Compare commits

..
186 Commits
Author SHA1 Message Date
Heng Li 59f23f7579 Release minimap2-2.14 (r883) 2018-11-06 00:03:16 -05:00
Heng Li 5e55e397e9 r882: guard against -E0 (#263) 2018-11-05 23:36:12 -05:00
Heng Li 88c421e8de r881: a recent change reduces sr accuracy 2018-11-05 22:03:59 -05:00
Heng Li 3db5bfe6e5 r880: fixed false wrong FASTA/Q alert 2018-11-05 20:52:07 -05:00
Heng Li 83dfdd5f50 draft release note 2018-11-05 20:07:57 -05:00
Heng Li 8a2b1cd4c9 updated mappy for extra option max_sw_mat 2018-11-05 19:28:44 -05:00
Heng Li 1ede8ca170 r877: renamed cap-sw-mat to cap-sw-mem 2018-11-05 11:46:38 -05:00
Heng Li 13981404e2 r876: skip DP if taking too much RAM (#259) 2018-11-05 11:43:10 -05:00
Heng Li fd64dd26f6 r875: warn given incorrect FASTA/Q
resolves #252
resolves #255
2018-11-05 10:02:44 -05:00
Heng Li 24df95e4b8 r874: don't call x86_simd() so often
This takes a few percent of time in profiler.
2018-11-05 09:20:35 -05:00
Heng Li a8ee48c2ce r873: comforming to C99/C11; resolves #261 2018-11-05 08:25:07 -05:00
Heng Li 09e089c3dc r872: choose the longest isoform 2018-11-04 23:48:50 -05:00
Heng Li e46cbb7d84 r871: print erroneous genes 2018-11-04 20:37:06 -05:00
Heng Li 57ec73ec6c r870: separate <50% and <10% 2018-11-04 19:31:25 -05:00
Heng Li 9e27575387 r869: classify incomplete genes 2018-11-04 19:21:55 -05:00
Heng Li b4ad8d8bf0 added asmgene
improvements coming; not made public yet
2018-11-04 17:24:05 -05:00
Heng Li e315b9fada hidden options to control bp calculation 2018-11-04 16:36:04 -05:00
Heng Li 42baf287a4 r866: fixed a typo; resolves #262 2018-10-30 09:11:55 -04:00
Heng Li 2ceba22a7a fixed a typo in manpage 2018-10-28 11:51:02 -04:00
Heng Li 9ed56b4a25 r860: MD/cs not working with --eqx 2018-10-26 23:23:53 -04:00
Heng Li ecb6c5c36c Document --no-pairing (#256) 2018-10-23 10:00:21 -04:00
Heng Li 377c7099a8 r858: fixed a bug; resolves #254 2018-10-22 22:47:11 -04:00
Heng Li 51e2abfa60 clarify that minimap2 may miss small exons 2018-10-22 11:16:16 -04:00
Heng Li 7b0a49732e r856: wrongly reported for an unrecognized option
Resolved #250
2018-10-19 20:07:14 -04:00
Heng Li 20268a6068 updated the copyright holder 2018-10-18 11:11:17 -04:00
Heng Li d04ac068fd r852: a minor when large --end-bonus is in use
We may use a large --end-bonus to mimic end-to-end alignment. In the short-read
mode, the candidate alignment region may be out of the band, which leads to
truncated alignment.
2018-10-15 21:28:27 -04:00
Heng Li 5d5d392c02 Release minimap2-2.13 (r850) 2018-10-11 13:18:31 -04:00
Heng Li 170863e553 r849: option -P doesn't work
I don't know why I haven't found it at the beginning.
2018-10-04 16:11:59 -04:00
Heng Li 97f97306a4 r847: guard against -N0 2018-09-27 15:13:44 -04:00
Heng Li 1077b7ddc8 r846: added --hard-mask-level for #244 2018-09-27 14:46:26 -04:00
Heng Li c57b59f02f r845: log peak memory 2018-09-23 20:27:49 -04:00
Torsten Seemann 34be359e25 Add -s sample option for VCF output 2018-09-19 18:24:47 -04:00
Heng Li 8b12da8b0f removed a useless dependency (not in repo) 2018-09-17 13:59:25 -04:00
Heng Li c63a33904f r836: fixed an integer overflow
Forgot this one.
2018-09-14 23:29:31 -04:00
Heng Li 70b0fede64 r835: improved help message. Resolved #232 2018-09-14 22:29:25 -04:00
Heng Li 0b681e51e7 Merge remote-tracking branch 'remotes/origin/master' 2018-09-14 22:22:20 -04:00
Heng Li 7d80d6de4a r832: fixed outdated -L. Resolved #231 and #233 2018-09-14 22:21:33 -04:00
Chris Rands 791e89ce0f PEP8 and other minor styles changes 2018-09-12 10:58:56 -04:00
Heng Li 98c48a1c45 Fixed wrong version links in the cookbook 2018-09-03 09:07:34 -04:00
Heng Li 63d397120a removed getopt.c from MANIFEST 2018-09-01 21:30:46 -04:00
Heng Li 7998fe9906 r829: replaced musl's getopt with ketopt 2018-09-01 21:18:02 -04:00
Heng Li 3a119d606f r828: --MD to support spliced alignment 2018-08-22 10:47:45 -04:00
Heng Li a5eafb75f9 Release minimap2-2.12 (r827) 2018-08-06 12:44:39 -04:00
Heng Li 9a567e4b37 allow mappy to change scoring 2018-08-06 09:52:13 -04:00
Heng Li 8e606bcc06 added a -C5 example to Getting Started 2018-08-06 09:08:33 -04:00
Heng Li a1b7219b5d explain added parameters 2018-08-05 21:32:05 -04:00
Heng Li b0f39a1a61 r823: mappy to index a single sequence 2018-08-05 20:57:05 -04:00
Heng Li 5ab6538757 r822: added option --no-end-flt 2018-08-05 19:42:12 -04:00
Heng Li b32296e18f r821: fixed memory when -y is used 2018-07-31 15:14:37 -04:00
Heng Li 99ecdf7b5d mappy to support arm64 (#203) 2018-07-24 23:53:02 -04:00
Heng Li ff9917a1c4 r819: mappy to support cs/MD 2018-07-24 23:29:55 -04:00
Mark Bicknell 8c064a5f29 Fixed mm_idx_is_idx to return the correct result on Windows. 2018-07-17 09:16:33 -04:00
Heng Li 0e137670fc Merge branch 'split' 2018-07-15 22:24:15 -04:00
Heng Li 395c8d678a r815: fixed a memory leak 2018-07-15 22:11:32 -04:00
Heng Li 830da7fa27 r814: resumed versioning 2018-07-15 11:48:14 -04:00
Heng Li a655cbef86 print SAM header; remove tmp files 2018-07-15 11:03:18 -04:00
Heng Li 4b707aac92 working with toy examples 2018-07-15 10:55:00 -04:00
Heng Li 951c0d1d35 apparently mm_append_cigar() wastes some memory 2018-07-14 23:47:44 -04:00
Heng Li 3545e35a42 pairing in the split-idx mode 2018-07-14 23:43:34 -04:00
Heng Li f3417da838 bugfix: unmapped records are duplicated in output 2018-07-14 22:54:05 -04:00
Heng Li e5277dbf5c code backup 2018-07-14 22:52:36 -04:00
Heng Li 1a55227d5a write hits to tmp files (unfinished) 2018-07-14 12:15:10 -04:00
Heng Li 5cfa621b2d use unmapped records 2018-07-07 12:49:15 -05:00
Heng Li a609a07f8c optionally output unmapped query in PAF 2018-07-07 10:26:08 -05:00
Heng Li bcf92b3c46 compute query coverage 2018-07-06 21:52:01 -05:00
Heng Li 097378ab90 reworked break point counting 2018-07-06 09:46:26 -04:00
Heng Li 10bbbe28c5 added asmstat 2018-07-05 13:22:32 -04:00
Hyeshik Chang c92a6866f3 Release the GIL to allow native Python threading. 2018-07-05 08:00:27 -04:00
Maël Kerbiriou 6908dc59a5 --splice implied when searching for splicing sites on single strand 2018-07-05 07:41:26 -04:00
Heng Li 50dae10421 paftools call to show statistics on longer indels 2018-07-03 14:28:09 -04:00
Heng Li 0517972d02 Release minimap2-2.11 (r797) 2018-06-21 00:04:08 -04:00
Heng Li d46e68e6ad r796: don't use ssize_t 2018-06-20 12:45:27 -04:00
Heng Li 2584a4149a r295: use -r2000 for ava-ont, NOT for ava-pb 2018-06-20 12:24:43 -04:00
Heng Li 66674afd09 r794: fixed a bug in seed filtering 2018-06-20 10:26:29 -04:00
Heng Li e9ca0c9dab added __version__; resolved #165
Not sure if this is the right way. Apparently working.
2018-06-19 15:40:26 -04:00
Heng Li 7e6e8ca73f r792: fixed -Wextra warnings and resolved #184 2018-06-19 15:26:58 -04:00
Ilya Kolpakov 408e098859 fix deserialization of zero-length reference names 2018-06-19 14:46:05 -04:00
Ilya Kolpakov 57f37551f8 expose mm_idx_is_idx, mm_idx_load and mm_idx_dump 2018-06-19 14:46:05 -04:00
Ilya Kolpakov 4c66b689c3 fix serialization of empty names in mm_idx_dump 2018-06-19 14:46:05 -04:00
mvdbeek 1bde2cf076 Allow setting max_frag_len on a per alignment level 2018-06-19 14:39:30 -04:00
mvdbeek 31fc0f218a Allow setting max_frag_len parameter in Aligner class 2018-06-19 14:39:30 -04:00
Aaron Wenger 3d3bcc29a8 Fix CIGAR reallocation with --eqx
Fix the logic that calculates the number of CIGAR entries when
match "M" entries are expanded into "=" and "X".  The number
of entries depends not on the number of mismatches but rather
on the number of transitions between "=" to "X".
2018-06-19 14:37:41 -04:00
Hasindu Gamaarachchi 99dcd75f64 added support for 64 bit ARM architectures 2018-06-19 14:28:45 -04:00
Heng Li 154d2caf5b r784: support the =/X CIGAR operators (#156) 2018-05-30 16:11:22 -04:00
Heng Li a3afeec0b2 r783: reverted to r781 (#155) 2018-05-30 15:25:34 -04:00
Heng Li 3573784b4d r782: no mask a chain having long ref ovlp (#155) 2018-05-30 13:53:45 -04:00
Heng Li 872f300955 r781: fixed the buggy heapmerge (resolves #166) 2018-05-30 11:55:14 -04:00
Heng Li d7b61a039e updated citation 2018-05-30 11:11:55 -04:00
Heng Li 248158a3e1 Resolved #168: citing the manpage for cs 2018-05-30 11:03:16 -04:00
Heng Li 9f4309c376 r777: avoid skipping too many seeds 2018-05-11 10:25:18 -04:00
Heng Li 463f9309f9 Merge branch 'hot-fix' into fix-long-gap 2018-05-11 10:13:19 -04:00
Heng Li abe989e355 the previous fix on int overflow is incomplete 2018-05-11 10:12:57 -04:00
Heng Li 881b4ca3a2 r774: Merge branch 'hot-fix' into fix-long-gap 2018-05-11 10:02:17 -04:00
Heng Li 10c6dd2551 r773: fixed an integer overflow 2018-05-11 10:01:23 -04:00
Heng Li 7ec6721c44 r772: option -Y not working 2018-05-11 10:00:11 -04:00
Heng Li e61812ee55 reduced gap len to trigger bad seed filtering 2018-05-01 16:17:21 -04:00
Heng Li 734ac379bb r770: matching N bases not working properly (#155) 2018-04-30 19:55:23 -04:00
Heng Li 759f8e4ac9 r769: filter out seeds breaking long gaps 2018-04-24 15:37:37 -04:00
Heng Li aef7b0744c r768: shortened preset; added dv tag (#25)
Also added asm20 to command line help (#151)
2018-04-24 12:48:54 -04:00
Heng Li 39f836eac8 r767: don't crash when there is no "cg" (#153) 2018-04-24 12:32:37 -04:00
Heng Li cbeb86dad6 Merge remote-tracking branch 'origin/master' 2018-04-10 09:12:26 -04:00
Heng Li 372c90ceb5 r764: fixed incorrect inversion mapq (#148) 2018-04-10 09:11:49 -04:00
apregier 2e2e69107c Small bugfix for paftools.js
The bug resulted in the wrong coverage being printed in some cases.
2018-04-04 16:29:54 -04:00
Heng Li ee4cd089f7 r763: fine control long join flank len (#128) 2018-03-29 14:16:58 -04:00
Heng Li 2d7ec75d50 Release minimap2-2.10 (r761) 2018-03-27 11:45:44 -04:00
Heng Li 7938ed4893 fixed two mappy warnings 2018-03-26 15:12:54 -04:00
Heng Li 4740423afa Merge remote-tracking branch 'origin/master' 2018-03-26 14:37:17 -04:00
Heng Li 1776311a9b updated cookbook 2018-03-26 14:37:02 -04:00
Heng Li c1a3e05cb0 Merge pull request #138 from zingdle/patch-1
Fix typo in README.md
2018-03-26 07:50:39 -04:00
zingdle ecb6703d4a Update README.md
Fix typo.
TD;DR -> TL;DR
2018-03-26 14:54:52 +08:00
Heng Li 0bf97a367b r755: junceval to only evaluate chromosomes 2018-03-24 23:10:06 -04:00
Heng Li 1c504d72e4 r754: option to only change name 2018-03-23 12:27:11 -04:00
Heng Li 5ef9580b17 r753: change bandwidth in ava-ont to 2000bp 2018-03-23 10:15:23 -04:00
Heng Li 08bd2123b6 r752: option to copy comments to output (#136) 2018-03-23 10:04:33 -04:00
Heng Li 8766d286df r751: optionally output MD (#118) 2018-03-22 14:15:33 -04:00
Heng Li 623b5d9d48 r750: check puts() return (#132 & #103) 2018-03-22 11:31:58 -04:00
Heng Li 18659118cd r749: don't print version etc at low verbose 2018-03-22 11:10:55 -04:00
Heng Li d1050f4eaf r748: optionally to use system getopt() (#134) 2018-03-19 11:18:26 -04:00
Heng Li b81d45510e Revision v2 2018-03-16 11:18:06 -04:00
Heng Li d135feb1a5 response to reviewers' comments, round 2 2018-03-15 21:59:57 -04:00
Heng Li 242ff4e91d r745: junceval - recognize "-" as file name 2018-03-15 12:51:46 -04:00
Heng Li 7a0c1316ce added more examples to cookbook 2018-03-12 22:24:22 -04:00
Heng Li 77ebd479f4 r743: added VCF output to "call" 2018-03-12 21:51:31 -04:00
Heng Li e3f226a9d9 working on section "Full-Genome Alignment"
found an apparent bug in paftools.js call. To debug...
2018-03-12 16:12:18 -04:00
Heng Li bdc615c1d4 r741: added --min-occ-floor to improve #107 2018-03-12 14:32:27 -04:00
Heng Li ad1beaf255 backup; not finished 2018-03-12 13:20:25 -04:00
Heng Li de0480ac5b finished section "Read Overlap" 2018-03-12 13:05:51 -04:00
Heng Li f2866533a8 finished "mapping genomic reads" 2018-03-12 12:50:21 -04:00
Heng Li 0173850ef0 don't use bullets - they are hard to read 2018-03-12 12:42:13 -04:00
Heng Li acea3594fb updated cookbook 2018-03-12 12:39:57 -04:00
Heng Li f78a247749 Started to work on a cookbook 2018-03-12 12:00:44 -04:00
Heng Li ccaf12e1a2 r734: removed debugging print in call() 2018-03-09 23:46:21 -05:00
Heng Li 96b132c97d fixed a bug/typo in Aligner.seq() (#126) 2018-03-08 19:12:12 -05:00
Heng Li 70428ca3a8 speedup tag parsing for sam2paf 2018-03-02 10:17:55 -05:00
Heng Li 9aea79d621 faster tag parsing 2018-03-02 10:09:14 -05:00
Heng Li 1770988627 make calling work with sam2paf output 2018-03-02 10:03:06 -05:00
Heng Li 2bfdad34bb minor cleanup to last commit 2018-03-02 01:07:37 -05:00
Heng Li 953766cedd generate cs; not carefully tested 2018-03-02 00:14:55 -05:00
Heng Li dc61301d9f sam2paf cleanup 2018-03-01 21:58:12 -05:00
Heng Li 19e05a099d for clarity 2018-03-01 18:25:29 -05:00
Heng Li 0238caa8b1 clarify minimap2 not working for >2Gbp seq #129 2018-03-01 18:23:40 -05:00
Heng Li a22ebb9836 use SSE compiler flags more precisely (#127) 2018-02-26 09:51:01 -05:00
Heng Li eeb314edd6 Release minimap2-2.9 (r720) 2018-02-24 09:31:09 -05:00
Heng Li 83c57a9d98 r719: fixed bad memory access 2018-02-23 17:27:41 -05:00
Heng Li 24a4808826 r718: retrieve sequence from the index 2018-02-23 10:18:26 -05:00
Heng Li 29ed675ee5 bugfix: in-place revcomp() not working 2018-02-20 11:05:54 -05:00
Heng Li 7dc7097208 added reverse complement 2018-02-20 09:41:25 -05:00
Heng Li f434653432 added peakrss(); not used for now 2018-02-17 20:40:31 -05:00
Heng Li 090361c25b fixed a typo in mappy (#117) 2018-02-16 21:10:57 -05:00
Heng Li e1f18690f6 paftools-r713: fixed bug for cov1 regions 2018-02-16 12:20:46 -05:00
Heng Li 54a42aafe5 keep documents in sync 2018-02-15 17:21:09 -05:00
Heng Li 8fc5f8dc90 r711: assign proper mapq to primary inversions 2018-02-15 14:34:59 -05:00
Heng Li a0d62519c1 r710: fixed incorrect inversion coordinate (#112) 2018-02-15 14:23:42 -05:00
Heng Li b71c01b316 added test data for inversions 2018-02-15 11:04:27 -05:00
Heng Li 1372977a37 r708: implemented double Z-drop thresholds (#112)
When aligning long reads, we would prefer to align through low-quality
regions. This requires a large Z-drop threshold. However, to find small
inversions, we need to use a small Z-drop. This commit address this
conflict with two Z-drop thresholds. When Z-drop exceeds the smaller
threshold, we perform a local alignment to check if there is a potential
inversion. If there is one, we break the alignment; otherwise we break
the alignment only if Z-drop excess the larger threshold.

This commit also fixes a bug that reported wrong coordinates when the
inversion is on the forward strand (#112).
2018-02-15 10:50:49 -05:00
Heng Li c0e0d5d84b r707: bugfix for inversions on rev strand (#112) 2018-02-14 14:09:03 -05:00
Heng Li b328795051 r706: don't segfault upon wrong FASTA/Q (#111)
The lack of robustness cost me several hours to identify.
2018-02-13 10:00:22 -05:00
Heng Li 3b17d62ccd minor doc improvements 2018-02-12 22:27:02 -05:00
Heng Li 874b8c4795 rework misc/README; progressing but unfinished 2018-02-12 22:06:05 -05:00
Heng Li 7ef5490884 r703: added --max-clip-ratio
still testing the option
2018-02-12 13:29:18 -05:00
Heng Li f66de7df59 updated paftools revision number to r702 2018-02-12 11:39:04 -05:00
Heng Li fbbd4e0968 changed output messages for clarity 2018-02-12 11:32:32 -05:00
Heng Li 8c89ba005e merged cnt-feat into paftools 2018-02-12 11:29:42 -05:00
Heng Li 50775a1e6f added liftOver
tested on a few toy examples
2018-02-12 11:12:23 -05:00
Heng Li 87cf650168 r697: fixed wrong #mapped reads in junceval 2018-02-09 18:45:57 -05:00
Heng Li 6e65c5e631 Revision 1 2018-02-09 17:39:02 -05:00
Heng Li a58b05a61b extend the section on genome alignment 2018-02-09 13:59:00 -05:00
Heng Li 42dab6319b don't call SNPs involving 'n' 2018-02-09 13:27:17 -05:00
Heng Li 8428809369 convert MUMmer's delta to PAF 2018-02-09 12:14:28 -05:00
Heng Li 642af5591e merged intron-eval into paftools 2018-02-09 11:07:14 -05:00
Heng Li 2025a6279a merged gff2bed and mapstat to paftools 2018-02-09 10:47:12 -05:00
Heng Li 3465b04724 merged a few converters to paftools 2018-02-09 10:23:30 -05:00
Heng Li 66c5e71fa8 merging scripts into one long script 2018-02-09 10:00:35 -05:00
Heng Li 01560f1db0 Revision v1, to be submitted 2018-02-07 11:07:08 -05:00
Heng Li 39535565ee first round of revision 2018-02-06 16:19:22 -05:00
Heng Li a8d476c6ad r686: end seed trimming don't go over long join 2018-02-06 11:31:32 -05:00
Heng Li 29b4a1786c r685: tune end seed filter again 2018-02-05 11:48:22 -05:00
Heng Li dbf284b2d9 r684: separate end score from min_chain_score 2018-02-05 11:40:38 -05:00
Heng Li 3df5015668 General doc improvements 2018-02-02 21:45:46 -05:00
Heng Li 756379bf83 Documented paf2diff.js (more to come later) 2018-02-02 14:43:58 -05:00
Heng Li 41fd8a966a Documented ov-eval.js 2018-02-02 14:18:18 -05:00
Heng Li 86e4933b1a Added TOC 2018-02-02 14:12:30 -05:00
Heng Li a633a744b6 more doc in misc 2018-02-02 14:07:17 -05:00
Heng Li ddc31f57ba Documented some k8 scripts; more coming 2018-02-02 13:57:08 -05:00
Heng Li 35d3e064bf r677: reduce the change of missing hits
that are close to end of alignments. It is still possible to create examples
that fail the heuristic.
2018-02-02 10:35:33 -05:00
Heng Li 997ab9bb2e Fixed the description of --dual 2018-02-01 15:11:51 -05:00
56 changed files with 5031 additions and 2898 deletions
+2 -1
View File
@@ -1,6 +1,7 @@
The MIT License The MIT License
Copyright (c) 2017 Broad Institute, Inc. Copyright (c) 2018- Dana-Farber Cancer Institute
2017-2018 Broad Institute, Inc.
Permission is hereby granted, free of charge, to any person obtaining Permission is hereby granted, free of charge, to any person obtaining
a copy of this software and associated documentation files (the a copy of this software and associated documentation files (the
+1 -1
View File
@@ -1,9 +1,9 @@
include *.h include *.h
include Makefile include Makefile
include ksw2_dispatch.c include ksw2_dispatch.c
include getopt.c
include main.c include main.c
include README.md include README.md
include sse2neon/emmintrin.h
include python/mappy.c include python/mappy.c
include python/cmappy.h include python/cmappy.h
include python/cmappy.pxd include python/cmappy.pxd
+32 -23
View File
@@ -1,21 +1,25 @@
CFLAGS= -g -Wall -O2 -Wc++-compat CFLAGS= -g -Wall -O2 -Wc++-compat #-Wextra
CPPFLAGS= -DHAVE_KALLOC CPPFLAGS= -DHAVE_KALLOC
INCLUDES= INCLUDES=
OBJS= kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o options.o index.o chain.o align.o hit.o map.o format.o pe.o esterr.o ksw2_ll_sse.o OBJS= kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o options.o index.o chain.o align.o hit.o map.o format.o pe.o esterr.o splitidx.o ksw2_ll_sse.o
PROG= minimap2 PROG= minimap2
PROG_EXTRA= sdust minimap2-lite PROG_EXTRA= sdust minimap2-lite
LIBS= -lm -lz -lpthread LIBS= -lm -lz -lpthread
ifeq ($(arm_neon),) ifeq ($(arm_neon),) # if arm_neon is not defined
ifeq ($(sse2only),) ifeq ($(sse2only),) # if sse2only is not defined
OBJS+=ksw2_extz2_sse41.o ksw2_extd2_sse41.o ksw2_exts2_sse41.o ksw2_extz2_sse2.o ksw2_extd2_sse2.o ksw2_exts2_sse2.o ksw2_dispatch.o OBJS+=ksw2_extz2_sse41.o ksw2_extd2_sse41.o ksw2_exts2_sse41.o ksw2_extz2_sse2.o ksw2_extd2_sse2.o ksw2_exts2_sse2.o ksw2_dispatch.o
else else # if sse2only is defined
OBJS+=ksw2_extz2_sse.o ksw2_extd2_sse.o ksw2_exts2_sse.o OBJS+=ksw2_extz2_sse.o ksw2_extd2_sse.o ksw2_exts2_sse.o
endif endif
else else # if arm_neon is defined
OBJS+=ksw2_extz2_neon.o ksw2_extd2_neon.o ksw2_exts2_neon.o OBJS+=ksw2_extz2_neon.o ksw2_extd2_neon.o ksw2_exts2_neon.o
CFLAGS+=-D_FILE_OFFSET_BITS=64 -mfpu=neon -fsigned-char INCLUDES+=-Isse2neon
INCLUDES+=-I sse2neon ifeq ($(aarch64),) #if aarch64 is not defined
CFLAGS+=-D_FILE_OFFSET_BITS=64 -mfpu=neon -fsigned-char
else #if aarch64 is defined
CFLAGS+=-D_FILE_OFFSET_BITS=64 -fsigned-char
endif
endif endif
.PHONY:all extra clean depend .PHONY:all extra clean depend
@@ -28,8 +32,8 @@ all:$(PROG)
extra:all $(PROG_EXTRA) extra:all $(PROG_EXTRA)
minimap2:main.o getopt.o libminimap2.a minimap2:main.o libminimap2.a
$(CC) $(CFLAGS) main.o getopt.o -o $@ -L. -lminimap2 $(LIBS) $(CC) $(CFLAGS) main.o -o $@ -L. -lminimap2 $(LIBS)
minimap2-lite:example.o libminimap2.a minimap2-lite:example.o libminimap2.a
$(CC) $(CFLAGS) $< -o $@ -L. -lminimap2 $(LIBS) $(CC) $(CFLAGS) $< -o $@ -L. -lminimap2 $(LIBS)
@@ -37,31 +41,36 @@ minimap2-lite:example.o libminimap2.a
libminimap2.a:$(OBJS) libminimap2.a:$(OBJS)
$(AR) -csru $@ $(OBJS) $(AR) -csru $@ $(OBJS)
sdust:sdust.c getopt.o kalloc.o kalloc.h kdq.h kvec.h kseq.h sdust.h sdust:sdust.c kalloc.o kalloc.h kdq.h kvec.h kseq.h ketopt.h sdust.h
$(CC) -D_SDUST_MAIN $(CFLAGS) $< getopt.o kalloc.o -o $@ -lz $(CC) -D_SDUST_MAIN $(CFLAGS) $< kalloc.o -o $@ -lz
# SSE-specific targets on x86/x86_64 # SSE-specific targets on x86/x86_64
ifeq ($(arm_neon),) # if arm_neon is defined, compile this target with the default setting (i.e. no -msse2)
ksw2_ll_sse.o:ksw2_ll_sse.c ksw2.h kalloc.h
$(CC) -c $(CFLAGS) -msse2 $(CPPFLAGS) $(INCLUDES) $< -o $@
endif
ksw2_extz2_sse41.o:ksw2_extz2_sse.c ksw2.h kalloc.h ksw2_extz2_sse41.o:ksw2_extz2_sse.c ksw2.h kalloc.h
$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@ $(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
ksw2_extz2_sse2.o:ksw2_extz2_sse.c ksw2.h kalloc.h ksw2_extz2_sse2.o:ksw2_extz2_sse.c ksw2.h kalloc.h
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@ $(CC) -c $(CFLAGS) -msse2 -mno-sse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
ksw2_extd2_sse41.o:ksw2_extd2_sse.c ksw2.h kalloc.h ksw2_extd2_sse41.o:ksw2_extd2_sse.c ksw2.h kalloc.h
$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@ $(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
ksw2_extd2_sse2.o:ksw2_extd2_sse.c ksw2.h kalloc.h ksw2_extd2_sse2.o:ksw2_extd2_sse.c ksw2.h kalloc.h
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@ $(CC) -c $(CFLAGS) -msse2 -mno-sse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
ksw2_exts2_sse41.o:ksw2_exts2_sse.c ksw2.h kalloc.h ksw2_exts2_sse41.o:ksw2_exts2_sse.c ksw2.h kalloc.h
$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@ $(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
ksw2_exts2_sse2.o:ksw2_exts2_sse.c ksw2.h kalloc.h ksw2_exts2_sse2.o:ksw2_exts2_sse.c ksw2.h kalloc.h
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@ $(CC) -c $(CFLAGS) -msse2 -mno-sse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
ksw2_dispatch.o:ksw2_dispatch.c ksw2.h ksw2_dispatch.o:ksw2_dispatch.c ksw2.h
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@ $(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
# NEON-specific targets on ARM # NEON-specific targets on ARM
@@ -90,7 +99,6 @@ chain.o: minimap.h mmpriv.h bseq.h kalloc.h
esterr.o: mmpriv.h minimap.h bseq.h esterr.o: mmpriv.h minimap.h bseq.h
example.o: minimap.h kseq.h example.o: minimap.h kseq.h
format.o: kalloc.h mmpriv.h minimap.h bseq.h format.o: kalloc.h mmpriv.h minimap.h bseq.h
getopt.o: getopt.h
hit.o: mmpriv.h minimap.h bseq.h kalloc.h khash.h hit.o: mmpriv.h minimap.h bseq.h kalloc.h khash.h
index.o: kthread.h bseq.h minimap.h mmpriv.h kvec.h kalloc.h khash.h index.o: kthread.h bseq.h minimap.h mmpriv.h kvec.h kalloc.h khash.h
kalloc.o: kalloc.h kalloc.o: kalloc.h
@@ -99,11 +107,12 @@ ksw2_exts2_sse.o: ksw2.h kalloc.h
ksw2_extz2_sse.o: ksw2.h kalloc.h ksw2_extz2_sse.o: ksw2.h kalloc.h
ksw2_ll_sse.o: ksw2.h kalloc.h ksw2_ll_sse.o: ksw2.h kalloc.h
kthread.o: kthread.h kthread.o: kthread.h
main.o: bseq.h minimap.h mmpriv.h getopt.h main.o: bseq.h minimap.h mmpriv.h ketopt.h
map.o: kthread.h kvec.h kalloc.h sdust.h mmpriv.h minimap.h bseq.h khash.h map.o: kthread.h kvec.h kalloc.h sdust.h mmpriv.h minimap.h bseq.h khash.h
map.o: ksort.h map.o: ksort.h
misc.o: mmpriv.h minimap.h bseq.h ksort.h misc.o: mmpriv.h minimap.h bseq.h ksort.h
options.o: mmpriv.h minimap.h bseq.h options.o: mmpriv.h minimap.h bseq.h
pe.o: mmpriv.h minimap.h bseq.h kvec.h kalloc.h ksort.h pe.o: mmpriv.h minimap.h bseq.h kvec.h kalloc.h ksort.h
sdust.o: kalloc.h kdq.h kvec.h sdust.h sdust.o: kalloc.h kdq.h kvec.h ketopt.h sdust.h
sketch.o: kvec.h kalloc.h mmpriv.h minimap.h bseq.h sketch.o: kvec.h kalloc.h mmpriv.h minimap.h bseq.h
splitidx.o: mmpriv.h minimap.h bseq.h
+198
View File
@@ -1,3 +1,201 @@
Release 2.14-r883 (5 November 2018)
-----------------------------------
Notable changes:
* Fixed two minor bugs caused by typos (#254 and #266).
* Fixed a bug that made minimap2 abort when --eqx was used together with --MD
or --cs (#257).
* Added --cap-sw-mem to cap the size of DP matrices (#259). Base alignment may
take a lot of memory in the splicing mode. This may lead to issues when we
run minimap2 on a cluster with a hard memory limit. The new option avoids
unlimited memory usage at the cost of missing a few long introns.
* Conforming to C99 and C11 when possible (#261).
* Warn about malformatted FASTA or FASTQ (#252 and #255).
This release occasionally produces base alignments different from v2.13. The
overall alignment accuracy remain similar.
(2.14: 5 November 2018, r883)
Release 2.13-r850 (11 October 2018)
-----------------------------------
Changes to minimap2:
* Fixed wrongly formatted SAM when -L is in use (#231 and #233).
* Fixed an integer overflow in rare cases.
* Added --hard-mask-level to fine control split alignments (#244).
* Made --MD work with spliced alignment (#139).
* Replaced musl's getopt with ketopt for portability.
* Log peak memory usage on exit.
This release should produce alignments identical to v2.12 and v2.11.
(2.13: 11 October 2018, r850)
Release 2.12-r827 (6 August 2018)
---------------------------------
Changes to minimap2:
* Added option --split-prefix to write proper alignments (correct mapping
quality and clustered query sequences) given a multi-part index (#141 and
#189; mostly by @hasindu2008).
* Fixed a memory leak when option -y is in use.
Changes to mappy:
* Support the MD/cs tag (#183 and #203).
* Allow mappy to index a single sequence, to add extra flags and to change the
scoring system.
Minimap2 should produce alignments identical to v2.11.
(2.12: 6 August 2018, r827)
Release 2.11-r797 (20 June 2018)
--------------------------------
Changes to minimap2:
* Improved alignment accuracy in low-complexity regions for SV calling. Thank
@armintoepfer for multiple offline examples.
* Added option --eqx to encode sequence match/mismatch with the =/X CIGAR
operators (#156, #157 and #175).
* When compiled with VC++, minimap2 generated wrong alignments due to a
comparison between a signed integer and an unsigned integer (#184). Also
fixed warnings reported by "clang -Wextra".
* Fixed incorrect anchor filtering due to a missing 64- to 32-bit cast.
* Fixed incorrect mapping quality for inversions (#148).
* Fixed incorrect alignment involving ambiguous bases (#155).
* Fixed incorrect presets: option `-r 2000` is intended to be used with
ava-ont, not ava-pb. The bug was introduced in 2.10.
* Fixed a bug when --for-only/--rev-only is used together with --sr or
--heap-sort=yes (#166).
* Fixed option -Y that was not working in the previous releases.
* Added option --lj-min-ratio to fine control the alignment of long gaps
found by the "long-join" heuristic (#128).
* Exposed `mm_idx_is_idx`, `mm_idx_load` and `mm_idx_dump` C APIs (#177).
Also fixed a bug when indexing without reference names (this feature is not
exposed to the command line).
Changes to mappy:
* Added `__version__` (#165).
* Exposed the maximum fragment length parameter to mappy (#174).
Changes to paftools:
* Don't crash when there is no "cg" tag (#153).
* Fixed wrong coverage report by "paftools.js call" (#145).
This version may produce slightly different base-level alignment. The overall
alignment statistics should remain similar.
(2.11: 20 June 2018, r797)
Release 2.10-r761 (27 March 2018)
---------------------------------
Changes to minimap2:
* Optionally output the MD tag for compatibility with existing tools (#63,
#118 and #137).
* Use SSE compiler flags more precisely to prevent compiling errors on certain
machines (#127).
* Added option --min-occ-floor to set a minimum occurrence threshold. Presets
intended for assembly-to-reference alignment set this option to 100. This
option alleviates issues with regions having high copy numbers (#107).
* Exit with non-zero code on file writing errors (e.g. disk full; #103 and
#132).
* Added option -y to copy FASTA/FASTQ comments in query sequences to the
output (#136).
* Added the asm20 preset for alignments between genomes at 5-10% sequence
divergence.
* Changed the band-width in the ava-ont preset from 500 to 2000. Oxford
Nanopore reads may contain long deletion sequencing errors that break
chaining.
Changes to mappy, the Python binding:
* Fixed a typo in Align.seq() (#126).
Changes to paftools.js, the companion script:
* Command sam2paf now converts the MD tag to cs.
* Support VCF output for assembly-to-reference variant calling (#109).
This version should produce identical alignment for read overlapping, RNA-seq
read mapping, and genomic read mapping. We have also added a cook book to show
the variety uses of minimap2 on real datasets. Please see cookbook.md in the
minimap2 source code directory.
(2.10: 27 March 2017, r761)
Release 2.9-r720 (23 February 2018)
-----------------------------------
This release fixed multiple minor bugs.
* Fixed two bugs that lead to incorrect inversion alignment. Also improved the
sensitivity to small inversions by using double Z-drop cutoff (#112).
* Fixed an issue that may cause the end of a query sequence unmapped (#104).
* Added a mappy API to retrieve sequences from the index (#126) and to reverse
complement DNA sequences. Fixed a bug where the `best_n` parameter did not
work (#117).
* Avoided segmentation fault given incorrect FASTQ input (#111).
* Combined all auxiliary javascripts to paftools.js. Fixed several bugs in
these scripts at the same time.
(2.9: 24 February 2018, r720)
Release 2.8-r672 (1 February 2018) Release 2.8-r672 (1 February 2018)
---------------------------------- ----------------------------------
+32 -32
View File
@@ -14,9 +14,11 @@ cd minimap2 && make
# use presets (no test data) # use presets (no test data)
./minimap2 -ax map-pb ref.fa pacbio.fq.gz > aln.sam # PacBio genomic reads ./minimap2 -ax map-pb ref.fa pacbio.fq.gz > aln.sam # PacBio genomic reads
./minimap2 -ax map-ont ref.fa ont.fq.gz > aln.sam # Oxford Nanopore genomic reads ./minimap2 -ax map-ont ref.fa ont.fq.gz > aln.sam # Oxford Nanopore genomic reads
./minimap2 -ax asm20 ref.fa pacbio-ccs.fq.gz > aln.sam # PacBio CCS genomic reads
./minimap2 -ax sr ref.fa read1.fa read2.fa > aln.sam # short genomic paired-end reads ./minimap2 -ax sr ref.fa read1.fa read2.fa > aln.sam # short genomic paired-end reads
./minimap2 -ax splice ref.fa rna-reads.fa > aln.sam # spliced long reads ./minimap2 -ax splice ref.fa rna-reads.fa > aln.sam # spliced long reads (strand unknown)
./minimap2 -ax splice -k14 -uf ref.fa reads.fa > aln.sam # Nanopore Direct RNA-seq ./minimap2 -ax splice -uf -k14 ref.fa reads.fa > aln.sam # noisy Nanopore Direct RNA-seq
./minimap2 -ax splice -uf -C5 ref.fa query.fa > aln.sam # Final PacBio Iso-seq or traditional cDNA
./minimap2 -cx asm5 asm1.fa asm2.fa > aln.paf # intra-species asm-to-asm alignment ./minimap2 -cx asm5 asm1.fa asm2.fa > aln.paf # intra-species asm-to-asm alignment
./minimap2 -x ava-pb reads.fa reads.fa > overlaps.paf # PacBio read overlap ./minimap2 -x ava-pb reads.fa reads.fa > overlaps.paf # PacBio read overlap
./minimap2 -x ava-ont reads.fa reads.fa > overlaps.paf # Nanopore read overlap ./minimap2 -x ava-ont reads.fa reads.fa > overlaps.paf # Nanopore read overlap
@@ -38,7 +40,7 @@ man ./minimap2.1
- [Advanced features](#advanced) - [Advanced features](#advanced)
- [Working with >65535 CIGAR operations](#long-cigar) - [Working with >65535 CIGAR operations](#long-cigar)
- [The cs optional tag](#cs) - [The cs optional tag](#cs)
- [Evaluation scripts](#eval) - [Working with the PAF format](#paftools)
- [Algorithm overview](#algo) - [Algorithm overview](#algo)
- [Getting help](#help) - [Getting help](#help)
- [Citing minimap2](#cite) - [Citing minimap2](#cite)
@@ -61,16 +63,16 @@ mainstream long-read mappers such as BLASR, BWA-MEM, NGMLR and GMAP. It is more
accurate on simulated long reads and produces biologically meaningful alignment accurate on simulated long reads and produces biologically meaningful alignment
ready for downstream analyses. For >100bp Illumina short reads, minimap2 is ready for downstream analyses. For >100bp Illumina short reads, minimap2 is
three times as fast as BWA-MEM and Bowtie2, and as accurate on simulated data. three times as fast as BWA-MEM and Bowtie2, and as accurate on simulated data.
Detailed evaluations are available from the [minimap2 preprint][preprint]. Detailed evaluations are available from the [minimap2 paper][doi] or the
[preprint][preprint].
### <a name="install"></a>Installation ### <a name="install"></a>Installation
Minimap2 is optimized for x86-64 CPUs. You can acquire precompiled binaries from Minimap2 is optimized for x86-64 CPUs. You can acquire precompiled binaries from
the [release page][release] with: the [release page][release] with:
```sh ```sh
curl -L https://github.com/lh3/minimap2/releases/download/v2.8/minimap2-2.8_x64-linux.tar.bz2 \ curl -L https://github.com/lh3/minimap2/releases/download/v2.14/minimap2-2.14_x64-linux.tar.bz2 | tar -jxvf -
| tar -jxvf - ./minimap2-2.14_x64-linux/minimap2
./minimap2-2.8_x64-linux/minimap2
``` ```
If you want to compile from the source, you need to have a C compiler, GNU make If you want to compile from the source, you need to have a C compiler, GNU make
and zlib development files installed. Then type `make` in the source code and zlib development files installed. Then type `make` in the source code
@@ -78,7 +80,7 @@ directory to compile. If you see compilation errors, try `make sse2only=1`
to disable SSE4 code, which will make minimap2 slightly slower. to disable SSE4 code, which will make minimap2 slightly slower.
Minimap2 also works with ARM CPUs supporting the NEON instruction sets. To Minimap2 also works with ARM CPUs supporting the NEON instruction sets. To
compile, use `make arm_neon=1`. compile for 32 bit ARM architectures (such as ARMv7), use `make arm_neon=1`. To compile for for 64 bit ARM architectures (such as ARMv8), use `make arm_neon=1 aarch64=1`.
### <a name="general"></a>General usage ### <a name="general"></a>General usage
@@ -137,7 +139,7 @@ Nanopore reads.
#### <a name="map-long-splice"></a>Map long mRNA/cDNA reads #### <a name="map-long-splice"></a>Map long mRNA/cDNA reads
```sh ```sh
minimap2 -ax splice -uf ref.fa iso-seq.fq > aln.sam # PacBio Iso-seq/traditional cDNA minimap2 -ax splice -uf -C5 ref.fa iso-seq.fq > aln.sam # PacBio Iso-seq/traditional cDNA
minimap2 -ax splice ref.fa nanopore-cdna.fa > aln.sam # Nanopore 2D cDNA-seq minimap2 -ax splice ref.fa nanopore-cdna.fa > aln.sam # Nanopore 2D cDNA-seq
minimap2 -ax splice -uf -k14 ref.fa direct-rna.fq > aln.sam # Nanopore Direct RNA-seq minimap2 -ax splice -uf -k14 ref.fa direct-rna.fq > aln.sam # Nanopore Direct RNA-seq
minimap2 -ax splice --splice-flank=no SIRV.fa SIRV-seq.fa # mapping against SIRV control minimap2 -ax splice --splice-flank=no SIRV.fa SIRV-seq.fa # mapping against SIRV control
@@ -229,7 +231,7 @@ sorting) still work with such BAM records; tools that read CIGAR will
effectively ignore these records. It has been decided that future tools will effectively ignore these records. It has been decided that future tools will
will seamlessly recognize long-cigar records generated by option `-L`. will seamlessly recognize long-cigar records generated by option `-L`.
**TD;DR**: if you work with ultra-long reads and use tools that only process **TL;DR**: if you work with ultra-long reads and use tools that only process
BAM files, please add option `-L`. BAM files, please add option `-L`.
#### <a name="cs"></a>The cs optional tag #### <a name="cs"></a>The cs optional tag
@@ -254,28 +256,17 @@ similar to the `MD` SAM tag but is standalone and easier to parse.
If `--cs=long` is used, the `cs` string also contains identical sequences in If `--cs=long` is used, the `cs` string also contains identical sequences in
the alignment. The above example will become the alignment. The above example will become
`=CGATCG-ata=AATAGAGTAG+gtc=GAAT*at=GCA`. The long form of `cs` encodes both `=CGATCG-ata=AATAGAGTAG+gtc=GAAT*at=GCA`. The long form of `cs` encodes both
reference and query sequences in one string. reference and query sequences in one string. The `cs` tag also encodes intron
positions and splicing signals (see the [minimap2 manpage][manpage-cs] for
details).
#### <a name="eval"></a>Evaluation scripts #### <a name="paftools"></a>Working with the PAF format
Minimap2 comes with several (java)scripts for evaluating the accuracy of Minimap2 also comes with a (java)script [paftools.js](misc/paftools.js) that
minimap2. These scripts require the [k8][k8] javascript shell to run. processes alignments in the PAF format. It calls variants from
Recent minimap2 binary release tar-balls contain a copy of k8 executable, a assembly-to-reference alignment, lifts over BED files based on alignment,
single file. Here are a few examples on how to use these scripts: converts between formats and provides utilities for various evaluations. For
details, please see [misc/README.md](misc/README.md).
```sh
# Generate reads from PBSIM alignment (truth encoded in read names)
k8 misc/sim-pbsim.js ref.fa.fai pbsim-aln.maf > pbsim-reads.fq
# Generate reads from mason2 alignment (not tested for simulated SVs)
k8 misc/sim-mason2.js mason2-aln.sam > mason2-reads.fq
# Evaluate mapping accuracy with ROC-like curve
k8 misc/sim-eval.js my-aln.sam.gz > result.txt
k8 misc/sim-eval.js my-aln.paf.gz > result.txt
# Collect alignment statistics
k8 misc/mapstat.js my-aln.sam > result.txt
# Compare spliced junctions to existing gene annotations
k8 misc/intron-eval.js anno.gtf my-spliced-aln.sam > result.txt
```
### <a name="algo"></a>Algorithm overview ### <a name="algo"></a>Algorithm overview
@@ -330,9 +321,10 @@ There is not a specific mailing list for the time being.
### <a name="cite"></a>Citing minimap2 ### <a name="cite"></a>Citing minimap2
If you use minimap2 in your work, please consider to cite: If you use minimap2 in your work, please cite:
> Li, H. (2017). Minimap2: fast pairwise alignment for long nucleotide sequences. [arXiv:1708.01492][preprint] > Li, H. (2018). Minimap2: pairwise alignment for nucleotide sequences.
> Bioinformatics. [doi:10.1093/bioinformatics/bty191][doi]
## <a name="dguide"></a>Developers' Guide ## <a name="dguide"></a>Developers' Guide
@@ -359,6 +351,12 @@ mappy` or [from BioConda][mappyconda] via `conda install -c bioconda mappy`.
possible to add non-SIMD support, but it would make minimap2 slower by possible to add non-SIMD support, but it would make minimap2 slower by
several times. several times.
* Minimap2 does not work with a single query or database sequence ~2
billion bases or longer (2,147,483,647 to be exact). The total length of all
sequences can well exceed this threshold.
* Minimap2 often misses small exons.
[paf]: https://github.com/lh3/miniasm/blob/master/PAF.md [paf]: https://github.com/lh3/miniasm/blob/master/PAF.md
@@ -375,3 +373,5 @@ mappy` or [from BioConda][mappyconda] via `conda install -c bioconda mappy`.
