mirror of
https://github.com/lh3/minimap2.git
synced 2026-09-25 11:18:13 +08:00
Compare commits
| Author | SHA1 | Date | |
|---|---|---|---|
|
|
9febf532c1 | ||
|
|
cec23131e4 | ||
|
|
ef09ccf104 | ||
|
|
e74dfd1aa9 | ||
|
|
f31705bb4a | ||
|
|
41d7ccb191 | ||
|
|
34a41197d7 | ||
|
|
9626b3e716 | ||
|
|
379728726a | ||
|
|
4f91558160 | ||
|
|
ec3bc6efd7 | ||
|
|
8ec8866100 | ||
|
|
9e7247cff9 | ||
|
|
cd66777bfb | ||
|
|
5d7d25e92d | ||
|
|
2a3793bbd2 | ||
|
|
f97008a10e | ||
|
|
10502e2a78 | ||
|
|
4422c0c6f9 | ||
|
|
42a11e1d58 | ||
|
|
76df351fa8 | ||
|
|
d065d3bead | ||
|
|
ac146fe7bc | ||
|
|
6c96078ed0 | ||
|
|
bbb4f97e52 | ||
|
|
b7f4d8a0f4 | ||
|
|
e81927e7a1 | ||
|
|
f7dc5799c5 | ||
|
|
817cb81cb0 | ||
|
|
0f5608c4a4 | ||
|
|
e8823a3709 | ||
|
|
7edeec67b0 | ||
|
|
feb92d32ea | ||
|
|
cdbd96be0c | ||
|
|
ba52c79024 | ||
|
|
cd9ccfa069 | ||
|
|
86b716448c | ||
|
|
9ab95be1bb | ||
|
|
b51e859945 | ||
|
|
a9037dc16c | ||
|
|
9729fa99ad | ||
|
|
b6ff332de1 | ||
|
|
77abafaaf3 | ||
|
|
507d39af15 | ||
|
|
827ca4b461 | ||
|
|
d3dde2fdd4 | ||
|
|
7db2e8d21a | ||
|
|
0b41dd26a2 | ||
|
|
2b47846cd6 | ||
|
|
67dd906a80 | ||
|
|
1b0bb7b0ba | ||
|
|
1c4b7e8a48 | ||
|
|
ecbc399fa2 | ||
|
|
4dfd495cc2 | ||
|
|
194b457e79 | ||
|
|
75c8933511 | ||
|
|
1025993469 | ||
|
|
a3253d1a6b | ||
|
|
2da649d1d7 | ||
|
|
f995f55610 | ||
|
|
c9874e2dc5 | ||
|
|
ccb0f7b05d | ||
|
|
66db9da7d8 | ||
|
|
2b3403f094 | ||
|
|
3e16e4e39d | ||
|
|
f47e8a525e | ||
|
|
c172df7d2d | ||
|
|
9e6fdd376b | ||
|
|
29f67a1666 | ||
|
|
adde608a42 | ||
|
|
f10dff78dc | ||
|
|
d97bba9f27 | ||
|
|
50775362bb | ||
|
|
0a5e386359 | ||
|
|
cb56fb762a | ||
|
|
e2451e497a | ||
|
|
d2de282d21 | ||
|
|
48cb80ea94 | ||
|
|
6a4b9f9082 | ||
|
|
a7a01fe5bd | ||
|
|
9dceae59a0 | ||
|
|
20a3987082 | ||
|
|
eb3ed6993d | ||
|
|
7996f04008 | ||
|
|
d2e14705e7 | ||
|
|
24f50f38e8 | ||
|
|
04e015d803 | ||
|
|
040f74102c | ||
|
|
cdb7857841 | ||
|
|
3c0d05d272 | ||
|
|
47b646acbf | ||
|
|
a79cb3e991 | ||
|
|
367aed4271 | ||
|
|
081df6ac7d | ||
|
|
a3e7a575fb | ||
|
|
d90583b83c | ||
|
|
7fc03b0c32 | ||
|
|
20c104ce8d | ||
|
|
238b6bb3ea | ||
|
|
e026e18439 | ||
|
|
58c2251b18 | ||
|
|
03dc8d5d97 | ||
|
|
5cb61f8ee6 | ||
|
|
c16a1742a3 | ||
|
|
4bd5a018c2 | ||
|
|
05974c80f1 | ||
|
|
7bc87b4175 | ||
|
|
6762368cf0 | ||
|
|
c2aec88b84 | ||
|
|
97f67a2a0a | ||
|
|
189555503a | ||
|
|
69af86657e | ||
|
|
49c6d83a8e | ||
|
|
f64e426a5a | ||
|
|
2bb8cbbeef | ||
|
|
e80759c97a | ||
|
|
f4c844b143 | ||
|
|
be171aa2dc | ||
|
|
cdc730d573 | ||
|
|
6420acca6d | ||
|
|
371bc9513a | ||
|
|
169216bfff | ||
|
|
6b391e3373 | ||
|
|
55e39c2d30 | ||
|
|
90b7b83ec7 | ||
|
|
d431dc0181 | ||
|
|
ccf1680aaf | ||
|
|
ea84fc0a53 | ||
|
|
19208fb06b | ||
|
|
e02bebd96d | ||
|
|
32ab6ce15b | ||
|
|
1739a260fb | ||
|
|
aaf3233818 | ||
|
|
8b05880f73 | ||
|
|
eba237f39d | ||
|
|
a8e1e3cbb8 | ||
|
|
597212b9f3 | ||
|
|
30abcf3cf9 | ||
|
|
48e230f40d | ||
|
|
c404f49569 | ||
|
|
cf2bae6e9b | ||
|
|
5b2fdfff9c | ||
|
|
ea2b1c5b2a | ||
|
|
eef1cee9b7 | ||
|
|
2c52364527 | ||
|
|
128476efc9 | ||
|
|
1b3a6a0fe5 | ||
|
|
83a8ee7038 | ||
|
|
62bbadf668 | ||
|
|
91f548b497 | ||
|
|
cdaf46665a | ||
|
|
6596c63dcd | ||
|
|
59f23f7579 | ||
|
|
5e55e397e9 | ||
|
|
88c421e8de | ||
|
|
3db5bfe6e5 | ||
|
|
83dfdd5f50 | ||
|
|
8a2b1cd4c9 | ||
|
|
1ede8ca170 | ||
|
|
13981404e2 | ||
|
|
fd64dd26f6 | ||
|
|
24df95e4b8 | ||
|
|
a8ee48c2ce | ||
|
|
09e089c3dc | ||
|
|
e46cbb7d84 | ||
|
|
57ec73ec6c | ||
|
|
9e27575387 | ||
|
|
b4ad8d8bf0 | ||
|
|
e315b9fada | ||
|
|
42baf287a4 | ||
|
|
2ceba22a7a | ||
|
|
9ed56b4a25 | ||
|
|
ecb6c5c36c | ||
|
|
377c7099a8 | ||
|
|
51e2abfa60 | ||
|
|
7b0a49732e | ||
|
|
20268a6068 | ||
|
|
d04ac068fd | ||
|
|
5d5d392c02 | ||
|
|
170863e553 | ||
|
|
97f97306a4 | ||
|
|
1077b7ddc8 | ||
|
|
c57b59f02f | ||
|
|
34be359e25 | ||
|
|
8b12da8b0f | ||
|
|
c63a33904f | ||
|
|
70b0fede64 | ||
|
|
0b681e51e7 | ||
|
|
7d80d6de4a | ||
|
|
791e89ce0f | ||
|
|
98c48a1c45 | ||
|
|
63d397120a | ||
|
|
7998fe9906 | ||
|
|
3a119d606f | ||
|
|
a5eafb75f9 | ||
|
|
9a567e4b37 | ||
|
|
8e606bcc06 | ||
|
|
a1b7219b5d | ||
|
|
b0f39a1a61 | ||
|
|
5ab6538757 | ||
|
|
b32296e18f | ||
|
|
99ecdf7b5d | ||
|
|
ff9917a1c4 | ||
|
|
8c064a5f29 | ||
|
|
0e137670fc | ||
|
|
395c8d678a | ||
|
|
830da7fa27 | ||
|
|
a655cbef86 | ||
|
|
4b707aac92 | ||
|
|
951c0d1d35 | ||
|
|
3545e35a42 | ||
|
|
f3417da838 | ||
|
|
e5277dbf5c | ||
|
|
1a55227d5a | ||
|
|
5cfa621b2d | ||
|
|
a609a07f8c | ||
|
|
bcf92b3c46 | ||
|
|
097378ab90 | ||
|
|
10bbbe28c5 | ||
|
|
c92a6866f3 | ||
|
|
6908dc59a5 | ||
|
|
50dae10421 | ||
|
|
0517972d02 | ||
|
|
d46e68e6ad | ||
|
|
2584a4149a | ||
|
|
66674afd09 | ||
|
|
e9ca0c9dab | ||
|
|
7e6e8ca73f | ||
|
|
408e098859 | ||
|
|
57f37551f8 | ||
|
|
4c66b689c3 | ||
|
|
1bde2cf076 | ||
|
|
31fc0f218a | ||
|
|
3d3bcc29a8 | ||
|
|
99dcd75f64 | ||
|
|
154d2caf5b | ||
|
|
a3afeec0b2 | ||
|
|
3573784b4d | ||
|
|
872f300955 | ||
|
|
d7b61a039e | ||
|
|
248158a3e1 | ||
|
|
9f4309c376 | ||
|
|
463f9309f9 | ||
|
|
abe989e355 | ||
|
|
881b4ca3a2 | ||
|
|
10c6dd2551 | ||
|
|
7ec6721c44 | ||
|
|
e61812ee55 | ||
|
|
734ac379bb | ||
|
|
759f8e4ac9 | ||
|
|
aef7b0744c | ||
|
|
39f836eac8 | ||
|
|
cbeb86dad6 | ||
|
|
372c90ceb5 | ||
|
|
2e2e69107c | ||
|
|
ee4cd089f7 | ||
|
|
2d7ec75d50 | ||
|
|
7938ed4893 | ||
|
|
4740423afa | ||
|
|
1776311a9b | ||
|
|
c1a3e05cb0 | ||
|
|
ecb6703d4a | ||
|
|
0bf97a367b | ||
|
|
1c504d72e4 | ||
|
|
5ef9580b17 | ||
|
|
08bd2123b6 | ||
|
|
8766d286df | ||
|
|
623b5d9d48 | ||
|
|
18659118cd | ||
|
|
d1050f4eaf | ||
|
|
b81d45510e | ||
|
|
d135feb1a5 | ||
|
|
242ff4e91d | ||
|
|
7a0c1316ce | ||
|
|
77ebd479f4 | ||
|
|
e3f226a9d9 | ||
|
|
bdc615c1d4 | ||
|
|
ad1beaf255 | ||
|
|
de0480ac5b | ||
|
|
f2866533a8 | ||
|
|
0173850ef0 | ||
|
|
acea3594fb | ||
|
|
f78a247749 | ||
|
|
ccaf12e1a2 | ||
|
|
96b132c97d | ||
|
|
70428ca3a8 | ||
|
|
9aea79d621 | ||
|
|
1770988627 | ||
|
|
2bfdad34bb | ||
|
|
953766cedd | ||
|
|
dc61301d9f | ||
|
|
19e05a099d | ||
|
|
0238caa8b1 | ||
|
|
a22ebb9836 |
@@ -0,0 +1,21 @@
|
||||
name: CI
|
||||
|
||||
on:
|
||||
push:
|
||||
branches:
|
||||
- master
|
||||
pull_request:
|
||||
|
||||
jobs:
|
||||
build:
|
||||
runs-on: ubuntu-latest
|
||||
strategy:
|
||||
matrix:
|
||||
compiler: [gcc, clang]
|
||||
|
||||
steps:
|
||||
- name: Checkout minimap2
|
||||
uses: actions/checkout@v2
|
||||
|
||||
- name: Compile with ${{ matrix.compiler }}
|
||||
run: make CC=${{ matrix.compiler }}
|
||||
@@ -0,0 +1,3 @@
|
||||
[submodule "lib/simde"]
|
||||
path = lib/simde
|
||||
url = https://github.com/nemequ/simde.git
|
||||
+5
-1
@@ -6,6 +6,10 @@ matrix:
|
||||
- language: c
|
||||
compiler: clang
|
||||
script: make
|
||||
- arch: arm64
|
||||
language: c
|
||||
compiler: gcc
|
||||
script: make arm_neon=1 aarch64=1
|
||||
- language: python
|
||||
python: "2.7"
|
||||
before_install: pip install cython
|
||||
@@ -15,6 +19,6 @@ matrix:
|
||||
before_install: pip install cython
|
||||
script: python setup.py build_ext
|
||||
- language: python
|
||||
python: "3.6"
|
||||
python: "3.9"
|
||||
before_install: pip install cython
|
||||
script: python setup.py build_ext
|
||||
|
||||
@@ -0,0 +1,46 @@
|
||||
#### 1. Alignment different with option `-a` or `-c`?
|
||||
|
||||
Without `-a`, `-c` or `--cs`, minimap2 only finds *approximate* mapping
|
||||
locations without detailed base alignment. In particular, the start and end
|
||||
positions of the alignment are impricise. With one of those options, minimap2
|
||||
will perform base alignment, which is generally more accurate but is much
|
||||
slower.
|
||||
|
||||
#### 2. How to map Illumina short reads to noisy long reads?
|
||||
|
||||
No good solutions. The better approach is to assemble short reads into contigs
|
||||
and then map noisy reads to contigs.
|
||||
|
||||
#### 3. The output SAM doesn't have a header.
|
||||
|
||||
By default, minimap2 indexes 4 billion reference bases (4Gb) in a batch and map
|
||||
all reads against each reference batch. Given a reference longer than 4Gb,
|
||||
minimap2 is unable to see all the sequences and thus can't produce a correct
|
||||
SAM header. In this case, minimap2 doesn't output any SAM header. There are two
|
||||
solutions to this issue. First, you may increase option `-I` to, for example,
|
||||
`-I8g` to index more reference bases in a batch. This is preferred if your
|
||||
machine has enough memory. Second, if your machines doesn't have enough memory
|
||||
to hold the reference index, you can use the `--split-prefix` option in a
|
||||
command line like:
|
||||
```sh
|
||||
minimap2 -ax map-ont --split-prefix=tmp ref.fa reads.fq
|
||||
```
|
||||
This second approach uses less memory, but it is slower and requires temporary
|
||||
disk space.
|
||||
|
||||
#### 4. The output SAM is malformatted.
|
||||
|
||||
This typically happens when you use nohup to wrap a minimap2 command line.
|
||||
Nohup is discouraged as it breaks piping. If you have to use nohup, please
|
||||
specify an output file with option `-o`.
|
||||
|
||||
#### 5. How to output one alignment per read?
|
||||
|
||||
You can use `--secondary=no` to suppress secondary alignments (aka multiple
|
||||
mappings), but you can't suppress supplementary alignment (aka split or
|
||||
chimeric alignment) this way. You can use samtools to filter out these
|
||||
alignments:
|
||||
```sh
|
||||
minimap2 -ax map-out ref.fa reads.fq | samtools view -F0x900
|
||||
```
|
||||
However, this is discouraged as supplementary alignment is informative.
|
||||
+2
-1
@@ -1,6 +1,7 @@
|
||||
The MIT License
|
||||
|
||||
Copyright (c) 2017 Broad Institute, Inc.
|
||||
Copyright (c) 2018- Dana-Farber Cancer Institute
|
||||
2017-2018 Broad Institute, Inc.
|
||||
|
||||
Permission is hereby granted, free of charge, to any person obtaining
|
||||
a copy of this software and associated documentation files (the
|
||||
|
||||
+1
-2
@@ -1,10 +1,9 @@
|
||||
include *.h
|
||||
include Makefile
|
||||
include ksw2_dispatch.c
|
||||
include getopt.c
|
||||
include main.c
|
||||
include README.md
|
||||
include python/mappy.c
|
||||
include sse2neon/emmintrin.h
|
||||
include python/cmappy.h
|
||||
include python/cmappy.pxd
|
||||
include python/mappy.pyx
|
||||
|
||||
@@ -1,21 +1,37 @@
|
||||
CFLAGS= -g -Wall -O2 -Wc++-compat
|
||||
CFLAGS= -g -Wall -O2 -Wc++-compat #-Wextra
|
||||
CPPFLAGS= -DHAVE_KALLOC
|
||||
INCLUDES=
|
||||
OBJS= kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o options.o index.o chain.o align.o hit.o map.o format.o pe.o esterr.o ksw2_ll_sse.o
|
||||
OBJS= kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o options.o index.o \
|
||||
lchain.o align.o hit.o seed.o map.o format.o pe.o esterr.o splitidx.o \
|
||||
ksw2_ll_sse.o
|
||||
PROG= minimap2
|
||||
PROG_EXTRA= sdust minimap2-lite
|
||||
LIBS= -lm -lz -lpthread
|
||||
|
||||
ifeq ($(arm_neon),)
|
||||
ifeq ($(sse2only),)
|
||||
ifeq ($(arm_neon),) # if arm_neon is not defined
|
||||
ifeq ($(sse2only),) # if sse2only is not defined
|
||||
OBJS+=ksw2_extz2_sse41.o ksw2_extd2_sse41.o ksw2_exts2_sse41.o ksw2_extz2_sse2.o ksw2_extd2_sse2.o ksw2_exts2_sse2.o ksw2_dispatch.o
|
||||
else
|
||||
else # if sse2only is defined
|
||||
OBJS+=ksw2_extz2_sse.o ksw2_extd2_sse.o ksw2_exts2_sse.o
|
||||
endif
|
||||
else
|
||||
OBJS+=ksw2_extz2_neon.o ksw2_extd2_neon.o ksw2_exts2_neon.o
|
||||
CFLAGS+=-D_FILE_OFFSET_BITS=64 -mfpu=neon -fsigned-char
|
||||
INCLUDES+=-I sse2neon
|
||||
else # if arm_neon is defined
|
||||
OBJS+=ksw2_extz2_neon.o ksw2_extd2_neon.o ksw2_exts2_neon.o
|
||||
INCLUDES+=-Isse2neon
|
||||
ifeq ($(aarch64),) #if aarch64 is not defined
|
||||
CFLAGS+=-D_FILE_OFFSET_BITS=64 -mfpu=neon -fsigned-char
|
||||
else #if aarch64 is defined
|
||||
CFLAGS+=-D_FILE_OFFSET_BITS=64 -fsigned-char
|
||||
endif
|
||||
endif
|
||||
|
||||
ifneq ($(asan),)
|
||||
CFLAGS+=-fsanitize=address
|
||||
LIBS+=-fsanitize=address
|
||||
endif
|
||||
|
||||
ifneq ($(tsan),)
|
||||
CFLAGS+=-fsanitize=thread
|
||||
LIBS+=-fsanitize=thread
|
||||
endif
|
||||
|
||||
.PHONY:all extra clean depend
|
||||
@@ -28,8 +44,8 @@ all:$(PROG)
|
||||
|
||||
extra:all $(PROG_EXTRA)
|
||||
|
||||
minimap2:main.o getopt.o libminimap2.a
|
||||
$(CC) $(CFLAGS) main.o getopt.o -o $@ -L. -lminimap2 $(LIBS)
|
||||
minimap2:main.o libminimap2.a
|
||||
$(CC) $(CFLAGS) main.o -o $@ -L. -lminimap2 $(LIBS)
|
||||
|
||||
minimap2-lite:example.o libminimap2.a
|
||||
$(CC) $(CFLAGS) $< -o $@ -L. -lminimap2 $(LIBS)
|
||||
@@ -37,31 +53,36 @@ minimap2-lite:example.o libminimap2.a
|
||||
libminimap2.a:$(OBJS)
|
||||
$(AR) -csru $@ $(OBJS)
|
||||
|
||||
sdust:sdust.c getopt.o kalloc.o kalloc.h kdq.h kvec.h kseq.h sdust.h
|
||||
$(CC) -D_SDUST_MAIN $(CFLAGS) $< getopt.o kalloc.o -o $@ -lz
|
||||
sdust:sdust.c kalloc.o kalloc.h kdq.h kvec.h kseq.h ketopt.h sdust.h
|
||||
$(CC) -D_SDUST_MAIN $(CFLAGS) $< kalloc.o -o $@ -lz
|
||||
|
||||
# SSE-specific targets on x86/x86_64
|
||||
|
||||
ifeq ($(arm_neon),) # if arm_neon is defined, compile this target with the default setting (i.e. no -msse2)
|
||||
ksw2_ll_sse.o:ksw2_ll_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c $(CFLAGS) -msse2 $(CPPFLAGS) $(INCLUDES) $< -o $@
|
||||
endif
|
||||
|
||||
ksw2_extz2_sse41.o:ksw2_extz2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_extz2_sse2.o:ksw2_extz2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
|
||||
$(CC) -c $(CFLAGS) -msse2 -mno-sse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_extd2_sse41.o:ksw2_extd2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_extd2_sse2.o:ksw2_extd2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
|
||||
$(CC) -c $(CFLAGS) -msse2 -mno-sse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_exts2_sse41.o:ksw2_exts2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_exts2_sse2.o:ksw2_exts2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
|
||||
$(CC) -c $(CFLAGS) -msse2 -mno-sse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_dispatch.o:ksw2_dispatch.c ksw2.h
|
||||
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||
|
||||
# NEON-specific targets on ARM
|
||||
|
||||
@@ -84,26 +105,28 @@ depend:
|
||||
|
||||
# DO NOT DELETE
|
||||
|
||||
align.o: minimap.h mmpriv.h bseq.h ksw2.h kalloc.h
|
||||
align.o: minimap.h mmpriv.h bseq.h kseq.h ksw2.h kalloc.h
|
||||
bseq.o: bseq.h kvec.h kalloc.h kseq.h
|
||||
chain.o: minimap.h mmpriv.h bseq.h kalloc.h
|
||||
esterr.o: mmpriv.h minimap.h bseq.h
|
||||
esterr.o: mmpriv.h minimap.h bseq.h kseq.h
|
||||
example.o: minimap.h kseq.h
|
||||
format.o: kalloc.h mmpriv.h minimap.h bseq.h
|
||||
getopt.o: getopt.h
|
||||
hit.o: mmpriv.h minimap.h bseq.h kalloc.h khash.h
|
||||
index.o: kthread.h bseq.h minimap.h mmpriv.h kvec.h kalloc.h khash.h
|
||||
format.o: kalloc.h mmpriv.h minimap.h bseq.h kseq.h
|
||||
hit.o: mmpriv.h minimap.h bseq.h kseq.h kalloc.h khash.h
|
||||
index.o: kthread.h bseq.h minimap.h mmpriv.h kseq.h kvec.h kalloc.h khash.h
|
||||
index.o: ksort.h
|
||||
kalloc.o: kalloc.h
|
||||
ksw2_extd2_sse.o: ksw2.h kalloc.h
|
||||
ksw2_exts2_sse.o: ksw2.h kalloc.h
|
||||
ksw2_extz2_sse.o: ksw2.h kalloc.h
|
||||
ksw2_ll_sse.o: ksw2.h kalloc.h
|
||||
kthread.o: kthread.h
|
||||
main.o: bseq.h minimap.h mmpriv.h getopt.h
|
||||
map.o: kthread.h kvec.h kalloc.h sdust.h mmpriv.h minimap.h bseq.h khash.h
|
||||
map.o: ksort.h
|
||||
misc.o: mmpriv.h minimap.h bseq.h ksort.h
|
||||
options.o: mmpriv.h minimap.h bseq.h
|
||||
pe.o: mmpriv.h minimap.h bseq.h kvec.h kalloc.h ksort.h
|
||||
lchain.o: mmpriv.h minimap.h bseq.h kseq.h kalloc.h krmq.h
|
||||
main.o: bseq.h minimap.h mmpriv.h kseq.h ketopt.h
|
||||
map.o: kthread.h kvec.h kalloc.h sdust.h mmpriv.h minimap.h bseq.h kseq.h
|
||||
map.o: khash.h ksort.h
|
||||
misc.o: mmpriv.h minimap.h bseq.h kseq.h ksort.h
|
||||
options.o: mmpriv.h minimap.h bseq.h kseq.h
|
||||
pe.o: mmpriv.h minimap.h bseq.h kseq.h kvec.h kalloc.h ksort.h
|
||||
sdust.o: kalloc.h kdq.h kvec.h sdust.h
|
||||
sketch.o: kvec.h kalloc.h mmpriv.h minimap.h bseq.h
|
||||
seed.o: mmpriv.h minimap.h bseq.h kseq.h kalloc.h ksort.h
|
||||
sketch.o: kvec.h kalloc.h mmpriv.h minimap.h bseq.h kseq.h
|
||||
splitidx.o: mmpriv.h minimap.h bseq.h kseq.h
|
||||
|
||||
@@ -0,0 +1,97 @@
|
||||
CFLAGS= -g -Wall -O2 -Wc++-compat #-Wextra
|
||||
CPPFLAGS= -DHAVE_KALLOC -DUSE_SIMDE -DSIMDE_ENABLE_NATIVE_ALIASES
|
||||
INCLUDES= -Ilib/simde
|
||||
OBJS= kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o options.o index.o chain.o align.o hit.o map.o format.o pe.o esterr.o splitidx.o \
|
||||
ksw2_extz2_simde.o ksw2_extd2_simde.o ksw2_exts2_simde.o ksw2_ll_simde.o
|
||||
PROG= minimap2
|
||||
PROG_EXTRA= sdust minimap2-lite
|
||||
LIBS= -lm -lz -lpthread
|
||||
|
||||
|
||||
ifneq ($(arm_neon),) # if arm_neon is defined
|
||||
ifeq ($(aarch64),) #if aarch64 is not defined
|
||||
CFLAGS+=-D_FILE_OFFSET_BITS=64 -mfpu=neon -fsigned-char
|
||||
else #if aarch64 is defined
|
||||
CFLAGS+=-D_FILE_OFFSET_BITS=64 -fsigned-char
|
||||
endif
|
||||
endif
|
||||
|
||||
ifneq ($(asan),)
|
||||
CFLAGS+=-fsanitize=address
|
||||
LIBS+=-fsanitize=address
|
||||
endif
|
||||
|
||||
ifneq ($(tsan),)
|
||||
CFLAGS+=-fsanitize=thread
|
||||
LIBS+=-fsanitize=thread
|
||||
endif
|
||||
|
||||
.PHONY:all extra clean depend
|
||||
.SUFFIXES:.c .o
|
||||
|
||||
.c.o:
|
||||
$(CC) -c $(CFLAGS) $(CPPFLAGS) $(INCLUDES) $< -o $@
|
||||
|
||||
all:$(PROG)
|
||||
|
||||
extra:all $(PROG_EXTRA)
|
||||
|
||||
minimap2:main.o libminimap2.a
|
||||
$(CC) $(CFLAGS) main.o -o $@ -L. -lminimap2 $(LIBS)
|
||||
|
||||
minimap2-lite:example.o libminimap2.a
|
||||
$(CC) $(CFLAGS) $< -o $@ -L. -lminimap2 $(LIBS)
|
||||
|
||||
libminimap2.a:$(OBJS)
|
||||
$(AR) -csru $@ $(OBJS)
|
||||
|
||||
sdust:sdust.c kalloc.o kalloc.h kdq.h kvec.h kseq.h ketopt.h sdust.h
|
||||
$(CC) -D_SDUST_MAIN $(CFLAGS) $< kalloc.o -o $@ -lz
|
||||
|
||||
ksw2_ll_simde.o:ksw2_ll_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c $(CFLAGS) -msse2 $(CPPFLAGS) $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_extz2_simde.o:ksw2_extz2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_extd2_simde.o:ksw2_extd2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_exts2_simde.o:ksw2_exts2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) $(INCLUDES) $< -o $@
|
||||
|
||||
# other non-file targets
|
||||
|
||||
clean:
|
||||
rm -fr gmon.out *.o a.out $(PROG) $(PROG_EXTRA) *~ *.a *.dSYM build dist mappy*.so mappy.c python/mappy.c mappy.egg*
|
||||
|
||||
depend:
|
||||
(LC_ALL=C; export LC_ALL; makedepend -Y -- $(CFLAGS) $(CPPFLAGS) -- *.c)
|
||||
|
||||
# DO NOT DELETE
|
||||
|
||||
align.o: minimap.h mmpriv.h bseq.h kseq.h ksw2.h kalloc.h
|
||||
bseq.o: bseq.h kvec.h kalloc.h kseq.h
|
||||
chain.o: minimap.h mmpriv.h bseq.h kseq.h kalloc.h
|
||||
esterr.o: mmpriv.h minimap.h bseq.h kseq.h
|
||||
example.o: minimap.h kseq.h
|
||||
format.o: kalloc.h mmpriv.h minimap.h bseq.h kseq.h
|
||||
hit.o: mmpriv.h minimap.h bseq.h kseq.h kalloc.h khash.h
|
||||
index.o: kthread.h bseq.h minimap.h mmpriv.h kseq.h kvec.h kalloc.h khash.h
|
||||
index.o: ksort.h
|
||||
kalloc.o: kalloc.h
|
||||
ksw2_extd2_sse.o: ksw2.h kalloc.h
|
||||
ksw2_exts2_sse.o: ksw2.h kalloc.h
|
||||
ksw2_extz2_sse.o: ksw2.h kalloc.h
|
||||
ksw2_ll_sse.o: ksw2.h kalloc.h
|
||||
kthread.o: kthread.h
|
||||
main.o: bseq.h minimap.h mmpriv.h kseq.h ketopt.h
|
||||
map.o: kthread.h kvec.h kalloc.h sdust.h mmpriv.h minimap.h bseq.h kseq.h
|
||||
map.o: khash.h ksort.h
|
||||
misc.o: mmpriv.h minimap.h bseq.h kseq.h ksort.h
|
||||
options.o: mmpriv.h minimap.h bseq.h kseq.h
|
||||
pe.o: mmpriv.h minimap.h bseq.h kseq.h kvec.h kalloc.h ksort.h
|
||||
sdust.o: kalloc.h kdq.h kvec.h sdust.h
|
||||
self-chain.o: minimap.h kseq.h
|
||||
sketch.o: kvec.h kalloc.h mmpriv.h minimap.h bseq.h kseq.h
|
||||
splitidx.o: mmpriv.h minimap.h bseq.h kseq.h
|
||||
@@ -1,3 +1,416 @@
|
||||
Release 2.19-r1057 (26 May 2021)
|
||||
--------------------------------
|
||||
|
||||
This release includes a few important improvements backported from unimap:
|
||||
|
||||
* Improvement: more contiguous alignment through long INDELs. This is enabled
|
||||
by the minigraph chaining algorithm. All `asm*` presets now use the new
|
||||
algorithm. They can find INDELs up to 100kb and may be faster for
|
||||
chromosome-long contigs. The default mode and `map*` presets use this
|
||||
algorithm to replace the long-join heuristic.
|
||||
|
||||
* Improvement: better alignment in highly repetitive regions by rescuing
|
||||
high-occurrence seeds. If the distance between two adjacent seeds is too
|
||||
large, attempt to choose a fraction of high-occurrence seeds in-between.
|
||||
Minimap2 now produces fewer clippings and alignment break points in long
|
||||
satellite regions.
|
||||
|
||||
* Improvement: allow to specify an interval of k-mer occurrences with `-U`.
|
||||
For repeat-rich genomes, the automatic k-mer occurrence threshold determined
|
||||
by `-f` may be too large and makes alignment impractically slow. The new
|
||||
option protects against such cases. Enabled for `asm*` and `map-hifi`.
|
||||
|
||||
* New feature: added the `map-hifi` preset for maping PacBio High-Fidelity
|
||||
(HiFi) reads.
|
||||
|
||||
* Change to the default: apply `--cap-sw-mem=100m` for genomic alignment.
|
||||
|
||||
* Bugfix: minimap2 could not generate an index file with `-xsr` (#734).
|
||||
|
||||
This release represents the most signficant algorithmic change since v2.1 in
|
||||
2017. With features backported from unimap, minimap2 now has similar power to
|
||||
unimap for contig alignment. Unimap will remain an experimental project and is
|
||||
no longer recommended over minimap2. Sorry for reverting the recommendation in
|
||||
short time.
|
||||
|
||||
(2.20: 26 May 2021, r1057)
|
||||
|
||||
|
||||
|
||||
Release 2.18-r1015 (9 April 2021)
|
||||
---------------------------------
|
||||
|
||||
This release fixes multiple rare bugs in minimap2 and adds additional
|
||||
functionality to paftools.js.
|
||||
|
||||
Changes to minimap2:
|
||||
|
||||
* Bugfix: a rare segfault caused by an off-by-one error (#489)
|
||||
|
||||
* Bugfix: minimap2 segfaulted due to an uninitilized variable (#622 and #625).
|
||||
|
||||
* Bugfix: minimap2 parsed spaces as field separators in BED (#721). This led
|
||||
to issues when the BED name column contains spaces.
|
||||
|
||||
* Bugfix: minimap2 `--split-prefix` did not work with long reference names
|
||||
(#394).
|
||||
|
||||
* Bugfix: option `--junc-bonus` didn't work (#513)
|
||||
|
||||
* Bugfix: minimap2 didn't return 1 on I/O errors (#532)
|
||||
|
||||
* Bugfix: the `de:f` tag (sequence divergence) could be negative if there were
|
||||
ambiguous bases
|
||||
|
||||
* Bugfix: fixed two undefined behaviors caused by calling memcpy() on
|
||||
zero-length blocks (#443)
|
||||
|
||||
* Bugfix: there were duplicated SAM @SQ lines if option `--split-prefix` is in
|
||||
use (#400 and #527)
|
||||
|
||||
* Bugfix: option -K had to be smaller than 2 billion (#491). This was caused
|
||||
by a 32-bit integer overflow.
|
||||
|
||||
* Improvement: optionally compile against SIMDe (#597). Minimap2 should work
|
||||
with IBM POWER CPUs, though this has not been tested. To compile with SIMDe,
|
||||
please use `make -f Makefile.simde`.
|
||||
|
||||
* Improvement: more informative error message for I/O errors (#454) and for
|
||||
FASTQ parsing errors (#510)
|
||||
|
||||
* Improvement: abort given malformatted RG line (#541)
|
||||
|
||||
* Improvement: better formula to estimate the `dv:f` tag (approximate sequence
|
||||
divergence). See DOI:10.1101/2021.01.15.426881.
|
||||
|
||||
* New feature: added the `--mask-len` option to fine control the removal of
|
||||
redundant hits (#659). The default behavior is unchanged.
|
||||
|
||||
Changes to mappy:
|
||||
|
||||
* Bugfix: mappy caused segmentation fault if the reference index is not
|
||||
present (#413).
|
||||
|
||||
* Bugfix: fixed a memory leak via 238b6bb3
|
||||
|
||||
* Change: always require Cython to compile the mappy module (#723). Older
|
||||
mappy packages at PyPI bundled the C source code generated by Cython such
|
||||
that end users did not need to install Cython to compile mappy. However, as
|
||||
Python 3.9 is breaking backward compatibility, older mappy does not work
|
||||
with Python 3.9 anymore. We have to add this Cython dependency as a
|
||||
workaround.
|
||||
|
||||
Changes to paftools.js:
|
||||
|
||||
* Bugfix: the "part10-" line from asmgene was wrong (#581)
|
||||
|
||||
* Improvement: compatibility with GTF files from GenBank (#422)
|
||||
|
||||
* New feature: asmgene also checks missing multi-copy genes
|
||||
|
||||
* New feature: added the misjoin command to evaluate large-scale misjoins and
|
||||
megabase-long inversions.
|
||||
|
||||
Although given the many bug fixes and minor improvements, the core algorithm
|
||||
stays the same. This version of minimap2 produces nearly identical alignments
|
||||
to v2.17 except very rare corner cases.
|
||||
|
||||
Now unimap is recommended over minimap2 for aligning long contigs against a
|
||||
reference genome. It often takes less wall-clock time and is much more
|
||||
sensitive to long insertions and deletions.
|
||||
|
||||
(2.18: 9 April 2021, r1015)
|
||||
|
||||
|
||||
|
||||
Release 2.17-r941 (4 May 2019)
|
||||
------------------------------
|
||||
|
||||
Changes since the last release:
|
||||
|
||||
* Fixed flawed CIGARs like `5I6D7I` (#392).
|
||||
|
||||
* Bugfix: TLEN should be 0 when either end is unmapped (#373 and #365).
|
||||
|
||||
* Bugfix: mappy is unable to write index (#372).
|
||||
|
||||
* Added option `--junc-bed` to load known gene annotations in the BED12
|
||||
format. Minimap2 prefers annotated junctions over novel junctions (#197 and
|
||||
#348). GTF can be converted to BED12 with `paftools.js gff2bed`.
|
||||
|
||||
* Added option `--sam-hit-only` to suppress unmapped hits in SAM (#377).
|
||||
|
||||
* Added preset `splice:hq` for high-quality CCS or mRNA sequences. It applies
|
||||
better scoring and improves the sensitivity to small exons. This preset may
|
||||
introduce false small introns, but the overall accuracy should be higher.
|
||||
|
||||
This version produces nearly identical alignments to v2.16, except for CIGARs
|
||||
affected by the bug mentioned above.
|
||||
|
||||
(2.17: 5 May 2019, r941)
|
||||
|
||||
|
||||
|
||||
Release 2.16-r922 (28 February 2019)
|
||||
------------------------------------
|
||||
|
||||
This release is 50% faster for mapping ultra-long nanopore reads at comparable
|
||||
accuracy. For short-read mapping, long-read overlapping and ordinary long-read
|
||||
mapping, the performance and accuracy remain similar. This speedup is achieved
|
||||
with a new heuristic to limit the number of chaining iterations (#324). Users
|
||||
can disable the heuristic by increasing a new option `--max-chain-iter` to a
|
||||
huge number.
|
||||
|
||||
Other changes to minimap2:
|
||||
|
||||
* Implemented option `--paf-no-hit` to output unmapped query sequences in PAF.
|
||||
The strand and reference name columns are both `*` at an unmapped line. The
|
||||
hidden option is available in earlier minimap2 but had a different 2-column
|
||||
output format instead of PAF.
|
||||
|
||||
* Fixed a bug that leads to wrongly calculated `de` tags when ambiguous bases
|
||||
are involved (#309). This bug only affects v2.15.
|
||||
|
||||
* Fixed a bug when parsing command-line option `--splice` (#344). This bug was
|
||||
introduced in v2.13.
|
||||
|
||||
* Fixed two division-by-zero cases (#326). They don't affect final alignments
|
||||
because the results of the divisions are not used in both case.
|
||||
|
||||
* Added an option `-o` to output alignments to a specified file. It is still
|
||||
recommended to use UNIX pipes for on-the-fly conversion or compression.
|
||||
|
||||
* Output a new `rl` tag to give the length of query regions harboring
|
||||
repetitive seeds.
|
||||
|
||||
Changes to paftool.js:
|
||||
|
||||
* Added a new option to convert the MD tag to the long form of the cs tag.
|
||||
|
||||
Changes to mappy:
|
||||
|
||||
* Added the `mappy.Aligner.seq_names` method to return sequence names (#312).
|
||||
|
||||
For NA12878 ultra-long reads, this release changes the alignments of <0.1% of
|
||||
reads in comparison to v2.15. All these reads have highly fragmented alignments
|
||||
and are likely to be problematic anyway. For shorter or well aligned reads,
|
||||
this release should produce mostly identical alignments to v2.15.
|
||||
|
||||
(2.16: 28 February 2019, r922)
|
||||
|
||||
|
||||
|
||||
Release 2.15-r905 (10 January 2019)
|
||||
-----------------------------------
|
||||
|
||||
Changes to minimap2:
|
||||
|
||||
* Fixed a rare segmentation fault when option -H is in use (#307). This may
|
||||
happen when there are very long homopolymers towards the 5'-end of a read.
|
||||
|
||||
* Fixed wrong CIGARs when option --eqx is used (#266).
|
||||
|
||||
* Fixed a typo in the base encoding table (#264). This should have no
|
||||
practical effect.
|
||||
|
||||
* Fixed a typo in the example code (#265).
|
||||
|
||||
* Improved the C++ compatibility by removing "register" (#261). However,
|
||||
minimap2 still can't be compiled in the pedantic C++ mode (#306).
|
||||
|
||||
* Output a new "de" tag for gap-compressed sequence divergence.
|
||||
|
||||
Changes to paftools.js:
|
||||
|
||||
* Added "asmgene" to evaluate the completeness of an assembly by measuring the
|
||||
uniquely mapped single-copy genes. This command learns the idea of BUSCO.
|
||||
|
||||
* Added "vcfpair" to call a phased VCF from phased whole-genome assemblies. An
|
||||
earlier version of this script is used to produce the ground truth for the
|
||||
syndip benchmark [PMID:30013044].
|
||||
|
||||
This release produces identical alignment coordinates and CIGARs in comparison
|
||||
to v2.14. Users are advised to upgrade due to the several bug fixes.
|
||||
|
||||
(2.15: 10 Janurary 2019, r905)
|
||||
|
||||
|
||||
|
||||
Release 2.14-r883 (5 November 2018)
|
||||
-----------------------------------
|
||||
|
||||
Notable changes:
|
||||
|
||||
* Fixed two minor bugs caused by typos (#254 and #266).
|
||||
|
||||
* Fixed a bug that made minimap2 abort when --eqx was used together with --MD
|
||||
or --cs (#257).
|
||||
|
||||
* Added --cap-sw-mem to cap the size of DP matrices (#259). Base alignment may
|
||||
take a lot of memory in the splicing mode. This may lead to issues when we
|
||||
run minimap2 on a cluster with a hard memory limit. The new option avoids
|
||||
unlimited memory usage at the cost of missing a few long introns.
|
||||
|
||||
* Conforming to C99 and C11 when possible (#261).
|
||||
|
||||
* Warn about malformatted FASTA or FASTQ (#252 and #255).
|
||||
|
||||
This release occasionally produces base alignments different from v2.13. The
|
||||
overall alignment accuracy remain similar.
|
||||
|
||||
(2.14: 5 November 2018, r883)
|
||||
|
||||
|
||||
|
||||
Release 2.13-r850 (11 October 2018)
|
||||
-----------------------------------
|
||||
|
||||
Changes to minimap2:
|
||||
|
||||
* Fixed wrongly formatted SAM when -L is in use (#231 and #233).
|
||||
|
||||
* Fixed an integer overflow in rare cases.
|
||||
|
||||
* Added --hard-mask-level to fine control split alignments (#244).
|
||||
|
||||
* Made --MD work with spliced alignment (#139).
|
||||
|
||||
* Replaced musl's getopt with ketopt for portability.
|
||||
|
||||
* Log peak memory usage on exit.
|
||||
|
||||
This release should produce alignments identical to v2.12 and v2.11.
|
||||
|
||||
(2.13: 11 October 2018, r850)
|
||||
|
||||
|
||||
|
||||
Release 2.12-r827 (6 August 2018)
|
||||
---------------------------------
|
||||
|
||||
Changes to minimap2:
|
||||
|
||||
* Added option --split-prefix to write proper alignments (correct mapping
|
||||
quality and clustered query sequences) given a multi-part index (#141 and
|
||||
#189; mostly by @hasindu2008).
|
||||
|
||||
* Fixed a memory leak when option -y is in use.
|
||||
|
||||
Changes to mappy:
|
||||
|
||||
* Support the MD/cs tag (#183 and #203).
|
||||
|
||||
* Allow mappy to index a single sequence, to add extra flags and to change the
|
||||
scoring system.
|
||||
|
||||
Minimap2 should produce alignments identical to v2.11.
|
||||
|
||||
(2.12: 6 August 2018, r827)
|
||||
|
||||
|
||||
|
||||
Release 2.11-r797 (20 June 2018)
|
||||
--------------------------------
|
||||
|
||||
Changes to minimap2:
|
||||
|
||||
* Improved alignment accuracy in low-complexity regions for SV calling. Thank
|
||||
@armintoepfer for multiple offline examples.
|
||||
|
||||
* Added option --eqx to encode sequence match/mismatch with the =/X CIGAR
|
||||
operators (#156, #157 and #175).
|
||||
|
||||
* When compiled with VC++, minimap2 generated wrong alignments due to a
|
||||
comparison between a signed integer and an unsigned integer (#184). Also
|
||||
fixed warnings reported by "clang -Wextra".
|
||||
|
||||
* Fixed incorrect anchor filtering due to a missing 64- to 32-bit cast.
|
||||
|
||||
* Fixed incorrect mapping quality for inversions (#148).
|
||||
|
||||
* Fixed incorrect alignment involving ambiguous bases (#155).
|
||||
|
||||
* Fixed incorrect presets: option `-r 2000` is intended to be used with
|
||||
ava-ont, not ava-pb. The bug was introduced in 2.10.
|
||||
|
||||
* Fixed a bug when --for-only/--rev-only is used together with --sr or
|
||||
--heap-sort=yes (#166).
|
||||
|
||||
* Fixed option -Y that was not working in the previous releases.
|
||||
|
||||
* Added option --lj-min-ratio to fine control the alignment of long gaps
|
||||
found by the "long-join" heuristic (#128).
|
||||
|
||||
* Exposed `mm_idx_is_idx`, `mm_idx_load` and `mm_idx_dump` C APIs (#177).
|
||||
Also fixed a bug when indexing without reference names (this feature is not
|
||||
exposed to the command line).
|
||||
|
||||
Changes to mappy:
|
||||
|
||||
* Added `__version__` (#165).
|
||||
|
||||
* Exposed the maximum fragment length parameter to mappy (#174).
|
||||
|
||||
Changes to paftools:
|
||||
|
||||
* Don't crash when there is no "cg" tag (#153).
|
||||
|
||||
* Fixed wrong coverage report by "paftools.js call" (#145).
|
||||
|
||||
This version may produce slightly different base-level alignment. The overall
|
||||
alignment statistics should remain similar.
|
||||
|
||||
(2.11: 20 June 2018, r797)
|
||||
|
||||
|
||||
|
||||
Release 2.10-r761 (27 March 2018)
|
||||
---------------------------------
|
||||
|
||||
Changes to minimap2:
|
||||
|
||||
* Optionally output the MD tag for compatibility with existing tools (#63,
|
||||
#118 and #137).
|
||||
|
||||
* Use SSE compiler flags more precisely to prevent compiling errors on certain
|
||||
machines (#127).
|
||||
|
||||
* Added option --min-occ-floor to set a minimum occurrence threshold. Presets
|
||||
intended for assembly-to-reference alignment set this option to 100. This
|
||||
option alleviates issues with regions having high copy numbers (#107).
|
||||
|
||||
* Exit with non-zero code on file writing errors (e.g. disk full; #103 and
|
||||
#132).
|
||||
|
||||
* Added option -y to copy FASTA/FASTQ comments in query sequences to the
|
||||
output (#136).
|
||||
|
||||
* Added the asm20 preset for alignments between genomes at 5-10% sequence
|
||||
divergence.
|
||||
|
||||
* Changed the band-width in the ava-ont preset from 500 to 2000. Oxford
|
||||
Nanopore reads may contain long deletion sequencing errors that break
|
||||
chaining.
|
||||
|
||||
Changes to mappy, the Python binding:
|
||||
|
||||
* Fixed a typo in Align.seq() (#126).
|
||||
|
||||
Changes to paftools.js, the companion script:
|
||||
|
||||
* Command sam2paf now converts the MD tag to cs.
|
||||
|
||||
* Support VCF output for assembly-to-reference variant calling (#109).
|
||||
|
||||
This version should produce identical alignment for read overlapping, RNA-seq
|
||||
read mapping, and genomic read mapping. We have also added a cook book to show
|
||||
the variety uses of minimap2 on real datasets. Please see cookbook.md in the
|
||||
minimap2 source code directory.
|
||||
|
||||
(2.10: 27 March 2017, r761)
|
||||
|
||||
|
||||
|
||||
Release 2.9-r720 (23 February 2018)
|
||||
-----------------------------------
|
||||
|
||||
|
||||
@@ -1,7 +1,7 @@
|
||||
[](https://github.com/lh3/minimap2/releases)
|
||||
[](https://anaconda.org/bioconda/minimap2)
|
||||
[](https://pypi.python.org/pypi/mappy)
|
||||
[](https://travis-ci.org/lh3/minimap2)
|
||||
[](https://github.com/lh3/minimap2/actions)
|
||||
## <a name="started"></a>Getting Started
|
||||
```sh
|
||||
git clone https://github.com/lh3/minimap2
|
||||
@@ -9,20 +9,25 @@ cd minimap2 && make
|
||||
# long sequences against a reference genome
|
||||
./minimap2 -a test/MT-human.fa test/MT-orang.fa > test.sam
|
||||
# create an index first and then map
|
||||
./minimap2 -d MT-human.mmi test/MT-human.fa
|
||||
./minimap2 -a MT-human.mmi test/MT-orang.fa > test.sam
|
||||
./minimap2 -x map-ont -d MT-human-ont.mmi test/MT-human.fa
|
||||
./minimap2 -a MT-human-ont.mmi test/MT-orang.fa > test.sam
|
||||
# use presets (no test data)
|
||||
./minimap2 -ax map-pb ref.fa pacbio.fq.gz > aln.sam # PacBio genomic reads
|
||||
./minimap2 -ax map-pb ref.fa pacbio.fq.gz > aln.sam # PacBio CLR genomic reads
|
||||
./minimap2 -ax map-ont ref.fa ont.fq.gz > aln.sam # Oxford Nanopore genomic reads
|
||||
./minimap2 -ax map-hifi ref.fa pacbio-ccs.fq.gz > aln.sam # PacBio HiFi/CCS genomic reads (v2.19 or lateer)
|
||||
./minimap2 -ax asm20 ref.fa pacbio-ccs.fq.gz > aln.sam # PacBio HiFi/CCS genomic reads (v2.18 or earlier)
|
||||
./minimap2 -ax sr ref.fa read1.fa read2.fa > aln.sam # short genomic paired-end reads
|
||||
./minimap2 -ax splice ref.fa rna-reads.fa > aln.sam # spliced long reads
|
||||
./minimap2 -ax splice -k14 -uf ref.fa reads.fa > aln.sam # Nanopore Direct RNA-seq
|
||||
./minimap2 -ax splice ref.fa rna-reads.fa > aln.sam # spliced long reads (strand unknown)
|
||||
./minimap2 -ax splice -uf -k14 ref.fa reads.fa > aln.sam # noisy Nanopore Direct RNA-seq
|
||||
./minimap2 -ax splice:hq -uf ref.fa query.fa > aln.sam # Final PacBio Iso-seq or traditional cDNA
|
||||
./minimap2 -ax splice --junc-bed anno.bed12 ref.fa query.fa > aln.sam # prioritize on annotated junctions
|
||||
./minimap2 -cx asm5 asm1.fa asm2.fa > aln.paf # intra-species asm-to-asm alignment
|
||||
./minimap2 -x ava-pb reads.fa reads.fa > overlaps.paf # PacBio read overlap
|
||||
./minimap2 -x ava-ont reads.fa reads.fa > overlaps.paf # Nanopore read overlap
|
||||
# man page for detailed command line options
|
||||
man ./minimap2.1
|
||||
```
|
||||
|
||||
## Table of Contents
|
||||
|
||||
- [Getting Started](#started)
|
||||
@@ -61,16 +66,16 @@ mainstream long-read mappers such as BLASR, BWA-MEM, NGMLR and GMAP. It is more
|
||||
accurate on simulated long reads and produces biologically meaningful alignment
|
||||
ready for downstream analyses. For >100bp Illumina short reads, minimap2 is
|
||||
three times as fast as BWA-MEM and Bowtie2, and as accurate on simulated data.
|
||||
Detailed evaluations are available from the [minimap2 preprint][preprint].
|
||||
Detailed evaluations are available from the [minimap2 paper][doi] or the
|
||||
[preprint][preprint].
|
||||
|
||||
### <a name="install"></a>Installation
|
||||
|
||||
Minimap2 is optimized for x86-64 CPUs. You can acquire precompiled binaries from
|
||||
the [release page][release] with:
|
||||
```sh
|
||||
curl -L https://github.com/lh3/minimap2/releases/download/v2.9/minimap2-2.9_x64-linux.tar.bz2 \
|
||||
| tar -jxvf -
|
||||
./minimap2-2.9_x64-linux/minimap2
|
||||
curl -L https://github.com/lh3/minimap2/releases/download/v2.19/minimap2-2.19_x64-linux.tar.bz2 | tar -jxvf -
|
||||
./minimap2-2.19_x64-linux/minimap2
|
||||
```
|
||||
If you want to compile from the source, you need to have a C compiler, GNU make
|
||||
and zlib development files installed. Then type `make` in the source code
|
||||
@@ -78,7 +83,14 @@ directory to compile. If you see compilation errors, try `make sse2only=1`
|
||||
to disable SSE4 code, which will make minimap2 slightly slower.
|
||||
|
||||
Minimap2 also works with ARM CPUs supporting the NEON instruction sets. To
|
||||
compile, use `make arm_neon=1`.
|
||||
compile for 32 bit ARM architectures (such as ARMv7), use `make arm_neon=1`. To
|
||||
compile for for 64 bit ARM architectures (such as ARMv8), use `make arm_neon=1
|
||||
aarch64=1`.
|
||||
|
||||
Minimap2 can use [SIMD Everywhere (SIMDe)][simde] library for porting
|
||||
implementation to the different SIMD instruction sets. To compile using SIMDe,
|
||||
use `make -f Makefile.simde`. To compile for ARM CPUs, use `Makefile.simde`
|
||||
with the ARM related command lines given above.
|
||||
|
||||
### <a name="general"></a>General usage
|
||||
|
||||
@@ -125,19 +137,19 @@ parameters at the same time. The default setting is the same as `map-ont`.
|
||||
#### <a name="map-long-genomic"></a>Map long noisy genomic reads
|
||||
|
||||
```sh
|
||||
minimap2 -ax map-pb ref.fa pacbio-reads.fq > aln.sam # for PacBio subreads
|
||||
minimap2 -ax map-pb ref.fa pacbio-reads.fq > aln.sam # for PacBio CLR reads
|
||||
minimap2 -ax map-ont ref.fa ont-reads.fq > aln.sam # for Oxford Nanopore reads
|
||||
```
|
||||
The difference between `map-pb` and `map-ont` is that `map-pb` uses
|
||||
homopolymer-compressed (HPC) minimizers as seeds, while `map-ont` uses ordinary
|
||||
minimizers as seeds. Emperical evaluation suggests HPC minimizers improve
|
||||
performance and sensitivity when aligning PacBio reads, but hurt when aligning
|
||||
performance and sensitivity when aligning PacBio CLR reads, but hurt when aligning
|
||||
Nanopore reads.
|
||||
|
||||
#### <a name="map-long-splice"></a>Map long mRNA/cDNA reads
|
||||
|
||||
```sh
|
||||
minimap2 -ax splice -uf ref.fa iso-seq.fq > aln.sam # PacBio Iso-seq/traditional cDNA
|
||||
minimap2 -ax splice:hq -uf ref.fa iso-seq.fq > aln.sam # PacBio Iso-seq/traditional cDNA
|
||||
minimap2 -ax splice ref.fa nanopore-cdna.fa > aln.sam # Nanopore 2D cDNA-seq
|
||||
minimap2 -ax splice -uf -k14 ref.fa direct-rna.fq > aln.sam # Nanopore Direct RNA-seq
|
||||
minimap2 -ax splice --splice-flank=no SIRV.fa SIRV-seq.fa # mapping against SIRV control
|
||||
@@ -176,10 +188,23 @@ This is because SIRV does not honor the evolutionarily conservative splicing
|
||||
signal. If you are studying SIRV, you may apply `--splice-flank=no` to let
|
||||
minimap2 only model GT..AG, ignoring the additional base.
|
||||
|
||||
Since v2.17, minimap2 can optionally take annotated genes as input and
|
||||
prioritize on annotated splice junctions. To use this feature, you can
|
||||
```sh
|
||||
paftools.js gff2bed anno.gff > anno.bed
|
||||
minimap2 -ax splice --junc-bed anno.bed ref.fa query.fa > aln.sam
|
||||
```
|
||||
Here, `anno.gff` is the gene annotation in the GTF or GFF3 format (`gff2bed`
|
||||
automatically tests the format). The output of `gff2bed` is in the 12-column
|
||||
BED format, or the BED12 format. With the `--junc-bed` option, minimap2 adds a
|
||||
bonus score (tuned by `--junc-bonus`) if an aligned junction matches a junction
|
||||
in the annotation. Option `--junc-bed` also takes 5-column BED, including the
|
||||
strand field. In this case, each line indicates an oriented junction.
|
||||
|
||||
#### <a name="long-overlap"></a>Find overlaps between long reads
|
||||
|
||||
```sh
|
||||
minimap2 -x ava-pb reads.fq reads.fq > ovlp.paf # PacBio read overlap
|
||||
minimap2 -x ava-pb reads.fq reads.fq > ovlp.paf # PacBio CLR read overlap
|
||||
minimap2 -x ava-ont reads.fq reads.fq > ovlp.paf # Oxford Nanopore read overlap
|
||||
```
|
||||
Similarly, `ava-pb` uses HPC minimizers while `ava-ont` uses ordinary
|
||||
@@ -226,10 +251,10 @@ To avoid this issue, you can add option `-L` at the minimap2 command line.
|
||||
This option moves a long CIGAR to the `CG` tag and leaves a fully clipped CIGAR
|
||||
at the SAM CIGAR column. Current tools that don't read CIGAR (e.g. merging and
|
||||
sorting) still work with such BAM records; tools that read CIGAR will
|
||||
effectively ignore these records. It has been decided that future tools will
|
||||
effectively ignore these records. It has been decided that future tools
|
||||
will seamlessly recognize long-cigar records generated by option `-L`.
|
||||
|
||||
**TD;DR**: if you work with ultra-long reads and use tools that only process
|
||||
**TL;DR**: if you work with ultra-long reads and use tools that only process
|
||||
BAM files, please add option `-L`.
|
||||
|
||||
#### <a name="cs"></a>The cs optional tag
|
||||
@@ -247,14 +272,16 @@ CGATCGATAAATAGAGTAG---GAATAGCA
|
||||
CGATCG---AATAGAGTAGGTCGAATtGCA
|
||||
```
|
||||
is represented as `:6-ata:10+gtc:4*at:3`, where `:[0-9]+` represents an
|
||||
identical block, `-ata` represents a deltion, `+gtc` an insertion and `*at`
|
||||
identical block, `-ata` represents a deletion, `+gtc` an insertion and `*at`
|
||||
indicates reference base `a` is substituted with a query base `t`. It is
|
||||
similar to the `MD` SAM tag but is standalone and easier to parse.
|
||||
|
||||
If `--cs=long` is used, the `cs` string also contains identical sequences in
|
||||
the alignment. The above example will become
|
||||
`=CGATCG-ata=AATAGAGTAG+gtc=GAAT*at=GCA`. The long form of `cs` encodes both
|
||||
reference and query sequences in one string.
