
||||
\def\short@uthor[#1]{\authormark{#1}\@@author}
|
||||
\def\@uthor#1{\authormark{#1}\@@author{#1}}
|
||||
\long\def\@@author#1{\gdef\@author{#1}}
|
||||
|
||||
\def\vol#1{\global\def\@vol{#1}}
|
||||
\def\issue#1{\global\def\@issue{#1}}
|
||||
\def\address#1{\global\def\@issue{#1}}
|
||||
\def\history#1{\global\def\@history{#1}}
|
||||
\def\editor#1{\global\def\@editor{#1}}
|
||||
\def\pubyear#1{\global\def\@pubyear{#1}}
|
||||
\def\copyrightyear#1{\global\def\@copyrightyear{#1}}
|
||||
\def\address#1{\global\def\@address{#1}}
|
||||
\def\DOI#1{\global\def\@DOI{#1}}
|
||||
|
||||
\definecolor{gray}{cmyk}{0, 0, 0, 0.15}
|
||||
\newlength{\extraspace}
|
||||
\setlength{\extraspace}{\z@}
|
||||
|
||||
\newcommand\maketitle{\par
|
||||
\begingroup
|
||||
\renewcommand\thefootnote{\@fnsymbol\c@footnote}%
|
||||
\def\@makefnmark{\rlap{\@textsuperscript{\normalfont\@thefnmark}}}%
|
||||
\long\def\@makefntext##1{\parindent 3mm\noindent
|
||||
% \@textsuperscript{\normalfont\@thefnmark}\raggedright##1}%
|
||||
\@textsuperscript{\normalfont\@thefnmark}##1}%
|
||||
\if@twocolumn
|
||||
\ifnum \col@number=\@ne
|
||||
\@maketitle
|
||||
\else
|
||||
\twocolumn[\@maketitle]%
|
||||
\fi
|
||||
\else
|
||||
\newpage
|
||||
\global\@topnum\z@ % Prevents figures from going at top of page.
|
||||
\@maketitle
|
||||
\fi
|
||||
\thispagestyle{opening}\@thanks
|
||||
\endgroup
|
||||
\setcounter{footnote}{0}%
|
||||
\global\let\thanks\relax
|
||||
\global\let\maketitle\relax
|
||||
\global\let\@maketitle\relax
|
||||
\global\let\@address\@empty
|
||||
\global\let\@history\@empty
|
||||
\global\let\@editor\@empty
|
||||
\global\let\@thanks\@empty
|
||||
\global\let\@author\@empty
|
||||
\global\let\@date\@empty
|
||||
\global\let\@title\@empty
|
||||
\global\let\@pubyear\@empty
|
||||
\global\let\address\relax
|
||||
\global\let\history\relax
|
||||
\global\let\editor\relax
|
||||
\global\let\title\relax
|
||||
\global\let\author\relax
|
||||
\global\let\date\relax
|
||||
\global\let\pubyear\relax
|
||||
\global\let\@copyrightline\@empty
|
||||
\global\let\and\relax
|
||||
\@afterindentfalse\@afterheading
|
||||
}
|
||||
|
||||
\newlength{\aboveskipchk}%for checking oddpage or evenpage top skip
|
||||
\setlength{\aboveskipchk}{\z@}%
|
||||
|
||||
\def\@maketitle{%
|
||||
\let\footnote\thanks
|
||||
\clearemptydoublepage
|
||||
\checkoddpage\ifcpoddpage\setlength{\aboveskipchk}{-3pc}\else\setlength{\aboveskipchk}{-5pc}\fi%for checking oddpage or evenpage top skip%%
|
||||
\vspace*{\aboveskipchk}%
|
||||
\vspace{\dropfromtop}%
|
||||
\hbox to \textwidth{%
|
||||
{\helvetica\itshape\bfseries\fontsize{19}{12}\selectfont {\color{gray}TECHNICAL REPORT}
|
||||
\hfil
|
||||
\if@appnotes APPLICATIONS NOTE\hfil\fi
|
||||
}%
|
||||
\enskip \parbox[b]{11.3pc}{%
|
||||
\helvetica
|
||||
\flushright\fontsize{8}{10}\fontshape{it}\selectfont
|
||||
\hfill
|
||||
}}
|
||||
\rule{\textwidth}{1\p@}\par%
|
||||
\helvetica
|
||||
\hbox to \textwidth{%
|
||||
\parbox[t]{41pc}{%
|
||||
\vspace*{1sp}
|
||||
{\helveticabold\fontsize{16}{21}\selectfont\raggedright \@title \par}%
|
||||
\vspace{4.5\p@}
|
||||
{\authoraffliate\fontsize{11}{13}\selectfont\raggedright \@author \par}%
|
||||
\vspace{4\p@}
|
||||
{\authoraffliate\fontsize{9}{11}\selectfont\raggedright \@address \par}%
|
||||
\vspace{4\p@}
|
||||
%{\helvetica\fontsize{8}{10}\selectfont\raggedright \@history \par}
|
||||
%\vspace{24\p@}
|
||||
%{\helvetica\fontsize{10}{12}\selectfont\raggedright \@editor \par}
|
||||
%\vspace{20\p@}
|
||||
}%
|
||||
}
|
||||
\vspace{4.5\p@}%
|
||||
\rule{\textwidth}{1\p@}%
|
||||
\vspace{12\p@ plus 6\p@ minus 6\p@}%
|
||||
\vspace{\extraspace}
|
||||
}
|
||||
%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%
|
||||
|
||||
%%%%%%%%%%%%%%%%%%%%%%%%%%%% Abstract %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%
|
||||
\newcommand{\absection}[1]{%
|
||||
\par\noindent{\bfseries #1}\space\ignorespaces}
|
||||
|
||||
\newenvironment{abstract}{%
|
||||
\begingroup
|
||||
\let\section\absection
|
||||
\fontfamily{\sfdefault}\fontsize{8}{11}\sffamily\selectfont
|
||||
{\fontseries{b}\selectfont ABSTRACT}\par}
|
||||
{\endgroup\bigskip\@afterheading\@afterindentfalse\vskip 12pt plus 3pt minus 1pt}
|
||||
|
||||
% Section macros
|
||||
|
||||
% Lowest level heading that takes a number by default
|
||||
\setcounter{secnumdepth}{3}
|
||||
|
||||
\renewcommand{\@seccntformat}[1]{\csname the#1\endcsname\quad}
|
||||
|
||||
\def\section{%
|
||||
\@startsection{section}{1}{\z@}
|
||||
{-22\p@ plus -3\p@}{3\p@}
|
||||
{\reset@font\raggedright\helveticabold\fontsize{10}{12}\selectfont\MakeUppercase}}
|
||||
|
||||
\def\subsection{%
|
||||
\@startsection{subsection}{2}{\z@}
|
||||
{-11\p@ plus -2\p@}{3\p@}
|
||||
{\reset@font\raggedright\mathversion{bold}\fontseries{b}\fontsize{10}{12}\selectfont}}
|
||||
|
||||
\def\subsubsection{%
|
||||
\@startsection{subsubsection}{3}{\z@}
|
||||
%{-11\p@ plus -1\p@}{-1em}
|
||||
{-11\p@ plus -1\p@}{0.001em}
|
||||
{\reset@font\normalfont\normalsize\itshape}}
|
||||
|
||||
\def\textcolon{\text{\rm :}}
|
||||
|
||||
\def\paragraph{%
|
||||
\@startsection{paragraph}{4}{\z@}
|
||||
{-6\p@}
|
||||
{-.4em}
|
||||
{\reset@font\itshape}}
|
||||
|
||||
% ********************
|
||||
% Figures and tables *
|
||||
% ********************
|
||||
|
||||
% Table and array parameters
|
||||
\setlength\arraycolsep{.5em}
|
||||
\setlength\tabcolsep{.5em}
|
||||
\setlength\arrayrulewidth{.5pt}
|
||||
\setlength\doublerulesep{2.5pt}
|
||||
\setlength\extrarowheight{\z@}
|
||||
\renewcommand\arraystretch{1}
|
||||
|
||||
\newlength{\abovecaptionskip}
|
||||
\newlength{\belowcaptionskip}
|
||||
\setlength{\abovecaptionskip}{13pt}
|
||||
\setlength{\belowcaptionskip}{10.5pt}
|
||||
|
||||
\long\def\@makecaption#1#2{\vspace{\abovecaptionskip}%
|
||||
\begingroup
|
||||
\footnotesize
|
||||
\textbf{#1.}\enskip{#2}\par
|
||||
\endgroup}
|
||||
|
||||
\long\def\@tablecaption#1#2{%
|
||||
\begingroup
|
||||
\footnotesize
|
||||
\textbf{#1.}\enskip{#2\strut\par}
|
||||
\endgroup\vspace{\belowcaptionskip}}
|
||||
|
||||
% Table rules
|
||||
\def\toprule{\noalign{\ifnum0=`}\fi\hrule \@height 0.5pt \hrule \@height 6pt \@width 0pt \futurelet
|
||||
\@tempa\@xhline}
|
||||
\def\midrule{\noalign{\ifnum0=`}\fi \hrule \@height 6.75pt \@width 0pt \hrule \@height 0.5pt
|
||||
\hrule \@height 6pt \@width 0pt \futurelet \@tempa\@xhline}
|
||||
\def\botrule{\noalign{\ifnum0=`}\fi \hrule \@height 5.75pt \@width 0pt \hrule \@height 0.5pt \futurelet
|
||||
\@tempa\@xhline}
|
||||
\def\hrulefill{\leavevmode\leaders\hrule height .5pt\hfill\kern\z@}
|
||||
|
||||
\def\thefigure{\@arabic\c@figure}
|
||||
\def\fps@figure{tbp}
|
||||
\def\ftype@figure{1}
|
||||
\def\ext@figure{lof}
|
||||
\def\fnum@figure{\figurename~\thefigure}
|
||||
\def\figure{\@float{figure}}
|
||||
\let\endfigure\end@float
|
||||
\@namedef{figure*}{\@dblfloat{figure}}
|
||||
\@namedef{endfigure*}{\end@dblfloat}
|
||||
\def\thetable{\@arabic\c@table}
|
||||
\def\fps@table{tbp}
|
||||
\def\ftype@table{2}
|
||||
\def\ext@table{lot}
|
||||
\def\fnum@table{Table~\thetable}
|
||||
\def\table{\let\@makecaption\@tablecaption\let\source\tablesource\@float{table}}
|
||||
\def\endtable{\end@float}
|
||||
\@namedef{table*}{\let\@makecaption\@tablecaption\@dblfloat{table}}
|
||||
\@namedef{endtable*}{\end@dblfloat}
|
||||
|
||||
\newif\if@rotate \@rotatefalse
|
||||
\newif\if@rotatecenter \@rotatecenterfalse
|
||||
\def\rotatecenter{\global\@rotatecentertrue}
|
||||
\def\rotateendcenter{\global\@rotatecenterfalse}
|
||||
\def\rotate{\global\@rotatetrue}
|
||||
\def\endrotate{\global\@rotatefalse}
|
||||
\newdimen\rotdimen
|
||||
\def\rotstart#1{\special{ps: gsave currentpoint currentpoint translate
|
||||
#1 neg exch neg exch translate}}
|
||||
\def\rotfinish{\special{ps: currentpoint grestore moveto}}
|
||||
\def\rotl#1{\rotdimen=\ht#1\advance\rotdimen by \dp#1
|
||||
\hbox to \rotdimen{\vbox to\wd#1{\vskip \wd#1
|
||||
\rotstart{270 rotate}\box #1\vss}\hss}\rotfinish}
|
||||
\def\rotr#1{\rotdimen=\ht #1\advance\rotdimen by \dp#1
|
||||
\hbox to \rotdimen{\vbox to \wd#1{\vskip \wd#1
|
||||
\rotstart{90 rotate}\box #1\vss}\hss}\rotfinish}
|
||||
|
||||
\newdimen\tempdime
|
||||
\newbox\temptbox
|
||||
|
||||
% From ifmtarg.sty
|
||||
% Copyright Peter Wilson and Donald Arseneau, 2000
|
||||
\begingroup
|
||||
\catcode`\Q=3
|
||||
\long\gdef\@ifmtarg#1{\@xifmtarg#1QQ\@secondoftwo\@firstoftwo\@nil}
|
||||
\long\gdef\@xifmtarg#1#2Q#3#4#5\@nil{#4}
|
||||
\long\gdef\@ifnotmtarg#1{\@xifmtarg#1QQ\@firstofone\@gobble\@nil}
|
||||
\endgroup
|
||||
|
||||
\def\tablesize{\@setfontsize\tablesize{8\p@}{10\p@}}
|
||||
|
||||
\newenvironment{processtable}[3]{\setbox\temptbox=\hbox{{\tablesize #2}}%
|
||||
\tempdime\wd\temptbox\@processtable{#1}{#2}{#3}{\tempdime}}
|
||||
{\relax}
|
||||
|
||||
\newcommand{\@processtable}[4]{%
|
||||
\if@rotate
|
||||
\setbox4=\vbox to \hsize{\vss\hbox to \textheight{%
|
||||
\begin{minipage}{#4}%
|
||||
\@ifmtarg{#1}{}{\caption{#1}}{\tablesize #2}%
|
||||
\vskip7\p@\noindent
|
||||
\parbox{#4}{\fontsize{7}{9}\selectfont #3\par}%
|
||||
\end{minipage}}\vss}%
|
||||
\rotr{4}
|
||||
\else
|
||||
\hbox to \hsize{\hss\begin{minipage}[t]{#4}%
|
||||
\vskip2.9pt
|
||||
\@ifmtarg{#1}{}{\caption{#1}}{\tablesize #2}%
|
||||
\vskip6\p@\noindent
|
||||
\parbox{#4}{\fontsize{7}{9}\selectfont #3\par}%
|
||||
\end{minipage}\hss}\fi}%
|
||||
|
||||
\newcolumntype{P}[1]{>{\raggedright\let\\\@arraycr\hangindent1em}p{#1}}
|
||||
|
||||
% ******************************
|
||||
% List numbering and lettering *
|
||||
% ******************************
|
||||
\def\labelenumi{{\rm\arabic{enumi}.}}
|
||||
\def\theenumi{\arabic{enumi}}
|
||||
\def\labelenumii{{\rm\alph{enumii}.}}
|
||||
\def\theenumii{\alph{enumii}}
|
||||
\def\p@enumii{\theenumi}
|
||||
\def\labelenumiii{{\rm(\arabic{enumiii})}}
|
||||
\def\theenumiii{\roman{enumiii}}
|
||||
\def\p@enumiii{\theenumi(\theenumii)}
|
||||
\def\labelenumiv{{\rm(\arabic{enumiv})}}
|
||||
\def\theenumiv{\Alph{enumiv}}
|
||||
\def\p@enumiv{\p@enumiii\theenumiii}
|
||||
\def\labelitemi{{\small$\bullet$}}
|
||||
\def\labelitemii{{\small$\bullet$}}
|
||||
\def\labelitemiii{{\small$\bullet$}}
|
||||
\def\labelitemiv{{\small$\bullet$}}
|
||||
|
||||
\def\@listI{\leftmargin\leftmargini \topsep\medskipamount}
|
||||
\let\@listi\@listI
|
||||
\@listi
|
||||
\def\@listii{\topsep\z@\leftmargin\leftmarginii}
|
||||
\def\@listiii{\leftmargin\leftmarginiii \topsep\z@}
|
||||
\def\@listiv{\leftmargin\leftmarginiv \topsep\z@}
|
||||
\def\@listv{\leftmargin\leftmarginv \topsep\z@}
|
||||
\def\@listvi{\leftmargin\leftmarginvi \topsep\z@}
|
||||
|
||||
\setlength{\leftmargini}{3mm}
|
||||
\setlength{\leftmarginii}{\z@}
|
||||
\setlength{\leftmarginiii}{\z@}
|
||||
\setlength{\leftmarginiv}{\z@}
|
||||
|
||||
% Changes to the list parameters for enumerate
|
||||
\def\enumargs{%
|
||||
\partopsep \z@
|
||||
\itemsep 3\p@
|
||||
\parsep \z@
|
||||
\labelsep 0.5em
|
||||
\listparindent \parindent
|
||||
\itemindent \z@
|
||||
\topsep 11\p@
|
||||
}
|
||||
|
||||
\def\enumerate{%
|
||||
\@ifnextchar[{\@numerate}{\@numerate[0]}}
|
||||
|
||||
\def\@numerate[#1]{%
|
||||
\ifnum \@enumdepth >3 \@toodeep\else
|
||||
\advance\@enumdepth \@ne
|
||||
\edef\@enumctr{enum\romannumeral\the\@enumdepth}
|
||||
\list{\csname label\@enumctr\endcsname}{%
|
||||
\enumargs
|
||||
\setlength{\leftmargin}{\csname leftmargin\romannumeral\the\@enumdepth\endcsname}
|
||||
\usecounter{\@enumctr}
|
||||
\settowidth\labelwidth{#1}
|
||||
\addtolength{\leftmargin}{\labelwidth}
|
||||
\addtolength{\leftmargin}{\labelsep}
|
||||
\def\makelabel##1{\hss \llap{##1}}}%
|
||||
\fi
|
||||
}
|
||||
\let\endenumerate\endlist
|
||||
|
||||
% Changes to the list parameters for itemize
|
||||
\def\itemargs{%
|
||||
\partopsep \z@
|
||||
\itemsep 3\p@
|
||||
\parsep \z@
|
||||
\labelsep 0.5em
|
||||
\rightmargin \z@
|
||||
\listparindent \parindent
|
||||
\itemindent \z@
|
||||
\topsep11\p@
|
||||
}
|
||||
|
||||
\def\itemize{%
|
||||
\@ifnextchar[{\@itemize}{\@itemize[$\bullet$]}}
|
||||
|
||||
\def\@itemize[#1]{%
|
||||
\ifnum \@itemdepth >3 \@toodeep\else
|
||||
\advance\@itemdepth \@ne
|
||||
\edef\@itemctr{item\romannumeral\the\@itemdepth}
|
||||
\list{\csname label\@itemctr\endcsname}{%
|
||||
\itemargs
|
||||
\setlength{\leftmargin}{\csname leftmargin\romannumeral\the\@itemdepth\endcsname}
|
||||
\settowidth\labelwidth{#1}
|
||||
\addtolength{\leftmargin}{\labelwidth}
|
||||
\addtolength{\leftmargin}{\labelsep}
|
||||
\def\makelabel##1{\hss \llap{##1}}}%
|
||||
\fi
|
||||
}
|
||||
\let\enditemize\endlist
|
||||
|
||||
\newenvironment{unlist}{%
|
||||
\begin{list}{}%
|
||||
{\setlength{\labelwidth}{\z@}%
|
||||
\setlength{\labelsep}{\z@}%
|
||||
\setlength{\topsep}{\medskipamount}%
|
||||
\setlength{\itemsep}{3\p@}%
|
||||
\setlength{\leftmargin}{2em}%
|
||||
\setlength{\itemindent}{-2em}}}
|
||||
{\end{list}}
|
||||
|
||||
|
||||
% ***********************
|
||||
% Quotes and Quotations *
|
||||
% ***********************
|
||||
\def\quotation{\par\begin{list}{}{
|
||||
\setlength{\topsep}{\medskipamount}
|
||||
\setlength{\leftmargin}{2em}%
|
||||
\setlength{\rightmargin}{\z@}%
|
||||
\setlength\labelwidth{0pt}%
|
||||
\setlength\labelsep{0pt}%
|
||||
\listparindent\parindent}%
|
||||
\item[]}
|
||||
\def\endquotation{\end{list}}
|
||||
\let\quote\quotation
|
||||
\let\endquote\endquotation
|
||||
|
||||
\skip\@mpfootins = \skip\footins
|
||||
\fboxsep=6\p@
|
||||
\fboxrule=1\p@
|
||||
|
||||
% *******************
|
||||
% Table of contents *
|
||||
% *******************
|
||||
\newcommand\@pnumwidth{4em}
|
||||
\newcommand\@tocrmarg{2.55em plus 1fil}
|
||||
\newcommand\@dotsep{1000}
|
||||
\setcounter{tocdepth}{4}
|
||||
|
||||
\def\numberline#1{\hbox to \@tempdima{{#1}}}
|
||||
|
||||
\def\@authortocline#1#2#3#4#5{%
|
||||
\vskip 1.5\p@
|
||||
\ifnum #1>\c@tocdepth \else
|
||||
{\leftskip #2\relax \rightskip \@tocrmarg \parfillskip -\rightskip
|
||||
\parindent #2\relax\@afterindenttrue
|
||||
\interlinepenalty\@M
|
||||
\leavevmode
|
||||
\@tempdima #3\relax
|
||||
\advance\leftskip \@tempdima \null\nobreak\hskip -\leftskip
|
||||
{\itshape #4}\nobreak
|
||||
\leaders\hbox{$\m@th
|
||||
\mkern \@dotsep mu\hbox{.}\mkern \@dotsep
|
||||
mu$}\hfill
|
||||
\nobreak
|
||||
\hb@xt@\@pnumwidth{\hfil}%
|
||||
\par}%
|
||||
\fi}
|
||||
|
||||
\newcommand*\l@author{\@authortocline{2}{0pt}{30pt}}
|
||||
\newcommand*\l@section{\@dottedtocline{3}{11pt}{20pt}}
|
||||
\newcommand*\l@subsection{\@dottedtocline{4}{31pt}{29pt}}
|
||||
\newcommand*\l@subsubsection[2]{}
|
||||
|
||||
|
||||
|
||||
% ***********
|
||||
% Footnotes *
|
||||
% ***********
|
||||
|
||||
\def\footnoterule{\noindent\rule{\columnwidth}{0.5pt}}
|
||||
\def\@makefnmark{\@textsuperscript{\normalfont\@thefnmark}}%
|
||||
\newcommand\@makefntext[1]{\noindent{\@makefnmark}\enskip#1}
|
||||
|
||||
% ***********
|
||||
% References *
|
||||
% ***********
|
||||
|
||||
\providecommand{\newblock}{}
|
||||
\newenvironment{thebibliography}{%
|
||||
\section{\bibname}%
|
||||
\begingroup
|
||||
\small
|
||||
\begin{list}{}{%
|
||||
\setlength{\topsep}{\z@}%
|
||||
\setlength{\labelsep}{\z@}%
|
||||
\settowidth{\labelwidth}{\z@}%
|
||||
\setlength{\leftmargin}{4mm}%
|
||||
\setlength{\itemindent}{-4mm}}\small}
|
||||
{\end{list}\endgroup}
|
||||
|
||||
\RequirePackage{natbib}
|
||||
|
||||
% **********
|
||||
% Appendix *
|
||||
% **********
|
||||
\newif\ifappend % Are we in the Appendix?
