Compare commits

...
38 Commits
Author SHA1 Message Date
Heng Li 2d7ec75d50 Release minimap2-2.10 (r761) 2018-03-27 11:45:44 -04:00
Heng Li 7938ed4893 fixed two mappy warnings 2018-03-26 15:12:54 -04:00
Heng Li 4740423afa Merge remote-tracking branch 'origin/master' 2018-03-26 14:37:17 -04:00
Heng Li 1776311a9b updated cookbook 2018-03-26 14:37:02 -04:00
Heng Li c1a3e05cb0 Merge pull request #138 from zingdle/patch-1
Fix typo in README.md
2018-03-26 07:50:39 -04:00
zingdle ecb6703d4a Update README.md
Fix typo.
TD;DR -> TL;DR
2018-03-26 14:54:52 +08:00
Heng Li 0bf97a367b r755: junceval to only evaluate chromosomes 2018-03-24 23:10:06 -04:00
Heng Li 1c504d72e4 r754: option to only change name 2018-03-23 12:27:11 -04:00
Heng Li 5ef9580b17 r753: change bandwidth in ava-ont to 2000bp 2018-03-23 10:15:23 -04:00
Heng Li 08bd2123b6 r752: option to copy comments to output (#136) 2018-03-23 10:04:33 -04:00
Heng Li 8766d286df r751: optionally output MD (#118) 2018-03-22 14:15:33 -04:00
Heng Li 623b5d9d48 r750: check puts() return (#132 & #103) 2018-03-22 11:31:58 -04:00
Heng Li 18659118cd r749: don't print version etc at low verbose 2018-03-22 11:10:55 -04:00
Heng Li d1050f4eaf r748: optionally to use system getopt() (#134) 2018-03-19 11:18:26 -04:00
Heng Li b81d45510e Revision v2 2018-03-16 11:18:06 -04:00
Heng Li d135feb1a5 response to reviewers' comments, round 2 2018-03-15 21:59:57 -04:00
Heng Li 242ff4e91d r745: junceval - recognize "-" as file name 2018-03-15 12:51:46 -04:00
Heng Li 7a0c1316ce added more examples to cookbook 2018-03-12 22:24:22 -04:00
Heng Li 77ebd479f4 r743: added VCF output to "call" 2018-03-12 21:51:31 -04:00
Heng Li e3f226a9d9 working on section "Full-Genome Alignment"
found an apparent bug in paftools.js call. To debug...
2018-03-12 16:12:18 -04:00
Heng Li bdc615c1d4 r741: added --min-occ-floor to improve #107 2018-03-12 14:32:27 -04:00
Heng Li ad1beaf255 backup; not finished 2018-03-12 13:20:25 -04:00
Heng Li de0480ac5b finished section "Read Overlap" 2018-03-12 13:05:51 -04:00
Heng Li f2866533a8 finished "mapping genomic reads" 2018-03-12 12:50:21 -04:00
Heng Li 0173850ef0 don't use bullets - they are hard to read 2018-03-12 12:42:13 -04:00
Heng Li acea3594fb updated cookbook 2018-03-12 12:39:57 -04:00
Heng Li f78a247749 Started to work on a cookbook 2018-03-12 12:00:44 -04:00
Heng Li ccaf12e1a2 r734: removed debugging print in call() 2018-03-09 23:46:21 -05:00
Heng Li 96b132c97d fixed a bug/typo in Aligner.seq() (#126) 2018-03-08 19:12:12 -05:00
Heng Li 70428ca3a8 speedup tag parsing for sam2paf 2018-03-02 10:17:55 -05:00
Heng Li 9aea79d621 faster tag parsing 2018-03-02 10:09:14 -05:00
Heng Li 1770988627 make calling work with sam2paf output 2018-03-02 10:03:06 -05:00
Heng Li 2bfdad34bb minor cleanup to last commit 2018-03-02 01:07:37 -05:00
Heng Li 953766cedd generate cs; not carefully tested 2018-03-02 00:14:55 -05:00
Heng Li dc61301d9f sam2paf cleanup 2018-03-01 21:58:12 -05:00
Heng Li 19e05a099d for clarity 2018-03-01 18:25:29 -05:00
Heng Li 0238caa8b1 clarify minimap2 not working for >2Gbp seq #129 2018-03-01 18:23:40 -05:00
Heng Li a22ebb9836 use SSE compiler flags more precisely (#127) 2018-02-26 09:51:01 -05:00
21 changed files with 778 additions and 177 deletions
+17 -12
View File
@@ -6,16 +6,16 @@ PROG= minimap2
PROG_EXTRA= sdust minimap2-lite PROG_EXTRA= sdust minimap2-lite
LIBS= -lm -lz -lpthread LIBS= -lm -lz -lpthread
ifeq ($(arm_neon),) ifeq ($(arm_neon),) # if arm_neon is not defined
ifeq ($(sse2only),) ifeq ($(sse2only),) # if sse2only is not defined
OBJS+=ksw2_extz2_sse41.o ksw2_extd2_sse41.o ksw2_exts2_sse41.o ksw2_extz2_sse2.o ksw2_extd2_sse2.o ksw2_exts2_sse2.o ksw2_dispatch.o OBJS+=ksw2_extz2_sse41.o ksw2_extd2_sse41.o ksw2_exts2_sse41.o ksw2_extz2_sse2.o ksw2_extd2_sse2.o ksw2_exts2_sse2.o ksw2_dispatch.o
else else # if sse2only is defined
OBJS+=ksw2_extz2_sse.o ksw2_extd2_sse.o ksw2_exts2_sse.o OBJS+=ksw2_extz2_sse.o ksw2_extd2_sse.o ksw2_exts2_sse.o
endif endif
else else # if arm_neon is defined
OBJS+=ksw2_extz2_neon.o ksw2_extd2_neon.o ksw2_exts2_neon.o OBJS+=ksw2_extz2_neon.o ksw2_extd2_neon.o ksw2_exts2_neon.o
CFLAGS+=-D_FILE_OFFSET_BITS=64 -mfpu=neon -fsigned-char CFLAGS+=-D_FILE_OFFSET_BITS=64 -mfpu=neon -fsigned-char
INCLUDES+=-I sse2neon INCLUDES+=-Isse2neon
endif endif
.PHONY:all extra clean depend .PHONY:all extra clean depend
@@ -42,26 +42,31 @@ sdust:sdust.c getopt.o kalloc.o kalloc.h kdq.h kvec.h kseq.h sdust.h
# SSE-specific targets on x86/x86_64 # SSE-specific targets on x86/x86_64
ifeq ($(arm_neon),) # if arm_neon is defined, compile this target with the default setting (i.e. no -msse2)
ksw2_ll_sse.o:ksw2_ll_sse.c ksw2.h kalloc.h
$(CC) -c $(CFLAGS) -msse2 $(CPPFLAGS) $(INCLUDES) $< -o $@
endif
ksw2_extz2_sse41.o:ksw2_extz2_sse.c ksw2.h kalloc.h ksw2_extz2_sse41.o:ksw2_extz2_sse.c ksw2.h kalloc.h
$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@ $(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
ksw2_extz2_sse2.o:ksw2_extz2_sse.c ksw2.h kalloc.h ksw2_extz2_sse2.o:ksw2_extz2_sse.c ksw2.h kalloc.h
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@ $(CC) -c $(CFLAGS) -msse2 -mno-sse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
ksw2_extd2_sse41.o:ksw2_extd2_sse.c ksw2.h kalloc.h ksw2_extd2_sse41.o:ksw2_extd2_sse.c ksw2.h kalloc.h
$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@ $(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
ksw2_extd2_sse2.o:ksw2_extd2_sse.c ksw2.h kalloc.h ksw2_extd2_sse2.o:ksw2_extd2_sse.c ksw2.h kalloc.h
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@ $(CC) -c $(CFLAGS) -msse2 -mno-sse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
ksw2_exts2_sse41.o:ksw2_exts2_sse.c ksw2.h kalloc.h ksw2_exts2_sse41.o:ksw2_exts2_sse.c ksw2.h kalloc.h
$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@ $(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
ksw2_exts2_sse2.o:ksw2_exts2_sse.c ksw2.h kalloc.h ksw2_exts2_sse2.o:ksw2_exts2_sse.c ksw2.h kalloc.h
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@ $(CC) -c $(CFLAGS) -msse2 -mno-sse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
ksw2_dispatch.o:ksw2_dispatch.c ksw2.h ksw2_dispatch.o:ksw2_dispatch.c ksw2.h
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@ $(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
# NEON-specific targets on ARM # NEON-specific targets on ARM
+47
View File
@@ -1,3 +1,50 @@
Release 2.10-r761 (27 March 2018)
---------------------------------
Changes to minimap2:
* Optionally output the MD tag for compatibility with existing tools (#63,
#118 and #137).
* Use SSE compiler flags more precisely to prevent compiling errors on certain
machines (#127).
* Added option --min-occ-floor to set a minimum occurrence threshold. Presets
intended for assembly-to-reference alignment set this option to 100. This
option alleviates issues with regions having high copy numbers (#107).
* Exit with non-zero code on file writing errors (e.g. disk full; #103 and
#132).
* Added option -y to copy FASTA/FASTQ comments in query sequences to the
output (#136).
* Added the asm20 preset for alignments between genomes at 5-10% sequence
divergence.
* Changed the band-width in the ava-ont preset from 500 to 2000. Oxford
Nanopore reads may contain long deletion sequencing errors that break
chaining.
Changes to mappy, the Python binding:
* Fixed a typo in Align.seq() (#126).
Changes to paftools.js, the companion script:
* Command sam2paf now converts the MD tag to cs.
* Support VCF output for assembly-to-reference variant calling (#109).
This version should produce identical alignment for read overlapping, RNA-seq
read mapping, and genomic read mapping. We have also added a cook book to show
the variety uses of minimap2 on real datasets. Please see cookbook.md in the
minimap2 source code directory.
(2.10: 27 March 2017, r761)
Release 2.9-r720 (23 February 2018) Release 2.9-r720 (23 February 2018)
----------------------------------- -----------------------------------
+8 -5
View File
@@ -68,9 +68,8 @@ Detailed evaluations are available from the [minimap2 preprint][preprint].
Minimap2 is optimized for x86-64 CPUs. You can acquire precompiled binaries from Minimap2 is optimized for x86-64 CPUs. You can acquire precompiled binaries from
the [release page][release] with: the [release page][release] with:
```sh ```sh
curl -L https://github.com/lh3/minimap2/releases/download/v2.9/minimap2-2.9_x64-linux.tar.bz2 \ curl -L https://github.com/lh3/minimap2/releases/download/v2.10/minimap2-2.10_x64-linux.tar.bz2 | tar -jxvf -
| tar -jxvf - ./minimap2-2.10_x64-linux/minimap2
./minimap2-2.9_x64-linux/minimap2
``` ```
If you want to compile from the source, you need to have a C compiler, GNU make If you want to compile from the source, you need to have a C compiler, GNU make
and zlib development files installed. Then type `make` in the source code and zlib development files installed. Then type `make` in the source code
@@ -137,7 +136,7 @@ Nanopore reads.
#### <a name="map-long-splice"></a>Map long mRNA/cDNA reads #### <a name="map-long-splice"></a>Map long mRNA/cDNA reads
```sh ```sh
minimap2 -ax splice -uf ref.fa iso-seq.fq > aln.sam # PacBio Iso-seq/traditional cDNA minimap2 -ax splice -uf -C5 ref.fa iso-seq.fq > aln.sam # PacBio Iso-seq/traditional cDNA
minimap2 -ax splice ref.fa nanopore-cdna.fa > aln.sam # Nanopore 2D cDNA-seq minimap2 -ax splice ref.fa nanopore-cdna.fa > aln.sam # Nanopore 2D cDNA-seq
minimap2 -ax splice -uf -k14 ref.fa direct-rna.fq > aln.sam # Nanopore Direct RNA-seq minimap2 -ax splice -uf -k14 ref.fa direct-rna.fq > aln.sam # Nanopore Direct RNA-seq
minimap2 -ax splice --splice-flank=no SIRV.fa SIRV-seq.fa # mapping against SIRV control minimap2 -ax splice --splice-flank=no SIRV.fa SIRV-seq.fa # mapping against SIRV control
@@ -229,7 +228,7 @@ sorting) still work with such BAM records; tools that read CIGAR will
effectively ignore these records. It has been decided that future tools will effectively ignore these records. It has been decided that future tools will
will seamlessly recognize long-cigar records generated by option `-L`. will seamlessly recognize long-cigar records generated by option `-L`.
**TD;DR**: if you work with ultra-long reads and use tools that only process **TL;DR**: if you work with ultra-long reads and use tools that only process
BAM files, please add option `-L`. BAM files, please add option `-L`.
#### <a name="cs"></a>The cs optional tag #### <a name="cs"></a>The cs optional tag
@@ -346,6 +345,10 @@ mappy` or [from BioConda][mappyconda] via `conda install -c bioconda mappy`.
possible to add non-SIMD support, but it would make minimap2 slower by possible to add non-SIMD support, but it would make minimap2 slower by
several times. several times.
* Minimap2 does not work with a single query or database sequence ~2
billion bases or longer (2,147,483,647 to be exact). The total length of all
sequences can well exceed this threshold.
