Release minimap2-2.12 (r827)

Not sure if this is the right way. Apparently working.

.travis.yml

@@ -10,10 +10,6 @@ matrix:
       python: "2.7"
       before_install: pip install cython
       script: python setup.py build_ext
-    - language: python
-      python: "3.3"
-      before_install: pip install cython
-      script: python setup.py build_ext
     - language: python
       python: "3.5"
       before_install: pip install cython

MANIFEST.in

@@ -4,6 +4,7 @@ include ksw2_dispatch.c
 include getopt.c
 include main.c
 include README.md
+include sse2neon/emmintrin.h
 include python/mappy.c
 include python/cmappy.h
 include python/cmappy.pxd

Makefile

@@ -1,17 +1,28 @@
-CFLAGS=		-g -Wall -O2 -Wc++-compat
+CFLAGS=		-g -Wall -O2 -Wc++-compat #-Wextra
 CPPFLAGS=	-DHAVE_KALLOC
 INCLUDES=
-OBJS=		kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o index.o chain.o align.o hit.o map.o format.o pe.o esterr.o ksw2_ll_sse.o
+OBJS=		kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o options.o index.o chain.o align.o hit.o map.o format.o pe.o esterr.o splitidx.o ksw2_ll_sse.o
 PROG=		minimap2
 PROG_EXTRA=	sdust minimap2-lite
 LIBS=		-lm -lz -lpthread
 
-ifeq ($(sse2only),)
+ifeq ($(arm_neon),) # if arm_neon is not defined
+ifeq ($(sse2only),) # if sse2only is not defined
 	OBJS+=ksw2_extz2_sse41.o ksw2_extd2_sse41.o ksw2_exts2_sse41.o ksw2_extz2_sse2.o ksw2_extd2_sse2.o ksw2_exts2_sse2.o ksw2_dispatch.o
-else
+else                # if sse2only is defined
 	OBJS+=ksw2_extz2_sse.o ksw2_extd2_sse.o ksw2_exts2_sse.o
 endif
+else				# if arm_neon is defined
+	OBJS+=ksw2_extz2_neon.o ksw2_extd2_neon.o ksw2_exts2_neon.o
+    INCLUDES+=-Isse2neon
+ifeq ($(aarch64),)	#if aarch64 is not defined
+	CFLAGS+=-D_FILE_OFFSET_BITS=64 -mfpu=neon -fsigned-char
+else				#if aarch64 is defined
+	CFLAGS+=-D_FILE_OFFSET_BITS=64 -fsigned-char
+endif
+endif
 
+.PHONY:all extra clean depend
 .SUFFIXES:.c .o
 
 .c.o:
@@ -33,29 +44,49 @@ libminimap2.a:$(OBJS)
 sdust:sdust.c getopt.o kalloc.o kalloc.h kdq.h kvec.h kseq.h sdust.h
 		$(CC) -D_SDUST_MAIN $(CFLAGS) $< getopt.o kalloc.o -o $@ -lz
 
+# SSE-specific targets on x86/x86_64
+
+ifeq ($(arm_neon),)   # if arm_neon is defined, compile this target with the default setting (i.e. no -msse2)
+ksw2_ll_sse.o:ksw2_ll_sse.c ksw2.h kalloc.h
+		$(CC) -c $(CFLAGS) -msse2 $(CPPFLAGS) $(INCLUDES) $< -o $@
+endif
+
 ksw2_extz2_sse41.o:ksw2_extz2_sse.c ksw2.h kalloc.h
-		$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
+		$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
 
 ksw2_extz2_sse2.o:ksw2_extz2_sse.c ksw2.h kalloc.h
-		$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
+		$(CC) -c $(CFLAGS) -msse2 -mno-sse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
 
 ksw2_extd2_sse41.o:ksw2_extd2_sse.c ksw2.h kalloc.h
-		$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
+		$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
 
 ksw2_extd2_sse2.o:ksw2_extd2_sse.c ksw2.h kalloc.h
-		$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
+		$(CC) -c $(CFLAGS) -msse2 -mno-sse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
 
 ksw2_exts2_sse41.o:ksw2_exts2_sse.c ksw2.h kalloc.h
-		$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
+		$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
 
 ksw2_exts2_sse2.o:ksw2_exts2_sse.c ksw2.h kalloc.h
-		$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
+		$(CC) -c $(CFLAGS) -msse2 -mno-sse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
 
 ksw2_dispatch.o:ksw2_dispatch.c ksw2.h
-		$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
+		$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
+
+# NEON-specific targets on ARM
+
+ksw2_extz2_neon.o:ksw2_extz2_sse.c ksw2.h kalloc.h
+		$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_SSE2_ONLY -D__SSE2__ $(INCLUDES) $< -o $@
+
+ksw2_extd2_neon.o:ksw2_extd2_sse.c ksw2.h kalloc.h
+		$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_SSE2_ONLY -D__SSE2__ $(INCLUDES) $< -o $@
+
+ksw2_exts2_neon.o:ksw2_exts2_sse.c ksw2.h kalloc.h
+		$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_SSE2_ONLY -D__SSE2__ $(INCLUDES) $< -o $@
+
+# other non-file targets
 
 clean:
-		rm -fr gmon.out *.o a.out $(PROG) $(PROG_EXTRA) *~ *.a *.dSYM build dist mappy.so mappy.c python/mappy.c mappy.egg*
+		rm -fr gmon.out *.o a.out $(PROG) $(PROG_EXTRA) *~ *.a *.dSYM build dist mappy*.so mappy.c python/mappy.c mappy.egg*
 
 depend:
 		(LC_ALL=C; export LC_ALL; makedepend -Y -- $(CFLAGS) $(CPPFLAGS) -- *.c)
@@ -65,6 +96,7 @@ depend:
 align.o: minimap.h mmpriv.h bseq.h ksw2.h kalloc.h
 bseq.o: bseq.h kvec.h kalloc.h kseq.h
 chain.o: minimap.h mmpriv.h bseq.h kalloc.h
+esterr.o: mmpriv.h minimap.h bseq.h
 example.o: minimap.h kseq.h
 format.o: kalloc.h mmpriv.h minimap.h bseq.h
 getopt.o: getopt.h
@@ -75,9 +107,12 @@ ksw2_extd2_sse.o: ksw2.h kalloc.h
 ksw2_exts2_sse.o: ksw2.h kalloc.h
 ksw2_extz2_sse.o: ksw2.h kalloc.h
 ksw2_ll_sse.o: ksw2.h kalloc.h
+kthread.o: kthread.h
 main.o: bseq.h minimap.h mmpriv.h getopt.h
 map.o: kthread.h kvec.h kalloc.h sdust.h mmpriv.h minimap.h bseq.h khash.h
-misc.o: minimap.h ksort.h
+map.o: ksort.h
+misc.o: mmpriv.h minimap.h bseq.h ksort.h
+options.o: mmpriv.h minimap.h bseq.h
 pe.o: mmpriv.h minimap.h bseq.h kvec.h kalloc.h ksort.h
 sdust.o: kalloc.h kdq.h kvec.h sdust.h
-sketch.o: kvec.h kalloc.h minimap.h
+sketch.o: kvec.h kalloc.h mmpriv.h minimap.h bseq.h

NEWS.md

@@ -1,3 +1,206 @@
+Release 2.12-r827 (6 August 2018)
+---------------------------------
+
+Changes to minimap2:
+
+ * Added option --split-prefix to write proper alignments (correct mapping
+   quality and clustered query sequences) given a multi-part index (#141 and
+   #189; mostly by @hasindu2008).
+
+ * Fixed a memory leak when option -y is in use.
+
+Changes to mappy:
+
+ * Support the MD/cs tag (#183 and #203).
+
+ * Allow mappy to index a single sequence, to add extra flags and to change the
+   scoring system.
+
+Minimap2 should produce alignments identical to v2.11.
+
+(2.12: 6 August 2018, r827)
+
+
+
+Release 2.11-r797 (20 June 2018)
+--------------------------------
+
+Changes to minimap2:
+
+ * Improved alignment accuracy in low-complexity regions for SV calling. Thank
+   @armintoepfer for multiple offline examples.
+
+ * Added option --eqx to encode sequence match/mismatch with the =/X CIGAR
+   operators (#156, #157 and #175).
+
+ * When compiled with VC++, minimap2 generated wrong alignments due to a
+   comparison between a signed integer and an unsigned integer (#184). Also
+   fixed warnings reported by "clang -Wextra".
+
+ * Fixed incorrect anchor filtering due to a missing 64- to 32-bit cast.
+
+ * Fixed incorrect mapping quality for inversions (#148).
+
+ * Fixed incorrect alignment involving ambiguous bases (#155).
+
+ * Fixed incorrect presets: option `-r 2000` is intended to be used with
+   ava-ont, not ava-pb. The bug was introduced in 2.10.
+
+ * Fixed a bug when --for-only/--rev-only is used together with --sr or
+   --heap-sort=yes (#166).
+
+ * Fixed option -Y that was not working in the previous releases.
+
+ * Added option --lj-min-ratio to fine control the alignment of long gaps
+   found by the "long-join" heuristic (#128).
+
+ * Exposed `mm_idx_is_idx`, `mm_idx_load` and `mm_idx_dump` C APIs (#177).
+   Also fixed a bug when indexing without reference names (this feature is not
+   exposed to the command line).
+
+Changes to mappy:
+
+ * Added `__version__` (#165).
+
+ * Exposed the maximum fragment length parameter to mappy (#174).
+
+Changes to paftools:
+
+ * Don't crash when there is no "cg" tag (#153).
+
+ * Fixed wrong coverage report by "paftools.js call" (#145).
+
+This version may produce slightly different base-level alignment. The overall
+alignment statistics should remain similar.
+
+(2.11: 20 June 2018, r797)
+
+
+
+Release 2.10-r761 (27 March 2018)
+---------------------------------
+
+Changes to minimap2:
+
+ * Optionally output the MD tag for compatibility with existing tools (#63,
+   #118 and #137).
+
+ * Use SSE compiler flags more precisely to prevent compiling errors on certain
+   machines (#127).
+
+ * Added option --min-occ-floor to set a minimum occurrence threshold. Presets
+   intended for assembly-to-reference alignment set this option to 100. This
+   option alleviates issues with regions having high copy numbers (#107).
+
+ * Exit with non-zero code on file writing errors (e.g. disk full; #103 and
+   #132).
+
+ * Added option -y to copy FASTA/FASTQ comments in query sequences to the
+   output (#136).
+
+ * Added the asm20 preset for alignments between genomes at 5-10% sequence
+   divergence.
+
+ * Changed the band-width in the ava-ont preset from 500 to 2000. Oxford
+   Nanopore reads may contain long deletion sequencing errors that break
+   chaining.
+
+Changes to mappy, the Python binding:
+
+ * Fixed a typo in Align.seq() (#126).
+
+Changes to paftools.js, the companion script:
+
+ * Command sam2paf now converts the MD tag to cs.
+
+ * Support VCF output for assembly-to-reference variant calling (#109).
+
+This version should produce identical alignment for read overlapping, RNA-seq
+read mapping, and genomic read mapping. We have also added a cook book to show
+the variety uses of minimap2 on real datasets. Please see cookbook.md in the
+minimap2 source code directory.
+
+(2.10: 27 March 2017, r761)
+
+
+
+Release 2.9-r720 (23 February 2018)
+-----------------------------------
+
+This release fixed multiple minor bugs.
+
+* Fixed two bugs that lead to incorrect inversion alignment. Also improved the
+  sensitivity to small inversions by using double Z-drop cutoff (#112).
+
+* Fixed an issue that may cause the end of a query sequence unmapped (#104).
+
+* Added a mappy API to retrieve sequences from the index (#126) and to reverse
+  complement DNA sequences. Fixed a bug where the `best_n` parameter did not
+  work (#117).
+
+* Avoided segmentation fault given incorrect FASTQ input (#111).
+
+* Combined all auxiliary javascripts to paftools.js. Fixed several bugs in
+  these scripts at the same time.
+
+(2.9: 24 February 2018, r720)
+
+
+
+Release 2.8-r672 (1 February 2018)
+----------------------------------
+
+Notable changes in this release include:
+
+ * Speed up short-read alignment by ~10%. The overall mapping accuracy stays
+   the same, but the output alignments are not always identical to v2.7 due to
+   unstable sorting employed during chaining. Long-read alignment is not
+   affected by this change as the speedup is short-read specific.
+
+ * Mappy now supports paired-end short-read alignment (#87). Please see
+   python/README.rst for details.
+
+ * Added option --for-only and --rev-only to perform alignment against the
+   forward or the reverse strand of the reference genome only (#91).
+
+ * Alleviated the issue with undesired diagonal alignment in the self mapping
+   mode (#10). Even if the output is not ideal, it should not interfere with
+   other alignments. Fully resolving the issue is intricate and may require
+   additional heuristic thresholds.
+
+ * Enhanced error checking against incorrect input (#92 and #96).
+
+For long query sequences, minimap2 should output identical alignments to v2.7.
+
+(2.8: 1 February 2018, r672)
+
+
+
+Release 2.7-r654 (9 January 2018)
+---------------------------------
+
+This release fixed a bug in the splice mode and added a few minor features:
+
+ * Fixed a bug that occasionally takes an intron as a long deletion in the
+   splice mode. This was caused by wrong backtracking at the last CIGAR
+   operator. The current fix eliminates the error, but it is not optimal in
+   that it often produces a wrong junction when the last operator is an intron.
+   A future version of minimap2 may improve upon this.
+
+ * Support high-end ARM CPUs that implement the NEON instruction set (#81).
+   This enables minimap2 to work on Raspberry Pi 3 and Odroid XU4.
+
+ * Added a C API to construct a minimizer index from a set of C strings (#80).
+
+ * Check scoring specified on the command line (#79). Due to the 8-bit limit,
+   excessively large score penalties fail minimap2.
+
+For genomic sequences, minimap2 should give identical alignments to v2.6.
+
+(2.7: 9 January 2018, r654)
+
+
+
 Release 2.6-r623 (12 December 2017)
 -----------------------------------
 

README.md

@@ -15,8 +15,9 @@ cd minimap2 && make
 ./minimap2 -ax map-pb ref.fa pacbio.fq.gz > aln.sam       # PacBio genomic reads
 ./minimap2 -ax map-ont ref.fa ont.fq.gz > aln.sam         # Oxford Nanopore genomic reads
 ./minimap2 -ax sr ref.fa read1.fa read2.fa > aln.sam      # short genomic paired-end reads
-./minimap2 -ax splice ref.fa rna-reads.fa > aln.sam       # spliced long reads
+./minimap2 -ax splice ref.fa rna-reads.fa > aln.sam       # spliced long reads (strand unknown)
-./minimap2 -ax splice -k14 -uf ref.fa reads.fa > aln.sam  # Nanopore Direct RNA-seq
+./minimap2 -ax splice -uf -k14 ref.fa reads.fa > aln.sam  # noisy Nanopore Direct RNA-seq
+./minimap2 -ax splice -uf -C5 ref.fa query.fa > aln.sam   # Final PacBio Iso-seq or traditional cDNA
 ./minimap2 -cx asm5 asm1.fa asm2.fa > aln.paf             # intra-species asm-to-asm alignment
 ./minimap2 -x ava-pb reads.fa reads.fa > overlaps.paf     # PacBio read overlap
 ./minimap2 -x ava-ont reads.fa reads.fa > overlaps.paf    # Nanopore read overlap
@@ -38,7 +39,7 @@ man ./minimap2.1
   - [Advanced features](#advanced)
     - [Working with >65535 CIGAR operations](#long-cigar)
     - [The cs optional tag](#cs)
-    - [Evaluation scripts](#eval)
+    - [Working with the PAF format](#paftools)
   - [Algorithm overview](#algo)
   - [Getting help](#help)
   - [Citing minimap2](#cite)
@@ -61,22 +62,25 @@ mainstream long-read mappers such as BLASR, BWA-MEM, NGMLR and GMAP. It is more
 accurate on simulated long reads and produces biologically meaningful alignment
 ready for downstream analyses. For >100bp Illumina short reads, minimap2 is
 three times as fast as BWA-MEM and Bowtie2, and as accurate on simulated data.
-Detailed evaluations are available from the [minimap2 preprint][preprint].
+Detailed evaluations are available from the [minimap2 paper][doi] or the
+[preprint][preprint].
 
 ### <a name="install"></a>Installation
 
-Minimap2 only works on x86-64 CPUs. You can acquire precompiled binaries from
+Minimap2 is optimized for x86-64 CPUs. You can acquire precompiled binaries from
 the [release page][release] with:
 ```sh
-curl -L https://github.com/lh3/minimap2/releases/download/v2.6/minimap2-2.6_x64-linux.tar.bz2 \
+curl -L https://github.com/lh3/minimap2/releases/download/v2.12/minimap2-2.12_x64-linux.tar.bz2 | tar -jxvf -
-  | tar -jxvf -
+./minimap2-2.12_x64-linux/minimap2
-./minimap2-2.6_x64-linux/minimap2
 ```
 If you want to compile from the source, you need to have a C compiler, GNU make
 and zlib development files installed. Then type `make` in the source code
 directory to compile. If you see compilation errors, try `make sse2only=1`
 to disable SSE4 code, which will make minimap2 slightly slower.
 
+Minimap2 also works with ARM CPUs supporting the NEON instruction sets. To
+compile for 32 bit ARM architectures (such as ARMv7), use `make arm_neon=1`. To compile for for 64 bit ARM architectures (such as ARMv8), use `make arm_neon=1 aarch64=1`.
+
 ### <a name="general"></a>General usage
 