|
||||
\def\appendix{\par
|
||||
\setcounter{section}{0}
|
||||
\setcounter{subsection}{0}
|
||||
\appendtrue
|
||||
}
|
||||
|
||||
%Math parameters
|
||||
|
||||
\setlength{\jot}{5\p@}
|
||||
\mathchardef\@m=1500 % adapted value
|
||||
|
||||
\def\frenchspacing{\sfcode`\.\@m \sfcode`\?\@m \sfcode`\!\@m
|
||||
\sfcode`\:\@m \sfcode`\;\@m \sfcode`\,\@m}
|
||||
|
||||
% Theorems
|
||||
\def\th@plain{%
|
||||
%% \let\thm@indent\noindent % no indent
|
||||
\thm@headfont{\quad\scshape}% heading font is bold
|
||||
\thm@notefont{\upshape\mdseries}% same as heading font
|
||||
\thm@headpunct{.}% no period after heading
|
||||
\thm@headsep 5\p@ plus\p@ minus\p@\relax
|
||||
%% \let\thm@swap\@gobble
|
||||
%% \thm@preskip\topsep
|
||||
%% \thm@postskip\theorempreskipamount
|
||||
\itshape % body font
|
||||
}
|
||||
|
||||
\vbadness=9999
|
||||
\tolerance=9999
|
||||
\doublehyphendemerits=10000
|
||||
\doublehyphendemerits 640000 % corresponds to badness 800
|
||||
\finalhyphendemerits 1000000 % corresponds to badness 1000
|
||||
|
||||
\flushbottom
|
||||
\frenchspacing
|
||||
\ps@headings
|
||||
\twocolumn
|
||||
|
||||
% Screen PDF compatability
|
||||
\newcommand{\medline}[1]{%
|
||||
\unskip\unskip\ignorespaces}
|
||||
|
||||
|
||||
%%%%for smaller size text
|
||||
\newenvironment{methods}{%
|
||||
\begingroup
|
||||
\def\section{%
|
||||
\@startsection{section}{1}{\z@}
|
||||
{-24\p@ plus -3\p@}{4\p@}
|
||||
{\reset@font\raggedright\helveticabold\fontsize{10}{12}\selectfont\MakeUppercase}}
|
||||
\def\subsection{%
|
||||
\@startsection{subsection}{2}{\z@}
|
||||
{-5\p@ plus -2\p@}{4\p@}
|
||||
{\reset@font\raggedright\mathversion{bold}\fontseries{b}\fontsize{10}{12}\selectfont}}
|
||||
\def\subsubsection{%
|
||||
\@startsection{subsubsection}{3}{\z@}
|
||||
% {-6\p@ plus -1\p@}{-1em}
|
||||
{-6\p@ plus -1\p@}{0.001em}
|
||||
{\reset@font\normalfont\normalsize\itshape}}
|
||||
\footnotesize
|
||||
\par}
|
||||
{\par\endgroup\bigskip\@afterheading\@afterindentfalse}
|
||||
|
||||
|
||||
|
||||
\graphicspath{{g:/artwork/oup/bioinfo/}}
|
||||
|
||||
\language=2
|
||||
|
||||
\hyphenation{Figure Table Figures Tables}
|
||||
|
||||
\newcommand{\href}[2]{#2}
|
||||
|
||||
\renewenvironment{proof}[1][\proofname]{\par
|
||||
\normalfont \topsep6\p@\@plus6\p@\relax
|
||||
\labelsep 0.5em
|
||||
\trivlist
|
||||
\item[\hskip\labelsep\hskip1em\textsc{#1}.]\ignorespaces
|
||||
}{\endtrivlist\@endpefalse}
|
||||
|
||||
%%Different Bonds
|
||||
|
||||
\def\sbond{\ensuremath{\raise.25ex\hbox{${-}\!\!\!\!{-}$}}\kern -.9pt}
|
||||
\def\dbond{\ensuremath{\raise.25ex\hbox{=$\!$=}}}
|
||||
\def\tbond{\ensuremath{\raise.20ex\hbox{${\equiv}\!\!\!{\equiv}$}}}
|
||||
|
||||
% Author queries
|
||||
%\fboxsep=4\p@
|
||||
%\fboxrule=0.5\p@
|
||||
\newcommand{\query}[2][0pt]{}%
|
||||
% \marginpar{\vspace*{#1}%
|
||||
% {\parbox{\marginparwidth}{%
|
||||
% \raggedright\fontsize{6}{8}\selectfont
|
||||
% #2}}}}
|
||||
|
||||
\renewcommand{\dag}{{\mathversion{normal}$^{\dagger}$}}
|
||||
|
||||
\endinput
|
||||
@@ -0,0 +1,17 @@
|
||||
Q 60 32681 57 0.001744133
|
||||
Q 39 3 1 0.001774569
|
||||
Q 38 3 1 0.001804999
|
||||
Q 35 5 1 0.001835311
|
||||
Q 34 31 2 0.001894692
|
||||
Q 20 11 2 0.001955154
|
||||
Q 19 4 1 0.001985460
|
||||
Q 15 29 5 0.002136296
|
||||
Q 14 6 1 0.002166417
|
||||
Q 10 11 1 0.002196193
|
||||
Q 6 11 2 0.002256442
|
||||
Q 5 1 1 0.002286864
|
||||
Q 4 1 1 0.002317285
|
||||
Q 3 36 15 0.002771602
|
||||
Q 2 5 2 0.002832085
|
||||
Q 1 12 9 0.003105023
|
||||
Q 0 220 83 0.005594194
|
||||
@@ -0,0 +1,55 @@
|
||||
Q 60 31721 27 0.000851171
|
||||
Q 59 54 4 0.000975610
|
||||
Q 58 29 5 0.001131933
|
||||
Q 57 21 2 0.001194030
|
||||
Q 56 14 4 0.001319137
|
||||
Q 55 22 6 0.001506544
|
||||
Q 54 12 4 0.001631475
|
||||
Q 53 16 3 0.001724733
|
||||
Q 51 10 1 0.001755541
|
||||
Q 50 10 1 0.001786330
|
||||
Q 49 11 3 0.001879699
|
||||
Q 47 8 2 0.001941869
|
||||
Q 46 17 1 0.001972140
|
||||
Q 44 8 3 0.002065534
|
||||
Q 43 10 1 0.002096174
|
||||
Q 42 13 1 0.002126595
|
||||
Q 41 14 3 0.002219444
|
||||
Q 40 13 2 0.002281036
|
||||
Q 38 17 4 0.002404747
|
||||
Q 37 15 4 0.002528484
|
||||
Q 36 12 1 0.002558742
|
||||
Q 35 19 3 0.002650783
|
||||
Q 34 12 3 0.002743313
|
||||
Q 33 7 1 0.002773882
|
||||
Q 32 21 3 0.002865508
|
||||
Q 31 11 2 0.002926799
|
||||
Q 30 14 3 0.003018891
|
||||
Q 29 17 1 0.003048401
|
||||
Q 28 11 2 0.003109549
|
||||
Q 27 20 5 0.003262998
|
||||
Q 26 11 1 0.003292948
|
||||
Q 25 14 4 0.003415725
|
||||
Q 24 16 5 0.003569212
|
||||
Q 23 43 6 0.003750426
|
||||
Q 21 15 1 0.003779664
|
||||
Q 20 29 7 0.003992943
|
||||
Q 19 22 2 0.004052089
|
||||
Q 18 28 4 0.004172204
|
||||
Q 16 25 5 0.004323390
|
||||
Q 15 24 5 0.004474480
|
||||
Q 14 25 5 0.004625204
|
||||
Q 13 23 3 0.004714365
|
||||
Q 12 22 1 0.004741963
|
||||
Q 11 32 11 0.005075674
|
||||
Q 10 35 7 0.005285315
|
||||
Q 9 32 12 0.005648503
|
||||
Q 8 33 8 0.005888126
|
||||
Q 7 39 7 0.006095506
|
||||
Q 6 42 14 0.006515953
|
||||
Q 5 38 15 0.006966725
|
||||
Q 4 37 12 0.007325113
|
||||
Q 3 49 18 0.007862737
|
||||
Q 2 63 21 0.008486434
|
||||
Q 1 55 27 0.009292156
|
||||
Q 0 153 77 0.011576593
|
||||
Executable
+33
@@ -0,0 +1,33 @@
|
||||
#!/usr/bin/perl
|
||||
|
||||
use strict;
|
||||
use warnings;
|
||||
use Getopt::Std;
|
||||
|
||||
my %opts = (n=>33088, s=>100);
|
||||
getopts('n:', \%opts);
|
||||
|
||||
my $pseudo = .5;
|
||||
my $tot = $pseudo;
|
||||
my $err = $pseudo;
|
||||
my $tot_last_out = -$opts{s};
|
||||
my $state = 0;
|
||||
my $mapq = 0;
|
||||
while (<>) {
|
||||
chomp;
|
||||
if (/^Q\t(\d+)\t(\d+)\t(\d+)/) {
|
||||
$tot += $2;
|
||||
$err += $3;
|
||||
if ($tot - $tot_last_out >= $opts{s}) {
|
||||
print join("\t", $1, $err/$tot, $tot / $opts{n}), "\n";
|
||||
$tot_last_out = $tot;
|
||||
$state = 0;
|
||||
} else {
|
||||
$state = 1;
|
||||
$mapq = $1;
|
||||
}
|
||||
}
|
||||
}
|
||||
if ($state) {
|
||||
print join("\t", $mapq, $err/$tot, $tot / $opts{n}), "\n";
|
||||
}
|
||||
@@ -0,0 +1,4 @@
|
||||
Q 40 31897 63 0.001975107
|
||||
Q 3 423 267 0.010210396
|
||||
Q 2 162 120 0.013853827
|
||||
Q 1 188 172 0.019038874
|
||||
@@ -0,0 +1,4 @@
|
||||
./pbsim --prefix pb-1 --depth 0.1 --sample-fastq m131017_060208_42213_c100579642550000001823095604021496_s1_p0.1.subreads.fastq --length-min 1000 --length-max 30000 --seed 11 hs38.fa
|
||||
|
||||
bin/mason_variator -ir hs38.fa -s 1 -ov hs38-s1.vcf --snp-rate 1e-3 --small-indel-rate 2e-4 --sv-indel-rate 0 --sv-inversion-rate 0 --sv-translocation-rate 0 --sv-duplication-rate 0 --max-small-indel-size 10
|
||||
bin/mason_simulator -ir hs38.fa -iv hs38-s1.vcf -n 1000000 --seed 1 -o s1_1.fq -or s1_2.fq -oa s1.sam --illumina-prob-mismatch-scale 2.5
|
||||
@@ -0,0 +1,49 @@
|
||||
Q 60 32070 190 0.005924540
|
||||
Q 59 62 2 0.005975352
|
||||
Q 58 37 5 0.006123908
|
||||
Q 57 40 7 0.006333633
|
||||
Q 56 39 6 0.006512032
|
||||
Q 55 32 2 0.006567534
|
||||
Q 54 54 2 0.006618420
|
||||
Q 53 33 4 0.006735255
|
||||
Q 52 39 2 0.006788866
|
||||
Q 51 48 3 0.006871264
|
||||
Q 50 34 2 0.006925634
|
||||
Q 49 32 3 0.007011070
|
||||
Q 48 35 2 0.007064967
|
||||
Q 47 36 4 0.007179896
|
||||
Q 46 23 1 0.007205495
|
||||
Q 45 25 1 0.007230614
|
||||
Q 44 17 3 0.007318716
|
||||
Q 43 17 2 0.007376121
|
||||
Q 42 31 5 0.007522016
|
||||
Q 41 25 4 0.007638486
|
||||
Q 40 26 4 0.007754541
|
||||
Q 39 35 2 0.007807258
|
||||
Q 37 18 4 0.007924896
|
||||
Q 36 13 3 0.008013162
|
||||
Q 35 15 2 0.008070411
|
||||
Q 34 20 3 0.008156805
|
||||
Q 33 11 1 0.008184501
|
||||
Q 32 15 3 0.008272003
|
||||
Q 31 25 1 0.008296107
|
||||
Q 29 8 1 0.008324472
|
||||
Q 28 7 2 0.008383452
|
||||
Q 27 9 2 0.008441894
|
||||
Q 26 30 2 0.008494888
|
||||
Q 23 2 1 0.008524710
|
||||
Q 22 11 3 0.008612846
|
||||
Q 20 23 3 0.008697760
|
||||
Q 19 6 1 0.008726479
|
||||
Q 18 8 1 0.008754658
|
||||
Q 16 6 1 0.008783354
|
||||
Q 13 2 1 0.008813108
|
||||
Q 12 4 2 0.008872604
|
||||
Q 11 7 2 0.008931275
|
||||
Q 10 4 3 0.009021009
|
||||
Q 9 6 4 0.009140436
|
||||
Q 8 6 3 0.009229559
|
||||
Q 7 5 1 0.009258419
|
||||
Q 6 8 3 0.009346925
|
||||
Q 4 8 5 0.009495872
|
||||
Q 3 17 8 0.009732801
|
||||
@@ -0,0 +1,261 @@
|
||||
@article{Chaisson:2012aa,
|
||||
Author = {Chaisson, Mark J and Tesler, Glenn},
|
||||
Journal = {BMC Bioinformatics},
|
||||
Pages = {238},
|
||||
Title = {{Mapping single molecule sequencing reads using basic local alignment with successive refinement (BLASR): application and theory}},
|
||||
Volume = {13},
|
||||
Year = {2012}}
|
||||
|
||||
@article{Liu:2016ab,
|
||||
Author = {Liu, Bo and others},
|
||||
Journal = {Bioinformatics},
|
||||
Pages = {1625-31},
|
||||
Title = {{rHAT}: fast alignment of noisy long reads with regional hashing},
|
||||
Volume = {32},
|
||||
Year = {2016}}
|
||||
|
||||
@article{Liu:2017aa,
|
||||
Author = {Liu, Bo and others},
|
||||
Journal = {Bioinformatics},
|
||||
Pages = {192-201},
|
||||
Title = {{LAMSA}: fast split read alignment with long approximate matches},
|
||||
Volume = {33},
|
||||
Year = {2017}}
|
||||
|
||||
@article{Lin:2017aa,
|
||||
Author = {Lin, Hsin-Nan and Hsu, Wen-Lian},
|
||||
Journal = {Bioinformatics},
|
||||
Title = {Kart: a divide-and-conquer algorithm for {NGS} read alignment},
|
||||
Year = {2017}}
|
||||
|
||||
@article{Li:2013aa,
|
||||
Author = {Li, Heng},
|
||||
Journal = {arXiv:1303.3997},
|
||||
Title = {Aligning sequence reads, clone sequences and assembly contigs with {BWA-MEM}},
|
||||
archivePrefix = "arXiv",
|
||||
eprint = {1303.3997},
|
||||
primaryClass = "q-bio",
|
||||
Year = {2013}}
|
||||
|
||||
@article{Sovic:2016aa,
|
||||
Author = {Sovi{\'c}, Ivan and others},
|
||||
Journal = {Nat Commun},
|
||||
Pages = {11307},
|
||||
Title = {Fast and sensitive mapping of nanopore sequencing reads with {GraphMap}},
|
||||
Volume = {7},
|
||||
Year = {2016}}
|
||||
|
||||
@article{Langmead:2012fk,
|
||||
Author = {Langmead, Ben and Salzberg, Steven L},
|
||||
Journal = {Nat Methods},
|
||||
Pages = {357-9},
|
||||
Title = {Fast gapped-read alignment with {Bowtie} 2},
|
||||
Volume = {9},
|
||||
Year = {2012}}
|
||||
|
||||
@article{Li:2016aa,
|
||||
Author = {Li, Heng},
|
||||
Journal = {Bioinformatics},
|
||||
Pages = {2103-10},
|
||||
Title = {Minimap and miniasm: fast mapping and de novo assembly for noisy long sequences},
|
||||
Volume = {32},
|
||||
Year = {2016}}
|
||||
|
||||
@misc{Suzuki:2016,
|
||||
title = {Fast and accurate alignment tool for PacBio and Nanopore long reads},
|
||||
author = {Hajime Suzuki},
|
||||
journal = {Unpublished},
|
||||
howpublished = {\href{https://github.com/ocxtal/minialign}{https://github.com/ocxtal/minialign}},
|
||||
year = {2016}}
|
||||
|
||||
@misc{Ruan:2016,
|
||||
title = {Ultra-fast de novo assembler using long noisy reads},
|
||||
author = {Jue Ruan},
|
||||
journal = {Unpulished},
|
||||
howpublished = {\href{https://github.com/ruanjue/smartdenovo}{https://github.com/ruanjue/smartdenovo}},
|
||||
year = {2016}}
|
||||
|
||||
@article{Miller:1988aa,
|
||||
Author = {Miller, W and Myers, E W},
|
||||
Journal = {Bull Math Biol},
|
||||
Number = {2},
|
||||
Pages = {97-120},
|
||||
Title = {Sequence comparison with concave weighting functions},
|
||||
Volume = {50},
|
||||
Year = {1988}}
|
||||
|
||||
@article{Gotoh:1990aa,
|
||||
Author = {Gotoh, O},
|
||||
Journal = {Bull Math Biol},
|
||||
Pages = {359-73},
|
||||
Title = {Optimal sequence alignment allowing for long gaps},
|
||||
Volume = {52},
|
||||
Year = {1990}}
|
||||
|
||||
@article{Wu:1996aa,
|
||||
Author = {Wu, Sun and others},
|
||||
Journal = {Algorithmica},
|
||||
Pages = {50-67},
|
||||
Title = {A subquadratic algorithm for approximate limited expression matching},
|
||||
Volume = {15},
|
||||
Year = {1996}}
|
||||
|
||||