[paf]: https://github.com/lh3/miniasm/blob/master/PAF.md [paf]: https://github.com/lh3/miniasm/blob/master/PAF.md
+17 -6
View File
@@ -62,7 +62,7 @@ static inline char *kstrdup(const kstring_t *s)
return t; return t;
} }
static inline void kseq2bseq(kseq_t *ks, mm_bseq1_t *s, int with_qual) static inline void kseq2bseq(kseq_t *ks, mm_bseq1_t *s, int with_qual, int with_comment)
{ {
int i; int i;
s->name = kstrdup(&ks->name); s->name = kstrdup(&ks->name);
@@ -71,10 +71,11 @@ static inline void kseq2bseq(kseq_t *ks, mm_bseq1_t *s, int with_qual)
if (s->seq[i] == 'u' || s->seq[i] == 'U') if (s->seq[i] == 'u' || s->seq[i] == 'U')
--s->seq[i]; --s->seq[i];
s->qual = with_qual && ks->qual.l? kstrdup(&ks->qual) : 0; s->qual = with_qual && ks->qual.l? kstrdup(&ks->qual) : 0;
s->comment = with_comment && ks->comment.l? kstrdup(&ks->comment) : 0;
s->l_seq = ks->seq.l; s->l_seq = ks->seq.l;
} }
mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int frag_mode, int *n_) mm_bseq1_t *mm_bseq_read3(mm_bseq_file_t *fp, int chunk_size, int with_qual, int with_comment, int frag_mode, int *n_)
{ {
int64_t size = 0; int64_t size = 0;
kvec_t(mm_bseq1_t) a = {0,0,0}; kvec_t(mm_bseq1_t) a = {0,0,0};
@@ -91,12 +92,12 @@ mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int
assert(ks->seq.l <= INT32_MAX); assert(ks->seq.l <= INT32_MAX);
if (a.m == 0) kv_resize(mm_bseq1_t, 0, a, 256); if (a.m == 0) kv_resize(mm_bseq1_t, 0, a, 256);
kv_pushp(mm_bseq1_t, 0, a, &s); kv_pushp(mm_bseq1_t, 0, a, &s);
kseq2bseq(ks, s, with_qual); kseq2bseq(ks, s, with_qual, with_comment);
size += s->l_seq; size += s->l_seq;
if (size >= chunk_size) { if (size >= chunk_size) {
if (frag_mode && a.a[a.n-1].l_seq < CHECK_PAIR_THRES) { if (frag_mode && a.a[a.n-1].l_seq < CHECK_PAIR_THRES) {
while (kseq_read(ks) >= 0) { while (kseq_read(ks) >= 0) {
kseq2bseq(ks, &fp->s, with_qual); kseq2bseq(ks, &fp->s, with_qual, with_comment);
if (mm_qname_same(fp->s.name, a.a[a.n-1].name)) { if (mm_qname_same(fp->s.name, a.a[a.n-1].name)) {
kv_push(mm_bseq1_t, 0, a, fp->s); kv_push(mm_bseq1_t, 0, a, fp->s);
memset(&fp->s, 0, sizeof(mm_bseq1_t)); memset(&fp->s, 0, sizeof(mm_bseq1_t));
@@ -110,12 +111,17 @@ mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int
return a.a; return a.a;
} }
mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int frag_mode, int *n_)
{
return mm_bseq_read3(fp, chunk_size, with_qual, 0, frag_mode, n_);
}
mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int chunk_size, int with_qual, int *n_) mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int chunk_size, int with_qual, int *n_)
{ {
return mm_bseq_read2(fp, chunk_size, with_qual, 0, n_); return mm_bseq_read2(fp, chunk_size, with_qual, 0, n_);
} }
mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int *n_) mm_bseq1_t *mm_bseq_read_frag2(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int with_comment, int *n_)
{ {
int i; int i;
int64_t size = 0; int64_t size = 0;
@@ -136,7 +142,7 @@ mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int
for (i = 0; i < n_fp; ++i) { for (i = 0; i < n_fp; ++i) {
mm_bseq1_t *s; mm_bseq1_t *s;
kv_pushp(mm_bseq1_t, 0, a, &s); kv_pushp(mm_bseq1_t, 0, a, &s);
kseq2bseq(fp[i]->ks, s, with_qual); kseq2bseq(fp[i]->ks, s, with_qual, with_comment);
size += s->l_seq; size += s->l_seq;
} }
if (size >= chunk_size) break; if (size >= chunk_size) break;
@@ -145,6 +151,11 @@ mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int
return a.a; return a.a;
} }
mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int *n_)
{
return mm_bseq_read_frag2(n_fp, fp, chunk_size, with_qual, 0, n_);
}
int mm_bseq_eof(mm_bseq_file_t *fp) int mm_bseq_eof(mm_bseq_file_t *fp)
{ {
return (ks_eof(fp->ks->f) && fp->s.seq == 0); return (ks_eof(fp->ks->f) && fp->s.seq == 0);
+3 -1
View File
@@ -13,13 +13,15 @@ typedef struct mm_bseq_file_s mm_bseq_file_t;
typedef struct { typedef struct {
int l_seq, rid; int l_seq, rid;
char *name, *seq, *qual; char *name, *seq, *qual, *comment;
} mm_bseq1_t; } mm_bseq1_t;
mm_bseq_file_t *mm_bseq_open(const char *fn); mm_bseq_file_t *mm_bseq_open(const char *fn);
void mm_bseq_close(mm_bseq_file_t *fp); void mm_bseq_close(mm_bseq_file_t *fp);
mm_bseq1_t *mm_bseq_read3(mm_bseq_file_t *fp, int chunk_size, int with_qual, int with_comment, int frag_mode, int *n_);
mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int frag_mode, int *n_); mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int frag_mode, int *n_);
mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int chunk_size, int with_qual, int *n_); mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int chunk_size, int with_qual, int *n_);
mm_bseq1_t *mm_bseq_read_frag2(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int with_comment, int *n_);
mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int *n_); mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int *n_);
int mm_bseq_eof(mm_bseq_file_t *fp); int mm_bseq_eof(mm_bseq_file_t *fp);
+243
View File
@@ -0,0 +1,243 @@
## Table of Contents
- [Introduction & Installation](#intro)
- [Mapping Genomic Reads](#map-reads)
* [Mapping long reads](#map-pb)
* [Mapping Illumina paired-end reads](#map-sr)
* [Evaluating mapping accuracy with simulated reads (for developers)](#mapeval)
- [Mapping Long RNA-seq Reads](#map-rna)
* [Mapping Nanopore 2D cDNA reads](#map-ont-cdna-2d)
* [Mapping Nanopore direct-RNA reads](#map-direct-rna)
* [Mapping PacBio Iso-seq reads](#map-iso-seq)
- [Full-Genome Alignment](#genome-aln)
* [Intra-species assembly alignment](#asm-to-ref)
* [Cross-species full-genome alignment](#x-species)
* [Eyeballing alignment](#view-aln)
* [Calling variants from assembly-to-reference alignment](#asm-var)
* [Constructing self-homology map](#hom-map)
* [Lift Over (for developers)](#liftover)
- [Read Overlap](#read-overlap)
* [Long-read overlap](#long-read-overlap)
* [Evaluating overlap sensitivity (for developers)](#ov-eval)
## <a name="intro"></a>Introduction & Installation
This cookbook walks you through a variety of applications of minimap2 and its
companion script `paftools.js`. All data here are freely available from the
minimap2 release page at version tag [v2.10][v2.10]. Some examples only work
with v2.10 or later.
To acquire the data used in this cookbook and to install minimap2 and paftools,
please follow the command lines below:
```sh
# install minimap2 executables
curl -L https://github.com/lh3/minimap2/releases/download/v2.10/minimap2-2.10_x64-linux.tar.bz2 | tar jxf -
cp minimap2-2.10_x64-linux/{minimap2,k8,paftools.js} . # copy executables
export PATH="$PATH:"`pwd` # put the current directory on PATH
# download example datasets
curl -L https://github.com/lh3/minimap2/releases/download/v2.10/cookbook-data.tgz | tar zxf -
```
## <a name="map-reads"></a>Mapping Genomic Reads
### <a name="map-pb"></a>Mapping long reads
```sh
minimap2 -ax map-pb -t4 ecoli_ref.fa ecoli_p6_25x_canu.fa > mapped.sam
```
Alternatively, you can create a minimap2 index first and then map:
```sh
minimap2 -x map-pb -d ecoli-pb.mmi ecoli_ref.fa # create an index
minimap2 -ax map-pb ecoli-pb.mmi ecoli_p6_25x_canu.fa > mapped.sam
```
This will save you a couple of minutes when you map against the human genome.
**HOWEVER**, key algorithm parameters such as the k-mer length and window
size can't be changed after indexing. Minimap2 will give you a warning if
parameters used in a pre-built index doesn't match parameters on the command
line. **Please always make sure you are using an intended pre-built index.**
### <a name="map-sr"></a>Mapping Illumina paired-end reads:
```sh
minimap2 -ax sr -t4 ecoli_ref.fa ecoli_mason_1.fq ecoli_mason_2.fq > mapped-sr.sam
```
### <a name="mapeval"></a>Evaluating mapping accuracy with simulated reads (for developers)
```sh
minimap2 -ax sr ecoli_ref.fa ecoli_mason_1.fq ecoli_mason_2.fq | paftools.js mapeval -
```
The output is:
```
Q 60 19712 0 0.000000000 19712
Q 0 282 219 0.010953286 19994
U 6
```
where a `U`-line gives the number of unmapped reads (for SAM input only); a
`Q`-line gives:
1. Mapping quality (mapQ) threshold
2. Number of mapped reads between this threshold and the previous mapQ threshold.
3. Number of wrong mappings in the same mapQ interval
4. Accumulative mapping error rate
5. Accumulative number of mappings
For `paftools.js mapeval` to work, you need to encode the true read positions
in read names in the right format. For [PBSIM][pbsim] and [mason2][mason2], we
provide scripts to generate the right format. Simulated reads in this cookbook
were created with the following command lines:
```sh
# in PBSIM source code directory:
src/pbsim ../ecoli_ref.fa --depth 1 --sample-fastq sample/sample.fastq
paftools.js pbsim2fq ../ecoli_ref.fa.fai sd_0001.maf > ../ecoli_pbsim.fa
# mason2 simulation
mason_simulator --illumina-prob-mismatch-scale 2.5 -ir ecoli_ref.fa -n 10000 -o tmp-l.fq -or tmp-r.fq -oa tmp.sam
paftools.js mason2fq tmp.sam | seqtk seq -1 > ecoli_mason_1.fq
paftools.js mason2fq tmp.sam | seqtk seq -2 > ecoli_mason_2.fq
```
## <a name="map-rna"></a>Mapping Long RNA-seq Reads
### <a name="map-ont-cdna-2d"></a>Mapping Nanopore 2D cDNA reads
```sh
minimap2 -ax splice SIRV_E2.fa SIRV_ont-cdna.fa > aln.sam
```
You can compare the alignment to the true annotations with:
```sh
paftools.js junceval SIRV_E2C.gtf aln.sam
```
It gives the percentage of introns found in the annotation. For SIRV data, it
is possible to achieve higher junction accuracy with
```sh
minimap2 -ax splice --splice-flank=no SIRV_E2.fa SIRV_ont-cdna.fa | paftools.js junceval SIRV_E2C.gtf
```
This is because minimap2 models one additional evolutionarily conserved base
around a canonical junction, but SIRV doesn't honor this signal. Option
`--splice-flank=no` asks minimap2 no to model this additional base.
In the output a tag `ts:A:+` indicates that the read strand is the same as the
transcript strand; `ts:A:-` indicates the read strand is opposite to the
transcript strand. This tag is inferred from the GT-AG signal and is thus only
available to spliced reads.
### <a name="map-direct-rna"></a>Mapping Nanopore direct-RNA reads
```sh
minimap2 -ax splice -k14 -uf SIRV_E2.fa SIRV_ont-drna.fa > aln.sam
```
Direct-RNA reads are noisier, so we use a shorter k-mer for improved
sensitivity. Here, option `-uf` forces minimap2 to map reads to the forward
transcript strand only because direct-RNA reads are stranded. Again, applying
`--splice-flank=no` helps junction accuracy for SIRV data.
### <a name="map-iso-seq"></a>Mapping PacBio Iso-seq reads
```sh
minimap2 -ax splice -uf -C5 SIRV_E2.fa SIRV_iso-seq.fq > aln.sam
```
Option `-C5` reduces the penalty on non-canonical splicing sites. It helps
to align such sites correctly for data with low error rate such as Iso-seq
reads and traditional cDNAs. On this example, minimap2 makes one junction
error. Applying `--splice-flank=no` fixes this alignment error.
Note that the command line above is optimized for the final Iso-seq reads.
PacBio's Iso-seq pipeline produces intermediate sequences at varying quality.
For example, some intermediate reads are not stranded. For these reads, option
`-uf` will lead to more errors. Please revise the minimap2 command line
accordingly.
## <a name="genome-aln"></a>Full-Genome Alignment
### <a name="asm-to-ref"></a>Intra-species assembly alignment
```sh
# option "--cs" is recommended as paftools.js may need it
minimap2 -cx asm5 --cs ecoli_ref.fa ecoli_canu.fa > ecoli_canu.paf
```
Here `ecoli_canu.fa` is the Canu assembly of `ecoli_p6_25x_canu.fa`. This
command line outputs alignments in the [PAF format][paf]. Use `-a` instead of
`-c` to get output in the SAM format.
### <a name="x-species"></a>Cross-species full-genome alignment
```sh
minimap2 -cx asm20 --cs ecoli_ref.fa ecoli_O104:H4.fa > ecoli_O104:H4.paf
sort -k6,6 -k8,8n ecoli_O104:H4.paf | paftools.js call -f ecoli_ref.fa -L10000 -l1000 - > out.vcf
```
Minimap2 has three presets for full-genome alignment: "asm5" for sequence
divergence below 1%, "asm10" for divergence around a couple of percent and
"asm20" for divergence not more than 10%. In theory, with the right setting,
minimap2 should work for sequence pairs with sequence divergence up to ~15%,
but this has not been carefully evaluated.
### <a name="view-aln"></a>Eyeballing alignment
```sh
# option "--cs" required; minimap2-r741 or higher required for the "asm20" preset
minimap2 -cx asm20 --cs ecoli_ref.fa ecoli_O104:H4.fa | paftools.js view - | less -S
```
This prints the alignment in a BLAST-like format.