[issue]: https://github.com/lh3/minimap2/issues [issue]: https://github.com/lh3/minimap2/issues
[k8]: https://github.com/attractivechaos/k8 [k8]: https://github.com/attractivechaos/k8
[manpage]: https://lh3.github.io/minimap2/minimap2.html [manpage]: https://lh3.github.io/minimap2/minimap2.html
[manpage-cs]: https://lh3.github.io/minimap2/minimap2.html#10
[doi]: https://doi.org/10.1093/bioinformatics/bty191
+233 -66
View File
@@ -6,18 +6,19 @@
#include "mmpriv.h" #include "mmpriv.h"
#include "ksw2.h" #include "ksw2.h"
static void ksw_gen_simple_mat(int m, int8_t *mat, int8_t a, int8_t b) static void ksw_gen_simple_mat(int m, int8_t *mat, int8_t a, int8_t b, int8_t sc_ambi)
{ {
int i, j; int i, j;
a = a < 0? -a : a; a = a < 0? -a : a;
b = b > 0? -b : b; b = b > 0? -b : b;
sc_ambi = sc_ambi > 0? -sc_ambi : sc_ambi;
for (i = 0; i < m - 1; ++i) { for (i = 0; i < m - 1; ++i) {
for (j = 0; j < m - 1; ++j) for (j = 0; j < m - 1; ++j)
mat[i * m + j] = i == j? a : b; mat[i * m + j] = i == j? a : b;
mat[i * m + m - 1] = 0; mat[i * m + m - 1] = sc_ambi;
} }
for (j = 0; j < m; ++j) for (j = 0; j < m; ++j)
mat[(m - 1) * m + j] = 0; mat[(m - 1) * m + j] = sc_ambi;
} }
static inline void mm_seq_rev(uint32_t len, uint8_t *seq) static inline void mm_seq_rev(uint32_t len, uint8_t *seq)
@@ -28,45 +29,70 @@ static inline void mm_seq_rev(uint32_t len, uint8_t *seq)
t = seq[i], seq[i] = seq[len - 1 - i], seq[len - 1 - i] = t; t = seq[i], seq[i] = seq[len - 1 - i], seq[len - 1 - i] = t;
} }
static inline int test_zdrop_aux(int32_t score, int i, int j, int32_t *max, int *max_i, int *max_j, int e, int zdrop) static inline void update_max_zdrop(int32_t score, int i, int j, int32_t *max, int *max_i, int *max_j, int e, int *max_zdrop, int pos[2][2])
{ {
if (score < *max) { if (score < *max) {
int li = i - *max_i; int li = i - *max_i;
int lj = j - *max_j; int lj = j - *max_j;
int diff = li > lj? li - lj : lj - li; int diff = li > lj? li - lj : lj - li;
if (*max - score > zdrop + diff * e) int z = *max - score - diff * e;
return 1; if (z > *max_zdrop) {
*max_zdrop = z;
pos[0][0] = *max_i, pos[0][1] = i + 1;
pos[1][0] = *max_j, pos[1][1] = j + 1;
}
} else *max = score, *max_i = i, *max_j = j; } else *max = score, *max_i = i, *max_j = j;
return 0;
} }
static int mm_check_zdrop(const uint8_t *qseq, const uint8_t *tseq, uint32_t n_cigar, uint32_t *cigar, const int8_t *mat, int8_t q, int8_t e, int zdrop) static int mm_test_zdrop(void *km, const mm_mapopt_t *opt, const uint8_t *qseq, const uint8_t *tseq, uint32_t n_cigar, uint32_t *cigar, const int8_t *mat)
{ {
uint32_t k; uint32_t k;
int32_t score = 0, max = 0, max_i = -1, max_j = -1, i = 0, j = 0; int32_t score = 0, max = INT32_MIN, max_i = -1, max_j = -1, i = 0, j = 0, max_zdrop = 0;
for (k = 0; k < n_cigar; ++k) { int pos[2][2] = {{-1, -1}, {-1, -1}}, q_len, t_len;
// find the score and the region where score drops most along diagonal
for (k = 0, score = 0; k < n_cigar; ++k) {
uint32_t l, op = cigar[k]&0xf, len = cigar[k]>>4; uint32_t l, op = cigar[k]&0xf, len = cigar[k]>>4;
if (op == 0) { if (op == 0) {
for (l = 0; l < len; ++l) { for (l = 0; l < len; ++l) {
score += mat[tseq[i + l] * 5 + qseq[j + l]]; score += mat[tseq[i + l] * 5 + qseq[j + l]];
if (test_zdrop_aux(score, i+l, j+l, &max, &max_i, &max_j, e, zdrop)) return 1; update_max_zdrop(score, i+l, j+l, &max, &max_i, &max_j, opt->e, &max_zdrop, pos);
} }
i += len, j += len; i += len, j += len;
} else if (op == 1) { } else if (op == 1 || op == 2 || op == 3) {
score -= q + e * len, j += len; score -= opt->q + opt->e * len;
if (test_zdrop_aux(score, i, j, &max, &max_i, &max_j, e, zdrop)) return 1; if (op == 1) j += len; // insertion
} else if (op == 2 || op == 3) { else i += len; // deletion
score -= q + e * len, i += len; update_max_zdrop(score, i, j, &max, &max_i, &max_j, opt->e, &max_zdrop, pos);
if (test_zdrop_aux(score, i, j, &max, &max_i, &max_j, e, zdrop)) return 1;
} }
} }
return 0;
// test if there is an inversion in the most dropped region
q_len = pos[1][1] - pos[1][0], t_len = pos[0][1] - pos[0][0];
if (!(opt->flag&(MM_F_SPLICE|MM_F_SR|MM_F_FOR_ONLY|MM_F_REV_ONLY)) && max_zdrop > opt->zdrop_inv && q_len < opt->max_gap && t_len < opt->max_gap) {
uint8_t *qseq2;
void *qp;
int q_off, t_off;
qseq2 = (uint8_t*)kmalloc(km, q_len);
for (i = 0; i < q_len; ++i) {
int c = qseq[pos[1][1] - i - 1];
qseq2[i] = c >= 4? 4 : 3 - c;
}
qp = ksw_ll_qinit(km, 2, q_len, qseq2, 5, mat);
score = ksw_ll_i16(qp, t_len, tseq + pos[0][0], opt->q, opt->e, &q_off, &t_off);
kfree(km, qseq2);
kfree(km, qp);
if (score >= opt->min_chain_score * opt->a && score >= opt->min_dp_max)
return 2; // there is a potential inversion
}
return max_zdrop > opt->zdrop? 1 : 0;
} }
static void mm_fix_cigar(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq, int *qshift, int *tshift) static void mm_fix_cigar(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq, int *qshift, int *tshift)
{ {
mm_extra_t *p = r->p; mm_extra_t *p = r->p;
int32_t k, toff = 0, qoff = 0, to_shrink = 0; int32_t toff = 0, qoff = 0, to_shrink = 0;
uint32_t k;
*qshift = *tshift = 0; *qshift = *tshift = 0;
if (p->n_cigar <= 1) return; if (p->n_cigar <= 1) return;
for (k = 0; k < p->n_cigar; ++k) { // indel left alignment for (k = 0; k < p->n_cigar; ++k) { // indel left alignment
@@ -123,8 +149,8 @@ static void mm_fix_cigar(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq,
static void mm_update_extra(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq, const int8_t *mat, int8_t q, int8_t e) static void mm_update_extra(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq, const int8_t *mat, int8_t q, int8_t e)
{ {
uint32_t k, l, toff = 0, qoff = 0; uint32_t k, l;
int32_t s = 0, max = 0, qshift, tshift; int32_t s = 0, max = 0, qshift, tshift, toff = 0, qoff = 0;
mm_extra_t *p = r->p; mm_extra_t *p = r->p;
if (p == 0) return; if (p == 0) return;
mm_fix_cigar(r, qseq, tseq, &qshift, &tshift); mm_fix_cigar(r, qseq, tseq, &qshift, &tshift);
@@ -173,12 +199,12 @@ static void mm_append_cigar(mm_reg1_t *r, uint32_t n_cigar, uint32_t *cigar) //
mm_extra_t *p; mm_extra_t *p;
if (n_cigar == 0) return; if (n_cigar == 0) return;
if (r->p == 0) { if (r->p == 0) {
uint32_t capacity = n_cigar + sizeof(mm_extra_t); uint32_t capacity = n_cigar + sizeof(mm_extra_t)/4;
kroundup32(capacity); kroundup32(capacity);
r->p = (mm_extra_t*)calloc(capacity, 4); r->p = (mm_extra_t*)calloc(capacity, 4);
r->p->capacity = capacity; r->p->capacity = capacity;
} else if (r->p->n_cigar + n_cigar + sizeof(mm_extra_t) > r->p->capacity) { } else if (r->p->n_cigar + n_cigar + sizeof(mm_extra_t)/4 > r->p->capacity) {
r->p->capacity = r->p->n_cigar + n_cigar + sizeof(mm_extra_t); r->p->capacity = r->p->n_cigar + n_cigar + sizeof(mm_extra_t)/4;
kroundup32(r->p->capacity); kroundup32(r->p->capacity);
r->p = (mm_extra_t*)realloc(r->p, r->p->capacity * 4); r->p = (mm_extra_t*)realloc(r->p, r->p->capacity * 4);
} }
@@ -193,9 +219,79 @@ static void mm_append_cigar(mm_reg1_t *r, uint32_t n_cigar, uint32_t *cigar) //
} }
} }
static void mm_align_pair(void *km, const mm_mapopt_t *opt, int qlen, const uint8_t *qseq, int tlen, const uint8_t *tseq, const int8_t *mat, int w, int end_bonus, int flag, ksw_extz_t *ez) static void mm_update_cigar_eqx(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq) // written by @armintoepfer
{
uint32_t n_EQX = 0;
uint32_t k, l, m, cap, toff = 0, qoff = 0, n_M = 0;
mm_extra_t *p;
if (r->p == 0) return;
for (k = 0; k < r->p->n_cigar; ++k) {
uint32_t op = r->p->cigar[k]&0xf, len = r->p->cigar[k]>>4;
if (op == 0) {
while (len > 0) {
for (l = 0; l < len && qseq[qoff + l] == tseq[toff + l]; ++l) {} // run of "="; TODO: N<=>N is converted to "="
if (l > 0) { ++n_EQX; len -= l; toff += l; qoff += l; }
for (l = 0; l < len && qseq[qoff + l] != tseq[toff + l]; ++l) {} // run of "X"
if (l > 0) { ++n_EQX; len -= l; toff += l; qoff += l; }
}
++n_M;
} else if (op == 1) { // insertion
qoff += len;
} else if (op == 2) { // deletion
toff += len;
} else if (op == 3) { // intron
toff += len;
}
}
// update in-place if we can
if (n_EQX == n_M) {
for (k = 0; k < r->p->n_cigar; ++k) {
uint32_t op = r->p->cigar[k]&0xf, len = r->p->cigar[k]>>4;
if (op == 0) r->p->cigar[k] = len << 4 | 7;
}
return;
}
// allocate new storage
cap = r->p->n_cigar + (n_EQX - n_M) + sizeof(mm_extra_t);
kroundup32(cap);
p = (mm_extra_t*)calloc(cap, 4);
memcpy(p, r->p, sizeof(mm_extra_t));
p->capacity = cap;
// update cigar while copying
toff = qoff = m = 0;
for (k = 0; k < r->p->n_cigar; ++k) {
uint32_t op = r->p->cigar[k]&0xf, len = r->p->cigar[k]>>4;
if (op == 0) { // match/mismatch
while (len > 0) {
// match
for (l = 0; l < len && qseq[qoff + l] == tseq[toff + l]; ++l) {}
if (l > 0) p->cigar[m++] = l << 4 | 7;
len -= l;
toff += l, qoff += l;
// mismatch
for (l = 0; l < len && qseq[qoff + l] != tseq[toff + l]; ++l) {}
if (l > 0) p->cigar[m++] = l << 4 | 8;
len -= l;
toff += l, qoff += l;
}
continue;
} else if (op == 1) { // insertion
qoff += len;
} else if (op == 2) { // deletion
toff += len;
} else if (op == 3) { // intron
toff += len;
}
p->cigar[m++] = r->p->cigar[k];
}
p->n_cigar = m;
free(r->p);
r->p = p;
}
static void mm_align_pair(void *km, const mm_mapopt_t *opt, int qlen, const uint8_t *qseq, int tlen, const uint8_t *tseq, const int8_t *mat, int w, int end_bonus, int zdrop, int flag, ksw_extz_t *ez)
{ {
int zdrop = opt->zdrop;
if (mm_dbg_flag & MM_DBG_PRINT_ALN_SEQ) { if (mm_dbg_flag & MM_DBG_PRINT_ALN_SEQ) {
int i; int i;
fprintf(stderr, "===> q=(%d,%d), e=(%d,%d), bw=%d, flag=%d, zdrop=%d <===\n", opt->q, opt->q2, opt->e, opt->e2, w, flag, opt->zdrop); fprintf(stderr, "===> q=(%d,%d), e=(%d,%d), bw=%d, flag=%d, zdrop=%d <===\n", opt->q, opt->q2, opt->e, opt->e2, w, flag, opt->zdrop);
@@ -204,7 +300,10 @@ static void mm_align_pair(void *km, const mm_mapopt_t *opt, int qlen, const uint
for (i = 0; i < qlen; ++i) fputc("ACGTN"[qseq[i]], stderr); for (i = 0; i < qlen; ++i) fputc("ACGTN"[qseq[i]], stderr);
fputc('\n', stderr); fputc('\n', stderr);
} }
if (opt->flag & MM_F_SPLICE) if (opt->max_sw_mat > 0 && (int64_t)tlen * qlen > opt->max_sw_mat) {
ksw_reset_extz(ez);
ez->zdropped = 1;
} else if (opt->flag & MM_F_SPLICE)
ksw_exts2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->noncan, zdrop, flag, ez); ksw_exts2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->noncan, zdrop, flag, ez);
else if (opt->q == opt->q2 && opt->e == opt->e2) else if (opt->q == opt->q2 && opt->e == opt->e2)
ksw_extz2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, w, zdrop, end_bonus, flag, ez); ksw_extz2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, w, zdrop, end_bonus, flag, ez);
@@ -245,20 +344,30 @@ static inline void mm_adjust_minier(const mm_idx_t *mi, uint8_t *const qseq0[2],
} }
} }
static void mm_filter_bad_seeds(void *km, int as1, int cnt1, mm128_t *a, int min_gap, int diff_thres, int max_ext_len, int max_ext_cnt) static int *collect_long_gaps(void *km, int as1, int cnt1, mm128_t *a, int min_gap, int *n_)
{ {
int max_st, max_en, n, i, k, max, *K; int i, n, *K;
*n_ = 0;
for (i = 1, n = 0; i < cnt1; ++i) { // count the number of gaps longer than min_gap for (i = 1, n = 0; i < cnt1; ++i) { // count the number of gaps longer than min_gap
int gap = ((int32_t)a[as1 + i].y - a[as1 + i - 1].y) - ((int32_t)a[as1 + i].x - a[as1 + i - 1].x); int gap = ((int32_t)a[as1 + i].y - a[as1 + i - 1].y) - ((int32_t)a[as1 + i].x - a[as1 + i - 1].x);
if (gap < -min_gap || gap > min_gap) ++n; if (gap < -min_gap || gap > min_gap) ++n;
} }
if (n <= 1) return; if (n <= 1) return 0;
K = (int*)kmalloc(km, n * sizeof(int)); K = (int*)kmalloc(km, n * sizeof(int));
for (i = 1, n = 0; i < cnt1; ++i) { // store the positions of long gaps for (i = 1, n = 0; i < cnt1; ++i) { // store the positions of long gaps
int gap = ((int32_t)a[as1 + i].y - a[as1 + i - 1].y) - ((int32_t)a[as1 + i].x - a[as1 + i - 1].x); int gap = ((int32_t)a[as1 + i].y - a[as1 + i - 1].y) - ((int32_t)a[as1 + i].x - a[as1 + i - 1].x);
if (gap < -min_gap || gap > min_gap) if (gap < -min_gap || gap > min_gap)
K[n++] = i; K[n++] = i;
} }
*n_ = n;
return K;
}
static void mm_filter_bad_seeds(void *km, int as1, int cnt1, mm128_t *a, int min_gap, int diff_thres, int max_ext_len, int max_ext_cnt)
{
int max_st, max_en, n, i, k, max, *K;
K = collect_long_gaps(km, as1, cnt1, a, min_gap, &n);
if (K == 0) return;
max = 0, max_st = max_en = -1; max = 0, max_st = max_en = -1;
for (k = 0;; ++k) { // traverse long gaps for (k = 0;; ++k) { // traverse long gaps
int gap, l, n_ins = 0, n_del = 0, qs, rs, max_diff = 0, max_diff_l = -1; int gap, l, n_ins = 0, n_del = 0, qs, rs, max_diff = 0, max_diff_l = -1;
@@ -270,7 +379,7 @@ static void mm_filter_bad_seeds(void *km, int as1, int cnt1, mm128_t *a, int min
if (k == n) break; if (k == n) break;
} }
i = K[k]; i = K[k];
gap = ((int32_t)a[as1 + i].y - a[as1 + i - 1].y) - ((int32_t)a[as1 + i].x - a[as1 + i - 1].x); gap = ((int32_t)a[as1 + i].y - (int32_t)a[as1 + i - 1].y) - (int32_t)(a[as1 + i].x - a[as1 + i - 1].x);
if (gap > 0) n_ins += gap; if (gap > 0) n_ins += gap;
else n_del += -gap; else n_del += -gap;
qs = (int32_t)a[as1 + i - 1].y; qs = (int32_t)a[as1 + i - 1].y;
@@ -278,7 +387,7 @@ static void mm_filter_bad_seeds(void *km, int as1, int cnt1, mm128_t *a, int min
for (l = k + 1; l < n && l <= k + max_ext_cnt; ++l) { for (l = k + 1; l < n && l <= k + max_ext_cnt; ++l) {
int j = K[l], diff; int j = K[l], diff;
if ((int32_t)a[as1 + j].y - qs > max_ext_len || (int32_t)a[as1 + j].x - rs > max_ext_len) break; if ((int32_t)a[as1 + j].y - qs > max_ext_len || (int32_t)a[as1 + j].x - rs > max_ext_len) break;
gap = ((int32_t)a[as1 + j].y - (int32_t)a[as1 + j - 1].y) - (a[as1 + j].x - a[as1 + j - 1].x); gap = ((int32_t)a[as1 + j].y - (int32_t)a[as1 + j - 1].y) - (int32_t)(a[as1 + j].x - a[as1 + j - 1].x);
if (gap > 0) n_ins += gap; if (gap > 0) n_ins += gap;
else n_del += -gap; else n_del += -gap;
diff = n_ins + n_del - abs(n_ins - n_del); diff = n_ins + n_del - abs(n_ins - n_del);
@@ -291,37 +400,79 @@ static void mm_filter_bad_seeds(void *km, int as1, int cnt1, mm128_t *a, int min
kfree(km, K); kfree(km, K);
} }
static void mm_fix_bad_ends(const mm_reg1_t *r, const mm128_t *a, int bw, int32_t *as, int32_t *cnt) static void mm_filter_bad_seeds_alt(void *km, int as1, int cnt1, mm128_t *a, int min_gap, int max_ext)
{ {
int32_t i, l; int n, k, *K;
K = collect_long_gaps(km, as1, cnt1, a, min_gap, &n);
if (K == 0) return;
for (k = 0; k < n;) {
int i = K[k], l;
int gap1 = ((int32_t)a[as1 + i].y - (int32_t)a[as1 + i - 1].y) - ((int32_t)a[as1 + i].x - (int32_t)a[as1 + i - 1].x);
int re1 = (int32_t)a[as1 + i].x;
int qe1 = (int32_t)a[as1 + i].y;
gap1 = gap1 > 0? gap1 : -gap1;
for (l = k + 1; l < n; ++l) {
int j = K[l], gap2, q_span_pre, rs2, qs2, m;
if ((int32_t)a[as1 + j].y - qe1 > max_ext || (int32_t)a[as1 + j].x - re1 > max_ext) break;
gap2 = ((int32_t)a[as1 + j].y - (int32_t)a[as1 + j - 1].y) - (int32_t)(a[as1 + j].x - a[as1 + j - 1].x);
q_span_pre = a[as1 + j - 1].y >> 32 & 0xff;
rs2 = (int32_t)a[as1 + j - 1].x + q_span_pre;
qs2 = (int32_t)a[as1 + j - 1].y + q_span_pre;
m = rs2 - re1 < qs2 - qe1? rs2 - re1 : qs2 - qe1;
gap2 = gap2 > 0? gap2 : -gap2;
if (m > gap1 + gap2) break;
re1 = (int32_t)a[as1 + j].x;
qe1 = (int32_t)a[as1 + j].y;
gap1 = gap2;
}
if (l > k + 1) {
int j, end = K[l - 1];
for (j = K[k]; j < end; ++j)
a[as1 + j].y |= MM_SEED_IGNORE;
a[as1 + end].y |= MM_SEED_LONG_JOIN;
}
k = l;
}
kfree(km, K);
}
static void mm_fix_bad_ends(const mm_reg1_t *r, const mm128_t *a, int bw, int min_match, int32_t *as, int32_t *cnt)
{
int32_t i, l, m;
*as = r->as, *cnt = r->cnt; *as = r->as, *cnt = r->cnt;
if (r->cnt < 3) return; if (r->cnt < 3) return;
l = a[r->as].y >> 32 & 0xff; m = l = a[r->as].y >> 32 & 0xff;
for (i = r->as + 1; i < r->as + r->cnt - 1; ++i) { for (i = r->as + 1; i < r->as + r->cnt - 1; ++i) {
int32_t lq, lr, min, max; int32_t lq, lr, min, max;
int32_t q_span = a[i].y >> 32 & 0xff;
if (a[i].y & MM_SEED_LONG_JOIN) break;
lr = (int32_t)a[i].x - (int32_t)a[i-1].x; lr = (int32_t)a[i].x - (int32_t)a[i-1].x;
lq = (int32_t)a[i].y - (int32_t)a[i-1].y; lq = (int32_t)a[i].y - (int32_t)a[i-1].y;
min = lr < lq? lr : lq; min = lr < lq? lr : lq;
max = lr > lq? lr : lq; max = lr > lq? lr : lq;
if (max - min > l >> 1) *as = i; if (max - min > l >> 1) *as = i;
l += min; l += min;
if (l >= bw << 1) break; m += min < q_span? min : q_span;
if (l >= bw << 1 || (m >= min_match && m >= bw) || m >= r->mlen >> 1) break;
} }
*cnt = r->as + r->cnt - *as; *cnt = r->as + r->cnt - *as;
l = a[r->as + r->cnt - 1].y >> 32 & 0xff; m = l = a[r->as + r->cnt - 1].y >> 32 & 0xff;
for (i = r->as + r->cnt - 2; i > *as; --i) { for (i = r->as + r->cnt - 2; i > *as; --i) {
int32_t lq, lr, min, max; int32_t lq, lr, min, max;
int32_t q_span = a[i+1].y >> 32 & 0xff;
if (a[i+1].y & MM_SEED_LONG_JOIN) break;
lr = (int32_t)a[i+1].x - (int32_t)a[i].x; lr = (int32_t)a[i+1].x - (int32_t)a[i].x;
lq = (int32_t)a[i+1].y - (int32_t)a[i].y; lq = (int32_t)a[i+1].y - (int32_t)a[i].y;
min = lr < lq? lr : lq; min = lr < lq? lr : lq;
max = lr > lq? lr : lq; max = lr > lq? lr : lq;
if (max - min > l >> 1) *cnt = i + 1 - *as; if (max - min > l >> 1) *cnt = i + 1 - *as;
l += min; l += min;
if (l >= bw) break; m += min < q_span? min : q_span;
if (l >= bw << 1 || (m >= min_match && m >= bw) || m >= r->mlen >> 1) break;
} }
} }
static void mm_max_stretch(const mm_mapopt_t *opt, const mm_reg1_t *r, const mm128_t *a, int32_t *as, int32_t *cnt) static void mm_max_stretch(const mm_reg1_t *r, const mm128_t *a, int32_t *as, int32_t *cnt)
{ {
int32_t i, score, max_score, len, max_i, max_len; int32_t i, score, max_score, len, max_i, max_len;
@@ -359,7 +510,7 @@ static int mm_seed_ext_score(void *km, const mm_mapopt_t *opt, const mm_idx_t *m
qe = (uint32_t)a->y + 1, qs = qe - q_span; qe = (uint32_t)a->y + 1, qs = qe - q_span;
rs = rs - ext_len > 0? rs - ext_len : 0; rs = rs - ext_len > 0? rs - ext_len : 0;
qs = qs - ext_len > 0? qs - ext_len : 0; qs = qs - ext_len > 0? qs - ext_len : 0;
re = re + ext_len < mi->seq[rid].len? re + ext_len : mi->seq[rid].len; re = re + ext_len < (int32_t)mi->seq[rid].len? re + ext_len : mi->seq[rid].len;
qe = qe + ext_len < qlen? qe + ext_len : qlen; qe = qe + ext_len < qlen? qe + ext_len : qlen;
tseq = (uint8_t*)kmalloc(km, re - rs); tseq = (uint8_t*)kmalloc(km, re - rs);
mm_idx_getseq(mi, rid, rs, re, tseq); mm_idx_getseq(mi, rid, rs, re, tseq);
@@ -405,22 +556,24 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
r2->cnt = 0; r2->cnt = 0;
if (r->cnt == 0) return; if (r->cnt == 0) return;
ksw_gen_simple_mat(5, mat, opt->a, opt->b); ksw_gen_simple_mat(5, mat, opt->a, opt->b, opt->sc_ambi);
bw = (int)(opt->bw * 1.5 + 1.); bw = (int)(opt->bw * 1.5 + 1.);
if (is_sr && !(mi->flag & MM_I_HPC)) { if (is_sr && !(mi->flag & MM_I_HPC)) {
mm_max_stretch(opt, r, a, &as1, &cnt1); mm_max_stretch(r, a, &as1, &cnt1);
rs = (int32_t)a[as1].x + 1 - (int32_t)(a[as1].y>>32&0xff); rs = (int32_t)a[as1].x + 1 - (int32_t)(a[as1].y>>32&0xff);
qs = (int32_t)a[as1].y + 1 - (int32_t)(a[as1].y>>32&0xff); qs = (int32_t)a[as1].y + 1 - (int32_t)(a[as1].y>>32&0xff);
re = (int32_t)a[as1+cnt1-1].x + 1; re = (int32_t)a[as1+cnt1-1].x + 1;
qe = (int32_t)a[as1+cnt1-1].y + 1; qe = (int32_t)a[as1+cnt1-1].y + 1;
} else { } else {
if (is_splice) { if (!(opt->flag & MM_F_NO_END_FLT)) {
mm_fix_bad_ends_splice(km, opt, mi, r, mat, qlen, qseq0, a, &as1, &cnt1); if (is_splice)
} else { mm_fix_bad_ends_splice(km, opt, mi, r, mat, qlen, qseq0, a, &as1, &cnt1);
mm_fix_bad_ends(r, a, opt->bw, &as1, &cnt1); else
} mm_fix_bad_ends(r, a, opt->bw, opt->min_chain_score * 2, &as1, &cnt1);
} else as1 = r->as, cnt1 = r->cnt;
mm_filter_bad_seeds(km, as1, cnt1, a, 10, 40, opt->max_gap>>1, 10); mm_filter_bad_seeds(km, as1, cnt1, a, 10, 40, opt->max_gap>>1, 10);
mm_filter_bad_seeds_alt(km, as1, cnt1, a, 30, opt->max_gap>>1);
mm_adjust_minier(mi, qseq0, &a[as1], &rs, &qs); mm_adjust_minier(mi, qseq0, &a[as1], &rs, &qs);
mm_adjust_minier(mi, qseq0, &a[as1 + cnt1 - 1], &re, &qe); mm_adjust_minier(mi, qseq0, &a[as1 + cnt1 - 1], &re, &qe);
} }
@@ -444,7 +597,7 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
rs0 = rs - l > 0? rs - l : 0; rs0 = rs - l > 0? rs - l : 0;
l = qlen - qe; l = qlen - qe;
l += l * opt->a + opt->end_bonus > opt->q? (l * opt->a + opt->end_bonus - opt->q) / opt->e : 0; l += l * opt->a + opt->end_bonus > opt->q? (l * opt->a + opt->end_bonus - opt->q) / opt->e : 0;
re0 = re + l < mi->seq[rid].len? re + l : mi->seq[rid].len; re0 = re + l < (int32_t)mi->seq[rid].len? re + l : mi->seq[rid].len;
} else { } else {
// compute rs0 and qs0 // compute rs0 and qs0
rs0 = (int32_t)a[r->as].x + 1 - (int32_t)(a[r->as].y>>32&0xff); rs0 = (int32_t)a[r->as].x + 1 - (int32_t)(a[r->as].y>>32&0xff);
@@ -488,13 +641,13 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
} }
} }
} }
if (qe < qlen && re < mi->seq[rid].len) { if (qe < qlen && re < (int32_t)mi->seq[rid].len) {
l = qlen - qe < opt->max_gap? qlen - qe : opt->max_gap; l = qlen - qe < opt->max_gap? qlen - qe : opt->max_gap;
qe1 = qe1 < qe + l? qe1 : qe + l; qe1 = qe1 < qe + l? qe1 : qe + l;
qe0 = qe0 > qe1? qe0 : qe1; // at least include qe0 qe0 = qe0 > qe1? qe0 : qe1; // at least include qe0
l += l * opt->a > opt->q? (l * opt->a - opt->q) / opt->e : 0; l += l * opt->a > opt->q? (l * opt->a - opt->q) / opt->e : 0;
l = l < opt->max_gap? l : opt->max_gap; l = l < opt->max_gap? l : opt->max_gap;
l = l < mi->seq[rid].len - re? l : mi->seq[rid].len - re; l = l < (int32_t)mi->seq[rid].len - re? l : mi->seq[rid].len - re;
re1 = re1 < re + l? re1 : re + l; re1 = re1 < re + l? re1 : re + l;
re0 = re0 > re1? re0 : re1; re0 = re0 > re1? re0 : re1;
} else re0 = re, qe0 = qe; } else re0 = re, qe0 = qe;
@@ -516,7 +669,7 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
mm_idx_getseq(mi, rid, rs0, rs, tseq); mm_idx_getseq(mi, rid, rs0, rs, tseq);
mm_seq_rev(qs - qs0, qseq); mm_seq_rev(qs - qs0, qseq);
mm_seq_rev(rs - rs0, tseq); mm_seq_rev(rs - rs0, tseq);
mm_align_pair(km, opt, qs - qs0, qseq, rs - rs0, tseq, mat, bw, opt->end_bonus, extra_flag|KSW_EZ_EXTZ_ONLY|KSW_EZ_RIGHT|KSW_EZ_REV_CIGAR, ez); mm_align_pair(km, opt, qs - qs0, qseq, rs - rs0, tseq, mat, bw, opt->end_bonus, r->split_inv? opt->zdrop_inv : opt->zdrop, extra_flag|KSW_EZ_EXTZ_ONLY|KSW_EZ_RIGHT|KSW_EZ_REV_CIGAR, ez);
if (ez->n_cigar > 0) { if (ez->n_cigar > 0) {
mm_append_cigar(r, ez->n_cigar, ez->cigar); mm_append_cigar(r, ez->n_cigar, ez->cigar);
r->p->dp_score += ez->max; r->p->dp_score += ez->max;
@@ -536,9 +689,10 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
} else mm_adjust_minier(mi, qseq0, &a[as1 + i], &re, &qe); } else mm_adjust_minier(mi, qseq0, &a[as1 + i], &re, &qe);
re1 = re, qe1 = qe; re1 = re, qe1 = qe;
if (i == cnt1 - 1 || (a[as1+i].y&MM_SEED_LONG_JOIN) || (qe - qs >= opt->min_ksw_len && re - rs >= opt->min_ksw_len)) { if (i == cnt1 - 1 || (a[as1+i].y&MM_SEED_LONG_JOIN) || (qe - qs >= opt->min_ksw_len && re - rs >= opt->min_ksw_len)) {
int j, bw1 = bw; int j, bw1 = bw, zdrop_code;
if (a[as1+i].y & MM_SEED_LONG_JOIN) if (a[as1+i].y & MM_SEED_LONG_JOIN)
bw1 = qe - qs > re - rs? qe - qs : re - rs; bw1 = qe - qs > re - rs? qe - qs : re - rs;
// perform alignment
qseq = &qseq0[rev][qs]; qseq = &qseq0[rev][qs];
mm_idx_getseq(mi, rid, rs, re, tseq); mm_idx_getseq(mi, rid, rs, re, tseq);
if (is_sr) { // perform ungapped alignment if (is_sr) { // perform ungapped alignment
@@ -550,10 +704,12 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
} }
ez->cigar = ksw_push_cigar(km, &ez->n_cigar, &ez->m_cigar, ez->cigar, 0, qe - qs); ez->cigar = ksw_push_cigar(km, &ez->n_cigar, &ez->m_cigar, ez->cigar, 0, qe - qs);
} else { // perform normal gapped alignment } else { // perform normal gapped alignment
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, mat, bw1, -1, extra_flag|KSW_EZ_APPROX_MAX, ez); // first pass: with approximate Z-drop mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, mat, bw1, -1, opt->zdrop, extra_flag|KSW_EZ_APPROX_MAX, ez); // first pass: with approximate Z-drop
} }
if (mm_check_zdrop(qseq, tseq, ez->n_cigar, ez->cigar, mat, opt->q, opt->e, opt->zdrop)) // test Z-drop and inversion Z-drop
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, mat, bw1, -1, extra_flag, ez); // second pass: lift approximate if ((zdrop_code = mm_test_zdrop(km, opt, qseq, tseq, ez->n_cigar, ez->cigar, mat)) != 0)
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, mat, bw1, -1, zdrop_code == 2? opt->zdrop_inv : opt->zdrop, extra_flag, ez); // second pass: lift approximate
// update CIGAR
if (ez->n_cigar > 0) if (ez->n_cigar > 0)
mm_append_cigar(r, ez->n_cigar, ez->cigar); mm_append_cigar(r, ez->n_cigar, ez->cigar);
if (ez->zdropped) { // truncated by Z-drop; TODO: sometimes Z-drop kicks in because the next seed placement is wrong. This can be fixed in principle. if (ez->zdropped) { // truncated by Z-drop; TODO: sometimes Z-drop kicks in because the next seed placement is wrong. This can be fixed in principle.
@@ -565,8 +721,10 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
r->p->dp_score += ez->max; r->p->dp_score += ez->max;
re1 = rs + (ez->max_t + 1); re1 = rs + (ez->max_t + 1);
qe1 = qs + (ez->max_q + 1); qe1 = qs + (ez->max_q + 1);
if (cnt1 - (j + 1) >= opt->min_cnt) if (cnt1 - (j + 1) >= opt->min_cnt) {
mm_split_reg(r, r2, as1 + j + 1 - r->as, qlen, a); mm_split_reg(r, r2, as1 + j + 1 - r->as, qlen, a);
if (zdrop_code == 2) r2->split_inv = 1;
}
break; break;
} else r->p->dp_score += ez->score; } else r->p->dp_score += ez->score;
rs = re, qs = qe; rs = re, qs = qe;
@@ -576,7 +734,7 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
if (!dropped && qe < qe0 && re < re0) { // right extension if (!dropped && qe < qe0 && re < re0) { // right extension
qseq = &qseq0[rev][qe]; qseq = &qseq0[rev][qe];
mm_idx_getseq(mi, rid, re, re0, tseq); mm_idx_getseq(mi, rid, re, re0, tseq);
mm_align_pair(km, opt, qe0 - qe, qseq, re0 - re, tseq, mat, bw, opt->end_bonus, extra_flag|KSW_EZ_EXTZ_ONLY, ez); mm_align_pair(km, opt, qe0 - qe, qseq, re0 - re, tseq, mat, bw, opt->end_bonus, opt->zdrop, extra_flag|KSW_EZ_EXTZ_ONLY, ez);
if (ez->n_cigar > 0) { if (ez->n_cigar > 0) {
mm_append_cigar(r, ez->n_cigar, ez->cigar); mm_append_cigar(r, ez->n_cigar, ez->cigar);
r->p->dp_score += ez->max; r->p->dp_score += ez->max;
@@ -594,6 +752,7 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
if (r->p) { if (r->p) {
mm_idx_getseq(mi, rid, rs1, re1, tseq); mm_idx_getseq(mi, rid, rs1, re1, tseq);
mm_update_extra(r, &qseq0[r->rev][qs1], tseq, mat, opt->q, opt->e); mm_update_extra(r, &qseq0[r->rev][qs1], tseq, mat, opt->q, opt->e);
if (opt->flag & MM_F_EQX) mm_update_cigar_eqx(r, &qseq0[r->rev][qs1], tseq);
if (rev && r->p->trans_strand) if (rev && r->p->trans_strand)
r->p->trans_strand ^= 3; // flip to the read strand r->p->trans_strand ^= 3; // flip to the read strand
} }
@@ -613,15 +772,15 @@ static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, i
if (r1->id != r1->parent && r1->parent != MM_PARENT_TMP_PRI) return 0; if (r1->id != r1->parent && r1->parent != MM_PARENT_TMP_PRI) return 0;
if (r2->id != r2->parent && r2->parent != MM_PARENT_TMP_PRI) return 0; if (r2->id != r2->parent && r2->parent != MM_PARENT_TMP_PRI) return 0;
if (r1->rid != r2->rid || r1->rev != r2->rev) return 0; if (r1->rid != r2->rid || r1->rev != r2->rev) return 0;
ql = r2->qs - r1->qe; ql = r1->rev? r1->qs - r2->qe : r2->qs - r1->qe;
tl = r2->rs - r1->re; tl = r2->rs - r1->re;
if (ql < opt->min_chain_score || ql > opt->max_gap) return 0; if (ql < opt->min_chain_score || ql > opt->max_gap) return 0;
if (tl < opt->min_chain_score || tl > opt->max_gap) return 0; if (tl < opt->min_chain_score || tl > opt->max_gap) return 0;
ksw_gen_simple_mat(5, mat, opt->a, opt->b); ksw_gen_simple_mat(5, mat, opt->a, opt->b, opt->sc_ambi);
tseq = (uint8_t*)kmalloc(km, tl); tseq = (uint8_t*)kmalloc(km, tl);
mm_idx_getseq(mi, r1->rid, r1->re, r2->rs, tseq); mm_idx_getseq(mi, r1->rid, r1->re, r2->rs, tseq);
qseq = &qseq0[!r1->rev][qlen - r2->qs]; qseq = r1->rev? &qseq0[0][r2->qe] : &qseq0[1][qlen - r2->qs];
mm_seq_rev(ql, qseq); mm_seq_rev(ql, qseq);
mm_seq_rev(tl, tseq); mm_seq_rev(tl, tseq);
@@ -632,7 +791,7 @@ static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, i
mm_seq_rev(tl, tseq); mm_seq_rev(tl, tseq);
if (score < opt->min_dp_max) goto end_align1_inv; if (score < opt->min_dp_max) goto end_align1_inv;
q_off = ql - (q_off + 1), t_off = tl - (t_off + 1); q_off = ql - (q_off + 1), t_off = tl - (t_off + 1);
mm_align_pair(km, opt, ql - q_off, qseq + q_off, tl - t_off, tseq + t_off, mat, (int)(opt->bw * 1.5), -1, KSW_EZ_EXTZ_ONLY, ez); mm_align_pair(km, opt, ql - q_off, qseq + q_off, tl - t_off, tseq + t_off, mat, (int)(opt->bw * 1.5), -1, opt->zdrop, KSW_EZ_EXTZ_ONLY, ez);
if (ez->n_cigar == 0) goto end_align1_inv; // should never be here if (ez->n_cigar == 0) goto end_align1_inv; // should never be here
mm_append_cigar(r_inv, ez->n_cigar, ez->cigar); mm_append_cigar(r_inv, ez->n_cigar, ez->cigar);
r_inv->p->dp_score = ez->max; r_inv->p->dp_score = ez->max;
@@ -642,9 +801,17 @@ static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, i
r_inv->rev = !r1->rev; r_inv->rev = !r1->rev;
r_inv->rid = r1->rid; r_inv->rid = r1->rid;
r_inv->div = -1.0f; r_inv->div = -1.0f;
r_inv->qs = r1->qe + q_off, r_inv->qe = r_inv->qs + ez->max_q + 1; if (r_inv->rev == 0) {
r_inv->rs = r1->re + t_off, r_inv->re = r_inv->rs + ez->max_t + 1; r_inv->qs = r2->qe + q_off;
r_inv->qe = r_inv->qs + ez->max_q + 1;
} else {
r_inv->qe = r2->qs - q_off;
r_inv->qs = r_inv->qe - (ez->max_q + 1);
}
r_inv->rs = r1->re + t_off;
r_inv->re = r_inv->rs + ez->max_t + 1;
mm_update_extra(r_inv, &qseq[q_off], &tseq[t_off], mat, opt->q, opt->e); mm_update_extra(r_inv, &qseq[q_off], &tseq[t_off], mat, opt->q, opt->e);
if (opt->flag & MM_F_EQX) mm_update_cigar_eqx(r_inv, &qseq[q_off], &tseq[t_off]);
ret = 1; ret = 1;
end_align1_inv: end_align1_inv:
kfree(km, tseq); kfree(km, tseq);
@@ -704,7 +871,7 @@ mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *m
regs[i].p->trans_strand = opt->flag&MM_F_SPLICE_FOR? 1 : 2; regs[i].p->trans_strand = opt->flag&MM_F_SPLICE_FOR? 1 : 2;
} }
if (r2.cnt > 0) regs = mm_insert_reg(&r2, i, &n_regs, regs); if (r2.cnt > 0) regs = mm_insert_reg(&r2, i, &n_regs, regs);
if (!(opt->flag&(MM_F_SPLICE|MM_F_SR)) && !(opt->flag&(MM_F_FOR_ONLY|MM_F_REV_ONLY)) && i > 0) { // don't try inversion alignment for -xsplice or -xsr, or --for-only/rev-only if (i > 0 && regs[i].split_inv) {
if (mm_align1_inv(km, opt, mi, qlen, qseq0, &regs[i-1], &regs[i], &r2, &ez)) { if (mm_align1_inv(km, opt, mi, qlen, qseq0, &regs[i-1], &regs[i], &r2, &ez)) {
regs = mm_insert_reg(&r2, i, &n_regs, regs); regs = mm_insert_reg(&r2, i, &n_regs, regs);
++i; // skip the inserted INV alignment ++i; // skip the inserted INV alignment
@@ -714,7 +881,7 @@ mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *m
*n_regs_ = n_regs; *n_regs_ = n_regs;
kfree(km, qseq0[0]); kfree(km, qseq0[0]);
kfree(km, ez.cigar); kfree(km, ez.cigar);
mm_filter_regs(km, opt, n_regs_, regs); mm_filter_regs(opt, qlen, n_regs_, regs);
mm_hit_sort_by_dp(km, n_regs_, regs); mm_hit_sort(km, n_regs_, regs);
return regs; return regs;
} }
+36 -12
View File
@@ -39,7 +39,7 @@ mm_bseq_file_t *mm_bseq_open(const char *fn)
{ {
mm_bseq_file_t *fp; mm_bseq_file_t *fp;
gzFile f; gzFile f;
f = fn && strcmp(fn, "-")? gzopen(fn, "r") : gzdopen(fileno(stdin), "r"); f = fn && strcmp(fn, "-")? gzopen(fn, "r") : gzdopen(0, "r");
if (f == 0) return 0; if (f == 0) return 0;
fp = (mm_bseq_file_t*)calloc(1, sizeof(mm_bseq_file_t)); fp = (mm_bseq_file_t*)calloc(1, sizeof(mm_bseq_file_t));
fp->fp = f; fp->fp = f;
@@ -54,21 +54,33 @@ void mm_bseq_close(mm_bseq_file_t *fp)
free(fp); free(fp);
} }
static inline void kseq2bseq(kseq_t *ks, mm_bseq1_t *s, int with_qual) static inline char *kstrdup(const kstring_t *s)
{
char *t;
t = (char*)malloc(s->l + 1);
memcpy(t, s->s, s->l + 1);
return t;
}
static inline void kseq2bseq(kseq_t *ks, mm_bseq1_t *s, int with_qual, int with_comment)
{ {
int i; int i;
s->name = strdup(ks->name.s); if (ks->name.l == 0)
s->seq = strdup(ks->seq.s); fprintf(stderr, "[WARNING]\033[1;31m empty sequence name in the input.\033[0m\n");
for (i = 0; i < ks->seq.l; ++i) // convert U to T s->name = kstrdup(&ks->name);
s->seq = kstrdup(&ks->seq);
for (i = 0; i < (int)ks->seq.l; ++i) // convert U to T
if (s->seq[i] == 'u' || s->seq[i] == 'U') if (s->seq[i] == 'u' || s->seq[i] == 'U')
--s->seq[i]; --s->seq[i];
s->qual = with_qual && ks->qual.l? strdup(ks->qual.s) : 0; s->qual = with_qual && ks->qual.l? kstrdup(&ks->qual) : 0;
s->comment = with_comment && ks->comment.l? kstrdup(&ks->comment) : 0;
s->l_seq = ks->seq.l; s->l_seq = ks->seq.l;
} }
mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int frag_mode, int *n_) mm_bseq1_t *mm_bseq_read3(mm_bseq_file_t *fp, int chunk_size, int with_qual, int with_comment, int frag_mode, int *n_)
{ {
int64_t size = 0; int64_t size = 0;
int ret;
kvec_t(mm_bseq1_t) a = {0,0,0}; kvec_t(mm_bseq1_t) a = {0,0,0};
kseq_t *ks = fp->ks; kseq_t *ks = fp->ks;
*n_ = 0; *n_ = 0;
@@ -78,17 +90,17 @@ mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int
size = fp->s.l_seq; size = fp->s.l_seq;
memset(&fp->s, 0, sizeof(mm_bseq1_t)); memset(&fp->s, 0, sizeof(mm_bseq1_t));
} }
while (kseq_read(ks) >= 0) { while ((ret = kseq_read(ks)) >= 0) {
mm_bseq1_t *s; mm_bseq1_t *s;
assert(ks->seq.l <= INT32_MAX); assert(ks->seq.l <= INT32_MAX);
if (a.m == 0) kv_resize(mm_bseq1_t, 0, a, 256); if (a.m == 0) kv_resize(mm_bseq1_t, 0, a, 256);
kv_pushp(mm_bseq1_t, 0, a, &s); kv_pushp(mm_bseq1_t, 0, a, &s);
kseq2bseq(ks, s, with_qual); kseq2bseq(ks, s, with_qual, with_comment);
size += s->l_seq; size += s->l_seq;
if (size >= chunk_size) { if (size >= chunk_size) {
if (frag_mode && a.a[a.n-1].l_seq < CHECK_PAIR_THRES) { if (frag_mode && a.a[a.n-1].l_seq < CHECK_PAIR_THRES) {
while (kseq_read(ks) >= 0) { while (kseq_read(ks) >= 0) {
kseq2bseq(ks, &fp->s, with_qual); kseq2bseq(ks, &fp->s, with_qual, with_comment);
if (mm_qname_same(fp->s.name, a.a[a.n-1].name)) { if (mm_qname_same(fp->s.name, a.a[a.n-1].name)) {
kv_push(mm_bseq1_t, 0, a, fp->s); kv_push(mm_bseq1_t, 0, a, fp->s);
memset(&fp->s, 0, sizeof(mm_bseq1_t)); memset(&fp->s, 0, sizeof(mm_bseq1_t));
@@ -98,16 +110,23 @@ mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int
break; break;
} }
} }
if (ret < -1)
fprintf(stderr, "[WARNING]\033[1;31m wrong FASTA/FASTQ record. Continue anyway.\033[0m\n");
*n_ = a.n; *n_ = a.n;
return a.a; return a.a;
} }
mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int frag_mode, int *n_)
{
return mm_bseq_read3(fp, chunk_size, with_qual, 0, frag_mode, n_);
}
mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int chunk_size, int with_qual, int *n_) mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int chunk_size, int with_qual, int *n_)
{ {
return mm_bseq_read2(fp, chunk_size, with_qual, 0, n_); return mm_bseq_read2(fp, chunk_size, with_qual, 0, n_);
} }
mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int *n_) mm_bseq1_t *mm_bseq_read_frag2(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int with_comment, int *n_)
{ {
int i; int i;
int64_t size = 0; int64_t size = 0;
@@ -128,7 +147,7 @@ mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int
for (i = 0; i < n_fp; ++i) { for (i = 0; i < n_fp; ++i) {
mm_bseq1_t *s; mm_bseq1_t *s;
kv_pushp(mm_bseq1_t, 0, a, &s); kv_pushp(mm_bseq1_t, 0, a, &s);
kseq2bseq(fp[i]->ks, s, with_qual); kseq2bseq(fp[i]->ks, s, with_qual, with_comment);
size += s->l_seq; size += s->l_seq;
} }
if (size >= chunk_size) break; if (size >= chunk_size) break;
@@ -137,6 +156,11 @@ mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int
return a.a; return a.a;
} }
mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int *n_)
{
return mm_bseq_read_frag2(n_fp, fp, chunk_size, with_qual, 0, n_);
}
int mm_bseq_eof(mm_bseq_file_t *fp) int mm_bseq_eof(mm_bseq_file_t *fp)
{ {
return (ks_eof(fp->ks->f) && fp->s.seq == 0); return (ks_eof(fp->ks->f) && fp->s.seq == 0);
+3 -1
View File
@@ -13,13 +13,15 @@ typedef struct mm_bseq_file_s mm_bseq_file_t;
typedef struct { typedef struct {
int l_seq, rid; int l_seq, rid;
char *name, *seq, *qual; char *name, *seq, *qual, *comment;
} mm_bseq1_t; } mm_bseq1_t;
mm_bseq_file_t *mm_bseq_open(const char *fn); mm_bseq_file_t *mm_bseq_open(const char *fn);
void mm_bseq_close(mm_bseq_file_t *fp); void mm_bseq_close(mm_bseq_file_t *fp);
mm_bseq1_t *mm_bseq_read3(mm_bseq_file_t *fp, int chunk_size, int with_qual, int with_comment, int frag_mode, int *n_);
mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int frag_mode, int *n_); mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int frag_mode, int *n_);
mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int chunk_size, int with_qual, int *n_); mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int chunk_size, int with_qual, int *n_);
mm_bseq1_t *mm_bseq_read_frag2(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int with_comment, int *n_);
mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int *n_); mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int *n_);
int mm_bseq_eof(mm_bseq_file_t *fp); int mm_bseq_eof(mm_bseq_file_t *fp);
+1 -1
View File
@@ -44,7 +44,7 @@ mm128_t *mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int m
int32_t qi = (int32_t)a[i].y, q_span = a[i].y>>32&0xff; // NB: only 8 bits of span is used!!! int32_t qi = (int32_t)a[i].y, q_span = a[i].y>>32&0xff; // NB: only 8 bits of span is used!!!
int32_t max_f = q_span, n_skip = 0, min_d; int32_t max_f = q_span, n_skip = 0, min_d;
int32_t sidi = (a[i].y & MM_SEED_SEG_MASK) >> MM_SEED_SEG_SHIFT; int32_t sidi = (a[i].y & MM_SEED_SEG_MASK) >> MM_SEED_SEG_SHIFT;
while (st < i && ri - a[st].x > max_dist_x) ++st; while (st < i && ri > a[st].x + max_dist_x) ++st;
for (j = i - 1; j >= st; --j) { for (j = i - 1; j >= st; --j) {
int64_t dr = ri - a[j].x; int64_t dr = ri - a[j].x;
int32_t dq = qi - (int32_t)a[j].y, dd, sc, log_dd; int32_t dq = qi - (int32_t)a[j].y, dd, sc, log_dd;
+243
View File
@@ -0,0 +1,243 @@
## Table of Contents
- [Introduction & Installation](#intro)
- [Mapping Genomic Reads](#map-reads)
* [Mapping long reads](#map-pb)
* [Mapping Illumina paired-end reads](#map-sr)
* [Evaluating mapping accuracy with simulated reads (for developers)](#mapeval)
- [Mapping Long RNA-seq Reads](#map-rna)
* [Mapping Nanopore 2D cDNA reads](#map-ont-cdna-2d)
* [Mapping Nanopore direct-RNA reads](#map-direct-rna)
* [Mapping PacBio Iso-seq reads](#map-iso-seq)
- [Full-Genome Alignment](#genome-aln)
* [Intra-species assembly alignment](#asm-to-ref)
* [Cross-species full-genome alignment](#x-species)
* [Eyeballing alignment](#view-aln)
* [Calling variants from assembly-to-reference alignment](#asm-var)
* [Constructing self-homology map](#hom-map)
* [Lift Over (for developers)](#liftover)
- [Read Overlap](#read-overlap)
* [Long-read overlap](#long-read-overlap)
* [Evaluating overlap sensitivity (for developers)](#ov-eval)
## <a name="intro"></a>Introduction & Installation
This cookbook walks you through a variety of applications of minimap2 and its
companion script `paftools.js`. All data here are freely available from the
minimap2 release page at version tag [v2.10][v2.10]. Some examples only work
with v2.10 or later.
To acquire the data used in this cookbook and to install minimap2 and paftools,
please follow the command lines below:
```sh
# install minimap2 executables
curl -L https://github.com/lh3/minimap2/releases/download/v2.14/minimap2-2.14_x64-linux.tar.bz2 | tar jxf -
cp minimap2-2.14_x64-linux/{minimap2,k8,paftools.js} . # copy executables
export PATH="$PATH:"`pwd` # put the current directory on PATH
# download example datasets
curl -L https://github.com/lh3/minimap2/releases/download/v2.10/cookbook-data.tgz | tar zxf -
```
## <a name="map-reads"></a>Mapping Genomic Reads
### <a name="map-pb"></a>Mapping long reads
```sh
minimap2 -ax map-pb -t4 ecoli_ref.fa ecoli_p6_25x_canu.fa > mapped.sam
```
Alternatively, you can create a minimap2 index first and then map:
```sh
minimap2 -x map-pb -d ecoli-pb.mmi ecoli_ref.fa # create an index
minimap2 -ax map-pb ecoli-pb.mmi ecoli_p6_25x_canu.fa > mapped.sam
```
This will save you a couple of minutes when you map against the human genome.
**HOWEVER**, key algorithm parameters such as the k-mer length and window
size can't be changed after indexing. Minimap2 will give you a warning if
parameters used in a pre-built index doesn't match parameters on the command
line. **Please always make sure you are using an intended pre-built index.**
### <a name="map-sr"></a>Mapping Illumina paired-end reads:
```sh
minimap2 -ax sr -t4 ecoli_ref.fa ecoli_mason_1.fq ecoli_mason_2.fq > mapped-sr.sam
```
### <a name="mapeval"></a>Evaluating mapping accuracy with simulated reads (for developers)
```sh
minimap2 -ax sr ecoli_ref.fa ecoli_mason_1.fq ecoli_mason_2.fq | paftools.js mapeval -
```
The output is:
```
Q 60 19712 0 0.000000000 19712
Q 0 282 219 0.010953286 19994
U 6
```
where a `U`-line gives the number of unmapped reads (for SAM input only); a
`Q`-line gives:
1. Mapping quality (mapQ) threshold
2. Number of mapped reads between this threshold and the previous mapQ threshold.
3. Number of wrong mappings in the same mapQ interval
4. Accumulative mapping error rate
5. Accumulative number of mappings
For `paftools.js mapeval` to work, you need to encode the true read positions
in read names in the right format. For [PBSIM][pbsim] and [mason2][mason2], we
provide scripts to generate the right format. Simulated reads in this cookbook
were created with the following command lines:
```sh
# in PBSIM source code directory:
src/pbsim ../ecoli_ref.fa --depth 1 --sample-fastq sample/sample.fastq
paftools.js pbsim2fq ../ecoli_ref.fa.fai sd_0001.maf > ../ecoli_pbsim.fa
# mason2 simulation
mason_simulator --illumina-prob-mismatch-scale 2.5 -ir ecoli_ref.fa -n 10000 -o tmp-l.fq -or tmp-r.fq -oa tmp.sam
paftools.js mason2fq tmp.sam | seqtk seq -1 > ecoli_mason_1.fq
paftools.js mason2fq tmp.sam | seqtk seq -2 > ecoli_mason_2.fq
```
## <a name="map-rna"></a>Mapping Long RNA-seq Reads
### <a name="map-ont-cdna-2d"></a>Mapping Nanopore 2D cDNA reads
```sh
minimap2 -ax splice SIRV_E2.fa SIRV_ont-cdna.fa > aln.sam
```
You can compare the alignment to the true annotations with:
```sh
paftools.js junceval SIRV_E2C.gtf aln.sam
```
It gives the percentage of introns found in the annotation. For SIRV data, it
is possible to achieve higher junction accuracy with
```sh
minimap2 -ax splice --splice-flank=no SIRV_E2.fa SIRV_ont-cdna.fa | paftools.js junceval SIRV_E2C.gtf
```
This is because minimap2 models one additional evolutionarily conserved base
around a canonical junction, but SIRV doesn't honor this signal. Option
`--splice-flank=no` asks minimap2 no to model this additional base.
In the output a tag `ts:A:+` indicates that the read strand is the same as the
transcript strand; `ts:A:-` indicates the read strand is opposite to the
transcript strand. This tag is inferred from the GT-AG signal and is thus only
available to spliced reads.
### <a name="map-direct-rna"></a>Mapping Nanopore direct-RNA reads
```sh
minimap2 -ax splice -k14 -uf SIRV_E2.fa SIRV_ont-drna.fa > aln.sam
```
Direct-RNA reads are noisier, so we use a shorter k-mer for improved
sensitivity. Here, option `-uf` forces minimap2 to map reads to the forward
transcript strand only because direct-RNA reads are stranded. Again, applying
`--splice-flank=no` helps junction accuracy for SIRV data.
### <a name="map-iso-seq"></a>Mapping PacBio Iso-seq reads
```sh
minimap2 -ax splice -uf -C5 SIRV_E2.fa SIRV_iso-seq.fq > aln.sam
```
Option `-C5` reduces the penalty on non-canonical splicing sites. It helps
to align such sites correctly for data with low error rate such as Iso-seq
reads and traditional cDNAs. On this example, minimap2 makes one junction
error. Applying `--splice-flank=no` fixes this alignment error.
Note that the command line above is optimized for the final Iso-seq reads.
PacBio's Iso-seq pipeline produces intermediate sequences at varying quality.
For example, some intermediate reads are not stranded. For these reads, option
`-uf` will lead to more errors. Please revise the minimap2 command line
accordingly.
## <a name="genome-aln"></a>Full-Genome Alignment
### <a name="asm-to-ref"></a>Intra-species assembly alignment
```sh
# option "--cs" is recommended as paftools.js may need it
minimap2 -cx asm5 --cs ecoli_ref.fa ecoli_canu.fa > ecoli_canu.paf
```
Here `ecoli_canu.fa` is the Canu assembly of `ecoli_p6_25x_canu.fa`. This
command line outputs alignments in the [PAF format][paf]. Use `-a` instead of
`-c` to get output in the SAM format.
### <a name="x-species"></a>Cross-species full-genome alignment
```sh
minimap2 -cx asm20 --cs ecoli_ref.fa ecoli_O104:H4.fa > ecoli_O104:H4.paf
sort -k6,6 -k8,8n ecoli_O104:H4.paf | paftools.js call -f ecoli_ref.fa -L10000 -l1000 - > out.vcf
```
Minimap2 has three presets for full-genome alignment: "asm5" for sequence
divergence below 1%, "asm10" for divergence around a couple of percent and
"asm20" for divergence not more than 10%. In theory, with the right setting,
minimap2 should work for sequence pairs with sequence divergence up to ~15%,
but this has not been carefully evaluated.
### <a name="view-aln"></a>Eyeballing alignment
```sh
# option "--cs" required; minimap2-r741 or higher required for the "asm20" preset
minimap2 -cx asm20 --cs ecoli_ref.fa ecoli_O104:H4.fa | paftools.js view - | less -S
```
This prints the alignment in a BLAST-like format.
### <a name="asm-var"></a>Calling variants from assembly-to-reference alignment
```sh
# don't forget the "--cs" option; otherwise it doesn't work
minimap2 -cx asm5 --cs ecoli_ref.fa ecoli_canu.fa \
| sort -k6,6 -k8,8n \
| paftools.js call -f ecoli_ref.fa - > out.vcf
```
Without option `-f`, `paftools.js call` outputs in a custom format. In this
format, lines starting with `R` give the regions covered by one contig only.
This information is not available in the VCF output.
### <a name="hom-map"></a>Constructing self-homology map
```sh
minimap2 -DP -k19 -w19 -m200 ecoli_ref.fa ecoli_ref.fa > out.paf
```
Option `-D` asks minimap2 to ignore anchors from perfect self match and `-P`
outputs all chains. For large nomes, we don't recommend to perform base-level
alignment (with `-c`, `-a` or `--cs`) when `-P` is applied. This is because
base-alignment is slow and occasionally gives wrong alignments close to the
diagonal of a dotter plot. For E. coli, though, base-alignment is still fast.
### <a name="liftover"></a>Lift over (for developers)
```sh
minimap2 -cx asm5 --cs ecoli_ref.fa ecoli_canu.fa > ecoli_canu.paf
echo -e 'tig00000001\t200000\t300000' | paftools.js liftover ecoli_canu.paf -
```
This lifts over a region on query sequences to one or multiple regions on
reference sequences. Note that this paftools.js command may not be efficient
enough to lift millions of regions.
## <a name="read-overlap"></a>Read Overlap
### <a name="long-read-overlap"></a>Long read overlap
```sh
# For pacbio reads:
minimap2 -x ava-pb ecoli_p6_25x_canu.fa ecoli_p6_25x_canu.fa > overlap.paf
# For Nanopore reads (ava-ont also works with PacBio but not as good):
minimap2 -x ava-ont -r 10000 ecoli_p6_25x_canu.fa ecoli_p6_25x_canu.fa > overlap.paf
# If you have miniasm installed:
miniasm -f ecoli_p6_25x_canu.fa overlap.paf > asm.gfa
```
Here we explicitly applied `-r 10000`. We are considering to set this as the
default for the `ava-ont` mode as this seems to improve the contiguity for
nanopore read assembly (Loman, personal communication).
*Minimap2 doesn't work well with short-read overlap.*
### <a name="ov-eval"></a>Evaluating overlap sensitivity (for developers)
```sh
# read to reference mapping
minimap2 -cx map-pb ecoli_ref.fa ecoli_p6_25x_canu.fa > to-ref.paf
# evaluate overlap sensitivity
sort -k6,6 -k8,8n to-ref.paf | paftools.js ov-eval - overlap.paf
```
You can see that for PacBio reads, minimap2 achieves higher overlap sensitivity
with `-x ava-pb` (99% vs 93% with `-x ava-ont`).