@article{Daily:2016aa,
|
||||
Author = {Daily, Jeff},
|
||||
Journal = {BMC Bioinformatics},
|
||||
Month = {Feb},
|
||||
Pages = {81},
|
||||
Title = {Parasail: {SIMD C} library for global, semi-global, and local pairwise sequence alignments},
|
||||
Volume = {17},
|
||||
Year = {2016}}
|
||||
|
||||
@article{Sedlazeck169557,
|
||||
author = {Sedlazeck, Fritz J and others},
|
||||
title = {Accurate detection of complex structural variations using single molecule sequencing},
|
||||
note = {doi:10.1101/169557},
|
||||
journal = {bioRxiv},
|
||||
year = {2017}}
|
||||
|
||||
@article{Altschul:1997vn,
|
||||
Author = {Altschul, S F and others},
|
||||
Journal = {Nucleic Acids Res},
|
||||
Pages = {3389-402},
|
||||
Title = {Gapped {BLAST} and {PSI-BLAST}: a new generation of protein database search programs},
|
||||
Volume = {25},
|
||||
Year = {1997}}
|
||||
|
||||
@article{Sosic:2017aa,
|
||||
Author = {{\v S}o{\v s}i\'{c}, Martin and {\v S}ikic, Mile},
|
||||
Journal = {Bioinformatics},
|
||||
Pages = {1394-1395},
|
||||
Title = {Edlib: a {C/C++} library for fast, exact sequence alignment using edit distance},
|
||||
Volume = {33},
|
||||
Year = {2017}}
|
||||
|
||||
@article{Abouelhoda:2005aa,
|
||||
Author = {Mohamed Ibrahim Abouelhoda and Enno Ohlebusch},
|
||||
Journal = {J. Discrete Algorithms},
|
||||
Pages = {321-41},
|
||||
Title = {Chaining algorithms for multiple genome comparison},
|
||||
Volume = {3},
|
||||
Year = {2005}}
|
||||
|
||||
@article{Ono:2013aa,
|
||||
Author = {Ono, Yukiteru and others},
|
||||
Journal = {Bioinformatics},
|
||||
Pages = {119-21},
|
||||
Title = {{PBSIM}: {PacBio} reads simulator--toward accurate genome assembly},
|
||||
Volume = {29},
|
||||
Year = {2013}}
|
||||
|
||||
@article {Jain128835,
|
||||
author = {Jain, Miten and others},
|
||||
title = {Nanopore sequencing and assembly of a human genome with ultra-long reads},
|
||||
year = {2017},
|
||||
note = {doi:10.1101/128835},
|
||||
publisher = {Cold Spring Harbor Labs Journals},
|
||||
journal = {bioRxiv}}
|
||||
|
||||
@article{Lau:2016aa,
|
||||
Author = {Lau, Bayo and others},
|
||||
Journal = {Bioinformatics},
|
||||
Pages = {3829-3832},
|
||||
Title = {{LongISLND}: in silico sequencing of lengthy and noisy datatypes},
|
||||
Volume = {32},
|
||||
Year = {2016}}
|
||||
|
||||
@article{Robinson:2011aa,
|
||||
Author = {Robinson, James T and others},
|
||||
Journal = {Nat Biotechnol},
|
||||
Pages = {24-6},
|
||||
Title = {Integrative genomics viewer},
|
||||
Volume = {29},
|
||||
Year = {2011}}
|
||||
|
||||
@article {Suzuki130633,
|
||||
author = {Suzuki, Hajime and Kasahara, Masahiro},
|
||||
title = {Acceleration Of Nucleotide Semi-Global Alignment With Adaptive Banded Dynamic Programming},
|
||||
year = {2017},
|
||||
note = {doi:10.1101/130633},
|
||||
publisher = {Cold Spring Harbor Labs Journals},
|
||||
journal = {bioRxiv}}
|
||||
|
||||
@article{Gotoh:1982aa,
|
||||
Author = {Gotoh, O},
|
||||
Journal = {J Mol Biol},
|
||||
Pages = {705-8},
|
||||
Title = {An improved algorithm for matching biological sequences},
|
||||
Volume = {162},
|
||||
Year = {1982}}
|
||||
|
||||
@article{Altschul:1986aa,
|
||||
Author = {Altschul, S F and Erickson, B W},
|
||||
Journal = {Bull Math Biol},
|
||||
Pages = {603-16},
|
||||
Title = {Optimal sequence alignment using affine gap costs},
|
||||
Volume = {48},
|
||||
Year = {1986}}
|
||||
|
||||
@article{Wu:2005vn,
|
||||
Author = {Wu, Thomas D and Watanabe, Colin K},
|
||||
Journal = {Bioinformatics},
|
||||
Pages = {1859-75},
|
||||
Title = {{GMAP}: a genomic mapping and alignment program for {mRNA} and {EST} sequences},
|
||||
Volume = {21},
|
||||
Year = {2005}}
|
||||
|
||||
@article{Iwata:2012aa,
|
||||
Author = {Iwata, Hiroaki and Gotoh, Osamu},
|
||||
Journal = {Nucleic Acids Res},
|
||||
Pages = {e161},
|
||||
Title = {Benchmarking spliced alignment programs including {Spaln2}, an extended version of {Spaln} that incorporates additional species-specific features},
|
||||
Volume = {40},
|
||||
Year = {2012}}
|
||||
|
||||
@article{Dobin:2013kx,
|
||||
Author = {Dobin, Alexander and others},
|
||||
Journal = {Bioinformatics},
|
||||
Pages = {15-21},
|
||||
Title = {{STAR}: ultrafast universal {RNA-seq} aligner},
|
||||
Volume = {29},
|
||||
Year = {2013}}
|
||||
|
||||
@article{Byrne:2017aa,
|
||||
Author = {Byrne, Ashley and others},
|
||||
Journal = {Nat Commun},
|
||||
Pages = {16027},
|
||||
Title = {Nanopore long-read {RNAseq} reveals widespread transcriptional variation among the surface receptors of individual {B} cells},
|
||||
Volume = {8},
|
||||
Year = {2017}}
|
||||
|
||||
@article{Roberts:2004fv,
|
||||
Author = {Roberts, Michael and others},
|
||||
Journal = {Bioinformatics},
|
||||
Pages = {3363-9},
|
||||
Title = {Reducing storage requirements for biological sequence comparison},
|
||||
Volume = {20},
|
||||
Year = {2004}}
|
||||
|
||||
@article{Zhang:2006aa,
|
||||
Author = {Zhang, Miao and Gish, Warren},
|
||||
Journal = {Bioinformatics},
|
||||
Pages = {13-20},
|
||||
Title = {Improved spliced alignment from an information theoretic approach},
|
||||
Volume = {22},
|
||||
Year = {2006}}
|
||||
|
||||
@article{Li:2007aa,
|
||||
Author = {Li, Heng and others},
|
||||
Journal = {BMC Bioinformatics},
|
||||
Pages = {349},
|
||||
Title = {A cross-species alignment tool {(CAT)}},
|
||||
Volume = {8},
|
||||
Year = {2007}}
|
||||
|
||||
@article{Farrar:2007hs,
|
||||
Author = {Farrar, Michael},
|
||||
Journal = {Bioinformatics},
|
||||
Pages = {156-61},
|
||||
Title = {{Striped Smith-Waterman speeds database searches six times over other SIMD implementations}},
|
||||
Volume = {23},
|
||||
Year = {2007}}
|
||||
@@ -0,0 +1,509 @@
|
||||
\documentclass{bioinfo}
|
||||
\copyrightyear{2017}
|
||||
\pubyear{2017}
|
||||
|
||||
\usepackage{graphicx}
|
||||
\usepackage{hyperref}
|
||||
\usepackage{url}
|
||||
\usepackage{amsmath}
|
||||
\usepackage[ruled,vlined]{algorithm2e}
|
||||
\newcommand\mycommfont[1]{\footnotesize\rmfamily{\it #1}}
|
||||
\SetCommentSty{mycommfont}
|
||||
\SetKwComment{Comment}{$\triangleright$\ }{}
|
||||
|
||||
\usepackage{natbib}
|
||||
\bibliographystyle{apalike}
|
||||
\usepackage{hyperref}
|
||||
|
||||
\DeclareMathOperator*{\argmax}{argmax}
|
||||
|
||||
\begin{document}
|
||||
\firstpage{1}
|
||||
|
||||
\title[Aligning long nucleotide sequences with minimap2]{Minimap2: fast pairwise alignment for long nucleotide sequences}
|
||||
\author[Li]{Heng Li}
|
||||
\address{Broad Institute, 415 Main Street, Cambridge, MA 02142, USA}
|
||||
|
||||
\maketitle
|
||||
|
||||
\begin{abstract}
|
||||
\section{Summary:} Minimap2 is a general-purpose mapper to align long noisy DNA
|
||||
or mRNA sequences against a large reference database. It targets query
|
||||
sequences of 1kb--100Mb in length with per-base divergence typically below
|
||||
25\%. For DNA sequence reads, minimap2 is $\sim$30 times faster than many
|
||||
mainstream long-read aligners and achieves higher accuracy on simulated data.
|
||||
It also employs concave gap cost and rescues inversions for improved alignment
|
||||
around potential structural variations. For real long RNA-seq reads, minimap2
|
||||
is $\sim$40 times faster than peers and produces alignment more consistent with
|
||||
existing gene annotations.
|
||||
|
||||
\section{Availability and implementation:}
|
||||
\href{https://github.com/lh3/minimap2}{https://github.com/lh3/minimap2}
|
||||
|
||||
\section{Contact:} hengli@broadinstitute.org
|
||||
\end{abstract}
|
||||
|
||||
\section{Introduction}
|
||||
|
||||
Single Molecule Real-Time (SMRT) sequencing technology and Oxford Nanopore
|
||||
technologies (ONT) produce reads over 10kbp in length at an error rate
|
||||
$\sim$15\%. Several aligners have been developed for such
|
||||
data~\citep{Chaisson:2012aa,Li:2013aa,Liu:2016ab,Sovic:2016aa,Liu:2017aa,Lin:2017aa,Sedlazeck169557}.
|
||||
Most of them were five times as slow as mainstream short-read
|
||||
aligners~\citep{Langmead:2012fk,Li:2013aa} in terms of the number of bases
|
||||
mapped per second. We speculated there could be substantial room for speedup on
|
||||
the thought that 10kb long sequences should be easier to map than 100bp reads
|
||||
because we can more effectively skip repetitive regions, which are often the
|
||||
bottleneck of short-read alignment. We confirmed our speculation by achieving
|
||||
approximate mapping 50 times faster than BWA-MEM~\citep{Li:2016aa}.
|
||||
\citet{Suzuki:2016} extended our work with a fast and novel algorithm on
|
||||
generating base-level alignment, which in turn inspired us to develop minimap2
|
||||
towards higher accuracy and more practical functionality.
|
||||
|
||||
Both SMRT and ONT have been applied to sequence spliced mRNAs (RNA-seq). While
|
||||
traditional mRNA aligners work~\citep{Wu:2005vn,Iwata:2012aa}, they are not
|
||||
optimized for long noisy sequence reads and are tens of times slower than
|
||||
dedicated long-read aligners. When developing minimap2 initially for aligning
|
||||
genomic DNA only, we realized minor modifications could make it competitive for
|
||||
aligning mRNAs as well. Minimap2 is a first RNA-seq aligner specifically
|
||||
designed for long noisy reads.
|
||||
|
||||
\begin{methods}
|
||||
\section{Methods}
|
||||
|
||||
Minimap2 follows a typical seed-chain-align procedure as is used by most
|
||||
full-genome aligners. It collects minimizers~\citep{Roberts:2004fv} of the
|
||||
reference sequences and indexes them in a hash table. Then for each query
|
||||
sequence, minimap2 takes query minimizers as \emph{seeds}, finds matches to the
|
||||
reference, and identifies sets of colinear seeds, which are called
|
||||
\emph{chains}. If base-level alignment is requested, minimap2 applies dynamic
|
||||
programming (DP) to extend from the ends of chains and to close unseeded
|
||||
regions between adjacent seeds in chains.
|
||||
|
||||
Minimap2 uses indexing and seeding algorithms similar to
|
||||
minimap~\citep{Li:2016aa}, and furthers the predecessor with more accurate
|
||||
chaining, the ability to produce base-level alignment and the support of
|
||||
spliced alignment.
|
||||
|
||||
\subsection{Chaining}
|
||||
|
||||
\subsubsection{Chaining}
|
||||
An \emph{anchor} is a 3-tuple $(x,y,w)$, indicating interval $[x-w+1,x]$ on the
|
||||
reference matching interval $[y-w+1,y]$ on the query. Given a list of anchors
|
||||
sorted by ending reference position $x$, let $f(i)$ be the maximal chaining
|
||||
score up to the $i$-th anchor in the list. $f(i)$ can be calculated with
|
||||
dynamic programming:
|
||||
\begin{equation}\label{eq:chain}
|
||||
f(i)=\max\big\{\max_{i>j\ge 1} \{ f(j)+\alpha(j,i)-\beta(j,i) \},w_i\big\}
|
||||
\end{equation}
|
||||
where $\alpha(j,i)=\min\big\{\min\{y_i-y_j,x_i-x_j\},w_i\big\}$ is the number of
|
||||
matching bases between the two anchors. $\beta(j,i)>0$ is the gap cost. It
|
||||
equals $\infty$ if $y_j\ge y_i$ or $\max\{y_i-y_j,x_i-x_j\}>G$ (i.e. the
|
||||
distance between two anchors is too large); otherwise
|
||||
\begin{equation}\label{eq:chain-gap}
|
||||
\beta(j,i)=\gamma_c\big((y_i-y_j)-(x_i-x_j)\big)
|
||||
\end{equation}
|
||||
In implementation, a gap of length $l$ costs $\gamma_c(l)=0.01\cdot \bar{w}\cdot
|
||||
|l|+0.5\log_2|l|$, where $\bar{w}$ is the average seed length. For $m$ anchors, directly computing all $f(\cdot)$ with
|
||||
Eq.~(\ref{eq:chain}) takes $O(m^2)$ time. Although theoretically faster
|
||||
chaining algorithms exist~\citep{Abouelhoda:2005aa}, they
|
||||
are inapplicable to generic gap cost, complex to implement and usually
|
||||
associated with a large constant. We introduced a simple heuristic to
|
||||
accelerate chaining.