### <a name="asm-var"></a>Calling variants from assembly-to-reference alignment
```sh
# don't forget the "--cs" option; otherwise it doesn't work
minimap2 -cx asm5 --cs ecoli_ref.fa ecoli_canu.fa \
| sort -k6,6 -k8,8n \
| paftools.js call -f ecoli_ref.fa - > out.vcf
```
Without option `-f`, `paftools.js call` outputs in a custom format. In this
format, lines starting with `R` give the regions covered by one contig only.
This information is not available in the VCF output.
### <a name="hom-map"></a>Constructing self-homology map
```sh
minimap2 -DP -k19 -w19 -m200 ecoli_ref.fa ecoli_ref.fa > out.paf
```
Option `-D` asks minimap2 to ignore anchors from perfect self match and `-P`
outputs all chains. For large nomes, we don't recommend to perform base-level
alignment (with `-c`, `-a` or `--cs`) when `-P` is applied. This is because
base-alignment is slow and occasionally gives wrong alignments close to the
diagonal of a dotter plot. For E. coli, though, base-alignment is still fast.
### <a name="liftover"></a>Lift over (for developers)
```sh
minimap2 -cx asm5 --cs ecoli_ref.fa ecoli_canu.fa > ecoli_canu.paf
echo -e 'tig00000001\t200000\t300000' | paftools.js liftover ecoli_canu.paf -
```
This lifts over a region on query sequences to one or multiple regions on
reference sequences. Note that this paftools.js command may not be efficient
enough to lift millions of regions.
## <a name="read-overlap"></a>Read Overlap
### <a name="long-read-overlap"></a>Long read overlap
```sh
# For pacbio reads:
minimap2 -x ava-pb ecoli_p6_25x_canu.fa ecoli_p6_25x_canu.fa > overlap.paf
# For Nanopore reads (ava-ont also works with PacBio but not as good):
minimap2 -x ava-ont -r 10000 ecoli_p6_25x_canu.fa ecoli_p6_25x_canu.fa > overlap.paf
# If you have miniasm installed:
miniasm -f ecoli_p6_25x_canu.fa overlap.paf > asm.gfa
```
Here we explicitly applied `-r 10000`. We are considering to set this as the
default for the `ava-ont` mode as this seems to improve the contiguity for
nanopore read assembly (Loman, personal communication).
*Minimap2 doesn't work well with short-read overlap.*
### <a name="ov-eval"></a>Evaluating overlap sensitivity (for developers)
```sh
# read to reference mapping
minimap2 -cx map-pb ecoli_ref.fa ecoli_p6_25x_canu.fa > to-ref.paf
# evaluate overlap sensitivity
sort -k6,6 -k8,8n to-ref.paf | paftools.js ov-eval - overlap.paf
```
You can see that for PacBio reads, minimap2 achieves higher overlap sensitivity
with `-x ava-pb` (99% vs 93% with `-x ava-ont`).
[pbsim]: https://github.com/pfaucon/PBSIM-PacBio-Simulator
[mason2]: https://github.com/seqan/seqan/tree/master/apps/mason2
[paf]: https://github.com/lh3/miniasm/blob/master/PAF.md
[v2.10]: https://github.com/lh3/minimap2/releases/tag/v2.10
+69 -29
View File
@@ -118,7 +118,7 @@ void mm_write_sam_hdr(const mm_idx_t *idx, const char *rg, const char *ver, int
if (idx) { if (idx) {
uint32_t i; uint32_t i;
for (i = 0; i < idx->n_seq; ++i) for (i = 0; i < idx->n_seq; ++i)
printf("@SQ\tSN:%s\tLN:%d\n", idx->seq[i].name, idx->seq[i].len); mm_sprintf_lite(&str, "@SQ\tSN:%s\tLN:%d\n", idx->seq[i].name, idx->seq[i].len);
} }
if (rg) sam_write_rg_line(&str, rg); if (rg) sam_write_rg_line(&str, rg);
mm_sprintf_lite(&str, "@PG\tID:minimap2\tPN:minimap2"); mm_sprintf_lite(&str, "@PG\tID:minimap2\tPN:minimap2");
@@ -129,36 +129,18 @@ void mm_write_sam_hdr(const mm_idx_t *idx, const char *rg, const char *ver, int
for (i = 1; i < argc; ++i) for (i = 1; i < argc; ++i)
mm_sprintf_lite(&str, " %s", argv[i]); mm_sprintf_lite(&str, " %s", argv[i]);
} }
mm_sprintf_lite(&str, "\n"); mm_err_puts(str.s);
fputs(str.s, stdout);
free(str.s); free(str.s);
} }
static void write_cs(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int no_iden) static void write_cs_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq, const mm_reg1_t *r, char *tmp, int no_iden)
{ {
extern unsigned char seq_nt4_table[256];
int i, q_off, t_off; int i, q_off, t_off;
uint8_t *qseq, *tseq;
char *tmp;
if (r->p == 0) return;
mm_sprintf_lite(s, "\tcs:Z:"); mm_sprintf_lite(s, "\tcs:Z:");
qseq = (uint8_t*)kmalloc(km, r->qe - r->qs);
tseq = (uint8_t*)kmalloc(km, r->re - r->rs);
tmp = (char*)kmalloc(km, r->re - r->rs > r->qe - r->qs? r->re - r->rs + 1 : r->qe - r->qs + 1);
mm_idx_getseq(mi, r->rid, r->rs, r->re, tseq);
if (!r->rev) {
for (i = r->qs; i < r->qe; ++i)
qseq[i - r->qs] = seq_nt4_table[(uint8_t)t->seq[i]];
} else {
for (i = r->qs; i < r->qe; ++i) {
uint8_t c = seq_nt4_table[(uint8_t)t->seq[i]];
qseq[r->qe - i - 1] = c >= 4? 4 : 3 - c;
}
}
for (i = q_off = t_off = 0; i < r->p->n_cigar; ++i) { for (i = q_off = t_off = 0; i < r->p->n_cigar; ++i) {
int j, op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4; int j, op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
assert(op >= 0 && op <= 3); assert(op >= 0 && op <= 3);
if (op == 0) { if (op == 0) { // match
int l_tmp = 0; int l_tmp = 0;
for (j = 0; j < len; ++j) { for (j = 0; j < len; ++j) {
if (qseq[q_off + j] != tseq[t_off + j]) { if (qseq[q_off + j] != tseq[t_off + j]) {
@@ -179,17 +161,17 @@ static void write_cs(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_
} else mm_sprintf_lite(s, ":%d", l_tmp); } else mm_sprintf_lite(s, ":%d", l_tmp);
} }
q_off += len, t_off += len; q_off += len, t_off += len;
} else if (op == 1) { } else if (op == 1) { // insertion to ref
for (j = 0, tmp[len] = 0; j < len; ++j) for (j = 0, tmp[len] = 0; j < len; ++j)
tmp[j] = "acgtn"[qseq[q_off + j]]; tmp[j] = "acgtn"[qseq[q_off + j]];
mm_sprintf_lite(s, "+%s", tmp); mm_sprintf_lite(s, "+%s", tmp);
q_off += len; q_off += len;
} else if (op == 2) { } else if (op == 2) { // deletion from ref
for (j = 0, tmp[len] = 0; j < len; ++j) for (j = 0, tmp[len] = 0; j < len; ++j)
tmp[j] = "acgtn"[tseq[t_off + j]]; tmp[j] = "acgtn"[tseq[t_off + j]];
mm_sprintf_lite(s, "-%s", tmp); mm_sprintf_lite(s, "-%s", tmp);
t_off += len; t_off += len;
} else { } else { // intron
assert(len >= 2); assert(len >= 2);
mm_sprintf_lite(s, "~%c%c%d%c%c", "acgtn"[tseq[t_off]], "acgtn"[tseq[t_off+1]], mm_sprintf_lite(s, "~%c%c%d%c%c", "acgtn"[tseq[t_off]], "acgtn"[tseq[t_off+1]],
len, "acgtn"[tseq[t_off+len-2]], "acgtn"[tseq[t_off+len-1]]); len, "acgtn"[tseq[t_off+len-2]], "acgtn"[tseq[t_off+len-1]]);
@@ -197,6 +179,59 @@ static void write_cs(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_
} }
} }
assert(t_off == r->re - r->rs && q_off == r->qe - r->qs); assert(t_off == r->re - r->rs && q_off == r->qe - r->qs);
}
static void write_MD_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq, const mm_reg1_t *r, char *tmp)
{
int i, q_off, t_off, l_MD = 0;
mm_sprintf_lite(s, "\tMD:Z:");
for (i = q_off = t_off = 0; i < r->p->n_cigar; ++i) {
int j, op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
assert(op >= 0 && op <= 2); // introns (aka reference skips) are not supported
if (op == 0) { // match
for (j = 0; j < len; ++j) {
if (qseq[q_off + j] != tseq[t_off + j]) {
mm_sprintf_lite(s, "%d%c", l_MD, "ACGTN"[tseq[t_off + j]]);
l_MD = 0;
} else ++l_MD;
}
q_off += len, t_off += len;
} else if (op == 1) { // insertion to ref
q_off += len;
} else if (op == 2) { // deletion from ref
for (j = 0, tmp[len] = 0; j < len; ++j)
tmp[j] = "ACGTN"[tseq[t_off + j]];
mm_sprintf_lite(s, "%d^%s", l_MD, tmp);
l_MD = 0;
t_off += len;
}
}
if (l_MD > 0) mm_sprintf_lite(s, "%d", l_MD);
assert(t_off == r->re - r->rs && q_off == r->qe - r->qs);
}
static void write_cs_or_MD(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int no_iden, int is_MD)
{
extern unsigned char seq_nt4_table[256];
int i;
uint8_t *qseq, *tseq;
char *tmp;
if (r->p == 0) return;
qseq = (uint8_t*)kmalloc(km, r->qe - r->qs);
tseq = (uint8_t*)kmalloc(km, r->re - r->rs);
tmp = (char*)kmalloc(km, r->re - r->rs > r->qe - r->qs? r->re - r->rs + 1 : r->qe - r->qs + 1);
mm_idx_getseq(mi, r->rid, r->rs, r->re, tseq);
if (!r->rev) {
for (i = r->qs; i < r->qe; ++i)
qseq[i - r->qs] = seq_nt4_table[(uint8_t)t->seq[i]];
} else {
for (i = r->qs; i < r->qe; ++i) {
uint8_t c = seq_nt4_table[(uint8_t)t->seq[i]];
qseq[r->qe - i - 1] = c >= 4? 4 : 3 - c;
}
}
if (is_MD) write_MD_core(s, tseq, qseq, r, tmp);
else write_cs_core(s, tseq, qseq, r, tmp, no_iden);
kfree(km, qseq); kfree(km, tseq); kfree(km, tmp); kfree(km, qseq); kfree(km, tseq); kfree(km, tmp);
} }
@@ -237,8 +272,10 @@ void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const m
for (k = 0; k < r->p->n_cigar; ++k) for (k = 0; k < r->p->n_cigar; ++k)
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDN"[r->p->cigar[k]&0xf]); mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDN"[r->p->cigar[k]&0xf]);
} }
if (r->p && (opt_flag & MM_F_OUT_CS)) if (r->p && (opt_flag & (MM_F_OUT_CS|MM_F_OUT_MD)))
write_cs(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG)); write_cs_or_MD(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG), opt_flag&MM_F_OUT_MD);
if ((opt_flag & MM_F_COPY_COMMENT) && t->comment)
mm_sprintf_lite(s, "\t%s", t->comment);
} }
static void sam_write_sq(kstring_t *s, char *seq, int l, int rev, int comp) static void sam_write_sq(kstring_t *s, char *seq, int l, int rev, int comp)
@@ -434,12 +471,15 @@ void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
} }
} }
} }
if (r->p && (opt_flag & MM_F_OUT_CS)) if (r->p && (opt_flag & (MM_F_OUT_CS|MM_F_OUT_MD)))
write_cs(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG)); write_cs_or_MD(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG), opt_flag&MM_F_OUT_MD);
if (cigar_in_tag) if (cigar_in_tag)
write_sam_cigar(s, flag, 1, t->l_seq, r, opt_flag); write_sam_cigar(s, flag, 1, t->l_seq, r, opt_flag);
} }
if ((opt_flag & MM_F_COPY_COMMENT) && t->comment)
mm_sprintf_lite(s, "\t%s", t->comment);
s->s[s->l] = 0; // we always have room for an extra byte (see str_enlarge) s->s[s->l] = 0; // we always have room for an extra byte (see str_enlarge)
} }
+21 -4
View File
@@ -4,9 +4,13 @@
#include "bseq.h" #include "bseq.h"
#include "minimap.h" #include "minimap.h"
#include "mmpriv.h" #include "mmpriv.h"
#ifdef HAVE_GETOPT
#include <getopt.h>
#else
#include "getopt.h" #include "getopt.h"
#endif
#define MM_VERSION "2.9-r720" #define MM_VERSION "2.10-r761"
#ifdef __linux__ #ifdef __linux__
#include <sys/resource.h> #include <sys/resource.h>
@@ -51,6 +55,8 @@ static struct option long_options[] = {
{ "all-chain", no_argument, 0, 'P' }, { "all-chain", no_argument, 0, 'P' },
{ "dual", required_argument, 0, 0 }, // 26 { "dual", required_argument, 0, 0 }, // 26
{ "max-clip-ratio", required_argument, 0, 0 }, // 27 { "max-clip-ratio", required_argument, 0, 0 }, // 27
{ "min-occ-floor", required_argument, 0, 0 }, // 28
{ "MD", no_argument, 0, 0 }, // 29
{ "help", no_argument, 0, 'h' }, { "help", no_argument, 0, 'h' },
{ "max-intron-len", required_argument, 0, 'G' }, { "max-intron-len", required_argument, 0, 'G' },
