mirror of
https://github.com/lh3/minimap2.git
synced 2026-10-07 07:08:12 +08:00
Compare commits
| Author | SHA1 | Date | |
|---|---|---|---|
|
|
2d7ec75d50 | ||
|
|
7938ed4893 | ||
|
|
4740423afa | ||
|
|
1776311a9b | ||
|
|
c1a3e05cb0 | ||
|
|
ecb6703d4a | ||
|
|
0bf97a367b | ||
|
|
1c504d72e4 | ||
|
|
5ef9580b17 | ||
|
|
08bd2123b6 | ||
|
|
8766d286df | ||
|
|
623b5d9d48 | ||
|
|
18659118cd | ||
|
|
d1050f4eaf | ||
|
|
b81d45510e | ||
|
|
d135feb1a5 | ||
|
|
242ff4e91d | ||
|
|
7a0c1316ce | ||
|
|
77ebd479f4 | ||
|
|
e3f226a9d9 | ||
|
|
bdc615c1d4 | ||
|
|
ad1beaf255 | ||
|
|
de0480ac5b | ||
|
|
f2866533a8 | ||
|
|
0173850ef0 | ||
|
|
acea3594fb | ||
|
|
f78a247749 | ||
|
|
ccaf12e1a2 | ||
|
|
96b132c97d | ||
|
|
70428ca3a8 | ||
|
|
9aea79d621 | ||
|
|
1770988627 | ||
|
|
2bfdad34bb | ||
|
|
953766cedd | ||
|
|
dc61301d9f | ||
|
|
19e05a099d | ||
|
|
0238caa8b1 | ||
|
|
a22ebb9836 |
@@ -6,13 +6,13 @@ PROG= minimap2
|
||||
PROG_EXTRA= sdust minimap2-lite
|
||||
LIBS= -lm -lz -lpthread
|
||||
|
||||
ifeq ($(arm_neon),)
|
||||
ifeq ($(sse2only),)
|
||||
ifeq ($(arm_neon),) # if arm_neon is not defined
|
||||
ifeq ($(sse2only),) # if sse2only is not defined
|
||||
OBJS+=ksw2_extz2_sse41.o ksw2_extd2_sse41.o ksw2_exts2_sse41.o ksw2_extz2_sse2.o ksw2_extd2_sse2.o ksw2_exts2_sse2.o ksw2_dispatch.o
|
||||
else
|
||||
else # if sse2only is defined
|
||||
OBJS+=ksw2_extz2_sse.o ksw2_extd2_sse.o ksw2_exts2_sse.o
|
||||
endif
|
||||
else
|
||||
else # if arm_neon is defined
|
||||
OBJS+=ksw2_extz2_neon.o ksw2_extd2_neon.o ksw2_exts2_neon.o
|
||||
CFLAGS+=-D_FILE_OFFSET_BITS=64 -mfpu=neon -fsigned-char
|
||||
INCLUDES+=-Isse2neon
|
||||
@@ -42,26 +42,31 @@ sdust:sdust.c getopt.o kalloc.o kalloc.h kdq.h kvec.h kseq.h sdust.h
|
||||
|
||||
# SSE-specific targets on x86/x86_64
|
||||
|
||||
ifeq ($(arm_neon),) # if arm_neon is defined, compile this target with the default setting (i.e. no -msse2)
|
||||
ksw2_ll_sse.o:ksw2_ll_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c $(CFLAGS) -msse2 $(CPPFLAGS) $(INCLUDES) $< -o $@
|
||||
endif
|
||||
|
||||
ksw2_extz2_sse41.o:ksw2_extz2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_extz2_sse2.o:ksw2_extz2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
|
||||
$(CC) -c $(CFLAGS) -msse2 -mno-sse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_extd2_sse41.o:ksw2_extd2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_extd2_sse2.o:ksw2_extd2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
|
||||
$(CC) -c $(CFLAGS) -msse2 -mno-sse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_exts2_sse41.o:ksw2_exts2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_exts2_sse2.o:ksw2_exts2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
|
||||
$(CC) -c $(CFLAGS) -msse2 -mno-sse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_dispatch.o:ksw2_dispatch.c ksw2.h
|
||||
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||
|
||||
# NEON-specific targets on ARM
|
||||
|
||||
|
||||
@@ -1,3 +1,50 @@
|
||||
Release 2.10-r761 (27 March 2018)
|
||||
---------------------------------
|
||||
|
||||
Changes to minimap2:
|
||||
|
||||
* Optionally output the MD tag for compatibility with existing tools (#63,
|
||||
#118 and #137).
|
||||
|
||||
* Use SSE compiler flags more precisely to prevent compiling errors on certain
|
||||
machines (#127).
|
||||
|
||||
* Added option --min-occ-floor to set a minimum occurrence threshold. Presets
|
||||
intended for assembly-to-reference alignment set this option to 100. This
|
||||
option alleviates issues with regions having high copy numbers (#107).
|
||||
|
||||
* Exit with non-zero code on file writing errors (e.g. disk full; #103 and
|
||||
#132).
|
||||
|
||||
* Added option -y to copy FASTA/FASTQ comments in query sequences to the
|
||||
output (#136).
|
||||
|
||||
* Added the asm20 preset for alignments between genomes at 5-10% sequence
|
||||
divergence.
|
||||
|
||||
* Changed the band-width in the ava-ont preset from 500 to 2000. Oxford
|
||||
Nanopore reads may contain long deletion sequencing errors that break
|
||||
chaining.
|
||||
|
||||
Changes to mappy, the Python binding:
|
||||
|
||||
* Fixed a typo in Align.seq() (#126).
|
||||
|
||||
Changes to paftools.js, the companion script:
|
||||
|
||||
* Command sam2paf now converts the MD tag to cs.
|
||||
|
||||
* Support VCF output for assembly-to-reference variant calling (#109).
|
||||
|
||||
This version should produce identical alignment for read overlapping, RNA-seq
|
||||
read mapping, and genomic read mapping. We have also added a cook book to show
|
||||
the variety uses of minimap2 on real datasets. Please see cookbook.md in the
|
||||
minimap2 source code directory.
|
||||
|
||||
(2.10: 27 March 2017, r761)
|
||||
|
||||
|
||||
|
||||
Release 2.9-r720 (23 February 2018)
|
||||
-----------------------------------
|
||||
|
||||
|
||||
@@ -68,9 +68,8 @@ Detailed evaluations are available from the [minimap2 preprint][preprint].
|
||||
Minimap2 is optimized for x86-64 CPUs. You can acquire precompiled binaries from
|
||||
the [release page][release] with:
|
||||
```sh
|
||||
curl -L https://github.com/lh3/minimap2/releases/download/v2.9/minimap2-2.9_x64-linux.tar.bz2 \
|
||||
| tar -jxvf -
|
||||
./minimap2-2.9_x64-linux/minimap2
|
||||
curl -L https://github.com/lh3/minimap2/releases/download/v2.10/minimap2-2.10_x64-linux.tar.bz2 | tar -jxvf -
|
||||
./minimap2-2.10_x64-linux/minimap2
|
||||
```
|
||||
If you want to compile from the source, you need to have a C compiler, GNU make
|
||||
and zlib development files installed. Then type `make` in the source code
|
||||
@@ -137,7 +136,7 @@ Nanopore reads.
|
||||
#### <a name="map-long-splice"></a>Map long mRNA/cDNA reads
|
||||
|
||||
```sh
|
||||
minimap2 -ax splice -uf ref.fa iso-seq.fq > aln.sam # PacBio Iso-seq/traditional cDNA
|
||||
minimap2 -ax splice -uf -C5 ref.fa iso-seq.fq > aln.sam # PacBio Iso-seq/traditional cDNA
|
||||
minimap2 -ax splice ref.fa nanopore-cdna.fa > aln.sam # Nanopore 2D cDNA-seq
|
||||
minimap2 -ax splice -uf -k14 ref.fa direct-rna.fq > aln.sam # Nanopore Direct RNA-seq
|
||||
minimap2 -ax splice --splice-flank=no SIRV.fa SIRV-seq.fa # mapping against SIRV control
|
||||
@@ -229,7 +228,7 @@ sorting) still work with such BAM records; tools that read CIGAR will
|
||||
effectively ignore these records. It has been decided that future tools will
|
||||
will seamlessly recognize long-cigar records generated by option `-L`.
|
||||
|
||||
**TD;DR**: if you work with ultra-long reads and use tools that only process
|
||||
**TL;DR**: if you work with ultra-long reads and use tools that only process
|
||||
BAM files, please add option `-L`.
|
||||
|
||||
#### <a name="cs"></a>The cs optional tag
|
||||
@@ -346,6 +345,10 @@ mappy` or [from BioConda][mappyconda] via `conda install -c bioconda mappy`.
|
||||
possible to add non-SIMD support, but it would make minimap2 slower by
|
||||
several times.
|
||||
|
||||
* Minimap2 does not work with a single query or database sequence ~2
|
||||
billion bases or longer (2,147,483,647 to be exact). The total length of all
|
||||
sequences can well exceed this threshold.
|
||||
|
||||
|
||||
|
||||
[paf]: https://github.com/lh3/miniasm/blob/master/PAF.md
|
||||
|
||||
@@ -62,7 +62,7 @@ static inline char *kstrdup(const kstring_t *s)
|
||||
return t;
|
||||
}
|
||||
|
||||
static inline void kseq2bseq(kseq_t *ks, mm_bseq1_t *s, int with_qual)
|
||||
static inline void kseq2bseq(kseq_t *ks, mm_bseq1_t *s, int with_qual, int with_comment)
|
||||
{
|
||||
int i;
|
||||
s->name = kstrdup(&ks->name);
|
||||
@@ -71,10 +71,11 @@ static inline void kseq2bseq(kseq_t *ks, mm_bseq1_t *s, int with_qual)
|
||||
if (s->seq[i] == 'u' || s->seq[i] == 'U')
|
||||
--s->seq[i];
|
||||
s->qual = with_qual && ks->qual.l? kstrdup(&ks->qual) : 0;
|
||||
s->comment = with_comment && ks->comment.l? kstrdup(&ks->comment) : 0;
|
||||
s->l_seq = ks->seq.l;
|
||||
}
|
||||
|
||||
mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int frag_mode, int *n_)
|
||||
mm_bseq1_t *mm_bseq_read3(mm_bseq_file_t *fp, int chunk_size, int with_qual, int with_comment, int frag_mode, int *n_)
|
||||
{
|
||||
int64_t size = 0;
|
||||
kvec_t(mm_bseq1_t) a = {0,0,0};
|
||||
@@ -91,12 +92,12 @@ mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int
|
||||
assert(ks->seq.l <= INT32_MAX);
|
||||
if (a.m == 0) kv_resize(mm_bseq1_t, 0, a, 256);
|
||||
kv_pushp(mm_bseq1_t, 0, a, &s);
|
||||
kseq2bseq(ks, s, with_qual);
|
||||
kseq2bseq(ks, s, with_qual, with_comment);
|
||||
size += s->l_seq;
|
||||
if (size >= chunk_size) {
|
||||
if (frag_mode && a.a[a.n-1].l_seq < CHECK_PAIR_THRES) {
|
||||
while (kseq_read(ks) >= 0) {
|
||||
kseq2bseq(ks, &fp->s, with_qual);
|
||||
kseq2bseq(ks, &fp->s, with_qual, with_comment);
|
||||
if (mm_qname_same(fp->s.name, a.a[a.n-1].name)) {
|
||||
kv_push(mm_bseq1_t, 0, a, fp->s);
|
||||
memset(&fp->s, 0, sizeof(mm_bseq1_t));
|
||||
@@ -110,12 +111,17 @@ mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int
|
||||
return a.a;
|
||||
}
|
||||
|
||||
mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int frag_mode, int *n_)
|
||||
{
|
||||
return mm_bseq_read3(fp, chunk_size, with_qual, 0, frag_mode, n_);
|
||||
}
|
||||
|
||||
mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int chunk_size, int with_qual, int *n_)
|
||||
{
|
||||
return mm_bseq_read2(fp, chunk_size, with_qual, 0, n_);
|
||||
}
|
||||
|
||||
mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int *n_)
|
||||
mm_bseq1_t *mm_bseq_read_frag2(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int with_comment, int *n_)
|
||||
{
|
||||
int i;
|
||||
int64_t size = 0;
|
||||
@@ -136,7 +142,7 @@ mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int
|
||||
for (i = 0; i < n_fp; ++i) {
|
||||
mm_bseq1_t *s;
|
||||
kv_pushp(mm_bseq1_t, 0, a, &s);
|
||||
kseq2bseq(fp[i]->ks, s, with_qual);
|
||||
kseq2bseq(fp[i]->ks, s, with_qual, with_comment);
|
||||
size += s->l_seq;
|
||||
}
|
||||
if (size >= chunk_size) break;
|
||||
@@ -145,6 +151,11 @@ mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int
|
||||
return a.a;
|
||||
}
|
||||
|
||||
mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int *n_)
|
||||
{
|
||||
return mm_bseq_read_frag2(n_fp, fp, chunk_size, with_qual, 0, n_);
|
||||
}
|
||||
|
||||
int mm_bseq_eof(mm_bseq_file_t *fp)
|
||||
{
|
||||
return (ks_eof(fp->ks->f) && fp->s.seq == 0);
|
||||
|
||||
@@ -13,13 +13,15 @@ typedef struct mm_bseq_file_s mm_bseq_file_t;
|
||||
|
||||
typedef struct {
|
||||
int l_seq, rid;
|
||||
char *name, *seq, *qual;
|
||||
char *name, *seq, *qual, *comment;
|
||||
} mm_bseq1_t;
|
||||
|
||||
mm_bseq_file_t *mm_bseq_open(const char *fn);
|
||||
void mm_bseq_close(mm_bseq_file_t *fp);
|
||||
mm_bseq1_t *mm_bseq_read3(mm_bseq_file_t *fp, int chunk_size, int with_qual, int with_comment, int frag_mode, int *n_);
|
||||
mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int frag_mode, int *n_);
|
||||
mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int chunk_size, int with_qual, int *n_);
|
||||
mm_bseq1_t *mm_bseq_read_frag2(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int with_comment, int *n_);
|
||||
mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int *n_);
|
||||
int mm_bseq_eof(mm_bseq_file_t *fp);
|
||||
|
||||
|
||||
+243
@@ -0,0 +1,243 @@
|
||||
## Table of Contents
|
||||
|
||||
- [Introduction & Installation](#intro)
|
||||
- [Mapping Genomic Reads](#map-reads)
|
||||
* [Mapping long reads](#map-pb)
|
||||
* [Mapping Illumina paired-end reads](#map-sr)
|
||||
* [Evaluating mapping accuracy with simulated reads (for developers)](#mapeval)
|
||||
- [Mapping Long RNA-seq Reads](#map-rna)
|
||||
* [Mapping Nanopore 2D cDNA reads](#map-ont-cdna-2d)
|
||||
* [Mapping Nanopore direct-RNA reads](#map-direct-rna)
|
||||
* [Mapping PacBio Iso-seq reads](#map-iso-seq)
|
||||
- [Full-Genome Alignment](#genome-aln)
|
||||
* [Intra-species assembly alignment](#asm-to-ref)
|
||||
* [Cross-species full-genome alignment](#x-species)
|
||||
* [Eyeballing alignment](#view-aln)
|
||||
* [Calling variants from assembly-to-reference alignment](#asm-var)
|
||||
* [Constructing self-homology map](#hom-map)
|
||||
* [Lift Over (for developers)](#liftover)
|
||||
- [Read Overlap](#read-overlap)
|
||||
* [Long-read overlap](#long-read-overlap)
|
||||
* [Evaluating overlap sensitivity (for developers)](#ov-eval)
|
||||
|
||||
## <a name="intro"></a>Introduction & Installation
|
||||
|
||||
This cookbook walks you through a variety of applications of minimap2 and its
|
||||
companion script `paftools.js`. All data here are freely available from the
|
||||
minimap2 release page at version tag [v2.10][v2.10]. Some examples only work
|
||||
with v2.10 or later.
