Compare commits

..
82 Commits
Author SHA1 Message Date
Heng Li 2d7ec75d50 Release minimap2-2.10 (r761) 2018-03-27 11:45:44 -04:00
Heng Li 7938ed4893 fixed two mappy warnings 2018-03-26 15:12:54 -04:00
Heng Li 4740423afa Merge remote-tracking branch 'origin/master' 2018-03-26 14:37:17 -04:00
Heng Li 1776311a9b updated cookbook 2018-03-26 14:37:02 -04:00
Heng Li c1a3e05cb0 Merge pull request #138 from zingdle/patch-1
Fix typo in README.md
2018-03-26 07:50:39 -04:00
zingdle ecb6703d4a Update README.md
Fix typo.
TD;DR -> TL;DR
2018-03-26 14:54:52 +08:00
Heng Li 0bf97a367b r755: junceval to only evaluate chromosomes 2018-03-24 23:10:06 -04:00
Heng Li 1c504d72e4 r754: option to only change name 2018-03-23 12:27:11 -04:00
Heng Li 5ef9580b17 r753: change bandwidth in ava-ont to 2000bp 2018-03-23 10:15:23 -04:00
Heng Li 08bd2123b6 r752: option to copy comments to output (#136) 2018-03-23 10:04:33 -04:00
Heng Li 8766d286df r751: optionally output MD (#118) 2018-03-22 14:15:33 -04:00
Heng Li 623b5d9d48 r750: check puts() return (#132 & #103) 2018-03-22 11:31:58 -04:00
Heng Li 18659118cd r749: don't print version etc at low verbose 2018-03-22 11:10:55 -04:00
Heng Li d1050f4eaf r748: optionally to use system getopt() (#134) 2018-03-19 11:18:26 -04:00
Heng Li b81d45510e Revision v2 2018-03-16 11:18:06 -04:00
Heng Li d135feb1a5 response to reviewers' comments, round 2 2018-03-15 21:59:57 -04:00
Heng Li 242ff4e91d r745: junceval - recognize "-" as file name 2018-03-15 12:51:46 -04:00
Heng Li 7a0c1316ce added more examples to cookbook 2018-03-12 22:24:22 -04:00
Heng Li 77ebd479f4 r743: added VCF output to "call" 2018-03-12 21:51:31 -04:00
Heng Li e3f226a9d9 working on section "Full-Genome Alignment"
found an apparent bug in paftools.js call. To debug...
2018-03-12 16:12:18 -04:00
Heng Li bdc615c1d4 r741: added --min-occ-floor to improve #107 2018-03-12 14:32:27 -04:00
Heng Li ad1beaf255 backup; not finished 2018-03-12 13:20:25 -04:00
Heng Li de0480ac5b finished section "Read Overlap" 2018-03-12 13:05:51 -04:00
Heng Li f2866533a8 finished "mapping genomic reads" 2018-03-12 12:50:21 -04:00
Heng Li 0173850ef0 don't use bullets - they are hard to read 2018-03-12 12:42:13 -04:00
Heng Li acea3594fb updated cookbook 2018-03-12 12:39:57 -04:00
Heng Li f78a247749 Started to work on a cookbook 2018-03-12 12:00:44 -04:00
Heng Li ccaf12e1a2 r734: removed debugging print in call() 2018-03-09 23:46:21 -05:00
Heng Li 96b132c97d fixed a bug/typo in Aligner.seq() (#126) 2018-03-08 19:12:12 -05:00
Heng Li 70428ca3a8 speedup tag parsing for sam2paf 2018-03-02 10:17:55 -05:00
Heng Li 9aea79d621 faster tag parsing 2018-03-02 10:09:14 -05:00
Heng Li 1770988627 make calling work with sam2paf output 2018-03-02 10:03:06 -05:00
Heng Li 2bfdad34bb minor cleanup to last commit 2018-03-02 01:07:37 -05:00
Heng Li 953766cedd generate cs; not carefully tested 2018-03-02 00:14:55 -05:00
Heng Li dc61301d9f sam2paf cleanup 2018-03-01 21:58:12 -05:00
Heng Li 19e05a099d for clarity 2018-03-01 18:25:29 -05:00
Heng Li 0238caa8b1 clarify minimap2 not working for >2Gbp seq #129 2018-03-01 18:23:40 -05:00
Heng Li a22ebb9836 use SSE compiler flags more precisely (#127) 2018-02-26 09:51:01 -05:00
Heng Li eeb314edd6 Release minimap2-2.9 (r720) 2018-02-24 09:31:09 -05:00
Heng Li 83c57a9d98 r719: fixed bad memory access 2018-02-23 17:27:41 -05:00
Heng Li 24a4808826 r718: retrieve sequence from the index 2018-02-23 10:18:26 -05:00
Heng Li 29ed675ee5 bugfix: in-place revcomp() not working 2018-02-20 11:05:54 -05:00
Heng Li 7dc7097208 added reverse complement 2018-02-20 09:41:25 -05:00
Heng Li f434653432 added peakrss(); not used for now 2018-02-17 20:40:31 -05:00
Heng Li 090361c25b fixed a typo in mappy (#117) 2018-02-16 21:10:57 -05:00
Heng Li e1f18690f6 paftools-r713: fixed bug for cov1 regions 2018-02-16 12:20:46 -05:00
Heng Li 54a42aafe5 keep documents in sync 2018-02-15 17:21:09 -05:00
Heng Li 8fc5f8dc90 r711: assign proper mapq to primary inversions 2018-02-15 14:34:59 -05:00
Heng Li a0d62519c1 r710: fixed incorrect inversion coordinate (#112) 2018-02-15 14:23:42 -05:00
Heng Li b71c01b316 added test data for inversions 2018-02-15 11:04:27 -05:00
Heng Li 1372977a37 r708: implemented double Z-drop thresholds (#112)
When aligning long reads, we would prefer to align through low-quality
regions. This requires a large Z-drop threshold. However, to find small
inversions, we need to use a small Z-drop. This commit address this
conflict with two Z-drop thresholds. When Z-drop exceeds the smaller
threshold, we perform a local alignment to check if there is a potential
inversion. If there is one, we break the alignment; otherwise we break
the alignment only if Z-drop excess the larger threshold.

This commit also fixes a bug that reported wrong coordinates when the
inversion is on the forward strand (#112).
2018-02-15 10:50:49 -05:00
Heng Li c0e0d5d84b r707: bugfix for inversions on rev strand (#112) 2018-02-14 14:09:03 -05:00
Heng Li b328795051 r706: don't segfault upon wrong FASTA/Q (#111)
The lack of robustness cost me several hours to identify.
2018-02-13 10:00:22 -05:00
Heng Li 3b17d62ccd minor doc improvements 2018-02-12 22:27:02 -05:00
Heng Li 874b8c4795 rework misc/README; progressing but unfinished 2018-02-12 22:06:05 -05:00
Heng Li 7ef5490884 r703: added --max-clip-ratio
still testing the option
2018-02-12 13:29:18 -05:00
Heng Li f66de7df59 updated paftools revision number to r702 2018-02-12 11:39:04 -05:00
Heng Li fbbd4e0968 changed output messages for clarity 2018-02-12 11:32:32 -05:00
Heng Li 8c89ba005e merged cnt-feat into paftools 2018-02-12 11:29:42 -05:00
Heng Li 50775a1e6f added liftOver
tested on a few toy examples
2018-02-12 11:12:23 -05:00
Heng Li 87cf650168 r697: fixed wrong #mapped reads in junceval 2018-02-09 18:45:57 -05:00
Heng Li 6e65c5e631 Revision 1 2018-02-09 17:39:02 -05:00
Heng Li a58b05a61b extend the section on genome alignment 2018-02-09 13:59:00 -05:00
Heng Li 42dab6319b don't call SNPs involving 'n' 2018-02-09 13:27:17 -05:00
Heng Li 8428809369 convert MUMmer's delta to PAF 2018-02-09 12:14:28 -05:00
Heng Li 642af5591e merged intron-eval into paftools 2018-02-09 11:07:14 -05:00
Heng Li 2025a6279a merged gff2bed and mapstat to paftools 2018-02-09 10:47:12 -05:00
Heng Li 3465b04724 merged a few converters to paftools 2018-02-09 10:23:30 -05:00
Heng Li 66c5e71fa8 merging scripts into one long script 2018-02-09 10:00:35 -05:00
Heng Li 01560f1db0 Revision v1, to be submitted 2018-02-07 11:07:08 -05:00
Heng Li 39535565ee first round of revision 2018-02-06 16:19:22 -05:00
Heng Li a8d476c6ad r686: end seed trimming don't go over long join 2018-02-06 11:31:32 -05:00
Heng Li 29b4a1786c r685: tune end seed filter again 2018-02-05 11:48:22 -05:00
Heng Li dbf284b2d9 r684: separate end score from min_chain_score 2018-02-05 11:40:38 -05:00
Heng Li 3df5015668 General doc improvements 2018-02-02 21:45:46 -05:00
Heng Li 756379bf83 Documented paf2diff.js (more to come later) 2018-02-02 14:43:58 -05:00
Heng Li 41fd8a966a Documented ov-eval.js 2018-02-02 14:18:18 -05:00
Heng Li 86e4933b1a Added TOC 2018-02-02 14:12:30 -05:00
Heng Li a633a744b6 more doc in misc 2018-02-02 14:07:17 -05:00
Heng Li ddc31f57ba Documented some k8 scripts; more coming 2018-02-02 13:57:08 -05:00
Heng Li 35d3e064bf r677: reduce the change of missing hits
that are close to end of alignments. It is still possible to create examples
that fail the heuristic.
2018-02-02 10:35:33 -05:00
Heng Li 997ab9bb2e Fixed the description of --dual 2018-02-01 15:11:51 -05:00
41 changed files with 3366 additions and 2270 deletions
+17 -12
View File
@@ -6,16 +6,16 @@ PROG= minimap2
PROG_EXTRA= sdust minimap2-lite
LIBS= -lm -lz -lpthread
ifeq ($(arm_neon),)
ifeq ($(sse2only),)
ifeq ($(arm_neon),) # if arm_neon is not defined
ifeq ($(sse2only),) # if sse2only is not defined
OBJS+=ksw2_extz2_sse41.o ksw2_extd2_sse41.o ksw2_exts2_sse41.o ksw2_extz2_sse2.o ksw2_extd2_sse2.o ksw2_exts2_sse2.o ksw2_dispatch.o
else
else # if sse2only is defined
OBJS+=ksw2_extz2_sse.o ksw2_extd2_sse.o ksw2_exts2_sse.o
endif
else
else # if arm_neon is defined
OBJS+=ksw2_extz2_neon.o ksw2_extd2_neon.o ksw2_exts2_neon.o
CFLAGS+=-D_FILE_OFFSET_BITS=64 -mfpu=neon -fsigned-char
INCLUDES+=-I sse2neon
INCLUDES+=-Isse2neon
endif
.PHONY:all extra clean depend
@@ -42,26 +42,31 @@ sdust:sdust.c getopt.o kalloc.o kalloc.h kdq.h kvec.h kseq.h sdust.h
# SSE-specific targets on x86/x86_64
ifeq ($(arm_neon),) # if arm_neon is defined, compile this target with the default setting (i.e. no -msse2)
ksw2_ll_sse.o:ksw2_ll_sse.c ksw2.h kalloc.h
$(CC) -c $(CFLAGS) -msse2 $(CPPFLAGS) $(INCLUDES) $< -o $@
endif
ksw2_extz2_sse41.o:ksw2_extz2_sse.c ksw2.h kalloc.h
$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
ksw2_extz2_sse2.o:ksw2_extz2_sse.c ksw2.h kalloc.h
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
$(CC) -c $(CFLAGS) -msse2 -mno-sse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
ksw2_extd2_sse41.o:ksw2_extd2_sse.c ksw2.h kalloc.h
$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
ksw2_extd2_sse2.o:ksw2_extd2_sse.c ksw2.h kalloc.h
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
$(CC) -c $(CFLAGS) -msse2 -mno-sse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
ksw2_exts2_sse41.o:ksw2_exts2_sse.c ksw2.h kalloc.h
$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
ksw2_exts2_sse2.o:ksw2_exts2_sse.c ksw2.h kalloc.h
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
$(CC) -c $(CFLAGS) -msse2 -mno-sse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
ksw2_dispatch.o:ksw2_dispatch.c ksw2.h
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
# NEON-specific targets on ARM
+70
View File
@@ -1,3 +1,73 @@
Release 2.10-r761 (27 March 2018)
---------------------------------
Changes to minimap2:
* Optionally output the MD tag for compatibility with existing tools (#63,
#118 and #137).
* Use SSE compiler flags more precisely to prevent compiling errors on certain
machines (#127).
* Added option --min-occ-floor to set a minimum occurrence threshold. Presets
intended for assembly-to-reference alignment set this option to 100. This
option alleviates issues with regions having high copy numbers (#107).
* Exit with non-zero code on file writing errors (e.g. disk full; #103 and
#132).
* Added option -y to copy FASTA/FASTQ comments in query sequences to the
output (#136).
* Added the asm20 preset for alignments between genomes at 5-10% sequence
divergence.
* Changed the band-width in the ava-ont preset from 500 to 2000. Oxford
Nanopore reads may contain long deletion sequencing errors that break
chaining.
Changes to mappy, the Python binding:
* Fixed a typo in Align.seq() (#126).
Changes to paftools.js, the companion script:
* Command sam2paf now converts the MD tag to cs.
* Support VCF output for assembly-to-reference variant calling (#109).
This version should produce identical alignment for read overlapping, RNA-seq
read mapping, and genomic read mapping. We have also added a cook book to show
the variety uses of minimap2 on real datasets. Please see cookbook.md in the
minimap2 source code directory.
(2.10: 27 March 2017, r761)
Release 2.9-r720 (23 February 2018)
-----------------------------------
This release fixed multiple minor bugs.
* Fixed two bugs that lead to incorrect inversion alignment. Also improved the
sensitivity to small inversions by using double Z-drop cutoff (#112).
* Fixed an issue that may cause the end of a query sequence unmapped (#104).
* Added a mappy API to retrieve sequences from the index (#126) and to reverse
complement DNA sequences. Fixed a bug where the `best_n` parameter did not
work (#117).
* Avoided segmentation fault given incorrect FASTQ input (#111).
* Combined all auxiliary javascripts to paftools.js. Fixed several bugs in
these scripts at the same time.
(2.9: 24 February 2018, r720)
Release 2.8-r672 (1 February 2018)
----------------------------------
+15 -25
View File
@@ -38,7 +38,7 @@ man ./minimap2.1
- [Advanced features](#advanced)
- [Working with >65535 CIGAR operations](#long-cigar)
- [The cs optional tag](#cs)
- [Evaluation scripts](#eval)
- [Working with the PAF format](#paftools)
- [Algorithm overview](#algo)
- [Getting help](#help)
- [Citing minimap2](#cite)
@@ -68,9 +68,8 @@ Detailed evaluations are available from the [minimap2 preprint][preprint].
Minimap2 is optimized for x86-64 CPUs. You can acquire precompiled binaries from
the [release page][release] with:
```sh
curl -L https://github.com/lh3/minimap2/releases/download/v2.8/minimap2-2.8_x64-linux.tar.bz2 \
| tar -jxvf -
./minimap2-2.8_x64-linux/minimap2
curl -L https://github.com/lh3/minimap2/releases/download/v2.10/minimap2-2.10_x64-linux.tar.bz2 | tar -jxvf -
./minimap2-2.10_x64-linux/minimap2
```
If you want to compile from the source, you need to have a C compiler, GNU make
and zlib development files installed. Then type `make` in the source code
@@ -137,7 +136,7 @@ Nanopore reads.
#### <a name="map-long-splice"></a>Map long mRNA/cDNA reads
```sh
minimap2 -ax splice -uf ref.fa iso-seq.fq > aln.sam # PacBio Iso-seq/traditional cDNA
minimap2 -ax splice -uf -C5 ref.fa iso-seq.fq > aln.sam # PacBio Iso-seq/traditional cDNA
minimap2 -ax splice ref.fa nanopore-cdna.fa > aln.sam # Nanopore 2D cDNA-seq
minimap2 -ax splice -uf -k14 ref.fa direct-rna.fq > aln.sam # Nanopore Direct RNA-seq
minimap2 -ax splice --splice-flank=no SIRV.fa SIRV-seq.fa # mapping against SIRV control
@@ -229,7 +228,7 @@ sorting) still work with such BAM records; tools that read CIGAR will
effectively ignore these records. It has been decided that future tools will
will seamlessly recognize long-cigar records generated by option `-L`.
**TD;DR**: if you work with ultra-long reads and use tools that only process
**TL;DR**: if you work with ultra-long reads and use tools that only process
BAM files, please add option `-L`.
#### <a name="cs"></a>The cs optional tag
@@ -256,26 +255,13 @@ the alignment. The above example will become
`=CGATCG-ata=AATAGAGTAG+gtc=GAAT*at=GCA`. The long form of `cs` encodes both
reference and query sequences in one string.
#### <a name="eval"></a>Evaluation scripts
#### <a name="paftools"></a>Working with the PAF format
Minimap2 comes with several (java)scripts for evaluating the accuracy of
minimap2. These scripts require the [k8][k8] javascript shell to run.
Recent minimap2 binary release tar-balls contain a copy of k8 executable, a
single file. Here are a few examples on how to use these scripts:
```sh
# Generate reads from PBSIM alignment (truth encoded in read names)
k8 misc/sim-pbsim.js ref.fa.fai pbsim-aln.maf > pbsim-reads.fq
# Generate reads from mason2 alignment (not tested for simulated SVs)
k8 misc/sim-mason2.js mason2-aln.sam > mason2-reads.fq
# Evaluate mapping accuracy with ROC-like curve
k8 misc/sim-eval.js my-aln.sam.gz > result.txt
k8 misc/sim-eval.js my-aln.paf.gz > result.txt
# Collect alignment statistics
k8 misc/mapstat.js my-aln.sam > result.txt
# Compare spliced junctions to existing gene annotations
k8 misc/intron-eval.js anno.gtf my-spliced-aln.sam > result.txt
```
Minimap2 also comes with a (java)script [paftools.js](misc/paftools.js) that
processes alignments in the PAF format. It calls variants from
assembly-to-reference alignment, lifts over BED files based on alignment,
converts between formats and provides utilities for various evaluations. For
details, please see [misc/README.md](misc/README.md).
### <a name="algo"></a>Algorithm overview
@@ -359,6 +345,10 @@ mappy` or [from BioConda][mappyconda] via `conda install -c bioconda mappy`.
possible to add non-SIMD support, but it would make minimap2 slower by
several times.
* Minimap2 does not work with a single query or database sequence ~2
billion bases or longer (2,147,483,647 to be exact). The total length of all
sequences can well exceed this threshold.
[paf]: https://github.com/lh3/miniasm/blob/master/PAF.md
+79 -38
View File
@@ -28,39 +28,63 @@ static inline void mm_seq_rev(uint32_t len, uint8_t *seq)
t = seq[i], seq[i] = seq[len - 1 - i], seq[len - 1 - i] = t;
}
static inline int test_zdrop_aux(int32_t score, int i, int j, int32_t *max, int *max_i, int *max_j, int e, int zdrop)
static inline void update_max_zdrop(int32_t score, int i, int j, int32_t *max, int *max_i, int *max_j, int e, int *max_zdrop, int pos[2][2])
{
if (score < *max) {
int li = i - *max_i;
int lj = j - *max_j;
int diff = li > lj? li - lj : lj - li;
if (*max - score > zdrop + diff * e)
return 1;
int z = *max - score - diff * e;
if (z > *max_zdrop) {
*max_zdrop = z;
pos[0][0] = *max_i, pos[0][1] = i + 1;
pos[1][0] = *max_j, pos[1][1] = j + 1;
}
} else *max = score, *max_i = i, *max_j = j;
return 0;
}
static int mm_check_zdrop(const uint8_t *qseq, const uint8_t *tseq, uint32_t n_cigar, uint32_t *cigar, const int8_t *mat, int8_t q, int8_t e, int zdrop)
static int mm_test_zdrop(void *km, const mm_mapopt_t *opt, const uint8_t *qseq, const uint8_t *tseq, uint32_t n_cigar, uint32_t *cigar, const int8_t *mat)
{
uint32_t k;
int32_t score = 0, max = 0, max_i = -1, max_j = -1, i = 0, j = 0;
for (k = 0; k < n_cigar; ++k) {
int32_t score = 0, max = INT32_MIN, max_i = -1, max_j = -1, i = 0, j = 0, max_zdrop = 0;
int pos[2][2] = {{-1, -1}, {-1, -1}}, q_len, t_len;
// find the score and the region where score drops most along diagonal
for (k = 0, score = 0; k < n_cigar; ++k) {
uint32_t l, op = cigar[k]&0xf, len = cigar[k]>>4;
if (op == 0) {
for (l = 0; l < len; ++l) {
score += mat[tseq[i + l] * 5 + qseq[j + l]];
if (test_zdrop_aux(score, i+l, j+l, &max, &max_i, &max_j, e, zdrop)) return 1;
update_max_zdrop(score, i+l, j+l, &max, &max_i, &max_j, opt->e, &max_zdrop, pos);
}
i += len, j += len;
} else if (op == 1) {
score -= q + e * len, j += len;
if (test_zdrop_aux(score, i, j, &max, &max_i, &max_j, e, zdrop)) return 1;
} else if (op == 2 || op == 3) {
score -= q + e * len, i += len;
if (test_zdrop_aux(score, i, j, &max, &max_i, &max_j, e, zdrop)) return 1;
} else if (op == 1 || op == 2 || op == 3) {
score -= opt->q + opt->e * len;
if (op == 1) j += len; // insertion
else i += len; // deletion
update_max_zdrop(score, i, j, &max, &max_i, &max_j, opt->e, &max_zdrop, pos);
}
}
return 0;
// test if there is an inversion in the most dropped region
q_len = pos[1][1] - pos[1][0], t_len = pos[0][1] - pos[0][0];
if (!(opt->flag&(MM_F_SPLICE|MM_F_SR|MM_F_FOR_ONLY|MM_F_REV_ONLY)) && max_zdrop > opt->zdrop_inv && q_len < opt->max_gap && t_len < opt->max_gap) {
uint8_t *qseq2;
void *qp;
int q_off, t_off;
qseq2 = (uint8_t*)kmalloc(km, q_len);
for (i = 0; i < q_len; ++i) {
int c = qseq[pos[1][1] - i - 1];
qseq2[i] = c >= 4? 4 : 3 - c;
}
qp = ksw_ll_qinit(km, 2, q_len, qseq2, 5, mat);
score = ksw_ll_i16(qp, t_len, tseq + pos[0][0], opt->q, opt->e, &q_off, &t_off);
kfree(km, qseq2);
kfree(km, qp);
if (score >= opt->min_chain_score * opt->a && score >= opt->min_dp_max)
return 2; // there is a potential inversion
}
return max_zdrop > opt->zdrop? 1 : 0;
}
static void mm_fix_cigar(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq, int *qshift, int *tshift)
@@ -193,9 +217,8 @@ static void mm_append_cigar(mm_reg1_t *r, uint32_t n_cigar, uint32_t *cigar) //
}
}
static void mm_align_pair(void *km, const mm_mapopt_t *opt, int qlen, const uint8_t *qseq, int tlen, const uint8_t *tseq, const int8_t *mat, int w, int end_bonus, int flag, ksw_extz_t *ez)
static void mm_align_pair(void *km, const mm_mapopt_t *opt, int qlen, const uint8_t *qseq, int tlen, const uint8_t *tseq, const int8_t *mat, int w, int end_bonus, int zdrop, int flag, ksw_extz_t *ez)
{
int zdrop = opt->zdrop;
if (mm_dbg_flag & MM_DBG_PRINT_ALN_SEQ) {
int i;
fprintf(stderr, "===> q=(%d,%d), e=(%d,%d), bw=%d, flag=%d, zdrop=%d <===\n", opt->q, opt->q2, opt->e, opt->e2, w, flag, opt->zdrop);
@@ -291,33 +314,39 @@ static void mm_filter_bad_seeds(void *km, int as1, int cnt1, mm128_t *a, int min
kfree(km, K);
}
static void mm_fix_bad_ends(const mm_reg1_t *r, const mm128_t *a, int bw, int32_t *as, int32_t *cnt)
static void mm_fix_bad_ends(const mm_reg1_t *r, const mm128_t *a, int bw, int min_match, int32_t *as, int32_t *cnt)
{
int32_t i, l;
int32_t i, l, m;
*as = r->as, *cnt = r->cnt;
if (r->cnt < 3) return;
l = a[r->as].y >> 32 & 0xff;
m = l = a[r->as].y >> 32 & 0xff;
for (i = r->as + 1; i < r->as + r->cnt - 1; ++i) {
int32_t lq, lr, min, max;
int32_t q_span = a[i].y >> 32 & 0xff;
if (a[i].y & MM_SEED_LONG_JOIN) break;
lr = (int32_t)a[i].x - (int32_t)a[i-1].x;
lq = (int32_t)a[i].y - (int32_t)a[i-1].y;
min = lr < lq? lr : lq;
max = lr > lq? lr : lq;
if (max - min > l >> 1) *as = i;
l += min;
if (l >= bw << 1) break;
m += min < q_span? min : q_span;
if (l >= bw << 1 || (m >= min_match && m >= bw) || m >= r->mlen >> 1) break;
}
*cnt = r->as + r->cnt - *as;
l = a[r->as + r->cnt - 1].y >> 32 & 0xff;
m = l = a[r->as + r->cnt - 1].y >> 32 & 0xff;
for (i = r->as + r->cnt - 2; i > *as; --i) {
int32_t lq, lr, min, max;
int32_t q_span = a[i+1].y >> 32 & 0xff;
if (a[i+1].y & MM_SEED_LONG_JOIN) break;
lr = (int32_t)a[i+1].x - (int32_t)a[i].x;
lq = (int32_t)a[i+1].y - (int32_t)a[i].y;
min = lr < lq? lr : lq;
max = lr > lq? lr : lq;
if (max - min > l >> 1) *cnt = i + 1 - *as;
l += min;
if (l >= bw) break;
m += min < q_span? min : q_span;
if (l >= bw << 1 || (m >= min_match && m >= bw) || m >= r->mlen >> 1) break;
}
}
@@ -418,7 +447,7 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
if (is_splice) {
mm_fix_bad_ends_splice(km, opt, mi, r, mat, qlen, qseq0, a, &as1, &cnt1);
} else {
mm_fix_bad_ends(r, a, opt->bw, &as1, &cnt1);
mm_fix_bad_ends(r, a, opt->bw, opt->min_chain_score * 2, &as1, &cnt1);
}
mm_filter_bad_seeds(km, as1, cnt1, a, 10, 40, opt->max_gap>>1, 10);
mm_adjust_minier(mi, qseq0, &a[as1], &rs, &qs);
@@ -516,7 +545,7 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
mm_idx_getseq(mi, rid, rs0, rs, tseq);
mm_seq_rev(qs - qs0, qseq);
mm_seq_rev(rs - rs0, tseq);
mm_align_pair(km, opt, qs - qs0, qseq, rs - rs0, tseq, mat, bw, opt->end_bonus, extra_flag|KSW_EZ_EXTZ_ONLY|KSW_EZ_RIGHT|KSW_EZ_REV_CIGAR, ez);
mm_align_pair(km, opt, qs - qs0, qseq, rs - rs0, tseq, mat, bw, opt->end_bonus, r->split_inv? opt->zdrop_inv : opt->zdrop, extra_flag|KSW_EZ_EXTZ_ONLY|KSW_EZ_RIGHT|KSW_EZ_REV_CIGAR, ez);
if (ez->n_cigar > 0) {
mm_append_cigar(r, ez->n_cigar, ez->cigar);
r->p->dp_score += ez->max;
@@ -536,9 +565,10 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
} else mm_adjust_minier(mi, qseq0, &a[as1 + i], &re, &qe);
re1 = re, qe1 = qe;
if (i == cnt1 - 1 || (a[as1+i].y&MM_SEED_LONG_JOIN) || (qe - qs >= opt->min_ksw_len && re - rs >= opt->min_ksw_len)) {
int j, bw1 = bw;
int j, bw1 = bw, zdrop_code;
if (a[as1+i].y & MM_SEED_LONG_JOIN)
bw1 = qe - qs > re - rs? qe - qs : re - rs;
// perform alignment
qseq = &qseq0[rev][qs];
mm_idx_getseq(mi, rid, rs, re, tseq);
if (is_sr) { // perform ungapped alignment
@@ -550,10 +580,12 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
}
ez->cigar = ksw_push_cigar(km, &ez->n_cigar, &ez->m_cigar, ez->cigar, 0, qe - qs);
} else { // perform normal gapped alignment
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, mat, bw1, -1, extra_flag|KSW_EZ_APPROX_MAX, ez); // first pass: with approximate Z-drop
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, mat, bw1, -1, opt->zdrop, extra_flag|KSW_EZ_APPROX_MAX, ez); // first pass: with approximate Z-drop
}
if (mm_check_zdrop(qseq, tseq, ez->n_cigar, ez->cigar, mat, opt->q, opt->e, opt->zdrop))
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, mat, bw1, -1, extra_flag, ez); // second pass: lift approximate
// test Z-drop and inversion Z-drop
if ((zdrop_code = mm_test_zdrop(km, opt, qseq, tseq, ez->n_cigar, ez->cigar, mat)) != 0)
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, mat, bw1, -1, zdrop_code == 2? opt->zdrop_inv : opt->zdrop, extra_flag, ez); // second pass: lift approximate
// update CIGAR
if (ez->n_cigar > 0)
mm_append_cigar(r, ez->n_cigar, ez->cigar);
if (ez->zdropped) { // truncated by Z-drop; TODO: sometimes Z-drop kicks in because the next seed placement is wrong. This can be fixed in principle.
