updated the manpage

.gitignore

@@ -1,6 +0,0 @@
-.cproject
-.project
-.*.swp
-*.a
-*.o
-*.dSYM

.travis.yml

@@ -1,5 +0,0 @@
-language: c
-compiler:
-  - gcc
-  - clang
-script: make

LICENSE.txt

@@ -1,23 +0,0 @@
-The MIT License
-
-Copyright (c) 2017 Broad Institute, Inc.
-
-Permission is hereby granted, free of charge, to any person obtaining
-a copy of this software and associated documentation files (the
-"Software"), to deal in the Software without restriction, including
-without limitation the rights to use, copy, modify, merge, publish,
-distribute, sublicense, and/or sell copies of the Software, and to
-permit persons to whom the Software is furnished to do so, subject to
-the following conditions:
-
-The above copyright notice and this permission notice shall be
-included in all copies or substantial portions of the Software.
-
-THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
-EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
-MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
-NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS
-BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN
-ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN
-CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
-SOFTWARE.

Makefile

@@ -1,83 +0,0 @@
-CC=			gcc
-CFLAGS=		-g -Wall -O2 -Wc++-compat
-CPPFLAGS=	-DHAVE_KALLOC
-INCLUDES=
-OBJS=		kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o index.o chain.o align.o hit.o map.o format.o ksw2_ll_sse.o
-PROG=		minimap2
-PROG_EXTRA=	sdust minimap2-lite
-LIBS=		-lm -lz -lpthread
-
-ifeq ($(sse2only),)
-	OBJS+=ksw2_extz2_sse41.o ksw2_extd2_sse41.o ksw2_exts2_sse41.o ksw2_extz2_sse2.o ksw2_extd2_sse2.o ksw2_exts2_sse2.o ksw2_dispatch.o
-else
-	OBJS+=ksw2_extz2_sse.o ksw2_extd2_sse.o ksw2_exts2_sse.o
-endif
-
-.SUFFIXES:.c .o
-
-.c.o:
-		$(CC) -c $(CFLAGS) $(CPPFLAGS) $(INCLUDES) $< -o $@
-
-all:$(PROG)
-
-extra:all $(PROG_EXTRA)
-
-minimap2:main.o getopt.o libminimap2.a
-		$(CC) $(CFLAGS) main.o getopt.o -o $@ -L. -lminimap2 $(LIBS)
-
-minimap2-lite:example.o libminimap2.a
-		$(CC) $(CFLAGS) $< -o $@ -L. -lminimap2 $(LIBS)
-
-libminimap2.a:$(OBJS)
-		$(AR) -csru $@ $(OBJS)
-
-sdust:sdust.c getopt.o kalloc.o kalloc.h kdq.h kvec.h kseq.h sdust.h
-		$(CC) -D_SDUST_MAIN $(CFLAGS) $< getopt.o kalloc.o -o $@ -lz
-
-ksw2_extz2_sse41.o:ksw2_extz2_sse.c ksw2.h kalloc.h
-		$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
-
-ksw2_extz2_sse2.o:ksw2_extz2_sse.c ksw2.h kalloc.h
-		$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
-
-ksw2_extd2_sse41.o:ksw2_extd2_sse.c ksw2.h kalloc.h
-		$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
-
-ksw2_extd2_sse2.o:ksw2_extd2_sse.c ksw2.h kalloc.h
-		$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
-
-ksw2_exts2_sse41.o:ksw2_exts2_sse.c ksw2.h kalloc.h
-		$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
-
-ksw2_exts2_sse2.o:ksw2_exts2_sse.c ksw2.h kalloc.h
-		$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
-
-ksw2_dispatch.o:ksw2_dispatch.c ksw2.h
-		$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
-
-clean:
-		rm -fr gmon.out *.o a.out $(PROG) $(PROG_EXTRA) *~ *.a *.dSYM session*
-
-depend:
-		(LC_ALL=C; export LC_ALL; makedepend -Y -- $(CFLAGS) $(CPPFLAGS) -- *.c)
-
-# DO NOT DELETE
-
-align.o: minimap.h mmpriv.h bseq.h ksw2.h kalloc.h
-bseq.o: bseq.h kseq.h
-chain.o: minimap.h mmpriv.h bseq.h kalloc.h
-example.o: minimap.h kseq.h
-format.o: kalloc.h mmpriv.h minimap.h bseq.h
-getopt.o: getopt.h
-hit.o: mmpriv.h minimap.h bseq.h kalloc.h
-index.o: kthread.h bseq.h minimap.h mmpriv.h kvec.h kalloc.h khash.h
-kalloc.o: kalloc.h
-ksw2_extd2_sse.o: ksw2.h kalloc.h
-ksw2_exts2_sse.o: ksw2.h kalloc.h
-ksw2_extz2_sse.o: ksw2.h kalloc.h
-ksw2_ll_sse.o: ksw2.h kalloc.h
-main.o: bseq.h minimap.h mmpriv.h getopt.h
-map.o: kthread.h kvec.h kalloc.h sdust.h mmpriv.h minimap.h bseq.h
-misc.o: minimap.h ksort.h
-sdust.o: kalloc.h kdq.h kvec.h sdust.h
-sketch.o: kvec.h kalloc.h minimap.h

NEWS.md

@@ -1,95 +0,0 @@
-Release 2.1.1-r341 (6 September 2017)
--------------------------------------
-
-This is a maintenance release that is expected to output identical alignment to
-v2.1. Detailed changes include:
-
- * Support CPU dispatch. By default, minimap2 is compiled with both SSE2 and
-   SSE4 based implementation of alignment and automatically chooses the right
-   one at runtime. This avoids unexpected errors on older CPUs (#21).
-
- * Improved Windows support as is requested by Oxford Nanopore (#19). Minimap2
-   now avoids variable-length stacked arrays, eliminates alloca(), ships with
-   getopt_long() and provides timing functions implemented with Windows APIs.
-
- * Fixed a potential segmentation fault when specifying -k/-w/-H with
-   multi-part index (#23).
-
- * Fixed two memory leaks in example.c
-
-(2.1.1: 6 September 2017, r341)
-
-
-
-Release 2.1-r311 (25 August 2017)
----------------------------------
-
-This release adds spliced alignment for long noisy RNA-seq reads. On a SMRT
-Iso-Seq and a Oxford Nanopore data sets, minimap2 appears to outperform
-traditional mRNA aligners. For DNA alignment, this release gives almost
-identical output to v2.0. Other changes include:
-
- * Added option `-R` to set the read group header line in SAM.
-
- * Optionally output the `cs:Z` tag in PAF to encode both the query and the
-   reference sequences in the alignment.
-
- * Fixed an issue where DP alignment uses excessive memory.
-
-The minimap2 technical report has been updated with more details and the
-evaluation of spliced alignment:
-
- * Li, H. (2017). Minimap2: fast pairwise alignment for long nucleotide
-   sequences. [arXiv:1708.01492v2](https://arxiv.org/abs/1708.01492v2).
-
-(2.1: 25 August 2017, r311)
-
-
-
-Release 2.0-r275 (8 August 2017)
---------------------------------
-
-This release is identical to version 2.0rc1, except the version number. It is
-described and evaluated in the following technical report:
-
- * Li, H. (2017). Minimap2: fast pairwise alignment for long DNA sequences.
-   [arXiv:1708.01492v1](https://arxiv.org/abs/1708.01492v1).
-
-(2.0: 8 August 2017, r275)
-
-
-
-Release 2.0rc1-r232 (30 July 2017)
-----------------------------------
-
-This release improves the accuracy of long-read alignment and added several
-minor features.
-
- * Improved mapping quality estimate for short alignments containing few seed
-   hits.
-
- * Fixed a minor bug that affects the chaining accuracy towards the ends of a
-   chain. Changed the gap cost for chaining to reduce false seeding.
-
- * Skip potentially wrong seeding and apply dynamic programming more frequently.
-   This slightly increases run time, but greatly reduces false long gaps.
-
- * Perform local alignment at Z-drop break point to recover potential inversion
-   alignment. Output the SA tag in the SAM format. Added scripts to evaluate
-   mapping accuracy for reads simulated with pbsim.
-
-This release completes features intended for v2.0. No major features will be
-added to the master branch before the final v2.0.
-
-(2.0rc1: 30 July 2017, r232)
-
-
-
-Release r191 (19 July 2017)
----------------------------
-
-This is the first public release of minimap2, an aligner for long reads and
-assemblies. This release has a few issues and is generally not recommended for
-production uses.
-
-(19 July 2017, r191)

README.md

@@ -1,117 +0,0 @@
-[![Build Status](https://travis-ci.org/lh3/minimap2.svg?branch=master)](https://travis-ci.org/lh3/minimap2)
-## Getting Started
-```sh
-git clone https://github.com/lh3/minimap2
-cd minimap2 && make
-# long reads against a reference genome
-./minimap2 -ax map10k test/MT-human.fa test/MT-orang.fa > test.sam
-# create an index first and then map
-./minimap2 -x map10k -d MT-human.mmi test/MT-human.fa
-./minimap2 -ax map10k MT-human.mmi test/MT-orang.fa > test.sam
-# long-read overlap (no test data)
-./minimap2 -x ava-pb your-reads.fa your-reads.fa > overlaps.paf
-# spliced alignment (no test data)
-./minimap2 -ax splice ref.fa rna-seq-reads.fa > spliced.sam
-# man page
-man ./minimap2.1
-```
-
-## Introduction
-
-Minimap2 is a fast sequence mapping and alignment program that can find
-overlaps between long noisy reads, or map long reads or their assemblies to a
-reference genome optionally with detailed alignment (i.e. CIGAR). At present,
-it works efficiently with query sequences from a few kilobases to ~100
-megabases in length at an error rate ~15%. Minimap2 outputs in the [PAF][paf] or
-the [SAM format][sam]. On limited test data sets, minimap2 is over 20 times
-faster than most other long-read aligners. It will replace BWA-MEM for long
-reads and contig alignment.
-
-Minimap2 is the successor of [minimap][minimap]. It uses a similar
-minimizer-based indexing and seeding algorithm, and improves the original
-minimap with homopolyer-compressed k-mers (see also [SMARTdenovo][smartdenovo]
-and [longISLND][longislnd]), better chaining and the ability to produce CIGAR
-with fast extension alignment (see also [libgaba][gaba] and [ksw2][ksw2]) and
-piece-wise affine gap cost.
-
-If you use minimap2 in your work, please consider to cite:
-
-> Li, H. (2017). Minimap2: fast pairwise alignment for long DNA sequences. [arXiv:1708.01492](https://arxiv.org/abs/1708.01492).
-
-## Installation
-
-For modern x86-64 CPUs, just type `make` in the source code directory. This
-will compile a binary `minimap2` which you can copy to your desired location.
-If you see compilation errors, try `make sse2only=1` to disable SSE4. Minimap2
-will run a little slower. At present, minimap2 does not work with non-x86 CPUs
-or ancient CPUs that do not support SSE2. SSE2 is critical to the performance
-of minimap2.
-
-## Algorithm Overview
-
-In the following, minimap2 command line options have a dash ahead and are
-highlighted in bold.
-
-1. Read **-I** [=*4G*] reference bases, extract (**-k**,**-w**)-minimizers and
-   index them in a hash table.
-
-2. Read **-K** [=*200M*] query bases. For each query sequence, do step 3
-   through 7:
-
-3. For each (**-k**,**-w**)-minimizer on the query, check against the reference
-   index. If a reference minimizer is not among the top **-f** [=*2e-4*] most
-   frequent, collect its the occurrences in the reference, which are called
-   *seeds*.
-
-4. Sort seeds by position in the reference. Chain them with dynamic
-   programming. Each chain represents a potential mapping. For read
-   overlapping, report all chains and then go to step 8. For reference mapping,
-   do step 5 through 7:
-
-5. Let *P* be the set of primary mappings, which is an empty set initially. For
-   each chain from the best to the worst according to their chaining scores: if
-   on the query, the chain overlaps with a chain in *P* by **--mask-level**
-   [=*0.5*] or higher fraction of the shorter chain, mark the chain as
-   *secondary* to the chain in *P*; otherwise, add the chain to *P*.
-
-6. Retain all primary mappings. Also retain up to **-N** [=*5*] top secondary
-   mappings if their chaining scores are higher than **-p** [=*0.8*] of their
-   corresponding primary mappings.
-
-7. If alignment is requested, filter out an internal seed if it potentially
-   leads to both a long insertion and a long deletion. Extend from the
-   left-most seed. Perform global alignments between internal seeds.  Split the
-   chain if the accumulative score along the global alignment drops by **-z**
-   [=*400*], disregarding long gaps. Extend from the right-most seed.  Output
-   chains and their alignments.
-
-8. If there are more query sequences in the input, go to step 2 until no more
-   queries are left.
-
-9. If there are more reference sequences, reopen the query file from the start
-   and go to step 1; otherwise stop.
-
-## Limitations
-
-* Minimap2 may produce suboptimal alignments through long low-complexity
-  regions where seed positions may be suboptimal. This should not be a big
-  concern because even the optimal alignment may be wrong in such regions.
-
-* Minimap2 does not work well with Illumina short reads as of now.
-
-* Minimap2 requires SSE2 instructions to compile. It is possible to add
-  non-SSE2 support, but it would make minimap2 slower by several times.
-
-In general, minimap2 is a young project with most code written since June, 2017.
-It may have bugs and room for improvements. Bug reports and suggestions are
-warmly welcomed.
-
-
-
-[paf]: https://github.com/lh3/miniasm/blob/master/PAF.md
-[sam]: https://samtools.github.io/hts-specs/SAMv1.pdf
-[minimap]: https://github.com/lh3/minimap
-[smartdenovo]: https://github.com/ruanjue/smartdenovo
-[longislnd]: https://www.ncbi.nlm.nih.gov/pubmed/27667791
-[gaba]: https://github.com/ocxtal/libgaba
-[ksw2]: https://github.com/lh3/ksw2

_config.yml

@@ -0,0 +1 @@
+theme: jekyll-theme-modernist

align.c

@@ -1,498 +0,0 @@
-#include <assert.h>
-#include <string.h>
-#include "minimap.h"
-#include "mmpriv.h"
-#include "ksw2.h"
-
-static void ksw_gen_simple_mat(int m, int8_t *mat, int8_t a, int8_t b)
-{
-	int i, j;
-	a = a < 0? -a : a;
-	b = b > 0? -b : b;
-	for (i = 0; i < m - 1; ++i) {
-		for (j = 0; j < m - 1; ++j)
-			mat[i * m + j] = i == j? a : b;
-		mat[i * m + m - 1] = 0;
-	}
-	for (j = 0; j < m; ++j)
-		mat[(m - 1) * m + j] = 0;
-}
-
-static inline void mm_seq_rev(uint32_t len, uint8_t *seq)
-{
-	uint32_t i;
-	uint8_t t;
-	for (i = 0; i < len>>1; ++i)
-		t = seq[i], seq[i] = seq[len - 1 - i], seq[len - 1 - i] = t;
-}
-
-static inline int test_zdrop_aux(int32_t score, int i, int j, int32_t *max, int *max_i, int *max_j, int e, int zdrop)
-{
-	if (score < *max) {
-		int li = i - *max_i;
-		int lj = j - *max_j;
-		int diff = li > lj? li - lj : lj - li;
-		if (*max - score > zdrop + diff * e)
-			return 1;
-	} else *max = score, *max_i = i, *max_j = j;
-	return 0;
-}
-
-static int mm_check_zdrop(const uint8_t *qseq, const uint8_t *tseq, uint32_t n_cigar, uint32_t *cigar, const int8_t *mat, int8_t q, int8_t e, int zdrop)
-{
-	uint32_t k;
-	int32_t score = 0, max = 0, max_i = -1, max_j = -1, i = 0, j = 0;
-	for (k = 0; k < n_cigar; ++k) {
-		uint32_t l, op = cigar[k]&0xf, len = cigar[k]>>4;
-		if (op == 0) {
-			for (l = 0; l < len; ++l) {
-				score += mat[tseq[i + l] * 5 + qseq[j + l]];
-				if (test_zdrop_aux(score, i+l, j+l, &max, &max_i, &max_j, e, zdrop)) return 1;
-			}
-			i += len, j += len;
-		} else if (op == 1) {
-			score -= q + e * len, j += len;
-			if (test_zdrop_aux(score, i, j, &max, &max_i, &max_j, e, zdrop)) return 1;
-		} else if (op == 2 || op == 3) {
-			score -= q + e * len, i += len;
-			if (test_zdrop_aux(score, i, j, &max, &max_i, &max_j, e, zdrop)) return 1;
-		}
-	}
-	return 0;
-}
-
-static void mm_update_extra(mm_extra_t *p, const uint8_t *qseq, const uint8_t *tseq, const int8_t *mat, int8_t q, int8_t e)
-{
-	uint32_t k, l, toff = 0, qoff = 0;
-	int32_t s = 0, max = 0, n_gtag = 0, n_ctac = 0;
-	if (p == 0) return;
-	for (k = 0; k < p->n_cigar; ++k) {
-		uint32_t op = p->cigar[k]&0xf, len = p->cigar[k]>>4;
-		if (op == 0) { // match/mismatch
-			for (l = 0; l < len; ++l) {
-				int cq = qseq[qoff + l], ct = tseq[toff + l];
-				if (ct > 3 || cq > 3) ++p->n_ambi;
-				else if (ct != cq) ++p->n_diff;
-				s += mat[ct * 5 + cq];
-				if (s < 0) s = 0;
-				else max = max > s? max : s;
-			}
-			toff += len, qoff += len, p->blen += len;
-		} else if (op == 1) { // insertion
-			int n_ambi = 0;
-			for (l = 0; l < len; ++l)
-				if (qseq[qoff + l] > 3) ++n_ambi;
-			qoff += len, p->blen += len;
-			p->n_ambi += n_ambi, p->n_diff += len - n_ambi;
-			s -= q + e * len;
-			if (s < 0) s = 0;
-		} else if (op == 2) { // deletion
-			int n_ambi = 0;
-			for (l = 0; l < len; ++l)
-				if (tseq[toff + l] > 3) ++n_ambi;
-			toff += len, p->blen += len;
-			p->n_ambi += n_ambi, p->n_diff += len - n_ambi;
-			s -= q + e * len;
-			if (s < 0) s = 0;
-		} else if (op == 3) { // intron
-			uint8_t b[4];
-			b[0] = tseq[toff], b[1] = tseq[toff+1];
-			b[2] = tseq[toff+len-2], b[3] = tseq[toff+len-1];
-			if (memcmp(b, "\2\3\0\2", 4) == 0) ++n_gtag;
-			else if (memcmp(b, "\1\3\0\1", 4) == 0) ++n_ctac;
-			toff += len, p->blen += len;
-		}
-	}
-	p->dp_max = max;
-	if (n_gtag > n_ctac) p->trans_strand = 1;
-	else if (n_gtag < n_ctac) p->trans_strand = 2;
-}
-
-static void mm_append_cigar(mm_reg1_t *r, uint32_t n_cigar, uint32_t *cigar) // TODO: this calls the libc realloc()
-{
-	mm_extra_t *p;
-	if (n_cigar == 0) return;
-	if (r->p == 0) {
-		uint32_t capacity = n_cigar + sizeof(mm_extra_t);
-		kroundup32(capacity);
-		r->p = (mm_extra_t*)calloc(capacity, 4);
-		r->p->capacity = capacity;
-	} else if (r->p->n_cigar + n_cigar + sizeof(mm_extra_t) > r->p->capacity) {
-		r->p->capacity = r->p->n_cigar + n_cigar + sizeof(mm_extra_t);
-		kroundup32(r->p->capacity);
-		r->p = (mm_extra_t*)realloc(r->p, r->p->capacity * 4);
-	}
-	p = r->p;
-	if (p->n_cigar > 0 && (p->cigar[p->n_cigar-1]&0xf) == (cigar[0]&0xf)) { // same CIGAR op at the boundary
-		p->cigar[p->n_cigar-1] += cigar[0]>>4<<4;
-		if (n_cigar > 1) memcpy(p->cigar + p->n_cigar, cigar + 1, (n_cigar - 1) * 4);
-		p->n_cigar += n_cigar - 1;
-	} else {
-		memcpy(p->cigar + p->n_cigar, cigar, n_cigar * 4);
-		p->n_cigar += n_cigar;
-	}
-}
-
-static void mm_align_pair(void *km, const mm_mapopt_t *opt, int qlen, const uint8_t *qseq, int tlen, const uint8_t *tseq, const int8_t *mat, int w, int flag, ksw_extz_t *ez)
-{
-	if (mm_dbg_flag & MM_DBG_PRINT_ALN_SEQ) {
-		int i;
-		fprintf(stderr, "===> q=(%d,%d), e=(%d,%d), bw=%d, flag=%d, zdrop=%d <===\n", opt->q, opt->q2, opt->e, opt->e2, w, flag, opt->zdrop);
-		for (i = 0; i < tlen; ++i) fputc("ACGTN"[tseq[i]], stderr);
-		fputc('\n', stderr);
-		for (i = 0; i < qlen; ++i) fputc("ACGTN"[qseq[i]], stderr);
-		fputc('\n', stderr);
-	}
-	if (opt->flag & MM_F_SPLICE)
-		ksw_exts2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->noncan, opt->zdrop, flag, ez);
-	else if (opt->q == opt->q2 && opt->e == opt->e2)
-		ksw_extz2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, w, opt->zdrop, flag, ez);
-	else
-		ksw_extd2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->e2, w, opt->zdrop, flag, ez);
-}
-
-static inline int mm_get_hplen_back(const mm_idx_t *mi, uint32_t rid, uint32_t x)
-{
-	int64_t i, off0 = mi->seq[rid].offset, off = off0 + x;
-	int c = mm_seq4_get(mi->S, off);
-	for (i = off - 1; i >= off0; --i)
-		if (mm_seq4_get(mi->S, i) != c) break;
-	return (int)(off - i);
-}
-
-static inline void mm_adjust_minier(const mm_idx_t *mi, uint8_t *const qseq0[2], mm128_t *a, int32_t *r, int32_t *q)
-{
-	if (mi->is_hpc) {
-		const uint8_t *qseq = qseq0[a->x>>63];
-		int i, c;
-		*q = (int32_t)a->y;
-		for (i = *q - 1, c = qseq[*q]; i > 0; --i)
-			if (qseq[i] != c) break;
-		*q = i + 1;
-		c = mm_get_hplen_back(mi, a->x<<1>>33, (int32_t)a->x);
-		*r = (int32_t)a->x + 1 - c;
-	} else {
-		*r = (int32_t)a->x - (mi->k>>1);
-		*q = (int32_t)a->y - (mi->k>>1);
-	}
-}
-
-static void mm_filter_bad_seeds(void *km, int as1, int cnt1, mm128_t *a, int min_gap, int diff_thres, int max_ext_len, int max_ext_cnt)
-{
-	int max_st, max_en, n, i, k, max, *K;
-	for (i = 1, n = 0; i < cnt1; ++i) { // count the number of gaps longer than min_gap
-		int gap = ((int32_t)a[as1 + i].y - a[as1 + i - 1].y) - ((int32_t)a[as1 + i].x - a[as1 + i - 1].x);
-		if (gap < -min_gap || gap > min_gap) ++n;
-	}
-	if (n <= 1) return;
-	K = (int*)kmalloc(km, n * sizeof(int));
-	for (i = 1, n = 0; i < cnt1; ++i) { // store the positions of long gaps
-		int gap = ((int32_t)a[as1 + i].y - a[as1 + i - 1].y) - ((int32_t)a[as1 + i].x - a[as1 + i - 1].x);
-		if (gap < -min_gap || gap > min_gap)
-			K[n++] = i;
-	}
-	max = 0, max_st = max_en = -1;
-	for (k = 0;; ++k) { // traverse long gaps
-		int gap, l, n_ins = 0, n_del = 0, qs, rs, max_diff = 0, max_diff_l = -1;
-		if (k == n || k >= max_en) {
-			if (max_en > 0)
-				for (i = K[max_st]; i < K[max_en]; ++i)
-					a[as1 + i].y |= MM_SEED_IGNORE;
-			max = 0, max_st = max_en = -1;
-			if (k == n) break;
-		}
-		i = K[k];
-		gap = ((int32_t)a[as1 + i].y - a[as1 + i - 1].y) - ((int32_t)a[as1 + i].x - a[as1 + i - 1].x);
-		if (gap > 0) n_ins += gap;
-		else n_del += -gap;
-		qs = (int32_t)a[as1 + i - 1].y;
-		rs = (int32_t)a[as1 + i - 1].x;
-		for (l = k + 1; l < n && l <= k + max_ext_cnt; ++l) {
-			int j = K[l], diff;
-			if ((int32_t)a[as1 + j].y - qs > max_ext_len || (int32_t)a[as1 + j].x - rs > max_ext_len) break;
-			gap = ((int32_t)a[as1 + j].y - (int32_t)a[as1 + j - 1].y) - (a[as1 + j].x - a[as1 + j - 1].x);
-			if (gap > 0) n_ins += gap;
-			else n_del += -gap;
-			diff = n_ins + n_del - abs(n_ins - n_del);
-			if (max_diff < diff)
-				max_diff = diff, max_diff_l = l;
-		}
-		if (max_diff > diff_thres && max_diff > max)
-			max = max_diff, max_st = k, max_en = max_diff_l;
-	}
-	kfree(km, K);
-}
-
-static void mm_fix_bad_ends(const mm_reg1_t *r, const mm128_t *a, int bw, int32_t *as, int32_t *cnt)
-{
-	int32_t i, l;
-	*as = r->as, *cnt = r->cnt;
-	if (r->cnt < 3) return;
-	l = a[r->as].y >> 32 & 0xff;
-	for (i = r->as + 1; i < r->as + r->cnt - 1; ++i) {
-		int32_t lq, lr, min, max;
-		lr = (int32_t)a[i].x - (int32_t)a[i-1].x;
-		lq = (int32_t)a[i].y - (int32_t)a[i-1].y;
-		min = lr < lq? lr : lq;
-		max = lr > lq? lr : lq;
-		if (max - min > l >> 1) *as = i;
-		l += min;
-		if (l >= bw << 1) break;
-	}
-	*cnt = r->as + r->cnt - *as;
-	l = a[r->as + r->cnt - 1].y >> 32 & 0xff;
-	for (i = r->as + r->cnt - 2; i > *as; --i) {
-		int32_t lq, lr, min, max;
-		lr = (int32_t)a[i+1].x - (int32_t)a[i].x;
-		lq = (int32_t)a[i+1].y - (int32_t)a[i].y;
-		min = lr < lq? lr : lq;
-		max = lr > lq? lr : lq;
-		if (max - min > l >> 1) *cnt = i + 1 - *as;
-		l += min;
-		if (l >= bw) break;
-	}
-}
-
-static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, uint8_t *qseq0[2], mm_reg1_t *r, mm_reg1_t *r2, mm128_t *a, ksw_extz_t *ez, int splice_flag)
-{
-	int32_t rid = a[r->as].x<<1>>33, rev = a[r->as].x>>63, as1, cnt1;
-	uint8_t *tseq, *qseq;
-	int32_t i, l, bw, dropped = 0, extra_flag = 0, rs0, re0, qs0, qe0;
-	int32_t rs, re, qs, qe;
-	int32_t rs1, qs1, re1, qe1;
-	int8_t mat[25];
-
-	if (r->cnt == 0) return;
-	ksw_gen_simple_mat(5, mat, opt->a, opt->b);
-	bw = (int)(opt->bw * 1.5 + 1.);
-
-	r2->cnt = 0;
-	if (!(opt->flag & MM_F_SPLICE))
-		mm_fix_bad_ends(r, a, opt->bw, &as1, &cnt1);
-	else as1 = r->as, cnt1 = r->cnt;
-	mm_filter_bad_seeds(km, as1, cnt1, a, 10, 40, opt->max_gap>>1, 10);
-	mm_adjust_minier(mi, qseq0, &a[as1], &rs, &qs);
-	mm_adjust_minier(mi, qseq0, &a[as1 + cnt1 - 1], &re, &qe);
-
-	if (opt->flag & MM_F_SPLICE) {
-		if (splice_flag & MM_F_SPLICE_FOR) extra_flag |= rev? KSW_EZ_SPLICE_REV : KSW_EZ_SPLICE_FOR;
-		if (splice_flag & MM_F_SPLICE_REV) extra_flag |= rev? KSW_EZ_SPLICE_FOR : KSW_EZ_SPLICE_REV;
-		if (splice_flag & MM_F_SPLICE_BOTH) extra_flag |= KSW_EZ_SPLICE_FOR|KSW_EZ_SPLICE_REV;
-	}
-
-	// compute rs0 and qs0
-	if (r->split && as1 > 0) {
-		mm_adjust_minier(mi, qseq0, &a[as1-1], &rs0, &qs0);
-	} else {
-		if (qs > 0 && rs > 0) { // actually this is always true
-			l = qs < opt->max_gap? qs : opt->max_gap;
-			qs0 = qs - l;
-			l += l * opt->a > opt->q? (l * opt->a - opt->q) / opt->e : 0;
-			l = l < opt->max_gap? l : opt->max_gap;
-			l = l < rs? l : rs;
-			rs0 = rs - l;
-		} else rs0 = rs, qs0 = qs;
-
-	}
-	// compute re0 and qe0
-	if (qe < qlen && re < mi->seq[rid].len) {
-		l = qlen - qe < opt->max_gap? qlen - qe : opt->max_gap;
-		qe0 = qe + l;
-		l += l * opt->a > opt->q? (l * opt->a - opt->q) / opt->e : 0;
-		l = l < opt->max_gap? l : opt->max_gap;
-		l = l < mi->seq[rid].len - re? l : mi->seq[rid].len - re;
-		re0 = re + l;
-	} else re0 = re, qe0 = qe;
-
-	assert(re0 > rs0);
-	tseq = (uint8_t*)kmalloc(km, re0 - rs0);
-
-	if (qs > 0 && rs > 0) { // left extension
-		qseq = &qseq0[rev][qs0];
-		mm_idx_getseq(mi, rid, rs0, rs, tseq);
-		mm_seq_rev(qs - qs0, qseq);
-		mm_seq_rev(rs - rs0, tseq);
-		mm_align_pair(km, opt, qs - qs0, qseq, rs - rs0, tseq, mat, bw, extra_flag|KSW_EZ_EXTZ_ONLY|KSW_EZ_RIGHT|KSW_EZ_REV_CIGAR, ez);
-		if (ez->n_cigar > 0) {
-			mm_append_cigar(r, ez->n_cigar, ez->cigar);
-			r->p->dp_score += ez->max;
-		}
-		rs1 = rs - (ez->max_t + 1);
-		qs1 = qs - (ez->max_q + 1);
-		mm_seq_rev(qs - qs0, qseq);
-	} else rs1 = rs, qs1 = qs;
-	re1 = rs, qe1 = qs;
-	assert(qs1 >= 0 && rs1 >= 0);
-
-	for (i = 1; i < cnt1; ++i) { // gap filling
-		if ((a[as1+i].y & (MM_SEED_IGNORE|MM_SEED_TANDEM)) && i != cnt1 - 1) continue;
-		mm_adjust_minier(mi, qseq0, &a[as1 + i], &re, &qe);
-		re1 = re, qe1 = qe;
-		if (i == cnt1 - 1 || (a[as1+i].y&MM_SEED_LONG_JOIN) || (qe - qs >= opt->min_ksw_len && re - rs >= opt->min_ksw_len)) {
-			int bw1 = bw;
-			if (a[as1+i].y & MM_SEED_LONG_JOIN)
-				bw1 = qe - qs > re - rs? qe - qs : re - rs;
-			qseq = &qseq0[rev][qs];
-			mm_idx_getseq(mi, rid, rs, re, tseq);
-			mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, mat, bw1, extra_flag|KSW_EZ_APPROX_MAX, ez);
-			if (mm_check_zdrop(qseq, tseq, ez->n_cigar, ez->cigar, mat, opt->q, opt->e, opt->zdrop))
-				mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, mat, bw1, extra_flag, ez);
-			if (ez->n_cigar > 0)
-				mm_append_cigar(r, ez->n_cigar, ez->cigar);
-			if (ez->zdropped) { // truncated by Z-drop; TODO: sometimes Z-drop kicks in because the next seed placement is wrong. This can be fixed in principle.
-				int j;
-				for (j = i - 1; j >= 0; --j)
-					if ((int32_t)a[as1 + j].x < re + ez->max_t)
-						break;
-				dropped = 1;
-				r->p->dp_score += ez->max;
-				re1 = rs + (ez->max_t + 1);
-				qe1 = qs + (ez->max_q + 1);
-				if (cnt1 - (j + 1) >= opt->min_cnt)
-					mm_split_reg(r, r2, j + 1, qlen, a);
-				break;
-			} else r->p->dp_score += ez->score;
-			rs = re, qs = qe;
-		}
-	}
-
-	if (!dropped && qe < qe0 && re < re0) { // right extension
-		qseq = &qseq0[rev][qe];
-		mm_idx_getseq(mi, rid, re, re0, tseq);
-		mm_align_pair(km, opt, qe0 - qe, qseq, re0 - re, tseq, mat, bw, extra_flag|KSW_EZ_EXTZ_ONLY, ez);
-		if (ez->n_cigar > 0) {
-			mm_append_cigar(r, ez->n_cigar, ez->cigar);
-			r->p->dp_score += ez->max;
-		}
-		re1 = re + (ez->max_t + 1);
-		qe1 = qe + (ez->max_q + 1);
-	}
-	assert(qe1 <= qlen);
-
-	r->rs = rs1, r->re = re1;
-	if (rev) r->qs = qlen - qe1, r->qe = qlen - qs1;
-	else r->qs = qs1, r->qe = qe1;
-
-	assert(re1 - rs1 <= re0 - rs0);
-	if (r->p) {
-		mm_idx_getseq(mi, rid, rs1, re1, tseq);
-		mm_update_extra(r->p, &qseq0[r->rev][qs1], tseq, mat, opt->q, opt->e);
-		if (rev && r->p->trans_strand)
-			r->p->trans_strand ^= 3; // flip to the read strand
-	}
-
-	kfree(km, tseq);
-}
-
-static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, uint8_t *qseq0[2], const mm_reg1_t *r1, const mm_reg1_t *r2, mm_reg1_t *r_inv, ksw_extz_t *ez)
-{
-	int tl, ql, score, ret = 0, q_off, t_off;
-	uint8_t *tseq, *qseq;
-	int8_t mat[25];
-	void *qp;
-
-	memset(r_inv, 0, sizeof(mm_reg1_t));
-	if (!(r1->split&1) || !(r2->split&2)) return 0;
-	if (r1->id != r1->parent && r1->parent != MM_PARENT_TMP_PRI) return 0;
-	if (r2->id != r2->parent && r2->parent != MM_PARENT_TMP_PRI) return 0;
-	if (r1->rid != r2->rid || r1->rev != r2->rev) return 0;
-	ql = r2->qs - r1->qe;
-	tl = r2->rs - r1->re;
-	if (ql < opt->min_chain_score || ql > opt->max_gap) return 0;
-	if (tl < opt->min_chain_score || tl > opt->max_gap) return 0;
-
-	ksw_gen_simple_mat(5, mat, opt->a, opt->b);
-	tseq = (uint8_t*)kmalloc(km, tl);
-	mm_idx_getseq(mi, r1->rid, r1->re, r2->rs, tseq);
-	qseq = &qseq0[!r1->rev][qlen - r2->qs];
-
-	mm_seq_rev(ql, qseq);
-	mm_seq_rev(tl, tseq);
-	qp = ksw_ll_qinit(km, 2, ql, qseq, 5, mat);
-	score = ksw_ll_i16(qp, tl, tseq, opt->q, opt->e, &q_off, &t_off);
-	kfree(km, qp);
-	mm_seq_rev(ql, qseq);
-	mm_seq_rev(tl, tseq);
-	if (score < opt->min_dp_max) goto end_align1_inv;
-	q_off = ql - (q_off + 1), t_off = tl - (t_off + 1);
-	mm_align_pair(km, opt, ql - q_off, qseq + q_off, tl - t_off, tseq + t_off, mat, (int)(opt->bw * 1.5), KSW_EZ_EXTZ_ONLY, ez);
-	if (ez->n_cigar == 0) goto end_align1_inv; // should never be here
-	mm_append_cigar(r_inv, ez->n_cigar, ez->cigar);
-	r_inv->p->dp_score = ez->max;
-	mm_update_extra(r_inv->p, qseq + q_off, tseq + t_off, mat, opt->q, opt->e);
-	r_inv->id = -1;
-	r_inv->parent = MM_PARENT_UNSET;
-	r_inv->inv = 1;
-	r_inv->rev = !r1->rev;
-	r_inv->qs = r1->qe + q_off, r_inv->qe = r_inv->qs + ez->max_q + 1;
-	r_inv->rs = r1->re + t_off, r_inv->re = r_inv->rs + ez->max_t + 1;
-	ret = 1;
-end_align1_inv:
-	kfree(km, tseq);
-	return ret;
-}
-
-static inline mm_reg1_t *mm_insert_reg(const mm_reg1_t *r, int i, int *n_regs, mm_reg1_t *regs)
-{
-	regs = (mm_reg1_t*)realloc(regs, (*n_regs + 1) * sizeof(mm_reg1_t));
-	if (i + 1 != *n_regs)
-		memmove(&regs[i + 2], &regs[i + 1], sizeof(mm_reg1_t) * (*n_regs - i - 1));
-	regs[i + 1] = *r;
-	++*n_regs;
-	return regs;
-}
-
-mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a)
-{
-	extern unsigned char seq_nt4_table[256];
-	int32_t i, n_regs = *n_regs_;
-	uint8_t *qseq0[2];
-	ksw_extz_t ez;
-
-	// encode the query sequence
-	qseq0[0] = (uint8_t*)kmalloc(km, qlen);
-	qseq0[1] = (uint8_t*)kmalloc(km, qlen);
-	for (i = 0; i < qlen; ++i) {
-		qseq0[0][i] = seq_nt4_table[(uint8_t)qstr[i]];
-		qseq0[1][qlen - 1 - i] = qseq0[0][i] < 4? 3 - qseq0[0][i] : 4;
-	}
-
-	// align through seed hits
-	memset(&ez, 0, sizeof(ksw_extz_t));
-	for (i = 0; i < n_regs; ++i) {
-		mm_reg1_t r2;
-		if ((opt->flag&MM_F_SPLICE) && (opt->flag&MM_F_SPLICE_FOR) && (opt->flag&MM_F_SPLICE_REV)) {
-			mm_reg1_t s[2], s2[2];
-			int which, trans_strand;
-			s[0] = s[1] = regs[i];
-			mm_align1(km, opt, mi, qlen, qseq0, &s[0], &s2[0], a, &ez, MM_F_SPLICE_FOR);
-			mm_align1(km, opt, mi, qlen, qseq0, &s[1], &s2[1], a, &ez, MM_F_SPLICE_REV);
-			if (s[0].p->dp_score > s[1].p->dp_score) which = 0, trans_strand = 1;
-			else if (s[0].p->dp_score < s[1].p->dp_score) which = 1, trans_strand = 2;
-			else trans_strand = 3, which = (qlen + s[0].p->dp_score) & 1; // randomly choose a strand, effectively
-			if (which == 0) {
-				regs[i] = s[0], r2 = s2[0];
-				free(s[1].p);
-			} else {
-				regs[i] = s[1], r2 = s2[1];
-				free(s[0].p);
-			}
-			regs[i].p->trans_strand = trans_strand;
-		} else {
-			mm_align1(km, opt, mi, qlen, qseq0, &regs[i], &r2, a, &ez, opt->flag);
-			if ((opt->flag&MM_F_SPLICE) && !(opt->flag&MM_F_SPLICE_BOTH))
-				regs[i].p->trans_strand = opt->flag&MM_F_SPLICE_FOR? 1 : 2;
-		}
-		if (r2.cnt > 0) regs = mm_insert_reg(&r2, i, &n_regs, regs);
-		if (i > 0 && mm_align1_inv(km, opt, mi, qlen, qseq0, &regs[i-1], &regs[i], &r2, &ez)) {
-			regs = mm_insert_reg(&r2, i, &n_regs, regs);
-			++i; // skip the inserted INV alignment
-		}
-	}
-	*n_regs_ = n_regs;
-	kfree(km, qseq0[0]); kfree(km, qseq0[1]);
-	kfree(km, ez.cigar);
-	mm_filter_regs(km, opt, n_regs_, regs);
-	mm_hit_sort_by_dp(km, n_regs_, regs);
-	return regs;
-}

bseq.c

@@ -1,62 +0,0 @@
-#include <zlib.h>
-#include <stdio.h>
-#include <stdlib.h>
-#include <string.h>
-#include <assert.h>
-#include "bseq.h"
-#include "kseq.h"
-KSEQ_INIT(gzFile, gzread)
-
-struct mm_bseq_file_s {
-	gzFile fp;
-	kseq_t *ks;
-};
-
-mm_bseq_file_t *mm_bseq_open(const char *fn)
-{
-	mm_bseq_file_t *fp;
-	gzFile f;
-	f = fn && strcmp(fn, "-")? gzopen(fn, "r") : gzdopen(fileno(stdin), "r");
-	if (f == 0) return 0;
-	fp = (mm_bseq_file_t*)calloc(1, sizeof(mm_bseq_file_t));
-	fp->fp = f;
-	fp->ks = kseq_init(fp->fp);
-	return fp;
-}
-
-void mm_bseq_close(mm_bseq_file_t *fp)
-{
-	kseq_destroy(fp->ks);
-	gzclose(fp->fp);
-	free(fp);
-}
-
-mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int chunk_size, int with_qual, int *n_)
-{
-	int size = 0, m, n;
-	mm_bseq1_t *seqs;
-	kseq_t *ks = fp->ks;
-	m = n = 0; seqs = 0;
-	while (kseq_read(ks) >= 0) {
-		mm_bseq1_t *s;
-		assert(ks->seq.l <= INT32_MAX);
-		if (n >= m) {
-			m = m? m<<1 : 256;
-			seqs = (mm_bseq1_t*)realloc(seqs, m * sizeof(mm_bseq1_t));
-		}
-		s = &seqs[n];
-		s->name = strdup(ks->name.s);
-		s->seq = strdup(ks->seq.s);
-		s->qual = with_qual && ks->qual.l? strdup(ks->qual.s) : 0;
-		s->l_seq = ks->seq.l;
-		size += seqs[n++].l_seq;
-		if (size >= chunk_size) break;
-	}
-	*n_ = n;
-	return seqs;
-}
-
-int mm_bseq_eof(mm_bseq_file_t *fp)
-{
-	return ks_eof(fp->ks->f);
-}

bseq.h

@@ -1,29 +0,0 @@
-#ifndef MM_BSEQ_H
-#define MM_BSEQ_H
-
-#include <stdint.h>
-
-#ifdef __cplusplus
-extern "C" {
-#endif
-
-struct mm_bseq_file_s;
-typedef struct mm_bseq_file_s mm_bseq_file_t;
-
-typedef struct {
-	int l_seq, rid;
-	char *name, *seq, *qual;
-} mm_bseq1_t;
-
-mm_bseq_file_t *mm_bseq_open(const char *fn);
-void mm_bseq_close(mm_bseq_file_t *fp);
-mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int chunk_size, int with_qual, int *n_);
-int mm_bseq_eof(mm_bseq_file_t *fp);
-
-extern unsigned char seq_nt4_table[256];
-
-#ifdef __cplusplus
-}
-#endif
-
-#endif

chain.c

@@ -1,149 +0,0 @@
-#include <stdint.h>
-#include <string.h>
-#include <stdio.h>
-#include "minimap.h"
-#include "mmpriv.h"
-#include "kalloc.h"
-
-static const char LogTable256[256] = {
-#define LT(n) n, n, n, n, n, n, n, n, n, n, n, n, n, n, n, n
-	-1, 0, 1, 1, 2, 2, 2, 2, 3, 3, 3, 3, 3, 3, 3, 3,
-	LT(4), LT(5), LT(5), LT(6), LT(6), LT(6), LT(6),
-	LT(7), LT(7), LT(7), LT(7), LT(7), LT(7), LT(7), LT(7)
-};
-
-static inline int ilog2_32(uint32_t v)
-{
-	register uint32_t t, tt;
-	if ((tt = v>>16)) return (t = tt>>8) ? 24 + LogTable256[t] : 16 + LogTable256[tt];
-	return (t = v>>8) ? 8 + LogTable256[t] : LogTable256[v];
-}
-
-int mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int min_cnt, int min_sc, int is_cdna, int64_t n, mm128_t *a, uint64_t **_u, void *km)
-{ // TODO: make sure this works when n has more than 32 bits
-	int32_t st = 0, k, *f, *p, *t, *v, n_u, n_v;
-	int64_t i, j;
-	uint64_t *u, *u2, sum_qspan = 0;
-	float avg_qspan;
-	mm128_t *b, *w;
-
-	if (_u) *_u = 0;
-	f = (int32_t*)kmalloc(km, n * 4);
-	p = (int32_t*)kmalloc(km, n * 4);
-	t = (int32_t*)kmalloc(km, n * 4);
-	v = (int32_t*)kmalloc(km, n * 4);
-	memset(t, 0, n * 4);
-
-	for (i = 0; i < n; ++i) sum_qspan += a[i].y>>32&0xff;
-	avg_qspan = (float)sum_qspan / n;
-
-	// fill the score and backtrack arrays
-	for (i = 0; i < n; ++i) {
-		uint64_t ri = a[i].x;
-		int32_t qi = (int32_t)a[i].y, q_span = a[i].y>>32&0xff; // NB: only 8 bits of span is used!!!
-		int32_t max_f = q_span, max_j = -1, n_skip = 0, min_d, max_f_past = -INT32_MAX;
-		while (st < i && ri - a[st].x > max_dist_x) ++st;
-		for (j = i - 1; j >= st; --j) {
-			int64_t dr = ri - a[j].x;
-			int32_t dq = qi - (int32_t)a[j].y, dd, sc;
-			if (dr == 0 || dq <= 0 || dq > max_dist_y) continue;
-			dd = dr > dq? dr - dq : dq - dr;
-			if (dd > bw) continue;
-			max_f_past = max_f_past > f[j]? max_f_past : f[j];
-			min_d = dq < dr? dq : dr;
-			sc = min_d > q_span? q_span : dq < dr? dq : dr;
-			if (is_cdna) {
-				int c_log, c_lin;
-				c_lin = (int)(dd * .01 * avg_qspan);
-				c_log = ilog2_32(dd);
-				if (dr > dq) sc -= c_lin < c_log? c_lin : c_log;
-				else sc -= c_lin + (c_log>>1);
-			} else sc -= (int)(dd * .01 * avg_qspan) + (ilog2_32(dd)>>1);
-			sc += f[j];
-			if (sc > max_f) {
-				max_f = sc, max_j = j;
-				if (n_skip > 0) --n_skip;
-			} else if (t[j] == i) {
-				if (++n_skip > max_skip)
-					break;
-			}
-			if (p[j] >= 0) t[p[j]] = i;
-		}
-		f[i] = max_f, p[i] = max_j, v[i] = max_f_past; // v[] keeps the max score in the previous chain
-	}
-
-	// find the ending positions of chains
-	memset(t, 0, n * 4);
-	for (i = 0; i < n; ++i)
-		if (p[i] >= 0) t[p[i]] = 1;
-	for (i = n_u = 0; i < n; ++i)
-		if (t[i] == 0 && v[i] >= min_sc)
-			++n_u;
-	if (n_u == 0) {
-		kfree(km, f); kfree(km, p); kfree(km, t); kfree(km, v);
-		return 0;
-	}
-	u = (uint64_t*)kmalloc(km, n_u * 8);
-	for (i = n_u = 0; i < n; ++i) {
-		if (t[i] == 0 && v[i] >= min_sc) {
-			j = i;
-			while (j >= 0 && f[j] < v[j]) j = p[j]; // find the point that maximizes f[]
-			if (j < 0) j = i; // TODO: this should really be assert(j>=0)
-			u[n_u++] = (uint64_t)f[j] << 32 | j;
-		}
-	}
-	radix_sort_64(u, u + n_u);
-	for (i = 0; i < n_u>>1; ++i) { // reverse, s.t. the highest scoring chain is the first
-		uint64_t t = u[i];
-		u[i] = u[n_u - i - 1], u[n_u - i - 1] = t;
-	}
-
-	// backtrack
-	memset(t, 0, n * 4);
-	for (i = n_v = k = 0; i < n_u; ++i) { // starting from the highest score
-		int32_t n_v0 = n_v, k0 = k;
-		j = (int32_t)u[i];
-		do {
-			v[n_v++] = j;
-			t[j] = 1;
-			j = p[j];
-		} while (j >= 0 && t[j] == 0);
-		if (j < 0) {
-			if (n_v - n_v0 >= min_cnt) u[k++] = u[i]>>32<<32 | (n_v - n_v0);
-		} else if ((int32_t)(u[i]>>32) - f[j] >= min_sc) {
-			if (n_v - n_v0 >= min_cnt) u[k++] = ((u[i]>>32) - f[j]) << 32 | (n_v - n_v0);
-		}
-		if (k0 == k) n_v = n_v0; // no new chain added, reset
-	}
-	n_u = k, *_u = u; // NB: note that u[] may not be sorted by score here
-
-	// free
-	kfree(km, f); kfree(km, p); kfree(km, t);
-
-	// write the result to b[]
-	b = (mm128_t*)kmalloc(km, n_v * sizeof(mm128_t));
-	for (i = 0, k = 0; i < n_u; ++i) {
-		int32_t k0 = k, ni = (int32_t)u[i];
-		for (j = 0; j < ni; ++j)
-			b[k] = a[v[k0 + (ni - j - 1)]], ++k;
-	}
-	kfree(km, v);
-
-	// sort u[] and a[] by a[].x, such that adjacent chains may be joined (required by mm_join_long)
-	w = (mm128_t*)kmalloc(km, n_u * sizeof(mm128_t));
-	for (i = k = 0; i < n_u; ++i) {
-		w[i].x = b[k].x, w[i].y = (uint64_t)k<<32|i;
-		k += (int32_t)u[i];
-	}
-	radix_sort_128x(w, w + n_u);
-	u2 = (uint64_t*)kmalloc(km, n_u * 8);
-	for (i = k = 0; i < n_u; ++i) {
-		int32_t j = (int32_t)w[i].y, n = (int32_t)u[j];
-		u2[i] = u[j];
-		memcpy(&a[k], &b[w[i].y>>32], n * sizeof(mm128_t));
-		k += n;
-	}
-	memcpy(u, u2, n_u * 8);
-	kfree(km, b); kfree(km, w); kfree(km, u2);
-	return n_u;
-}

example.c

@@ -1,63 +0,0 @@
-// To compile:
-//   gcc -g -O2 example.c libminimap2.a -lz
-
-#include <stdlib.h>
-#include <assert.h>
-#include <stdio.h>
-#include <zlib.h>
-#include "minimap.h"
-#include "kseq.h"
-KSEQ_INIT(gzFile, gzread)
-
-int main(int argc, char *argv[])
-{
-	mm_verbose = 2; // disable message output to stderr
-
-	if (argc < 3) {
-		fprintf(stderr, "Usage: minimap2-lite <target.fa> <query.fa>\n");
-		return 1;
-	}
-	
-	// open query file for reading; you may use your favorite FASTA/Q parser
-	gzFile f = gzopen(argv[2], "r");
-	assert(f);
-	kseq_t *ks = kseq_init(f);
-
-	// create index for target; we are creating one index for all target sequence
-	int n_threads = 4, w = 10, k = 15, is_hpc = 0;
-	mm_idx_t *mi = mm_idx_build(argv[1], w, k, is_hpc, n_threads);
-	assert(mi);
-
-	// mapping
-	mm_mapopt_t opt;
-	mm_mapopt_init(&opt); // initialize mapping parameters
-	mm_mapopt_update(&opt, mi); // this sets the maximum minimizer occurrence; TODO: set a better default in mm_mapopt_init()!
-	opt.flag |= MM_F_CIGAR; // perform alignment
-	mm_tbuf_t *tbuf = mm_tbuf_init(); // thread buffer; for multi-threading, allocate one tbuf for each thread
-	while (kseq_read(ks) >= 0) { // each kseq_read() call reads one query sequence
-		mm_reg1_t *reg;
-		int j, i, n_reg;
-		// get all hits for the query
-		reg = mm_map(mi, ks->seq.l, ks->seq.s, &n_reg, tbuf, &opt, 0);
-		// traverse hits and print them out
-		for (j = 0; j < n_reg; ++j) {
-			mm_reg1_t *r = &reg[j];
-			assert(r->p); // with MM_F_CIGAR, this should not be NULL
-			printf("%s\t%d\t%d\t%d\t%c\t", ks->name.s, ks->seq.l, r->qs, r->qe, "+-"[r->rev]);
-			printf("%s\t%d\t%d\t%d\t%d\t%d\t%d\tcg:Z:", mi->seq[r->rid].name, mi->seq[r->rid].len, r->rs, r->re,
-				   r->p->blen - r->p->n_ambi - r->p->n_diff, r->p->blen, r->mapq);
-			for (i = 0; i < r->p->n_cigar; ++i) // IMPORTANT: this gives the CIGAR in the aligned regions. NO soft/hard clippings!
-				printf("%d%c", r->p->cigar[i]>>4, "MIDSHN"[r->p->cigar[i]&0xf]);
-			putchar('\n');
-			free(r->p);
-		}
-		free(reg);
-	}
-	mm_tbuf_destroy(tbuf);
-
-	// deallocate index and close the query file
-	mm_idx_destroy(mi);
-	kseq_destroy(ks);
-	gzclose(f);
-	return 0;
-}

format.c

@@ -1,314 +0,0 @@
-#include <stdarg.h>
-#include <stdlib.h>
-#include <string.h>
-#include <assert.h>
-#include <stdio.h>
-#include "kalloc.h"
-#include "mmpriv.h"
-
-static char mm_rg_id[256];
-
-static inline void str_enlarge(kstring_t *s, int l)
-{
-	if (s->l + l + 1 > s->m) {
-		s->m = s->l + l + 1;
-		kroundup32(s->m);
-		s->s = (char*)realloc(s->s, s->m);
-	}
-}
-
-static inline void str_copy(kstring_t *s, const char *st, const char *en)
-{
-	str_enlarge(s, en - st);
-	memcpy(&s->s[s->l], st, en - st);
-	s->l += en - st;
-}
-
-static void mm_sprintf_lite(kstring_t *s, const char *fmt, ...)
-{
-	char buf[16]; // for integer to string conversion
-	const char *p, *q;
-	va_list ap;
-	va_start(ap, fmt);
-	for (q = p = fmt; *p; ++p) {
-		if (*p == '%') {
-			if (p > q) str_copy(s, q, p);
-			++p;
-			if (*p == 'd') {
-				int c, i, l = 0;
-				unsigned int x;
-				c = va_arg(ap, int);
-				x = c >= 0? c : -c;
-				do { buf[l++] = x%10 + '0'; x /= 10; } while (x > 0);
-				if (c < 0) buf[l++] = '-';
-				str_enlarge(s, l);
-				for (i = l - 1; i >= 0; --i) s->s[s->l++] = buf[i];
-			} else if (*p == 's') {
-				char *r = va_arg(ap, char*);
-				str_copy(s, r, r + strlen(r));
-			} else if (*p == 'c') {
-				str_enlarge(s, 1);
-				s->s[s->l++] = va_arg(ap, int);
-			} else abort();
-			q = p + 1;
-		}
-	}
-	if (p > q) str_copy(s, q, p);
-	va_end(ap);
-	s->s[s->l] = 0;
-}
-
-static char *mm_escape(char *s)
-{
-	char *p, *q;
-	for (p = q = s; *p; ++p) {
-		if (*p == '\\') {
-			++p;
-			if (*p == 't') *q++ = '\t';
-			else if (*p == '\\') *q++ = '\\';
-		} else *q++ = *p;
-	}
-	*q = '\0';
-	return s;
-}
-
-static void sam_write_rg_line(kstring_t *str, const char *s)
-{
-	char *p, *q, *r, *rg_line = 0;
-	memset(mm_rg_id, 0, 256);
-	if (s == 0) return;
-	if (strstr(s, "@RG") != s) {
-		if (mm_verbose >= 1) fprintf(stderr, "[ERROR] the read group line is not started with @RG\n");
-		goto err_set_rg;
-	}
-	if (strstr(s, "\t") != NULL) {
-		if (mm_verbose >= 1) fprintf(stderr, "[ERROR] the read group line contained literal <tab> characters -- replace with escaped tabs: \\t\n");
-		goto err_set_rg;
-	}
-	rg_line = strdup(s);
-	mm_escape(rg_line);
-	if ((p = strstr(rg_line, "\tID:")) == 0) {
-		if (mm_verbose >= 1) fprintf(stderr, "[ERROR] no ID within the read group line\n");
-		goto err_set_rg;
-	}
-	p += 4;
-	for (q = p; *q && *q != '\t' && *q != '\n'; ++q);
-	if (q - p + 1 > 256) {
-		if (mm_verbose >= 1) fprintf(stderr, "[ERROR] @RG:ID is longer than 255 characters\n");
-		goto err_set_rg;
-	}
-	for (q = p, r = mm_rg_id; *q && *q != '\t' && *q != '\n'; ++q)
-		*r++ = *q;
-	mm_sprintf_lite(str, "%s\n", rg_line);
-
-err_set_rg:
-	free(rg_line);
-}
-
-void mm_write_sam_hdr_no_SQ(const char *rg, const char *ver, int argc, char *argv[])
-{
-	kstring_t str = {0,0,0};
-	sam_write_rg_line(&str, rg);
-	mm_sprintf_lite(&str, "@PG\tID:minimap2\tPN:minimap2");
-	if (ver) mm_sprintf_lite(&str, "\tVN:%s", ver);
-	if (argc > 1) {
-		int i;
-		mm_sprintf_lite(&str, "\tCL:minimap2");
-		for (i = 1; i < argc; ++i)
-			mm_sprintf_lite(&str, " %s", argv[i]);
-	}
-	mm_sprintf_lite(&str, "\n");
-	fputs(str.s, stdout);
-	free(str.s);
-}
-
-static void write_cs(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r)
-{
-	extern unsigned char seq_nt4_table[256];
-	int i, q_off, t_off;
-	uint8_t *qseq, *tseq;
-	char *tmp;
-	if (r->p == 0) return;
-	mm_sprintf_lite(s, "\tcs:Z:");
-	qseq = (uint8_t*)kmalloc(km, r->qe - r->qs);
-	tseq = (uint8_t*)kmalloc(km, r->re - r->rs);
-	tmp = (char*)kmalloc(km, r->re - r->rs > r->qe - r->qs? r->re - r->rs + 1 : r->qe - r->qs + 1);
-	mm_idx_getseq(mi, r->rid, r->rs, r->re, tseq);
-	if (!r->rev) {
-		for (i = r->qs; i < r->qe; ++i)
-			qseq[i - r->qs] = seq_nt4_table[(uint8_t)t->seq[i]];
-	} else {
-		for (i = r->qs; i < r->qe; ++i) {
-			uint8_t c = seq_nt4_table[(uint8_t)t->seq[i]];
-			qseq[r->qe - i - 1] = c >= 4? 4 : 3 - c;
-		}
-	}
-	for (i = q_off = t_off = 0; i < r->p->n_cigar; ++i) {
-		int j, op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
-		assert(op >= 0 && op <= 2);
-		if (op == 0) {
-			int l_tmp = 0;
-			for (j = 0; j < len; ++j) {
-				if (qseq[q_off + j] != tseq[t_off + j]) {
-					if (l_tmp > 0) {
-						tmp[l_tmp] = 0;
-						mm_sprintf_lite(s, "=%s", tmp);
-						l_tmp = 0;
-					}
-					mm_sprintf_lite(s, "*%c%c", "acgtn"[tseq[t_off + j]], "acgtn"[qseq[q_off + j]]);
-				} else tmp[l_tmp++] = "ACGTN"[qseq[q_off + j]];
-			}
-			if (l_tmp > 0) {
-				tmp[l_tmp] = 0;
-				mm_sprintf_lite(s, "=%s", tmp);
-			}
-			q_off += len, t_off += len;
-		} else if (op == 1) {
-			for (j = 0, tmp[len] = 0; j < len; ++j)
-				tmp[j] = "acgtn"[qseq[q_off + j]];
-			mm_sprintf_lite(s, "+%s", tmp);
-			q_off += len;
-		} else if (op == 2) {
-			for (j = 0, tmp[len] = 0; j < len; ++j)
-				tmp[j] = "acgtn"[tseq[t_off + j]];
-			mm_sprintf_lite(s, "-%s", tmp);
-			t_off += len;
-		}
-	}
-	assert(t_off == r->re - r->rs && q_off == r->qe - r->qs);
-	kfree(km, qseq); kfree(km, tseq); kfree(km, tmp);
-}
-
-static inline void write_tags(kstring_t *s, const mm_reg1_t *r)
-{
-	int type = r->inv? 'I' : r->id == r->parent? 'P' : 'S';
-	mm_sprintf_lite(s, "\ttp:A:%c\tcm:i:%d\ts1:i:%d", type, r->cnt, r->score);
-	if (r->parent == r->id) mm_sprintf_lite(s, "\ts2:i:%d", r->subsc);
-	if (r->split) mm_sprintf_lite(s, "\tzd:i:%d", r->split);
-	if (r->p) {
-		mm_sprintf_lite(s, "\tNM:i:%d\tms:i:%d\tAS:i:%d\tnn:i:%d", r->p->n_diff, r->p->dp_max, r->p->dp_score, r->p->n_ambi);
-		if (r->p->trans_strand == 1 || r->p->trans_strand == 2)
-			mm_sprintf_lite(s, "\tts:A:%c", "?+-?"[r->p->trans_strand]);
-	}
-}
-
-void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int opt_flag)
-{
-	s->l = 0;
-	mm_sprintf_lite(s, "%s\t%d\t%d\t%d\t%c\t", t->name, t->l_seq, r->qs, r->qe, "+-"[r->rev]);
-	if (mi->seq[r->rid].name) mm_sprintf_lite(s, "%s", mi->seq[r->rid].name);
-	else mm_sprintf_lite(s, "%d", r->rid);
-	mm_sprintf_lite(s, "\t%d\t%d\t%d", mi->seq[r->rid].len, r->rs, r->re);
-	if (r->p) mm_sprintf_lite(s, "\t%d\t%d", r->p->blen - r->p->n_ambi - r->p->n_diff, r->p->blen);
-	else mm_sprintf_lite(s, "\t%d\t%d", r->fuzzy_mlen, r->fuzzy_blen);
-	mm_sprintf_lite(s, "\t%d", r->mapq);
-	write_tags(s, r);
-	if (r->p && (opt_flag & MM_F_OUT_CG)) {
-		uint32_t k;
-		mm_sprintf_lite(s, "\tcg:Z:");
-		for (k = 0; k < r->p->n_cigar; ++k)
-			mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDN"[r->p->cigar[k]&0xf]);
-	}
-	if (r->p && (opt_flag & MM_F_OUT_CS))
-		write_cs(km, s, mi, t, r);
-}
-
-static char comp_tab[] = {
-	  0,   1,	2,	 3,	  4,   5,	6,	 7,	  8,   9,  10,	11,	 12,  13,  14,	15,
-	 16,  17,  18,	19,	 20,  21,  22,	23,	 24,  25,  26,	27,	 28,  29,  30,	31,
-	 32,  33,  34,	35,	 36,  37,  38,	39,	 40,  41,  42,	43,	 44,  45,  46,	47,
-	 48,  49,  50,	51,	 52,  53,  54,	55,	 56,  57,  58,	59,	 60,  61,  62,	63,
-	 64, 'T', 'V', 'G', 'H', 'E', 'F', 'C', 'D', 'I', 'J', 'M', 'L', 'K', 'N', 'O',
-	'P', 'Q', 'Y', 'S', 'A', 'A', 'B', 'W', 'X', 'R', 'Z',	91,	 92,  93,  94,	95,
-	 64, 't', 'v', 'g', 'h', 'e', 'f', 'c', 'd', 'i', 'j', 'm', 'l', 'k', 'n', 'o',
-	'p', 'q', 'y', 's', 'a', 'a', 'b', 'w', 'x', 'r', 'z', 123, 124, 125, 126, 127
-};
-
-void mm_write_sam_SQ(const mm_idx_t *idx)
-{
-	uint32_t i;
-	for (i = 0; i < idx->n_seq; ++i)
-		printf("@SQ\tSN:%s\tLN:%d\n", idx->seq[i].name, idx->seq[i].len);
-}
-
-static void sam_write_sq(kstring_t *s, char *seq, int l, int rev, int comp)
-{
-	if (rev) {
-		int i;
-		str_enlarge(s, l);
-		for (i = 0; i < l; ++i) {
-			int c = seq[l - 1 - i];
-			s->s[s->l + i] = c < 128 && comp? comp_tab[c] : c;
-		}
-		s->l += l;
-	} else str_copy(s, seq, seq + l);
-}
-
-void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int n_regs, const mm_reg1_t *regs)
-{
-	int flag = 0;
-	s->l = 0;
-	if (r == 0) {
-		mm_sprintf_lite(s, "%s\t4\t*\t0\t0\t*\t*\t0\t0\t", t->name);
-		sam_write_sq(s, t->seq, t->l_seq, 0, 0);
-		mm_sprintf_lite(s, "\t");
-		if (t->qual) sam_write_sq(s, t->qual, t->l_seq, 0, 0);
-		else mm_sprintf_lite(s, "*");
-	} else {
-		if (r->rev) flag |= 0x10;
-		if (r->parent != r->id) flag |= 0x100;
-		else if (!r->sam_pri) flag |= 0x800;
-		mm_sprintf_lite(s, "%s\t%d\t%s\t%d\t%d\t", t->name, flag, mi->seq[r->rid].name, r->rs+1, r->mapq);
-		if (r->p) { // actually this should always be true for SAM output
-			uint32_t k, clip_len = r->rev? t->l_seq - r->qe : r->qs;
-			int clip_char = (flag&0x800)? 'H' : 'S';
-			if (clip_len) mm_sprintf_lite(s, "%d%c", clip_len, clip_char);
-			for (k = 0; k < r->p->n_cigar; ++k)
-				mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDN"[r->p->cigar[k]&0xf]);
-			clip_len = r->rev? r->qs : t->l_seq - r->qe;
-			if (clip_len) mm_sprintf_lite(s, "%d%c", clip_len, clip_char);
-		} else mm_sprintf_lite(s, "*");
-		mm_sprintf_lite(s, "\t*\t0\t0\t");
-		if ((flag & 0x900) == 0) {
-			sam_write_sq(s, t->seq, t->l_seq, r->rev, r->rev);
-			mm_sprintf_lite(s, "\t");
-			if (t->qual) sam_write_sq(s, t->qual, t->l_seq, r->rev, 0);
-			else mm_sprintf_lite(s, "*");
-		} else if (flag & 0x100) {
-			mm_sprintf_lite(s, "*\t*");
-		} else {
-			sam_write_sq(s, t->seq + r->qs, r->qe - r->qs, r->rev, r->rev);
-			mm_sprintf_lite(s, "\t");
-			if (t->qual) sam_write_sq(s, t->qual + r->qs, r->qe - r->qs, r->rev, 0);
-			else mm_sprintf_lite(s, "*");
-		}
-		write_tags(s, r);
-		if (mm_rg_id[0]) mm_sprintf_lite(s, "\tRG:Z:%s", mm_rg_id);
-		if (r->parent == r->id && r->p && n_regs > 1 && regs && r >= regs && r - regs < n_regs) { // supplementary aln may exist
-			int i, n_sa = 0; // n_sa: number of SA fields
-			for (i = 0; i < n_regs; ++i)
-				if (i != r - regs && regs[i].parent == regs[i].id && regs[i].p)
-					++n_sa;
-			if (n_sa > 0) {
-				mm_sprintf_lite(s, "\tSA:Z:");
-				for (i = 0; i < n_regs; ++i) {
-					const mm_reg1_t *q = &regs[i];
-					int l_M, l_I = 0, l_D = 0, clip5 = 0, clip3 = 0;
-					if (r == q || q->parent != q->id || q->p == 0) continue;
-					if (q->qe - q->qs < q->re - q->rs) l_M = q->qe - q->qs, l_D = (q->re - q->rs) - l_M;
-					else l_M = q->re - q->rs, l_I = (q->qe - q->qs) - l_M;
-					clip5 = q->rev? t->l_seq - q->qe : q->qs;
-					clip3 = q->rev? q->qs : t->l_seq - q->qe;
-					mm_sprintf_lite(s, "%s,%d,%c,", mi->seq[q->rid].name, q->rs+1, "+-"[q->rev]);
-					if (clip5) mm_sprintf_lite(s, "%dS", clip5);
-					if (l_M) mm_sprintf_lite(s, "%dM", l_M);
-					if (l_I) mm_sprintf_lite(s, "%dI", l_I);
-					if (l_D) mm_sprintf_lite(s, "%dD", l_D);
-					if (clip3) mm_sprintf_lite(s, "%dS", clip3);
-					mm_sprintf_lite(s, ",%d,%d;", q->mapq, q->p->n_diff);
-				}
-			}
-		}
-	}
-	s->s[s->l] = 0; // we always have room for an extra byte (see str_enlarge)
-}

getopt.c

@@ -1,216 +0,0 @@
-#include <stddef.h>
-#include <stdio.h>
-#include <string.h>
-#include "getopt.h"
-
-char *optarg;
-int optind=1, opterr=1, optopt, __optpos, optreset=0;
-
-#define optpos __optpos
-
-static void __getopt_msg(const char *a, const char *b, const char *c, size_t l)
-{
-	FILE *f = stderr;
-#if !defined(WIN32) && !defined(_WIN32)
-	flockfile(f);
-#endif
-	fputs(a, f);
-	fwrite(b, strlen(b), 1, f);
-	fwrite(c, 1, l, f);
-	fputc('\n', f);
-#if !defined(WIN32) && !defined(_WIN32)
-	funlockfile(f);
-#endif
-}
-
-int getopt(int argc, char * const argv[], const char *optstring)
-{
-	int i, c, d;
-	int k, l;
-	char *optchar;
-
-	if (!optind || optreset) {
-		optreset = 0;
-		__optpos = 0;
-		optind = 1;
-	}
-
-	if (optind >= argc || !argv[optind])
-		return -1;
-
-	if (argv[optind][0] != '-') {
-		if (optstring[0] == '-') {
-			optarg = argv[optind++];
-			return 1;
-		}
-		return -1;
-	}
-
-	if (!argv[optind][1])
-		return -1;
-
-	if (argv[optind][1] == '-' && !argv[optind][2])
-		return optind++, -1;
-
-	if (!optpos) optpos++;
-	c = argv[optind][optpos], k = 1;
-	optchar = argv[optind]+optpos;
-	optopt = c;
-	optpos += k;
-
-	if (!argv[optind][optpos]) {
-		optind++;
-		optpos = 0;
-	}
-
-	if (optstring[0] == '-' || optstring[0] == '+')
-		optstring++;
-
-	i = 0;
-	d = 0;
-	do {
-		d = optstring[i], l = 1;
-		if (l>0) i+=l; else i++;
-	} while (l && d != c);
-
-	if (d != c) {
-		if (optstring[0] != ':' && opterr)
-			__getopt_msg(argv[0], ": unrecognized option: ", optchar, k);
-		return '?';
-	}
-	if (optstring[i] == ':') {
-		if (optstring[i+1] == ':') optarg = 0;
-		else if (optind >= argc) {
-			if (optstring[0] == ':') return ':';
-			if (opterr) __getopt_msg(argv[0],
-				": option requires an argument: ",
-				optchar, k);
-			return '?';
-		}
-		if (optstring[i+1] != ':' || optpos) {
-			optarg = argv[optind++] + optpos;
-			optpos = 0;
-		}
-	}
-	return c;
-}
-
-static void permute(char *const *argv, int dest, int src)
-{
-	char **av = (char **)argv;
-	char *tmp = av[src];
-	int i;
-	for (i=src; i>dest; i--)
-		av[i] = av[i-1];
-	av[dest] = tmp;
-}
-
-static int __getopt_long_core(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx, int longonly)
-{
-	optarg = 0;
-	if (longopts && argv[optind][0] == '-' &&
-		((longonly && argv[optind][1] && argv[optind][1] != '-') ||
-		 (argv[optind][1] == '-' && argv[optind][2])))
-	{
-		int colon = optstring[optstring[0]=='+'||optstring[0]=='-']==':';
-		int i, cnt, match;
-		char *opt;
-		for (cnt=i=0; longopts[i].name; i++) {
-			const char *name = longopts[i].name;
-			opt = argv[optind]+1;
-			if (*opt == '-') opt++;
-			for (; *name && *name == *opt; name++, opt++);
-			if (*opt && *opt != '=') continue;
-			match = i;
-			if (!*name) {
-				cnt = 1;
-				break;
-			}
-			cnt++;
-		}
-		if (cnt==1) {
-			i = match;
-			optind++;
-			optopt = longopts[i].val;
-			if (*opt == '=') {
-				if (!longopts[i].has_arg) {
-					if (colon || !opterr)
-						return '?';
-					__getopt_msg(argv[0],
-						": option does not take an argument: ",
-						longopts[i].name,
-						strlen(longopts[i].name));
-					return '?';
-				}
-				optarg = opt+1;
-			} else if (longopts[i].has_arg == required_argument) {
-				if (!(optarg = argv[optind])) {
-					if (colon) return ':';
-					if (!opterr) return '?';
-					__getopt_msg(argv[0],
-						": option requires an argument: ",
-						longopts[i].name,
-						strlen(longopts[i].name));
-					return '?';
-				}
-				optind++;
-			}
-			if (idx) *idx = i;
-			if (longopts[i].flag) {
-				*longopts[i].flag = longopts[i].val;
-				return 0;
-			}
-			return longopts[i].val;
-		}
-		if (argv[optind][1] == '-') {
-			if (!colon && opterr)
-				__getopt_msg(argv[0], cnt ?
-					": option is ambiguous: " :
-					": unrecognized option: ",
-					argv[optind]+2,
-					strlen(argv[optind]+2));
-			optind++;
-			return '?';
-		}
-	}
-	return getopt(argc, argv, optstring);
-}
-
-static int __getopt_long(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx, int longonly)
-{
-	int ret, skipped, resumed;
-	if (!optind || optreset) {
-		optreset = 0;
-		__optpos = 0;
-		optind = 1;
-	}
-	if (optind >= argc || !argv[optind]) return -1;
-	skipped = optind;
-	if (optstring[0] != '+' && optstring[0] != '-') {
-		int i;
-		for (i=optind; ; i++) {
-			if (i >= argc || !argv[i]) return -1;
-			if (argv[i][0] == '-' && argv[i][1]) break;
-		}
-		optind = i;
-	}
-	resumed = optind;
-	ret = __getopt_long_core(argc, argv, optstring, longopts, idx, longonly);
-	if (resumed > skipped) {
-		int i, cnt = optind-resumed;
-		for (i=0; i<cnt; i++)
-			permute(argv, skipped, optind-1);
-		optind = skipped + cnt;
-	}
-	return ret;
-}
-
-int getopt_long(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx)
-{
-	return __getopt_long(argc, argv, optstring, longopts, idx, 0);
-}
-
-int getopt_long_only(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx)
-{
-	return __getopt_long(argc, argv, optstring, longopts, idx, 1);
-}

getopt.h

@@ -1,53 +0,0 @@
-/*
-  Copyright 2005-2014 Rich Felker, et al.
-  
-  Permission is hereby granted, free of charge, to any person obtaining
-  a copy of this software and associated documentation files (the
-  "Software"), to deal in the Software without restriction, including
-  without limitation the rights to use, copy, modify, merge, publish,
-  distribute, sublicense, and/or sell copies of the Software, and to
-  permit persons to whom the Software is furnished to do so, subject to
-  the following conditions:
-  
-  The above copyright notice and this permission notice shall be
-  included in all copies or substantial portions of the Software.
-  
-  THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
-  EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
-  MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT.
-  IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY
-  CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT,
-  TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE
-  SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
-*/
-
-#ifndef _GETOPT_H
-#define _GETOPT_H
-
-#ifdef __cplusplus
-extern "C" {
-#endif
-
-int getopt(int, char * const [], const char *);
-extern char *optarg;
-extern int optind, opterr, optopt, optreset;
-
-struct option {
-	const char *name;
-	int has_arg;
-	int *flag;
-	int val;
-};
-
-int getopt_long(int, char *const *, const char *, const struct option *, int *);
-int getopt_long_only(int, char *const *, const char *, const struct option *, int *);
-
-#define no_argument        0
-#define required_argument  1
-#define optional_argument  2
-
-#ifdef __cplusplus
-}
-#endif
-
-#endif