|
||||
|
||||
We note that if anchor $i$ is chained to $j$, chaining $i$ to a predecessor
|
||||
of $j$ is likely to yield a lower score. When evaluating Eq.~(\ref{eq:chain}),
|
||||
we start from anchor $i-1$ and stop the process if we cannot find a better
|
||||
score after up to $h$ iterations. This approach reduces the average time to
|
||||
$O(h\cdot m)$. In practice, we can almost always find the optimal chain with
|
||||
$h=50$; even if the heuristic fails, the optimal chain is often close.
|
||||
|
||||
\subsubsection{Backtracking}
|
||||
Let $P(i)$ be the index of the best predecessor of anchor $i$. It equals 0 if
|
||||
$f(i)=w_i$ or $\argmax_j\{f(j)+\eta(j,i)-\gamma(j,i)\}$ otherwise. For each
|
||||
anchor $i$ in the descending order of $f(i)$, we apply $P(\cdot)$ repeatedly to
|
||||
find its predecessor and mark each visited $i$ as `used', until $P(i)=0$ or we
|
||||
reach an already `used' $i$. This way we find all chains with no anchors used
|
||||
in more than one chains.
|
||||
|
||||
\subsubsection{Identifying primary chains}
|
||||
In the absence of copy number changes, each query segment should not be mapped
|
||||
to two places in the reference. However, chains found at the previous step may
|
||||
have significant or complete overlaps due to repeats in the reference.
|
||||
Minimap2 used the following procedure to identify \emph{primary chains} that do
|
||||
not greatly overlap on the query. Let $Q$ be an empty set initially. For each
|
||||
chain from the best to the worst according to their chaining scores: if on the
|
||||
query, the chain overlaps with a chain in $Q$ by 50\% or higher percentage of
|
||||
the shorter chain, mark the chain as secondary to the chain in $Q$; otherwise,
|
||||
add the chain to $Q$. In the end, $Q$ contains all the primary chains. We did
|
||||
not choose a more sophisticated data structure (e.g. range tree or k-d tree)
|
||||
because this step is not the performance bottleneck.
|
||||
|
||||
\subsection{Aligning genomic DNA}
|
||||
|
||||
\subsubsection{Alignment with 2-piece affine gap cost}
|
||||
|
||||
Minimap2 performs DP-based global alignment between adjacent anchors in a
|
||||
chain. It uses a 2-piece affine gap cost~\citep{Gotoh:1990aa}:
|
||||
\begin{equation}\label{eq:2-piece}
|
||||
\gamma_a(l)=\min\{q+|l|\cdot e,\tilde{q}+|l|\cdot\tilde{e}\}
|
||||
\end{equation}
|
||||
Without losing generality, we always assume $q+e<\tilde{q}+\tilde{e}$.
|
||||
On the condition that $e>\tilde{e}$, it applies cost $q+|l|\cdot e$ to gaps
|
||||
shorter than $\lceil(\tilde{q}-q)/(e-\tilde{e})\rceil$ and applies
|
||||
$\tilde{q}+|l|\cdot\tilde{e}$ to longer gaps. This scheme helps to recover
|
||||
longer insertions and deletions~(INDELs).
|
||||
|
||||
The equation to compute the optimal alignment under $\gamma_a(\cdot)$ is
|
||||
\begin{equation}\label{eq:ae86}
|
||||
\left\{\begin{array}{l}
|
||||
H_{ij} = \max\{H_{i-1,j-1}+s(i,j),E_{ij},F_{ij},\tilde{E}_{ij},\tilde{F}_{ij}\}\\
|
||||
E_{i+1,j}= \max\{H_{ij}-q,E_{ij}\}-e\\
|
||||
F_{i,j+1}= \max\{H_{ij}-q,F_{ij}\}-e\\
|
||||
\tilde{E}_{i+1,j}= \max\{H_{ij}-\tilde{q},\tilde{E}_{ij}\}-\tilde{e}\\
|
||||
\tilde{F}_{i,j+1}= \max\{H_{ij}-\tilde{q},\tilde{F}_{ij}\}-\tilde{e}
|
||||
\end{array}\right.
|
||||
\end{equation}
|
||||
where $s(i,j)$ is the score between the $i$-th reference base and $j$-th query
|
||||
base. Eq.~(\ref{eq:ae86}) is a natural extension to the equation under affine
|
||||
gap cost~\citep{Gotoh:1982aa,Altschul:1986aa}.
|
||||
|
||||
\subsubsection{Suzuki's formulation}
|
||||
|
||||
When we allow gaps longer than several hundred base pairs, nucleotide-level
|
||||
alignment is much slower than chaining. SSE acceleration is critical to the
|
||||
performance of minimap2. Traditional SSE implementations~\citep{Farrar:2007hs}
|
||||
based on Eq.~(\ref{eq:ae86}) can achieve 16-way parallelization for short
|
||||
sequences, but only 4-way parallelization when the peak alignment score reaches
|
||||
32767. Long sequence alignment may exceed this threshold. Inspired by
|
||||
\citet{Wu:1996aa} and the following work, \citet{Suzuki:2016} proposed a
|
||||
difference-based formulation that lifted this limitation.
|
||||
In case of 2-piece gap cost, define
|
||||
\[
|
||||
\left\{\begin{array}{ll}
|
||||
u_{ij}\triangleq H_{ij}-H_{i-1,j} & v_{ij}\triangleq H_{ij}-H_{i,j-1} \\
|
||||
x_{ij}\triangleq E_{i+1,j}-H_{ij} & \tilde{x}_{ij}\triangleq \tilde{E}_{i+1,j}-\tilde{H}_{ij} \\
|
||||
y_{ij}\triangleq F_{i,j+1}-H_{ij} & \tilde{y}_{ij}\triangleq \tilde{F}_{i,j+1}-\tilde{H}_{ij}
|
||||
\end{array}\right.
|
||||
\]
|
||||
We can transform Eq.~(\ref{eq:ae86}) to
|
||||
\begin{equation}\label{eq:suzuki}
|
||||
\left\{\begin{array}{lll}
|
||||
z_{ij}&=&\max\{s(i,j),x_{i-1,j}+v_{i-1,j},y_{i,j-1}+u_{i,j-1},\\
|
||||
&&\tilde{x}_{i-1,j}+v_{i-1,j},\tilde{y}_{i,j-1}+u_{i,j-1}\}\\
|
||||
u_{ij}&=&z_{ij}-v_{i-1,j}\\
|
||||
v_{ij}&=&z_{ij}-u_{i,j-1}\\
|
||||
x_{ij}&=&\max\{0,x_{i-1,j}+v_{i-1,j}-z_{ij}+q\}-q-e\\
|
||||
y_{ij}&=&\max\{0,y_{i,j-1}+u_{i,j-1}-z_{ij}+q\}-q-e\\
|
||||
\tilde{x}_{ij}&=&\max\{0,\tilde{x}_{i-1,j}+v_{i-1,j}-z_{ij}+\tilde{q}\}-\tilde{q}-\tilde{e}\\
|
||||
\tilde{y}_{ij}&=&\max\{0,\tilde{y}_{i,j-1}+u_{i,j-1}-z_{ij}+\tilde{q}\}-\tilde{q}-\tilde{e}
|
||||
\end{array}\right.
|
||||
\end{equation}
|
||||
where $z_{ij}$ is a temporary variable that does not need to be stored.
|
||||
|
||||
An important property of Eq.~(\ref{eq:suzuki}) is that all values are bounded
|
||||
by scoring parameters. To see that,
|
||||
\[
|
||||
x_{ij}=E_{i+1,j}-H_{ij}=\max\{-q,E_{ij}-H_{ij}\}-e
|
||||
\]
|
||||
With $E_{ij}\le H_{ij}$, we have
|
||||
\[
|
||||
-q-e\le x_{ij}\le\max\{-q,0\}-e=-e
|
||||
\]
|
||||
and similar inequations for $y_{ij}$, $\tilde{x}_{ij}$ and $\tilde{y}_{ij}$.
|
||||
In addition,
|
||||
\[
|
||||
u_{ij}=z_{ij}-v_{i-1,j}\ge\max\{x_{i-1,j},\tilde{x}_{i-1,j}\}\ge-q-e
|
||||
\]
|
||||
As the maximum value of $z_{ij}=H_{ij}-H_{i-1,j-1}$ is $M$, the maximal
|
||||
matching score, we can derive
|
||||
\[
|
||||
u_{ij}\le M-v_{i-1,j}\le M+q+e
|
||||
\]
|
||||
In conclusion, in Eq.~(\ref{eq:suzuki}), $x$ and $y$ are bounded by $[-q-e,-e]$,
|
||||
$\tilde{x}$ and $\tilde{y}$ by $[-\tilde{q}-\tilde{e},-\tilde{e}]$, and $u$ and
|
||||
$v$ by $[-q-e,M+q+e]$. When $-128\le-q-e<M+q+e\le127$, each of them can be stored as
|
||||
a 8-bit integer. This enables 16-way SSE vectorization regardless of the peak
|
||||
score of the alignment.
|
||||
|
||||
For a more efficient SSE implementation, we transform the row-column coordinate
|
||||
to the diagonal-antidiagonal coordinate by letting $r\gets i+j$ and $t\gets i$.
|
||||
Eq.~(\ref{eq:suzuki}) becomes:
|
||||
\begin{equation*}
|
||||
\left\{\begin{array}{lll}
|
||||
z_{rt}&=&\max\{s(t,r-t),x_{r-1,t-1}+v_{r-1,t-1},y_{r-1,t}\\
|
||||
&&+u_{r-1,t},\tilde{x}_{r-1,t-1}+v_{r-1,t-1},\tilde{y}_{r-1,t}+u_{r-1,t}\}\\
|
||||
u_{rt}&=&z_{rt}-v_{r-1,t-1}\\
|
||||
v_{rt}&=&z_{rt}-u_{r-1,t}\\
|
||||
x_{rt}&=&\max\{0,x_{r-1,t-1}+v_{r-1,t-1}-z_{rt}+q\}-q-e\\
|
||||
y_{rt}&=&\max\{0,y_{r-1,t}+u_{r-1,t}-z_{rt}+q\}-q-e\\
|
||||
\tilde{x}_{rt}&=&\max\{0,\tilde{x}_{r-1,t-1}+v_{r-1,t-1}-z_{rt}+\tilde{q}\}-\tilde{q}-\tilde{e}\\
|
||||
\tilde{y}_{rt}&=&\max\{0,\tilde{y}_{r-1,t}+u_{r-1,t}-z_{rt}+\tilde{q}\}-\tilde{q}-\tilde{e}
|
||||
\end{array}\right.
|
||||
\end{equation*}
|
||||
In this formulation, cells with the same diagonal index $r$ are independent of
|
||||
each other. This allows us to fully vectorize the computation of all cells on
|
||||
the same anti-diagonal in one inner loop. It also simplifies banded alignment,
|
||||
which would be difficult with striped vectorization~\citep{Farrar:2007hs}.
|
||||
|
||||
On the condition that $q+e<\tilde{q}+\tilde{e}$ and $e>\tilde{e}$, the initial
|
||||
values in the diagonal-antidiagonal formuation is
|
||||
\[
|
||||
\left\{\begin{array}{l}
|
||||
x_{r-1,-1}=y_{r-1,r}=-q-e\\
|
||||
\tilde{x}_{r-1,-1}=\tilde{y}_{r-1,r}=-\tilde{q}-\tilde{e}\\
|
||||
u_{r-1,r}=v_{r-1,-1}=\eta(r)\\
|
||||
\end{array}\right.
|
||||
\]
|
||||
where
|
||||
\[
|
||||
\eta(r)=\left\{\begin{array}{ll}
|
||||
-q-e & (r=0) \\
|
||||
-e & (r<\lceil\frac{\tilde{q}-q}{e-\tilde{e}}-1\rceil) \\
|
||||
r\cdot(e-\tilde{e})-(\tilde{q}-q)-\tilde{e} & (r=\lceil\frac{\tilde{q}-q}{e-\tilde{e}}-1\rceil) \\
|
||||
-\tilde{e} & (r>\lceil\frac{\tilde{q}-q}{e-\tilde{e}}-1\rceil)
|
||||
\end{array}\right.
|
||||
\]
|
||||
These can be derived from the initial values for Eq.~(\ref{eq:ae86}).
|
||||
|
||||
In practice, our 16-way vectorized implementation of global alignment is three
|
||||
times as fast as Parasail's 4-way vectorization~\citep{Daily:2016aa}. Without
|
||||
banding, our implementation is slower than Edlib~\citep{Sosic:2017aa}, but with
|
||||
a 1000bp band, it is considerably faster. When performing global alignment
|
||||
between anchors, we expect the alignment to stay close to the diagonal of the
|
||||
DP matrix. Banding is applicable most of time.
|
||||
|
||||
\subsubsection{The Z-drop heuristic}
|
||||
|
||||
With global alignment, minimap2 may force to align unrelated sequences between
|
||||
two adjacent anchors. To avoid such an artifact, we compute accumulative
|
||||
alignment score along the alignment path and break the alignment where the
|
||||
score drops too fast in the diagonal direction. More precisely, let $S(i,j)$ be
|
||||
the alignment score along the alignment path ending at cell $(i,j)$ in the DP
|
||||
matrix. We break the alignment if there exist $(i',j')$ and $(i,j)$, $i'<i$ and
|
||||
$j'<j$, such that
|
||||
\[
|
||||
S(i',j')-S(i,j)>Z+e\cdot|(i-i')-(j-j')|
|
||||
\]
|
||||
where $e$ is the gap extension cost and $Z$ is an arbitrary threshold.
|
||||
This strategy is first used in BWA-MEM. It is similar to X-drop employed in
|
||||
BLAST~\citep{Altschul:1997vn}, but unlike X-drop, it would not break the
|
||||
alignment in the presence of a single long gap.
|
||||
|
||||
When minimap2 breaks a global alignment between two anchors, it performs local
|
||||
alignment between the two subsequences involved in the global alignment, but
|
||||
this time with the one subsequence reverse complemented. This additional
|
||||
alignment step may identify short inversions that are missed during chaining.
|
||||
|
||||
\subsection{Aligning spliced sequences}
|
||||
|
||||
The algorithm described above can be adapted to spliced alignment. In this
|
||||
mode, the chaining gap cost distinguishes insertions to and deletions from the
|
||||
reference: $\gamma_c(l)$ in Eq.~(\ref{eq:chain-gap}) takes the form of
|
||||
\[
|
||||
\gamma_c(l)=\left\{\begin{array}{ll}
|
||||
0.01\cdot\bar{w}\cdot l+0.5\log_2 l & (l>0) \\
|
||||
\min\{0.01\cdot\bar{w}\cdot|l|,\log_2|l|\} & (l<0)
|
||||
\end{array}\right.
|
||||
\]
|
||||
Similarly, the gap cost function used for DP-based alignment is changed to
|
||||
\[
|
||||
\gamma_a(l)=\left\{\begin{array}{ll}
|
||||
q+l\cdot e & (l>0) \\
|
||||
\min\{q+|l|\cdot e,\tilde{q}\} & (l<0)
|
||||
\end{array}\right.
|
||||
\]
|
||||
In alignment, a deletion no shorter than $\lceil(\tilde{q}-q)/e\rceil$ is
|
||||
regarded as an intron, which pays no cost to gap extensions.
|
||||
|
||||
To pinpoint precise splicing junctions, minimap2 introduces reference-dependent
|
||||
cost to penalize non-canonical splicing:
|
||||
\begin{equation}\label{eq:splice}
|
||||
\left\{\begin{array}{l}
|
||||
H_{ij} = \max\{H_{i-1,j-1}+s(i,j),E_{ij},F_{ij},\tilde{E}_{ij}-a(i)\}\\
|
||||
E_{i+1,j}= \max\{H_{ij}-q,E_{ij}\}-e\\
|
||||
F_{i,j+1}= \max\{H_{ij}-q,F_{ij}\}-e\\
|
||||
\tilde{E}_{i+1,j}= \max\{H_{ij}-d(i)-\tilde{q},\tilde{E}_{ij}\}\\
|
||||
\end{array}\right.
|
||||
\end{equation}
|
||||
Let $T$ be the reference sequence. $d(i)$ is the cost of a non-canonical donor
|
||||
site, which takes 0 if $T[i+1,i+2]={\tt GT}$, or a positive number $p$
|
||||
otherwise. Similarly, $a(i)$ is the cost of a non-canonical acceptor site, which
|
||||
takes 0 if $T[i-1,i]={\tt AG}$, or $p$ otherwise. Eq.~(\ref{eq:splice}) is
|
||||
almost equivalent to the equation used by EXALIN~\citep{Zhang:2006aa} except
|
||||
that we allow insertions immediately followed by deletions and vice versa; in
|
||||
addition, we use Suzuki's diagonal formulation in actual implementation.
|
||||
|
||||
%Given that $d_i$ and $a_i$
|
||||
%are a function of the reference sequence, it is possible to incorporate
|
||||
%splicing signals with more sophisticated models, such as positional weight
|
||||
%matrices. We have not tried this approach.
|
||||
|
||||
If RNA-seq reads are not sequenced from stranded libraries, the read strand
|
||||
relative to the underlying transcript is unknown. By default, minimap2 aligns
|
||||
each chain twice, first assuming ${\tt GT}$--${\tt AG}$ as the splicing signal
|
||||
and then assuming ${\tt CT}$--${\tt AC}$, the reverse complement of ${\tt
|
||||
GT}$--${\tt AG}$, as the splicing signal. The alignment with a higher score is
|
||||
taken as the final alignment. This procedure also infers the relative strand of
|
||||
reads that span canonical splicing sites.
