mirror of
https://github.com/lh3/minimap2.git
synced 2026-09-25 18:08:11 +08:00
Compare commits
| Author | SHA1 | Date | |
|---|---|---|---|
|
|
0517972d02 | ||
|
|
d46e68e6ad | ||
|
|
2584a4149a | ||
|
|
66674afd09 | ||
|
|
e9ca0c9dab | ||
|
|
7e6e8ca73f | ||
|
|
408e098859 | ||
|
|
57f37551f8 | ||
|
|
4c66b689c3 | ||
|
|
1bde2cf076 | ||
|
|
31fc0f218a | ||
|
|
3d3bcc29a8 | ||
|
|
99dcd75f64 | ||
|
|
154d2caf5b | ||
|
|
a3afeec0b2 | ||
|
|
3573784b4d | ||
|
|
872f300955 | ||
|
|
d7b61a039e | ||
|
|
248158a3e1 | ||
|
|
9f4309c376 | ||
|
|
463f9309f9 | ||
|
|
abe989e355 | ||
|
|
881b4ca3a2 | ||
|
|
10c6dd2551 | ||
|
|
7ec6721c44 | ||
|
|
e61812ee55 | ||
|
|
734ac379bb | ||
|
|
759f8e4ac9 | ||
|
|
aef7b0744c | ||
|
|
39f836eac8 | ||
|
|
cbeb86dad6 | ||
|
|
372c90ceb5 | ||
|
|
2e2e69107c | ||
|
|
ee4cd089f7 | ||
|
|
2d7ec75d50 | ||
|
|
7938ed4893 | ||
|
|
4740423afa | ||
|
|
1776311a9b | ||
|
|
c1a3e05cb0 | ||
|
|
ecb6703d4a | ||
|
|
0bf97a367b | ||
|
|
1c504d72e4 | ||
|
|
5ef9580b17 | ||
|
|
08bd2123b6 | ||
|
|
8766d286df | ||
|
|
623b5d9d48 | ||
|
|
18659118cd | ||
|
|
d1050f4eaf | ||
|
|
b81d45510e | ||
|
|
d135feb1a5 | ||
|
|
242ff4e91d | ||
|
|
7a0c1316ce | ||
|
|
77ebd479f4 | ||
|
|
e3f226a9d9 | ||
|
|
bdc615c1d4 | ||
|
|
ad1beaf255 | ||
|
|
de0480ac5b | ||
|
|
f2866533a8 | ||
|
|
0173850ef0 | ||
|
|
acea3594fb | ||
|
|
f78a247749 | ||
|
|
ccaf12e1a2 | ||
|
|
96b132c97d | ||
|
|
70428ca3a8 | ||
|
|
9aea79d621 | ||
|
|
1770988627 | ||
|
|
2bfdad34bb | ||
|
|
953766cedd | ||
|
|
dc61301d9f | ||
|
|
19e05a099d | ||
|
|
0238caa8b1 | ||
|
|
a22ebb9836 |
@@ -1,4 +1,4 @@
|
||||
CFLAGS= -g -Wall -O2 -Wc++-compat
|
||||
CFLAGS= -g -Wall -O2 -Wc++-compat #-Wextra
|
||||
CPPFLAGS= -DHAVE_KALLOC
|
||||
INCLUDES=
|
||||
OBJS= kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o options.o index.o chain.o align.o hit.o map.o format.o pe.o esterr.o ksw2_ll_sse.o
|
||||
@@ -6,16 +6,20 @@ PROG= minimap2
|
||||
PROG_EXTRA= sdust minimap2-lite
|
||||
LIBS= -lm -lz -lpthread
|
||||
|
||||
ifeq ($(arm_neon),)
|
||||
ifeq ($(sse2only),)
|
||||
ifeq ($(arm_neon),) # if arm_neon is not defined
|
||||
ifeq ($(sse2only),) # if sse2only is not defined
|
||||
OBJS+=ksw2_extz2_sse41.o ksw2_extd2_sse41.o ksw2_exts2_sse41.o ksw2_extz2_sse2.o ksw2_extd2_sse2.o ksw2_exts2_sse2.o ksw2_dispatch.o
|
||||
else
|
||||
else # if sse2only is defined
|
||||
OBJS+=ksw2_extz2_sse.o ksw2_extd2_sse.o ksw2_exts2_sse.o
|
||||
endif
|
||||
else
|
||||
OBJS+=ksw2_extz2_neon.o ksw2_extd2_neon.o ksw2_exts2_neon.o
|
||||
CFLAGS+=-D_FILE_OFFSET_BITS=64 -mfpu=neon -fsigned-char
|
||||
INCLUDES+=-I sse2neon
|
||||
else # if arm_neon is defined
|
||||
OBJS+=ksw2_extz2_neon.o ksw2_extd2_neon.o ksw2_exts2_neon.o
|
||||
INCLUDES+=-Isse2neon
|
||||
ifeq ($(aarch64),) #if aarch64 is not defined
|
||||
CFLAGS+=-D_FILE_OFFSET_BITS=64 -mfpu=neon -fsigned-char
|
||||
else #if aarch64 is defined
|
||||
CFLAGS+=-D_FILE_OFFSET_BITS=64 -fsigned-char
|
||||
endif
|
||||
endif
|
||||
|
||||
.PHONY:all extra clean depend
|
||||
@@ -42,26 +46,31 @@ sdust:sdust.c getopt.o kalloc.o kalloc.h kdq.h kvec.h kseq.h sdust.h
|
||||
|
||||
# SSE-specific targets on x86/x86_64
|
||||
|
||||
ifeq ($(arm_neon),) # if arm_neon is defined, compile this target with the default setting (i.e. no -msse2)
|
||||
ksw2_ll_sse.o:ksw2_ll_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c $(CFLAGS) -msse2 $(CPPFLAGS) $(INCLUDES) $< -o $@
|
||||
endif
|
||||
|
||||
ksw2_extz2_sse41.o:ksw2_extz2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_extz2_sse2.o:ksw2_extz2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
|
||||
$(CC) -c $(CFLAGS) -msse2 -mno-sse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_extd2_sse41.o:ksw2_extd2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_extd2_sse2.o:ksw2_extd2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
|
||||
$(CC) -c $(CFLAGS) -msse2 -mno-sse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_exts2_sse41.o:ksw2_exts2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_exts2_sse2.o:ksw2_exts2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
|
||||
$(CC) -c $(CFLAGS) -msse2 -mno-sse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_dispatch.o:ksw2_dispatch.c ksw2.h
|
||||
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||
|
||||
# NEON-specific targets on ARM
|
||||
|
||||
|
||||
@@ -1,3 +1,105 @@
|
||||
Release 2.11-r797 (20 June 2018)
|
||||
--------------------------------
|
||||
|
||||
Changes to minimap2:
|
||||
|
||||
* Improved alignment accuracy in low-complexity regions for SV calling. Thank
|
||||
@armintoepfer for multiple offline examples.
|
||||
|
||||
* Added option --eqx to encode sequence match/mismatch with the =/X CIGAR
|
||||
operators (#156, #157 and #175).
|
||||
|
||||
* When compiled with VC++, minimap2 generated wrong alignments due to a
|
||||
comparison between a signed integer and an unsigned integer (#184). Also
|
||||
fixed warnings reported by "clang -Wextra".
|
||||
|
||||
* Fixed incorrect anchor filtering due to a missing 64- to 32-bit cast.
|
||||
|
||||
* Fixed incorrect mapping quality for inversions (#148).
|
||||
|
||||
* Fixed incorrect alignment involving ambiguous bases (#155).
|
||||
|
||||
* Fixed incorrect presets: option `-r 2000` is intended to be used with
|
||||
ava-ont, not ava-pb. The bug was introduced in 2.10.
|
||||
|
||||
* Fixed a bug when --for-only/--rev-only is used together with --sr or
|
||||
--heap-sort=yes (#166).
|
||||
|
||||
* Fixed option -Y that was not working in the previous releases.
|
||||
|
||||
* Added option --lj-min-ratio to fine control the alignment of long gaps
|
||||
found by the "long-join" heuristic (#128).
|
||||
|
||||
* Exposed `mm_idx_is_idx`, `mm_idx_load` and `mm_idx_dump` C APIs (#177).
|
||||
Also fixed a bug when indexing without reference names (this feature is not
|
||||
exposed to the command line).
|
||||
|
||||
Changes to mappy:
|
||||
|
||||
* Added `__version__` (#165).
|
||||
|
||||
* Exposed the maximum fragment length parameter to mappy (#174).
|
||||
|
||||
Changes to paftools:
|
||||
|
||||
* Don't crash when there is no "cg" tag (#153).
|
||||
|
||||
* Fixed wrong coverage report by "paftools.js call" (#145).
|
||||
|
||||
This version may produce slightly different base-level alignment. The overall
|
||||
alignment statistics should remain similar.
|
||||
|
||||
(2.11: 20 June 2018, r797)
|
||||
|
||||
|
||||
|
||||
Release 2.10-r761 (27 March 2018)
|
||||
---------------------------------
|
||||
|
||||
Changes to minimap2:
|
||||
|
||||
* Optionally output the MD tag for compatibility with existing tools (#63,
|
||||
#118 and #137).
|
||||
|
||||
* Use SSE compiler flags more precisely to prevent compiling errors on certain
|
||||
machines (#127).
|
||||
|
||||
* Added option --min-occ-floor to set a minimum occurrence threshold. Presets
|
||||
intended for assembly-to-reference alignment set this option to 100. This
|
||||
option alleviates issues with regions having high copy numbers (#107).
|
||||
|
||||
* Exit with non-zero code on file writing errors (e.g. disk full; #103 and
|
||||
#132).
|
||||
|
||||
* Added option -y to copy FASTA/FASTQ comments in query sequences to the
|
||||
output (#136).
|
||||
|
||||
* Added the asm20 preset for alignments between genomes at 5-10% sequence
|
||||
divergence.
|
||||
|
||||
* Changed the band-width in the ava-ont preset from 500 to 2000. Oxford
|
||||
Nanopore reads may contain long deletion sequencing errors that break
|
||||
chaining.
|
||||
|
||||
Changes to mappy, the Python binding:
|
||||
|
||||
* Fixed a typo in Align.seq() (#126).
|
||||
|
||||
Changes to paftools.js, the companion script:
|
||||
|
||||
* Command sam2paf now converts the MD tag to cs.
|
||||
|
||||
* Support VCF output for assembly-to-reference variant calling (#109).
|
||||
|
||||
This version should produce identical alignment for read overlapping, RNA-seq
|
||||
read mapping, and genomic read mapping. We have also added a cook book to show
|
||||
the variety uses of minimap2 on real datasets. Please see cookbook.md in the
|
||||
minimap2 source code directory.
|
||||
|
||||
(2.10: 27 March 2017, r761)
|
||||
|
||||
|
||||
|
||||
Release 2.9-r720 (23 February 2018)
|
||||
-----------------------------------
|
||||
|
||||
|
||||
@@ -61,16 +61,16 @@ mainstream long-read mappers such as BLASR, BWA-MEM, NGMLR and GMAP. It is more
|
||||
accurate on simulated long reads and produces biologically meaningful alignment
|
||||
ready for downstream analyses. For >100bp Illumina short reads, minimap2 is
|
||||
three times as fast as BWA-MEM and Bowtie2, and as accurate on simulated data.
|
||||
Detailed evaluations are available from the [minimap2 preprint][preprint].
|
||||
Detailed evaluations are available from the [minimap2 paper][doi] or the
|
||||
[preprint][preprint].
|
||||
|
||||
### <a name="install"></a>Installation
|
||||
|
||||
Minimap2 is optimized for x86-64 CPUs. You can acquire precompiled binaries from
|
||||
the [release page][release] with:
|
||||
```sh
|
||||
curl -L https://github.com/lh3/minimap2/releases/download/v2.9/minimap2-2.9_x64-linux.tar.bz2 \
|
||||
| tar -jxvf -
|
||||
./minimap2-2.9_x64-linux/minimap2
|
||||
curl -L https://github.com/lh3/minimap2/releases/download/v2.11/minimap2-2.11_x64-linux.tar.bz2 | tar -jxvf -
|
||||
./minimap2-2.11_x64-linux/minimap2
|
||||
```
|
||||
If you want to compile from the source, you need to have a C compiler, GNU make
|
||||
and zlib development files installed. Then type `make` in the source code
|
||||
@@ -78,7 +78,7 @@ directory to compile. If you see compilation errors, try `make sse2only=1`
|
||||
to disable SSE4 code, which will make minimap2 slightly slower.
|
||||
|
||||
Minimap2 also works with ARM CPUs supporting the NEON instruction sets. To
|
||||
compile, use `make arm_neon=1`.
|
||||
compile for 32 bit ARM architectures (such as ARMv7), use `make arm_neon=1`. To compile for for 64 bit ARM architectures (such as ARMv8), use `make arm_neon=1 aarch64=1`.
|
||||
|
||||
### <a name="general"></a>General usage
|
||||
|
||||
@@ -137,7 +137,7 @@ Nanopore reads.
|
||||
#### <a name="map-long-splice"></a>Map long mRNA/cDNA reads
|
||||
|
||||
```sh
|
||||
minimap2 -ax splice -uf ref.fa iso-seq.fq > aln.sam # PacBio Iso-seq/traditional cDNA
|
||||
minimap2 -ax splice -uf -C5 ref.fa iso-seq.fq > aln.sam # PacBio Iso-seq/traditional cDNA
|
||||
minimap2 -ax splice ref.fa nanopore-cdna.fa > aln.sam # Nanopore 2D cDNA-seq
|
||||
minimap2 -ax splice -uf -k14 ref.fa direct-rna.fq > aln.sam # Nanopore Direct RNA-seq
|
||||
minimap2 -ax splice --splice-flank=no SIRV.fa SIRV-seq.fa # mapping against SIRV control
|
||||
@@ -229,7 +229,7 @@ sorting) still work with such BAM records; tools that read CIGAR will
|
||||
effectively ignore these records. It has been decided that future tools will
|
||||
will seamlessly recognize long-cigar records generated by option `-L`.
|
||||
|
||||
**TD;DR**: if you work with ultra-long reads and use tools that only process
|
||||
**TL;DR**: if you work with ultra-long reads and use tools that only process
|
||||
BAM files, please add option `-L`.
|
||||
|
||||
#### <a name="cs"></a>The cs optional tag
|
||||
@@ -254,7 +254,9 @@ similar to the `MD` SAM tag but is standalone and easier to parse.
|
||||
If `--cs=long` is used, the `cs` string also contains identical sequences in
|
||||
the alignment. The above example will become
|
||||
`=CGATCG-ata=AATAGAGTAG+gtc=GAAT*at=GCA`. The long form of `cs` encodes both
|
||||
reference and query sequences in one string.
|
||||
reference and query sequences in one string. The `cs` tag also encodes intron
|
||||
positions and splicing signals (see the [minimap2 manpage][manpage-cs] for
|
||||
details).
|
||||
|
||||
#### <a name="paftools"></a>Working with the PAF format
|
||||
|
||||
@@ -317,9 +319,10 @@ There is not a specific mailing list for the time being.
|
||||
|
||||
### <a name="cite"></a>Citing minimap2
|
||||
|
||||
If you use minimap2 in your work, please consider to cite:
|
||||
If you use minimap2 in your work, please cite:
|
||||
|
||||
> Li, H. (2017). Minimap2: fast pairwise alignment for long nucleotide sequences. [arXiv:1708.01492][preprint]
|
||||
> Li, H. (2018). Minimap2: pairwise alignment for nucleotide sequences.
|
||||
> Bioinformatics. [doi:10.1093/bioinformatics/bty191][doi]
|
||||
|
||||
## <a name="dguide"></a>Developers' Guide
|
||||
|
||||
@@ -346,6 +349,10 @@ mappy` or [from BioConda][mappyconda] via `conda install -c bioconda mappy`.
|
||||
possible to add non-SIMD support, but it would make minimap2 slower by
|
||||
several times.
|
||||
|
||||
* Minimap2 does not work with a single query or database sequence ~2
|
||||
billion bases or longer (2,147,483,647 to be exact). The total length of all
|
||||
sequences can well exceed this threshold.
|
||||
|
||||
|
||||
|
||||
[paf]: https://github.com/lh3/miniasm/blob/master/PAF.md
|
||||
@@ -362,3 +369,5 @@ mappy` or [from BioConda][mappyconda] via `conda install -c bioconda mappy`.
|
||||
[issue]: https://github.com/lh3/minimap2/issues
|
||||
[k8]: https://github.com/attractivechaos/k8
|
||||
[manpage]: https://lh3.github.io/minimap2/minimap2.html
|
||||
[manpage-cs]: https://lh3.github.io/minimap2/minimap2.html#10
|
||||
[doi]: https://doi.org/10.1093/bioinformatics/bty191
|
||||
|
||||
@@ -6,18 +6,19 @@
|
||||
#include "mmpriv.h"
|
||||
#include "ksw2.h"
|
||||
|
||||
static void ksw_gen_simple_mat(int m, int8_t *mat, int8_t a, int8_t b)
|
||||
static void ksw_gen_simple_mat(int m, int8_t *mat, int8_t a, int8_t b, int8_t sc_ambi)
|
||||
{
|
||||
int i, j;
|
||||
a = a < 0? -a : a;
|
||||
b = b > 0? -b : b;
|
||||
sc_ambi = sc_ambi > 0? -sc_ambi : sc_ambi;
|
||||
for (i = 0; i < m - 1; ++i) {
|
||||
for (j = 0; j < m - 1; ++j)
|
||||
mat[i * m + j] = i == j? a : b;
|
||||
mat[i * m + m - 1] = 0;
|
||||
mat[i * m + m - 1] = sc_ambi;
|
||||
}
|
||||
for (j = 0; j < m; ++j)
|
||||
mat[(m - 1) * m + j] = 0;
|
||||
mat[(m - 1) * m + j] = sc_ambi;
|
||||
}
|
||||
|
||||
static inline void mm_seq_rev(uint32_t len, uint8_t *seq)
|
||||
@@ -90,7 +91,8 @@ static int mm_test_zdrop(void *km, const mm_mapopt_t *opt, const uint8_t *qseq,
|
||||
static void mm_fix_cigar(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq, int *qshift, int *tshift)
|
||||
{
|
||||
mm_extra_t *p = r->p;
|
||||
int32_t k, toff = 0, qoff = 0, to_shrink = 0;
|
||||
int32_t toff = 0, qoff = 0, to_shrink = 0;
|
||||
uint32_t k;
|
||||
*qshift = *tshift = 0;
|
||||
if (p->n_cigar <= 1) return;
|
||||
for (k = 0; k < p->n_cigar; ++k) { // indel left alignment
|
||||
@@ -147,8 +149,8 @@ static void mm_fix_cigar(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq,
|
||||
|
||||
static void mm_update_extra(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq, const int8_t *mat, int8_t q, int8_t e)
|
||||
{
|
||||
uint32_t k, l, toff = 0, qoff = 0;
|
||||
int32_t s = 0, max = 0, qshift, tshift;
|
||||
uint32_t k, l;
|
||||
int32_t s = 0, max = 0, qshift, tshift, toff = 0, qoff = 0;
|
||||
mm_extra_t *p = r->p;
|
||||
if (p == 0) return;
|
||||
mm_fix_cigar(r, qseq, tseq, &qshift, &tshift);
|
||||
@@ -197,7 +199,7 @@ static void mm_append_cigar(mm_reg1_t *r, uint32_t n_cigar, uint32_t *cigar) //
|
||||
mm_extra_t *p;
|
||||
if (n_cigar == 0) return;
|
||||
if (r->p == 0) {
|
||||
uint32_t capacity = n_cigar + sizeof(mm_extra_t);
|
||||
uint32_t capacity = n_cigar + sizeof(mm_extra_t); // TODO: should this be "n_cigar + sizeof(mm_extra_t)/4" instead?