hit.c

@@ -1,311 +0,0 @@
-#include <string.h>
-#include <math.h>
-#include "mmpriv.h"
-#include "kalloc.h"
-
-static inline void mm_cal_fuzzy_len(mm_reg1_t *r, const mm128_t *a)
-{
-	int i;
-	r->fuzzy_mlen = r->fuzzy_blen = 0;
-	if (r->cnt <= 0) return;
-	r->fuzzy_mlen = r->fuzzy_blen = a[r->as].y>>32&0xff;
-	for (i = r->as + 1; i < r->as + r->cnt; ++i) {
-		int span = a[i].y>>32&0xff;
-		int tl = (int32_t)a[i].x - (int32_t)a[i-1].x;
-		int ql = (int32_t)a[i].y - (int32_t)a[i-1].y;
-		r->fuzzy_blen += tl > ql? tl : ql;
-		r->fuzzy_mlen += tl > span && ql > span? span : tl < ql? tl : ql;
-	}
-}
-
-static inline void mm_reg_set_coor(mm_reg1_t *r, int32_t qlen, const mm128_t *a)
-{ // NB: r->as and r->cnt MUST BE set correctly for this function to work
-	int32_t k = r->as, q_span = (int32_t)(a[k].y>>32&0xff);
-	r->rev = a[k].x>>63;
-	r->rid = a[k].x<<1>>33;
-	r->rs = (int32_t)a[k].x + 1 > q_span? (int32_t)a[k].x + 1 - q_span : 0; // NB: target span may be shorter, so this test is necessary
-	r->re = (int32_t)a[k + r->cnt - 1].x + 1;
-	if (!r->rev) {
-		r->qs = (int32_t)a[k].y + 1 - q_span;
-		r->qe = (int32_t)a[k + r->cnt - 1].y + 1;
-	} else {
-		r->qs = qlen - ((int32_t)a[k + r->cnt - 1].y + 1);
-		r->qe = qlen - ((int32_t)a[k].y + 1 - q_span);
-	}
-	mm_cal_fuzzy_len(r, a);
-}
-
-mm_reg1_t *mm_gen_regs(void *km, int qlen, int n_u, uint64_t *u, mm128_t *a) // convert chains to hits
-{
-	mm128_t *z, tmp;
-	mm_reg1_t *r;
-	int i, k;
-
-	if (n_u == 0) return 0;
-
-	// sort by score
-	z = (mm128_t*)kmalloc(km, n_u * 16);
-	for (i = k = 0; i < n_u; ++i) {
-		z[i].x = u[i] >> 32;
-		z[i].y = (uint64_t)k << 32 | (int32_t)u[i];
-		k += (int32_t)u[i];
-	}
-	radix_sort_128x(z, z + n_u);
-	for (i = 0; i < n_u>>1; ++i) // reverse, s.t. larger score first
-		tmp = z[i], z[i] = z[n_u-1-i], z[n_u-1-i] = tmp;
-
-	// populate r[]
-	r = (mm_reg1_t*)calloc(n_u, sizeof(mm_reg1_t));
-	for (i = 0; i < n_u; ++i) {
-		mm_reg1_t *ri = &r[i];
-		ri->id = i;
-		ri->parent = MM_PARENT_UNSET;
-		ri->score = z[i].x;
-		ri->cnt = (int32_t)z[i].y;
-		ri->as = z[i].y >> 32;
-		mm_reg_set_coor(ri, qlen, a);
-	}
-	kfree(km, z);
-	return r;
-}
-
-void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a)
-{
-	if (n <= 0 || n >= r->cnt) return;
-	*r2 = *r;
-	r2->id = -1;
-	r2->sam_pri = 0;
-	r2->p = 0;
-	r2->cnt = r->cnt - n;
-	r2->score = (int32_t)(r->score * ((float)r2->cnt / r->cnt) + .499);
-	r2->as = r->as + n;
-	if (r->parent == r->id) r2->parent = MM_PARENT_TMP_PRI;
-	mm_reg_set_coor(r2, qlen, a);
-	r->cnt -= r2->cnt;
-	r->score -= r2->score;
-	mm_reg_set_coor(r, qlen, a);
-	r->split |= 1, r2->split |= 2;
-}
-
-void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r) // and compute mm_reg1_t::subsc
-{
-	int i, j, k, *w;
-	if (n <= 0) return;
-	for (i = 0; i < n; ++i) r[i].id = i;
-	w = (int*)kmalloc(km, n * sizeof(int));
-	w[0] = 0, r[0].parent = 0;
-	for (i = 1, k = 1; i < n; ++i) {
-		mm_reg1_t *ri = &r[i];
-		int si = ri->qs, ei = ri->qe;
-		for (j = 0; j < k; ++j) {
-			mm_reg1_t *rp = &r[w[j]];
-			int sj = rp->qs, ej = rp->qe;
-			int min = ej - sj < ei - si? ej - sj : ei - si;
-			int ol = si < sj? (ei < sj? 0 : ei < ej? ei - sj : ej - sj) : (ej < si? 0 : ej < ei? ej - si : ei - si);
-			if (ol > mask_level * min) {
-				ri->parent = rp->parent;
-				rp->subsc = rp->subsc > ri->score? rp->subsc : ri->score;
-				if (rp->p && ri->p)
-					rp->p->dp_max2 = rp->p->dp_max2 > ri->p->dp_max? rp->p->dp_max2 : ri->p->dp_max;
-				break;
-			}
-		}
-		if (j == k) w[k++] = i, ri->parent = i;
-	}
-	kfree(km, w);
-}
-
-void mm_hit_sort_by_dp(void *km, int *n_regs, mm_reg1_t *r)
-{
-	int32_t i, n_aux, n = *n_regs;
-	uint64_t *aux;
-	mm_reg1_t *t;
-
-	if (n <= 1) return;
-	aux = (uint64_t*)kmalloc(km, n * 8);
-	t = (mm_reg1_t*)kmalloc(km, n * sizeof(mm_reg1_t));
-	for (i = n_aux = 0; i < n; ++i) {
-		if (r[i].inv || r[i].cnt > 0) { // squeeze out elements with cnt==0 (soft deleted)
-			assert(r[i].p);
-			aux[n_aux++] = (uint64_t)r[i].p->dp_max << 32 | i;
-		} else if (r[i].p) {
-			free(r[i].p);
-			r[i].p = 0;
-		}
-	}
-	radix_sort_64(aux, aux + n_aux);
-	for (i = n_aux - 1; i >= 0; --i)
-		t[n_aux - 1 - i] = r[(int32_t)aux[i]];
-	memcpy(r, t, sizeof(mm_reg1_t) * n_aux);
-	*n_regs = n_aux;
-	kfree(km, aux);
-	kfree(km, t);
-}
-
-int mm_set_sam_pri(int n, mm_reg1_t *r)
-{
-	int i, n_pri = 0;
-	for (i = 0; i < n; ++i)
-		if (r[i].id == r[i].parent) {
-			++n_pri;
-			r[i].sam_pri = (n_pri == 1);
-		} else r[i].sam_pri = 0;
-	return n_pri;
-}
-
-void mm_sync_regs(void *km, int n_regs, mm_reg1_t *regs) // keep mm_reg1_t::{id,parent} in sync; also reset id
-{
-	int *tmp, i, max_id = -1, n_tmp;
-	if (n_regs <= 0) return;
-	for (i = 0; i < n_regs; ++i) // NB: doesn't work if mm_reg1_t::id is negative
-		max_id = max_id > regs[i].id? max_id : regs[i].id;
-	n_tmp = max_id + 1;
-	tmp = (int*)kmalloc(km, n_tmp * sizeof(int));
-	for (i = 0; i < n_tmp; ++i) tmp[i] = -1;
-	for (i = 0; i < n_regs; ++i)
-		if (regs[i].id >= 0) tmp[regs[i].id] = i;
-	for (i = 0; i < n_regs; ++i) {
-		mm_reg1_t *r = &regs[i];
-		r->id = i;
-		if (r->parent == MM_PARENT_TMP_PRI)
-			r->parent = i;
-		else if (r->parent >= 0 && tmp[r->parent] >= 0)
-			r->parent = tmp[r->parent];
-		else r->parent = MM_PARENT_UNSET;
-	}
-	kfree(km, tmp);
-	mm_set_sam_pri(n_regs, regs);
-}
-
-void mm_select_sub(void *km, float mask_level, float pri_ratio, int min_diff, int best_n, int *n_, mm_reg1_t *r)
-{
-	if (pri_ratio > 0.0f && *n_ > 0) {
-		int i, k, n = *n_, n_2nd = 0;
-		for (i = k = 0; i < n; ++i)
-			if (r[i].parent == i) r[k++] = r[i];
-			else if ((r[i].score >= r[r[i].parent].score * pri_ratio || r[i].score + min_diff >= r[r[i].parent].score) && n_2nd++ < best_n)
-				r[k++] = r[i];
-			else if (r[i].p) free(r[i].p);
-		if (k != n) mm_sync_regs(km, k, r); // removing hits requires sync()
-		*n_ = k;
-	}
-}
-
-void mm_filter_regs(void *km, const mm_mapopt_t *opt, int *n_regs, mm_reg1_t *regs)
-{ // NB: after this call, mm_reg1_t::parent can be -1 if its parent filtered out
-	int i, k;
-	for (i = k = 0; i < *n_regs; ++i) {
-		mm_reg1_t *r = &regs[i];
-		int flt = 0;
-		if (!r->inv && r->cnt < opt->min_cnt) flt = 1;
-		if (r->p) {
-			if (r->p->blen - r->p->n_ambi - r->p->n_diff < opt->min_chain_score) flt = 1;
-			else if (r->p->dp_max < opt->min_dp_max) flt = 1;
-			if (flt) free(r->p);
-		}
-		if (!flt) {
-			if (k < i) regs[k++] = regs[i];
-			else ++k;
-		}
-	}
-	*n_regs = k;
-}
-
-int mm_squeeze_a(void *km, int n_regs, mm_reg1_t *regs, mm128_t *a)
-{ // squeeze out regions in a[] that are not referenced by regs[]
-	int i, as = 0;
-	uint64_t *aux;
-	aux = (uint64_t*)kmalloc(km, n_regs * 8);
-	for (i = 0; i < n_regs; ++i)
-		aux[i] = (uint64_t)regs[i].as << 32 | i;
-	radix_sort_64(aux, aux + n_regs);
-	for (i = 0; i < n_regs; ++i) {
-		mm_reg1_t *r = &regs[(int32_t)aux[i]];
-		if (r->as != as) {
-			memmove(&a[as], &a[r->as], r->cnt * 16);
-			r->as = as;
-		}
-		as += r->cnt;
-	}
-	kfree(km, aux);
-	return as;
-}
-
-void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs_, mm_reg1_t *regs, mm128_t *a)
-{
-	int i, n_aux, n_regs = *n_regs_, n_drop = 0;
-	uint64_t *aux;
-
-	if (n_regs < 2) return; // nothing to join
-	mm_squeeze_a(km, n_regs, regs, a);
-
-	aux = (uint64_t*)kmalloc(km, n_regs * 8);
-	for (i = n_aux = 0; i < n_regs; ++i)
-		if (regs[i].parent == i || regs[i].parent < 0)
-			aux[n_aux++] = (uint64_t)regs[i].as << 32 | i;
-	radix_sort_64(aux, aux + n_aux);
-
-	for (i = n_aux - 1; i >= 1; --i) {
-		mm_reg1_t *r0 = &regs[(int32_t)aux[i-1]], *r1 = &regs[(int32_t)aux[i]];
-		mm128_t *a0e, *a1s;
-		int max_gap, min_gap, sc_thres;
-
-		// test
-		if (r0->as + r0->cnt != r1->as) continue; // not adjacent in a[]
-		if (r0->rid != r1->rid || r0->rev != r1->rev) continue; // make sure on the same target and strand
-		a0e = &a[r0->as + r0->cnt - 1];
-		a1s = &a[r1->as];
-		if (a1s->x <= a0e->x || (int32_t)a1s->y <= (int32_t)a0e->y) continue; // keep colinearity
-		max_gap = min_gap = (int32_t)a1s->y - (int32_t)a0e->y;
-		max_gap = max_gap > a1s->x - a0e->x? max_gap : a1s->x - a0e->x;
-		min_gap = min_gap < a1s->x - a0e->x? min_gap : a1s->x - a0e->x;
-		if (max_gap > opt->max_join_long || min_gap > opt->max_join_short) continue;
-		sc_thres = (int)((float)opt->min_join_flank_sc / opt->max_join_long * max_gap + .499);
-		if (r0->score < sc_thres || r1->score < sc_thres) continue; // require good flanking chains
-		if (r0->re - r0->rs < max_gap>>1 || r0->qe - r0->qs < max_gap>>1) continue; // require enough flanking length
-		if (r1->re - r1->rs < max_gap>>1 || r1->qe - r1->qs < max_gap>>1) continue;
-
-		// all conditions satisfied; join
-		a[r1->as].y |= MM_SEED_LONG_JOIN;
-		r0->cnt += r1->cnt, r0->score += r1->score;
-		mm_reg_set_coor(r0, qlen, a);
-		r1->cnt = 0;
-		r1->parent = r0->id;
-		++n_drop;
-	}
-	kfree(km, aux);
-
-	if (n_drop > 0) { // then fix the hits hierarchy
-		for (i = 0; i < n_regs; ++i) { // adjust the mm_reg1_t::parent
-			mm_reg1_t *r = &regs[i];
-			if (r->parent >= 0 && r->id != r->parent) { // fix for secondary hits only
-				if (regs[r->parent].parent >= 0 && regs[r->parent].parent != r->parent)
-					r->parent = regs[r->parent].parent;
-			}
-		}
-		mm_filter_regs(km, opt, n_regs_, regs);
-		mm_sync_regs(km, *n_regs_, regs);
-	}
-}
-
-void mm_set_mapq(int n_regs, mm_reg1_t *regs, int min_chain_sc)
-{
-	static const float q_coef = 30.0f;
-	int i;
-	for (i = 0; i < n_regs; ++i) {
-		mm_reg1_t *r = &regs[i];
-		if (r->inv) {
-			r->mapq = 0;
-		} else if (r->parent == r->id) {
-			int mapq, subsc;
-			float pen_cm = r->cnt >= 10? 1.0f : 0.1f * r->cnt;
-			subsc = r->subsc > min_chain_sc? r->subsc : min_chain_sc;
-			if (r->p && r->p->dp_max2 > 0 && r->p->dp_max > 0) {
-				float identity = (float)(r->p->blen - r->p->n_diff - r->p->n_ambi) / (r->p->blen - r->p->n_ambi);
-				mapq = (int)(identity * pen_cm * q_coef * (1. - (float)r->p->dp_max2 * subsc / r->p->dp_max / r->score) * logf(r->score));
-			} else mapq = (int)(pen_cm * q_coef * (1. - (float)subsc / r->score) * logf(r->score));
-			mapq = mapq > 0? mapq : 0;
-			r->mapq = mapq < 60? mapq : 60;
-		} else r->mapq = 0;
-	}
-}

index.c

@@ -1,431 +0,0 @@
-#include <stdlib.h>
-#include <assert.h>
-#if defined(WIN32) || defined(_WIN32)
-#include <io.h> // for open(2)
-#else
-#include <unistd.h>
-#endif
-#include <fcntl.h>
-#include <stdio.h>
-#include "kthread.h"
-#include "bseq.h"
-#include "minimap.h"
-#include "mmpriv.h"
-#include "kvec.h"
-#include "khash.h"
-
-#define idx_hash(a) ((a)>>1)
-#define idx_eq(a, b) ((a)>>1 == (b)>>1)
-KHASH_INIT(idx, uint64_t, uint64_t, 1, idx_hash, idx_eq)
-typedef khash_t(idx) idxhash_t;
-
-#define kroundup64(x) (--(x), (x)|=(x)>>1, (x)|=(x)>>2, (x)|=(x)>>4, (x)|=(x)>>8, (x)|=(x)>>16, (x)|=(x)>>32, ++(x))
-
-mm_idx_t *mm_idx_init(int w, int k, int b, int is_hpc)
-{
-	mm_idx_t *mi;
-	if (k*2 < b) b = k * 2;
-	if (w < 1) w = 1;
-	mi = (mm_idx_t*)calloc(1, sizeof(mm_idx_t));
-	mi->w = w, mi->k = k, mi->b = b, mi->is_hpc = is_hpc;
-	mi->B = (mm_idx_bucket_t*)calloc(1<<b, sizeof(mm_idx_bucket_t));
-	if (!(mm_dbg_flag & 1)) mi->km = km_init();
-	return mi;
-}
-
-void mm_idx_destroy(mm_idx_t *mi)
-{
-	int i;
-	if (mi == 0) return;
-	for (i = 0; i < 1<<mi->b; ++i) {
-		free(mi->B[i].p);
-		free(mi->B[i].a.a);
-		kh_destroy(idx, (idxhash_t*)mi->B[i].h);
-	}
-	if (!mi->km) {
-		for (i = 0; i < mi->n_seq; ++i)
-			free(mi->seq[i].name);
-		free(mi->seq);
-	} else km_destroy(mi->km);
-	free(mi->B); free(mi->S); free(mi);
-}
-
-const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n)
-{
-	int mask = (1<<mi->b) - 1;
-	khint_t k;
-	mm_idx_bucket_t *b = &mi->B[minier&mask];
-	idxhash_t *h = (idxhash_t*)b->h;
-	*n = 0;
-	if (h == 0) return 0;
-	k = kh_get(idx, h, minier>>mi->b<<1);
-	if (k == kh_end(h)) return 0;
-	if (kh_key(h, k)&1) { // special casing when there is only one k-mer
-		*n = 1;
-		return &kh_val(h, k);
-	} else {
-		*n = (uint32_t)kh_val(h, k);
-		return &b->p[kh_val(h, k)>>32];
-	}
-}
-
-void mm_idx_stat(const mm_idx_t *mi)
-{
-	int i, n = 0, n1 = 0;
-	uint64_t sum = 0, len = 0;
-	fprintf(stderr, "[M::%s] kmer size: %d; skip: %d; is_HPC: %d; #seq: %d\n", __func__, mi->k, mi->w, mi->is_hpc, mi->n_seq);
-	for (i = 0; i < mi->n_seq; ++i)
-		len += mi->seq[i].len;
-	for (i = 0; i < 1<<mi->b; ++i)
-		if (mi->B[i].h) n += kh_size((idxhash_t*)mi->B[i].h);
-	for (i = 0; i < 1<<mi->b; ++i) {
-		idxhash_t *h = (idxhash_t*)mi->B[i].h;
-		khint_t k;
-		if (h == 0) continue;
-		for (k = 0; k < kh_end(h); ++k)
-			if (kh_exist(h, k)) {
-				sum += kh_key(h, k)&1? 1 : (uint32_t)kh_val(h, k);
-				if (kh_key(h, k)&1) ++n1;
-			}
-	}
-	fprintf(stderr, "[M::%s::%.3f*%.2f] distinct minimizers: %d (%.2f%% are singletons); average occurrences: %.3lf; average spacing: %.3lf\n",
-			__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), n, 100.0*n1/n, (double)sum / n, (double)len / sum);
-}
-
-int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq)
-{
-	uint64_t i, st1, en1;
-	if (rid >= mi->n_seq || st >= mi->seq[rid].len) return -1;
-	if (en > mi->seq[rid].len) en = mi->seq[rid].len;
-	st1 = mi->seq[rid].offset + st;
-	en1 = mi->seq[rid].offset + en;
-	for (i = st1; i < en1; ++i)
-		seq[i - st1] = mm_seq4_get(mi->S, i);
-	return en - st;
-}
-
-uint32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f)
-{
-	int i;
-	size_t n = 0;
-	uint32_t thres;
-	khint_t *a, k;
-	if (f <= 0.) return UINT32_MAX;
-	for (i = 0; i < 1<<mi->b; ++i)
-		if (mi->B[i].h) n += kh_size((idxhash_t*)mi->B[i].h);
-	a = (uint32_t*)malloc(n * 4);
-	for (i = n = 0; i < 1<<mi->b; ++i) {
-		idxhash_t *h = (idxhash_t*)mi->B[i].h;
-		if (h == 0) continue;
-		for (k = 0; k < kh_end(h); ++k) {
-			if (!kh_exist(h, k)) continue;
-			a[n++] = kh_key(h, k)&1? 1 : (uint32_t)kh_val(h, k);
-		}
-	}
-	thres = ks_ksmall_uint32_t(n, a, (uint32_t)((1. - f) * n)) + 1;
-	free(a);
-	return thres;
-}
-
-/*********************************
- * Sort and generate hash tables *
- *********************************/
-
-static void worker_post(void *g, long i, int tid)
-{
-	int j, start_a, start_p, n, n_keys;
-	idxhash_t *h;
-	mm_idx_t *mi = (mm_idx_t*)g;
-	mm_idx_bucket_t *b = &mi->B[i];
-	if (b->a.n == 0) return;
-
-	// sort by minimizer
-	radix_sort_128x(b->a.a, b->a.a + b->a.n);
-
-	// count and preallocate
-	for (j = 1, n = 1, n_keys = 0, b->n = 0; j <= b->a.n; ++j) {
-		if (j == b->a.n || b->a.a[j].x>>8 != b->a.a[j-1].x>>8) {
-			++n_keys;
-			if (n > 1) b->n += n;
-			n = 1;
-		} else ++n;
-	}
-	h = kh_init(idx);
-	kh_resize(idx, h, n_keys);
-	b->p = (uint64_t*)calloc(b->n, 8);
-
-	// create the hash table
-	for (j = 1, n = 1, start_a = start_p = 0; j <= b->a.n; ++j) {
-		if (j == b->a.n || b->a.a[j].x>>8 != b->a.a[j-1].x>>8) {
-			khint_t itr;
-			int absent;
-			mm128_t *p = &b->a.a[j-1];
-			itr = kh_put(idx, h, p->x>>8>>mi->b<<1, &absent);
-			assert(absent && j - start_a == n);
-			if (n == 1) {
-				kh_key(h, itr) |= 1;
-				kh_val(h, itr) = p->y;
-			} else {
-				int k;
-				for (k = 0; k < n; ++k)
-					b->p[start_p + k] = b->a.a[start_a + k].y;
-				radix_sort_64(&b->p[start_p], &b->p[start_p + n]); // sort by position; needed as in-place radix_sort_128x() is not stable
-				kh_val(h, itr) = (uint64_t)start_p<<32 | n;
-				start_p += n;
-			}
-			start_a = j, n = 1;
-		} else ++n;
-	}
-	b->h = h;
-	assert(b->n == start_p);
-
-	// deallocate and clear b->a
-	free(b->a.a);
-	b->a.n = b->a.m = 0, b->a.a = 0;
-}
- 
-static void mm_idx_post(mm_idx_t *mi, int n_threads)
-{
-	kt_for(n_threads, worker_post, mi, 1<<mi->b);
-}
-
-/******************
- * Generate index *
- ******************/
-
-#include <string.h>
-#include <zlib.h>
-#include "bseq.h"
-
-typedef struct {
-	int mini_batch_size, keep_name;
-	uint64_t batch_size, sum_len;
-	mm_bseq_file_t *fp;
-	mm_idx_t *mi;
-} pipeline_t;
-
-typedef struct {
-    int n_seq;
-	mm_bseq1_t *seq;
-	mm128_v a;
-} step_t;
-
-static void mm_idx_add(mm_idx_t *mi, int n, const mm128_t *a)
-{
-	int i, mask = (1<<mi->b) - 1;
-	for (i = 0; i < n; ++i) {
-		mm128_v *p = &mi->B[a[i].x>>8&mask].a;
-		kv_push(mm128_t, 0, *p, a[i]);
-	}
-}
-
-static void *worker_pipeline(void *shared, int step, void *in)
-{
-	int i;
-    pipeline_t *p = (pipeline_t*)shared;
-    if (step == 0) { // step 0: read sequences
-        step_t *s;
-		if (p->sum_len > p->batch_size) return 0;
-        s = (step_t*)calloc(1, sizeof(step_t));
-		s->seq = mm_bseq_read(p->fp, p->mini_batch_size, 0, &s->n_seq); // read a mini-batch
-		if (s->seq) {
-			uint32_t old_m, m;
-			uint64_t sum_len, old_max_len, max_len;
-			assert((uint64_t)p->mi->n_seq + s->n_seq <= UINT32_MAX); // to prevent integer overflow
-			// make room for p->mi->seq
-			old_m = p->mi->n_seq, m = p->mi->n_seq + s->n_seq;
-			kroundup32(m); kroundup32(old_m);
-			if (old_m != m)
-				p->mi->seq = (mm_idx_seq_t*)krealloc(p->mi->km, p->mi->seq, m * sizeof(mm_idx_seq_t));
-			// make room for p->mi->S
-			for (i = 0, sum_len = 0; i < s->n_seq; ++i) sum_len += s->seq[i].l_seq;
-			old_max_len = (p->sum_len + 7) / 8;
-			max_len = (p->sum_len + sum_len + 7) / 8;
-			kroundup64(old_max_len); kroundup64(max_len);
-			if (old_max_len != max_len) {
-				p->mi->S = (uint32_t*)realloc(p->mi->S, max_len * 4);
-				memset(&p->mi->S[old_max_len], 0, 4 * (max_len - old_max_len));
-			}
-			// populate p->mi->seq
-			for (i = 0; i < s->n_seq; ++i) {
-				mm_idx_seq_t *seq = &p->mi->seq[p->mi->n_seq];
-				uint32_t j;
-				if (p->keep_name) {
-					assert(strlen(s->seq[i].name) <= 254); // a long query name breaks BAM
-					seq->name = (char*)kmalloc(p->mi->km, strlen(s->seq[i].name) + 1);
-					strcpy(seq->name, s->seq[i].name);
-				} else seq->name = 0;
-				seq->len = s->seq[i].l_seq;
-				seq->offset = p->sum_len;
-				// copy the sequence
-				for (j = 0; j < seq->len; ++j) { // TODO: this is not the fastest way, but let's first see if speed matters here
-					uint64_t o = p->sum_len + j;
-					int c = seq_nt4_table[(uint8_t)s->seq[i].seq[j]];
-					mm_seq4_set(p->mi->S, o, c);
-				}
-				// update p->sum_len and p->mi->n_seq
-				p->sum_len += seq->len;
-				s->seq[i].rid = p->mi->n_seq++;
-			}
-			return s;
-		} else free(s);
-    } else if (step == 1) { // step 1: compute sketch
-        step_t *s = (step_t*)in;
-		for (i = 0; i < s->n_seq; ++i) {
-			mm_bseq1_t *t = &s->seq[i];
-			mm_sketch(0, t->seq, t->l_seq, p->mi->w, p->mi->k, t->rid, p->mi->is_hpc, &s->a);
-			free(t->seq); free(t->name);
-		}
-		free(s->seq); s->seq = 0;
-		return s;
-    } else if (step == 2) { // dispatch sketch to buckets
-        step_t *s = (step_t*)in;
-		mm_idx_add(p->mi, s->a.n, s->a.a);
-		free(s->a.a); free(s);
-	}
-    return 0;
-}
-
-mm_idx_t *mm_idx_gen(mm_bseq_file_t *fp, int w, int k, int b, int is_hpc, int mini_batch_size, int n_threads, uint64_t batch_size, int keep_name)
-{
-	pipeline_t pl;
-	if (fp == 0 || mm_bseq_eof(fp)) return 0;
-	memset(&pl, 0, sizeof(pipeline_t));
-	pl.mini_batch_size = mini_batch_size < batch_size? mini_batch_size : batch_size;
-	pl.keep_name = keep_name;
-	pl.batch_size = batch_size;
-	pl.fp = fp;
-	pl.mi = mm_idx_init(w, k, b, is_hpc);
-
-	kt_pipeline(n_threads < 3? n_threads : 3, worker_pipeline, &pl, 3);
-	if (mm_verbose >= 3)
-		fprintf(stderr, "[M::%s::%.3f*%.2f] collected minimizers\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0));
-
-	mm_idx_post(pl.mi, n_threads);
-	if (mm_verbose >= 3)
-		fprintf(stderr, "[M::%s::%.3f*%.2f] sorted minimizers\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0));
-
-	return pl.mi;
-}
-
-mm_idx_t *mm_idx_build(const char *fn, int w, int k, int is_hpc, int n_threads) // a simpler interface
-{
-	mm_bseq_file_t *fp;
-	mm_idx_t *mi;
-	fp = mm_bseq_open(fn);
-	if (fp == 0) return 0;
-	mi = mm_idx_gen(fp, w, k, MM_IDX_DEF_B, is_hpc, 1<<18, n_threads, UINT64_MAX, 1);
-	mm_bseq_close(fp);
-	return mi;
-}
-
-/*************
- * index I/O *
- *************/
-
-void mm_idx_dump(FILE *fp, const mm_idx_t *mi)
-{
-	uint64_t sum_len = 0;
-	uint32_t x[5];
-	int i;
-
-	x[0] = mi->w, x[1] = mi->k, x[2] = mi->b, x[3] = mi->n_seq, x[4] = mi->is_hpc;
-	fwrite(MM_IDX_MAGIC, 1, 4, fp);
-	fwrite(x, 4, 5, fp);
-	for (i = 0; i < mi->n_seq; ++i) {
-		uint8_t l;
-		l = strlen(mi->seq[i].name);
-		fwrite(&l, 1, 1, fp);
-		fwrite(mi->seq[i].name, 1, l, fp);
-		fwrite(&mi->seq[i].len, 4, 1, fp);
-		sum_len += mi->seq[i].len;
-	}
-	for (i = 0; i < 1<<mi->b; ++i) {
-		mm_idx_bucket_t *b = &mi->B[i];
-		khint_t k;
-		idxhash_t *h = (idxhash_t*)b->h;
-		uint32_t size = h? h->size : 0;
-		fwrite(&b->n, 4, 1, fp);
-		fwrite(b->p, 8, b->n, fp);
-		fwrite(&size, 4, 1, fp);
-		if (size == 0) continue;
-		for (k = 0; k < kh_end(h); ++k) {
-			uint64_t x[2];
-			if (!kh_exist(h, k)) continue;
-			x[0] = kh_key(h, k), x[1] = kh_val(h, k);
-			fwrite(x, 8, 2, fp);
-		}
-	}
-	fwrite(mi->S, 4, (sum_len + 7) / 8, fp);
-	fflush(fp);
-}
-
-mm_idx_t *mm_idx_load(FILE *fp)
-{
-	int i;
-	char magic[4];
-	uint32_t x[5];
-	uint64_t sum_len = 0;
-	mm_idx_t *mi;
-
-	if (fread(magic, 1, 4, fp) != 4) return 0;
-	if (strncmp(magic, MM_IDX_MAGIC, 4) != 0) return 0;
-	if (fread(x, 4, 5, fp) != 5) return 0;
-	mi = mm_idx_init(x[0], x[1], x[2], x[4]);
-	mi->n_seq = x[3];
-	mi->seq = (mm_idx_seq_t*)kcalloc(mi->km, mi->n_seq, sizeof(mm_idx_seq_t));
-	for (i = 0; i < mi->n_seq; ++i) {
-		uint8_t l;
-		mm_idx_seq_t *s = &mi->seq[i];
-		fread(&l, 1, 1, fp);
-		s->name = (char*)kmalloc(mi->km, l + 1);
-		fread(s->name, 1, l, fp);
-		s->name[l] = 0;
-		fread(&s->len, 4, 1, fp);
-		s->offset = sum_len;
-		sum_len += s->len;
-	}
-	for (i = 0; i < 1<<mi->b; ++i) {
-		mm_idx_bucket_t *b = &mi->B[i];
-		uint32_t j, size;
-		khint_t k;
-		idxhash_t *h;
-		fread(&b->n, 4, 1, fp);
-		b->p = (uint64_t*)malloc(b->n * 8);
-		fread(b->p, 8, b->n, fp);
-		fread(&size, 4, 1, fp);
-		if (size == 0) continue;
-		b->h = h = kh_init(idx);
-		kh_resize(idx, h, size);
-		for (j = 0; j < size; ++j) {
-			uint64_t x[2];
-			int absent;
-			fread(x, 8, 2, fp);
-			k = kh_put(idx, h, x[0], &absent);
-			assert(absent);
-			kh_val(h, k) = x[1];
-		}
-	}
-	mi->S = (uint32_t*)malloc((sum_len + 7) / 8 * 4);
-	fread(mi->S, 4, (sum_len + 7) / 8, fp);
-	return mi;
-}
-
-int mm_idx_is_idx(const char *fn)
-{
-	int fd, is_idx = 0;
-	off_t ret;
-	char magic[4];
-
-	if (strcmp(fn, "-") == 0) return 0; // read from pipe; not an index
-	fd = open(fn, O_RDONLY);
-	if (fd < 0) return -1; // error
-	if ((ret = lseek(fd, 0, SEEK_END)) >= 4) {
-		lseek(fd, 0, SEEK_SET);
-		ret = read(fd, magic, 4);
-		if (ret == 4 && strncmp(magic, MM_IDX_MAGIC, 4) == 0)
-			is_idx = 1;
-	}
-	close(fd);
-	return is_idx;
-}

index.md

@@ -0,0 +1,23 @@
+## Getting help
+
+* [README][doc]: general documentation
+* [Manpage](minimap2.html): explanation of command-line options
+* [Peer-reviewed paper][doi]: algorithms and evaluations (please cite if you use minimap2)
+* [Preprint][arxiv]: similar to the paper but free of charge
+* [GitHub Issues page][issue]: report bugs, request features and ask questions
+
+## Acquiring minimap2
+
+* `git clone https://github.com/lh3/minimap2.git`
+* [GitHub Release page][release]: versioned packages and precompiled binaries
+* Also [available from BioConda][bioconda]
+* Python binding [via PyPI][pypi] or [via BioConda][mappy-bc]
+
+[doc]: https://github.com/lh3/minimap2/blob/master/README.md
+[arxiv]: https://arxiv.org/abs/1708.01492
+[pypi]: https://pypi.python.org/pypi/mappy
+[mappy-bc]: https://anaconda.org/bioconda/mappy
+[bioconda]: https://anaconda.org/bioconda/minimap2
+[release]: https://github.com/lh3/minimap2/releases
+[issue]: https://github.com/lh3/minimap2/issues
+[doi]: https://doi.org/10.1093/bioinformatics/bty191

kalloc.c

@@ -1,214 +0,0 @@
-#include <stdio.h>
-#include <stdlib.h>
-#include <string.h>
-#include <limits.h>
-#include "kalloc.h"
-
-/* The whole thing is: ("@" for the kheader_t of the block, "-" for free
- * memory, and "+" for allocated memory. One char for one unit.)
- *                        
- *           This region is core 1.                             This region is core 2.
- *
- *   @-------@++++++@++++++++++++@------------           @----------@++++++++++++@+++++++@------------
- *   |                           |                       |                               |
- *   p=p->ptr->ptr->ptr->ptr     p->ptr             p->ptr->ptr                p->ptr->ptr->ptr
- */
-
-#define PTR(p) ((size_t*)((size_t*)p)[1])
-
-typedef struct _allocated_t {
-	struct _allocated_t *next;
-	size_t *ptr;
-} allocated_t;
-
-typedef struct {
-	size_t base[2], *loop_head;
-	allocated_t list_head, *list_tail;
-	size_t total_allocated;
-} kmem_t;
-
-void *km_init()
-{
-	return calloc(1, sizeof(kmem_t));
-}
-
-static void kerror(const char *s)
-{
-	fprintf(stderr, "%s\n", s);
-	exit(1);
-}
-
-static size_t *morecore(kmem_t *km, size_t nu)
-{
-	size_t rnu, *up;
-
-	rnu = (nu + 0xfffff) & (~(size_t)0xfffff);
-	up = (size_t*)malloc(rnu * sizeof(size_t));
-	if (!up) { /* fail to allocate memory */
-		km_stat(km);
-		fprintf(stderr, "[morecore] %lu bytes requested but not available.\n", (unsigned long)rnu * sizeof(size_t));
-		exit(1);
-	}
-	/* put the pointer in km->list_head */
-	if (km->list_tail == 0) km->list_tail = &km->list_head;
-	km->list_tail->ptr = up;
-	km->list_tail->next = (allocated_t*)calloc(1, sizeof(allocated_t));
-	km->list_tail = km->list_tail->next;
-
-	km->total_allocated += rnu * sizeof(size_t);
-	*up = rnu; /* the size of the current block, and in this case the block is the same as the new core */
-	kfree(km, up + 1); /* initialize the new "core" */
-	return km->loop_head;
-}
-
-void km_destroy(void *_km)
-{
-	kmem_t *km = (kmem_t*)_km;
-	allocated_t *p, *q;
-	if (km == 0) return;
-	p = &km->list_head;
-	do {
-		q = p->next;
-		free(p->ptr);
-		if (p != &km->list_head) free(p);
-		p = q;
-	} while (p && p->next);
-	if (p != &km->list_head) free(p);
-	free(km);
-}
-
-void kfree(void *_km, void *ap)
-{
-	size_t *p, *q;
-	kmem_t *km = (kmem_t*)_km;
-	
-	if (!ap) return;
-	if (km == 0) {
-		free(ap);
-		return;
-	}
-	p = (size_t*)ap - 1; /* *p is the size of the current block */
-	/* Find the pointer that points to the block to be freed. The following loop can stop on two conditions:
-	 *
-	 * a) "p>q && p<q->ptr": @------@++++++++@+++++++@-------    @---------------@+++++++@-------
-	 *    (can also be in    |      |                |        -> |                       |
-	 *     two cores)        q      p           q->ptr           q                  q->ptr
-	 *
-	 *                       @--------    @+++++++++@--------    @--------    @------------------
-	 *                       |            |         |         -> |            |
-	 *                       q            p    q->ptr            q       q->ptr
-	 *
-	 * b) "q>=q->ptr && (p>q || p<q->ptr)":  @-------@+++++   @--------@+++++++     @-------@+++++   @----------------
-	 *                                       |                |        |         -> |                |
-	 *                                  q->ptr                q        p       q->ptr                q
-	 *
-	 *                                       @+++++++@-----   @++++++++@-------     @-------------   @++++++++@-------
-	 *                                       |       |                 |         -> |                         |
-	 *                                       p  q->ptr                 q       q->ptr                         q
-	 */
-	for (q = km->loop_head; !(p > q && p < PTR(q)); q = PTR(q))
-		if (q >= PTR(q) && (p > q || p < PTR(q))) break;
-	if (p + (*p) == PTR(q)) { /* two adjacent blocks, merge p and q->ptr (the 2nd and 4th cases) */
-		*p += *PTR(q); /* this is the new q->ptr size */
-		p[1] = (size_t)PTR(PTR(q)); /* this is the new q->ptr->ptr */
-		/* p is actually the new q->ptr. The actual change happens a few lines below. */
-	} else if (p + (*p) > PTR(q) && PTR(q) >= p) { /* the end of the allocated block is in the next free block */
-		kerror("[kfree] The end of the allocated block enters a free block.");
-	} else p[1] = (size_t)PTR(q); /* backup q->ptr */
-
-	if (q + (*q) == p) { /* two adjacent blocks, merge q and p (the other two cases) */
-		*q += *p;
-		q[1] = (size_t)PTR(p);
-		km->loop_head = q;
-	} else if (q + (*q) > p && p >= q) { /* the end of a free block in the allocated block */
-		kerror("[kfree] The end of a free block enters the allocated block.");
-	} else km->loop_head = p, q[1] = (size_t)p; /* in two cores, cannot be merged */
-}
-
-void *krealloc(void *_km, void *ap, size_t n_bytes)
-{
-	kmem_t *km = (kmem_t*)_km;
-	size_t n_units, *p, *q;
-
-	if (n_bytes == 0) {
-		kfree(km, ap); return 0;
-	}
-	if (km == 0) return realloc(ap, n_bytes);
-	if (!ap) return kmalloc(km, n_bytes);
-	n_units = 1 + (n_bytes + sizeof(size_t) - 1) / sizeof(size_t);
-	p = (size_t*)ap - 1;
-	if (*p >= n_units) return ap; /* TODO: this prevents shrinking */
-	q = (size_t*)kmalloc(km, n_bytes);
-	memcpy(q, ap, (*p - 1) * sizeof(size_t));
-	kfree(km, ap);
-	return q;
-}
-
-void *kmalloc(void *_km, size_t n_bytes)
-{
-	kmem_t *km = (kmem_t*)_km;
-	size_t n_units, *p, *q;
-
-	if (n_bytes == 0) return 0;
-	if (km == 0) return malloc(n_bytes);
-	/* "n_units" means the number of units. The size of one unit equals to sizeof(kheader_t).
-	 * "1" is the kheader_t of a block, which is always required. */
-	n_units = 1 + (n_bytes + sizeof(size_t) - 1) / sizeof(size_t);
-	if (n_units&1) ++n_units; /* make n_units an even number, or it will segfault if only one unit remains */
-
-	if (!(q = km->loop_head)) { /* the first time when kmalloc() is called, intialization */
-		km->base[1] = (size_t)(km->loop_head = q = km->base); *q = 0;
-	}
-	for (p = PTR(q);; q = p, p = PTR(p)) { /* search for a suitable block */
-		if (*p >= n_units) { /* p->size if the size of current block. This line means the current block is large enough. */
-			if (*p == n_units) q[1] = (size_t)PTR(p); /* no need to split the block */
-			else { /* split the block */
-				/* memory is allocated at the end of the block */
-				*p -= n_units; /* reduce the size of the free block */
-				p += *p; /* skip to the kheader_t of the allocated block */
-				*p = n_units; /* set the size */
-			}
-			km->loop_head = q; /* set the end of chain */
-			return p + 1; /* skip the kheader_t */
-		}
-		if (p == km->loop_head) { /* then ask for more "cores" */
-			if ((p = morecore(km, n_units)) == 0) return 0;
-		}
-	}
-}
-
-void *kcalloc(void *_km, size_t count, size_t size)
-{
-	kmem_t *km = (kmem_t*)_km;
-	void *p;
-	if (size == 0 || count == 0) return 0;
-	if (km == 0) return calloc(count, size);
-	p = kmalloc(km, count * size);
-	memset(p, 0, count * size);
-	return p;
-}
-
-void km_stat(const void *_km)
-{
-	kmem_t *km = (kmem_t*)_km;
-	unsigned n_blocks, n_units;
-	size_t max_block = 0, *p, *q;
-	float frag;
-
-	if (km == 0 || !(p = km->loop_head)) return;
-	n_blocks = n_units = 0;
-	do {
-		q = PTR(p);
-		if (*p > max_block) max_block = *p;
-		n_units += *p;
-		if (p + (*p) > q && q > p)
-			kerror("[kr_stat] The end of a free block enters another free block.");
-		p = q;
-		++n_blocks;
-	} while (p != km->loop_head);
-	
-	--n_blocks;
-	frag = 1.0/1024.0 * n_units * sizeof(size_t) / n_blocks;
-	fprintf(stderr, "[kr_stat] tot=%lu, free=%lu, n_block=%u, max_block=%lu, frag_len=%.3fK\n",
-			(unsigned long)km->total_allocated, (unsigned long)n_units * sizeof(size_t), n_blocks, (unsigned long)max_block * sizeof(size_t), frag);
-}

kalloc.h

@@ -1,26 +0,0 @@
-#ifndef _KALLOC_H_
-#define _KALLOC_H_
-
-#include <stdlib.h>
-
-#define km_size(x) (*(((size_t*)(x))-1) * sizeof(size_t))
-
-#ifdef __cplusplus
-extern "C" {
-#endif
-
-void *kmalloc(void *km, size_t size);
-void *krealloc(void *km, void *ptr, size_t size);
-void *kcalloc(void *km, size_t count, size_t size);
-void kfree(void *km, void *ptr);
-
-void *km_init(void);
-void km_destroy(void *km);
-
-void km_stat(const void *km); // TODO: return numbers instead of print to stderr
-
-#ifdef __cplusplus
-}
-#endif
-
-#endif

kdq.h

@@ -1,132 +0,0 @@
-#ifndef __AC_KDQ_H
-#define __AC_KDQ_H
-
-#include <stdlib.h>
-#include <string.h>
-#include <stdint.h>
-#include "kalloc.h"
-
-#define __KDQ_TYPE(type) \
-	typedef struct { \
-		uint64_t front:58, bits:6, count, mask; \
-		type *a; \
-		void *km; \
-	} kdq_##type##_t;
-
-#define kdq_t(type) kdq_##type##_t
-#define kdq_size(q) ((q)->count)
-#define kdq_first(q) ((q)->a[(q)->front])
-#define kdq_last(q) ((q)->a[((q)->front + (q)->count - 1) & (q)->mask])
-#define kdq_at(q, i) ((q)->a[((q)->front + (i)) & (q)->mask])
-
-#define __KDQ_IMPL(type, SCOPE) \
-	SCOPE kdq_##type##_t *kdq_init_##type(void *km) \
-	{ \
-		kdq_##type##_t *q; \
-		q = (kdq_##type##_t*)kcalloc(km, 1, sizeof(kdq_##type##_t)); \
-		q->bits = 2, q->mask = (1ULL<<q->bits) - 1; \
-		q->a = (type*)kmalloc(km, (1<<q->bits) * sizeof(type)); \
-		q->km = km; \
-		return q; \
-	} \
-	SCOPE void kdq_destroy_##type(kdq_##type##_t *q) \
-	{ \
-		if (q == 0) return; \
-		kfree(q->km, q->a); kfree(q->km, q); \
-	} \
-	SCOPE int kdq_resize_##type(kdq_##type##_t *q, int new_bits) \
-	{ \
-		size_t new_size = 1ULL<<new_bits, old_size = 1ULL<<q->bits; \
-		if (new_size < q->count) { /* not big enough */ \
-			int i; \
-			for (i = 0; i < 64; ++i) \
-				if (1ULL<<i > q->count) break; \
-			new_bits = i, new_size = 1ULL<<new_bits; \
-		} \
-		if (new_bits == q->bits) return q->bits; /* unchanged */ \
-		if (new_bits > q->bits) q->a = (type*)krealloc(q->km, q->a, (1ULL<<new_bits) * sizeof(type)); \
-		if (q->front + q->count <= old_size) { /* unwrapped */ \
-			if (q->front + q->count > new_size) /* only happens for shrinking */ \
-				memmove(q->a, q->a + new_size, (q->front + q->count - new_size) * sizeof(type)); \
-		} else { /* wrapped */ \
-			memmove(q->a + (new_size - (old_size - q->front)), q->a + q->front, (old_size - q->front) * sizeof(type)); \
-			q->front = new_size - (old_size - q->front); \
-		} \
-		q->bits = new_bits, q->mask = (1ULL<<q->bits) - 1; \
-		if (new_bits < q->bits) q->a = (type*)krealloc(q->km, q->a, (1ULL<<new_bits) * sizeof(type)); \
-		return q->bits; \
-	} \
-	SCOPE type *kdq_pushp_##type(kdq_##type##_t *q) \
-	{ \
-		if (q->count == 1ULL<<q->bits) kdq_resize_##type(q, q->bits + 1); \
-		return &q->a[((q->count++) + q->front) & (q)->mask]; \
-	} \
-	SCOPE void kdq_push_##type(kdq_##type##_t *q, type v) \
-	{ \
-		if (q->count == 1ULL<<q->bits) kdq_resize_##type(q, q->bits + 1); \
-		q->a[((q->count++) + q->front) & (q)->mask] = v; \
-	} \
-	SCOPE type *kdq_unshiftp_##type(kdq_##type##_t *q) \
-	{ \
-		if (q->count == 1ULL<<q->bits) kdq_resize_##type(q, q->bits + 1); \
-		++q->count; \
-		q->front = q->front? q->front - 1 : (1ULL<<q->bits) - 1; \
-		return &q->a[q->front]; \
-	} \
-	SCOPE void kdq_unshift_##type(kdq_##type##_t *q, type v) \
-	{ \
-		type *p; \
-		p = kdq_unshiftp_##type(q); \
-		*p = v; \
-	} \
-	SCOPE type *kdq_pop_##type(kdq_##type##_t *q) \
-	{ \
-		return q->count? &q->a[((--q->count) + q->front) & q->mask] : 0; \
-	} \
-	SCOPE type *kdq_shift_##type(kdq_##type##_t *q) \
-	{ \
-		type *d = 0; \
-		if (q->count == 0) return 0; \
-		d = &q->a[q->front++]; \
-		q->front &= q->mask; \
-		--q->count; \
-		return d; \
-	}
-
-#define KDQ_INIT2(type, SCOPE) \
-	__KDQ_TYPE(type) \
-	__KDQ_IMPL(type, SCOPE)
-
-#ifndef klib_unused
-#if (defined __clang__ && __clang_major__ >= 3) || (defined __GNUC__ && __GNUC__ >= 3)
-#define klib_unused __attribute__ ((__unused__))
-#else
-#define klib_unused
-#endif
-#endif /* klib_unused */
-
-#define KDQ_INIT(type) KDQ_INIT2(type, static inline klib_unused)
-
-#define KDQ_DECLARE(type) \
-	__KDQ_TYPE(type) \
-	kdq_##type##_t *kdq_init_##type(); \
-	void kdq_destroy_##type(kdq_##type##_t *q); \
-	int kdq_resize_##type(kdq_##type##_t *q, int new_bits); \
-	type *kdq_pushp_##type(kdq_##type##_t *q); \
-	void kdq_push_##type(kdq_##type##_t *q, type v); \
-	type *kdq_unshiftp_##type(kdq_##type##_t *q); \
-	void kdq_unshift_##type(kdq_##type##_t *q, type v); \
-	type *kdq_pop_##type(kdq_##type##_t *q); \
-	type *kdq_shift_##type(kdq_##type##_t *q);
-
-#define kdq_init(type, km) kdq_init_##type(km)
-#define kdq_destroy(type, q) kdq_destroy_##type(q)
-#define kdq_resize(type, q, new_bits) kdq_resize_##type(q, new_bits)
-#define kdq_pushp(type, q) kdq_pushp_##type(q)
-#define kdq_push(type, q, v) kdq_push_##type(q, v)
-#define kdq_pop(type, q) kdq_pop_##type(q)
-#define kdq_unshiftp(type, q) kdq_unshiftp_##type(q)
-#define kdq_unshift(type, q, v) kdq_unshift_##type(q, v)
-#define kdq_shift(type, q) kdq_shift_##type(q)
-
-#endif

khash.h

@@ -1,615 +0,0 @@
-/* The MIT License
-
-   Copyright (c) 2008, 2009, 2011 by Attractive Chaos <attractor@live.co.uk>
-
-   Permission is hereby granted, free of charge, to any person obtaining
-   a copy of this software and associated documentation files (the
-   "Software"), to deal in the Software without restriction, including
-   without limitation the rights to use, copy, modify, merge, publish,
-   distribute, sublicense, and/or sell copies of the Software, and to
-   permit persons to whom the Software is furnished to do so, subject to
-   the following conditions:
-
-   The above copyright notice and this permission notice shall be
-   included in all copies or substantial portions of the Software.
-
-   THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
-   EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
-   MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
-   NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS
-   BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN
-   ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN
-   CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
-   SOFTWARE.
-*/
-
-/*
-  An example:
-
-#include "khash.h"
-KHASH_MAP_INIT_INT(32, char)
-int main() {
-	int ret, is_missing;
-	khiter_t k;
-	khash_t(32) *h = kh_init(32);
-	k = kh_put(32, h, 5, &ret);
-	kh_value(h, k) = 10;
-	k = kh_get(32, h, 10);
-	is_missing = (k == kh_end(h));
-	k = kh_get(32, h, 5);
-	kh_del(32, h, k);
-	for (k = kh_begin(h); k != kh_end(h); ++k)
-		if (kh_exist(h, k)) kh_value(h, k) = 1;
-	kh_destroy(32, h);
-	return 0;
-}
-*/
-
-/*
-  2013-05-02 (0.2.8):
-
-	* Use quadratic probing. When the capacity is power of 2, stepping function
-	  i*(i+1)/2 guarantees to traverse each bucket. It is better than double
-	  hashing on cache performance and is more robust than linear probing.
-
-	  In theory, double hashing should be more robust than quadratic probing.
-	  However, my implementation is probably not for large hash tables, because
-	  the second hash function is closely tied to the first hash function,
-	  which reduce the effectiveness of double hashing.
-
-	Reference: http://research.cs.vt.edu/AVresearch/hashing/quadratic.php
-
-  2011-12-29 (0.2.7):
-
-    * Minor code clean up; no actual effect.
-
-  2011-09-16 (0.2.6):
-
-	* The capacity is a power of 2. This seems to dramatically improve the
-	  speed for simple keys. Thank Zilong Tan for the suggestion. Reference:
-
-	   - http://code.google.com/p/ulib/
-	   - http://nothings.org/computer/judy/
-
-	* Allow to optionally use linear probing which usually has better
-	  performance for random input. Double hashing is still the default as it
-	  is more robust to certain non-random input.
-
-	* Added Wang's integer hash function (not used by default). This hash
-	  function is more robust to certain non-random input.
-
-  2011-02-14 (0.2.5):
-
-    * Allow to declare global functions.
-
-  2009-09-26 (0.2.4):
-
-    * Improve portability
-
-  2008-09-19 (0.2.3):
-
-	* Corrected the example
-	* Improved interfaces
-
-  2008-09-11 (0.2.2):
-
-	* Improved speed a little in kh_put()
-
-  2008-09-10 (0.2.1):
-
-	* Added kh_clear()
-	* Fixed a compiling error
-
-  2008-09-02 (0.2.0):
-
-	* Changed to token concatenation which increases flexibility.
-
-  2008-08-31 (0.1.2):
-
-	* Fixed a bug in kh_get(), which has not been tested previously.
-
-  2008-08-31 (0.1.1):
-
-	* Added destructor
-*/
-
-
-#ifndef __AC_KHASH_H
-#define __AC_KHASH_H
-
-/*!
-  @header
-
-  Generic hash table library.
- */
-
-#define AC_VERSION_KHASH_H "0.2.8"
-
-#include <stdlib.h>
-#include <string.h>
-#include <limits.h>
-#include "kalloc.h"
-
-/* compiler specific configuration */
-
-#if UINT_MAX == 0xffffffffu
-typedef unsigned int khint32_t;
-#elif ULONG_MAX == 0xffffffffu
-typedef unsigned long khint32_t;
-#endif
-
-#if ULONG_MAX == ULLONG_MAX
-typedef unsigned long khint64_t;
-#else
-typedef unsigned long long khint64_t;
-#endif
-
-#ifndef kh_inline
-#ifdef _MSC_VER
-#define kh_inline __inline
-#else
-#define kh_inline inline
-#endif
-#endif /* kh_inline */
-
-#ifndef klib_unused
-#if (defined __clang__ && __clang_major__ >= 3) || (defined __GNUC__ && __GNUC__ >= 3)
-#define klib_unused __attribute__ ((__unused__))
-#else
-#define klib_unused
-#endif
-#endif /* klib_unused */
-
-typedef khint32_t khint_t;
-typedef khint_t khiter_t;
-
-#define __ac_isempty(flag, i) ((flag[i>>4]>>((i&0xfU)<<1))&2)
-#define __ac_isdel(flag, i) ((flag[i>>4]>>((i&0xfU)<<1))&1)
-#define __ac_iseither(flag, i) ((flag[i>>4]>>((i&0xfU)<<1))&3)
-#define __ac_set_isdel_false(flag, i) (flag[i>>4]&=~(1ul<<((i&0xfU)<<1)))
-#define __ac_set_isempty_false(flag, i) (flag[i>>4]&=~(2ul<<((i&0xfU)<<1)))
-#define __ac_set_isboth_false(flag, i) (flag[i>>4]&=~(3ul<<((i&0xfU)<<1)))
-#define __ac_set_isdel_true(flag, i) (flag[i>>4]|=1ul<<((i&0xfU)<<1))
-
-#define __ac_fsize(m) ((m) < 16? 1 : (m)>>4)
-
-#ifndef kroundup32
-#define kroundup32(x) (--(x), (x)|=(x)>>1, (x)|=(x)>>2, (x)|=(x)>>4, (x)|=(x)>>8, (x)|=(x)>>16, ++(x))
-#endif
-
-static const double __ac_HASH_UPPER = 0.77;
-
-#define __KHASH_TYPE(name, khkey_t, khval_t) \
-	typedef struct kh_##name##_s { \
-		khint_t n_buckets, size, n_occupied, upper_bound; \
-		khint32_t *flags; \
-		khkey_t *keys; \
-		khval_t *vals; \
-	} kh_##name##_t;
-
-#define __KHASH_PROTOTYPES(name, khkey_t, khval_t)	 					\
-	extern kh_##name##_t *kh_init_##name(void);							\
-	extern void kh_destroy_##name(kh_##name##_t *h);					\
-	extern void kh_clear_##name(kh_##name##_t *h);						\
-	extern khint_t kh_get_##name(const kh_##name##_t *h, khkey_t key); 	\
-	extern int kh_resize_##name(kh_##name##_t *h, khint_t new_n_buckets); \
-	extern khint_t kh_put_##name(kh_##name##_t *h, khkey_t key, int *ret); \
-	extern void kh_del_##name(kh_##name##_t *h, khint_t x);
-
-#define __KHASH_IMPL(name, SCOPE, khkey_t, khval_t, kh_is_map, __hash_func, __hash_equal) \
-	SCOPE kh_##name##_t *kh_init_##name(void) {							\
-		return (kh_##name##_t*)kcalloc(0, 1, sizeof(kh_##name##_t));	\
-	}																	\
-	SCOPE void kh_destroy_##name(kh_##name##_t *h)						\
-	{																	\
-		if (h) {														\
-			kfree(0, (void *)h->keys); kfree(0, h->flags);				\
-			kfree(0, (void *)h->vals);									\
-			kfree(0, h);												\
-		}																\
-	}																	\
-	SCOPE void kh_clear_##name(kh_##name##_t *h)						\
-	{																	\
-		if (h && h->flags) {											\
-			memset(h->flags, 0xaa, __ac_fsize(h->n_buckets) * sizeof(khint32_t)); \
-			h->size = h->n_occupied = 0;								\
-		}																\
-	}																	\
-	SCOPE khint_t kh_get_##name(const kh_##name##_t *h, khkey_t key) 	\
-	{																	\
-		if (h->n_buckets) {												\
-			khint_t k, i, last, mask, step = 0; \
-			mask = h->n_buckets - 1;									\
-			k = __hash_func(key); i = k & mask;							\
-			last = i; \
-			while (!__ac_isempty(h->flags, i) && (__ac_isdel(h->flags, i) || !__hash_equal(h->keys[i], key))) { \
-				i = (i + (++step)) & mask; \
-				if (i == last) return h->n_buckets;						\
-			}															\
-			return __ac_iseither(h->flags, i)? h->n_buckets : i;		\
-		} else return 0;												\
-	}																	\
-	SCOPE int kh_resize_##name(kh_##name##_t *h, khint_t new_n_buckets) \
-	{ /* This function uses 0.25*n_buckets bytes of working space instead of [sizeof(key_t+val_t)+.25]*n_buckets. */ \
-		khint32_t *new_flags = 0;										\
-		khint_t j = 1;													\
-		{																\
-			kroundup32(new_n_buckets); 									\
-			if (new_n_buckets < 4) new_n_buckets = 4;					\
-			if (h->size >= (khint_t)(new_n_buckets * __ac_HASH_UPPER + 0.5)) j = 0;	/* requested size is too small */ \
-			else { /* hash table size to be changed (shrink or expand); rehash */ \
-				new_flags = (khint32_t*)kmalloc(0, __ac_fsize(new_n_buckets) * sizeof(khint32_t));	\
-				if (!new_flags) return -1;								\
-				memset(new_flags, 0xaa, __ac_fsize(new_n_buckets) * sizeof(khint32_t)); \
-				if (h->n_buckets < new_n_buckets) {	/* expand */		\
-					khkey_t *new_keys = (khkey_t*)krealloc(0, (void *)h->keys, new_n_buckets * sizeof(khkey_t)); \
-					if (!new_keys) { kfree(0, new_flags); return -1; }	\
-					h->keys = new_keys;									\
-					if (kh_is_map) {									\
-						khval_t *new_vals = (khval_t*)krealloc(0, (void *)h->vals, new_n_buckets * sizeof(khval_t)); \
-						if (!new_vals) { kfree(0, new_flags); return -1; } \
-						h->vals = new_vals;								\
-					}													\
-				} /* otherwise shrink */								\
-			}															\
-		}																\
-		if (j) { /* rehashing is needed */								\
-			for (j = 0; j != h->n_buckets; ++j) {						\
-				if (__ac_iseither(h->flags, j) == 0) {					\
-					khkey_t key = h->keys[j];							\
-					khval_t val;										\
-					khint_t new_mask;									\
-					new_mask = new_n_buckets - 1; 						\
-					if (kh_is_map) val = h->vals[j];					\
-					__ac_set_isdel_true(h->flags, j);					\
-					while (1) { /* kick-out process; sort of like in Cuckoo hashing */ \
-						khint_t k, i, step = 0; \
-						k = __hash_func(key);							\
-						i = k & new_mask;								\
-						while (!__ac_isempty(new_flags, i)) i = (i + (++step)) & new_mask; \
-						__ac_set_isempty_false(new_flags, i);			\
-						if (i < h->n_buckets && __ac_iseither(h->flags, i) == 0) { /* kick out the existing element */ \
-							{ khkey_t tmp = h->keys[i]; h->keys[i] = key; key = tmp; } \
-							if (kh_is_map) { khval_t tmp = h->vals[i]; h->vals[i] = val; val = tmp; } \
-							__ac_set_isdel_true(h->flags, i); /* mark it as deleted in the old hash table */ \
-						} else { /* write the element and jump out of the loop */ \
-							h->keys[i] = key;							\
-							if (kh_is_map) h->vals[i] = val;			\
-							break;										\
-						}												\
-					}													\
-				}														\
-			}															\
-			if (h->n_buckets > new_n_buckets) { /* shrink the hash table */ \
-				h->keys = (khkey_t*)krealloc(0, (void *)h->keys, new_n_buckets * sizeof(khkey_t)); \
-				if (kh_is_map) h->vals = (khval_t*)krealloc(0, (void *)h->vals, new_n_buckets * sizeof(khval_t)); \
-			}															\
-			kfree(0, h->flags); /* free the working space */			\
-			h->flags = new_flags;										\
-			h->n_buckets = new_n_buckets;								\
-			h->n_occupied = h->size;									\
-			h->upper_bound = (khint_t)(h->n_buckets * __ac_HASH_UPPER + 0.5); \
-		}																\
-		return 0;														\
-	}																	\
-	SCOPE khint_t kh_put_##name(kh_##name##_t *h, khkey_t key, int *ret) \
-	{																	\
-		khint_t x;														\
-		if (h->n_occupied >= h->upper_bound) { /* update the hash table */ \
-			if (h->n_buckets > (h->size<<1)) {							\
-				if (kh_resize_##name(h, h->n_buckets - 1) < 0) { /* clear "deleted" elements */ \
-					*ret = -1; return h->n_buckets;						\
-				}														\
-			} else if (kh_resize_##name(h, h->n_buckets + 1) < 0) { /* expand the hash table */ \
-				*ret = -1; return h->n_buckets;							\
-			}															\
-		} /* TODO: to implement automatically shrinking; resize() already support shrinking */ \
-		{																\
-			khint_t k, i, site, last, mask = h->n_buckets - 1, step = 0; \
-			x = site = h->n_buckets; k = __hash_func(key); i = k & mask; \
-			if (__ac_isempty(h->flags, i)) x = i; /* for speed up */	\
-			else {														\
-				last = i; \
-				while (!__ac_isempty(h->flags, i) && (__ac_isdel(h->flags, i) || !__hash_equal(h->keys[i], key))) { \
-					if (__ac_isdel(h->flags, i)) site = i;				\
-					i = (i + (++step)) & mask; \
-					if (i == last) { x = site; break; }					\
-				}														\
-				if (x == h->n_buckets) {								\
-					if (__ac_isempty(h->flags, i) && site != h->n_buckets) x = site; \
-					else x = i;											\
-				}														\
-			}															\
-		}																\
-		if (__ac_isempty(h->flags, x)) { /* not present at all */		\
-			h->keys[x] = key;											\
-			__ac_set_isboth_false(h->flags, x);							\
-			++h->size; ++h->n_occupied;									\
-			*ret = 1;													\
-		} else if (__ac_isdel(h->flags, x)) { /* deleted */				\
-			h->keys[x] = key;											\
-			__ac_set_isboth_false(h->flags, x);							\
-			++h->size;													\
-			*ret = 2;													\
-		} else *ret = 0; /* Don't touch h->keys[x] if present and not deleted */ \
-		return x;														\
-	}																	\
-	SCOPE void kh_del_##name(kh_##name##_t *h, khint_t x)				\
-	{																	\
-		if (x != h->n_buckets && !__ac_iseither(h->flags, x)) {			\
-			__ac_set_isdel_true(h->flags, x);							\
-			--h->size;													\
-		}																\
-	}
-
-#define KHASH_DECLARE(name, khkey_t, khval_t)		 					\
-	__KHASH_TYPE(name, khkey_t, khval_t) 								\
-	__KHASH_PROTOTYPES(name, khkey_t, khval_t)
-
-#define KHASH_INIT2(name, SCOPE, khkey_t, khval_t, kh_is_map, __hash_func, __hash_equal) \
-	__KHASH_TYPE(name, khkey_t, khval_t) 								\
-	__KHASH_IMPL(name, SCOPE, khkey_t, khval_t, kh_is_map, __hash_func, __hash_equal)
-
-#define KHASH_INIT(name, khkey_t, khval_t, kh_is_map, __hash_func, __hash_equal) \
-	KHASH_INIT2(name, static kh_inline klib_unused, khkey_t, khval_t, kh_is_map, __hash_func, __hash_equal)
-
-/* --- BEGIN OF HASH FUNCTIONS --- */
-
-/*! @function
-  @abstract     Integer hash function
-  @param  key   The integer [khint32_t]
-  @return       The hash value [khint_t]
- */
-#define kh_int_hash_func(key) (khint32_t)(key)
-/*! @function
-  @abstract     Integer comparison function
- */
-#define kh_int_hash_equal(a, b) ((a) == (b))
-/*! @function
-  @abstract     64-bit integer hash function
-  @param  key   The integer [khint64_t]
-  @return       The hash value [khint_t]
- */
-#define kh_int64_hash_func(key) (khint32_t)((key)>>33^(key)^(key)<<11)
-/*! @function
-  @abstract     64-bit integer comparison function
- */
-#define kh_int64_hash_equal(a, b) ((a) == (b))
-/*! @function
-  @abstract     const char* hash function
-  @param  s     Pointer to a null terminated string
-  @return       The hash value
- */
-static kh_inline khint_t __ac_X31_hash_string(const char *s)
-{
-	khint_t h = (khint_t)*s;
-	if (h) for (++s ; *s; ++s) h = (h << 5) - h + (khint_t)*s;
-	return h;
-}
-/*! @function
-  @abstract     Another interface to const char* hash function
-  @param  key   Pointer to a null terminated string [const char*]
-  @return       The hash value [khint_t]
- */
-#define kh_str_hash_func(key) __ac_X31_hash_string(key)
-/*! @function
-  @abstract     Const char* comparison function
- */
-#define kh_str_hash_equal(a, b) (strcmp(a, b) == 0)
-
-static kh_inline khint_t __ac_Wang_hash(khint_t key)
-{
-    key += ~(key << 15);
-    key ^=  (key >> 10);
-    key +=  (key << 3);
-    key ^=  (key >> 6);
-    key += ~(key << 11);
-    key ^=  (key >> 16);
-    return key;
-}
-#define kh_int_hash_func2(key) __ac_Wang_hash((khint_t)key)
-
-/* --- END OF HASH FUNCTIONS --- */
-
-/* Other convenient macros... */
-
-/*!
-  @abstract Type of the hash table.
-  @param  name  Name of the hash table [symbol]
- */
-#define khash_t(name) kh_##name##_t
-
-/*! @function
-  @abstract     Initiate a hash table.
-  @param  name  Name of the hash table [symbol]
-  @return       Pointer to the hash table [khash_t(name)*]
- */
-#define kh_init(name) kh_init_##name()
-
-/*! @function
-  @abstract     Destroy a hash table.
-  @param  name  Name of the hash table [symbol]
-  @param  h     Pointer to the hash table [khash_t(name)*]
- */
-#define kh_destroy(name, h) kh_destroy_##name(h)
-
-/*! @function
-  @abstract     Reset a hash table without deallocating memory.
-  @param  name  Name of the hash table [symbol]
-  @param  h     Pointer to the hash table [khash_t(name)*]
- */
-#define kh_clear(name, h) kh_clear_##name(h)
-
-/*! @function
-  @abstract     Resize a hash table.
-  @param  name  Name of the hash table [symbol]
-  @param  h     Pointer to the hash table [khash_t(name)*]
-  @param  s     New size [khint_t]
- */
-#define kh_resize(name, h, s) kh_resize_##name(h, s)
-
-/*! @function
-  @abstract     Insert a key to the hash table.
-  @param  name  Name of the hash table [symbol]
-  @param  h     Pointer to the hash table [khash_t(name)*]
-  @param  k     Key [type of keys]
-  @param  r     Extra return code: -1 if the operation failed;
-                0 if the key is present in the hash table;
-                1 if the bucket is empty (never used); 2 if the element in
-				the bucket has been deleted [int*]
-  @return       Iterator to the inserted element [khint_t]
- */
-#define kh_put(name, h, k, r) kh_put_##name(h, k, r)
-
-/*! @function
-  @abstract     Retrieve a key from the hash table.
-  @param  name  Name of the hash table [symbol]
-  @param  h     Pointer to the hash table [khash_t(name)*]
-  @param  k     Key [type of keys]
-  @return       Iterator to the found element, or kh_end(h) if the element is absent [khint_t]
- */
-#define kh_get(name, h, k) kh_get_##name(h, k)
-
-/*! @function
-  @abstract     Remove a key from the hash table.
-  @param  name  Name of the hash table [symbol]
-  @param  h     Pointer to the hash table [khash_t(name)*]
-  @param  k     Iterator to the element to be deleted [khint_t]
- */
-#define kh_del(name, h, k) kh_del_##name(h, k)
-
-/*! @function
-  @abstract     Test whether a bucket contains data.
-  @param  h     Pointer to the hash table [khash_t(name)*]
-  @param  x     Iterator to the bucket [khint_t]
-  @return       1 if containing data; 0 otherwise [int]
- */
-#define kh_exist(h, x) (!__ac_iseither((h)->flags, (x)))
-
-/*! @function
-  @abstract     Get key given an iterator
-  @param  h     Pointer to the hash table [khash_t(name)*]
-  @param  x     Iterator to the bucket [khint_t]
-  @return       Key [type of keys]
- */
-#define kh_key(h, x) ((h)->keys[x])
-
-/*! @function
-  @abstract     Get value given an iterator
-  @param  h     Pointer to the hash table [khash_t(name)*]
-  @param  x     Iterator to the bucket [khint_t]
-  @return       Value [type of values]
-  @discussion   For hash sets, calling this results in segfault.
- */
-#define kh_val(h, x) ((h)->vals[x])
-
-/*! @function
-  @abstract     Alias of kh_val()
- */
-#define kh_value(h, x) ((h)->vals[x])
-
-/*! @function
-  @abstract     Get the start iterator
-  @param  h     Pointer to the hash table [khash_t(name)*]
-  @return       The start iterator [khint_t]
- */
-#define kh_begin(h) (khint_t)(0)
-
-/*! @function
-  @abstract     Get the end iterator
-  @param  h     Pointer to the hash table [khash_t(name)*]
-  @return       The end iterator [khint_t]
- */
-#define kh_end(h) ((h)->n_buckets)
-
-/*! @function
-  @abstract     Get the number of elements in the hash table
-  @param  h     Pointer to the hash table [khash_t(name)*]
-  @return       Number of elements in the hash table [khint_t]
- */
-#define kh_size(h) ((h)->size)
-
-/*! @function
-  @abstract     Get the number of buckets in the hash table
-  @param  h     Pointer to the hash table [khash_t(name)*]
-  @return       Number of buckets in the hash table [khint_t]
- */
-#define kh_n_buckets(h) ((h)->n_buckets)
-
-/*! @function
-  @abstract     Iterate over the entries in the hash table
-  @param  h     Pointer to the hash table [khash_t(name)*]
-  @param  kvar  Variable to which key will be assigned
-  @param  vvar  Variable to which value will be assigned
-  @param  code  Block of code to execute
- */
-#define kh_foreach(h, kvar, vvar, code) { khint_t __i;		\
-	for (__i = kh_begin(h); __i != kh_end(h); ++__i) {		\
-		if (!kh_exist(h,__i)) continue;						\
-		(kvar) = kh_key(h,__i);								\
-		(vvar) = kh_val(h,__i);								\
-		code;												\
-	} }
-
-/*! @function
-  @abstract     Iterate over the values in the hash table
-  @param  h     Pointer to the hash table [khash_t(name)*]
-  @param  vvar  Variable to which value will be assigned
-  @param  code  Block of code to execute
- */
-#define kh_foreach_value(h, vvar, code) { khint_t __i;		\
-	for (__i = kh_begin(h); __i != kh_end(h); ++__i) {		\
-		if (!kh_exist(h,__i)) continue;						\
-		(vvar) = kh_val(h,__i);								\
-		code;												\
-	} }
-
-/* More conenient interfaces */
-
-/*! @function
-  @abstract     Instantiate a hash set containing integer keys
-  @param  name  Name of the hash table [symbol]
- */
-#define KHASH_SET_INIT_INT(name)										\
-	KHASH_INIT(name, khint32_t, char, 0, kh_int_hash_func, kh_int_hash_equal)
-
-/*! @function
-  @abstract     Instantiate a hash map containing integer keys
-  @param  name  Name of the hash table [symbol]
-  @param  khval_t  Type of values [type]
- */
-#define KHASH_MAP_INIT_INT(name, khval_t)								\
-	KHASH_INIT(name, khint32_t, khval_t, 1, kh_int_hash_func, kh_int_hash_equal)
-
-/*! @function
-  @abstract     Instantiate a hash map containing 64-bit integer keys
-  @param  name  Name of the hash table [symbol]
- */
-#define KHASH_SET_INIT_INT64(name)										\
-	KHASH_INIT(name, khint64_t, char, 0, kh_int64_hash_func, kh_int64_hash_equal)
-
-/*! @function
-  @abstract     Instantiate a hash map containing 64-bit integer keys
-  @param  name  Name of the hash table [symbol]
-  @param  khval_t  Type of values [type]
- */
-#define KHASH_MAP_INIT_INT64(name, khval_t)								\
-	KHASH_INIT(name, khint64_t, khval_t, 1, kh_int64_hash_func, kh_int64_hash_equal)
-
-typedef const char *kh_cstr_t;
-/*! @function
-  @abstract     Instantiate a hash map containing const char* keys
-  @param  name  Name of the hash table [symbol]
- */
-#define KHASH_SET_INIT_STR(name)										\
-	KHASH_INIT(name, kh_cstr_t, char, 0, kh_str_hash_func, kh_str_hash_equal)
-
-/*! @function
-  @abstract     Instantiate a hash map containing const char* keys
-  @param  name  Name of the hash table [symbol]
-  @param  khval_t  Type of values [type]
- */
-#define KHASH_MAP_INIT_STR(name, khval_t)								\
-	KHASH_INIT(name, kh_cstr_t, khval_t, 1, kh_str_hash_func, kh_str_hash_equal)
-
-#endif /* __AC_KHASH_H */

kseq.h

@@ -1,248 +0,0 @@
-/* The MIT License
-
-   Copyright (c) 2008, 2009, 2011 Attractive Chaos <attractor@live.co.uk>
-
-   Permission is hereby granted, free of charge, to any person obtaining
-   a copy of this software and associated documentation files (the
-   "Software"), to deal in the Software without restriction, including
-   without limitation the rights to use, copy, modify, merge, publish,
-   distribute, sublicense, and/or sell copies of the Software, and to
-   permit persons to whom the Software is furnished to do so, subject to
-   the following conditions:
-
-   The above copyright notice and this permission notice shall be
-   included in all copies or substantial portions of the Software.
-
-   THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
-   EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
-   MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
-   NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS
-   BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN
-   ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN
-   CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
-   SOFTWARE.
-*/
-
-/* Last Modified: 05MAR2012 */
-
-#ifndef AC_KSEQ_H
-#define AC_KSEQ_H
-
-#include <ctype.h>
-#include <string.h>
-#include <stdlib.h>
-
-#define KS_SEP_SPACE 0 // isspace(): \t, \n, \v, \f, \r
-#define KS_SEP_TAB   1 // isspace() && !' '
-#define KS_SEP_LINE  2 // line separator: "\n" (Unix) or "\r\n" (Windows)
-#define KS_SEP_MAX   2
-
-#define __KS_TYPE(type_t) \
-	typedef struct __kstream_t { \
-		int begin, end; \
-		int is_eof:2, bufsize:30; \
-		type_t f; \
-		unsigned char *buf; \
-	} kstream_t;
-
-#define ks_eof(ks) ((ks)->is_eof && (ks)->begin >= (ks)->end)
-#define ks_rewind(ks) ((ks)->is_eof = (ks)->begin = (ks)->end = 0)
-
-#define __KS_BASIC(SCOPE, type_t, __bufsize) \
-	SCOPE kstream_t *ks_init(type_t f) \
-	{ \
-		kstream_t *ks = (kstream_t*)calloc(1, sizeof(kstream_t)); \
-		ks->f = f; ks->bufsize = __bufsize; \
-		ks->buf = (unsigned char*)malloc(__bufsize); \
-		return ks; \
-	} \
-	SCOPE void ks_destroy(kstream_t *ks) \
-	{ \
-		if (!ks) return; \
-		free(ks->buf); \
-		free(ks); \
-	}
-
-#define __KS_INLINED(__read) \
-	static inline int ks_getc(kstream_t *ks) \
-	{ \
-		if (ks->is_eof && ks->begin >= ks->end) return -1; \
-		if (ks->begin >= ks->end) { \
-			ks->begin = 0; \
-			ks->end = __read(ks->f, ks->buf, ks->bufsize); \
-			if (ks->end < ks->bufsize) ks->is_eof = 1; \
-			if (ks->end == 0) return -1; \
-		} \
-		return (int)ks->buf[ks->begin++]; \
-	} \
-	static inline int ks_getuntil(kstream_t *ks, int delimiter, kstring_t *str, int *dret) \
-	{ return ks_getuntil2(ks, delimiter, str, dret, 0); }
-
-#ifndef KSTRING_T
-#define KSTRING_T kstring_t
-typedef struct __kstring_t {
-	unsigned l, m;
-	char *s;
-} kstring_t;
-#endif
-
-#ifndef kroundup32
-#define kroundup32(x) (--(x), (x)|=(x)>>1, (x)|=(x)>>2, (x)|=(x)>>4, (x)|=(x)>>8, (x)|=(x)>>16, ++(x))
-#endif
-
-#define __KS_GETUNTIL(SCOPE, __read) \
-	SCOPE int ks_getuntil2(kstream_t *ks, int delimiter, kstring_t *str, int *dret, int append) \
-	{ \
-		if (dret) *dret = 0; \
-		str->l = append? str->l : 0; \
-		if (ks->begin >= ks->end && ks->is_eof) return -1; \
-		for (;;) { \
-			int i; \
-			if (ks->begin >= ks->end) { \
-				if (!ks->is_eof) { \
-					ks->begin = 0; \
-					ks->end = __read(ks->f, ks->buf, ks->bufsize); \
-					if (ks->end < ks->bufsize) ks->is_eof = 1; \
-					if (ks->end == 0) break; \
-				} else break; \
-			} \
-			if (delimiter == KS_SEP_LINE) { \
-				for (i = ks->begin; i < ks->end; ++i) \
-					if (ks->buf[i] == '\n') break; \
-			} else if (delimiter > KS_SEP_MAX) { \
-				for (i = ks->begin; i < ks->end; ++i) \
-					if (ks->buf[i] == delimiter) break; \
-			} else if (delimiter == KS_SEP_SPACE) { \
-				for (i = ks->begin; i < ks->end; ++i) \
-					if (isspace(ks->buf[i])) break; \
-			} else if (delimiter == KS_SEP_TAB) { \
-				for (i = ks->begin; i < ks->end; ++i) \
-					if (isspace(ks->buf[i]) && ks->buf[i] != ' ') break; \
-			} else i = 0; /* never come to here! */ \
-			if (str->m - str->l < (size_t)(i - ks->begin + 1)) { \
-				str->m = str->l + (i - ks->begin) + 1; \
-				kroundup32(str->m); \
-				str->s = (char*)realloc(str->s, str->m); \
-			} \
-			memcpy(str->s + str->l, ks->buf + ks->begin, i - ks->begin); \
-			str->l = str->l + (i - ks->begin); \
-			ks->begin = i + 1; \
-			if (i < ks->end) { \
-				if (dret) *dret = ks->buf[i]; \
-				break; \
-			} \
-		} \
-		if (str->s == 0) { \
-			str->m = 1; \
-			str->s = (char*)calloc(1, 1); \
-		} else if (delimiter == KS_SEP_LINE && str->l > 1 && str->s[str->l-1] == '\r') --str->l; \
-		str->s[str->l] = '\0'; \
-		return str->l; \
-	}
-
-#define KSTREAM_INIT2(SCOPE, type_t, __read, __bufsize) \
-	__KS_TYPE(type_t) \
-	__KS_BASIC(SCOPE, type_t, __bufsize) \
-	__KS_GETUNTIL(SCOPE, __read) \
-	__KS_INLINED(__read)
-
-#define KSTREAM_INIT(type_t, __read, __bufsize) KSTREAM_INIT2(static, type_t, __read, __bufsize)
-
-#define KSTREAM_DECLARE(type_t, __read) \
-	__KS_TYPE(type_t) \
-	extern int ks_getuntil2(kstream_t *ks, int delimiter, kstring_t *str, int *dret, int append); \
-	extern kstream_t *ks_init(type_t f); \
-	extern void ks_destroy(kstream_t *ks); \
-	__KS_INLINED(__read)
-
-/******************
- * FASTA/Q parser *
- ******************/
-
-#define kseq_rewind(ks) ((ks)->last_char = (ks)->f->is_eof = (ks)->f->begin = (ks)->f->end = 0)
-
-#define __KSEQ_BASIC(SCOPE, type_t) \
-	SCOPE kseq_t *kseq_init(type_t fd) \
-	{ \
-		kseq_t *s = (kseq_t*)calloc(1, sizeof(kseq_t)); \
-		s->f = ks_init(fd); \
-		return s; \
-	} \
-	SCOPE void kseq_destroy(kseq_t *ks) \
-	{ \
-		if (!ks) return; \
-		free(ks->name.s); free(ks->comment.s); free(ks->seq.s);	free(ks->qual.s); \
-		ks_destroy(ks->f); \
-		free(ks); \
-	}
-
-/* Return value:
-   >=0  length of the sequence (normal)
-   -1   end-of-file
-   -2   truncated quality string
- */
-#define __KSEQ_READ(SCOPE) \
-	SCOPE int kseq_read(kseq_t *seq) \
-	{ \
-		int c; \
-		kstream_t *ks = seq->f; \
-		if (seq->last_char == 0) { /* then jump to the next header line */ \
-			while ((c = ks_getc(ks)) != -1 && c != '>' && c != '@'); \
-			if (c == -1) return -1; /* end of file */ \
-			seq->last_char = c; \
-		} /* else: the first header char has been read in the previous call */ \
-		seq->comment.l = seq->seq.l = seq->qual.l = 0; /* reset all members */ \
-		if (ks_getuntil(ks, 0, &seq->name, &c) < 0) return -1; /* normal exit: EOF */ \
-		if (c != '\n') ks_getuntil(ks, KS_SEP_LINE, &seq->comment, 0); /* read FASTA/Q comment */ \
-		if (seq->seq.s == 0) { /* we can do this in the loop below, but that is slower */ \
-			seq->seq.m = 256; \
-			seq->seq.s = (char*)malloc(seq->seq.m); \
-		} \
-		while ((c = ks_getc(ks)) != -1 && c != '>' && c != '+' && c != '@') { \
-			if (c == '\n') continue; /* skip empty lines */ \
-			seq->seq.s[seq->seq.l++] = c; /* this is safe: we always have enough space for 1 char */ \
-			ks_getuntil2(ks, KS_SEP_LINE, &seq->seq, 0, 1); /* read the rest of the line */ \
-		} \
-		if (c == '>' || c == '@') seq->last_char = c; /* the first header char has been read */ \
-		if (seq->seq.l + 1 >= seq->seq.m) { /* seq->seq.s[seq->seq.l] below may be out of boundary */ \
-			seq->seq.m = seq->seq.l + 2; \
-			kroundup32(seq->seq.m); /* rounded to the next closest 2^k */ \
-			seq->seq.s = (char*)realloc(seq->seq.s, seq->seq.m); \
-		} \
-		seq->seq.s[seq->seq.l] = 0;	/* null terminated string */ \
-		if (c != '+') return seq->seq.l; /* FASTA */ \
-		if (seq->qual.m < seq->seq.m) {	/* allocate memory for qual in case insufficient */ \
-			seq->qual.m = seq->seq.m; \
-			seq->qual.s = (char*)realloc(seq->qual.s, seq->qual.m); \
-		} \
-		while ((c = ks_getc(ks)) != -1 && c != '\n'); /* skip the rest of '+' line */ \
-		if (c == -1) return -2; /* error: no quality string */ \
-		while (ks_getuntil2(ks, KS_SEP_LINE, &seq->qual, 0, 1) >= 0 && seq->qual.l < seq->seq.l); \
-		seq->last_char = 0;	/* we have not come to the next header line */ \
-		if (seq->seq.l != seq->qual.l) return -2; /* error: qual string is of a different length */ \
-		return seq->seq.l; \
-	}
-
-#define __KSEQ_TYPE(type_t) \
-	typedef struct { \
-		kstring_t name, comment, seq, qual; \
-		int last_char; \
-		kstream_t *f; \
-	} kseq_t;
-
-#define KSEQ_INIT2(SCOPE, type_t, __read) \
-	KSTREAM_INIT2(SCOPE, type_t, __read, 16384) \
-	__KSEQ_TYPE(type_t) \
-	__KSEQ_BASIC(SCOPE, type_t) \
-	__KSEQ_READ(SCOPE)
-
-#define KSEQ_INIT(type_t, __read) KSEQ_INIT2(static, type_t, __read)
-
-#define KSEQ_DECLARE(type_t) \
-	__KS_TYPE(type_t) \
-	__KSEQ_TYPE(type_t) \
-	extern kseq_t *kseq_init(type_t fd); \
-	void kseq_destroy(kseq_t *ks); \
-	int kseq_read(kseq_t *seq);
-
-#endif