|
||||
reference and query sequences in one string. The `cs` tag also encodes intron
|
||||
positions and splicing signals (see the [minimap2 manpage][manpage-cs] for
|
||||
details).
|
||||
|
||||
#### <a name="paftools"></a>Working with the PAF format
|
||||
|
||||
@@ -311,15 +338,17 @@ highlighted in bold. The description may help to tune minimap2 parameters.
|
||||
### <a name="help"></a>Getting help
|
||||
|
||||
Manpage [minimap2.1][manpage] provides detailed description of minimap2
|
||||
command line options and optional tags. If you encounter bugs or have further
|
||||
questions or requests, you can raise an issue at the [issue page][issue].
|
||||
There is not a specific mailing list for the time being.
|
||||
command line options and optional tags. The [FAQ](FAQ.md) page answers several
|
||||
frequently asked questions. If you encounter bugs or have further questions or
|
||||
requests, you can raise an issue at the [issue page][issue]. There is not a
|
||||
specific mailing list for the time being.
|
||||
|
||||
### <a name="cite"></a>Citing minimap2
|
||||
|
||||
If you use minimap2 in your work, please consider to cite:
|
||||
If you use minimap2 in your work, please cite:
|
||||
|
||||
> Li, H. (2017). Minimap2: fast pairwise alignment for long nucleotide sequences. [arXiv:1708.01492][preprint]
|
||||
> Li, H. (2018). Minimap2: pairwise alignment for nucleotide sequences.
|
||||
> *Bioinformatics*, **34**:3094-3100. [doi:10.1093/bioinformatics/bty191][doi]
|
||||
|
||||
## <a name="dguide"></a>Developers' Guide
|
||||
|
||||
@@ -346,6 +375,12 @@ mappy` or [from BioConda][mappyconda] via `conda install -c bioconda mappy`.
|
||||
possible to add non-SIMD support, but it would make minimap2 slower by
|
||||
several times.
|
||||
|
||||
* Minimap2 does not work with a single query or database sequence ~2
|
||||
billion bases or longer (2,147,483,647 to be exact). The total length of all
|
||||
sequences can well exceed this threshold.
|
||||
|
||||
* Minimap2 often misses small exons.
|
||||
|
||||
|
||||
|
||||
[paf]: https://github.com/lh3/miniasm/blob/master/PAF.md
|
||||
@@ -362,3 +397,7 @@ mappy` or [from BioConda][mappyconda] via `conda install -c bioconda mappy`.
|
||||
[issue]: https://github.com/lh3/minimap2/issues
|
||||
[k8]: https://github.com/attractivechaos/k8
|
||||
[manpage]: https://lh3.github.io/minimap2/minimap2.html
|
||||
[manpage-cs]: https://lh3.github.io/minimap2/minimap2.html#10
|
||||
[doi]: https://doi.org/10.1093/bioinformatics/bty191
|
||||
[smide]: https://github.com/nemequ/simde
|
||||
[unimap]: https://github.com/lh3/unimap
|
||||
|
||||
@@ -6,18 +6,19 @@
|
||||
#include "mmpriv.h"
|
||||
#include "ksw2.h"
|
||||
|
||||
static void ksw_gen_simple_mat(int m, int8_t *mat, int8_t a, int8_t b)
|
||||
static void ksw_gen_simple_mat(int m, int8_t *mat, int8_t a, int8_t b, int8_t sc_ambi)
|
||||
{
|
||||
int i, j;
|
||||
a = a < 0? -a : a;
|
||||
b = b > 0? -b : b;
|
||||
sc_ambi = sc_ambi > 0? -sc_ambi : sc_ambi;
|
||||
for (i = 0; i < m - 1; ++i) {
|
||||
for (j = 0; j < m - 1; ++j)
|
||||
mat[i * m + j] = i == j? a : b;
|
||||
mat[i * m + m - 1] = 0;
|
||||
mat[i * m + m - 1] = sc_ambi;
|
||||
}
|
||||
for (j = 0; j < m; ++j)
|
||||
mat[(m - 1) * m + j] = 0;
|
||||
mat[(m - 1) * m + j] = sc_ambi;
|
||||
}
|
||||
|
||||
static inline void mm_seq_rev(uint32_t len, uint8_t *seq)
|
||||
@@ -37,8 +38,8 @@ static inline void update_max_zdrop(int32_t score, int i, int j, int32_t *max, i
|
||||
int z = *max - score - diff * e;
|
||||
if (z > *max_zdrop) {
|
||||
*max_zdrop = z;
|
||||
pos[0][0] = *max_i, pos[0][1] = i + 1;
|
||||
pos[1][0] = *max_j, pos[1][1] = j + 1;
|
||||
pos[0][0] = *max_i, pos[0][1] = i;
|
||||
pos[1][0] = *max_j, pos[1][1] = j;
|
||||
}
|
||||
} else *max = score, *max_i = i, *max_j = j;
|
||||
}
|
||||
@@ -90,7 +91,8 @@ static int mm_test_zdrop(void *km, const mm_mapopt_t *opt, const uint8_t *qseq,
|
||||
static void mm_fix_cigar(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq, int *qshift, int *tshift)
|
||||
{
|
||||
mm_extra_t *p = r->p;
|
||||
int32_t k, toff = 0, qoff = 0, to_shrink = 0;
|
||||
int32_t toff = 0, qoff = 0, to_shrink = 0;
|
||||
uint32_t k;
|
||||
*qshift = *tshift = 0;
|
||||
if (p->n_cigar <= 1) return;
|
||||
for (k = 0; k < p->n_cigar; ++k) { // indel left alignment
|
||||
@@ -121,6 +123,25 @@ static void mm_fix_cigar(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq,
|
||||
}
|
||||
}
|
||||
assert(qoff == r->qe - r->qs && toff == r->re - r->rs);
|
||||
for (k = 0; k < p->n_cigar - 2; ++k) { // fix CIGAR like 5I6D7I
|
||||
if ((p->cigar[k]&0xf) > 0 && (p->cigar[k]&0xf) + (p->cigar[k+1]&0xf) == 3) {
|
||||
uint32_t l, s[3] = {0,0,0};
|
||||
for (l = k; l < p->n_cigar; ++l) { // count number of adjacent I and D
|
||||
uint32_t op = p->cigar[l]&0xf;
|
||||
if (op == 1 || op == 2 || p->cigar[l]>>4 == 0)
|
||||
s[op] += p->cigar[l] >> 4;
|
||||
else break;
|
||||
}
|
||||
if (s[1] > 0 && s[2] > 0 && l - k > 2) { // turn to a single I and a single D
|
||||
p->cigar[k] = s[1]<<4|1;
|
||||
p->cigar[k+1] = s[2]<<4|2;
|
||||
for (k += 2; k < l; ++k)
|
||||
p->cigar[k] &= 0xf;
|
||||
to_shrink = 1;
|
||||
}
|
||||
k = l;
|
||||
}
|
||||
}
|
||||
if (to_shrink) { // squeeze out zero-length operations
|
||||
int32_t l = 0;
|
||||
for (k = 0; k < p->n_cigar; ++k) // squeeze out zero-length operations
|
||||
@@ -145,10 +166,81 @@ static void mm_fix_cigar(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq,
|
||||
}
|
||||
}
|
||||
|
||||
static void mm_update_extra(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq, const int8_t *mat, int8_t q, int8_t e)
|
||||
static void mm_update_cigar_eqx(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq) // written by @armintoepfer
|
||||
{
|
||||
uint32_t k, l, toff = 0, qoff = 0;
|
||||
int32_t s = 0, max = 0, qshift, tshift;
|
||||
uint32_t n_EQX = 0;
|
||||
uint32_t k, l, m, cap, toff = 0, qoff = 0, n_M = 0;
|
||||
mm_extra_t *p;
|
||||
if (r->p == 0) return;
|
||||
for (k = 0; k < r->p->n_cigar; ++k) {
|
||||
uint32_t op = r->p->cigar[k]&0xf, len = r->p->cigar[k]>>4;
|
||||
if (op == 0) {
|
||||
while (len > 0) {
|
||||
for (l = 0; l < len && qseq[qoff + l] == tseq[toff + l]; ++l) {} // run of "="; TODO: N<=>N is converted to "="
|
||||
if (l > 0) { ++n_EQX; len -= l; toff += l; qoff += l; }
|
||||
|
||||
for (l = 0; l < len && qseq[qoff + l] != tseq[toff + l]; ++l) {} // run of "X"
|
||||
if (l > 0) { ++n_EQX; len -= l; toff += l; qoff += l; }
|
||||
}
|
||||
++n_M;
|
||||
} else if (op == 1) { // insertion
|
||||
qoff += len;
|
||||
} else if (op == 2) { // deletion
|
||||
toff += len;
|
||||
} else if (op == 3) { // intron
|
||||
toff += len;
|
||||
}
|
||||
}
|
||||
// update in-place if we can
|
||||
if (n_EQX == n_M) {
|
||||
for (k = 0; k < r->p->n_cigar; ++k) {
|
||||
uint32_t op = r->p->cigar[k]&0xf, len = r->p->cigar[k]>>4;
|
||||
if (op == 0) r->p->cigar[k] = len << 4 | 7;
|
||||
}
|
||||
return;
|
||||
}
|
||||
// allocate new storage
|
||||
cap = r->p->n_cigar + (n_EQX - n_M) + sizeof(mm_extra_t);
|
||||
kroundup32(cap);
|
||||
p = (mm_extra_t*)calloc(cap, 4);
|
||||
memcpy(p, r->p, sizeof(mm_extra_t));
|
||||
p->capacity = cap;
|
||||
// update cigar while copying
|
||||
toff = qoff = m = 0;
|
||||
for (k = 0; k < r->p->n_cigar; ++k) {
|
||||
uint32_t op = r->p->cigar[k]&0xf, len = r->p->cigar[k]>>4;
|
||||
if (op == 0) { // match/mismatch
|
||||
while (len > 0) {
|
||||
// match
|
||||
for (l = 0; l < len && qseq[qoff + l] == tseq[toff + l]; ++l) {}
|
||||
if (l > 0) p->cigar[m++] = l << 4 | 7;
|
||||
len -= l;
|
||||
toff += l, qoff += l;
|
||||
// mismatch
|
||||
for (l = 0; l < len && qseq[qoff + l] != tseq[toff + l]; ++l) {}
|
||||
if (l > 0) p->cigar[m++] = l << 4 | 8;
|
||||
len -= l;
|
||||
toff += l, qoff += l;
|
||||
}
|
||||
continue;
|
||||
} else if (op == 1) { // insertion
|
||||
qoff += len;
|
||||
} else if (op == 2) { // deletion
|
||||
toff += len;
|
||||
} else if (op == 3) { // intron
|
||||
toff += len;
|
||||
}
|
||||
p->cigar[m++] = r->p->cigar[k];
|
||||
}
|
||||
p->n_cigar = m;
|
||||
free(r->p);
|
||||
r->p = p;
|
||||
}
|
||||
|
||||
static void mm_update_extra(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq, const int8_t *mat, int8_t q, int8_t e, int is_eqx)
|
||||
{
|
||||
uint32_t k, l;
|
||||
int32_t s = 0, max = 0, qshift, tshift, toff = 0, qoff = 0;
|
||||
mm_extra_t *p = r->p;
|
||||
if (p == 0) return;
|
||||
mm_fix_cigar(r, qseq, tseq, &qshift, &tshift);
|
||||
@@ -190,6 +282,7 @@ static void mm_update_extra(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *ts
|
||||
}
|
||||
p->dp_max = max;
|
||||
assert(qoff == r->qe - r->qs && toff == r->re - r->rs);
|
||||
if (is_eqx) mm_update_cigar_eqx(r, qseq, tseq); // NB: it has to be called here as changes to qseq and tseq are not returned
|
||||
}
|
||||
|
||||
static void mm_append_cigar(mm_reg1_t *r, uint32_t n_cigar, uint32_t *cigar) // TODO: this calls the libc realloc()
|
||||
@@ -197,12 +290,12 @@ static void mm_append_cigar(mm_reg1_t *r, uint32_t n_cigar, uint32_t *cigar) //
|
||||
mm_extra_t *p;
|
||||
if (n_cigar == 0) return;
|
||||
if (r->p == 0) {
|
||||
uint32_t capacity = n_cigar + sizeof(mm_extra_t);
|
||||
uint32_t capacity = n_cigar + sizeof(mm_extra_t)/4;
|
||||
kroundup32(capacity);
|
||||
r->p = (mm_extra_t*)calloc(capacity, 4);
|
||||
r->p->capacity = capacity;
|
||||
} else if (r->p->n_cigar + n_cigar + sizeof(mm_extra_t) > r->p->capacity) {
|
||||
r->p->capacity = r->p->n_cigar + n_cigar + sizeof(mm_extra_t);
|
||||
} else if (r->p->n_cigar + n_cigar + sizeof(mm_extra_t)/4 > r->p->capacity) {
|
||||
r->p->capacity = r->p->n_cigar + n_cigar + sizeof(mm_extra_t)/4;
|
||||
kroundup32(r->p->capacity);
|
||||
r->p = (mm_extra_t*)realloc(r->p, r->p->capacity * 4);
|
||||
}
|
||||
@@ -217,7 +310,7 @@ static void mm_append_cigar(mm_reg1_t *r, uint32_t n_cigar, uint32_t *cigar) //
|
||||
}
|
||||
}
|
||||
|
||||
static void mm_align_pair(void *km, const mm_mapopt_t *opt, int qlen, const uint8_t *qseq, int tlen, const uint8_t *tseq, const int8_t *mat, int w, int end_bonus, int zdrop, int flag, ksw_extz_t *ez)
|
||||
static void mm_align_pair(void *km, const mm_mapopt_t *opt, int qlen, const uint8_t *qseq, int tlen, const uint8_t *tseq, const uint8_t *junc, const int8_t *mat, int w, int end_bonus, int zdrop, int flag, ksw_extz_t *ez)
|
||||
{
|
||||
if (mm_dbg_flag & MM_DBG_PRINT_ALN_SEQ) {
|
||||
int i;
|
||||
@@ -227,8 +320,11 @@ static void mm_align_pair(void *km, const mm_mapopt_t *opt, int qlen, const uint
|
||||
for (i = 0; i < qlen; ++i) fputc("ACGTN"[qseq[i]], stderr);
|
||||
fputc('\n', stderr);
|
||||
}
|
||||
if (opt->flag & MM_F_SPLICE)
|
||||
ksw_exts2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->noncan, zdrop, flag, ez);
|
||||
if (opt->max_sw_mat > 0 && (int64_t)tlen * qlen > opt->max_sw_mat) {
|
||||
ksw_reset_extz(ez);
|
||||
ez->zdropped = 1;
|
||||
} else if (opt->flag & MM_F_SPLICE)
|
||||
ksw_exts2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->noncan, zdrop, opt->junc_bonus, flag, junc, ez);
|
||||
else if (opt->q == opt->q2 && opt->e == opt->e2)
|
||||
ksw_extz2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, w, zdrop, end_bonus, flag, ez);
|
||||
else
|
||||
@@ -268,20 +364,30 @@ static inline void mm_adjust_minier(const mm_idx_t *mi, uint8_t *const qseq0[2],
|
||||
}
|
||||
}
|
||||
|
||||
static void mm_filter_bad_seeds(void *km, int as1, int cnt1, mm128_t *a, int min_gap, int diff_thres, int max_ext_len, int max_ext_cnt)
|
||||
static int *collect_long_gaps(void *km, int as1, int cnt1, mm128_t *a, int min_gap, int *n_)
|
||||
{
|
||||
int max_st, max_en, n, i, k, max, *K;
|
||||
int i, n, *K;
|
||||
*n_ = 0;
|
||||
for (i = 1, n = 0; i < cnt1; ++i) { // count the number of gaps longer than min_gap
|
||||
int gap = ((int32_t)a[as1 + i].y - a[as1 + i - 1].y) - ((int32_t)a[as1 + i].x - a[as1 + i - 1].x);
|
||||
if (gap < -min_gap || gap > min_gap) ++n;
|
||||
}
|
||||
if (n <= 1) return;
|
||||
if (n <= 1) return 0;
|
||||
K = (int*)kmalloc(km, n * sizeof(int));
|
||||
for (i = 1, n = 0; i < cnt1; ++i) { // store the positions of long gaps
|
||||
int gap = ((int32_t)a[as1 + i].y - a[as1 + i - 1].y) - ((int32_t)a[as1 + i].x - a[as1 + i - 1].x);
|
||||
if (gap < -min_gap || gap > min_gap)
|
||||
K[n++] = i;
|
||||
}
|
||||
*n_ = n;
|
||||
return K;
|
||||
}
|
||||
|
||||
static void mm_filter_bad_seeds(void *km, int as1, int cnt1, mm128_t *a, int min_gap, int diff_thres, int max_ext_len, int max_ext_cnt)
|
||||
{
|
||||
int max_st, max_en, n, i, k, max, *K;
|
||||
K = collect_long_gaps(km, as1, cnt1, a, min_gap, &n);
|
||||
if (K == 0) return;
|
||||
max = 0, max_st = max_en = -1;
|
||||
for (k = 0;; ++k) { // traverse long gaps
|
||||
int gap, l, n_ins = 0, n_del = 0, qs, rs, max_diff = 0, max_diff_l = -1;
|
||||
@@ -293,7 +399,7 @@ static void mm_filter_bad_seeds(void *km, int as1, int cnt1, mm128_t *a, int min
|
||||
if (k == n) break;
|
||||
}
|
||||
i = K[k];
|
||||
gap = ((int32_t)a[as1 + i].y - a[as1 + i - 1].y) - ((int32_t)a[as1 + i].x - a[as1 + i - 1].x);
|
||||
gap = ((int32_t)a[as1 + i].y - (int32_t)a[as1 + i - 1].y) - (int32_t)(a[as1 + i].x - a[as1 + i - 1].x);
|
||||
if (gap > 0) n_ins += gap;
|
||||
else n_del += -gap;
|
||||
qs = (int32_t)a[as1 + i - 1].y;
|
||||
@@ -301,7 +407,7 @@ static void mm_filter_bad_seeds(void *km, int as1, int cnt1, mm128_t *a, int min
|
||||
for (l = k + 1; l < n && l <= k + max_ext_cnt; ++l) {
|
||||
int j = K[l], diff;
|
||||
if ((int32_t)a[as1 + j].y - qs > max_ext_len || (int32_t)a[as1 + j].x - rs > max_ext_len) break;
|
||||
gap = ((int32_t)a[as1 + j].y - (int32_t)a[as1 + j - 1].y) - (a[as1 + j].x - a[as1 + j - 1].x);
|
||||
gap = ((int32_t)a[as1 + j].y - (int32_t)a[as1 + j - 1].y) - (int32_t)(a[as1 + j].x - a[as1 + j - 1].x);
|
||||
if (gap > 0) n_ins += gap;
|
||||
else n_del += -gap;
|
||||
diff = n_ins + n_del - abs(n_ins - n_del);
|
||||
@@ -314,6 +420,42 @@ static void mm_filter_bad_seeds(void *km, int as1, int cnt1, mm128_t *a, int min
|
||||
kfree(km, K);
|
||||
}
|
||||
|
||||
static void mm_filter_bad_seeds_alt(void *km, int as1, int cnt1, mm128_t *a, int min_gap, int max_ext)
|
||||
{
|
||||
int n, k, *K;
|
||||
K = collect_long_gaps(km, as1, cnt1, a, min_gap, &n);
|
||||
if (K == 0) return;
|
||||
for (k = 0; k < n;) {
|
||||
int i = K[k], l;
|
||||
int gap1 = ((int32_t)a[as1 + i].y - (int32_t)a[as1 + i - 1].y) - ((int32_t)a[as1 + i].x - (int32_t)a[as1 + i - 1].x);
|
||||
int re1 = (int32_t)a[as1 + i].x;
|
||||
int qe1 = (int32_t)a[as1 + i].y;
|
||||
gap1 = gap1 > 0? gap1 : -gap1;
|
||||
for (l = k + 1; l < n; ++l) {
|
||||
int j = K[l], gap2, q_span_pre, rs2, qs2, m;
|
||||
if ((int32_t)a[as1 + j].y - qe1 > max_ext || (int32_t)a[as1 + j].x - re1 > max_ext) break;
|
||||
gap2 = ((int32_t)a[as1 + j].y - (int32_t)a[as1 + j - 1].y) - (int32_t)(a[as1 + j].x - a[as1 + j - 1].x);
|
||||
q_span_pre = a[as1 + j - 1].y >> 32 & 0xff;
|
||||
rs2 = (int32_t)a[as1 + j - 1].x + q_span_pre;
|
||||
qs2 = (int32_t)a[as1 + j - 1].y + q_span_pre;
|
||||
m = rs2 - re1 < qs2 - qe1? rs2 - re1 : qs2 - qe1;
|
||||
gap2 = gap2 > 0? gap2 : -gap2;
|
||||
if (m > gap1 + gap2) break;
|
||||
re1 = (int32_t)a[as1 + j].x;
|
||||
qe1 = (int32_t)a[as1 + j].y;
|
||||
gap1 = gap2;
|
||||
}
|
||||
if (l > k + 1) {
|
||||
int j, end = K[l - 1];
|
||||
for (j = K[k]; j < end; ++j)
|
||||
a[as1 + j].y |= MM_SEED_IGNORE;
|
||||
a[as1 + end].y |= MM_SEED_LONG_JOIN;
|
||||
}
|
||||
k = l;
|
||||
}
|
||||
kfree(km, K);
|
||||
}
|
||||
|
||||
static void mm_fix_bad_ends(const mm_reg1_t *r, const mm128_t *a, int bw, int min_match, int32_t *as, int32_t *cnt)
|
||||
{
|
||||
int32_t i, l, m;
|
||||
@@ -350,7 +492,7 @@ static void mm_fix_bad_ends(const mm_reg1_t *r, const mm128_t *a, int bw, int mi
|
||||
}
|
||||
}
|
||||
|
||||
static void mm_max_stretch(const mm_mapopt_t *opt, const mm_reg1_t *r, const mm128_t *a, int32_t *as, int32_t *cnt)
|
||||
static void mm_max_stretch(const mm_reg1_t *r, const mm128_t *a, int32_t *as, int32_t *cnt)
|
||||
{
|
||||
int32_t i, score, max_score, len, max_i, max_len;
|
||||
|
||||
@@ -388,7 +530,7 @@ static int mm_seed_ext_score(void *km, const mm_mapopt_t *opt, const mm_idx_t *m
|
||||
qe = (uint32_t)a->y + 1, qs = qe - q_span;
|
||||
rs = rs - ext_len > 0? rs - ext_len : 0;
|
||||
qs = qs - ext_len > 0? qs - ext_len : 0;
|
||||
re = re + ext_len < mi->seq[rid].len? re + ext_len : mi->seq[rid].len;
|
||||
re = re + ext_len < (int32_t)mi->seq[rid].len? re + ext_len : mi->seq[rid].len;
|
||||
qe = qe + ext_len < qlen? qe + ext_len : qlen;
|
||||
tseq = (uint8_t*)kmalloc(km, re - rs);
|
||||
mm_idx_getseq(mi, rid, rs, re, tseq);
|
||||
@@ -424,8 +566,8 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
|
||||
{
|
||||
int is_sr = !!(opt->flag & MM_F_SR), is_splice = !!(opt->flag & MM_F_SPLICE);
|
||||
int32_t rid = a[r->as].x<<1>>33, rev = a[r->as].x>>63, as1, cnt1;
|
||||
uint8_t *tseq, *qseq;
|
||||
int32_t i, l, bw, dropped = 0, extra_flag = 0, rs0, re0, qs0, qe0;
|
||||
uint8_t *tseq, *qseq, *junc;
|
||||
int32_t i, l, bw, bw_long, dropped = 0, extra_flag = 0, rs0, re0, qs0, qe0;
|
||||
int32_t rs, re, qs, qe;
|
||||
int32_t rs1, qs1, re1, qe1;
|
||||
int8_t mat[25];
|
||||
@@ -434,22 +576,26 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
|
||||
|
||||
r2->cnt = 0;
|
||||
if (r->cnt == 0) return;
|
||||
ksw_gen_simple_mat(5, mat, opt->a, opt->b);
|
||||
ksw_gen_simple_mat(5, mat, opt->a, opt->b, opt->sc_ambi);
|
||||
bw = (int)(opt->bw * 1.5 + 1.);
|
||||
bw_long = (int)(opt->bw_long * 1.5 + 1.);
|
||||
if (bw_long < bw) bw_long = bw;
|
||||
|
||||
if (is_sr && !(mi->flag & MM_I_HPC)) {
|
||||
mm_max_stretch(opt, r, a, &as1, &cnt1);
|
||||
mm_max_stretch(r, a, &as1, &cnt1);
|
||||
rs = (int32_t)a[as1].x + 1 - (int32_t)(a[as1].y>>32&0xff);
|
||||
qs = (int32_t)a[as1].y + 1 - (int32_t)(a[as1].y>>32&0xff);
|
||||
re = (int32_t)a[as1+cnt1-1].x + 1;
|
||||
qe = (int32_t)a[as1+cnt1-1].y + 1;
|
||||
} else {
|
||||
if (is_splice) {
|
||||
mm_fix_bad_ends_splice(km, opt, mi, r, mat, qlen, qseq0, a, &as1, &cnt1);
|
||||
} else {
|
||||
mm_fix_bad_ends(r, a, opt->bw, opt->min_chain_score * 2, &as1, &cnt1);
|
||||
}
|
||||
if (!(opt->flag & MM_F_NO_END_FLT)) {
|
||||
if (is_splice)
|
||||
mm_fix_bad_ends_splice(km, opt, mi, r, mat, qlen, qseq0, a, &as1, &cnt1);
|
||||
else
|
||||
mm_fix_bad_ends(r, a, opt->bw, opt->min_chain_score * 2, &as1, &cnt1);
|
||||
} else as1 = r->as, cnt1 = r->cnt;
|
||||
mm_filter_bad_seeds(km, as1, cnt1, a, 10, 40, opt->max_gap>>1, 10);
|
||||
mm_filter_bad_seeds_alt(km, as1, cnt1, a, 30, opt->max_gap>>1);
|
||||
mm_adjust_minier(mi, qseq0, &a[as1], &rs, &qs);
|
||||
mm_adjust_minier(mi, qseq0, &a[as1 + cnt1 - 1], &re, &qe);
|
||||
}
|
||||
@@ -473,7 +619,7 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
|
||||
rs0 = rs - l > 0? rs - l : 0;
|
||||
l = qlen - qe;
|
||||
l += l * opt->a + opt->end_bonus > opt->q? (l * opt->a + opt->end_bonus - opt->q) / opt->e : 0;
|
||||
re0 = re + l < mi->seq[rid].len? re + l : mi->seq[rid].len;
|
||||
re0 = re + l < (int32_t)mi->seq[rid].len? re + l : mi->seq[rid].len;
|
||||
} else {
|
||||
// compute rs0 and qs0
|
||||
rs0 = (int32_t)a[r->as].x + 1 - (int32_t)(a[r->as].y>>32&0xff);
|
||||
@@ -488,6 +634,7 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
|
||||
if (++l > opt->min_cnt) {
|
||||
l = rs0 - x > qs0 - y? rs0 - x : qs0 - y;
|
||||
rs1 = rs0 - l, qs1 = qs0 - l;
|
||||
if (rs1 < 0) rs1 = 0; // not strictly necessary; better have this guard for explicit
|
||||
break;
|
||||
}
|
||||
}
|
||||
@@ -501,6 +648,7 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
|
||||
l = l < rs? l : rs;
|
||||
rs1 = rs1 > rs - l? rs1 : rs - l;
|
||||
rs0 = rs0 < rs1? rs0 : rs1;
|
||||
rs0 = rs0 < rs? rs0 : rs;
|
||||
} else rs0 = rs, qs0 = qs;
|
||||
// compute re0 and qe0
|
||||
re0 = (int32_t)a[r->as + r->cnt - 1].x + 1;
|
||||
@@ -517,13 +665,13 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
|
||||
}
|
||||
}
|
||||
}
|
||||
if (qe < qlen && re < mi->seq[rid].len) {
|
||||
if (qe < qlen && re < (int32_t)mi->seq[rid].len) {
|
||||
l = qlen - qe < opt->max_gap? qlen - qe : opt->max_gap;
|
||||
qe1 = qe1 < qe + l? qe1 : qe + l;
|
||||
qe0 = qe0 > qe1? qe0 : qe1; // at least include qe0
|
||||
l += l * opt->a > opt->q? (l * opt->a - opt->q) / opt->e : 0;
|
||||
l = l < opt->max_gap? l : opt->max_gap;
|
||||
l = l < mi->seq[rid].len - re? l : mi->seq[rid].len - re;
|
||||
l = l < (int32_t)mi->seq[rid].len - re? l : mi->seq[rid].len - re;
|
||||
re1 = re1 < re + l? re1 : re + l;
|
||||
re0 = re0 > re1? re0 : re1;
|
||||
} else re0 = re, qe0 = qe;
|
||||
@@ -539,13 +687,16 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
|
||||
|
||||
assert(re0 > rs0);
|
||||
tseq = (uint8_t*)kmalloc(km, re0 - rs0);
|
||||
junc = (uint8_t*)kmalloc(km, re0 - rs0);
|
||||
|
||||
if (qs > 0 && rs > 0) { // left extension
|
||||
if (qs > 0 && rs > 0) { // left extension; probably the condition can be changed to "qs > qs0 && rs > rs0"
|
||||
qseq = &qseq0[rev][qs0];
|
||||
mm_idx_getseq(mi, rid, rs0, rs, tseq);
|
||||
mm_idx_bed_junc(mi, rid, rs0, rs, junc);
|
||||
mm_seq_rev(qs - qs0, qseq);
|
||||
mm_seq_rev(rs - rs0, tseq);
|
||||
mm_align_pair(km, opt, qs - qs0, qseq, rs - rs0, tseq, mat, bw, opt->end_bonus, r->split_inv? opt->zdrop_inv : opt->zdrop, extra_flag|KSW_EZ_EXTZ_ONLY|KSW_EZ_RIGHT|KSW_EZ_REV_CIGAR, ez);
|
||||
mm_seq_rev(rs - rs0, junc);
|
||||
mm_align_pair(km, opt, qs - qs0, qseq, rs - rs0, tseq, junc, mat, bw, opt->end_bonus, r->split_inv? opt->zdrop_inv : opt->zdrop, extra_flag|KSW_EZ_EXTZ_ONLY|KSW_EZ_RIGHT|KSW_EZ_REV_CIGAR, ez);
|
||||
if (ez->n_cigar > 0) {
|
||||
mm_append_cigar(r, ez->n_cigar, ez->cigar);
|
||||
r->p->dp_score += ez->max;
|
||||
@@ -565,12 +716,13 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
|
||||
} else mm_adjust_minier(mi, qseq0, &a[as1 + i], &re, &qe);
|
||||
re1 = re, qe1 = qe;
|
||||
if (i == cnt1 - 1 || (a[as1+i].y&MM_SEED_LONG_JOIN) || (qe - qs >= opt->min_ksw_len && re - rs >= opt->min_ksw_len)) {
|
||||
int j, bw1 = bw, zdrop_code;
|
||||
int j, bw1 = bw_long, zdrop_code;
|
||||
if (a[as1+i].y & MM_SEED_LONG_JOIN)
|
||||
bw1 = qe - qs > re - rs? qe - qs : re - rs;
|
||||
// perform alignment
|
||||
qseq = &qseq0[rev][qs];
|
||||
mm_idx_getseq(mi, rid, rs, re, tseq);
|
||||
mm_idx_bed_junc(mi, rid, rs, re, junc);
|
||||
if (is_sr) { // perform ungapped alignment
|
||||
assert(qe - qs == re - rs);
|
||||
ksw_reset_extz(ez);
|
||||
@@ -580,15 +732,22 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
|
||||
}
|
||||
ez->cigar = ksw_push_cigar(km, &ez->n_cigar, &ez->m_cigar, ez->cigar, 0, qe - qs);
|
||||
} else { // perform normal gapped alignment
|
||||
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, mat, bw1, -1, opt->zdrop, extra_flag|KSW_EZ_APPROX_MAX, ez); // first pass: with approximate Z-drop
|
||||
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, junc, mat, bw1, -1, opt->zdrop, extra_flag|KSW_EZ_APPROX_MAX, ez); // first pass: with approximate Z-drop
|
||||
}
|
||||
// test Z-drop and inversion Z-drop
|
||||
if ((zdrop_code = mm_test_zdrop(km, opt, qseq, tseq, ez->n_cigar, ez->cigar, mat)) != 0)
|
||||
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, mat, bw1, -1, zdrop_code == 2? opt->zdrop_inv : opt->zdrop, extra_flag, ez); // second pass: lift approximate
|
||||
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, junc, mat, bw1, -1, zdrop_code == 2? opt->zdrop_inv : opt->zdrop, extra_flag, ez); // second pass: lift approximate
|
||||
// update CIGAR
|
||||
if (ez->n_cigar > 0)
|
||||
mm_append_cigar(r, ez->n_cigar, ez->cigar);
|
||||
if (ez->zdropped) { // truncated by Z-drop; TODO: sometimes Z-drop kicks in because the next seed placement is wrong. This can be fixed in principle.
|
||||
if (!r->p) {
|
||||
assert(ez->n_cigar == 0);
|
||||
uint32_t capacity = sizeof(mm_extra_t)/4;
|
||||
kroundup32(capacity);
|
||||
r->p = (mm_extra_t*)calloc(capacity, 4);
|
||||
r->p->capacity = capacity;
|
||||
}
|
||||
for (j = i - 1; j >= 0; --j)
|
||||
if ((int32_t)a[as1 + j].x <= rs + ez->max_t)
|
||||
break;
|
||||
@@ -610,7 +769,8 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
|
||||
if (!dropped && qe < qe0 && re < re0) { // right extension
|
||||
qseq = &qseq0[rev][qe];
|
||||
mm_idx_getseq(mi, rid, re, re0, tseq);
|
||||
mm_align_pair(km, opt, qe0 - qe, qseq, re0 - re, tseq, mat, bw, opt->end_bonus, opt->zdrop, extra_flag|KSW_EZ_EXTZ_ONLY, ez);
|
||||
mm_idx_bed_junc(mi, rid, re, re0, junc);
|
||||
mm_align_pair(km, opt, qe0 - qe, qseq, re0 - re, tseq, junc, mat, bw, opt->end_bonus, opt->zdrop, extra_flag|KSW_EZ_EXTZ_ONLY, ez);
|
||||
if (ez->n_cigar > 0) {
|
||||
mm_append_cigar(r, ez->n_cigar, ez->cigar);
|
||||
r->p->dp_score += ez->max;
|
||||
@@ -627,12 +787,13 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
|
||||
assert(re1 - rs1 <= re0 - rs0);
|
||||
if (r->p) {
|
||||
mm_idx_getseq(mi, rid, rs1, re1, tseq);
|
||||
mm_update_extra(r, &qseq0[r->rev][qs1], tseq, mat, opt->q, opt->e);
|
||||
mm_update_extra(r, &qseq0[r->rev][qs1], tseq, mat, opt->q, opt->e, opt->flag & MM_F_EQX);
|
||||
if (rev && r->p->trans_strand)
|
||||
r->p->trans_strand ^= 3; // flip to the read strand
|
||||
}
|
||||
|
||||
kfree(km, tseq);
|
||||
kfree(km, junc);
|
||||
}
|
||||
|
||||
static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, uint8_t *qseq0[2], const mm_reg1_t *r1, const mm_reg1_t *r2, mm_reg1_t *r_inv, ksw_extz_t *ez)
|
||||
@@ -652,7 +813,7 @@ static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, i
|
||||
if (ql < opt->min_chain_score || ql > opt->max_gap) return 0;
|
||||
if (tl < opt->min_chain_score || tl > opt->max_gap) return 0;
|
||||
|
||||
ksw_gen_simple_mat(5, mat, opt->a, opt->b);
|
||||
ksw_gen_simple_mat(5, mat, opt->a, opt->b, opt->sc_ambi);
|
||||
tseq = (uint8_t*)kmalloc(km, tl);
|
||||
mm_idx_getseq(mi, r1->rid, r1->re, r2->rs, tseq);
|
||||
qseq = r1->rev? &qseq0[0][r2->qe] : &qseq0[1][qlen - r2->qs];
|
||||
@@ -666,7 +827,7 @@ static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, i
|
||||
mm_seq_rev(tl, tseq);
|
||||
if (score < opt->min_dp_max) goto end_align1_inv;
|
||||
q_off = ql - (q_off + 1), t_off = tl - (t_off + 1);
|
||||
mm_align_pair(km, opt, ql - q_off, qseq + q_off, tl - t_off, tseq + t_off, mat, (int)(opt->bw * 1.5), -1, opt->zdrop, KSW_EZ_EXTZ_ONLY, ez);
|
||||
mm_align_pair(km, opt, ql - q_off, qseq + q_off, tl - t_off, tseq + t_off, 0, mat, (int)(opt->bw * 1.5), -1, opt->zdrop, KSW_EZ_EXTZ_ONLY, ez);
|
||||
if (ez->n_cigar == 0) goto end_align1_inv; // should never be here
|
||||
mm_append_cigar(r_inv, ez->n_cigar, ez->cigar);
|
||||
r_inv->p->dp_score = ez->max;
|
||||
@@ -685,7 +846,7 @@ static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, i
|
||||
}
|
||||
r_inv->rs = r1->re + t_off;
|
||||
r_inv->re = r_inv->rs + ez->max_t + 1;
|
||||
mm_update_extra(r_inv, &qseq[q_off], &tseq[t_off], mat, opt->q, opt->e);
|
||||
mm_update_extra(r_inv, &qseq[q_off], &tseq[t_off], mat, opt->q, opt->e, opt->flag & MM_F_EQX);
|
||||
ret = 1;
|
||||
end_align1_inv:
|
||||
kfree(km, tseq);
|
||||
@@ -755,7 +916,7 @@ mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *m
|
||||
*n_regs_ = n_regs;
|
||||
kfree(km, qseq0[0]);
|
||||
kfree(km, ez.cigar);
|
||||
mm_filter_regs(km, opt, qlen, n_regs_, regs);
|
||||
mm_hit_sort_by_dp(km, n_regs_, regs);
|
||||
mm_filter_regs(opt, qlen, n_regs_, regs);
|
||||
mm_hit_sort(km, n_regs_, regs, opt->alt_drop);
|
||||
return regs;
|
||||
}
|
||||
|
||||
@@ -15,7 +15,7 @@ unsigned char seq_comp_table[256] = {
|
||||
48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63,
|
||||
64, 'T', 'V', 'G', 'H', 'E', 'F', 'C', 'D', 'I', 'J', 'M', 'L', 'K', 'N', 'O',
|
||||
'P', 'Q', 'Y', 'S', 'A', 'A', 'B', 'W', 'X', 'R', 'Z', 91, 92, 93, 94, 95,
|
||||
64, 't', 'v', 'g', 'h', 'e', 'f', 'c', 'd', 'i', 'j', 'm', 'l', 'k', 'n', 'o',
|
||||
96, 't', 'v', 'g', 'h', 'e', 'f', 'c', 'd', 'i', 'j', 'm', 'l', 'k', 'n', 'o',
|
||||
'p', 'q', 'y', 's', 'a', 'a', 'b', 'w', 'x', 'r', 'z', 123, 124, 125, 126, 127,
|
||||
128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143,
|
||||
144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159,
|
||||
@@ -39,7 +39,7 @@ mm_bseq_file_t *mm_bseq_open(const char *fn)
|
||||
{
|
||||
mm_bseq_file_t *fp;
|
||||
gzFile f;
|
||||
f = fn && strcmp(fn, "-")? gzopen(fn, "r") : gzdopen(fileno(stdin), "r");
|
||||
f = fn && strcmp(fn, "-")? gzopen(fn, "r") : gzdopen(0, "r");
|
||||
if (f == 0) return 0;
|
||||
fp = (mm_bseq_file_t*)calloc(1, sizeof(mm_bseq_file_t));
|
||||
fp->fp = f;
|
||||
@@ -62,21 +62,25 @@ static inline char *kstrdup(const kstring_t *s)
|
||||
return t;
|
||||
}
|
||||
|
||||
static inline void kseq2bseq(kseq_t *ks, mm_bseq1_t *s, int with_qual)
|
||||
static inline void kseq2bseq(kseq_t *ks, mm_bseq1_t *s, int with_qual, int with_comment)
|
||||
{
|
||||
int i;
|
||||
if (ks->name.l == 0)
|
||||
fprintf(stderr, "[WARNING]\033[1;31m empty sequence name in the input.\033[0m\n");
|
||||
s->name = kstrdup(&ks->name);
|
||||
s->seq = kstrdup(&ks->seq);
|
||||
for (i = 0; i < ks->seq.l; ++i) // convert U to T
|
||||
for (i = 0; i < (int)ks->seq.l; ++i) // convert U to T
|
||||
if (s->seq[i] == 'u' || s->seq[i] == 'U')
|
||||
--s->seq[i];
|
||||
s->qual = with_qual && ks->qual.l? kstrdup(&ks->qual) : 0;
|
||||
s->comment = with_comment && ks->comment.l? kstrdup(&ks->comment) : 0;
|
||||
s->l_seq = ks->seq.l;
|
||||
}
|
||||
|
||||
mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int frag_mode, int *n_)
|
||||
mm_bseq1_t *mm_bseq_read3(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int with_comment, int frag_mode, int *n_)
|
||||
{
|
||||
int64_t size = 0;
|
||||
int ret;
|
||||
kvec_t(mm_bseq1_t) a = {0,0,0};
|
||||
kseq_t *ks = fp->ks;
|
||||
*n_ = 0;
|
||||
@@ -86,17 +90,17 @@ mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int
|
||||
size = fp->s.l_seq;
|
||||
memset(&fp->s, 0, sizeof(mm_bseq1_t));
|
||||
}
|
||||
while (kseq_read(ks) >= 0) {
|
||||
while ((ret = kseq_read(ks)) >= 0) {
|
||||
mm_bseq1_t *s;
|
||||
assert(ks->seq.l <= INT32_MAX);
|
||||
if (a.m == 0) kv_resize(mm_bseq1_t, 0, a, 256);
|
||||
kv_pushp(mm_bseq1_t, 0, a, &s);
|
||||
kseq2bseq(ks, s, with_qual);
|
||||
kseq2bseq(ks, s, with_qual, with_comment);
|
||||
size += s->l_seq;
|
||||
if (size >= chunk_size) {
|
||||
if (frag_mode && a.a[a.n-1].l_seq < CHECK_PAIR_THRES) {
|
||||
while (kseq_read(ks) >= 0) {
|
||||
kseq2bseq(ks, &fp->s, with_qual);
|
||||
while ((ret = kseq_read(ks)) >= 0) {
|
||||
kseq2bseq(ks, &fp->s, with_qual, with_comment);
|
||||
if (mm_qname_same(fp->s.name, a.a[a.n-1].name)) {
|
||||
kv_push(mm_bseq1_t, 0, a, fp->s);
|
||||
memset(&fp->s, 0, sizeof(mm_bseq1_t));
|
||||
@@ -106,16 +110,25 @@ mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int
|
||||
break;
|
||||
}
|
||||
}
|
||||
if (ret < -1) {
|
||||
if (a.n) fprintf(stderr, "[WARNING]\033[1;31m failed to parse the FASTA/FASTQ record next to '%s'. Continue anyway.\033[0m\n", a.a[a.n-1].name);
|
||||
else fprintf(stderr, "[WARNING]\033[1;31m failed to parse the first FASTA/FASTQ record. Continue anyway.\033[0m\n");
|
||||
}
|
||||
*n_ = a.n;
|
||||
return a.a;
|
||||
}
|
||||
|
||||
mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int chunk_size, int with_qual, int *n_)
|
||||
mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int frag_mode, int *n_)
|
||||
{
|
||||
return mm_bseq_read3(fp, chunk_size, with_qual, 0, frag_mode, n_);
|
||||
}
|
||||
|
||||
mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int *n_)
|
||||
{
|
||||
return mm_bseq_read2(fp, chunk_size, with_qual, 0, n_);
|
||||
}
|
||||
|
||||
mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int *n_)
|
||||
mm_bseq1_t *mm_bseq_read_frag2(int n_fp, mm_bseq_file_t **fp, int64_t chunk_size, int with_qual, int with_comment, int *n_)
|
||||
{
|
||||
int i;
|
||||
int64_t size = 0;
|
||||
@@ -136,7 +149,7 @@ mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int
|
||||
for (i = 0; i < n_fp; ++i) {
|
||||
mm_bseq1_t *s;
|
||||
kv_pushp(mm_bseq1_t, 0, a, &s);
|
||||
kseq2bseq(fp[i]->ks, s, with_qual);
|
||||
kseq2bseq(fp[i]->ks, s, with_qual, with_comment);
|
||||
size += s->l_seq;
|
||||
}
|
||||
if (size >= chunk_size) break;
|
||||
@@ -145,6 +158,11 @@ mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int
|
||||
return a.a;
|
||||
}
|
||||
|
||||
mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int64_t chunk_size, int with_qual, int *n_)
|
||||
{
|
||||
return mm_bseq_read_frag2(n_fp, fp, chunk_size, with_qual, 0, n_);
|
||||
}
|
||||
|
||||
int mm_bseq_eof(mm_bseq_file_t *fp)
|
||||
{
|
||||
return (ks_eof(fp->ks->f) && fp->s.seq == 0);
|
||||
|
||||
@@ -13,14 +13,16 @@ typedef struct mm_bseq_file_s mm_bseq_file_t;
|
||||
|
||||
typedef struct {
|
||||
int l_seq, rid;
|
||||
char *name, *seq, *qual;
|
||||
char *name, *seq, *qual, *comment;
|
||||
} mm_bseq1_t;
|
||||
|
||||
mm_bseq_file_t *mm_bseq_open(const char *fn);
|
||||
void mm_bseq_close(mm_bseq_file_t *fp);
|
||||
mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int frag_mode, int *n_);
|
||||
mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int chunk_size, int with_qual, int *n_);
|
||||
mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int *n_);
|
||||
mm_bseq1_t *mm_bseq_read3(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int with_comment, int frag_mode, int *n_);
|
||||
mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int frag_mode, int *n_);
|
||||
mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int *n_);
|
||||
mm_bseq1_t *mm_bseq_read_frag2(int n_fp, mm_bseq_file_t **fp, int64_t chunk_size, int with_qual, int with_comment, int *n_);
|
||||
mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int64_t chunk_size, int with_qual, int *n_);
|
||||
int mm_bseq_eof(mm_bseq_file_t *fp);
|
||||
|
||||
extern unsigned char seq_nt4_table[256];
|
||||
|
||||
@@ -1,157 +0,0 @@
|
||||
#include <stdint.h>
|
||||
#include <string.h>
|
||||
#include <stdio.h>
|
||||
#include "minimap.h"
|
||||
#include "mmpriv.h"
|
||||
#include "kalloc.h"
|
||||
|
||||
static const char LogTable256[256] = {
|
||||
#define LT(n) n, n, n, n, n, n, n, n, n, n, n, n, n, n, n, n
|
||||
-1, 0, 1, 1, 2, 2, 2, 2, 3, 3, 3, 3, 3, 3, 3, 3,
|
||||
LT(4), LT(5), LT(5), LT(6), LT(6), LT(6), LT(6),
|
||||
LT(7), LT(7), LT(7), LT(7), LT(7), LT(7), LT(7), LT(7)
|
||||
};
|
||||
|
||||
static inline int ilog2_32(uint32_t v)
|
||||
{
|
||||
register uint32_t t, tt;
|
||||
if ((tt = v>>16)) return (t = tt>>8) ? 24 + LogTable256[t] : 16 + LogTable256[tt];
|
||||
return (t = v>>8) ? 8 + LogTable256[t] : LogTable256[v];
|
||||
}
|
||||
|
||||
mm128_t *mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int min_cnt, int min_sc, int is_cdna, int n_segs, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km)
|
||||
{ // TODO: make sure this works when n has more than 32 bits
|
||||
int32_t k, *f, *p, *t, *v, n_u, n_v;
|
||||
int64_t i, j, st = 0;
|
||||
uint64_t *u, *u2, sum_qspan = 0;
|
||||
float avg_qspan;
|
||||
mm128_t *b, *w;
|
||||
|
||||
if (_u) *_u = 0, *n_u_ = 0;
|
||||
f = (int32_t*)kmalloc(km, n * 4);
|
||||
p = (int32_t*)kmalloc(km, n * 4);
|
||||
t = (int32_t*)kmalloc(km, n * 4);
|
||||
v = (int32_t*)kmalloc(km, n * 4);
|
||||
memset(t, 0, n * 4);
|
||||
|
||||
for (i = 0; i < n; ++i) sum_qspan += a[i].y>>32&0xff;
|
||||
avg_qspan = (float)sum_qspan / n;
|
||||
|
||||
// fill the score and backtrack arrays
|
||||
for (i = 0; i < n; ++i) {
|
||||
uint64_t ri = a[i].x;
|
||||
int64_t max_j = -1;
|
||||
int32_t qi = (int32_t)a[i].y, q_span = a[i].y>>32&0xff; // NB: only 8 bits of span is used!!!
|
||||
int32_t max_f = q_span, n_skip = 0, min_d;
|
||||
int32_t sidi = (a[i].y & MM_SEED_SEG_MASK) >> MM_SEED_SEG_SHIFT;
|
||||
while (st < i && ri - a[st].x > max_dist_x) ++st;
|
||||
for (j = i - 1; j >= st; --j) {
|
||||
int64_t dr = ri - a[j].x;
|
||||
int32_t dq = qi - (int32_t)a[j].y, dd, sc, log_dd;
|
||||
int32_t sidj = (a[j].y & MM_SEED_SEG_MASK) >> MM_SEED_SEG_SHIFT;
|
||||
if ((sidi == sidj && dr == 0) || dq <= 0) continue; // don't skip if an anchor is used by multiple segments; see below
|
||||
if ((sidi == sidj && dq > max_dist_y) || dq > max_dist_x) continue;
|
||||
dd = dr > dq? dr - dq : dq - dr;
|
||||
if (sidi == sidj && dd > bw) continue;
|
||||
if (n_segs > 1 && !is_cdna && sidi == sidj && dr > max_dist_y) continue;
|
||||
min_d = dq < dr? dq : dr;
|
||||
sc = min_d > q_span? q_span : dq < dr? dq : dr;
|
||||
log_dd = dd? ilog2_32(dd) : 0;
|
||||
if (is_cdna || sidi != sidj) {
|
||||
int c_log, c_lin;
|
||||
c_lin = (int)(dd * .01 * avg_qspan);
|
||||
c_log = log_dd;
|
||||
if (sidi != sidj && dr == 0) ++sc; // possibly due to overlapping paired ends; give a minor bonus
|
||||
else if (dr > dq || sidi != sidj) sc -= c_lin < c_log? c_lin : c_log;
|
||||
else sc -= c_lin + (c_log>>1);
|
||||
} else sc -= (int)(dd * .01 * avg_qspan) + (log_dd>>1);
|
||||
sc += f[j];
|
||||
if (sc > max_f) {
|
||||
max_f = sc, max_j = j;
|
||||
if (n_skip > 0) --n_skip;
|
||||
} else if (t[j] == i) {
|
||||
if (++n_skip > max_skip)
|
||||
break;
|
||||
}
|
||||
if (p[j] >= 0) t[p[j]] = i;
|
||||
}
|
||||
f[i] = max_f, p[i] = max_j;
|
||||
v[i] = max_j >= 0 && v[max_j] > max_f? v[max_j] : max_f; // v[] keeps the peak score up to i; f[] is the score ending at i, not always the peak
|
||||
}
|
||||
|
||||
// find the ending positions of chains
|
||||
memset(t, 0, n * 4);
|
||||
for (i = 0; i < n; ++i)
|
||||
if (p[i] >= 0) t[p[i]] = 1;
|
||||
for (i = n_u = 0; i < n; ++i)
|
||||
if (t[i] == 0 && v[i] >= min_sc)
|
||||
++n_u;
|
||||
if (n_u == 0) {
|
||||
kfree(km, a); kfree(km, f); kfree(km, p); kfree(km, t); kfree(km, v);
|
||||
return 0;
|
||||
}
|
||||
u = (uint64_t*)kmalloc(km, n_u * 8);
|
||||
for (i = n_u = 0; i < n; ++i) {
|
||||
if (t[i] == 0 && v[i] >= min_sc) {
|
||||
j = i;
|
||||
while (j >= 0 && f[j] < v[j]) j = p[j]; // find the peak that maximizes f[]
|
||||
if (j < 0) j = i; // TODO: this should really be assert(j>=0)
|
||||
u[n_u++] = (uint64_t)f[j] << 32 | j;
|
||||
}
|
||||
}
|
||||
radix_sort_64(u, u + n_u);
|
||||
for (i = 0; i < n_u>>1; ++i) { // reverse, s.t. the highest scoring chain is the first
|
||||
uint64_t t = u[i];
|
||||
u[i] = u[n_u - i - 1], u[n_u - i - 1] = t;
|
||||
}
|
||||
|
||||
// backtrack
|
||||
memset(t, 0, n * 4);
|
||||
for (i = n_v = k = 0; i < n_u; ++i) { // starting from the highest score
|
||||
int32_t n_v0 = n_v, k0 = k;
|
||||
j = (int32_t)u[i];
|
||||
do {
|
||||
v[n_v++] = j;
|
||||
t[j] = 1;
|
||||
j = p[j];
|
||||
} while (j >= 0 && t[j] == 0);
|
||||
if (j < 0) {
|
||||
if (n_v - n_v0 >= min_cnt) u[k++] = u[i]>>32<<32 | (n_v - n_v0);
|
||||
} else if ((int32_t)(u[i]>>32) - f[j] >= min_sc) {
|
||||
if (n_v - n_v0 >= min_cnt) u[k++] = ((u[i]>>32) - f[j]) << 32 | (n_v - n_v0);
|
||||
}
|
||||
if (k0 == k) n_v = n_v0; // no new chain added, reset
|
||||
}
|
||||
*n_u_ = n_u = k, *_u = u; // NB: note that u[] may not be sorted by score here
|
||||
|
||||
// free temporary arrays
|
||||
kfree(km, f); kfree(km, p); kfree(km, t);
|
||||
|
||||
// write the result to b[]
|
||||
b = (mm128_t*)kmalloc(km, n_v * sizeof(mm128_t));
|
||||
for (i = 0, k = 0; i < n_u; ++i) {
|
||||
int32_t k0 = k, ni = (int32_t)u[i];
|
||||
for (j = 0; j < ni; ++j)
|
||||
b[k] = a[v[k0 + (ni - j - 1)]], ++k;
|
||||
}
|
||||
kfree(km, v);
|
||||
|
||||
// sort u[] and a[] by a[].x, such that adjacent chains may be joined (required by mm_join_long)
|
||||
w = (mm128_t*)kmalloc(km, n_u * sizeof(mm128_t));
|
||||
for (i = k = 0; i < n_u; ++i) {
|
||||
w[i].x = b[k].x, w[i].y = (uint64_t)k<<32|i;
|
||||
k += (int32_t)u[i];
|
||||
}
|
||||
radix_sort_128x(w, w + n_u);
|
||||
u2 = (uint64_t*)kmalloc(km, n_u * 8);
|
||||
for (i = k = 0; i < n_u; ++i) {
|
||||
int32_t j = (int32_t)w[i].y, n = (int32_t)u[j];
|
||||
u2[i] = u[j];
|
||||
memcpy(&a[k], &b[w[i].y>>32], n * sizeof(mm128_t));
|
||||
k += n;
|
||||
}
|
||||
memcpy(u, u2, n_u * 8);
|
||||
memcpy(b, a, k * sizeof(mm128_t)); // write _a_ to _b_ and deallocate _a_ because _a_ is oversized, sometimes a lot
|
||||
kfree(km, a); kfree(km, w); kfree(km, u2);
|
||||
return b;
|
||||
}
|
||||
@@ -0,0 +1,30 @@
|
||||
## Contributor Code of Conduct
|
||||
|
||||
As contributors and maintainers of this project, we pledge to respect all
|
||||
people who contribute through reporting issues, posting feature requests,
|
||||
updating documentation, submitting pull requests or patches, and other
|
||||
activities.
|
||||
|
||||
We are committed to making participation in this project a harassment-free
|
||||
experience for everyone, regardless of level of experience, gender, gender
|
||||
identity and expression, sexual orientation, disability, personal appearance,
|
||||
body size, race, age, or religion.
|
||||
|
||||
Examples of unacceptable behavior by participants include the use of sexual
|
||||
language or imagery, derogatory comments or personal attacks, trolling, public
|
||||
or private harassment, insults, or other unprofessional conduct.
|
||||
|
||||
Project maintainers have the right and responsibility to remove, edit, or
|
||||
reject comments, commits, code, wiki edits, issues, and other contributions
|
||||
that are not aligned to this Code of Conduct. Project maintainers or
|
||||
contributors who do not follow the Code of Conduct may be removed from the
|
||||
project team.
|
||||
|
||||
Instances of abusive, harassing, or otherwise unacceptable behavior may be
|
||||
reported by opening an issue or contacting the maintainer via email.
|
||||
|
||||
This Code of Conduct is adapted from the [Contributor Covenant][cc], [version
|
||||
1.0.0][v1].
|
||||
|
||||
[cc]: http://contributor-covenant.org/
|
||||
[v1]: http://contributor-covenant.org/version/1/0/0/
|
||||
+243
@@ -0,0 +1,243 @@
|
||||
## Table of Contents
|
||||
|
||||
- [Introduction & Installation](#intro)
|
||||
- [Mapping Genomic Reads](#map-reads)
|
||||
* [Mapping long reads](#map-pb)
|
||||
* [Mapping Illumina paired-end reads](#map-sr)
|
||||
* [Evaluating mapping accuracy with simulated reads (for developers)](#mapeval)
|
||||
- [Mapping Long RNA-seq Reads](#map-rna)
|
||||
* [Mapping Nanopore 2D cDNA reads](#map-ont-cdna-2d)
|
||||
* [Mapping Nanopore direct-RNA reads](#map-direct-rna)
|
||||
* [Mapping PacBio Iso-seq reads](#map-iso-seq)
|
||||
- [Full-Genome Alignment](#genome-aln)
|
||||
* [Intra-species assembly alignment](#asm-to-ref)
|
||||
* [Cross-species full-genome alignment](#x-species)
|
||||
* [Eyeballing alignment](#view-aln)
|
||||
* [Calling variants from assembly-to-reference alignment](#asm-var)
|
||||
* [Constructing self-homology map](#hom-map)
|
||||
* [Lift Over (for developers)](#liftover)
|
||||
- [Read Overlap](#read-overlap)
|
||||
* [Long-read overlap](#long-read-overlap)
|
||||
* [Evaluating overlap sensitivity (for developers)](#ov-eval)
|
||||
|
||||
## <a name="intro"></a>Introduction & Installation
|
||||
|
||||
This cookbook walks you through a variety of applications of minimap2 and its
|
||||
companion script `paftools.js`. All data here are freely available from the
|
||||
minimap2 release page at version tag [v2.10][v2.10]. Some examples only work
|
||||
with v2.10 or later.