@@ -565,8 +597,10 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
r->p->dp_score += ez->max;
re1 = rs + (ez->max_t + 1);
qe1 = qs + (ez->max_q + 1);
if (cnt1 - (j + 1) >= opt->min_cnt)
if (cnt1 - (j + 1) >= opt->min_cnt) {
mm_split_reg(r, r2, as1 + j + 1 - r->as, qlen, a);
if (zdrop_code == 2) r2->split_inv = 1;
}
break;
} else r->p->dp_score += ez->score;
rs = re, qs = qe;
@@ -576,7 +610,7 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
if (!dropped && qe < qe0 && re < re0) { // right extension
qseq = &qseq0[rev][qe];
mm_idx_getseq(mi, rid, re, re0, tseq);
mm_align_pair(km, opt, qe0 - qe, qseq, re0 - re, tseq, mat, bw, opt->end_bonus, extra_flag|KSW_EZ_EXTZ_ONLY, ez);
mm_align_pair(km, opt, qe0 - qe, qseq, re0 - re, tseq, mat, bw, opt->end_bonus, opt->zdrop, extra_flag|KSW_EZ_EXTZ_ONLY, ez);
if (ez->n_cigar > 0) {
mm_append_cigar(r, ez->n_cigar, ez->cigar);
r->p->dp_score += ez->max;
@@ -613,7 +647,7 @@ static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, i
if (r1->id != r1->parent && r1->parent != MM_PARENT_TMP_PRI) return 0;
if (r2->id != r2->parent && r2->parent != MM_PARENT_TMP_PRI) return 0;
if (r1->rid != r2->rid || r1->rev != r2->rev) return 0;
ql = r2->qs - r1->qe;
ql = r1->rev? r1->qs - r2->qe : r2->qs - r1->qe;
tl = r2->rs - r1->re;
if (ql < opt->min_chain_score || ql > opt->max_gap) return 0;
if (tl < opt->min_chain_score || tl > opt->max_gap) return 0;
@@ -621,7 +655,7 @@ static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, i
ksw_gen_simple_mat(5, mat, opt->a, opt->b);
tseq = (uint8_t*)kmalloc(km, tl);
mm_idx_getseq(mi, r1->rid, r1->re, r2->rs, tseq);
qseq = &qseq0[!r1->rev][qlen - r2->qs];
qseq = r1->rev? &qseq0[0][r2->qe] : &qseq0[1][qlen - r2->qs];
mm_seq_rev(ql, qseq);
mm_seq_rev(tl, tseq);
@@ -632,7 +666,7 @@ static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, i
mm_seq_rev(tl, tseq);
if (score < opt->min_dp_max) goto end_align1_inv;
q_off = ql - (q_off + 1), t_off = tl - (t_off + 1);
mm_align_pair(km, opt, ql - q_off, qseq + q_off, tl - t_off, tseq + t_off, mat, (int)(opt->bw * 1.5), -1, KSW_EZ_EXTZ_ONLY, ez);
mm_align_pair(km, opt, ql - q_off, qseq + q_off, tl - t_off, tseq + t_off, mat, (int)(opt->bw * 1.5), -1, opt->zdrop, KSW_EZ_EXTZ_ONLY, ez);
if (ez->n_cigar == 0) goto end_align1_inv; // should never be here
mm_append_cigar(r_inv, ez->n_cigar, ez->cigar);
r_inv->p->dp_score = ez->max;
@@ -642,8 +676,15 @@ static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, i
r_inv->rev = !r1->rev;
r_inv->rid = r1->rid;
r_inv->div = -1.0f;
r_inv->qs = r1->qe + q_off, r_inv->qe = r_inv->qs + ez->max_q + 1;
r_inv->rs = r1->re + t_off, r_inv->re = r_inv->rs + ez->max_t + 1;
if (r_inv->rev == 0) {
r_inv->qs = r2->qe + q_off;
r_inv->qe = r_inv->qs + ez->max_q + 1;
} else {
r_inv->qe = r2->qs - q_off;
r_inv->qs = r_inv->qe - (ez->max_q + 1);
}
r_inv->rs = r1->re + t_off;
r_inv->re = r_inv->rs + ez->max_t + 1;
mm_update_extra(r_inv, &qseq[q_off], &tseq[t_off], mat, opt->q, opt->e);
ret = 1;
end_align1_inv:
@@ -704,7 +745,7 @@ mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *m
regs[i].p->trans_strand = opt->flag&MM_F_SPLICE_FOR? 1 : 2;
}
if (r2.cnt > 0) regs = mm_insert_reg(&r2, i, &n_regs, regs);
if (!(opt->flag&(MM_F_SPLICE|MM_F_SR)) && !(opt->flag&(MM_F_FOR_ONLY|MM_F_REV_ONLY)) && i > 0) { // don't try inversion alignment for -xsplice or -xsr, or --for-only/rev-only
if (i > 0 && regs[i].split_inv) {
if (mm_align1_inv(km, opt, mi, qlen, qseq0, &regs[i-1], &regs[i], &r2, &ez)) {
regs = mm_insert_reg(&r2, i, &n_regs, regs);
++i; // skip the inserted INV alignment
@@ -714,7 +755,7 @@ mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *m
*n_regs_ = n_regs;
kfree(km, qseq0[0]);
kfree(km, ez.cigar);
mm_filter_regs(km, opt, n_regs_, regs);
mm_filter_regs(km, opt, qlen, n_regs_, regs);
mm_hit_sort_by_dp(km, n_regs_, regs);
return regs;
}
+28 -9
View File
@@ -54,19 +54,28 @@ void mm_bseq_close(mm_bseq_file_t *fp)
free(fp);
}
static inline void kseq2bseq(kseq_t *ks, mm_bseq1_t *s, int with_qual)
static inline char *kstrdup(const kstring_t *s)
{
char *t;
t = (char*)malloc(s->l + 1);
memcpy(t, s->s, s->l + 1);
return t;
}
static inline void kseq2bseq(kseq_t *ks, mm_bseq1_t *s, int with_qual, int with_comment)
{
int i;
s->name = strdup(ks->name.s);
s->seq = strdup(ks->seq.s);
s->name = kstrdup(&ks->name);
s->seq = kstrdup(&ks->seq);
for (i = 0; i < ks->seq.l; ++i) // convert U to T
if (s->seq[i] == 'u' || s->seq[i] == 'U')
--s->seq[i];
s->qual = with_qual && ks->qual.l? strdup(ks->qual.s) : 0;
s->qual = with_qual && ks->qual.l? kstrdup(&ks->qual) : 0;
s->comment = with_comment && ks->comment.l? kstrdup(&ks->comment) : 0;
s->l_seq = ks->seq.l;
}
mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int frag_mode, int *n_)
mm_bseq1_t *mm_bseq_read3(mm_bseq_file_t *fp, int chunk_size, int with_qual, int with_comment, int frag_mode, int *n_)
{
int64_t size = 0;
kvec_t(mm_bseq1_t) a = {0,0,0};
@@ -83,12 +92,12 @@ mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int
assert(ks->seq.l <= INT32_MAX);
if (a.m == 0) kv_resize(mm_bseq1_t, 0, a, 256);
kv_pushp(mm_bseq1_t, 0, a, &s);
kseq2bseq(ks, s, with_qual);
kseq2bseq(ks, s, with_qual, with_comment);
size += s->l_seq;
if (size >= chunk_size) {
if (frag_mode && a.a[a.n-1].l_seq < CHECK_PAIR_THRES) {
while (kseq_read(ks) >= 0) {
kseq2bseq(ks, &fp->s, with_qual);
kseq2bseq(ks, &fp->s, with_qual, with_comment);
if (mm_qname_same(fp->s.name, a.a[a.n-1].name)) {
kv_push(mm_bseq1_t, 0, a, fp->s);
memset(&fp->s, 0, sizeof(mm_bseq1_t));
@@ -102,12 +111,17 @@ mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int
return a.a;
}
mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int frag_mode, int *n_)
{
return mm_bseq_read3(fp, chunk_size, with_qual, 0, frag_mode, n_);
}
mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int chunk_size, int with_qual, int *n_)
{
return mm_bseq_read2(fp, chunk_size, with_qual, 0, n_);
}
mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int *n_)
mm_bseq1_t *mm_bseq_read_frag2(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int with_comment, int *n_)
{
int i;
int64_t size = 0;
@@ -128,7 +142,7 @@ mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int
for (i = 0; i < n_fp; ++i) {
mm_bseq1_t *s;
kv_pushp(mm_bseq1_t, 0, a, &s);
kseq2bseq(fp[i]->ks, s, with_qual);
kseq2bseq(fp[i]->ks, s, with_qual, with_comment);
size += s->l_seq;
}
if (size >= chunk_size) break;
@@ -137,6 +151,11 @@ mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int
return a.a;
}
mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int *n_)
{
return mm_bseq_read_frag2(n_fp, fp, chunk_size, with_qual, 0, n_);
}
int mm_bseq_eof(mm_bseq_file_t *fp)
{
return (ks_eof(fp->ks->f) && fp->s.seq == 0);
+3 -1
View File
@@ -13,13 +13,15 @@ typedef struct mm_bseq_file_s mm_bseq_file_t;
typedef struct {
int l_seq, rid;
char *name, *seq, *qual;
char *name, *seq, *qual, *comment;
} mm_bseq1_t;
mm_bseq_file_t *mm_bseq_open(const char *fn);
void mm_bseq_close(mm_bseq_file_t *fp);
mm_bseq1_t *mm_bseq_read3(mm_bseq_file_t *fp, int chunk_size, int with_qual, int with_comment, int frag_mode, int *n_);
mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int frag_mode, int *n_);
mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int chunk_size, int with_qual, int *n_);
mm_bseq1_t *mm_bseq_read_frag2(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int with_comment, int *n_);
mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int *n_);
int mm_bseq_eof(mm_bseq_file_t *fp);
+243
View File
@@ -0,0 +1,243 @@
## Table of Contents
- [Introduction & Installation](#intro)
- [Mapping Genomic Reads](#map-reads)
* [Mapping long reads](#map-pb)
* [Mapping Illumina paired-end reads](#map-sr)
* [Evaluating mapping accuracy with simulated reads (for developers)](#mapeval)
- [Mapping Long RNA-seq Reads](#map-rna)
* [Mapping Nanopore 2D cDNA reads](#map-ont-cdna-2d)
* [Mapping Nanopore direct-RNA reads](#map-direct-rna)
* [Mapping PacBio Iso-seq reads](#map-iso-seq)
- [Full-Genome Alignment](#genome-aln)
* [Intra-species assembly alignment](#asm-to-ref)
* [Cross-species full-genome alignment](#x-species)
* [Eyeballing alignment](#view-aln)
* [Calling variants from assembly-to-reference alignment](#asm-var)
* [Constructing self-homology map](#hom-map)
* [Lift Over (for developers)](#liftover)
- [Read Overlap](#read-overlap)
* [Long-read overlap](#long-read-overlap)
* [Evaluating overlap sensitivity (for developers)](#ov-eval)
## <a name="intro"></a>Introduction & Installation
This cookbook walks you through a variety of applications of minimap2 and its
companion script `paftools.js`. All data here are freely available from the
minimap2 release page at version tag [v2.10][v2.10]. Some examples only work
with v2.10 or later.
To acquire the data used in this cookbook and to install minimap2 and paftools,
please follow the command lines below:
```sh
# install minimap2 executables
curl -L https://github.com/lh3/minimap2/releases/download/v2.10/minimap2-2.10_x64-linux.tar.bz2 | tar jxf -
cp minimap2-2.10_x64-linux/{minimap2,k8,paftools.js} . # copy executables
export PATH="$PATH:"`pwd` # put the current directory on PATH
# download example datasets
curl -L https://github.com/lh3/minimap2/releases/download/v2.10/cookbook-data.tgz | tar zxf -
```
## <a name="map-reads"></a>Mapping Genomic Reads
### <a name="map-pb"></a>Mapping long reads
```sh
minimap2 -ax map-pb -t4 ecoli_ref.fa ecoli_p6_25x_canu.fa > mapped.sam
```
Alternatively, you can create a minimap2 index first and then map:
```sh
minimap2 -x map-pb -d ecoli-pb.mmi ecoli_ref.fa # create an index
minimap2 -ax map-pb ecoli-pb.mmi ecoli_p6_25x_canu.fa > mapped.sam
```
This will save you a couple of minutes when you map against the human genome.
**HOWEVER**, key algorithm parameters such as the k-mer length and window
size can't be changed after indexing. Minimap2 will give you a warning if
parameters used in a pre-built index doesn't match parameters on the command
line. **Please always make sure you are using an intended pre-built index.**
### <a name="map-sr"></a>Mapping Illumina paired-end reads:
```sh
minimap2 -ax sr -t4 ecoli_ref.fa ecoli_mason_1.fq ecoli_mason_2.fq > mapped-sr.sam
```
### <a name="mapeval"></a>Evaluating mapping accuracy with simulated reads (for developers)
```sh
minimap2 -ax sr ecoli_ref.fa ecoli_mason_1.fq ecoli_mason_2.fq | paftools.js mapeval -
```
The output is:
```
Q 60 19712 0 0.000000000 19712
Q 0 282 219 0.010953286 19994
U 6
```
where a `U`-line gives the number of unmapped reads (for SAM input only); a
`Q`-line gives:
1. Mapping quality (mapQ) threshold
2. Number of mapped reads between this threshold and the previous mapQ threshold.
3. Number of wrong mappings in the same mapQ interval
4. Accumulative mapping error rate
5. Accumulative number of mappings
For `paftools.js mapeval` to work, you need to encode the true read positions
in read names in the right format. For [PBSIM][pbsim] and [mason2][mason2], we
provide scripts to generate the right format. Simulated reads in this cookbook
were created with the following command lines:
```sh
# in PBSIM source code directory:
src/pbsim ../ecoli_ref.fa --depth 1 --sample-fastq sample/sample.fastq
paftools.js pbsim2fq ../ecoli_ref.fa.fai sd_0001.maf > ../ecoli_pbsim.fa
# mason2 simulation
mason_simulator --illumina-prob-mismatch-scale 2.5 -ir ecoli_ref.fa -n 10000 -o tmp-l.fq -or tmp-r.fq -oa tmp.sam
paftools.js mason2fq tmp.sam | seqtk seq -1 > ecoli_mason_1.fq
paftools.js mason2fq tmp.sam | seqtk seq -2 > ecoli_mason_2.fq
```
## <a name="map-rna"></a>Mapping Long RNA-seq Reads
### <a name="map-ont-cdna-2d"></a>Mapping Nanopore 2D cDNA reads
```sh
minimap2 -ax splice SIRV_E2.fa SIRV_ont-cdna.fa > aln.sam
```
You can compare the alignment to the true annotations with:
```sh
paftools.js junceval SIRV_E2C.gtf aln.sam
```
It gives the percentage of introns found in the annotation. For SIRV data, it
is possible to achieve higher junction accuracy with
```sh
minimap2 -ax splice --splice-flank=no SIRV_E2.fa SIRV_ont-cdna.fa | paftools.js junceval SIRV_E2C.gtf
```
This is because minimap2 models one additional evolutionarily conserved base
around a canonical junction, but SIRV doesn't honor this signal. Option
`--splice-flank=no` asks minimap2 no to model this additional base.
In the output a tag `ts:A:+` indicates that the read strand is the same as the
transcript strand; `ts:A:-` indicates the read strand is opposite to the
transcript strand. This tag is inferred from the GT-AG signal and is thus only
available to spliced reads.
### <a name="map-direct-rna"></a>Mapping Nanopore direct-RNA reads
```sh
minimap2 -ax splice -k14 -uf SIRV_E2.fa SIRV_ont-drna.fa > aln.sam
```
Direct-RNA reads are noisier, so we use a shorter k-mer for improved
sensitivity. Here, option `-uf` forces minimap2 to map reads to the forward
transcript strand only because direct-RNA reads are stranded. Again, applying
`--splice-flank=no` helps junction accuracy for SIRV data.
### <a name="map-iso-seq"></a>Mapping PacBio Iso-seq reads
```sh
minimap2 -ax splice -uf -C5 SIRV_E2.fa SIRV_iso-seq.fq > aln.sam
```
Option `-C5` reduces the penalty on non-canonical splicing sites. It helps
to align such sites correctly for data with low error rate such as Iso-seq
reads and traditional cDNAs. On this example, minimap2 makes one junction
error. Applying `--splice-flank=no` fixes this alignment error.
Note that the command line above is optimized for the final Iso-seq reads.
PacBio's Iso-seq pipeline produces intermediate sequences at varying quality.
For example, some intermediate reads are not stranded. For these reads, option
`-uf` will lead to more errors. Please revise the minimap2 command line
accordingly.
## <a name="genome-aln"></a>Full-Genome Alignment
### <a name="asm-to-ref"></a>Intra-species assembly alignment
```sh
# option "--cs" is recommended as paftools.js may need it
minimap2 -cx asm5 --cs ecoli_ref.fa ecoli_canu.fa > ecoli_canu.paf
```
Here `ecoli_canu.fa` is the Canu assembly of `ecoli_p6_25x_canu.fa`. This
command line outputs alignments in the [PAF format][paf]. Use `-a` instead of
`-c` to get output in the SAM format.
### <a name="x-species"></a>Cross-species full-genome alignment
```sh
minimap2 -cx asm20 --cs ecoli_ref.fa ecoli_O104:H4.fa > ecoli_O104:H4.paf
sort -k6,6 -k8,8n ecoli_O104:H4.paf | paftools.js call -f ecoli_ref.fa -L10000 -l1000 - > out.vcf
```
Minimap2 has three presets for full-genome alignment: "asm5" for sequence
divergence below 1%, "asm10" for divergence around a couple of percent and
"asm20" for divergence not more than 10%. In theory, with the right setting,
minimap2 should work for sequence pairs with sequence divergence up to ~15%,
but this has not been carefully evaluated.
### <a name="view-aln"></a>Eyeballing alignment
```sh
# option "--cs" required; minimap2-r741 or higher required for the "asm20" preset
minimap2 -cx asm20 --cs ecoli_ref.fa ecoli_O104:H4.fa | paftools.js view - | less -S
```
This prints the alignment in a BLAST-like format.
### <a name="asm-var"></a>Calling variants from assembly-to-reference alignment
```sh
# don't forget the "--cs" option; otherwise it doesn't work
minimap2 -cx asm5 --cs ecoli_ref.fa ecoli_canu.fa \
| sort -k6,6 -k8,8n \
| paftools.js call -f ecoli_ref.fa - > out.vcf
```
Without option `-f`, `paftools.js call` outputs in a custom format. In this
format, lines starting with `R` give the regions covered by one contig only.
This information is not available in the VCF output.
### <a name="hom-map"></a>Constructing self-homology map
```sh
minimap2 -DP -k19 -w19 -m200 ecoli_ref.fa ecoli_ref.fa > out.paf
```
Option `-D` asks minimap2 to ignore anchors from perfect self match and `-P`
outputs all chains. For large nomes, we don't recommend to perform base-level
alignment (with `-c`, `-a` or `--cs`) when `-P` is applied. This is because
base-alignment is slow and occasionally gives wrong alignments close to the
diagonal of a dotter plot. For E. coli, though, base-alignment is still fast.
### <a name="liftover"></a>Lift over (for developers)
```sh
minimap2 -cx asm5 --cs ecoli_ref.fa ecoli_canu.fa > ecoli_canu.paf
echo -e 'tig00000001\t200000\t300000' | paftools.js liftover ecoli_canu.paf -
```
This lifts over a region on query sequences to one or multiple regions on
reference sequences. Note that this paftools.js command may not be efficient
enough to lift millions of regions.
## <a name="read-overlap"></a>Read Overlap
### <a name="long-read-overlap"></a>Long read overlap
```sh
# For pacbio reads:
minimap2 -x ava-pb ecoli_p6_25x_canu.fa ecoli_p6_25x_canu.fa > overlap.paf
# For Nanopore reads (ava-ont also works with PacBio but not as good):
minimap2 -x ava-ont -r 10000 ecoli_p6_25x_canu.fa ecoli_p6_25x_canu.fa > overlap.paf
# If you have miniasm installed:
miniasm -f ecoli_p6_25x_canu.fa overlap.paf > asm.gfa
```
Here we explicitly applied `-r 10000`. We are considering to set this as the
default for the `ava-ont` mode as this seems to improve the contiguity for
nanopore read assembly (Loman, personal communication).
*Minimap2 doesn't work well with short-read overlap.*
### <a name="ov-eval"></a>Evaluating overlap sensitivity (for developers)
```sh
# read to reference mapping
minimap2 -cx map-pb ecoli_ref.fa ecoli_p6_25x_canu.fa > to-ref.paf
# evaluate overlap sensitivity
sort -k6,6 -k8,8n to-ref.paf | paftools.js ov-eval - overlap.paf
```
You can see that for PacBio reads, minimap2 achieves higher overlap sensitivity
with `-x ava-pb` (99% vs 93% with `-x ava-ont`).