 Without any options, minimap2 takes a reference database and a query sequence
@@ -134,7 +138,7 @@ Nanopore reads.
 #### <a name="map-long-splice"></a>Map long mRNA/cDNA reads
 
 ```sh
-minimap2 -ax splice -uf ref.fa iso-seq.fq > aln.sam          # PacBio Iso-seq/traditional cDNA
+minimap2 -ax splice -uf -C5 ref.fa iso-seq.fq > aln.sam      # PacBio Iso-seq/traditional cDNA
 minimap2 -ax splice ref.fa nanopore-cdna.fa > aln.sam        # Nanopore 2D cDNA-seq
 minimap2 -ax splice -uf -k14 ref.fa direct-rna.fq > aln.sam  # Nanopore Direct RNA-seq
 minimap2 -ax splice --splice-flank=no SIRV.fa SIRV-seq.fa    # mapping against SIRV control
@@ -226,7 +230,7 @@ sorting) still work with such BAM records; tools that read CIGAR will
 effectively ignore these records. It has been decided that future tools will
 will seamlessly recognize long-cigar records generated by option `-L`.
 
-**TD;DR**: if you work with ultra-long reads and use tools that only process
+**TL;DR**: if you work with ultra-long reads and use tools that only process
 BAM files, please add option `-L`.
 
 #### <a name="cs"></a>The cs optional tag
@@ -251,28 +255,17 @@ similar to the `MD` SAM tag but is standalone and easier to parse.
 If `--cs=long` is used, the `cs` string also contains identical sequences in
 the alignment. The above example will become
 `=CGATCG-ata=AATAGAGTAG+gtc=GAAT*at=GCA`. The long form of `cs` encodes both
-reference and query sequences in one string.
+reference and query sequences in one string. The `cs` tag also encodes intron
+positions and splicing signals (see the [minimap2 manpage][manpage-cs] for
+details).
 
-#### <a name="eval"></a>Evaluation scripts
+#### <a name="paftools"></a>Working with the PAF format
 
-Minimap2 comes with several (java)scripts for evaluating the accuracy of
+Minimap2 also comes with a (java)script [paftools.js](misc/paftools.js) that
-minimap2. These scripts require the [k8][k8] javascript shell to run.
+processes alignments in the PAF format. It calls variants from
-Recent minimap2 binary release tar-balls contain a copy of k8 executable, a
+assembly-to-reference alignment, lifts over BED files based on alignment,
-single file. Here are a few examples on how to use these scripts:
+converts between formats and provides utilities for various evaluations. For
-
+details, please see [misc/README.md](misc/README.md).
-```sh
-# Generate reads from PBSIM alignment (truth encoded in read names)
-k8 misc/sim-pbsim.js ref.fa.fai pbsim-aln.maf > pbsim-reads.fq
-# Generate reads from mason2 alignment (not tested for simulated SVs)
-k8 misc/sim-mason2.js mason2-aln.sam > mason2-reads.fq
-# Evaluate mapping accuracy with ROC-like curve
-k8 misc/sim-eval.js my-aln.sam.gz > result.txt
-k8 misc/sim-eval.js my-aln.paf.gz > result.txt
-# Collect alignment statistics
-k8 misc/mapstat.js my-aln.sam > result.txt
-# Compare spliced junctions to existing gene annotations
-k8 misc/intron-eval.js anno.gtf my-spliced-aln.sam > result.txt
-```
 
 ### <a name="algo"></a>Algorithm overview
 
@@ -327,9 +320,10 @@ There is not a specific mailing list for the time being.
 
 ### <a name="cite"></a>Citing minimap2
 
-If you use minimap2 in your work, please consider to cite:
+If you use minimap2 in your work, please cite:
 
-> Li, H. (2017). Minimap2: fast pairwise alignment for long nucleotide sequences. [arXiv:1708.01492][preprint]
+> Li, H. (2018). Minimap2: pairwise alignment for nucleotide sequences.
+> Bioinformatics. [doi:10.1093/bioinformatics/bty191][doi]
 
 ## <a name="dguide"></a>Developers' Guide
 
@@ -352,12 +346,13 @@ mappy` or [from BioConda][mappyconda] via `conda install -c bioconda mappy`.
   regions where seed positions may be suboptimal. This should not be a big
   concern because even the optimal alignment may be wrong in such regions.
 
-* Minimap2 requires SSE2 instructions to compile. It is possible to add
+* Minimap2 requires SSE2 instructions on x86 CPUs or NEON on ARM CPUs. It is
-  non-SSE2 support, but it would make minimap2 slower by several times.
+  possible to add non-SIMD support, but it would make minimap2 slower by
+  several times.
 
-In general, minimap2 is a young project with most code written since June, 2017.
+* Minimap2 does not work with a single query or database sequence ~2
-It may have bugs and room for improvements. Bug reports and suggestions are
+  billion bases or longer (2,147,483,647 to be exact). The total length of all
-warmly welcomed.
+  sequences can well exceed this threshold.
 
 
 
@@ -375,3 +370,5 @@ warmly welcomed.
 [issue]: https://github.com/lh3/minimap2/issues
 [k8]: https://github.com/attractivechaos/k8
 [manpage]: https://lh3.github.io/minimap2/minimap2.html
+[manpage-cs]: https://lh3.github.io/minimap2/minimap2.html#10
+[doi]: https://doi.org/10.1093/bioinformatics/bty191

align.c

@@ -6,18 +6,19 @@
 #include "mmpriv.h"
 #include "ksw2.h"
 
-static void ksw_gen_simple_mat(int m, int8_t *mat, int8_t a, int8_t b)
+static void ksw_gen_simple_mat(int m, int8_t *mat, int8_t a, int8_t b, int8_t sc_ambi)
 {
 	int i, j;
 	a = a < 0? -a : a;
 	b = b > 0? -b : b;
+	sc_ambi = sc_ambi > 0? -sc_ambi : sc_ambi;
 	for (i = 0; i < m - 1; ++i) {
 		for (j = 0; j < m - 1; ++j)
 			mat[i * m + j] = i == j? a : b;
-		mat[i * m + m - 1] = 0;
+		mat[i * m + m - 1] = sc_ambi;
 	}
 	for (j = 0; j < m; ++j)
-		mat[(m - 1) * m + j] = 0;
+		mat[(m - 1) * m + j] = sc_ambi;
 }
 
 static inline void mm_seq_rev(uint32_t len, uint8_t *seq)
@@ -28,45 +29,70 @@ static inline void mm_seq_rev(uint32_t len, uint8_t *seq)
 		t = seq[i], seq[i] = seq[len - 1 - i], seq[len - 1 - i] = t;
 }
 
-static inline int test_zdrop_aux(int32_t score, int i, int j, int32_t *max, int *max_i, int *max_j, int e, int zdrop)
+static inline void update_max_zdrop(int32_t score, int i, int j, int32_t *max, int *max_i, int *max_j, int e, int *max_zdrop, int pos[2][2])
 {
 	if (score < *max) {
 		int li = i - *max_i;
 		int lj = j - *max_j;
 		int diff = li > lj? li - lj : lj - li;
-		if (*max - score > zdrop + diff * e)
+		int z = *max - score - diff * e;
-			return 1;
+		if (z > *max_zdrop) {
+			*max_zdrop = z;
+			pos[0][0] = *max_i, pos[0][1] = i + 1;
+			pos[1][0] = *max_j, pos[1][1] = j + 1;
+		}
 	} else *max = score, *max_i = i, *max_j = j;
-	return 0;
 }
 
-static int mm_check_zdrop(const uint8_t *qseq, const uint8_t *tseq, uint32_t n_cigar, uint32_t *cigar, const int8_t *mat, int8_t q, int8_t e, int zdrop)
+static int mm_test_zdrop(void *km, const mm_mapopt_t *opt, const uint8_t *qseq, const uint8_t *tseq, uint32_t n_cigar, uint32_t *cigar, const int8_t *mat)
 {
 	uint32_t k;
-	int32_t score = 0, max = 0, max_i = -1, max_j = -1, i = 0, j = 0;
+	int32_t score = 0, max = INT32_MIN, max_i = -1, max_j = -1, i = 0, j = 0, max_zdrop = 0;
-	for (k = 0; k < n_cigar; ++k) {
+	int pos[2][2] = {{-1, -1}, {-1, -1}}, q_len, t_len;
+
+	// find the score and the region where score drops most along diagonal
+	for (k = 0, score = 0; k < n_cigar; ++k) {
 		uint32_t l, op = cigar[k]&0xf, len = cigar[k]>>4;
 		if (op == 0) {
 			for (l = 0; l < len; ++l) {
 				score += mat[tseq[i + l] * 5 + qseq[j + l]];
-				if (test_zdrop_aux(score, i+l, j+l, &max, &max_i, &max_j, e, zdrop)) return 1;
+				update_max_zdrop(score, i+l, j+l, &max, &max_i, &max_j, opt->e, &max_zdrop, pos);
 			}
 			i += len, j += len;
-		} else if (op == 1) {
+		} else if (op == 1 || op == 2 || op == 3) {
-			score -= q + e * len, j += len;
+			score -= opt->q + opt->e * len;
-			if (test_zdrop_aux(score, i, j, &max, &max_i, &max_j, e, zdrop)) return 1;
+			if (op == 1) j += len; // insertion
-		} else if (op == 2 || op == 3) {
+			else i += len;         // deletion
-			score -= q + e * len, i += len;
+			update_max_zdrop(score, i, j, &max, &max_i, &max_j, opt->e, &max_zdrop, pos);
-			if (test_zdrop_aux(score, i, j, &max, &max_i, &max_j, e, zdrop)) return 1;
 		}
 	}
-	return 0;
+
+	// test if there is an inversion in the most dropped region
+	q_len = pos[1][1] - pos[1][0], t_len = pos[0][1] - pos[0][0];
+	if (!(opt->flag&(MM_F_SPLICE|MM_F_SR|MM_F_FOR_ONLY|MM_F_REV_ONLY)) && max_zdrop > opt->zdrop_inv && q_len < opt->max_gap && t_len < opt->max_gap) {
+		uint8_t *qseq2;
+		void *qp;
+		int q_off, t_off;
+		qseq2 = (uint8_t*)kmalloc(km, q_len);
+		for (i = 0; i < q_len; ++i) {
+			int c = qseq[pos[1][1] - i - 1];
+			qseq2[i] = c >= 4? 4 : 3 - c;
+		}
+		qp = ksw_ll_qinit(km, 2, q_len, qseq2, 5, mat);
+		score = ksw_ll_i16(qp, t_len, tseq + pos[0][0], opt->q, opt->e, &q_off, &t_off);
+		kfree(km, qseq2);
+		kfree(km, qp);
+		if (score >= opt->min_chain_score * opt->a && score >= opt->min_dp_max)
+			return 2; // there is a potential inversion
+	}
+	return max_zdrop > opt->zdrop? 1 : 0;
 }
 
 static void mm_fix_cigar(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq, int *qshift, int *tshift)
 {
 	mm_extra_t *p = r->p;
-	int32_t k, toff = 0, qoff = 0, to_shrink = 0;
+	int32_t toff = 0, qoff = 0, to_shrink = 0;
+	uint32_t k;
 	*qshift = *tshift = 0;
 	if (p->n_cigar <= 1) return;
 	for (k = 0; k < p->n_cigar; ++k) { // indel left alignment
@@ -123,8 +149,8 @@ static void mm_fix_cigar(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq,
 
 static void mm_update_extra(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq, const int8_t *mat, int8_t q, int8_t e)
 {
-	uint32_t k, l, toff = 0, qoff = 0;
+	uint32_t k, l;
-	int32_t s = 0, max = 0, qshift, tshift;
+	int32_t s = 0, max = 0, qshift, tshift, toff = 0, qoff = 0;
 	mm_extra_t *p = r->p;
 	if (p == 0) return;
 	mm_fix_cigar(r, qseq, tseq, &qshift, &tshift);
@@ -173,12 +199,12 @@ static void mm_append_cigar(mm_reg1_t *r, uint32_t n_cigar, uint32_t *cigar) //
 	mm_extra_t *p;
 	if (n_cigar == 0) return;
 	if (r->p == 0) {
-		uint32_t capacity = n_cigar + sizeof(mm_extra_t);
+		uint32_t capacity = n_cigar + sizeof(mm_extra_t)/4;
 		kroundup32(capacity);
 		r->p = (mm_extra_t*)calloc(capacity, 4);
 		r->p->capacity = capacity;
-	} else if (r->p->n_cigar + n_cigar + sizeof(mm_extra_t) > r->p->capacity) {
+	} else if (r->p->n_cigar + n_cigar + sizeof(mm_extra_t)/4 > r->p->capacity) {
-		r->p->capacity = r->p->n_cigar + n_cigar + sizeof(mm_extra_t);
+		r->p->capacity = r->p->n_cigar + n_cigar + sizeof(mm_extra_t)/4;
 		kroundup32(r->p->capacity);
 		r->p = (mm_extra_t*)realloc(r->p, r->p->capacity * 4);
 	}
@@ -193,9 +219,79 @@ static void mm_append_cigar(mm_reg1_t *r, uint32_t n_cigar, uint32_t *cigar) //
 	}
 }
 
-static void mm_align_pair(void *km, const mm_mapopt_t *opt, int qlen, const uint8_t *qseq, int tlen, const uint8_t *tseq, const int8_t *mat, int w, int end_bonus, int flag, ksw_extz_t *ez)
+static void mm_update_cigar_eqx(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq) // written by @armintoepfer
+{
+	uint32_t n_EQX = 0;
+	uint32_t k, l, m, cap, toff = 0, qoff = 0, n_M = 0;
+	mm_extra_t *p;
+	if (r->p == 0) return;
+	for (k = 0; k < r->p->n_cigar; ++k) {
+		uint32_t op = r->p->cigar[k]&0xf, len = r->p->cigar[k]>>4;
+		if (op == 0) {
+			while (len > 0) {
+				for (l = 0; l < len && qseq[qoff + l] == tseq[toff + l]; ++l) {} // run of "="; TODO: N<=>N is converted to "="
+				if (l > 0) { ++n_EQX; len -= l; toff += l; qoff += l; }
+
+				for (l = 0; l < len && qseq[qoff + l] != tseq[toff + l]; ++l) {} // run of "X"
+				if (l > 0) { ++n_EQX; len -= l; toff += l; qoff += l; }
+			}
+			++n_M;
+		} else if (op == 1) { // insertion
+			qoff += len;
+		} else if (op == 2) { // deletion
+			toff += len;
+		} else if (op == 3) { // intron
+			toff += len;
+		}
+	}
+	// update in-place if we can
+	if (n_EQX == n_M) {
+		for (k = 0; k < r->p->n_cigar; ++k) {
+			uint32_t op = r->p->cigar[k]&0xf, len = r->p->cigar[k]>>4;
+			if (op == 0) r->p->cigar[k] = len << 4 | 7;
+		}
+		return;
+	}
+	// allocate new storage
+	cap = r->p->n_cigar + (n_EQX - n_M) + sizeof(mm_extra_t);
+	kroundup32(cap);
+	p = (mm_extra_t*)calloc(cap, 4);
+	memcpy(p, r->p, sizeof(mm_extra_t));
+	p->capacity = cap;
+	// update cigar while copying
+	toff = qoff = m = 0;
+	for (k = 0; k < r->p->n_cigar; ++k) {
+		uint32_t op = r->p->cigar[k]&0xf, len = r->p->cigar[k]>>4;
+		if (op == 0) { // match/mismatch
+			while (len > 0) {
+				// match
+				for (l = 0; l < len && qseq[qoff + l] == tseq[toff + l]; ++l) {}
+				if (l > 0) p->cigar[m++] = l << 4 | 7;
+				len -= l;
+				toff += l, qoff += l;
+				// mismatch
+				for (l = 0; l < len && qseq[qoff + l] != tseq[toff + l]; ++l) {}
+				if (l > 0) p->cigar[m++] = l << 4 | 8;
+				len -= l;
+				toff += l, qoff += l;
+			}
+			continue;
+		} else if (op == 1) { // insertion
+			qoff += len;
+		} else if (op == 2) { // deletion
+			toff += len;
+		} else if (op == 3) { // intron
+			toff += len;
+		}
+		p->cigar[m++] = r->p->cigar[k];
+	}
+	p->n_cigar = m;
+	free(r->p);
+	r->p = p;
+}
+
+static void mm_align_pair(void *km, const mm_mapopt_t *opt, int qlen, const uint8_t *qseq, int tlen, const uint8_t *tseq, const int8_t *mat, int w, int end_bonus, int zdrop, int flag, ksw_extz_t *ez)
 {
-	int zdrop = opt->zdrop;
 	if (mm_dbg_flag & MM_DBG_PRINT_ALN_SEQ) {
 		int i;
 		fprintf(stderr, "===> q=(%d,%d), e=(%d,%d), bw=%d, flag=%d, zdrop=%d <===\n", opt->q, opt->q2, opt->e, opt->e2, w, flag, opt->zdrop);
@@ -210,6 +306,13 @@ static void mm_align_pair(void *km, const mm_mapopt_t *opt, int qlen, const uint
 		ksw_extz2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, w, zdrop, end_bonus, flag, ez);
 	else
 		ksw_extd2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->e2, w, zdrop, end_bonus, flag, ez);
+	if (mm_dbg_flag & MM_DBG_PRINT_ALN_SEQ) {
+		int i;
+		fprintf(stderr, "score=%d, cigar=", ez->score);
+		for (i = 0; i < ez->n_cigar; ++i)
+			fprintf(stderr, "%d%c", ez->cigar[i]>>4, "MIDN"[ez->cigar[i]&0xf]);
+		fprintf(stderr, "\n");
+	}
 }
 
 static inline int mm_get_hplen_back(const mm_idx_t *mi, uint32_t rid, uint32_t x)
@@ -238,20 +341,30 @@ static inline void mm_adjust_minier(const mm_idx_t *mi, uint8_t *const qseq0[2],
 	}
 }
 
-static void mm_filter_bad_seeds(void *km, int as1, int cnt1, mm128_t *a, int min_gap, int diff_thres, int max_ext_len, int max_ext_cnt)
+static int *collect_long_gaps(void *km, int as1, int cnt1, mm128_t *a, int min_gap, int *n_)
 {
-	int max_st, max_en, n, i, k, max, *K;
+	int i, n, *K;
+	*n_ = 0;
 	for (i = 1, n = 0; i < cnt1; ++i) { // count the number of gaps longer than min_gap
 		int gap = ((int32_t)a[as1 + i].y - a[as1 + i - 1].y) - ((int32_t)a[as1 + i].x - a[as1 + i - 1].x);
 		if (gap < -min_gap || gap > min_gap) ++n;
 	}
-	if (n <= 1) return;
+	if (n <= 1) return 0;
 	K = (int*)kmalloc(km, n * sizeof(int));
 	for (i = 1, n = 0; i < cnt1; ++i) { // store the positions of long gaps
 		int gap = ((int32_t)a[as1 + i].y - a[as1 + i - 1].y) - ((int32_t)a[as1 + i].x - a[as1 + i - 1].x);
 		if (gap < -min_gap || gap > min_gap)
 			K[n++] = i;
 	}
+	*n_ = n;
+	return K;
+}
+
+static void mm_filter_bad_seeds(void *km, int as1, int cnt1, mm128_t *a, int min_gap, int diff_thres, int max_ext_len, int max_ext_cnt)
+{
+	int max_st, max_en, n, i, k, max, *K;
+	K = collect_long_gaps(km, as1, cnt1, a, min_gap, &n);
+	if (K == 0) return;
 	max = 0, max_st = max_en = -1;
 	for (k = 0;; ++k) { // traverse long gaps
 		int gap, l, n_ins = 0, n_del = 0, qs, rs, max_diff = 0, max_diff_l = -1;
@@ -263,7 +376,7 @@ static void mm_filter_bad_seeds(void *km, int as1, int cnt1, mm128_t *a, int min
 			if (k == n) break;
 		}
 		i = K[k];
-		gap = ((int32_t)a[as1 + i].y - a[as1 + i - 1].y) - ((int32_t)a[as1 + i].x - a[as1 + i - 1].x);
+		gap = ((int32_t)a[as1 + i].y - (int32_t)a[as1 + i - 1].y) - (int32_t)(a[as1 + i].x - a[as1 + i - 1].x);
 		if (gap > 0) n_ins += gap;
 		else n_del += -gap;
 		qs = (int32_t)a[as1 + i - 1].y;
@@ -271,7 +384,7 @@ static void mm_filter_bad_seeds(void *km, int as1, int cnt1, mm128_t *a, int min
 		for (l = k + 1; l < n && l <= k + max_ext_cnt; ++l) {
 			int j = K[l], diff;
 			if ((int32_t)a[as1 + j].y - qs > max_ext_len || (int32_t)a[as1 + j].x - rs > max_ext_len) break;
-			gap = ((int32_t)a[as1 + j].y - (int32_t)a[as1 + j - 1].y) - (a[as1 + j].x - a[as1 + j - 1].x);
+			gap = ((int32_t)a[as1 + j].y - (int32_t)a[as1 + j - 1].y) - (int32_t)(a[as1 + j].x - a[as1 + j - 1].x);
 			if (gap > 0) n_ins += gap;
 			else n_del += -gap;
 			diff = n_ins + n_del - abs(n_ins - n_del);
@@ -284,37 +397,79 @@ static void mm_filter_bad_seeds(void *km, int as1, int cnt1, mm128_t *a, int min
 	kfree(km, K);
 }
 
-static void mm_fix_bad_ends(const mm_reg1_t *r, const mm128_t *a, int bw, int32_t *as, int32_t *cnt)
+static void mm_filter_bad_seeds_alt(void *km, int as1, int cnt1, mm128_t *a, int min_gap, int max_ext)
 {
-	int32_t i, l;
+	int n, k, *K;
+	K = collect_long_gaps(km, as1, cnt1, a, min_gap, &n);
+	if (K == 0) return;
+	for (k = 0; k < n;) {
+		int i = K[k], l;
+		int gap1 = ((int32_t)a[as1 + i].y - (int32_t)a[as1 + i - 1].y) - ((int32_t)a[as1 + i].x - (int32_t)a[as1 + i - 1].x);
+		int re1 = (int32_t)a[as1 + i].x;
+		int qe1 = (int32_t)a[as1 + i].y;
+		gap1 = gap1 > 0? gap1 : -gap1;
+		for (l = k + 1; l < n; ++l) {
+			int j = K[l], gap2, q_span_pre, rs2, qs2, m;
+			if ((int32_t)a[as1 + j].y - qe1 > max_ext || (int32_t)a[as1 + j].x - re1 > max_ext) break;
+			gap2 = ((int32_t)a[as1 + j].y - (int32_t)a[as1 + j - 1].y) - (int32_t)(a[as1 + j].x - a[as1 + j - 1].x);
+			q_span_pre = a[as1 + j - 1].y >> 32 & 0xff;
+			rs2 = (int32_t)a[as1 + j - 1].x + q_span_pre;
+			qs2 = (int32_t)a[as1 + j - 1].x + q_span_pre;
+			m = rs2 - re1 < qs2 - qe1? rs2 - re1 : qs2 - qe1;
+			gap2 = gap2 > 0? gap2 : -gap2;
+			if (m > gap1 + gap2) break;
+			re1 = (int32_t)a[as1 + j].x;
+			qe1 = (int32_t)a[as1 + j].y;
+			gap1 = gap2;
+		}
+		if (l > k + 1) {
+			int j, end = K[l - 1];
+			for (j = K[k]; j < end; ++j)
+				a[as1 + j].y |= MM_SEED_IGNORE;
+			a[as1 + end].y |= MM_SEED_LONG_JOIN;
+		}
+		k = l;
+	}
+	kfree(km, K);
+}
+
+static void mm_fix_bad_ends(const mm_reg1_t *r, const mm128_t *a, int bw, int min_match, int32_t *as, int32_t *cnt)
+{
+	int32_t i, l, m;
 	*as = r->as, *cnt = r->cnt;
 	if (r->cnt < 3) return;
-	l = a[r->as].y >> 32 & 0xff;
+	m = l = a[r->as].y >> 32 & 0xff;
 	for (i = r->as + 1; i < r->as + r->cnt - 1; ++i) {
 		int32_t lq, lr, min, max;
+		int32_t q_span = a[i].y >> 32 & 0xff;
+		if (a[i].y & MM_SEED_LONG_JOIN) break;
 		lr = (int32_t)a[i].x - (int32_t)a[i-1].x;
 		lq = (int32_t)a[i].y - (int32_t)a[i-1].y;
 		min = lr < lq? lr : lq;
 		max = lr > lq? lr : lq;
 		if (max - min > l >> 1) *as = i;
 		l += min;
-		if (l >= bw << 1) break;
+		m += min < q_span? min : q_span;
+		if (l >= bw << 1 || (m >= min_match && m >= bw) || m >= r->mlen >> 1) break;
 	}
 	*cnt = r->as + r->cnt - *as;
-	l = a[r->as + r->cnt - 1].y >> 32 & 0xff;
+	m = l = a[r->as + r->cnt - 1].y >> 32 & 0xff;
 	for (i = r->as + r->cnt - 2; i > *as; --i) {
 		int32_t lq, lr, min, max;
+		int32_t q_span = a[i+1].y >> 32 & 0xff;
+		if (a[i+1].y & MM_SEED_LONG_JOIN) break;
 		lr = (int32_t)a[i+1].x - (int32_t)a[i].x;
 		lq = (int32_t)a[i+1].y - (int32_t)a[i].y;
 		min = lr < lq? lr : lq;
 		max = lr > lq? lr : lq;
 		if (max - min > l >> 1) *cnt = i + 1 - *as;
 		l += min;
-		if (l >= bw) break;
+		m += min < q_span? min : q_span;
+		if (l >= bw << 1 || (m >= min_match && m >= bw) || m >= r->mlen >> 1) break;
 	}
 }
 
-static void mm_max_stretch(const mm_mapopt_t *opt, const mm_reg1_t *r, const mm128_t *a, int32_t *as, int32_t *cnt)
+static void mm_max_stretch(const mm_reg1_t *r, const mm128_t *a, int32_t *as, int32_t *cnt)
 {
 	int32_t i, score, max_score, len, max_i, max_len;
 
@@ -352,7 +507,7 @@ static int mm_seed_ext_score(void *km, const mm_mapopt_t *opt, const mm_idx_t *m
 	qe = (uint32_t)a->y + 1, qs = qe - q_span;
 	rs = rs - ext_len > 0? rs - ext_len : 0;
 	qs = qs - ext_len > 0? qs - ext_len : 0;
-	re = re + ext_len < mi->seq[rid].len? re + ext_len : mi->seq[rid].len;
+	re = re + ext_len < (int32_t)mi->seq[rid].len? re + ext_len : mi->seq[rid].len;
 	qe = qe + ext_len < qlen? qe + ext_len : qlen;
 	tseq = (uint8_t*)kmalloc(km, re - rs);
 	mm_idx_getseq(mi, rid, rs, re, tseq);
@@ -398,22 +553,24 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
 
 	r2->cnt = 0;
 	if (r->cnt == 0) return;
-	ksw_gen_simple_mat(5, mat, opt->a, opt->b);
+	ksw_gen_simple_mat(5, mat, opt->a, opt->b, opt->sc_ambi);
 	bw = (int)(opt->bw * 1.5 + 1.);
 
 	if (is_sr && !(mi->flag & MM_I_HPC)) {
-		mm_max_stretch(opt, r, a, &as1, &cnt1);
+		mm_max_stretch(r, a, &as1, &cnt1);
 		rs = (int32_t)a[as1].x + 1 - (int32_t)(a[as1].y>>32&0xff);
 		qs = (int32_t)a[as1].y + 1 - (int32_t)(a[as1].y>>32&0xff);
 		re = (int32_t)a[as1+cnt1-1].x + 1;
 		qe = (int32_t)a[as1+cnt1-1].y + 1;
 	} else {
-		if (is_splice) {
+		if (!(opt->flag & MM_F_NO_END_FLT)) {
-			mm_fix_bad_ends_splice(km, opt, mi, r, mat, qlen, qseq0, a, &as1, &cnt1);
+			if (is_splice)
-		} else {
+				mm_fix_bad_ends_splice(km, opt, mi, r, mat, qlen, qseq0, a, &as1, &cnt1);
-			mm_fix_bad_ends(r, a, opt->bw, &as1, &cnt1);
+			else
-		}
+				mm_fix_bad_ends(r, a, opt->bw, opt->min_chain_score * 2, &as1, &cnt1);
+		} else as1 = r->as, cnt1 = r->cnt;
 		mm_filter_bad_seeds(km, as1, cnt1, a, 10, 40, opt->max_gap>>1, 10);
+		mm_filter_bad_seeds_alt(km, as1, cnt1, a, 30, opt->max_gap>>1);
 		mm_adjust_minier(mi, qseq0, &a[as1], &rs, &qs);
 		mm_adjust_minier(mi, qseq0, &a[as1 + cnt1 - 1], &re, &qe);
 	}
@@ -437,7 +594,7 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
 		rs0 = rs - l > 0? rs - l : 0;
 		l = qlen - qe;
 		l += l * opt->a + opt->end_bonus > opt->q? (l * opt->a + opt->end_bonus - opt->q) / opt->e : 0;
-		re0 = re + l < mi->seq[rid].len? re + l : mi->seq[rid].len;
+		re0 = re + l < (int32_t)mi->seq[rid].len? re + l : mi->seq[rid].len;
 	} else {
 		// compute rs0 and qs0
 		rs0 = (int32_t)a[r->as].x + 1 - (int32_t)(a[r->as].y>>32&0xff);
@@ -481,17 +638,25 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
 				}
 			}
 		}
-		if (qe < qlen && re < mi->seq[rid].len) {
+		if (qe < qlen && re < (int32_t)mi->seq[rid].len) {
 			l = qlen - qe < opt->max_gap? qlen - qe : opt->max_gap;
 			qe1 = qe1 < qe + l? qe1 : qe + l;
 			qe0 = qe0 > qe1? qe0 : qe1; // at least include qe0
 			l += l * opt->a > opt->q? (l * opt->a - opt->q) / opt->e : 0;
 			l = l < opt->max_gap? l : opt->max_gap;
-			l = l < mi->seq[rid].len - re? l : mi->seq[rid].len - re;
+			l = l < (int32_t)mi->seq[rid].len - re? l : mi->seq[rid].len - re;
 			re1 = re1 < re + l? re1 : re + l;
 			re0 = re0 > re1? re0 : re1;
 		} else re0 = re, qe0 = qe;
 	}
+	if (a[r->as].y & MM_SEED_SELF) {
+		int max_ext = r->qs > r->rs? r->qs - r->rs : r->rs - r->qs;
+		if (r->rs - rs0 > max_ext) rs0 = r->rs - max_ext;
+		if (r->qs - qs0 > max_ext) qs0 = r->qs - max_ext;
+		max_ext = r->qe > r->re? r->qe - r->re : r->re - r->qe;
+		if (re0 - r->re > max_ext) re0 = r->re + max_ext;
+		if (qe0 - r->qe > max_ext) qe0 = r->qe + max_ext;
+	}
 
 	assert(re0 > rs0);
 	tseq = (uint8_t*)kmalloc(km, re0 - rs0);
@@ -501,7 +666,7 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
 		mm_idx_getseq(mi, rid, rs0, rs, tseq);
 		mm_seq_rev(qs - qs0, qseq);
 		mm_seq_rev(rs - rs0, tseq);
-		mm_align_pair(km, opt, qs - qs0, qseq, rs - rs0, tseq, mat, bw, opt->end_bonus, extra_flag|KSW_EZ_EXTZ_ONLY|KSW_EZ_RIGHT|KSW_EZ_REV_CIGAR, ez);
+		mm_align_pair(km, opt, qs - qs0, qseq, rs - rs0, tseq, mat, bw, opt->end_bonus, r->split_inv? opt->zdrop_inv : opt->zdrop, extra_flag|KSW_EZ_EXTZ_ONLY|KSW_EZ_RIGHT|KSW_EZ_REV_CIGAR, ez);
 		if (ez->n_cigar > 0) {
 			mm_append_cigar(r, ez->n_cigar, ez->cigar);
 			r->p->dp_score += ez->max;
@@ -521,9 +686,10 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
 		} else mm_adjust_minier(mi, qseq0, &a[as1 + i], &re, &qe);
 		re1 = re, qe1 = qe;
 		if (i == cnt1 - 1 || (a[as1+i].y&MM_SEED_LONG_JOIN) || (qe - qs >= opt->min_ksw_len && re - rs >= opt->min_ksw_len)) {
-			int j, bw1 = bw;
+			int j, bw1 = bw, zdrop_code;
 			if (a[as1+i].y & MM_SEED_LONG_JOIN)
 				bw1 = qe - qs > re - rs? qe - qs : re - rs;
+			// perform alignment
 			qseq = &qseq0[rev][qs];
 			mm_idx_getseq(mi, rid, rs, re, tseq);
 			if (is_sr) { // perform ungapped alignment
@@ -535,10 +701,12 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
 				}
 				ez->cigar = ksw_push_cigar(km, &ez->n_cigar, &ez->m_cigar, ez->cigar, 0, qe - qs);
 			} else { // perform normal gapped alignment
-				mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, mat, bw1, -1, extra_flag|KSW_EZ_APPROX_MAX, ez); // first pass: with approximate Z-drop
+				mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, mat, bw1, -1, opt->zdrop, extra_flag|KSW_EZ_APPROX_MAX, ez); // first pass: with approximate Z-drop
 			}
-			if (mm_check_zdrop(qseq, tseq, ez->n_cigar, ez->cigar, mat, opt->q, opt->e, opt->zdrop))
+			// test Z-drop and inversion Z-drop
-				mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, mat, bw1, -1, extra_flag, ez); // second pass: lift approximate
+			if ((zdrop_code = mm_test_zdrop(km, opt, qseq, tseq, ez->n_cigar, ez->cigar, mat)) != 0)
+				mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, mat, bw1, -1, zdrop_code == 2? opt->zdrop_inv : opt->zdrop, extra_flag, ez); // second pass: lift approximate
+			// update CIGAR
 			if (ez->n_cigar > 0)
 				mm_append_cigar(r, ez->n_cigar, ez->cigar);
 			if (ez->zdropped) { // truncated by Z-drop; TODO: sometimes Z-drop kicks in because the next seed placement is wrong. This can be fixed in principle.
@@ -550,8 +718,10 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
 				r->p->dp_score += ez->max;
 				re1 = rs + (ez->max_t + 1);
 				qe1 = qs + (ez->max_q + 1);
-				if (cnt1 - (j + 1) >= opt->min_cnt)
+				if (cnt1 - (j + 1) >= opt->min_cnt) {
 					mm_split_reg(r, r2, as1 + j + 1 - r->as, qlen, a);
+					if (zdrop_code == 2) r2->split_inv = 1;
+				}
 				break;
 			} else r->p->dp_score += ez->score;
 			rs = re, qs = qe;
@@ -561,7 +731,7 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
 	if (!dropped && qe < qe0 && re < re0) { // right extension
 		qseq = &qseq0[rev][qe];
 		mm_idx_getseq(mi, rid, re, re0, tseq);
-		mm_align_pair(km, opt, qe0 - qe, qseq, re0 - re, tseq, mat, bw, opt->end_bonus, extra_flag|KSW_EZ_EXTZ_ONLY, ez);
+		mm_align_pair(km, opt, qe0 - qe, qseq, re0 - re, tseq, mat, bw, opt->end_bonus, opt->zdrop, extra_flag|KSW_EZ_EXTZ_ONLY, ez);
 		if (ez->n_cigar > 0) {
 			mm_append_cigar(r, ez->n_cigar, ez->cigar);
 			r->p->dp_score += ez->max;
@@ -579,6 +749,7 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
 	if (r->p) {
 		mm_idx_getseq(mi, rid, rs1, re1, tseq);
 		mm_update_extra(r, &qseq0[r->rev][qs1], tseq, mat, opt->q, opt->e);
+		if (opt->flag & MM_F_EQX) mm_update_cigar_eqx(r, &qseq0[r->rev][qs1], tseq);
 		if (rev && r->p->trans_strand)
 			r->p->trans_strand ^= 3; // flip to the read strand
 	}
@@ -598,15 +769,15 @@ static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, i
 	if (r1->id != r1->parent && r1->parent != MM_PARENT_TMP_PRI) return 0;
 	if (r2->id != r2->parent && r2->parent != MM_PARENT_TMP_PRI) return 0;
 	if (r1->rid != r2->rid || r1->rev != r2->rev) return 0;
-	ql = r2->qs - r1->qe;
+	ql = r1->rev? r1->qs - r2->qe : r2->qs - r1->qe;
 	tl = r2->rs - r1->re;
 	if (ql < opt->min_chain_score || ql > opt->max_gap) return 0;
 	if (tl < opt->min_chain_score || tl > opt->max_gap) return 0;
 
-	ksw_gen_simple_mat(5, mat, opt->a, opt->b);
+	ksw_gen_simple_mat(5, mat, opt->a, opt->b, opt->sc_ambi);
 	tseq = (uint8_t*)kmalloc(km, tl);
 	mm_idx_getseq(mi, r1->rid, r1->re, r2->rs, tseq);
-	qseq = &qseq0[!r1->rev][qlen - r2->qs];
+	qseq = r1->rev? &qseq0[0][r2->qe] : &qseq0[1][qlen - r2->qs];
 
 	mm_seq_rev(ql, qseq);
 	mm_seq_rev(tl, tseq);
@@ -617,7 +788,7 @@ static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, i
 	mm_seq_rev(tl, tseq);
 	if (score < opt->min_dp_max) goto end_align1_inv;
 	q_off = ql - (q_off + 1), t_off = tl - (t_off + 1);
-	mm_align_pair(km, opt, ql - q_off, qseq + q_off, tl - t_off, tseq + t_off, mat, (int)(opt->bw * 1.5), -1, KSW_EZ_EXTZ_ONLY, ez);
+	mm_align_pair(km, opt, ql - q_off, qseq + q_off, tl - t_off, tseq + t_off, mat, (int)(opt->bw * 1.5), -1, opt->zdrop, KSW_EZ_EXTZ_ONLY, ez);
 	if (ez->n_cigar == 0) goto end_align1_inv; // should never be here
 	mm_append_cigar(r_inv, ez->n_cigar, ez->cigar);
 	r_inv->p->dp_score = ez->max;
@@ -627,9 +798,17 @@ static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, i
 	r_inv->rev = !r1->rev;
 	r_inv->rid = r1->rid;
 	r_inv->div = -1.0f;
-	r_inv->qs = r1->qe + q_off, r_inv->qe = r_inv->qs + ez->max_q + 1;
+	if (r_inv->rev == 0) {
-	r_inv->rs = r1->re + t_off, r_inv->re = r_inv->rs + ez->max_t + 1;
+		r_inv->qs = r2->qe + q_off;
+		r_inv->qe = r_inv->qs + ez->max_q + 1;
+	} else {
+		r_inv->qe = r2->qs - q_off;
+		r_inv->qs = r_inv->qe - (ez->max_q + 1);
+	}
+	r_inv->rs = r1->re + t_off;
+	r_inv->re = r_inv->rs + ez->max_t + 1;
 	mm_update_extra(r_inv, &qseq[q_off], &tseq[t_off], mat, opt->q, opt->e);
+	if (opt->flag & MM_F_EQX) mm_update_cigar_eqx(r_inv, &qseq[q_off], &tseq[t_off]);
 	ret = 1;
 end_align1_inv:
 	kfree(km, tseq);
@@ -689,7 +868,7 @@ mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *m
 				regs[i].p->trans_strand = opt->flag&MM_F_SPLICE_FOR? 1 : 2;
 		}
 		if (r2.cnt > 0) regs = mm_insert_reg(&r2, i, &n_regs, regs);
-		if (!(opt->flag&MM_F_SPLICE) && !(opt->flag&MM_F_SR) && i > 0) { // don't try inversion alignment for -xsplice or -xsr
+		if (i > 0 && regs[i].split_inv) {
 			if (mm_align1_inv(km, opt, mi, qlen, qseq0, &regs[i-1], &regs[i], &r2, &ez)) {
 				regs = mm_insert_reg(&r2, i, &n_regs, regs);
 				++i; // skip the inserted INV alignment
@@ -699,7 +878,7 @@ mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *m
 	*n_regs_ = n_regs;
 	kfree(km, qseq0[0]);
 	kfree(km, ez.cigar);
-	mm_filter_regs(km, opt, n_regs_, regs);
+	mm_filter_regs(opt, qlen, n_regs_, regs);
-	mm_hit_sort_by_dp(km, n_regs_, regs);
+	mm_hit_sort(km, n_regs_, regs);
 	return regs;
 }

bseq.c

@@ -2,6 +2,7 @@
 #include <stdio.h>
 #include <stdlib.h>
 #include <assert.h>
+#define __STDC_LIMIT_MACROS
 #include "bseq.h"
 #include "kvec.h"
 #include "kseq.h"
@@ -53,19 +54,28 @@ void mm_bseq_close(mm_bseq_file_t *fp)
 	free(fp);
 }
 
-static inline void kseq2bseq(kseq_t *ks, mm_bseq1_t *s, int with_qual)
+static inline char *kstrdup(const kstring_t *s)
+{
+	char *t;
+	t = (char*)malloc(s->l + 1);
+	memcpy(t, s->s, s->l + 1);
+	return t;
+}
+
+static inline void kseq2bseq(kseq_t *ks, mm_bseq1_t *s, int with_qual, int with_comment)
 {
 	int i;
-	s->name = strdup(ks->name.s);
+	s->name = kstrdup(&ks->name);
-	s->seq = strdup(ks->seq.s);
+	s->seq = kstrdup(&ks->seq);
-	for (i = 0; i < ks->seq.l; ++i) // convert U to T
+	for (i = 0; i < (int)ks->seq.l; ++i) // convert U to T
 		if (s->seq[i] == 'u' || s->seq[i] == 'U')
 			--s->seq[i];
-	s->qual = with_qual && ks->qual.l? strdup(ks->qual.s) : 0;
+	s->qual = with_qual && ks->qual.l? kstrdup(&ks->qual) : 0;
+	s->comment = with_comment && ks->comment.l? kstrdup(&ks->comment) : 0;
 	s->l_seq = ks->seq.l;
 }
 
-mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int frag_mode, int *n_)
+mm_bseq1_t *mm_bseq_read3(mm_bseq_file_t *fp, int chunk_size, int with_qual, int with_comment, int frag_mode, int *n_)
 {
 	int64_t size = 0;
 	kvec_t(mm_bseq1_t) a = {0,0,0};
@@ -82,12 +92,12 @@ mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int
 		assert(ks->seq.l <= INT32_MAX);
 		if (a.m == 0) kv_resize(mm_bseq1_t, 0, a, 256);
 		kv_pushp(mm_bseq1_t, 0, a, &s);
-		kseq2bseq(ks, s, with_qual);
+		kseq2bseq(ks, s, with_qual, with_comment);
 		size += s->l_seq;
 		if (size >= chunk_size) {
 			if (frag_mode && a.a[a.n-1].l_seq < CHECK_PAIR_THRES) {
 				while (kseq_read(ks) >= 0) {
-					kseq2bseq(ks, &fp->s, with_qual);
+					kseq2bseq(ks, &fp->s, with_qual, with_comment);
 					if (mm_qname_same(fp->s.name, a.a[a.n-1].name)) {
 						kv_push(mm_bseq1_t, 0, a, fp->s);
 						memset(&fp->s, 0, sizeof(mm_bseq1_t));
@@ -101,12 +111,17 @@ mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int
 	return a.a;
 }
 
+mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int frag_mode, int *n_)
+{
+	return mm_bseq_read3(fp, chunk_size, with_qual, 0, frag_mode, n_);
+}
+
 mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int chunk_size, int with_qual, int *n_)
 {
 	return mm_bseq_read2(fp, chunk_size, with_qual, 0, n_);
 }
 
-mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int *n_)
+mm_bseq1_t *mm_bseq_read_frag2(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int with_comment, int *n_)
 {
 	int i;
 	int64_t size = 0;
@@ -114,15 +129,20 @@ mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int
 	*n_ = 0;
 	if (n_fp < 1) return 0;
 	while (1) {
+		int n_read = 0;
 		for (i = 0; i < n_fp; ++i)
-			if (kseq_read(fp[i]->ks) < 0)
+			if (kseq_read(fp[i]->ks) >= 0)
-				break;
+				++n_read;
-		if (i != n_fp) break; // some file reaches the end
+		if (n_read < n_fp) {
+			if (n_read > 0)
+				fprintf(stderr, "[W::%s]\033[1;31m query files have different number of records; extra records skipped.\033[0m\n", __func__);
+			break; // some file reaches the end
+		}
 		if (a.m == 0) kv_resize(mm_bseq1_t, 0, a, 256);
 		for (i = 0; i < n_fp; ++i) {
 			mm_bseq1_t *s;
 			kv_pushp(mm_bseq1_t, 0, a, &s);
-			kseq2bseq(fp[i]->ks, s, with_qual);
+			kseq2bseq(fp[i]->ks, s, with_qual, with_comment);
 			size += s->l_seq;
 		}
 		if (size >= chunk_size) break;
@@ -131,6 +151,11 @@ mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int
 	return a.a;
 }
 
+mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int *n_)
+{
+	return mm_bseq_read_frag2(n_fp, fp, chunk_size, with_qual, 0, n_);
+}
+
 int mm_bseq_eof(mm_bseq_file_t *fp)
 {
 	return (ks_eof(fp->ks->f) && fp->s.seq == 0);

bseq.h

@@ -13,13 +13,15 @@ typedef struct mm_bseq_file_s mm_bseq_file_t;
 
 typedef struct {
 	int l_seq, rid;
-	char *name, *seq, *qual;
+	char *name, *seq, *qual, *comment;
 } mm_bseq1_t;
 
 mm_bseq_file_t *mm_bseq_open(const char *fn);
 void mm_bseq_close(mm_bseq_file_t *fp);
+mm_bseq1_t *mm_bseq_read3(mm_bseq_file_t *fp, int chunk_size, int with_qual, int with_comment, int frag_mode, int *n_);
 mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int frag_mode, int *n_);
 mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int chunk_size, int with_qual, int *n_);
+mm_bseq1_t *mm_bseq_read_frag2(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int with_comment, int *n_);
 mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int *n_);
 int mm_bseq_eof(mm_bseq_file_t *fp);
 

chain.c

@@ -44,7 +44,7 @@ mm128_t *mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int m
 		int32_t qi = (int32_t)a[i].y, q_span = a[i].y>>32&0xff; // NB: only 8 bits of span is used!!!
 		int32_t max_f = q_span, n_skip = 0, min_d;
 		int32_t sidi = (a[i].y & MM_SEED_SEG_MASK) >> MM_SEED_SEG_SHIFT;
-		while (st < i && ri - a[st].x > max_dist_x) ++st;
+		while (st < i && ri > a[st].x + max_dist_x) ++st;
 		for (j = i - 1; j >= st; --j) {
 			int64_t dr = ri - a[j].x;
 			int32_t dq = qi - (int32_t)a[j].y, dd, sc, log_dd;

cookbook.md

@@ -0,0 +1,243 @@
+## Table of Contents
+
+- [Introduction & Installation](#intro)
+- [Mapping Genomic Reads](#map-reads)
+  * [Mapping long reads](#map-pb)
+  * [Mapping Illumina paired-end reads](#map-sr)
+  * [Evaluating mapping accuracy with simulated reads (for developers)](#mapeval)
+- [Mapping Long RNA-seq Reads](#map-rna)
+  * [Mapping Nanopore 2D cDNA reads](#map-ont-cdna-2d)
+  * [Mapping Nanopore direct-RNA reads](#map-direct-rna)
+  * [Mapping PacBio Iso-seq reads](#map-iso-seq)
+- [Full-Genome Alignment](#genome-aln)
+  * [Intra-species assembly alignment](#asm-to-ref)
+  * [Cross-species full-genome alignment](#x-species)
+  * [Eyeballing alignment](#view-aln)
+  * [Calling variants from assembly-to-reference alignment](#asm-var)
+  * [Constructing self-homology map](#hom-map)
+  * [Lift Over (for developers)](#liftover)
+- [Read Overlap](#read-overlap)
+  * [Long-read overlap](#long-read-overlap)
+  * [Evaluating overlap sensitivity (for developers)](#ov-eval)
+
+## <a name="intro"></a>Introduction & Installation
+
+This cookbook walks you through a variety of applications of minimap2 and its
+companion script `paftools.js`. All data here are freely available from the
+minimap2 release page at version tag [v2.12][v2.12]. Some examples only work
+with v2.10 or later.
+
+To acquire the data used in this cookbook and to install minimap2 and paftools,
+please follow the command lines below:
+```sh
+# install minimap2 executables
+curl -L https://github.com/lh3/minimap2/releases/download/v2.12/minimap2-2.12_x64-linux.tar.bz2 | tar jxf -
+cp minimap2-2.12_x64-linux/{minimap2,k8,paftools.js} .  # copy executables
+export PATH="$PATH:"`pwd`                               # put the current directory on PATH
+# download example datasets
+curl -L https://github.com/lh3/minimap2/releases/download/v2.10/cookbook-data.tgz | tar zxf -
+```
+
+## <a name="map-reads"></a>Mapping Genomic Reads
+
+### <a name="map-pb"></a>Mapping long reads
+```sh
+minimap2 -ax map-pb -t4 ecoli_ref.fa ecoli_p6_25x_canu.fa > mapped.sam
+```
+Alternatively, you can create a minimap2 index first and then map:
+```sh
+minimap2 -x map-pb -d ecoli-pb.mmi ecoli_ref.fa                      # create an index
+minimap2 -ax map-pb ecoli-pb.mmi ecoli_p6_25x_canu.fa > mapped.sam
+```
+This will save you a couple of minutes when you map against the human genome.
+**HOWEVER**, key algorithm parameters such as the k-mer length and window
+size can't be changed after indexing. Minimap2 will give you a warning if
+parameters used in a pre-built index doesn't match parameters on the command
+line. **Please always make sure you are using an intended pre-built index.**
+
+### <a name="map-sr"></a>Mapping Illumina paired-end reads:
+```sh
+minimap2 -ax sr -t4 ecoli_ref.fa ecoli_mason_1.fq ecoli_mason_2.fq > mapped-sr.sam
+```
+
+### <a name="mapeval"></a>Evaluating mapping accuracy with simulated reads (for developers)
+```sh
+minimap2 -ax sr ecoli_ref.fa ecoli_mason_1.fq ecoli_mason_2.fq | paftools.js mapeval -
+```
+The output is:
+```
+Q       60      19712   0       0.000000000     19712
+Q       0       282     219     0.010953286     19994
+U       6
+```
+where a `U`-line gives the number of unmapped reads (for SAM input only); a
+`Q`-line gives:
+
+1. Mapping quality (mapQ) threshold
+2. Number of mapped reads between this threshold and the previous mapQ threshold.
+3. Number of wrong mappings in the same mapQ interval
+4. Accumulative mapping error rate
+5. Accumulative number of mappings
+
+For `paftools.js mapeval` to work, you need to encode the true read positions
+in read names in the right format. For [PBSIM][pbsim] and [mason2][mason2], we
+provide scripts to generate the right format. Simulated reads in this cookbook
+were created with the following command lines:
+```sh
+# in PBSIM source code directory:
+src/pbsim ../ecoli_ref.fa --depth 1 --sample-fastq sample/sample.fastq
+paftools.js pbsim2fq ../ecoli_ref.fa.fai sd_0001.maf > ../ecoli_pbsim.fa
+
+# mason2 simulation
+mason_simulator --illumina-prob-mismatch-scale 2.5 -ir ecoli_ref.fa -n 10000 -o tmp-l.fq -or tmp-r.fq -oa tmp.sam
+paftools.js mason2fq tmp.sam | seqtk seq -1 > ecoli_mason_1.fq
+paftools.js mason2fq tmp.sam | seqtk seq -2 > ecoli_mason_2.fq
+```
+
+
+
+## <a name="map-rna"></a>Mapping Long RNA-seq Reads
+
+### <a name="map-ont-cdna-2d"></a>Mapping Nanopore 2D cDNA reads
+```sh
+minimap2 -ax splice SIRV_E2.fa SIRV_ont-cdna.fa > aln.sam
+```
+You can compare the alignment to the true annotations with:
+```sh
+paftools.js junceval SIRV_E2C.gtf aln.sam
+```
+It gives the percentage of introns found in the annotation. For SIRV data, it
+is possible to achieve higher junction accuracy with
+```sh
+minimap2 -ax splice --splice-flank=no SIRV_E2.fa SIRV_ont-cdna.fa | paftools.js junceval SIRV_E2C.gtf
+```
+This is because minimap2 models one additional evolutionarily conserved base
+around a canonical junction, but SIRV doesn't honor this signal. Option
+`--splice-flank=no` asks minimap2 no to model this additional base.
+
+In the output a tag `ts:A:+` indicates that the read strand is the same as the
+transcript strand; `ts:A:-` indicates the read strand is opposite to the
+transcript strand. This tag is inferred from the GT-AG signal and is thus only
+available to spliced reads.
+
+### <a name="map-direct-rna"></a>Mapping Nanopore direct-RNA reads
+```sh
+minimap2 -ax splice -k14 -uf SIRV_E2.fa SIRV_ont-drna.fa > aln.sam
+```
+Direct-RNA reads are noisier, so we use a shorter k-mer for improved
+sensitivity. Here, option `-uf` forces minimap2 to map reads to the forward
+transcript strand only because direct-RNA reads are stranded. Again, applying
+`--splice-flank=no` helps junction accuracy for SIRV data.
+
+### <a name="map-iso-seq"></a>Mapping PacBio Iso-seq reads
+```sh
+minimap2 -ax splice -uf -C5 SIRV_E2.fa SIRV_iso-seq.fq > aln.sam
+```
+Option `-C5` reduces the penalty on non-canonical splicing sites. It helps
+to align such sites correctly for data with low error rate such as Iso-seq
+reads and traditional cDNAs. On this example, minimap2 makes one junction
+error. Applying `--splice-flank=no` fixes this alignment error.
+
+Note that the command line above is optimized for the final Iso-seq reads.
+PacBio's Iso-seq pipeline produces intermediate sequences at varying quality.
+For example, some intermediate reads are not stranded. For these reads, option
+`-uf` will lead to more errors. Please revise the minimap2 command line
+accordingly.
+
+
+
+## <a name="genome-aln"></a>Full-Genome Alignment
+
+### <a name="asm-to-ref"></a>Intra-species assembly alignment
+```sh
+# option "--cs" is recommended as paftools.js may need it
+minimap2 -cx asm5 --cs ecoli_ref.fa ecoli_canu.fa > ecoli_canu.paf
+```
+Here `ecoli_canu.fa` is the Canu assembly of `ecoli_p6_25x_canu.fa`. This
+command line outputs alignments in the [PAF format][paf]. Use `-a` instead of
+`-c` to get output in the SAM format.
+
+### <a name="x-species"></a>Cross-species full-genome alignment
+```sh
+minimap2 -cx asm20 --cs ecoli_ref.fa ecoli_O104:H4.fa > ecoli_O104:H4.paf
+sort -k6,6 -k8,8n ecoli_O104:H4.paf | paftools.js call -f ecoli_ref.fa -L10000 -l1000 - > out.vcf
+```
+Minimap2 has three presets for full-genome alignment: "asm5" for sequence
+divergence below 1%, "asm10" for divergence around a couple of percent and
+"asm20" for divergence not more than 10%. In theory, with the right setting,
+minimap2 should work for sequence pairs with sequence divergence up to ~15%,
+but this has not been carefully evaluated.
+
+### <a name="view-aln"></a>Eyeballing alignment
+```sh
+# option "--cs" required; minimap2-r741 or higher required for the "asm20" preset
+minimap2 -cx asm20 --cs ecoli_ref.fa ecoli_O104:H4.fa | paftools.js view - | less -S
+```
+This prints the alignment in a BLAST-like format.
+
+### <a name="asm-var"></a>Calling variants from assembly-to-reference alignment
+```sh
+# don't forget the "--cs" option; otherwise it doesn't work
+minimap2 -cx asm5 --cs ecoli_ref.fa ecoli_canu.fa \