|
||||
|
||||
In the spliced alignment mode, minimap2 further increases the density of
|
||||
minimizers and disables banded alignment. Together with the two-round DP-based
|
||||
alignment, spliced alignment is several times slower than DNA sequence
|
||||
alignment.
|
||||
|
||||
\end{methods}
|
||||
|
||||
\section{Results}
|
||||
|
||||
\subsection{Aligning genomic reads}
|
||||
|
||||
\begin{figure}[!tb]
|
||||
\centering
|
||||
\includegraphics[width=.5\textwidth]{roc-color.pdf}
|
||||
\caption{Evaluation on simulated SMRT reads aligned against human genome
|
||||
GRCh38. 33,088 $\ge$1000bp reads were simulated using pbsim~\citep{Ono:2013aa}
|
||||
with error profile sampled from file `m131017\_060208\_42213\_*.1.*' downloaded
|
||||
at \href{http://bit.ly/chm1p5c3}{http://bit.ly/chm1p5c3}. The N50 read length
|
||||
is 11,628. A read is considered correctly mapped if the true position overlaps
|
||||
with the best mapping position by 10\% of the read length. All aligners were
|
||||
run under the default setting for SMRT reads. (a) ROC-like curve. Alignments
|
||||
are sorted by mapping quality in the descending order. For each mapping quality
|
||||
threshold, the fraction of alignments with mapping quality above the threshold
|
||||
and their error rate are plotted. Kart outputted all alignments at mapping
|
||||
quality 60, so is not shown in the figure. It mapped nearly all reads with
|
||||
4.1\% of alignments being wrong, less accurate than others. (b) Accumulative
|
||||
mapping error rate as a function of mapping quality.}\label{fig:eval}
|
||||
\end{figure}
|
||||
|
||||
As a sanity check, we evaluated minimap2 on simulated human reads along with
|
||||
BLASR~(v1.MC.rc64; \citealp{Chaisson:2012aa}),
|
||||
BWA-MEM~(v0.7.15; \citealp{Li:2013aa}),
|
||||
GraphMap~(v0.5.2; \citealp{Sovic:2016aa}),
|
||||
Kart~(v2.2.5; \citealp{Lin:2017aa}),
|
||||
minialign~(v0.5.3; \citealp{Suzuki:2016}) and
|
||||
NGMLR~(v0.2.5; \citealp{Sedlazeck169557}). We excluded rHAT~\citep{Liu:2016ab}
|
||||
and LAMSA~\citep{Liu:2017aa} because they either
|
||||
crashed or produced malformatted output. In this evaluation, minimap2 has
|
||||
higher power to distinguish unique and repetitive hits, and achieves overall
|
||||
higher mapping accuracy (Fig.~\ref{fig:eval}a). It is still the most accurate
|
||||
even if we skip DP-based alignment (data not shown), confirming chaining alone
|
||||
is sufficient to achieve high accuracy for approximate mapping. Minimap2 and
|
||||
NGMLR provide better mapping quality estimate: they rarely give repetitive hits
|
||||
high mapping quality (Fig.~\ref{fig:eval}b). Apparently, other aligners may
|
||||
occasionally miss close suboptimal hits and be overconfident in wrong mappings.
|
||||
On run time, minialign is slightly faster than minimap2 and Kart. They are over
|
||||
30 times faster than the rest. Minimap2 consumed 6.1GB memory at the peak,
|
||||
more than BWA-MEM but less than others.
|
||||
|
||||
On real human SMRT reads, the relative performance and sensitivity of
|
||||
these aligners are broadly similar to the metrics on simulated data. We are
|
||||
unable to provide a good estimate of mapping error rate due to the lack of the
|
||||
truth. On ONT $\sim$100kb human reads~\citep{Jain128835}, BWA-MEM failed.
|
||||
Kart, minialign and minimap2 are over 70 times faster than others. We have also
|
||||
examined tens of $\ge$100bp INDELs in IGV~\citep{Robinson:2011aa} and can
|
||||
confirm the observation by~\citet{Sedlazeck169557} that BWA-MEM often breaks
|
||||
them into shorter gaps. The issue is much alleviated with minimap2, thanks
|
||||
to the 2-piece affine gap cost.
|
||||
|
||||
\subsection{Aligning spliced reads}
|
||||
|
||||
We evaluated minimap2 on SIRV control data~(AC:SRR5286959;
|
||||
\citealp{Byrne:2017aa}) where the truth is known. Minimap2 predicted 59\,916
|
||||
introns from 11\,017 reads. 93.0\% of splice juctions are precise. We examined
|
||||
wrongly predicted junctions and found the majority were caused by clustered
|
||||
splicing signals (e.g. two adjacent ${\tt GT}$ sites). When INDEL sequencing
|
||||
errors are frequent, it is difficult to find precise splicing sites in this
|
||||
case. If we allow up to 10bp distance from true splicing sites, 98.4\% of
|
||||
aligned introns are approximately correct. Given this observation, we might be
|
||||
able to improve boundary detection by initializing $d(\cdot)$ and $a(\cdot)$ in
|
||||
Eq.~(\ref{eq:splice}) with position-specific scoring matrices or more
|
||||
sophisticated models. We have not tried this approach.
|
||||
|
||||
\begin{table}[!tb]
|
||||
\processtable{Evaluation of junction accuracy on 2D ONT reads}
|
||||
{\footnotesize\label{tab:intron}
|
||||
\begin{tabular}{p{3.1cm}rrrr}
|
||||
\toprule
|
||||
& GMAP & minimap2 & SpAln & STAR\\
|
||||
\midrule
|
||||
Run time (CPU min) & 631 & 15.5 & 2\,076 & 33.9 \\
|
||||
Peak RAM (GByte) & 8.9 & 14.5 & 3.2 & 29.2\vspace{1em}\\
|
||||
\# aligned reads & 103\,669 & 103\,917 & 103\,711 & 26\,479\\
|
||||
\# chimeric alignments & 1\,904 & 1\,671 & 0 & 0\\
|
||||
\# non-spliced alignments & 15\,854 & 14\,483 & 17\,033 & 10\,545\vspace{1em}\\
|
||||
\# aligned introns & 692\,275 & 694\,237 & 692\,945 & 78\,603 \\
|
||||
\# novel introns & 11\,239 & 3\,217 & 8\,550 & 1\,214 \\
|
||||
\% exact introns & 83.8\% & 91.8\% & 87.9\% & 55.2\% \\
|
||||
\% approx. introns & 91.8\% & 96.5\% & 92.5\% & 82.4\% \\
|
||||
\botrule
|
||||
\end{tabular}
|
||||
}{Mouse reads (AC:SRR5286960) were mapped to the primary assembly of mouse
|
||||
genome GRCm38 with the following tools and command options: minimap2 (`-ax
|
||||
splice'); GMAP (`-n 0 --min-intronlength 30 --cross-species'); SpAln (`-Q7 -LS
|
||||
-S3'); STARlong (according to
|
||||
\href{http://bit.ly/star-pb}{http://bit.ly/star-pb}). The alignments were
|
||||
compared to the EnsEMBL gene annotation, release 89. A predicted intron
|
||||
is \emph{novel} if it has no overlaps with any annotated introns. An intron
|
||||
is \emph{exact} if it is identical to an annotated intron. An intron is
|
||||
\emph{approximate} if both its 5'- and 3'-end are within 10bp around the ends
|
||||
of an annotated intron.}
|
||||
\end{table}
|
||||
|
||||
We next aligned real mouse reads~\citep{Byrne:2017aa} with GMAP~(v2017-06-20;
|
||||
\citealp{Wu:2005vn}), minimap2, SpAln~(v2.3.1; \citealp{Iwata:2012aa}) and
|
||||
STAR~(v2.5.3a; \citealp{Dobin:2013kx}). In general, minimap2 is more
|
||||
consistent with existing annotations (Table~\ref{tab:intron}): it finds
|
||||
more junctions with a higher percentage being exactly or approximately correct.
|
||||
Minimap2 is over 40 times faster than GMAP and SpAln. While STAR is close to
|
||||
minimap2 in speed, it does not work well with noisy reads. We have also
|
||||
evaluated spliced aligners on public Iso-Seq data (human Alzheimer brain
|
||||
from \href{http://bit.ly/isoseqpub}{http://bit.ly/isoseqpub}). The observation
|
||||
is similar: minimap2 is faster at higher junction accuracy.
|
||||
|
||||
We noted that GMAP and SpAln have not been optimized for noisy reads. We are
|
||||
showing the best setting we have experimented, but their developers should be
|
||||
able to improve their accuracy further.
|
||||
|
||||
%\begin{table}[!tb]
|
||||
%\processtable{Evaluation of junction accuracy on SMRT Iso-Seq reads}
|
||||
%{\footnotesize
|
||||
%\begin{tabular}{lrrrr}
|
||||
%\toprule
|
||||
%& GMAP & minimap2 & SpAln & STAR\\
|
||||
%\midrule
|
||||
%Run time (CPU min) & & 243 & 2\,352 & 1\,647 \\
|
||||
%\# aligned reads & & 1\,123\,025 & 1\,094\,092 & 682\,452\\
|
||||
%\# chimeric alignments & & 33\,091 & 0 & 0\\
|
||||
%\# non-spliced alignments & & 339\,081 & 291\,447 & 272\,536\vspace{1em}\\
|
||||
%\# aligned introns & & 9\,071\,755 & 9\,208\,564 & 3\,029\,121 \\
|
||||
%\# novel introns & & 42\,773 & 82\,230 & 17\,791 \\
|
||||
%\% exact introns & & 94.9\% & 91.7\% & 84.7\% \\
|
||||
%\% approx. introns&& 96.9\% & 93.4\% & 93.8\% \\
|
||||
%\botrule
|
||||
%\end{tabular}
|
||||
%}{}
|
||||
%\end{table}
|
||||
|
||||
|
||||
\section{Conclusion}
|
||||
|
||||
Minimap2 is a fast, accurate and versatile aligner for long nucleotide
|
||||
sequences. In addition to reference-based read mapping, minimap2 inherits
|
||||
minimap's functionality to search against huge multi-species databases and to
|
||||
find read overlaps. On a few test data sets, minimap2 appears to yield slightly
|
||||
better miniasm assembly~\citep{Li:2016aa}. Minimap2 can also align similar
|
||||
genomes or different assemblies of the same species. However, full-genome
|
||||
alignment is an intricate research topic. More thorough evaluations would be
|
||||
necessary to justify the use of minimap2 for such applications.
|
||||
|
||||
\section*{Acknowledgements}
|
||||
We owe a debt of gratitude to Hajime Suzuki for releasing his masterpiece and
|
||||
insightful notes before formal publication. We thank M. Schatz, P. Rescheneder
|
||||
and F. Sedlazeck for pointing out the limitation of BWA-MEM. We are also
|
||||
grateful to early minimap2 testers who have greatly helped to suggest features
|
||||
and to fix various issues.
|
||||
|
||||
\bibliography{minimap2}
|
||||
|
||||
\end{document}
|
||||
@@ -0,0 +1,30 @@
|
||||
Q 60 32066 0 0.000000000
|
||||
Q 40 32 1 0.000031155
|
||||
Q 38 19 1 0.000062272
|
||||
Q 36 11 1 0.000093376
|
||||
Q 35 32 1 0.000124378
|
||||
Q 33 15 1 0.000155400
|
||||
Q 32 58 1 0.000186145
|
||||
Q 27 11 1 0.000217095
|
||||
Q 26 80 1 0.000247494
|
||||
Q 21 19 2 0.000309186
|
||||
Q 20 16 1 0.000339936
|
||||
Q 19 19 1 0.000370622
|
||||
Q 18 22 2 0.000432099
|
||||
Q 17 37 5 0.000585751
|
||||
Q 15 24 2 0.000646930
|
||||
Q 14 18 3 0.000738939
|
||||
Q 13 30 6 0.000922821
|
||||
Q 12 18 1 0.000953054
|
||||
Q 11 29 2 0.001013638
|
||||
Q 10 30 1 0.001043393
|
||||
Q 9 20 5 0.001196099
|
||||
Q 8 25 8 0.001440348
|
||||
Q 7 28 6 0.001622830
|
||||
Q 6 35 12 0.001988132
|
||||
Q 5 34 12 0.002352725
|
||||
Q 4 29 8 0.002594865
|
||||
Q 3 36 14 0.003018937
|
||||
Q 2 46 15 0.003471482
|
||||
Q 1 69 36 0.004558162
|
||||
Q 0 167 94 0.007377173
|
||||
@@ -0,0 +1,17 @@
|
||||
Q 60 32072 0 0.000000000
|
||||
Q 43 206 1 0.000030981
|
||||
Q 27 201 1 0.000061578
|
||||
Q 15 59 1 0.000092200
|
||||
Q 12 25 1 0.000122839
|
||||
Q 11 16 1 0.000153473
|
||||
Q 10 24 1 0.000184032
|
||||
Q 9 17 2 0.000245248
|
||||
Q 8 27 3 0.000336938
|
||||
Q 7 23 1 0.000367309
|
||||
Q 6 20 1 0.000397675
|
||||
Q 5 18 4 0.000519751
|
||||
Q 4 17 1 0.000550038
|
||||
Q 3 29 5 0.000702204
|
||||
Q 2 32 4 0.000823522
|
||||
Q 1 54 6 0.001004872
|
||||
Q 0 234 106 0.004202697
|
||||
+1288
File diff suppressed because it is too large
Load Diff
+803
@@ -0,0 +1,803 @@
|
||||
%%
|
||||
%% This is file `natbib.sty',
|
||||
%% generated with the docstrip utility.
|
||||
%%
|
||||
%% The original source files were:
|
||||
%%
|
||||
%% natbib.dtx (with options: `package,all')
|
||||
%% =============================================
|
||||
%% IMPORTANT NOTICE:
|
||||
%%
|
||||
%% This program can be redistributed and/or modified under the terms
|
||||
%% of the LaTeX Project Public License Distributed from CTAN
|
||||
%% archives in directory macros/latex/base/lppl.txt; either
|
||||
%% version 1 of the License, or any later version.
|
||||
%%
|
||||
%% This is a generated file.
|
||||
%% It may not be distributed without the original source file natbib.dtx.
|
||||
%%
|
||||
%% Full documentation can be obtained by LaTeXing that original file.
|
||||
%% Only a few abbreviated comments remain here to describe the usage.
|
||||
%% =============================================
|
||||
%% Copyright 1993-2000 Patrick W Daly
|
||||
%% Max-Planck-Institut f\"ur Aeronomie
|
||||
%% Max-Planck-Str. 2
|
||||
%% D-37191 Katlenburg-Lindau
|
||||
%% Germany
|
||||
%% E-mail: daly@linmpi.mpg.de
|
||||
\NeedsTeXFormat{LaTeX2e}[1995/06/01]
|
||||
\ProvidesPackage{natbib}
|
||||
[2000/07/24 7.0a (PWD)]
|
||||
% This package reimplements the LaTeX \cite command to be used for various
|
||||
% citation styles, both author-year and numerical. It accepts BibTeX
|
||||
% output intended for many other packages, and therefore acts as a
|
||||
% general, all-purpose citation-style interface.
|
||||
%
|
||||
% With standard numerical .bst files, only numerical citations are
|
||||
% possible. With an author-year .bst file, both numerical and
|
||||
% author-year citations are possible.
|
||||
%
|
||||
% If author-year citations are selected, \bibitem must have one of the
|
||||
% following forms:
|
||||
% \bibitem[Jones et al.(1990)]{key}...
|
||||
% \bibitem[Jones et al.(1990)Jones, Baker, and Williams]{key}...
|
||||
% \bibitem[Jones et al., 1990]{key}...
|
||||
% \bibitem[\protect\citeauthoryear{Jones, Baker, and Williams}{Jones
|
||||
% et al.}{1990}]{key}...
|
||||
% \bibitem[\protect\citeauthoryear{Jones et al.}{1990}]{key}...
|
||||
% \bibitem[\protect\astroncite{Jones et al.}{1990}]{key}...
|
||||
% \bibitem[\protect\citename{Jones et al., }1990]{key}...
|
||||
% \harvarditem[Jones et al.]{Jones, Baker, and Williams}{1990}{key}...
|
||||
%
|
||||
% This is either to be made up manually, or to be generated by an
|
||||
% appropriate .bst file with BibTeX.
|
||||
% Author-year mode || Numerical mode
|
||||
% Then, \citet{key} ==>> Jones et al. (1990) || Jones et al. [21]
|
||||
% \citep{key} ==>> (Jones et al., 1990) || [21]
|
||||
% Multiple citations as normal:
|
||||
% \citep{key1,key2} ==>> (Jones et al., 1990; Smith, 1989) || [21,24]
|
||||
% or (Jones et al., 1990, 1991) || [21,24]
|
||||
% or (Jones et al., 1990a,b) || [21,24]
|
||||
% \cite{key} is the equivalent of \citet{key} in author-year mode
|
||||
% and of \citep{key} in numerical mode
|
||||
% Full author lists may be forced with \citet* or \citep*, e.g.
|
||||
% \citep*{key} ==>> (Jones, Baker, and Williams, 1990)
|
||||
% Optional notes as:
|
||||
% \citep[chap. 2]{key} ==>> (Jones et al., 1990, chap. 2)
|
||||
% \citep[e.g.,][]{key} ==>> (e.g., Jones et al., 1990)
|
||||
% \citep[see][pg. 34]{key}==>> (see Jones et al., 1990, pg. 34)
|
||||
% (Note: in standard LaTeX, only one note is allowed, after the ref.
|
||||
% Here, one note is like the standard, two make pre- and post-notes.)
|
||||
% \citealt{key} ==>> Jones et al. 1990
|
||||
% \citealt*{key} ==>> Jones, Baker, and Williams 1990
|
||||
% \citealp{key} ==>> Jones et al., 1990
|
||||
% \citealp*{key} ==>> Jones, Baker, and Williams, 1990
|
||||
% Additional citation possibilities (both author-year and numerical modes)
|
||||
% \citeauthor{key} ==>> Jones et al.