|
||||
|
||||
To acquire the data used in this cookbook and to install minimap2 and paftools,
|
||||
please follow the command lines below:
|
||||
```sh
|
||||
# install minimap2 executables
|
||||
curl -L https://github.com/lh3/minimap2/releases/download/v2.10/minimap2-2.10_x64-linux.tar.bz2 | tar jxf -
|
||||
cp minimap2-2.10_x64-linux/{minimap2,k8,paftools.js} . # copy executables
|
||||
export PATH="$PATH:"`pwd` # put the current directory on PATH
|
||||
# download example datasets
|
||||
curl -L https://github.com/lh3/minimap2/releases/download/v2.10/cookbook-data.tgz | tar zxf -
|
||||
```
|
||||
|
||||
## <a name="map-reads"></a>Mapping Genomic Reads
|
||||
|
||||
### <a name="map-pb"></a>Mapping long reads
|
||||
```sh
|
||||
minimap2 -ax map-pb -t4 ecoli_ref.fa ecoli_p6_25x_canu.fa > mapped.sam
|
||||
```
|
||||
Alternatively, you can create a minimap2 index first and then map:
|
||||
```sh
|
||||
minimap2 -x map-pb -d ecoli-pb.mmi ecoli_ref.fa # create an index
|
||||
minimap2 -ax map-pb ecoli-pb.mmi ecoli_p6_25x_canu.fa > mapped.sam
|
||||
```
|
||||
This will save you a couple of minutes when you map against the human genome.
|
||||
**HOWEVER**, key algorithm parameters such as the k-mer length and window
|
||||
size can't be changed after indexing. Minimap2 will give you a warning if
|
||||
parameters used in a pre-built index doesn't match parameters on the command
|
||||
line. **Please always make sure you are using an intended pre-built index.**
|
||||
|
||||
### <a name="map-sr"></a>Mapping Illumina paired-end reads:
|
||||
```sh
|
||||
minimap2 -ax sr -t4 ecoli_ref.fa ecoli_mason_1.fq ecoli_mason_2.fq > mapped-sr.sam
|
||||
```
|
||||
|
||||
### <a name="mapeval"></a>Evaluating mapping accuracy with simulated reads (for developers)
|
||||
```sh
|
||||
minimap2 -ax sr ecoli_ref.fa ecoli_mason_1.fq ecoli_mason_2.fq | paftools.js mapeval -
|
||||
```
|
||||
The output is:
|
||||
```
|
||||
Q 60 19712 0 0.000000000 19712
|
||||
Q 0 282 219 0.010953286 19994
|
||||
U 6
|
||||
```
|
||||
where a `U`-line gives the number of unmapped reads (for SAM input only); a
|
||||
`Q`-line gives:
|
||||
|
||||
1. Mapping quality (mapQ) threshold
|
||||
2. Number of mapped reads between this threshold and the previous mapQ threshold.
|
||||
3. Number of wrong mappings in the same mapQ interval
|
||||
4. Accumulative mapping error rate
|
||||
5. Accumulative number of mappings
|
||||
|
||||
For `paftools.js mapeval` to work, you need to encode the true read positions
|
||||
in read names in the right format. For [PBSIM][pbsim] and [mason2][mason2], we
|
||||
provide scripts to generate the right format. Simulated reads in this cookbook
|
||||
were created with the following command lines:
|
||||
```sh
|
||||
# in PBSIM source code directory:
|
||||
src/pbsim ../ecoli_ref.fa --depth 1 --sample-fastq sample/sample.fastq
|
||||
paftools.js pbsim2fq ../ecoli_ref.fa.fai sd_0001.maf > ../ecoli_pbsim.fa
|
||||
|
||||
# mason2 simulation
|
||||
mason_simulator --illumina-prob-mismatch-scale 2.5 -ir ecoli_ref.fa -n 10000 -o tmp-l.fq -or tmp-r.fq -oa tmp.sam
|
||||
paftools.js mason2fq tmp.sam | seqtk seq -1 > ecoli_mason_1.fq
|
||||
paftools.js mason2fq tmp.sam | seqtk seq -2 > ecoli_mason_2.fq
|
||||
```
|
||||
|
||||
|
||||
|
||||
## <a name="map-rna"></a>Mapping Long RNA-seq Reads
|
||||
|
||||
### <a name="map-ont-cdna-2d"></a>Mapping Nanopore 2D cDNA reads
|
||||
```sh
|
||||
minimap2 -ax splice SIRV_E2.fa SIRV_ont-cdna.fa > aln.sam
|
||||
```
|
||||
You can compare the alignment to the true annotations with:
|
||||
```sh
|
||||
paftools.js junceval SIRV_E2C.gtf aln.sam
|
||||
```
|
||||
It gives the percentage of introns found in the annotation. For SIRV data, it
|
||||
is possible to achieve higher junction accuracy with
|
||||
```sh
|
||||
minimap2 -ax splice --splice-flank=no SIRV_E2.fa SIRV_ont-cdna.fa | paftools.js junceval SIRV_E2C.gtf
|
||||
```
|
||||
This is because minimap2 models one additional evolutionarily conserved base
|
||||
around a canonical junction, but SIRV doesn't honor this signal. Option
|
||||
`--splice-flank=no` asks minimap2 no to model this additional base.
|
||||
|
||||
In the output a tag `ts:A:+` indicates that the read strand is the same as the
|
||||
transcript strand; `ts:A:-` indicates the read strand is opposite to the
|
||||
transcript strand. This tag is inferred from the GT-AG signal and is thus only
|
||||
available to spliced reads.
|
||||
|
||||
### <a name="map-direct-rna"></a>Mapping Nanopore direct-RNA reads
|
||||
```sh
|
||||
minimap2 -ax splice -k14 -uf SIRV_E2.fa SIRV_ont-drna.fa > aln.sam
|
||||
```
|
||||
Direct-RNA reads are noisier, so we use a shorter k-mer for improved
|
||||
sensitivity. Here, option `-uf` forces minimap2 to map reads to the forward
|
||||
transcript strand only because direct-RNA reads are stranded. Again, applying
|
||||
`--splice-flank=no` helps junction accuracy for SIRV data.
|
||||
|
||||
### <a name="map-iso-seq"></a>Mapping PacBio Iso-seq reads
|
||||
```sh
|
||||
minimap2 -ax splice -uf -C5 SIRV_E2.fa SIRV_iso-seq.fq > aln.sam
|
||||
```
|
||||
Option `-C5` reduces the penalty on non-canonical splicing sites. It helps
|
||||
to align such sites correctly for data with low error rate such as Iso-seq
|
||||
reads and traditional cDNAs. On this example, minimap2 makes one junction
|
||||
error. Applying `--splice-flank=no` fixes this alignment error.
|
||||
|
||||
Note that the command line above is optimized for the final Iso-seq reads.
|
||||
PacBio's Iso-seq pipeline produces intermediate sequences at varying quality.
|
||||
For example, some intermediate reads are not stranded. For these reads, option
|
||||
`-uf` will lead to more errors. Please revise the minimap2 command line
|
||||
accordingly.
|
||||
|
||||
|
||||
|
||||
## <a name="genome-aln"></a>Full-Genome Alignment
|
||||
|
||||
### <a name="asm-to-ref"></a>Intra-species assembly alignment
|
||||
```sh
|
||||
# option "--cs" is recommended as paftools.js may need it
|
||||
minimap2 -cx asm5 --cs ecoli_ref.fa ecoli_canu.fa > ecoli_canu.paf
|
||||
```
|
||||
Here `ecoli_canu.fa` is the Canu assembly of `ecoli_p6_25x_canu.fa`. This
|
||||
command line outputs alignments in the [PAF format][paf]. Use `-a` instead of
|
||||
`-c` to get output in the SAM format.
|
||||
|
||||
### <a name="x-species"></a>Cross-species full-genome alignment
|
||||
```sh
|
||||
minimap2 -cx asm20 --cs ecoli_ref.fa ecoli_O104:H4.fa > ecoli_O104:H4.paf
|
||||
sort -k6,6 -k8,8n ecoli_O104:H4.paf | paftools.js call -f ecoli_ref.fa -L10000 -l1000 - > out.vcf
|
||||
```
|
||||
Minimap2 has three presets for full-genome alignment: "asm5" for sequence
|
||||
divergence below 1%, "asm10" for divergence around a couple of percent and
|
||||
"asm20" for divergence not more than 10%. In theory, with the right setting,
|
||||
minimap2 should work for sequence pairs with sequence divergence up to ~15%,
|
||||
but this has not been carefully evaluated.
|
||||
|
||||
### <a name="view-aln"></a>Eyeballing alignment
|
||||
```sh
|
||||
# option "--cs" required; minimap2-r741 or higher required for the "asm20" preset
|
||||
minimap2 -cx asm20 --cs ecoli_ref.fa ecoli_O104:H4.fa | paftools.js view - | less -S
|
||||
```
|
||||
This prints the alignment in a BLAST-like format.
|
||||
|
||||
### <a name="asm-var"></a>Calling variants from assembly-to-reference alignment
|
||||
```sh
|
||||
# don't forget the "--cs" option; otherwise it doesn't work
|
||||
minimap2 -cx asm5 --cs ecoli_ref.fa ecoli_canu.fa \
|
||||
| sort -k6,6 -k8,8n \
|
||||
| paftools.js call -f ecoli_ref.fa - > out.vcf
|
||||
```
|
||||
Without option `-f`, `paftools.js call` outputs in a custom format. In this
|
||||
format, lines starting with `R` give the regions covered by one contig only.
|
||||
This information is not available in the VCF output.