+  | sort -k6,6 -k8,8n \
+  | paftools.js call -f ecoli_ref.fa - > out.vcf
+```
+Without option `-f`, `paftools.js call` outputs in a custom format. In this
+format, lines starting with `R` give the regions covered by one contig only.
+This information is not available in the VCF output.
+
+### <a name="hom-map"></a>Constructing self-homology map
+```sh
+minimap2 -DP -k19 -w19 -m200 ecoli_ref.fa ecoli_ref.fa > out.paf
+```
+Option `-D` asks minimap2 to ignore anchors from perfect self match and `-P`
+outputs all chains. For large nomes, we don't recommend to perform base-level
+alignment (with `-c`, `-a` or `--cs`) when `-P` is applied. This is because
+base-alignment is slow and occasionally gives wrong alignments close to the
+diagonal of a dotter plot. For E. coli, though, base-alignment is still fast.
+
+### <a name="liftover"></a>Lift over (for developers)
+```sh
+minimap2 -cx asm5 --cs ecoli_ref.fa ecoli_canu.fa > ecoli_canu.paf
+echo -e 'tig00000001\t200000\t300000' | paftools.js liftover ecoli_canu.paf -
+```
+This lifts over a region on query sequences to one or multiple regions on
+reference sequences. Note that this paftools.js command may not be efficient
+enough to lift millions of regions.
+
+
+
+## <a name="read-overlap"></a>Read Overlap
+
+### <a name="long-read-overlap"></a>Long read overlap
+```sh
+# For pacbio reads:
+minimap2 -x ava-pb ecoli_p6_25x_canu.fa ecoli_p6_25x_canu.fa > overlap.paf
+# For Nanopore reads (ava-ont also works with PacBio but not as good):
+minimap2 -x ava-ont -r 10000 ecoli_p6_25x_canu.fa ecoli_p6_25x_canu.fa > overlap.paf
+# If you have miniasm installed:
+miniasm -f ecoli_p6_25x_canu.fa overlap.paf > asm.gfa
+```
+Here we explicitly applied `-r 10000`. We are considering to set this as the
+default for the `ava-ont` mode as this seems to improve the contiguity for
+nanopore read assembly (Loman, personal communication).
+
+*Minimap2 doesn't work well with short-read overlap.*
+
+### <a name="ov-eval"></a>Evaluating overlap sensitivity (for developers)
+
+```sh
+# read to reference mapping
+minimap2 -cx map-pb ecoli_ref.fa ecoli_p6_25x_canu.fa > to-ref.paf
+# evaluate overlap sensitivity
+sort -k6,6 -k8,8n to-ref.paf | paftools.js ov-eval - overlap.paf
+```
+You can see that for PacBio reads, minimap2 achieves higher overlap sensitivity
+with `-x ava-pb` (99% vs 93% with `-x ava-ont`).
+
+
+
+[pbsim]: https://github.com/pfaucon/PBSIM-PacBio-Simulator
+[mason2]: https://github.com/seqan/seqan/tree/master/apps/mason2
+[paf]: https://github.com/lh3/miniasm/blob/master/PAF.md
+[v2.12]: https://github.com/lh3/minimap2/releases/tag/v2.12

format.c

@@ -118,7 +118,7 @@ void mm_write_sam_hdr(const mm_idx_t *idx, const char *rg, const char *ver, int
 	if (idx) {
 		uint32_t i;
 		for (i = 0; i < idx->n_seq; ++i)
-			printf("@SQ\tSN:%s\tLN:%d\n", idx->seq[i].name, idx->seq[i].len);
+			mm_sprintf_lite(&str, "@SQ\tSN:%s\tLN:%d\n", idx->seq[i].name, idx->seq[i].len);
 	}
 	if (rg) sam_write_rg_line(&str, rg);
 	mm_sprintf_lite(&str, "@PG\tID:minimap2\tPN:minimap2");
@@ -129,36 +129,18 @@ void mm_write_sam_hdr(const mm_idx_t *idx, const char *rg, const char *ver, int
 		for (i = 1; i < argc; ++i)
 			mm_sprintf_lite(&str, " %s", argv[i]);
 	}
-	mm_sprintf_lite(&str, "\n");
+	mm_err_puts(str.s);
-	fputs(str.s, stdout);
 	free(str.s);
 }
 
-static void write_cs(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int no_iden)
+static void write_cs_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq, const mm_reg1_t *r, char *tmp, int no_iden, int write_tag)
 {
-	extern unsigned char seq_nt4_table[256];
 	int i, q_off, t_off;
-	uint8_t *qseq, *tseq;
+	if (write_tag) mm_sprintf_lite(s, "\tcs:Z:");
-	char *tmp;
+	for (i = q_off = t_off = 0; i < (int)r->p->n_cigar; ++i) {
-	if (r->p == 0) return;
-	mm_sprintf_lite(s, "\tcs:Z:");
-	qseq = (uint8_t*)kmalloc(km, r->qe - r->qs);
-	tseq = (uint8_t*)kmalloc(km, r->re - r->rs);
-	tmp = (char*)kmalloc(km, r->re - r->rs > r->qe - r->qs? r->re - r->rs + 1 : r->qe - r->qs + 1);
-	mm_idx_getseq(mi, r->rid, r->rs, r->re, tseq);
-	if (!r->rev) {
-		for (i = r->qs; i < r->qe; ++i)
-			qseq[i - r->qs] = seq_nt4_table[(uint8_t)t->seq[i]];
-	} else {
-		for (i = r->qs; i < r->qe; ++i) {
-			uint8_t c = seq_nt4_table[(uint8_t)t->seq[i]];
-			qseq[r->qe - i - 1] = c >= 4? 4 : 3 - c;
-		}
-	}
-	for (i = q_off = t_off = 0; i < r->p->n_cigar; ++i) {
 		int j, op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
 		assert(op >= 0 && op <= 3);
-		if (op == 0) {
+		if (op == 0) { // match
 			int l_tmp = 0;
 			for (j = 0; j < len; ++j) {
 				if (qseq[q_off + j] != tseq[t_off + j]) {
@@ -179,17 +161,17 @@ static void write_cs(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_
 				} else mm_sprintf_lite(s, ":%d", l_tmp);
 			}
 			q_off += len, t_off += len;
-		} else if (op == 1) {
+		} else if (op == 1) { // insertion to ref
 			for (j = 0, tmp[len] = 0; j < len; ++j)
 				tmp[j] = "acgtn"[qseq[q_off + j]];
 			mm_sprintf_lite(s, "+%s", tmp);
 			q_off += len;
-		} else if (op == 2) {
+		} else if (op == 2) { // deletion from ref
 			for (j = 0, tmp[len] = 0; j < len; ++j)
 				tmp[j] = "acgtn"[tseq[t_off + j]];
 			mm_sprintf_lite(s, "-%s", tmp);
 			t_off += len;
-		} else {
+		} else { // intron
 			assert(len >= 2);
 			mm_sprintf_lite(s, "~%c%c%d%c%c", "acgtn"[tseq[t_off]], "acgtn"[tseq[t_off+1]],
 				len, "acgtn"[tseq[t_off+len-2]], "acgtn"[tseq[t_off+len-1]]);
@@ -197,9 +179,85 @@ static void write_cs(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_
 		}
 	}
 	assert(t_off == r->re - r->rs && q_off == r->qe - r->qs);
+}
+
+static void write_MD_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq, const mm_reg1_t *r, char *tmp, int write_tag)
+{
+	int i, q_off, t_off, l_MD = 0;
+	if (write_tag) mm_sprintf_lite(s, "\tMD:Z:");
+	for (i = q_off = t_off = 0; i < (int)r->p->n_cigar; ++i) {
+		int j, op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
+		assert(op >= 0 && op <= 2); // introns (aka reference skips) are not supported
+		if (op == 0) { // match
+			for (j = 0; j < len; ++j) {
+				if (qseq[q_off + j] != tseq[t_off + j]) {
+					mm_sprintf_lite(s, "%d%c", l_MD, "ACGTN"[tseq[t_off + j]]);
+					l_MD = 0;
+				} else ++l_MD;
+			}
+			q_off += len, t_off += len;
+		} else if (op == 1) { // insertion to ref
+			q_off += len;
+		} else if (op == 2) { // deletion from ref
+			for (j = 0, tmp[len] = 0; j < len; ++j)
+				tmp[j] = "ACGTN"[tseq[t_off + j]];
+			mm_sprintf_lite(s, "%d^%s", l_MD, tmp);
+			l_MD = 0;
+			t_off += len;
+		}
+	}
+	if (l_MD > 0) mm_sprintf_lite(s, "%d", l_MD);
+	assert(t_off == r->re - r->rs && q_off == r->qe - r->qs);
+}
+
+static void write_cs_or_MD(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int no_iden, int is_MD, int write_tag)
+{
+	extern unsigned char seq_nt4_table[256];
+	int i;
+	uint8_t *qseq, *tseq;
+	char *tmp;
+	if (r->p == 0) return;
+	qseq = (uint8_t*)kmalloc(km, r->qe - r->qs);
+	tseq = (uint8_t*)kmalloc(km, r->re - r->rs);
+	tmp = (char*)kmalloc(km, r->re - r->rs > r->qe - r->qs? r->re - r->rs + 1 : r->qe - r->qs + 1);
+	mm_idx_getseq(mi, r->rid, r->rs, r->re, tseq);
+	if (!r->rev) {
+		for (i = r->qs; i < r->qe; ++i)
+			qseq[i - r->qs] = seq_nt4_table[(uint8_t)t->seq[i]];
+	} else {
+		for (i = r->qs; i < r->qe; ++i) {
+			uint8_t c = seq_nt4_table[(uint8_t)t->seq[i]];
+			qseq[r->qe - i - 1] = c >= 4? 4 : 3 - c;
+		}
+	}
+	if (is_MD) write_MD_core(s, tseq, qseq, r, tmp, write_tag);
+	else write_cs_core(s, tseq, qseq, r, tmp, no_iden, write_tag);
 	kfree(km, qseq); kfree(km, tseq); kfree(km, tmp);
 }
 
+int mm_gen_cs_or_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int is_MD, int no_iden)
+{
+	mm_bseq1_t t;
+	kstring_t str;
+	str.s = *buf, str.l = 0, str.m = *max_len;
+	t.l_seq = strlen(seq);
+	t.seq = (char*)seq;
+	write_cs_or_MD(km, &str, mi, &t, r, no_iden, is_MD, 0);
+	*max_len = str.m;
+	*buf = str.s;
+	return str.l;
+}
+
+int mm_gen_cs(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int no_iden)
+{
+	return mm_gen_cs_or_MD(km, buf, max_len, mi, r, seq, 0, no_iden);
+}
+
+int mm_gen_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq)
+{
+	return mm_gen_cs_or_MD(km, buf, max_len, mi, r, seq, 1, 0);
+}
+
 static inline void write_tags(kstring_t *s, const mm_reg1_t *r)
 {
 	int type;
@@ -224,6 +282,10 @@ static inline void write_tags(kstring_t *s, const mm_reg1_t *r)
 void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int opt_flag)
 {
 	s->l = 0;
+	if (r == 0) {
+		mm_sprintf_lite(s, "%s\t%d", t->name, t->l_seq);
+		return;
+	}
 	mm_sprintf_lite(s, "%s\t%d\t%d\t%d\t%c\t", t->name, t->l_seq, r->qs, r->qe, "+-"[r->rev]);
 	if (mi->seq[r->rid].name) mm_sprintf_lite(s, "%s", mi->seq[r->rid].name);
 	else mm_sprintf_lite(s, "%d", r->rid);
@@ -235,10 +297,12 @@ void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const m
 		uint32_t k;
 		mm_sprintf_lite(s, "\tcg:Z:");
 		for (k = 0; k < r->p->n_cigar; ++k)
-			mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDN"[r->p->cigar[k]&0xf]);
+			mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDNSHP=XB"[r->p->cigar[k]&0xf]);
 	}
-	if (r->p && (opt_flag & MM_F_OUT_CS))
+	if (r->p && (opt_flag & (MM_F_OUT_CS|MM_F_OUT_MD)))
-		write_cs(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG));
+		write_cs_or_MD(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG), opt_flag&MM_F_OUT_MD, 1);
+	if ((opt_flag & MM_F_COPY_COMMENT) && t->comment)
+		mm_sprintf_lite(s, "\t%s", t->comment);
 }
 
 static void sam_write_sq(kstring_t *s, char *seq, int l, int rev, int comp)
@@ -284,7 +348,7 @@ static void write_sam_cigar(kstring_t *s, int sam_flag, int in_tag, int qlen, co
 			int clip_char = (sam_flag&0x800) && !(opt_flag&MM_F_SOFTCLIP)? 'H' : 'S';
 			if (clip_len[0]) mm_sprintf_lite(s, "%d%c", clip_len[0], clip_char);
 			for (k = 0; k < r->p->n_cigar; ++k)
-				mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDN"[r->p->cigar[k]&0xf]);
+				mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDNSHP=XB"[r->p->cigar[k]&0xf]);
 			if (clip_len[1]) mm_sprintf_lite(s, "%d%c", clip_len[1], clip_char);
 		}
 	}
@@ -434,12 +498,15 @@ void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
 				}
 			}
 		}
-		if (r->p && (opt_flag & MM_F_OUT_CS))
+		if (r->p && (opt_flag & (MM_F_OUT_CS|MM_F_OUT_MD)))
-			write_cs(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG));
+			write_cs_or_MD(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG), opt_flag&MM_F_OUT_MD, 1);
 		if (cigar_in_tag)
 			write_sam_cigar(s, flag, 1, t->l_seq, r, opt_flag);
 	}
 
+	if ((opt_flag & MM_F_COPY_COMMENT) && t->comment)
+		mm_sprintf_lite(s, "\t%s", t->comment);
+
 	s->s[s->l] = 0; // we always have room for an extra byte (see str_enlarge)
 }
 

hit.c

@@ -94,6 +94,7 @@ void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a)
 	r2->id = -1;
 	r2->sam_pri = 0;
 	r2->p = 0;
+	r2->split_inv = 0;
 	r2->cnt = r->cnt - n;
 	r2->score = (int32_t)(r->score * ((float)r2->cnt / r->cnt) + .499);
 	r2->as = r->as + n;
@@ -131,7 +132,7 @@ void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r, int sub_diff
 			int j, x = si;
 			radix_sort_64(cov, cov + n_cov);
 			for (j = 0; j < n_cov; ++j) {
-				if (cov[j]>>32 > x) uncov_len += (cov[j]>>32) - x;
+				if ((int)(cov[j]>>32) > x) uncov_len += (cov[j]>>32) - x;
 				x = (int32_t)cov[j] > x? (int32_t)cov[j] : x;
 			}
 			if (ei > x) uncov_len += ei - x;
@@ -142,7 +143,7 @@ void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r, int sub_diff
 			if (ej <= si || sj >= ei) continue; // no overlap
 			min = ej - sj < ei - si? ej - sj : ei - si;
 			max = ej - sj > ei - si? ej - sj : ei - si;
-			ol = si < sj? (ei < sj? 0 : ei < ej? ei - sj : ej - sj) : (ej < si? 0 : ej < ei? ej - si : ei - si); // overlap length
+			ol = si < sj? (ei < sj? 0 : ei < ej? ei - sj : ej - sj) : (ej < si? 0 : ej < ei? ej - si : ei - si); // overlap length; TODO: this can be simplified
 			if ((float)ol / min - (float)uncov_len / max > mask_level) {
 				int cnt_sub = 0;
 				ri->parent = rp->parent;
@@ -163,9 +164,9 @@ set_parent_test:
 	kfree(km, w);
 }
 
-void mm_hit_sort_by_dp(void *km, int *n_regs, mm_reg1_t *r)
+void mm_hit_sort(void *km, int *n_regs, mm_reg1_t *r)
 {
-	int32_t i, n_aux, n = *n_regs;
+	int32_t i, n_aux, n = *n_regs, has_cigar = 0, no_cigar = 0;
 	mm128_t *aux;
 	mm_reg1_t *t;
 
@@ -174,14 +175,20 @@ void mm_hit_sort_by_dp(void *km, int *n_regs, mm_reg1_t *r)
 	t = (mm_reg1_t*)kmalloc(km, n * sizeof(mm_reg1_t));
 	for (i = n_aux = 0; i < n; ++i) {
 		if (r[i].inv || r[i].cnt > 0) { // squeeze out elements with cnt==0 (soft deleted)
-			assert(r[i].p);
+			if (r[i].p) {
-			aux[n_aux].x = (uint64_t)r[i].p->dp_max << 32 | r[i].hash;
+				aux[n_aux].x = (uint64_t)r[i].p->dp_max << 32 | r[i].hash;
+				has_cigar = 1;
+			} else {
+				aux[n_aux].x = (uint64_t)r[i].score << 32 | r[i].hash;
+				no_cigar = 1;
+			}
 			aux[n_aux++].y = i;
 		} else if (r[i].p) {
 			free(r[i].p);
 			r[i].p = 0;
 		}
 	}
+	assert(has_cigar + no_cigar == 1);
 	radix_sort_128x(aux, aux + n_aux);
 	for (i = n_aux - 1; i >= 0; --i)
 		t[n_aux - 1 - i] = r[aux[i].y];
@@ -245,16 +252,17 @@ void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int *n_,
 	}
 }
 
-void mm_filter_regs(void *km, const mm_mapopt_t *opt, int *n_regs, mm_reg1_t *regs)
+void mm_filter_regs(const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs)
 { // NB: after this call, mm_reg1_t::parent can be -1 if its parent filtered out
 	int i, k;
 	for (i = k = 0; i < *n_regs; ++i) {
 		mm_reg1_t *r = &regs[i];
 		int flt = 0;
 		if (!r->inv && !r->seg_split && r->cnt < opt->min_cnt) flt = 1;
-		if (r->p) {
+		if (r->p) { // these filters are only applied when base-alignment is available
 			if (r->mlen < opt->min_chain_score) flt = 1;
 			else if (r->p->dp_max < opt->min_dp_max) flt = 1;
+			else if (r->qs > qlen * opt->max_clip_ratio && qlen - r->qe > qlen * opt->max_clip_ratio) flt = 1;
 			if (flt) free(r->p);
 		}
 		if (!flt) {
@@ -302,7 +310,7 @@ void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs_, mm_r
 	for (i = n_aux - 1; i >= 1; --i) {
 		mm_reg1_t *r0 = &regs[(int32_t)aux[i-1]], *r1 = &regs[(int32_t)aux[i]];
 		mm128_t *a0e, *a1s;
-		int max_gap, min_gap, sc_thres;
+		int max_gap, min_gap, sc_thres, min_flank_len;
 
 		// test
 		if (r0->as + r0->cnt != r1->as) continue; // not adjacent in a[]
@@ -311,13 +319,14 @@ void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs_, mm_r
 		a1s = &a[r1->as];
 		if (a1s->x <= a0e->x || (int32_t)a1s->y <= (int32_t)a0e->y) continue; // keep colinearity
 		max_gap = min_gap = (int32_t)a1s->y - (int32_t)a0e->y;
-		max_gap = max_gap > a1s->x - a0e->x? max_gap : a1s->x - a0e->x;
+		max_gap = a0e->x + max_gap > a1s->x? max_gap : a1s->x - a0e->x;
-		min_gap = min_gap < a1s->x - a0e->x? min_gap : a1s->x - a0e->x;
+		min_gap = a0e->x + min_gap < a1s->x? min_gap : a1s->x - a0e->x;
 		if (max_gap > opt->max_join_long || min_gap > opt->max_join_short) continue;
 		sc_thres = (int)((float)opt->min_join_flank_sc / opt->max_join_long * max_gap + .499);
 		if (r0->score < sc_thres || r1->score < sc_thres) continue; // require good flanking chains
-		if (r0->re - r0->rs < max_gap>>1 || r0->qe - r0->qs < max_gap>>1) continue; // require enough flanking length
+		min_flank_len = (int)(max_gap * opt->min_join_flank_ratio);
-		if (r1->re - r1->rs < max_gap>>1 || r1->qe - r1->qs < max_gap>>1) continue;
+		if (r0->re - r0->rs < min_flank_len || r0->qe - r0->qs < min_flank_len) continue; // require enough flanking length
+		if (r1->re - r1->rs < min_flank_len || r1->qe - r1->qs < min_flank_len) continue;
 
 		// all conditions satisfied; join
 		a[r1->as].y |= MM_SEED_LONG_JOIN;
@@ -337,7 +346,7 @@ void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs_, mm_r
 					r->parent = regs[r->parent].parent;
 			}
 		}
-		mm_filter_regs(km, opt, n_regs_, regs);
+		mm_filter_regs(opt, qlen, n_regs_, regs);
 		mm_sync_regs(km, *n_regs_, regs);
 	}
 }
@@ -390,8 +399,10 @@ mm_seg_t *mm_seg_gen(void *km, uint32_t hash, int n_segs, const int *qlens, int
 	for (s = 0; s < n_segs; ++s) {
 		regs[s] = mm_gen_regs(km, hash, qlens[s], seg[s].n_u, seg[s].u, seg[s].a);
 		n_regs[s] = seg[s].n_u;
-		for (i = 0; i < n_regs[s]; ++i)
+		for (i = 0; i < n_regs[s]; ++i) {
 			regs[s][i].seg_split = 1;
+			regs[s][i].seg_id = s;
+		}
 	}
 	return seg;
 }
@@ -404,7 +415,33 @@ void mm_seg_free(void *km, int n_segs, mm_seg_t *segs)
 	kfree(km, segs);
 }
 
-void mm_set_mapq(int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr)
+static void mm_set_inv_mapq(void *km, int n_regs, mm_reg1_t *regs)
+{
+	int i, n_aux;
+	mm128_t *aux;
+	if (n_regs < 3) return;
+	for (i = 0; i < n_regs; ++i)
+		if (regs[i].inv) break;
+	if (i == n_regs) return; // no inversion hits
+
+	aux = (mm128_t*)kmalloc(km, n_regs * 16);
+	for (i = n_aux = 0; i < n_regs; ++i)
+		if (regs[i].parent == i || regs[i].parent < 0)
+			aux[n_aux].y = i, aux[n_aux++].x = (uint64_t)regs[i].rid << 32 | regs[i].rs;
+	radix_sort_128x(aux, aux + n_aux);
+
+	for (i = 1; i < n_aux - 1; ++i) {
+		mm_reg1_t *inv = &regs[aux[i].y];
+		if (inv->inv) {
+			mm_reg1_t *l = &regs[aux[i-1].y];
+			mm_reg1_t *r = &regs[aux[i+1].y];
+			inv->mapq = l->mapq < r->mapq? l->mapq : r->mapq;
+		}
+	}
+	kfree(km, aux);
+}
+
+void mm_set_mapq(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr)
 {
 	static const float q_coef = 40.0f;
 	int64_t sum_sc = 0;
@@ -447,4 +484,5 @@ void mm_set_mapq(int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, in
 			if (r->p && r->p->dp_max > r->p->dp_max2 && r->mapq == 0) r->mapq = 1;
 		} else r->mapq = 0;
 	}
+	mm_set_inv_mapq(km, n_regs, regs);
 }

index.c

@@ -7,6 +7,7 @@
 #endif
 #include <fcntl.h>
 #include <stdio.h>
+#define __STDC_LIMIT_MACROS
 #include "kthread.h"
 #include "bseq.h"
 #include "minimap.h"
@@ -19,6 +20,8 @@
 KHASH_INIT(idx, uint64_t, uint64_t, 1, idx_hash, idx_eq)
 typedef khash_t(idx) idxhash_t;
 
+KHASH_MAP_INIT_STR(str, uint32_t)
+
 #define kroundup64(x) (--(x), (x)|=(x)>>1, (x)|=(x)>>2, (x)|=(x)>>4, (x)|=(x)>>8, (x)|=(x)>>16, (x)|=(x)>>32, ++(x))
 
 typedef struct mm_idx_bucket_s {
@@ -28,15 +31,6 @@ typedef struct mm_idx_bucket_s {
 	void *h;     // hash table indexing _p_ and minimizers appearing once
 } mm_idx_bucket_t;
 
-void mm_idxopt_init(mm_idxopt_t *opt)
-{
-	memset(opt, 0, sizeof(mm_idxopt_t));
-	opt->k = 15, opt->w = 10, opt->flag = 0;
-	opt->bucket_bits = 14;
-	opt->mini_batch_size = 50000000;
-	opt->batch_size = 4000000000ULL;
-}
-
 mm_idx_t *mm_idx_init(int w, int k, int b, int flag)
 {
 	mm_idx_t *mi;
@@ -51,12 +45,15 @@ mm_idx_t *mm_idx_init(int w, int k, int b, int flag)
 
 void mm_idx_destroy(mm_idx_t *mi)
 {
-	int i;
+	uint32_t i;
 	if (mi == 0) return;
-	for (i = 0; i < 1<<mi->b; ++i) {
+	if (mi->h) kh_destroy(str, (khash_t(str)*)mi->h);
-		free(mi->B[i].p);
+	if (mi->B) {
-		free(mi->B[i].a.a);
+		for (i = 0; i < 1U<<mi->b; ++i) {
-		kh_destroy(idx, (idxhash_t*)mi->B[i].h);
+			free(mi->B[i].p);
+			free(mi->B[i].a.a);
+			kh_destroy(idx, (idxhash_t*)mi->B[i].h);
+		}
 	}
 	if (!mi->km) {
 		for (i = 0; i < mi->n_seq; ++i)
@@ -87,14 +84,15 @@ const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n)
 
 void mm_idx_stat(const mm_idx_t *mi)
 {
-	int i, n = 0, n1 = 0;
+	int n = 0, n1 = 0;
+	uint32_t i;
 	uint64_t sum = 0, len = 0;
 	fprintf(stderr, "[M::%s] kmer size: %d; skip: %d; is_hpc: %d; #seq: %d\n", __func__, mi->k, mi->w, mi->flag&MM_I_HPC, mi->n_seq);
 	for (i = 0; i < mi->n_seq; ++i)
 		len += mi->seq[i].len;
-	for (i = 0; i < 1<<mi->b; ++i)
+	for (i = 0; i < 1U<<mi->b; ++i)
 		if (mi->B[i].h) n += kh_size((idxhash_t*)mi->B[i].h);
-	for (i = 0; i < 1<<mi->b; ++i) {
+	for (i = 0; i < 1U<<mi->b; ++i) {
 		idxhash_t *h = (idxhash_t*)mi->B[i].h;
 		khint_t k;
 		if (h == 0) continue;
@@ -108,6 +106,34 @@ void mm_idx_stat(const mm_idx_t *mi)
 			__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), n, 100.0*n1/n, (double)sum / n, (double)len / sum);
 }
 
+int mm_idx_index_name(mm_idx_t *mi)
+{
+	khash_t(str) *h;
+	uint32_t i;
+	int has_dup = 0, absent;
+	if (mi->h) return 0;
+	h = kh_init(str);
+	for (i = 0; i < mi->n_seq; ++i) {
+		khint_t k;
+		k = kh_put(str, h, mi->seq[i].name, &absent);
+		if (absent) kh_val(h, k) = i;
+		else has_dup = 1;
+	}
+	mi->h = h;
+	if (has_dup && mm_verbose >= 2)
+		fprintf(stderr, "[WARNING] some database sequences have identical sequence names\n");
+	return has_dup;
+}
+
+int mm_idx_name2id(const mm_idx_t *mi, const char *name)
+{
+	khash_t(str) *h = (khash_t(str)*)mi->h;
+	khint_t k;
+	if (h == 0) return -2;
+	k = kh_get(str, h, name);
+	return k == kh_end(h)? -1 : kh_val(h, k);
+}
+
 int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq)
 {
 	uint64_t i, st1, en1;
@@ -149,7 +175,8 @@ int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f)
 
 static void worker_post(void *g, long i, int tid)
 {
-	int j, start_a, start_p, n, n_keys;
+	int n, n_keys;
+	size_t j, start_a, start_p;
 	idxhash_t *h;
 	mm_idx_t *mi = (mm_idx_t*)g;
 	mm_idx_bucket_t *b = &mi->B[i];
@@ -177,7 +204,7 @@ static void worker_post(void *g, long i, int tid)
 			int absent;
 			mm128_t *p = &b->a.a[j-1];
 			itr = kh_put(idx, h, p->x>>8>>mi->b<<1, &absent);
-			assert(absent && j - start_a == n);
+			assert(absent && j == start_a + n);
 			if (n == 1) {
 				kh_key(h, itr) |= 1;
 				kh_val(h, itr) = p->y;
@@ -193,7 +220,7 @@ static void worker_post(void *g, long i, int tid)
 		} else ++n;
 	}
 	b->h = h;
-	assert(b->n == start_p);
+	assert(b->n == (int32_t)start_p);
 
 	// deallocate and clear b->a
 	kfree(0, b->a.a);
@@ -313,7 +340,7 @@ mm_idx_t *mm_idx_gen(mm_bseq_file_t *fp, int w, int k, int b, int flag, int mini
 	pipeline_t pl;
 	if (fp == 0 || mm_bseq_eof(fp)) return 0;
 	memset(&pl, 0, sizeof(pipeline_t));
-	pl.mini_batch_size = mini_batch_size < batch_size? mini_batch_size : batch_size;
+	pl.mini_batch_size = (uint64_t)mini_batch_size < batch_size? mini_batch_size : batch_size;
 	pl.batch_size = batch_size;
 	pl.fp = fp;
 	pl.mi = mm_idx_init(w, k, b, flag);
@@ -329,7 +356,7 @@ mm_idx_t *mm_idx_gen(mm_bseq_file_t *fp, int w, int k, int b, int flag, int mini
 	return pl.mi;
 }
 
-mm_idx_t *mm_idx_build(const char *fn, int w, int k, int flag, int n_threads) // a simpler interface
+mm_idx_t *mm_idx_build(const char *fn, int w, int k, int flag, int n_threads) // a simpler interface; deprecated
 {
 	mm_bseq_file_t *fp;
 	mm_idx_t *mi;
@@ -340,6 +367,55 @@ mm_idx_t *mm_idx_build(const char *fn, int w, int k, int flag, int n_threads) //
 	return mi;
 }
 
+mm_idx_t *mm_idx_str(int w, int k, int is_hpc, int bucket_bits, int n, const char **seq, const char **name)
+{
+	uint64_t sum_len = 0;
+	mm128_v a = {0,0,0};
+	mm_idx_t *mi;
+	khash_t(str) *h;
+	int i, flag = 0;
+
+	if (n <= 0) return 0;
+	for (i = 0; i < n; ++i) // get the total length
+		sum_len += strlen(seq[i]);
+	if (is_hpc) flag |= MM_I_HPC;
+	if (name == 0) flag |= MM_I_NO_NAME;
+	if (bucket_bits < 0) bucket_bits = 14;
+	mi = mm_idx_init(w, k, bucket_bits, flag);
+	mi->n_seq = n;
+	mi->seq = (mm_idx_seq_t*)kcalloc(mi->km, n, sizeof(mm_idx_seq_t)); // ->seq is allocated from km
+	mi->S = (uint32_t*)calloc((sum_len + 7) / 8, 4);
+	mi->h = h = kh_init(str);
+	for (i = 0, sum_len = 0; i < n; ++i) {
+		const char *s = seq[i];
+		mm_idx_seq_t *p = &mi->seq[i];
+		uint32_t j;
+		if (name && name[i]) {
+			int absent;
+			p->name = (char*)kmalloc(mi->km, strlen(name[i]) + 1);
+			strcpy(p->name, name[i]);
+			kh_put(str, h, p->name, &absent);
+			assert(absent);
+		}
+		p->offset = sum_len;
+		p->len = strlen(s);
+		for (j = 0; j < p->len; ++j) {
+			int c = seq_nt4_table[(uint8_t)s[j]];
+			uint64_t o = sum_len + j;
+			mm_seq4_set(mi->S, o, c);
+		}
+		sum_len += p->len;
+		if (p->len > 0) {
+			a.n = 0;
+			mm_sketch(0, s, p->len, w, k, i, is_hpc, &a);
+			mm_idx_add(mi, a.n, a.a);
+		}
+	}
+	free(a.a);
+	mm_idx_post(mi, 1);
+	return mi;
+}
+
 /*************
  * index I/O *
  *************/
@@ -347,17 +423,20 @@ mm_idx_t *mm_idx_build(const char *fn, int w, int k, int flag, int n_threads) //
 void mm_idx_dump(FILE *fp, const mm_idx_t *mi)
 {
 	uint64_t sum_len = 0;
-	uint32_t x[5];
+	uint32_t x[5], i;
-	int i;
 
 	x[0] = mi->w, x[1] = mi->k, x[2] = mi->b, x[3] = mi->n_seq, x[4] = mi->flag;
 	fwrite(MM_IDX_MAGIC, 1, 4, fp);
 	fwrite(x, 4, 5, fp);
 	for (i = 0; i < mi->n_seq; ++i) {
-		uint8_t l;
+		if (mi->seq[i].name) {
-		l = strlen(mi->seq[i].name);
+			uint8_t l = strlen(mi->seq[i].name);
-		fwrite(&l, 1, 1, fp);
+			fwrite(&l, 1, 1, fp);
-		fwrite(mi->seq[i].name, 1, l, fp);
+			fwrite(mi->seq[i].name, 1, l, fp);
+		} else {
+			uint8_t l = 0;
+			fwrite(&l, 1, 1, fp);
+		}
 		fwrite(&mi->seq[i].len, 4, 1, fp);
 		sum_len += mi->seq[i].len;
 	}
@@ -384,9 +463,8 @@ void mm_idx_dump(FILE *fp, const mm_idx_t *mi)
 
 mm_idx_t *mm_idx_load(FILE *fp)
 {
-	int i;
 	char magic[4];
-	uint32_t x[5];
+	uint32_t x[5], i;
 	uint64_t sum_len = 0;
 	mm_idx_t *mi;
 
@@ -400,9 +478,11 @@ mm_idx_t *mm_idx_load(FILE *fp)
 		uint8_t l;
 		mm_idx_seq_t *s = &mi->seq[i];
 		fread(&l, 1, 1, fp);
-		s->name = (char*)kmalloc(mi->km, l + 1);
+		if (l) {
-		fread(s->name, 1, l, fp);
+			s->name = (char*)kmalloc(mi->km, l + 1);
-		s->name[l] = 0;
+			fread(s->name, 1, l, fp);
+			s->name[l] = 0;
+		}
 		fread(&s->len, 4, 1, fp);
 		s->offset = sum_len;
 		sum_len += s->len;
@@ -438,14 +518,19 @@ mm_idx_t *mm_idx_load(FILE *fp)
 int64_t mm_idx_is_idx(const char *fn)
 {
 	int fd, is_idx = 0;
-	off_t ret, off_end;
+	int64_t ret, off_end;
 	char magic[4];
 
 	if (strcmp(fn, "-") == 0) return 0; // read from pipe; not an index
 	fd = open(fn, O_RDONLY);
 	if (fd < 0) return -1; // error
+#ifdef WIN32
+	if ((off_end = _lseeki64(fd, 0, SEEK_END)) >= 4) {
+		_lseeki64(fd, 0, SEEK_SET);
+#else
 	if ((off_end = lseek(fd, 0, SEEK_END)) >= 4) {
 		lseek(fd, 0, SEEK_SET);
+#endif // WIN32
 		ret = read(fd, magic, 4);
 		if (ret == 4 && strncmp(magic, MM_IDX_MAGIC, 4) == 0)
 			is_idx = 1;
@@ -491,7 +576,7 @@ mm_idx_t *mm_idx_reader_read(mm_idx_reader_t *r, int n_threads)
 		mi = mm_idx_gen(r->fp.seq, r->opt.w, r->opt.k, r->opt.bucket_bits, r->opt.flag, r->opt.mini_batch_size, n_threads, r->opt.batch_size);
 	if (mi) {
 		if (r->fp_out) mm_idx_dump(r->fp_out, mi);
-		++r->n_parts;
+		mi->index = r->n_parts++;
 	}
 	return mi;
 }

ksort.h

@@ -39,7 +39,24 @@ typedef struct {
 
 #define KSORT_SWAP(type_t, a, b) { register type_t t=(a); (a)=(b); (b)=t; }
 
-#define KSORT_INIT(name, type_t, __sort_lt)								\
+#define KSORT_INIT(name, type_t, __sort_lt) \
+	void ks_heapdown_##name(size_t i, size_t n, type_t l[]) \
+	{ \
+		size_t k = i; \
+		type_t tmp = l[i]; \
+		while ((k = (k << 1) + 1) < n) { \
+			if (k != n - 1 && __sort_lt(l[k], l[k+1])) ++k; \
+			if (__sort_lt(l[k], tmp)) break; \
+			l[i] = l[k]; i = k; \
+		} \
+		l[i] = tmp; \
+	} \
+	void ks_heapmake_##name(size_t lsize, type_t l[]) \
+	{ \
+		size_t i; \
+		for (i = (lsize >> 1) - 1; i != (size_t)(-1); --i) \
+			ks_heapdown_##name(i, lsize, l); \
+	} \
 	type_t ks_ksmall_##name(size_t n, type_t arr[], size_t kk)			\
 	{																	\
 		type_t *low, *high, *k, *ll, *hh, *mid;							\

ksw2.h

@@ -116,7 +116,7 @@ static inline uint32_t *ksw_push_cigar(void *km, int *n_cigar, int *m_cigar, uin
 //   bit 0-2: which type gets the max - 0 for H, 1 for E, 2 for F, 3 for \tilde{E} and 4 for \tilde{F}
 //   bit 3/0x08: 1 if a continuation on the E state (bit 5/0x20 for a continuation on \tilde{E})
 //   bit 4/0x10: 1 if a continuation on the F state (bit 6/0x40 for a continuation on \tilde{F})
-static inline void ksw_backtrack(void *km, int is_rot, int is_rev, int with_N, const uint8_t *p, const int *off, const int *off_end, int n_col, int i0, int j0,
+static inline void ksw_backtrack(void *km, int is_rot, int is_rev, int min_intron_len, const uint8_t *p, const int *off, const int *off_end, int n_col, int i0, int j0,
 								 int *m_cigar_, int *n_cigar_, uint32_t **cigar_)
 { // p[] - lower 3 bits: which type gets the max; bit
 	int n_cigar = 0, m_cigar = *m_cigar_, i = i0, j = j0, r, state = 0;
@@ -127,22 +127,22 @@ static inline void ksw_backtrack(void *km, int is_rot, int is_rev, int with_N, c
 			r = i + j;
 			if (i < off[r]) force_state = 2;
 			if (off_end && i > off_end[r]) force_state = 1;
-			tmp = force_state < 0? p[r * n_col + i - off[r]] : 0;
+			tmp = force_state < 0? p[(size_t)r * n_col + i - off[r]] : 0;
 		} else {
 			if (j < off[i]) force_state = 2;
 			if (off_end && j > off_end[i]) force_state = 1;
-			tmp = force_state < 0? p[i * n_col + j - off[i]] : 0;
+			tmp = force_state < 0? p[(size_t)i * n_col + j - off[i]] : 0;
 		}
 		if (state == 0) state = tmp & 7; // if requesting the H state, find state one maximizes it.
 		else if (!(tmp >> (state + 2) & 1)) state = 0; // if requesting other states, _state_ stays the same if it is a continuation; otherwise, set to H
 		if (state == 0) state = tmp & 7; // TODO: probably this line can be merged into the "else if" line right above; not 100% sure
 		if (force_state >= 0) state = force_state;
 		if (state == 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 0, 1), --i, --j; // match
-		else if (state == 1 || (state == 3 && !with_N)) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 2, 1), --i; // deletion
+		else if (state == 1 || (state == 3 && min_intron_len <= 0)) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 2, 1), --i; // deletion
-		else if (state == 3 && with_N) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 3, 1), --i; // intron
+		else if (state == 3 && min_intron_len > 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 3, 1), --i; // intron
 		else cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 1, 1), --j; // insertion
 	}
-	if (i >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 2, i + 1); // first deletion
+	if (i >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, min_intron_len > 0 && i >= min_intron_len? 3 : 2, i + 1); // first deletion
 	if (j >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 1, j + 1); // first insertion
 	if (!is_rev)
 		for (i = 0; i < n_cigar>>1; ++i) // reverse CIGAR

ksw2_extd2_sse.c

@@ -76,7 +76,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
 	qe2_    = _mm_set1_epi8(q2 + e2);
 	sc_mch_ = _mm_set1_epi8(mat[0]);
 	sc_mis_ = _mm_set1_epi8(mat[1]);
-	sc_N_   = _mm_set1_epi8(-e2);
+	sc_N_   = mat[m*m-1] == 0? _mm_set1_epi8(-e2) : _mm_set1_epi8(mat[m*m-1]);
 	m1_     = _mm_set1_epi8(m - 1); // wildcard
 
 	if (w < 0) w = tlen > qlen? tlen : qlen;
@@ -111,7 +111,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
 		for (t = 0; t < tlen_ * 16; ++t) H[t] = KSW_NEG_INF;
 	}
 	if (with_cigar) {
-		mem2 = (uint8_t*)kmalloc(km, ((qlen + tlen - 1) * n_col_ + 1) * 16);
+		mem2 = (uint8_t*)kmalloc(km, ((size_t)(qlen + tlen - 1) * n_col_ + 1) * 16);
 		p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4);
 		off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int) * 2);
 		off_end = off + qlen + tlen - 1;
@@ -218,7 +218,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
 #endif
 			}
 		} else if (!(flag&KSW_EZ_RIGHT)) { // gap left-alignment
-			__m128i *pr = p + r * n_col_ - st_;
+			__m128i *pr = p + (size_t)r * n_col_ - st_;
 			off[r] = st, off_end[r] = en;
 			for (t = st_; t <= en_; ++t) {
 				__m128i d, z, a, b, a2, b2, xt1, x2t1, vt1, ut, tmp;
@@ -265,7 +265,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
 				_mm_store_si128(&pr[t], d);
 			}
 		} else { // gap right-alignment
-			__m128i *pr = p + r * n_col_ - st_;
+			__m128i *pr = p + (size_t)r * n_col_ - st_;
 			off[r] = st, off_end[r] = en;
 			for (t = st_; t <= en_; ++t) {
 				__m128i d, z, a, b, a2, b2, xt1, x2t1, vt1, ut, tmp;
@@ -382,7 +382,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
 		int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
 		if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY)) {
 			ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
-		} else if (!ez->zdropped && (flag&KSW_EZ_EXTZ_ONLY) && ez->mqe + end_bonus > ez->max) {
+		} else if (!ez->zdropped && (flag&KSW_EZ_EXTZ_ONLY) && ez->mqe + end_bonus > (int)ez->max) {
 			ez->reach_end = 1;
 			ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, ez->mqe_t, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
 		} else if (ez->max_t >= 0 && ez->max_q >= 0) {

ksw2_exts2_sse.c

@@ -71,7 +71,7 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
 	qe_     = _mm_set1_epi8(q + e);
 	sc_mch_ = _mm_set1_epi8(mat[0]);
 	sc_mis_ = _mm_set1_epi8(mat[1]);
-	sc_N_   = _mm_set1_epi8(-e);
+	sc_N_   = mat[m*m-1] == 0? _mm_set1_epi8(-e) : _mm_set1_epi8(mat[m*m-1]);
 	m1_     = _mm_set1_epi8(m - 1); // wildcard
 
 	tlen_ = (tlen + 15) / 16;
@@ -367,9 +367,9 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
 	if (with_cigar) { // backtrack
 		int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
 		if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY))
-			ksw_backtrack(km, 1, rev_cigar, 1, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
+			ksw_backtrack(km, 1, rev_cigar, long_thres, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
 		else if (ez->max_t >= 0 && ez->max_q >= 0)
-			ksw_backtrack(km, 1, rev_cigar, 1, (uint8_t*)p, off, off_end, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
+			ksw_backtrack(km, 1, rev_cigar, long_thres, (uint8_t*)p, off, off_end, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
 		kfree(km, mem2); kfree(km, off);
 	}
 }

ksw2_extz2_sse.c

@@ -65,7 +65,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
 	flag16_ = _mm_set1_epi8(0x10);
 	sc_mch_ = _mm_set1_epi8(mat[0]);
 	sc_mis_ = _mm_set1_epi8(mat[1]);
-	sc_N_   = _mm_set1_epi8(-e);
+	sc_N_   = mat[m*m-1] == 0? _mm_set1_epi8(-e) : _mm_set1_epi8(mat[m*m-1]);
 	m1_     = _mm_set1_epi8(m - 1); // wildcard
 	max_sc_ = _mm_set1_epi8(mat[0] + (q + e) * 2);
 
@@ -89,7 +89,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
 		for (t = 0; t < tlen_ * 16; ++t) H[t] = KSW_NEG_INF;
 	}
 	if (with_cigar) {
-		mem2 = (uint8_t*)kmalloc(km, ((qlen + tlen - 1) * n_col_ + 1) * 16);
+		mem2 = (uint8_t*)kmalloc(km, ((size_t)(qlen + tlen - 1) * n_col_ + 1) * 16);
 		p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4);
 		off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int) * 2);
 		off_end = off + qlen + tlen - 1;
@@ -169,7 +169,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
 #endif
 			}
 		} else if (!(flag&KSW_EZ_RIGHT)) { // gap left-alignment
-			__m128i *pr = p + r * n_col_ - st_;
+			__m128i *pr = p + (size_t)r * n_col_ - st_;
 			off[r] = st, off_end[r] = en;
 			for (t = st_; t <= en_; ++t) {
 				__m128i d, z, a, b, xt1, vt1, ut, tmp;
@@ -195,7 +195,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
 				_mm_store_si128(&pr[t], d);
 			}
 		} else { // gap right-alignment
-			__m128i *pr = p + r * n_col_ - st_;
+			__m128i *pr = p + (size_t)r * n_col_ - st_;
 			off[r] = st, off_end[r] = en;
 			for (t = st_; t <= en_; ++t) {
 				__m128i d, z, a, b, xt1, vt1, ut, tmp;
@@ -293,7 +293,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
 		int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
 		if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY)) {
 			ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
-		} else if (!ez->zdropped && (flag&KSW_EZ_EXTZ_ONLY) && ez->mqe + end_bonus > ez->max) {
+		} else if (!ez->zdropped && (flag&KSW_EZ_EXTZ_ONLY) && ez->mqe + end_bonus > (int)ez->max) {
 			ez->reach_end = 1;
 			ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, ez->mqe_t, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
 		} else if (ez->max_t >= 0 && ez->max_q >= 0) {

kthread.c

@@ -2,6 +2,7 @@
 #include <stdlib.h>
 #include <limits.h>
 #include <stdint.h>
+#include "kthread.h"
 
 #if (defined(WIN32) || defined(_WIN32)) && defined(_MSC_VER)
 #define __sync_fetch_and_add(ptr, addend)     _InterlockedExchangeAdd((void*)ptr, addend)

main.c

@@ -4,9 +4,13 @@
 #include "bseq.h"
 #include "minimap.h"
 #include "mmpriv.h"
+#ifdef HAVE_GETOPT
+#include <getopt.h>
+#else
 #include "getopt.h"
+#endif
 
-#define MM_VERSION "2.6-r623"
+#define MM_VERSION "2.12-r827"
 
 #ifdef __linux__
 #include <sys/resource.h>
@@ -28,7 +32,7 @@ static struct option long_options[] = {
 	{ "seed",           required_argument, 0, 0 },
 	{ "no-kalloc",      no_argument,       0, 0 },
 	{ "print-qname",    no_argument,       0, 0 },
-	{ "no-self",        no_argument,       0, 0 },
+	{ "no-self",        no_argument,       0, 'D' },
 	{ "print-seeds",    no_argument,       0, 0 },
 	{ "max-chain-skip", required_argument, 0, 0 },
 	{ "min-dp-len",     required_argument, 0, 0 },
@@ -37,14 +41,28 @@ static struct option long_options[] = {
 	{ "cost-non-gt-ag", required_argument, 0, 'C' },
 	{ "no-long-join",   no_argument,       0, 0 },
 	{ "sr",             no_argument,       0, 0 },
-	{ "frag",           optional_argument, 0, 0 },
+	{ "frag",           required_argument, 0, 0 },
-	{ "secondary",      optional_argument, 0, 0 },
+	{ "secondary",      required_argument, 0, 0 },
 	{ "cs",             optional_argument, 0, 0 },
 	{ "end-bonus",      required_argument, 0, 0 },
 	{ "no-pairing",     no_argument,       0, 0 },
-	{ "splice-flank",   optional_argument, 0, 0 },
+	{ "splice-flank",   required_argument, 0, 0 },
 	{ "idx-no-seq",     no_argument,       0, 0 },
 	{ "end-seed-pen",   required_argument, 0, 0 },   // 21
+	{ "for-only",       no_argument,       0, 0 },   // 22
+	{ "rev-only",       no_argument,       0, 0 },   // 23
+	{ "heap-sort",      required_argument, 0, 0 },   // 24
+	{ "all-chain",      no_argument,       0, 'P' },
+	{ "dual",           required_argument, 0, 0 },   // 26
+	{ "max-clip-ratio", required_argument, 0, 0 },   // 27
+	{ "min-occ-floor",  required_argument, 0, 0 },   // 28
+	{ "MD",             no_argument,       0, 0 },   // 29
+	{ "lj-min-ratio",   required_argument, 0, 0 },   // 30
+	{ "score-N",        required_argument, 0, 0 },   // 31
+	{ "eqx",            no_argument,       0, 0 },   // 32
+	{ "paf-no-hit",     no_argument,       0, 0 },   // 33
+	{ "split-prefix",   required_argument, 0, 0 },   // 34
+	{ "no-end-flt",     no_argument,       0, 0 },   // 35
 	{ "help",           no_argument,       0, 'h' },
 	{ "max-intron-len", required_argument, 0, 'G' },
 	{ "version",        no_argument,       0, 'V' },
@@ -60,19 +78,32 @@ static inline int64_t mm_parse_num(const char *str)
 {
 	double x;
 	char *p;
-	x = strtod(optarg, &p);
+	x = strtod(str, &p);
 	if (*p == 'G' || *p == 'g') x *= 1e9;
 	else if (*p == 'M' || *p == 'm') x *= 1e6;
 	else if (*p == 'K' || *p == 'k') x *= 1e3;
 	return (int64_t)(x + .499);
 }
 
+static inline void yes_or_no(mm_mapopt_t *opt, int flag, int long_idx, const char *arg, int yes_to_set)
+{
+	if (yes_to_set) {
+		if (strcmp(arg, "yes") == 0 || strcmp(arg, "y") == 0) opt->flag |= flag;
+		else if (strcmp(arg, "no") == 0 || strcmp(arg, "n") == 0) opt->flag &= ~flag;
+		else fprintf(stderr, "[WARNING]\033[1;31m option '--%s' only accepts 'yes' or 'no'.\033[0m\n", long_options[long_idx].name);
+	} else {
+		if (strcmp(arg, "yes") == 0 || strcmp(arg, "y") == 0) opt->flag &= ~flag;
+		else if (strcmp(arg, "no") == 0 || strcmp(arg, "n") == 0) opt->flag |= flag;
+		else fprintf(stderr, "[WARNING]\033[1;31m option '--%s' only accepts 'yes' or 'no'.\033[0m\n", long_options[long_idx].name);
+	}
+}
+
 int main(int argc, char *argv[])
 {
-	const char *opt_str = "2aSw:k:K:t:r:f:Vv:g:G:I:d:XT:s:x:Hcp:M:n:z:A:B:O:E:m:N:Qu:R:hF:LC:";
+	const char *opt_str = "2aSDw:k:K:t:r:f:Vv:g:G:I:d:XT:s:x:Hcp:M:n:z:A:B:O:E:m:N:Qu:R:hF:LC:yY";
 	mm_mapopt_t opt;
 	mm_idxopt_t ipt;
-	int i, c, n_threads = 3, long_idx;
+	int i, c, n_threads = 3, n_parts, long_idx;
 	char *fnw = 0, *rg = 0, *s;
 	FILE *fp_help = stderr;
 	mm_idx_reader_t *idx_rdr;
@@ -91,7 +122,7 @@ int main(int argc, char *argv[])
 			}
 			break;
 		}
-	optreset = 1;
+	optind = 0; // for musl getopt, optind=0 has the same effect as optreset=1; older libc doesn't have optreset
 
 	while ((c = getopt_long(argc, argv, opt_str, long_options, &long_idx)) >= 0) {
 		if (c == 'w') ipt.w = atoi(optarg);
@@ -108,17 +139,19 @@ int main(int argc, char *argv[])
 		else if (c == 'p') opt.pri_ratio = atof(optarg);
 		else if (c == 'M') opt.mask_level = atof(optarg);
 		else if (c == 'c') opt.flag |= MM_F_OUT_CG | MM_F_CIGAR;
-		else if (c == 'X') opt.flag |= MM_F_AVA | MM_F_NO_SELF;
+		else if (c == 'D') opt.flag |= MM_F_NO_DIAG;
+		else if (c == 'P') opt.flag |= MM_F_ALL_CHAINS;
+		else if (c == 'X') opt.flag |= MM_F_ALL_CHAINS | MM_F_NO_DIAG | MM_F_NO_DUAL | MM_F_NO_LJOIN; // -D -P --no-long-join --dual=no
 		else if (c == 'a') opt.flag |= MM_F_OUT_SAM | MM_F_CIGAR;
 		else if (c == 'Q') opt.flag |= MM_F_NO_QUAL;
 		else if (c == 'Y') opt.flag |= MM_F_SOFTCLIP;
 		else if (c == 'L') opt.flag |= MM_F_LONG_CIGAR;
+		else if (c == 'y') opt.flag |= MM_F_COPY_COMMENT;
 		else if (c == 'T') opt.sdust_thres = atoi(optarg);
 		else if (c == 'n') opt.min_cnt = atoi(optarg);
 		else if (c == 'm') opt.min_chain_score = atoi(optarg);
 		else if (c == 'A') opt.a = atoi(optarg);
 		else if (c == 'B') opt.b = atoi(optarg);
-		else if (c == 'z') opt.zdrop = atoi(optarg);
 		else if (c == 's') opt.min_dp_max = atoi(optarg);
 		else if (c == 'C') opt.noncan = atoi(optarg);
 		else if (c == 'I') ipt.batch_size = mm_parse_num(optarg);
@@ -130,11 +163,10 @@ int main(int argc, char *argv[])
 		else if (c == 0 && long_idx == 2) opt.seed = atoi(optarg); // --seed
 		else if (c == 0 && long_idx == 3) mm_dbg_flag |= MM_DBG_NO_KALLOC; // --no-kalloc
 		else if (c == 0 && long_idx == 4) mm_dbg_flag |= MM_DBG_PRINT_QNAME; // --print-qname
-		else if (c == 0 && long_idx == 5) opt.flag |= MM_F_NO_SELF; // --no-self
 		else if (c == 0 && long_idx == 6) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_SEED, n_threads = 1; // --print-seed
 		else if (c == 0 && long_idx == 7) opt.max_chain_skip = atoi(optarg); // --max-chain-skip
 		else if (c == 0 && long_idx == 8) opt.min_ksw_len = atoi(optarg); // --min-dp-len
-		else if (c == 0 && long_idx == 9) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_ALN_SEQ; // --print-aln-seq
+		else if (c == 0 && long_idx == 9) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_ALN_SEQ, n_threads = 1; // --print-aln-seq
 		else if (c == 0 && long_idx ==10) opt.flag |= MM_F_SPLICE; // --splice
 		else if (c == 0 && long_idx ==12) opt.flag |= MM_F_NO_LJOIN; // --no-long-join
 		else if (c == 0 && long_idx ==13) opt.flag |= MM_F_SR; // --sr
@@ -142,14 +174,21 @@ int main(int argc, char *argv[])
 		else if (c == 0 && long_idx ==18) opt.flag |= MM_F_INDEPEND_SEG; // --no-pairing
 		else if (c == 0 && long_idx ==20) ipt.flag |= MM_I_NO_SEQ; // --idx-no-seq
 		else if (c == 0 && long_idx ==21) opt.anchor_ext_shift = atoi(optarg); // --end-seed-pen
+		else if (c == 0 && long_idx ==22) opt.flag |= MM_F_FOR_ONLY; // --for-only
+		else if (c == 0 && long_idx ==23) opt.flag |= MM_F_REV_ONLY; // --rev-only
+		else if (c == 0 && long_idx ==27) opt.max_clip_ratio = atof(optarg); // --max-clip-ratio