|
||||
kroundup32(capacity);
|
||||
r->p = (mm_extra_t*)calloc(capacity, 4);
|
||||
r->p->capacity = capacity;
|
||||
@@ -217,6 +219,77 @@ static void mm_append_cigar(mm_reg1_t *r, uint32_t n_cigar, uint32_t *cigar) //
|
||||
}
|
||||
}
|
||||
|
||||
static void mm_update_cigar_eqx(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq) // written by @armintoepfer
|
||||
{
|
||||
uint32_t n_EQX = 0;
|
||||
uint32_t k, l, m, cap, toff = 0, qoff = 0, n_M = 0;
|
||||
mm_extra_t *p;
|
||||
if (r->p == 0) return;
|
||||
for (k = 0; k < r->p->n_cigar; ++k) {
|
||||
uint32_t op = r->p->cigar[k]&0xf, len = r->p->cigar[k]>>4;
|
||||
if (op == 0) {
|
||||
while (len > 0) {
|
||||
for (l = 0; l < len && qseq[qoff + l] == tseq[toff + l]; ++l) {} // run of "="; TODO: N<=>N is converted to "="
|
||||
if (l > 0) { ++n_EQX; len -= l; toff += l; qoff += l; }
|
||||
|
||||
for (l = 0; l < len && qseq[qoff + l] != tseq[toff + l]; ++l) {} // run of "X"
|
||||
if (l > 0) { ++n_EQX; len -= l; toff += l; qoff += l; }
|
||||
}
|
||||
++n_M;
|
||||
} else if (op == 1) { // insertion
|
||||
qoff += len;
|
||||
} else if (op == 2) { // deletion
|
||||
toff += len;
|
||||
} else if (op == 3) { // intron
|
||||
toff += len;
|
||||
}
|
||||
}
|
||||
// update in-place if we can
|
||||
if (n_EQX == n_M) {
|
||||
for (k = 0; k < r->p->n_cigar; ++k) {
|
||||
uint32_t op = r->p->cigar[k]&0xf, len = r->p->cigar[k]>>4;
|
||||
if (op == 0) r->p->cigar[k] = len << 4 | 7;
|
||||
}
|
||||
return;
|
||||
}
|
||||
// allocate new storage
|
||||
cap = r->p->n_cigar + (n_EQX - n_M) + sizeof(mm_extra_t);
|
||||
kroundup32(cap);
|
||||
p = (mm_extra_t*)calloc(cap, 4);
|
||||
memcpy(p, r->p, sizeof(mm_extra_t));
|
||||
p->capacity = cap;
|
||||
// update cigar while copying
|
||||
toff = qoff = m = 0;
|
||||
for (k = 0; k < r->p->n_cigar; ++k) {
|
||||
uint32_t op = r->p->cigar[k]&0xf, len = r->p->cigar[k]>>4;
|
||||
if (op == 0) { // match/mismatch
|
||||
while (len > 0) {
|
||||
// match
|
||||
for (l = 0; l < len && qseq[qoff + l] == tseq[toff + l]; ++l) {}
|
||||
if (l > 0) p->cigar[m++] = l << 4 | 7;
|
||||
len -= l;
|
||||
toff += l, qoff += l;
|
||||
// mismatch
|
||||
for (l = 0; l < len && qseq[qoff + l] != tseq[toff + l]; ++l) {}
|
||||
if (l > 0) p->cigar[m++] = l << 4 | 8;
|
||||
len -= l;
|
||||
toff += l, qoff += l;
|
||||
}
|
||||
continue;
|
||||
} else if (op == 1) { // insertion
|
||||
qoff += len;
|
||||
} else if (op == 2) { // deletion
|
||||
toff += len;
|
||||
} else if (op == 3) { // intron
|
||||
toff += len;
|
||||
}
|
||||
p->cigar[m++] = r->p->cigar[k];
|
||||
}
|
||||
p->n_cigar = m;
|
||||
free(r->p);
|
||||
r->p = p;
|
||||
}
|
||||
|
||||
static void mm_align_pair(void *km, const mm_mapopt_t *opt, int qlen, const uint8_t *qseq, int tlen, const uint8_t *tseq, const int8_t *mat, int w, int end_bonus, int zdrop, int flag, ksw_extz_t *ez)
|
||||
{
|
||||
if (mm_dbg_flag & MM_DBG_PRINT_ALN_SEQ) {
|
||||
@@ -268,20 +341,30 @@ static inline void mm_adjust_minier(const mm_idx_t *mi, uint8_t *const qseq0[2],
|
||||
}
|
||||
}
|
||||
|
||||
static void mm_filter_bad_seeds(void *km, int as1, int cnt1, mm128_t *a, int min_gap, int diff_thres, int max_ext_len, int max_ext_cnt)
|
||||
static int *collect_long_gaps(void *km, int as1, int cnt1, mm128_t *a, int min_gap, int *n_)
|
||||
{
|
||||
int max_st, max_en, n, i, k, max, *K;
|
||||
int i, n, *K;
|
||||
*n_ = 0;
|
||||
for (i = 1, n = 0; i < cnt1; ++i) { // count the number of gaps longer than min_gap
|
||||
int gap = ((int32_t)a[as1 + i].y - a[as1 + i - 1].y) - ((int32_t)a[as1 + i].x - a[as1 + i - 1].x);
|
||||
if (gap < -min_gap || gap > min_gap) ++n;
|
||||
}
|
||||
if (n <= 1) return;
|
||||
if (n <= 1) return 0;
|
||||
K = (int*)kmalloc(km, n * sizeof(int));
|
||||
for (i = 1, n = 0; i < cnt1; ++i) { // store the positions of long gaps
|
||||
int gap = ((int32_t)a[as1 + i].y - a[as1 + i - 1].y) - ((int32_t)a[as1 + i].x - a[as1 + i - 1].x);
|
||||
if (gap < -min_gap || gap > min_gap)
|
||||
K[n++] = i;
|
||||
}
|
||||
*n_ = n;
|
||||
return K;
|
||||
}
|
||||
|
||||
static void mm_filter_bad_seeds(void *km, int as1, int cnt1, mm128_t *a, int min_gap, int diff_thres, int max_ext_len, int max_ext_cnt)
|
||||
{
|
||||
int max_st, max_en, n, i, k, max, *K;
|
||||
K = collect_long_gaps(km, as1, cnt1, a, min_gap, &n);
|
||||
if (K == 0) return;
|
||||
max = 0, max_st = max_en = -1;
|
||||
for (k = 0;; ++k) { // traverse long gaps
|
||||
int gap, l, n_ins = 0, n_del = 0, qs, rs, max_diff = 0, max_diff_l = -1;
|
||||
@@ -293,7 +376,7 @@ static void mm_filter_bad_seeds(void *km, int as1, int cnt1, mm128_t *a, int min
|
||||
if (k == n) break;
|
||||
}
|
||||
i = K[k];
|
||||
gap = ((int32_t)a[as1 + i].y - a[as1 + i - 1].y) - ((int32_t)a[as1 + i].x - a[as1 + i - 1].x);
|
||||
gap = ((int32_t)a[as1 + i].y - (int32_t)a[as1 + i - 1].y) - (int32_t)(a[as1 + i].x - a[as1 + i - 1].x);
|
||||
if (gap > 0) n_ins += gap;
|
||||
else n_del += -gap;
|
||||
qs = (int32_t)a[as1 + i - 1].y;
|
||||
@@ -301,7 +384,7 @@ static void mm_filter_bad_seeds(void *km, int as1, int cnt1, mm128_t *a, int min
|
||||
for (l = k + 1; l < n && l <= k + max_ext_cnt; ++l) {
|
||||
int j = K[l], diff;
|
||||
if ((int32_t)a[as1 + j].y - qs > max_ext_len || (int32_t)a[as1 + j].x - rs > max_ext_len) break;
|
||||
gap = ((int32_t)a[as1 + j].y - (int32_t)a[as1 + j - 1].y) - (a[as1 + j].x - a[as1 + j - 1].x);
|
||||
gap = ((int32_t)a[as1 + j].y - (int32_t)a[as1 + j - 1].y) - (int32_t)(a[as1 + j].x - a[as1 + j - 1].x);
|
||||
if (gap > 0) n_ins += gap;
|
||||
else n_del += -gap;
|
||||
diff = n_ins + n_del - abs(n_ins - n_del);
|
||||
@@ -314,6 +397,42 @@ static void mm_filter_bad_seeds(void *km, int as1, int cnt1, mm128_t *a, int min
|
||||
kfree(km, K);
|
||||
}
|
||||
|
||||
static void mm_filter_bad_seeds_alt(void *km, int as1, int cnt1, mm128_t *a, int min_gap, int max_ext)
|
||||
{
|
||||
int n, k, *K;
|
||||
K = collect_long_gaps(km, as1, cnt1, a, min_gap, &n);
|
||||
if (K == 0) return;
|
||||
for (k = 0; k < n;) {
|
||||
int i = K[k], l;
|
||||
int gap1 = ((int32_t)a[as1 + i].y - (int32_t)a[as1 + i - 1].y) - ((int32_t)a[as1 + i].x - (int32_t)a[as1 + i - 1].x);
|
||||
int re1 = (int32_t)a[as1 + i].x;
|
||||
int qe1 = (int32_t)a[as1 + i].y;
|
||||
gap1 = gap1 > 0? gap1 : -gap1;
|
||||
for (l = k + 1; l < n; ++l) {
|
||||
int j = K[l], gap2, q_span_pre, rs2, qs2, m;
|
||||
if ((int32_t)a[as1 + j].y - qe1 > max_ext || (int32_t)a[as1 + j].x - re1 > max_ext) break;
|
||||
gap2 = ((int32_t)a[as1 + j].y - (int32_t)a[as1 + j - 1].y) - (int32_t)(a[as1 + j].x - a[as1 + j - 1].x);
|
||||
q_span_pre = a[as1 + j - 1].y >> 32 & 0xff;
|
||||
rs2 = (int32_t)a[as1 + j - 1].x + q_span_pre;
|
||||
qs2 = (int32_t)a[as1 + j - 1].x + q_span_pre;
|
||||
m = rs2 - re1 < qs2 - qe1? rs2 - re1 : qs2 - qe1;
|
||||
gap2 = gap2 > 0? gap2 : -gap2;
|
||||
if (m > gap1 + gap2) break;
|
||||
re1 = (int32_t)a[as1 + j].x;
|
||||
qe1 = (int32_t)a[as1 + j].y;
|
||||
gap1 = gap2;
|
||||
}
|
||||
if (l > k + 1) {
|
||||
int j, end = K[l - 1];
|
||||
for (j = K[k]; j < end; ++j)
|
||||
a[as1 + j].y |= MM_SEED_IGNORE;
|
||||
a[as1 + end].y |= MM_SEED_LONG_JOIN;
|
||||
}
|
||||
k = l;
|
||||
}
|
||||
kfree(km, K);
|
||||
}
|
||||
|
||||
static void mm_fix_bad_ends(const mm_reg1_t *r, const mm128_t *a, int bw, int min_match, int32_t *as, int32_t *cnt)
|
||||
{
|
||||
int32_t i, l, m;
|
||||
@@ -350,7 +469,7 @@ static void mm_fix_bad_ends(const mm_reg1_t *r, const mm128_t *a, int bw, int mi
|
||||
}
|
||||
}
|
||||
|
||||
static void mm_max_stretch(const mm_mapopt_t *opt, const mm_reg1_t *r, const mm128_t *a, int32_t *as, int32_t *cnt)
|
||||
static void mm_max_stretch(const mm_reg1_t *r, const mm128_t *a, int32_t *as, int32_t *cnt)
|
||||
{
|
||||
int32_t i, score, max_score, len, max_i, max_len;
|
||||
|
||||
@@ -388,7 +507,7 @@ static int mm_seed_ext_score(void *km, const mm_mapopt_t *opt, const mm_idx_t *m
|
||||
qe = (uint32_t)a->y + 1, qs = qe - q_span;
|
||||
rs = rs - ext_len > 0? rs - ext_len : 0;
|
||||
qs = qs - ext_len > 0? qs - ext_len : 0;
|
||||
re = re + ext_len < mi->seq[rid].len? re + ext_len : mi->seq[rid].len;
|
||||
re = re + ext_len < (int32_t)mi->seq[rid].len? re + ext_len : mi->seq[rid].len;
|
||||
qe = qe + ext_len < qlen? qe + ext_len : qlen;
|
||||
tseq = (uint8_t*)kmalloc(km, re - rs);
|
||||
mm_idx_getseq(mi, rid, rs, re, tseq);
|
||||
@@ -434,11 +553,11 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
|
||||
|
||||
r2->cnt = 0;
|
||||
if (r->cnt == 0) return;
|
||||
ksw_gen_simple_mat(5, mat, opt->a, opt->b);
|
||||
ksw_gen_simple_mat(5, mat, opt->a, opt->b, opt->sc_ambi);
|
||||
bw = (int)(opt->bw * 1.5 + 1.);
|
||||
|
||||
if (is_sr && !(mi->flag & MM_I_HPC)) {
|
||||
mm_max_stretch(opt, r, a, &as1, &cnt1);
|
||||
mm_max_stretch(r, a, &as1, &cnt1);
|
||||
rs = (int32_t)a[as1].x + 1 - (int32_t)(a[as1].y>>32&0xff);
|
||||
qs = (int32_t)a[as1].y + 1 - (int32_t)(a[as1].y>>32&0xff);
|
||||
re = (int32_t)a[as1+cnt1-1].x + 1;
|
||||
@@ -450,6 +569,7 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
|
||||
mm_fix_bad_ends(r, a, opt->bw, opt->min_chain_score * 2, &as1, &cnt1);
|
||||
}
|
||||
mm_filter_bad_seeds(km, as1, cnt1, a, 10, 40, opt->max_gap>>1, 10);
|
||||
mm_filter_bad_seeds_alt(km, as1, cnt1, a, 30, opt->max_gap>>1);
|
||||
mm_adjust_minier(mi, qseq0, &a[as1], &rs, &qs);
|
||||
mm_adjust_minier(mi, qseq0, &a[as1 + cnt1 - 1], &re, &qe);
|
||||
}
|
||||
@@ -473,7 +593,7 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
|
||||
rs0 = rs - l > 0? rs - l : 0;
|
||||
l = qlen - qe;
|
||||
l += l * opt->a + opt->end_bonus > opt->q? (l * opt->a + opt->end_bonus - opt->q) / opt->e : 0;
|
||||
re0 = re + l < mi->seq[rid].len? re + l : mi->seq[rid].len;
|
||||
re0 = re + l < (int32_t)mi->seq[rid].len? re + l : mi->seq[rid].len;
|
||||
} else {
|
||||
// compute rs0 and qs0
|
||||
rs0 = (int32_t)a[r->as].x + 1 - (int32_t)(a[r->as].y>>32&0xff);
|
||||
@@ -517,13 +637,13 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
|
||||
}
|
||||
}
|
||||
}
|
||||
if (qe < qlen && re < mi->seq[rid].len) {
|
||||
if (qe < qlen && re < (int32_t)mi->seq[rid].len) {
|
||||
l = qlen - qe < opt->max_gap? qlen - qe : opt->max_gap;
|
||||
qe1 = qe1 < qe + l? qe1 : qe + l;
|
||||
qe0 = qe0 > qe1? qe0 : qe1; // at least include qe0
|
||||
l += l * opt->a > opt->q? (l * opt->a - opt->q) / opt->e : 0;
|
||||
l = l < opt->max_gap? l : opt->max_gap;
|
||||
l = l < mi->seq[rid].len - re? l : mi->seq[rid].len - re;
|
||||
l = l < (int32_t)mi->seq[rid].len - re? l : mi->seq[rid].len - re;
|
||||
re1 = re1 < re + l? re1 : re + l;
|
||||
re0 = re0 > re1? re0 : re1;
|
||||
} else re0 = re, qe0 = qe;
|
||||
@@ -628,6 +748,7 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
|
||||
if (r->p) {
|
||||
mm_idx_getseq(mi, rid, rs1, re1, tseq);
|
||||
mm_update_extra(r, &qseq0[r->rev][qs1], tseq, mat, opt->q, opt->e);
|
||||
if (opt->flag & MM_F_EQX) mm_update_cigar_eqx(r, &qseq0[r->rev][qs1], tseq);
|
||||
if (rev && r->p->trans_strand)
|
||||
r->p->trans_strand ^= 3; // flip to the read strand
|
||||
}
|
||||
@@ -652,7 +773,7 @@ static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, i
|
||||
if (ql < opt->min_chain_score || ql > opt->max_gap) return 0;
|
||||
if (tl < opt->min_chain_score || tl > opt->max_gap) return 0;
|
||||
|
||||
ksw_gen_simple_mat(5, mat, opt->a, opt->b);
|
||||
ksw_gen_simple_mat(5, mat, opt->a, opt->b, opt->sc_ambi);
|
||||
tseq = (uint8_t*)kmalloc(km, tl);
|
||||
mm_idx_getseq(mi, r1->rid, r1->re, r2->rs, tseq);
|
||||
qseq = r1->rev? &qseq0[0][r2->qe] : &qseq0[1][qlen - r2->qs];
|
||||
@@ -686,6 +807,7 @@ static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, i
|
||||
r_inv->rs = r1->re + t_off;
|
||||
r_inv->re = r_inv->rs + ez->max_t + 1;
|
||||
mm_update_extra(r_inv, &qseq[q_off], &tseq[t_off], mat, opt->q, opt->e);
|
||||
if (opt->flag & MM_F_EQX) mm_update_cigar_eqx(r_inv, &qseq[q_off], &tseq[t_off]);
|
||||
ret = 1;
|
||||
end_align1_inv:
|
||||
kfree(km, tseq);
|
||||
@@ -755,7 +877,7 @@ mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *m
|
||||
*n_regs_ = n_regs;
|
||||
kfree(km, qseq0[0]);
|
||||
kfree(km, ez.cigar);
|
||||
mm_filter_regs(km, opt, qlen, n_regs_, regs);
|
||||
mm_filter_regs(opt, qlen, n_regs_, regs);
|
||||
mm_hit_sort_by_dp(km, n_regs_, regs);
|
||||
return regs;
|
||||
}
|
||||
|
||||
@@ -62,19 +62,20 @@ static inline char *kstrdup(const kstring_t *s)
|
||||
return t;
|
||||
}
|
||||
|
||||
static inline void kseq2bseq(kseq_t *ks, mm_bseq1_t *s, int with_qual)
|
||||
static inline void kseq2bseq(kseq_t *ks, mm_bseq1_t *s, int with_qual, int with_comment)
|
||||
{
|
||||
int i;
|
||||
s->name = kstrdup(&ks->name);
|
||||
s->seq = kstrdup(&ks->seq);
|
||||
for (i = 0; i < ks->seq.l; ++i) // convert U to T
|
||||
for (i = 0; i < (int)ks->seq.l; ++i) // convert U to T
|
||||
if (s->seq[i] == 'u' || s->seq[i] == 'U')
|
||||
--s->seq[i];
|
||||
s->qual = with_qual && ks->qual.l? kstrdup(&ks->qual) : 0;
|
||||
s->comment = with_comment && ks->comment.l? kstrdup(&ks->comment) : 0;
|
||||
s->l_seq = ks->seq.l;
|
||||
}
|
||||
|
||||
mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int frag_mode, int *n_)
|
||||
mm_bseq1_t *mm_bseq_read3(mm_bseq_file_t *fp, int chunk_size, int with_qual, int with_comment, int frag_mode, int *n_)
|
||||
{
|
||||
int64_t size = 0;
|
||||
kvec_t(mm_bseq1_t) a = {0,0,0};
|
||||
@@ -91,12 +92,12 @@ mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int
|
||||
assert(ks->seq.l <= INT32_MAX);
|
||||
if (a.m == 0) kv_resize(mm_bseq1_t, 0, a, 256);
|
||||
kv_pushp(mm_bseq1_t, 0, a, &s);
|
||||
kseq2bseq(ks, s, with_qual);
|
||||
kseq2bseq(ks, s, with_qual, with_comment);
|
||||
size += s->l_seq;
|
||||
if (size >= chunk_size) {
|
||||
if (frag_mode && a.a[a.n-1].l_seq < CHECK_PAIR_THRES) {
|
||||
while (kseq_read(ks) >= 0) {
|
||||
kseq2bseq(ks, &fp->s, with_qual);
|
||||
kseq2bseq(ks, &fp->s, with_qual, with_comment);
|
||||
if (mm_qname_same(fp->s.name, a.a[a.n-1].name)) {
|
||||
kv_push(mm_bseq1_t, 0, a, fp->s);
|
||||
memset(&fp->s, 0, sizeof(mm_bseq1_t));
|
||||
@@ -110,12 +111,17 @@ mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int
|
||||
return a.a;
|
||||
}
|
||||
|
||||
mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int frag_mode, int *n_)
|
||||
{
|
||||
return mm_bseq_read3(fp, chunk_size, with_qual, 0, frag_mode, n_);
|
||||
}
|
||||
|
||||
mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int chunk_size, int with_qual, int *n_)
|
||||
{
|
||||
return mm_bseq_read2(fp, chunk_size, with_qual, 0, n_);
|
||||
}
|
||||
|
||||
mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int *n_)
|
||||
mm_bseq1_t *mm_bseq_read_frag2(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int with_comment, int *n_)
|
||||
{
|
||||
int i;
|
||||
int64_t size = 0;
|
||||
@@ -136,7 +142,7 @@ mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int
|
||||
for (i = 0; i < n_fp; ++i) {
|
||||
mm_bseq1_t *s;
|
||||
kv_pushp(mm_bseq1_t, 0, a, &s);
|
||||
kseq2bseq(fp[i]->ks, s, with_qual);
|
||||
kseq2bseq(fp[i]->ks, s, with_qual, with_comment);
|
||||
size += s->l_seq;
|
||||
}
|
||||
if (size >= chunk_size) break;
|
||||
@@ -145,6 +151,11 @@ mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int
|
||||
return a.a;
|
||||
}
|
||||
|
||||
mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int *n_)
|
||||
{
|
||||
return mm_bseq_read_frag2(n_fp, fp, chunk_size, with_qual, 0, n_);
|
||||
}
|
||||
|
||||
int mm_bseq_eof(mm_bseq_file_t *fp)
|
||||
{
|
||||
return (ks_eof(fp->ks->f) && fp->s.seq == 0);
|
||||
|
||||
@@ -13,13 +13,15 @@ typedef struct mm_bseq_file_s mm_bseq_file_t;
|
||||
|
||||
typedef struct {
|
||||
int l_seq, rid;
|
||||
char *name, *seq, *qual;
|
||||
char *name, *seq, *qual, *comment;
|
||||
} mm_bseq1_t;
|
||||
|
||||
mm_bseq_file_t *mm_bseq_open(const char *fn);
|
||||
void mm_bseq_close(mm_bseq_file_t *fp);
|
||||
mm_bseq1_t *mm_bseq_read3(mm_bseq_file_t *fp, int chunk_size, int with_qual, int with_comment, int frag_mode, int *n_);
|
||||
mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int frag_mode, int *n_);
|
||||
mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int chunk_size, int with_qual, int *n_);
|
||||
mm_bseq1_t *mm_bseq_read_frag2(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int with_comment, int *n_);
|
||||
mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int *n_);
|
||||
int mm_bseq_eof(mm_bseq_file_t *fp);
|
||||
|
||||
|
||||
@@ -44,7 +44,7 @@ mm128_t *mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int m
|
||||
int32_t qi = (int32_t)a[i].y, q_span = a[i].y>>32&0xff; // NB: only 8 bits of span is used!!!
|
||||
int32_t max_f = q_span, n_skip = 0, min_d;
|
||||
int32_t sidi = (a[i].y & MM_SEED_SEG_MASK) >> MM_SEED_SEG_SHIFT;
|
||||
while (st < i && ri - a[st].x > max_dist_x) ++st;
|
||||
while (st < i && ri > a[st].x + max_dist_x) ++st;
|
||||
for (j = i - 1; j >= st; --j) {
|
||||
int64_t dr = ri - a[j].x;
|
||||
int32_t dq = qi - (int32_t)a[j].y, dd, sc, log_dd;
|
||||
|
||||
+243
@@ -0,0 +1,243 @@
|
||||
## Table of Contents
|
||||
|
||||
- [Introduction & Installation](#intro)
|
||||
- [Mapping Genomic Reads](#map-reads)
|
||||
* [Mapping long reads](#map-pb)
|
||||
* [Mapping Illumina paired-end reads](#map-sr)
|
||||
* [Evaluating mapping accuracy with simulated reads (for developers)](#mapeval)
|
||||
- [Mapping Long RNA-seq Reads](#map-rna)
|
||||
* [Mapping Nanopore 2D cDNA reads](#map-ont-cdna-2d)
|
||||
* [Mapping Nanopore direct-RNA reads](#map-direct-rna)
|
||||
* [Mapping PacBio Iso-seq reads](#map-iso-seq)
|
||||
- [Full-Genome Alignment](#genome-aln)
|
||||
* [Intra-species assembly alignment](#asm-to-ref)
|
||||
* [Cross-species full-genome alignment](#x-species)
|
||||
* [Eyeballing alignment](#view-aln)
|
||||
* [Calling variants from assembly-to-reference alignment](#asm-var)
|
||||
* [Constructing self-homology map](#hom-map)
|
||||
* [Lift Over (for developers)](#liftover)
|
||||
- [Read Overlap](#read-overlap)
|
||||
* [Long-read overlap](#long-read-overlap)
|
||||
* [Evaluating overlap sensitivity (for developers)](#ov-eval)
|
||||
|
||||
## <a name="intro"></a>Introduction & Installation
|
||||
|
||||
This cookbook walks you through a variety of applications of minimap2 and its
|
||||
companion script `paftools.js`. All data here are freely available from the
|
||||
minimap2 release page at version tag [v2.11][v2.11]. Some examples only work
|
||||
with v2.11 or later.