ksort.h

@@ -1,136 +0,0 @@
-/* The MIT License
-
-   Copyright (c) 2008, 2011 Attractive Chaos <attractor@live.co.uk>
-
-   Permission is hereby granted, free of charge, to any person obtaining
-   a copy of this software and associated documentation files (the
-   "Software"), to deal in the Software without restriction, including
-   without limitation the rights to use, copy, modify, merge, publish,
-   distribute, sublicense, and/or sell copies of the Software, and to
-   permit persons to whom the Software is furnished to do so, subject to
-   the following conditions:
-
-   The above copyright notice and this permission notice shall be
-   included in all copies or substantial portions of the Software.
-
-   THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
-   EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
-   MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
-   NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS
-   BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN
-   ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN
-   CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
-   SOFTWARE.
-*/
-
-// This is a simplified version of ksort.h
-
-#ifndef AC_KSORT_H
-#define AC_KSORT_H
-
-#include <stdlib.h>
-#include <string.h>
-#include <assert.h>
-
-typedef struct {
-	void *left, *right;
-	int depth;
-} ks_isort_stack_t;
-
-#define KSORT_SWAP(type_t, a, b) { register type_t t=(a); (a)=(b); (b)=t; }
-
-#define KSORT_INIT(name, type_t, __sort_lt)								\
-	type_t ks_ksmall_##name(size_t n, type_t arr[], size_t kk)			\
-	{																	\
-		type_t *low, *high, *k, *ll, *hh, *mid;							\
-		low = arr; high = arr + n - 1; k = arr + kk;					\
-		for (;;) {														\
-			if (high <= low) return *k;									\
-			if (high == low + 1) {										\
-				if (__sort_lt(*high, *low)) KSORT_SWAP(type_t, *low, *high); \
-				return *k;												\
-			}															\
-			mid = low + (high - low) / 2;								\
-			if (__sort_lt(*high, *mid)) KSORT_SWAP(type_t, *mid, *high); \
-			if (__sort_lt(*high, *low)) KSORT_SWAP(type_t, *low, *high); \
-			if (__sort_lt(*low, *mid)) KSORT_SWAP(type_t, *mid, *low);	\
-			KSORT_SWAP(type_t, *mid, *(low+1));							\
-			ll = low + 1; hh = high;									\
-			for (;;) {													\
-				do ++ll; while (__sort_lt(*ll, *low));					\
-				do --hh; while (__sort_lt(*low, *hh));					\
-				if (hh < ll) break;										\
-				KSORT_SWAP(type_t, *ll, *hh);							\
-			}															\
-			KSORT_SWAP(type_t, *low, *hh);								\
-			if (hh <= k) low = ll;										\
-			if (hh >= k) high = hh - 1;									\
-		}																\
-	}																	\
-
-#define ks_ksmall(name, n, a, k) ks_ksmall_##name(n, a, k)
-
-#define ks_lt_generic(a, b) ((a) < (b))
-#define ks_lt_str(a, b) (strcmp((a), (b)) < 0)
-
-typedef const char *ksstr_t;
-
-#define KSORT_INIT_GENERIC(type_t) KSORT_INIT(type_t, type_t, ks_lt_generic)
-#define KSORT_INIT_STR KSORT_INIT(str, ksstr_t, ks_lt_str)
-
-#define RS_MIN_SIZE 64
-#define RS_MAX_BITS 8
-
-#define KRADIX_SORT_INIT(name, rstype_t, rskey, sizeof_key) \
-	typedef struct { \
-		rstype_t *b, *e; \
-	} rsbucket_##name##_t; \
-	void rs_insertsort_##name(rstype_t *beg, rstype_t *end) \
-	{ \
-		rstype_t *i; \
-		for (i = beg + 1; i < end; ++i) \
-			if (rskey(*i) < rskey(*(i - 1))) { \
-				rstype_t *j, tmp = *i; \
-				for (j = i; j > beg && rskey(tmp) < rskey(*(j-1)); --j) \
-					*j = *(j - 1); \
-				*j = tmp; \
-			} \
-	} \
-	void rs_sort_##name(rstype_t *beg, rstype_t *end, int n_bits, int s) \
-	{ \
-		rstype_t *i; \
-		int size = 1<<n_bits, m = size - 1; \
-		rsbucket_##name##_t *k, b[1<<RS_MAX_BITS], *be = b + size; \
-		assert(n_bits <= RS_MAX_BITS); \
-		for (k = b; k != be; ++k) k->b = k->e = beg; \
-		for (i = beg; i != end; ++i) ++b[rskey(*i)>>s&m].e; \
-		for (k = b + 1; k != be; ++k) \
-			k->e += (k-1)->e - beg, k->b = (k-1)->e; \
-		for (k = b; k != be;) { \
-			if (k->b != k->e) { \
-				rsbucket_##name##_t *l; \
-				if ((l = b + (rskey(*k->b)>>s&m)) != k) { \
-					rstype_t tmp = *k->b, swap; \
-					do { \
-						swap = tmp; tmp = *l->b; *l->b++ = swap; \
-						l = b + (rskey(tmp)>>s&m); \
-					} while (l != k); \
-					*k->b++ = tmp; \
-				} else ++k->b; \
-			} else ++k; \
-		} \
-		for (b->b = beg, k = b + 1; k != be; ++k) k->b = (k-1)->e; \
-		if (s) { \
-			s = s > n_bits? s - n_bits : 0; \
-			for (k = b; k != be; ++k) \
-				if (k->e - k->b > RS_MIN_SIZE) rs_sort_##name(k->b, k->e, n_bits, s); \
-				else if (k->e - k->b > 1) rs_insertsort_##name(k->b, k->e); \
-		} \
-	} \
-	void radix_sort_##name(rstype_t *beg, rstype_t *end) \
-	{ \
-		if (end - beg <= RS_MIN_SIZE) rs_insertsort_##name(beg, end); \
-		else rs_sort_##name(beg, end, RS_MAX_BITS, (sizeof_key - 1) * RS_MAX_BITS); \
-	}
-
-#endif

ksw2.h

@@ -1,172 +0,0 @@
-#ifndef KSW2_H_
-#define KSW2_H_
-
-#include <stdint.h>
-
-#define KSW_NEG_INF -0x40000000
-
-#define KSW_EZ_SCORE_ONLY  0x01 // don't record alignment path/cigar
-#define KSW_EZ_RIGHT       0x02 // right-align gaps
-#define KSW_EZ_GENERIC_SC  0x04 // without this flag: match/mismatch only; last symbol is a wildcard
-#define KSW_EZ_APPROX_MAX  0x08 // approximate max; this is faster with sse
-#define KSW_EZ_APPROX_DROP 0x10 // approximate Z-drop; faster with sse
-#define KSW_EZ_EXTZ_ONLY   0x40 // only perform extension
-#define KSW_EZ_REV_CIGAR   0x80 // reverse CIGAR in the output
-#define KSW_EZ_SPLICE_FOR  0x100
-#define KSW_EZ_SPLICE_REV  0x200
-
-#ifdef __cplusplus
-extern "C" {
-#endif
-
-typedef struct {
-	uint32_t max:31, zdropped:1;
-	int max_q, max_t;      // max extension coordinate
-	int mqe, mqe_t;        // max score when reaching the end of query
-	int mte, mte_q;        // max score when reaching the end of target
-	int score;             // max score reaching both ends; may be KSW_NEG_INF
-	int m_cigar, n_cigar;
-	uint32_t *cigar;
-} ksw_extz_t;
-
-/**
- * NW-like extension
- *
- * @param km        memory pool, when used with kalloc
- * @param qlen      query length
- * @param query     query sequence with 0 <= query[i] < m
- * @param tlen      target length
- * @param target    target sequence with 0 <= target[i] < m
- * @param m         number of residue types
- * @param mat       m*m scoring mattrix in one-dimension array
- * @param gapo      gap open penalty; a gap of length l cost "-(gapo+l*gape)"
- * @param gape      gap extension penalty
- * @param w         band width (<0 to disable)
- * @param zdrop     off-diagonal drop-off to stop extension (positive; <0 to disable)
- * @param flag      flag (see KSW_EZ_* macros)
- * @param ez        (out) scores and cigar
- */
-void ksw_extz(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int flag, ksw_extz_t *ez);
-void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int flag, ksw_extz_t *ez);
-
-void ksw_extd(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
-			  int8_t gapo, int8_t gape, int8_t gapo2, int8_t gape2, int w, int zdrop, int flag, ksw_extz_t *ez);
-
-void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
-				   int8_t gapo, int8_t gape, int8_t gapo2, int8_t gape2, int w, int zdrop, int flag, ksw_extz_t *ez);
-
-void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
-				   int8_t gapo, int8_t gape, int8_t gapo2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez);
-
-void ksw_extf2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t mch, int8_t mis, int8_t e, int w, int xdrop, ksw_extz_t *ez);
-
-/**
- * Global alignment
- *
- * (first 10 parameters identical to ksw_extz_sse())
- * @param m_cigar   (modified) max CIGAR length; feed 0 if cigar==0
- * @param n_cigar   (out) number of CIGAR elements
- * @param cigar     (out) BAM-encoded CIGAR; caller need to deallocate with kfree(km, )
- *
- * @return          score of the alignment
- */
-int ksw_gg(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t gapo, int8_t gape, int w, int *m_cigar_, int *n_cigar_, uint32_t **cigar_);
-int ksw_gg2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t gapo, int8_t gape, int w, int *m_cigar_, int *n_cigar_, uint32_t **cigar_);
-int ksw_gg2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t gapo, int8_t gape, int w, int *m_cigar_, int *n_cigar_, uint32_t **cigar_);
-
-void *ksw_ll_qinit(void *km, int size, int qlen, const uint8_t *query, int m, const int8_t *mat);
-int ksw_ll_i16(void *q, int tlen, const uint8_t *target, int gapo, int gape, int *qe, int *te);
-
-#ifdef __cplusplus
-}
-#endif
-
-/************************************
- *** Private macros and functions ***
- ************************************/
-
-#ifdef HAVE_KALLOC
-#include "kalloc.h"
-#else
-#include <stdlib.h>
-#define kmalloc(km, size) malloc((size))
-#define kcalloc(km, count, size) calloc((count), (size))
-#define krealloc(km, ptr, size) realloc((ptr), (size))
-#define kfree(km, ptr) free((ptr))
-#endif
-
-static inline uint32_t *ksw_push_cigar(void *km, int *n_cigar, int *m_cigar, uint32_t *cigar, uint32_t op, int len)
-{
-	if (*n_cigar == 0 || op != (cigar[(*n_cigar) - 1]&0xf)) {
-		if (*n_cigar == *m_cigar) {
-			*m_cigar = *m_cigar? (*m_cigar)<<1 : 4;
-			cigar = (uint32_t*)krealloc(km, cigar, (*m_cigar) << 2);
-		}
-		cigar[(*n_cigar)++] = len<<4 | op;
-	} else cigar[(*n_cigar)-1] += len<<4;
-	return cigar;
-}
-
-// In the backtrack matrix, value p[] has the following structure:
-//   bit 0-2: which type gets the max - 0 for H, 1 for E, 2 for F, 3 for \tilde{E} and 4 for \tilde{F}
-//   bit 3/0x08: 1 if a continuation on the E state (bit 5/0x20 for a continuation on \tilde{E})
-//   bit 4/0x10: 1 if a continuation on the F state (bit 6/0x40 for a continuation on \tilde{F})
-static inline void ksw_backtrack(void *km, int is_rot, int is_rev, int with_N, const uint8_t *p, const int *off, const int *off_end, int n_col, int i0, int j0,
-								 int *m_cigar_, int *n_cigar_, uint32_t **cigar_)
-{ // p[] - lower 3 bits: which type gets the max; bit
-	int n_cigar = 0, m_cigar = *m_cigar_, i = i0, j = j0, r, state = 0;
-	uint32_t *cigar = *cigar_, tmp;
-	while (i >= 0 && j >= 0) { // at the beginning of the loop, _state_ tells us which state to check
-		int force_state = -1;
-		if (is_rot) {
-			r = i + j;
-			if (i < off[r]) force_state = 2;
-			if (off_end && i > off_end[r]) force_state = 1;
-			tmp = force_state < 0? p[r * n_col + i - off[r]] : 0;
-		} else {
-			if (j < off[i]) force_state = 2;
-			if (off_end && j > off_end[i]) force_state = 1;
-			tmp = force_state < 0? p[i * n_col + j - off[i]] : 0;
-		}
-		if (state == 0) state = tmp & 7; // if requesting the H state, find state one maximizes it.
-		else if (!(tmp >> (state + 2) & 1)) state = 0; // if requesting other states, _state_ stays the same if it is a continuation; otherwise, set to H
-		if (state == 0) state = tmp & 7; // TODO: probably this line can be merged into the "else if" line right above; not 100% sure
-		if (force_state >= 0) state = force_state;
-		if (state == 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 0, 1), --i, --j; // match
-		else if (state == 1 || (state == 3 && !with_N)) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 2, 1), --i; // deletion
-		else if (state == 3 && with_N) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 3, 1), --i; // intron
-		else cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 1, 1), --j; // insertion
-	}
-	if (i >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 2, i + 1); // first deletion
-	if (j >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 1, j + 1); // first insertion
-	if (!is_rev)
-		for (i = 0; i < n_cigar>>1; ++i) // reverse CIGAR
-			tmp = cigar[i], cigar[i] = cigar[n_cigar-1-i], cigar[n_cigar-1-i] = tmp;
-	*m_cigar_ = m_cigar, *n_cigar_ = n_cigar, *cigar_ = cigar;
-}
-
-static inline void ksw_reset_extz(ksw_extz_t *ez)
-{
-	ez->max_q = ez->max_t = ez->mqe_t = ez->mte_q = -1;
-	ez->max = 0, ez->score = ez->mqe = ez->mte = KSW_NEG_INF;
-	ez->n_cigar = 0, ez->zdropped = 0;
-}
-
-static inline int ksw_apply_zdrop(ksw_extz_t *ez, int is_rot, int32_t H, int a, int b, int zdrop, int8_t e)
-{
-	int r, t;
-	if (is_rot) r = a, t = b;
-	else r = a + b, t = a;
-	if (H > (int32_t)ez->max) {
-		ez->max = H, ez->max_t = t, ez->max_q = r - t;
-	} else if (t >= ez->max_t && r - t >= ez->max_q) {
-		int tl = t - ez->max_t, ql = (r - t) - ez->max_q, l;
-		l = tl > ql? tl - ql : ql - tl;
-		if (zdrop >= 0 && ez->max - H > zdrop + l * e) {
-			ez->zdropped = 1;
-			return 1;
-		}
-	}
-	return 0;
-}
-#endif

ksw2_dispatch.c

@@ -1,97 +0,0 @@
-#ifdef KSW_CPU_DISPATCH
-#include <stdlib.h>
-#include "ksw2.h"
-
-#define SIMD_SSE     0x1
-#define SIMD_SSE2    0x2
-#define SIMD_SSE3    0x4
-#define SIMD_SSSE3   0x8
-#define SIMD_SSE4_1  0x10
-#define SIMD_SSE4_2  0x20
-#define SIMD_AVX     0x40
-#define SIMD_AVX2    0x80
-#define SIMD_AVX512F 0x100
-
-#ifndef _MSC_VER
-// adapted from https://github.com/01org/linux-sgx/blob/master/common/inc/internal/linux/cpuid_gnu.h
-void __cpuidex(int cpuid[4], int func_id, int subfunc_id)
-{
-#if defined(__x86_64__)
-	asm volatile ("cpuid"
-			: "=a" (cpuid[0]), "=b" (cpuid[1]), "=c" (cpuid[2]), "=d" (cpuid[3])
-			: "0" (func_id), "2" (subfunc_id));
-#else // on 32bit, ebx can NOT be used as PIC code
-	asm volatile ("xchgl %%ebx, %1; cpuid; xchgl %%ebx, %1"
-			: "=a" (cpuid[0]), "=r" (cpuid[1]), "=c" (cpuid[2]), "=d" (cpuid[3])
-			: "0" (func_id), "2" (subfunc_id));
-#endif
-}
-#endif
-
-int x86_simd(void)
-{
-	int flag = 0, cpuid[4], max_id;
-	__cpuidex(cpuid, 0, 0);
-	max_id = cpuid[0];
-	if (max_id == 0) return 0;
-	__cpuidex(cpuid, 1, 0);
-	if (cpuid[3]>>25&1) flag |= SIMD_SSE;
-	if (cpuid[3]>>26&1) flag |= SIMD_SSE2;
-	if (cpuid[2]>>0 &1) flag |= SIMD_SSE3;
-	if (cpuid[2]>>9 &1) flag |= SIMD_SSSE3;
-	if (cpuid[2]>>19&1) flag |= SIMD_SSE4_1;
-	if (cpuid[2]>>20&1) flag |= SIMD_SSE4_2;
-	if (cpuid[2]>>28&1) flag |= SIMD_AVX;
-	if (max_id >= 7) {
-		__cpuidex(cpuid, 7, 0);
-		if (cpuid[1]>>5 &1) flag |= SIMD_AVX2;
-		if (cpuid[1]>>16&1) flag |= SIMD_AVX512F;
-	}
-	return flag;
-}
-
-void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int flag, ksw_extz_t *ez)
-{
-	extern void ksw_extz2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int flag, ksw_extz_t *ez);
-	extern void ksw_extz2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int flag, ksw_extz_t *ez);
-	unsigned simd;
-	simd = x86_simd();
-	if (simd & SIMD_SSE4_1)
-		ksw_extz2_sse41(km, qlen, query, tlen, target, m, mat, q, e, w, zdrop, flag, ez);
-	else if (simd & SIMD_SSE2)
-		ksw_extz2_sse2(km, qlen, query, tlen, target, m, mat, q, e, w, zdrop, flag, ez);
-	else abort();
-}
-
-void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
-				   int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int flag, ksw_extz_t *ez)
-{
-	extern void ksw_extd2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
-				   int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int flag, ksw_extz_t *ez);
-	extern void ksw_extd2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
-				   int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int flag, ksw_extz_t *ez);
-	unsigned simd;
-	simd = x86_simd();
-	if (simd & SIMD_SSE4_1)
-		ksw_extd2_sse41(km, qlen, query, tlen, target, m, mat, q, e, q2, e2, w, zdrop, flag, ez);
-	else if (simd & SIMD_SSE2)
-		ksw_extd2_sse2(km, qlen, query, tlen, target, m, mat, q, e, q2, e2, w, zdrop, flag, ez);
-	else abort();
-}
-
-void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
-				   int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez)
-{
-	extern void ksw_exts2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
-				   int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez);
-	extern void ksw_exts2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
-				   int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez);
-	unsigned simd;
-	simd = x86_simd();
-	if (simd & SIMD_SSE4_1)
-		ksw_exts2_sse41(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, flag, ez);
-	else if (simd & SIMD_SSE2)
-		ksw_exts2_sse2(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, flag, ez);
-	else abort();
-}
-#endif

ksw2_extd2_sse.c

@@ -1,388 +0,0 @@
-#include <string.h>
-#include <stdio.h>
-#include <assert.h>
-#include "ksw2.h"
-
-#ifdef __SSE2__
-#include <emmintrin.h>
-
-#ifdef KSW_SSE2_ONLY
-#undef __SSE4_1__
-#endif
-
-#ifdef __SSE4_1__
-#include <smmintrin.h>
-#endif
-
-#ifdef KSW_CPU_DISPATCH
-#ifdef __SSE4_1__
-void ksw_extd2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
-				   int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int flag, ksw_extz_t *ez)
-#else
-void ksw_extd2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
-				   int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int flag, ksw_extz_t *ez)
-#endif
-#else
-void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
-				   int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int flag, ksw_extz_t *ez)
-#endif // ~KSW_CPU_DISPATCH
-{
-#define __dp_code_block1 \
-	z = _mm_load_si128(&s[t]); \
-	xt1 = _mm_load_si128(&x[t]);                     /* xt1 <- x[r-1][t..t+15] */ \
-	tmp = _mm_srli_si128(xt1, 15);                   /* tmp <- x[r-1][t+15] */ \
-	xt1 = _mm_or_si128(_mm_slli_si128(xt1, 1), x1_); /* xt1 <- x[r-1][t-1..t+14] */ \
-	x1_ = tmp; \
-	vt1 = _mm_load_si128(&v[t]);                     /* vt1 <- v[r-1][t..t+15] */ \
-	tmp = _mm_srli_si128(vt1, 15);                   /* tmp <- v[r-1][t+15] */ \
-	vt1 = _mm_or_si128(_mm_slli_si128(vt1, 1), v1_); /* vt1 <- v[r-1][t-1..t+14] */ \
-	v1_ = tmp; \
-	a = _mm_add_epi8(xt1, vt1);                      /* a <- x[r-1][t-1..t+14] + v[r-1][t-1..t+14] */ \
-	ut = _mm_load_si128(&u[t]);                      /* ut <- u[t..t+15] */ \
-	b = _mm_add_epi8(_mm_load_si128(&y[t]), ut);     /* b <- y[r-1][t..t+15] + u[r-1][t..t+15] */ \
-	x2t1= _mm_load_si128(&x2[t]); \
-	tmp = _mm_srli_si128(x2t1, 15); \
-	x2t1= _mm_or_si128(_mm_slli_si128(x2t1, 1), x21_); \
-	x21_= tmp; \
-	a2= _mm_add_epi8(x2t1, vt1); \
-	b2= _mm_add_epi8(_mm_load_si128(&y2[t]), ut);
-
-#define __dp_code_block2 \
-	_mm_store_si128(&u[t], _mm_sub_epi8(z, vt1));    /* u[r][t..t+15] <- z - v[r-1][t-1..t+14] */ \
-	_mm_store_si128(&v[t], _mm_sub_epi8(z, ut));     /* v[r][t..t+15] <- z - u[r-1][t..t+15] */ \
-	tmp = _mm_sub_epi8(z, q_); \
-	a = _mm_sub_epi8(a, tmp); \
-	b = _mm_sub_epi8(b, tmp); \
-	tmp = _mm_sub_epi8(z, q2_); \
-	a2= _mm_sub_epi8(a2, tmp); \
-	b2= _mm_sub_epi8(b2, tmp);
-
-	int r, t, qe = q + e, n_col_, *off = 0, *off_end = 0, tlen_, qlen_, last_st, last_en, wl, wr, max_sc, min_sc, long_thres, long_diff;
-	int with_cigar = !(flag&KSW_EZ_SCORE_ONLY), approx_max = !!(flag&KSW_EZ_APPROX_MAX);
-	int32_t *H = 0, H0 = 0, last_H0_t = 0;
-	uint8_t *qr, *sf, *mem, *mem2 = 0;
-	__m128i q_, q2_, qe_, qe2_, zero_, sc_mch_, sc_mis_, m1_;
-	__m128i *u, *v, *x, *y, *x2, *y2, *s, *p = 0;
-
-	ksw_reset_extz(ez);
-	if (m <= 1 || qlen <= 0 || tlen <= 0) return;
-
-	if (q2 + e2 < q + e) t = q, q = q2, q2 = t, t = e, e = e2, e2 = t; // make sure q+e no larger than q2+e2
-
-	zero_   = _mm_set1_epi8(0);
-	q_      = _mm_set1_epi8(q);
-	q2_     = _mm_set1_epi8(q2);
-	qe_     = _mm_set1_epi8(q + e);
-	qe2_    = _mm_set1_epi8(q2 + e2);
-	sc_mch_ = _mm_set1_epi8(mat[0]);
-	sc_mis_ = _mm_set1_epi8(mat[1]);
-	m1_     = _mm_set1_epi8(m - 1); // wildcard
-
-	if (w < 0) w = tlen > qlen? tlen : qlen;
-	wl = wr = w;
-	tlen_ = (tlen + 15) / 16;
-	n_col_ = qlen < tlen? qlen : tlen;
-	n_col_ = ((n_col_ < w + 1? n_col_ : w + 1) + 15) / 16 + 1;
-	qlen_ = (qlen + 15) / 16;
-	for (t = 1, max_sc = mat[0], min_sc = mat[1]; t < m * m; ++t) {
-		max_sc = max_sc > mat[t]? max_sc : mat[t];
-		min_sc = min_sc < mat[t]? min_sc : mat[t];
-	}
-	if (-min_sc > 2 * (q + e)) return; // otherwise, we won't see any mismatches
-
-	long_thres = e != e2? (q2 - q) / (e - e2) - 1 : 0;
-	if (q2 + e2 + long_thres * e2 > q + e + long_thres * e)
-		++long_thres;
-	long_diff = long_thres * (e - e2) - (q2 - q) - e2;
-
-	mem = (uint8_t*)kcalloc(km, tlen_ * 8 + qlen_ + 1, 16);
-	u = (__m128i*)(((size_t)mem + 15) >> 4 << 4); // 16-byte aligned
-	v = u + tlen_, x = v + tlen_, y = x + tlen_, x2 = y + tlen_, y2 = x2 + tlen_;
-	s = y2 + tlen_, sf = (uint8_t*)(s + tlen_), qr = sf + tlen_ * 16;
-	memset(u,  -q  - e,  tlen_ * 16);
-	memset(v,  -q  - e,  tlen_ * 16);
-	memset(x,  -q  - e,  tlen_ * 16);
-	memset(y,  -q  - e,  tlen_ * 16);
-	memset(x2, -q2 - e2, tlen_ * 16);
-	memset(y2, -q2 - e2, tlen_ * 16);
-	if (!approx_max) {
-		H = (int32_t*)kmalloc(km, tlen_ * 16 * 4);
-		for (t = 0; t < tlen_ * 16; ++t) H[t] = KSW_NEG_INF;
-	}
-	if (with_cigar) {
-		mem2 = (uint8_t*)kmalloc(km, ((qlen + tlen - 1) * n_col_ + 1) * 16);
-		p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4);
-		off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int) * 2);
-		off_end = off + qlen + tlen - 1;
-	}
-
-	for (t = 0; t < qlen; ++t) qr[t] = query[qlen - 1 - t];
-	memcpy(sf, target, tlen);
-
-	for (r = 0, last_st = last_en = -1; r < qlen + tlen - 1; ++r) {
-		int st = 0, en = tlen - 1, st0, en0, st_, en_;
-		int8_t x1, x21, v1;
-		uint8_t *qrr = qr + (qlen - 1 - r);
-		int8_t *u8 = (int8_t*)u, *v8 = (int8_t*)v, *x8 = (int8_t*)x, *x28 = (int8_t*)x2;
-		__m128i x1_, x21_, v1_;
-		// find the boundaries
-		if (st < r - qlen + 1) st = r - qlen + 1;
-		if (en > r) en = r;
-		if (st < (r-wr+1)>>1) st = (r-wr+1)>>1; // take the ceil
-		if (en > (r+wl)>>1) en = (r+wl)>>1; // take the floor
-		if (st > en) {
-			ez->zdropped = 1;
-			break;
-		}
-		st0 = st, en0 = en;
-		st = st / 16 * 16, en = (en + 16) / 16 * 16 - 1;
-		// set boundary conditions
-		if (st > 0) {
-			if (st - 1 >= last_st && st - 1 <= last_en) {
-				x1 = x8[st - 1], x21 = x28[st - 1], v1 = v8[st - 1]; // (r-1,s-1) calculated in the last round
-			} else {
-				x1 = -q - e, x21 = -q2 - e2;
-				v1 = -q - e;
-			}
-		} else {
-			x1 = -q - e, x21 = -q2 - e2;
-			v1 = r == 0? -q - e : r < long_thres? -e : r == long_thres? long_diff : -e2;
-		}
-		if (en >= r) {
-			((int8_t*)y)[r] = -q - e, ((int8_t*)y2)[r] = -q2 - e2;
-			u8[r] = r == 0? -q - e : r < long_thres? -e : r == long_thres? long_diff : -e2;
-		}
-		// loop fission: set scores first
-		if (!(flag & KSW_EZ_GENERIC_SC)) {
-			for (t = st0; t <= en0; t += 16) {
-				__m128i sq, st, tmp, mask;
-				sq = _mm_loadu_si128((__m128i*)&sf[t]);
-				st = _mm_loadu_si128((__m128i*)&qrr[t]);
-				mask = _mm_or_si128(_mm_cmpeq_epi8(sq, m1_), _mm_cmpeq_epi8(st, m1_));
-				tmp = _mm_cmpeq_epi8(sq, st);
-#ifdef __SSE4_1__
-				tmp = _mm_blendv_epi8(sc_mis_, sc_mch_, tmp);
-#else
-				tmp = _mm_or_si128(_mm_andnot_si128(tmp, sc_mis_), _mm_and_si128(tmp, sc_mch_));
-#endif
-				tmp = _mm_andnot_si128(mask, tmp);
-				_mm_storeu_si128((__m128i*)((int8_t*)s + t), tmp);
-			}
-		} else {
-			for (t = st0; t <= en0; ++t)
-				((uint8_t*)s)[t] = mat[sf[t] * m + qrr[t]];
-		}
-		// core loop
-		x1_  = _mm_cvtsi32_si128((uint8_t)x1);
-		x21_ = _mm_cvtsi32_si128((uint8_t)x21);
-		v1_  = _mm_cvtsi32_si128((uint8_t)v1);
-		st_ = st / 16, en_ = en / 16;
-		assert(en_ - st_ + 1 <= n_col_);
-		if (!with_cigar) { // score only
-			for (t = st_; t <= en_; ++t) {
-				__m128i z, a, b, a2, b2, xt1, x2t1, vt1, ut, tmp;
-				__dp_code_block1;
-#ifdef __SSE4_1__
-				z = _mm_max_epi8(z, a);
-				z = _mm_max_epi8(z, b);
-				z = _mm_max_epi8(z, a2);
-				z = _mm_max_epi8(z, b2);
-				z = _mm_min_epi8(z, sc_mch_);
-				__dp_code_block2; // save u[] and v[]; update a, b, a2 and b2
-				_mm_store_si128(&x[t],  _mm_sub_epi8(_mm_max_epi8(a,  zero_), qe_));
-				_mm_store_si128(&y[t],  _mm_sub_epi8(_mm_max_epi8(b,  zero_), qe_));
-				_mm_store_si128(&x2[t], _mm_sub_epi8(_mm_max_epi8(a2, zero_), qe2_));
-				_mm_store_si128(&y2[t], _mm_sub_epi8(_mm_max_epi8(b2, zero_), qe2_));
-#else
-				tmp = _mm_cmpgt_epi8(a,  z);
-				z = _mm_or_si128(_mm_andnot_si128(tmp, z), _mm_and_si128(tmp, a));
-				tmp = _mm_cmpgt_epi8(b,  z);
-				z = _mm_or_si128(_mm_andnot_si128(tmp, z), _mm_and_si128(tmp, b));
-				tmp = _mm_cmpgt_epi8(a2, z);
-				z = _mm_or_si128(_mm_andnot_si128(tmp, z), _mm_and_si128(tmp, a2));
-				tmp = _mm_cmpgt_epi8(b2, z);
-				z = _mm_or_si128(_mm_andnot_si128(tmp, z), _mm_and_si128(tmp, b2));
-				tmp = _mm_cmplt_epi8(sc_mch_, z);
-				z = _mm_or_si128(_mm_and_si128(tmp, sc_mch_), _mm_andnot_si128(tmp, z));
-				__dp_code_block2;
-				tmp = _mm_cmpgt_epi8(a, zero_);
-				_mm_store_si128(&x[t],  _mm_sub_epi8(_mm_and_si128(tmp, a),  qe_));
-				tmp = _mm_cmpgt_epi8(b, zero_);
-				_mm_store_si128(&y[t],  _mm_sub_epi8(_mm_and_si128(tmp, b),  qe_));
-				tmp = _mm_cmpgt_epi8(a2, zero_);
-				_mm_store_si128(&x2[t], _mm_sub_epi8(_mm_and_si128(tmp, a2), qe2_));
-				tmp = _mm_cmpgt_epi8(b2, zero_);
-				_mm_store_si128(&y2[t], _mm_sub_epi8(_mm_and_si128(tmp, b2), qe2_));
-#endif
-			}
-		} else if (!(flag&KSW_EZ_RIGHT)) { // gap left-alignment
-			__m128i *pr = p + r * n_col_ - st_;
-			off[r] = st, off_end[r] = en;
-			for (t = st_; t <= en_; ++t) {
-				__m128i d, z, a, b, a2, b2, xt1, x2t1, vt1, ut, tmp;
-				__dp_code_block1;
-#ifdef __SSE4_1__
-				d = _mm_and_si128(_mm_cmpgt_epi8(a, z), _mm_set1_epi8(1));       // d = a  > z? 1 : 0
-				z = _mm_max_epi8(z, a);
-				d = _mm_blendv_epi8(d, _mm_set1_epi8(2), _mm_cmpgt_epi8(b,  z)); // d = b  > z? 2 : d
-				z = _mm_max_epi8(z, b);
-				d = _mm_blendv_epi8(d, _mm_set1_epi8(3), _mm_cmpgt_epi8(a2, z)); // d = a2 > z? 3 : d
-				z = _mm_max_epi8(z, a2);
-				d = _mm_blendv_epi8(d, _mm_set1_epi8(4), _mm_cmpgt_epi8(b2, z)); // d = a2 > z? 3 : d
-				z = _mm_max_epi8(z, b2);
-				z = _mm_min_epi8(z, sc_mch_);
-#else // we need to emulate SSE4.1 intrinsics _mm_max_epi8() and _mm_blendv_epi8()
-				tmp = _mm_cmpgt_epi8(a,  z);
-				d = _mm_and_si128(tmp, _mm_set1_epi8(1));
-				z = _mm_or_si128(_mm_andnot_si128(tmp, z), _mm_and_si128(tmp, a));
-				tmp = _mm_cmpgt_epi8(b,  z);
-				d = _mm_or_si128(_mm_andnot_si128(tmp, d), _mm_and_si128(tmp, _mm_set1_epi8(2)));
-				z = _mm_or_si128(_mm_andnot_si128(tmp, z), _mm_and_si128(tmp, b));
-				tmp = _mm_cmpgt_epi8(a2, z);
-				d = _mm_or_si128(_mm_andnot_si128(tmp, d), _mm_and_si128(tmp, _mm_set1_epi8(3)));
-				z = _mm_or_si128(_mm_andnot_si128(tmp, z), _mm_and_si128(tmp, a2));
-				tmp = _mm_cmpgt_epi8(b2, z);
-				d = _mm_or_si128(_mm_andnot_si128(tmp, d), _mm_and_si128(tmp, _mm_set1_epi8(4)));
-				z = _mm_or_si128(_mm_andnot_si128(tmp, z), _mm_and_si128(tmp, b2));
-				tmp = _mm_cmplt_epi8(sc_mch_, z);
-				z = _mm_or_si128(_mm_and_si128(tmp, sc_mch_), _mm_andnot_si128(tmp, z));
-#endif
-				__dp_code_block2;
-				tmp = _mm_cmpgt_epi8(a, zero_);
-				_mm_store_si128(&x[t],  _mm_sub_epi8(_mm_and_si128(tmp, a),  qe_));
-				d = _mm_or_si128(d, _mm_and_si128(tmp, _mm_set1_epi8(0x08))); // d = a > 0? 1<<3 : 0
-				tmp = _mm_cmpgt_epi8(b, zero_);
-				_mm_store_si128(&y[t],  _mm_sub_epi8(_mm_and_si128(tmp, b),  qe_));
-				d = _mm_or_si128(d, _mm_and_si128(tmp, _mm_set1_epi8(0x10))); // d = b > 0? 1<<4 : 0
-				tmp = _mm_cmpgt_epi8(a2, zero_);
-				_mm_store_si128(&x2[t], _mm_sub_epi8(_mm_and_si128(tmp, a2), qe2_));
-				d = _mm_or_si128(d, _mm_and_si128(tmp, _mm_set1_epi8(0x20))); // d = a > 0? 1<<5 : 0
-				tmp = _mm_cmpgt_epi8(b2, zero_);
-				_mm_store_si128(&y2[t], _mm_sub_epi8(_mm_and_si128(tmp, b2), qe2_));
-				d = _mm_or_si128(d, _mm_and_si128(tmp, _mm_set1_epi8(0x40))); // d = b > 0? 1<<6 : 0
-				_mm_store_si128(&pr[t], d);
-			}
-		} else { // gap right-alignment
-			__m128i *pr = p + r * n_col_ - st_;
-			off[r] = st, off_end[r] = en;
-			for (t = st_; t <= en_; ++t) {
-				__m128i d, z, a, b, a2, b2, xt1, x2t1, vt1, ut, tmp;
-				__dp_code_block1;
-#ifdef __SSE4_1__
-				d = _mm_andnot_si128(_mm_cmpgt_epi8(z, a), _mm_set1_epi8(1));    // d = z > a?  0 : 1
-				z = _mm_max_epi8(z, a);
-				d = _mm_blendv_epi8(_mm_set1_epi8(2), d, _mm_cmpgt_epi8(z, b));  // d = z > b?  d : 2
-				z = _mm_max_epi8(z, b);
-				d = _mm_blendv_epi8(_mm_set1_epi8(3), d, _mm_cmpgt_epi8(z, a2)); // d = z > a2? d : 3
-				z = _mm_max_epi8(z, a2);
-				d = _mm_blendv_epi8(_mm_set1_epi8(4), d, _mm_cmpgt_epi8(z, b2)); // d = z > b2? d : 4
-				z = _mm_max_epi8(z, b2);
-				z = _mm_min_epi8(z, sc_mch_);
-#else // we need to emulate SSE4.1 intrinsics _mm_max_epi8() and _mm_blendv_epi8()
-				tmp = _mm_cmpgt_epi8(z, a);
-				d = _mm_andnot_si128(tmp, _mm_set1_epi8(1));
-				z = _mm_or_si128(_mm_and_si128(tmp, z), _mm_andnot_si128(tmp, a));
-				tmp = _mm_cmpgt_epi8(z, b);
-				d = _mm_or_si128(_mm_and_si128(tmp, d), _mm_andnot_si128(tmp, _mm_set1_epi8(2)));
-				z = _mm_or_si128(_mm_and_si128(tmp, z), _mm_andnot_si128(tmp, b));
-				tmp = _mm_cmpgt_epi8(z, a2);
-				d = _mm_or_si128(_mm_and_si128(tmp, d), _mm_andnot_si128(tmp, _mm_set1_epi8(3)));
-				z = _mm_or_si128(_mm_and_si128(tmp, z), _mm_andnot_si128(tmp, a2));
-				tmp = _mm_cmpgt_epi8(z, b2);
-				d = _mm_or_si128(_mm_and_si128(tmp, d), _mm_andnot_si128(tmp, _mm_set1_epi8(4)));
-				z = _mm_or_si128(_mm_and_si128(tmp, z), _mm_andnot_si128(tmp, b2));
-				tmp = _mm_cmplt_epi8(sc_mch_, z);
-				z = _mm_or_si128(_mm_and_si128(tmp, sc_mch_), _mm_andnot_si128(tmp, z));
-#endif
-				__dp_code_block2;
-				tmp = _mm_cmpgt_epi8(zero_, a);
-				_mm_store_si128(&x[t],  _mm_sub_epi8(_mm_andnot_si128(tmp, a),  qe_));
-				d = _mm_or_si128(d, _mm_andnot_si128(tmp, _mm_set1_epi8(0x08))); // d = a > 0? 1<<3 : 0
-				tmp = _mm_cmpgt_epi8(zero_, b);
-				_mm_store_si128(&y[t],  _mm_sub_epi8(_mm_andnot_si128(tmp, b),  qe_));
-				d = _mm_or_si128(d, _mm_andnot_si128(tmp, _mm_set1_epi8(0x10))); // d = b > 0? 1<<4 : 0
-				tmp = _mm_cmpgt_epi8(zero_, a2);
-				_mm_store_si128(&x2[t], _mm_sub_epi8(_mm_andnot_si128(tmp, a2), qe2_));
-				d = _mm_or_si128(d, _mm_andnot_si128(tmp, _mm_set1_epi8(0x20))); // d = a > 0? 1<<5 : 0
-				tmp = _mm_cmpgt_epi8(zero_, b2);
-				_mm_store_si128(&y2[t], _mm_sub_epi8(_mm_andnot_si128(tmp, b2), qe2_));
-				d = _mm_or_si128(d, _mm_andnot_si128(tmp, _mm_set1_epi8(0x40))); // d = b > 0? 1<<6 : 0
-				_mm_store_si128(&pr[t], d);
-			}
-		}
-		if (!approx_max) { // find the exact max with a 32-bit score array
-			int32_t max_H, max_t;
-			// compute H[], max_H and max_t
-			if (r > 0) {
-				int32_t HH[4], tt[4], en1 = st0 + (en0 - st0) / 4 * 4, i;
-				__m128i max_H_, max_t_;
-				max_H = H[en0] = en0 > 0? H[en0-1] + u8[en0] : H[en0] + v8[en0]; // special casing the last element
-				max_t = en0;
-				max_H_ = _mm_set1_epi32(max_H);
-				max_t_ = _mm_set1_epi32(max_t);
-				for (t = st0; t < en1; t += 4) { // this implements: H[t]+=v8[t]-qe; if(H[t]>max_H) max_H=H[t],max_t=t;
-					__m128i H1, tmp, t_;
-					H1 = _mm_loadu_si128((__m128i*)&H[t]);
-					t_ = _mm_setr_epi32(v8[t], v8[t+1], v8[t+2], v8[t+3]);
-					H1 = _mm_add_epi32(H1, t_);
-					_mm_storeu_si128((__m128i*)&H[t], H1);
-					t_ = _mm_set1_epi32(t);
-					tmp = _mm_cmpgt_epi32(H1, max_H_);
-#ifdef __SSE4_1__
-					max_H_ = _mm_blendv_epi8(max_H_, H1, tmp);
-					max_t_ = _mm_blendv_epi8(max_t_, t_, tmp);
-#else
-					max_H_ = _mm_or_si128(_mm_and_si128(tmp, H1), _mm_andnot_si128(tmp, max_H_));
-					max_t_ = _mm_or_si128(_mm_and_si128(tmp, t_), _mm_andnot_si128(tmp, max_t_));
-#endif
-				}
-				_mm_storeu_si128((__m128i*)HH, max_H_);
-				_mm_storeu_si128((__m128i*)tt, max_t_);
-				for (i = 0; i < 4; ++i)
-					if (max_H < HH[i]) max_H = HH[i], max_t = tt[i] + i;
-				for (; t < en0; ++t) { // for the rest of values that haven't been computed with SSE
-					H[t] += (int32_t)v8[t];
-					if (H[t] > max_H)
-						max_H = H[t], max_t = t;
-				}
-			} else H[0] = v8[0] - qe, max_H = H[0], max_t = 0; // special casing r==0
-			// update ez
-			if (en0 == tlen - 1 && H[en0] > ez->mte)
-				ez->mte = H[en0], ez->mte_q = r - en;
-			if (r - st0 == qlen - 1 && H[st0] > ez->mqe)
-				ez->mqe = H[st0], ez->mqe_t = st0;
-			if (ksw_apply_zdrop(ez, 1, max_H, r, max_t, zdrop, e2)) break;
-			if (r == qlen + tlen - 2 && en0 == tlen - 1)
-				ez->score = H[tlen - 1];
-		} else { // find approximate max; Z-drop might be inaccurate, too.
-			if (r > 0) {
-				if (last_H0_t >= st0 && last_H0_t <= en0 && last_H0_t + 1 >= st0 && last_H0_t + 1 <= en0) {
-					int32_t d0 = v8[last_H0_t];
-					int32_t d1 = u8[last_H0_t + 1];
-					if (d0 > d1) H0 += d0;
-					else H0 += d1, ++last_H0_t;
-				} else if (last_H0_t >= st0 && last_H0_t <= en0) {
-					H0 += v8[last_H0_t];
-				} else {
-					++last_H0_t, H0 += u8[last_H0_t];
-				}
-			} else H0 = v8[0] - qe, last_H0_t = 0;
-			if ((flag & KSW_EZ_APPROX_DROP) && ksw_apply_zdrop(ez, 1, H0, r, last_H0_t, zdrop, e2)) break;
-			if (r == qlen + tlen - 2 && en0 == tlen - 1)
-				ez->score = H0;
-		}
-		last_st = st, last_en = en;
-		//for (t = st0; t <= en0; ++t) printf("(%d,%d)\t(%d,%d,%d,%d)\t%d\n", r, t, ((int8_t*)u)[t], ((int8_t*)v)[t], ((int8_t*)x)[t], ((int8_t*)y)[t], H[t]); // for debugging
-	}
-	kfree(km, mem);
-	if (!approx_max) kfree(km, H);
-	if (with_cigar) { // backtrack
-		int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
-		if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY))
-			ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
-		else if (ez->max_t >= 0 && ez->max_q >= 0)
-			ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
-		kfree(km, mem2); kfree(km, off);
-	}
-}
-#endif // __SSE2__

ksw2_exts2_sse.c

@@ -1,371 +0,0 @@
-#include <string.h>
-#include <stdio.h>
-#include <assert.h>
-#include "ksw2.h"
-
-#ifdef __SSE2__
-#include <emmintrin.h>
-
-#ifdef KSW_SSE2_ONLY
-#undef __SSE4_1__
-#endif
-
-#ifdef __SSE4_1__
-#include <smmintrin.h>
-#endif
-
-#ifdef KSW_CPU_DISPATCH
-#ifdef __SSE4_1__
-void ksw_exts2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
-				   int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez)
-#else
-void ksw_exts2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
-				   int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez)
-#endif
-#else
-void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
-				   int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez)
-#endif // ~KSW_CPU_DISPATCH
-{
-#define __dp_code_block1 \
-	z = _mm_load_si128(&s[t]); \
-	xt1 = _mm_load_si128(&x[t]);                     /* xt1 <- x[r-1][t..t+15] */ \
-	tmp = _mm_srli_si128(xt1, 15);                   /* tmp <- x[r-1][t+15] */ \
-	xt1 = _mm_or_si128(_mm_slli_si128(xt1, 1), x1_); /* xt1 <- x[r-1][t-1..t+14] */ \
-	x1_ = tmp; \
-	vt1 = _mm_load_si128(&v[t]);                     /* vt1 <- v[r-1][t..t+15] */ \
-	tmp = _mm_srli_si128(vt1, 15);                   /* tmp <- v[r-1][t+15] */ \
-	vt1 = _mm_or_si128(_mm_slli_si128(vt1, 1), v1_); /* vt1 <- v[r-1][t-1..t+14] */ \
-	v1_ = tmp; \
-	a = _mm_add_epi8(xt1, vt1);                      /* a <- x[r-1][t-1..t+14] + v[r-1][t-1..t+14] */ \
-	ut = _mm_load_si128(&u[t]);                      /* ut <- u[t..t+15] */ \
-	b = _mm_add_epi8(_mm_load_si128(&y[t]), ut);     /* b <- y[r-1][t..t+15] + u[r-1][t..t+15] */ \
-	x2t1= _mm_load_si128(&x2[t]); \
-	tmp = _mm_srli_si128(x2t1, 15); \
-	x2t1= _mm_or_si128(_mm_slli_si128(x2t1, 1), x21_); \
-	x21_= tmp; \
-	a2  = _mm_add_epi8(x2t1, vt1); \
-	a2a = _mm_add_epi8(a2, _mm_load_si128(&acceptor[t]));
-
-#define __dp_code_block2 \
-	_mm_store_si128(&u[t], _mm_sub_epi8(z, vt1));    /* u[r][t..t+15] <- z - v[r-1][t-1..t+14] */ \
-	_mm_store_si128(&v[t], _mm_sub_epi8(z, ut));     /* v[r][t..t+15] <- z - u[r-1][t..t+15] */ \
-	tmp = _mm_sub_epi8(z, q_); \
-	a = _mm_sub_epi8(a, tmp); \
-	b = _mm_sub_epi8(b, tmp); \
-	a2= _mm_sub_epi8(a2, _mm_sub_epi8(z, q2_));
-
-	int r, t, qe = q + e, n_col_, *off = 0, *off_end = 0, tlen_, qlen_, last_st, last_en, max_sc, min_sc, long_thres, long_diff;
-	int with_cigar = !(flag&KSW_EZ_SCORE_ONLY), approx_max = !!(flag&KSW_EZ_APPROX_MAX);
-	int32_t *H = 0, H0 = 0, last_H0_t = 0;
-	uint8_t *qr, *sf, *mem, *mem2 = 0;
-	__m128i q_, q2_, qe_, zero_, sc_mch_, sc_mis_, m1_;
-	__m128i *u, *v, *x, *y, *x2, *s, *p = 0, *donor, *acceptor;
-
-	ksw_reset_extz(ez);
-	if (m <= 1 || qlen <= 0 || tlen <= 0 || q2 <= q + e) return;
-
-	zero_   = _mm_set1_epi8(0);
-	q_      = _mm_set1_epi8(q);
-	q2_     = _mm_set1_epi8(q2);
-	qe_     = _mm_set1_epi8(q + e);
-	sc_mch_ = _mm_set1_epi8(mat[0]);
-	sc_mis_ = _mm_set1_epi8(mat[1]);
-	m1_     = _mm_set1_epi8(m - 1); // wildcard
-
-	tlen_ = (tlen + 15) / 16;
-	n_col_ = ((qlen < tlen? qlen : tlen) + 15) / 16 + 1;
-	qlen_ = (qlen + 15) / 16;
-	for (t = 1, max_sc = mat[0], min_sc = mat[1]; t < m * m; ++t) {
-		max_sc = max_sc > mat[t]? max_sc : mat[t];
-		min_sc = min_sc < mat[t]? min_sc : mat[t];
-	}
-	if (-min_sc > 2 * (q + e)) return; // otherwise, we won't see any mismatches
-
-	long_thres = (q2 - q) / e - 1;
-	if (q2 > q + e + long_thres * e)
-		++long_thres;
-	long_diff = long_thres * e - (q2 - q);
-
-	mem = (uint8_t*)kcalloc(km, tlen_ * 9 + qlen_ + 1, 16);
-	u = (__m128i*)(((size_t)mem + 15) >> 4 << 4); // 16-byte aligned
-	v = u + tlen_, x = v + tlen_, y = x + tlen_, x2 = y + tlen_;
-	donor = x2 + tlen_, acceptor = donor + tlen_;
-	s = acceptor + tlen_, sf = (uint8_t*)(s + tlen_), qr = sf + tlen_ * 16;
-	memset(u,  -q - e,  tlen_ * 16 * 4); // this set u, v, x, y (because they are in the same array)
-	memset(x2, -q2,     tlen_ * 16);
-	if (!approx_max) {
-		H = (int32_t*)kmalloc(km, tlen_ * 16 * 4);
-		for (t = 0; t < tlen_ * 16; ++t) H[t] = KSW_NEG_INF;
-	}
-	if (with_cigar) {
-		mem2 = (uint8_t*)kmalloc(km, ((qlen + tlen - 1) * n_col_ + 1) * 16);
-		p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4);
-		off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int) * 2);
-		off_end = off + qlen + tlen - 1;
-	}
-
-	for (t = 0; t < qlen; ++t) qr[t] = query[qlen - 1 - t];
-	memcpy(sf, target, tlen);
-
-	// set the donor and acceptor arrays. TODO: this assumes 0/1/2/3 encoding!
-	if (flag & (KSW_EZ_SPLICE_FOR|KSW_EZ_SPLICE_REV)) {
-		memset(donor, -noncan, tlen_ * 16);
-		for (t = 0; t < tlen - 2; ++t) {
-			int is_can = 0; // is a canonical site
-			if ((flag & KSW_EZ_SPLICE_FOR) && target[t+1] == 2 && target[t+2] == 3) is_can = 1;
-			if ((flag & KSW_EZ_SPLICE_REV) && target[t+1] == 1 && target[t+2] == 3) is_can = 1;
-			if (is_can) ((int8_t*)donor)[t] = 0;
-		}
-		memset(acceptor, -noncan, tlen_ * 16);
-		for (t = 2; t < tlen; ++t) {
-			int is_can = 0;
-			if ((flag & KSW_EZ_SPLICE_FOR) && target[t-1] == 0 && target[t] == 2) is_can = 1;
-			if ((flag & KSW_EZ_SPLICE_REV) && target[t-1] == 0 && target[t] == 1) is_can = 1;
-			if (is_can) ((int8_t*)acceptor)[t] = 0;
-		}
-	}
-
-	for (r = 0, last_st = last_en = -1; r < qlen + tlen - 1; ++r) {
-		int st = 0, en = tlen - 1, st0, en0, st_, en_;
-		int8_t x1, x21, v1, *u8 = (int8_t*)u, *v8 = (int8_t*)v;
-		uint8_t *qrr = qr + (qlen - 1 - r);
-		__m128i x1_, x21_, v1_;
-		// find the boundaries
-		if (st < r - qlen + 1) st = r - qlen + 1;
-		if (en > r) en = r;
-		st0 = st, en0 = en;
-		st = st / 16 * 16, en = (en + 16) / 16 * 16 - 1;
-		// set boundary conditions
-		if (st > 0) {
-			if (st - 1 >= last_st && st - 1 <= last_en)
-				x1 = ((int8_t*)x)[st - 1], x21 = ((int8_t*)x2)[st - 1], v1 = v8[st - 1]; // (r-1,s-1) calculated in the last round
-			else x1 = -q - e, x21 = -q2, v1 = -q - e;
-		} else {
-			x1 = -q - e, x21 = -q2;
-			v1 = r == 0? -q - e : r < long_thres? -e : r == long_thres? long_diff : 0;
-		}
-		if (en >= r) {
-			((int8_t*)y)[r] = -q - e;
-			u8[r] = r == 0? -q - e : r < long_thres? -e : r == long_thres? long_diff : 0;
-		}
-		// loop fission: set scores first
-		if (!(flag & KSW_EZ_GENERIC_SC)) {
-			for (t = st0; t <= en0; t += 16) {
-				__m128i sq, st, tmp, mask;
-				sq = _mm_loadu_si128((__m128i*)&sf[t]);
-				st = _mm_loadu_si128((__m128i*)&qrr[t]);
-				mask = _mm_or_si128(_mm_cmpeq_epi8(sq, m1_), _mm_cmpeq_epi8(st, m1_));
-				tmp = _mm_cmpeq_epi8(sq, st);
-#ifdef __SSE4_1__
-				tmp = _mm_blendv_epi8(sc_mis_, sc_mch_, tmp);
-#else
-				tmp = _mm_or_si128(_mm_andnot_si128(tmp, sc_mis_), _mm_and_si128(tmp, sc_mch_));
-#endif
-				tmp = _mm_andnot_si128(mask, tmp);
-				_mm_storeu_si128((__m128i*)((int8_t*)s + t), tmp);
-			}
-		} else {
-			for (t = st0; t <= en0; ++t)
-				((uint8_t*)s)[t] = mat[sf[t] * m + qrr[t]];
-		}
-		// core loop
-		x1_  = _mm_cvtsi32_si128((uint8_t)x1);
-		x21_ = _mm_cvtsi32_si128((uint8_t)x21);
-		v1_  = _mm_cvtsi32_si128((uint8_t)v1);
-		st_ = st / 16, en_ = en / 16;
-		assert(en_ - st_ + 1 <= n_col_);
-		if (!with_cigar) { // score only
-			for (t = st_; t <= en_; ++t) {
-				__m128i z, a, b, a2, a2a, xt1, x2t1, vt1, ut, tmp;
-				__dp_code_block1;
-#ifdef __SSE4_1__
-				z = _mm_max_epi8(z, a);
-				z = _mm_max_epi8(z, b);
-				z = _mm_max_epi8(z, a2a);
-				__dp_code_block2; // save u[] and v[]; update a, b and a2
-				_mm_store_si128(&x[t],  _mm_sub_epi8(_mm_max_epi8(a,  zero_), qe_));
-				_mm_store_si128(&y[t],  _mm_sub_epi8(_mm_max_epi8(b,  zero_), qe_));
-				tmp = _mm_load_si128(&donor[t]);
-				_mm_store_si128(&x2[t], _mm_sub_epi8(_mm_max_epi8(a2, tmp), q2_));
-#else
-				tmp = _mm_cmpgt_epi8(a,  z);
-				z = _mm_or_si128(_mm_andnot_si128(tmp, z), _mm_and_si128(tmp, a));
-				tmp = _mm_cmpgt_epi8(b,  z);
-				z = _mm_or_si128(_mm_andnot_si128(tmp, z), _mm_and_si128(tmp, b));
-				tmp = _mm_cmpgt_epi8(a2a, z);
-				z = _mm_or_si128(_mm_andnot_si128(tmp, z), _mm_and_si128(tmp, a2a));
-				__dp_code_block2;
-				tmp = _mm_cmpgt_epi8(a, zero_);
-				_mm_store_si128(&x[t],  _mm_sub_epi8(_mm_and_si128(tmp, a),  qe_));
-				tmp = _mm_cmpgt_epi8(b, zero_);
-				_mm_store_si128(&y[t],  _mm_sub_epi8(_mm_and_si128(tmp, b),  qe_));
-				tmp = _mm_load_si128(&donor[t]); // TODO: check if this is correct
-				tmp = _mm_cmpgt_epi8(a2, tmp);
-				tmp = _mm_or_si128(_mm_andnot_si128(tmp, tmp), _mm_and_si128(tmp, a2));
-				_mm_store_si128(&x2[t], _mm_sub_epi8(tmp, q2_));
-#endif
-			}
-		} else if (!(flag&KSW_EZ_RIGHT)) { // gap left-alignment
-			__m128i *pr = p + r * n_col_ - st_;
-			off[r] = st, off_end[r] = en;
-			for (t = st_; t <= en_; ++t) {
-				__m128i d, z, a, b, a2, a2a, xt1, x2t1, vt1, ut, tmp, tmp2;
-				__dp_code_block1;
-#ifdef __SSE4_1__
-				d = _mm_and_si128(_mm_cmpgt_epi8(a, z), _mm_set1_epi8(1));       // d = a  > z? 1 : 0
-				z = _mm_max_epi8(z, a);
-				d = _mm_blendv_epi8(d, _mm_set1_epi8(2), _mm_cmpgt_epi8(b,  z)); // d = b  > z? 2 : d
-				z = _mm_max_epi8(z, b);
-				d = _mm_blendv_epi8(d, _mm_set1_epi8(3), _mm_cmpgt_epi8(a2a, z)); // d = a2 > z? 3 : d
-				z = _mm_max_epi8(z, a2a);
-#else // we need to emulate SSE4.1 intrinsics _mm_max_epi8() and _mm_blendv_epi8()
-				tmp = _mm_cmpgt_epi8(a,  z);
-				d = _mm_and_si128(tmp, _mm_set1_epi8(1));
-				z = _mm_or_si128(_mm_andnot_si128(tmp, z), _mm_and_si128(tmp, a));
-				tmp = _mm_cmpgt_epi8(b,  z);
-				d = _mm_or_si128(_mm_andnot_si128(tmp, d), _mm_and_si128(tmp, _mm_set1_epi8(2)));
-				z = _mm_or_si128(_mm_andnot_si128(tmp, z), _mm_and_si128(tmp, b));
-				tmp = _mm_cmpgt_epi8(a2a, z);
-				d = _mm_or_si128(_mm_andnot_si128(tmp, d), _mm_and_si128(tmp, _mm_set1_epi8(3)));
-				z = _mm_or_si128(_mm_andnot_si128(tmp, z), _mm_and_si128(tmp, a2a));
-#endif
-				__dp_code_block2;
-				tmp = _mm_cmpgt_epi8(a, zero_);
-				_mm_store_si128(&x[t],  _mm_sub_epi8(_mm_and_si128(tmp, a),  qe_));
-				d = _mm_or_si128(d, _mm_and_si128(tmp, _mm_set1_epi8(0x08))); // d = a > 0? 1<<3 : 0
-				tmp = _mm_cmpgt_epi8(b, zero_);
-				_mm_store_si128(&y[t],  _mm_sub_epi8(_mm_and_si128(tmp, b),  qe_));
-				d = _mm_or_si128(d, _mm_and_si128(tmp, _mm_set1_epi8(0x10))); // d = b > 0? 1<<4 : 0
-
-				tmp2 = _mm_load_si128(&donor[t]);
-				tmp = _mm_cmpgt_epi8(a2, tmp2);
-#ifdef __SSE4_1__
-				tmp2 = _mm_max_epi8(a2, tmp2);
-#else
-				tmp2 = _mm_or_si128(_mm_andnot_si128(tmp, tmp2), _mm_and_si128(tmp, a2));
-#endif
-				_mm_store_si128(&x2[t], _mm_sub_epi8(tmp2, q2_));
-				d = _mm_or_si128(d, _mm_and_si128(tmp, _mm_set1_epi8(0x20)));
-				_mm_store_si128(&pr[t], d);
-			}
-		} else { // gap right-alignment
-			__m128i *pr = p + r * n_col_ - st_;
-			off[r] = st, off_end[r] = en;
-			for (t = st_; t <= en_; ++t) {
-				__m128i d, z, a, b, a2, a2a, xt1, x2t1, vt1, ut, tmp, tmp2;
-				__dp_code_block1;
-#ifdef __SSE4_1__
-				d = _mm_andnot_si128(_mm_cmpgt_epi8(z, a), _mm_set1_epi8(1));    // d = z > a?  0 : 1
-				z = _mm_max_epi8(z, a);
-				d = _mm_blendv_epi8(_mm_set1_epi8(2), d, _mm_cmpgt_epi8(z, b));  // d = z > b?  d : 2
-				z = _mm_max_epi8(z, b);
-				d = _mm_blendv_epi8(_mm_set1_epi8(3), d, _mm_cmpgt_epi8(z, a2a)); // d = z > a2? d : 3
-				z = _mm_max_epi8(z, a2a);
-#else // we need to emulate SSE4.1 intrinsics _mm_max_epi8() and _mm_blendv_epi8()
-				tmp = _mm_cmpgt_epi8(z, a);
-				d = _mm_andnot_si128(tmp, _mm_set1_epi8(1));
-				z = _mm_or_si128(_mm_and_si128(tmp, z), _mm_andnot_si128(tmp, a));
-				tmp = _mm_cmpgt_epi8(z, b);
-				d = _mm_or_si128(_mm_and_si128(tmp, d), _mm_andnot_si128(tmp, _mm_set1_epi8(2)));
-				z = _mm_or_si128(_mm_and_si128(tmp, z), _mm_andnot_si128(tmp, b));
-				tmp = _mm_cmpgt_epi8(z, a2a);
-				d = _mm_or_si128(_mm_and_si128(tmp, d), _mm_andnot_si128(tmp, _mm_set1_epi8(3)));
-				z = _mm_or_si128(_mm_and_si128(tmp, z), _mm_andnot_si128(tmp, a2a));
-#endif
-				__dp_code_block2;
-				tmp = _mm_cmpgt_epi8(zero_, a);
-				_mm_store_si128(&x[t],  _mm_sub_epi8(_mm_andnot_si128(tmp, a),  qe_));
-				d = _mm_or_si128(d, _mm_andnot_si128(tmp, _mm_set1_epi8(0x08))); // d = a > 0? 1<<3 : 0
-				tmp = _mm_cmpgt_epi8(zero_, b);
-				_mm_store_si128(&y[t],  _mm_sub_epi8(_mm_andnot_si128(tmp, b),  qe_));
-				d = _mm_or_si128(d, _mm_andnot_si128(tmp, _mm_set1_epi8(0x10))); // d = b > 0? 1<<4 : 0
-
-				tmp2 = _mm_load_si128(&donor[t]);
-				tmp = _mm_cmpgt_epi8(tmp2, a2);
-#ifdef __SSE4_1__
-				tmp2 = _mm_max_epi8(tmp2, a2);
-#else
-				tmp2 = _mm_or_si128(_mm_andnot_si128(tmp, a2), _mm_and_si128(tmp, tmp2));
-#endif
-				_mm_store_si128(&x2[t], _mm_sub_epi8(tmp2, q2_));
-				d = _mm_or_si128(d, _mm_andnot_si128(tmp, _mm_set1_epi8(0x20))); // d = a > 0? 1<<5 : 0
-				_mm_store_si128(&pr[t], d);
-			}
-		}
-		if (!approx_max) { // find the exact max with a 32-bit score array
-			int32_t max_H, max_t;
-			// compute H[], max_H and max_t
-			if (r > 0) {
-				int32_t HH[4], tt[4], en1 = st0 + (en0 - st0) / 4 * 4, i;
-				__m128i max_H_, max_t_;
-				max_H = H[en0] = en0 > 0? H[en0-1] + u8[en0] : H[en0] + v8[en0]; // special casing the last element
-				max_t = en0;
-				max_H_ = _mm_set1_epi32(max_H);
-				max_t_ = _mm_set1_epi32(max_t);
-				for (t = st0; t < en1; t += 4) { // this implements: H[t]+=v8[t]-qe; if(H[t]>max_H) max_H=H[t],max_t=t;
-					__m128i H1, tmp, t_;
-					H1 = _mm_loadu_si128((__m128i*)&H[t]);
-					t_ = _mm_setr_epi32(v8[t], v8[t+1], v8[t+2], v8[t+3]);
-					H1 = _mm_add_epi32(H1, t_);
-					_mm_storeu_si128((__m128i*)&H[t], H1);
-					t_ = _mm_set1_epi32(t);
-					tmp = _mm_cmpgt_epi32(H1, max_H_);
-#ifdef __SSE4_1__
-					max_H_ = _mm_blendv_epi8(max_H_, H1, tmp);
-					max_t_ = _mm_blendv_epi8(max_t_, t_, tmp);
-#else
-					max_H_ = _mm_or_si128(_mm_and_si128(tmp, H1), _mm_andnot_si128(tmp, max_H_));
-					max_t_ = _mm_or_si128(_mm_and_si128(tmp, t_), _mm_andnot_si128(tmp, max_t_));
-#endif
-				}
-				_mm_storeu_si128((__m128i*)HH, max_H_);
-				_mm_storeu_si128((__m128i*)tt, max_t_);
-				for (i = 0; i < 4; ++i)
-					if (max_H < HH[i]) max_H = HH[i], max_t = tt[i] + i;
-				for (; t < en0; ++t) { // for the rest of values that haven't been computed with SSE
-					H[t] += (int32_t)v8[t];
-					if (H[t] > max_H)
-						max_H = H[t], max_t = t;
-				}
-			} else H[0] = v8[0] - qe, max_H = H[0], max_t = 0; // special casing r==0
-			// update ez
-			if (en0 == tlen - 1 && H[en0] > ez->mte)
-				ez->mte = H[en0], ez->mte_q = r - en;
-			if (r - st0 == qlen - 1 && H[st0] > ez->mqe)
-				ez->mqe = H[st0], ez->mqe_t = st0;
-			if (ksw_apply_zdrop(ez, 1, max_H, r, max_t, zdrop, 0)) break;
-			if (r == qlen + tlen - 2 && en0 == tlen - 1)
-				ez->score = H[tlen - 1];
-		} else { // find approximate max; Z-drop might be inaccurate, too.
-			if (r > 0) {
-				if (last_H0_t >= st0 && last_H0_t <= en0 && last_H0_t + 1 >= st0 && last_H0_t + 1 <= en0) {
-					int32_t d0 = v8[last_H0_t];
-					int32_t d1 = u8[last_H0_t + 1];
-					if (d0 > d1) H0 += d0;
-					else H0 += d1, ++last_H0_t;
-				} else if (last_H0_t >= st0 && last_H0_t <= en0) {
-					H0 += v8[last_H0_t];
-				} else {
-					++last_H0_t, H0 += u8[last_H0_t];
-				}
-			} else H0 = v8[0] - qe, last_H0_t = 0;
-			if ((flag & KSW_EZ_APPROX_DROP) && ksw_apply_zdrop(ez, 1, H0, r, last_H0_t, zdrop, 0)) break;
-			if (r == qlen + tlen - 2 && en0 == tlen - 1)
-				ez->score = H0;
-		}
-		last_st = st, last_en = en;
-		//for (t = st0; t <= en0; ++t) printf("(%d,%d)\t(%d,%d,%d,%d)\t%d\n", r, t, ((int8_t*)u)[t], ((int8_t*)v)[t], ((int8_t*)x)[t], ((int8_t*)y)[t], H[t]); // for debugging
-	}
-	kfree(km, mem);
-	if (!approx_max) kfree(km, H);
-	if (with_cigar) { // backtrack
-		int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
-		if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY))
-			ksw_backtrack(km, 1, rev_cigar, 1, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
-		else if (ez->max_t >= 0 && ez->max_q >= 0)
-			ksw_backtrack(km, 1, rev_cigar, 1, (uint8_t*)p, off, off_end, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
-		kfree(km, mem2); kfree(km, off);
-	}
-}
-#endif // __SSE2__

ksw2_extz2_sse.c

@@ -1,299 +0,0 @@
-#include <string.h>
-#include <assert.h>
-#include "ksw2.h"
-
-#ifdef __SSE2__
-#include <emmintrin.h>
-
-#ifdef KSW_SSE2_ONLY
-#undef __SSE4_1__
-#endif
-
-#ifdef __SSE4_1__
-#include <smmintrin.h>
-#endif
-
-#ifdef KSW_CPU_DISPATCH
-#ifdef __SSE4_1__
-void ksw_extz2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int flag, ksw_extz_t *ez)
-#else
-void ksw_extz2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int flag, ksw_extz_t *ez)
-#endif
-#else
-void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int flag, ksw_extz_t *ez)
-#endif // ~KSW_CPU_DISPATCH
-{
-#define __dp_code_block1 \
-	z = _mm_add_epi8(_mm_load_si128(&s[t]), qe2_); \
-	xt1 = _mm_load_si128(&x[t]);                     /* xt1 <- x[r-1][t..t+15] */ \
-	tmp = _mm_srli_si128(xt1, 15);                   /* tmp <- x[r-1][t+15] */ \
-	xt1 = _mm_or_si128(_mm_slli_si128(xt1, 1), x1_); /* xt1 <- x[r-1][t-1..t+14] */ \
-	x1_ = tmp; \
-	vt1 = _mm_load_si128(&v[t]);                     /* vt1 <- v[r-1][t..t+15] */ \
-	tmp = _mm_srli_si128(vt1, 15);                   /* tmp <- v[r-1][t+15] */ \
-	vt1 = _mm_or_si128(_mm_slli_si128(vt1, 1), v1_); /* vt1 <- v[r-1][t-1..t+14] */ \
-	v1_ = tmp; \
-	a = _mm_add_epi8(xt1, vt1);                      /* a <- x[r-1][t-1..t+14] + v[r-1][t-1..t+14] */ \
-	ut = _mm_load_si128(&u[t]);                      /* ut <- u[t..t+15] */ \
-	b = _mm_add_epi8(_mm_load_si128(&y[t]), ut);     /* b <- y[r-1][t..t+15] + u[r-1][t..t+15] */
-
-#define __dp_code_block2 \
-	z = _mm_max_epu8(z, b);                          /* z = max(z, b); this works because both are non-negative */ \
-	z = _mm_min_epu8(z, max_sc_); \
-	_mm_store_si128(&u[t], _mm_sub_epi8(z, vt1));    /* u[r][t..t+15] <- z - v[r-1][t-1..t+14] */ \
-	_mm_store_si128(&v[t], _mm_sub_epi8(z, ut));     /* v[r][t..t+15] <- z - u[r-1][t..t+15] */ \
-	z = _mm_sub_epi8(z, q_); \
-	a = _mm_sub_epi8(a, z); \
-	b = _mm_sub_epi8(b, z);
-
-	int r, t, qe = q + e, n_col_, *off = 0, *off_end = 0, tlen_, qlen_, last_st, last_en, wl, wr, max_sc, min_sc;
-	int with_cigar = !(flag&KSW_EZ_SCORE_ONLY), approx_max = !!(flag&KSW_EZ_APPROX_MAX);
-	int32_t *H = 0, H0 = 0, last_H0_t = 0;
-	uint8_t *qr, *sf, *mem, *mem2 = 0;
-	__m128i q_, qe2_, zero_, flag1_, flag2_, flag8_, flag16_, sc_mch_, sc_mis_, m1_, max_sc_;
-	__m128i *u, *v, *x, *y, *s, *p = 0;
-
-	ksw_reset_extz(ez);
-	if (m <= 0 || qlen <= 0 || tlen <= 0) return;
-
-	zero_   = _mm_set1_epi8(0);
-	q_      = _mm_set1_epi8(q);
-	qe2_    = _mm_set1_epi8((q + e) * 2);
-	flag1_  = _mm_set1_epi8(1);
-	flag2_  = _mm_set1_epi8(2);
-	flag8_  = _mm_set1_epi8(0x08);
-	flag16_ = _mm_set1_epi8(0x10);
-	sc_mch_ = _mm_set1_epi8(mat[0]);
-	sc_mis_ = _mm_set1_epi8(mat[1]);
-	m1_     = _mm_set1_epi8(m - 1); // wildcard
-	max_sc_ = _mm_set1_epi8(mat[0] + (q + e) * 2);
-
-	if (w < 0) w = tlen > qlen? tlen : qlen;
-	wl = wr = w;
-	tlen_ = (tlen + 15) / 16;
-	n_col_ = qlen < tlen? qlen : tlen;
-	n_col_ = ((n_col_ < w + 1? n_col_ : w + 1) + 15) / 16 + 1;
-	qlen_ = (qlen + 15) / 16;
-	for (t = 1, max_sc = mat[0], min_sc = mat[1]; t < m * m; ++t) {
-		max_sc = max_sc > mat[t]? max_sc : mat[t];
-		min_sc = min_sc < mat[t]? min_sc : mat[t];
-	}
-	if (-min_sc > 2 * (q + e)) return; // otherwise, we won't see any mismatches
-
-	mem = (uint8_t*)kcalloc(km, tlen_ * 6 + qlen_ + 1, 16);
-	u = (__m128i*)(((size_t)mem + 15) >> 4 << 4); // 16-byte aligned
-	v = u + tlen_, x = v + tlen_, y = x + tlen_, s = y + tlen_, sf = (uint8_t*)(s + tlen_), qr = sf + tlen_ * 16;
-	if (!approx_max) {
-		H = (int32_t*)kmalloc(km, tlen_ * 16 * 4);
-		for (t = 0; t < tlen_ * 16; ++t) H[t] = KSW_NEG_INF;
-	}
-	if (with_cigar) {
-		mem2 = (uint8_t*)kmalloc(km, ((qlen + tlen - 1) * n_col_ + 1) * 16);
-		p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4);
-		off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int) * 2);
-		off_end = off + qlen + tlen - 1;
-	}
-
-	for (t = 0; t < qlen; ++t) qr[t] = query[qlen - 1 - t];
-	memcpy(sf, target, tlen);
-
-	for (r = 0, last_st = last_en = -1; r < qlen + tlen - 1; ++r) {
-		int st = 0, en = tlen - 1, st0, en0, st_, en_;
-		int8_t x1, v1;
-		uint8_t *qrr = qr + (qlen - 1 - r), *u8 = (uint8_t*)u, *v8 = (uint8_t*)v;
-		__m128i x1_, v1_;
-		// find the boundaries
-		if (st < r - qlen + 1) st = r - qlen + 1;
-		if (en > r) en = r;
-		if (st < (r-wr+1)>>1) st = (r-wr+1)>>1; // take the ceil
-		if (en > (r+wl)>>1) en = (r+wl)>>1; // take the floor
-		if (st > en) {
-			ez->zdropped = 1;
-			break;
-		}
-		st0 = st, en0 = en;
-		st = st / 16 * 16, en = (en + 16) / 16 * 16 - 1;
-		// set boundary conditions
-		if (st > 0) {
-			if (st - 1 >= last_st && st - 1 <= last_en)
-				x1 = ((uint8_t*)x)[st - 1], v1 = v8[st - 1]; // (r-1,s-1) calculated in the last round
-			else x1 = v1 = 0; // not calculated; set to zeros
-		} else x1 = 0, v1 = r? q : 0;
-		if (en >= r) ((uint8_t*)y)[r] = 0, u8[r] = r? q : 0;
-		// loop fission: set scores first
-		if (!(flag & KSW_EZ_GENERIC_SC)) {
-			for (t = st0; t <= en0; t += 16) {
-				__m128i sq, st, tmp, mask;
-				sq = _mm_loadu_si128((__m128i*)&sf[t]);
-				st = _mm_loadu_si128((__m128i*)&qrr[t]);
-				mask = _mm_or_si128(_mm_cmpeq_epi8(sq, m1_), _mm_cmpeq_epi8(st, m1_));
-				tmp = _mm_cmpeq_epi8(sq, st);
-#ifdef __SSE4_1__
-				tmp = _mm_blendv_epi8(sc_mis_, sc_mch_, tmp);
-#else
-				tmp = _mm_or_si128(_mm_andnot_si128(tmp, sc_mis_), _mm_and_si128(tmp, sc_mch_));
-#endif
-				tmp = _mm_andnot_si128(mask, tmp);
-				_mm_storeu_si128((__m128i*)((uint8_t*)s + t), tmp);
-			}
-		} else {
-			for (t = st0; t <= en0; ++t)
-				((uint8_t*)s)[t] = mat[sf[t] * m + qrr[t]];
-		}
-		// core loop
-		x1_ = _mm_cvtsi32_si128(x1);
-		v1_ = _mm_cvtsi32_si128(v1);
-		st_ = st / 16, en_ = en / 16;
-		assert(en_ - st_ + 1 <= n_col_);
-		if (!with_cigar) { // score only
-			for (t = st_; t <= en_; ++t) {
-				__m128i z, a, b, xt1, vt1, ut, tmp;
-				__dp_code_block1;
-#ifdef __SSE4_1__
-				z = _mm_max_epi8(z, a);                          // z = z > a? z : a (signed)
-#else // we need to emulate SSE4.1 intrinsics _mm_max_epi8()
-				z = _mm_and_si128(z, _mm_cmpgt_epi8(z, zero_));  // z = z > 0? z : 0;
-				z = _mm_max_epu8(z, a);                          // z = max(z, a); this works because both are non-negative
-#endif
-				__dp_code_block2;
-#ifdef __SSE4_1__
-				_mm_store_si128(&x[t], _mm_max_epi8(a, zero_));
-				_mm_store_si128(&y[t], _mm_max_epi8(b, zero_));
-#else
-				tmp = _mm_cmpgt_epi8(a, zero_);
-				_mm_store_si128(&x[t], _mm_and_si128(a, tmp));
-				tmp = _mm_cmpgt_epi8(b, zero_);
-				_mm_store_si128(&y[t], _mm_and_si128(b, tmp));
-#endif
-			}
-		} else if (!(flag&KSW_EZ_RIGHT)) { // gap left-alignment
-			__m128i *pr = p + r * n_col_ - st_;
-			off[r] = st, off_end[r] = en;
-			for (t = st_; t <= en_; ++t) {
-				__m128i d, z, a, b, xt1, vt1, ut, tmp;
-				__dp_code_block1;
-				d = _mm_and_si128(_mm_cmpgt_epi8(a, z), flag1_); // d = a > z? 1 : 0
-#ifdef __SSE4_1__
-				z = _mm_max_epi8(z, a);                          // z = z > a? z : a (signed)
-				tmp = _mm_cmpgt_epi8(b, z);
-				d = _mm_blendv_epi8(d, flag2_, tmp);             // d = b > z? 2 : d
-#else // we need to emulate SSE4.1 intrinsics _mm_max_epi8() and _mm_blendv_epi8()
-				z = _mm_and_si128(z, _mm_cmpgt_epi8(z, zero_));  // z = z > 0? z : 0;
-				z = _mm_max_epu8(z, a);                          // z = max(z, a); this works because both are non-negative
-				tmp = _mm_cmpgt_epi8(b, z);
-				d = _mm_or_si128(_mm_andnot_si128(tmp, d), _mm_and_si128(tmp, flag2_)); // d = b > z? 2 : d; emulating blendv
-#endif
-				__dp_code_block2;
-				tmp = _mm_cmpgt_epi8(a, zero_);
-				_mm_store_si128(&x[t], _mm_and_si128(tmp, a));
-				d = _mm_or_si128(d, _mm_and_si128(tmp, flag8_));  // d = a > 0? 0x08 : 0
-				tmp = _mm_cmpgt_epi8(b, zero_);
-				_mm_store_si128(&y[t], _mm_and_si128(tmp, b));
-				d = _mm_or_si128(d, _mm_and_si128(tmp, flag16_)); // d = b > 0? 0x10 : 0
-				_mm_store_si128(&pr[t], d);
-			}
-		} else { // gap right-alignment
-			__m128i *pr = p + r * n_col_ - st_;
-			off[r] = st, off_end[r] = en;
-			for (t = st_; t <= en_; ++t) {
-				__m128i d, z, a, b, xt1, vt1, ut, tmp;
-				__dp_code_block1;
-				d = _mm_andnot_si128(_mm_cmpgt_epi8(z, a), flag1_); // d = z > a? 0 : 1
-#ifdef __SSE4_1__
-				z = _mm_max_epi8(z, a);                          // z = z > a? z : a (signed)
-				tmp = _mm_cmpgt_epi8(z, b);
-				d = _mm_blendv_epi8(flag2_, d, tmp);             // d = z > b? d : 2
-#else // we need to emulate SSE4.1 intrinsics _mm_max_epi8() and _mm_blendv_epi8()
-				z = _mm_and_si128(z, _mm_cmpgt_epi8(z, zero_));  // z = z > 0? z : 0;
-				z = _mm_max_epu8(z, a);                          // z = max(z, a); this works because both are non-negative
-				tmp = _mm_cmpgt_epi8(z, b);
-				d = _mm_or_si128(_mm_andnot_si128(tmp, flag2_), _mm_and_si128(tmp, d)); // d = z > b? d : 2; emulating blendv
-#endif
-				__dp_code_block2;
-				tmp = _mm_cmpgt_epi8(zero_, a);
-				_mm_store_si128(&x[t], _mm_andnot_si128(tmp, a));
-				d = _mm_or_si128(d, _mm_andnot_si128(tmp, flag8_));  // d = 0 > a? 0 : 0x08
-				tmp = _mm_cmpgt_epi8(zero_, b);
-				_mm_store_si128(&y[t], _mm_andnot_si128(tmp, b));
-				d = _mm_or_si128(d, _mm_andnot_si128(tmp, flag16_)); // d = 0 > b? 0 : 0x10
-				_mm_store_si128(&pr[t], d);
-			}
-		}
-		if (!approx_max) { // find the exact max with a 32-bit score array
-			int32_t max_H, max_t;
-			// compute H[], max_H and max_t
-			if (r > 0) {
-				int32_t HH[4], tt[4], en1 = st0 + (en0 - st0) / 4 * 4, i;
-				__m128i max_H_, max_t_, qe_;
-				max_H = H[en0] = en0 > 0? H[en0-1] + u8[en0] - qe : H[en0] + v8[en0] - qe; // special casing the last element
-				max_t = en0;
-				max_H_ = _mm_set1_epi32(max_H);
-				max_t_ = _mm_set1_epi32(max_t);
-				qe_    = _mm_set1_epi32(q + e);
-				for (t = st0; t < en1; t += 4) { // this implements: H[t]+=v8[t]-qe; if(H[t]>max_H) max_H=H[t],max_t=t;
-					__m128i H1, tmp, t_;
-					H1 = _mm_loadu_si128((__m128i*)&H[t]);
-					t_ = _mm_setr_epi32(v8[t], v8[t+1], v8[t+2], v8[t+3]);
-					H1 = _mm_add_epi32(H1, t_);
-					H1 = _mm_sub_epi32(H1, qe_);
-					_mm_storeu_si128((__m128i*)&H[t], H1);
-					t_ = _mm_set1_epi32(t);
-					tmp = _mm_cmpgt_epi32(H1, max_H_);
-#ifdef __SSE4_1__
-					max_H_ = _mm_blendv_epi8(max_H_, H1, tmp);
-					max_t_ = _mm_blendv_epi8(max_t_, t_, tmp);
-#else
-					max_H_ = _mm_or_si128(_mm_and_si128(tmp, H1), _mm_andnot_si128(tmp, max_H_));
-					max_t_ = _mm_or_si128(_mm_and_si128(tmp, t_), _mm_andnot_si128(tmp, max_t_));
-#endif
-				}
-				_mm_storeu_si128((__m128i*)HH, max_H_);
-				_mm_storeu_si128((__m128i*)tt, max_t_);
-				for (i = 0; i < 4; ++i)
-					if (max_H < HH[i]) max_H = HH[i], max_t = tt[i] + i;
-				for (; t < en0; ++t) { // for the rest of values that haven't been computed with SSE
-					H[t] += (int32_t)v8[t] - qe;
-					if (H[t] > max_H)
-						max_H = H[t], max_t = t;
-				}
-			} else H[0] = v8[0] - qe - qe, max_H = H[0], max_t = 0; // special casing r==0
-			// update ez
-			if (en0 == tlen - 1 && H[en0] > ez->mte)
-				ez->mte = H[en0], ez->mte_q = r - en;
-			if (r - st0 == qlen - 1 && H[st0] > ez->mqe)
-				ez->mqe = H[st0], ez->mqe_t = st0;
-			if (ksw_apply_zdrop(ez, 1, max_H, r, max_t, zdrop, e)) break;
-			if (r == qlen + tlen - 2 && en0 == tlen - 1)
-				ez->score = H[tlen - 1];
-		} else { // find approximate max; Z-drop might be inaccurate, too.
-			if (r > 0) {
-				if (last_H0_t >= st0 && last_H0_t <= en0 && last_H0_t + 1 >= st0 && last_H0_t + 1 <= en0) {
-					int32_t d0 = v8[last_H0_t] - qe;
-					int32_t d1 = u8[last_H0_t + 1] - qe;
-					if (d0 > d1) H0 += d0;
-					else H0 += d1, ++last_H0_t;
-				} else if (last_H0_t >= st0 && last_H0_t <= en0) {
-					H0 += v8[last_H0_t] - qe;
-				} else {
-					++last_H0_t, H0 += u8[last_H0_t] - qe;
-				}
-				if ((flag & KSW_EZ_APPROX_DROP) && ksw_apply_zdrop(ez, 1, H0, r, last_H0_t, zdrop, e)) break;
-			} else H0 = v8[0] - qe - qe, last_H0_t = 0;
-			if (r == qlen + tlen - 2 && en0 == tlen - 1)
-				ez->score = H0;
-		}
-		last_st = st, last_en = en;
-		//for (t = st0; t <= en0; ++t) printf("(%d,%d)\t(%d,%d,%d,%d)\t%d\n", r, t, ((int8_t*)u)[t], ((int8_t*)v)[t], ((int8_t*)x)[t], ((int8_t*)y)[t], H[t]); // for debugging
-	}
-	kfree(km, mem);
-	if (!approx_max) kfree(km, H);
-	if (with_cigar) { // backtrack
-		int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
-		if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY))
-			ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
-		else if (ez->max_t >= 0 && ez->max_q >= 0)
-			ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
-		kfree(km, mem2); kfree(km, off);
-	}
-}
-#endif // __SSE2__