+		else if (c == 0 && long_idx ==28) opt.min_mid_occ = atoi(optarg); // --min-occ-floor
+		else if (c == 0 && long_idx ==29) opt.flag |= MM_F_OUT_MD; // --MD
+		else if (c == 0 && long_idx ==30) opt.min_join_flank_ratio = atof(optarg); // --lj-min-ratio
+		else if (c == 0 && long_idx ==31) opt.sc_ambi = atoi(optarg); // --score-N
+		else if (c == 0 && long_idx ==32) opt.flag |= MM_F_EQX; // --eqx
+		else if (c == 0 && long_idx ==33) opt.flag |= MM_F_PAF_NO_HIT; // --paf-no-hit
+		else if (c == 0 && long_idx ==34) opt.split_prefix = optarg; // --split-prefix
+		else if (c == 0 && long_idx ==35) opt.flag |= MM_F_NO_END_FLT; // --no-end-flt
 		else if (c == 0 && long_idx == 14) { // --frag
-			if (optarg == 0 || strcmp(optarg, "yes") == 0 || strcmp(optarg, "y") == 0)
+			yes_or_no(&opt, MM_F_FRAG_MODE, long_idx, optarg, 1);
-				opt.flag |= MM_F_FRAG_MODE;
-			else opt.flag &= ~MM_F_FRAG_MODE;
 		} else if (c == 0 && long_idx == 15) { // --secondary
-			if (optarg == 0 || strcmp(optarg, "yes") == 0 || strcmp(optarg, "y") == 0)
+			yes_or_no(&opt, MM_F_NO_PRINT_2ND, long_idx, optarg, 0);
-				opt.flag &= ~MM_F_NO_PRINT_2ND;
-			else opt.flag |= MM_F_NO_PRINT_2ND;
 		} else if (c == 0 && long_idx == 16) { // --cs
 			opt.flag |= MM_F_OUT_CS | MM_F_CIGAR;
 			if (optarg == 0 || strcmp(optarg, "short") == 0) {
@@ -162,9 +201,11 @@ int main(int argc, char *argv[])
 				fprintf(stderr, "[WARNING]\033[1;31m --cs only takes 'short' or 'long'. Invalid values are assumed to be 'short'.\033[0m\n");
 			}
 		} else if (c == 0 && long_idx == 19) { // --splice-flank
-			if (optarg == 0 || strcmp(optarg, "yes") == 0 || strcmp(optarg, "y") == 0)
+			yes_or_no(&opt, MM_F_SPLICE_FLANK, long_idx, optarg, 1);
-				opt.flag |= MM_F_SPLICE_FLANK;
+		} else if (c == 0 && long_idx == 24) { // --heap-sort
-			else opt.flag &= ~MM_F_SPLICE_FLANK;
+			yes_or_no(&opt, MM_F_HEAP_SORT, long_idx, optarg, 1);
+		} else if (c == 0 && long_idx == 26) { // --dual
+			yes_or_no(&opt, MM_F_NO_DUAL, long_idx, optarg, 0);
 		} else if (c == 'S') {
 			opt.flag |= MM_F_OUT_CS | MM_F_CIGAR | MM_F_OUT_CS_LONG;
 			if (mm_verbose >= 2)
@@ -188,6 +229,9 @@ int main(int argc, char *argv[])
 				fprintf(stderr, "[ERROR]\033[1;31m unrecognized cDNA direction\033[0m\n");
 				return 1;
 			}
+		} else if (c == 'z') {
+			opt.zdrop = opt.zdrop_inv = strtol(optarg, &s, 10);
+			if (*s == ',') opt.zdrop_inv = strtol(s + 1, &s, 10);
 		} else if (c == 'O') {
 			opt.q = opt.q2 = strtol(optarg, &s, 10);
 			if (*s == ',') opt.q2 = strtol(s + 1, &s, 10);
@@ -202,12 +246,14 @@ int main(int argc, char *argv[])
 	}
 	if (!fnw && !(opt.flag&MM_F_CIGAR))
 		ipt.flag |= MM_I_NO_SEQ;
+	if (mm_check_opt(&ipt, &opt) < 0)
+		return 1;
 
 	if (argc == optind || fp_help == stdout) {
 		fprintf(fp_help, "Usage: minimap2 [options] <target.fa>|<target.idx> [query.fa] [...]\n");
 		fprintf(fp_help, "Options:\n");
 		fprintf(fp_help, "  Indexing:\n");
-		fprintf(fp_help, "    -H           use homopolymer-compressed k-mer\n");
+		fprintf(fp_help, "    -H           use homopolymer-compressed k-mer (preferrable for PacBio)\n");
 		fprintf(fp_help, "    -k INT       k-mer size (no larger than 28) [%d]\n", ipt.k);
 		fprintf(fp_help, "    -w INT       minizer window size [%d]\n", ipt.w);
 		fprintf(fp_help, "    -I NUM       split index for every ~NUM input bases [4G]\n");
@@ -229,7 +275,7 @@ int main(int argc, char *argv[])
 		fprintf(fp_help, "    -B INT       mismatch penalty [%d]\n", opt.b);
 		fprintf(fp_help, "    -O INT[,INT] gap open penalty [%d,%d]\n", opt.q, opt.q2);
 		fprintf(fp_help, "    -E INT[,INT] gap extension penalty; a k-long gap costs min{O1+k*E1,O2+k*E2} [%d,%d]\n", opt.e, opt.e2);
-		fprintf(fp_help, "    -z INT       Z-drop score [%d]\n", opt.zdrop);
+		fprintf(fp_help, "    -z INT[,INT] Z-drop score and inversion Z-drop score [%d,%d]\n", opt.zdrop, opt.zdrop_inv);
 		fprintf(fp_help, "    -s INT       minimal peak DP alignment score [%d]\n", opt.min_dp_max);
 		fprintf(fp_help, "    -u CHAR      how to find GT-AG. f:transcript strand, b:both strands, n:don't match GT-AG [n]\n");
 		fprintf(fp_help, "  Input/Output:\n");
@@ -239,25 +285,28 @@ int main(int argc, char *argv[])
 		fprintf(fp_help, "    -R STR       SAM read group line in a format like '@RG\\tID:foo\\tSM:bar' []\n");
 		fprintf(fp_help, "    -c           output CIGAR in PAF\n");
 		fprintf(fp_help, "    --cs[=STR]   output the cs tag; STR is 'short' (if absent) or 'long' [none]\n");
+		fprintf(fp_help, "    --MD         output the MD tag\n");
+		fprintf(fp_help, "    --eqx        write =/X CIGAR operators\n");
 		fprintf(fp_help, "    -Y           use soft clipping for supplementary alignments\n");
 		fprintf(fp_help, "    -t INT       number of threads [%d]\n", n_threads);
 		fprintf(fp_help, "    -K NUM       minibatch size for mapping [500M]\n");
 //		fprintf(fp_help, "    -v INT       verbose level [%d]\n", mm_verbose);
 		fprintf(fp_help, "    --version    show version number\n");
 		fprintf(fp_help, "  Preset:\n");
-		fprintf(fp_help, "    -x STR       preset (always applied before other options) []\n");
+		fprintf(fp_help, "    -x STR       preset (always applied before other options; see minimap2.1 for details) []\n");
-		fprintf(fp_help, "                 map-pb: -Hk19 (PacBio vs reference mapping)\n");
+		fprintf(fp_help, "                 - map-pb/map-ont: PacBio/Nanopore vs reference mapping\n");
-		fprintf(fp_help, "                 map-ont: -k15 (Oxford Nanopore vs reference mapping)\n");
+		fprintf(fp_help, "                 - ava-pb/ava-ont: PacBio/Nanopore read overlap\n");
-		fprintf(fp_help, "                 asm5: -k19 -w19 -A1 -B19 -O39,81 -E3,1 -s200 -z200 (asm to ref mapping; break at 5%% div.)\n");
+		fprintf(fp_help, "                 - asm5/asm10/asm20: asm-to-ref mapping, for ~0.1/1/5%% sequence divergence\n");
-		fprintf(fp_help, "                 asm10: -k19 -w19 -A1 -B9 -O16,41 -E2,1 -s200 -z200 (asm to ref mapping; break at 10%% div.)\n");
+		fprintf(fp_help, "                 - splice: long-read spliced alignment\n");
-		fprintf(fp_help, "                 ava-pb: -Hk19 -w5 -Xp0 -m100 -g10000 --max-chain-skip 25 (PacBio read overlap)\n");
+		fprintf(fp_help, "                 - sr: genomic short-read mapping\n");
-		fprintf(fp_help, "                 ava-ont: -k15 -w5 -Xp0 -m100 -g10000 --max-chain-skip 25 (ONT read overlap)\n");
-		fprintf(fp_help, "                 splice: long-read spliced alignment (see minimap2.1 for details)\n");
-		fprintf(fp_help, "                 sr: short single-end reads without splicing (see minimap2.1 for details)\n");
 		fprintf(fp_help, "\nSee `man ./minimap2.1' for detailed description of command-line options.\n");
 		return fp_help == stdout? 0 : 1;
 	}
 
+	if ((opt.flag & MM_F_SR) && argc - optind > 3) {
+		fprintf(stderr, "[ERROR] incorrect input: in the sr mode, please specify no more than two query files.\n");
+		return 1;
+	}
 	idx_rdr = mm_idx_reader_open(argv[optind], &ipt, fnw);
 	if (idx_rdr == 0) {
 		fprintf(stderr, "[ERROR] failed to open file '%s'\n", argv[optind]);
@@ -282,8 +331,8 @@ int main(int argc, char *argv[])
 				mm_write_sam_hdr(mi, rg, MM_VERSION, argc, argv);
 			} else {
 				mm_write_sam_hdr(0, rg, MM_VERSION, argc, argv);
-				if (mm_verbose >= 2)
+				if (opt.split_prefix == 0 && mm_verbose >= 2)
-					fprintf(stderr, "[WARNING]\033[1;31m For a multi-part index, no @SQ lines will be outputted.\033[0m\n");
+					fprintf(stderr, "[WARNING]\033[1;31m For a multi-part index, no @SQ lines will be outputted. Please use --split-prefix.\033[0m\n");
 			}
 		}
 		if (mm_verbose >= 3)
@@ -299,12 +348,23 @@ int main(int argc, char *argv[])
 		}
 		mm_idx_destroy(mi);
 	}
+	n_parts = idx_rdr->n_parts;
 	mm_idx_reader_close(idx_rdr);
 
-	fprintf(stderr, "[M::%s] Version: %s\n", __func__, MM_VERSION);
+	if (opt.split_prefix)
-	fprintf(stderr, "[M::%s] CMD:", __func__);
+		mm_split_merge(argc - (optind + 1), (const char**)&argv[optind + 1], &opt, n_parts);
-	for (i = 0; i < argc; ++i)
+
-		fprintf(stderr, " %s", argv[i]);
+	if (fflush(stdout) == EOF) {
-	fprintf(stderr, "\n[M::%s] Real time: %.3f sec; CPU: %.3f sec\n", __func__, realtime() - mm_realtime0, cputime());
+		fprintf(stderr, "[ERROR] failed to write the results\n");
+		exit(EXIT_FAILURE);
+	}
+
+	if (mm_verbose >= 3) {
+		fprintf(stderr, "[M::%s] Version: %s\n", __func__, MM_VERSION);
+		fprintf(stderr, "[M::%s] CMD:", __func__);
+		for (i = 0; i < argc; ++i)
+			fprintf(stderr, " %s", argv[i]);
+		fprintf(stderr, "\n[M::%s] Real time: %.3f sec; CPU: %.3f sec\n", __func__, realtime() - mm_realtime0, cputime());
+	}
 	return 0;
 }

map.c

@@ -9,121 +9,9 @@
 #include "bseq.h"
 #include "khash.h"
 
-void mm_mapopt_init(mm_mapopt_t *opt)
-{
-	memset(opt, 0, sizeof(mm_mapopt_t));
-	opt->seed = 11;
-	opt->mid_occ_frac = 2e-4f;
-	opt->sdust_thres = 0; // no SDUST masking
-
-	opt->min_cnt = 3;
-	opt->min_chain_score = 40;
-	opt->bw = 500;
-	opt->max_gap = 5000;
-	opt->max_gap_ref = -1;
-	opt->max_chain_skip = 25;
-
-	opt->mask_level = 0.5f;
-	opt->pri_ratio = 0.8f;
-	opt->best_n = 5;
-
-	opt->max_join_long = 20000;
-	opt->max_join_short = 2000;
-	opt->min_join_flank_sc = 1000;
-
-	opt->a = 2, opt->b = 4, opt->q = 4, opt->e = 2, opt->q2 = 24, opt->e2 = 1;
-	opt->zdrop = 400;
-	opt->end_bonus = -1;
-	opt->min_dp_max = opt->min_chain_score * opt->a;
-	opt->min_ksw_len = 200;
-	opt->anchor_ext_len = 20, opt->anchor_ext_shift = 6;
-	opt->mini_batch_size = 500000000;
-
-	opt->pe_ori = 0; // FF
-	opt->pe_bonus = 33;
-}
-
-void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
-{
-	if ((opt->flag & MM_F_SPLICE_FOR) && (opt->flag & MM_F_SPLICE_REV))
-		opt->flag |= MM_F_SPLICE;
-	if (opt->mid_occ <= 0)
-		opt->mid_occ = mm_idx_cal_max_occ(mi, opt->mid_occ_frac);
-	if (mm_verbose >= 3)
-		fprintf(stderr, "[M::%s::%.3f*%.2f] mid_occ = %d\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), opt->mid_occ);
-}
-
-void mm_mapopt_max_intron_len(mm_mapopt_t *opt, int max_intron_len)
-{
-	if ((opt->flag & MM_F_SPLICE) && max_intron_len > 0)
-		opt->max_gap_ref = opt->bw = max_intron_len;
-}
-
-int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
-{
-	if (preset == 0) {
-		mm_idxopt_init(io);
-		mm_mapopt_init(mo);
-	} else if (strcmp(preset, "ava-ont") == 0) {
-		io->flag = 0, io->k = 15, io->w = 5;
-		mo->flag |= MM_F_AVA | MM_F_NO_SELF;
-		mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_gap = 10000, mo->max_chain_skip = 25;
-	} else if (strcmp(preset, "ava-pb") == 0) {
-		io->flag |= MM_I_HPC, io->k = 19, io->w = 5;
-		mo->flag |= MM_F_AVA | MM_F_NO_SELF;
-		mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_gap = 10000, mo->max_chain_skip = 25;
-	} else if (strcmp(preset, "map10k") == 0 || strcmp(preset, "map-pb") == 0) {
-		io->flag |= MM_I_HPC, io->k = 19;
-	} else if (strcmp(preset, "map-ont") == 0) {
-		io->flag = 0, io->k = 15;
-	} else if (strcmp(preset, "asm5") == 0) {
-		io->flag = 0, io->k = 19, io->w = 19;
-		mo->a = 1, mo->b = 19, mo->q = 39, mo->q2 = 81, mo->e = 3, mo->e2 = 1, mo->zdrop = 200;
-		mo->min_dp_max = 200;
-		mo->best_n = 50;
-	} else if (strcmp(preset, "asm10") == 0) {
-		io->flag = 0, io->k = 19, io->w = 19;
-		mo->a = 1, mo->b = 9, mo->q = 16, mo->q2 = 41, mo->e = 2, mo->e2 = 1, mo->zdrop = 200;
-		mo->min_dp_max = 200;
-		mo->best_n = 50;
-	} else if (strcmp(preset, "short") == 0 || strcmp(preset, "sr") == 0) {
-		io->flag = 0, io->k = 21, io->w = 11;
-		mo->flag |= MM_F_SR | MM_F_FRAG_MODE | MM_F_NO_PRINT_2ND | MM_F_2_IO_THREADS;
-		mo->pe_ori = 0<<1|1; // FR
-		mo->a = 2, mo->b = 8, mo->q = 12, mo->e = 2, mo->q2 = 24, mo->e2 = 1;
-		mo->zdrop = 100;
-		mo->end_bonus = 10;
-		mo->max_frag_len = 800;
-		mo->max_gap = 100;
-		mo->bw = 100;
-		mo->pri_ratio = 0.5f;
-		mo->min_cnt = 2;
-		mo->min_chain_score = 25;
-		mo->min_dp_max = 40;
-		mo->best_n = 20;
-		mo->mid_occ = 1000;
-		mo->max_occ = 5000;
-		mo->mini_batch_size = 50000000;
-	} else if (strcmp(preset, "splice") == 0 || strcmp(preset, "cdna") == 0) {
-		io->flag = 0, io->k = 15, io->w = 5;
-		mo->flag |= MM_F_SPLICE | MM_F_SPLICE_FOR | MM_F_SPLICE_REV | MM_F_SPLICE_FLANK;
-		mo->max_gap = 2000, mo->max_gap_ref = mo->bw = 200000;
-		mo->a = 1, mo->b = 2, mo->q = 2, mo->e = 1, mo->q2 = 32, mo->e2 = 0;
-		mo->noncan = 9;
-		mo->zdrop = 200;
-	} else return -1;
-	return 0;
-}
-
-typedef struct {
-	uint32_t n;
-	uint32_t qpos;
-	uint32_t seg_id;
-	const uint64_t *cr;
-} mm_match_t;
-
 struct mm_tbuf_s {
 	void *km;
+	int rep_len, frag_gap;
 };
 
 mm_tbuf_t *mm_tbuf_init(void)
@@ -141,6 +29,11 @@ void mm_tbuf_destroy(mm_tbuf_t *b)
 	free(b);
 }
 
+void *mm_tbuf_get_km(mm_tbuf_t *b)
+{
+	return b->km;
+}
+
 static int mm_dust_minier(void *km, int n, mm128_t *a, int l_seq, const char *seq, int sdust_thres)
 {
 	int n_dreg, j, k, u = 0;
@@ -152,12 +45,12 @@ static int mm_dust_minier(void *km, int n, mm128_t *a, int l_seq, const char *se
 	for (j = k = 0; j < n; ++j) { // squeeze out minimizers that significantly overlap with LCRs
 		int32_t qpos = (uint32_t)a[j].y>>1, span = a[j].x&0xff;
 		int32_t s = qpos - (span - 1), e = s + span;
-		while (u < n_dreg && (uint32_t)dreg[u] <= s) ++u;
+		while (u < n_dreg && (int32_t)dreg[u] <= s) ++u;
-		if (u < n_dreg && dreg[u]>>32 < e) {
+		if (u < n_dreg && (int32_t)(dreg[u]>>32) < e) {
 			int v, l = 0;
-			for (v = u; v < n_dreg && dreg[v]>>32 < e; ++v) { // iterate over LCRs overlapping this minimizer
+			for (v = u; v < n_dreg && (int32_t)(dreg[v]>>32) < e; ++v) { // iterate over LCRs overlapping this minimizer
-				int ss = s > dreg[v]>>32? s : dreg[v]>>32;
+				int ss = s > (int32_t)(dreg[v]>>32)? s : dreg[v]>>32;
-				int ee = e < (uint32_t)dreg[v]? e : (uint32_t)dreg[v];
+				int ee = e < (int32_t)dreg[v]? e : (uint32_t)dreg[v];
 				l += ee - ss;
 			}
 			if (l <= span>>1) a[k++] = a[j]; // keep the minimizer if less than half of it falls in masked region
@@ -169,9 +62,10 @@ static int mm_dust_minier(void *km, int n, mm128_t *a, int l_seq, const char *se
 
 static void collect_minimizers(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, mm128_v *mv)
 {
-	int i, j, n, sum = 0;
+	int i, n, sum = 0;
 	mv->n = 0;
 	for (i = n = 0; i < n_segs; ++i) {
+		size_t j;
 		mm_sketch(km, seqs[i], qlens[i], mi->w, mi->k, i, mi->flag&MM_I_HPC, mv);
 		for (j = n; j < mv->n; ++j)
 			mv->a[j].y += sum << 1;
@@ -181,88 +75,192 @@ static void collect_minimizers(void *km, const mm_mapopt_t *opt, const mm_idx_t
 	}
 }
 
-static mm128_t *collect_seed_hits(void *km, const mm_mapopt_t *opt, int max_occ, const mm_idx_t *mi, const char *qname, const mm128_v *mv, int qlen, int64_t *n_a, int *rep_len,
+#include "ksort.h"
-								  int *n_mini_pos, uint64_t **mini_pos)
+#define heap_lt(a, b) ((a).x > (b).x)
-{
+KSORT_INIT(heap, mm128_t, heap_lt)
-	int rep_st = 0, rep_en = 0, i;
-	mm_match_t *m;
-	mm128_t *a;
 
+typedef struct {
+	uint32_t n;
+	uint32_t q_pos, q_span;
+	uint32_t seg_id:31, is_tandem:1;
+	const uint64_t *cr;
+} mm_match_t;
+
+static mm_match_t *collect_matches(void *km, int *_n_m, int max_occ, const mm_idx_t *mi, const mm128_v *mv, int64_t *n_a, int *rep_len, int *n_mini_pos, uint64_t **mini_pos)
+{
+	int rep_st = 0, rep_en = 0, n_m;
+	size_t i;
+	mm_match_t *m;
 	*n_mini_pos = 0;
 	*mini_pos = (uint64_t*)kmalloc(km, mv->n * sizeof(uint64_t));
 	m = (mm_match_t*)kmalloc(km, mv->n * sizeof(mm_match_t));
-	for (i = 0; i < mv->n; ++i) {
+	for (i = 0, n_m = 0, *rep_len = 0, *n_a = 0; i < mv->n; ++i) {
+		const uint64_t *cr;
+		mm128_t *p = &mv->a[i];
+		uint32_t q_pos = (uint32_t)p->y, q_span = p->x & 0xff;
 		int t;
-		mm128_t *p = &mv->a[i];
+		cr = mm_idx_get(mi, p->x>>8, &t);
-		m[i].qpos = (uint32_t)p->y;
+		if (t >= max_occ) {
-		m[i].cr = mm_idx_get(mi, p->x>>8, &t);
+			int en = (q_pos >> 1) + 1, st = en - q_span;
-		m[i].n = t;
-		m[i].seg_id = p->y >> 32;
-	}
-	for (i = 0, *n_a = 0; i < mv->n; ++i) // find the length of a[]
-		if (m[i].n < max_occ) *n_a += m[i].n;
-	a = (mm128_t*)kmalloc(km, *n_a * sizeof(mm128_t));
-	for (i = *rep_len = 0, *n_a = 0; i < mv->n; ++i) {
-		mm128_t *p = &mv->a[i];
-		mm_match_t *q = &m[i];
-		const uint64_t *r = q->cr;
-		int k, q_span = p->x & 0xff, is_tandem = 0;
-		if (q->n >= max_occ) {
-			int en = (q->qpos>>1) + 1, st = en - q_span;
 			if (st > rep_en) {
 				*rep_len += rep_en - rep_st;
 				rep_st = st, rep_en = en;
 			} else rep_en = en;
-			continue;
+		} else {
-		}
+			mm_match_t *q = &m[n_m++];
-		(*mini_pos)[(*n_mini_pos)++] = (uint64_t)q_span<<32 | q->qpos>>1;
+			q->q_pos = q_pos, q->q_span = q_span, q->cr = cr, q->n = t, q->seg_id = p->y >> 32;
-		if (i > 0 && p->x>>8 == mv->a[i - 1].x>>8) is_tandem = 1;
+			q->is_tandem = 0;
-		if (i < mv->n - 1 && p->x>>8 == mv->a[i + 1].x>>8) is_tandem = 1;
+			if (i > 0 && p->x>>8 == mv->a[i - 1].x>>8) q->is_tandem = 1;
-		for (k = 0; k < q->n; ++k) {
+			if (i < mv->n - 1 && p->x>>8 == mv->a[i + 1].x>>8) q->is_tandem = 1;
-			int32_t rpos = (uint32_t)r[k] >> 1;
+			*n_a += q->n;
-			mm128_t *p;
+			(*mini_pos)[(*n_mini_pos)++] = (uint64_t)q_span<<32 | q_pos>>1;
-			if (qname && (opt->flag&(MM_F_NO_SELF|MM_F_AVA))) {
-				const char *tname = mi->seq[r[k]>>32].name;
-				int cmp;
-				cmp = strcmp(qname, tname);
-				if ((opt->flag&MM_F_NO_SELF) && cmp == 0 && rpos == (q->qpos>>1)) // avoid the diagonal
-					continue;
-				if ((opt->flag&MM_F_AVA) && cmp > 0) // all-vs-all mode: map once
-					continue;
-			}
-			p = &a[(*n_a)++];
-			if ((r[k]&1) == (q->qpos&1)) { // forward strand
-				p->x = (r[k]&0xffffffff00000000ULL) | rpos;
-				p->y = (uint64_t)q_span << 32 | q->qpos >> 1;
-			} else { // reverse strand
-				p->x = 1ULL<<63 | (r[k]&0xffffffff00000000ULL) | rpos;
-				p->y = (uint64_t)q_span << 32 | (qlen - ((q->qpos>>1) + 1 - q_span) - 1);
-			}
-			p->y |= (uint64_t)q->seg_id << MM_SEED_SEG_SHIFT;
-			if (is_tandem) p->y |= MM_SEED_TANDEM;
 		}
 	}
 	*rep_len += rep_en - rep_st;
+	*_n_m = n_m;
+	return m;
+}
+
+static inline int skip_seed(int flag, uint64_t r, const mm_match_t *q, const char *qname, int qlen, const mm_idx_t *mi, int *is_self)
+{
+	*is_self = 0;
+	if (qname && (flag & (MM_F_NO_DIAG|MM_F_NO_DUAL))) {
+		const mm_idx_seq_t *s = &mi->seq[r>>32];
+		int cmp;
+		cmp = strcmp(qname, s->name);
+		if ((flag&MM_F_NO_DIAG) && cmp == 0 && (int)s->len == qlen) {
+			if ((uint32_t)r>>1 == (q->q_pos>>1)) return 1; // avoid the diagnonal anchors
+			if ((r&1) == (q->q_pos&1)) *is_self = 1; // this flag is used to avoid spurious extension on self chain
+		}
+		if ((flag&MM_F_NO_DUAL) && cmp > 0) // all-vs-all mode: map once
+			return 1;
+	}
+	if (flag & (MM_F_FOR_ONLY|MM_F_REV_ONLY)) {
+		if ((r&1) == (q->q_pos&1)) { // forward strand
+			if (flag & MM_F_REV_ONLY) return 1;
+		} else {
+			if (flag & MM_F_FOR_ONLY) return 1;
+		}
+	}
+	return 0;
+}
+
+static mm128_t *collect_seed_hits_heap(void *km, const mm_mapopt_t *opt, int max_occ, const mm_idx_t *mi, const char *qname, const mm128_v *mv, int qlen, int64_t *n_a, int *rep_len,
+								  int *n_mini_pos, uint64_t **mini_pos)
+{
+	int i, n_m, heap_size = 0;
+	int64_t j, n_for = 0, n_rev = 0;
+	mm_match_t *m;
+	mm128_t *a, *heap;
+
+	m = collect_matches(km, &n_m, max_occ, mi, mv, n_a, rep_len, n_mini_pos, mini_pos);
+
+	heap = (mm128_t*)kmalloc(km, n_m * sizeof(mm128_t));
+	a = (mm128_t*)kmalloc(km, *n_a * sizeof(mm128_t));
+
+	for (i = 0, heap_size = 0; i < n_m; ++i) {
+		if (m[i].n > 0) {
+			heap[heap_size].x = m[i].cr[0];
+			heap[heap_size].y = (uint64_t)i<<32;
+			++heap_size;
+		}
+	}
+	ks_heapmake_heap(heap_size, heap);
+	while (heap_size > 0) {
+		mm_match_t *q = &m[heap->y>>32];
+		mm128_t *p;
+		uint64_t r = heap->x;
+		int32_t is_self, rpos = (uint32_t)r >> 1;
+		if (!skip_seed(opt->flag, r, q, qname, qlen, mi, &is_self)) {
+			if ((r&1) == (q->q_pos&1)) { // forward strand
+				p = &a[n_for++];
+				p->x = (r&0xffffffff00000000ULL) | rpos;
+				p->y = (uint64_t)q->q_span << 32 | q->q_pos >> 1;
+			} else { // reverse strand
+				p = &a[(*n_a) - (++n_rev)];
+				p->x = 1ULL<<63 | (r&0xffffffff00000000ULL) | rpos;
+				p->y = (uint64_t)q->q_span << 32 | (qlen - ((q->q_pos>>1) + 1 - q->q_span) - 1);
+			}
+			p->y |= (uint64_t)q->seg_id << MM_SEED_SEG_SHIFT;
+			if (q->is_tandem) p->y |= MM_SEED_TANDEM;
+			if (is_self) p->y |= MM_SEED_SELF;
+		}
+		// update the heap
+		if ((uint32_t)heap->y < q->n - 1) {
+			++heap[0].y;
+			heap[0].x = m[heap[0].y>>32].cr[(uint32_t)heap[0].y];
+		} else {
+			heap[0] = heap[heap_size - 1];
+			--heap_size;
+		}
+		ks_heapdown_heap(0, heap_size, heap);
+	}
 	kfree(km, m);
+	kfree(km, heap);
+
+	// reverse anchors on the reverse strand, as they are in the descending order
+	for (j = 0; j < n_rev>>1; ++j) {
+		mm128_t t = a[(*n_a) - 1 - j];
+		a[(*n_a) - 1 - j] = a[(*n_a) - (n_rev - j)];
+		a[(*n_a) - (n_rev - j)] = t;
+	}
+	if (*n_a > n_for + n_rev) {
+		memmove(a + n_for, a + (*n_a) - n_rev, n_rev * sizeof(mm128_t));
+		*n_a = n_for + n_rev;
+	}
+	return a;
+}
+
+static mm128_t *collect_seed_hits(void *km, const mm_mapopt_t *opt, int max_occ, const mm_idx_t *mi, const char *qname, const mm128_v *mv, int qlen, int64_t *n_a, int *rep_len,
+								  int *n_mini_pos, uint64_t **mini_pos)
+{
+	int i, n_m;
+	mm_match_t *m;
+	mm128_t *a;
+	m = collect_matches(km, &n_m, max_occ, mi, mv, n_a, rep_len, n_mini_pos, mini_pos);
+	a = (mm128_t*)kmalloc(km, *n_a * sizeof(mm128_t));
+	for (i = 0, *n_a = 0; i < n_m; ++i) {
+		mm_match_t *q = &m[i];
+		const uint64_t *r = q->cr;
+		uint32_t k;
+		for (k = 0; k < q->n; ++k) {
+			int32_t is_self, rpos = (uint32_t)r[k] >> 1;
+			mm128_t *p;
+			if (skip_seed(opt->flag, r[k], q, qname, qlen, mi, &is_self)) continue;
+			p = &a[(*n_a)++];
+			if ((r[k]&1) == (q->q_pos&1)) { // forward strand
+				p->x = (r[k]&0xffffffff00000000ULL) | rpos;
+				p->y = (uint64_t)q->q_span << 32 | q->q_pos >> 1;
+			} else { // reverse strand
+				p->x = 1ULL<<63 | (r[k]&0xffffffff00000000ULL) | rpos;
+				p->y = (uint64_t)q->q_span << 32 | (qlen - ((q->q_pos>>1) + 1 - q->q_span) - 1);
+			}
+			p->y |= (uint64_t)q->seg_id << MM_SEED_SEG_SHIFT;
+			if (q->is_tandem) p->y |= MM_SEED_TANDEM;
+			if (is_self) p->y |= MM_SEED_SELF;
+		}
+	}
+	kfree(km, m);
+	radix_sort_128x(a, a + (*n_a));
 	return a;
 }
 
 static void chain_post(const mm_mapopt_t *opt, int max_chain_gap_ref, const mm_idx_t *mi, void *km, int qlen, int n_segs, const int *qlens, int *n_regs, mm_reg1_t *regs, mm128_t *a)
 {
-	if (!(opt->flag & MM_F_AVA)) { // don't choose primary mapping(s) for read overlap
+	if (!(opt->flag & MM_F_ALL_CHAINS)) { // don't choose primary mapping(s)
 		mm_set_parent(km, opt->mask_level, *n_regs, regs, opt->a * 2 + opt->b);
 		if (n_segs <= 1) mm_select_sub(km, opt->pri_ratio, mi->k*2, opt->best_n, n_regs, regs);
 		else mm_select_sub_multi(km, opt->pri_ratio, 0.2f, 0.7f, max_chain_gap_ref, mi->k*2, opt->best_n, n_segs, qlens, n_regs, regs);
-		if (!(opt->flag & MM_F_SPLICE) && !(opt->flag & MM_F_SR) && !(opt->flag & MM_F_NO_LJOIN))
+		if (!(opt->flag & (MM_F_SPLICE|MM_F_SR|MM_F_NO_LJOIN))) // long join not working well without primary chains
 			mm_join_long(km, opt, qlen, n_regs, regs, a);
 	}
 }
 
-static mm_reg1_t *align_regs(const mm_mapopt_t *opt, const mm_idx_t *mi, void *km, int qlen, const char *seq, const char *qual, int *n_regs, mm_reg1_t *regs, mm128_t *a)
+static mm_reg1_t *align_regs(const mm_mapopt_t *opt, const mm_idx_t *mi, void *km, int qlen, const char *seq, int *n_regs, mm_reg1_t *regs, mm128_t *a)
 {
 	if (!(opt->flag & MM_F_CIGAR)) return regs;
 	regs = mm_align_skeleton(km, opt, mi, qlen, seq, n_regs, regs, a); // this calls mm_filter_regs()
-	if (!(opt->flag & MM_F_AVA)) {
+	if (!(opt->flag & MM_F_ALL_CHAINS)) { // don't choose primary mapping(s)
 		mm_set_parent(km, opt->mask_level, *n_regs, regs, opt->a * 2 + opt->b);
 		mm_select_sub(km, opt->pri_ratio, mi->k*2, opt->best_n, n_regs, regs);
 		mm_set_sam_pri(*n_regs, regs);
@@ -270,7 +268,7 @@ static mm_reg1_t *align_regs(const mm_mapopt_t *opt, const mm_idx_t *mi, void *k
 	return regs;
 }
 
-void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, const char **quals, int *n_regs, mm_reg1_t **regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname)
+void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, int *n_regs, mm_reg1_t **regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname)
 {
 	int i, j, rep_len, qlen_sum, n_regs0, n_mini_pos;
 	int max_chain_gap_qry, max_chain_gap_ref, is_splice = !!(opt->flag & MM_F_SPLICE), is_sr = !!(opt->flag & MM_F_SR);
@@ -292,8 +290,8 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
 	hash  = __ac_Wang_hash(hash);
 
 	collect_minimizers(b->km, opt, mi, n_segs, qlens, seqs, &mv);
-	a = collect_seed_hits(b->km, opt, opt->mid_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
+	if (opt->flag & MM_F_HEAP_SORT) a = collect_seed_hits_heap(b->km, opt, opt->mid_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
-	radix_sort_128x(a, a + n_a);
+	else a = collect_seed_hits(b->km, opt, opt->mid_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
 
 	if (mm_dbg_flag & MM_DBG_PRINT_SEED) {
 		fprintf(stderr, "RS\t%d\n", rep_len);
@@ -320,10 +318,10 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
 		if (n_regs0 > 0) { // test if the best chain has all the segments
 			int n_chained_segs = 1, max = 0, max_i = -1, max_off = -1, off = 0;
 			for (i = 0; i < n_regs0; ++i) { // find the best chain
-				if (max < u[i]>>32) max = u[i]>>32, max_i = i, max_off = off;
+				if (max < (int)(u[i]>>32)) max = u[i]>>32, max_i = i, max_off = off;
 				off += (uint32_t)u[i];
 			}
-			for (i = 1; i < (uint32_t)u[max_i]; ++i) // count the number of segments in the best chain
+			for (i = 1; i < (int32_t)u[max_i]; ++i) // count the number of segments in the best chain
 				if ((a[max_off+i].y&MM_SEED_SEG_MASK) != (a[max_off+i-1].y&MM_SEED_SEG_MASK))
 					++n_chained_segs;
 			if (n_chained_segs < n_segs)
@@ -333,11 +331,13 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
 			kfree(b->km, a);
 			kfree(b->km, u);
 			kfree(b->km, mini_pos);
-			a = collect_seed_hits(b->km, opt, opt->max_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
+			if (opt->flag & MM_F_HEAP_SORT) a = collect_seed_hits_heap(b->km, opt, opt->max_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
-			radix_sort_128x(a, a + n_a);
+			else a = collect_seed_hits(b->km, opt, opt->max_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
 			a = mm_chain_dp(max_chain_gap_ref, max_chain_gap_qry, opt->bw, opt->max_chain_skip, opt->min_cnt, opt->min_chain_score, is_splice, n_segs, n_a, a, &n_regs0, &u, b->km);
 		}
 	}
+	b->frag_gap = max_chain_gap_ref;
+	b->rep_len = rep_len;
 
 	regs0 = mm_gen_regs(b->km, hash, qlen_sum, n_regs0, u, a);
 
@@ -351,8 +351,8 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
 	if (!is_sr) mm_est_err(mi, qlen_sum, n_regs0, regs0, a, n_mini_pos, mini_pos);
 
 	if (n_segs == 1) { // uni-segment
-		regs0 = align_regs(opt, mi, b->km, qlens[0], seqs[0], quals? quals[0] : 0, &n_regs0, regs0, a);
+		regs0 = align_regs(opt, mi, b->km, qlens[0], seqs[0], &n_regs0, regs0, a);
-		mm_set_mapq(n_regs0, regs0, opt->min_chain_score, opt->a, rep_len, is_sr);
+		mm_set_mapq(b->km, n_regs0, regs0, opt->min_chain_score, opt->a, rep_len, is_sr);
 		n_regs[0] = n_regs0, regs[0] = regs0;
 	} else { // multi-segment
 		mm_seg_t *seg;
@@ -360,8 +360,8 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
 		free(regs0);
 		for (i = 0; i < n_segs; ++i) {
 			mm_set_parent(b->km, opt->mask_level, n_regs[i], regs[i], opt->a * 2 + opt->b); // update mm_reg1_t::parent
-			regs[i] = align_regs(opt, mi, b->km, qlens[i], seqs[i], quals? quals[i] : 0, &n_regs[i], regs[i], seg[i].a);
+			regs[i] = align_regs(opt, mi, b->km, qlens[i], seqs[i], &n_regs[i], regs[i], seg[i].a);
-			mm_set_mapq(n_regs[i], regs[i], opt->min_chain_score, opt->a, rep_len, is_sr);
+			mm_set_mapq(b->km, n_regs[i], regs[i], opt->min_chain_score, opt->a, rep_len, is_sr);
 		}
 		mm_seg_free(b->km, n_segs, seg);
 		if (n_segs == 2 && opt->pe_ori >= 0 && (opt->flag&MM_F_CIGAR))
@@ -388,7 +388,7 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
 mm_reg1_t *mm_map(const mm_idx_t *mi, int qlen, const char *seq, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname)
 {
 	mm_reg1_t *regs;
-	mm_map_frag(mi, 1, &qlen, &seq, 0, n_regs, &regs, b, opt, qname);
+	mm_map_frag(mi, 1, &qlen, &seq, n_regs, &regs, b, opt, qname);
 	return regs;
 }
 
@@ -402,13 +402,17 @@ typedef struct {
 	mm_bseq_file_t **fp;
 	const mm_idx_t *mi;
 	kstring_t str;
+
+	int n_parts;
+	uint32_t *rid_shift;
+	FILE *fp_split, **fp_parts;
 } pipeline_t;
 
 typedef struct {
 	const pipeline_t *p;
     int n_seq, n_frag;
 	mm_bseq1_t *seq;
-	int *n_reg, *seg_off, *n_seg;
+	int *n_reg, *seg_off, *n_seg, *rep_len, *frag_gap;
 	mm_reg1_t **reg;
 	mm_tbuf_t **buf;
 } step_t;
@@ -416,11 +420,10 @@ typedef struct {
 static void worker_for(void *_data, long i, int tid) // kt_for() callback
 {
     step_t *s = (step_t*)_data;
-	int qlens[MM_MAX_SEG], j, off = s->seg_off[i], pe_ori = s->p->opt->pe_ori, is_sr = !!(s->p->opt->flag & MM_F_SR);
+	int qlens[MM_MAX_SEG], j, off = s->seg_off[i], pe_ori = s->p->opt->pe_ori;
-	const char *qseqs[MM_MAX_SEG], *quals[MM_MAX_SEG];
+	const char *qseqs[MM_MAX_SEG];
 	mm_tbuf_t *b = s->buf[tid];
 	assert(s->n_seg[i] <= MM_MAX_SEG);
-	memset(quals, 0, sizeof(char*) * MM_MAX_SEG);
 	if (mm_dbg_flag & MM_DBG_PRINT_QNAME)
 		fprintf(stderr, "QR\t%s\t%d\t%d\n", s->seq[off].name, tid, s->seq[off].l_seq);
 	for (j = 0; j < s->n_seg[i]; ++j) {
@@ -428,13 +431,19 @@ static void worker_for(void *_data, long i, int tid) // kt_for() callback
 			mm_revcomp_bseq(&s->seq[off + j]);
 		qlens[j] = s->seq[off + j].l_seq;
 		qseqs[j] = s->seq[off + j].seq;
-		quals[j] = is_sr? s->seq[off + j].qual : 0;
 	}
 	if (s->p->opt->flag & MM_F_INDEPEND_SEG) {
-		for (j = 0; j < s->n_seg[i]; ++j)
+		for (j = 0; j < s->n_seg[i]; ++j) {
-			mm_map_frag(s->p->mi, 1, &qlens[j], &qseqs[j], &quals[j], &s->n_reg[off+j], &s->reg[off+j], b, s->p->opt, s->seq[off+j].name);
+			mm_map_frag(s->p->mi, 1, &qlens[j], &qseqs[j], &s->n_reg[off+j], &s->reg[off+j], b, s->p->opt, s->seq[off+j].name);
+			s->rep_len[off + j] = b->rep_len;
+			s->frag_gap[off + j] = b->frag_gap;
+		}
 	} else {
-		mm_map_frag(s->p->mi, s->n_seg[i], qlens, qseqs, quals, &s->n_reg[off], &s->reg[off], b, s->p->opt, s->seq[off].name);
+		mm_map_frag(s->p->mi, s->n_seg[i], qlens, qseqs, &s->n_reg[off], &s->reg[off], b, s->p->opt, s->seq[off].name);
+		for (j = 0; j < s->n_seg[i]; ++j) {
+			s->rep_len[off + j] = b->rep_len;
+			s->frag_gap[off + j] = b->frag_gap;
+		}
 	}
 	for (j = 0; j < s->n_seg[i]; ++j) // flip the query strand and coordinate to the original read strand
 		if (s->n_seg[i] == 2 && ((j == 0 && (pe_ori>>1&1)) || (j == 1 && (pe_ori&1)))) {
@@ -450,17 +459,75 @@ static void worker_for(void *_data, long i, int tid) // kt_for() callback
 		}
 }
 
+static void merge_hits(step_t *s)
+{
+	int f, i, k0, k, max_seg = 0, *n_reg_part, *rep_len_part, *frag_gap_part, *qlens;
+	void *km;
+	FILE **fp = s->p->fp_parts;
+	const mm_mapopt_t *opt = s->p->opt;
+
+	km = km_init();
+	for (f = 0; f < s->n_frag; ++f)
+		max_seg = max_seg > s->n_seg[f]? max_seg : s->n_seg[f];
+	qlens = CALLOC(int, max_seg + s->p->n_parts * 3);
+	n_reg_part = qlens + max_seg;
+	rep_len_part = n_reg_part + s->p->n_parts;
+	frag_gap_part = rep_len_part + s->p->n_parts;
+	for (f = 0, k = k0 = 0; f < s->n_frag; ++f) {
+		k0 = k;
+		for (i = 0; i < s->n_seg[f]; ++i, ++k) {
+			int j, l, t, rep_len = 0;
+			qlens[i] = s->seq[k].l_seq;
+			for (j = 0, s->n_reg[k] = 0; j < s->p->n_parts; ++j) {
+				mm_err_fread(&n_reg_part[j],    sizeof(int), 1, fp[j]);
+				mm_err_fread(&rep_len_part[j],  sizeof(int), 1, fp[j]);
+				mm_err_fread(&frag_gap_part[j], sizeof(int), 1, fp[j]);
+				s->n_reg[k] += n_reg_part[j];
+				if (rep_len < rep_len_part[j])
+					rep_len = rep_len_part[j];
+			}
+			s->reg[k] = CALLOC(mm_reg1_t, s->n_reg[k]);
+			for (j = 0, l = 0; j < s->p->n_parts; ++j) {
+				for (t = 0; t < n_reg_part[j]; ++t, ++l) {
+					mm_reg1_t *r = &s->reg[k][l];
+					uint32_t capacity;
+					mm_err_fread(r, sizeof(mm_reg1_t), 1, fp[j]);
+					r->rid += s->p->rid_shift[j];
+					if (opt->flag & MM_F_CIGAR) {
+						mm_err_fread(&capacity, 4, 1, fp[j]);
+						r->p = (mm_extra_t*)calloc(capacity, 4);
+						r->p->capacity = capacity;
+						mm_err_fread(r->p, r->p->capacity, 4, fp[j]);
+					}
+				}
+			}
+			mm_hit_sort(km, &s->n_reg[k], s->reg[k]);
+			mm_set_parent(km, opt->mask_level, s->n_reg[k], s->reg[k], opt->a * 2 + opt->b);
+			if (!(opt->flag & MM_F_ALL_CHAINS)) {
+				mm_select_sub(km, opt->pri_ratio, s->p->mi->k*2, opt->best_n, &s->n_reg[k], s->reg[k]);
+				mm_set_sam_pri(s->n_reg[k], s->reg[k]);
+			}
+			mm_set_mapq(km, s->n_reg[k], s->reg[k], opt->min_chain_score, opt->a, rep_len, !!(opt->flag & MM_F_SR));
+		}
+		if (s->n_seg[f] == 2 && opt->pe_ori >= 0 && (opt->flag&MM_F_CIGAR))
+			mm_pair(km, frag_gap_part[0], opt->pe_bonus, opt->a * 2 + opt->b, opt->a, qlens, &s->n_reg[k0], &s->reg[k0]);
+	}
+	free(qlens);
+	km_destroy(km);
+}
+
 static void *worker_pipeline(void *shared, int step, void *in)
 {
 	int i, j, k;
     pipeline_t *p = (pipeline_t*)shared;
     if (step == 0) { // step 0: read sequences
 		int with_qual = (!!(p->opt->flag & MM_F_OUT_SAM) && !(p->opt->flag & MM_F_NO_QUAL));
+		int with_comment = !!(p->opt->flag & MM_F_COPY_COMMENT);
 		int frag_mode = (p->n_fp > 1 || !!(p->opt->flag & MM_F_FRAG_MODE));
         step_t *s;
         s = (step_t*)calloc(1, sizeof(step_t));
-		if (p->n_fp > 1) s->seq = mm_bseq_read_frag(p->n_fp, p->fp, p->mini_batch_size, with_qual, &s->n_seq);
+		if (p->n_fp > 1) s->seq = mm_bseq_read_frag2(p->n_fp, p->fp, p->mini_batch_size, with_qual, with_comment, &s->n_seq);
-		else s->seq = mm_bseq_read2(p->fp[0], p->mini_batch_size, with_qual, frag_mode, &s->n_seq);
+		else s->seq = mm_bseq_read3(p->fp[0], p->mini_batch_size, with_qual, with_comment, frag_mode, &s->n_seq);
 		if (s->seq) {
 			s->p = p;
 			for (i = 0; i < s->n_seq; ++i)
@@ -468,9 +535,11 @@ static void *worker_pipeline(void *shared, int step, void *in)
 			s->buf = (mm_tbuf_t**)calloc(p->n_threads, sizeof(mm_tbuf_t*));
 			for (i = 0; i < p->n_threads; ++i)
 				s->buf[i] = mm_tbuf_init();
-			s->n_reg = (int*)calloc(3 * s->n_seq, sizeof(int));
+			s->n_reg = (int*)calloc(5 * s->n_seq, sizeof(int));
-			s->seg_off = s->n_reg + s->n_seq; // seg_off and n_seg are allocated together with n_reg
+			s->seg_off = s->n_reg + s->n_seq; // seg_off, n_seg, rep_len and frag_gap are allocated together with n_reg
 			s->n_seg = s->seg_off + s->n_seq;
+			s->rep_len = s->n_seg + s->n_seq;
+			s->frag_gap = s->rep_len + s->n_seq;
 			s->reg = (mm_reg1_t**)calloc(s->n_seq, sizeof(mm_reg1_t*));
 			for (i = 1, j = 0; i <= s->n_seq; ++i)
 				if (i == s->n_seq || !frag_mode || !mm_qname_same(s->seq[i-1].name, s->seq[i].name)) {
@@ -481,7 +550,8 @@ static void *worker_pipeline(void *shared, int step, void *in)
 			return s;
 		} else free(s);
     } else if (step == 1) { // step 1: map
-		kt_for(p->n_threads, worker_for, in, ((step_t*)in)->n_frag);
+		if (p->n_parts > 0) merge_hits((step_t*)in);
+		else kt_for(p->n_threads, worker_for, in, ((step_t*)in)->n_frag);
 		return in;
     } else if (step == 2) { // step 2: output
 		void *km = 0;
@@ -494,20 +564,36 @@ static void *worker_pipeline(void *shared, int step, void *in)
 			int seg_st = s->seg_off[k], seg_en = s->seg_off[k] + s->n_seg[k];
 			for (i = seg_st; i < seg_en; ++i) {
 				mm_bseq1_t *t = &s->seq[i];
-				for (j = 0; j < s->n_reg[i]; ++j) {
+				if (p->opt->split_prefix && p->n_parts == 0) { // then write to temporary files
-					mm_reg1_t *r = &s->reg[i][j];
+					mm_err_fwrite(&s->n_reg[i],    sizeof(int), 1, p->fp_split);
-					assert(!r->sam_pri || r->id == r->parent);
+					mm_err_fwrite(&s->rep_len[i],  sizeof(int), 1, p->fp_split);
-					if ((p->opt->flag & MM_F_NO_PRINT_2ND) && r->id != r->parent)
+					mm_err_fwrite(&s->frag_gap[i], sizeof(int), 1, p->fp_split);
-						continue;
+					for (j = 0; j < s->n_reg[i]; ++j) {
+						mm_reg1_t *r = &s->reg[i][j];
+						mm_err_fwrite(r, sizeof(mm_reg1_t), 1, p->fp_split);
+						if (p->opt->flag & MM_F_CIGAR) {
+							mm_err_fwrite(&r->p->capacity, 4, 1, p->fp_split);
+							mm_err_fwrite(r->p, r->p->capacity, 4, p->fp_split);
+						}
+					}
+				} else if (s->n_reg[i] > 0) { // the query has at least one hit
+					for (j = 0; j < s->n_reg[i]; ++j) {
+						mm_reg1_t *r = &s->reg[i][j];
+						assert(!r->sam_pri || r->id == r->parent);
+						if ((p->opt->flag & MM_F_NO_PRINT_2ND) && r->id != r->parent)
+							continue;
+						if (p->opt->flag & MM_F_OUT_SAM)
+							mm_write_sam2(&p->str, mi, t, i - seg_st, j, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag);
+						else
+							mm_write_paf(&p->str, mi, t, r, km, p->opt->flag);
+						mm_err_puts(p->str.s);
+					}
+				} else if (p->opt->flag & (MM_F_OUT_SAM|MM_F_PAF_NO_HIT)) { // output an empty hit, if requested
 					if (p->opt->flag & MM_F_OUT_SAM)
-						mm_write_sam2(&p->str, mi, t, i - seg_st, j, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag);
+						mm_write_sam2(&p->str, mi, t, i - seg_st, -1, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag);
 					else
-						mm_write_paf(&p->str, mi, t, r, km, p->opt->flag);
+						mm_write_paf(&p->str, mi, t, 0, 0, p->opt->flag);
-					puts(p->str.s);
+					mm_err_puts(p->str.s);
-				}
-				if (s->n_reg[i] == 0 && (p->opt->flag & MM_F_OUT_SAM)) {
-					mm_write_sam2(&p->str, mi, t, i - seg_st, -1, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag);
-					puts(p->str.s);
 				}
 			}
 			for (i = seg_st; i < seg_en; ++i) {
@@ -515,9 +601,10 @@ static void *worker_pipeline(void *shared, int step, void *in)
 				free(s->reg[i]);
 				free(s->seq[i].seq); free(s->seq[i].name);
 				if (s->seq[i].qual) free(s->seq[i].qual);
+				if (s->seq[i].comment) free(s->seq[i].comment);
 			}
 		}
-		free(s->reg); free(s->n_reg); free(s->seq); // seg_off and n_seg were allocated with reg; no memory leak here
+		free(s->reg); free(s->n_reg); free(s->seq); // seg_off, n_seg, rep_len and frag_gap were allocated with reg; no memory leak here
 		km_destroy(km);
 		if (mm_verbose >= 3)
 			fprintf(stderr, "[M::%s::%.3f*%.2f] mapped %d sequences\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), s->n_seq);
@@ -526,32 +613,44 @@ static void *worker_pipeline(void *shared, int step, void *in)
     return 0;
 }
 
+static mm_bseq_file_t **open_bseqs(int n, const char **fn)
+{
+	mm_bseq_file_t **fp;
+	int i, j;
+	fp = (mm_bseq_file_t**)calloc(n, sizeof(mm_bseq_file_t*));
+	for (i = 0; i < n; ++i) {
+		if ((fp[i] = mm_bseq_open(fn[i])) == 0) {
+			if (mm_verbose >= 1)
+				fprintf(stderr, "ERROR: failed to open file '%s'\n", fn[i]);
+			for (j = 0; j < i; ++j)
+				mm_bseq_close(fp[j]);
+			free(fp);
+			return 0;
+		}
+	}
+	return fp;
+}
+
 int mm_map_file_frag(const mm_idx_t *idx, int n_segs, const char **fn, const mm_mapopt_t *opt, int n_threads)
 {
-	int i, j, pl_threads;
+	int i, pl_threads;
 	pipeline_t pl;
 	if (n_segs < 1) return -1;
 	memset(&pl, 0, sizeof(pipeline_t));
 	pl.n_fp = n_segs;
-	pl.fp = (mm_bseq_file_t**)calloc(n_segs, sizeof(mm_bseq_file_t*));
+	pl.fp = open_bseqs(pl.n_fp, fn);
-	for (i = 0; i < n_segs; ++i) {
+	if (pl.fp == 0) return -1;
-		pl.fp[i] = mm_bseq_open(fn[i]);
-		if (pl.fp[i] == 0) {
-			if (mm_verbose >= 1)
-				fprintf(stderr, "ERROR: failed to open file '%s'\n", fn[i]);
-			for (j = 0; j < i; ++j)
-				mm_bseq_close(pl.fp[j]);
-			free(pl.fp);
-			return -1;
-		}
-	}
 	pl.opt = opt, pl.mi = idx;
 	pl.n_threads = n_threads > 1? n_threads : 1;
 	pl.mini_batch_size = opt->mini_batch_size;
+	if (opt->split_prefix)
+		pl.fp_split = mm_split_init(opt->split_prefix, idx);
 	pl_threads = n_threads == 1? 1 : (opt->flag&MM_F_2_IO_THREADS)? 3 : 2;
 	kt_pipeline(pl_threads, worker_pipeline, &pl, 3);
+
 	free(pl.str.s);
-	for (i = 0; i < n_segs; ++i)
+	if (pl.fp_split) fclose(pl.fp_split);
+	for (i = 0; i < pl.n_fp; ++i)
 		mm_bseq_close(pl.fp[i]);
 	free(pl.fp);
 	return 0;
@@ -561,3 +660,48 @@ int mm_map_file(const mm_idx_t *idx, const char *fn, const mm_mapopt_t *opt, int
 {
 	return mm_map_file_frag(idx, 1, &fn, opt, n_threads);
 }
+
+int mm_split_merge(int n_segs, const char **fn, const mm_mapopt_t *opt, int n_split_idx)
+{
+	int i;
+	pipeline_t pl;
+	mm_idx_t *mi;
+	if (n_segs < 1 || n_split_idx < 1) return -1;
+	memset(&pl, 0, sizeof(pipeline_t));
+	pl.n_fp = n_segs;
+	pl.fp = open_bseqs(pl.n_fp, fn);
+	if (pl.fp == 0) return -1;
+	pl.opt = opt;
+	pl.mini_batch_size = opt->mini_batch_size;
+
+	pl.n_parts = n_split_idx;
+	pl.fp_parts  = CALLOC(FILE*, pl.n_parts);
+	pl.rid_shift = CALLOC(uint32_t, pl.n_parts);
+	pl.mi = mi = mm_split_merge_prep(opt->split_prefix, n_split_idx, pl.fp_parts, pl.rid_shift);
+	if (pl.mi == 0) {
+		free(pl.fp_parts);
+		free(pl.rid_shift);
+		return -1;
+	}
+	for (i = n_split_idx - 1; i > 0; --i)
+		pl.rid_shift[i] = pl.rid_shift[i - 1];
+	for (pl.rid_shift[0] = 0, i = 1; i < n_split_idx; ++i)
+		pl.rid_shift[i] += pl.rid_shift[i - 1];
+	if (opt->flag & MM_F_OUT_SAM)
+		for (i = 0; i < (int32_t)pl.mi->n_seq; ++i)
+			printf("@SQ\tSN:%s\tLN:%d\n", pl.mi->seq[i].name, pl.mi->seq[i].len);
+
+	kt_pipeline(2, worker_pipeline, &pl, 3);
+
+	free(pl.str.s);
+	mm_idx_destroy(mi);
+	free(pl.rid_shift);
+	for (i = 0; i < n_split_idx; ++i)
+		fclose(pl.fp_parts[i]);
+	free(pl.fp_parts);
+	for (i = 0; i < pl.n_fp; ++i)
+		mm_bseq_close(pl.fp[i]);
+	free(pl.fp);
+	mm_split_rm_tmp(opt->split_prefix, n_split_idx);
+	return 0;
+}

minimap.h

@@ -5,26 +5,35 @@
 #include <stdio.h>
 #include <sys/types.h>
 
-#define MM_F_NO_SELF     0x001
+#define MM_F_NO_DIAG       0x001 // no exact diagonal hit
-#define MM_F_AVA         0x002
+#define MM_F_NO_DUAL       0x002 // skip pairs where query name is lexicographically larger than target name
-#define MM_F_CIGAR       0x004
+#define MM_F_CIGAR         0x004
-#define MM_F_OUT_SAM     0x008
+#define MM_F_OUT_SAM       0x008
-#define MM_F_NO_QUAL     0x010
+#define MM_F_NO_QUAL       0x010
-#define MM_F_OUT_CG      0x020
+#define MM_F_OUT_CG        0x020
-#define MM_F_OUT_CS      0x040
+#define MM_F_OUT_CS        0x040
-#define MM_F_SPLICE      0x080 // splice mode
+#define MM_F_SPLICE        0x080 // splice mode
-#define MM_F_SPLICE_FOR  0x100 // match GT-AG
+#define MM_F_SPLICE_FOR    0x100 // match GT-AG
-#define MM_F_SPLICE_REV  0x200 // match CT-AC, the reverse complement of GT-AG
+#define MM_F_SPLICE_REV    0x200 // match CT-AC, the reverse complement of GT-AG
-#define MM_F_NO_LJOIN    0x400
+#define MM_F_NO_LJOIN      0x400
-#define MM_F_OUT_CS_LONG 0x800
+#define MM_F_OUT_CS_LONG   0x800
-#define MM_F_SR          0x1000
+#define MM_F_SR            0x1000
-#define MM_F_FRAG_MODE   0x2000
+#define MM_F_FRAG_MODE     0x2000
 #define MM_F_NO_PRINT_2ND  0x4000
 #define MM_F_2_IO_THREADS  0x8000
 #define MM_F_LONG_CIGAR    0x10000