|
||||
|
||||
To acquire the data used in this cookbook and to install minimap2 and paftools,
|
||||
please follow the command lines below:
|
||||
```sh
|
||||
# install minimap2 executables
|
||||
curl -L https://github.com/lh3/minimap2/releases/download/v2.11/minimap2-2.11_x64-linux.tar.bz2 | tar jxf -
|
||||
cp minimap2-2.11_x64-linux/{minimap2,k8,paftools.js} . # copy executables
|
||||
export PATH="$PATH:"`pwd` # put the current directory on PATH
|
||||
# download example datasets
|
||||
curl -L https://github.com/lh3/minimap2/releases/download/v2.11/cookbook-data.tgz | tar zxf -
|
||||
```
|
||||
|
||||
## <a name="map-reads"></a>Mapping Genomic Reads
|
||||
|
||||
### <a name="map-pb"></a>Mapping long reads
|
||||
```sh
|
||||
minimap2 -ax map-pb -t4 ecoli_ref.fa ecoli_p6_25x_canu.fa > mapped.sam
|
||||
```
|
||||
Alternatively, you can create a minimap2 index first and then map:
|
||||
```sh
|
||||
minimap2 -x map-pb -d ecoli-pb.mmi ecoli_ref.fa # create an index
|
||||
minimap2 -ax map-pb ecoli-pb.mmi ecoli_p6_25x_canu.fa > mapped.sam
|
||||
```
|
||||
This will save you a couple of minutes when you map against the human genome.
|
||||
**HOWEVER**, key algorithm parameters such as the k-mer length and window
|
||||
size can't be changed after indexing. Minimap2 will give you a warning if
|
||||
parameters used in a pre-built index doesn't match parameters on the command
|
||||
line. **Please always make sure you are using an intended pre-built index.**
|
||||
|
||||
### <a name="map-sr"></a>Mapping Illumina paired-end reads:
|
||||
```sh
|
||||
minimap2 -ax sr -t4 ecoli_ref.fa ecoli_mason_1.fq ecoli_mason_2.fq > mapped-sr.sam
|
||||
```
|
||||
|
||||
### <a name="mapeval"></a>Evaluating mapping accuracy with simulated reads (for developers)
|
||||
```sh
|
||||
minimap2 -ax sr ecoli_ref.fa ecoli_mason_1.fq ecoli_mason_2.fq | paftools.js mapeval -
|
||||
```
|
||||
The output is:
|
||||
```
|
||||
Q 60 19712 0 0.000000000 19712
|
||||
Q 0 282 219 0.010953286 19994
|
||||
U 6
|
||||
```
|
||||
where a `U`-line gives the number of unmapped reads (for SAM input only); a
|
||||
`Q`-line gives:
|
||||
|
||||
1. Mapping quality (mapQ) threshold
|
||||
2. Number of mapped reads between this threshold and the previous mapQ threshold.
|
||||
3. Number of wrong mappings in the same mapQ interval
|
||||
4. Accumulative mapping error rate
|
||||
5. Accumulative number of mappings
|
||||
|
||||
For `paftools.js mapeval` to work, you need to encode the true read positions
|
||||
in read names in the right format. For [PBSIM][pbsim] and [mason2][mason2], we
|
||||
provide scripts to generate the right format. Simulated reads in this cookbook
|
||||
were created with the following command lines:
|
||||
```sh
|
||||
# in PBSIM source code directory:
|
||||
src/pbsim ../ecoli_ref.fa --depth 1 --sample-fastq sample/sample.fastq
|
||||
paftools.js pbsim2fq ../ecoli_ref.fa.fai sd_0001.maf > ../ecoli_pbsim.fa
|
||||
|
||||
# mason2 simulation
|
||||
mason_simulator --illumina-prob-mismatch-scale 2.5 -ir ecoli_ref.fa -n 10000 -o tmp-l.fq -or tmp-r.fq -oa tmp.sam
|
||||
paftools.js mason2fq tmp.sam | seqtk seq -1 > ecoli_mason_1.fq
|
||||
paftools.js mason2fq tmp.sam | seqtk seq -2 > ecoli_mason_2.fq
|
||||
```
|
||||
|
||||
|
||||
|
||||
## <a name="map-rna"></a>Mapping Long RNA-seq Reads
|
||||
|
||||
### <a name="map-ont-cdna-2d"></a>Mapping Nanopore 2D cDNA reads
|
||||
```sh
|
||||
minimap2 -ax splice SIRV_E2.fa SIRV_ont-cdna.fa > aln.sam
|
||||
```
|
||||
You can compare the alignment to the true annotations with:
|
||||
```sh
|
||||
paftools.js junceval SIRV_E2C.gtf aln.sam
|
||||
```
|
||||
It gives the percentage of introns found in the annotation. For SIRV data, it
|
||||
is possible to achieve higher junction accuracy with
|
||||
```sh
|
||||
minimap2 -ax splice --splice-flank=no SIRV_E2.fa SIRV_ont-cdna.fa | paftools.js junceval SIRV_E2C.gtf
|
||||
```
|
||||
This is because minimap2 models one additional evolutionarily conserved base
|
||||
around a canonical junction, but SIRV doesn't honor this signal. Option
|
||||
`--splice-flank=no` asks minimap2 no to model this additional base.
|
||||
|
||||
In the output a tag `ts:A:+` indicates that the read strand is the same as the
|
||||
transcript strand; `ts:A:-` indicates the read strand is opposite to the
|
||||
transcript strand. This tag is inferred from the GT-AG signal and is thus only
|
||||
available to spliced reads.
|
||||
|
||||
### <a name="map-direct-rna"></a>Mapping Nanopore direct-RNA reads
|
||||
```sh
|
||||
minimap2 -ax splice -k14 -uf SIRV_E2.fa SIRV_ont-drna.fa > aln.sam
|
||||
```
|
||||
Direct-RNA reads are noisier, so we use a shorter k-mer for improved
|
||||
sensitivity. Here, option `-uf` forces minimap2 to map reads to the forward
|
||||
transcript strand only because direct-RNA reads are stranded. Again, applying
|
||||
`--splice-flank=no` helps junction accuracy for SIRV data.
|
||||
|
||||
### <a name="map-iso-seq"></a>Mapping PacBio Iso-seq reads
|
||||
```sh
|
||||
minimap2 -ax splice -uf -C5 SIRV_E2.fa SIRV_iso-seq.fq > aln.sam
|
||||
```
|
||||
Option `-C5` reduces the penalty on non-canonical splicing sites. It helps
|
||||
to align such sites correctly for data with low error rate such as Iso-seq
|
||||
reads and traditional cDNAs. On this example, minimap2 makes one junction
|
||||
error. Applying `--splice-flank=no` fixes this alignment error.
|
||||
|
||||
Note that the command line above is optimized for the final Iso-seq reads.
|
||||
PacBio's Iso-seq pipeline produces intermediate sequences at varying quality.
|
||||
For example, some intermediate reads are not stranded. For these reads, option
|
||||
`-uf` will lead to more errors. Please revise the minimap2 command line
|
||||
accordingly.
|
||||
|
||||
|
||||
|
||||
## <a name="genome-aln"></a>Full-Genome Alignment
|
||||
|
||||
### <a name="asm-to-ref"></a>Intra-species assembly alignment
|
||||
```sh
|
||||
# option "--cs" is recommended as paftools.js may need it
|
||||
minimap2 -cx asm5 --cs ecoli_ref.fa ecoli_canu.fa > ecoli_canu.paf
|
||||
```
|
||||
Here `ecoli_canu.fa` is the Canu assembly of `ecoli_p6_25x_canu.fa`. This
|
||||
command line outputs alignments in the [PAF format][paf]. Use `-a` instead of
|
||||
`-c` to get output in the SAM format.
|
||||
|
||||
### <a name="x-species"></a>Cross-species full-genome alignment
|
||||
```sh
|
||||
minimap2 -cx asm20 --cs ecoli_ref.fa ecoli_O104:H4.fa > ecoli_O104:H4.paf
|
||||
sort -k6,6 -k8,8n ecoli_O104:H4.paf | paftools.js call -f ecoli_ref.fa -L10000 -l1000 - > out.vcf
|
||||
```
|
||||
Minimap2 has three presets for full-genome alignment: "asm5" for sequence
|
||||
divergence below 1%, "asm10" for divergence around a couple of percent and
|
||||
"asm20" for divergence not more than 10%. In theory, with the right setting,
|
||||
minimap2 should work for sequence pairs with sequence divergence up to ~15%,
|
||||
but this has not been carefully evaluated.
|
||||
|
||||
### <a name="view-aln"></a>Eyeballing alignment
|
||||
```sh
|
||||
# option "--cs" required; minimap2-r741 or higher required for the "asm20" preset
|
||||
minimap2 -cx asm20 --cs ecoli_ref.fa ecoli_O104:H4.fa | paftools.js view - | less -S
|
||||
```
|
||||
This prints the alignment in a BLAST-like format.
|
||||
|
||||
### <a name="asm-var"></a>Calling variants from assembly-to-reference alignment
|
||||
```sh
|
||||
# don't forget the "--cs" option; otherwise it doesn't work
|
||||
minimap2 -cx asm5 --cs ecoli_ref.fa ecoli_canu.fa \
|
||||
| sort -k6,6 -k8,8n \
|
||||
| paftools.js call -f ecoli_ref.fa - > out.vcf
|
||||
```
|
||||
Without option `-f`, `paftools.js call` outputs in a custom format. In this
|
||||
format, lines starting with `R` give the regions covered by one contig only.
|
||||
This information is not available in the VCF output.
|
||||
|
||||
### <a name="hom-map"></a>Constructing self-homology map
|
||||
```sh
|
||||
minimap2 -DP -k19 -w19 -m200 ecoli_ref.fa ecoli_ref.fa > out.paf
|
||||
```
|
||||
Option `-D` asks minimap2 to ignore anchors from perfect self match and `-P`
|
||||
outputs all chains. For large nomes, we don't recommend to perform base-level
|
||||
alignment (with `-c`, `-a` or `--cs`) when `-P` is applied. This is because
|
||||
base-alignment is slow and occasionally gives wrong alignments close to the
|
||||
diagonal of a dotter plot. For E. coli, though, base-alignment is still fast.
|
||||
|
||||
### <a name="liftover"></a>Lift over (for developers)
|
||||
```sh
|
||||
minimap2 -cx asm5 --cs ecoli_ref.fa ecoli_canu.fa > ecoli_canu.paf
|
||||
echo -e 'tig00000001\t200000\t300000' | paftools.js liftover ecoli_canu.paf -
|
||||
```
|
||||
This lifts over a region on query sequences to one or multiple regions on
|
||||
reference sequences. Note that this paftools.js command may not be efficient
|
||||
enough to lift millions of regions.
|
||||
|
||||
|
||||
|
||||
## <a name="read-overlap"></a>Read Overlap
|
||||
|
||||
### <a name="long-read-overlap"></a>Long read overlap
|
||||
```sh
|
||||
# For pacbio reads:
|
||||
minimap2 -x ava-pb ecoli_p6_25x_canu.fa ecoli_p6_25x_canu.fa > overlap.paf
|
||||
# For Nanopore reads (ava-ont also works with PacBio but not as good):
|
||||
minimap2 -x ava-ont -r 10000 ecoli_p6_25x_canu.fa ecoli_p6_25x_canu.fa > overlap.paf
|
||||
# If you have miniasm installed:
|
||||
miniasm -f ecoli_p6_25x_canu.fa overlap.paf > asm.gfa
|
||||
```
|
||||
Here we explicitly applied `-r 10000`. We are considering to set this as the
|
||||
default for the `ava-ont` mode as this seems to improve the contiguity for
|
||||
nanopore read assembly (Loman, personal communication).
|
||||
|
||||
*Minimap2 doesn't work well with short-read overlap.*
|
||||
|
||||
### <a name="ov-eval"></a>Evaluating overlap sensitivity (for developers)
|
||||
|
||||
```sh
|
||||
# read to reference mapping
|
||||
minimap2 -cx map-pb ecoli_ref.fa ecoli_p6_25x_canu.fa > to-ref.paf
|
||||
# evaluate overlap sensitivity
|
||||
sort -k6,6 -k8,8n to-ref.paf | paftools.js ov-eval - overlap.paf
|
||||
```
|
||||
You can see that for PacBio reads, minimap2 achieves higher overlap sensitivity
|
||||
with `-x ava-pb` (99% vs 93% with `-x ava-ont`).
|
||||
|
||||
|
||||
|
||||
[pbsim]: https://github.com/pfaucon/PBSIM-PacBio-Simulator
|
||||
[mason2]: https://github.com/seqan/seqan/tree/master/apps/mason2
|
||||
[paf]: https://github.com/lh3/miniasm/blob/master/PAF.md
|
||||
[v2.11]: https://github.com/lh3/minimap2/releases/tag/v2.11
|
||||
@@ -118,7 +118,7 @@ void mm_write_sam_hdr(const mm_idx_t *idx, const char *rg, const char *ver, int
|
||||
if (idx) {
|
||||
uint32_t i;
|
||||
for (i = 0; i < idx->n_seq; ++i)
|
||||
printf("@SQ\tSN:%s\tLN:%d\n", idx->seq[i].name, idx->seq[i].len);
|
||||
mm_sprintf_lite(&str, "@SQ\tSN:%s\tLN:%d\n", idx->seq[i].name, idx->seq[i].len);
|
||||
}
|
||||
if (rg) sam_write_rg_line(&str, rg);
|
||||
mm_sprintf_lite(&str, "@PG\tID:minimap2\tPN:minimap2");
|
||||
@@ -129,36 +129,18 @@ void mm_write_sam_hdr(const mm_idx_t *idx, const char *rg, const char *ver, int
|
||||
for (i = 1; i < argc; ++i)
|
||||
mm_sprintf_lite(&str, " %s", argv[i]);
|
||||
}
|
||||
mm_sprintf_lite(&str, "\n");
|
||||
fputs(str.s, stdout);
|
||||
mm_err_puts(str.s);
|
||||
free(str.s);
|
||||
}
|
||||
|
||||
static void write_cs(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int no_iden)
|
||||
static void write_cs_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq, const mm_reg1_t *r, char *tmp, int no_iden)
|
||||
{
|
||||
extern unsigned char seq_nt4_table[256];
|
||||
int i, q_off, t_off;
|
||||
uint8_t *qseq, *tseq;
|
||||
char *tmp;
|
||||
if (r->p == 0) return;
|
||||
mm_sprintf_lite(s, "\tcs:Z:");
|
||||
qseq = (uint8_t*)kmalloc(km, r->qe - r->qs);
|
||||
tseq = (uint8_t*)kmalloc(km, r->re - r->rs);
|
||||
tmp = (char*)kmalloc(km, r->re - r->rs > r->qe - r->qs? r->re - r->rs + 1 : r->qe - r->qs + 1);
|
||||
mm_idx_getseq(mi, r->rid, r->rs, r->re, tseq);
|
||||
if (!r->rev) {
|
||||
for (i = r->qs; i < r->qe; ++i)
|
||||
qseq[i - r->qs] = seq_nt4_table[(uint8_t)t->seq[i]];
|
||||
} else {
|
||||
for (i = r->qs; i < r->qe; ++i) {
|
||||
uint8_t c = seq_nt4_table[(uint8_t)t->seq[i]];
|
||||
qseq[r->qe - i - 1] = c >= 4? 4 : 3 - c;
|
||||
}
|
||||
}
|
||||
for (i = q_off = t_off = 0; i < r->p->n_cigar; ++i) {
|
||||
for (i = q_off = t_off = 0; i < (int)r->p->n_cigar; ++i) {
|
||||
int j, op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
|
||||
assert(op >= 0 && op <= 3);
|
||||
if (op == 0) {
|
||||
if (op == 0) { // match
|
||||
int l_tmp = 0;
|
||||
for (j = 0; j < len; ++j) {
|
||||
if (qseq[q_off + j] != tseq[t_off + j]) {
|
||||
@@ -179,17 +161,17 @@ static void write_cs(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_
|
||||
} else mm_sprintf_lite(s, ":%d", l_tmp);
|
||||
}
|
||||
q_off += len, t_off += len;
|
||||
} else if (op == 1) {
|
||||
} else if (op == 1) { // insertion to ref
|
||||
for (j = 0, tmp[len] = 0; j < len; ++j)
|
||||
tmp[j] = "acgtn"[qseq[q_off + j]];
|
||||
mm_sprintf_lite(s, "+%s", tmp);
|
||||
q_off += len;
|
||||
} else if (op == 2) {
|
||||
} else if (op == 2) { // deletion from ref
|
||||
for (j = 0, tmp[len] = 0; j < len; ++j)
|
||||
tmp[j] = "acgtn"[tseq[t_off + j]];
|
||||
mm_sprintf_lite(s, "-%s", tmp);
|
||||
t_off += len;
|
||||
} else {
|
||||
} else { // intron
|
||||
assert(len >= 2);
|
||||
mm_sprintf_lite(s, "~%c%c%d%c%c", "acgtn"[tseq[t_off]], "acgtn"[tseq[t_off+1]],
|
||||
len, "acgtn"[tseq[t_off+len-2]], "acgtn"[tseq[t_off+len-1]]);
|
||||
@@ -197,6 +179,59 @@ static void write_cs(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_
|
||||
}
|
||||
}
|
||||
assert(t_off == r->re - r->rs && q_off == r->qe - r->qs);
|
||||
}
|
||||
|
||||
static void write_MD_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq, const mm_reg1_t *r, char *tmp)
|
||||
{
|
||||
int i, q_off, t_off, l_MD = 0;
|
||||
mm_sprintf_lite(s, "\tMD:Z:");
|
||||
for (i = q_off = t_off = 0; i < (int)r->p->n_cigar; ++i) {
|
||||
int j, op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
|
||||
assert(op >= 0 && op <= 2); // introns (aka reference skips) are not supported
|
||||
if (op == 0) { // match
|
||||
for (j = 0; j < len; ++j) {
|
||||
if (qseq[q_off + j] != tseq[t_off + j]) {
|
||||
mm_sprintf_lite(s, "%d%c", l_MD, "ACGTN"[tseq[t_off + j]]);
|
||||
l_MD = 0;
|
||||
} else ++l_MD;
|
||||
}
|
||||
q_off += len, t_off += len;
|
||||
} else if (op == 1) { // insertion to ref
|
||||
q_off += len;
|
||||
} else if (op == 2) { // deletion from ref
|
||||
for (j = 0, tmp[len] = 0; j < len; ++j)
|
||||
tmp[j] = "ACGTN"[tseq[t_off + j]];
|
||||
mm_sprintf_lite(s, "%d^%s", l_MD, tmp);
|
||||
l_MD = 0;
|
||||
t_off += len;
|
||||
}
|
||||
}
|
||||
if (l_MD > 0) mm_sprintf_lite(s, "%d", l_MD);
|
||||
assert(t_off == r->re - r->rs && q_off == r->qe - r->qs);
|
||||
}
|
||||
|
||||
static void write_cs_or_MD(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int no_iden, int is_MD)
|
||||
{
|
||||
extern unsigned char seq_nt4_table[256];
|
||||
int i;
|
||||
uint8_t *qseq, *tseq;
|
||||
char *tmp;
|
||||
if (r->p == 0) return;
|
||||
qseq = (uint8_t*)kmalloc(km, r->qe - r->qs);
|
||||
tseq = (uint8_t*)kmalloc(km, r->re - r->rs);
|
||||
tmp = (char*)kmalloc(km, r->re - r->rs > r->qe - r->qs? r->re - r->rs + 1 : r->qe - r->qs + 1);
|
||||
mm_idx_getseq(mi, r->rid, r->rs, r->re, tseq);
|
||||
if (!r->rev) {
|
||||
for (i = r->qs; i < r->qe; ++i)
|
||||
qseq[i - r->qs] = seq_nt4_table[(uint8_t)t->seq[i]];
|
||||
} else {
|
||||
for (i = r->qs; i < r->qe; ++i) {
|
||||
uint8_t c = seq_nt4_table[(uint8_t)t->seq[i]];
|
||||
qseq[r->qe - i - 1] = c >= 4? 4 : 3 - c;
|
||||
}
|
||||
}
|
||||
if (is_MD) write_MD_core(s, tseq, qseq, r, tmp);
|
||||
else write_cs_core(s, tseq, qseq, r, tmp, no_iden);
|
||||
kfree(km, qseq); kfree(km, tseq); kfree(km, tmp);
|
||||
}
|
||||
|
||||
@@ -235,10 +270,12 @@ void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const m
|
||||
uint32_t k;
|
||||
mm_sprintf_lite(s, "\tcg:Z:");
|
||||
for (k = 0; k < r->p->n_cigar; ++k)
|
||||
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDN"[r->p->cigar[k]&0xf]);
|
||||
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDNSHP=XB"[r->p->cigar[k]&0xf]);
|
||||
}
|
||||
if (r->p && (opt_flag & MM_F_OUT_CS))
|
||||
write_cs(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG));
|
||||
if (r->p && (opt_flag & (MM_F_OUT_CS|MM_F_OUT_MD)))
|
||||
write_cs_or_MD(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG), opt_flag&MM_F_OUT_MD);
|
||||
if ((opt_flag & MM_F_COPY_COMMENT) && t->comment)
|
||||
mm_sprintf_lite(s, "\t%s", t->comment);
|
||||
}