[pbsim]: https://github.com/pfaucon/PBSIM-PacBio-Simulator
[mason2]: https://github.com/seqan/seqan/tree/master/apps/mason2
[paf]: https://github.com/lh3/miniasm/blob/master/PAF.md
[v2.10]: https://github.com/lh3/minimap2/releases/tag/v2.10
+110 -38
View File
@@ -92,7 +92,8 @@ static void sam_write_rg_line(kstring_t *str, const char *s)
if (mm_verbose >= 1) fprintf(stderr, "[ERROR] the read group line contained literal <tab> characters -- replace with escaped tabs: \\t\n"); if (mm_verbose >= 1) fprintf(stderr, "[ERROR] the read group line contained literal <tab> characters -- replace with escaped tabs: \\t\n");
goto err_set_rg; goto err_set_rg;
} }
rg_line = strdup(s); rg_line = (char*)malloc(strlen(s) + 1);
strcpy(rg_line, s);
mm_escape(rg_line); mm_escape(rg_line);
if ((p = strstr(rg_line, "\tID:")) == 0) { if ((p = strstr(rg_line, "\tID:")) == 0) {
if (mm_verbose >= 1) fprintf(stderr, "[ERROR] no ID within the read group line\n"); if (mm_verbose >= 1) fprintf(stderr, "[ERROR] no ID within the read group line\n");
@@ -118,7 +119,7 @@ void mm_write_sam_hdr(const mm_idx_t *idx, const char *rg, const char *ver, int
if (idx) { if (idx) {
uint32_t i; uint32_t i;
for (i = 0; i < idx->n_seq; ++i) for (i = 0; i < idx->n_seq; ++i)
printf("@SQ\tSN:%s\tLN:%d\n", idx->seq[i].name, idx->seq[i].len); mm_sprintf_lite(&str, "@SQ\tSN:%s\tLN:%d\n", idx->seq[i].name, idx->seq[i].len);
} }
if (rg) sam_write_rg_line(&str, rg); if (rg) sam_write_rg_line(&str, rg);
mm_sprintf_lite(&str, "@PG\tID:minimap2\tPN:minimap2"); mm_sprintf_lite(&str, "@PG\tID:minimap2\tPN:minimap2");
@@ -129,36 +130,18 @@ void mm_write_sam_hdr(const mm_idx_t *idx, const char *rg, const char *ver, int
for (i = 1; i < argc; ++i) for (i = 1; i < argc; ++i)
mm_sprintf_lite(&str, " %s", argv[i]); mm_sprintf_lite(&str, " %s", argv[i]);
} }
mm_sprintf_lite(&str, "\n"); mm_err_puts(str.s);
fputs(str.s, stdout);
free(str.s); free(str.s);
} }
static void write_cs(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int no_iden) static void write_cs_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq, const mm_reg1_t *r, char *tmp, int no_iden, int write_tag)
{ {
extern unsigned char seq_nt4_table[256];
int i, q_off, t_off; int i, q_off, t_off;
uint8_t *qseq, *tseq; if (write_tag) mm_sprintf_lite(s, "\tcs:Z:");
char *tmp; for (i = q_off = t_off = 0; i < (int)r->p->n_cigar; ++i) {
if (r->p == 0) return;
mm_sprintf_lite(s, "\tcs:Z:");
qseq = (uint8_t*)kmalloc(km, r->qe - r->qs);
tseq = (uint8_t*)kmalloc(km, r->re - r->rs);
tmp = (char*)kmalloc(km, r->re - r->rs > r->qe - r->qs? r->re - r->rs + 1 : r->qe - r->qs + 1);
mm_idx_getseq(mi, r->rid, r->rs, r->re, tseq);
if (!r->rev) {
for (i = r->qs; i < r->qe; ++i)
qseq[i - r->qs] = seq_nt4_table[(uint8_t)t->seq[i]];
} else {
for (i = r->qs; i < r->qe; ++i) {
uint8_t c = seq_nt4_table[(uint8_t)t->seq[i]];
qseq[r->qe - i - 1] = c >= 4? 4 : 3 - c;
}
}
for (i = q_off = t_off = 0; i < r->p->n_cigar; ++i) {
int j, op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4; int j, op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
assert(op >= 0 && op <= 3); assert((op >= 0 && op <= 3) || op == 7 || op == 8);
if (op == 0) { if (op == 0 || op == 7 || op == 8) { // match
int l_tmp = 0; int l_tmp = 0;
for (j = 0; j < len; ++j) { for (j = 0; j < len; ++j) {
if (qseq[q_off + j] != tseq[t_off + j]) { if (qseq[q_off + j] != tseq[t_off + j]) {
@@ -179,17 +162,17 @@ static void write_cs(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_
} else mm_sprintf_lite(s, ":%d", l_tmp); } else mm_sprintf_lite(s, ":%d", l_tmp);
} }
q_off += len, t_off += len; q_off += len, t_off += len;
} else if (op == 1) { } else if (op == 1) { // insertion to ref
for (j = 0, tmp[len] = 0; j < len; ++j) for (j = 0, tmp[len] = 0; j < len; ++j)
tmp[j] = "acgtn"[qseq[q_off + j]]; tmp[j] = "acgtn"[qseq[q_off + j]];
mm_sprintf_lite(s, "+%s", tmp); mm_sprintf_lite(s, "+%s", tmp);
q_off += len; q_off += len;
} else if (op == 2) { } else if (op == 2) { // deletion from ref
for (j = 0, tmp[len] = 0; j < len; ++j) for (j = 0, tmp[len] = 0; j < len; ++j)
tmp[j] = "acgtn"[tseq[t_off + j]]; tmp[j] = "acgtn"[tseq[t_off + j]];
mm_sprintf_lite(s, "-%s", tmp); mm_sprintf_lite(s, "-%s", tmp);
t_off += len; t_off += len;
} else { } else { // intron
assert(len >= 2); assert(len >= 2);
mm_sprintf_lite(s, "~%c%c%d%c%c", "acgtn"[tseq[t_off]], "acgtn"[tseq[t_off+1]], mm_sprintf_lite(s, "~%c%c%d%c%c", "acgtn"[tseq[t_off]], "acgtn"[tseq[t_off+1]],
len, "acgtn"[tseq[t_off+len-2]], "acgtn"[tseq[t_off+len-1]]); len, "acgtn"[tseq[t_off+len-2]], "acgtn"[tseq[t_off+len-1]]);
@@ -197,9 +180,87 @@ static void write_cs(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_
} }
} }
assert(t_off == r->re - r->rs && q_off == r->qe - r->qs); assert(t_off == r->re - r->rs && q_off == r->qe - r->qs);
}
static void write_MD_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq, const mm_reg1_t *r, char *tmp, int write_tag)
{
int i, q_off, t_off, l_MD = 0;
if (write_tag) mm_sprintf_lite(s, "\tMD:Z:");
for (i = q_off = t_off = 0; i < (int)r->p->n_cigar; ++i) {
int j, op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
assert((op >= 0 && op <= 3) || op == 7 || op == 8);
if (op == 0 || op == 7 || op == 8) { // match
for (j = 0; j < len; ++j) {
if (qseq[q_off + j] != tseq[t_off + j]) {
mm_sprintf_lite(s, "%d%c", l_MD, "ACGTN"[tseq[t_off + j]]);
l_MD = 0;
} else ++l_MD;
}
q_off += len, t_off += len;
} else if (op == 1) { // insertion to ref
q_off += len;
} else if (op == 2) { // deletion from ref
for (j = 0, tmp[len] = 0; j < len; ++j)
tmp[j] = "ACGTN"[tseq[t_off + j]];
mm_sprintf_lite(s, "%d^%s", l_MD, tmp);
l_MD = 0;
t_off += len;
} else if (op == 3) { // reference skip
t_off += len;
}
}
if (l_MD > 0) mm_sprintf_lite(s, "%d", l_MD);
assert(t_off == r->re - r->rs && q_off == r->qe - r->qs);
}
static void write_cs_or_MD(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int no_iden, int is_MD, int write_tag)
{
extern unsigned char seq_nt4_table[256];
int i;
uint8_t *qseq, *tseq;
char *tmp;
if (r->p == 0) return;
qseq = (uint8_t*)kmalloc(km, r->qe - r->qs);
tseq = (uint8_t*)kmalloc(km, r->re - r->rs);
tmp = (char*)kmalloc(km, r->re - r->rs > r->qe - r->qs? r->re - r->rs + 1 : r->qe - r->qs + 1);
mm_idx_getseq(mi, r->rid, r->rs, r->re, tseq);
if (!r->rev) {
for (i = r->qs; i < r->qe; ++i)
qseq[i - r->qs] = seq_nt4_table[(uint8_t)t->seq[i]];
} else {
for (i = r->qs; i < r->qe; ++i) {
uint8_t c = seq_nt4_table[(uint8_t)t->seq[i]];
qseq[r->qe - i - 1] = c >= 4? 4 : 3 - c;
}
}
if (is_MD) write_MD_core(s, tseq, qseq, r, tmp, write_tag);
else write_cs_core(s, tseq, qseq, r, tmp, no_iden, write_tag);
kfree(km, qseq); kfree(km, tseq); kfree(km, tmp); kfree(km, qseq); kfree(km, tseq); kfree(km, tmp);
} }
int mm_gen_cs_or_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int is_MD, int no_iden)
{
mm_bseq1_t t;
kstring_t str;
str.s = *buf, str.l = 0, str.m = *max_len;
t.l_seq = strlen(seq);
t.seq = (char*)seq;
write_cs_or_MD(km, &str, mi, &t, r, no_iden, is_MD, 0);
*max_len = str.m;
*buf = str.s;
return str.l;
}
int mm_gen_cs(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int no_iden)
{
return mm_gen_cs_or_MD(km, buf, max_len, mi, r, seq, 0, no_iden);
}
int mm_gen_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq)
{
return mm_gen_cs_or_MD(km, buf, max_len, mi, r, seq, 1, 0);
}
static inline void write_tags(kstring_t *s, const mm_reg1_t *r) static inline void write_tags(kstring_t *s, const mm_reg1_t *r)
{ {
int type; int type;
@@ -224,6 +285,10 @@ static inline void write_tags(kstring_t *s, const mm_reg1_t *r)
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int opt_flag) void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int opt_flag)
{ {
s->l = 0; s->l = 0;
if (r == 0) {
mm_sprintf_lite(s, "%s\t%d", t->name, t->l_seq);
return;
}
mm_sprintf_lite(s, "%s\t%d\t%d\t%d\t%c\t", t->name, t->l_seq, r->qs, r->qe, "+-"[r->rev]); mm_sprintf_lite(s, "%s\t%d\t%d\t%d\t%c\t", t->name, t->l_seq, r->qs, r->qe, "+-"[r->rev]);
if (mi->seq[r->rid].name) mm_sprintf_lite(s, "%s", mi->seq[r->rid].name); if (mi->seq[r->rid].name) mm_sprintf_lite(s, "%s", mi->seq[r->rid].name);
else mm_sprintf_lite(s, "%d", r->rid); else mm_sprintf_lite(s, "%d", r->rid);
@@ -235,10 +300,12 @@ void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const m
uint32_t k; uint32_t k;
mm_sprintf_lite(s, "\tcg:Z:"); mm_sprintf_lite(s, "\tcg:Z:");
for (k = 0; k < r->p->n_cigar; ++k) for (k = 0; k < r->p->n_cigar; ++k)
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDN"[r->p->cigar[k]&0xf]); mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDNSHP=XB"[r->p->cigar[k]&0xf]);
} }
if (r->p && (opt_flag & MM_F_OUT_CS)) if (r->p && (opt_flag & (MM_F_OUT_CS|MM_F_OUT_MD)))
write_cs(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG)); write_cs_or_MD(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG), opt_flag&MM_F_OUT_MD, 1);
if ((opt_flag & MM_F_COPY_COMMENT) && t->comment)
mm_sprintf_lite(s, "\t%s", t->comment);
} }
static void sam_write_sq(kstring_t *s, char *seq, int l, int rev, int comp) static void sam_write_sq(kstring_t *s, char *seq, int l, int rev, int comp)
@@ -284,7 +351,7 @@ static void write_sam_cigar(kstring_t *s, int sam_flag, int in_tag, int qlen, co
int clip_char = (sam_flag&0x800) && !(opt_flag&MM_F_SOFTCLIP)? 'H' : 'S'; int clip_char = (sam_flag&0x800) && !(opt_flag&MM_F_SOFTCLIP)? 'H' : 'S';
if (clip_len[0]) mm_sprintf_lite(s, "%d%c", clip_len[0], clip_char); if (clip_len[0]) mm_sprintf_lite(s, "%d%c", clip_len[0], clip_char);
for (k = 0; k < r->p->n_cigar; ++k) for (k = 0; k < r->p->n_cigar; ++k)
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDN"[r->p->cigar[k]&0xf]); mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDNSHP=XB"[r->p->cigar[k]&0xf]);
if (clip_len[1]) mm_sprintf_lite(s, "%d%c", clip_len[1], clip_char); if (clip_len[1]) mm_sprintf_lite(s, "%d%c", clip_len[1], clip_char);
} }
} }
@@ -353,9 +420,11 @@ void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
cigar_in_tag = 1; cigar_in_tag = 1;
} }
if (cigar_in_tag) { if (cigar_in_tag) {
if (flag & 0x100) mm_sprintf_lite(s, "0S"); // secondary alignment int slen;
else if (flag & 0x800) mm_sprintf_lite(s, "%dS", r->re - r->rs); // supplementary alignment if ((flag & 0x900) == 0 || (opt_flag & MM_F_SOFTCLIP)) slen = t->l_seq;
else mm_sprintf_lite(s, "%dS", t->l_seq); else if (flag & 0x100) slen = 0;
else slen = r->qe - r->qs;
mm_sprintf_lite(s, "%dS%dN", slen, r->re - r->rs);
} else write_sam_cigar(s, flag, 0, t->l_seq, r, opt_flag); } else write_sam_cigar(s, flag, 0, t->l_seq, r, opt_flag);
} }
@@ -434,12 +503,15 @@ void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
} }
} }
} }
if (r->p && (opt_flag & MM_F_OUT_CS)) if (r->p && (opt_flag & (MM_F_OUT_CS|MM_F_OUT_MD)))
write_cs(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG)); write_cs_or_MD(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG), opt_flag&MM_F_OUT_MD, 1);
if (cigar_in_tag) if (cigar_in_tag)
write_sam_cigar(s, flag, 1, t->l_seq, r, opt_flag); write_sam_cigar(s, flag, 1, t->l_seq, r, opt_flag);
} }
if ((opt_flag & MM_F_COPY_COMMENT) && t->comment)
mm_sprintf_lite(s, "\t%s", t->comment);
s->s[s->l] = 0; // we always have room for an extra byte (see str_enlarge) s->s[s->l] = 0; // we always have room for an extra byte (see str_enlarge)
} }
-216
View File
@@ -1,216 +0,0 @@
#include <stddef.h>
#include <stdio.h>
#include <string.h>
#include "getopt.h"
char *optarg;
int optind=1, opterr=1, optopt, __optpos, optreset=0;
#define optpos __optpos
static void __getopt_msg(const char *a, const char *b, const char *c, size_t l)
{
FILE *f = stderr;
#if !defined(WIN32) && !defined(_WIN32)
flockfile(f);
#endif
fputs(a, f);
fwrite(b, strlen(b), 1, f);
fwrite(c, 1, l, f);
fputc('\n', f);
#if !defined(WIN32) && !defined(_WIN32)
funlockfile(f);
#endif
}
int getopt(int argc, char * const argv[], const char *optstring)
{
int i, c, d;
int k, l;
char *optchar;
if (!optind || optreset) {
optreset = 0;
__optpos = 0;
optind = 1;
}
if (optind >= argc || !argv[optind])
return -1;
if (argv[optind][0] != '-') {
if (optstring[0] == '-') {
optarg = argv[optind++];
return 1;
}
return -1;
}
if (!argv[optind][1])
return -1;
if (argv[optind][1] == '-' && !argv[optind][2])
return optind++, -1;
if (!optpos) optpos++;
c = argv[optind][optpos], k = 1;
optchar = argv[optind]+optpos;
optopt = c;
optpos += k;
if (!argv[optind][optpos]) {
optind++;
optpos = 0;
}
if (optstring[0] == '-' || optstring[0] == '+')
optstring++;
i = 0;
d = 0;
do {
d = optstring[i], l = 1;
if (l>0) i+=l; else i++;
} while (l && d != c);
if (d != c) {
if (optstring[0] != ':' && opterr)
__getopt_msg(argv[0], ": unrecognized option: ", optchar, k);
return '?';
}
if (optstring[i] == ':') {
if (optstring[i+1] == ':') optarg = 0;
else if (optind >= argc) {
if (optstring[0] == ':') return ':';
if (opterr) __getopt_msg(argv[0],
": option requires an argument: ",
optchar, k);
return '?';
}
if (optstring[i+1] != ':' || optpos) {
optarg = argv[optind++] + optpos;
optpos = 0;
}
}
return c;
}
static void permute(char *const *argv, int dest, int src)
{
char **av = (char **)argv;
char *tmp = av[src];
int i;
for (i=src; i>dest; i--)
av[i] = av[i-1];
av[dest] = tmp;
}
static int __getopt_long_core(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx, int longonly)
{
optarg = 0;
if (longopts && argv[optind][0] == '-' &&
((longonly && argv[optind][1] && argv[optind][1] != '-') ||
(argv[optind][1] == '-' && argv[optind][2])))
{
int colon = optstring[optstring[0]=='+'||optstring[0]=='-']==':';
int i, cnt, match = -1;
char *opt;
for (cnt=i=0; longopts[i].name; i++) {
const char *name = longopts[i].name;
opt = argv[optind]+1;
if (*opt == '-') opt++;
for (; *name && *name == *opt; name++, opt++);
if (*opt && *opt != '=') continue;
match = i;
if (!*name) {
cnt = 1;
break;
}
cnt++;
}
if (cnt==1) {
i = match;
optind++;
optopt = longopts[i].val;
if (*opt == '=') {
if (!longopts[i].has_arg) {
if (colon || !opterr)
return '?';
__getopt_msg(argv[0],
": option does not take an argument: ",
longopts[i].name,
strlen(longopts[i].name));
return '?';
}
optarg = opt+1;
} else if (longopts[i].has_arg == required_argument) {
if (!(optarg = argv[optind])) {
if (colon) return ':';
if (!opterr) return '?';
__getopt_msg(argv[0],
": option requires an argument: ",
longopts[i].name,
strlen(longopts[i].name));
return '?';
}
optind++;
}
if (idx) *idx = i;
if (longopts[i].flag) {
*longopts[i].flag = longopts[i].val;
return 0;
}
return longopts[i].val;
}
if (argv[optind][1] == '-') {
if (!colon && opterr)
__getopt_msg(argv[0], cnt ?
": option is ambiguous: " :
": unrecognized option: ",
argv[optind]+2,
strlen(argv[optind]+2));
optind++;
return '?';
}
}
return getopt(argc, argv, optstring);
}
static int __getopt_long(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx, int longonly)
{
int ret, skipped, resumed;
if (!optind || optreset) {
optreset = 0;
__optpos = 0;
optind = 1;
}
if (optind >= argc || !argv[optind]) return -1;
skipped = optind;
if (optstring[0] != '+' && optstring[0] != '-') {
int i;
for (i=optind; ; i++) {
if (i >= argc || !argv[i]) return -1;
if (argv[i][0] == '-' && argv[i][1]) break;
}
optind = i;
}
resumed = optind;
ret = __getopt_long_core(argc, argv, optstring, longopts, idx, longonly);
if (resumed > skipped) {
int i, cnt = optind-resumed;
for (i=0; i<cnt; i++)
permute(argv, skipped, optind-1);
optind = skipped + cnt;
}
return ret;
}
int getopt_long(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx)
{
return __getopt_long(argc, argv, optstring, longopts, idx, 0);
}
int getopt_long_only(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx)
{
return __getopt_long(argc, argv, optstring, longopts, idx, 1);
}
-53
View File
@@ -1,53 +0,0 @@
/*
Copyright 2005-2014 Rich Felker, et al.
Permission is hereby granted, free of charge, to any person obtaining
a copy of this software and associated documentation files (the
"Software"), to deal in the Software without restriction, including
without limitation the rights to use, copy, modify, merge, publish,
distribute, sublicense, and/or sell copies of the Software, and to
permit persons to whom the Software is furnished to do so, subject to
the following conditions:
The above copyright notice and this permission notice shall be
included in all copies or substantial portions of the Software.
THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT.
IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY
CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT,
TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE
SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
*/
#ifndef _GETOPT_H
#define _GETOPT_H
#ifdef __cplusplus
extern "C" {
#endif
int getopt(int, char * const [], const char *);
extern char *optarg;
extern int optind, opterr, optopt, optreset;
struct option {
const char *name;
int has_arg;
int *flag;
int val;
};
int getopt_long(int, char *const *, const char *, const struct option *, int *);
int getopt_long_only(int, char *const *, const char *, const struct option *, int *);
#define no_argument 0
#define required_argument 1
#define optional_argument 2
#ifdef __cplusplus
}
#endif
#endif
+54 -16
View File
@@ -94,6 +94,7 @@ void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a)
r2->id = -1; r2->id = -1;
r2->sam_pri = 0; r2->sam_pri = 0;
r2->p = 0; r2->p = 0;
r2->split_inv = 0;
r2->cnt = r->cnt - n; r2->cnt = r->cnt - n;
r2->score = (int32_t)(r->score * ((float)r2->cnt / r->cnt) + .499); r2->score = (int32_t)(r->score * ((float)r2->cnt / r->cnt) + .499);
r2->as = r->as + n; r2->as = r->as + n;
@@ -105,7 +106,7 @@ void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a)
r->split |= 1, r2->split |= 2; r->split |= 1, r2->split |= 2;
} }
void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r, int sub_diff) // and compute mm_reg1_t::subsc void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r, int sub_diff, int hard_mask_level) // and compute mm_reg1_t::subsc
{ {
int i, j, k, *w; int i, j, k, *w;
uint64_t *cov; uint64_t *cov;
@@ -117,6 +118,7 @@ void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r, int sub_diff
for (i = 1, k = 1; i < n; ++i) { for (i = 1, k = 1; i < n; ++i) {
mm_reg1_t *ri = &r[i]; mm_reg1_t *ri = &r[i];
int si = ri->qs, ei = ri->qe, n_cov = 0, uncov_len = 0; int si = ri->qs, ei = ri->qe, n_cov = 0, uncov_len = 0;
if (hard_mask_level) goto skip_uncov;
for (j = 0; j < k; ++j) { // traverse existing primary hits to find overlapping hits for (j = 0; j < k; ++j) { // traverse existing primary hits to find overlapping hits
mm_reg1_t *rp = &r[w[j]]; mm_reg1_t *rp = &r[w[j]];
int sj = rp->qs, ej = rp->qe; int sj = rp->qs, ej = rp->qe;
@@ -131,18 +133,19 @@ void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r, int sub_diff
int j, x = si; int j, x = si;
radix_sort_64(cov, cov + n_cov); radix_sort_64(cov, cov + n_cov);
for (j = 0; j < n_cov; ++j) { for (j = 0; j < n_cov; ++j) {
if (cov[j]>>32 > x) uncov_len += (cov[j]>>32) - x; if ((int)(cov[j]>>32) > x) uncov_len += (cov[j]>>32) - x;
x = (int32_t)cov[j] > x? (int32_t)cov[j] : x; x = (int32_t)cov[j] > x? (int32_t)cov[j] : x;
} }
if (ei > x) uncov_len += ei - x; if (ei > x) uncov_len += ei - x;
} }
skip_uncov:
for (j = 0; j < k; ++j) { // traverse existing primary hits again for (j = 0; j < k; ++j) { // traverse existing primary hits again
mm_reg1_t *rp = &r[w[j]]; mm_reg1_t *rp = &r[w[j]];
int sj = rp->qs, ej = rp->qe, min, max, ol; int sj = rp->qs, ej = rp->qe, min, max, ol;
if (ej <= si || sj >= ei) continue; // no overlap if (ej <= si || sj >= ei) continue; // no overlap
min = ej - sj < ei - si? ej - sj : ei - si; min = ej - sj < ei - si? ej - sj : ei - si;
max = ej - sj > ei - si? ej - sj : ei - si; max = ej - sj > ei - si? ej - sj : ei - si;
ol = si < sj? (ei < sj? 0 : ei < ej? ei - sj : ej - sj) : (ej < si? 0 : ej < ei? ej - si : ei - si); // overlap length ol = si < sj? (ei < sj? 0 : ei < ej? ei - sj : ej - sj) : (ej < si? 0 : ej < ei? ej - si : ei - si); // overlap length; TODO: this can be simplified
if ((float)ol / min - (float)uncov_len / max > mask_level) { if ((float)ol / min - (float)uncov_len / max > mask_level) {
int cnt_sub = 0; int cnt_sub = 0;
ri->parent = rp->parent; ri->parent = rp->parent;
@@ -163,9 +166,9 @@ set_parent_test:
kfree(km, w); kfree(km, w);
} }
void mm_hit_sort_by_dp(void *km, int *n_regs, mm_reg1_t *r) void mm_hit_sort(void *km, int *n_regs, mm_reg1_t *r)
{ {
int32_t i, n_aux, n = *n_regs; int32_t i, n_aux, n = *n_regs, has_cigar = 0, no_cigar = 0;
mm128_t *aux; mm128_t *aux;
mm_reg1_t *t; mm_reg1_t *t;
@@ -174,14 +177,20 @@ void mm_hit_sort_by_dp(void *km, int *n_regs, mm_reg1_t *r)
t = (mm_reg1_t*)kmalloc(km, n * sizeof(mm_reg1_t)); t = (mm_reg1_t*)kmalloc(km, n * sizeof(mm_reg1_t));
for (i = n_aux = 0; i < n; ++i) { for (i = n_aux = 0; i < n; ++i) {
if (r[i].inv || r[i].cnt > 0) { // squeeze out elements with cnt==0 (soft deleted) if (r[i].inv || r[i].cnt > 0) { // squeeze out elements with cnt==0 (soft deleted)
assert(r[i].p); if (r[i].p) {
aux[n_aux].x = (uint64_t)r[i].p->dp_max << 32 | r[i].hash; aux[n_aux].x = (uint64_t)r[i].p->dp_max << 32 | r[i].hash;
has_cigar = 1;
} else {
aux[n_aux].x = (uint64_t)r[i].score << 32 | r[i].hash;
no_cigar = 1;
}
aux[n_aux++].y = i; aux[n_aux++].y = i;
} else if (r[i].p) { } else if (r[i].p) {
free(r[i].p); free(r[i].p);
r[i].p = 0; r[i].p = 0;
} }
} }
assert(has_cigar + no_cigar == 1);
radix_sort_128x(aux, aux + n_aux); radix_sort_128x(aux, aux + n_aux);
for (i = n_aux - 1; i >= 0; --i) for (i = n_aux - 1; i >= 0; --i)
t[n_aux - 1 - i] = r[aux[i].y]; t[n_aux - 1 - i] = r[aux[i].y];
@@ -245,16 +254,17 @@ void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int *n_,
} }
} }
void mm_filter_regs(void *km, const mm_mapopt_t *opt, int *n_regs, mm_reg1_t *regs) void mm_filter_regs(const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs)
{ // NB: after this call, mm_reg1_t::parent can be -1 if its parent filtered out { // NB: after this call, mm_reg1_t::parent can be -1 if its parent filtered out
int i, k; int i, k;
for (i = k = 0; i < *n_regs; ++i) { for (i = k = 0; i < *n_regs; ++i) {
mm_reg1_t *r = &regs[i]; mm_reg1_t *r = &regs[i];
int flt = 0; int flt = 0;
if (!r->inv && !r->seg_split && r->cnt < opt->min_cnt) flt = 1; if (!r->inv && !r->seg_split && r->cnt < opt->min_cnt) flt = 1;
if (r->p) { if (r->p) { // these filters are only applied when base-alignment is available
if (r->mlen < opt->min_chain_score) flt = 1; if (r->mlen < opt->min_chain_score) flt = 1;
else if (r->p->dp_max < opt->min_dp_max) flt = 1; else if (r->p->dp_max < opt->min_dp_max) flt = 1;
else if (r->qs > qlen * opt->max_clip_ratio && qlen - r->qe > qlen * opt->max_clip_ratio) flt = 1;
if (flt) free(r->p); if (flt) free(r->p);
} }
if (!flt) { if (!flt) {
@@ -302,7 +312,7 @@ void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs_, mm_r
for (i = n_aux - 1; i >= 1; --i) { for (i = n_aux - 1; i >= 1; --i) {
mm_reg1_t *r0 = &regs[(int32_t)aux[i-1]], *r1 = &regs[(int32_t)aux[i]]; mm_reg1_t *r0 = &regs[(int32_t)aux[i-1]], *r1 = &regs[(int32_t)aux[i]];
mm128_t *a0e, *a1s; mm128_t *a0e, *a1s;
int max_gap, min_gap, sc_thres; int max_gap, min_gap, sc_thres, min_flank_len;
// test // test
if (r0->as + r0->cnt != r1->as) continue; // not adjacent in a[] if (r0->as + r0->cnt != r1->as) continue; // not adjacent in a[]
@@ -311,13 +321,14 @@ void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs_, mm_r
a1s = &a[r1->as]; a1s = &a[r1->as];
if (a1s->x <= a0e->x || (int32_t)a1s->y <= (int32_t)a0e->y) continue; // keep colinearity if (a1s->x <= a0e->x || (int32_t)a1s->y <= (int32_t)a0e->y) continue; // keep colinearity
max_gap = min_gap = (int32_t)a1s->y - (int32_t)a0e->y; max_gap = min_gap = (int32_t)a1s->y - (int32_t)a0e->y;
max_gap = max_gap > a1s->x - a0e->x? max_gap : a1s->x - a0e->x; max_gap = a0e->x + max_gap > a1s->x? max_gap : a1s->x - a0e->x;
min_gap = min_gap < a1s->x - a0e->x? min_gap : a1s->x - a0e->x; min_gap = a0e->x + min_gap < a1s->x? min_gap : a1s->x - a0e->x;
if (max_gap > opt->max_join_long || min_gap > opt->max_join_short) continue; if (max_gap > opt->max_join_long || min_gap > opt->max_join_short) continue;
sc_thres = (int)((float)opt->min_join_flank_sc / opt->max_join_long * max_gap + .499); sc_thres = (int)((float)opt->min_join_flank_sc / opt->max_join_long * max_gap + .499);
if (r0->score < sc_thres || r1->score < sc_thres) continue; // require good flanking chains if (r0->score < sc_thres || r1->score < sc_thres) continue; // require good flanking chains
if (r0->re - r0->rs < max_gap>>1 || r0->qe - r0->qs < max_gap>>1) continue; // require enough flanking length min_flank_len = (int)(max_gap * opt->min_join_flank_ratio);
if (r1->re - r1->rs < max_gap>>1 || r1->qe - r1->qs < max_gap>>1) continue; if (r0->re - r0->rs < min_flank_len || r0->qe - r0->qs < min_flank_len) continue; // require enough flanking length
if (r1->re - r1->rs < min_flank_len || r1->qe - r1->qs < min_flank_len) continue;
// all conditions satisfied; join // all conditions satisfied; join
a[r1->as].y |= MM_SEED_LONG_JOIN; a[r1->as].y |= MM_SEED_LONG_JOIN;
@@ -337,7 +348,7 @@ void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs_, mm_r
r->parent = regs[r->parent].parent; r->parent = regs[r->parent].parent;
} }
} }
mm_filter_regs(km, opt, n_regs_, regs); mm_filter_regs(opt, qlen, n_regs_, regs);
mm_sync_regs(km, *n_regs_, regs); mm_sync_regs(km, *n_regs_, regs);
} }
} }
@@ -406,7 +417,33 @@ void mm_seg_free(void *km, int n_segs, mm_seg_t *segs)
kfree(km, segs); kfree(km, segs);
} }
void mm_set_mapq(int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr) static void mm_set_inv_mapq(void *km, int n_regs, mm_reg1_t *regs)
{
int i, n_aux;
mm128_t *aux;
if (n_regs < 3) return;
for (i = 0; i < n_regs; ++i)
if (regs[i].inv) break;
if (i == n_regs) return; // no inversion hits
aux = (mm128_t*)kmalloc(km, n_regs * 16);
for (i = n_aux = 0; i < n_regs; ++i)
if (regs[i].parent == i || regs[i].parent < 0)
aux[n_aux].y = i, aux[n_aux++].x = (uint64_t)regs[i].rid << 32 | regs[i].rs;
radix_sort_128x(aux, aux + n_aux);
for (i = 1; i < n_aux - 1; ++i) {
mm_reg1_t *inv = &regs[aux[i].y];
if (inv->inv) {
mm_reg1_t *l = &regs[aux[i-1].y];
mm_reg1_t *r = &regs[aux[i+1].y];
inv->mapq = l->mapq < r->mapq? l->mapq : r->mapq;
}
}
kfree(km, aux);
}
void mm_set_mapq(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr)
{ {
static const float q_coef = 40.0f; static const float q_coef = 40.0f;
int64_t sum_sc = 0; int64_t sum_sc = 0;
@@ -449,4 +486,5 @@ void mm_set_mapq(int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, in
if (r->p && r->p->dp_max > r->p->dp_max2 && r->mapq == 0) r->mapq = 1; if (r->p && r->p->dp_max > r->p->dp_max2 && r->mapq == 0) r->mapq = 1;
} else r->mapq = 0; } else r->mapq = 0;
} }
mm_set_inv_mapq(km, n_regs, regs);
} }
+75 -34
View File
@@ -20,6 +20,8 @@
KHASH_INIT(idx, uint64_t, uint64_t, 1, idx_hash, idx_eq) KHASH_INIT(idx, uint64_t, uint64_t, 1, idx_hash, idx_eq)
typedef khash_t(idx) idxhash_t; typedef khash_t(idx) idxhash_t;
KHASH_MAP_INIT_STR(str, uint32_t)
#define kroundup64(x) (--(x), (x)|=(x)>>1, (x)|=(x)>>2, (x)|=(x)>>4, (x)|=(x)>>8, (x)|=(x)>>16, (x)|=(x)>>32, ++(x)) #define kroundup64(x) (--(x), (x)|=(x)>>1, (x)|=(x)>>2, (x)|=(x)>>4, (x)|=(x)>>8, (x)|=(x)>>16, (x)|=(x)>>32, ++(x))
typedef struct mm_idx_bucket_s { typedef struct mm_idx_bucket_s {
@@ -29,15 +31,6 @@ typedef struct mm_idx_bucket_s {
void *h; // hash table indexing _p_ and minimizers appearing once void *h; // hash table indexing _p_ and minimizers appearing once
} mm_idx_bucket_t; } mm_idx_bucket_t;
void mm_idxopt_init(mm_idxopt_t *opt)
{
memset(opt, 0, sizeof(mm_idxopt_t));
opt->k = 15, opt->w = 10, opt->flag = 0;
opt->bucket_bits = 14;
opt->mini_batch_size = 50000000;
opt->batch_size = 4000000000ULL;
}
mm_idx_t *mm_idx_init(int w, int k, int b, int flag) mm_idx_t *mm_idx_init(int w, int k, int b, int flag)
{ {
mm_idx_t *mi; mm_idx_t *mi;
@@ -52,12 +45,15 @@ mm_idx_t *mm_idx_init(int w, int k, int b, int flag)
void mm_idx_destroy(mm_idx_t *mi) void mm_idx_destroy(mm_idx_t *mi)
{ {
int i; uint32_t i;
if (mi == 0) return; if (mi == 0) return;
for (i = 0; i < 1<<mi->b; ++i) { if (mi->h) kh_destroy(str, (khash_t(str)*)mi->h);
free(mi->B[i].p); if (mi->B) {
free(mi->B[i].a.a); for (i = 0; i < 1U<<mi->b; ++i) {
kh_destroy(idx, (idxhash_t*)mi->B[i].h); free(mi->B[i].p);
free(mi->B[i].a.a);
kh_destroy(idx, (idxhash_t*)mi->B[i].h);
}
} }
if (!mi->km) { if (!mi->km) {
for (i = 0; i < mi->n_seq; ++i) for (i = 0; i < mi->n_seq; ++i)
@@ -88,14 +84,15 @@ const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n)
void mm_idx_stat(const mm_idx_t *mi) void mm_idx_stat(const mm_idx_t *mi)
{ {
int i, n = 0, n1 = 0; int n = 0, n1 = 0;
uint32_t i;
uint64_t sum = 0, len = 0; uint64_t sum = 0, len = 0;
fprintf(stderr, "[M::%s] kmer size: %d; skip: %d; is_hpc: %d; #seq: %d\n", __func__, mi->k, mi->w, mi->flag&MM_I_HPC, mi->n_seq); fprintf(stderr, "[M::%s] kmer size: %d; skip: %d; is_hpc: %d; #seq: %d\n", __func__, mi->k, mi->w, mi->flag&MM_I_HPC, mi->n_seq);
for (i = 0; i < mi->n_seq; ++i) for (i = 0; i < mi->n_seq; ++i)
len += mi->seq[i].len; len += mi->seq[i].len;
for (i = 0; i < 1<<mi->b; ++i) for (i = 0; i < 1U<<mi->b; ++i)
if (mi->B[i].h) n += kh_size((idxhash_t*)mi->B[i].h); if (mi->B[i].h) n += kh_size((idxhash_t*)mi->B[i].h);
for (i = 0; i < 1<<mi->b; ++i) { for (i = 0; i < 1U<<mi->b; ++i) {
idxhash_t *h = (idxhash_t*)mi->B[i].h; idxhash_t *h = (idxhash_t*)mi->B[i].h;
khint_t k; khint_t k;
if (h == 0) continue; if (h == 0) continue;
@@ -109,6 +106,34 @@ void mm_idx_stat(const mm_idx_t *mi)
__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), n, 100.0*n1/n, (double)sum / n, (double)len / sum); __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), n, 100.0*n1/n, (double)sum / n, (double)len / sum);
} }
int mm_idx_index_name(mm_idx_t *mi)
{
khash_t(str) *h;
uint32_t i;
int has_dup = 0, absent;
if (mi->h) return 0;
h = kh_init(str);
for (i = 0; i < mi->n_seq; ++i) {
khint_t k;
k = kh_put(str, h, mi->seq[i].name, &absent);
if (absent) kh_val(h, k) = i;
else has_dup = 1;
}
mi->h = h;
if (has_dup && mm_verbose >= 2)
fprintf(stderr, "[WARNING] some database sequences have identical sequence names\n");
return has_dup;
}
int mm_idx_name2id(const mm_idx_t *mi, const char *name)
{
khash_t(str) *h = (khash_t(str)*)mi->h;
khint_t k;
if (h == 0) return -2;
k = kh_get(str, h, name);
return k == kh_end(h)? -1 : kh_val(h, k);
}
int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq) int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq)
{ {
uint64_t i, st1, en1; uint64_t i, st1, en1;
@@ -150,7 +175,8 @@ int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f)
static void worker_post(void *g, long i, int tid) static void worker_post(void *g, long i, int tid)
{ {
int j, start_a, start_p, n, n_keys; int n, n_keys;
size_t j, start_a, start_p;
idxhash_t *h; idxhash_t *h;
mm_idx_t *mi = (mm_idx_t*)g; mm_idx_t *mi = (mm_idx_t*)g;
mm_idx_bucket_t *b = &mi->B[i]; mm_idx_bucket_t *b = &mi->B[i];
@@ -178,7 +204,7 @@ static void worker_post(void *g, long i, int tid)
int absent; int absent;
mm128_t *p = &b->a.a[j-1]; mm128_t *p = &b->a.a[j-1];
itr = kh_put(idx, h, p->x>>8>>mi->b<<1, &absent); itr = kh_put(idx, h, p->x>>8>>mi->b<<1, &absent);
assert(absent && j - start_a == n); assert(absent && j == start_a + n);
if (n == 1) { if (n == 1) {
kh_key(h, itr) |= 1; kh_key(h, itr) |= 1;
kh_val(h, itr) = p->y; kh_val(h, itr) = p->y;
@@ -194,7 +220,7 @@ static void worker_post(void *g, long i, int tid)
} else ++n; } else ++n;
} }
b->h = h; b->h = h;
assert(b->n == start_p); assert(b->n == (int32_t)start_p);
// deallocate and clear b->a // deallocate and clear b->a
kfree(0, b->a.a); kfree(0, b->a.a);
@@ -314,7 +340,7 @@ mm_idx_t *mm_idx_gen(mm_bseq_file_t *fp, int w, int k, int b, int flag, int mini
pipeline_t pl; pipeline_t pl;
if (fp == 0 || mm_bseq_eof(fp)) return 0; if (fp == 0 || mm_bseq_eof(fp)) return 0;
memset(&pl, 0, sizeof(pipeline_t)); memset(&pl, 0, sizeof(pipeline_t));
pl.mini_batch_size = mini_batch_size < batch_size? mini_batch_size : batch_size; pl.mini_batch_size = (uint64_t)mini_batch_size < batch_size? mini_batch_size : batch_size;
pl.batch_size = batch_size; pl.batch_size = batch_size;
pl.fp = fp; pl.fp = fp;
pl.mi = mm_idx_init(w, k, b, flag); pl.mi = mm_idx_init(w, k, b, flag);
@@ -346,7 +372,9 @@ mm_idx_t *mm_idx_str(int w, int k, int is_hpc, int bucket_bits, int n, const cha
uint64_t sum_len = 0; uint64_t sum_len = 0;
mm128_v a = {0,0,0}; mm128_v a = {0,0,0};
mm_idx_t *mi; mm_idx_t *mi;
khash_t(str) *h;
int i, flag = 0; int i, flag = 0;
if (n <= 0) return 0; if (n <= 0) return 0;
for (i = 0; i < n; ++i) // get the total length for (i = 0; i < n; ++i) // get the total length
sum_len += strlen(seq[i]); sum_len += strlen(seq[i]);
@@ -357,13 +385,17 @@ mm_idx_t *mm_idx_str(int w, int k, int is_hpc, int bucket_bits, int n, const cha
mi->n_seq = n; mi->n_seq = n;
mi->seq = (mm_idx_seq_t*)kcalloc(mi->km, n, sizeof(mm_idx_seq_t)); // ->seq is allocated from km mi->seq = (mm_idx_seq_t*)kcalloc(mi->km, n, sizeof(mm_idx_seq_t)); // ->seq is allocated from km
mi->S = (uint32_t*)calloc((sum_len + 7) / 8, 4); mi->S = (uint32_t*)calloc((sum_len + 7) / 8, 4);
mi->h = h = kh_init(str);
for (i = 0, sum_len = 0; i < n; ++i) { for (i = 0, sum_len = 0; i < n; ++i) {
const char *s = seq[i]; const char *s = seq[i];
mm_idx_seq_t *p = &mi->seq[i]; mm_idx_seq_t *p = &mi->seq[i];
uint32_t j; uint32_t j;
if (name && name[i]) { if (name && name[i]) {
int absent;
p->name = (char*)kmalloc(mi->km, strlen(name[i]) + 1); p->name = (char*)kmalloc(mi->km, strlen(name[i]) + 1);
strcpy(p->name, name[i]); strcpy(p->name, name[i]);
kh_put(str, h, p->name, &absent);
assert(absent);
} }
p->offset = sum_len; p->offset = sum_len;
p->len = strlen(s); p->len = strlen(s);
@@ -391,17 +423,20 @@ mm_idx_t *mm_idx_str(int w, int k, int is_hpc, int bucket_bits, int n, const cha
void mm_idx_dump(FILE *fp, const mm_idx_t *mi) void mm_idx_dump(FILE *fp, const mm_idx_t *mi)
{ {
uint64_t sum_len = 0; uint64_t sum_len = 0;
uint32_t x[5]; uint32_t x[5], i;
int i;
x[0] = mi->w, x[1] = mi->k, x[2] = mi->b, x[3] = mi->n_seq, x[4] = mi->flag; x[0] = mi->w, x[1] = mi->k, x[2] = mi->b, x[3] = mi->n_seq, x[4] = mi->flag;
fwrite(MM_IDX_MAGIC, 1, 4, fp); fwrite(MM_IDX_MAGIC, 1, 4, fp);
fwrite(x, 4, 5, fp); fwrite(x, 4, 5, fp);
for (i = 0; i < mi->n_seq; ++i) { for (i = 0; i < mi->n_seq; ++i) {
uint8_t l; if (mi->seq[i].name) {
l = strlen(mi->seq[i].name); uint8_t l = strlen(mi->seq[i].name);
fwrite(&l, 1, 1, fp); fwrite(&l, 1, 1, fp);
fwrite(mi->seq[i].name, 1, l, fp); fwrite(mi->seq[i].name, 1, l, fp);
} else {
uint8_t l = 0;
fwrite(&l, 1, 1, fp);
}
fwrite(&mi->seq[i].len, 4, 1, fp); fwrite(&mi->seq[i].len, 4, 1, fp);
sum_len += mi->seq[i].len; sum_len += mi->seq[i].len;
} }
@@ -428,9 +463,8 @@ void mm_idx_dump(FILE *fp, const mm_idx_t *mi)
mm_idx_t *mm_idx_load(FILE *fp) mm_idx_t *mm_idx_load(FILE *fp)
{ {
int i;
char magic[4]; char magic[4];
uint32_t x[5]; uint32_t x[5], i;
uint64_t sum_len = 0; uint64_t sum_len = 0;
mm_idx_t *mi; mm_idx_t *mi;
@@ -444,9 +478,11 @@ mm_idx_t *mm_idx_load(FILE *fp)
uint8_t l; uint8_t l;
mm_idx_seq_t *s = &mi->seq[i]; mm_idx_seq_t *s = &mi->seq[i];
fread(&l, 1, 1, fp); fread(&l, 1, 1, fp);
s->name = (char*)kmalloc(mi->km, l + 1); if (l) {
fread(s->name, 1, l, fp); s->name = (char*)kmalloc(mi->km, l + 1);
s->name[l] = 0; fread(s->name, 1, l, fp);
s->name[l] = 0;
}
fread(&s->len, 4, 1, fp); fread(&s->len, 4, 1, fp);
s->offset = sum_len; s->offset = sum_len;
sum_len += s->len; sum_len += s->len;
@@ -482,14 +518,19 @@ mm_idx_t *mm_idx_load(FILE *fp)
int64_t mm_idx_is_idx(const char *fn) int64_t mm_idx_is_idx(const char *fn)
{ {
int fd, is_idx = 0; int fd, is_idx = 0;
off_t ret, off_end; int64_t ret, off_end;
char magic[4]; char magic[4];
if (strcmp(fn, "-") == 0) return 0; // read from pipe; not an index if (strcmp(fn, "-") == 0) return 0; // read from pipe; not an index
fd = open(fn, O_RDONLY); fd = open(fn, O_RDONLY);
if (fd < 0) return -1; // error if (fd < 0) return -1; // error
#ifdef WIN32
if ((off_end = _lseeki64(fd, 0, SEEK_END)) >= 4) {
_lseeki64(fd, 0, SEEK_SET);
#else
if ((off_end = lseek(fd, 0, SEEK_END)) >= 4) { if ((off_end = lseek(fd, 0, SEEK_END)) >= 4) {
lseek(fd, 0, SEEK_SET); lseek(fd, 0, SEEK_SET);
#endif // WIN32
ret = read(fd, magic, 4); ret = read(fd, magic, 4);
if (ret == 4 && strncmp(magic, MM_IDX_MAGIC, 4) == 0) if (ret == 4 && strncmp(magic, MM_IDX_MAGIC, 4) == 0)
is_idx = 1; is_idx = 1;
@@ -535,7 +576,7 @@ mm_idx_t *mm_idx_reader_read(mm_idx_reader_t *r, int n_threads)
mi = mm_idx_gen(r->fp.seq, r->opt.w, r->opt.k, r->opt.bucket_bits, r->opt.flag, r->opt.mini_batch_size, n_threads, r->opt.batch_size); mi = mm_idx_gen(r->fp.seq, r->opt.w, r->opt.k, r->opt.bucket_bits, r->opt.flag, r->opt.mini_batch_size, n_threads, r->opt.batch_size);
if (mi) { if (mi) {
if (r->fp_out) mm_idx_dump(r->fp_out, mi); if (r->fp_out) mm_idx_dump(r->fp_out, mi);
++r->n_parts; mi->index = r->n_parts++;
} }
return mi; return mi;
} }
+116
View File
@@ -0,0 +1,116 @@
#ifndef KETOPT_H
#define KETOPT_H
#include <string.h> /* for strchr() and strncmp() */
#define ko_no_argument 0
#define ko_required_argument 1
#define ko_optional_argument 2
typedef struct {
int ind; /* equivalent to optind */
int opt; /* equivalent to optopt */
char *arg; /* equivalent to optarg */
int longidx; /* index of a long option; or -1 if short */
/* private variables not intended for external uses */
int i, pos, n_args;
} ketopt_t;
typedef struct {
char *name;
int has_arg;
int val;
} ko_longopt_t;
static ketopt_t KETOPT_INIT = { 1, 0, 0, -1, 1, 0, 0 };
static void ketopt_permute(char *argv[], int j, int n) /* move argv[j] over n elements to the left */
{
int k;
char *p = argv[j];
for (k = 0; k < n; ++k)
argv[j - k] = argv[j - k - 1];
argv[j - k] = p;
}
/**
* Parse command-line options and arguments
*
* This fuction has a similar interface to GNU's getopt_long(). Each call
* parses one option and returns the option name. s->arg points to the option
* argument if present. The function returns -1 when all command-line arguments
* are parsed. In this case, s->ind is the index of the first non-option
* argument.
*
* @param s status; shall be initialized to KETOPT_INIT on the first call
* @param argc length of argv[]
* @param argv list of command-line arguments; argv[0] is ignored
* @param permute non-zero to move options ahead of non-option arguments
* @param ostr option string
* @param longopts long options
*
* @return ASCII for a short option; ko_longopt_t::val for a long option; -1 if
* argv[] is fully processed; '?' for an unknown option or an ambiguous
* long option; ':' if an option argument is missing
*/
static int ketopt(ketopt_t *s, int argc, char *argv[], int permute, const char *ostr, const ko_longopt_t *longopts)
{
int opt = -1, i0, j;
if (permute) {
while (s->i < argc && (argv[s->i][0] != '-' || argv[s->i][1] == '\0'))
++s->i, ++s->n_args;
}
s->arg = 0, s->longidx = -1, i0 = s->i;
if (s->i >= argc || argv[s->i][0] != '-' || argv[s->i][1] == '\0') {
s->ind = s->i - s->n_args;
return -1;
}
if (argv[s->i][0] == '-' && argv[s->i][1] == '-') { /* "--" or a long option */
if (argv[s->i][2] == '\0') { /* a bare "--" */
ketopt_permute(argv, s->i, s->n_args);
++s->i, s->ind = s->i - s->n_args;
return -1;
}
s->opt = 0, opt = '?', s->pos = -1;
if (longopts) { /* parse long options */
int k, n_matches = 0;
const ko_longopt_t *o = 0;
for (j = 2; argv[s->i][j] != '\0' && argv[s->i][j] != '='; ++j) {} /* find the end of the option name */
for (k = 0; longopts[k].name != 0; ++k)
if (strncmp(&argv[s->i][2], longopts[k].name, j - 2) == 0)
++n_matches, o = &longopts[k];
if (n_matches == 1) {
s->opt = opt = o->val, s->longidx = o - longopts;
if (argv[s->i][j] == '=') s->arg = &argv[s->i][j + 1];
if (o->has_arg == 1 && argv[s->i][j] == '\0') {
if (s->i < argc - 1) s->arg = argv[++s->i];
else opt = ':'; /* missing option argument */
}
}
}
} else { /* a short option */
char *p;
if (s->pos == 0) s->pos = 1;
opt = s->opt = argv[s->i][s->pos++];
p = strchr(ostr, opt);
if (p == 0) {
opt = '?'; /* unknown option */
} else if (p[1] == ':') {
if (argv[s->i][s->pos] == 0) {
if (s->i < argc - 1) s->arg = argv[++s->i];
else opt = ':'; /* missing option argument */
} else s->arg = &argv[s->i][s->pos];
s->pos = -1;
}
}
if (s->pos < 0 || argv[s->i][s->pos] == 0) {
++s->i, s->pos = 0;
if (s->n_args > 0) /* permute */
for (j = i0; j < s->i; ++j)
ketopt_permute(argv, j, s->n_args);
}
s->ind = s->i - s->n_args;
return opt;
}
#endif
+2 -2
View File
@@ -127,11 +127,11 @@ static inline void ksw_backtrack(void *km, int is_rot, int is_rev, int min_intro
r = i + j; r = i + j;
if (i < off[r]) force_state = 2; if (i < off[r]) force_state = 2;
if (off_end && i > off_end[r]) force_state = 1; if (off_end && i > off_end[r]) force_state = 1;
tmp = force_state < 0? p[r * n_col + i - off[r]] : 0; tmp = force_state < 0? p[(size_t)r * n_col + i - off[r]] : 0;
} else { } else {
if (j < off[i]) force_state = 2; if (j < off[i]) force_state = 2;
if (off_end && j > off_end[i]) force_state = 1; if (off_end && j > off_end[i]) force_state = 1;
tmp = force_state < 0? p[i * n_col + j - off[i]] : 0; tmp = force_state < 0? p[(size_t)i * n_col + j - off[i]] : 0;
} }
if (state == 0) state = tmp & 7; // if requesting the H state, find state one maximizes it. if (state == 0) state = tmp & 7; // if requesting the H state, find state one maximizes it.