 #define MM_F_INDEPEND_SEG  0x20000
 #define MM_F_SPLICE_FLANK  0x40000
 #define MM_F_SOFTCLIP      0x80000
+#define MM_F_FOR_ONLY      0x100000
+#define MM_F_REV_ONLY      0x200000
+#define MM_F_HEAP_SORT     0x400000
+#define MM_F_ALL_CHAINS    0x800000
+#define MM_F_OUT_MD        0x1000000
+#define MM_F_COPY_COMMENT  0x2000000
+#define MM_F_EQX           0x4000000 // use =/X instead of M
+#define MM_F_PAF_NO_HIT    0x8000000 // output unmapped reads to PAF
+#define MM_F_NO_END_FLT    0x10000000
 
 #define MM_I_HPC          0x1
 #define MM_I_NO_SEQ       0x2
@@ -52,10 +61,11 @@ typedef struct {
 typedef struct {
 	int32_t b, w, k, flag;
 	uint32_t n_seq;            // number of reference sequences
+	int32_t index;
 	mm_idx_seq_t *seq;         // sequence name, length and offset
 	uint32_t *S;               // 4-bit packed sequence
 	struct mm_idx_bucket_s *B; // index (hidden)
-	void *km;
+	void *km, *h;
 } mm_idx_t;
 
 // minimap2 alignment
@@ -78,7 +88,7 @@ typedef struct {
 	int32_t mlen, blen;     // seeded exact match length; seeded alignment block length
 	int32_t n_sub;          // number of suboptimal mappings
 	int32_t score0;         // initial chaining score (before chain merging/spliting)
-	uint32_t mapq:8, split:2, rev:1, inv:1, sam_pri:1, proper_frag:1, pe_thru:1, seg_split:1, dummy:16;
+	uint32_t mapq:8, split:2, rev:1, inv:1, sam_pri:1, proper_frag:1, pe_thru:1, seg_split:1, seg_id:8, split_inv:1, dummy:7;
 	uint32_t hash;
 	float div;
 	mm_extra_t *p;
@@ -109,21 +119,27 @@ typedef struct {
 
 	int max_join_long, max_join_short;
 	int min_join_flank_sc;
+	float min_join_flank_ratio;
 
 	int a, b, q, e, q2, e2; // matching score, mismatch, gap-open and gap-ext penalties
+	int sc_ambi; // score when one or both bases are "N"
 	int noncan;      // cost of non-canonical splicing sites
-	int zdrop;       // break alignment if alignment score drops too fast along the diagonal
+	int zdrop, zdrop_inv;   // break alignment if alignment score drops too fast along the diagonal
 	int end_bonus;
 	int min_dp_max;  // drop an alignment if the score of the max scoring segment is below this threshold
 	int min_ksw_len;
 	int anchor_ext_len, anchor_ext_shift;
+	float max_clip_ratio; // drop an alignment if BOTH ends are clipped above this ratio
 
 	int pe_ori, pe_bonus;
 
 	float mid_occ_frac;  // only used by mm_mapopt_update(); see below
+	int32_t min_mid_occ;
 	int32_t mid_occ;     // ignore seeds with occurrences above this threshold
 	int32_t max_occ;
 	int mini_batch_size; // size of a batch of query bases to process in parallel
+
+	const char *split_prefix;
 } mm_mapopt_t;
 
 // index reader
@@ -155,6 +171,7 @@ extern double mm_realtime0; // wall-clock timer
  * @return 0 if success; -1 if _present_ unknown
  */
 int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo);
+int mm_check_opt(const mm_idxopt_t *io, const mm_mapopt_t *mo);
 
 /**
  * Update mm_mapopt_t::mid_occ via mm_mapopt_t::mid_occ_frac
@@ -207,6 +224,51 @@ void mm_idx_reader_close(mm_idx_reader_t *r);
 
 int mm_idx_reader_eof(const mm_idx_reader_t *r);
 
+/**
+ * Check whether the file contains a minimap2 index
+ *
+ * @param fn         file name
+ *
+ * @return the file size if fn is an index file; 0 if fn is not.
+ */
+int64_t mm_idx_is_idx(const char *fn);
+
+/**
+ * Load a part of an index
+ *
+ * Given a uni-part index, this function loads the entire index into memory.
+ * Given a multi-part index, it loads one part only and places the file pointer
+ * at the end of that part.
+ *
+ * @param fp         pointer to FILE object
+ *
+ * @return minimap2 index read from fp
+ */
+mm_idx_t *mm_idx_load(FILE *fp);
+
+/**
+ * Append an index (or one part of a full index) to file
+ *
+ * @param fp         pointer to FILE object
+ * @param mi         minimap2 index
+ */
+void mm_idx_dump(FILE *fp, const mm_idx_t *mi);
+
+/**
+ * Create an index from strings in memory
+ *
+ * @param w            minimizer window size
+ * @param k            minimizer k-mer size
+ * @param is_hpc       use HPC k-mer if true
+ * @param bucket_bits  number of bits for the first level of the hash table
+ * @param n            number of sequences
+ * @param seq          sequences in A/C/G/T
+ * @param name         sequence names; could be NULL
+ *
+ * @return minimap2 index
+ */
+mm_idx_t *mm_idx_str(int w, int k, int is_hpc, int bucket_bits, int n, const char **seq, const char **name);
+
 /**
  * Print index statistics to stderr
  *
@@ -240,6 +302,8 @@ mm_tbuf_t *mm_tbuf_init(void);
  */
 void mm_tbuf_destroy(mm_tbuf_t *b);
 
+void *mm_tbuf_get_km(mm_tbuf_t *b);
+
 /**
  * Align a query sequence against an index
  *
@@ -260,6 +324,8 @@ void mm_tbuf_destroy(mm_tbuf_t *b);
  */
 mm_reg1_t *mm_map(const mm_idx_t *mi, int l_seq, const char *seq, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *name);
 
+void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, int *n_regs, mm_reg1_t **regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname);
+
 /**
  * Align a fasta/fastq file and print alignments to stdout
  *
@@ -274,6 +340,27 @@ int mm_map_file(const mm_idx_t *idx, const char *fn, const mm_mapopt_t *opt, int
 
 int mm_map_file_frag(const mm_idx_t *idx, int n_segs, const char **fn, const mm_mapopt_t *opt, int n_threads);
 
+/**
+ * Generate the cs tag (new in 2.12)
+ *
+ * @param km         memory blocks; set to NULL if unsure
+ * @param buf        buffer to write the cs/MD tag; typicall NULL on the first call
+ * @param max_len    max length of the buffer; typically set to 0 on the first call
+ * @param mi         index
+ * @param r          alignment
+ * @param seq        query sequence
+ * @param no_iden    true to use : instead of =
+ *
+ * @return the length of cs
+ */
+int mm_gen_cs(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int no_iden);
+int mm_gen_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq);
+
+// query sequence name and sequence in the minimap2 index
+int mm_idx_index_name(mm_idx_t *mi);
+int mm_idx_name2id(const mm_idx_t *mi, const char *name);
+int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq);
+
 // deprecated APIs for backward compatibility
 void mm_mapopt_init(mm_mapopt_t *opt);
 mm_idx_t *mm_idx_build(const char *fn, int w, int k, int flag, int n_threads);

minimap2.1

@@ -1,4 +1,4 @@
-.TH minimap2 1 "12 December 2017" "minimap2-2.6 (r623)" "Bioinformatics tools"
+.TH minimap2 1 "6 August 2018" "minimap2-2.12 (r827)" "Bioinformatics tools"
 .SH NAME
 .PP
 minimap2 - mapping and alignment between collections of DNA sequences
@@ -123,13 +123,30 @@ provided as the target sequences, options
 will be effectively overridden by the options stored in the index file.
 .SS Mapping options
 .TP 10
-.BI -f \ FLOAT
+.BI -f \ FLOAT | INT1 [, INT2 ]
-Ignore top
+If fraction, ignore top
 .I FLOAT
-fraction of most frequent minimizers [0.0002]
+fraction of most frequent minimizers [0.0002]. If integer,
+ignore minimizers occuring more than
+.I INT1
+times.
+.I INT2
+is only effective in the
+.B --sr
+or
+.B -xsr
+mode, which sets the threshold for a second round of seeding.
+.TP
+.BI --min-occ-floor \ INT
+Force minimap2 to always use k-mers occurring
+.I INT
+times or less [0]. In effect, the max occurrence threshold is set to
+the
+.RI max{ INT ,
+.BR -f }.
 .TP
 .BI -g \ INT
-Stop chain enlongation if there are no minimizers in
+Stop chain enlongation if there are no minimizers within
 .IR INT -bp
 [10000].
 .TP
@@ -148,11 +165,30 @@ Discard chains with chaining score
 [40]. Chaining score equals the approximate number of matching bases minus a
 concave gap penalty. It is computed with dynamic programming.
 .TP
+.B -D
+If query sequence name/length are identical to the target name/length, ignore
+diagonal anchors. This option also reduces DP-based extension along the
+diagonal.
+.TP
+.B -P
+Retain all chains and don't attempt to set primary chains. Options
+.B -p
+and
+.B -N
+have no effect when this option is in use.
+.TP
+.BR --dual = yes | no
+If
+.BR no ,
+skip query-target pairs wherein the query name is lexicographically greater
+than the target name [yes]
+.TP
 .B -X
-Perform all-vs-all mapping. In this mode, if the query sequence name is
+Equivalent to
-lexicographically larger than the target sequence name, the hits between them
+.RB ' -DP
-will be suppressed; if the query sequence name is the same as the target name,
+.BR --dual = no
-diagonal minimizer hits will also be suppressed.
+.BR --no-long-join '.
+Primarily used for all-vs-all read overlapping.
 .TP
 .BI -p \ FLOAT
 Minimal secondary-to-primary score ratio to output secondary mappings [0.8].
@@ -162,6 +198,9 @@ the chain with a lower score is secondary to the chain with a higher score.
 If the ratio of the scores is below
 .IR FLOAT ,
 the secondary chain will not be outputted or extended with DP alignment later.
+This option has no effect when
+.B -X
+is applied.
 .TP
 .BI -N \ INT
 Output at most
@@ -179,9 +218,14 @@ Increasing this option slows down spliced alignment. [200k]
 .TP
 .BI -F \ NUM
 Maximum fragment length (aka insert size; effective with
-.BR -xsr / --frag)
+.BR -xsr / --frag = yes )
 [800]
 .TP
+.BI -M \ FLOAT
+Mark as secondary a chain that overlaps with a better chain by
+.I FLOAT
+or more of the shorter chain [0.5]
+.TP
 .BI --max-chain-skip \ INT
 A heuristics that stops chaining early [50]. Minimap2 uses dynamic programming
 for chaining. The time complexity is quadratic in the number of seeds. This
@@ -195,6 +239,10 @@ Disable the long gap patching heuristic. When this option is applied, the
 maximum alignment gap is mostly controlled by
 .BR -r .
 .TP
+.BI --lj-min-ratio \ FLOAT
+Fraction of query sequence length required to bridge a long gap [0.5]. A
+smaller value helps to recover longer gaps, at the cost of more false gaps.
+.TP
 .B --splice
 Enable the splice alignment mode.
 .TP
@@ -204,8 +252,23 @@ applies a second round of chaining with a higher minimizer occurrence threshold
 if no good chain is found. In addition, minimap2 attempts to patch gaps between
 seeds with ungapped alignment.
 .TP
-.BR --frag [= no | yes ]
+.BI --split-prefix \ STR
+Prefix to create temporary files. Typically used for a multi-part index.
+.TP
+.BR --frag = no | yes
 Whether to enable the fragment mode [no]
+.TP
+.B --for-only
+Only map to the forward strand of the reference sequences. For paired-end
+reads in the forward-reverse orientation, the first read is mapped to forward
+strand of the reference and the second read to the reverse stand.
+.TP
+.B --rev-only
+Only map to the reverse complement strand of the reference sequences.
+.TP
+.BR --heap-sort = no | yes
+If yes, sort anchors with heap merge, instead of radix sort. Heap merge is
+faster for short reads, but slower for long reads. [no]
 .SS Alignment options
 .TP 10
 .BI -A \ INT
@@ -232,11 +295,22 @@ Cost for a non-canonical GT-AG splicing (effective with
 .BR --splice )
 [0]
 .TP
-.BI -z \ INT
+.BI -z \ INT1[,INT2]
-Break an alignment if the running score drops too quickly along the diagonal of
+Truncate an alignment if the running alignment score drops too quickly along
-the DP matrix (diagonal X-drop, or Z-drop) [400]. Increasing the value improves
+the diagonal of the DP matrix (diagonal X-drop, or Z-drop) [400,200]. If the
-the contiguity of the alignment at the cost of poor alignment in the middle
+drop of score is above
-(e.g. caused by a long inversion).
+.IR INT2 ,
+minimap2 will reverse complement the query in the related region and align
+again to test small inversions. Minimap2 truncates alignment if there is an
+inversion or the drop of score is greater than
+.IR INT1 .
+Decrease
+.I INT2
+to find small inversions at the cost of performance and false positives.
+Increase
+.I INT1
+to improves the contiguity of alignment at the cost of poor alignment in the
+middle.
 .TP
 .BI -s \ INT
 Minimal peak DP alignment score to output [40]. The peak score is computed from
@@ -255,14 +329,16 @@ no attempt to match GT-AG [n]
 .BI --end-bonus \ INT
 Score bonus when alignment extends to the end of the query sequence [0].
 .TP
-.BR --splice-flank [= yes | no ]
+.BI --score-N \ INT
+Score of a mismatch involving ambiguous bases [1].
+.TP
+.BR --splice-flank = yes | no
 Assume the next base to a
 .B GT
 donor site tends to be A/G (91% in human and 92% in mouse) and the preceding
 base to a
 .B AG
-acceptor tends to be C/T [yes with
+acceptor tends to be C/T [no].
-.BR --splice ].
 This trend is evolutionarily conservative, all the way to S. cerevisiae
 (PMID:18688272). Specifying this option generally leads to higher junction
 accuracy by several percents, so it is applied by default with
@@ -284,6 +360,10 @@ the length of the terminal gap in the chain. This option is only effective
 with
 .BR --splice .
 It helps to avoid tiny terminal exons. [6]
+.TP
+.B --no-end-flt
+Don't filter seeds towards the ends of chains before performing base-level
+alignment.
 .SS Input/output options
 .TP 10
 .B -a
@@ -304,6 +384,9 @@ SAM read group line in a format like
 .B @RG\\\\tID:foo\\\\tSM:bar
 [].
 .TP
+.B -y
+Copy input FASTA/Q comments to output.
+.TP
 .B -c
 Generate CIGAR. In PAF, the CIGAR is written to the `cg' custom tag.
 .TP
@@ -322,6 +405,12 @@ is given,
 .I short
 is assumed. [none]
 .TP
+.B --MD
+Output the MD tag (see the SAM spec).
+.TP
+.B --eqx
+Output =/X CIGAR operators for sequence match/mismatch.
+.TP
 .B -Y
 In SAM output, use soft clipping for supplementary alignments.
 .TP
@@ -352,7 +441,7 @@ K/M/G/k/m/g suffix is accepted. A large
 helps load balancing in the multi-threading mode, at the cost of increased
 memory.
 .TP
-.BR --secondary [= yes | no ]
+.BR --secondary = yes | no
 Whether to output secondary alignments [yes]
 .TP
 .B --version
@@ -384,28 +473,35 @@ is determined by the sequencing error mode.
 .B asm5
 Long assembly to reference mapping
 .RB ( -k19
-.B -w19 -A1 -B19 -O39,81 -E3,1 -s200
+.B -w19 -A1 -B19 -O39,81 -E3,1 -s200 -z200
-.BR -z200 ).
+.BR --min-occ-floor=100 ).
 Typically, the alignment will not extend to regions with 5% or higher sequence
 divergence. Only use this preset if the average divergence is far below 5%.
 .TP
 .B asm10
 Long assembly to reference mapping
 .RB ( -k19
-.B -w19 -A1 -B9 -O16,41 -E2,1 -s200
+.B -w19 -A1 -B9 -O16,41 -E2,1 -s200 -z200
-.BR -z200 ).
+.BR --min-occ-floor=100 ).
 Up to 10% sequence divergence.
 .TP
+.B asm20
+Long assembly to reference mapping
+.RB ( -k19
+.B -w10 -A1 -B6 -O6,26 -E2,1 -s200 -z200
+.BR --min-occ-floor=100 ).
+Up to 20% sequence divergence.
+.TP
 .B ava-pb
 PacBio all-vs-all overlap mapping
 .RB ( -Hk19
-.B -w5 -Xp0 -m100 -g10000 --max-chain-skip
+.B -Xw5 -m100 -g10000 --max-chain-skip
 .BR 25 ).
 .TP
 .B ava-ont
 Oxford Nanopore all-vs-all overlap mapping
 .RB ( -k15
-.B -w5 -Xp0 -m100 -g10000 --max-chain-skip
+.B -Xw5 -m100 -g10000 -r2000 --max-chain-skip
 .BR 25 ).
 Similarly, the major difference from
 .B ava-pb
@@ -427,8 +523,8 @@ tag ignores introns to demote hits to pseudogenes.
 .B sr
 Short single-end reads without splicing
 .RB ( -k21
-.B -w11 --sr --frag -A2 -B8 -O12,32 -E2,1 -r50 -p.5 -N20 -f1000,5000 -n2 -m20
+.B -w11 --sr --frag=yes -A2 -B8 -O12,32 -E2,1 -r50 -p.5 -N20 -f1000,5000 -n2 -m20
-.B -s40 -g200 -2K50m
+.B -s40 -g200 -2K50m --heap-sort=yes
 .BR --secondary=no ).
 .RE
 .SS Miscellaneous options
@@ -486,12 +582,14 @@ cm	i	Number of minimizers on the chain
 s1	i	Chaining score
 s2	i	Chaining score of the best secondary chain
 NM	i	Total number of mismatches and gaps in the alignment
+MD	Z	To generate the ref sequence in the alignment
 AS	i	DP alignment score
 ms	i	DP score of the max scoring segment in the alignment
 nn	i	Number of ambiguous bases in the alignment
 ts	A	Transcript strand (splice mode only)
 cg	Z	CIGAR string (only in PAF)
 cs	Z	Difference string
+dv	f	Approximate per-base sequence divergence
 .TE
 
 .PP
@@ -522,8 +620,8 @@ where seed positions may be suboptimal. This should not be a big concern
 because even the optimal alignment may be wrong in such regions.
 .TP
 *
-Minimap2 requires SSE2 instructions to compile. It is possible to add
+Minimap2 requires SSE2 or NEON instructions to compile. It is possible to add
-non-SSE2 support, but it would make minimap2 slower by several times.
+non-SSE2/NEON support, but it would make minimap2 slower by several times.
 .SH SEE ALSO
 .PP
 miniasm(1), minimap(1), bwa(1).

misc.c

@@ -1,4 +1,5 @@
-#include "minimap.h"
+#include <stdlib.h>
+#include "mmpriv.h"
 
 int mm_verbose = 1;
 int mm_dbg_flag = 0;
@@ -86,6 +87,8 @@ double cputime()
 
 	return kernelModeTime + userModeTime;
 }
+
+long peakrss(void) { return 0; }
 #else
 #include <sys/resource.h>
 #include <sys/time.h>
@@ -96,6 +99,18 @@ double cputime(void)
 	getrusage(RUSAGE_SELF, &r);
 	return r.ru_utime.tv_sec + r.ru_stime.tv_sec + 1e-6 * (r.ru_utime.tv_usec + r.ru_stime.tv_usec);
 }
+
+long peakrss(void)
+{
+	struct rusage r;
+	getrusage(RUSAGE_SELF, &r);
+#ifdef __linux__
+	return r.ru_maxrss * 1024;
+#else
+	return r.ru_maxrss;
+#endif
+}
+
 #endif /* WIN32 || _WIN32 */
 
 double realtime(void)
@@ -106,6 +121,36 @@ double realtime(void)
 	return tp.tv_sec + tp.tv_usec * 1e-6;
 }
 
+void mm_err_puts(const char *str)
+{
+	int ret;
+	ret = puts(str);
+	if (ret == EOF) {
+		fprintf(stderr, "[ERROR] failed to write the results\n");
+		exit(EXIT_FAILURE);
+	}
+}
+
+void mm_err_fwrite(const void *p, size_t size, size_t nitems, FILE *fp)
+{
+	int ret;
+	ret = fwrite(p, size, nitems, fp);
+	if (ret == EOF) {
+		fprintf(stderr, "[ERROR] failed to write data\n");
+		exit(EXIT_FAILURE);
+	}
+}
+
+void mm_err_fread(void *p, size_t size, size_t nitems, FILE *fp)
+{
+	int ret;
+	ret = fread(p, size, nitems, fp);
+	if (ret == EOF) {
+		fprintf(stderr, "[ERROR] failed to read data\n");
+		exit(EXIT_FAILURE);
+	}
+}
+
 #include "ksort.h"
 
 #define sort_key_128x(a) ((a).x)

misc/README.md

@@ -1,28 +1,179 @@
-The [K8 Javascript shell][k8] is needed to run Javascripts in this directory.
+## <a name="started"></a>Getting Started
-Precompiled k8 binaries for Mac and Linux can be found at the [K8 release
-page][k8bin].
 
-* [paf2aln.js](paf2aln.js): convert PAF to [MAF][maf] or BLAST-like output for
+```sh
-  eyeballing. PAF has to be generated with minimap2 option `-S`, which writes
+# install minimap2
-  the aligned sequences to the `cs` tag. An example:
+git clone https://github.com/lh3/minimap2
-  ```sh
+cd minimap2 && make
-  ../minimap2 -S ../test/MT-*.fa | k8 paf2aln.js /dev/stdin
+# install the k8 javascript shell
-  ```
+curl -L https://github.com/attractivechaos/k8/releases/download/v0.2.4/k8-0.2.4.tar.bz2 | tar -jxf -
+cp k8-0.2.4/k8-`uname -s` k8              # or copy it to a directory on your $PATH
+# export PATH="$PATH:`pwd`:`pwd`/misc"    # run this if k8, minimap2 or paftools.js not on your $PATH
+minimap2 --cs test/MT-human.fa test/MT-orang.fa | paftools.js view -     # view alignment
+minimap2 -c test/MT-human.fa test/MT-orang.fa | paftools.js stat -       # basic alignment statistics
+minimap2 -c --cs test/MT-human.fa test/MT-orang.fa \
+  | sort -k6,6 -k8,8n | paftools.js call -L15000 -     # calling variants from asm-to-ref alignment
+minimap2 -c test/MT-human.fa test/MT-orang.fa \
+  | paftools.js liftover -l10000 - <(echo -e "MT_orang\t2000\t5000")     # liftOver
+# no test data for the following examples
+paftools.js junceval -e anno.gtf splice.sam > out.txt  # compare splice junctions to annotations
+paftools.js splice2bed anno.gtf > anno.bed             # convert GTF/GFF3 to BED12
+```
 
-* [mapstat.js](mapstat.js): output basic statistics such as the number of
+## Table of Contents
-  non-redundant mapped bases, number of split and secondary alignments and
-  number of long gaps. This scripts seamlessly works with both SAM and PAF.
 
-* [sim-pbsim.js](sim-pbsim.js): convert reads simulated with [PBSIM][pbsim] to
+- [Getting Started](#started)
-  FASTA and encode the true mapping positions to read names in a format like
+- [Introduction](#intro)
-  `S1_33!chr1!225258409!225267761!-`.
+- [Evaluation](#eval)
+  - [Evaluating mapping accuracy with simulated reads](#mapeval)
+  - [Evaluating read overlap sensitivity](#oveval)
+- [Calling Variants from Assemblies](#asmvar)
 
-* [sim-eval.js](sim-eval.js): evaluate mapping accuracy for FASTA generated
+## <a name="intro"></a>Introduction
-  with [sim-pbsim.js](sim-pbsim.js) or [sim-mason2.js](sim-mason2.js).
 
-* [sam2paf.js](sam2paf.js): convert SAM to PAF.
+paftools.js is a script that processes alignments in the [PAF format][paf],
+such as converting between formats, evaluating mapping accuracy, lifting over
+BED files based on alignment, and calling variants from assembly-to-assembly
+alignment. This script *requires* the [k8 Javascript shell][k8] to run. On
+Linux or Mac, you can download the precompiled k8 binary with:
 
+```sh
+curl -L https://github.com/attractivechaos/k8/releases/download/v0.2.4/k8-0.2.4.tar.bz2 | tar -jxf -
+cp k8-0.2.4/k8-`uname -s` $HOME/bin/k8  # assuming $HOME/bin in your $PATH
+```
+
+It is highly recommended to copy the executable `k8` to a directory on your
+`$PATH` such as `/usr/bin/env` can find it. Like python scripts, once you
+install `k8`, you can launch paftools.js in one of the two ways:
+
+```sh
+path/to/paftools.js             # only if k8 is on your $PATH
+k8 path/to/paftools.js
+```
+
+In a nutshell, paftools.js has the following commands:
+
+```
+Usage: paftools.js <command> [arguments]
+Commands:
+  view       convert PAF to BLAST-like (for eyeballing) or MAF
+  splice2bed convert spliced alignment in PAF/SAM to BED12
+  sam2paf    convert SAM to PAF
+  delta2paf  convert MUMmer's delta to PAF
+  gff2bed    convert GTF/GFF3 to BED12
+
+  stat       collect basic mapping information in PAF/SAM
+  liftover   simplistic liftOver
+  call       call variants from asm-to-ref alignment with the cs tag
+  bedcov     compute the number of bases covered
+
+  mapeval    evaluate mapping accuracy using mason2/PBSIM-simulated FASTQ
+  mason2fq   convert mason2-simulated SAM to FASTQ
+  pbsim2fq   convert PBSIM-simulated MAF to FASTQ
+  junceval   evaluate splice junction consistency with known annotations
+  ov-eval    evaluate read overlap sensitivity using read-to-ref mapping
+```
+
+paftools.js seamlessly reads both plain text files and gzip'd text files.
+
+## <a name="eval"></a>Evaluation
+
+### <a name="mapeval"></a>Evaluating mapping accuracy with simulated reads
+
+The **pbsim2fq** command of paftools.js converts the MAF output of [pbsim][pbsim]
+to FASTQ and encodes the true mapping position in the read name in a format like
+`S1_33!chr1!225258409!225267761!-`. Similarly, the **mason2fq** command
+converts [mason2][mason2] simulated SAM to FASTQ.
+
+Command **mapeval** evaluates mapped SAM/PAF. Here is example output:
+
+```
+Q       60      32478   0       0.000000000     32478
+Q       22      16      1       0.000030775     32494
+Q       21      43      1       0.000061468     32537
+Q       19      73      1       0.000091996     32610
+Q       14      66      1       0.000122414     32676
+Q       10      27      3       0.000214048     32703
+Q       8       14      1       0.000244521     32717
+Q       7       13      2       0.000305530     32730
+Q       6       46      1       0.000335611     32776
+Q       3       10      1       0.000366010     32786
+Q       2       20      2       0.000426751     32806
+Q       1       248     94      0.003267381     33054
+Q       0       31      17      0.003778147     33085
+U       3
+```
+
+where each Q-line gives the quality threshold, the number of reads mapped with
+mapping quality equal to or greater than the threshold, number of wrong
+mappings, accumulative mapping error rate and the accumulative number of
+mapped reads. The U-line, if present, gives the number of unmapped reads if
+they are present in the SAM file.
+
+Suppose the reported mapping coordinate overlap with the true coordinate like
+the following:
+
+```
+truth:   --------------------
+mapper:           ----------------------
+         |<- l1 ->|<-- o -->|<-- l2 -->|
+```
+
+Let `r=o/(l1+o+l2)`. The reported mapping is considered correct if `r>0.1` by
+default.
+
+### <a name="oveval"></a>Evaluating read overlap sensitivity
+
+Command **ov-eval** takes *sorted* read-to-reference alignment and read
+overlaps in PAF as input, and evaluates the sensitivity. For example:
+
+```sh
+minimap2 -cx map-pb ref.fa reads.fq.gz | sort -k6,6 -k8,8n > reads-to-ref.paf
+minimap2 -x ava-pb reads.fq.gz reads.fq.gz > ovlp.paf
+k8 ov-eval.js reads-to-ref.paf ovlp.paf
+```
+
+## <a name="asmvar"></a>Calling Variants from Haploid Assemblies
+
+The **call** command of paftools.js calls variants from coordinate-sorted
+assembly-to-reference alignment. It calls variants from the [cs tag][cs] and
+identifies confident/callable regions as those covered by exactly one contig.
+Here are example command lines:
+
+```sh
+minimap2 -cx asm5 -t8 --cs ref.fa asm.fa > asm.paf  # keeping this file is recommended; --cs required!
+sort -k6,6 -k8,8n asm.paf > asm.srt.paf             # sort by reference start coordinate
+k8 paftools.js call asm.srt.paf > asm.var.txt
+```
+
+Here is sample output:
+
+```
+V   chr1    2276040 2276041 1   60  c   g   LJII01000171.1  1217409 1217410 +
+V   chr1    2280409 2280410 1   60  a   g   LJII01000171.1  1221778 1221779 +
+V   chr1    2280504 2280505 1   60  a   g   LJII01000171.1  1221873 1221874 +
+R   chr1    2325140 2436340
+V   chr1    2325287 2325287 1   60  -   ct  LJII01000171.1  1272894 1272896 +
+V   chr1    2325642 2325644 1   60  tt  -   LJII01000171.1  1273251 1273251 +
+V   chr1    2326051 2326052 1   60  c   t   LJII01000171.1  1273658 1273659 +
+V   chr1    2326287 2326288 1   60  c   t   LJII01000171.1  1273894 1273895 +
+```
+
+where a line starting with `R` gives regions covered by one query contig, and a
+V-line encodes a variant in the following format: chr, start, end, query depth,
+mapping quality, REF allele, ALT allele, query name, query start, end and the
+query orientation. Generally, you should only look at variants where column 5
+is one.
+
+By default, when calling variants, "paftools.js call" ignores alignments 50kb
+or shorter; when deriving callable regions, it ignores alignments 10kb or
+shorter.  It uses two thresholds to avoid edge effects. These defaults are
+designed for long-read assemblies. For short reads, both should be reduced.
+
+
+
+[paf]: https://github.com/lh3/miniasm/blob/master/PAF.md
+[cs]: https://github.com/lh3/minimap2#cs
 [k8]: https://github.com/attractivechaos/k8
-[k8bin]: https://github.com/attractivechaos/k8/releases
 [maf]: https://genome.ucsc.edu/FAQ/FAQformat#format5
 [pbsim]: https://github.com/pfaucon/PBSIM-PacBio-Simulator
+[mason2]: https://github.com/seqan/seqan/tree/master/apps/mason2

misc/intron-eval.js

@@ -1,267 +0,0 @@
-/*******************************
- * Command line option parsing *
- *******************************/
-
-var getopt = function(args, ostr) {
-	var oli; // option letter list index
-	if (typeof(getopt.place) == 'undefined')
-		getopt.ind = 0, getopt.arg = null, getopt.place = -1;
-	if (getopt.place == -1) { // update scanning pointer
-		if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
-			getopt.place = -1;
-			return null;
-		}
-		if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
-			++getopt.ind;
-			getopt.place = -1;
-			return null;
-		}
-	}
-	var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
-	if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
-		if (optopt == '-') return null; //  if the user didn't specify '-' as an option, assume it means null.
-		if (getopt.place < 0) ++getopt.ind;
-		return '?';
-	}
-	if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
-		getopt.arg = null;
-		if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
-	} else { // need an argument
-		if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
-			getopt.arg = args[getopt.ind].substr(getopt.place);
-		else if (args.length <= ++getopt.ind) { // no arg
-			getopt.place = -1;
-			if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
-			return '?';
-		} else getopt.arg = args[getopt.ind]; // white space
-		getopt.place = -1;
-		++getopt.ind;
-	}
-	return optopt;
-}
-
-/***********************
- * Interval operations *
- ***********************/
-
-Interval = {};
-
-Interval.sort = function(a)
-{
-	if (typeof a[0] == 'number')
-		a.sort(function(x, y) { return x - y });
-	else a.sort(function(x, y) { return x[0] != y[0]? x[0] - y[0] : x[1] - y[1] });
-}
-
-Interval.merge = function(a, sorted)
-{
-	if (typeof sorted == 'undefined') sorted = true;
-	if (!sorted) Interval.sort(a);
-	var k = 0;
-	for (var i = 1; i < a.length; ++i) {
-		if (a[k][1] >= a[i][0])
-			a[k][1] = a[k][1] > a[i][1]? a[k][1] : a[i][1];
-		else a[++k] = a[i].slice(0);
-	}
-	a.length = k + 1;
-}
-
-Interval.index_end = function(a, sorted)
-{
-	if (a.length == 0) return;
-	if (typeof sorted == 'undefined') sorted = true;
-	if (!sorted) Interval.sort(a);
-	a[0].push(0);
-	var k = 0, k_en = a[0][1];
-	for (var i = 1; i < a.length; ++i) {
-		if (k_en <= a[i][0]) {
-			for (++k; k < i; ++k)
-				if (a[k][1] > a[i][0])
-					break;
-			k_en = a[k][1];
-		}
-		a[i].push(k);
-	}
-}
-
-Interval.find_intv = function(a, x)
-{
-	var left = -1, right = a.length;
-	if (typeof a[0] == 'number') {
-		while (right - left > 1) {
-			var mid = left + ((right - left) >> 1);
-			if (a[mid] > x) right = mid;
-			else if (a[mid] < x) left = mid;
-			else return mid;
-		}
-	} else {
-		while (right - left > 1) {
-			var mid = left + ((right - left) >> 1);
-			if (a[mid][0] > x) right = mid;
-			else if (a[mid][0] < x) left = mid;
-			else return mid;
-		}
-	}
-	return left;
-}
-
-Interval.find_ovlp = function(a, st, en)
-{
-	if (a.length == 0 || st >= en) return [];
-	var l = Interval.find_intv(a, st);
-	var k = l < 0? 0 : a[l][a[l].length - 1];
-	var b = [];
-	for (var i = k; i < a.length; ++i) {
-		if (a[i][0] >= en) break;
-		else if (st < a[i][1])
-			b.push(a[i]);
-	}
-	return b;
-}
-
-/*****************
- * Main function *
- *****************/
-
-var c, l_fuzzy = 0, print_ovlp = false, print_err_only = false, first_only = false;
-while ((c = getopt(arguments, "l:ep")) != null) {
-	if (c == 'l') l_fuzzy = parseInt(getopt.arg);
-	else if (c == 'e') print_err_only = print_ovlp = true;
-	else if (c == 'p') print_ovlp = true;
-}
-
-if (arguments.length - getopt.ind < 2) {
-	print("Usage: k8 intron-eval.js [options] <gene.gtf> <aln.sam>");
-	exit(1);
-}
-
-var file, buf = new Bytes();
-
-var tr = {};
-file = new File(arguments[getopt.ind]);
-while (file.readline(buf) >= 0) {
-	var m, t = buf.toString().split("\t");
-	if (t[0].charAt(0) == '#') continue;
-	if (t[2] != 'exon') continue;
-	var st = parseInt(t[3]) - 1;
-	var en = parseInt(t[4]);
-	if ((m = /transcript_id "(\S+)"/.exec(t[8])) == null) continue;
-	var tid = m[1];
-	if (tr[tid] == null) tr[tid] = [t[0], t[6], 0, 0, []];
-	tr[tid][4].push([st, en]);
-}
-file.close();
-
-var anno = {};
-for (var tid in tr) {
-	var t = tr[tid];
-	Interval.sort(t[4]);
-	t[2] = t[4][0][0];
-	t[3] = t[4][t[4].length - 1][1];
-	if (anno[t[0]] == null) anno[t[0]] = [];
-	var s = t[4];
-	for (var i = 0; i < s.length - 1; ++i) {
-		if (s[i][1] >= s[i+1][0])
-			warn("WARNING: incorrect annotation for transcript "+tid+" ("+s[i][1]+" >= "+s[i+1][0]+")")
-		anno[t[0]].push([s[i][1], s[i+1][0]]);
-	}
-}
-tr = null;
-
-for (var chr in anno) {
-	var e = anno[chr];
-	if (e.length == 0) continue;
-	Interval.sort(e);
-	var k = 0;
-	for (var i = 1; i < e.length; ++i) // dedup
-		if (e[i][0] != e[k][0] || e[i][1] != e[k][1])
-			e[++k] = e[i].slice(0);
-	e.length = k + 1;
-	Interval.index_end(e);
-}
-
-var n_pri = 0, n_unmapped = 0, n_mapped = 0;
-var n_sgl = 0, n_splice = 0, n_splice_hit = 0, n_splice_novel = 0;
-
-file = new File(arguments[getopt.ind+1]);
-var last_qname = null;
-var re_cigar = /(\d+)([MIDNSHX=])/g;
-while (file.readline(buf) >= 0) {
-	var m, t = buf.toString().split("\t");
-
-	if (t[0].charAt(0) == '@') continue;
-	var flag = parseInt(t[1]);
-	if (flag&0x100) continue;
-	if (first_only && last_qname == t[0]) continue;
-	if (t[2] == '*') {
-		++n_unmapped;
-		continue;
-	} else {
-		++n_pri;
-		if (last_qname != t[0]) ++n_mapped;
-	}
-
-	var pos = parseInt(t[3]) - 1, intron = [];
-	while ((m = re_cigar.exec(t[5])) != null) {
-		var len = parseInt(m[1]), op = m[2];
-		if (op == 'N') {
-			intron.push([pos, pos + len]);
-			pos += len;
-		} else if (op == 'M' || op == 'X' || op == '=' || op == 'D') pos += len;
-	}
-	if (intron.length == 0) {
-		++n_sgl;
-		continue;
-	}
-	n_splice += intron.length;
-
-	var chr = anno[t[2]];
-	if (chr != null) {
-		for (var i = 0; i < intron.length; ++i) {
-			var o = Interval.find_ovlp(chr, intron[i][0], intron[i][1]);
-			if (o.length > 0) {
-				var hit = false;
-				for (var j = 0; j < o.length; ++j) {
-					var st_diff = intron[i][0] - o[j][0];
-					var en_diff = intron[i][1] - o[j][1];
-					if (st_diff < 0) st_diff = -st_diff;
-					if (en_diff < 0) en_diff = -en_diff;
-					if (st_diff <= l_fuzzy && en_diff <= l_fuzzy)
-						++n_splice_hit, hit = true;
-					if (hit) break;
-				}
-				if (print_ovlp) {
-					var type = hit? 'C' : 'P';
-					if (hit && print_err_only) continue;
-					var x = '[';
-					for (var j = 0; j < o.length; ++j) {
-						if (j) x += ', ';
-						x += '(' + o[j][0] + "," + o[j][1] + ')';
-					}
-					x += ']';
-					print(type, t[0], i+1, t[2], intron[i][0], intron[i][1], x);
-				}
-			} else {
-				++n_splice_novel;
-				if (print_ovlp)
-					print('N', t[0], i+1, t[2], intron[i][0], intron[i][1]);
-			}
-		}
-	} else {
-		n_splice_novel += intron.length;
-	}
-	last_qname = t[0];
-}
-file.close();
-
-buf.destroy();
-
-if (!print_ovlp) {
-	print("# unmapped reads: " + n_unmapped);
-	print("# mapped reads: " + n_mapped);
-	print("# primary alignments: " + n_pri);
-	print("# singletons: " + n_sgl);
-	print("# predicted introns: " + n_splice);
-	print("# non-overlapping introns: " + n_splice_novel);
-	print("# correct introns: " + n_splice_hit + " (" + (n_splice_hit / n_splice * 100).toFixed(2) + "%)");
-}

misc/mapstat.js

@@ -1,183 +0,0 @@
-var getopt = function(args, ostr) {
-	var oli; // option letter list index
-	if (typeof(getopt.place) == 'undefined')
-		getopt.ind = 0, getopt.arg = null, getopt.place = -1;
-	if (getopt.place == -1) { // update scanning pointer
-		if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
-			getopt.place = -1;
-			return null;
-		}
-		if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
-			++getopt.ind;
-			getopt.place = -1;
-			return null;
-		}
-	}
-	var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
-	if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
-		if (optopt == '-') return null; //  if the user didn't specify '-' as an option, assume it means null.
-		if (getopt.place < 0) ++getopt.ind;
-		return '?';
-	}
-	if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
-		getopt.arg = null;
-		if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
-	} else { // need an argument
-		if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
-			getopt.arg = args[getopt.ind].substr(getopt.place);
-		else if (args.length <= ++getopt.ind) { // no arg
-			getopt.place = -1;
-			if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
-			return '?';
-		} else getopt.arg = args[getopt.ind]; // white space
-		getopt.place = -1;
-		++getopt.ind;
-	}
-	return optopt;
-}
-
-var c, gap_out_len = null;
-while ((c = getopt(arguments, "l:")) != null)
-	if (c == 'l') gap_out_len = parseInt(getopt.arg);
-
-if (getopt.ind == arguments.length) {
-	print("Usage: k8 mapstat.js [-l gapOutLen] <in.sam>|<in.paf>");
-	exit(1);
-}
-
-var buf = new Bytes();
-var file = new File(arguments[getopt.ind]);
-var re = /(\d+)([MIDSHNX=])/g;
-
-var lineno = 0, n_pri = 0, n_2nd = 0, n_seq = 0, n_cigar_64k = 0, l_tot = 0, l_cov = 0;
-var n_gap = [[0, 0, 0, 0, 0, 0], [0, 0, 0, 0, 0, 0]];
-
-function cov_len(regs)
-{
-	regs.sort(function(a,b) {return a[0]-b[0]});
-	var st = regs[0][0], en = regs[0][1], l = 0;
-	for (var i = 1; i < regs.length; ++i) {
-		if (regs[i][0] < en)
-			en = en > regs[i][1]? en : regs[i][1];
-		else l += en - st, st = regs[i][0], en = regs[i][1];
-	}
-	l += en - st;
-	return l;
-}
-
-var last = null, last_qlen = null, regs = [];
-while (file.readline(buf) >= 0) {
-	var line = buf.toString();
-	++lineno;
-	if (line.charAt(0) != '@') {
-		var t = line.split("\t", 12);
-		var m, rs, cigar = null, is_pri = false, is_sam = false, is_rev = false, tname = null;
-		var atlen = null, aqlen, qs, qe, mapq, ori_qlen;
-		if (t[4] == '+' || t[4] == '-') { // PAF
-			if (!/\ts2:i:\d+/.test(line)) {
-				++n_2nd;
-				continue;
-			}
-			if ((m = /\tcg:Z:(\S+)/.exec(line)) != null)
-				cigar = m[1];
-			if (cigar == null) {
-				warn("WARNING: no CIGAR at line " + lineno);
-				continue;
-			}
-			tname = t[5];
-			qs = parseInt(t[2]), qe = parseInt(t[3]);
-			aqlen = qe - qs;
-			is_rev = t[4] == '+'? false : true;
-			rs = parseInt(t[7]);
-			atlen = parseInt(t[8]) - rs;
-			mapq = parseInt(t[11]);
-			ori_qlen = parseInt(t[1]);
-		} else { // SAM
-			var flag = parseInt(t[1]);
-			if ((flag & 4) || t[2] == '*' || t[5] == '*') continue;
-			if (flag & 0x100) {
-				++n_2nd;
-				continue;
-			}
-			cigar = t[5];
-			tname = t[2];
-			rs = parseInt(t[3]) - 1;
-			mapq = parseInt(t[4]);
-			aqlen = t[9].length;
-			is_sam = true;
-			is_rev = !!(flag&0x10);
-		}
-		++n_pri;
-		if (last != t[0]) {
-			if (last != null) {
-				l_tot += last_qlen;
-				l_cov += cov_len(regs);
-			}
-			regs = [];
-			++n_seq, last = t[0];
-		}
-		var M = 0, tl = 0, ql = 0, clip = [0, 0], n_cigar = 0, sclip = 0;
-		while ((m = re.exec(cigar)) != null) {
-			var l = parseInt(m[1]);
-			++n_cigar;
-			if (m[2] == 'M' || m[2] == '=' || m[2] == 'X') {
-				tl += l, ql += l, M += l;
-			} else if (m[2] == 'I' || m[2] == 'D') {
-				var type;
-				if (l < 50) type = 0;
-				else if (l < 100) type = 1;
-				else if (l < 300) type = 2;
-				else if (l < 400) type = 3;
-				else if (l < 1000) type = 4;
-				else type = 5;
-				if (m[2] == 'I') ql += l, ++n_gap[0][type];
-				else tl += l, ++n_gap[1][type];
-				if (gap_out_len != null && l >= gap_out_len)
-					print(t[0], ql, is_rev? '-' : '+', tname, rs + tl, m[2], l);
-			} else if (m[2] == 'N') {
-				tl += l;
-			} else if (m[2] == 'S') {
-				clip[M == 0? 0 : 1] = l, sclip += l;
-			} else if (m[2] == 'H') {
-				clip[M == 0? 0 : 1] = l;
-			}
-		}
-		if (n_cigar > 65535) ++n_cigar_64k;
-		if (ql + sclip != aqlen)
-			warn("WARNING: aligned query length is inconsistent with CIGAR at line " + lineno + " (" + (ql+sclip) + " != " + aqlen + ")");
-		if (atlen != null && atlen != tl)
-			warn("WARNING: aligned reference length is inconsistent with CIGAR at line " + lineno);
-		if (is_sam) {
-			qs = clip[is_rev? 1 : 0], qe = qs + ql;
-			ori_qlen = clip[0] + ql + clip[1];
-		}
-		regs.push([qs, qe]);
-		last_qlen = ori_qlen;
-	}
-}
-l_tot += last_qlen;
-l_cov += cov_len(regs);
-
-file.close();
-buf.destroy();
-
-if (gap_out_len == null) {
-	print("Number of mapped sequences: " + n_seq);
-	print("Number of primary alignments: " + n_pri);
-	print("Number of secondary alignments: " + n_2nd);
-	print("Number of primary alignments with >65535 CIGAR operations: " + n_cigar_64k);
-	print("Number of bases in mapped sequences: " + l_tot);
-	print("Number of mapped bases: " + l_cov);
-	print("Number of insertions in [0,50): " + n_gap[0][0]);
-	print("Number of insertions in [50,100): " + n_gap[0][1]);
-	print("Number of insertions in [100,300): " + n_gap[0][2]);
-	print("Number of insertions in [300,400): " + n_gap[0][3]);
-	print("Number of insertions in [400,1000): " + n_gap[0][4]);
-	print("Number of insertions in [1000,inf): " + n_gap[0][5]);
-	print("Number of deletions in [0,50): " + n_gap[1][0]);
-	print("Number of deletions in [50,100): " + n_gap[1][1]);
-	print("Number of deletions in [100,300): " + n_gap[1][2]);
-	print("Number of deletions in [300,400): " + n_gap[1][3]);
-	print("Number of deletions in [400,1000): " + n_gap[1][4]);
-	print("Number of deletions in [1000,inf): " + n_gap[1][5]);
-}

misc/paf2aln.js

@@ -1,196 +0,0 @@
-var getopt = function(args, ostr) {
-	var oli; // option letter list index
-	if (typeof(getopt.place) == 'undefined')
-		getopt.ind = 0, getopt.arg = null, getopt.place = -1;
-	if (getopt.place == -1) { // update scanning pointer
-		if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
-			getopt.place = -1;
-			return null;
-		}
-		if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
-			++getopt.ind;
-			getopt.place = -1;
-			return null;
-		}
-	}
-	var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
-	if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
-		if (optopt == '-') return null; //  if the user didn't specify '-' as an option, assume it means null.
-		if (getopt.place < 0) ++getopt.ind;
-		return '?';
-	}
-	if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
-		getopt.arg = null;
-		if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
-	} else { // need an argument
-		if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
-			getopt.arg = args[getopt.ind].substr(getopt.place);
-		else if (args.length <= ++getopt.ind) { // no arg
-			getopt.place = -1;
-			if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
-			return '?';
-		} else getopt.arg = args[getopt.ind]; // white space
-		getopt.place = -1;
-		++getopt.ind;
-	}
-	return optopt;
-}
-
-var c, line_len = 80, fmt = "aln";
-while ((c = getopt(arguments, "f:l:")) != null) {
-	if (c == 'f') {
-		fmt = getopt.arg;
-		if (fmt != "aln" && fmt != "lastz-cigar" && fmt != "maf")
-			throw Error("format must be one of aln, lastz-cigar and maf");
-	} else if (c == 'l') line_len = parseInt(getopt.arg);
-}
-if (line_len == 0) line_len = 0x7fffffff;
-
-if (getopt.ind == arguments.length) {
-	print("Usage: k8 paf2aln.js [options] <in.paf>");
-	print("Options:");
-	print("  -f STR    output format: aln (BLAST-like), maf or lastz-cigar [aln]");
-	print("  -l INT    line length in BLAST-like output [80]");
-	exit(1);
-}
-
-function padding_str(x, len, right)
-{
-	var s = x.toString();
-	if (s.length < len) {
-		if (right) s += Array(len - s.length + 1).join(" ");
-		else s = Array(len - s.length + 1).join(" ") + s;
-	}
-	return s;
-}
-
-function update_aln(s_ref, s_qry, s_mid, type, seq, slen)
-{
-	var l = type == '*'? 1 : seq.length;
-	if (type == '=' || type == ':') {
-		s_ref.set(seq);
-		s_qry.set(seq);
-		s_mid.set(Array(l+1).join("|"));
-		slen[0] += l, slen[1] += l;
-	} else if (type == '*') {
-		s_ref.set(seq.charAt(0));
-		s_qry.set(seq.charAt(1));
-		s_mid.set(' ');
-		slen[0] += 1, slen[1] += 1;
-	} else if (type == '+') {
-		s_ref.set(Array(l+1).join("-"));
-		s_qry.set(seq);
-		s_mid.set(Array(l+1).join(" "));
-		slen[1] += l;
-	} else if (type == '-') {
-		s_ref.set(seq);
-		s_qry.set(Array(l+1).join("-"));
-		s_mid.set(Array(l+1).join(" "));