|
||||
|
||||
static void sam_write_sq(kstring_t *s, char *seq, int l, int rev, int comp)
|
||||
@@ -284,7 +321,7 @@ static void write_sam_cigar(kstring_t *s, int sam_flag, int in_tag, int qlen, co
|
||||
int clip_char = (sam_flag&0x800) && !(opt_flag&MM_F_SOFTCLIP)? 'H' : 'S';
|
||||
if (clip_len[0]) mm_sprintf_lite(s, "%d%c", clip_len[0], clip_char);
|
||||
for (k = 0; k < r->p->n_cigar; ++k)
|
||||
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDN"[r->p->cigar[k]&0xf]);
|
||||
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDNSHP=XB"[r->p->cigar[k]&0xf]);
|
||||
if (clip_len[1]) mm_sprintf_lite(s, "%d%c", clip_len[1], clip_char);
|
||||
}
|
||||
}
|
||||
@@ -434,12 +471,15 @@ void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
|
||||
}
|
||||
}
|
||||
}
|
||||
if (r->p && (opt_flag & MM_F_OUT_CS))
|
||||
write_cs(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG));
|
||||
if (r->p && (opt_flag & (MM_F_OUT_CS|MM_F_OUT_MD)))
|
||||
write_cs_or_MD(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG), opt_flag&MM_F_OUT_MD);
|
||||
if (cigar_in_tag)
|
||||
write_sam_cigar(s, flag, 1, t->l_seq, r, opt_flag);
|
||||
}
|
||||
|
||||
if ((opt_flag & MM_F_COPY_COMMENT) && t->comment)
|
||||
mm_sprintf_lite(s, "\t%s", t->comment);
|
||||
|
||||
s->s[s->l] = 0; // we always have room for an extra byte (see str_enlarge)
|
||||
}
|
||||
|
||||
|
||||
@@ -132,7 +132,7 @@ void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r, int sub_diff
|
||||
int j, x = si;
|
||||
radix_sort_64(cov, cov + n_cov);
|
||||
for (j = 0; j < n_cov; ++j) {
|
||||
if (cov[j]>>32 > x) uncov_len += (cov[j]>>32) - x;
|
||||
if ((int)(cov[j]>>32) > x) uncov_len += (cov[j]>>32) - x;
|
||||
x = (int32_t)cov[j] > x? (int32_t)cov[j] : x;
|
||||
}
|
||||
if (ei > x) uncov_len += ei - x;
|
||||
@@ -143,7 +143,7 @@ void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r, int sub_diff
|
||||
if (ej <= si || sj >= ei) continue; // no overlap
|
||||
min = ej - sj < ei - si? ej - sj : ei - si;
|
||||
max = ej - sj > ei - si? ej - sj : ei - si;
|
||||
ol = si < sj? (ei < sj? 0 : ei < ej? ei - sj : ej - sj) : (ej < si? 0 : ej < ei? ej - si : ei - si); // overlap length
|
||||
ol = si < sj? (ei < sj? 0 : ei < ej? ei - sj : ej - sj) : (ej < si? 0 : ej < ei? ej - si : ei - si); // overlap length; TODO: this can be simplified
|
||||
if ((float)ol / min - (float)uncov_len / max > mask_level) {
|
||||
int cnt_sub = 0;
|
||||
ri->parent = rp->parent;
|
||||
@@ -246,7 +246,7 @@ void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int *n_,
|
||||
}
|
||||
}
|
||||
|
||||
void mm_filter_regs(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs)
|
||||
void mm_filter_regs(const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs)
|
||||
{ // NB: after this call, mm_reg1_t::parent can be -1 if its parent filtered out
|
||||
int i, k;
|
||||
for (i = k = 0; i < *n_regs; ++i) {
|
||||
@@ -304,7 +304,7 @@ void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs_, mm_r
|
||||
for (i = n_aux - 1; i >= 1; --i) {
|
||||
mm_reg1_t *r0 = ®s[(int32_t)aux[i-1]], *r1 = ®s[(int32_t)aux[i]];
|
||||
mm128_t *a0e, *a1s;
|
||||
int max_gap, min_gap, sc_thres;
|
||||
int max_gap, min_gap, sc_thres, min_flank_len;
|
||||
|
||||
// test
|
||||
if (r0->as + r0->cnt != r1->as) continue; // not adjacent in a[]
|
||||
@@ -313,13 +313,14 @@ void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs_, mm_r
|
||||
a1s = &a[r1->as];
|
||||
if (a1s->x <= a0e->x || (int32_t)a1s->y <= (int32_t)a0e->y) continue; // keep colinearity
|
||||
max_gap = min_gap = (int32_t)a1s->y - (int32_t)a0e->y;
|
||||
max_gap = max_gap > a1s->x - a0e->x? max_gap : a1s->x - a0e->x;
|
||||
min_gap = min_gap < a1s->x - a0e->x? min_gap : a1s->x - a0e->x;
|
||||
max_gap = a0e->x + max_gap > a1s->x? max_gap : a1s->x - a0e->x;
|
||||
min_gap = a0e->x + min_gap < a1s->x? min_gap : a1s->x - a0e->x;
|
||||
if (max_gap > opt->max_join_long || min_gap > opt->max_join_short) continue;
|
||||
sc_thres = (int)((float)opt->min_join_flank_sc / opt->max_join_long * max_gap + .499);
|
||||
if (r0->score < sc_thres || r1->score < sc_thres) continue; // require good flanking chains
|
||||
if (r0->re - r0->rs < max_gap>>1 || r0->qe - r0->qs < max_gap>>1) continue; // require enough flanking length
|
||||
if (r1->re - r1->rs < max_gap>>1 || r1->qe - r1->qs < max_gap>>1) continue;
|
||||
min_flank_len = (int)(max_gap * opt->min_join_flank_ratio);
|
||||
if (r0->re - r0->rs < min_flank_len || r0->qe - r0->qs < min_flank_len) continue; // require enough flanking length
|
||||
if (r1->re - r1->rs < min_flank_len || r1->qe - r1->qs < min_flank_len) continue;
|
||||
|
||||
// all conditions satisfied; join
|
||||
a[r1->as].y |= MM_SEED_LONG_JOIN;
|
||||
@@ -339,7 +340,7 @@ void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs_, mm_r
|
||||
r->parent = regs[r->parent].parent;
|
||||
}
|
||||
}
|
||||
mm_filter_regs(km, opt, qlen, n_regs_, regs);
|
||||
mm_filter_regs(opt, qlen, n_regs_, regs);
|
||||
mm_sync_regs(km, *n_regs_, regs);
|
||||
}
|
||||
}
|
||||
@@ -411,23 +412,23 @@ void mm_seg_free(void *km, int n_segs, mm_seg_t *segs)
|
||||
static void mm_set_inv_mapq(void *km, int n_regs, mm_reg1_t *regs)
|
||||
{
|
||||
int i, n_aux;
|
||||
uint64_t *aux;
|
||||
mm128_t *aux;
|
||||
if (n_regs < 3) return;
|
||||
for (i = 0; i < n_regs; ++i)
|
||||
if (regs[i].inv) break;
|
||||
if (i == n_regs) return; // no inversion hits
|
||||
|
||||
aux = (uint64_t*)kmalloc(km, n_regs * 8);
|
||||
aux = (mm128_t*)kmalloc(km, n_regs * 16);
|
||||
for (i = n_aux = 0; i < n_regs; ++i)
|
||||
if (regs[i].parent == i || regs[i].parent < 0)
|
||||
aux[n_aux++] = (uint64_t)regs[i].as << 32 | i;
|
||||
radix_sort_64(aux, aux + n_aux);
|
||||
aux[n_aux].y = i, aux[n_aux++].x = (uint64_t)regs[i].rid << 32 | regs[i].rs;
|
||||
radix_sort_128x(aux, aux + n_aux);
|
||||
|
||||
for (i = 1; i < n_aux - 1; ++i) {
|
||||
mm_reg1_t *inv = ®s[(int32_t)aux[i]];
|
||||
mm_reg1_t *inv = ®s[aux[i].y];
|
||||
if (inv->inv) {
|
||||
mm_reg1_t *l = ®s[(int32_t)aux[i-1]];
|
||||
mm_reg1_t *r = ®s[(int32_t)aux[i+1]];
|
||||
mm_reg1_t *l = ®s[aux[i-1].y];
|
||||
mm_reg1_t *r = ®s[aux[i+1].y];
|
||||
inv->mapq = l->mapq < r->mapq? l->mapq : r->mapq;
|
||||
}
|
||||
}
|
||||
|
||||
@@ -45,10 +45,10 @@ mm_idx_t *mm_idx_init(int w, int k, int b, int flag)
|
||||
|
||||
void mm_idx_destroy(mm_idx_t *mi)
|
||||
{
|
||||
int i;
|
||||
uint32_t i;
|
||||
if (mi == 0) return;
|
||||
if (mi->h) kh_destroy(str, (khash_t(str)*)mi->h);
|
||||
for (i = 0; i < 1<<mi->b; ++i) {
|
||||
for (i = 0; i < 1U<<mi->b; ++i) {
|
||||
free(mi->B[i].p);
|
||||
free(mi->B[i].a.a);
|
||||
kh_destroy(idx, (idxhash_t*)mi->B[i].h);
|
||||
@@ -82,14 +82,15 @@ const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n)
|
||||
|
||||
void mm_idx_stat(const mm_idx_t *mi)
|
||||
{
|
||||
int i, n = 0, n1 = 0;
|
||||
int n = 0, n1 = 0;
|
||||
uint32_t i;
|
||||
uint64_t sum = 0, len = 0;
|
||||
fprintf(stderr, "[M::%s] kmer size: %d; skip: %d; is_hpc: %d; #seq: %d\n", __func__, mi->k, mi->w, mi->flag&MM_I_HPC, mi->n_seq);
|
||||
for (i = 0; i < mi->n_seq; ++i)
|
||||
len += mi->seq[i].len;
|
||||
for (i = 0; i < 1<<mi->b; ++i)
|
||||
for (i = 0; i < 1U<<mi->b; ++i)
|
||||
if (mi->B[i].h) n += kh_size((idxhash_t*)mi->B[i].h);
|
||||
for (i = 0; i < 1<<mi->b; ++i) {
|
||||
for (i = 0; i < 1U<<mi->b; ++i) {
|
||||
idxhash_t *h = (idxhash_t*)mi->B[i].h;
|
||||
khint_t k;
|
||||
if (h == 0) continue;
|
||||
@@ -172,7 +173,8 @@ int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f)
|
||||
|
||||
static void worker_post(void *g, long i, int tid)
|
||||
{
|
||||
int j, start_a, start_p, n, n_keys;
|
||||
int n, n_keys;
|
||||
size_t j, start_a, start_p;
|
||||
idxhash_t *h;
|
||||
mm_idx_t *mi = (mm_idx_t*)g;
|
||||
mm_idx_bucket_t *b = &mi->B[i];
|
||||
@@ -200,7 +202,7 @@ static void worker_post(void *g, long i, int tid)
|
||||
int absent;
|
||||
mm128_t *p = &b->a.a[j-1];
|
||||
itr = kh_put(idx, h, p->x>>8>>mi->b<<1, &absent);
|
||||
assert(absent && j - start_a == n);
|
||||
assert(absent && j == start_a + n);
|
||||
if (n == 1) {
|
||||
kh_key(h, itr) |= 1;
|
||||
kh_val(h, itr) = p->y;
|
||||
@@ -216,7 +218,7 @@ static void worker_post(void *g, long i, int tid)
|
||||
} else ++n;
|
||||
}
|
||||
b->h = h;
|
||||
assert(b->n == start_p);
|
||||
assert(b->n == (int32_t)start_p);
|
||||
|
||||
// deallocate and clear b->a
|
||||
kfree(0, b->a.a);
|
||||
@@ -336,7 +338,7 @@ mm_idx_t *mm_idx_gen(mm_bseq_file_t *fp, int w, int k, int b, int flag, int mini
|
||||
pipeline_t pl;
|
||||
if (fp == 0 || mm_bseq_eof(fp)) return 0;
|
||||
memset(&pl, 0, sizeof(pipeline_t));
|
||||
pl.mini_batch_size = mini_batch_size < batch_size? mini_batch_size : batch_size;
|
||||
pl.mini_batch_size = (uint64_t)mini_batch_size < batch_size? mini_batch_size : batch_size;
|
||||
pl.batch_size = batch_size;
|
||||
pl.fp = fp;
|
||||
pl.mi = mm_idx_init(w, k, b, flag);
|
||||
@@ -413,17 +415,20 @@ mm_idx_t *mm_idx_str(int w, int k, int is_hpc, int bucket_bits, int n, const cha
|
||||
void mm_idx_dump(FILE *fp, const mm_idx_t *mi)
|
||||
{
|
||||
uint64_t sum_len = 0;
|
||||
uint32_t x[5];
|
||||
int i;
|
||||
uint32_t x[5], i;
|
||||
|
||||
x[0] = mi->w, x[1] = mi->k, x[2] = mi->b, x[3] = mi->n_seq, x[4] = mi->flag;
|
||||
fwrite(MM_IDX_MAGIC, 1, 4, fp);
|
||||
fwrite(x, 4, 5, fp);
|
||||
for (i = 0; i < mi->n_seq; ++i) {
|
||||
uint8_t l;
|
||||
l = strlen(mi->seq[i].name);
|
||||
fwrite(&l, 1, 1, fp);
|
||||
fwrite(mi->seq[i].name, 1, l, fp);
|
||||
if (mi->seq[i].name) {
|
||||
uint8_t l = strlen(mi->seq[i].name);
|
||||
fwrite(&l, 1, 1, fp);
|
||||
fwrite(mi->seq[i].name, 1, l, fp);
|
||||
} else {
|
||||
uint8_t l = 0;
|
||||
fwrite(&l, 1, 1, fp);
|
||||
}
|
||||
fwrite(&mi->seq[i].len, 4, 1, fp);
|
||||
sum_len += mi->seq[i].len;
|
||||
}
|
||||
@@ -450,9 +455,8 @@ void mm_idx_dump(FILE *fp, const mm_idx_t *mi)
|
||||
|
||||
mm_idx_t *mm_idx_load(FILE *fp)
|
||||
{
|
||||
int i;
|
||||
char magic[4];
|
||||
uint32_t x[5];
|
||||
uint32_t x[5], i;
|
||||
uint64_t sum_len = 0;
|
||||
mm_idx_t *mi;
|
||||
|
||||
@@ -466,9 +470,11 @@ mm_idx_t *mm_idx_load(FILE *fp)
|
||||
uint8_t l;
|
||||
mm_idx_seq_t *s = &mi->seq[i];
|
||||
fread(&l, 1, 1, fp);
|
||||
s->name = (char*)kmalloc(mi->km, l + 1);
|
||||
fread(s->name, 1, l, fp);
|
||||
s->name[l] = 0;
|
||||
if (l) {
|
||||
s->name = (char*)kmalloc(mi->km, l + 1);
|
||||
fread(s->name, 1, l, fp);
|
||||
s->name[l] = 0;
|
||||
}
|
||||
fread(&s->len, 4, 1, fp);
|
||||
s->offset = sum_len;
|
||||
sum_len += s->len;
|
||||
|
||||
@@ -127,11 +127,11 @@ static inline void ksw_backtrack(void *km, int is_rot, int is_rev, int min_intro
|
||||
r = i + j;
|
||||
if (i < off[r]) force_state = 2;
|
||||
if (off_end && i > off_end[r]) force_state = 1;
|
||||
tmp = force_state < 0? p[r * n_col + i - off[r]] : 0;
|
||||
tmp = force_state < 0? p[(size_t)r * n_col + i - off[r]] : 0;
|
||||
} else {
|
||||
if (j < off[i]) force_state = 2;
|
||||
if (off_end && j > off_end[i]) force_state = 1;
|
||||
tmp = force_state < 0? p[i * n_col + j - off[i]] : 0;
|
||||
tmp = force_state < 0? p[(size_t)i * n_col + j - off[i]] : 0;
|
||||
}
|
||||
if (state == 0) state = tmp & 7; // if requesting the H state, find state one maximizes it.
|
||||
else if (!(tmp >> (state + 2) & 1)) state = 0; // if requesting other states, _state_ stays the same if it is a continuation; otherwise, set to H
|
||||
|
||||
+5
-5
@@ -76,7 +76,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
qe2_ = _mm_set1_epi8(q2 + e2);
|
||||
sc_mch_ = _mm_set1_epi8(mat[0]);
|
||||
sc_mis_ = _mm_set1_epi8(mat[1]);
|
||||
sc_N_ = _mm_set1_epi8(-e2);
|
||||
sc_N_ = mat[m*m-1] == 0? _mm_set1_epi8(-e2) : _mm_set1_epi8(mat[m*m-1]);
|
||||
m1_ = _mm_set1_epi8(m - 1); // wildcard
|
||||
|
||||
if (w < 0) w = tlen > qlen? tlen : qlen;
|
||||
@@ -111,7 +111,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
for (t = 0; t < tlen_ * 16; ++t) H[t] = KSW_NEG_INF;
|
||||
}
|
||||
if (with_cigar) {
|
||||
mem2 = (uint8_t*)kmalloc(km, ((qlen + tlen - 1) * n_col_ + 1) * 16);
|
||||
mem2 = (uint8_t*)kmalloc(km, ((size_t)(qlen + tlen - 1) * n_col_ + 1) * 16);
|
||||
p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4);
|
||||
off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int) * 2);
|
||||
off_end = off + qlen + tlen - 1;
|
||||
@@ -218,7 +218,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
#endif
|
||||
}
|
||||
} else if (!(flag&KSW_EZ_RIGHT)) { // gap left-alignment
|
||||
__m128i *pr = p + r * n_col_ - st_;
|
||||
__m128i *pr = p + (size_t)r * n_col_ - st_;
|
||||
off[r] = st, off_end[r] = en;
|
||||
for (t = st_; t <= en_; ++t) {
|
||||
__m128i d, z, a, b, a2, b2, xt1, x2t1, vt1, ut, tmp;
|
||||
@@ -265,7 +265,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
_mm_store_si128(&pr[t], d);
|
||||
}
|
||||
} else { // gap right-alignment
|
||||
__m128i *pr = p + r * n_col_ - st_;
|
||||
__m128i *pr = p + (size_t)r * n_col_ - st_;
|
||||
off[r] = st, off_end[r] = en;
|
||||
for (t = st_; t <= en_; ++t) {
|
||||
__m128i d, z, a, b, a2, b2, xt1, x2t1, vt1, ut, tmp;
|
||||
@@ -382,7 +382,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
|
||||
if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY)) {
|
||||
ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||
} else if (!ez->zdropped && (flag&KSW_EZ_EXTZ_ONLY) && ez->mqe + end_bonus > ez->max) {
|
||||
} else if (!ez->zdropped && (flag&KSW_EZ_EXTZ_ONLY) && ez->mqe + end_bonus > (int)ez->max) {
|
||||
ez->reach_end = 1;
|
||||
ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, ez->mqe_t, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||
} else if (ez->max_t >= 0 && ez->max_q >= 0) {
|
||||
|
||||
+1
-1
@@ -71,7 +71,7 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
qe_ = _mm_set1_epi8(q + e);
|
||||
sc_mch_ = _mm_set1_epi8(mat[0]);
|
||||
sc_mis_ = _mm_set1_epi8(mat[1]);
|
||||
sc_N_ = _mm_set1_epi8(-e);
|
||||
sc_N_ = mat[m*m-1] == 0? _mm_set1_epi8(-e) : _mm_set1_epi8(mat[m*m-1]);
|
||||
m1_ = _mm_set1_epi8(m - 1); // wildcard
|
||||
|
||||
tlen_ = (tlen + 15) / 16;
|
||||
|
||||
+5
-5
@@ -65,7 +65,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
flag16_ = _mm_set1_epi8(0x10);
|
||||
sc_mch_ = _mm_set1_epi8(mat[0]);
|
||||
sc_mis_ = _mm_set1_epi8(mat[1]);
|
||||
sc_N_ = _mm_set1_epi8(-e);
|
||||
sc_N_ = mat[m*m-1] == 0? _mm_set1_epi8(-e) : _mm_set1_epi8(mat[m*m-1]);
|
||||
m1_ = _mm_set1_epi8(m - 1); // wildcard
|
||||
max_sc_ = _mm_set1_epi8(mat[0] + (q + e) * 2);
|
||||
|
||||
@@ -89,7 +89,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
for (t = 0; t < tlen_ * 16; ++t) H[t] = KSW_NEG_INF;
|
||||
}
|
||||
if (with_cigar) {
|
||||
mem2 = (uint8_t*)kmalloc(km, ((qlen + tlen - 1) * n_col_ + 1) * 16);
|
||||
mem2 = (uint8_t*)kmalloc(km, ((size_t)(qlen + tlen - 1) * n_col_ + 1) * 16);
|
||||
p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4);
|
||||
off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int) * 2);
|
||||
off_end = off + qlen + tlen - 1;
|
||||
@@ -169,7 +169,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
#endif
|
||||
}
|
||||
} else if (!(flag&KSW_EZ_RIGHT)) { // gap left-alignment
|
||||
__m128i *pr = p + r * n_col_ - st_;
|
||||
__m128i *pr = p + (size_t)r * n_col_ - st_;
|
||||
off[r] = st, off_end[r] = en;
|
||||
for (t = st_; t <= en_; ++t) {
|
||||
__m128i d, z, a, b, xt1, vt1, ut, tmp;
|
||||
@@ -195,7 +195,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
_mm_store_si128(&pr[t], d);
|
||||
}
|
||||
} else { // gap right-alignment
|
||||
__m128i *pr = p + r * n_col_ - st_;
|
||||
__m128i *pr = p + (size_t)r * n_col_ - st_;
|
||||
off[r] = st, off_end[r] = en;
|
||||
for (t = st_; t <= en_; ++t) {
|
||||
__m128i d, z, a, b, xt1, vt1, ut, tmp;
|
||||
@@ -293,7 +293,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
|
||||
if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY)) {
|
||||
ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||
} else if (!ez->zdropped && (flag&KSW_EZ_EXTZ_ONLY) && ez->mqe + end_bonus > ez->max) {
|
||||
} else if (!ez->zdropped && (flag&KSW_EZ_EXTZ_ONLY) && ez->mqe + end_bonus > (int)ez->max) {
|
||||
ez->reach_end = 1;
|
||||
ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, ez->mqe_t, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||
} else if (ez->max_t >= 0 && ez->max_q >= 0) {
|
||||
|
||||
@@ -4,9 +4,13 @@
|
||||
#include "bseq.h"
|
||||
#include "minimap.h"
|
||||
#include "mmpriv.h"
|
||||
#ifdef HAVE_GETOPT
|
||||
#include <getopt.h>
|
||||
#else
|
||||
#include "getopt.h"
|
||||
#endif
|
||||
|
||||
#define MM_VERSION "2.9-r720"
|
||||
#define MM_VERSION "2.11-r797"
|
||||