|
||||
|
||||
To acquire the data used in this cookbook and to install minimap2 and paftools,
|
||||
please follow the command lines below:
|
||||
```sh
|
||||
# install minimap2 executables
|
||||
curl -L https://github.com/lh3/minimap2/releases/download/v2.19/minimap2-2.19_x64-linux.tar.bz2 | tar jxf -
|
||||
cp minimap2-2.19_x64-linux/{minimap2,k8,paftools.js} . # copy executables
|
||||
export PATH="$PATH:"`pwd` # put the current directory on PATH
|
||||
# download example datasets
|
||||
curl -L https://github.com/lh3/minimap2/releases/download/v2.10/cookbook-data.tgz | tar zxf -
|
||||
```
|
||||
|
||||
## <a name="map-reads"></a>Mapping Genomic Reads
|
||||
|
||||
### <a name="map-pb"></a>Mapping long reads
|
||||
```sh
|
||||
minimap2 -ax map-pb -t4 ecoli_ref.fa ecoli_p6_25x_canu.fa > mapped.sam
|
||||
```
|
||||
Alternatively, you can create a minimap2 index first and then map:
|
||||
```sh
|
||||
minimap2 -x map-pb -d ecoli-pb.mmi ecoli_ref.fa # create an index
|
||||
minimap2 -ax map-pb ecoli-pb.mmi ecoli_p6_25x_canu.fa > mapped.sam
|
||||
```
|
||||
This will save you a couple of minutes when you map against the human genome.
|
||||
**HOWEVER**, key algorithm parameters such as the k-mer length and window
|
||||
size can't be changed after indexing. Minimap2 will give you a warning if
|
||||
parameters used in a pre-built index doesn't match parameters on the command
|
||||
line. **Please always make sure you are using an intended pre-built index.**
|
||||
|
||||
### <a name="map-sr"></a>Mapping Illumina paired-end reads:
|
||||
```sh
|
||||
minimap2 -ax sr -t4 ecoli_ref.fa ecoli_mason_1.fq ecoli_mason_2.fq > mapped-sr.sam
|
||||
```
|
||||
|
||||
### <a name="mapeval"></a>Evaluating mapping accuracy with simulated reads (for developers)
|
||||
```sh
|
||||
minimap2 -ax sr ecoli_ref.fa ecoli_mason_1.fq ecoli_mason_2.fq | paftools.js mapeval -
|
||||
```
|
||||
The output is:
|
||||
```
|
||||
Q 60 19712 0 0.000000000 19712
|
||||
Q 0 282 219 0.010953286 19994
|
||||
U 6
|
||||
```
|
||||
where a `U`-line gives the number of unmapped reads (for SAM input only); a
|
||||
`Q`-line gives:
|
||||
|
||||
1. Mapping quality (mapQ) threshold
|
||||
2. Number of mapped reads between this threshold and the previous mapQ threshold.
|
||||
3. Number of wrong mappings in the same mapQ interval
|
||||
4. Accumulative mapping error rate
|
||||
5. Accumulative number of mappings
|
||||
|
||||
For `paftools.js mapeval` to work, you need to encode the true read positions
|
||||
in read names in the right format. For [PBSIM][pbsim] and [mason2][mason2], we
|
||||
provide scripts to generate the right format. Simulated reads in this cookbook
|
||||
were created with the following command lines:
|
||||
```sh
|
||||
# in PBSIM source code directory:
|
||||
src/pbsim ../ecoli_ref.fa --depth 1 --sample-fastq sample/sample.fastq
|
||||
paftools.js pbsim2fq ../ecoli_ref.fa.fai sd_0001.maf > ../ecoli_pbsim.fa
|
||||
|
||||
# mason2 simulation
|
||||
mason_simulator --illumina-prob-mismatch-scale 2.5 -ir ecoli_ref.fa -n 10000 -o tmp-l.fq -or tmp-r.fq -oa tmp.sam
|
||||
paftools.js mason2fq tmp.sam | seqtk seq -1 > ecoli_mason_1.fq
|
||||
paftools.js mason2fq tmp.sam | seqtk seq -2 > ecoli_mason_2.fq
|
||||
```
|
||||
|
||||
|
||||
|
||||
## <a name="map-rna"></a>Mapping Long RNA-seq Reads
|
||||
|
||||
### <a name="map-ont-cdna-2d"></a>Mapping Nanopore 2D cDNA reads
|
||||
```sh
|
||||
minimap2 -ax splice SIRV_E2.fa SIRV_ont-cdna.fa > aln.sam
|
||||
```
|
||||
You can compare the alignment to the true annotations with:
|
||||
```sh
|
||||
paftools.js junceval SIRV_E2C.gtf aln.sam
|
||||
```
|
||||
It gives the percentage of introns found in the annotation. For SIRV data, it
|
||||
is possible to achieve higher junction accuracy with
|
||||
```sh
|
||||
minimap2 -ax splice --splice-flank=no SIRV_E2.fa SIRV_ont-cdna.fa | paftools.js junceval SIRV_E2C.gtf
|
||||
```
|
||||
This is because minimap2 models one additional evolutionarily conserved base
|
||||
around a canonical junction, but SIRV doesn't honor this signal. Option
|
||||
`--splice-flank=no` asks minimap2 no to model this additional base.
|
||||
|
||||
In the output a tag `ts:A:+` indicates that the read strand is the same as the
|
||||
transcript strand; `ts:A:-` indicates the read strand is opposite to the
|
||||
transcript strand. This tag is inferred from the GT-AG signal and is thus only
|
||||
available to spliced reads.
|
||||
|
||||
### <a name="map-direct-rna"></a>Mapping Nanopore direct-RNA reads
|
||||
```sh
|
||||
minimap2 -ax splice -k14 -uf SIRV_E2.fa SIRV_ont-drna.fa > aln.sam
|
||||
```
|
||||
Direct-RNA reads are noisier, so we use a shorter k-mer for improved
|
||||
sensitivity. Here, option `-uf` forces minimap2 to map reads to the forward
|
||||
transcript strand only because direct-RNA reads are stranded. Again, applying
|
||||
`--splice-flank=no` helps junction accuracy for SIRV data.
|
||||
|
||||
### <a name="map-iso-seq"></a>Mapping PacBio Iso-seq reads
|
||||
```sh
|
||||
minimap2 -ax splice -uf -C5 SIRV_E2.fa SIRV_iso-seq.fq > aln.sam
|
||||
```
|
||||
Option `-C5` reduces the penalty on non-canonical splicing sites. It helps
|
||||
to align such sites correctly for data with low error rate such as Iso-seq
|
||||
reads and traditional cDNAs. On this example, minimap2 makes one junction
|
||||
error. Applying `--splice-flank=no` fixes this alignment error.
|
||||
|
||||
Note that the command line above is optimized for the final Iso-seq reads.
|
||||
PacBio's Iso-seq pipeline produces intermediate sequences at varying quality.
|
||||
For example, some intermediate reads are not stranded. For these reads, option
|
||||
`-uf` will lead to more errors. Please revise the minimap2 command line
|
||||
accordingly.
|
||||
|
||||
|
||||
|
||||
## <a name="genome-aln"></a>Full-Genome Alignment
|
||||
|
||||
### <a name="asm-to-ref"></a>Intra-species assembly alignment
|
||||
```sh
|
||||
# option "--cs" is recommended as paftools.js may need it
|
||||
minimap2 -cx asm5 --cs ecoli_ref.fa ecoli_canu.fa > ecoli_canu.paf
|
||||
```
|
||||
Here `ecoli_canu.fa` is the Canu assembly of `ecoli_p6_25x_canu.fa`. This
|
||||
command line outputs alignments in the [PAF format][paf]. Use `-a` instead of
|
||||
`-c` to get output in the SAM format.
|
||||
|
||||
### <a name="x-species"></a>Cross-species full-genome alignment
|
||||
```sh
|
||||
minimap2 -cx asm20 --cs ecoli_ref.fa ecoli_O104:H4.fa > ecoli_O104:H4.paf
|
||||
sort -k6,6 -k8,8n ecoli_O104:H4.paf | paftools.js call -f ecoli_ref.fa -L10000 -l1000 - > out.vcf
|
||||
```
|
||||
Minimap2 has three presets for full-genome alignment: "asm5" for sequence
|
||||
divergence below 1%, "asm10" for divergence around a couple of percent and
|
||||
"asm20" for divergence not more than 10%. In theory, with the right setting,
|
||||
minimap2 should work for sequence pairs with sequence divergence up to ~15%,
|
||||
but this has not been carefully evaluated.
|
||||
|
||||
### <a name="view-aln"></a>Eyeballing alignment
|
||||
```sh
|
||||
# option "--cs" required; minimap2-r741 or higher required for the "asm20" preset
|
||||
minimap2 -cx asm20 --cs ecoli_ref.fa ecoli_O104:H4.fa | paftools.js view - | less -S
|
||||
```
|
||||
This prints the alignment in a BLAST-like format.
|
||||
|
||||
### <a name="asm-var"></a>Calling variants from assembly-to-reference alignment
|
||||
```sh
|
||||
# don't forget the "--cs" option; otherwise it doesn't work
|
||||
minimap2 -cx asm5 --cs ecoli_ref.fa ecoli_canu.fa \
|
||||
| sort -k6,6 -k8,8n \
|
||||
| paftools.js call -f ecoli_ref.fa - > out.vcf
|
||||
```
|
||||
Without option `-f`, `paftools.js call` outputs in a custom format. In this
|
||||
format, lines starting with `R` give the regions covered by one contig only.
|
||||
This information is not available in the VCF output.
|
||||
|
||||
### <a name="hom-map"></a>Constructing self-homology map
|
||||
```sh
|
||||
minimap2 -DP -k19 -w19 -m200 ecoli_ref.fa ecoli_ref.fa > out.paf
|
||||
```
|
||||
Option `-D` asks minimap2 to ignore anchors from perfect self match and `-P`
|
||||
outputs all chains. For large nomes, we don't recommend to perform base-level
|
||||
alignment (with `-c`, `-a` or `--cs`) when `-P` is applied. This is because
|
||||
base-alignment is slow and occasionally gives wrong alignments close to the
|
||||
diagonal of a dotter plot. For E. coli, though, base-alignment is still fast.
|
||||
|
||||
### <a name="liftover"></a>Lift over (for developers)
|
||||
```sh
|
||||
minimap2 -cx asm5 --cs ecoli_ref.fa ecoli_canu.fa > ecoli_canu.paf
|
||||
echo -e 'tig00000001\t200000\t300000' | paftools.js liftover ecoli_canu.paf -
|
||||
```
|
||||
This lifts over a region on query sequences to one or multiple regions on
|
||||
reference sequences. Note that this paftools.js command may not be efficient
|
||||
enough to lift millions of regions.
|
||||
|
||||
|
||||
|
||||
## <a name="read-overlap"></a>Read Overlap
|
||||
|
||||
### <a name="long-read-overlap"></a>Long read overlap
|
||||
```sh
|
||||
# For pacbio reads:
|
||||
minimap2 -x ava-pb ecoli_p6_25x_canu.fa ecoli_p6_25x_canu.fa > overlap.paf
|
||||
# For Nanopore reads (ava-ont also works with PacBio but not as good):
|
||||
minimap2 -x ava-ont -r 10000 ecoli_p6_25x_canu.fa ecoli_p6_25x_canu.fa > overlap.paf
|
||||
# If you have miniasm installed:
|
||||
miniasm -f ecoli_p6_25x_canu.fa overlap.paf > asm.gfa
|
||||
```
|
||||
Here we explicitly applied `-r 10000`. We are considering to set this as the
|
||||
default for the `ava-ont` mode as this seems to improve the contiguity for
|
||||
nanopore read assembly (Loman, personal communication).
|
||||
|
||||
*Minimap2 doesn't work well with short-read overlap.*
|
||||
|
||||
### <a name="ov-eval"></a>Evaluating overlap sensitivity (for developers)
|
||||
|
||||
```sh
|
||||
# read to reference mapping
|
||||
minimap2 -cx map-pb ecoli_ref.fa ecoli_p6_25x_canu.fa > to-ref.paf
|
||||
# evaluate overlap sensitivity
|
||||
sort -k6,6 -k8,8n to-ref.paf | paftools.js ov-eval - overlap.paf
|
||||
```
|
||||
You can see that for PacBio reads, minimap2 achieves higher overlap sensitivity
|
||||
with `-x ava-pb` (99% vs 93% with `-x ava-ont`).
|
||||
|
||||
|
||||
|
||||
[pbsim]: https://github.com/pfaucon/PBSIM-PacBio-Simulator
|
||||
[mason2]: https://github.com/seqan/seqan/tree/master/apps/mason2
|
||||
[paf]: https://github.com/lh3/miniasm/blob/master/PAF.md
|
||||
[v2.10]: https://github.com/lh3/minimap2/releases/tag/v2.10
|
||||
@@ -59,6 +59,6 @@ void mm_est_err(const mm_idx_t *mi, int qlen, int n_regs, mm_reg1_t *regs, const
|
||||
n_tot = en - st + 1;
|
||||
if (r->qs > avg_k && r->rs > avg_k) ++n_tot;
|
||||
if (qlen - r->qs > avg_k && l_ref - r->re > avg_k) ++n_tot;
|
||||
r->div = logf((float)n_tot / n_match) / avg_k;
|
||||
r->div = n_match >= n_tot? 0.0f : (float)(1.0 - pow((double)n_match / n_tot, 1.0 / avg_k));
|
||||
}
|
||||
}
|
||||
|
||||
@@ -35,6 +35,8 @@ int main(int argc, char *argv[])
|
||||
while ((mi = mm_idx_reader_read(r, n_threads)) != 0) { // traverse each part of the index
|
||||
mm_mapopt_update(&mopt, mi); // this sets the maximum minimizer occurrence; TODO: set a better default in mm_mapopt_init()!
|
||||
mm_tbuf_t *tbuf = mm_tbuf_init(); // thread buffer; for multi-threading, allocate one tbuf for each thread
|
||||
gzrewind(f);
|
||||
kseq_rewind(ks);
|
||||
while (kseq_read(ks) >= 0) { // each kseq_read() call reads one query sequence
|
||||
mm_reg1_t *reg;
|
||||
int j, i, n_reg;
|
||||
@@ -45,7 +47,7 @@ int main(int argc, char *argv[])
|
||||
printf("%s\t%d\t%d\t%d\t%c\t", ks->name.s, ks->seq.l, r->qs, r->qe, "+-"[r->rev]);
|
||||
printf("%s\t%d\t%d\t%d\t%d\t%d\t%d\tcg:Z:", mi->seq[r->rid].name, mi->seq[r->rid].len, r->rs, r->re, r->mlen, r->blen, r->mapq);
|
||||
for (i = 0; i < r->p->n_cigar; ++i) // IMPORTANT: this gives the CIGAR in the aligned regions. NO soft/hard clippings!
|
||||
printf("%d%c", r->p->cigar[i]>>4, "MIDSHN"[r->p->cigar[i]&0xf]);
|
||||
printf("%d%c", r->p->cigar[i]>>4, "MIDNSH"[r->p->cigar[i]&0xf]);
|
||||
putchar('\n');
|
||||
free(r->p);
|
||||
}
|
||||
|
||||
@@ -79,11 +79,11 @@ static char *mm_escape(char *s)
|
||||
return s;
|
||||
}
|
||||
|
||||
static void sam_write_rg_line(kstring_t *str, const char *s)
|
||||
static int sam_write_rg_line(kstring_t *str, const char *s)
|
||||
{
|
||||
char *p, *q, *r, *rg_line = 0;
|
||||
memset(mm_rg_id, 0, 256);
|
||||
if (s == 0) return;
|
||||
if (s == 0) return 0;
|
||||
if (strstr(s, "@RG") != s) {
|
||||
if (mm_verbose >= 1) fprintf(stderr, "[ERROR] the read group line is not started with @RG\n");
|
||||
goto err_set_rg;
|
||||
@@ -92,7 +92,8 @@ static void sam_write_rg_line(kstring_t *str, const char *s)
|
||||
if (mm_verbose >= 1) fprintf(stderr, "[ERROR] the read group line contained literal <tab> characters -- replace with escaped tabs: \\t\n");
|
||||
goto err_set_rg;
|
||||
}
|
||||
rg_line = strdup(s);
|
||||
rg_line = (char*)malloc(strlen(s) + 1);
|
||||
strcpy(rg_line, s);
|
||||
mm_escape(rg_line);
|
||||
if ((p = strstr(rg_line, "\tID:")) == 0) {
|
||||
if (mm_verbose >= 1) fprintf(stderr, "[ERROR] no ID within the read group line\n");
|
||||
@@ -107,20 +108,23 @@ static void sam_write_rg_line(kstring_t *str, const char *s)
|
||||
for (q = p, r = mm_rg_id; *q && *q != '\t' && *q != '\n'; ++q)
|
||||
*r++ = *q;
|
||||
mm_sprintf_lite(str, "%s\n", rg_line);
|
||||
return 0;
|
||||
|
||||
err_set_rg:
|
||||
free(rg_line);
|
||||
return -1;
|
||||
}
|
||||
|
||||
void mm_write_sam_hdr(const mm_idx_t *idx, const char *rg, const char *ver, int argc, char *argv[])
|
||||
int mm_write_sam_hdr(const mm_idx_t *idx, const char *rg, const char *ver, int argc, char *argv[])
|
||||
{
|
||||
kstring_t str = {0,0,0};
|
||||
int ret = 0;
|
||||
if (idx) {
|
||||
uint32_t i;
|
||||
for (i = 0; i < idx->n_seq; ++i)
|
||||
printf("@SQ\tSN:%s\tLN:%d\n", idx->seq[i].name, idx->seq[i].len);
|
||||
mm_sprintf_lite(&str, "@SQ\tSN:%s\tLN:%d\n", idx->seq[i].name, idx->seq[i].len);
|
||||
}
|
||||
if (rg) sam_write_rg_line(&str, rg);
|
||||
if (rg) ret = sam_write_rg_line(&str, rg);
|
||||
mm_sprintf_lite(&str, "@PG\tID:minimap2\tPN:minimap2");
|
||||
if (ver) mm_sprintf_lite(&str, "\tVN:%s", ver);
|
||||
if (argc > 1) {
|
||||
@@ -129,36 +133,19 @@ void mm_write_sam_hdr(const mm_idx_t *idx, const char *rg, const char *ver, int
|
||||
for (i = 1; i < argc; ++i)
|
||||
mm_sprintf_lite(&str, " %s", argv[i]);
|
||||
}
|
||||
mm_sprintf_lite(&str, "\n");
|
||||
fputs(str.s, stdout);
|
||||
mm_err_puts(str.s);
|
||||
free(str.s);
|
||||
return ret;
|
||||
}
|
||||
|
||||
static void write_cs(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int no_iden)
|
||||
static void write_cs_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq, const mm_reg1_t *r, char *tmp, int no_iden, int write_tag)
|
||||
{
|
||||
extern unsigned char seq_nt4_table[256];
|
||||
int i, q_off, t_off;
|
||||
uint8_t *qseq, *tseq;
|
||||
char *tmp;
|
||||
if (r->p == 0) return;
|
||||
mm_sprintf_lite(s, "\tcs:Z:");
|
||||
qseq = (uint8_t*)kmalloc(km, r->qe - r->qs);
|
||||
tseq = (uint8_t*)kmalloc(km, r->re - r->rs);
|
||||
tmp = (char*)kmalloc(km, r->re - r->rs > r->qe - r->qs? r->re - r->rs + 1 : r->qe - r->qs + 1);
|
||||
mm_idx_getseq(mi, r->rid, r->rs, r->re, tseq);
|
||||
if (!r->rev) {
|
||||
for (i = r->qs; i < r->qe; ++i)
|
||||
qseq[i - r->qs] = seq_nt4_table[(uint8_t)t->seq[i]];
|
||||
} else {
|
||||
for (i = r->qs; i < r->qe; ++i) {
|
||||
uint8_t c = seq_nt4_table[(uint8_t)t->seq[i]];
|
||||
qseq[r->qe - i - 1] = c >= 4? 4 : 3 - c;
|
||||
}
|
||||
}
|
||||
for (i = q_off = t_off = 0; i < r->p->n_cigar; ++i) {
|
||||
if (write_tag) mm_sprintf_lite(s, "\tcs:Z:");
|
||||
for (i = q_off = t_off = 0; i < (int)r->p->n_cigar; ++i) {
|
||||
int j, op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
|
||||
assert(op >= 0 && op <= 3);
|
||||
if (op == 0) {
|
||||
assert((op >= 0 && op <= 3) || op == 7 || op == 8);
|
||||
if (op == 0 || op == 7 || op == 8) { // match
|
||||
int l_tmp = 0;
|
||||
for (j = 0; j < len; ++j) {
|
||||
if (qseq[q_off + j] != tseq[t_off + j]) {
|
||||
@@ -179,17 +166,17 @@ static void write_cs(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_
|
||||
} else mm_sprintf_lite(s, ":%d", l_tmp);
|
||||
}
|
||||
q_off += len, t_off += len;
|
||||
} else if (op == 1) {
|
||||
} else if (op == 1) { // insertion to ref
|
||||
for (j = 0, tmp[len] = 0; j < len; ++j)
|
||||
tmp[j] = "acgtn"[qseq[q_off + j]];
|
||||
mm_sprintf_lite(s, "+%s", tmp);
|
||||
q_off += len;
|
||||
} else if (op == 2) {
|
||||
} else if (op == 2) { // deletion from ref
|
||||
for (j = 0, tmp[len] = 0; j < len; ++j)
|
||||
tmp[j] = "acgtn"[tseq[t_off + j]];
|
||||
mm_sprintf_lite(s, "-%s", tmp);
|
||||
t_off += len;
|
||||
} else {
|
||||
} else { // intron
|
||||
assert(len >= 2);
|
||||
mm_sprintf_lite(s, "~%c%c%d%c%c", "acgtn"[tseq[t_off]], "acgtn"[tseq[t_off+1]],
|
||||
len, "acgtn"[tseq[t_off+len-2]], "acgtn"[tseq[t_off+len-1]]);
|
||||
@@ -197,9 +184,99 @@ static void write_cs(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_
|
||||
}
|
||||
}
|
||||
assert(t_off == r->re - r->rs && q_off == r->qe - r->qs);
|
||||
}
|
||||
|
||||
static void write_MD_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq, const mm_reg1_t *r, char *tmp, int write_tag)
|
||||
{
|
||||
int i, q_off, t_off, l_MD = 0;
|
||||
if (write_tag) mm_sprintf_lite(s, "\tMD:Z:");
|
||||
for (i = q_off = t_off = 0; i < (int)r->p->n_cigar; ++i) {
|
||||
int j, op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
|
||||
assert((op >= 0 && op <= 3) || op == 7 || op == 8);
|
||||
if (op == 0 || op == 7 || op == 8) { // match
|
||||
for (j = 0; j < len; ++j) {
|
||||
if (qseq[q_off + j] != tseq[t_off + j]) {
|
||||
mm_sprintf_lite(s, "%d%c", l_MD, "ACGTN"[tseq[t_off + j]]);
|
||||
l_MD = 0;
|
||||
} else ++l_MD;
|
||||
}
|
||||
q_off += len, t_off += len;
|
||||
} else if (op == 1) { // insertion to ref
|
||||
q_off += len;
|
||||
} else if (op == 2) { // deletion from ref
|
||||
for (j = 0, tmp[len] = 0; j < len; ++j)
|
||||
tmp[j] = "ACGTN"[tseq[t_off + j]];
|
||||
mm_sprintf_lite(s, "%d^%s", l_MD, tmp);
|
||||
l_MD = 0;
|
||||
t_off += len;
|
||||
} else if (op == 3) { // reference skip
|
||||
t_off += len;
|
||||
}
|
||||
}
|
||||
if (l_MD > 0) mm_sprintf_lite(s, "%d", l_MD);
|
||||
assert(t_off == r->re - r->rs && q_off == r->qe - r->qs);
|
||||
}
|
||||
|
||||
static void write_cs_or_MD(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int no_iden, int is_MD, int write_tag)
|
||||
{
|
||||
extern unsigned char seq_nt4_table[256];
|
||||
int i;
|
||||
uint8_t *qseq, *tseq;
|
||||
char *tmp;
|
||||
if (r->p == 0) return;
|
||||
qseq = (uint8_t*)kmalloc(km, r->qe - r->qs);
|
||||
tseq = (uint8_t*)kmalloc(km, r->re - r->rs);
|
||||
tmp = (char*)kmalloc(km, r->re - r->rs > r->qe - r->qs? r->re - r->rs + 1 : r->qe - r->qs + 1);
|
||||
mm_idx_getseq(mi, r->rid, r->rs, r->re, tseq);
|
||||
if (!r->rev) {
|
||||
for (i = r->qs; i < r->qe; ++i)
|
||||
qseq[i - r->qs] = seq_nt4_table[(uint8_t)t->seq[i]];
|
||||
} else {
|
||||
for (i = r->qs; i < r->qe; ++i) {
|
||||
uint8_t c = seq_nt4_table[(uint8_t)t->seq[i]];
|
||||
qseq[r->qe - i - 1] = c >= 4? 4 : 3 - c;
|
||||
}
|
||||
}
|
||||
if (is_MD) write_MD_core(s, tseq, qseq, r, tmp, write_tag);
|
||||
else write_cs_core(s, tseq, qseq, r, tmp, no_iden, write_tag);
|
||||
kfree(km, qseq); kfree(km, tseq); kfree(km, tmp);
|
||||
}
|
||||
|
||||
int mm_gen_cs_or_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int is_MD, int no_iden)
|
||||
{
|
||||
mm_bseq1_t t;
|
||||
kstring_t str;
|
||||
str.s = *buf, str.l = 0, str.m = *max_len;
|
||||
t.l_seq = strlen(seq);
|
||||
t.seq = (char*)seq;
|
||||
write_cs_or_MD(km, &str, mi, &t, r, no_iden, is_MD, 0);
|
||||
*max_len = str.m;
|
||||
*buf = str.s;
|
||||
return str.l;
|
||||
}
|
||||
|
||||
int mm_gen_cs(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int no_iden)
|
||||
{
|
||||
return mm_gen_cs_or_MD(km, buf, max_len, mi, r, seq, 0, no_iden);
|
||||
}
|
||||
|
||||
int mm_gen_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq)
|
||||
{
|
||||
return mm_gen_cs_or_MD(km, buf, max_len, mi, r, seq, 1, 0);
|
||||
}
|
||||
|
||||
double mm_event_identity(const mm_reg1_t *r)
|
||||
{
|
||||
int32_t i, n_gapo = 0, n_gap = 0;
|
||||
if (r->p == 0) return -1.0f;
|
||||
for (i = 0; i < r->p->n_cigar; ++i) {
|
||||
int32_t op = r->p->cigar[i] & 0xf, len = r->p->cigar[i] >> 4;
|
||||
if (op == 1 || op == 2)
|
||||
++n_gapo, n_gap += len;
|
||||
}
|
||||
return (double)r->mlen / (r->blen + r->p->n_ambi - n_gap + n_gapo);
|
||||
}
|
||||
|
||||
static inline void write_tags(kstring_t *s, const mm_reg1_t *r)
|
||||
{
|
||||
int type;
|
||||
@@ -212,18 +289,30 @@ static inline void write_tags(kstring_t *s, const mm_reg1_t *r)
|
||||
}
|
||||
mm_sprintf_lite(s, "\ttp:A:%c\tcm:i:%d\ts1:i:%d", type, r->cnt, r->score);
|
||||
if (r->parent == r->id) mm_sprintf_lite(s, "\ts2:i:%d", r->subsc);
|
||||
if (r->div >= 0.0f && r->div <= 1.0f) {
|
||||
char buf[8];
|
||||
if (r->p) {
|
||||
char buf[16];
|
||||
double div;
|
||||
div = 1.0 - mm_event_identity(r);
|
||||
if (div == 0.0) buf[0] = '0', buf[1] = 0;
|
||||
else snprintf(buf, 16, "%.4f", 1.0 - mm_event_identity(r));
|
||||
mm_sprintf_lite(s, "\tde:f:%s", buf);
|
||||
} else if (r->div >= 0.0f && r->div <= 1.0f) {
|
||||
char buf[16];
|
||||
if (r->div == 0.0f) buf[0] = '0', buf[1] = 0;
|
||||
else sprintf(buf, "%.4f", r->div);
|
||||
else snprintf(buf, 16, "%.4f", r->div);
|
||||
mm_sprintf_lite(s, "\tdv:f:%s", buf);
|
||||
}
|
||||
if (r->split) mm_sprintf_lite(s, "\tzd:i:%d", r->split);
|
||||
}
|
||||
|
||||
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int opt_flag)
|
||||
void mm_write_paf3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int opt_flag, int rep_len)
|
||||
{
|
||||
s->l = 0;
|
||||
if (r == 0) {
|
||||
mm_sprintf_lite(s, "%s\t%d\t0\t0\t*\t*\t0\t0\t0\t0\t0\t0", t->name, t->l_seq);
|
||||
if (rep_len >= 0) mm_sprintf_lite(s, "\trl:i:%d", rep_len);
|
||||
return;
|
||||
}
|
||||
mm_sprintf_lite(s, "%s\t%d\t%d\t%d\t%c\t", t->name, t->l_seq, r->qs, r->qe, "+-"[r->rev]);
|
||||
if (mi->seq[r->rid].name) mm_sprintf_lite(s, "%s", mi->seq[r->rid].name);
|
||||
else mm_sprintf_lite(s, "%d", r->rid);
|
||||
@@ -231,14 +320,22 @@ void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const m
|
||||
mm_sprintf_lite(s, "\t%d\t%d", r->mlen, r->blen);
|
||||
mm_sprintf_lite(s, "\t%d", r->mapq);
|
||||
write_tags(s, r);
|
||||
if (rep_len >= 0) mm_sprintf_lite(s, "\trl:i:%d", rep_len);
|
||||
if (r->p && (opt_flag & MM_F_OUT_CG)) {
|
||||
uint32_t k;
|
||||
mm_sprintf_lite(s, "\tcg:Z:");
|
||||
for (k = 0; k < r->p->n_cigar; ++k)
|
||||
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDN"[r->p->cigar[k]&0xf]);
|
||||
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDNSHP=XB"[r->p->cigar[k]&0xf]);
|
||||
}
|
||||
if (r->p && (opt_flag & MM_F_OUT_CS))
|
||||
write_cs(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG));
|
||||
if (r->p && (opt_flag & (MM_F_OUT_CS|MM_F_OUT_MD)))
|
||||
write_cs_or_MD(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG), opt_flag&MM_F_OUT_MD, 1);
|
||||
if ((opt_flag & MM_F_COPY_COMMENT) && t->comment)
|
||||
mm_sprintf_lite(s, "\t%s", t->comment);
|
||||
}
|
||||
|
||||
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int opt_flag)
|
||||
{
|
||||
mm_write_paf3(s, mi, t, r, km, opt_flag, -1);
|
||||
}
|
||||
|
||||
static void sam_write_sq(kstring_t *s, char *seq, int l, int rev, int comp)
|
||||
@@ -282,19 +379,20 @@ static void write_sam_cigar(kstring_t *s, int sam_flag, int in_tag, int qlen, co
|
||||
if (clip_len[1]) mm_sprintf_lite(s, ",%u", clip_len[1]<<4|clip_char);
|
||||
} else {
|
||||
int clip_char = (sam_flag&0x800) && !(opt_flag&MM_F_SOFTCLIP)? 'H' : 'S';
|
||||
assert(clip_len[0] < qlen && clip_len[1] < qlen);
|
||||
if (clip_len[0]) mm_sprintf_lite(s, "%d%c", clip_len[0], clip_char);
|
||||
for (k = 0; k < r->p->n_cigar; ++k)
|
||||
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDN"[r->p->cigar[k]&0xf]);
|
||||
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDNSHP=XB"[r->p->cigar[k]&0xf]);
|
||||
if (clip_len[1]) mm_sprintf_lite(s, "%d%c", clip_len[1], clip_char);
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regss, const mm_reg1_t *const* regss, void *km, int opt_flag)
|
||||
void mm_write_sam3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regss, const mm_reg1_t *const* regss, void *km, int opt_flag, int rep_len)
|
||||
{
|
||||
const int max_bam_cigar_op = 65535;
|
||||
int flag, n_regs = n_regss[seg_idx], cigar_in_tag = 0;
|
||||
int this_rid = -1, this_pos = -1, this_rev = 0;
|
||||
int this_rid = -1, this_pos = -1;
|
||||
const mm_reg1_t *regs = regss[seg_idx], *r_prev = NULL, *r_next;
|
||||
const mm_reg1_t *r = n_regs > 0 && reg_idx < n_regs && reg_idx >= 0? ®s[reg_idx] : NULL;
|
||||
|
||||
@@ -343,7 +441,7 @@ void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
|
||||
mm_sprintf_lite(s, "\t%s\t%d\t0\t*", mi->seq[this_rid].name, this_pos+1);
|
||||
} else mm_sprintf_lite(s, "\t*\t0\t0\t*");
|
||||
} else {
|
||||
this_rid = r->rid, this_pos = r->rs, this_rev = r->rev;
|
||||
this_rid = r->rid, this_pos = r->rs;
|
||||
mm_sprintf_lite(s, "\t%s\t%d\t%d\t", mi->seq[r->rid].name, r->rs+1, r->mapq);
|
||||
if ((opt_flag & MM_F_LONG_CIGAR) && r->p && r->p->n_cigar > max_bam_cigar_op - 2) {
|
||||
int n_cigar = r->p->n_cigar;
|
||||
@@ -353,9 +451,11 @@ void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
|
||||
cigar_in_tag = 1;
|
||||
}
|
||||
if (cigar_in_tag) {
|
||||
if (flag & 0x100) mm_sprintf_lite(s, "0S"); // secondary alignment
|
||||
else if (flag & 0x800) mm_sprintf_lite(s, "%dS", r->re - r->rs); // supplementary alignment
|
||||
else mm_sprintf_lite(s, "%dS", t->l_seq);
|
||||
int slen;
|
||||
if ((flag & 0x900) == 0 || (opt_flag & MM_F_SOFTCLIP)) slen = t->l_seq;
|
||||
else if (flag & 0x100) slen = 0;
|
||||
else slen = r->qe - r->qs;
|
||||
mm_sprintf_lite(s, "%dS%dN", slen, r->re - r->rs);
|
||||
} else write_sam_cigar(s, flag, 0, t->l_seq, r, opt_flag);
|
||||
}
|
||||
|
||||
@@ -364,17 +464,17 @@ void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
|
||||
int tlen = 0;
|
||||
if (this_rid >= 0 && r_next) {
|
||||
if (this_rid == r_next->rid) {
|
||||
int this_pos5 = r && r->rev? r->re - 1 : this_pos;
|
||||
int next_pos5 = r_next->rev? r_next->re - 1 : r_next->rs;
|
||||
tlen = next_pos5 - this_pos5;
|
||||
if (r) {
|
||||
int this_pos5 = r->rev? r->re - 1 : this_pos;
|
||||
int next_pos5 = r_next->rev? r_next->re - 1 : r_next->rs;
|
||||
tlen = next_pos5 - this_pos5;
|
||||
}
|
||||
mm_sprintf_lite(s, "\t=\t");
|
||||
} else mm_sprintf_lite(s, "\t%s\t", mi->seq[r_next->rid].name);
|
||||
mm_sprintf_lite(s, "%d\t", r_next->rs + 1);
|
||||
} else if (r_next) { // && this_rid < 0
|
||||
mm_sprintf_lite(s, "\t%s\t%d\t", mi->seq[r_next->rid].name, r_next->rs + 1);
|
||||
} else if (this_rid >= 0) { // && r_next == NULL
|
||||
int this_pos5 = this_rev? r->re - 1 : this_pos; // this_rev is only true when r != NULL
|
||||
tlen = this_pos - this_pos5; // next_pos5 will be this_pos
|
||||
mm_sprintf_lite(s, "\t=\t%d\t", this_pos + 1); // next segment will take r's coordinate
|
||||
} else mm_sprintf_lite(s, "\t*\t0\t"); // neither has coordinates
|
||||
if (tlen > 0) ++tlen;
|
||||
@@ -434,15 +534,24 @@ void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
|
||||
}
|
||||
}
|
||||
}
|
||||
if (r->p && (opt_flag & MM_F_OUT_CS))
|
||||
write_cs(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG));
|
||||
if (r->p && (opt_flag & (MM_F_OUT_CS|MM_F_OUT_MD)))
|
||||
write_cs_or_MD(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG), opt_flag&MM_F_OUT_MD, 1);
|
||||
if (cigar_in_tag)
|
||||
write_sam_cigar(s, flag, 1, t->l_seq, r, opt_flag);
|
||||
}
|
||||
if (rep_len >= 0) mm_sprintf_lite(s, "\trl:i:%d", rep_len);
|
||||
|
||||
if ((opt_flag & MM_F_COPY_COMMENT) && t->comment)
|
||||
mm_sprintf_lite(s, "\t%s", t->comment);
|
||||
|
||||
s->s[s->l] = 0; // we always have room for an extra byte (see str_enlarge)
|
||||
}
|
||||
|
||||
void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regss, const mm_reg1_t *const* regss, void *km, int opt_flag)
|
||||
{
|
||||
mm_write_sam3(s, mi, t, seg_idx, reg_idx, n_seg, n_regss, regss, km, opt_flag, -1);
|
||||
}
|
||||
|
||||
void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int n_regs, const mm_reg1_t *regs)
|
||||
{
|
||||
int i;
|
||||
|
||||
@@ -1,216 +0,0 @@
|
||||
#include <stddef.h>
|
||||
#include <stdio.h>
|
||||
#include <string.h>
|
||||
#include "getopt.h"
|
||||
|
||||
char *optarg;
|
||||
int optind=1, opterr=1, optopt, __optpos, optreset=0;
|
||||
|
||||
#define optpos __optpos
|
||||
|
||||
static void __getopt_msg(const char *a, const char *b, const char *c, size_t l)
|
||||
{
|
||||
FILE *f = stderr;
|
||||
#if !defined(WIN32) && !defined(_WIN32)
|
||||
flockfile(f);
|
||||
#endif
|
||||
fputs(a, f);
|
||||
fwrite(b, strlen(b), 1, f);
|
||||
fwrite(c, 1, l, f);
|
||||
fputc('\n', f);
|
||||
#if !defined(WIN32) && !defined(_WIN32)
|
||||
funlockfile(f);
|
||||
#endif
|
||||
}
|
||||
|
||||
int getopt(int argc, char * const argv[], const char *optstring)
|
||||
{
|
||||
int i, c, d;
|
||||
int k, l;
|
||||
char *optchar;
|
||||
|
||||
if (!optind || optreset) {
|
||||
optreset = 0;
|
||||
__optpos = 0;
|
||||
optind = 1;
|
||||
}
|
||||
|
||||
if (optind >= argc || !argv[optind])
|
||||
return -1;
|
||||
|
||||
if (argv[optind][0] != '-') {
|
||||
if (optstring[0] == '-') {
|
||||
optarg = argv[optind++];
|
||||
return 1;
|
||||
}
|
||||
return -1;
|
||||
}
|
||||
|
||||
if (!argv[optind][1])
|
||||
return -1;
|
||||
|
||||
if (argv[optind][1] == '-' && !argv[optind][2])
|
||||
return optind++, -1;
|
||||
|
||||
if (!optpos) optpos++;
|
||||
c = argv[optind][optpos], k = 1;
|
||||
optchar = argv[optind]+optpos;
|
||||
optopt = c;
|
||||
optpos += k;
|
||||
|
||||
if (!argv[optind][optpos]) {
|
||||
optind++;
|
||||
optpos = 0;
|
||||
}
|
||||
|
||||
if (optstring[0] == '-' || optstring[0] == '+')
|
||||
optstring++;
|
||||
|
||||
i = 0;
|
||||
d = 0;
|
||||
do {
|
||||
d = optstring[i], l = 1;
|
||||
if (l>0) i+=l; else i++;
|
||||
} while (l && d != c);
|
||||
|
||||
if (d != c) {
|
||||
if (optstring[0] != ':' && opterr)
|
||||
__getopt_msg(argv[0], ": unrecognized option: ", optchar, k);
|
||||
return '?';
|
||||
}
|
||||
if (optstring[i] == ':') {
|
||||
if (optstring[i+1] == ':') optarg = 0;
|
||||
else if (optind >= argc) {
|
||||
if (optstring[0] == ':') return ':';
|
||||
if (opterr) __getopt_msg(argv[0],
|
||||
": option requires an argument: ",
|
||||
optchar, k);
|
||||
return '?';
|
||||
}
|
||||
if (optstring[i+1] != ':' || optpos) {
|
||||
optarg = argv[optind++] + optpos;
|
||||
optpos = 0;
|
||||
}
|
||||
}
|
||||
return c;
|
||||
}
|
||||
|
||||
static void permute(char *const *argv, int dest, int src)
|
||||
{
|
||||
char **av = (char **)argv;
|
||||
char *tmp = av[src];
|
||||
int i;
|
||||
for (i=src; i>dest; i--)
|
||||
av[i] = av[i-1];
|
||||
av[dest] = tmp;
|
||||
}
|
||||
|
||||
static int __getopt_long_core(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx, int longonly)
|
||||
{
|
||||
optarg = 0;
|
||||
if (longopts && argv[optind][0] == '-' &&
|
||||
((longonly && argv[optind][1] && argv[optind][1] != '-') ||
|
||||
(argv[optind][1] == '-' && argv[optind][2])))
|
||||
{
|
||||
int colon = optstring[optstring[0]=='+'||optstring[0]=='-']==':';
|
||||
int i, cnt, match = -1;
|
||||
char *opt;
|
||||
for (cnt=i=0; longopts[i].name; i++) {
|
||||
const char *name = longopts[i].name;
|
||||
opt = argv[optind]+1;
|
||||
if (*opt == '-') opt++;
|
||||
for (; *name && *name == *opt; name++, opt++);
|
||||
if (*opt && *opt != '=') continue;
|
||||
match = i;
|
||||
if (!*name) {
|
||||
cnt = 1;
|
||||
break;
|
||||
}
|
||||
cnt++;
|
||||
}
|
||||
if (cnt==1) {
|
||||
i = match;
|
||||
optind++;
|
||||
optopt = longopts[i].val;
|
||||
if (*opt == '=') {
|
||||
if (!longopts[i].has_arg) {
|
||||
if (colon || !opterr)
|
||||
return '?';
|
||||
__getopt_msg(argv[0],
|
||||
": option does not take an argument: ",
|
||||
longopts[i].name,
|
||||
strlen(longopts[i].name));
|
||||
return '?';
|
||||
}
|
||||
optarg = opt+1;
|
||||
} else if (longopts[i].has_arg == required_argument) {
|
||||
if (!(optarg = argv[optind])) {
|
||||
if (colon) return ':';
|
||||
if (!opterr) return '?';
|
||||
__getopt_msg(argv[0],
|
||||
": option requires an argument: ",
|
||||
longopts[i].name,
|
||||
strlen(longopts[i].name));
|
||||
return '?';
|
||||
}
|
||||
optind++;
|
||||
}
|
||||
if (idx) *idx = i;
|
||||
if (longopts[i].flag) {
|
||||
*longopts[i].flag = longopts[i].val;
|
||||
return 0;
|
||||
}
|
||||
return longopts[i].val;
|
||||
}
|
||||
if (argv[optind][1] == '-') {
|
||||
if (!colon && opterr)
|
||||
__getopt_msg(argv[0], cnt ?
|
||||
": option is ambiguous: " :
|
||||
": unrecognized option: ",
|
||||
argv[optind]+2,
|
||||
strlen(argv[optind]+2));
|
||||
optind++;
|
||||
return '?';
|
||||
}
|
||||
}
|
||||
return getopt(argc, argv, optstring);
|
||||
}
|
||||
|
||||
static int __getopt_long(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx, int longonly)
|
||||
{
|
||||
int ret, skipped, resumed;
|
||||
if (!optind || optreset) {
|
||||
optreset = 0;
|
||||
__optpos = 0;
|
||||
optind = 1;
|
||||
}
|
||||
if (optind >= argc || !argv[optind]) return -1;
|
||||
skipped = optind;
|
||||
if (optstring[0] != '+' && optstring[0] != '-') {
|
||||
int i;
|
||||
for (i=optind; ; i++) {
|
||||
if (i >= argc || !argv[i]) return -1;
|
||||
if (argv[i][0] == '-' && argv[i][1]) break;
|
||||
}
|
||||
optind = i;
|
||||
}
|
||||
resumed = optind;
|
||||
ret = __getopt_long_core(argc, argv, optstring, longopts, idx, longonly);
|
||||
if (resumed > skipped) {
|
||||
int i, cnt = optind-resumed;
|
||||
for (i=0; i<cnt; i++)
|
||||
permute(argv, skipped, optind-1);
|
||||
optind = skipped + cnt;
|
||||
}
|
||||
return ret;
|
||||
}
|
||||
|
||||
int getopt_long(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx)
|
||||
{
|
||||
return __getopt_long(argc, argv, optstring, longopts, idx, 0);
|
||||
}
|
||||
|
||||
int getopt_long_only(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx)
|
||||
{
|
||||
return __getopt_long(argc, argv, optstring, longopts, idx, 1);
|
||||
}
|
||||
@@ -1,53 +0,0 @@
|
||||
/*
|
||||
Copyright 2005-2014 Rich Felker, et al.
|
||||
|
||||
Permission is hereby granted, free of charge, to any person obtaining
|
||||
a copy of this software and associated documentation files (the
|
||||
"Software"), to deal in the Software without restriction, including
|
||||
without limitation the rights to use, copy, modify, merge, publish,
|
||||
distribute, sublicense, and/or sell copies of the Software, and to
|
||||
permit persons to whom the Software is furnished to do so, subject to
|
||||
the following conditions:
|
||||
|
||||
The above copyright notice and this permission notice shall be
|
||||
included in all copies or substantial portions of the Software.
|
||||
|
||||
THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
|
||||
EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
|
||||
MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT.