[pbsim]: https://github.com/pfaucon/PBSIM-PacBio-Simulator
[mason2]: https://github.com/seqan/seqan/tree/master/apps/mason2
[paf]: https://github.com/lh3/miniasm/blob/master/PAF.md
[v2.10]: https://github.com/lh3/minimap2/releases/tag/v2.10
+69 -29
View File
@@ -118,7 +118,7 @@ void mm_write_sam_hdr(const mm_idx_t *idx, const char *rg, const char *ver, int
if (idx) {
uint32_t i;
for (i = 0; i < idx->n_seq; ++i)
printf("@SQ\tSN:%s\tLN:%d\n", idx->seq[i].name, idx->seq[i].len);
mm_sprintf_lite(&str, "@SQ\tSN:%s\tLN:%d\n", idx->seq[i].name, idx->seq[i].len);
}
if (rg) sam_write_rg_line(&str, rg);
mm_sprintf_lite(&str, "@PG\tID:minimap2\tPN:minimap2");
@@ -129,36 +129,18 @@ void mm_write_sam_hdr(const mm_idx_t *idx, const char *rg, const char *ver, int
for (i = 1; i < argc; ++i)
mm_sprintf_lite(&str, " %s", argv[i]);
}
mm_sprintf_lite(&str, "\n");
fputs(str.s, stdout);
mm_err_puts(str.s);
free(str.s);
}
static void write_cs(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int no_iden)
static void write_cs_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq, const mm_reg1_t *r, char *tmp, int no_iden)
{
extern unsigned char seq_nt4_table[256];
int i, q_off, t_off;
uint8_t *qseq, *tseq;
char *tmp;
if (r->p == 0) return;
mm_sprintf_lite(s, "\tcs:Z:");
qseq = (uint8_t*)kmalloc(km, r->qe - r->qs);
tseq = (uint8_t*)kmalloc(km, r->re - r->rs);
tmp = (char*)kmalloc(km, r->re - r->rs > r->qe - r->qs? r->re - r->rs + 1 : r->qe - r->qs + 1);
mm_idx_getseq(mi, r->rid, r->rs, r->re, tseq);
if (!r->rev) {
for (i = r->qs; i < r->qe; ++i)
qseq[i - r->qs] = seq_nt4_table[(uint8_t)t->seq[i]];
} else {
for (i = r->qs; i < r->qe; ++i) {
uint8_t c = seq_nt4_table[(uint8_t)t->seq[i]];
qseq[r->qe - i - 1] = c >= 4? 4 : 3 - c;
}
}
for (i = q_off = t_off = 0; i < r->p->n_cigar; ++i) {
int j, op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
assert(op >= 0 && op <= 3);
if (op == 0) {
if (op == 0) { // match
int l_tmp = 0;
for (j = 0; j < len; ++j) {
if (qseq[q_off + j] != tseq[t_off + j]) {
@@ -179,17 +161,17 @@ static void write_cs(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_
} else mm_sprintf_lite(s, ":%d", l_tmp);
}
q_off += len, t_off += len;
} else if (op == 1) {
} else if (op == 1) { // insertion to ref
for (j = 0, tmp[len] = 0; j < len; ++j)
tmp[j] = "acgtn"[qseq[q_off + j]];
mm_sprintf_lite(s, "+%s", tmp);
q_off += len;
} else if (op == 2) {
} else if (op == 2) { // deletion from ref
for (j = 0, tmp[len] = 0; j < len; ++j)
tmp[j] = "acgtn"[tseq[t_off + j]];
mm_sprintf_lite(s, "-%s", tmp);
t_off += len;
} else {
} else { // intron
assert(len >= 2);
mm_sprintf_lite(s, "~%c%c%d%c%c", "acgtn"[tseq[t_off]], "acgtn"[tseq[t_off+1]],
len, "acgtn"[tseq[t_off+len-2]], "acgtn"[tseq[t_off+len-1]]);
@@ -197,6 +179,59 @@ static void write_cs(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_
}
}
assert(t_off == r->re - r->rs && q_off == r->qe - r->qs);
}
static void write_MD_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq, const mm_reg1_t *r, char *tmp)
{
int i, q_off, t_off, l_MD = 0;
mm_sprintf_lite(s, "\tMD:Z:");
for (i = q_off = t_off = 0; i < r->p->n_cigar; ++i) {
int j, op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
assert(op >= 0 && op <= 2); // introns (aka reference skips) are not supported
if (op == 0) { // match
for (j = 0; j < len; ++j) {
if (qseq[q_off + j] != tseq[t_off + j]) {
mm_sprintf_lite(s, "%d%c", l_MD, "ACGTN"[tseq[t_off + j]]);
l_MD = 0;
} else ++l_MD;
}
q_off += len, t_off += len;
} else if (op == 1) { // insertion to ref
q_off += len;
} else if (op == 2) { // deletion from ref
for (j = 0, tmp[len] = 0; j < len; ++j)
tmp[j] = "ACGTN"[tseq[t_off + j]];
mm_sprintf_lite(s, "%d^%s", l_MD, tmp);
l_MD = 0;
t_off += len;
}
}
if (l_MD > 0) mm_sprintf_lite(s, "%d", l_MD);
assert(t_off == r->re - r->rs && q_off == r->qe - r->qs);
}
static void write_cs_or_MD(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int no_iden, int is_MD)
{
extern unsigned char seq_nt4_table[256];
int i;
uint8_t *qseq, *tseq;
char *tmp;
if (r->p == 0) return;
qseq = (uint8_t*)kmalloc(km, r->qe - r->qs);
tseq = (uint8_t*)kmalloc(km, r->re - r->rs);
tmp = (char*)kmalloc(km, r->re - r->rs > r->qe - r->qs? r->re - r->rs + 1 : r->qe - r->qs + 1);
mm_idx_getseq(mi, r->rid, r->rs, r->re, tseq);
if (!r->rev) {
for (i = r->qs; i < r->qe; ++i)
qseq[i - r->qs] = seq_nt4_table[(uint8_t)t->seq[i]];
} else {
for (i = r->qs; i < r->qe; ++i) {
uint8_t c = seq_nt4_table[(uint8_t)t->seq[i]];
qseq[r->qe - i - 1] = c >= 4? 4 : 3 - c;
}
}
if (is_MD) write_MD_core(s, tseq, qseq, r, tmp);
else write_cs_core(s, tseq, qseq, r, tmp, no_iden);
kfree(km, qseq); kfree(km, tseq); kfree(km, tmp);
}
@@ -237,8 +272,10 @@ void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const m
for (k = 0; k < r->p->n_cigar; ++k)
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDN"[r->p->cigar[k]&0xf]);
}
if (r->p && (opt_flag & MM_F_OUT_CS))
write_cs(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG));
if (r->p && (opt_flag & (MM_F_OUT_CS|MM_F_OUT_MD)))
write_cs_or_MD(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG), opt_flag&MM_F_OUT_MD);
if ((opt_flag & MM_F_COPY_COMMENT) && t->comment)
mm_sprintf_lite(s, "\t%s", t->comment);
}
static void sam_write_sq(kstring_t *s, char *seq, int l, int rev, int comp)
@@ -434,12 +471,15 @@ void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
}
}
}
if (r->p && (opt_flag & MM_F_OUT_CS))
write_cs(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG));
if (r->p && (opt_flag & (MM_F_OUT_CS|MM_F_OUT_MD)))
write_cs_or_MD(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG), opt_flag&MM_F_OUT_MD);
if (cigar_in_tag)
write_sam_cigar(s, flag, 1, t->l_seq, r, opt_flag);
}
if ((opt_flag & MM_F_COPY_COMMENT) && t->comment)
mm_sprintf_lite(s, "\t%s", t->comment);
s->s[s->l] = 0; // we always have room for an extra byte (see str_enlarge)
}
+33 -4
View File
@@ -94,6 +94,7 @@ void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a)
r2->id = -1;
r2->sam_pri = 0;
r2->p = 0;
r2->split_inv = 0;
r2->cnt = r->cnt - n;
r2->score = (int32_t)(r->score * ((float)r2->cnt / r->cnt) + .499);
r2->as = r->as + n;
@@ -245,16 +246,17 @@ void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int *n_,
}
}
void mm_filter_regs(void *km, const mm_mapopt_t *opt, int *n_regs, mm_reg1_t *regs)
void mm_filter_regs(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs)
{ // NB: after this call, mm_reg1_t::parent can be -1 if its parent filtered out
int i, k;
for (i = k = 0; i < *n_regs; ++i) {
mm_reg1_t *r = &regs[i];
int flt = 0;
if (!r->inv && !r->seg_split && r->cnt < opt->min_cnt) flt = 1;
if (r->p) {
if (r->p) { // these filters are only applied when base-alignment is available
if (r->mlen < opt->min_chain_score) flt = 1;
else if (r->p->dp_max < opt->min_dp_max) flt = 1;
else if (r->qs > qlen * opt->max_clip_ratio && qlen - r->qe > qlen * opt->max_clip_ratio) flt = 1;
if (flt) free(r->p);
}
if (!flt) {
@@ -337,7 +339,7 @@ void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs_, mm_r
r->parent = regs[r->parent].parent;
}
}
mm_filter_regs(km, opt, n_regs_, regs);
mm_filter_regs(km, opt, qlen, n_regs_, regs);
mm_sync_regs(km, *n_regs_, regs);
}
}
@@ -406,7 +408,33 @@ void mm_seg_free(void *km, int n_segs, mm_seg_t *segs)
kfree(km, segs);
}
void mm_set_mapq(int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr)
static void mm_set_inv_mapq(void *km, int n_regs, mm_reg1_t *regs)
{
int i, n_aux;
uint64_t *aux;
if (n_regs < 3) return;
for (i = 0; i < n_regs; ++i)
if (regs[i].inv) break;
if (i == n_regs) return; // no inversion hits
aux = (uint64_t*)kmalloc(km, n_regs * 8);
for (i = n_aux = 0; i < n_regs; ++i)
if (regs[i].parent == i || regs[i].parent < 0)
aux[n_aux++] = (uint64_t)regs[i].as << 32 | i;
radix_sort_64(aux, aux + n_aux);
for (i = 1; i < n_aux - 1; ++i) {
mm_reg1_t *inv = &regs[(int32_t)aux[i]];
if (inv->inv) {
mm_reg1_t *l = &regs[(int32_t)aux[i-1]];
mm_reg1_t *r = &regs[(int32_t)aux[i+1]];
inv->mapq = l->mapq < r->mapq? l->mapq : r->mapq;
}
}
kfree(km, aux);
}
void mm_set_mapq(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr)
{
static const float q_coef = 40.0f;
int64_t sum_sc = 0;
@@ -449,4 +477,5 @@ void mm_set_mapq(int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, in
if (r->p && r->p->dp_max > r->p->dp_max2 && r->mapq == 0) r->mapq = 1;
} else r->mapq = 0;
}
mm_set_inv_mapq(km, n_regs, regs);
}
+31 -9
View File
@@ -20,6 +20,8 @@
KHASH_INIT(idx, uint64_t, uint64_t, 1, idx_hash, idx_eq)
typedef khash_t(idx) idxhash_t;
KHASH_MAP_INIT_STR(str, uint32_t)
#define kroundup64(x) (--(x), (x)|=(x)>>1, (x)|=(x)>>2, (x)|=(x)>>4, (x)|=(x)>>8, (x)|=(x)>>16, (x)|=(x)>>32, ++(x))
typedef struct mm_idx_bucket_s {
@@ -29,15 +31,6 @@ typedef struct mm_idx_bucket_s {
void *h; // hash table indexing _p_ and minimizers appearing once
} mm_idx_bucket_t;
void mm_idxopt_init(mm_idxopt_t *opt)
{
memset(opt, 0, sizeof(mm_idxopt_t));
opt->k = 15, opt->w = 10, opt->flag = 0;
opt->bucket_bits = 14;
opt->mini_batch_size = 50000000;
opt->batch_size = 4000000000ULL;
}
mm_idx_t *mm_idx_init(int w, int k, int b, int flag)
{
mm_idx_t *mi;
@@ -54,6 +47,7 @@ void mm_idx_destroy(mm_idx_t *mi)
{
int i;
if (mi == 0) return;
if (mi->h) kh_destroy(str, (khash_t(str)*)mi->h);
for (i = 0; i < 1<<mi->b; ++i) {
free(mi->B[i].p);
free(mi->B[i].a.a);
@@ -109,6 +103,34 @@ void mm_idx_stat(const mm_idx_t *mi)
__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), n, 100.0*n1/n, (double)sum / n, (double)len / sum);
}
int mm_idx_index_name(mm_idx_t *mi)
{
khash_t(str) *h;
uint32_t i;
int has_dup = 0, absent;
if (mi->h) return 0;
h = kh_init(str);
for (i = 0; i < mi->n_seq; ++i) {
khint_t k;
k = kh_put(str, h, mi->seq[i].name, &absent);
if (absent) kh_val(h, k) = i;
else has_dup = 1;
}
mi->h = h;
if (has_dup && mm_verbose >= 2)
fprintf(stderr, "[WARNING] some database sequences have identical sequence names\n");
return has_dup;
}
int mm_idx_name2id(const mm_idx_t *mi, const char *name)
{
khash_t(str) *h = (khash_t(str)*)mi->h;
khint_t k;
if (h == 0) return -2;
k = kh_get(str, h, name);
return k == kh_end(h)? -1 : kh_val(h, k);
}
int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq)
{
uint64_t i, st1, en1;
+32 -11
View File
@@ -4,9 +4,13 @@
#include "bseq.h"
#include "minimap.h"
#include "mmpriv.h"
#ifdef HAVE_GETOPT
#include <getopt.h>
#else
#include "getopt.h"
#endif
#define MM_VERSION "2.8-r672"
#define MM_VERSION "2.10-r761"
#ifdef __linux__
#include <sys/resource.h>
@@ -50,6 +54,9 @@ static struct option long_options[] = {
{ "heap-sort", required_argument, 0, 0 }, // 24
{ "all-chain", no_argument, 0, 'P' },
{ "dual", required_argument, 0, 0 }, // 26
{ "max-clip-ratio", required_argument, 0, 0 }, // 27
{ "min-occ-floor", required_argument, 0, 0 }, // 28
{ "MD", no_argument, 0, 0 }, // 29
{ "help", no_argument, 0, 'h' },
{ "max-intron-len", required_argument, 0, 'G' },
{ "version", no_argument, 0, 'V' },
@@ -87,7 +94,7 @@ static inline void yes_or_no(mm_mapopt_t *opt, int flag, int long_idx, const cha
int main(int argc, char *argv[])
{
const char *opt_str = "2aSDw:k:K:t:r:f:Vv:g:G:I:d:XT:s:x:Hcp:M:n:z:A:B:O:E:m:N:Qu:R:hF:LC:";
const char *opt_str = "2aSDw:k:K:t:r:f:Vv:g:G:I:d:XT:s:x:Hcp:M:n:z:A:B:O:E:m:N:Qu:R:hF:LC:y";
mm_mapopt_t opt;
mm_idxopt_t ipt;
int i, c, n_threads = 3, long_idx;
@@ -109,7 +116,7 @@ int main(int argc, char *argv[])
}
break;
}
optreset = 1;
optind = 0; // for musl getopt, optind=0 has the same effect as optreset=1; older libc doesn't have optreset
while ((c = getopt_long(argc, argv, opt_str, long_options, &long_idx)) >= 0) {
if (c == 'w') ipt.w = atoi(optarg);
@@ -133,12 +140,12 @@ int main(int argc, char *argv[])
else if (c == 'Q') opt.flag |= MM_F_NO_QUAL;
else if (c == 'Y') opt.flag |= MM_F_SOFTCLIP;
else if (c == 'L') opt.flag |= MM_F_LONG_CIGAR;
else if (c == 'y') opt.flag |= MM_F_COPY_COMMENT;
else if (c == 'T') opt.sdust_thres = atoi(optarg);
else if (c == 'n') opt.min_cnt = atoi(optarg);
else if (c == 'm') opt.min_chain_score = atoi(optarg);
else if (c == 'A') opt.a = atoi(optarg);
else if (c == 'B') opt.b = atoi(optarg);
else if (c == 'z') opt.zdrop = atoi(optarg);
else if (c == 's') opt.min_dp_max = atoi(optarg);
else if (c == 'C') opt.noncan = atoi(optarg);
else if (c == 'I') ipt.batch_size = mm_parse_num(optarg);
@@ -163,6 +170,9 @@ int main(int argc, char *argv[])
else if (c == 0 && long_idx ==21) opt.anchor_ext_shift = atoi(optarg); // --end-seed-pen
else if (c == 0 && long_idx ==22) opt.flag |= MM_F_FOR_ONLY; // --for-only
else if (c == 0 && long_idx ==23) opt.flag |= MM_F_REV_ONLY; // --rev-only
else if (c == 0 && long_idx ==27) opt.max_clip_ratio = atof(optarg); // --max-clip-ratio
else if (c == 0 && long_idx ==28) opt.min_mid_occ = atoi(optarg); // --min-occ-floor
else if (c == 0 && long_idx ==29) opt.flag |= MM_F_OUT_MD; // --MD
else if (c == 0 && long_idx == 14) { // --frag
yes_or_no(&opt, MM_F_FRAG_MODE, long_idx, optarg, 1);
} else if (c == 0 && long_idx == 15) { // --secondary
@@ -207,6 +217,9 @@ int main(int argc, char *argv[])
fprintf(stderr, "[ERROR]\033[1;31m unrecognized cDNA direction\033[0m\n");
return 1;
}
} else if (c == 'z') {
opt.zdrop = opt.zdrop_inv = strtol(optarg, &s, 10);
if (*s == ',') opt.zdrop_inv = strtol(s + 1, &s, 10);
} else if (c == 'O') {
opt.q = opt.q2 = strtol(optarg, &s, 10);
if (*s == ',') opt.q2 = strtol(s + 1, &s, 10);
@@ -250,7 +263,7 @@ int main(int argc, char *argv[])
fprintf(fp_help, " -B INT mismatch penalty [%d]\n", opt.b);
fprintf(fp_help, " -O INT[,INT] gap open penalty [%d,%d]\n", opt.q, opt.q2);
fprintf(fp_help, " -E INT[,INT] gap extension penalty; a k-long gap costs min{O1+k*E1,O2+k*E2} [%d,%d]\n", opt.e, opt.e2);
fprintf(fp_help, " -z INT Z-drop score [%d]\n", opt.zdrop);
fprintf(fp_help, " -z INT[,INT] Z-drop score and inversion Z-drop score [%d,%d]\n", opt.zdrop, opt.zdrop_inv);
fprintf(fp_help, " -s INT minimal peak DP alignment score [%d]\n", opt.min_dp_max);
fprintf(fp_help, " -u CHAR how to find GT-AG. f:transcript strand, b:both strands, n:don't match GT-AG [n]\n");
fprintf(fp_help, " Input/Output:\n");
@@ -260,6 +273,7 @@ int main(int argc, char *argv[])
fprintf(fp_help, " -R STR SAM read group line in a format like '@RG\\tID:foo\\tSM:bar' []\n");
fprintf(fp_help, " -c output CIGAR in PAF\n");
fprintf(fp_help, " --cs[=STR] output the cs tag; STR is 'short' (if absent) or 'long' [none]\n");
fprintf(fp_help, " --MD output the MD tag\n");
fprintf(fp_help, " -Y use soft clipping for supplementary alignments\n");
fprintf(fp_help, " -t INT number of threads [%d]\n", n_threads);
fprintf(fp_help, " -K NUM minibatch size for mapping [500M]\n");
@@ -272,7 +286,7 @@ int main(int argc, char *argv[])
fprintf(fp_help, " asm5: -k19 -w19 -A1 -B19 -O39,81 -E3,1 -s200 -z200 (asm to ref mapping; break at 5%% div.)\n");
fprintf(fp_help, " asm10: -k19 -w19 -A1 -B9 -O16,41 -E2,1 -s200 -z200 (asm to ref mapping; break at 10%% div.)\n");
fprintf(fp_help, " ava-pb: -Hk19 -Xw5 -m100 -g10000 --max-chain-skip 25 (PacBio read overlap)\n");
fprintf(fp_help, " ava-ont: -k15 -Xw5 -m100 -g10000 --max-chain-skip 25 (ONT read overlap)\n");
fprintf(fp_help, " ava-ont: -k15 -Xw5 -m100 -g10000 -r2000 --max-chain-skip 25 (ONT read overlap)\n");
fprintf(fp_help, " splice: long-read spliced alignment (see minimap2.1 for details)\n");
fprintf(fp_help, " sr: short single-end reads without splicing (see minimap2.1 for details)\n");
fprintf(fp_help, "\nSee `man ./minimap2.1' for detailed description of command-line options.\n");
@@ -326,10 +340,17 @@ int main(int argc, char *argv[])
}
mm_idx_reader_close(idx_rdr);
fprintf(stderr, "[M::%s] Version: %s\n", __func__, MM_VERSION);
fprintf(stderr, "[M::%s] CMD:", __func__);
for (i = 0; i < argc; ++i)
fprintf(stderr, " %s", argv[i]);
fprintf(stderr, "\n[M::%s] Real time: %.3f sec; CPU: %.3f sec\n", __func__, realtime() - mm_realtime0, cputime());
if (fflush(stdout) == EOF) {
fprintf(stderr, "[ERROR] failed to write the results\n");
exit(EXIT_FAILURE);
}
if (mm_verbose >= 3) {
fprintf(stderr, "[M::%s] Version: %s\n", __func__, MM_VERSION);
fprintf(stderr, "[M::%s] CMD:", __func__);
for (i = 0; i < argc; ++i)
fprintf(stderr, " %s", argv[i]);
fprintf(stderr, "\n[M::%s] Real time: %.3f sec; CPU: %.3f sec\n", __func__, realtime() - mm_realtime0, cputime());
}
return 0;
}
+8 -7
View File
@@ -340,7 +340,7 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
if (n_segs == 1) { // uni-segment
regs0 = align_regs(opt, mi, b->km, qlens[0], seqs[0], &n_regs0, regs0, a);
mm_set_mapq(n_regs0, regs0, opt->min_chain_score, opt->a, rep_len, is_sr);
mm_set_mapq(b->km, n_regs0, regs0, opt->min_chain_score, opt->a, rep_len, is_sr);
n_regs[0] = n_regs0, regs[0] = regs0;
} else { // multi-segment
mm_seg_t *seg;
@@ -349,7 +349,7 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
for (i = 0; i < n_segs; ++i) {
mm_set_parent(b->km, opt->mask_level, n_regs[i], regs[i], opt->a * 2 + opt->b); // update mm_reg1_t::parent
regs[i] = align_regs(opt, mi, b->km, qlens[i], seqs[i], &n_regs[i], regs[i], seg[i].a);
mm_set_mapq(n_regs[i], regs[i], opt->min_chain_score, opt->a, rep_len, is_sr);
mm_set_mapq(b->km, n_regs[i], regs[i], opt->min_chain_score, opt->a, rep_len, is_sr);
}
mm_seg_free(b->km, n_segs, seg);
if (n_segs == 2 && opt->pe_ori >= 0 && (opt->flag&MM_F_CIGAR))
@@ -442,11 +442,12 @@ static void *worker_pipeline(void *shared, int step, void *in)
pipeline_t *p = (pipeline_t*)shared;
if (step == 0) { // step 0: read sequences
int with_qual = (!!(p->opt->flag & MM_F_OUT_SAM) && !(p->opt->flag & MM_F_NO_QUAL));
int with_comment = !!(p->opt->flag & MM_F_COPY_COMMENT);
int frag_mode = (p->n_fp > 1 || !!(p->opt->flag & MM_F_FRAG_MODE));
step_t *s;
s = (step_t*)calloc(1, sizeof(step_t));
if (p->n_fp > 1) s->seq = mm_bseq_read_frag(p->n_fp, p->fp, p->mini_batch_size, with_qual, &s->n_seq);
else s->seq = mm_bseq_read2(p->fp[0], p->mini_batch_size, with_qual, frag_mode, &s->n_seq);
if (p->n_fp > 1) s->seq = mm_bseq_read_frag2(p->n_fp, p->fp, p->mini_batch_size, with_qual, with_comment, &s->n_seq);
else s->seq = mm_bseq_read3(p->fp[0], p->mini_batch_size, with_qual, with_comment, frag_mode, &s->n_seq);
if (s->seq) {
s->p = p;
for (i = 0; i < s->n_seq; ++i)
@@ -489,11 +490,11 @@ static void *worker_pipeline(void *shared, int step, void *in)
mm_write_sam2(&p->str, mi, t, i - seg_st, j, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag);
else
mm_write_paf(&p->str, mi, t, r, km, p->opt->flag);
puts(p->str.s);
mm_err_puts(p->str.s);
}
if (s->n_reg[i] == 0 && (p->opt->flag & MM_F_OUT_SAM)) {
if (s->n_reg[i] == 0 && (p->opt->flag & MM_F_OUT_SAM)) { // write an unmapped record
mm_write_sam2(&p->str, mi, t, i - seg_st, -1, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag);
puts(p->str.s);
mm_err_puts(p->str.s);
}
}
for (i = seg_st; i < seg_en; ++i) {
+12 -3
View File
@@ -29,6 +29,8 @@
#define MM_F_REV_ONLY 0x200000
#define MM_F_HEAP_SORT 0x400000
#define MM_F_ALL_CHAINS 0x800000
#define MM_F_OUT_MD 0x1000000
#define MM_F_COPY_COMMENT 0x2000000
#define MM_I_HPC 0x1
#define MM_I_NO_SEQ 0x2
@@ -59,7 +61,7 @@ typedef struct {
mm_idx_seq_t *seq; // sequence name, length and offset
uint32_t *S; // 4-bit packed sequence
struct mm_idx_bucket_s *B; // index (hidden)
void *km;
void *km, *h;
} mm_idx_t;
// minimap2 alignment
@@ -82,7 +84,7 @@ typedef struct {
int32_t mlen, blen; // seeded exact match length; seeded alignment block length
int32_t n_sub; // number of suboptimal mappings
int32_t score0; // initial chaining score (before chain merging/spliting)
uint32_t mapq:8, split:2, rev:1, inv:1, sam_pri:1, proper_frag:1, pe_thru:1, seg_split:1, seg_id:8, dummy:8;
uint32_t mapq:8, split:2, rev:1, inv:1, sam_pri:1, proper_frag:1, pe_thru:1, seg_split:1, seg_id:8, split_inv:1, dummy:7;
uint32_t hash;
float div;
mm_extra_t *p;
@@ -116,15 +118,17 @@ typedef struct {
int a, b, q, e, q2, e2; // matching score, mismatch, gap-open and gap-ext penalties
int noncan; // cost of non-canonical splicing sites
int zdrop; // break alignment if alignment score drops too fast along the diagonal
int zdrop, zdrop_inv; // break alignment if alignment score drops too fast along the diagonal
int end_bonus;
int min_dp_max; // drop an alignment if the score of the max scoring segment is below this threshold
int min_ksw_len;
int anchor_ext_len, anchor_ext_shift;
float max_clip_ratio; // drop an alignment if BOTH ends are clipped above this ratio
int pe_ori, pe_bonus;
float mid_occ_frac; // only used by mm_mapopt_update(); see below
int32_t min_mid_occ;
int32_t mid_occ; // ignore seeds with occurrences above this threshold
int32_t max_occ;
int mini_batch_size; // size of a batch of query bases to process in parallel
@@ -296,6 +300,11 @@ int mm_map_file(const mm_idx_t *idx, const char *fn, const mm_mapopt_t *opt, int
int mm_map_file_frag(const mm_idx_t *idx, int n_segs, const char **fn, const mm_mapopt_t *opt, int n_threads);
// query sequence name and sequence in the minimap2 index
int mm_idx_index_name(mm_idx_t *mi);
int mm_idx_name2id(const mm_idx_t *mi, const char *name);
int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq);
// deprecated APIs for backward compatibility
void mm_mapopt_init(mm_mapopt_t *opt);
mm_idx_t *mm_idx_build(const char *fn, int w, int k, int flag, int n_threads);
+60 -16
View File
@@ -1,4 +1,4 @@
.TH minimap2 1 "1 February 2018" "minimap2-2.8 (r672)" "Bioinformatics tools"
.TH minimap2 1 "27 March 2018" "minimap2-2.10 (r761)" "Bioinformatics tools"
.SH NAME
.PP
minimap2 - mapping and alignment between collections of DNA sequences
@@ -123,10 +123,27 @@ provided as the target sequences, options
will be effectively overridden by the options stored in the index file.
.SS Mapping options
.TP 10
.BI -f \ FLOAT
Ignore top
.BI -f \ FLOAT | INT1 [, INT2 ]
If fraction, ignore top
.I FLOAT
fraction of most frequent minimizers [0.0002]
fraction of most frequent minimizers [0.0002]. If integer,
ignore minimizers occuring more than
.I INT1
times.
.I INT2
is only effective in the
.B --sr
or
.B -xsr
mode, which sets the threshold for a second round of seeding.
.TP
.BI --min-occ-floor \ INT
Force minimap2 to always use k-mers occurring
.I INT
times or less [0]. In effect, the max occurrence threshold is set to
the
.RI max{ INT ,
.BR -f }.
.TP
.BI -g \ INT
Stop chain enlongation if there are no minimizers within
@@ -161,8 +178,10 @@ and
have no effect when this option is in use.
.TP
.BR --dual = yes | no
During chaining, whether to skip pairs wherein the query name is
lexicographically greater than the target name [yes]
If
.BR no ,
skip query-target pairs wherein the query name is lexicographically greater
than the target name [yes]
.TP
.B -X
Equivalent to
@@ -269,11 +288,22 @@ Cost for a non-canonical GT-AG splicing (effective with
.BR --splice )
[0]
.TP
.BI -z \ INT
Break an alignment if the running score drops too quickly along the diagonal of
the DP matrix (diagonal X-drop, or Z-drop) [400]. Increasing the value improves
the contiguity of the alignment at the cost of poor alignment in the middle
(e.g. caused by a long inversion).
.BI -z \ INT1[,INT2]
Truncate an alignment if the running alignment score drops too quickly along
the diagonal of the DP matrix (diagonal X-drop, or Z-drop) [400,200]. If the
drop of score is above
.IR INT2 ,
minimap2 will reverse complement the query in the related region and align
again to test small inversions. Minimap2 truncates alignment if there is an
inversion or the drop of score is greater than
.IR INT1 .
Decrease
.I INT2
to find small inversions at the cost of performance and false positives.
Increase
.I INT1
to improves the contiguity of alignment at the cost of poor alignment in the
middle.
.TP
.BI -s \ INT
Minimal peak DP alignment score to output [40]. The peak score is computed from
@@ -340,6 +370,9 @@ SAM read group line in a format like
.B @RG\\\\tID:foo\\\\tSM:bar
[].
.TP
.B -y
Copy input FASTA/Q comments to output.
.TP
.B -c
Generate CIGAR. In PAF, the CIGAR is written to the `cg' custom tag.
.TP
@@ -358,6 +391,9 @@ is given,
.I short
is assumed. [none]
.TP
.B --MD
Output the MD tag (see the SAM spec).
.TP
.B -Y
In SAM output, use soft clipping for supplementary alignments.
.TP
@@ -420,18 +456,25 @@ is determined by the sequencing error mode.
.B asm5
Long assembly to reference mapping
.RB ( -k19
.B -w19 -A1 -B19 -O39,81 -E3,1 -s200
.BR -z200 ).
.B -w19 -A1 -B19 -O39,81 -E3,1 -s200 -z200
.BR --min-occ-floor=100 ).
Typically, the alignment will not extend to regions with 5% or higher sequence
divergence. Only use this preset if the average divergence is far below 5%.
.TP
.B asm10
Long assembly to reference mapping
.RB ( -k19
.B -w19 -A1 -B9 -O16,41 -E2,1 -s200
.BR -z200 ).
.B -w19 -A1 -B9 -O16,41 -E2,1 -s200 -z200
.BR --min-occ-floor=100 ).
Up to 10% sequence divergence.
.TP
.B asm20
Long assembly to reference mapping
.RB ( -k19
.B -w10 -A1 -B6 -O6,26 -E2,1 -s200 -z200
.BR --min-occ-floor=100 ).
Up to 20% sequence divergence.
.TP
.B ava-pb
PacBio all-vs-all overlap mapping
.RB ( -Hk19
@@ -441,7 +484,7 @@ PacBio all-vs-all overlap mapping
.B ava-ont
Oxford Nanopore all-vs-all overlap mapping
.RB ( -k15
.B -Xw5 -m100 -g10000 --max-chain-skip
.B -Xw5 -m100 -g10000 -r2000 --max-chain-skip
.BR 25 ).