|
||||
#ifdef __linux__
|
||||
#include <sys/resource.h>
|
||||
@@ -51,6 +55,11 @@ static struct option long_options[] = {
|
||||
{ "all-chain", no_argument, 0, 'P' },
|
||||
{ "dual", required_argument, 0, 0 }, // 26
|
||||
{ "max-clip-ratio", required_argument, 0, 0 }, // 27
|
||||
{ "min-occ-floor", required_argument, 0, 0 }, // 28
|
||||
{ "MD", no_argument, 0, 0 }, // 29
|
||||
{ "lj-min-ratio", required_argument, 0, 0 }, // 30
|
||||
{ "score-N", required_argument, 0, 0 }, // 31
|
||||
{ "eqx", no_argument, 0, 0 }, // 32
|
||||
{ "help", no_argument, 0, 'h' },
|
||||
{ "max-intron-len", required_argument, 0, 'G' },
|
||||
{ "version", no_argument, 0, 'V' },
|
||||
@@ -66,7 +75,7 @@ static inline int64_t mm_parse_num(const char *str)
|
||||
{
|
||||
double x;
|
||||
char *p;
|
||||
x = strtod(optarg, &p);
|
||||
x = strtod(str, &p);
|
||||
if (*p == 'G' || *p == 'g') x *= 1e9;
|
||||
else if (*p == 'M' || *p == 'm') x *= 1e6;
|
||||
else if (*p == 'K' || *p == 'k') x *= 1e3;
|
||||
@@ -88,7 +97,7 @@ static inline void yes_or_no(mm_mapopt_t *opt, int flag, int long_idx, const cha
|
||||
|
||||
int main(int argc, char *argv[])
|
||||
{
|
||||
const char *opt_str = "2aSDw:k:K:t:r:f:Vv:g:G:I:d:XT:s:x:Hcp:M:n:z:A:B:O:E:m:N:Qu:R:hF:LC:";
|
||||
const char *opt_str = "2aSDw:k:K:t:r:f:Vv:g:G:I:d:XT:s:x:Hcp:M:n:z:A:B:O:E:m:N:Qu:R:hF:LC:yY";
|
||||
mm_mapopt_t opt;
|
||||
mm_idxopt_t ipt;
|
||||
int i, c, n_threads = 3, long_idx;
|
||||
@@ -110,7 +119,7 @@ int main(int argc, char *argv[])
|
||||
}
|
||||
break;
|
||||
}
|
||||
optreset = 1;
|
||||
optind = 0; // for musl getopt, optind=0 has the same effect as optreset=1; older libc doesn't have optreset
|
||||
|
||||
while ((c = getopt_long(argc, argv, opt_str, long_options, &long_idx)) >= 0) {
|
||||
if (c == 'w') ipt.w = atoi(optarg);
|
||||
@@ -134,6 +143,7 @@ int main(int argc, char *argv[])
|
||||
else if (c == 'Q') opt.flag |= MM_F_NO_QUAL;
|
||||
else if (c == 'Y') opt.flag |= MM_F_SOFTCLIP;
|
||||
else if (c == 'L') opt.flag |= MM_F_LONG_CIGAR;
|
||||
else if (c == 'y') opt.flag |= MM_F_COPY_COMMENT;
|
||||
else if (c == 'T') opt.sdust_thres = atoi(optarg);
|
||||
else if (c == 'n') opt.min_cnt = atoi(optarg);
|
||||
else if (c == 'm') opt.min_chain_score = atoi(optarg);
|
||||
@@ -164,6 +174,11 @@ int main(int argc, char *argv[])
|
||||
else if (c == 0 && long_idx ==22) opt.flag |= MM_F_FOR_ONLY; // --for-only
|
||||
else if (c == 0 && long_idx ==23) opt.flag |= MM_F_REV_ONLY; // --rev-only
|
||||
else if (c == 0 && long_idx ==27) opt.max_clip_ratio = atof(optarg); // --max-clip-ratio
|
||||
else if (c == 0 && long_idx ==28) opt.min_mid_occ = atoi(optarg); // --min-occ-floor
|
||||
else if (c == 0 && long_idx ==29) opt.flag |= MM_F_OUT_MD; // --MD
|
||||
else if (c == 0 && long_idx ==30) opt.min_join_flank_ratio = atof(optarg); // --lj-min-ratio
|
||||
else if (c == 0 && long_idx ==31) opt.sc_ambi = atoi(optarg); // --score-N
|
||||
else if (c == 0 && long_idx ==32) opt.flag |= MM_F_EQX; // --eqx
|
||||
else if (c == 0 && long_idx == 14) { // --frag
|
||||
yes_or_no(&opt, MM_F_FRAG_MODE, long_idx, optarg, 1);
|
||||
} else if (c == 0 && long_idx == 15) { // --secondary
|
||||
@@ -232,7 +247,7 @@ int main(int argc, char *argv[])
|
||||
fprintf(fp_help, "Usage: minimap2 [options] <target.fa>|<target.idx> [query.fa] [...]\n");
|
||||
fprintf(fp_help, "Options:\n");
|
||||
fprintf(fp_help, " Indexing:\n");
|
||||
fprintf(fp_help, " -H use homopolymer-compressed k-mer\n");
|
||||
fprintf(fp_help, " -H use homopolymer-compressed k-mer (preferrable for PacBio)\n");
|
||||
fprintf(fp_help, " -k INT k-mer size (no larger than 28) [%d]\n", ipt.k);
|
||||
fprintf(fp_help, " -w INT minizer window size [%d]\n", ipt.w);
|
||||
fprintf(fp_help, " -I NUM split index for every ~NUM input bases [4G]\n");
|
||||
@@ -264,21 +279,20 @@ int main(int argc, char *argv[])
|
||||
fprintf(fp_help, " -R STR SAM read group line in a format like '@RG\\tID:foo\\tSM:bar' []\n");
|
||||
fprintf(fp_help, " -c output CIGAR in PAF\n");
|
||||
fprintf(fp_help, " --cs[=STR] output the cs tag; STR is 'short' (if absent) or 'long' [none]\n");
|
||||
fprintf(fp_help, " --MD output the MD tag\n");
|
||||
fprintf(fp_help, " --eqx write =/X CIGAR operators\n");
|
||||
fprintf(fp_help, " -Y use soft clipping for supplementary alignments\n");
|
||||
fprintf(fp_help, " -t INT number of threads [%d]\n", n_threads);
|
||||
fprintf(fp_help, " -K NUM minibatch size for mapping [500M]\n");
|
||||
// fprintf(fp_help, " -v INT verbose level [%d]\n", mm_verbose);
|
||||
fprintf(fp_help, " --version show version number\n");
|
||||
fprintf(fp_help, " Preset:\n");
|
||||
fprintf(fp_help, " -x STR preset (always applied before other options) []\n");
|
||||
fprintf(fp_help, " map-pb: -Hk19 (PacBio vs reference mapping)\n");
|
||||
fprintf(fp_help, " map-ont: -k15 (Oxford Nanopore vs reference mapping)\n");
|
||||
fprintf(fp_help, " asm5: -k19 -w19 -A1 -B19 -O39,81 -E3,1 -s200 -z200 (asm to ref mapping; break at 5%% div.)\n");
|
||||
fprintf(fp_help, " asm10: -k19 -w19 -A1 -B9 -O16,41 -E2,1 -s200 -z200 (asm to ref mapping; break at 10%% div.)\n");
|
||||
fprintf(fp_help, " ava-pb: -Hk19 -Xw5 -m100 -g10000 --max-chain-skip 25 (PacBio read overlap)\n");
|
||||
fprintf(fp_help, " ava-ont: -k15 -Xw5 -m100 -g10000 --max-chain-skip 25 (ONT read overlap)\n");
|
||||
fprintf(fp_help, " splice: long-read spliced alignment (see minimap2.1 for details)\n");
|
||||
fprintf(fp_help, " sr: short single-end reads without splicing (see minimap2.1 for details)\n");
|
||||
fprintf(fp_help, " -x STR preset (always applied before other options; see minimap2.1 for details) []\n");
|
||||
fprintf(fp_help, " - map-pb/map-ont: PacBio/Nanopore vs reference mapping\n");
|
||||
fprintf(fp_help, " - ava-pb/ava-ont: PacBio/Nanopore read overlap\n");
|
||||
fprintf(fp_help, " - asm5/asm10/asm20: asm-to-ref mapping, for ~0.1/1/5%% sequence divergence\n");
|
||||
fprintf(fp_help, " - splice: long-read spliced alignment\n");
|
||||
fprintf(fp_help, " - sr: genomic short-read mapping\n");
|
||||
fprintf(fp_help, "\nSee `man ./minimap2.1' for detailed description of command-line options.\n");
|
||||
return fp_help == stdout? 0 : 1;
|
||||
}
|
||||
@@ -330,10 +344,17 @@ int main(int argc, char *argv[])
|
||||
}
|
||||
mm_idx_reader_close(idx_rdr);
|
||||
|
||||
fprintf(stderr, "[M::%s] Version: %s\n", __func__, MM_VERSION);
|
||||
fprintf(stderr, "[M::%s] CMD:", __func__);
|
||||
for (i = 0; i < argc; ++i)
|
||||
fprintf(stderr, " %s", argv[i]);
|
||||
fprintf(stderr, "\n[M::%s] Real time: %.3f sec; CPU: %.3f sec\n", __func__, realtime() - mm_realtime0, cputime());
|
||||
if (fflush(stdout) == EOF) {
|
||||
fprintf(stderr, "[ERROR] failed to write the results\n");
|
||||
exit(EXIT_FAILURE);
|
||||
}
|
||||
|
||||
if (mm_verbose >= 3) {
|
||||
fprintf(stderr, "[M::%s] Version: %s\n", __func__, MM_VERSION);
|
||||
fprintf(stderr, "[M::%s] CMD:", __func__);
|
||||
for (i = 0; i < argc; ++i)
|
||||
fprintf(stderr, " %s", argv[i]);
|
||||
fprintf(stderr, "\n[M::%s] Real time: %.3f sec; CPU: %.3f sec\n", __func__, realtime() - mm_realtime0, cputime());
|
||||
}
|
||||
return 0;
|
||||
}
|
||||
|
||||
@@ -39,12 +39,12 @@ static int mm_dust_minier(void *km, int n, mm128_t *a, int l_seq, const char *se
|
||||
for (j = k = 0; j < n; ++j) { // squeeze out minimizers that significantly overlap with LCRs
|
||||
int32_t qpos = (uint32_t)a[j].y>>1, span = a[j].x&0xff;
|
||||
int32_t s = qpos - (span - 1), e = s + span;
|
||||
while (u < n_dreg && (uint32_t)dreg[u] <= s) ++u;
|
||||
if (u < n_dreg && dreg[u]>>32 < e) {
|
||||
while (u < n_dreg && (int32_t)dreg[u] <= s) ++u;
|
||||
if (u < n_dreg && (int32_t)(dreg[u]>>32) < e) {
|
||||
int v, l = 0;
|
||||
for (v = u; v < n_dreg && dreg[v]>>32 < e; ++v) { // iterate over LCRs overlapping this minimizer
|
||||
int ss = s > dreg[v]>>32? s : dreg[v]>>32;
|
||||
int ee = e < (uint32_t)dreg[v]? e : (uint32_t)dreg[v];
|
||||
for (v = u; v < n_dreg && (int32_t)(dreg[v]>>32) < e; ++v) { // iterate over LCRs overlapping this minimizer
|
||||
int ss = s > (int32_t)(dreg[v]>>32)? s : dreg[v]>>32;
|
||||
int ee = e < (int32_t)dreg[v]? e : (uint32_t)dreg[v];
|
||||
l += ee - ss;
|
||||
}
|
||||
if (l <= span>>1) a[k++] = a[j]; // keep the minimizer if less than half of it falls in masked region
|
||||
@@ -56,9 +56,10 @@ static int mm_dust_minier(void *km, int n, mm128_t *a, int l_seq, const char *se
|
||||
|
||||
static void collect_minimizers(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, mm128_v *mv)
|
||||
{
|
||||
int i, j, n, sum = 0;
|
||||
int i, n, sum = 0;
|
||||
mv->n = 0;
|
||||
for (i = n = 0; i < n_segs; ++i) {
|
||||
size_t j;
|
||||
mm_sketch(km, seqs[i], qlens[i], mi->w, mi->k, i, mi->flag&MM_I_HPC, mv);
|
||||
for (j = n; j < mv->n; ++j)
|
||||
mv->a[j].y += sum << 1;
|
||||
@@ -81,12 +82,13 @@ typedef struct {
|
||||
|
||||
static mm_match_t *collect_matches(void *km, int *_n_m, int max_occ, const mm_idx_t *mi, const mm128_v *mv, int64_t *n_a, int *rep_len, int *n_mini_pos, uint64_t **mini_pos)
|
||||
{
|
||||
int i, rep_st = 0, rep_en = 0, n_m;
|
||||
int rep_st = 0, rep_en = 0, n_m;
|
||||
size_t i;
|
||||
mm_match_t *m;
|
||||
*n_mini_pos = 0;
|
||||
*mini_pos = (uint64_t*)kmalloc(km, mv->n * sizeof(uint64_t));
|
||||
m = (mm_match_t*)kmalloc(km, mv->n * sizeof(mm_match_t));
|
||||
for (i = n_m = 0, *rep_len = 0, *n_a = 0; i < mv->n; ++i) {
|
||||
for (i = 0, n_m = 0, *rep_len = 0, *n_a = 0; i < mv->n; ++i) {
|
||||
const uint64_t *cr;
|
||||
mm128_t *p = &mv->a[i];
|
||||
uint32_t q_pos = (uint32_t)p->y, q_span = p->x & 0xff;
|
||||
@@ -120,7 +122,7 @@ static inline int skip_seed(int flag, uint64_t r, const mm_match_t *q, const cha
|
||||
const mm_idx_seq_t *s = &mi->seq[r>>32];
|
||||
int cmp;
|
||||
cmp = strcmp(qname, s->name);
|
||||
if ((flag&MM_F_NO_DIAG) && cmp == 0 && s->len == qlen) {
|
||||
if ((flag&MM_F_NO_DIAG) && cmp == 0 && (int)s->len == qlen) {
|
||||
if ((uint32_t)r>>1 == (q->q_pos>>1)) return 1; // avoid the diagnonal anchors
|
||||
if ((r&1) == (q->q_pos&1)) *is_self = 1; // this flag is used to avoid spurious extension on self chain
|
||||
}
|
||||
@@ -163,19 +165,20 @@ static mm128_t *collect_seed_hits_heap(void *km, const mm_mapopt_t *opt, int max
|
||||
mm128_t *p;
|
||||
uint64_t r = heap->x;
|
||||
int32_t is_self, rpos = (uint32_t)r >> 1;
|
||||
if (skip_seed(opt->flag, r, q, qname, qlen, mi, &is_self)) continue;
|
||||
if ((r&1) == (q->q_pos&1)) { // forward strand
|
||||
p = &a[n_for++];
|
||||
p->x = (r&0xffffffff00000000ULL) | rpos;
|
||||
p->y = (uint64_t)q->q_span << 32 | q->q_pos >> 1;
|
||||
} else { // reverse strand
|
||||
p = &a[(*n_a) - (++n_rev)];
|
||||
p->x = 1ULL<<63 | (r&0xffffffff00000000ULL) | rpos;
|
||||
p->y = (uint64_t)q->q_span << 32 | (qlen - ((q->q_pos>>1) + 1 - q->q_span) - 1);
|
||||
if (!skip_seed(opt->flag, r, q, qname, qlen, mi, &is_self)) {
|
||||
if ((r&1) == (q->q_pos&1)) { // forward strand
|
||||
p = &a[n_for++];
|
||||
p->x = (r&0xffffffff00000000ULL) | rpos;
|
||||
p->y = (uint64_t)q->q_span << 32 | q->q_pos >> 1;
|
||||
} else { // reverse strand
|
||||
p = &a[(*n_a) - (++n_rev)];
|
||||
p->x = 1ULL<<63 | (r&0xffffffff00000000ULL) | rpos;
|
||||
p->y = (uint64_t)q->q_span << 32 | (qlen - ((q->q_pos>>1) + 1 - q->q_span) - 1);
|
||||
}
|
||||
p->y |= (uint64_t)q->seg_id << MM_SEED_SEG_SHIFT;
|
||||
if (q->is_tandem) p->y |= MM_SEED_TANDEM;
|
||||
if (is_self) p->y |= MM_SEED_SELF;
|
||||
}
|
||||
p->y |= (uint64_t)q->seg_id << MM_SEED_SEG_SHIFT;
|
||||
if (q->is_tandem) p->y |= MM_SEED_TANDEM;
|
||||
if (is_self) p->y |= MM_SEED_SELF;
|
||||
// update the heap
|
||||
if ((uint32_t)heap->y < q->n - 1) {
|
||||
++heap[0].y;
|
||||
@@ -205,7 +208,7 @@ static mm128_t *collect_seed_hits_heap(void *km, const mm_mapopt_t *opt, int max
|
||||
static mm128_t *collect_seed_hits(void *km, const mm_mapopt_t *opt, int max_occ, const mm_idx_t *mi, const char *qname, const mm128_v *mv, int qlen, int64_t *n_a, int *rep_len,
|
||||
int *n_mini_pos, uint64_t **mini_pos)
|
||||
{
|
||||
int i, k, n_m;
|
||||
int i, n_m;
|
||||
mm_match_t *m;
|
||||
mm128_t *a;
|
||||
m = collect_matches(km, &n_m, max_occ, mi, mv, n_a, rep_len, n_mini_pos, mini_pos);
|
||||
@@ -213,6 +216,7 @@ static mm128_t *collect_seed_hits(void *km, const mm_mapopt_t *opt, int max_occ,
|
||||
for (i = 0, *n_a = 0; i < n_m; ++i) {
|
||||
mm_match_t *q = &m[i];
|
||||
const uint64_t *r = q->cr;
|
||||
uint32_t k;
|
||||
for (k = 0; k < q->n; ++k) {
|
||||
int32_t is_self, rpos = (uint32_t)r[k] >> 1;
|
||||
mm128_t *p;
|
||||
@@ -308,10 +312,10 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
|
||||
if (n_regs0 > 0) { // test if the best chain has all the segments
|
||||
int n_chained_segs = 1, max = 0, max_i = -1, max_off = -1, off = 0;
|
||||
for (i = 0; i < n_regs0; ++i) { // find the best chain
|
||||
if (max < u[i]>>32) max = u[i]>>32, max_i = i, max_off = off;
|
||||
if (max < (int)(u[i]>>32)) max = u[i]>>32, max_i = i, max_off = off;
|
||||
off += (uint32_t)u[i];
|
||||
}
|
||||
for (i = 1; i < (uint32_t)u[max_i]; ++i) // count the number of segments in the best chain
|
||||
for (i = 1; i < (int32_t)u[max_i]; ++i) // count the number of segments in the best chain
|
||||
if ((a[max_off+i].y&MM_SEED_SEG_MASK) != (a[max_off+i-1].y&MM_SEED_SEG_MASK))
|
||||
++n_chained_segs;
|
||||
if (n_chained_segs < n_segs)
|
||||
@@ -442,11 +446,12 @@ static void *worker_pipeline(void *shared, int step, void *in)
|
||||
pipeline_t *p = (pipeline_t*)shared;
|
||||
if (step == 0) { // step 0: read sequences
|
||||
int with_qual = (!!(p->opt->flag & MM_F_OUT_SAM) && !(p->opt->flag & MM_F_NO_QUAL));
|
||||
int with_comment = !!(p->opt->flag & MM_F_COPY_COMMENT);
|
||||
int frag_mode = (p->n_fp > 1 || !!(p->opt->flag & MM_F_FRAG_MODE));
|
||||
step_t *s;
|
||||
s = (step_t*)calloc(1, sizeof(step_t));
|
||||
if (p->n_fp > 1) s->seq = mm_bseq_read_frag(p->n_fp, p->fp, p->mini_batch_size, with_qual, &s->n_seq);
|
||||
else s->seq = mm_bseq_read2(p->fp[0], p->mini_batch_size, with_qual, frag_mode, &s->n_seq);
|
||||
if (p->n_fp > 1) s->seq = mm_bseq_read_frag2(p->n_fp, p->fp, p->mini_batch_size, with_qual, with_comment, &s->n_seq);
|
||||
else s->seq = mm_bseq_read3(p->fp[0], p->mini_batch_size, with_qual, with_comment, frag_mode, &s->n_seq);
|
||||
if (s->seq) {
|
||||
s->p = p;
|
||||
for (i = 0; i < s->n_seq; ++i)
|
||||
@@ -489,11 +494,11 @@ static void *worker_pipeline(void *shared, int step, void *in)
|
||||
mm_write_sam2(&p->str, mi, t, i - seg_st, j, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag);
|
||||
else
|
||||
mm_write_paf(&p->str, mi, t, r, km, p->opt->flag);
|
||||
puts(p->str.s);
|
||||
mm_err_puts(p->str.s);
|
||||
}
|
||||
if (s->n_reg[i] == 0 && (p->opt->flag & MM_F_OUT_SAM)) {
|
||||
if (s->n_reg[i] == 0 && (p->opt->flag & MM_F_OUT_SAM)) { // write an unmapped record
|
||||
mm_write_sam2(&p->str, mi, t, i - seg_st, -1, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag);
|
||||
puts(p->str.s);
|
||||
mm_err_puts(p->str.s);
|
||||
}
|
||||
}
|
||||
for (i = seg_st; i < seg_en; ++i) {
|
||||
|
||||
@@ -29,6 +29,9 @@
|
||||
#define MM_F_REV_ONLY 0x200000
|
||||
#define MM_F_HEAP_SORT 0x400000
|
||||
#define MM_F_ALL_CHAINS 0x800000
|
||||
#define MM_F_OUT_MD 0x1000000
|
||||
#define MM_F_COPY_COMMENT 0x2000000
|
||||
#define MM_F_EQX 0x4000000 // use =/X instead of M
|
||||
|
||||
#define MM_I_HPC 0x1
|
||||
#define MM_I_NO_SEQ 0x2
|
||||
@@ -113,8 +116,10 @@ typedef struct {
|
||||
|
||||
int max_join_long, max_join_short;
|
||||
int min_join_flank_sc;
|
||||
float min_join_flank_ratio;
|
||||
|
||||
int a, b, q, e, q2, e2; // matching score, mismatch, gap-open and gap-ext penalties
|
||||
int sc_ambi; // score when one or both bases are "N"
|
||||
int noncan; // cost of non-canonical splicing sites
|
||||
int zdrop, zdrop_inv; // break alignment if alignment score drops too fast along the diagonal
|
||||
int end_bonus;
|
||||
@@ -126,6 +131,7 @@ typedef struct {
|
||||
int pe_ori, pe_bonus;
|
||||
|
||||
float mid_occ_frac; // only used by mm_mapopt_update(); see below
|
||||
int32_t min_mid_occ;
|
||||
int32_t mid_occ; // ignore seeds with occurrences above this threshold
|
||||
int32_t max_occ;
|
||||
int mini_batch_size; // size of a batch of query bases to process in parallel
|
||||
@@ -213,6 +219,36 @@ void mm_idx_reader_close(mm_idx_reader_t *r);
|
||||
|
||||
int mm_idx_reader_eof(const mm_idx_reader_t *r);
|
||||
|
||||
/**
|
||||
* Check whether the file contains a minimap2 index
|
||||
*
|
||||
* @param fn file name
|
||||
*
|
||||
* @return the file size if fn is an index file; 0 if fn is not.