|
||||
|
||||
### <a name="hom-map"></a>Constructing self-homology map
|
||||
```sh
|
||||
minimap2 -DP -k19 -w19 -m200 ecoli_ref.fa ecoli_ref.fa > out.paf
|
||||
```
|
||||
Option `-D` asks minimap2 to ignore anchors from perfect self match and `-P`
|
||||
outputs all chains. For large nomes, we don't recommend to perform base-level
|
||||
alignment (with `-c`, `-a` or `--cs`) when `-P` is applied. This is because
|
||||
base-alignment is slow and occasionally gives wrong alignments close to the
|
||||
diagonal of a dotter plot. For E. coli, though, base-alignment is still fast.
|
||||
|
||||
### <a name="liftover"></a>Lift over (for developers)
|
||||
```sh
|
||||
minimap2 -cx asm5 --cs ecoli_ref.fa ecoli_canu.fa > ecoli_canu.paf
|
||||
echo -e 'tig00000001\t200000\t300000' | paftools.js liftover ecoli_canu.paf -
|
||||
```
|
||||
This lifts over a region on query sequences to one or multiple regions on
|
||||
reference sequences. Note that this paftools.js command may not be efficient
|
||||
enough to lift millions of regions.
|
||||
|
||||
|
||||
|
||||
## <a name="read-overlap"></a>Read Overlap
|
||||
|
||||
### <a name="long-read-overlap"></a>Long read overlap
|
||||
```sh
|
||||
# For pacbio reads:
|
||||
minimap2 -x ava-pb ecoli_p6_25x_canu.fa ecoli_p6_25x_canu.fa > overlap.paf
|
||||
# For Nanopore reads (ava-ont also works with PacBio but not as good):
|
||||
minimap2 -x ava-ont -r 10000 ecoli_p6_25x_canu.fa ecoli_p6_25x_canu.fa > overlap.paf
|
||||
# If you have miniasm installed:
|
||||
miniasm -f ecoli_p6_25x_canu.fa overlap.paf > asm.gfa
|
||||
```
|
||||
Here we explicitly applied `-r 10000`. We are considering to set this as the
|
||||
default for the `ava-ont` mode as this seems to improve the contiguity for
|
||||
nanopore read assembly (Loman, personal communication).
|
||||
|
||||
*Minimap2 doesn't work well with short-read overlap.*
|
||||
|
||||
### <a name="ov-eval"></a>Evaluating overlap sensitivity (for developers)
|
||||
|
||||
```sh
|
||||
# read to reference mapping
|
||||
minimap2 -cx map-pb ecoli_ref.fa ecoli_p6_25x_canu.fa > to-ref.paf
|
||||
# evaluate overlap sensitivity
|
||||
sort -k6,6 -k8,8n to-ref.paf | paftools.js ov-eval - overlap.paf
|
||||
```
|
||||
You can see that for PacBio reads, minimap2 achieves higher overlap sensitivity
|
||||
with `-x ava-pb` (99% vs 93% with `-x ava-ont`).
|
||||
|
||||
|
||||
|
||||
[pbsim]: https://github.com/pfaucon/PBSIM-PacBio-Simulator
|
||||
[mason2]: https://github.com/seqan/seqan/tree/master/apps/mason2
|
||||
[paf]: https://github.com/lh3/miniasm/blob/master/PAF.md
|
||||
[v2.10]: https://github.com/lh3/minimap2/releases/tag/v2.10
|
||||
@@ -118,7 +118,7 @@ void mm_write_sam_hdr(const mm_idx_t *idx, const char *rg, const char *ver, int
|
||||
if (idx) {
|
||||
uint32_t i;
|
||||
for (i = 0; i < idx->n_seq; ++i)
|
||||
printf("@SQ\tSN:%s\tLN:%d\n", idx->seq[i].name, idx->seq[i].len);
|
||||
mm_sprintf_lite(&str, "@SQ\tSN:%s\tLN:%d\n", idx->seq[i].name, idx->seq[i].len);
|
||||
}
|
||||
if (rg) sam_write_rg_line(&str, rg);
|
||||
mm_sprintf_lite(&str, "@PG\tID:minimap2\tPN:minimap2");
|
||||
@@ -129,36 +129,18 @@ void mm_write_sam_hdr(const mm_idx_t *idx, const char *rg, const char *ver, int
|
||||
for (i = 1; i < argc; ++i)
|
||||
mm_sprintf_lite(&str, " %s", argv[i]);
|
||||
}
|
||||
mm_sprintf_lite(&str, "\n");
|
||||
fputs(str.s, stdout);
|
||||
mm_err_puts(str.s);
|
||||
free(str.s);
|
||||
}
|
||||
|
||||
static void write_cs(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int no_iden)
|
||||
static void write_cs_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq, const mm_reg1_t *r, char *tmp, int no_iden)
|
||||
{
|
||||
extern unsigned char seq_nt4_table[256];
|
||||
int i, q_off, t_off;
|
||||
uint8_t *qseq, *tseq;
|
||||
char *tmp;
|
||||
if (r->p == 0) return;
|
||||
mm_sprintf_lite(s, "\tcs:Z:");
|
||||
qseq = (uint8_t*)kmalloc(km, r->qe - r->qs);
|
||||
tseq = (uint8_t*)kmalloc(km, r->re - r->rs);
|
||||
tmp = (char*)kmalloc(km, r->re - r->rs > r->qe - r->qs? r->re - r->rs + 1 : r->qe - r->qs + 1);
|
||||
mm_idx_getseq(mi, r->rid, r->rs, r->re, tseq);
|
||||
if (!r->rev) {
|
||||
for (i = r->qs; i < r->qe; ++i)
|
||||
qseq[i - r->qs] = seq_nt4_table[(uint8_t)t->seq[i]];
|
||||
} else {
|
||||
for (i = r->qs; i < r->qe; ++i) {
|
||||
uint8_t c = seq_nt4_table[(uint8_t)t->seq[i]];
|
||||
qseq[r->qe - i - 1] = c >= 4? 4 : 3 - c;
|
||||
}
|
||||
}
|
||||
for (i = q_off = t_off = 0; i < r->p->n_cigar; ++i) {
|
||||
int j, op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
|
||||
assert(op >= 0 && op <= 3);
|
||||
if (op == 0) {
|
||||
if (op == 0) { // match
|
||||
int l_tmp = 0;
|
||||
for (j = 0; j < len; ++j) {
|
||||
if (qseq[q_off + j] != tseq[t_off + j]) {
|
||||
@@ -179,17 +161,17 @@ static void write_cs(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_
|
||||
} else mm_sprintf_lite(s, ":%d", l_tmp);
|
||||
}
|
||||
q_off += len, t_off += len;
|
||||
} else if (op == 1) {
|
||||
} else if (op == 1) { // insertion to ref
|
||||
for (j = 0, tmp[len] = 0; j < len; ++j)
|
||||
tmp[j] = "acgtn"[qseq[q_off + j]];
|
||||
mm_sprintf_lite(s, "+%s", tmp);
|
||||
q_off += len;
|
||||
} else if (op == 2) {
|
||||
} else if (op == 2) { // deletion from ref
|
||||
for (j = 0, tmp[len] = 0; j < len; ++j)
|
||||
tmp[j] = "acgtn"[tseq[t_off + j]];
|
||||
mm_sprintf_lite(s, "-%s", tmp);
|
||||
t_off += len;
|
||||
} else {
|
||||
} else { // intron
|
||||
assert(len >= 2);
|
||||
mm_sprintf_lite(s, "~%c%c%d%c%c", "acgtn"[tseq[t_off]], "acgtn"[tseq[t_off+1]],
|
||||
len, "acgtn"[tseq[t_off+len-2]], "acgtn"[tseq[t_off+len-1]]);
|
||||
@@ -197,6 +179,59 @@ static void write_cs(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_
|
||||
}
|
||||
}
|
||||
assert(t_off == r->re - r->rs && q_off == r->qe - r->qs);
|
||||
}
|
||||
|
||||
static void write_MD_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq, const mm_reg1_t *r, char *tmp)
|
||||
{
|
||||
int i, q_off, t_off, l_MD = 0;
|
||||
mm_sprintf_lite(s, "\tMD:Z:");
|
||||
for (i = q_off = t_off = 0; i < r->p->n_cigar; ++i) {
|
||||
int j, op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
|
||||
assert(op >= 0 && op <= 2); // introns (aka reference skips) are not supported
|
||||
if (op == 0) { // match
|
||||
for (j = 0; j < len; ++j) {
|
||||
if (qseq[q_off + j] != tseq[t_off + j]) {
|
||||
mm_sprintf_lite(s, "%d%c", l_MD, "ACGTN"[tseq[t_off + j]]);
|
||||
l_MD = 0;
|
||||
} else ++l_MD;
|
||||
}
|
||||
q_off += len, t_off += len;
|
||||
} else if (op == 1) { // insertion to ref
|
||||
q_off += len;
|
||||
} else if (op == 2) { // deletion from ref
|
||||
for (j = 0, tmp[len] = 0; j < len; ++j)
|
||||
tmp[j] = "ACGTN"[tseq[t_off + j]];
|
||||
mm_sprintf_lite(s, "%d^%s", l_MD, tmp);
|
||||
l_MD = 0;
|
||||
t_off += len;
|
||||
}
|
||||
}
|
||||
if (l_MD > 0) mm_sprintf_lite(s, "%d", l_MD);
|
||||
assert(t_off == r->re - r->rs && q_off == r->qe - r->qs);
|
||||
}
|
||||
|
||||
static void write_cs_or_MD(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int no_iden, int is_MD)
|
||||
{
|
||||
extern unsigned char seq_nt4_table[256];
|
||||
int i;
|
||||
uint8_t *qseq, *tseq;
|
||||
char *tmp;
|
||||
if (r->p == 0) return;
|
||||
qseq = (uint8_t*)kmalloc(km, r->qe - r->qs);
|
||||
tseq = (uint8_t*)kmalloc(km, r->re - r->rs);
|
||||
tmp = (char*)kmalloc(km, r->re - r->rs > r->qe - r->qs? r->re - r->rs + 1 : r->qe - r->qs + 1);
|
||||
mm_idx_getseq(mi, r->rid, r->rs, r->re, tseq);
|
||||
if (!r->rev) {
|
||||
for (i = r->qs; i < r->qe; ++i)
|
||||
qseq[i - r->qs] = seq_nt4_table[(uint8_t)t->seq[i]];
|
||||
} else {
|
||||
for (i = r->qs; i < r->qe; ++i) {
|
||||
uint8_t c = seq_nt4_table[(uint8_t)t->seq[i]];
|
||||
qseq[r->qe - i - 1] = c >= 4? 4 : 3 - c;
|
||||
}
|
||||
}
|
||||
if (is_MD) write_MD_core(s, tseq, qseq, r, tmp);
|
||||
else write_cs_core(s, tseq, qseq, r, tmp, no_iden);
|
||||
kfree(km, qseq); kfree(km, tseq); kfree(km, tmp);
|
||||
}
|
||||
|
||||
@@ -237,8 +272,10 @@ void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const m
|
||||
for (k = 0; k < r->p->n_cigar; ++k)
|
||||
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDN"[r->p->cigar[k]&0xf]);
|
||||
}
|
||||
if (r->p && (opt_flag & MM_F_OUT_CS))
|
||||
write_cs(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG));
|
||||
if (r->p && (opt_flag & (MM_F_OUT_CS|MM_F_OUT_MD)))
|
||||
write_cs_or_MD(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG), opt_flag&MM_F_OUT_MD);
|
||||
if ((opt_flag & MM_F_COPY_COMMENT) && t->comment)
|
||||
mm_sprintf_lite(s, "\t%s", t->comment);
|
||||
}
|
||||
|
||||
static void sam_write_sq(kstring_t *s, char *seq, int l, int rev, int comp)
|
||||
@@ -434,12 +471,15 @@ void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
|
||||
}
|
||||
}
|
||||
}
|
||||
if (r->p && (opt_flag & MM_F_OUT_CS))
|
||||
write_cs(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG));
|
||||
if (r->p && (opt_flag & (MM_F_OUT_CS|MM_F_OUT_MD)))
|
||||
write_cs_or_MD(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG), opt_flag&MM_F_OUT_MD);
|
||||
if (cigar_in_tag)
|
||||
write_sam_cigar(s, flag, 1, t->l_seq, r, opt_flag);
|
||||
}
|
||||
|
||||
if ((opt_flag & MM_F_COPY_COMMENT) && t->comment)
|
||||
mm_sprintf_lite(s, "\t%s", t->comment);
|
||||
|
||||