ksw2_ll_sse.c

@@ -1,147 +0,0 @@
-#include <stdlib.h>
-#include <stdint.h>
-#include <string.h>
-#include <emmintrin.h>
-#include "ksw2.h"
-
-#ifdef __GNUC__
-#define LIKELY(x) __builtin_expect((x),1)
-#define UNLIKELY(x) __builtin_expect((x),0)
-#else
-#define LIKELY(x) (x)
-#define UNLIKELY(x) (x)
-#endif
-
-typedef struct {
-	int qlen, slen;
-	uint8_t shift, mdiff, max, size;
-	__m128i *qp, *H0, *H1, *E, *Hmax;
-} kswq_t;
-
-/**
- * Initialize the query data structure
- *
- * @param size   Number of bytes used to store a score; valid valures are 1 or 2
- * @param qlen   Length of the query sequence
- * @param query  Query sequence
- * @param m      Size of the alphabet
- * @param mat    Scoring matrix in a one-dimension array
- *
- * @return       Query data structure
- */
-void *ksw_ll_qinit(void *km, int size, int qlen, const uint8_t *query, int m, const int8_t *mat)
-{
-	kswq_t *q;
-	int slen, a, tmp, p;
-
-	size = size > 1? 2 : 1;
-	p = 8 * (3 - size); // # values per __m128i
-	slen = (qlen + p - 1) / p; // segmented length
-	q = (kswq_t*)kmalloc(km, sizeof(kswq_t) + 256 + 16 * slen * (m + 4)); // a single block of memory
-	q->qp = (__m128i*)(((size_t)q + sizeof(kswq_t) + 15) >> 4 << 4); // align memory
-	q->H0 = q->qp + slen * m;
-	q->H1 = q->H0 + slen;
-	q->E  = q->H1 + slen;
-	q->Hmax = q->E + slen;
-	q->slen = slen; q->qlen = qlen; q->size = size;
-	// compute shift
-	tmp = m * m;
-	for (a = 0, q->shift = 127, q->mdiff = 0; a < tmp; ++a) { // find the minimum and maximum score
-		if (mat[a] < (int8_t)q->shift) q->shift = mat[a];
-		if (mat[a] > (int8_t)q->mdiff) q->mdiff = mat[a];
-	}
-	q->max = q->mdiff;
-	q->shift = 256 - q->shift; // NB: q->shift is uint8_t
-	q->mdiff += q->shift; // this is the difference between the min and max scores
-	// An example: p=8, qlen=19, slen=3 and segmentation:
-	//  {{0,3,6,9,12,15,18,-1},{1,4,7,10,13,16,-1,-1},{2,5,8,11,14,17,-1,-1}}
-	if (size == 1) {
-		int8_t *t = (int8_t*)q->qp;
-		for (a = 0; a < m; ++a) {
-			int i, k, nlen = slen * p;
-			const int8_t *ma = mat + a * m;
-			for (i = 0; i < slen; ++i)
-				for (k = i; k < nlen; k += slen) // p iterations
-					*t++ = (k >= qlen? 0 : ma[query[k]]) + q->shift;
-		}
-	} else {
-		int16_t *t = (int16_t*)q->qp;
-		for (a = 0; a < m; ++a) {
-			int i, k, nlen = slen * p;
-			const int8_t *ma = mat + a * m;
-			for (i = 0; i < slen; ++i)
-				for (k = i; k < nlen; k += slen) // p iterations
-					*t++ = (k >= qlen? 0 : ma[query[k]]);
-		}
-	}
-	return q;
-}
-
-int ksw_ll_i16(void *q_, int tlen, const uint8_t *target, int _gapo, int _gape, int *qe, int *te)
-{
-	kswq_t *q = (kswq_t*)q_;
-	int slen, i, gmax = 0, qlen8;
-	__m128i zero, gapoe, gape, *H0, *H1, *E, *Hmax;
-	uint16_t *H8;
-
-#define __max_8(ret, xx) do { \
-		(xx) = _mm_max_epi16((xx), _mm_srli_si128((xx), 8)); \
-		(xx) = _mm_max_epi16((xx), _mm_srli_si128((xx), 4)); \
-		(xx) = _mm_max_epi16((xx), _mm_srli_si128((xx), 2)); \
-		(ret) = _mm_extract_epi16((xx), 0); \
-	} while (0)
-
-	// initialization
-	*qe = *te = -1;
-	zero = _mm_set1_epi32(0);
-	gapoe = _mm_set1_epi16(_gapo + _gape);
-	gape = _mm_set1_epi16(_gape);
-	H0 = q->H0; H1 = q->H1; E = q->E; Hmax = q->Hmax;
-	slen = q->slen, qlen8 = slen * 8;
-	memset(E,    0, slen * sizeof(__m128i));
-	memset(H0,   0, slen * sizeof(__m128i));
-	memset(Hmax, 0, slen * sizeof(__m128i));
-	// the core loop
-	for (i = 0; i < tlen; ++i) {
-		int j, k, imax;
-		__m128i e, h, f = zero, max = zero, *S = q->qp + target[i] * slen; // s is the 1st score vector
-		h = _mm_load_si128(H0 + slen - 1); // h={2,5,8,11,14,17,-1,-1} in the above example
-		h = _mm_slli_si128(h, 2);
-		for (j = 0; LIKELY(j < slen); ++j) {
-			h = _mm_adds_epi16(h, *S++);
-			e = _mm_load_si128(E + j);
-			h = _mm_max_epi16(h, e);
-			h = _mm_max_epi16(h, f);
-			max = _mm_max_epi16(max, h);
-			_mm_store_si128(H1 + j, h);
-			h = _mm_subs_epu16(h, gapoe);
-			e = _mm_subs_epu16(e, gape);
-			e = _mm_max_epi16(e, h);
-			_mm_store_si128(E + j, e);
-			f = _mm_subs_epu16(f, gape);
-			f = _mm_max_epi16(f, h);
-			h = _mm_load_si128(H0 + j);
-		}
-		for (k = 0; LIKELY(k < 16); ++k) {
-			f = _mm_slli_si128(f, 2);
-			for (j = 0; LIKELY(j < slen); ++j) {
-				h = _mm_load_si128(H1 + j);
-				h = _mm_max_epi16(h, f);
-				_mm_store_si128(H1 + j, h);
-				h = _mm_subs_epu16(h, gapoe);
-				f = _mm_subs_epu16(f, gape);
-				if(UNLIKELY(!_mm_movemask_epi8(_mm_cmpgt_epi16(f, h)))) goto end_loop_i16;
-			}
-		}
-end_loop_i16:
-		__max_8(imax, max);
-		if (imax >= gmax) {
-			gmax = imax; *te = i;
-			memcpy(Hmax, H1, slen * sizeof(__m128i));
-		}
-		S = H1; H1 = H0; H0 = S;
-	}
-	for (i = 0, H8 = (uint16_t*)Hmax; i < qlen8; ++i)
-		if ((int)H8[i] == gmax) *qe = i / 8 + i % 8 * slen;
-	return gmax;
-}

kthread.c

@@ -1,158 +0,0 @@
-#include <pthread.h>
-#include <stdlib.h>
-#include <limits.h>
-#include <stdint.h>
-
-#if (defined(WIN32) || defined(_WIN32)) && defined(_MSC_VER)
-#define __sync_fetch_and_add(ptr, addend)     _InterlockedExchangeAdd((void*)ptr, addend)
-#endif
-
-/************
- * kt_for() *
- ************/
-
-struct kt_for_t;
-
-typedef struct {
-	struct kt_for_t *t;
-	long i;
-} ktf_worker_t;
-
-typedef struct kt_for_t {
-	int n_threads;
-	long n;
-	ktf_worker_t *w;
-	void (*func)(void*,long,int);
-	void *data;
-} kt_for_t;
-
-static inline long steal_work(kt_for_t *t)
-{
-	int i, min_i = -1;
-	long k, min = LONG_MAX;
-	for (i = 0; i < t->n_threads; ++i)
-		if (min > t->w[i].i) min = t->w[i].i, min_i = i;
-	k = __sync_fetch_and_add(&t->w[min_i].i, t->n_threads);
-	return k >= t->n? -1 : k;
-}
-
-static void *ktf_worker(void *data)
-{
-	ktf_worker_t *w = (ktf_worker_t*)data;
-	long i;
-	for (;;) {
-		i = __sync_fetch_and_add(&w->i, w->t->n_threads);
-		if (i >= w->t->n) break;
-		w->t->func(w->t->data, i, w - w->t->w);
-	}
-	while ((i = steal_work(w->t)) >= 0)
-		w->t->func(w->t->data, i, w - w->t->w);
-	pthread_exit(0);
-}
-
-void kt_for(int n_threads, void (*func)(void*,long,int), void *data, long n)
-{
-	if (n_threads > 1) {
-		int i;
-		kt_for_t t;
-		pthread_t *tid;
-		t.func = func, t.data = data, t.n_threads = n_threads, t.n = n;
-		t.w = (ktf_worker_t*)calloc(n_threads, sizeof(ktf_worker_t));
-		tid = (pthread_t*)calloc(n_threads, sizeof(pthread_t));
-		for (i = 0; i < n_threads; ++i)
-			t.w[i].t = &t, t.w[i].i = i;
-		for (i = 0; i < n_threads; ++i) pthread_create(&tid[i], 0, ktf_worker, &t.w[i]);
-		for (i = 0; i < n_threads; ++i) pthread_join(tid[i], 0);
-		free(tid); free(t.w);
-	} else {
-		long j;
-		for (j = 0; j < n; ++j) func(data, j, 0);
-	}
-}
-
-/*****************
- * kt_pipeline() *
- *****************/
-
-struct ktp_t;
-
-typedef struct {
-	struct ktp_t *pl;
-	int64_t index;
-	int step;
-	void *data;
-} ktp_worker_t;
-
-typedef struct ktp_t {
-	void *shared;
-	void *(*func)(void*, int, void*);
-	int64_t index;
-	int n_workers, n_steps;
-	ktp_worker_t *workers;
-	pthread_mutex_t mutex;
-	pthread_cond_t cv;
-} ktp_t;
-
-static void *ktp_worker(void *data)
-{
-	ktp_worker_t *w = (ktp_worker_t*)data;
-	ktp_t *p = w->pl;
-	while (w->step < p->n_steps) {
-		// test whether we can kick off the job with this worker
-		pthread_mutex_lock(&p->mutex);
-		for (;;) {
-			int i;
-			// test whether another worker is doing the same step
-			for (i = 0; i < p->n_workers; ++i) {
-				if (w == &p->workers[i]) continue; // ignore itself
-				if (p->workers[i].step <= w->step && p->workers[i].index < w->index)
-					break;
-			}
-			if (i == p->n_workers) break; // no workers with smaller indices are doing w->step or the previous steps
-			pthread_cond_wait(&p->cv, &p->mutex);
-		}
-		pthread_mutex_unlock(&p->mutex);
-
-		// working on w->step
-		w->data = p->func(p->shared, w->step, w->step? w->data : 0); // for the first step, input is NULL
-
-		// update step and let other workers know
-		pthread_mutex_lock(&p->mutex);
-		w->step = w->step == p->n_steps - 1 || w->data? (w->step + 1) % p->n_steps : p->n_steps;
-		if (w->step == 0) w->index = p->index++;
-		pthread_cond_broadcast(&p->cv);
-		pthread_mutex_unlock(&p->mutex);
-	}
-	pthread_exit(0);
-}
-
-void kt_pipeline(int n_threads, void *(*func)(void*, int, void*), void *shared_data, int n_steps)
-{
-	ktp_t aux;
-	pthread_t *tid;
-	int i;
-
-	if (n_threads < 1) n_threads = 1;
-	aux.n_workers = n_threads;
-	aux.n_steps = n_steps;
-	aux.func = func;
-	aux.shared = shared_data;
-	aux.index = 0;
-	pthread_mutex_init(&aux.mutex, 0);
-	pthread_cond_init(&aux.cv, 0);
-
-	aux.workers = (ktp_worker_t*)calloc(n_threads, sizeof(ktp_worker_t));
-	for (i = 0; i < n_threads; ++i) {
-		ktp_worker_t *w = &aux.workers[i];
-		w->step = 0; w->pl = &aux; w->data = 0;
-		w->index = aux.index++;
-	}
-
-	tid = (pthread_t*)calloc(n_threads, sizeof(pthread_t));
-	for (i = 0; i < n_threads; ++i) pthread_create(&tid[i], 0, ktp_worker, &aux.workers[i]);
-	for (i = 0; i < n_threads; ++i) pthread_join(tid[i], 0);
-	free(tid); free(aux.workers);
-
-	pthread_mutex_destroy(&aux.mutex);
-	pthread_cond_destroy(&aux.cv);
-}

kthread.h

@@ -1,15 +0,0 @@
-#ifndef KTHREAD_H
-#define KTHREAD_H
-
-#ifdef __cplusplus
-extern "C" {
-#endif
-
-void kt_for(int n_threads, void (*func)(void*,long,int), void *data, long n);
-void kt_pipeline(int n_threads, void *(*func)(void*, int, void*), void *shared_data, int n_steps);
-
-#ifdef __cplusplus
-}
-#endif
-
-#endif

kvec.h

@@ -1,105 +0,0 @@
-/* The MIT License
-
-   Copyright (c) 2008, by Attractive Chaos <attractor@live.co.uk>
-
-   Permission is hereby granted, free of charge, to any person obtaining
-   a copy of this software and associated documentation files (the
-   "Software"), to deal in the Software without restriction, including
-   without limitation the rights to use, copy, modify, merge, publish,
-   distribute, sublicense, and/or sell copies of the Software, and to
-   permit persons to whom the Software is furnished to do so, subject to
-   the following conditions:
-
-   The above copyright notice and this permission notice shall be
-   included in all copies or substantial portions of the Software.
-
-   THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
-   EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
-   MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
-   NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS
-   BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN
-   ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN
-   CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
-   SOFTWARE.
-*/
-
-/*
-  An example:
-
-#include "kvec.h"
-int main() {
-	kvec_t(int) array;
-	kv_init(array);
-	kv_push(int, array, 10); // append
-	kv_a(int, array, 20) = 5; // dynamic
-	kv_A(array, 20) = 4; // static
-	kv_destroy(array);
-	return 0;
-}
-*/
-
-/*
-  2008-09-22 (0.1.0):
-
-	* The initial version.
-
-*/
-
-#ifndef AC_KVEC_H
-#define AC_KVEC_H
-
-#include <stdlib.h>
-#include "kalloc.h"
-
-#define kv_roundup32(x) (--(x), (x)|=(x)>>1, (x)|=(x)>>2, (x)|=(x)>>4, (x)|=(x)>>8, (x)|=(x)>>16, ++(x))
-
-#define kvec_t(type) struct { size_t n, m; type *a; }
-#define kv_init(v) ((v).n = (v).m = 0, (v).a = 0)
-#define kv_destroy(v) free((v).a)
-#define kv_A(v, i) ((v).a[(i)])
-#define kv_pop(v) ((v).a[--(v).n])
-#define kv_size(v) ((v).n)
-#define kv_max(v) ((v).m)
-
-#define kv_resize(type, km, v, s) do { \
-		if ((v).m < (s)) { \
-			(v).m = (s); \
-			kv_roundup32((v).m); \
-			(v).a = (type*)krealloc((km), (v).a, sizeof(type) * (v).m); \
-		} \
-	} while (0)
-
-#define kv_copy(type, km, v1, v0) do { \
-		if ((v1).m < (v0).n) kv_resize(type, (km), (v1), (v0).n); \
-		(v1).n = (v0).n; \
-		memcpy((v1).a, (v0).a, sizeof(type) * (v0).n); \
-	} while (0) \
-
-#define kv_push(type, km, v, x) do { \
-		if ((v).n == (v).m) { \
-			(v).m = (v).m? (v).m<<1 : 2; \
-			(v).a = (type*)krealloc((km), (v).a, sizeof(type) * (v).m); \
-		} \
-		(v).a[(v).n++] = (x); \
-	} while (0)
-
-#define kv_pushp(type, km, v, p) do { \
-		if ((v).n == (v).m) { \
-			(v).m = (v).m? (v).m<<1 : 2; \
-			(v).a = (type*)krealloc((km), (v).a, sizeof(type) * (v).m); \
-		} \
-		*(p) = &(v).a[(v).n++]; \
-	} while (0)
-
-#define kv_reverse(type, v, start) do { \
-		if ((v).m > 0 && (v).n > (start)) { \
-			size_t __i, __end = (v).n - (start); \
-			type *__a = (v).a + (start); \
-			for (__i = 0; __i < __end>>1; ++__i) { \
-				type __t = __a[__end - 1 - __i]; \
-				__a[__end - 1 - __i] = __a[__i]; __a[__i] = __t; \
-			} \
-		} \
-	} while (0)
-
-#endif

main.c

@@ -1,279 +0,0 @@
-#include <stdlib.h>
-#include <stdio.h>
-#include <string.h>
-#include "bseq.h"
-#include "minimap.h"
-#include "mmpriv.h"
-#include "getopt.h"
-
-#define MM_VERSION "2.1.1-r341"
-
-#ifdef __linux__
-#include <sys/resource.h>
-#include <sys/time.h>
-void liftrlimit()
-{
-	struct rlimit r;
-	getrlimit(RLIMIT_AS, &r);
-	r.rlim_cur = r.rlim_max;
-	setrlimit(RLIMIT_AS, &r);
-}
-#else
-void liftrlimit() {}
-#endif
-
-static struct option long_options[] = {
-	{ "bucket-bits",    required_argument, 0, 0 },
-	{ "mb-size",        required_argument, 0, 'K' },
-	{ "int-rname",      no_argument,       0, 0 },
-	{ "no-kalloc",      no_argument,       0, 0 },
-	{ "print-qname",    no_argument,       0, 0 },
-	{ "no-self",        no_argument,       0, 0 },
-	{ "print-seed",     no_argument,       0, 0 },
-	{ "max-chain-skip", required_argument, 0, 0 },
-	{ "min-dp-len",     required_argument, 0, 0 },
-	{ "print-aln-seq",  no_argument,       0, 0 },
-	{ "splice",         no_argument,       0, 0 },
-	{ "cost-non-gt-ag", required_argument, 0, 0 },
-	{ "no-sam-sq",      no_argument,       0, 0 },
-	{ "help",           no_argument,       0, 'h' },
-	{ "max-intron-len", required_argument, 0, 'G' },
-	{ "version",        no_argument,       0, 'V' },
-	{ "min-count",      required_argument, 0, 'n' },
-	{ "min-chain-score",required_argument, 0, 'm' },
-	{ "mask-level",     required_argument, 0, 'M' },
-	{ "min-dp-score",   required_argument, 0, 's' },
-	{ "sam",            no_argument,       0, 'a' },
-	{ 0, 0, 0, 0}
-};
-
-static inline int64_t mm_parse_num(const char *str)
-{
-	double x;
-	char *p;
-	x = strtod(optarg, &p);
-	if (*p == 'G' || *p == 'g') x *= 1e9;
-	else if (*p == 'M' || *p == 'm') x *= 1e6;
-	else if (*p == 'K' || *p == 'k') x *= 1e3;
-	return (int64_t)(x + .499);
-}
-
-int main(int argc, char *argv[])
-{
-	mm_mapopt_t opt;
-	int i, c, k = 15, w = -1, bucket_bits = MM_IDX_DEF_B, n_threads = 3, keep_name = 1, is_idx, is_hpc = 0, long_idx, idx_par_set = 0, max_intron_len = 0, n_idx_part = 0;
-	int minibatch_size = 200000000;
-	uint64_t batch_size = 4000000000ULL;
-	mm_bseq_file_t *fp = 0;
-	char *fnw = 0, *rg = 0, *s;
-	FILE *fpr = 0, *fpw = 0, *fp_help = stderr;
-
-	liftrlimit();
-	mm_realtime0 = realtime();
-	mm_mapopt_init(&opt);
-
-	while ((c = getopt_long(argc, argv, "aSw:k:K:t:r:f:Vv:g:G:I:d:XT:s:x:Hcp:M:n:z:A:B:O:E:m:N:Qu:R:h", long_options, &long_idx)) >= 0) {
-		if (c == 'w') w = atoi(optarg), idx_par_set = 1;
-		else if (c == 'k') k = atoi(optarg), idx_par_set = 1;
-		else if (c == 'H') is_hpc = 1, idx_par_set = 1;
-		else if (c == 'd') fnw = optarg; // the above are indexing related options, except -I
-		else if (c == 'r') opt.bw = (int)mm_parse_num(optarg);
-		else if (c == 'f') opt.mid_occ_frac = atof(optarg);
-		else if (c == 't') n_threads = atoi(optarg);
-		else if (c == 'v') mm_verbose = atoi(optarg);
-		else if (c == 'g') opt.max_gap = (int)mm_parse_num(optarg);
-		else if (c == 'G') max_intron_len = (int)mm_parse_num(optarg);
-		else if (c == 'N') opt.best_n = atoi(optarg);
-		else if (c == 'p') opt.pri_ratio = atof(optarg);
-		else if (c == 'M') opt.mask_level = atof(optarg);
-		else if (c == 'c') opt.flag |= MM_F_OUT_CG | MM_F_CIGAR;
-		else if (c == 'S') opt.flag |= MM_F_OUT_CS | MM_F_CIGAR;
-		else if (c == 'X') opt.flag |= MM_F_AVA | MM_F_NO_SELF;
-		else if (c == 'a') opt.flag |= MM_F_OUT_SAM | MM_F_CIGAR;
-		else if (c == 'Q') opt.flag |= MM_F_NO_QUAL;
-		else if (c == 'T') opt.sdust_thres = atoi(optarg);
-		else if (c == 'n') opt.min_cnt = atoi(optarg);
-		else if (c == 'm') opt.min_chain_score = atoi(optarg);
-		else if (c == 'A') opt.a = atoi(optarg);
-		else if (c == 'B') opt.b = atoi(optarg);
-		else if (c == 'z') opt.zdrop = atoi(optarg);
-		else if (c == 's') opt.min_dp_max = atoi(optarg);
-		else if (c == 'I') batch_size = mm_parse_num(optarg);
-		else if (c == 'K') minibatch_size = (int)mm_parse_num(optarg);
-		else if (c == 'R') rg = optarg;
-		else if (c == 'h') fp_help = stdout;
-		else if (c == 0 && long_idx == 0) bucket_bits = atoi(optarg); // --bucket-bits
-		else if (c == 0 && long_idx == 2) keep_name = 0; // --int-rname
-		else if (c == 0 && long_idx == 3) mm_dbg_flag |= MM_DBG_NO_KALLOC; // --no-kalloc
-		else if (c == 0 && long_idx == 4) mm_dbg_flag |= MM_DBG_PRINT_QNAME; // --print-qname
-		else if (c == 0 && long_idx == 5) opt.flag |= MM_F_NO_SELF; // --no-self
-		else if (c == 0 && long_idx == 6) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_SEED; // --print-seed
-		else if (c == 0 && long_idx == 7) opt.max_chain_skip = atoi(optarg); // --max-chain-skip
-		else if (c == 0 && long_idx == 8) opt.min_ksw_len = atoi(optarg); // --min-dp-len
-		else if (c == 0 && long_idx == 9) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_ALN_SEQ; // --print-aln-seq
-		else if (c == 0 && long_idx ==10) opt.flag |= MM_F_SPLICE; // --splice
-		else if (c == 0 && long_idx ==11) opt.noncan = atoi(optarg); // --cost-non-gt-ag
-		else if (c == 0 && long_idx ==12) opt.flag |= MM_F_NO_SAM_SQ; // --no-sam-sq
-		else if (c == 'V') {
-			puts(MM_VERSION);
-			return 0;
-		} else if (c == 'u') {
-			if (*optarg == 'b') opt.flag |= MM_F_SPLICE_FOR|MM_F_SPLICE_REV;
-			else if (*optarg == 'B') opt.flag |= MM_F_SPLICE_BOTH;
-			else if (*optarg == 'f') opt.flag |= MM_F_SPLICE_FOR, opt.flag &= ~MM_F_SPLICE_REV;
-			else if (*optarg == 'r') opt.flag |= MM_F_SPLICE_REV, opt.flag &= ~MM_F_SPLICE_FOR;
-			else if (*optarg == 'n') opt.flag &= ~(MM_F_SPLICE_FOR|MM_F_SPLICE_REV);
-			else {
-				fprintf(stderr, "[E::%s] unrecognized cDNA direction\n", __func__);
-				return 1;
-			}
-		} else if (c == 'O') {
-			opt.q = opt.q2 = strtol(optarg, &s, 10);
-			if (*s == ',') opt.q2 = strtol(s + 1, &s, 10);
-		} else if (c == 'E') {
-			opt.e = opt.e2 = strtol(optarg, &s, 10);
-			if (*s == ',') opt.e2 = strtol(s + 1, &s, 10);
-		} else if (c == 'x') {
-			if (strcmp(optarg, "ava-ont") == 0) {
-				opt.flag |= MM_F_AVA | MM_F_NO_SELF;
-				opt.min_chain_score = 100, opt.pri_ratio = 0.0f, opt.max_gap = 10000, opt.max_chain_skip = 25;
-				minibatch_size = 500000000;
-				k = 15, w = 5;
-			} else if (strcmp(optarg, "ava-pb") == 0) {
-				opt.flag |= MM_F_AVA | MM_F_NO_SELF;
-				opt.min_chain_score = 100, opt.pri_ratio = 0.0f, opt.max_gap = 10000, opt.max_chain_skip = 25;
-				minibatch_size = 500000000;
-				is_hpc = 1, k = 19, w = 5;
-			} else if (strcmp(optarg, "map10k") == 0 || strcmp(optarg, "map-pb") == 0) {
-				is_hpc = 1, k = 19;
-			} else if (strcmp(optarg, "map-ont") == 0) {
-				is_hpc = 0, k = 15;
-			} else if (strcmp(optarg, "asm5") == 0) {
-				k = 19, w = 19;
-				opt.a = 1, opt.b = 19, opt.q = 39, opt.q2 = 81, opt.e = 3, opt.e2 = 1, opt.zdrop = 200;
-				opt.min_dp_max = 200;
-			} else if (strcmp(optarg, "asm10") == 0) {
-				k = 19, w = 19;
-				opt.a = 1, opt.b = 9, opt.q = 16, opt.q2 = 41, opt.e = 2, opt.e2 = 1, opt.zdrop = 200;
-				opt.min_dp_max = 200;
-			} else if (strcmp(optarg, "splice") == 0 || strcmp(optarg, "cdna") == 0) {
-				k = 15, w = 5;
-				opt.flag |= MM_F_SPLICE | MM_F_SPLICE_FOR | MM_F_SPLICE_REV;
-				opt.max_gap = 2000, opt.max_gap_ref = opt.bw = 200000;
-				opt.a = 1, opt.b = 2, opt.q = 2, opt.e = 1, opt.q2 = 32, opt.e2 = 0;
-				opt.noncan = 5;
-				opt.zdrop = 200;
-			} else {
-				fprintf(stderr, "[E::%s] unknown preset '%s'\n", __func__, optarg);
-				return 1;
-			}
-		}
-	}
-	if (w < 0) w = (int)(.6666667 * k + .499);
-	if ((opt.flag & MM_F_SPLICE) && max_intron_len > 0)
-		opt.max_gap_ref = opt.bw = max_intron_len;
-
-	if (argc == optind || fp_help == stdout) {
-		fprintf(fp_help, "Usage: minimap2 [options] <target.fa>|<target.idx> [query.fa] [...]\n");
-		fprintf(fp_help, "Options:\n");
-		fprintf(fp_help, "  Indexing:\n");
-		fprintf(fp_help, "    -H           use homopolymer-compressed k-mer\n");
-		fprintf(fp_help, "    -k INT       k-mer size (no larger than 28) [%d]\n", k);
-		fprintf(fp_help, "    -w INT       minizer window size [{-k}*2/3]\n");
-		fprintf(fp_help, "    -I NUM       split index for every ~NUM input bases [4G]\n");
-		fprintf(fp_help, "    -d FILE      dump index to FILE []\n");
-		fprintf(fp_help, "  Mapping:\n");
-		fprintf(fp_help, "    -f FLOAT     filter out top FLOAT fraction of repetitive minimizers [%g]\n", opt.mid_occ_frac);
-		fprintf(fp_help, "    -g INT       stop chain enlongation if there are no minimizers in INT-bp [%d]\n", opt.max_gap);
-		fprintf(fp_help, "    -r INT       bandwidth used in chaining and DP-based alignment [%d]\n", opt.bw);
-		fprintf(fp_help, "    -n INT       minimal number of minimizers on a chain [%d]\n", opt.min_cnt);
-		fprintf(fp_help, "    -m INT       minimal chaining score (matching bases minus log gap penalty) [%d]\n", opt.min_chain_score);
-//		fprintf(fp_help, "    -T INT       SDUST threshold; 0 to disable SDUST [%d]\n", opt.sdust_thres); // TODO: this option is never used; might be buggy
-		fprintf(fp_help, "    -X           skip self and dual mappings (for the all-vs-all mode)\n");
-		fprintf(fp_help, "    -p FLOAT     min secondary-to-primary score ratio [%g]\n", opt.pri_ratio);
-		fprintf(fp_help, "    -N INT       retain at most INT secondary alignments [%d]\n", opt.best_n);
-		fprintf(fp_help, "    -G NUM       max intron length (only effective following -x splice) [200k]\n");
-		fprintf(fp_help, "  Alignment:\n");
-		fprintf(fp_help, "    -A INT       matching score [%d]\n", opt.a);
-		fprintf(fp_help, "    -B INT       mismatch penalty [%d]\n", opt.b);
-		fprintf(fp_help, "    -O INT[,INT] gap open penalty [%d,%d]\n", opt.q, opt.q2);
-		fprintf(fp_help, "    -E INT[,INT] gap extension penalty; a k-long gap costs min{O1+k*E1,O2+k*E2} [%d,%d]\n", opt.e, opt.e2);
-		fprintf(fp_help, "    -z INT       Z-drop score [%d]\n", opt.zdrop);
-		fprintf(fp_help, "    -s INT       minimal peak DP alignment score [%d]\n", opt.min_dp_max);
-		fprintf(fp_help, "    -u CHAR      how to find GT-AG. f:transcript strand, b:both strands, n:don't match GT-AG [n]\n");
-		fprintf(fp_help, "  Input/Output:\n");
-		fprintf(fp_help, "    -a           output in the SAM format (PAF by default)\n");
-		fprintf(fp_help, "    -Q           don't output base quality in SAM\n");
-		fprintf(fp_help, "    -R STR       SAM read group line in a format like '@RG\\tID:foo\\tSM:bar' []\n");
-		fprintf(fp_help, "    -c           output CIGAR in PAF\n");
-		fprintf(fp_help, "    -S           output the cs tag in PAF (cs encodes both query and ref sequences)\n");
-		fprintf(fp_help, "    -t INT       number of threads [%d]\n", n_threads);
-		fprintf(fp_help, "    -K NUM       minibatch size [200M]\n");
-//		fprintf(fp_help, "    -v INT       verbose level [%d]\n", mm_verbose);
-		fprintf(fp_help, "    --version    show version number\n");
-		fprintf(fp_help, "  Preset:\n");
-		fprintf(fp_help, "    -x STR       preset (recommended to be applied before other options) []\n");
-		fprintf(fp_help, "                 map10k/map-pb: -Hk19 (PacBio/ONT vs reference mapping)\n");
-		fprintf(fp_help, "                 map-ont: -k15 (slightly more sensitive than 'map10k' for ONT vs reference)\n");
-		fprintf(fp_help, "                 asm5: -k19 -w19 -A1 -B19 -O39,81 -E3,1 -s200 -z200 (asm to ref mapping; break at 5%% div.)\n");
-		fprintf(fp_help, "                 asm10: -k19 -w19 -A1 -B9 -O16,41 -E2,1 -s200 -z200 (asm to ref mapping; break at 10%% div.)\n");
-		fprintf(fp_help, "                 ava-pb: -Hk19 -w5 -Xp0 -m100 -g10000 -K500m --max-chain-skip 25 (PacBio read overlap)\n");
-		fprintf(fp_help, "                 ava-ont: -k15 -w5 -Xp0 -m100 -g10000 -K500m --max-chain-skip 25 (ONT read overlap)\n");
-		fprintf(fp_help, "                 splice: long-read spliced alignment (see minimap2.1 for details)\n");
-		fprintf(fp_help, "\nSee `man ./minimap2.1' for detailed description of command-line options.\n");
-		return fp_help == stdout? 0 : 1;
-	}
-
-	is_idx = mm_idx_is_idx(argv[optind]);
-	if (is_idx < 0) {
-		fprintf(stderr, "[ERROR] failed to open file '%s'\n", argv[optind]);
-		return 1;
-	}
-	if (!is_idx && fnw == 0 && argc - optind < 2) {
-		fprintf(stderr, "[ERROR] missing input: please specify a query file to map or option -d to keep the index\n");
-		return 1;
-	}
-	if (is_idx) fpr = fopen(argv[optind], "rb");
-	else fp = mm_bseq_open(argv[optind]);
-	if (fnw) fpw = fopen(fnw, "wb");
-	if (opt.flag & MM_F_OUT_SAM)
-		mm_write_sam_hdr_no_SQ(rg, MM_VERSION, argc, argv);
-	for (;;) {
-		mm_idx_t *mi;
-		if (fpr) {
-			mi = mm_idx_load(fpr);
-			if (mi == 0) break;
-			if (idx_par_set && mm_verbose >= 2 && (mi->k != k || mi->w != w || mi->is_hpc != is_hpc))
-				fprintf(stderr, "[WARNING] \033[1;31mIndexing parameters on the command line (-k/-w/-H) overridden by parameters in the prebuilt index.\033[0m\n");
-		} else {
-			mi = mm_idx_gen(fp, w, k, bucket_bits, is_hpc, minibatch_size, n_threads, batch_size, keep_name);
-		}
-		if (mi == 0) break;
-		++n_idx_part;
-		if (mm_verbose >= 2 && n_idx_part > 1 && (opt.flag&MM_F_OUT_SAM) && !(opt.flag&MM_F_NO_SAM_SQ))
-			fprintf(stderr, "[WARNING] \033[1;31mSAM output is malformated due to internal @SQ lines. Please add option --no-sam-sq or filter afterwards.\033[0m\n");
-		if (mm_verbose >= 3)
-			fprintf(stderr, "[M::%s::%.3f*%.2f] loaded/built the index for %d target sequence(s)\n",
-					__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), mi->n_seq);
-		if (fpw) {
-			mm_idx_dump(fpw, mi);
-			if (mm_verbose >= 3)
-				fprintf(stderr, "[M::%s::%.3f*%.2f] dumpped the (partial) index to disk\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0));
-		}
-		if (argc != optind + 1) mm_mapopt_update(&opt, mi);
-		if (mm_verbose >= 3) mm_idx_stat(mi);
-		for (i = optind + 1; i < argc; ++i)
-			mm_map_file(mi, argv[i], &opt, n_threads, minibatch_size);
-		mm_idx_destroy(mi);
-	}
-	if (fpw) fclose(fpw);
-	if (fpr) fclose(fpr);
-	if (fp)  mm_bseq_close(fp);
-
-	fprintf(stderr, "[M::%s] Version: %s\n", __func__, MM_VERSION);
-	fprintf(stderr, "[M::%s] CMD:", __func__);
-	for (i = 0; i < argc; ++i)
-		fprintf(stderr, " %s", argv[i]);
-	fprintf(stderr, "\n[M::%s] Real time: %.3f sec; CPU: %.3f sec\n", __func__, realtime() - mm_realtime0, cputime());
-	return 0;
-}

map.c

@@ -1,398 +0,0 @@
-#include <stdlib.h>
-#include <string.h>
-#include <assert.h>
-#include "kthread.h"
-#include "kvec.h"
-#include "kalloc.h"
-#include "sdust.h"
-#include "mmpriv.h"
-#include "bseq.h"
-
-void mm_mapopt_init(mm_mapopt_t *opt)
-{
-	memset(opt, 0, sizeof(mm_mapopt_t));
-	opt->max_occ_frac = 1e-5f;
-	opt->mid_occ_frac = 2e-4f;
-	opt->sdust_thres = 0;
-
-	opt->min_cnt = 3;
-	opt->min_chain_score = 40;
-	opt->bw = 500;
-	opt->max_gap = 5000;
-	opt->max_gap_ref = -1;
-	opt->max_chain_skip = 25;
-
-	opt->mask_level = 0.5f;
-	opt->pri_ratio = 0.8f;
-	opt->best_n = 5;
-
-	opt->max_join_long = 20000;
-	opt->max_join_short = 2000;
-	opt->min_join_flank_sc = 1000;
-
-	opt->a = 2, opt->b = 4, opt->q = 4, opt->e = 2, opt->q2 = 24, opt->e2 = 1;
-	opt->zdrop = 400;
-	opt->min_dp_max = opt->min_chain_score * opt->a;
-	opt->min_ksw_len = 200;
-}
-
-void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
-{
-	if (opt->flag & MM_F_SPLICE_BOTH)
-		opt->flag &= ~(MM_F_SPLICE_FOR|MM_F_SPLICE_REV);
-	opt->max_occ = mm_idx_cal_max_occ(mi, opt->max_occ_frac);
-	opt->mid_occ = mm_idx_cal_max_occ(mi, opt->mid_occ_frac);
-	if (mm_verbose >= 3)
-		fprintf(stderr, "[M::%s::%.3f*%.2f] mid_occ = %d; max_occ = %d\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0),
-				opt->mid_occ, opt->max_occ);
-}
-
-typedef struct {
-	uint32_t n:31, is_alloc:1;
-	uint32_t qpos;
-	union {
-		const uint64_t *cr;
-		uint64_t *r;
-	} x;
-} mm_match_t;
-
-struct mm_tbuf_s {
-	sdust_buf_t *sdb;
-	mm128_v mini;
-	void *km;
-};
-
-mm_tbuf_t *mm_tbuf_init(void)
-{
-	mm_tbuf_t *b;
-	b = (mm_tbuf_t*)calloc(1, sizeof(mm_tbuf_t));
-	if (!(mm_dbg_flag & 1)) b->km = km_init();
-	b->sdb = sdust_buf_init(b->km);
-	return b;
-}
-
-void mm_tbuf_destroy(mm_tbuf_t *b)
-{
-	if (b == 0) return;
-	kfree(b->km, b->mini.a);
-	sdust_buf_destroy(b->sdb);
-	km_destroy(b->km);
-	free(b);
-}
-
-static void mm_dust_minier(mm128_v *mini, int l_seq, const char *seq, int sdust_thres, sdust_buf_t *sdb)
-{
-	int n_dreg, j, k, u = 0;
-	const uint64_t *dreg;
-	if (sdust_thres <= 0 || sdb == 0) return;
-	dreg = sdust_core((const uint8_t*)seq, l_seq, sdust_thres, 64, &n_dreg, sdb);
-	for (j = k = 0; j < mini->n; ++j) { // squeeze out minimizers that significantly overlap with LCRs
-		int32_t qpos = (uint32_t)mini->a[j].y>>1, span = mini->a[j].x&0xff;
-		int32_t s = qpos - (span - 1), e = s + span;
-		while (u < n_dreg && (uint32_t)dreg[u] <= s) ++u;
-		if (u < n_dreg && dreg[u]>>32 < e) {
-			int v, l = 0;
-			for (v = u; v < n_dreg && dreg[v]>>32 < e; ++v) { // iterate over LCRs overlapping this minimizer
-				int ss = s > dreg[v]>>32? s : dreg[v]>>32;
-				int ee = e < (uint32_t)dreg[v]? e : (uint32_t)dreg[v];
-				l += ee - ss;
-			}
-			if (l <= span>>1) mini->a[k++] = mini->a[j]; // keep the minimizer if less than half of it falls in masked region
-		}
-	}
-	mini->n = k;
-}
-#if 0
-int mm_pair_thin_core(mm_tbuf_t *b, uint64_t x, int radius, int rel, int st0, int n, const uint64_t *z, uint64_v *a)
-{
-	int i, st = st0, en = n, mid = en - 1;
-	while (st < en) {
-		uint64_t y;
-		mid = st + ((en - st) >> 1);
-		y = z[mid];
-		if (y < x && (x - y)>>1 > radius) st = mid + 1;
-		else if (y >= x && (y - x)>>1 > radius) en = mid;
-		else break;
-	}
-	if (st < en) {
-		for (en = mid + 1; en < n; ++en)
-			if (z[en] > x && (z[en] - x)>>1 > radius)
-				break;
-		for (st = mid - 1; st >= st0; --st)
-			if (z[st] < x && (x - z[st])>>1 > radius)
-				break;
-		++st;
-		for (i = st; i < en; ++i) {
-			uint64_t y = z[i];
-			if (((x ^ y) & 1) == rel) {
-//				printf("* %d,%d\n", (uint32_t)x>>1, (uint32_t)y>>1);
-				kv_push(uint64_t, b->km, *a, y);
-			}
-		}
-		return en;
-	} else return st < n && z[st] < x? st + 1 : en;
-}
-
-void mm_pair_thin(mm_tbuf_t *b, int radius, mm_match_t *m1, mm_match_t *m2)
-{
-	mm_match_t *m[2];
-	const uint64_t *z[2];
-	uint64_v a[2];
-	int i, n[2], k[2], u = 0, rel = (m1->qpos ^ m2->qpos) & 1;
-
-	m[0] = m1, m[1] = m2;
-	for (i = 0; i < 2; ++i) {
-		n[i] = m[i]->n;
-		z[i] = m[i]->x.cr;
-		k[i] = 0;
-		kv_init(a[i]);
-		kv_resize(uint64_t, b->km, a[i], 256);
-	}
-	while (k[0] < n[0] && k[1] < n[1]) {
-		//printf("%d; %d,%d\n", u, k[0], k[1]);
-		int v = u^1, dist = (int)(m[v]->qpos>>1) - (int)(m[u]->qpos>>1);
-		uint64_t x = z[u][k[u]];
-		int uori = (x ^ m[u]->qpos) & 1, last;
-		int64_t tpos = x>>1 & 0x7fffffff;
-		tpos = uori == 0? tpos + dist : tpos - dist;
-		if (tpos < 0) tpos = 0;
-		x = x>>32<<32 | tpos<<1 | (x&1);
-		last = a[v].n;
-		k[v] = mm_pair_thin_core(b, x, radius, rel, k[v], n[v], z[v], &a[v]);
-		if (a[v].n > last) kv_push(uint64_t, b->km, a[u], z[u][k[u]]);
-		++k[u];
-		u ^= 1;
-	}
-	for (i = 0; i < 2; ++i)
-		m[i]->n = a[i].n, m[i]->x.r = a[i].a, m[i]->is_alloc = 1;
-//	printf("%d,%d; %d,%d\n", m[0]->qpos>>1, m[1]->qpos>>1, m[0]->n, m[1]->n);
-}
-#endif
-mm_reg1_t *mm_map_frag(const mm_mapopt_t *opt, const mm_idx_t *mi, mm_tbuf_t *b, uint32_t m_st, uint32_t m_en, const char *qname, int qlen, const char *seq, int *n_regs)
-{
-	int i, n = m_en - m_st, j, n_u, max_gap_ref;
-	int64_t n_a;
-	uint64_t *u;
-	mm_match_t *m;
-	mm128_t *a;
-	mm_reg1_t *regs;
-
-	// convert to local representation
-	m = (mm_match_t*)kmalloc(b->km, n * sizeof(mm_match_t));
-	for (i = 0; i < n; ++i) {
-		int t;
-		mm128_t *p = &b->mini.a[i + m_st];
-		m[i].is_alloc = 0;
-		m[i].qpos = (uint32_t)p->y;
-		m[i].x.cr = mm_idx_get(mi, p->x>>8, &t);
-		m[i].n = t;
-	}
-#if 0
-	int last = -1, last2 = -1;
-	// pair k-mer thinning
-	for (i = 0; i < n; ++i) {
-		if (m[i].n >= opt->mid_occ && m[i].n < opt->max_occ) {
-			if (last2 < 0) last2 = i;
-			if (last < 0 || m[last].n < m[i].n) last = i;
-			if (last >= 0 && (m[last].qpos>>1) + (m[last].span>>1) <= m[i].qpos>>1) {
-				mm_pair_thin(b, opt->bw, &m[last], &m[i]);
-				last2 = last = -1;
-			} else if (last2 >= 0 && (m[last2].qpos>>1) + (m[last2].span>>1) <= m[i].qpos>>1) {
-				mm_pair_thin(b, opt->bw, &m[last2], &m[i]);
-				last2 = last = -1;
-			}
-		}
-	}
-#endif
-	// fill the _a_ array
-	for (i = 0, n_a = 0; i < n; ++i) // find the length of a[]
-		if (m[i].n < opt->mid_occ) n_a += m[i].n;
-	a = (mm128_t*)kmalloc(b->km, n_a * sizeof(mm128_t));
-	for (i = j = 0; i < n; ++i) {
-		mm128_t *p = &b->mini.a[i + m_st];
-		mm_match_t *q = &m[i];
-		const uint64_t *r = q->x.cr;
-		int k, q_span = p->x & 0xff, is_tandem = 0;
-		if (q->n >= opt->mid_occ) continue;
-		if (i > 0 && p->x>>8 == b->mini.a[m_st + i - 1].x>>8) is_tandem = 1;
-		if (i < n - 1 && p->x>>8 == b->mini.a[m_st + i + 1].x>>8) is_tandem = 1;
-		for (k = 0; k < q->n; ++k) {
-			const char *tname = mi->seq[r[k]>>32].name;
-			int32_t rpos = (uint32_t)r[k] >> 1;
-			mm128_t *p;
-			if (qname && (opt->flag&MM_F_NO_SELF) && strcmp(qname, tname) == 0 && rpos == (q->qpos>>1)) // avoid the diagonal
-				continue;
-			if (qname && (opt->flag&MM_F_AVA) && strcmp(qname, tname) > 0) // all-vs-all mode: map once
-				continue;
-			p = &a[j++];
-			if ((r[k]&1) == (q->qpos&1)) { // forward strand
-				p->x = (r[k]&0xffffffff00000000ULL) | (uint32_t)r[k]>>1;
-				p->y = (uint64_t)q_span << 32 | q->qpos >> 1;
-			} else { // reverse strand
-				p->x = 1ULL<<63 | (r[k]&0xffffffff00000000ULL) | (uint32_t)r[k]>>1;
-				p->y = (uint64_t)q_span << 32 | (qlen - ((q->qpos>>1) + 1 - q_span) - 1);
-			}
-			if (is_tandem) p->y |= MM_SEED_TANDEM;
-		}
-	}
-	n_a = j;
-	radix_sort_128x(a, a + n_a);
-	for (i = 0; i < n; ++i)
-		if (m[i].is_alloc) kfree(b->km, m[i].x.r);
-	kfree(b->km, m);
-
-	if (mm_dbg_flag & MM_DBG_PRINT_SEED)
-		for (i = 0; i < n_a; ++i)
-			fprintf(stderr, "SD\t%s\t%d\t%c\t%d\t%d\t%d\n", mi->seq[a[i].x<<1>>33].name, (int32_t)a[i].x, "+-"[a[i].x>>63], (int32_t)a[i].y, (int32_t)(a[i].y>>32&0xff),
-					i == 0? 0 : ((int32_t)a[i].y - (int32_t)a[i-1].y) - ((int32_t)a[i].x - (int32_t)a[i-1].x));
-
-	max_gap_ref = opt->max_gap_ref >= 0? opt->max_gap_ref : opt->max_gap;
-	n_u = mm_chain_dp(max_gap_ref, opt->max_gap, opt->bw, opt->max_chain_skip, opt->min_cnt, opt->min_chain_score, !!(opt->flag&MM_F_SPLICE), n_a, a, &u, b->km);
-	regs = mm_gen_regs(b->km, qlen, n_u, u, a);
-	*n_regs = n_u;
-
-	if (mm_dbg_flag & MM_DBG_PRINT_SEED)
-		for (j = 0; j < n_u; ++j)
-			for (i = regs[j].as; i < regs[j].as + regs[j].cnt; ++i)
-				fprintf(stderr, "CN\t%d\t%s\t%d\t%c\t%d\t%d\t%d\n", j, mi->seq[a[i].x<<1>>33].name, (int32_t)a[i].x, "+-"[a[i].x>>63], (int32_t)a[i].y, (int32_t)(a[i].y>>32&0xff),
-						i == regs[j].as? 0 : ((int32_t)a[i].y - (int32_t)a[i-1].y) - ((int32_t)a[i].x - (int32_t)a[i-1].x));
-
-	if (!(opt->flag & MM_F_AVA)) { // don't choose primary mapping(s) for read overlap
-		mm_set_parent(b->km, opt->mask_level, *n_regs, regs);
-		mm_select_sub(b->km, opt->mask_level, opt->pri_ratio, mi->k*2, opt->best_n, n_regs, regs);
-		if (!(opt->flag & MM_F_SPLICE))
-			mm_join_long(b->km, opt, qlen, n_regs, regs, a); // TODO: this can be applied to all-vs-all in principle
-	}
-	if (opt->flag & MM_F_CIGAR) {
-		regs = mm_align_skeleton(b->km, opt, mi, qlen, seq, n_regs, regs, a); // this calls mm_filter_regs()
-		if (!(opt->flag & MM_F_AVA)) {
-			mm_set_parent(b->km, opt->mask_level, *n_regs, regs);
-			mm_select_sub(b->km, opt->mask_level, opt->pri_ratio, mi->k*2, opt->best_n, n_regs, regs);
-			mm_set_sam_pri(*n_regs, regs);
-		}
-	}
-	mm_set_mapq(*n_regs, regs, opt->min_chain_score);
-
-	// free
-	kfree(b->km, a);
-	kfree(b->km, u);
-	return regs;
-}
-
-mm_reg1_t *mm_map(const mm_idx_t *mi, int l_seq, const char *seq, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname)
-{
-	mm_reg1_t *regs;
-	b->mini.n = 0;
-	mm_sketch(b->km, seq, l_seq, mi->w, mi->k, 0, mi->is_hpc, &b->mini);
-	if (opt->sdust_thres > 0)
-		mm_dust_minier(&b->mini, l_seq, seq, opt->sdust_thres, b->sdb);
-	regs = mm_map_frag(opt, mi, b, 0, b->mini.n, qname, l_seq, seq, n_regs);
-	return regs;
-}
-
-/**************************
- * Multi-threaded mapping *
- **************************/
-
-typedef struct {
-	int mini_batch_size, n_processed, n_threads;
-	const mm_mapopt_t *opt;
-	mm_bseq_file_t *fp;
-	const mm_idx_t *mi;
-	kstring_t str;
-} pipeline_t;
-
-typedef struct {
-	const pipeline_t *p;
-    int n_seq;
-	mm_bseq1_t *seq;
-	int *n_reg;
-	mm_reg1_t **reg;
-	mm_tbuf_t **buf;
-} step_t;
-
-static void worker_for(void *_data, long i, int tid) // kt_for() callback
-{
-    step_t *step = (step_t*)_data;
-	if (mm_dbg_flag & MM_DBG_PRINT_QNAME)
-		fprintf(stderr, "QR\t%s\t%d\n", step->seq[i].name, tid);
-	step->reg[i] = mm_map(step->p->mi, step->seq[i].l_seq, step->seq[i].seq, &step->n_reg[i], step->buf[tid], step->p->opt, step->seq[i].name);
-}
-
-static void *worker_pipeline(void *shared, int step, void *in)
-{
-	int i, j;
-    pipeline_t *p = (pipeline_t*)shared;
-    if (step == 0) { // step 0: read sequences
-		int with_qual = (!!(p->opt->flag & MM_F_OUT_SAM) && !(p->opt->flag & MM_F_NO_QUAL));
-        step_t *s;
-        s = (step_t*)calloc(1, sizeof(step_t));
-		s->seq = mm_bseq_read(p->fp, p->mini_batch_size, with_qual, &s->n_seq);
-		if (s->seq) {
-			s->p = p;
-			for (i = 0; i < s->n_seq; ++i)
-				s->seq[i].rid = p->n_processed++;
-			s->buf = (mm_tbuf_t**)calloc(p->n_threads, sizeof(mm_tbuf_t*));
-			for (i = 0; i < p->n_threads; ++i)
-				s->buf[i] = mm_tbuf_init();
-			s->n_reg = (int*)calloc(s->n_seq, sizeof(int));
-			s->reg = (mm_reg1_t**)calloc(s->n_seq, sizeof(mm_reg1_t*));
-			return s;
-		} else free(s);
-    } else if (step == 1) { // step 1: map
-		kt_for(p->n_threads, worker_for, in, ((step_t*)in)->n_seq);
-		return in;
-    } else if (step == 2) { // step 2: output
-		void *km = 0;
-        step_t *s = (step_t*)in;
-		const mm_idx_t *mi = p->mi;
-		for (i = 0; i < p->n_threads; ++i) mm_tbuf_destroy(s->buf[i]);
-		free(s->buf);
-		if ((p->opt->flag & MM_F_OUT_CS) && !(mm_dbg_flag & MM_DBG_NO_KALLOC)) km = km_init();
-		for (i = 0; i < s->n_seq; ++i) {
-			mm_bseq1_t *t = &s->seq[i];
-			for (j = 0; j < s->n_reg[i]; ++j) {
-				mm_reg1_t *r = &s->reg[i][j];
-				if (p->opt->flag & MM_F_OUT_SAM)
-					mm_write_sam(&p->str, mi, t, r, s->n_reg[i], s->reg[i]);
-				else
-					mm_write_paf(&p->str, mi, t, r, km, p->opt->flag);
-				puts(p->str.s);
-			}
-			if (s->n_reg[i] == 0 && (p->opt->flag & MM_F_OUT_SAM)) {
-				mm_write_sam(&p->str, 0, t, 0, 0, 0);
-				puts(p->str.s);
-			}
-			for (j = 0; j < s->n_reg[i]; ++j) free(s->reg[i][j].p);
-			free(s->reg[i]);
-			free(s->seq[i].seq); free(s->seq[i].name);
-			if (s->seq[i].qual) free(s->seq[i].qual);
-		}
-		free(s->reg); free(s->n_reg); free(s->seq);
-		km_destroy(km);
-		if (mm_verbose >= 3)
-			fprintf(stderr, "[M::%s::%.3f*%.2f] mapped %d sequences\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), s->n_seq);
-		free(s);
-	}
-    return 0;
-}
-
-int mm_map_file(const mm_idx_t *idx, const char *fn, const mm_mapopt_t *opt, int n_threads, int mini_batch_size)
-{
-	pipeline_t pl;
-	memset(&pl, 0, sizeof(pipeline_t));
-	pl.fp = mm_bseq_open(fn);
-	if (pl.fp == 0) {
-		if (mm_verbose >= 1)
-			fprintf(stderr, "ERROR: failed to open file '%s'\n", fn);
-		return -1;
-	}
-	pl.opt = opt, pl.mi = idx;
-	pl.n_threads = n_threads, pl.mini_batch_size = mini_batch_size;
-	if ((opt->flag & MM_F_OUT_SAM) && !(opt->flag & MM_F_NO_SAM_SQ))
-		mm_write_sam_SQ(idx);
-	kt_pipeline(n_threads == 1? 1 : 2, worker_pipeline, &pl, 3);
-	free(pl.str.s);
-	mm_bseq_close(pl.fp);
-	return 0;
-}

minimap.h

@@ -1,154 +0,0 @@
-#ifndef MINIMAP2_H
-#define MINIMAP2_H
-
-#include <stdint.h>
-#include <stdio.h>
-#include <sys/types.h>
-
-#define MM_IDX_DEF_B     14
-
-#define MM_F_NO_SELF     0x001
-#define MM_F_AVA         0x002
-#define MM_F_CIGAR       0x004
-#define MM_F_OUT_SAM     0x008
-#define MM_F_NO_QUAL     0x010
-#define MM_F_OUT_CG      0x020
-#define MM_F_OUT_CS      0x040
-#define MM_F_SPLICE      0x080
-#define MM_F_SPLICE_FOR  0x100
-#define MM_F_SPLICE_REV  0x200
-#define MM_F_SPLICE_BOTH 0x400
-#define MM_F_NO_SAM_SQ   0x800
-
-#define MM_IDX_MAGIC   "MMI\2"
-
-#ifdef __cplusplus
-extern "C" {
-#endif
-
-typedef struct {
- 	uint64_t x, y;
-} mm128_t;
-
-typedef struct { size_t n, m; mm128_t *a; } mm128_v;
-typedef struct { size_t n, m; uint64_t *a; } uint64_v;
-typedef struct { size_t n, m; uint32_t *a; } uint32_v;
-
-typedef struct {
-	mm128_v a;   // (minimizer, position) array
-	int32_t n;   // size of the _p_ array
-	uint64_t *p; // position array for minimizers appearing >1 times
-	void *h;     // hash table indexing _p_ and minimizers appearing once
-} mm_idx_bucket_t;
-
-typedef struct {
-	char *name;      // name of the db sequence
-	uint64_t offset; // offset in mm_idx_t::S
-	uint32_t len;    // length
-} mm_idx_seq_t;
-
-typedef struct {
-	int32_t b, w, k, is_hpc;
-	uint32_t n_seq;     // number of reference sequences
-	mm_idx_seq_t *seq;  // sequence name, length and offset
-	uint32_t *S;        // 4-bit packed sequence
-	mm_idx_bucket_t *B; // index
-	void *km;
-} mm_idx_t;
-
-typedef struct {
-	uint32_t capacity;
-	int32_t dp_score, dp_max, dp_max2;
-	uint32_t blen;
-	uint32_t n_diff;
-	uint32_t n_ambi:30, trans_strand:2;
-	uint32_t n_cigar;
-	uint32_t cigar[];
-} mm_extra_t;
-
-typedef struct {
-	int32_t id;
-	uint32_t cnt:31, rev:1;
-	uint32_t rid:31, inv:1;
-	int32_t score;
-	int32_t qs, qe, rs, re;
-	int32_t parent, subsc;
-	int32_t as;
-	int32_t fuzzy_mlen, fuzzy_blen;
-	uint32_t mapq:8, split:2, sam_pri:1, n_sub:21; // TODO: n_sub is not used for now
-	mm_extra_t *p;
-} mm_reg1_t;
-
-typedef struct {
-	float max_occ_frac;
-	float mid_occ_frac;
-	int sdust_thres;  // score threshold for SDUST; 0 to disable
-	int flag;    // see MM_F_* macros
-
-	int bw;  // bandwidth
-	int max_gap, max_gap_ref; // break a chain if there are no minimizers in a max_gap window
-	int max_chain_skip;
-	int min_cnt;
-	int min_chain_score;
-
-	float mask_level;
-	float pri_ratio;
-	int best_n;
-
-	int max_join_long, max_join_short;
-	int min_join_flank_sc;
-
-	int a, b, q, e, q2, e2; // matching score, mismatch, gap-open and gap-ext penalties
-	int noncan;
-	int zdrop;
-	int min_dp_max;
-	int min_ksw_len;
-
-	int max_occ;
-	int mid_occ;
-} mm_mapopt_t;
-
-extern int mm_verbose, mm_dbg_flag;
-extern double mm_realtime0;
-
-struct mm_tbuf_s;
-typedef struct mm_tbuf_s mm_tbuf_t;
-
-struct mm_bseq_file_s;
-
-#define mm_seq4_set(s, i, c) ((s)[(i)>>3] |= (uint32_t)(c) << (((i)&7)<<2))
-#define mm_seq4_get(s, i)    ((s)[(i)>>3] >> (((i)&7)<<2) & 0xf)
-
-// compute minimizers
-void mm_sketch(void *km, const char *str, int len, int w, int k, uint32_t rid, int is_hpc, mm128_v *p);
-
-// minimizer indexing
-mm_idx_t *mm_idx_init(int w, int k, int b, int is_hpc);
-void mm_idx_destroy(mm_idx_t *mi);
-mm_idx_t *mm_idx_gen(struct mm_bseq_file_s *fp, int w, int k, int b, int is_hpc, int mini_batch_size, int n_threads, uint64_t batch_size, int keep_name);
-uint32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f);
-void mm_idx_stat(const mm_idx_t *idx);
-const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n);
-int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq);
-
-mm_idx_t *mm_idx_build(const char *fn, int w, int k, int is_hpc, int n_threads);
-int mm_idx_is_idx(const char *fn);
-
-// minimizer index I/O
-void mm_idx_dump(FILE *fp, const mm_idx_t *mi);
-mm_idx_t *mm_idx_load(FILE *fp);
-
-// mapping
-void mm_mapopt_init(mm_mapopt_t *opt);
-void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi);
-mm_tbuf_t *mm_tbuf_init(void);
-void mm_tbuf_destroy(mm_tbuf_t *b);
-mm_reg1_t *mm_map(const mm_idx_t *mi, int l_seq, const char *seq, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *name);
-
-int mm_map_file(const mm_idx_t *idx, const char *fn, const mm_mapopt_t *opt, int n_threads, int tbatch_size);
-
-#ifdef __cplusplus
-}
-#endif
-
-#endif // MINIMAP2_H

minimap2.1

@@ -1,413 +0,0 @@
-.TH minimap2 1 "6 September 2017" "minimap2-2.1.1-r341" "Bioinformatics tools"
-.SH NAME
-.PP
-minimap2 - mapping and alignment between collections of DNA sequences
-.SH SYNOPSIS
-* Indexing the target sequences (optional):
-.RS 4
-minimap2
-.RB [ -x
-.IR preset ]
-.B -d
-.I target.mmi
-.I target.fa
-.br
-minimap2
-.RB [ -H ]
-.RB [ -k
-.IR kmer ]
-.RB [ -w
-.IR miniWinSize ]
-.RB [ -I
-.IR batchSize ]
-.B -d
-.I target.mmi
-.I target.fa
-.RE
-
-* Long-read alignment with CIGAR:
-.RS 4
-minimap2
-.B -a
-.RB [ -x
-.IR preset ]
-.I target.mmi
-.I query.fa
->
-.I output.sam
-.br
-minimap2
-.B -c
-.RB [ -H ]
-.RB [ -k
-.IR kmer ]
-.RB [ -w
-.IR miniWinSize ]
-.RB [ ... ]
-.I target.fa
-.I query.fa
->
-.I output.paf
-.RE
-
-* Long-read overlap without CIGAR:
-.RS 4
-minimap2
-.B -x
-ava-ont
-.RB [ -t
-.IR nThreads ]
-.I target.fa
-.I query.fa
->
-.I output.paf
-.RE
-.SH DESCRIPTION
-.PP
-Minimap2 is a fast sequence mapping and alignment program that can find
-overlaps between long noisy reads, or map long reads or their assemblies to a
-reference genome optionally with detailed alignment (i.e. CIGAR). At present,
-it works efficiently with query sequences from a few kilobases to ~100
-megabases in length at a error rate ~15%. Minimap2 outputs in the PAF or the
-SAM format.
-.SH OPTIONS
-.SS Indexing options
-.TP 10
-.BI -k \ INT
-Minimizer k-mer length [15]
-.TP
-.BI -w \ INT
-Minimizer window size [2/3 of k-mer length]. A minimizer is the smallest k-mer
-in a window of w consecutive k-mers.
-.TP
-.B -H
-Use homopolymer-compressed (HPC) minimizers. An HPC sequence is constructed by
-contracting homopolymer runs to a single base. An HPC minimizer is a minimizer
-on the HPC sequence.
-.TP
-.BI -I \ NUM
-Load at most
-.I NUM
-target bases into RAM for indexing [4G]. If there are more than
-.I NUM
-bases in
-.IR target.fa ,
-minimap2 needs to read
-.I query.fa
-multiple times to map it against each batch of target sequences.
-.I NUM
-may be ending with k/K/m/M/g/G. NB: mapping quality is incorrect given a
-multi-part index.
-.TP
-.BI -d \ FILE
-Save the minimizer index of
-.I target.fa
-to
-.I FILE
-[no dump]. Minimap2 indexing is fast. It can index the human genome in a couple
-of minutes. If even shorter startup time is desired, use this option to save
-the index. Indexing options are fixed in the index file. When an index file is
-provided as the target sequences, options
-.BR -H ,
-.BR -k ,
-.BR -w ,
-.B -I
-will be effectively overridden by the options stored in the index file.
-.SS Mapping options
-.TP 10
-.BI -f \ FLOAT
-Ignore top
-.I FLOAT
-fraction of most frequent minimizers [0.0002]
-.TP
-.BI -g \ INT
-Stop chain enlongation if there are no minimizers in
-.IR INT -bp
-[10000].
-.TP
-.BI -r \ INT
-Bandwidth used in chaining and DP-based alignment [1000]. This option
-approximately controls the maximum gap size.
-.TP
-.BI -n \ INT
-Discard chains consisting of
-.RI < INT
-number of minimizers [3]
-.TP
-.BI -m \ INT
-Discard chains with chaining score
-.RI < INT
-[40]. Chaining score equals the approximate number of matching bases minus a
-concave gap penalty. It is computed with dynamic programming.
-.TP
-.B -X
-Perform all-vs-all mapping. In this mode, if the query sequence name is
-lexicographically larger than the target sequence name, the hits between them
-will be suppressed; if the query sequence name is the same as the target name,
-diagonal minimizer hits will also be suppressed.
-.TP
-.BI -p \ FLOAT
-Minimal secondary-to-primary score ratio to output secondary mappings [0.8].
-Between two chains overlaping over half of the shorter chain (controled by
-.BR --mask-level ),
-the chain with a lower score is secondary to the chain with a higher score.
-If the ratio of the scores is below
-.IR FLOAT ,
-the secondary chain will not be outputted or extended with DP alignment later.
-.TP
-.BI -N \ INT
-Output at most
-.I INT
-secondary alignments [5]. This option has no effect when
-.B -X
-is applied.
-.TP
-.BI -G \ NUM
-Maximal intron length in the splice mode [200k]. This option also changes the
-bandwidth to
-.IR NUM .
-Increasing this option slows down spliced alignment.
-.TP
-.BI --max-chain-skip \ INT
-A heuristics that stops chaining early [50]. Minimap2 uses dynamic programming
-for chaining. The time complexity is quadratic in the number of seeds. This
-option makes minimap2 exits the inner loop if it repeatedly sees seeds already
-on chains. Set
-.I INT
-to a large number to switch off this heurstics.
-.SS Alignment options
-.TP 10
-.BI -A \ INT
-Matching score [2]
-.TP
-.BI -B \ INT
-Mismatching penalty [4]
-.TP
-.BI -O \ INT1[,INT2]
-Gap open penalty [4,24]. If
-.I INT2
-is not specified, it is set to
-.IR INT1 .
-.TP
-.BI -E \ INT1[,INT2]
-Gap extension penalty [2,1]. A gap of length
-.I k
-costs
-.RI min{ O1 + k * E1 , O2 + k * E2 }.
-.TP
-.BI -z \ INT
-Break an alignment if the running score drops too quickly along the diagonal of
-the DP matrix (diagonal X-drop, or Z-drop) [400]. Increasing the value improves
-the contiguity of the alignment at the cost of poor alignment in the middle
-(e.g. caused by a long inversion).
-.TP
-.BI -s \ INT
-Minimal peak DP alignment score to output [40]. The peak score is computed from
-the final CIGAR. It is the score of the max scoring segment in the alignment
-and may be different from the total alignment score.
-.TP
-.BI -u \ CHAR
-How to find canonical splicing sites GT-AG -
-.BR f :
-transcript strand;
-.BR b :
-both strands;
-.BR n :
-no attempt to match GT-AG [n]
-.TP
-.BI --cost-non-gt-ag \ INT
-Cost of non-canonical splicing sites [0].
-.SS Input/output options
-.TP 10
-.B -a
-Generate CIGAR and output alignments in the SAM format. Minimap2 outputs in PAF
-by default.
-.TP
-.B -Q
-Ignore base quality in the input file.
-.TP
-.BI -R \ STR
-SAM read group line in a format like
-.B @RG\\\\tID:foo\\\\tSM:bar
-[].
-.TP
-.B -c
-Generate CIGAR. In PAF, the CIGAR is written to the `cg' custom tag.
-.TP
-.BI -t \ INT
-Number of threads [3]. Minimap2 uses at most three threads when indexing target
-sequences, and uses up to
-.IR INT +1
-threads when mapping (the extra thread is for I/O, which is frequently idle and
-takes little CPU time).
-.TP
-.BI -K \ NUM
-Number of bases loaded into memory to process in a mini-batch [200M].
-Similar to option
-.BR -I ,
-K/M/G/k/m/g suffix is accepted. A large
-.I NUM
-helps load balancing in the multi-threading mode, at the cost of increased
-memory. Preset
-.B ava-pb
-and
-.B ava-ont
-use
-.BR -K500m .
-.TP
-.B --version
-Print version number to stdout
-.TP
-.B --no-sam-hdr
-Don't output SAM header lines. Use this option if the index consists of
-multiple parts; otherwise the SAM output is malformated due to internal header
-lines.
-.SS Preset options
-.TP 10
-.BI -x \ STR
-Preset []. This option applies multiple options at the same time. It should be
-applied before other options because options applied later will overwrite the
-values set by
-.BR -x .
-Available
-.I STR
-are:
-.RS
-.TP 8
-.B map-pb
-PacBio/Oxford Nanopore read to reference mapping
-.RB ( -Hk19 )
-.TP
-.B map10k
-The same as
-.B map-pb
-.RB ( -Hk19 )
-.TP
-.B map-ont
-Slightly more sensitive for Oxford Nanopore to reference mapping
-.RB ( -k15 ).
-For PacBio reads, HPC minimizers consistently leads to faster performance and
-more sensitive results in comparison to normal minimizers. For Oxford Nanopore
-data, normal minimizers are better, though not much. The effectiveness of HPC
-is determined by the sequencing error mode.
-.TP
-.B asm5
-Long assembly to reference mapping
-.RB ( -k19
-.B -w19 -A1 -B19 -O39,81 -E3,1 -s200
-.BR -z200 ).
-Typically, the alignment will not extend to regions with 5% or higher sequence
-divergence. Only use this preset if the average divergence is far below 5%.
-.TP
-.B asm10
-Long assembly to reference mapping
-.RB ( -k19
-.B -w19 -A1 -B9 -O16,41 -E2,1 -s200
-.BR -z200 ).
-Up to 10% sequence divergence.
-.TP
-.B ava-pb
-PacBio all-vs-all overlap mapping
-.RB ( -Hk19
-.B -w5 -Xp0 -m100 -K500m -g10000 --max-chain-skip
-.BR 25 ).
-.TP
-.B ava-ont
-Oxford Nanopore all-vs-all overlap mapping
-.RB ( -k15
-.B -w5 -Xp0 -m100 -K500m -g10000 --max-chain-skip
-.BR 25 ).
-Similarly, the major difference from
-.B ava-pb
-is that this preset is not using HPC minimizers.
-.TP
-.B splice
-Long-read spliced alignment
-.RB ( -k15
-.B -w5 --splice -g2000 -G200k -A1 -B2 -O2,32 -E1,0 -z200 -ub --cost-non-gt-ag
-.BR 5 ).
-In the splice mode, 1) long deletions are taken as introns and represented as
-the
-.RB ` N '
-CIGAR operator; 2) long insertions are disabled; 3) deletion and insertion gap
-costs are different during chaining; 4) the computation of the
-.RB ` ms '
-tag ignores introns to demote hits to pseudogenes.
-.RE
-.SS Miscellaneous options
-.TP 10
-.B --no-kalloc
-Use the libc default allocator instead of the kalloc thread-local allocator.
-This debugging option is mostly used with Valgrind to detect invalid memory
-accesses. Minimap2 runs slower with this option, especially in the
-multi-threading mode.
-.TP
-.B --print-qname
-Print query names to stderr, mostly to see which query is crashing minimap2.
-.TP
-.B --print-seed
-Print seed positions to stderr, for debugging only.
-.SH OUTPUT FORMAT
-.PP
-Minimap2 outputs mapping positions in the Pairwise mApping Format (PAF) by
-default. PAF is a TAB-delimited text format with each line consisting of at
-least 12 fields as are described in the following table:
-.TS
-center box;
-cb | cb | cb
-r | c | l .
-Col	Type	Description
-_
-1	string	Query sequence name
-2	int	Query sequence length
-3	int	Query start coordinate (0-based)
-4	int	Query end coordinate (0-based)
-5	char	`+' if query/target on the same strand; `-' if opposite
-6	string	Target sequence name
-7	int	Target sequence length
-8	int	Target start coordinate on the original strand
-9	int	Target end coordinate on the original strand
-10	int	Number of matching bases in the mapping
-11	int	Number bases, including gaps, in the mapping
-12	int	Mapping quality (0-255 with 255 for missing)
-.TE
-
-.PP
-When alignment is available, column 11 gives the total number of sequence
-matches, mismatches and gaps in the alignment; column 10 divided by column 11
-gives the BLAST-like alignment identity. When alignment is unavailable,
-these two columns are approximate. PAF may optionally have additional fields in
-the SAM-like typed key-value format. Minimap2 may output the following tags:
-.TS
-center box;
-cb | cb | cb
-r | c | l .
-Tag	Type	Description
-_
-tp	A	Type of aln: P/primary, S/secondary and I/inversion
-cm	i	Number of minimizers on the chain
-s1	i	Chaining score
-s2	i	Chaining score of the best secondary chain
-NM	i	Total number of mismatches and gaps in the alignment
-AS	i	DP alignment score
-ms	i	DP score of the max scoring segment in the alignment
-nn	i	Number of ambiguous bases in the alignment
-cg	Z	CIGAR string (only in PAF)
-.TE
-
-.SH LIMITATIONS
-.TP 2
-*
-Minimap2 may produce suboptimal alignments through long low-complexity regions
-where seed positions may be suboptimal. This should not be a big concern
-because even the optimal alignment may be wrong in such regions.
-.TP
-*
-Minimap2 does not work well with Illumina short reads as of now.
-.TP
-*
-Minimap2 requires SSE2 instructions to compile. It is possible to add
-non-SSE2 support, but it would make minimap2 slower by several times.
-.SH SEE ALSO
-.PP
-miniasm(1), minimap(1), bwa(1).