|
||||
IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY
|
||||
CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT,
|
||||
TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE
|
||||
SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
|
||||
*/
|
||||
|
||||
#ifndef _GETOPT_H
|
||||
#define _GETOPT_H
|
||||
|
||||
#ifdef __cplusplus
|
||||
extern "C" {
|
||||
#endif
|
||||
|
||||
int getopt(int, char * const [], const char *);
|
||||
extern char *optarg;
|
||||
extern int optind, opterr, optopt, optreset;
|
||||
|
||||
struct option {
|
||||
const char *name;
|
||||
int has_arg;
|
||||
int *flag;
|
||||
int val;
|
||||
};
|
||||
|
||||
int getopt_long(int, char *const *, const char *, const struct option *, int *);
|
||||
int getopt_long_only(int, char *const *, const char *, const struct option *, int *);
|
||||
|
||||
#define no_argument 0
|
||||
#define required_argument 1
|
||||
#define optional_argument 2
|
||||
|
||||
#ifdef __cplusplus
|
||||
}
|
||||
#endif
|
||||
|
||||
#endif
|
||||
@@ -87,6 +87,22 @@ mm_reg1_t *mm_gen_regs(void *km, uint32_t hash, int qlen, int n_u, uint64_t *u,
|
||||
return r;
|
||||
}
|
||||
|
||||
void mm_mark_alt(const mm_idx_t *mi, int n, mm_reg1_t *r)
|
||||
{
|
||||
int i;
|
||||
if (mi->n_alt == 0) return;
|
||||
for (i = 0; i < n; ++i)
|
||||
if (mi->seq[r[i].rid].is_alt)
|
||||
r[i].is_alt = 1;
|
||||
}
|
||||
|
||||
static inline int mm_alt_score(int score, float alt_diff_frac)
|
||||
{
|
||||
if (score < 0) return score;
|
||||
score = (int)(score * (1.0 - alt_diff_frac) + .499);
|
||||
return score > 0? score : 1;
|
||||
}
|
||||
|
||||
void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a)
|
||||
{
|
||||
if (n <= 0 || n >= r->cnt) return;
|
||||
@@ -106,7 +122,7 @@ void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a)
|
||||
r->split |= 1, r2->split |= 2;
|
||||
}
|
||||
|
||||
void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r, int sub_diff) // and compute mm_reg1_t::subsc
|
||||
void mm_set_parent(void *km, float mask_level, int mask_len, int n, mm_reg1_t *r, int sub_diff, int hard_mask_level, float alt_diff_frac) // and compute mm_reg1_t::subsc
|
||||
{
|
||||
int i, j, k, *w;
|
||||
uint64_t *cov;
|
||||
@@ -118,6 +134,7 @@ void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r, int sub_diff
|
||||
for (i = 1, k = 1; i < n; ++i) {
|
||||
mm_reg1_t *ri = &r[i];
|
||||
int si = ri->qs, ei = ri->qe, n_cov = 0, uncov_len = 0;
|
||||
if (hard_mask_level) goto skip_uncov;
|
||||
for (j = 0; j < k; ++j) { // traverse existing primary hits to find overlapping hits
|
||||
mm_reg1_t *rp = &r[w[j]];
|
||||
int sj = rp->qs, ej = rp->qe;
|
||||
@@ -132,25 +149,29 @@ void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r, int sub_diff
|
||||
int j, x = si;
|
||||
radix_sort_64(cov, cov + n_cov);
|
||||
for (j = 0; j < n_cov; ++j) {
|
||||
if (cov[j]>>32 > x) uncov_len += (cov[j]>>32) - x;
|
||||
if ((int)(cov[j]>>32) > x) uncov_len += (cov[j]>>32) - x;
|
||||
x = (int32_t)cov[j] > x? (int32_t)cov[j] : x;
|
||||
}
|
||||
if (ei > x) uncov_len += ei - x;
|
||||
}
|
||||
skip_uncov:
|
||||
for (j = 0; j < k; ++j) { // traverse existing primary hits again
|
||||
mm_reg1_t *rp = &r[w[j]];
|
||||
int sj = rp->qs, ej = rp->qe, min, max, ol;
|
||||
if (ej <= si || sj >= ei) continue; // no overlap
|
||||
min = ej - sj < ei - si? ej - sj : ei - si;
|
||||
max = ej - sj > ei - si? ej - sj : ei - si;
|
||||
ol = si < sj? (ei < sj? 0 : ei < ej? ei - sj : ej - sj) : (ej < si? 0 : ej < ei? ej - si : ei - si); // overlap length
|
||||
if ((float)ol / min - (float)uncov_len / max > mask_level) {
|
||||
int cnt_sub = 0;
|
||||
ol = si < sj? (ei < sj? 0 : ei < ej? ei - sj : ej - sj) : (ej < si? 0 : ej < ei? ej - si : ei - si); // overlap length; TODO: this can be simplified
|
||||
if ((float)ol / min - (float)uncov_len / max > mask_level && uncov_len <= mask_len) { // then this is a secondary hit
|
||||
int cnt_sub = 0, sci = ri->score;
|
||||
ri->parent = rp->parent;
|
||||
rp->subsc = rp->subsc > ri->score? rp->subsc : ri->score;
|
||||
if (!rp->is_alt && ri->is_alt) sci = mm_alt_score(sci, alt_diff_frac);
|
||||
rp->subsc = rp->subsc > sci? rp->subsc : sci;
|
||||
if (ri->cnt >= rp->cnt) cnt_sub = 1;
|
||||
if (rp->p && ri->p && (rp->rid != ri->rid || rp->rs != ri->rs || rp->re != ri->re || ol != min)) { // the last condition excludes identical hits after DP
|
||||
rp->p->dp_max2 = rp->p->dp_max2 > ri->p->dp_max? rp->p->dp_max2 : ri->p->dp_max;
|
||||
sci = ri->p->dp_max;
|
||||
if (!rp->is_alt && ri->is_alt) sci = mm_alt_score(sci, alt_diff_frac);
|
||||
rp->p->dp_max2 = rp->p->dp_max2 > sci? rp->p->dp_max2 : sci;
|
||||
if (rp->p->dp_max - ri->p->dp_max <= sub_diff) cnt_sub = 1;
|
||||
}
|
||||
if (cnt_sub) ++rp->n_sub;
|
||||
@@ -164,9 +185,9 @@ set_parent_test:
|
||||
kfree(km, w);
|
||||
}
|
||||
|
||||
void mm_hit_sort_by_dp(void *km, int *n_regs, mm_reg1_t *r)
|
||||
void mm_hit_sort(void *km, int *n_regs, mm_reg1_t *r, float alt_diff_frac)
|
||||
{
|
||||
int32_t i, n_aux, n = *n_regs;
|
||||
int32_t i, n_aux, n = *n_regs, has_cigar = 0, no_cigar = 0;
|
||||
mm128_t *aux;
|
||||
mm_reg1_t *t;
|
||||
|
||||
@@ -175,14 +196,18 @@ void mm_hit_sort_by_dp(void *km, int *n_regs, mm_reg1_t *r)
|
||||
t = (mm_reg1_t*)kmalloc(km, n * sizeof(mm_reg1_t));
|
||||
for (i = n_aux = 0; i < n; ++i) {
|
||||
if (r[i].inv || r[i].cnt > 0) { // squeeze out elements with cnt==0 (soft deleted)
|
||||
assert(r[i].p);
|
||||
aux[n_aux].x = (uint64_t)r[i].p->dp_max << 32 | r[i].hash;
|
||||
int score;
|
||||
if (r[i].p) score = r[i].p->dp_max, has_cigar = 1;
|
||||
else score = r[i].score, no_cigar = 1;
|
||||
if (r[i].is_alt) score = mm_alt_score(score, alt_diff_frac);
|
||||
aux[n_aux].x = (uint64_t)score << 32 | r[i].hash;
|
||||
aux[n_aux++].y = i;
|
||||
} else if (r[i].p) {
|
||||
free(r[i].p);
|
||||
r[i].p = 0;
|
||||
}
|
||||
}
|
||||
assert(has_cigar + no_cigar == 1);
|
||||
radix_sort_128x(aux, aux + n_aux);
|
||||
for (i = n_aux - 1; i >= 0; --i)
|
||||
t[n_aux - 1 - i] = r[aux[i].y];
|
||||
@@ -246,7 +271,7 @@ void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int *n_,
|
||||
}
|
||||
}
|
||||
|
||||
void mm_filter_regs(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs)
|
||||
void mm_filter_regs(const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs)
|
||||
{ // NB: after this call, mm_reg1_t::parent can be -1 if its parent filtered out
|
||||
int i, k;
|
||||
for (i = k = 0; i < *n_regs; ++i) {
|
||||
@@ -287,63 +312,6 @@ int mm_squeeze_a(void *km, int n_regs, mm_reg1_t *regs, mm128_t *a)
|
||||
return as;
|
||||
}
|
||||
|
||||
void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs_, mm_reg1_t *regs, mm128_t *a)
|
||||
{
|
||||
int i, n_aux, n_regs = *n_regs_, n_drop = 0;
|
||||
uint64_t *aux;
|
||||
|
||||
if (n_regs < 2) return; // nothing to join
|
||||
mm_squeeze_a(km, n_regs, regs, a);
|
||||
|
||||
aux = (uint64_t*)kmalloc(km, n_regs * 8);
|
||||
for (i = n_aux = 0; i < n_regs; ++i)
|
||||
if (regs[i].parent == i || regs[i].parent < 0)
|
||||
aux[n_aux++] = (uint64_t)regs[i].as << 32 | i;
|
||||
radix_sort_64(aux, aux + n_aux);
|
||||
|
||||
for (i = n_aux - 1; i >= 1; --i) {
|
||||
mm_reg1_t *r0 = ®s[(int32_t)aux[i-1]], *r1 = ®s[(int32_t)aux[i]];
|
||||
mm128_t *a0e, *a1s;
|
||||
int max_gap, min_gap, sc_thres;
|
||||
|
||||
// test
|
||||
if (r0->as + r0->cnt != r1->as) continue; // not adjacent in a[]
|
||||
if (r0->rid != r1->rid || r0->rev != r1->rev) continue; // make sure on the same target and strand
|
||||
a0e = &a[r0->as + r0->cnt - 1];
|
||||
a1s = &a[r1->as];
|
||||
if (a1s->x <= a0e->x || (int32_t)a1s->y <= (int32_t)a0e->y) continue; // keep colinearity
|
||||
max_gap = min_gap = (int32_t)a1s->y - (int32_t)a0e->y;
|
||||
max_gap = max_gap > a1s->x - a0e->x? max_gap : a1s->x - a0e->x;
|
||||
min_gap = min_gap < a1s->x - a0e->x? min_gap : a1s->x - a0e->x;
|
||||
if (max_gap > opt->max_join_long || min_gap > opt->max_join_short) continue;
|
||||
sc_thres = (int)((float)opt->min_join_flank_sc / opt->max_join_long * max_gap + .499);
|
||||
if (r0->score < sc_thres || r1->score < sc_thres) continue; // require good flanking chains
|
||||
if (r0->re - r0->rs < max_gap>>1 || r0->qe - r0->qs < max_gap>>1) continue; // require enough flanking length
|
||||
if (r1->re - r1->rs < max_gap>>1 || r1->qe - r1->qs < max_gap>>1) continue;
|
||||
|
||||
// all conditions satisfied; join
|
||||
a[r1->as].y |= MM_SEED_LONG_JOIN;
|
||||
r0->cnt += r1->cnt, r0->score += r1->score;
|
||||
mm_reg_set_coor(r0, qlen, a);
|
||||
r1->cnt = 0;
|
||||
r1->parent = r0->id;
|
||||
++n_drop;
|
||||
}
|
||||
kfree(km, aux);
|
||||
|
||||
if (n_drop > 0) { // then fix the hits hierarchy
|
||||
for (i = 0; i < n_regs; ++i) { // adjust the mm_reg1_t::parent
|
||||
mm_reg1_t *r = ®s[i];
|
||||
if (r->parent >= 0 && r->id != r->parent) { // fix for secondary hits only
|
||||
if (regs[r->parent].parent >= 0 && regs[r->parent].parent != r->parent)
|
||||
r->parent = regs[r->parent].parent;
|
||||
}
|
||||
}
|
||||
mm_filter_regs(km, opt, qlen, n_regs_, regs);
|
||||
mm_sync_regs(km, *n_regs_, regs);
|
||||
}
|
||||
}
|
||||
|
||||
mm_seg_t *mm_seg_gen(void *km, uint32_t hash, int n_segs, const int *qlens, int n_regs0, const mm_reg1_t *regs0, int *n_regs, mm_reg1_t **regs, const mm128_t *a)
|
||||
{
|
||||
int s, i, j, acc_qlen[MM_MAX_SEG+1], qlen_sum = 0;
|
||||
@@ -411,23 +379,23 @@ void mm_seg_free(void *km, int n_segs, mm_seg_t *segs)
|
||||
static void mm_set_inv_mapq(void *km, int n_regs, mm_reg1_t *regs)
|
||||
{
|
||||
int i, n_aux;
|
||||
uint64_t *aux;
|
||||
mm128_t *aux;
|
||||
if (n_regs < 3) return;
|
||||
for (i = 0; i < n_regs; ++i)
|
||||
if (regs[i].inv) break;
|
||||
if (i == n_regs) return; // no inversion hits
|
||||
|
||||
aux = (uint64_t*)kmalloc(km, n_regs * 8);
|
||||
aux = (mm128_t*)kmalloc(km, n_regs * 16);
|
||||
for (i = n_aux = 0; i < n_regs; ++i)
|
||||
if (regs[i].parent == i || regs[i].parent < 0)
|
||||
aux[n_aux++] = (uint64_t)regs[i].as << 32 | i;
|
||||
radix_sort_64(aux, aux + n_aux);
|
||||
aux[n_aux].y = i, aux[n_aux++].x = (uint64_t)regs[i].rid << 32 | regs[i].rs;
|
||||
radix_sort_128x(aux, aux + n_aux);
|
||||
|
||||
for (i = 1; i < n_aux - 1; ++i) {
|
||||
mm_reg1_t *inv = ®s[(int32_t)aux[i]];
|
||||
mm_reg1_t *inv = ®s[aux[i].y];
|
||||
if (inv->inv) {
|
||||
mm_reg1_t *l = ®s[(int32_t)aux[i-1]];
|
||||
mm_reg1_t *r = ®s[(int32_t)aux[i+1]];
|
||||
mm_reg1_t *l = ®s[aux[i-1].y];
|
||||
mm_reg1_t *r = ®s[aux[i+1].y];
|
||||
inv->mapq = l->mapq < r->mapq? l->mapq : r->mapq;
|
||||
}
|
||||
}
|
||||
@@ -440,6 +408,7 @@ void mm_set_mapq(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int ma
|
||||
int64_t sum_sc = 0;
|
||||
float uniq_ratio;
|
||||
int i;
|
||||
if (n_regs == 0) return;
|
||||
for (i = 0; i < n_regs; ++i)
|
||||
if (regs[i].parent == regs[i].id)
|
||||
sum_sc += regs[i].score;
|
||||
|
||||
@@ -31,6 +31,16 @@ typedef struct mm_idx_bucket_s {
|
||||
void *h; // hash table indexing _p_ and minimizers appearing once
|
||||
} mm_idx_bucket_t;
|
||||
|
||||
typedef struct {
|
||||
int32_t st, en, max; // max is not used for now
|
||||
int32_t score:30, strand:2;
|
||||
} mm_idx_intv1_t;
|
||||
|
||||
typedef struct mm_idx_intv_s {
|
||||
int32_t n, m;
|
||||
mm_idx_intv1_t *a;
|
||||
} mm_idx_intv_t;
|
||||
|
||||
mm_idx_t *mm_idx_init(int w, int k, int b, int flag)
|
||||
{
|
||||
mm_idx_t *mi;
|
||||
@@ -45,13 +55,20 @@ mm_idx_t *mm_idx_init(int w, int k, int b, int flag)
|
||||
|
||||
void mm_idx_destroy(mm_idx_t *mi)
|
||||
{
|
||||
int i;
|
||||
uint32_t i;
|
||||
if (mi == 0) return;
|
||||
if (mi->h) kh_destroy(str, (khash_t(str)*)mi->h);
|
||||
for (i = 0; i < 1<<mi->b; ++i) {
|
||||
free(mi->B[i].p);
|
||||
free(mi->B[i].a.a);
|
||||
kh_destroy(idx, (idxhash_t*)mi->B[i].h);
|
||||
if (mi->B) {
|
||||
for (i = 0; i < 1U<<mi->b; ++i) {
|
||||
free(mi->B[i].p);
|
||||
free(mi->B[i].a.a);
|
||||
kh_destroy(idx, (idxhash_t*)mi->B[i].h);
|
||||
}
|
||||
}
|
||||
if (mi->I) {
|
||||
for (i = 0; i < mi->n_seq; ++i)
|
||||
free(mi->I[i].a);
|
||||
free(mi->I);
|
||||
}
|
||||
if (!mi->km) {
|
||||
for (i = 0; i < mi->n_seq; ++i)
|
||||
@@ -82,14 +99,15 @@ const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n)
|
||||
|
||||
void mm_idx_stat(const mm_idx_t *mi)
|
||||
{
|
||||
int i, n = 0, n1 = 0;
|
||||
int n = 0, n1 = 0;
|
||||
uint32_t i;
|
||||
uint64_t sum = 0, len = 0;
|
||||
fprintf(stderr, "[M::%s] kmer size: %d; skip: %d; is_hpc: %d; #seq: %d\n", __func__, mi->k, mi->w, mi->flag&MM_I_HPC, mi->n_seq);
|
||||
for (i = 0; i < mi->n_seq; ++i)
|
||||
len += mi->seq[i].len;
|
||||
for (i = 0; i < 1<<mi->b; ++i)
|
||||
for (i = 0; i < 1U<<mi->b; ++i)
|
||||
if (mi->B[i].h) n += kh_size((idxhash_t*)mi->B[i].h);
|
||||
for (i = 0; i < 1<<mi->b; ++i) {
|
||||
for (i = 0; i < 1U<<mi->b; ++i) {
|
||||
idxhash_t *h = (idxhash_t*)mi->B[i].h;
|
||||
khint_t k;
|
||||
if (h == 0) continue;
|
||||
@@ -99,8 +117,8 @@ void mm_idx_stat(const mm_idx_t *mi)
|
||||
if (kh_key(h, k)&1) ++n1;
|
||||
}
|
||||
}
|
||||
fprintf(stderr, "[M::%s::%.3f*%.2f] distinct minimizers: %d (%.2f%% are singletons); average occurrences: %.3lf; average spacing: %.3lf\n",
|
||||
__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), n, 100.0*n1/n, (double)sum / n, (double)len / sum);
|
||||
fprintf(stderr, "[M::%s::%.3f*%.2f] distinct minimizers: %d (%.2f%% are singletons); average occurrences: %.3lf; average spacing: %.3lf; total length: %ld\n",
|
||||
__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), n, 100.0*n1/n, (double)sum / n, (double)len / sum, (long)len);
|
||||
}
|
||||
|
||||
int mm_idx_index_name(mm_idx_t *mi)
|
||||
@@ -172,7 +190,8 @@ int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f)
|
||||
|
||||
static void worker_post(void *g, long i, int tid)
|
||||
{
|
||||
int j, start_a, start_p, n, n_keys;
|
||||
int n, n_keys;
|
||||
size_t j, start_a, start_p;
|
||||
idxhash_t *h;
|
||||
mm_idx_t *mi = (mm_idx_t*)g;
|
||||
mm_idx_bucket_t *b = &mi->B[i];
|
||||
@@ -200,7 +219,7 @@ static void worker_post(void *g, long i, int tid)
|
||||
int absent;
|
||||
mm128_t *p = &b->a.a[j-1];
|
||||
itr = kh_put(idx, h, p->x>>8>>mi->b<<1, &absent);
|
||||
assert(absent && j - start_a == n);
|
||||
assert(absent && j == start_a + n);
|
||||
if (n == 1) {
|
||||
kh_key(h, itr) |= 1;
|
||||
kh_val(h, itr) = p->y;
|
||||
@@ -216,7 +235,7 @@ static void worker_post(void *g, long i, int tid)
|
||||
} else ++n;
|
||||
}
|
||||
b->h = h;
|
||||
assert(b->n == start_p);
|
||||
assert(b->n == (int32_t)start_p);
|
||||
|
||||
// deallocate and clear b->a
|
||||
kfree(0, b->a.a);
|
||||
@@ -297,6 +316,7 @@ static void *worker_pipeline(void *shared, int step, void *in)
|
||||
} else seq->name = 0;
|
||||
seq->len = s->seq[i].l_seq;
|
||||
seq->offset = p->sum_len;
|
||||
seq->is_alt = 0;
|
||||
// copy the sequence
|
||||
if (!(p->mi->flag & MM_I_NO_SEQ)) {
|
||||
for (j = 0; j < seq->len; ++j) { // TODO: this is not the fastest way, but let's first see if speed matters here
|
||||
@@ -336,7 +356,7 @@ mm_idx_t *mm_idx_gen(mm_bseq_file_t *fp, int w, int k, int b, int flag, int mini
|
||||
pipeline_t pl;
|
||||
if (fp == 0 || mm_bseq_eof(fp)) return 0;
|
||||
memset(&pl, 0, sizeof(pipeline_t));
|
||||
pl.mini_batch_size = mini_batch_size < batch_size? mini_batch_size : batch_size;
|
||||
pl.mini_batch_size = (uint64_t)mini_batch_size < batch_size? mini_batch_size : batch_size;
|
||||
pl.batch_size = batch_size;
|
||||
pl.fp = fp;
|
||||
pl.mi = mm_idx_init(w, k, b, flag);
|
||||
@@ -368,7 +388,9 @@ mm_idx_t *mm_idx_str(int w, int k, int is_hpc, int bucket_bits, int n, const cha
|
||||
uint64_t sum_len = 0;
|
||||
mm128_v a = {0,0,0};
|
||||
mm_idx_t *mi;
|
||||
khash_t(str) *h;
|
||||
int i, flag = 0;
|
||||
|
||||
if (n <= 0) return 0;
|
||||
for (i = 0; i < n; ++i) // get the total length
|
||||
sum_len += strlen(seq[i]);
|
||||
@@ -379,16 +401,21 @@ mm_idx_t *mm_idx_str(int w, int k, int is_hpc, int bucket_bits, int n, const cha
|
||||
mi->n_seq = n;
|
||||
mi->seq = (mm_idx_seq_t*)kcalloc(mi->km, n, sizeof(mm_idx_seq_t)); // ->seq is allocated from km
|
||||
mi->S = (uint32_t*)calloc((sum_len + 7) / 8, 4);
|
||||
mi->h = h = kh_init(str);
|
||||
for (i = 0, sum_len = 0; i < n; ++i) {
|
||||
const char *s = seq[i];
|
||||
mm_idx_seq_t *p = &mi->seq[i];
|
||||
uint32_t j;
|
||||
if (name && name[i]) {
|
||||
int absent;
|
||||
p->name = (char*)kmalloc(mi->km, strlen(name[i]) + 1);
|
||||
strcpy(p->name, name[i]);
|
||||
kh_put(str, h, p->name, &absent);
|
||||
assert(absent);
|
||||
}
|
||||
p->offset = sum_len;
|
||||
p->len = strlen(s);
|
||||
p->is_alt = 0;
|
||||
for (j = 0; j < p->len; ++j) {
|
||||
int c = seq_nt4_table[(uint8_t)s[j]];
|
||||
uint64_t o = sum_len + j;
|
||||
@@ -413,17 +440,20 @@ mm_idx_t *mm_idx_str(int w, int k, int is_hpc, int bucket_bits, int n, const cha
|
||||
void mm_idx_dump(FILE *fp, const mm_idx_t *mi)
|
||||
{
|
||||
uint64_t sum_len = 0;
|
||||
uint32_t x[5];
|
||||
int i;
|
||||
uint32_t x[5], i;
|
||||
|
||||
x[0] = mi->w, x[1] = mi->k, x[2] = mi->b, x[3] = mi->n_seq, x[4] = mi->flag;
|
||||
fwrite(MM_IDX_MAGIC, 1, 4, fp);
|
||||
fwrite(x, 4, 5, fp);
|
||||
for (i = 0; i < mi->n_seq; ++i) {
|
||||
uint8_t l;
|
||||
l = strlen(mi->seq[i].name);
|
||||
fwrite(&l, 1, 1, fp);
|
||||
fwrite(mi->seq[i].name, 1, l, fp);
|
||||
if (mi->seq[i].name) {
|
||||
uint8_t l = strlen(mi->seq[i].name);
|
||||
fwrite(&l, 1, 1, fp);
|
||||
fwrite(mi->seq[i].name, 1, l, fp);
|
||||
} else {
|
||||
uint8_t l = 0;
|
||||
fwrite(&l, 1, 1, fp);
|
||||
}
|
||||
fwrite(&mi->seq[i].len, 4, 1, fp);
|
||||
sum_len += mi->seq[i].len;
|
||||
}
|
||||
@@ -450,9 +480,8 @@ void mm_idx_dump(FILE *fp, const mm_idx_t *mi)
|
||||
|
||||
mm_idx_t *mm_idx_load(FILE *fp)
|
||||
{
|
||||
int i;
|
||||
char magic[4];
|
||||
uint32_t x[5];
|
||||
uint32_t x[5], i;
|
||||
uint64_t sum_len = 0;
|
||||
mm_idx_t *mi;
|
||||
|
||||
@@ -466,11 +495,14 @@ mm_idx_t *mm_idx_load(FILE *fp)
|
||||
uint8_t l;
|
||||
mm_idx_seq_t *s = &mi->seq[i];
|
||||
fread(&l, 1, 1, fp);
|
||||
s->name = (char*)kmalloc(mi->km, l + 1);
|
||||
fread(s->name, 1, l, fp);
|
||||
s->name[l] = 0;
|
||||
if (l) {
|
||||
s->name = (char*)kmalloc(mi->km, l + 1);
|
||||
fread(s->name, 1, l, fp);
|
||||
s->name[l] = 0;
|
||||
}
|
||||
fread(&s->len, 4, 1, fp);
|
||||
s->offset = sum_len;
|
||||
s->is_alt = 0;
|
||||
sum_len += s->len;
|
||||
}
|
||||
for (i = 0; i < 1<<mi->b; ++i) {
|
||||
@@ -504,14 +536,19 @@ mm_idx_t *mm_idx_load(FILE *fp)
|
||||
int64_t mm_idx_is_idx(const char *fn)
|
||||
{
|
||||
int fd, is_idx = 0;
|
||||
off_t ret, off_end;
|
||||
int64_t ret, off_end;
|
||||
char magic[4];
|
||||
|
||||
if (strcmp(fn, "-") == 0) return 0; // read from pipe; not an index
|
||||
fd = open(fn, O_RDONLY);
|
||||
if (fd < 0) return -1; // error
|
||||
#ifdef WIN32
|
||||
if ((off_end = _lseeki64(fd, 0, SEEK_END)) >= 4) {
|
||||
_lseeki64(fd, 0, SEEK_SET);
|
||||
#else
|
||||
if ((off_end = lseek(fd, 0, SEEK_END)) >= 4) {
|
||||
lseek(fd, 0, SEEK_SET);
|
||||
#endif // WIN32
|
||||
ret = read(fd, magic, 4);
|
||||
if (ret == 4 && strncmp(magic, MM_IDX_MAGIC, 4) == 0)
|
||||
is_idx = 1;
|
||||
@@ -557,7 +594,7 @@ mm_idx_t *mm_idx_reader_read(mm_idx_reader_t *r, int n_threads)
|
||||
mi = mm_idx_gen(r->fp.seq, r->opt.w, r->opt.k, r->opt.bucket_bits, r->opt.flag, r->opt.mini_batch_size, n_threads, r->opt.batch_size);
|
||||
if (mi) {
|
||||
if (r->fp_out) mm_idx_dump(r->fp_out, mi);
|
||||
++r->n_parts;
|
||||
mi->index = r->n_parts++;
|
||||
}
|
||||
return mi;
|
||||
}
|
||||
@@ -566,3 +603,151 @@ int mm_idx_reader_eof(const mm_idx_reader_t *r) // TODO: in extremely rare cases
|
||||
{
|
||||
return r->is_idx? (feof(r->fp.idx) || ftell(r->fp.idx) == r->idx_size) : mm_bseq_eof(r->fp.seq);
|
||||
}
|
||||
|
||||
#include <ctype.h>
|
||||
#include <zlib.h>
|
||||
#include "ksort.h"
|
||||
#include "kseq.h"
|
||||
KSTREAM_DECLARE(gzFile, gzread)
|
||||
|
||||
int mm_idx_alt_read(mm_idx_t *mi, const char *fn)
|
||||
{
|
||||
int n_alt = 0;
|
||||
gzFile fp;
|
||||
kstream_t *ks;
|
||||
kstring_t str = {0,0,0};
|
||||
fp = fn && strcmp(fn, "-")? gzopen(fn, "r") : gzdopen(fileno(stdin), "r");
|
||||
if (fp == 0) return -1;
|
||||
ks = ks_init(fp);
|
||||
if (mi->h == 0) mm_idx_index_name(mi);
|
||||
while (ks_getuntil(ks, KS_SEP_LINE, &str, 0) >= 0) {
|
||||
char *p;
|
||||
int id;
|
||||
for (p = str.s; *p && !isspace(*p); ++p) { }
|
||||
*p = 0;
|
||||
id = mm_idx_name2id(mi, str.s);
|
||||
if (id >= 0) mi->seq[id].is_alt = 1, ++n_alt;
|
||||
}
|
||||
mi->n_alt = n_alt;
|
||||
if (mm_verbose >= 3)
|
||||
fprintf(stderr, "[M::%s] found %d ALT contigs\n", __func__, n_alt);
|
||||
return n_alt;
|
||||
}
|
||||
|
||||
#define sort_key_bed(a) ((a).st)
|
||||
KRADIX_SORT_INIT(bed, mm_idx_intv1_t, sort_key_bed, 4)
|
||||
|
||||
mm_idx_intv_t *mm_idx_read_bed(const mm_idx_t *mi, const char *fn, int read_junc)
|
||||
{
|
||||
gzFile fp;
|
||||
kstream_t *ks;
|
||||
kstring_t str = {0,0,0};
|
||||
mm_idx_intv_t *I;
|
||||
|
||||
fp = fn && strcmp(fn, "-")? gzopen(fn, "r") : gzdopen(fileno(stdin), "r");
|
||||
if (fp == 0) return 0;
|
||||
I = (mm_idx_intv_t*)calloc(mi->n_seq, sizeof(*I));
|
||||
ks = ks_init(fp);
|
||||
while (ks_getuntil(ks, KS_SEP_LINE, &str, 0) >= 0) {
|
||||
mm_idx_intv_t *r;
|
||||
mm_idx_intv1_t t = {-1,-1,-1,-1,0};
|
||||
char *p, *q, *bl, *bs;
|
||||
int32_t i, id = -1, n_blk = 0;
|
||||
for (p = q = str.s, i = 0;; ++p) {
|
||||
if (*p == 0 || *p == '\t') {
|
||||
int32_t c = *p;
|
||||
*p = 0;
|
||||
if (i == 0) { // chr
|
||||
id = mm_idx_name2id(mi, q);
|
||||
if (id < 0) break; // unknown name; TODO: throw a warning
|
||||
} else if (i == 1) { // start
|
||||
t.st = atol(q); // TODO: watch out integer overflow!
|
||||
if (t.st < 0) break;
|
||||
} else if (i == 2) { // end
|
||||
t.en = atol(q);
|
||||
if (t.en < 0) break;
|
||||
} else if (i == 4) { // BED score
|
||||
t.score = atol(q);
|
||||
} else if (i == 5) { // strand
|
||||
t.strand = *q == '+'? 1 : *q == '-'? -1 : 0;
|
||||
} else if (i == 9) {
|
||||
if (!isdigit(*q)) break;
|
||||
n_blk = atol(q);
|
||||
} else if (i == 10) {
|
||||
bl = q;
|
||||
} else if (i == 11) {
|
||||
bs = q;
|
||||
break;
|
||||
}
|
||||
if (c == 0) break;
|
||||
++i, q = p + 1;
|
||||
}
|
||||
}
|
||||
if (id < 0 || t.st < 0 || t.st >= t.en) continue;
|
||||
r = &I[id];
|
||||
if (i >= 11 && read_junc) { // BED12
|
||||
int32_t st, sz, en;
|
||||
st = strtol(bs, &bs, 10); ++bs;
|
||||
sz = strtol(bl, &bl, 10); ++bl;
|
||||
en = t.st + st + sz;
|
||||
for (i = 1; i < n_blk; ++i) {
|
||||
mm_idx_intv1_t s = t;
|
||||
if (r->n == r->m) {
|
||||
r->m = r->m? r->m + (r->m>>1) : 16;
|
||||
r->a = (mm_idx_intv1_t*)realloc(r->a, sizeof(*r->a) * r->m);
|
||||
}
|
||||
st = strtol(bs, &bs, 10); ++bs;
|
||||
sz = strtol(bl, &bl, 10); ++bl;
|
||||
s.st = en, s.en = t.st + st;
|
||||
en = t.st + st + sz;
|
||||
if (s.en > s.st) r->a[r->n++] = s;
|
||||
}
|
||||
} else {
|
||||
if (r->n == r->m) {
|
||||
r->m = r->m? r->m + (r->m>>1) : 16;
|
||||
r->a = (mm_idx_intv1_t*)realloc(r->a, sizeof(*r->a) * r->m);
|
||||
}
|
||||
r->a[r->n++] = t;
|
||||
}
|
||||
}
|
||||
free(str.s);
|
||||
ks_destroy(ks);
|
||||
gzclose(fp);
|
||||
return I;
|
||||
}
|
||||
|
||||
int mm_idx_bed_read(mm_idx_t *mi, const char *fn, int read_junc)
|
||||
{
|
||||
int32_t i;
|
||||
if (mi->h == 0) mm_idx_index_name(mi);
|
||||
mi->I = mm_idx_read_bed(mi, fn, read_junc);
|
||||
if (mi->I == 0) return -1;
|
||||
for (i = 0; i < mi->n_seq; ++i) // TODO: eliminate redundant intervals
|
||||
radix_sort_bed(mi->I[i].a, mi->I[i].a + mi->I[i].n);
|
||||
return 0;
|
||||
}
|
||||
|
||||
int mm_idx_bed_junc(const mm_idx_t *mi, int32_t ctg, int32_t st, int32_t en, uint8_t *s)
|
||||
{
|
||||
int32_t i, left, right;
|
||||
mm_idx_intv_t *r;
|
||||
memset(s, 0, en - st);
|
||||
if (mi->I == 0 || ctg < 0 || ctg >= mi->n_seq) return -1;
|
||||
r = &mi->I[ctg];
|
||||
left = 0, right = r->n;
|
||||
while (right > left) {
|
||||
int32_t mid = left + ((right - left) >> 1);
|
||||
if (r->a[mid].st >= st) right = mid;
|
||||
else left = mid + 1;
|
||||
}
|
||||
for (i = left; i < r->n; ++i) {
|
||||
if (st <= r->a[i].st && en >= r->a[i].en && r->a[i].strand != 0) {
|
||||
if (r->a[i].strand > 0) {
|
||||
s[r->a[i].st - st] |= 1, s[r->a[i].en - 1 - st] |= 2;
|
||||
} else {
|
||||
s[r->a[i].st - st] |= 8, s[r->a[i].en - 1 - st] |= 4;
|
||||
}
|
||||
}
|
||||
}
|
||||
return left;
|
||||
}
|
||||
|
||||
@@ -18,15 +18,14 @@
|
||||
* | | | |
|
||||
* p=p->ptr->ptr->ptr->ptr p->ptr p->ptr->ptr p->ptr->ptr->ptr
|
||||
*/
|
||||
|
||||
#define MIN_CORE_SIZE 0x80000
|
||||
|
||||
typedef struct header_t {
|
||||
size_t size;
|
||||
struct header_t *ptr;
|
||||
} header_t;
|
||||
|
||||
typedef struct {
|
||||
void *par;
|
||||
size_t min_core_size;
|
||||
header_t base, *loop_head, *core_head; /* base is a zero-sized block always kept in the loop */
|
||||
} kmem_t;
|
||||
|
||||
@@ -36,31 +35,39 @@ static void panic(const char *s)
|
||||
abort();
|
||||
}
|
||||
|
||||
void *km_init(void)
|
||||
void *km_init2(void *km_par, size_t min_core_size)
|
||||
{
|
||||
return calloc(1, sizeof(kmem_t));
|
||||
kmem_t *km;
|
||||
km = (kmem_t*)kcalloc(km_par, 1, sizeof(kmem_t));
|
||||
km->par = km_par;
|
||||
km->min_core_size = min_core_size > 0? min_core_size : 0x80000;
|
||||
return (void*)km;
|
||||
}
|
||||
|
||||
void *km_init(void) { return km_init2(0, 0); }
|
||||
|
||||
void km_destroy(void *_km)
|
||||
{
|
||||
kmem_t *km = (kmem_t*)_km;
|
||||
void *km_par;
|
||||
header_t *p, *q;
|
||||
if (km == NULL) return;
|
||||
km_par = km->par;
|
||||
for (p = km->core_head; p != NULL;) {
|
||||
q = p->ptr;
|
||||
free(p);
|
||||
kfree(km_par, p);
|
||||
p = q;
|
||||
}
|
||||
free(km);
|
||||
kfree(km_par, km);
|
||||
}
|
||||
|
||||
static header_t *morecore(kmem_t *km, size_t nu)
|
||||
{
|
||||
header_t *q;
|
||||
size_t bytes, *p;
|
||||
nu = (nu + 1 + (MIN_CORE_SIZE - 1)) / MIN_CORE_SIZE * MIN_CORE_SIZE; /* the first +1 for core header */
|
||||
nu = (nu + 1 + (km->min_core_size - 1)) / km->min_core_size * km->min_core_size; /* the first +1 for core header */
|
||||
bytes = nu * sizeof(header_t);
|
||||
q = (header_t*)malloc(bytes);
|
||||
q = (header_t*)kmalloc(km->par, bytes);
|
||||
if (!q) panic("[morecore] insufficient memory");
|
||||
q->ptr = km->core_head, q->size = nu, km->core_head = q;
|
||||
p = (size_t*)(q + 1);
|
||||
@@ -125,7 +132,7 @@ void *kmalloc(void *_km, size_t n_bytes)
|
||||
|
||||
if (n_bytes == 0) return 0;
|
||||
if (km == NULL) return malloc(n_bytes);
|
||||
n_units = (n_bytes + sizeof(size_t) + sizeof(header_t) - 1) / sizeof(header_t) + 1;
|
||||
n_units = (n_bytes + sizeof(size_t) + sizeof(header_t) - 1) / sizeof(header_t); /* header+n_bytes requires at least this number of units */
|
||||
|
||||
if (!(q = km->loop_head)) /* the first time when kmalloc() is called, intialize it */
|
||||
q = km->loop_head = km->base.ptr = &km->base;
|
||||
@@ -160,18 +167,18 @@ void *kcalloc(void *_km, size_t count, size_t size)
|
||||
void *krealloc(void *_km, void *ap, size_t n_bytes) // TODO: this can be made more efficient in principle
|
||||
{
|
||||
kmem_t *km = (kmem_t*)_km;
|
||||
size_t n_units, *p, *q;
|
||||
size_t cap, *p, *q;
|
||||
|
||||
if (n_bytes == 0) {
|
||||
kfree(km, ap); return 0;
|
||||
}
|
||||
if (km == NULL) return realloc(ap, n_bytes);
|
||||
if (ap == NULL) return kmalloc(km, n_bytes);
|
||||
n_units = (n_bytes + sizeof(size_t) + sizeof(header_t) - 1) / sizeof(header_t);
|
||||
p = (size_t*)ap - 1;
|
||||
if (*p >= n_units) return ap; /* TODO: this prevents shrinking */
|
||||
cap = (*p) * sizeof(header_t) - sizeof(size_t);
|
||||
if (cap >= n_bytes) return ap; /* TODO: this prevents shrinking */
|
||||
q = (size_t*)kmalloc(km, n_bytes);
|
||||
memcpy(q, ap, (*p - 1) * sizeof(header_t));
|
||||
memcpy(q, ap, cap);
|
||||
kfree(km, ap);
|
||||
return q;
|
||||
}
|
||||
|
||||
@@ -17,6 +17,7 @@ void *kcalloc(void *km, size_t count, size_t size);
|
||||
void kfree(void *km, void *ptr);
|
||||
|
||||
void *km_init(void);
|
||||
void *km_init2(void *km_par, size_t min_core_size);
|
||||
void km_destroy(void *km);
|
||||
void km_stat(const void *_km, km_stat_t *s);
|
||||
|
||||
@@ -24,4 +25,52 @@ void km_stat(const void *_km, km_stat_t *s);
|
||||
}
|
||||
#endif
|
||||
|
||||
#define KMALLOC(km, ptr, len) ((ptr) = (__typeof__(ptr))kmalloc((km), (len) * sizeof(*(ptr))))
|
||||
#define KCALLOC(km, ptr, len) ((ptr) = (__typeof__(ptr))kcalloc((km), (len), sizeof(*(ptr))))
|
||||
#define KREALLOC(km, ptr, len) ((ptr) = (__typeof__(ptr))krealloc((km), (ptr), (len) * sizeof(*(ptr))))
|
||||
|
||||
#define KEXPAND(km, a, m) do { \
|
||||
(m) = (m) >= 4? (m) + ((m)>>1) : 16; \
|
||||
KREALLOC((km), (a), (m)); \
|
||||
} while (0)
|
||||
|
||||
#ifndef klib_unused
|
||||
#if (defined __clang__ && __clang_major__ >= 3) || (defined __GNUC__ && __GNUC__ >= 3)
|
||||
#define klib_unused __attribute__ ((__unused__))
|
||||
#else
|
||||
#define klib_unused
|
||||
#endif
|
||||
#endif /* klib_unused */
|
||||
|
||||
#define KALLOC_POOL_INIT2(SCOPE, name, kmptype_t) \
|
||||
typedef struct { \
|
||||
size_t cnt, n, max; \
|
||||
kmptype_t **buf; \
|
||||
void *km; \
|
||||
} kmp_##name##_t; \
|
||||
SCOPE kmp_##name##_t *kmp_init_##name(void *km) { \
|
||||
kmp_##name##_t *mp; \
|
||||
KCALLOC(km, mp, 1); \
|
||||
mp->km = km; \
|
||||
return mp; \
|
||||
} \
|
||||
SCOPE void kmp_destroy_##name(kmp_##name##_t *mp) { \
|
||||
size_t k; \
|
||||
for (k = 0; k < mp->n; ++k) kfree(mp->km, mp->buf[k]); \
|
||||
kfree(mp->km, mp->buf); kfree(mp->km, mp); \
|
||||
} \
|
||||
SCOPE kmptype_t *kmp_alloc_##name(kmp_##name##_t *mp) { \
|
||||
++mp->cnt; \
|
||||
if (mp->n == 0) return (kmptype_t*)kcalloc(mp->km, 1, sizeof(kmptype_t)); \
|
||||
return mp->buf[--mp->n]; \
|
||||
} \
|
||||
SCOPE void kmp_free_##name(kmp_##name##_t *mp, kmptype_t *p) { \
|
||||
--mp->cnt; \
|
||||
if (mp->n == mp->max) KEXPAND(mp->km, mp->buf, mp->max); \
|
||||
mp->buf[mp->n++] = p; \
|
||||
}
|
||||
|
||||
#define KALLOC_POOL_INIT(name, kmptype_t) \
|
||||
KALLOC_POOL_INIT2(static inline klib_unused, name, kmptype_t)
|
||||
|
||||
#endif
|
||||
|
||||
@@ -0,0 +1,120 @@
|
||||
#ifndef KETOPT_H
|
||||
#define KETOPT_H
|
||||
|
||||
#include <string.h> /* for strchr() and strncmp() */
|
||||
|
||||
#define ko_no_argument 0
|
||||
#define ko_required_argument 1
|
||||
#define ko_optional_argument 2
|
||||
|
||||
typedef struct {
|
||||
int ind; /* equivalent to optind */
|
||||
int opt; /* equivalent to optopt */
|
||||
char *arg; /* equivalent to optarg */
|
||||
int longidx; /* index of a long option; or -1 if short */
|
||||
/* private variables not intended for external uses */
|
||||
int i, pos, n_args;
|
||||
} ketopt_t;
|
||||
|
||||
typedef struct {
|
||||
char *name;
|
||||
int has_arg;
|
||||
int val;
|
||||
} ko_longopt_t;
|
||||
|
||||
static ketopt_t KETOPT_INIT = { 1, 0, 0, -1, 1, 0, 0 };
|
||||
|
||||
static void ketopt_permute(char *argv[], int j, int n) /* move argv[j] over n elements to the left */
|
||||
{
|
||||
int k;
|
||||
char *p = argv[j];
|
||||
for (k = 0; k < n; ++k)
|
||||
argv[j - k] = argv[j - k - 1];
|
||||
argv[j - k] = p;
|
||||
}
|
||||
|
||||
/**
|
||||
* Parse command-line options and arguments
|
||||
*
|
||||
* This fuction has a similar interface to GNU's getopt_long(). Each call
|
||||
* parses one option and returns the option name. s->arg points to the option
|
||||
* argument if present. The function returns -1 when all command-line arguments
|
||||
* are parsed. In this case, s->ind is the index of the first non-option
|
||||
* argument.
|
||||
*
|
||||
* @param s status; shall be initialized to KETOPT_INIT on the first call
|
||||
* @param argc length of argv[]
|
||||
* @param argv list of command-line arguments; argv[0] is ignored
|
||||
* @param permute non-zero to move options ahead of non-option arguments
|
||||
* @param ostr option string
|
||||
* @param longopts long options
|
||||
*
|
||||
* @return ASCII for a short option; ko_longopt_t::val for a long option; -1 if
|
||||
* argv[] is fully processed; '?' for an unknown option or an ambiguous
|
||||
* long option; ':' if an option argument is missing
|
||||
*/
|
||||
static int ketopt(ketopt_t *s, int argc, char *argv[], int permute, const char *ostr, const ko_longopt_t *longopts)
|
||||
{
|
||||
int opt = -1, i0, j;
|
||||
if (permute) {
|
||||
while (s->i < argc && (argv[s->i][0] != '-' || argv[s->i][1] == '\0'))
|
||||
++s->i, ++s->n_args;
|
||||
}
|
||||
s->arg = 0, s->longidx = -1, i0 = s->i;
|
||||
if (s->i >= argc || argv[s->i][0] != '-' || argv[s->i][1] == '\0') {
|
||||
s->ind = s->i - s->n_args;
|
||||
return -1;
|
||||
}
|
||||
if (argv[s->i][0] == '-' && argv[s->i][1] == '-') { /* "--" or a long option */
|
||||
if (argv[s->i][2] == '\0') { /* a bare "--" */
|
||||
ketopt_permute(argv, s->i, s->n_args);
|
||||
++s->i, s->ind = s->i - s->n_args;
|
||||
return -1;
|
||||
}
|
||||
s->opt = 0, opt = '?', s->pos = -1;
|
||||
if (longopts) { /* parse long options */
|
||||
int k, n_exact = 0, n_partial = 0;
|
||||
const ko_longopt_t *o = 0, *o_exact = 0, *o_partial = 0;
|
||||
for (j = 2; argv[s->i][j] != '\0' && argv[s->i][j] != '='; ++j) {} /* find the end of the option name */
|
||||
for (k = 0; longopts[k].name != 0; ++k)
|
||||
if (strncmp(&argv[s->i][2], longopts[k].name, j - 2) == 0) {
|
||||
if (longopts[k].name[j - 2] == 0) ++n_exact, o_exact = &longopts[k];
|
||||
else ++n_partial, o_partial = &longopts[k];
|
||||
}
|
||||
if (n_exact > 1 || (n_exact == 0 && n_partial > 1)) return '?';
|
||||
o = n_exact == 1? o_exact : n_partial == 1? o_partial : 0;
|
||||
if (o) {
|
||||
s->opt = opt = o->val, s->longidx = o - longopts;
|
||||
if (argv[s->i][j] == '=') s->arg = &argv[s->i][j + 1];
|
||||
if (o->has_arg == 1 && argv[s->i][j] == '\0') {
|
||||
if (s->i < argc - 1) s->arg = argv[++s->i];
|
||||
else opt = ':'; /* missing option argument */
|
||||
}
|
||||
}
|
||||
}
|
||||
} else { /* a short option */
|
||||
char *p;
|
||||
if (s->pos == 0) s->pos = 1;
|
||||
opt = s->opt = argv[s->i][s->pos++];
|
||||
p = strchr((char*)ostr, opt);
|
||||
if (p == 0) {
|
||||
opt = '?'; /* unknown option */
|
||||
} else if (p[1] == ':') {
|
||||
if (argv[s->i][s->pos] == 0) {
|
||||
if (s->i < argc - 1) s->arg = argv[++s->i];
|
||||
else opt = ':'; /* missing option argument */
|
||||
} else s->arg = &argv[s->i][s->pos];
|
||||
s->pos = -1;
|
||||
}
|
||||
}
|
||||
if (s->pos < 0 || argv[s->i][s->pos] == 0) {
|
||||
++s->i, s->pos = 0;
|
||||
if (s->n_args > 0) /* permute */
|
||||
for (j = i0; j < s->i; ++j)
|
||||
ketopt_permute(argv, j, s->n_args);
|
||||
}
|
||||
s->ind = s->i - s->n_args;
|
||||
return opt;
|
||||
}
|
||||
|
||||
#endif
|
||||
@@ -0,0 +1,474 @@
|
||||
/* The MIT License
|
||||
|
||||
Copyright (c) 2019 by Attractive Chaos <attractor@live.co.uk>
|
||||
|
||||
Permission is hereby granted, free of charge, to any person obtaining
|
||||
a copy of this software and associated documentation files (the
|
||||
"Software"), to deal in the Software without restriction, including
|
||||
without limitation the rights to use, copy, modify, merge, publish,
|
||||
distribute, sublicense, and/or sell copies of the Software, and to
|
||||
permit persons to whom the Software is furnished to do so, subject to
|
||||
the following conditions:
|
||||
|
||||
The above copyright notice and this permission notice shall be
|
||||
included in all copies or substantial portions of the Software.
|
||||
|
||||
THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
|
||||
EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
|
||||
MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
|
||||
NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS
|
||||
BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN
|
||||
ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN
|
||||
CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
|
||||
SOFTWARE.
|
||||
*/
|
||||
|
||||
/* An example:
|
||||
|
||||
#include <stdio.h>
|
||||
#include <string.h>
|
||||
#include <stdlib.h>
|
||||
#include "krmq.h"
|
||||
|
||||
struct my_node {
|
||||
char key;
|
||||
KRMQ_HEAD(struct my_node) head;
|
||||
};
|
||||
#define my_cmp(p, q) (((q)->key < (p)->key) - ((p)->key < (q)->key))
|
||||
KRMQ_INIT(my, struct my_node, head, my_cmp)
|
||||
|
||||
int main(void) {
|
||||
const char *str = "MNOLKQOPHIA"; // from wiki, except a duplicate
|
||||
struct my_node *root = 0;
|
||||
int i, l = strlen(str);
|
||||
for (i = 0; i < l; ++i) { // insert in the input order
|
||||
struct my_node *q, *p = malloc(sizeof(*p));
|
||||
p->key = str[i];
|
||||
q = krmq_insert(my, &root, p, 0);
|
||||
if (p != q) free(p); // if already present, free
|
||||
}
|
||||
krmq_itr_t(my) itr;
|
||||
krmq_itr_first(my, root, &itr); // place at first
|
||||
do { // traverse
|
||||
const struct my_node *p = krmq_at(&itr);
|
||||
putchar(p->key);
|
||||
free((void*)p); // free node
|
||||
} while (krmq_itr_next(my, &itr));
|
||||
putchar('\n');
|
||||
return 0;
|
||||
}
|
||||
*/
|
||||
|
||||
#ifndef KRMQ_H
|
||||
#define KRMQ_H
|
||||
|
||||
#ifdef __STRICT_ANSI__
|
||||
#define inline __inline__
|
||||
#endif
|
||||
|
||||
#define KRMQ_MAX_DEPTH 64
|
||||
|
||||
#define krmq_size(head, p) ((p)? (p)->head.size : 0)
|
||||
#define krmq_size_child(head, q, i) ((q)->head.p[(i)]? (q)->head.p[(i)]->head.size : 0)
|
||||
|
||||
#define KRMQ_HEAD(__type) \
|
||||
struct { \
|
||||
__type *p[2], *s; \
|
||||
signed char balance; /* balance factor */ \
|
||||
unsigned size; /* #elements in subtree */ \
|
||||
}
|
||||
|
||||
#define __KRMQ_FIND(suf, __scope, __type, __head, __cmp) \
|
||||
__scope __type *krmq_find_##suf(const __type *root, const __type *x, unsigned *cnt_) { \
|
||||
const __type *p = root; \
|
||||
unsigned cnt = 0; \
|
||||
while (p != 0) { \
|
||||
int cmp; \
|
||||
cmp = __cmp(x, p); \
|
||||
if (cmp >= 0) cnt += krmq_size_child(__head, p, 0) + 1; \
|
||||
if (cmp < 0) p = p->__head.p[0]; \
|
||||
else if (cmp > 0) p = p->__head.p[1]; \
|
||||
else break; \
|
||||
} \
|
||||
if (cnt_) *cnt_ = cnt; \
|
||||
return (__type*)p; \
|
||||
} \
|
||||
__scope __type *krmq_interval_##suf(const __type *root, const __type *x, __type **lower, __type **upper) { \
|
||||
const __type *p = root, *l = 0, *u = 0; \
|
||||
while (p != 0) { \
|
||||
int cmp; \
|
||||
cmp = __cmp(x, p); \
|
||||
if (cmp < 0) u = p, p = p->__head.p[0]; \
|
||||
else if (cmp > 0) l = p, p = p->__head.p[1]; \
|
||||
else { l = u = p; break; } \
|
||||
} \
|
||||
if (lower) *lower = (__type*)l; \
|
||||
if (upper) *upper = (__type*)u; \
|
||||
return (__type*)p; \
|
||||
}
|
||||
|
||||
#define __KRMQ_RMQ(suf, __scope, __type, __head, __cmp, __lt2) \
|
||||
__scope __type *krmq_rmq_##suf(const __type *root, const __type *lo, const __type *up) { /* CLOSED interval */ \
|
||||
const __type *p = root, *path[2][KRMQ_MAX_DEPTH], *min; \
|
||||
int plen[2] = {0, 0}, pcmp[2][KRMQ_MAX_DEPTH], i, cmp, lca; \
|
||||
if (root == 0) return 0; \
|
||||
while (p) { \
|
||||
cmp = __cmp(lo, p); \
|
||||
path[0][plen[0]] = p, pcmp[0][plen[0]++] = cmp; \
|
||||
if (cmp < 0) p = p->__head.p[0]; \
|
||||
else if (cmp > 0) p = p->__head.p[1]; \
|
||||
else break; \
|
||||
} \
|
||||
p = root; \
|
||||
while (p) { \
|
||||
cmp = __cmp(up, p); \
|
||||
path[1][plen[1]] = p, pcmp[1][plen[1]++] = cmp; \
|
||||
if (cmp < 0) p = p->__head.p[0]; \
|
||||
else if (cmp > 0) p = p->__head.p[1]; \
|
||||
else break; \
|
||||
} \
|
||||
for (i = 0; i < plen[0] && i < plen[1]; ++i) /* find the LCA */ \
|
||||
if (path[0][i] == path[1][i] && pcmp[0][i] <= 0 && pcmp[1][i] >= 0) \
|
||||
break; \
|
||||
if (i == plen[0] || i == plen[1]) return 0; /* no elements in the closed interval */ \
|
||||
lca = i, min = path[0][lca]; \
|
||||
for (i = lca + 1; i < plen[0]; ++i) { \
|
||||
if (pcmp[0][i] <= 0) { \
|
||||
if (__lt2(path[0][i], min)) min = path[0][i]; \
|
||||
if (path[0][i]->__head.p[1] && __lt2(path[0][i]->__head.p[1]->__head.s, min)) \
|
||||
min = path[0][i]->__head.p[1]->__head.s; \
|
||||
} \
|
||||
} \
|
||||
for (i = lca + 1; i < plen[1]; ++i) { \
|
||||
if (pcmp[1][i] >= 0) { \
|
||||
if (__lt2(path[1][i], min)) min = path[1][i]; \
|
||||
if (path[1][i]->__head.p[0] && __lt2(path[1][i]->__head.p[0]->__head.s, min)) \
|
||||
min = path[1][i]->__head.p[0]->__head.s; \
|
||||
} \
|
||||
} \
|
||||
return (__type*)min; \
|
||||
}
|
||||
|
||||
#define __KRMQ_ROTATE(suf, __type, __head, __lt2) \
|
||||
/* */ \
|
||||
static inline void krmq_update_min_##suf(__type *p, const __type *q, const __type *r) { \
|
||||
p->__head.s = !q || __lt2(p, q->__head.s)? p : q->__head.s; \
|
||||
p->__head.s = !r || __lt2(p->__head.s, r->__head.s)? p->__head.s : r->__head.s; \
|
||||
} \
|
||||
/* one rotation: (a,(b,c)q)p => ((a,b)p,c)q */ \
|
||||
static inline __type *krmq_rotate1_##suf(__type *p, int dir) { /* dir=0 to left; dir=1 to right */ \
|
||||
int opp = 1 - dir; /* opposite direction */ \
|
||||
__type *q = p->__head.p[opp], *s = p->__head.s; \
|
||||
unsigned size_p = p->__head.size; \
|
||||
p->__head.size -= q->__head.size - krmq_size_child(__head, q, dir); \
|
||||
q->__head.size = size_p; \
|
||||
krmq_update_min_##suf(p, p->__head.p[dir], q->__head.p[dir]); \
|
||||
q->__head.s = s; \
|
||||
p->__head.p[opp] = q->__head.p[dir]; \
|
||||
q->__head.p[dir] = p; \
|
||||
return q; \
|
||||
} \
|
||||
/* two consecutive rotations: (a,((b,c)r,d)q)p => ((a,b)p,(c,d)q)r */ \
|
||||
static inline __type *krmq_rotate2_##suf(__type *p, int dir) { \
|
||||
int b1, opp = 1 - dir; \
|
||||
__type *q = p->__head.p[opp], *r = q->__head.p[dir], *s = p->__head.s; \
|
||||
unsigned size_x_dir = krmq_size_child(__head, r, dir); \
|
||||
r->__head.size = p->__head.size; \
|
||||
p->__head.size -= q->__head.size - size_x_dir; \
|
||||
q->__head.size -= size_x_dir + 1; \
|
||||
krmq_update_min_##suf(p, p->__head.p[dir], r->__head.p[dir]); \
|
||||
krmq_update_min_##suf(q, q->__head.p[opp], r->__head.p[opp]); \
|
||||
r->__head.s = s; \
|
||||
p->__head.p[opp] = r->__head.p[dir]; \
|
||||
r->__head.p[dir] = p; \
|
||||
q->__head.p[dir] = r->__head.p[opp]; \
|
||||
r->__head.p[opp] = q; \
|
||||
b1 = dir == 0? +1 : -1; \
|
||||
if (r->__head.balance == b1) q->__head.balance = 0, p->__head.balance = -b1; \
|
||||
else if (r->__head.balance == 0) q->__head.balance = p->__head.balance = 0; \
|
||||
else q->__head.balance = b1, p->__head.balance = 0; \
|
||||
r->__head.balance = 0; \
|
||||
return r; \
|
||||
}
|
||||
|
||||
#define __KRMQ_INSERT(suf, __scope, __type, __head, __cmp, __lt2) \
|
||||
__scope __type *krmq_insert_##suf(__type **root_, __type *x, unsigned *cnt_) { \
|
||||
unsigned char stack[KRMQ_MAX_DEPTH]; \
|
||||
__type *path[KRMQ_MAX_DEPTH]; \
|
||||
__type *bp, *bq; \
|
||||
__type *p, *q, *r = 0; /* _r_ is potentially the new root */ \
|
||||
int i, which = 0, top, b1, path_len; \
|
||||
unsigned cnt = 0; \
|
||||
bp = *root_, bq = 0; \
|
||||
/* find the insertion location */ \
|
||||
for (p = bp, q = bq, top = path_len = 0; p; q = p, p = p->__head.p[which]) { \
|
||||
int cmp; \
|
||||
cmp = __cmp(x, p); \
|
||||
if (cmp >= 0) cnt += krmq_size_child(__head, p, 0) + 1; \
|
||||
if (cmp == 0) { \
|
||||
if (cnt_) *cnt_ = cnt; \
|
||||
return p; \
|
||||
} \
|
||||
if (p->__head.balance != 0) \
|
||||
bq = q, bp = p, top = 0; \
|
||||
stack[top++] = which = (cmp > 0); \
|
||||
path[path_len++] = p; \
|
||||
} \
|
||||
if (cnt_) *cnt_ = cnt; \
|
||||
x->__head.balance = 0, x->__head.size = 1, x->__head.p[0] = x->__head.p[1] = 0, x->__head.s = x; \
|
||||
if (q == 0) *root_ = x; \
|
||||
else q->__head.p[which] = x; \
|
||||
if (bp == 0) return x; \
|
||||
for (i = 0; i < path_len; ++i) ++path[i]->__head.size; \
|
||||
for (i = path_len - 1; i >= 0; --i) { \
|
||||
krmq_update_min_##suf(path[i], path[i]->__head.p[0], path[i]->__head.p[1]); \
|
||||
if (path[i]->__head.s != x) break; \
|
||||
} \
|
||||
for (p = bp, top = 0; p != x; p = p->__head.p[stack[top]], ++top) /* update balance factors */ \
|
||||
if (stack[top] == 0) --p->__head.balance; \
|
||||
else ++p->__head.balance; \
|
||||
if (bp->__head.balance > -2 && bp->__head.balance < 2) return x; /* no re-balance needed */ \
|
||||
/* re-balance */ \
|
||||
which = (bp->__head.balance < 0); \
|
||||
b1 = which == 0? +1 : -1; \
|
||||
q = bp->__head.p[1 - which]; \
|
||||
if (q->__head.balance == b1) { \
|
||||
r = krmq_rotate1_##suf(bp, which); \
|
||||
q->__head.balance = bp->__head.balance = 0; \
|
||||
} else r = krmq_rotate2_##suf(bp, which); \
|
||||
if (bq == 0) *root_ = r; \
|
||||
else bq->__head.p[bp != bq->__head.p[0]] = r; \
|
||||
return x; \
|
||||
}
|
||||
|
||||
#define __KRMQ_ERASE(suf, __scope, __type, __head, __cmp, __lt2) \
|
||||
__scope __type *krmq_erase_##suf(__type **root_, const __type *x, unsigned *cnt_) { \
|
||||
__type *p, *path[KRMQ_MAX_DEPTH], fake; \
|
||||
unsigned char dir[KRMQ_MAX_DEPTH]; \
|
||||
int i, d = 0, cmp; \
|
||||
unsigned cnt = 0; \
|
||||
fake.__head.p[0] = *root_, fake.__head.p[1] = 0; \
|
||||
if (cnt_) *cnt_ = 0; \
|
||||
if (x) { \
|
||||
for (cmp = -1, p = &fake; cmp; cmp = __cmp(x, p)) { \
|
||||
int which = (cmp > 0); \
|
||||
if (cmp > 0) cnt += krmq_size_child(__head, p, 0) + 1; \
|
||||
dir[d] = which; \
|
||||
path[d++] = p; \
|
||||
p = p->__head.p[which]; \
|
||||
if (p == 0) { \
|
||||
if (cnt_) *cnt_ = 0; \
|
||||
return 0; \
|
||||
} \
|
||||
} \
|
||||
cnt += krmq_size_child(__head, p, 0) + 1; /* because p==x is not counted */ \
|
||||
} else { \
|
||||
for (p = &fake, cnt = 1; p; p = p->__head.p[0]) \
|
||||
dir[d] = 0, path[d++] = p; \
|
||||
p = path[--d]; \
|
||||
} \
|
||||
if (cnt_) *cnt_ = cnt; \
|
||||
for (i = 1; i < d; ++i) --path[i]->__head.size; \
|
||||
if (p->__head.p[1] == 0) { /* ((1,.)2,3)4 => (1,3)4; p=2 */ \
|
||||
path[d-1]->__head.p[dir[d-1]] = p->__head.p[0]; \
|
||||
} else { \
|
||||
__type *q = p->__head.p[1]; \
|
||||
if (q->__head.p[0] == 0) { /* ((1,2)3,4)5 => ((1)2,4)5; p=3,q=2 */ \
|
||||
q->__head.p[0] = p->__head.p[0]; \
|
||||
q->__head.balance = p->__head.balance; \
|
||||
path[d-1]->__head.p[dir[d-1]] = q; \
|
||||
path[d] = q, dir[d++] = 1; \
|
||||
q->__head.size = p->__head.size - 1; \
|
||||
} else { /* ((1,((.,2)3,4)5)6,7)8 => ((1,(2,4)5)3,7)8; p=6 */ \
|
||||
__type *r; \
|
||||
int e = d++; /* backup _d_ */\
|
||||
for (;;) { \
|
||||
dir[d] = 0; \
|
||||
path[d++] = q; \
|
||||
r = q->__head.p[0]; \
|
||||
if (r->__head.p[0] == 0) break; \
|
||||
q = r; \
|
||||
} \
|
||||
r->__head.p[0] = p->__head.p[0]; \
|
||||
q->__head.p[0] = r->__head.p[1]; \
|
||||
r->__head.p[1] = p->__head.p[1]; \
|
||||
r->__head.balance = p->__head.balance; \
|
||||
path[e-1]->__head.p[dir[e-1]] = r; \
|
||||
path[e] = r, dir[e] = 1; \
|
||||
for (i = e + 1; i < d; ++i) --path[i]->__head.size; \
|
||||
r->__head.size = p->__head.size - 1; \
|
||||
} \
|
||||
} \
|
||||
for (i = d - 1; i >= 0; --i) /* not sure why adding condition "path[i]->__head.s==p" doesn't work */ \
|
||||
krmq_update_min_##suf(path[i], path[i]->__head.p[0], path[i]->__head.p[1]); \
|
||||
while (--d > 0) { \
|
||||
__type *q = path[d]; \
|
||||
int which, other, b1 = 1, b2 = 2; \
|
||||
which = dir[d], other = 1 - which; \
|
||||
if (which) b1 = -b1, b2 = -b2; \
|
||||
q->__head.balance += b1; \
|
||||
if (q->__head.balance == b1) break; \
|
||||
else if (q->__head.balance == b2) { \
|
||||
__type *r = q->__head.p[other]; \
|
||||
if (r->__head.balance == -b1) { \
|
||||
path[d-1]->__head.p[dir[d-1]] = krmq_rotate2_##suf(q, which); \
|
||||
} else { \
|
||||
path[d-1]->__head.p[dir[d-1]] = krmq_rotate1_##suf(q, which); \
|
||||
if (r->__head.balance == 0) { \
|
||||
r->__head.balance = -b1; \
|
||||
q->__head.balance = b1; \
|
||||
break; \
|
||||
} else r->__head.balance = q->__head.balance = 0; \
|
||||
} \
|
||||
} \
|
||||
} \
|
||||
*root_ = fake.__head.p[0]; \
|
||||
return p; \
|
||||
}
|
||||
|
||||
#define krmq_free(__type, __head, __root, __free) do { \
|
||||
__type *_p, *_q; \
|
||||
for (_p = __root; _p; _p = _q) { \
|
||||
if (_p->__head.p[0] == 0) { \
|
||||
_q = _p->__head.p[1]; \
|
||||
__free(_p); \
|
||||
} else { \
|
||||
_q = _p->__head.p[0]; \
|
||||
_p->__head.p[0] = _q->__head.p[1]; \
|
||||
_q->__head.p[1] = _p; \
|
||||
} \
|
||||
} \
|
||||
} while (0)
|
||||
|
||||
#define __KRMQ_ITR(suf, __scope, __type, __head, __cmp) \
|
||||
struct krmq_itr_##suf { \
|
||||
const __type *stack[KRMQ_MAX_DEPTH], **top; \
|
||||
}; \
|
||||
__scope void krmq_itr_first_##suf(const __type *root, struct krmq_itr_##suf *itr) { \
|
||||
const __type *p; \
|
||||
for (itr->top = itr->stack - 1, p = root; p; p = p->__head.p[0]) \
|
||||
*++itr->top = p; \
|
||||
} \
|
||||
__scope int krmq_itr_find_##suf(const __type *root, const __type *x, struct krmq_itr_##suf *itr) { \
|
||||
const __type *p = root; \
|
||||
itr->top = itr->stack - 1; \
|
||||
while (p != 0) { \
|
||||
int cmp; \
|
||||
*++itr->top = p; \
|
||||
cmp = __cmp(x, p); \
|
||||
if (cmp < 0) p = p->__head.p[0]; \
|
||||
else if (cmp > 0) p = p->__head.p[1]; \
|
||||
else break; \
|
||||
} \
|
||||
return p? 1 : 0; \
|
||||
} \
|
||||
__scope int krmq_itr_next_bidir_##suf(struct krmq_itr_##suf *itr, int dir) { \
|
||||
const __type *p; \
|
||||
if (itr->top < itr->stack) return 0; \
|
||||
dir = !!dir; \
|
||||
p = (*itr->top)->__head.p[dir]; \
|
||||
if (p) { /* go down */ \
|
||||
for (; p; p = p->__head.p[!dir]) \
|
||||
*++itr->top = p; \
|
||||
return 1; \
|
||||
} else { /* go up */ \
|
||||
do { \
|
||||
p = *itr->top--; \
|
||||
} while (itr->top >= itr->stack && p == (*itr->top)->__head.p[dir]); \
|
||||
return itr->top < itr->stack? 0 : 1; \
|
||||
} \
|
||||
} \
|
||||
|
||||
/**
|
||||
* Insert a node to the tree
|
||||
*
|
||||
* @param suf name suffix used in KRMQ_INIT()
|
||||
* @param proot pointer to the root of the tree (in/out: root may change)
|
||||
* @param x node to insert (in)
|
||||
* @param cnt number of nodes smaller than or equal to _x_; can be NULL (out)
|
||||
*
|
||||
* @return _x_ if not present in the tree, or the node equal to x.