s->s[s->l] = 0; // we always have room for an extra byte (see str_enlarge)
|
||||
}
|
||||
|
||||
|
||||
@@ -4,9 +4,13 @@
|
||||
#include "bseq.h"
|
||||
#include "minimap.h"
|
||||
#include "mmpriv.h"
|
||||
#ifdef HAVE_GETOPT
|
||||
#include <getopt.h>
|
||||
#else
|
||||
#include "getopt.h"
|
||||
#endif
|
||||
|
||||
#define MM_VERSION "2.9-r720"
|
||||
#define MM_VERSION "2.10-r761"
|
||||
|
||||
#ifdef __linux__
|
||||
#include <sys/resource.h>
|
||||
@@ -51,6 +55,8 @@ static struct option long_options[] = {
|
||||
{ "all-chain", no_argument, 0, 'P' },
|
||||
{ "dual", required_argument, 0, 0 }, // 26
|
||||
{ "max-clip-ratio", required_argument, 0, 0 }, // 27
|
||||
{ "min-occ-floor", required_argument, 0, 0 }, // 28
|
||||
{ "MD", no_argument, 0, 0 }, // 29
|
||||
{ "help", no_argument, 0, 'h' },
|
||||
{ "max-intron-len", required_argument, 0, 'G' },
|
||||
{ "version", no_argument, 0, 'V' },
|
||||
@@ -88,7 +94,7 @@ static inline void yes_or_no(mm_mapopt_t *opt, int flag, int long_idx, const cha
|
||||
|
||||
int main(int argc, char *argv[])
|
||||
{
|
||||
const char *opt_str = "2aSDw:k:K:t:r:f:Vv:g:G:I:d:XT:s:x:Hcp:M:n:z:A:B:O:E:m:N:Qu:R:hF:LC:";
|
||||
const char *opt_str = "2aSDw:k:K:t:r:f:Vv:g:G:I:d:XT:s:x:Hcp:M:n:z:A:B:O:E:m:N:Qu:R:hF:LC:y";
|
||||
mm_mapopt_t opt;
|
||||
mm_idxopt_t ipt;
|
||||
int i, c, n_threads = 3, long_idx;
|
||||
@@ -110,7 +116,7 @@ int main(int argc, char *argv[])
|
||||
}
|
||||
break;
|
||||
}
|
||||
optreset = 1;
|
||||
optind = 0; // for musl getopt, optind=0 has the same effect as optreset=1; older libc doesn't have optreset
|
||||
|
||||
while ((c = getopt_long(argc, argv, opt_str, long_options, &long_idx)) >= 0) {
|
||||
if (c == 'w') ipt.w = atoi(optarg);
|
||||
@@ -134,6 +140,7 @@ int main(int argc, char *argv[])
|
||||
else if (c == 'Q') opt.flag |= MM_F_NO_QUAL;
|
||||
else if (c == 'Y') opt.flag |= MM_F_SOFTCLIP;
|
||||
else if (c == 'L') opt.flag |= MM_F_LONG_CIGAR;
|
||||
else if (c == 'y') opt.flag |= MM_F_COPY_COMMENT;
|
||||
else if (c == 'T') opt.sdust_thres = atoi(optarg);
|
||||
else if (c == 'n') opt.min_cnt = atoi(optarg);
|
||||
else if (c == 'm') opt.min_chain_score = atoi(optarg);
|
||||
@@ -164,6 +171,8 @@ int main(int argc, char *argv[])
|
||||
else if (c == 0 && long_idx ==22) opt.flag |= MM_F_FOR_ONLY; // --for-only
|
||||
else if (c == 0 && long_idx ==23) opt.flag |= MM_F_REV_ONLY; // --rev-only
|
||||
else if (c == 0 && long_idx ==27) opt.max_clip_ratio = atof(optarg); // --max-clip-ratio
|
||||
else if (c == 0 && long_idx ==28) opt.min_mid_occ = atoi(optarg); // --min-occ-floor
|
||||
else if (c == 0 && long_idx ==29) opt.flag |= MM_F_OUT_MD; // --MD
|
||||
else if (c == 0 && long_idx == 14) { // --frag
|
||||
yes_or_no(&opt, MM_F_FRAG_MODE, long_idx, optarg, 1);
|
||||
} else if (c == 0 && long_idx == 15) { // --secondary
|
||||
@@ -264,6 +273,7 @@ int main(int argc, char *argv[])
|
||||
fprintf(fp_help, " -R STR SAM read group line in a format like '@RG\\tID:foo\\tSM:bar' []\n");
|
||||
fprintf(fp_help, " -c output CIGAR in PAF\n");
|
||||
fprintf(fp_help, " --cs[=STR] output the cs tag; STR is 'short' (if absent) or 'long' [none]\n");
|
||||
fprintf(fp_help, " --MD output the MD tag\n");
|
||||
fprintf(fp_help, " -Y use soft clipping for supplementary alignments\n");
|
||||
fprintf(fp_help, " -t INT number of threads [%d]\n", n_threads);
|
||||
fprintf(fp_help, " -K NUM minibatch size for mapping [500M]\n");
|
||||
@@ -276,7 +286,7 @@ int main(int argc, char *argv[])
|
||||
fprintf(fp_help, " asm5: -k19 -w19 -A1 -B19 -O39,81 -E3,1 -s200 -z200 (asm to ref mapping; break at 5%% div.)\n");
|
||||
fprintf(fp_help, " asm10: -k19 -w19 -A1 -B9 -O16,41 -E2,1 -s200 -z200 (asm to ref mapping; break at 10%% div.)\n");
|
||||
fprintf(fp_help, " ava-pb: -Hk19 -Xw5 -m100 -g10000 --max-chain-skip 25 (PacBio read overlap)\n");
|
||||
fprintf(fp_help, " ava-ont: -k15 -Xw5 -m100 -g10000 --max-chain-skip 25 (ONT read overlap)\n");
|
||||
fprintf(fp_help, " ava-ont: -k15 -Xw5 -m100 -g10000 -r2000 --max-chain-skip 25 (ONT read overlap)\n");
|
||||
fprintf(fp_help, " splice: long-read spliced alignment (see minimap2.1 for details)\n");
|
||||
fprintf(fp_help, " sr: short single-end reads without splicing (see minimap2.1 for details)\n");
|
||||
fprintf(fp_help, "\nSee `man ./minimap2.1' for detailed description of command-line options.\n");
|
||||
@@ -330,10 +340,17 @@ int main(int argc, char *argv[])
|
||||
}
|
||||
mm_idx_reader_close(idx_rdr);
|
||||
|
||||
if (fflush(stdout) == EOF) {
|
||||
fprintf(stderr, "[ERROR] failed to write the results\n");
|
||||
exit(EXIT_FAILURE);
|
||||
}
|
||||
|
||||
if (mm_verbose >= 3) {
|
||||
fprintf(stderr, "[M::%s] Version: %s\n", __func__, MM_VERSION);
|
||||
fprintf(stderr, "[M::%s] CMD:", __func__);
|
||||
for (i = 0; i < argc; ++i)
|
||||
fprintf(stderr, " %s", argv[i]);
|
||||
fprintf(stderr, "\n[M::%s] Real time: %.3f sec; CPU: %.3f sec\n", __func__, realtime() - mm_realtime0, cputime());
|
||||
}
|
||||
return 0;
|
||||
}
|
||||
|
||||
@@ -442,11 +442,12 @@ static void *worker_pipeline(void *shared, int step, void *in)
|
||||
pipeline_t *p = (pipeline_t*)shared;
|
||||
if (step == 0) { // step 0: read sequences
|
||||
int with_qual = (!!(p->opt->flag & MM_F_OUT_SAM) && !(p->opt->flag & MM_F_NO_QUAL));
|
||||
int with_comment = !!(p->opt->flag & MM_F_COPY_COMMENT);
|
||||
int frag_mode = (p->n_fp > 1 || !!(p->opt->flag & MM_F_FRAG_MODE));
|
||||
step_t *s;
|
||||
s = (step_t*)calloc(1, sizeof(step_t));
|
||||
if (p->n_fp > 1) s->seq = mm_bseq_read_frag(p->n_fp, p->fp, p->mini_batch_size, with_qual, &s->n_seq);
|
||||
else s->seq = mm_bseq_read2(p->fp[0], p->mini_batch_size, with_qual, frag_mode, &s->n_seq);
|
||||
if (p->n_fp > 1) s->seq = mm_bseq_read_frag2(p->n_fp, p->fp, p->mini_batch_size, with_qual, with_comment, &s->n_seq);
|
||||
else s->seq = mm_bseq_read3(p->fp[0], p->mini_batch_size, with_qual, with_comment, frag_mode, &s->n_seq);
|
||||
if (s->seq) {
|
||||
s->p = p;
|
||||
for (i = 0; i < s->n_seq; ++i)
|
||||
@@ -489,11 +490,11 @@ static void *worker_pipeline(void *shared, int step, void *in)
|
||||
mm_write_sam2(&p->str, mi, t, i - seg_st, j, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag);
|
||||
else
|
||||
mm_write_paf(&p->str, mi, t, r, km, p->opt->flag);
|
||||
puts(p->str.s);
|
||||
mm_err_puts(p->str.s);
|
||||
}
|
||||
if (s->n_reg[i] == 0 && (p->opt->flag & MM_F_OUT_SAM)) {
|
||||
if (s->n_reg[i] == 0 && (p->opt->flag & MM_F_OUT_SAM)) { // write an unmapped record
|
||||
mm_write_sam2(&p->str, mi, t, i - seg_st, -1, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag);
|
||||
puts(p->str.s);
|
||||
mm_err_puts(p->str.s);
|
||||
}
|
||||
}
|
||||
for (i = seg_st; i < seg_en; ++i) {
|
||||
|
||||
@@ -29,6 +29,8 @@
|
||||
#define MM_F_REV_ONLY 0x200000
|
||||
#define MM_F_HEAP_SORT 0x400000
|
||||
#define MM_F_ALL_CHAINS 0x800000
|
||||
#define MM_F_OUT_MD 0x1000000
|
||||
#define MM_F_COPY_COMMENT 0x2000000
|
||||
|
||||
#define MM_I_HPC 0x1
|
||||
#define MM_I_NO_SEQ 0x2
|
||||
@@ -126,6 +128,7 @@ typedef struct {
|
||||
int pe_ori, pe_bonus;
|
||||
|
||||
float mid_occ_frac; // only used by mm_mapopt_update(); see below
|
||||
int32_t min_mid_occ;
|
||||
int32_t mid_occ; // ignore seeds with occurrences above this threshold
|
||||
int32_t max_occ;
|
||||
int mini_batch_size; // size of a batch of query bases to process in parallel
|
||||
|
||||
+40
-9
@@ -1,4 +1,4 @@
|
||||
.TH minimap2 1 "24 February 2018" "minimap2-2.9 (r720)" "Bioinformatics tools"
|
||||
.TH minimap2 1 "27 March 2018" "minimap2-2.10 (r761)" "Bioinformatics tools"
|
||||
.SH NAME
|
||||
.PP
|
||||
minimap2 - mapping and alignment between collections of DNA sequences
|
||||
@@ -123,10 +123,27 @@ provided as the target sequences, options
|
||||
will be effectively overridden by the options stored in the index file.
|
||||
.SS Mapping options
|
||||
.TP 10
|
||||
.BI -f \ FLOAT
|
||||
Ignore top
|
||||
.BI -f \ FLOAT | INT1 [, INT2 ]
|
||||
If fraction, ignore top
|
||||
.I FLOAT
|
||||
fraction of most frequent minimizers [0.0002]
|
||||
fraction of most frequent minimizers [0.0002]. If integer,
|
||||
ignore minimizers occuring more than
|
||||
.I INT1
|
||||
times.
|
||||
.I INT2
|
||||
is only effective in the
|
||||
.B --sr
|
||||
or
|
||||
.B -xsr
|
||||
mode, which sets the threshold for a second round of seeding.
|
||||
.TP
|
||||
.BI --min-occ-floor \ INT
|
||||
Force minimap2 to always use k-mers occurring
|
||||
.I INT
|
||||
times or less [0]. In effect, the max occurrence threshold is set to
|
||||
the
|
||||
.RI max{ INT ,
|
||||
.BR -f }.
|
||||
.TP
|
||||
.BI -g \ INT
|
||||
Stop chain enlongation if there are no minimizers within
|
||||
@@ -353,6 +370,9 @@ SAM read group line in a format like
|
||||
.B @RG\\\\tID:foo\\\\tSM:bar
|
||||
[].
|
||||
.TP
|
||||
.B -y
|
||||
Copy input FASTA/Q comments to output.
|
||||
.TP
|
||||
.B -c
|
||||
Generate CIGAR. In PAF, the CIGAR is written to the `cg' custom tag.
|
||||
.TP
|
||||
@@ -371,6 +391,9 @@ is given,
|
||||
.I short
|
||||
is assumed. [none]
|
||||
.TP
|
||||
.B --MD
|
||||
Output the MD tag (see the SAM spec).
|
||||
.TP
|
||||
.B -Y
|
||||
In SAM output, use soft clipping for supplementary alignments.
|
||||
.TP
|
||||
@@ -433,18 +456,25 @@ is determined by the sequencing error mode.