{ "version", no_argument, 0, 'V' }, { "version", no_argument, 0, 'V' },
@@ -88,7 +94,7 @@ static inline void yes_or_no(mm_mapopt_t *opt, int flag, int long_idx, const cha
int main(int argc, char *argv[]) int main(int argc, char *argv[])
{ {
const char *opt_str = "2aSDw:k:K:t:r:f:Vv:g:G:I:d:XT:s:x:Hcp:M:n:z:A:B:O:E:m:N:Qu:R:hF:LC:"; const char *opt_str = "2aSDw:k:K:t:r:f:Vv:g:G:I:d:XT:s:x:Hcp:M:n:z:A:B:O:E:m:N:Qu:R:hF:LC:y";
mm_mapopt_t opt; mm_mapopt_t opt;
mm_idxopt_t ipt; mm_idxopt_t ipt;
int i, c, n_threads = 3, long_idx; int i, c, n_threads = 3, long_idx;
@@ -110,7 +116,7 @@ int main(int argc, char *argv[])
} }
break; break;
} }
optreset = 1; optind = 0; // for musl getopt, optind=0 has the same effect as optreset=1; older libc doesn't have optreset
while ((c = getopt_long(argc, argv, opt_str, long_options, &long_idx)) >= 0) { while ((c = getopt_long(argc, argv, opt_str, long_options, &long_idx)) >= 0) {
if (c == 'w') ipt.w = atoi(optarg); if (c == 'w') ipt.w = atoi(optarg);
@@ -134,6 +140,7 @@ int main(int argc, char *argv[])
else if (c == 'Q') opt.flag |= MM_F_NO_QUAL; else if (c == 'Q') opt.flag |= MM_F_NO_QUAL;
else if (c == 'Y') opt.flag |= MM_F_SOFTCLIP; else if (c == 'Y') opt.flag |= MM_F_SOFTCLIP;
else if (c == 'L') opt.flag |= MM_F_LONG_CIGAR; else if (c == 'L') opt.flag |= MM_F_LONG_CIGAR;
else if (c == 'y') opt.flag |= MM_F_COPY_COMMENT;
else if (c == 'T') opt.sdust_thres = atoi(optarg); else if (c == 'T') opt.sdust_thres = atoi(optarg);
else if (c == 'n') opt.min_cnt = atoi(optarg); else if (c == 'n') opt.min_cnt = atoi(optarg);
else if (c == 'm') opt.min_chain_score = atoi(optarg); else if (c == 'm') opt.min_chain_score = atoi(optarg);
@@ -164,6 +171,8 @@ int main(int argc, char *argv[])
else if (c == 0 && long_idx ==22) opt.flag |= MM_F_FOR_ONLY; // --for-only else if (c == 0 && long_idx ==22) opt.flag |= MM_F_FOR_ONLY; // --for-only
else if (c == 0 && long_idx ==23) opt.flag |= MM_F_REV_ONLY; // --rev-only else if (c == 0 && long_idx ==23) opt.flag |= MM_F_REV_ONLY; // --rev-only
else if (c == 0 && long_idx ==27) opt.max_clip_ratio = atof(optarg); // --max-clip-ratio else if (c == 0 && long_idx ==27) opt.max_clip_ratio = atof(optarg); // --max-clip-ratio
else if (c == 0 && long_idx ==28) opt.min_mid_occ = atoi(optarg); // --min-occ-floor
else if (c == 0 && long_idx ==29) opt.flag |= MM_F_OUT_MD; // --MD
else if (c == 0 && long_idx == 14) { // --frag else if (c == 0 && long_idx == 14) { // --frag
yes_or_no(&opt, MM_F_FRAG_MODE, long_idx, optarg, 1); yes_or_no(&opt, MM_F_FRAG_MODE, long_idx, optarg, 1);
} else if (c == 0 && long_idx == 15) { // --secondary } else if (c == 0 && long_idx == 15) { // --secondary
@@ -264,6 +273,7 @@ int main(int argc, char *argv[])
fprintf(fp_help, " -R STR SAM read group line in a format like '@RG\\tID:foo\\tSM:bar' []\n"); fprintf(fp_help, " -R STR SAM read group line in a format like '@RG\\tID:foo\\tSM:bar' []\n");
fprintf(fp_help, " -c output CIGAR in PAF\n"); fprintf(fp_help, " -c output CIGAR in PAF\n");
fprintf(fp_help, " --cs[=STR] output the cs tag; STR is 'short' (if absent) or 'long' [none]\n"); fprintf(fp_help, " --cs[=STR] output the cs tag; STR is 'short' (if absent) or 'long' [none]\n");
fprintf(fp_help, " --MD output the MD tag\n");
fprintf(fp_help, " -Y use soft clipping for supplementary alignments\n"); fprintf(fp_help, " -Y use soft clipping for supplementary alignments\n");
fprintf(fp_help, " -t INT number of threads [%d]\n", n_threads); fprintf(fp_help, " -t INT number of threads [%d]\n", n_threads);
fprintf(fp_help, " -K NUM minibatch size for mapping [500M]\n"); fprintf(fp_help, " -K NUM minibatch size for mapping [500M]\n");
@@ -276,7 +286,7 @@ int main(int argc, char *argv[])
fprintf(fp_help, " asm5: -k19 -w19 -A1 -B19 -O39,81 -E3,1 -s200 -z200 (asm to ref mapping; break at 5%% div.)\n"); fprintf(fp_help, " asm5: -k19 -w19 -A1 -B19 -O39,81 -E3,1 -s200 -z200 (asm to ref mapping; break at 5%% div.)\n");
fprintf(fp_help, " asm10: -k19 -w19 -A1 -B9 -O16,41 -E2,1 -s200 -z200 (asm to ref mapping; break at 10%% div.)\n"); fprintf(fp_help, " asm10: -k19 -w19 -A1 -B9 -O16,41 -E2,1 -s200 -z200 (asm to ref mapping; break at 10%% div.)\n");
fprintf(fp_help, " ava-pb: -Hk19 -Xw5 -m100 -g10000 --max-chain-skip 25 (PacBio read overlap)\n"); fprintf(fp_help, " ava-pb: -Hk19 -Xw5 -m100 -g10000 --max-chain-skip 25 (PacBio read overlap)\n");
fprintf(fp_help, " ava-ont: -k15 -Xw5 -m100 -g10000 --max-chain-skip 25 (ONT read overlap)\n"); fprintf(fp_help, " ava-ont: -k15 -Xw5 -m100 -g10000 -r2000 --max-chain-skip 25 (ONT read overlap)\n");
fprintf(fp_help, " splice: long-read spliced alignment (see minimap2.1 for details)\n"); fprintf(fp_help, " splice: long-read spliced alignment (see minimap2.1 for details)\n");
fprintf(fp_help, " sr: short single-end reads without splicing (see minimap2.1 for details)\n"); fprintf(fp_help, " sr: short single-end reads without splicing (see minimap2.1 for details)\n");
fprintf(fp_help, "\nSee `man ./minimap2.1' for detailed description of command-line options.\n"); fprintf(fp_help, "\nSee `man ./minimap2.1' for detailed description of command-line options.\n");
@@ -330,10 +340,17 @@ int main(int argc, char *argv[])
} }
mm_idx_reader_close(idx_rdr); mm_idx_reader_close(idx_rdr);
if (fflush(stdout) == EOF) {
fprintf(stderr, "[ERROR] failed to write the results\n");
exit(EXIT_FAILURE);
}
if (mm_verbose >= 3) {
fprintf(stderr, "[M::%s] Version: %s\n", __func__, MM_VERSION); fprintf(stderr, "[M::%s] Version: %s\n", __func__, MM_VERSION);
fprintf(stderr, "[M::%s] CMD:", __func__); fprintf(stderr, "[M::%s] CMD:", __func__);
for (i = 0; i < argc; ++i) for (i = 0; i < argc; ++i)
fprintf(stderr, " %s", argv[i]); fprintf(stderr, " %s", argv[i]);
fprintf(stderr, "\n[M::%s] Real time: %.3f sec; CPU: %.3f sec\n", __func__, realtime() - mm_realtime0, cputime()); fprintf(stderr, "\n[M::%s] Real time: %.3f sec; CPU: %.3f sec\n", __func__, realtime() - mm_realtime0, cputime());
}
return 0; return 0;
} }
+6 -5
View File
@@ -442,11 +442,12 @@ static void *worker_pipeline(void *shared, int step, void *in)
pipeline_t *p = (pipeline_t*)shared; pipeline_t *p = (pipeline_t*)shared;
if (step == 0) { // step 0: read sequences if (step == 0) { // step 0: read sequences
int with_qual = (!!(p->opt->flag & MM_F_OUT_SAM) && !(p->opt->flag & MM_F_NO_QUAL)); int with_qual = (!!(p->opt->flag & MM_F_OUT_SAM) && !(p->opt->flag & MM_F_NO_QUAL));
int with_comment = !!(p->opt->flag & MM_F_COPY_COMMENT);
int frag_mode = (p->n_fp > 1 || !!(p->opt->flag & MM_F_FRAG_MODE)); int frag_mode = (p->n_fp > 1 || !!(p->opt->flag & MM_F_FRAG_MODE));
step_t *s; step_t *s;
s = (step_t*)calloc(1, sizeof(step_t)); s = (step_t*)calloc(1, sizeof(step_t));
if (p->n_fp > 1) s->seq = mm_bseq_read_frag(p->n_fp, p->fp, p->mini_batch_size, with_qual, &s->n_seq); if (p->n_fp > 1) s->seq = mm_bseq_read_frag2(p->n_fp, p->fp, p->mini_batch_size, with_qual, with_comment, &s->n_seq);
else s->seq = mm_bseq_read2(p->fp[0], p->mini_batch_size, with_qual, frag_mode, &s->n_seq); else s->seq = mm_bseq_read3(p->fp[0], p->mini_batch_size, with_qual, with_comment, frag_mode, &s->n_seq);
if (s->seq) { if (s->seq) {
s->p = p; s->p = p;
for (i = 0; i < s->n_seq; ++i) for (i = 0; i < s->n_seq; ++i)
@@ -489,11 +490,11 @@ static void *worker_pipeline(void *shared, int step, void *in)
mm_write_sam2(&p->str, mi, t, i - seg_st, j, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag); mm_write_sam2(&p->str, mi, t, i - seg_st, j, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag);
else else
mm_write_paf(&p->str, mi, t, r, km, p->opt->flag); mm_write_paf(&p->str, mi, t, r, km, p->opt->flag);
puts(p->str.s); mm_err_puts(p->str.s);
} }
if (s->n_reg[i] == 0 && (p->opt->flag & MM_F_OUT_SAM)) { if (s->n_reg[i] == 0 && (p->opt->flag & MM_F_OUT_SAM)) { // write an unmapped record
mm_write_sam2(&p->str, mi, t, i - seg_st, -1, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag); mm_write_sam2(&p->str, mi, t, i - seg_st, -1, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag);
puts(p->str.s); mm_err_puts(p->str.s);
} }
} }
for (i = seg_st; i < seg_en; ++i) { for (i = seg_st; i < seg_en; ++i) {
+3
View File
@@ -29,6 +29,8 @@
#define MM_F_REV_ONLY 0x200000 #define MM_F_REV_ONLY 0x200000
#define MM_F_HEAP_SORT 0x400000 #define MM_F_HEAP_SORT 0x400000
#define MM_F_ALL_CHAINS 0x800000 #define MM_F_ALL_CHAINS 0x800000
#define MM_F_OUT_MD 0x1000000
#define MM_F_COPY_COMMENT 0x2000000
#define MM_I_HPC 0x1 #define MM_I_HPC 0x1
#define MM_I_NO_SEQ 0x2 #define MM_I_NO_SEQ 0x2
@@ -126,6 +128,7 @@ typedef struct {
int pe_ori, pe_bonus; int pe_ori, pe_bonus;
float mid_occ_frac; // only used by mm_mapopt_update(); see below float mid_occ_frac; // only used by mm_mapopt_update(); see below
int32_t min_mid_occ;
int32_t mid_occ; // ignore seeds with occurrences above this threshold int32_t mid_occ; // ignore seeds with occurrences above this threshold
int32_t max_occ; int32_t max_occ;
int mini_batch_size; // size of a batch of query bases to process in parallel int mini_batch_size; // size of a batch of query bases to process in parallel
+40 -9
View File
@@ -1,4 +1,4 @@
.TH minimap2 1 "24 February 2018" "minimap2-2.9 (r720)" "Bioinformatics tools" .TH minimap2 1 "27 March 2018" "minimap2-2.10 (r761)" "Bioinformatics tools"
.SH NAME .SH NAME
.PP .PP
minimap2 - mapping and alignment between collections of DNA sequences minimap2 - mapping and alignment between collections of DNA sequences
@@ -123,10 +123,27 @@ provided as the target sequences, options
will be effectively overridden by the options stored in the index file. will be effectively overridden by the options stored in the index file.
.SS Mapping options .SS Mapping options
.TP 10 .TP 10
.BI -f \ FLOAT .BI -f \ FLOAT | INT1 [, INT2 ]
Ignore top If fraction, ignore top
.I FLOAT .I FLOAT
fraction of most frequent minimizers [0.0002] fraction of most frequent minimizers [0.0002]. If integer,
ignore minimizers occuring more than
.I INT1
times.
.I INT2
is only effective in the
.B --sr
or
.B -xsr
mode, which sets the threshold for a second round of seeding.
.TP
.BI --min-occ-floor \ INT
Force minimap2 to always use k-mers occurring
.I INT
times or less [0]. In effect, the max occurrence threshold is set to
the
.RI max{ INT ,
.BR -f }.
.TP .TP
.BI -g \ INT .BI -g \ INT
Stop chain enlongation if there are no minimizers within Stop chain enlongation if there are no minimizers within
@@ -353,6 +370,9 @@ SAM read group line in a format like
.B @RG\\\\tID:foo\\\\tSM:bar .B @RG\\\\tID:foo\\\\tSM:bar
[]. [].
.TP .TP
.B -y
Copy input FASTA/Q comments to output.
.TP
.B -c .B -c
Generate CIGAR. In PAF, the CIGAR is written to the `cg' custom tag. Generate CIGAR. In PAF, the CIGAR is written to the `cg' custom tag.