Similarly, the major difference from
.B ava-pb
@@ -522,6 +565,7 @@ cm i Number of minimizers on the chain
s1 i Chaining score
s2 i Chaining score of the best secondary chain
NM i Total number of mismatches and gaps in the alignment
MD Z To generate the ref sequence in the alignment
AS i DP alignment score
ms i DP score of the max scoring segment in the alignment
nn i Number of ambiguous bases in the alignment
+25
View File
@@ -1,3 +1,4 @@
#include <stdlib.h>
#include "mmpriv.h"
int mm_verbose = 1;
@@ -86,6 +87,8 @@ double cputime()
return kernelModeTime + userModeTime;
}
long peakrss(void) { return 0; }
#else
#include <sys/resource.h>
#include <sys/time.h>
@@ -96,6 +99,18 @@ double cputime(void)
getrusage(RUSAGE_SELF, &r);
return r.ru_utime.tv_sec + r.ru_stime.tv_sec + 1e-6 * (r.ru_utime.tv_usec + r.ru_stime.tv_usec);
}
long peakrss(void)
{
struct rusage r;
getrusage(RUSAGE_SELF, &r);
#ifdef __linux__
return r.ru_maxrss * 1024;
#else
return r.ru_maxrss;
#endif
}
#endif /* WIN32 || _WIN32 */
double realtime(void)
@@ -106,6 +121,16 @@ double realtime(void)
return tp.tv_sec + tp.tv_usec * 1e-6;
}
void mm_err_puts(const char *str)
{
int ret;
ret = puts(str);
if (ret == EOF) {
fprintf(stderr, "[ERROR] failed to write the results\n");
exit(EXIT_FAILURE);
}
}
#include "ksort.h"
#define sort_key_128x(a) ((a).x)
+170 -19
View File
@@ -1,28 +1,179 @@
The [K8 Javascript shell][k8] is needed to run Javascripts in this directory.
Precompiled k8 binaries for Mac and Linux can be found at the [K8 release
page][k8bin].
## <a name="started"></a>Getting Started
* [paf2aln.js](paf2aln.js): convert PAF to [MAF][maf] or BLAST-like output for
eyeballing. PAF has to be generated with minimap2 option `-S`, which writes
the aligned sequences to the `cs` tag. An example:
```sh
../minimap2 -S ../test/MT-*.fa | k8 paf2aln.js /dev/stdin
```
```sh
# install minimap2
git clone https://github.com/lh3/minimap2
cd minimap2 && make
# install the k8 javascript shell
curl -L https://github.com/attractivechaos/k8/releases/download/v0.2.4/k8-0.2.4.tar.bz2 | tar -jxf -
cp k8-0.2.4/k8-`uname -s` k8 # or copy it to a directory on your $PATH
# export PATH="$PATH:`pwd`:`pwd`/misc" # run this if k8, minimap2 or paftools.js not on your $PATH
minimap2 --cs test/MT-human.fa test/MT-orang.fa | paftools.js view - # view alignment
minimap2 -c test/MT-human.fa test/MT-orang.fa | paftools.js stat - # basic alignment statistics
minimap2 -c --cs test/MT-human.fa test/MT-orang.fa \
| sort -k6,6 -k8,8n | paftools.js call -L15000 - # calling variants from asm-to-ref alignment
minimap2 -c test/MT-human.fa test/MT-orang.fa \
| paftools.js liftover -l10000 - <(echo -e "MT_orang\t2000\t5000") # liftOver
# no test data for the following examples
paftools.js junceval -e anno.gtf splice.sam > out.txt # compare splice junctions to annotations
paftools.js splice2bed anno.gtf > anno.bed # convert GTF/GFF3 to BED12
```
* [mapstat.js](mapstat.js): output basic statistics such as the number of
non-redundant mapped bases, number of split and secondary alignments and
number of long gaps. This scripts seamlessly works with both SAM and PAF.
## Table of Contents
* [sim-pbsim.js](sim-pbsim.js): convert reads simulated with [PBSIM][pbsim] to
FASTA and encode the true mapping positions to read names in a format like
`S1_33!chr1!225258409!225267761!-`.
- [Getting Started](#started)
- [Introduction](#intro)
- [Evaluation](#eval)
- [Evaluating mapping accuracy with simulated reads](#mapeval)
- [Evaluating read overlap sensitivity](#oveval)
- [Calling Variants from Assemblies](#asmvar)
* [sim-eval.js](sim-eval.js): evaluate mapping accuracy for FASTA generated
with [sim-pbsim.js](sim-pbsim.js) or [sim-mason2.js](sim-mason2.js).
## <a name="intro"></a>Introduction
* [sam2paf.js](sam2paf.js): convert SAM to PAF.
paftools.js is a script that processes alignments in the [PAF format][paf],
such as converting between formats, evaluating mapping accuracy, lifting over
BED files based on alignment, and calling variants from assembly-to-assembly
alignment. This script *requires* the [k8 Javascript shell][k8] to run. On
Linux or Mac, you can download the precompiled k8 binary with:
```sh
curl -L https://github.com/attractivechaos/k8/releases/download/v0.2.4/k8-0.2.4.tar.bz2 | tar -jxf -
cp k8-0.2.4/k8-`uname -s` $HOME/bin/k8 # assuming $HOME/bin in your $PATH
```
It is highly recommended to copy the executable `k8` to a directory on your
`$PATH` such as `/usr/bin/env` can find it. Like python scripts, once you
install `k8`, you can launch paftools.js in one of the two ways:
```sh
path/to/paftools.js # only if k8 is on your $PATH
k8 path/to/paftools.js
```
In a nutshell, paftools.js has the following commands:
```
Usage: paftools.js <command> [arguments]
Commands:
view convert PAF to BLAST-like (for eyeballing) or MAF
splice2bed convert spliced alignment in PAF/SAM to BED12
sam2paf convert SAM to PAF
delta2paf convert MUMmer's delta to PAF
gff2bed convert GTF/GFF3 to BED12
stat collect basic mapping information in PAF/SAM
liftover simplistic liftOver
call call variants from asm-to-ref alignment with the cs tag
bedcov compute the number of bases covered
mapeval evaluate mapping accuracy using mason2/PBSIM-simulated FASTQ
mason2fq convert mason2-simulated SAM to FASTQ
pbsim2fq convert PBSIM-simulated MAF to FASTQ
junceval evaluate splice junction consistency with known annotations
ov-eval evaluate read overlap sensitivity using read-to-ref mapping
```
paftools.js seamlessly reads both plain text files and gzip'd text files.
## <a name="eval"></a>Evaluation
### <a name="mapeval"></a>Evaluating mapping accuracy with simulated reads
The **pbsim2fq** command of paftools.js converts the MAF output of [pbsim][pbsim]
to FASTQ and encodes the true mapping position in the read name in a format like
`S1_33!chr1!225258409!225267761!-`. Similarly, the **mason2fq** command
converts [mason2][mason2] simulated SAM to FASTQ.
Command **mapeval** evaluates mapped SAM/PAF. Here is example output:
```
Q 60 32478 0 0.000000000 32478
Q 22 16 1 0.000030775 32494
Q 21 43 1 0.000061468 32537
Q 19 73 1 0.000091996 32610
Q 14 66 1 0.000122414 32676
Q 10 27 3 0.000214048 32703
Q 8 14 1 0.000244521 32717
Q 7 13 2 0.000305530 32730
Q 6 46 1 0.000335611 32776
Q 3 10 1 0.000366010 32786
Q 2 20 2 0.000426751 32806
Q 1 248 94 0.003267381 33054
Q 0 31 17 0.003778147 33085
U 3
```
where each Q-line gives the quality threshold, the number of reads mapped with
mapping quality equal to or greater than the threshold, number of wrong
mappings, accumulative mapping error rate and the accumulative number of
mapped reads. The U-line, if present, gives the number of unmapped reads if
they are present in the SAM file.
Suppose the reported mapping coordinate overlap with the true coordinate like
the following:
```
truth: --------------------
mapper: ----------------------
|<- l1 ->|<-- o -->|<-- l2 -->|
```
Let `r=o/(l1+o+l2)`. The reported mapping is considered correct if `r>0.1` by
default.
### <a name="oveval"></a>Evaluating read overlap sensitivity
Command **ov-eval** takes *sorted* read-to-reference alignment and read
overlaps in PAF as input, and evaluates the sensitivity. For example:
```sh
minimap2 -cx map-pb ref.fa reads.fq.gz | sort -k6,6 -k8,8n > reads-to-ref.paf
minimap2 -x ava-pb reads.fq.gz reads.fq.gz > ovlp.paf
k8 ov-eval.js reads-to-ref.paf ovlp.paf
```
## <a name="asmvar"></a>Calling Variants from Haploid Assemblies
The **call** command of paftools.js calls variants from coordinate-sorted
assembly-to-reference alignment. It calls variants from the [cs tag][cs] and
identifies confident/callable regions as those covered by exactly one contig.
Here are example command lines:
```sh
minimap2 -cx asm5 -t8 --cs ref.fa asm.fa > asm.paf # keeping this file is recommended; --cs required!
sort -k6,6 -k8,8n asm.paf > asm.srt.paf # sort by reference start coordinate
k8 paftools.js call asm.srt.paf > asm.var.txt
```
Here is sample output:
```
V chr1 2276040 2276041 1 60 c g LJII01000171.1 1217409 1217410 +
V chr1 2280409 2280410 1 60 a g LJII01000171.1 1221778 1221779 +
V chr1 2280504 2280505 1 60 a g LJII01000171.1 1221873 1221874 +
R chr1 2325140 2436340
V chr1 2325287 2325287 1 60 - ct LJII01000171.1 1272894 1272896 +
V chr1 2325642 2325644 1 60 tt - LJII01000171.1 1273251 1273251 +
V chr1 2326051 2326052 1 60 c t LJII01000171.1 1273658 1273659 +
V chr1 2326287 2326288 1 60 c t LJII01000171.1 1273894 1273895 +
```
where a line starting with `R` gives regions covered by one query contig, and a
V-line encodes a variant in the following format: chr, start, end, query depth,
mapping quality, REF allele, ALT allele, query name, query start, end and the
query orientation. Generally, you should only look at variants where column 5
is one.
By default, when calling variants, "paftools.js call" ignores alignments 50kb
or shorter; when deriving callable regions, it ignores alignments 10kb or
shorter. It uses two thresholds to avoid edge effects. These defaults are
designed for long-read assemblies. For short reads, both should be reduced.
[paf]: https://github.com/lh3/miniasm/blob/master/PAF.md
[cs]: https://github.com/lh3/minimap2#cs
[k8]: https://github.com/attractivechaos/k8
[k8bin]: https://github.com/attractivechaos/k8/releases
[maf]: https://genome.ucsc.edu/FAQ/FAQformat#format5
[pbsim]: https://github.com/pfaucon/PBSIM-PacBio-Simulator
[mason2]: https://github.com/seqan/seqan/tree/master/apps/mason2
-258
View File
@@ -1,258 +0,0 @@
/*******************************
* Command line option parsing *
*******************************/
var getopt = function(args, ostr) {
var oli; // option letter list index
if (typeof(getopt.place) == 'undefined')
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
if (getopt.place == -1) { // update scanning pointer
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
getopt.place = -1;
return null;
}
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
++getopt.ind;
getopt.place = -1;
return null;
}
}
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
if (getopt.place < 0) ++getopt.ind;
return '?';
}
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
getopt.arg = null;
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
} else { // need an argument
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
getopt.arg = args[getopt.ind].substr(getopt.place);
else if (args.length <= ++getopt.ind) { // no arg
getopt.place = -1;
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
return '?';
} else getopt.arg = args[getopt.ind]; // white space
getopt.place = -1;
++getopt.ind;
}
return optopt;
}
/***********************
* Interval operations *
***********************/
Interval = {};
Interval.sort = function(a)
{
if (typeof a[0] == 'number')
a.sort(function(x, y) { return x - y });
else a.sort(function(x, y) { return x[0] != y[0]? x[0] - y[0] : x[1] - y[1] });
}
Interval.merge = function(a, sorted)
{
if (typeof sorted == 'undefined') sorted = true;
if (!sorted) Interval.sort(a);
var k = 0;
for (var i = 1; i < a.length; ++i) {
if (a[k][1] >= a[i][0])
a[k][1] = a[k][1] > a[i][1]? a[k][1] : a[i][1];
else a[++k] = a[i].slice(0);
}
a.length = k + 1;
}
Interval.dedup = function(a, sorted)
{
if (typeof sorted == 'undefined') sorted = true;
if (!sorted) Interval.sort(a);
var k = 0;
for (var i = 1; i < a.length; ++i)
if (a[k][0] != a[i][0] || a[k][1] != a[i][1])
a[++k] = a[i].slice(0);
a.length = k + 1;
}
Interval.index_end = function(a, sorted)
{
if (a.length == 0) return;
if (typeof sorted == 'undefined') sorted = true;
if (!sorted) Interval.sort(a);
a[0].push(0);
var k = 0, k_en = a[0][1];
for (var i = 1; i < a.length; ++i) {
if (k_en <= a[i][0]) {
for (++k; k < i; ++k)
if (a[k][1] > a[i][0])
break;
k_en = a[k][1];
}
a[i].push(k);
}
}
Interval.find_intv = function(a, x)
{
var left = -1, right = a.length;
if (typeof a[0] == 'number') {
while (right - left > 1) {
var mid = left + ((right - left) >> 1);
if (a[mid] > x) right = mid;
else if (a[mid] < x) left = mid;
else return mid;
}
} else {
while (right - left > 1) {
var mid = left + ((right - left) >> 1);
if (a[mid][0] > x) right = mid;
else if (a[mid][0] < x) left = mid;
else return mid;
}
}
return left;
}
Interval.find_ovlp = function(a, st, en)
{
if (a.length == 0 || st >= en) return [];
var l = Interval.find_intv(a, st);
var k = l < 0? 0 : a[l][a[l].length - 1];
var b = [];
for (var i = k; i < a.length; ++i) {
if (a[i][0] >= en) break;
else if (st < a[i][1])
b.push(a[i]);
}
return b;
}
/*****************
* Main function *
*****************/
function read_bed(fn, to_merge, to_dedup)
{
var file = new File(fn);
var buf = new Bytes();
var h = {};
while (file.readline(buf) >= 0) {
var t = buf.toString().split("\t");
if (h[t[0]] == null)
h[t[0]] = [];
var bst = parseInt(t[1]);
var ben = parseInt(t[2]);
if (t.length >= 12 && /^\d+$/.test(t[9])) {
t[9] = parseInt(t[9]);
var sz = t[10].split(",");
var st = t[11].split(",");
for (var i = 0; i < t[9]; ++i) {
st[i] = parseInt(st[i]);
sz[i] = parseInt(sz[i]);
h[t[0]].push([bst + st[i], bst + st[i] + sz[i], 0, 0, 0]);
}
} else {
h[t[0]].push([bst, ben, 0, 0, 0]);
}
}
buf.destroy();
file.close();
for (var chr in h) {
if (to_merge) Interval.merge(h[chr], false);
else if (to_dedup) Interval.dedup(h[chr], false);
else Interval.sort(h[chr]);
Interval.index_end(h[chr]);
}
return h;
}
function main(args)
{
var c, print_len = false, to_merge = true, to_dedup = false, fn_excl = null;
while ((c = getopt(args, "pde:")) != null) {
if (c == 'p') print_len = true;
else if (c == 'd') to_dedup = true, to_merge = false;
else if (c == 'e') fn_excl = getopt.arg;
}
if (args.length - getopt.ind < 2) {
print("Usage: k8 cnt-feat.js [options] <target.bed> <feature.bed>");
print("Options:");
print(" -e FILE exclude features overlapping regions in BED FILE []");
print(" -p print number of covered bases for each feature");
exit(1);
}
var excl = fn_excl != null? read_bed(fn_excl, true, false) : null;
var target = read_bed(args[getopt.ind], to_merge, to_dedup);
var file, buf = new Bytes();
var tot_len = 0, hit_len = 0;
file = args[getopt.ind+1] != '-'? new File(args[getopt.ind+1]) : new File();
while (file.readline(buf) >= 0) {
var t = buf.toString().split("\t");
var a = [];
var bst = parseInt(t[1]);
var ben = parseInt(t[2]);
if (t.length >= 12 && /^\d+$/.test(t[9])) { // BED12
t[9] = parseInt(t[9]);
var sz = t[10].split(",");
var st = t[11].split(",");
for (var i = 0; i < t[9]; ++i) {
st[i] = parseInt(st[i]);
sz[i] = parseInt(sz[i]);
a.push([bst + st[i], bst + st[i] + sz[i], false]);
}
} else a.push([bst, ben, false]); // 3-column BED
var feat_len = 0;
for (var i = 0; i < a.length; ++i) {
if (excl != null && excl[t[0]] != null) {
var oe = Interval.find_ovlp(excl[t[0]], a[i][0], a[i][1]);
if (oe.length > 0)
continue;
}
a[i][2] = true;
feat_len += a[i][1] - a[i][0];
}
tot_len += feat_len;
if (target[t[0]] == null) continue;
var b = [];
for (var i = 0; i < a.length; ++i) {
if (!a[i][2]) continue;
var o = Interval.find_ovlp(target[t[0]], a[i][0], a[i][1]);
for (var j = 0; j < o.length; ++j) {
var max_st = o[j][0] > a[i][0]? o[j][0] : a[i][0];
var min_en = o[j][1] < a[i][1]? o[j][1] : a[i][1];
b.push([max_st, min_en]);
o[j][2] += min_en - max_st;
++o[j][3];
if (max_st == o[j][0] && min_en == o[j][1])
++o[j][4];
}
}
// find the length covered
var feat_hit_len = 0;
if (b.length > 0) {
b.sort(function(a,b) {return a[0]-b[0]});
var st = b[0][0], en = b[0][1];
for (var i = 1; i < b.length; ++i) {
if (b[i][0] <= en) en = en > b[i][1]? en : b[i][1];
else feat_hit_len += en - st, st = b[i][0], en = b[i][1];
}
feat_hit_len += en - st;
}
hit_len += feat_hit_len;
if (print_len) print('F', t.slice(0, 4).join("\t"), feat_len, feat_hit_len);
}
file.close();
buf.destroy();
warn("# feature bases: " + tot_len);
warn("# feature bases overlapping targets: " + hit_len + ' (' + (100.0 * hit_len / tot_len).toFixed(2) + '%)');
}
main(arguments);
-150
View File
@@ -1,150 +0,0 @@
var getopt = function(args, ostr) {
var oli; // option letter list index
if (typeof(getopt.place) == 'undefined')
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
if (getopt.place == -1) { // update scanning pointer
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
getopt.place = -1;
return null;
}
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
++getopt.ind;
getopt.place = -1;
return null;
}
}
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
if (getopt.place < 0) ++getopt.ind;
return '?';
}
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
getopt.arg = null;
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
} else { // need an argument
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
getopt.arg = args[getopt.ind].substr(getopt.place);
else if (args.length <= ++getopt.ind) { // no arg
getopt.place = -1;
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
return '?';
} else getopt.arg = args[getopt.ind]; // white space
getopt.place = -1;
++getopt.ind;
}
return optopt;
}
var c, fn_ucsc_fai = null, is_short = false;
while ((c = getopt(arguments, "u:s")) != null) {
if (c == 'u') fn_ucsc_fai = getopt.arg;
else if (c == 's') is_short = true;
}
if (getopt.ind == arguments.length) {
print("Usage: k8 gff2bed.js [-u ucsc-genome.fa.fai] <in.gff>");
exit(1);
}
var ens2ucsc = {};
if (fn_ucsc_fai != null) {
var buf = new Bytes();
var file = new File(fn_ucsc_fai);
while (file.readline(buf) >= 0) {
var t = buf.toString().split("\t");
var s = t[0];
if (/_(random|alt|decoy)$/.test(s)) {
s = s.replace(/_(random|alt|decoy)$/, '');
s = s.replace(/^chr\S+_/, '');
} else {
s = s.replace(/^chrUn_/, '');
}
s = s.replace(/v(\d+)/, ".$1");
if (s != t[0]) ens2ucsc[s] = t[0];
}
file.close();
buf.destroy();
}
var colors = {
'protein_coding':'0,128,255',
'lincRNA':'0,192,0',
'snRNA':'0,192,0',
'miRNA':'0,192,0',
'misc_RNA':'0,192,0'
};
function print_bed12(exons, cds_st, cds_en, is_short)
{
if (exons.length == 0) return;
var name = is_short? exons[0][7] + "|" + exons[0][5] : exons[0].slice(4, 7).join("|");
var a = exons.sort(function(a,b) {return a[1]-b[1]});
var sizes = [], starts = [], st, en;
st = a[0][1];
en = a[a.length - 1][2];
if (cds_st == 1<<30) cds_st = st;
if (cds_en == 0) cds_en = en;
if (cds_st < st || cds_en > en)
throw Error("inconsistent thick start or end for transcript " + a[0][4]);
for (var i = 0; i < a.length; ++i) {
sizes.push(a[i][2] - a[i][1]);
starts.push(a[i][1] - st);
}
var color = colors[a[0][5]];
if (color == null) color = '196,196,196';
print(a[0][0], st, en, name, 1000, a[0][3], cds_st, cds_en, color, a.length, sizes.join(",") + ",", starts.join(",") + ",");
}
var re_gtf = /(transcript_id|transcript_type|transcript_biotype|gene_name|transcript_name) "([^"]+)";/g;
var re_gff3 = /(transcript_id|transcript_type|transcript_biotype|gene_name|transcript_name)=([^;]+)/g;
var buf = new Bytes();
var file = new File(arguments[getopt.ind]);
var exons = [], cds_st = 1<<30, cds_en = 0, last_id = null;
while (file.readline(buf) >= 0) {
var t = buf.toString().split("\t");
if (t[0].charAt(0) == '#') continue;
if (t[2] != "CDS" && t[2] != "exon") continue;
t[3] = parseInt(t[3]) - 1;
t[4] = parseInt(t[4]);
var id = null, type = "", gname = "N/A", biotype = "", m, tname = "N/A";
while ((m = re_gtf.exec(t[8])) != null) {
if (m[1] == "transcript_id") id = m[2];
else if (m[1] == "transcript_type") type = m[2];
else if (m[1] == "transcript_biotype") biotype = m[2];
else if (m[1] == "gene_name") name = m[2];
else if (m[1] == "transcript_name") tname = m[2];
}
while ((m = re_gff3.exec(t[8])) != null) {
if (m[1] == "transcript_id") id = m[2];
else if (m[1] == "transcript_type") type = m[2];
else if (m[1] == "transcript_biotype") biotype = m[2];
else if (m[1] == "gene_name") name = m[2];
else if (m[1] == "transcript_name") tname = m[2];
}
if (type == "" && biotype != "") type = biotype;
if (id == null) throw Error("No transcript_id");
if (id != last_id) {
print_bed12(exons, cds_st, cds_en, is_short);
exons = [], cds_st = 1<<30, cds_en = 0;
last_id = id;
}
if (t[2] == "CDS") {
cds_st = cds_st < t[3]? cds_st : t[3];
cds_en = cds_en > t[4]? cds_en : t[4];
} else if (t[2] == "exon") {
if (fn_ucsc_fai != null) {
if (ens2ucsc[t[0]] != null)
t[0] = ens2ucsc[t[0]];
else if (/^[A-Z]+\d+\.\d+$/.test(t[0]))
t[0] = t[0].replace(/([A-Z]+\d+)\.(\d+)/, "chrUn_$1v$2");
}
exons.push([t[0], t[3], t[4], t[6], id, type, name, tname]);
}
}
if (last_id != null)
print_bed12(exons, cds_st, cds_en, is_short);
file.close();
buf.destroy();
-267
View File
@@ -1,267 +0,0 @@
/*******************************
* Command line option parsing *
*******************************/
var getopt = function(args, ostr) {
var oli; // option letter list index
if (typeof(getopt.place) == 'undefined')
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
if (getopt.place == -1) { // update scanning pointer
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
getopt.place = -1;
return null;
}
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
++getopt.ind;
getopt.place = -1;
return null;
}
}
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
if (getopt.place < 0) ++getopt.ind;
return '?';
}
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
getopt.arg = null;
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
} else { // need an argument
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
getopt.arg = args[getopt.ind].substr(getopt.place);
else if (args.length <= ++getopt.ind) { // no arg
getopt.place = -1;
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
return '?';
} else getopt.arg = args[getopt.ind]; // white space
getopt.place = -1;
++getopt.ind;
}
return optopt;
}
/***********************
* Interval operations *
***********************/
Interval = {};
Interval.sort = function(a)
{
if (typeof a[0] == 'number')
a.sort(function(x, y) { return x - y });
else a.sort(function(x, y) { return x[0] != y[0]? x[0] - y[0] : x[1] - y[1] });
}
Interval.merge = function(a, sorted)
{
if (typeof sorted == 'undefined') sorted = true;
if (!sorted) Interval.sort(a);
var k = 0;
for (var i = 1; i < a.length; ++i) {
if (a[k][1] >= a[i][0])
a[k][1] = a[k][1] > a[i][1]? a[k][1] : a[i][1];
else a[++k] = a[i].slice(0);
}
a.length = k + 1;
}
Interval.index_end = function(a, sorted)
{
if (a.length == 0) return;
if (typeof sorted == 'undefined') sorted = true;
if (!sorted) Interval.sort(a);
a[0].push(0);
var k = 0, k_en = a[0][1];
for (var i = 1; i < a.length; ++i) {
if (k_en <= a[i][0]) {
for (++k; k < i; ++k)
if (a[k][1] > a[i][0])
break;
k_en = a[k][1];
}
a[i].push(k);
}
}
Interval.find_intv = function(a, x)
{
var left = -1, right = a.length;
if (typeof a[0] == 'number') {
while (right - left > 1) {
var mid = left + ((right - left) >> 1);
if (a[mid] > x) right = mid;
else if (a[mid] < x) left = mid;
else return mid;
}
} else {
while (right - left > 1) {
var mid = left + ((right - left) >> 1);
if (a[mid][0] > x) right = mid;
else if (a[mid][0] < x) left = mid;
else return mid;
}
}
return left;
}
Interval.find_ovlp = function(a, st, en)
{
if (a.length == 0 || st >= en) return [];
var l = Interval.find_intv(a, st);
var k = l < 0? 0 : a[l][a[l].length - 1];
var b = [];
for (var i = k; i < a.length; ++i) {
if (a[i][0] >= en) break;
else if (st < a[i][1])
b.push(a[i]);
}
return b;
}
/*****************
* Main function *
*****************/
var c, l_fuzzy = 0, print_ovlp = false, print_err_only = false, first_only = false;
while ((c = getopt(arguments, "l:ep")) != null) {
if (c == 'l') l_fuzzy = parseInt(getopt.arg);
else if (c == 'e') print_err_only = print_ovlp = true;
else if (c == 'p') print_ovlp = true;
}
if (arguments.length - getopt.ind < 2) {
print("Usage: k8 intron-eval.js [options] <gene.gtf> <aln.sam>");
exit(1);
}
var file, buf = new Bytes();
var tr = {};
file = new File(arguments[getopt.ind]);
while (file.readline(buf) >= 0) {
var m, t = buf.toString().split("\t");
if (t[0].charAt(0) == '#') continue;
if (t[2] != 'exon') continue;
var st = parseInt(t[3]) - 1;
var en = parseInt(t[4]);
if ((m = /transcript_id "(\S+)"/.exec(t[8])) == null) continue;
var tid = m[1];
if (tr[tid] == null) tr[tid] = [t[0], t[6], 0, 0, []];
tr[tid][4].push([st, en]);
}
file.close();
var anno = {};
for (var tid in tr) {
var t = tr[tid];
Interval.sort(t[4]);
t[2] = t[4][0][0];
t[3] = t[4][t[4].length - 1][1];
if (anno[t[0]] == null) anno[t[0]] = [];
var s = t[4];
for (var i = 0; i < s.length - 1; ++i) {
if (s[i][1] >= s[i+1][0])
warn("WARNING: incorrect annotation for transcript "+tid+" ("+s[i][1]+" >= "+s[i+1][0]+")")