|
||||
.B asm5
|
||||
Long assembly to reference mapping
|
||||
.RB ( -k19
|
||||
.B -w19 -A1 -B19 -O39,81 -E3,1 -s200
|
||||
.BR -z200 ).
|
||||
.B -w19 -A1 -B19 -O39,81 -E3,1 -s200 -z200
|
||||
.BR --min-occ-floor=100 ).
|
||||
Typically, the alignment will not extend to regions with 5% or higher sequence
|
||||
divergence. Only use this preset if the average divergence is far below 5%.
|
||||
.TP
|
||||
.B asm10
|
||||
Long assembly to reference mapping
|
||||
.RB ( -k19
|
||||
.B -w19 -A1 -B9 -O16,41 -E2,1 -s200
|
||||
.BR -z200 ).
|
||||
.B -w19 -A1 -B9 -O16,41 -E2,1 -s200 -z200
|
||||
.BR --min-occ-floor=100 ).
|
||||
Up to 10% sequence divergence.
|
||||
.TP
|
||||
.B asm20
|
||||
Long assembly to reference mapping
|
||||
.RB ( -k19
|
||||
.B -w10 -A1 -B6 -O6,26 -E2,1 -s200 -z200
|
||||
.BR --min-occ-floor=100 ).
|
||||
Up to 20% sequence divergence.
|
||||
.TP
|
||||
.B ava-pb
|
||||
PacBio all-vs-all overlap mapping
|
||||
.RB ( -Hk19
|
||||
@@ -454,7 +484,7 @@ PacBio all-vs-all overlap mapping
|
||||
.B ava-ont
|
||||
Oxford Nanopore all-vs-all overlap mapping
|
||||
.RB ( -k15
|
||||
.B -Xw5 -m100 -g10000 --max-chain-skip
|
||||
.B -Xw5 -m100 -g10000 -r2000 --max-chain-skip
|
||||
.BR 25 ).
|
||||
Similarly, the major difference from
|
||||
.B ava-pb
|
||||
@@ -535,6 +565,7 @@ cm i Number of minimizers on the chain
|
||||
s1 i Chaining score
|
||||
s2 i Chaining score of the best secondary chain
|
||||
NM i Total number of mismatches and gaps in the alignment
|
||||
MD Z To generate the ref sequence in the alignment
|
||||
AS i DP alignment score
|
||||
ms i DP score of the max scoring segment in the alignment
|
||||
nn i Number of ambiguous bases in the alignment
|
||||
|
||||
@@ -1,3 +1,4 @@
|
||||
#include <stdlib.h>
|
||||
#include "mmpriv.h"
|
||||
|
||||
int mm_verbose = 1;
|
||||
@@ -120,6 +121,16 @@ double realtime(void)
|
||||
return tp.tv_sec + tp.tv_usec * 1e-6;
|
||||
}
|
||||
|
||||
void mm_err_puts(const char *str)
|
||||
{
|
||||
int ret;
|
||||
ret = puts(str);
|
||||
if (ret == EOF) {
|
||||
fprintf(stderr, "[ERROR] failed to write the results\n");
|
||||
exit(EXIT_FAILURE);
|
||||
}
|
||||
}
|
||||
|
||||
#include "ksort.h"
|
||||
|
||||
#define sort_key_128x(a) ((a).x)
|
||||
|
||||
+226
-62
@@ -1,6 +1,6 @@
|
||||
#!/usr/bin/env k8
|
||||
|
||||
var paftools_version = 'r713';
|
||||
var paftools_version = 'r755';
|
||||
|
||||
/*****************************
|
||||
***** Library functions *****
|
||||
@@ -131,6 +131,40 @@ Interval.find_ovlp = function(a, st, en)
|
||||
* Reverse and reverse complement *
|
||||
**********************************/
|
||||
|
||||
function fasta_read(fn)
|
||||
{
|
||||
var h = {}, gt = '>'.charCodeAt(0);
|
||||
var file = fn == '-'? new File() : new File(fn);
|
||||
var buf = new Bytes(), seq = null, name = null, seqlen = [];
|
||||
while (file.readline(buf) >= 0) {
|
||||
if (buf[0] == gt) {
|
||||
if (seq != null && name != null) {
|
||||
seqlen.push([name, seq.length]);
|
||||
h[name] = seq;
|
||||
name = seq = null;
|
||||
}
|
||||
var m, line = buf.toString();
|
||||
if ((m = /^>(\S+)/.exec(line)) != null) {
|
||||
name = m[1];
|
||||
seq = new Bytes();
|
||||
}
|
||||
} else seq.set(buf);
|
||||
}
|
||||
if (seq != null && name != null) {
|
||||
seqlen.push([name, seq.length]);
|
||||
h[name] = seq;
|
||||
}
|
||||
buf.destroy();
|
||||
file.close();
|
||||
return [h, seqlen];
|
||||
}
|
||||
|
||||
function fasta_free(fa)
|
||||
{
|
||||
for (var name in fa)
|
||||
fa[name].destroy();
|
||||
}
|
||||
|
||||
Bytes.prototype.reverse = function()
|
||||
{
|
||||
for (var i = 0; i < this.length>>1; ++i) {
|
||||
@@ -305,14 +339,17 @@ function paf_liftover(args)
|
||||
// variant calling
|
||||
function paf_call(args)
|
||||
{
|
||||
var re_cs = /([:=*+-])(\d+|[A-Za-z]+)/g;
|
||||
var re_cs = /([:=*+-])(\d+|[A-Za-z]+)/g, re_tag = /\t(\S\S:[AZif]):(\S+)/g;
|
||||
var c, min_cov_len = 10000, min_var_len = 50000, gap_thres = 50, min_mapq = 5;
|
||||
while ((c = getopt(args, "l:L:g:q:B:")) != null) {
|
||||
var fa_tmp = null, fa, fa_lens, is_vcf = false;
|
||||
while ((c = getopt(args, "l:L:g:q:B:f:")) != null) {
|
||||
if (c == 'l') min_cov_len = parseInt(getopt.arg);
|
||||
else if (c == 'L') min_var_len = parseInt(getopt.arg);
|
||||
else if (c == 'g') gap_thres = parseInt(getopt.arg);
|
||||
else if (c == 'q') min_mapq = parseInt(getopt.arg);
|
||||
else if (c == 'f') fa_tmp = fasta_read(getopt.arg, fa_lens);
|
||||
}
|
||||
if (fa_tmp != null) fa = fa_tmp[0], fa_lens = fa_tmp[1], is_vcf = true;
|
||||
|
||||
if (args.length == getopt.ind) {
|
||||
print("Usage: sort -k6,6 -k8,8n <with-cs.paf> | paftools.js call [options] -");
|
||||
@@ -321,6 +358,7 @@ function paf_call(args)
|
||||
print(" -L INT min alignment length to call variants ["+min_var_len+"]");
|
||||
print(" -q INT min mapping quality ["+min_mapq+"]");
|
||||
print(" -g INT short/long gap threshold (for statistics only) ["+gap_thres+"]");
|
||||
print(" -f FILE reference sequences (enabling VCF output) [null]");
|
||||
exit(1);
|
||||
}
|
||||
|
||||
@@ -328,6 +366,27 @@ function paf_call(args)
|
||||
var buf = new Bytes();
|
||||
var tot_len = 0, n_sub = [0, 0, 0], n_ins = [0, 0, 0, 0], n_del = [0, 0, 0, 0];
|
||||
|
||||
function print_vcf(o, fa)
|
||||
{
|
||||
var v = null;
|
||||
if (o[3] != 1) return; // coverage is one; skip
|
||||
if (o[5] == '-' && o[6] == '-') return;
|
||||
if (o[5] != '-' && o[6] != '-') { // snp
|
||||
v = [o[0], o[1] + 1, '.', o[5].toUpperCase(), o[6].toUpperCase()];
|
||||
} else if (o[1] > 0) { // shouldn't happen in theory
|
||||
if (fa[o[0]] == null) throw Error('sequence "' + o[0] + '" is absent from the reference FASTA');
|
||||
if (o[1] >= fa[o[0]].length) throw Error('position ' + o[1] + ' exceeds the length of sequence "' + o[0] + '"');
|
||||
var ref = String.fromCharCode(fa[o[0]][o[1]-1]).toUpperCase();
|
||||
if (o[5] == '-') // insertion
|
||||
v = [o[0], o[1], '.', ref, ref + o[6].toUpperCase()];
|
||||
else // deletion
|
||||
v = [o[0], o[1], '.', ref + o[5].toUpperCase(), ref];
|
||||
}
|
||||
v.push(o[4], '.', 'QNAME=' + o[7] + ';QSTART=' + (o[8]+1) + ';QSTRAND=' + (rev? '-' : '+'), 'GT', '1/1');
|
||||
if (v == null) throw Error("unexpected variant: [" + o.join(",") + "]");
|
||||
print(v.join("\t"));
|
||||
}
|
||||
|
||||
function count_var(o)
|
||||
{
|
||||
if (o[3] > 1) return;
|
||||
@@ -346,46 +405,66 @@ function paf_call(args)
|
||||
else ++n_del[3];
|
||||
} else {
|
||||
++n_sub[0];
|
||||
var s = o[5] + o[6];
|
||||
var s = (o[5] + o[6]).toLowerCase();
|
||||
if (s == 'ag' || s == 'ga' || s == 'ct' || s == 'tc')
|
||||
++n_sub[1];
|
||||
else ++n_sub[2];
|
||||
}
|
||||
}
|
||||
|
||||
if (is_vcf) {
|
||||
print('##fileformat=VCFv4.1');
|
||||
for (var i = 0; i < fa_lens.length; ++i)
|
||||
print('##contig=<ID=' + fa_lens[i][0] + ',length=' + fa_lens[i][1] + '>');
|
||||
print('##INFO=<ID=QNAME,Number=1,Type=String,Description="Query name">');
|
||||
print('##INFO=<ID=QSTART,Number=1,Type=Integer,Description="Query start">');
|
||||
print('##INFO=<ID=QSTRAND,Number=1,Type=String,Description="Query strand">');
|
||||
print('##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">');
|
||||
print('#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT sample');
|
||||
}
|
||||
|
||||
var a = [], out = [];
|
||||
var c1_ctg = null, c1_start = 0, c1_end = 0, c1_counted = false, c1_len = 0;
|
||||
while (file.readline(buf) >= 0) {
|
||||
var line = buf.toString();
|
||||
if (!/\ts2:i:/.test(line)) continue; // skip secondary alignments
|
||||
var m, t = line.split("\t", 12);
|
||||
for (var i = 6; i <= 11; ++i)
|
||||
t[i] = parseInt(t[i]);
|
||||
if (t[10] < min_cov_len || t[11] < min_mapq) continue;
|
||||
print(t[0], t[7], t[8], c1_start, c1_end);
|
||||
//print(t[0], t[7], t[8], c1_start, c1_end);
|
||||
for (var i = 1; i <= 3; ++i)
|
||||
t[i] = parseInt(t[i]);
|
||||
var ctg = t[5], x = t[7], end = t[8];
|
||||
var query = t[0], rev = (t[4] == '-'), y = rev? t[3] : t[2];
|
||||
// collect tags
|
||||
var cs = null, tp = null, have_s1 = false, have_s2 = false;
|
||||
while ((m = re_tag.exec(line)) != null) {
|
||||
if (m[1] == 'cs:Z') cs = m[2];
|
||||
else if (m[1] == 'tp:A') tp = m[2];
|
||||
else if (m[1] == 's1:i') have_s1 = true;
|
||||
else if (m[1] == 's2:i') have_s2 = true;
|
||||
}
|
||||
if (have_s1 && !have_s2) continue;
|
||||
if (tp != null && (tp == 'S' || tp == 'i')) continue;
|
||||
// compute regions covered by 1 contig
|
||||
if (ctg != c1_ctg || x >= c1_end) {
|
||||
if (c1_counted && c1_end > c1_start) {
|
||||
c1_len += c1_end - c1_start;
|
||||
print('R', c1_ctg, c1_start, c1_end);
|
||||
if (!is_vcf) print('R', c1_ctg, c1_start, c1_end);
|
||||
}
|
||||
c1_ctg = ctg, c1_start = x, c1_end = end;
|
||||
c1_counted = (t[10] >= min_var_len);
|
||||
} else if (end > c1_end) { // overlap
|
||||
if (c1_counted && x > c1_start) {
|
||||
c1_len += x - c1_start;
|
||||
print('R', c1_ctg, c1_start, x);
|
||||
if (!is_vcf) print('R', c1_ctg, c1_start, x);
|
||||
}
|
||||
c1_start = c1_end, c1_end = end;
|
||||
c1_counted = (t[10] >= min_var_len);
|
||||
} else if (end > c1_start) { // contained
|
||||
if (c1_counted && x > c1_start) {
|
||||
c1_len += x - c1_start;
|
||||
print('R', c1_ctg, c1_start, x);
|
||||
if (!is_vcf) print('R', c1_ctg, c1_start, x);
|
||||
}
|
||||
c1_start = end;
|
||||
} // else, the alignment precedes the cov1 region; do nothing
|
||||
@@ -393,7 +472,8 @@ function paf_call(args)
|
||||
while (out.length) {
|
||||
if (out[0][0] != ctg || out[0][2] <= x) {
|
||||
count_var(out[0]);
|
||||
print('V', out[0].join("\t"));
|
||||
if (is_vcf) print_vcf(out[0], fa);
|
||||
else print('V', out[0].join("\t"));
|
||||
out.shift();
|
||||
} else break;
|
||||
}
|
||||
@@ -409,8 +489,7 @@ function paf_call(args)
|
||||
a.length = k;
|
||||
// core loop
|
||||
if (t[10] >= min_var_len) {
|
||||
if ((m = /\tcs:Z:(\S+)/.exec(line)) == null) continue; // no cs tag
|
||||
var cs = m[1];
|
||||
if (cs == null) continue; // no cs tag
|
||||
var blen = 0, n_diff = 0;
|
||||
tot_len += t[10];
|