-		slen[0] += l;
-	}
-}
-
-function print_aln(rs, qs, strand, slen, elen, s_ref, s_qry, s_mid)
-{
-	print(["Ref+:", padding_str(rs + slen[0] + 1, 10, false), s_ref.toString(), padding_str(rs + elen[0], 10, true)].join(" "));
-	print("                 " + s_mid.toString());
-	var st, en;
-	if (strand == '+') st = qs + slen[1] + 1, en = qs + elen[1];
-	else st = qs - slen[1], en = qs - elen[1] + 1;
-	print(["Qry" + strand + ":", padding_str(st, 10, false), s_qry.toString(), padding_str(en, 10, true)].join(" "));
-}
-
-var s_ref = new Bytes(), s_qry = new Bytes(), s_mid = new Bytes(); // these are used to show padded alignment
-var re_cs = /([:=\-\+\*])(\d+|[A-Za-z]+)/g;
-var re_cg = /(\d+)([MIDNSH])/g;
-
-var buf = new Bytes();
-var file = arguments[getopt.ind] == "-"? new File() : new File(arguments[getopt.ind]);
-var lineno = 0;
-if (fmt == "maf") print("##maf version=1\n");
-while (file.readline(buf) >= 0) {
-	var m, line = buf.toString();
-	var t = line.split("\t", 12);
-	++lineno;
-	s_ref.length = s_qry.length = s_mid.length = 0;
-	var slen = [0, 0], elen = [0, 0];
-	if (fmt == "lastz-cigar") { // LASTZ-cigar output
-		var cg = (m = /\tcg:Z:(\S+)/.exec(line)) != null? m[1] : null;
-		if (cg == null) {
-			warn("WARNING: converting to LASTZ-cigar format requires the 'cg' tag, which is absent on line " + lineno);
-			continue;
-		}
-		var score = (m = /\tAS:i:(\d+)/.exec(line)) != null? m[1] : 0;
-		var out = ['cigar:', t[0], t[2], t[3], t[4], t[5], t[7], t[8], '+', score];
-		while ((m = re_cg.exec(cg)) != null)
-			out.push(m[2], m[1]);
-		print(out.join(" "));
-	} else if (fmt == "maf") { // MAF output
-		var cs = (m = /\tcs:Z:(\S+)/.exec(line)) != null? m[1] : null;
-		if (cs == null) {
-			warn("WARNING: converting to MAF requires the 'cs' tag, which is absent on line " + lineno);
-			continue;
-		}
-		while ((m = re_cs.exec(cs)) != null) {
-			if (m[1] == ':')
-				throw Error("converting to MAF only works with 'minimap2 --cs=long'");
-			update_aln(s_ref, s_qry, s_mid, m[1], m[2], elen);
-		}
-		var score = (m = /\tAS:i:(\d+)/.exec(line)) != null? parseInt(m[1]) : 0;
-		var len = t[0].length > t[5].length? t[0].length : t[5].length;
-		print("a " + score);
-		print(["s", padding_str(t[5], len, true), padding_str(t[7], 10, false), padding_str(parseInt(t[8]) - parseInt(t[7]), 10, false),
-				"+", padding_str(t[6], 10, false), s_ref.toString()].join(" "));
-		var qs, qe, ql = parseInt(t[1]);
-		if (t[4] == '+') {
-			qs = parseInt(t[2]);
-			qe = parseInt(t[3]);
-		} else {
-			qs = ql - parseInt(t[3]);
-			qe = ql - parseInt(t[2]);
-		}
-		print(["s", padding_str(t[0], len, true), padding_str(qs, 10, false), padding_str(qe - qs, 10, false),
-				t[4], padding_str(ql, 10, false), s_qry.toString()].join(" "));
-		print("");
-	} else { // BLAST-like output
-		var cs = (m = /\tcs:Z:(\S+)/.exec(line)) != null? m[1] : null;
-		if (cs == null) {
-			warn("WARNING: converting to BLAST-like alignment requires the 'cs' tag, which is absent on line " + lineno);
-			continue;
-		}
-		line = line.replace(/\tc[sg]:Z:\S+/g, ""); // get rid of cs or cg tags
-		print('>' + line);
-		var rs = parseInt(t[7]), qs = t[4] == '+'? parseInt(t[2]) : parseInt(t[3]);
-		var n_blocks = 0;
-		while ((m = re_cs.exec(cs)) != null) {
-			if (m[1] == ':') m[2] = Array(parseInt(m[2]) + 1).join("=");
-			var start = 0, rest = m[1] == '*'? 1 : m[2].length;
-			while (rest > 0) {
-				var l_proc;
-				if (s_ref.length + rest >= line_len) {
-					l_proc = line_len - s_ref.length;
-					update_aln(s_ref, s_qry, s_mid, m[1], m[1] == '*'? m[2] : m[2].substr(start, l_proc), elen);
-					if (n_blocks > 0) print("");
-					print_aln(rs, qs, t[4], slen, elen, s_ref, s_qry, s_mid);
-					++n_blocks;
-					s_ref.length = s_qry.length = s_mid.length = 0;
-					slen[0] = elen[0], slen[1] = elen[1];
-				} else {
-					l_proc = rest;
-					update_aln(s_ref, s_qry, s_mid, m[1], m[1] == '*'? m[2] : m[2].substr(start, l_proc), elen);
-				}
-				rest -= l_proc, start += l_proc;
-			}
-		}
-		if (s_ref.length > 0) {
-			if (n_blocks > 0) print("");
-			print_aln(rs, qs, t[4], slen, elen, s_ref, s_qry, s_mid);
-			++n_blocks;
-		}
-		print("//");
-	}
-}
-file.close();
-buf.destroy();
-
-s_ref.destroy(); s_qry.destroy(); s_mid.destroy();

misc/paf2diff.js

@@ -1,188 +0,0 @@
-var getopt = function(args, ostr) {
-	var oli; // option letter list index
-	if (typeof(getopt.place) == 'undefined')
-		getopt.ind = 0, getopt.arg = null, getopt.place = -1;
-	if (getopt.place == -1) { // update scanning pointer
-		if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
-			getopt.place = -1;
-			return null;
-		}
-		if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
-			++getopt.ind;
-			getopt.place = -1;
-			return null;
-		}
-	}
-	var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
-	if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
-		if (optopt == '-') return null; //  if the user didn't specify '-' as an option, assume it means null.
-		if (getopt.place < 0) ++getopt.ind;
-		return '?';
-	}
-	if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
-		getopt.arg = null;
-		if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
-	} else { // need an argument
-		if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
-			getopt.arg = args[getopt.ind].substr(getopt.place);
-		else if (args.length <= ++getopt.ind) { // no arg
-			getopt.place = -1;
-			if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
-			return '?';
-		} else getopt.arg = args[getopt.ind]; // white space
-		getopt.place = -1;
-		++getopt.ind;
-	}
-	return optopt;
-}
-
-var re_cs = /([:=*+-])(\d+|[A-Za-z]+)/g;
-var c, min_cov_len = 10000, min_var_len = 50000, gap_thres = 50, min_mapq = 5;
-while ((c = getopt(arguments, "l:L:g:q:")) != null) {
-	if (c == 'l') min_cov_len = parseInt(getopt.arg);
-	else if (c == 'L') min_var_len = parseInt(optarg.arg);
-	else if (c == 'g') gap_thres = parseInt(optarg.arg);
-	else if (c == 'q') min_mapq = parseInt(optarg.arg);
-}
-
-if (arguments.length == getopt.ind) {
-	print("Usage: k8 paf2diff.js [options] <with-cs.paf>");
-	print("Options:");
-	print("  -l INT    min alignment length to compute coverage ["+min_cov_len+"]");
-	print("  -L INT    min alignment length to call variants ["+min_var_len+"]");
-	print("  -q INT    min mapping quality ["+min_mapq+"]");
-	print("  -g INT    short/long gap threshold (for statistics only) ["+gap_thres+"]");
-	exit(1);
-}
-
-var file = new File(arguments[getopt.ind]);
-var buf = new Bytes();
-var tot_len = 0, n_sub = [0, 0, 0], n_ins = [0, 0, 0, 0], n_del = [0, 0, 0, 0];
-
-function count_var(o)
-{
-	if (o[3] > 1) return;
-	if (o[5] == '-' && o[6] == '-') return;
-	if (o[5] == '-') { // insertion
-		var l = o[6].length;
-		if (l == 1) ++n_ins[0];
-		else if (l == 2) ++n_ins[1];
-		else if (l < gap_thres) ++n_ins[2];
-		else ++n_ins[3];
-	} else if (o[6] == '-') { // deletion
-		var l = o[5].length;
-		if (l == 1) ++n_del[0];
-		else if (l == 2) ++n_del[1];
-		else if (l < gap_thres) ++n_del[2];
-		else ++n_del[3];
-	} else {
-		++n_sub[0];
-		var s = o[5] + o[6];
-		if (s == 'ag' || s == 'ga' || s == 'ct' || s == 'tc')
-			++n_sub[1];
-		else ++n_sub[2];
-	}
-}
-
-var a = [], out = [];
-var c1_ctg = null, c1_start = 0, c1_end = 0, c1_counted = false, c1_len = 0;
-while (file.readline(buf) >= 0) {
-	var line = buf.toString();
-	if (!/\ts2:i:/.test(line)) continue; // skip secondary alignments
-	var m, t = line.split("\t", 12);
-	for (var i = 6; i <= 11; ++i)
-		t[i] = parseInt(t[i]);
-	if (t[10] < min_cov_len || t[11] < min_mapq) continue;
-	var ctg = t[5], x = t[7], end = t[8];
-	// compute regions covered by 1 contig
-	if (ctg != c1_ctg || x >= c1_end) {
-		if (c1_counted && c1_end > c1_start) {
-			c1_len += c1_end - c1_start;
-			print('R', c1_ctg, c1_start, c1_end);
-		}
-		c1_ctg = ctg, c1_start = x, c1_end = end;
-		c1_counted = (t[10] >= min_var_len);
-	} else if (end > c1_end) { // overlap
-		if (c1_counted && x > c1_start) {
-			c1_len += x - c1_start;
-			print('R', c1_ctg, c1_start, x);
-		}
-		c1_start = c1_end, c1_end = end;
-		c1_counted = (t[10] >= min_var_len);
-	} else { // contained
-		if (c1_counted && x > c1_start) {
-			c1_len += x - c1_start;
-			print('R', c1_ctg, c1_start, x);
-		}
-		c1_start = end;
-	}
-	// output variants ahead of this alignment
-	while (out.length) {
-		if (out[0][0] != ctg || out[0][2] <= x) {
-			count_var(out[0]);
-			print('V', out[0].join("\t"));
-			out.shift();
-		} else break;
-	}
-	// update coverage
-	for (var i = 0; i < out.length; ++i)
-		if (out[i][1] >= x && out[i][2] <= end)
-			++out[i][3];
-	// drop alignments that don't overlap with the current one
-	var k = 0;
-	for (var i = 0; i < a.length; ++i)
-		if (a[0][0] == ctg && a[0][2] > x)
-			a[k++] = a[i];
-	a.length = k;
-	// core loop
-	if (t[10] >= min_var_len) {
-		if ((m = /\tcs:Z:(\S+)/.exec(line)) == null) continue; // no cs tag
-		var cs = m[1];
-		var blen = 0, n_diff = 0;
-		tot_len += t[10];
-		while ((m = re_cs.exec(cs)) != null) {
-			var cov = 1;
-			if (m[1] == '*' || m[1] == '+' || m[1] == '-')
-				for (var i = 0; i < a.length; ++i)
-					if (a[0][2] > x) ++cov;
-			if (m[1] == '=' || m[1] == ':') {
-				var l = m[1] == '='? m[2].length : parseInt(m[2]);
-				x += l, blen += l;
-			} else if (m[1] == '*') {
-				out.push([t[5], x, x+1, cov, t[11], m[2].charAt(0), m[2].charAt(1)]);
-				++x, ++blen, ++n_diff;
-			} else if (m[1] == '+') {
-				out.push([t[5], x, x, cov, t[11], '-', m[2]]);
-				++blen, ++n_diff;
-			} else if (m[1] == '-') {
-				out.push([t[5], x, x + m[2].length, cov, t[11], m[2], '-']);
-				x += m[2].length, ++blen, ++n_diff;
-			}
-		}
-	}
-	a.push([t[5], t[7], t[8]]);
-}
-if (c1_counted && c1_end > c1_start) {
-	c1_len += c1_end - c1_start;
-	print('R', c1_ctg, c1_start, c1_end);
-}
-while (out.length) {
-	count_var(out[0]);
-	print('V', out[0].join("\t"));
-	out.shift();
-}
-
-//warn(tot_len + " alignment columns considered in calling");
-warn(c1_len + " reference bases covered by exactly one contig");
-warn(n_sub[0] + " substitutions; ts/tv = " + (n_sub[1]/n_sub[2]).toFixed(3));
-warn(n_del[0] + " 1bp deletions");
-warn(n_ins[0] + " 1bp insertions");
-warn(n_del[1] + " 2bp deletions");
-warn(n_ins[1] + " 2bp insertions");
-warn(n_del[2] + " [3,"+gap_thres+") deletions");
-warn(n_ins[2] + " [3,"+gap_thres+") insertions");
-warn(n_del[3] + " >="+gap_thres+" deletions");
-warn(n_ins[3] + " >="+gap_thres+" insertions");
-
-buf.destroy();
-file.close();

misc/sam2paf.js

@@ -1,114 +0,0 @@
-var getopt = function(args, ostr) {
-	var oli; // option letter list index
-	if (typeof(getopt.place) == 'undefined')
-		getopt.ind = 0, getopt.arg = null, getopt.place = -1;
-	if (getopt.place == -1) { // update scanning pointer
-		if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
-			getopt.place = -1;
-			return null;
-		}
-		if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
-			++getopt.ind;
-			getopt.place = -1;
-			return null;
-		}
-	}
-	var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
-	if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
-		if (optopt == '-') return null; //  if the user didn't specify '-' as an option, assume it means null.
-		if (getopt.place < 0) ++getopt.ind;
-		return '?';
-	}
-	if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
-		getopt.arg = null;
-		if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
-	} else { // need an argument
-		if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
-			getopt.arg = args[getopt.ind].substr(getopt.place);
-		else if (args.length <= ++getopt.ind) { // no arg
-			getopt.place = -1;
-			if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
-			return '?';
-		} else getopt.arg = args[getopt.ind]; // white space
-		getopt.place = -1;
-		++getopt.ind;
-	}
-	return optopt;
-}
-
-var c, pri_only = false;
-while ((c = getopt(arguments, "p")) != null)
-	if (c == 'p') pri_only = true;
-
-var file = arguments.length == getopt.ind? new File() : new File(arguments[getopt.ind]);
-var buf = new Bytes();
-var re = /(\d+)([MIDSHNX=])/g;
-
-var len = {}, lineno = 0;
-while (file.readline(buf) >= 0) {
-	var m, n_cigar = 0, line = buf.toString();
-	++lineno;
-	if (line.charAt(0) == '@') {
-		if (/^@SQ/.test(line)) {
-			var name = (m = /\tSN:(\S+)/.exec(line)) != null? m[1] : null;
-			var l = (m = /\tLN:(\d+)/.exec(line)) != null? parseInt(m[1]) : null;
-			if (name != null && l != null) len[name] = l;
-		}
-		continue;
-	}
-	var t = line.split("\t");
-	var flag = parseInt(t[1]);
-	if (t[9] != '*' && t[10] != '*' && t[9].length != t[10].length) throw Error("ERROR at line " + lineno + ": inconsistent SEQ and QUAL lengths - " + t[9].length + " != " + t[10].length);
-	if (t[2] == '*' || (flag&4)) continue;
-	if (pri_only && (flag&0x100)) continue;
-	var tlen = len[t[2]];
-	if (tlen == null) throw Error("ERROR at line " + lineno + ": can't find the length of contig " + t[2]);
-	var nn = (m = /\tnn:i:(\d+)/.exec(line)) != null? parseInt(m[1]) : 0;
-	var NM = (m = /\tNM:i:(\d+)/.exec(line)) != null? parseInt(m[1]) : null;
-	var have_NM = NM == null? false : true;
-	NM += nn;
-	var clip = [0, 0], I = [0, 0], D = [0, 0], M = 0, N = 0, ql = 0, tl = 0, mm = 0, ext_cigar = false;
-	while ((m = re.exec(t[5])) != null) {
-		var l = parseInt(m[1]);
-		if (m[2] == 'M') M += l, ql += l, tl += l, ext_cigar = false;
-		else if (m[2] == 'I') ++I[0], I[1] += l, ql += l;
-		else if (m[2] == 'D') ++D[0], D[1] += l, tl += l;
-		else if (m[2] == 'N') N += l, tl += l;
-		else if (m[2] == 'S') clip[M == 0? 0 : 1] = l, ql += l;
-		else if (m[2] == 'H') clip[M == 0? 0 : 1] = l;
-		else if (m[2] == '=') M += l, ql += l, tl += l, ext_cigar = true;
-		else if (m[2] == 'X') M += l, ql += l, tl += l, mm += l, ext_cigar = true;
-		++n_cigar;
-	}
-	if (n_cigar > 65535)
-		warn("WARNING at line " + lineno + ": " + n_cigar + " CIGAR operations");
-	if (tl + parseInt(t[3]) - 1 > tlen) {
-		warn("WARNING at line " + lineno + ": alignment end position larger than ref length; skipped");
-		continue;
-	}
-	if (t[9] != '*' && t[9].length != ql) {
-		warn("WARNING at line " + lineno + ": SEQ length inconsistent with CIGAR (" + t[9].length + " != " + ql + "); skipped");
-		continue;
-	}
-	if (!have_NM || ext_cigar) NM = I[1] + D[1] + mm;
-	if (NM < I[1] + D[1] + mm) {
-		warn("WARNING at line " + lineno + ": NM is less than the total number of gaps (" + NM + " < " + (I[1]+D[1]+mm) + ")");
-		NM = I[1] + D[1] + mm;
-	}
-	var extra = ["mm:i:"+(NM-I[1]-D[1]), "io:i:"+I[0], "in:i:"+I[1], "do:i:"+D[0], "dn:i:"+D[1]];
-	var match = M - (NM - I[1] - D[1]);
-	var blen = M + I[1] + D[1];
-	var qlen = M + I[1] + clip[0] + clip[1];
-	var qs, qe;
-	if (flag&16) qs = clip[1], qe = qlen - clip[0];
-	else qs = clip[0], qe = qlen - clip[1];
-	var ts = parseInt(t[3]) - 1, te = ts + M + D[1] + N;
-	var qname = t[0];
-	if ((flag&1) && (flag&0x40)) qname += '/1';
-	if ((flag&1) && (flag&0x80)) qname += '/2';
-	var a = [qname, qlen, qs, qe, flag&16? '-' : '+', t[2], tlen, ts, te, match, blen, t[4]];
-	print(a.join("\t"), extra.join("\t"));
-}
-
-buf.destroy();
-file.close();

misc/sim-eval.js

@@ -1,193 +0,0 @@
-var getopt = function(args, ostr) {
-	var oli; // option letter list index
-	if (typeof(getopt.place) == 'undefined')
-		getopt.ind = 0, getopt.arg = null, getopt.place = -1;
-	if (getopt.place == -1) { // update scanning pointer
-		if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
-			getopt.place = -1;
-			return null;
-		}
-		if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
-			++getopt.ind;
-			getopt.place = -1;
-			return null;
-		}
-	}
-	var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
-	if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
-		if (optopt == '-') return null; //  if the user didn't specify '-' as an option, assume it means null.
-		if (getopt.place < 0) ++getopt.ind;
-		return '?';
-	}
-	if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
-		getopt.arg = null;
-		if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
-	} else { // need an argument
-		if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
-			getopt.arg = args[getopt.ind].substr(getopt.place);
-		else if (args.length <= ++getopt.ind) { // no arg
-			getopt.place = -1;
-			if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
-			return '?';
-		} else getopt.arg = args[getopt.ind]; // white space
-		getopt.place = -1;
-		++getopt.ind;
-	}
-	return optopt;
-}
-
-var c, max_mapq = 60, mode = 0, err_out_q = 256, print_err = false, ovlp_ratio = 0.1, cap_short_mapq = false;
-while ((c = getopt(arguments, "Q:r:m:c")) != null) {
-	if (c == 'Q') err_out_q = parseInt(getopt.arg), print_err = true;
-	else if (c == 'r') ovlp_ratio = parseFloat(getopt.arg);
-	else if (c == 'm') mode = parseInt(getopt.arg);
-	else if (c == 'c') cap_short_mapq = true;
-}
-
-var file = arguments.length == getopt.ind? new File() : new File(arguments[getopt.ind]);
-var buf = new Bytes();
-
-var tot = [], err = [];
-for (var q = 0; q <= max_mapq; ++q)
-	tot[q] = err[q] = 0;
-
-function is_correct(s, b)
-{
-	if (s[0] != b[0] || s[3] != b[3]) return false;
-	var o, l;
-	if (s[1] < b[1]) {
-		if (s[2] <= b[1]) return false;
-		o = (s[2] < b[2]? s[2] : b[2]) - b[1];
-		l = (s[2] > b[2]? s[2] : b[2]) - s[1];
-	} else {
-		if (b[2] <= s[1]) return false;
-		o = (s[2] < b[2]? s[2] : b[2]) - s[1];
-		l = (s[2] > b[2]? s[2] : b[2]) - b[1];
-	}
-	return o/l > ovlp_ratio? true : false;
-}
-
-function count_err(qname, a, tot, err, mode)
-{
-	if (a.length == 0) return;
-
-	var m, s;
-	if ((m = /^(\S+)!(\S+)!(\d+)!(\d+)!([\+\-])$/.exec(qname)) != null) { // pbsim single-end reads
-		s = [m[1], m[2], parseInt(m[3]), parseInt(m[4]), m[5]];
-	} else if ((m = /^(\S+)!(\S+)!(\d+)_(\d+)!(\d+)_(\d+)!([\+\-])([\+\-])\/([12])$/.exec(qname)) != null) { // mason2 paired-end reads
-		if (m[9] == '1') {
-			s = [m[1], m[2], parseInt(m[3]), parseInt(m[5]), m[7]];
-		} else {
-			s = [m[1], m[2], parseInt(m[4]), parseInt(m[6]), m[8]];
-		}
-	} else throw Error("Failed to parse simulated read names '" + qname + "'");
-	s.shift(); // skip the orginal read name
-
-	if (mode == 0 || mode == 1) { // longest only or first only
-		var max_i = 0;
-		if (mode == 0) { // longest only
-			var max = 0;
-			for (var i = 0; i < a.length; ++i)
-				if (a[i][5] > max)
-					max = a[i][5], max_i = i;
-		}
-		var mapq = a[max_i][4];
-		++tot[mapq];
-		if (!is_correct(s, a[max_i])) {
-			if (mapq >= err_out_q)
-				print('E', qname, a[max_i].join("\t"));
-			++err[mapq];
-		}
-	} else if (mode == 2) { // all primary mode
-		var max_err_mapq = -1, max_mapq = 0, max_err_i = -1;
-		if (cap_short_mapq) {
-			var max = 0, max_q = 0;
-			for (var i = 0; i < a.length; ++i)
-				if (a[i][5] > max)
-					max = a[i][5], max_q = a[i][4];
-			for (var i = 0; i < a.length; ++i)
-				a[i][4] = max_q < a[i][4]? max_q : a[i][4];
-		}
-		for (var i = 0; i < a.length; ++i) {
-			max_mapq = max_mapq > a[i][4]? max_mapq : a[i][4];
-			if (!is_correct(s, a[i]))
-				if (a[i][4] > max_err_mapq)
-					max_err_mapq = a[i][4], max_err_i = i;
-		}
-		if (max_err_mapq >= 0) {
-			++tot[max_err_mapq], ++err[max_err_mapq];
-			if (max_err_mapq >= err_out_q)
-				print('E', qname, a[max_err_i].join("\t"));
-		} else ++tot[max_mapq];
-	}
-}
-
-var lineno = 0, last = null, a = [], n_unmapped = null;
-var re_cigar = /(\d+)([MIDSHN])/g;
-while (file.readline(buf) >= 0) {
-	var m, line = buf.toString();
-	++lineno;
-	if (line[0] != '@') {
-		var t = line.split("\t");
-		if (t[4] == '+' || t[4] == '-') { // PAF
-			if (last != t[0]) {
-				if (last != null) count_err(last, a, tot, err, mode);
-				a = [], last = t[0];
-			}
-			if (/\ts1:i:\d+/.test(line) && !/\ts2:i:\d+/.test(line)) // secondary alignment in minimap2 PAF
-				continue;
-			var mapq = parseInt(t[11]);
-			if (mapq > max_mapq) mapq = max_mapq;
-			a.push([t[5], parseInt(t[7]), parseInt(t[8]), t[4], mapq, parseInt(t[9])]);
-		} else { // SAM
-			var flag = parseInt(t[1]);
-			var read_no = flag>>6&0x3;
-			var qname = t[0];
-			if (!/\/[12]$/.test(qname))
-				qname = read_no == 1 || read_no == 2? t[0] + '/' + read_no : t[0];
-			if (last != qname) {
-				if (last != null) count_err(last, a, tot, err, mode);
-				a = [], last = qname;
-			}
-			if (flag&0x100) continue; // secondary alignment
-			if ((flag&0x4) || t[2] == '*') { // unmapped
-				if (n_unmapped == null) n_unmapped = 0;
-				++n_unmapped;
-				continue;
-			}
-			var mapq = parseInt(t[4]);
-			if (mapq > max_mapq) mapq = max_mapq;
-			var pos = parseInt(t[3]) - 1, pos_end = pos;
-			var n_gap = 0, mlen = 0;
-			while ((m = re_cigar.exec(t[5])) != null) {
-				var len = parseInt(m[1]);
-				if (m[2] == 'M') pos_end += len, mlen += len;
-				else if (m[2] == 'I') n_gap += len;
-				else if (m[2] == 'D') n_gap += len, pos_end += len;
-			}
-			var score = pos_end - pos;
-			if ((m = /\tNM:i:(\d+)/.exec(line)) != null) {
-				var NM = parseInt(m[1]);
-				if (NM >= n_gap) score = mlen - (NM - n_gap);
-			}
-			a.push([t[2], pos, pos_end, (flag&16)? '-' : '+', mapq, score]);
-		}
-	}
-}
-if (last != null) count_err(last, a, tot, err, mode);
-
-buf.destroy();
-file.close();
-
-var sum_tot = 0, sum_err = 0, q_out = -1, sum_tot2 = 0, sum_err2 = 0;
-for (var q = max_mapq; q >= 0; --q) {
-	if (tot[q] == 0) continue;
-	if (q_out < 0 || err[q] > 0) {
-		if (q_out >= 0) print('Q', q_out, sum_tot, sum_err, (sum_err2/sum_tot2).toFixed(9), sum_tot2);
-		sum_tot = sum_err = 0, q_out = q;
-	}
-	sum_tot += tot[q], sum_err += err[q];
-	sum_tot2 += tot[q], sum_err2 += err[q];
-}
-print('Q', q_out, sum_tot, sum_err, (sum_err2/sum_tot2).toFixed(9), sum_tot2);
-if (n_unmapped != null) print('U', n_unmapped);

misc/sim-mason2.js

@@ -1,105 +0,0 @@
-Bytes.prototype.reverse = function()
-{
-	for (var i = 0; i < this.length>>1; ++i) {
-		var tmp = this[i];
-		this[i] = this[this.length - i - 1];
-		this[this.length - i - 1] = tmp;
-	}
-}
-
-// reverse complement a DNA string
-Bytes.prototype.revcomp = function()
-{
-	if (Bytes.rctab == null) {
-		var s1 = 'WSATUGCYRKMBDHVNwsatugcyrkmbdhvn';
-		var s2 = 'WSTAACGRYMKVHDBNwstaacgrymkvhdbn';
-		Bytes.rctab = [];
-		for (var i = 0; i < 256; ++i) Bytes.rctab[i] = 0;
-		for (var i = 0; i < s1.length; ++i)
-			Bytes.rctab[s1.charCodeAt(i)] = s2.charCodeAt(i);
-	}
-	for (var i = 0; i < this.length>>1; ++i) {
-		var tmp = this[this.length - i - 1];
-		this[this.length - i - 1] = Bytes.rctab[this[i]];
-		this[i] = Bytes.rctab[tmp];
-	}
-	if (this.length&1)
-		this[this.length>>1] = Bytes.rctab[this[this.length>>1]];
-}
-
-if (arguments.length == 0) {
-	print("Usage: k8 sim-mason2.js <mason.sam>");
-	exit(1);
-}
-
-function print_se(a)
-{
-	print('@' + a.slice(0, 5).join("!") + " " + a[8]);
-	print(a[5]);
-	print("+");
-	print(a[6]);
-}
-
-var buf = new Bytes(), buf2 = new Bytes();
-var file = new File(arguments[0]);
-var re = /(\d+)([MIDSHN])/g;
-var last = null;
-while (file.readline(buf) >= 0) {
-	var t = buf.toString().split("\t");
-	if (t[0].charAt(0) == '@') continue;
-	var m, l_ref = 0;
-	while ((m = re.exec(t[5])) != null)
-		if (m[2] == 'D' || m[2] == 'M' || m[2] == 'N')
-			l_ref += parseInt(m[1]);
-	var flag = parseInt(t[1]);
-	var rev = !!(flag&16);
-	var seq, qual;
-	if (rev) {
-		buf2.length = 0;
-		buf2.set(t[9], 0);
-		buf2.revcomp();
-		seq = buf2.toString();
-		buf2.set(t[10], 0);
-		buf2.reverse();
-		qual = buf2.toString();
-	} else seq = t[9], qual = t[10];
-	var qname = t[0];
-	qname = qname.replace(/^simulated./, "");
-	var chr = t[2];
-	var pos = parseInt(t[3]) - 1;
-	var strand = (flag&16)? '-' : '+';
-	var read_no = flag&0xc0;
-	if (read_no == 0x40) read_no = 1;
-	else if (read_no == 0x80) read_no = 2;
-	else read_no = 0;
-	var err = 0, snp = 0, indel = 0;
-	for (var i = 11; i < t.length; ++i) {
-		if ((m = /^XE:i:(\d+)/.exec(t[i])) != null) err = m[1];
-		else if ((m = /^XS:i:(\d+)/.exec(t[i])) != null) snp = m[1];
-		else if ((m = /^XI:i:(\d+)/.exec(t[i])) != null) indel = m[1];
-	}
-	var comment = [err, snp, indel].join(":");
-	if (last == null) {
-		last = [qname, chr, pos, pos + l_ref, strand, seq, qual, read_no, comment];
-	} else if (last[0] != qname) {
-		print_se(last);
-		last = [qname, chr, pos, pos + l_ref, strand, seq, qual, read_no, comment];
-	} else {
-		if (read_no == 2) { // last[] is the first read
-			if (last[7] != 1) throw Error("ERROR: can't find read1");
-			var name = [qname, chr, last[2] + "_" + pos, last[3] + "_" + (pos + l_ref), last[4] + strand].join("!");
-			print('@' + name + '/1' + ' ' + last[8]); print(last[5]); print("+"); print(last[6]);
-			print('@' + name + '/2' + ' ' + comment); print(seq); print("+"); print(qual);
-		} else {
-			if (last[7] != 2) throw Error("ERROR: can't find read2");
-			var name = [qname, chr, pos + "_" + last[2], (pos + l_ref) + "_" + last[3], strand + last[4]].join("!");
-			print('@' + name + '/1' + ' ' + comment); print(seq); print("+"); print(qual);
-			print('@' + name + '/2' + ' ' + last[8]); print(last[5]); print("+"); print(last[6]);
-		}
-		last = null;
-	}
-}
-if (last != null) print_se(last);
-file.close();
-buf.destroy();
-buf2.destroy();

misc/sim-pbsim.js

@@ -1,81 +0,0 @@
-Bytes.prototype.reverse = function()
-{
-	for (var i = 0; i < this.length>>1; ++i) {
-		var tmp = this[i];
-		this[i] = this[this.length - i - 1];
-		this[this.length - i - 1] = tmp;
-	}
-}
-
-// reverse complement a DNA string
-Bytes.prototype.revcomp = function()
-{
-	if (Bytes.rctab == null) {
-		var s1 = 'WSATUGCYRKMBDHVNwsatugcyrkmbdhvn';
-		var s2 = 'WSTAACGRYMKVHDBNwstaacgrymkvhdbn';
-		Bytes.rctab = [];
-		for (var i = 0; i < 256; ++i) Bytes.rctab[i] = 0;
-		for (var i = 0; i < s1.length; ++i)
-			Bytes.rctab[s1.charCodeAt(i)] = s2.charCodeAt(i);
-	}
-	for (var i = 0; i < this.length>>1; ++i) {
-		var tmp = this[this.length - i - 1];
-		this[this.length - i - 1] = Bytes.rctab[this[i]];
-		this[i] = Bytes.rctab[tmp];
-	}
-	if (this.length&1)
-		this[this.length>>1] = Bytes.rctab[this[this.length>>1]];
-}
-
-if (arguments.length < 2) {
-	print("Usage: k8 sim-pbsim.js <ref.fa.fai> <pbsim1.maf> [[pbsim2.maf] ...]");
-	exit(1);
-}
-
-var file, buf = new Bytes(), buf2 = new Bytes();
-file = new File(arguments[0]);
-var chr_list = [];
-while (file.readline(buf) >= 0) {
-	var t = buf.toString().split(/\s+/);
-	chr_list.push(t[0]);
-}
-file.close();
-
-for (var k = 1; k < arguments.length; ++k) {
-	var fn = arguments[k];
-	file = new File(fn);
-	var state = 0, reg;
-	while (file.readline(buf) >= 0) {
-		var line = buf.toString();
-		if (state == 0 && line.charAt(0) == 'a') {
-			state = 1;
-		} else if (state == 1 && line.charAt(0) == 's') {
-			var t = line.split(/\s+/);
-			var st = parseInt(t[2]);
-			reg = [st, st + parseInt(t[3])];
-			state = 2;
-		} else if (state == 2 && line.charAt(0) == 's') {
-			var m, t = line.split(/\s+/);
-			if ((m = /S(\d+)_\d+/.exec(t[1])) == null) throw Error("Failed to parse the read name");
-			var chr_id = parseInt(m[1]) - 1;
-			if (chr_id >= chr_list.length) throw Error("Index outside the chr list");
-			var name = [t[1], chr_list[chr_id], reg[0], reg[1], t[4]].join("!");
-			var seq = t[6].replace(/\-/g, "");
-			if (seq.length != parseInt(t[5])) throw Error("Inconsistent read length");
-			if (seq.indexOf("NN") < 0) {
-				if (t[4] == '-') {
-					buf2.set(seq, 0);
-					buf2.length = seq.length;
-					buf2.revcomp();
-					seq = buf2.toString();
-				}
-				print(">" + name);
-				print(seq);
-			}
-			state = 0;
-		}
-	}
-	file.close();
-}
-buf.destroy();
-buf2.destroy();

misc/splice2bed.js

@@ -1,127 +0,0 @@
-var getopt = function(args, ostr) {
-	var oli; // option letter list index
-	if (typeof(getopt.place) == 'undefined')
-		getopt.ind = 0, getopt.arg = null, getopt.place = -1;
-	if (getopt.place == -1) { // update scanning pointer
-		if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
-			getopt.place = -1;
-			return null;
-		}
-		if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
-			++getopt.ind;
-			getopt.place = -1;
-			return null;
-		}
-	}
-	var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
-	if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
-		if (optopt == '-') return null; //  if the user didn't specify '-' as an option, assume it means null.
-		if (getopt.place < 0) ++getopt.ind;
-		return '?';
-	}
-	if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
-		getopt.arg = null;
-		if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
-	} else { // need an argument
-		if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
-			getopt.arg = args[getopt.ind].substr(getopt.place);
-		else if (args.length <= ++getopt.ind) { // no arg
-			getopt.place = -1;
-			if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
-			return '?';
-		} else getopt.arg = args[getopt.ind]; // white space
-		getopt.place = -1;
-		++getopt.ind;
-	}
-	return optopt;
-}
-
-var colors = ["0,128,255", "255,0,0", "0,192,0"];
-
-function print_lines(a, fmt) {
-	if (a.length == 0) return;
-	if (fmt == "bed") {
-		var n_pri = 0;
-		for (var i = 0; i < a.length; ++i)
-			if (a[i][8] == 0) ++n_pri;
-		if (n_pri > 1) {
-			for (var i = 0; i < a.length; ++i)
-				if (a[i][8] == 0) a[i][8] = 1;
-		} else if (n_pri == 0) {
-			warn("Warning: " + a[0][3] + " doesn't have a primary alignment");
-		}
-		for (var i = 0; i < a.length; ++i) {
-			a[i][8] = colors[a[i][8]];
-			print(a[i].join("\t"));
-		}
-	}
-	a.length = 0;
-}
-
-function main(args) {
-	var re = /(\d+)([MIDNSH])/g;
-	var c, fmt = "bed";
-	while ((c = getopt(args, "f:")) != null) {
-		if (c == 'f') fmt = getopt.arg;
-	}
-	if (getopt.ind == args.length) {
-		warn("Usage: k8 splice2bed.js <in.paf>");
-		exit(1);
-	}
-
-	var file = new File(args[getopt.ind]);
-	var buf = new Bytes();
-	var a = [];
-	while (file.readline(buf) >= 0) {
-		var line = buf.toString();
-		if (line.charAt(0) == '@') continue; // skip SAM header lines
-		var t = line.split("\t");
-		var is_pri = false, cigar = null, a1;
-		if (a.length && a[0][3] != t[0]) {
-			print_lines(a, fmt);
-			a = [];
-		}
-		if (t.length >= 12 && (t[4] == '+' || t[4] == '-')) {
-			for (var i = 12; i < t.length; ++i) {
-				if (t[i].substr(0, 5) == 'cg:Z:') {
-					cigar = t[i].substr(5);
-				} else if (t[i].substr(0, 5) == 's2:i:') {
-					is_pri = true;
-				}
-			}
-			a1 = [t[5], t[7], t[8], t[0], Math.floor(t[9]/t[10]*1000), t[4]];
-		} else if (t.length >= 10) {
-			var flag = parseInt(t[1]);
-			if ((flag&4) || a[2] == '*') continue;
-			cigar = t[5];
-			is_pri = (flag&0x100)? false : true;
-			a1 = [t[2], parseInt(t[3])-1, null, t[0], 1000, (flag&16)? '-' : '+'];
-		} else {
-			throw Error("unrecognized input format");
-		}
-		if (cigar == null) throw Error("missing CIGAR");
-		var m, x0 = 0, x = 0, bs = [], bl = [];
-		while ((m = re.exec(cigar)) != null) {
-			if (m[2] == 'M' || m[2] == 'D') {
-				x += parseInt(m[1]);
-			} else if (m[2] == 'N') {
-				bs.push(x0);
-				bl.push(x - x0);
-				x += parseInt(m[1]);
-				x0 = x;
-			}
-		}
-		bs.push(x0);
-		bl.push(x - x0);
-		// write the BED12 line
-		if (a1[2] == null) a1[2] = a1[1] + x;
-		a1.push(a1[1], a1[2]); // thick start/end is the same as start/end
-		a1.push(is_pri? 0 : 2, bs.length, bl.join(",")+",", bs.join(",")+",");
-		a.push(a1);
-	}
-	print_lines(a, fmt);
-	buf.destroy();
-	file.close();
-}
-
-main(arguments);

mmpriv.h

@@ -16,6 +16,7 @@
 #define MM_SEED_LONG_JOIN  (1ULL<<40)
 #define MM_SEED_IGNORE     (1ULL<<41)
 #define MM_SEED_TANDEM     (1ULL<<42)
+#define MM_SEED_SELF       (1ULL<<43)
 
 #define MM_SEED_SEG_SHIFT  48
 #define MM_SEED_SEG_MASK   (0xffULL<<(MM_SEED_SEG_SHIFT))
@@ -27,6 +28,9 @@
 #define mm_seq4_set(s, i, c) ((s)[(i)>>3] |= (uint32_t)(c) << (((i)&7)<<2))
 #define mm_seq4_get(s, i)    ((s)[(i)>>3] >> (((i)&7)<<2) & 0xf)
 
+#define MALLOC(type, len) ((type*)malloc((len) * sizeof(type)))
+#define CALLOC(type, len) ((type*)calloc((len), sizeof(type)))
+
 #ifdef __cplusplus
 extern "C" {
 #endif
@@ -47,6 +51,7 @@ typedef struct {
 
 double cputime(void);
 double realtime(void);
+long peakrss(void);
 
 void radix_sort_128x(mm128_t *beg, mm128_t *end);
 void radix_sort_64(uint64_t *beg, uint64_t *end);
@@ -61,7 +66,6 @@ void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
 
 void mm_idxopt_init(mm_idxopt_t *opt);
 const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n);
-int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq);
 int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f);
 mm128_t *mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int min_cnt, int min_sc, int is_cdna, int n_segs, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km);
 mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a);
@@ -74,10 +78,10 @@ int mm_set_sam_pri(int n, mm_reg1_t *r);
 void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r, int sub_diff);
 void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int *n_, mm_reg1_t *r);
 void mm_select_sub_multi(void *km, float pri_ratio, float pri1, float pri2, int max_gap_ref, int min_diff, int best_n, int n_segs, const int *qlens, int *n_, mm_reg1_t *r);
-void mm_filter_regs(void *km, const mm_mapopt_t *opt, int *n_regs, mm_reg1_t *regs);
+void mm_filter_regs(const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs);
 void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs, mm128_t *a);
-void mm_hit_sort_by_dp(void *km, int *n_regs, mm_reg1_t *r);
+void mm_hit_sort(void *km, int *n_regs, mm_reg1_t *r);
-void mm_set_mapq(int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr);
+void mm_set_mapq(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr);
 
 void mm_est_err(const mm_idx_t *mi, int qlen, int n_regs, mm_reg1_t *regs, const mm128_t *a, int32_t n, const uint64_t *mini_pos);
 
@@ -85,6 +89,15 @@ mm_seg_t *mm_seg_gen(void *km, uint32_t hash, int n_segs, const int *qlens, int
 void mm_seg_free(void *km, int n_segs, mm_seg_t *segs);
 void mm_pair(void *km, int max_gap_ref, int dp_bonus, int sub_diff, int match_sc, const int *qlens, int *n_regs, mm_reg1_t **regs);
 
+FILE *mm_split_init(const char *prefix, const mm_idx_t *mi);
+mm_idx_t *mm_split_merge_prep(const char *prefix, int n_splits, FILE **fp, uint32_t *n_seq_part);
+int mm_split_merge(int n_segs, const char **fn, const mm_mapopt_t *opt, int n_split_idx);
+void mm_split_rm_tmp(const char *prefix, int n_splits);
+
+void mm_err_puts(const char *str);
+void mm_err_fwrite(const void *p, size_t size, size_t nitems, FILE *fp);
+void mm_err_fread(void *p, size_t size, size_t nitems, FILE *fp);
+
 #ifdef __cplusplus
 }
 #endif

options.c

@@ -0,0 +1,178 @@
+#include <stdio.h>
+#include "mmpriv.h"
+
+void mm_idxopt_init(mm_idxopt_t *opt)
+{
+	memset(opt, 0, sizeof(mm_idxopt_t));
+	opt->k = 15, opt->w = 10, opt->flag = 0;
+	opt->bucket_bits = 14;
+	opt->mini_batch_size = 50000000;
+	opt->batch_size = 4000000000ULL;
+}
+
+void mm_mapopt_init(mm_mapopt_t *opt)
+{
+	memset(opt, 0, sizeof(mm_mapopt_t));
+	opt->seed = 11;
+	opt->mid_occ_frac = 2e-4f;
+	opt->sdust_thres = 0; // no SDUST masking
+
+	opt->min_cnt = 3;
+	opt->min_chain_score = 40;
+	opt->bw = 500;
+	opt->max_gap = 5000;
+	opt->max_gap_ref = -1;
+	opt->max_chain_skip = 25;
+
+	opt->mask_level = 0.5f;
+	opt->pri_ratio = 0.8f;
+	opt->best_n = 5;
+
+	opt->max_join_long = 20000;
+	opt->max_join_short = 2000;
+	opt->min_join_flank_sc = 1000;
+	opt->min_join_flank_ratio = 0.5f;
+
+	opt->a = 2, opt->b = 4, opt->q = 4, opt->e = 2, opt->q2 = 24, opt->e2 = 1;
+	opt->sc_ambi = 1;
+	opt->zdrop = 400, opt->zdrop_inv = 200;
+	opt->end_bonus = -1;
+	opt->min_dp_max = opt->min_chain_score * opt->a;
+	opt->min_ksw_len = 200;
+	opt->anchor_ext_len = 20, opt->anchor_ext_shift = 6;
+	opt->max_clip_ratio = 1.0f;
+	opt->mini_batch_size = 500000000;
+
+	opt->pe_ori = 0; // FF
+	opt->pe_bonus = 33;
+}
+
+void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
+{
+	if ((opt->flag & MM_F_SPLICE_FOR) || (opt->flag & MM_F_SPLICE_REV))
+		opt->flag |= MM_F_SPLICE;
+	if (opt->mid_occ <= 0)
+		opt->mid_occ = mm_idx_cal_max_occ(mi, opt->mid_occ_frac);
+	if (opt->mid_occ < opt->min_mid_occ)
+		opt->mid_occ = opt->min_mid_occ;
+	if (mm_verbose >= 3)
+		fprintf(stderr, "[M::%s::%.3f*%.2f] mid_occ = %d\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), opt->mid_occ);
+}
+
+void mm_mapopt_max_intron_len(mm_mapopt_t *opt, int max_intron_len)
+{
+	if ((opt->flag & MM_F_SPLICE) && max_intron_len > 0)
+		opt->max_gap_ref = opt->bw = max_intron_len;
+}
+
+int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
+{
+	if (preset == 0) {
+		mm_idxopt_init(io);
+		mm_mapopt_init(mo);
+	} else if (strcmp(preset, "ava-ont") == 0) {
+		io->flag = 0, io->k = 15, io->w = 5;
+		mo->flag |= MM_F_ALL_CHAINS | MM_F_NO_DIAG | MM_F_NO_DUAL | MM_F_NO_LJOIN;
+		mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_gap = 10000, mo->max_chain_skip = 25;
+		mo->bw = 2000;
+	} else if (strcmp(preset, "ava-pb") == 0) {
+		io->flag |= MM_I_HPC, io->k = 19, io->w = 5;
+		mo->flag |= MM_F_ALL_CHAINS | MM_F_NO_DIAG | MM_F_NO_DUAL | MM_F_NO_LJOIN;
+		mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_gap = 10000, mo->max_chain_skip = 25;
+	} else if (strcmp(preset, "map10k") == 0 || strcmp(preset, "map-pb") == 0) {
+		io->flag |= MM_I_HPC, io->k = 19;
+	} else if (strcmp(preset, "map-ont") == 0) {
+		io->flag = 0, io->k = 15;
+	} else if (strcmp(preset, "asm5") == 0) {
+		io->flag = 0, io->k = 19, io->w = 19;
+		mo->a = 1, mo->b = 19, mo->q = 39, mo->q2 = 81, mo->e = 3, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
+		mo->min_mid_occ = 100;
+		mo->min_dp_max = 200;
+		mo->best_n = 50;
+	} else if (strcmp(preset, "asm10") == 0) {
+		io->flag = 0, io->k = 19, io->w = 19;
+		mo->a = 1, mo->b = 9, mo->q = 16, mo->q2 = 41, mo->e = 2, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
+		mo->min_mid_occ = 100;
+		mo->min_dp_max = 200;
+		mo->best_n = 50;
+	} else if (strcmp(preset, "asm20") == 0) {
+		io->flag = 0, io->k = 19, io->w = 10;
+		mo->a = 1, mo->b = 4, mo->q = 6, mo->q2 = 26, mo->e = 2, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
+		mo->min_mid_occ = 100;
+		mo->min_dp_max = 200;
+		mo->best_n = 50;
+	} else if (strcmp(preset, "short") == 0 || strcmp(preset, "sr") == 0) {
+		io->flag = 0, io->k = 21, io->w = 11;
+		mo->flag |= MM_F_SR | MM_F_FRAG_MODE | MM_F_NO_PRINT_2ND | MM_F_2_IO_THREADS | MM_F_HEAP_SORT;
+		mo->pe_ori = 0<<1|1; // FR
+		mo->a = 2, mo->b = 8, mo->q = 12, mo->e = 2, mo->q2 = 24, mo->e2 = 1;
+		mo->zdrop = mo->zdrop_inv = 100;
+		mo->end_bonus = 10;
+		mo->max_frag_len = 800;
+		mo->max_gap = 100;
+		mo->bw = 100;
+		mo->pri_ratio = 0.5f;
+		mo->min_cnt = 2;
+		mo->min_chain_score = 25;
+		mo->min_dp_max = 40;
+		mo->best_n = 20;
+		mo->mid_occ = 1000;
+		mo->max_occ = 5000;
+		mo->mini_batch_size = 50000000;
+	} else if (strcmp(preset, "splice") == 0 || strcmp(preset, "cdna") == 0) {
+		io->flag = 0, io->k = 15, io->w = 5;
+		mo->flag |= MM_F_SPLICE | MM_F_SPLICE_FOR | MM_F_SPLICE_REV | MM_F_SPLICE_FLANK;
+		mo->max_gap = 2000, mo->max_gap_ref = mo->bw = 200000;
+		mo->a = 1, mo->b = 2, mo->q = 2, mo->e = 1, mo->q2 = 32, mo->e2 = 0;
+		mo->noncan = 9;
+		mo->zdrop = 200, mo->zdrop_inv = 100; // because mo->a is halved
+	} else return -1;
+	return 0;
+}
+
+int mm_check_opt(const mm_idxopt_t *io, const mm_mapopt_t *mo)
+{
+	if (mo->split_prefix && (mo->flag & (MM_F_OUT_CS|MM_F_OUT_MD))) {
+		if (mm_verbose >= 1)
+			fprintf(stderr, "[ERROR]\033[1;31m --cs or --MD doesn't work with --split-prefix\033[0m\n");
+		return -6;
+	}
+	if (io->k <= 0 || io->w <= 0) {
+		if (mm_verbose >= 1)
+			fprintf(stderr, "[ERROR]\033[1;31m -k and -w must be positive\033[0m\n");
+		return -5;
+	}
+	if (mo->best_n < 0) {
+		if (mm_verbose >= 1)
+			fprintf(stderr, "[ERROR]\033[1;31m -N must be no less than 0\033[0m\n");
+		return -4;
+	}
+	if (mo->best_n == 0 && mm_verbose >= 2)
+		fprintf(stderr, "[WARNING]\033[1;31m '-N 0' reduces mapping accuracy. Please use '--secondary=no' instead.\033[0m\n");
+	if (mo->pri_ratio < 0.0f || mo->pri_ratio > 1.0f) {
+		if (mm_verbose >= 1)
+			fprintf(stderr, "[ERROR]\033[1;31m -p must be within 0 and 1 (including 0 and 1)\033[0m\n");
+		return -4;
+	}
+	if ((mo->flag & MM_F_FOR_ONLY) && (mo->flag & MM_F_REV_ONLY)) {
+		if (mm_verbose >= 1)
+			fprintf(stderr, "[ERROR]\033[1;31m --for-only and --rev-only can't be applied at the same time\033[0m\n");
+		return -3;
+	}
+	if ((mo->q != mo->q2 || mo->e != mo->e2) && !(mo->e > mo->e2 && mo->q + mo->e < mo->q2 + mo->e2)) {
+		if (mm_verbose >= 1)
+			fprintf(stderr, "[ERROR]\033[1;31m dual gap penalties violating E1>E2 and O1+E1<O2+E2\033[0m\n");
+		return -2;
+	}
+	if ((mo->q + mo->e) + (mo->q2 + mo->e2) > 127) {
+		if (mm_verbose >= 1)
+			fprintf(stderr, "[ERROR]\033[1;31m scoring system violating ({-O}+{-E})+({-O2}+{-E2}) <= 127\033[0m\n");
+		return -1;
+	}
+	if (mo->zdrop < mo->zdrop_inv) {
+		if (mm_verbose >= 1)
+			fprintf(stderr, "[ERROR]\033[1;31m Z-drop should not be less than inversion-Z-drop\033[0m\n");
+		return -5;
+	}
+	return 0;
+}

pe.c

@@ -105,7 +105,7 @@ void mm_pair(void *km, int max_gap_ref, int pe_bonus, int sub_diff, int match_sc
 	max = -1;
 	max_idx[0] = max_idx[1] = -1;
 	last[0] = last[1] = -1;
-	kv_resize(uint64_t, km, sc, n);
+	kv_resize(uint64_t, km, sc, (size_t)n);
 	for (i = 0; i < n; ++i) {
 		if (a[i].key & 1) { // reverse first read or forward second read
 			mm_reg1_t *q, *r;
@@ -151,8 +151,8 @@ void mm_pair(void *km, int max_gap_ref, int pe_bonus, int sub_diff, int match_sc
 			}
 		}
 		mapq_pe = r[0]->mapq > r[1]->mapq? r[0]->mapq : r[1]->mapq;
-		for (i = 0; i < sc.n; ++i)
+		for (i = 0; i < (int)sc.n; ++i)
-			if ((sc.a[i]>>32) + sub_diff >= max>>32)
+			if ((sc.a[i]>>32) + sub_diff >= (uint64_t)max>>32)
 				++n_sub;
 		if (sc.n > 1) {
 			int mapq_pe_alt;
@@ -164,7 +164,7 @@ void mm_pair(void *km, int max_gap_ref, int pe_bonus, int sub_diff, int match_sc
 		if (sc.n == 1) {
 			if (r[0]->mapq < 2) r[0]->mapq = 2;
 			if (r[1]->mapq < 2) r[1]->mapq = 2;
-		} else if (max>>32 > sc.a[sc.n - 2]>>32) {
+		} else if ((uint64_t)max>>32 > sc.a[sc.n - 2]>>32) {
 			if (r[0]->mapq < 1) r[0]->mapq = 1;
 			if (r[1]->mapq < 1) r[1]->mapq = 1;
 		}

python/README.rst

@@ -34,6 +34,8 @@ The following Python script demonstrates the key functionality of mappy:
 	import mappy as mp
 	a = mp.Aligner("test/MT-human.fa")  # load or build index
 	if not a: raise Exception("ERROR: failed to load/build index")
+	s = a.seq("MT_human", 100, 200)     # retrieve a subsequence from the index
+	print(mp.revcomp(s))                # reverse complement
 	for name, seq, qual in mp.fastx_read("test/MT-orang.fa"): # read a fasta/q sequence
 		for hit in a.map(seq): # traverse alignments
 			print("{}\t{}\t{}\t{}".format(hit.ctg, hit.r_st, hit.r_en, hit.cigar_str))
@@ -41,20 +43,24 @@ The following Python script demonstrates the key functionality of mappy:
 APIs
 ----
 
-Mappy implements two classes and one global function.
+Mappy implements two classes and two global function.
 
 Class mappy.Aligner
 ~~~~~~~~~~~~~~~~~~~
 