|
||||
% \citeauthor*{key} ==>> Jones, Baker, and Williams
|
||||
% \citeyear{key} ==>> 1990
|
||||
% \citeyearpar{key} ==>> (1990)
|
||||
% \citetext{priv. comm.} ==>> (priv. comm.)
|
||||
% Note: full author lists depends on whether the bib style supports them;
|
||||
% if not, the abbreviated list is printed even when full requested.
|
||||
%
|
||||
% For names like della Robbia at the start of a sentence, use
|
||||
% \Citet{dRob98} ==>> Della Robbia (1998)
|
||||
% \Citep{dRob98} ==>> (Della Robbia, 1998)
|
||||
% \Citeauthor{dRob98} ==>> Della Robbia
|
||||
%
|
||||
%
|
||||
% Citation aliasing is achieved with
|
||||
% \defcitealias{key}{text}
|
||||
% \citetalias{key} ==>> text
|
||||
% \citepalias{key} ==>> (text)
|
||||
%
|
||||
% Defining the citation style of a given bib style:
|
||||
% Use \bibpunct (in the preamble only) with 6 mandatory arguments:
|
||||
% 1. opening bracket for citation
|
||||
% 2. closing bracket
|
||||
% 3. citation separator (for multiple citations in one \cite)
|
||||
% 4. the letter n for numerical styles, s for superscripts
|
||||
% else anything for author-year
|
||||
% 5. punctuation between authors and date
|
||||
% 6. punctuation between years (or numbers) when common authors missing
|
||||
% One optional argument is the character coming before post-notes. It
|
||||
% appears in square braces before all other arguments. May be left off.
|
||||
% Example (and default) \bibpunct[, ]{(}{)}{;}{a}{,}{,}
|
||||
%
|
||||
% To make this automatic for a given bib style, named newbib, say, make
|
||||
% a local configuration file, natbib.cfg, with the definition
|
||||
% \newcommand{\bibstyle@newbib}{\bibpunct...}
|
||||
% Then the \bibliographystyle{newbib} will cause \bibstyle@newbib to
|
||||
% be called on THE NEXT LATEX RUN (via the aux file).
|
||||
%
|
||||
% Such preprogrammed definitions may be invoked in the text (preamble only)
|
||||
% by calling \citestyle{newbib}. This is only useful if the style specified
|
||||
% differs from that in \bibliographystyle.
|
||||
%
|
||||
% With \citeindextrue and \citeindexfalse, one can control whether the
|
||||
% \cite commands make an automatic entry of the citation in the .idx
|
||||
% indexing file. For this, \makeindex must also be given in the preamble.
|
||||
%
|
||||
% LaTeX2e Options: (for selecting punctuation)
|
||||
% round - round parentheses are used (default)
|
||||
% square - square brackets are used [option]
|
||||
% curly - curly braces are used {option}
|
||||
% angle - angle brackets are used <option>
|
||||
% colon - multiple citations separated by colon (default)
|
||||
% comma - separated by comma
|
||||
% authoryear - selects author-year citations (default)
|
||||
% numbers- selects numerical citations
|
||||
% super - numerical citations as superscripts
|
||||
% sort - sorts multiple citations according to order in ref. list
|
||||
% sort&compress - like sort, but also compresses numerical citations
|
||||
% longnamesfirst - makes first citation full author list
|
||||
% sectionbib - puts bibliography in a \section* instead of \chapter*
|
||||
% Punctuation so selected dominates over any predefined ones.
|
||||
% LaTeX2e options are called as, e.g.
|
||||
% \usepackage[square,comma]{natbib}
|
||||
% LaTeX the source file natbib.dtx to obtain more details
|
||||
% or the file natnotes.tex for a brief reference sheet.
|
||||
%-----------------------------------------------------------
|
||||
\@ifclassloaded{aguplus}{\PackageError{natbib}
|
||||
{The aguplus class already includes natbib coding,\MessageBreak
|
||||
so you should not add it explicitly}
|
||||
{Type <Return> for now, but then later remove\MessageBreak
|
||||
the command \protect\usepackage{natbib} from the document}
|
||||
\endinput}{}
|
||||
\@ifclassloaded{nlinproc}{\PackageError{natbib}
|
||||
{The nlinproc class already includes natbib coding,\MessageBreak
|
||||
so you should not add it explicitly}
|
||||
{Type <Return> for now, but then later remove\MessageBreak
|
||||
the command \protect\usepackage{natbib} from the document}
|
||||
\endinput}{}
|
||||
\@ifclassloaded{egs}{\PackageError{natbib}
|
||||
{The egs class already includes natbib coding,\MessageBreak
|
||||
so you should not add it explicitly}
|
||||
{Type <Return> for now, but then later remove\MessageBreak
|
||||
the command \protect\usepackage{natbib} from the document}
|
||||
\endinput}{}
|
||||
% Define citation punctuation for some author-year styles
|
||||
% One may add and delete at this point
|
||||
% Or put additions into local configuration file natbib.cfg
|
||||
\newcommand\bibstyle@chicago{\bibpunct{(}{)}{;}{a}{,}{,}}
|
||||
\newcommand\bibstyle@named{\bibpunct{[}{]}{;}{a}{,}{,}}
|
||||
\newcommand\bibstyle@agu{\bibpunct{[}{]}{;}{a}{,}{,~}}%Amer. Geophys. Union
|
||||
\newcommand\bibstyle@egs{\bibpunct{(}{)}{;}{a}{,}{,}}%Eur. Geophys. Soc.
|
||||
\newcommand\bibstyle@agsm{\bibpunct{(}{)}{,}{a}{}{,}\gdef\harvardand{\&}}
|
||||
\newcommand\bibstyle@kluwer{\bibpunct{(}{)}{,}{a}{}{,}\gdef\harvardand{\&}}
|
||||
\newcommand\bibstyle@dcu{\bibpunct{(}{)}{;}{a}{;}{,}\gdef\harvardand{and}}
|
||||
\newcommand\bibstyle@aa{\bibpunct{(}{)}{;}{a}{}{,}} %Astronomy & Astrophysics
|
||||
\newcommand\bibstyle@pass{\bibpunct{(}{)}{;}{a}{,}{,}}%Planet. & Space Sci
|
||||
\newcommand\bibstyle@anngeo{\bibpunct{(}{)}{;}{a}{,}{,}}%Annales Geophysicae
|
||||
\newcommand\bibstyle@nlinproc{\bibpunct{(}{)}{;}{a}{,}{,}}%Nonlin.Proc.Geophys.
|
||||
% Define citation punctuation for some numerical styles
|
||||
\newcommand\bibstyle@cospar{\bibpunct{/}{/}{,}{n}{}{}%
|
||||
\gdef\NAT@biblabelnum##1{##1.}}
|
||||
\newcommand\bibstyle@esa{\bibpunct{(Ref.~}{)}{,}{n}{}{}%
|
||||
\gdef\NAT@biblabelnum##1{##1.\hspace{1em}}}
|
||||
\newcommand\bibstyle@nature{\bibpunct{}{}{,}{s}{}{\textsuperscript{,}}%
|
||||
\gdef\NAT@biblabelnum##1{##1.}}
|
||||
% The standard LaTeX styles
|
||||
\newcommand\bibstyle@plain{\bibpunct{[}{]}{,}{n}{}{,}}
|
||||
\let\bibstyle@alpha=\bibstyle@plain
|
||||
\let\bibstyle@abbrv=\bibstyle@plain
|
||||
\let\bibstyle@unsrt=\bibstyle@plain
|
||||
% The author-year modifications of the standard styles
|
||||
\newcommand\bibstyle@plainnat{\bibpunct{[}{]}{,}{a}{,}{,}}
|
||||
\let\bibstyle@abbrvnat=\bibstyle@plainnat
|
||||
\let\bibstyle@unsrtnat=\bibstyle@plainnat
|
||||
\newif\ifNAT@numbers \NAT@numbersfalse
|
||||
\newif\ifNAT@super \NAT@superfalse
|
||||
\DeclareOption{numbers}{\NAT@numberstrue
|
||||
\ExecuteOptions{square,comma,nobibstyle}}
|
||||
\DeclareOption{super}{\NAT@supertrue\NAT@numberstrue
|
||||
\renewcommand\NAT@open{}\renewcommand\NAT@close{}
|
||||
\ExecuteOptions{nobibstyle}}
|
||||
\DeclareOption{authoryear}{\NAT@numbersfalse
|
||||
\ExecuteOptions{round,colon,bibstyle}}
|
||||
\DeclareOption{round}{%
|
||||
\renewcommand\NAT@open{(} \renewcommand\NAT@close{)}
|
||||
\ExecuteOptions{nobibstyle}}
|
||||
\DeclareOption{square}{%
|
||||
\renewcommand\NAT@open{[} \renewcommand\NAT@close{]}
|
||||
\ExecuteOptions{nobibstyle}}
|
||||
\DeclareOption{angle}{%
|
||||
\renewcommand\NAT@open{$<$} \renewcommand\NAT@close{$>$}
|
||||
\ExecuteOptions{nobibstyle}}
|
||||
\DeclareOption{curly}{%
|
||||
\renewcommand\NAT@open{\{} \renewcommand\NAT@close{\}}
|
||||
\ExecuteOptions{nobibstyle}}
|
||||
\DeclareOption{comma}{\renewcommand\NAT@sep{,}
|
||||
\ExecuteOptions{nobibstyle}}
|
||||
\DeclareOption{colon}{\renewcommand\NAT@sep{;}
|
||||
\ExecuteOptions{nobibstyle}}
|
||||
\DeclareOption{nobibstyle}{\let\bibstyle=\@gobble}
|
||||
\DeclareOption{bibstyle}{\let\bibstyle=\@citestyle}
|
||||
\newif\ifNAT@openbib \NAT@openbibfalse
|
||||
\DeclareOption{openbib}{\NAT@openbibtrue}
|
||||
\DeclareOption{sectionbib}{\def\NAT@sectionbib{on}}
|
||||
\def\NAT@sort{0}
|
||||
\DeclareOption{sort}{\def\NAT@sort{1}}
|
||||
\DeclareOption{sort&compress}{\def\NAT@sort{2}}
|
||||
\@ifpackageloaded{cite}{\PackageWarningNoLine{natbib}
|
||||
{The `cite' package should not be used\MessageBreak
|
||||
with natbib. Use option `sort' instead}\ExecuteOptions{sort}}{}
|
||||
\newif\ifNAT@longnames\NAT@longnamesfalse
|
||||
\DeclareOption{longnamesfirst}{\NAT@longnamestrue}
|
||||
\DeclareOption{nonamebreak}{\def\NAT@nmfmt#1{\mbox{\NAT@up#1}}}
|
||||
\def\NAT@nmfmt#1{{\NAT@up#1}}
|
||||
\renewcommand\bibstyle[1]{\@ifundefined{bibstyle@#1}{\relax}
|
||||
{\csname bibstyle@#1\endcsname}}
|
||||
\AtBeginDocument{\global\let\bibstyle=\@gobble}
|
||||
\let\@citestyle\bibstyle
|
||||
\newcommand\citestyle[1]{\@citestyle{#1}\let\bibstyle\@gobble}
|
||||
\@onlypreamble{\citestyle}\@onlypreamble{\@citestyle}
|
||||
\newcommand\bibpunct[7][, ]%
|
||||
{\gdef\NAT@open{#2}\gdef\NAT@close{#3}\gdef
|
||||
\NAT@sep{#4}\global\NAT@numbersfalse\ifx #5n\global\NAT@numberstrue
|
||||
\else
|
||||
\ifx #5s\global\NAT@numberstrue\global\NAT@supertrue
|
||||
\fi\fi
|
||||
\gdef\NAT@aysep{#6}\gdef\NAT@yrsep{#7}%
|
||||
\gdef\NAT@cmt{#1}%
|
||||
\global\let\bibstyle\@gobble
|
||||
}
|
||||
\@onlypreamble{\bibpunct}
|
||||
\newcommand\NAT@open{(} \newcommand\NAT@close{)}
|
||||
\newcommand\NAT@sep{;}
|
||||
\ProcessOptions
|
||||
\newcommand\NAT@aysep{,} \newcommand\NAT@yrsep{,}
|
||||
\newcommand\NAT@cmt{, }
|
||||
\newcommand\NAT@cite%
|
||||
[3]{\ifNAT@swa\NAT@@open\if*#2*\else#2\ \fi
|
||||
#1\if*#3*\else\NAT@cmt#3\fi\NAT@@close\else#1\fi\endgroup}
|
||||
\newcommand\NAT@citenum%
|
||||
[3]{\ifNAT@swa\NAT@@open\if*#2*\else#2\ \fi
|
||||
#1\if*#3*\else\NAT@cmt#3\fi\NAT@@close\else#1\fi\endgroup}
|
||||
\newcommand\NAT@citesuper[3]{\ifNAT@swa
|
||||
\unskip\hspace{1\p@}\textsuperscript{#1}%
|
||||
\if*#3*\else\ (#3)\fi\else #1\fi\endgroup}
|
||||
\providecommand
|
||||
\textsuperscript[1]{\mbox{$^{\mbox{\scriptsize#1}}$}}
|
||||
\providecommand\@firstofone[1]{#1}
|
||||
\newcommand\NAT@citexnum{}
|
||||
\def\NAT@citexnum[#1][#2]#3{%
|
||||
\NAT@sort@cites{#3}%
|
||||
\let\@citea\@empty
|
||||
\@cite{\def\NAT@num{-1}\let\NAT@last@yr\relax\let\NAT@nm\@empty
|
||||
\@for\@citeb:=\NAT@cite@list\do
|
||||
{\edef\@citeb{\expandafter\@firstofone\@citeb}%
|
||||
\if@filesw\immediate\write\@auxout{\string\citation{\@citeb}}\fi
|
||||
\@ifundefined{b@\@citeb\@extra@b@citeb}{%
|
||||
{\reset@font\bfseries?}
|
||||
\NAT@citeundefined\PackageWarning{natbib}%
|
||||
{Citation `\@citeb' on page \thepage \space undefined}}%
|
||||
{\let\NAT@last@num\NAT@num\let\NAT@last@nm\NAT@nm
|
||||
\NAT@parse{\@citeb}%
|
||||
\ifNAT@longnames\@ifundefined{bv@\@citeb\@extra@b@citeb}{%
|
||||
\let\NAT@name=\NAT@all@names
|
||||
\global\@namedef{bv@\@citeb\@extra@b@citeb}{}}{}%
|
||||
\fi
|
||||
\ifNAT@full\let\NAT@nm\NAT@all@names\else
|
||||
\let\NAT@nm\NAT@name\fi
|
||||
\ifNAT@swa
|
||||
\ifnum\NAT@ctype>1\relax\@citea
|
||||
\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
|
||||
\ifnum\NAT@ctype=2\relax\NAT@test{\NAT@ctype}%
|
||||
\else\NAT@alias
|
||||
\fi\hyper@natlinkend\else
|
||||
\ifnum\NAT@sort>1
|
||||
\begingroup\catcode`\_=8
|
||||
\ifcat _\ifnum\z@<0\NAT@num _\else A\fi
|
||||
\global\let\NAT@nm=\NAT@num \else \gdef\NAT@nm{-2}\fi
|
||||
\ifcat _\ifnum\z@<0\NAT@last@num _\else A\fi
|
||||
\global\@tempcnta=\NAT@last@num \global\advance\@tempcnta by\@ne
|
||||
\else \global\@tempcnta\m@ne\fi
|
||||
\endgroup
|
||||
\ifnum\NAT@nm=\@tempcnta
|
||||
\ifx\NAT@last@yr\relax
|
||||
\edef\NAT@last@yr{\@citea \mbox{\noexpand\citenumfont{\NAT@num}}}%
|
||||
\else
|
||||
\edef\NAT@last@yr{--\penalty\@m\mbox{\noexpand\citenumfont{\NAT@num}}}%
|
||||
\fi
|
||||
\else
|
||||
\NAT@last@yr \@citea \mbox{\citenumfont{\NAT@num}}%
|
||||
\let\NAT@last@yr\relax
|
||||
\fi
|
||||
\else
|
||||
\@citea \mbox{\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
|
||||
{\citenumfont{\NAT@num}}\hyper@natlinkend}%
|
||||
\fi
|
||||
\fi
|
||||
\def\@citea{\NAT@sep\penalty\@m\NAT@space}%
|
||||
\else
|
||||
\ifcase\NAT@ctype\relax
|
||||
\ifx\NAT@last@nm\NAT@nm \NAT@yrsep\penalty\@m\NAT@space\else
|
||||
\@citea \NAT@test{1}\ \NAT@@open
|
||||
\if*#1*\else#1\ \fi\fi \NAT@mbox{%
|
||||
\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
|
||||
{\citenumfont{\NAT@num}}\hyper@natlinkend}%
|
||||
\def\@citea{\NAT@@close\NAT@sep\penalty\@m\ }%
|
||||
\or\@citea
|
||||