||||
while ((m = re_cs.exec(cs)) != null) {
|
||||
@@ -450,11 +529,12 @@ function paf_call(args)
|
||||
}
|
||||
if (c1_counted && c1_end > c1_start) {
|
||||
c1_len += c1_end - c1_start;
|
||||
print('R', c1_ctg, c1_start, c1_end);
|
||||
if (!is_vcf) print('R', c1_ctg, c1_start, c1_end);
|
||||
}
|
||||
while (out.length) {
|
||||
count_var(out[0]);
|
||||
print('V', out[0].join("\t"));
|
||||
if (is_vcf) print_vcf(out[0], fa);
|
||||
else print('V', out[0].join("\t"));
|
||||
out.shift();
|
||||
}
|
||||
|
||||
@@ -472,6 +552,7 @@ function paf_call(args)
|
||||
|
||||
buf.destroy();
|
||||
file.close();
|
||||
if (fa != null) fasta_free(fa);
|
||||
}
|
||||
|
||||
function paf_stat(args)
|
||||
@@ -912,14 +993,15 @@ function paf_view(args)
|
||||
|
||||
function paf_gff2bed(args)
|
||||
{
|
||||
var c, fn_ucsc_fai = null, is_short = false;
|
||||
while ((c = getopt(args, "u:s")) != null) {
|
||||
var c, fn_ucsc_fai = null, is_short = false, keep_gff = false;
|
||||
while ((c = getopt(args, "u:sg")) != null) {
|
||||
if (c == 'u') fn_ucsc_fai = getopt.arg;
|
||||
else if (c == 's') is_short = true;
|
||||
else if (c == 'g') keep_gff = true;
|
||||
}
|
||||
|
||||
if (getopt.ind == args.length) {
|
||||
print("Usage: paftools.js gff2bed [-u ucsc-genome.fa.fai] <in.gff>");
|
||||
print("Usage: paftools.js gff2bed [-g] [-u ucsc-genome.fa.fai] <in.gff>");
|
||||
exit(1);
|
||||
}
|
||||
|
||||
@@ -980,6 +1062,12 @@ function paf_gff2bed(args)
|
||||
var exons = [], cds_st = 1<<30, cds_en = 0, last_id = null;
|
||||
while (file.readline(buf) >= 0) {
|
||||
var t = buf.toString().split("\t");
|
||||
if (keep_gff) {
|
||||
if (t[0].charAt(0) != '#' && ens2ucsc[t[0]] != null)
|
||||
t[0] = ens2ucsc[t[0]];
|
||||
print(t.join("\t"));
|
||||
continue;
|
||||
}
|
||||
if (t[0].charAt(0) == '#') continue;
|
||||
if (t[2] != "CDS" && t[2] != "exon") continue;
|
||||
t[3] = parseInt(t[3]) - 1;
|
||||
@@ -1028,15 +1116,19 @@ function paf_gff2bed(args)
|
||||
|
||||
function paf_sam2paf(args)
|
||||
{
|
||||
var c, pri_only = false;
|
||||
var c, pri_only = false, use_eq = false;
|
||||
while ((c = getopt(args, "p")) != null)
|
||||
if (c == 'p') pri_only = true;
|
||||
if (args.length == getopt.ind) {
|
||||
print("Usage: paftools.js sam2paf [-p] <in.sam>");
|
||||
exit(1);
|
||||
}
|
||||
|
||||
var file = args.length == getopt.ind || args[getopt.ind] == "-"? new File() : new File(args[getopt.ind]);
|
||||
var file = args[getopt.ind] == "-"? new File() : new File(args[getopt.ind]);
|
||||
var buf = new Bytes();
|
||||
var re = /(\d+)([MIDSHNX=])/g;
|
||||
var re = /(\d+)([MIDSHNX=])/g, re_MD = /(\d+)|(\^[A-Za-z]+)|([A-Za-z])/g, re_tag = /\t(\S\S:[AZif]):(\S+)/g;
|
||||
|
||||
var len = {}, lineno = 0;
|
||||
var ctg_len = {}, lineno = 0;
|
||||
while (file.readline(buf) >= 0) {
|
||||
var m, n_cigar = 0, line = buf.toString();
|
||||
++lineno;
|
||||
@@ -1044,37 +1136,52 @@ function paf_sam2paf(args)
|
||||
if (/^@SQ/.test(line)) {
|
||||
var name = (m = /\tSN:(\S+)/.exec(line)) != null? m[1] : null;
|
||||
var l = (m = /\tLN:(\d+)/.exec(line)) != null? parseInt(m[1]) : null;
|
||||
if (name != null && l != null) len[name] = l;
|
||||
if (name != null && l != null) ctg_len[name] = l;
|
||||
}
|
||||
continue;
|
||||
}
|
||||
var t = line.split("\t");
|
||||
var t = line.split("\t", 11);
|
||||
var flag = parseInt(t[1]);
|
||||
if (t[9] != '*' && t[10] != '*' && t[9].length != t[10].length) throw Error("ERROR at line " + lineno + ": inconsistent SEQ and QUAL lengths - " + t[9].length + " != " + t[10].length);
|
||||
if (t[2] == '*' || (flag&4)) continue;
|
||||
if (t[9] != '*' && t[10] != '*' && t[9].length != t[10].length)
|
||||
throw Error("at line " + lineno + ": inconsistent SEQ and QUAL lengths - " + t[9].length + " != " + t[10].length);
|
||||
if (t[2] == '*' || (flag&4) || t[5] == '*') continue;
|
||||
if (pri_only && (flag&0x100)) continue;
|
||||
var tlen = len[t[2]];
|
||||
if (tlen == null) throw Error("ERROR at line " + lineno + ": can't find the length of contig " + t[2]);
|
||||
var nn = (m = /\tnn:i:(\d+)/.exec(line)) != null? parseInt(m[1]) : 0;
|
||||
var NM = (m = /\tNM:i:(\d+)/.exec(line)) != null? parseInt(m[1]) : null;
|
||||
var have_NM = NM == null? false : true;
|
||||
NM += nn;
|
||||
var clip = [0, 0], I = [0, 0], D = [0, 0], M = 0, N = 0, ql = 0, tl = 0, mm = 0, ext_cigar = false;
|
||||
while ((m = re.exec(t[5])) != null) {
|
||||
var l = parseInt(m[1]);
|
||||
if (m[2] == 'M') M += l, ql += l, tl += l, ext_cigar = false;
|
||||
else if (m[2] == 'I') ++I[0], I[1] += l, ql += l;
|
||||
else if (m[2] == 'D') ++D[0], D[1] += l, tl += l;
|
||||
else if (m[2] == 'N') N += l, tl += l;
|
||||
else if (m[2] == 'S') clip[M == 0? 0 : 1] = l, ql += l;
|
||||
else if (m[2] == 'H') clip[M == 0? 0 : 1] = l;
|
||||
else if (m[2] == '=') M += l, ql += l, tl += l, ext_cigar = true;
|
||||
else if (m[2] == 'X') M += l, ql += l, tl += l, mm += l, ext_cigar = true;
|
||||
++n_cigar;
|
||||
var tlen = ctg_len[t[2]];
|
||||
if (tlen == null) throw Error("at line " + lineno + ": can't find the length of contig " + t[2]);
|
||||
// find tags
|
||||
var nn = 0, NM = null, MD = null, md_list = [];
|
||||
while ((m = re_tag.exec(line)) != null) {
|
||||
if (m[1] == "NM:i") NM = parseInt(m[2]);
|
||||
else if (m[1] == "nn:i") nn = parseInt(m[2]);
|
||||
else if (m[1] == "MD:Z") MD = m[2];
|
||||
}
|
||||
if (t[9] == '*') MD = null;
|
||||
// infer various lengths from CIGAR
|
||||
var clip = [0, 0], soft_clip = 0, I = [0, 0], D = [0, 0], M = 0, N = 0, mm = 0, have_M = false, have_ext = false, cigar = [];
|
||||
while ((m = re.exec(t[5])) != null) {
|
||||
var l = parseInt(m[1]), op = m[2];
|
||||
if (op == 'M') M += l, have_M = true;
|
||||
else if (op == 'I') ++I[0], I[1] += l;
|
||||
else if (op == 'D') ++D[0], D[1] += l;
|
||||
else if (op == 'N') N += l;
|
||||
else if (op == 'S') clip[n_cigar == 0? 0 : 1] = l, soft_clip += l;
|
||||
else if (op == 'H') clip[n_cigar == 0? 0 : 1] = l;
|
||||
else if (op == '=') M += l, have_ext = true, op = 'M';
|
||||
else if (op == 'X') M += l, mm += l, have_ext = true, op = 'M';
|
||||
++n_cigar;
|
||||
if (MD != null && op != 'H') {
|
||||
if (cigar.length > 0 && cigar[cigar.length-1][1] == op)
|
||||
cigar[cigar.length-1][0] += l;
|
||||
else cigar.push([l, op]);
|
||||
}
|
||||
}
|
||||
var ql = M + I[1] + soft_clip;
|
||||
var tl = M + D[1] + N;
|
||||
var ts = parseInt(t[3]) - 1, te = ts + tl;
|
||||
// checking coordinate and length consistencies
|
||||
if (n_cigar > 65535)
|
||||
warn("WARNING at line " + lineno + ": " + n_cigar + " CIGAR operations");
|
||||
if (tl + parseInt(t[3]) - 1 > tlen) {
|
||||
if (te > tlen) {
|
||||
warn("WARNING at line " + lineno + ": alignment end position larger than ref length; skipped");
|
||||
continue;
|
||||
}
|
||||
@@ -1082,24 +1189,78 @@ function paf_sam2paf(args)
|
||||
warn("WARNING at line " + lineno + ": SEQ length inconsistent with CIGAR (" + t[9].length + " != " + ql + "); skipped");
|
||||
continue;
|
||||
}
|
||||
if (!have_NM || ext_cigar) NM = I[1] + D[1] + mm;
|
||||
if (NM < I[1] + D[1] + mm) {
|
||||
warn("WARNING at line " + lineno + ": NM is less than the total number of gaps (" + NM + " < " + (I[1]+D[1]+mm) + ")");
|
||||
NM = I[1] + D[1] + mm;
|
||||
// parse MD
|
||||
var cs = [];
|
||||
if (MD != null) {
|
||||
var k = 0, cx = 0, cy = 0, mx = 0, my = 0;
|
||||
while ((m = re_MD.exec(MD)) != null) {
|
||||
if (m[2] != null) { // deletion from the reference
|
||||
var len = m[2].length - 1;
|
||||
cs.push('-', m[2].substr(1));
|
||||
mx += len, cx += len, ++k;
|
||||
} else { // copy or mismatch
|
||||
var ml = m[1] != null? parseInt(m[1]) : 1;
|
||||
while (k < cigar.length && cigar[k][1] != 'D') {
|
||||
var cl = cigar[k][0], op = cigar[k][1];
|
||||
if (op == 'M') {
|
||||
if (my + ml < cy + cl) {
|
||||
if (ml > 0) {
|
||||
if (m[3] != null) cs.push('*', m[3], t[9][my]);
|
||||
else cs.push(':', ml);
|
||||
}
|
||||
var extra = ["mm:i:"+(NM-I[1]-D[1]), "io:i:"+I[0], "in:i:"+I[1], "do:i:"+D[0], "dn:i:"+D[1]];
|
||||
var match = M - (NM - I[1] - D[1]);
|
||||
mx += ml, my += ml, ml = 0;
|
||||
break;
|
||||
} else {
|
||||
var dl = cy + cl - my;
|
||||
cs.push(':', dl);
|
||||
cx += cl, cy += cl, ++k;
|
||||
mx += dl, my += dl, ml -= dl;
|
||||
}
|
||||
} else if (op == 'I') {
|
||||
cs.push('+', t[9].substr(cy, cl));
|
||||
cy += cl, my += cl, ++k;
|
||||
} else if (op == 'S') {
|
||||
cy += cl, my += cl, ++k;
|
||||
} else throw Error("at line " + lineno + ": inconsistent MD tag");
|
||||
}
|
||||
if (ml != 0) throw Error("at line " + lineno + ": inconsistent MD tag");
|
||||
}
|
||||
}
|
||||
if (cx != mx || cy != my) throw Error("at line " + lineno + ": inconsistent MD tag");
|
||||
}
|
||||
// compute matching length, block length and calibrate NM
|
||||
if (have_ext && !have_M) { // extended CIGAR
|
||||
if (NM != null && NM != I[1] + D[1] + mm)
|
||||
warn("WARNING at line " + lineno + ": NM is different from sum of gaps and mismatches");
|
||||
NM = I[1] + D[1] + mm;
|
||||
} else if (NM != null) { // standard CIGAR; NM present
|
||||
if (NM < I[1] + D[1]) {
|
||||
warn("WARNING at line " + lineno + ": NM is less than the total number of gaps (" + NM + " < " + (I[1]+D[1]) + ")");
|
||||
NM = I[1] + D[1];
|
||||
}
|
||||
mm = NM - (I[1] + D[1]);
|
||||
} else { // no way to compute mm
|
||||
warn("WARNING at line " + lineno + ": unable to find the number of mismatches; assuming zero");
|
||||
mm = 0;
|
||||
}
|
||||
var mlen = M - mm;
|
||||
var blen = M + I[1] + D[1];
|
||||
// find query name, start and end
|
||||
var qlen = M + I[1] + clip[0] + clip[1];
|
||||
var qs, qe;
|
||||
if (flag&16) qs = clip[1], qe = qlen - clip[0];
|
||||
else qs = clip[0], qe = qlen - clip[1];
|
||||
var ts = parseInt(t[3]) - 1, te = ts + M + D[1] + N;
|
||||
var qname = t[0];
|
||||
var qname = t[0], qs, qe;
|
||||
if ((flag&1) && (flag&0x40)) qname += '/1';
|
||||
if ((flag&1) && (flag&0x80)) qname += '/2';
|
||||
var a = [qname, qlen, qs, qe, flag&16? '-' : '+', t[2], tlen, ts, te, match, blen, t[4]];
|
||||