else if (!(tmp >> (state + 2) & 1)) state = 0; // if requesting other states, _state_ stays the same if it is a continuation; otherwise, set to H else if (!(tmp >> (state + 2) & 1)) state = 0; // if requesting other states, _state_ stays the same if it is a continuation; otherwise, set to H
+14 -15
View File
@@ -17,18 +17,20 @@
void __cpuidex(int cpuid[4], int func_id, int subfunc_id) void __cpuidex(int cpuid[4], int func_id, int subfunc_id)
{ {
#if defined(__x86_64__) #if defined(__x86_64__)
asm volatile ("cpuid" __asm__ volatile ("cpuid"
: "=a" (cpuid[0]), "=b" (cpuid[1]), "=c" (cpuid[2]), "=d" (cpuid[3]) : "=a" (cpuid[0]), "=b" (cpuid[1]), "=c" (cpuid[2]), "=d" (cpuid[3])
: "0" (func_id), "2" (subfunc_id)); : "0" (func_id), "2" (subfunc_id));
#else // on 32bit, ebx can NOT be used as PIC code #else // on 32bit, ebx can NOT be used as PIC code
asm volatile ("xchgl %%ebx, %1; cpuid; xchgl %%ebx, %1" __asm__ volatile ("xchgl %%ebx, %1; cpuid; xchgl %%ebx, %1"
: "=a" (cpuid[0]), "=r" (cpuid[1]), "=c" (cpuid[2]), "=d" (cpuid[3]) : "=a" (cpuid[0]), "=r" (cpuid[1]), "=c" (cpuid[2]), "=d" (cpuid[3])
: "0" (func_id), "2" (subfunc_id)); : "0" (func_id), "2" (subfunc_id));
#endif #endif
} }
#endif #endif
int x86_simd(void) static int ksw_simd = -1;
static int x86_simd(void)
{ {
int flag = 0, cpuid[4], max_id; int flag = 0, cpuid[4], max_id;
__cpuidex(cpuid, 0, 0); __cpuidex(cpuid, 0, 0);
@@ -54,11 +56,10 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
{ {
extern void ksw_extz2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez); extern void ksw_extz2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
extern void ksw_extz2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez); extern void ksw_extz2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
unsigned simd; if (ksw_simd < 0) ksw_simd = x86_simd();
simd = x86_simd(); if (ksw_simd & SIMD_SSE4_1)
if (simd & SIMD_SSE4_1)
ksw_extz2_sse41(km, qlen, query, tlen, target, m, mat, q, e, w, zdrop, end_bonus, flag, ez); ksw_extz2_sse41(km, qlen, query, tlen, target, m, mat, q, e, w, zdrop, end_bonus, flag, ez);
else if (simd & SIMD_SSE2) else if (ksw_simd & SIMD_SSE2)
ksw_extz2_sse2(km, qlen, query, tlen, target, m, mat, q, e, w, zdrop, end_bonus, flag, ez); ksw_extz2_sse2(km, qlen, query, tlen, target, m, mat, q, e, w, zdrop, end_bonus, flag, ez);
else abort(); else abort();
} }
@@ -70,11 +71,10 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez); int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
extern void ksw_extd2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, extern void ksw_extd2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez); int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
unsigned simd; if (ksw_simd < 0) ksw_simd = x86_simd();
simd = x86_simd(); if (ksw_simd & SIMD_SSE4_1)
if (simd & SIMD_SSE4_1)
ksw_extd2_sse41(km, qlen, query, tlen, target, m, mat, q, e, q2, e2, w, zdrop, end_bonus, flag, ez); ksw_extd2_sse41(km, qlen, query, tlen, target, m, mat, q, e, q2, e2, w, zdrop, end_bonus, flag, ez);
else if (simd & SIMD_SSE2) else if (ksw_simd & SIMD_SSE2)
ksw_extd2_sse2(km, qlen, query, tlen, target, m, mat, q, e, q2, e2, w, zdrop, end_bonus, flag, ez); ksw_extd2_sse2(km, qlen, query, tlen, target, m, mat, q, e, q2, e2, w, zdrop, end_bonus, flag, ez);
else abort(); else abort();
} }
@@ -86,11 +86,10 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez); int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez);
extern void ksw_exts2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, extern void ksw_exts2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez); int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez);
unsigned simd; if (ksw_simd < 0) ksw_simd = x86_simd();
simd = x86_simd(); if (ksw_simd & SIMD_SSE4_1)
if (simd & SIMD_SSE4_1)
ksw_exts2_sse41(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, flag, ez); ksw_exts2_sse41(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, flag, ez);
else if (simd & SIMD_SSE2) else if (ksw_simd & SIMD_SSE2)
ksw_exts2_sse2(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, flag, ez); ksw_exts2_sse2(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, flag, ez);
else abort(); else abort();
} }
+5 -5
View File
@@ -76,7 +76,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
qe2_ = _mm_set1_epi8(q2 + e2); qe2_ = _mm_set1_epi8(q2 + e2);
sc_mch_ = _mm_set1_epi8(mat[0]); sc_mch_ = _mm_set1_epi8(mat[0]);
sc_mis_ = _mm_set1_epi8(mat[1]); sc_mis_ = _mm_set1_epi8(mat[1]);
sc_N_ = _mm_set1_epi8(-e2); sc_N_ = mat[m*m-1] == 0? _mm_set1_epi8(-e2) : _mm_set1_epi8(mat[m*m-1]);
m1_ = _mm_set1_epi8(m - 1); // wildcard m1_ = _mm_set1_epi8(m - 1); // wildcard
if (w < 0) w = tlen > qlen? tlen : qlen; if (w < 0) w = tlen > qlen? tlen : qlen;
@@ -111,7 +111,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
for (t = 0; t < tlen_ * 16; ++t) H[t] = KSW_NEG_INF; for (t = 0; t < tlen_ * 16; ++t) H[t] = KSW_NEG_INF;
} }
if (with_cigar) { if (with_cigar) {
mem2 = (uint8_t*)kmalloc(km, ((qlen + tlen - 1) * n_col_ + 1) * 16); mem2 = (uint8_t*)kmalloc(km, ((size_t)(qlen + tlen - 1) * n_col_ + 1) * 16);
p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4); p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4);
off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int) * 2); off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int) * 2);
off_end = off + qlen + tlen - 1; off_end = off + qlen + tlen - 1;
@@ -218,7 +218,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
#endif #endif
} }
} else if (!(flag&KSW_EZ_RIGHT)) { // gap left-alignment } else if (!(flag&KSW_EZ_RIGHT)) { // gap left-alignment
__m128i *pr = p + r * n_col_ - st_; __m128i *pr = p + (size_t)r * n_col_ - st_;
off[r] = st, off_end[r] = en; off[r] = st, off_end[r] = en;
for (t = st_; t <= en_; ++t) { for (t = st_; t <= en_; ++t) {
__m128i d, z, a, b, a2, b2, xt1, x2t1, vt1, ut, tmp; __m128i d, z, a, b, a2, b2, xt1, x2t1, vt1, ut, tmp;
@@ -265,7 +265,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
_mm_store_si128(&pr[t], d); _mm_store_si128(&pr[t], d);
} }
} else { // gap right-alignment } else { // gap right-alignment
__m128i *pr = p + r * n_col_ - st_; __m128i *pr = p + (size_t)r * n_col_ - st_;
off[r] = st, off_end[r] = en; off[r] = st, off_end[r] = en;
for (t = st_; t <= en_; ++t) { for (t = st_; t <= en_; ++t) {
__m128i d, z, a, b, a2, b2, xt1, x2t1, vt1, ut, tmp; __m128i d, z, a, b, a2, b2, xt1, x2t1, vt1, ut, tmp;
@@ -382,7 +382,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR); int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY)) { if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY)) {
ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar); ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
} else if (!ez->zdropped && (flag&KSW_EZ_EXTZ_ONLY) && ez->mqe + end_bonus > ez->max) { } else if (!ez->zdropped && (flag&KSW_EZ_EXTZ_ONLY) && ez->mqe + end_bonus > (int)ez->max) {
ez->reach_end = 1; ez->reach_end = 1;
ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, ez->mqe_t, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar); ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, ez->mqe_t, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
} else if (ez->max_t >= 0 && ez->max_q >= 0) { } else if (ez->max_t >= 0 && ez->max_q >= 0) {
+2 -2
View File
@@ -71,7 +71,7 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
qe_ = _mm_set1_epi8(q + e); qe_ = _mm_set1_epi8(q + e);
sc_mch_ = _mm_set1_epi8(mat[0]); sc_mch_ = _mm_set1_epi8(mat[0]);
sc_mis_ = _mm_set1_epi8(mat[1]); sc_mis_ = _mm_set1_epi8(mat[1]);
sc_N_ = _mm_set1_epi8(-e); sc_N_ = mat[m*m-1] == 0? _mm_set1_epi8(-e) : _mm_set1_epi8(mat[m*m-1]);
m1_ = _mm_set1_epi8(m - 1); // wildcard m1_ = _mm_set1_epi8(m - 1); // wildcard
tlen_ = (tlen + 15) / 16; tlen_ = (tlen + 15) / 16;
@@ -100,7 +100,7 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
for (t = 0; t < tlen_ * 16; ++t) H[t] = KSW_NEG_INF; for (t = 0; t < tlen_ * 16; ++t) H[t] = KSW_NEG_INF;
} }
if (with_cigar) { if (with_cigar) {
mem2 = (uint8_t*)kmalloc(km, ((qlen + tlen - 1) * n_col_ + 1) * 16); mem2 = (uint8_t*)kmalloc(km, ((size_t)(qlen + tlen - 1) * n_col_ + 1) * 16);
p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4); p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4);
off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int) * 2); off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int) * 2);
off_end = off + qlen + tlen - 1; off_end = off + qlen + tlen - 1;
+5 -5
View File
@@ -65,7 +65,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
flag16_ = _mm_set1_epi8(0x10); flag16_ = _mm_set1_epi8(0x10);
sc_mch_ = _mm_set1_epi8(mat[0]); sc_mch_ = _mm_set1_epi8(mat[0]);
sc_mis_ = _mm_set1_epi8(mat[1]); sc_mis_ = _mm_set1_epi8(mat[1]);
sc_N_ = _mm_set1_epi8(-e); sc_N_ = mat[m*m-1] == 0? _mm_set1_epi8(-e) : _mm_set1_epi8(mat[m*m-1]);
m1_ = _mm_set1_epi8(m - 1); // wildcard m1_ = _mm_set1_epi8(m - 1); // wildcard
max_sc_ = _mm_set1_epi8(mat[0] + (q + e) * 2); max_sc_ = _mm_set1_epi8(mat[0] + (q + e) * 2);
@@ -89,7 +89,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
for (t = 0; t < tlen_ * 16; ++t) H[t] = KSW_NEG_INF; for (t = 0; t < tlen_ * 16; ++t) H[t] = KSW_NEG_INF;
} }
if (with_cigar) { if (with_cigar) {
mem2 = (uint8_t*)kmalloc(km, ((qlen + tlen - 1) * n_col_ + 1) * 16); mem2 = (uint8_t*)kmalloc(km, ((size_t)(qlen + tlen - 1) * n_col_ + 1) * 16);
p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4); p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4);
off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int) * 2); off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int) * 2);
off_end = off + qlen + tlen - 1; off_end = off + qlen + tlen - 1;
@@ -169,7 +169,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
#endif #endif
} }
} else if (!(flag&KSW_EZ_RIGHT)) { // gap left-alignment } else if (!(flag&KSW_EZ_RIGHT)) { // gap left-alignment
__m128i *pr = p + r * n_col_ - st_; __m128i *pr = p + (size_t)r * n_col_ - st_;
off[r] = st, off_end[r] = en; off[r] = st, off_end[r] = en;
for (t = st_; t <= en_; ++t) { for (t = st_; t <= en_; ++t) {
__m128i d, z, a, b, xt1, vt1, ut, tmp; __m128i d, z, a, b, xt1, vt1, ut, tmp;
@@ -195,7 +195,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
_mm_store_si128(&pr[t], d); _mm_store_si128(&pr[t], d);
} }
} else { // gap right-alignment } else { // gap right-alignment
__m128i *pr = p + r * n_col_ - st_; __m128i *pr = p + (size_t)r * n_col_ - st_;
off[r] = st, off_end[r] = en; off[r] = st, off_end[r] = en;
for (t = st_; t <= en_; ++t) { for (t = st_; t <= en_; ++t) {
__m128i d, z, a, b, xt1, vt1, ut, tmp; __m128i d, z, a, b, xt1, vt1, ut, tmp;
@@ -293,7 +293,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR); int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY)) { if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY)) {
ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar); ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
} else if (!ez->zdropped && (flag&KSW_EZ_EXTZ_ONLY) && ez->mqe + end_bonus > ez->max) { } else if (!ez->zdropped && (flag&KSW_EZ_EXTZ_ONLY) && ez->mqe + end_bonus > (int)ez->max) {
ez->reach_end = 1; ez->reach_end = 1;
ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, ez->mqe_t, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar); ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, ez->mqe_t, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
} else if (ez->max_t >= 0 && ez->max_q >= 0) { } else if (ez->max_t >= 0 && ez->max_q >= 0) {
+182 -136
View File
@@ -4,9 +4,9 @@
#include "bseq.h" #include "bseq.h"
#include "minimap.h" #include "minimap.h"
#include "mmpriv.h" #include "mmpriv.h"
#include "getopt.h" #include "ketopt.h"
#define MM_VERSION "2.8-r672" #define MM_VERSION "2.14-r883"
#ifdef __linux__ #ifdef __linux__
#include <sys/resource.h> #include <sys/resource.h>
@@ -22,50 +22,61 @@ void liftrlimit()
void liftrlimit() {} void liftrlimit() {}
#endif #endif
static struct option long_options[] = { static ko_longopt_t long_options[] = {
{ "bucket-bits", required_argument, 0, 0 }, { "bucket-bits", ko_required_argument, 300 },
{ "mb-size", required_argument, 0, 'K' }, { "mb-size", ko_required_argument, 'K' },
{ "seed", required_argument, 0, 0 }, { "seed", ko_required_argument, 302 },
{ "no-kalloc", no_argument, 0, 0 }, { "no-kalloc", ko_no_argument, 303 },
{ "print-qname", no_argument, 0, 0 }, { "print-qname", ko_no_argument, 304 },
{ "no-self", no_argument, 0, 'D' }, { "no-self", ko_no_argument, 'D' },
{ "print-seeds", no_argument, 0, 0 }, { "print-seeds", ko_no_argument, 306 },
{ "max-chain-skip", required_argument, 0, 0 }, { "max-chain-skip", ko_required_argument, 307 },
{ "min-dp-len", required_argument, 0, 0 }, { "min-dp-len", ko_required_argument, 308 },
{ "print-aln-seq", no_argument, 0, 0 }, { "print-aln-seq", ko_no_argument, 309 },
{ "splice", no_argument, 0, 0 }, { "splice", ko_no_argument, 310 },
{ "cost-non-gt-ag", required_argument, 0, 'C' }, { "cost-non-gt-ag", ko_required_argument, 'C' },
{ "no-long-join", no_argument, 0, 0 }, { "no-long-join", ko_no_argument, 312 },
{ "sr", no_argument, 0, 0 }, { "sr", ko_no_argument, 313 },
{ "frag", required_argument, 0, 0 }, { "frag", ko_required_argument, 314 },
{ "secondary", required_argument, 0, 0 }, { "secondary", ko_required_argument, 315 },
{ "cs", optional_argument, 0, 0 }, { "cs", ko_optional_argument, 316 },
{ "end-bonus", required_argument, 0, 0 }, { "end-bonus", ko_required_argument, 317 },
{ "no-pairing", no_argument, 0, 0 }, { "no-pairing", ko_no_argument, 318 },
{ "splice-flank", required_argument, 0, 0 }, { "splice-flank", ko_required_argument, 319 },
{ "idx-no-seq", no_argument, 0, 0 }, { "idx-no-seq", ko_no_argument, 320 },
{ "end-seed-pen", required_argument, 0, 0 }, // 21 { "end-seed-pen", ko_required_argument, 321 },
{ "for-only", no_argument, 0, 0 }, // 22 { "for-only", ko_no_argument, 322 },
{ "rev-only", no_argument, 0, 0 }, // 23 { "rev-only", ko_no_argument, 323 },
{ "heap-sort", required_argument, 0, 0 }, // 24 { "heap-sort", ko_required_argument, 324 },
{ "all-chain", no_argument, 0, 'P' }, { "all-chain", ko_no_argument, 'P' },
{ "dual", required_argument, 0, 0 }, // 26 { "dual", ko_required_argument, 326 },
{ "help", no_argument, 0, 'h' }, { "max-clip-ratio", ko_required_argument, 327 },
{ "max-intron-len", required_argument, 0, 'G' }, { "min-occ-floor", ko_required_argument, 328 },
{ "version", no_argument, 0, 'V' }, { "MD", ko_no_argument, 329 },
{ "min-count", required_argument, 0, 'n' }, { "lj-min-ratio", ko_required_argument, 330 },
{ "min-chain-score",required_argument, 0, 'm' }, { "score-N", ko_required_argument, 331 },
{ "mask-level", required_argument, 0, 'M' }, { "eqx", ko_no_argument, 332 },
{ "min-dp-score", required_argument, 0, 's' }, { "paf-no-hit", ko_no_argument, 333 },
{ "sam", no_argument, 0, 'a' }, { "split-prefix", ko_required_argument, 334 },
{ 0, 0, 0, 0} { "no-end-flt", ko_no_argument, 335 },
{ "hard-mask-level",ko_no_argument, 336 },
{ "cap-sw-mem", ko_required_argument, 337 },
{ "help", ko_no_argument, 'h' },
{ "max-intron-len", ko_required_argument, 'G' },
{ "version", ko_no_argument, 'V' },
{ "min-count", ko_required_argument, 'n' },
{ "min-chain-score",ko_required_argument, 'm' },
{ "mask-level", ko_required_argument, 'M' },
{ "min-dp-score", ko_required_argument, 's' },
{ "sam", ko_no_argument, 'a' },
{ 0, 0, 0 }
}; };
static inline int64_t mm_parse_num(const char *str) static inline int64_t mm_parse_num(const char *str)
{ {
double x; double x;
char *p; char *p;
x = strtod(optarg, &p); x = strtod(str, &p);
if (*p == 'G' || *p == 'g') x *= 1e9; if (*p == 'G' || *p == 'g') x *= 1e9;
else if (*p == 'M' || *p == 'm') x *= 1e6; else if (*p == 'M' || *p == 'm') x *= 1e6;
else if (*p == 'K' || *p == 'k') x *= 1e3; else if (*p == 'K' || *p == 'k') x *= 1e3;
@@ -87,10 +98,11 @@ static inline void yes_or_no(mm_mapopt_t *opt, int flag, int long_idx, const cha
int main(int argc, char *argv[]) int main(int argc, char *argv[])
{ {
const char *opt_str = "2aSDw:k:K:t:r:f:Vv:g:G:I:d:XT:s:x:Hcp:M:n:z:A:B:O:E:m:N:Qu:R:hF:LC:"; const char *opt_str = "2aSDw:k:K:t:r:f:Vv:g:G:I:d:XT:s:x:Hcp:M:n:z:A:B:O:E:m:N:Qu:R:hF:LC:yYP";
ketopt_t o = KETOPT_INIT;
mm_mapopt_t opt; mm_mapopt_t opt;
mm_idxopt_t ipt; mm_idxopt_t ipt;
int i, c, n_threads = 3, long_idx; int i, c, n_threads = 3, n_parts, old_best_n = -1;
char *fnw = 0, *rg = 0, *s; char *fnw = 0, *rg = 0, *s;
FILE *fp_help = stderr; FILE *fp_help = stderr;
mm_idx_reader_t *idx_rdr; mm_idx_reader_t *idx_rdr;
@@ -101,30 +113,36 @@ int main(int argc, char *argv[])
mm_realtime0 = realtime(); mm_realtime0 = realtime();
mm_set_opt(0, &ipt, &opt); mm_set_opt(0, &ipt, &opt);
while ((c = getopt_long(argc, argv, opt_str, long_options, &long_idx)) >= 0) // apply option -x/preset first while ((c = ketopt(&o, argc, argv, 1, opt_str, long_options)) >= 0) { // test command line options and apply option -x/preset first
if (c == 'x') { if (c == 'x') {
if (mm_set_opt(optarg, &ipt, &opt) < 0) { if (mm_set_opt(o.arg, &ipt, &opt) < 0) {
fprintf(stderr, "[ERROR] unknown preset '%s'\n", optarg); fprintf(stderr, "[ERROR] unknown preset '%s'\n", o.arg);
return 1; return 1;
} }
break; } else if (c == ':') {
fprintf(stderr, "[ERROR] missing option argument\n");
return 1;
} else if (c == '?') {
fprintf(stderr, "[ERROR] unknown option in \"%s\"\n", argv[o.i - 1]);
return 1;
} }
optreset = 1; }
o = KETOPT_INIT;
while ((c = getopt_long(argc, argv, opt_str, long_options, &long_idx)) >= 0) { while ((c = ketopt(&o, argc, argv, 1, opt_str, long_options)) >= 0) {
if (c == 'w') ipt.w = atoi(optarg); if (c == 'w') ipt.w = atoi(o.arg);
else if (c == 'k') ipt.k = atoi(optarg); else if (c == 'k') ipt.k = atoi(o.arg);
else if (c == 'H') ipt.flag |= MM_I_HPC; else if (c == 'H') ipt.flag |= MM_I_HPC;
else if (c == 'd') fnw = optarg; // the above are indexing related options, except -I else if (c == 'd') fnw = o.arg; // the above are indexing related options, except -I
else if (c == 'r') opt.bw = (int)mm_parse_num(optarg); else if (c == 'r') opt.bw = (int)mm_parse_num(o.arg);
else if (c == 't') n_threads = atoi(optarg); else if (c == 't') n_threads = atoi(o.arg);
else if (c == 'v') mm_verbose = atoi(optarg); else if (c == 'v') mm_verbose = atoi(o.arg);
else if (c == 'g') opt.max_gap = (int)mm_parse_num(optarg); else if (c == 'g') opt.max_gap = (int)mm_parse_num(o.arg);
else if (c == 'G') mm_mapopt_max_intron_len(&opt, (int)mm_parse_num(optarg)); else if (c == 'G') mm_mapopt_max_intron_len(&opt, (int)mm_parse_num(o.arg));
else if (c == 'F') opt.max_frag_len = (int)mm_parse_num(optarg); else if (c == 'F') opt.max_frag_len = (int)mm_parse_num(o.arg);
else if (c == 'N') opt.best_n = atoi(optarg); else if (c == 'N') old_best_n = opt.best_n, opt.best_n = atoi(o.arg);
else if (c == 'p') opt.pri_ratio = atof(optarg); else if (c == 'p') opt.pri_ratio = atof(o.arg);
else if (c == 'M') opt.mask_level = atof(optarg); else if (c == 'M') opt.mask_level = atof(o.arg);
else if (c == 'c') opt.flag |= MM_F_OUT_CG | MM_F_CIGAR; else if (c == 'c') opt.flag |= MM_F_OUT_CG | MM_F_CIGAR;
else if (c == 'D') opt.flag |= MM_F_NO_DIAG; else if (c == 'D') opt.flag |= MM_F_NO_DIAG;
else if (c == 'P') opt.flag |= MM_F_ALL_CHAINS; else if (c == 'P') opt.flag |= MM_F_ALL_CHAINS;
@@ -133,57 +151,68 @@ int main(int argc, char *argv[])
else if (c == 'Q') opt.flag |= MM_F_NO_QUAL; else if (c == 'Q') opt.flag |= MM_F_NO_QUAL;
else if (c == 'Y') opt.flag |= MM_F_SOFTCLIP; else if (c == 'Y') opt.flag |= MM_F_SOFTCLIP;
else if (c == 'L') opt.flag |= MM_F_LONG_CIGAR; else if (c == 'L') opt.flag |= MM_F_LONG_CIGAR;
else if (c == 'T') opt.sdust_thres = atoi(optarg); else if (c == 'y') opt.flag |= MM_F_COPY_COMMENT;
else if (c == 'n') opt.min_cnt = atoi(optarg); else if (c == 'T') opt.sdust_thres = atoi(o.arg);
else if (c == 'm') opt.min_chain_score = atoi(optarg); else if (c == 'n') opt.min_cnt = atoi(o.arg);
else if (c == 'A') opt.a = atoi(optarg); else if (c == 'm') opt.min_chain_score = atoi(o.arg);
else if (c == 'B') opt.b = atoi(optarg); else if (c == 'A') opt.a = atoi(o.arg);
else if (c == 'z') opt.zdrop = atoi(optarg); else if (c == 'B') opt.b = atoi(o.arg);
else if (c == 's') opt.min_dp_max = atoi(optarg); else if (c == 's') opt.min_dp_max = atoi(o.arg);
else if (c == 'C') opt.noncan = atoi(optarg); else if (c == 'C') opt.noncan = atoi(o.arg);
else if (c == 'I') ipt.batch_size = mm_parse_num(optarg); else if (c == 'I') ipt.batch_size = mm_parse_num(o.arg);
else if (c == 'K') opt.mini_batch_size = (int)mm_parse_num(optarg); else if (c == 'K') opt.mini_batch_size = (int)mm_parse_num(o.arg);
else if (c == 'R') rg = optarg; else if (c == 'R') rg = o.arg;
else if (c == 'h') fp_help = stdout; else if (c == 'h') fp_help = stdout;
else if (c == '2') opt.flag |= MM_F_2_IO_THREADS; else if (c == '2') opt.flag |= MM_F_2_IO_THREADS;
else if (c == 0 && long_idx == 0) ipt.bucket_bits = atoi(optarg); // --bucket-bits else if (c == 300) ipt.bucket_bits = atoi(o.arg); // --bucket-bits
else if (c == 0 && long_idx == 2) opt.seed = atoi(optarg); // --seed else if (c == 302) opt.seed = atoi(o.arg); // --seed
else if (c == 0 && long_idx == 3) mm_dbg_flag |= MM_DBG_NO_KALLOC; // --no-kalloc else if (c == 303) mm_dbg_flag |= MM_DBG_NO_KALLOC; // --no-kalloc
else if (c == 0 && long_idx == 4) mm_dbg_flag |= MM_DBG_PRINT_QNAME; // --print-qname else if (c == 304) mm_dbg_flag |= MM_DBG_PRINT_QNAME; // --print-qname
else if (c == 0 && long_idx == 6) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_SEED, n_threads = 1; // --print-seed else if (c == 306) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_SEED, n_threads = 1; // --print-seed
else if (c == 0 && long_idx == 7) opt.max_chain_skip = atoi(optarg); // --max-chain-skip else if (c == 307) opt.max_chain_skip = atoi(o.arg); // --max-chain-skip
else if (c == 0 && long_idx == 8) opt.min_ksw_len = atoi(optarg); // --min-dp-len else if (c == 308) opt.min_ksw_len = atoi(o.arg); // --min-dp-len
else if (c == 0 && long_idx == 9) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_ALN_SEQ, n_threads = 1; // --print-aln-seq else if (c == 309) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_ALN_SEQ, n_threads = 1; // --print-aln-seq
else if (c == 0 && long_idx ==10) opt.flag |= MM_F_SPLICE; // --splice else if (c == 310) opt.flag |= MM_F_SPLICE; // --splice
else if (c == 0 && long_idx ==12) opt.flag |= MM_F_NO_LJOIN; // --no-long-join else if (c == 312) opt.flag |= MM_F_NO_LJOIN; // --no-long-join
else if (c == 0 && long_idx ==13) opt.flag |= MM_F_SR; // --sr else if (c == 313) opt.flag |= MM_F_SR; // --sr
else if (c == 0 && long_idx ==17) opt.end_bonus = atoi(optarg); // --end-bonus else if (c == 317) opt.end_bonus = atoi(o.arg); // --end-bonus
else if (c == 0 && long_idx ==18) opt.flag |= MM_F_INDEPEND_SEG; // --no-pairing else if (c == 318) opt.flag |= MM_F_INDEPEND_SEG; // --no-pairing
else if (c == 0 && long_idx ==20) ipt.flag |= MM_I_NO_SEQ; // --idx-no-seq else if (c == 320) ipt.flag |= MM_I_NO_SEQ; // --idx-no-seq
else if (c == 0 && long_idx ==21) opt.anchor_ext_shift = atoi(optarg); // --end-seed-pen else if (c == 321) opt.anchor_ext_shift = atoi(o.arg); // --end-seed-pen
else if (c == 0 && long_idx ==22) opt.flag |= MM_F_FOR_ONLY; // --for-only else if (c == 322) opt.flag |= MM_F_FOR_ONLY; // --for-only
else if (c == 0 && long_idx ==23) opt.flag |= MM_F_REV_ONLY; // --rev-only else if (c == 323) opt.flag |= MM_F_REV_ONLY; // --rev-only
else if (c == 0 && long_idx == 14) { // --frag else if (c == 327) opt.max_clip_ratio = atof(o.arg); // --max-clip-ratio
yes_or_no(&opt, MM_F_FRAG_MODE, long_idx, optarg, 1); else if (c == 328) opt.min_mid_occ = atoi(o.arg); // --min-occ-floor
} else if (c == 0 && long_idx == 15) { // --secondary else if (c == 329) opt.flag |= MM_F_OUT_MD; // --MD
yes_or_no(&opt, MM_F_NO_PRINT_2ND, long_idx, optarg, 0); else if (c == 330) opt.min_join_flank_ratio = atof(o.arg); // --lj-min-ratio
} else if (c == 0 && long_idx == 16) { // --cs else if (c == 331) opt.sc_ambi = atoi(o.arg); // --score-N
else if (c == 332) opt.flag |= MM_F_EQX; // --eqx
else if (c == 333) opt.flag |= MM_F_PAF_NO_HIT; // --paf-no-hit
else if (c == 334) opt.split_prefix = o.arg; // --split-prefix
else if (c == 335) opt.flag |= MM_F_NO_END_FLT; // --no-end-flt
else if (c == 336) opt.flag |= MM_F_HARD_MLEVEL; // --hard-mask-level
else if (c == 337) opt.max_sw_mat = mm_parse_num(o.arg); // --cap-sw-mat
else if (c == 314) { // --frag
yes_or_no(&opt, MM_F_FRAG_MODE, o.longidx, o.arg, 1);
} else if (c == 315) { // --secondary
yes_or_no(&opt, MM_F_NO_PRINT_2ND, o.longidx, o.arg, 0);
} else if (c == 316) { // --cs
opt.flag |= MM_F_OUT_CS | MM_F_CIGAR; opt.flag |= MM_F_OUT_CS | MM_F_CIGAR;
if (optarg == 0 || strcmp(optarg, "short") == 0) { if (o.arg == 0 || strcmp(o.arg, "short") == 0) {
opt.flag &= ~MM_F_OUT_CS_LONG; opt.flag &= ~MM_F_OUT_CS_LONG;
} else if (strcmp(optarg, "long") == 0) { } else if (strcmp(o.arg, "long") == 0) {
opt.flag |= MM_F_OUT_CS_LONG; opt.flag |= MM_F_OUT_CS_LONG;
} else if (strcmp(optarg, "none") == 0) { } else if (strcmp(o.arg, "none") == 0) {
opt.flag &= ~MM_F_OUT_CS; opt.flag &= ~MM_F_OUT_CS;
} else if (mm_verbose >= 2) { } else if (mm_verbose >= 2) {
fprintf(stderr, "[WARNING]\033[1;31m --cs only takes 'short' or 'long'. Invalid values are assumed to be 'short'.\033[0m\n"); fprintf(stderr, "[WARNING]\033[1;31m --cs only takes 'short' or 'long'. Invalid values are assumed to be 'short'.\033[0m\n");
} }
} else if (c == 0 && long_idx == 19) { // --splice-flank } else if (c == 319) { // --splice-flank
yes_or_no(&opt, MM_F_SPLICE_FLANK, long_idx, optarg, 1); yes_or_no(&opt, MM_F_SPLICE_FLANK, o.longidx, o.arg, 1);
} else if (c == 0 && long_idx == 24) { // --heap-sort } else if (c == 324) { // --heap-sort
yes_or_no(&opt, MM_F_HEAP_SORT, long_idx, optarg, 1); yes_or_no(&opt, MM_F_HEAP_SORT, o.longidx, o.arg, 1);
} else if (c == 0 && long_idx == 26) { // --dual } else if (c == 326) { // --dual
yes_or_no(&opt, MM_F_NO_DUAL, long_idx, optarg, 0); yes_or_no(&opt, MM_F_NO_DUAL, o.longidx, o.arg, 0);
} else if (c == 'S') { } else if (c == 'S') {
opt.flag |= MM_F_OUT_CS | MM_F_CIGAR | MM_F_OUT_CS_LONG; opt.flag |= MM_F_OUT_CS | MM_F_CIGAR | MM_F_OUT_CS_LONG;
if (mm_verbose >= 2) if (mm_verbose >= 2)
@@ -194,24 +223,27 @@ int main(int argc, char *argv[])
} else if (c == 'f') { } else if (c == 'f') {
double x; double x;
char *p; char *p;
x = strtod(optarg, &p); x = strtod(o.arg, &p);
if (x < 1.0) opt.mid_occ_frac = x, opt.mid_occ = 0; if (x < 1.0) opt.mid_occ_frac = x, opt.mid_occ = 0;
else opt.mid_occ = (int)(x + .499); else opt.mid_occ = (int)(x + .499);
if (*p == ',') opt.max_occ = (int)(strtod(p+1, &p) + .499); if (*p == ',') opt.max_occ = (int)(strtod(p+1, &p) + .499);
} else if (c == 'u') { } else if (c == 'u') {
if (*optarg == 'b') opt.flag |= MM_F_SPLICE_FOR|MM_F_SPLICE_REV; // both strands if (*o.arg == 'b') opt.flag |= MM_F_SPLICE_FOR|MM_F_SPLICE_REV; // both strands
else if (*optarg == 'f') opt.flag |= MM_F_SPLICE_FOR, opt.flag &= ~MM_F_SPLICE_REV; // match GT-AG else if (*o.arg == 'f') opt.flag |= MM_F_SPLICE_FOR, opt.flag &= ~MM_F_SPLICE_REV; // match GT-AG
else if (*optarg == 'r') opt.flag |= MM_F_SPLICE_REV, opt.flag &= ~MM_F_SPLICE_FOR; // match CT-AC (reverse complement of GT-AG) else if (*o.arg == 'r') opt.flag |= MM_F_SPLICE_REV, opt.flag &= ~MM_F_SPLICE_FOR; // match CT-AC (reverse complement of GT-AG)
else if (*optarg == 'n') opt.flag &= ~(MM_F_SPLICE_FOR|MM_F_SPLICE_REV); // don't try to match the GT-AG signal else if (*o.arg == 'n') opt.flag &= ~(MM_F_SPLICE_FOR|MM_F_SPLICE_REV); // don't try to match the GT-AG signal
else { else {
fprintf(stderr, "[ERROR]\033[1;31m unrecognized cDNA direction\033[0m\n"); fprintf(stderr, "[ERROR]\033[1;31m unrecognized cDNA direction\033[0m\n");
return 1; return 1;
} }
} else if (c == 'z') {
opt.zdrop = opt.zdrop_inv = strtol(o.arg, &s, 10);
if (*s == ',') opt.zdrop_inv = strtol(s + 1, &s, 10);
} else if (c == 'O') { } else if (c == 'O') {
opt.q = opt.q2 = strtol(optarg, &s, 10); opt.q = opt.q2 = strtol(o.arg, &s, 10);
if (*s == ',') opt.q2 = strtol(s + 1, &s, 10); if (*s == ',') opt.q2 = strtol(s + 1, &s, 10);
} else if (c == 'E') { } else if (c == 'E') {
opt.e = opt.e2 = strtol(optarg, &s, 10); opt.e = opt.e2 = strtol(o.arg, &s, 10);
if (*s == ',') opt.e2 = strtol(s + 1, &s, 10); if (*s == ',') opt.e2 = strtol(s + 1, &s, 10);
} }
} }
@@ -223,12 +255,16 @@ int main(int argc, char *argv[])
ipt.flag |= MM_I_NO_SEQ; ipt.flag |= MM_I_NO_SEQ;
if (mm_check_opt(&ipt, &opt) < 0) if (mm_check_opt(&ipt, &opt) < 0)
return 1; return 1;
if (opt.best_n == 0) {
fprintf(stderr, "[WARNING]\033[1;31m changed '-N 0' to '-N %d --secondary=no'.\033[0m\n", old_best_n);
opt.best_n = old_best_n, opt.flag |= MM_F_NO_PRINT_2ND;
}
if (argc == optind || fp_help == stdout) { if (argc == o.ind || fp_help == stdout) {
fprintf(fp_help, "Usage: minimap2 [options] <target.fa>|<target.idx> [query.fa] [...]\n"); fprintf(fp_help, "Usage: minimap2 [options] <target.fa>|<target.idx> [query.fa] [...]\n");
fprintf(fp_help, "Options:\n"); fprintf(fp_help, "Options:\n");
fprintf(fp_help, " Indexing:\n"); fprintf(fp_help, " Indexing:\n");
fprintf(fp_help, " -H use homopolymer-compressed k-mer\n"); fprintf(fp_help, " -H use homopolymer-compressed k-mer (preferrable for PacBio)\n");
fprintf(fp_help, " -k INT k-mer size (no larger than 28) [%d]\n", ipt.k); fprintf(fp_help, " -k INT k-mer size (no larger than 28) [%d]\n", ipt.k);
fprintf(fp_help, " -w INT minizer window size [%d]\n", ipt.w); fprintf(fp_help, " -w INT minizer window size [%d]\n", ipt.w);
fprintf(fp_help, " -I NUM split index for every ~NUM input bases [4G]\n"); fprintf(fp_help, " -I NUM split index for every ~NUM input bases [4G]\n");
@@ -250,7 +286,7 @@ int main(int argc, char *argv[])
fprintf(fp_help, " -B INT mismatch penalty [%d]\n", opt.b); fprintf(fp_help, " -B INT mismatch penalty [%d]\n", opt.b);
fprintf(fp_help, " -O INT[,INT] gap open penalty [%d,%d]\n", opt.q, opt.q2); fprintf(fp_help, " -O INT[,INT] gap open penalty [%d,%d]\n", opt.q, opt.q2);
fprintf(fp_help, " -E INT[,INT] gap extension penalty; a k-long gap costs min{O1+k*E1,O2+k*E2} [%d,%d]\n", opt.e, opt.e2); fprintf(fp_help, " -E INT[,INT] gap extension penalty; a k-long gap costs min{O1+k*E1,O2+k*E2} [%d,%d]\n", opt.e, opt.e2);
fprintf(fp_help, " -z INT Z-drop score [%d]\n", opt.zdrop); fprintf(fp_help, " -z INT[,INT] Z-drop score and inversion Z-drop score [%d,%d]\n", opt.zdrop, opt.zdrop_inv);
fprintf(fp_help, " -s INT minimal peak DP alignment score [%d]\n", opt.min_dp_max); fprintf(fp_help, " -s INT minimal peak DP alignment score [%d]\n", opt.min_dp_max);
fprintf(fp_help, " -u CHAR how to find GT-AG. f:transcript strand, b:both strands, n:don't match GT-AG [n]\n"); fprintf(fp_help, " -u CHAR how to find GT-AG. f:transcript strand, b:both strands, n:don't match GT-AG [n]\n");
fprintf(fp_help, " Input/Output:\n"); fprintf(fp_help, " Input/Output:\n");
@@ -260,35 +296,34 @@ int main(int argc, char *argv[])
fprintf(fp_help, " -R STR SAM read group line in a format like '@RG\\tID:foo\\tSM:bar' []\n"); fprintf(fp_help, " -R STR SAM read group line in a format like '@RG\\tID:foo\\tSM:bar' []\n");
fprintf(fp_help, " -c output CIGAR in PAF\n"); fprintf(fp_help, " -c output CIGAR in PAF\n");
fprintf(fp_help, " --cs[=STR] output the cs tag; STR is 'short' (if absent) or 'long' [none]\n"); fprintf(fp_help, " --cs[=STR] output the cs tag; STR is 'short' (if absent) or 'long' [none]\n");
fprintf(fp_help, " --MD output the MD tag\n");
fprintf(fp_help, " --eqx write =/X CIGAR operators\n");
fprintf(fp_help, " -Y use soft clipping for supplementary alignments\n"); fprintf(fp_help, " -Y use soft clipping for supplementary alignments\n");
fprintf(fp_help, " -t INT number of threads [%d]\n", n_threads); fprintf(fp_help, " -t INT number of threads [%d]\n", n_threads);
fprintf(fp_help, " -K NUM minibatch size for mapping [500M]\n"); fprintf(fp_help, " -K NUM minibatch size for mapping [500M]\n");
// fprintf(fp_help, " -v INT verbose level [%d]\n", mm_verbose); // fprintf(fp_help, " -v INT verbose level [%d]\n", mm_verbose);
fprintf(fp_help, " --version show version number\n"); fprintf(fp_help, " --version show version number\n");
fprintf(fp_help, " Preset:\n"); fprintf(fp_help, " Preset:\n");
fprintf(fp_help, " -x STR preset (always applied before other options) []\n"); fprintf(fp_help, " -x STR preset (always applied before other options; see minimap2.1 for details) []\n");
fprintf(fp_help, " map-pb: -Hk19 (PacBio vs reference mapping)\n"); fprintf(fp_help, " - map-pb/map-ont: PacBio/Nanopore vs reference mapping\n");
fprintf(fp_help, " map-ont: -k15 (Oxford Nanopore vs reference mapping)\n"); fprintf(fp_help, " - ava-pb/ava-ont: PacBio/Nanopore read overlap\n");
fprintf(fp_help, " asm5: -k19 -w19 -A1 -B19 -O39,81 -E3,1 -s200 -z200 (asm to ref mapping; break at 5%% div.)\n"); fprintf(fp_help, " - asm5/asm10/asm20: asm-to-ref mapping, for ~0.1/1/5%% sequence divergence\n");
fprintf(fp_help, " asm10: -k19 -w19 -A1 -B9 -O16,41 -E2,1 -s200 -z200 (asm to ref mapping; break at 10%% div.)\n"); fprintf(fp_help, " - splice: long-read spliced alignment\n");
fprintf(fp_help, " ava-pb: -Hk19 -Xw5 -m100 -g10000 --max-chain-skip 25 (PacBio read overlap)\n"); fprintf(fp_help, " - sr: genomic short-read mapping\n");
fprintf(fp_help, " ava-ont: -k15 -Xw5 -m100 -g10000 --max-chain-skip 25 (ONT read overlap)\n"); fprintf(fp_help, "\nSee `man ./minimap2.1' for detailed description of these and other advanced command-line options.\n");
fprintf(fp_help, " splice: long-read spliced alignment (see minimap2.1 for details)\n");
fprintf(fp_help, " sr: short single-end reads without splicing (see minimap2.1 for details)\n");
fprintf(fp_help, "\nSee `man ./minimap2.1' for detailed description of command-line options.\n");
return fp_help == stdout? 0 : 1; return fp_help == stdout? 0 : 1;
} }
if ((opt.flag & MM_F_SR) && argc - optind > 3) { if ((opt.flag & MM_F_SR) && argc - o.ind > 3) {
fprintf(stderr, "[ERROR] incorrect input: in the sr mode, please specify no more than two query files.\n"); fprintf(stderr, "[ERROR] incorrect input: in the sr mode, please specify no more than two query files.\n");
return 1; return 1;
} }
idx_rdr = mm_idx_reader_open(argv[optind], &ipt, fnw); idx_rdr = mm_idx_reader_open(argv[o.ind], &ipt, fnw);
if (idx_rdr == 0) { if (idx_rdr == 0) {
fprintf(stderr, "[ERROR] failed to open file '%s'\n", argv[optind]); fprintf(stderr, "[ERROR] failed to open file '%s'\n", argv[o.ind]);
return 1; return 1;
} }
if (!idx_rdr->is_idx && fnw == 0 && argc - optind < 2) { if (!idx_rdr->is_idx && fnw == 0 && argc - o.ind < 2) {
fprintf(stderr, "[ERROR] missing input: please specify a query file to map or option -d to keep the index\n"); fprintf(stderr, "[ERROR] missing input: please specify a query file to map or option -d to keep the index\n");
mm_idx_reader_close(idx_rdr); mm_idx_reader_close(idx_rdr);
return 1; return 1;
@@ -307,29 +342,40 @@ int main(int argc, char *argv[])
mm_write_sam_hdr(mi, rg, MM_VERSION, argc, argv); mm_write_sam_hdr(mi, rg, MM_VERSION, argc, argv);
} else { } else {
mm_write_sam_hdr(0, rg, MM_VERSION, argc, argv); mm_write_sam_hdr(0, rg, MM_VERSION, argc, argv);
if (mm_verbose >= 2) if (opt.split_prefix == 0 && mm_verbose >= 2)
fprintf(stderr, "[WARNING]\033[1;31m For a multi-part index, no @SQ lines will be outputted.\033[0m\n"); fprintf(stderr, "[WARNING]\033[1;31m For a multi-part index, no @SQ lines will be outputted. Please use --split-prefix.\033[0m\n");
} }
} }
if (mm_verbose >= 3) if (mm_verbose >= 3)
fprintf(stderr, "[M::%s::%.3f*%.2f] loaded/built the index for %d target sequence(s)\n", fprintf(stderr, "[M::%s::%.3f*%.2f] loaded/built the index for %d target sequence(s)\n",
__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), mi->n_seq); __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), mi->n_seq);
if (argc != optind + 1) mm_mapopt_update(&opt, mi); if (argc != o.ind + 1) mm_mapopt_update(&opt, mi);
if (mm_verbose >= 3) mm_idx_stat(mi); if (mm_verbose >= 3) mm_idx_stat(mi);
if (!(opt.flag & MM_F_FRAG_MODE)) { if (!(opt.flag & MM_F_FRAG_MODE)) {
for (i = optind + 1; i < argc; ++i) for (i = o.ind + 1; i < argc; ++i)
mm_map_file(mi, argv[i], &opt, n_threads); mm_map_file(mi, argv[i], &opt, n_threads);
} else { } else {
mm_map_file_frag(mi, argc - (optind + 1), (const char**)&argv[optind + 1], &opt, n_threads); mm_map_file_frag(mi, argc - (o.ind + 1), (const char**)&argv[o.ind + 1], &opt, n_threads);
} }
mm_idx_destroy(mi); mm_idx_destroy(mi);
} }
n_parts = idx_rdr->n_parts;
mm_idx_reader_close(idx_rdr); mm_idx_reader_close(idx_rdr);
fprintf(stderr, "[M::%s] Version: %s\n", __func__, MM_VERSION); if (opt.split_prefix)
fprintf(stderr, "[M::%s] CMD:", __func__); mm_split_merge(argc - (o.ind + 1), (const char**)&argv[o.ind + 1], &opt, n_parts);
for (i = 0; i < argc; ++i)
fprintf(stderr, " %s", argv[i]); if (fflush(stdout) == EOF) {
fprintf(stderr, "\n[M::%s] Real time: %.3f sec; CPU: %.3f sec\n", __func__, realtime() - mm_realtime0, cputime()); fprintf(stderr, "[ERROR] failed to write the results\n");
exit(EXIT_FAILURE);
}
if (mm_verbose >= 3) {
fprintf(stderr, "[M::%s] Version: %s\n", __func__, MM_VERSION);
fprintf(stderr, "[M::%s] CMD:", __func__);
for (i = 0; i < argc; ++i)
fprintf(stderr, " %s", argv[i]);
fprintf(stderr, "\n[M::%s] Real time: %.3f sec; CPU: %.3f sec; Peak RSS: %.3f GB\n", __func__, realtime() - mm_realtime0, cputime(), peakrss() / 1024.0 / 1024.0 / 1024.0);
}
return 0; return 0;
} }
+221 -63
View File
@@ -11,6 +11,7 @@
struct mm_tbuf_s { struct mm_tbuf_s {
void *km; void *km;
int rep_len, frag_gap;
}; };
mm_tbuf_t *mm_tbuf_init(void) mm_tbuf_t *mm_tbuf_init(void)
@@ -28,6 +29,11 @@ void mm_tbuf_destroy(mm_tbuf_t *b)
free(b); free(b);
} }
void *mm_tbuf_get_km(mm_tbuf_t *b)
{
return b->km;
}
static int mm_dust_minier(void *km, int n, mm128_t *a, int l_seq, const char *seq, int sdust_thres) static int mm_dust_minier(void *km, int n, mm128_t *a, int l_seq, const char *seq, int sdust_thres)
{ {
int n_dreg, j, k, u = 0; int n_dreg, j, k, u = 0;
@@ -39,12 +45,12 @@ static int mm_dust_minier(void *km, int n, mm128_t *a, int l_seq, const char *se
for (j = k = 0; j < n; ++j) { // squeeze out minimizers that significantly overlap with LCRs for (j = k = 0; j < n; ++j) { // squeeze out minimizers that significantly overlap with LCRs
int32_t qpos = (uint32_t)a[j].y>>1, span = a[j].x&0xff; int32_t qpos = (uint32_t)a[j].y>>1, span = a[j].x&0xff;
int32_t s = qpos - (span - 1), e = s + span; int32_t s = qpos - (span - 1), e = s + span;
while (u < n_dreg && (uint32_t)dreg[u] <= s) ++u; while (u < n_dreg && (int32_t)dreg[u] <= s) ++u;
if (u < n_dreg && dreg[u]>>32 < e) { if (u < n_dreg && (int32_t)(dreg[u]>>32) < e) {
int v, l = 0; int v, l = 0;
for (v = u; v < n_dreg && dreg[v]>>32 < e; ++v) { // iterate over LCRs overlapping this minimizer for (v = u; v < n_dreg && (int32_t)(dreg[v]>>32) < e; ++v) { // iterate over LCRs overlapping this minimizer
int ss = s > dreg[v]>>32? s : dreg[v]>>32; int ss = s > (int32_t)(dreg[v]>>32)? s : dreg[v]>>32;
int ee = e < (uint32_t)dreg[v]? e : (uint32_t)dreg[v]; int ee = e < (int32_t)dreg[v]? e : (uint32_t)dreg[v];
l += ee - ss; l += ee - ss;
} }
if (l <= span>>1) a[k++] = a[j]; // keep the minimizer if less than half of it falls in masked region if (l <= span>>1) a[k++] = a[j]; // keep the minimizer if less than half of it falls in masked region
@@ -56,9 +62,10 @@ static int mm_dust_minier(void *km, int n, mm128_t *a, int l_seq, const char *se
static void collect_minimizers(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, mm128_v *mv) static void collect_minimizers(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, mm128_v *mv)
{ {
int i, j, n, sum = 0; int i, n, sum = 0;
mv->n = 0; mv->n = 0;
for (i = n = 0; i < n_segs; ++i) { for (i = n = 0; i < n_segs; ++i) {
size_t j;
mm_sketch(km, seqs[i], qlens[i], mi->w, mi->k, i, mi->flag&MM_I_HPC, mv); mm_sketch(km, seqs[i], qlens[i], mi->w, mi->k, i, mi->flag&MM_I_HPC, mv);
for (j = n; j < mv->n; ++j) for (j = n; j < mv->n; ++j)
mv->a[j].y += sum << 1; mv->a[j].y += sum << 1;
@@ -81,12 +88,13 @@ typedef struct {
static mm_match_t *collect_matches(void *km, int *_n_m, int max_occ, const mm_idx_t *mi, const mm128_v *mv, int64_t *n_a, int *rep_len, int *n_mini_pos, uint64_t **mini_pos) static mm_match_t *collect_matches(void *km, int *_n_m, int max_occ, const mm_idx_t *mi, const mm128_v *mv, int64_t *n_a, int *rep_len, int *n_mini_pos, uint64_t **mini_pos)
{ {
int i, rep_st = 0, rep_en = 0, n_m; int rep_st = 0, rep_en = 0, n_m;
size_t i;
mm_match_t *m; mm_match_t *m;
*n_mini_pos = 0; *n_mini_pos = 0;
*mini_pos = (uint64_t*)kmalloc(km, mv->n * sizeof(uint64_t)); *mini_pos = (uint64_t*)kmalloc(km, mv->n * sizeof(uint64_t));
m = (mm_match_t*)kmalloc(km, mv->n * sizeof(mm_match_t)); m = (mm_match_t*)kmalloc(km, mv->n * sizeof(mm_match_t));
for (i = n_m = 0, *rep_len = 0, *n_a = 0; i < mv->n; ++i) { for (i = 0, n_m = 0, *rep_len = 0, *n_a = 0; i < mv->n; ++i) {
const uint64_t *cr; const uint64_t *cr;
mm128_t *p = &mv->a[i]; mm128_t *p = &mv->a[i];
uint32_t q_pos = (uint32_t)p->y, q_span = p->x & 0xff; uint32_t q_pos = (uint32_t)p->y, q_span = p->x & 0xff;
@@ -120,7 +128,7 @@ static inline int skip_seed(int flag, uint64_t r, const mm_match_t *q, const cha
const mm_idx_seq_t *s = &mi->seq[r>>32]; const mm_idx_seq_t *s = &mi->seq[r>>32];
int cmp; int cmp;
cmp = strcmp(qname, s->name); cmp = strcmp(qname, s->name);
if ((flag&MM_F_NO_DIAG) && cmp == 0 && s->len == qlen) { if ((flag&MM_F_NO_DIAG) && cmp == 0 && (int)s->len == qlen) {
if ((uint32_t)r>>1 == (q->q_pos>>1)) return 1; // avoid the diagnonal anchors if ((uint32_t)r>>1 == (q->q_pos>>1)) return 1; // avoid the diagnonal anchors
if ((r&1) == (q->q_pos&1)) *is_self = 1; // this flag is used to avoid spurious extension on self chain if ((r&1) == (q->q_pos&1)) *is_self = 1; // this flag is used to avoid spurious extension on self chain
} }
@@ -163,19 +171,20 @@ static mm128_t *collect_seed_hits_heap(void *km, const mm_mapopt_t *opt, int max
mm128_t *p; mm128_t *p;
uint64_t r = heap->x; uint64_t r = heap->x;
int32_t is_self, rpos = (uint32_t)r >> 1; int32_t is_self, rpos = (uint32_t)r >> 1;
if (skip_seed(opt->flag, r, q, qname, qlen, mi, &is_self)) continue; if (!skip_seed(opt->flag, r, q, qname, qlen, mi, &is_self)) {
if ((r&1) == (q->q_pos&1)) { // forward strand if ((r&1) == (q->q_pos&1)) { // forward strand
p = &a[n_for++]; p = &a[n_for++];
p->x = (r&0xffffffff00000000ULL) | rpos; p->x = (r&0xffffffff00000000ULL) | rpos;
p->y = (uint64_t)q->q_span << 32 | q->q_pos >> 1; p->y = (uint64_t)q->q_span << 32 | q->q_pos >> 1;
} else { // reverse strand } else { // reverse strand
p = &a[(*n_a) - (++n_rev)]; p = &a[(*n_a) - (++n_rev)];
p->x = 1ULL<<63 | (r&0xffffffff00000000ULL) | rpos; p->x = 1ULL<<63 | (r&0xffffffff00000000ULL) | rpos;
p->y = (uint64_t)q->q_span << 32 | (qlen - ((q->q_pos>>1) + 1 - q->q_span) - 1); p->y = (uint64_t)q->q_span << 32 | (qlen - ((q->q_pos>>1) + 1 - q->q_span) - 1);
}
p->y |= (uint64_t)q->seg_id << MM_SEED_SEG_SHIFT;
if (q->is_tandem) p->y |= MM_SEED_TANDEM;
if (is_self) p->y |= MM_SEED_SELF;
} }
p->y |= (uint64_t)q->seg_id << MM_SEED_SEG_SHIFT;
if (q->is_tandem) p->y |= MM_SEED_TANDEM;
if (is_self) p->y |= MM_SEED_SELF;
// update the heap // update the heap
if ((uint32_t)heap->y < q->n - 1) { if ((uint32_t)heap->y < q->n - 1) {
++heap[0].y; ++heap[0].y;
@@ -205,7 +214,7 @@ static mm128_t *collect_seed_hits_heap(void *km, const mm_mapopt_t *opt, int max
static mm128_t *collect_seed_hits(void *km, const mm_mapopt_t *opt, int max_occ, const mm_idx_t *mi, const char *qname, const mm128_v *mv, int qlen, int64_t *n_a, int *rep_len, static mm128_t *collect_seed_hits(void *km, const mm_mapopt_t *opt, int max_occ, const mm_idx_t *mi, const char *qname, const mm128_v *mv, int qlen, int64_t *n_a, int *rep_len,
int *n_mini_pos, uint64_t **mini_pos) int *n_mini_pos, uint64_t **mini_pos)
{ {
int i, k, n_m; int i, n_m;
mm_match_t *m; mm_match_t *m;
mm128_t *a; mm128_t *a;
m = collect_matches(km, &n_m, max_occ, mi, mv, n_a, rep_len, n_mini_pos, mini_pos); m = collect_matches(km, &n_m, max_occ, mi, mv, n_a, rep_len, n_mini_pos, mini_pos);
@@ -213,6 +222,7 @@ static mm128_t *collect_seed_hits(void *km, const mm_mapopt_t *opt, int max_occ,
for (i = 0, *n_a = 0; i < n_m; ++i) { for (i = 0, *n_a = 0; i < n_m; ++i) {
mm_match_t *q = &m[i]; mm_match_t *q = &m[i];
const uint64_t *r = q->cr; const uint64_t *r = q->cr;
uint32_t k;
for (k = 0; k < q->n; ++k) { for (k = 0; k < q->n; ++k) {
int32_t is_self, rpos = (uint32_t)r[k] >> 1; int32_t is_self, rpos = (uint32_t)r[k] >> 1;
mm128_t *p; mm128_t *p;
@@ -238,7 +248,7 @@ static mm128_t *collect_seed_hits(void *km, const mm_mapopt_t *opt, int max_occ,
static void chain_post(const mm_mapopt_t *opt, int max_chain_gap_ref, const mm_idx_t *mi, void *km, int qlen, int n_segs, const int *qlens, int *n_regs, mm_reg1_t *regs, mm128_t *a) static void chain_post(const mm_mapopt_t *opt, int max_chain_gap_ref, const mm_idx_t *mi, void *km, int qlen, int n_segs, const int *qlens, int *n_regs, mm_reg1_t *regs, mm128_t *a)