 .. code:: python
 
-	mappy.Aligner(fn_idx_in, preset=None, ...)
+	mappy.Aligner(fn_idx_in=None, preset=None, ...)
 
 This constructor accepts the following arguments:
 
 * **fn_idx_in**: index or sequence file name. Minimap2 automatically tests the
   file type. If a sequence file is provided, minimap2 builds an index. The
-  sequence file can be optionally gzip'd.
+  sequence file can be optionally gzip'd. This option has no effect if **seq**
+  is set.
+
+* **seq**: a single sequence to index. The sequence name will be set to
+  :code:`N/A`.
 
 * **preset**: minimap2 preset. Currently, minimap2 supports the following
   presets: **sr** for single-end short reads; **map-pb** for PacBio
@@ -77,14 +83,36 @@ This constructor accepts the following arguments:
 
 * **n_threads**: number of indexing threads; 3 by default
 
-* **fn_idx_out**: name of file to which the index is written
+* **extra_flags**: additional flags defined in minimap.h
+
+* **fn_idx_out**: name of file to which the index is written. This parameter
+  has no effect if **seq** is set.
+
+* **scoring**: scoring system. It is a tuple/list consisting of 4, 6 or 7
+  positive integers. The first 4 elements specify match scoring, mismatch
+  penalty, gap open and gap extension penalty. The 5th and 6th elements, if
+  present, set long-gap open and long-gap extension penalty. The 7th sets a
+  mismatch penalty involving ambiguous bases.
 
 .. code:: python
 
-	mappy.Aligner.map(seq)
+	mappy.Aligner.map(seq, seq2=None, cs=False, MD=False)
 
 This method aligns :code:`seq` against the index. It is a generator, *yielding*
-a series of :code:`mappy.Alignment` objects.
+a series of :code:`mappy.Alignment` objects. If :code:`seq2` is present, mappy
+performs paired-end alignment, assuming the two ends are in the FR orientation.
+Alignments of the two ends can be distinguished by the :code:`read_num` field
+(see Class mappy.Alignment below). Argument :code:`cs` asks mappy to generate
+the :code:`cs` tag; :code:`MD` is similar. These two arguments might slightly
+degrade performance and are not enabled by default.
+
+.. code:: python
+
+	mappy.Aligner.seq(name, start=0, end=0x7fffffff)
+
+This method retrieves a (sub)sequence from the index and returns it as a Python
+string. :code:`None` is returned if :code:`name` is not present in the index or
+the start/end coordinates are invalid.
 