|
||||
*/
|
||||
int64_t mm_idx_is_idx(const char *fn);
|
||||
|
||||
/**
|
||||
* Load a part of an index
|
||||
*
|
||||
* Given a uni-part index, this function loads the entire index into memory.
|
||||
* Given a multi-part index, it loads one part only and places the file pointer
|
||||
* at the end of that part.
|
||||
*
|
||||
* @param fp pointer to FILE object
|
||||
*
|
||||
* @return minimap2 index read from fp
|
||||
*/
|
||||
mm_idx_t *mm_idx_load(FILE *fp);
|
||||
|
||||
/**
|
||||
* Append an index (or one part of a full index) to file
|
||||
*
|
||||
* @param fp pointer to FILE object
|
||||
* @param mi minimap2 index
|
||||
*/
|
||||
void mm_idx_dump(FILE *fp, const mm_idx_t *mi);
|
||||
|
||||
/**
|
||||
* Create an index from strings in memory
|
||||
*
|
||||
|
||||
+51
-9
@@ -1,4 +1,4 @@
|
||||
.TH minimap2 1 "24 February 2018" "minimap2-2.9 (r720)" "Bioinformatics tools"
|
||||
.TH minimap2 1 "20 June 2018" "minimap2-2.11 (r797)" "Bioinformatics tools"
|
||||
.SH NAME
|
||||
.PP
|
||||
minimap2 - mapping and alignment between collections of DNA sequences
|
||||
@@ -123,10 +123,27 @@ provided as the target sequences, options
|
||||
will be effectively overridden by the options stored in the index file.
|
||||
.SS Mapping options
|
||||
.TP 10
|
||||
.BI -f \ FLOAT
|
||||
Ignore top
|
||||
.BI -f \ FLOAT | INT1 [, INT2 ]
|
||||
If fraction, ignore top
|
||||
.I FLOAT
|
||||
fraction of most frequent minimizers [0.0002]
|
||||
fraction of most frequent minimizers [0.0002]. If integer,
|
||||
ignore minimizers occuring more than
|
||||
.I INT1
|
||||
times.
|
||||
.I INT2
|
||||
is only effective in the
|
||||
.B --sr
|
||||
or
|
||||
.B -xsr
|
||||
mode, which sets the threshold for a second round of seeding.
|
||||
.TP
|
||||
.BI --min-occ-floor \ INT
|
||||
Force minimap2 to always use k-mers occurring
|
||||
.I INT
|
||||
times or less [0]. In effect, the max occurrence threshold is set to
|
||||
the
|
||||
.RI max{ INT ,
|
||||
.BR -f }.
|
||||
.TP
|
||||
.BI -g \ INT
|
||||
Stop chain enlongation if there are no minimizers within
|
||||
@@ -222,6 +239,10 @@ Disable the long gap patching heuristic. When this option is applied, the
|
||||
maximum alignment gap is mostly controlled by
|
||||
.BR -r .
|
||||
.TP
|
||||
.B --lj-min-ratio \ FLOAT
|
||||
Fraction of query sequence length required to bridge a long gap [0.5]. A
|
||||
smaller value helps to recover longer gaps, at the cost of more false gaps.
|
||||
.TP
|
||||
.B --splice
|
||||
Enable the splice alignment mode.
|
||||
.TP
|
||||
@@ -305,6 +326,9 @@ no attempt to match GT-AG [n]
|
||||
.BI --end-bonus \ INT
|
||||
Score bonus when alignment extends to the end of the query sequence [0].
|
||||
.TP
|
||||
.BI --score-N \ INT
|
||||
Score of a mismatch involving ambiguous bases [1].
|
||||
.TP
|
||||
.BR --splice-flank = yes | no
|
||||
Assume the next base to a
|
||||
.B GT
|
||||
@@ -353,6 +377,9 @@ SAM read group line in a format like
|
||||
.B @RG\\\\tID:foo\\\\tSM:bar
|
||||
[].
|
||||
.TP
|
||||
.B -y
|
||||
Copy input FASTA/Q comments to output.
|
||||
.TP
|
||||
.B -c
|
||||
Generate CIGAR. In PAF, the CIGAR is written to the `cg' custom tag.
|
||||
.TP
|
||||
@@ -371,6 +398,12 @@ is given,
|
||||
.I short
|
||||
is assumed. [none]
|
||||
.TP
|
||||
.B --MD
|
||||
Output the MD tag (see the SAM spec).
|
||||
.TP
|
||||
.B --eqx
|
||||
Output =/X CIGAR operators for sequence match/mismatch.
|
||||
.TP
|
||||
.B -Y
|
||||
In SAM output, use soft clipping for supplementary alignments.
|
||||
.TP
|
||||
@@ -433,18 +466,25 @@ is determined by the sequencing error mode.
|
||||
.B asm5
|
||||
Long assembly to reference mapping
|
||||
.RB ( -k19
|
||||
.B -w19 -A1 -B19 -O39,81 -E3,1 -s200
|
||||
.BR -z200 ).
|
||||
.B -w19 -A1 -B19 -O39,81 -E3,1 -s200 -z200
|
||||
.BR --min-occ-floor=100 ).
|
||||
Typically, the alignment will not extend to regions with 5% or higher sequence
|
||||
divergence. Only use this preset if the average divergence is far below 5%.
|
||||
.TP
|
||||
.B asm10
|
||||
Long assembly to reference mapping
|
||||
.RB ( -k19
|
||||
.B -w19 -A1 -B9 -O16,41 -E2,1 -s200
|
||||
.BR -z200 ).
|
||||
.B -w19 -A1 -B9 -O16,41 -E2,1 -s200 -z200
|
||||
.BR --min-occ-floor=100 ).
|
||||
Up to 10% sequence divergence.
|
||||
.TP
|
||||
.B asm20
|
||||
Long assembly to reference mapping
|
||||
.RB ( -k19
|
||||
.B -w10 -A1 -B6 -O6,26 -E2,1 -s200 -z200
|
||||
.BR --min-occ-floor=100 ).
|
||||
Up to 20% sequence divergence.
|
||||
.TP
|
||||
.B ava-pb
|
||||
PacBio all-vs-all overlap mapping
|
||||
.RB ( -Hk19
|
||||
@@ -454,7 +494,7 @@ PacBio all-vs-all overlap mapping
|
||||
.B ava-ont
|
||||
Oxford Nanopore all-vs-all overlap mapping
|
||||
.RB ( -k15
|
||||
.B -Xw5 -m100 -g10000 --max-chain-skip
|
||||
.B -Xw5 -m100 -g10000 -r2000 --max-chain-skip
|
||||
.BR 25 ).
|
||||
Similarly, the major difference from
|
||||
.B ava-pb
|
||||
@@ -535,12 +575,14 @@ cm i Number of minimizers on the chain
|
||||
s1 i Chaining score
|
||||
s2 i Chaining score of the best secondary chain
|
||||
NM i Total number of mismatches and gaps in the alignment
|
||||
MD Z To generate the ref sequence in the alignment
|
||||
AS i DP alignment score
|
||||
ms i DP score of the max scoring segment in the alignment
|
||||
nn i Number of ambiguous bases in the alignment
|
||||
ts A Transcript strand (splice mode only)
|
||||
cg Z CIGAR string (only in PAF)
|
||||
cs Z Difference string
|
||||
dv f Approximate per-base sequence divergence
|
||||
.TE
|
||||
|
||||
.PP
|
||||
|
||||
@@ -1,3 +1,4 @@
|
||||
#include <stdlib.h>
|
||||
#include "mmpriv.h"
|
||||
|
||||
int mm_verbose = 1;
|
||||
@@ -120,6 +121,16 @@ double realtime(void)
|
||||
return tp.tv_sec + tp.tv_usec * 1e-6;
|
||||
}
|
||||
|
||||
void mm_err_puts(const char *str)
|
||||
{
|
||||
int ret;
|
||||
ret = puts(str);
|
||||
if (ret == EOF) {
|
||||
fprintf(stderr, "[ERROR] failed to write the results\n");
|
||||
exit(EXIT_FAILURE);
|
||||
}
|
||||
}
|
||||
|
||||
#include "ksort.h"
|
||||
|
||||
#define sort_key_128x(a) ((a).x)
|
||||
|
||||
+232
-66
@@ -1,6 +1,6 @@
|
||||
#!/usr/bin/env k8
|
||||
|
||||
var paftools_version = 'r713';
|
||||
var paftools_version = 'r767';
|
||||
|
||||
/*****************************
|
||||
***** Library functions *****
|
||||
@@ -131,6 +131,40 @@ Interval.find_ovlp = function(a, st, en)
|
||||
* Reverse and reverse complement *
|
||||
**********************************/
|
||||
|
||||
function fasta_read(fn)
|
||||
{
|
||||
var h = {}, gt = '>'.charCodeAt(0);
|
||||
var file = fn == '-'? new File() : new File(fn);
|
||||
var buf = new Bytes(), seq = null, name = null, seqlen = [];
|
||||
while (file.readline(buf) >= 0) {
|
||||
if (buf[0] == gt) {
|
||||
if (seq != null && name != null) {
|
||||
seqlen.push([name, seq.length]);
|
||||
h[name] = seq;
|
||||
name = seq = null;
|
||||
}
|
||||
var m, line = buf.toString();
|
||||
if ((m = /^>(\S+)/.exec(line)) != null) {
|
||||
name = m[1];
|
||||
seq = new Bytes();
|
||||
}
|
||||
} else seq.set(buf);
|
||||
}
|
||||
if (seq != null && name != null) {
|
||||
seqlen.push([name, seq.length]);
|
||||
h[name] = seq;
|
||||
}
|
||||
buf.destroy();
|
||||
file.close();
|
||||
return [h, seqlen];
|
||||
}
|
||||
|
||||
function fasta_free(fa)
|
||||
{
|
||||
for (var name in fa)
|
||||
fa[name].destroy();
|
||||
}
|
||||
|
||||
Bytes.prototype.reverse = function()
|
||||
{
|
||||
for (var i = 0; i < this.length>>1; ++i) {
|
||||
@@ -305,14 +339,17 @@ function paf_liftover(args)
|
||||
// variant calling
|
||||
function paf_call(args)
|
||||
{
|
||||
var re_cs = /([:=*+-])(\d+|[A-Za-z]+)/g;
|
||||
var re_cs = /([:=*+-])(\d+|[A-Za-z]+)/g, re_tag = /\t(\S\S:[AZif]):(\S+)/g;
|
||||
var c, min_cov_len = 10000, min_var_len = 50000, gap_thres = 50, min_mapq = 5;
|
||||
while ((c = getopt(args, "l:L:g:q:B:")) != null) {
|
||||
var fa_tmp = null, fa, fa_lens, is_vcf = false;
|
||||
while ((c = getopt(args, "l:L:g:q:B:f:")) != null) {
|
||||
if (c == 'l') min_cov_len = parseInt(getopt.arg);
|
||||
else if (c == 'L') min_var_len = parseInt(getopt.arg);
|
||||
else if (c == 'g') gap_thres = parseInt(getopt.arg);
|
||||
else if (c == 'q') min_mapq = parseInt(getopt.arg);
|
||||
else if (c == 'f') fa_tmp = fasta_read(getopt.arg, fa_lens);
|
||||
}
|
||||
if (fa_tmp != null) fa = fa_tmp[0], fa_lens = fa_tmp[1], is_vcf = true;
|
||||
|
||||
if (args.length == getopt.ind) {
|
||||
print("Usage: sort -k6,6 -k8,8n <with-cs.paf> | paftools.js call [options] -");
|
||||
@@ -321,6 +358,7 @@ function paf_call(args)
|
||||
print(" -L INT min alignment length to call variants ["+min_var_len+"]");
|
||||
print(" -q INT min mapping quality ["+min_mapq+"]");
|
||||
print(" -g INT short/long gap threshold (for statistics only) ["+gap_thres+"]");
|
||||
print(" -f FILE reference sequences (enabling VCF output) [null]");
|
||||
exit(1);
|
||||
}
|
||||
|
||||
@@ -328,6 +366,27 @@ function paf_call(args)
|
||||
var buf = new Bytes();
|
||||
var tot_len = 0, n_sub = [0, 0, 0], n_ins = [0, 0, 0, 0], n_del = [0, 0, 0, 0];
|
||||
|
||||
function print_vcf(o, fa)
|
||||
{
|
||||
var v = null;
|
||||
if (o[3] != 1) return; // coverage is one; skip
|
||||
if (o[5] == '-' && o[6] == '-') return;
|
||||
if (o[5] != '-' && o[6] != '-') { // snp
|
||||
v = [o[0], o[1] + 1, '.', o[5].toUpperCase(), o[6].toUpperCase()];
|
||||
} else if (o[1] > 0) { // shouldn't happen in theory
|
||||
if (fa[o[0]] == null) throw Error('sequence "' + o[0] + '" is absent from the reference FASTA');
|
||||
if (o[1] >= fa[o[0]].length) throw Error('position ' + o[1] + ' exceeds the length of sequence "' + o[0] + '"');
|
||||
var ref = String.fromCharCode(fa[o[0]][o[1]-1]).toUpperCase();
|
||||
if (o[5] == '-') // insertion
|
||||
v = [o[0], o[1], '.', ref, ref + o[6].toUpperCase()];
|
||||
else // deletion
|
||||
v = [o[0], o[1], '.', ref + o[5].toUpperCase(), ref];
|
||||
}
|
||||
v.push(o[4], '.', 'QNAME=' + o[7] + ';QSTART=' + (o[8]+1) + ';QSTRAND=' + (rev? '-' : '+'), 'GT', '1/1');
|
||||
if (v == null) throw Error("unexpected variant: [" + o.join(",") + "]");
|
||||
print(v.join("\t"));
|
||||
}
|
||||
|
||||
function count_var(o)
|
||||
{
|
||||
if (o[3] > 1) return;
|
||||
@@ -346,46 +405,66 @@ function paf_call(args)
|
||||
else ++n_del[3];
|
||||
} else {
|
||||
++n_sub[0];
|
||||
var s = o[5] + o[6];
|
||||
var s = (o[5] + o[6]).toLowerCase();
|
||||
if (s == 'ag' || s == 'ga' || s == 'ct' || s == 'tc')
|
||||
++n_sub[1];
|
||||
else ++n_sub[2];
|
||||
}
|
||||
}
|
||||
|
||||
if (is_vcf) {
|
||||
print('##fileformat=VCFv4.1');
|
||||
for (var i = 0; i < fa_lens.length; ++i)
|
||||
print('##contig=<ID=' + fa_lens[i][0] + ',length=' + fa_lens[i][1] + '>');
|
||||
print('##INFO=<ID=QNAME,Number=1,Type=String,Description="Query name">');
|
||||
print('##INFO=<ID=QSTART,Number=1,Type=Integer,Description="Query start">');
|
||||
print('##INFO=<ID=QSTRAND,Number=1,Type=String,Description="Query strand">');
|
||||
print('##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">');
|
||||
print('#CHROM POS ID REF ALT QUAL FILTER INFO FORMAT sample');
|
||||
}
|
||||
|
||||
var a = [], out = [];
|
||||
var c1_ctg = null, c1_start = 0, c1_end = 0, c1_counted = false, c1_len = 0;
|
||||
while (file.readline(buf) >= 0) {
|
||||
var line = buf.toString();
|
||||
if (!/\ts2:i:/.test(line)) continue; // skip secondary alignments
|
||||
var m, t = line.split("\t", 12);
|
||||
for (var i = 6; i <= 11; ++i)
|
||||
t[i] = parseInt(t[i]);
|
||||
if (t[10] < min_cov_len || t[11] < min_mapq) continue;
|
||||
print(t[0], t[7], t[8], c1_start, c1_end);
|
||||
//print(t[0], t[7], t[8], c1_start, c1_end);
|
||||
for (var i = 1; i <= 3; ++i)
|
||||
t[i] = parseInt(t[i]);
|
||||
var ctg = t[5], x = t[7], end = t[8];
|
||||
var query = t[0], rev = (t[4] == '-'), y = rev? t[3] : t[2];
|
||||
// collect tags
|
||||
var cs = null, tp = null, have_s1 = false, have_s2 = false;
|
||||
while ((m = re_tag.exec(line)) != null) {
|
||||
if (m[1] == 'cs:Z') cs = m[2];
|
||||
else if (m[1] == 'tp:A') tp = m[2];
|
||||
else if (m[1] == 's1:i') have_s1 = true;
|
||||
else if (m[1] == 's2:i') have_s2 = true;
|
||||
}
|
||||
if (have_s1 && !have_s2) continue;
|
||||
if (tp != null && (tp == 'S' || tp == 'i')) continue;
|
||||
// compute regions covered by 1 contig
|
||||
if (ctg != c1_ctg || x >= c1_end) {
|
||||
if (c1_counted && c1_end > c1_start) {
|
||||
c1_len += c1_end - c1_start;
|
||||
print('R', c1_ctg, c1_start, c1_end);
|
||||
if (!is_vcf) print('R', c1_ctg, c1_start, c1_end);
|
||||
}
|
||||
c1_ctg = ctg, c1_start = x, c1_end = end;
|
||||
c1_counted = (t[10] >= min_var_len);
|
||||
} else if (end > c1_end) { // overlap
|
||||
if (c1_counted && x > c1_start) {
|
||||
c1_len += x - c1_start;
|
||||
print('R', c1_ctg, c1_start, x);
|
||||
if (!is_vcf) print('R', c1_ctg, c1_start, x);
|
||||
}
|
||||
c1_start = c1_end, c1_end = end;
|
||||
c1_counted = (t[10] >= min_var_len);
|
||||
} else if (end > c1_start) { // contained
|
||||
if (c1_counted && x > c1_start) {
|
||||
c1_len += x - c1_start;
|
||||
print('R', c1_ctg, c1_start, x);
|
||||
if (!is_vcf) print('R', c1_ctg, c1_start, x);
|
||||
}
|
||||
c1_start = end;
|
||||
} // else, the alignment precedes the cov1 region; do nothing
|
||||
@@ -393,7 +472,8 @@ function paf_call(args)
|
||||
while (out.length) {
|
||||
if (out[0][0] != ctg || out[0][2] <= x) {
|
||||
count_var(out[0]);
|
||||
print('V', out[0].join("\t"));
|
||||
if (is_vcf) print_vcf(out[0], fa);
|
||||
else print('V', out[0].join("\t"));
|
||||
out.shift();
|
||||
} else break;
|
||||
}
|
||||
@@ -404,20 +484,19 @@ function paf_call(args)
|
||||
// drop alignments that don't overlap with the current one
|
||||
var k = 0;
|
||||
for (var i = 0; i < a.length; ++i)
|
||||
if (a[0][0] == ctg && a[0][2] > x)
|
||||
if (a[i][0] == ctg && a[i][2] > x)
|
||||
a[k++] = a[i];
|
||||
a.length = k;
|
||||
// core loop
|
||||
if (t[10] >= min_var_len) {
|
||||
if ((m = /\tcs:Z:(\S+)/.exec(line)) == null) continue; // no cs tag
|
||||
var cs = m[1];
|
||||
if (cs == null) continue; // no cs tag
|
||||
var blen = 0, n_diff = 0;
|
||||
tot_len += t[10];
|
||||
while ((m = re_cs.exec(cs)) != null) {
|
||||
var cov = 1;
|
||||
if (m[1] == '*' || m[1] == '+' || m[1] == '-')
|
||||
for (var i = 0; i < a.length; ++i)
|
||||
if (a[0][2] > x) ++cov;
|
||||
if (a[i][2] > x) ++cov;
|
||||
var qs, qe;
|
||||
if (m[1] == '=' || m[1] == ':') {
|
||||
var l = m[1] == '='? m[2].length : parseInt(m[2]);
|
||||
@@ -450,11 +529,12 @@ function paf_call(args)
|
||||
}
|
||||
if (c1_counted && c1_end > c1_start) {
|
||||
c1_len += c1_end - c1_start;
|
||||
print('R', c1_ctg, c1_start, c1_end);
|
||||
if (!is_vcf) print('R', c1_ctg, c1_start, c1_end);
|
||||
}
|
||||
while (out.length) {
|
||||
count_var(out[0]);
|
||||
print('V', out[0].join("\t"));
|
||||
if (is_vcf) print_vcf(out[0], fa);
|
||||
else print('V', out[0].join("\t"));
|
||||
out.shift();
|
||||
}
|
||||
|
||||
@@ -472,6 +552,7 @@ function paf_call(args)
|
||||
|
||||
buf.destroy();
|
||||
file.close();
|
||||
if (fa != null) fasta_free(fa);
|
||||
}
|
||||
|
||||
function paf_stat(args)
|
||||
@@ -595,8 +676,10 @@ function paf_stat(args)
|
||||
last_qlen = ori_qlen;
|
||||
}
|
||||
}
|
||||
l_tot += last_qlen;
|
||||
l_cov += cov_len(regs);
|
||||
if (regs.length) {
|
||||
l_tot += last_qlen;
|
||||
l_cov += cov_len(regs);
|
||||
}
|
||||
|
||||
file.close();
|
||||
buf.destroy();
|
||||
@@ -912,14 +995,15 @@ function paf_view(args)
|
||||
|
||||
function paf_gff2bed(args)
|
||||
{
|
||||
var c, fn_ucsc_fai = null, is_short = false;
|
||||
while ((c = getopt(args, "u:s")) != null) {
|
||||
var c, fn_ucsc_fai = null, is_short = false, keep_gff = false;
|
||||
while ((c = getopt(args, "u:sg")) != null) {
|
||||
if (c == 'u') fn_ucsc_fai = getopt.arg;
|
||||
else if (c == 's') is_short = true;
|
||||
else if (c == 'g') keep_gff = true;
|
||||
}
|
||||
|
||||
if (getopt.ind == args.length) {
|
||||
print("Usage: paftools.js gff2bed [-u ucsc-genome.fa.fai] <in.gff>");
|
||||
print("Usage: paftools.js gff2bed [-g] [-u ucsc-genome.fa.fai] <in.gff>");
|
||||
exit(1);
|
||||
}
|
||||
|
||||
@@ -980,6 +1064,12 @@ function paf_gff2bed(args)
|
||||
var exons = [], cds_st = 1<<30, cds_en = 0, last_id = null;
|
||||
while (file.readline(buf) >= 0) {
|
||||
var t = buf.toString().split("\t");
|
||||
if (keep_gff) {
|
||||
if (t[0].charAt(0) != '#' && ens2ucsc[t[0]] != null)
|
||||
t[0] = ens2ucsc[t[0]];
|
||||
print(t.join("\t"));
|
||||
continue;
|
||||
}
|
||||
if (t[0].charAt(0) == '#') continue;
|
||||
if (t[2] != "CDS" && t[2] != "exon") continue;
|
||||
t[3] = parseInt(t[3]) - 1;
|
||||
@@ -1028,15 +1118,19 @@ function paf_gff2bed(args)