anno[t[0]].push([s[i][1], s[i+1][0]]);
}
}
tr = null;
for (var chr in anno) {
var e = anno[chr];
if (e.length == 0) continue;
Interval.sort(e);
var k = 0;
for (var i = 1; i < e.length; ++i) // dedup
if (e[i][0] != e[k][0] || e[i][1] != e[k][1])
e[++k] = e[i].slice(0);
e.length = k + 1;
Interval.index_end(e);
}
var n_pri = 0, n_unmapped = 0, n_mapped = 0;
var n_sgl = 0, n_splice = 0, n_splice_hit = 0, n_splice_novel = 0;
file = new File(arguments[getopt.ind+1]);
var last_qname = null;
var re_cigar = /(\d+)([MIDNSHX=])/g;
while (file.readline(buf) >= 0) {
var m, t = buf.toString().split("\t");
if (t[0].charAt(0) == '@') continue;
var flag = parseInt(t[1]);
if (flag&0x100) continue;
if (first_only && last_qname == t[0]) continue;
if (t[2] == '*') {
++n_unmapped;
continue;
} else {
++n_pri;
if (last_qname != t[0]) ++n_mapped;
}
var pos = parseInt(t[3]) - 1, intron = [];
while ((m = re_cigar.exec(t[5])) != null) {
var len = parseInt(m[1]), op = m[2];
if (op == 'N') {
intron.push([pos, pos + len]);
pos += len;
} else if (op == 'M' || op == 'X' || op == '=' || op == 'D') pos += len;
}
if (intron.length == 0) {
++n_sgl;
continue;
}
n_splice += intron.length;
var chr = anno[t[2]];
if (chr != null) {
for (var i = 0; i < intron.length; ++i) {
var o = Interval.find_ovlp(chr, intron[i][0], intron[i][1]);
if (o.length > 0) {
var hit = false;
for (var j = 0; j < o.length; ++j) {
var st_diff = intron[i][0] - o[j][0];
var en_diff = intron[i][1] - o[j][1];
if (st_diff < 0) st_diff = -st_diff;
if (en_diff < 0) en_diff = -en_diff;
if (st_diff <= l_fuzzy && en_diff <= l_fuzzy)
++n_splice_hit, hit = true;
if (hit) break;
}
if (print_ovlp) {
var type = hit? 'C' : 'P';
if (hit && print_err_only) continue;
var x = '[';
for (var j = 0; j < o.length; ++j) {
if (j) x += ', ';
x += '(' + o[j][0] + "," + o[j][1] + ')';
}
x += ']';
print(type, t[0], i+1, t[2], intron[i][0], intron[i][1], x);
}
} else {
++n_splice_novel;
if (print_ovlp)
print('N', t[0], i+1, t[2], intron[i][0], intron[i][1]);
}
}
} else {
n_splice_novel += intron.length;
}
last_qname = t[0];
}
file.close();
buf.destroy();
if (!print_ovlp) {
print("# unmapped reads: " + n_unmapped);
print("# mapped reads: " + n_mapped);
print("# primary alignments: " + n_pri);
print("# singletons: " + n_sgl);
print("# predicted introns: " + n_splice);
print("# non-overlapping introns: " + n_splice_novel);
print("# correct introns: " + n_splice_hit + " (" + (n_splice_hit / n_splice * 100).toFixed(2) + "%)");
}
-183
View File
@@ -1,183 +0,0 @@
var getopt = function(args, ostr) {
var oli; // option letter list index
if (typeof(getopt.place) == 'undefined')
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
if (getopt.place == -1) { // update scanning pointer
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
getopt.place = -1;
return null;
}
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
++getopt.ind;
getopt.place = -1;
return null;
}
}
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
if (getopt.place < 0) ++getopt.ind;
return '?';
}
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
getopt.arg = null;
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
} else { // need an argument
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
getopt.arg = args[getopt.ind].substr(getopt.place);
else if (args.length <= ++getopt.ind) { // no arg
getopt.place = -1;
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
return '?';
} else getopt.arg = args[getopt.ind]; // white space
getopt.place = -1;
++getopt.ind;
}
return optopt;
}
var c, gap_out_len = null;
while ((c = getopt(arguments, "l:")) != null)
if (c == 'l') gap_out_len = parseInt(getopt.arg);
if (getopt.ind == arguments.length) {
print("Usage: k8 mapstat.js [-l gapOutLen] <in.sam>|<in.paf>");
exit(1);
}
var buf = new Bytes();
var file = new File(arguments[getopt.ind]);
var re = /(\d+)([MIDSHNX=])/g;
var lineno = 0, n_pri = 0, n_2nd = 0, n_seq = 0, n_cigar_64k = 0, l_tot = 0, l_cov = 0;
var n_gap = [[0, 0, 0, 0, 0, 0], [0, 0, 0, 0, 0, 0]];
function cov_len(regs)
{
regs.sort(function(a,b) {return a[0]-b[0]});
var st = regs[0][0], en = regs[0][1], l = 0;
for (var i = 1; i < regs.length; ++i) {
if (regs[i][0] < en)
en = en > regs[i][1]? en : regs[i][1];
else l += en - st, st = regs[i][0], en = regs[i][1];
}
l += en - st;
return l;
}
var last = null, last_qlen = null, regs = [];
while (file.readline(buf) >= 0) {
var line = buf.toString();
++lineno;
if (line.charAt(0) != '@') {
var t = line.split("\t", 12);
var m, rs, cigar = null, is_pri = false, is_sam = false, is_rev = false, tname = null;
var atlen = null, aqlen, qs, qe, mapq, ori_qlen;
if (t[4] == '+' || t[4] == '-') { // PAF
if (!/\ts2:i:\d+/.test(line)) {
++n_2nd;
continue;
}
if ((m = /\tcg:Z:(\S+)/.exec(line)) != null)
cigar = m[1];
if (cigar == null) {
warn("WARNING: no CIGAR at line " + lineno);
continue;
}
tname = t[5];
qs = parseInt(t[2]), qe = parseInt(t[3]);
aqlen = qe - qs;
is_rev = t[4] == '+'? false : true;
rs = parseInt(t[7]);
atlen = parseInt(t[8]) - rs;
mapq = parseInt(t[11]);
ori_qlen = parseInt(t[1]);
} else { // SAM
var flag = parseInt(t[1]);
if ((flag & 4) || t[2] == '*' || t[5] == '*') continue;
if (flag & 0x100) {
++n_2nd;
continue;
}
cigar = t[5];
tname = t[2];
rs = parseInt(t[3]) - 1;
mapq = parseInt(t[4]);
aqlen = t[9].length;
is_sam = true;
is_rev = !!(flag&0x10);
}
++n_pri;
if (last != t[0]) {
if (last != null) {
l_tot += last_qlen;
l_cov += cov_len(regs);
}
regs = [];
++n_seq, last = t[0];
}
var M = 0, tl = 0, ql = 0, clip = [0, 0], n_cigar = 0, sclip = 0;
while ((m = re.exec(cigar)) != null) {
var l = parseInt(m[1]);
++n_cigar;
if (m[2] == 'M' || m[2] == '=' || m[2] == 'X') {
tl += l, ql += l, M += l;
} else if (m[2] == 'I' || m[2] == 'D') {
var type;
if (l < 50) type = 0;
else if (l < 100) type = 1;
else if (l < 300) type = 2;
else if (l < 400) type = 3;
else if (l < 1000) type = 4;
else type = 5;
if (m[2] == 'I') ql += l, ++n_gap[0][type];
else tl += l, ++n_gap[1][type];
if (gap_out_len != null && l >= gap_out_len)
print(t[0], ql, is_rev? '-' : '+', tname, rs + tl, m[2], l);
} else if (m[2] == 'N') {
tl += l;
} else if (m[2] == 'S') {
clip[M == 0? 0 : 1] = l, sclip += l;
} else if (m[2] == 'H') {
clip[M == 0? 0 : 1] = l;
}
}
if (n_cigar > 65535) ++n_cigar_64k;
if (ql + sclip != aqlen)
warn("WARNING: aligned query length is inconsistent with CIGAR at line " + lineno + " (" + (ql+sclip) + " != " + aqlen + ")");
if (atlen != null && atlen != tl)
warn("WARNING: aligned reference length is inconsistent with CIGAR at line " + lineno);
if (is_sam) {
qs = clip[is_rev? 1 : 0], qe = qs + ql;
ori_qlen = clip[0] + ql + clip[1];
}
regs.push([qs, qe]);
last_qlen = ori_qlen;
}
}
l_tot += last_qlen;
l_cov += cov_len(regs);
file.close();
buf.destroy();
if (gap_out_len == null) {
print("Number of mapped sequences: " + n_seq);
print("Number of primary alignments: " + n_pri);
print("Number of secondary alignments: " + n_2nd);
print("Number of primary alignments with >65535 CIGAR operations: " + n_cigar_64k);
print("Number of bases in mapped sequences: " + l_tot);
print("Number of mapped bases: " + l_cov);
print("Number of insertions in [0,50): " + n_gap[0][0]);
print("Number of insertions in [50,100): " + n_gap[0][1]);
print("Number of insertions in [100,300): " + n_gap[0][2]);
print("Number of insertions in [300,400): " + n_gap[0][3]);
print("Number of insertions in [400,1000): " + n_gap[0][4]);
print("Number of insertions in [1000,inf): " + n_gap[0][5]);
print("Number of deletions in [0,50): " + n_gap[1][0]);
print("Number of deletions in [50,100): " + n_gap[1][1]);
print("Number of deletions in [100,300): " + n_gap[1][2]);
print("Number of deletions in [300,400): " + n_gap[1][3]);
print("Number of deletions in [400,1000): " + n_gap[1][4]);
print("Number of deletions in [1000,inf): " + n_gap[1][5]);
}
-105
View File
@@ -1,105 +0,0 @@
var getopt = function(args, ostr) {
var oli; // option letter list index
if (typeof(getopt.place) == 'undefined')
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
if (getopt.place == -1) { // update scanning pointer
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
getopt.place = -1;
return null;
}
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
++getopt.ind;
getopt.place = -1;
return null;
}
}
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
if (getopt.place < 0) ++getopt.ind;
return '?';
}
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
getopt.arg = null;
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
} else { // need an argument
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
getopt.arg = args[getopt.ind].substr(getopt.place);
else if (args.length <= ++getopt.ind) { // no arg
getopt.place = -1;
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
return '?';
} else getopt.arg = args[getopt.ind]; // white space
getopt.place = -1;
++getopt.ind;
}
return optopt;
}
var c, min_ovlp = 2000, min_frac = 0.95, min_mapq = 10;
while ((c = getopt(arguments, "q:l:f:")) != null) {
if (c == 'q') min_mapq = parseInt(getopt.arg);
else if (c == 'l') min_ovlp = parseInt(getopt.arg);
else if (c == 'f') min_frac = parseFloat(getopt.arg);
}
if (arguments.length - getopt.ind < 2) {
print("Usage: sort -k6,6 -k8,8n to-ref.paf | k8 ov-eval.js [options] - <ovlp.paf>");
print("Options:");
print(" -l INT min overlap length [2000]");
print(" -q INT min mapping quality [10]");
print(" -f FLOAT min fraction of mapped length [0.95]");
exit(1);
}
var buf = new Bytes();
var file = arguments[getopt.ind] == '-'? new File() : new File(arguments[getopt.ind]);
var a = [], h = {};
while (file.readline(buf) >= 0) {
var t = buf.toString().split("\t");
var is_pri = false;
if (parseInt(t[11]) < min_mapq) continue;
for (var i = 12; i < t.length; ++i)
if (t[i] == 'tp:A:P')
is_pri = true;
if (!is_pri) continue;
for (var i = 1; i <= 3; ++i)
t[i] = parseInt(t[i]);
for (var i = 6; i <= 8; ++i)
t[i] = parseInt(t[i]);
if (t[3] - t[2] < min_ovlp || t[8] - t[7] < min_ovlp || (t[3] - t[2]) / t[1] < min_frac)
continue;
var ctg = t[5], st = t[7], en = t[8];
while (a.length > 0) {
if (a[0][0] == ctg && a[0][2] > st)
break;
else a.shift();
}
for (var j = 0; j < a.length; ++j) {
if (a[j][3] == t[0]) continue;
var len = (en > a[j][2]? a[j][2] : en) - st;
if (len >= min_ovlp) {
var key = a[j][3] < t[0]? a[j][3] + "\t" + t[0] : t[0] + "\t" + a[j][3];
h[key] = len;
}
}
a.push([ctg, st, en, t[0]]);
}
file.close();
file = new File(arguments[getopt.ind + 1]);
while (file.readline(buf) >= 0) {
var t = buf.toString().split("\t");
var key = t[0] < t[5]? t[0] + "\t" + t[5] : t[5] + "\t" + t[0];
if (h[key] > 0) h[key] = -h[key];
}
file.close();
buf.destroy();
var n_ovlp = 0, n_missing = 0;
for (var key in h) {
++n_ovlp;
if (h[key] > 0) ++n_missing;
}
print(n_ovlp + " overlaps inferred from the reference mapping");
print(n_missing + " missed by the read overlapper");
print((100 * (1 - n_missing / n_ovlp)).toFixed(2) + "% sensitivity");
-196
View File
@@ -1,196 +0,0 @@
var getopt = function(args, ostr) {
var oli; // option letter list index
if (typeof(getopt.place) == 'undefined')
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
if (getopt.place == -1) { // update scanning pointer
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
getopt.place = -1;
return null;
}
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
++getopt.ind;
getopt.place = -1;
return null;
}
}
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
if (getopt.place < 0) ++getopt.ind;
return '?';
}
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
getopt.arg = null;
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
} else { // need an argument
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
getopt.arg = args[getopt.ind].substr(getopt.place);
else if (args.length <= ++getopt.ind) { // no arg
getopt.place = -1;
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
return '?';
} else getopt.arg = args[getopt.ind]; // white space
getopt.place = -1;
++getopt.ind;
}
return optopt;
}
var c, line_len = 80, fmt = "aln";
while ((c = getopt(arguments, "f:l:")) != null) {
if (c == 'f') {
fmt = getopt.arg;
if (fmt != "aln" && fmt != "lastz-cigar" && fmt != "maf")
throw Error("format must be one of aln, lastz-cigar and maf");
} else if (c == 'l') line_len = parseInt(getopt.arg);
}
if (line_len == 0) line_len = 0x7fffffff;
if (getopt.ind == arguments.length) {
print("Usage: k8 paf2aln.js [options] <in.paf>");
print("Options:");
print(" -f STR output format: aln (BLAST-like), maf or lastz-cigar [aln]");
print(" -l INT line length in BLAST-like output [80]");
exit(1);
}
function padding_str(x, len, right)
{
var s = x.toString();
if (s.length < len) {
if (right) s += Array(len - s.length + 1).join(" ");
else s = Array(len - s.length + 1).join(" ") + s;
}
return s;
}
function update_aln(s_ref, s_qry, s_mid, type, seq, slen)
{
var l = type == '*'? 1 : seq.length;
if (type == '=' || type == ':') {
s_ref.set(seq);
s_qry.set(seq);
s_mid.set(Array(l+1).join("|"));
slen[0] += l, slen[1] += l;
} else if (type == '*') {
s_ref.set(seq.charAt(0));
s_qry.set(seq.charAt(1));
s_mid.set(' ');
slen[0] += 1, slen[1] += 1;
} else if (type == '+') {
s_ref.set(Array(l+1).join("-"));
s_qry.set(seq);
s_mid.set(Array(l+1).join(" "));
slen[1] += l;
} else if (type == '-') {
s_ref.set(seq);
s_qry.set(Array(l+1).join("-"));
s_mid.set(Array(l+1).join(" "));
slen[0] += l;
}
}
function print_aln(rs, qs, strand, slen, elen, s_ref, s_qry, s_mid)
{
print(["Ref+:", padding_str(rs + slen[0] + 1, 10, false), s_ref.toString(), padding_str(rs + elen[0], 10, true)].join(" "));
print(" " + s_mid.toString());
var st, en;
if (strand == '+') st = qs + slen[1] + 1, en = qs + elen[1];
else st = qs - slen[1], en = qs - elen[1] + 1;
print(["Qry" + strand + ":", padding_str(st, 10, false), s_qry.toString(), padding_str(en, 10, true)].join(" "));
}
var s_ref = new Bytes(), s_qry = new Bytes(), s_mid = new Bytes(); // these are used to show padded alignment
var re_cs = /([:=\-\+\*])(\d+|[A-Za-z]+)/g;
var re_cg = /(\d+)([MIDNSH])/g;
var buf = new Bytes();
var file = arguments[getopt.ind] == "-"? new File() : new File(arguments[getopt.ind]);
var lineno = 0;
if (fmt == "maf") print("##maf version=1\n");
while (file.readline(buf) >= 0) {
var m, line = buf.toString();
var t = line.split("\t", 12);
++lineno;
s_ref.length = s_qry.length = s_mid.length = 0;
var slen = [0, 0], elen = [0, 0];
if (fmt == "lastz-cigar") { // LASTZ-cigar output
var cg = (m = /\tcg:Z:(\S+)/.exec(line)) != null? m[1] : null;
if (cg == null) {
warn("WARNING: converting to LASTZ-cigar format requires the 'cg' tag, which is absent on line " + lineno);
continue;
}
var score = (m = /\tAS:i:(\d+)/.exec(line)) != null? m[1] : 0;
var out = ['cigar:', t[0], t[2], t[3], t[4], t[5], t[7], t[8], '+', score];
while ((m = re_cg.exec(cg)) != null)
out.push(m[2], m[1]);
print(out.join(" "));
} else if (fmt == "maf") { // MAF output
var cs = (m = /\tcs:Z:(\S+)/.exec(line)) != null? m[1] : null;
if (cs == null) {
warn("WARNING: converting to MAF requires the 'cs' tag, which is absent on line " + lineno);
continue;
}
while ((m = re_cs.exec(cs)) != null) {
if (m[1] == ':')
throw Error("converting to MAF only works with 'minimap2 --cs=long'");
update_aln(s_ref, s_qry, s_mid, m[1], m[2], elen);
}
var score = (m = /\tAS:i:(\d+)/.exec(line)) != null? parseInt(m[1]) : 0;
var len = t[0].length > t[5].length? t[0].length : t[5].length;
print("a " + score);
print(["s", padding_str(t[5], len, true), padding_str(t[7], 10, false), padding_str(parseInt(t[8]) - parseInt(t[7]), 10, false),
"+", padding_str(t[6], 10, false), s_ref.toString()].join(" "));
var qs, qe, ql = parseInt(t[1]);
if (t[4] == '+') {
qs = parseInt(t[2]);
qe = parseInt(t[3]);
} else {
qs = ql - parseInt(t[3]);
qe = ql - parseInt(t[2]);
}
print(["s", padding_str(t[0], len, true), padding_str(qs, 10, false), padding_str(qe - qs, 10, false),
t[4], padding_str(ql, 10, false), s_qry.toString()].join(" "));
print("");
} else { // BLAST-like output
var cs = (m = /\tcs:Z:(\S+)/.exec(line)) != null? m[1] : null;
if (cs == null) {
warn("WARNING: converting to BLAST-like alignment requires the 'cs' tag, which is absent on line " + lineno);
continue;
}
line = line.replace(/\tc[sg]:Z:\S+/g, ""); // get rid of cs or cg tags
print('>' + line);
var rs = parseInt(t[7]), qs = t[4] == '+'? parseInt(t[2]) : parseInt(t[3]);
var n_blocks = 0;
while ((m = re_cs.exec(cs)) != null) {
if (m[1] == ':') m[2] = Array(parseInt(m[2]) + 1).join("=");
var start = 0, rest = m[1] == '*'? 1 : m[2].length;
while (rest > 0) {
var l_proc;
if (s_ref.length + rest >= line_len) {
l_proc = line_len - s_ref.length;
update_aln(s_ref, s_qry, s_mid, m[1], m[1] == '*'? m[2] : m[2].substr(start, l_proc), elen);
if (n_blocks > 0) print("");
print_aln(rs, qs, t[4], slen, elen, s_ref, s_qry, s_mid);
++n_blocks;
s_ref.length = s_qry.length = s_mid.length = 0;
slen[0] = elen[0], slen[1] = elen[1];
} else {
l_proc = rest;
update_aln(s_ref, s_qry, s_mid, m[1], m[1] == '*'? m[2] : m[2].substr(start, l_proc), elen);
}
rest -= l_proc, start += l_proc;
}
}
if (s_ref.length > 0) {
if (n_blocks > 0) print("");
print_aln(rs, qs, t[4], slen, elen, s_ref, s_qry, s_mid);
++n_blocks;
}
print("//");
}
}
file.close();
buf.destroy();
s_ref.destroy(); s_qry.destroy(); s_mid.destroy();
-188
View File
@@ -1,188 +0,0 @@
var getopt = function(args, ostr) {
var oli; // option letter list index
if (typeof(getopt.place) == 'undefined')
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
if (getopt.place == -1) { // update scanning pointer
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
getopt.place = -1;
return null;
}
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
++getopt.ind;
getopt.place = -1;
return null;
}
}
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
if (getopt.place < 0) ++getopt.ind;
return '?';
}
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
getopt.arg = null;
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
} else { // need an argument
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
getopt.arg = args[getopt.ind].substr(getopt.place);
else if (args.length <= ++getopt.ind) { // no arg
getopt.place = -1;
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
return '?';
} else getopt.arg = args[getopt.ind]; // white space
getopt.place = -1;
++getopt.ind;
}
return optopt;
}
var re_cs = /([:=*+-])(\d+|[A-Za-z]+)/g;
var c, min_cov_len = 10000, min_var_len = 50000, gap_thres = 50, min_mapq = 5;
while ((c = getopt(arguments, "l:L:g:q:")) != null) {
if (c == 'l') min_cov_len = parseInt(getopt.arg);
else if (c == 'L') min_var_len = parseInt(getopt.arg);
else if (c == 'g') gap_thres = parseInt(getopt.arg);
else if (c == 'q') min_mapq = parseInt(getopt.arg);
}
if (arguments.length == getopt.ind) {
print("Usage: k8 paf2diff.js [options] <with-cs.paf>");
print("Options:");
print(" -l INT min alignment length to compute coverage ["+min_cov_len+"]");
print(" -L INT min alignment length to call variants ["+min_var_len+"]");
print(" -q INT min mapping quality ["+min_mapq+"]");
print(" -g INT short/long gap threshold (for statistics only) ["+gap_thres+"]");
exit(1);
}
var file = arguments[getopt.ind] == '-'? new File() : new File(arguments[getopt.ind]);
var buf = new Bytes();
var tot_len = 0, n_sub = [0, 0, 0], n_ins = [0, 0, 0, 0], n_del = [0, 0, 0, 0];
function count_var(o)
{
if (o[3] > 1) return;
if (o[5] == '-' && o[6] == '-') return;
if (o[5] == '-') { // insertion
var l = o[6].length;
if (l == 1) ++n_ins[0];
else if (l == 2) ++n_ins[1];
else if (l < gap_thres) ++n_ins[2];
else ++n_ins[3];
} else if (o[6] == '-') { // deletion
var l = o[5].length;
if (l == 1) ++n_del[0];
else if (l == 2) ++n_del[1];
else if (l < gap_thres) ++n_del[2];
else ++n_del[3];
} else {
++n_sub[0];
var s = o[5] + o[6];
if (s == 'ag' || s == 'ga' || s == 'ct' || s == 'tc')
++n_sub[1];
else ++n_sub[2];
}
}
var a = [], out = [];
var c1_ctg = null, c1_start = 0, c1_end = 0, c1_counted = false, c1_len = 0;
while (file.readline(buf) >= 0) {
var line = buf.toString();
if (!/\ts2:i:/.test(line)) continue; // skip secondary alignments
var m, t = line.split("\t", 12);
for (var i = 6; i <= 11; ++i)
t[i] = parseInt(t[i]);
if (t[10] < min_cov_len || t[11] < min_mapq) continue;
var ctg = t[5], x = t[7], end = t[8];
// compute regions covered by 1 contig
if (ctg != c1_ctg || x >= c1_end) {
if (c1_counted && c1_end > c1_start) {
c1_len += c1_end - c1_start;
print('R', c1_ctg, c1_start, c1_end);
}
c1_ctg = ctg, c1_start = x, c1_end = end;
c1_counted = (t[10] >= min_var_len);
} else if (end > c1_end) { // overlap
if (c1_counted && x > c1_start) {
c1_len += x - c1_start;
print('R', c1_ctg, c1_start, x);
}
c1_start = c1_end, c1_end = end;
c1_counted = (t[10] >= min_var_len);
} else { // contained
if (c1_counted && x > c1_start) {
c1_len += x - c1_start;
print('R', c1_ctg, c1_start, x);
}
c1_start = end;
}
// output variants ahead of this alignment
while (out.length) {
if (out[0][0] != ctg || out[0][2] <= x) {
count_var(out[0]);
print('V', out[0].join("\t"));
out.shift();
} else break;
}
// update coverage
for (var i = 0; i < out.length; ++i)
if (out[i][1] >= x && out[i][2] <= end)
++out[i][3];
// drop alignments that don't overlap with the current one
var k = 0;
for (var i = 0; i < a.length; ++i)
if (a[0][0] == ctg && a[0][2] > x)
a[k++] = a[i];
a.length = k;
// core loop
if (t[10] >= min_var_len) {
if ((m = /\tcs:Z:(\S+)/.exec(line)) == null) continue; // no cs tag
var cs = m[1];
var blen = 0, n_diff = 0;
tot_len += t[10];
while ((m = re_cs.exec(cs)) != null) {
var cov = 1;
if (m[1] == '*' || m[1] == '+' || m[1] == '-')
for (var i = 0; i < a.length; ++i)
if (a[0][2] > x) ++cov;
if (m[1] == '=' || m[1] == ':') {
var l = m[1] == '='? m[2].length : parseInt(m[2]);
x += l, blen += l;
} else if (m[1] == '*') {
out.push([t[5], x, x+1, cov, t[11], m[2].charAt(0), m[2].charAt(1)]);
++x, ++blen, ++n_diff;
} else if (m[1] == '+') {
out.push([t[5], x, x, cov, t[11], '-', m[2]]);
++blen, ++n_diff;
} else if (m[1] == '-') {
out.push([t[5], x, x + m[2].length, cov, t[11], m[2], '-']);
x += m[2].length, ++blen, ++n_diff;
}
}
}
a.push([t[5], t[7], t[8]]);
}
if (c1_counted && c1_end > c1_start) {
c1_len += c1_end - c1_start;
print('R', c1_ctg, c1_start, c1_end);
}
while (out.length) {
count_var(out[0]);
print('V', out[0].join("\t"));
out.shift();
}
//warn(tot_len + " alignment columns considered in calling");
warn(c1_len + " reference bases covered by exactly one contig");
warn(n_sub[0] + " substitutions; ts/tv = " + (n_sub[1]/n_sub[2]).toFixed(3));
warn(n_del[0] + " 1bp deletions");
warn(n_ins[0] + " 1bp insertions");
warn(n_del[1] + " 2bp deletions");
warn(n_ins[1] + " 2bp insertions");
warn(n_del[2] + " [3,"+gap_thres+") deletions");
warn(n_ins[2] + " [3,"+gap_thres+") insertions");
warn(n_del[3] + " >="+gap_thres+" deletions");
warn(n_ins[3] + " >="+gap_thres+" insertions");
buf.destroy();
file.close();
+2034
View File
File diff suppressed because it is too large Load Diff
-114
View File
@@ -1,114 +0,0 @@
var getopt = function(args, ostr) {
var oli; // option letter list index
if (typeof(getopt.place) == 'undefined')
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
if (getopt.place == -1) { // update scanning pointer
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
getopt.place = -1;
return null;
}
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
++getopt.ind;
getopt.place = -1;
return null;
}
}
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
if (getopt.place < 0) ++getopt.ind;
return '?';
}
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
getopt.arg = null;
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
} else { // need an argument
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
getopt.arg = args[getopt.ind].substr(getopt.place);
else if (args.length <= ++getopt.ind) { // no arg
getopt.place = -1;
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
return '?';
} else getopt.arg = args[getopt.ind]; // white space
getopt.place = -1;
++getopt.ind;
}
return optopt;
}
var c, pri_only = false;
while ((c = getopt(arguments, "p")) != null)
if (c == 'p') pri_only = true;
var file = arguments.length == getopt.ind? new File() : new File(arguments[getopt.ind]);
var buf = new Bytes();
var re = /(\d+)([MIDSHNX=])/g;
var len = {}, lineno = 0;
while (file.readline(buf) >= 0) {
var m, n_cigar = 0, line = buf.toString();
++lineno;
if (line.charAt(0) == '@') {
if (/^@SQ/.test(line)) {