\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
|
||||
\NAT@test{\NAT@ctype}\hyper@natlinkend
|
||||
\def\@citea{\NAT@sep\penalty\@m\ }%
|
||||
\or\@citea
|
||||
\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
|
||||
\NAT@test{\NAT@ctype}\hyper@natlinkend
|
||||
\def\@citea{\NAT@sep\penalty\@m\ }%
|
||||
\or\@citea
|
||||
\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
|
||||
\NAT@alias\hyper@natlinkend
|
||||
\def\@citea{\NAT@sep\penalty\@m\ }%
|
||||
\fi
|
||||
\fi
|
||||
}}%
|
||||
\ifnum\NAT@sort>1\relax\NAT@last@yr\fi
|
||||
\ifNAT@swa\else\ifnum\NAT@ctype=0\if*#2*\else
|
||||
\NAT@cmt#2\fi \NAT@@close\fi\fi}{#1}{#2}}
|
||||
\newcommand\NAT@test[1]{\ifnum#1=1 \ifx\NAT@nm\NAT@noname
|
||||
{\reset@font\bfseries(author?)}\PackageWarning{natbib}
|
||||
{Author undefined for citation`\@citeb'
|
||||
\MessageBreak
|
||||
on page \thepage}\else \NAT@nm \fi
|
||||
\else \if\relax\NAT@date\relax
|
||||
{\reset@font\bfseries(year?)}\PackageWarning{natbib}
|
||||
{Year undefined for citation`\@citeb'
|
||||
\MessageBreak
|
||||
on page \thepage}\else \NAT@date \fi \fi}
|
||||
\let\citenumfont=\relax
|
||||
\newcommand\NAT@citex{}
|
||||
\def\NAT@citex%
|
||||
[#1][#2]#3{%
|
||||
\NAT@sort@cites{#3}%
|
||||
\let\@citea\@empty
|
||||
\@cite{\let\NAT@nm\@empty\let\NAT@year\@empty
|
||||
\@for\@citeb:=\NAT@cite@list\do
|
||||
{\edef\@citeb{\expandafter\@firstofone\@citeb}%
|
||||
\if@filesw\immediate\write\@auxout{\string\citation{\@citeb}}\fi
|
||||
\@ifundefined{b@\@citeb\@extra@b@citeb}{\@citea%
|
||||
{\reset@font\bfseries ?}\NAT@citeundefined
|
||||
\PackageWarning{natbib}%
|
||||
{Citation `\@citeb' on page \thepage \space undefined}\def\NAT@date{}}%
|
||||
{\let\NAT@last@nm=\NAT@nm\let\NAT@last@yr=\NAT@year
|
||||
\NAT@parse{\@citeb}%
|
||||
\ifNAT@longnames\@ifundefined{bv@\@citeb\@extra@b@citeb}{%
|
||||
\let\NAT@name=\NAT@all@names
|
||||
\global\@namedef{bv@\@citeb\@extra@b@citeb}{}}{}%
|
||||
\fi
|
||||
\ifNAT@full\let\NAT@nm\NAT@all@names\else
|
||||
\let\NAT@nm\NAT@name\fi
|
||||
\ifNAT@swa\ifcase\NAT@ctype
|
||||
\if\relax\NAT@date\relax
|
||||
\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
|
||||
\NAT@nmfmt{\NAT@nm}\NAT@date\hyper@natlinkend
|
||||
\else
|
||||
\ifx\NAT@last@nm\NAT@nm\NAT@yrsep
|
||||
\ifx\NAT@last@yr\NAT@year
|
||||
\hyper@natlinkstart{\@citeb\@extra@b@citeb}\NAT@exlab
|
||||
\hyper@natlinkend
|
||||
\else\unskip\
|
||||
\hyper@natlinkstart{\@citeb\@extra@b@citeb}\NAT@date
|
||||
\hyper@natlinkend
|
||||
\fi
|
||||
\else\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
|
||||
\NAT@nmfmt{\NAT@nm}%
|
||||
\hyper@natlinkbreak{\NAT@aysep\ }{\@citeb\@extra@b@citeb}%
|
||||
\NAT@date\hyper@natlinkend
|
||||
\fi
|
||||
\fi
|
||||
\or\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
|
||||
\NAT@nmfmt{\NAT@nm}\hyper@natlinkend
|
||||
\or\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
|
||||
\NAT@date\hyper@natlinkend
|
||||
\or\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
|
||||
\NAT@alias\hyper@natlinkend
|
||||
\fi \def\@citea{\NAT@sep\ }%
|
||||
\else\ifcase\NAT@ctype
|
||||
\if\relax\NAT@date\relax
|
||||
\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
|
||||
\NAT@nmfmt{\NAT@nm}\hyper@natlinkend
|
||||
\else
|
||||
\ifx\NAT@last@nm\NAT@nm\NAT@yrsep
|
||||
\ifx\NAT@last@yr\NAT@year
|
||||
\hyper@natlinkstart{\@citeb\@extra@b@citeb}\NAT@exlab
|
||||
\hyper@natlinkend
|
||||
\else\unskip\
|
||||
\hyper@natlinkstart{\@citeb\@extra@b@citeb}\NAT@date
|
||||
\hyper@natlinkend
|
||||
\fi
|
||||
\else\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
|
||||
\NAT@nmfmt{\NAT@nm}%
|
||||
\hyper@natlinkbreak{\ \NAT@@open\if*#1*\else#1\ \fi}%
|
||||
{\@citeb\@extra@b@citeb}%
|
||||
\NAT@date\hyper@natlinkend\fi
|
||||
\fi
|
||||
\or\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
|
||||
\NAT@nmfmt{\NAT@nm}\hyper@natlinkend
|
||||
\or\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
|
||||
\NAT@date\hyper@natlinkend
|
||||
\or\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
|
||||
\NAT@alias\hyper@natlinkend
|
||||
\fi \if\relax\NAT@date\relax\def\@citea{\NAT@sep\ }%
|
||||
\else\def\@citea{\NAT@@close\NAT@sep\ }\fi
|
||||
\fi
|
||||
}}\ifNAT@swa\else\if*#2*\else\NAT@cmt#2\fi
|
||||
\if\relax\NAT@date\relax\else\NAT@@close\fi\fi}{#1}{#2}}
|
||||
\newif\ifNAT@par \NAT@partrue
|
||||
\newcommand\NAT@@open{\ifNAT@par\NAT@open\fi}
|
||||
\newcommand\NAT@@close{\ifNAT@par\NAT@close\fi}
|
||||
\newcommand\NAT@alias{\@ifundefined{al@\@citeb\@extra@b@citeb}{%
|
||||
{\reset@font\bfseries(alias?)}\PackageWarning{natbib}
|
||||
{Alias undefined for citation `\@citeb'
|
||||
\MessageBreak on page \thepage}}{\@nameuse{al@\@citeb\@extra@b@citeb}}}
|
||||
\let\NAT@up\relax
|
||||
\newcommand\NAT@Up[1]{{\let\protect\@unexpandable@protect\let~\relax
|
||||
\expandafter\NAT@deftemp#1}\expandafter\NAT@UP\NAT@temp}
|
||||
\newcommand\NAT@deftemp[1]{\xdef\NAT@temp{#1}}
|
||||
\newcommand\NAT@UP[1]{\let\@tempa\NAT@UP\ifcat a#1\MakeUppercase{#1}%
|
||||
\let\@tempa\relax\else#1\fi\@tempa}
|
||||
\newcommand\shortcites[1]{%
|
||||
\@bsphack\@for\@citeb:=#1\do
|
||||
{\edef\@citeb{\expandafter\@firstofone\@citeb}%
|
||||
\global\@namedef{bv@\@citeb\@extra@b@citeb}{}}\@esphack}
|
||||
\newcommand\NAT@biblabel[1]{\hfill}
|
||||
\newcommand\NAT@biblabelnum[1]{\bibnumfmt{#1}}
|
||||
\newcommand\bibnumfmt[1]{[#1]}
|
||||
\def\@tempa#1{[#1]}
|
||||
\ifx\@tempa\@biblabel\let\@biblabel\@empty\fi
|
||||
\newcommand\NAT@bibsetnum[1]{\settowidth\labelwidth{\@biblabel{#1}}%
|
||||
\setlength{\leftmargin}{\labelwidth}\addtolength{\leftmargin}{\labelsep}%
|
||||
\setlength{\itemsep}{\bibsep}\setlength{\parsep}{\z@}%
|
||||
\ifNAT@openbib
|
||||
\addtolength{\leftmargin}{4mm}%
|
||||
\setlength{\itemindent}{-4mm}%
|
||||
\setlength{\listparindent}{\itemindent}%
|
||||
\setlength{\parsep}{0pt}%
|
||||
\fi
|
||||
}
|
||||
\newlength{\bibhang}
|
||||
\setlength{\bibhang}{1em}
|
||||
\newlength{\bibsep}
|
||||
{\@listi \global\bibsep\itemsep \global\advance\bibsep by\parsep}
|
||||
|
||||
\newcommand\NAT@bibsetup%
|
||||
[1]{\setlength{\leftmargin}{\bibhang}\setlength{\itemindent}{-\leftmargin}%
|
||||
\setlength{\itemsep}{\bibsep}\setlength{\parsep}{\z@}}
|
||||
\newcommand\NAT@set@cites{\ifNAT@numbers
|
||||
\ifNAT@super \let\@cite\NAT@citesuper
|
||||
\def\NAT@mbox##1{\unskip\nobreak\hspace{1\p@}\textsuperscript{##1}}%
|
||||
\let\citeyearpar=\citeyear
|
||||
\let\NAT@space\relax\else
|
||||
\let\NAT@mbox=\mbox
|
||||
\let\@cite\NAT@citenum \def\NAT@space{ }\fi
|
||||
\let\@citex\NAT@citexnum
|
||||
\ifx\@biblabel\@empty\let\@biblabel\NAT@biblabelnum\fi
|
||||
\let\@bibsetup\NAT@bibsetnum
|
||||
\def\natexlab##1{}%
|
||||
\else
|
||||
\let\@cite\NAT@cite
|
||||
\let\@citex\NAT@citex
|
||||
\let\@biblabel\NAT@biblabel
|
||||
\let\@bibsetup\NAT@bibsetup
|
||||
\def\natexlab##1{##1}%
|
||||
\fi}
|
||||
\AtBeginDocument{\NAT@set@cites}
|
||||
\AtBeginDocument{\ifx\SK@def\@undefined\else
|
||||
\ifx\SK@cite\@empty\else
|
||||
\SK@def\@citex[#1][#2]#3{\SK@\SK@@ref{#3}\SK@@citex[#1][#2]{#3}}\fi
|
||||
\ifx\SK@citeauthor\@undefined\def\HAR@checkdef{}\else
|
||||
\let\citeauthor\SK@citeauthor
|
||||
\let\citefullauthor\SK@citefullauthor
|
||||
\let\citeyear\SK@citeyear\fi
|
||||
\fi}
|
||||
\AtBeginDocument{\@ifpackageloaded{hyperref}{%
|
||||
\ifnum\NAT@sort=2\def\NAT@sort{1}\fi}{}}
|
||||
\newif\ifNAT@full\NAT@fullfalse
|
||||
\newif\ifNAT@swa
|
||||
\DeclareRobustCommand\citet
|
||||
{\begingroup\NAT@swafalse\def\NAT@ctype{0}\NAT@partrue
|
||||
\@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
|
||||
\newcommand\NAT@citetp{\@ifnextchar[{\NAT@@citetp}{\NAT@@citetp[]}}
|
||||
\newcommand\NAT@@citetp{}
|
||||
\def\NAT@@citetp[#1]{\@ifnextchar[{\@citex[#1]}{\@citex[][#1]}}
|
||||
\DeclareRobustCommand\citep
|
||||
{\begingroup\NAT@swatrue\def\NAT@ctype{0}\NAT@partrue
|
||||
\@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
|
||||
\DeclareRobustCommand\cite
|
||||
{\begingroup\def\NAT@ctype{0}\NAT@partrue\NAT@swatrue
|
||||
\@ifstar{\NAT@fulltrue\NAT@cites}{\NAT@fullfalse\NAT@cites}}
|
||||
\newcommand\NAT@cites{\@ifnextchar [{\NAT@@citetp}{%
|
||||
\ifNAT@numbers\else
|
||||
\NAT@swafalse
|
||||
\fi
|
||||
\NAT@@citetp[]}}
|
||||
\DeclareRobustCommand\citealt
|
||||
{\begingroup\NAT@swafalse\def\NAT@ctype{0}\NAT@parfalse
|
||||
\@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
|
||||
\DeclareRobustCommand\citealp
|
||||
{\begingroup\NAT@swatrue\def\NAT@ctype{0}\NAT@parfalse
|
||||
\@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
|
||||
\DeclareRobustCommand\citeauthor
|
||||
{\begingroup\NAT@swafalse\def\NAT@ctype{1}\NAT@parfalse
|
||||
\@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
|
||||
\DeclareRobustCommand\Citet
|
||||
{\begingroup\NAT@swafalse\def\NAT@ctype{0}\NAT@partrue
|
||||
\let\NAT@up\NAT@Up
|
||||
\@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
|
||||
\DeclareRobustCommand\Citep
|
||||
{\begingroup\NAT@swatrue\def\NAT@ctype{0}\NAT@partrue
|
||||
\let\NAT@up\NAT@Up
|
||||
\@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
|
||||
\DeclareRobustCommand\Citealt
|
||||
{\begingroup\NAT@swafalse\def\NAT@ctype{0}\NAT@parfalse
|
||||
\let\NAT@up\NAT@Up
|
||||
\@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
|
||||
\DeclareRobustCommand\Citealp
|
||||
{\begingroup\NAT@swatrue\def\NAT@ctype{0}\NAT@parfalse
|
||||
\let\NAT@up\NAT@Up
|
||||
\@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
|
||||
\DeclareRobustCommand\Citeauthor
|
||||
{\begingroup\NAT@swafalse\def\NAT@ctype{1}\NAT@parfalse
|
||||
\let\NAT@up\NAT@Up
|
||||
\@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
|
||||
\DeclareRobustCommand\citeyear
|
||||
{\begingroup\NAT@swafalse\def\NAT@ctype{2}\NAT@parfalse\NAT@citetp}
|
||||
\DeclareRobustCommand\citeyearpar
|
||||
{\begingroup\NAT@swatrue\def\NAT@ctype{2}\NAT@partrue\NAT@citetp}
|
||||
\newcommand\citetext[1]{\NAT@open#1\NAT@close}
|
||||
\DeclareRobustCommand\citefullauthor
|
||||
{\citeauthor*}
|
||||
\newcommand\defcitealias[2]{%
|
||||
\@ifundefined{al@#1\@extra@b@citeb}{}
|
||||
{\PackageWarning{natbib}{Overwriting existing alias for citation #1}}
|
||||
\@namedef{al@#1\@extra@b@citeb}{#2}}
|
||||
\DeclareRobustCommand\citetalias{\begingroup
|
||||
\NAT@swafalse\def\NAT@ctype{3}\NAT@parfalse\NAT@citetp}
|
||||
\DeclareRobustCommand\citepalias{\begingroup
|
||||
\NAT@swatrue\def\NAT@ctype{3}\NAT@partrue\NAT@citetp}
|
||||
\renewcommand\nocite[1]{\@bsphack
|
||||
\@for\@citeb:=#1\do{%
|
||||
\edef\@citeb{\expandafter\@firstofone\@citeb}%
|
||||
\if@filesw\immediate\write\@auxout{\string\citation{\@citeb}}\fi
|
||||
\if*\@citeb\else
|
||||
\@ifundefined{b@\@citeb\@extra@b@citeb}{%
|
||||
\NAT@citeundefined \PackageWarning{natbib}%
|
||||
{Citation `\@citeb' undefined}}{}\fi}%
|
||||
\@esphack}
|
||||
\newcommand\NAT@parse[1]{{%
|
||||
\let\protect=\@unexpandable@protect\let~\relax
|
||||
\let\active@prefix=\@gobble
|
||||
\xdef\NAT@temp{\csname b@#1\@extra@b@citeb\endcsname}}%
|
||||
\expandafter\NAT@split\NAT@temp
|
||||
\expandafter\NAT@parse@date\NAT@date??????@@%
|
||||
\ifciteindex\NAT@index\fi
|
||||
}
|
||||
\newcommand\NAT@split[4]{%
|
||||
\gdef\NAT@num{#1}\gdef\NAT@name{#3}\gdef\NAT@date{#2}%
|
||||
\gdef\NAT@all@names{#4}%
|
||||
\ifx\NAT@noname\NAT@all@names \gdef\NAT@all@names{#3}\fi}
|
||||
\newcommand\NAT@parse@date{}
|
||||
\def\NAT@parse@date#1#2#3#4#5#6@@{%
|
||||
\ifnum\the\catcode`#1=11\def\NAT@year{}\def\NAT@exlab{#1}\else
|
||||
\ifnum\the\catcode`#2=11\def\NAT@year{#1}\def\NAT@exlab{#2}\else
|
||||
\ifnum\the\catcode`#3=11\def\NAT@year{#1#2}\def\NAT@exlab{#3}\else
|
||||
\ifnum\the\catcode`#4=11\def\NAT@year{#1#2#3}\def\NAT@exlab{#4}\else
|
||||
\def\NAT@year{#1#2#3#4}\def\NAT@exlab{{#5}}\fi\fi\fi\fi}
|
||||
\newcommand\NAT@index{}
|
||||
\let\NAT@makeindex=\makeindex
|
||||
\renewcommand\makeindex{\NAT@makeindex
|
||||
\renewcommand\NAT@index{\@bsphack\begingroup
|
||||
\def~{\string~}\@wrindex{\NAT@idxtxt}}}
|
||||
\newcommand\NAT@idxtxt{\NAT@name\ \NAT@open\NAT@date\NAT@close}
|
||||
\@ifundefined{@indexfile}{}{\let\NAT@makeindex\relax\makeindex}
|
||||
\newif\ifciteindex \citeindexfalse