minimap2.html

@@ -0,0 +1,925 @@
+<HTML><HEAD>
+<style type="text/css">
+a:link {
+	text-decoration: none;
+	color: #0092e8;
+}
+a:visited {
+	text-decoration: none;
+	color: #0092e8;
+}
+a:hover {
+	text-decoration: underline;
+	color: #0092e8;
+}
+body, td, th {
+	font: 12px consolas, andale mono, courier, mono;
+}
+body {
+	color: #000;
+	background: #fff;
+	margin: 0;
+	padding: 0;
+}
+table {
+	border: solid 0px #ccc;
+}
+td {
+	vertical-align: top;
+	padding: 0.2em;
+}
+th {
+	font-weight: bold;
+	text-align: left;
+	padding: 0.2em;
+}
+#tbl table {
+	border: solid 1px #ccc;
+}
+#tbl td {
+	border: solid 1px #ccc;
+	padding: 0.3em;
+}
+#wrap {
+  width: 780px;
+  text-align: left;
+  margin: 0 auto;
+}
+hr {
+	margin: 1em 0;
+	color: #C7C7C7;
+	background: #C7C7C7;
+	border-color: #C7C7C7;
+	border-style: none;
+	height: 1px;
+}
+h1, h2, h3, h4, h5, h6 {
+	font-family: "Trebuchet MS", arial, sans-serif;
+	font-weight: bold;
+}
+p {
+    text-align: justify;
+}
+</style>
+<TITLE>minimap2.1</TITLE>
+</HEAD>
+<BODY bgcolor=#F0F0F0 text=#000000 link=#0000ff vlink=#C000C0 alink=#ff0000><div id="wrap"><A NAME=top></A>
+<CENTER>
+<H1><HR><I>Manual Reference Pages &nbsp;-&nbsp;</I><NOBR>minimap2 (1)</NOBR><HR></H1>
+</CENTER>
+<A name=0></A>
+
+     <H3>NAME</H3>
+
+
+<BLOCKQUOTE>
+<P>
+minimap2 - mapping and alignment between collections of DNA sequences
+</BLOCKQUOTE>
+<A name=contents></A><H3>CONTENTS</H3></A>
+<BLOCKQUOTE>
+<A HREF=#1>Synopsis</A><BR>
+<A HREF=#2>Description</A><BR>
+<A HREF=#3>Options</A><BR>
+&nbsp; &nbsp; &nbsp;<A HREF=#4>Indexing options</A><BR>
+&nbsp; &nbsp; &nbsp;<A HREF=#5>Mapping options</A><BR>
+&nbsp; &nbsp; &nbsp;<A HREF=#6>Alignment options</A><BR>
+&nbsp; &nbsp; &nbsp;<A HREF=#7>Input/output options</A><BR>
+&nbsp; &nbsp; &nbsp;<A HREF=#8>Preset options</A><BR>
+&nbsp; &nbsp; &nbsp;<A HREF=#9>Miscellaneous options</A><BR>
+<A HREF=#10>Output Format</A><BR>
+<A HREF=#11>Limitations</A><BR>
+<A HREF=#12>See Also</A><BR>
+</BLOCKQUOTE>
+<A name=13></A>
+
+     <H3>SYNOPSIS</H3>
+
+
+<BLOCKQUOTE>
+* Indexing the target sequences (optional):
+<BLOCKQUOTE>
+minimap2
+[<B>-x</B> <I>preset</I>] <B>-d</B> <I>target.mmi</I> <I>target.fa</I> <!-- Need break --><BR>
+minimap2
+[<B>-H</B>] [<B>-k</B> <I>kmer</I>] [<B>-w</B> <I>miniWinSize</I>] [<B>-I</B> <I>batchSize</I>] <B>-d</B> <I>target.mmi</I> <I>target.fa</I> </BLOCKQUOTE>
+<P>
+* Long-read alignment with CIGAR:
+<BLOCKQUOTE>
+minimap2
+<B>-a</B> [<B>-x</B> <I>preset</I>] <I>target.mmi</I> <I>query.fa</I> &gt;
+<I>output.sam</I> <!-- Need break --><BR>
+minimap2
+<B>-c</B> [<B>-H</B>] [<B>-k</B> <I>kmer</I>] [<B>-w</B> <I>miniWinSize</I>] [<B>...</B>] <I>target.fa</I> <I>query.fa</I> &gt;
+<I>output.paf</I> </BLOCKQUOTE>
+<P>
+* Long-read overlap without CIGAR:
+<BLOCKQUOTE>
+minimap2
+<B>-x</B> ava-ont
+[<B>-t</B> <I>nThreads</I>] <I>target.fa</I> <I>query.fa</I> &gt;
+<I>output.paf</I> </BLOCKQUOTE>
+</BLOCKQUOTE>
+<A name=2></A>
+
+     <H3>DESCRIPTION</H3>
+
+
+<BLOCKQUOTE>
+<P>
+Minimap2 is a fast sequence mapping and alignment program that can find
+overlaps between long noisy reads, or map long reads or their assemblies to a
+reference genome optionally with detailed alignment (i.e. CIGAR). At present,
+it works efficiently with query sequences from a few kilobases to ~100
+megabases in length at a error rate ~15%. Minimap2 outputs in the PAF or the
+SAM format.
+</BLOCKQUOTE>
+<A name=3></A>
+
+     <H3>OPTIONS</H3>
+
+
+<BLOCKQUOTE>
+</BLOCKQUOTE>
+<A name=4></A>
+
+    <H4>&nbsp; &nbsp; Indexing options</H4>
+
+<BLOCKQUOTE>
+<TABLE cellpadding=3>
+<TR valign=top><TD width=10% nowrap>
+<B>-k</B><I> INT</I> </TD><TD valign=bottom>
+Minimizer k-mer length [15]
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>-w</B><I> INT</I> </TD><TD valign=bottom>
+Minimizer window size [10]. A minimizer is the smallest k-mer
+in a window of w consecutive k-mers.
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>-j</B><I> INT</I> </TD><TD valign=bottom>
+Syncmer submer size [10]. Option
+<B>-j</B> and
+<B>-w</B> will override each: if
+<B>-w</B> is applied after
+<B>-j</B>, <B>-j</B> will have no effect, and vice versa.
+<P>
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>-H</B> </TD><TD valign=bottom>
+Use homopolymer-compressed (HPC) minimizers. An HPC sequence is constructed by
+contracting homopolymer runs to a single base. An HPC minimizer is a minimizer
+on the HPC sequence.
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>-I</B><I> NUM</I> </TD><TD valign=bottom>
+Load at most
+<I>NUM</I> target bases into RAM for indexing [8G]. If there are more than
+<I>NUM</I> bases in
+<I>target.fa</I>, minimap2 needs to read
+<I>query.fa</I> multiple times to map it against each batch of target sequences. This would create a multi-part index.
+<I>NUM</I> may be ending with k/K/m/M/g/G. NB: mapping quality is incorrect given a
+multi-part index. See also option
+<B>--split-prefix</B>. </TD></TR>
+<TR valign=top><TD colspan=2>
+<B>--idx-no-seq</B> </TD></TR><TR valign=top><TD width=10%>&nbsp;</TD><TD>
+Don&#146;t store target sequences in the index. It saves disk space and memory but
+the index generated with this option will not work with
+<B>-a</B> or
+<B>-c</B>. When base-level alignment is not requested, this option is automatically applied.
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>-d</B><I> FILE</I> </TD><TD valign=bottom>
+Save the minimizer index of
+<I>target.fa</I> to
+<I>FILE</I> [no dump]. Minimap2 indexing is fast. It can index the human genome in a couple
+of minutes. If even shorter startup time is desired, use this option to save
+the index. Indexing options are fixed in the index file. When an index file is
+provided as the target sequences, options
+<B>-H</B>, <B>-k</B>, <B>-w</B>, <B>-I</B> will be effectively overridden by the options stored in the index file.
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>--alt</B><I> FILE</I> </TD><TD valign=bottom>
+List of ALT contigs [null]
+</TD></TR>
+<TR valign=top><TD colspan=2>
+<B>--alt-drop</B><I> FLOAT</I> </TD></TR><TR valign=top><TD width=10%>&nbsp;</TD><TD>
+Drop ALT hits by
+<I>FLOAT</I> fraction when ranking and computing mapping quality [0.15]
+</TD></TR>
+<TR></TR></TABLE></BLOCKQUOTE>
+<A name=5></A>
+
+    <H4>&nbsp; &nbsp; Mapping options</H4>
+
+<BLOCKQUOTE>
+<TABLE cellpadding=3>
+<TR valign=top><TD colspan=2>
+<B>-f</B><I> FLOAT</I><B>|</B><I>INT1</I><B>[,</B><I>INT2</I><B>]</B> </TD></TR><TR valign=top><TD width=10%>&nbsp;</TD><TD>
+If fraction, ignore top
+<I>FLOAT</I> fraction of most frequent minimizers [0.0002]. If integer,
+ignore minimizers occuring more than
+<I>INT1</I> times.
+<I>INT2</I> is only effective in the
+<B>--sr</B> or
+<B>-xsr</B> mode, which sets the threshold for a second round of seeding.
+</TD></TR>
+<TR valign=top><TD colspan=2>
+<B>-U</B><I> INT1</I><B>[,</B><I>INT2</I><B>]</B> </TD></TR><TR valign=top><TD width=10%>&nbsp;</TD><TD>
+Lower and upper bounds of k-mer occurrences [10,1000000]. The final k-mer occurrence threshold is
+max{<I>INT1</I>, min{<I>INT2</I>, <B>-f</B>}}. This option prevents excessively small or large
+<B>-f</B> estimated from the input reference. Available since r1034 and deprecating
+<B>--min-occ-floor</B> in earlier versions of minimap2.
+</TD></TR>
+<TR valign=top><TD colspan=2>
+<B>--q-occ-frac</B><I> FLOAT</I> </TD></TR><TR valign=top><TD width=10%>&nbsp;</TD><TD>
+Discard a query minimizer if its occurrence is higher than
+<I>FLOAT</I> fraction of query minimizers and than the reference occurrence threshold
+[0.01]. Set 0 to disable. Available since r1105.
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>-e</B><I> INT</I> </TD><TD valign=bottom>
+Sample a high-frequency minimizer every
+<I>INT</I> basepairs [500].
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>-g</B><I> NUM</I> </TD><TD valign=bottom>
+Stop chain enlongation if there are no minimizers within
+<I>NUM</I>-bp [10k].
+</TD></TR>
+<TR valign=top><TD colspan=2>
+<B>-r</B><I> NUM1</I><B>[,</B><I>NUM2</I><B>]</B> </TD></TR><TR valign=top><TD width=10%>&nbsp;</TD><TD>
+Bandwidth for chaining and base alignment [500,20k].
+<I>NUM1</I> is used for initial chaining and alignment extension;
+<I>NUM2</I> for RMQ-based re-chaining and closing gaps in alignments.
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>-n</B><I> INT</I> </TD><TD valign=bottom>
+Discard chains consisting of
+&lt;<I>INT</I> number of minimizers [3]
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>-m</B><I> INT</I> </TD><TD valign=bottom>
+Discard chains with chaining score
+&lt;<I>INT</I> [40]. Chaining score equals the approximate number of matching bases minus a
+concave gap penalty. It is computed with dynamic programming.
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>-D</B> </TD><TD valign=bottom>
+If query sequence name/length are identical to the target name/length, ignore
+diagonal anchors. This option also reduces DP-based extension along the
+diagonal.
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>-P</B> </TD><TD valign=bottom>
+Retain all chains and don&#146;t attempt to set primary chains. Options
+<B>-p</B> and
+<B>-N</B> have no effect when this option is in use.
+</TD></TR>
+<TR valign=top><TD colspan=2>
+<B>--dual</B>=<B>yes</B>|<B>no</B> </TD></TR><TR valign=top><TD width=10%>&nbsp;</TD><TD>
+If
+<B>no</B>, skip query-target pairs wherein the query name is lexicographically greater
+than the target name [yes]
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>-X</B> </TD><TD valign=bottom>
+Equivalent to
+&#146;<B>-DP</B> <B>--dual</B>=<B>no</B> <B>--no-long-join</B>&#146;. Primarily used for all-vs-all read overlapping.
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>-p</B><I> FLOAT</I> </TD><TD valign=bottom>
+Minimal secondary-to-primary score ratio to output secondary mappings [0.8].
+Between two chains overlaping over half of the shorter chain (controlled by
+<B>-M</B>), the chain with a lower score is secondary to the chain with a higher score.
+If the ratio of the scores is below
+<I>FLOAT</I>, the secondary chain will not be outputted or extended with DP alignment later.
+This option has no effect when
+<B>-X</B> is applied.
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>-N</B><I> INT</I> </TD><TD valign=bottom>
+Output at most
+<I>INT</I> secondary alignments [5]. This option has no effect when
+<B>-X</B> is applied.
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>-G</B><I> NUM</I> </TD><TD valign=bottom>
+Maximum gap on the reference (effective with
+<B>-xsplice</B>/<B>--splice</B>). This option also changes the chaining and alignment band width to
+<I>NUM</I>. Increasing this option slows down spliced alignment. [200k]
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>-F</B><I> NUM</I> </TD><TD valign=bottom>
+Maximum fragment length (aka insert size; effective with
+<B>-xsr</B>/<B>--frag</B>=<B>yes</B>) [800]
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>-M</B><I> FLOAT</I> </TD><TD valign=bottom>
+Mark as secondary a chain that overlaps with a better chain by
+<I>FLOAT</I> or more of the shorter chain [0.5]
+</TD></TR>
+<TR valign=top><TD colspan=2>
+<B>--rmq</B>=<B>no</B>|<B>yes</B> </TD></TR><TR valign=top><TD width=10%>&nbsp;</TD><TD>
+Use the minigraph chaining algorithm [no]. The minigraph algorithm is better
+for aligning contigs through long INDELs.
+</TD></TR>
+<TR valign=top><TD colspan=2>
+<B>--rmq-inner</B><I> NUM</I> </TD></TR><TR valign=top><TD width=10%>&nbsp;</TD><TD>
+Apply full dynamic programming for anchors within distance
+<I>NUM</I> [1000].
+</TD></TR>
+<TR valign=top><TD colspan=2>
+<B>--hard-mask-level</B> </TD></TR><TR valign=top><TD width=10%>&nbsp;</TD><TD>
+Honor option
+<B>-M</B> and disable a heurstic to save unmapped subsequences and disables
+<B>--mask-len</B>. </TD></TR>
+<TR valign=top><TD colspan=2>
+<B>--mask-len</B><I> NUM</I> </TD></TR><TR valign=top><TD width=10%>&nbsp;</TD><TD>
+Keep an alignment if dropping it leaves an unaligned region on query longer than
+<I>INT</I> [inf]. Effective without
+<B>--hard-mask-level</B>. </TD></TR>
+<TR valign=top><TD colspan=2>
+<B>--max-chain-skip</B><I> INT</I> </TD></TR><TR valign=top><TD width=10%>&nbsp;</TD><TD>
+A heuristics that stops chaining early [25]. Minimap2 uses dynamic programming
+for chaining. The time complexity is quadratic in the number of seeds. This
+option makes minimap2 exits the inner loop if it repeatedly sees seeds already
+on chains. Set
+<I>INT</I> to a large number to switch off this heurstics.
+</TD></TR>
+<TR valign=top><TD colspan=2>
+<B>--max-chain-iter</B><I> INT</I> </TD></TR><TR valign=top><TD width=10%>&nbsp;</TD><TD>
+Check up to
+<I>INT</I> partial chains during chaining [5000]. This is a heuristic to avoid quadratic
+time complexity in the worst case.
+</TD></TR>
+<TR valign=top><TD colspan=2>
+<B>--chain-gap-scale</B><I> FLOAT</I> </TD></TR><TR valign=top><TD width=10%>&nbsp;</TD><TD>
+Scale of gap cost during chaining [1.0]
+</TD></TR>
+<TR valign=top><TD colspan=2>
+<B>--no-long-join</B> </TD></TR><TR valign=top><TD width=10%>&nbsp;</TD><TD>
+Disable the long gap patching heuristic. When this option is applied, the
+maximum alignment gap is mostly controlled by
+<B>-r</B>. </TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>--splice</B> </TD><TD valign=bottom>
+Enable the splice alignment mode.
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>--sr</B> </TD><TD valign=bottom>
+Enable short-read alignment heuristics. In the short-read mode, minimap2
+applies a second round of chaining with a higher minimizer occurrence threshold
+if no good chain is found. In addition, minimap2 attempts to patch gaps between
+seeds with ungapped alignment.
+</TD></TR>
+<TR valign=top><TD colspan=2>
+<B>--split-prefix</B><I> STR</I> </TD></TR><TR valign=top><TD width=10%>&nbsp;</TD><TD>
+Prefix to create temporary files. Typically used for a multi-part index.
+</TD></TR>
+<TR valign=top><TD colspan=2>
+<B>--frag</B>=<B>no</B>|<B>yes</B> </TD></TR><TR valign=top><TD width=10%>&nbsp;</TD><TD>
+Whether to enable the fragment mode [no]
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>--for-only</B> </TD><TD valign=bottom>
+Only map to the forward strand of the reference sequences. For paired-end
+reads in the forward-reverse orientation, the first read is mapped to forward
+strand of the reference and the second read to the reverse stand.
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>--rev-only</B> </TD><TD valign=bottom>
+Only map to the reverse complement strand of the reference sequences.
+</TD></TR>
+<TR valign=top><TD colspan=2>
+<B>--heap-sort</B>=<B>no</B>|<B>yes</B> </TD></TR><TR valign=top><TD width=10%>&nbsp;</TD><TD>
+If yes, sort anchors with heap merge, instead of radix sort. Heap merge is
+faster for short reads, but slower for long reads. [no]
+</TD></TR>
+<TR valign=top><TD colspan=2>
+<B>--no-pairing</B> </TD></TR><TR valign=top><TD width=10%>&nbsp;</TD><TD>
+Treat two reads in a pair as independent reads. The mate related fields in SAM
+are still properly populated.
+</TD></TR>
+<TR valign=top><TD colspan=2>
+<B>--no-hash-name</B> </TD></TR><TR valign=top><TD width=10%>&nbsp;</TD><TD>
+Produce the same alignment for identical sequences regardless of their sequence names.
+</TD></TR>
+<TR></TR></TABLE></BLOCKQUOTE>
+<A name=6></A>
+
+    <H4>&nbsp; &nbsp; Alignment options</H4>
+
+<BLOCKQUOTE>
+<TABLE cellpadding=3>
+<TR valign=top><TD width=10% nowrap>
+<B>-A</B><I> INT</I> </TD><TD valign=bottom>
+Matching score [2]
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>-B</B><I> INT</I> </TD><TD valign=bottom>
+Mismatching penalty [4]
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>-b</B><I> INT</I> </TD><TD valign=bottom>
+Mismatching penalty for transitions [same as
+<B>-B</B>]. </TD></TR>
+<TR valign=top><TD colspan=2>
+<B>-O</B><I> INT1[,INT2]</I> </TD></TR><TR valign=top><TD width=10%>&nbsp;</TD><TD>
+Gap open penalty [4,24]. If
+<I>INT2</I> is not specified, it is set to
+<I>INT1</I>. </TD></TR>
+<TR valign=top><TD colspan=2>
+<B>-E</B><I> INT1[,INT2]</I> </TD></TR><TR valign=top><TD width=10%>&nbsp;</TD><TD>
+Gap extension penalty [2,1]. A gap of length
+<I>k</I> costs
+min{<I>O1</I>+<I>k</I>*<I>E1</I>,<I>O2</I>+<I>k</I>*<I>E2</I>}. In the splice mode, the second gap penalties are not used.
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>-J</B><I> INT</I> </TD><TD valign=bottom>
+Splice model [1]. 0 for the original minimap2 splice model that always penalizes non-GT-AG splicing;
+1 for the miniprot model that considers non-GT-AG. Option
+<B>-C</B> has no effect with the default
+<B>-J1</B>. <B>-J0</B>. </TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>-C</B><I> INT</I> </TD><TD valign=bottom>
+Cost for a non-canonical GT-AG splicing (effective with
+<B>--splice</B> <B>-J0</B>) [0].
+</TD></TR>
+<TR valign=top><TD colspan=2>
+<B>-z</B><I> INT1[,INT2]</I> </TD></TR><TR valign=top><TD width=10%>&nbsp;</TD><TD>
+Truncate an alignment if the running alignment score drops too quickly along
+the diagonal of the DP matrix (diagonal X-drop, or Z-drop) [400,200]. If the
+drop of score is above
+<I>INT2</I>, minimap2 will reverse complement the query in the related region and align
+again to test small inversions. Minimap2 truncates alignment if there is an
+inversion or the drop of score is greater than
+<I>INT1</I>. Decrease
+<I>INT2</I> to find small inversions at the cost of performance and false positives.
+Increase
+<I>INT1</I> to improves the contiguity of alignment at the cost of poor alignment in the
+middle.
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>-s</B><I> INT</I> </TD><TD valign=bottom>
+Minimal peak DP alignment score to output [40]. The peak score is computed from
+the final CIGAR. It is the score of the max scoring segment in the alignment
+and may be different from the total alignment score.
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>-u</B><I> CHAR</I> </TD><TD valign=bottom>
+How to find canonical splicing sites GT-AG -
+<B>f</B>: transcript strand;
+<B>b</B>: both strands;
+<B>n</B>: no attempt to match GT-AG [n]
+</TD></TR>
+<TR valign=top><TD colspan=2>
+<B>--end-bonus</B><I> INT</I> </TD></TR><TR valign=top><TD width=10%>&nbsp;</TD><TD>
+Score bonus when alignment extends to the end of the query sequence [0].
+</TD></TR>
+<TR valign=top><TD colspan=2>
+<B>--score-N</B><I> INT</I> </TD></TR><TR valign=top><TD width=10%>&nbsp;</TD><TD>
+Score of a mismatch involving ambiguous bases [1].
+</TD></TR>
+<TR valign=top><TD colspan=2>
+<B>--pe-ind-chain</B> </TD></TR><TR valign=top><TD width=10%>&nbsp;</TD><TD>
+For paired-end short reads, perform chaining for each end independently.
+By default, minimap2 chains the two ends together.
+</TD></TR>
+<TR valign=top><TD colspan=2>
+<B>--splice-flank</B>=<B>yes</B>|<B>no</B> </TD></TR><TR valign=top><TD width=10%>&nbsp;</TD><TD>
+Assume the next base to a
+<B>GT</B> donor site tends to be A/G (91% in human and 92% in mouse) and the preceding
+base to a
+<B>AG</B> acceptor tends to be C/T [no].
+This trend is evolutionarily conservative, all the way to S. cerevisiae
+(PMID:18688272). Specifying this option generally leads to higher junction
+accuracy by several percents, so it is applied by default with
+<B>--splice</B>. However, the SIRV control does not honor this trend
+(only ~60%). This option reduces accuracy. If you are benchmarking minimap2
+on SIRV data, please add
+<B>--splice-flank=no</B> to the command line.
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>--spsc</B> FILE </TD><TD valign=bottom>
+Splice scores []. Each line consists of five fields: 1) contig, 2) offset, 3) &#145;+&#146; or &#145;-&#146;, 4) &#145;D&#146; or &#145;A&#146;, and 5) score,
+where offset is the number of bases before a splice junction, &#145;D&#146; indicates the
+line corresponds to a donor site and &#145;A&#146; for an acceptor site.
+A positive score suggests the junction is preferred and a negative score
+suggests the junction is not preferred.
+</TD></TR>
+<TR valign=top><TD colspan=2>
+<B>--junc-pen</B> INT </TD></TR><TR valign=top><TD width=10%>&nbsp;</TD><TD>
+Penalty for a position not in FILE specified by
+<B>--spsc</B> [5]. Effective with
+<B>--spsc</B> but not
+<B>--junc-bed</B>. </TD></TR>
+<TR valign=top><TD colspan=2>
+<B>--junc-bed</B> FILE </TD></TR><TR valign=top><TD width=10%>&nbsp;</TD><TD>
+Gene annotations in the BED12 format (aka 12-column BED), or intron positions
+in 5-column BED. With this option, minimap2 prefers splicing in annotations.
+BED12 file can be converted from GTF/GFF3 with &#145;paftools.js gff2bed anno.gtf&#146;
+[].
+</TD></TR>
+<TR valign=top><TD colspan=2>
+<B>--junc-bonus</B> INT </TD></TR><TR valign=top><TD width=10%>&nbsp;</TD><TD>
+Score bonus for a splice donor or acceptor found in annotation [9]. Effective with
+<B>--junc-bed</B> but not
+<B>--spsc</B>. </TD></TR>
+<TR valign=top><TD colspan=2>
+<B>--end-seed-pen</B><I> INT</I> </TD></TR><TR valign=top><TD width=10%>&nbsp;</TD><TD>
+Drop a terminal anchor if
+<I>s</I>&lt;log(<I>g</I>)+<I>INT</I>, where
+<I>s</I> is the local alignment score around the anchor and
+<I>g</I> the length of the terminal gap in the chain. This option is only effective
+with
+<B>--splice</B>. It helps to avoid tiny terminal exons. [6]
+</TD></TR>
+<TR valign=top><TD colspan=2>
+<B>--no-end-flt</B> </TD></TR><TR valign=top><TD width=10%>&nbsp;</TD><TD>
+Don&#146;t filter seeds towards the ends of chains before performing base-level
+alignment.
+</TD></TR>
+<TR valign=top><TD colspan=2>
+<B>--cap-sw-mem</B><I> NUM</I> </TD></TR><TR valign=top><TD width=10%>&nbsp;</TD><TD>
+Skip alignment if the DP matrix size is above
+<I>NUM</I>. Set 0 to disable [100m].
+</TD></TR>
+<TR valign=top><TD colspan=2>
+<B>--cap-kalloc</B><I> NUM</I> </TD></TR><TR valign=top><TD width=10%>&nbsp;</TD><TD>
+Free thread-local kalloc memory reservoir if after the alignment the size of the reservoir above
+<I>NUM</I>. Set 0 to disable [500m].
+</TD></TR>
+<TR></TR></TABLE></BLOCKQUOTE>
+<A name=7></A>
+
+    <H4>&nbsp; &nbsp; Input/output options</H4>
+
+<BLOCKQUOTE>
+<TABLE cellpadding=3>
+<TR valign=top><TD width=10% nowrap>
+<B>-a</B> </TD><TD valign=bottom>
+Generate CIGAR and output alignments in the SAM format. Minimap2 outputs in PAF
+by default.
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>-o</B><I> FILE</I> </TD><TD valign=bottom>
+Output alignments to
+<I>FILE</I> [stdout].
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>-Q</B> </TD><TD valign=bottom>
+Ignore base quality in the input file.
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>-L</B> </TD><TD valign=bottom>
+Write CIGAR with &gt;65535 operators at the CG tag. Older tools are unable to
+convert alignments with &gt;65535 CIGAR ops to BAM. This option makes minimap2 SAM
+compatible with older tools. Newer tools recognizes this tag and reconstruct
+the real CIGAR in memory.
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>-R</B><I> STR</I> </TD><TD valign=bottom>
+SAM read group line in a format like
+<B>@RG\\tID:foo\\tSM:bar</B> [].
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>-y</B> </TD><TD valign=bottom>
+Copy input FASTA/Q comments to output.
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>-c</B> </TD><TD valign=bottom>
+Generate CIGAR. In PAF, the CIGAR is written to the &#145;cg&#146; custom tag.
+</TD></TR>
+<TR valign=top><TD colspan=2>
+<B>--cs[=</B><I>STR</I><B>]</B> </TD></TR><TR valign=top><TD width=10%>&nbsp;</TD><TD>
+Output the
+<B>cs</B> tag.
+<I>STR</I> can be either
+<I>short</I> or
+<I>long</I>. If no
+<I>STR</I> is given,
+<I>short</I> is assumed. [none]
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>--MD</B> </TD><TD valign=bottom>
+Output the MD tag (see the SAM spec).
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>--eqx</B> </TD><TD valign=bottom>
+Output =/X CIGAR operators for sequence match/mismatch.
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>-Y</B> </TD><TD valign=bottom>
+In SAM output, use soft clipping for supplementary alignments.
+</TD></TR>
+<TR valign=top><TD colspan=2>
+<B>--secondary-seq</B> </TD></TR><TR valign=top><TD width=10%>&nbsp;</TD><TD>
+In SAM output, show query sequences for secondary alignments.
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>--seed</B><I> INT</I> </TD><TD valign=bottom>
+Integer seed for randomizing equally best hits. Minimap2 hashes
+<I>INT</I> and read name when choosing between equally best hits. [11]
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>-t</B><I> INT</I> </TD><TD valign=bottom>
+Number of threads [3]. Minimap2 uses at most three threads when indexing target
+sequences, and uses up to
+<I>INT</I>+1 threads when mapping (the extra thread is for I/O, which is frequently idle and
+takes little CPU time).
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>-2</B> </TD><TD valign=bottom>
+Use two I/O threads during mapping. By default, minimap2 uses one I/O thread.
+When I/O is slow (e.g. piping to gzip, or reading from a slow pipe), the I/O
+thread may become the bottleneck. Apply this option to use one thread for input
+and another thread for output, at the cost of increased peak RAM.
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>-K</B><I> NUM</I> </TD><TD valign=bottom>
+Number of bases loaded into memory to process in a mini-batch [500M].
+Similar to option
+<B>-I</B>, K/M/G/k/m/g suffix is accepted. A large
+<I>NUM</I> helps load balancing in the multi-threading mode, at the cost of increased
+memory.
+</TD></TR>
+<TR valign=top><TD colspan=2>
+<B>--secondary</B>=<B>yes</B>|<B>no</B> </TD></TR><TR valign=top><TD width=10%>&nbsp;</TD><TD>
+Whether to output secondary alignments [yes]
+</TD></TR>
+<TR valign=top><TD colspan=2>
+<B>--max-qlen</B><I> NUM</I> </TD></TR><TR valign=top><TD width=10%>&nbsp;</TD><TD>
+Filter out query sequences longer than
+<I>NUM</I>. </TD></TR>
+<TR valign=top><TD colspan=2>
+<B>--paf-no-hit</B> </TD></TR><TR valign=top><TD width=10%>&nbsp;</TD><TD>
+In PAF, output unmapped queries; the strand and the reference name fields are
+set to &#145;*&#146;. Warning: some paftools.js commands may not work with such output
+for the moment.
+</TD></TR>
+<TR valign=top><TD colspan=2>
+<B>--sam-hit-only</B> </TD></TR><TR valign=top><TD width=10%>&nbsp;</TD><TD>
+In SAM, don&#146;t output unmapped reads.
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>--version</B> </TD><TD valign=bottom>
+Print version number to stdout
+</TD></TR>
+<TR></TR></TABLE></BLOCKQUOTE>
+<A name=8></A>
+
+    <H4>&nbsp; &nbsp; Preset options</H4>
+
+<BLOCKQUOTE>
+<TABLE cellpadding=3>
+<TR valign=top><TD width=10% nowrap>
+<B>-x</B><I> STR</I> </TD><TD valign=bottom>
+Preset []. This option applies multiple options at the same time. It should be
+applied before other options because options applied later will overwrite the
+values set by
+<B>-x</B>. Available
+<I>STR</I> are:
+<TABLE width=100% cellpadding=3><!-- tsb: Preset []. This option applies multiple options at the same time. It should be
+ -->
+<TR></TR><TR></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>map-ont</B> </TD><TD valign=bottom>
+Align noisy long reads of ~10% error rate to a reference genome. This is the
+default mode.
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>lr:hq</B> </TD><TD valign=bottom>
+Align accurate long reads (error rate &lt;1%) to a reference genome
+(<B>-k19</B> <B>-w19 -U50,500</B> <B>-g10k</B>). This was recommended by ONT developers for recent Nanopore reads
+produced with chemistry v14 that can reach ~99% in accuracy.
+It was shown to work better for accurate Nanopore reads
+than
+<B>map-hifi</B>. </TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>map-hifi</B> </TD><TD valign=bottom>
+Align PacBio high-fidelity (HiFi) reads to a reference genome
+(<B>-xlr:hq</B> <B>-A1 -B4 -O6,26 -E2,1</B> <B>-s200</B>). It differs from
+<B>lr:hq</B> only in scoring. It has not been tested whether
+<B>lr:hq</B> would work better for PacBio HiFi reads.
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>map-pb</B> </TD><TD valign=bottom>
+Align older PacBio continuous long (CLR) reads to a reference genome
+(<B>-Hk19</B>). Note that this data type is effectively deprecated by HiFi.
+Unless you work on very old data, you probably want to use
+<B>map-hifi</B> or
+<B>lr:hq</B>. </TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>map-iclr</B> </TD><TD valign=bottom>
+Align Illumina Complete Long Reads (ICLR) to a reference genome
+(<B>-k19</B> <B>-B6 -b4</B> <B>-O10,50</B>). This was recommended by Illumina developers.
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>asm5</B> </TD><TD valign=bottom>
+Long assembly to reference mapping
+(<B>-k19</B> <B>-w19 -U50,500 --rmq -r1k,100k -g10k -A1 -B19 -O39,81 -E3,1 -s200 -z200</B> <B>-N50</B>). Typically, the alignment will not extend to regions with 5% or higher sequence
+divergence. Use this preset if the average divergence is not much higher than 0.1%.
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>asm10</B> </TD><TD valign=bottom>
+Long assembly to reference mapping
+(<B>-k19</B> <B>-w19 -U50,500 --rmq -r1k,100k -g10k -A1 -B9 -O16,41 -E2,1 -s200 -z200</B> <B>-N50</B>). Use this if the average divergence is around 1%.
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>asm20</B> </TD><TD valign=bottom>
+Long assembly to reference mapping
+(<B>-k19</B> <B>-w10 -U50,500 --rmq -r1k,100k -g10k -A1 -B4 -O6,26 -E2,1 -s200 -z200</B> <B>-N50</B>). Use this if the average divergence is around several percent.
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>splice</B> </TD><TD valign=bottom>
+Long-read spliced alignment
+(<B>-k15</B> <B>-w5 --splice -g2k -G200k -A1 -B2 -O2,32 -E1,0 -C9 -z200 -ub --junc-bonus=9 --cap-sw-mem=0</B> <B>--splice-flank=yes</B>). In the splice mode, 1) long deletions are taken as introns and represented as
+the
+&#145;<B>N</B>&#146; CIGAR operator; 2) long insertions are disabled; 3) deletion and insertion gap
+costs are different during chaining; 4) the computation of the
+&#145;<B>ms</B>&#146; tag ignores introns to demote hits to pseudogenes.
+</TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>splice:hq</B> </TD><TD valign=bottom>
+Spliced alignment for accurate long RNA-seq reads such as PacBio iso-seq
+(<B>-xsplice</B> <B>-C5 -O6,24</B> <B>-B4</B>). </TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>splice:sr</B> </TD><TD valign=bottom>
+Spliced alignment for short RNA-seq reads
+(<B>-xsplice:hq</B> <B>--frag=yes --end-bonus=10 -2K50m --heap-sort=yes --pe-ind-chain</B> <B>--secondary=no</B>). </TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>sr</B> </TD><TD valign=bottom>
+Short-read alignment without splicing
+(<B>-k21</B> <B>-w11 --sr --frag=yes -A2 -B8 -O12,32 -E2,1 -r100 -p.5 -N20 -f1000,5000 -n2 -m25</B> <B>-s40 -g100 -2K50m --heap-sort=yes</B> <B>--secondary=no</B>). </TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>ava-pb</B> </TD><TD valign=bottom>
+PacBio CLR all-vs-all overlap mapping
+(<B>-Hk19</B> <B>-Xw5 -e0</B> <B>-m100</B>). </TD></TR>
+<TR valign=top><TD width=10% nowrap>
+<B>ava-ont</B> </TD><TD valign=bottom>
+Oxford Nanopore all-vs-all overlap mapping
+(<B>-k15</B> <B>-Xw5 -e0 -m100</B> <B>-r2k</B>). </TD></TR>
+<TR></TR></TABLE></TD></TR>
+<TR></TR></TABLE></BLOCKQUOTE>
+<A name=9></A>
+
+    <H4>&nbsp; &nbsp; Miscellaneous options</H4>
+
+<BLOCKQUOTE>
+<TABLE cellpadding=3>
+<TR valign=top><TD colspan=2>
+<B>--no-kalloc</B> </TD></TR><TR valign=top><TD width=10%>&nbsp;</TD><TD>
+Use the libc default allocator instead of the kalloc thread-local allocator.
+This debugging option is mostly used with Valgrind to detect invalid memory
+accesses. Minimap2 runs slower with this option, especially in the
+multi-threading mode.
+</TD></TR>
+<TR valign=top><TD colspan=2>
+<B>--print-qname</B> </TD></TR><TR valign=top><TD width=10%>&nbsp;</TD><TD>
+Print query names to stderr, mostly to see which query is crashing minimap2.
+</TD></TR>
+<TR valign=top><TD colspan=2>
+<B>--print-seeds</B> </TD></TR><TR valign=top><TD width=10%>&nbsp;</TD><TD>
+Print seed positions to stderr, for debugging only.
+</TD></TR>
+<TR></TR></TABLE></BLOCKQUOTE>
+<A name=10></A>
+
+     <H3>OUTPUT FORMAT</H3>
+
+
+<BLOCKQUOTE>
+<P>
+Minimap2 outputs mapping positions in the Pairwise mApping Format (PAF) by
+default. PAF is a TAB-delimited text format with each line consisting of at
+least 12 fields as are described in the following table:
+<P><BLOCKQUOTE><div id='tbl'><TABLE border=1 cellspacing=0 cellpadding=3>
+<TR valign=top>
+<TD align=center><B>Col</B></TD><TD align=center><B>Type</B></TD><TD align=center><B>Description</B></TD></TR>
+<TR></TR><TR></TR>
+<TR valign=top>
+<TD align=right>1</TD><TD align=center>string</TD><TD>Query sequence name</TD></TR>
+<TR valign=top>
+<TD align=right>2</TD><TD align=center>int</TD><TD>Query sequence length</TD></TR>
+<TR valign=top>
+<TD align=right>3</TD><TD align=center>int</TD><TD>Query start coordinate (0-based)</TD></TR>
+<TR valign=top>
+<TD align=right>4</TD><TD align=center>int</TD><TD>Query end coordinate (0-based)</TD></TR>
+<TR valign=top>
+<TD align=right>5</TD><TD align=center>char</TD><TD>&#145;+&#146; if query/target on the same strand; &#145;-&#146; if opposite</TD></TR>
+<TR valign=top>
+<TD align=right>6</TD><TD align=center>string</TD><TD>Target sequence name</TD></TR>
+<TR valign=top>
+<TD align=right>7</TD><TD align=center>int</TD><TD>Target sequence length</TD></TR>
+<TR valign=top>
+<TD align=right>8</TD><TD align=center>int</TD><TD>Target start coordinate on the original strand</TD></TR>
+<TR valign=top>
+<TD align=right>9</TD><TD align=center>int</TD><TD>Target end coordinate on the original strand</TD></TR>
+<TR valign=top>
+<TD align=right>10</TD><TD align=center>int</TD><TD>Number of matching bases in the mapping</TD></TR>
+<TR valign=top>
+<TD align=right>11</TD><TD align=center>int</TD><TD>Number bases, including gaps, in the mapping</TD></TR>
+<TR valign=top>
+<TD align=right>12</TD><TD align=center>int</TD><TD>Mapping quality (0-255 with 255 for missing)</TD></TR>
+</TABLE></div></BLOCKQUOTE>
+<P>
+<P>
+When alignment is available, column 11 gives the total number of sequence
+matches, mismatches and gaps in the alignment; column 10 divided by column 11
+gives the BLAST-like alignment identity. When alignment is unavailable,
+these two columns are approximate. PAF may optionally have additional fields in
+the SAM-like typed key-value format. Minimap2 may output the following tags:
+<P><BLOCKQUOTE><div id='tbl'><TABLE border=1 cellspacing=0 cellpadding=3>
+<TR valign=top>
+<TD align=center><B>Tag</B></TD><TD align=center><B>Type</B></TD><TD align=center><B>Description</B></TD></TR>
+<TR></TR><TR></TR>
+<TR valign=top>
+<TD align=right>tp</TD><TD align=center>A</TD><TD>Type of aln: P/primary, S/secondary and I,i/inversion</TD></TR>
+<TR valign=top>
+<TD align=right>cm</TD><TD align=center>i</TD><TD>Number of minimizers on the chain</TD></TR>
+<TR valign=top>
+<TD align=right>s1</TD><TD align=center>i</TD><TD>Chaining score</TD></TR>
+<TR valign=top>
+<TD align=right>s2</TD><TD align=center>i</TD><TD>Chaining score of the best secondary chain</TD></TR>
+<TR valign=top>
+<TD align=right>NM</TD><TD align=center>i</TD><TD>Total number of mismatches and gaps in the alignment</TD></TR>
+<TR valign=top>
+<TD align=right>MD</TD><TD align=center>Z</TD><TD>To generate the ref sequence in the alignment</TD></TR>
+<TR valign=top>
+<TD align=right>AS</TD><TD align=center>i</TD><TD>DP alignment score</TD></TR>
+<TR valign=top>
+<TD align=right>SA</TD><TD align=center>Z</TD><TD>List of other supplementary alignments (with approximate CIGAR strings)</TD></TR>
+<TR valign=top>
+<TD align=right>ms</TD><TD align=center>i</TD><TD>DP score of the max scoring segment in the alignment</TD></TR>
+<TR valign=top>
+<TD align=right>nn</TD><TD align=center>i</TD><TD>Number of ambiguous bases in the alignment</TD></TR>
+<TR valign=top>
+<TD align=right>ts</TD><TD align=center>A</TD><TD>Transcript strand (splice mode only)</TD></TR>
+<TR valign=top>
+<TD align=right>cg</TD><TD align=center>Z</TD><TD>CIGAR string (only in PAF)</TD></TR>
+<TR valign=top>
+<TD align=right>cs</TD><TD align=center>Z</TD><TD>Difference string</TD></TR>
+<TR valign=top>
+<TD align=right>dv</TD><TD align=center>f</TD><TD>Approximate per-base sequence divergence</TD></TR>
+<TR valign=top>
+<TD align=right>de</TD><TD align=center>f</TD><TD>Gap-compressed per-base sequence divergence</TD></TR>
+<TR valign=top>
+<TD align=right>rl</TD><TD align=center>i</TD><TD>Length of query regions harboring repetitive seeds</TD></TR>
+</TABLE></div></BLOCKQUOTE>
+<P>
+<P>
+The
+<B>cs</B> tag encodes difference sequences in the short form or the entire query
+<I>AND</I> reference sequences in the long form. It consists of a series of operations:
+<P><BLOCKQUOTE><div id='tbl'><TABLE border=1 cellspacing=0 cellpadding=3>
+<TR valign=top>
+<TD align=center><B>Op</B></TD><TD align=center><B>Regex</B></TD><TD align=center><B>Description</B></TD></TR>
+<TR></TR><TR></TR>
+<TR valign=top>
+<TD align=right> =</TD><TD>[ACGTN]+</TD><TD>Identical sequence (long form)</TD></TR>
+<TR valign=top>
+<TD align=right> :</TD><TD>[0-9]+</TD><TD>Identical sequence length</TD></TR>
+<TR valign=top>
+<TD align=right> *</TD><TD>[acgtn][acgtn]</TD><TD>Substitution: ref to query</TD></TR>
+<TR valign=top>
+<TD align=right> +</TD><TD>[acgtn]+</TD><TD>Insertion to the reference</TD></TR>
+<TR valign=top>
+<TD align=right> -</TD><TD>[acgtn]+</TD><TD>Deletion from the reference</TD></TR>
+<TR valign=top>
+<TD align=right> ~</TD><TD>[acgtn]{2}[0-9]+[acgtn]{2}</TD><TD>Intron length and splice signal</TD></TR>
+</TABLE></div></BLOCKQUOTE>
+<P>
+</BLOCKQUOTE>
+<A name=11></A>
+
+     <H3>LIMITATIONS</H3>
+
+
+<BLOCKQUOTE>
+<TABLE cellpadding=3>
+<TR valign=top><TD width=2% nowrap>
+*
+</TD><TD valign=bottom>
+Minimap2 may produce suboptimal alignments through long low-complexity regions
+where seed positions may be suboptimal. This should not be a big concern
+because even the optimal alignment may be wrong in such regions.
+</TD></TR>
+<TR valign=top><TD width=2% nowrap>
+*
+</TD><TD valign=bottom>
+Minimap2 requires SSE2 or NEON instructions to compile. It is possible to add
+non-SSE2/NEON support, but it would make minimap2 slower by several times.
+</TD></TR>
+<TR></TR></TABLE></BLOCKQUOTE>
+<A name=12></A>
+
+     <H3>SEE ALSO</H3>
+
+
+<BLOCKQUOTE>
+<P>
+miniasm(1), minimap(1), bwa(1).
+</BLOCKQUOTE>
+<P><HR>
+<TABLE width=100%><TR> <TD width=33%><I>minimap2-2.28-dirty (r1237)</I></TD> <TD width=33% align=center>minimap2 (1)</TD> <TD align=right width=33%><I>30 March 2025</I></TD> </TR></TABLE></div></BODY></HTML>

misc.c

@@ -1,117 +0,0 @@
-#include "minimap.h"
-
-int mm_verbose = 3;
-int mm_dbg_flag = 0;
-double mm_realtime0;
-
-#if defined(WIN32) || defined(_WIN32)
-#include <windows.h>
-
-struct timezone
-{
-  __int32  tz_minuteswest; /* minutes W of Greenwich */
-  int  tz_dsttime;     /* type of dst correction */
-};
-
-/*
- * gettimeofday.c
- *    Win32 gettimeofday() replacement
- *    taken from PostgreSQL, according to
- *    https://stackoverflow.com/questions/1676036/what-should-i-use-to-replace-gettimeofday-on-windows
- *
- * src/port/gettimeofday.c
- *
- * Copyright (c) 2003 SRA, Inc.
- * Copyright (c) 2003 SKC, Inc.
- *
- * Permission to use, copy, modify, and distribute this software and
- * its documentation for any purpose, without fee, and without a
- * written agreement is hereby granted, provided that the above
- * copyright notice and this paragraph and the following two
- * paragraphs appear in all copies.
- *
- * IN NO EVENT SHALL THE AUTHOR BE LIABLE TO ANY PARTY FOR DIRECT,
- * INDIRECT, SPECIAL, INCIDENTAL, OR CONSEQUENTIAL DAMAGES, INCLUDING
- * LOST PROFITS, ARISING OUT OF THE USE OF THIS SOFTWARE AND ITS
- * DOCUMENTATION, EVEN IF THE UNIVERSITY OF CALIFORNIA HAS BEEN ADVISED
- * OF THE POSSIBILITY OF SUCH DAMAGE.
- *
- * THE AUTHOR SPECIFICALLY DISCLAIMS ANY WARRANTIES, INCLUDING, BUT NOT
- * LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR
- * A PARTICULAR PURPOSE.  THE SOFTWARE PROVIDED HEREUNDER IS ON AN "AS
- * IS" BASIS, AND THE AUTHOR HAS NO OBLIGATIONS TO PROVIDE MAINTENANCE,
- * SUPPORT, UPDATES, ENHANCEMENTS, OR MODIFICATIONS.
- */
-
-/* FILETIME of Jan 1 1970 00:00:00. */
-static const unsigned __int64 epoch = ((unsigned __int64) 116444736000000000ULL);
-
-/*
- * timezone information is stored outside the kernel so tzp isn't used anymore.
- *
- * Note: this function is not for Win32 high precision timing purpose. See
- * elapsed_time().
- */
-int gettimeofday(struct timeval * tp, struct timezone *tzp)
-{
-    FILETIME    file_time;
-    SYSTEMTIME  system_time;
-    ULARGE_INTEGER ularge;
-
-    GetSystemTime(&system_time);
-    SystemTimeToFileTime(&system_time, &file_time);
-    ularge.LowPart = file_time.dwLowDateTime;
-    ularge.HighPart = file_time.dwHighDateTime;
-
-    tp->tv_sec = (long) ((ularge.QuadPart - epoch) / 10000000L);
-    tp->tv_usec = (long) (system_time.wMilliseconds * 1000);
-
-    return 0;
-}
-
-// taken from https://stackoverflow.com/questions/5272470/c-get-cpu-usage-on-linux-and-windows
-double cputime()
-{
-	HANDLE hProcess = GetCurrentProcess();
-	FILETIME ftCreation, ftExit, ftKernel, ftUser;
-	SYSTEMTIME stKernel;
-	SYSTEMTIME stUser;
-
-	GetProcessTimes(hProcess, &ftCreation, &ftExit, &ftKernel, &ftUser);
-	FileTimeToSystemTime(&ftKernel, &stKernel);
-	FileTimeToSystemTime(&ftUser, &stUser);
-
-	double kernelModeTime = ((stKernel.wHour * 60.) + stKernel.wMinute * 60.) + stKernel.wSecond * 1. + stKernel.wMilliseconds / 1000.;
-	double userModeTime = ((stUser.wHour * 60.) + stUser.wMinute * 60.) + stUser.wSecond * 1. + stUser.wMilliseconds / 1000.;
-
-	return kernelModeTime + userModeTime;
-}
-#else
-#include <sys/resource.h>
-#include <sys/time.h>
-
-double cputime()
-{
-	struct rusage r;
-	getrusage(RUSAGE_SELF, &r);
-	return r.ru_utime.tv_sec + r.ru_stime.tv_sec + 1e-6 * (r.ru_utime.tv_usec + r.ru_stime.tv_usec);
-}
-#endif /* WIN32 || _WIN32 */
-
-double realtime()
-{
-	struct timeval tp;
-	struct timezone tzp;
-	gettimeofday(&tp, &tzp);
-	return tp.tv_sec + tp.tv_usec * 1e-6;
-}
-
-#include "ksort.h"
-
-#define sort_key_128x(a) ((a).x)
-KRADIX_SORT_INIT(128x, mm128_t, sort_key_128x, 8) 
-
-#define sort_key_64(x) (x)
-KRADIX_SORT_INIT(64, uint64_t, sort_key_64, 8)
-
-KSORT_INIT_GENERIC(uint32_t)

misc/README.md

@@ -1,28 +0,0 @@
-The [K8 Javascript shell][k8] is needed to run Javascripts in this directory.
-Precompiled k8 binaries for Mac and Linux can be found at the [K8 release
-page][k8bin].
-
-* [paf2aln.js](paf2aln.js): convert PAF to [MAF][maf] or BLAST-like output for
-  eyeballing. PAF has to be generated with minimap2 option `-S`, which writes
-  the aligned sequences to the `cs` tag. An example:
-  ```sh
-  ../minimap2 -S ../test/MT-*.fa | k8 paf2aln.js /dev/stdin
-  ```
-
-* [mapstat.js](mapstat.js): output basic statistics such as the number of
-  non-redundant mapped bases, number of split and secondary alignments and
-  number of long gaps. This scripts seamlessly works with both SAM and PAF.
-
-* [sim-pbsim.js](sim-pbsim.js): convert reads simulated with [PBSIM][pbsim] to
-  FASTA and encode the true mapping positions to read names in a format like
-  `S1_33!chr1!225258409!225267761!-`.
-
-* [sim-eval.js](sim-eval.js): evaluate mapping accuracy for FASTA generated
-  with [sim-pbsim.js](sim-pbsim.js) or [sim-mason2.js](sim-mason2.js).
-
-* [sam2paf.js](sam2paf.js): convert SAM to PAF.
-
-[k8]: https://github.com/attractivechaos/k8
-[k8bin]: https://github.com/attractivechaos/k8/releases
-[maf]: https://genome.ucsc.edu/FAQ/FAQformat#format5
-[pbsim]: https://github.com/pfaucon/PBSIM-PacBio-Simulator

misc/intron-eval.js

@@ -1,266 +0,0 @@
-/*******************************
- * Command line option parsing *
- *******************************/
-
-var getopt = function(args, ostr) {
-	var oli; // option letter list index
-	if (typeof(getopt.place) == 'undefined')
-		getopt.ind = 0, getopt.arg = null, getopt.place = -1;
-	if (getopt.place == -1) { // update scanning pointer
-		if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
-			getopt.place = -1;
-			return null;
-		}
-		if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
-			++getopt.ind;
-			getopt.place = -1;
-			return null;
-		}
-	}
-	var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
-	if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
-		if (optopt == '-') return null; //  if the user didn't specify '-' as an option, assume it means null.
-		if (getopt.place < 0) ++getopt.ind;
-		return '?';
-	}
-	if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
-		getopt.arg = null;
-		if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
-	} else { // need an argument
-		if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
-			getopt.arg = args[getopt.ind].substr(getopt.place);
-		else if (args.length <= ++getopt.ind) { // no arg
-			getopt.place = -1;
-			if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
-			return '?';
-		} else getopt.arg = args[getopt.ind]; // white space
-		getopt.place = -1;
-		++getopt.ind;
-	}
-	return optopt;
-}
-
-/***********************
- * Interval operations *
- ***********************/
-
-Interval = {};
-
-Interval.sort = function(a)
-{
-	if (typeof a[0] == 'number')
-		a.sort(function(x, y) { return x - y });
-	else a.sort(function(x, y) { return x[0] != y[0]? x[0] - y[0] : x[1] - y[1] });
-}
-
-Interval.merge = function(a, sorted)
-{
-	if (typeof sorted == 'undefined') sorted = true;
-	if (!sorted) Interval.sort(a);
-	var k = 0;
-	for (var i = 1; i < a.length; ++i) {
-		if (a[k][1] >= a[i][0])
-			a[k][1] = a[k][1] > a[i][1]? a[k][1] : a[i][1];
-		else a[++k] = a[i].slice(0);
-	}
-	a.length = k + 1;
-}
-
-Interval.index_end = function(a, sorted)
-{
-	if (a.length == 0) return;
-	if (typeof sorted == 'undefined') sorted = true;
-	if (!sorted) Interval.sort(a);
-	a[0].push(0);
-	var k = 0, k_en = a[0][1];
-	for (var i = 1; i < a.length; ++i) {
-		if (k_en <= a[i][0]) {
-			for (++k; k < i; ++k)
-				if (a[k][1] > a[i][0])
-					break;
-			k_en = a[k][1];
-		}
-		a[i].push(k);
-	}
-}
-
-Interval.find_intv = function(a, x)
-{
-	var left = -1, right = a.length;
-	if (typeof a[0] == 'number') {
-		while (right - left > 1) {
-			var mid = left + ((right - left) >> 1);
-			if (a[mid] > x) right = mid;
-			else if (a[mid] < x) left = mid;
-			else return mid;
-		}
-	} else {
-		while (right - left > 1) {
-			var mid = left + ((right - left) >> 1);
-			if (a[mid][0] > x) right = mid;
-			else if (a[mid][0] < x) left = mid;
-			else return mid;
-		}
-	}
-	return left;
-}
-
-Interval.find_ovlp = function(a, st, en)
-{
-	if (a.length == 0 || st >= en) return [];
-	var l = Interval.find_intv(a, st);
-	var k = l < 0? 0 : a[l][a[l].length - 1];
-	var b = [];
-	for (var i = k; i < a.length; ++i) {
-		if (a[i][0] >= en) break;
-		else if (st < a[i][1])
-			b.push(a[i]);
-	}
-	return b;
-}
-
-/*****************
- * Main function *
- *****************/
-
-var c, l_fuzzy = 0, print_ovlp = false, print_err_only = false, first_only = false;
-while ((c = getopt(arguments, "l:ep")) != null) {
-	if (c == 'l') l_fuzzy = parseInt(getopt.arg);
-	else if (c == 'e') print_err_only = print_ovlp = true;
-	else if (c == 'p') print_ovlp = true;
-}
-
-if (arguments.length - getopt.ind < 2) {
-	print("Usage: k8 intron-eval.js [options] <gene.gtf> <aln.sam>");
-	exit(1);
-}
-
-var file, buf = new Bytes();
-
-var tr = {};
-file = new File(arguments[getopt.ind]);
-while (file.readline(buf) >= 0) {
-	var m, t = buf.toString().split("\t");
-	if (t[0].charAt(0) == '#') continue;
-	if (t[2] != 'exon') continue;
-	var st = parseInt(t[3]) - 1;
-	var en = parseInt(t[4]);
-	if ((m = /transcript_id "(\S+)"/.exec(t[8])) == null) continue;
-	var tid = m[1];
-	if (tr[tid] == null) tr[tid] = [t[0], t[6], 0, 0, []];
-	tr[tid][4].push([st, en]);
-}
-file.close();
-
-var anno = {};
-for (var tid in tr) {
-	var t = tr[tid];
-	Interval.sort(t[4]);
-	t[2] = t[4][0][0];
-	t[3] = t[4][t[4].length - 1][1];
-	if (anno[t[0]] == null) anno[t[0]] = [];
-	var s = t[4];
-	for (var i = 0; i < s.length - 1; ++i) {
-		if (s[i][1] >= s[i+1][0]) throw Error("ERROR: wrong annotation!");
-		anno[t[0]].push([s[i][1], s[i+1][0]]);
-	}
-}
-tr = null;
-
-for (var chr in anno) {
-	var e = anno[chr];
-	if (e.length == 0) continue;
-	Interval.sort(e);
-	var k = 0;
-	for (var i = 1; i < e.length; ++i) // dedup
-		if (e[i][0] != e[k][0] || e[i][1] != e[k][1])
-			e[++k] = e[i].slice(0);
-	e.length = k + 1;
-	Interval.index_end(e);
-}
-
-var n_pri = 0, n_unmapped = 0, n_mapped = 0;
-var n_sgl = 0, n_splice = 0, n_splice_hit = 0, n_splice_novel = 0;
-
-file = new File(arguments[getopt.ind+1]);
-var last_qname = null;
-var re_cigar = /(\d+)([MIDNSHX=])/g;
-while (file.readline(buf) >= 0) {
-	var m, t = buf.toString().split("\t");
-
-	if (t[0].charAt(0) == '@') continue;
-	var flag = parseInt(t[1]);
-	if (flag&0x100) continue;
-	if (first_only && last_qname == t[0]) continue;
-	if (t[2] == '*') {
-		++n_unmapped;
-		continue;
-	} else {
-		++n_pri;
-		if (last_qname != t[0]) ++n_mapped;
-	}
-
-	var pos = parseInt(t[3]) - 1, intron = [];
-	while ((m = re_cigar.exec(t[5])) != null) {
-		var len = parseInt(m[1]), op = m[2];
-		if (op == 'N') {
-			intron.push([pos, pos + len]);
-			pos += len;
-		} else if (op == 'M' || op == 'X' || op == '=' || op == 'D') pos += len;
-	}
-	if (intron.length == 0) {
-		++n_sgl;
-		continue;
-	}
-	n_splice += intron.length;
-
-	var chr = anno[t[2]];
-	if (chr != null) {
-		for (var i = 0; i < intron.length; ++i) {
-			var o = Interval.find_ovlp(chr, intron[i][0], intron[i][1]);
-			if (o.length > 0) {
-				var hit = false;
-				for (var j = 0; j < o.length; ++j) {
-					var st_diff = intron[i][0] - o[j][0];
-					var en_diff = intron[i][1] - o[j][1];
-					if (st_diff < 0) st_diff = -st_diff;
-					if (en_diff < 0) en_diff = -en_diff;
-					if (st_diff <= l_fuzzy && en_diff <= l_fuzzy)
-						++n_splice_hit, hit = true;
-					if (hit) break;
-				}
-				if (print_ovlp) {
-					var type = hit? 'C' : 'P';
-					if (hit && print_err_only) continue;
-					var x = '[';
-					for (var j = 0; j < o.length; ++j) {
-						if (j) x += ', ';
-						x += '(' + o[j][0] + "," + o[j][1] + ')';
-					}
-					x += ']';
-					print(type, t[0], i+1, t[2], intron[i][0], intron[i][1], x);
-				}
-			} else {
-				++n_splice_novel;
-				if (print_ovlp)
-					print('N', t[0], i+1, t[2], intron[i][0], intron[i][1]);
-			}
-		}
-	} else {
-		n_splice_novel += intron.length;
-	}
-	last_qname = t[0];
-}
-file.close();
-
-buf.destroy();
-
-if (!print_ovlp) {
-	print("# unmapped reads: " + n_unmapped);
-	print("# mapped reads: " + n_mapped);
-	print("# primary alignments: " + n_pri);
-	print("# singletons: " + n_sgl);
-	print("# predicted introns: " + n_splice);
-	print("# non-overlapping introns: " + n_splice_novel);
-	print("# correct introns: " + n_splice_hit + " (" + (n_splice_hit / n_splice * 100).toFixed(2) + "%)");
-}

misc/mapstat.js

@@ -1,183 +0,0 @@
-var getopt = function(args, ostr) {
-	var oli; // option letter list index
-	if (typeof(getopt.place) == 'undefined')
-		getopt.ind = 0, getopt.arg = null, getopt.place = -1;
-	if (getopt.place == -1) { // update scanning pointer
-		if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
-			getopt.place = -1;
-			return null;
-		}
-		if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
-			++getopt.ind;
-			getopt.place = -1;
-			return null;
-		}
-	}
-	var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
-	if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
-		if (optopt == '-') return null; //  if the user didn't specify '-' as an option, assume it means null.
-		if (getopt.place < 0) ++getopt.ind;
-		return '?';
-	}
-	if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
-		getopt.arg = null;
-		if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
-	} else { // need an argument
-		if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
-			getopt.arg = args[getopt.ind].substr(getopt.place);
-		else if (args.length <= ++getopt.ind) { // no arg
-			getopt.place = -1;
-			if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
-			return '?';
-		} else getopt.arg = args[getopt.ind]; // white space
-		getopt.place = -1;
-		++getopt.ind;
-	}
-	return optopt;
-}
-
-var c, gap_out_len = null;
-while ((c = getopt(arguments, "l:")) != null)
-	if (c == 'l') gap_out_len = parseInt(getopt.arg);
-
-if (getopt.ind == arguments.length) {
-	print("Usage: k8 mapstat.js [-l gapOutLen] <in.sam>|<in.paf>");
-	exit(1);
-}
-
-var buf = new Bytes();
-var file = new File(arguments[getopt.ind]);
-var re = /(\d+)([MIDSHNX=])/g;
-
-var lineno = 0, n_pri = 0, n_2nd = 0, n_seq = 0, n_cigar_64k = 0, l_tot = 0, l_cov = 0;
-var n_gap = [[0, 0, 0, 0, 0, 0], [0, 0, 0, 0, 0, 0]];
-
-function cov_len(regs)
-{
-	regs.sort(function(a,b) {return a[0]-b[0]});
-	var st = regs[0][0], en = regs[0][1], l = 0;
-	for (var i = 1; i < regs.length; ++i) {
-		if (regs[i][0] < en)
-			en = en > regs[i][1]? en : regs[i][1];
-		else l += en - st, st = regs[i][0], en = regs[i][1];
-	}
-	l += en - st;
-	return l;
-}
-
-var last = null, last_qlen = null, regs = [];
-while (file.readline(buf) >= 0) {
-	var line = buf.toString();
-	++lineno;
-	if (line.charAt(0) != '@') {
-		var t = line.split("\t", 12);
-		var m, rs, cigar = null, is_pri = false, is_sam = false, is_rev = false, tname = null;
-		var atlen = null, aqlen, qs, qe, mapq, ori_qlen;
-		if (t[4] == '+' || t[4] == '-') { // PAF
-			if (!/\ts2:i:\d+/.test(line)) {
-				++n_2nd;
-				continue;
-			}
-			if ((m = /\tcg:Z:(\S+)/.exec(line)) != null)
-				cigar = m[1];
-			if (cigar == null) {
-				warn("WARNING: no CIGAR at line " + lineno);
-				continue;
-			}
-			tname = t[5];
-			qs = parseInt(t[2]), qe = parseInt(t[3]);
-			aqlen = qe - qs;
-			is_rev = t[4] == '+'? false : true;
-			rs = parseInt(t[7]);
-			atlen = parseInt(t[8]) - rs;
-			mapq = parseInt(t[11]);
-			ori_qlen = parseInt(t[1]);
-		} else { // SAM
-			var flag = parseInt(t[1]);
-			if ((flag & 4) || t[2] == '*' || t[5] == '*') continue;
-			if (flag & 0x100) {
-				++n_2nd;
-				continue;
-			}
-			cigar = t[5];
-			tname = t[2];
-			rs = parseInt(t[3]) - 1;
-			mapq = parseInt(t[4]);
-			aqlen = t[9].length;
-			is_sam = true;
-			is_rev = !!(flag&0x10);
-		}
-		++n_pri;
-		if (last != t[0]) {
-			if (last != null) {
-				l_tot += last_qlen;
-				l_cov += cov_len(regs);
-			}
-			regs = [];
-			++n_seq, last = t[0];
-		}
-		var M = 0, tl = 0, ql = 0, clip = [0, 0], n_cigar = 0, sclip = 0;
-		while ((m = re.exec(cigar)) != null) {
-			var l = parseInt(m[1]);
-			++n_cigar;
-			if (m[2] == 'M' || m[2] == '=' || m[2] == 'X') {
-				tl += l, ql += l, M += l;
-			} else if (m[2] == 'I' || m[2] == 'D') {
-				var type;
-				if (l < 50) type = 0;
-				else if (l < 100) type = 1;
-				else if (l < 300) type = 2;
-				else if (l < 400) type = 3;
-				else if (l < 1000) type = 4;
-				else type = 5;
-				if (m[2] == 'I') ql += l, ++n_gap[0][type];
-				else tl += l, ++n_gap[1][type];
-				if (gap_out_len != null && l >= gap_out_len)
-					print(t[0], ql, is_rev? '-' : '+', tname, rs + tl, m[2], l);
-			} else if (m[2] == 'N') {
-				tl += l;
-			} else if (m[2] == 'S') {
-				clip[M == 0? 0 : 1] = l, sclip += l;
-			} else if (m[2] == 'H') {
-				clip[M == 0? 0 : 1] = l;
-			}
-		}
-		if (n_cigar > 65535) ++n_cigar_64k;
-		if (ql + sclip != aqlen)
-			warn("WARNING: aligned query length is inconsistent with CIGAR at line " + lineno + " (" + (ql+sclip) + " != " + aqlen + ")");
-		if (atlen != null && atlen != tl)
-			warn("WARNING: aligned reference length is inconsistent with CIGAR at line " + lineno);
-		if (is_sam) {
-			qs = clip[is_rev? 1 : 0], qe = qs + ql;
-			ori_qlen = clip[0] + ql + clip[1];
-		}
-		regs.push([qs, qe]);
-		last_qlen = ori_qlen;
-	}
-}
-l_tot += last_qlen;
-l_cov += cov_len(regs);
-
-file.close();
-buf.destroy();
-
-if (gap_out_len == null) {
-	print("Number of mapped sequences: " + n_seq);
-	print("Number of primary alignments: " + n_pri);
-	print("Number of secondary alignments: " + n_2nd);
-	print("Number of primary alignments with >65535 CIGAR operations: " + n_cigar_64k);
-	print("Number of bases in mapped sequences: " + l_tot);
-	print("Number of mapped bases: " + l_cov);
-	print("Number of insertions in [0,50): " + n_gap[0][0]);
-	print("Number of insertions in [50,100): " + n_gap[0][1]);
-	print("Number of insertions in [100,300): " + n_gap[0][2]);
-	print("Number of insertions in [300,400): " + n_gap[0][3]);
-	print("Number of insertions in [400,1000): " + n_gap[0][4]);
-	print("Number of insertions in [1000,inf): " + n_gap[0][5]);
-	print("Number of deletions in [0,50): " + n_gap[1][0]);
-	print("Number of deletions in [50,100): " + n_gap[1][1]);
-	print("Number of deletions in [100,300): " + n_gap[1][2]);
-	print("Number of deletions in [300,400): " + n_gap[1][3]);
-	print("Number of deletions in [400,1000): " + n_gap[1][4]);
-	print("Number of deletions in [1000,inf): " + n_gap[1][5]);
-}

misc/paf2aln.js

@@ -1,171 +0,0 @@
-var getopt = function(args, ostr) {
-	var oli; // option letter list index
-	if (typeof(getopt.place) == 'undefined')
-		getopt.ind = 0, getopt.arg = null, getopt.place = -1;
-	if (getopt.place == -1) { // update scanning pointer
-		if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
-			getopt.place = -1;
-			return null;
-		}
-		if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
-			++getopt.ind;
-			getopt.place = -1;
-			return null;
-		}
-	}
-	var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
-	if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
-		if (optopt == '-') return null; //  if the user didn't specify '-' as an option, assume it means null.
-		if (getopt.place < 0) ++getopt.ind;
-		return '?';
-	}
-	if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
-		getopt.arg = null;
-		if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
-	} else { // need an argument
-		if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
-			getopt.arg = args[getopt.ind].substr(getopt.place);
-		else if (args.length <= ++getopt.ind) { // no arg
-			getopt.place = -1;
-			if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
-			return '?';
-		} else getopt.arg = args[getopt.ind]; // white space
-		getopt.place = -1;
-		++getopt.ind;
-	}
-	return optopt;
-}
-
-var c, maf_out = false, line_len = 80;
-while ((c = getopt(arguments, "ml:")) != null) {
-	if (c == 'm') maf_out = true;
-	else if (c == 'l') line_len = parseInt(getopt.arg); // TODO: not implemented yet
-}
-if (line_len == 0) line_len = 0x7fffffff;
-
-if (getopt.ind == arguments.length) {
-	print("Usage: k8 paf2aln.js [options] <with-cs.paf>");
-	print("Options:");
-	print("  -m        MAF output (BLAST-like output by default)");
-	print("  -l INT    line length in BLAST-like output [80]");
-	print("");
-	print("Note: this script only works when minimap2 is run with option '-S'");
-	exit(1);
-}
-
-function padding_str(x, len, right)
-{
-	var s = x.toString();
-	if (s.length < len) {
-		if (right) s += Array(len - s.length + 1).join(" ");
-		else s = Array(len - s.length + 1).join(" ") + s;
-	}
-	return s;
-}
-
-function update_aln(s_ref, s_qry, s_mid, type, seq, slen)
-{
-	var l = type == '*'? 1 : seq.length;
-	if (type == '=') {
-		s_ref.set(seq);
-		s_qry.set(seq);
-		s_mid.set(Array(l+1).join("|"));
-		slen[0] += l, slen[1] += l;
-	} else if (type == '*') {
-		s_ref.set(seq.charAt(0));
-		s_qry.set(seq.charAt(1));
-		s_mid.set(' ');
-		slen[0] += 1, slen[1] += 1;
-	} else if (type == '+') {
-		s_ref.set(Array(l+1).join("-"));
-		s_qry.set(seq);
-		s_mid.set(Array(l+1).join(" "));
-		slen[1] += l;
-	} else if (type == '-') {
-		s_ref.set(seq);
-		s_qry.set(Array(l+1).join("-"));
-		s_mid.set(Array(l+1).join(" "));
-		slen[0] += l;
-	}
-}
-
-function print_aln(rs, qs, strand, slen, elen, s_ref, s_qry, s_mid)
-{
-	print(["Ref+:", padding_str(rs + slen[0] + 1, 10, false), s_ref.toString(), padding_str(rs + elen[0], 10, true)].join(" "));
-	print("                 " + s_mid.toString());
-	var st, en;
-	if (strand == '+') st = qs + slen[1] + 1, en = qs + elen[1];
-	else st = qs - slen[1], en = qs - elen[1] + 1;
-	print(["Qry" + strand + ":", padding_str(st,               10, false), s_qry.toString(), padding_str(en          , 10, true)].join(" "));
-}
-
-var s_ref = new Bytes(), s_qry = new Bytes(), s_mid = new Bytes();
-var re = /([=\-\+\*])([A-Za-z]+)/g;
-
-var buf = new Bytes();
-var file = new File(arguments[getopt.ind]);
-if (maf_out) print("##maf version=1\n");
-while (file.readline(buf) >= 0) {
-	var m, line = buf.toString();
-	var t = line.split("\t", 12);
-	if ((m = /\tcs:Z:(\S+)/.exec(line)) == null) continue;
-	var cs = m[1];
-	s_ref.length = s_qry.length = s_mid.length = 0;
-	var slen = [0, 0], elen = [0, 0];
-	if (maf_out) {
-		while ((m = re.exec(cs)) != null)
-			update_aln(s_ref, s_qry, s_mid, m[1], m[2], elen);
-		if (maf_out) {
-			var score = (m = /\tAS:i:(\d+)/.exec(line)) != null? parseInt(m[1]) : 0;
-			var len = t[0].length > t[5].length? t[0].length : t[5].length;
-			print("a " + score);
-			print(["s", padding_str(t[5], len, true), padding_str(t[7], 10, false), padding_str(parseInt(t[8]) - parseInt(t[7]), 10, false),
-				   "+", padding_str(t[6], 10, false), s_ref.toString()].join(" "));
-			var qs, qe, ql = parseInt(t[1]);
-			if (t[4] == '+') {
-				qs = parseInt(t[2]);
-				qe = parseInt(t[3]);
-			} else {
-				qs = ql - parseInt(t[3]);
-				qe = ql - parseInt(t[2]);
-			}
-			print(["s", padding_str(t[0], len, true), padding_str(qs, 10, false), padding_str(qe - qs, 10, false),
-				   t[4], padding_str(ql, 10, false), s_qry.toString()].join(" "));
-			print("");
-		}
-	} else {
-		line = line.replace(/\tc[sg]:Z:\S+/g, "");
-		print('>' + line);
-		var rs = parseInt(t[7]), qs = t[4] == '+'? parseInt(t[2]) : parseInt(t[3]);
-		var n_blocks = 0;
-		while ((m = re.exec(cs)) != null) {
-			var start = 0, rest = m[1] == '*'? 1 : m[2].length;
-			while (rest > 0) {
-				var l_proc;
-				if (s_ref.length + rest >= line_len) {
-					l_proc = line_len - s_ref.length;
-					update_aln(s_ref, s_qry, s_mid, m[1], m[1] == '*'? m[2] : m[2].substr(start, l_proc), elen);
-					if (n_blocks > 0) print("");
-					print_aln(rs, qs, t[4], slen, elen, s_ref, s_qry, s_mid);
-					++n_blocks;
-					s_ref.length = s_qry.length = s_mid.length = 0;
-					slen[0] = elen[0], slen[1] = elen[1];
-				} else {
-					l_proc = rest;
-					update_aln(s_ref, s_qry, s_mid, m[1], m[1] == '*'? m[2] : m[2].substr(start, l_proc), elen);
-				}
-				rest -= l_proc, start += l_proc;
-			}
-		}
-		if (s_ref.length > 0) {
-			if (n_blocks > 0) print("");
-			print_aln(rs, qs, t[4], slen, elen, s_ref, s_qry, s_mid);
-			++n_blocks;
-		}
-		print("//");
-	}
-}
-file.close();
-buf.destroy();
-
-s_ref.destroy(); s_qry.destroy(); s_mid.destroy();

misc/sam2paf.js

@@ -1,111 +0,0 @@
-var getopt = function(args, ostr) {
-	var oli; // option letter list index
-	if (typeof(getopt.place) == 'undefined')
-		getopt.ind = 0, getopt.arg = null, getopt.place = -1;
-	if (getopt.place == -1) { // update scanning pointer
-		if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
-			getopt.place = -1;
-			return null;
-		}
-		if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
-			++getopt.ind;
-			getopt.place = -1;
-			return null;
-		}
-	}
-	var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
-	if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
-		if (optopt == '-') return null; //  if the user didn't specify '-' as an option, assume it means null.
-		if (getopt.place < 0) ++getopt.ind;
-		return '?';
-	}
-	if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
-		getopt.arg = null;
-		if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
-	} else { // need an argument
-		if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
-			getopt.arg = args[getopt.ind].substr(getopt.place);
-		else if (args.length <= ++getopt.ind) { // no arg
-			getopt.place = -1;
-			if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
-			return '?';
-		} else getopt.arg = args[getopt.ind]; // white space
-		getopt.place = -1;
-		++getopt.ind;
-	}
-	return optopt;
-}
-
-var c, pri_only = false;
-while ((c = getopt(arguments, "p")) != null)
-	if (c == 'p') pri_only = true;
-
-var file = arguments.length == getopt.ind? new File() : new File(arguments[getopt.ind]);
-var buf = new Bytes();
-var re = /(\d+)([MIDSHNX=])/g;
-
-var len = {}, lineno = 0;
-while (file.readline(buf) >= 0) {
-	var m, n_cigar = 0, line = buf.toString();
-	++lineno;
-	if (line.charAt(0) == '@') {
-		if (/^@SQ/.test(line)) {
-			var name = (m = /\tSN:(\S+)/.exec(line)) != null? m[1] : null;
-			var l = (m = /\tLN:(\d+)/.exec(line)) != null? parseInt(m[1]) : null;
-			if (name != null && l != null) len[name] = l;
-		}
-		continue;
-	}
-	var t = line.split("\t");
-	var flag = parseInt(t[1]);
-	if (t[9] != '*' && t[10] != '*' && t[9].length != t[10].length) throw Error("ERROR at line " + lineno + ": inconsistent SEQ and QUAL lengths - " + t[9].length + " != " + t[10].length);
-	if (t[2] == '*' || (flag&4)) continue;
-	if (pri_only && (flag&0x100)) continue;
-	var tlen = len[t[2]];
-	if (tlen == null) throw Error("ERROR at line " + lineno + ": can't find the length of contig " + t[2]);
-	var nn = (m = /\tnn:i:(\d+)/.exec(line)) != null? parseInt(m[1]) : 0;
-	var NM = (m = /\tNM:i:(\d+)/.exec(line)) != null? parseInt(m[1]) : null;
-	var have_NM = NM == null? false : true;
-	NM += nn;
-	var clip = [0, 0], I = [0, 0], D = [0, 0], M = 0, N = 0, ql = 0, tl = 0, mm = 0, ext_cigar = false;
-	while ((m = re.exec(t[5])) != null) {
-		var l = parseInt(m[1]);
-		if (m[2] == 'M') M += l, ql += l, tl += l, ext_cigar = false;
-		else if (m[2] == 'I') ++I[0], I[1] += l, ql += l;
-		else if (m[2] == 'D') ++D[0], D[1] += l, tl += l;
-		else if (m[2] == 'N') N += l, tl += l;
-		else if (m[2] == 'S') clip[M == 0? 0 : 1] = l, ql += l;
-		else if (m[2] == 'H') clip[M == 0? 0 : 1] = l;
-		else if (m[2] == '=') M += l, ql += l, tl += l, ext_cigar = true;
-		else if (m[2] == 'X') M += l, ql += l, tl += l, mm += l, ext_cigar = true;
-		++n_cigar;
-	}
-	if (n_cigar > 65535)
-		warn("WARNING at line " + lineno + ": " + n_cigar + " CIGAR operations");
-	if (tl + parseInt(t[3]) - 1 > tlen) {
-		warn("WARNING at line " + lineno + ": alignment end position larger than ref length; skipped");
-		continue;
-	}
-	if (t[9] != '*' && t[9].length != ql) {
-		warn("WARNING at line " + lineno + ": SEQ length inconsistent with CIGAR (" + t[9].length + " != " + ql + "); skipped");
-		continue;
-	}
-	if (!have_NM || ext_cigar) NM = I[1] + D[1] + mm;
-	if (NM < I[1] + D[1] + mm) {
-		warn("WARNING at line " + lineno + ": NM is less than the total number of gaps (" + NM + " < " + (I[1]+D[1]+mm) + ")");
-		NM = I[1] + D[1] + mm;
-	}
-	var extra = ["mm:i:"+(NM-I[1]-D[1]), "io:i:"+I[0], "in:i:"+I[1], "do:i:"+D[0], "dn:i:"+D[1]];
-	var match = M - (NM - I[1] - D[1]);
-	var blen = M + I[1] + D[1];
-	var qlen = M + I[1] + clip[0] + clip[1];
-	var qs, qe;
-	if (flag&16) qs = clip[1], qe = qlen - clip[0];
-	else qs = clip[0], qe = qlen - clip[1];
-	var ts = parseInt(t[3]) - 1, te = ts + M + D[1] + N;
-	var a = [t[0], qlen, qs, qe, flag&16? '-' : '+', t[2], tlen, ts, te, match, blen, t[4]];
-	print(a.join("\t"), extra.join("\t"));
-}
-
-buf.destroy();
-file.close();