{ {
if (!(opt->flag & MM_F_ALL_CHAINS)) { // don't choose primary mapping(s) if (!(opt->flag & MM_F_ALL_CHAINS)) { // don't choose primary mapping(s)
mm_set_parent(km, opt->mask_level, *n_regs, regs, opt->a * 2 + opt->b); mm_set_parent(km, opt->mask_level, *n_regs, regs, opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL);
if (n_segs <= 1) mm_select_sub(km, opt->pri_ratio, mi->k*2, opt->best_n, n_regs, regs); if (n_segs <= 1) mm_select_sub(km, opt->pri_ratio, mi->k*2, opt->best_n, n_regs, regs);
else mm_select_sub_multi(km, opt->pri_ratio, 0.2f, 0.7f, max_chain_gap_ref, mi->k*2, opt->best_n, n_segs, qlens, n_regs, regs); else mm_select_sub_multi(km, opt->pri_ratio, 0.2f, 0.7f, max_chain_gap_ref, mi->k*2, opt->best_n, n_segs, qlens, n_regs, regs);
if (!(opt->flag & (MM_F_SPLICE|MM_F_SR|MM_F_NO_LJOIN))) // long join not working well without primary chains if (!(opt->flag & (MM_F_SPLICE|MM_F_SR|MM_F_NO_LJOIN))) // long join not working well without primary chains
@@ -251,7 +261,7 @@ static mm_reg1_t *align_regs(const mm_mapopt_t *opt, const mm_idx_t *mi, void *k
if (!(opt->flag & MM_F_CIGAR)) return regs; if (!(opt->flag & MM_F_CIGAR)) return regs;
regs = mm_align_skeleton(km, opt, mi, qlen, seq, n_regs, regs, a); // this calls mm_filter_regs() regs = mm_align_skeleton(km, opt, mi, qlen, seq, n_regs, regs, a); // this calls mm_filter_regs()
if (!(opt->flag & MM_F_ALL_CHAINS)) { // don't choose primary mapping(s) if (!(opt->flag & MM_F_ALL_CHAINS)) { // don't choose primary mapping(s)
mm_set_parent(km, opt->mask_level, *n_regs, regs, opt->a * 2 + opt->b); mm_set_parent(km, opt->mask_level, *n_regs, regs, opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL);
mm_select_sub(km, opt->pri_ratio, mi->k*2, opt->best_n, n_regs, regs); mm_select_sub(km, opt->pri_ratio, mi->k*2, opt->best_n, n_regs, regs);
mm_set_sam_pri(*n_regs, regs); mm_set_sam_pri(*n_regs, regs);
} }
@@ -308,10 +318,10 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
if (n_regs0 > 0) { // test if the best chain has all the segments if (n_regs0 > 0) { // test if the best chain has all the segments
int n_chained_segs = 1, max = 0, max_i = -1, max_off = -1, off = 0; int n_chained_segs = 1, max = 0, max_i = -1, max_off = -1, off = 0;
for (i = 0; i < n_regs0; ++i) { // find the best chain for (i = 0; i < n_regs0; ++i) { // find the best chain
if (max < u[i]>>32) max = u[i]>>32, max_i = i, max_off = off; if (max < (int)(u[i]>>32)) max = u[i]>>32, max_i = i, max_off = off;
off += (uint32_t)u[i]; off += (uint32_t)u[i];
} }
for (i = 1; i < (uint32_t)u[max_i]; ++i) // count the number of segments in the best chain for (i = 1; i < (int32_t)u[max_i]; ++i) // count the number of segments in the best chain
if ((a[max_off+i].y&MM_SEED_SEG_MASK) != (a[max_off+i-1].y&MM_SEED_SEG_MASK)) if ((a[max_off+i].y&MM_SEED_SEG_MASK) != (a[max_off+i-1].y&MM_SEED_SEG_MASK))
++n_chained_segs; ++n_chained_segs;
if (n_chained_segs < n_segs) if (n_chained_segs < n_segs)
@@ -326,6 +336,8 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
a = mm_chain_dp(max_chain_gap_ref, max_chain_gap_qry, opt->bw, opt->max_chain_skip, opt->min_cnt, opt->min_chain_score, is_splice, n_segs, n_a, a, &n_regs0, &u, b->km); a = mm_chain_dp(max_chain_gap_ref, max_chain_gap_qry, opt->bw, opt->max_chain_skip, opt->min_cnt, opt->min_chain_score, is_splice, n_segs, n_a, a, &n_regs0, &u, b->km);
} }
} }
b->frag_gap = max_chain_gap_ref;
b->rep_len = rep_len;
regs0 = mm_gen_regs(b->km, hash, qlen_sum, n_regs0, u, a); regs0 = mm_gen_regs(b->km, hash, qlen_sum, n_regs0, u, a);
@@ -340,16 +352,16 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
if (n_segs == 1) { // uni-segment if (n_segs == 1) { // uni-segment
regs0 = align_regs(opt, mi, b->km, qlens[0], seqs[0], &n_regs0, regs0, a); regs0 = align_regs(opt, mi, b->km, qlens[0], seqs[0], &n_regs0, regs0, a);
mm_set_mapq(n_regs0, regs0, opt->min_chain_score, opt->a, rep_len, is_sr); mm_set_mapq(b->km, n_regs0, regs0, opt->min_chain_score, opt->a, rep_len, is_sr);
n_regs[0] = n_regs0, regs[0] = regs0; n_regs[0] = n_regs0, regs[0] = regs0;
} else { // multi-segment } else { // multi-segment
mm_seg_t *seg; mm_seg_t *seg;
seg = mm_seg_gen(b->km, hash, n_segs, qlens, n_regs0, regs0, n_regs, regs, a); // split fragment chain to separate segment chains seg = mm_seg_gen(b->km, hash, n_segs, qlens, n_regs0, regs0, n_regs, regs, a); // split fragment chain to separate segment chains
free(regs0); free(regs0);
for (i = 0; i < n_segs; ++i) { for (i = 0; i < n_segs; ++i) {
mm_set_parent(b->km, opt->mask_level, n_regs[i], regs[i], opt->a * 2 + opt->b); // update mm_reg1_t::parent mm_set_parent(b->km, opt->mask_level, n_regs[i], regs[i], opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL); // update mm_reg1_t::parent
regs[i] = align_regs(opt, mi, b->km, qlens[i], seqs[i], &n_regs[i], regs[i], seg[i].a); regs[i] = align_regs(opt, mi, b->km, qlens[i], seqs[i], &n_regs[i], regs[i], seg[i].a);
mm_set_mapq(n_regs[i], regs[i], opt->min_chain_score, opt->a, rep_len, is_sr); mm_set_mapq(b->km, n_regs[i], regs[i], opt->min_chain_score, opt->a, rep_len, is_sr);
} }
mm_seg_free(b->km, n_segs, seg); mm_seg_free(b->km, n_segs, seg);
if (n_segs == 2 && opt->pe_ori >= 0 && (opt->flag&MM_F_CIGAR)) if (n_segs == 2 && opt->pe_ori >= 0 && (opt->flag&MM_F_CIGAR))
@@ -390,13 +402,17 @@ typedef struct {
mm_bseq_file_t **fp; mm_bseq_file_t **fp;
const mm_idx_t *mi; const mm_idx_t *mi;
kstring_t str; kstring_t str;
int n_parts;
uint32_t *rid_shift;
FILE *fp_split, **fp_parts;
} pipeline_t; } pipeline_t;
typedef struct { typedef struct {
const pipeline_t *p; const pipeline_t *p;
int n_seq, n_frag; int n_seq, n_frag;
mm_bseq1_t *seq; mm_bseq1_t *seq;
int *n_reg, *seg_off, *n_seg; int *n_reg, *seg_off, *n_seg, *rep_len, *frag_gap;
mm_reg1_t **reg; mm_reg1_t **reg;
mm_tbuf_t **buf; mm_tbuf_t **buf;
} step_t; } step_t;
@@ -417,10 +433,17 @@ static void worker_for(void *_data, long i, int tid) // kt_for() callback
qseqs[j] = s->seq[off + j].seq; qseqs[j] = s->seq[off + j].seq;
} }
if (s->p->opt->flag & MM_F_INDEPEND_SEG) { if (s->p->opt->flag & MM_F_INDEPEND_SEG) {
for (j = 0; j < s->n_seg[i]; ++j) for (j = 0; j < s->n_seg[i]; ++j) {
mm_map_frag(s->p->mi, 1, &qlens[j], &qseqs[j], &s->n_reg[off+j], &s->reg[off+j], b, s->p->opt, s->seq[off+j].name); mm_map_frag(s->p->mi, 1, &qlens[j], &qseqs[j], &s->n_reg[off+j], &s->reg[off+j], b, s->p->opt, s->seq[off+j].name);
s->rep_len[off + j] = b->rep_len;
s->frag_gap[off + j] = b->frag_gap;
}
} else { } else {
mm_map_frag(s->p->mi, s->n_seg[i], qlens, qseqs, &s->n_reg[off], &s->reg[off], b, s->p->opt, s->seq[off].name); mm_map_frag(s->p->mi, s->n_seg[i], qlens, qseqs, &s->n_reg[off], &s->reg[off], b, s->p->opt, s->seq[off].name);
for (j = 0; j < s->n_seg[i]; ++j) {
s->rep_len[off + j] = b->rep_len;
s->frag_gap[off + j] = b->frag_gap;
}
} }
for (j = 0; j < s->n_seg[i]; ++j) // flip the query strand and coordinate to the original read strand for (j = 0; j < s->n_seg[i]; ++j) // flip the query strand and coordinate to the original read strand
if (s->n_seg[i] == 2 && ((j == 0 && (pe_ori>>1&1)) || (j == 1 && (pe_ori&1)))) { if (s->n_seg[i] == 2 && ((j == 0 && (pe_ori>>1&1)) || (j == 1 && (pe_ori&1)))) {
@@ -436,17 +459,75 @@ static void worker_for(void *_data, long i, int tid) // kt_for() callback
} }
} }
static void merge_hits(step_t *s)
{
int f, i, k0, k, max_seg = 0, *n_reg_part, *rep_len_part, *frag_gap_part, *qlens;
void *km;
FILE **fp = s->p->fp_parts;
const mm_mapopt_t *opt = s->p->opt;
km = km_init();
for (f = 0; f < s->n_frag; ++f)
max_seg = max_seg > s->n_seg[f]? max_seg : s->n_seg[f];
qlens = CALLOC(int, max_seg + s->p->n_parts * 3);
n_reg_part = qlens + max_seg;
rep_len_part = n_reg_part + s->p->n_parts;
frag_gap_part = rep_len_part + s->p->n_parts;
for (f = 0, k = k0 = 0; f < s->n_frag; ++f) {
k0 = k;
for (i = 0; i < s->n_seg[f]; ++i, ++k) {
int j, l, t, rep_len = 0;
qlens[i] = s->seq[k].l_seq;
for (j = 0, s->n_reg[k] = 0; j < s->p->n_parts; ++j) {
mm_err_fread(&n_reg_part[j], sizeof(int), 1, fp[j]);
mm_err_fread(&rep_len_part[j], sizeof(int), 1, fp[j]);
mm_err_fread(&frag_gap_part[j], sizeof(int), 1, fp[j]);
s->n_reg[k] += n_reg_part[j];
if (rep_len < rep_len_part[j])
rep_len = rep_len_part[j];
}
s->reg[k] = CALLOC(mm_reg1_t, s->n_reg[k]);
for (j = 0, l = 0; j < s->p->n_parts; ++j) {
for (t = 0; t < n_reg_part[j]; ++t, ++l) {
mm_reg1_t *r = &s->reg[k][l];
uint32_t capacity;
mm_err_fread(r, sizeof(mm_reg1_t), 1, fp[j]);
r->rid += s->p->rid_shift[j];
if (opt->flag & MM_F_CIGAR) {
mm_err_fread(&capacity, 4, 1, fp[j]);
r->p = (mm_extra_t*)calloc(capacity, 4);
r->p->capacity = capacity;
mm_err_fread(r->p, r->p->capacity, 4, fp[j]);
}
}
}
mm_hit_sort(km, &s->n_reg[k], s->reg[k]);
mm_set_parent(km, opt->mask_level, s->n_reg[k], s->reg[k], opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL);
if (!(opt->flag & MM_F_ALL_CHAINS)) {
mm_select_sub(km, opt->pri_ratio, s->p->mi->k*2, opt->best_n, &s->n_reg[k], s->reg[k]);
mm_set_sam_pri(s->n_reg[k], s->reg[k]);
}
mm_set_mapq(km, s->n_reg[k], s->reg[k], opt->min_chain_score, opt->a, rep_len, !!(opt->flag & MM_F_SR));
}
if (s->n_seg[f] == 2 && opt->pe_ori >= 0 && (opt->flag&MM_F_CIGAR))
mm_pair(km, frag_gap_part[0], opt->pe_bonus, opt->a * 2 + opt->b, opt->a, qlens, &s->n_reg[k0], &s->reg[k0]);
}
free(qlens);
km_destroy(km);
}
static void *worker_pipeline(void *shared, int step, void *in) static void *worker_pipeline(void *shared, int step, void *in)
{ {
int i, j, k; int i, j, k;
pipeline_t *p = (pipeline_t*)shared; pipeline_t *p = (pipeline_t*)shared;
if (step == 0) { // step 0: read sequences if (step == 0) { // step 0: read sequences
int with_qual = (!!(p->opt->flag & MM_F_OUT_SAM) && !(p->opt->flag & MM_F_NO_QUAL)); int with_qual = (!!(p->opt->flag & MM_F_OUT_SAM) && !(p->opt->flag & MM_F_NO_QUAL));
int with_comment = !!(p->opt->flag & MM_F_COPY_COMMENT);
int frag_mode = (p->n_fp > 1 || !!(p->opt->flag & MM_F_FRAG_MODE)); int frag_mode = (p->n_fp > 1 || !!(p->opt->flag & MM_F_FRAG_MODE));
step_t *s; step_t *s;
s = (step_t*)calloc(1, sizeof(step_t)); s = (step_t*)calloc(1, sizeof(step_t));
if (p->n_fp > 1) s->seq = mm_bseq_read_frag(p->n_fp, p->fp, p->mini_batch_size, with_qual, &s->n_seq); if (p->n_fp > 1) s->seq = mm_bseq_read_frag2(p->n_fp, p->fp, p->mini_batch_size, with_qual, with_comment, &s->n_seq);
else s->seq = mm_bseq_read2(p->fp[0], p->mini_batch_size, with_qual, frag_mode, &s->n_seq); else s->seq = mm_bseq_read3(p->fp[0], p->mini_batch_size, with_qual, with_comment, frag_mode, &s->n_seq);
if (s->seq) { if (s->seq) {
s->p = p; s->p = p;
for (i = 0; i < s->n_seq; ++i) for (i = 0; i < s->n_seq; ++i)
@@ -454,9 +535,11 @@ static void *worker_pipeline(void *shared, int step, void *in)
s->buf = (mm_tbuf_t**)calloc(p->n_threads, sizeof(mm_tbuf_t*)); s->buf = (mm_tbuf_t**)calloc(p->n_threads, sizeof(mm_tbuf_t*));
for (i = 0; i < p->n_threads; ++i) for (i = 0; i < p->n_threads; ++i)
s->buf[i] = mm_tbuf_init(); s->buf[i] = mm_tbuf_init();
s->n_reg = (int*)calloc(3 * s->n_seq, sizeof(int)); s->n_reg = (int*)calloc(5 * s->n_seq, sizeof(int));
s->seg_off = s->n_reg + s->n_seq; // seg_off and n_seg are allocated together with n_reg s->seg_off = s->n_reg + s->n_seq; // seg_off, n_seg, rep_len and frag_gap are allocated together with n_reg
s->n_seg = s->seg_off + s->n_seq; s->n_seg = s->seg_off + s->n_seq;
s->rep_len = s->n_seg + s->n_seq;
s->frag_gap = s->rep_len + s->n_seq;
s->reg = (mm_reg1_t**)calloc(s->n_seq, sizeof(mm_reg1_t*)); s->reg = (mm_reg1_t**)calloc(s->n_seq, sizeof(mm_reg1_t*));
for (i = 1, j = 0; i <= s->n_seq; ++i) for (i = 1, j = 0; i <= s->n_seq; ++i)
if (i == s->n_seq || !frag_mode || !mm_qname_same(s->seq[i-1].name, s->seq[i].name)) { if (i == s->n_seq || !frag_mode || !mm_qname_same(s->seq[i-1].name, s->seq[i].name)) {
@@ -467,7 +550,8 @@ static void *worker_pipeline(void *shared, int step, void *in)
return s; return s;
} else free(s); } else free(s);
} else if (step == 1) { // step 1: map } else if (step == 1) { // step 1: map
kt_for(p->n_threads, worker_for, in, ((step_t*)in)->n_frag); if (p->n_parts > 0) merge_hits((step_t*)in);
else kt_for(p->n_threads, worker_for, in, ((step_t*)in)->n_frag);
return in; return in;
} else if (step == 2) { // step 2: output } else if (step == 2) { // step 2: output
void *km = 0; void *km = 0;
@@ -480,20 +564,36 @@ static void *worker_pipeline(void *shared, int step, void *in)
int seg_st = s->seg_off[k], seg_en = s->seg_off[k] + s->n_seg[k]; int seg_st = s->seg_off[k], seg_en = s->seg_off[k] + s->n_seg[k];
for (i = seg_st; i < seg_en; ++i) { for (i = seg_st; i < seg_en; ++i) {
mm_bseq1_t *t = &s->seq[i]; mm_bseq1_t *t = &s->seq[i];
for (j = 0; j < s->n_reg[i]; ++j) { if (p->opt->split_prefix && p->n_parts == 0) { // then write to temporary files
mm_reg1_t *r = &s->reg[i][j]; mm_err_fwrite(&s->n_reg[i], sizeof(int), 1, p->fp_split);
assert(!r->sam_pri || r->id == r->parent); mm_err_fwrite(&s->rep_len[i], sizeof(int), 1, p->fp_split);
if ((p->opt->flag & MM_F_NO_PRINT_2ND) && r->id != r->parent) mm_err_fwrite(&s->frag_gap[i], sizeof(int), 1, p->fp_split);
continue; for (j = 0; j < s->n_reg[i]; ++j) {
mm_reg1_t *r = &s->reg[i][j];
mm_err_fwrite(r, sizeof(mm_reg1_t), 1, p->fp_split);
if (p->opt->flag & MM_F_CIGAR) {
mm_err_fwrite(&r->p->capacity, 4, 1, p->fp_split);
mm_err_fwrite(r->p, r->p->capacity, 4, p->fp_split);
}
}
} else if (s->n_reg[i] > 0) { // the query has at least one hit
for (j = 0; j < s->n_reg[i]; ++j) {
mm_reg1_t *r = &s->reg[i][j];
assert(!r->sam_pri || r->id == r->parent);
if ((p->opt->flag & MM_F_NO_PRINT_2ND) && r->id != r->parent)
continue;
if (p->opt->flag & MM_F_OUT_SAM)
mm_write_sam2(&p->str, mi, t, i - seg_st, j, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag);
else
mm_write_paf(&p->str, mi, t, r, km, p->opt->flag);
mm_err_puts(p->str.s);
}
} else if (p->opt->flag & (MM_F_OUT_SAM|MM_F_PAF_NO_HIT)) { // output an empty hit, if requested
if (p->opt->flag & MM_F_OUT_SAM) if (p->opt->flag & MM_F_OUT_SAM)
mm_write_sam2(&p->str, mi, t, i - seg_st, j, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag); mm_write_sam2(&p->str, mi, t, i - seg_st, -1, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag);
else else
mm_write_paf(&p->str, mi, t, r, km, p->opt->flag); mm_write_paf(&p->str, mi, t, 0, 0, p->opt->flag);
puts(p->str.s); mm_err_puts(p->str.s);
}
if (s->n_reg[i] == 0 && (p->opt->flag & MM_F_OUT_SAM)) {
mm_write_sam2(&p->str, mi, t, i - seg_st, -1, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag);
puts(p->str.s);
} }
} }
for (i = seg_st; i < seg_en; ++i) { for (i = seg_st; i < seg_en; ++i) {
@@ -501,9 +601,10 @@ static void *worker_pipeline(void *shared, int step, void *in)
free(s->reg[i]); free(s->reg[i]);
free(s->seq[i].seq); free(s->seq[i].name); free(s->seq[i].seq); free(s->seq[i].name);
if (s->seq[i].qual) free(s->seq[i].qual); if (s->seq[i].qual) free(s->seq[i].qual);
if (s->seq[i].comment) free(s->seq[i].comment);
} }
} }
free(s->reg); free(s->n_reg); free(s->seq); // seg_off and n_seg were allocated with reg; no memory leak here free(s->reg); free(s->n_reg); free(s->seq); // seg_off, n_seg, rep_len and frag_gap were allocated with reg; no memory leak here
km_destroy(km); km_destroy(km);
if (mm_verbose >= 3) if (mm_verbose >= 3)
fprintf(stderr, "[M::%s::%.3f*%.2f] mapped %d sequences\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), s->n_seq); fprintf(stderr, "[M::%s::%.3f*%.2f] mapped %d sequences\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), s->n_seq);
@@ -512,32 +613,44 @@ static void *worker_pipeline(void *shared, int step, void *in)
return 0; return 0;
} }
static mm_bseq_file_t **open_bseqs(int n, const char **fn)
{
mm_bseq_file_t **fp;
int i, j;
fp = (mm_bseq_file_t**)calloc(n, sizeof(mm_bseq_file_t*));
for (i = 0; i < n; ++i) {
if ((fp[i] = mm_bseq_open(fn[i])) == 0) {
if (mm_verbose >= 1)
fprintf(stderr, "ERROR: failed to open file '%s'\n", fn[i]);
for (j = 0; j < i; ++j)
mm_bseq_close(fp[j]);
free(fp);
return 0;
}
}
return fp;
}
int mm_map_file_frag(const mm_idx_t *idx, int n_segs, const char **fn, const mm_mapopt_t *opt, int n_threads) int mm_map_file_frag(const mm_idx_t *idx, int n_segs, const char **fn, const mm_mapopt_t *opt, int n_threads)
{ {
int i, j, pl_threads; int i, pl_threads;
pipeline_t pl; pipeline_t pl;
if (n_segs < 1) return -1; if (n_segs < 1) return -1;
memset(&pl, 0, sizeof(pipeline_t)); memset(&pl, 0, sizeof(pipeline_t));
pl.n_fp = n_segs; pl.n_fp = n_segs;
pl.fp = (mm_bseq_file_t**)calloc(n_segs, sizeof(mm_bseq_file_t*)); pl.fp = open_bseqs(pl.n_fp, fn);
for (i = 0; i < n_segs; ++i) { if (pl.fp == 0) return -1;
pl.fp[i] = mm_bseq_open(fn[i]);
if (pl.fp[i] == 0) {
if (mm_verbose >= 1)
fprintf(stderr, "ERROR: failed to open file '%s'\n", fn[i]);
for (j = 0; j < i; ++j)
mm_bseq_close(pl.fp[j]);
free(pl.fp);
return -1;
}
}
pl.opt = opt, pl.mi = idx; pl.opt = opt, pl.mi = idx;
pl.n_threads = n_threads > 1? n_threads : 1; pl.n_threads = n_threads > 1? n_threads : 1;
pl.mini_batch_size = opt->mini_batch_size; pl.mini_batch_size = opt->mini_batch_size;
if (opt->split_prefix)
pl.fp_split = mm_split_init(opt->split_prefix, idx);
pl_threads = n_threads == 1? 1 : (opt->flag&MM_F_2_IO_THREADS)? 3 : 2; pl_threads = n_threads == 1? 1 : (opt->flag&MM_F_2_IO_THREADS)? 3 : 2;
kt_pipeline(pl_threads, worker_pipeline, &pl, 3); kt_pipeline(pl_threads, worker_pipeline, &pl, 3);
free(pl.str.s); free(pl.str.s);
for (i = 0; i < n_segs; ++i) if (pl.fp_split) fclose(pl.fp_split);
for (i = 0; i < pl.n_fp; ++i)
mm_bseq_close(pl.fp[i]); mm_bseq_close(pl.fp[i]);
free(pl.fp); free(pl.fp);
return 0; return 0;
@@ -547,3 +660,48 @@ int mm_map_file(const mm_idx_t *idx, const char *fn, const mm_mapopt_t *opt, int
{ {
return mm_map_file_frag(idx, 1, &fn, opt, n_threads); return mm_map_file_frag(idx, 1, &fn, opt, n_threads);
} }
int mm_split_merge(int n_segs, const char **fn, const mm_mapopt_t *opt, int n_split_idx)
{
int i;
pipeline_t pl;
mm_idx_t *mi;
if (n_segs < 1 || n_split_idx < 1) return -1;
memset(&pl, 0, sizeof(pipeline_t));
pl.n_fp = n_segs;
pl.fp = open_bseqs(pl.n_fp, fn);
if (pl.fp == 0) return -1;
pl.opt = opt;
pl.mini_batch_size = opt->mini_batch_size;
pl.n_parts = n_split_idx;
pl.fp_parts = CALLOC(FILE*, pl.n_parts);
pl.rid_shift = CALLOC(uint32_t, pl.n_parts);
pl.mi = mi = mm_split_merge_prep(opt->split_prefix, n_split_idx, pl.fp_parts, pl.rid_shift);
if (pl.mi == 0) {
free(pl.fp_parts);
free(pl.rid_shift);
return -1;
}
for (i = n_split_idx - 1; i > 0; --i)
pl.rid_shift[i] = pl.rid_shift[i - 1];
for (pl.rid_shift[0] = 0, i = 1; i < n_split_idx; ++i)
pl.rid_shift[i] += pl.rid_shift[i - 1];
if (opt->flag & MM_F_OUT_SAM)
for (i = 0; i < (int32_t)pl.mi->n_seq; ++i)
printf("@SQ\tSN:%s\tLN:%d\n", pl.mi->seq[i].name, pl.mi->seq[i].len);
kt_pipeline(2, worker_pipeline, &pl, 3);
free(pl.str.s);
mm_idx_destroy(mi);
free(pl.rid_shift);
for (i = 0; i < n_split_idx; ++i)
fclose(pl.fp_parts[i]);
free(pl.fp_parts);
for (i = 0; i < pl.n_fp; ++i)
mm_bseq_close(pl.fp[i]);
free(pl.fp);
mm_split_rm_tmp(opt->split_prefix, n_split_idx);
return 0;
}
+70 -3
View File
@@ -29,6 +29,12 @@
#define MM_F_REV_ONLY 0x200000 #define MM_F_REV_ONLY 0x200000
#define MM_F_HEAP_SORT 0x400000 #define MM_F_HEAP_SORT 0x400000
#define MM_F_ALL_CHAINS 0x800000 #define MM_F_ALL_CHAINS 0x800000
#define MM_F_OUT_MD 0x1000000
#define MM_F_COPY_COMMENT 0x2000000
#define MM_F_EQX 0x4000000 // use =/X instead of M
#define MM_F_PAF_NO_HIT 0x8000000 // output unmapped reads to PAF
#define MM_F_NO_END_FLT 0x10000000
#define MM_F_HARD_MLEVEL 0x20000000
#define MM_I_HPC 0x1 #define MM_I_HPC 0x1
#define MM_I_NO_SEQ 0x2 #define MM_I_NO_SEQ 0x2
@@ -56,10 +62,11 @@ typedef struct {
typedef struct { typedef struct {
int32_t b, w, k, flag; int32_t b, w, k, flag;
uint32_t n_seq; // number of reference sequences uint32_t n_seq; // number of reference sequences
int32_t index;
mm_idx_seq_t *seq; // sequence name, length and offset mm_idx_seq_t *seq; // sequence name, length and offset
uint32_t *S; // 4-bit packed sequence uint32_t *S; // 4-bit packed sequence
struct mm_idx_bucket_s *B; // index (hidden) struct mm_idx_bucket_s *B; // index (hidden)
void *km; void *km, *h;
} mm_idx_t; } mm_idx_t;
// minimap2 alignment // minimap2 alignment
@@ -82,7 +89,7 @@ typedef struct {
int32_t mlen, blen; // seeded exact match length; seeded alignment block length int32_t mlen, blen; // seeded exact match length; seeded alignment block length
int32_t n_sub; // number of suboptimal mappings int32_t n_sub; // number of suboptimal mappings
int32_t score0; // initial chaining score (before chain merging/spliting) int32_t score0; // initial chaining score (before chain merging/spliting)
uint32_t mapq:8, split:2, rev:1, inv:1, sam_pri:1, proper_frag:1, pe_thru:1, seg_split:1, seg_id:8, dummy:8; uint32_t mapq:8, split:2, rev:1, inv:1, sam_pri:1, proper_frag:1, pe_thru:1, seg_split:1, seg_id:8, split_inv:1, dummy:7;
uint32_t hash; uint32_t hash;
float div; float div;
mm_extra_t *p; mm_extra_t *p;
@@ -113,21 +120,28 @@ typedef struct {
int max_join_long, max_join_short; int max_join_long, max_join_short;
int min_join_flank_sc; int min_join_flank_sc;
float min_join_flank_ratio;
int a, b, q, e, q2, e2; // matching score, mismatch, gap-open and gap-ext penalties int a, b, q, e, q2, e2; // matching score, mismatch, gap-open and gap-ext penalties
int sc_ambi; // score when one or both bases are "N"
int noncan; // cost of non-canonical splicing sites int noncan; // cost of non-canonical splicing sites
int zdrop; // break alignment if alignment score drops too fast along the diagonal int zdrop, zdrop_inv; // break alignment if alignment score drops too fast along the diagonal
int end_bonus; int end_bonus;
int min_dp_max; // drop an alignment if the score of the max scoring segment is below this threshold int min_dp_max; // drop an alignment if the score of the max scoring segment is below this threshold
int min_ksw_len; int min_ksw_len;
int anchor_ext_len, anchor_ext_shift; int anchor_ext_len, anchor_ext_shift;
float max_clip_ratio; // drop an alignment if BOTH ends are clipped above this ratio
int pe_ori, pe_bonus; int pe_ori, pe_bonus;
float mid_occ_frac; // only used by mm_mapopt_update(); see below float mid_occ_frac; // only used by mm_mapopt_update(); see below
int32_t min_mid_occ;
int32_t mid_occ; // ignore seeds with occurrences above this threshold int32_t mid_occ; // ignore seeds with occurrences above this threshold
int32_t max_occ; int32_t max_occ;
int mini_batch_size; // size of a batch of query bases to process in parallel int mini_batch_size; // size of a batch of query bases to process in parallel
int64_t max_sw_mat;
const char *split_prefix;
} mm_mapopt_t; } mm_mapopt_t;
// index reader // index reader
@@ -212,6 +226,36 @@ void mm_idx_reader_close(mm_idx_reader_t *r);
int mm_idx_reader_eof(const mm_idx_reader_t *r); int mm_idx_reader_eof(const mm_idx_reader_t *r);
/**
* Check whether the file contains a minimap2 index
*
* @param fn file name
*
* @return the file size if fn is an index file; 0 if fn is not.
*/
int64_t mm_idx_is_idx(const char *fn);
/**
* Load a part of an index
*
* Given a uni-part index, this function loads the entire index into memory.
* Given a multi-part index, it loads one part only and places the file pointer
* at the end of that part.
*
* @param fp pointer to FILE object
*
* @return minimap2 index read from fp
*/
mm_idx_t *mm_idx_load(FILE *fp);
/**
* Append an index (or one part of a full index) to file
*
* @param fp pointer to FILE object
* @param mi minimap2 index
*/
void mm_idx_dump(FILE *fp, const mm_idx_t *mi);
/** /**
* Create an index from strings in memory * Create an index from strings in memory
* *
@@ -260,6 +304,8 @@ mm_tbuf_t *mm_tbuf_init(void);
*/ */
void mm_tbuf_destroy(mm_tbuf_t *b); void mm_tbuf_destroy(mm_tbuf_t *b);
void *mm_tbuf_get_km(mm_tbuf_t *b);
/** /**
* Align a query sequence against an index * Align a query sequence against an index
* *
@@ -296,6 +342,27 @@ int mm_map_file(const mm_idx_t *idx, const char *fn, const mm_mapopt_t *opt, int
int mm_map_file_frag(const mm_idx_t *idx, int n_segs, const char **fn, const mm_mapopt_t *opt, int n_threads); int mm_map_file_frag(const mm_idx_t *idx, int n_segs, const char **fn, const mm_mapopt_t *opt, int n_threads);
/**
* Generate the cs tag (new in 2.12)
*
* @param km memory blocks; set to NULL if unsure
* @param buf buffer to write the cs/MD tag; typicall NULL on the first call
* @param max_len max length of the buffer; typically set to 0 on the first call
* @param mi index
* @param r alignment
* @param seq query sequence
* @param no_iden true to use : instead of =
*
* @return the length of cs
*/
int mm_gen_cs(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int no_iden);
int mm_gen_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq);
// query sequence name and sequence in the minimap2 index
int mm_idx_index_name(mm_idx_t *mi);
int mm_idx_name2id(const mm_idx_t *mi, const char *name);
int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq);
// deprecated APIs for backward compatibility // deprecated APIs for backward compatibility
void mm_mapopt_init(mm_mapopt_t *opt); void mm_mapopt_init(mm_mapopt_t *opt);
mm_idx_t *mm_idx_build(const char *fn, int w, int k, int flag, int n_threads); mm_idx_t *mm_idx_build(const char *fn, int w, int k, int flag, int n_threads);
+93 -17
View File
@@ -1,4 +1,4 @@
.TH minimap2 1 "1 February 2018" "minimap2-2.8 (r672)" "Bioinformatics tools" .TH minimap2 1 "5 November 2018" "minimap2-2.14 (r883)" "Bioinformatics tools"
.SH NAME .SH NAME
.PP .PP
minimap2 - mapping and alignment between collections of DNA sequences minimap2 - mapping and alignment between collections of DNA sequences
@@ -123,10 +123,27 @@ provided as the target sequences, options
will be effectively overridden by the options stored in the index file. will be effectively overridden by the options stored in the index file.
.SS Mapping options .SS Mapping options
.TP 10 .TP 10
.BI -f \ FLOAT .BI -f \ FLOAT | INT1 [, INT2 ]
Ignore top If fraction, ignore top
.I FLOAT .I FLOAT
fraction of most frequent minimizers [0.0002] fraction of most frequent minimizers [0.0002]. If integer,
ignore minimizers occuring more than
.I INT1
times.
.I INT2
is only effective in the
.B --sr
or
.B -xsr
mode, which sets the threshold for a second round of seeding.
.TP
.BI --min-occ-floor \ INT
Force minimap2 to always use k-mers occurring
.I INT
times or less [0]. In effect, the max occurrence threshold is set to
the
.RI max{ INT ,
.BR -f }.
.TP .TP
.BI -g \ INT .BI -g \ INT
Stop chain enlongation if there are no minimizers within Stop chain enlongation if there are no minimizers within
@@ -161,8 +178,10 @@ and
have no effect when this option is in use. have no effect when this option is in use.
.TP .TP
.BR --dual = yes | no .BR --dual = yes | no
During chaining, whether to skip pairs wherein the query name is If
lexicographically greater than the target name [yes] .BR no ,
skip query-target pairs wherein the query name is lexicographically greater
than the target name [yes]
.TP .TP
.B -X .B -X
Equivalent to Equivalent to
@@ -174,7 +193,7 @@ Primarily used for all-vs-all read overlapping.
.BI -p \ FLOAT .BI -p \ FLOAT
Minimal secondary-to-primary score ratio to output secondary mappings [0.8]. Minimal secondary-to-primary score ratio to output secondary mappings [0.8].
Between two chains overlaping over half of the shorter chain (controlled by Between two chains overlaping over half of the shorter chain (controlled by
.BR --mask-level ), .BR -M ),
the chain with a lower score is secondary to the chain with a higher score. the chain with a lower score is secondary to the chain with a higher score.
If the ratio of the scores is below If the ratio of the scores is below
.IR FLOAT , .IR FLOAT ,
@@ -207,6 +226,11 @@ Mark as secondary a chain that overlaps with a better chain by
.I FLOAT .I FLOAT
or more of the shorter chain [0.5] or more of the shorter chain [0.5]
.TP .TP
.B --hard-mask-level
Honor option
.B -M
and disable a heurstic to save unmapped subsequences.
.TP
.BI --max-chain-skip \ INT .BI --max-chain-skip \ INT
A heuristics that stops chaining early [50]. Minimap2 uses dynamic programming A heuristics that stops chaining early [50]. Minimap2 uses dynamic programming
for chaining. The time complexity is quadratic in the number of seeds. This for chaining. The time complexity is quadratic in the number of seeds. This
@@ -220,6 +244,10 @@ Disable the long gap patching heuristic. When this option is applied, the
maximum alignment gap is mostly controlled by maximum alignment gap is mostly controlled by
.BR -r . .BR -r .
.TP .TP
.BI --lj-min-ratio \ FLOAT
Fraction of query sequence length required to bridge a long gap [0.5]. A
smaller value helps to recover longer gaps, at the cost of more false gaps.
.TP
.B --splice .B --splice
Enable the splice alignment mode. Enable the splice alignment mode.
.TP .TP
@@ -229,6 +257,9 @@ applies a second round of chaining with a higher minimizer occurrence threshold
if no good chain is found. In addition, minimap2 attempts to patch gaps between if no good chain is found. In addition, minimap2 attempts to patch gaps between
seeds with ungapped alignment. seeds with ungapped alignment.
.TP .TP
.BI --split-prefix \ STR
Prefix to create temporary files. Typically used for a multi-part index.
.TP
.BR --frag = no | yes .BR --frag = no | yes
Whether to enable the fragment mode [no] Whether to enable the fragment mode [no]
.TP .TP
@@ -243,6 +274,10 @@ Only map to the reverse complement strand of the reference sequences.
.BR --heap-sort = no | yes .BR --heap-sort = no | yes
If yes, sort anchors with heap merge, instead of radix sort. Heap merge is If yes, sort anchors with heap merge, instead of radix sort. Heap merge is
faster for short reads, but slower for long reads. [no] faster for short reads, but slower for long reads. [no]
.TP
.B --no-pairing
Treat two reads in a pair as independent reads. The mate related fields in SAM
are still properly populated.
.SS Alignment options .SS Alignment options
.TP 10 .TP 10
.BI -A \ INT .BI -A \ INT
@@ -269,11 +304,22 @@ Cost for a non-canonical GT-AG splicing (effective with
.BR --splice ) .BR --splice )
[0] [0]
.TP .TP
.BI -z \ INT .BI -z \ INT1[,INT2]
Break an alignment if the running score drops too quickly along the diagonal of Truncate an alignment if the running alignment score drops too quickly along
the DP matrix (diagonal X-drop, or Z-drop) [400]. Increasing the value improves the diagonal of the DP matrix (diagonal X-drop, or Z-drop) [400,200]. If the
the contiguity of the alignment at the cost of poor alignment in the middle drop of score is above
(e.g. caused by a long inversion). .IR INT2 ,
minimap2 will reverse complement the query in the related region and align
again to test small inversions. Minimap2 truncates alignment if there is an
inversion or the drop of score is greater than
.IR INT1 .
Decrease
.I INT2
to find small inversions at the cost of performance and false positives.
Increase
.I INT1
to improves the contiguity of alignment at the cost of poor alignment in the
middle.
.TP .TP
.BI -s \ INT .BI -s \ INT
Minimal peak DP alignment score to output [40]. The peak score is computed from Minimal peak DP alignment score to output [40]. The peak score is computed from
@@ -292,6 +338,9 @@ no attempt to match GT-AG [n]
.BI --end-bonus \ INT .BI --end-bonus \ INT
Score bonus when alignment extends to the end of the query sequence [0]. Score bonus when alignment extends to the end of the query sequence [0].
.TP .TP
.BI --score-N \ INT
Score of a mismatch involving ambiguous bases [1].
.TP
.BR --splice-flank = yes | no .BR --splice-flank = yes | no
Assume the next base to a Assume the next base to a
.B GT .B GT
@@ -320,6 +369,15 @@ the length of the terminal gap in the chain. This option is only effective
with with
.BR --splice . .BR --splice .
It helps to avoid tiny terminal exons. [6] It helps to avoid tiny terminal exons. [6]
.TP
.B --no-end-flt
Don't filter seeds towards the ends of chains before performing base-level
alignment.
.TP
.BI --cap-sw-mem \ NUM
Skip alignment if the DP matrix size is above
.IR NUM .
Set 0 to disable [0].
.SS Input/output options .SS Input/output options
.TP 10 .TP 10
.B -a .B -a
@@ -340,6 +398,9 @@ SAM read group line in a format like
.B @RG\\\\tID:foo\\\\tSM:bar .B @RG\\\\tID:foo\\\\tSM:bar
[]. [].
.TP .TP
.B -y
Copy input FASTA/Q comments to output.
.TP
.B -c .B -c
Generate CIGAR. In PAF, the CIGAR is written to the `cg' custom tag. Generate CIGAR. In PAF, the CIGAR is written to the `cg' custom tag.
.TP .TP
@@ -358,6 +419,12 @@ is given,
.I short .I short
is assumed. [none] is assumed. [none]
.TP .TP
.B --MD
Output the MD tag (see the SAM spec).
.TP
.B --eqx
Output =/X CIGAR operators for sequence match/mismatch.
.TP
.B -Y .B -Y
In SAM output, use soft clipping for supplementary alignments. In SAM output, use soft clipping for supplementary alignments.
.TP .TP
@@ -420,18 +487,25 @@ is determined by the sequencing error mode.
.B asm5 .B asm5
Long assembly to reference mapping Long assembly to reference mapping
.RB ( -k19 .RB ( -k19
.B -w19 -A1 -B19 -O39,81 -E3,1 -s200 .B -w19 -A1 -B19 -O39,81 -E3,1 -s200 -z200
.BR -z200 ). .BR --min-occ-floor=100 ).
Typically, the alignment will not extend to regions with 5% or higher sequence Typically, the alignment will not extend to regions with 5% or higher sequence
divergence. Only use this preset if the average divergence is far below 5%. divergence. Only use this preset if the average divergence is far below 5%.
.TP .TP
.B asm10 .B asm10
Long assembly to reference mapping Long assembly to reference mapping
.RB ( -k19 .RB ( -k19
.B -w19 -A1 -B9 -O16,41 -E2,1 -s200 .B -w19 -A1 -B9 -O16,41 -E2,1 -s200 -z200
.BR -z200 ). .BR --min-occ-floor=100 ).
Up to 10% sequence divergence. Up to 10% sequence divergence.
.TP .TP
.B asm20
Long assembly to reference mapping
.RB ( -k19
.B -w10 -A1 -B4 -O6,26 -E2,1 -s200 -z200
.BR --min-occ-floor=100 ).
Up to 20% sequence divergence.
.TP
.B ava-pb .B ava-pb
PacBio all-vs-all overlap mapping PacBio all-vs-all overlap mapping
.RB ( -Hk19 .RB ( -Hk19
@@ -441,7 +515,7 @@ PacBio all-vs-all overlap mapping
.B ava-ont .B ava-ont
Oxford Nanopore all-vs-all overlap mapping Oxford Nanopore all-vs-all overlap mapping
.RB ( -k15 .RB ( -k15
.B -Xw5 -m100 -g10000 --max-chain-skip .B -Xw5 -m100 -g10000 -r2000 --max-chain-skip
.BR 25 ). .BR 25 ).
Similarly, the major difference from Similarly, the major difference from
.B ava-pb .B ava-pb
@@ -522,12 +596,14 @@ cm i Number of minimizers on the chain
s1 i Chaining score s1 i Chaining score
s2 i Chaining score of the best secondary chain s2 i Chaining score of the best secondary chain
NM i Total number of mismatches and gaps in the alignment NM i Total number of mismatches and gaps in the alignment
MD Z To generate the ref sequence in the alignment
AS i DP alignment score AS i DP alignment score
ms i DP score of the max scoring segment in the alignment ms i DP score of the max scoring segment in the alignment
nn i Number of ambiguous bases in the alignment nn i Number of ambiguous bases in the alignment
ts A Transcript strand (splice mode only) ts A Transcript strand (splice mode only)
cg Z CIGAR string (only in PAF) cg Z CIGAR string (only in PAF)
cs Z Difference string cs Z Difference string
dv f Approximate per-base sequence divergence
.TE .TE
.PP .PP
+46 -2
View File
@@ -1,3 +1,4 @@
#include <stdlib.h>
#include "mmpriv.h" #include "mmpriv.h"
int mm_verbose = 1; int mm_verbose = 1;
@@ -86,6 +87,8 @@ double cputime()
return kernelModeTime + userModeTime; return kernelModeTime + userModeTime;
} }
long peakrss(void) { return 0; }
#else #else
#include <sys/resource.h> #include <sys/resource.h>
#include <sys/time.h> #include <sys/time.h>
@@ -96,16 +99,57 @@ double cputime(void)
getrusage(RUSAGE_SELF, &r); getrusage(RUSAGE_SELF, &r);
return r.ru_utime.tv_sec + r.ru_stime.tv_sec + 1e-6 * (r.ru_utime.tv_usec + r.ru_stime.tv_usec); return r.ru_utime.tv_sec + r.ru_stime.tv_sec + 1e-6 * (r.ru_utime.tv_usec + r.ru_stime.tv_usec);
} }
long peakrss(void)
{
struct rusage r;
getrusage(RUSAGE_SELF, &r);
#ifdef __linux__
return r.ru_maxrss * 1024;
#else
return r.ru_maxrss;
#endif
}
#endif /* WIN32 || _WIN32 */ #endif /* WIN32 || _WIN32 */
double realtime(void) double realtime(void)
{ {
struct timeval tp; struct timeval tp;
struct timezone tzp; gettimeofday(&tp, NULL);
gettimeofday(&tp, &tzp);
return tp.tv_sec + tp.tv_usec * 1e-6; return tp.tv_sec + tp.tv_usec * 1e-6;
} }
void mm_err_puts(const char *str)
{
int ret;
ret = puts(str);
if (ret == EOF) {
fprintf(stderr, "[ERROR] failed to write the results\n");
exit(EXIT_FAILURE);
}
}
void mm_err_fwrite(const void *p, size_t size, size_t nitems, FILE *fp)
{
int ret;
ret = fwrite(p, size, nitems, fp);
if (ret == EOF) {
fprintf(stderr, "[ERROR] failed to write data\n");
exit(EXIT_FAILURE);
}
}
void mm_err_fread(void *p, size_t size, size_t nitems, FILE *fp)
{
int ret;
ret = fread(p, size, nitems, fp);
if (ret == EOF) {
fprintf(stderr, "[ERROR] failed to read data\n");
exit(EXIT_FAILURE);
}
}
#include "ksort.h" #include "ksort.h"
#define sort_key_128x(a) ((a).x) #define sort_key_128x(a) ((a).x)
+170 -19
View File
@@ -1,28 +1,179 @@
The [K8 Javascript shell][k8] is needed to run Javascripts in this directory. ## <a name="started"></a>Getting Started
Precompiled k8 binaries for Mac and Linux can be found at the [K8 release
page][k8bin].
* [paf2aln.js](paf2aln.js): convert PAF to [MAF][maf] or BLAST-like output for ```sh
eyeballing. PAF has to be generated with minimap2 option `-S`, which writes # install minimap2
the aligned sequences to the `cs` tag. An example: git clone https://github.com/lh3/minimap2
```sh cd minimap2 && make
../minimap2 -S ../test/MT-*.fa | k8 paf2aln.js /dev/stdin # install the k8 javascript shell
``` curl -L https://github.com/attractivechaos/k8/releases/download/v0.2.4/k8-0.2.4.tar.bz2 | tar -jxf -
cp k8-0.2.4/k8-`uname -s` k8 # or copy it to a directory on your $PATH
# export PATH="$PATH:`pwd`:`pwd`/misc" # run this if k8, minimap2 or paftools.js not on your $PATH
minimap2 --cs test/MT-human.fa test/MT-orang.fa | paftools.js view - # view alignment
minimap2 -c test/MT-human.fa test/MT-orang.fa | paftools.js stat - # basic alignment statistics
minimap2 -c --cs test/MT-human.fa test/MT-orang.fa \
| sort -k6,6 -k8,8n | paftools.js call -L15000 - # calling variants from asm-to-ref alignment
minimap2 -c test/MT-human.fa test/MT-orang.fa \
| paftools.js liftover -l10000 - <(echo -e "MT_orang\t2000\t5000") # liftOver
# no test data for the following examples
paftools.js junceval -e anno.gtf splice.sam > out.txt # compare splice junctions to annotations
paftools.js splice2bed anno.gtf > anno.bed # convert GTF/GFF3 to BED12
```
* [mapstat.js](mapstat.js): output basic statistics such as the number of ## Table of Contents
non-redundant mapped bases, number of split and secondary alignments and
number of long gaps. This scripts seamlessly works with both SAM and PAF.
* [sim-pbsim.js](sim-pbsim.js): convert reads simulated with [PBSIM][pbsim] to - [Getting Started](#started)
FASTA and encode the true mapping positions to read names in a format like - [Introduction](#intro)
`S1_33!chr1!225258409!225267761!-`. - [Evaluation](#eval)
- [Evaluating mapping accuracy with simulated reads](#mapeval)
- [Evaluating read overlap sensitivity](#oveval)
- [Calling Variants from Assemblies](#asmvar)
* [sim-eval.js](sim-eval.js): evaluate mapping accuracy for FASTA generated ## <a name="intro"></a>Introduction
with [sim-pbsim.js](sim-pbsim.js) or [sim-mason2.js](sim-mason2.js).
* [sam2paf.js](sam2paf.js): convert SAM to PAF. paftools.js is a script that processes alignments in the [PAF format][paf],
such as converting between formats, evaluating mapping accuracy, lifting over
BED files based on alignment, and calling variants from assembly-to-assembly
alignment. This script *requires* the [k8 Javascript shell][k8] to run. On
Linux or Mac, you can download the precompiled k8 binary with:
```sh
curl -L https://github.com/attractivechaos/k8/releases/download/v0.2.4/k8-0.2.4.tar.bz2 | tar -jxf -
cp k8-0.2.4/k8-`uname -s` $HOME/bin/k8 # assuming $HOME/bin in your $PATH
```
It is highly recommended to copy the executable `k8` to a directory on your
`$PATH` such as `/usr/bin/env` can find it. Like python scripts, once you
install `k8`, you can launch paftools.js in one of the two ways:
```sh
path/to/paftools.js # only if k8 is on your $PATH
k8 path/to/paftools.js
```
In a nutshell, paftools.js has the following commands:
```
Usage: paftools.js <command> [arguments]
Commands:
view convert PAF to BLAST-like (for eyeballing) or MAF
splice2bed convert spliced alignment in PAF/SAM to BED12
sam2paf convert SAM to PAF
delta2paf convert MUMmer's delta to PAF
gff2bed convert GTF/GFF3 to BED12
stat collect basic mapping information in PAF/SAM
liftover simplistic liftOver
call call variants from asm-to-ref alignment with the cs tag
bedcov compute the number of bases covered
mapeval evaluate mapping accuracy using mason2/PBSIM-simulated FASTQ
mason2fq convert mason2-simulated SAM to FASTQ
pbsim2fq convert PBSIM-simulated MAF to FASTQ
junceval evaluate splice junction consistency with known annotations
ov-eval evaluate read overlap sensitivity using read-to-ref mapping
```
paftools.js seamlessly reads both plain text files and gzip'd text files.
## <a name="eval"></a>Evaluation
### <a name="mapeval"></a>Evaluating mapping accuracy with simulated reads
The **pbsim2fq** command of paftools.js converts the MAF output of [pbsim][pbsim]
to FASTQ and encodes the true mapping position in the read name in a format like
`S1_33!chr1!225258409!225267761!-`. Similarly, the **mason2fq** command
converts [mason2][mason2] simulated SAM to FASTQ.
Command **mapeval** evaluates mapped SAM/PAF. Here is example output:
```
Q 60 32478 0 0.000000000 32478
Q 22 16 1 0.000030775 32494
Q 21 43 1 0.000061468 32537
Q 19 73 1 0.000091996 32610
Q 14 66 1 0.000122414 32676
Q 10 27 3 0.000214048 32703
Q 8 14 1 0.000244521 32717
Q 7 13 2 0.000305530 32730
Q 6 46 1 0.000335611 32776
Q 3 10 1 0.000366010 32786
Q 2 20 2 0.000426751 32806
Q 1 248 94 0.003267381 33054
Q 0 31 17 0.003778147 33085
U 3
```
where each Q-line gives the quality threshold, the number of reads mapped with
mapping quality equal to or greater than the threshold, number of wrong
mappings, accumulative mapping error rate and the accumulative number of
mapped reads. The U-line, if present, gives the number of unmapped reads if
they are present in the SAM file.
Suppose the reported mapping coordinate overlap with the true coordinate like
the following:
```
truth: --------------------
mapper: ----------------------
|<- l1 ->|<-- o -->|<-- l2 -->|
```
Let `r=o/(l1+o+l2)`. The reported mapping is considered correct if `r>0.1` by
default.
### <a name="oveval"></a>Evaluating read overlap sensitivity
Command **ov-eval** takes *sorted* read-to-reference alignment and read
overlaps in PAF as input, and evaluates the sensitivity. For example:
```sh
minimap2 -cx map-pb ref.fa reads.fq.gz | sort -k6,6 -k8,8n > reads-to-ref.paf
minimap2 -x ava-pb reads.fq.gz reads.fq.gz > ovlp.paf
k8 ov-eval.js reads-to-ref.paf ovlp.paf
```
## <a name="asmvar"></a>Calling Variants from Haploid Assemblies
The **call** command of paftools.js calls variants from coordinate-sorted
assembly-to-reference alignment. It calls variants from the [cs tag][cs] and
identifies confident/callable regions as those covered by exactly one contig.
Here are example command lines:
```sh
minimap2 -cx asm5 -t8 --cs ref.fa asm.fa > asm.paf # keeping this file is recommended; --cs required!
sort -k6,6 -k8,8n asm.paf > asm.srt.paf # sort by reference start coordinate
k8 paftools.js call asm.srt.paf > asm.var.txt
```
Here is sample output:
```
V chr1 2276040 2276041 1 60 c g LJII01000171.1 1217409 1217410 +
V chr1 2280409 2280410 1 60 a g LJII01000171.1 1221778 1221779 +
V chr1 2280504 2280505 1 60 a g LJII01000171.1 1221873 1221874 +
R chr1 2325140 2436340
V chr1 2325287 2325287 1 60 - ct LJII01000171.1 1272894 1272896 +
V chr1 2325642 2325644 1 60 tt - LJII01000171.1 1273251 1273251 +
V chr1 2326051 2326052 1 60 c t LJII01000171.1 1273658 1273659 +
V chr1 2326287 2326288 1 60 c t LJII01000171.1 1273894 1273895 +
```
where a line starting with `R` gives regions covered by one query contig, and a
V-line encodes a variant in the following format: chr, start, end, query depth,
mapping quality, REF allele, ALT allele, query name, query start, end and the
query orientation. Generally, you should only look at variants where column 5
is one.
By default, when calling variants, "paftools.js call" ignores alignments 50kb
or shorter; when deriving callable regions, it ignores alignments 10kb or
shorter. It uses two thresholds to avoid edge effects. These defaults are
designed for long-read assemblies. For short reads, both should be reduced.