|
||||
*/
|
||||
#define krmq_insert(suf, proot, x, cnt) krmq_insert_##suf(proot, x, cnt)
|
||||
|
||||
/**
|
||||
* Find a node in the tree
|
||||
*
|
||||
* @param suf name suffix used in KRMQ_INIT()
|
||||
* @param root root of the tree
|
||||
* @param x node value to find (in)
|
||||
* @param cnt number of nodes smaller than or equal to _x_; can be NULL (out)
|
||||
*
|
||||
* @return node equal to _x_ if present, or NULL if absent
|
||||
*/
|
||||
#define krmq_find(suf, root, x, cnt) krmq_find_##suf(root, x, cnt)
|
||||
#define krmq_interval(suf, root, x, lower, upper) krmq_interval_##suf(root, x, lower, upper)
|
||||
#define krmq_rmq(suf, root, lo, up) krmq_rmq_##suf(root, lo, up)
|
||||
|
||||
/**
|
||||
* Delete a node from the tree
|
||||
*
|
||||
* @param suf name suffix used in KRMQ_INIT()
|
||||
* @param proot pointer to the root of the tree (in/out: root may change)
|
||||
* @param x node value to delete; if NULL, delete the first node (in)
|
||||
*
|
||||
* @return node removed from the tree if present, or NULL if absent
|
||||
*/
|
||||
#define krmq_erase(suf, proot, x, cnt) krmq_erase_##suf(proot, x, cnt)
|
||||
#define krmq_erase_first(suf, proot) krmq_erase_##suf(proot, 0, 0)
|
||||
|
||||
#define krmq_itr_t(suf) struct krmq_itr_##suf
|
||||
|
||||
/**
|
||||
* Place the iterator at the smallest object
|
||||
*
|
||||
* @param suf name suffix used in KRMQ_INIT()
|
||||
* @param root root of the tree
|
||||
* @param itr iterator
|
||||
*/
|
||||
#define krmq_itr_first(suf, root, itr) krmq_itr_first_##suf(root, itr)
|
||||
|
||||
/**
|
||||
* Place the iterator at the object equal to or greater than the query
|
||||
*
|
||||
* @param suf name suffix used in KRMQ_INIT()
|
||||
* @param root root of the tree
|
||||
* @param x query (in)
|
||||
* @param itr iterator (out)
|
||||
*
|
||||
* @return 1 if find; 0 otherwise. krmq_at(itr) is NULL if and only if query is
|
||||
* larger than all objects in the tree
|
||||
*/
|
||||
#define krmq_itr_find(suf, root, x, itr) krmq_itr_find_##suf(root, x, itr)
|
||||
|
||||
/**
|
||||
* Move to the next object in order
|
||||
*
|
||||
* @param itr iterator (modified)
|
||||
*
|
||||
* @return 1 if there is a next object; 0 otherwise
|
||||
*/
|
||||
#define krmq_itr_next(suf, itr) krmq_itr_next_bidir_##suf(itr, 1)
|
||||
#define krmq_itr_prev(suf, itr) krmq_itr_next_bidir_##suf(itr, 0)
|
||||
|
||||
/**
|
||||
* Return the pointer at the iterator
|
||||
*
|
||||
* @param itr iterator
|
||||
*
|
||||
* @return pointer if present; NULL otherwise
|
||||
*/
|
||||
#define krmq_at(itr) ((itr)->top < (itr)->stack? 0 : *(itr)->top)
|
||||
|
||||
#define KRMQ_INIT2(suf, __scope, __type, __head, __cmp, __lt2) \
|
||||
__KRMQ_FIND(suf, __scope, __type, __head, __cmp) \
|
||||
__KRMQ_RMQ(suf, __scope, __type, __head, __cmp, __lt2) \
|
||||
__KRMQ_ROTATE(suf, __type, __head, __lt2) \
|
||||
__KRMQ_INSERT(suf, __scope, __type, __head, __cmp, __lt2) \
|
||||
__KRMQ_ERASE(suf, __scope, __type, __head, __cmp, __lt2) \
|
||||
__KRMQ_ITR(suf, __scope, __type, __head, __cmp)
|
||||
|
||||
#define KRMQ_INIT(suf, __type, __head, __cmp, __lt2) \
|
||||
KRMQ_INIT2(suf,, __type, __head, __cmp, __lt2)
|
||||
|
||||
#endif
|
||||
@@ -37,6 +37,14 @@
|
||||
#define KS_SEP_LINE 2 // line separator: "\n" (Unix) or "\r\n" (Windows)
|
||||
#define KS_SEP_MAX 2
|
||||
|
||||
#ifndef klib_unused
|
||||
#if (defined __clang__ && __clang_major__ >= 3) || (defined __GNUC__ && __GNUC__ >= 3)
|
||||
#define klib_unused __attribute__ ((__unused__))
|
||||
#else
|
||||
#define klib_unused
|
||||
#endif
|
||||
#endif /* klib_unused */
|
||||
|
||||
#define __KS_TYPE(type_t) \
|
||||
typedef struct __kstream_t { \
|
||||
int begin, end; \
|
||||
@@ -64,7 +72,7 @@
|
||||
}
|
||||
|
||||
#define __KS_INLINED(__read) \
|
||||
static inline int ks_getc(kstream_t *ks) \
|
||||
static inline klib_unused int ks_getc(kstream_t *ks) \
|
||||
{ \
|
||||
if (ks->is_eof && ks->begin >= ks->end) return -1; \
|
||||
if (ks->begin >= ks->end) { \
|
||||
@@ -81,7 +89,7 @@
|
||||
#ifndef KSTRING_T
|
||||
#define KSTRING_T kstring_t
|
||||
typedef struct __kstring_t {
|
||||
unsigned l, m;
|
||||
size_t l, m;
|
||||
char *s;
|
||||
} kstring_t;
|
||||
#endif
|
||||
|
||||
@@ -37,7 +37,7 @@ typedef struct {
|
||||
int depth;
|
||||
} ks_isort_stack_t;
|
||||
|
||||
#define KSORT_SWAP(type_t, a, b) { register type_t t=(a); (a)=(b); (b)=t; }
|
||||
#define KSORT_SWAP(type_t, a, b) { type_t t=(a); (a)=(b); (b)=t; }
|
||||
|
||||
#define KSORT_INIT(name, type_t, __sort_lt) \
|
||||
void ks_heapdown_##name(size_t i, size_t n, type_t l[]) \
|
||||
|
||||
@@ -61,7 +61,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
int8_t gapo, int8_t gape, int8_t gapo2, int8_t gape2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
|
||||
|
||||
void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t gapo, int8_t gape, int8_t gapo2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez);
|
||||
int8_t gapo, int8_t gape, int8_t gapo2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez);
|
||||
|
||||
void ksw_extf2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t mch, int8_t mis, int8_t e, int w, int xdrop, ksw_extz_t *ez);
|
||||
|
||||
@@ -127,11 +127,11 @@ static inline void ksw_backtrack(void *km, int is_rot, int is_rev, int min_intro
|
||||
r = i + j;
|
||||
if (i < off[r]) force_state = 2;
|
||||
if (off_end && i > off_end[r]) force_state = 1;
|
||||
tmp = force_state < 0? p[r * n_col + i - off[r]] : 0;
|
||||
tmp = force_state < 0? p[(size_t)r * n_col + i - off[r]] : 0;
|
||||
} else {
|
||||
if (j < off[i]) force_state = 2;
|
||||
if (off_end && j > off_end[i]) force_state = 1;
|
||||
tmp = force_state < 0? p[i * n_col + j - off[i]] : 0;
|
||||
tmp = force_state < 0? p[(size_t)i * n_col + j - off[i]] : 0;
|
||||
}
|
||||
if (state == 0) state = tmp & 7; // if requesting the H state, find state one maximizes it.
|
||||
else if (!(tmp >> (state + 2) & 1)) state = 0; // if requesting other states, _state_ stays the same if it is a continuation; otherwise, set to H
|
||||
|
||||
+19
-20
@@ -17,18 +17,20 @@
|
||||
void __cpuidex(int cpuid[4], int func_id, int subfunc_id)
|
||||
{
|
||||
#if defined(__x86_64__)
|
||||
asm volatile ("cpuid"
|
||||
__asm__ volatile ("cpuid"
|
||||
: "=a" (cpuid[0]), "=b" (cpuid[1]), "=c" (cpuid[2]), "=d" (cpuid[3])
|
||||
: "0" (func_id), "2" (subfunc_id));
|
||||
#else // on 32bit, ebx can NOT be used as PIC code
|
||||
asm volatile ("xchgl %%ebx, %1; cpuid; xchgl %%ebx, %1"
|
||||
__asm__ volatile ("xchgl %%ebx, %1; cpuid; xchgl %%ebx, %1"
|
||||
: "=a" (cpuid[0]), "=r" (cpuid[1]), "=c" (cpuid[2]), "=d" (cpuid[3])
|
||||
: "0" (func_id), "2" (subfunc_id));
|
||||
#endif
|
||||
}
|
||||
#endif
|
||||
|
||||
int x86_simd(void)
|
||||
static int ksw_simd = -1;
|
||||
|
||||
static int x86_simd(void)
|
||||
{
|
||||
int flag = 0, cpuid[4], max_id;
|
||||
__cpuidex(cpuid, 0, 0);
|
||||
@@ -54,11 +56,10 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
{
|
||||
extern void ksw_extz2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
|
||||
extern void ksw_extz2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
|
||||
unsigned simd;
|
||||
simd = x86_simd();
|
||||
if (simd & SIMD_SSE4_1)
|
||||
if (ksw_simd < 0) ksw_simd = x86_simd();
|
||||
if (ksw_simd & SIMD_SSE4_1)
|
||||
ksw_extz2_sse41(km, qlen, query, tlen, target, m, mat, q, e, w, zdrop, end_bonus, flag, ez);
|
||||
else if (simd & SIMD_SSE2)
|
||||
else if (ksw_simd & SIMD_SSE2)
|
||||
ksw_extz2_sse2(km, qlen, query, tlen, target, m, mat, q, e, w, zdrop, end_bonus, flag, ez);
|
||||
else abort();
|
||||
}
|
||||
@@ -70,28 +71,26 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
|
||||
extern void ksw_extd2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
|
||||
unsigned simd;
|
||||
simd = x86_simd();
|
||||
if (simd & SIMD_SSE4_1)
|
||||
if (ksw_simd < 0) ksw_simd = x86_simd();
|
||||
if (ksw_simd & SIMD_SSE4_1)
|
||||
ksw_extd2_sse41(km, qlen, query, tlen, target, m, mat, q, e, q2, e2, w, zdrop, end_bonus, flag, ez);
|
||||
else if (simd & SIMD_SSE2)
|
||||
else if (ksw_simd & SIMD_SSE2)
|
||||
ksw_extd2_sse2(km, qlen, query, tlen, target, m, mat, q, e, q2, e2, w, zdrop, end_bonus, flag, ez);
|
||||
else abort();
|
||||
}
|
||||
|
||||
void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez)
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez)
|
||||
{
|
||||
extern void ksw_exts2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez);
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez);
|
||||
extern void ksw_exts2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez);
|
||||
unsigned simd;
|
||||
simd = x86_simd();
|
||||
if (simd & SIMD_SSE4_1)
|
||||
ksw_exts2_sse41(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, flag, ez);
|
||||
else if (simd & SIMD_SSE2)
|
||||
ksw_exts2_sse2(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, flag, ez);
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez);
|
||||
if (ksw_simd < 0) ksw_simd = x86_simd();
|
||||
if (ksw_simd & SIMD_SSE4_1)
|
||||
ksw_exts2_sse41(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, junc_bonus, flag, junc, ez);
|
||||
else if (ksw_simd & SIMD_SSE2)
|
||||
ksw_exts2_sse2(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, junc_bonus, flag, junc, ez);
|
||||
else abort();
|
||||
}
|
||||
#endif
|
||||
|
||||
+13
-5
@@ -4,15 +4,23 @@
|
||||
#include "ksw2.h"
|
||||
|
||||
#ifdef __SSE2__
|
||||
#ifdef USE_SIMDE
|
||||
#include <simde/x86/sse2.h>
|
||||
#else
|
||||
#include <emmintrin.h>
|
||||
#endif
|
||||
|
||||
#ifdef KSW_SSE2_ONLY
|
||||
#undef __SSE4_1__
|
||||
#endif
|
||||
|
||||
#ifdef __SSE4_1__
|
||||
#ifdef USE_SIMDE
|
||||
#include <simde/x86/sse4.1.h>
|
||||
#else
|
||||
#include <smmintrin.h>
|
||||
#endif
|
||||
#endif
|
||||
|
||||
#ifdef KSW_CPU_DISPATCH
|
||||
#ifdef __SSE4_1__
|
||||
@@ -76,7 +84,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
qe2_ = _mm_set1_epi8(q2 + e2);
|
||||
sc_mch_ = _mm_set1_epi8(mat[0]);
|
||||
sc_mis_ = _mm_set1_epi8(mat[1]);
|
||||
sc_N_ = _mm_set1_epi8(-e2);
|
||||
sc_N_ = mat[m*m-1] == 0? _mm_set1_epi8(-e2) : _mm_set1_epi8(mat[m*m-1]);
|
||||
m1_ = _mm_set1_epi8(m - 1); // wildcard
|
||||
|
||||
if (w < 0) w = tlen > qlen? tlen : qlen;
|
||||
@@ -111,7 +119,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
for (t = 0; t < tlen_ * 16; ++t) H[t] = KSW_NEG_INF;
|
||||
}
|
||||
if (with_cigar) {
|
||||
mem2 = (uint8_t*)kmalloc(km, ((qlen + tlen - 1) * n_col_ + 1) * 16);
|
||||
mem2 = (uint8_t*)kmalloc(km, ((size_t)(qlen + tlen - 1) * n_col_ + 1) * 16);
|
||||
p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4);
|
||||
off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int) * 2);
|
||||
off_end = off + qlen + tlen - 1;
|
||||
@@ -218,7 +226,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
#endif
|
||||
}
|
||||
} else if (!(flag&KSW_EZ_RIGHT)) { // gap left-alignment
|
||||
__m128i *pr = p + r * n_col_ - st_;
|
||||
__m128i *pr = p + (size_t)r * n_col_ - st_;
|
||||
off[r] = st, off_end[r] = en;
|
||||
for (t = st_; t <= en_; ++t) {
|
||||
__m128i d, z, a, b, a2, b2, xt1, x2t1, vt1, ut, tmp;
|
||||
@@ -265,7 +273,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
_mm_store_si128(&pr[t], d);
|
||||
}
|
||||
} else { // gap right-alignment
|
||||
__m128i *pr = p + r * n_col_ - st_;
|
||||
__m128i *pr = p + (size_t)r * n_col_ - st_;
|
||||
off[r] = st, off_end[r] = en;
|
||||
for (t = st_; t <= en_; ++t) {
|
||||
__m128i d, z, a, b, a2, b2, xt1, x2t1, vt1, ut, tmp;
|
||||
@@ -382,7 +390,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
|
||||
if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY)) {
|
||||
ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||
} else if (!ez->zdropped && (flag&KSW_EZ_EXTZ_ONLY) && ez->mqe + end_bonus > ez->max) {
|
||||
} else if (!ez->zdropped && (flag&KSW_EZ_EXTZ_ONLY) && ez->mqe + end_bonus > (int)ez->max) {
|
||||
ez->reach_end = 1;
|
||||
ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, ez->mqe_t, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||
} else if (ez->max_t >= 0 && ez->max_q >= 0) {
|
||||
|
||||
+59
-19
@@ -4,27 +4,34 @@
|
||||
#include "ksw2.h"
|
||||
|
||||
#ifdef __SSE2__
|
||||
#ifdef USE_SIMDE
|
||||
#include <simde/x86/sse2.h>
|
||||
#else
|
||||
#include <emmintrin.h>
|
||||
|
||||
#endif
|
||||
#ifdef KSW_SSE2_ONLY
|
||||
#undef __SSE4_1__
|
||||
#endif
|
||||
|
||||
#ifdef __SSE4_1__
|
||||
#ifdef USE_SIMDE
|
||||
#include <simde/x86/sse4.1.h>
|
||||
#else
|
||||
#include <smmintrin.h>
|
||||
#endif
|
||||
#endif
|
||||
|
||||
#ifdef KSW_CPU_DISPATCH
|
||||
#ifdef __SSE4_1__
|
||||
void ksw_exts2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez)
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez)
|
||||
#else
|
||||
void ksw_exts2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez)
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez)
|
||||
#endif
|
||||
#else
|
||||
void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez)
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez)
|
||||
#endif // ~KSW_CPU_DISPATCH
|
||||
{
|
||||
#define __dp_code_block1 \
|
||||
@@ -71,7 +78,7 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
qe_ = _mm_set1_epi8(q + e);
|
||||
sc_mch_ = _mm_set1_epi8(mat[0]);
|
||||
sc_mis_ = _mm_set1_epi8(mat[1]);
|
||||
sc_N_ = _mm_set1_epi8(-e);
|
||||
sc_N_ = mat[m*m-1] == 0? _mm_set1_epi8(-e) : _mm_set1_epi8(mat[m*m-1]);
|
||||
m1_ = _mm_set1_epi8(m - 1); // wildcard
|
||||
|
||||
tlen_ = (tlen + 15) / 16;
|
||||
@@ -100,7 +107,7 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
for (t = 0; t < tlen_ * 16; ++t) H[t] = KSW_NEG_INF;
|
||||
}
|
||||
if (with_cigar) {
|
||||
mem2 = (uint8_t*)kmalloc(km, ((qlen + tlen - 1) * n_col_ + 1) * 16);
|
||||
mem2 = (uint8_t*)kmalloc(km, ((size_t)(qlen + tlen - 1) * n_col_ + 1) * 16);
|
||||
p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4);
|
||||
off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int) * 2);
|
||||
off_end = off + qlen + tlen - 1;
|
||||
@@ -113,20 +120,53 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
if (flag & (KSW_EZ_SPLICE_FOR|KSW_EZ_SPLICE_REV)) {
|
||||
int semi_cost = flag&KSW_EZ_SPLICE_FLANK? -noncan/2 : 0; // GTr or yAG is worth 0.5 bit; see PMID:18688272
|
||||
memset(donor, -noncan, tlen_ * 16);
|
||||
for (t = 0; t < tlen - 4; ++t) {
|
||||
int can_type = 0; // type of canonical site: 0=none, 1=GT/AG only, 2=GTr/yAG
|
||||
if ((flag & KSW_EZ_SPLICE_FOR) && target[t+1] == 2 && target[t+2] == 3) can_type = 1; // GTr...
|
||||
if ((flag & KSW_EZ_SPLICE_REV) && target[t+1] == 1 && target[t+2] == 3) can_type = 1; // CTr...
|
||||
if (can_type && (target[t+3] == 0 || target[t+3] == 2)) can_type = 2;
|
||||
if (can_type) ((int8_t*)donor)[t] = can_type == 2? 0 : semi_cost;
|
||||
}
|
||||
memset(acceptor, -noncan, tlen_ * 16);
|
||||
for (t = 2; t < tlen; ++t) {
|
||||
int can_type = 0;
|
||||
if ((flag & KSW_EZ_SPLICE_FOR) && target[t-1] == 0 && target[t] == 2) can_type = 1; // ...yAG
|
||||
if ((flag & KSW_EZ_SPLICE_REV) && target[t-1] == 0 && target[t] == 1) can_type = 1; // ...yAC
|
||||
if (can_type && (target[t-2] == 1 || target[t-2] == 3)) can_type = 2;
|
||||
if (can_type) ((int8_t*)acceptor)[t] = can_type == 2? 0 : semi_cost;
|
||||
if (!(flag & KSW_EZ_REV_CIGAR)) {
|
||||
for (t = 0; t < tlen - 4; ++t) {
|
||||
int can_type = 0; // type of canonical site: 0=none, 1=GT/AG only, 2=GTr/yAG
|
||||
if ((flag & KSW_EZ_SPLICE_FOR) && target[t+1] == 2 && target[t+2] == 3) can_type = 1; // GTr...
|
||||
if ((flag & KSW_EZ_SPLICE_REV) && target[t+1] == 1 && target[t+2] == 3) can_type = 1; // CTr...
|
||||
if (can_type && (target[t+3] == 0 || target[t+3] == 2)) can_type = 2;
|
||||
if (can_type) ((int8_t*)donor)[t] = can_type == 2? 0 : semi_cost;
|
||||
}
|
||||
if (junc)
|
||||
for (t = 0; t < tlen - 1; ++t)
|
||||
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t+1]&1)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t+1]&8)))
|
||||
((int8_t*)donor)[t] += junc_bonus;
|
||||
for (t = 2; t < tlen; ++t) {
|
||||
int can_type = 0;
|
||||
if ((flag & KSW_EZ_SPLICE_FOR) && target[t-1] == 0 && target[t] == 2) can_type = 1; // ...yAG
|
||||
if ((flag & KSW_EZ_SPLICE_REV) && target[t-1] == 0 && target[t] == 1) can_type = 1; // ...yAC
|
||||
if (can_type && (target[t-2] == 1 || target[t-2] == 3)) can_type = 2;
|
||||
if (can_type) ((int8_t*)acceptor)[t] = can_type == 2? 0 : semi_cost;
|
||||
}
|
||||
if (junc)
|
||||
for (t = 0; t < tlen; ++t)
|
||||
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t]&2)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t]&4)))
|
||||
((int8_t*)acceptor)[t] += junc_bonus;
|
||||
} else {
|
||||
for (t = 0; t < tlen - 4; ++t) {
|
||||
int can_type = 0; // type of canonical site: 0=none, 1=GT/AG only, 2=GTr/yAG
|
||||
if ((flag & KSW_EZ_SPLICE_FOR) && target[t+1] == 2 && target[t+2] == 0) can_type = 1; // GAy...
|
||||
if ((flag & KSW_EZ_SPLICE_REV) && target[t+1] == 1 && target[t+2] == 0) can_type = 1; // CAy...
|
||||
if (can_type && (target[t+3] == 1 || target[t+3] == 3)) can_type = 2;
|
||||
if (can_type) ((int8_t*)donor)[t] = can_type == 2? 0 : semi_cost;
|
||||
}
|
||||
if (junc)
|
||||
for (t = 0; t < tlen - 1; ++t)
|
||||
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t+1]&2)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t+1]&4)))
|
||||
((int8_t*)donor)[t] += junc_bonus;
|
||||
for (t = 2; t < tlen; ++t) {
|
||||
int can_type = 0;
|
||||
if ((flag & KSW_EZ_SPLICE_FOR) && target[t-1] == 3 && target[t] == 2) can_type = 1; // ...rTG
|
||||
if ((flag & KSW_EZ_SPLICE_REV) && target[t-1] == 3 && target[t] == 1) can_type = 1; // ...rTC
|
||||
if (can_type && (target[t-2] == 0 || target[t-2] == 2)) can_type = 2;
|
||||
if (can_type) ((int8_t*)acceptor)[t] = can_type == 2? 0 : semi_cost;
|
||||
}
|
||||
if (junc)
|
||||
for (t = 0; t < tlen; ++t)
|
||||
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t]&1)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t]&8)))
|
||||
((int8_t*)acceptor)[t] += junc_bonus;
|
||||
}
|
||||
}
|
||||
|
||||
|
||||
+13
-5
@@ -3,15 +3,23 @@
|
||||
#include "ksw2.h"
|
||||
|
||||
#ifdef __SSE2__
|
||||
#ifdef USE_SIMDE
|
||||
#include <simde/x86/sse2.h>
|
||||
#else
|
||||
#include <emmintrin.h>
|
||||
#endif
|
||||
|
||||
#ifdef KSW_SSE2_ONLY
|
||||
#undef __SSE4_1__
|
||||
#endif
|
||||
|
||||
#ifdef __SSE4_1__
|
||||
#ifdef USE_SIMDE
|
||||
#include <simde/x86/sse4.1.h>
|
||||
#else
|
||||
#include <smmintrin.h>
|
||||
#endif
|
||||
#endif
|
||||
|
||||
#ifdef KSW_CPU_DISPATCH
|
||||
#ifdef __SSE4_1__
|
||||
@@ -65,7 +73,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
flag16_ = _mm_set1_epi8(0x10);
|
||||
sc_mch_ = _mm_set1_epi8(mat[0]);
|
||||
sc_mis_ = _mm_set1_epi8(mat[1]);
|
||||
sc_N_ = _mm_set1_epi8(-e);
|
||||
sc_N_ = mat[m*m-1] == 0? _mm_set1_epi8(-e) : _mm_set1_epi8(mat[m*m-1]);
|
||||
m1_ = _mm_set1_epi8(m - 1); // wildcard
|
||||
max_sc_ = _mm_set1_epi8(mat[0] + (q + e) * 2);
|
||||
|
||||
@@ -89,7 +97,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
for (t = 0; t < tlen_ * 16; ++t) H[t] = KSW_NEG_INF;
|
||||
}
|
||||
if (with_cigar) {
|
||||
mem2 = (uint8_t*)kmalloc(km, ((qlen + tlen - 1) * n_col_ + 1) * 16);
|
||||
mem2 = (uint8_t*)kmalloc(km, ((size_t)(qlen + tlen - 1) * n_col_ + 1) * 16);
|
||||
p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4);
|
||||
off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int) * 2);
|
||||
off_end = off + qlen + tlen - 1;
|
||||
@@ -169,7 +177,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
#endif
|
||||
}
|
||||
} else if (!(flag&KSW_EZ_RIGHT)) { // gap left-alignment
|
||||
__m128i *pr = p + r * n_col_ - st_;
|
||||
__m128i *pr = p + (size_t)r * n_col_ - st_;
|
||||
off[r] = st, off_end[r] = en;
|
||||
for (t = st_; t <= en_; ++t) {
|
||||
__m128i d, z, a, b, xt1, vt1, ut, tmp;
|
||||
@@ -195,7 +203,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
_mm_store_si128(&pr[t], d);
|
||||
}
|
||||
} else { // gap right-alignment
|
||||
__m128i *pr = p + r * n_col_ - st_;
|
||||
__m128i *pr = p + (size_t)r * n_col_ - st_;
|
||||
off[r] = st, off_end[r] = en;
|
||||
for (t = st_; t <= en_; ++t) {
|
||||
__m128i d, z, a, b, xt1, vt1, ut, tmp;
|
||||
@@ -293,7 +301,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
|
||||
if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY)) {
|
||||
ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||
} else if (!ez->zdropped && (flag&KSW_EZ_EXTZ_ONLY) && ez->mqe + end_bonus > ez->max) {
|
||||
} else if (!ez->zdropped && (flag&KSW_EZ_EXTZ_ONLY) && ez->mqe + end_bonus > (int)ez->max) {
|
||||
ez->reach_end = 1;
|
||||
ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, ez->mqe_t, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||
} else if (ez->max_t >= 0 && ez->max_q >= 0) {
|
||||
|
||||
+6
-1
@@ -1,9 +1,14 @@
|
||||
#include <stdlib.h>
|
||||
#include <stdint.h>
|
||||
#include <string.h>
|
||||
#include <emmintrin.h>
|
||||
#include "ksw2.h"
|
||||
|
||||
#ifdef USE_SIMDE
|
||||
#include <simde/x86/sse2.h>
|
||||
#else
|
||||
#include <emmintrin.h>
|
||||
#endif
|
||||
|
||||
#ifdef __GNUC__
|
||||
#define LIKELY(x) __builtin_expect((x),1)
|
||||
#define UNLIKELY(x) __builtin_expect((x),0)
|
||||
|
||||
@@ -0,0 +1,353 @@
|
||||
#include <stdint.h>
|
||||
#include <string.h>
|
||||
#include <stdio.h>
|
||||
#include <assert.h>
|
||||
#include "mmpriv.h"
|
||||
#include "kalloc.h"
|
||||
#include "krmq.h"
|
||||
|
||||
static inline float mg_log2(float x) // NB: this doesn't work when x<2
|
||||
{
|
||||
union { float f; uint32_t i; } z = { x };
|
||||
float log_2 = ((z.i >> 23) & 255) - 128;
|
||||
z.i &= ~(255 << 23);
|
||||
z.i += 127 << 23;
|
||||
log_2 += (-0.34484843f * z.f + 2.02466578f) * z.f - 0.67487759f;
|
||||
return log_2;
|
||||
}
|
||||
|
||||
uint64_t *mg_chain_backtrack(void *km, int64_t n, const int32_t *f, const int64_t *p, int32_t *v, int32_t *t, int32_t min_cnt, int32_t min_sc, int32_t *n_u_, int32_t *n_v_)
|
||||
{
|
||||
mm128_t *z;
|
||||
uint64_t *u;
|
||||
int64_t i, k, n_z, n_v;
|
||||
int32_t n_u;
|
||||
|
||||
*n_u_ = *n_v_ = 0;
|
||||
for (i = 0, n_z = 0; i < n; ++i) // precompute n_z
|
||||
if (f[i] >= min_sc) ++n_z;
|
||||
if (n_z == 0) return 0;
|
||||
KMALLOC(km, z, n_z);
|
||||
for (i = 0, k = 0; i < n; ++i) // populate z[]
|
||||
if (f[i] >= min_sc) z[k].x = f[i], z[k++].y = i;
|
||||
radix_sort_128x(z, z + n_z);
|
||||
|
||||
memset(t, 0, n * 4);
|
||||
for (k = n_z - 1, n_v = n_u = 0; k >= 0; --k) { // precompute n_u
|
||||
int64_t n_v0 = n_v;
|
||||
int32_t sc;
|
||||
for (i = z[k].y; i >= 0 && t[i] == 0; i = p[i])
|
||||
++n_v, t[i] = 1;
|
||||
sc = i < 0? z[k].x : (int32_t)z[k].x - f[i];
|
||||
if (sc >= min_sc && n_v > n_v0 && n_v - n_v0 >= min_cnt)
|
||||
++n_u;
|
||||
else n_v = n_v0;
|
||||
}
|
||||
KMALLOC(km, u, n_u);
|
||||
memset(t, 0, n * 4);
|
||||
for (k = n_z - 1, n_v = n_u = 0; k >= 0; --k) { // populate u[]
|
||||
int64_t n_v0 = n_v;
|
||||
int32_t sc;
|
||||
for (i = z[k].y; i >= 0 && t[i] == 0; i = p[i])
|
||||
v[n_v++] = i, t[i] = 1;
|
||||
sc = i < 0? z[k].x : (int32_t)z[k].x - f[i];
|
||||
if (sc >= min_sc && n_v > n_v0 && n_v - n_v0 >= min_cnt)
|
||||
u[n_u++] = (uint64_t)sc << 32 | (n_v - n_v0);
|
||||
else n_v = n_v0;
|
||||
}
|
||||
kfree(km, z);
|
||||
assert(n_v < INT32_MAX);
|
||||
*n_u_ = n_u, *n_v_ = n_v;
|
||||
return u;
|
||||
}
|
||||
|
||||
static mm128_t *compact_a(void *km, int32_t n_u, uint64_t *u, int32_t n_v, int32_t *v, mm128_t *a)
|
||||
{
|
||||
mm128_t *b, *w;
|
||||
uint64_t *u2;
|
||||
int64_t i, j, k;
|
||||
|
||||
// write the result to b[]
|
||||
KMALLOC(km, b, n_v);
|
||||
for (i = 0, k = 0; i < n_u; ++i) {
|
||||
int32_t k0 = k, ni = (int32_t)u[i];
|
||||
for (j = 0; j < ni; ++j)
|
||||
b[k++] = a[v[k0 + (ni - j - 1)]];
|
||||
}
|
||||
kfree(km, v);
|
||||
|
||||
// sort u[] and a[] by the target position, such that adjacent chains may be joined
|
||||
KMALLOC(km, w, n_u);
|
||||
for (i = k = 0; i < n_u; ++i) {
|
||||
w[i].x = b[k].x, w[i].y = (uint64_t)k<<32|i;
|
||||
k += (int32_t)u[i];
|
||||
}
|
||||
radix_sort_128x(w, w + n_u);
|
||||
KMALLOC(km, u2, n_u);
|
||||
for (i = k = 0; i < n_u; ++i) {
|
||||
int32_t j = (int32_t)w[i].y, n = (int32_t)u[j];
|
||||
u2[i] = u[j];
|
||||
memcpy(&a[k], &b[w[i].y>>32], n * sizeof(mm128_t));
|
||||
k += n;
|
||||
}
|
||||
memcpy(u, u2, n_u * 8);
|
||||
memcpy(b, a, k * sizeof(mm128_t)); // write _a_ to _b_ and deallocate _a_ because _a_ is oversized, sometimes a lot
|
||||
kfree(km, a); kfree(km, w); kfree(km, u2);
|
||||
return b;
|
||||
}
|
||||
|
||||
static inline int32_t comput_sc(const mm128_t *ai, const mm128_t *aj, int32_t max_dist_x, int32_t max_dist_y, int32_t bw, float chn_pen_gap, float chn_pen_skip, int is_cdna, int n_seg)
|
||||
{
|
||||
int32_t dq = (int32_t)ai->y - (int32_t)aj->y, dr, dd, dg, q_span, sc;
|
||||
int32_t sidi = (ai->y & MM_SEED_SEG_MASK) >> MM_SEED_SEG_SHIFT;
|
||||
int32_t sidj = (aj->y & MM_SEED_SEG_MASK) >> MM_SEED_SEG_SHIFT;
|
||||
if (dq <= 0 || dq > max_dist_x) return INT32_MIN;
|
||||
dr = (int32_t)(ai->x - aj->x);
|
||||
if (sidi == sidj && (dr == 0 || dq > max_dist_y)) return INT32_MIN;
|
||||
dd = dr > dq? dr - dq : dq - dr;
|
||||
if (sidi == sidj && dd > bw) return INT32_MIN;
|
||||
if (n_seg > 1 && !is_cdna && sidi == sidj && dr > max_dist_y) return INT32_MIN;
|
||||
dg = dr < dq? dr : dq;
|
||||
q_span = aj->y>>32&0xff;
|
||||
sc = q_span < dg? q_span : dg;
|
||||
if (dd || dg > q_span) {
|
||||
float lin_pen, log_pen;
|
||||
lin_pen = chn_pen_gap * (float)dd + chn_pen_skip * (float)dg;
|
||||
log_pen = dd >= 1? mg_log2(dd + 1) : 0.0f; // mg_log2() only works for dd>=2
|
||||
if (is_cdna) {
|
||||
if (dr > dq) sc -= (int)(lin_pen < log_pen? lin_pen : log_pen); // deletion or jump between paired ends
|
||||
else sc -= (int)(lin_pen + .5f * log_pen);
|
||||
} else sc -= (int)(lin_pen + .5f * log_pen);
|
||||
}
|
||||
return sc;
|
||||
}
|
||||
|
||||
/* Input:
|
||||
* a[].x: tid<<33 | rev<<32 | tpos
|
||||
* a[].y: flags<<40 | q_span<<32 | q_pos
|
||||
* Output:
|
||||
* n_u: #chains
|
||||
* u[]: score<<32 | #anchors (sum of lower 32 bits of u[] is the returned length of a[])
|
||||
* input a[] is deallocated on return
|
||||
*/
|
||||
mm128_t *mg_lchain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int max_iter, int min_cnt, int min_sc, float chn_pen_gap, float chn_pen_skip,
|
||||
int is_cdna, int n_seg, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km)
|
||||
{ // TODO: make sure this works when n has more than 32 bits
|
||||
int32_t *f, *t, *v, n_u, n_v, mmax_f = 0;
|
||||
int64_t *p, i, j, max_ii, st = 0, n_iter = 0;
|
||||
uint64_t *u;
|
||||
|
||||
if (_u) *_u = 0, *n_u_ = 0;
|
||||
if (n == 0 || a == 0) {
|
||||
kfree(km, a);
|
||||
return 0;
|
||||
}
|
||||
if (max_dist_x < bw) max_dist_x = bw;
|
||||
if (max_dist_y < bw && !is_cdna) max_dist_y = bw;
|
||||
KMALLOC(km, p, n);
|
||||
KMALLOC(km, f, n);
|
||||
KMALLOC(km, v, n);
|
||||
KCALLOC(km, t, n);
|
||||
|
||||
// fill the score and backtrack arrays
|
||||
for (i = 0, max_ii = -1; i < n; ++i) {
|
||||
int64_t max_j = -1, end_j;
|
||||
int32_t max_f = a[i].y>>32&0xff, n_skip = 0;
|
||||
while (st < i && (a[i].x>>32 != a[st].x>>32 || a[i].x > a[st].x + max_dist_x)) ++st;
|
||||
if (i - st > max_iter) st = i - max_iter;
|
||||
for (j = i - 1; j >= st; --j) {
|
||||
int32_t sc;
|
||||
sc = comput_sc(&a[i], &a[j], max_dist_x, max_dist_y, bw, chn_pen_gap, chn_pen_skip, is_cdna, n_seg);
|
||||
++n_iter;
|
||||
if (sc == INT32_MIN) continue;
|
||||
sc += f[j];
|
||||
if (sc > max_f) {
|
||||
max_f = sc, max_j = j;
|
||||
if (n_skip > 0) --n_skip;
|
||||
} else if (t[j] == (int32_t)i) {
|
||||
if (++n_skip > max_skip)
|
||||
break;
|
||||
}
|
||||
if (p[j] >= 0) t[p[j]] = i;
|
||||
}
|
||||
end_j = j;
|
||||
if (max_ii < 0 || a[i].x - a[max_ii].x > (int64_t)max_dist_x) {
|
||||
int32_t max = INT32_MIN;
|
||||
max_ii = -1;
|
||||
for (j = i - 1; j >= st; --j)
|
||||
if (max < f[j]) max = f[j], max_ii = j;
|
||||
}
|
||||
if (max_ii >= 0 && max_ii < end_j) {
|
||||
int32_t tmp;
|
||||
tmp = comput_sc(&a[i], &a[max_ii], max_dist_x, max_dist_y, bw, chn_pen_gap, chn_pen_skip, is_cdna, n_seg);
|
||||
if (tmp != INT32_MIN && max_f < tmp + f[max_ii])
|
||||
max_f = tmp + f[max_ii], max_j = max_ii;
|
||||
}
|
||||
f[i] = max_f, p[i] = max_j;
|
||||
v[i] = max_j >= 0 && v[max_j] > max_f? v[max_j] : max_f; // v[] keeps the peak score up to i; f[] is the score ending at i, not always the peak
|
||||
if (max_ii < 0 || (a[i].x - a[max_ii].x <= (int64_t)max_dist_x && f[max_ii] < f[i]))
|
||||
max_ii = i;
|
||||
if (mmax_f < max_f) mmax_f = max_f;
|
||||
}
|
||||
|
||||
u = mg_chain_backtrack(km, n, f, p, v, t, min_cnt, min_sc, &n_u, &n_v);
|
||||
*n_u_ = n_u, *_u = u; // NB: note that u[] may not be sorted by score here
|
||||
kfree(km, p); kfree(km, f); kfree(km, t);
|
||||
if (n_u == 0) {
|
||||
kfree(km, a); kfree(km, v);
|
||||
return 0;
|
||||
}
|
||||
return compact_a(km, n_u, u, n_v, v, a);
|
||||
}
|
||||
|
||||
typedef struct lc_elem_s {
|
||||
int32_t y;
|
||||
int64_t i;
|
||||
double pri;
|
||||
KRMQ_HEAD(struct lc_elem_s) head;
|
||||
} lc_elem_t;
|
||||
|
||||
#define lc_elem_cmp(a, b) ((a)->y < (b)->y? -1 : (a)->y > (b)->y? 1 : ((a)->i > (b)->i) - ((a)->i < (b)->i))
|
||||
#define lc_elem_lt2(a, b) ((a)->pri < (b)->pri)
|
||||
KRMQ_INIT(lc_elem, lc_elem_t, head, lc_elem_cmp, lc_elem_lt2)
|
||||
|
||||
KALLOC_POOL_INIT(rmq, lc_elem_t)
|
||||
|
||||
static inline int32_t comput_sc_simple(const mm128_t *ai, const mm128_t *aj, float chn_pen_gap, float chn_pen_skip, int32_t *exact, int32_t *width)
|
||||
{
|
||||
int32_t dq = (int32_t)ai->y - (int32_t)aj->y, dr, dd, dg, q_span, sc;
|
||||
dr = (int32_t)(ai->x - aj->x);
|
||||
*width = dd = dr > dq? dr - dq : dq - dr;
|
||||
dg = dr < dq? dr : dq;
|
||||
q_span = aj->y>>32&0xff;
|
||||
sc = q_span < dg? q_span : dg;
|
||||
if (exact) *exact = (dd == 0 && dg <= q_span);
|
||||
if (dd || dq > q_span) {
|
||||
float lin_pen, log_pen;
|
||||
lin_pen = chn_pen_gap * (float)dd + chn_pen_skip * (float)dg;
|
||||
log_pen = dd >= 1? mg_log2(dd + 1) : 0.0f; // mg_log2() only works for dd>=2
|
||||
sc -= (int)(lin_pen + .5f * log_pen);
|
||||
}
|
||||
return sc;
|
||||
}
|
||||
|
||||
mm128_t *mg_lchain_rmq(int max_dist, int max_dist_inner, int bw, int max_chn_skip, int cap_rmq_size, int min_cnt, int min_sc, float chn_pen_gap, float chn_pen_skip,
|
||||
int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km)
|
||||
{
|
||||
int32_t *f,*t, *v, n_u, n_v, mmax_f = 0, max_rmq_size = 0;
|
||||
int64_t *p, i, i0, st = 0, st_inner = 0, n_iter = 0;
|
||||
uint64_t *u;
|
||||
lc_elem_t *root = 0, *root_inner = 0;
|
||||
void *mem_mp = 0;
|
||||
kmp_rmq_t *mp;
|
||||
|
||||
if (_u) *_u = 0, *n_u_ = 0;
|
||||
if (n == 0 || a == 0) {
|
||||
kfree(km, a);
|
||||
return 0;
|
||||
}
|
||||
if (max_dist < bw) max_dist = bw;
|
||||
if (max_dist_inner <= 0 || max_dist_inner >= max_dist) max_dist_inner = 0;
|
||||
KMALLOC(km, p, n);
|
||||
KMALLOC(km, f, n);
|
||||
KCALLOC(km, t, n);
|
||||
KMALLOC(km, v, n);
|
||||
mem_mp = km_init2(km, 0x10000);
|
||||
mp = kmp_init_rmq(mem_mp);
|
||||
|
||||
// fill the score and backtrack arrays
|
||||
for (i = i0 = 0; i < n; ++i) {
|
||||
int64_t max_j = -1;
|
||||
int32_t q_span = a[i].y>>32&0xff, max_f = q_span;
|
||||
lc_elem_t s, *q, *r, lo, hi;
|
||||
// add in-range anchors
|
||||
if (i0 < i && a[i0].x != a[i].x) {
|
||||
int64_t j;
|
||||
for (j = i0; j < i; ++j) {
|
||||
q = kmp_alloc_rmq(mp);
|
||||
q->y = (int32_t)a[j].y, q->i = j, q->pri = -(f[j] + 0.5 * chn_pen_gap * ((int32_t)a[j].x + (int32_t)a[j].y));
|
||||
krmq_insert(lc_elem, &root, q, 0);
|
||||
if (max_dist_inner > 0) {
|
||||
r = kmp_alloc_rmq(mp);
|
||||
*r = *q;
|
||||
krmq_insert(lc_elem, &root_inner, r, 0);
|
||||
}
|
||||
}
|
||||
i0 = i;
|
||||
}
|
||||
// get rid of active chains out of range
|
||||
while (st < i && (a[i].x>>32 != a[st].x>>32 || a[i].x > a[st].x + max_dist || krmq_size(head, root) > cap_rmq_size)) {
|
||||
s.y = (int32_t)a[st].y, s.i = st;
|
||||
if ((q = krmq_find(lc_elem, root, &s, 0)) != 0) {
|
||||
q = krmq_erase(lc_elem, &root, q, 0);
|
||||
kmp_free_rmq(mp, q);
|
||||
}
|
||||
++st;
|
||||
}
|
||||
if (max_dist_inner > 0) { // similar to the block above, but applied to the inner tree
|
||||
while (st_inner < i && (a[i].x>>32 != a[st_inner].x>>32 || a[i].x > a[st_inner].x + max_dist_inner || krmq_size(head, root_inner) > cap_rmq_size)) {
|
||||
s.y = (int32_t)a[st_inner].y, s.i = st_inner;
|
||||
if ((q = krmq_find(lc_elem, root_inner, &s, 0)) != 0) {
|
||||
q = krmq_erase(lc_elem, &root_inner, q, 0);
|
||||
kmp_free_rmq(mp, q);
|
||||
}
|
||||
++st_inner;
|
||||
}
|
||||
}
|
||||
// RMQ
|
||||
lo.i = INT32_MAX, lo.y = (int32_t)a[i].y - max_dist;
|
||||
hi.i = 0, hi.y = (int32_t)a[i].y;
|
||||
if ((q = krmq_rmq(lc_elem, root, &lo, &hi)) != 0) {
|
||||
int32_t sc, exact, width, n_skip = 0;
|
||||
int64_t j = q->i;
|
||||
assert(q->y >= lo.y && q->y <= hi.y);
|
||||
sc = f[j] + comput_sc_simple(&a[i], &a[j], chn_pen_gap, chn_pen_skip, &exact, &width);
|
||||
if (width <= bw && sc > max_f) max_f = sc, max_j = j;
|
||||
if (!exact && root_inner && (int32_t)a[i].y > 0) {
|
||||
lc_elem_t *lo, *hi;
|
||||
s.y = (int32_t)a[i].y - 1, s.i = n;
|
||||
krmq_interval(lc_elem, root_inner, &s, &lo, &hi);
|
||||
if (lo) {
|
||||
const lc_elem_t *q;
|
||||
int32_t width, n_rmq_iter = 0;
|
||||
krmq_itr_t(lc_elem) itr;
|
||||
krmq_itr_find(lc_elem, root_inner, lo, &itr);
|
||||
while ((q = krmq_at(&itr)) != 0) {
|
||||
if (q->y < (int32_t)a[i].y - max_dist_inner) break;
|
||||
++n_rmq_iter;
|
||||
j = q->i;
|
||||
sc = f[j] + comput_sc_simple(&a[i], &a[j], chn_pen_gap, chn_pen_skip, 0, &width);
|
||||
if (width <= bw) {
|
||||
if (sc > max_f) {
|
||||
max_f = sc, max_j = j;
|
||||
if (n_skip > 0) --n_skip;
|
||||
} else if (t[j] == (int32_t)i) {
|
||||
if (++n_skip > max_chn_skip)
|
||||
break;
|
||||
}
|
||||
if (p[j] >= 0) t[p[j]] = i;
|
||||
}
|
||||
if (!krmq_itr_prev(lc_elem, &itr)) break;
|
||||
}
|
||||
n_iter += n_rmq_iter;
|
||||
}
|
||||
}
|
||||
}
|
||||
// set max
|
||||
assert(max_j < 0 || (a[max_j].x < a[i].x && (int32_t)a[max_j].y < (int32_t)a[i].y));
|
||||
f[i] = max_f, p[i] = max_j;
|
||||
v[i] = max_j >= 0 && v[max_j] > max_f? v[max_j] : max_f; // v[] keeps the peak score up to i; f[] is the score ending at i, not always the peak
|
||||
if (mmax_f < max_f) mmax_f = max_f;
|
||||
if (max_rmq_size < krmq_size(head, root)) max_rmq_size = krmq_size(head, root);
|
||||
}
|
||||
km_destroy(mem_mp);
|
||||
|
||||
u = mg_chain_backtrack(km, n, f, p, v, t, min_cnt, min_sc, &n_u, &n_v);
|
||||
*n_u_ = n_u, *_u = u; // NB: note that u[] may not be sorted by score here
|
||||
kfree(km, p); kfree(km, f); kfree(km, t);
|
||||
if (n_u == 0) {
|
||||
kfree(km, a); kfree(km, v);
|
||||
return 0;
|
||||
}
|
||||
return compact_a(km, n_u, u, n_v, v, a);
|
||||
}
|
||||
Submodule
+1
Submodule lib/simde added at b30129b3b4
@@ -1,12 +1,13 @@
|
||||
#include <stdlib.h>
|
||||
#include <stdio.h>
|
||||
#include <string.h>
|
||||
#include <errno.h>
|
||||
#include "bseq.h"
|
||||
#include "minimap.h"
|
||||
#include "mmpriv.h"
|
||||
#include "getopt.h"
|
||||
#include "ketopt.h"
|
||||
|
||||
#define MM_VERSION "2.9-r720"
|
||||
#define MM_VERSION "2.19-r1057"
|
||||
|
||||
#ifdef __linux__
|
||||
#include <sys/resource.h>
|
||||
@@ -22,57 +23,83 @@ void liftrlimit()
|
||||
void liftrlimit() {}
|
||||
#endif
|
||||
|
||||
static struct option long_options[] = {
|
||||
{ "bucket-bits", required_argument, 0, 0 },
|
||||
{ "mb-size", required_argument, 0, 'K' },
|
||||
{ "seed", required_argument, 0, 0 },
|
||||
{ "no-kalloc", no_argument, 0, 0 },
|
||||
{ "print-qname", no_argument, 0, 0 },
|
||||
{ "no-self", no_argument, 0, 'D' },
|
||||
{ "print-seeds", no_argument, 0, 0 },
|
||||
{ "max-chain-skip", required_argument, 0, 0 },
|
||||
{ "min-dp-len", required_argument, 0, 0 },
|
||||
{ "print-aln-seq", no_argument, 0, 0 },
|
||||
{ "splice", no_argument, 0, 0 },
|
||||
{ "cost-non-gt-ag", required_argument, 0, 'C' },
|
||||
{ "no-long-join", no_argument, 0, 0 },
|
||||
{ "sr", no_argument, 0, 0 },
|
||||
{ "frag", required_argument, 0, 0 },
|
||||
{ "secondary", required_argument, 0, 0 },
|
||||
{ "cs", optional_argument, 0, 0 },
|
||||
{ "end-bonus", required_argument, 0, 0 },
|
||||
{ "no-pairing", no_argument, 0, 0 },
|
||||
{ "splice-flank", required_argument, 0, 0 },
|
||||
{ "idx-no-seq", no_argument, 0, 0 },
|
||||
{ "end-seed-pen", required_argument, 0, 0 }, // 21
|
||||
{ "for-only", no_argument, 0, 0 }, // 22
|
||||
{ "rev-only", no_argument, 0, 0 }, // 23
|
||||
{ "heap-sort", required_argument, 0, 0 }, // 24
|
||||
{ "all-chain", no_argument, 0, 'P' },
|
||||
{ "dual", required_argument, 0, 0 }, // 26
|
||||
{ "max-clip-ratio", required_argument, 0, 0 }, // 27
|
||||
{ "help", no_argument, 0, 'h' },
|
||||
{ "max-intron-len", required_argument, 0, 'G' },
|
||||
{ "version", no_argument, 0, 'V' },
|
||||
{ "min-count", required_argument, 0, 'n' },
|
||||
{ "min-chain-score",required_argument, 0, 'm' },
|
||||
{ "mask-level", required_argument, 0, 'M' },
|
||||
{ "min-dp-score", required_argument, 0, 's' },
|
||||
{ "sam", no_argument, 0, 'a' },
|
||||
{ 0, 0, 0, 0}
|
||||
static ko_longopt_t long_options[] = {
|
||||
{ "bucket-bits", ko_required_argument, 300 },
|
||||
{ "mb-size", ko_required_argument, 'K' },
|
||||
{ "seed", ko_required_argument, 302 },
|
||||
{ "no-kalloc", ko_no_argument, 303 },
|
||||
{ "print-qname", ko_no_argument, 304 },
|
||||
{ "no-self", ko_no_argument, 'D' },
|
||||
{ "print-seeds", ko_no_argument, 306 },
|
||||
{ "max-chain-skip", ko_required_argument, 307 },
|
||||
{ "min-dp-len", ko_required_argument, 308 },
|
||||
{ "print-aln-seq", ko_no_argument, 309 },
|
||||
{ "splice", ko_no_argument, 310 },
|
||||
{ "cost-non-gt-ag", ko_required_argument, 'C' },
|
||||
{ "no-long-join", ko_no_argument, 312 },
|
||||
{ "sr", ko_no_argument, 313 },
|
||||
{ "frag", ko_required_argument, 314 },
|
||||
{ "secondary", ko_required_argument, 315 },
|
||||
{ "cs", ko_optional_argument, 316 },
|
||||
{ "end-bonus", ko_required_argument, 317 },
|
||||
{ "no-pairing", ko_no_argument, 318 },
|
||||
{ "splice-flank", ko_required_argument, 319 },
|
||||
{ "idx-no-seq", ko_no_argument, 320 },
|
||||
{ "end-seed-pen", ko_required_argument, 321 },
|
||||
{ "for-only", ko_no_argument, 322 },
|
||||
{ "rev-only", ko_no_argument, 323 },
|
||||
{ "heap-sort", ko_required_argument, 324 },
|
||||
{ "all-chain", ko_no_argument, 'P' },
|
||||
{ "dual", ko_required_argument, 326 },
|
||||
{ "max-clip-ratio", ko_required_argument, 327 },
|
||||
{ "min-occ-floor", ko_required_argument, 328 },
|
||||
{ "MD", ko_no_argument, 329 },
|
||||
{ "lj-min-ratio", ko_required_argument, 330 },
|
||||
{ "score-N", ko_required_argument, 331 },
|
||||
{ "eqx", ko_no_argument, 332 },
|
||||
{ "paf-no-hit", ko_no_argument, 333 },
|
||||
{ "split-prefix", ko_required_argument, 334 },
|
||||
{ "no-end-flt", ko_no_argument, 335 },
|
||||
{ "hard-mask-level",ko_no_argument, 336 },
|
||||
{ "cap-sw-mem", ko_required_argument, 337 },
|
||||
{ "max-qlen", ko_required_argument, 338 },
|
||||
{ "max-chain-iter", ko_required_argument, 339 },
|
||||
{ "junc-bed", ko_required_argument, 340 },
|
||||
{ "junc-bonus", ko_required_argument, 341 },
|
||||
{ "sam-hit-only", ko_no_argument, 342 },
|
||||
{ "chain-gap-scale",ko_required_argument, 343 },
|
||||
{ "alt", ko_required_argument, 344 },
|
||||
{ "alt-drop", ko_required_argument, 345 },
|
||||
{ "mask-len", ko_required_argument, 346 },
|
||||
{ "rmq", ko_optional_argument, 347 },
|
||||
{ "help", ko_no_argument, 'h' },
|
||||
{ "max-intron-len", ko_required_argument, 'G' },
|
||||
{ "version", ko_no_argument, 'V' },
|
||||
{ "min-count", ko_required_argument, 'n' },
|
||||
{ "min-chain-score",ko_required_argument, 'm' },
|
||||
{ "mask-level", ko_required_argument, 'M' },
|
||||
{ "min-dp-score", ko_required_argument, 's' },
|
||||
{ "sam", ko_no_argument, 'a' },
|
||||
{ 0, 0, 0 }
|
||||
};
|
||||
|
||||
static inline int64_t mm_parse_num(const char *str)
|
||||
static inline int64_t mm_parse_num2(const char *str, char **q)
|
||||
{
|
||||
double x;
|
||||
char *p;
|
||||
x = strtod(optarg, &p);
|
||||
if (*p == 'G' || *p == 'g') x *= 1e9;
|
||||
else if (*p == 'M' || *p == 'm') x *= 1e6;
|
||||
else if (*p == 'K' || *p == 'k') x *= 1e3;
|
||||
x = strtod(str, &p);
|
||||
if (*p == 'G' || *p == 'g') x *= 1e9, ++p;
|
||||
else if (*p == 'M' || *p == 'm') x *= 1e6, ++p;
|
||||
else if (*p == 'K' || *p == 'k') x *= 1e3, ++p;
|
||||
if (q) *q = p;
|
||||
return (int64_t)(x + .499);
|
||||
}
|
||||
|
||||
static inline int64_t mm_parse_num(const char *str)
|
||||
{
|
||||
return mm_parse_num2(str, 0);
|
||||
}
|
||||
|
||||
static inline void yes_or_no(mm_mapopt_t *opt, int flag, int long_idx, const char *arg, int yes_to_set)
|
||||
{
|
||||
if (yes_to_set) {
|
||||
@@ -88,11 +115,12 @@ static inline void yes_or_no(mm_mapopt_t *opt, int flag, int long_idx, const cha
|
||||
|
||||
int main(int argc, char *argv[])
|
||||
{
|
||||
const char *opt_str = "2aSDw:k:K:t:r:f:Vv:g:G:I:d:XT:s:x:Hcp:M:n:z:A:B:O:E:m:N:Qu:R:hF:LC:";
|
||||
const char *opt_str = "2aSDw:k:K:t:r:f:Vv:g:G:I:d:XT:s:x:Hcp:M:n:z:A:B:O:E:m:N:Qu:R:hF:LC:yYPo:e:U:";
|
||||
ketopt_t o = KETOPT_INIT;
|
||||
mm_mapopt_t opt;
|
||||
mm_idxopt_t ipt;
|
||||
int i, c, n_threads = 3, long_idx;
|
||||
char *fnw = 0, *rg = 0, *s;
|
||||
int i, c, n_threads = 3, n_parts, old_best_n = -1;
|
||||
char *fnw = 0, *rg = 0, *junc_bed = 0, *s, *alt_list = 0;
|
||||
FILE *fp_help = stderr;
|
||||
mm_idx_reader_t *idx_rdr;
|
||||
mm_idx_t *mi;
|
||||
@@ -102,30 +130,35 @@ int main(int argc, char *argv[])
|
||||
mm_realtime0 = realtime();
|
||||
mm_set_opt(0, &ipt, &opt);
|
||||
|
||||
while ((c = getopt_long(argc, argv, opt_str, long_options, &long_idx)) >= 0) // apply option -x/preset first
|
||||
while ((c = ketopt(&o, argc, argv, 1, opt_str, long_options)) >= 0) { // test command line options and apply option -x/preset first
|
||||
if (c == 'x') {
|
||||
if (mm_set_opt(optarg, &ipt, &opt) < 0) {
|
||||
fprintf(stderr, "[ERROR] unknown preset '%s'\n", optarg);
|
||||
if (mm_set_opt(o.arg, &ipt, &opt) < 0) {
|
||||
fprintf(stderr, "[ERROR] unknown preset '%s'\n", o.arg);
|
||||
return 1;
|
||||
}
|
||||
break;
|
||||
} else if (c == ':') {
|
||||
fprintf(stderr, "[ERROR] missing option argument\n");
|
||||
return 1;
|
||||
} else if (c == '?') {
|
||||
fprintf(stderr, "[ERROR] unknown option in \"%s\"\n", argv[o.i - 1]);
|
||||
return 1;
|
||||
}
|
||||
optreset = 1;
|
||||
}
|
||||
o = KETOPT_INIT;
|
||||
|
||||
while ((c = getopt_long(argc, argv, opt_str, long_options, &long_idx)) >= 0) {
|
||||
if (c == 'w') ipt.w = atoi(optarg);
|
||||
else if (c == 'k') ipt.k = atoi(optarg);
|
||||
while ((c = ketopt(&o, argc, argv, 1, opt_str, long_options)) >= 0) {
|
||||
if (c == 'w') ipt.w = atoi(o.arg);
|
||||
else if (c == 'k') ipt.k = atoi(o.arg);
|
||||
else if (c == 'H') ipt.flag |= MM_I_HPC;
|
||||
else if (c == 'd') fnw = optarg; // the above are indexing related options, except -I
|
||||
else if (c == 'r') opt.bw = (int)mm_parse_num(optarg);
|
||||
else if (c == 't') n_threads = atoi(optarg);
|
||||
else if (c == 'v') mm_verbose = atoi(optarg);
|
||||
else if (c == 'g') opt.max_gap = (int)mm_parse_num(optarg);
|
||||
else if (c == 'G') mm_mapopt_max_intron_len(&opt, (int)mm_parse_num(optarg));
|
||||
else if (c == 'F') opt.max_frag_len = (int)mm_parse_num(optarg);
|
||||
else if (c == 'N') opt.best_n = atoi(optarg);
|
||||
else if (c == 'p') opt.pri_ratio = atof(optarg);
|
||||
else if (c == 'M') opt.mask_level = atof(optarg);
|
||||
else if (c == 'd') fnw = o.arg; // the above are indexing related options, except -I
|
||||
else if (c == 't') n_threads = atoi(o.arg);
|
||||
else if (c == 'v') mm_verbose = atoi(o.arg);
|
||||
else if (c == 'g') opt.max_gap = (int)mm_parse_num(o.arg);
|
||||
else if (c == 'G') mm_mapopt_max_intron_len(&opt, (int)mm_parse_num(o.arg));
|
||||
else if (c == 'F') opt.max_frag_len = (int)mm_parse_num(o.arg);
|
||||
else if (c == 'N') old_best_n = opt.best_n, opt.best_n = atoi(o.arg);
|
||||
else if (c == 'p') opt.pri_ratio = atof(o.arg);
|
||||
else if (c == 'M') opt.mask_level = atof(o.arg);
|
||||
else if (c == 'c') opt.flag |= MM_F_OUT_CG | MM_F_CIGAR;
|
||||
else if (c == 'D') opt.flag |= MM_F_NO_DIAG;
|
||||
else if (c == 'P') opt.flag |= MM_F_ALL_CHAINS;
|
||||
@@ -134,57 +167,89 @@ int main(int argc, char *argv[])
|
||||
else if (c == 'Q') opt.flag |= MM_F_NO_QUAL;
|
||||
else if (c == 'Y') opt.flag |= MM_F_SOFTCLIP;
|
||||
else if (c == 'L') opt.flag |= MM_F_LONG_CIGAR;
|
||||
else if (c == 'T') opt.sdust_thres = atoi(optarg);
|
||||
else if (c == 'n') opt.min_cnt = atoi(optarg);
|
||||
else if (c == 'm') opt.min_chain_score = atoi(optarg);
|
||||
else if (c == 'A') opt.a = atoi(optarg);
|
||||
else if (c == 'B') opt.b = atoi(optarg);
|
||||
else if (c == 's') opt.min_dp_max = atoi(optarg);
|
||||
else if (c == 'C') opt.noncan = atoi(optarg);
|
||||
else if (c == 'I') ipt.batch_size = mm_parse_num(optarg);
|
||||
else if (c == 'K') opt.mini_batch_size = (int)mm_parse_num(optarg);
|
||||
else if (c == 'R') rg = optarg;
|
||||
else if (c == 'y') opt.flag |= MM_F_COPY_COMMENT;
|
||||
else if (c == 'T') opt.sdust_thres = atoi(o.arg);
|
||||
else if (c == 'n') opt.min_cnt = atoi(o.arg);
|
||||
else if (c == 'm') opt.min_chain_score = atoi(o.arg);
|
||||
else if (c == 'A') opt.a = atoi(o.arg);
|
||||
else if (c == 'B') opt.b = atoi(o.arg);
|
||||
else if (c == 's') opt.min_dp_max = atoi(o.arg);
|
||||
else if (c == 'C') opt.noncan = atoi(o.arg);
|
||||
else if (c == 'I') ipt.batch_size = mm_parse_num(o.arg);
|
||||
else if (c == 'K') opt.mini_batch_size = mm_parse_num(o.arg);
|
||||
else if (c == 'e') opt.occ_dist = mm_parse_num(o.arg);
|
||||
else if (c == 'R') rg = o.arg;
|
||||
else if (c == 'h') fp_help = stdout;
|
||||
else if (c == '2') opt.flag |= MM_F_2_IO_THREADS;
|
||||
else if (c == 0 && long_idx == 0) ipt.bucket_bits = atoi(optarg); // --bucket-bits
|
||||
else if (c == 0 && long_idx == 2) opt.seed = atoi(optarg); // --seed
|
||||
else if (c == 0 && long_idx == 3) mm_dbg_flag |= MM_DBG_NO_KALLOC; // --no-kalloc
|
||||
else if (c == 0 && long_idx == 4) mm_dbg_flag |= MM_DBG_PRINT_QNAME; // --print-qname
|
||||
else if (c == 0 && long_idx == 6) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_SEED, n_threads = 1; // --print-seed
|
||||
else if (c == 0 && long_idx == 7) opt.max_chain_skip = atoi(optarg); // --max-chain-skip
|
||||
else if (c == 0 && long_idx == 8) opt.min_ksw_len = atoi(optarg); // --min-dp-len
|
||||
else if (c == 0 && long_idx == 9) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_ALN_SEQ, n_threads = 1; // --print-aln-seq
|
||||
else if (c == 0 && long_idx ==10) opt.flag |= MM_F_SPLICE; // --splice
|
||||
else if (c == 0 && long_idx ==12) opt.flag |= MM_F_NO_LJOIN; // --no-long-join
|
||||
else if (c == 0 && long_idx ==13) opt.flag |= MM_F_SR; // --sr
|
||||
else if (c == 0 && long_idx ==17) opt.end_bonus = atoi(optarg); // --end-bonus
|
||||
else if (c == 0 && long_idx ==18) opt.flag |= MM_F_INDEPEND_SEG; // --no-pairing
|
||||
else if (c == 0 && long_idx ==20) ipt.flag |= MM_I_NO_SEQ; // --idx-no-seq
|
||||
else if (c == 0 && long_idx ==21) opt.anchor_ext_shift = atoi(optarg); // --end-seed-pen
|
||||
else if (c == 0 && long_idx ==22) opt.flag |= MM_F_FOR_ONLY; // --for-only
|
||||
else if (c == 0 && long_idx ==23) opt.flag |= MM_F_REV_ONLY; // --rev-only
|
||||
else if (c == 0 && long_idx ==27) opt.max_clip_ratio = atof(optarg); // --max-clip-ratio
|
||||
else if (c == 0 && long_idx == 14) { // --frag
|
||||
yes_or_no(&opt, MM_F_FRAG_MODE, long_idx, optarg, 1);
|
||||
} else if (c == 0 && long_idx == 15) { // --secondary
|
||||
yes_or_no(&opt, MM_F_NO_PRINT_2ND, long_idx, optarg, 0);
|
||||
} else if (c == 0 && long_idx == 16) { // --cs
|
||||
else if (c == 'o') {
|
||||
if (strcmp(o.arg, "-") != 0) {
|
||||
if (freopen(o.arg, "wb", stdout) == NULL) {
|
||||
fprintf(stderr, "[ERROR]\033[1;31m failed to write the output to file '%s'\033[0m: %s\n", o.arg, strerror(errno));
|
||||
exit(1);
|
||||
}
|
||||
}
|
||||
}
|
||||
else if (c == 300) ipt.bucket_bits = atoi(o.arg); // --bucket-bits
|
||||
else if (c == 302) opt.seed = atoi(o.arg); // --seed
|
||||
else if (c == 303) mm_dbg_flag |= MM_DBG_NO_KALLOC; // --no-kalloc
|
||||
else if (c == 304) mm_dbg_flag |= MM_DBG_PRINT_QNAME; // --print-qname
|
||||
else if (c == 306) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_SEED, n_threads = 1; // --print-seed