misc/sim-eval.js

@@ -1,191 +0,0 @@
-var getopt = function(args, ostr) {
-	var oli; // option letter list index
-	if (typeof(getopt.place) == 'undefined')
-		getopt.ind = 0, getopt.arg = null, getopt.place = -1;
-	if (getopt.place == -1) { // update scanning pointer
-		if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
-			getopt.place = -1;
-			return null;
-		}
-		if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
-			++getopt.ind;
-			getopt.place = -1;
-			return null;
-		}
-	}
-	var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
-	if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
-		if (optopt == '-') return null; //  if the user didn't specify '-' as an option, assume it means null.
-		if (getopt.place < 0) ++getopt.ind;
-		return '?';
-	}
-	if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
-		getopt.arg = null;
-		if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
-	} else { // need an argument
-		if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
-			getopt.arg = args[getopt.ind].substr(getopt.place);
-		else if (args.length <= ++getopt.ind) { // no arg
-			getopt.place = -1;
-			if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
-			return '?';
-		} else getopt.arg = args[getopt.ind]; // white space
-		getopt.place = -1;
-		++getopt.ind;
-	}
-	return optopt;
-}
-
-var c, max_mapq = 60, mode = 0, err_out_q = 256, print_err = false, ovlp_ratio = 0.1, cap_short_mapq = false;
-while ((c = getopt(arguments, "Q:r:m:c")) != null) {
-	if (c == 'Q') err_out_q = parseInt(getopt.arg), print_err = true;
-	else if (c == 'r') ovlp_ratio = parseFloat(getopt.arg);
-	else if (c == 'm') mode = parseInt(getopt.arg);
-	else if (c == 'c') cap_short_mapq = true;
-}
-
-var file = arguments.length == getopt.ind? new File() : new File(arguments[getopt.ind]);
-var buf = new Bytes();
-
-var tot = [], err = [];
-for (var q = 0; q <= max_mapq; ++q)
-	tot[q] = err[q] = 0;
-
-function is_correct(s, b)
-{
-	if (s[0] != b[0] || s[3] != b[3]) return false;
-	var o, l;
-	if (s[1] < b[1]) {
-		if (s[2] <= b[1]) return false;
-		o = (s[2] < b[2]? s[2] : b[2]) - b[1];
-		l = (s[2] > b[2]? s[2] : b[2]) - s[1];
-	} else {
-		if (b[2] <= s[1]) return false;
-		o = (s[2] < b[2]? s[2] : b[2]) - s[1];
-		l = (s[2] > b[2]? s[2] : b[2]) - b[1];
-	}
-	return o/l > ovlp_ratio? true : false;
-}
-
-function count_err(qname, a, tot, err, mode)
-{
-	if (a.length == 0) return;
-
-	var m, s;
-	if ((m = /^(\S+)!(\S+)!(\d+)!(\d+)!([\+\-])$/.exec(qname)) != null) { // pbsim single-end reads
-		s = [m[1], m[2], parseInt(m[3]), parseInt(m[4]), m[5]];
-	} else if ((m = /^(\S+)!(\S+)!(\d+)_(\d+)!(\d+)_(\d+)!([\+\-])([\+\-])\/([12])$/.exec(qname)) != null) { // mason2 paired-end reads
-		if (m[9] == '1') {
-			s = [m[1], m[2], parseInt(m[3]), parseInt(m[5]), m[7]];
-		} else {
-			s = [m[1], m[2], parseInt(m[4]), parseInt(m[6]), m[8]];
-		}
-	} else throw Error("Failed to parse simulated read names '" + qname + "'");
-	s.shift(); // skip the orginal read name
-
-	if (mode == 0 || mode == 1) { // longest only or first only
-		var max_i = 0;
-		if (mode == 0) { // longest only
-			var max = 0;
-			for (var i = 0; i < a.length; ++i)
-				if (a[i][5] > max)
-					max = a[i][5], max_i = i;
-		}
-		var mapq = a[max_i][4];
-		++tot[mapq];
-		if (!is_correct(s, a[max_i])) {
-			if (mapq >= err_out_q)
-				print('E', qname, a[max_i].join("\t"));
-			++err[mapq];
-		}
-	} else if (mode == 2) { // all primary mode
-		var max_err_mapq = -1, max_mapq = 0, max_err_i = -1;
-		if (cap_short_mapq) {
-			var max = 0, max_q = 0;
-			for (var i = 0; i < a.length; ++i)
-				if (a[i][5] > max)
-					max = a[i][5], max_q = a[i][4];
-			for (var i = 0; i < a.length; ++i)
-				a[i][4] = max_q < a[i][4]? max_q : a[i][4];
-		}
-		for (var i = 0; i < a.length; ++i) {
-			max_mapq = max_mapq > a[i][4]? max_mapq : a[i][4];
-			if (!is_correct(s, a[i]))
-				if (a[i][4] > max_err_mapq)
-					max_err_mapq = a[i][4], max_err_i = i;
-		}
-		if (max_err_mapq >= 0) {
-			++tot[max_err_mapq], ++err[max_err_mapq];
-			if (max_err_mapq >= err_out_q)
-				print('E', qname, a[max_err_i].join("\t"));
-		} else ++tot[max_mapq];
-	}
-}
-
-var lineno = 0, last = null, a = [], n_unmapped = null;
-var re_cigar = /(\d+)([MIDSHN])/g;
-while (file.readline(buf) >= 0) {
-	var m, line = buf.toString();
-	++lineno;
-	if (line[0] != '@') {
-		var t = line.split("\t");
-		if (t[4] == '+' || t[4] == '-') { // PAF
-			if (last != t[0]) {
-				if (last != null) count_err(last, a, tot, err, mode);
-				a = [], last = t[0];
-			}
-			if (/\ts1:i:\d+/.test(line) && !/\ts2:i:\d+/.test(line)) // secondary alignment in minimap2 PAF
-				continue;
-			var mapq = parseInt(t[11]);
-			if (mapq > max_mapq) mapq = max_mapq;
-			a.push([t[5], parseInt(t[7]), parseInt(t[8]), t[4], mapq, parseInt(t[9])]);
-		} else { // SAM
-			var flag = parseInt(t[1]);
-			var read_no = flag>>6&0x3;
-			var qname = read_no == 1 || read_no == 2? t[0] + '/' + read_no : t[0];
-			if (last != qname) {
-				if (last != null) count_err(last, a, tot, err, mode);
-				a = [], last = qname;
-			}
-			if (flag&0x100) continue; // secondary alignment
-			if ((flag&0x4) || t[2] == '*') { // unmapped
-				if (n_unmapped == null) n_unmapped = 0;
-				++n_unmapped;
-				continue;
-			}
-			var mapq = parseInt(t[4]);
-			if (mapq > max_mapq) mapq = max_mapq;
-			var pos = parseInt(t[3]) - 1, pos_end = pos;
-			var n_gap = 0, mlen = 0;
-			while ((m = re_cigar.exec(t[5])) != null) {
-				var len = parseInt(m[1]);
-				if (m[2] == 'M') pos_end += len, mlen += len;
-				else if (m[2] == 'I') n_gap += len;
-				else if (m[2] == 'D') n_gap += len, pos_end += len;
-			}
-			var score = pos_end - pos;
-			if ((m = /\tNM:i:(\d+)/.exec(line)) != null) {
-				var NM = parseInt(m[1]);
-				if (NM >= n_gap) score = mlen - (NM - n_gap);
-			}
-			a.push([t[2], pos, pos_end, (flag&16)? '-' : '+', mapq, score]);
-		}
-	}
-}
-if (last != null) count_err(last, a, tot, err, mode);
-
-buf.destroy();
-file.close();
-
-var sum_tot = 0, sum_err = 0, q_out = -1, sum_tot2 = 0, sum_err2 = 0;
-for (var q = max_mapq; q >= 0; --q) {
-	if (tot[q] == 0) continue;
-	if (q_out < 0 || err[q] > 0) {
-		if (q_out >= 0) print('Q', q_out, sum_tot, sum_err, (sum_err2/sum_tot2).toFixed(9));
-		sum_tot = sum_err = 0, q_out = q;
-	}
-	sum_tot += tot[q], sum_err += err[q];
-	sum_tot2 += tot[q], sum_err2 += err[q];
-}
-print('Q', q_out, sum_tot, sum_err, (sum_err2/sum_tot2).toFixed(9));
-if (n_unmapped != null) print('U', n_unmapped);

misc/sim-mason2.js

@@ -1,105 +0,0 @@
-Bytes.prototype.reverse = function()
-{
-	for (var i = 0; i < this.length>>1; ++i) {
-		var tmp = this[i];
-		this[i] = this[this.length - i - 1];
-		this[this.length - i - 1] = tmp;
-	}
-}
-
-// reverse complement a DNA string
-Bytes.prototype.revcomp = function()
-{
-	if (Bytes.rctab == null) {
-		var s1 = 'WSATUGCYRKMBDHVNwsatugcyrkmbdhvn';
-		var s2 = 'WSTAACGRYMKVHDBNwstaacgrymkvhdbn';
-		Bytes.rctab = [];
-		for (var i = 0; i < 256; ++i) Bytes.rctab[i] = 0;
-		for (var i = 0; i < s1.length; ++i)
-			Bytes.rctab[s1.charCodeAt(i)] = s2.charCodeAt(i);
-	}
-	for (var i = 0; i < this.length>>1; ++i) {
-		var tmp = this[this.length - i - 1];
-		this[this.length - i - 1] = Bytes.rctab[this[i]];
-		this[i] = Bytes.rctab[tmp];
-	}
-	if (this.length&1)
-		this[this.length>>1] = Bytes.rctab[this[this.length>>1]];
-}
-
-if (arguments.length == 0) {
-	print("Usage: k8 sim-mason2.js <mason.sam>");
-	exit(1);
-}
-
-function print_se(a)
-{
-	print('@' + a.slice(0, 5).join("!") + " " + a[8]);
-	print(a[5]);
-	print("+");
-	print(a[6]);
-}
-
-var buf = new Bytes(), buf2 = new Bytes();
-var file = new File(arguments[0]);
-var re = /(\d+)([MIDSHN])/g;
-var last = null;
-while (file.readline(buf) >= 0) {
-	var t = buf.toString().split("\t");
-	if (t[0].charAt(0) == '@') continue;
-	var m, l_ref = 0;
-	while ((m = re.exec(t[5])) != null)
-		if (m[2] == 'D' || m[2] == 'M' || m[2] == 'N')
-			l_ref += parseInt(m[1]);
-	var flag = parseInt(t[1]);
-	var rev = !!(flag&16);
-	var seq, qual;
-	if (rev) {
-		buf2.length = 0;
-		buf2.set(t[9], 0);
-		buf2.revcomp();
-		seq = buf2.toString();
-		buf2.set(t[10], 0);
-		buf2.reverse();
-		qual = buf2.toString();
-	} else seq = t[9], qual = t[10];
-	var qname = t[0];
-	qname = qname.replace(/^simulated./, "");
-	var chr = t[2];
-	var pos = parseInt(t[3]) - 1;
-	var strand = (flag&16)? '-' : '+';
-	var read_no = flag&0xc0;
-	if (read_no == 0x40) read_no = 1;
-	else if (read_no == 0x80) read_no = 2;
-	else read_no = 0;
-	var err = 0, snp = 0, indel = 0;
-	for (var i = 11; i < t.length; ++i) {
-		if ((m = /^XE:i:(\d+)/.exec(t[i])) != null) err = m[1];
-		else if ((m = /^XS:i:(\d+)/.exec(t[i])) != null) snp = m[1];
-		else if ((m = /^XI:i:(\d+)/.exec(t[i])) != null) indel = m[1];
-	}
-	var comment = [err, snp, indel].join(":");
-	if (last == null) {
-		last = [qname, chr, pos, pos + l_ref, strand, seq, qual, read_no, comment];
-	} else if (last[0] != qname) {
-		print_se(last);
-		last = [qname, chr, pos, pos + l_ref, strand, seq, qual, read_no, comment];
-	} else {
-		if (read_no == 2) { // last[] is the first read
-			if (last[7] != 1) throw Error("ERROR: can't find read1");
-			var name = [qname, chr, last[2] + "_" + pos, last[3] + "_" + (pos + l_ref), last[4] + strand].join("!");
-			print('@' + name + '/1' + ' ' + last[8]); print(last[5]); print("+"); print(last[6]);
-			print('@' + name + '/2' + ' ' + comment); print(seq); print("+"); print(qual);
-		} else {
-			if (last[7] != 2) throw Error("ERROR: can't find read2");
-			var name = [qname, chr, pos + "_" + last[2], (pos + l_ref) + "_" + last[3], strand + last[4]].join("!");
-			print('@' + name + '/1' + ' ' + comment); print(seq); print("+"); print(qual);
-			print('@' + name + '/2' + ' ' + last[8]); print(last[5]); print("+"); print(last[6]);
-		}
-		last = null;
-	}
-}
-if (last != null) print_se(last);
-file.close();
-buf.destroy();
-buf2.destroy();

misc/sim-pbsim.js

@@ -1,81 +0,0 @@
-Bytes.prototype.reverse = function()
-{
-	for (var i = 0; i < this.length>>1; ++i) {
-		var tmp = this[i];
-		this[i] = this[this.length - i - 1];
-		this[this.length - i - 1] = tmp;
-	}
-}
-
-// reverse complement a DNA string
-Bytes.prototype.revcomp = function()
-{
-	if (Bytes.rctab == null) {
-		var s1 = 'WSATUGCYRKMBDHVNwsatugcyrkmbdhvn';
-		var s2 = 'WSTAACGRYMKVHDBNwstaacgrymkvhdbn';
-		Bytes.rctab = [];
-		for (var i = 0; i < 256; ++i) Bytes.rctab[i] = 0;
-		for (var i = 0; i < s1.length; ++i)
-			Bytes.rctab[s1.charCodeAt(i)] = s2.charCodeAt(i);
-	}
-	for (var i = 0; i < this.length>>1; ++i) {
-		var tmp = this[this.length - i - 1];
-		this[this.length - i - 1] = Bytes.rctab[this[i]];
-		this[i] = Bytes.rctab[tmp];
-	}
-	if (this.length&1)
-		this[this.length>>1] = Bytes.rctab[this[this.length>>1]];
-}
-
-if (arguments.length < 2) {
-	print("Usage: k8 sim-pbsim.js <ref.fa.fai> <pbsim1.maf> [[pbsim2.maf] ...]");
-	exit(1);
-}
-
-var file, buf = new Bytes(), buf2 = new Bytes();
-file = new File(arguments[0]);
-var chr_list = [];
-while (file.readline(buf) >= 0) {
-	var t = buf.toString().split(/\s+/);
-	chr_list.push(t[0]);
-}
-file.close();
-
-for (var k = 1; k < arguments.length; ++k) {
-	var fn = arguments[k];
-	file = new File(fn);
-	var state = 0, reg;
-	while (file.readline(buf) >= 0) {
-		var line = buf.toString();
-		if (state == 0 && line.charAt(0) == 'a') {
-			state = 1;
-		} else if (state == 1 && line.charAt(0) == 's') {
-			var t = line.split(/\s+/);
-			var st = parseInt(t[2]);
-			reg = [st, st + parseInt(t[3])];
-			state = 2;
-		} else if (state == 2 && line.charAt(0) == 's') {
-			var m, t = line.split(/\s+/);
-			if ((m = /S(\d+)_\d+/.exec(t[1])) == null) throw Error("Failed to parse the read name");
-			var chr_id = parseInt(m[1]) - 1;
-			if (chr_id >= chr_list.length) throw Error("Index outside the chr list");
-			var name = [t[1], chr_list[chr_id], reg[0], reg[1], t[4]].join("!");
-			var seq = t[6].replace(/\-/g, "");
-			if (seq.length != parseInt(t[5])) throw Error("Inconsistent read length");
-			if (seq.indexOf("NN") < 0) {
-				if (t[4] == '-') {
-					buf2.set(seq, 0);
-					buf2.length = seq.length;
-					buf2.revcomp();
-					seq = buf2.toString();
-				}
-				print(">" + name);
-				print(seq);
-			}
-			state = 0;
-		}
-	}
-	file.close();
-}
-buf.destroy();
-buf2.destroy();

mmpriv.h

@@ -1,65 +0,0 @@
-#ifndef MMPRIV2_H
-#define MMPRIV2_H
-
-#include <assert.h>
-#include "minimap.h"
-#include "bseq.h"
-
-#define MM_PARENT_UNSET   (-1)
-#define MM_PARENT_TMP_PRI (-2)
-
-#define MM_DBG_NO_KALLOC     0x1
-#define MM_DBG_PRINT_QNAME   0x2
-#define MM_DBG_PRINT_SEED    0x4
-#define MM_DBG_PRINT_ALN_SEQ 0x8
-
-#define MM_SEED_LONG_JOIN  (1ULL<<40)
-#define MM_SEED_IGNORE     (1ULL<<41)
-#define MM_SEED_TANDEM     (1ULL<<42)
-
-#ifndef kroundup32
-#define kroundup32(x) (--(x), (x)|=(x)>>1, (x)|=(x)>>2, (x)|=(x)>>4, (x)|=(x)>>8, (x)|=(x)>>16, ++(x))
-#endif
-
-#ifdef __cplusplus
-extern "C" {
-#endif
-
-#ifndef KSTRING_T
-#define KSTRING_T kstring_t
-typedef struct __kstring_t {
-	unsigned l, m;
-	char *s;
-} kstring_t;
-#endif
-
-double cputime(void);
-double realtime(void);
-
-void radix_sort_128x(mm128_t *beg, mm128_t *end);
-void radix_sort_64(uint64_t *beg, uint64_t *end);
-uint32_t ks_ksmall_uint32_t(size_t n, uint32_t arr[], size_t kk);
-
-void mm_write_sam_SQ(const mm_idx_t *idx);
-void mm_write_sam_hdr_no_SQ(const char *rg, const char *ver, int argc, char *argv[]);
-void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int opt_flag);
-void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int n_regs, const mm_reg1_t *regs);
-int mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int min_cnt, int min_sc, int is_cdna, int64_t n, mm128_t *a, uint64_t **_u, void *km);
-mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a);
-
-mm_reg1_t *mm_gen_regs(void *km, int qlen, int n_u, uint64_t *u, mm128_t *a);
-void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a);
-void mm_sync_regs(void *km, int n_regs, mm_reg1_t *regs);
-int mm_set_sam_pri(int n, mm_reg1_t *r);
-void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r);
-void mm_select_sub(void *km, float mask_level, float pri_ratio, int min_diff, int best_n, int *n_, mm_reg1_t *r);
-void mm_filter_regs(void *km, const mm_mapopt_t *opt, int *n_regs, mm_reg1_t *regs);
-void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs, mm128_t *a);
-void mm_hit_sort_by_dp(void *km, int *n_regs, mm_reg1_t *r);
-void mm_set_mapq(int n_regs, mm_reg1_t *regs, int min_chain_sc);
-
-#ifdef __cplusplus
-}
-#endif
-
-#endif

sdust.c

@@ -1,211 +0,0 @@
-#include <string.h>
-#include <stdint.h>
-#include <stdio.h>
-#include "kalloc.h"
-#include "kdq.h"
-#include "kvec.h"
-#include "sdust.h"
-
-#define SD_WLEN 3
-#define SD_WTOT (1<<(SD_WLEN<<1))
-#define SD_WMSK (SD_WTOT - 1)
-
-typedef struct {
-	int start, finish;
-	int r, l;
-} perf_intv_t;
-
-typedef kvec_t(perf_intv_t) perf_intv_v;
-typedef kvec_t(uint64_t) uint64_v;
-
-KDQ_INIT(int)
-
-#if defined(_NO_NT4_TBL) || defined(_SDUST_MAIN)
-unsigned char seq_nt4_table[256] = {
-	0, 1, 2, 3,  4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4, 
-	4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4, 
-	4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4,
-	4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4, 
-	4, 0, 4, 1,  4, 4, 4, 2,  4, 4, 4, 4,  4, 4, 4, 4, 
-	4, 4, 4, 4,  3, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4, 
-	4, 0, 4, 1,  4, 4, 4, 2,  4, 4, 4, 4,  4, 4, 4, 4, 
-	4, 4, 4, 4,  3, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4, 
-	4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4, 
-	4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4, 
-	4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4, 
-	4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4, 
-	4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4, 
-	4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4, 
-	4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4, 
-	4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4
-};
-#else
-extern unsigned char seq_nt4_table[256];
-#endif
-
-struct sdust_buf_s {
-	kdq_t(int) *w;
-	perf_intv_v P; // the list of perfect intervals for the current window, sorted by descending start and then by ascending finish
-	uint64_v res;  // the result
-	void *km;      // memory pool
-};
-
-sdust_buf_t *sdust_buf_init(void *km)
-{
-	sdust_buf_t *buf;
-	buf = (sdust_buf_t*)kcalloc(km, 1, sizeof(sdust_buf_t));
-	buf->km = km;
-	buf->w = kdq_init(int, buf->km);
-	return buf;
-}
-
-void sdust_buf_destroy(sdust_buf_t *buf)
-{
-	if (buf == 0) return;
-	kdq_destroy(int, buf->w);
-	kfree(buf->km, buf->P.a); kfree(buf->km, buf->res.a); kfree(buf->km, buf);
-}
-
-static inline void shift_window(int t, kdq_t(int) *w, int T, int W, int *L, int *rw, int *rv, int *cw, int *cv)
-{
-	int s;
-	if (kdq_size(w) >= W - SD_WLEN + 1) { // TODO: is this right for SD_WLEN!=3?
-		s = *kdq_shift(int, w);
-		*rw -= --cw[s];
-		if (*L > kdq_size(w))
-			--*L, *rv -= --cv[s];
-	}
-	kdq_push(int, w, t);
-	++*L;
-	*rw += cw[t]++;
-	*rv += cv[t]++;
-	if (cv[t] * 10 > T<<1) {
-		do {
-			s = kdq_at(w, kdq_size(w) - *L);
-			*rv -= --cv[s];
-			--*L;
-		} while (s != t);
-	}
-}
-
-static inline void save_masked_regions(void *km, uint64_v *res, perf_intv_v *P, int start)
-{
-	int i, saved = 0;
-	perf_intv_t *p;
-	if (P->n == 0 || P->a[P->n - 1].start >= start) return;
-	p = &P->a[P->n - 1];
-	if (res->n) {
-		int s = res->a[res->n - 1]>>32, f = (uint32_t)res->a[res->n - 1];
-		if (p->start <= f) // if overlapping with or adjacent to the previous interval
-			saved = 1, res->a[res->n - 1] = (uint64_t)s<<32 | (f > p->finish? f : p->finish);
-	}
-	if (!saved) kv_push(uint64_t, km, *res, (uint64_t)p->start<<32|p->finish);
-	for (i = P->n - 1; i >= 0 && P->a[i].start < start; --i); // remove perfect intervals that have falled out of the window
-	P->n = i + 1;
-}
-
-static void find_perfect(void *km, perf_intv_v *P, const kdq_t(int) *w, int T, int start, int L, int rv, const int *cv)
-{
-	int c[SD_WTOT], r = rv, i, max_r = 0, max_l = 0;
-	memcpy(c, cv, SD_WTOT * sizeof(int));
-	for (i = (long)kdq_size(w) - L - 1; i >= 0; --i) {
-		int j, t = kdq_at(w, i), new_r, new_l;
-		r += c[t]++;
-		new_r = r, new_l = kdq_size(w) - i - 1;
-		if (new_r * 10 > T * new_l) {
-			for (j = 0; j < P->n && P->a[j].start >= i + start; ++j) { // find insertion position
-				perf_intv_t *p = &P->a[j];
-				if (max_r == 0 || p->r * max_l > max_r * p->l)
-					max_r = p->r, max_l = p->l;
-			}
-			if (max_r == 0 || new_r * max_l >= max_r * new_l) { // then insert
-				max_r = new_r, max_l = new_l;
-				if (P->n == P->m) kv_resize(perf_intv_t, km, *P, P->n + 1);
-				memmove(&P->a[j+1], &P->a[j], (P->n - j) * sizeof(perf_intv_t)); // make room
-				++P->n;
-				P->a[j].start = i + start, P->a[j].finish = kdq_size(w) + (SD_WLEN - 1) + start;
-				P->a[j].r = new_r, P->a[j].l = new_l;
-			}
-		}
-	}
-}
-
-const uint64_t *sdust_core(const uint8_t *seq, int l_seq, int T, int W, int *n, sdust_buf_t *buf)
-{
-	int rv = 0, rw = 0, L = 0, cv[SD_WTOT], cw[SD_WTOT];
-	int i, start, l; // _start_: start of the current window; _l_: length of a contiguous A/C/G/T (sub)sequence
-	unsigned t; // current word
-
-	buf->P.n = buf->res.n = 0;
-	buf->w->front = buf->w->count = 0;
-	memset(cv, 0, SD_WTOT * sizeof(int));
-	memset(cw, 0, SD_WTOT * sizeof(int));
-	if (l_seq < 0) l_seq = strlen((const char*)seq);
-	for (i = l = t = 0; i <= l_seq; ++i) {
-		int b = i < l_seq? seq_nt4_table[seq[i]] : 4;
-		if (b < 4) { // an A/C/G/T base
-			++l, t = (t<<2 | b) & SD_WMSK;
-			if (l >= SD_WLEN) { // we have seen a word
-				start = (l - W > 0? l - W : 0) + (i + 1 - l); // set the start of the current window
-				save_masked_regions(buf->km, &buf->res, &buf->P, start); // save intervals falling out of the current window?
-				shift_window(t, buf->w, T, W, &L, &rw, &rv, cw, cv);
-				if (rw * 10 > L * T)
-					find_perfect(buf->km, &buf->P, buf->w, T, start, L, rv, cv);
-			}
-		} else { // N or the end of sequence; N effectively breaks input into pieces of independent sequences
-			start = (l - W + 1 > 0? l - W + 1 : 0) + (i + 1 - l);
-			while (buf->P.n) save_masked_regions(buf->km, &buf->res, &buf->P, start++); // clear up unsaved perfect intervals
-			l = t = 0;
-		}
-	}
-	*n = buf->res.n;
-	return buf->res.a;
-}
-
-uint64_t *sdust(void *km, const uint8_t *seq, int l_seq, int T, int W, int *n)
-{
-	uint64_t *ret;
-	sdust_buf_t *buf;
-	buf = sdust_buf_init(km);
-	ret = (uint64_t*)sdust_core(seq, l_seq, T, W, n, buf);
-	buf->res.a = 0;
-	sdust_buf_destroy(buf);
-	return ret;
-}
-
-#ifdef _SDUST_MAIN
-#include <zlib.h>
-#include <stdio.h>
-#include "getopt.h"
-#include "kseq.h"
-KSEQ_INIT(gzFile, gzread)
-
-int main(int argc, char *argv[])
-{
-	gzFile fp;
-	kseq_t *ks;
-	int W = 64, T = 20, c;
-
-	while ((c = getopt(argc, argv, "w:t:")) >= 0) {
-		if (c == 'w') W = atoi(optarg);
-		else if (c == 't') T = atoi(optarg);
-	}
-	if (optind == argc) {
-		fprintf(stderr, "Usage: sdust [-w %d] [-t %d] <in.fa>\n", W, T);
-		return 1;
-	}
-	fp = strcmp(argv[optind], "-")? gzopen(argv[optind], "r") : gzdopen(fileno(stdin), "r");
-	ks = kseq_init(fp);
-	while (kseq_read(ks) >= 0) {
-		uint64_t *r;
-		int i, n;
-		r = sdust(0, (uint8_t*)ks->seq.s, -1, T, W, &n);
-		for (i = 0; i < n; ++i)
-			printf("%s\t%d\t%d\n", ks->name.s, (int)(r[i]>>32), (int)r[i]);
-		free(r);
-	}
-	kseq_destroy(ks);
-	gzclose(fp);
-	return 0;
-}
-#endif

sdust.h

@@ -1,25 +0,0 @@
-#ifndef SDUST_H
-#define SDUST_H
-
-#include <stdint.h>
-
-#ifdef __cplusplus
-extern "C" {
-#endif
-
-struct sdust_buf_s;
-typedef struct sdust_buf_s sdust_buf_t;
-
-// the simple interface
-uint64_t *sdust(void *km, const uint8_t *seq, int l_seq, int T, int W, int *n);
-
-// the following interface dramatically reduce heap allocations when sdust is frequently called.
-sdust_buf_t *sdust_buf_init(void *km);
-void sdust_buf_destroy(sdust_buf_t *buf);
-const uint64_t *sdust_core(const uint8_t *seq, int l_seq, int T, int W, int *n, sdust_buf_t *buf);
-
-#ifdef __cplusplus
-}
-#endif
-
-#endif

sketch.c

@@ -1,142 +0,0 @@
-#include <stdio.h>
-#include <stdlib.h>
-#include <assert.h>
-#include <string.h>
-#include "kvec.h"
-#include "minimap.h"
-
-unsigned char seq_nt4_table[256] = {
-	0, 1, 2, 3,  4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4, 
-	4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4, 
-	4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4,
-	4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4, 
-	4, 0, 4, 1,  4, 4, 4, 2,  4, 4, 4, 4,  4, 4, 4, 4, 
-	4, 4, 4, 4,  3, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4, 
-	4, 0, 4, 1,  4, 4, 4, 2,  4, 4, 4, 4,  4, 4, 4, 4, 
-	4, 4, 4, 4,  3, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4, 
-	4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4, 
-	4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4, 
-	4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4, 
-	4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4, 
-	4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4, 
-	4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4, 
-	4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4, 
-	4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4
-};
-
-static inline uint64_t hash64(uint64_t key, uint64_t mask)
-{
-	key = (~key + (key << 21)) & mask; // key = (key << 21) - key - 1;
-	key = key ^ key >> 24;
-	key = ((key + (key << 3)) + (key << 8)) & mask; // key * 265
-	key = key ^ key >> 14;
-	key = ((key + (key << 2)) + (key << 4)) & mask; // key * 21
-	key = key ^ key >> 28;
-	key = (key + (key << 31)) & mask;
-	return key;
-}
-
-typedef struct { // a simplified version of kdq
-	int front, count;
-	int a[32];
-} tiny_queue_t;
-
-static inline void tq_push(tiny_queue_t *q, int x)
-{
-	q->a[((q->count++) + q->front) & 0x1f] = x;
-}
-
-static inline int tq_shift(tiny_queue_t *q)
-{
-	int x;
-	if (q->count == 0) return -1;
-	x = q->a[q->front++];
-	q->front &= 0x1f;
-	--q->count;
-	return x;
-}
-
-/**
- * Find symmetric (w,k)-minimizers on a DNA sequence
- *
- * @param km     thread-local memory pool; using NULL falls back to malloc()
- * @param str    DNA sequence
- * @param len    length of $str
- * @param w      find a minimizer for every $w consecutive k-mers
- * @param k      k-mer size
- * @param rid    reference ID; will be copied to the output $p array
- * @param is_hpc homopolymer-compressed or not
- * @param p      minimizers
- *               p->a[i].x = kMer<<8 | kmerSpan
- *               p->a[i].y = rid<<32 | lastPos<<1 | strand
- *               where lastPos is the position of the last base of the i-th minimizer,
- *               and strand indicates whether the minimizer comes from the top or the bottom strand.
- *               Callers may want to set "p->n = 0"; otherwise results are appended to p
- */
-void mm_sketch(void *km, const char *str, int len, int w, int k, uint32_t rid, int is_hpc, mm128_v *p)
-{
-	uint64_t shift1 = 2 * (k - 1), mask = (1ULL<<2*k) - 1, kmer[2] = {0,0};
-	int i, j, l, buf_pos, min_pos, kmer_span = 0;
-	mm128_t buf[256], min = { UINT64_MAX, UINT64_MAX };
-	tiny_queue_t tq;
-
-	assert(len > 0 && (w > 0 && w < 256) && (k > 0 && k <= 28)); // 56 bits for k-mer; could use long k-mers, but 28 enough in practice
-	memset(buf, 0xff, w * 16);
-	memset(&tq, 0, sizeof(tiny_queue_t));
-	kv_resize(mm128_t, km, *p, p->n + len/w);
-
-	for (i = l = buf_pos = min_pos = 0; i < len; ++i) {
-		int c = seq_nt4_table[(uint8_t)str[i]];
-		mm128_t info = { UINT64_MAX, UINT64_MAX };
-		if (c < 4) { // not an ambiguous base
-			int z;
-			if (is_hpc) {
-				int skip_len = 1;
-				if (i + 1 < len && seq_nt4_table[(uint8_t)str[i + 1]] == c) {
-					for (skip_len = 2; i + skip_len < len; ++skip_len)
-						if (seq_nt4_table[(uint8_t)str[i + skip_len]] != c)
-							break;
-					i += skip_len - 1; // put $i at the end of the current homopolymer run
-				}
-				tq_push(&tq, skip_len);
-				kmer_span += skip_len;
-				if (tq.count > k) kmer_span -= tq_shift(&tq);
-				if (kmer_span >= 256) continue; // make sure $kmer_span does not take more than 8 bits
-			} else kmer_span = l + 1 < k? l + 1 : k;
-			kmer[0] = (kmer[0] << 2 | c) & mask;           // forward k-mer
-			kmer[1] = (kmer[1] >> 2) | (3ULL^c) << shift1; // reverse k-mer
-			if (kmer[0] == kmer[1]) continue; // skip "symmetric k-mers" as we don't know it strand
-			z = kmer[0] < kmer[1]? 0 : 1; // strand
-			if (++l >= k) {
-				info.x = hash64(kmer[z], mask) << 8 | kmer_span;
-				info.y = (uint64_t)rid<<32 | (uint32_t)i<<1 | z;
-			}
-		} else l = 0, tq.count = tq.front = 0, kmer_span = 0;
-		buf[buf_pos] = info; // need to do this here as appropriate buf_pos and buf[buf_pos] are needed below
-		if (l == w + k - 1) { // special case for the first window - because identical k-mers are not stored yet
-			for (j = buf_pos + 1; j < w; ++j)
-				if (min.x == buf[j].x && buf[j].y != min.y) kv_push(mm128_t, km, *p, buf[j]);
-			for (j = 0; j < buf_pos; ++j)
-				if (min.x == buf[j].x && buf[j].y != min.y) kv_push(mm128_t, km, *p, buf[j]);
-		}
-		if (info.x <= min.x) { // a new minimum; then write the old min
-			if (l >= w + k) kv_push(mm128_t, km, *p, min);
-			min = info, min_pos = buf_pos;
-		} else if (buf_pos == min_pos) { // old min has moved outside the window
-			if (l >= w + k - 1) kv_push(mm128_t, km, *p, min);
-			for (j = buf_pos + 1, min.x = UINT64_MAX; j < w; ++j) // the two loops are necessary when there are identical k-mers
-				if (min.x >= buf[j].x) min = buf[j], min_pos = j; // >= is important s.t. min is always the closest k-mer
-			for (j = 0; j <= buf_pos; ++j)
-				if (min.x >= buf[j].x) min = buf[j], min_pos = j;
-			if (l >= w + k - 1) { // write identical k-mers
-				for (j = buf_pos + 1; j < w; ++j) // these two loops make sure the output is sorted
-					if (min.x == buf[j].x && min.y != buf[j].y) kv_push(mm128_t, km, *p, buf[j]);
-				for (j = 0; j <= buf_pos; ++j)
-					if (min.x == buf[j].x && min.y != buf[j].y) kv_push(mm128_t, km, *p, buf[j]);
-			}
-		}
-		if (++buf_pos == w) buf_pos = 0;
-	}
-	if (min.x != UINT64_MAX)
-		kv_push(mm128_t, km, *p, min);
-}

test/MT-human.fa

@@ -1,278 +0,0 @@
->MT_human
-GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTT
-CGTCTGGGGGGTATGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTC
-GCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTACGTTCAATATT
-ACAGGCGAACATACTTACTAAAGTGTGTTAATTAATTAATGCTTGTAGGACATAATAATA
-ACAATTGAATGTCTGCACAGCCACTTTCCACACAGACATCATAACAAAAAATTTCCACCA
-AACCCCCCCTCCCCCGCTTCTGGCCACAGCACTTAAACACATCTCTGCCAAACCCCAAAA
-ACAAAGAACCCTAACACCAGCCTAACCAGATTTCAAATTTTATCTTTTGGCGGTATGCAC
-TTTTAACAGTCACCCCCCAACTAACACATTATTTTCCCCTCCCACTCCCATACTACTAAT
-CTCATCAATACAACCCCCGCCCATCCTACCCAGCACACACACACCGCTGCTAACCCCATA
-CCCCGAACCAACCAAACCCCAAAGACACCCCCCACAGTTTATGTAGCTTACCTCCTCAAA
-GCAATACACTGAAAATGTTTAGACGGGCTCACATCACCCCATAAACAAATAGGTTTGGTC
-CTAGCCTTTCTATTAGCTCTTAGTAAGATTACACATGCAAGCATCCCCGTTCCAGTGAGT
-TCACCCTCTAAATCACCACGATCAAAAGGAACAAGCATCAAGCACGCAGCAATGCAGCTC
-AAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAA
-ACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACCGC
-GGTCACACGATTAACCCAAGTCAATAGAAGCCGGCGTAAAGAGTGTTTTAGATCACCCCC
-TCCCCAATAAAGCTAAAACTCACCTGAGTTGTAAAAAACTCCAGTTGACACAAAATAGAC
-TACGAAAGTGGCTTTAACATATCTGAACACACAATAGCTAAGACCCAAACTGGGATTAGA
-TACCCCACTATGCTTAGCCCTAAACCTCAACAGTTAAATCAACAAAACTGCTCGCCAGAA
-CACTACGAGCCACAGCTTAAAACTCAAAGGACCTGGCGGTGCTTCATATCCCTCTAGAGG
-AGCCTGTTCTGTAATCGATAAACCCCGATCAACCTCACCACCTCTTGCTCAGCCTATATA
-CCGCCATCTTCAGCAAACCCTGATGAAGGCTACAAAGTAAGCGCAAGTACCCACGTAAAG
-ACGTTAGGTCAAGGTGTAGCCCATGAGGTGGCAAGAAATGGGCTACATTTTCTACCCCAG
-AAAACTACGATAGCCCTTATGAAACTTAAGGGTCGAAGGTGGATTTAGCAGTAAACTAAG
-AGTAGAGTGCTTAGTTGAACAGGGCCCTGAAGCGCGTACACACCGCCCGTCACCCTCCTC
-AAGTATACTTCAAAGGACATTTAACTAAAACCCCTACGCATTTATATAGAGGAGACAAGT
-CGTAACATGGTAAGTGTACTGGAAAGTGCACTTGGACGAACCAGAGTGTAGCTTAACACA
-AAGCACCCAACTTACACTTAGGAGATTTCAACTTAACTTGACCGCTCTGAGCTAAACCTA
-GCCCCAAACCCACTCCACCTTACTACCAGACAACCTTAGCCAAACCATTTACCCAAATAA
-AGTATAGGCGATAGAAATTGAAACCTGGCGCAATAGATATAGTACCGCAAGGGAAAGATG
-AAAAATTATAACCAAGCATAATATAGCAAGGACTAACCCCTATACCTTCTGCATAATGAA
-TTAACTAGAAATAACTTTGCAAGGAGAGCCAAAGCTAAGACCCCCGAAACCAGACGAGCT
-ACCTAAGAACAGCTAAAAGAGCACACCCGTCTATGTAGCAAAATAGTGGGAAGATTTATA
-GGTAGAGGCGACAAACCTACCGAGCCTGGTGATAGCTGGTTGTCCAAGATAGAATCTTAG
-TTCAACTTTAAATTTGCCCACAGAACCCTCTAAATCCCCTTGTAAATTTAACTGTTAGTC
-CAAAGAGGAACAGCTCTTTGGACACTAGGAAAAAACCTTGTAGAGAGAGTAAAAAATTTA
-ACACCCATAGTAGGCCTAAAAGCAGCCACCAATTAAGAAAGCGTTCAAGCTCAACACCCA
-CTACCTAAAAAATCCCAAACATATAACTGAACTCCTCACACCCAATTGGACCAATCTATC
-ACCCTATAGAAGAACTAATGTTAGTATAAGTAACATGAAAACATTCTCCTCCGCATAAGC
-CTGCGTCAGATTAAAACACTGAACTGACAATTAACAGCCCAATATCTACAATCAACCAAC
-AAGTCATTATTACCCTCACTGTCAACCCAACACAGGCATGCTCATAAGGAAAGGTTAAAA
-AAAGTAAAAGGAACTCGGCAAATCTTACCCCGCCTGTTTACCAAAAACATCACCTCTAGC
-ATCACCAGTATTAGAGGCACCGCCTGCCCAGTGACACATGTTTAACGGCCGCGGTACCCT
-AACCGTGCAAAGGTAGCATAATCACTTGTTCCTTAAATAGGGACCTGTATGAATGGCTCC
-ACGAGGGTTCAGCTGTCTCTTACTTTTAACCAGTGAAATTGACCTGCCCGTGAAGAGGCG
-GGCATAACACAGCAAGACGAGAAGACCCTATGGAGCTTTAATTTATTAATGCAAACAGTA
-CCTAACAAACCCACAGGTCCTAAACTACCAAACCTGCATTAAAAATTTCGGTTGGGGCGA
-CCTCGGAGCAGAACCCAACCTCCGAGCAGTACATGCTAAGACTTCACCAGTCAAAGCGAA
-CTACTATACTCAATTGATCCAATAACTTGACCAACGGAACAAGTTACCCTAGGGATAACA
-GCGCAATCCTATTCTAGAGTCCATATCAACAATAGGGTTTACGACCTCGATGTTGGATCA
-GGACATCCCGATGGTGCAGCCGCTATTAAAGGTTCGTTTGTTCAACGATTAAAGTCCTAC
-GTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTTCTATCTACaTTCAAATTCCTCC
-CTGTACGAAAGGACAAGAGAAATAAGGCCTACTTCACAAAGCGCCTTCCCCCGTAAATGA
-TATCATCTCAACTTAGTATTATACCCACACCCACCCAAGAACAGGGTTTGTTAAGATGGC
-AGAGCCCGGTAATCGCATAAAACTTAAAACTTTACAGTCAGAGGTTCAATTCCTCTTCTT
-AACAACATACCCATGGCCAACCTCCTACTCCTCATTGTACCCATTCTAATCGCAATGGCA
-TTCCTAATGCTTACCGAACGAAAAATTCTAGGCTATATACAACTACGCAAAGGCCCCAAC
-GTTGTAGGCCCCTACGGGCTACTACAACCCTTCGCTGACGCCATAAAACTCTTCACCAAA
-GAGCCCCTAAAACCCGCCACATCTACCATCACCCTCTACATCACCGCCCCGACCTTAGCT
-CTCACCATCGCTCTTCTACTATGAACCCCCCTCCCCATACCCAACCCCCTGGTCAACCTC
-AACCTAGGCCTCCTATTTATTCTAGCCACCTCTAGCCTAGCCGTTTACTCAATCCTCTGA
-TCAGGGTGAGCATCAAACTCAAACTACGCCCTGATCGGCGCACTGCGAGCAGTAGCCCAA
-ACAATCTCATATGAAGTCACCCTAGCCATCATTCTACTATCAACATTACTAATAAGTGGC
-TCCTTTAACCTCTCCACCCTTATCACAACACAAGAACACCTCTGATTACTCCTGCCATCA
-TGACCCTTGGCCATAATATGATTTATCTCCACACTAGCAGAGACCAACCGAACCCCCTTC
-GACCTTGCCGAAGGGGAGTCCGAACTAGTCTCAGGCTTCAACATCGAATACGCCGCAGGC
-CCCTTCGCCCTATTCTTCATAGCCGAATACACAAACATTATTATAATAAACACCCTCACC
-ACTACAATCTTCCTAGGAACAACATATGACGCACTCTCCCCTGAACTCTACACAACATAT
-TTTGTCACCAAGACCCTACTTCTAACCTCCCTGTTCTTATGAATTCGAACAGCATACCCC
-CGATTCCGCTACGACCAACTCATACACCTCCTATGAAAAAACTTCCTACCACTCACCCTA
-GCATTACTTATATGATATGTCTCCATACCCATTACAATCTCCAGCATTCCCCCTCAAACC
-TAAGAAATATGTCTGATAAAAGAGTTACTTTGATAGAGTAAATAATAGGAGCTTAAACCC
-CCTTATTTCTAGGACTATGAGAATCGAACCCATCCCTGAGAATCCAAAATTCTCCGTGCC
-ACCTATCACACCCCATCCTAAAGTAAGGTCAGCTAAATAAGCTATCGGGCCCATACCCCG
-AAAATGTTGGTTATACCCTTCCCGTACTAATTAATCCCCTGGCCCAACCCGTCATCTACT
-CTACCATCTTTGCAGGCACACTCATCACAGCGCTAAGCTCGCACTGATTTTTTACCTGAG
-TAGGCCTAGAAATAAACATGCTAGCTTTTATTCCAGTTCTAACCAAAAAAATAAACCCTC
-GTTCCACAGAAGCTGCCATCAAGTATTTCCTCACGCAAGCAACCGCATCCATAATCCTTC
-TAATAGCTATCCTCTTCAACAATATACTCTCCGGACAATGAACCATAACCAATACTACCA
-ATCAATACTCATCATTAATAATCATAATAGCTATAGCAATAAAACTAGGAATAGCCCCCT
-TTCACTTCTGAGTCCCAGAGGTTACCCAAGGCACCCCTCTGACATCCGGCCTGCTTCTTC
-TCACATGACAAAAACTAGCCCCCATCTCAATCATATACCAAATCTCTCCCTCACTAAACG
-TAAGCCTTCTCCTCACTCTCTCAATCTTATCCATCATAGCAGGCAGTTGAGGTGGATTAA
-ACCAAACCCAGCTACGCAAAATCTTAGCATACTCCTCAATTACCCACATAGGATGAATAA
-TAGCAGTTCTACCGTACAACCCTAACATAACCATTCTTAATTTAACTATTTATATTATCC
-TAACTACTACCGCATTCCTACTACTCAACTTAAACTCCAGCACCACGACCCTACTACTAT
-CTCGCACCTGAAACAAGCTAACATGACTAACACCCTTAATTCCATCCACCCTCCTCTCCC
-TAGGAGGCCTGCCCCCGCTAACCGGCTTTTTGCCCAAATGGGCCATTATCGAAGAATTCA
-CAAAAAACAATAGCCTCATCATCCCCACCATCATAGCCACCATCACCCTCCTTAACCTCT
-ACTTCTACCTACGCCTAATCTACTCCACCTCAATCACACTACTCCCCATATCTAACAACG
-TAAAAATAAAATGACAGTTTGAACATACAAAACCCACCCCATTCCTCCCCACACTCATCG
-CCCTTACCACGCTACTCCTACCTATCTCCCCTTTTATACTAATAATCTTATAGAAATTTA
-GGTTAAATACAGACCAAGAGCCTTCAAAGCCCTCAGTAAGTTGCAATACTTAATTTCTGT
-AACAGCTAAGGACTGCAAAACCCCACTCTGCATCAACTGAACGCAAATCAGCCACTTTAA
-TTAAGCTAAGCCCTTACTAGACCAATGGGACTTAAACCCACAAACACTTAGTTAACAGCT
-AAGCACCCTAATCAACTGGCTTCAATCTACTTCTCCCGCCGCCGGGAAAAAAGGCGGGAG
-AAGCCCCGGCAGGTTTGAAGCTGCTTCTTCGAATTTGCAATTCAATATGAAAATCACCTC
-GGAGCTGGTAAAAAGAGGCCTAACCCCTGTCTTTAGATTTACAGTCCAATGCTTCACTCA
-GCCATTTTACCTCACCCCCACTGATGTTCGCCGACCGTTGACTATTCTCTACAAACCACA
-AAGACATTGGAACACTATACCTATTATTCGGCGCATGAGCTGGAGTCCTAGGCACAGCTC
-TAAGCCTCCTTATTCGAGCCGAGCTGGGCCAGCCAGGCAACCTTCTAGGTAACGACCACA
-TCTACAACGTTATCGTCACAGCCCATGCATTTGTAATAATCTTCTTCATAGTAATACCCA
-TCATAATCGGAGGCTTTGGCAACTGACTAGTTCCCCTAATAATCGGTGCCCCCGATATGG
-CGTTTCCCCGCATAAACAACATAAGCTTCTGACTCTTACCTCCCTCTCTCCTACTCCTGC
-TCGCATCTGCTATAGTGGAGGCCGGAGCAGGAACAGGTTGAACAGTCTACCCTCCCTTAG
-CAGGGAACTACTCCCACCCTGGAGCCTCCGTAGACCTAACCATCTTCTCCTTACACCTAG
-CAGGTGTCTCCTCTATCTTAGGGGCCATCAATTTCATCACAACAATTATCAATATAAAAC
-CCCCTGCCATAACCCAATACCAAACGCCCCTCTTCGTCTGATCCGTCCTAATCACAGCAG
-TCCTACTTCTCCTATCTCTCCCAGTCCTAGCTGCTGGCATCACTATACTACTAACAGACC
-GCAACCTCAACACCACCTTCTTCGACCCCGCCGGAGGAGGAGACCCCATTCTATACCAAC
-ACCTATTCTGATTTTTCGGTCACCCTGAAGTTTATATTCTTATCCTACCAGGCTTCGGAA
-TAATCTCCCATATTGTAACTTACTACTCCGGAAAAAAAGAACCATTTGGATACATAGGTA
-TGGTCTGAGCTATGATATCAATTGGCTTCCTAGGGTTTATCGTGTGAGCACACCATATAT
-TTACAGTAGGAATAGACGTAGACACACGAGCATATTTCACCTCCGCTACCATAATCATCG
-CTATCCCCACCGGCGTCAAAGTATTTAGCTGACTCGCCACACTCCACGGAAGCAATATGA
-AATGATCTGCTGCAGTGCTCTGAGCCCTAGGATTCATCTTTCTTTTCACCGTAGGTGGCC
-TGACTGGCATTGTATTAGCAAACTCATCACTAGACATCGTACTACACGACACGTACTACG
-TTGTAGCCCACTTCCACTATGTCCTATCAATAGGAGCTGTATTTGCCATCATAGGAGGCT
-TCATTCACTGATTTCCCCTATTCTCAGGCTACACCCTAGACCAAACCTACGCCAAAATCC
-ATTTCACTATCATATTCATCGGCGTAAATCTAACTTTCTTCCCACAACACTTTCTCGGCC
-TATCCGGAATGCCCCGACGTTACTCGGACTACCCCGATGCATACACCACATGAAACATCC
-TATCATCTGTAGGCTCATTCATTTCTCTAACAGCAGTAATATTAATAATTTTCATGATTT
-GAGAAGCCTTCGCTTCGAAGCGAAAAGTCCTAATAGTAGAAGAACCCTCCATAAACCTGG
-AGTGACTATATGGATGCCCCCCACCCTACCACACATTCGAAGAACCCGTATACATAAAAT
-CTAGACAAAAAAGGAAGGAATCGAACCCCCCAAAGCTGGTTTCAAGCCAACCCCATGGCC
-TCCATGACTTTTTCAAAAAGGTATTAGAAAAACCATTTCATAACTTTGTCAAAGTTAAAT
-TATAGGCTAAATCCTATATATCTTAATGGCACATGCAGCGCAAGTAGGTCTACAAGACGC
-TACTTCCCCTATCATAGAAGAGCTTATCACCTTTCATGATCACGCCCTCATAATCATTTT
-CCTTATCTGCTTCCTAGTCCTGTATGCCCTTTTCCTAACACTCACAACAAAACTAACTAA
-TACTAACATCTCAGACGCTCAGGAAATAGAAACCGTCTGAACTATCCTGCCCGCCATCAT
-CCTAGTCCTCATCGCCCTCCCATCCCTACGCATCCTTTACATAACAGACGAGGTCAACGA
-TCCCTCCCTTACCATCAAATCAATTGGCCACCAATGGTACTGAACCTACGAGTACACCGA
-CTACGGCGGACTAATCTTCAACTCCTACATACTTCCCCCATTATTCCTAGAACCAGGCGA
-CCTGCGACTCCTTGACGTTGACAATCGAGTAGTACTCCCGATTGAAGCCCCCATTCGTAT
-AATAATTACATCACAAGACGTCTTGCACTCATGAGCTGTCCCCACATTAGGCTTAAAAAC
-AGATGCAATTCCCGGACGTCTAAACCAAACCACTTTCACCGCTACACGACCGGGGGTATA
-CTACGGTCAATGCTCTGAAATCTGTGGAGCAAACCACAGTTTCATGCCCATCGTCCTAGA
-ATTAATTCCCCTAAAAATCTTTGAAATAGGGCCCGTATTTACCCTATAGCACCCCCTCTA
-CCCCCTCTAGAGCCCACTGTAAAGCTAACTTAGCATTAACCTTTTAAGTTAAAGATTAAG
-AGAACCAACACCTCTTTACAGTGAAATGCCCCAACTAAATACTACCGTATGGCCCACCAT
-AATTACCCCCATACTCCTTACACTATTCCTCATCACCCAACTAAAAATATTAAACACAAA
-CTACCACCTACCTCCCTCACCAAAGCCCATAAAAATAAAAAATTATAACAAACCCTGAGA
-ACCAAAATGAACGAAAATCTGTTCGCTTCATTCATTGCCCCCACAATCCTAGGCCTACCC
-GCCGCAGTACTGATCATTCTATTTCCCCCTCTATTGATCCCCACCTCCAAATATCTCATC
-AACAACCGACTAATCACCACCCAACAATGACTAATCAAACTAACCTCAAAACAAATGATA
-ACCATACACAACACTAAAGGACGAACCTGATCTCTTATACTAGTATCCTTAATCATTTTT
-ATTGCCACAACTAACCTCCTCGGACTCCTGCCTCACTCATTTACACCAACCACCCAACTA
-TCTATAAACCTAGCCATGGCCATCCCCTTATGAGCGGGCACAGTGATTATAGGCTTTCGC
-TCTAAGATTAAAAATGCCCTAGCCCACTTCTTACCACAAGGCACACCTACACCCCTTATC
-CCCATACTAGTTATTATCGAAACCATCAGCCTACTCATTCAACCAATAGCCCTGGCCGTA
-CGCCTAACCGCTAACATTACTGCAGGCCACCTACTCATGCACCTAATTGGAAGCGCCACC
-CTAGCAATATCAACCATTAACCTTCCCTCTACACTTATCATCTTCACAATTCTAATTCTA
-CTGACTATCCTAGAAATCGCTGTCGCCTTAATCCAAGCCTACGTTTTCACACTTCTAGTA
-AGCCTCTACCTGCACGACAACACATAATGACCCACCAATCACATGCCTATCATATAGTAA
-AACCCAGCCCATGACCCCTAACAGGGGCCCTCTCAGCCCTCCTAATGACCTCCGGCCTAG
-CCATGTGATTTCACTTCCACTCCATAACGCTCCTCATACTAGGCCTACTAACCAACACAC
-TAACCATATACCAATGATGGCGCGATGTAACACGAGAAAGCACATACCAAGGCCACCACA
-CACCACCTGTCCAAAAAGGCCTTCGATACGGGATAATCCTATTTATTACCTCAGAAGTTT
-TTTTCTTCGCAGGATTTTTCTGAGCCTTTTACCACTCCAGCCTAGCCCCTACCCCCCAAT
-TAGGAGGGCACTGGCCCCCAACAGGCATCACCCCGCTAAATCCCCTAGAAGTCCCACTCC
-TAAACACATCCGTATTACTCGCATCAGGAGTATCAATCACCTGAGCTCACCATAGTCTAA
-TAGAAAACAACCGAAACCAAATAATTCAAGCACTGCTTATTACAATTTTACTGGGTCTCT
-ATTTTACCCTCCTACAAGCCTCAGAGTACTTCGAGTCTCCCTTCACCATTTCCGACGGCA
-TCTACGGCTCAACATTTTTTGTAGCCACAGGCTTCCACGGACTTCACGTCATTATTGGCT
-CAACTTTCCTCACTATCTGCTTCATCCGCCAACTAATATTTCACTTTACATCCAAACATC
-ACTTTGGCTTCGAAGCCGCCGCCTGATACTGGCATTTTGTAGATGTGGTTTGACTATTTC
-TGTATGTCTCCATCTATTGATGAGGGTCTTACTCTTTTAGTATAAATAGTACCGTTAACT
-TCCAATTAACTAGTTTTGACAACATTCAAAAAAGAGTAATAAACTTCGCCTTAATTTTAA
-TAATCAACACCCTCCTAGCCTTACTACTAATAATTATTACATTTTGACTACCACAACTCA
-ACGGCTACATAGAAAAATCCACCCCTTACGAGTGCGGCTTCGACCCTATATCCCCCGCCC
-GCGTCCCTTTCTCCATAAAATTCTTCTTAGTAGCTATTACCTTCTTATTATTTGATCTAG
-AAATTGCCCTCCTTTTACCCCTACCATGAGCCCTACAAACAACTAACCTGCCACTAATAG
-TTATGTCATCCCTCTTATTAATCATCATCCTAGCCCTAAGTCTGGCCTATGAGTGACTAC
-AAAAAGGATTAGACTGAACCGAATTGGTATATAGTTTAAACAAAACGAATGATTTCGACT
-CATTAAATTATGATAATCATATTTACCAAATGCCCCTCATTTACATAAATATTATACTAG
-CATTTACCATCTCACTTCTAGGAATACTAGTATATCGCTCACACCTCATATCCTCCCTAC
-TATGCCTAGAAGGAATAATACTATCGCTGTTCATTATAGCTACTCTCATAACCCTCAACA
-CCCACTCCCTCTTAGCCAATATTGTGCCTATTGCCATACTAGTCTTTGCCGCCTGCGAAG
-CAGCGGTGGGCCTAGCCCTACTAGTCTCAATCTCCAACACATATGGCCTAGACTACGTAC
-ATAACCTAAACCTACTCCAATGCTAAAACTAATCGTCCCAACAATTATATTACTACCACT
-GACATGACTTTCCAAAAAACACATAATTTGAATCAACACAACCACCCACAGCCTAATTAT
-TAGCATCATCCCTCTACTATTTTTTAACCAAATCAACAACAACCTATTTAGCTGTTCCCC
-AACCTTTTCCTCCGACCCCCTAACAACCCCCCTCCTAATACTAACTACCTGACTCCTACC
-CCTCACAATCATGGCAAGCCAACGCCACTTATCCAGTGAACCACTATCACGAAAAAAACT
-CTACCTCTCTATACTAATCTCCCTACAAATCTCCTTAATTATAACATTCACAGCCACAGA
-ACTAATCATATTTTATATCTTCTTCGAAACCACACTTATCCCCACCTTGGCTATCATCAC
-CCGATGAGGCAACCAGCCAGAACGCCTGAACGCAGGCACATACTTCCTATTCTACACCCT
-AGTAGGCTCCCTTCCCCTACTCATCGCACTAATTTACACTCACAACACCCTAGGCTCACT
-AAACATTCTACTACTCACTCTCACTGCCCAAGAACTATCAAACTCCTGAGCCAACAACTT
-AATATGACTAGCTTACACAATAGCTTTTATAGTAAAGATACCTCTTTACGGACTCCACTT
-ATGACTCCCTAAAGCCCATGTCGAAGCCCCCATCGCTGGGTCAATAGTACTTGCCGCAGT
-ACTCTTAAAACTAGGCGGCTATGGTATAATACGCCTCACACTCATTCTCAACCCCCTGAC
-AAAACACATAGCCTACCCCTTCCTTGTACTATCCCTATGAGGCATAATTATAACAAGCTC
-CATCTGCCTACGACAAACAGACCTAAAATCGCTCATTGCATACTCTTCAATCAGCCACAT
-AGCCCTCGTAGTAACAGCCATTCTCATCCAAACCCCCTGAAGCTTCACCGGCGCAGTCAT
-TCTCATAATCGCCCACGGGCTTACATCCTCATTACTATTCTGCCTAGCAAACTCAAACTA
-CGAACGCACTCACAGTCGCATCATAATCCTCTCTCAAGGACTTCAAACTCTACTCCCACT
-AATAGCTTTTTGATGACTTCTAGCAAGCCTCGCTAACCTCGCCTTACCCCCCACTATTAA
-CCTACTGGGAGAACTCTCTGTGCTAGTAACCACGTTCTCCTGATCAAATATCACTCTCCT
-ACTTACAGGACTCAACATACTAGTCACAGCCCTATACTCCCTCTACATATTTACCACAAC
-ACAATGGGGCTCACTCACCCACCACATTAACAACATAAAACCCTCATTCACACGAGAAAA
-CACCCTCATGTTCATACACCTATCCCCCATTCTCCTCCTATCCCTCAACCCCGACATCAT
-TACCGGGTTTTCCTCTTGTAAATATAGTTTAACCAAAACATCAGATTGTGAATCTGACAA
-CAGAGGCTTACGACCCCTTATTTACCGAGAAAGCTCACAAGAACTGCTAACTCATGCCCC
-CATGTCTAACAACATGGCTTTCTCAACTTTTAAAGGATAACAGCTATCCATTGGTCTTAG
-GCCCCAAAAATTTTGGTGCAACTCCAAATAAAAGTAATAACCATGCACACTACTATAACC
-ACCCTAACCCTGACTTCCCTAATTCCCCCCATCCTTACCACCCTCGTTAACCCTAACAAA
-AAAAACTCATACCCCCATTATGTAAAATCCATTGTCGCATCCACCTTTATTATCAGTCTC
-TTCCCCACAACAATATTCATGTGCCTAGACCAAGAAGTTATTATCTCGAACTGACACTGA
-GCCACAACCCAAACAACCCAGCTCTCCCTAAGCTTCAAACTAGACTACTTCTCCATAATA
-TTCATCCCTGTAGCATTGTTCGTTACATGGTCCATCATAGAATTCTCACTGTGATATATA
-AACTCAGACCCAAACATTAATCAGTTCTTCAAATATCTACTCATCTTCCTAATTACCATA
-CTAATCTTAGTTACCGCTAACAACCTATTCCAACTGTTCATCGGCTGAGAGGGCGTAGGA
-ATTATATCCTTCTTGCTCATCAGTTGATGATACGCCCGAGCAGATGCCAACACAGCAGCC
-ATTCAAGCAATCCTATACAACCGTATCGGCGATATCGGTTTCATCCTCGCCTTAGCATGA
-TTTATCCTACACTCCAACTCATGAGACCCACAACAAATAGCCCTTCTAAACGCTAATCCA
-AGCCTCACCCCACTACTAGGCCTCCTCCTAGCAGCAGCAGGCAAATCAGCCCAATTAGGT
-CTCCACCCCTGACTCCCCTCAGCCATAGAAGGCCCCACCCCAGTCTCAGCCCTACTCCAC
-TCAAGCACTATAGTTGTAGCAGGAATCTTCTTACTCATCCGCTTCCACCCCCTAGCAGAA
-AATAGCCCACTAATCCAAACTCTAACACTATGCTTAGGCGCTATCACCACTCTGTTCGCA
-GCAGTCTGCGCCCTTACACAAAATGACATCAAAAAAATCGTAGCCTTCTCCACTTCAAGT
-CAACTAGGACTCATAATAGTTACAATCGGCATCAACCAACCACACCTAGCATTCCTGCAC
-ATCTGTACCCACGCCTTCTTCAAAGCCATACTATTTATGTGCTCCGGGTCCATCATCCAC
-AACCTTAACAATGAACAAGATATTCGAAAAATAGGAGGACTACTCAAAACCATACCTCTC
-ACTTCAACCTCCCTCACCATTGGCAGCCTAGCATTAGCAGGAATACCTTTCCTCACAGGT
-TTCTACTCCAAAGACCACATCATCGAAACCGCAAACATATCATACACAAACGCCTGAGCC
-CTATCTATTACTCTCATCGCTACCTCCCTGACAAGCGCCTATAGCACTCGAATAATTCTT
-CTCACCCTAACAGGTCAACCTCGCTTCCCCACCCTTACTAACATTAACGAAAATAACCCC
-ACCCTACTAAACCCCATTAAACGCCTGGCAGCCGGAAGCCTATTCGCAGGATTTCTCATT
-ACTAACAACATTTCCCCCGCATCCCCCTTCCAAACAACAATCCCCCTCTACCTAAAACTC
-ACAGCCCTCGCTGTCACTTTCCTAGGACTTCTAACAGCCCTAGACCTCAACTACCTAACC
-AACAAACTTAAAATAAAATCCCCACTATGCACATTTTATTTCTCCAACATACTCGGATTC
-TACCCTAGCATCACACACCGCACAATCCCCTATCTAGGCCTTCTTACGAGCCAAAACCTG
-CCCCTACTCCTCCTAGACCTAACCTGACTAGAAAAGCTATTACCTAAAACAATTTCACAG
-CACCAAATCTCCACCTCCATCATCACCTCAACCCAAAAAGGCATAATTAAACTTTACTTC
-CTCTCTTTCTTCTTCCCACTCATCCTAACCCTACTCCTAATCACATAACCTATTCCCCCG
-AGCAATCTCAATTACAATATATACACCAACAAACAATGTTCAACCAGTAACTACTACTAA
-TCAACGCCCATAATCATACAAAGCCCCCGCACCAATAGGATCCTCCCGAATCAACCCTGA
-CCCCTCTCCTTCATAAATTATTCAGCTTCCTACACTATTAAAGTTTACCACAACCACCAC
-CCCATCATACTCTTTCACCCACAGCACCAATCCTACCTCCATCGCTAACCCCACTAAAAC
-ACTCACCAAGACCTCAACCCCTGACCCCCATGCCTCAGGATACTCCTCAATAGCCATCGC
-TGTAGTATATCCAAAGACAACCATCATTCCCCCTAAATAAATTAAAAAAACTATTAAACC
-CATATAACCTCCCCCAAAATTCAGAATAATAACACACCCGACCACACCGCTAACAATCAA
-TACTAAACCCCCATAAATAGGAGAAGGCTTAGAAGAAAACCCCACAAACCCCATTACTAA
-ACCCACACTCAACAGAAACAAAGCATACATCATTATTCTCGCACGGACTACAACCACGAC
-CAATGATATGAAAAACCATCGTTGTATTTCAACTACAAGAACACCAATGACCCCAATACG
-CAAAACTAACCCCCTAATAAAATTAATTAACCACTCATTCATCGACCTCCCCACCCCATC
-CAACATCTCCGCATGATGAAACTTCGGCTCACTCCTTGGCGCCTGCCTGATCCTCCAAAT
-CACCACAGGACTATTCCTAGCCATGCACTACTCACCAGACGCCTCAACCGCCTTTTCATC
-AATCGCCCACATCACTCGAGACGTAAATTATGGCTGAATCATCCGCTACCTTCACGCCAA
-TGGCGCCTCAATATTCTTTATCTGCCTCTTCCTACACATCGGGCGAGGCCTATATTACGG
-ATCATTTCTCTACTCAGAAACCTGAAACATCGGCATTATCCTCCTGCTTGCAACTATAGC
-AACAGCCTTCATAGGCTATGTCCTCCCGTGAGGCCAAATATCATTCTGAGGGGCCACAGT
-AATTACAAACTTACTATCCGCCATCCCATACATTGGGACAGACCTAGTTCAATGAATCTG
-AGGAGGCTACTCAGTAGACAGTCCCACCCTCACACGATTCTTTACCTTTCACTTCATCTT
-GCCCTTCATTATTGCAGCCCTAGCAACACTCCACCTCCTATTCTTGCACGAAACGGGATC
-AAACAACCCCCTAGGAATCACCTCCCATTCCGATAAAATCACCTTCCACCCTTACTACAC
-AATCAAAGACGCCCTCGGCTTACTTCTCTTCCTTCTCTCCTTAATGACATTAACACTATT
-CTCACCAGACCTCCTAGGCGACCCAGACAATTATACCCTAGCCAACCCCTTAAACACCCC
-TCCCCACATCAAGCCCGAATGATATTTCCTATTCGCCTACACAATTCTCCGATCCGTCCC
-TAACAAACTAGGAGGCGTCCTTGCCCTATTACTATCCATCCTCATCCTAGCAATAATCCC
-CATCCTCCATATATCCAAACAACAAAGCATAATATTTCGCCCACTAAGCCAATCACTTTA
-TTGACTCCTAGCCGCAGACCTCCTCATTCTAACCTGAATCGGAGGACAACCAGTAAGCTA
-CCCTTTTACCATCATTGGACAAGTAGCATCCGTACTATACTTCACAACAATCCTAATCCT
-AATACCAACTATCTCCCTAATTGAAAACAAAATACTCAAATGGGCCTGTCCTTGTAGTAT
-AAACTAATACACCAGTCTTGTAAACCGGAGATGAAAACCTTTTTCCAAGGACAAATCAGA
-GAAAAAGTCTTTAACTCCACCATTAGCACCCAAAGCTAAGATTCTAATTTAAACTATTCT
-CTGTTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAACA
-ACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGTACGGTACCATAAAT
-ACTTGACCACCTGTAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTA
-CAAGCAAGTACAGCAATCAACCCTCAACTATCACACATCAACTGCAACTCCAAAGCCACC
-CCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGC
-CATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCC
-TCAGATAGGGGTCCCTTGACCACCATCCTCCGTGAAATCAATATCCCGCACAAGAGTGCT
-ACTCTCCTCGCTCCGGGCCCATAACACTTGGGGGTAGCTAAAGTGAACTGTATCCGACAT
-CTGGTTCCTACTTCAGGGTCATAAAGCCTAAATAGCCCACACGTTCCCCTTAAATAAGAC
-ATCACGATG