var name = (m = /\tSN:(\S+)/.exec(line)) != null? m[1] : null;
var l = (m = /\tLN:(\d+)/.exec(line)) != null? parseInt(m[1]) : null;
if (name != null && l != null) len[name] = l;
}
continue;
}
var t = line.split("\t");
var flag = parseInt(t[1]);
if (t[9] != '*' && t[10] != '*' && t[9].length != t[10].length) throw Error("ERROR at line " + lineno + ": inconsistent SEQ and QUAL lengths - " + t[9].length + " != " + t[10].length);
if (t[2] == '*' || (flag&4)) continue;
if (pri_only && (flag&0x100)) continue;
var tlen = len[t[2]];
if (tlen == null) throw Error("ERROR at line " + lineno + ": can't find the length of contig " + t[2]);
var nn = (m = /\tnn:i:(\d+)/.exec(line)) != null? parseInt(m[1]) : 0;
var NM = (m = /\tNM:i:(\d+)/.exec(line)) != null? parseInt(m[1]) : null;
var have_NM = NM == null? false : true;
NM += nn;
var clip = [0, 0], I = [0, 0], D = [0, 0], M = 0, N = 0, ql = 0, tl = 0, mm = 0, ext_cigar = false;
while ((m = re.exec(t[5])) != null) {
var l = parseInt(m[1]);
if (m[2] == 'M') M += l, ql += l, tl += l, ext_cigar = false;
else if (m[2] == 'I') ++I[0], I[1] += l, ql += l;
else if (m[2] == 'D') ++D[0], D[1] += l, tl += l;
else if (m[2] == 'N') N += l, tl += l;
else if (m[2] == 'S') clip[M == 0? 0 : 1] = l, ql += l;
else if (m[2] == 'H') clip[M == 0? 0 : 1] = l;
else if (m[2] == '=') M += l, ql += l, tl += l, ext_cigar = true;
else if (m[2] == 'X') M += l, ql += l, tl += l, mm += l, ext_cigar = true;
++n_cigar;
}
if (n_cigar > 65535)
warn("WARNING at line " + lineno + ": " + n_cigar + " CIGAR operations");
if (tl + parseInt(t[3]) - 1 > tlen) {
warn("WARNING at line " + lineno + ": alignment end position larger than ref length; skipped");
continue;
}
if (t[9] != '*' && t[9].length != ql) {
warn("WARNING at line " + lineno + ": SEQ length inconsistent with CIGAR (" + t[9].length + " != " + ql + "); skipped");
continue;
}
if (!have_NM || ext_cigar) NM = I[1] + D[1] + mm;
if (NM < I[1] + D[1] + mm) {
warn("WARNING at line " + lineno + ": NM is less than the total number of gaps (" + NM + " < " + (I[1]+D[1]+mm) + ")");
NM = I[1] + D[1] + mm;
}
var extra = ["mm:i:"+(NM-I[1]-D[1]), "io:i:"+I[0], "in:i:"+I[1], "do:i:"+D[0], "dn:i:"+D[1]];
var match = M - (NM - I[1] - D[1]);
var blen = M + I[1] + D[1];
var qlen = M + I[1] + clip[0] + clip[1];
var qs, qe;
if (flag&16) qs = clip[1], qe = qlen - clip[0];
else qs = clip[0], qe = qlen - clip[1];
var ts = parseInt(t[3]) - 1, te = ts + M + D[1] + N;
var qname = t[0];
if ((flag&1) && (flag&0x40)) qname += '/1';
if ((flag&1) && (flag&0x80)) qname += '/2';
var a = [qname, qlen, qs, qe, flag&16? '-' : '+', t[2], tlen, ts, te, match, blen, t[4]];
print(a.join("\t"), extra.join("\t"));
}
buf.destroy();
file.close();
-193
View File
@@ -1,193 +0,0 @@
var getopt = function(args, ostr) {
var oli; // option letter list index
if (typeof(getopt.place) == 'undefined')
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
if (getopt.place == -1) { // update scanning pointer
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
getopt.place = -1;
return null;
}
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
++getopt.ind;
getopt.place = -1;
return null;
}
}
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
if (getopt.place < 0) ++getopt.ind;
return '?';
}
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
getopt.arg = null;
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
} else { // need an argument
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
getopt.arg = args[getopt.ind].substr(getopt.place);
else if (args.length <= ++getopt.ind) { // no arg
getopt.place = -1;
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
return '?';
} else getopt.arg = args[getopt.ind]; // white space
getopt.place = -1;
++getopt.ind;
}
return optopt;
}
var c, max_mapq = 60, mode = 0, err_out_q = 256, print_err = false, ovlp_ratio = 0.1, cap_short_mapq = false;
while ((c = getopt(arguments, "Q:r:m:c")) != null) {
if (c == 'Q') err_out_q = parseInt(getopt.arg), print_err = true;
else if (c == 'r') ovlp_ratio = parseFloat(getopt.arg);
else if (c == 'm') mode = parseInt(getopt.arg);
else if (c == 'c') cap_short_mapq = true;
}
var file = arguments.length == getopt.ind? new File() : new File(arguments[getopt.ind]);
var buf = new Bytes();
var tot = [], err = [];
for (var q = 0; q <= max_mapq; ++q)
tot[q] = err[q] = 0;
function is_correct(s, b)
{
if (s[0] != b[0] || s[3] != b[3]) return false;
var o, l;
if (s[1] < b[1]) {
if (s[2] <= b[1]) return false;
o = (s[2] < b[2]? s[2] : b[2]) - b[1];
l = (s[2] > b[2]? s[2] : b[2]) - s[1];
} else {
if (b[2] <= s[1]) return false;
o = (s[2] < b[2]? s[2] : b[2]) - s[1];
l = (s[2] > b[2]? s[2] : b[2]) - b[1];
}
return o/l > ovlp_ratio? true : false;
}
function count_err(qname, a, tot, err, mode)
{
if (a.length == 0) return;
var m, s;
if ((m = /^(\S+)!(\S+)!(\d+)!(\d+)!([\+\-])$/.exec(qname)) != null) { // pbsim single-end reads
s = [m[1], m[2], parseInt(m[3]), parseInt(m[4]), m[5]];
} else if ((m = /^(\S+)!(\S+)!(\d+)_(\d+)!(\d+)_(\d+)!([\+\-])([\+\-])\/([12])$/.exec(qname)) != null) { // mason2 paired-end reads
if (m[9] == '1') {
s = [m[1], m[2], parseInt(m[3]), parseInt(m[5]), m[7]];
} else {
s = [m[1], m[2], parseInt(m[4]), parseInt(m[6]), m[8]];
}
} else throw Error("Failed to parse simulated read names '" + qname + "'");
s.shift(); // skip the orginal read name
if (mode == 0 || mode == 1) { // longest only or first only
var max_i = 0;
if (mode == 0) { // longest only
var max = 0;
for (var i = 0; i < a.length; ++i)
if (a[i][5] > max)
max = a[i][5], max_i = i;
}
var mapq = a[max_i][4];
++tot[mapq];
if (!is_correct(s, a[max_i])) {
if (mapq >= err_out_q)
print('E', qname, a[max_i].join("\t"));
++err[mapq];
}
} else if (mode == 2) { // all primary mode
var max_err_mapq = -1, max_mapq = 0, max_err_i = -1;
if (cap_short_mapq) {
var max = 0, max_q = 0;
for (var i = 0; i < a.length; ++i)
if (a[i][5] > max)
max = a[i][5], max_q = a[i][4];
for (var i = 0; i < a.length; ++i)
a[i][4] = max_q < a[i][4]? max_q : a[i][4];
}
for (var i = 0; i < a.length; ++i) {
max_mapq = max_mapq > a[i][4]? max_mapq : a[i][4];
if (!is_correct(s, a[i]))
if (a[i][4] > max_err_mapq)
max_err_mapq = a[i][4], max_err_i = i;
}
if (max_err_mapq >= 0) {
++tot[max_err_mapq], ++err[max_err_mapq];
if (max_err_mapq >= err_out_q)
print('E', qname, a[max_err_i].join("\t"));
} else ++tot[max_mapq];
}
}
var lineno = 0, last = null, a = [], n_unmapped = null;
var re_cigar = /(\d+)([MIDSHN])/g;
while (file.readline(buf) >= 0) {
var m, line = buf.toString();
++lineno;
if (line[0] != '@') {
var t = line.split("\t");
if (t[4] == '+' || t[4] == '-') { // PAF
if (last != t[0]) {
if (last != null) count_err(last, a, tot, err, mode);
a = [], last = t[0];
}
if (/\ts1:i:\d+/.test(line) && !/\ts2:i:\d+/.test(line)) // secondary alignment in minimap2 PAF
continue;
var mapq = parseInt(t[11]);
if (mapq > max_mapq) mapq = max_mapq;
a.push([t[5], parseInt(t[7]), parseInt(t[8]), t[4], mapq, parseInt(t[9])]);
} else { // SAM
var flag = parseInt(t[1]);
var read_no = flag>>6&0x3;
var qname = t[0];
if (!/\/[12]$/.test(qname))
qname = read_no == 1 || read_no == 2? t[0] + '/' + read_no : t[0];
if (last != qname) {
if (last != null) count_err(last, a, tot, err, mode);
a = [], last = qname;
}
if (flag&0x100) continue; // secondary alignment
if ((flag&0x4) || t[2] == '*') { // unmapped
if (n_unmapped == null) n_unmapped = 0;
++n_unmapped;
continue;
}
var mapq = parseInt(t[4]);
if (mapq > max_mapq) mapq = max_mapq;
var pos = parseInt(t[3]) - 1, pos_end = pos;
var n_gap = 0, mlen = 0;
while ((m = re_cigar.exec(t[5])) != null) {
var len = parseInt(m[1]);
if (m[2] == 'M') pos_end += len, mlen += len;
else if (m[2] == 'I') n_gap += len;
else if (m[2] == 'D') n_gap += len, pos_end += len;
}
var score = pos_end - pos;
if ((m = /\tNM:i:(\d+)/.exec(line)) != null) {
var NM = parseInt(m[1]);
if (NM >= n_gap) score = mlen - (NM - n_gap);
}
a.push([t[2], pos, pos_end, (flag&16)? '-' : '+', mapq, score]);
}
}
}
if (last != null) count_err(last, a, tot, err, mode);
buf.destroy();
file.close();
var sum_tot = 0, sum_err = 0, q_out = -1, sum_tot2 = 0, sum_err2 = 0;
for (var q = max_mapq; q >= 0; --q) {
if (tot[q] == 0) continue;
if (q_out < 0 || err[q] > 0) {
if (q_out >= 0) print('Q', q_out, sum_tot, sum_err, (sum_err2/sum_tot2).toFixed(9), sum_tot2);
sum_tot = sum_err = 0, q_out = q;
}
sum_tot += tot[q], sum_err += err[q];
sum_tot2 += tot[q], sum_err2 += err[q];
}
print('Q', q_out, sum_tot, sum_err, (sum_err2/sum_tot2).toFixed(9), sum_tot2);
if (n_unmapped != null) print('U', n_unmapped);
-105
View File
@@ -1,105 +0,0 @@
Bytes.prototype.reverse = function()
{
for (var i = 0; i < this.length>>1; ++i) {
var tmp = this[i];
this[i] = this[this.length - i - 1];
this[this.length - i - 1] = tmp;
}
}
// reverse complement a DNA string
Bytes.prototype.revcomp = function()
{
if (Bytes.rctab == null) {
var s1 = 'WSATUGCYRKMBDHVNwsatugcyrkmbdhvn';
var s2 = 'WSTAACGRYMKVHDBNwstaacgrymkvhdbn';
Bytes.rctab = [];
for (var i = 0; i < 256; ++i) Bytes.rctab[i] = 0;
for (var i = 0; i < s1.length; ++i)
Bytes.rctab[s1.charCodeAt(i)] = s2.charCodeAt(i);
}
for (var i = 0; i < this.length>>1; ++i) {
var tmp = this[this.length - i - 1];
this[this.length - i - 1] = Bytes.rctab[this[i]];
this[i] = Bytes.rctab[tmp];
}
if (this.length&1)
this[this.length>>1] = Bytes.rctab[this[this.length>>1]];
}
if (arguments.length == 0) {
print("Usage: k8 sim-mason2.js <mason.sam>");
exit(1);
}
function print_se(a)
{
print('@' + a.slice(0, 5).join("!") + " " + a[8]);
print(a[5]);
print("+");
print(a[6]);
}
var buf = new Bytes(), buf2 = new Bytes();
var file = new File(arguments[0]);
var re = /(\d+)([MIDSHN])/g;
var last = null;
while (file.readline(buf) >= 0) {
var t = buf.toString().split("\t");
if (t[0].charAt(0) == '@') continue;
var m, l_ref = 0;
while ((m = re.exec(t[5])) != null)
if (m[2] == 'D' || m[2] == 'M' || m[2] == 'N')
l_ref += parseInt(m[1]);
var flag = parseInt(t[1]);
var rev = !!(flag&16);
var seq, qual;
if (rev) {
buf2.length = 0;
buf2.set(t[9], 0);
buf2.revcomp();
seq = buf2.toString();
buf2.set(t[10], 0);
buf2.reverse();
qual = buf2.toString();
} else seq = t[9], qual = t[10];
var qname = t[0];
qname = qname.replace(/^simulated./, "");
var chr = t[2];
var pos = parseInt(t[3]) - 1;
var strand = (flag&16)? '-' : '+';
var read_no = flag&0xc0;
if (read_no == 0x40) read_no = 1;
else if (read_no == 0x80) read_no = 2;
else read_no = 0;
var err = 0, snp = 0, indel = 0;
for (var i = 11; i < t.length; ++i) {
if ((m = /^XE:i:(\d+)/.exec(t[i])) != null) err = m[1];
else if ((m = /^XS:i:(\d+)/.exec(t[i])) != null) snp = m[1];
else if ((m = /^XI:i:(\d+)/.exec(t[i])) != null) indel = m[1];
}
var comment = [err, snp, indel].join(":");
if (last == null) {
last = [qname, chr, pos, pos + l_ref, strand, seq, qual, read_no, comment];
} else if (last[0] != qname) {
print_se(last);
last = [qname, chr, pos, pos + l_ref, strand, seq, qual, read_no, comment];
} else {
if (read_no == 2) { // last[] is the first read
if (last[7] != 1) throw Error("ERROR: can't find read1");
var name = [qname, chr, last[2] + "_" + pos, last[3] + "_" + (pos + l_ref), last[4] + strand].join("!");
print('@' + name + '/1' + ' ' + last[8]); print(last[5]); print("+"); print(last[6]);
print('@' + name + '/2' + ' ' + comment); print(seq); print("+"); print(qual);
} else {
if (last[7] != 2) throw Error("ERROR: can't find read2");
var name = [qname, chr, pos + "_" + last[2], (pos + l_ref) + "_" + last[3], strand + last[4]].join("!");
print('@' + name + '/1' + ' ' + comment); print(seq); print("+"); print(qual);
print('@' + name + '/2' + ' ' + last[8]); print(last[5]); print("+"); print(last[6]);
}
last = null;
}
}
if (last != null) print_se(last);
file.close();
buf.destroy();
buf2.destroy();
-81
View File
@@ -1,81 +0,0 @@
Bytes.prototype.reverse = function()
{
for (var i = 0; i < this.length>>1; ++i) {
var tmp = this[i];
this[i] = this[this.length - i - 1];
this[this.length - i - 1] = tmp;
}
}
// reverse complement a DNA string
Bytes.prototype.revcomp = function()
{
if (Bytes.rctab == null) {
var s1 = 'WSATUGCYRKMBDHVNwsatugcyrkmbdhvn';
var s2 = 'WSTAACGRYMKVHDBNwstaacgrymkvhdbn';
Bytes.rctab = [];
for (var i = 0; i < 256; ++i) Bytes.rctab[i] = 0;
for (var i = 0; i < s1.length; ++i)
Bytes.rctab[s1.charCodeAt(i)] = s2.charCodeAt(i);
}
for (var i = 0; i < this.length>>1; ++i) {
var tmp = this[this.length - i - 1];
this[this.length - i - 1] = Bytes.rctab[this[i]];
this[i] = Bytes.rctab[tmp];
}
if (this.length&1)
this[this.length>>1] = Bytes.rctab[this[this.length>>1]];
}
if (arguments.length < 2) {
print("Usage: k8 sim-pbsim.js <ref.fa.fai> <pbsim1.maf> [[pbsim2.maf] ...]");
exit(1);
}
var file, buf = new Bytes(), buf2 = new Bytes();
file = new File(arguments[0]);
var chr_list = [];
while (file.readline(buf) >= 0) {
var t = buf.toString().split(/\s+/);
chr_list.push(t[0]);
}
file.close();
for (var k = 1; k < arguments.length; ++k) {
var fn = arguments[k];
file = new File(fn);
var state = 0, reg;
while (file.readline(buf) >= 0) {
var line = buf.toString();
if (state == 0 && line.charAt(0) == 'a') {
state = 1;
} else if (state == 1 && line.charAt(0) == 's') {
var t = line.split(/\s+/);
var st = parseInt(t[2]);
reg = [st, st + parseInt(t[3])];
state = 2;
} else if (state == 2 && line.charAt(0) == 's') {
var m, t = line.split(/\s+/);
if ((m = /S(\d+)_\d+/.exec(t[1])) == null) throw Error("Failed to parse the read name");
var chr_id = parseInt(m[1]) - 1;
if (chr_id >= chr_list.length) throw Error("Index outside the chr list");
var name = [t[1], chr_list[chr_id], reg[0], reg[1], t[4]].join("!");
var seq = t[6].replace(/\-/g, "");
if (seq.length != parseInt(t[5])) throw Error("Inconsistent read length");
if (seq.indexOf("NN") < 0) {
if (t[4] == '-') {
buf2.set(seq, 0);
buf2.length = seq.length;
buf2.revcomp();
seq = buf2.toString();
}
print(">" + name);
print(seq);
}
state = 0;
}
}
file.close();
}
buf.destroy();
buf2.destroy();
-148
View File
@@ -1,148 +0,0 @@
var getopt = function(args, ostr) {
var oli; // option letter list index
if (typeof(getopt.place) == 'undefined')
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
if (getopt.place == -1) { // update scanning pointer
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
getopt.place = -1;
return null;
}
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
++getopt.ind;
getopt.place = -1;
return null;
}
}
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
if (getopt.place < 0) ++getopt.ind;
return '?';
}
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
getopt.arg = null;
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
} else { // need an argument
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
getopt.arg = args[getopt.ind].substr(getopt.place);
else if (args.length <= ++getopt.ind) { // no arg
getopt.place = -1;
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
return '?';
} else getopt.arg = args[getopt.ind]; // white space
getopt.place = -1;
++getopt.ind;
}
return optopt;
}
var colors = ["0,128,255", "255,0,0", "0,192,0"];
function print_lines(a, fmt) {
if (a.length == 0) return;
if (fmt == "bed") {
var n_pri = 0;
for (var i = 0; i < a.length; ++i)
if (a[i][8] == 0) ++n_pri;
if (n_pri > 1) {
for (var i = 0; i < a.length; ++i)
if (a[i][8] == 0) a[i][8] = 1;
} else if (n_pri == 0) {
warn("Warning: " + a[0][3] + " doesn't have a primary alignment");
}
for (var i = 0; i < a.length; ++i) {
a[i][8] = colors[a[i][8]];
print(a[i].join("\t"));
}
}
a.length = 0;
}
function main(args) {
var re = /(\d+)([MIDNSH])/g;
var c, fmt = "bed", fn_name_conv = null;
while ((c = getopt(args, "f:n:")) != null) {
if (c == 'f') fmt = getopt.arg;
else if (c == 'n') fn_name_conv = getopt.arg;
}
if (getopt.ind == args.length) {
warn("Usage: k8 splice2bed.js <in.paf>");
exit(1);
}
var conv = null;
if (fn_name_conv != null) {
conv = new Map();
var file = new File(fn_name_conv);
var buf = new Bytes();
while (file.readline(buf) >= 0) {
var t = buf.toString().split("\t");
conv.put(t[0], t[1]);
}
buf.destroy();
file.close();
}
var file = new File(args[getopt.ind]);
var buf = new Bytes();
var a = [];
while (file.readline(buf) >= 0) {
var line = buf.toString();
if (line.charAt(0) == '@') continue; // skip SAM header lines
var t = line.split("\t");
var is_pri = false, cigar = null, a1;
var qname = conv != null? conv.get(t[0]) : null;
if (qname != null) t[0] = qname;
if (t.length >= 10 && t[4] != '+' && t[4] != '-' && /^\d+/.test(t[1])) { // SAM
var flag = parseInt(t[1]);
if (flag&1) t[0] += '/' + (flag>>6&3);
}
if (a.length && a[0][3] != t[0]) {
print_lines(a, fmt);
a = [];
}
if (t.length >= 12 && (t[4] == '+' || t[4] == '-')) { // PAF
for (var i = 12; i < t.length; ++i) {
if (t[i].substr(0, 5) == 'cg:Z:') {
cigar = t[i].substr(5);
} else if (t[i].substr(0, 5) == 's2:i:') {
is_pri = true;
}
}
a1 = [t[5], t[7], t[8], t[0], Math.floor(t[9]/t[10]*1000), t[4]];
} else if (t.length >= 10) { // SAM
var flag = parseInt(t[1]);
if ((flag&4) || a[2] == '*') continue;
cigar = t[5];
is_pri = (flag&0x100)? false : true;
a1 = [t[2], parseInt(t[3])-1, null, t[0], 1000, (flag&16)? '-' : '+'];
} else {
throw Error("unrecognized input format");
}
if (cigar == null) throw Error("missing CIGAR");
var m, x0 = 0, x = 0, bs = [], bl = [];
while ((m = re.exec(cigar)) != null) {
if (m[2] == 'M' || m[2] == 'D') {
x += parseInt(m[1]);
} else if (m[2] == 'N') {
bs.push(x0);
bl.push(x - x0);
x += parseInt(m[1]);
x0 = x;
}
}
bs.push(x0);
bl.push(x - x0);
// write the BED12 line
if (a1[2] == null) a1[2] = a1[1] + x;
a1.push(a1[1], a1[2]); // thick start/end is the same as start/end
a1.push(is_pri? 0 : 2, bs.length, bl.join(",")+",", bs.join(",")+",");
a.push(a1);
}
print_lines(a, fmt);
buf.destroy();
file.close();
if (conv != null) conv.destroy();
}
main(arguments);
+5 -3
View File
@@ -48,6 +48,7 @@ typedef struct {
double cputime(void);
double realtime(void);
long peakrss(void);
void radix_sort_128x(mm128_t *beg, mm128_t *end);
void radix_sort_64(uint64_t *beg, uint64_t *end);
@@ -62,7 +63,6 @@ void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
void mm_idxopt_init(mm_idxopt_t *opt);
const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n);
int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq);
int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f);
mm128_t *mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int min_cnt, int min_sc, int is_cdna, int n_segs, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km);
mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a);
@@ -75,10 +75,10 @@ int mm_set_sam_pri(int n, mm_reg1_t *r);
void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r, int sub_diff);
void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int *n_, mm_reg1_t *r);
void mm_select_sub_multi(void *km, float pri_ratio, float pri1, float pri2, int max_gap_ref, int min_diff, int best_n, int n_segs, const int *qlens, int *n_, mm_reg1_t *r);
void mm_filter_regs(void *km, const mm_mapopt_t *opt, int *n_regs, mm_reg1_t *regs);
void mm_filter_regs(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs);
void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs, mm128_t *a);
void mm_hit_sort_by_dp(void *km, int *n_regs, mm_reg1_t *r);
void mm_set_mapq(int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr);
void mm_set_mapq(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr);
void mm_est_err(const mm_idx_t *mi, int qlen, int n_regs, mm_reg1_t *regs, const mm128_t *a, int32_t n, const uint64_t *mini_pos);
@@ -86,6 +86,8 @@ mm_seg_t *mm_seg_gen(void *km, uint32_t hash, int n_segs, const int *qlens, int
void mm_seg_free(void *km, int n_segs, mm_seg_t *segs);
void mm_pair(void *km, int max_gap_ref, int dp_bonus, int sub_diff, int match_sc, const int *qlens, int *n_regs, mm_reg1_t **regs);
void mm_err_puts(const char *str);
#ifdef __cplusplus
}
#endif
+31 -5
View File
@@ -1,6 +1,15 @@
#include <stdio.h>
#include "mmpriv.h"
void mm_idxopt_init(mm_idxopt_t *opt)
{
memset(opt, 0, sizeof(mm_idxopt_t));
opt->k = 15, opt->w = 10, opt->flag = 0;
opt->bucket_bits = 14;
opt->mini_batch_size = 50000000;
opt->batch_size = 4000000000ULL;
}
void mm_mapopt_init(mm_mapopt_t *opt)
{
memset(opt, 0, sizeof(mm_mapopt_t));
@@ -24,11 +33,12 @@ void mm_mapopt_init(mm_mapopt_t *opt)
opt->min_join_flank_sc = 1000;
opt->a = 2, opt->b = 4, opt->q = 4, opt->e = 2, opt->q2 = 24, opt->e2 = 1;
opt->zdrop = 400;
opt->zdrop = 400, opt->zdrop_inv = 200;
opt->end_bonus = -1;
opt->min_dp_max = opt->min_chain_score * opt->a;
opt->min_ksw_len = 200;
opt->anchor_ext_len = 20, opt->anchor_ext_shift = 6;
opt->max_clip_ratio = 1.0f;
opt->mini_batch_size = 500000000;
opt->pe_ori = 0; // FF
@@ -41,6 +51,8 @@ void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
opt->flag |= MM_F_SPLICE;
if (opt->mid_occ <= 0)
opt->mid_occ = mm_idx_cal_max_occ(mi, opt->mid_occ_frac);
if (opt->mid_occ < opt->min_mid_occ)
opt->mid_occ = opt->min_mid_occ;
if (mm_verbose >= 3)
fprintf(stderr, "[M::%s::%.3f*%.2f] mid_occ = %d\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), opt->mid_occ);
}
@@ -64,18 +76,27 @@ int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
io->flag |= MM_I_HPC, io->k = 19, io->w = 5;
mo->flag |= MM_F_ALL_CHAINS | MM_F_NO_DIAG | MM_F_NO_DUAL | MM_F_NO_LJOIN;
mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_gap = 10000, mo->max_chain_skip = 25;
mo->bw = 2000;
} else if (strcmp(preset, "map10k") == 0 || strcmp(preset, "map-pb") == 0) {
io->flag |= MM_I_HPC, io->k = 19;
} else if (strcmp(preset, "map-ont") == 0) {
io->flag = 0, io->k = 15;
} else if (strcmp(preset, "asm5") == 0) {
io->flag = 0, io->k = 19, io->w = 19;
mo->a = 1, mo->b = 19, mo->q = 39, mo->q2 = 81, mo->e = 3, mo->e2 = 1, mo->zdrop = 200;
mo->a = 1, mo->b = 19, mo->q = 39, mo->q2 = 81, mo->e = 3, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
mo->min_mid_occ = 100;
mo->min_dp_max = 200;
mo->best_n = 50;
} else if (strcmp(preset, "asm10") == 0) {
io->flag = 0, io->k = 19, io->w = 19;
mo->a = 1, mo->b = 9, mo->q = 16, mo->q2 = 41, mo->e = 2, mo->e2 = 1, mo->zdrop = 200;
mo->a = 1, mo->b = 9, mo->q = 16, mo->q2 = 41, mo->e = 2, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
mo->min_mid_occ = 100;
mo->min_dp_max = 200;
mo->best_n = 50;
} else if (strcmp(preset, "asm20") == 0) {
io->flag = 0, io->k = 19, io->w = 10;
mo->a = 1, mo->b = 4, mo->q = 6, mo->q2 = 26, mo->e = 2, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
mo->min_mid_occ = 100;
mo->min_dp_max = 200;
mo->best_n = 50;
} else if (strcmp(preset, "short") == 0 || strcmp(preset, "sr") == 0) {
@@ -83,7 +104,7 @@ int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
mo->flag |= MM_F_SR | MM_F_FRAG_MODE | MM_F_NO_PRINT_2ND | MM_F_2_IO_THREADS | MM_F_HEAP_SORT;
mo->pe_ori = 0<<1|1; // FR
mo->a = 2, mo->b = 8, mo->q = 12, mo->e = 2, mo->q2 = 24, mo->e2 = 1;
mo->zdrop = 100;
mo->zdrop = mo->zdrop_inv = 100;
mo->end_bonus = 10;
mo->max_frag_len = 800;
mo->max_gap = 100;
@@ -102,7 +123,7 @@ int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
mo->max_gap = 2000, mo->max_gap_ref = mo->bw = 200000;
mo->a = 1, mo->b = 2, mo->q = 2, mo->e = 1, mo->q2 = 32, mo->e2 = 0;
mo->noncan = 9;
mo->zdrop = 200;
mo->zdrop = 200, mo->zdrop_inv = 100; // because mo->a is halved
} else return -1;
return 0;
}
@@ -136,5 +157,10 @@ int mm_check_opt(const mm_idxopt_t *io, const mm_mapopt_t *mo)
fprintf(stderr, "[ERROR]\033[1;31m scoring system violating ({-O}+{-E})+({-O2}+{-E2}) <= 127\033[0m\n");
return -1;
}
if (mo->zdrop < mo->zdrop_inv) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m Z-drop should not be less than inversion-Z-drop\033[0m\n");
return -5;
}
return 0;
}
+24 -5
View File
@@ -34,6 +34,8 @@ The following Python script demonstrates the key functionality of mappy:
import mappy as mp
a = mp.Aligner("test/MT-human.fa") # load or build index
if not a: raise Exception("ERROR: failed to load/build index")
s = a.seq("MT_human", 100, 200) # retrieve a subsequence from the index
print(mp.revcomp(s)) # reverse complement
for name, seq, qual in mp.fastx_read("test/MT-orang.fa"): # read a fasta/q sequence
for hit in a.map(seq): # traverse alignments
print("{}\t{}\t{}\t{}".format(hit.ctg, hit.r_st, hit.r_en, hit.cigar_str))
@@ -87,7 +89,15 @@ This method aligns :code:`seq` against the index. It is a generator, *yielding*
a series of :code:`mappy.Alignment` objects. If :code:`seq2` is present, mappy
performs paired-end alignment, assuming the two ends are in the FR orientation.