|
||||
else if (c == 307) opt.max_chain_skip = atoi(o.arg); // --max-chain-skip
|
||||
else if (c == 339) opt.max_chain_iter = atoi(o.arg); // --max-chain-iter
|
||||
else if (c == 308) opt.min_ksw_len = atoi(o.arg); // --min-dp-len
|
||||
else if (c == 309) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_ALN_SEQ, n_threads = 1; // --print-aln-seq
|
||||
else if (c == 310) opt.flag |= MM_F_SPLICE; // --splice
|
||||
else if (c == 312) opt.flag |= MM_F_NO_LJOIN; // --no-long-join
|
||||
else if (c == 313) opt.flag |= MM_F_SR; // --sr
|
||||
else if (c == 317) opt.end_bonus = atoi(o.arg); // --end-bonus
|
||||
else if (c == 318) opt.flag |= MM_F_INDEPEND_SEG; // --no-pairing
|
||||
else if (c == 320) ipt.flag |= MM_I_NO_SEQ; // --idx-no-seq
|
||||
else if (c == 321) opt.anchor_ext_shift = atoi(o.arg); // --end-seed-pen
|
||||
else if (c == 322) opt.flag |= MM_F_FOR_ONLY; // --for-only
|
||||
else if (c == 323) opt.flag |= MM_F_REV_ONLY; // --rev-only
|
||||
else if (c == 327) opt.max_clip_ratio = atof(o.arg); // --max-clip-ratio
|
||||
else if (c == 328) opt.min_mid_occ = atoi(o.arg); // --min-occ-floor
|
||||
else if (c == 329) opt.flag |= MM_F_OUT_MD; // --MD
|
||||
else if (c == 331) opt.sc_ambi = atoi(o.arg); // --score-N
|
||||
else if (c == 332) opt.flag |= MM_F_EQX; // --eqx
|
||||
else if (c == 333) opt.flag |= MM_F_PAF_NO_HIT; // --paf-no-hit
|
||||
else if (c == 334) opt.split_prefix = o.arg; // --split-prefix
|
||||
else if (c == 335) opt.flag |= MM_F_NO_END_FLT; // --no-end-flt
|
||||
else if (c == 336) opt.flag |= MM_F_HARD_MLEVEL; // --hard-mask-level
|
||||
else if (c == 337) opt.max_sw_mat = mm_parse_num(o.arg); // --cap-sw-mat
|
||||
else if (c == 338) opt.max_qlen = mm_parse_num(o.arg); // --max-qlen
|
||||
else if (c == 340) junc_bed = o.arg; // --junc-bed
|
||||
else if (c == 341) opt.junc_bonus = atoi(o.arg); // --junc-bonus
|
||||
else if (c == 342) opt.flag |= MM_F_SAM_HIT_ONLY; // --sam-hit-only
|
||||
else if (c == 343) opt.chain_gap_scale = atof(o.arg); // --chain-gap-scale
|
||||
else if (c == 344) alt_list = o.arg; // --alt
|
||||
else if (c == 345) opt.alt_drop = atof(o.arg); // --alt-drop
|
||||
else if (c == 346) opt.mask_len = mm_parse_num(o.arg); // --mask-len
|
||||
else if (c == 330) {
|
||||
fprintf(stderr, "[WARNING] \033[1;31m --lj-min-ratio has been deprecated.\033[0m\n");
|
||||
} else if (c == 314) { // --frag
|
||||
yes_or_no(&opt, MM_F_FRAG_MODE, o.longidx, o.arg, 1);
|
||||
} else if (c == 315) { // --secondary
|
||||
yes_or_no(&opt, MM_F_NO_PRINT_2ND, o.longidx, o.arg, 0);
|
||||
} else if (c == 316) { // --cs
|
||||
opt.flag |= MM_F_OUT_CS | MM_F_CIGAR;
|
||||
if (optarg == 0 || strcmp(optarg, "short") == 0) {
|
||||
if (o.arg == 0 || strcmp(o.arg, "short") == 0) {
|
||||
opt.flag &= ~MM_F_OUT_CS_LONG;
|
||||
} else if (strcmp(optarg, "long") == 0) {
|
||||
} else if (strcmp(o.arg, "long") == 0) {
|
||||
opt.flag |= MM_F_OUT_CS_LONG;
|
||||
} else if (strcmp(optarg, "none") == 0) {
|
||||
} else if (strcmp(o.arg, "none") == 0) {
|
||||
opt.flag &= ~MM_F_OUT_CS;
|
||||
} else if (mm_verbose >= 2) {
|
||||
fprintf(stderr, "[WARNING]\033[1;31m --cs only takes 'short' or 'long'. Invalid values are assumed to be 'short'.\033[0m\n");
|
||||
}
|
||||
} else if (c == 0 && long_idx == 19) { // --splice-flank
|
||||
yes_or_no(&opt, MM_F_SPLICE_FLANK, long_idx, optarg, 1);
|
||||
} else if (c == 0 && long_idx == 24) { // --heap-sort
|
||||
yes_or_no(&opt, MM_F_HEAP_SORT, long_idx, optarg, 1);
|
||||
} else if (c == 0 && long_idx == 26) { // --dual
|
||||
yes_or_no(&opt, MM_F_NO_DUAL, long_idx, optarg, 0);
|
||||
} else if (c == 319) { // --splice-flank
|
||||
yes_or_no(&opt, MM_F_SPLICE_FLANK, o.longidx, o.arg, 1);
|
||||
} else if (c == 324) { // --heap-sort
|
||||
yes_or_no(&opt, MM_F_HEAP_SORT, o.longidx, o.arg, 1);
|
||||
} else if (c == 326) { // --dual
|
||||
yes_or_no(&opt, MM_F_NO_DUAL, o.longidx, o.arg, 0);
|
||||
} else if (c == 347) { // --rmq
|
||||
yes_or_no(&opt, MM_F_RMQ, o.longidx, o.arg, 1);
|
||||
} else if (c == 'S') {
|
||||
opt.flag |= MM_F_OUT_CS | MM_F_CIGAR | MM_F_OUT_CS_LONG;
|
||||
if (mm_verbose >= 2)
|
||||
@@ -192,30 +257,36 @@ int main(int argc, char *argv[])
|
||||
} else if (c == 'V') {
|
||||
puts(MM_VERSION);
|
||||
return 0;
|
||||
} else if (c == 'r') {
|
||||
opt.bw = (int)mm_parse_num2(o.arg, &s);
|
||||
if (*s == ',') opt.bw_long = (int)mm_parse_num2(s + 1, &s);
|
||||
} else if (c == 'U') {
|
||||
opt.min_mid_occ = strtol(o.arg, &s, 10);
|
||||
if (*s == ',') opt.max_mid_occ = strtol(s + 1, &s, 10);
|
||||
} else if (c == 'f') {
|
||||
double x;
|
||||
char *p;
|
||||
x = strtod(optarg, &p);
|
||||
x = strtod(o.arg, &p);
|
||||
if (x < 1.0) opt.mid_occ_frac = x, opt.mid_occ = 0;
|
||||
else opt.mid_occ = (int)(x + .499);
|
||||
if (*p == ',') opt.max_occ = (int)(strtod(p+1, &p) + .499);
|
||||
} else if (c == 'u') {
|
||||
if (*optarg == 'b') opt.flag |= MM_F_SPLICE_FOR|MM_F_SPLICE_REV; // both strands
|
||||
else if (*optarg == 'f') opt.flag |= MM_F_SPLICE_FOR, opt.flag &= ~MM_F_SPLICE_REV; // match GT-AG
|
||||
else if (*optarg == 'r') opt.flag |= MM_F_SPLICE_REV, opt.flag &= ~MM_F_SPLICE_FOR; // match CT-AC (reverse complement of GT-AG)
|
||||
else if (*optarg == 'n') opt.flag &= ~(MM_F_SPLICE_FOR|MM_F_SPLICE_REV); // don't try to match the GT-AG signal
|
||||
if (*o.arg == 'b') opt.flag |= MM_F_SPLICE_FOR|MM_F_SPLICE_REV; // both strands
|
||||
else if (*o.arg == 'f') opt.flag |= MM_F_SPLICE_FOR, opt.flag &= ~MM_F_SPLICE_REV; // match GT-AG
|
||||
else if (*o.arg == 'r') opt.flag |= MM_F_SPLICE_REV, opt.flag &= ~MM_F_SPLICE_FOR; // match CT-AC (reverse complement of GT-AG)
|
||||
else if (*o.arg == 'n') opt.flag &= ~(MM_F_SPLICE_FOR|MM_F_SPLICE_REV); // don't try to match the GT-AG signal
|
||||
else {
|
||||
fprintf(stderr, "[ERROR]\033[1;31m unrecognized cDNA direction\033[0m\n");
|
||||
return 1;
|
||||
}
|
||||
} else if (c == 'z') {
|
||||
opt.zdrop = opt.zdrop_inv = strtol(optarg, &s, 10);
|
||||
opt.zdrop = opt.zdrop_inv = strtol(o.arg, &s, 10);
|
||||
if (*s == ',') opt.zdrop_inv = strtol(s + 1, &s, 10);
|
||||
} else if (c == 'O') {
|
||||
opt.q = opt.q2 = strtol(optarg, &s, 10);
|
||||
opt.q = opt.q2 = strtol(o.arg, &s, 10);
|
||||
if (*s == ',') opt.q2 = strtol(s + 1, &s, 10);
|
||||
} else if (c == 'E') {
|
||||
opt.e = opt.e2 = strtol(optarg, &s, 10);
|
||||
opt.e = opt.e2 = strtol(o.arg, &s, 10);
|
||||
if (*s == ',') opt.e2 = strtol(s + 1, &s, 10);
|
||||
}
|
||||
}
|
||||
@@ -227,14 +298,18 @@ int main(int argc, char *argv[])
|
||||
ipt.flag |= MM_I_NO_SEQ;
|
||||
if (mm_check_opt(&ipt, &opt) < 0)
|
||||
return 1;
|
||||
if (opt.best_n == 0) {
|
||||
fprintf(stderr, "[WARNING]\033[1;31m changed '-N 0' to '-N %d --secondary=no'.\033[0m\n", old_best_n);
|
||||
opt.best_n = old_best_n, opt.flag |= MM_F_NO_PRINT_2ND;
|
||||
}
|
||||
|
||||
if (argc == optind || fp_help == stdout) {
|
||||
if (argc == o.ind || fp_help == stdout) {
|
||||
fprintf(fp_help, "Usage: minimap2 [options] <target.fa>|<target.idx> [query.fa] [...]\n");
|
||||
fprintf(fp_help, "Options:\n");
|
||||
fprintf(fp_help, " Indexing:\n");
|
||||
fprintf(fp_help, " -H use homopolymer-compressed k-mer\n");
|
||||
fprintf(fp_help, " -H use homopolymer-compressed k-mer (preferrable for PacBio)\n");
|
||||
fprintf(fp_help, " -k INT k-mer size (no larger than 28) [%d]\n", ipt.k);
|
||||
fprintf(fp_help, " -w INT minizer window size [%d]\n", ipt.w);
|
||||
fprintf(fp_help, " -w INT minimizer window size [%d]\n", ipt.w);
|
||||
fprintf(fp_help, " -I NUM split index for every ~NUM input bases [4G]\n");
|
||||
fprintf(fp_help, " -d FILE dump index to FILE []\n");
|
||||
fprintf(fp_help, " Mapping:\n");
|
||||
@@ -259,40 +334,40 @@ int main(int argc, char *argv[])
|
||||
fprintf(fp_help, " -u CHAR how to find GT-AG. f:transcript strand, b:both strands, n:don't match GT-AG [n]\n");
|
||||
fprintf(fp_help, " Input/Output:\n");
|
||||
fprintf(fp_help, " -a output in the SAM format (PAF by default)\n");
|
||||
fprintf(fp_help, " -Q don't output base quality in SAM\n");
|
||||
fprintf(fp_help, " -o FILE output alignments to FILE [stdout]\n");
|
||||
fprintf(fp_help, " -L write CIGAR with >65535 ops at the CG tag\n");
|
||||
fprintf(fp_help, " -R STR SAM read group line in a format like '@RG\\tID:foo\\tSM:bar' []\n");
|
||||
fprintf(fp_help, " -c output CIGAR in PAF\n");
|
||||
fprintf(fp_help, " --cs[=STR] output the cs tag; STR is 'short' (if absent) or 'long' [none]\n");
|
||||
fprintf(fp_help, " --MD output the MD tag\n");
|
||||
fprintf(fp_help, " --eqx write =/X CIGAR operators\n");
|
||||
fprintf(fp_help, " -Y use soft clipping for supplementary alignments\n");
|
||||
fprintf(fp_help, " -t INT number of threads [%d]\n", n_threads);
|
||||
fprintf(fp_help, " -K NUM minibatch size for mapping [500M]\n");
|
||||
// fprintf(fp_help, " -v INT verbose level [%d]\n", mm_verbose);
|
||||
fprintf(fp_help, " --version show version number\n");
|
||||
fprintf(fp_help, " Preset:\n");
|
||||
fprintf(fp_help, " -x STR preset (always applied before other options) []\n");
|
||||
fprintf(fp_help, " map-pb: -Hk19 (PacBio vs reference mapping)\n");
|
||||
fprintf(fp_help, " map-ont: -k15 (Oxford Nanopore vs reference mapping)\n");
|
||||
fprintf(fp_help, " asm5: -k19 -w19 -A1 -B19 -O39,81 -E3,1 -s200 -z200 (asm to ref mapping; break at 5%% div.)\n");
|
||||
fprintf(fp_help, " asm10: -k19 -w19 -A1 -B9 -O16,41 -E2,1 -s200 -z200 (asm to ref mapping; break at 10%% div.)\n");
|
||||
fprintf(fp_help, " ava-pb: -Hk19 -Xw5 -m100 -g10000 --max-chain-skip 25 (PacBio read overlap)\n");
|
||||
fprintf(fp_help, " ava-ont: -k15 -Xw5 -m100 -g10000 --max-chain-skip 25 (ONT read overlap)\n");
|
||||
fprintf(fp_help, " splice: long-read spliced alignment (see minimap2.1 for details)\n");
|
||||
fprintf(fp_help, " sr: short single-end reads without splicing (see minimap2.1 for details)\n");
|
||||
fprintf(fp_help, "\nSee `man ./minimap2.1' for detailed description of command-line options.\n");
|
||||
fprintf(fp_help, " -x STR preset (always applied before other options; see minimap2.1 for details) []\n");
|
||||
fprintf(fp_help, " - map-pb/map-ont - PacBio CLR/Nanopore vs reference mapping\n");
|
||||
fprintf(fp_help, " - map-hifi - PacBio HiFi reads vs reference mapping\n");
|
||||
fprintf(fp_help, " - ava-pb/ava-ont - PacBio/Nanopore read overlap\n");
|
||||
fprintf(fp_help, " - asm5/asm10/asm20 - asm-to-ref mapping, for ~0.1/1/5%% sequence divergence\n");
|
||||
fprintf(fp_help, " - splice/splice:hq - long-read/Pacbio-CCS spliced alignment\n");
|
||||
fprintf(fp_help, " - sr - genomic short-read mapping\n");
|
||||
fprintf(fp_help, "\nSee `man ./minimap2.1' for detailed description of these and other advanced command-line options.\n");
|
||||
return fp_help == stdout? 0 : 1;
|
||||
}
|
||||
|
||||
if ((opt.flag & MM_F_SR) && argc - optind > 3) {
|
||||
if ((opt.flag & MM_F_SR) && argc - o.ind > 3) {
|
||||
fprintf(stderr, "[ERROR] incorrect input: in the sr mode, please specify no more than two query files.\n");
|
||||
return 1;
|
||||
}
|
||||
idx_rdr = mm_idx_reader_open(argv[optind], &ipt, fnw);
|
||||
idx_rdr = mm_idx_reader_open(argv[o.ind], &ipt, fnw);
|
||||
if (idx_rdr == 0) {
|
||||
fprintf(stderr, "[ERROR] failed to open file '%s'\n", argv[optind]);
|
||||
fprintf(stderr, "[ERROR] failed to open file '%s': %s\n", argv[o.ind], strerror(errno));
|
||||
return 1;
|
||||
}
|
||||
if (!idx_rdr->is_idx && fnw == 0 && argc - optind < 2) {
|
||||
if (!idx_rdr->is_idx && fnw == 0 && argc - o.ind < 2) {
|
||||
fprintf(stderr, "[ERROR] missing input: please specify a query file to map or option -d to keep the index\n");
|
||||
mm_idx_reader_close(idx_rdr);
|
||||
return 1;
|
||||
@@ -300,6 +375,7 @@ int main(int argc, char *argv[])
|
||||
if (opt.best_n == 0 && (opt.flag&MM_F_CIGAR) && mm_verbose >= 2)
|
||||
fprintf(stderr, "[WARNING]\033[1;31m `-N 0' reduces alignment accuracy. Please use --secondary=no to suppress secondary alignments.\033[0m\n");
|
||||
while ((mi = mm_idx_reader_read(idx_rdr, n_threads)) != 0) {
|
||||
int ret;
|
||||
if ((opt.flag & MM_F_CIGAR) && (mi->flag & MM_I_NO_SEQ)) {
|
||||
fprintf(stderr, "[ERROR] the prebuilt index doesn't contain sequences.\n");
|
||||
mm_idx_destroy(mi);
|
||||
@@ -308,32 +384,61 @@ int main(int argc, char *argv[])
|
||||
}
|
||||
if ((opt.flag & MM_F_OUT_SAM) && idx_rdr->n_parts == 1) {
|
||||
if (mm_idx_reader_eof(idx_rdr)) {
|
||||
mm_write_sam_hdr(mi, rg, MM_VERSION, argc, argv);
|
||||
if (opt.split_prefix == 0)
|
||||
ret = mm_write_sam_hdr(mi, rg, MM_VERSION, argc, argv);
|
||||
else
|
||||
ret = mm_write_sam_hdr(0, rg, MM_VERSION, argc, argv);
|
||||
} else {
|
||||
mm_write_sam_hdr(0, rg, MM_VERSION, argc, argv);
|
||||
if (mm_verbose >= 2)
|
||||
fprintf(stderr, "[WARNING]\033[1;31m For a multi-part index, no @SQ lines will be outputted.\033[0m\n");
|
||||
ret = mm_write_sam_hdr(0, rg, MM_VERSION, argc, argv);
|
||||
if (opt.split_prefix == 0 && mm_verbose >= 2)
|
||||
fprintf(stderr, "[WARNING]\033[1;31m For a multi-part index, no @SQ lines will be outputted. Please use --split-prefix.\033[0m\n");
|
||||
}
|
||||
if (ret != 0) {
|
||||
mm_idx_destroy(mi);
|
||||
mm_idx_reader_close(idx_rdr);
|
||||
return 1;
|
||||
}
|
||||
}
|
||||
if (mm_verbose >= 3)
|
||||
fprintf(stderr, "[M::%s::%.3f*%.2f] loaded/built the index for %d target sequence(s)\n",
|
||||
__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), mi->n_seq);
|
||||
if (argc != optind + 1) mm_mapopt_update(&opt, mi);
|
||||
if (argc != o.ind + 1) mm_mapopt_update(&opt, mi);
|
||||
if (mm_verbose >= 3) mm_idx_stat(mi);
|
||||
if (junc_bed) mm_idx_bed_read(mi, junc_bed, 1);
|
||||
if (alt_list) mm_idx_alt_read(mi, alt_list);
|
||||
if (argc - (o.ind + 1) == 0) continue; // no query files
|
||||
ret = 0;
|
||||
if (!(opt.flag & MM_F_FRAG_MODE)) {
|
||||
for (i = optind + 1; i < argc; ++i)
|
||||
mm_map_file(mi, argv[i], &opt, n_threads);
|
||||
for (i = o.ind + 1; i < argc; ++i) {
|
||||
ret = mm_map_file(mi, argv[i], &opt, n_threads);
|
||||
if (ret < 0) break;
|
||||
}
|
||||
} else {
|
||||
mm_map_file_frag(mi, argc - (optind + 1), (const char**)&argv[optind + 1], &opt, n_threads);
|
||||
ret = mm_map_file_frag(mi, argc - (o.ind + 1), (const char**)&argv[o.ind + 1], &opt, n_threads);
|
||||
}
|
||||
mm_idx_destroy(mi);
|
||||
if (ret < 0) {
|
||||
fprintf(stderr, "ERROR: failed to map the query file\n");
|
||||
exit(EXIT_FAILURE);
|
||||
}
|
||||
}
|
||||
n_parts = idx_rdr->n_parts;
|
||||
mm_idx_reader_close(idx_rdr);
|
||||
|
||||
fprintf(stderr, "[M::%s] Version: %s\n", __func__, MM_VERSION);
|
||||
fprintf(stderr, "[M::%s] CMD:", __func__);
|
||||
for (i = 0; i < argc; ++i)
|
||||
fprintf(stderr, " %s", argv[i]);
|
||||
fprintf(stderr, "\n[M::%s] Real time: %.3f sec; CPU: %.3f sec\n", __func__, realtime() - mm_realtime0, cputime());
|
||||
if (opt.split_prefix)
|
||||
mm_split_merge(argc - (o.ind + 1), (const char**)&argv[o.ind + 1], &opt, n_parts);
|
||||
|
||||
if (fflush(stdout) == EOF) {
|
||||
perror("[ERROR] failed to write the results");
|
||||
exit(EXIT_FAILURE);
|
||||
}
|
||||
|
||||
if (mm_verbose >= 3) {
|
||||
fprintf(stderr, "[M::%s] Version: %s\n", __func__, MM_VERSION);
|
||||
fprintf(stderr, "[M::%s] CMD:", __func__);
|
||||
for (i = 0; i < argc; ++i)
|
||||
fprintf(stderr, " %s", argv[i]);
|
||||
fprintf(stderr, "\n[M::%s] Real time: %.3f sec; CPU: %.3f sec; Peak RSS: %.3f GB\n", __func__, realtime() - mm_realtime0, cputime(), peakrss() / 1024.0 / 1024.0 / 1024.0);
|
||||
}
|
||||
return 0;
|
||||
}
|
||||
|
||||
@@ -1,6 +1,7 @@
|
||||
#include <stdlib.h>
|
||||
#include <string.h>
|
||||
#include <assert.h>
|
||||
#include <errno.h>
|
||||
#include "kthread.h"
|
||||
#include "kvec.h"
|
||||
#include "kalloc.h"
|
||||
@@ -11,6 +12,7 @@
|
||||
|
||||
struct mm_tbuf_s {
|
||||
void *km;
|
||||
int rep_len, frag_gap;
|
||||
};
|
||||
|
||||
mm_tbuf_t *mm_tbuf_init(void)
|
||||
@@ -28,6 +30,11 @@ void mm_tbuf_destroy(mm_tbuf_t *b)
|
||||
free(b);
|
||||
}
|
||||
|
||||
void *mm_tbuf_get_km(mm_tbuf_t *b)
|
||||
{
|
||||
return b->km;
|
||||
}
|
||||
|
||||
static int mm_dust_minier(void *km, int n, mm128_t *a, int l_seq, const char *seq, int sdust_thres)
|
||||
{
|
||||
int n_dreg, j, k, u = 0;
|
||||
@@ -39,12 +46,12 @@ static int mm_dust_minier(void *km, int n, mm128_t *a, int l_seq, const char *se
|
||||
for (j = k = 0; j < n; ++j) { // squeeze out minimizers that significantly overlap with LCRs
|
||||
int32_t qpos = (uint32_t)a[j].y>>1, span = a[j].x&0xff;
|
||||
int32_t s = qpos - (span - 1), e = s + span;
|
||||
while (u < n_dreg && (uint32_t)dreg[u] <= s) ++u;
|
||||
if (u < n_dreg && dreg[u]>>32 < e) {
|
||||
while (u < n_dreg && (int32_t)dreg[u] <= s) ++u;
|
||||
if (u < n_dreg && (int32_t)(dreg[u]>>32) < e) {
|
||||
int v, l = 0;
|
||||
for (v = u; v < n_dreg && dreg[v]>>32 < e; ++v) { // iterate over LCRs overlapping this minimizer
|
||||
int ss = s > dreg[v]>>32? s : dreg[v]>>32;
|
||||
int ee = e < (uint32_t)dreg[v]? e : (uint32_t)dreg[v];
|
||||
for (v = u; v < n_dreg && (int32_t)(dreg[v]>>32) < e; ++v) { // iterate over LCRs overlapping this minimizer
|
||||
int ss = s > (int32_t)(dreg[v]>>32)? s : dreg[v]>>32;
|
||||
int ee = e < (int32_t)dreg[v]? e : (uint32_t)dreg[v];
|
||||
l += ee - ss;
|
||||
}
|
||||
if (l <= span>>1) a[k++] = a[j]; // keep the minimizer if less than half of it falls in masked region
|
||||
@@ -56,9 +63,10 @@ static int mm_dust_minier(void *km, int n, mm128_t *a, int l_seq, const char *se
|
||||
|
||||
static void collect_minimizers(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, mm128_v *mv)
|
||||
{
|
||||
int i, j, n, sum = 0;
|
||||
int i, n, sum = 0;
|
||||
mv->n = 0;
|
||||
for (i = n = 0; i < n_segs; ++i) {
|
||||
size_t j;
|
||||
mm_sketch(km, seqs[i], qlens[i], mi->w, mi->k, i, mi->flag&MM_I_HPC, mv);
|
||||
for (j = n; j < mv->n; ++j)
|
||||
mv->a[j].y += sum << 1;
|
||||
@@ -72,55 +80,14 @@ static void collect_minimizers(void *km, const mm_mapopt_t *opt, const mm_idx_t
|
||||
#define heap_lt(a, b) ((a).x > (b).x)
|
||||
KSORT_INIT(heap, mm128_t, heap_lt)
|
||||
|
||||
typedef struct {
|
||||
uint32_t n;
|
||||
uint32_t q_pos, q_span;
|
||||
uint32_t seg_id:31, is_tandem:1;
|
||||
const uint64_t *cr;
|
||||
} mm_match_t;
|
||||
|
||||
static mm_match_t *collect_matches(void *km, int *_n_m, int max_occ, const mm_idx_t *mi, const mm128_v *mv, int64_t *n_a, int *rep_len, int *n_mini_pos, uint64_t **mini_pos)
|
||||
{
|
||||
int i, rep_st = 0, rep_en = 0, n_m;
|
||||
mm_match_t *m;
|
||||
*n_mini_pos = 0;
|
||||
*mini_pos = (uint64_t*)kmalloc(km, mv->n * sizeof(uint64_t));
|
||||
m = (mm_match_t*)kmalloc(km, mv->n * sizeof(mm_match_t));
|
||||
for (i = n_m = 0, *rep_len = 0, *n_a = 0; i < mv->n; ++i) {
|
||||
const uint64_t *cr;
|
||||
mm128_t *p = &mv->a[i];
|
||||
uint32_t q_pos = (uint32_t)p->y, q_span = p->x & 0xff;
|
||||
int t;
|
||||
cr = mm_idx_get(mi, p->x>>8, &t);
|
||||
if (t >= max_occ) {
|
||||
int en = (q_pos >> 1) + 1, st = en - q_span;
|
||||
if (st > rep_en) {
|
||||
*rep_len += rep_en - rep_st;
|
||||
rep_st = st, rep_en = en;
|
||||
} else rep_en = en;
|
||||
} else {
|
||||
mm_match_t *q = &m[n_m++];
|
||||
q->q_pos = q_pos, q->q_span = q_span, q->cr = cr, q->n = t, q->seg_id = p->y >> 32;
|
||||
q->is_tandem = 0;
|
||||
if (i > 0 && p->x>>8 == mv->a[i - 1].x>>8) q->is_tandem = 1;
|
||||
if (i < mv->n - 1 && p->x>>8 == mv->a[i + 1].x>>8) q->is_tandem = 1;
|
||||
*n_a += q->n;
|
||||
(*mini_pos)[(*n_mini_pos)++] = (uint64_t)q_span<<32 | q_pos>>1;
|
||||
}
|
||||
}
|
||||
*rep_len += rep_en - rep_st;
|
||||
*_n_m = n_m;
|
||||
return m;
|
||||
}
|
||||
|
||||
static inline int skip_seed(int flag, uint64_t r, const mm_match_t *q, const char *qname, int qlen, const mm_idx_t *mi, int *is_self)
|
||||
static inline int skip_seed(int flag, uint64_t r, const mm_seed_t *q, const char *qname, int qlen, const mm_idx_t *mi, int *is_self)
|
||||
{
|
||||
*is_self = 0;
|
||||
if (qname && (flag & (MM_F_NO_DIAG|MM_F_NO_DUAL))) {
|
||||
const mm_idx_seq_t *s = &mi->seq[r>>32];
|
||||
int cmp;
|
||||
cmp = strcmp(qname, s->name);
|
||||
if ((flag&MM_F_NO_DIAG) && cmp == 0 && s->len == qlen) {
|
||||
if ((flag&MM_F_NO_DIAG) && cmp == 0 && (int)s->len == qlen) {
|
||||
if ((uint32_t)r>>1 == (q->q_pos>>1)) return 1; // avoid the diagnonal anchors
|
||||
if ((r&1) == (q->q_pos&1)) *is_self = 1; // this flag is used to avoid spurious extension on self chain
|
||||
}
|
||||
@@ -142,10 +109,10 @@ static mm128_t *collect_seed_hits_heap(void *km, const mm_mapopt_t *opt, int max
|
||||
{
|
||||
int i, n_m, heap_size = 0;
|
||||
int64_t j, n_for = 0, n_rev = 0;
|
||||
mm_match_t *m;
|
||||
mm_seed_t *m;
|
||||
mm128_t *a, *heap;
|
||||
|
||||
m = collect_matches(km, &n_m, max_occ, mi, mv, n_a, rep_len, n_mini_pos, mini_pos);
|
||||
m = mm_collect_matches(km, &n_m, qlen, max_occ, opt->max_max_occ, opt->occ_dist, mi, mv, n_a, rep_len, n_mini_pos, mini_pos);
|
||||
|
||||
heap = (mm128_t*)kmalloc(km, n_m * sizeof(mm128_t));
|
||||
a = (mm128_t*)kmalloc(km, *n_a * sizeof(mm128_t));
|
||||
@@ -159,23 +126,24 @@ static mm128_t *collect_seed_hits_heap(void *km, const mm_mapopt_t *opt, int max
|
||||
}
|
||||
ks_heapmake_heap(heap_size, heap);
|
||||
while (heap_size > 0) {
|
||||
mm_match_t *q = &m[heap->y>>32];
|
||||
mm_seed_t *q = &m[heap->y>>32];
|
||||
mm128_t *p;
|
||||
uint64_t r = heap->x;
|
||||
int32_t is_self, rpos = (uint32_t)r >> 1;
|
||||
if (skip_seed(opt->flag, r, q, qname, qlen, mi, &is_self)) continue;
|
||||
if ((r&1) == (q->q_pos&1)) { // forward strand
|
||||
p = &a[n_for++];
|
||||
p->x = (r&0xffffffff00000000ULL) | rpos;
|
||||
p->y = (uint64_t)q->q_span << 32 | q->q_pos >> 1;
|
||||
} else { // reverse strand
|
||||
p = &a[(*n_a) - (++n_rev)];
|
||||
p->x = 1ULL<<63 | (r&0xffffffff00000000ULL) | rpos;
|
||||
p->y = (uint64_t)q->q_span << 32 | (qlen - ((q->q_pos>>1) + 1 - q->q_span) - 1);
|
||||
if (!skip_seed(opt->flag, r, q, qname, qlen, mi, &is_self)) {
|
||||
if ((r&1) == (q->q_pos&1)) { // forward strand
|
||||
p = &a[n_for++];
|
||||
p->x = (r&0xffffffff00000000ULL) | rpos;
|
||||
p->y = (uint64_t)q->q_span << 32 | q->q_pos >> 1;
|
||||
} else { // reverse strand
|
||||
p = &a[(*n_a) - (++n_rev)];
|
||||
p->x = 1ULL<<63 | (r&0xffffffff00000000ULL) | rpos;
|
||||
p->y = (uint64_t)q->q_span << 32 | (qlen - ((q->q_pos>>1) + 1 - q->q_span) - 1);
|
||||
}
|
||||
p->y |= (uint64_t)q->seg_id << MM_SEED_SEG_SHIFT;
|
||||
if (q->is_tandem) p->y |= MM_SEED_TANDEM;
|
||||
if (is_self) p->y |= MM_SEED_SELF;
|
||||
}
|
||||
p->y |= (uint64_t)q->seg_id << MM_SEED_SEG_SHIFT;
|
||||
if (q->is_tandem) p->y |= MM_SEED_TANDEM;
|
||||
if (is_self) p->y |= MM_SEED_SELF;
|
||||
// update the heap
|
||||
if ((uint32_t)heap->y < q->n - 1) {
|
||||
++heap[0].y;
|
||||
@@ -205,14 +173,15 @@ static mm128_t *collect_seed_hits_heap(void *km, const mm_mapopt_t *opt, int max
|
||||
static mm128_t *collect_seed_hits(void *km, const mm_mapopt_t *opt, int max_occ, const mm_idx_t *mi, const char *qname, const mm128_v *mv, int qlen, int64_t *n_a, int *rep_len,
|
||||
int *n_mini_pos, uint64_t **mini_pos)
|
||||
{
|
||||
int i, k, n_m;
|
||||
mm_match_t *m;
|
||||
int i, n_m;
|
||||
mm_seed_t *m;
|
||||
mm128_t *a;
|
||||
m = collect_matches(km, &n_m, max_occ, mi, mv, n_a, rep_len, n_mini_pos, mini_pos);
|
||||
m = mm_collect_matches(km, &n_m, qlen, max_occ, opt->max_max_occ, opt->occ_dist, mi, mv, n_a, rep_len, n_mini_pos, mini_pos);
|
||||
a = (mm128_t*)kmalloc(km, *n_a * sizeof(mm128_t));
|
||||
for (i = 0, *n_a = 0; i < n_m; ++i) {
|
||||
mm_match_t *q = &m[i];
|
||||
mm_seed_t *q = &m[i];
|
||||
const uint64_t *r = q->cr;
|
||||
uint32_t k;
|
||||
for (k = 0; k < q->n; ++k) {
|
||||
int32_t is_self, rpos = (uint32_t)r[k] >> 1;
|
||||
mm128_t *p;
|
||||
@@ -238,11 +207,9 @@ static mm128_t *collect_seed_hits(void *km, const mm_mapopt_t *opt, int max_occ,
|
||||
static void chain_post(const mm_mapopt_t *opt, int max_chain_gap_ref, const mm_idx_t *mi, void *km, int qlen, int n_segs, const int *qlens, int *n_regs, mm_reg1_t *regs, mm128_t *a)
|
||||
{
|
||||
if (!(opt->flag & MM_F_ALL_CHAINS)) { // don't choose primary mapping(s)
|
||||
mm_set_parent(km, opt->mask_level, *n_regs, regs, opt->a * 2 + opt->b);
|
||||
mm_set_parent(km, opt->mask_level, opt->mask_len, *n_regs, regs, opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL, opt->alt_drop);
|
||||
if (n_segs <= 1) mm_select_sub(km, opt->pri_ratio, mi->k*2, opt->best_n, n_regs, regs);
|
||||
else mm_select_sub_multi(km, opt->pri_ratio, 0.2f, 0.7f, max_chain_gap_ref, mi->k*2, opt->best_n, n_segs, qlens, n_regs, regs);
|
||||
if (!(opt->flag & (MM_F_SPLICE|MM_F_SR|MM_F_NO_LJOIN))) // long join not working well without primary chains
|
||||
mm_join_long(km, opt, qlen, n_regs, regs, a);
|
||||
}
|
||||
}
|
||||
|
||||
@@ -251,7 +218,7 @@ static mm_reg1_t *align_regs(const mm_mapopt_t *opt, const mm_idx_t *mi, void *k
|
||||
if (!(opt->flag & MM_F_CIGAR)) return regs;
|
||||
regs = mm_align_skeleton(km, opt, mi, qlen, seq, n_regs, regs, a); // this calls mm_filter_regs()
|
||||
if (!(opt->flag & MM_F_ALL_CHAINS)) { // don't choose primary mapping(s)
|
||||
mm_set_parent(km, opt->mask_level, *n_regs, regs, opt->a * 2 + opt->b);
|
||||
mm_set_parent(km, opt->mask_level, opt->mask_len, *n_regs, regs, opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL, opt->alt_drop);
|
||||
mm_select_sub(km, opt->pri_ratio, mi->k*2, opt->best_n, n_regs, regs);
|
||||
mm_set_sam_pri(*n_regs, regs);
|
||||
}
|
||||
@@ -274,6 +241,7 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
|
||||
qlen_sum += qlens[i], n_regs[i] = 0, regs[i] = 0;
|
||||
|
||||
if (qlen_sum == 0 || n_segs <= 0 || n_segs > MM_MAX_SEG) return;
|
||||
if (opt->max_qlen > 0 && qlen_sum > opt->max_qlen) return;
|
||||
|
||||
hash = qname? __ac_X31_hash_string(qname) : 0;
|
||||
hash ^= __ac_Wang_hash(qlen_sum) + __ac_Wang_hash(opt->seed);
|
||||
@@ -301,17 +269,23 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
|
||||
if (max_chain_gap_ref < opt->max_gap) max_chain_gap_ref = opt->max_gap;
|
||||
} else max_chain_gap_ref = opt->max_gap;
|
||||
|
||||
a = mm_chain_dp(max_chain_gap_ref, max_chain_gap_qry, opt->bw, opt->max_chain_skip, opt->min_cnt, opt->min_chain_score, is_splice, n_segs, n_a, a, &n_regs0, &u, b->km);
|
||||
if (opt->flag & MM_F_RMQ) {
|
||||
a = mg_lchain_rmq(opt->max_gap, opt->rmq_inner_dist, opt->bw, opt->max_chain_skip, opt->rmq_size_cap, opt->min_cnt, opt->min_chain_score,
|
||||
opt->chain_gap_scale * 0.01 * mi->k, 0.0f, n_a, a, &n_regs0, &u, b->km);
|
||||
} else {
|
||||
a = mg_lchain_dp(max_chain_gap_ref, max_chain_gap_qry, opt->bw, opt->max_chain_skip, opt->max_chain_iter, opt->min_cnt, opt->min_chain_score,
|
||||
opt->chain_gap_scale * 0.01 * mi->k, 0.0f, is_splice, n_segs, n_a, a, &n_regs0, &u, b->km);
|
||||
}
|
||||
|
||||
if (opt->max_occ > opt->mid_occ && rep_len > 0) {
|
||||
if (opt->max_occ > opt->mid_occ && rep_len > 0 && !(opt->flag & MM_F_RMQ)) {
|
||||
int rechain = 0;
|
||||
if (n_regs0 > 0) { // test if the best chain has all the segments
|
||||
int n_chained_segs = 1, max = 0, max_i = -1, max_off = -1, off = 0;
|
||||
for (i = 0; i < n_regs0; ++i) { // find the best chain
|
||||
if (max < u[i]>>32) max = u[i]>>32, max_i = i, max_off = off;
|
||||
if (max < (int)(u[i]>>32)) max = u[i]>>32, max_i = i, max_off = off;
|
||||
off += (uint32_t)u[i];
|
||||
}
|
||||
for (i = 1; i < (uint32_t)u[max_i]; ++i) // count the number of segments in the best chain
|
||||
for (i = 1; i < (int32_t)u[max_i]; ++i) // count the number of segments in the best chain
|
||||
if ((a[max_off+i].y&MM_SEED_SEG_MASK) != (a[max_off+i-1].y&MM_SEED_SEG_MASK))
|
||||
++n_chained_segs;
|
||||
if (n_chained_segs < n_segs)
|
||||
@@ -323,11 +297,28 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
|
||||
kfree(b->km, mini_pos);
|
||||
if (opt->flag & MM_F_HEAP_SORT) a = collect_seed_hits_heap(b->km, opt, opt->max_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
|
||||
else a = collect_seed_hits(b->km, opt, opt->max_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
|
||||
a = mm_chain_dp(max_chain_gap_ref, max_chain_gap_qry, opt->bw, opt->max_chain_skip, opt->min_cnt, opt->min_chain_score, is_splice, n_segs, n_a, a, &n_regs0, &u, b->km);
|
||||
a = mg_lchain_dp(max_chain_gap_ref, max_chain_gap_qry, opt->bw, opt->max_chain_skip, opt->max_chain_iter, opt->min_cnt, opt->min_chain_score,
|
||||
opt->chain_gap_scale * 0.01 * mi->k, 0.0f, is_splice, n_segs, n_a, a, &n_regs0, &u, b->km);
|
||||
}
|
||||
} else if (opt->bw_long > opt->bw && (opt->flag & (MM_F_RMQ|MM_F_NO_LJOIN)) == 0 && n_segs == 1 && n_regs0 > 1) {
|
||||
int32_t st = (int32_t)a[0].y, en = (int32_t)a[(int32_t)u[0] - 1].y;
|
||||
if (qlen_sum - (en - st) > opt->rmq_rescue_size || en - st > qlen_sum * opt->rmq_rescue_ratio) {
|
||||
int32_t i;
|
||||
for (i = 0, n_a = 0; i < n_regs0; ++i) n_a += (int32_t)u[i];
|
||||
kfree(b->km, u);
|
||||
radix_sort_128x(a, a + n_a);
|
||||
a = mg_lchain_rmq(opt->max_gap, opt->rmq_inner_dist, opt->bw_long, opt->max_chain_skip, opt->rmq_size_cap, opt->min_cnt, opt->min_chain_score,
|
||||
opt->chain_gap_scale * 0.01 * mi->k, 0.0f, n_a, a, &n_regs0, &u, b->km);
|
||||
}
|
||||
}
|
||||
b->frag_gap = max_chain_gap_ref;
|
||||
b->rep_len = rep_len;
|
||||
|
||||
regs0 = mm_gen_regs(b->km, hash, qlen_sum, n_regs0, u, a);
|
||||
if (mi->n_alt) {
|
||||
mm_mark_alt(mi, n_regs0, regs0);
|
||||
mm_hit_sort(b->km, &n_regs0, regs0, opt->alt_drop); // this step can be merged into mm_gen_regs(); will do if this shows up in profile
|
||||
}
|
||||
|
||||
if (mm_dbg_flag & MM_DBG_PRINT_SEED)
|
||||
for (j = 0; j < n_regs0; ++j)
|
||||
@@ -347,7 +338,7 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
|
||||
seg = mm_seg_gen(b->km, hash, n_segs, qlens, n_regs0, regs0, n_regs, regs, a); // split fragment chain to separate segment chains
|
||||
free(regs0);
|
||||
for (i = 0; i < n_segs; ++i) {
|
||||
mm_set_parent(b->km, opt->mask_level, n_regs[i], regs[i], opt->a * 2 + opt->b); // update mm_reg1_t::parent
|
||||
mm_set_parent(b->km, opt->mask_level, opt->mask_len, n_regs[i], regs[i], opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL, opt->alt_drop); // update mm_reg1_t::parent
|
||||
regs[i] = align_regs(opt, mi, b->km, qlens[i], seqs[i], &n_regs[i], regs[i], seg[i].a);
|
||||
mm_set_mapq(b->km, n_regs[i], regs[i], opt->min_chain_score, opt->a, rep_len, is_sr);
|
||||
}
|
||||
@@ -385,18 +376,23 @@ mm_reg1_t *mm_map(const mm_idx_t *mi, int qlen, const char *seq, int *n_regs, mm
|
||||
**************************/
|
||||
|
||||
typedef struct {
|
||||
int mini_batch_size, n_processed, n_threads, n_fp;
|
||||
int n_processed, n_threads, n_fp;
|
||||
int64_t mini_batch_size;
|
||||
const mm_mapopt_t *opt;
|
||||
mm_bseq_file_t **fp;
|
||||
const mm_idx_t *mi;
|
||||
kstring_t str;
|
||||
|
||||
int n_parts;
|
||||
uint32_t *rid_shift;
|
||||
FILE *fp_split, **fp_parts;
|
||||
} pipeline_t;
|
||||
|
||||
typedef struct {
|
||||
const pipeline_t *p;
|
||||
int n_seq, n_frag;
|
||||
mm_bseq1_t *seq;
|
||||
int *n_reg, *seg_off, *n_seg;
|
||||
int *n_reg, *seg_off, *n_seg, *rep_len, *frag_gap;
|
||||
mm_reg1_t **reg;
|
||||
mm_tbuf_t **buf;
|
||||
} step_t;
|
||||
@@ -417,10 +413,17 @@ static void worker_for(void *_data, long i, int tid) // kt_for() callback
|
||||
qseqs[j] = s->seq[off + j].seq;
|
||||
}
|
||||
if (s->p->opt->flag & MM_F_INDEPEND_SEG) {
|
||||
for (j = 0; j < s->n_seg[i]; ++j)
|
||||
for (j = 0; j < s->n_seg[i]; ++j) {
|
||||
mm_map_frag(s->p->mi, 1, &qlens[j], &qseqs[j], &s->n_reg[off+j], &s->reg[off+j], b, s->p->opt, s->seq[off+j].name);
|
||||
s->rep_len[off + j] = b->rep_len;
|
||||
s->frag_gap[off + j] = b->frag_gap;
|
||||
}
|
||||
} else {
|
||||
mm_map_frag(s->p->mi, s->n_seg[i], qlens, qseqs, &s->n_reg[off], &s->reg[off], b, s->p->opt, s->seq[off].name);
|
||||
for (j = 0; j < s->n_seg[i]; ++j) {
|
||||
s->rep_len[off + j] = b->rep_len;
|
||||
s->frag_gap[off + j] = b->frag_gap;
|
||||
}
|
||||
}
|
||||
for (j = 0; j < s->n_seg[i]; ++j) // flip the query strand and coordinate to the original read strand
|
||||
if (s->n_seg[i] == 2 && ((j == 0 && (pe_ori>>1&1)) || (j == 1 && (pe_ori&1)))) {
|
||||
@@ -436,17 +439,75 @@ static void worker_for(void *_data, long i, int tid) // kt_for() callback
|
||||
}
|
||||
}
|
||||
|
||||
static void merge_hits(step_t *s)
|
||||
{
|
||||
int f, i, k0, k, max_seg = 0, *n_reg_part, *rep_len_part, *frag_gap_part, *qlens;
|
||||
void *km;
|
||||
FILE **fp = s->p->fp_parts;
|
||||
const mm_mapopt_t *opt = s->p->opt;
|
||||
|
||||
km = km_init();
|
||||
for (f = 0; f < s->n_frag; ++f)
|
||||
max_seg = max_seg > s->n_seg[f]? max_seg : s->n_seg[f];
|
||||
qlens = CALLOC(int, max_seg + s->p->n_parts * 3);
|
||||
n_reg_part = qlens + max_seg;
|
||||
rep_len_part = n_reg_part + s->p->n_parts;
|
||||
frag_gap_part = rep_len_part + s->p->n_parts;
|
||||
for (f = 0, k = k0 = 0; f < s->n_frag; ++f) {
|
||||
k0 = k;
|
||||
for (i = 0; i < s->n_seg[f]; ++i, ++k) {
|
||||
int j, l, t, rep_len = 0;
|
||||
qlens[i] = s->seq[k].l_seq;
|
||||
for (j = 0, s->n_reg[k] = 0; j < s->p->n_parts; ++j) {
|
||||
mm_err_fread(&n_reg_part[j], sizeof(int), 1, fp[j]);
|
||||
mm_err_fread(&rep_len_part[j], sizeof(int), 1, fp[j]);
|
||||
mm_err_fread(&frag_gap_part[j], sizeof(int), 1, fp[j]);
|
||||
s->n_reg[k] += n_reg_part[j];
|
||||
if (rep_len < rep_len_part[j])
|
||||
rep_len = rep_len_part[j];
|
||||
}
|
||||
s->reg[k] = CALLOC(mm_reg1_t, s->n_reg[k]);
|
||||
for (j = 0, l = 0; j < s->p->n_parts; ++j) {
|
||||
for (t = 0; t < n_reg_part[j]; ++t, ++l) {
|
||||
mm_reg1_t *r = &s->reg[k][l];
|
||||
uint32_t capacity;
|
||||
mm_err_fread(r, sizeof(mm_reg1_t), 1, fp[j]);
|
||||
r->rid += s->p->rid_shift[j];
|
||||
if (opt->flag & MM_F_CIGAR) {
|
||||
mm_err_fread(&capacity, 4, 1, fp[j]);
|
||||
r->p = (mm_extra_t*)calloc(capacity, 4);
|
||||
r->p->capacity = capacity;
|
||||
mm_err_fread(r->p, r->p->capacity, 4, fp[j]);
|
||||
}
|
||||
}
|
||||
}
|
||||
mm_hit_sort(km, &s->n_reg[k], s->reg[k], opt->alt_drop);
|
||||
mm_set_parent(km, opt->mask_level, opt->mask_len, s->n_reg[k], s->reg[k], opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL, opt->alt_drop);
|
||||
if (!(opt->flag & MM_F_ALL_CHAINS)) {
|
||||
mm_select_sub(km, opt->pri_ratio, s->p->mi->k*2, opt->best_n, &s->n_reg[k], s->reg[k]);
|
||||
mm_set_sam_pri(s->n_reg[k], s->reg[k]);
|
||||
}
|
||||
mm_set_mapq(km, s->n_reg[k], s->reg[k], opt->min_chain_score, opt->a, rep_len, !!(opt->flag & MM_F_SR));
|
||||
}
|
||||
if (s->n_seg[f] == 2 && opt->pe_ori >= 0 && (opt->flag&MM_F_CIGAR))
|
||||
mm_pair(km, frag_gap_part[0], opt->pe_bonus, opt->a * 2 + opt->b, opt->a, qlens, &s->n_reg[k0], &s->reg[k0]);
|
||||
}
|
||||
free(qlens);
|
||||
km_destroy(km);
|
||||
}
|
||||
|
||||
static void *worker_pipeline(void *shared, int step, void *in)
|
||||
{
|
||||
int i, j, k;
|
||||
pipeline_t *p = (pipeline_t*)shared;
|
||||
if (step == 0) { // step 0: read sequences
|
||||
int with_qual = (!!(p->opt->flag & MM_F_OUT_SAM) && !(p->opt->flag & MM_F_NO_QUAL));
|
||||
int with_comment = !!(p->opt->flag & MM_F_COPY_COMMENT);
|
||||
int frag_mode = (p->n_fp > 1 || !!(p->opt->flag & MM_F_FRAG_MODE));
|
||||
step_t *s;
|
||||
s = (step_t*)calloc(1, sizeof(step_t));
|
||||
if (p->n_fp > 1) s->seq = mm_bseq_read_frag(p->n_fp, p->fp, p->mini_batch_size, with_qual, &s->n_seq);
|
||||
else s->seq = mm_bseq_read2(p->fp[0], p->mini_batch_size, with_qual, frag_mode, &s->n_seq);
|
||||
if (p->n_fp > 1) s->seq = mm_bseq_read_frag2(p->n_fp, p->fp, p->mini_batch_size, with_qual, with_comment, &s->n_seq);
|
||||
else s->seq = mm_bseq_read3(p->fp[0], p->mini_batch_size, with_qual, with_comment, frag_mode, &s->n_seq);
|
||||
if (s->seq) {
|
||||
s->p = p;
|
||||
for (i = 0; i < s->n_seq; ++i)
|
||||
@@ -454,9 +515,11 @@ static void *worker_pipeline(void *shared, int step, void *in)
|
||||
s->buf = (mm_tbuf_t**)calloc(p->n_threads, sizeof(mm_tbuf_t*));
|
||||
for (i = 0; i < p->n_threads; ++i)
|
||||
s->buf[i] = mm_tbuf_init();
|
||||
s->n_reg = (int*)calloc(3 * s->n_seq, sizeof(int));
|
||||
s->seg_off = s->n_reg + s->n_seq; // seg_off and n_seg are allocated together with n_reg
|
||||
s->n_reg = (int*)calloc(5 * s->n_seq, sizeof(int));
|
||||
s->seg_off = s->n_reg + s->n_seq; // seg_off, n_seg, rep_len and frag_gap are allocated together with n_reg
|
||||
s->n_seg = s->seg_off + s->n_seq;
|
||||
s->rep_len = s->n_seg + s->n_seq;
|
||||
s->frag_gap = s->rep_len + s->n_seq;
|
||||
s->reg = (mm_reg1_t**)calloc(s->n_seq, sizeof(mm_reg1_t*));
|
||||
for (i = 1, j = 0; i <= s->n_seq; ++i)
|
||||
if (i == s->n_seq || !frag_mode || !mm_qname_same(s->seq[i-1].name, s->seq[i].name)) {
|
||||
@@ -467,7 +530,8 @@ static void *worker_pipeline(void *shared, int step, void *in)
|
||||
return s;
|
||||
} else free(s);
|
||||
} else if (step == 1) { // step 1: map
|
||||
kt_for(p->n_threads, worker_for, in, ((step_t*)in)->n_frag);
|
||||
if (p->n_parts > 0) merge_hits((step_t*)in);
|
||||
else kt_for(p->n_threads, worker_for, in, ((step_t*)in)->n_frag);
|
||||
return in;
|
||||
} else if (step == 2) { // step 2: output
|
||||
void *km = 0;
|
||||
@@ -480,20 +544,36 @@ static void *worker_pipeline(void *shared, int step, void *in)
|
||||
int seg_st = s->seg_off[k], seg_en = s->seg_off[k] + s->n_seg[k];
|
||||
for (i = seg_st; i < seg_en; ++i) {
|
||||
mm_bseq1_t *t = &s->seq[i];
|
||||
for (j = 0; j < s->n_reg[i]; ++j) {
|
||||
mm_reg1_t *r = &s->reg[i][j];
|
||||
assert(!r->sam_pri || r->id == r->parent);
|
||||
if ((p->opt->flag & MM_F_NO_PRINT_2ND) && r->id != r->parent)
|
||||
continue;
|
||||
if (p->opt->split_prefix && p->n_parts == 0) { // then write to temporary files
|
||||
mm_err_fwrite(&s->n_reg[i], sizeof(int), 1, p->fp_split);
|
||||
mm_err_fwrite(&s->rep_len[i], sizeof(int), 1, p->fp_split);
|
||||
mm_err_fwrite(&s->frag_gap[i], sizeof(int), 1, p->fp_split);
|
||||
for (j = 0; j < s->n_reg[i]; ++j) {
|
||||
mm_reg1_t *r = &s->reg[i][j];
|
||||
mm_err_fwrite(r, sizeof(mm_reg1_t), 1, p->fp_split);
|
||||
if (p->opt->flag & MM_F_CIGAR) {
|
||||
mm_err_fwrite(&r->p->capacity, 4, 1, p->fp_split);
|
||||
mm_err_fwrite(r->p, r->p->capacity, 4, p->fp_split);
|
||||
}
|
||||
}
|
||||
} else if (s->n_reg[i] > 0) { // the query has at least one hit
|
||||
for (j = 0; j < s->n_reg[i]; ++j) {
|
||||
mm_reg1_t *r = &s->reg[i][j];
|
||||
assert(!r->sam_pri || r->id == r->parent);
|
||||
if ((p->opt->flag & MM_F_NO_PRINT_2ND) && r->id != r->parent)
|
||||
continue;
|
||||
if (p->opt->flag & MM_F_OUT_SAM)
|
||||
mm_write_sam3(&p->str, mi, t, i - seg_st, j, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag, s->rep_len[i]);
|
||||
else
|
||||
mm_write_paf3(&p->str, mi, t, r, km, p->opt->flag, s->rep_len[i]);
|
||||
mm_err_puts(p->str.s);
|
||||
}
|
||||
} else if ((p->opt->flag & MM_F_PAF_NO_HIT) || ((p->opt->flag & MM_F_OUT_SAM) && !(p->opt->flag & MM_F_SAM_HIT_ONLY))) { // output an empty hit, if requested
|
||||
if (p->opt->flag & MM_F_OUT_SAM)
|
||||
mm_write_sam2(&p->str, mi, t, i - seg_st, j, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag);
|
||||
mm_write_sam3(&p->str, mi, t, i - seg_st, -1, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag, s->rep_len[i]);
|
||||
else
|
||||
mm_write_paf(&p->str, mi, t, r, km, p->opt->flag);
|
||||
puts(p->str.s);
|
||||
}
|
||||
if (s->n_reg[i] == 0 && (p->opt->flag & MM_F_OUT_SAM)) {
|
||||
mm_write_sam2(&p->str, mi, t, i - seg_st, -1, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag);
|
||||
puts(p->str.s);
|
||||
mm_write_paf3(&p->str, mi, t, 0, 0, p->opt->flag, s->rep_len[i]);
|
||||
mm_err_puts(p->str.s);
|
||||
}
|
||||
}
|
||||
for (i = seg_st; i < seg_en; ++i) {
|
||||
@@ -501,9 +581,10 @@ static void *worker_pipeline(void *shared, int step, void *in)
|
||||
free(s->reg[i]);
|
||||
free(s->seq[i].seq); free(s->seq[i].name);
|
||||
if (s->seq[i].qual) free(s->seq[i].qual);
|
||||
if (s->seq[i].comment) free(s->seq[i].comment);
|
||||
}
|
||||
}
|
||||
free(s->reg); free(s->n_reg); free(s->seq); // seg_off and n_seg were allocated with reg; no memory leak here
|
||||
free(s->reg); free(s->n_reg); free(s->seq); // seg_off, n_seg, rep_len and frag_gap were allocated with reg; no memory leak here
|
||||
km_destroy(km);
|
||||
if (mm_verbose >= 3)
|
||||
fprintf(stderr, "[M::%s::%.3f*%.2f] mapped %d sequences\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), s->n_seq);
|
||||
@@ -512,32 +593,44 @@ static void *worker_pipeline(void *shared, int step, void *in)
|
||||
return 0;
|
||||
}
|
||||
|
||||
static mm_bseq_file_t **open_bseqs(int n, const char **fn)
|
||||
{
|
||||
mm_bseq_file_t **fp;
|
||||
int i, j;
|
||||
fp = (mm_bseq_file_t**)calloc(n, sizeof(mm_bseq_file_t*));
|
||||
for (i = 0; i < n; ++i) {
|
||||
if ((fp[i] = mm_bseq_open(fn[i])) == 0) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "ERROR: failed to open file '%s': %s\n", fn[i], strerror(errno));
|
||||
for (j = 0; j < i; ++j)
|
||||
mm_bseq_close(fp[j]);
|
||||
free(fp);
|
||||
return 0;
|
||||
}
|
||||
}
|
||||
return fp;
|
||||
}
|
||||
|
||||
int mm_map_file_frag(const mm_idx_t *idx, int n_segs, const char **fn, const mm_mapopt_t *opt, int n_threads)
|
||||
{
|
||||
int i, j, pl_threads;
|
||||
int i, pl_threads;
|
||||
pipeline_t pl;
|
||||
if (n_segs < 1) return -1;
|
||||
memset(&pl, 0, sizeof(pipeline_t));
|
||||
pl.n_fp = n_segs;
|
||||
pl.fp = (mm_bseq_file_t**)calloc(n_segs, sizeof(mm_bseq_file_t*));
|
||||
for (i = 0; i < n_segs; ++i) {
|
||||
pl.fp[i] = mm_bseq_open(fn[i]);
|
||||
if (pl.fp[i] == 0) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "ERROR: failed to open file '%s'\n", fn[i]);
|
||||
for (j = 0; j < i; ++j)
|
||||
mm_bseq_close(pl.fp[j]);
|
||||
free(pl.fp);
|
||||
return -1;
|
||||
}
|
||||
}
|
||||
pl.fp = open_bseqs(pl.n_fp, fn);
|
||||
if (pl.fp == 0) return -1;
|
||||
pl.opt = opt, pl.mi = idx;
|
||||
pl.n_threads = n_threads > 1? n_threads : 1;
|
||||
pl.mini_batch_size = opt->mini_batch_size;
|
||||
if (opt->split_prefix)
|
||||
pl.fp_split = mm_split_init(opt->split_prefix, idx);
|
||||
pl_threads = n_threads == 1? 1 : (opt->flag&MM_F_2_IO_THREADS)? 3 : 2;
|
||||
kt_pipeline(pl_threads, worker_pipeline, &pl, 3);
|
||||
|
||||
free(pl.str.s);
|
||||
for (i = 0; i < n_segs; ++i)
|
||||
if (pl.fp_split) fclose(pl.fp_split);
|
||||
for (i = 0; i < pl.n_fp; ++i)
|
||||
mm_bseq_close(pl.fp[i]);
|
||||
free(pl.fp);
|
||||
return 0;
|
||||
@@ -547,3 +640,48 @@ int mm_map_file(const mm_idx_t *idx, const char *fn, const mm_mapopt_t *opt, int
|
||||
{
|
||||
return mm_map_file_frag(idx, 1, &fn, opt, n_threads);
|
||||
}
|
||||
|
||||
int mm_split_merge(int n_segs, const char **fn, const mm_mapopt_t *opt, int n_split_idx)
|
||||
{
|
||||
int i;
|
||||
pipeline_t pl;
|
||||
mm_idx_t *mi;
|
||||
if (n_segs < 1 || n_split_idx < 1) return -1;
|
||||
memset(&pl, 0, sizeof(pipeline_t));
|
||||
pl.n_fp = n_segs;
|
||||
pl.fp = open_bseqs(pl.n_fp, fn);
|
||||
if (pl.fp == 0) return -1;
|
||||
pl.opt = opt;
|
||||
pl.mini_batch_size = opt->mini_batch_size;
|
||||
|
||||
pl.n_parts = n_split_idx;
|
||||
pl.fp_parts = CALLOC(FILE*, pl.n_parts);
|
||||
pl.rid_shift = CALLOC(uint32_t, pl.n_parts);
|
||||
pl.mi = mi = mm_split_merge_prep(opt->split_prefix, n_split_idx, pl.fp_parts, pl.rid_shift);
|
||||
if (pl.mi == 0) {
|
||||
free(pl.fp_parts);
|
||||
free(pl.rid_shift);
|
||||
return -1;
|
||||
}
|
||||
for (i = n_split_idx - 1; i > 0; --i)
|
||||
pl.rid_shift[i] = pl.rid_shift[i - 1];
|
||||
for (pl.rid_shift[0] = 0, i = 1; i < n_split_idx; ++i)
|
||||
pl.rid_shift[i] += pl.rid_shift[i - 1];
|
||||
if (opt->flag & MM_F_OUT_SAM)
|
||||
for (i = 0; i < (int32_t)pl.mi->n_seq; ++i)
|
||||
printf("@SQ\tSN:%s\tLN:%d\n", pl.mi->seq[i].name, pl.mi->seq[i].len);
|
||||
|
||||
kt_pipeline(2, worker_pipeline, &pl, 3);
|
||||
|
||||
free(pl.str.s);
|
||||
mm_idx_destroy(mi);
|
||||
free(pl.rid_shift);
|
||||
for (i = 0; i < n_split_idx; ++i)
|
||||
fclose(pl.fp_parts[i]);
|
||||
free(pl.fp_parts);
|
||||
for (i = 0; i < pl.n_fp; ++i)
|
||||
mm_bseq_close(pl.fp[i]);
|
||||
free(pl.fp);
|
||||
mm_split_rm_tmp(opt->split_prefix, n_split_idx);
|
||||
return 0;
|
||||
}
|
||||
|
||||
@@ -29,6 +29,14 @@
|
||||
#define MM_F_REV_ONLY 0x200000
|
||||
#define MM_F_HEAP_SORT 0x400000
|
||||
#define MM_F_ALL_CHAINS 0x800000
|
||||
#define MM_F_OUT_MD 0x1000000
|
||||
#define MM_F_COPY_COMMENT 0x2000000
|
||||
#define MM_F_EQX 0x4000000 // use =/X instead of M
|
||||
#define MM_F_PAF_NO_HIT 0x8000000 // output unmapped reads to PAF
|
||||
#define MM_F_NO_END_FLT 0x10000000
|
||||
#define MM_F_HARD_MLEVEL 0x20000000
|
||||
#define MM_F_SAM_HIT_ONLY 0x40000000
|
||||
#define MM_F_RMQ 0x80000000LL
|
||||
|
||||
#define MM_I_HPC 0x1
|
||||
#define MM_I_NO_SEQ 0x2
|
||||
@@ -51,14 +59,18 @@ typedef struct {
|
||||
char *name; // name of the db sequence
|
||||
uint64_t offset; // offset in mm_idx_t::S
|
||||
uint32_t len; // length
|
||||
uint32_t is_alt;
|
||||
} mm_idx_seq_t;
|
||||
|
||||
typedef struct {
|
||||
int32_t b, w, k, flag;
|
||||
uint32_t n_seq; // number of reference sequences
|
||||
int32_t index;
|
||||
int32_t n_alt;
|
||||
mm_idx_seq_t *seq; // sequence name, length and offset
|
||||
uint32_t *S; // 4-bit packed sequence
|
||||
struct mm_idx_bucket_s *B; // index (hidden)
|
||||
struct mm_idx_intv_s *I; // intervals (hidden)
|
||||
void *km, *h;
|
||||
} mm_idx_t;
|
||||
|
||||
@@ -82,7 +94,7 @@ typedef struct {
|
||||
int32_t mlen, blen; // seeded exact match length; seeded alignment block length
|
||||
int32_t n_sub; // number of suboptimal mappings
|
||||
int32_t score0; // initial chaining score (before chain merging/spliting)
|
||||
uint32_t mapq:8, split:2, rev:1, inv:1, sam_pri:1, proper_frag:1, pe_thru:1, seg_split:1, seg_id:8, split_inv:1, dummy:7;
|
||||
uint32_t mapq:8, split:2, rev:1, inv:1, sam_pri:1, proper_frag:1, pe_thru:1, seg_split:1, seg_id:8, split_inv:1, is_alt:1, dummy:6;
|
||||
uint32_t hash;
|
||||
float div;
|
||||
mm_extra_t *p;
|
||||
@@ -91,31 +103,39 @@ typedef struct {
|
||||
// indexing and mapping options
|
||||
typedef struct {
|
||||
short k, w, flag, bucket_bits;
|
||||
int mini_batch_size;
|
||||
int64_t mini_batch_size;
|
||||
uint64_t batch_size;
|
||||
} mm_idxopt_t;
|
||||
|
||||
typedef struct {
|
||||
int64_t flag; // see MM_F_* macros
|
||||
int seed;
|
||||
int sdust_thres; // score threshold for SDUST; 0 to disable
|
||||
int flag; // see MM_F_* macros
|
||||
|
||||
int bw; // bandwidth
|
||||
int max_qlen; // max query length
|
||||
|
||||
int bw, bw_long; // bandwidth
|
||||
int max_gap, max_gap_ref; // break a chain if there are no minimizers in a max_gap window
|
||||
int max_frag_len;
|
||||
int max_chain_skip;
|
||||
int max_chain_skip, max_chain_iter;
|
||||
int min_cnt; // min number of minimizers on each chain
|
||||
int min_chain_score; // min chaining score
|
||||
float chain_gap_scale;
|
||||
int rmq_size_cap, rmq_inner_dist;
|
||||
int rmq_rescue_size;
|
||||
float rmq_rescue_ratio;
|
||||
|
||||
float mask_level;
|
||||
int mask_len;
|
||||
float pri_ratio;
|
||||
int best_n; // top best_n chains are subjected to DP alignment
|
||||
|
||||
int max_join_long, max_join_short;
|
||||
int min_join_flank_sc;
|
||||
float alt_drop;
|
||||
|
||||
int a, b, q, e, q2, e2; // matching score, mismatch, gap-open and gap-ext penalties
|
||||
int sc_ambi; // score when one or both bases are "N"
|
||||
int noncan; // cost of non-canonical splicing sites
|
||||
int junc_bonus;
|
||||
int zdrop, zdrop_inv; // break alignment if alignment score drops too fast along the diagonal
|
||||
int end_bonus;
|
||||
int min_dp_max; // drop an alignment if the score of the max scoring segment is below this threshold
|
||||
@@ -126,9 +146,13 @@ typedef struct {
|
||||
int pe_ori, pe_bonus;
|
||||
|
||||
float mid_occ_frac; // only used by mm_mapopt_update(); see below
|
||||
int32_t min_mid_occ, max_mid_occ;
|
||||
int32_t mid_occ; // ignore seeds with occurrences above this threshold
|
||||
int32_t max_occ;
|
||||
int mini_batch_size; // size of a batch of query bases to process in parallel
|
||||
int32_t max_occ, max_max_occ, occ_dist;
|
||||
int64_t mini_batch_size; // size of a batch of query bases to process in parallel
|
||||
int64_t max_sw_mat;
|
||||
|
||||
const char *split_prefix;
|
||||
} mm_mapopt_t;
|
||||
|
||||
// index reader
|
||||
@@ -213,6 +237,36 @@ void mm_idx_reader_close(mm_idx_reader_t *r);
|
||||
|
||||
int mm_idx_reader_eof(const mm_idx_reader_t *r);
|
||||
|
||||
/**
|
||||
* Check whether the file contains a minimap2 index
|
||||
*
|
||||
* @param fn file name
|
||||
*
|
||||
* @return the file size if fn is an index file; 0 if fn is not.