test/MT-orang.fa

@@ -1,276 +0,0 @@
->MT_orang
-GTTTATGTAGCTTATTCTATCCAAAGCAATGCACTGAAAATGTCTCGACGGGCCCACACG
-CCCCATAAACAAATAGGTTTGGTCCTAGCCTTTCTATTAGCTCTTAGTGAGGTTACACAT
-GCAAGCATCCCCGCCCCAGTGAGTCGCCCTCCAAGTCACTCTGACTAAGAGGAGCAAGCA
-TCAAGCACGCAACAGCGCAGCTCAAGACGCTCAGCCTAGCCACACCCCCACGGGAGACAG
-CAGTGATAAGTCTTTAGCAATAAACGAAAGTTCAACTAAGCTACACTAACCCCAGGGTTG
-GTCAACTTCGTGCCAGCCACCGCGGTCACACGATTAGCCCAAGTTAATAGAGATCGGCGT
-AGAGAGTGTTTTAGATTCTTTTTCTCCCCAATAAAGCTAAAATTTACCTGAGTTGTAGAA
-AACTTAAGCTAATACAAAATAAACTACGAAAGTGGCTTTAATATATCTGAACACACAATA
-GCTAAGGCCCAAACTGGGATTAGATACCCCACTATGCTTAGCCCTAAACTTTAACAGTTA
-AATCAACAAAACTGCTCGCCAGAACACTACGAGCCACAGCTTAAAACTCAAAGGACCTGG
-CGGTGCTTCATATCCCTCTAGAGGAGCCTGTTCTGTAATCGATAAACCCCGATCAACCTC
-ACCACCCCTTGCTCAGCCTATATACCGCCATCTTCAGCAAACCCTGATGAAGGCCACGAA
-GTAAGCGCAAGCATCCACATAAAGACGTTAGGTCAAGGTGTAGCCCATGGAGTGGCAAGA
-AATGGGCTACATTTTCTACTTCAGAAAACTACGATAGCCCTCATGAAACCTGAGGGTCGA
-AGGTGGATTTAGCAGTAAACTAAGAGTAGAGTGCTTAGTTGAACAGGGCCCTGAAGCGCG
-TACACACCGCCCGTCACCCTCTTCAAGTATATTTCAGGGACTACCTAACTAAAACCCCCA
-CGCATCTATATAGAGGAGGCAAGTCGTAACATGGTAAGCGTACTGGAAAGTGCGCTTGGA
-CGAACCAGAGGGTAGCTTAACACAAAGCACCCGGCTTACACCTGGGAGATTTCAATTCAA
-CCTGGCCCCTCTGAGCTAACCCTAGCCCCAAACCCAACCCACCCTACTACCAACCAACCC
-TAACCAAACCATTCACCCAAACAAAGTATAGGCGATAGAAATTACAATCCGGCGCAATAG
-ACACAGTACCGTAAGGGAAAGATGAAAAAACACAACCAAGCACAACATAGCAAGGACTAA
-CCCCTGTACCTTTTGCATAATGAATTAACTAGAAACAACTTTGCAAGGAGAGCCAAAGCC
-AAGACCCCCGAAACCAGACGAGCTACCCATAAACAGCTAAAAGAGCACACCCGTCTATGT
-AGCAAAATAGTGGGAAGATTTATGGGTAGAGGCGACAAACCTACCGAGCCTGGTGATAGC
-TGGTTGTCCAAGACAGAATCTTAGTTCAACTTTAAATTTACTTACAGAACCCCTAATCCC
-CTCGTAAATTTAATTGCTAGTCTAAAGAGGAACAGCTCTTTAGACACTAGGAAAAAACCT
-TAAAAAGAGAGTAAAAAACACAACACCCATAGTGGGCCCAAAAGCAGCCATCAATTAAGA
-AAGCGTTCAAGCTCGACACCTAAACACCAAAAAATACCAAACACAAAACTGAACTCCTTA
-CTCCCCATTGGACTAATCTATTGCCCCATAGAAGAAACAATGTTAGTATAAGTAACATGA
-AGATATTCTCCCCCGCATAAGTCTACGTCAGACCGAAACATCACACTGACAATTAACGGT
-CCAATATGCATAGTTAACAAATAAACTATTATTTTTTCCCCCCGTTAATCCAACACAGGC
-ATGCCTATAAGGAAAGGTTAAAAAAAGTAAAAGGAACTCGGCAAATCTCACCCCGCCTGT
-TTACCAAAAACATCACCTCTAGCATTACCAGTATTAGAGGCACCGCCTGCCCGGTGACAT
-ACGTTTAACGGCCGCGGTACCCTGACCGTGCAAAGGTAGCATAATCACTTGTTCCTTAAA
-TGGGGACTTGTATGAATGGCTTCACGAGGGTTCGACTGTCTCTTACTTTTAACCAGTGAA
-ATTGACCTGCCCGTGAAGAGGCGGGCATAACATAACAAGACGAGAAGACCCTATGGAGCT
-TCAATTTACCAGTGCAAATAACATACAACAAGCCCACAGGCCCTAAATCACCAAACCTGC
-ACTGAAGATTTCGGTTGGGGCGACCTCGGAGCACAACCCAACCTCCGAGAAACACATGTT
-AAGACCTCACAAGTCAAAACGAACTTCCACACACAATTGATCCAACAACTTGACCAACGG
-AACAAGTTACCCTAGGGATAACAGCGCAATCCTGTTCTAGAGTCCATATCAACAACAGGG
-TTTACGACCTCGATGTTGGATCAGGACATCCTAATGGTGCAGCCGCTATTAAAGGTTCGT
-TTGTTCAACGATTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGCAATCCAGGTCGGTT
-TCTATCTATTTCACATTTCTCCCTGTACGAAAGGACAAGAGAAATGGGGCCTACTTCACA
-TAAGCGCCTTTCCCAAACAAATGATATCATCTCAATTTAACACCACACCAACACCCACCC
-AAGAAAAGGGCTATGTTAAGATGGCAGAGCCCGGTAACTGCATAAAATTTAAAGCTTTAC
-AGTCAGAGGTTCAACTCCTCTTCTTAACAATATGCCCATAATCAACCTCCTACTCCTCAT
-TATATCCATCCTAATCGCCATAGCATTTCTAATGCTAACCGAACGAAAAATCCTAGGCCA
-CACACAACTACGCAAAGGGCCCAACATTGTGGGCCCCTACGGCTTACTACAACCCTTTGC
-CGACGCCCTAAAACTATTCACCAAAGAACCCCTAAAACCCTCCACATCAACCATCACCCT
-TTACATTATTTCCCCCGCCCTAGCCCTTACCATTGCCCTCCTACTATGAACCCCCCTCCC
-TATGCCCATCCCCCTAATCAACCTCAACTTAGGCCTCCTATTTATCCTAGCCGCGTCAAG
-CCTAACCGTCTACTCCATCCTCTGATCAGGATGAGCATCTAACTCAAACTACGCCCTAAT
-CGGCGCATTGCGGGCGGTAGCCCAAACGATCTCATACGAAATTACCCTAGCCCTTATCCT
-GTTATCAGTACTACTAATAAGCGGCTCTTTTAACCTCTCCGCCCTCATCACAACACAAGA
-ACACTCATGACTACTTCTACCATCATGACCTCTAGCCCTAATATGATTTATTTCAACACT
-AGCAGAAACCAACCGAGCCCCCTTCGACCTCACCGAAGGAGAATCCGAACTAGTTTCGGG
-CTTTAACACTGAATACGCCGCAGGTCCATTCGCCCTATTCTTCATAGCCGAATATACAAA
-CATTATCTTAATAAACGCCCTCACCACTATAATTTTCCTAGGAACAACATTCAACATCCA
-CTCCCCAGAACTCTACACAACCCTCTTCACCATCAAAACCCTACTCCTAACCTCCCTATT
-CCTATGAATTCGATCAACATACCCCCGATTCCGCTACGACCAACTCATGCACCTTCTATG
-AAAAAATTTCCTGCCACTCACCCTAGCACTACTAATATGACACATCTCCGTACCCATTGC
-AACCTCCGGCATTCCCCCACAAACCTAAGAAATATGTCTGACAAAAGAGTTACTTTGATA
-GAGTAAAAAATAGAGGTCTAAATCCCCTTATTTCTAGGATTATGGGAGTTGAACCCACCC
-CTGAGAATCCAAAATTCTCCGTGCCACCCATCACACCCTATCCTAAAGTAAGGTCAGCTA
-AATAAGCTATCGGGCCCATACCCCGAAAATGTTGGTTATACCCTTCCCGTACTAATTAAC
-CCCTTGGCCCAACCCATCATTTACCCCACCATCTTCACAGGCACGCTCATTACAGCACTG
-AGCTCCCACTGATTCTTTGCCTGACTGGGACTAGAAATAAATATACTCGCTTTCATCCCA
-GTCCTAACCAAAAAAACAAGCCCCCGCTCCACAGAAGCCGCCATTAAATATTTCCTCACA
-CAGGCAACCGCATCCATAATCCTCCTGATAGCCATCCTCTACAACAACATACTTTCCGGA
-CAGTGAACCACAACCAACACCACCAACCCATATTCATCTCTAATAATCGTAACCGCCCTA
-GCAATGAAGCTAGGAATAGCCCCCTTCCACTTTTGAGTCCCAGAAGTCACCCAAGGAGTC
-CCCCTGACATCCGGCTTACTCCTCCTTACATGACAAAAATTAGCCCCCATTTCAATTATA
-TACCAAATATCTTCATCGGTAGACACAAACATCCTCCTCACCCTCTCAATTCTATCTATC
-CTAGTAGGCGGCTGAGGCGGACTAAACCAAACCCAACTACGCAAAATCCTGGCATACTCC
-TCAATCACCCATATAGGATGAATAATAGCAGTACTACCATATAACCCAGACATCACTATC
-CTCAACCTAATCATCTACATCATCCTGACAACTACCGCATTCCTAATCCTCGACTTAAAC
-TCTAGTGTCACAATCCTAATATTAACCCGCACCTGGAACAAGCTGACATGACTAATACCC
-TTAATCCCATCAACCTTATTATCCCTAGGGGGCCTGCCACCACTAACCGGCTTCCTGCCC
-AAATGAGCCATCATTGAAGAATTTGCAAAAAATGGCAATCTCATTACCCCCACAATCATG
-GCTATTATCACCCTCCTCAACCTCTACTTCTACGTACGCCTAATCTACGCCACCTCAATC
-ACACTACTCCCCATATCTAACAACGCAAAAATGAAATGACAGTTCGAAAACACAAAACCC
-ACCCCTCTTCTCCCCACACTCACCATTCTTACCACCCTACTCCTACCTATCTCCCCTCTC
-ATCCTATCTATCTCATAGAAATTTAGGTTAACACAGACCAAGAGCCTTCAAAGCCCTCAG
-CAAGTCACAGCACTTAATTTCTGTAACACTAAGGACTGCAAAGCCCCGCTCTGCATCAAC
-TGAACGCAAACCAGCCACTTTAATTAAGCTAAGCCCTCCCTAGACCGATGGGACTTAAAC
-CCACAAACATTTAGTTAACAGCTAAACACCCTAATCAATTGGCTTCAGTCCACTTCTCCC
-GCCGCGGGGAAAAAGGCGGGAGAAGCCCCGGCAGGCCTTAAAGCTGCTCCTTCGAATTTG
-CAATTCAACATGACAATCACCTCGGGGCTGGTAAAAAGAGGTCTAACCCCTGTTCTTAGA
-TTTACAGCCTAATGCCTTAACTCGGCCATTTTACCCCCCCCCCCCCTTTTTTTCTCCACT
-AATGTTCGCCGACCGCTGGCTATTCTCCACGAACCACAAAGACATCGGGACACTATACCT
-GTTATTCGGCGCATGGGCTGGAGTCCTAGGCACTGCCCTAAGCCTCCTCATTCGAGCTGA
-ACTGGGCCAACCCGGCAACCTTCTAGGCAATGACCATATCTACAATGTCATCGTCACAGC
-TCATGCATTCGTAATAATTTTCTTTATAGTCATACCCATTATAATTGGAGGCTTTGGCAA
-CTGACTAGTGCCCCTAATAATCGGCGCCCCCGATATAGCATTCCCGCGCATAAATAATAT
-AAGCTTCTGACTCCTCCCCCCCTCCTTTCTCCTACTGCTCGCTTCTGCTACAGTAGAGGC
-TGGCGCAGGAACAGGCTGAACAGTCTATCCGCCCCTAGCAGGAAACTACTCTCACCCAGG
-AGCCTCTGTAGACTTAACAATCTTCTCTTTACACCTAGCAGGCATTTCCTCTATCCTAGG
-AGCTATCAATTTCATCACAACAATTATTAATATAAAACCCCCTGCAATATCCCAATACCA
-AACCCCCCTCTTCGTCTGATCAGTCTTGATCACAGCAGTCCTACTTCTCCTTTCCCTCCC
-AGTCCTAGCCGCTGGCATCACCATACTACTAACAGATCGCAACCTAAACACCACATTCTT
-TGACCCAGCCGGAGGTGGAGATCCCATCCTATATCAGCACCTATTCTGATTTTTTGGCCA
-CCCTGAAGTCTACATTCTCATCCTGCCGGGTTTCGGCATAATCTCCCACATCGTAACACA
-CTATTCCGGAAAAGAAGAGCCATTTGGGTACATAGGCATAGTCTGAGCCATAGTCTCAAT
-TGGCTTCCTGGGCTTTATCGTATGGGCCCACCACATATTCACAGTAGGAATAGACGTGGA
-CACACGAGCCTACTTCACCTCCGCTACCATAATCATTGCCATCCCCACCGGCGTCAAAGT
-ATTTAGCTGACTCGCTACACTCCACGGAAGCAACACTAAATGATCTGCCGCAATCCTCTG
-AGCCTTAGGATTCATTTTCCTCTTCACCGTAGGCGGCCTAACAGGCATCGTACTAGCAAA
-CTCATCACTAGACATTGTATTACACGATACATACTACGTTGTAGCCCACTTTCATTACGT
-CCTATCAATAGGAGCTGTATTCGCCATCATGGGAGGCTTCATCCACTGGTTCCCACTATT
-CTCAGGCTACACCTTAGACCAGACCTATGCTAAAATTCACTTCATCACCATATTTATCGG
-CGTAAATTTAACTTTCTTCCCACAACATTTCCTCGGCCTGTCAGGCATACCCCGACGCTA
-CTCCGACTACCCCGACGCGTACACCACCTGAAATATTTTATCATCCGCAGGCTCATTTAT
-CTCCCTAACAGCAGTCATACTAATAATTTTCATAATTTGAGAAGCCTTCGCCTCAAAACG
-AAAAGTCCCAATAGTTGAACAACCCTCCACAAGCCTAGAGTGATTGTACGGATGCCCCCC
-ACCCTACCACACATTTGAAGAACCCGTCTATATAAAACCAGAACAAAAAAGGAAGGAATC
-GAACCTCCTAAAGCTGGTTTCAAGCCAACCCCACAACCTCCATGACTTTTTCAAGAGATA
-CTAGAAAAACCATTTCATGACTTTGTCAAAGTTAAGTTACAGGCCAAACCCTGTGTATCT
-TAATGGCGCACGCAGCACAGGTAGGTTTACAAGACGCTACCTCTCCTATCATAGAAGAAT
-TGGTCATCTTTCACGACCACGCCCTCATAATCATTTTCCTAATCTGCTTCCTAGTCCTGT
-ACGCCCTATTCCTAACACTCACAACAAAACTCACCAACACCAGCATCTCAGACGCCCAAG
-AGATAGAGACTATTTGAACTATCCTACCGGCCATCATCCTAATTCTAATCGCCCTCCCAT
-CCCTACGCATCCTCTACTTAACAGACGAGATCAACGACCCTTCCTTCACCATCAAATCAA
-TCGGTCATCAATGATACTGAACCTACGAGTACACTGACTACGGTGGATTGATCTTCAACT
-CTTACATGCTCCCACCACTATTCCTAGAACCAGGCGACCTTCGACTCCTCGACGTCGACA
-ACCGAGTAGTCCTCCCAGTCGAAGCTCCCGTTCGCATAATAATCACATCCCAAGACGTCT
-TACACTCATGAACTGTACCCTCACTAGGCCTGAAAACGGACGCAATCCCCGGACGCCTAA
-ACCAAACCACATTCACTGCCACGCGACCAGGAGTGTACTATGGCCAATGCTCAGAAATCT
-GTGGAGCTAACCACAGCTTTATGCCTATCGTCCTAGAACTAATCCCCCTAAAAATCTTCG
-AAATAGGGCCCGTATTCACTTTATAACTTCCCCCACCCCCACAACCCATCCTACCCCCTT
-TCCTGAGGCCCACTGCAAAGCTAATCTAGCATTAACCTTTTAAGTTAAAGACTAAGAGAA
-TCAACCCCTCTTTGCAGTGAAATGCCCCAACTAAATACCACCACATGGCCCACCATCATC
-ACCCCAATACTCCTTGCACTATTCCTCATCACTCAACTAAAACTACTAAACTCACACCTC
-CACCCACCCACCCCACCAAAATTCACTAAACCAAAACTCCACGCCAAACCCTGAGGACCA
-AAATGAACGAAAGTCTATTTACCCCATTCATTACCCCCACAGTACTAGGCCTCCCCGCCG
-CAGTACTAGTCATCTTATTTCCCCCCTTACTGATCCCCACCTCCAAACATCTCATCAACA
-ACCGACTAATTATTATCCAACAATGACTAATCCGACTCATCCTAAAACAAATAATAACCA
-CCCATAACGCTAAAGGACGAACTTGATCCCTCATACTAACGTCCCTAATCATTTTCATCG
-CCTCAACCAACCTCCTAGGACTCCTCCCCTACTCATTTACACCAACCACCCAACTATCCA
-TAAATTTAGCTATAGCAATTCCCTTATGAGCAAGCACGGTAGCTATGGGCCTTCGCTTCA
-AAGCCAAAATTACCCTAACCCACCTCTTACCACAAGGTACCCCCACACCTCTCATCCCTA
-TACTAATTATTATTGAAACCGTCAGCCTTTTCATTCAACCACTAGCCTTAGCCGTACGCC
-TAACTGCTAACATCACTGCAGGCCACCTACTCATGCACCTAATCGGAAGCTCTGCACTAG
-CTATACTAGCCATCAACCTCCCCCTAACCCTCATCACCCTTACAATCTTAACCCTGCTAA
-CAATCCTGGAGACTGCCATCGCCCTAATTCAAGCCTACGTCTTCACACTTCTAGTAAGCC
-TCTACCTGCACGACAACTCATAATGGCCCATCAATCACACGCCTACCACATAGTAAAACC
-TAGCCCATGACCCCTAACAGGAGCTCTCTCAGCCCTCCTAACAACATCTGGCCTAACCAT
-GTGATTCCACTTCCACTCCACAACCCTACTATTAACAGGCCTACTAACCAATGCACTAAC
-CATATACCAATGGTGACGAGATGTAGTGCGAGAAAGCACATACCAAGGCCACCACACACT
-ACCCGTCCAAAAAGGCCTCCGATATGGAATAATCCTATTCATCACTTCAGAAGTCTTTTT
-CTTCGCCGGATTCTTCTGAGCATTCTACCACTCCAGCCTAGCCCCCACCCCTCAACTTGG
-AGGACACTGACCCCCAACAGGCATTATCCCCCTCAACCCCCTAGAAGTCCCACTCCTAAA
-CACATCCGTACTACTCGCATCAGGAGTCTCAATTACCTGAGCCCATCACAGCCTGATGGA
-AAATAATCGAACCCAAATAATTCAAGCACTACTCATCACAATCTTACTAGGCATCTACTT
-CACTCTCCTTCAGGCTTCAGAATACATTGAAGCTCCTTTCACCATCTCTGACGGCATCTA
-CGGCTCAACATTCTTCATAGCCACGGGATTCCACGGCCTCCACGTCATTATCGGATCAAC
-TTTCCTCACTGTATGCCTAGCCCGCCAGCTATTATTCCACTTCACATCCAAACATCACTT
-TGGCTTTGAGGCCGCCGCCTGATACTGGCACTTTGTAGACGTAGTCTGACTGTTTCTGTA
-CGTCTCCATCTACTGATGAGGTTCCTACTCTTTTAGTATAAACAGTACCGTTAACTTCCA
-ATTAACTAGTTTTGACAACGCCCAAAAAAGAGTAATTAACTTCGTCCTAGCTCTAACAGT
-CAACACCCTCCTAGCCCTGCTACTAATAACCATCACATTCTGACTACCACAACTCTACCC
-CTACATAGAAAAATCCGACCCATACGAATGTGGATTTGACCCCGCATACCCCGCTCGCAT
-TCCTTTCTCCATAAAATTTTTCTTAGTAGCCATCACCTTCCTACTATTCGACCTAGAAAT
-CGCCCTGCTACTACCCCTGCCATGGGCCCTACAAACAACCAACTTACCACTAATAACTAC
-ATCATCACTTATATTAATTATCATCCTAGCCCTAGGCCTAACTTACGAATGATCACAAAA
-AGGATTAGACTGAGCCGAATTGGTAAATAGTTTAAACAAAACAAATGATTTCGACTCATT
-AAATTATGACAGCCATATTTACCAAATGCCCCTTATCTACATAAATATCACACTAGCATT
-CACCATATCACTCCTAGGCATACTAGTCTACCGCTCACACCTAATATCTTCTCTACTATG
-TCTAGAAGGAATAATATTATCATTGTTCATTATAATTACTCTCATAACCCTCAACACCCA
-CTCTCTCCTAGCTAACATCATACCCATCACCATGCTAGTCTTCGCTGCCTGCGAAGCAGC
-AGTAGGCCTCGCCCTACTAGCCTCAATCTCCAATACATACGGCCTAGACTACGTCAACAA
-CCTAAACCTACTTCAATGCTAAAACTAATTATCCCAACAATCATACTGCTGCCCCTAACA
-TGACTCTCCAAAACGCACATAATCTGAATCAACACCACCACCCACAGCCTAATCATCAGC
-TCCATCCCCCTACTATTCCTCAATCAAACCAACAGCAACCTGTACAGCTACTCCCTTCTT
-TTCTCCTCCGACCCCTTATCAACCCCCCTTCTAATACTAACAACCTGACTCCTACCCCTC
-ATAATTATAGCAAGCCAACACCATCTATCCAACGAACCCCCATCACGAAAAAAATTATAC
-CTCACCATACTAATCTCTCTTCAAATCTCCCTAATCATAACATTCACAGCCACAGAGCTA
-ATTATATTTTATATCCTCTTCGAAACCACTCTCATCCCCACCCTAGTCATTATCACCCGC
-TGAGGCAACCAGCCAGAGCGCTTAAATGCAGGCACATACTTTCTATTCTACACACTAGTA
-GGCTCCCTCCCCCTACTCATTGCCCTAATCCACACCTACAACACCCTAGGCTCGCTTAAC
-ATTGTATTACTAACTCTCACCGCCCGGGAGCTAACAGACTCCTGATCCAACAGCCTAATA
-TGACTAGCGTACACAATAGCTTTCATAGTAAAAATACCCCTCTACGGACTACACCTATGA
-CTCCCTAAAGCCCATGTAGAAGCCCCCATTGCCGGCTCAATAGTACTCGCCGCAGTGCTC
-TTAAAACTAGGTGGTTACGGTATAATACGCCTTATCCCCATTCTCAATCCCCTAACTAAA
-CACATAGCCTACCCCTTTATCATACTATCCCTATGAGGCATAATCATAACAAGCTCCATC
-TGCTTACGACAAACCGACCTAAAATCACTCATCGCATACTCCTCAGTCAGCCACATAGCG
-CTTGTTGTAGCAGCTATCCTCATTCAAACCCCCTGAAGCTTCACCGGCGCAACCACCCTC
-ATAATTGCCCATGGACTCACATCCTCCCTACTGTTCTGCCTAGCAAACTCAAACTACGAA
-CGAACCCACAGCCGCATCATAATCCTCTCTCAAGGCCTTCAAACTCTACTCCCCCTAATA
-GCCCTCTGATGACTTCTAGCAAGCCTCACTAACCTTGCCCTACCACCCACCATCAACCTA
-CTAGGAGAACTCTCCGTACTAATAGCCATATTCTCTTGATCTAACATCACCATCCTACTA
-ACAGGACTCAACATACTAATCACAACCCTATACTCTCTCTATATATTCACCACAACACAA
-CGAGGTACACCCACACATCACACCAACAACATAAAACCTTCTTTCACACGTGAAAACACC
-CTCATGCTCATACACCTATCCCCCATTCTCCTCTTGTCCCTCAACCCCAGCATCATCGCT
-GGATTCGCCTACTGTAAATATAGTTTAACCAAAACATCAGATTGTGAATCTAATAATAGG
-GCCCACAACCCCTTATTTACCGAGAAAGCTCACAAGAACTGCTAACTCTCACCCCATGTG
-TAACAACATGGCTTTCTCAACTTTTAAAGGATAACAGCTATCCCTTGGTCTTAGGACCCA
-AAAATTTTGGTGCAACTCCAAATAAAAGTAACAGCCATGTTTACCACCATAACTGCCCTC
-ACCTTGACTTCCCTAATCCCCCCCATTACCGCTACCCTCATTAACCCCAACAAAAAAAAC
-TCATACCCCCACTATGTAAAAACTGCCATCGCATCCGCCTTTACTATCAGCCTTATCCCA
-ACAACAATATTTATCTGCCTAGGACAAGAAACCATCGTCACAAACTGATGCTGAACAACC
-ACCCAGACACTACAACTCTCACTAAGCTTCAAACTTGACTACTTCTCCATAACATTCCTC
-CCCGTAGCACTACTCATCACTTGATCCATTATAGAATTTTCACTATGGTATATAGCCTCA
-GACCCAAACATCAACCAATTTCTCAAATTCCTCCTTATTTTCCTAATCACCATAATTATC
-CTAGTCACTGCCAATAACCTACTCCAACTCTTCATCGGCTGAGAGGGCGTAGGGATCATA
-TCCTTCCTGCTCATTAGTTGATGATACGCCCGAACAGACGCCAACACGGCAGCTATTCAA
-GCAATCCTATACAATCGTATCGGCGATATTGGCTTCATCCTGGCTCTAGCATGATTCCTC
-CTACACTCCAACTCATGGGAACTACAACAAGTATTCCTCCTAAACAATAACCCTAACCTC
-CTCCCACTACTAGGACTCCTCCTAGCCGCAGCTGGCAAATCAGCCCAACTAGGCCTTCAC
-CCCTGACTACCCTCAGCCATAGAAGGCCCAACCCCCGTCTCAGCCCTACTTCACTCAAGC
-ACCATGGTCGTGGCTGGGGTCTTCCTACTCATCCGCTTTCACCCATTAACAGAAAACAGC
-CCACATATCCAAACCCTTACACTATGCTTAGGGGCCATCACCACCCTGTTCGCAGCAATC
-TGCGCCCTCACACAAAACGACATTAAGAAAATCGTAGCTTTCTCCACCTCAAGTCAACTA
-GGACTTATAATGGTCACAATTGGCATTAACCAGCCACACCTGGCACTCCTCCACATCTGC
-ACCCACGCCTTCTTCAAAGCCCTTTTATTCATATGTTCTGGGTCCATCATCCACAACCTC
-AACAATGAGCAAGACATCCGAAAAATAGGAGGACTACTCAAAACCATACCCCTAACCTCA
-ACCTCCCTCACTATCAGCAGCCTAGCCCTCGCAGGAATACCCTTCCTCTCAGGCTTCTAC
-TCCAAAGACCTCATTATCGAGACCGCAAACATATCCTATACCAACACCTGAGCCCTGTCT
-ATCACTCTCATCGCCACCTCCTTAACAGGCGCCTACAGCACTCGAATAATCCTCCACACC
-CTTACAAGCAAACCCCACTTCCCAACCCCAATCTCTATCAATGAAAACAACCCCACTCTA
-CTTAAACCCATCAAGCGCCTTATGCTAGGAAGCCTATTCGCAGGATTCCTAATCACCAAC
-AACATCCCCCCTATATCCCTGCCCCAAGTAACAACCCCCCCTTACCTAAAACTCGCAGCT
-CTAGCTGCCACCCTCCTAGGTCTCCTAGTAGCCCTAGACTTAAACTACCTAGCCAACAAA
-CTCAAGACAAAAACCCCTCCACCCACATTCTATTTCTCCATCATACTCGGATTCTACCCT
-AGCATCATCCACCGCATAATCCCCCACCTAAGCCTTCTCATAAGCCAAAACTTATCCCTA
-CTCCTACTAGACCTAACCTGACTAAAAAAACTAATACCCAAAACAATCTCACAACACCAA
-ACCTCAGCCTCCATCACTATTTCAACCCAAAAAGGTTTAATCAAACTCTACTTCCTCTCT
-TTCCTCATCCCACTCCTCCTAATCCTCCTTATAATCTCATAACCTATTACCCCGAGCAAT
-CTCAATTACAACATAAACACCAACAAATAACGTTCAACCAGTAACCACCACCAACCAACG
-CCCATAATCATATAAAGCCCCCGCACCAATAGGATCCTCCCGAATCAACCCCGACCCTTC
-CCCTTCATAAATTATCCAGCTCCCCACGCTATTAAAATTCACCACTACCACCACTCCATC
-ATACTCTTTTACCCACAACACCAGCCCCACTTCCATCACTAATCCCACCAGAACACTCAC
-CAATACCTCAACCCCTGACCCCCATGCCTCAGGATATTCCTCAATAGCTATTGCCGTAGT
-ATACCCAAAAACAACCATCATACCCCCTAAATAAATTAAAAAAACCATTAAACCCATATA
-ACCTCCCCCACAATTTAAAATAACTGCACACCCAACCGCACCACTAATAATCAACACTAA
-ACCCCCATAAATAGGAGAGGGCTTAGAAGAAAACCCCACGAACCCTATCACTAAAATTAC
-ACTCAACAGAAACAAAGCATATGTCATTGTTCTCGCATAGACTGTGACTATGACCAATGG
-TATGAAAAAACATCGTTGTACCTCAACTACAAGAACACTAATGACCTCAACACGTAAAAC
-CAACCCACTAATAAAATTAATCAACCACTCACTTATCGACCTCCCCACCCCATCAAACAT
-CTCCGCATGATGGAACTTCGGCTCACTCCTAGGCGCCTGCTTAATCATCCAAATCACCAC
-TGGACTATTCCTAGCTATACATTATTCACCAGACGCCTCCACTGCCTTTTCATCAATCGC
-CCACATCACTCGAGATGTAAACTACGGCTGAATAATTCGCCACCTCCACGCTAACGGCGC
-CTCAATATTCTTTATCTGCCTCTTCTTACATATCGGCCGAGGCCTATACTATGGCTCATT
-CACCCACCTAGAAACCTGAAACATCGGCATCATCCTACTATTTACAACTATAATAACAGC
-CTTCATAGGTTACGTCCTCCCATGAGGCCAAATATCCTTCTGAGGAGCCACAGTAATCAC
-AAATCTACTGTCCGCCATCCCATACATTGGAACAGACCTGGTCCAATGAGTCTGAGGTGG
-CTACTCAGTAAATAGCCCCACTCTAACACGATTCTTCACCCTACACTTCATACTACCCTT
-CATTATTACAGCCCTAACAACTCTACACCTCTTATTCCTACACGAAACAGGATCAAATAA
-CCCCCTGGGAATCCCCTCCCATTCCGACAAAATCACCTTCCACCCCTACTACACAATCAA
-AGACATCCTAGGCCTACTCCTTTTTCTCCTCGCCCTAATAACACTAACACTACTCTCACC
-AGACCTCCTAAGCGACCCAGACAACTACACCTTAGCTAACCCCCTAAGCACCCCACCCCA
-CATTAAACCCGAATGATATTTCCTATTCGCCTACGCAATCCTACGATCCGTCCCCAACAA
-ACTAGGAGGTGTAATAGCCCTCATACTATCCATCCTAATCCTAACAACAATCCCTGCCCT
-TCACATGTCCAAGCAACAGAGCATAACATTTCGCCCATTGAGCCAATTCCTATATTGACT
-TTTAATCGCCGACCTTCTAATTCTCACCTGAATTGGAGGGCAACCAGTAAGCTACCCCTT
-CATCACCATTAGCCAAGTAGCATCCACATTGTACTTCACTACTATCCTTCTACTTATACC
-AGCCTCTTCCCTGATCGAAAACCACATACTCAAATGAACCTGCCCCTGTAGTACAAATAA
-GTACACCAGCCTTGTAACCTGAAAATGAAGACCCTCTTCCATGGGCAAAAAAAATCAGAG
-AAAAAGCACTTAACTTCACCGTCAGCCCCCAAAGCCAACATTCTAATTTTAAACTACTCT
-CTGTTCTTTCATGGGGGACCAGATTTGGGTGCCACCCCAGTACTGACCCATTTCTAACGG
-CCTATGTATTTCGTACATTCCTGCTAGCCAACATGAATATCACCCAACACAACAATCGCT
-TAACCAACTATAATGCATACAAAACTCCAACCACACTCGACCTCCACACCCCGCTTACAA
-GCAAGTACCCCCCCATGCCCCCCCACCCAAACACATACACCGATCTCTCCACATAACCCC
-TCAACCCCCAGCATATCAACAGACCAAACAAACCTTAAAGTACATAGCACATACTATCCT
-AACCGCACATAGCACATCCCGTTAAAACCCTGCTCATCCCCACGGATGCCCCCCCTCAGT
-TAGTAATCCCTTACTCACCATCCTCCGTGAAATCAATATCCCGCACAAGAGTGCTACTCC
-CCTCGCTCCGGGCCCATAAAACCTGGGGGTAGCTAAAGTGAGCTGTATCCGGCATCTGGT
-TCTTACTTCAGGGCCATAAAACCCAAGATCGCCCACACGTTCCCCTTAAATAAGACATCA
-CGATGGATCACAGGCCTATCACCCTATTAATCACTCACGGGAGCTCTCCATGCATCTGGT
-ATTTTTTCGGGGGGGGATGCACGCGATAGCATCGCGGGCCGCTGGAACCGGAGCACCCTA
-TGTCGCAGGATCTGTCTTTGATTCCTACCTCATGCCATTATTAATCGCGCCTAATATCCA
-ATATCCTAGCCCCACCCTCAGTGTTTGAAGCTGCTATTTAATTTATGCTAGAGGACATAA
-AATTACCAAAAAAAAATAAACGAACTCTCAACAACCCTACCCCATCAACCCAACAAAATC
-CAATTTTTATCTTTAGGCTATGTGCACTTTCAACAGGCACCCCTCAACTAACACAATCTC
-CTTCTTATCCCACCCACCAACCCCCCCCCCCCCTTCCTCCCTCTTTCTCCATTTTCCCCA
-CAAACACCGCTACTACCCCCACACCCCAGACCAACCCAACCCAAAAGACACCCCGCACG

test/q2.fa

@@ -1,2 +0,0 @@
->q2
-GGACATCCCGATGGTGCAGTCCTACCTGTACGAAAGGAC

test/t2.fa

@@ -1,2 +0,0 @@
->t2
-GGACATCCCGATGGTGCAGgtGCTATTAAAGGTTCGTTTGTTCAACGATTAAagTCCTACCTGTACGAAAGGAC

tex/Makefile

@@ -1,21 +0,0 @@
-.SUFFIXES: .gp .tex .eps .pdf .eps.gz
-
-.eps.pdf:
-		epstopdf --outfile $@ $<
-
-.eps.gz.pdf:
-		gzip -dc $< | epstopdf --filter > $@
-
-.pdf.eps:
-		pdftops -eps $< $@
-
-all:minimap2.pdf
-
-roc-color.eps:roc.gp
-		gnuplot roc.gp
-
-minimap2.pdf:minimap2.tex minimap2.bib roc-color.pdf
-		pdflatex minimap2; bibtex minimap2; pdflatex minimap2; pdflatex minimap2;
-
-clean:
-		rm -fr *.toc *.aux *.bbl *.blg *.idx *.log *.out *~ minimap2.pdf

tex/bioinfo.cls

@@ -1,930 +0,0 @@
-\newcommand\classname{bioinfo}
-\newcommand\lastmodifieddate{2003/02/08}
-\newcommand\versionnumber{0.1}
-
-% Are we printing crop marks?
-\newif\if@cropmarkson \@cropmarksontrue
-
-\NeedsTeXFormat{LaTeX2e}[2001/06/01]
-\ProvidesClass{\classname}[\lastmodifieddate\space\versionnumber]
-
-\setlength{\paperheight}{11truein}
-\setlength{\paperwidth}{8.5truein}
-
-\newif\if@final
-
-\DeclareOption{draft}{\PassOptionsToPackage{draft}{graphicx}}
-\DeclareOption{a4paper}{\PassOptionsToPackage{a4}{crop}}
-\DeclareOption{centre}{\PassOptionsToPackage{center}{crop}}
-\DeclareOption{crop}{\PassOptionsToPackage{cam}{crop}\global\@cropmarksontrue}
-\DeclareOption{nocrop}{\PassOptionsToPackage{off}{crop}\global\@cropmarksonfalse}
-\DeclareOption{info}{\PassOptionsToPackage{info}{crop}}
-\DeclareOption{noinfo}{\PassOptionsToPackage{noinfo}{crop}}
-\DeclareOption{final}{\global\@finaltrue}
-
-\ExecuteOptions{a4paper,nocrop,centre,info}
-
-\ProcessOptions
-
-% Load all necessary packages
-\RequirePackage{inputenc,crop,graphicx,amsmath,array,color,amssymb,flushend,stfloats,amsthm,chngpage,times}
-%\RequirePackage[LY1]{fontenc}
-%\RequirePackage[LY1,mtbold]{mathtime}
-\def\authoraffliate{\fontfamily{phv}\selectfont}
-\def\helvetica{\fontfamily{phv}\selectfont}
-\def\helveticaitalic{\fontfamily{phv}\itshape\selectfont}
-\def\helveticabold{\fontfamily{phv}\bfseries\selectfont}
-\def\helveticabolditalic{\fontfamily{phv}\bfseries\itshape\selectfont}
-
-% Not sure if needed.
-\newcommand\@ptsize{0}
-
-% Set twoside printing
-\@twosidetrue
-
-% Marginal notes are on the outside edge
-\@mparswitchfalse
-
-\reversemarginpar
-
-\renewcommand\normalsize{%
-   \@setfontsize\normalsize{9}{11}%
-   \abovedisplayskip 10\p@ \@plus2\p@ \@minus5\p@
-   \abovedisplayshortskip \z@ \@plus3\p@
-   \belowdisplayshortskip 6\p@ \@plus3\p@ \@minus3\p@
-   \belowdisplayskip \abovedisplayskip
-   \let\@listi\@listI}
-\normalsize
-\let\@bls\baselineskip
-
-\newcommand\small{%
-    \@setfontsize\small{9}{11}%
-    \abovedisplayskip 11\p@ minus 3\p@
-    \belowdisplayskip \abovedisplayskip
-    \abovedisplayshortskip \z@ plus 2\p@
-    \belowdisplayshortskip 4\p@ plus 2\p@ minus2\p@
-    \def\@listi{\topsep 4.5\p@ plus 2\p@ minus 1\p@
-       \itemsep \parsep
-       \topsep 4\p@ plus 2\p@ minus 2\p@}}
-
-\newcommand\footnotesize{%
-    \@setfontsize\footnotesize{8}{10}%
-    \abovedisplayskip 6\p@ minus 3\p@
-    \belowdisplayskip\abovedisplayskip
-    \abovedisplayshortskip \z@ plus 3\p@
-    \belowdisplayshortskip 6\p@ plus 3\p@ minus 3\p@
-    \def\@listi{\topsep 3\p@ plus 1\p@ minus 1\p@
-       \parsep 2\p@ plus 1\p@ minus 1\p@\itemsep \parsep}}
-
-\def\scriptsize{\@setfontsize\scriptsize{7pt}{9pt}}
-\def\tiny{\@setfontsize\tiny{5pt}{7pt}}
-\def\large{\@setfontsize\large{11.5pt}{12pt}}
-\def\Large{\@setfontsize\Large{14pt}{16}}
-\def\LARGE{\@setfontsize\LARGE{15pt}{17pt}}
-\def\huge{\@setfontsize\huge{22pt}{22pt}}
-\def\Huge{\@setfontsize\Huge{30pt}{30pt}}
-
-\DeclareOldFontCommand{\rm}{\normalfont\rmfamily}{\mathrm}
-\DeclareOldFontCommand{\sf}{\normalfont\sffamily}{\mathsf}
-\DeclareOldFontCommand{\tt}{\normalfont\ttfamily}{\mathtt}
-\DeclareOldFontCommand{\bf}{\normalfont\bfseries}{\mathbf}
-\DeclareOldFontCommand{\it}{\normalfont\itshape}{\mathit}
-\DeclareOldFontCommand{\sl}{\normalfont\slshape}{\@nomath\sl}
-\DeclareOldFontCommand{\sc}{\normalfont\scshape}{\@nomath\sc}
-
-% Line spacing
-\setlength\lineskip{1\p@}
-\setlength\normallineskip{1\p@}
-\renewcommand\baselinestretch{}
-
-% Paragraph dimensions and inter-para spacing
-\setlength\parskip{0\p@}
-\setlength\parindent{3mm}
-
-% Set inter-para skips
-\setlength\smallskipamount{3\p@ \@plus 1\p@ \@minus 1\p@}
-\setlength\medskipamount{6\p@ \@plus 2\p@}
-\setlength\bigskipamount{12\p@ \@plus 4\p@ \@minus 4\p@}
-
-% Page break penalties
-\@lowpenalty   51
-\@medpenalty  151
-\@highpenalty 301
-
-% Disallow widows and orphans
-\clubpenalty 10000
-\widowpenalty 10000
-
-% Disable page breaks before equations, allow pagebreaks after
-% equations and discourage widow lines before equations.
-\displaywidowpenalty 100
-\predisplaypenalty   10000
-\postdisplaypenalty  2500
-
-% Allow breaking the page in the middle of a paragraph
-\interlinepenalty 0
-
-% Disallow breaking the page after a hyphenated line
-\brokenpenalty 10000
-
-% Hyphenation; don't split words into less than three characters
-\lefthyphenmin=3
-\righthyphenmin=3
-
-%
-% Set page layout dimensions
-%
-\setlength\headheight{16\p@}        % height of running head
-\setlength\topmargin{2.9pc}         % head margin
-\addtolength\topmargin{-1in}        % subtract out the 1 inch driver margin
-
-\setlength\topskip{10\p@}           % height of first line of text
-\setlength\headsep{19\p@}        %   space below running head --
-
-\setlength\footskip{34\p@}          % space above footer line
-\setlength\maxdepth{.5\topskip}     % pages can be short or deep by half a line?
-
-\setlength\textwidth{42pc}          % text measure excluding margins
-
-\setlength\textheight{58\baselineskip} % 54 lines on a full page,
-\addtolength\textheight{\topskip}      %   including the first
-                                       %   line on the page
-
-% Set the margins
-\setlength\marginparsep{3\p@}
-\setlength\marginparpush{3\p@}
-\setlength\marginparwidth{35\p@}
-
-\setlength\oddsidemargin{4.5pc}
-\addtolength\oddsidemargin{-1in}     % subtract out the 1 inch driver margin
-\setlength\@tempdima{\paperwidth}
-\addtolength\@tempdima{-\textwidth}
-\addtolength\@tempdima{-4.5pc}
-\setlength\evensidemargin{\@tempdima}
-\addtolength\evensidemargin{-1in}
-
-\setlength\columnsep{1.5pc}          % space between columns for double-column text
-\setlength\columnseprule{0\p@}       % width of rule between two columns
-
-% Footnotes
-\setlength\footnotesep{9\p@}      % space between footnotes
-% space between text and footnote
-\setlength{\skip\footins}{12\p@ \@plus 6\p@ \@minus 1\p@}
-
-% Float placement parameters
-
-% The total number of floats that can be allowed on a page.
-\setcounter{totalnumber}{10}
-% The maximum number of floats at the top and bottom of a page.
-\setcounter{topnumber}{5}
-\setcounter{bottomnumber}{5}
-% The maximum part of the top or bottom of a text page that can be
-% occupied by floats. This is set so that at least four lines of text
-% fit on the page.
-\renewcommand\topfraction{.9}
-\renewcommand\bottomfraction{.9}
-% The minimum amount of a text page that must be occupied by text.
-% This should accomodate four lines of text.
-\renewcommand\textfraction{.06}
-% The minimum amount of a float page that must be occupied by floats.
-\renewcommand\floatpagefraction{.94}
-
-% The same parameters repeated for double column output
-\renewcommand\dbltopfraction{.9}
-\renewcommand\dblfloatpagefraction{.9}
-
-% Space between floats
-\setlength\floatsep    {12\p@ \@plus 2\p@ \@minus 2\p@}
-% Space between floats and text
-\setlength\textfloatsep{20\p@ \@plus 2\p@ \@minus 4\p@}
-% Space above and below an inline figure
-\setlength\intextsep   {18\p@ \@plus 2\p@ \@minus 2\p@}
-
-% For double column floats
-\setlength\dblfloatsep    {12\p@ \@plus 2\p@ \@minus 2\p@}
-\setlength\dbltextfloatsep{20\p@ \@plus 2\p@ \@minus 4\p@}
-
-% Space left at top, bottom and inbetween floats on a float page.
-\setlength\@fptop{0\p@}         % no space above float page figures
-\setlength\@fpsep{12\p@ \@plus 1fil}
-\setlength\@fpbot{0\p@}
-
-% The same for double column
-\setlength\@dblfptop{0\p@}
-\setlength\@dblfpsep{12\p@ \@plus 1fil}
-\setlength\@dblfpbot{0\p@}
-
-% Override settings in mathtime back to TeX defaults
-\DeclareMathSizes{5}     {5}   {5}  {5}
-\DeclareMathSizes{6}     {6}   {5}  {5}
-\DeclareMathSizes{7}     {7}   {5}  {5}
-\DeclareMathSizes{8}     {8}   {6}  {5}
-\DeclareMathSizes{9}     {9}   {6.5}  {5}
-\DeclareMathSizes{10}   {10}   {7.5}  {5}
-\DeclareMathSizes{12}   {12}   {9}  {7}
-
-% Page styles
-\def\ps@headings
-  {%
-  \def\@oddfoot{\vbox to 12.5\p@{\hbox{\rule{\textwidth}{0.5\p@}}\vss
-        \hbox to \textwidth{\hfill\helveticabold\small\thepage}%
-        }}%
-  \def\@evenfoot{\vbox to 12.5\p@{\rule{\textwidth}{0.5\p@}\vss
-        \hbox to \textwidth{\helveticabold\small\thepage\hfill}%
-        }}%
-  \def\@evenhead{\vbox{\hbox to \textwidth{\fontsize{8}{10}\selectfont
-        \helveticabold{\fontshape{it}\selectfont
-        \strut\leftmark}\hfill}\vspace{6.5\p@}\rule{\textwidth}{0.5\p@}}}%
-  \def\@oddhead{\vbox{\hbox to \textwidth{\hfill\fontsize{8}{10}\selectfont
-        \helveticabold{\fontshape{it}\selectfont\strut\rightmark}}%
-        \vspace{6.5\p@}\rule{\textwidth}{0.5\p@}}}%
-  \def\titlemark##1{\markboth{##1}{##1}}%
-  \def\authormark##1{\gdef\leftmark{##1}}%
-  }
-
-\def\ps@opening
-  {%
-  \def\@oddfoot{\vbox to 13\p@{\hbox{\rule{\textwidth}{1\p@}}\vss
-        \hbox to \textwidth{\helvetica
-        \fontsize{7}{9}\fontshape{n}\selectfont%
-          \hfill\small\helveticabold\thepage}%
-        }}%
-  \def\@evenfoot{\vbox to 13\p@{\rule{\textwidth}\vss
-        \hbox to \textwidth{\helvetica\thepage\hfill
-          \fontsize{7}{9}\fontshape{n}\selectfont}%
-        }}%
-  \let\@evenhead\relax
-  \let\@oddhead\relax}
-
-% Page range
-\newif\iflastpagegiven   \lastpagegivenfalse
-\newcommand\firstpage[1]{%
-  \gdef\@firstpage{#1}%
-  \ifnum\@firstpage>\c@page
-    \setcounter{page}{#1}%
-    \ClassWarning{BIO}{Increasing pagenumber to \@firstpage}%
-  \else \ifnum\@firstpage<\c@page
-    \ClassWarning{BIO}{Firstpage lower than pagenumber}\fi\fi
-    \xdef\@firstpage{\the\c@page}%
-    }
-\def\@firstpage{1}
-\def\pagenumbering#1{%
-    \global\c@page \@ne
-    \gdef\thepage{\csname @#1\endcsname \c@page}%
-    \gdef\thefirstpage{%
-            \csname @#1\endcsname \@firstpage}%
-    \gdef\thelastpage{%
-            \csname @#1\endcsname \@lastpage}%
-    }
-
-\newcommand\lastpage[1]{\xdef\@lastpage{#1}%
-  \global\lastpagegiventrue}
-\def\@lastpage{0}
-\def\setlastpage{\iflastpagegiven\else
-    \edef\@tempa{@lastpage@}%
-    \expandafter
-    \ifx \csname \@tempa \endcsname \relax
-        \gdef\@lastpage{0}%
-    \else
-        \xdef\@lastpage{\@nameuse{@lastpage@}}%
-        \fi
-    \fi }
-\def\writelastpage{%
-    \iflastpagegiven \else
-    \immediate\write\@auxout%
-    {\string\global\string\@namedef{@lastpage@}{\the\c@page}}%
-    \fi
-    }
-\def\thepagerange{%
-  \ifnum\@lastpage =0 {\ \bf ???} \else
-  \ifnum\@lastpage = \@firstpage \ \thefirstpage\else
-  \thefirstpage--\thelastpage \fi\fi}
-
-\AtBeginDocument{\setlastpage
-     \pagenumbering{arabic}%
-   }
-\AtEndDocument{%
-    \writelastpage
-    \if@final
-    \clearemptydoublepage
-    \else
-    \clearpage
-    \fi}
-
-%
-% Sectional units
-%
-
-% Counters
-\newcounter{section}
-\newcounter{subsection}[section]
-\newcounter{subsubsection}[subsection]
-\newcounter{paragraph}[subsubsection]
-\newcounter{subparagraph}[paragraph]
-\newcounter{figure}
-\newcounter{table}
-
-% Form of the numbers
-\newcommand\thepage{\arabic{page}}
-\renewcommand\thesection{\arabic{section}}
-\renewcommand\thesubsection{{\thesection.\arabic{subsection}}}
-\renewcommand\thesubsubsection{{\thesubsection.\arabic{subsubsection}}}
-\renewcommand\theparagraph{\thesubsubsection.\arabic{paragraph}}
-\renewcommand\thesubparagraph{\theparagraph.\arabic{subparagraph}}
-\renewcommand\theequation{\arabic{equation}}
-
-% Form of the words
-\newcommand\contentsname{Contents}
-\newcommand\listfigurename{List of Figures}
-\newcommand\listtablename{List of Tables}
-\newcommand\partname{Part}
-\newcommand\appendixname{Appendix}
-\newcommand\abstractname{Abstract}
-\newcommand\refname{References}
-\newcommand\bibname{References}
-\newcommand\indexname{Index}
-\newcommand\figurename{Fig.}
-\newcommand\tablename{Table}
-
-% Clearemptydoublepage should really clear the running heads too
-\newcommand{\clearemptydoublepage}{\newpage{\pagestyle{empty}\cleardoublepage}}
-
-% Frontmatter, mainmatter and backmatter
-
-\newif\if@mainmatter \@mainmattertrue
-
-\newcommand\frontmatter{%
-  \clearpage
-  \@mainmatterfalse
-  \pagenumbering{roman}}
-
-\newcommand\mainmatter{%
-  \clearpage
-  \@mainmattertrue
-  \pagenumbering{arabic}}
-
-\newcommand\backmatter{%
-  \clearpage
-  \@mainmatterfalse}
-
-%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% TITLE %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%
-\newlength{\dropfromtop}
-\setlength{\dropfromtop}{\z@}
-
-% Application Notes
-\newif\if@appnotes
-\newcommand{\application}{%
-%  \setlength{\dropfromtop}{-2.25pc}%
-  \global\@appnotestrue}
-
-\long\def\title{\@ifnextchar[{\short@title}{\@@title}}
-\def\short@title[#1]{\titlemark{#1}\@@@title}
-\def\@@title#1{\authormark{#1}\@@@title{#1}}
-\long\def\@@@title#1{\gdef\@title{#1}}
-
-\long\def\author{\@ifnextchar[{\short@uthor}{\@uthor}}
-\def\short@uthor[#1]{\authormark{#1}\@@author}
-\def\@uthor#1{\authormark{#1}\@@author{#1}}
-\long\def\@@author#1{\gdef\@author{#1}}
-
-\def\vol#1{\global\def\@vol{#1}}
-\def\issue#1{\global\def\@issue{#1}}
-\def\address#1{\global\def\@issue{#1}}
-\def\history#1{\global\def\@history{#1}}
-\def\editor#1{\global\def\@editor{#1}}
-\def\pubyear#1{\global\def\@pubyear{#1}}
-\def\copyrightyear#1{\global\def\@copyrightyear{#1}}
-\def\address#1{\global\def\@address{#1}}
-\def\DOI#1{\global\def\@DOI{#1}}
-
-\definecolor{gray}{cmyk}{0, 0, 0, 0.15}
-\newlength{\extraspace}
-\setlength{\extraspace}{\z@}
-
-\newcommand\maketitle{\par
-  \begingroup
-    \renewcommand\thefootnote{\@fnsymbol\c@footnote}%
-    \def\@makefnmark{\rlap{\@textsuperscript{\normalfont\@thefnmark}}}%
-    \long\def\@makefntext##1{\parindent 3mm\noindent
-%      \@textsuperscript{\normalfont\@thefnmark}\raggedright##1}%
-      \@textsuperscript{\normalfont\@thefnmark}##1}%
-    \if@twocolumn
-      \ifnum \col@number=\@ne
-        \@maketitle
-      \else
-        \twocolumn[\@maketitle]%
-      \fi
-    \else
-      \newpage
-      \global\@topnum\z@   % Prevents figures from going at top of page.
-      \@maketitle
-    \fi
-    \thispagestyle{opening}\@thanks
-  \endgroup
-  \setcounter{footnote}{0}%
-  \global\let\thanks\relax
-  \global\let\maketitle\relax
-  \global\let\@maketitle\relax
-  \global\let\@address\@empty
-  \global\let\@history\@empty
-  \global\let\@editor\@empty
-  \global\let\@thanks\@empty
-  \global\let\@author\@empty
-  \global\let\@date\@empty
-  \global\let\@title\@empty
-  \global\let\@pubyear\@empty
-  \global\let\address\relax
-  \global\let\history\relax
-  \global\let\editor\relax
-  \global\let\title\relax
-  \global\let\author\relax
-  \global\let\date\relax
-  \global\let\pubyear\relax
-  \global\let\@copyrightline\@empty
-  \global\let\and\relax
-  \@afterindentfalse\@afterheading
-}
-
-\newlength{\aboveskipchk}%for checking oddpage or evenpage top skip
-\setlength{\aboveskipchk}{\z@}%
-
-\def\@maketitle{%
-  \let\footnote\thanks
-  \clearemptydoublepage
-    \checkoddpage\ifcpoddpage\setlength{\aboveskipchk}{-3pc}\else\setlength{\aboveskipchk}{-5pc}\fi%for checking oddpage or evenpage top skip%%
-  \vspace*{\aboveskipchk}%
-  \vspace{\dropfromtop}%
-  \hbox to \textwidth{%
-  {\helvetica\itshape\bfseries\fontsize{19}{12}\selectfont {\color{gray}TECHNICAL REPORT}
-    \hfil
-    \if@appnotes APPLICATIONS NOTE\hfil\fi
-    }%
-\enskip  \parbox[b]{11.3pc}{%
-    \helvetica
-    \flushright\fontsize{8}{10}\fontshape{it}\selectfont
-        \hfill
-  }}
-  \rule{\textwidth}{1\p@}\par%
-  \helvetica
-  \hbox to \textwidth{%
-  \parbox[t]{41pc}{%
-    \vspace*{1sp}
-    {\helveticabold\fontsize{16}{21}\selectfont\raggedright \@title \par}%
-    \vspace{4.5\p@}
-    {\authoraffliate\fontsize{11}{13}\selectfont\raggedright \@author \par}%
-        \vspace{4\p@}
-    {\authoraffliate\fontsize{9}{11}\selectfont\raggedright \@address \par}%
-    \vspace{4\p@}
-    %{\helvetica\fontsize{8}{10}\selectfont\raggedright \@history \par}
-    %\vspace{24\p@}
-    %{\helvetica\fontsize{10}{12}\selectfont\raggedright \@editor \par}
-    %\vspace{20\p@}
-    }%
-  }
-  \vspace{4.5\p@}%
-  \rule{\textwidth}{1\p@}%
-  \vspace{12\p@ plus 6\p@ minus 6\p@}%
-  \vspace{\extraspace}
-  }
-%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%
-
-%%%%%%%%%%%%%%%%%%%%%%%%%%%% Abstract %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%
-\newcommand{\absection}[1]{%
-  \par\noindent{\bfseries #1}\space\ignorespaces}
-
-\newenvironment{abstract}{%
-  \begingroup
-  \let\section\absection
-  \fontfamily{\sfdefault}\fontsize{8}{11}\sffamily\selectfont
-  {\fontseries{b}\selectfont ABSTRACT}\par}
-{\endgroup\bigskip\@afterheading\@afterindentfalse\vskip 12pt plus 3pt minus 1pt}
-
-% Section macros
-
-% Lowest level heading that takes a number by default
-\setcounter{secnumdepth}{3}
-
-\renewcommand{\@seccntformat}[1]{\csname the#1\endcsname\quad}
-
-\def\section{%
-  \@startsection{section}{1}{\z@}
-  {-22\p@ plus -3\p@}{3\p@}
-  {\reset@font\raggedright\helveticabold\fontsize{10}{12}\selectfont\MakeUppercase}}
-
-\def\subsection{%
-  \@startsection{subsection}{2}{\z@}
-  {-11\p@ plus -2\p@}{3\p@}
-  {\reset@font\raggedright\mathversion{bold}\fontseries{b}\fontsize{10}{12}\selectfont}}
-
-\def\subsubsection{%
-  \@startsection{subsubsection}{3}{\z@}
-  %{-11\p@ plus -1\p@}{-1em}
-  {-11\p@ plus -1\p@}{0.001em}
-  {\reset@font\normalfont\normalsize\itshape}}
-
-\def\textcolon{\text{\rm :}}
-
- \def\paragraph{%
-   \@startsection{paragraph}{4}{\z@}
-   {-6\p@}
-   {-.4em}
-   {\reset@font\itshape}}
-
-% ********************
-% Figures and tables *
-% ********************
-
-% Table and array parameters
-\setlength\arraycolsep{.5em}
-\setlength\tabcolsep{.5em}
-\setlength\arrayrulewidth{.5pt}
-\setlength\doublerulesep{2.5pt}
-\setlength\extrarowheight{\z@}
-\renewcommand\arraystretch{1}
-
-\newlength{\abovecaptionskip}
-\newlength{\belowcaptionskip}
-\setlength{\abovecaptionskip}{13pt}
-\setlength{\belowcaptionskip}{10.5pt}
-
-\long\def\@makecaption#1#2{\vspace{\abovecaptionskip}%
-  \begingroup
-  \footnotesize
-  \textbf{#1.}\enskip{#2}\par
-  \endgroup}
-
-\long\def\@tablecaption#1#2{%
-  \begingroup
-  \footnotesize
-  \textbf{#1.}\enskip{#2\strut\par}
-  \endgroup\vspace{\belowcaptionskip}}
-
-% Table rules
-\def\toprule{\noalign{\ifnum0=`}\fi\hrule \@height 0.5pt \hrule \@height 6pt \@width 0pt \futurelet
-   \@tempa\@xhline}
-\def\midrule{\noalign{\ifnum0=`}\fi \hrule \@height 6.75pt \@width 0pt \hrule \@height 0.5pt
-    \hrule \@height 6pt \@width 0pt \futurelet \@tempa\@xhline}
-\def\botrule{\noalign{\ifnum0=`}\fi \hrule \@height 5.75pt \@width 0pt \hrule \@height 0.5pt \futurelet
-   \@tempa\@xhline}
-\def\hrulefill{\leavevmode\leaders\hrule height .5pt\hfill\kern\z@}
-
-\def\thefigure{\@arabic\c@figure}
-\def\fps@figure{tbp}
-\def\ftype@figure{1}
-\def\ext@figure{lof}
-\def\fnum@figure{\figurename~\thefigure}
-\def\figure{\@float{figure}}
-\let\endfigure\end@float
-\@namedef{figure*}{\@dblfloat{figure}}
-\@namedef{endfigure*}{\end@dblfloat}
-\def\thetable{\@arabic\c@table}
-\def\fps@table{tbp}
-\def\ftype@table{2}
-\def\ext@table{lot}
-\def\fnum@table{Table~\thetable}
-\def\table{\let\@makecaption\@tablecaption\let\source\tablesource\@float{table}}
-\def\endtable{\end@float}
-\@namedef{table*}{\let\@makecaption\@tablecaption\@dblfloat{table}}
-\@namedef{endtable*}{\end@dblfloat}
-
-\newif\if@rotate \@rotatefalse
-\newif\if@rotatecenter \@rotatecenterfalse
-\def\rotatecenter{\global\@rotatecentertrue}
-\def\rotateendcenter{\global\@rotatecenterfalse}
-\def\rotate{\global\@rotatetrue}
-\def\endrotate{\global\@rotatefalse}
-\newdimen\rotdimen
-\def\rotstart#1{\special{ps: gsave currentpoint currentpoint translate
-    #1 neg exch neg exch translate}}
-\def\rotfinish{\special{ps: currentpoint grestore moveto}}
-\def\rotl#1{\rotdimen=\ht#1\advance\rotdimen by \dp#1
-    \hbox to \rotdimen{\vbox to\wd#1{\vskip \wd#1
-    \rotstart{270 rotate}\box #1\vss}\hss}\rotfinish}
-\def\rotr#1{\rotdimen=\ht #1\advance\rotdimen by \dp#1
-    \hbox to \rotdimen{\vbox to \wd#1{\vskip \wd#1
-    \rotstart{90 rotate}\box #1\vss}\hss}\rotfinish}
-
-\newdimen\tempdime
-\newbox\temptbox
-
-% From ifmtarg.sty
-% Copyright Peter Wilson and Donald Arseneau, 2000
-\begingroup
-\catcode`\Q=3
-\long\gdef\@ifmtarg#1{\@xifmtarg#1QQ\@secondoftwo\@firstoftwo\@nil}
-\long\gdef\@xifmtarg#1#2Q#3#4#5\@nil{#4}
-\long\gdef\@ifnotmtarg#1{\@xifmtarg#1QQ\@firstofone\@gobble\@nil}
-\endgroup
-
-\def\tablesize{\@setfontsize\tablesize{8\p@}{10\p@}}
-
-\newenvironment{processtable}[3]{\setbox\temptbox=\hbox{{\tablesize #2}}%
-\tempdime\wd\temptbox\@processtable{#1}{#2}{#3}{\tempdime}}
-{\relax}
-
-\newcommand{\@processtable}[4]{%
-\if@rotate
-\setbox4=\vbox to \hsize{\vss\hbox to \textheight{%
-\begin{minipage}{#4}%
-\@ifmtarg{#1}{}{\caption{#1}}{\tablesize #2}%
-\vskip7\p@\noindent
-\parbox{#4}{\fontsize{7}{9}\selectfont #3\par}%
-\end{minipage}}\vss}%
-\rotr{4}
-\else
-\hbox to \hsize{\hss\begin{minipage}[t]{#4}%
-\vskip2.9pt
-\@ifmtarg{#1}{}{\caption{#1}}{\tablesize #2}%
-\vskip6\p@\noindent
-\parbox{#4}{\fontsize{7}{9}\selectfont #3\par}%
-\end{minipage}\hss}\fi}%
-
-\newcolumntype{P}[1]{>{\raggedright\let\\\@arraycr\hangindent1em}p{#1}}
-
-% ******************************
-% List numbering and lettering *
-% ******************************
-\def\labelenumi{{\rm\arabic{enumi}.}}
-\def\theenumi{\arabic{enumi}}
-\def\labelenumii{{\rm\alph{enumii}.}}
-\def\theenumii{\alph{enumii}}
-\def\p@enumii{\theenumi}
-\def\labelenumiii{{\rm(\arabic{enumiii})}}
-\def\theenumiii{\roman{enumiii}}
-\def\p@enumiii{\theenumi(\theenumii)}
-\def\labelenumiv{{\rm(\arabic{enumiv})}}
-\def\theenumiv{\Alph{enumiv}}
-\def\p@enumiv{\p@enumiii\theenumiii}
-\def\labelitemi{{\small$\bullet$}}
-\def\labelitemii{{\small$\bullet$}}
-\def\labelitemiii{{\small$\bullet$}}
-\def\labelitemiv{{\small$\bullet$}}
-
-\def\@listI{\leftmargin\leftmargini \topsep\medskipamount}
-\let\@listi\@listI
-\@listi
-\def\@listii{\topsep\z@\leftmargin\leftmarginii}
-\def\@listiii{\leftmargin\leftmarginiii \topsep\z@}
-\def\@listiv{\leftmargin\leftmarginiv \topsep\z@}
-\def\@listv{\leftmargin\leftmarginv \topsep\z@}
-\def\@listvi{\leftmargin\leftmarginvi \topsep\z@}
-
-\setlength{\leftmargini}{3mm}
-\setlength{\leftmarginii}{\z@}
-\setlength{\leftmarginiii}{\z@}
-\setlength{\leftmarginiv}{\z@}
-
-% Changes to the list parameters for enumerate
-\def\enumargs{%
-   \partopsep     \z@
-   \itemsep       3\p@
-   \parsep        \z@
-   \labelsep      0.5em
-   \listparindent \parindent
-   \itemindent    \z@
-   \topsep 11\p@
-}
-
-\def\enumerate{%
-    \@ifnextchar[{\@numerate}{\@numerate[0]}}
-
-\def\@numerate[#1]{%
-     \ifnum \@enumdepth >3 \@toodeep\else
-     \advance\@enumdepth \@ne
-     \edef\@enumctr{enum\romannumeral\the\@enumdepth}
-     \list{\csname label\@enumctr\endcsname}{%
-       \enumargs
-       \setlength{\leftmargin}{\csname leftmargin\romannumeral\the\@enumdepth\endcsname}
-       \usecounter{\@enumctr}
-       \settowidth\labelwidth{#1}
-       \addtolength{\leftmargin}{\labelwidth}
-       \addtolength{\leftmargin}{\labelsep}
-       \def\makelabel##1{\hss \llap{##1}}}%
-     \fi
-   }
-\let\endenumerate\endlist
-
-% Changes to the list parameters for itemize
-\def\itemargs{%
-   \partopsep     \z@
-   \itemsep       3\p@
-   \parsep        \z@
-   \labelsep      0.5em
-   \rightmargin   \z@
-   \listparindent \parindent
-   \itemindent    \z@
-   \topsep11\p@
-}
-
-\def\itemize{%
-    \@ifnextchar[{\@itemize}{\@itemize[$\bullet$]}}
-
-\def\@itemize[#1]{%
-     \ifnum \@itemdepth >3 \@toodeep\else
-     \advance\@itemdepth \@ne
-     \edef\@itemctr{item\romannumeral\the\@itemdepth}
-     \list{\csname label\@itemctr\endcsname}{%
-       \itemargs
-       \setlength{\leftmargin}{\csname leftmargin\romannumeral\the\@itemdepth\endcsname}
-       \settowidth\labelwidth{#1}
-       \addtolength{\leftmargin}{\labelwidth}
-       \addtolength{\leftmargin}{\labelsep}
-       \def\makelabel##1{\hss \llap{##1}}}%
-     \fi
-   }
-\let\enditemize\endlist
-
-\newenvironment{unlist}{%
-  \begin{list}{}%
-    {\setlength{\labelwidth}{\z@}%
-     \setlength{\labelsep}{\z@}%
-     \setlength{\topsep}{\medskipamount}%
-     \setlength{\itemsep}{3\p@}%
-     \setlength{\leftmargin}{2em}%
-     \setlength{\itemindent}{-2em}}}
-{\end{list}}
-
-
-% ***********************
-% Quotes and Quotations *
-% ***********************
-\def\quotation{\par\begin{list}{}{
-      \setlength{\topsep}{\medskipamount}
-      \setlength{\leftmargin}{2em}%
-      \setlength{\rightmargin}{\z@}%
-      \setlength\labelwidth{0pt}%
-      \setlength\labelsep{0pt}%
-      \listparindent\parindent}%
-  \item[]}
-\def\endquotation{\end{list}}
-\let\quote\quotation
-\let\endquote\endquotation
-
-\skip\@mpfootins = \skip\footins
-\fboxsep=6\p@
-\fboxrule=1\p@
-
-% *******************
-% Table of contents *
-% *******************
-\newcommand\@pnumwidth{4em}
-\newcommand\@tocrmarg{2.55em plus 1fil}
-\newcommand\@dotsep{1000}
-\setcounter{tocdepth}{4}
-
-\def\numberline#1{\hbox to \@tempdima{{#1}}}
-
-\def\@authortocline#1#2#3#4#5{%
-  \vskip 1.5\p@
-  \ifnum #1>\c@tocdepth \else
-    {\leftskip #2\relax \rightskip \@tocrmarg \parfillskip -\rightskip
-     \parindent #2\relax\@afterindenttrue
-     \interlinepenalty\@M
-     \leavevmode
-     \@tempdima #3\relax
-     \advance\leftskip \@tempdima \null\nobreak\hskip -\leftskip
-     {\itshape #4}\nobreak
-     \leaders\hbox{$\m@th
-        \mkern \@dotsep mu\hbox{.}\mkern \@dotsep
-        mu$}\hfill
-     \nobreak
-     \hb@xt@\@pnumwidth{\hfil}%
-     \par}%
-  \fi}
-
-\newcommand*\l@author{\@authortocline{2}{0pt}{30pt}}
-\newcommand*\l@section{\@dottedtocline{3}{11pt}{20pt}}
-\newcommand*\l@subsection{\@dottedtocline{4}{31pt}{29pt}}
-\newcommand*\l@subsubsection[2]{}
-
-
-
-% ***********
-% Footnotes *
-% ***********
-
-\def\footnoterule{\noindent\rule{\columnwidth}{0.5pt}}
-\def\@makefnmark{\@textsuperscript{\normalfont\@thefnmark}}%
-\newcommand\@makefntext[1]{\noindent{\@makefnmark}\enskip#1}
-
-% ***********
-% References *
-% ***********
-
-\providecommand{\newblock}{}
-\newenvironment{thebibliography}{%
-  \section{\bibname}%
-  \begingroup
-  \small
-  \begin{list}{}{%
-      \setlength{\topsep}{\z@}%
-      \setlength{\labelsep}{\z@}%
-      \settowidth{\labelwidth}{\z@}%
-      \setlength{\leftmargin}{4mm}%
-      \setlength{\itemindent}{-4mm}}\small}
-{\end{list}\endgroup}
-
-\RequirePackage{natbib}
-
-% **********
-% Appendix *
-% **********
-\newif\ifappend % Are we in the Appendix?
-\def\appendix{\par
-        \setcounter{section}{0}
-        \setcounter{subsection}{0}
-        \appendtrue
-}
-
-%Math parameters
-
-\setlength{\jot}{5\p@}
-\mathchardef\@m=1500   % adapted value
-
-\def\frenchspacing{\sfcode`\.\@m \sfcode`\?\@m \sfcode`\!\@m
-  \sfcode`\:\@m \sfcode`\;\@m \sfcode`\,\@m}
-
-% Theorems
-\def\th@plain{%
-%%  \let\thm@indent\noindent % no indent
-\thm@headfont{\quad\scshape}% heading font is bold
-\thm@notefont{\upshape\mdseries}% same as heading font
-\thm@headpunct{.}% no period after heading
-\thm@headsep 5\p@ plus\p@ minus\p@\relax
-%%  \let\thm@swap\@gobble
-%%  \thm@preskip\topsep
-%%  \thm@postskip\theorempreskipamount
-\itshape % body font
-}
-
-\vbadness=9999
-\tolerance=9999
-\doublehyphendemerits=10000
-\doublehyphendemerits 640000   % corresponds to badness 800
-\finalhyphendemerits  1000000  % corresponds to badness 1000
-
-\flushbottom
-\frenchspacing
-\ps@headings
-\twocolumn
-
-% Screen PDF compatability
-\newcommand{\medline}[1]{%
-  \unskip\unskip\ignorespaces}
-
-
-%%%%for smaller size text
-\newenvironment{methods}{%
-  \begingroup
-\def\section{%
-  \@startsection{section}{1}{\z@}
-  {-24\p@ plus -3\p@}{4\p@}
-  {\reset@font\raggedright\helveticabold\fontsize{10}{12}\selectfont\MakeUppercase}}
- \def\subsection{%
-  \@startsection{subsection}{2}{\z@}
-  {-5\p@ plus -2\p@}{4\p@}
-  {\reset@font\raggedright\mathversion{bold}\fontseries{b}\fontsize{10}{12}\selectfont}}
- \def\subsubsection{%
-  \@startsection{subsubsection}{3}{\z@}
-%  {-6\p@ plus -1\p@}{-1em}
-  {-6\p@ plus -1\p@}{0.001em}
-  {\reset@font\normalfont\normalsize\itshape}}
-\footnotesize
-  \par}
-{\par\endgroup\bigskip\@afterheading\@afterindentfalse}
-
-
-
-\graphicspath{{g:/artwork/oup/bioinfo/}}
-
-\language=2
-
-\hyphenation{Figure Table Figures Tables}
-
-\newcommand{\href}[2]{#2}
-
-\renewenvironment{proof}[1][\proofname]{\par
-  \normalfont \topsep6\p@\@plus6\p@\relax
-  \labelsep 0.5em
-  \trivlist
-  \item[\hskip\labelsep\hskip1em\textsc{#1}.]\ignorespaces
-}{\endtrivlist\@endpefalse}
-
-%%Different Bonds
-
-\def\sbond{\ensuremath{\raise.25ex\hbox{${-}\!\!\!\!{-}$}}\kern -.9pt}
-\def\dbond{\ensuremath{\raise.25ex\hbox{=$\!$=}}}
-\def\tbond{\ensuremath{\raise.20ex\hbox{${\equiv}\!\!\!{\equiv}$}}}
-
-% Author queries
-%\fboxsep=4\p@
-%\fboxrule=0.5\p@
-\newcommand{\query}[2][0pt]{}%
-%  \marginpar{\vspace*{#1}%
-%    {\parbox{\marginparwidth}{%
-%     \raggedright\fontsize{6}{8}\selectfont
-%         #2}}}}
-
-\renewcommand{\dag}{{\mathversion{normal}$^{\dagger}$}}
-
-\endinput

tex/blasr-mc.eval

@@ -1,17 +0,0 @@
-Q	60	32681	57	0.001744133
-Q	39	3	1	0.001774569
-Q	38	3	1	0.001804999
-Q	35	5	1	0.001835311
-Q	34	31	2	0.001894692
-Q	20	11	2	0.001955154
-Q	19	4	1	0.001985460
-Q	15	29	5	0.002136296
-Q	14	6	1	0.002166417
-Q	10	11	1	0.002196193
-Q	6	11	2	0.002256442
-Q	5	1	1	0.002286864
-Q	4	1	1	0.002317285
-Q	3	36	15	0.002771602
-Q	2	5	2	0.002832085
-Q	1	12	9	0.003105023
-Q	0	220	83	0.005594194

tex/bwa.eval

@@ -1,55 +0,0 @@
-Q	60	31721	27	0.000851171
-Q	59	54	4	0.000975610
-Q	58	29	5	0.001131933
-Q	57	21	2	0.001194030
-Q	56	14	4	0.001319137
-Q	55	22	6	0.001506544
-Q	54	12	4	0.001631475
-Q	53	16	3	0.001724733
-Q	51	10	1	0.001755541
-Q	50	10	1	0.001786330
-Q	49	11	3	0.001879699
-Q	47	8	2	0.001941869
-Q	46	17	1	0.001972140
-Q	44	8	3	0.002065534
-Q	43	10	1	0.002096174
-Q	42	13	1	0.002126595
-Q	41	14	3	0.002219444
-Q	40	13	2	0.002281036
-Q	38	17	4	0.002404747
-Q	37	15	4	0.002528484
-Q	36	12	1	0.002558742
-Q	35	19	3	0.002650783
-Q	34	12	3	0.002743313
-Q	33	7	1	0.002773882
-Q	32	21	3	0.002865508
-Q	31	11	2	0.002926799
-Q	30	14	3	0.003018891
-Q	29	17	1	0.003048401
-Q	28	11	2	0.003109549
-Q	27	20	5	0.003262998
-Q	26	11	1	0.003292948
-Q	25	14	4	0.003415725
-Q	24	16	5	0.003569212
-Q	23	43	6	0.003750426
-Q	21	15	1	0.003779664
-Q	20	29	7	0.003992943
-Q	19	22	2	0.004052089
-Q	18	28	4	0.004172204
-Q	16	25	5	0.004323390
-Q	15	24	5	0.004474480
-Q	14	25	5	0.004625204
-Q	13	23	3	0.004714365
-Q	12	22	1	0.004741963
-Q	11	32	11	0.005075674
-Q	10	35	7	0.005285315
-Q	9	32	12	0.005648503
-Q	8	33	8	0.005888126
-Q	7	39	7	0.006095506
-Q	6	42	14	0.006515953
-Q	5	38	15	0.006966725
-Q	4	37	12	0.007325113
-Q	3	49	18	0.007862737
-Q	2	63	21	0.008486434
-Q	1	55	27	0.009292156
-Q	0	153	77	0.011576593

tex/eval2roc.pl

@@ -1,33 +0,0 @@
-#!/usr/bin/perl
-
-use strict;
-use warnings;
-use Getopt::Std;
-
-my %opts = (n=>33088, s=>100);
-getopts('n:', \%opts);
-
-my $pseudo = .5;
-my $tot = $pseudo;
-my $err = $pseudo;
-my $tot_last_out = -$opts{s};
-my $state = 0;
-my $mapq = 0;
-while (<>) {
-	chomp;
-	if (/^Q\t(\d+)\t(\d+)\t(\d+)/) {
-		$tot += $2;
-		$err += $3;
-		if ($tot - $tot_last_out >= $opts{s}) {
-			print join("\t", $1, $err/$tot, $tot / $opts{n}), "\n";
-			$tot_last_out = $tot;
-			$state = 0;
-		} else {
-			$state = 1;
-			$mapq = $1;
-		}
-	}
-}
-if ($state) {
-	print join("\t", $mapq, $err/$tot, $tot / $opts{n}), "\n";
-}

tex/graphmap.eval

@@ -1,4 +0,0 @@
-Q	40	31897	63	0.001975107
-Q	3	423	267	0.010210396
-Q	2	162	120	0.013853827
-Q	1	188	172	0.019038874

tex/hs38-simu.sh

@@ -1,4 +0,0 @@
-./pbsim --prefix pb-1 --depth 0.1 --sample-fastq m131017_060208_42213_c100579642550000001823095604021496_s1_p0.1.subreads.fastq --length-min 1000 --length-max 30000 --seed 11 hs38.fa
-
-bin/mason_variator -ir hs38.fa -s 1 -ov hs38-s1.vcf --snp-rate 1e-3 --small-indel-rate 2e-4 --sv-indel-rate 0 --sv-inversion-rate 0 --sv-translocation-rate 0 --sv-duplication-rate 0 --max-small-indel-size 10
-bin/mason_simulator -ir hs38.fa -iv hs38-s1.vcf -n 1000000 --seed 1 -o s1_1.fq -or s1_2.fq -oa s1.sam --illumina-prob-mismatch-scale 2.5

tex/minialign.eval

@@ -1,49 +0,0 @@
-Q	60	32070	190	0.005924540
-Q	59	62	2	0.005975352
-Q	58	37	5	0.006123908
-Q	57	40	7	0.006333633
-Q	56	39	6	0.006512032
-Q	55	32	2	0.006567534
-Q	54	54	2	0.006618420
-Q	53	33	4	0.006735255
-Q	52	39	2	0.006788866
-Q	51	48	3	0.006871264
-Q	50	34	2	0.006925634
-Q	49	32	3	0.007011070
-Q	48	35	2	0.007064967
-Q	47	36	4	0.007179896
-Q	46	23	1	0.007205495
-Q	45	25	1	0.007230614
-Q	44	17	3	0.007318716
-Q	43	17	2	0.007376121
-Q	42	31	5	0.007522016
-Q	41	25	4	0.007638486
-Q	40	26	4	0.007754541
-Q	39	35	2	0.007807258
-Q	37	18	4	0.007924896
-Q	36	13	3	0.008013162
-Q	35	15	2	0.008070411
-Q	34	20	3	0.008156805
-Q	33	11	1	0.008184501
-Q	32	15	3	0.008272003
-Q	31	25	1	0.008296107
-Q	29	8	1	0.008324472
-Q	28	7	2	0.008383452
-Q	27	9	2	0.008441894
-Q	26	30	2	0.008494888
-Q	23	2	1	0.008524710
-Q	22	11	3	0.008612846
-Q	20	23	3	0.008697760
-Q	19	6	1	0.008726479
-Q	18	8	1	0.008754658
-Q	16	6	1	0.008783354
-Q	13	2	1	0.008813108
-Q	12	4	2	0.008872604
-Q	11	7	2	0.008931275
-Q	10	4	3	0.009021009
-Q	9	6	4	0.009140436
-Q	8	6	3	0.009229559
-Q	7	5	1	0.009258419
-Q	6	8	3	0.009346925
-Q	4	8	5	0.009495872
-Q	3	17	8	0.009732801

tex/minimap2.bib

@@ -1,261 +0,0 @@
-@article{Chaisson:2012aa,
-	Author = {Chaisson, Mark J and Tesler, Glenn},
-	Journal = {BMC Bioinformatics},
-	Pages = {238},
-	Title = {{Mapping single molecule sequencing reads using basic local alignment with successive refinement (BLASR): application and theory}},
-	Volume = {13},
-	Year = {2012}}
-
-@article{Liu:2016ab,
-	Author = {Liu, Bo and others},
-	Journal = {Bioinformatics},
-	Pages = {1625-31},
-	Title = {{rHAT}: fast alignment of noisy long reads with regional hashing},
-	Volume = {32},
-	Year = {2016}}
-
-@article{Liu:2017aa,
-	Author = {Liu, Bo and others},
-	Journal = {Bioinformatics},
-	Pages = {192-201},
-	Title = {{LAMSA}: fast split read alignment with long approximate matches},
-	Volume = {33},
-	Year = {2017}}
-
-@article{Lin:2017aa,
-	Author = {Lin, Hsin-Nan and Hsu, Wen-Lian},
-	Journal = {Bioinformatics},
-	Title = {Kart: a divide-and-conquer algorithm for {NGS} read alignment},
-	Year = {2017}}
-
-@article{Li:2013aa,
-	Author = {Li, Heng},
-	Journal = {arXiv:1303.3997},
-	Title = {Aligning sequence reads, clone sequences and assembly contigs with {BWA-MEM}},
-	archivePrefix = "arXiv",
-	eprint = {1303.3997},
-	primaryClass = "q-bio",
-	Year = {2013}}
-
-@article{Sovic:2016aa,
-	Author = {Sovi{\'c}, Ivan and others},
-	Journal = {Nat Commun},
-	Pages = {11307},
-	Title = {Fast and sensitive mapping of nanopore sequencing reads with {GraphMap}},
-	Volume = {7},
-	Year = {2016}}
-
-@article{Langmead:2012fk,
-	Author = {Langmead, Ben and Salzberg, Steven L},
-	Journal = {Nat Methods},
-	Pages = {357-9},
-	Title = {Fast gapped-read alignment with {Bowtie} 2},
-	Volume = {9},
-	Year = {2012}}
-
-@article{Li:2016aa,
-	Author = {Li, Heng},
-	Journal = {Bioinformatics},
-	Pages = {2103-10},
-	Title = {Minimap and miniasm: fast mapping and de novo assembly for noisy long sequences},
-	Volume = {32},
-	Year = {2016}}
-
-@misc{Suzuki:2016,
-	title = {Fast and accurate alignment tool for PacBio and Nanopore long reads},
-	author = {Hajime Suzuki},
-	journal = {Unpublished},
-	howpublished = {\href{https://github.com/ocxtal/minialign}{https://github.com/ocxtal/minialign}},
-	year = {2016}}
-
-@misc{Ruan:2016,
-	title = {Ultra-fast de novo assembler using long noisy reads},
-	author = {Jue Ruan},
-	journal = {Unpulished},
-	howpublished = {\href{https://github.com/ruanjue/smartdenovo}{https://github.com/ruanjue/smartdenovo}},
-	year = {2016}}
-
-@article{Miller:1988aa,
-	Author = {Miller, W and Myers, E W},
-	Journal = {Bull Math Biol},
-	Number = {2},
-	Pages = {97-120},
-	Title = {Sequence comparison with concave weighting functions},
-	Volume = {50},
-	Year = {1988}}
-
-@article{Gotoh:1990aa,
-	Author = {Gotoh, O},
-	Journal = {Bull Math Biol},
-	Pages = {359-73},
-	Title = {Optimal sequence alignment allowing for long gaps},
-	Volume = {52},
-	Year = {1990}}
-
-@article{Wu:1996aa,
-	Author = {Wu, Sun and others},
-	Journal = {Algorithmica},
-	Pages = {50-67},
-	Title = {A subquadratic algorithm for approximate limited expression matching},
-	Volume = {15},
-	Year = {1996}}
-
-@article{Daily:2016aa,
-	Author = {Daily, Jeff},
-	Journal = {BMC Bioinformatics},
-	Month = {Feb},
-	Pages = {81},
-	Title = {Parasail: {SIMD C} library for global, semi-global, and local pairwise sequence alignments},
-	Volume = {17},
-	Year = {2016}}
-
-@article{Sedlazeck169557,
-	author = {Sedlazeck, Fritz J and others},
-	title = {Accurate detection of complex structural variations using single molecule sequencing},
-	note = {doi:10.1101/169557},
-	journal = {bioRxiv},
-	year = {2017}}
-
-@article{Altschul:1997vn,
-	Author = {Altschul, S F and others},
-	Journal = {Nucleic Acids Res},
-	Pages = {3389-402},
-	Title = {Gapped {BLAST} and {PSI-BLAST}: a new generation of protein database search programs},
-	Volume = {25},
-	Year = {1997}}
-
-@article{Sosic:2017aa,
-	Author = {{\v S}o{\v s}i\'{c}, Martin and {\v S}ikic, Mile},
-	Journal = {Bioinformatics},
-	Pages = {1394-1395},
-	Title = {Edlib: a {C/C++} library for fast, exact sequence alignment using edit distance},
-	Volume = {33},
-	Year = {2017}}
-
-@article{Abouelhoda:2005aa,
-	Author = {Mohamed Ibrahim Abouelhoda and Enno Ohlebusch},
-	Journal = {J. Discrete Algorithms},
-	Pages = {321-41},
-	Title = {Chaining algorithms for multiple genome comparison},
-	Volume = {3},
-	Year = {2005}}
-
-@article{Ono:2013aa,
-	Author = {Ono, Yukiteru and others},
-	Journal = {Bioinformatics},
-	Pages = {119-21},
-	Title = {{PBSIM}: {PacBio} reads simulator--toward accurate genome assembly},
-	Volume = {29},
-	Year = {2013}}
-
-@article {Jain128835,
-	author = {Jain, Miten and others},
-	title = {Nanopore sequencing and assembly of a human genome with ultra-long reads},
-	year = {2017},
-	note = {doi:10.1101/128835},
-	publisher = {Cold Spring Harbor Labs Journals},
-	journal = {bioRxiv}}
-
-@article{Lau:2016aa,
-	Author = {Lau, Bayo and others},
-	Journal = {Bioinformatics},
-	Pages = {3829-3832},
-	Title = {{LongISLND}: in silico sequencing of lengthy and noisy datatypes},
-	Volume = {32},
-	Year = {2016}}
-
-@article{Robinson:2011aa,
-	Author = {Robinson, James T and others},
-	Journal = {Nat Biotechnol},
-	Pages = {24-6},
-	Title = {Integrative genomics viewer},
-	Volume = {29},
-	Year = {2011}}
-
-@article {Suzuki130633,
-	author = {Suzuki, Hajime and Kasahara, Masahiro},
-	title = {Acceleration Of Nucleotide Semi-Global Alignment With Adaptive Banded Dynamic Programming},
-	year = {2017},
-	note = {doi:10.1101/130633},
-	publisher = {Cold Spring Harbor Labs Journals},
-	journal = {bioRxiv}}
-
-@article{Gotoh:1982aa,
-	Author = {Gotoh, O},
-	Journal = {J Mol Biol},
-	Pages = {705-8},
-	Title = {An improved algorithm for matching biological sequences},
-	Volume = {162},
-	Year = {1982}}
-
-@article{Altschul:1986aa,
-	Author = {Altschul, S F and Erickson, B W},
-	Journal = {Bull Math Biol},
-	Pages = {603-16},
-	Title = {Optimal sequence alignment using affine gap costs},
-	Volume = {48},
-	Year = {1986}}
-
-@article{Wu:2005vn,
-	Author = {Wu, Thomas D and Watanabe, Colin K},
-	Journal = {Bioinformatics},
-	Pages = {1859-75},
-	Title = {{GMAP}: a genomic mapping and alignment program for {mRNA} and {EST} sequences},
-	Volume = {21},
-	Year = {2005}}
-
-@article{Iwata:2012aa,
-	Author = {Iwata, Hiroaki and Gotoh, Osamu},
-	Journal = {Nucleic Acids Res},
-	Pages = {e161},
-	Title = {Benchmarking spliced alignment programs including {Spaln2}, an extended version of {Spaln} that incorporates additional species-specific features},
-	Volume = {40},
-	Year = {2012}}
-
-@article{Dobin:2013kx,
-	Author = {Dobin, Alexander and others},
-	Journal = {Bioinformatics},
-	Pages = {15-21},
-	Title = {{STAR}: ultrafast universal {RNA-seq} aligner},
-	Volume = {29},
-	Year = {2013}}
-
-@article{Byrne:2017aa,
-	Author = {Byrne, Ashley and others},
-	Journal = {Nat Commun},
-	Pages = {16027},
-	Title = {Nanopore long-read {RNAseq} reveals widespread transcriptional variation among the surface receptors of individual {B} cells},
-	Volume = {8},
-	Year = {2017}}
-
-@article{Roberts:2004fv,
-	Author = {Roberts, Michael and others},
-	Journal = {Bioinformatics},
-	Pages = {3363-9},
-	Title = {Reducing storage requirements for biological sequence comparison},
-	Volume = {20},
-	Year = {2004}}
-
-@article{Zhang:2006aa,
-	Author = {Zhang, Miao and Gish, Warren},
-	Journal = {Bioinformatics},
-	Pages = {13-20},
-	Title = {Improved spliced alignment from an information theoretic approach},
-	Volume = {22},
-	Year = {2006}}
-
-@article{Li:2007aa,
-	Author = {Li, Heng and others},
-	Journal = {BMC Bioinformatics},
-	Pages = {349},
-	Title = {A cross-species alignment tool {(CAT)}},
-	Volume = {8},
-	Year = {2007}}
-
-@article{Farrar:2007hs,
-	Author = {Farrar, Michael},
-	Journal = {Bioinformatics},
-	Pages = {156-61},
-	Title = {{Striped Smith-Waterman speeds database searches six times over other SIMD implementations}},
-	Volume = {23},
-	Year = {2007}}