[paf]: https://github.com/lh3/miniasm/blob/master/PAF.md
[cs]: https://github.com/lh3/minimap2#cs
[k8]: https://github.com/attractivechaos/k8 [k8]: https://github.com/attractivechaos/k8
[k8bin]: https://github.com/attractivechaos/k8/releases
[maf]: https://genome.ucsc.edu/FAQ/FAQformat#format5 [maf]: https://genome.ucsc.edu/FAQ/FAQformat#format5
[pbsim]: https://github.com/pfaucon/PBSIM-PacBio-Simulator [pbsim]: https://github.com/pfaucon/PBSIM-PacBio-Simulator
[mason2]: https://github.com/seqan/seqan/tree/master/apps/mason2
-258
View File
@@ -1,258 +0,0 @@
/*******************************
* Command line option parsing *
*******************************/
var getopt = function(args, ostr) {
var oli; // option letter list index
if (typeof(getopt.place) == 'undefined')
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
if (getopt.place == -1) { // update scanning pointer
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
getopt.place = -1;
return null;
}
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
++getopt.ind;
getopt.place = -1;
return null;
}
}
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
if (getopt.place < 0) ++getopt.ind;
return '?';
}
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
getopt.arg = null;
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
} else { // need an argument
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
getopt.arg = args[getopt.ind].substr(getopt.place);
else if (args.length <= ++getopt.ind) { // no arg
getopt.place = -1;
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
return '?';
} else getopt.arg = args[getopt.ind]; // white space
getopt.place = -1;
++getopt.ind;
}
return optopt;
}
/***********************
* Interval operations *
***********************/
Interval = {};
Interval.sort = function(a)
{
if (typeof a[0] == 'number')
a.sort(function(x, y) { return x - y });
else a.sort(function(x, y) { return x[0] != y[0]? x[0] - y[0] : x[1] - y[1] });
}
Interval.merge = function(a, sorted)
{
if (typeof sorted == 'undefined') sorted = true;
if (!sorted) Interval.sort(a);
var k = 0;
for (var i = 1; i < a.length; ++i) {
if (a[k][1] >= a[i][0])
a[k][1] = a[k][1] > a[i][1]? a[k][1] : a[i][1];
else a[++k] = a[i].slice(0);
}
a.length = k + 1;
}
Interval.dedup = function(a, sorted)
{
if (typeof sorted == 'undefined') sorted = true;
if (!sorted) Interval.sort(a);
var k = 0;
for (var i = 1; i < a.length; ++i)
if (a[k][0] != a[i][0] || a[k][1] != a[i][1])
a[++k] = a[i].slice(0);
a.length = k + 1;
}
Interval.index_end = function(a, sorted)
{
if (a.length == 0) return;
if (typeof sorted == 'undefined') sorted = true;
if (!sorted) Interval.sort(a);
a[0].push(0);
var k = 0, k_en = a[0][1];
for (var i = 1; i < a.length; ++i) {
if (k_en <= a[i][0]) {
for (++k; k < i; ++k)
if (a[k][1] > a[i][0])
break;
k_en = a[k][1];
}
a[i].push(k);
}
}
Interval.find_intv = function(a, x)
{
var left = -1, right = a.length;
if (typeof a[0] == 'number') {
while (right - left > 1) {
var mid = left + ((right - left) >> 1);
if (a[mid] > x) right = mid;
else if (a[mid] < x) left = mid;
else return mid;
}
} else {
while (right - left > 1) {
var mid = left + ((right - left) >> 1);
if (a[mid][0] > x) right = mid;
else if (a[mid][0] < x) left = mid;
else return mid;
}
}
return left;
}
Interval.find_ovlp = function(a, st, en)
{
if (a.length == 0 || st >= en) return [];
var l = Interval.find_intv(a, st);
var k = l < 0? 0 : a[l][a[l].length - 1];
var b = [];
for (var i = k; i < a.length; ++i) {
if (a[i][0] >= en) break;
else if (st < a[i][1])
b.push(a[i]);
}
return b;
}
/*****************
* Main function *
*****************/
function read_bed(fn, to_merge, to_dedup)
{
var file = new File(fn);
var buf = new Bytes();
var h = {};
while (file.readline(buf) >= 0) {
var t = buf.toString().split("\t");
if (h[t[0]] == null)
h[t[0]] = [];
var bst = parseInt(t[1]);
var ben = parseInt(t[2]);
if (t.length >= 12 && /^\d+$/.test(t[9])) {
t[9] = parseInt(t[9]);
var sz = t[10].split(",");
var st = t[11].split(",");
for (var i = 0; i < t[9]; ++i) {
st[i] = parseInt(st[i]);
sz[i] = parseInt(sz[i]);
h[t[0]].push([bst + st[i], bst + st[i] + sz[i], 0, 0, 0]);
}
} else {
h[t[0]].push([bst, ben, 0, 0, 0]);
}
}
buf.destroy();
file.close();
for (var chr in h) {
if (to_merge) Interval.merge(h[chr], false);
else if (to_dedup) Interval.dedup(h[chr], false);
else Interval.sort(h[chr]);
Interval.index_end(h[chr]);
}
return h;
}
function main(args)
{
var c, print_len = false, to_merge = true, to_dedup = false, fn_excl = null;
while ((c = getopt(args, "pde:")) != null) {
if (c == 'p') print_len = true;
else if (c == 'd') to_dedup = true, to_merge = false;
else if (c == 'e') fn_excl = getopt.arg;
}
if (args.length - getopt.ind < 2) {
print("Usage: k8 cnt-feat.js [options] <target.bed> <feature.bed>");
print("Options:");
print(" -e FILE exclude features overlapping regions in BED FILE []");
print(" -p print number of covered bases for each feature");
exit(1);
}
var excl = fn_excl != null? read_bed(fn_excl, true, false) : null;
var target = read_bed(args[getopt.ind], to_merge, to_dedup);
var file, buf = new Bytes();
var tot_len = 0, hit_len = 0;
file = args[getopt.ind+1] != '-'? new File(args[getopt.ind+1]) : new File();
while (file.readline(buf) >= 0) {
var t = buf.toString().split("\t");
var a = [];
var bst = parseInt(t[1]);
var ben = parseInt(t[2]);
if (t.length >= 12 && /^\d+$/.test(t[9])) { // BED12
t[9] = parseInt(t[9]);
var sz = t[10].split(",");
var st = t[11].split(",");
for (var i = 0; i < t[9]; ++i) {
st[i] = parseInt(st[i]);
sz[i] = parseInt(sz[i]);
a.push([bst + st[i], bst + st[i] + sz[i], false]);
}
} else a.push([bst, ben, false]); // 3-column BED
var feat_len = 0;
for (var i = 0; i < a.length; ++i) {
if (excl != null && excl[t[0]] != null) {
var oe = Interval.find_ovlp(excl[t[0]], a[i][0], a[i][1]);
if (oe.length > 0)
continue;
}
a[i][2] = true;
feat_len += a[i][1] - a[i][0];
}
tot_len += feat_len;
if (target[t[0]] == null) continue;
var b = [];
for (var i = 0; i < a.length; ++i) {
if (!a[i][2]) continue;
var o = Interval.find_ovlp(target[t[0]], a[i][0], a[i][1]);
for (var j = 0; j < o.length; ++j) {
var max_st = o[j][0] > a[i][0]? o[j][0] : a[i][0];
var min_en = o[j][1] < a[i][1]? o[j][1] : a[i][1];
b.push([max_st, min_en]);
o[j][2] += min_en - max_st;
++o[j][3];
if (max_st == o[j][0] && min_en == o[j][1])
++o[j][4];
}
}
// find the length covered
var feat_hit_len = 0;
if (b.length > 0) {
b.sort(function(a,b) {return a[0]-b[0]});
var st = b[0][0], en = b[0][1];
for (var i = 1; i < b.length; ++i) {
if (b[i][0] <= en) en = en > b[i][1]? en : b[i][1];
else feat_hit_len += en - st, st = b[i][0], en = b[i][1];
}
feat_hit_len += en - st;
}
hit_len += feat_hit_len;
if (print_len) print('F', t.slice(0, 4).join("\t"), feat_len, feat_hit_len);
}
file.close();
buf.destroy();
warn("# feature bases: " + tot_len);
warn("# feature bases overlapping targets: " + hit_len + ' (' + (100.0 * hit_len / tot_len).toFixed(2) + '%)');
}
main(arguments);
-150
View File
@@ -1,150 +0,0 @@
var getopt = function(args, ostr) {
var oli; // option letter list index
if (typeof(getopt.place) == 'undefined')
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
if (getopt.place == -1) { // update scanning pointer
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
getopt.place = -1;
return null;
}
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
++getopt.ind;
getopt.place = -1;
return null;
}
}
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
if (getopt.place < 0) ++getopt.ind;
return '?';
}
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
getopt.arg = null;
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
} else { // need an argument
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
getopt.arg = args[getopt.ind].substr(getopt.place);
else if (args.length <= ++getopt.ind) { // no arg
getopt.place = -1;
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
return '?';
} else getopt.arg = args[getopt.ind]; // white space
getopt.place = -1;
++getopt.ind;
}
return optopt;
}
var c, fn_ucsc_fai = null, is_short = false;
while ((c = getopt(arguments, "u:s")) != null) {
if (c == 'u') fn_ucsc_fai = getopt.arg;
else if (c == 's') is_short = true;
}
if (getopt.ind == arguments.length) {
print("Usage: k8 gff2bed.js [-u ucsc-genome.fa.fai] <in.gff>");
exit(1);
}
var ens2ucsc = {};
if (fn_ucsc_fai != null) {
var buf = new Bytes();
var file = new File(fn_ucsc_fai);
while (file.readline(buf) >= 0) {
var t = buf.toString().split("\t");
var s = t[0];
if (/_(random|alt|decoy)$/.test(s)) {
s = s.replace(/_(random|alt|decoy)$/, '');
s = s.replace(/^chr\S+_/, '');
} else {
s = s.replace(/^chrUn_/, '');
}
s = s.replace(/v(\d+)/, ".$1");
if (s != t[0]) ens2ucsc[s] = t[0];
}
file.close();
buf.destroy();
}
var colors = {
'protein_coding':'0,128,255',
'lincRNA':'0,192,0',
'snRNA':'0,192,0',
'miRNA':'0,192,0',
'misc_RNA':'0,192,0'
};
function print_bed12(exons, cds_st, cds_en, is_short)
{
if (exons.length == 0) return;
var name = is_short? exons[0][7] + "|" + exons[0][5] : exons[0].slice(4, 7).join("|");
var a = exons.sort(function(a,b) {return a[1]-b[1]});
var sizes = [], starts = [], st, en;
st = a[0][1];
en = a[a.length - 1][2];
if (cds_st == 1<<30) cds_st = st;
if (cds_en == 0) cds_en = en;
if (cds_st < st || cds_en > en)
throw Error("inconsistent thick start or end for transcript " + a[0][4]);
for (var i = 0; i < a.length; ++i) {
sizes.push(a[i][2] - a[i][1]);
starts.push(a[i][1] - st);
}
var color = colors[a[0][5]];
if (color == null) color = '196,196,196';
print(a[0][0], st, en, name, 1000, a[0][3], cds_st, cds_en, color, a.length, sizes.join(",") + ",", starts.join(",") + ",");
}
var re_gtf = /(transcript_id|transcript_type|transcript_biotype|gene_name|transcript_name) "([^"]+)";/g;
var re_gff3 = /(transcript_id|transcript_type|transcript_biotype|gene_name|transcript_name)=([^;]+)/g;
var buf = new Bytes();
var file = new File(arguments[getopt.ind]);
var exons = [], cds_st = 1<<30, cds_en = 0, last_id = null;
while (file.readline(buf) >= 0) {
var t = buf.toString().split("\t");
if (t[0].charAt(0) == '#') continue;
if (t[2] != "CDS" && t[2] != "exon") continue;
t[3] = parseInt(t[3]) - 1;
t[4] = parseInt(t[4]);
var id = null, type = "", gname = "N/A", biotype = "", m, tname = "N/A";
while ((m = re_gtf.exec(t[8])) != null) {
if (m[1] == "transcript_id") id = m[2];
else if (m[1] == "transcript_type") type = m[2];
else if (m[1] == "transcript_biotype") biotype = m[2];
else if (m[1] == "gene_name") name = m[2];
else if (m[1] == "transcript_name") tname = m[2];
}
while ((m = re_gff3.exec(t[8])) != null) {
if (m[1] == "transcript_id") id = m[2];
else if (m[1] == "transcript_type") type = m[2];
else if (m[1] == "transcript_biotype") biotype = m[2];
else if (m[1] == "gene_name") name = m[2];
else if (m[1] == "transcript_name") tname = m[2];
}
if (type == "" && biotype != "") type = biotype;
if (id == null) throw Error("No transcript_id");
if (id != last_id) {
print_bed12(exons, cds_st, cds_en, is_short);
exons = [], cds_st = 1<<30, cds_en = 0;
last_id = id;
}
if (t[2] == "CDS") {
cds_st = cds_st < t[3]? cds_st : t[3];
cds_en = cds_en > t[4]? cds_en : t[4];
} else if (t[2] == "exon") {
if (fn_ucsc_fai != null) {
if (ens2ucsc[t[0]] != null)
t[0] = ens2ucsc[t[0]];
else if (/^[A-Z]+\d+\.\d+$/.test(t[0]))
t[0] = t[0].replace(/([A-Z]+\d+)\.(\d+)/, "chrUn_$1v$2");
}
exons.push([t[0], t[3], t[4], t[6], id, type, name, tname]);
}
}
if (last_id != null)
print_bed12(exons, cds_st, cds_en, is_short);
file.close();
buf.destroy();
-267
View File
@@ -1,267 +0,0 @@
/*******************************
* Command line option parsing *
*******************************/
var getopt = function(args, ostr) {
var oli; // option letter list index
if (typeof(getopt.place) == 'undefined')
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
if (getopt.place == -1) { // update scanning pointer
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
getopt.place = -1;
return null;
}
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
++getopt.ind;
getopt.place = -1;
return null;
}
}
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
if (getopt.place < 0) ++getopt.ind;
return '?';
}
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
getopt.arg = null;
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
} else { // need an argument
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
getopt.arg = args[getopt.ind].substr(getopt.place);
else if (args.length <= ++getopt.ind) { // no arg
getopt.place = -1;
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
return '?';
} else getopt.arg = args[getopt.ind]; // white space
getopt.place = -1;
++getopt.ind;
}
return optopt;
}
/***********************
* Interval operations *
***********************/
Interval = {};
Interval.sort = function(a)
{
if (typeof a[0] == 'number')
a.sort(function(x, y) { return x - y });
else a.sort(function(x, y) { return x[0] != y[0]? x[0] - y[0] : x[1] - y[1] });
}
Interval.merge = function(a, sorted)
{
if (typeof sorted == 'undefined') sorted = true;
if (!sorted) Interval.sort(a);
var k = 0;
for (var i = 1; i < a.length; ++i) {
if (a[k][1] >= a[i][0])
a[k][1] = a[k][1] > a[i][1]? a[k][1] : a[i][1];
else a[++k] = a[i].slice(0);
}
a.length = k + 1;
}
Interval.index_end = function(a, sorted)
{
if (a.length == 0) return;
if (typeof sorted == 'undefined') sorted = true;
if (!sorted) Interval.sort(a);
a[0].push(0);
var k = 0, k_en = a[0][1];
for (var i = 1; i < a.length; ++i) {
if (k_en <= a[i][0]) {
for (++k; k < i; ++k)
if (a[k][1] > a[i][0])
break;
k_en = a[k][1];
}
a[i].push(k);
}
}
Interval.find_intv = function(a, x)
{
var left = -1, right = a.length;
if (typeof a[0] == 'number') {
while (right - left > 1) {
var mid = left + ((right - left) >> 1);
if (a[mid] > x) right = mid;
else if (a[mid] < x) left = mid;
else return mid;
}
} else {
while (right - left > 1) {
var mid = left + ((right - left) >> 1);
if (a[mid][0] > x) right = mid;
else if (a[mid][0] < x) left = mid;
else return mid;
}
}
return left;
}
Interval.find_ovlp = function(a, st, en)
{
if (a.length == 0 || st >= en) return [];
var l = Interval.find_intv(a, st);
var k = l < 0? 0 : a[l][a[l].length - 1];
var b = [];
for (var i = k; i < a.length; ++i) {
if (a[i][0] >= en) break;
else if (st < a[i][1])
b.push(a[i]);
}
return b;
}
/*****************
* Main function *
*****************/
var c, l_fuzzy = 0, print_ovlp = false, print_err_only = false, first_only = false;
while ((c = getopt(arguments, "l:ep")) != null) {
if (c == 'l') l_fuzzy = parseInt(getopt.arg);
else if (c == 'e') print_err_only = print_ovlp = true;
else if (c == 'p') print_ovlp = true;
}
if (arguments.length - getopt.ind < 2) {
print("Usage: k8 intron-eval.js [options] <gene.gtf> <aln.sam>");
exit(1);
}
var file, buf = new Bytes();
var tr = {};
file = new File(arguments[getopt.ind]);
while (file.readline(buf) >= 0) {
var m, t = buf.toString().split("\t");
if (t[0].charAt(0) == '#') continue;
if (t[2] != 'exon') continue;
var st = parseInt(t[3]) - 1;
var en = parseInt(t[4]);
if ((m = /transcript_id "(\S+)"/.exec(t[8])) == null) continue;
var tid = m[1];
if (tr[tid] == null) tr[tid] = [t[0], t[6], 0, 0, []];
tr[tid][4].push([st, en]);
}
file.close();
var anno = {};
for (var tid in tr) {
var t = tr[tid];
Interval.sort(t[4]);
t[2] = t[4][0][0];
t[3] = t[4][t[4].length - 1][1];
if (anno[t[0]] == null) anno[t[0]] = [];
var s = t[4];
for (var i = 0; i < s.length - 1; ++i) {
if (s[i][1] >= s[i+1][0])
warn("WARNING: incorrect annotation for transcript "+tid+" ("+s[i][1]+" >= "+s[i+1][0]+")")
anno[t[0]].push([s[i][1], s[i+1][0]]);
}
}
tr = null;
for (var chr in anno) {
var e = anno[chr];
if (e.length == 0) continue;
Interval.sort(e);
var k = 0;
for (var i = 1; i < e.length; ++i) // dedup
if (e[i][0] != e[k][0] || e[i][1] != e[k][1])
e[++k] = e[i].slice(0);
e.length = k + 1;
Interval.index_end(e);
}
var n_pri = 0, n_unmapped = 0, n_mapped = 0;
var n_sgl = 0, n_splice = 0, n_splice_hit = 0, n_splice_novel = 0;
file = new File(arguments[getopt.ind+1]);
var last_qname = null;
var re_cigar = /(\d+)([MIDNSHX=])/g;
while (file.readline(buf) >= 0) {
var m, t = buf.toString().split("\t");
if (t[0].charAt(0) == '@') continue;
var flag = parseInt(t[1]);
if (flag&0x100) continue;
if (first_only && last_qname == t[0]) continue;
if (t[2] == '*') {
++n_unmapped;
continue;
} else {
++n_pri;
if (last_qname != t[0]) ++n_mapped;
}
var pos = parseInt(t[3]) - 1, intron = [];
while ((m = re_cigar.exec(t[5])) != null) {
var len = parseInt(m[1]), op = m[2];
if (op == 'N') {
intron.push([pos, pos + len]);
pos += len;
} else if (op == 'M' || op == 'X' || op == '=' || op == 'D') pos += len;
}
if (intron.length == 0) {
++n_sgl;
continue;
}
n_splice += intron.length;
var chr = anno[t[2]];
if (chr != null) {
for (var i = 0; i < intron.length; ++i) {
var o = Interval.find_ovlp(chr, intron[i][0], intron[i][1]);
if (o.length > 0) {
var hit = false;
for (var j = 0; j < o.length; ++j) {
var st_diff = intron[i][0] - o[j][0];
var en_diff = intron[i][1] - o[j][1];
if (st_diff < 0) st_diff = -st_diff;
if (en_diff < 0) en_diff = -en_diff;
if (st_diff <= l_fuzzy && en_diff <= l_fuzzy)
++n_splice_hit, hit = true;
if (hit) break;
}
if (print_ovlp) {
var type = hit? 'C' : 'P';
if (hit && print_err_only) continue;
var x = '[';
for (var j = 0; j < o.length; ++j) {
if (j) x += ', ';
x += '(' + o[j][0] + "," + o[j][1] + ')';
}
x += ']';
print(type, t[0], i+1, t[2], intron[i][0], intron[i][1], x);
}
} else {
++n_splice_novel;
if (print_ovlp)
print('N', t[0], i+1, t[2], intron[i][0], intron[i][1]);
}
}
} else {
n_splice_novel += intron.length;
}
last_qname = t[0];
}
file.close();
buf.destroy();
if (!print_ovlp) {
print("# unmapped reads: " + n_unmapped);
print("# mapped reads: " + n_mapped);
print("# primary alignments: " + n_pri);
print("# singletons: " + n_sgl);
print("# predicted introns: " + n_splice);
print("# non-overlapping introns: " + n_splice_novel);
print("# correct introns: " + n_splice_hit + " (" + (n_splice_hit / n_splice * 100).toFixed(2) + "%)");
}
-183
View File
@@ -1,183 +0,0 @@
var getopt = function(args, ostr) {
var oli; // option letter list index
if (typeof(getopt.place) == 'undefined')
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
if (getopt.place == -1) { // update scanning pointer
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
getopt.place = -1;
return null;
}
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
++getopt.ind;
getopt.place = -1;
return null;
}
}
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
if (getopt.place < 0) ++getopt.ind;
return '?';
}
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
getopt.arg = null;
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
} else { // need an argument
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
getopt.arg = args[getopt.ind].substr(getopt.place);
else if (args.length <= ++getopt.ind) { // no arg
getopt.place = -1;
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
return '?';
} else getopt.arg = args[getopt.ind]; // white space
getopt.place = -1;
++getopt.ind;
}
return optopt;
}
var c, gap_out_len = null;
while ((c = getopt(arguments, "l:")) != null)
if (c == 'l') gap_out_len = parseInt(getopt.arg);
if (getopt.ind == arguments.length) {
print("Usage: k8 mapstat.js [-l gapOutLen] <in.sam>|<in.paf>");
exit(1);
}
var buf = new Bytes();
var file = new File(arguments[getopt.ind]);
var re = /(\d+)([MIDSHNX=])/g;
var lineno = 0, n_pri = 0, n_2nd = 0, n_seq = 0, n_cigar_64k = 0, l_tot = 0, l_cov = 0;
var n_gap = [[0, 0, 0, 0, 0, 0], [0, 0, 0, 0, 0, 0]];
function cov_len(regs)
{
regs.sort(function(a,b) {return a[0]-b[0]});
var st = regs[0][0], en = regs[0][1], l = 0;
for (var i = 1; i < regs.length; ++i) {
if (regs[i][0] < en)
en = en > regs[i][1]? en : regs[i][1];
else l += en - st, st = regs[i][0], en = regs[i][1];
}
l += en - st;
return l;
}
var last = null, last_qlen = null, regs = [];
while (file.readline(buf) >= 0) {
var line = buf.toString();
++lineno;
if (line.charAt(0) != '@') {
var t = line.split("\t", 12);
var m, rs, cigar = null, is_pri = false, is_sam = false, is_rev = false, tname = null;
var atlen = null, aqlen, qs, qe, mapq, ori_qlen;
if (t[4] == '+' || t[4] == '-') { // PAF
if (!/\ts2:i:\d+/.test(line)) {
++n_2nd;
continue;
}
if ((m = /\tcg:Z:(\S+)/.exec(line)) != null)
cigar = m[1];
if (cigar == null) {
warn("WARNING: no CIGAR at line " + lineno);
continue;
}
tname = t[5];
qs = parseInt(t[2]), qe = parseInt(t[3]);
aqlen = qe - qs;
is_rev = t[4] == '+'? false : true;
rs = parseInt(t[7]);
atlen = parseInt(t[8]) - rs;
mapq = parseInt(t[11]);
ori_qlen = parseInt(t[1]);
} else { // SAM
var flag = parseInt(t[1]);
if ((flag & 4) || t[2] == '*' || t[5] == '*') continue;
if (flag & 0x100) {
++n_2nd;
continue;
}
cigar = t[5];
tname = t[2];
rs = parseInt(t[3]) - 1;
mapq = parseInt(t[4]);
aqlen = t[9].length;
is_sam = true;
is_rev = !!(flag&0x10);
}
++n_pri;
if (last != t[0]) {
if (last != null) {
l_tot += last_qlen;
l_cov += cov_len(regs);
}
regs = [];
++n_seq, last = t[0];
}
var M = 0, tl = 0, ql = 0, clip = [0, 0], n_cigar = 0, sclip = 0;
while ((m = re.exec(cigar)) != null) {
var l = parseInt(m[1]);
++n_cigar;
if (m[2] == 'M' || m[2] == '=' || m[2] == 'X') {
tl += l, ql += l, M += l;
} else if (m[2] == 'I' || m[2] == 'D') {
var type;
if (l < 50) type = 0;
else if (l < 100) type = 1;
else if (l < 300) type = 2;
else if (l < 400) type = 3;
else if (l < 1000) type = 4;
else type = 5;
if (m[2] == 'I') ql += l, ++n_gap[0][type];
else tl += l, ++n_gap[1][type];
if (gap_out_len != null && l >= gap_out_len)
print(t[0], ql, is_rev? '-' : '+', tname, rs + tl, m[2], l);
} else if (m[2] == 'N') {
tl += l;
} else if (m[2] == 'S') {
clip[M == 0? 0 : 1] = l, sclip += l;
} else if (m[2] == 'H') {
clip[M == 0? 0 : 1] = l;
}
}
if (n_cigar > 65535) ++n_cigar_64k;
if (ql + sclip != aqlen)
warn("WARNING: aligned query length is inconsistent with CIGAR at line " + lineno + " (" + (ql+sclip) + " != " + aqlen + ")");
if (atlen != null && atlen != tl)
warn("WARNING: aligned reference length is inconsistent with CIGAR at line " + lineno);
if (is_sam) {
qs = clip[is_rev? 1 : 0], qe = qs + ql;
ori_qlen = clip[0] + ql + clip[1];
}
regs.push([qs, qe]);
last_qlen = ori_qlen;
}
}
l_tot += last_qlen;
l_cov += cov_len(regs);
file.close();
buf.destroy();
if (gap_out_len == null) {
print("Number of mapped sequences: " + n_seq);
print("Number of primary alignments: " + n_pri);
print("Number of secondary alignments: " + n_2nd);
print("Number of primary alignments with >65535 CIGAR operations: " + n_cigar_64k);
print("Number of bases in mapped sequences: " + l_tot);
print("Number of mapped bases: " + l_cov);
print("Number of insertions in [0,50): " + n_gap[0][0]);
print("Number of insertions in [50,100): " + n_gap[0][1]);
print("Number of insertions in [100,300): " + n_gap[0][2]);
print("Number of insertions in [300,400): " + n_gap[0][3]);
print("Number of insertions in [400,1000): " + n_gap[0][4]);
print("Number of insertions in [1000,inf): " + n_gap[0][5]);
print("Number of deletions in [0,50): " + n_gap[1][0]);
print("Number of deletions in [50,100): " + n_gap[1][1]);
print("Number of deletions in [100,300): " + n_gap[1][2]);
print("Number of deletions in [300,400): " + n_gap[1][3]);
print("Number of deletions in [400,1000): " + n_gap[1][4]);
print("Number of deletions in [1000,inf): " + n_gap[1][5]);
}
-105
View File
@@ -1,105 +0,0 @@
var getopt = function(args, ostr) {
var oli; // option letter list index
if (typeof(getopt.place) == 'undefined')
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
if (getopt.place == -1) { // update scanning pointer
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
getopt.place = -1;
return null;
}
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
++getopt.ind;
getopt.place = -1;
return null;
}
}
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
if (getopt.place < 0) ++getopt.ind;
return '?';
}
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
getopt.arg = null;
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
} else { // need an argument
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
getopt.arg = args[getopt.ind].substr(getopt.place);
else if (args.length <= ++getopt.ind) { // no arg
getopt.place = -1;
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
return '?';
} else getopt.arg = args[getopt.ind]; // white space
getopt.place = -1;
++getopt.ind;
}
return optopt;
}
var c, min_ovlp = 2000, min_frac = 0.95, min_mapq = 10;
while ((c = getopt(arguments, "q:l:f:")) != null) {
if (c == 'q') min_mapq = parseInt(getopt.arg);
else if (c == 'l') min_ovlp = parseInt(getopt.arg);
else if (c == 'f') min_frac = parseFloat(getopt.arg);
}
if (arguments.length - getopt.ind < 2) {
print("Usage: sort -k6,6 -k8,8n to-ref.paf | k8 ov-eval.js [options] - <ovlp.paf>");
print("Options:");
print(" -l INT min overlap length [2000]");
print(" -q INT min mapping quality [10]");
print(" -f FLOAT min fraction of mapped length [0.95]");
exit(1);
}
var buf = new Bytes();
var file = arguments[getopt.ind] == '-'? new File() : new File(arguments[getopt.ind]);
var a = [], h = {};
while (file.readline(buf) >= 0) {
var t = buf.toString().split("\t");
var is_pri = false;
if (parseInt(t[11]) < min_mapq) continue;
for (var i = 12; i < t.length; ++i)
if (t[i] == 'tp:A:P')
is_pri = true;
if (!is_pri) continue;
for (var i = 1; i <= 3; ++i)
t[i] = parseInt(t[i]);
for (var i = 6; i <= 8; ++i)
t[i] = parseInt(t[i]);
if (t[3] - t[2] < min_ovlp || t[8] - t[7] < min_ovlp || (t[3] - t[2]) / t[1] < min_frac)
continue;
var ctg = t[5], st = t[7], en = t[8];
while (a.length > 0) {
if (a[0][0] == ctg && a[0][2] > st)
break;
else a.shift();
}
for (var j = 0; j < a.length; ++j) {
if (a[j][3] == t[0]) continue;
var len = (en > a[j][2]? a[j][2] : en) - st;
if (len >= min_ovlp) {
var key = a[j][3] < t[0]? a[j][3] + "\t" + t[0] : t[0] + "\t" + a[j][3];
h[key] = len;
}
}
a.push([ctg, st, en, t[0]]);
}
file.close();
file = new File(arguments[getopt.ind + 1]);
while (file.readline(buf) >= 0) {
var t = buf.toString().split("\t");
var key = t[0] < t[5]? t[0] + "\t" + t[5] : t[5] + "\t" + t[0];
if (h[key] > 0) h[key] = -h[key];
}
file.close();
buf.destroy();
var n_ovlp = 0, n_missing = 0;
for (var key in h) {
++n_ovlp;
if (h[key] > 0) ++n_missing;
}
print(n_ovlp + " overlaps inferred from the reference mapping");
print(n_missing + " missed by the read overlapper");
print((100 * (1 - n_missing / n_ovlp)).toFixed(2) + "% sensitivity");
-196
View File
@@ -1,196 +0,0 @@
var getopt = function(args, ostr) {
var oli; // option letter list index
if (typeof(getopt.place) == 'undefined')
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
if (getopt.place == -1) { // update scanning pointer
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
getopt.place = -1;
return null;
}
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
++getopt.ind;
getopt.place = -1;
return null;
}
}
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
if (getopt.place < 0) ++getopt.ind;
return '?';
}
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
getopt.arg = null;
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
} else { // need an argument
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
getopt.arg = args[getopt.ind].substr(getopt.place);
else if (args.length <= ++getopt.ind) { // no arg
getopt.place = -1;
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
return '?';
} else getopt.arg = args[getopt.ind]; // white space
getopt.place = -1;
++getopt.ind;
}
return optopt;
}
var c, line_len = 80, fmt = "aln";
while ((c = getopt(arguments, "f:l:")) != null) {
if (c == 'f') {
fmt = getopt.arg;
if (fmt != "aln" && fmt != "lastz-cigar" && fmt != "maf")
throw Error("format must be one of aln, lastz-cigar and maf");
} else if (c == 'l') line_len = parseInt(getopt.arg);
}
if (line_len == 0) line_len = 0x7fffffff;
if (getopt.ind == arguments.length) {
print("Usage: k8 paf2aln.js [options] <in.paf>");
print("Options:");
print(" -f STR output format: aln (BLAST-like), maf or lastz-cigar [aln]");
print(" -l INT line length in BLAST-like output [80]");
exit(1);
}
function padding_str(x, len, right)
{
var s = x.toString();
if (s.length < len) {
if (right) s += Array(len - s.length + 1).join(" ");
else s = Array(len - s.length + 1).join(" ") + s;
}
return s;
}
function update_aln(s_ref, s_qry, s_mid, type, seq, slen)
{
var l = type == '*'? 1 : seq.length;
if (type == '=' || type == ':') {
s_ref.set(seq);
s_qry.set(seq);
s_mid.set(Array(l+1).join("|"));
slen[0] += l, slen[1] += l;
} else if (type == '*') {
s_ref.set(seq.charAt(0));
s_qry.set(seq.charAt(1));
s_mid.set(' ');
slen[0] += 1, slen[1] += 1;
} else if (type == '+') {
s_ref.set(Array(l+1).join("-"));
s_qry.set(seq);
s_mid.set(Array(l+1).join(" "));
slen[1] += l;
} else if (type == '-') {
s_ref.set(seq);
s_qry.set(Array(l+1).join("-"));
s_mid.set(Array(l+1).join(" "));
slen[0] += l;
}
}
function print_aln(rs, qs, strand, slen, elen, s_ref, s_qry, s_mid)
{
print(["Ref+:", padding_str(rs + slen[0] + 1, 10, false), s_ref.toString(), padding_str(rs + elen[0], 10, true)].join(" "));
print(" " + s_mid.toString());
var st, en;
if (strand == '+') st = qs + slen[1] + 1, en = qs + elen[1];
else st = qs - slen[1], en = qs - elen[1] + 1;
print(["Qry" + strand + ":", padding_str(st, 10, false), s_qry.toString(), padding_str(en, 10, true)].join(" "));
}
var s_ref = new Bytes(), s_qry = new Bytes(), s_mid = new Bytes(); // these are used to show padded alignment
var re_cs = /([:=\-\+\*])(\d+|[A-Za-z]+)/g;
var re_cg = /(\d+)([MIDNSH])/g;
var buf = new Bytes();
var file = arguments[getopt.ind] == "-"? new File() : new File(arguments[getopt.ind]);
var lineno = 0;
if (fmt == "maf") print("##maf version=1\n");
while (file.readline(buf) >= 0) {
var m, line = buf.toString();
var t = line.split("\t", 12);
++lineno;
s_ref.length = s_qry.length = s_mid.length = 0;
var slen = [0, 0], elen = [0, 0];
if (fmt == "lastz-cigar") { // LASTZ-cigar output
var cg = (m = /\tcg:Z:(\S+)/.exec(line)) != null? m[1] : null;
if (cg == null) {
warn("WARNING: converting to LASTZ-cigar format requires the 'cg' tag, which is absent on line " + lineno);
continue;
}
var score = (m = /\tAS:i:(\d+)/.exec(line)) != null? m[1] : 0;
var out = ['cigar:', t[0], t[2], t[3], t[4], t[5], t[7], t[8], '+', score];
while ((m = re_cg.exec(cg)) != null)
out.push(m[2], m[1]);
print(out.join(" "));
} else if (fmt == "maf") { // MAF output
var cs = (m = /\tcs:Z:(\S+)/.exec(line)) != null? m[1] : null;
if (cs == null) {
warn("WARNING: converting to MAF requires the 'cs' tag, which is absent on line " + lineno);
continue;
}
while ((m = re_cs.exec(cs)) != null) {
if (m[1] == ':')
throw Error("converting to MAF only works with 'minimap2 --cs=long'");
update_aln(s_ref, s_qry, s_mid, m[1], m[2], elen);
}
var score = (m = /\tAS:i:(\d+)/.exec(line)) != null? parseInt(m[1]) : 0;
var len = t[0].length > t[5].length? t[0].length : t[5].length;
print("a " + score);
print(["s", padding_str(t[5], len, true), padding_str(t[7], 10, false), padding_str(parseInt(t[8]) - parseInt(t[7]), 10, false),
"+", padding_str(t[6], 10, false), s_ref.toString()].join(" "));
var qs, qe, ql = parseInt(t[1]);
if (t[4] == '+') {
qs = parseInt(t[2]);
qe = parseInt(t[3]);
} else {
qs = ql - parseInt(t[3]);
qe = ql - parseInt(t[2]);
}
print(["s", padding_str(t[0], len, true), padding_str(qs, 10, false), padding_str(qe - qs, 10, false),
t[4], padding_str(ql, 10, false), s_qry.toString()].join(" "));
print("");
} else { // BLAST-like output
var cs = (m = /\tcs:Z:(\S+)/.exec(line)) != null? m[1] : null;
if (cs == null) {
warn("WARNING: converting to BLAST-like alignment requires the 'cs' tag, which is absent on line " + lineno);
continue;
}
line = line.replace(/\tc[sg]:Z:\S+/g, ""); // get rid of cs or cg tags
print('>' + line);
var rs = parseInt(t[7]), qs = t[4] == '+'? parseInt(t[2]) : parseInt(t[3]);
var n_blocks = 0;
while ((m = re_cs.exec(cs)) != null) {
if (m[1] == ':') m[2] = Array(parseInt(m[2]) + 1).join("=");
var start = 0, rest = m[1] == '*'? 1 : m[2].length;
while (rest > 0) {
var l_proc;
if (s_ref.length + rest >= line_len) {
l_proc = line_len - s_ref.length;
update_aln(s_ref, s_qry, s_mid, m[1], m[1] == '*'? m[2] : m[2].substr(start, l_proc), elen);
if (n_blocks > 0) print("");
print_aln(rs, qs, t[4], slen, elen, s_ref, s_qry, s_mid);
++n_blocks;
s_ref.length = s_qry.length = s_mid.length = 0;
slen[0] = elen[0], slen[1] = elen[1];
} else {
l_proc = rest;
update_aln(s_ref, s_qry, s_mid, m[1], m[1] == '*'? m[2] : m[2].substr(start, l_proc), elen);
}
rest -= l_proc, start += l_proc;
}
}
if (s_ref.length > 0) {
if (n_blocks > 0) print("");
print_aln(rs, qs, t[4], slen, elen, s_ref, s_qry, s_mid);
++n_blocks;
}
print("//");
}
}
file.close();
buf.destroy();
s_ref.destroy(); s_qry.destroy(); s_mid.destroy();
-188
View File
@@ -1,188 +0,0 @@
var getopt = function(args, ostr) {
var oli; // option letter list index
if (typeof(getopt.place) == 'undefined')
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
if (getopt.place == -1) { // update scanning pointer
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
getopt.place = -1;
return null;
}
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
++getopt.ind;
getopt.place = -1;
return null;
}
}
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
if (getopt.place < 0) ++getopt.ind;
return '?';
}
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
getopt.arg = null;
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
} else { // need an argument
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
getopt.arg = args[getopt.ind].substr(getopt.place);
else if (args.length <= ++getopt.ind) { // no arg
getopt.place = -1;
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
return '?';
} else getopt.arg = args[getopt.ind]; // white space
getopt.place = -1;
++getopt.ind;
}
return optopt;
}
var re_cs = /([:=*+-])(\d+|[A-Za-z]+)/g;
var c, min_cov_len = 10000, min_var_len = 50000, gap_thres = 50, min_mapq = 5;
while ((c = getopt(arguments, "l:L:g:q:")) != null) {
if (c == 'l') min_cov_len = parseInt(getopt.arg);
else if (c == 'L') min_var_len = parseInt(getopt.arg);
else if (c == 'g') gap_thres = parseInt(getopt.arg);
else if (c == 'q') min_mapq = parseInt(getopt.arg);
}
if (arguments.length == getopt.ind) {
print("Usage: k8 paf2diff.js [options] <with-cs.paf>");
print("Options:");
print(" -l INT min alignment length to compute coverage ["+min_cov_len+"]");
print(" -L INT min alignment length to call variants ["+min_var_len+"]");
print(" -q INT min mapping quality ["+min_mapq+"]");
print(" -g INT short/long gap threshold (for statistics only) ["+gap_thres+"]");
exit(1);
}
var file = arguments[getopt.ind] == '-'? new File() : new File(arguments[getopt.ind]);
var buf = new Bytes();
var tot_len = 0, n_sub = [0, 0, 0], n_ins = [0, 0, 0, 0], n_del = [0, 0, 0, 0];
function count_var(o)
{
if (o[3] > 1) return;
if (o[5] == '-' && o[6] == '-') return;
if (o[5] == '-') { // insertion
var l = o[6].length;
if (l == 1) ++n_ins[0];
else if (l == 2) ++n_ins[1];
else if (l < gap_thres) ++n_ins[2];
else ++n_ins[3];
} else if (o[6] == '-') { // deletion
var l = o[5].length;
if (l == 1) ++n_del[0];
else if (l == 2) ++n_del[1];
else if (l < gap_thres) ++n_del[2];
else ++n_del[3];
} else {
++n_sub[0];
var s = o[5] + o[6];
if (s == 'ag' || s == 'ga' || s == 'ct' || s == 'tc')
++n_sub[1];
else ++n_sub[2];
}
}
var a = [], out = [];
var c1_ctg = null, c1_start = 0, c1_end = 0, c1_counted = false, c1_len = 0;
while (file.readline(buf) >= 0) {
var line = buf.toString();
if (!/\ts2:i:/.test(line)) continue; // skip secondary alignments
var m, t = line.split("\t", 12);
for (var i = 6; i <= 11; ++i)
t[i] = parseInt(t[i]);
if (t[10] < min_cov_len || t[11] < min_mapq) continue;
var ctg = t[5], x = t[7], end = t[8];
// compute regions covered by 1 contig
if (ctg != c1_ctg || x >= c1_end) {
if (c1_counted && c1_end > c1_start) {
c1_len += c1_end - c1_start;
print('R', c1_ctg, c1_start, c1_end);
}
c1_ctg = ctg, c1_start = x, c1_end = end;
c1_counted = (t[10] >= min_var_len);
} else if (end > c1_end) { // overlap
if (c1_counted && x > c1_start) {
c1_len += x - c1_start;
print('R', c1_ctg, c1_start, x);
}
c1_start = c1_end, c1_end = end;
c1_counted = (t[10] >= min_var_len);
} else { // contained
if (c1_counted && x > c1_start) {
c1_len += x - c1_start;
print('R', c1_ctg, c1_start, x);
}
c1_start = end;
}
// output variants ahead of this alignment
while (out.length) {
if (out[0][0] != ctg || out[0][2] <= x) {
count_var(out[0]);
print('V', out[0].join("\t"));
out.shift();
} else break;
}
// update coverage
for (var i = 0; i < out.length; ++i)
if (out[i][1] >= x && out[i][2] <= end)
++out[i][3];
// drop alignments that don't overlap with the current one
var k = 0;
for (var i = 0; i < a.length; ++i)
if (a[0][0] == ctg && a[0][2] > x)
a[k++] = a[i];
a.length = k;
// core loop
if (t[10] >= min_var_len) {
if ((m = /\tcs:Z:(\S+)/.exec(line)) == null) continue; // no cs tag
var cs = m[1];
var blen = 0, n_diff = 0;
tot_len += t[10];
while ((m = re_cs.exec(cs)) != null) {
var cov = 1;
if (m[1] == '*' || m[1] == '+' || m[1] == '-')
for (var i = 0; i < a.length; ++i)
if (a[0][2] > x) ++cov;
if (m[1] == '=' || m[1] == ':') {
var l = m[1] == '='? m[2].length : parseInt(m[2]);
x += l, blen += l;
} else if (m[1] == '*') {
out.push([t[5], x, x+1, cov, t[11], m[2].charAt(0), m[2].charAt(1)]);
++x, ++blen, ++n_diff;
} else if (m[1] == '+') {
out.push([t[5], x, x, cov, t[11], '-', m[2]]);
++blen, ++n_diff;
} else if (m[1] == '-') {
out.push([t[5], x, x + m[2].length, cov, t[11], m[2], '-']);
x += m[2].length, ++blen, ++n_diff;
}
}
}
a.push([t[5], t[7], t[8]]);
}
if (c1_counted && c1_end > c1_start) {
c1_len += c1_end - c1_start;
print('R', c1_ctg, c1_start, c1_end);
}
while (out.length) {
count_var(out[0]);
print('V', out[0].join("\t"));
out.shift();
}
//warn(tot_len + " alignment columns considered in calling");
warn(c1_len + " reference bases covered by exactly one contig");
warn(n_sub[0] + " substitutions; ts/tv = " + (n_sub[1]/n_sub[2]).toFixed(3));
warn(n_del[0] + " 1bp deletions");
warn(n_ins[0] + " 1bp insertions");
warn(n_del[1] + " 2bp deletions");
warn(n_ins[1] + " 2bp insertions");
warn(n_del[2] + " [3,"+gap_thres+") deletions");
warn(n_ins[2] + " [3,"+gap_thres+") insertions");
warn(n_del[3] + " >="+gap_thres+" deletions");
warn(n_ins[3] + " >="+gap_thres+" insertions");
buf.destroy();
file.close();
+2381
View File
File diff suppressed because it is too large Load Diff
-114
View File
@@ -1,114 +0,0 @@
var getopt = function(args, ostr) {
var oli; // option letter list index
if (typeof(getopt.place) == 'undefined')
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
if (getopt.place == -1) { // update scanning pointer
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
getopt.place = -1;
return null;
}
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
++getopt.ind;
getopt.place = -1;
return null;
}
}
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
if (getopt.place < 0) ++getopt.ind;
return '?';
}
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
getopt.arg = null;
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
} else { // need an argument
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
getopt.arg = args[getopt.ind].substr(getopt.place);
else if (args.length <= ++getopt.ind) { // no arg
getopt.place = -1;
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
return '?';
} else getopt.arg = args[getopt.ind]; // white space
getopt.place = -1;
++getopt.ind;
}
return optopt;
}
var c, pri_only = false;
while ((c = getopt(arguments, "p")) != null)
if (c == 'p') pri_only = true;
var file = arguments.length == getopt.ind? new File() : new File(arguments[getopt.ind]);
var buf = new Bytes();
var re = /(\d+)([MIDSHNX=])/g;
var len = {}, lineno = 0;
while (file.readline(buf) >= 0) {
var m, n_cigar = 0, line = buf.toString();
++lineno;
if (line.charAt(0) == '@') {
if (/^@SQ/.test(line)) {
var name = (m = /\tSN:(\S+)/.exec(line)) != null? m[1] : null;
var l = (m = /\tLN:(\d+)/.exec(line)) != null? parseInt(m[1]) : null;
if (name != null && l != null) len[name] = l;
}
continue;
}
var t = line.split("\t");
var flag = parseInt(t[1]);
if (t[9] != '*' && t[10] != '*' && t[9].length != t[10].length) throw Error("ERROR at line " + lineno + ": inconsistent SEQ and QUAL lengths - " + t[9].length + " != " + t[10].length);
if (t[2] == '*' || (flag&4)) continue;
if (pri_only && (flag&0x100)) continue;
var tlen = len[t[2]];
if (tlen == null) throw Error("ERROR at line " + lineno + ": can't find the length of contig " + t[2]);
var nn = (m = /\tnn:i:(\d+)/.exec(line)) != null? parseInt(m[1]) : 0;
var NM = (m = /\tNM:i:(\d+)/.exec(line)) != null? parseInt(m[1]) : null;
var have_NM = NM == null? false : true;
NM += nn;
var clip = [0, 0], I = [0, 0], D = [0, 0], M = 0, N = 0, ql = 0, tl = 0, mm = 0, ext_cigar = false;
while ((m = re.exec(t[5])) != null) {
var l = parseInt(m[1]);
if (m[2] == 'M') M += l, ql += l, tl += l, ext_cigar = false;
else if (m[2] == 'I') ++I[0], I[1] += l, ql += l;
else if (m[2] == 'D') ++D[0], D[1] += l, tl += l;
else if (m[2] == 'N') N += l, tl += l;
else if (m[2] == 'S') clip[M == 0? 0 : 1] = l, ql += l;
else if (m[2] == 'H') clip[M == 0? 0 : 1] = l;
else if (m[2] == '=') M += l, ql += l, tl += l, ext_cigar = true;
else if (m[2] == 'X') M += l, ql += l, tl += l, mm += l, ext_cigar = true;
++n_cigar;
}
if (n_cigar > 65535)
warn("WARNING at line " + lineno + ": " + n_cigar + " CIGAR operations");
if (tl + parseInt(t[3]) - 1 > tlen) {
warn("WARNING at line " + lineno + ": alignment end position larger than ref length; skipped");
continue;
}
if (t[9] != '*' && t[9].length != ql) {
warn("WARNING at line " + lineno + ": SEQ length inconsistent with CIGAR (" + t[9].length + " != " + ql + "); skipped");
continue;
}
if (!have_NM || ext_cigar) NM = I[1] + D[1] + mm;
if (NM < I[1] + D[1] + mm) {
warn("WARNING at line " + lineno + ": NM is less than the total number of gaps (" + NM + " < " + (I[1]+D[1]+mm) + ")");
NM = I[1] + D[1] + mm;
}
var extra = ["mm:i:"+(NM-I[1]-D[1]), "io:i:"+I[0], "in:i:"+I[1], "do:i:"+D[0], "dn:i:"+D[1]];
var match = M - (NM - I[1] - D[1]);
var blen = M + I[1] + D[1];
var qlen = M + I[1] + clip[0] + clip[1];
var qs, qe;
if (flag&16) qs = clip[1], qe = qlen - clip[0];
else qs = clip[0], qe = qlen - clip[1];
var ts = parseInt(t[3]) - 1, te = ts + M + D[1] + N;
var qname = t[0];
if ((flag&1) && (flag&0x40)) qname += '/1';
if ((flag&1) && (flag&0x80)) qname += '/2';
var a = [qname, qlen, qs, qe, flag&16? '-' : '+', t[2], tlen, ts, te, match, blen, t[4]];
print(a.join("\t"), extra.join("\t"));
}
buf.destroy();
file.close();
-193
View File
@@ -1,193 +0,0 @@
var getopt = function(args, ostr) {
var oli; // option letter list index
if (typeof(getopt.place) == 'undefined')
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
if (getopt.place == -1) { // update scanning pointer
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
getopt.place = -1;
return null;
}
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
++getopt.ind;
getopt.place = -1;
return null;
}
}
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
if (getopt.place < 0) ++getopt.ind;
return '?';
}
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
getopt.arg = null;
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
} else { // need an argument
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
getopt.arg = args[getopt.ind].substr(getopt.place);
else if (args.length <= ++getopt.ind) { // no arg
getopt.place = -1;
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
return '?';
} else getopt.arg = args[getopt.ind]; // white space
getopt.place = -1;
++getopt.ind;
}
return optopt;
}
var c, max_mapq = 60, mode = 0, err_out_q = 256, print_err = false, ovlp_ratio = 0.1, cap_short_mapq = false;
while ((c = getopt(arguments, "Q:r:m:c")) != null) {
if (c == 'Q') err_out_q = parseInt(getopt.arg), print_err = true;
else if (c == 'r') ovlp_ratio = parseFloat(getopt.arg);
else if (c == 'm') mode = parseInt(getopt.arg);
else if (c == 'c') cap_short_mapq = true;
}
var file = arguments.length == getopt.ind? new File() : new File(arguments[getopt.ind]);
var buf = new Bytes();
var tot = [], err = [];
for (var q = 0; q <= max_mapq; ++q)
tot[q] = err[q] = 0;
function is_correct(s, b)
{
if (s[0] != b[0] || s[3] != b[3]) return false;
var o, l;
if (s[1] < b[1]) {
if (s[2] <= b[1]) return false;
o = (s[2] < b[2]? s[2] : b[2]) - b[1];
l = (s[2] > b[2]? s[2] : b[2]) - s[1];
} else {
if (b[2] <= s[1]) return false;
o = (s[2] < b[2]? s[2] : b[2]) - s[1];
l = (s[2] > b[2]? s[2] : b[2]) - b[1];
}
return o/l > ovlp_ratio? true : false;
}
function count_err(qname, a, tot, err, mode)
{
if (a.length == 0) return;
var m, s;
if ((m = /^(\S+)!(\S+)!(\d+)!(\d+)!([\+\-])$/.exec(qname)) != null) { // pbsim single-end reads
s = [m[1], m[2], parseInt(m[3]), parseInt(m[4]), m[5]];
} else if ((m = /^(\S+)!(\S+)!(\d+)_(\d+)!(\d+)_(\d+)!([\+\-])([\+\-])\/([12])$/.exec(qname)) != null) { // mason2 paired-end reads
if (m[9] == '1') {
s = [m[1], m[2], parseInt(m[3]), parseInt(m[5]), m[7]];
} else {
s = [m[1], m[2], parseInt(m[4]), parseInt(m[6]), m[8]];
}
} else throw Error("Failed to parse simulated read names '" + qname + "'");
s.shift(); // skip the orginal read name
if (mode == 0 || mode == 1) { // longest only or first only
var max_i = 0;
if (mode == 0) { // longest only
var max = 0;
for (var i = 0; i < a.length; ++i)
if (a[i][5] > max)
max = a[i][5], max_i = i;
}
var mapq = a[max_i][4];
++tot[mapq];
if (!is_correct(s, a[max_i])) {
if (mapq >= err_out_q)
print('E', qname, a[max_i].join("\t"));
++err[mapq];
}
} else if (mode == 2) { // all primary mode
var max_err_mapq = -1, max_mapq = 0, max_err_i = -1;
if (cap_short_mapq) {
var max = 0, max_q = 0;
for (var i = 0; i < a.length; ++i)
if (a[i][5] > max)
max = a[i][5], max_q = a[i][4];
for (var i = 0; i < a.length; ++i)
a[i][4] = max_q < a[i][4]? max_q : a[i][4];
}
for (var i = 0; i < a.length; ++i) {
max_mapq = max_mapq > a[i][4]? max_mapq : a[i][4];
if (!is_correct(s, a[i]))
if (a[i][4] > max_err_mapq)
max_err_mapq = a[i][4], max_err_i = i;
}
if (max_err_mapq >= 0) {
++tot[max_err_mapq], ++err[max_err_mapq];
if (max_err_mapq >= err_out_q)
print('E', qname, a[max_err_i].join("\t"));
} else ++tot[max_mapq];
}
}
var lineno = 0, last = null, a = [], n_unmapped = null;
var re_cigar = /(\d+)([MIDSHN])/g;
while (file.readline(buf) >= 0) {
var m, line = buf.toString();
++lineno;
if (line[0] != '@') {
var t = line.split("\t");
if (t[4] == '+' || t[4] == '-') { // PAF
if (last != t[0]) {
if (last != null) count_err(last, a, tot, err, mode);
a = [], last = t[0];
}
if (/\ts1:i:\d+/.test(line) && !/\ts2:i:\d+/.test(line)) // secondary alignment in minimap2 PAF
continue;
var mapq = parseInt(t[11]);
if (mapq > max_mapq) mapq = max_mapq;
a.push([t[5], parseInt(t[7]), parseInt(t[8]), t[4], mapq, parseInt(t[9])]);
} else { // SAM
var flag = parseInt(t[1]);
var read_no = flag>>6&0x3;
var qname = t[0];
if (!/\/[12]$/.test(qname))
qname = read_no == 1 || read_no == 2? t[0] + '/' + read_no : t[0];
if (last != qname) {
if (last != null) count_err(last, a, tot, err, mode);
a = [], last = qname;
}
if (flag&0x100) continue; // secondary alignment
if ((flag&0x4) || t[2] == '*') { // unmapped
if (n_unmapped == null) n_unmapped = 0;
++n_unmapped;
continue;
}
var mapq = parseInt(t[4]);
if (mapq > max_mapq) mapq = max_mapq;
var pos = parseInt(t[3]) - 1, pos_end = pos;
var n_gap = 0, mlen = 0;
while ((m = re_cigar.exec(t[5])) != null) {
var len = parseInt(m[1]);
if (m[2] == 'M') pos_end += len, mlen += len;
else if (m[2] == 'I') n_gap += len;
else if (m[2] == 'D') n_gap += len, pos_end += len;
}
var score = pos_end - pos;
if ((m = /\tNM:i:(\d+)/.exec(line)) != null) {
var NM = parseInt(m[1]);
if (NM >= n_gap) score = mlen - (NM - n_gap);
}
a.push([t[2], pos, pos_end, (flag&16)? '-' : '+', mapq, score]);
}
}
}
if (last != null) count_err(last, a, tot, err, mode);
buf.destroy();
file.close();
var sum_tot = 0, sum_err = 0, q_out = -1, sum_tot2 = 0, sum_err2 = 0;
for (var q = max_mapq; q >= 0; --q) {
if (tot[q] == 0) continue;
if (q_out < 0 || err[q] > 0) {
if (q_out >= 0) print('Q', q_out, sum_tot, sum_err, (sum_err2/sum_tot2).toFixed(9), sum_tot2);
sum_tot = sum_err = 0, q_out = q;
}
sum_tot += tot[q], sum_err += err[q];
sum_tot2 += tot[q], sum_err2 += err[q];
}
print('Q', q_out, sum_tot, sum_err, (sum_err2/sum_tot2).toFixed(9), sum_tot2);
if (n_unmapped != null) print('U', n_unmapped);
-105
View File
@@ -1,105 +0,0 @@
Bytes.prototype.reverse = function()
{
for (var i = 0; i < this.length>>1; ++i) {
var tmp = this[i];
this[i] = this[this.length - i - 1];
this[this.length - i - 1] = tmp;
}
}
// reverse complement a DNA string
Bytes.prototype.revcomp = function()
{
if (Bytes.rctab == null) {
var s1 = 'WSATUGCYRKMBDHVNwsatugcyrkmbdhvn';
var s2 = 'WSTAACGRYMKVHDBNwstaacgrymkvhdbn';
Bytes.rctab = [];
for (var i = 0; i < 256; ++i) Bytes.rctab[i] = 0;
for (var i = 0; i < s1.length; ++i)
Bytes.rctab[s1.charCodeAt(i)] = s2.charCodeAt(i);
}
for (var i = 0; i < this.length>>1; ++i) {
var tmp = this[this.length - i - 1];
this[this.length - i - 1] = Bytes.rctab[this[i]];
this[i] = Bytes.rctab[tmp];
}
if (this.length&1)
this[this.length>>1] = Bytes.rctab[this[this.length>>1]];
}
if (arguments.length == 0) {
print("Usage: k8 sim-mason2.js <mason.sam>");
exit(1);
}
function print_se(a)
{
print('@' + a.slice(0, 5).join("!") + " " + a[8]);
print(a[5]);
print("+");
print(a[6]);
}
var buf = new Bytes(), buf2 = new Bytes();
var file = new File(arguments[0]);
var re = /(\d+)([MIDSHN])/g;
var last = null;
while (file.readline(buf) >= 0) {
var t = buf.toString().split("\t");
if (t[0].charAt(0) == '@') continue;
var m, l_ref = 0;
while ((m = re.exec(t[5])) != null)