print(a.join("\t"), extra.join("\t"));
|
||||
if (flag&16) qs = clip[1], qe = qlen - clip[0];
|
||||
else qs = clip[0], qe = qlen - clip[1];
|
||||
// optional tags
|
||||
var type = flag&0x100? 'S' : 'P';
|
||||
var tags = ["tp:A:" + type];
|
||||
if (NM != null) tags.push("mm:i:"+mm);
|
||||
tags.push("gn:i:"+(I[1]+D[1]), "go:i:"+(I[0]+D[0]), "cg:Z:" + t[5].replace(/\d+[SH]/g, ''));
|
||||
if (cs.length > 0) tags.push("cs:Z:" + cs.join(""));
|
||||
// print out
|
||||
var a = [qname, qlen, qs, qe, flag&16? '-' : '+', t[2], tlen, ts, te, mlen, blen, t[4]];
|
||||
print(a.join("\t"), tags.join("\t"));
|
||||
}
|
||||
|
||||
buf.destroy();
|
||||
@@ -1597,26 +1758,28 @@ function paf_pbsim2fq(args)
|
||||
|
||||
function paf_junceval(args)
|
||||
{
|
||||
var c, l_fuzzy = 0, print_ovlp = false, print_err_only = false, first_only = false;
|
||||
while ((c = getopt(args, "l:ep")) != null) {
|
||||
var c, l_fuzzy = 0, print_ovlp = false, print_err_only = false, first_only = false, chr_only = false;
|
||||
while ((c = getopt(args, "l:epc")) != null) {
|
||||
if (c == 'l') l_fuzzy = parseInt(getopt.arg);
|
||||
else if (c == 'e') print_err_only = print_ovlp = true;
|
||||
else if (c == 'p') print_ovlp = true;
|
||||
else if (c == 'c') chr_only = true;
|
||||
}
|
||||
|
||||
if (args.length - getopt.ind < 2) {
|
||||
if (args.length - getopt.ind < 1) {
|
||||
print("Usage: paftools.js junceval [options] <gene.gtf> <aln.sam>");
|
||||
print("Options:");
|
||||
print(" -l INT tolerance of junction positions (0 for exact) [0]");
|
||||
print(" -p print overlapping introns");
|
||||
print(" -e print erroreous overlapping introns");
|
||||
print(" -c only consider alignments to /^(chr)?([0-9]+|X|Y)$/");
|
||||
exit(1);
|
||||
}
|
||||
|
||||
var file, buf = new Bytes();
|
||||
|
||||
var tr = {};
|
||||
file = new File(args[getopt.ind]);
|
||||
file = args[getopt.ind] == '-'? new File() : new File(args[getopt.ind]);
|
||||
while (file.readline(buf) >= 0) {
|
||||
var m, t = buf.toString().split("\t");
|
||||
if (t[0].charAt(0) == '#') continue;
|
||||
@@ -1661,13 +1824,14 @@ function paf_junceval(args)
|
||||
var n_pri = 0, n_unmapped = 0, n_mapped = 0;
|
||||
var n_sgl = 0, n_splice = 0, n_splice_hit = 0, n_splice_novel = 0;
|
||||
|
||||
file = new File(args[getopt.ind+1]);
|
||||
file = getopt.ind+1 >= args.length || args[getopt.ind+1] == '-'? new File() : new File(args[getopt.ind+1]);
|
||||
var last_qname = null;
|
||||
var re_cigar = /(\d+)([MIDNSHX=])/g;
|
||||
while (file.readline(buf) >= 0) {
|
||||
var m, t = buf.toString().split("\t");
|
||||
|
||||
if (t[0].charAt(0) == '@') continue;
|
||||
if (chr_only && !/^(chr)?([0-9]+|X|Y)$/.test(t[2])) continue;
|
||||
var flag = parseInt(t[1]);
|
||||
if (flag&0x100) continue;
|
||||
if (first_only && last_qname == t[0]) continue;
|
||||
|
||||
@@ -86,6 +86,8 @@ mm_seg_t *mm_seg_gen(void *km, uint32_t hash, int n_segs, const int *qlens, int
|
||||
void mm_seg_free(void *km, int n_segs, mm_seg_t *segs);
|
||||
void mm_pair(void *km, int max_gap_ref, int dp_bonus, int sub_diff, int match_sc, const int *qlens, int *n_regs, mm_reg1_t **regs);
|
||||
|
||||
void mm_err_puts(const char *str);
|
||||
|
||||
#ifdef __cplusplus
|
||||
}
|
||||
#endif
|
||||
|
||||
@@ -51,6 +51,8 @@ void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
|
||||
opt->flag |= MM_F_SPLICE;
|
||||
if (opt->mid_occ <= 0)
|
||||
opt->mid_occ = mm_idx_cal_max_occ(mi, opt->mid_occ_frac);
|
||||
if (opt->mid_occ < opt->min_mid_occ)
|
||||
opt->mid_occ = opt->min_mid_occ;
|
||||
if (mm_verbose >= 3)
|
||||
fprintf(stderr, "[M::%s::%.3f*%.2f] mid_occ = %d\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), opt->mid_occ);
|
||||
}
|
||||
@@ -74,6 +76,7 @@ int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
|
||||
io->flag |= MM_I_HPC, io->k = 19, io->w = 5;
|
||||
mo->flag |= MM_F_ALL_CHAINS | MM_F_NO_DIAG | MM_F_NO_DUAL | MM_F_NO_LJOIN;
|
||||
mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_gap = 10000, mo->max_chain_skip = 25;
|
||||
mo->bw = 2000;
|
||||
} else if (strcmp(preset, "map10k") == 0 || strcmp(preset, "map-pb") == 0) {
|
||||
io->flag |= MM_I_HPC, io->k = 19;
|
||||
} else if (strcmp(preset, "map-ont") == 0) {
|
||||
@@ -81,11 +84,19 @@ int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
|
||||
} else if (strcmp(preset, "asm5") == 0) {
|
||||
io->flag = 0, io->k = 19, io->w = 19;
|
||||
mo->a = 1, mo->b = 19, mo->q = 39, mo->q2 = 81, mo->e = 3, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
|
||||
mo->min_mid_occ = 100;
|
||||
mo->min_dp_max = 200;
|
||||
mo->best_n = 50;
|
||||
} else if (strcmp(preset, "asm10") == 0) {
|
||||
io->flag = 0, io->k = 19, io->w = 19;
|
||||
mo->a = 1, mo->b = 9, mo->q = 16, mo->q2 = 41, mo->e = 2, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
|
||||
mo->min_mid_occ = 100;
|
||||
mo->min_dp_max = 200;
|
||||
mo->best_n = 50;
|
||||
} else if (strcmp(preset, "asm20") == 0) {
|
||||
io->flag = 0, io->k = 19, io->w = 10;
|
||||
mo->a = 1, mo->b = 4, mo->q = 6, mo->q2 = 26, mo->e = 2, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
|
||||
mo->min_mid_occ = 100;
|
||||
mo->min_dp_max = 200;
|
||||
mo->best_n = 50;
|
||||
} else if (strcmp(preset, "short") == 0 || strcmp(preset, "sr") == 0) {
|
||||
|
||||
+4
-4
@@ -119,11 +119,11 @@ static char *mappy_fetch_seq(const mm_idx_t *mi, const char *name, int st, int e
|
||||
*len = 0;
|
||||
rid = mm_idx_name2id(mi, name);
|
||||
if (rid < 0) return 0;
|
||||
if (st >= mi->seq[i].len || st >= en) return 0;
|
||||
if (en < 0 || en > mi->seq[i].len)
|
||||
en = mi->seq[i].len;
|
||||
if (st >= mi->seq[rid].len || st >= en) return 0;
|
||||
if (en < 0 || en > mi->seq[rid].len)
|
||||
en = mi->seq[rid].len;
|
||||
s = (char*)malloc(en - st + 1);
|
||||
*len = mm_idx_getseq(mi, rid, st, en, s);
|
||||
*len = mm_idx_getseq(mi, rid, st, en, (uint8_t*)s);
|
||||
for (i = 0; i < *len; ++i)
|
||||
s[i] = "ACGTN"[(uint8_t)s[i]];
|
||||
s[*len] = 0;
|
||||
|
||||
+3
-1
@@ -34,6 +34,7 @@ cdef extern from "minimap.h":
|
||||
float max_clip_ratio
|
||||
int pe_ori, pe_bonus
|
||||
float mid_occ_frac
|
||||
int32_t min_mid_occ
|
||||
int32_t mid_occ
|
||||
int32_t max_occ
|
||||
int mini_batch_size
|
||||
@@ -58,7 +59,8 @@ cdef extern from "minimap.h":
|
||||
mm_idx_seq_t *seq
|
||||
uint32_t *S
|
||||
mm_idx_bucket_t *B
|
||||
void *km, *h
|
||||
void *km
|
||||
void *h
|
||||
|
||||
ctypedef struct mm_idx_reader_t:
|
||||
pass
|
||||
|
||||
@@ -23,7 +23,7 @@ def readme():
|
||||
|
||||
setup(
|
||||
name = 'mappy',
|
||||
version = '2.9',
|
||||
version = '2.10',
|
||||
url = 'https://github.com/lh3/minimap2',
|
||||
description = 'Minimap2 python binding',
|
||||
long_description = readme(),
|
||||
@@ -39,7 +39,7 @@ setup(
|
||||
depends = ['minimap.h', 'bseq.h', 'kalloc.h', 'kdq.h', 'khash.h', 'kseq.h', 'ksort.h',
|
||||
'ksw2.h', 'kthread.h', 'kvec.h', 'mmpriv.h', 'sdust.h',
|
||||
'python/cmappy.h', 'python/cmappy.pxd'],
|
||||
extra_compile_args = ['-DHAVE_KALLOC', '-msse4'], # WARNING: ancient x86_64 CPUs don't have SSE4
|
||||
extra_compile_args = ['-DHAVE_KALLOC', '-msse4.1'], # WARNING: ancient x86_64 CPUs don't have SSE4
|
||||
include_dirs = ['.'],
|
||||
libraries = ['z', 'm', 'pthread'])],
|
||||
classifiers = [
|
||||
|
||||
+1
-1
@@ -1,4 +1,4 @@
|
||||
>MT_orang
|
||||
>MT_orang co:Z:comment
|
||||
GTTTATGTAGCTTATTCTATCCAAAGCAATGCACTGAAAATGTCTCGACGGGCCCACACG
|
||||
CCCCATAAACAAATAGGTTTGGTCCTAGCCTTTCTATTAGCTCTTAGTGAGGTTACACAT
|
||||
GCAAGCATCCCCGCCCCAGTGAGTCGCCCTCCAAGTCACTCTGACTAAGAGGAGCAAGCA
|
||||
|
||||
+16
-15
@@ -61,13 +61,6 @@
|
||||
Volume = {32},
|
||||
Year = {2016}}
|
||||
|
||||
@misc{Suzuki:2016,
|
||||
title = {Fast and accurate alignment tool for PacBio and Nanopore long reads},
|
||||
author = {Hajime Suzuki},
|
||||
journal = {Unpublished},
|
||||
howpublished = {\href{https://github.com/ocxtal/minialign}{https://github.com/ocxtal/minialign}},
|
||||
year = {2016}}
|
||||
|
||||
@misc{Ruan:2016,
|
||||
title = {Ultra-fast de novo assembler using long noisy reads},
|
||||
author = {Jue Ruan},
|
||||
@@ -172,14 +165,6 @@
|
||||
Volume = {29},
|
||||
Year = {2011}}
|
||||
|
||||
@article {Suzuki130633,
|
||||
author = {Suzuki, Hajime and Kasahara, Masahiro},
|
||||
title = {Acceleration Of Nucleotide Semi-Global Alignment With Adaptive Banded Dynamic Programming},
|
||||
year = {2017},
|
||||
note = {doi:10.1101/130633},
|
||||
publisher = {Cold Spring Harbor Labs Journals},
|
||||
journal = {bioRxiv}}
|
||||
|
||||
@article{Gotoh:1982aa,
|
||||
Author = {Gotoh, O},
|
||||
Journal = {J Mol Biol},
|
||||
@@ -337,3 +322,19 @@
|
||||
Title = {{MUMmer4}: A fast and versatile genome alignment system},
|
||||
Volume = {14},
|
||||
Year = {2018}}
|
||||
|
||||
@article{Li:2009ys,
|
||||
Author = {Li, Heng and others},
|
||||
Journal = {Bioinformatics},
|
||||
Pages = {2078-9},
|
||||
Title = {The {Sequence Alignment/Map format and SAMtools}},
|
||||
Volume = {25},
|
||||
Year = {2009}}
|
||||
|
||||
@article{Suzuki:2018aa,
|
||||
Author = {Suzuki, Hajime and Kasahara, Masahiro},
|
||||
Journal = {BMC Bioinformatics},
|
||||
Pages = {45},
|
||||
Title = {Introducing difference recurrence relations for faster semi-global alignment of long sequences},
|
||||
Volume = {19},
|
||||
Year = {2018}}
|
||||
|
||||
+23
-16
@@ -19,7 +19,7 @@
|
||||
\begin{document}
|
||||
\firstpage{1}
|
||||
|
||||
\title[Aligning nucleotide sequences with minimap2]{Minimap2: versatile pairwise alignment for nucleotide sequences}
|
||||
\title[Aligning nucleotide sequences with minimap2]{Minimap2: pairwise alignment for nucleotide sequences}
|
||||
\author[Li]{Heng Li}
|
||||
\address{Broad Institute, 415 Main Street, Cambridge, MA 02142, USA}
|
||||
|
||||
@@ -64,7 +64,7 @@ the thought that 10kb long sequences should be easier to map than 100bp reads
|
||||
because we can more effectively skip repetitive regions, which are often the
|
||||
bottleneck of short-read alignment. We confirmed our speculation by achieving
|
||||
approximate mapping 50 times faster than BWA-MEM~\citep{Li:2016aa}.