|
||||
|
||||
function paf_sam2paf(args)
|
||||
{
|
||||
var c, pri_only = false;
|
||||
var c, pri_only = false, use_eq = false;
|
||||
while ((c = getopt(args, "p")) != null)
|
||||
if (c == 'p') pri_only = true;
|
||||
if (args.length == getopt.ind) {
|
||||
print("Usage: paftools.js sam2paf [-p] <in.sam>");
|
||||
exit(1);
|
||||
}
|
||||
|
||||
var file = args.length == getopt.ind || args[getopt.ind] == "-"? new File() : new File(args[getopt.ind]);
|
||||
var file = args[getopt.ind] == "-"? new File() : new File(args[getopt.ind]);
|
||||
var buf = new Bytes();
|
||||
var re = /(\d+)([MIDSHNX=])/g;
|
||||
var re = /(\d+)([MIDSHNX=])/g, re_MD = /(\d+)|(\^[A-Za-z]+)|([A-Za-z])/g, re_tag = /\t(\S\S:[AZif]):(\S+)/g;
|
||||
|
||||
var len = {}, lineno = 0;
|
||||
var ctg_len = {}, lineno = 0;
|
||||
while (file.readline(buf) >= 0) {
|
||||
var m, n_cigar = 0, line = buf.toString();
|
||||
++lineno;
|
||||
@@ -1044,37 +1138,52 @@ function paf_sam2paf(args)
|
||||
if (/^@SQ/.test(line)) {
|
||||
var name = (m = /\tSN:(\S+)/.exec(line)) != null? m[1] : null;
|
||||
var l = (m = /\tLN:(\d+)/.exec(line)) != null? parseInt(m[1]) : null;
|
||||
if (name != null && l != null) len[name] = l;
|
||||
if (name != null && l != null) ctg_len[name] = l;
|
||||
}
|
||||
continue;
|
||||
}
|
||||
var t = line.split("\t");
|
||||
var t = line.split("\t", 11);
|
||||
var flag = parseInt(t[1]);
|
||||
if (t[9] != '*' && t[10] != '*' && t[9].length != t[10].length) throw Error("ERROR at line " + lineno + ": inconsistent SEQ and QUAL lengths - " + t[9].length + " != " + t[10].length);
|
||||
if (t[2] == '*' || (flag&4)) continue;
|
||||
if (t[9] != '*' && t[10] != '*' && t[9].length != t[10].length)
|
||||
throw Error("at line " + lineno + ": inconsistent SEQ and QUAL lengths - " + t[9].length + " != " + t[10].length);
|
||||
if (t[2] == '*' || (flag&4) || t[5] == '*') continue;
|
||||
if (pri_only && (flag&0x100)) continue;
|
||||
var tlen = len[t[2]];
|
||||
if (tlen == null) throw Error("ERROR at line " + lineno + ": can't find the length of contig " + t[2]);
|
||||
var nn = (m = /\tnn:i:(\d+)/.exec(line)) != null? parseInt(m[1]) : 0;
|
||||
var NM = (m = /\tNM:i:(\d+)/.exec(line)) != null? parseInt(m[1]) : null;
|
||||
var have_NM = NM == null? false : true;
|
||||
NM += nn;
|
||||
var clip = [0, 0], I = [0, 0], D = [0, 0], M = 0, N = 0, ql = 0, tl = 0, mm = 0, ext_cigar = false;
|
||||
while ((m = re.exec(t[5])) != null) {
|
||||
var l = parseInt(m[1]);
|
||||
if (m[2] == 'M') M += l, ql += l, tl += l, ext_cigar = false;
|
||||
else if (m[2] == 'I') ++I[0], I[1] += l, ql += l;
|
||||
else if (m[2] == 'D') ++D[0], D[1] += l, tl += l;
|
||||
else if (m[2] == 'N') N += l, tl += l;
|
||||
else if (m[2] == 'S') clip[M == 0? 0 : 1] = l, ql += l;
|
||||
else if (m[2] == 'H') clip[M == 0? 0 : 1] = l;
|
||||
else if (m[2] == '=') M += l, ql += l, tl += l, ext_cigar = true;
|
||||
else if (m[2] == 'X') M += l, ql += l, tl += l, mm += l, ext_cigar = true;
|
||||
++n_cigar;
|
||||
var tlen = ctg_len[t[2]];
|
||||
if (tlen == null) throw Error("at line " + lineno + ": can't find the length of contig " + t[2]);
|
||||
// find tags
|
||||
var nn = 0, NM = null, MD = null, md_list = [];
|
||||
while ((m = re_tag.exec(line)) != null) {
|
||||
if (m[1] == "NM:i") NM = parseInt(m[2]);
|
||||
else if (m[1] == "nn:i") nn = parseInt(m[2]);
|
||||
else if (m[1] == "MD:Z") MD = m[2];
|
||||
}
|
||||
if (t[9] == '*') MD = null;
|
||||
// infer various lengths from CIGAR
|
||||
var clip = [0, 0], soft_clip = 0, I = [0, 0], D = [0, 0], M = 0, N = 0, mm = 0, have_M = false, have_ext = false, cigar = [];
|
||||
while ((m = re.exec(t[5])) != null) {
|
||||
var l = parseInt(m[1]), op = m[2];
|
||||
if (op == 'M') M += l, have_M = true;
|
||||
else if (op == 'I') ++I[0], I[1] += l;
|
||||
else if (op == 'D') ++D[0], D[1] += l;
|
||||
else if (op == 'N') N += l;
|
||||
else if (op == 'S') clip[n_cigar == 0? 0 : 1] = l, soft_clip += l;
|
||||
else if (op == 'H') clip[n_cigar == 0? 0 : 1] = l;
|
||||
else if (op == '=') M += l, have_ext = true, op = 'M';
|
||||
else if (op == 'X') M += l, mm += l, have_ext = true, op = 'M';
|
||||
++n_cigar;
|
||||
if (MD != null && op != 'H') {
|
||||
if (cigar.length > 0 && cigar[cigar.length-1][1] == op)
|
||||
cigar[cigar.length-1][0] += l;
|
||||
else cigar.push([l, op]);
|
||||
}
|
||||
}
|
||||
var ql = M + I[1] + soft_clip;
|
||||
var tl = M + D[1] + N;
|
||||
var ts = parseInt(t[3]) - 1, te = ts + tl;
|
||||
// checking coordinate and length consistencies
|
||||
if (n_cigar > 65535)
|
||||
warn("WARNING at line " + lineno + ": " + n_cigar + " CIGAR operations");
|
||||
if (tl + parseInt(t[3]) - 1 > tlen) {
|
||||
if (te > tlen) {
|
||||
warn("WARNING at line " + lineno + ": alignment end position larger than ref length; skipped");
|
||||
continue;
|
||||
}
|
||||
@@ -1082,24 +1191,78 @@ function paf_sam2paf(args)
|
||||
warn("WARNING at line " + lineno + ": SEQ length inconsistent with CIGAR (" + t[9].length + " != " + ql + "); skipped");
|
||||
continue;
|
||||
}
|
||||
if (!have_NM || ext_cigar) NM = I[1] + D[1] + mm;
|
||||
if (NM < I[1] + D[1] + mm) {
|
||||
warn("WARNING at line " + lineno + ": NM is less than the total number of gaps (" + NM + " < " + (I[1]+D[1]+mm) + ")");
|
||||
NM = I[1] + D[1] + mm;
|
||||
// parse MD
|
||||
var cs = [];
|
||||
if (MD != null) {
|
||||
var k = 0, cx = 0, cy = 0, mx = 0, my = 0;
|
||||
while ((m = re_MD.exec(MD)) != null) {
|
||||
if (m[2] != null) { // deletion from the reference
|
||||
var len = m[2].length - 1;
|
||||
cs.push('-', m[2].substr(1));
|
||||
mx += len, cx += len, ++k;
|
||||
} else { // copy or mismatch
|
||||
var ml = m[1] != null? parseInt(m[1]) : 1;
|
||||
while (k < cigar.length && cigar[k][1] != 'D') {
|
||||
var cl = cigar[k][0], op = cigar[k][1];
|
||||
if (op == 'M') {
|
||||
if (my + ml < cy + cl) {
|
||||
if (ml > 0) {
|
||||
if (m[3] != null) cs.push('*', m[3], t[9][my]);
|
||||
else cs.push(':', ml);
|
||||
}
|
||||
mx += ml, my += ml, ml = 0;
|
||||
break;
|
||||
} else {
|
||||
var dl = cy + cl - my;
|
||||
cs.push(':', dl);
|
||||
cx += cl, cy += cl, ++k;
|
||||
mx += dl, my += dl, ml -= dl;
|
||||
}
|
||||
} else if (op == 'I') {
|
||||
cs.push('+', t[9].substr(cy, cl));
|
||||
cy += cl, my += cl, ++k;
|
||||
} else if (op == 'S') {
|
||||
cy += cl, my += cl, ++k;
|
||||
} else throw Error("at line " + lineno + ": inconsistent MD tag");
|
||||
}
|
||||
if (ml != 0) throw Error("at line " + lineno + ": inconsistent MD tag");
|
||||
}
|
||||
}
|
||||
if (cx != mx || cy != my) throw Error("at line " + lineno + ": inconsistent MD tag");
|
||||
}
|
||||
var extra = ["mm:i:"+(NM-I[1]-D[1]), "io:i:"+I[0], "in:i:"+I[1], "do:i:"+D[0], "dn:i:"+D[1]];
|
||||
var match = M - (NM - I[1] - D[1]);
|
||||
// compute matching length, block length and calibrate NM
|
||||
if (have_ext && !have_M) { // extended CIGAR
|
||||
if (NM != null && NM != I[1] + D[1] + mm)
|
||||
warn("WARNING at line " + lineno + ": NM is different from sum of gaps and mismatches");
|
||||
NM = I[1] + D[1] + mm;
|
||||
} else if (NM != null) { // standard CIGAR; NM present
|
||||
if (NM < I[1] + D[1]) {
|
||||
warn("WARNING at line " + lineno + ": NM is less than the total number of gaps (" + NM + " < " + (I[1]+D[1]) + ")");
|
||||
NM = I[1] + D[1];
|
||||
}
|
||||
mm = NM - (I[1] + D[1]);
|
||||
} else { // no way to compute mm
|
||||
warn("WARNING at line " + lineno + ": unable to find the number of mismatches; assuming zero");
|
||||
mm = 0;
|
||||
}
|
||||
var mlen = M - mm;
|
||||
var blen = M + I[1] + D[1];
|
||||
// find query name, start and end
|
||||
var qlen = M + I[1] + clip[0] + clip[1];
|
||||
var qs, qe;
|
||||
if (flag&16) qs = clip[1], qe = qlen - clip[0];
|
||||
else qs = clip[0], qe = qlen - clip[1];
|
||||
var ts = parseInt(t[3]) - 1, te = ts + M + D[1] + N;
|
||||
var qname = t[0];
|
||||
var qname = t[0], qs, qe;
|
||||
if ((flag&1) && (flag&0x40)) qname += '/1';
|
||||
if ((flag&1) && (flag&0x80)) qname += '/2';
|
||||
var a = [qname, qlen, qs, qe, flag&16? '-' : '+', t[2], tlen, ts, te, match, blen, t[4]];
|
||||
print(a.join("\t"), extra.join("\t"));
|
||||
if (flag&16) qs = clip[1], qe = qlen - clip[0];
|
||||
else qs = clip[0], qe = qlen - clip[1];
|
||||
// optional tags
|
||||
var type = flag&0x100? 'S' : 'P';
|
||||
var tags = ["tp:A:" + type];
|
||||
if (NM != null) tags.push("mm:i:"+mm);
|
||||
tags.push("gn:i:"+(I[1]+D[1]), "go:i:"+(I[0]+D[0]), "cg:Z:" + t[5].replace(/\d+[SH]/g, ''));
|
||||
if (cs.length > 0) tags.push("cs:Z:" + cs.join(""));
|
||||
// print out
|
||||
var a = [qname, qlen, qs, qe, flag&16? '-' : '+', t[2], tlen, ts, te, mlen, blen, t[4]];
|
||||
print(a.join("\t"), tags.join("\t"));
|
||||
}
|
||||
|
||||
buf.destroy();
|
||||
@@ -1597,26 +1760,28 @@ function paf_pbsim2fq(args)
|
||||
|
||||
function paf_junceval(args)
|
||||
{
|
||||
var c, l_fuzzy = 0, print_ovlp = false, print_err_only = false, first_only = false;
|
||||
while ((c = getopt(args, "l:ep")) != null) {
|
||||
var c, l_fuzzy = 0, print_ovlp = false, print_err_only = false, first_only = false, chr_only = false;
|
||||
while ((c = getopt(args, "l:epc")) != null) {
|
||||
if (c == 'l') l_fuzzy = parseInt(getopt.arg);
|
||||
else if (c == 'e') print_err_only = print_ovlp = true;
|
||||
else if (c == 'p') print_ovlp = true;
|
||||
else if (c == 'c') chr_only = true;
|
||||
}
|
||||
|
||||
if (args.length - getopt.ind < 2) {
|
||||
if (args.length - getopt.ind < 1) {
|
||||
print("Usage: paftools.js junceval [options] <gene.gtf> <aln.sam>");
|
||||
print("Options:");
|
||||
print(" -l INT tolerance of junction positions (0 for exact) [0]");
|
||||
print(" -p print overlapping introns");
|
||||
print(" -e print erroreous overlapping introns");
|
||||
print(" -c only consider alignments to /^(chr)?([0-9]+|X|Y)$/");
|
||||
exit(1);
|
||||
}
|
||||
|
||||
var file, buf = new Bytes();
|
||||
|
||||
var tr = {};
|
||||
file = new File(args[getopt.ind]);
|
||||
file = args[getopt.ind] == '-'? new File() : new File(args[getopt.ind]);
|
||||
while (file.readline(buf) >= 0) {
|
||||
var m, t = buf.toString().split("\t");
|
||||
if (t[0].charAt(0) == '#') continue;
|
||||
@@ -1661,13 +1826,14 @@ function paf_junceval(args)
|
||||
var n_pri = 0, n_unmapped = 0, n_mapped = 0;
|
||||
var n_sgl = 0, n_splice = 0, n_splice_hit = 0, n_splice_novel = 0;
|
||||
|
||||
file = new File(args[getopt.ind+1]);
|
||||
file = getopt.ind+1 >= args.length || args[getopt.ind+1] == '-'? new File() : new File(args[getopt.ind+1]);
|
||||
var last_qname = null;
|
||||
var re_cigar = /(\d+)([MIDNSHX=])/g;
|
||||
while (file.readline(buf) >= 0) {
|
||||
var m, t = buf.toString().split("\t");
|
||||
|
||||
if (t[0].charAt(0) == '@') continue;
|
||||
if (chr_only && !/^(chr)?([0-9]+|X|Y)$/.test(t[2])) continue;
|
||||
var flag = parseInt(t[1]);
|
||||
if (flag&0x100) continue;
|
||||
if (first_only && last_qname == t[0]) continue;
|
||||
|
||||
@@ -75,7 +75,7 @@ int mm_set_sam_pri(int n, mm_reg1_t *r);
|
||||
void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r, int sub_diff);
|
||||
void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int *n_, mm_reg1_t *r);
|
||||
void mm_select_sub_multi(void *km, float pri_ratio, float pri1, float pri2, int max_gap_ref, int min_diff, int best_n, int n_segs, const int *qlens, int *n_, mm_reg1_t *r);
|
||||
void mm_filter_regs(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs);
|
||||
void mm_filter_regs(const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs);
|
||||
void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs, mm128_t *a);
|
||||
void mm_hit_sort_by_dp(void *km, int *n_regs, mm_reg1_t *r);
|
||||
void mm_set_mapq(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr);
|
||||
@@ -86,6 +86,8 @@ mm_seg_t *mm_seg_gen(void *km, uint32_t hash, int n_segs, const int *qlens, int
|
||||
void mm_seg_free(void *km, int n_segs, mm_seg_t *segs);
|
||||
void mm_pair(void *km, int max_gap_ref, int dp_bonus, int sub_diff, int match_sc, const int *qlens, int *n_regs, mm_reg1_t **regs);
|
||||
|
||||
void mm_err_puts(const char *str);
|
||||
|
||||
#ifdef __cplusplus
|
||||
}
|
||||
#endif
|
||||
|
||||
@@ -31,8 +31,10 @@ void mm_mapopt_init(mm_mapopt_t *opt)
|
||||
opt->max_join_long = 20000;
|
||||
opt->max_join_short = 2000;
|
||||
opt->min_join_flank_sc = 1000;
|
||||
opt->min_join_flank_ratio = 0.5f;
|
||||
|
||||
opt->a = 2, opt->b = 4, opt->q = 4, opt->e = 2, opt->q2 = 24, opt->e2 = 1;
|
||||
opt->sc_ambi = 1;
|
||||
opt->zdrop = 400, opt->zdrop_inv = 200;
|
||||
opt->end_bonus = -1;
|
||||
opt->min_dp_max = opt->min_chain_score * opt->a;
|
||||
@@ -51,6 +53,8 @@ void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
|
||||
opt->flag |= MM_F_SPLICE;
|
||||
if (opt->mid_occ <= 0)
|
||||
opt->mid_occ = mm_idx_cal_max_occ(mi, opt->mid_occ_frac);
|
||||
if (opt->mid_occ < opt->min_mid_occ)
|
||||
opt->mid_occ = opt->min_mid_occ;
|
||||
if (mm_verbose >= 3)
|
||||
fprintf(stderr, "[M::%s::%.3f*%.2f] mid_occ = %d\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), opt->mid_occ);
|
||||
}
|
||||
@@ -70,6 +74,7 @@ int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
|
||||
io->flag = 0, io->k = 15, io->w = 5;
|
||||
mo->flag |= MM_F_ALL_CHAINS | MM_F_NO_DIAG | MM_F_NO_DUAL | MM_F_NO_LJOIN;
|
||||
mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_gap = 10000, mo->max_chain_skip = 25;
|
||||
mo->bw = 2000;
|
||||
} else if (strcmp(preset, "ava-pb") == 0) {
|
||||
io->flag |= MM_I_HPC, io->k = 19, io->w = 5;
|
||||
mo->flag |= MM_F_ALL_CHAINS | MM_F_NO_DIAG | MM_F_NO_DUAL | MM_F_NO_LJOIN;
|
||||
@@ -81,11 +86,19 @@ int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
|
||||
} else if (strcmp(preset, "asm5") == 0) {
|
||||
io->flag = 0, io->k = 19, io->w = 19;
|
||||
mo->a = 1, mo->b = 19, mo->q = 39, mo->q2 = 81, mo->e = 3, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
|
||||
mo->min_mid_occ = 100;
|
||||
mo->min_dp_max = 200;
|
||||
mo->best_n = 50;
|
||||
} else if (strcmp(preset, "asm10") == 0) {
|
||||
io->flag = 0, io->k = 19, io->w = 19;
|
||||
mo->a = 1, mo->b = 9, mo->q = 16, mo->q2 = 41, mo->e = 2, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
|
||||
mo->min_mid_occ = 100;
|
||||
mo->min_dp_max = 200;
|
||||
mo->best_n = 50;
|
||||
} else if (strcmp(preset, "asm20") == 0) {
|
||||
io->flag = 0, io->k = 19, io->w = 10;
|
||||
mo->a = 1, mo->b = 4, mo->q = 6, mo->q2 = 26, mo->e = 2, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
|
||||
mo->min_mid_occ = 100;
|
||||
mo->min_dp_max = 200;
|
||||
mo->best_n = 50;
|
||||
} else if (strcmp(preset, "short") == 0 || strcmp(preset, "sr") == 0) {
|
||||
@@ -119,6 +132,11 @@ int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
|
||||
|
||||
int mm_check_opt(const mm_idxopt_t *io, const mm_mapopt_t *mo)
|
||||
{
|
||||
if (io->k <= 0 || io->w <= 0) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "[ERROR]\033[1;31m -k and -w must be positive\033[0m\n");
|
||||
return -5;
|
||||
}
|
||||
if (mo->best_n < 0) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "[ERROR]\033[1;31m -N must be no less than 0\033[0m\n");
|
||||
|
||||
@@ -105,7 +105,7 @@ void mm_pair(void *km, int max_gap_ref, int pe_bonus, int sub_diff, int match_sc
|
||||
max = -1;
|
||||
max_idx[0] = max_idx[1] = -1;
|
||||
last[0] = last[1] = -1;
|
||||
kv_resize(uint64_t, km, sc, n);
|
||||
kv_resize(uint64_t, km, sc, (size_t)n);
|
||||
for (i = 0; i < n; ++i) {
|
||||
if (a[i].key & 1) { // reverse first read or forward second read
|
||||
mm_reg1_t *q, *r;
|
||||
@@ -151,8 +151,8 @@ void mm_pair(void *km, int max_gap_ref, int pe_bonus, int sub_diff, int match_sc
|
||||
}
|
||||
}
|
||||
mapq_pe = r[0]->mapq > r[1]->mapq? r[0]->mapq : r[1]->mapq;
|
||||
for (i = 0; i < sc.n; ++i)
|
||||
if ((sc.a[i]>>32) + sub_diff >= max>>32)
|
||||
for (i = 0; i < (int)sc.n; ++i)
|
||||
if ((sc.a[i]>>32) + sub_diff >= (uint64_t)max>>32)
|
||||
++n_sub;
|
||||
if (sc.n > 1) {
|
||||
int mapq_pe_alt;
|
||||
@@ -164,7 +164,7 @@ void mm_pair(void *km, int max_gap_ref, int pe_bonus, int sub_diff, int match_sc
|
||||
if (sc.n == 1) {
|
||||
if (r[0]->mapq < 2) r[0]->mapq = 2;
|
||||
if (r[1]->mapq < 2) r[1]->mapq = 2;
|
||||
} else if (max>>32 > sc.a[sc.n - 2]>>32) {
|
||||
} else if ((uint64_t)max>>32 > sc.a[sc.n - 2]>>32) {
|
||||
if (r[0]->mapq < 1) r[0]->mapq = 1;
|
||||
if (r[1]->mapq < 1) r[1]->mapq = 1;
|
||||
}
|
||||
|
||||
+4
-4
@@ -119,11 +119,11 @@ static char *mappy_fetch_seq(const mm_idx_t *mi, const char *name, int st, int e
|
||||
*len = 0;
|
||||
rid = mm_idx_name2id(mi, name);
|
||||
if (rid < 0) return 0;
|
||||
if (st >= mi->seq[i].len || st >= en) return 0;