if (m[2] == 'D' || m[2] == 'M' || m[2] == 'N')
l_ref += parseInt(m[1]);
var flag = parseInt(t[1]);
var rev = !!(flag&16);
var seq, qual;
if (rev) {
buf2.length = 0;
buf2.set(t[9], 0);
buf2.revcomp();
seq = buf2.toString();
buf2.set(t[10], 0);
buf2.reverse();
qual = buf2.toString();
} else seq = t[9], qual = t[10];
var qname = t[0];
qname = qname.replace(/^simulated./, "");
var chr = t[2];
var pos = parseInt(t[3]) - 1;
var strand = (flag&16)? '-' : '+';
var read_no = flag&0xc0;
if (read_no == 0x40) read_no = 1;
else if (read_no == 0x80) read_no = 2;
else read_no = 0;
var err = 0, snp = 0, indel = 0;
for (var i = 11; i < t.length; ++i) {
if ((m = /^XE:i:(\d+)/.exec(t[i])) != null) err = m[1];
else if ((m = /^XS:i:(\d+)/.exec(t[i])) != null) snp = m[1];
else if ((m = /^XI:i:(\d+)/.exec(t[i])) != null) indel = m[1];
}
var comment = [err, snp, indel].join(":");
if (last == null) {
last = [qname, chr, pos, pos + l_ref, strand, seq, qual, read_no, comment];
} else if (last[0] != qname) {
print_se(last);
last = [qname, chr, pos, pos + l_ref, strand, seq, qual, read_no, comment];
} else {
if (read_no == 2) { // last[] is the first read
if (last[7] != 1) throw Error("ERROR: can't find read1");
var name = [qname, chr, last[2] + "_" + pos, last[3] + "_" + (pos + l_ref), last[4] + strand].join("!");
print('@' + name + '/1' + ' ' + last[8]); print(last[5]); print("+"); print(last[6]);
print('@' + name + '/2' + ' ' + comment); print(seq); print("+"); print(qual);
} else {
if (last[7] != 2) throw Error("ERROR: can't find read2");
var name = [qname, chr, pos + "_" + last[2], (pos + l_ref) + "_" + last[3], strand + last[4]].join("!");
print('@' + name + '/1' + ' ' + comment); print(seq); print("+"); print(qual);
print('@' + name + '/2' + ' ' + last[8]); print(last[5]); print("+"); print(last[6]);
}
last = null;
}
}
if (last != null) print_se(last);
file.close();
buf.destroy();
buf2.destroy();
-81
View File
@@ -1,81 +0,0 @@
Bytes.prototype.reverse = function()
{
for (var i = 0; i < this.length>>1; ++i) {
var tmp = this[i];
this[i] = this[this.length - i - 1];
this[this.length - i - 1] = tmp;
}
}
// reverse complement a DNA string
Bytes.prototype.revcomp = function()
{
if (Bytes.rctab == null) {
var s1 = 'WSATUGCYRKMBDHVNwsatugcyrkmbdhvn';
var s2 = 'WSTAACGRYMKVHDBNwstaacgrymkvhdbn';
Bytes.rctab = [];
for (var i = 0; i < 256; ++i) Bytes.rctab[i] = 0;
for (var i = 0; i < s1.length; ++i)
Bytes.rctab[s1.charCodeAt(i)] = s2.charCodeAt(i);
}
for (var i = 0; i < this.length>>1; ++i) {
var tmp = this[this.length - i - 1];
this[this.length - i - 1] = Bytes.rctab[this[i]];
this[i] = Bytes.rctab[tmp];
}
if (this.length&1)
this[this.length>>1] = Bytes.rctab[this[this.length>>1]];
}
if (arguments.length < 2) {
print("Usage: k8 sim-pbsim.js <ref.fa.fai> <pbsim1.maf> [[pbsim2.maf] ...]");
exit(1);
}
var file, buf = new Bytes(), buf2 = new Bytes();
file = new File(arguments[0]);
var chr_list = [];
while (file.readline(buf) >= 0) {
var t = buf.toString().split(/\s+/);
chr_list.push(t[0]);
}
file.close();
for (var k = 1; k < arguments.length; ++k) {
var fn = arguments[k];
file = new File(fn);
var state = 0, reg;
while (file.readline(buf) >= 0) {
var line = buf.toString();
if (state == 0 && line.charAt(0) == 'a') {
state = 1;
} else if (state == 1 && line.charAt(0) == 's') {
var t = line.split(/\s+/);
var st = parseInt(t[2]);
reg = [st, st + parseInt(t[3])];
state = 2;
} else if (state == 2 && line.charAt(0) == 's') {
var m, t = line.split(/\s+/);
if ((m = /S(\d+)_\d+/.exec(t[1])) == null) throw Error("Failed to parse the read name");
var chr_id = parseInt(m[1]) - 1;
if (chr_id >= chr_list.length) throw Error("Index outside the chr list");
var name = [t[1], chr_list[chr_id], reg[0], reg[1], t[4]].join("!");
var seq = t[6].replace(/\-/g, "");
if (seq.length != parseInt(t[5])) throw Error("Inconsistent read length");
if (seq.indexOf("NN") < 0) {
if (t[4] == '-') {
buf2.set(seq, 0);
buf2.length = seq.length;
buf2.revcomp();
seq = buf2.toString();
}
print(">" + name);
print(seq);
}
state = 0;
}
}
file.close();
}
buf.destroy();
buf2.destroy();
-148
View File
@@ -1,148 +0,0 @@
var getopt = function(args, ostr) {
var oli; // option letter list index
if (typeof(getopt.place) == 'undefined')
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
if (getopt.place == -1) { // update scanning pointer
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
getopt.place = -1;
return null;
}
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
++getopt.ind;
getopt.place = -1;
return null;
}
}
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
if (getopt.place < 0) ++getopt.ind;
return '?';
}
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
getopt.arg = null;
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
} else { // need an argument
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
getopt.arg = args[getopt.ind].substr(getopt.place);
else if (args.length <= ++getopt.ind) { // no arg
getopt.place = -1;
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
return '?';
} else getopt.arg = args[getopt.ind]; // white space
getopt.place = -1;
++getopt.ind;
}
return optopt;
}
var colors = ["0,128,255", "255,0,0", "0,192,0"];
function print_lines(a, fmt) {
if (a.length == 0) return;
if (fmt == "bed") {
var n_pri = 0;
for (var i = 0; i < a.length; ++i)
if (a[i][8] == 0) ++n_pri;
if (n_pri > 1) {
for (var i = 0; i < a.length; ++i)
if (a[i][8] == 0) a[i][8] = 1;
} else if (n_pri == 0) {
warn("Warning: " + a[0][3] + " doesn't have a primary alignment");
}
for (var i = 0; i < a.length; ++i) {
a[i][8] = colors[a[i][8]];
print(a[i].join("\t"));
}
}
a.length = 0;
}
function main(args) {
var re = /(\d+)([MIDNSH])/g;
var c, fmt = "bed", fn_name_conv = null;
while ((c = getopt(args, "f:n:")) != null) {
if (c == 'f') fmt = getopt.arg;
else if (c == 'n') fn_name_conv = getopt.arg;
}
if (getopt.ind == args.length) {
warn("Usage: k8 splice2bed.js <in.paf>");
exit(1);
}
var conv = null;
if (fn_name_conv != null) {
conv = new Map();
var file = new File(fn_name_conv);
var buf = new Bytes();
while (file.readline(buf) >= 0) {
var t = buf.toString().split("\t");
conv.put(t[0], t[1]);
}
buf.destroy();
file.close();
}
var file = new File(args[getopt.ind]);
var buf = new Bytes();
var a = [];
while (file.readline(buf) >= 0) {
var line = buf.toString();
if (line.charAt(0) == '@') continue; // skip SAM header lines
var t = line.split("\t");
var is_pri = false, cigar = null, a1;
var qname = conv != null? conv.get(t[0]) : null;
if (qname != null) t[0] = qname;
if (t.length >= 10 && t[4] != '+' && t[4] != '-' && /^\d+/.test(t[1])) { // SAM
var flag = parseInt(t[1]);
if (flag&1) t[0] += '/' + (flag>>6&3);
}
if (a.length && a[0][3] != t[0]) {
print_lines(a, fmt);
a = [];
}
if (t.length >= 12 && (t[4] == '+' || t[4] == '-')) { // PAF
for (var i = 12; i < t.length; ++i) {
if (t[i].substr(0, 5) == 'cg:Z:') {
cigar = t[i].substr(5);
} else if (t[i].substr(0, 5) == 's2:i:') {
is_pri = true;
}
}
a1 = [t[5], t[7], t[8], t[0], Math.floor(t[9]/t[10]*1000), t[4]];
} else if (t.length >= 10) { // SAM
var flag = parseInt(t[1]);
if ((flag&4) || a[2] == '*') continue;
cigar = t[5];
is_pri = (flag&0x100)? false : true;
a1 = [t[2], parseInt(t[3])-1, null, t[0], 1000, (flag&16)? '-' : '+'];
} else {
throw Error("unrecognized input format");
}
if (cigar == null) throw Error("missing CIGAR");
var m, x0 = 0, x = 0, bs = [], bl = [];
while ((m = re.exec(cigar)) != null) {
if (m[2] == 'M' || m[2] == 'D') {
x += parseInt(m[1]);
} else if (m[2] == 'N') {
bs.push(x0);
bl.push(x - x0);
x += parseInt(m[1]);
x0 = x;
}
}
bs.push(x0);
bl.push(x - x0);
// write the BED12 line
if (a1[2] == null) a1[2] = a1[1] + x;
a1.push(a1[1], a1[2]); // thick start/end is the same as start/end
a1.push(is_pri? 0 : 2, bs.length, bl.join(",")+",", bs.join(",")+",");
a.push(a1);
}
print_lines(a, fmt);
buf.destroy();
file.close();
if (conv != null) conv.destroy();
}
main(arguments);
+17 -5
View File
@@ -28,6 +28,9 @@
#define mm_seq4_set(s, i, c) ((s)[(i)>>3] |= (uint32_t)(c) << (((i)&7)<<2)) #define mm_seq4_set(s, i, c) ((s)[(i)>>3] |= (uint32_t)(c) << (((i)&7)<<2))
#define mm_seq4_get(s, i) ((s)[(i)>>3] >> (((i)&7)<<2) & 0xf) #define mm_seq4_get(s, i) ((s)[(i)>>3] >> (((i)&7)<<2) & 0xf)
#define MALLOC(type, len) ((type*)malloc((len) * sizeof(type)))
#define CALLOC(type, len) ((type*)calloc((len), sizeof(type)))
#ifdef __cplusplus #ifdef __cplusplus
extern "C" { extern "C" {
#endif #endif
@@ -48,6 +51,7 @@ typedef struct {
double cputime(void); double cputime(void);
double realtime(void); double realtime(void);
long peakrss(void);
void radix_sort_128x(mm128_t *beg, mm128_t *end); void radix_sort_128x(mm128_t *beg, mm128_t *end);
void radix_sort_64(uint64_t *beg, uint64_t *end); void radix_sort_64(uint64_t *beg, uint64_t *end);
@@ -62,7 +66,6 @@ void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
void mm_idxopt_init(mm_idxopt_t *opt); void mm_idxopt_init(mm_idxopt_t *opt);
const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n); const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n);
int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq);
int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f); int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f);
mm128_t *mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int min_cnt, int min_sc, int is_cdna, int n_segs, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km); mm128_t *mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int min_cnt, int min_sc, int is_cdna, int n_segs, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km);
mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a); mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a);
@@ -72,13 +75,13 @@ void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a);
void mm_sync_regs(void *km, int n_regs, mm_reg1_t *regs); void mm_sync_regs(void *km, int n_regs, mm_reg1_t *regs);
int mm_squeeze_a(void *km, int n_regs, mm_reg1_t *regs, mm128_t *a); int mm_squeeze_a(void *km, int n_regs, mm_reg1_t *regs, mm128_t *a);
int mm_set_sam_pri(int n, mm_reg1_t *r); int mm_set_sam_pri(int n, mm_reg1_t *r);
void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r, int sub_diff); void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r, int sub_diff, int hard_mask_level);
void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int *n_, mm_reg1_t *r); void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int *n_, mm_reg1_t *r);
void mm_select_sub_multi(void *km, float pri_ratio, float pri1, float pri2, int max_gap_ref, int min_diff, int best_n, int n_segs, const int *qlens, int *n_, mm_reg1_t *r); void mm_select_sub_multi(void *km, float pri_ratio, float pri1, float pri2, int max_gap_ref, int min_diff, int best_n, int n_segs, const int *qlens, int *n_, mm_reg1_t *r);
void mm_filter_regs(void *km, const mm_mapopt_t *opt, int *n_regs, mm_reg1_t *regs); void mm_filter_regs(const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs);
void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs, mm128_t *a); void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs, mm128_t *a);
void mm_hit_sort_by_dp(void *km, int *n_regs, mm_reg1_t *r); void mm_hit_sort(void *km, int *n_regs, mm_reg1_t *r);
void mm_set_mapq(int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr); void mm_set_mapq(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr);
void mm_est_err(const mm_idx_t *mi, int qlen, int n_regs, mm_reg1_t *regs, const mm128_t *a, int32_t n, const uint64_t *mini_pos); void mm_est_err(const mm_idx_t *mi, int qlen, int n_regs, mm_reg1_t *regs, const mm128_t *a, int32_t n, const uint64_t *mini_pos);
@@ -86,6 +89,15 @@ mm_seg_t *mm_seg_gen(void *km, uint32_t hash, int n_segs, const int *qlens, int
void mm_seg_free(void *km, int n_segs, mm_seg_t *segs); void mm_seg_free(void *km, int n_segs, mm_seg_t *segs);
void mm_pair(void *km, int max_gap_ref, int dp_bonus, int sub_diff, int match_sc, const int *qlens, int *n_regs, mm_reg1_t **regs); void mm_pair(void *km, int max_gap_ref, int dp_bonus, int sub_diff, int match_sc, const int *qlens, int *n_regs, mm_reg1_t **regs);
FILE *mm_split_init(const char *prefix, const mm_idx_t *mi);
mm_idx_t *mm_split_merge_prep(const char *prefix, int n_splits, FILE **fp, uint32_t *n_seq_part);
int mm_split_merge(int n_segs, const char **fn, const mm_mapopt_t *opt, int n_split_idx);
void mm_split_rm_tmp(const char *prefix, int n_splits);
void mm_err_puts(const char *str);
void mm_err_fwrite(const void *p, size_t size, size_t nitems, FILE *fp);
void mm_err_fread(void *p, size_t size, size_t nitems, FILE *fp);
#ifdef __cplusplus #ifdef __cplusplus
} }
#endif #endif
+54 -6
View File
@@ -1,6 +1,15 @@
#include <stdio.h> #include <stdio.h>
#include "mmpriv.h" #include "mmpriv.h"
void mm_idxopt_init(mm_idxopt_t *opt)
{
memset(opt, 0, sizeof(mm_idxopt_t));
opt->k = 15, opt->w = 10, opt->flag = 0;
opt->bucket_bits = 14;
opt->mini_batch_size = 50000000;
opt->batch_size = 4000000000ULL;
}
void mm_mapopt_init(mm_mapopt_t *opt) void mm_mapopt_init(mm_mapopt_t *opt)
{ {
memset(opt, 0, sizeof(mm_mapopt_t)); memset(opt, 0, sizeof(mm_mapopt_t));
@@ -22,13 +31,16 @@ void mm_mapopt_init(mm_mapopt_t *opt)
opt->max_join_long = 20000; opt->max_join_long = 20000;
opt->max_join_short = 2000; opt->max_join_short = 2000;
opt->min_join_flank_sc = 1000; opt->min_join_flank_sc = 1000;
opt->min_join_flank_ratio = 0.5f;
opt->a = 2, opt->b = 4, opt->q = 4, opt->e = 2, opt->q2 = 24, opt->e2 = 1; opt->a = 2, opt->b = 4, opt->q = 4, opt->e = 2, opt->q2 = 24, opt->e2 = 1;
opt->zdrop = 400; opt->sc_ambi = 1;
opt->zdrop = 400, opt->zdrop_inv = 200;
opt->end_bonus = -1; opt->end_bonus = -1;
opt->min_dp_max = opt->min_chain_score * opt->a; opt->min_dp_max = opt->min_chain_score * opt->a;
opt->min_ksw_len = 200; opt->min_ksw_len = 200;
opt->anchor_ext_len = 20, opt->anchor_ext_shift = 6; opt->anchor_ext_len = 20, opt->anchor_ext_shift = 6;
opt->max_clip_ratio = 1.0f;
opt->mini_batch_size = 500000000; opt->mini_batch_size = 500000000;
opt->pe_ori = 0; // FF opt->pe_ori = 0; // FF
@@ -37,10 +49,12 @@ void mm_mapopt_init(mm_mapopt_t *opt)
void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi) void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
{ {
if ((opt->flag & MM_F_SPLICE_FOR) && (opt->flag & MM_F_SPLICE_REV)) if ((opt->flag & MM_F_SPLICE_FOR) || (opt->flag & MM_F_SPLICE_REV))
opt->flag |= MM_F_SPLICE; opt->flag |= MM_F_SPLICE;
if (opt->mid_occ <= 0) if (opt->mid_occ <= 0)
opt->mid_occ = mm_idx_cal_max_occ(mi, opt->mid_occ_frac); opt->mid_occ = mm_idx_cal_max_occ(mi, opt->mid_occ_frac);
if (opt->mid_occ < opt->min_mid_occ)
opt->mid_occ = opt->min_mid_occ;
if (mm_verbose >= 3) if (mm_verbose >= 3)
fprintf(stderr, "[M::%s::%.3f*%.2f] mid_occ = %d\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), opt->mid_occ); fprintf(stderr, "[M::%s::%.3f*%.2f] mid_occ = %d\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), opt->mid_occ);
} }
@@ -60,6 +74,7 @@ int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
io->flag = 0, io->k = 15, io->w = 5; io->flag = 0, io->k = 15, io->w = 5;
mo->flag |= MM_F_ALL_CHAINS | MM_F_NO_DIAG | MM_F_NO_DUAL | MM_F_NO_LJOIN; mo->flag |= MM_F_ALL_CHAINS | MM_F_NO_DIAG | MM_F_NO_DUAL | MM_F_NO_LJOIN;
mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_gap = 10000, mo->max_chain_skip = 25; mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_gap = 10000, mo->max_chain_skip = 25;
mo->bw = 2000;
} else if (strcmp(preset, "ava-pb") == 0) { } else if (strcmp(preset, "ava-pb") == 0) {
io->flag |= MM_I_HPC, io->k = 19, io->w = 5; io->flag |= MM_I_HPC, io->k = 19, io->w = 5;
mo->flag |= MM_F_ALL_CHAINS | MM_F_NO_DIAG | MM_F_NO_DUAL | MM_F_NO_LJOIN; mo->flag |= MM_F_ALL_CHAINS | MM_F_NO_DIAG | MM_F_NO_DUAL | MM_F_NO_LJOIN;
@@ -70,12 +85,20 @@ int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
io->flag = 0, io->k = 15; io->flag = 0, io->k = 15;
} else if (strcmp(preset, "asm5") == 0) { } else if (strcmp(preset, "asm5") == 0) {
io->flag = 0, io->k = 19, io->w = 19; io->flag = 0, io->k = 19, io->w = 19;
mo->a = 1, mo->b = 19, mo->q = 39, mo->q2 = 81, mo->e = 3, mo->e2 = 1, mo->zdrop = 200; mo->a = 1, mo->b = 19, mo->q = 39, mo->q2 = 81, mo->e = 3, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
mo->min_mid_occ = 100;
mo->min_dp_max = 200; mo->min_dp_max = 200;
mo->best_n = 50; mo->best_n = 50;
} else if (strcmp(preset, "asm10") == 0) { } else if (strcmp(preset, "asm10") == 0) {
io->flag = 0, io->k = 19, io->w = 19; io->flag = 0, io->k = 19, io->w = 19;
mo->a = 1, mo->b = 9, mo->q = 16, mo->q2 = 41, mo->e = 2, mo->e2 = 1, mo->zdrop = 200; mo->a = 1, mo->b = 9, mo->q = 16, mo->q2 = 41, mo->e = 2, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
mo->min_mid_occ = 100;
mo->min_dp_max = 200;
mo->best_n = 50;
} else if (strcmp(preset, "asm20") == 0) {
io->flag = 0, io->k = 19, io->w = 10;
mo->a = 1, mo->b = 4, mo->q = 6, mo->q2 = 26, mo->e = 2, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
mo->min_mid_occ = 100;
mo->min_dp_max = 200; mo->min_dp_max = 200;
mo->best_n = 50; mo->best_n = 50;
} else if (strcmp(preset, "short") == 0 || strcmp(preset, "sr") == 0) { } else if (strcmp(preset, "short") == 0 || strcmp(preset, "sr") == 0) {
@@ -83,7 +106,7 @@ int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
mo->flag |= MM_F_SR | MM_F_FRAG_MODE | MM_F_NO_PRINT_2ND | MM_F_2_IO_THREADS | MM_F_HEAP_SORT; mo->flag |= MM_F_SR | MM_F_FRAG_MODE | MM_F_NO_PRINT_2ND | MM_F_2_IO_THREADS | MM_F_HEAP_SORT;
mo->pe_ori = 0<<1|1; // FR mo->pe_ori = 0<<1|1; // FR
mo->a = 2, mo->b = 8, mo->q = 12, mo->e = 2, mo->q2 = 24, mo->e2 = 1; mo->a = 2, mo->b = 8, mo->q = 12, mo->e = 2, mo->q2 = 24, mo->e2 = 1;
mo->zdrop = 100; mo->zdrop = mo->zdrop_inv = 100;
mo->end_bonus = 10; mo->end_bonus = 10;
mo->max_frag_len = 800; mo->max_frag_len = 800;
mo->max_gap = 100; mo->max_gap = 100;
@@ -102,13 +125,23 @@ int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
mo->max_gap = 2000, mo->max_gap_ref = mo->bw = 200000; mo->max_gap = 2000, mo->max_gap_ref = mo->bw = 200000;
mo->a = 1, mo->b = 2, mo->q = 2, mo->e = 1, mo->q2 = 32, mo->e2 = 0; mo->a = 1, mo->b = 2, mo->q = 2, mo->e = 1, mo->q2 = 32, mo->e2 = 0;
mo->noncan = 9; mo->noncan = 9;
mo->zdrop = 200; mo->zdrop = 200, mo->zdrop_inv = 100; // because mo->a is halved
} else return -1; } else return -1;
return 0; return 0;
} }
int mm_check_opt(const mm_idxopt_t *io, const mm_mapopt_t *mo) int mm_check_opt(const mm_idxopt_t *io, const mm_mapopt_t *mo)
{ {
if (mo->split_prefix && (mo->flag & (MM_F_OUT_CS|MM_F_OUT_MD))) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m --cs or --MD doesn't work with --split-prefix\033[0m\n");
return -6;
}
if (io->k <= 0 || io->w <= 0) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m -k and -w must be positive\033[0m\n");
return -5;
}
if (mo->best_n < 0) { if (mo->best_n < 0) {
if (mm_verbose >= 1) if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m -N must be no less than 0\033[0m\n"); fprintf(stderr, "[ERROR]\033[1;31m -N must be no less than 0\033[0m\n");
@@ -126,6 +159,11 @@ int mm_check_opt(const mm_idxopt_t *io, const mm_mapopt_t *mo)
fprintf(stderr, "[ERROR]\033[1;31m --for-only and --rev-only can't be applied at the same time\033[0m\n"); fprintf(stderr, "[ERROR]\033[1;31m --for-only and --rev-only can't be applied at the same time\033[0m\n");
return -3; return -3;
} }
if (mo->e <= 0 || mo->q <= 0) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m -O and -E must be positive\033[0m\n");
return -1;
}
if ((mo->q != mo->q2 || mo->e != mo->e2) && !(mo->e > mo->e2 && mo->q + mo->e < mo->q2 + mo->e2)) { if ((mo->q != mo->q2 || mo->e != mo->e2) && !(mo->e > mo->e2 && mo->q + mo->e < mo->q2 + mo->e2)) {
if (mm_verbose >= 1) if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m dual gap penalties violating E1>E2 and O1+E1<O2+E2\033[0m\n"); fprintf(stderr, "[ERROR]\033[1;31m dual gap penalties violating E1>E2 and O1+E1<O2+E2\033[0m\n");
@@ -136,5 +174,15 @@ int mm_check_opt(const mm_idxopt_t *io, const mm_mapopt_t *mo)
fprintf(stderr, "[ERROR]\033[1;31m scoring system violating ({-O}+{-E})+({-O2}+{-E2}) <= 127\033[0m\n"); fprintf(stderr, "[ERROR]\033[1;31m scoring system violating ({-O}+{-E})+({-O2}+{-E2}) <= 127\033[0m\n");
return -1; return -1;
} }
if (mo->zdrop < mo->zdrop_inv) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m Z-drop should not be less than inversion-Z-drop\033[0m\n");
return -5;
}
if ((mo->flag & MM_F_NO_PRINT_2ND) && (mo->flag & MM_F_ALL_CHAINS)) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m -X/-P and --secondary=no can't be applied at the same time\033[0m\n");
return -5;
}
return 0; return 0;
} }
+5 -5
View File
@@ -54,7 +54,7 @@ void mm_set_pe_thru(const int *qlens, int *n_regs, mm_reg1_t **regs)
if (n_pri[0] == 1 && n_pri[1] == 1) { if (n_pri[0] == 1 && n_pri[1] == 1) {
mm_reg1_t *p = &regs[0][pri[0]]; mm_reg1_t *p = &regs[0][pri[0]];
mm_reg1_t *q = &regs[1][pri[1]]; mm_reg1_t *q = &regs[1][pri[1]];
if (p->rid == q->rid && p->rev == q->rev && abs(p->rs - q->rs) < 3 && abs(p->re - p->re) < 3 if (p->rid == q->rid && p->rev == q->rev && abs(p->rs - q->rs) < 3 && abs(p->re - q->re) < 3
&& ((p->qs == 0 && qlens[1] - q->qe == 0) || (q->qs == 0 && qlens[0] - p->qe == 0))) && ((p->qs == 0 && qlens[1] - q->qe == 0) || (q->qs == 0 && qlens[0] - p->qe == 0)))
{ {
p->pe_thru = q->pe_thru = 1; p->pe_thru = q->pe_thru = 1;
@@ -105,7 +105,7 @@ void mm_pair(void *km, int max_gap_ref, int pe_bonus, int sub_diff, int match_sc
max = -1; max = -1;
max_idx[0] = max_idx[1] = -1; max_idx[0] = max_idx[1] = -1;
last[0] = last[1] = -1; last[0] = last[1] = -1;
kv_resize(uint64_t, km, sc, n); kv_resize(uint64_t, km, sc, (size_t)n);
for (i = 0; i < n; ++i) { for (i = 0; i < n; ++i) {
if (a[i].key & 1) { // reverse first read or forward second read if (a[i].key & 1) { // reverse first read or forward second read
mm_reg1_t *q, *r; mm_reg1_t *q, *r;
@@ -151,8 +151,8 @@ void mm_pair(void *km, int max_gap_ref, int pe_bonus, int sub_diff, int match_sc
} }
} }
mapq_pe = r[0]->mapq > r[1]->mapq? r[0]->mapq : r[1]->mapq; mapq_pe = r[0]->mapq > r[1]->mapq? r[0]->mapq : r[1]->mapq;
for (i = 0; i < sc.n; ++i) for (i = 0; i < (int)sc.n; ++i)
if ((sc.a[i]>>32) + sub_diff >= max>>32) if ((sc.a[i]>>32) + sub_diff >= (uint64_t)max>>32)
++n_sub; ++n_sub;
if (sc.n > 1) { if (sc.n > 1) {
int mapq_pe_alt; int mapq_pe_alt;
@@ -164,7 +164,7 @@ void mm_pair(void *km, int max_gap_ref, int pe_bonus, int sub_diff, int match_sc
if (sc.n == 1) { if (sc.n == 1) {
if (r[0]->mapq < 2) r[0]->mapq = 2; if (r[0]->mapq < 2) r[0]->mapq = 2;
if (r[1]->mapq < 2) r[1]->mapq = 2; if (r[1]->mapq < 2) r[1]->mapq = 2;
} else if (max>>32 > sc.a[sc.n - 2]>>32) { } else if ((uint64_t)max>>32 > sc.a[sc.n - 2]>>32) {
if (r[0]->mapq < 1) r[0]->mapq = 1; if (r[0]->mapq < 1) r[0]->mapq = 1;
if (r[1]->mapq < 1) r[1]->mapq = 1; if (r[1]->mapq < 1) r[1]->mapq = 1;
} }
+49 -10
View File
@@ -34,6 +34,8 @@ The following Python script demonstrates the key functionality of mappy:
import mappy as mp import mappy as mp
a = mp.Aligner("test/MT-human.fa") # load or build index a = mp.Aligner("test/MT-human.fa") # load or build index
if not a: raise Exception("ERROR: failed to load/build index") if not a: raise Exception("ERROR: failed to load/build index")
s = a.seq("MT_human", 100, 200) # retrieve a subsequence from the index
print(mp.revcomp(s)) # reverse complement
for name, seq, qual in mp.fastx_read("test/MT-orang.fa"): # read a fasta/q sequence for name, seq, qual in mp.fastx_read("test/MT-orang.fa"): # read a fasta/q sequence
for hit in a.map(seq): # traverse alignments for hit in a.map(seq): # traverse alignments
print("{}\t{}\t{}\t{}".format(hit.ctg, hit.r_st, hit.r_en, hit.cigar_str)) print("{}\t{}\t{}\t{}".format(hit.ctg, hit.r_st, hit.r_en, hit.cigar_str))
@@ -41,20 +43,24 @@ The following Python script demonstrates the key functionality of mappy:
APIs APIs
---- ----
Mappy implements two classes and one global function. Mappy implements two classes and two global function.
Class mappy.Aligner Class mappy.Aligner
~~~~~~~~~~~~~~~~~~~ ~~~~~~~~~~~~~~~~~~~
.. code:: python .. code:: python
mappy.Aligner(fn_idx_in, preset=None, ...) mappy.Aligner(fn_idx_in=None, preset=None, ...)
This constructor accepts the following arguments: This constructor accepts the following arguments:
* **fn_idx_in**: index or sequence file name. Minimap2 automatically tests the * **fn_idx_in**: index or sequence file name. Minimap2 automatically tests the
file type. If a sequence file is provided, minimap2 builds an index. The file type. If a sequence file is provided, minimap2 builds an index. The
sequence file can be optionally gzip'd. sequence file can be optionally gzip'd. This option has no effect if **seq**
is set.
* **seq**: a single sequence to index. The sequence name will be set to
:code:`N/A`.
* **preset**: minimap2 preset. Currently, minimap2 supports the following * **preset**: minimap2 preset. Currently, minimap2 supports the following
presets: **sr** for single-end short reads; **map-pb** for PacBio presets: **sr** for single-end short reads; **map-pb** for PacBio
@@ -77,17 +83,36 @@ This constructor accepts the following arguments:
* **n_threads**: number of indexing threads; 3 by default * **n_threads**: number of indexing threads; 3 by default
* **fn_idx_out**: name of file to which the index is written * **extra_flags**: additional flags defined in minimap.h
* **fn_idx_out**: name of file to which the index is written. This parameter
has no effect if **seq** is set.
* **scoring**: scoring system. It is a tuple/list consisting of 4, 6 or 7
positive integers. The first 4 elements specify match scoring, mismatch
penalty, gap open and gap extension penalty. The 5th and 6th elements, if
present, set long-gap open and long-gap extension penalty. The 7th sets a
mismatch penalty involving ambiguous bases.
.. code:: python .. code:: python
mappy.Aligner.map(seq, seq2=None) mappy.Aligner.map(seq, seq2=None, cs=False, MD=False)
This method aligns :code:`seq` against the index. It is a generator, *yielding* This method aligns :code:`seq` against the index. It is a generator, *yielding*
a series of :code:`mappy.Alignment` objects. If :code:`seq2` is present, mappy a series of :code:`mappy.Alignment` objects. If :code:`seq2` is present, mappy
performs paired-end alignment, assuming the two ends are in the FR orientation. performs paired-end alignment, assuming the two ends are in the FR orientation.
Alignments of the two ends can be distinguished by the :code:`read_num` field Alignments of the two ends can be distinguished by the :code:`read_num` field
(see below). (see Class mappy.Alignment below). Argument :code:`cs` asks mappy to generate
the :code:`cs` tag; :code:`MD` is similar. These two arguments might slightly
degrade performance and are not enabled by default.
.. code:: python
mappy.Aligner.seq(name, start=0, end=0x7fffffff)
This method retrieves a (sub)sequence from the index and returns it as a Python
string. :code:`None` is returned if :code:`name` is not present in the index or
the start/end coordinates are invalid.
Class mappy.Alignment Class mappy.Alignment
~~~~~~~~~~~~~~~~~~~~~ ~~~~~~~~~~~~~~~~~~~~~
@@ -129,6 +154,11 @@ properties:
* **cigar**: CIGAR returned as an array of shape :code:`(n_cigar,2)`. The two * **cigar**: CIGAR returned as an array of shape :code:`(n_cigar,2)`. The two
numbers give the length and the operator of each CIGAR operation. numbers give the length and the operator of each CIGAR operation.
* **MD**: the :code:`MD` tag as in the SAM format. It is an empty string unless
the :code:`MD` argument is applied when calling :code:`mappy.Aligner.map()`.
* **cs**: the :code:`cs` tag.
An :code:`Alignment` object can be converted to a string with :code:`str()` in An :code:`Alignment` object can be converted to a string with :code:`str()` in
the following format: the following format:
@@ -139,13 +169,22 @@ the following format:
It is effectively the PAF format without the QueryName and QueryLength columns It is effectively the PAF format without the QueryName and QueryLength columns
(the first two columns in PAF). (the first two columns in PAF).
Function mappy.fastx_read Miscellaneous Functions
~~~~~~~~~~~~~~~~~~~~~~~~~ ~~~~~~~~~~~~~~~~~~~~~~~
.. code:: python .. code:: python
mappy.fastx_read(fn) mappy.fastx_read(fn, read_comment=False)
This generator function opens a FASTA/FASTQ file and *yields* a This generator function opens a FASTA/FASTQ file and *yields* a
:code:`(name,seq,qual)` tuple for each sequence entry. The input file may be :code:`(name,seq,qual)` tuple for each sequence entry. The input file may be
optionally gzip'd. optionally gzip'd. If :code:`read_comment` is True, this generator yields
a :code:`(name,seq,qual,comment)` tuple instead.
.. code:: python
mappy.revcomp(seq)
Return the reverse complement of DNA string :code:`seq`. This function
recognizes IUB code and preserves the letter cases. Uracil :code:`U` is
complemented to :code:`A`.
+50 -2
View File
@@ -73,13 +73,17 @@ static inline void mm_reset_timer(void)
extern unsigned char seq_comp_table[256]; extern unsigned char seq_comp_table[256];
static inline mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char *seq1, const char *seq2, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt) static inline mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char *seq1, const char *seq2, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt)
{ {
mm_reg1_t *r;
Py_BEGIN_ALLOW_THREADS
if (seq2 == 0) { if (seq2 == 0) {
return mm_map(mi, strlen(seq1), seq1, n_regs, b, opt, NULL); r = mm_map(mi, strlen(seq1), seq1, n_regs, b, opt, NULL);
} else { } else {
int _n_regs[2]; int _n_regs[2];
mm_reg1_t *regs[2]; mm_reg1_t *regs[2];
char *seq[2]; char *seq[2];
int i, len[2]; int i, len[2];
len[0] = strlen(seq1); len[0] = strlen(seq1);
len[1] = strlen(seq2); len[1] = strlen(seq2);
seq[0] = (char*)seq1; seq[0] = (char*)seq1;
@@ -97,8 +101,52 @@ static inline mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char *seq1, const
regs[0] = (mm_reg1_t*)realloc(regs[0], sizeof(mm_reg1_t) * (*n_regs)); regs[0] = (mm_reg1_t*)realloc(regs[0], sizeof(mm_reg1_t) * (*n_regs));
memcpy(&regs[0][_n_regs[0]], regs[1], _n_regs[1] * sizeof(mm_reg1_t)); memcpy(&regs[0][_n_regs[0]], regs[1], _n_regs[1] * sizeof(mm_reg1_t));
free(regs[1]); free(regs[1]);
return regs[0]; r = regs[0];
} }
Py_END_ALLOW_THREADS
return r;
}
static inline char *mappy_revcomp(int len, const uint8_t *seq)
{
int i;
char *rev;
rev = (char*)malloc(len + 1);
for (i = 0; i < len; ++i)
rev[len - i - 1] = seq_comp_table[seq[i]];
rev[len] = 0;
return rev;
}
static char *mappy_fetch_seq(const mm_idx_t *mi, const char *name, int st, int en, int *len)
{
int i, rid;
char *s;
*len = 0;
rid = mm_idx_name2id(mi, name);
if (rid < 0) return 0;
if ((uint32_t)st >= mi->seq[rid].len || st >= en) return 0;
if (en < 0 || (uint32_t)en > mi->seq[rid].len)
en = mi->seq[rid].len;
s = (char*)malloc(en - st + 1);
*len = mm_idx_getseq(mi, rid, st, en, (uint8_t*)s);
for (i = 0; i < *len; ++i)
s[i] = "ACGTN"[(uint8_t)s[i]];
s[*len] = 0;
return s;
}
static mm_idx_t *mappy_idx_seq(int w, int k, int is_hpc, int bucket_bits, const char *seq, int len)
{
const char *fake_name = "N/A";
char *s;
mm_idx_t *mi;
s = (char*)calloc(len + 1, 1);
memcpy(s, seq, len);
mi = mm_idx_str(w, k, is_hpc, bucket_bits, 1, (const char**)&s, (const char**)&fake_name);
free(s);
return mi;
} }
#endif #endif
+16 -1
View File
@@ -24,18 +24,24 @@ cdef extern from "minimap.h":
int best_n int best_n
int max_join_long, max_join_short int max_join_long, max_join_short
int min_join_flank_sc int min_join_flank_sc
float min_join_flank_ratio;
int a, b, q, e, q2, e2 int a, b, q, e, q2, e2
int sc_ambi
int noncan int noncan
int zdrop int zdrop, zdrop_inv
int end_bonus int end_bonus
int min_dp_max int min_dp_max
int min_ksw_len int min_ksw_len
int anchor_ext_len, anchor_ext_shift int anchor_ext_len, anchor_ext_shift
float max_clip_ratio
int pe_ori, pe_bonus int pe_ori, pe_bonus
float mid_occ_frac float mid_occ_frac
int32_t min_mid_occ
int32_t mid_occ int32_t mid_occ
int32_t max_occ int32_t max_occ
int mini_batch_size int mini_batch_size
int64_t max_sw_mat
const char *split_prefix
int mm_set_opt(char *preset, mm_idxopt_t *io, mm_mapopt_t *mo) int mm_set_opt(char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
int mm_verbose int mm_verbose
@@ -58,6 +64,7 @@ cdef extern from "minimap.h":
uint32_t *S uint32_t *S
mm_idx_bucket_t *B mm_idx_bucket_t *B
void *km void *km
void *h
ctypedef struct mm_idx_reader_t: ctypedef struct mm_idx_reader_t:
pass pass
@@ -68,6 +75,8 @@ cdef extern from "minimap.h":
void mm_idx_destroy(mm_idx_t *mi) void mm_idx_destroy(mm_idx_t *mi)
void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi) void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
int mm_idx_index_name(mm_idx_t *mi)
# #
# Mapping (key struct defined in cmappy.h below) # Mapping (key struct defined in cmappy.h below)
# #
@@ -79,6 +88,9 @@ cdef extern from "minimap.h":
mm_tbuf_t *mm_tbuf_init() mm_tbuf_t *mm_tbuf_init()
void mm_tbuf_destroy(mm_tbuf_t *b) void mm_tbuf_destroy(mm_tbuf_t *b)
void *mm_tbuf_get_km(mm_tbuf_t *b)
int mm_gen_cs(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int no_iden)
int mm_gen_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq)
# #
# Helper header (because it is hard to expose mm_reg1_t with Cython) # Helper header (because it is hard to expose mm_reg1_t with Cython)
@@ -98,6 +110,8 @@ cdef extern from "cmappy.h":
void mm_reg2hitpy(const mm_idx_t *mi, mm_reg1_t *r, mm_hitpy_t *h) void mm_reg2hitpy(const mm_idx_t *mi, mm_reg1_t *r, mm_hitpy_t *h)
void mm_free_reg1(mm_reg1_t *r) void mm_free_reg1(mm_reg1_t *r)
mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char *seq1, const char *seq2, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt) mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char *seq1, const char *seq2, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt)
char *mappy_fetch_seq(const mm_idx_t *mi, const char *name, int st, int en, int *l)
mm_idx_t *mappy_idx_seq(int w, int k, int is_hpc, int bucket_bits, const char *seq, int l)
ctypedef struct kstring_t: ctypedef struct kstring_t:
unsigned l, m unsigned l, m
@@ -115,5 +129,6 @@ cdef extern from "cmappy.h":
void mm_fastx_close(kseq_t *ks) void mm_fastx_close(kseq_t *ks)
int kseq_read(kseq_t *seq) int kseq_read(kseq_t *seq)
char *mappy_revcomp(int l, const uint8_t *seq)
int mm_verbose_level(int v) int mm_verbose_level(int v)
void mm_reset_timer() void mm_reset_timer()
+102 -20
View File
@@ -1,6 +1,9 @@
from libc.stdint cimport uint8_t, int8_t from libc.stdint cimport uint8_t, int8_t
from libc.stdlib cimport free from libc.stdlib cimport free
cimport cmappy cimport cmappy
import sys
__version__ = '2.14'
cmappy.mm_reset_timer() cmappy.mm_reset_timer()
@@ -11,9 +14,9 @@ cdef class Alignment:
cdef int8_t _strand, _trans_strand cdef int8_t _strand, _trans_strand
cdef uint8_t _mapq, _is_primary cdef uint8_t _mapq, _is_primary
cdef int _seg_id cdef int _seg_id
cdef _ctg, _cigar # these are python objects cdef _ctg, _cigar, _cs, _MD # these are python objects
def __cinit__(self, ctg, cl, cs, ce, strand, qs, qe, mapq, cigar, is_primary, mlen, blen, NM, trans_strand, seg_id): def __cinit__(self, ctg, cl, cs, ce, strand, qs, qe, mapq, cigar, is_primary, mlen, blen, NM, trans_strand, seg_id, cs_str, MD_str):
self._ctg = ctg if isinstance(ctg, str) else ctg.decode() self._ctg = ctg if isinstance(ctg, str) else ctg.decode()
self._ctg_len, self._r_st, self._r_en = cl, cs, ce self._ctg_len, self._r_st, self._r_en = cl, cs, ce
self._strand, self._q_st, self._q_en = strand, qs, qe self._strand, self._q_st, self._q_en = strand, qs, qe
@@ -23,6 +26,8 @@ cdef class Alignment:
self._is_primary = is_primary self._is_primary = is_primary
self._trans_strand = trans_strand self._trans_strand = trans_strand
self._seg_id = seg_id self._seg_id = seg_id
self._cs = cs_str
self._MD = MD_str
@property @property
def ctg(self): return self._ctg def ctg(self): return self._ctg
@@ -69,6 +74,12 @@ cdef class Alignment:
@property @property
def read_num(self): return self._seg_id + 1 def read_num(self): return self._seg_id + 1
@property
def cs(self): return self._cs
@property
def MD(self): return self._MD
@property @property
def cigar_str(self): def cigar_str(self):
return "".join(map(lambda x: str(x[0]) + 'MIDNSH'[x[1]], self._cigar)) return "".join(map(lambda x: str(x[0]) + 'MIDNSH'[x[1]], self._cigar))
@@ -82,8 +93,10 @@ cdef class Alignment:
if self._trans_strand > 0: ts = 'ts:A:+' if self._trans_strand > 0: ts = 'ts:A:+'
elif self._trans_strand < 0: ts = 'ts:A:-' elif self._trans_strand < 0: ts = 'ts:A:-'
else: ts = 'ts:A:.' else: ts = 'ts:A:.'
return "\t".join([str(self._q_st), str(self._q_en), strand, self._ctg, str(self._ctg_len), str(self._r_st), str(self._r_en), a = [str(self._q_st), str(self._q_en), strand, self._ctg, str(self._ctg_len), str(self._r_st), str(self._r_en),
str(self._mlen), str(self._blen), str(self._mapq), tp, ts, "cg:Z:" + self.cigar_str]) str(self._mlen), str(self._blen), str(self._mapq), tp, ts, "cg:Z:" + self.cigar_str]
if self._cs != "": a.append("cs:Z:" + self._cs)
return "\t".join(a)
cdef class ThreadBuffer: cdef class ThreadBuffer:
cdef cmappy.mm_tbuf_t *_b cdef cmappy.mm_tbuf_t *_b
@@ -99,7 +112,7 @@ cdef class Aligner:
cdef cmappy.mm_idxopt_t idx_opt cdef cmappy.mm_idxopt_t idx_opt
cdef cmappy.mm_mapopt_t map_opt cdef cmappy.mm_mapopt_t map_opt
def __cinit__(self, fn_idx_in, preset=None, k=None, w=None, min_cnt=None, min_chain_score=None, min_dp_score=None, bw=None, best_n=None, n_threads=3, fn_idx_out=None): def __cinit__(self, fn_idx_in=None, preset=None, k=None, w=None, min_cnt=None, min_chain_score=None, min_dp_score=None, bw=None, best_n=None, n_threads=3, fn_idx_out=None, max_frag_len=None, extra_flags=None, seq=None, scoring=None):
cmappy.mm_set_opt(NULL, &self.idx_opt, &self.map_opt) # set the default options cmappy.mm_set_opt(NULL, &self.idx_opt, &self.map_opt) # set the default options
if preset is not None: if preset is not None:
cmappy.mm_set_opt(str.encode(preset), &self.idx_opt, &self.map_opt) # apply preset cmappy.mm_set_opt(str.encode(preset), &self.idx_opt, &self.map_opt) # apply preset
@@ -111,17 +124,34 @@ cdef class Aligner:
if min_chain_score is not None: self.map_opt.min_chain_score = min_chain_score if min_chain_score is not None: self.map_opt.min_chain_score = min_chain_score
if min_dp_score is not None: self.map_opt.min_dp_max = min_dp_score if min_dp_score is not None: self.map_opt.min_dp_max = min_dp_score
if bw is not None: self.map_opt.bw = bw if bw is not None: self.map_opt.bw = bw
if best_n is not None: self.best_n = best_n if best_n is not None: self.map_opt.best_n = best_n
if max_frag_len is not None: self.map_opt.max_frag_len = max_frag_len
if extra_flags is not None: self.map_opt.flag |= extra_flags
if scoring is not None and len(scoring) >= 4:
self.map_opt.a, self.map_opt.b = scoring[0], scoring[1]
self.map_opt.q, self.map_opt.e = scoring[2], scoring[3]
self.map_opt.q2, self.map_opt.e2 = self.map_opt.q, self.map_opt.e
if len(scoring) >= 6:
self.map_opt.q2, self.map_opt.e2 = scoring[4], scoring[5]
if len(scoring) >= 7:
self.map_opt.sc_ambi = scoring[6]
cdef cmappy.mm_idx_reader_t *r; cdef cmappy.mm_idx_reader_t *r;
if fn_idx_out is None:
r = cmappy.mm_idx_reader_open(str.encode(fn_idx_in), &self.idx_opt, NULL) if seq is None:
if fn_idx_out is None:
r = cmappy.mm_idx_reader_open(str.encode(fn_idx_in), &self.idx_opt, NULL)
else:
r = cmappy.mm_idx_reader_open(str.encode(fn_idx_in), &self.idx_opt, fn_idx_out)
if r is not NULL:
self._idx = cmappy.mm_idx_reader_read(r, n_threads) # NB: ONLY read the first part
cmappy.mm_idx_reader_close(r)
cmappy.mm_mapopt_update(&self.map_opt, self._idx)
cmappy.mm_idx_index_name(self._idx)
else: else:
r = cmappy.mm_idx_reader_open(str.encode(fn_idx_in), &self.idx_opt, fn_idx_out) self._idx = cmappy.mappy_idx_seq(self.idx_opt.w, self.idx_opt.k, self.idx_opt.flag&1, self.idx_opt.bucket_bits, str.encode(seq), len(seq))
if r is not NULL:
self._idx = cmappy.mm_idx_reader_read(r, n_threads) # NB: ONLY read the first part
cmappy.mm_idx_reader_close(r)
cmappy.mm_mapopt_update(&self.map_opt, self._idx) cmappy.mm_mapopt_update(&self.map_opt, self._idx)
self.map_opt.mid_occ = 1000 # don't filter high-occ seeds
def __dealloc__(self): def __dealloc__(self):
if self._idx is not NULL: if self._idx is not NULL:
@@ -130,29 +160,68 @@ cdef class Aligner:
def __bool__(self): def __bool__(self):
return (self._idx != NULL) return (self._idx != NULL)
def map(self, seq, seq2=None, buf=None): def map(self, seq, seq2=None, buf=None, cs=False, MD=False, max_frag_len=None, extra_flags=None):
cdef cmappy.mm_reg1_t *regs cdef cmappy.mm_reg1_t *regs
cdef cmappy.mm_hitpy_t h cdef cmappy.mm_hitpy_t h
cdef ThreadBuffer b cdef ThreadBuffer b
cdef int n_regs cdef int n_regs
cdef char *cs_str = NULL
cdef int l_cs_str, m_cs_str = 0
cdef void *km
cdef cmappy.mm_mapopt_t map_opt
map_opt = self.map_opt
if max_frag_len is not None: map_opt.max_frag_len = max_frag_len
if extra_flags is not None: map_opt.flag |= extra_flags
if self._idx is NULL: return None if self._idx is NULL: return None
if buf is None: b = ThreadBuffer() if buf is None: b = ThreadBuffer()
else: b = buf else: b = buf
if seq2 is None: regs = cmappy.mm_map_aux(self._idx, str.encode(seq), NULL, &n_regs, b._b, &self.map_opt) km = cmappy.mm_tbuf_get_km(b._b)
else: regs = cmappy.mm_map_aux(self._idx, str.encode(seq), str.encode(seq2), &n_regs, b._b, &self.map_opt)
_seq = seq if isinstance(seq, bytes) else seq.encode()
if seq2 is None:
regs = cmappy.mm_map_aux(self._idx, _seq, NULL, &n_regs, b._b, &map_opt)
else:
_seq2 = seq2 if isinstance(seq2, bytes) else seq2.encode()
regs = cmappy.mm_map_aux(self._idx, _seq, _seq2, &n_regs, b._b, &map_opt)
for i in range(n_regs): for i in range(n_regs):
cmappy.mm_reg2hitpy(self._idx, &regs[i], &h) cmappy.mm_reg2hitpy(self._idx, &regs[i], &h)
cigar = [] cigar, _cs, _MD = [], '', ''
for k in range(h.n_cigar32): for k in range(h.n_cigar32): # convert the 32-bit CIGAR encoding to Python array
c = h.cigar32[k] c = h.cigar32[k]
cigar.append([c>>4, c&0xf]) cigar.append([c>>4, c&0xf])
yield Alignment(h.ctg, h.ctg_len, h.ctg_start, h.ctg_end, h.strand, h.qry_start, h.qry_end, h.mapq, cigar, h.is_primary, h.mlen, h.blen, h.NM, h.trans_strand, h.seg_id) if cs or MD: # generate the cs and/or the MD tag, if requested
if cs:
l_cs_str = cmappy.mm_gen_cs(km, &cs_str, &m_cs_str, self._idx, &regs[i], _seq, 1)
_cs = cs_str[:l_cs_str] if isinstance(cs_str, str) else cs_str[:l_cs_str].decode()
if MD:
l_cs_str = cmappy.mm_gen_MD(km, &cs_str, &m_cs_str, self._idx, &regs[i], _seq)
_MD = cs_str[:l_cs_str] if isinstance(cs_str, str) else cs_str[:l_cs_str].decode()
yield Alignment(h.ctg, h.ctg_len, h.ctg_start, h.ctg_end, h.strand, h.qry_start, h.qry_end, h.mapq, cigar, h.is_primary, h.mlen, h.blen, h.NM, h.trans_strand, h.seg_id, _cs, _MD)
cmappy.mm_free_reg1(&regs[i]) cmappy.mm_free_reg1(&regs[i])
free(regs) free(regs)
free(cs_str)
def fastx_read(fn): def seq(self, str name, int start=0, int end=0x7fffffff):
cdef int l
cdef char *s = cmappy.mappy_fetch_seq(self._idx, name.encode(), start, end, &l)
if l == 0: return None
r = s[:l] if isinstance(s, str) else s[:l].decode()
free(s)
return r
@property
def k(self): return self._idx.k
@property
def w(self): return self._idx.w
@property
def n_seq(self): return self._idx.n_seq
def fastx_read(fn, read_comment=False):
cdef cmappy.kseq_t *ks cdef cmappy.kseq_t *ks
ks = cmappy.mm_fastx_open(str.encode(fn)) ks = cmappy.mm_fastx_open(str.encode(fn))
if ks is NULL: return None if ks is NULL: return None
@@ -161,9 +230,22 @@ def fastx_read(fn):
else: qual = None else: qual = None
name = ks.name.s if isinstance(ks.name.s, str) else ks.name.s.decode() name = ks.name.s if isinstance(ks.name.s, str) else ks.name.s.decode()
seq = ks.seq.s if isinstance(ks.seq.s, str) else ks.seq.s.decode() seq = ks.seq.s if isinstance(ks.seq.s, str) else ks.seq.s.decode()
yield name, seq, qual if read_comment:
if ks.comment.l > 0: comment = ks.comment.s if isinstance(ks.comment.s, str) else ks.comment.s.decode()
else: comment = None
yield name, seq, qual, comment
else:
yield name, seq, qual
cmappy.mm_fastx_close(ks) cmappy.mm_fastx_close(ks)
def revcomp(seq):
l = len(seq)
bseq = seq if isinstance(seq, bytes) else seq.encode()
cdef char *s = cmappy.mappy_revcomp(l, bseq)
r = s[:l] if isinstance(s, str) else s[:l].decode()
free(s)
return r
def verbose(v=None): def verbose(v=None):
if v is None: v = -1 if v is None: v = -1
return cmappy.mm_verbose_level(v) return cmappy.mm_verbose_level(v)
+8 -4
View File
@@ -1,10 +1,11 @@
#!/usr/bin/env python #!/usr/bin/env python
import sys, getopt import sys
import getopt
import mappy as mp import mappy as mp
def main(argv): def main(argv):
opts, args = getopt.getopt(argv[1:], "x:n:m:k:w:r:") opts, args = getopt.getopt(argv[1:], "x:n:m:k:w:r:c")
if len(args) < 2: if len(args) < 2:
print("Usage: minimap2.py [options] <ref.fa>|<ref.mmi> <query.fq>") print("Usage: minimap2.py [options] <ref.fa>|<ref.mmi> <query.fq>")
print("Options:") print("Options:")
@@ -14,9 +15,11 @@ def main(argv):
print(" -k INT k-mer length") print(" -k INT k-mer length")
print(" -w INT minimizer window length") print(" -w INT minimizer window length")
print(" -r INT band width") print(" -r INT band width")
print(" -c output the cs tag")
sys.exit(1) sys.exit(1)
preset, min_cnt, min_sc, k, w, bw = None, None, None, None, None, None preset = min_cnt = min_sc = k = w = bw = None
out_cs = False
for opt, arg in opts: for opt, arg in opts:
if opt == '-x': preset = arg if opt == '-x': preset = arg
elif opt == '-n': min_cnt = int(arg) elif opt == '-n': min_cnt = int(arg)
@@ -24,11 +27,12 @@ def main(argv):
elif opt == '-r': bw = int(arg) elif opt == '-r': bw = int(arg)
elif opt == '-k': k = int(arg) elif opt == '-k': k = int(arg)
elif opt == '-w': w = int(arg) elif opt == '-w': w = int(arg)
elif opt == '-c': out_cs = True
a = mp.Aligner(args[0], preset=preset, min_cnt=min_cnt, min_chain_score=min_sc, k=k, w=w, bw=bw) a = mp.Aligner(args[0], preset=preset, min_cnt=min_cnt, min_chain_score=min_sc, k=k, w=w, bw=bw)
if not a: raise Exception("ERROR: failed to load/build index file '{}'".format(args[0])) if not a: raise Exception("ERROR: failed to load/build index file '{}'".format(args[0]))
for name, seq, qual in mp.fastx_read(args[1]): # read one sequence for name, seq, qual in mp.fastx_read(args[1]): # read one sequence
for h in a.map(seq): # traverse hits for h in a.map(seq, cs=out_cs): # traverse hits
print('{}\t{}\t{}'.format(name, len(seq), h)) print('{}\t{}\t{}'.format(name, len(seq), h))
if __name__ == "__main__": if __name__ == "__main__":
+10 -9
View File
@@ -70,10 +70,10 @@ void sdust_buf_destroy(sdust_buf_t *buf)
static inline void shift_window(int t, kdq_t(int) *w, int T, int W, int *L, int *rw, int *rv, int *cw, int *cv) static inline void shift_window(int t, kdq_t(int) *w, int T, int W, int *L, int *rw, int *rv, int *cw, int *cv)
{ {
int s; int s;
if (kdq_size(w) >= W - SD_WLEN + 1) { // TODO: is this right for SD_WLEN!=3? if ((int)kdq_size(w) >= W - SD_WLEN + 1) { // TODO: is this right for SD_WLEN!=3?
s = *kdq_shift(int, w); s = *kdq_shift(int, w);
*rw -= --cw[s]; *rw -= --cw[s];
if (*L > kdq_size(w)) if (*L > (int)kdq_size(w))
--*L, *rv -= --cv[s]; --*L, *rv -= --cv[s];
} }
kdq_push(int, w, t); kdq_push(int, w, t);
@@ -114,7 +114,7 @@ static void find_perfect(void *km, perf_intv_v *P, const kdq_t(int) *w, int T, i
r += c[t]++; r += c[t]++;
new_r = r, new_l = kdq_size(w) - i - 1; new_r = r, new_l = kdq_size(w) - i - 1;
if (new_r * 10 > T * new_l) { if (new_r * 10 > T * new_l) {
for (j = 0; j < P->n && P->a[j].start >= i + start; ++j) { // find insertion position for (j = 0; j < (int)P->n && P->a[j].start >= i + start; ++j) { // find insertion position
perf_intv_t *p = &P->a[j]; perf_intv_t *p = &P->a[j];
if (max_r == 0 || p->r * max_l > max_r * p->l) if (max_r == 0 || p->r * max_l > max_r * p->l)
max_r = p->r, max_l = p->l; max_r = p->r, max_l = p->l;
@@ -177,7 +177,7 @@ uint64_t *sdust(void *km, const uint8_t *seq, int l_seq, int T, int W, int *n)
#ifdef _SDUST_MAIN #ifdef _SDUST_MAIN
#include <zlib.h> #include <zlib.h>
#include <stdio.h> #include <stdio.h>
#include "getopt.h" #include "ketopt.h"
#include "kseq.h" #include "kseq.h"
KSEQ_INIT(gzFile, gzread) KSEQ_INIT(gzFile, gzread)
@@ -186,16 +186,17 @@ int main(int argc, char *argv[])
gzFile fp; gzFile fp;
kseq_t *ks; kseq_t *ks;
int W = 64, T = 20, c; int W = 64, T = 20, c;
ketopt_t o = KETOPT_INIT;
while ((c = getopt(argc, argv, "w:t:")) >= 0) { while ((c = ketopt(&o, argc, argv, 1, "w:t:", 0)) >= 0) {
if (c == 'w') W = atoi(optarg); if (c == 'w') W = atoi(o.arg);
else if (c == 't') T = atoi(optarg); else if (c == 't') T = atoi(o.arg);
} }
if (optind == argc) { if (o.ind == argc) {
fprintf(stderr, "Usage: sdust [-w %d] [-t %d] <in.fa>\n", W, T); fprintf(stderr, "Usage: sdust [-w %d] [-t %d] <in.fa>\n", W, T);
return 1; return 1;
} }
fp = strcmp(argv[optind], "-")? gzopen(argv[optind], "r") : gzdopen(fileno(stdin), "r"); fp = strcmp(argv[o.ind], "-")? gzopen(argv[o.ind], "r") : gzdopen(fileno(stdin), "r");
ks = kseq_init(fp); ks = kseq_init(fp);
while (kseq_read(ks) >= 0) { while (kseq_read(ks) >= 0) {
uint64_t *r; uint64_t *r;
+18 -8
View File
@@ -14,16 +14,26 @@ else: # with Cython
module_src = 'python/mappy.pyx' module_src = 'python/mappy.pyx'
cmdclass['build_ext'] = build_ext cmdclass['build_ext'] = build_ext
import sys import sys, platform
sys.path.append('python') sys.path.append('python')
extra_compile_args = ['-DHAVE_KALLOC']
include_dirs = ["."]