Alignments of the two ends can be distinguished by the :code:`read_num` field
(see below).
(see Class mappy.Alignment below).
.. code:: python
mappy.Aligner.seq(name, start=0, end=0x7fffffff)
This method retrieves a (sub)sequence from the index and returns it as a Python
string. :code:`None` is returned if :code:`name` is not present in the index or
the start/end coordinates are invalid.
Class mappy.Alignment
~~~~~~~~~~~~~~~~~~~~~
@@ -139,13 +149,22 @@ the following format:
It is effectively the PAF format without the QueryName and QueryLength columns
(the first two columns in PAF).
Function mappy.fastx_read
~~~~~~~~~~~~~~~~~~~~~~~~~
Miscellaneous Functions
~~~~~~~~~~~~~~~~~~~~~~~
.. code:: python
mappy.fastx_read(fn)
mappy.fastx_read(fn, read_comment=False)
This generator function opens a FASTA/FASTQ file and *yields* a
:code:`(name,seq,qual)` tuple for each sequence entry. The input file may be
optionally gzip'd.
optionally gzip'd. If :code:`read_comment` is True, this generator yields
a :code:`(name,seq,qual,comment)` tuple instead.
.. code:: python
mappy.revcomp(seq)
Return the reverse complement of DNA string :code:`seq`. This function
recognizes IUB code and preserves the letter cases. Uracil :code:`U` is
complemented to :code:`A`.
+29
View File
@@ -101,4 +101,33 @@ static inline mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char *seq1, const
}
}
static inline char *mappy_revcomp(int len, const uint8_t *seq)
{
int i;
char *rev;
rev = (char*)malloc(len + 1);
for (i = 0; i < len; ++i)
rev[len - i - 1] = seq_comp_table[seq[i]];
rev[len] = 0;
return rev;
}
static char *mappy_fetch_seq(const mm_idx_t *mi, const char *name, int st, int en, int *len)
{
int i, rid;
char *s;
*len = 0;
rid = mm_idx_name2id(mi, name);
if (rid < 0) return 0;
if (st >= mi->seq[rid].len || st >= en) return 0;
if (en < 0 || en > mi->seq[rid].len)
en = mi->seq[rid].len;
s = (char*)malloc(en - st + 1);
*len = mm_idx_getseq(mi, rid, st, en, (uint8_t*)s);
for (i = 0; i < *len; ++i)
s[i] = "ACGTN"[(uint8_t)s[i]];
s[*len] = 0;
return s;
}
#endif
+8 -1
View File
@@ -26,13 +26,15 @@ cdef extern from "minimap.h":
int min_join_flank_sc
int a, b, q, e, q2, e2
int noncan
int zdrop
int zdrop, zdrop_inv
int end_bonus
int min_dp_max
int min_ksw_len
int anchor_ext_len, anchor_ext_shift
float max_clip_ratio
int pe_ori, pe_bonus
float mid_occ_frac
int32_t min_mid_occ
int32_t mid_occ
int32_t max_occ
int mini_batch_size
@@ -58,6 +60,7 @@ cdef extern from "minimap.h":
uint32_t *S
mm_idx_bucket_t *B
void *km
void *h
ctypedef struct mm_idx_reader_t:
pass
@@ -68,6 +71,8 @@ cdef extern from "minimap.h":
void mm_idx_destroy(mm_idx_t *mi)
void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
int mm_idx_index_name(mm_idx_t *mi)
#
# Mapping (key struct defined in cmappy.h below)
#
@@ -98,6 +103,7 @@ cdef extern from "cmappy.h":
void mm_reg2hitpy(const mm_idx_t *mi, mm_reg1_t *r, mm_hitpy_t *h)
void mm_free_reg1(mm_reg1_t *r)
mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char *seq1, const char *seq2, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt)
char *mappy_fetch_seq(const mm_idx_t *mi, const char *name, int st, int en, int *l)
ctypedef struct kstring_t:
unsigned l, m
@@ -115,5 +121,6 @@ cdef extern from "cmappy.h":
void mm_fastx_close(kseq_t *ks)
int kseq_read(kseq_t *seq)
char *mappy_revcomp(int l, const uint8_t *seq)
int mm_verbose_level(int v)
void mm_reset_timer()
+42 -5
View File
@@ -1,6 +1,7 @@
from libc.stdint cimport uint8_t, int8_t
from libc.stdlib cimport free
cimport cmappy
import sys
cmappy.mm_reset_timer()
@@ -111,7 +112,7 @@ cdef class Aligner:
if min_chain_score is not None: self.map_opt.min_chain_score = min_chain_score
if min_dp_score is not None: self.map_opt.min_dp_max = min_dp_score
if bw is not None: self.map_opt.bw = bw
if best_n is not None: self.best_n = best_n
if best_n is not None: self.map_opt.best_n = best_n
cdef cmappy.mm_idx_reader_t *r;
if fn_idx_out is None:
@@ -122,6 +123,7 @@ cdef class Aligner:
self._idx = cmappy.mm_idx_reader_read(r, n_threads) # NB: ONLY read the first part
cmappy.mm_idx_reader_close(r)
cmappy.mm_mapopt_update(&self.map_opt, self._idx)
cmappy.mm_idx_index_name(self._idx)
def __dealloc__(self):
if self._idx is not NULL:
@@ -139,8 +141,13 @@ cdef class Aligner:
if self._idx is NULL: return None
if buf is None: b = ThreadBuffer()
else: b = buf
if seq2 is None: regs = cmappy.mm_map_aux(self._idx, str.encode(seq), NULL, &n_regs, b._b, &self.map_opt)
else: regs = cmappy.mm_map_aux(self._idx, str.encode(seq), str.encode(seq2), &n_regs, b._b, &self.map_opt)
_seq = seq if isinstance(seq, bytes) else seq.encode()
if seq2 is None:
regs = cmappy.mm_map_aux(self._idx, _seq, NULL, &n_regs, b._b, &self.map_opt)
else:
_seq2 = seq2 if isinstance(seq2, bytes) else seq2.encode()
regs = cmappy.mm_map_aux(self._idx, _seq, _seq2, &n_regs, b._b, &self.map_opt)
for i in range(n_regs):
cmappy.mm_reg2hitpy(self._idx, &regs[i], &h)
@@ -152,7 +159,24 @@ cdef class Aligner:
cmappy.mm_free_reg1(&regs[i])
free(regs)
def fastx_read(fn):
def seq(self, str name, int start=0, int end=0x7fffffff):
cdef int l
cdef char *s = cmappy.mappy_fetch_seq(self._idx, name.encode(), start, end, &l)
if l == 0: return None
r = s[:l] if isinstance(s, str) else s[:l].decode()
free(s)
return r
@property
def k(self): return self._idx.k
@property
def w(self): return self._idx.w
@property
def n_seq(self): return self._idx.n_seq
def fastx_read(fn, read_comment=False):
cdef cmappy.kseq_t *ks
ks = cmappy.mm_fastx_open(str.encode(fn))
if ks is NULL: return None
@@ -161,9 +185,22 @@ def fastx_read(fn):
else: qual = None
name = ks.name.s if isinstance(ks.name.s, str) else ks.name.s.decode()
seq = ks.seq.s if isinstance(ks.seq.s, str) else ks.seq.s.decode()
yield name, seq, qual
if read_comment:
if ks.comment.l > 0: comment = ks.comment.s if isinstance(ks.comment.s, str) else ks.comment.s.decode()
else: comment = None
yield name, seq, qual, comment
else:
yield name, seq, qual
cmappy.mm_fastx_close(ks)
def revcomp(seq):
l = len(seq)
bseq = seq if isinstance(seq, bytes) else seq.encode()
cdef char *s = cmappy.mappy_revcomp(l, bseq)
r = s[:l] if isinstance(s, str) else s[:l].decode()
free(s)
return r
def verbose(v=None):
if v is None: v = -1
return cmappy.mm_verbose_level(v)
+3 -3
View File
@@ -23,7 +23,7 @@ def readme():
setup(
name = 'mappy',
version = '2.8',
version = '2.10',
url = 'https://github.com/lh3/minimap2',
description = 'Minimap2 python binding',
long_description = readme(),
@@ -39,11 +39,11 @@ setup(
depends = ['minimap.h', 'bseq.h', 'kalloc.h', 'kdq.h', 'khash.h', 'kseq.h', 'ksort.h',
'ksw2.h', 'kthread.h', 'kvec.h', 'mmpriv.h', 'sdust.h',
'python/cmappy.h', 'python/cmappy.pxd'],
extra_compile_args = ['-DHAVE_KALLOC', '-msse4'], # WARNING: ancient x86_64 CPUs don't have SSE4
extra_compile_args = ['-DHAVE_KALLOC', '-msse4.1'], # WARNING: ancient x86_64 CPUs don't have SSE4
include_dirs = ['.'],
libraries = ['z', 'm', 'pthread'])],
classifiers = [
'Development Status :: 4 - Beta',
'Development Status :: 5 - Production/Stable',
'License :: OSI Approved :: MIT License',
'Operating System :: POSIX',
'Programming Language :: C',
+1 -1
View File
@@ -1,4 +1,4 @@
>MT_orang
>MT_orang co:Z:comment
GTTTATGTAGCTTATTCTATCCAAAGCAATGCACTGAAAATGTCTCGACGGGCCCACACG
CCCCATAAACAAATAGGTTTGGTCCTAGCCTTTCTATTAGCTCTTAGTGAGGTTACACAT
GCAAGCATCCCCGCCCCAGTGAGTCGCCCTCCAAGTCACTCTGACTAAGAGGAGCAAGCA
+4
View File
File diff suppressed because one or more lines are too long
+127
View File
@@ -0,0 +1,127 @@
>ref
TGCGGAGGCTGAAGCAACTCCATCTTGGAAGCTAATCTACCATGTTGGCTTCTGATTAAC
ATCAGTTCTGGGAAGGCTTGTAAGATTTCCTGTTTGTCTATTATTTCCTAGGTAAGAGCA
GATACTTACTGTAAATCCTGCCCCTAGATTAAACAACCTTGGTGTTATCGTACTTCCATT
GTCCTATACATCCCTTCGGAATCCCCCTTTCCCTATGGTCCTCAAGCCCTTGGTCTGGGG
AGTAACAGCATAGGGATCAACCATCTCGTCTTGCCACTGCCCGAAATACAGACATGGCTT
CTGTTCCTAAGTCCCTATTCAACTTTTCTTTCTAAGAAACTGGATTTGTCAGCCTCTTTC
TTCACCTCTCAGCTTCCTTGGACTTTGGGGGTAGGTTTGCGTAGACATGCTCACCACAGA
CACAATATCAGCTTCATTCTACAGATGAGGAAGGCAAGCCTTGGGGAGCTTAACCAACTT
GTCGAGACTCATGTATATACCAACACTGAAAAGCAGATATTCCAGACTCCCAGTCATGCC
ACAGGCACACCCCTCAGTGAGAGGTGGGGTTTGTAGTTGAGGCTATTTCCTGCCCAGGGA
GCAGGGAGGCACTCTAGCTTCCCTGAGCTAACGTGGTTCTGCTTGTGTCTGACTTCCAGG
TCTCTGCCCTTTCCAAGCTCACTAGGATGGGCTTCGGGTGTGTCAAATGCCTCAGACAGT
ACAGATCCACACAGAATGGGCATATGCAACCAATCAGTGTCATAAAAAAGAAGGAAATGA
CTCGGGCCCCCTGTGTGTTCAACATGTCGAAGGTATCTGTGCAGCAGAAGAAAGAGGGGC
AAAAGCCCCCAGTGCCACAGGCCAGAGGCAGCAGCTTGGGCCCATGTGGGAGGGTTTGCT
TTCCCCTGCCAAAGTGATGGGCTGCTGCAGCCTGGGGCTTGTGGGAATCCTTCCTGGGCC
TGTGTGGGAAGTGTAGGCAGGGAGAGTGCTGCTTTCCCAAGCTCATCCCAGCTACAGCTA
CCTTTGTGCTCTGGGATTCAGGACCCCCGAGGGGGCTGGCAGGAGAGTCTCTGTTCTCGG
ATGGGTTGTCACCAGGGCATACATGGGAAGTGGGCTCTCTGGAGTCACCCTCCAGGGGAC
AATGCCAATTCCAGACACATTTACTGGAACCCCTACACTGATGACCTTTTGTTGAGGGTT
GAATTATGTCCCCAAAAAAGATACATTGAAGTCCAAACCTCTGGTGTCTATAAATGTGAT
TTTATTTGAAAATGAGGTTTCTATGGACTAAATTGTGTCCCTCCCAAATTCATATTTTGA
AGCCCTAGCCCCCAGTGTGACTATACCTAGAGACAGAGATCTTTAGGAGGTAATTAAGGT
TCAATGAGGTCAGGTGGGTGGGGCCCTAAACCAACAGGAAGGACTGTGGCCTTACTAGAA
AAGGAAGAAAAAGCATTTCCTCTCTTCTAGTATAAAAGGACACAGAAAGAAGGCAGATAT
CTACAAGCCACGAAGAGAGACGTCACTGAGAACTGAATTTGTGTACATTGATCTGGAACT
TCCAGCCTCCAGAACTTGAGAAATACATTTCTGTTGTTTATTTTTTTTTCATGTAATCAA
TTCATTTATCATATATTTATTGAGTGCCTACTATGTGCCAGAGGATACAGCAGTAACAAA
ACTAGGCAAAAATTGTGCCTAAAAGAGGGAAGATGACTTTTCTTAAAGTGTGGAATAAAG
AAAAGTAAGATAGCGGATAGAAGCTTGAAGTGAAAGCAGGTTCACAGGAAGTTTCTTTGG
TCATTTGTTTTGTTTTTAAATAGTGGAAAGATGTATATGTTTATGGAGAAAGATTGCCTT
GAAGATGCAAGAGGAAGAGATGATCAAAATTCAAGAAGAAGCAGAAAGTGATAGAATAAA
GAGCACAAGTGGAGAATTAGTGTTAATGAAAAGAAGGATGCTTCCTTTGATATGAAGTGA
AGGAAGAGAGAATGAGTAAAGACCAAGACTTGAAGTCCCTAGTTTAATAGAGGGAGATTT
CTTCTTTTGATAGCAACAATGGTATTCTGAATTATTTGAAGACATGTCATATTTCTCTTG
TGCCATTTTCCTCCCAGTTTAAACATTCTCATAACCTCTATTCCTCACATGATGTTTTTC
CAGGTCCTTTATTCTTTGGCACTCTCTTCTCTGGACACATTGTATTCTGTCATTGGTCCT
AAAATTTAGATACCCACAATTGAACATACTCCTCTAGATATGGTCTAGCTAATGCAAAAG
AACTGCTGCCTTCCAACTTGTTCAGACATCATATGTTTGTTGTCAAACGCTAAGTTGAGT
TGTTATCTTTTAAGTTTTGTTTTTGTTTTTTTTTTTTTTTTTTAATTCCAAGAGGTGCCC
ACGTTGGCTAAGTACCAAACAGGGTACTAGGGAATTTTACTTCTGAGTTAAATGCCATTC
TAGTTGTTTTTTCTTCATCTCCAGTAAGGTTATCTTTATTCACCAGTTGTTACAATAGCT
GTGGGTCTTGCTTCTCACAGTTTTATGCTGTCTGTGCTATTTTCTCTACTGATCATCACC
ACAATCATTATTGCTTATCATAATTGTTATCTTTATTTTCTCCTTTAATCAAGAATCAGT
CTTCCTTTATCTCATTATTCTCTTTTGCAGGCTTCAGGATAATTATGGTTGGAGTGCACT
GGGGGAACCAGTGCAGCTAAGCTCTGACATCTTTGCATCCCTTTTCCATCTGCTGTTTTG
GCACTCTGGTAGAATAGATAACCTAAAAACGACTTTAAAACATCTAGAAATTTTGGATAA
AATATAACAAACATCCCTTTAAATGCACAACTGATCTTCCATGGAAGTCACAGAAATATA
TAACGCCAAAAAGAAGGGAAGCTGAAACCCAGGGCTGTAAACATGAACATCATCTTCTCT
CCCTTTTTCTTGTGACTTATCTTGTTTTTCTCAGCTTTGGTGCTACCAAGGCTTGACTTT
AATAGGCATTTCCAATCAATGAGAGAATTTCTTTTGCTTTCATCAACAATTCAGTTATTG
ATGTTAACATATATATCATTTGAGTACTTTTCTTTTTTTTATTATTATTATACTTTAAGT
TTTAGGGTCCATGTGCACAATGTGCAGGTTAGTTACGTATGTATACATGTGCCATGCTGG
TGTGCTGCACCCATTAACTCATCATTTAGCATTAGGTATATCTCCTAATGCTATCCCTTC
CCCCTCTCCCCACCCCACAACAGTCCCCAGAGTGTTCCCCTTCCTGTGTCCATGTGTTCT
CATTGTTCAATCCCCATCTATGAGTGAGAACATGCGGTGTTTGGTTTTTTGTCCTTGCAA
TAGTTTACTGAGAATGATGATTTCTAATTTCATCCATGTCCCTAAAGAGCTTCTGCACAG
CAAAAGAAACTACCATCAGAGTGAACAGGCAACCTACAAAATGGGAGAAAATTTTCACAA
CCTGCTCATCTGACAAAGGGCTAATATCCAGAATCTACAATGAACTCAAACAAATTTACA
AGAAAAAAACAAACAACCCCATCAAAAAGTGGGCAAAGGATATGAACAGACACTTCTCAA
AAGAAGACATTTATGCAGCCAAAAGACACATGAAAAAATGCTCATCATCACTGGCCATCA
GAGAAATGCAAACCAAAACCACAATGAGATACCATCTCACACCAGTTAAAATGGCAATCA
TTAAAAAGTCAGGAAACAACAGGTGCTGGAGAGGATGTGGAGAAACAGGAACACTTTTAC
ACTGTTGGTGGGACTGTAAACTAGTTCAACCATTGTGGAAGTCAGTGTGCTGATTCCTCA
GGGATCTAGAACTAGAAATACCATTTGACCCAGCCATCCCATTACTGGGTATATACCCAA
AGGACTATAAATCATGCTGCTATAAAGACACATGCACACGTATGTTTATTGCGGCACTAT
TCACAATAGCAAAGACTTGGAACCAACCCAAATGTCCAACAATGATAGACTGGATTAAGA
AAATGTGGCACATATACACCACGGAATACTGTGCAGCCATAAAAAATGATGAGTTCATGT
CCTTTGTAGGGACACGGATGAAATTGGAAATCATTTCTGTTGTTTAAACCACGAAGTCTA
TGGTATCTGGTTATGACAACCTGAGAATACTAACTCAAGGGTCTTTCGCAGATGTCATTA
AGTTGTTAAAGTGAGGTCATTATGGTGGGTCCTAATCCAAGAGAAGAGATGCATGGACAG
ACGTGCACAACGGGAGGACCAAGCCAAGACACACAGGGAGAATGGCCATGGGAAGATGGA
GGCAGAGATCAAAGTGAGGCACCCACAAGCCAAGAAATGGCAGGAGCTACCAGCAGCTGG
AAGATGCAGAGAAGCATTCCTTCTTAGAGGTTTCAGAGAGAGTATGGTGCTACTGACACC
TTGATTTTGAACTTCTAGTCTCCAGAACTATGAGAGAATAAATTTCTGTTGGTTAAGCCA
TCGAGTTTGTGTAAGTTTGTTATAAGAGCCCTAGGAAATAAACATATCCATTTATTCAGG
AAAGCCTGCTAGAGTGCAAATATTTGGAAAAGATACTACTATGCAAATGTTTGAAAAAGA
TATTGCTCTTGATTCTGCCTTATGGGTTTTTCATTTCTGTAAGCTATTCTCAAAGTTTTG
TTCTTGGACTACTATTGGTAATTAAGACTGCAACATGTTTGGCAACATCAGTTGAGAACT
GTTGCTCTGGGAACGTTTTCGGCAAGCCTCAGCCCTTCTTTTCCCTTGGCTTGCATTGAG
GAGTTAGGTGATACTCTGCTGCTCAGGCCCAGCACCTTTATGGACCGTATTCCCCTGGTG
GAATGACCATCTCTGCTTGCTCTGATTGGCTGTTGGGGTTTTCTAGCATGCCCTATTTAA
TATGTATGATTTATCTCTTACTTCAGTTGGAAGGTACAGTTGCTCTGTAGTTGGCATGCA
GTCATGGTGACTATGAAAATATAAAATAATGTTTTGGTTTACAGACACTTAGAAATAAGT
TGTGTCTCAAAATTGGGTGACTATTCTAGTTATCTGCTACTCAATATCCTTGTGCGAGCC
CTCTTTACCCAGAATCAAACTAAACCATGAGGGGCACTATAGAATGTCACCCCTGGGTCC
AGGATACTATGGGGACTCAGAAGCCAAGCTCCCACTGGGGGATCTAGGGCATGCCCCCAA
GGTAAGATTCCCACCTCTTTGTTCAGCAGGAAGCACCCATCACACAAGGAGGTAGGAATA
AACAAGCATTCGTCAAGAACAAAAGATACAGATGTTCTGCTGGAGCTTGGATACATAGCA
TAAGAGGGAACAGTTCTCACAGGTAAGAGTAAGTTTTCCTCTGGTGGTGACAGTGGGACC
TGTGGGGGAGAGAATTGGGAGTACTGACAGGAAGGCAGAGTGGCTGTCCAAATGAACGGA
TTGTTTGCACATGGCCTTTAGGGCACGTTGTGTTAGCCTTCCATTGCTGCTTATATTAGT
CTGTTTTCACACTGCCCATAAATGCATACCTGAGACTGGATAATTTATAAAGAAAAAGAG
CCTTAATGTACTCATAGTTGCATGTGGCTGGGGAGGCCTCACAATCATGGCAGAAGGTGA
AAGGCACATCTTACATGGAAGCAGACAAGAGAGAATTGAGGACCAAGTGAAAGGGGTTTC
CCCTTATAAAACCATCAGATCACATGAGACTTTTTCACCACCATGAGAACAGTAAGGGGA
AAACTATGCTCATGATTCAATTGTCTCCCACTGGATTCCTCCCACAACACATAGGAATTA
TGGGAGCTAAAATTCAAGATGAGATTTGGGTGAGGACACAGCCAAACCCTATCACTGCTG
TAATCAATTCCCACCAACTTAGTGGCTCGAAACATCACAGATTTATGATCTTATGACGGT
GGAGGTCCCCAAATGGATCTTCTAGGTCTAGAATCAAGGTATCAGCAGACCACTTCTTTT
GGAGGCTCTGGTGGAGAAACCATTTCCTCGCCTTTTCCAGCTTCTAGAGGCTGCCCTTCT
CATTCCTTGGTTCACGGCCACACTCATTTCCATCTCTGCTTCCACTGTGACAACTTCTCT
GCCTCAGACCCTCCTGCTTTGCCTTTGTAAGGACCCTTGTGATGAGATCAGGCCCATCCA
GGATTATCCCTCATCTCAAGACCTTTACCTTAATCACATTTGCAAGGTCTCTTCCACTGT
GTCAGGTAACATTTTCACAGGTTCCAGGGATTAGGGTGTGGACATCTTGGGGAGCTGGAG
GATATTATTTCATCTACCACACACATCTCTACCTTGTACAGGCAAGCACTTGCAAAGTGC
AATGTGATCCTCTGGAGCCACTGTCCTCCCAGAGCTTATATATACTCTGAAAGTCAACTC
TCAGACCACAGCCTCCTGTCCATGCACCACTCTCATCAACACCCCCACCCGAAACACTTT
CACTCCACCCTCTTTGTCCCCTAACTCATGGAGAAGAAAATCTAATTAGTAGGAGTGGAA
TTTGGCTTTCATCTTTACCAGTACTAGAAATATGGTGTGTGTCTTTTTGTAAAAATTCTC
TCAACTAAATTGTTTTTATTAATTTCTGCAAAATGTGAACATCAACTCCCTTCATGTGAA
TGTCAATAAGATTAAATGAGCTGTCTCAGCTCCTAGCCTGTGCAAGCTAACAGCTCAGGA
GATGTTTATTTCTTTCCCTCTTCTTTCCTTAATGAAGCCCTCTCCTTTGACATCTTCAAT
TCTGGAGCGCTTCTTTTCTGAGGCCTTGGCTCCCCCACATTGCCCACCCTTTTCCTGCTC
GTCCACATTTCTGGCTTCTATTCTCTTGTCTTTACCATCTCCCTGAACAATGTTATCCGT
TCCAATGACTTCAACAGTCTCTCCGCTTACATATGATGCCTCTCAAACTCTGATCTCCAA
CTCTTCCAAAGAGCTCTGGACCTTTGTTCCAATTACCTGAAAAACATCTTCTTGGATGTC
CCATTAGCACTGTTAAATCAAACAAGAATTTCCCTCCCTCCTGCCTTGCTGTAGTTCCCC
TAGGGATTCGGTTGTGTGGGAAGATGTGTGGAGAGCTCTTAGTTGACTCCCTTCTCTGCA
GTTCTACCTCTCTAGAGACTTGGAGGACCCACTGTTTCCGCCTCGCTTTTTCAGGCCTAG
AGATTGCTCGCTCCTGGGCTGGCTGCTTCATAATTCCTTATTAGTAGTTTCCCAAGCTTA
CATATCTGTAAATATTTACTTTAGTTAAATTCTCCCCAATTTCCACAATATGTTGGCTGC
ACATGCTTTCTACTAGGAGTCACACAACTATGATAAGAACCAAGAAATATTAGTAAACGT
TTTTTACCATTATTGGCCTATACCCTGGAATAGCCAACAATAACCTAGAACCTATGCAAC
AAGAATATCCAACAAGAACCTAGAGACCTGTCAGTCTATAGGTGGGAACTACAGGATGAG
A
+40 -15
View File
@@ -61,13 +61,6 @@
Volume = {32},
Year = {2016}}
@misc{Suzuki:2016,
title = {Fast and accurate alignment tool for PacBio and Nanopore long reads},
author = {Hajime Suzuki},
journal = {Unpublished},
howpublished = {\href{https://github.com/ocxtal/minialign}{https://github.com/ocxtal/minialign}},
year = {2016}}
@misc{Ruan:2016,
title = {Ultra-fast de novo assembler using long noisy reads},
author = {Jue Ruan},
@@ -172,14 +165,6 @@
Volume = {29},
Year = {2011}}
@article {Suzuki130633,
author = {Suzuki, Hajime and Kasahara, Masahiro},
title = {Acceleration Of Nucleotide Semi-Global Alignment With Adaptive Banded Dynamic Programming},
year = {2017},
note = {doi:10.1101/130633},
publisher = {Cold Spring Harbor Labs Journals},
journal = {bioRxiv}}
@article{Gotoh:1982aa,
Author = {Gotoh, O},
Journal = {J Mol Biol},
@@ -313,3 +298,43 @@
Title = {Assembling large genomes with single-molecule sequencing and locality-sensitive hashing},
Volume = {33},
Year = {2015}}
@article{Gurevich:2013aa,
Author = {Gurevich, Alexey and others},
Journal = {Bioinformatics},
Pages = {1072-5},
Title = {{QUAST}: quality assessment tool for genome assemblies},
Volume = {29},
Year = {2013}}
@article{Li:2010fk,
Author = {Li, Heng and Durbin, Richard},
Journal = {Bioinformatics},
Pages = {589-95},
Title = {Fast and accurate long-read alignment with {Burrows-Wheeler} transform},
Volume = {26},
Year = {2010}}
@article{Marcais:2018aa,
Author = {Mar{\c c}ais, Guillaume and others},
Journal = {PLoS Comput Biol},
Pages = {e1005944},
Title = {{MUMmer4}: A fast and versatile genome alignment system},
Volume = {14},
Year = {2018}}
@article{Li:2009ys,
Author = {Li, Heng and others},
Journal = {Bioinformatics},
Pages = {2078-9},
Title = {The {Sequence Alignment/Map format and SAMtools}},
Volume = {25},
Year = {2009}}
@article{Suzuki:2018aa,
Author = {Suzuki, Hajime and Kasahara, Masahiro},
Journal = {BMC Bioinformatics},
Pages = {45},
Title = {Introducing difference recurrence relations for faster semi-global alignment of long sequences},
Volume = {19},
Year = {2018}}
+123 -61
View File
@@ -1,6 +1,6 @@
\documentclass{bioinfo}
\copyrightyear{2017}
\pubyear{2017}
\copyrightyear{2018}
\pubyear{2018}
\usepackage{graphicx}
\usepackage{hyperref}
@@ -19,7 +19,7 @@
\begin{document}
\firstpage{1}
\title[Aligning nucleotide sequences with minimap2]{Minimap2: versatile pairwise alignment for nucleotide sequences}
\title[Aligning nucleotide sequences with minimap2]{Minimap2: pairwise alignment for nucleotide sequences}
\author[Li]{Heng Li}
\address{Broad Institute, 415 Main Street, Cambridge, MA 02142, USA}
@@ -40,9 +40,10 @@ full-length noisy Direct RNA or cDNA reads, and assembly contigs or closely
related full chromosomes of hundreds of megabases in length. Minimap2 does
split-read alignment, employs concave gap cost for long insertions and
deletions (INDELs) and introduces new heuristics to reduce spurious alignments.