|
||||
*/
|
||||
int64_t mm_idx_is_idx(const char *fn);
|
||||
|
||||
/**
|
||||
* Load a part of an index
|
||||
*
|
||||
* Given a uni-part index, this function loads the entire index into memory.
|
||||
* Given a multi-part index, it loads one part only and places the file pointer
|
||||
* at the end of that part.
|
||||
*
|
||||
* @param fp pointer to FILE object
|
||||
*
|
||||
* @return minimap2 index read from fp
|
||||
*/
|
||||
mm_idx_t *mm_idx_load(FILE *fp);
|
||||
|
||||
/**
|
||||
* Append an index (or one part of a full index) to file
|
||||
*
|
||||
* @param fp pointer to FILE object
|
||||
* @param mi minimap2 index
|
||||
*/
|
||||
void mm_idx_dump(FILE *fp, const mm_idx_t *mi);
|
||||
|
||||
/**
|
||||
* Create an index from strings in memory
|
||||
*
|
||||
@@ -261,6 +315,8 @@ mm_tbuf_t *mm_tbuf_init(void);
|
||||
*/
|
||||
void mm_tbuf_destroy(mm_tbuf_t *b);
|
||||
|
||||
void *mm_tbuf_get_km(mm_tbuf_t *b);
|
||||
|
||||
/**
|
||||
* Align a query sequence against an index
|
||||
*
|
||||
@@ -297,11 +353,31 @@ int mm_map_file(const mm_idx_t *idx, const char *fn, const mm_mapopt_t *opt, int
|
||||
|
||||
int mm_map_file_frag(const mm_idx_t *idx, int n_segs, const char **fn, const mm_mapopt_t *opt, int n_threads);
|
||||
|
||||
/**
|
||||
* Generate the cs tag (new in 2.12)
|
||||
*
|
||||
* @param km memory blocks; set to NULL if unsure
|
||||
* @param buf buffer to write the cs/MD tag; typicall NULL on the first call
|
||||
* @param max_len max length of the buffer; typically set to 0 on the first call
|
||||
* @param mi index
|
||||
* @param r alignment
|
||||
* @param seq query sequence
|
||||
* @param no_iden true to use : instead of =
|
||||
*
|
||||
* @return the length of cs
|
||||
*/
|
||||
int mm_gen_cs(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int no_iden);
|
||||
int mm_gen_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq);
|
||||
|
||||
// query sequence name and sequence in the minimap2 index
|
||||
int mm_idx_index_name(mm_idx_t *mi);
|
||||
int mm_idx_name2id(const mm_idx_t *mi, const char *name);
|
||||
int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq);
|
||||
|
||||
int mm_idx_alt_read(mm_idx_t *mi, const char *fn);
|
||||
int mm_idx_bed_read(mm_idx_t *mi, const char *fn, int read_junc);
|
||||
int mm_idx_bed_junc(const mm_idx_t *mi, int32_t ctg, int32_t st, int32_t en, uint8_t *s);
|
||||
|
||||
// deprecated APIs for backward compatibility
|
||||
void mm_mapopt_init(mm_mapopt_t *opt);
|
||||
mm_idx_t *mm_idx_build(const char *fn, int w, int k, int flag, int n_threads);
|
||||
|
||||
+171
-41
@@ -1,4 +1,4 @@
|
||||
.TH minimap2 1 "24 February 2018" "minimap2-2.9 (r720)" "Bioinformatics tools"
|
||||
.TH minimap2 1 "26 May 2021" "minimap2-2.19 (r1057)" "Bioinformatics tools"
|
||||
.SH NAME
|
||||
.PP
|
||||
minimap2 - mapping and alignment between collections of DNA sequences
|
||||
@@ -121,20 +121,52 @@ provided as the target sequences, options
|
||||
.BR -w ,
|
||||
.B -I
|
||||
will be effectively overridden by the options stored in the index file.
|
||||
.TP
|
||||
.BI --alt \ FILE
|
||||
List of ALT contigs [null]
|
||||
.TP
|
||||
.BI --alt-drop \ FLOAT
|
||||
Drop ALT hits by
|
||||
.I FLOAT
|
||||
fraction when ranking and computing mapping quality [0.15]
|
||||
.SS Mapping options
|
||||
.TP 10
|
||||
.BI -f \ FLOAT
|
||||
Ignore top
|
||||
.BI -f \ FLOAT | INT1 [, INT2 ]
|
||||
If fraction, ignore top
|
||||
.I FLOAT
|
||||
fraction of most frequent minimizers [0.0002]
|
||||
fraction of most frequent minimizers [0.0002]. If integer,
|
||||
ignore minimizers occuring more than
|
||||
.I INT1
|
||||
times.
|
||||
.I INT2
|
||||
is only effective in the
|
||||
.B --sr
|
||||
or
|
||||
.B -xsr
|
||||
mode, which sets the threshold for a second round of seeding.
|
||||
.TP
|
||||
.BI -g \ INT
|
||||
.BI -U \ INT1 [, INT2 ]
|
||||
Lower and upper bounds of k-mer occurrences [10,1000000]. The final k-mer occurrence threshold is
|
||||
.RI max{ INT1 ,\ min{ INT2 ,
|
||||
.BR -f }}.
|
||||
This option prevents excessively small or large
|
||||
.B -f
|
||||
estimated from the input reference. It deprecates
|
||||
.B --min-occ-floor
|
||||
in earlier versions of minimap2.
|
||||
.TP
|
||||
.BI -e \ INT
|
||||
Sample a high-frequency minimizer every
|
||||
.I INT
|
||||
basepairs [500].
|
||||
.TP
|
||||
.BI -g \ NUM
|
||||
Stop chain enlongation if there are no minimizers within
|
||||
.IR INT -bp
|
||||
[10000].
|
||||
.IR NUM -bp
|
||||
[10k].
|
||||
.TP
|
||||
.BI -r \ INT
|
||||
Bandwidth used in chaining and DP-based alignment [500]. This option
|
||||
.BI -r \ NUM
|
||||
Bandwidth used in chaining and DP-based alignment [500,20k]. This option
|
||||
approximately controls the maximum gap size.
|
||||
.TP
|
||||
.BI -n \ INT
|
||||
@@ -176,7 +208,7 @@ Primarily used for all-vs-all read overlapping.
|
||||
.BI -p \ FLOAT
|
||||
Minimal secondary-to-primary score ratio to output secondary mappings [0.8].
|
||||
Between two chains overlaping over half of the shorter chain (controlled by
|
||||
.BR --mask-level ),
|
||||
.BR -M ),
|
||||
the chain with a lower score is secondary to the chain with a higher score.
|
||||
If the ratio of the scores is below
|
||||
.IR FLOAT ,
|
||||
@@ -209,14 +241,39 @@ Mark as secondary a chain that overlaps with a better chain by
|
||||
.I FLOAT
|
||||
or more of the shorter chain [0.5]
|
||||
.TP
|
||||
.BR --rmq = no | yes
|
||||
Use the minigraph chaining algorithm [no]. The minigraph algorithm is better
|
||||
for aligning contigs through long INDELs.
|
||||
.TP
|
||||
.B --hard-mask-level
|
||||
Honor option
|
||||
.B -M
|
||||
and disable a heurstic to save unmapped subsequences and disables
|
||||
.BR --mask-len .
|
||||
.TP
|
||||
.BI --mask-len \ NUM
|
||||
Keep an alignment if dropping it leaves an unaligned region on query longer than
|
||||
.IR INT
|
||||
[inf]. Effective without
|
||||
.BR --hard-mask-level .
|
||||
.TP
|
||||
.BI --max-chain-skip \ INT
|
||||
A heuristics that stops chaining early [50]. Minimap2 uses dynamic programming
|
||||
A heuristics that stops chaining early [25]. Minimap2 uses dynamic programming
|
||||
for chaining. The time complexity is quadratic in the number of seeds. This
|
||||
option makes minimap2 exits the inner loop if it repeatedly sees seeds already
|
||||
on chains. Set
|
||||
.I INT
|
||||
to a large number to switch off this heurstics.
|
||||
.TP
|
||||
.BI --max-chain-iter \ INT
|
||||
Check up to
|
||||
.I INT
|
||||
partial chains during chaining [5000]. This is a heuristic to avoid quadratic
|
||||
time complexity in the worst case.
|
||||
.TP
|
||||
.BI --chain-gap-scale \ FLOAT
|
||||
Scale of gap cost during chaining [1.0]
|
||||
.TP
|
||||
.B --no-long-join
|
||||
Disable the long gap patching heuristic. When this option is applied, the
|
||||
maximum alignment gap is mostly controlled by
|
||||
@@ -231,6 +288,9 @@ applies a second round of chaining with a higher minimizer occurrence threshold
|
||||
if no good chain is found. In addition, minimap2 attempts to patch gaps between
|
||||
seeds with ungapped alignment.
|
||||
.TP
|
||||
.BI --split-prefix \ STR
|
||||
Prefix to create temporary files. Typically used for a multi-part index.
|
||||
.TP
|
||||
.BR --frag = no | yes
|
||||
Whether to enable the fragment mode [no]
|
||||
.TP
|
||||
@@ -245,6 +305,10 @@ Only map to the reverse complement strand of the reference sequences.
|
||||
.BR --heap-sort = no | yes
|
||||
If yes, sort anchors with heap merge, instead of radix sort. Heap merge is
|
||||
faster for short reads, but slower for long reads. [no]
|
||||
.TP
|
||||
.B --no-pairing
|
||||
Treat two reads in a pair as independent reads. The mate related fields in SAM
|
||||
are still properly populated.
|
||||
.SS Alignment options
|
||||
.TP 10
|
||||
.BI -A \ INT
|
||||
@@ -305,6 +369,9 @@ no attempt to match GT-AG [n]
|
||||
.BI --end-bonus \ INT
|
||||
Score bonus when alignment extends to the end of the query sequence [0].
|
||||
.TP
|
||||
.BI --score-N \ INT
|
||||
Score of a mismatch involving ambiguous bases [1].
|
||||
.TP
|
||||
.BR --splice-flank = yes | no
|
||||
Assume the next base to a
|
||||
.B GT
|
||||
@@ -322,6 +389,17 @@ on SIRV data, please add
|
||||
.B --splice-flank=no
|
||||
to the command line.
|
||||
.TP
|
||||
.BR --junc-bed \ FILE
|
||||
Gene annotations in the BED12 format (aka 12-column BED), or intron positions
|
||||
in 5-column BED. With this option, minimap2 prefers splicing in annotations.
|
||||
BED12 file can be converted from GTF/GFF3 with `paftools.js gff2bed anno.gtf'
|
||||
[].
|
||||
.TP
|
||||
.BR --junc-bonus \ INT
|
||||
Score bonus for a splice donor or acceptor found in annotation (effective with
|
||||
.BR --junc-bed )
|
||||
[9].
|
||||
.TP
|
||||
.BI --end-seed-pen \ INT
|
||||
Drop a terminal anchor if
|
||||
.IR s <log( g )+ INT ,
|
||||
@@ -333,12 +411,26 @@ the length of the terminal gap in the chain. This option is only effective
|
||||
with
|
||||
.BR --splice .
|
||||
It helps to avoid tiny terminal exons. [6]
|
||||
.TP
|
||||
.B --no-end-flt
|
||||
Don't filter seeds towards the ends of chains before performing base-level
|
||||
alignment.
|
||||
.TP
|
||||
.BI --cap-sw-mem \ NUM
|
||||
Skip alignment if the DP matrix size is above
|
||||
.IR NUM .
|
||||
Set 0 to disable [100m].
|
||||
.SS Input/output options
|
||||
.TP 10
|
||||
.B -a
|
||||
Generate CIGAR and output alignments in the SAM format. Minimap2 outputs in PAF
|
||||
by default.
|
||||
.TP
|
||||
.BI -o \ FILE
|
||||
Output alignments to
|
||||
.I FILE
|
||||
[stdout].
|
||||
.TP
|
||||
.B -Q
|
||||
Ignore base quality in the input file.
|
||||
.TP
|
||||
@@ -353,6 +445,9 @@ SAM read group line in a format like
|
||||
.B @RG\\\\tID:foo\\\\tSM:bar
|
||||
[].
|
||||
.TP
|
||||
.B -y
|
||||
Copy input FASTA/Q comments to output.
|
||||
.TP
|
||||
.B -c
|
||||
Generate CIGAR. In PAF, the CIGAR is written to the `cg' custom tag.
|
||||
.TP
|
||||
@@ -371,6 +466,12 @@ is given,
|
||||
.I short
|
||||
is assumed. [none]
|
||||
.TP
|
||||
.B --MD
|
||||
Output the MD tag (see the SAM spec).
|
||||
.TP
|
||||
.B --eqx
|
||||
Output =/X CIGAR operators for sequence match/mismatch.
|
||||
.TP
|
||||
.B -Y
|
||||
In SAM output, use soft clipping for supplementary alignments.
|
||||
.TP
|
||||
@@ -404,6 +505,18 @@ memory.
|
||||
.BR --secondary = yes | no
|
||||
Whether to output secondary alignments [yes]
|
||||
.TP
|
||||
.BI --max-qlen \ NUM
|
||||
Filter out query sequences longer than
|
||||
.IR NUM .
|
||||
.TP
|
||||
.B --paf-no-hit
|
||||
In PAF, output unmapped queries; the strand and the reference name fields are
|
||||
set to `*'. Warning: some paftools.js commands may not work with such output
|
||||
for the moment.
|
||||
.TP
|
||||
.B --sam-hit-only
|
||||
In SAM, don't output unmapped reads.
|
||||
.TP
|
||||
.B --version
|
||||
Print version number to stdout
|
||||
.SS Preset options
|
||||
@@ -417,53 +530,47 @@ Available
|
||||
.I STR
|
||||
are:
|
||||
.RS
|
||||
.TP 8
|
||||
.B map-pb
|
||||
PacBio/Oxford Nanopore read to reference mapping
|
||||
.RB ( -Hk19 )
|
||||
.TP
|
||||
.TP 10
|
||||
.B map-ont
|
||||
Slightly more sensitive for Oxford Nanopore to reference mapping
|
||||
.RB ( -k15 ).
|
||||
For PacBio reads, HPC minimizers consistently leads to faster performance and
|
||||
more sensitive results in comparison to normal minimizers. For Oxford Nanopore
|
||||
data, normal minimizers are better, though not much. The effectiveness of HPC
|
||||
is determined by the sequencing error mode.
|
||||
Align noisy long reads of ~10% error rate to a reference genome. This is the
|
||||
default mode.
|
||||
.TP
|
||||
.B map-hifi
|
||||
Align PacBio high-fidelity (HiFi) reads to a reference genome
|
||||
.RB ( -k19
|
||||
.B -w19 -U50,500 -g10k -A1 -B4 -O6,26 -E2,1
|
||||
.BR -s200 ).
|
||||
.TP
|
||||
.B map-pb
|
||||
Align older PacBio continuous long (CLR) reads to a reference genome
|
||||
.RB ( -Hk19 ).
|
||||
.TP
|
||||
.B asm5
|
||||
Long assembly to reference mapping
|
||||
.RB ( -k19
|
||||
.B -w19 -A1 -B19 -O39,81 -E3,1 -s200
|
||||
.BR -z200 ).
|
||||
.B -w19 -U50,500 --rmq -r100k -g10k -A1 -B19 -O39,81 -E3,1 -s200 -z200
|
||||
.BR -N50 ).
|
||||
Typically, the alignment will not extend to regions with 5% or higher sequence
|
||||
divergence. Only use this preset if the average divergence is far below 5%.
|
||||
.TP
|
||||
.B asm10
|
||||
Long assembly to reference mapping
|
||||
.RB ( -k19
|
||||
.B -w19 -A1 -B9 -O16,41 -E2,1 -s200
|
||||
.BR -z200 ).
|
||||
.B -w19 -U50,500 --rmq -r100k -g10k -A1 -B9 -O16,41 -E2,1 -s200 -z200
|
||||
.BR -N50 ).
|
||||
Up to 10% sequence divergence.
|
||||
.TP
|
||||
.B ava-pb
|
||||
PacBio all-vs-all overlap mapping
|
||||
.RB ( -Hk19
|
||||
.B -Xw5 -m100 -g10000 --max-chain-skip
|
||||
.BR 25 ).
|
||||
.TP
|
||||
.B ava-ont
|
||||
Oxford Nanopore all-vs-all overlap mapping
|
||||
.RB ( -k15
|
||||
.B -Xw5 -m100 -g10000 --max-chain-skip
|
||||
.BR 25 ).
|
||||
Similarly, the major difference from
|
||||
.B ava-pb
|
||||
is that this preset is not using HPC minimizers.
|
||||
.B asm20
|
||||
Long assembly to reference mapping
|
||||
.RB ( -k19
|
||||
.B -w10 -U50,500 --rmq -r100k -g10k -A1 -B4 -O6,26 -E2,1 -s200 -z200
|
||||
.BR -N50 ).
|
||||
Up to 20% sequence divergence.
|
||||
.TP
|
||||
.B splice
|
||||
Long-read spliced alignment
|
||||
.RB ( -k15
|
||||
.B -w5 --splice -g2000 -G200k -A1 -B2 -O2,32 -E1,0 -C9 -z200 -ub
|
||||
.B -w5 --splice -g2k -G200k -A1 -B2 -O2,32 -E1,0 -C9 -z200 -ub --junc-bonus=9 --cap-sw-mem=0
|
||||
.BR --splice-flank=yes ).
|
||||
In the splice mode, 1) long deletions are taken as introns and represented as
|
||||
the
|
||||
@@ -473,12 +580,30 @@ costs are different during chaining; 4) the computation of the
|
||||
.RB ` ms '
|
||||
tag ignores introns to demote hits to pseudogenes.
|
||||
.TP
|
||||
.B splice:hq
|
||||
Long-read splice alignment for PacBio CCS reads
|
||||
.RB ( -xsplice
|
||||
.B -C5 -O6,24
|
||||
.BR -B4 ).
|
||||
.TP
|
||||
.B sr
|
||||
Short single-end reads without splicing
|
||||
.RB ( -k21
|
||||
.B -w11 --sr --frag=yes -A2 -B8 -O12,32 -E2,1 -r50 -p.5 -N20 -f1000,5000 -n2 -m20
|
||||
.B -s40 -g200 -2K50m --heap-sort=yes
|
||||
.BR --secondary=no ).
|
||||
.TP
|
||||
.B ava-pb
|
||||
PacBio CLR all-vs-all overlap mapping
|
||||
.RB ( -Hk19
|
||||
.B -Xw5 -e0
|
||||
.BR -m100 ).
|
||||
.TP
|
||||
.B ava-ont
|
||||
Oxford Nanopore all-vs-all overlap mapping
|
||||
.RB ( -k15
|
||||
.B -Xw5 -e0 -m100
|
||||
.BR -r2k ).
|
||||
.RE
|
||||
.SS Miscellaneous options
|
||||
.TP 10
|
||||
@@ -535,12 +660,17 @@ cm i Number of minimizers on the chain
|
||||
s1 i Chaining score
|
||||
s2 i Chaining score of the best secondary chain
|
||||
NM i Total number of mismatches and gaps in the alignment
|
||||
MD Z To generate the ref sequence in the alignment
|
||||
AS i DP alignment score
|
||||
SA Z List of other supplementary alignments
|
||||
ms i DP score of the max scoring segment in the alignment
|
||||
nn i Number of ambiguous bases in the alignment
|
||||
ts A Transcript strand (splice mode only)
|
||||
cg Z CIGAR string (only in PAF)
|
||||
cs Z Difference string
|
||||
dv f Approximate per-base sequence divergence
|
||||
de f Gap-compressed per-base sequence divergence
|
||||
rl i Length of query regions harboring repetitive seeds
|
||||
.TE
|
||||
|
||||
.PP
|
||||
|
||||
@@ -1,3 +1,4 @@
|
||||
#include <stdlib.h>
|
||||
#include "mmpriv.h"
|
||||
|
||||
int mm_verbose = 1;
|
||||
@@ -115,11 +116,40 @@ long peakrss(void)
|
||||
double realtime(void)
|
||||
{
|
||||
struct timeval tp;
|
||||
struct timezone tzp;
|
||||
gettimeofday(&tp, &tzp);
|
||||
gettimeofday(&tp, NULL);
|
||||
return tp.tv_sec + tp.tv_usec * 1e-6;
|
||||
}
|
||||
|
||||
void mm_err_puts(const char *str)
|
||||
{
|
||||
int ret;
|
||||
ret = puts(str);
|
||||
if (ret == EOF) {
|
||||
perror("[ERROR] failed to write the results");
|
||||
exit(EXIT_FAILURE);
|
||||
}
|
||||
}
|
||||
|
||||
void mm_err_fwrite(const void *p, size_t size, size_t nitems, FILE *fp)
|
||||
{
|
||||
int ret;
|
||||
ret = fwrite(p, size, nitems, fp);
|
||||
if (ret == EOF) {
|
||||
perror("[ERROR] failed to write data");
|
||||
exit(EXIT_FAILURE);
|
||||
}
|
||||
}
|
||||
|
||||
void mm_err_fread(void *p, size_t size, size_t nitems, FILE *fp)
|
||||
{
|
||||
int ret;
|
||||
ret = fread(p, size, nitems, fp);
|
||||
if (ret == EOF) {
|
||||
perror("[ERROR] failed to read data");
|
||||
exit(EXIT_FAILURE);
|
||||
}
|
||||
}
|
||||
|
||||
#include "ksort.h"
|
||||
|
||||
#define sort_key_128x(a) ((a).x)
|
||||
@@ -129,3 +159,4 @@ KRADIX_SORT_INIT(128x, mm128_t, sort_key_128x, 8)
|
||||
KRADIX_SORT_INIT(64, uint64_t, sort_key_64, 8)
|
||||
|
||||
KSORT_INIT_GENERIC(uint32_t)
|
||||
KSORT_INIT_GENERIC(uint64_t)
|
||||
|
||||
+1223
-100
File diff suppressed because it is too large
Load Diff
@@ -4,6 +4,7 @@
|
||||
#include <assert.h>
|
||||
#include "minimap.h"
|
||||
#include "bseq.h"
|
||||
#include "kseq.h"
|
||||
|
||||
#define MM_PARENT_UNSET (-1)
|
||||
#define MM_PARENT_TMP_PRI (-2)
|
||||
@@ -28,17 +29,20 @@
|
||||
#define mm_seq4_set(s, i, c) ((s)[(i)>>3] |= (uint32_t)(c) << (((i)&7)<<2))
|
||||
#define mm_seq4_get(s, i) ((s)[(i)>>3] >> (((i)&7)<<2) & 0xf)
|
||||
|
||||
#define MALLOC(type, len) ((type*)malloc((len) * sizeof(type)))
|
||||
#define CALLOC(type, len) ((type*)calloc((len), sizeof(type)))
|
||||
|
||||
#ifdef __cplusplus
|
||||
extern "C" {
|
||||
#endif
|
||||
|
||||
#ifndef KSTRING_T
|
||||
#define KSTRING_T kstring_t
|
||||
typedef struct __kstring_t {
|
||||
unsigned l, m;
|
||||
char *s;
|
||||
} kstring_t;
|
||||
#endif
|
||||
typedef struct {
|
||||
uint32_t n;
|
||||
uint32_t q_pos;
|
||||
uint32_t q_span:31, flt:1;
|
||||
uint32_t seg_id:31, is_tandem:1;
|
||||
const uint64_t *cr;
|
||||
} mm_seed_t;
|
||||
|
||||
typedef struct {
|
||||
int n_u, n_a;
|
||||
@@ -56,28 +60,38 @@ uint32_t ks_ksmall_uint32_t(size_t n, uint32_t arr[], size_t kk);
|
||||
|
||||
void mm_sketch(void *km, const char *str, int len, int w, int k, uint32_t rid, int is_hpc, mm128_v *p);
|
||||
|
||||
void mm_write_sam_hdr(const mm_idx_t *mi, const char *rg, const char *ver, int argc, char *argv[]);
|
||||
mm_seed_t *mm_collect_matches(void *km, int *_n_m, int qlen, int max_occ, int max_max_occ, int dist, const mm_idx_t *mi, const mm128_v *mv, int64_t *n_a, int *rep_len, int *n_mini_pos, uint64_t **mini_pos);
|
||||
|
||||
int mm_write_sam_hdr(const mm_idx_t *mi, const char *rg, const char *ver, int argc, char *argv[]);
|
||||
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int opt_flag);
|
||||
void mm_write_paf3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int opt_flag, int rep_len);
|
||||
void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int n_regs, const mm_reg1_t *regs);
|
||||
void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regs, const mm_reg1_t *const* regs, void *km, int opt_flag);
|
||||
void mm_write_sam3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regss, const mm_reg1_t *const* regss, void *km, int opt_flag, int rep_len);
|
||||
|
||||
void mm_idxopt_init(mm_idxopt_t *opt);
|
||||
const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n);
|
||||
int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f);
|
||||
mm128_t *mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int min_cnt, int min_sc, int is_cdna, int n_segs, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km);
|
||||
mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a);
|
||||
|
||||
mm128_t *mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int max_iter, int min_cnt, int min_sc, float gap_scale,
|
||||
int is_cdna, int n_segs, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km);
|
||||
mm128_t *mg_lchain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int max_iter, int min_cnt, int min_sc, float chn_pen_gap, float chn_pen_skip,
|
||||
int is_cdna, int n_segs, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km);
|
||||
mm128_t *mg_lchain_rmq(int max_dist, int max_dist_inner, int bw, int max_chn_skip, int cap_rmq_size, int min_cnt, int min_sc, float chn_pen_gap, float chn_pen_skip,
|
||||
int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km);
|
||||
|
||||
mm_reg1_t *mm_gen_regs(void *km, uint32_t hash, int qlen, int n_u, uint64_t *u, mm128_t *a);
|
||||
void mm_mark_alt(const mm_idx_t *mi, int n, mm_reg1_t *r);
|
||||
void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a);
|
||||
void mm_sync_regs(void *km, int n_regs, mm_reg1_t *regs);
|
||||
int mm_squeeze_a(void *km, int n_regs, mm_reg1_t *regs, mm128_t *a);
|
||||
int mm_set_sam_pri(int n, mm_reg1_t *r);
|
||||
void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r, int sub_diff);
|
||||
void mm_set_parent(void *km, float mask_level, int mask_len, int n, mm_reg1_t *r, int sub_diff, int hard_mask_level, float alt_diff_frac);
|
||||
void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int *n_, mm_reg1_t *r);
|
||||
void mm_select_sub_multi(void *km, float pri_ratio, float pri1, float pri2, int max_gap_ref, int min_diff, int best_n, int n_segs, const int *qlens, int *n_, mm_reg1_t *r);
|
||||
void mm_filter_regs(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs);
|
||||
void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs, mm128_t *a);
|
||||
void mm_hit_sort_by_dp(void *km, int *n_regs, mm_reg1_t *r);
|
||||
void mm_filter_regs(const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs);
|
||||
void mm_hit_sort(void *km, int *n_regs, mm_reg1_t *r, float alt_diff_frac);
|
||||
void mm_set_mapq(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr);
|
||||
|
||||
void mm_est_err(const mm_idx_t *mi, int qlen, int n_regs, mm_reg1_t *regs, const mm128_t *a, int32_t n, const uint64_t *mini_pos);
|
||||
@@ -86,6 +100,15 @@ mm_seg_t *mm_seg_gen(void *km, uint32_t hash, int n_segs, const int *qlens, int
|
||||
void mm_seg_free(void *km, int n_segs, mm_seg_t *segs);
|
||||
void mm_pair(void *km, int max_gap_ref, int dp_bonus, int sub_diff, int match_sc, const int *qlens, int *n_regs, mm_reg1_t **regs);
|
||||
|
||||
FILE *mm_split_init(const char *prefix, const mm_idx_t *mi);
|
||||
mm_idx_t *mm_split_merge_prep(const char *prefix, int n_splits, FILE **fp, uint32_t *n_seq_part);
|
||||
int mm_split_merge(int n_segs, const char **fn, const mm_mapopt_t *opt, int n_split_idx);
|
||||
void mm_split_rm_tmp(const char *prefix, int n_splits);
|
||||
|
||||
void mm_err_puts(const char *str);
|
||||
void mm_err_fwrite(const void *p, size_t size, size_t nitems, FILE *fp);
|
||||
void mm_err_fread(void *p, size_t size, size_t nitems, FILE *fp);
|
||||
|
||||
#ifdef __cplusplus
|
||||
}
|
||||
#endif
|
||||
|
||||
@@ -1,4 +1,5 @@
|
||||
#include <stdio.h>
|
||||
#include <limits.h>
|
||||
#include "mmpriv.h"
|
||||
|
||||
void mm_idxopt_init(mm_idxopt_t *opt)
|
||||
@@ -15,24 +16,34 @@ void mm_mapopt_init(mm_mapopt_t *opt)
|
||||
memset(opt, 0, sizeof(mm_mapopt_t));
|
||||
opt->seed = 11;
|
||||
opt->mid_occ_frac = 2e-4f;
|
||||
opt->min_mid_occ = 10;
|
||||
opt->max_mid_occ = 1000000;
|
||||
opt->sdust_thres = 0; // no SDUST masking
|
||||
|
||||
opt->min_cnt = 3;
|
||||
opt->min_chain_score = 40;
|
||||
opt->bw = 500;
|
||||
opt->bw = 500, opt->bw_long = 20000;
|
||||
opt->max_gap = 5000;
|
||||
opt->max_gap_ref = -1;
|
||||
opt->max_chain_skip = 25;
|
||||
opt->max_chain_iter = 5000;
|
||||
opt->rmq_inner_dist = 1000;
|
||||
opt->rmq_size_cap = 100000;
|
||||
opt->rmq_rescue_size = 1000;
|
||||
opt->rmq_rescue_ratio = 0.1f;
|
||||
opt->chain_gap_scale = 0.8f;
|
||||
opt->max_max_occ = 4095;
|
||||
opt->occ_dist = 500;
|
||||
|
||||
opt->mask_level = 0.5f;
|
||||
opt->mask_len = INT_MAX;
|
||||
opt->pri_ratio = 0.8f;
|
||||
opt->best_n = 5;
|
||||
|
||||
opt->max_join_long = 20000;
|
||||
opt->max_join_short = 2000;
|
||||
opt->min_join_flank_sc = 1000;
|
||||
opt->alt_drop = 0.15f;
|
||||
|
||||
opt->a = 2, opt->b = 4, opt->q = 4, opt->e = 2, opt->q2 = 24, opt->e2 = 1;
|
||||
opt->sc_ambi = 1;
|
||||
opt->zdrop = 400, opt->zdrop_inv = 200;
|
||||
opt->end_bonus = -1;
|
||||
opt->min_dp_max = opt->min_chain_score * opt->a;
|
||||
@@ -40,6 +51,7 @@ void mm_mapopt_init(mm_mapopt_t *opt)
|
||||
opt->anchor_ext_len = 20, opt->anchor_ext_shift = 6;
|
||||
opt->max_clip_ratio = 1.0f;
|
||||
opt->mini_batch_size = 500000000;
|
||||
opt->max_sw_mat = 100000000;
|
||||
|
||||
opt->pe_ori = 0; // FF
|
||||
opt->pe_bonus = 33;
|
||||
@@ -47,10 +59,15 @@ void mm_mapopt_init(mm_mapopt_t *opt)
|
||||
|
||||
void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
|
||||
{
|
||||
if ((opt->flag & MM_F_SPLICE_FOR) && (opt->flag & MM_F_SPLICE_REV))
|
||||
if ((opt->flag & MM_F_SPLICE_FOR) || (opt->flag & MM_F_SPLICE_REV))
|
||||
opt->flag |= MM_F_SPLICE;
|
||||
if (opt->mid_occ <= 0)
|
||||
if (opt->mid_occ <= 0) {
|
||||
opt->mid_occ = mm_idx_cal_max_occ(mi, opt->mid_occ_frac);
|
||||
if (opt->mid_occ < opt->min_mid_occ)
|
||||
opt->mid_occ = opt->min_mid_occ;
|
||||
if (opt->max_mid_occ > opt->min_mid_occ && opt->mid_occ > opt->max_mid_occ)
|
||||
opt->mid_occ = opt->max_mid_occ;
|
||||
}
|
||||
if (mm_verbose >= 3)
|
||||
fprintf(stderr, "[M::%s::%.3f*%.2f] mid_occ = %d\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), opt->mid_occ);
|
||||
}
|
||||
@@ -66,28 +83,44 @@ int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
|
||||
if (preset == 0) {
|
||||
mm_idxopt_init(io);
|
||||
mm_mapopt_init(mo);
|
||||
} else if (strcmp(preset, "map-ont") == 0) { // this is the same as the default
|
||||
} else if (strcmp(preset, "ava-ont") == 0) {
|
||||
io->flag = 0, io->k = 15, io->w = 5;
|
||||
mo->flag |= MM_F_ALL_CHAINS | MM_F_NO_DIAG | MM_F_NO_DUAL | MM_F_NO_LJOIN;
|
||||
mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_gap = 10000, mo->max_chain_skip = 25;
|
||||
mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_chain_skip = 25;
|
||||
mo->bw = mo->bw_long = 2000;
|
||||
mo->occ_dist = 0;
|
||||
} else if (strcmp(preset, "map10k") == 0 || strcmp(preset, "map-pb") == 0) {
|
||||
io->flag |= MM_I_HPC, io->k = 19;
|
||||
} else if (strcmp(preset, "ava-pb") == 0) {
|
||||
io->flag |= MM_I_HPC, io->k = 19, io->w = 5;
|
||||
mo->flag |= MM_F_ALL_CHAINS | MM_F_NO_DIAG | MM_F_NO_DUAL | MM_F_NO_LJOIN;
|
||||
mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_gap = 10000, mo->max_chain_skip = 25;
|
||||
} else if (strcmp(preset, "map10k") == 0 || strcmp(preset, "map-pb") == 0) {
|
||||
io->flag |= MM_I_HPC, io->k = 19;
|
||||
} else if (strcmp(preset, "map-ont") == 0) {
|
||||
io->flag = 0, io->k = 15;
|
||||
} else if (strcmp(preset, "asm5") == 0) {
|
||||
mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_chain_skip = 25;
|
||||
mo->bw_long = mo->bw;
|
||||
mo->occ_dist = 0;
|
||||
} else if (strcmp(preset, "map-hifi") == 0 || strcmp(preset, "map-ccs") == 0) {
|
||||
io->flag = 0, io->k = 19, io->w = 19;
|
||||
mo->a = 1, mo->b = 19, mo->q = 39, mo->q2 = 81, mo->e = 3, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
|
||||
mo->max_gap = 10000;
|
||||
mo->a = 1, mo->b = 4, mo->q = 6, mo->q2 = 26, mo->e = 2, mo->e2 = 1;
|
||||
mo->occ_dist = 500;
|
||||
mo->min_mid_occ = 50, mo->max_mid_occ = 500;
|
||||
mo->min_dp_max = 200;
|
||||
mo->best_n = 50;
|
||||
} else if (strcmp(preset, "asm10") == 0) {
|
||||
} else if (strncmp(preset, "asm", 3) == 0) {
|
||||
io->flag = 0, io->k = 19, io->w = 19;
|
||||
mo->a = 1, mo->b = 9, mo->q = 16, mo->q2 = 41, mo->e = 2, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
|
||||
mo->bw = mo->bw_long = 100000;
|
||||
mo->max_gap = 10000;
|
||||
mo->flag |= MM_F_RMQ | MM_F_NO_LJOIN;
|
||||
mo->min_mid_occ = 50, mo->max_mid_occ = 500;
|
||||
mo->min_dp_max = 200;
|
||||
mo->best_n = 50;
|
||||
if (strcmp(preset, "asm5") == 0) {
|
||||
mo->a = 1, mo->b = 19, mo->q = 39, mo->q2 = 81, mo->e = 3, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
|
||||
} else if (strcmp(preset, "asm10") == 0) {
|
||||
mo->a = 1, mo->b = 9, mo->q = 16, mo->q2 = 41, mo->e = 2, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
|
||||
} else if (strcmp(preset, "asm20") == 0) {
|
||||
mo->a = 1, mo->b = 4, mo->q = 6, mo->q2 = 26, mo->e = 2, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
|
||||
io->w = 10;
|
||||
} else return -1;
|
||||
} else if (strcmp(preset, "short") == 0 || strcmp(preset, "sr") == 0) {
|
||||
io->flag = 0, io->k = 21, io->w = 11;
|
||||
mo->flag |= MM_F_SR | MM_F_FRAG_MODE | MM_F_NO_PRINT_2ND | MM_F_2_IO_THREADS | MM_F_HEAP_SORT;
|
||||
@@ -97,7 +130,7 @@ int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
|
||||
mo->end_bonus = 10;
|
||||
mo->max_frag_len = 800;
|
||||
mo->max_gap = 100;
|
||||
mo->bw = 100;
|
||||
mo->bw = mo->bw_long = 100;
|
||||
mo->pri_ratio = 0.5f;
|
||||
mo->min_cnt = 2;
|
||||
mo->min_chain_score = 25;
|
||||
@@ -106,19 +139,38 @@ int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
|
||||
mo->mid_occ = 1000;
|
||||
mo->max_occ = 5000;
|
||||
mo->mini_batch_size = 50000000;
|
||||
} else if (strcmp(preset, "splice") == 0 || strcmp(preset, "cdna") == 0) {
|
||||
} else if (strncmp(preset, "splice", 6) == 0 || strcmp(preset, "cdna") == 0) {
|
||||
io->flag = 0, io->k = 15, io->w = 5;
|
||||
mo->flag |= MM_F_SPLICE | MM_F_SPLICE_FOR | MM_F_SPLICE_REV | MM_F_SPLICE_FLANK;
|
||||
mo->max_gap = 2000, mo->max_gap_ref = mo->bw = 200000;
|
||||
mo->max_sw_mat = 0;
|
||||
mo->max_gap = 2000, mo->max_gap_ref = mo->bw = mo->bw_long = 200000;
|
||||
mo->a = 1, mo->b = 2, mo->q = 2, mo->e = 1, mo->q2 = 32, mo->e2 = 0;
|
||||
mo->noncan = 9;
|
||||
mo->junc_bonus = 9;
|
||||
mo->zdrop = 200, mo->zdrop_inv = 100; // because mo->a is halved
|
||||
if (strcmp(preset, "splice:hq") == 0)
|
||||
mo->junc_bonus = 5, mo->b = 4, mo->q = 6, mo->q2 = 24;
|
||||
} else return -1;
|
||||
return 0;
|
||||
}
|
||||
|
||||
int mm_check_opt(const mm_idxopt_t *io, const mm_mapopt_t *mo)
|
||||
{
|
||||
if ((mo->flag & MM_F_RMQ) && (mo->flag & (MM_F_SR|MM_F_SPLICE))) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "[ERROR]\033[1;31m --rmq doesn't work with --sr or --splice\033[0m\n");
|
||||
return -7;
|
||||
}
|
||||
if (mo->split_prefix && (mo->flag & (MM_F_OUT_CS|MM_F_OUT_MD))) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "[ERROR]\033[1;31m --cs or --MD doesn't work with --split-prefix\033[0m\n");
|
||||
return -6;
|
||||
}
|
||||
if (io->k <= 0 || io->w <= 0) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "[ERROR]\033[1;31m -k and -w must be positive\033[0m\n");
|
||||
return -5;
|
||||
}
|
||||
if (mo->best_n < 0) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "[ERROR]\033[1;31m -N must be no less than 0\033[0m\n");
|
||||
@@ -136,6 +188,11 @@ int mm_check_opt(const mm_idxopt_t *io, const mm_mapopt_t *mo)
|
||||
fprintf(stderr, "[ERROR]\033[1;31m --for-only and --rev-only can't be applied at the same time\033[0m\n");
|
||||
return -3;
|
||||
}
|
||||
if (mo->e <= 0 || mo->q <= 0) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "[ERROR]\033[1;31m -O and -E must be positive\033[0m\n");
|
||||
return -1;
|
||||
}
|
||||
if ((mo->q != mo->q2 || mo->e != mo->e2) && !(mo->e > mo->e2 && mo->q + mo->e < mo->q2 + mo->e2)) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "[ERROR]\033[1;31m dual gap penalties violating E1>E2 and O1+E1<O2+E2\033[0m\n");
|
||||
@@ -151,5 +208,10 @@ int mm_check_opt(const mm_idxopt_t *io, const mm_mapopt_t *mo)
|
||||
fprintf(stderr, "[ERROR]\033[1;31m Z-drop should not be less than inversion-Z-drop\033[0m\n");
|
||||
return -5;
|
||||
}
|
||||
if ((mo->flag & MM_F_NO_PRINT_2ND) && (mo->flag & MM_F_ALL_CHAINS)) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "[ERROR]\033[1;31m -X/-P and --secondary=no can't be applied at the same time\033[0m\n");
|
||||
return -5;
|
||||
}
|
||||
return 0;
|
||||
}
|
||||
|
||||
@@ -54,7 +54,7 @@ void mm_set_pe_thru(const int *qlens, int *n_regs, mm_reg1_t **regs)
|
||||
if (n_pri[0] == 1 && n_pri[1] == 1) {
|
||||
mm_reg1_t *p = ®s[0][pri[0]];
|
||||
mm_reg1_t *q = ®s[1][pri[1]];
|
||||
if (p->rid == q->rid && p->rev == q->rev && abs(p->rs - q->rs) < 3 && abs(p->re - p->re) < 3
|
||||
if (p->rid == q->rid && p->rev == q->rev && abs(p->rs - q->rs) < 3 && abs(p->re - q->re) < 3
|
||||
&& ((p->qs == 0 && qlens[1] - q->qe == 0) || (q->qs == 0 && qlens[0] - p->qe == 0)))
|
||||
{
|
||||
p->pe_thru = q->pe_thru = 1;
|
||||
@@ -105,7 +105,7 @@ void mm_pair(void *km, int max_gap_ref, int pe_bonus, int sub_diff, int match_sc
|
||||
max = -1;
|
||||
max_idx[0] = max_idx[1] = -1;
|
||||
last[0] = last[1] = -1;
|
||||
kv_resize(uint64_t, km, sc, n);
|
||||
kv_resize(uint64_t, km, sc, (size_t)n);
|
||||
for (i = 0; i < n; ++i) {
|
||||
if (a[i].key & 1) { // reverse first read or forward second read
|
||||
mm_reg1_t *q, *r;
|
||||
@@ -151,8 +151,8 @@ void mm_pair(void *km, int max_gap_ref, int pe_bonus, int sub_diff, int match_sc
|
||||
}
|
||||
}
|
||||
mapq_pe = r[0]->mapq > r[1]->mapq? r[0]->mapq : r[1]->mapq;
|
||||
for (i = 0; i < sc.n; ++i)
|
||||
if ((sc.a[i]>>32) + sub_diff >= max>>32)
|
||||
for (i = 0; i < (int)sc.n; ++i)
|
||||
if ((sc.a[i]>>32) + sub_diff >= (uint64_t)max>>32)
|
||||
++n_sub;
|
||||
if (sc.n > 1) {
|
||||
int mapq_pe_alt;
|
||||
@@ -164,7 +164,7 @@ void mm_pair(void *km, int max_gap_ref, int pe_bonus, int sub_diff, int match_sc
|
||||
if (sc.n == 1) {
|
||||
if (r[0]->mapq < 2) r[0]->mapq = 2;
|
||||
if (r[1]->mapq < 2) r[1]->mapq = 2;
|
||||
} else if (max>>32 > sc.a[sc.n - 2]>>32) {
|
||||
} else if ((uint64_t)max>>32 > sc.a[sc.n - 2]>>32) {
|
||||
if (r[0]->mapq < 1) r[0]->mapq = 1;
|
||||
if (r[1]->mapq < 1) r[1]->mapq = 1;
|
||||
}
|
||||
|
||||
+33
-7
@@ -43,20 +43,24 @@ The following Python script demonstrates the key functionality of mappy:
|
||||
APIs
|
||||
----
|
||||
|
||||
Mappy implements two classes and one global function.