if platform.machine() in ["aarch64", "arm64"]:
include_dirs.append("sse2neon/")
extra_compile_args.extend(['-ftree-vectorize', '-DKSW_SSE2_ONLY', '-D__SSE2__'])
else:
extra_compile_args.append('-msse4.1') # WARNING: ancient x86_64 CPUs don't have SSE4
def readme(): def readme():
with open('python/README.rst') as f: with open('python/README.rst') as f:
return f.read() return f.read()
setup( setup(
name = 'mappy', name = 'mappy',
version = '2.8', version = '2.14',
url = 'https://github.com/lh3/minimap2', url = 'https://github.com/lh3/minimap2',
description = 'Minimap2 python binding', description = 'Minimap2 python binding',
long_description = readme(), long_description = readme(),
@@ -35,15 +45,15 @@ setup(
ext_modules = [Extension('mappy', ext_modules = [Extension('mappy',
sources = [module_src, 'align.c', 'bseq.c', 'chain.c', 'format.c', 'hit.c', 'index.c', 'pe.c', 'options.c', sources = [module_src, 'align.c', 'bseq.c', 'chain.c', 'format.c', 'hit.c', 'index.c', 'pe.c', 'options.c',
'ksw2_extd2_sse.c', 'ksw2_exts2_sse.c', 'ksw2_extz2_sse.c', 'ksw2_ll_sse.c', 'ksw2_extd2_sse.c', 'ksw2_exts2_sse.c', 'ksw2_extz2_sse.c', 'ksw2_ll_sse.c',
'kalloc.c', 'kthread.c', 'map.c', 'misc.c', 'sdust.c', 'sketch.c', 'esterr.c'], 'kalloc.c', 'kthread.c', 'map.c', 'misc.c', 'sdust.c', 'sketch.c', 'esterr.c', 'splitidx.c'],
depends = ['minimap.h', 'bseq.h', 'kalloc.h', 'kdq.h', 'khash.h', 'kseq.h', 'ksort.h', depends = ['minimap.h', 'bseq.h', 'kalloc.h', 'kdq.h', 'khash.h', 'kseq.h', 'ksort.h',
'ksw2.h', 'kthread.h', 'kvec.h', 'mmpriv.h', 'sdust.h', 'ksw2.h', 'kthread.h', 'kvec.h', 'mmpriv.h', 'sdust.h',
'python/cmappy.h', 'python/cmappy.pxd'], 'python/cmappy.h', 'python/cmappy.pxd'],
extra_compile_args = ['-DHAVE_KALLOC', '-msse4'], # WARNING: ancient x86_64 CPUs don't have SSE4 extra_compile_args = extra_compile_args,
include_dirs = ['.'], include_dirs = include_dirs,
libraries = ['z', 'm', 'pthread'])], libraries = ['z', 'm', 'pthread'])],
classifiers = [ classifiers = [
'Development Status :: 4 - Beta', 'Development Status :: 5 - Production/Stable',
'License :: OSI Approved :: MIT License', 'License :: OSI Approved :: MIT License',
'Operating System :: POSIX', 'Operating System :: POSIX',
'Programming Language :: C', 'Programming Language :: C',
+80
View File
@@ -0,0 +1,80 @@
#include <string.h>
#include <assert.h>
#include <stdlib.h>
#include <stdio.h>
#include "mmpriv.h"
FILE *mm_split_init(const char *prefix, const mm_idx_t *mi)
{
char *fn;
FILE *fp;
uint32_t i, k = mi->k;
fn = (char*)calloc(strlen(prefix) + 10, 1);
sprintf(fn, "%s.%.4d.tmp", prefix, mi->index);
fp = fopen(fn, "wb");
assert(fp);
mm_err_fwrite(&k, 4, 1, fp);
mm_err_fwrite(&mi->n_seq, 4, 1, fp);
for (i = 0; i < mi->n_seq; ++i) {
uint8_t l;
l = strlen(mi->seq[i].name);
mm_err_fwrite(&l, 1, 1, fp);
mm_err_fwrite(mi->seq[i].name, 1, l, fp);
mm_err_fwrite(&mi->seq[i].len, 4, 1, fp);
}
free(fn);
return fp;
}
mm_idx_t *mm_split_merge_prep(const char *prefix, int n_splits, FILE **fp, uint32_t *n_seq_part)
{
mm_idx_t *mi = 0;
char *fn;
int i, j;
if (n_splits < 1) return 0;
fn = CALLOC(char, strlen(prefix) + 10);
for (i = 0; i < n_splits; ++i) {
sprintf(fn, "%s.%.4d.tmp", prefix, i);
if ((fp[i] = fopen(fn, "rb")) == 0) {
if (mm_verbose >= 1)
fprintf(stderr, "ERROR: failed to open temporary file '%s'\n", fn);
for (j = 0; j < i; ++j)
fclose(fp[j]);
free(fn);
return 0;
}
}
free(fn);
mi = CALLOC(mm_idx_t, 1);
for (i = 0; i < n_splits; ++i) {
mm_err_fread(&mi->k, 4, 1, fp[i]); // TODO: check if k is all the same
mm_err_fread(&n_seq_part[i], 4, 1, fp[i]);
mi->n_seq += n_seq_part[i];
}
mi->seq = CALLOC(mm_idx_seq_t, mi->n_seq);
for (i = j = 0; i < n_splits; ++i) {
uint32_t k;
for (k = 0; k < n_seq_part[i]; ++k, ++j) {
uint8_t l;
mm_err_fread(&l, 1, 1, fp[i]);
mi->seq[j].name = (char*)calloc(l + 1, 1);
mm_err_fread(mi->seq[j].name, 1, l, fp[i]);
mm_err_fread(&mi->seq[j].len, 4, 1, fp[i]);
}
}
return mi;
}
void mm_split_rm_tmp(const char *prefix, int n_splits)
{
int i;
char *fn;
fn = CALLOC(char, strlen(prefix) + 10);
for (i = 0; i < n_splits; ++i) {
sprintf(fn, "%s.%.4d.tmp", prefix, i);
remove(fn);
}
free(fn);
}
+1 -1
View File
@@ -1,4 +1,4 @@
>MT_orang >MT_orang co:Z:comment
GTTTATGTAGCTTATTCTATCCAAAGCAATGCACTGAAAATGTCTCGACGGGCCCACACG GTTTATGTAGCTTATTCTATCCAAAGCAATGCACTGAAAATGTCTCGACGGGCCCACACG
CCCCATAAACAAATAGGTTTGGTCCTAGCCTTTCTATTAGCTCTTAGTGAGGTTACACAT CCCCATAAACAAATAGGTTTGGTCCTAGCCTTTCTATTAGCTCTTAGTGAGGTTACACAT
GCAAGCATCCCCGCCCCAGTGAGTCGCCCTCCAAGTCACTCTGACTAAGAGGAGCAAGCA GCAAGCATCCCCGCCCCAGTGAGTCGCCCTCCAAGTCACTCTGACTAAGAGGAGCAAGCA
+4
View File
File diff suppressed because one or more lines are too long
+127
View File
@@ -0,0 +1,127 @@
>ref
TGCGGAGGCTGAAGCAACTCCATCTTGGAAGCTAATCTACCATGTTGGCTTCTGATTAAC
ATCAGTTCTGGGAAGGCTTGTAAGATTTCCTGTTTGTCTATTATTTCCTAGGTAAGAGCA
GATACTTACTGTAAATCCTGCCCCTAGATTAAACAACCTTGGTGTTATCGTACTTCCATT
GTCCTATACATCCCTTCGGAATCCCCCTTTCCCTATGGTCCTCAAGCCCTTGGTCTGGGG
AGTAACAGCATAGGGATCAACCATCTCGTCTTGCCACTGCCCGAAATACAGACATGGCTT
CTGTTCCTAAGTCCCTATTCAACTTTTCTTTCTAAGAAACTGGATTTGTCAGCCTCTTTC
TTCACCTCTCAGCTTCCTTGGACTTTGGGGGTAGGTTTGCGTAGACATGCTCACCACAGA
CACAATATCAGCTTCATTCTACAGATGAGGAAGGCAAGCCTTGGGGAGCTTAACCAACTT
GTCGAGACTCATGTATATACCAACACTGAAAAGCAGATATTCCAGACTCCCAGTCATGCC
ACAGGCACACCCCTCAGTGAGAGGTGGGGTTTGTAGTTGAGGCTATTTCCTGCCCAGGGA
GCAGGGAGGCACTCTAGCTTCCCTGAGCTAACGTGGTTCTGCTTGTGTCTGACTTCCAGG
TCTCTGCCCTTTCCAAGCTCACTAGGATGGGCTTCGGGTGTGTCAAATGCCTCAGACAGT
ACAGATCCACACAGAATGGGCATATGCAACCAATCAGTGTCATAAAAAAGAAGGAAATGA
CTCGGGCCCCCTGTGTGTTCAACATGTCGAAGGTATCTGTGCAGCAGAAGAAAGAGGGGC
AAAAGCCCCCAGTGCCACAGGCCAGAGGCAGCAGCTTGGGCCCATGTGGGAGGGTTTGCT
TTCCCCTGCCAAAGTGATGGGCTGCTGCAGCCTGGGGCTTGTGGGAATCCTTCCTGGGCC
TGTGTGGGAAGTGTAGGCAGGGAGAGTGCTGCTTTCCCAAGCTCATCCCAGCTACAGCTA
CCTTTGTGCTCTGGGATTCAGGACCCCCGAGGGGGCTGGCAGGAGAGTCTCTGTTCTCGG
ATGGGTTGTCACCAGGGCATACATGGGAAGTGGGCTCTCTGGAGTCACCCTCCAGGGGAC
AATGCCAATTCCAGACACATTTACTGGAACCCCTACACTGATGACCTTTTGTTGAGGGTT
GAATTATGTCCCCAAAAAAGATACATTGAAGTCCAAACCTCTGGTGTCTATAAATGTGAT
TTTATTTGAAAATGAGGTTTCTATGGACTAAATTGTGTCCCTCCCAAATTCATATTTTGA
AGCCCTAGCCCCCAGTGTGACTATACCTAGAGACAGAGATCTTTAGGAGGTAATTAAGGT
TCAATGAGGTCAGGTGGGTGGGGCCCTAAACCAACAGGAAGGACTGTGGCCTTACTAGAA
AAGGAAGAAAAAGCATTTCCTCTCTTCTAGTATAAAAGGACACAGAAAGAAGGCAGATAT
CTACAAGCCACGAAGAGAGACGTCACTGAGAACTGAATTTGTGTACATTGATCTGGAACT
TCCAGCCTCCAGAACTTGAGAAATACATTTCTGTTGTTTATTTTTTTTTCATGTAATCAA
TTCATTTATCATATATTTATTGAGTGCCTACTATGTGCCAGAGGATACAGCAGTAACAAA
ACTAGGCAAAAATTGTGCCTAAAAGAGGGAAGATGACTTTTCTTAAAGTGTGGAATAAAG
AAAAGTAAGATAGCGGATAGAAGCTTGAAGTGAAAGCAGGTTCACAGGAAGTTTCTTTGG
TCATTTGTTTTGTTTTTAAATAGTGGAAAGATGTATATGTTTATGGAGAAAGATTGCCTT
GAAGATGCAAGAGGAAGAGATGATCAAAATTCAAGAAGAAGCAGAAAGTGATAGAATAAA
GAGCACAAGTGGAGAATTAGTGTTAATGAAAAGAAGGATGCTTCCTTTGATATGAAGTGA
AGGAAGAGAGAATGAGTAAAGACCAAGACTTGAAGTCCCTAGTTTAATAGAGGGAGATTT
CTTCTTTTGATAGCAACAATGGTATTCTGAATTATTTGAAGACATGTCATATTTCTCTTG
TGCCATTTTCCTCCCAGTTTAAACATTCTCATAACCTCTATTCCTCACATGATGTTTTTC
CAGGTCCTTTATTCTTTGGCACTCTCTTCTCTGGACACATTGTATTCTGTCATTGGTCCT
AAAATTTAGATACCCACAATTGAACATACTCCTCTAGATATGGTCTAGCTAATGCAAAAG
AACTGCTGCCTTCCAACTTGTTCAGACATCATATGTTTGTTGTCAAACGCTAAGTTGAGT
TGTTATCTTTTAAGTTTTGTTTTTGTTTTTTTTTTTTTTTTTTAATTCCAAGAGGTGCCC
ACGTTGGCTAAGTACCAAACAGGGTACTAGGGAATTTTACTTCTGAGTTAAATGCCATTC
TAGTTGTTTTTTCTTCATCTCCAGTAAGGTTATCTTTATTCACCAGTTGTTACAATAGCT
GTGGGTCTTGCTTCTCACAGTTTTATGCTGTCTGTGCTATTTTCTCTACTGATCATCACC
ACAATCATTATTGCTTATCATAATTGTTATCTTTATTTTCTCCTTTAATCAAGAATCAGT
CTTCCTTTATCTCATTATTCTCTTTTGCAGGCTTCAGGATAATTATGGTTGGAGTGCACT
GGGGGAACCAGTGCAGCTAAGCTCTGACATCTTTGCATCCCTTTTCCATCTGCTGTTTTG
GCACTCTGGTAGAATAGATAACCTAAAAACGACTTTAAAACATCTAGAAATTTTGGATAA
AATATAACAAACATCCCTTTAAATGCACAACTGATCTTCCATGGAAGTCACAGAAATATA
TAACGCCAAAAAGAAGGGAAGCTGAAACCCAGGGCTGTAAACATGAACATCATCTTCTCT
CCCTTTTTCTTGTGACTTATCTTGTTTTTCTCAGCTTTGGTGCTACCAAGGCTTGACTTT
AATAGGCATTTCCAATCAATGAGAGAATTTCTTTTGCTTTCATCAACAATTCAGTTATTG
ATGTTAACATATATATCATTTGAGTACTTTTCTTTTTTTTATTATTATTATACTTTAAGT
TTTAGGGTCCATGTGCACAATGTGCAGGTTAGTTACGTATGTATACATGTGCCATGCTGG
TGTGCTGCACCCATTAACTCATCATTTAGCATTAGGTATATCTCCTAATGCTATCCCTTC
CCCCTCTCCCCACCCCACAACAGTCCCCAGAGTGTTCCCCTTCCTGTGTCCATGTGTTCT
CATTGTTCAATCCCCATCTATGAGTGAGAACATGCGGTGTTTGGTTTTTTGTCCTTGCAA
TAGTTTACTGAGAATGATGATTTCTAATTTCATCCATGTCCCTAAAGAGCTTCTGCACAG
CAAAAGAAACTACCATCAGAGTGAACAGGCAACCTACAAAATGGGAGAAAATTTTCACAA
CCTGCTCATCTGACAAAGGGCTAATATCCAGAATCTACAATGAACTCAAACAAATTTACA
AGAAAAAAACAAACAACCCCATCAAAAAGTGGGCAAAGGATATGAACAGACACTTCTCAA
AAGAAGACATTTATGCAGCCAAAAGACACATGAAAAAATGCTCATCATCACTGGCCATCA
GAGAAATGCAAACCAAAACCACAATGAGATACCATCTCACACCAGTTAAAATGGCAATCA
TTAAAAAGTCAGGAAACAACAGGTGCTGGAGAGGATGTGGAGAAACAGGAACACTTTTAC
ACTGTTGGTGGGACTGTAAACTAGTTCAACCATTGTGGAAGTCAGTGTGCTGATTCCTCA
GGGATCTAGAACTAGAAATACCATTTGACCCAGCCATCCCATTACTGGGTATATACCCAA
AGGACTATAAATCATGCTGCTATAAAGACACATGCACACGTATGTTTATTGCGGCACTAT
TCACAATAGCAAAGACTTGGAACCAACCCAAATGTCCAACAATGATAGACTGGATTAAGA
AAATGTGGCACATATACACCACGGAATACTGTGCAGCCATAAAAAATGATGAGTTCATGT
CCTTTGTAGGGACACGGATGAAATTGGAAATCATTTCTGTTGTTTAAACCACGAAGTCTA
TGGTATCTGGTTATGACAACCTGAGAATACTAACTCAAGGGTCTTTCGCAGATGTCATTA
AGTTGTTAAAGTGAGGTCATTATGGTGGGTCCTAATCCAAGAGAAGAGATGCATGGACAG
ACGTGCACAACGGGAGGACCAAGCCAAGACACACAGGGAGAATGGCCATGGGAAGATGGA
GGCAGAGATCAAAGTGAGGCACCCACAAGCCAAGAAATGGCAGGAGCTACCAGCAGCTGG
AAGATGCAGAGAAGCATTCCTTCTTAGAGGTTTCAGAGAGAGTATGGTGCTACTGACACC
TTGATTTTGAACTTCTAGTCTCCAGAACTATGAGAGAATAAATTTCTGTTGGTTAAGCCA
TCGAGTTTGTGTAAGTTTGTTATAAGAGCCCTAGGAAATAAACATATCCATTTATTCAGG
AAAGCCTGCTAGAGTGCAAATATTTGGAAAAGATACTACTATGCAAATGTTTGAAAAAGA
TATTGCTCTTGATTCTGCCTTATGGGTTTTTCATTTCTGTAAGCTATTCTCAAAGTTTTG
TTCTTGGACTACTATTGGTAATTAAGACTGCAACATGTTTGGCAACATCAGTTGAGAACT
GTTGCTCTGGGAACGTTTTCGGCAAGCCTCAGCCCTTCTTTTCCCTTGGCTTGCATTGAG
GAGTTAGGTGATACTCTGCTGCTCAGGCCCAGCACCTTTATGGACCGTATTCCCCTGGTG
GAATGACCATCTCTGCTTGCTCTGATTGGCTGTTGGGGTTTTCTAGCATGCCCTATTTAA
TATGTATGATTTATCTCTTACTTCAGTTGGAAGGTACAGTTGCTCTGTAGTTGGCATGCA
GTCATGGTGACTATGAAAATATAAAATAATGTTTTGGTTTACAGACACTTAGAAATAAGT
TGTGTCTCAAAATTGGGTGACTATTCTAGTTATCTGCTACTCAATATCCTTGTGCGAGCC
CTCTTTACCCAGAATCAAACTAAACCATGAGGGGCACTATAGAATGTCACCCCTGGGTCC
AGGATACTATGGGGACTCAGAAGCCAAGCTCCCACTGGGGGATCTAGGGCATGCCCCCAA
GGTAAGATTCCCACCTCTTTGTTCAGCAGGAAGCACCCATCACACAAGGAGGTAGGAATA
AACAAGCATTCGTCAAGAACAAAAGATACAGATGTTCTGCTGGAGCTTGGATACATAGCA
TAAGAGGGAACAGTTCTCACAGGTAAGAGTAAGTTTTCCTCTGGTGGTGACAGTGGGACC
TGTGGGGGAGAGAATTGGGAGTACTGACAGGAAGGCAGAGTGGCTGTCCAAATGAACGGA
TTGTTTGCACATGGCCTTTAGGGCACGTTGTGTTAGCCTTCCATTGCTGCTTATATTAGT
CTGTTTTCACACTGCCCATAAATGCATACCTGAGACTGGATAATTTATAAAGAAAAAGAG
CCTTAATGTACTCATAGTTGCATGTGGCTGGGGAGGCCTCACAATCATGGCAGAAGGTGA
AAGGCACATCTTACATGGAAGCAGACAAGAGAGAATTGAGGACCAAGTGAAAGGGGTTTC
CCCTTATAAAACCATCAGATCACATGAGACTTTTTCACCACCATGAGAACAGTAAGGGGA
AAACTATGCTCATGATTCAATTGTCTCCCACTGGATTCCTCCCACAACACATAGGAATTA
TGGGAGCTAAAATTCAAGATGAGATTTGGGTGAGGACACAGCCAAACCCTATCACTGCTG
TAATCAATTCCCACCAACTTAGTGGCTCGAAACATCACAGATTTATGATCTTATGACGGT
GGAGGTCCCCAAATGGATCTTCTAGGTCTAGAATCAAGGTATCAGCAGACCACTTCTTTT
GGAGGCTCTGGTGGAGAAACCATTTCCTCGCCTTTTCCAGCTTCTAGAGGCTGCCCTTCT
CATTCCTTGGTTCACGGCCACACTCATTTCCATCTCTGCTTCCACTGTGACAACTTCTCT
GCCTCAGACCCTCCTGCTTTGCCTTTGTAAGGACCCTTGTGATGAGATCAGGCCCATCCA
GGATTATCCCTCATCTCAAGACCTTTACCTTAATCACATTTGCAAGGTCTCTTCCACTGT
GTCAGGTAACATTTTCACAGGTTCCAGGGATTAGGGTGTGGACATCTTGGGGAGCTGGAG
GATATTATTTCATCTACCACACACATCTCTACCTTGTACAGGCAAGCACTTGCAAAGTGC
AATGTGATCCTCTGGAGCCACTGTCCTCCCAGAGCTTATATATACTCTGAAAGTCAACTC
TCAGACCACAGCCTCCTGTCCATGCACCACTCTCATCAACACCCCCACCCGAAACACTTT
CACTCCACCCTCTTTGTCCCCTAACTCATGGAGAAGAAAATCTAATTAGTAGGAGTGGAA
TTTGGCTTTCATCTTTACCAGTACTAGAAATATGGTGTGTGTCTTTTTGTAAAAATTCTC
TCAACTAAATTGTTTTTATTAATTTCTGCAAAATGTGAACATCAACTCCCTTCATGTGAA
TGTCAATAAGATTAAATGAGCTGTCTCAGCTCCTAGCCTGTGCAAGCTAACAGCTCAGGA
GATGTTTATTTCTTTCCCTCTTCTTTCCTTAATGAAGCCCTCTCCTTTGACATCTTCAAT
TCTGGAGCGCTTCTTTTCTGAGGCCTTGGCTCCCCCACATTGCCCACCCTTTTCCTGCTC
GTCCACATTTCTGGCTTCTATTCTCTTGTCTTTACCATCTCCCTGAACAATGTTATCCGT
TCCAATGACTTCAACAGTCTCTCCGCTTACATATGATGCCTCTCAAACTCTGATCTCCAA
CTCTTCCAAAGAGCTCTGGACCTTTGTTCCAATTACCTGAAAAACATCTTCTTGGATGTC
CCATTAGCACTGTTAAATCAAACAAGAATTTCCCTCCCTCCTGCCTTGCTGTAGTTCCCC
TAGGGATTCGGTTGTGTGGGAAGATGTGTGGAGAGCTCTTAGTTGACTCCCTTCTCTGCA
GTTCTACCTCTCTAGAGACTTGGAGGACCCACTGTTTCCGCCTCGCTTTTTCAGGCCTAG
AGATTGCTCGCTCCTGGGCTGGCTGCTTCATAATTCCTTATTAGTAGTTTCCCAAGCTTA
CATATCTGTAAATATTTACTTTAGTTAAATTCTCCCCAATTTCCACAATATGTTGGCTGC
ACATGCTTTCTACTAGGAGTCACACAACTATGATAAGAACCAAGAAATATTAGTAAACGT
TTTTTACCATTATTGGCCTATACCCTGGAATAGCCAACAATAACCTAGAACCTATGCAAC
AAGAATATCCAACAAGAACCTAGAGACCTGTCAGTCTATAGGTGGGAACTACAGGATGAG
A
+40 -15
View File
@@ -61,13 +61,6 @@
Volume = {32}, Volume = {32},
Year = {2016}} Year = {2016}}
@misc{Suzuki:2016,
title = {Fast and accurate alignment tool for PacBio and Nanopore long reads},
author = {Hajime Suzuki},
journal = {Unpublished},
howpublished = {\href{https://github.com/ocxtal/minialign}{https://github.com/ocxtal/minialign}},
year = {2016}}
@misc{Ruan:2016, @misc{Ruan:2016,
title = {Ultra-fast de novo assembler using long noisy reads}, title = {Ultra-fast de novo assembler using long noisy reads},
author = {Jue Ruan}, author = {Jue Ruan},
@@ -172,14 +165,6 @@
Volume = {29}, Volume = {29},
Year = {2011}} Year = {2011}}
@article {Suzuki130633,
author = {Suzuki, Hajime and Kasahara, Masahiro},
title = {Acceleration Of Nucleotide Semi-Global Alignment With Adaptive Banded Dynamic Programming},
year = {2017},
note = {doi:10.1101/130633},
publisher = {Cold Spring Harbor Labs Journals},
journal = {bioRxiv}}
@article{Gotoh:1982aa, @article{Gotoh:1982aa,
Author = {Gotoh, O}, Author = {Gotoh, O},
Journal = {J Mol Biol}, Journal = {J Mol Biol},
@@ -313,3 +298,43 @@
Title = {Assembling large genomes with single-molecule sequencing and locality-sensitive hashing}, Title = {Assembling large genomes with single-molecule sequencing and locality-sensitive hashing},
Volume = {33}, Volume = {33},
Year = {2015}} Year = {2015}}
@article{Gurevich:2013aa,
Author = {Gurevich, Alexey and others},
Journal = {Bioinformatics},
Pages = {1072-5},
Title = {{QUAST}: quality assessment tool for genome assemblies},
Volume = {29},
Year = {2013}}
@article{Li:2010fk,
Author = {Li, Heng and Durbin, Richard},
Journal = {Bioinformatics},
Pages = {589-95},
Title = {Fast and accurate long-read alignment with {Burrows-Wheeler} transform},
Volume = {26},
Year = {2010}}
@article{Marcais:2018aa,
Author = {Mar{\c c}ais, Guillaume and others},
Journal = {PLoS Comput Biol},
Pages = {e1005944},
Title = {{MUMmer4}: A fast and versatile genome alignment system},
Volume = {14},
Year = {2018}}
@article{Li:2009ys,
Author = {Li, Heng and others},
Journal = {Bioinformatics},
Pages = {2078-9},
Title = {The {Sequence Alignment/Map format and SAMtools}},
Volume = {25},
Year = {2009}}
@article{Suzuki:2018aa,
Author = {Suzuki, Hajime and Kasahara, Masahiro},
Journal = {BMC Bioinformatics},
Pages = {45},
Title = {Introducing difference recurrence relations for faster semi-global alignment of long sequences},
Volume = {19},
Year = {2018}}
+123 -61
View File
@@ -1,6 +1,6 @@
\documentclass{bioinfo} \documentclass{bioinfo}
\copyrightyear{2017} \copyrightyear{2018}
\pubyear{2017} \pubyear{2018}
\usepackage{graphicx} \usepackage{graphicx}
\usepackage{hyperref} \usepackage{hyperref}
@@ -19,7 +19,7 @@
\begin{document} \begin{document}
\firstpage{1} \firstpage{1}
\title[Aligning nucleotide sequences with minimap2]{Minimap2: versatile pairwise alignment for nucleotide sequences} \title[Aligning nucleotide sequences with minimap2]{Minimap2: pairwise alignment for nucleotide sequences}
\author[Li]{Heng Li} \author[Li]{Heng Li}
\address{Broad Institute, 415 Main Street, Cambridge, MA 02142, USA} \address{Broad Institute, 415 Main Street, Cambridge, MA 02142, USA}
@@ -40,9 +40,10 @@ full-length noisy Direct RNA or cDNA reads, and assembly contigs or closely
related full chromosomes of hundreds of megabases in length. Minimap2 does related full chromosomes of hundreds of megabases in length. Minimap2 does
split-read alignment, employs concave gap cost for long insertions and split-read alignment, employs concave gap cost for long insertions and
deletions (INDELs) and introduces new heuristics to reduce spurious alignments. deletions (INDELs) and introduces new heuristics to reduce spurious alignments.
It is 3--4 times faster than mainstream short-read mappers at comparable It is 3--4 times as fast as mainstream short-read mappers at comparable
accuracy and $\ge$30 times faster at higher accuracy for both genomic and mRNA accuracy, and is $\ge$30 times faster than long-read genomic or cDNA
reads, surpassing most aligners specialized in one type of alignment. mappers at higher accuracy, surpassing most aligners specialized in one type of
alignment.
\section{Availability and implementation:} \section{Availability and implementation:}
\href{https://github.com/lh3/minimap2}{https://github.com/lh3/minimap2} \href{https://github.com/lh3/minimap2}{https://github.com/lh3/minimap2}
@@ -63,7 +64,7 @@ the thought that 10kb long sequences should be easier to map than 100bp reads
because we can more effectively skip repetitive regions, which are often the because we can more effectively skip repetitive regions, which are often the
bottleneck of short-read alignment. We confirmed our speculation by achieving bottleneck of short-read alignment. We confirmed our speculation by achieving
approximate mapping 50 times faster than BWA-MEM~\citep{Li:2016aa}. approximate mapping 50 times faster than BWA-MEM~\citep{Li:2016aa}.
\citet{Suzuki130633} extended our work with a fast and novel algorithm on \citet{Suzuki:2018aa} extended our work with a fast and novel algorithm on
generating base-level alignment, which in turn inspired us to develop minimap2 generating base-level alignment, which in turn inspired us to develop minimap2
with added functionality. with added functionality.
@@ -87,12 +88,14 @@ the versatility of minimap2.
Minimap2 follows a typical seed-chain-align procedure as is used by most Minimap2 follows a typical seed-chain-align procedure as is used by most
full-genome aligners. It collects minimizers~\citep{Roberts:2004fv} of the full-genome aligners. It collects minimizers~\citep{Roberts:2004fv} of the
reference sequences and indexes them in a hash table. Then for each query reference sequences and indexes them in a hash table, with the key being the
sequence, minimap2 takes query minimizers as \emph{seeds}, finds matches to the hash of a minimizer and the value being a list of locations of the minimizer
reference, and identifies sets of colinear seeds, which are called copies. Then for each query
sequence, minimap2 takes query minimizers as \emph{seeds}, finds exact matches
(i.e. \emph{anchors}) to the reference, and identifies sets of colinear anchors as
\emph{chains}. If base-level alignment is requested, minimap2 applies dynamic \emph{chains}. If base-level alignment is requested, minimap2 applies dynamic
programming (DP) to extend from the ends of chains and to close unseeded programming (DP) to extend from the ends of chains and to close
regions between adjacent seeds in chains. regions between adjacent anchors in chains.
Minimap2 uses indexing and seeding algorithms similar to Minimap2 uses indexing and seeding algorithms similar to
minimap~\citep{Li:2016aa}, and furthers the predecessor with more accurate minimap~\citep{Li:2016aa}, and furthers the predecessor with more accurate
@@ -119,10 +122,13 @@ distance between two anchors is too large); otherwise
\end{equation} \end{equation}
In implementation, a gap of length $l$ costs In implementation, a gap of length $l$ costs
\[ \[
\gamma_c(l)=0.01\cdot \bar{w}\cdot|l|+0.5\log_2|l| \gamma_c(l)=\left\{\begin{array}{ll}
0.01\cdot \bar{w}\cdot|l|+0.5\log_2|l| & (l\not=0) \\
0 & (l=0)
\end{array}\right.
\] \]
where $\bar{w}$ is the average seed length. For $m$ anchors, directly computing all $f(\cdot)$ with where $\bar{w}$ is the average seed length. For $N$ anchors, directly computing all $f(\cdot)$ with
Eq.~(\ref{eq:chain}) takes $O(m^2)$ time. Although theoretically faster Eq.~(\ref{eq:chain}) takes $O(N^2)$ time. Although theoretically faster
chaining algorithms exist~\citep{Abouelhoda:2005aa}, they chaining algorithms exist~\citep{Abouelhoda:2005aa}, they
are inapplicable to generic gap cost, complex to implement and usually are inapplicable to generic gap cost, complex to implement and usually
associated with a large constant. We introduced a simple heuristic to associated with a large constant. We introduced a simple heuristic to
@@ -132,7 +138,7 @@ We note that if anchor $i$ is chained to $j$, chaining $i$ to a predecessor
of $j$ is likely to yield a lower score. When evaluating Eq.~(\ref{eq:chain}), of $j$ is likely to yield a lower score. When evaluating Eq.~(\ref{eq:chain}),
we start from anchor $i-1$ and stop the process if we cannot find a better we start from anchor $i-1$ and stop the process if we cannot find a better
score after up to $h$ iterations. This approach reduces the average time to score after up to $h$ iterations. This approach reduces the average time to
$O(h\cdot m)$. In practice, we can almost always find the optimal chain with $O(hN)$. In practice, we can almost always find the optimal chain with
$h=50$; even if the heuristic fails, the optimal chain is often close. $h=50$; even if the heuristic fails, the optimal chain is often close.
\subsubsection{Backtracking} \subsubsection{Backtracking}
@@ -146,9 +152,11 @@ in more than one chains.
\subsubsection{Identifying primary chains}\label{sec:primary} \subsubsection{Identifying primary chains}\label{sec:primary}
In the absence of copy number changes, each query segment should not be mapped In the absence of copy number changes, each query segment should not be mapped
to two places in the reference. However, chains found at the previous step may to two places in the reference. However, chains found at the previous step may
have significant or complete overlaps due to repeats in the reference. have significant or complete overlaps due to repeats in the reference~\citep{Li:2010fk}.
Minimap2 used the following procedure to identify \emph{primary chains} that do Minimap2 used the following procedure to identify \emph{primary chains} that do
not greatly overlap on the query. Let $Q$ be an empty set initially. For each not greatly overlap on the query.
Let $Q$ be an empty set initially. For each
chain from the best to the worst according to their chaining scores: if on the chain from the best to the worst according to their chaining scores: if on the
query, the chain overlaps with a chain in $Q$ by 50\% or higher percentage of query, the chain overlaps with a chain in $Q$ by 50\% or higher percentage of
the shorter chain, mark the chain as secondary to the chain in $Q$; otherwise, the shorter chain, mark the chain as secondary to the chain in $Q$; otherwise,
@@ -156,6 +164,16 @@ add the chain to $Q$. In the end, $Q$ contains all the primary chains. We did
not choose a more sophisticated data structure (e.g. range tree or k-d tree) not choose a more sophisticated data structure (e.g. range tree or k-d tree)
because this step is not the performance bottleneck. because this step is not the performance bottleneck.
For each primary chain, minimap2 estimates its mapping quality with an
empirical formula:
\[
{\rm mapQ}=40\cdot (1-f_2/f_1)\cdot\min\{1,m/10\}\cdot\log f_1
\]
where $\log$ denotes natural logarithm, $m$ is the number of anchors on the primary chain, $f_1$ is the chaining
score, and $f_2\le f_1$ is the score of the best chain that is secondary to the
primary chain. Intuitively, a chain is assigned to a higher mapping quality if
it is long and its best secondary chain is weak.
\subsubsection{Estimating per-base sequence divergence} \subsubsection{Estimating per-base sequence divergence}
Suppose a query sequence harbors $n$ seeds of length $k$, $m$ of which are Suppose a query sequence harbors $n$ seeds of length $k$, $m$ of which are
present in a chain. We want to estimate the sequence divergence $\epsilon$ present in a chain. We want to estimate the sequence divergence $\epsilon$
@@ -186,7 +204,7 @@ $0.9$.
\subsubsection{Indexing with homopolymer compressed $k$-mers} \subsubsection{Indexing with homopolymer compressed $k$-mers}
SmartDenovo SmartDenovo
(\href{https://github.com/ruanjue/smartdenovo}{https://github.com/ruanjue/smartdenovo}; (\href{https://github.com/ruanjue/smartdenovo}{https://github.com/ruanjue/smartdenovo};
J Ruan, personal communication) indexes reads with homopolymer-compressed (HPC) J. Ruan, personal communication) indexes reads with homopolymer-compressed (HPC)
$k$-mers and finds the strategy improves overlap sensitivity for SMRT reads. $k$-mers and finds the strategy improves overlap sensitivity for SMRT reads.
Minimap2 adopts the same heuristic. Minimap2 adopts the same heuristic.
@@ -199,9 +217,9 @@ To demonstrate the effectiveness of HPC $k$-mers, we performed read overlapping
for the example {\it E. coli} SMRT reads from PBcR~\citep{Berlin:2015xy}, using for the example {\it E. coli} SMRT reads from PBcR~\citep{Berlin:2015xy}, using
different types of $k$-mers. With normal 15bp minimizers per 5bp window, different types of $k$-mers. With normal 15bp minimizers per 5bp window,
minimap2 finds 90.9\% of $\ge$2kb overlaps inferred from the read-to-reference minimap2 finds 90.9\% of $\ge$2kb overlaps inferred from the read-to-reference
alignment. With HPC 19-mers, minimap2 finds 97.4\% of overlaps. It achieves this alignment. With HPC 19-mers per 5bp window, minimap2 finds 97.4\% of overlaps. It achieves this
higher sensitivity by indexing 1/3 fewer minimizers, which further helps higher sensitivity by indexing 1/3 fewer minimizers, which further helps
performance. HPC-based indexing reduces the sensitivity for ONT reads, though. performance. HPC-based indexing reduces the sensitivity for current ONT reads, though.
\subsection{Aligning genomic DNA}\label{sec:genomic} \subsection{Aligning genomic DNA}\label{sec:genomic}
@@ -240,14 +258,14 @@ performance of minimap2. Traditional SSE implementations~\citep{Farrar:2007hs}
based on Eq.~(\ref{eq:ae86}) can achieve 16-way parallelization for short based on Eq.~(\ref{eq:ae86}) can achieve 16-way parallelization for short
sequences, but only 4-way parallelization when the peak alignment score reaches sequences, but only 4-way parallelization when the peak alignment score reaches
32767. Long sequence alignment may exceed this threshold. Inspired by 32767. Long sequence alignment may exceed this threshold. Inspired by
\citet{Wu:1996aa} and the following work, \citet{Suzuki130633} proposed a \citet{Wu:1996aa} and the following work, \citet{Suzuki:2018aa} proposed a
difference-based formulation that lifted this limitation. difference-based formulation that lifted this limitation.
In case of 2-piece gap cost, define In case of 2-piece gap cost, define
\[ \[
\left\{\begin{array}{ll} \left\{\begin{array}{ll}
u_{ij}\triangleq H_{ij}-H_{i-1,j} & v_{ij}\triangleq H_{ij}-H_{i,j-1} \\ u_{ij}\triangleq H_{ij}-H_{i-1,j} & v_{ij}\triangleq H_{ij}-H_{i,j-1} \\
x_{ij}\triangleq E_{i+1,j}-H_{ij} & \tilde{x}_{ij}\triangleq \tilde{E}_{i+1,j}-\tilde{H}_{ij} \\ x_{ij}\triangleq E_{i+1,j}-H_{ij} & \tilde{x}_{ij}\triangleq \tilde{E}_{i+1,j}-H_{ij} \\
y_{ij}\triangleq F_{i,j+1}-H_{ij} & \tilde{y}_{ij}\triangleq \tilde{F}_{i,j+1}-\tilde{H}_{ij} y_{ij}\triangleq F_{i,j+1}-H_{ij} & \tilde{y}_{ij}\triangleq \tilde{F}_{i,j+1}-H_{ij}
\end{array}\right. \end{array}\right.
\] \]
We can transform Eq.~(\ref{eq:ae86}) to We can transform Eq.~(\ref{eq:ae86}) to
@@ -307,11 +325,11 @@ y_{rt}&=&\max\{0,y_{r-1,t}+u_{r-1,t}-z_{rt}+q\}-q-e\\
\end{equation*} \end{equation*}
In this formulation, cells with the same diagonal index $r$ are independent of In this formulation, cells with the same diagonal index $r$ are independent of
each other. This allows us to fully vectorize the computation of all cells on each other. This allows us to fully vectorize the computation of all cells on
the same anti-diagonal in one inner loop. It also simplifies banded alignment, the same anti-diagonal in one inner loop. It also simplifies banded alignment (500bp band width by default),
which would be difficult with striped vectorization~\citep{Farrar:2007hs}. which would be difficult with striped vectorization~\citep{Farrar:2007hs}.
On the condition that $q+e<\tilde{q}+\tilde{e}$ and $e>\tilde{e}$, the initial On the condition that $q+e<\tilde{q}+\tilde{e}$ and $e>\tilde{e}$, the initial
values in the diagonal-antidiagonal formuation is values in the diagonal-antidiagonal formuation are
\[ \[
\left\{\begin{array}{l} \left\{\begin{array}{l}
x_{r-1,-1}=y_{r-1,r}=-q-e\\ x_{r-1,-1}=y_{r-1,r}=-q-e\\
@@ -330,12 +348,19 @@ r\cdot(e-\tilde{e})-(\tilde{q}-q)-\tilde{e} & (r=\lceil\frac{\tilde{q}-q}{e-\til
\] \]
These can be derived from the initial values for Eq.~(\ref{eq:ae86}). These can be derived from the initial values for Eq.~(\ref{eq:ae86}).
When performing global alignment, we do not need to compute $H_{rt}$ in each cell.
We use 16-way vectorization throughout the alignment process. When extending
alignments from ends of chains, we need to find the cell $(r,t)$ where $H_{rt}$
reaches the maximum. We resort to 4-way vectorization to compute
$H_{rt}=H_{r-1,t}+u_{rt}$. Because this computation is simple,
Eq.~(\ref{eq:suzuki}) is still the dominant performance bottleneck.
In practice, our 16-way vectorized implementation of global alignment is three In practice, our 16-way vectorized implementation of global alignment is three
times as fast as Parasail's 4-way vectorization~\citep{Daily:2016aa}. Without times as fast as Parasail's 4-way vectorization~\citep{Daily:2016aa}. Without
banding, our implementation is slower than Edlib~\citep{Sosic:2017aa}, but with banding, our implementation is slower than Edlib~\citep{Sosic:2017aa}, but with
a 1000bp band, it is considerably faster. When performing global alignment a 1000bp band, it is considerably faster. When performing global alignment
between anchors, we expect the alignment to stay close to the diagonal of the between anchors, we expect the alignment to stay close to the diagonal of the
DP matrix. Banding is applicable most of time. DP matrix. Banding is applicable most of the time.
\subsubsection{The Z-drop heuristic} \subsubsection{The Z-drop heuristic}
@@ -359,6 +384,16 @@ alignment between the two subsequences involved in the global alignment, but
this time with the one subsequence reverse complemented. This additional this time with the one subsequence reverse complemented. This additional
alignment step may identify short inversions that are missed during chaining. alignment step may identify short inversions that are missed during chaining.
\subsubsection{Filtering out misplaced anchors}
Due to sequencing errors and local homology, some anchors in a chain may be
wrong. If we blindly align regions between two misplaced anchors, we will
produce a suboptimal alignment. To reduce this artifact, we filter out
anchors that lead to a $>$10bp insertion and a $>$10bp deletion at the same
time, and filter out terminal anchors that lead to a long gap towards the ends
of a chain. These heuristics greatly alleviate the issues with misplaced
anchors, but they are unable to fix all such errors. Local misalignment is a
limitation of minimap2 which we hope to address in future.
\subsection{Aligning spliced sequences} \subsection{Aligning spliced sequences}
The algorithm described above can be adapted to spliced alignment. In this The algorithm described above can be adapted to spliced alignment. In this
@@ -397,7 +432,7 @@ p/2 & \mbox{if $T[i+1,i+3]$ is ${\tt GTC}$ or ${\tt GTT}$} \\
p & \mbox{otherwise} p & \mbox{otherwise}
\end{array}\right.\] \end{array}\right.\]
where $T[i,j]$ extracts a substring of $T$ between $i$ and $j$ inclusively. where $T[i,j]$ extracts a substring of $T$ between $i$ and $j$ inclusively.
$d(i)$ penalizes non-canonical donor sites with $p$ and less frequent Eukayotic $d(i)$ penalizes non-canonical donor sites with $p$ and less frequent Eukaryotic
splicing signal ${\tt GT[C/T]}$ with $p/2$~\citep{Irimia:2008aa}. Similarly, splicing signal ${\tt GT[C/T]}$ with $p/2$~\citep{Irimia:2008aa}. Similarly,
\[a(i)=\left\{\begin{array}{ll} \[a(i)=\left\{\begin{array}{ll}
0 & \mbox{if $T[i-2,i]$ is ${\tt CAG}$ or ${\tt TAG}$} \\ 0 & \mbox{if $T[i-2,i]$ is ${\tt CAG}$ or ${\tt TAG}$} \\
@@ -424,13 +459,13 @@ alignment.
\subsection{Aligning short paired-end reads} \subsection{Aligning short paired-end reads}
During chainging, minimap2 takes a pair of reads as one fragment with a gap of During chaining, minimap2 takes a pair of reads as one fragment with a gap of
unknown length in the middle. It applies a normal gap cost between seeds on the unknown length in the middle. It applies a normal gap cost between seeds on the
same read but is a more permissive gap cost between seeds on different reads. same read but is a more permissive gap cost between seeds on different reads.
More precisely, the gap cost during chaining is: More precisely, the gap cost during chaining is ($l\not=0$):
\[ \[
\gamma_c(l)=\left\{\begin{array}{ll} \gamma_c(l)=\left\{\begin{array}{ll}
0.01\cdot\bar{w}\cdot l+0.5\log_2 l & \mbox{if two seeds on the same read} \\ 0.01\cdot\bar{w}\cdot |l|+0.5\log_2 |l| & \mbox{if two seeds on the same read} \\
\min\{0.01\cdot\bar{w}\cdot|l|,\log_2|l|\} & \mbox{otherwise} \min\{0.01\cdot\bar{w}\cdot|l|,\log_2|l|\} & \mbox{otherwise}
\end{array}\right. \end{array}\right.
\] \]
@@ -443,6 +478,17 @@ consistent paired-end alignments.
\section{Results} \section{Results}
Minimap2 is implemented in the C programming language and comes with APIs in
both C and Python. It is distributed under the MIT license, free to both
commercial and academic uses. Minimap2 uses the same base algorithm for all
applications, but it has to apply different sets of parameters depending on
input data types. Similar to BWA-MEM, minimap2 introduces `presets' that
modify multiple parameters with a simple invocation. Detailed settings
and command-line options can be found in the minimap2 manpage. In addition to
the applications evaluated in the following sections, minimap2 also retains
minimap's functionality to find overlaps between long reads and to search
against large multi-species databases such as \emph{nt} from NCBI.
\subsection{Aligning long genomic reads}\label{sec:long-genomic} \subsection{Aligning long genomic reads}\label{sec:long-genomic}
\begin{figure}[!tb] \begin{figure}[!tb]
@@ -450,19 +496,22 @@ consistent paired-end alignments.
\includegraphics[width=.5\textwidth]{roc-color.pdf} \includegraphics[width=.5\textwidth]{roc-color.pdf}
\caption{Evaluation on aligning simulated reads. Simulated reads were mapped \caption{Evaluation on aligning simulated reads. Simulated reads were mapped
to the primary assembly of human genome GRCh38. A read is considered correctly to the primary assembly of human genome GRCh38. A read is considered correctly
mapped if the true position overlaps with the best mapping position by 10\% of mapped if its longest alignment overlaps with the true interval, and the
the read length. Read alignments are sorted by mapping quality in the overlap length is $\ge$10\% of the true interval length. Read alignments are
descending order. For each mapping quality threshold, the fraction of sorted by mapping quality in the descending order. For each mapping quality
alignments with mapping quality above the threshold and their error rate are threshold, the fraction of alignments (out of the number of input reads) with
mapping quality above the threshold and their error rate are
plotted along the curve. (a) long-read alignment evaluation. 33,088 $\ge$1000bp plotted along the curve. (a) long-read alignment evaluation. 33,088 $\ge$1000bp
reads were simulated using pbsim~\citep{Ono:2013aa} with error profile sampled reads were simulated using pbsim~\citep{Ono:2013aa} with error profile sampled
from file `m131017\_060208\_42213\_*.1.*' downloaded at from file `m131017\_060208\_42213\_*.1.*' downloaded at
\href{http://bit.ly/chm1p5c3}{http://bit.ly/chm1p5c3}. The N50 read length is \href{http://bit.ly/chm1p5c3}{http://bit.ly/chm1p5c3}. The N50 read length is
11,628. Aligners were run under the default setting for SMRT reads. 11,628. Aligners were run under the default setting for SMRT reads.
(b) short-read alignment evaluation. 10 million pairs of 150bp reads were Kart outputted all alignments at mapping quality 60, so is not shown in the
simulated using mason2~\citep{Holtgrewe:2010aa} with option figure. It mapped nearly all reads with 4.1\% of alignments being wrong, less
`\mbox{--illumina-prob-mismatch-scale 2.5}'. Short-read aligners were run under the accurate than others. (b) short-read alignment evaluation. 10 million pairs of
default setting except for changing the maximum fragment length to 150bp reads were simulated using mason2~\citep{Holtgrewe:2010aa} with option
`\mbox{--illumina-prob-mismatch-scale 2.5}'. Short-read aligners were run under
the default setting except for changing the maximum fragment length to
800bp.}\label{fig:eval} 800bp.}\label{fig:eval}
\end{figure} \end{figure}
@@ -471,7 +520,7 @@ BLASR~(v1.MC.rc64; \citealp{Chaisson:2012aa}),
BWA-MEM~(v0.7.15; \citealp{Li:2013aa}), BWA-MEM~(v0.7.15; \citealp{Li:2013aa}),
GraphMap~(v0.5.2; \citealp{Sovic:2016aa}), GraphMap~(v0.5.2; \citealp{Sovic:2016aa}),
Kart~(v2.2.5; \citealp{Lin:2017aa}), Kart~(v2.2.5; \citealp{Lin:2017aa}),
minialign~(v0.5.3; \citealp{Suzuki:2016}) and minialign~(v0.5.3; \href{https://github.com/ocxtal/minialign}{https://github.com/ocxtal/minialign}) and
NGMLR~(v0.2.5; \citealp{Sedlazeck169557}). We excluded rHAT~\citep{Liu:2016ab} NGMLR~(v0.2.5; \citealp{Sedlazeck169557}). We excluded rHAT~\citep{Liu:2016ab}
and LAMSA~\citep{Liu:2017aa} because they either and LAMSA~\citep{Liu:2017aa} because they either
crashed or produced malformatted output. In this evaluation, minimap2 has crashed or produced malformatted output. In this evaluation, minimap2 has
@@ -480,11 +529,11 @@ higher mapping accuracy (Fig.~\ref{fig:eval}a). Minimap2 and
NGMLR provide better mapping quality estimate: they rarely give repetitive hits NGMLR provide better mapping quality estimate: they rarely give repetitive hits
high mapping quality. Apparently, other aligners may high mapping quality. Apparently, other aligners may
occasionally miss close suboptimal hits and be overconfident in wrong mappings. occasionally miss close suboptimal hits and be overconfident in wrong mappings.
On run time, minialign is slightly faster than minimap2 and Kart. They are over On run time, minimap2 took 200 CPU seconds, comparable to minialign and Kart, and is over
30 times faster than the rest. Minimap2 consumed 6.1GB memory at the peak, 30 times faster than the rest. Minimap2 consumed 6.8GB memory at the peak,
more than BWA-MEM but less than others. more than BWA-MEM (5.4GB), similar to NGMLR and less than others.
On real human SMRT reads, the relative performance and sensitivity of On real human SMRT reads, the relative performance and fraction of mapped reads reported by
these aligners are broadly similar to the metrics on simulated data. We are these aligners are broadly similar to the metrics on simulated data. We are
unable to provide a good estimate of mapping error rate due to the lack of the unable to provide a good estimate of mapping error rate due to the lack of the
truth. On ONT $\sim$100kb human reads~\citep{Jain128835}, BWA-MEM failed. truth. On ONT $\sim$100kb human reads~\citep{Jain128835}, BWA-MEM failed.
@@ -526,7 +575,7 @@ Peak RAM (GByte) & 8.9 & 14.5 & 3.2 & 29.2\vspace{1em}\\
\% approx. introns & 91.8\% & 96.9\% & 92.5\% & 82.4\% \\ \% approx. introns & 91.8\% & 96.9\% & 92.5\% & 82.4\% \\
\botrule \botrule
\end{tabular} \end{tabular}
}{Mouse reads (AC:SRR5286960) were mapped to the primary assembly of mouse }{Mouse cDNA reads (AC:SRR5286960; R9.4 chemistry) were mapped to the primary assembly of mouse
genome GRCm38 with the following tools and command options: minimap2 (`-ax genome GRCm38 with the following tools and command options: minimap2 (`-ax
splice'); GMAP (`-n 0 --min-intronlength 30 --cross-species'); SpAln (`-Q7 -LS splice'); GMAP (`-n 0 --min-intronlength 30 --cross-species'); SpAln (`-Q7 -LS
-S3'); STARlong (according to -S3'); STARlong (according to
@@ -535,7 +584,7 @@ compared to the EnsEMBL gene annotation, release 89. A predicted intron
is \emph{novel} if it has no overlaps with any annotated introns. An intron is \emph{novel} if it has no overlaps with any annotated introns. An intron
is \emph{exact} if it is identical to an annotated intron. An intron is is \emph{exact} if it is identical to an annotated intron. An intron is
\emph{approximate} if both its 5'- and 3'-end are within 10bp around the ends \emph{approximate} if both its 5'- and 3'-end are within 10bp around the ends
of an annotated intron.} of an annotated intron. Chimeric alignments are defined in the SAM spec~\citep{Li:2009ys}.}
\end{table} \end{table}
We next aligned real mouse reads~\citep{Byrne:2017aa} with GMAP~(v2017-06-20; We next aligned real mouse reads~\citep{Byrne:2017aa} with GMAP~(v2017-06-20;
@@ -592,7 +641,7 @@ simulated data set than Bowtie2 and SNAP but less accurate than BWA-MEM
(Fig.~\ref{fig:eval}b). Closer investigation reveals that BWA-MEM achieves (Fig.~\ref{fig:eval}b). Closer investigation reveals that BWA-MEM achieves
a higher accuracy partly because it tries to locally align a read in a small a higher accuracy partly because it tries to locally align a read in a small
region close to its mate. If we disable this feature, BWA-MEM becomes slightly region close to its mate. If we disable this feature, BWA-MEM becomes slightly
less accurate than minimap2. We might consider to implement a similar heuristic less accurate than minimap2. We might implement a similar heuristic
in minimap2 in future. in minimap2 in future.
To evaluate the accuracy of minimap2 on real data, we aligned human reads To evaluate the accuracy of minimap2 on real data, we aligned human reads
@@ -603,19 +652,29 @@ across the whole genome and have been \emph{de novo} assembled with SMRT reads
to high quality. This allowed us to construct an independent truth variant to high quality. This allowed us to construct an independent truth variant
dataset~\citep{Li223297} for dataset~\citep{Li223297} for
ERR1341796. In this evaluation, minimap2 has higher SNP false negative rate ERR1341796. In this evaluation, minimap2 has higher SNP false negative rate
(FNR; 2.5\% of minimap2 vs 2.2\% of BWA-MEM), but fewer false positive SNPs per (FNR; 2.6\% of minimap2 vs 2.3\% of BWA-MEM), but fewer false positive SNPs per
million bases (FPPM; 3.0 vs 3.9), lower 2--50bp INDEL FNR (7.3\% vs 7.5\%) and million bases (FPPM; 7.0 vs 8.8), similar INDEL FNR (11.2\% vs 11.3\%) and
similar INDEL FPPM (both 1.0). Minimap2 is broadly similar to BWA-MEM in the similar INDEL FPPM (6.4 vs 6.5). Minimap2 is broadly comparable to BWA-MEM in the
context of small variant calling. context of small variant calling.
\subsection{Other applications} \subsection{Aligning long-read assemblies}
Minimap2 retains minimap's functionality to find overlaps between long reads Minimap2 can align a SMRT assembly (AC:GCA\_001297185.1) against GRCh38 in 7
and to search against large multi-species databases such as \emph{nt} from minutes using 8 CPU cores, over 20 times faster than nucmer from
NCBI. Minimap2 can also align similar genomes or different assemblies of the MUMmer4~\citep{Marcais:2018aa}. With the paftools.js script from the minimap2
same species. It took 7 wall-clock minutes over 8 CPU cores to align a human package, we called 2.67 million single-base substitutions out of 2.78Gbp
SMRT assembly (AC:GCA\_001297185.1) to GRCh38, over 20 times faster genomic regions. The transition-to-transversion ratio (ts/tv) is 2.01. In
MUMmer4~\citep{Kurtz:2004zr}. comparison, using MUMmer4's dnadiff pipeline, we called 2.86 million
substitutions in 2.83Gbp at ts/tv=1.87. Given that ts/tv averaged across the
human genome is about 2 but ts/tv averaged over random errors is 0.5, the
minimap2 callset arguably has higher precision at lower sensitivity.
The sample being assembled is a female. Minimap2 still called 201 substitutions
on the Y chromosome. These substitutions all come from one contig aligned at
96.8\% sequence identity. The contig could be a segmental duplication
absent from GRCh38. In constrast, dnadiff called 9070 substitutions on the Y
chromosome across 73 SMRT contigs. This again implies our minimap2-based
pipeline has higher precision.
\section{Discussions} \section{Discussions}
@@ -633,9 +692,9 @@ involving $>$100kb introns, which was impractically slow ten years ago. The
minimap2 chaining algorithm is fast and highly accurate by itself. In fact, minimap2 chaining algorithm is fast and highly accurate by itself. In fact,
chaining alone is more accurate than all the other long-read mappers in chaining alone is more accurate than all the other long-read mappers in
Fig.~\ref{fig:eval}a (data not shown). This accuracy helps to reduce downstream Fig.~\ref{fig:eval}a (data not shown). This accuracy helps to reduce downstream
base-level alignment of candidate chains, which is still times slower than base-level alignment of candidate chains, which is still several times slower than
chaining even with the Suzuki-Kasahara improvement. In addition, taking a chaining even with the Suzuki-Kasahara improvement. In addition, taking a
general form, minimap2 chaining can be adapted to non-typical data types such general form, minimap2 chaining can be adapted to non-typical data types such as
spliced reads and multiple reads per fragment. This gives us the opportunity to spliced reads and multiple reads per fragment. This gives us the opportunity to
extend the same base algorithm to a variety of use cases. extend the same base algorithm to a variety of use cases.
@@ -647,8 +706,9 @@ k-mers with a hash table instead. Such fixed-length seeds are inferior to
variable-length seeds in theory, but can be computed much more efficiently in variable-length seeds in theory, but can be computed much more efficiently in
practice. When a query sequence has multiple seed hits, we can afford to skip practice. When a query sequence has multiple seed hits, we can afford to skip
highly repetitive seeds without affecting the final accuracy. This further highly repetitive seeds without affecting the final accuracy. This further
alleviates the concern with the uniqueness of seeds. Hash table is the ideal alleviates the concern with the seeding uniqueness. At the same time, at low
data structure for mapping long query sequences. sequence identity, it is rare to see long seeds anyway. Hash table is the ideal
data structure for mapping long noisy sequences.
\section*{Acknowledgements} \section*{Acknowledgements}
We owe a debt of gratitude to H. Suzuki and M. Kasahara for releasing their We owe a debt of gratitude to H. Suzuki and M. Kasahara for releasing their
@@ -657,6 +717,8 @@ Schatz, P. Rescheneder and F. Sedlazeck for pointing out the limitation of
BWA-MEM. We are also grateful to minimap2 users who have greatly helped to BWA-MEM. We are also grateful to minimap2 users who have greatly helped to
suggest features and to fix various issues. suggest features and to fix various issues.
\paragraph{Funding\textcolon} NHGRI 1R01HG010040-01
\bibliography{minimap2} \bibliography{minimap2}
\end{document} \end{document}