|
||||
\newcommand\citeindextype{default}
|
||||
\newcommand\NAT@index@alt{{\let\protect=\noexpand\let~\relax
|
||||
\xdef\NAT@temp{\NAT@idxtxt}}\expandafter\NAT@exp\NAT@temp\@nil}
|
||||
\newcommand\NAT@exp{}
|
||||
\def\NAT@exp#1\@nil{\mbox{}\index[\citeindextype]{#1}}
|
||||
|
||||
\AtBeginDocument{%
|
||||
\@ifpackageloaded{index}{\let\NAT@index=\NAT@index@alt}{}}
|
||||
\newcommand\NAT@ifcmd{\futurelet\NAT@temp\NAT@ifxcmd}
|
||||
\newcommand\NAT@ifxcmd{\ifx\NAT@temp\relax\else\expandafter\NAT@bare\fi}
|
||||
\def\NAT@bare#1(#2)#3(@)#4\@nil#5{%
|
||||
\if @#2
|
||||
\expandafter\NAT@apalk#1, , \@nil{#5}\else
|
||||
\stepcounter{NAT@ctr}%
|
||||
\NAT@wrout{\arabic {NAT@ctr}}{#2}{#1}{#3}{#5}
|
||||
\fi
|
||||
}
|
||||
\newcommand\NAT@wrout[5]{%
|
||||
\if@filesw
|
||||
{\let\protect\noexpand\let~\relax
|
||||
\immediate
|
||||
\write\@auxout{\string\bibcite{#5}{{#1}{#2}{{#3}}{{#4}}}}}\fi
|
||||
\ignorespaces}
|
||||
\def\NAT@noname{{}}
|
||||
\renewcommand\bibitem{%
|
||||
\@ifnextchar[{\@lbibitem}{%
|
||||
\global\NAT@stdbsttrue
|
||||
\stepcounter{NAT@ctr}\@lbibitem[\arabic{NAT@ctr}]}}
|
||||
\def\@lbibitem[#1]#2{%
|
||||
\if\relax\@extra@b@citeb\relax\else
|
||||
\@ifundefined{br@#2\@extra@b@citeb}{}{%
|
||||
\@namedef{br@#2}{\@nameuse{br@#2\@extra@b@citeb}}}\fi
|
||||
\@ifundefined{b@#2\@extra@b@citeb}{\def\NAT@num{}}{\NAT@parse{#2}}%
|
||||
\item[\hfil\hyper@natanchorstart{#2\@extra@b@citeb}\@biblabel{\NAT@num}%
|
||||
\hyper@natanchorend]%
|
||||
\NAT@ifcmd#1(@)(@)\@nil{#2}}
|
||||
\ifx\SK@lbibitem\@undefined\else
|
||||
\let\SK@lbibitem\@lbibitem
|
||||
\def\@lbibitem[#1]#2{%
|
||||
\SK@lbibitem[#1]{#2}\SK@\SK@@label{#2}\ignorespaces}\fi
|
||||
\newif\ifNAT@stdbst \NAT@stdbstfalse
|
||||
|
||||
\AtEndDocument
|
||||
{\ifNAT@stdbst\if@filesw\immediate\write\@auxout{\string
|
||||
\global\string\NAT@numberstrue}\fi\fi
|
||||
}
|
||||
\providecommand\bibcite{}
|
||||
\renewcommand\bibcite[2]{\@ifundefined{b@#1\@extra@binfo}\relax
|
||||
{\NAT@citemultiple
|
||||
\PackageWarningNoLine{natbib}{Citation `#1' multiply defined}}%
|
||||
\global\@namedef{b@#1\@extra@binfo}{#2}}
|
||||
\AtEndDocument{\NAT@swatrue\let\bibcite\NAT@testdef}
|
||||
\newcommand\NAT@testdef[2]{%
|
||||
\def\NAT@temp{#2}\expandafter \ifx \csname b@#1\@extra@binfo\endcsname
|
||||
\NAT@temp \else \ifNAT@swa \NAT@swafalse
|
||||
\PackageWarningNoLine{natbib}{Citation(s) may have
|
||||
changed.\MessageBreak
|
||||
Rerun to get citations correct}\fi\fi}
|
||||
\newcommand\NAT@apalk{}
|
||||
\def\NAT@apalk#1, #2, #3\@nil#4{\if\relax#2\relax
|
||||
\global\NAT@stdbsttrue
|
||||
\NAT@wrout{#1}{}{}{}{#4}\else
|
||||
\stepcounter{NAT@ctr}%
|
||||
\NAT@wrout{\arabic {NAT@ctr}}{#2}{#1}{}{#4}\fi}
|
||||
\newcommand\citeauthoryear{}
|
||||
\def\citeauthoryear#1#2#3(@)(@)\@nil#4{\stepcounter{NAT@ctr}\if\relax#3\relax
|
||||
\NAT@wrout{\arabic {NAT@ctr}}{#2}{#1}{}{#4}\else
|
||||
\NAT@wrout{\arabic {NAT@ctr}}{#3}{#2}{#1}{#4}\fi}
|
||||
\newcommand\citestarts{\NAT@open}
|
||||
\newcommand\citeends{\NAT@close}
|
||||
\newcommand\betweenauthors{and}
|
||||
\newcommand\astroncite{}
|
||||
\def\astroncite#1#2(@)(@)\@nil#3{\stepcounter{NAT@ctr}\NAT@wrout{\arabic
|
||||
{NAT@ctr}}{#2}{#1}{}{#3}}
|
||||
\newcommand\citename{}
|
||||
\def\citename#1#2(@)(@)\@nil#3{\expandafter\NAT@apalk#1#2, \@nil{#3}}
|
||||
\newcommand\harvarditem[4][]%
|
||||
{\if\relax#1\relax\bibitem[#2(#3)]{#4}\else
|
||||
\bibitem[#1(#3)#2]{#4}\fi }
|
||||
\newcommand\harvardleft{\NAT@open}
|
||||
\newcommand\harvardright{\NAT@close}
|
||||
\newcommand\harvardyearleft{\NAT@open}
|
||||
\newcommand\harvardyearright{\NAT@close}
|
||||
\AtBeginDocument{\providecommand{\harvardand}{and}}
|
||||
\newcommand\harvardurl[1]{\textbf{URL:} \textit{#1}}
|
||||
\providecommand\bibsection{}
|
||||
\@ifundefined{chapter}%
|
||||
{\renewcommand\bibsection{\section*{\refname
|
||||
\@mkboth{\MakeUppercase{\refname}}{\MakeUppercase{\refname}}}}}
|
||||
{\@ifundefined{NAT@sectionbib}%
|
||||
{\renewcommand\bibsection{\chapter*{\bibname
|
||||
\@mkboth{\MakeUppercase{\bibname}}{\MakeUppercase{\bibname}}}}}
|
||||
{\renewcommand\bibsection{\section*{\bibname
|
||||
\ifx\@mkboth\@gobbletwo\else\markright{\MakeUppercase{\bibname}}\fi}}}}
|
||||
\@ifclassloaded{amsart}%
|
||||
{\renewcommand\bibsection{\section*{\refname}}}{}
|
||||
\@ifclassloaded{amsbook}%
|
||||
{\renewcommand\bibsection{\chapter*{\bibname}}}{}
|
||||
\@ifundefined{bib@heading}{}{\let\bibsection\bib@heading}
|
||||
\newcounter{NAT@ctr}
|
||||
\renewenvironment{thebibliography}[1]{%
|
||||
\bibsection
|
||||
\vspace{1\p@}\parindent \z@\bibpreamble\bibfont\list
|
||||
{\@biblabel{\arabic{NAT@ctr}}}{\@bibsetup{#1}%
|
||||
\setcounter{NAT@ctr}{0}}%
|
||||
\ifNAT@openbib
|
||||
\renewcommand\newblock{\par}
|
||||
\else
|
||||
\renewcommand\newblock{\hskip .11em \@plus.33em \@minus.07em}%
|
||||
\fi
|
||||
\sloppy\clubpenalty4000\widowpenalty4000
|
||||
\sfcode`\.=1000\relax
|
||||
\let\citeN\cite \let\shortcite\cite
|
||||
\let\citeasnoun\cite\fontsize{7}{9}\selectfont
|
||||
}{\def\@noitemerr{%
|
||||
\PackageWarning{natbib}
|
||||
{Empty `thebibliography' environment}}%
|
||||
\endlist\vskip-\lastskip}
|
||||
\let\bibfont\relax
|
||||
\let\bibpreamble\relax
|
||||
\providecommand\reset@font{\relax}
|
||||
\providecommand\bibname{Bibliography}
|
||||
\providecommand\refname{References}
|
||||
\newcommand\NAT@citeundefined{\gdef \NAT@undefined {%
|
||||
\PackageWarningNoLine{natbib}{There were undefined citations}}}
|
||||
\let \NAT@undefined \relax
|
||||
\newcommand\NAT@citemultiple{\gdef \NAT@multiple {%
|
||||
\PackageWarningNoLine{natbib}{There were multiply defined citations}}}
|
||||
\let \NAT@multiple \relax
|
||||
\AtEndDocument{\NAT@undefined\NAT@multiple}
|
||||
\providecommand\@mkboth[2]{}
|
||||
\providecommand\MakeUppercase{\uppercase}
|
||||
\providecommand{\@extra@b@citeb}{}
|
||||
\gdef\@extra@binfo{}
|
||||
\providecommand\hyper@natanchorstart[1]{}
|
||||
\providecommand\hyper@natanchorend{}
|
||||
\providecommand\hyper@natlinkstart[1]{}
|
||||
\providecommand\hyper@natlinkend{}
|
||||
\providecommand\hyper@natlinkbreak[2]{#1}
|
||||
\@ifundefined{bbl@redefine}{}{%
|
||||
\bbl@redefine\nocite#1{%
|
||||
\@safe@activestrue\org@nocite{#1}\@safe@activesfalse}%
|
||||
\bbl@redefine\@lbibitem[#1]#2{%
|
||||
\@safe@activestrue\org@@lbibitem[#1]{#2}\@safe@activesfalse}%
|
||||
}
|
||||
\AtBeginDocument{\@ifundefined{bbl@redefine}{}{%
|
||||
\bbl@redefine\@citex[#1][#2]#3{%
|
||||
\@safe@activestrue\org@@citex[#1][#2]{#3}\@safe@activesfalse}%
|
||||
\bbl@redefine\NAT@testdef#1#2{%
|
||||
\@safe@activestrue\org@NAT@testdef{#1}{#2}\@safe@activesfalse}%
|
||||
\@ifundefined{org@@lbibitem}{%
|
||||
\bbl@redefine\@lbibitem[#1]#2{%
|
||||
\@safe@activestrue\org@@lbibitem[#1]{#2}\@safe@activesfalse}}{}%
|
||||
}}
|
||||
\ifnum\NAT@sort>0
|
||||
\newcommand\NAT@sort@cites[1]{%
|
||||
\@tempcntb\m@ne
|
||||
\let\@celt\delimiter
|
||||
\def\NAT@num@list{}%
|
||||
\def\NAT@cite@list{}%
|
||||
\def\NAT@nonsort@list{}%
|
||||
\@for \@citeb:=#1\do{\NAT@make@cite@list}%
|
||||
\edef\NAT@cite@list{\NAT@cite@list\NAT@nonsort@list}%
|
||||
\edef\NAT@cite@list{\expandafter\NAT@xcom\NAT@cite@list @@}}
|
||||
\begingroup \catcode`\_=8
|
||||
\gdef\NAT@make@cite@list{%
|
||||
\edef\@citeb{\expandafter\@firstofone\@citeb}%
|
||||
\@ifundefined{b@\@citeb\@extra@b@citeb}{\def\NAT@num{A}}%
|
||||
{\NAT@parse{\@citeb}}%
|
||||
\ifcat _\ifnum\z@<0\NAT@num _\else A\fi
|
||||
\@tempcnta\NAT@num \relax
|
||||
\ifnum \@tempcnta>\@tempcntb
|
||||
\edef\NAT@num@list{\NAT@num@list \@celt{\NAT@num}}%
|
||||
\edef\NAT@cite@list{\NAT@cite@list\@citeb,}%
|
||||
\@tempcntb\@tempcnta
|
||||
\else
|
||||
\let\NAT@@cite@list=\NAT@cite@list \def\NAT@cite@list{}%
|
||||
\edef\NAT@num@list{\expandafter\NAT@num@celt \NAT@num@list \@gobble @}%
|
||||
{\let\@celt=\NAT@celt\NAT@num@list}%
|
||||
\fi
|
||||
\else
|
||||
\edef\NAT@nonsort@list{\NAT@nonsort@list\@citeb,}%
|
||||
\fi}
|
||||
\endgroup
|
||||
\def\NAT@celt#1{\ifnum #1<\@tempcnta
|
||||
\xdef\NAT@cite@list{\NAT@cite@list\expandafter\NAT@nextc\NAT@@cite@list @@}%
|
||||
\xdef\NAT@@cite@list{\expandafter\NAT@restc\NAT@@cite@list}%
|
||||
\else
|
||||
\xdef\NAT@cite@list{\NAT@cite@list\@citeb,\NAT@@cite@list}\let\@celt\@gobble%
|
||||
\fi}
|
||||
\def\NAT@num@celt#1#2{\ifx \@celt #1%
|
||||
\ifnum #2<\@tempcnta
|
||||
\@celt{#2}%
|
||||
\expandafter\expandafter\expandafter\NAT@num@celt
|
||||
\else
|
||||
\@celt{\number\@tempcnta}\@celt{#2}%
|
||||
\fi\fi}
|
||||
\def\NAT@nextc#1,#2@@{#1,}
|
||||
\def\NAT@restc#1,#2{#2}
|
||||
\def\NAT@xcom#1,@@{#1}
|
||||
\else
|
||||
\newcommand\NAT@sort@cites[1]{\edef\NAT@cite@list{#1}}\fi
|
||||
\InputIfFileExists{natbib.cfg}
|
||||
{\typeout{Local config file natbib.cfg used}}{}
|
||||
%%
|
||||
%% <<<<< End of generated file <<<<<<
|
||||
%%
|
||||
%% End of file `natbib.sty'.
|
||||
@@ -0,0 +1,38 @@
|
||||
Q 60 23616 0 0.000000000
|
||||
Q 45 3520 1 0.000036851
|
||||
Q 41 1840 1 0.000069023
|
||||
Q 37 328 2 0.000136500
|
||||
Q 36 276 1 0.000169033
|
||||
Q 35 480 1 0.000199601
|
||||
Q 33 375 2 0.000262855
|
||||
Q 31 178 2 0.000326659
|
||||
Q 30 153 5 0.000487551
|
||||
Q 29 200 1 0.000516696
|
||||
Q 27 100 3 0.000611601
|
||||
Q 26 93 3 0.000706056
|
||||
Q 25 75 2 0.000768393
|
||||
Q 24 82 1 0.000798314
|
||||
Q 23 80 6 0.000987387
|
||||
Q 22 71 6 0.001175835
|
||||
Q 21 76 7 0.001394921
|
||||
Q 20 63 9 0.001676897
|
||||
Q 19 55 4 0.001800322
|
||||
Q 18 62 8 0.002048987
|
||||
Q 17 55 7 0.002265718
|
||||
Q 16 60 10 0.002575539
|
||||
Q 15 82 9 0.002850877
|
||||
Q 14 67 7 0.003063745
|
||||
Q 13 62 11 0.003401042
|
||||
Q 12 64 13 0.003799084
|
||||
Q 11 56 5 0.003947900
|
||||
Q 10 58 17 0.004468303
|
||||
Q 9 70 22 0.005139796
|
||||
Q 8 23 9 0.005414604
|
||||
Q 7 41 17 0.005933068
|
||||
Q 6 42 18 0.006480881
|
||||
Q 5 33 9 0.006751757
|
||||
Q 4 29 9 0.007022948
|
||||
Q 3 27 15 0.007478764
|
||||
Q 2 23 10 0.007781024
|
||||
Q 1 9 2 0.007840364
|
||||
Q 0 13 8 0.008083105
|
||||
+52
@@ -0,0 +1,52 @@
|
||||
set t po eps enh co so "Helvetica,26"
|
||||
|
||||
set style line 1 lt 1 pt 1 lc rgb "#e41a1c" lw 2;
|
||||
set style line 2 lt 1 pt 2 lc rgb "#377eb8" lw 2;
|
||||
set style line 3 lt 1 pt 3 lc rgb "#4daf4a" lw 2;
|
||||
set style line 4 lt 1 pt 4 lc rgb "#984ea3" lw 2;
|
||||
set style line 5 lt 1 pt 6 lc rgb "#ff7f00" lw 2;
|
||||
set style line 6 lt 1 pt 8 lc rgb "#f781bf" lw 2;
|
||||
|
||||
set out "roc-color.eps"
|
||||
|
||||
set pointsize 2.0
|
||||
set size 1.59,1.04
|
||||
set multiplot layout 1,2
|
||||
|
||||
set label "(a)" at graph -0.245,1.06 font "Helvetica-bold,40"
|
||||
set xlab "Error rate of mapped reads"
|
||||
set ylab "Fraction of mapped reads" off +1.8
|
||||
set ytics 0.02
|
||||
set yran [0.9:1]
|
||||
|
||||
set size 0.8,1
|
||||
set log x
|
||||
set format x "10^{%L}"
|
||||
set key bot right
|
||||
plot "<./eval2roc.pl blasr-mc.eval" u 2:3 t "blasr-mc" w lp ls 4, \
|
||||
"<./eval2roc.pl bwa.eval" u 2:3 t "bwa-mem" w lp ls 2, \
|
||||
"<./eval2roc.pl graphmap.eval" u 2:3 t "graphmap" w lp ls 3, \
|
||||
"<./eval2roc.pl minialign.eval" u 2:3 t "minialign" w lp ls 1, \
|
||||
"<./eval2roc.pl mm2.eval" u 2:3 t "minimap2" w lp ls 6, \
|
||||
"<./eval2roc.pl ngmlr.eval" u 2:3 t "ngm-lr" w lp ls 5
|
||||
unset label
|
||||
|
||||
set origin 0.8,0
|
||||
set size 0.79,1
|
||||
set label "(b)" at graph -0.245,1.06 font "Helvetica-bold,40"
|
||||
unset log
|
||||
unset format
|
||||
unset key
|
||||
set log y
|
||||
set ylab "Accumulative mapping error rate" off +0
|
||||
set xlab "Mapping quality"
|
||||
set yran [1e-5:0.1]
|
||||
set ytics 1e-5,0.1
|
||||
set format y "10^{%L}"
|
||||
set xran [60:0] reverse
|
||||
plot "<./eval2roc.pl blasr-mc.eval" u 1:2 w lp ls 4, \
|
||||
"<./eval2roc.pl bwa.eval" u 1:2 t "bwa-mem" w lp ls 2, \
|
||||
"<./eval2roc.pl graphmap.eval" u 1:2 t "graphmap" w lp ls 3, \
|
||||
"<./eval2roc.pl minialign.eval" u 1:2 t "minialign" w lp ls 1, \
|
||||
"<./eval2roc.pl mm2.eval" u 1:2 t "minimap2" w lp ls 6, \
|
||||
"<./eval2roc.pl ngmlr.eval" u 1:2 t "ngm-lr" w lp ls 5
|
||||
Reference in New Issue
Block a user