|
||||
\citet{Suzuki130633} extended our work with a fast and novel algorithm on
|
||||
\citet{Suzuki:2018aa} extended our work with a fast and novel algorithm on
|
||||
generating base-level alignment, which in turn inspired us to develop minimap2
|
||||
with added functionality.
|
||||
|
||||
@@ -88,7 +88,9 @@ the versatility of minimap2.
|
||||
|
||||
Minimap2 follows a typical seed-chain-align procedure as is used by most
|
||||
full-genome aligners. It collects minimizers~\citep{Roberts:2004fv} of the
|
||||
reference sequences and indexes them in a hash table. Then for each query
|
||||
reference sequences and indexes them in a hash table, with the key being the
|
||||
hash of a minimizer and the value being a list of locations of the minimizer
|
||||
copies. Then for each query
|
||||
sequence, minimap2 takes query minimizers as \emph{seeds}, finds exact matches
|
||||
(i.e. \emph{anchors}) to the reference, and identifies sets of colinear anchors as
|
||||
\emph{chains}. If base-level alignment is requested, minimap2 applies dynamic
|
||||
@@ -118,9 +120,12 @@ distance between two anchors is too large); otherwise
|
||||
\begin{equation}\label{eq:chain-gap}
|
||||
\beta(j,i)=\gamma_c\big((y_i-y_j)-(x_i-x_j)\big)
|
||||
\end{equation}
|
||||
In implementation, a gap of length $l\not=0$ costs
|
||||
In implementation, a gap of length $l$ costs
|
||||
\[
|
||||
\gamma_c(l)=0.01\cdot \bar{w}\cdot|l|+0.5\log_2|l|
|
||||
\gamma_c(l)=\left\{\begin{array}{ll}
|
||||
0.01\cdot \bar{w}\cdot|l|+0.5\log_2|l| & (l\not=0) \\
|
||||
0 & (l=0)
|
||||
\end{array}\right.
|
||||
\]
|
||||
where $\bar{w}$ is the average seed length. For $N$ anchors, directly computing all $f(\cdot)$ with
|
||||
Eq.~(\ref{eq:chain}) takes $O(N^2)$ time. Although theoretically faster
|
||||
@@ -164,7 +169,7 @@ empirical formula:
|
||||
\[
|
||||
{\rm mapQ}=40\cdot (1-f_2/f_1)\cdot\min\{1,m/10\}\cdot\log f_1
|
||||
\]
|
||||
where $m$ is the number of anchors on the primary chain, $f_1$ is the chaining
|
||||
where $\log$ denotes natural logarithm, $m$ is the number of anchors on the primary chain, $f_1$ is the chaining
|
||||
score, and $f_2\le f_1$ is the score of the best chain that is secondary to the
|
||||
primary chain. Intuitively, a chain is assigned to a higher mapping quality if
|
||||
it is long and its best secondary chain is weak.
|
||||
@@ -253,7 +258,7 @@ performance of minimap2. Traditional SSE implementations~\citep{Farrar:2007hs}
|
||||
based on Eq.~(\ref{eq:ae86}) can achieve 16-way parallelization for short
|
||||
sequences, but only 4-way parallelization when the peak alignment score reaches
|
||||
32767. Long sequence alignment may exceed this threshold. Inspired by
|
||||
\citet{Wu:1996aa} and the following work, \citet{Suzuki130633} proposed a
|
||||
\citet{Wu:1996aa} and the following work, \citet{Suzuki:2018aa} proposed a
|
||||
difference-based formulation that lifted this limitation.
|
||||
In case of 2-piece gap cost, define
|
||||
\[
|
||||
@@ -320,7 +325,7 @@ y_{rt}&=&\max\{0,y_{r-1,t}+u_{r-1,t}-z_{rt}+q\}-q-e\\
|
||||
\end{equation*}
|
||||
In this formulation, cells with the same diagonal index $r$ are independent of
|
||||
each other. This allows us to fully vectorize the computation of all cells on
|
||||
the same anti-diagonal in one inner loop. It also simplifies banded alignment,
|
||||
the same anti-diagonal in one inner loop. It also simplifies banded alignment (500bp band width by default),
|
||||
which would be difficult with striped vectorization~\citep{Farrar:2007hs}.
|
||||
|
||||
On the condition that $q+e<\tilde{q}+\tilde{e}$ and $e>\tilde{e}$, the initial
|
||||
@@ -355,7 +360,7 @@ times as fast as Parasail's 4-way vectorization~\citep{Daily:2016aa}. Without
|
||||
banding, our implementation is slower than Edlib~\citep{Sosic:2017aa}, but with
|
||||
a 1000bp band, it is considerably faster. When performing global alignment
|
||||
between anchors, we expect the alignment to stay close to the diagonal of the
|
||||
DP matrix. Banding is applicable most of time.
|
||||
DP matrix. Banding is applicable most of the time.
|
||||
|
||||
\subsubsection{The Z-drop heuristic}
|
||||
|
||||
@@ -478,7 +483,7 @@ both C and Python. It is distributed under the MIT license, free to both
|
||||
commercial and academic uses. Minimap2 uses the same base algorithm for all
|
||||
applications, but it has to apply different sets of parameters depending on
|
||||
input data types. Similar to BWA-MEM, minimap2 introduces `presets' that
|
||||
modify multiple parameters with a simple invokation. Detailed settings
|
||||
modify multiple parameters with a simple invocation. Detailed settings
|
||||
and command-line options can be found in the minimap2 manpage. In addition to
|
||||
the applications evaluated in the following sections, minimap2 also retains
|
||||
minimap's functionality to find overlaps between long reads and to search
|
||||
@@ -570,7 +575,7 @@ Peak RAM (GByte) & 8.9 & 14.5 & 3.2 & 29.2\vspace{1em}\\
|
||||
\% approx. introns & 91.8\% & 96.9\% & 92.5\% & 82.4\% \\
|
||||
\botrule
|
||||
\end{tabular}
|
||||
}{Mouse reads (AC:SRR5286960; R9.4 chemistry) were mapped to the primary assembly of mouse
|
||||
}{Mouse cDNA reads (AC:SRR5286960; R9.4 chemistry) were mapped to the primary assembly of mouse
|
||||
genome GRCm38 with the following tools and command options: minimap2 (`-ax
|
||||
splice'); GMAP (`-n 0 --min-intronlength 30 --cross-species'); SpAln (`-Q7 -LS
|
||||
-S3'); STARlong (according to
|
||||
@@ -579,7 +584,7 @@ compared to the EnsEMBL gene annotation, release 89. A predicted intron
|
||||
is \emph{novel} if it has no overlaps with any annotated introns. An intron
|
||||
is \emph{exact} if it is identical to an annotated intron. An intron is
|
||||
\emph{approximate} if both its 5'- and 3'-end are within 10bp around the ends
|
||||
of an annotated intron.}
|
||||
of an annotated intron. Chimeric alignments are defined in the SAM spec~\citep{Li:2009ys}.}
|
||||
\end{table}
|
||||
|
||||
We next aligned real mouse reads~\citep{Byrne:2017aa} with GMAP~(v2017-06-20;
|
||||
@@ -647,9 +652,9 @@ across the whole genome and have been \emph{de novo} assembled with SMRT reads
|
||||
to high quality. This allowed us to construct an independent truth variant
|
||||
dataset~\citep{Li223297} for
|
||||
ERR1341796. In this evaluation, minimap2 has higher SNP false negative rate
|
||||
(FNR; 2.5\% of minimap2 vs 2.2\% of BWA-MEM), but fewer false positive SNPs per
|
||||
million bases (FPPM; 3.0 vs 3.9), lower 2--50bp INDEL FNR (7.3\% vs 7.5\%) and
|
||||
similar INDEL FPPM (both 1.0). Minimap2 is broadly similar to BWA-MEM in the
|
||||
(FNR; 2.6\% of minimap2 vs 2.3\% of BWA-MEM), but fewer false positive SNPs per
|
||||
million bases (FPPM; 7.0 vs 8.8), similar INDEL FNR (11.2\% vs 11.3\%) and
|
||||
similar INDEL FPPM (6.4 vs 6.5). Minimap2 is broadly comparable to BWA-MEM in the
|
||||
context of small variant calling.
|
||||
|
||||
\subsection{Aligning long-read assemblies}
|
||||
@@ -687,7 +692,7 @@ involving $>$100kb introns, which was impractically slow ten years ago. The
|
||||
minimap2 chaining algorithm is fast and highly accurate by itself. In fact,
|
||||
chaining alone is more accurate than all the other long-read mappers in
|
||||
Fig.~\ref{fig:eval}a (data not shown). This accuracy helps to reduce downstream
|
||||
base-level alignment of candidate chains, which is still times slower than
|
||||
base-level alignment of candidate chains, which is still several times slower than
|
||||
chaining even with the Suzuki-Kasahara improvement. In addition, taking a
|
||||
general form, minimap2 chaining can be adapted to non-typical data types such as
|
||||
spliced reads and multiple reads per fragment. This gives us the opportunity to
|
||||
@@ -712,6 +717,8 @@ Schatz, P. Rescheneder and F. Sedlazeck for pointing out the limitation of
|
||||
BWA-MEM. We are also grateful to minimap2 users who have greatly helped to
|
||||
suggest features and to fix various issues.
|
||||
|
||||
\paragraph{Funding\textcolon} NHGRI 1R01HG010040-01
|
||||
|
||||
\bibliography{minimap2}
|
||||
|
||||
\end{document}
|
||||
|
||||
Reference in New Issue
Block a user