 Class mappy.Alignment
 ~~~~~~~~~~~~~~~~~~~~~
@@ -118,11 +146,19 @@ properties:
 * **is_primary**: if the alignment is primary (typically the best and the first
   to generate)
 
+* **read_num**: read number that the alignment corresponds to; 1 for the first
+  read and 2 for the second read
+
 * **cigar_str**: CIGAR string
 
 * **cigar**: CIGAR returned as an array of shape :code:`(n_cigar,2)`. The two
   numbers give the length and the operator of each CIGAR operation.
 
+* **MD**: the :code:`MD` tag as in the SAM format. It is an empty string unless
+  the :code:`MD` argument is applied when calling :code:`mappy.Aligner.map()`.
+
+* **cs**: the :code:`cs` tag.
+
 An :code:`Alignment` object can be converted to a string with :code:`str()` in
 the following format:
 
@@ -133,13 +169,22 @@ the following format:
 It is effectively the PAF format without the QueryName and QueryLength columns
 (the first two columns in PAF).
 
-Function mappy.fastx_read
+Miscellaneous Functions
-~~~~~~~~~~~~~~~~~~~~~~~~~
+~~~~~~~~~~~~~~~~~~~~~~~
 
 .. code:: python
 
-	mappy.fastx_read(fn)
+	mappy.fastx_read(fn, read_comment=False)
 
 This generator function opens a FASTA/FASTQ file and *yields* a
 :code:`(name,seq,qual)` tuple for each sequence entry. The input file may be
-optionally gzip'd.
+optionally gzip'd. If :code:`read_comment` is True, this generator yields
+a :code:`(name,seq,qual,comment)` tuple instead.
+
+.. code:: python
+
+	mappy.revcomp(seq)
+
+Return the reverse complement of DNA string :code:`seq`. This function
+recognizes IUB code and preserves the letter cases. Uracil :code:`U` is
+complemented to :code:`A`.

python/cmappy.h

@@ -15,6 +15,7 @@ typedef struct {
 	int32_t blen, mlen, NM, ctg_len;
 	uint8_t mapq, is_primary;
 	int8_t strand, trans_strand;
+	int32_t seg_id;
 	int32_t n_cigar32;
 	uint32_t *cigar32;
 } mm_hitpy_t;
@@ -32,6 +33,7 @@ static inline void mm_reg2hitpy(const mm_idx_t *mi, mm_reg1_t *r, mm_hitpy_t *h)
 	h->NM = r->blen - r->mlen + r->p->n_ambi;
 	h->trans_strand = r->p->trans_strand == 1? 1 : r->p->trans_strand == 2? -1 : 0;
 	h->is_primary = (r->id == r->parent);
+	h->seg_id = r->seg_id;
 	h->n_cigar32 = r->p->n_cigar;
 	h->cigar32 = r->p->cigar;
 }
@@ -68,4 +70,83 @@ static inline void mm_reset_timer(void)
 	mm_realtime0 = realtime();
 }
 
+extern unsigned char seq_comp_table[256];
+static inline mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char *seq1, const char *seq2, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt)
+{
+	mm_reg1_t *r;
+
+	Py_BEGIN_ALLOW_THREADS
+	if (seq2 == 0) {
+		r = mm_map(mi, strlen(seq1), seq1, n_regs, b, opt, NULL);
+	} else {
+		int _n_regs[2];
+		mm_reg1_t *regs[2];
+		char *seq[2];
+		int i, len[2];
+
+		len[0] = strlen(seq1);
+		len[1] = strlen(seq2);
+		seq[0] = (char*)seq1;
+		seq[1] = strdup(seq2);
+		for (i = 0; i < len[1]>>1; ++i) {
+			int t = seq[1][len[1] - i - 1];
+			seq[1][len[1] - i - 1] = seq_comp_table[(uint8_t)seq[1][i]];
+			seq[1][i] = seq_comp_table[t];
+		}
+		if (len[1]&1) seq[1][len[1]>>1] = seq_comp_table[(uint8_t)seq[1][len[1]>>1]];
+		mm_map_frag(mi, 2, len, (const char**)seq, _n_regs, regs, b, opt, NULL);
+		for (i = 0; i < _n_regs[1]; ++i)
+			regs[1][i].rev = !regs[1][i].rev;
+		*n_regs = _n_regs[0] + _n_regs[1];
+		regs[0] = (mm_reg1_t*)realloc(regs[0], sizeof(mm_reg1_t) * (*n_regs));
+		memcpy(&regs[0][_n_regs[0]], regs[1], _n_regs[1] * sizeof(mm_reg1_t));
+		free(regs[1]);
+		r = regs[0];
+	}
+	Py_END_ALLOW_THREADS
+
+	return r;
+}
+
+static inline char *mappy_revcomp(int len, const uint8_t *seq)
+{
+	int i;
+	char *rev;
+	rev = (char*)malloc(len + 1);
+	for (i = 0; i < len; ++i)
+		rev[len - i - 1] = seq_comp_table[seq[i]];
+	rev[len] = 0;
+	return rev;
+}
+
+static char *mappy_fetch_seq(const mm_idx_t *mi, const char *name, int st, int en, int *len)
+{
+	int i, rid;
+	char *s;
+	*len = 0;
+	rid = mm_idx_name2id(mi, name);
+	if (rid < 0) return 0;
+	if ((uint32_t)st >= mi->seq[rid].len || st >= en) return 0;
+	if (en < 0 || (uint32_t)en > mi->seq[rid].len)
+		en = mi->seq[rid].len;
+	s = (char*)malloc(en - st + 1);
+	*len = mm_idx_getseq(mi, rid, st, en, (uint8_t*)s);
+	for (i = 0; i < *len; ++i)
+		s[i] = "ACGTN"[(uint8_t)s[i]];
+	s[*len] = 0;
+	return s;
+}
+
+static mm_idx_t *mappy_idx_seq(int w, int k, int is_hpc, int bucket_bits, const char *seq, int len)
+{
+	const char *fake_name = "N/A";
+	char *s;
+	mm_idx_t *mi;
+	s = (char*)calloc(len + 1, 1);
+	memcpy(s, seq, len);
+	mi = mm_idx_str(w, k, is_hpc, bucket_bits, 1, (const char**)&s, (const char**)&fake_name);
+	free(s);
+	return mi;
+}
+
 #endif

python/cmappy.pxd

@@ -24,18 +24,23 @@ cdef extern from "minimap.h":
 		int best_n
 		int max_join_long, max_join_short
 		int min_join_flank_sc
+		float min_join_flank_ratio;
 		int a, b, q, e, q2, e2
+		int sc_ambi
 		int noncan
-		int zdrop
+		int zdrop, zdrop_inv
 		int end_bonus
 		int min_dp_max
 		int min_ksw_len
 		int anchor_ext_len, anchor_ext_shift
+		float max_clip_ratio
 		int pe_ori, pe_bonus
 		float mid_occ_frac
+		int32_t min_mid_occ
 		int32_t mid_occ
 		int32_t max_occ
 		int mini_batch_size
+		const char *split_prefix
 
 	int mm_set_opt(char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
 	int mm_verbose
@@ -58,6 +63,7 @@ cdef extern from "minimap.h":
 		uint32_t *S
 		mm_idx_bucket_t *B
 		void *km
+		void *h
 
 	ctypedef struct mm_idx_reader_t:
 		pass
@@ -68,6 +74,8 @@ cdef extern from "minimap.h":
 	void mm_idx_destroy(mm_idx_t *mi)
 	void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
 
+	int mm_idx_index_name(mm_idx_t *mi)
+
 	#
 	# Mapping (key struct defined in cmappy.h below)
 	#
@@ -79,7 +87,9 @@ cdef extern from "minimap.h":
 
 	mm_tbuf_t *mm_tbuf_init()
 	void mm_tbuf_destroy(mm_tbuf_t *b)
-	mm_reg1_t *mm_map(const mm_idx_t *mi, int l_seq, const char *seq, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *name)
+	void *mm_tbuf_get_km(mm_tbuf_t *b)
+	int mm_gen_cs(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int no_iden)
+	int mm_gen_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq)
 
 #
 # Helper header (because it is hard to expose mm_reg1_t with Cython)
@@ -92,11 +102,15 @@ cdef extern from "cmappy.h":
 		int32_t blen, mlen, NM, ctg_len
 		uint8_t mapq, is_primary
 		int8_t strand, trans_strand
+		int32_t seg_id
 		int32_t n_cigar32
 		uint32_t *cigar32
 
 	void mm_reg2hitpy(const mm_idx_t *mi, mm_reg1_t *r, mm_hitpy_t *h)
 	void mm_free_reg1(mm_reg1_t *r)
+	mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char *seq1, const char *seq2, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt)
+	char *mappy_fetch_seq(const mm_idx_t *mi, const char *name, int st, int en, int *l)
+	mm_idx_t *mappy_idx_seq(int w, int k, int is_hpc, int bucket_bits, const char *seq, int l)
 
 	ctypedef struct kstring_t:
 		unsigned l, m
@@ -114,5 +128,6 @@ cdef extern from "cmappy.h":
 	void mm_fastx_close(kseq_t *ks)
 	int kseq_read(kseq_t *seq)
 
+	char *mappy_revcomp(int l, const uint8_t *seq)
 	int mm_verbose_level(int v)
 	void mm_reset_timer()

python/mappy.pyx

@@ -1,6 +1,9 @@
 from libc.stdint cimport uint8_t, int8_t
 from libc.stdlib cimport free
 cimport cmappy
+import sys
+
+__version__ = '2.11'
 
 cmappy.mm_reset_timer()
 
@@ -10,9 +13,10 @@ cdef class Alignment:
 	cdef int _NM, _mlen, _blen
 	cdef int8_t _strand, _trans_strand
 	cdef uint8_t _mapq, _is_primary
-	cdef _ctg, _cigar # these are python objects
+	cdef int _seg_id
+	cdef _ctg, _cigar, _cs, _MD # these are python objects
 
-	def __cinit__(self, ctg, cl, cs, ce, strand, qs, qe, mapq, cigar, is_primary, mlen, blen, NM, trans_strand):
+	def __cinit__(self, ctg, cl, cs, ce, strand, qs, qe, mapq, cigar, is_primary, mlen, blen, NM, trans_strand, seg_id, cs_str, MD_str):
 		self._ctg = ctg if isinstance(ctg, str) else ctg.decode()
 		self._ctg_len, self._r_st, self._r_en = cl, cs, ce
 		self._strand, self._q_st, self._q_en = strand, qs, qe
@@ -21,6 +25,9 @@ cdef class Alignment:
 		self._cigar = cigar
 		self._is_primary = is_primary
 		self._trans_strand = trans_strand
+		self._seg_id = seg_id
+		self._cs = cs_str
+		self._MD = MD_str
 
 	@property
 	def ctg(self): return self._ctg
@@ -64,6 +71,15 @@ cdef class Alignment:
 	@property
 	def cigar(self): return self._cigar
 
+	@property
+	def read_num(self): return self._seg_id + 1
+
+	@property
+	def cs(self): return self._cs
+
+	@property
+	def MD(self): return self._MD
+
 	@property
 	def cigar_str(self):
 		return "".join(map(lambda x: str(x[0]) + 'MIDNSH'[x[1]], self._cigar))
@@ -77,8 +93,10 @@ cdef class Alignment:
 		if self._trans_strand > 0: ts = 'ts:A:+'
 		elif self._trans_strand < 0: ts = 'ts:A:-'
 		else: ts = 'ts:A:.'
-		return "\t".join([str(self._q_st), str(self._q_en), strand, self._ctg, str(self._ctg_len), str(self._r_st), str(self._r_en),
+		a = [str(self._q_st), str(self._q_en), strand, self._ctg, str(self._ctg_len), str(self._r_st), str(self._r_en),
-				str(self._mlen), str(self._blen), str(self._mapq), tp, ts, "cg:Z:" + self.cigar_str])
+			str(self._mlen), str(self._blen), str(self._mapq), tp, ts, "cg:Z:" + self.cigar_str]
+		if self._cs != "": a.append("cs:Z:" + self._cs)
+		return "\t".join(a)
 
 cdef class ThreadBuffer:
 	cdef cmappy.mm_tbuf_t *_b
@@ -94,7 +112,7 @@ cdef class Aligner:
 	cdef cmappy.mm_idxopt_t idx_opt
 	cdef cmappy.mm_mapopt_t map_opt
 
-	def __cinit__(self, fn_idx_in, preset=None, k=None, w=None, min_cnt=None, min_chain_score=None, min_dp_score=None, bw=None, best_n=None, n_threads=3, fn_idx_out=None):
+	def __cinit__(self, fn_idx_in=None, preset=None, k=None, w=None, min_cnt=None, min_chain_score=None, min_dp_score=None, bw=None, best_n=None, n_threads=3, fn_idx_out=None, max_frag_len=None, extra_flags=None, seq=None, scoring=None):
 		cmappy.mm_set_opt(NULL, &self.idx_opt, &self.map_opt) # set the default options
 		if preset is not None:
 			cmappy.mm_set_opt(str.encode(preset), &self.idx_opt, &self.map_opt) # apply preset
@@ -106,17 +124,34 @@ cdef class Aligner:
 		if min_chain_score is not None: self.map_opt.min_chain_score = min_chain_score
 		if min_dp_score is not None: self.map_opt.min_dp_max = min_dp_score
 		if bw is not None: self.map_opt.bw = bw
-		if best_n is not None: self.best_n = best_n
+		if best_n is not None: self.map_opt.best_n = best_n
+		if max_frag_len is not None: self.map_opt.max_frag_len = max_frag_len
+		if extra_flags is not None: self.map_opt.flag |= extra_flags
+		if scoring is not None and len(scoring) >= 4:
+			self.map_opt.a, self.map_opt.b = scoring[0], scoring[1]
+			self.map_opt.q, self.map_opt.e = scoring[2], scoring[3]
+			self.map_opt.q2, self.map_opt.e2 = self.map_opt.q, self.map_opt.e
+			if len(scoring) >= 6:
+				self.map_opt.q2, self.map_opt.e2 = scoring[4], scoring[5]
+				if len(scoring) >= 7:
+					self.map_opt.sc_ambi = scoring[6]
 
 		cdef cmappy.mm_idx_reader_t *r;
-		if fn_idx_out is None:
+
-			r = cmappy.mm_idx_reader_open(str.encode(fn_idx_in), &self.idx_opt, NULL)
+		if seq is None:
+			if fn_idx_out is None:
+				r = cmappy.mm_idx_reader_open(str.encode(fn_idx_in), &self.idx_opt, NULL)
+			else:
+				r = cmappy.mm_idx_reader_open(str.encode(fn_idx_in), &self.idx_opt, fn_idx_out)
+			if r is not NULL:
+				self._idx = cmappy.mm_idx_reader_read(r, n_threads) # NB: ONLY read the first part
+				cmappy.mm_idx_reader_close(r)
+				cmappy.mm_mapopt_update(&self.map_opt, self._idx)
+				cmappy.mm_idx_index_name(self._idx)
 		else:
-			r = cmappy.mm_idx_reader_open(str.encode(fn_idx_in), &self.idx_opt, fn_idx_out)
+			self._idx = cmappy.mappy_idx_seq(self.idx_opt.w, self.idx_opt.k, self.idx_opt.flag&1, self.idx_opt.bucket_bits, str.encode(seq), len(seq))
-		if r is not NULL:
-			self._idx = cmappy.mm_idx_reader_read(r, n_threads) # NB: ONLY read the first part
-			cmappy.mm_idx_reader_close(r)
 			cmappy.mm_mapopt_update(&self.map_opt, self._idx)
+			self.map_opt.mid_occ = 1000 # don't filter high-occ seeds
 
 	def __dealloc__(self):
 		if self._idx is not NULL:
@@ -125,28 +160,68 @@ cdef class Aligner:
 	def __bool__(self):
 		return (self._idx != NULL)
 
-	def map(self, seq, buf=None):
+	def map(self, seq, seq2=None, buf=None, cs=False, MD=False, max_frag_len=None, extra_flags=None):
 		cdef cmappy.mm_reg1_t *regs
 		cdef cmappy.mm_hitpy_t h
 		cdef ThreadBuffer b
 		cdef int n_regs
+		cdef char *cs_str = NULL
+		cdef int l_cs_str, m_cs_str = 0
+		cdef void *km
+		cdef cmappy.mm_mapopt_t map_opt
+
+		map_opt = self.map_opt
+		if max_frag_len is not None: map_opt.max_frag_len = max_frag_len
+		if extra_flags is not None: map_opt.flag |= extra_flags
 
 		if self._idx is NULL: return None
 		if buf is None: b = ThreadBuffer()
 		else: b = buf
-		regs = cmappy.mm_map(self._idx, len(seq), str.encode(seq), &n_regs, b._b, &self.map_opt, NULL)
+		km = cmappy.mm_tbuf_get_km(b._b)
+
+		_seq = seq if isinstance(seq, bytes) else seq.encode()
+		if seq2 is None:
+			regs = cmappy.mm_map_aux(self._idx, _seq, NULL,  &n_regs, b._b, &map_opt)
+		else:
+			_seq2 = seq2 if isinstance(seq2, bytes) else seq2.encode()
+			regs = cmappy.mm_map_aux(self._idx, _seq, _seq2, &n_regs, b._b, &map_opt)
 
 		for i in range(n_regs):
 			cmappy.mm_reg2hitpy(self._idx, &regs[i], &h)
-			cigar = []
+			cigar, _cs, _MD = [], '', ''
-			for k in range(h.n_cigar32):
+			for k in range(h.n_cigar32): # convert the 32-bit CIGAR encoding to Python array
 				c = h.cigar32[k]
 				cigar.append([c>>4, c&0xf])
-			yield Alignment(h.ctg, h.ctg_len, h.ctg_start, h.ctg_end, h.strand, h.qry_start, h.qry_end, h.mapq, cigar, h.is_primary, h.mlen, h.blen, h.NM, h.trans_strand)
+			if cs or MD: # generate the cs and/or the MD tag, if requested
+				if cs:
+					l_cs_str = cmappy.mm_gen_cs(km, &cs_str, &m_cs_str, self._idx, &regs[i], _seq, 1)
+					_cs = cs_str[:l_cs_str] if isinstance(cs_str, str) else cs_str[:l_cs_str].decode()
+				if MD:
+					l_cs_str = cmappy.mm_gen_MD(km, &cs_str, &m_cs_str, self._idx, &regs[i], _seq)
+					_MD = cs_str[:l_cs_str] if isinstance(cs_str, str) else cs_str[:l_cs_str].decode()
+			yield Alignment(h.ctg, h.ctg_len, h.ctg_start, h.ctg_end, h.strand, h.qry_start, h.qry_end, h.mapq, cigar, h.is_primary, h.mlen, h.blen, h.NM, h.trans_strand, h.seg_id, _cs, _MD)
 			cmappy.mm_free_reg1(&regs[i])
 		free(regs)
+		free(cs_str)
 
-def fastx_read(fn):
+	def seq(self, str name, int start=0, int end=0x7fffffff):
+		cdef int l
+		cdef char *s = cmappy.mappy_fetch_seq(self._idx, name.encode(), start, end, &l)
+		if l == 0: return None
+		r = s[:l] if isinstance(s, str) else s[:l].decode()
+		free(s)
+		return r
+
+	@property
+	def k(self): return self._idx.k
+
+	@property
+	def w(self): return self._idx.w
+
+	@property
+	def n_seq(self): return self._idx.n_seq
+
+def fastx_read(fn, read_comment=False):
 	cdef cmappy.kseq_t *ks
 	ks = cmappy.mm_fastx_open(str.encode(fn))
 	if ks is NULL: return None
@@ -155,9 +230,22 @@ def fastx_read(fn):
 		else: qual = None
 		name = ks.name.s if isinstance(ks.name.s, str) else ks.name.s.decode()
 		seq = ks.seq.s if isinstance(ks.seq.s, str) else ks.seq.s.decode()
-		yield name, seq, qual
+		if read_comment:
+			if ks.comment.l > 0: comment = ks.comment.s if isinstance(ks.comment.s, str) else ks.comment.s.decode()
+			else: comment = None
+			yield name, seq, qual, comment
+		else:
+			yield name, seq, qual
 	cmappy.mm_fastx_close(ks)
 
+def revcomp(seq):
+	l = len(seq)
+	bseq = seq if isinstance(seq, bytes) else seq.encode()
+	cdef char *s = cmappy.mappy_revcomp(l, bseq)
+	r = s[:l] if isinstance(s, str) else s[:l].decode()
+	free(s)
+	return r
+
 def verbose(v=None):
 	if v is None: v = -1
 	return cmappy.mm_verbose_level(v)

python/minimap2.py

@@ -4,7 +4,7 @@ import sys, getopt
 import mappy as mp
 
 def main(argv):
-	opts, args = getopt.getopt(argv[1:], "x:n:m:k:w:r:")
+	opts, args = getopt.getopt(argv[1:], "x:n:m:k:w:r:c")
 	if len(args) < 2:
 		print("Usage: minimap2.py [options] <ref.fa>|<ref.mmi> <query.fq>")
 		print("Options:")
@@ -14,9 +14,10 @@ def main(argv):
 		print("  -k INT      k-mer length")
 		print("  -w INT      minimizer window length")
 		print("  -r INT      band width")
+		print("  -c          output the cs tag")
 		sys.exit(1)
 
-	preset, min_cnt, min_sc, k, w, bw = None, None, None, None, None, None
+	preset, min_cnt, min_sc, k, w, bw, out_cs = None, None, None, None, None, None, False
 	for opt, arg in opts:
 		if opt == '-x': preset = arg
 		elif opt == '-n': min_cnt = int(arg)
@@ -24,11 +25,12 @@ def main(argv):
 		elif opt == '-r': bw = int(arg)
 		elif opt == '-k': k = int(arg)
 		elif opt == '-w': w = int(arg)
+		elif opt == '-c': out_cs = True
 
 	a = mp.Aligner(args[0], preset=preset, min_cnt=min_cnt, min_chain_score=min_sc, k=k, w=w, bw=bw)
 	if not a: raise Exception("ERROR: failed to load/build index file '{}'".format(args[0]))
 	for name, seq, qual in mp.fastx_read(args[1]): # read one sequence
-		for h in a.map(seq): # traverse hits
+		for h in a.map(seq, cs=out_cs): # traverse hits
 			print('{}\t{}\t{}'.format(name, len(seq), h))
 
 if __name__ == "__main__":

sdust.c

@@ -70,10 +70,10 @@ void sdust_buf_destroy(sdust_buf_t *buf)
 static inline void shift_window(int t, kdq_t(int) *w, int T, int W, int *L, int *rw, int *rv, int *cw, int *cv)
 {
 	int s;
-	if (kdq_size(w) >= W - SD_WLEN + 1) { // TODO: is this right for SD_WLEN!=3?
+	if ((int)kdq_size(w) >= W - SD_WLEN + 1) { // TODO: is this right for SD_WLEN!=3?
 		s = *kdq_shift(int, w);
 		*rw -= --cw[s];
-		if (*L > kdq_size(w))
+		if (*L > (int)kdq_size(w))
 			--*L, *rv -= --cv[s];
 	}
 	kdq_push(int, w, t);
@@ -114,7 +114,7 @@ static void find_perfect(void *km, perf_intv_v *P, const kdq_t(int) *w, int T, i
 		r += c[t]++;
 		new_r = r, new_l = kdq_size(w) - i - 1;
 		if (new_r * 10 > T * new_l) {
-			for (j = 0; j < P->n && P->a[j].start >= i + start; ++j) { // find insertion position
+			for (j = 0; j < (int)P->n && P->a[j].start >= i + start; ++j) { // find insertion position
 				perf_intv_t *p = &P->a[j];
 				if (max_r == 0 || p->r * max_l > max_r * p->l)
 					max_r = p->r, max_l = p->l;

setup.py

@@ -14,16 +14,26 @@ else: # with Cython
 	module_src = 'python/mappy.pyx'
 	cmdclass['build_ext'] = build_ext
 
-import sys
+import sys, platform
+
 sys.path.append('python')
 
+extra_compile_args = ['-DHAVE_KALLOC']
+include_dirs = ["."]
+
+if platform.machine() in ["aarch64", "arm64"]:
+	include_dirs.append("sse2neon/")
+	extra_compile_args.extend(['-ftree-vectorize', '-DKSW_SSE2_ONLY', '-D__SSE2__'])
+else:
+	extra_compile_args.append('-msse4.1') # WARNING: ancient x86_64 CPUs don't have SSE4
+
 def readme():
-    with open('python/README.rst') as f:
+	with open('python/README.rst') as f:
-        return f.read()
+		return f.read()
 
 setup(
 	name = 'mappy',
-	version = '2.6',
+	version = '2.12',
 	url = 'https://github.com/lh3/minimap2',
 	description = 'Minimap2 python binding',
 	long_description = readme(),
@@ -33,17 +43,17 @@ setup(
 	keywords = 'sequence-alignment',
 	scripts = ['python/minimap2.py'],
     ext_modules = [Extension('mappy',
-		sources = [module_src, 'align.c', 'bseq.c', 'chain.c', 'format.c', 'hit.c', 'index.c', 'pe.c',
+		sources = [module_src, 'align.c', 'bseq.c', 'chain.c', 'format.c', 'hit.c', 'index.c', 'pe.c', 'options.c',
 				   'ksw2_extd2_sse.c', 'ksw2_exts2_sse.c', 'ksw2_extz2_sse.c', 'ksw2_ll_sse.c',
-				   'kalloc.c', 'kthread.c', 'map.c', 'misc.c', 'sdust.c', 'sketch.c', 'esterr.c'],
+				   'kalloc.c', 'kthread.c', 'map.c', 'misc.c', 'sdust.c', 'sketch.c', 'esterr.c', 'splitidx.c'],
 		depends = ['minimap.h', 'bseq.h', 'kalloc.h', 'kdq.h', 'khash.h', 'kseq.h', 'ksort.h',
 				   'ksw2.h', 'kthread.h', 'kvec.h', 'mmpriv.h', 'sdust.h',
 				   'python/cmappy.h', 'python/cmappy.pxd'],
-		extra_compile_args = ['-msse4'], # WARNING: ancient x86_64 CPUs don't have SSE4
+		extra_compile_args = extra_compile_args,
-		include_dirs = ['.'],
+		include_dirs = include_dirs,
 		libraries = ['z', 'm', 'pthread'])],
 	classifiers = [
-		'Development Status :: 4 - Beta',
+		'Development Status :: 5 - Production/Stable',
 		'License :: OSI Approved :: MIT License',
 		'Operating System :: POSIX',
 		'Programming Language :: C',

sketch.c

@@ -2,8 +2,9 @@
 #include <stdlib.h>
 #include <assert.h>
 #include <string.h>
+#define __STDC_LIMIT_MACROS
 #include "kvec.h"
-#include "minimap.h"
+#include "mmpriv.h"
 
 unsigned char seq_nt4_table[256] = {
 	0, 1, 2, 3,  4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4,
@@ -113,26 +114,26 @@ void mm_sketch(void *km, const char *str, int len, int w, int k, uint32_t rid, i
 			}
 		} else l = 0, tq.count = tq.front = 0, kmer_span = 0;
 		buf[buf_pos] = info; // need to do this here as appropriate buf_pos and buf[buf_pos] are needed below
-		if (l == w + k - 1) { // special case for the first window - because identical k-mers are not stored yet
+		if (l == w + k - 1 && min.x != UINT64_MAX) { // special case for the first window - because identical k-mers are not stored yet
 			for (j = buf_pos + 1; j < w; ++j)
-				if (min.x == buf[j].x && buf[j].y != min.y && buf[j].y != UINT64_MAX) kv_push(mm128_t, km, *p, buf[j]);
+				if (min.x == buf[j].x && buf[j].y != min.y) kv_push(mm128_t, km, *p, buf[j]);
 			for (j = 0; j < buf_pos; ++j)
-				if (min.x == buf[j].x && buf[j].y != min.y && buf[j].y != UINT64_MAX) kv_push(mm128_t, km, *p, buf[j]);
+				if (min.x == buf[j].x && buf[j].y != min.y) kv_push(mm128_t, km, *p, buf[j]);
 		}
 		if (info.x <= min.x) { // a new minimum; then write the old min
-			if (l >= w + k && min.y != UINT64_MAX) kv_push(mm128_t, km, *p, min);
+			if (l >= w + k && min.x != UINT64_MAX) kv_push(mm128_t, km, *p, min);
 			min = info, min_pos = buf_pos;
 		} else if (buf_pos == min_pos) { // old min has moved outside the window
-			if (l >= w + k - 1) kv_push(mm128_t, km, *p, min);
+			if (l >= w + k - 1 && min.x != UINT64_MAX) kv_push(mm128_t, km, *p, min);
 			for (j = buf_pos + 1, min.x = UINT64_MAX; j < w; ++j) // the two loops are necessary when there are identical k-mers
 				if (min.x >= buf[j].x) min = buf[j], min_pos = j; // >= is important s.t. min is always the closest k-mer
 			for (j = 0; j <= buf_pos; ++j)
 				if (min.x >= buf[j].x) min = buf[j], min_pos = j;
-			if (l >= w + k - 1) { // write identical k-mers
+			if (l >= w + k - 1 && min.x != UINT64_MAX) { // write identical k-mers
 				for (j = buf_pos + 1; j < w; ++j) // these two loops make sure the output is sorted
-					if (min.x == buf[j].x && min.y != buf[j].y && buf[j].y != UINT64_MAX) kv_push(mm128_t, km, *p, buf[j]);
+					if (min.x == buf[j].x && min.y != buf[j].y) kv_push(mm128_t, km, *p, buf[j]);
 				for (j = 0; j <= buf_pos; ++j)
-					if (min.x == buf[j].x && min.y != buf[j].y && buf[j].y != UINT64_MAX) kv_push(mm128_t, km, *p, buf[j]);
+					if (min.x == buf[j].x && min.y != buf[j].y) kv_push(mm128_t, km, *p, buf[j]);
 			}
 		}
 		if (++buf_pos == w) buf_pos = 0;

splitidx.c

@@ -0,0 +1,80 @@
+#include <string.h>
+#include <assert.h>
+#include <stdlib.h>
+#include <stdio.h>
+#include "mmpriv.h"
+
+FILE *mm_split_init(const char *prefix, const mm_idx_t *mi)
+{
+	char *fn;
+	FILE *fp;
+	uint32_t i, k = mi->k;
+	fn = (char*)calloc(strlen(prefix) + 10, 1);
+	sprintf(fn, "%s.%.4d.tmp", prefix, mi->index);
+	fp = fopen(fn, "wb");
+	assert(fp);
+	mm_err_fwrite(&k, 4, 1, fp);
+	mm_err_fwrite(&mi->n_seq, 4, 1, fp);
+	for (i = 0; i < mi->n_seq; ++i) {
+		uint8_t l;
+		l = strlen(mi->seq[i].name);
+		mm_err_fwrite(&l, 1, 1, fp);
+		mm_err_fwrite(mi->seq[i].name, 1, l, fp);
+		mm_err_fwrite(&mi->seq[i].len, 4, 1, fp);
+	}
+	free(fn);
+	return fp;
+}
+
+mm_idx_t *mm_split_merge_prep(const char *prefix, int n_splits, FILE **fp, uint32_t *n_seq_part)
+{
+	mm_idx_t *mi = 0;
+	char *fn;
+	int i, j;
+
+	if (n_splits < 1) return 0;
+	fn = CALLOC(char, strlen(prefix) + 10);
+	for (i = 0; i < n_splits; ++i) {
+		sprintf(fn, "%s.%.4d.tmp", prefix, i);
+		if ((fp[i] = fopen(fn, "rb")) == 0) {
+			if (mm_verbose >= 1)
+				fprintf(stderr, "ERROR: failed to open temporary file '%s'\n", fn);
+			for (j = 0; j < i; ++j)
+				fclose(fp[j]);
+			free(fn);
+			return 0;
+		}
+	}
+	free(fn);
+
+	mi = CALLOC(mm_idx_t, 1);
+	for (i = 0; i < n_splits; ++i) {
+		mm_err_fread(&mi->k, 4, 1, fp[i]); // TODO: check if k is all the same
+		mm_err_fread(&n_seq_part[i], 4, 1, fp[i]);
+		mi->n_seq += n_seq_part[i];
+	}
+	mi->seq = CALLOC(mm_idx_seq_t, mi->n_seq);
+	for (i = j = 0; i < n_splits; ++i) {
+		uint32_t k;
+		for (k = 0; k < n_seq_part[i]; ++k, ++j) {
+			uint8_t l;
+			mm_err_fread(&l, 1, 1, fp[i]);
+			mi->seq[j].name = (char*)calloc(l + 1, 1);
+			mm_err_fread(mi->seq[j].name, 1, l, fp[i]);
+			mm_err_fread(&mi->seq[j].len, 4, 1, fp[i]);
+		}
+	}
+	return mi;
+}
+
+void mm_split_rm_tmp(const char *prefix, int n_splits)
+{
+	int i;
+	char *fn;
+	fn = CALLOC(char, strlen(prefix) + 10);
+	for (i = 0; i < n_splits; ++i) {
+		sprintf(fn, "%s.%.4d.tmp", prefix, i);
+		remove(fn);
+	}
+	free(fn);
+}

test/MT-orang.fa

@@ -1,4 +1,4 @@
->MT_orang
+>MT_orang co:Z:comment
 GTTTATGTAGCTTATTCTATCCAAAGCAATGCACTGAAAATGTCTCGACGGGCCCACACG
 CCCCATAAACAAATAGGTTTGGTCCTAGCCTTTCTATTAGCTCTTAGTGAGGTTACACAT
 GCAAGCATCCCCGCCCCAGTGAGTCGCCCTCCAAGTCACTCTGACTAAGAGGAGCAAGCA

test/t-inv.fa

@@ -0,0 +1,127 @@
+>ref
+TGCGGAGGCTGAAGCAACTCCATCTTGGAAGCTAATCTACCATGTTGGCTTCTGATTAAC
+ATCAGTTCTGGGAAGGCTTGTAAGATTTCCTGTTTGTCTATTATTTCCTAGGTAAGAGCA
+GATACTTACTGTAAATCCTGCCCCTAGATTAAACAACCTTGGTGTTATCGTACTTCCATT
+GTCCTATACATCCCTTCGGAATCCCCCTTTCCCTATGGTCCTCAAGCCCTTGGTCTGGGG
+AGTAACAGCATAGGGATCAACCATCTCGTCTTGCCACTGCCCGAAATACAGACATGGCTT
+CTGTTCCTAAGTCCCTATTCAACTTTTCTTTCTAAGAAACTGGATTTGTCAGCCTCTTTC
+TTCACCTCTCAGCTTCCTTGGACTTTGGGGGTAGGTTTGCGTAGACATGCTCACCACAGA
+CACAATATCAGCTTCATTCTACAGATGAGGAAGGCAAGCCTTGGGGAGCTTAACCAACTT
+GTCGAGACTCATGTATATACCAACACTGAAAAGCAGATATTCCAGACTCCCAGTCATGCC
+ACAGGCACACCCCTCAGTGAGAGGTGGGGTTTGTAGTTGAGGCTATTTCCTGCCCAGGGA
+GCAGGGAGGCACTCTAGCTTCCCTGAGCTAACGTGGTTCTGCTTGTGTCTGACTTCCAGG
+TCTCTGCCCTTTCCAAGCTCACTAGGATGGGCTTCGGGTGTGTCAAATGCCTCAGACAGT
+ACAGATCCACACAGAATGGGCATATGCAACCAATCAGTGTCATAAAAAAGAAGGAAATGA
+CTCGGGCCCCCTGTGTGTTCAACATGTCGAAGGTATCTGTGCAGCAGAAGAAAGAGGGGC
+AAAAGCCCCCAGTGCCACAGGCCAGAGGCAGCAGCTTGGGCCCATGTGGGAGGGTTTGCT
+TTCCCCTGCCAAAGTGATGGGCTGCTGCAGCCTGGGGCTTGTGGGAATCCTTCCTGGGCC
+TGTGTGGGAAGTGTAGGCAGGGAGAGTGCTGCTTTCCCAAGCTCATCCCAGCTACAGCTA
+CCTTTGTGCTCTGGGATTCAGGACCCCCGAGGGGGCTGGCAGGAGAGTCTCTGTTCTCGG
+ATGGGTTGTCACCAGGGCATACATGGGAAGTGGGCTCTCTGGAGTCACCCTCCAGGGGAC
+AATGCCAATTCCAGACACATTTACTGGAACCCCTACACTGATGACCTTTTGTTGAGGGTT
+GAATTATGTCCCCAAAAAAGATACATTGAAGTCCAAACCTCTGGTGTCTATAAATGTGAT
+TTTATTTGAAAATGAGGTTTCTATGGACTAAATTGTGTCCCTCCCAAATTCATATTTTGA
+AGCCCTAGCCCCCAGTGTGACTATACCTAGAGACAGAGATCTTTAGGAGGTAATTAAGGT
+TCAATGAGGTCAGGTGGGTGGGGCCCTAAACCAACAGGAAGGACTGTGGCCTTACTAGAA
+AAGGAAGAAAAAGCATTTCCTCTCTTCTAGTATAAAAGGACACAGAAAGAAGGCAGATAT
+CTACAAGCCACGAAGAGAGACGTCACTGAGAACTGAATTTGTGTACATTGATCTGGAACT
+TCCAGCCTCCAGAACTTGAGAAATACATTTCTGTTGTTTATTTTTTTTTCATGTAATCAA
+TTCATTTATCATATATTTATTGAGTGCCTACTATGTGCCAGAGGATACAGCAGTAACAAA
+ACTAGGCAAAAATTGTGCCTAAAAGAGGGAAGATGACTTTTCTTAAAGTGTGGAATAAAG
+AAAAGTAAGATAGCGGATAGAAGCTTGAAGTGAAAGCAGGTTCACAGGAAGTTTCTTTGG
+TCATTTGTTTTGTTTTTAAATAGTGGAAAGATGTATATGTTTATGGAGAAAGATTGCCTT
+GAAGATGCAAGAGGAAGAGATGATCAAAATTCAAGAAGAAGCAGAAAGTGATAGAATAAA
+GAGCACAAGTGGAGAATTAGTGTTAATGAAAAGAAGGATGCTTCCTTTGATATGAAGTGA
+AGGAAGAGAGAATGAGTAAAGACCAAGACTTGAAGTCCCTAGTTTAATAGAGGGAGATTT
+CTTCTTTTGATAGCAACAATGGTATTCTGAATTATTTGAAGACATGTCATATTTCTCTTG
+TGCCATTTTCCTCCCAGTTTAAACATTCTCATAACCTCTATTCCTCACATGATGTTTTTC
+CAGGTCCTTTATTCTTTGGCACTCTCTTCTCTGGACACATTGTATTCTGTCATTGGTCCT
+AAAATTTAGATACCCACAATTGAACATACTCCTCTAGATATGGTCTAGCTAATGCAAAAG
+AACTGCTGCCTTCCAACTTGTTCAGACATCATATGTTTGTTGTCAAACGCTAAGTTGAGT
+TGTTATCTTTTAAGTTTTGTTTTTGTTTTTTTTTTTTTTTTTTAATTCCAAGAGGTGCCC
+ACGTTGGCTAAGTACCAAACAGGGTACTAGGGAATTTTACTTCTGAGTTAAATGCCATTC
+TAGTTGTTTTTTCTTCATCTCCAGTAAGGTTATCTTTATTCACCAGTTGTTACAATAGCT
+GTGGGTCTTGCTTCTCACAGTTTTATGCTGTCTGTGCTATTTTCTCTACTGATCATCACC
+ACAATCATTATTGCTTATCATAATTGTTATCTTTATTTTCTCCTTTAATCAAGAATCAGT
+CTTCCTTTATCTCATTATTCTCTTTTGCAGGCTTCAGGATAATTATGGTTGGAGTGCACT
+GGGGGAACCAGTGCAGCTAAGCTCTGACATCTTTGCATCCCTTTTCCATCTGCTGTTTTG
+GCACTCTGGTAGAATAGATAACCTAAAAACGACTTTAAAACATCTAGAAATTTTGGATAA
+AATATAACAAACATCCCTTTAAATGCACAACTGATCTTCCATGGAAGTCACAGAAATATA
+TAACGCCAAAAAGAAGGGAAGCTGAAACCCAGGGCTGTAAACATGAACATCATCTTCTCT
+CCCTTTTTCTTGTGACTTATCTTGTTTTTCTCAGCTTTGGTGCTACCAAGGCTTGACTTT
+AATAGGCATTTCCAATCAATGAGAGAATTTCTTTTGCTTTCATCAACAATTCAGTTATTG
+ATGTTAACATATATATCATTTGAGTACTTTTCTTTTTTTTATTATTATTATACTTTAAGT
+TTTAGGGTCCATGTGCACAATGTGCAGGTTAGTTACGTATGTATACATGTGCCATGCTGG
+TGTGCTGCACCCATTAACTCATCATTTAGCATTAGGTATATCTCCTAATGCTATCCCTTC
+CCCCTCTCCCCACCCCACAACAGTCCCCAGAGTGTTCCCCTTCCTGTGTCCATGTGTTCT
+CATTGTTCAATCCCCATCTATGAGTGAGAACATGCGGTGTTTGGTTTTTTGTCCTTGCAA
+TAGTTTACTGAGAATGATGATTTCTAATTTCATCCATGTCCCTAAAGAGCTTCTGCACAG
+CAAAAGAAACTACCATCAGAGTGAACAGGCAACCTACAAAATGGGAGAAAATTTTCACAA
+CCTGCTCATCTGACAAAGGGCTAATATCCAGAATCTACAATGAACTCAAACAAATTTACA
+AGAAAAAAACAAACAACCCCATCAAAAAGTGGGCAAAGGATATGAACAGACACTTCTCAA
+AAGAAGACATTTATGCAGCCAAAAGACACATGAAAAAATGCTCATCATCACTGGCCATCA
+GAGAAATGCAAACCAAAACCACAATGAGATACCATCTCACACCAGTTAAAATGGCAATCA
+TTAAAAAGTCAGGAAACAACAGGTGCTGGAGAGGATGTGGAGAAACAGGAACACTTTTAC
+ACTGTTGGTGGGACTGTAAACTAGTTCAACCATTGTGGAAGTCAGTGTGCTGATTCCTCA
+GGGATCTAGAACTAGAAATACCATTTGACCCAGCCATCCCATTACTGGGTATATACCCAA
+AGGACTATAAATCATGCTGCTATAAAGACACATGCACACGTATGTTTATTGCGGCACTAT
+TCACAATAGCAAAGACTTGGAACCAACCCAAATGTCCAACAATGATAGACTGGATTAAGA
+AAATGTGGCACATATACACCACGGAATACTGTGCAGCCATAAAAAATGATGAGTTCATGT
+CCTTTGTAGGGACACGGATGAAATTGGAAATCATTTCTGTTGTTTAAACCACGAAGTCTA
+TGGTATCTGGTTATGACAACCTGAGAATACTAACTCAAGGGTCTTTCGCAGATGTCATTA
+AGTTGTTAAAGTGAGGTCATTATGGTGGGTCCTAATCCAAGAGAAGAGATGCATGGACAG
+ACGTGCACAACGGGAGGACCAAGCCAAGACACACAGGGAGAATGGCCATGGGAAGATGGA
+GGCAGAGATCAAAGTGAGGCACCCACAAGCCAAGAAATGGCAGGAGCTACCAGCAGCTGG
+AAGATGCAGAGAAGCATTCCTTCTTAGAGGTTTCAGAGAGAGTATGGTGCTACTGACACC
+TTGATTTTGAACTTCTAGTCTCCAGAACTATGAGAGAATAAATTTCTGTTGGTTAAGCCA
+TCGAGTTTGTGTAAGTTTGTTATAAGAGCCCTAGGAAATAAACATATCCATTTATTCAGG
+AAAGCCTGCTAGAGTGCAAATATTTGGAAAAGATACTACTATGCAAATGTTTGAAAAAGA
+TATTGCTCTTGATTCTGCCTTATGGGTTTTTCATTTCTGTAAGCTATTCTCAAAGTTTTG
+TTCTTGGACTACTATTGGTAATTAAGACTGCAACATGTTTGGCAACATCAGTTGAGAACT
+GTTGCTCTGGGAACGTTTTCGGCAAGCCTCAGCCCTTCTTTTCCCTTGGCTTGCATTGAG
+GAGTTAGGTGATACTCTGCTGCTCAGGCCCAGCACCTTTATGGACCGTATTCCCCTGGTG
+GAATGACCATCTCTGCTTGCTCTGATTGGCTGTTGGGGTTTTCTAGCATGCCCTATTTAA
+TATGTATGATTTATCTCTTACTTCAGTTGGAAGGTACAGTTGCTCTGTAGTTGGCATGCA
+GTCATGGTGACTATGAAAATATAAAATAATGTTTTGGTTTACAGACACTTAGAAATAAGT
+TGTGTCTCAAAATTGGGTGACTATTCTAGTTATCTGCTACTCAATATCCTTGTGCGAGCC
+CTCTTTACCCAGAATCAAACTAAACCATGAGGGGCACTATAGAATGTCACCCCTGGGTCC
+AGGATACTATGGGGACTCAGAAGCCAAGCTCCCACTGGGGGATCTAGGGCATGCCCCCAA
+GGTAAGATTCCCACCTCTTTGTTCAGCAGGAAGCACCCATCACACAAGGAGGTAGGAATA
+AACAAGCATTCGTCAAGAACAAAAGATACAGATGTTCTGCTGGAGCTTGGATACATAGCA
+TAAGAGGGAACAGTTCTCACAGGTAAGAGTAAGTTTTCCTCTGGTGGTGACAGTGGGACC
+TGTGGGGGAGAGAATTGGGAGTACTGACAGGAAGGCAGAGTGGCTGTCCAAATGAACGGA
+TTGTTTGCACATGGCCTTTAGGGCACGTTGTGTTAGCCTTCCATTGCTGCTTATATTAGT
+CTGTTTTCACACTGCCCATAAATGCATACCTGAGACTGGATAATTTATAAAGAAAAAGAG
+CCTTAATGTACTCATAGTTGCATGTGGCTGGGGAGGCCTCACAATCATGGCAGAAGGTGA
+AAGGCACATCTTACATGGAAGCAGACAAGAGAGAATTGAGGACCAAGTGAAAGGGGTTTC
+CCCTTATAAAACCATCAGATCACATGAGACTTTTTCACCACCATGAGAACAGTAAGGGGA
+AAACTATGCTCATGATTCAATTGTCTCCCACTGGATTCCTCCCACAACACATAGGAATTA
+TGGGAGCTAAAATTCAAGATGAGATTTGGGTGAGGACACAGCCAAACCCTATCACTGCTG
+TAATCAATTCCCACCAACTTAGTGGCTCGAAACATCACAGATTTATGATCTTATGACGGT
+GGAGGTCCCCAAATGGATCTTCTAGGTCTAGAATCAAGGTATCAGCAGACCACTTCTTTT
+GGAGGCTCTGGTGGAGAAACCATTTCCTCGCCTTTTCCAGCTTCTAGAGGCTGCCCTTCT
+CATTCCTTGGTTCACGGCCACACTCATTTCCATCTCTGCTTCCACTGTGACAACTTCTCT
+GCCTCAGACCCTCCTGCTTTGCCTTTGTAAGGACCCTTGTGATGAGATCAGGCCCATCCA
+GGATTATCCCTCATCTCAAGACCTTTACCTTAATCACATTTGCAAGGTCTCTTCCACTGT
+GTCAGGTAACATTTTCACAGGTTCCAGGGATTAGGGTGTGGACATCTTGGGGAGCTGGAG
+GATATTATTTCATCTACCACACACATCTCTACCTTGTACAGGCAAGCACTTGCAAAGTGC
+AATGTGATCCTCTGGAGCCACTGTCCTCCCAGAGCTTATATATACTCTGAAAGTCAACTC
+TCAGACCACAGCCTCCTGTCCATGCACCACTCTCATCAACACCCCCACCCGAAACACTTT
+CACTCCACCCTCTTTGTCCCCTAACTCATGGAGAAGAAAATCTAATTAGTAGGAGTGGAA
+TTTGGCTTTCATCTTTACCAGTACTAGAAATATGGTGTGTGTCTTTTTGTAAAAATTCTC
+TCAACTAAATTGTTTTTATTAATTTCTGCAAAATGTGAACATCAACTCCCTTCATGTGAA
+TGTCAATAAGATTAAATGAGCTGTCTCAGCTCCTAGCCTGTGCAAGCTAACAGCTCAGGA
+GATGTTTATTTCTTTCCCTCTTCTTTCCTTAATGAAGCCCTCTCCTTTGACATCTTCAAT
+TCTGGAGCGCTTCTTTTCTGAGGCCTTGGCTCCCCCACATTGCCCACCCTTTTCCTGCTC
+GTCCACATTTCTGGCTTCTATTCTCTTGTCTTTACCATCTCCCTGAACAATGTTATCCGT
+TCCAATGACTTCAACAGTCTCTCCGCTTACATATGATGCCTCTCAAACTCTGATCTCCAA
+CTCTTCCAAAGAGCTCTGGACCTTTGTTCCAATTACCTGAAAAACATCTTCTTGGATGTC
+CCATTAGCACTGTTAAATCAAACAAGAATTTCCCTCCCTCCTGCCTTGCTGTAGTTCCCC
+TAGGGATTCGGTTGTGTGGGAAGATGTGTGGAGAGCTCTTAGTTGACTCCCTTCTCTGCA
+GTTCTACCTCTCTAGAGACTTGGAGGACCCACTGTTTCCGCCTCGCTTTTTCAGGCCTAG
+AGATTGCTCGCTCCTGGGCTGGCTGCTTCATAATTCCTTATTAGTAGTTTCCCAAGCTTA
+CATATCTGTAAATATTTACTTTAGTTAAATTCTCCCCAATTTCCACAATATGTTGGCTGC
+ACATGCTTTCTACTAGGAGTCACACAACTATGATAAGAACCAAGAAATATTAGTAAACGT
+TTTTTACCATTATTGGCCTATACCCTGGAATAGCCAACAATAACCTAGAACCTATGCAAC
+AAGAATATCCAACAAGAACCTAGAGACCTGTCAGTCTATAGGTGGGAACTACAGGATGAG
+A

tex/minimap2.bib

@@ -61,13 +61,6 @@
 	Volume = {32},
 	Year = {2016}}
 
-@misc{Suzuki:2016,
-	title = {Fast and accurate alignment tool for PacBio and Nanopore long reads},
-	author = {Hajime Suzuki},
-	journal = {Unpublished},
-	howpublished = {\href{https://github.com/ocxtal/minialign}{https://github.com/ocxtal/minialign}},
-	year = {2016}}
-
 @misc{Ruan:2016,
 	title = {Ultra-fast de novo assembler using long noisy reads},
 	author = {Jue Ruan},
@@ -172,14 +165,6 @@
 	Volume = {29},
 	Year = {2011}}
 
-@article {Suzuki130633,
-	author = {Suzuki, Hajime and Kasahara, Masahiro},
-	title = {Acceleration Of Nucleotide Semi-Global Alignment With Adaptive Banded Dynamic Programming},
-	year = {2017},
-	note = {doi:10.1101/130633},
-	publisher = {Cold Spring Harbor Labs Journals},
-	journal = {bioRxiv}}
-
 @article{Gotoh:1982aa,
 	Author = {Gotoh, O},
 	Journal = {J Mol Biol},
@@ -268,18 +253,10 @@
 	Title = {Mason -- a read simulator for second generation sequencing data},
 	Year = {2010}}
 
-@article{Langmead:2012fk,
-	Author = {Langmead, Ben and Salzberg, Steven L},
-	Journal = {Nat Methods},
-	Pages = {357-9},
-	Title = {Fast gapped-read alignment with Bowtie 2},
-	Volume = {9},
-	Year = {2012}}
-
 @article{Zaharia:2011aa,
 	Author = {Zaharia, Matei and others},
 	Journal = {arXiv:1111:5572},
-	Title = {Faster and More Accurate Sequence Alignment with SNAP},
+	Title = {Faster and More Accurate Sequence Alignment with {SNAP}},
 	Year = {2011}}
 
 @article{Irimia:2008aa,
@@ -305,3 +282,59 @@
 	Title = {Versatile and open software for comparing large genomes},
 	Volume = {5},
 	Year = {2004}}
+
+@article {Li223297,
+	author = {Li, Heng and others},
+	title = {New synthetic-diploid benchmark for accurate variant calling evaluation},
+	year = {2017},
+	note = {doi:10.1101/223297},
+	journal = {bioRxiv}
+}
+
+@article{Berlin:2015xy,
+	Author = {Berlin, Konstantin and others},
+	Journal = {Nat Biotechnol},
+	Pages = {623-30},
+	Title = {Assembling large genomes with single-molecule sequencing and locality-sensitive hashing},
+	Volume = {33},
+	Year = {2015}}
+
+@article{Gurevich:2013aa,
+	Author = {Gurevich, Alexey and others},
+	Journal = {Bioinformatics},
+	Pages = {1072-5},
+	Title = {{QUAST}: quality assessment tool for genome assemblies},
+	Volume = {29},
+	Year = {2013}}
+
+@article{Li:2010fk,
+	Author = {Li, Heng and Durbin, Richard},
+	Journal = {Bioinformatics},
+	Pages = {589-95},
+	Title = {Fast and accurate long-read alignment with {Burrows-Wheeler} transform},
+	Volume = {26},
+	Year = {2010}}
+
+@article{Marcais:2018aa,
+	Author = {Mar{\c c}ais, Guillaume and others},
+	Journal = {PLoS Comput Biol},
+	Pages = {e1005944},
+	Title = {{MUMmer4}: A fast and versatile genome alignment system},
+	Volume = {14},
+	Year = {2018}}
+
+@article{Li:2009ys,
+	Author = {Li, Heng and others},
+	Journal = {Bioinformatics},
+	Pages = {2078-9},
+	Title = {The {Sequence Alignment/Map format and SAMtools}},
+	Volume = {25},
+	Year = {2009}}
+
+@article{Suzuki:2018aa,
+	Author = {Suzuki, Hajime and Kasahara, Masahiro},
+	Journal = {BMC Bioinformatics},
+	Pages = {45},
+	Title = {Introducing difference recurrence relations for faster semi-global alignment of long sequences},
+	Volume = {19},
+	Year = {2018}}

tex/minimap2.tex

@@ -1,6 +1,6 @@
 \documentclass{bioinfo}
-\copyrightyear{2017}
+\copyrightyear{2018}
-\pubyear{2017}
+\pubyear{2018}
 
 \usepackage{graphicx}
 \usepackage{hyperref}
@@ -13,14 +13,13 @@
 
 \usepackage{natbib}
 \bibliographystyle{apalike}
-\usepackage{hyperref}
 
 \DeclareMathOperator*{\argmax}{argmax}
 
 \begin{document}
 \firstpage{1}
 
-\title[Aligning nucleotide sequences with minimap2]{Minimap2: versatile pairwise alignment for nucleotide sequences}
+\title[Aligning nucleotide sequences with minimap2]{Minimap2: pairwise alignment for nucleotide sequences}
 \author[Li]{Heng Li}
 \address{Broad Institute, 415 Main Street, Cambridge, MA 02142, USA}
 
@@ -41,9 +40,10 @@ full-length noisy Direct RNA or cDNA reads, and assembly contigs or closely
 related full chromosomes of hundreds of megabases in length. Minimap2 does
 split-read alignment, employs concave gap cost for long insertions and
 deletions (INDELs) and introduces new heuristics to reduce spurious alignments.
-It is 3--4 times faster than mainstream short-read mappers at comparable
+It is 3--4 times as fast as mainstream short-read mappers at comparable
-accuracy and $\ge$30 times faster at higher accuracy for both genomic and mRNA
+accuracy, and is $\ge$30 times faster than long-read genomic or cDNA
-reads, surpassing most aligners specialized in one type of alignment.
+mappers at higher accuracy, surpassing most aligners specialized in one type of
+alignment.
 
 \section{Availability and implementation:}
 \href{https://github.com/lh3/minimap2}{https://github.com/lh3/minimap2}
@@ -64,7 +64,7 @@ the thought that 10kb long sequences should be easier to map than 100bp reads
 because we can more effectively skip repetitive regions, which are often the
 bottleneck of short-read alignment. We confirmed our speculation by achieving
 approximate mapping 50 times faster than BWA-MEM~\citep{Li:2016aa}.
-\citet{Suzuki130633} extended our work with a fast and novel algorithm on
+\citet{Suzuki:2018aa} extended our work with a fast and novel algorithm on
 generating base-level alignment, which in turn inspired us to develop minimap2
 with added functionality.
 
@@ -88,12 +88,14 @@ the versatility of minimap2.
 
 Minimap2 follows a typical seed-chain-align procedure as is used by most
 full-genome aligners. It collects minimizers~\citep{Roberts:2004fv} of the
-reference sequences and indexes them in a hash table. Then for each query
+reference sequences and indexes them in a hash table, with the key being the
-sequence, minimap2 takes query minimizers as \emph{seeds}, finds matches to the
+hash of a minimizer and the value being a list of locations of the minimizer
-reference, and identifies sets of colinear seeds, which are called
+copies. Then for each query
+sequence, minimap2 takes query minimizers as \emph{seeds}, finds exact matches
+(i.e. \emph{anchors}) to the reference, and identifies sets of colinear anchors as
 \emph{chains}. If base-level alignment is requested, minimap2 applies dynamic
-programming (DP) to extend from the ends of chains and to close unseeded
+programming (DP) to extend from the ends of chains and to close
-regions between adjacent seeds in chains.
+regions between adjacent anchors in chains.
 
 Minimap2 uses indexing and seeding algorithms similar to
 minimap~\citep{Li:2016aa}, and furthers the predecessor with more accurate
@@ -120,10 +122,13 @@ distance between two anchors is too large); otherwise
 \end{equation}
 In implementation, a gap of length $l$ costs
 \[
-\gamma_c(l)=0.01\cdot \bar{w}\cdot|l|+0.5\log_2|l|
+\gamma_c(l)=\left\{\begin{array}{ll}
+0.01\cdot \bar{w}\cdot|l|+0.5\log_2|l| & (l\not=0) \\
+0 & (l=0)
+\end{array}\right.
 \]
-where $\bar{w}$ is the average seed length. For $m$ anchors, directly computing all $f(\cdot)$ with
+where $\bar{w}$ is the average seed length. For $N$ anchors, directly computing all $f(\cdot)$ with
-Eq.~(\ref{eq:chain}) takes $O(m^2)$ time. Although theoretically faster
+Eq.~(\ref{eq:chain}) takes $O(N^2)$ time. Although theoretically faster
 chaining algorithms exist~\citep{Abouelhoda:2005aa}, they
 are inapplicable to generic gap cost, complex to implement and usually
 associated with a large constant. We introduced a simple heuristic to
@@ -133,12 +138,12 @@ We note that if anchor $i$ is chained to $j$, chaining $i$ to a predecessor
 of $j$ is likely to yield a lower score. When evaluating Eq.~(\ref{eq:chain}),
 we start from anchor $i-1$ and stop the process if we cannot find a better
 score after up to $h$ iterations. This approach reduces the average time to
-$O(h\cdot m)$. In practice, we can almost always find the optimal chain with
+$O(hN)$. In practice, we can almost always find the optimal chain with
 $h=50$; even if the heuristic fails, the optimal chain is often close.
 
 \subsubsection{Backtracking}
 Let $P(i)$ be the index of the best predecessor of anchor $i$. It equals 0 if
-$f(i)=w_i$ or $\argmax_j\{f(j)+\eta(j,i)-\gamma(j,i)\}$ otherwise. For each
+$f(i)=w_i$ or $\argmax_j\{f(j)+\alpha(j,i)-\beta(j,i)\}$ otherwise. For each
 anchor $i$ in the descending order of $f(i)$, we apply $P(\cdot)$ repeatedly to
 find its predecessor and mark each visited $i$ as `used', until $P(i)=0$ or we
 reach an already `used' $i$. This way we find all chains with no anchors used
@@ -147,9 +152,11 @@ in more than one chains.
 \subsubsection{Identifying primary chains}\label{sec:primary}
 In the absence of copy number changes, each query segment should not be mapped
 to two places in the reference. However, chains found at the previous step may
-have significant or complete overlaps due to repeats in the reference.
+have significant or complete overlaps due to repeats in the reference~\citep{Li:2010fk}.
 Minimap2 used the following procedure to identify \emph{primary chains} that do
-not greatly overlap on the query. Let $Q$ be an empty set initially. For each
+not greatly overlap on the query.
+
+Let $Q$ be an empty set initially. For each
 chain from the best to the worst according to their chaining scores: if on the
 query, the chain overlaps with a chain in $Q$ by 50\% or higher percentage of
 the shorter chain, mark the chain as secondary to the chain in $Q$; otherwise,
@@ -157,6 +164,63 @@ add the chain to $Q$. In the end, $Q$ contains all the primary chains. We did
 not choose a more sophisticated data structure (e.g. range tree or k-d tree)
 because this step is not the performance bottleneck.
 
+For each primary chain, minimap2 estimates its mapping quality with an
+empirical formula:
+\[
+{\rm mapQ}=40\cdot (1-f_2/f_1)\cdot\min\{1,m/10\}\cdot\log f_1
+\]
+where $\log$ denotes natural logarithm, $m$ is the number of anchors on the primary chain, $f_1$ is the chaining
+score, and $f_2\le f_1$ is the score of the best chain that is secondary to the
+primary chain. Intuitively, a chain is assigned to a higher mapping quality if
+it is long and its best secondary chain is weak.
+
+\subsubsection{Estimating per-base sequence divergence}
+Suppose a query sequence harbors $n$ seeds of length $k$, $m$ of which are
+present in a chain. We want to estimate the sequence divergence $\epsilon$
+between the query and the reference sequences in the chain. This is useful
+when base-level alignment is too expensive to perform.
+
+If we model substitutions with a homogeneous Poisson process along the query
+sequence, the probablity of seeing $k$ consecutive bases without substitutions
+is $e^{-k\epsilon}$. On the assumption that all $k$-mers are independent of
+each other, the likelihood function of $\epsilon$ is
+\[
+\mathcal{L}(\epsilon|n,m,k)=e^{-m\cdot k\epsilon}(1-e^{-k\epsilon})^{n-m}
+\]
+The maximum likelihood estimate of $\epsilon$ is
+\[
+\hat{\epsilon}=\frac{1}{k}\log\frac{n}{m}
+\]
+In reality, sequencing errors are sometimes clustered and $k$-mers are not
+independent of each other, especially when we take minimizers as seeds. These
+violate the assumptions in the derivation above. As a result, $\hat{\epsilon}$
+is only approximate and can be biased. It also ignores long deletions from the
+reference sequence. In practice, fortunately, $\hat{\epsilon}$ is often close
+to and strongly correlated with the sequence divergence estimated from
+base-level alignments. On the several datasets used in
+Section~\ref{sec:long-genomic}, the Spearman correlation coefficient is around
+$0.9$.
+
+\subsubsection{Indexing with homopolymer compressed $k$-mers}
+SmartDenovo
+(\href{https://github.com/ruanjue/smartdenovo}{https://github.com/ruanjue/smartdenovo};
+J. Ruan, personal communication) indexes reads with homopolymer-compressed (HPC)
+$k$-mers and finds the strategy improves overlap sensitivity for SMRT reads.
+Minimap2 adopts the same heuristic.
+
+The HPC string of a string $s$, denoted by ${\rm HPC}(s)$, is constructed by
+contracting homopolymers in $s$ to a single base.  An HPC $k$-mer of $s$ is a
+$k$-long substring of ${\rm HPC}(s)$. For example, suppose $s={\tt GGATTTTCCA}$,
+${\rm HPC}(s)={\tt GATCA}$ and the first HPC 4-mer is ${\tt GATC}$.
+
+To demonstrate the effectiveness of HPC $k$-mers, we performed read overlapping
+for the example {\it E. coli} SMRT reads from PBcR~\citep{Berlin:2015xy}, using
+different types of $k$-mers. With normal 15bp minimizers per 5bp window,
+minimap2 finds 90.9\% of $\ge$2kb overlaps inferred from the read-to-reference
+alignment. With HPC 19-mers per 5bp window, minimap2 finds 97.4\% of overlaps. It achieves this
+higher sensitivity by indexing 1/3 fewer minimizers, which further helps
+performance. HPC-based indexing reduces the sensitivity for current ONT reads, though.
+
 \subsection{Aligning genomic DNA}\label{sec:genomic}
 
 \subsubsection{Alignment with 2-piece affine gap cost}
@@ -194,14 +258,14 @@ performance of minimap2. Traditional SSE implementations~\citep{Farrar:2007hs}
 based on Eq.~(\ref{eq:ae86}) can achieve 16-way parallelization for short
 sequences, but only 4-way parallelization when the peak alignment score reaches
 32767. Long sequence alignment may exceed this threshold. Inspired by
-\citet{Wu:1996aa} and the following work, \citet{Suzuki130633} proposed a
+\citet{Wu:1996aa} and the following work, \citet{Suzuki:2018aa} proposed a
 difference-based formulation that lifted this limitation.
 In case of 2-piece gap cost, define
 \[
 \left\{\begin{array}{ll}
 u_{ij}\triangleq H_{ij}-H_{i-1,j} & v_{ij}\triangleq H_{ij}-H_{i,j-1} \\
-x_{ij}\triangleq E_{i+1,j}-H_{ij} & \tilde{x}_{ij}\triangleq \tilde{E}_{i+1,j}-\tilde{H}_{ij} \\
+x_{ij}\triangleq E_{i+1,j}-H_{ij} & \tilde{x}_{ij}\triangleq \tilde{E}_{i+1,j}-H_{ij} \\
-y_{ij}\triangleq F_{i,j+1}-H_{ij} & \tilde{y}_{ij}\triangleq \tilde{F}_{i,j+1}-\tilde{H}_{ij}
+y_{ij}\triangleq F_{i,j+1}-H_{ij} & \tilde{y}_{ij}\triangleq \tilde{F}_{i,j+1}-H_{ij}
 \end{array}\right.
 \]
 We can transform Eq.~(\ref{eq:ae86}) to
@@ -261,11 +325,11 @@ y_{rt}&=&\max\{0,y_{r-1,t}+u_{r-1,t}-z_{rt}+q\}-q-e\\
 \end{equation*}
 In this formulation, cells with the same diagonal index $r$ are independent of
 each other. This allows us to fully vectorize the computation of all cells on
-the same anti-diagonal in one inner loop. It also simplifies banded alignment,
+the same anti-diagonal in one inner loop. It also simplifies banded alignment (500bp band width by default),
 which would be difficult with striped vectorization~\citep{Farrar:2007hs}.
 
 On the condition that $q+e<\tilde{q}+\tilde{e}$ and $e>\tilde{e}$, the initial
-values in the diagonal-antidiagonal formuation is
+values in the diagonal-antidiagonal formuation are
 \[
 \left\{\begin{array}{l}
 x_{r-1,-1}=y_{r-1,r}=-q-e\\
@@ -284,12 +348,19 @@ r\cdot(e-\tilde{e})-(\tilde{q}-q)-\tilde{e} & (r=\lceil\frac{\tilde{q}-q}{e-\til
 \]
 These can be derived from the initial values for Eq.~(\ref{eq:ae86}).
 
+When performing global alignment, we do not need to compute $H_{rt}$ in each cell.
+We use 16-way vectorization throughout the alignment process. When extending
+alignments from ends of chains, we need to find the cell $(r,t)$ where $H_{rt}$
+reaches the maximum. We resort to 4-way vectorization to compute
+$H_{rt}=H_{r-1,t}+u_{rt}$. Because this computation is simple,
+Eq.~(\ref{eq:suzuki}) is still the dominant performance bottleneck.
+
 In practice, our 16-way vectorized implementation of global alignment is three
 times as fast as Parasail's 4-way vectorization~\citep{Daily:2016aa}.  Without
 banding, our implementation is slower than Edlib~\citep{Sosic:2017aa}, but with
 a 1000bp band, it is considerably faster. When performing global alignment
 between anchors, we expect the alignment to stay close to the diagonal of the
-DP matrix. Banding is applicable most of time.
+DP matrix. Banding is applicable most of the time.
 
 \subsubsection{The Z-drop heuristic}
 
@@ -313,6 +384,16 @@ alignment between the two subsequences involved in the global alignment, but
 this time with the one subsequence reverse complemented. This additional
 alignment step may identify short inversions that are missed during chaining.
 
+\subsubsection{Filtering out misplaced anchors}
+Due to sequencing errors and local homology, some anchors in a chain may be
+wrong. If we blindly align regions between two misplaced anchors, we will
+produce a suboptimal alignment. To reduce this artifact, we filter out
+anchors that lead to a $>$10bp insertion and a $>$10bp deletion at the same
+time, and filter out terminal anchors that lead to a long gap towards the ends
+of a chain. These heuristics greatly alleviate the issues with misplaced
+anchors, but they are unable to fix all such errors. Local misalignment is a
+limitation of minimap2 which we hope to address in future.
+
 \subsection{Aligning spliced sequences}
 
 The algorithm described above can be adapted to spliced alignment. In this
@@ -351,7 +432,7 @@ p/2 & \mbox{if $T[i+1,i+3]$ is ${\tt GTC}$ or ${\tt GTT}$} \\
 p & \mbox{otherwise}
 \end{array}\right.\]
 where $T[i,j]$ extracts a substring of $T$ between $i$ and $j$ inclusively.
-$d(i)$ penalizes non-canonical donor sites with $p$ and less frequent Eukayotic
+$d(i)$ penalizes non-canonical donor sites with $p$ and less frequent Eukaryotic
 splicing signal ${\tt GT[C/T]}$ with $p/2$~\citep{Irimia:2008aa}. Similarly,
 \[a(i)=\left\{\begin{array}{ll}
 0 & \mbox{if $T[i-2,i]$ is ${\tt CAG}$ or ${\tt TAG}$} \\
@@ -378,13 +459,13 @@ alignment.
 
 \subsection{Aligning short paired-end reads}
 
-During chainging, minimap2 takes a pair of reads as one fragment with a gap of
+During chaining, minimap2 takes a pair of reads as one fragment with a gap of
 unknown length in the middle. It applies a normal gap cost between seeds on the
 same read but is a more permissive gap cost between seeds on different reads.
-More precisely, the gap cost during chaining is:
+More precisely, the gap cost during chaining is ($l\not=0$):
 \[
 \gamma_c(l)=\left\{\begin{array}{ll}
-0.01\cdot\bar{w}\cdot l+0.5\log_2 l & \mbox{if two seeds on the same read} \\
+0.01\cdot\bar{w}\cdot |l|+0.5\log_2 |l| & \mbox{if two seeds on the same read} \\
 \min\{0.01\cdot\bar{w}\cdot|l|,\log_2|l|\} & \mbox{otherwise}
 \end{array}\right.
 \]
@@ -397,26 +478,40 @@ consistent paired-end alignments.
 
 \section{Results}
 
-\subsection{Aligning long genomic reads}
+Minimap2 is implemented in the C programming language and comes with APIs in
+both C and Python. It is distributed under the MIT license, free to both
+commercial and academic uses. Minimap2 uses the same base algorithm for all
+applications, but it has to apply different sets of parameters depending on
+input data types. Similar to BWA-MEM, minimap2 introduces `presets' that
+modify multiple parameters with a simple invocation. Detailed settings
+and command-line options can be found in the minimap2 manpage. In addition to
+the applications evaluated in the following sections, minimap2 also retains
+minimap's functionality to find overlaps between long reads and to search
+against large multi-species databases such as \emph{nt} from NCBI.
+
+\subsection{Aligning long genomic reads}\label{sec:long-genomic}
 
 \begin{figure}[!tb]
 \centering
 \includegraphics[width=.5\textwidth]{roc-color.pdf}
 \caption{Evaluation on aligning simulated reads. Simulated reads were mapped 
 to the primary assembly of human genome GRCh38. A read is considered correctly
-mapped if the true position overlaps with the best mapping position by 10\% of
+mapped if its longest alignment overlaps with the true interval, and the
-the read length. Read alignments are sorted by mapping quality in the
+overlap length is $\ge$10\% of the true interval length.  Read alignments are
-descending order. For each mapping quality threshold, the fraction of
+sorted by mapping quality in the descending order. For each mapping quality
-alignments with mapping quality above the threshold and their error rate are
+threshold, the fraction of alignments (out of the number of input reads) with
+mapping quality above the threshold and their error rate are
 plotted along the curve. (a) long-read alignment evaluation. 33,088 $\ge$1000bp
 reads were simulated using pbsim~\citep{Ono:2013aa} with error profile sampled
 from file `m131017\_060208\_42213\_*.1.*' downloaded at
 \href{http://bit.ly/chm1p5c3}{http://bit.ly/chm1p5c3}. The N50 read length is
 11,628. Aligners were run under the default setting for SMRT reads.
-(b) short-read alignment evaluation. 10 million pairs of 150bp reads were
+Kart outputted all alignments at mapping quality 60, so is not shown in the
-simulated using mason2~\citep{Holtgrewe:2010aa} with option
+figure. It mapped nearly all reads with 4.1\% of alignments being wrong, less
-`\mbox{--illumina-prob-mismatch-scale 2.5}'. Short-read aligners were run under the
+accurate than others.  (b) short-read alignment evaluation. 10 million pairs of
-default setting except for changing the maximum fragment length to
+150bp reads were simulated using mason2~\citep{Holtgrewe:2010aa} with option
+`\mbox{--illumina-prob-mismatch-scale 2.5}'. Short-read aligners were run under
+the default setting except for changing the maximum fragment length to
 800bp.}\label{fig:eval}
 \end{figure}
 
@@ -425,7 +520,7 @@ BLASR~(v1.MC.rc64; \citealp{Chaisson:2012aa}),
 BWA-MEM~(v0.7.15; \citealp{Li:2013aa}),
 GraphMap~(v0.5.2; \citealp{Sovic:2016aa}),
 Kart~(v2.2.5; \citealp{Lin:2017aa}),
-minialign~(v0.5.3; \citealp{Suzuki:2016}) and
+minialign~(v0.5.3; \href{https://github.com/ocxtal/minialign}{https://github.com/ocxtal/minialign}) and
 NGMLR~(v0.2.5; \citealp{Sedlazeck169557}). We excluded rHAT~\citep{Liu:2016ab}
 and LAMSA~\citep{Liu:2017aa} because they either
 crashed or produced malformatted output. In this evaluation, minimap2 has
@@ -434,11 +529,11 @@ higher mapping accuracy (Fig.~\ref{fig:eval}a). Minimap2 and
 NGMLR provide better mapping quality estimate: they rarely give repetitive hits
 high mapping quality.  Apparently, other aligners may
 occasionally miss close suboptimal hits and be overconfident in wrong mappings.
-On run time, minialign is slightly faster than minimap2 and Kart. They are over
+On run time, minimap2 took 200 CPU seconds, comparable to minialign and Kart, and is over
-30 times faster than the rest.  Minimap2 consumed 6.1GB memory at the peak,
+30 times faster than the rest.  Minimap2 consumed 6.8GB memory at the peak,
-more than BWA-MEM but less than others.
+more than BWA-MEM (5.4GB), similar to NGMLR and less than others.
 
-On real human SMRT reads, the relative performance and sensitivity of
+On real human SMRT reads, the relative performance and fraction of mapped reads reported by
 these aligners are broadly similar to the metrics on simulated data. We are
 unable to provide a good estimate of mapping error rate due to the lack of the
 truth.  On ONT $\sim$100kb human reads~\citep{Jain128835}, BWA-MEM failed.
@@ -480,7 +575,7 @@ Peak RAM (GByte)          & 8.9      & 14.5     & 3.2      & 29.2\vspace{1em}\\
 \% approx. introns        & 91.8\%   & 96.9\%   & 92.5\%   & 82.4\% \\
 \botrule
 \end{tabular}
-}{Mouse reads (AC:SRR5286960) were mapped to the primary assembly of mouse
+}{Mouse cDNA reads (AC:SRR5286960; R9.4 chemistry) were mapped to the primary assembly of mouse
 genome GRCm38 with the following tools and command options: minimap2 (`-ax
 splice'); GMAP (`-n 0 --min-intronlength 30 --cross-species'); SpAln (`-Q7 -LS
 -S3'); STARlong (according to
@@ -489,7 +584,7 @@ compared to the EnsEMBL gene annotation, release 89. A predicted intron
 is \emph{novel} if it has no overlaps with any annotated introns. An intron
 is \emph{exact} if it is identical to an annotated intron. An intron is
 \emph{approximate} if both its 5'- and 3'-end are within 10bp around the ends
-of an annotated intron.}
+of an annotated intron. Chimeric alignments are defined in the SAM spec~\citep{Li:2009ys}.}
 \end{table}
 
 We next aligned real mouse reads~\citep{Byrne:2017aa} with GMAP~(v2017-06-20;
@@ -500,14 +595,18 @@ more junctions with a higher percentage being exactly or approximately correct.
 Minimap2 is over 40 times faster than GMAP and SpAln. While STAR is close to
 minimap2 in speed, it does not work well with noisy reads.
 
-We have also evaluated spliced aligners on public Iso-Seq data (human Alzheimer
+We have also evaluated spliced aligners on a human Nanopore Direct RNA-seq
-brain from \href{http://bit.ly/isoseqpub}{http://bit.ly/isoseqpub}). The
+dataset (\href{http://bit.ly/na12878ont}{http://bit.ly/na12878ont}). Minimap2
-observation is similar: minimap2 is faster at higher junction accuracy.
+aligned 10 million reads in $<$1 wall-clock hour using 16 CPU cores. 94.2\% of
-On a private Nanopore Direct RNA data set with $\sim$17\% sequencing error rate
+aligned splice junctions consistent with gene annotations. In comparison,
-(N. Loman, personal communication), minimap2 aligned 96\,467 introns
+GMAP under option `-k 14 -n 0 --min-intronlength 30 --cross-species' is 160
-from 37\,068 mapped reads with 95.4\% of them consistent with human gene
+times slower; 68.7\% of GMAP junctions are found in known gene annotations. The
-annotations. In comparison, only 74.8\% of GMAP introns found in known gene
+percentage increases to 84.1\% if an aligned junction within 10bp from an
-annotations.
+annotated junction is considered to be correct. On a public Iso-Seq dataset
+(human Alzheimer brain from
+\href{http://bit.ly/isoseqpub}{http://bit.ly/isoseqpub}), minimap2 is also
+faster at higher junction accuracy in comparison to other aligners in
+Table~\ref{tab:intron}.
 
 We noted that GMAP and SpAln have not been optimized for noisy reads. We are
 showing the best setting we have experimented, but their developers should be
@@ -542,7 +641,7 @@ simulated data set than Bowtie2 and SNAP but less accurate than BWA-MEM
 (Fig.~\ref{fig:eval}b). Closer investigation reveals that BWA-MEM achieves
 a higher accuracy partly because it tries to locally align a read in a small
 region close to its mate. If we disable this feature, BWA-MEM becomes slightly
-less accurate than minimap2. We might consider to implement a similar heuristic
+less accurate than minimap2. We might implement a similar heuristic
 in minimap2 in future.
 
 To evaluate the accuracy of minimap2 on real data, we aligned human reads
@@ -551,22 +650,31 @@ with GATK HaplotypeCaller v3.5~\citep{Depristo:2011vn}. This run was sequenced
 from experimentally mixed CHM1 and CHM13 cell lines. Both of them are homozygous
 across the whole genome and have been \emph{de novo} assembled with SMRT reads
 to high quality. This allowed us to construct an independent truth variant
-data set
+dataset~\citep{Li223297} for
-(\href{https://github.com/lh3/CHM-eval}{https://github.com/lh3/CHM-eval}) for
 ERR1341796. In this evaluation, minimap2 has higher SNP false negative rate
-(FNR; 2.5\% of minimap2 vs 2.2\% of BWA-MEM), but fewer false positive SNPs per
+(FNR; 2.6\% of minimap2 vs 2.3\% of BWA-MEM), but fewer false positive SNPs per
-million bases (FPPM; 3.0 vs 3.9), lower 2--50bp INDEL FNR (7.3\% vs 7.5\%) and
+million bases (FPPM; 7.0 vs 8.8), similar INDEL FNR (11.2\% vs 11.3\%) and
-similar INDEL FPPM (both 1.0). Minimap2 is broadly similar to BWA-MEM in the
+similar INDEL FPPM (6.4 vs 6.5). Minimap2 is broadly comparable to BWA-MEM in the
 context of small variant calling.
 
-\subsection{Other applications}
+\subsection{Aligning long-read assemblies}
 
-Minimap2 retains minimap's functionality to find overlaps between long reads
+Minimap2 can align a SMRT assembly (AC:GCA\_001297185.1) against GRCh38 in 7
-and to search against large multi-species databases such as \emph{nt} from
+minutes using 8 CPU cores, over 20 times faster than nucmer from
-NCBI. Minimap2 can also align similar genomes or different assemblies of the
+MUMmer4~\citep{Marcais:2018aa}. With the paftools.js script from the minimap2
-same species. It took 7 wall-clock minutes over 8 CPU cores to align a human
+package, we called 2.67 million single-base substitutions out of 2.78Gbp
-SMRT assembly (AC:GCA\_001297185.1) to GRCh38, over 20 times faster
+genomic regions. The transition-to-transversion ratio (ts/tv) is 2.01. In
-MUMmer4~\citep{Kurtz:2004zr}.
+comparison, using MUMmer4's dnadiff pipeline, we called 2.86 million
+substitutions in 2.83Gbp at ts/tv=1.87. Given that ts/tv averaged across the
+human genome is about 2 but ts/tv averaged over random errors is 0.5, the
+minimap2 callset arguably has higher precision at lower sensitivity.
+
+The sample being assembled is a female. Minimap2 still called 201 substitutions
+on the Y chromosome. These substitutions all come from one contig aligned at
+96.8\% sequence identity. The contig could be a segmental duplication
+absent from GRCh38. In constrast, dnadiff called 9070 substitutions on the Y
+chromosome across 73 SMRT contigs. This again implies our minimap2-based
+pipeline has higher precision.
 
 \section{Discussions}
 
@@ -584,9 +692,9 @@ involving $>$100kb introns, which was impractically slow ten years ago.  The
 minimap2 chaining algorithm is fast and highly accurate by itself.  In fact,
 chaining alone is more accurate than all the other long-read mappers in
 Fig.~\ref{fig:eval}a (data not shown). This accuracy helps to reduce downstream
-base-level alignment of candidate chains, which is still times slower than
+base-level alignment of candidate chains, which is still several times slower than
 chaining even with the Suzuki-Kasahara improvement. In addition, taking a
-general form, minimap2 chaining can be adapted to non-typical data types such
+general form, minimap2 chaining can be adapted to non-typical data types such as
 spliced reads and multiple reads per fragment. This gives us the opportunity to
 extend the same base algorithm to a variety of use cases.
 
@@ -597,16 +705,19 @@ uniqueness and reduce unsuccessful extensions. Minimap2 indexes reference
 k-mers with a hash table instead. Such fixed-length seeds are inferior to
 variable-length seeds in theory, but can be computed much more efficiently in
 practice. When a query sequence has multiple seed hits, we can afford to skip
-some highly repetitive seeds without affecting the final accuracy. This further
+highly repetitive seeds without affecting the final accuracy. This further
-alleviates the concern with the uniqueness of seeds. Hash table is the ideal
+alleviates the concern with the seeding uniqueness. At the same time, at low
-data structure for mapping long query sequences.
+sequence identity, it is rare to see long seeds anyway. Hash table is the ideal
+data structure for mapping long noisy sequences.
 
 \section*{Acknowledgements}
 We owe a debt of gratitude to H. Suzuki and M. Kasahara for releasing their
 masterpiece and insightful notes before formal publication. We thank M.
 Schatz, P. Rescheneder and F. Sedlazeck for pointing out the limitation of
-BWA-MEM. We are also grateful to early minimap2 testers who have greatly helped
+BWA-MEM. We are also grateful to minimap2 users who have greatly helped to
-to suggest features and to fix various issues.
+suggest features and to fix various issues.
+
+\paragraph{Funding\textcolon} NHGRI 1R01HG010040-01
 
 \bibliography{minimap2}