.TP .TP
@@ -371,6 +391,9 @@ is given,
.I short .I short
is assumed. [none] is assumed. [none]
.TP .TP
.B --MD
Output the MD tag (see the SAM spec).
.TP
.B -Y .B -Y
In SAM output, use soft clipping for supplementary alignments. In SAM output, use soft clipping for supplementary alignments.
.TP .TP
@@ -433,18 +456,25 @@ is determined by the sequencing error mode.
.B asm5 .B asm5
Long assembly to reference mapping Long assembly to reference mapping
.RB ( -k19 .RB ( -k19
.B -w19 -A1 -B19 -O39,81 -E3,1 -s200 .B -w19 -A1 -B19 -O39,81 -E3,1 -s200 -z200
.BR -z200 ). .BR --min-occ-floor=100 ).
Typically, the alignment will not extend to regions with 5% or higher sequence Typically, the alignment will not extend to regions with 5% or higher sequence
divergence. Only use this preset if the average divergence is far below 5%. divergence. Only use this preset if the average divergence is far below 5%.
.TP .TP
.B asm10 .B asm10
Long assembly to reference mapping Long assembly to reference mapping
.RB ( -k19 .RB ( -k19
.B -w19 -A1 -B9 -O16,41 -E2,1 -s200 .B -w19 -A1 -B9 -O16,41 -E2,1 -s200 -z200
.BR -z200 ). .BR --min-occ-floor=100 ).
Up to 10% sequence divergence. Up to 10% sequence divergence.
.TP .TP
.B asm20
Long assembly to reference mapping
.RB ( -k19
.B -w10 -A1 -B6 -O6,26 -E2,1 -s200 -z200
.BR --min-occ-floor=100 ).
Up to 20% sequence divergence.
.TP
.B ava-pb .B ava-pb
PacBio all-vs-all overlap mapping PacBio all-vs-all overlap mapping
.RB ( -Hk19 .RB ( -Hk19
@@ -454,7 +484,7 @@ PacBio all-vs-all overlap mapping
.B ava-ont .B ava-ont
Oxford Nanopore all-vs-all overlap mapping Oxford Nanopore all-vs-all overlap mapping
.RB ( -k15 .RB ( -k15
.B -Xw5 -m100 -g10000 --max-chain-skip .B -Xw5 -m100 -g10000 -r2000 --max-chain-skip
.BR 25 ). .BR 25 ).
Similarly, the major difference from Similarly, the major difference from
.B ava-pb .B ava-pb
@@ -535,6 +565,7 @@ cm i Number of minimizers on the chain
s1 i Chaining score s1 i Chaining score
s2 i Chaining score of the best secondary chain s2 i Chaining score of the best secondary chain
NM i Total number of mismatches and gaps in the alignment NM i Total number of mismatches and gaps in the alignment
MD Z To generate the ref sequence in the alignment
AS i DP alignment score AS i DP alignment score
ms i DP score of the max scoring segment in the alignment ms i DP score of the max scoring segment in the alignment
nn i Number of ambiguous bases in the alignment nn i Number of ambiguous bases in the alignment
+11
View File
@@ -1,3 +1,4 @@
#include <stdlib.h>
#include "mmpriv.h" #include "mmpriv.h"
int mm_verbose = 1; int mm_verbose = 1;
@@ -120,6 +121,16 @@ double realtime(void)
return tp.tv_sec + tp.tv_usec * 1e-6; return tp.tv_sec + tp.tv_usec * 1e-6;
} }
void mm_err_puts(const char *str)
{
int ret;
ret = puts(str);
if (ret == EOF) {
fprintf(stderr, "[ERROR] failed to write the results\n");
exit(EXIT_FAILURE);
}
}
#include "ksort.h" #include "ksort.h"
#define sort_key_128x(a) ((a).x) #define sort_key_128x(a) ((a).x)
+226 -62
View File
@@ -1,6 +1,6 @@
#!/usr/bin/env k8 #!/usr/bin/env k8
var paftools_version = 'r713'; var paftools_version = 'r755';
/***************************** /*****************************
***** Library functions ***** ***** Library functions *****
@@ -131,6 +131,40 @@ Interval.find_ovlp = function(a, st, en)
* Reverse and reverse complement * * Reverse and reverse complement *
**********************************/ **********************************/
function fasta_read(fn)
{
var h = {}, gt = '>'.charCodeAt(0);
var file = fn == '-'? new File() : new File(fn);
var buf = new Bytes(), seq = null, name = null, seqlen = [];
while (file.readline(buf) >= 0) {
if (buf[0] == gt) {
if (seq != null && name != null) {
seqlen.push([name, seq.length]);
h[name] = seq;
name = seq = null;
}
var m, line = buf.toString();
if ((m = /^>(\S+)/.exec(line)) != null) {
name = m[1];
seq = new Bytes();
}
} else seq.set(buf);
}
if (seq != null && name != null) {
seqlen.push([name, seq.length]);
h[name] = seq;
}
buf.destroy();
file.close();
return [h, seqlen];
}
function fasta_free(fa)
{
for (var name in fa)
fa[name].destroy();
}
Bytes.prototype.reverse = function() Bytes.prototype.reverse = function()
{ {
for (var i = 0; i < this.length>>1; ++i) { for (var i = 0; i < this.length>>1; ++i) {
@@ -305,14 +339,17 @@ function paf_liftover(args)
// variant calling // variant calling
function paf_call(args) function paf_call(args)
{ {
var re_cs = /([:=*+-])(\d+|[A-Za-z]+)/g; var re_cs = /([:=*+-])(\d+|[A-Za-z]+)/g, re_tag = /\t(\S\S:[AZif]):(\S+)/g;
var c, min_cov_len = 10000, min_var_len = 50000, gap_thres = 50, min_mapq = 5; var c, min_cov_len = 10000, min_var_len = 50000, gap_thres = 50, min_mapq = 5;
while ((c = getopt(args, "l:L:g:q:B:")) != null) { var fa_tmp = null, fa, fa_lens, is_vcf = false;
while ((c = getopt(args, "l:L:g:q:B:f:")) != null) {
if (c == 'l') min_cov_len = parseInt(getopt.arg); if (c == 'l') min_cov_len = parseInt(getopt.arg);
else if (c == 'L') min_var_len = parseInt(getopt.arg); else if (c == 'L') min_var_len = parseInt(getopt.arg);
else if (c == 'g') gap_thres = parseInt(getopt.arg); else if (c == 'g') gap_thres = parseInt(getopt.arg);
else if (c == 'q') min_mapq = parseInt(getopt.arg); else if (c == 'q') min_mapq = parseInt(getopt.arg);
else if (c == 'f') fa_tmp = fasta_read(getopt.arg, fa_lens);
} }
if (fa_tmp != null) fa = fa_tmp[0], fa_lens = fa_tmp[1], is_vcf = true;
if (args.length == getopt.ind) { if (args.length == getopt.ind) {
print("Usage: sort -k6,6 -k8,8n <with-cs.paf> | paftools.js call [options] -"); print("Usage: sort -k6,6 -k8,8n <with-cs.paf> | paftools.js call [options] -");
@@ -321,6 +358,7 @@ function paf_call(args)
print(" -L INT min alignment length to call variants ["+min_var_len+"]"); print(" -L INT min alignment length to call variants ["+min_var_len+"]");
print(" -q INT min mapping quality ["+min_mapq+"]"); print(" -q INT min mapping quality ["+min_mapq+"]");
print(" -g INT short/long gap threshold (for statistics only) ["+gap_thres+"]"); print(" -g INT short/long gap threshold (for statistics only) ["+gap_thres+"]");
print(" -f FILE reference sequences (enabling VCF output) [null]");
exit(1); exit(1);
} }
@@ -328,6 +366,27 @@ function paf_call(args)
var buf = new Bytes(); var buf = new Bytes();
var tot_len = 0, n_sub = [0, 0, 0], n_ins = [0, 0, 0, 0], n_del = [0, 0, 0, 0]; var tot_len = 0, n_sub = [0, 0, 0], n_ins = [0, 0, 0, 0], n_del = [0, 0, 0, 0];
function print_vcf(o, fa)
{
var v = null;
if (o[3] != 1) return; // coverage is one; skip
if (o[5] == '-' && o[6] == '-') return;
if (o[5] != '-' && o[6] != '-') { // snp
v = [o[0], o[1] + 1, '.', o[5].toUpperCase(), o[6].toUpperCase()];
} else if (o[1] > 0) { // shouldn't happen in theory
if (fa[o[0]] == null) throw Error('sequence "' + o[0] + '" is absent from the reference FASTA');
if (o[1] >= fa[o[0]].length) throw Error('position ' + o[1] + ' exceeds the length of sequence "' + o[0] + '"');
var ref = String.fromCharCode(fa[o[0]][o[1]-1]).toUpperCase();
if (o[5] == '-') // insertion
v = [o[0], o[1], '.', ref, ref + o[6].toUpperCase()];
else // deletion
v = [o[0], o[1], '.', ref + o[5].toUpperCase(), ref];
}
v.push(o[4], '.', 'QNAME=' + o[7] + ';QSTART=' + (o[8]+1) + ';QSTRAND=' + (rev? '-' : '+'), 'GT', '1/1');
if (v == null) throw Error("unexpected variant: [" + o.join(",") + "]");
print(v.join("\t"));
}
function count_var(o) function count_var(o)
{ {
if (o[3] > 1) return; if (o[3] > 1) return;
@@ -346,46 +405,66 @@ function paf_call(args)
else ++n_del[3]; else ++n_del[3];
} else { } else {
++n_sub[0]; ++n_sub[0];
var s = o[5] + o[6]; var s = (o[5] + o[6]).toLowerCase();
if (s == 'ag' || s == 'ga' || s == 'ct' || s == 'tc') if (s == 'ag' || s == 'ga' || s == 'ct' || s == 'tc')
++n_sub[1]; ++n_sub[1];
else ++n_sub[2]; else ++n_sub[2];
} }
} }
if (is_vcf) {
print('##fileformat=VCFv4.1');
for (var i = 0; i < fa_lens.length; ++i)
print('##contig=<ID=' + fa_lens[i][0] + ',length=' + fa_lens[i][1] + '>');
print('##INFO=<ID=QNAME,Number=1,Type=String,Description="Query name">');
print('##INFO=<ID=QSTART,Number=1,Type=Integer,Description="Query start">');
print('##INFO=<ID=QSTRAND,Number=1,Type=String,Description="Query strand">');
print('##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">');
print('#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT sample');
}
var a = [], out = []; var a = [], out = [];
var c1_ctg = null, c1_start = 0, c1_end = 0, c1_counted = false, c1_len = 0; var c1_ctg = null, c1_start = 0, c1_end = 0, c1_counted = false, c1_len = 0;
while (file.readline(buf) >= 0) { while (file.readline(buf) >= 0) {
var line = buf.toString(); var line = buf.toString();
if (!/\ts2:i:/.test(line)) continue; // skip secondary alignments
var m, t = line.split("\t", 12); var m, t = line.split("\t", 12);
for (var i = 6; i <= 11; ++i) for (var i = 6; i <= 11; ++i)
t[i] = parseInt(t[i]); t[i] = parseInt(t[i]);
if (t[10] < min_cov_len || t[11] < min_mapq) continue; if (t[10] < min_cov_len || t[11] < min_mapq) continue;
print(t[0], t[7], t[8], c1_start, c1_end); //print(t[0], t[7], t[8], c1_start, c1_end);
for (var i = 1; i <= 3; ++i) for (var i = 1; i <= 3; ++i)
t[i] = parseInt(t[i]); t[i] = parseInt(t[i]);
var ctg = t[5], x = t[7], end = t[8]; var ctg = t[5], x = t[7], end = t[8];
var query = t[0], rev = (t[4] == '-'), y = rev? t[3] : t[2]; var query = t[0], rev = (t[4] == '-'), y = rev? t[3] : t[2];
// collect tags
var cs = null, tp = null, have_s1 = false, have_s2 = false;
while ((m = re_tag.exec(line)) != null) {
if (m[1] == 'cs:Z') cs = m[2];
else if (m[1] == 'tp:A') tp = m[2];
else if (m[1] == 's1:i') have_s1 = true;
else if (m[1] == 's2:i') have_s2 = true;
}
if (have_s1 && !have_s2) continue;
if (tp != null && (tp == 'S' || tp == 'i')) continue;
// compute regions covered by 1 contig // compute regions covered by 1 contig
if (ctg != c1_ctg || x >= c1_end) { if (ctg != c1_ctg || x >= c1_end) {
if (c1_counted && c1_end > c1_start) { if (c1_counted && c1_end > c1_start) {
c1_len += c1_end - c1_start; c1_len += c1_end - c1_start;
print('R', c1_ctg, c1_start, c1_end); if (!is_vcf) print('R', c1_ctg, c1_start, c1_end);
} }
c1_ctg = ctg, c1_start = x, c1_end = end; c1_ctg = ctg, c1_start = x, c1_end = end;
c1_counted = (t[10] >= min_var_len); c1_counted = (t[10] >= min_var_len);
} else if (end > c1_end) { // overlap } else if (end > c1_end) { // overlap
if (c1_counted && x > c1_start) { if (c1_counted && x > c1_start) {
c1_len += x - c1_start; c1_len += x - c1_start;
print('R', c1_ctg, c1_start, x); if (!is_vcf) print('R', c1_ctg, c1_start, x);
} }
c1_start = c1_end, c1_end = end; c1_start = c1_end, c1_end = end;
c1_counted = (t[10] >= min_var_len); c1_counted = (t[10] >= min_var_len);
} else if (end > c1_start) { // contained } else if (end > c1_start) { // contained
if (c1_counted && x > c1_start) { if (c1_counted && x > c1_start) {
c1_len += x - c1_start; c1_len += x - c1_start;
print('R', c1_ctg, c1_start, x); if (!is_vcf) print('R', c1_ctg, c1_start, x);
} }
c1_start = end; c1_start = end;
} // else, the alignment precedes the cov1 region; do nothing } // else, the alignment precedes the cov1 region; do nothing
@@ -393,7 +472,8 @@ function paf_call(args)
while (out.length) { while (out.length) {
if (out[0][0] != ctg || out[0][2] <= x) { if (out[0][0] != ctg || out[0][2] <= x) {
count_var(out[0]); count_var(out[0]);
print('V', out[0].join("\t")); if (is_vcf) print_vcf(out[0], fa);
else print('V', out[0].join("\t"));