It is 3--4 times faster than mainstream short-read mappers at comparable
accuracy and $\ge$30 times faster at higher accuracy for both genomic and mRNA
reads, surpassing most aligners specialized in one type of alignment.
It is 3--4 times as fast as mainstream short-read mappers at comparable
accuracy, and is $\ge$30 times faster than long-read genomic or cDNA
mappers at higher accuracy, surpassing most aligners specialized in one type of
alignment.
\section{Availability and implementation:}
\href{https://github.com/lh3/minimap2}{https://github.com/lh3/minimap2}
@@ -63,7 +64,7 @@ the thought that 10kb long sequences should be easier to map than 100bp reads
because we can more effectively skip repetitive regions, which are often the
bottleneck of short-read alignment. We confirmed our speculation by achieving
approximate mapping 50 times faster than BWA-MEM~\citep{Li:2016aa}.
\citet{Suzuki130633} extended our work with a fast and novel algorithm on
\citet{Suzuki:2018aa} extended our work with a fast and novel algorithm on
generating base-level alignment, which in turn inspired us to develop minimap2
with added functionality.
@@ -87,12 +88,14 @@ the versatility of minimap2.
Minimap2 follows a typical seed-chain-align procedure as is used by most
full-genome aligners. It collects minimizers~\citep{Roberts:2004fv} of the
reference sequences and indexes them in a hash table. Then for each query
sequence, minimap2 takes query minimizers as \emph{seeds}, finds matches to the
reference, and identifies sets of colinear seeds, which are called
reference sequences and indexes them in a hash table, with the key being the
hash of a minimizer and the value being a list of locations of the minimizer
copies. Then for each query
sequence, minimap2 takes query minimizers as \emph{seeds}, finds exact matches
(i.e. \emph{anchors}) to the reference, and identifies sets of colinear anchors as
\emph{chains}. If base-level alignment is requested, minimap2 applies dynamic
programming (DP) to extend from the ends of chains and to close unseeded
regions between adjacent seeds in chains.
programming (DP) to extend from the ends of chains and to close
regions between adjacent anchors in chains.
Minimap2 uses indexing and seeding algorithms similar to
minimap~\citep{Li:2016aa}, and furthers the predecessor with more accurate
@@ -119,10 +122,13 @@ distance between two anchors is too large); otherwise
\end{equation}
In implementation, a gap of length $l$ costs
\[
\gamma_c(l)=0.01\cdot \bar{w}\cdot|l|+0.5\log_2|l|
\gamma_c(l)=\left\{\begin{array}{ll}
0.01\cdot \bar{w}\cdot|l|+0.5\log_2|l| & (l\not=0) \\
0 & (l=0)
\end{array}\right.
\]
where $\bar{w}$ is the average seed length. For $m$ anchors, directly computing all $f(\cdot)$ with
Eq.~(\ref{eq:chain}) takes $O(m^2)$ time. Although theoretically faster
where $\bar{w}$ is the average seed length. For $N$ anchors, directly computing all $f(\cdot)$ with
Eq.~(\ref{eq:chain}) takes $O(N^2)$ time. Although theoretically faster
chaining algorithms exist~\citep{Abouelhoda:2005aa}, they
are inapplicable to generic gap cost, complex to implement and usually
associated with a large constant. We introduced a simple heuristic to
@@ -132,7 +138,7 @@ We note that if anchor $i$ is chained to $j$, chaining $i$ to a predecessor
of $j$ is likely to yield a lower score. When evaluating Eq.~(\ref{eq:chain}),
we start from anchor $i-1$ and stop the process if we cannot find a better
score after up to $h$ iterations. This approach reduces the average time to
$O(h\cdot m)$. In practice, we can almost always find the optimal chain with
$O(hN)$. In practice, we can almost always find the optimal chain with
$h=50$; even if the heuristic fails, the optimal chain is often close.
\subsubsection{Backtracking}
@@ -146,9 +152,11 @@ in more than one chains.
\subsubsection{Identifying primary chains}\label{sec:primary}
In the absence of copy number changes, each query segment should not be mapped
to two places in the reference. However, chains found at the previous step may
have significant or complete overlaps due to repeats in the reference.
have significant or complete overlaps due to repeats in the reference~\citep{Li:2010fk}.
Minimap2 used the following procedure to identify \emph{primary chains} that do
not greatly overlap on the query. Let $Q$ be an empty set initially. For each
not greatly overlap on the query.
Let $Q$ be an empty set initially. For each
chain from the best to the worst according to their chaining scores: if on the
query, the chain overlaps with a chain in $Q$ by 50\% or higher percentage of
the shorter chain, mark the chain as secondary to the chain in $Q$; otherwise,
@@ -156,6 +164,16 @@ add the chain to $Q$. In the end, $Q$ contains all the primary chains. We did
not choose a more sophisticated data structure (e.g. range tree or k-d tree)
because this step is not the performance bottleneck.
For each primary chain, minimap2 estimates its mapping quality with an
empirical formula:
\[
{\rm mapQ}=40\cdot (1-f_2/f_1)\cdot\min\{1,m/10\}\cdot\log f_1
\]
where $\log$ denotes natural logarithm, $m$ is the number of anchors on the primary chain, $f_1$ is the chaining
score, and $f_2\le f_1$ is the score of the best chain that is secondary to the
primary chain. Intuitively, a chain is assigned to a higher mapping quality if
it is long and its best secondary chain is weak.
\subsubsection{Estimating per-base sequence divergence}
Suppose a query sequence harbors $n$ seeds of length $k$, $m$ of which are
present in a chain. We want to estimate the sequence divergence $\epsilon$
@@ -186,7 +204,7 @@ $0.9$.
\subsubsection{Indexing with homopolymer compressed $k$-mers}
SmartDenovo
(\href{https://github.com/ruanjue/smartdenovo}{https://github.com/ruanjue/smartdenovo};
J Ruan, personal communication) indexes reads with homopolymer-compressed (HPC)
J. Ruan, personal communication) indexes reads with homopolymer-compressed (HPC)
$k$-mers and finds the strategy improves overlap sensitivity for SMRT reads.
Minimap2 adopts the same heuristic.
@@ -199,9 +217,9 @@ To demonstrate the effectiveness of HPC $k$-mers, we performed read overlapping
for the example {\it E. coli} SMRT reads from PBcR~\citep{Berlin:2015xy}, using
different types of $k$-mers. With normal 15bp minimizers per 5bp window,
minimap2 finds 90.9\% of $\ge$2kb overlaps inferred from the read-to-reference
alignment. With HPC 19-mers, minimap2 finds 97.4\% of overlaps. It achieves this
alignment. With HPC 19-mers per 5bp window, minimap2 finds 97.4\% of overlaps. It achieves this
higher sensitivity by indexing 1/3 fewer minimizers, which further helps
performance. HPC-based indexing reduces the sensitivity for ONT reads, though.
performance. HPC-based indexing reduces the sensitivity for current ONT reads, though.
\subsection{Aligning genomic DNA}\label{sec:genomic}
@@ -240,14 +258,14 @@ performance of minimap2. Traditional SSE implementations~\citep{Farrar:2007hs}
based on Eq.~(\ref{eq:ae86}) can achieve 16-way parallelization for short
sequences, but only 4-way parallelization when the peak alignment score reaches
32767. Long sequence alignment may exceed this threshold. Inspired by
\citet{Wu:1996aa} and the following work, \citet{Suzuki130633} proposed a
\citet{Wu:1996aa} and the following work, \citet{Suzuki:2018aa} proposed a
difference-based formulation that lifted this limitation.
In case of 2-piece gap cost, define
\[
\left\{\begin{array}{ll}
u_{ij}\triangleq H_{ij}-H_{i-1,j} & v_{ij}\triangleq H_{ij}-H_{i,j-1} \\
x_{ij}\triangleq E_{i+1,j}-H_{ij} & \tilde{x}_{ij}\triangleq \tilde{E}_{i+1,j}-\tilde{H}_{ij} \\
y_{ij}\triangleq F_{i,j+1}-H_{ij} & \tilde{y}_{ij}\triangleq \tilde{F}_{i,j+1}-\tilde{H}_{ij}
x_{ij}\triangleq E_{i+1,j}-H_{ij} & \tilde{x}_{ij}\triangleq \tilde{E}_{i+1,j}-H_{ij} \\
y_{ij}\triangleq F_{i,j+1}-H_{ij} & \tilde{y}_{ij}\triangleq \tilde{F}_{i,j+1}-H_{ij}
\end{array}\right.
\]
We can transform Eq.~(\ref{eq:ae86}) to
@@ -307,11 +325,11 @@ y_{rt}&=&\max\{0,y_{r-1,t}+u_{r-1,t}-z_{rt}+q\}-q-e\\
\end{equation*}
In this formulation, cells with the same diagonal index $r$ are independent of
each other. This allows us to fully vectorize the computation of all cells on
the same anti-diagonal in one inner loop. It also simplifies banded alignment,
the same anti-diagonal in one inner loop. It also simplifies banded alignment (500bp band width by default),
which would be difficult with striped vectorization~\citep{Farrar:2007hs}.
On the condition that $q+e<\tilde{q}+\tilde{e}$ and $e>\tilde{e}$, the initial
values in the diagonal-antidiagonal formuation is
values in the diagonal-antidiagonal formuation are
\[
\left\{\begin{array}{l}
x_{r-1,-1}=y_{r-1,r}=-q-e\\
@@ -330,12 +348,19 @@ r\cdot(e-\tilde{e})-(\tilde{q}-q)-\tilde{e} & (r=\lceil\frac{\tilde{q}-q}{e-\til
\]
These can be derived from the initial values for Eq.~(\ref{eq:ae86}).
When performing global alignment, we do not need to compute $H_{rt}$ in each cell.
We use 16-way vectorization throughout the alignment process. When extending
alignments from ends of chains, we need to find the cell $(r,t)$ where $H_{rt}$
reaches the maximum. We resort to 4-way vectorization to compute
$H_{rt}=H_{r-1,t}+u_{rt}$. Because this computation is simple,
Eq.~(\ref{eq:suzuki}) is still the dominant performance bottleneck.
In practice, our 16-way vectorized implementation of global alignment is three
times as fast as Parasail's 4-way vectorization~\citep{Daily:2016aa}. Without
banding, our implementation is slower than Edlib~\citep{Sosic:2017aa}, but with
a 1000bp band, it is considerably faster. When performing global alignment
between anchors, we expect the alignment to stay close to the diagonal of the
DP matrix. Banding is applicable most of time.
DP matrix. Banding is applicable most of the time.
\subsubsection{The Z-drop heuristic}
@@ -359,6 +384,16 @@ alignment between the two subsequences involved in the global alignment, but
this time with the one subsequence reverse complemented. This additional
alignment step may identify short inversions that are missed during chaining.
\subsubsection{Filtering out misplaced anchors}
Due to sequencing errors and local homology, some anchors in a chain may be
wrong. If we blindly align regions between two misplaced anchors, we will
produce a suboptimal alignment. To reduce this artifact, we filter out
anchors that lead to a $>$10bp insertion and a $>$10bp deletion at the same
time, and filter out terminal anchors that lead to a long gap towards the ends
of a chain. These heuristics greatly alleviate the issues with misplaced
anchors, but they are unable to fix all such errors. Local misalignment is a
limitation of minimap2 which we hope to address in future.
\subsection{Aligning spliced sequences}
The algorithm described above can be adapted to spliced alignment. In this
@@ -397,7 +432,7 @@ p/2 & \mbox{if $T[i+1,i+3]$ is ${\tt GTC}$ or ${\tt GTT}$} \\
p & \mbox{otherwise}
\end{array}\right.\]
where $T[i,j]$ extracts a substring of $T$ between $i$ and $j$ inclusively.
$d(i)$ penalizes non-canonical donor sites with $p$ and less frequent Eukayotic
$d(i)$ penalizes non-canonical donor sites with $p$ and less frequent Eukaryotic
splicing signal ${\tt GT[C/T]}$ with $p/2$~\citep{Irimia:2008aa}. Similarly,
\[a(i)=\left\{\begin{array}{ll}
0 & \mbox{if $T[i-2,i]$ is ${\tt CAG}$ or ${\tt TAG}$} \\
@@ -424,13 +459,13 @@ alignment.
\subsection{Aligning short paired-end reads}
During chainging, minimap2 takes a pair of reads as one fragment with a gap of
During chaining, minimap2 takes a pair of reads as one fragment with a gap of
unknown length in the middle. It applies a normal gap cost between seeds on the
same read but is a more permissive gap cost between seeds on different reads.
More precisely, the gap cost during chaining is:
More precisely, the gap cost during chaining is ($l\not=0$):
\[
\gamma_c(l)=\left\{\begin{array}{ll}
0.01\cdot\bar{w}\cdot l+0.5\log_2 l & \mbox{if two seeds on the same read} \\
0.01\cdot\bar{w}\cdot |l|+0.5\log_2 |l| & \mbox{if two seeds on the same read} \\
\min\{0.01\cdot\bar{w}\cdot|l|,\log_2|l|\} & \mbox{otherwise}
\end{array}\right.
\]
@@ -443,6 +478,17 @@ consistent paired-end alignments.
\section{Results}
Minimap2 is implemented in the C programming language and comes with APIs in
both C and Python. It is distributed under the MIT license, free to both
commercial and academic uses. Minimap2 uses the same base algorithm for all
applications, but it has to apply different sets of parameters depending on
input data types. Similar to BWA-MEM, minimap2 introduces `presets' that
modify multiple parameters with a simple invocation. Detailed settings
and command-line options can be found in the minimap2 manpage. In addition to
the applications evaluated in the following sections, minimap2 also retains
minimap's functionality to find overlaps between long reads and to search
against large multi-species databases such as \emph{nt} from NCBI.
\subsection{Aligning long genomic reads}\label{sec:long-genomic}
\begin{figure}[!tb]
@@ -450,19 +496,22 @@ consistent paired-end alignments.
\includegraphics[width=.5\textwidth]{roc-color.pdf}
\caption{Evaluation on aligning simulated reads. Simulated reads were mapped
to the primary assembly of human genome GRCh38. A read is considered correctly
mapped if the true position overlaps with the best mapping position by 10\% of
the read length. Read alignments are sorted by mapping quality in the
descending order. For each mapping quality threshold, the fraction of
alignments with mapping quality above the threshold and their error rate are
mapped if its longest alignment overlaps with the true interval, and the
overlap length is $\ge$10\% of the true interval length. Read alignments are
sorted by mapping quality in the descending order. For each mapping quality
threshold, the fraction of alignments (out of the number of input reads) with
mapping quality above the threshold and their error rate are
plotted along the curve. (a) long-read alignment evaluation. 33,088 $\ge$1000bp
reads were simulated using pbsim~\citep{Ono:2013aa} with error profile sampled
from file `m131017\_060208\_42213\_*.1.*' downloaded at
\href{http://bit.ly/chm1p5c3}{http://bit.ly/chm1p5c3}. The N50 read length is
11,628. Aligners were run under the default setting for SMRT reads.
(b) short-read alignment evaluation. 10 million pairs of 150bp reads were
simulated using mason2~\citep{Holtgrewe:2010aa} with option
`\mbox{--illumina-prob-mismatch-scale 2.5}'. Short-read aligners were run under the
default setting except for changing the maximum fragment length to
Kart outputted all alignments at mapping quality 60, so is not shown in the
figure. It mapped nearly all reads with 4.1\% of alignments being wrong, less
accurate than others. (b) short-read alignment evaluation. 10 million pairs of
150bp reads were simulated using mason2~\citep{Holtgrewe:2010aa} with option
`\mbox{--illumina-prob-mismatch-scale 2.5}'. Short-read aligners were run under
the default setting except for changing the maximum fragment length to
800bp.}\label{fig:eval}
\end{figure}
@@ -471,7 +520,7 @@ BLASR~(v1.MC.rc64; \citealp{Chaisson:2012aa}),
BWA-MEM~(v0.7.15; \citealp{Li:2013aa}),
GraphMap~(v0.5.2; \citealp{Sovic:2016aa}),
Kart~(v2.2.5; \citealp{Lin:2017aa}),
minialign~(v0.5.3; \citealp{Suzuki:2016}) and
minialign~(v0.5.3; \href{https://github.com/ocxtal/minialign}{https://github.com/ocxtal/minialign}) and
NGMLR~(v0.2.5; \citealp{Sedlazeck169557}). We excluded rHAT~\citep{Liu:2016ab}
and LAMSA~\citep{Liu:2017aa} because they either
crashed or produced malformatted output. In this evaluation, minimap2 has
@@ -480,11 +529,11 @@ higher mapping accuracy (Fig.~\ref{fig:eval}a). Minimap2 and
NGMLR provide better mapping quality estimate: they rarely give repetitive hits
high mapping quality. Apparently, other aligners may
occasionally miss close suboptimal hits and be overconfident in wrong mappings.
On run time, minialign is slightly faster than minimap2 and Kart. They are over
30 times faster than the rest. Minimap2 consumed 6.1GB memory at the peak,
more than BWA-MEM but less than others.
On run time, minimap2 took 200 CPU seconds, comparable to minialign and Kart, and is over
30 times faster than the rest. Minimap2 consumed 6.8GB memory at the peak,
more than BWA-MEM (5.4GB), similar to NGMLR and less than others.
On real human SMRT reads, the relative performance and sensitivity of
On real human SMRT reads, the relative performance and fraction of mapped reads reported by
these aligners are broadly similar to the metrics on simulated data. We are
unable to provide a good estimate of mapping error rate due to the lack of the
truth. On ONT $\sim$100kb human reads~\citep{Jain128835}, BWA-MEM failed.
@@ -526,7 +575,7 @@ Peak RAM (GByte) & 8.9 & 14.5 & 3.2 & 29.2\vspace{1em}\\
\% approx. introns & 91.8\% & 96.9\% & 92.5\% & 82.4\% \\
\botrule
\end{tabular}
}{Mouse reads (AC:SRR5286960) were mapped to the primary assembly of mouse
}{Mouse cDNA reads (AC:SRR5286960; R9.4 chemistry) were mapped to the primary assembly of mouse
genome GRCm38 with the following tools and command options: minimap2 (`-ax
splice'); GMAP (`-n 0 --min-intronlength 30 --cross-species'); SpAln (`-Q7 -LS
-S3'); STARlong (according to
@@ -535,7 +584,7 @@ compared to the EnsEMBL gene annotation, release 89. A predicted intron
is \emph{novel} if it has no overlaps with any annotated introns. An intron
is \emph{exact} if it is identical to an annotated intron. An intron is
\emph{approximate} if both its 5'- and 3'-end are within 10bp around the ends
of an annotated intron.}
of an annotated intron. Chimeric alignments are defined in the SAM spec~\citep{Li:2009ys}.}
\end{table}
We next aligned real mouse reads~\citep{Byrne:2017aa} with GMAP~(v2017-06-20;
@@ -592,7 +641,7 @@ simulated data set than Bowtie2 and SNAP but less accurate than BWA-MEM
(Fig.~\ref{fig:eval}b). Closer investigation reveals that BWA-MEM achieves
a higher accuracy partly because it tries to locally align a read in a small
region close to its mate. If we disable this feature, BWA-MEM becomes slightly
less accurate than minimap2. We might consider to implement a similar heuristic
less accurate than minimap2. We might implement a similar heuristic
in minimap2 in future.
To evaluate the accuracy of minimap2 on real data, we aligned human reads
@@ -603,19 +652,29 @@ across the whole genome and have been \emph{de novo} assembled with SMRT reads
to high quality. This allowed us to construct an independent truth variant
dataset~\citep{Li223297} for
ERR1341796. In this evaluation, minimap2 has higher SNP false negative rate
(FNR; 2.5\% of minimap2 vs 2.2\% of BWA-MEM), but fewer false positive SNPs per
million bases (FPPM; 3.0 vs 3.9), lower 2--50bp INDEL FNR (7.3\% vs 7.5\%) and
similar INDEL FPPM (both 1.0). Minimap2 is broadly similar to BWA-MEM in the
(FNR; 2.6\% of minimap2 vs 2.3\% of BWA-MEM), but fewer false positive SNPs per
million bases (FPPM; 7.0 vs 8.8), similar INDEL FNR (11.2\% vs 11.3\%) and
similar INDEL FPPM (6.4 vs 6.5). Minimap2 is broadly comparable to BWA-MEM in the
context of small variant calling.
\subsection{Other applications}
\subsection{Aligning long-read assemblies}
Minimap2 retains minimap's functionality to find overlaps between long reads
and to search against large multi-species databases such as \emph{nt} from
NCBI. Minimap2 can also align similar genomes or different assemblies of the
same species. It took 7 wall-clock minutes over 8 CPU cores to align a human
SMRT assembly (AC:GCA\_001297185.1) to GRCh38, over 20 times faster
MUMmer4~\citep{Kurtz:2004zr}.
Minimap2 can align a SMRT assembly (AC:GCA\_001297185.1) against GRCh38 in 7
minutes using 8 CPU cores, over 20 times faster than nucmer from
MUMmer4~\citep{Marcais:2018aa}. With the paftools.js script from the minimap2
package, we called 2.67 million single-base substitutions out of 2.78Gbp
genomic regions. The transition-to-transversion ratio (ts/tv) is 2.01. In
comparison, using MUMmer4's dnadiff pipeline, we called 2.86 million
substitutions in 2.83Gbp at ts/tv=1.87. Given that ts/tv averaged across the
human genome is about 2 but ts/tv averaged over random errors is 0.5, the
minimap2 callset arguably has higher precision at lower sensitivity.
The sample being assembled is a female. Minimap2 still called 201 substitutions
on the Y chromosome. These substitutions all come from one contig aligned at
96.8\% sequence identity. The contig could be a segmental duplication
absent from GRCh38. In constrast, dnadiff called 9070 substitutions on the Y
chromosome across 73 SMRT contigs. This again implies our minimap2-based
pipeline has higher precision.
\section{Discussions}
@@ -633,9 +692,9 @@ involving $>$100kb introns, which was impractically slow ten years ago. The
minimap2 chaining algorithm is fast and highly accurate by itself. In fact,
chaining alone is more accurate than all the other long-read mappers in
Fig.~\ref{fig:eval}a (data not shown). This accuracy helps to reduce downstream
base-level alignment of candidate chains, which is still times slower than
base-level alignment of candidate chains, which is still several times slower than
chaining even with the Suzuki-Kasahara improvement. In addition, taking a
general form, minimap2 chaining can be adapted to non-typical data types such
general form, minimap2 chaining can be adapted to non-typical data types such as
spliced reads and multiple reads per fragment. This gives us the opportunity to
extend the same base algorithm to a variety of use cases.
@@ -647,8 +706,9 @@ k-mers with a hash table instead. Such fixed-length seeds are inferior to
variable-length seeds in theory, but can be computed much more efficiently in
practice. When a query sequence has multiple seed hits, we can afford to skip
highly repetitive seeds without affecting the final accuracy. This further
alleviates the concern with the uniqueness of seeds. Hash table is the ideal
data structure for mapping long query sequences.
alleviates the concern with the seeding uniqueness. At the same time, at low
sequence identity, it is rare to see long seeds anyway. Hash table is the ideal
data structure for mapping long noisy sequences.
\section*{Acknowledgements}
We owe a debt of gratitude to H. Suzuki and M. Kasahara for releasing their
@@ -657,6 +717,8 @@ Schatz, P. Rescheneder and F. Sedlazeck for pointing out the limitation of
BWA-MEM. We are also grateful to minimap2 users who have greatly helped to
suggest features and to fix various issues.
\paragraph{Funding\textcolon} NHGRI 1R01HG010040-01
\bibliography{minimap2}
\end{document}