tex/minimap2.tex

@@ -1,509 +0,0 @@
-\documentclass{bioinfo}
-\copyrightyear{2017}
-\pubyear{2017}
-
-\usepackage{graphicx}
-\usepackage{hyperref}
-\usepackage{url}
-\usepackage{amsmath}
-\usepackage[ruled,vlined]{algorithm2e}
-\newcommand\mycommfont[1]{\footnotesize\rmfamily{\it #1}}
-\SetCommentSty{mycommfont}
-\SetKwComment{Comment}{$\triangleright$\ }{}
-
-\usepackage{natbib}
-\bibliographystyle{apalike}
-\usepackage{hyperref}
-
-\DeclareMathOperator*{\argmax}{argmax}
-
-\begin{document}
-\firstpage{1}
-
-\title[Aligning long nucleotide sequences with minimap2]{Minimap2: fast pairwise alignment for long nucleotide sequences}
-\author[Li]{Heng Li}
-\address{Broad Institute, 415 Main Street, Cambridge, MA 02142, USA}
-
-\maketitle
-
-\begin{abstract}
-\section{Summary:} Minimap2 is a general-purpose mapper to align long noisy DNA
-or mRNA sequences against a large reference database. It targets query
-sequences of 1kb--100Mb in length with per-base divergence typically below
-25\%. For DNA sequence reads, minimap2 is $\sim$30 times faster than many
-mainstream long-read aligners and achieves higher accuracy on simulated data.
-It also employs concave gap cost and rescues inversions for improved alignment
-around potential structural variations. For real long RNA-seq reads, minimap2
-is $\sim$40 times faster than peers and produces alignment more consistent with
-existing gene annotations.
-
-\section{Availability and implementation:}
-\href{https://github.com/lh3/minimap2}{https://github.com/lh3/minimap2}
-
-\section{Contact:} hengli@broadinstitute.org
-\end{abstract}
-
-\section{Introduction}
-
-Single Molecule Real-Time (SMRT) sequencing technology and Oxford Nanopore
-technologies (ONT) produce reads over 10kbp in length at an error rate
-$\sim$15\%. Several aligners have been developed for such
-data~\citep{Chaisson:2012aa,Li:2013aa,Liu:2016ab,Sovic:2016aa,Liu:2017aa,Lin:2017aa,Sedlazeck169557}.
-Most of them were five times as slow as mainstream short-read
-aligners~\citep{Langmead:2012fk,Li:2013aa} in terms of the number of bases
-mapped per second. We speculated there could be substantial room for speedup on
-the thought that 10kb long sequences should be easier to map than 100bp reads
-because we can more effectively skip repetitive regions, which are often the
-bottleneck of short-read alignment. We confirmed our speculation by achieving
-approximate mapping 50 times faster than BWA-MEM~\citep{Li:2016aa}.
-\citet{Suzuki:2016} extended our work with a fast and novel algorithm on
-generating base-level alignment, which in turn inspired us to develop minimap2
-towards higher accuracy and more practical functionality.
-
-Both SMRT and ONT have been applied to sequence spliced mRNAs (RNA-seq). While
-traditional mRNA aligners work~\citep{Wu:2005vn,Iwata:2012aa}, they are not
-optimized for long noisy sequence reads and are tens of times slower than
-dedicated long-read aligners. When developing minimap2 initially for aligning
-genomic DNA only, we realized minor modifications could make it competitive for
-aligning mRNAs as well. Minimap2 is a first RNA-seq aligner specifically
-designed for long noisy reads.
-
-\begin{methods}
-\section{Methods}
-
-Minimap2 follows a typical seed-chain-align procedure as is used by most
-full-genome aligners. It collects minimizers~\citep{Roberts:2004fv} of the
-reference sequences and indexes them in a hash table. Then for each query
-sequence, minimap2 takes query minimizers as \emph{seeds}, finds matches to the
-reference, and identifies sets of colinear seeds, which are called
-\emph{chains}. If base-level alignment is requested, minimap2 applies dynamic
-programming (DP) to extend from the ends of chains and to close unseeded
-regions between adjacent seeds in chains.
-
-Minimap2 uses indexing and seeding algorithms similar to
-minimap~\citep{Li:2016aa}, and furthers the predecessor with more accurate
-chaining, the ability to produce base-level alignment and the support of
-spliced alignment.
-
-\subsection{Chaining}
-
-\subsubsection{Chaining}
-An \emph{anchor} is a 3-tuple $(x,y,w)$, indicating interval $[x-w+1,x]$ on the
-reference matching interval $[y-w+1,y]$ on the query. Given a list of anchors
-sorted by ending reference position $x$, let $f(i)$ be the maximal chaining
-score up to the $i$-th anchor in the list. $f(i)$ can be calculated with
-dynamic programming:
-\begin{equation}\label{eq:chain}
-f(i)=\max\big\{\max_{i>j\ge 1} \{ f(j)+\alpha(j,i)-\beta(j,i) \},w_i\big\}
-\end{equation}
-where $\alpha(j,i)=\min\big\{\min\{y_i-y_j,x_i-x_j\},w_i\big\}$ is the number of
-matching bases between the two anchors. $\beta(j,i)>0$ is the gap cost. It
-equals $\infty$ if $y_j\ge y_i$ or $\max\{y_i-y_j,x_i-x_j\}>G$ (i.e. the
-distance between two anchors is too large); otherwise
-\begin{equation}\label{eq:chain-gap}
-\beta(j,i)=\gamma_c\big((y_i-y_j)-(x_i-x_j)\big)
-\end{equation}
-In implementation, a gap of length $l$ costs $\gamma_c(l)=0.01\cdot \bar{w}\cdot
-|l|+0.5\log_2|l|$, where $\bar{w}$ is the average seed length. For $m$ anchors, directly computing all $f(\cdot)$ with
-Eq.~(\ref{eq:chain}) takes $O(m^2)$ time. Although theoretically faster
-chaining algorithms exist~\citep{Abouelhoda:2005aa}, they
-are inapplicable to generic gap cost, complex to implement and usually
-associated with a large constant. We introduced a simple heuristic to
-accelerate chaining.
-
-We note that if anchor $i$ is chained to $j$, chaining $i$ to a predecessor
-of $j$ is likely to yield a lower score. When evaluating Eq.~(\ref{eq:chain}),
-we start from anchor $i-1$ and stop the process if we cannot find a better
-score after up to $h$ iterations. This approach reduces the average time to
-$O(h\cdot m)$. In practice, we can almost always find the optimal chain with
-$h=50$; even if the heuristic fails, the optimal chain is often close.
-
-\subsubsection{Backtracking}
-Let $P(i)$ be the index of the best predecessor of anchor $i$. It equals 0 if
-$f(i)=w_i$ or $\argmax_j\{f(j)+\eta(j,i)-\gamma(j,i)\}$ otherwise. For each
-anchor $i$ in the descending order of $f(i)$, we apply $P(\cdot)$ repeatedly to
-find its predecessor and mark each visited $i$ as `used', until $P(i)=0$ or we
-reach an already `used' $i$. This way we find all chains with no anchors used
-in more than one chains.
-
-\subsubsection{Identifying primary chains}
-In the absence of copy number changes, each query segment should not be mapped
-to two places in the reference. However, chains found at the previous step may
-have significant or complete overlaps due to repeats in the reference.
-Minimap2 used the following procedure to identify \emph{primary chains} that do
-not greatly overlap on the query. Let $Q$ be an empty set initially. For each
-chain from the best to the worst according to their chaining scores: if on the
-query, the chain overlaps with a chain in $Q$ by 50\% or higher percentage of
-the shorter chain, mark the chain as secondary to the chain in $Q$; otherwise,
-add the chain to $Q$. In the end, $Q$ contains all the primary chains. We did
-not choose a more sophisticated data structure (e.g. range tree or k-d tree)
-because this step is not the performance bottleneck.
-
-\subsection{Aligning genomic DNA}
-
-\subsubsection{Alignment with 2-piece affine gap cost}
-
-Minimap2 performs DP-based global alignment between adjacent anchors in a
-chain. It uses a 2-piece affine gap cost~\citep{Gotoh:1990aa}:
-\begin{equation}\label{eq:2-piece}
-\gamma_a(l)=\min\{q+|l|\cdot e,\tilde{q}+|l|\cdot\tilde{e}\}
-\end{equation}
-Without losing generality, we always assume $q+e<\tilde{q}+\tilde{e}$.
-On the condition that $e>\tilde{e}$, it applies cost $q+|l|\cdot e$ to gaps
-shorter than $\lceil(\tilde{q}-q)/(e-\tilde{e})\rceil$ and applies
-$\tilde{q}+|l|\cdot\tilde{e}$ to longer gaps.  This scheme helps to recover
-longer insertions and deletions~(INDELs).
-
-The equation to compute the optimal alignment under $\gamma_a(\cdot)$ is
-\begin{equation}\label{eq:ae86}
-\left\{\begin{array}{l}
-H_{ij} = \max\{H_{i-1,j-1}+s(i,j),E_{ij},F_{ij},\tilde{E}_{ij},\tilde{F}_{ij}\}\\
-E_{i+1,j}= \max\{H_{ij}-q,E_{ij}\}-e\\
-F_{i,j+1}= \max\{H_{ij}-q,F_{ij}\}-e\\
-\tilde{E}_{i+1,j}= \max\{H_{ij}-\tilde{q},\tilde{E}_{ij}\}-\tilde{e}\\
-\tilde{F}_{i,j+1}= \max\{H_{ij}-\tilde{q},\tilde{F}_{ij}\}-\tilde{e}
-\end{array}\right.
-\end{equation}
-where $s(i,j)$ is the score between the $i$-th reference base and $j$-th query
-base. Eq.~(\ref{eq:ae86}) is a natural extension to the equation under affine
-gap cost~\citep{Gotoh:1982aa,Altschul:1986aa}.
-
-\subsubsection{Suzuki's formulation}
-
-When we allow gaps longer than several hundred base pairs, nucleotide-level
-alignment is much slower than chaining. SSE acceleration is critical to the
-performance of minimap2. Traditional SSE implementations~\citep{Farrar:2007hs}
-based on Eq.~(\ref{eq:ae86}) can achieve 16-way parallelization for short
-sequences, but only 4-way parallelization when the peak alignment score reaches
-32767. Long sequence alignment may exceed this threshold. Inspired by
-\citet{Wu:1996aa} and the following work, \citet{Suzuki:2016} proposed a
-difference-based formulation that lifted this limitation.
-In case of 2-piece gap cost, define
-\[
-\left\{\begin{array}{ll}
-u_{ij}\triangleq H_{ij}-H_{i-1,j} & v_{ij}\triangleq H_{ij}-H_{i,j-1} \\
-x_{ij}\triangleq E_{i+1,j}-H_{ij} & \tilde{x}_{ij}\triangleq \tilde{E}_{i+1,j}-\tilde{H}_{ij} \\
-y_{ij}\triangleq F_{i,j+1}-H_{ij} & \tilde{y}_{ij}\triangleq \tilde{F}_{i,j+1}-\tilde{H}_{ij}
-\end{array}\right.
-\]
-We can transform Eq.~(\ref{eq:ae86}) to
-\begin{equation}\label{eq:suzuki}
-\left\{\begin{array}{lll}
-z_{ij}&=&\max\{s(i,j),x_{i-1,j}+v_{i-1,j},y_{i,j-1}+u_{i,j-1},\\
-&&\tilde{x}_{i-1,j}+v_{i-1,j},\tilde{y}_{i,j-1}+u_{i,j-1}\}\\
-u_{ij}&=&z_{ij}-v_{i-1,j}\\
-v_{ij}&=&z_{ij}-u_{i,j-1}\\
-x_{ij}&=&\max\{0,x_{i-1,j}+v_{i-1,j}-z_{ij}+q\}-q-e\\
-y_{ij}&=&\max\{0,y_{i,j-1}+u_{i,j-1}-z_{ij}+q\}-q-e\\
-\tilde{x}_{ij}&=&\max\{0,\tilde{x}_{i-1,j}+v_{i-1,j}-z_{ij}+\tilde{q}\}-\tilde{q}-\tilde{e}\\
-\tilde{y}_{ij}&=&\max\{0,\tilde{y}_{i,j-1}+u_{i,j-1}-z_{ij}+\tilde{q}\}-\tilde{q}-\tilde{e}
-\end{array}\right.
-\end{equation}
-where $z_{ij}$ is a temporary variable that does not need to be stored.
-
-An important property of Eq.~(\ref{eq:suzuki}) is that all values are bounded
-by scoring parameters. To see that,
-\[
-x_{ij}=E_{i+1,j}-H_{ij}=\max\{-q,E_{ij}-H_{ij}\}-e
-\]
-With $E_{ij}\le H_{ij}$, we have
-\[
--q-e\le x_{ij}\le\max\{-q,0\}-e=-e
-\]
-and similar inequations for $y_{ij}$, $\tilde{x}_{ij}$ and $\tilde{y}_{ij}$.
-In addition,
-\[
-u_{ij}=z_{ij}-v_{i-1,j}\ge\max\{x_{i-1,j},\tilde{x}_{i-1,j}\}\ge-q-e
-\]
-As the maximum value of $z_{ij}=H_{ij}-H_{i-1,j-1}$ is $M$, the maximal
-matching score, we can derive
-\[
-u_{ij}\le M-v_{i-1,j}\le M+q+e
-\]
-In conclusion, in Eq.~(\ref{eq:suzuki}), $x$ and $y$ are bounded by $[-q-e,-e]$,
-$\tilde{x}$ and $\tilde{y}$ by $[-\tilde{q}-\tilde{e},-\tilde{e}]$, and $u$ and
-$v$ by $[-q-e,M+q+e]$. When $-128\le-q-e<M+q+e\le127$, each of them can be stored as
-a 8-bit integer. This enables 16-way SSE vectorization regardless of the peak
-score of the alignment.
-
-For a more efficient SSE implementation, we transform the row-column coordinate
-to the diagonal-antidiagonal coordinate by letting $r\gets i+j$ and $t\gets i$.
-Eq.~(\ref{eq:suzuki}) becomes:
-\begin{equation*}
-\left\{\begin{array}{lll}
-z_{rt}&=&\max\{s(t,r-t),x_{r-1,t-1}+v_{r-1,t-1},y_{r-1,t}\\
-&&+u_{r-1,t},\tilde{x}_{r-1,t-1}+v_{r-1,t-1},\tilde{y}_{r-1,t}+u_{r-1,t}\}\\
-u_{rt}&=&z_{rt}-v_{r-1,t-1}\\
-v_{rt}&=&z_{rt}-u_{r-1,t}\\
-x_{rt}&=&\max\{0,x_{r-1,t-1}+v_{r-1,t-1}-z_{rt}+q\}-q-e\\
-y_{rt}&=&\max\{0,y_{r-1,t}+u_{r-1,t}-z_{rt}+q\}-q-e\\
-\tilde{x}_{rt}&=&\max\{0,\tilde{x}_{r-1,t-1}+v_{r-1,t-1}-z_{rt}+\tilde{q}\}-\tilde{q}-\tilde{e}\\
-\tilde{y}_{rt}&=&\max\{0,\tilde{y}_{r-1,t}+u_{r-1,t}-z_{rt}+\tilde{q}\}-\tilde{q}-\tilde{e}
-\end{array}\right.
-\end{equation*}
-In this formulation, cells with the same diagonal index $r$ are independent of
-each other. This allows us to fully vectorize the computation of all cells on
-the same anti-diagonal in one inner loop. It also simplifies banded alignment,
-which would be difficult with striped vectorization~\citep{Farrar:2007hs}.
-
-On the condition that $q+e<\tilde{q}+\tilde{e}$ and $e>\tilde{e}$, the initial
-values in the diagonal-antidiagonal formuation is
-\[
-\left\{\begin{array}{l}
-x_{r-1,-1}=y_{r-1,r}=-q-e\\
-\tilde{x}_{r-1,-1}=\tilde{y}_{r-1,r}=-\tilde{q}-\tilde{e}\\
-u_{r-1,r}=v_{r-1,-1}=\eta(r)\\
-\end{array}\right.
-\]
-where
-\[
-\eta(r)=\left\{\begin{array}{ll}
--q-e & (r=0) \\
--e & (r<\lceil\frac{\tilde{q}-q}{e-\tilde{e}}-1\rceil) \\
-r\cdot(e-\tilde{e})-(\tilde{q}-q)-\tilde{e} & (r=\lceil\frac{\tilde{q}-q}{e-\tilde{e}}-1\rceil) \\
--\tilde{e} & (r>\lceil\frac{\tilde{q}-q}{e-\tilde{e}}-1\rceil)
-\end{array}\right.
-\]
-These can be derived from the initial values for Eq.~(\ref{eq:ae86}).
-
-In practice, our 16-way vectorized implementation of global alignment is three
-times as fast as Parasail's 4-way vectorization~\citep{Daily:2016aa}.  Without
-banding, our implementation is slower than Edlib~\citep{Sosic:2017aa}, but with
-a 1000bp band, it is considerably faster. When performing global alignment
-between anchors, we expect the alignment to stay close to the diagonal of the
-DP matrix. Banding is applicable most of time.
-
-\subsubsection{The Z-drop heuristic}
-
-With global alignment, minimap2 may force to align unrelated sequences between
-two adjacent anchors. To avoid such an artifact, we compute accumulative
-alignment score along the alignment path and break the alignment where the
-score drops too fast in the diagonal direction. More precisely, let $S(i,j)$ be
-the alignment score along the alignment path ending at cell $(i,j)$ in the DP
-matrix. We break the alignment if there exist $(i',j')$ and $(i,j)$, $i'<i$ and
-$j'<j$, such that
-\[
-S(i',j')-S(i,j)>Z+e\cdot|(i-i')-(j-j')|
-\]
-where $e$ is the gap extension cost and $Z$ is an arbitrary threshold.
-This strategy is first used in BWA-MEM. It is similar to X-drop employed in
-BLAST~\citep{Altschul:1997vn}, but unlike X-drop, it would not break the
-alignment in the presence of a single long gap.
-
-When minimap2 breaks a global alignment between two anchors, it performs local
-alignment between the two subsequences involved in the global alignment, but
-this time with the one subsequence reverse complemented. This additional
-alignment step may identify short inversions that are missed during chaining.
-
-\subsection{Aligning spliced sequences}
-
-The algorithm described above can be adapted to spliced alignment. In this
-mode, the chaining gap cost distinguishes insertions to and deletions from the
-reference: $\gamma_c(l)$ in Eq.~(\ref{eq:chain-gap}) takes the form of
-\[
-\gamma_c(l)=\left\{\begin{array}{ll}
-0.01\cdot\bar{w}\cdot l+0.5\log_2 l & (l>0) \\
-\min\{0.01\cdot\bar{w}\cdot|l|,\log_2|l|\} & (l<0)
-\end{array}\right.
-\]
-Similarly, the gap cost function used for DP-based alignment is changed to
-\[
-\gamma_a(l)=\left\{\begin{array}{ll}
-q+l\cdot e & (l>0) \\
-\min\{q+|l|\cdot e,\tilde{q}\} & (l<0)
-\end{array}\right.
-\]
-In alignment, a deletion no shorter than $\lceil(\tilde{q}-q)/e\rceil$ is
-regarded as an intron, which pays no cost to gap extensions.
-
-To pinpoint precise splicing junctions, minimap2 introduces reference-dependent
-cost to penalize non-canonical splicing:
-\begin{equation}\label{eq:splice}
-\left\{\begin{array}{l}
-H_{ij} = \max\{H_{i-1,j-1}+s(i,j),E_{ij},F_{ij},\tilde{E}_{ij}-a(i)\}\\
-E_{i+1,j}= \max\{H_{ij}-q,E_{ij}\}-e\\
-F_{i,j+1}= \max\{H_{ij}-q,F_{ij}\}-e\\
-\tilde{E}_{i+1,j}= \max\{H_{ij}-d(i)-\tilde{q},\tilde{E}_{ij}\}\\
-\end{array}\right.
-\end{equation}
-Let $T$ be the reference sequence. $d(i)$ is the cost of a non-canonical donor
-site, which takes 0 if $T[i+1,i+2]={\tt GT}$, or a positive number $p$
-otherwise. Similarly, $a(i)$ is the cost of a non-canonical acceptor site, which
-takes 0 if $T[i-1,i]={\tt AG}$, or $p$ otherwise. Eq.~(\ref{eq:splice}) is
-almost equivalent to the equation used by EXALIN~\citep{Zhang:2006aa} except
-that we allow insertions immediately followed by deletions and vice versa; in
-addition, we use Suzuki's diagonal formulation in actual implementation.
-
-%Given that $d_i$ and $a_i$
-%are a function of the reference sequence, it is possible to incorporate
-%splicing signals with more sophisticated models, such as positional weight
-%matrices. We have not tried this approach.
-
-If RNA-seq reads are not sequenced from stranded libraries, the read strand
-relative to the underlying transcript is unknown. By default, minimap2 aligns
-each chain twice, first assuming ${\tt GT}$--${\tt AG}$ as the splicing signal
-and then assuming ${\tt CT}$--${\tt AC}$, the reverse complement of ${\tt
-GT}$--${\tt AG}$, as the splicing signal. The alignment with a higher score is
-taken as the final alignment. This procedure also infers the relative strand of
-reads that span canonical splicing sites.
-
-In the spliced alignment mode, minimap2 further increases the density of
-minimizers and disables banded alignment. Together with the two-round DP-based
-alignment, spliced alignment is several times slower than DNA sequence
-alignment.
-
-\end{methods}
-
-\section{Results}
-
-\subsection{Aligning genomic reads}
-
-\begin{figure}[!tb]
-\centering
-\includegraphics[width=.5\textwidth]{roc-color.pdf}
-\caption{Evaluation on simulated SMRT reads aligned against human genome
-GRCh38.  33,088 $\ge$1000bp reads were simulated using pbsim~\citep{Ono:2013aa}
-with error profile sampled from file `m131017\_060208\_42213\_*.1.*' downloaded
-at \href{http://bit.ly/chm1p5c3}{http://bit.ly/chm1p5c3}. The N50 read length
-is 11,628. A read is considered correctly mapped if the true position overlaps
-with the best mapping position by 10\% of the read length. All aligners were
-run under the default setting for SMRT reads.  (a) ROC-like curve. Alignments
-are sorted by mapping quality in the descending order. For each mapping quality
-threshold, the fraction of alignments with mapping quality above the threshold
-and their error rate are plotted.  Kart outputted all alignments at mapping
-quality 60, so is not shown in the figure. It mapped nearly all reads with
-4.1\% of alignments being wrong, less accurate than others.  (b) Accumulative
-mapping error rate as a function of mapping quality.}\label{fig:eval}
-\end{figure}
-
-As a sanity check, we evaluated minimap2 on simulated human reads along with
-BLASR~(v1.MC.rc64; \citealp{Chaisson:2012aa}),
-BWA-MEM~(v0.7.15; \citealp{Li:2013aa}),
-GraphMap~(v0.5.2; \citealp{Sovic:2016aa}),
-Kart~(v2.2.5; \citealp{Lin:2017aa}),
-minialign~(v0.5.3; \citealp{Suzuki:2016}) and
-NGMLR~(v0.2.5; \citealp{Sedlazeck169557}). We excluded rHAT~\citep{Liu:2016ab}
-and LAMSA~\citep{Liu:2017aa} because they either
-crashed or produced malformatted output. In this evaluation, minimap2 has
-higher power to distinguish unique and repetitive hits, and achieves overall
-higher mapping accuracy (Fig.~\ref{fig:eval}a). It is still the most accurate
-even if we skip DP-based alignment (data not shown), confirming chaining alone
-is sufficient to achieve high accuracy for approximate mapping. Minimap2 and
-NGMLR provide better mapping quality estimate: they rarely give repetitive hits
-high mapping quality (Fig.~\ref{fig:eval}b).  Apparently, other aligners may
-occasionally miss close suboptimal hits and be overconfident in wrong mappings.
-On run time, minialign is slightly faster than minimap2 and Kart. They are over
-30 times faster than the rest.  Minimap2 consumed 6.1GB memory at the peak,
-more than BWA-MEM but less than others.
-
-On real human SMRT reads, the relative performance and sensitivity of
-these aligners are broadly similar to the metrics on simulated data. We are
-unable to provide a good estimate of mapping error rate due to the lack of the
-truth.  On ONT $\sim$100kb human reads~\citep{Jain128835}, BWA-MEM failed.
-Kart, minialign and minimap2 are over 70 times faster than others. We have also
-examined tens of $\ge$100bp INDELs in IGV~\citep{Robinson:2011aa} and can
-confirm the observation by~\citet{Sedlazeck169557} that BWA-MEM often breaks
-them into shorter gaps. The issue is much alleviated with minimap2, thanks
-to the 2-piece affine gap cost.
-
-\subsection{Aligning spliced reads}
-
-We evaluated minimap2 on SIRV control data~(AC:SRR5286959;
-\citealp{Byrne:2017aa}) where the truth is known. Minimap2 predicted 59\,916
-introns from 11\,017 reads. 93.0\% of splice juctions are precise. We examined
-wrongly predicted junctions and found the majority were caused by clustered
-splicing signals (e.g. two adjacent ${\tt GT}$ sites). When INDEL sequencing
-errors are frequent, it is difficult to find precise splicing sites in this
-case. If we allow up to 10bp distance from true splicing sites, 98.4\% of
-aligned introns are approximately correct.  Given this observation, we might be
-able to improve boundary detection by initializing $d(\cdot)$ and $a(\cdot)$ in
-Eq.~(\ref{eq:splice}) with position-specific scoring matrices or more
-sophisticated models. We have not tried this approach.
-
-\begin{table}[!tb]
-\processtable{Evaluation of junction accuracy on 2D ONT reads}
-{\footnotesize\label{tab:intron}
-\begin{tabular}{p{3.1cm}rrrr}
-\toprule
-& GMAP & minimap2 & SpAln & STAR\\
-\midrule
-Run time (CPU min) & 631 & 15.5 & 2\,076 & 33.9 \\
-Peak RAM (GByte) & 8.9 & 14.5 & 3.2 & 29.2\vspace{1em}\\
-\# aligned reads & 103\,669 & 103\,917 & 103\,711 & 26\,479\\
-\# chimeric alignments & 1\,904 & 1\,671 & 0 & 0\\
-\# non-spliced alignments & 15\,854 & 14\,483 & 17\,033 & 10\,545\vspace{1em}\\
-\# aligned introns & 692\,275 & 694\,237 & 692\,945 & 78\,603 \\
-\# novel introns & 11\,239 & 3\,217 & 8\,550 & 1\,214 \\
-\% exact introns & 83.8\% & 91.8\% & 87.9\% & 55.2\% \\
-\% approx. introns & 91.8\% & 96.5\% & 92.5\% & 82.4\% \\
-\botrule
-\end{tabular}
-}{Mouse reads (AC:SRR5286960) were mapped to the primary assembly of mouse
-genome GRCm38 with the following tools and command options: minimap2 (`-ax
-splice'); GMAP (`-n 0 --min-intronlength 30 --cross-species'); SpAln (`-Q7 -LS
--S3'); STARlong (according to
-\href{http://bit.ly/star-pb}{http://bit.ly/star-pb}). The alignments were
-compared to the EnsEMBL gene annotation, release 89. A predicted intron
-is \emph{novel} if it has no overlaps with any annotated introns. An intron
-is \emph{exact} if it is identical to an annotated intron. An intron is
-\emph{approximate} if both its 5'- and 3'-end are within 10bp around the ends
-of an annotated intron.}
-\end{table}
-
-We next aligned real mouse reads~\citep{Byrne:2017aa} with GMAP~(v2017-06-20;
-\citealp{Wu:2005vn}), minimap2, SpAln~(v2.3.1; \citealp{Iwata:2012aa}) and
-STAR~(v2.5.3a; \citealp{Dobin:2013kx}). In general, minimap2 is more
-consistent with existing annotations (Table~\ref{tab:intron}): it finds
-more junctions with a higher percentage being exactly or approximately correct.
-Minimap2 is over 40 times faster than GMAP and SpAln. While STAR is close to
-minimap2 in speed, it does not work well with noisy reads.  We have also
-evaluated spliced aligners on public Iso-Seq data (human Alzheimer brain
-from \href{http://bit.ly/isoseqpub}{http://bit.ly/isoseqpub}). The observation
-is similar: minimap2 is faster at higher junction accuracy.
-
-We noted that GMAP and SpAln have not been optimized for noisy reads. We are
-showing the best setting we have experimented, but their developers should be
-able to improve their accuracy further.
-
-%\begin{table}[!tb]
-%\processtable{Evaluation of junction accuracy on SMRT Iso-Seq reads}
-%{\footnotesize
-%\begin{tabular}{lrrrr}
-%\toprule
-%& GMAP & minimap2 & SpAln & STAR\\
-%\midrule
-%Run time (CPU min) & & 243 & 2\,352 & 1\,647 \\
-%\# aligned reads & & 1\,123\,025 & 1\,094\,092 & 682\,452\\
-%\# chimeric alignments & & 33\,091 & 0 & 0\\
-%\# non-spliced alignments & & 339\,081 & 291\,447 & 272\,536\vspace{1em}\\
-%\# aligned introns & & 9\,071\,755 & 9\,208\,564 & 3\,029\,121 \\
-%\# novel introns & & 42\,773 & 82\,230 & 17\,791 \\
-%\% exact introns & & 94.9\% & 91.7\% & 84.7\% \\
-%\% approx. introns&& 96.9\% & 93.4\% & 93.8\% \\
-%\botrule
-%\end{tabular}
-%}{}
-%\end{table}
-
-
-\section{Conclusion}
-
-Minimap2 is a fast, accurate and versatile aligner for long nucleotide
-sequences.  In addition to reference-based read mapping, minimap2 inherits
-minimap's functionality to search against huge multi-species databases and to
-find read overlaps. On a few test data sets, minimap2 appears to yield slightly
-better miniasm assembly~\citep{Li:2016aa}. Minimap2 can also align similar
-genomes or different assemblies of the same species. However, full-genome
-alignment is an intricate research topic. More thorough evaluations would be
-necessary to justify the use of minimap2 for such applications.
-
-\section*{Acknowledgements}
-We owe a debt of gratitude to Hajime Suzuki for releasing his masterpiece and
-insightful notes before formal publication. We thank M. Schatz, P. Rescheneder
-and F.  Sedlazeck for pointing out the limitation of BWA-MEM. We are also
-grateful to early minimap2 testers who have greatly helped to suggest features
-and to fix various issues.
-
-\bibliography{minimap2}
-
-\end{document}

tex/mm2.approx.eval

@@ -1,30 +0,0 @@
-Q	60	32066	0	0.000000000
-Q	40	32	1	0.000031155
-Q	38	19	1	0.000062272
-Q	36	11	1	0.000093376
-Q	35	32	1	0.000124378
-Q	33	15	1	0.000155400
-Q	32	58	1	0.000186145
-Q	27	11	1	0.000217095
-Q	26	80	1	0.000247494
-Q	21	19	2	0.000309186
-Q	20	16	1	0.000339936
-Q	19	19	1	0.000370622
-Q	18	22	2	0.000432099
-Q	17	37	5	0.000585751
-Q	15	24	2	0.000646930
-Q	14	18	3	0.000738939
-Q	13	30	6	0.000922821
-Q	12	18	1	0.000953054
-Q	11	29	2	0.001013638
-Q	10	30	1	0.001043393
-Q	9	20	5	0.001196099
-Q	8	25	8	0.001440348
-Q	7	28	6	0.001622830
-Q	6	35	12	0.001988132
-Q	5	34	12	0.002352725
-Q	4	29	8	0.002594865
-Q	3	36	14	0.003018937
-Q	2	46	15	0.003471482
-Q	1	69	36	0.004558162
-Q	0	167	94	0.007377173

tex/mm2.eval

@@ -1,17 +0,0 @@
-Q	60	32072	0	0.000000000
-Q	43	206	1	0.000030981
-Q	27	201	1	0.000061578
-Q	15	59	1	0.000092200
-Q	12	25	1	0.000122839
-Q	11	16	1	0.000153473
-Q	10	24	1	0.000184032
-Q	9	17	2	0.000245248
-Q	8	27	3	0.000336938
-Q	7	23	1	0.000367309
-Q	6	20	1	0.000397675
-Q	5	18	4	0.000519751
-Q	4	17	1	0.000550038
-Q	3	29	5	0.000702204
-Q	2	32	4	0.000823522
-Q	1	54	6	0.001004872
-Q	0	234	106	0.004202697

tex/natbib.sty

@@ -1,803 +0,0 @@
-%%
-%% This is file `natbib.sty',
-%% generated with the docstrip utility.
-%%
-%% The original source files were:
-%%
-%% natbib.dtx  (with options: `package,all')
-%% =============================================
-%% IMPORTANT NOTICE:
-%% 
-%% This program can be redistributed and/or modified under the terms
-%% of the LaTeX Project Public License Distributed from CTAN
-%% archives in directory macros/latex/base/lppl.txt; either
-%% version 1 of the License, or any later version.
-%% 
-%% This is a generated file.
-%% It may not be distributed without the original source file natbib.dtx.
-%% 
-%% Full documentation can be obtained by LaTeXing that original file.
-%% Only a few abbreviated comments remain here to describe the usage.
-%% =============================================
-%% Copyright 1993-2000 Patrick W Daly
-%% Max-Planck-Institut f\"ur Aeronomie
-%% Max-Planck-Str. 2
-%% D-37191 Katlenburg-Lindau
-%% Germany
-%% E-mail: daly@linmpi.mpg.de
-\NeedsTeXFormat{LaTeX2e}[1995/06/01]
-\ProvidesPackage{natbib}
-        [2000/07/24 7.0a (PWD)]
- % This package reimplements the LaTeX \cite command to be used for various
- % citation styles, both author-year and numerical. It accepts BibTeX
- % output intended for many other packages, and therefore acts as a
- % general, all-purpose citation-style interface.
- %
- % With standard numerical .bst files, only numerical citations are
- % possible. With an author-year .bst file, both numerical and
- % author-year citations are possible.
- %
- % If author-year citations are selected, \bibitem must have one of the
- %   following forms:
- %   \bibitem[Jones et al.(1990)]{key}...
- %   \bibitem[Jones et al.(1990)Jones, Baker, and Williams]{key}...
- %   \bibitem[Jones et al., 1990]{key}...
- %   \bibitem[\protect\citeauthoryear{Jones, Baker, and Williams}{Jones
- %       et al.}{1990}]{key}...
- %   \bibitem[\protect\citeauthoryear{Jones et al.}{1990}]{key}...
- %   \bibitem[\protect\astroncite{Jones et al.}{1990}]{key}...
- %   \bibitem[\protect\citename{Jones et al., }1990]{key}...
- %   \harvarditem[Jones et al.]{Jones, Baker, and Williams}{1990}{key}...
- %
- % This is either to be made up manually, or to be generated by an
- % appropriate .bst file with BibTeX.
- %                            Author-year mode     ||   Numerical mode
- % Then, \citet{key}  ==>>  Jones et al. (1990)    ||   Jones et al. [21]
- %       \citep{key}  ==>> (Jones et al., 1990)    ||   [21]
- % Multiple citations as normal:
- % \citep{key1,key2}  ==>> (Jones et al., 1990; Smith, 1989) || [21,24]
- %                           or  (Jones et al., 1990, 1991)  || [21,24]
- %                           or  (Jones et al., 1990a,b)     || [21,24]
- % \cite{key} is the equivalent of \citet{key} in author-year mode
- %                         and  of \citep{key} in numerical mode
- % Full author lists may be forced with \citet* or \citep*, e.g.
- %       \citep*{key}      ==>> (Jones, Baker, and Williams, 1990)
- % Optional notes as:
- %   \citep[chap. 2]{key}    ==>> (Jones et al., 1990, chap. 2)
- %   \citep[e.g.,][]{key}    ==>> (e.g., Jones et al., 1990)
- %   \citep[see][pg. 34]{key}==>> (see Jones et al., 1990, pg. 34)
- %  (Note: in standard LaTeX, only one note is allowed, after the ref.
- %   Here, one note is like the standard, two make pre- and post-notes.)
- %   \citealt{key}          ==>> Jones et al. 1990
- %   \citealt*{key}         ==>> Jones, Baker, and Williams 1990
- %   \citealp{key}          ==>> Jones et al., 1990
- %   \citealp*{key}         ==>> Jones, Baker, and Williams, 1990
- % Additional citation possibilities (both author-year and numerical modes)
- %   \citeauthor{key}       ==>> Jones et al.
- %   \citeauthor*{key}      ==>> Jones, Baker, and Williams
- %   \citeyear{key}         ==>> 1990
- %   \citeyearpar{key}      ==>> (1990)
- %   \citetext{priv. comm.} ==>> (priv. comm.)
- % Note: full author lists depends on whether the bib style supports them;
- %       if not, the abbreviated list is printed even when full requested.
- %
- % For names like della Robbia at the start of a sentence, use
- %   \Citet{dRob98}         ==>> Della Robbia (1998)
- %   \Citep{dRob98}         ==>> (Della Robbia, 1998)
- %   \Citeauthor{dRob98}    ==>> Della Robbia
- %
- %
- % Citation aliasing is achieved with
- %   \defcitealias{key}{text}
- %   \citetalias{key}  ==>> text
- %   \citepalias{key}  ==>> (text)
- %
- % Defining the citation style of a given bib style:
- % Use \bibpunct (in the preamble only) with 6 mandatory arguments:
- %    1. opening bracket for citation
- %    2. closing bracket
- %    3. citation separator (for multiple citations in one \cite)
- %    4. the letter n for numerical styles, s for superscripts
- %        else anything for author-year
- %    5. punctuation between authors and date
- %    6. punctuation between years (or numbers) when common authors missing
- % One optional argument is the character coming before post-notes. It
- %   appears in square braces before all other arguments. May be left off.
- % Example (and default) \bibpunct[, ]{(}{)}{;}{a}{,}{,}
- %
- % To make this automatic for a given bib style, named newbib, say, make
- % a local configuration file, natbib.cfg, with the definition
- %   \newcommand{\bibstyle@newbib}{\bibpunct...}
- % Then the \bibliographystyle{newbib} will cause \bibstyle@newbib to
- % be called on THE NEXT LATEX RUN (via the aux file).
- %
- % Such preprogrammed definitions may be invoked in the text (preamble only)
- %  by calling \citestyle{newbib}. This is only useful if the style specified
- %  differs from that in \bibliographystyle.
- %
- % With \citeindextrue and \citeindexfalse, one can control whether the
- % \cite commands make an automatic entry of the citation in the .idx
- % indexing file. For this, \makeindex must also be given in the preamble.
- %
- % LaTeX2e Options: (for selecting punctuation)
- %   round  -  round parentheses are used (default)
- %   square -  square brackets are used   [option]
- %   curly  -  curly braces are used      {option}
- %   angle  -  angle brackets are used    <option>
- %   colon  -  multiple citations separated by colon (default)
- %   comma  -  separated by comma
- %   authoryear - selects author-year citations (default)
- %   numbers-  selects numerical citations
- %   super  -  numerical citations as superscripts
- %   sort   -  sorts multiple citations according to order in ref. list
- %   sort&compress   -  like sort, but also compresses numerical citations
- %   longnamesfirst  -  makes first citation full author list
- %   sectionbib - puts bibliography in a \section* instead of \chapter*
- % Punctuation so selected dominates over any predefined ones.
- % LaTeX2e options are called as, e.g.
- %        \usepackage[square,comma]{natbib}
- % LaTeX the source file natbib.dtx to obtain more details
- % or the file natnotes.tex for a brief reference sheet.
- %-----------------------------------------------------------
-\@ifclassloaded{aguplus}{\PackageError{natbib}
-  {The aguplus class already includes natbib coding,\MessageBreak
-   so you should not add it explicitly}
-  {Type <Return> for now, but then later remove\MessageBreak
-   the command \protect\usepackage{natbib} from the document}
-  \endinput}{}
-\@ifclassloaded{nlinproc}{\PackageError{natbib}
-  {The nlinproc class already includes natbib coding,\MessageBreak
-   so you should not add it explicitly}
-  {Type <Return> for now, but then later remove\MessageBreak
-   the command \protect\usepackage{natbib} from the document}
-  \endinput}{}
-\@ifclassloaded{egs}{\PackageError{natbib}
-  {The egs class already includes natbib coding,\MessageBreak
-   so you should not add it explicitly}
-  {Type <Return> for now, but then later remove\MessageBreak
-   the command \protect\usepackage{natbib} from the document}
-  \endinput}{}
- % Define citation punctuation for some author-year styles
- % One may add and delete at this point
- % Or put additions into local configuration file natbib.cfg
-\newcommand\bibstyle@chicago{\bibpunct{(}{)}{;}{a}{,}{,}}
-\newcommand\bibstyle@named{\bibpunct{[}{]}{;}{a}{,}{,}}
-\newcommand\bibstyle@agu{\bibpunct{[}{]}{;}{a}{,}{,~}}%Amer. Geophys. Union
-\newcommand\bibstyle@egs{\bibpunct{(}{)}{;}{a}{,}{,}}%Eur. Geophys. Soc.
-\newcommand\bibstyle@agsm{\bibpunct{(}{)}{,}{a}{}{,}\gdef\harvardand{\&}}
-\newcommand\bibstyle@kluwer{\bibpunct{(}{)}{,}{a}{}{,}\gdef\harvardand{\&}}
-\newcommand\bibstyle@dcu{\bibpunct{(}{)}{;}{a}{;}{,}\gdef\harvardand{and}}
-\newcommand\bibstyle@aa{\bibpunct{(}{)}{;}{a}{}{,}} %Astronomy & Astrophysics
-\newcommand\bibstyle@pass{\bibpunct{(}{)}{;}{a}{,}{,}}%Planet. & Space Sci
-\newcommand\bibstyle@anngeo{\bibpunct{(}{)}{;}{a}{,}{,}}%Annales Geophysicae
-\newcommand\bibstyle@nlinproc{\bibpunct{(}{)}{;}{a}{,}{,}}%Nonlin.Proc.Geophys.
- % Define citation punctuation for some numerical styles
-\newcommand\bibstyle@cospar{\bibpunct{/}{/}{,}{n}{}{}%
-     \gdef\NAT@biblabelnum##1{##1.}}
-\newcommand\bibstyle@esa{\bibpunct{(Ref.~}{)}{,}{n}{}{}%
-     \gdef\NAT@biblabelnum##1{##1.\hspace{1em}}}
-\newcommand\bibstyle@nature{\bibpunct{}{}{,}{s}{}{\textsuperscript{,}}%
-     \gdef\NAT@biblabelnum##1{##1.}}
- % The standard LaTeX styles
-\newcommand\bibstyle@plain{\bibpunct{[}{]}{,}{n}{}{,}}
-\let\bibstyle@alpha=\bibstyle@plain
-\let\bibstyle@abbrv=\bibstyle@plain
-\let\bibstyle@unsrt=\bibstyle@plain
- % The author-year modifications of the standard styles
-\newcommand\bibstyle@plainnat{\bibpunct{[}{]}{,}{a}{,}{,}}
-\let\bibstyle@abbrvnat=\bibstyle@plainnat
-\let\bibstyle@unsrtnat=\bibstyle@plainnat
-\newif\ifNAT@numbers \NAT@numbersfalse
-\newif\ifNAT@super \NAT@superfalse
-\DeclareOption{numbers}{\NAT@numberstrue
-   \ExecuteOptions{square,comma,nobibstyle}}
-\DeclareOption{super}{\NAT@supertrue\NAT@numberstrue
-   \renewcommand\NAT@open{}\renewcommand\NAT@close{}
-   \ExecuteOptions{nobibstyle}}
-\DeclareOption{authoryear}{\NAT@numbersfalse
-   \ExecuteOptions{round,colon,bibstyle}}
-\DeclareOption{round}{%
-      \renewcommand\NAT@open{(} \renewcommand\NAT@close{)}
-   \ExecuteOptions{nobibstyle}}
-\DeclareOption{square}{%
-      \renewcommand\NAT@open{[} \renewcommand\NAT@close{]}
-   \ExecuteOptions{nobibstyle}}
-\DeclareOption{angle}{%
-      \renewcommand\NAT@open{$<$} \renewcommand\NAT@close{$>$}
-   \ExecuteOptions{nobibstyle}}
-\DeclareOption{curly}{%
-      \renewcommand\NAT@open{\{} \renewcommand\NAT@close{\}}
-   \ExecuteOptions{nobibstyle}}
-\DeclareOption{comma}{\renewcommand\NAT@sep{,}
-   \ExecuteOptions{nobibstyle}}
-\DeclareOption{colon}{\renewcommand\NAT@sep{;}
-   \ExecuteOptions{nobibstyle}}
-\DeclareOption{nobibstyle}{\let\bibstyle=\@gobble}
-\DeclareOption{bibstyle}{\let\bibstyle=\@citestyle}
-\newif\ifNAT@openbib \NAT@openbibfalse
-\DeclareOption{openbib}{\NAT@openbibtrue}
-\DeclareOption{sectionbib}{\def\NAT@sectionbib{on}}
-\def\NAT@sort{0}
-\DeclareOption{sort}{\def\NAT@sort{1}}
-\DeclareOption{sort&compress}{\def\NAT@sort{2}}
-\@ifpackageloaded{cite}{\PackageWarningNoLine{natbib}
-  {The `cite' package should not be used\MessageBreak
-   with natbib. Use option `sort' instead}\ExecuteOptions{sort}}{}
-\newif\ifNAT@longnames\NAT@longnamesfalse
-\DeclareOption{longnamesfirst}{\NAT@longnamestrue}
-\DeclareOption{nonamebreak}{\def\NAT@nmfmt#1{\mbox{\NAT@up#1}}}
-\def\NAT@nmfmt#1{{\NAT@up#1}}
-\renewcommand\bibstyle[1]{\@ifundefined{bibstyle@#1}{\relax}
-     {\csname bibstyle@#1\endcsname}}
-\AtBeginDocument{\global\let\bibstyle=\@gobble}
-\let\@citestyle\bibstyle
-\newcommand\citestyle[1]{\@citestyle{#1}\let\bibstyle\@gobble}
-\@onlypreamble{\citestyle}\@onlypreamble{\@citestyle}
-\newcommand\bibpunct[7][, ]%
-  {\gdef\NAT@open{#2}\gdef\NAT@close{#3}\gdef
-   \NAT@sep{#4}\global\NAT@numbersfalse\ifx #5n\global\NAT@numberstrue
-   \else
-   \ifx #5s\global\NAT@numberstrue\global\NAT@supertrue
-   \fi\fi
-   \gdef\NAT@aysep{#6}\gdef\NAT@yrsep{#7}%
-   \gdef\NAT@cmt{#1}%
-   \global\let\bibstyle\@gobble
-  }
-\@onlypreamble{\bibpunct}
-\newcommand\NAT@open{(} \newcommand\NAT@close{)}
-\newcommand\NAT@sep{;}
-\ProcessOptions
-\newcommand\NAT@aysep{,} \newcommand\NAT@yrsep{,}
-\newcommand\NAT@cmt{, }
-\newcommand\NAT@cite%
-    [3]{\ifNAT@swa\NAT@@open\if*#2*\else#2\ \fi
-        #1\if*#3*\else\NAT@cmt#3\fi\NAT@@close\else#1\fi\endgroup}
-\newcommand\NAT@citenum%
-    [3]{\ifNAT@swa\NAT@@open\if*#2*\else#2\ \fi
-        #1\if*#3*\else\NAT@cmt#3\fi\NAT@@close\else#1\fi\endgroup}
-\newcommand\NAT@citesuper[3]{\ifNAT@swa
-\unskip\hspace{1\p@}\textsuperscript{#1}%
-   \if*#3*\else\ (#3)\fi\else #1\fi\endgroup}
-\providecommand
-  \textsuperscript[1]{\mbox{$^{\mbox{\scriptsize#1}}$}}
-\providecommand\@firstofone[1]{#1}
-\newcommand\NAT@citexnum{}
-\def\NAT@citexnum[#1][#2]#3{%
- \NAT@sort@cites{#3}%
- \let\@citea\@empty
-  \@cite{\def\NAT@num{-1}\let\NAT@last@yr\relax\let\NAT@nm\@empty
-    \@for\@citeb:=\NAT@cite@list\do
-    {\edef\@citeb{\expandafter\@firstofone\@citeb}%
-     \if@filesw\immediate\write\@auxout{\string\citation{\@citeb}}\fi
-     \@ifundefined{b@\@citeb\@extra@b@citeb}{%
-       {\reset@font\bfseries?}
-        \NAT@citeundefined\PackageWarning{natbib}%
-       {Citation `\@citeb' on page \thepage \space undefined}}%
-     {\let\NAT@last@num\NAT@num\let\NAT@last@nm\NAT@nm
-      \NAT@parse{\@citeb}%
-      \ifNAT@longnames\@ifundefined{bv@\@citeb\@extra@b@citeb}{%
-        \let\NAT@name=\NAT@all@names
-        \global\@namedef{bv@\@citeb\@extra@b@citeb}{}}{}%
-      \fi
-      \ifNAT@full\let\NAT@nm\NAT@all@names\else
-        \let\NAT@nm\NAT@name\fi
-      \ifNAT@swa
-       \ifnum\NAT@ctype>1\relax\@citea
-        \hyper@natlinkstart{\@citeb\@extra@b@citeb}%
-            \ifnum\NAT@ctype=2\relax\NAT@test{\NAT@ctype}%
-            \else\NAT@alias
-            \fi\hyper@natlinkend\else
-       \ifnum\NAT@sort>1
-         \begingroup\catcode`\_=8
-            \ifcat _\ifnum\z@<0\NAT@num _\else A\fi
-              \global\let\NAT@nm=\NAT@num \else \gdef\NAT@nm{-2}\fi
-            \ifcat _\ifnum\z@<0\NAT@last@num _\else A\fi
-              \global\@tempcnta=\NAT@last@num \global\advance\@tempcnta by\@ne
-              \else \global\@tempcnta\m@ne\fi
-         \endgroup
-         \ifnum\NAT@nm=\@tempcnta
-           \ifx\NAT@last@yr\relax
-             \edef\NAT@last@yr{\@citea \mbox{\noexpand\citenumfont{\NAT@num}}}%
-           \else
-             \edef\NAT@last@yr{--\penalty\@m\mbox{\noexpand\citenumfont{\NAT@num}}}%
-           \fi
-         \else
-           \NAT@last@yr \@citea \mbox{\citenumfont{\NAT@num}}%
-           \let\NAT@last@yr\relax
-         \fi
-       \else
-         \@citea \mbox{\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
-           {\citenumfont{\NAT@num}}\hyper@natlinkend}%
-       \fi
-       \fi
-       \def\@citea{\NAT@sep\penalty\@m\NAT@space}%
-      \else
-        \ifcase\NAT@ctype\relax
-          \ifx\NAT@last@nm\NAT@nm \NAT@yrsep\penalty\@m\NAT@space\else
-          \@citea \NAT@test{1}\ \NAT@@open
-          \if*#1*\else#1\ \fi\fi \NAT@mbox{%
-          \hyper@natlinkstart{\@citeb\@extra@b@citeb}%
-          {\citenumfont{\NAT@num}}\hyper@natlinkend}%
-          \def\@citea{\NAT@@close\NAT@sep\penalty\@m\ }%
-        \or\@citea
-          \hyper@natlinkstart{\@citeb\@extra@b@citeb}%
-           \NAT@test{\NAT@ctype}\hyper@natlinkend
-          \def\@citea{\NAT@sep\penalty\@m\ }%
-        \or\@citea
-          \hyper@natlinkstart{\@citeb\@extra@b@citeb}%
-           \NAT@test{\NAT@ctype}\hyper@natlinkend
-          \def\@citea{\NAT@sep\penalty\@m\ }%
-        \or\@citea
-          \hyper@natlinkstart{\@citeb\@extra@b@citeb}%
-           \NAT@alias\hyper@natlinkend
-          \def\@citea{\NAT@sep\penalty\@m\ }%
-        \fi
-      \fi
-      }}%
-      \ifnum\NAT@sort>1\relax\NAT@last@yr\fi
-      \ifNAT@swa\else\ifnum\NAT@ctype=0\if*#2*\else
-      \NAT@cmt#2\fi \NAT@@close\fi\fi}{#1}{#2}}
-\newcommand\NAT@test[1]{\ifnum#1=1 \ifx\NAT@nm\NAT@noname
-  {\reset@font\bfseries(author?)}\PackageWarning{natbib}
-  {Author undefined for citation`\@citeb'
-   \MessageBreak
-   on page \thepage}\else \NAT@nm \fi
-  \else \if\relax\NAT@date\relax
-  {\reset@font\bfseries(year?)}\PackageWarning{natbib}
-  {Year undefined for citation`\@citeb'
-   \MessageBreak
-   on page \thepage}\else \NAT@date \fi \fi}
-\let\citenumfont=\relax
-\newcommand\NAT@citex{}
-\def\NAT@citex%
-  [#1][#2]#3{%
-  \NAT@sort@cites{#3}%
-  \let\@citea\@empty
-  \@cite{\let\NAT@nm\@empty\let\NAT@year\@empty
-    \@for\@citeb:=\NAT@cite@list\do
-    {\edef\@citeb{\expandafter\@firstofone\@citeb}%
-     \if@filesw\immediate\write\@auxout{\string\citation{\@citeb}}\fi
-     \@ifundefined{b@\@citeb\@extra@b@citeb}{\@citea%
-       {\reset@font\bfseries ?}\NAT@citeundefined
-                 \PackageWarning{natbib}%
-       {Citation `\@citeb' on page \thepage \space undefined}\def\NAT@date{}}%
-     {\let\NAT@last@nm=\NAT@nm\let\NAT@last@yr=\NAT@year
-     \NAT@parse{\@citeb}%
-      \ifNAT@longnames\@ifundefined{bv@\@citeb\@extra@b@citeb}{%
-        \let\NAT@name=\NAT@all@names
-        \global\@namedef{bv@\@citeb\@extra@b@citeb}{}}{}%
-      \fi
-     \ifNAT@full\let\NAT@nm\NAT@all@names\else
-       \let\NAT@nm\NAT@name\fi
-     \ifNAT@swa\ifcase\NAT@ctype
-       \if\relax\NAT@date\relax
-         \@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
-         \NAT@nmfmt{\NAT@nm}\NAT@date\hyper@natlinkend
-       \else
-         \ifx\NAT@last@nm\NAT@nm\NAT@yrsep
-            \ifx\NAT@last@yr\NAT@year
-              \hyper@natlinkstart{\@citeb\@extra@b@citeb}\NAT@exlab
-              \hyper@natlinkend
-            \else\unskip\
-              \hyper@natlinkstart{\@citeb\@extra@b@citeb}\NAT@date
-              \hyper@natlinkend
-            \fi
-         \else\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
-           \NAT@nmfmt{\NAT@nm}%
-           \hyper@natlinkbreak{\NAT@aysep\ }{\@citeb\@extra@b@citeb}%
-           \NAT@date\hyper@natlinkend
-         \fi
-       \fi
-     \or\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
-         \NAT@nmfmt{\NAT@nm}\hyper@natlinkend
-     \or\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
-         \NAT@date\hyper@natlinkend
-     \or\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
-         \NAT@alias\hyper@natlinkend
-     \fi \def\@citea{\NAT@sep\ }%
-     \else\ifcase\NAT@ctype
-        \if\relax\NAT@date\relax
-          \@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
-          \NAT@nmfmt{\NAT@nm}\hyper@natlinkend
-        \else
-         \ifx\NAT@last@nm\NAT@nm\NAT@yrsep
-            \ifx\NAT@last@yr\NAT@year
-              \hyper@natlinkstart{\@citeb\@extra@b@citeb}\NAT@exlab
-              \hyper@natlinkend
-            \else\unskip\
-              \hyper@natlinkstart{\@citeb\@extra@b@citeb}\NAT@date
-              \hyper@natlinkend
-            \fi
-         \else\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
-           \NAT@nmfmt{\NAT@nm}%
-           \hyper@natlinkbreak{\ \NAT@@open\if*#1*\else#1\ \fi}%
-              {\@citeb\@extra@b@citeb}%
-           \NAT@date\hyper@natlinkend\fi
-        \fi
-       \or\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
-         \NAT@nmfmt{\NAT@nm}\hyper@natlinkend
-       \or\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
-         \NAT@date\hyper@natlinkend
-       \or\@citea\hyper@natlinkstart{\@citeb\@extra@b@citeb}%
-         \NAT@alias\hyper@natlinkend
-       \fi \if\relax\NAT@date\relax\def\@citea{\NAT@sep\ }%
-           \else\def\@citea{\NAT@@close\NAT@sep\ }\fi
-     \fi
-     }}\ifNAT@swa\else\if*#2*\else\NAT@cmt#2\fi
-     \if\relax\NAT@date\relax\else\NAT@@close\fi\fi}{#1}{#2}}
-\newif\ifNAT@par \NAT@partrue
-\newcommand\NAT@@open{\ifNAT@par\NAT@open\fi}
-\newcommand\NAT@@close{\ifNAT@par\NAT@close\fi}
-\newcommand\NAT@alias{\@ifundefined{al@\@citeb\@extra@b@citeb}{%
-  {\reset@font\bfseries(alias?)}\PackageWarning{natbib}
-  {Alias undefined for citation `\@citeb'
-  \MessageBreak on page \thepage}}{\@nameuse{al@\@citeb\@extra@b@citeb}}}
-\let\NAT@up\relax
-\newcommand\NAT@Up[1]{{\let\protect\@unexpandable@protect\let~\relax
-  \expandafter\NAT@deftemp#1}\expandafter\NAT@UP\NAT@temp}
-\newcommand\NAT@deftemp[1]{\xdef\NAT@temp{#1}}
-\newcommand\NAT@UP[1]{\let\@tempa\NAT@UP\ifcat a#1\MakeUppercase{#1}%
-  \let\@tempa\relax\else#1\fi\@tempa}
-\newcommand\shortcites[1]{%
-  \@bsphack\@for\@citeb:=#1\do
-  {\edef\@citeb{\expandafter\@firstofone\@citeb}%
-   \global\@namedef{bv@\@citeb\@extra@b@citeb}{}}\@esphack}
-\newcommand\NAT@biblabel[1]{\hfill}
-\newcommand\NAT@biblabelnum[1]{\bibnumfmt{#1}}
-\newcommand\bibnumfmt[1]{[#1]}
-\def\@tempa#1{[#1]}
-\ifx\@tempa\@biblabel\let\@biblabel\@empty\fi
-\newcommand\NAT@bibsetnum[1]{\settowidth\labelwidth{\@biblabel{#1}}%
-   \setlength{\leftmargin}{\labelwidth}\addtolength{\leftmargin}{\labelsep}%
-   \setlength{\itemsep}{\bibsep}\setlength{\parsep}{\z@}%
-   \ifNAT@openbib
-     \addtolength{\leftmargin}{4mm}%
-     \setlength{\itemindent}{-4mm}%
-     \setlength{\listparindent}{\itemindent}%
-     \setlength{\parsep}{0pt}%
-   \fi
-}
-\newlength{\bibhang}
-\setlength{\bibhang}{1em}
-\newlength{\bibsep}
-{\@listi \global\bibsep\itemsep \global\advance\bibsep by\parsep}
-
-\newcommand\NAT@bibsetup%
-   [1]{\setlength{\leftmargin}{\bibhang}\setlength{\itemindent}{-\leftmargin}%
-       \setlength{\itemsep}{\bibsep}\setlength{\parsep}{\z@}}
-\newcommand\NAT@set@cites{\ifNAT@numbers
-  \ifNAT@super \let\@cite\NAT@citesuper
-     \def\NAT@mbox##1{\unskip\nobreak\hspace{1\p@}\textsuperscript{##1}}%
-     \let\citeyearpar=\citeyear
-     \let\NAT@space\relax\else
-     \let\NAT@mbox=\mbox
-     \let\@cite\NAT@citenum \def\NAT@space{ }\fi
-  \let\@citex\NAT@citexnum
-  \ifx\@biblabel\@empty\let\@biblabel\NAT@biblabelnum\fi
-  \let\@bibsetup\NAT@bibsetnum
-  \def\natexlab##1{}%
- \else
-  \let\@cite\NAT@cite
-  \let\@citex\NAT@citex
-  \let\@biblabel\NAT@biblabel
-  \let\@bibsetup\NAT@bibsetup
-  \def\natexlab##1{##1}%
- \fi}
-\AtBeginDocument{\NAT@set@cites}
-\AtBeginDocument{\ifx\SK@def\@undefined\else
-\ifx\SK@cite\@empty\else
-  \SK@def\@citex[#1][#2]#3{\SK@\SK@@ref{#3}\SK@@citex[#1][#2]{#3}}\fi
-\ifx\SK@citeauthor\@undefined\def\HAR@checkdef{}\else
-  \let\citeauthor\SK@citeauthor
-  \let\citefullauthor\SK@citefullauthor
-  \let\citeyear\SK@citeyear\fi
-\fi}
-\AtBeginDocument{\@ifpackageloaded{hyperref}{%
-  \ifnum\NAT@sort=2\def\NAT@sort{1}\fi}{}}
-\newif\ifNAT@full\NAT@fullfalse
-\newif\ifNAT@swa
-\DeclareRobustCommand\citet
-   {\begingroup\NAT@swafalse\def\NAT@ctype{0}\NAT@partrue
-     \@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
-\newcommand\NAT@citetp{\@ifnextchar[{\NAT@@citetp}{\NAT@@citetp[]}}
-\newcommand\NAT@@citetp{}
-\def\NAT@@citetp[#1]{\@ifnextchar[{\@citex[#1]}{\@citex[][#1]}}
-\DeclareRobustCommand\citep
-   {\begingroup\NAT@swatrue\def\NAT@ctype{0}\NAT@partrue
-         \@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
-\DeclareRobustCommand\cite
-    {\begingroup\def\NAT@ctype{0}\NAT@partrue\NAT@swatrue
-      \@ifstar{\NAT@fulltrue\NAT@cites}{\NAT@fullfalse\NAT@cites}}
-\newcommand\NAT@cites{\@ifnextchar [{\NAT@@citetp}{%
-     \ifNAT@numbers\else
-     \NAT@swafalse
-     \fi
-    \NAT@@citetp[]}}
-\DeclareRobustCommand\citealt
-   {\begingroup\NAT@swafalse\def\NAT@ctype{0}\NAT@parfalse
-         \@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
-\DeclareRobustCommand\citealp
-   {\begingroup\NAT@swatrue\def\NAT@ctype{0}\NAT@parfalse
-         \@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
-\DeclareRobustCommand\citeauthor
-   {\begingroup\NAT@swafalse\def\NAT@ctype{1}\NAT@parfalse
-    \@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
-\DeclareRobustCommand\Citet
-   {\begingroup\NAT@swafalse\def\NAT@ctype{0}\NAT@partrue
-     \let\NAT@up\NAT@Up
-     \@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
-\DeclareRobustCommand\Citep
-   {\begingroup\NAT@swatrue\def\NAT@ctype{0}\NAT@partrue
-     \let\NAT@up\NAT@Up
-         \@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
-\DeclareRobustCommand\Citealt
-   {\begingroup\NAT@swafalse\def\NAT@ctype{0}\NAT@parfalse
-     \let\NAT@up\NAT@Up
-         \@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
-\DeclareRobustCommand\Citealp
-   {\begingroup\NAT@swatrue\def\NAT@ctype{0}\NAT@parfalse
-     \let\NAT@up\NAT@Up
-         \@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
-\DeclareRobustCommand\Citeauthor
-   {\begingroup\NAT@swafalse\def\NAT@ctype{1}\NAT@parfalse
-     \let\NAT@up\NAT@Up
-    \@ifstar{\NAT@fulltrue\NAT@citetp}{\NAT@fullfalse\NAT@citetp}}
-\DeclareRobustCommand\citeyear
-   {\begingroup\NAT@swafalse\def\NAT@ctype{2}\NAT@parfalse\NAT@citetp}
-\DeclareRobustCommand\citeyearpar
-   {\begingroup\NAT@swatrue\def\NAT@ctype{2}\NAT@partrue\NAT@citetp}
-\newcommand\citetext[1]{\NAT@open#1\NAT@close}
-\DeclareRobustCommand\citefullauthor
-   {\citeauthor*}
-\newcommand\defcitealias[2]{%
-   \@ifundefined{al@#1\@extra@b@citeb}{}
-   {\PackageWarning{natbib}{Overwriting existing alias for citation #1}}
-   \@namedef{al@#1\@extra@b@citeb}{#2}}
-\DeclareRobustCommand\citetalias{\begingroup
-   \NAT@swafalse\def\NAT@ctype{3}\NAT@parfalse\NAT@citetp}
-\DeclareRobustCommand\citepalias{\begingroup
-   \NAT@swatrue\def\NAT@ctype{3}\NAT@partrue\NAT@citetp}
-\renewcommand\nocite[1]{\@bsphack
-  \@for\@citeb:=#1\do{%
-    \edef\@citeb{\expandafter\@firstofone\@citeb}%
-    \if@filesw\immediate\write\@auxout{\string\citation{\@citeb}}\fi
-    \if*\@citeb\else
-    \@ifundefined{b@\@citeb\@extra@b@citeb}{%
-       \NAT@citeundefined \PackageWarning{natbib}%
-       {Citation `\@citeb' undefined}}{}\fi}%
-  \@esphack}
-\newcommand\NAT@parse[1]{{%
-     \let\protect=\@unexpandable@protect\let~\relax
-     \let\active@prefix=\@gobble
-     \xdef\NAT@temp{\csname b@#1\@extra@b@citeb\endcsname}}%
-     \expandafter\NAT@split\NAT@temp
-     \expandafter\NAT@parse@date\NAT@date??????@@%
-     \ifciteindex\NAT@index\fi
-}
-\newcommand\NAT@split[4]{%
-  \gdef\NAT@num{#1}\gdef\NAT@name{#3}\gdef\NAT@date{#2}%
-  \gdef\NAT@all@names{#4}%
-  \ifx\NAT@noname\NAT@all@names \gdef\NAT@all@names{#3}\fi}
-\newcommand\NAT@parse@date{}
-\def\NAT@parse@date#1#2#3#4#5#6@@{%
-  \ifnum\the\catcode`#1=11\def\NAT@year{}\def\NAT@exlab{#1}\else
-  \ifnum\the\catcode`#2=11\def\NAT@year{#1}\def\NAT@exlab{#2}\else
-  \ifnum\the\catcode`#3=11\def\NAT@year{#1#2}\def\NAT@exlab{#3}\else
-  \ifnum\the\catcode`#4=11\def\NAT@year{#1#2#3}\def\NAT@exlab{#4}\else
-    \def\NAT@year{#1#2#3#4}\def\NAT@exlab{{#5}}\fi\fi\fi\fi}
-\newcommand\NAT@index{}
-\let\NAT@makeindex=\makeindex
-\renewcommand\makeindex{\NAT@makeindex
-  \renewcommand\NAT@index{\@bsphack\begingroup
-     \def~{\string~}\@wrindex{\NAT@idxtxt}}}
-\newcommand\NAT@idxtxt{\NAT@name\ \NAT@open\NAT@date\NAT@close}
-\@ifundefined{@indexfile}{}{\let\NAT@makeindex\relax\makeindex}
-\newif\ifciteindex \citeindexfalse
-\newcommand\citeindextype{default}
-\newcommand\NAT@index@alt{{\let\protect=\noexpand\let~\relax
-  \xdef\NAT@temp{\NAT@idxtxt}}\expandafter\NAT@exp\NAT@temp\@nil}
-\newcommand\NAT@exp{}
-\def\NAT@exp#1\@nil{\mbox{}\index[\citeindextype]{#1}}
-
-\AtBeginDocument{%
-\@ifpackageloaded{index}{\let\NAT@index=\NAT@index@alt}{}}
-\newcommand\NAT@ifcmd{\futurelet\NAT@temp\NAT@ifxcmd}
-\newcommand\NAT@ifxcmd{\ifx\NAT@temp\relax\else\expandafter\NAT@bare\fi}
-\def\NAT@bare#1(#2)#3(@)#4\@nil#5{%
-  \if @#2
-  \expandafter\NAT@apalk#1, , \@nil{#5}\else
-  \stepcounter{NAT@ctr}%
-  \NAT@wrout{\arabic {NAT@ctr}}{#2}{#1}{#3}{#5}
-\fi
-}
-\newcommand\NAT@wrout[5]{%
-\if@filesw
-      {\let\protect\noexpand\let~\relax
-       \immediate
-       \write\@auxout{\string\bibcite{#5}{{#1}{#2}{{#3}}{{#4}}}}}\fi
-\ignorespaces}
-\def\NAT@noname{{}}
-\renewcommand\bibitem{%
-  \@ifnextchar[{\@lbibitem}{%
-    \global\NAT@stdbsttrue
-    \stepcounter{NAT@ctr}\@lbibitem[\arabic{NAT@ctr}]}}
-\def\@lbibitem[#1]#2{%
-  \if\relax\@extra@b@citeb\relax\else
-    \@ifundefined{br@#2\@extra@b@citeb}{}{%
-     \@namedef{br@#2}{\@nameuse{br@#2\@extra@b@citeb}}}\fi
-   \@ifundefined{b@#2\@extra@b@citeb}{\def\NAT@num{}}{\NAT@parse{#2}}%
-   \item[\hfil\hyper@natanchorstart{#2\@extra@b@citeb}\@biblabel{\NAT@num}%
-    \hyper@natanchorend]%
-    \NAT@ifcmd#1(@)(@)\@nil{#2}}
-\ifx\SK@lbibitem\@undefined\else
-   \let\SK@lbibitem\@lbibitem
-   \def\@lbibitem[#1]#2{%
-     \SK@lbibitem[#1]{#2}\SK@\SK@@label{#2}\ignorespaces}\fi
-\newif\ifNAT@stdbst \NAT@stdbstfalse
-
-\AtEndDocument
-  {\ifNAT@stdbst\if@filesw\immediate\write\@auxout{\string
-   \global\string\NAT@numberstrue}\fi\fi
-  }
-\providecommand\bibcite{}
-\renewcommand\bibcite[2]{\@ifundefined{b@#1\@extra@binfo}\relax
-     {\NAT@citemultiple
-      \PackageWarningNoLine{natbib}{Citation `#1' multiply defined}}%
-  \global\@namedef{b@#1\@extra@binfo}{#2}}
-\AtEndDocument{\NAT@swatrue\let\bibcite\NAT@testdef}
-\newcommand\NAT@testdef[2]{%
-  \def\NAT@temp{#2}\expandafter \ifx \csname b@#1\@extra@binfo\endcsname
-    \NAT@temp \else \ifNAT@swa \NAT@swafalse
-       \PackageWarningNoLine{natbib}{Citation(s) may have
-          changed.\MessageBreak
-          Rerun to get citations correct}\fi\fi}
-\newcommand\NAT@apalk{}
-\def\NAT@apalk#1, #2, #3\@nil#4{\if\relax#2\relax
-  \global\NAT@stdbsttrue
-  \NAT@wrout{#1}{}{}{}{#4}\else
-  \stepcounter{NAT@ctr}%
-  \NAT@wrout{\arabic {NAT@ctr}}{#2}{#1}{}{#4}\fi}
-\newcommand\citeauthoryear{}
-\def\citeauthoryear#1#2#3(@)(@)\@nil#4{\stepcounter{NAT@ctr}\if\relax#3\relax
-   \NAT@wrout{\arabic {NAT@ctr}}{#2}{#1}{}{#4}\else
-   \NAT@wrout{\arabic {NAT@ctr}}{#3}{#2}{#1}{#4}\fi}
-\newcommand\citestarts{\NAT@open}
-\newcommand\citeends{\NAT@close}
-\newcommand\betweenauthors{and}
-\newcommand\astroncite{}
-\def\astroncite#1#2(@)(@)\@nil#3{\stepcounter{NAT@ctr}\NAT@wrout{\arabic
-{NAT@ctr}}{#2}{#1}{}{#3}}
-\newcommand\citename{}
-\def\citename#1#2(@)(@)\@nil#3{\expandafter\NAT@apalk#1#2, \@nil{#3}}
-\newcommand\harvarditem[4][]%
-    {\if\relax#1\relax\bibitem[#2(#3)]{#4}\else
-        \bibitem[#1(#3)#2]{#4}\fi }
-\newcommand\harvardleft{\NAT@open}
-\newcommand\harvardright{\NAT@close}
-\newcommand\harvardyearleft{\NAT@open}
-\newcommand\harvardyearright{\NAT@close}
-\AtBeginDocument{\providecommand{\harvardand}{and}}
-\newcommand\harvardurl[1]{\textbf{URL:} \textit{#1}}
-\providecommand\bibsection{}
-\@ifundefined{chapter}%
-  {\renewcommand\bibsection{\section*{\refname
-    \@mkboth{\MakeUppercase{\refname}}{\MakeUppercase{\refname}}}}}
-  {\@ifundefined{NAT@sectionbib}%
-    {\renewcommand\bibsection{\chapter*{\bibname
-     \@mkboth{\MakeUppercase{\bibname}}{\MakeUppercase{\bibname}}}}}
-    {\renewcommand\bibsection{\section*{\bibname
-     \ifx\@mkboth\@gobbletwo\else\markright{\MakeUppercase{\bibname}}\fi}}}}
-\@ifclassloaded{amsart}%
-  {\renewcommand\bibsection{\section*{\refname}}}{}
-\@ifclassloaded{amsbook}%
-  {\renewcommand\bibsection{\chapter*{\bibname}}}{}
-\@ifundefined{bib@heading}{}{\let\bibsection\bib@heading}
-\newcounter{NAT@ctr}
-\renewenvironment{thebibliography}[1]{%
- \bibsection
- \vspace{1\p@}\parindent \z@\bibpreamble\bibfont\list
-   {\@biblabel{\arabic{NAT@ctr}}}{\@bibsetup{#1}%
-    \setcounter{NAT@ctr}{0}}%
-    \ifNAT@openbib
-      \renewcommand\newblock{\par}
-    \else
-      \renewcommand\newblock{\hskip .11em \@plus.33em \@minus.07em}%
-    \fi
-    \sloppy\clubpenalty4000\widowpenalty4000
-    \sfcode`\.=1000\relax
-    \let\citeN\cite \let\shortcite\cite
-    \let\citeasnoun\cite\fontsize{7}{9}\selectfont
- }{\def\@noitemerr{%
-  \PackageWarning{natbib}
-     {Empty `thebibliography' environment}}%
-  \endlist\vskip-\lastskip}
-\let\bibfont\relax
-\let\bibpreamble\relax
-\providecommand\reset@font{\relax}
-\providecommand\bibname{Bibliography}
-\providecommand\refname{References}
-\newcommand\NAT@citeundefined{\gdef \NAT@undefined {%
-    \PackageWarningNoLine{natbib}{There were undefined citations}}}
-\let \NAT@undefined \relax
-\newcommand\NAT@citemultiple{\gdef \NAT@multiple {%
-    \PackageWarningNoLine{natbib}{There were multiply defined citations}}}
-\let \NAT@multiple \relax
-\AtEndDocument{\NAT@undefined\NAT@multiple}
-\providecommand\@mkboth[2]{}
-\providecommand\MakeUppercase{\uppercase}
-\providecommand{\@extra@b@citeb}{}
-\gdef\@extra@binfo{}
-\providecommand\hyper@natanchorstart[1]{}
-\providecommand\hyper@natanchorend{}
-\providecommand\hyper@natlinkstart[1]{}
-\providecommand\hyper@natlinkend{}
-\providecommand\hyper@natlinkbreak[2]{#1}
-\@ifundefined{bbl@redefine}{}{%
- \bbl@redefine\nocite#1{%
-  \@safe@activestrue\org@nocite{#1}\@safe@activesfalse}%
-\bbl@redefine\@lbibitem[#1]#2{%
-  \@safe@activestrue\org@@lbibitem[#1]{#2}\@safe@activesfalse}%
-}
-\AtBeginDocument{\@ifundefined{bbl@redefine}{}{%
-\bbl@redefine\@citex[#1][#2]#3{%
-  \@safe@activestrue\org@@citex[#1][#2]{#3}\@safe@activesfalse}%
-\bbl@redefine\NAT@testdef#1#2{%
-  \@safe@activestrue\org@NAT@testdef{#1}{#2}\@safe@activesfalse}%
-\@ifundefined{org@@lbibitem}{%
-\bbl@redefine\@lbibitem[#1]#2{%
-  \@safe@activestrue\org@@lbibitem[#1]{#2}\@safe@activesfalse}}{}%
-}}
-\ifnum\NAT@sort>0
-\newcommand\NAT@sort@cites[1]{%
-\@tempcntb\m@ne
-\let\@celt\delimiter
-\def\NAT@num@list{}%
-\def\NAT@cite@list{}%
-\def\NAT@nonsort@list{}%
-\@for \@citeb:=#1\do{\NAT@make@cite@list}%
-\edef\NAT@cite@list{\NAT@cite@list\NAT@nonsort@list}%
-\edef\NAT@cite@list{\expandafter\NAT@xcom\NAT@cite@list @@}}
-\begingroup \catcode`\_=8
-\gdef\NAT@make@cite@list{%
-     \edef\@citeb{\expandafter\@firstofone\@citeb}%
-    \@ifundefined{b@\@citeb\@extra@b@citeb}{\def\NAT@num{A}}%
-    {\NAT@parse{\@citeb}}%
-      \ifcat _\ifnum\z@<0\NAT@num _\else A\fi
-       \@tempcnta\NAT@num \relax
-       \ifnum \@tempcnta>\@tempcntb
-          \edef\NAT@num@list{\NAT@num@list \@celt{\NAT@num}}%
-          \edef\NAT@cite@list{\NAT@cite@list\@citeb,}%
-          \@tempcntb\@tempcnta
-       \else
-          \let\NAT@@cite@list=\NAT@cite@list \def\NAT@cite@list{}%
-          \edef\NAT@num@list{\expandafter\NAT@num@celt \NAT@num@list \@gobble @}%
-          {\let\@celt=\NAT@celt\NAT@num@list}%
-       \fi
-    \else
-       \edef\NAT@nonsort@list{\NAT@nonsort@list\@citeb,}%
- \fi}
-\endgroup
-\def\NAT@celt#1{\ifnum #1<\@tempcnta
-  \xdef\NAT@cite@list{\NAT@cite@list\expandafter\NAT@nextc\NAT@@cite@list @@}%
-  \xdef\NAT@@cite@list{\expandafter\NAT@restc\NAT@@cite@list}%
- \else
-  \xdef\NAT@cite@list{\NAT@cite@list\@citeb,\NAT@@cite@list}\let\@celt\@gobble%
- \fi}
-\def\NAT@num@celt#1#2{\ifx \@celt #1%
-     \ifnum #2<\@tempcnta
-        \@celt{#2}%
-        \expandafter\expandafter\expandafter\NAT@num@celt
-     \else
-        \@celt{\number\@tempcnta}\@celt{#2}%
-  \fi\fi}
-\def\NAT@nextc#1,#2@@{#1,}
-\def\NAT@restc#1,#2{#2}
-\def\NAT@xcom#1,@@{#1}
-\else
- \newcommand\NAT@sort@cites[1]{\edef\NAT@cite@list{#1}}\fi
-\InputIfFileExists{natbib.cfg}
-       {\typeout{Local config file natbib.cfg used}}{}
-%% 
-%% <<<<< End of generated file <<<<<<
-%%
-%% End of file `natbib.sty'.

tex/ngmlr.eval

@@ -1,38 +0,0 @@
-Q	60	23616	0	0.000000000
-Q	45	3520	1	0.000036851
-Q	41	1840	1	0.000069023
-Q	37	328	2	0.000136500
-Q	36	276	1	0.000169033
-Q	35	480	1	0.000199601
-Q	33	375	2	0.000262855
-Q	31	178	2	0.000326659
-Q	30	153	5	0.000487551
-Q	29	200	1	0.000516696
-Q	27	100	3	0.000611601
-Q	26	93	3	0.000706056
-Q	25	75	2	0.000768393
-Q	24	82	1	0.000798314
-Q	23	80	6	0.000987387
-Q	22	71	6	0.001175835
-Q	21	76	7	0.001394921
-Q	20	63	9	0.001676897
-Q	19	55	4	0.001800322
-Q	18	62	8	0.002048987
-Q	17	55	7	0.002265718
-Q	16	60	10	0.002575539
-Q	15	82	9	0.002850877
-Q	14	67	7	0.003063745
-Q	13	62	11	0.003401042
-Q	12	64	13	0.003799084
-Q	11	56	5	0.003947900
-Q	10	58	17	0.004468303
-Q	9	70	22	0.005139796
-Q	8	23	9	0.005414604
-Q	7	41	17	0.005933068
-Q	6	42	18	0.006480881
-Q	5	33	9	0.006751757
-Q	4	29	9	0.007022948
-Q	3	27	15	0.007478764
-Q	2	23	10	0.007781024
-Q	1	9	2	0.007840364
-Q	0	13	8	0.008083105

tex/roc.gp

@@ -1,52 +0,0 @@
-set t po eps enh co so "Helvetica,26"
-
-set style line 1 lt 1 pt 1 lc rgb "#e41a1c" lw 2;
-set style line 2 lt 1 pt 2 lc rgb "#377eb8" lw 2;
-set style line 3 lt 1 pt 3 lc rgb "#4daf4a" lw 2;
-set style line 4 lt 1 pt 4 lc rgb "#984ea3" lw 2;
-set style line 5 lt 1 pt 6 lc rgb "#ff7f00" lw 2;
-set style line 6 lt 1 pt 8 lc rgb "#f781bf" lw 2;
-
-set out "roc-color.eps"
-
-set pointsize 2.0
-set size 1.59,1.04
-set multiplot layout 1,2
-
-set label "(a)" at graph -0.245,1.06 font "Helvetica-bold,40"
-set xlab "Error rate of mapped reads"
-set ylab "Fraction of mapped reads" off +1.8
-set ytics 0.02
-set yran [0.9:1]
-
-set size 0.8,1
-set log x
-set format x "10^{%L}"
-set key bot right
-plot "<./eval2roc.pl blasr-mc.eval" u 2:3 t "blasr-mc" w lp ls 4, \
-     "<./eval2roc.pl bwa.eval" u 2:3 t "bwa-mem" w lp ls 2, \
-     "<./eval2roc.pl graphmap.eval" u 2:3 t "graphmap" w lp ls 3, \
-     "<./eval2roc.pl minialign.eval" u 2:3 t "minialign" w lp ls 1, \
-     "<./eval2roc.pl mm2.eval" u 2:3 t "minimap2" w lp ls 6, \
-     "<./eval2roc.pl ngmlr.eval" u 2:3 t "ngm-lr" w lp ls 5
-unset label
-
-set origin 0.8,0
-set size 0.79,1
-set label "(b)" at graph -0.245,1.06 font "Helvetica-bold,40"
-unset log
-unset format
-unset key
-set log y
-set ylab "Accumulative mapping error rate" off +0
-set xlab "Mapping quality"
-set yran [1e-5:0.1]
-set ytics 1e-5,0.1
-set format y "10^{%L}"
-set xran [60:0] reverse
-plot "<./eval2roc.pl blasr-mc.eval" u 1:2 w lp ls 4, \
-     "<./eval2roc.pl bwa.eval" u 1:2 t "bwa-mem" w lp ls 2, \
-     "<./eval2roc.pl graphmap.eval" u 1:2 t "graphmap" w lp ls 3, \
-     "<./eval2roc.pl minialign.eval" u 1:2 t "minialign" w lp ls 1, \
-     "<./eval2roc.pl mm2.eval" u 1:2 t "minimap2" w lp ls 6, \
-     "<./eval2roc.pl ngmlr.eval" u 1:2 t "ngm-lr" w lp ls 5