out.shift(); out.shift();
} else break; } else break;
} }
@@ -409,8 +489,7 @@ function paf_call(args)
a.length = k; a.length = k;
// core loop // core loop
if (t[10] >= min_var_len) { if (t[10] >= min_var_len) {
if ((m = /\tcs:Z:(\S+)/.exec(line)) == null) continue; // no cs tag if (cs == null) continue; // no cs tag
var cs = m[1];
var blen = 0, n_diff = 0; var blen = 0, n_diff = 0;
tot_len += t[10]; tot_len += t[10];
while ((m = re_cs.exec(cs)) != null) { while ((m = re_cs.exec(cs)) != null) {
@@ -450,11 +529,12 @@ function paf_call(args)
} }
if (c1_counted && c1_end > c1_start) { if (c1_counted && c1_end > c1_start) {
c1_len += c1_end - c1_start; c1_len += c1_end - c1_start;
print('R', c1_ctg, c1_start, c1_end); if (!is_vcf) print('R', c1_ctg, c1_start, c1_end);
} }
while (out.length) { while (out.length) {
count_var(out[0]); count_var(out[0]);
print('V', out[0].join("\t")); if (is_vcf) print_vcf(out[0], fa);
else print('V', out[0].join("\t"));
out.shift(); out.shift();
} }
@@ -472,6 +552,7 @@ function paf_call(args)
buf.destroy(); buf.destroy();
file.close(); file.close();
if (fa != null) fasta_free(fa);
} }
function paf_stat(args) function paf_stat(args)
@@ -912,14 +993,15 @@ function paf_view(args)
function paf_gff2bed(args) function paf_gff2bed(args)
{ {
var c, fn_ucsc_fai = null, is_short = false; var c, fn_ucsc_fai = null, is_short = false, keep_gff = false;
while ((c = getopt(args, "u:s")) != null) { while ((c = getopt(args, "u:sg")) != null) {
if (c == 'u') fn_ucsc_fai = getopt.arg; if (c == 'u') fn_ucsc_fai = getopt.arg;
else if (c == 's') is_short = true; else if (c == 's') is_short = true;
else if (c == 'g') keep_gff = true;
} }
if (getopt.ind == args.length) { if (getopt.ind == args.length) {
print("Usage: paftools.js gff2bed [-u ucsc-genome.fa.fai] <in.gff>"); print("Usage: paftools.js gff2bed [-g] [-u ucsc-genome.fa.fai] <in.gff>");
exit(1); exit(1);
} }
@@ -980,6 +1062,12 @@ function paf_gff2bed(args)
var exons = [], cds_st = 1<<30, cds_en = 0, last_id = null; var exons = [], cds_st = 1<<30, cds_en = 0, last_id = null;
while (file.readline(buf) >= 0) { while (file.readline(buf) >= 0) {
var t = buf.toString().split("\t"); var t = buf.toString().split("\t");
if (keep_gff) {
if (t[0].charAt(0) != '#' && ens2ucsc[t[0]] != null)
t[0] = ens2ucsc[t[0]];
print(t.join("\t"));
continue;
}
if (t[0].charAt(0) == '#') continue; if (t[0].charAt(0) == '#') continue;
if (t[2] != "CDS" && t[2] != "exon") continue; if (t[2] != "CDS" && t[2] != "exon") continue;
t[3] = parseInt(t[3]) - 1; t[3] = parseInt(t[3]) - 1;
@@ -1028,15 +1116,19 @@ function paf_gff2bed(args)
function paf_sam2paf(args) function paf_sam2paf(args)
{ {
var c, pri_only = false; var c, pri_only = false, use_eq = false;
while ((c = getopt(args, "p")) != null) while ((c = getopt(args, "p")) != null)
if (c == 'p') pri_only = true; if (c == 'p') pri_only = true;
if (args.length == getopt.ind) {
print("Usage: paftools.js sam2paf [-p] <in.sam>");
exit(1);
}
var file = args.length == getopt.ind || args[getopt.ind] == "-"? new File() : new File(args[getopt.ind]); var file = args[getopt.ind] == "-"? new File() : new File(args[getopt.ind]);
var buf = new Bytes(); var buf = new Bytes();
var re = /(\d+)([MIDSHNX=])/g; var re = /(\d+)([MIDSHNX=])/g, re_MD = /(\d+)|(\^[A-Za-z]+)|([A-Za-z])/g, re_tag = /\t(\S\S:[AZif]):(\S+)/g;
var len = {}, lineno = 0; var ctg_len = {}, lineno = 0;
while (file.readline(buf) >= 0) { while (file.readline(buf) >= 0) {
var m, n_cigar = 0, line = buf.toString(); var m, n_cigar = 0, line = buf.toString();
++lineno; ++lineno;
@@ -1044,37 +1136,52 @@ function paf_sam2paf(args)
if (/^@SQ/.test(line)) { if (/^@SQ/.test(line)) {
var name = (m = /\tSN:(\S+)/.exec(line)) != null? m[1] : null; var name = (m = /\tSN:(\S+)/.exec(line)) != null? m[1] : null;
var l = (m = /\tLN:(\d+)/.exec(line)) != null? parseInt(m[1]) : null; var l = (m = /\tLN:(\d+)/.exec(line)) != null? parseInt(m[1]) : null;
if (name != null && l != null) len[name] = l; if (name != null && l != null) ctg_len[name] = l;
} }
continue; continue;
} }
var t = line.split("\t"); var t = line.split("\t", 11);
var flag = parseInt(t[1]); var flag = parseInt(t[1]);
if (t[9] != '*' && t[10] != '*' && t[9].length != t[10].length) throw Error("ERROR at line " + lineno + ": inconsistent SEQ and QUAL lengths - " + t[9].length + " != " + t[10].length); if (t[9] != '*' && t[10] != '*' && t[9].length != t[10].length)
if (t[2] == '*' || (flag&4)) continue; throw Error("at line " + lineno + ": inconsistent SEQ and QUAL lengths - " + t[9].length + " != " + t[10].length);
if (t[2] == '*' || (flag&4) || t[5] == '*') continue;
if (pri_only && (flag&0x100)) continue; if (pri_only && (flag&0x100)) continue;
var tlen = len[t[2]]; var tlen = ctg_len[t[2]];
if (tlen == null) throw Error("ERROR at line " + lineno + ": can't find the length of contig " + t[2]); if (tlen == null) throw Error("at line " + lineno + ": can't find the length of contig " + t[2]);
var nn = (m = /\tnn:i:(\d+)/.exec(line)) != null? parseInt(m[1]) : 0; // find tags
var NM = (m = /\tNM:i:(\d+)/.exec(line)) != null? parseInt(m[1]) : null; var nn = 0, NM = null, MD = null, md_list = [];
var have_NM = NM == null? false : true; while ((m = re_tag.exec(line)) != null) {
NM += nn; if (m[1] == "NM:i") NM = parseInt(m[2]);
var clip = [0, 0], I = [0, 0], D = [0, 0], M = 0, N = 0, ql = 0, tl = 0, mm = 0, ext_cigar = false; else if (m[1] == "nn:i") nn = parseInt(m[2]);
while ((m = re.exec(t[5])) != null) { else if (m[1] == "MD:Z") MD = m[2];
var l = parseInt(m[1]);
if (m[2] == 'M') M += l, ql += l, tl += l, ext_cigar = false;
else if (m[2] == 'I') ++I[0], I[1] += l, ql += l;
else if (m[2] == 'D') ++D[0], D[1] += l, tl += l;
else if (m[2] == 'N') N += l, tl += l;
else if (m[2] == 'S') clip[M == 0? 0 : 1] = l, ql += l;
else if (m[2] == 'H') clip[M == 0? 0 : 1] = l;
else if (m[2] == '=') M += l, ql += l, tl += l, ext_cigar = true;
else if (m[2] == 'X') M += l, ql += l, tl += l, mm += l, ext_cigar = true;
++n_cigar;
} }
if (t[9] == '*') MD = null;
// infer various lengths from CIGAR
var clip = [0, 0], soft_clip = 0, I = [0, 0], D = [0, 0], M = 0, N = 0, mm = 0, have_M = false, have_ext = false, cigar = [];
while ((m = re.exec(t[5])) != null) {
var l = parseInt(m[1]), op = m[2];
if (op == 'M') M += l, have_M = true;
else if (op == 'I') ++I[0], I[1] += l;
else if (op == 'D') ++D[0], D[1] += l;
else if (op == 'N') N += l;
else if (op == 'S') clip[n_cigar == 0? 0 : 1] = l, soft_clip += l;
else if (op == 'H') clip[n_cigar == 0? 0 : 1] = l;
else if (op == '=') M += l, have_ext = true, op = 'M';
else if (op == 'X') M += l, mm += l, have_ext = true, op = 'M';
++n_cigar;
if (MD != null && op != 'H') {
if (cigar.length > 0 && cigar[cigar.length-1][1] == op)
cigar[cigar.length-1][0] += l;
else cigar.push([l, op]);
}
}
var ql = M + I[1] + soft_clip;
var tl = M + D[1] + N;
var ts = parseInt(t[3]) - 1, te = ts + tl;
// checking coordinate and length consistencies
if (n_cigar > 65535) if (n_cigar > 65535)
warn("WARNING at line " + lineno + ": " + n_cigar + " CIGAR operations"); warn("WARNING at line " + lineno + ": " + n_cigar + " CIGAR operations");
if (tl + parseInt(t[3]) - 1 > tlen) { if (te > tlen) {
warn("WARNING at line " + lineno + ": alignment end position larger than ref length; skipped"); warn("WARNING at line " + lineno + ": alignment end position larger than ref length; skipped");
continue; continue;
} }
@@ -1082,24 +1189,78 @@ function paf_sam2paf(args)
warn("WARNING at line " + lineno + ": SEQ length inconsistent with CIGAR (" + t[9].length + " != " + ql + "); skipped"); warn("WARNING at line " + lineno + ": SEQ length inconsistent with CIGAR (" + t[9].length + " != " + ql + "); skipped");
continue; continue;
} }
if (!have_NM || ext_cigar) NM = I[1] + D[1] + mm; // parse MD
if (NM < I[1] + D[1] + mm) { var cs = [];
warn("WARNING at line " + lineno + ": NM is less than the total number of gaps (" + NM + " < " + (I[1]+D[1]+mm) + ")"); if (MD != null) {
NM = I[1] + D[1] + mm; var k = 0, cx = 0, cy = 0, mx = 0, my = 0;
while ((m = re_MD.exec(MD)) != null) {
if (m[2] != null) { // deletion from the reference
var len = m[2].length - 1;
cs.push('-', m[2].substr(1));
mx += len, cx += len, ++k;
} else { // copy or mismatch
var ml = m[1] != null? parseInt(m[1]) : 1;
while (k < cigar.length && cigar[k][1] != 'D') {
var cl = cigar[k][0], op = cigar[k][1];
if (op == 'M') {
if (my + ml < cy + cl) {
if (ml > 0) {
if (m[3] != null) cs.push('*', m[3], t[9][my]);
else cs.push(':', ml);
} }
var extra = ["mm:i:"+(NM-I[1]-D[1]), "io:i:"+I[0], "in:i:"+I[1], "do:i:"+D[0], "dn:i:"+D[1]]; mx += ml, my += ml, ml = 0;
var match = M - (NM - I[1] - D[1]); break;
} else {
var dl = cy + cl - my;
cs.push(':', dl);
cx += cl, cy += cl, ++k;
mx += dl, my += dl, ml -= dl;
}
} else if (op == 'I') {
cs.push('+', t[9].substr(cy, cl));
cy += cl, my += cl, ++k;
} else if (op == 'S') {
cy += cl, my += cl, ++k;
} else throw Error("at line " + lineno + ": inconsistent MD tag");
}
if (ml != 0) throw Error("at line " + lineno + ": inconsistent MD tag");
}
}
if (cx != mx || cy != my) throw Error("at line " + lineno + ": inconsistent MD tag");
}
// compute matching length, block length and calibrate NM
if (have_ext && !have_M) { // extended CIGAR
if (NM != null && NM != I[1] + D[1] + mm)
warn("WARNING at line " + lineno + ": NM is different from sum of gaps and mismatches");
NM = I[1] + D[1] + mm;
} else if (NM != null) { // standard CIGAR; NM present
if (NM < I[1] + D[1]) {
warn("WARNING at line " + lineno + ": NM is less than the total number of gaps (" + NM + " < " + (I[1]+D[1]) + ")");
NM = I[1] + D[1];
}
mm = NM - (I[1] + D[1]);
} else { // no way to compute mm
warn("WARNING at line " + lineno + ": unable to find the number of mismatches; assuming zero");
mm = 0;
}
var mlen = M - mm;
var blen = M + I[1] + D[1]; var blen = M + I[1] + D[1];
// find query name, start and end
var qlen = M + I[1] + clip[0] + clip[1]; var qlen = M + I[1] + clip[0] + clip[1];
var qs, qe; var qname = t[0], qs, qe;
if (flag&16) qs = clip[1], qe = qlen - clip[0];
else qs = clip[0], qe = qlen - clip[1];
var ts = parseInt(t[3]) - 1, te = ts + M + D[1] + N;
var qname = t[0];
if ((flag&1) && (flag&0x40)) qname += '/1'; if ((flag&1) && (flag&0x40)) qname += '/1';
if ((flag&1) && (flag&0x80)) qname += '/2'; if ((flag&1) && (flag&0x80)) qname += '/2';
var a = [qname, qlen, qs, qe, flag&16? '-' : '+', t[2], tlen, ts, te, match, blen, t[4]]; if (flag&16) qs = clip[1], qe = qlen - clip[0];
print(a.join("\t"), extra.join("\t")); else qs = clip[0], qe = qlen - clip[1];
// optional tags
var type = flag&0x100? 'S' : 'P';
var tags = ["tp:A:" + type];
if (NM != null) tags.push("mm:i:"+mm);
tags.push("gn:i:"+(I[1]+D[1]), "go:i:"+(I[0]+D[0]), "cg:Z:" + t[5].replace(/\d+[SH]/g, ''));
if (cs.length > 0) tags.push("cs:Z:" + cs.join(""));
// print out
var a = [qname, qlen, qs, qe, flag&16? '-' : '+', t[2], tlen, ts, te, mlen, blen, t[4]];
print(a.join("\t"), tags.join("\t"));
} }
buf.destroy(); buf.destroy();
@@ -1597,26 +1758,28 @@ function paf_pbsim2fq(args)
function paf_junceval(args) function paf_junceval(args)
{ {
var c, l_fuzzy = 0, print_ovlp = false, print_err_only = false, first_only = false; var c, l_fuzzy = 0, print_ovlp = false, print_err_only = false, first_only = false, chr_only = false;
while ((c = getopt(args, "l:ep")) != null) { while ((c = getopt(args, "l:epc")) != null) {
if (c == 'l') l_fuzzy = parseInt(getopt.arg); if (c == 'l') l_fuzzy = parseInt(getopt.arg);