|
||||
Mappy implements two classes and two global function.
|
||||
|
||||
Class mappy.Aligner
|
||||
~~~~~~~~~~~~~~~~~~~
|
||||
|
||||
.. code:: python
|
||||
|
||||
mappy.Aligner(fn_idx_in, preset=None, ...)
|
||||
mappy.Aligner(fn_idx_in=None, preset=None, ...)
|
||||
|
||||
This constructor accepts the following arguments:
|
||||
|
||||
* **fn_idx_in**: index or sequence file name. Minimap2 automatically tests the
|
||||
file type. If a sequence file is provided, minimap2 builds an index. The
|
||||
sequence file can be optionally gzip'd.
|
||||
sequence file can be optionally gzip'd. This option has no effect if **seq**
|
||||
is set.
|
||||
|
||||
* **seq**: a single sequence to index. The sequence name will be set to
|
||||
:code:`N/A`.
|
||||
|
||||
* **preset**: minimap2 preset. Currently, minimap2 supports the following
|
||||
presets: **sr** for single-end short reads; **map-pb** for PacBio
|
||||
@@ -79,17 +83,28 @@ This constructor accepts the following arguments:
|
||||
|
||||
* **n_threads**: number of indexing threads; 3 by default
|
||||
|
||||
* **fn_idx_out**: name of file to which the index is written
|
||||
* **extra_flags**: additional flags defined in minimap.h
|
||||
|
||||
* **fn_idx_out**: name of file to which the index is written. This parameter
|
||||
has no effect if **seq** is set.
|
||||
|
||||
* **scoring**: scoring system. It is a tuple/list consisting of 4, 6 or 7
|
||||
positive integers. The first 4 elements specify match scoring, mismatch
|
||||
penalty, gap open and gap extension penalty. The 5th and 6th elements, if
|
||||
present, set long-gap open and long-gap extension penalty. The 7th sets a
|
||||
mismatch penalty involving ambiguous bases.
|
||||
|
||||
.. code:: python
|
||||
|
||||
mappy.Aligner.map(seq, seq2=None)
|
||||
mappy.Aligner.map(seq, seq2=None, cs=False, MD=False)
|
||||
|
||||
This method aligns :code:`seq` against the index. It is a generator, *yielding*
|
||||
a series of :code:`mappy.Alignment` objects. If :code:`seq2` is present, mappy
|
||||
performs paired-end alignment, assuming the two ends are in the FR orientation.
|
||||
Alignments of the two ends can be distinguished by the :code:`read_num` field
|
||||
(see Class mappy.Alignment below).
|
||||
(see Class mappy.Alignment below). Argument :code:`cs` asks mappy to generate
|
||||
the :code:`cs` tag; :code:`MD` is similar. These two arguments might slightly
|
||||
degrade performance and are not enabled by default.
|
||||
|
||||
.. code:: python
|
||||
|
||||
@@ -99,6 +114,12 @@ This method retrieves a (sub)sequence from the index and returns it as a Python
|
||||
string. :code:`None` is returned if :code:`name` is not present in the index or
|
||||
the start/end coordinates are invalid.
|
||||
|
||||
.. code:: python
|
||||
|
||||
mappy.Aligner.seq_names
|
||||
|
||||
This property gives the array of sequence names in the index.
|
||||
|
||||
Class mappy.Alignment
|
||||
~~~~~~~~~~~~~~~~~~~~~
|
||||
|
||||
@@ -123,7 +144,7 @@ properties:
|
||||
* **mlen**: length of the matching bases in the alignment, excluding ambiguous
|
||||
base matches.
|
||||
|
||||
* **NM**: number of mismatches, gaps and ambiguous poistions in the alignment
|
||||
* **NM**: number of mismatches, gaps and ambiguous positions in the alignment
|
||||
|
||||
* **trans_strand**: transcript strand. +1 if on the forward strand; -1 if on the
|
||||
reverse strand; 0 if unknown
|
||||
@@ -139,6 +160,11 @@ properties:
|
||||
* **cigar**: CIGAR returned as an array of shape :code:`(n_cigar,2)`. The two
|
||||
numbers give the length and the operator of each CIGAR operation.
|
||||
|
||||
* **MD**: the :code:`MD` tag as in the SAM format. It is an empty string unless
|
||||
the :code:`MD` argument is applied when calling :code:`mappy.Aligner.map()`.
|
||||
|
||||
* **cs**: the :code:`cs` tag.
|
||||
|
||||
An :code:`Alignment` object can be converted to a string with :code:`str()` in
|
||||
the following format:
|
||||
|
||||
|
||||
+25
-6
@@ -73,13 +73,17 @@ static inline void mm_reset_timer(void)
|
||||
extern unsigned char seq_comp_table[256];
|
||||
static inline mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char *seq1, const char *seq2, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt)
|
||||
{
|
||||
mm_reg1_t *r;
|
||||
|
||||
Py_BEGIN_ALLOW_THREADS
|
||||
if (seq2 == 0) {
|
||||
return mm_map(mi, strlen(seq1), seq1, n_regs, b, opt, NULL);
|
||||
r = mm_map(mi, strlen(seq1), seq1, n_regs, b, opt, NULL);
|
||||
} else {
|
||||
int _n_regs[2];
|
||||
mm_reg1_t *regs[2];
|
||||
char *seq[2];
|
||||
int i, len[2];
|
||||
|
||||
len[0] = strlen(seq1);
|
||||
len[1] = strlen(seq2);
|
||||
seq[0] = (char*)seq1;
|
||||
@@ -97,8 +101,11 @@ static inline mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char *seq1, const
|
||||
regs[0] = (mm_reg1_t*)realloc(regs[0], sizeof(mm_reg1_t) * (*n_regs));
|
||||
memcpy(®s[0][_n_regs[0]], regs[1], _n_regs[1] * sizeof(mm_reg1_t));
|
||||
free(regs[1]);
|
||||
return regs[0];
|
||||
r = regs[0];
|
||||
}
|
||||
Py_END_ALLOW_THREADS
|
||||
|
||||
return r;
|
||||
}
|
||||
|
||||
static inline char *mappy_revcomp(int len, const uint8_t *seq)
|
||||
@@ -119,15 +126,27 @@ static char *mappy_fetch_seq(const mm_idx_t *mi, const char *name, int st, int e
|
||||
*len = 0;
|
||||
rid = mm_idx_name2id(mi, name);
|
||||
if (rid < 0) return 0;
|
||||
if (st >= mi->seq[i].len || st >= en) return 0;
|
||||
if (en < 0 || en > mi->seq[i].len)
|
||||
en = mi->seq[i].len;
|
||||
if ((uint32_t)st >= mi->seq[rid].len || st >= en) return 0;
|
||||
if (en < 0 || (uint32_t)en > mi->seq[rid].len)
|
||||
en = mi->seq[rid].len;
|
||||
s = (char*)malloc(en - st + 1);
|
||||
*len = mm_idx_getseq(mi, rid, st, en, s);
|
||||
*len = mm_idx_getseq(mi, rid, st, en, (uint8_t*)s);
|
||||
for (i = 0; i < *len; ++i)
|
||||
s[i] = "ACGTN"[(uint8_t)s[i]];
|
||||
s[*len] = 0;
|
||||
return s;
|
||||
}
|
||||
|
||||
static mm_idx_t *mappy_idx_seq(int w, int k, int is_hpc, int bucket_bits, const char *seq, int len)
|
||||
{
|
||||
const char *fake_name = "N/A";
|
||||
char *s;
|
||||
mm_idx_t *mi;
|
||||
s = (char*)calloc(len + 1, 1);
|
||||
memcpy(s, seq, len);
|
||||
mi = mm_idx_str(w, k, is_hpc, bucket_bits, 1, (const char**)&s, (const char**)&fake_name);
|
||||
free(s);
|
||||
return mi;
|
||||
}
|
||||
|
||||
#endif
|
||||
|
||||
+31
-8
@@ -6,37 +6,55 @@ cdef extern from "minimap.h":
|
||||
#
|
||||
ctypedef struct mm_idxopt_t:
|
||||
short k, w, flag, bucket_bits
|
||||
int mini_batch_size
|
||||
int64_t mini_batch_size
|
||||
uint64_t batch_size
|
||||
|
||||
ctypedef struct mm_mapopt_t:
|
||||
int64_t flag
|
||||
int seed
|
||||
int sdust_thres
|
||||
int flag
|
||||
int bw
|
||||
|
||||
int max_qlen
|
||||
|
||||
int bw, bw_long
|
||||
int max_gap, max_gap_ref
|
||||
int max_frag_len
|
||||
int max_chain_skip
|
||||
int max_chain_skip, max_chain_iter
|
||||
int min_cnt
|
||||
int min_chain_score
|
||||
float chain_gap_scale
|
||||
int rmq_size_cap, rmq_inner_dist
|
||||
int rmq_rescue_size
|
||||
float rmq_rescue_ratio
|
||||
|
||||
float mask_level
|
||||
int mask_len
|
||||
float pri_ratio
|
||||
int best_n
|
||||
int max_join_long, max_join_short
|
||||
int min_join_flank_sc
|
||||
|
||||
float alt_drop
|
||||
|
||||
int a, b, q, e, q2, e2
|
||||
int sc_ambi
|
||||
int noncan
|
||||
int junc_bonus
|
||||
int zdrop, zdrop_inv
|
||||
int end_bonus
|
||||
int min_dp_max
|
||||
int min_ksw_len
|
||||
int anchor_ext_len, anchor_ext_shift
|
||||
float max_clip_ratio
|
||||
|
||||
int pe_ori, pe_bonus
|
||||
|
||||
float mid_occ_frac
|
||||
int32_t min_mid_occ
|
||||
int32_t mid_occ
|
||||
int32_t max_occ
|
||||
int mini_batch_size
|
||||
int64_t mini_batch_size
|
||||
int64_t max_sw_mat
|
||||
|
||||
const char *split_prefix
|
||||
|
||||
int mm_set_opt(char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
|
||||
int mm_verbose
|
||||
@@ -58,7 +76,8 @@ cdef extern from "minimap.h":
|
||||
mm_idx_seq_t *seq
|
||||
uint32_t *S
|
||||
mm_idx_bucket_t *B
|
||||
void *km, *h
|
||||
void *km
|
||||
void *h
|
||||
|
||||
ctypedef struct mm_idx_reader_t:
|
||||
pass
|
||||
@@ -82,6 +101,9 @@ cdef extern from "minimap.h":
|
||||
|
||||
mm_tbuf_t *mm_tbuf_init()
|
||||
void mm_tbuf_destroy(mm_tbuf_t *b)
|
||||
void *mm_tbuf_get_km(mm_tbuf_t *b)
|
||||
int mm_gen_cs(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int no_iden)
|
||||
int mm_gen_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq)
|
||||
|
||||
#
|
||||
# Helper header (because it is hard to expose mm_reg1_t with Cython)
|
||||
@@ -102,6 +124,7 @@ cdef extern from "cmappy.h":
|
||||
void mm_free_reg1(mm_reg1_t *r)
|
||||
mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char *seq1, const char *seq2, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt)
|
||||
char *mappy_fetch_seq(const mm_idx_t *mi, const char *name, int st, int en, int *l)
|
||||
mm_idx_t *mappy_idx_seq(int w, int k, int is_hpc, int bucket_bits, const char *seq, int l)
|
||||
|
||||
ctypedef struct kstring_t:
|
||||
unsigned l, m
|
||||
|
||||
+92
-25
@@ -3,6 +3,8 @@ from libc.stdlib cimport free
|
||||
cimport cmappy
|
||||
import sys
|
||||
|
||||
__version__ = '2.19'
|
||||
|
||||
cmappy.mm_reset_timer()
|
||||
|
||||
cdef class Alignment:
|
||||
@@ -12,9 +14,9 @@ cdef class Alignment:
|
||||
cdef int8_t _strand, _trans_strand
|
||||
cdef uint8_t _mapq, _is_primary
|
||||
cdef int _seg_id
|
||||
cdef _ctg, _cigar # these are python objects
|
||||
cdef _ctg, _cigar, _cs, _MD # these are python objects
|
||||
|
||||
def __cinit__(self, ctg, cl, cs, ce, strand, qs, qe, mapq, cigar, is_primary, mlen, blen, NM, trans_strand, seg_id):
|
||||
def __cinit__(self, ctg, cl, cs, ce, strand, qs, qe, mapq, cigar, is_primary, mlen, blen, NM, trans_strand, seg_id, cs_str, MD_str):
|
||||
self._ctg = ctg if isinstance(ctg, str) else ctg.decode()
|
||||
self._ctg_len, self._r_st, self._r_en = cl, cs, ce
|
||||
self._strand, self._q_st, self._q_en = strand, qs, qe
|
||||
@@ -24,6 +26,8 @@ cdef class Alignment:
|
||||
self._is_primary = is_primary
|
||||
self._trans_strand = trans_strand
|
||||
self._seg_id = seg_id
|
||||
self._cs = cs_str
|
||||
self._MD = MD_str
|
||||
|
||||
@property
|
||||
def ctg(self): return self._ctg
|
||||
@@ -70,6 +74,12 @@ cdef class Alignment:
|
||||
@property
|
||||
def read_num(self): return self._seg_id + 1
|
||||
|
||||
@property
|
||||
def cs(self): return self._cs
|
||||
|
||||
@property
|
||||
def MD(self): return self._MD
|
||||
|
||||
@property
|
||||
def cigar_str(self):
|
||||
return "".join(map(lambda x: str(x[0]) + 'MIDNSH'[x[1]], self._cigar))
|
||||
@@ -83,8 +93,10 @@ cdef class Alignment:
|
||||
if self._trans_strand > 0: ts = 'ts:A:+'
|
||||
elif self._trans_strand < 0: ts = 'ts:A:-'
|
||||
else: ts = 'ts:A:.'
|
||||
return "\t".join([str(self._q_st), str(self._q_en), strand, self._ctg, str(self._ctg_len), str(self._r_st), str(self._r_en),
|
||||
str(self._mlen), str(self._blen), str(self._mapq), tp, ts, "cg:Z:" + self.cigar_str])
|
||||
a = [str(self._q_st), str(self._q_en), strand, self._ctg, str(self._ctg_len), str(self._r_st), str(self._r_en),
|
||||
str(self._mlen), str(self._blen), str(self._mapq), tp, ts, "cg:Z:" + self.cigar_str]
|
||||
if self._cs != "": a.append("cs:Z:" + self._cs)
|
||||
return "\t".join(a)
|
||||
|
||||
cdef class ThreadBuffer:
|
||||
cdef cmappy.mm_tbuf_t *_b
|
||||
@@ -100,7 +112,8 @@ cdef class Aligner:
|
||||
cdef cmappy.mm_idxopt_t idx_opt
|
||||
cdef cmappy.mm_mapopt_t map_opt
|
||||
|
||||
def __cinit__(self, fn_idx_in, preset=None, k=None, w=None, min_cnt=None, min_chain_score=None, min_dp_score=None, bw=None, best_n=None, n_threads=3, fn_idx_out=None):
|
||||
def __cinit__(self, fn_idx_in=None, preset=None, k=None, w=None, min_cnt=None, min_chain_score=None, min_dp_score=None, bw=None, best_n=None, n_threads=3, fn_idx_out=None, max_frag_len=None, extra_flags=None, seq=None, scoring=None):
|
||||
self._idx = NULL
|
||||
cmappy.mm_set_opt(NULL, &self.idx_opt, &self.map_opt) # set the default options
|
||||
if preset is not None:
|
||||
cmappy.mm_set_opt(str.encode(preset), &self.idx_opt, &self.map_opt) # apply preset
|
||||
@@ -113,17 +126,33 @@ cdef class Aligner:
|
||||
if min_dp_score is not None: self.map_opt.min_dp_max = min_dp_score
|
||||
if bw is not None: self.map_opt.bw = bw
|
||||
if best_n is not None: self.map_opt.best_n = best_n
|
||||
if max_frag_len is not None: self.map_opt.max_frag_len = max_frag_len
|
||||
if extra_flags is not None: self.map_opt.flag |= extra_flags
|
||||
if scoring is not None and len(scoring) >= 4:
|
||||
self.map_opt.a, self.map_opt.b = scoring[0], scoring[1]
|
||||
self.map_opt.q, self.map_opt.e = scoring[2], scoring[3]
|
||||
self.map_opt.q2, self.map_opt.e2 = self.map_opt.q, self.map_opt.e
|
||||
if len(scoring) >= 6:
|
||||
self.map_opt.q2, self.map_opt.e2 = scoring[4], scoring[5]
|
||||
if len(scoring) >= 7:
|
||||
self.map_opt.sc_ambi = scoring[6]
|
||||
|
||||
cdef cmappy.mm_idx_reader_t *r;
|
||||
if fn_idx_out is None:
|
||||
r = cmappy.mm_idx_reader_open(str.encode(fn_idx_in), &self.idx_opt, NULL)
|
||||
|
||||
if seq is None:
|
||||
if fn_idx_out is None:
|
||||
r = cmappy.mm_idx_reader_open(str.encode(fn_idx_in), &self.idx_opt, NULL)
|
||||
else:
|
||||
r = cmappy.mm_idx_reader_open(str.encode(fn_idx_in), &self.idx_opt, str.encode(fn_idx_out))
|
||||
if r is not NULL:
|
||||
self._idx = cmappy.mm_idx_reader_read(r, n_threads) # NB: ONLY read the first part
|
||||
cmappy.mm_idx_reader_close(r)
|
||||
cmappy.mm_mapopt_update(&self.map_opt, self._idx)
|
||||
cmappy.mm_idx_index_name(self._idx)
|
||||
else:
|
||||
r = cmappy.mm_idx_reader_open(str.encode(fn_idx_in), &self.idx_opt, fn_idx_out)
|
||||
if r is not NULL:
|
||||
self._idx = cmappy.mm_idx_reader_read(r, n_threads) # NB: ONLY read the first part
|
||||
cmappy.mm_idx_reader_close(r)
|
||||
self._idx = cmappy.mappy_idx_seq(self.idx_opt.w, self.idx_opt.k, self.idx_opt.flag&1, self.idx_opt.bucket_bits, str.encode(seq), len(seq))
|
||||
cmappy.mm_mapopt_update(&self.map_opt, self._idx)
|
||||
cmappy.mm_idx_index_name(self._idx)
|
||||
self.map_opt.mid_occ = 1000 # don't filter high-occ seeds
|
||||
|
||||
def __dealloc__(self):
|
||||
if self._idx is not NULL:
|
||||
@@ -132,36 +161,63 @@ cdef class Aligner:
|
||||
def __bool__(self):
|
||||
return (self._idx != NULL)
|
||||
|
||||
def map(self, seq, seq2=None, buf=None):
|
||||
def map(self, seq, seq2=None, buf=None, cs=False, MD=False, max_frag_len=None, extra_flags=None):
|
||||
cdef cmappy.mm_reg1_t *regs
|
||||
cdef cmappy.mm_hitpy_t h
|
||||
cdef ThreadBuffer b
|
||||
cdef int n_regs
|
||||
cdef char *cs_str = NULL
|
||||
cdef int l_cs_str, m_cs_str = 0
|
||||
cdef void *km
|
||||
cdef cmappy.mm_mapopt_t map_opt
|
||||
|
||||
if self._idx == NULL: return
|
||||
map_opt = self.map_opt
|
||||
if max_frag_len is not None: map_opt.max_frag_len = max_frag_len
|
||||
if extra_flags is not None: map_opt.flag |= extra_flags
|
||||
|
||||
if self._idx is NULL: return None
|
||||
if buf is None: b = ThreadBuffer()
|
||||
else: b = buf
|
||||
km = cmappy.mm_tbuf_get_km(b._b)
|
||||
|
||||
_seq = seq if isinstance(seq, bytes) else seq.encode()
|
||||
if seq2 is None:
|
||||
regs = cmappy.mm_map_aux(self._idx, _seq, NULL, &n_regs, b._b, &self.map_opt)
|
||||
regs = cmappy.mm_map_aux(self._idx, _seq, NULL, &n_regs, b._b, &map_opt)
|
||||
else:
|
||||
_seq2 = seq2 if isinstance(seq2, bytes) else seq2.encode()
|
||||
regs = cmappy.mm_map_aux(self._idx, _seq, _seq2, &n_regs, b._b, &self.map_opt)
|
||||
regs = cmappy.mm_map_aux(self._idx, _seq, _seq2, &n_regs, b._b, &map_opt)
|
||||
|
||||
for i in range(n_regs):
|
||||
cmappy.mm_reg2hitpy(self._idx, ®s[i], &h)
|
||||
cigar = []
|
||||
for k in range(h.n_cigar32):
|
||||
c = h.cigar32[k]
|
||||
cigar.append([c>>4, c&0xf])
|
||||
yield Alignment(h.ctg, h.ctg_len, h.ctg_start, h.ctg_end, h.strand, h.qry_start, h.qry_end, h.mapq, cigar, h.is_primary, h.mlen, h.blen, h.NM, h.trans_strand, h.seg_id)
|
||||
cmappy.mm_free_reg1(®s[i])
|
||||
free(regs)
|
||||
try:
|
||||
i = 0
|
||||
while i < n_regs:
|
||||
cmappy.mm_reg2hitpy(self._idx, ®s[i], &h)
|
||||
cigar, _cs, _MD = [], '', ''
|
||||
for k in range(h.n_cigar32): # convert the 32-bit CIGAR encoding to Python array
|
||||
c = h.cigar32[k]
|
||||
cigar.append([c>>4, c&0xf])
|
||||
if cs or MD: # generate the cs and/or the MD tag, if requested
|
||||
if cs:
|
||||
l_cs_str = cmappy.mm_gen_cs(km, &cs_str, &m_cs_str, self._idx, ®s[i], _seq, 1)
|
||||
_cs = cs_str[:l_cs_str] if isinstance(cs_str, str) else cs_str[:l_cs_str].decode()
|
||||
if MD:
|
||||
l_cs_str = cmappy.mm_gen_MD(km, &cs_str, &m_cs_str, self._idx, ®s[i], _seq)
|
||||
_MD = cs_str[:l_cs_str] if isinstance(cs_str, str) else cs_str[:l_cs_str].decode()
|
||||
yield Alignment(h.ctg, h.ctg_len, h.ctg_start, h.ctg_end, h.strand, h.qry_start, h.qry_end, h.mapq, cigar, h.is_primary, h.mlen, h.blen, h.NM, h.trans_strand, h.seg_id, _cs, _MD)
|
||||
cmappy.mm_free_reg1(®s[i])
|
||||
i += 1
|
||||
finally:
|
||||
while i < n_regs:
|
||||
cmappy.mm_free_reg1(®s[i])
|
||||
i += 1
|
||||
free(regs)
|
||||
free(cs_str)
|
||||
|
||||
def seq(self, str name, int start=0, int end=0x7fffffff):
|
||||
cdef int l
|
||||
cdef char *s = cmappy.mappy_fetch_seq(self._idx, name.encode(), start, end, &l)
|
||||
cdef char *s
|
||||
if self._idx == NULL: return
|
||||
s = cmappy.mappy_fetch_seq(self._idx, name.encode(), start, end, &l)
|
||||
if l == 0: return None
|
||||
r = s[:l] if isinstance(s, str) else s[:l].decode()
|
||||
free(s)
|
||||
@@ -176,6 +232,17 @@ cdef class Aligner:
|
||||
@property
|
||||
def n_seq(self): return self._idx.n_seq
|
||||
|
||||
@property
|
||||
def seq_names(self):
|
||||
cdef char *p
|
||||
if self._idx == NULL: return
|
||||
sn = []
|
||||
for i in range(self._idx.n_seq):
|
||||
p = self._idx.seq[i].name
|
||||
s = p if isinstance(p, str) else p.decode()
|
||||
sn.append(s)
|
||||
return sn
|
||||
|
||||
def fastx_read(fn, read_comment=False):
|
||||
cdef cmappy.kseq_t *ks
|
||||
ks = cmappy.mm_fastx_open(str.encode(fn))
|
||||
|
||||
+8
-4
@@ -1,10 +1,11 @@
|
||||
#!/usr/bin/env python
|
||||
|
||||
import sys, getopt
|
||||
import sys
|
||||
import getopt
|
||||
import mappy as mp
|
||||
|
||||
def main(argv):
|
||||
opts, args = getopt.getopt(argv[1:], "x:n:m:k:w:r:")
|
||||
opts, args = getopt.getopt(argv[1:], "x:n:m:k:w:r:c")
|
||||
if len(args) < 2:
|
||||
print("Usage: minimap2.py [options] <ref.fa>|<ref.mmi> <query.fq>")
|
||||
print("Options:")
|
||||
@@ -14,9 +15,11 @@ def main(argv):
|
||||
print(" -k INT k-mer length")
|
||||
print(" -w INT minimizer window length")
|
||||
print(" -r INT band width")
|
||||
print(" -c output the cs tag")
|
||||
sys.exit(1)
|
||||
|
||||
preset, min_cnt, min_sc, k, w, bw = None, None, None, None, None, None
|
||||
preset = min_cnt = min_sc = k = w = bw = None
|
||||
out_cs = False
|
||||
for opt, arg in opts:
|
||||
if opt == '-x': preset = arg
|
||||
elif opt == '-n': min_cnt = int(arg)
|
||||
@@ -24,11 +27,12 @@ def main(argv):
|
||||
elif opt == '-r': bw = int(arg)
|
||||
elif opt == '-k': k = int(arg)
|
||||
elif opt == '-w': w = int(arg)
|
||||
elif opt == '-c': out_cs = True
|
||||
|
||||
a = mp.Aligner(args[0], preset=preset, min_cnt=min_cnt, min_chain_score=min_sc, k=k, w=w, bw=bw)
|
||||
if not a: raise Exception("ERROR: failed to load/build index file '{}'".format(args[0]))
|
||||
for name, seq, qual in mp.fastx_read(args[1]): # read one sequence
|
||||
for h in a.map(seq): # traverse hits
|
||||
for h in a.map(seq, cs=out_cs): # traverse hits
|
||||
print('{}\t{}\t{}'.format(name, len(seq), h))
|
||||
|
||||
if __name__ == "__main__":
|
||||
|
||||
@@ -70,10 +70,10 @@ void sdust_buf_destroy(sdust_buf_t *buf)
|
||||
static inline void shift_window(int t, kdq_t(int) *w, int T, int W, int *L, int *rw, int *rv, int *cw, int *cv)
|
||||
{
|
||||
int s;
|
||||
if (kdq_size(w) >= W - SD_WLEN + 1) { // TODO: is this right for SD_WLEN!=3?
|
||||
if ((int)kdq_size(w) >= W - SD_WLEN + 1) { // TODO: is this right for SD_WLEN!=3?
|
||||
s = *kdq_shift(int, w);
|
||||
*rw -= --cw[s];
|
||||
if (*L > kdq_size(w))
|
||||
if (*L > (int)kdq_size(w))
|
||||
--*L, *rv -= --cv[s];
|
||||
}
|
||||
kdq_push(int, w, t);
|
||||
@@ -114,7 +114,7 @@ static void find_perfect(void *km, perf_intv_v *P, const kdq_t(int) *w, int T, i
|
||||
r += c[t]++;
|
||||
new_r = r, new_l = kdq_size(w) - i - 1;
|
||||
if (new_r * 10 > T * new_l) {
|
||||
for (j = 0; j < P->n && P->a[j].start >= i + start; ++j) { // find insertion position
|
||||
for (j = 0; j < (int)P->n && P->a[j].start >= i + start; ++j) { // find insertion position
|
||||
perf_intv_t *p = &P->a[j];
|
||||
if (max_r == 0 || p->r * max_l > max_r * p->l)
|
||||
max_r = p->r, max_l = p->l;
|
||||
@@ -177,7 +177,7 @@ uint64_t *sdust(void *km, const uint8_t *seq, int l_seq, int T, int W, int *n)
|
||||
#ifdef _SDUST_MAIN
|
||||
#include <zlib.h>
|
||||
#include <stdio.h>
|
||||
#include "getopt.h"
|
||||
#include "ketopt.h"
|
||||
#include "kseq.h"
|
||||
KSEQ_INIT(gzFile, gzread)
|
||||
|
||||
@@ -186,16 +186,17 @@ int main(int argc, char *argv[])
|
||||
gzFile fp;
|
||||
kseq_t *ks;
|
||||
int W = 64, T = 20, c;
|
||||
ketopt_t o = KETOPT_INIT;
|
||||
|
||||
while ((c = getopt(argc, argv, "w:t:")) >= 0) {
|
||||
if (c == 'w') W = atoi(optarg);
|
||||
else if (c == 't') T = atoi(optarg);
|
||||
while ((c = ketopt(&o, argc, argv, 1, "w:t:", 0)) >= 0) {
|
||||
if (c == 'w') W = atoi(o.arg);
|
||||
else if (c == 't') T = atoi(o.arg);
|
||||
}
|
||||
if (optind == argc) {
|
||||
if (o.ind == argc) {
|
||||
fprintf(stderr, "Usage: sdust [-w %d] [-t %d] <in.fa>\n", W, T);
|
||||
return 1;
|
||||
}
|
||||
fp = strcmp(argv[optind], "-")? gzopen(argv[optind], "r") : gzdopen(fileno(stdin), "r");
|
||||
fp = strcmp(argv[o.ind], "-")? gzopen(argv[o.ind], "r") : gzdopen(fileno(stdin), "r");
|
||||
ks = kseq_init(fp);
|
||||
while (kseq_read(ks) >= 0) {
|
||||
uint64_t *r;
|
||||
|
||||
@@ -0,0 +1,105 @@
|
||||
#include "mmpriv.h"
|
||||
#include "kalloc.h"
|
||||
#include "ksort.h"
|
||||
|
||||
mm_seed_t *mm_seed_collect_all(void *km, const mm_idx_t *mi, const mm128_v *mv, int32_t *n_m_)
|
||||
{
|
||||
mm_seed_t *m;
|
||||
size_t i;
|
||||
int32_t k;
|
||||
m = (mm_seed_t*)kmalloc(km, mv->n * sizeof(mm_seed_t));
|
||||
for (i = k = 0; i < mv->n; ++i) {
|
||||
const uint64_t *cr;
|
||||
mm_seed_t *q;
|
||||
mm128_t *p = &mv->a[i];
|
||||
uint32_t q_pos = (uint32_t)p->y, q_span = p->x & 0xff;
|
||||
int t;
|
||||
cr = mm_idx_get(mi, p->x>>8, &t);
|
||||
if (t == 0) continue;
|
||||
q = &m[k++];
|
||||
q->q_pos = q_pos, q->q_span = q_span, q->cr = cr, q->n = t, q->seg_id = p->y >> 32;
|
||||
q->is_tandem = q->flt = 0;
|
||||
if (i > 0 && p->x>>8 == mv->a[i - 1].x>>8) q->is_tandem = 1;
|
||||
if (i < mv->n - 1 && p->x>>8 == mv->a[i + 1].x>>8) q->is_tandem = 1;
|
||||
}
|
||||
*n_m_ = k;
|
||||
return m;
|
||||
}
|
||||
|
||||
#define MAX_MAX_HIGH_OCC 128
|
||||
|
||||
void mm_seed_select(int32_t n, mm_seed_t *a, int len, int max_occ, int max_max_occ, int dist)
|
||||
{ // for high-occ minimizers, choose up to max_high_occ in each high-occ streak
|
||||
extern void ks_heapdown_uint64_t(size_t i, size_t n, uint64_t*);
|
||||
extern void ks_heapmake_uint64_t(size_t n, uint64_t*);
|
||||
int32_t i, last0, m;
|
||||
uint64_t b[MAX_MAX_HIGH_OCC]; // this is to avoid a heap allocation
|
||||
|
||||
if (n == 0 || n == 1) return;
|
||||
for (i = m = 0; i < n; ++i)
|
||||
if (a[i].n > max_occ) ++m;
|
||||
if (m == 0) return; // no high-frequency k-mers; do nothing
|
||||
for (i = 0, last0 = -1; i <= n; ++i) {
|
||||
if (i == n || a[i].n <= max_occ) {
|
||||
if (i - last0 > 1) {
|
||||
int32_t ps = last0 < 0? 0 : (uint32_t)a[last0].q_pos>>1;
|
||||
int32_t pe = i == n? len : (uint32_t)a[i].q_pos>>1;
|
||||
int32_t j, k, st = last0 + 1, en = i;
|
||||
int32_t max_high_occ = (int32_t)((double)(pe - ps) / dist + .499);
|
||||
//fprintf(stderr, "Y\t%d\t%d\n", ps, pe);
|
||||
if (max_high_occ > MAX_MAX_HIGH_OCC)
|
||||
max_high_occ = MAX_MAX_HIGH_OCC;
|
||||
for (j = st, k = 0; j < en && k < max_high_occ; ++j, ++k)
|
||||
b[k] = (uint64_t)a[j].n<<32 | j;
|
||||
ks_heapmake_uint64_t(k, b); // initialize the binomial heap
|
||||
for (; j < en; ++j) { // if there are more, choose top max_high_occ
|
||||
if (a[j].n < (int32_t)(b[0]>>32)) { // then update the heap
|
||||
b[0] = (uint64_t)a[j].n<<32 | j;
|
||||
ks_heapdown_uint64_t(0, k, b);
|
||||
}
|
||||
}
|
||||
for (j = 0; j < k; ++j) a[(uint32_t)b[j]].flt = 1;
|
||||
for (j = st; j < en; ++j) a[j].flt ^= 1;
|
||||
for (j = st; j < en; ++j)
|
||||
if (a[j].n > max_max_occ)
|
||||
a[j].flt = 1;
|
||||
}
|
||||
last0 = i;
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
mm_seed_t *mm_collect_matches(void *km, int *_n_m, int qlen, int max_occ, int max_max_occ, int dist, const mm_idx_t *mi, const mm128_v *mv, int64_t *n_a, int *rep_len, int *n_mini_pos, uint64_t **mini_pos)
|
||||
{
|
||||
int rep_st = 0, rep_en = 0, n_m, n_m0;
|
||||
size_t i;
|
||||
mm_seed_t *m;
|
||||
*n_mini_pos = 0;
|
||||
*mini_pos = (uint64_t*)kmalloc(km, mv->n * sizeof(uint64_t));
|
||||
m = mm_seed_collect_all(km, mi, mv, &n_m0);
|
||||
if (dist > 0 && max_max_occ > max_occ) {
|
||||
mm_seed_select(n_m0, m, qlen, max_occ, max_max_occ, dist);
|
||||
} else {
|
||||
for (i = 0; i < n_m0; ++i)
|
||||
if (m[i].n > max_occ)
|
||||
m[i].flt = 1;
|
||||
}
|
||||
for (i = 0, n_m = 0, *rep_len = 0, *n_a = 0; i < n_m0; ++i) {
|
||||
mm_seed_t *q = &m[i];
|
||||
//fprintf(stderr, "X\t%d\t%d\t%d\n", q->q_pos>>1, q->n, q->flt);
|
||||
if (q->flt) {
|
||||
int en = (q->q_pos >> 1) + 1, st = en - q->q_span;
|
||||
if (st > rep_en) {
|
||||
*rep_len += rep_en - rep_st;
|
||||
rep_st = st, rep_en = en;
|
||||
} else rep_en = en;
|
||||
} else {
|
||||
*n_a += q->n;
|
||||
(*mini_pos)[(*n_mini_pos)++] = (uint64_t)q->q_span<<32 | q->q_pos>>1;
|
||||
m[n_m++] = *q;
|
||||
}
|
||||
}
|
||||
*rep_len += rep_en - rep_st;
|
||||
*_n_m = n_m;
|
||||
return m;
|
||||
}
|
||||
@@ -4,26 +4,26 @@ except ImportError:
|
||||
from distutils.core import setup
|
||||
from distutils.extension import Extension
|
||||
|
||||
cmdclass = {}
|
||||
import sys, platform
|
||||
|
||||
try:
|
||||
from Cython.Build import build_ext
|
||||
except ImportError: # without Cython
|
||||
module_src = 'python/mappy.c'
|
||||
else: # with Cython
|
||||
module_src = 'python/mappy.pyx'
|
||||
cmdclass['build_ext'] = build_ext
|
||||
|
||||
import sys
|
||||
sys.path.append('python')
|
||||
|
||||
extra_compile_args = ['-DHAVE_KALLOC']
|
||||
include_dirs = ["."]
|
||||
|
||||
if platform.machine() in ["aarch64", "arm64"]:
|
||||
include_dirs.append("sse2neon/")
|
||||
extra_compile_args.extend(['-ftree-vectorize', '-DKSW_SSE2_ONLY', '-D__SSE2__'])
|
||||
else:
|
||||
extra_compile_args.append('-msse4.1') # WARNING: ancient x86_64 CPUs don't have SSE4
|
||||
|
||||
def readme():
|
||||
with open('python/README.rst') as f:
|
||||
return f.read()
|
||||
with open('python/README.rst') as f:
|
||||
return f.read()
|
||||
|
||||
setup(
|
||||
name = 'mappy',
|
||||
version = '2.9',
|
||||
version = '2.19',
|
||||
url = 'https://github.com/lh3/minimap2',
|
||||
description = 'Minimap2 python binding',
|
||||
long_description = readme(),
|
||||
@@ -32,15 +32,15 @@ setup(
|
||||
license = 'MIT',
|
||||
keywords = 'sequence-alignment',
|
||||
scripts = ['python/minimap2.py'],
|
||||
ext_modules = [Extension('mappy',
|
||||
sources = [module_src, 'align.c', 'bseq.c', 'chain.c', 'format.c', 'hit.c', 'index.c', 'pe.c', 'options.c',
|
||||
ext_modules = [Extension('mappy',
|
||||
sources = ['python/mappy.pyx', 'align.c', 'bseq.c', 'lchain.c', 'format.c', 'hit.c', 'index.c', 'pe.c', 'options.c',
|
||||
'ksw2_extd2_sse.c', 'ksw2_exts2_sse.c', 'ksw2_extz2_sse.c', 'ksw2_ll_sse.c',
|
||||
'kalloc.c', 'kthread.c', 'map.c', 'misc.c', 'sdust.c', 'sketch.c', 'esterr.c'],
|
||||
'kalloc.c', 'kthread.c', 'map.c', 'misc.c', 'sdust.c', 'sketch.c', 'esterr.c', 'splitidx.c'],
|
||||
depends = ['minimap.h', 'bseq.h', 'kalloc.h', 'kdq.h', 'khash.h', 'kseq.h', 'ksort.h',
|
||||
'ksw2.h', 'kthread.h', 'kvec.h', 'mmpriv.h', 'sdust.h',
|
||||
'python/cmappy.h', 'python/cmappy.pxd'],
|
||||
extra_compile_args = ['-DHAVE_KALLOC', '-msse4'], # WARNING: ancient x86_64 CPUs don't have SSE4
|
||||
include_dirs = ['.'],
|
||||
extra_compile_args = extra_compile_args,
|
||||
include_dirs = include_dirs,
|
||||
libraries = ['z', 'm', 'pthread'])],
|
||||
classifiers = [
|
||||
'Development Status :: 5 - Production/Stable',
|
||||
@@ -52,4 +52,4 @@ setup(
|
||||
'Programming Language :: Python :: 3',
|
||||
'Intended Audience :: Science/Research',
|
||||
'Topic :: Scientific/Engineering :: Bio-Informatics'],
|
||||
cmdclass = cmdclass)
|
||||
setup_requires=["cython"])
|
||||
|
||||
+84
@@ -0,0 +1,84 @@
|
||||
#include <string.h>
|
||||
#include <assert.h>
|
||||
#include <stdlib.h>
|
||||
#include <stdio.h>
|
||||
#include <errno.h>
|
||||
#include "mmpriv.h"
|
||||
|
||||
FILE *mm_split_init(const char *prefix, const mm_idx_t *mi)
|
||||
{
|
||||
char *fn;
|
||||
FILE *fp;
|
||||
uint32_t i, k = mi->k;
|
||||
fn = (char*)calloc(strlen(prefix) + 10, 1);
|
||||
sprintf(fn, "%s.%.4d.tmp", prefix, mi->index);
|
||||
if ((fp = fopen(fn, "wb")) == NULL) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "[ERROR]\033[1;31m failed to write to temporary file '%s'\033[0m: %s\n", fn, strerror(errno));
|
||||
exit(1);
|
||||
}
|
||||
mm_err_fwrite(&k, 4, 1, fp);
|
||||
mm_err_fwrite(&mi->n_seq, 4, 1, fp);
|
||||
for (i = 0; i < mi->n_seq; ++i) {
|
||||
uint32_t l;
|
||||
l = strlen(mi->seq[i].name);
|
||||
mm_err_fwrite(&l, 1, 4, fp);
|
||||
mm_err_fwrite(mi->seq[i].name, 1, l, fp);
|
||||
mm_err_fwrite(&mi->seq[i].len, 4, 1, fp);
|
||||
}
|
||||
free(fn);
|
||||
return fp;
|
||||
}
|
||||
|
||||
mm_idx_t *mm_split_merge_prep(const char *prefix, int n_splits, FILE **fp, uint32_t *n_seq_part)
|
||||
{
|
||||
mm_idx_t *mi = 0;
|
||||
char *fn;
|
||||
int i, j;
|
||||
|
||||
if (n_splits < 1) return 0;
|
||||
fn = CALLOC(char, strlen(prefix) + 10);
|
||||
for (i = 0; i < n_splits; ++i) {
|
||||
sprintf(fn, "%s.%.4d.tmp", prefix, i);
|
||||
if ((fp[i] = fopen(fn, "rb")) == 0) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "ERROR: failed to open temporary file '%s': %s\n", fn, strerror(errno));
|
||||
for (j = 0; j < i; ++j)
|
||||
fclose(fp[j]);
|
||||
free(fn);
|
||||
return 0;
|
||||
}
|
||||
}
|
||||
free(fn);
|
||||
|
||||
mi = CALLOC(mm_idx_t, 1);
|
||||
for (i = 0; i < n_splits; ++i) {
|
||||
mm_err_fread(&mi->k, 4, 1, fp[i]); // TODO: check if k is all the same
|
||||
mm_err_fread(&n_seq_part[i], 4, 1, fp[i]);
|
||||
mi->n_seq += n_seq_part[i];
|
||||
}
|
||||
mi->seq = CALLOC(mm_idx_seq_t, mi->n_seq);
|
||||
for (i = j = 0; i < n_splits; ++i) {
|
||||
uint32_t k;
|
||||
for (k = 0; k < n_seq_part[i]; ++k, ++j) {
|
||||
uint32_t l;
|
||||
mm_err_fread(&l, 1, 4, fp[i]);
|
||||
mi->seq[j].name = (char*)calloc(l + 1, 1);
|
||||
mm_err_fread(mi->seq[j].name, 1, l, fp[i]);
|
||||
mm_err_fread(&mi->seq[j].len, 4, 1, fp[i]);
|
||||
}
|
||||
}
|
||||
return mi;
|
||||
}
|
||||
|
||||
void mm_split_rm_tmp(const char *prefix, int n_splits)
|
||||
{
|
||||
int i;
|
||||
char *fn;
|
||||
fn = CALLOC(char, strlen(prefix) + 10);
|
||||
for (i = 0; i < n_splits; ++i) {
|
||||
sprintf(fn, "%s.%.4d.tmp", prefix, i);
|
||||
remove(fn);
|
||||
}
|
||||
free(fn);
|
||||
}
|
||||
+1
-1
@@ -1,4 +1,4 @@
|
||||
>MT_orang
|
||||
>MT_orang co:Z:comment
|
||||
GTTTATGTAGCTTATTCTATCCAAAGCAATGCACTGAAAATGTCTCGACGGGCCCACACG
|
||||
CCCCATAAACAAATAGGTTTGGTCCTAGCCTTTCTATTAGCTCTTAGTGAGGTTACACAT
|
||||
GCAAGCATCCCCGCCCCAGTGAGTCGCCCTCCAAGTCACTCTGACTAAGAGGAGCAAGCA
|
||||
|
||||
+16
-15
@@ -61,13 +61,6 @@
|
||||
Volume = {32},
|
||||
Year = {2016}}
|
||||
|
||||
@misc{Suzuki:2016,
|
||||
title = {Fast and accurate alignment tool for PacBio and Nanopore long reads},
|
||||
author = {Hajime Suzuki},
|
||||
journal = {Unpublished},
|
||||
howpublished = {\href{https://github.com/ocxtal/minialign}{https://github.com/ocxtal/minialign}},
|
||||
year = {2016}}
|
||||
|
||||
@misc{Ruan:2016,
|
||||
title = {Ultra-fast de novo assembler using long noisy reads},
|
||||
author = {Jue Ruan},
|
||||
@@ -172,14 +165,6 @@
|
||||
Volume = {29},
|
||||
Year = {2011}}
|
||||
|
||||
@article {Suzuki130633,
|
||||
author = {Suzuki, Hajime and Kasahara, Masahiro},
|
||||
title = {Acceleration Of Nucleotide Semi-Global Alignment With Adaptive Banded Dynamic Programming},
|
||||
year = {2017},
|
||||
note = {doi:10.1101/130633},
|
||||
publisher = {Cold Spring Harbor Labs Journals},
|
||||
journal = {bioRxiv}}
|
||||
|
||||
@article{Gotoh:1982aa,
|
||||
Author = {Gotoh, O},
|
||||
Journal = {J Mol Biol},
|
||||
@@ -337,3 +322,19 @@
|
||||
Title = {{MUMmer4}: A fast and versatile genome alignment system},
|
||||
Volume = {14},
|
||||
Year = {2018}}
|
||||
|
||||
@article{Li:2009ys,
|
||||
Author = {Li, Heng and others},
|
||||
Journal = {Bioinformatics},
|
||||
Pages = {2078-9},
|
||||
Title = {The {Sequence Alignment/Map format and SAMtools}},
|
||||
Volume = {25},
|
||||
Year = {2009}}
|
||||
|
||||
@article{Suzuki:2018aa,
|
||||
Author = {Suzuki, Hajime and Kasahara, Masahiro},
|
||||
Journal = {BMC Bioinformatics},
|
||||
Pages = {45},
|
||||
Title = {Introducing difference recurrence relations for faster semi-global alignment of long sequences},
|
||||
Volume = {19},
|
||||
Year = {2018}}
|
||||
|
||||
+23
-16
@@ -19,7 +19,7 @@
|
||||
\begin{document}
|
||||
\firstpage{1}
|
||||
|
||||
\title[Aligning nucleotide sequences with minimap2]{Minimap2: versatile pairwise alignment for nucleotide sequences}
|
||||
\title[Aligning nucleotide sequences with minimap2]{Minimap2: pairwise alignment for nucleotide sequences}
|
||||
\author[Li]{Heng Li}
|
||||
\address{Broad Institute, 415 Main Street, Cambridge, MA 02142, USA}
|
||||
|
||||
@@ -64,7 +64,7 @@ the thought that 10kb long sequences should be easier to map than 100bp reads
|
||||
because we can more effectively skip repetitive regions, which are often the
|
||||
bottleneck of short-read alignment. We confirmed our speculation by achieving
|
||||
approximate mapping 50 times faster than BWA-MEM~\citep{Li:2016aa}.
|
||||
\citet{Suzuki130633} extended our work with a fast and novel algorithm on
|
||||
\citet{Suzuki:2018aa} extended our work with a fast and novel algorithm on
|
||||
generating base-level alignment, which in turn inspired us to develop minimap2
|
||||
with added functionality.
|
||||
|
||||
@@ -88,7 +88,9 @@ the versatility of minimap2.
|
||||
|
||||
Minimap2 follows a typical seed-chain-align procedure as is used by most
|
||||
full-genome aligners. It collects minimizers~\citep{Roberts:2004fv} of the
|
||||
reference sequences and indexes them in a hash table. Then for each query
|
||||
reference sequences and indexes them in a hash table, with the key being the
|
||||
hash of a minimizer and the value being a list of locations of the minimizer
|
||||
copies. Then for each query
|
||||
sequence, minimap2 takes query minimizers as \emph{seeds}, finds exact matches
|
||||
(i.e. \emph{anchors}) to the reference, and identifies sets of colinear anchors as
|
||||
\emph{chains}. If base-level alignment is requested, minimap2 applies dynamic
|
||||
@@ -118,9 +120,12 @@ distance between two anchors is too large); otherwise
|
||||
\begin{equation}\label{eq:chain-gap}
|
||||
\beta(j,i)=\gamma_c\big((y_i-y_j)-(x_i-x_j)\big)
|
||||
\end{equation}
|
||||
In implementation, a gap of length $l\not=0$ costs
|
||||
In implementation, a gap of length $l$ costs
|
||||
\[
|
||||
\gamma_c(l)=0.01\cdot \bar{w}\cdot|l|+0.5\log_2|l|
|
||||
\gamma_c(l)=\left\{\begin{array}{ll}
|
||||
0.01\cdot \bar{w}\cdot|l|+0.5\log_2|l| & (l\not=0) \\
|
||||
0 & (l=0)
|
||||
\end{array}\right.
|
||||
\]
|
||||
where $\bar{w}$ is the average seed length. For $N$ anchors, directly computing all $f(\cdot)$ with
|
||||
Eq.~(\ref{eq:chain}) takes $O(N^2)$ time. Although theoretically faster
|
||||
@@ -164,7 +169,7 @@ empirical formula:
|
||||
\[
|
||||
{\rm mapQ}=40\cdot (1-f_2/f_1)\cdot\min\{1,m/10\}\cdot\log f_1
|
||||
\]
|
||||
where $m$ is the number of anchors on the primary chain, $f_1$ is the chaining
|
||||
where $\log$ denotes natural logarithm, $m$ is the number of anchors on the primary chain, $f_1$ is the chaining
|
||||
score, and $f_2\le f_1$ is the score of the best chain that is secondary to the
|
||||
primary chain. Intuitively, a chain is assigned to a higher mapping quality if
|
||||
it is long and its best secondary chain is weak.
|
||||
@@ -253,7 +258,7 @@ performance of minimap2. Traditional SSE implementations~\citep{Farrar:2007hs}
|
||||
based on Eq.~(\ref{eq:ae86}) can achieve 16-way parallelization for short
|
||||
sequences, but only 4-way parallelization when the peak alignment score reaches
|
||||
32767. Long sequence alignment may exceed this threshold. Inspired by
|
||||
\citet{Wu:1996aa} and the following work, \citet{Suzuki130633} proposed a
|
||||
\citet{Wu:1996aa} and the following work, \citet{Suzuki:2018aa} proposed a
|
||||
difference-based formulation that lifted this limitation.
|
||||
In case of 2-piece gap cost, define
|
||||
\[
|
||||
@@ -320,7 +325,7 @@ y_{rt}&=&\max\{0,y_{r-1,t}+u_{r-1,t}-z_{rt}+q\}-q-e\\
|
||||
\end{equation*}
|
||||
In this formulation, cells with the same diagonal index $r$ are independent of
|
||||
each other. This allows us to fully vectorize the computation of all cells on
|
||||
the same anti-diagonal in one inner loop. It also simplifies banded alignment,
|
||||
the same anti-diagonal in one inner loop. It also simplifies banded alignment (500bp band width by default),
|
||||
which would be difficult with striped vectorization~\citep{Farrar:2007hs}.
|
||||
|
||||
On the condition that $q+e<\tilde{q}+\tilde{e}$ and $e>\tilde{e}$, the initial
|
||||
@@ -355,7 +360,7 @@ times as fast as Parasail's 4-way vectorization~\citep{Daily:2016aa}. Without
|
||||
banding, our implementation is slower than Edlib~\citep{Sosic:2017aa}, but with
|
||||
a 1000bp band, it is considerably faster. When performing global alignment
|
||||
between anchors, we expect the alignment to stay close to the diagonal of the
|
||||
DP matrix. Banding is applicable most of time.
|
||||
DP matrix. Banding is applicable most of the time.
|
||||
|
||||
\subsubsection{The Z-drop heuristic}
|
||||
|
||||
@@ -478,7 +483,7 @@ both C and Python. It is distributed under the MIT license, free to both
|
||||
commercial and academic uses. Minimap2 uses the same base algorithm for all
|
||||
applications, but it has to apply different sets of parameters depending on
|
||||
input data types. Similar to BWA-MEM, minimap2 introduces `presets' that
|
||||
modify multiple parameters with a simple invokation. Detailed settings
|
||||
modify multiple parameters with a simple invocation. Detailed settings
|
||||
and command-line options can be found in the minimap2 manpage. In addition to
|
||||
the applications evaluated in the following sections, minimap2 also retains
|
||||
minimap's functionality to find overlaps between long reads and to search
|
||||
@@ -570,7 +575,7 @@ Peak RAM (GByte) & 8.9 & 14.5 & 3.2 & 29.2\vspace{1em}\\
|
||||
\% approx. introns & 91.8\% & 96.9\% & 92.5\% & 82.4\% \\
|
||||
\botrule
|
||||
\end{tabular}
|
||||
}{Mouse reads (AC:SRR5286960; R9.4 chemistry) were mapped to the primary assembly of mouse
|
||||
}{Mouse cDNA reads (AC:SRR5286960; R9.4 chemistry) were mapped to the primary assembly of mouse
|
||||
genome GRCm38 with the following tools and command options: minimap2 (`-ax
|
||||
splice'); GMAP (`-n 0 --min-intronlength 30 --cross-species'); SpAln (`-Q7 -LS
|
||||
-S3'); STARlong (according to
|
||||
@@ -579,7 +584,7 @@ compared to the EnsEMBL gene annotation, release 89. A predicted intron
|
||||
is \emph{novel} if it has no overlaps with any annotated introns. An intron
|
||||
is \emph{exact} if it is identical to an annotated intron. An intron is
|
||||
\emph{approximate} if both its 5'- and 3'-end are within 10bp around the ends
|
||||
of an annotated intron.}
|
||||
of an annotated intron. Chimeric alignments are defined in the SAM spec~\citep{Li:2009ys}.}
|
||||
\end{table}
|
||||
|
||||
We next aligned real mouse reads~\citep{Byrne:2017aa} with GMAP~(v2017-06-20;
|
||||
@@ -647,9 +652,9 @@ across the whole genome and have been \emph{de novo} assembled with SMRT reads
|
||||
to high quality. This allowed us to construct an independent truth variant
|
||||
dataset~\citep{Li223297} for
|
||||
ERR1341796. In this evaluation, minimap2 has higher SNP false negative rate
|
||||
(FNR; 2.5\% of minimap2 vs 2.2\% of BWA-MEM), but fewer false positive SNPs per
|
||||
million bases (FPPM; 3.0 vs 3.9), lower 2--50bp INDEL FNR (7.3\% vs 7.5\%) and
|
||||
similar INDEL FPPM (both 1.0). Minimap2 is broadly similar to BWA-MEM in the
|
||||
(FNR; 2.6\% of minimap2 vs 2.3\% of BWA-MEM), but fewer false positive SNPs per
|
||||
million bases (FPPM; 7.0 vs 8.8), similar INDEL FNR (11.2\% vs 11.3\%) and
|
||||
similar INDEL FPPM (6.4 vs 6.5). Minimap2 is broadly comparable to BWA-MEM in the
|
||||
context of small variant calling.
|
||||
|
||||
\subsection{Aligning long-read assemblies}
|
||||
@@ -687,7 +692,7 @@ involving $>$100kb introns, which was impractically slow ten years ago. The
|
||||
minimap2 chaining algorithm is fast and highly accurate by itself. In fact,
|
||||
chaining alone is more accurate than all the other long-read mappers in
|
||||
Fig.~\ref{fig:eval}a (data not shown). This accuracy helps to reduce downstream
|
||||
base-level alignment of candidate chains, which is still times slower than
|
||||
base-level alignment of candidate chains, which is still several times slower than
|
||||
chaining even with the Suzuki-Kasahara improvement. In addition, taking a
|
||||
general form, minimap2 chaining can be adapted to non-typical data types such as
|
||||
spliced reads and multiple reads per fragment. This gives us the opportunity to
|
||||
@@ -712,6 +717,8 @@ Schatz, P. Rescheneder and F. Sedlazeck for pointing out the limitation of
|
||||
BWA-MEM. We are also grateful to minimap2 users who have greatly helped to
|
||||
suggest features and to fix various issues.
|
||||
|
||||
\paragraph{Funding\textcolon} NHGRI 1R01HG010040-01
|
||||
|
||||
\bibliography{minimap2}
|
||||
|
||||
\end{document}
|
||||
|
||||
Reference in New Issue
Block a user