|
||||
if (en < 0 || en > mi->seq[i].len)
|
||||
en = mi->seq[i].len;
|
||||
if (st >= mi->seq[rid].len || st >= en) return 0;
|
||||
if (en < 0 || en > mi->seq[rid].len)
|
||||
en = mi->seq[rid].len;
|
||||
s = (char*)malloc(en - st + 1);
|
||||
*len = mm_idx_getseq(mi, rid, st, en, s);
|
||||
*len = mm_idx_getseq(mi, rid, st, en, (uint8_t*)s);
|
||||
for (i = 0; i < *len; ++i)
|
||||
s[i] = "ACGTN"[(uint8_t)s[i]];
|
||||
s[*len] = 0;
|
||||
|
||||
+5
-1
@@ -24,7 +24,9 @@ cdef extern from "minimap.h":
|
||||
int best_n
|
||||
int max_join_long, max_join_short
|
||||
int min_join_flank_sc
|
||||
float min_join_flank_ratio;
|
||||
int a, b, q, e, q2, e2
|
||||
int sc_ambi
|
||||
int noncan
|
||||
int zdrop, zdrop_inv
|
||||
int end_bonus
|
||||
@@ -34,6 +36,7 @@ cdef extern from "minimap.h":
|
||||
float max_clip_ratio
|
||||
int pe_ori, pe_bonus
|
||||
float mid_occ_frac
|
||||
int32_t min_mid_occ
|
||||
int32_t mid_occ
|
||||
int32_t max_occ
|
||||
int mini_batch_size
|
||||
@@ -58,7 +61,8 @@ cdef extern from "minimap.h":
|
||||
mm_idx_seq_t *seq
|
||||
uint32_t *S
|
||||
mm_idx_bucket_t *B
|
||||
void *km, *h
|
||||
void *km
|
||||
void *h
|
||||
|
||||
ctypedef struct mm_idx_reader_t:
|
||||
pass
|
||||
|
||||
+10
-4
@@ -3,6 +3,8 @@ from libc.stdlib cimport free
|
||||
cimport cmappy
|
||||
import sys
|
||||
|
||||
__version__ = '2.11'
|
||||
|
||||
cmappy.mm_reset_timer()
|
||||
|
||||
cdef class Alignment:
|
||||
@@ -100,7 +102,7 @@ cdef class Aligner:
|
||||
cdef cmappy.mm_idxopt_t idx_opt
|
||||
cdef cmappy.mm_mapopt_t map_opt
|
||||
|
||||
def __cinit__(self, fn_idx_in, preset=None, k=None, w=None, min_cnt=None, min_chain_score=None, min_dp_score=None, bw=None, best_n=None, n_threads=3, fn_idx_out=None):
|
||||
def __cinit__(self, fn_idx_in, preset=None, k=None, w=None, min_cnt=None, min_chain_score=None, min_dp_score=None, bw=None, best_n=None, n_threads=3, fn_idx_out=None, max_frag_len=None):
|
||||
cmappy.mm_set_opt(NULL, &self.idx_opt, &self.map_opt) # set the default options
|
||||
if preset is not None:
|
||||
cmappy.mm_set_opt(str.encode(preset), &self.idx_opt, &self.map_opt) # apply preset
|
||||
@@ -113,6 +115,7 @@ cdef class Aligner:
|
||||
if min_dp_score is not None: self.map_opt.min_dp_max = min_dp_score
|
||||
if bw is not None: self.map_opt.bw = bw
|
||||
if best_n is not None: self.map_opt.best_n = best_n
|
||||
if max_frag_len is not None: self.map_opt.max_frag_len = max_frag_len
|
||||
|
||||
cdef cmappy.mm_idx_reader_t *r;
|
||||
if fn_idx_out is None:
|
||||
@@ -132,11 +135,14 @@ cdef class Aligner:
|
||||
def __bool__(self):
|
||||
return (self._idx != NULL)
|
||||
|
||||
def map(self, seq, seq2=None, buf=None):
|
||||
def map(self, seq, seq2=None, buf=None, max_frag_len=None):
|
||||
cdef cmappy.mm_reg1_t *regs
|
||||
cdef cmappy.mm_hitpy_t h
|
||||
cdef ThreadBuffer b
|
||||
cdef int n_regs
|
||||
cdef cmappy.mm_mapopt_t map_opt
|
||||
map_opt = self.map_opt
|
||||
if max_frag_len is not None: map_opt.max_frag_len = max_frag_len
|
||||
|
||||
if self._idx is NULL: return None
|
||||
if buf is None: b = ThreadBuffer()
|
||||
@@ -144,10 +150,10 @@ cdef class Aligner:
|
||||
|
||||
_seq = seq if isinstance(seq, bytes) else seq.encode()
|
||||
if seq2 is None:
|
||||
regs = cmappy.mm_map_aux(self._idx, _seq, NULL, &n_regs, b._b, &self.map_opt)
|
||||
regs = cmappy.mm_map_aux(self._idx, _seq, NULL, &n_regs, b._b, &map_opt)
|
||||
else:
|
||||
_seq2 = seq2 if isinstance(seq2, bytes) else seq2.encode()
|
||||
regs = cmappy.mm_map_aux(self._idx, _seq, _seq2, &n_regs, b._b, &self.map_opt)
|
||||
regs = cmappy.mm_map_aux(self._idx, _seq, _seq2, &n_regs, b._b, &map_opt)
|
||||
|
||||
for i in range(n_regs):
|
||||
cmappy.mm_reg2hitpy(self._idx, ®s[i], &h)
|
||||
|
||||
@@ -70,10 +70,10 @@ void sdust_buf_destroy(sdust_buf_t *buf)
|
||||
static inline void shift_window(int t, kdq_t(int) *w, int T, int W, int *L, int *rw, int *rv, int *cw, int *cv)
|
||||
{
|
||||
int s;
|
||||
if (kdq_size(w) >= W - SD_WLEN + 1) { // TODO: is this right for SD_WLEN!=3?
|
||||
if ((int)kdq_size(w) >= W - SD_WLEN + 1) { // TODO: is this right for SD_WLEN!=3?
|
||||
s = *kdq_shift(int, w);
|
||||
*rw -= --cw[s];
|
||||
if (*L > kdq_size(w))
|
||||
if (*L > (int)kdq_size(w))
|
||||
--*L, *rv -= --cv[s];
|
||||
}
|
||||
kdq_push(int, w, t);
|
||||
@@ -114,7 +114,7 @@ static void find_perfect(void *km, perf_intv_v *P, const kdq_t(int) *w, int T, i
|
||||
r += c[t]++;
|
||||
new_r = r, new_l = kdq_size(w) - i - 1;
|
||||
if (new_r * 10 > T * new_l) {
|
||||
for (j = 0; j < P->n && P->a[j].start >= i + start; ++j) { // find insertion position
|
||||
for (j = 0; j < (int)P->n && P->a[j].start >= i + start; ++j) { // find insertion position
|
||||
perf_intv_t *p = &P->a[j];
|
||||
if (max_r == 0 || p->r * max_l > max_r * p->l)
|
||||
max_r = p->r, max_l = p->l;
|
||||
|
||||
@@ -23,7 +23,7 @@ def readme():
|
||||
|
||||
setup(
|
||||
name = 'mappy',
|
||||
version = '2.9',
|
||||
version = '2.11',
|
||||
url = 'https://github.com/lh3/minimap2',
|
||||
description = 'Minimap2 python binding',
|
||||
long_description = readme(),
|
||||
@@ -39,7 +39,7 @@ setup(
|
||||
depends = ['minimap.h', 'bseq.h', 'kalloc.h', 'kdq.h', 'khash.h', 'kseq.h', 'ksort.h',
|
||||
'ksw2.h', 'kthread.h', 'kvec.h', 'mmpriv.h', 'sdust.h',
|
||||
'python/cmappy.h', 'python/cmappy.pxd'],
|
||||
extra_compile_args = ['-DHAVE_KALLOC', '-msse4'], # WARNING: ancient x86_64 CPUs don't have SSE4
|
||||
extra_compile_args = ['-DHAVE_KALLOC', '-msse4.1'], # WARNING: ancient x86_64 CPUs don't have SSE4
|
||||
include_dirs = ['.'],
|
||||
libraries = ['z', 'm', 'pthread'])],
|
||||
classifiers = [
|
||||
|
||||
+1
-1
@@ -1,4 +1,4 @@
|
||||
>MT_orang
|
||||
>MT_orang co:Z:comment
|
||||
GTTTATGTAGCTTATTCTATCCAAAGCAATGCACTGAAAATGTCTCGACGGGCCCACACG
|
||||
CCCCATAAACAAATAGGTTTGGTCCTAGCCTTTCTATTAGCTCTTAGTGAGGTTACACAT
|
||||
GCAAGCATCCCCGCCCCAGTGAGTCGCCCTCCAAGTCACTCTGACTAAGAGGAGCAAGCA
|
||||
|
||||
+16
-15
@@ -61,13 +61,6 @@
|
||||
Volume = {32},
|
||||
Year = {2016}}
|
||||
|
||||
@misc{Suzuki:2016,
|
||||
title = {Fast and accurate alignment tool for PacBio and Nanopore long reads},
|
||||
author = {Hajime Suzuki},
|
||||
journal = {Unpublished},
|
||||
howpublished = {\href{https://github.com/ocxtal/minialign}{https://github.com/ocxtal/minialign}},
|
||||
year = {2016}}
|
||||
|
||||
@misc{Ruan:2016,
|
||||
title = {Ultra-fast de novo assembler using long noisy reads},
|
||||
author = {Jue Ruan},
|
||||
@@ -172,14 +165,6 @@
|
||||
Volume = {29},
|
||||
Year = {2011}}
|
||||
|
||||
@article {Suzuki130633,
|
||||
author = {Suzuki, Hajime and Kasahara, Masahiro},
|
||||
title = {Acceleration Of Nucleotide Semi-Global Alignment With Adaptive Banded Dynamic Programming},
|
||||
year = {2017},
|
||||
note = {doi:10.1101/130633},
|
||||
publisher = {Cold Spring Harbor Labs Journals},
|
||||
journal = {bioRxiv}}
|
||||
|
||||
@article{Gotoh:1982aa,
|
||||
Author = {Gotoh, O},
|
||||
Journal = {J Mol Biol},
|
||||
@@ -337,3 +322,19 @@
|
||||
Title = {{MUMmer4}: A fast and versatile genome alignment system},
|
||||
Volume = {14},
|
||||
Year = {2018}}
|
||||
|
||||
@article{Li:2009ys,
|
||||
Author = {Li, Heng and others},
|
||||
Journal = {Bioinformatics},
|
||||
Pages = {2078-9},
|
||||
Title = {The {Sequence Alignment/Map format and SAMtools}},
|
||||
Volume = {25},
|
||||
Year = {2009}}
|
||||
|
||||
@article{Suzuki:2018aa,
|
||||
Author = {Suzuki, Hajime and Kasahara, Masahiro},
|
||||
Journal = {BMC Bioinformatics},
|
||||
Pages = {45},
|
||||
Title = {Introducing difference recurrence relations for faster semi-global alignment of long sequences},
|
||||
Volume = {19},
|
||||
Year = {2018}}
|
||||
|
||||
+23
-16
@@ -19,7 +19,7 @@
|
||||
\begin{document}
|
||||
\firstpage{1}
|
||||
|
||||
\title[Aligning nucleotide sequences with minimap2]{Minimap2: versatile pairwise alignment for nucleotide sequences}
|
||||
\title[Aligning nucleotide sequences with minimap2]{Minimap2: pairwise alignment for nucleotide sequences}
|
||||
\author[Li]{Heng Li}
|
||||
\address{Broad Institute, 415 Main Street, Cambridge, MA 02142, USA}
|
||||
|
||||
@@ -64,7 +64,7 @@ the thought that 10kb long sequences should be easier to map than 100bp reads
|
||||
because we can more effectively skip repetitive regions, which are often the
|
||||
bottleneck of short-read alignment. We confirmed our speculation by achieving
|
||||
approximate mapping 50 times faster than BWA-MEM~\citep{Li:2016aa}.
|
||||
\citet{Suzuki130633} extended our work with a fast and novel algorithm on
|
||||
\citet{Suzuki:2018aa} extended our work with a fast and novel algorithm on
|
||||
generating base-level alignment, which in turn inspired us to develop minimap2
|
||||
with added functionality.
|
||||
|
||||
@@ -88,7 +88,9 @@ the versatility of minimap2.
|
||||
|
||||
Minimap2 follows a typical seed-chain-align procedure as is used by most
|
||||
full-genome aligners. It collects minimizers~\citep{Roberts:2004fv} of the
|
||||
reference sequences and indexes them in a hash table. Then for each query
|
||||
reference sequences and indexes them in a hash table, with the key being the
|
||||
hash of a minimizer and the value being a list of locations of the minimizer
|
||||
copies. Then for each query
|
||||
sequence, minimap2 takes query minimizers as \emph{seeds}, finds exact matches
|
||||
(i.e. \emph{anchors}) to the reference, and identifies sets of colinear anchors as
|
||||
\emph{chains}. If base-level alignment is requested, minimap2 applies dynamic
|
||||
@@ -118,9 +120,12 @@ distance between two anchors is too large); otherwise
|
||||
\begin{equation}\label{eq:chain-gap}
|
||||
\beta(j,i)=\gamma_c\big((y_i-y_j)-(x_i-x_j)\big)
|
||||
\end{equation}
|
||||
In implementation, a gap of length $l\not=0$ costs
|
||||
In implementation, a gap of length $l$ costs
|
||||
\[
|
||||
\gamma_c(l)=0.01\cdot \bar{w}\cdot|l|+0.5\log_2|l|
|
||||
\gamma_c(l)=\left\{\begin{array}{ll}
|
||||
0.01\cdot \bar{w}\cdot|l|+0.5\log_2|l| & (l\not=0) \\
|
||||
0 & (l=0)
|
||||
\end{array}\right.
|
||||
\]
|
||||
where $\bar{w}$ is the average seed length. For $N$ anchors, directly computing all $f(\cdot)$ with
|
||||
Eq.~(\ref{eq:chain}) takes $O(N^2)$ time. Although theoretically faster
|
||||
@@ -164,7 +169,7 @@ empirical formula:
|
||||
\[
|
||||
{\rm mapQ}=40\cdot (1-f_2/f_1)\cdot\min\{1,m/10\}\cdot\log f_1
|
||||
\]
|
||||
where $m$ is the number of anchors on the primary chain, $f_1$ is the chaining
|
||||
where $\log$ denotes natural logarithm, $m$ is the number of anchors on the primary chain, $f_1$ is the chaining
|
||||
score, and $f_2\le f_1$ is the score of the best chain that is secondary to the
|
||||
primary chain. Intuitively, a chain is assigned to a higher mapping quality if
|
||||
it is long and its best secondary chain is weak.
|
||||
@@ -253,7 +258,7 @@ performance of minimap2. Traditional SSE implementations~\citep{Farrar:2007hs}
|
||||
based on Eq.~(\ref{eq:ae86}) can achieve 16-way parallelization for short
|
||||
sequences, but only 4-way parallelization when the peak alignment score reaches
|
||||
32767. Long sequence alignment may exceed this threshold. Inspired by
|
||||
\citet{Wu:1996aa} and the following work, \citet{Suzuki130633} proposed a
|
||||
\citet{Wu:1996aa} and the following work, \citet{Suzuki:2018aa} proposed a
|
||||
difference-based formulation that lifted this limitation.
|
||||
In case of 2-piece gap cost, define
|
||||
\[
|
||||
@@ -320,7 +325,7 @@ y_{rt}&=&\max\{0,y_{r-1,t}+u_{r-1,t}-z_{rt}+q\}-q-e\\
|
||||
\end{equation*}
|
||||
In this formulation, cells with the same diagonal index $r$ are independent of
|
||||
each other. This allows us to fully vectorize the computation of all cells on
|
||||
the same anti-diagonal in one inner loop. It also simplifies banded alignment,
|
||||
the same anti-diagonal in one inner loop. It also simplifies banded alignment (500bp band width by default),
|
||||
which would be difficult with striped vectorization~\citep{Farrar:2007hs}.
|
||||
|
||||
On the condition that $q+e<\tilde{q}+\tilde{e}$ and $e>\tilde{e}$, the initial
|
||||
@@ -355,7 +360,7 @@ times as fast as Parasail's 4-way vectorization~\citep{Daily:2016aa}. Without
|
||||
banding, our implementation is slower than Edlib~\citep{Sosic:2017aa}, but with
|
||||
a 1000bp band, it is considerably faster. When performing global alignment
|
||||
between anchors, we expect the alignment to stay close to the diagonal of the
|
||||
DP matrix. Banding is applicable most of time.
|
||||
DP matrix. Banding is applicable most of the time.
|
||||
|
||||
\subsubsection{The Z-drop heuristic}
|
||||
|
||||
@@ -478,7 +483,7 @@ both C and Python. It is distributed under the MIT license, free to both
|
||||
commercial and academic uses. Minimap2 uses the same base algorithm for all
|
||||
applications, but it has to apply different sets of parameters depending on
|
||||
input data types. Similar to BWA-MEM, minimap2 introduces `presets' that
|
||||
modify multiple parameters with a simple invokation. Detailed settings
|
||||
modify multiple parameters with a simple invocation. Detailed settings
|
||||
and command-line options can be found in the minimap2 manpage. In addition to
|
||||
the applications evaluated in the following sections, minimap2 also retains
|
||||
minimap's functionality to find overlaps between long reads and to search
|
||||
@@ -570,7 +575,7 @@ Peak RAM (GByte) & 8.9 & 14.5 & 3.2 & 29.2\vspace{1em}\\
|
||||
\% approx. introns & 91.8\% & 96.9\% & 92.5\% & 82.4\% \\
|
||||
\botrule
|
||||
\end{tabular}
|
||||
}{Mouse reads (AC:SRR5286960; R9.4 chemistry) were mapped to the primary assembly of mouse
|
||||
}{Mouse cDNA reads (AC:SRR5286960; R9.4 chemistry) were mapped to the primary assembly of mouse
|
||||
genome GRCm38 with the following tools and command options: minimap2 (`-ax
|
||||
splice'); GMAP (`-n 0 --min-intronlength 30 --cross-species'); SpAln (`-Q7 -LS
|
||||
-S3'); STARlong (according to
|
||||
@@ -579,7 +584,7 @@ compared to the EnsEMBL gene annotation, release 89. A predicted intron
|
||||
is \emph{novel} if it has no overlaps with any annotated introns. An intron
|
||||
is \emph{exact} if it is identical to an annotated intron. An intron is
|
||||
\emph{approximate} if both its 5'- and 3'-end are within 10bp around the ends
|
||||
of an annotated intron.}
|
||||
of an annotated intron. Chimeric alignments are defined in the SAM spec~\citep{Li:2009ys}.}
|
||||
\end{table}
|
||||
|
||||
We next aligned real mouse reads~\citep{Byrne:2017aa} with GMAP~(v2017-06-20;
|
||||
@@ -647,9 +652,9 @@ across the whole genome and have been \emph{de novo} assembled with SMRT reads
|
||||
to high quality. This allowed us to construct an independent truth variant
|
||||
dataset~\citep{Li223297} for
|
||||
ERR1341796. In this evaluation, minimap2 has higher SNP false negative rate
|
||||
(FNR; 2.5\% of minimap2 vs 2.2\% of BWA-MEM), but fewer false positive SNPs per
|
||||
million bases (FPPM; 3.0 vs 3.9), lower 2--50bp INDEL FNR (7.3\% vs 7.5\%) and
|
||||
similar INDEL FPPM (both 1.0). Minimap2 is broadly similar to BWA-MEM in the
|
||||
(FNR; 2.6\% of minimap2 vs 2.3\% of BWA-MEM), but fewer false positive SNPs per
|
||||
million bases (FPPM; 7.0 vs 8.8), similar INDEL FNR (11.2\% vs 11.3\%) and
|
||||
similar INDEL FPPM (6.4 vs 6.5). Minimap2 is broadly comparable to BWA-MEM in the
|
||||
context of small variant calling.
|
||||
|
||||
\subsection{Aligning long-read assemblies}
|
||||
@@ -687,7 +692,7 @@ involving $>$100kb introns, which was impractically slow ten years ago. The
|
||||
minimap2 chaining algorithm is fast and highly accurate by itself. In fact,
|
||||
chaining alone is more accurate than all the other long-read mappers in
|
||||
Fig.~\ref{fig:eval}a (data not shown). This accuracy helps to reduce downstream
|
||||
base-level alignment of candidate chains, which is still times slower than
|
||||
base-level alignment of candidate chains, which is still several times slower than
|
||||
chaining even with the Suzuki-Kasahara improvement. In addition, taking a
|
||||
general form, minimap2 chaining can be adapted to non-typical data types such as
|
||||
spliced reads and multiple reads per fragment. This gives us the opportunity to
|
||||
@@ -712,6 +717,8 @@ Schatz, P. Rescheneder and F. Sedlazeck for pointing out the limitation of
|
||||
BWA-MEM. We are also grateful to minimap2 users who have greatly helped to
|
||||
suggest features and to fix various issues.
|
||||
|
||||
\paragraph{Funding\textcolon} NHGRI 1R01HG010040-01
|
||||
|
||||
\bibliography{minimap2}
|
||||
|
||||
\end{document}
|
||||
|
||||
Reference in New Issue
Block a user