else if (c == 'e') print_err_only = print_ovlp = true; else if (c == 'e') print_err_only = print_ovlp = true;
else if (c == 'p') print_ovlp = true; else if (c == 'p') print_ovlp = true;
else if (c == 'c') chr_only = true;
} }
if (args.length - getopt.ind < 2) { if (args.length - getopt.ind < 1) {
print("Usage: paftools.js junceval [options] <gene.gtf> <aln.sam>"); print("Usage: paftools.js junceval [options] <gene.gtf> <aln.sam>");
print("Options:"); print("Options:");
print(" -l INT tolerance of junction positions (0 for exact) [0]"); print(" -l INT tolerance of junction positions (0 for exact) [0]");
print(" -p print overlapping introns"); print(" -p print overlapping introns");
print(" -e print erroreous overlapping introns"); print(" -e print erroreous overlapping introns");
print(" -c only consider alignments to /^(chr)?([0-9]+|X|Y)$/");
exit(1); exit(1);
} }
var file, buf = new Bytes(); var file, buf = new Bytes();
var tr = {}; var tr = {};
file = new File(args[getopt.ind]); file = args[getopt.ind] == '-'? new File() : new File(args[getopt.ind]);
while (file.readline(buf) >= 0) { while (file.readline(buf) >= 0) {
var m, t = buf.toString().split("\t"); var m, t = buf.toString().split("\t");
if (t[0].charAt(0) == '#') continue; if (t[0].charAt(0) == '#') continue;
@@ -1661,13 +1824,14 @@ function paf_junceval(args)
var n_pri = 0, n_unmapped = 0, n_mapped = 0; var n_pri = 0, n_unmapped = 0, n_mapped = 0;
var n_sgl = 0, n_splice = 0, n_splice_hit = 0, n_splice_novel = 0; var n_sgl = 0, n_splice = 0, n_splice_hit = 0, n_splice_novel = 0;
file = new File(args[getopt.ind+1]); file = getopt.ind+1 >= args.length || args[getopt.ind+1] == '-'? new File() : new File(args[getopt.ind+1]);
var last_qname = null; var last_qname = null;
var re_cigar = /(\d+)([MIDNSHX=])/g; var re_cigar = /(\d+)([MIDNSHX=])/g;
while (file.readline(buf) >= 0) { while (file.readline(buf) >= 0) {
var m, t = buf.toString().split("\t"); var m, t = buf.toString().split("\t");
if (t[0].charAt(0) == '@') continue; if (t[0].charAt(0) == '@') continue;
if (chr_only && !/^(chr)?([0-9]+|X|Y)$/.test(t[2])) continue;
var flag = parseInt(t[1]); var flag = parseInt(t[1]);
if (flag&0x100) continue; if (flag&0x100) continue;
if (first_only && last_qname == t[0]) continue; if (first_only && last_qname == t[0]) continue;
+2
View File
@@ -86,6 +86,8 @@ mm_seg_t *mm_seg_gen(void *km, uint32_t hash, int n_segs, const int *qlens, int
void mm_seg_free(void *km, int n_segs, mm_seg_t *segs); void mm_seg_free(void *km, int n_segs, mm_seg_t *segs);
void mm_pair(void *km, int max_gap_ref, int dp_bonus, int sub_diff, int match_sc, const int *qlens, int *n_regs, mm_reg1_t **regs); void mm_pair(void *km, int max_gap_ref, int dp_bonus, int sub_diff, int match_sc, const int *qlens, int *n_regs, mm_reg1_t **regs);
void mm_err_puts(const char *str);
#ifdef __cplusplus #ifdef __cplusplus
} }
#endif #endif
+11
View File
@@ -51,6 +51,8 @@ void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
opt->flag |= MM_F_SPLICE; opt->flag |= MM_F_SPLICE;
if (opt->mid_occ <= 0) if (opt->mid_occ <= 0)
opt->mid_occ = mm_idx_cal_max_occ(mi, opt->mid_occ_frac); opt->mid_occ = mm_idx_cal_max_occ(mi, opt->mid_occ_frac);
if (opt->mid_occ < opt->min_mid_occ)
opt->mid_occ = opt->min_mid_occ;
if (mm_verbose >= 3) if (mm_verbose >= 3)
fprintf(stderr, "[M::%s::%.3f*%.2f] mid_occ = %d\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), opt->mid_occ); fprintf(stderr, "[M::%s::%.3f*%.2f] mid_occ = %d\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), opt->mid_occ);
} }
@@ -74,6 +76,7 @@ int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
io->flag |= MM_I_HPC, io->k = 19, io->w = 5; io->flag |= MM_I_HPC, io->k = 19, io->w = 5;
mo->flag |= MM_F_ALL_CHAINS | MM_F_NO_DIAG | MM_F_NO_DUAL | MM_F_NO_LJOIN; mo->flag |= MM_F_ALL_CHAINS | MM_F_NO_DIAG | MM_F_NO_DUAL | MM_F_NO_LJOIN;
mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_gap = 10000, mo->max_chain_skip = 25; mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_gap = 10000, mo->max_chain_skip = 25;
mo->bw = 2000;
} else if (strcmp(preset, "map10k") == 0 || strcmp(preset, "map-pb") == 0) { } else if (strcmp(preset, "map10k") == 0 || strcmp(preset, "map-pb") == 0) {
io->flag |= MM_I_HPC, io->k = 19; io->flag |= MM_I_HPC, io->k = 19;
} else if (strcmp(preset, "map-ont") == 0) { } else if (strcmp(preset, "map-ont") == 0) {
@@ -81,11 +84,19 @@ int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
} else if (strcmp(preset, "asm5") == 0) { } else if (strcmp(preset, "asm5") == 0) {
io->flag = 0, io->k = 19, io->w = 19; io->flag = 0, io->k = 19, io->w = 19;
mo->a = 1, mo->b = 19, mo->q = 39, mo->q2 = 81, mo->e = 3, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200; mo->a = 1, mo->b = 19, mo->q = 39, mo->q2 = 81, mo->e = 3, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
mo->min_mid_occ = 100;
mo->min_dp_max = 200; mo->min_dp_max = 200;
mo->best_n = 50; mo->best_n = 50;
} else if (strcmp(preset, "asm10") == 0) { } else if (strcmp(preset, "asm10") == 0) {
io->flag = 0, io->k = 19, io->w = 19; io->flag = 0, io->k = 19, io->w = 19;
mo->a = 1, mo->b = 9, mo->q = 16, mo->q2 = 41, mo->e = 2, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200; mo->a = 1, mo->b = 9, mo->q = 16, mo->q2 = 41, mo->e = 2, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
mo->min_mid_occ = 100;
mo->min_dp_max = 200;
mo->best_n = 50;
} else if (strcmp(preset, "asm20") == 0) {
io->flag = 0, io->k = 19, io->w = 10;
mo->a = 1, mo->b = 4, mo->q = 6, mo->q2 = 26, mo->e = 2, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
mo->min_mid_occ = 100;
mo->min_dp_max = 200; mo->min_dp_max = 200;
mo->best_n = 50; mo->best_n = 50;
} else if (strcmp(preset, "short") == 0 || strcmp(preset, "sr") == 0) { } else if (strcmp(preset, "short") == 0 || strcmp(preset, "sr") == 0) {
+4 -4
View File
@@ -119,11 +119,11 @@ static char *mappy_fetch_seq(const mm_idx_t *mi, const char *name, int st, int e
*len = 0; *len = 0;
rid = mm_idx_name2id(mi, name); rid = mm_idx_name2id(mi, name);
if (rid < 0) return 0; if (rid < 0) return 0;
if (st >= mi->seq[i].len || st >= en) return 0; if (st >= mi->seq[rid].len || st >= en) return 0;
if (en < 0 || en > mi->seq[i].len) if (en < 0 || en > mi->seq[rid].len)
en = mi->seq[i].len; en = mi->seq[rid].len;
s = (char*)malloc(en - st + 1); s = (char*)malloc(en - st + 1);
*len = mm_idx_getseq(mi, rid, st, en, s); *len = mm_idx_getseq(mi, rid, st, en, (uint8_t*)s);
for (i = 0; i < *len; ++i) for (i = 0; i < *len; ++i)
s[i] = "ACGTN"[(uint8_t)s[i]]; s[i] = "ACGTN"[(uint8_t)s[i]];
s[*len] = 0; s[*len] = 0;
+3 -1
View File
@@ -34,6 +34,7 @@ cdef extern from "minimap.h":
float max_clip_ratio float max_clip_ratio
int pe_ori, pe_bonus int pe_ori, pe_bonus
float mid_occ_frac float mid_occ_frac
int32_t min_mid_occ
int32_t mid_occ int32_t mid_occ
int32_t max_occ int32_t max_occ
int mini_batch_size int mini_batch_size
@@ -58,7 +59,8 @@ cdef extern from "minimap.h":
mm_idx_seq_t *seq mm_idx_seq_t *seq
uint32_t *S uint32_t *S
mm_idx_bucket_t *B mm_idx_bucket_t *B
void *km, *h void *km
void *h
ctypedef struct mm_idx_reader_t: ctypedef struct mm_idx_reader_t:
pass pass
+2 -2
View File
@@ -23,7 +23,7 @@ def readme():
setup( setup(
name = 'mappy', name = 'mappy',
version = '2.9', version = '2.10',
url = 'https://github.com/lh3/minimap2', url = 'https://github.com/lh3/minimap2',
description = 'Minimap2 python binding', description = 'Minimap2 python binding',
long_description = readme(), long_description = readme(),
@@ -39,7 +39,7 @@ setup(
depends = ['minimap.h', 'bseq.h', 'kalloc.h', 'kdq.h', 'khash.h', 'kseq.h', 'ksort.h', depends = ['minimap.h', 'bseq.h', 'kalloc.h', 'kdq.h', 'khash.h', 'kseq.h', 'ksort.h',
'ksw2.h', 'kthread.h', 'kvec.h', 'mmpriv.h', 'sdust.h', 'ksw2.h', 'kthread.h', 'kvec.h', 'mmpriv.h', 'sdust.h',
'python/cmappy.h', 'python/cmappy.pxd'], 'python/cmappy.h', 'python/cmappy.pxd'],
extra_compile_args = ['-DHAVE_KALLOC', '-msse4'], # WARNING: ancient x86_64 CPUs don't have SSE4 extra_compile_args = ['-DHAVE_KALLOC', '-msse4.1'], # WARNING: ancient x86_64 CPUs don't have SSE4
include_dirs = ['.'], include_dirs = ['.'],
libraries = ['z', 'm', 'pthread'])], libraries = ['z', 'm', 'pthread'])],
classifiers = [ classifiers = [
+1 -1
View File
@@ -1,4 +1,4 @@
>MT_orang >MT_orang co:Z:comment
GTTTATGTAGCTTATTCTATCCAAAGCAATGCACTGAAAATGTCTCGACGGGCCCACACG GTTTATGTAGCTTATTCTATCCAAAGCAATGCACTGAAAATGTCTCGACGGGCCCACACG
CCCCATAAACAAATAGGTTTGGTCCTAGCCTTTCTATTAGCTCTTAGTGAGGTTACACAT CCCCATAAACAAATAGGTTTGGTCCTAGCCTTTCTATTAGCTCTTAGTGAGGTTACACAT
GCAAGCATCCCCGCCCCAGTGAGTCGCCCTCCAAGTCACTCTGACTAAGAGGAGCAAGCA GCAAGCATCCCCGCCCCAGTGAGTCGCCCTCCAAGTCACTCTGACTAAGAGGAGCAAGCA
+16 -15
View File
@@ -61,13 +61,6 @@
Volume = {32}, Volume = {32},
Year = {2016}} Year = {2016}}
@misc{Suzuki:2016,
title = {Fast and accurate alignment tool for PacBio and Nanopore long reads},
author = {Hajime Suzuki},
journal = {Unpublished},
howpublished = {\href{https://github.com/ocxtal/minialign}{https://github.com/ocxtal/minialign}},
year = {2016}}
@misc{Ruan:2016, @misc{Ruan:2016,
title = {Ultra-fast de novo assembler using long noisy reads}, title = {Ultra-fast de novo assembler using long noisy reads},
author = {Jue Ruan}, author = {Jue Ruan},
@@ -172,14 +165,6 @@
Volume = {29}, Volume = {29},
Year = {2011}} Year = {2011}}
@article {Suzuki130633,
author = {Suzuki, Hajime and Kasahara, Masahiro},
title = {Acceleration Of Nucleotide Semi-Global Alignment With Adaptive Banded Dynamic Programming},
year = {2017},
note = {doi:10.1101/130633},
publisher = {Cold Spring Harbor Labs Journals},
journal = {bioRxiv}}
@article{Gotoh:1982aa, @article{Gotoh:1982aa,
Author = {Gotoh, O}, Author = {Gotoh, O},
Journal = {J Mol Biol}, Journal = {J Mol Biol},
@@ -337,3 +322,19 @@
Title = {{MUMmer4}: A fast and versatile genome alignment system}, Title = {{MUMmer4}: A fast and versatile genome alignment system},
Volume = {14}, Volume = {14},
Year = {2018}} Year = {2018}}
@article{Li:2009ys,
Author = {Li, Heng and others},
Journal = {Bioinformatics},
Pages = {2078-9},
Title = {The {Sequence Alignment/Map format and SAMtools}},
Volume = {25},
Year = {2009}}
@article{Suzuki:2018aa,
Author = {Suzuki, Hajime and Kasahara, Masahiro},
Journal = {BMC Bioinformatics},
Pages = {45},
Title = {Introducing difference recurrence relations for faster semi-global alignment of long sequences},
Volume = {19},
Year = {2018}}
+23 -16
View File
@@ -19,7 +19,7 @@
\begin{document} \begin{document}
\firstpage{1} \firstpage{1}
\title[Aligning nucleotide sequences with minimap2]{Minimap2: versatile pairwise alignment for nucleotide sequences} \title[Aligning nucleotide sequences with minimap2]{Minimap2: pairwise alignment for nucleotide sequences}
\author[Li]{Heng Li} \author[Li]{Heng Li}
\address{Broad Institute, 415 Main Street, Cambridge, MA 02142, USA} \address{Broad Institute, 415 Main Street, Cambridge, MA 02142, USA}
@@ -64,7 +64,7 @@ the thought that 10kb long sequences should be easier to map than 100bp reads
because we can more effectively skip repetitive regions, which are often the because we can more effectively skip repetitive regions, which are often the
bottleneck of short-read alignment. We confirmed our speculation by achieving bottleneck of short-read alignment. We confirmed our speculation by achieving
approximate mapping 50 times faster than BWA-MEM~\citep{Li:2016aa}. approximate mapping 50 times faster than BWA-MEM~\citep{Li:2016aa}.
\citet{Suzuki130633} extended our work with a fast and novel algorithm on \citet{Suzuki:2018aa} extended our work with a fast and novel algorithm on
generating base-level alignment, which in turn inspired us to develop minimap2 generating base-level alignment, which in turn inspired us to develop minimap2
with added functionality. with added functionality.
@@ -88,7 +88,9 @@ the versatility of minimap2.
Minimap2 follows a typical seed-chain-align procedure as is used by most Minimap2 follows a typical seed-chain-align procedure as is used by most
full-genome aligners. It collects minimizers~\citep{Roberts:2004fv} of the full-genome aligners. It collects minimizers~\citep{Roberts:2004fv} of the
reference sequences and indexes them in a hash table. Then for each query reference sequences and indexes them in a hash table, with the key being the
hash of a minimizer and the value being a list of locations of the minimizer
copies. Then for each query
sequence, minimap2 takes query minimizers as \emph{seeds}, finds exact matches sequence, minimap2 takes query minimizers as \emph{seeds}, finds exact matches
(i.e. \emph{anchors}) to the reference, and identifies sets of colinear anchors as (i.e. \emph{anchors}) to the reference, and identifies sets of colinear anchors as
\emph{chains}. If base-level alignment is requested, minimap2 applies dynamic \emph{chains}. If base-level alignment is requested, minimap2 applies dynamic
@@ -118,9 +120,12 @@ distance between two anchors is too large); otherwise
\begin{equation}\label{eq:chain-gap} \begin{equation}\label{eq:chain-gap}
\beta(j,i)=\gamma_c\big((y_i-y_j)-(x_i-x_j)\big) \beta(j,i)=\gamma_c\big((y_i-y_j)-(x_i-x_j)\big)
\end{equation} \end{equation}
In implementation, a gap of length $l\not=0$ costs In implementation, a gap of length $l$ costs
\[ \[
\gamma_c(l)=0.01\cdot \bar{w}\cdot|l|+0.5\log_2|l| \gamma_c(l)=\left\{\begin{array}{ll}
0.01\cdot \bar{w}\cdot|l|+0.5\log_2|l| & (l\not=0) \\
0 & (l=0)
\end{array}\right.
\] \]
where $\bar{w}$ is the average seed length. For $N$ anchors, directly computing all $f(\cdot)$ with where $\bar{w}$ is the average seed length. For $N$ anchors, directly computing all $f(\cdot)$ with
Eq.~(\ref{eq:chain}) takes $O(N^2)$ time. Although theoretically faster Eq.~(\ref{eq:chain}) takes $O(N^2)$ time. Although theoretically faster
@@ -164,7 +169,7 @@ empirical formula:
\[ \[
{\rm mapQ}=40\cdot (1-f_2/f_1)\cdot\min\{1,m/10\}\cdot\log f_1 {\rm mapQ}=40\cdot (1-f_2/f_1)\cdot\min\{1,m/10\}\cdot\log f_1
\] \]
where $m$ is the number of anchors on the primary chain, $f_1$ is the chaining where $\log$ denotes natural logarithm, $m$ is the number of anchors on the primary chain, $f_1$ is the chaining
score, and $f_2\le f_1$ is the score of the best chain that is secondary to the score, and $f_2\le f_1$ is the score of the best chain that is secondary to the
primary chain. Intuitively, a chain is assigned to a higher mapping quality if primary chain. Intuitively, a chain is assigned to a higher mapping quality if
it is long and its best secondary chain is weak. it is long and its best secondary chain is weak.
@@ -253,7 +258,7 @@ performance of minimap2. Traditional SSE implementations~\citep{Farrar:2007hs}
based on Eq.~(\ref{eq:ae86}) can achieve 16-way parallelization for short based on Eq.~(\ref{eq:ae86}) can achieve 16-way parallelization for short
sequences, but only 4-way parallelization when the peak alignment score reaches sequences, but only 4-way parallelization when the peak alignment score reaches
32767. Long sequence alignment may exceed this threshold. Inspired by 32767. Long sequence alignment may exceed this threshold. Inspired by
\citet{Wu:1996aa} and the following work, \citet{Suzuki130633} proposed a \citet{Wu:1996aa} and the following work, \citet{Suzuki:2018aa} proposed a
difference-based formulation that lifted this limitation. difference-based formulation that lifted this limitation.
In case of 2-piece gap cost, define In case of 2-piece gap cost, define
\[ \[
@@ -320,7 +325,7 @@ y_{rt}&=&\max\{0,y_{r-1,t}+u_{r-1,t}-z_{rt}+q\}-q-e\\
\end{equation*} \end{equation*}
In this formulation, cells with the same diagonal index $r$ are independent of In this formulation, cells with the same diagonal index $r$ are independent of
each other. This allows us to fully vectorize the computation of all cells on each other. This allows us to fully vectorize the computation of all cells on
the same anti-diagonal in one inner loop. It also simplifies banded alignment, the same anti-diagonal in one inner loop. It also simplifies banded alignment (500bp band width by default),
which would be difficult with striped vectorization~\citep{Farrar:2007hs}. which would be difficult with striped vectorization~\citep{Farrar:2007hs}.
On the condition that $q+e<\tilde{q}+\tilde{e}$ and $e>\tilde{e}$, the initial On the condition that $q+e<\tilde{q}+\tilde{e}$ and $e>\tilde{e}$, the initial
@@ -355,7 +360,7 @@ times as fast as Parasail's 4-way vectorization~\citep{Daily:2016aa}. Without
banding, our implementation is slower than Edlib~\citep{Sosic:2017aa}, but with banding, our implementation is slower than Edlib~\citep{Sosic:2017aa}, but with
a 1000bp band, it is considerably faster. When performing global alignment a 1000bp band, it is considerably faster. When performing global alignment
between anchors, we expect the alignment to stay close to the diagonal of the between anchors, we expect the alignment to stay close to the diagonal of the
DP matrix. Banding is applicable most of time. DP matrix. Banding is applicable most of the time.
\subsubsection{The Z-drop heuristic} \subsubsection{The Z-drop heuristic}
@@ -478,7 +483,7 @@ both C and Python. It is distributed under the MIT license, free to both
commercial and academic uses. Minimap2 uses the same base algorithm for all commercial and academic uses. Minimap2 uses the same base algorithm for all
applications, but it has to apply different sets of parameters depending on applications, but it has to apply different sets of parameters depending on
input data types. Similar to BWA-MEM, minimap2 introduces `presets' that input data types. Similar to BWA-MEM, minimap2 introduces `presets' that
modify multiple parameters with a simple invokation. Detailed settings modify multiple parameters with a simple invocation. Detailed settings
and command-line options can be found in the minimap2 manpage. In addition to and command-line options can be found in the minimap2 manpage. In addition to
the applications evaluated in the following sections, minimap2 also retains the applications evaluated in the following sections, minimap2 also retains
minimap's functionality to find overlaps between long reads and to search minimap's functionality to find overlaps between long reads and to search
@@ -570,7 +575,7 @@ Peak RAM (GByte) & 8.9 & 14.5 & 3.2 & 29.2\vspace{1em}\\
\% approx. introns & 91.8\% & 96.9\% & 92.5\% & 82.4\% \\ \% approx. introns & 91.8\% & 96.9\% & 92.5\% & 82.4\% \\
\botrule \botrule
\end{tabular} \end{tabular}
}{Mouse reads (AC:SRR5286960; R9.4 chemistry) were mapped to the primary assembly of mouse }{Mouse cDNA reads (AC:SRR5286960; R9.4 chemistry) were mapped to the primary assembly of mouse
genome GRCm38 with the following tools and command options: minimap2 (`-ax genome GRCm38 with the following tools and command options: minimap2 (`-ax
splice'); GMAP (`-n 0 --min-intronlength 30 --cross-species'); SpAln (`-Q7 -LS splice'); GMAP (`-n 0 --min-intronlength 30 --cross-species'); SpAln (`-Q7 -LS
-S3'); STARlong (according to -S3'); STARlong (according to
@@ -579,7 +584,7 @@ compared to the EnsEMBL gene annotation, release 89. A predicted intron
is \emph{novel} if it has no overlaps with any annotated introns. An intron is \emph{novel} if it has no overlaps with any annotated introns. An intron
is \emph{exact} if it is identical to an annotated intron. An intron is is \emph{exact} if it is identical to an annotated intron. An intron is
\emph{approximate} if both its 5'- and 3'-end are within 10bp around the ends \emph{approximate} if both its 5'- and 3'-end are within 10bp around the ends
of an annotated intron.} of an annotated intron. Chimeric alignments are defined in the SAM spec~\citep{Li:2009ys}.}
\end{table} \end{table}
We next aligned real mouse reads~\citep{Byrne:2017aa} with GMAP~(v2017-06-20; We next aligned real mouse reads~\citep{Byrne:2017aa} with GMAP~(v2017-06-20;
@@ -647,9 +652,9 @@ across the whole genome and have been \emph{de novo} assembled with SMRT reads
to high quality. This allowed us to construct an independent truth variant to high quality. This allowed us to construct an independent truth variant
dataset~\citep{Li223297} for dataset~\citep{Li223297} for
ERR1341796. In this evaluation, minimap2 has higher SNP false negative rate ERR1341796. In this evaluation, minimap2 has higher SNP false negative rate
(FNR; 2.5\% of minimap2 vs 2.2\% of BWA-MEM), but fewer false positive SNPs per (FNR; 2.6\% of minimap2 vs 2.3\% of BWA-MEM), but fewer false positive SNPs per
million bases (FPPM; 3.0 vs 3.9), lower 2--50bp INDEL FNR (7.3\% vs 7.5\%) and million bases (FPPM; 7.0 vs 8.8), similar INDEL FNR (11.2\% vs 11.3\%) and
similar INDEL FPPM (both 1.0). Minimap2 is broadly similar to BWA-MEM in the similar INDEL FPPM (6.4 vs 6.5). Minimap2 is broadly comparable to BWA-MEM in the
context of small variant calling. context of small variant calling.
\subsection{Aligning long-read assemblies} \subsection{Aligning long-read assemblies}
@@ -687,7 +692,7 @@ involving $>$100kb introns, which was impractically slow ten years ago. The
minimap2 chaining algorithm is fast and highly accurate by itself. In fact, minimap2 chaining algorithm is fast and highly accurate by itself. In fact,
chaining alone is more accurate than all the other long-read mappers in chaining alone is more accurate than all the other long-read mappers in
Fig.~\ref{fig:eval}a (data not shown). This accuracy helps to reduce downstream Fig.~\ref{fig:eval}a (data not shown). This accuracy helps to reduce downstream
base-level alignment of candidate chains, which is still times slower than base-level alignment of candidate chains, which is still several times slower than
chaining even with the Suzuki-Kasahara improvement. In addition, taking a chaining even with the Suzuki-Kasahara improvement. In addition, taking a
general form, minimap2 chaining can be adapted to non-typical data types such as general form, minimap2 chaining can be adapted to non-typical data types such as
spliced reads and multiple reads per fragment. This gives us the opportunity to spliced reads and multiple reads per fragment. This gives us the opportunity to
@@ -712,6 +717,8 @@ Schatz, P. Rescheneder and F. Sedlazeck for pointing out the limitation of
BWA-MEM. We are also grateful to minimap2 users who have greatly helped to BWA-MEM. We are also grateful to minimap2 users who have greatly helped to
suggest features and to fix various issues. suggest features and to fix various issues.
\paragraph{Funding\textcolon} NHGRI 1R01HG010040-01
\bibliography{minimap2} \bibliography{minimap2}
\end{document} \end{document}