Compare commits

..
717 Commits
Author SHA1 Message Date
Heng Li fe35e679e9 Release minimap2-2.24 (r1122) 2021-12-26 15:14:54 -05:00
Heng Li e25aa5ee74 r1121: change bw_long to bw if bw is longer
Resolve #852
2021-12-26 14:37:31 -05:00
Heng Li 3bde3450a0 r1121: updated obsolete settings in manpage
Resolve #851
2021-12-26 14:33:14 -05:00
Heng Li 36942ff711 r1119: fixed a typo in the new chaining code
Not affecting v2.23
2021-12-25 12:46:26 -05:00
Heng Li d3a89d34d4 r1118: use -r1k,100k for asm* modes 2021-12-23 20:43:54 -05:00
Heng Li c8f0a35c40 r1117: added --no-hash-name for deterministic 2021-11-24 16:49:48 -05:00
Heng Li fcaadc22b7 r1116: cut long chains at weak points 2021-11-20 19:07:44 -05:00
Heng Li db37fc43a7 r1115: prepare for chain breaking 2021-11-20 13:42:44 -05:00
Heng Li a8f1fa8ea3 r1114: retain more candidate inversion alignments 2021-11-18 21:37:10 -05:00
Heng Li b276772890 r1112: added --print-chains for debugging 2021-11-18 21:26:41 -05:00
Heng Li d0cff3eb36 Release minimap2-2.23 (r1111) 2021-11-18 17:11:48 -05:00
Heng Li ac334639ce r1110: default --cap-kalloc=1g; test more inv
See #816 and #823
2021-10-11 14:45:15 -04:00
Heng Li 546623dcb4 r1109: disable chain_skip_scale by default
Enabling the option slows down alignment, possibly because it fragments chains
in difficult regions.
2021-10-04 21:24:35 -04:00
Heng Li 39bdd45875 r1108: fixed missing inversions for #816 and #806 2021-10-04 16:34:30 -04:00
Heng Li aefa2c0d86 added --chain-skip-scale 2021-10-01 16:58:03 -04:00
Heng Li 7ee62dae1d updated manuscript 2021-10-01 11:42:36 -04:00
Heng Li 05a8a45d44 r1105: avoid long running time occasionally (#771)
Caused by highly repetitive minimizers on a query sequence. The solution is to
filter out these query minimizers.
2021-08-15 19:43:01 -04:00
Heng Li cc14d1afdf fixed typos 2021-08-08 11:18:02 -04:00
Heng Li bb3048b2a0 removed one extra sentence 2021-08-07 16:55:02 -04:00
Heng Li 5113ca2628 improved manuscript 2021-08-07 16:01:15 -04:00
Heng Li 7358a1ead1 Release minimap2-2.22 (r1101) 2021-08-07 11:30:31 -04:00
Heng Li 32f552957e Merge remote-tracking branch 'remotes/origin/master' 2021-08-07 10:40:02 -04:00
Heng Li a05edfa5ec a different ending sentence 2021-08-07 10:38:48 -04:00
Heng Li 8e81145817 finished the first draft 2021-08-07 00:33:31 -04:00
Heng Li e37f5ffe39 finished results 2021-08-07 00:06:28 -04:00
Heng Li 8a1d52bcbe r1094: for --split-prefix update max_dp at the end 2021-08-06 21:40:43 -04:00
Heng Li f7271a7c24 expose mapQ threshold to command line of pafcmp 2021-08-06 19:41:46 -04:00
Heng Li 70393eb46e minimap2 update manuscript 2021-08-06 19:41:17 -04:00
Heng Li 9d049f0562 added pafcmp 2021-08-05 12:41:21 -04:00
Heng Li 5180b70ff3 r1090: log wall-clock time for each read 2021-08-04 17:45:09 -04:00
Heng Li 2392e54fe2 r1089: fixed an unusual memory leak (#749)
This is more apparent when there are many candidate chains. Although only a
small numbers of them are extended, they are still occupying memory. A
realloc() solves this problem. This is a long existiing issue.
2021-08-04 17:07:00 -04:00
Heng Li 629c11728e output the number of mismatches 2021-08-04 17:05:06 -04:00
Ryan Lim 59488f0271 call mm_idx_destroy at the end of loop to fix memory leak 2021-07-26 18:25:08 -04:00
Heng Li 7e33fde82b dev-r1087: added --cap-kalloc 2021-07-19 21:20:04 -04:00
Heng Li c4fe52fb07 reduced the default -l and -b 2021-07-19 17:25:11 -04:00
Heng Li ead1cfbaca output for binning 2021-07-19 14:56:33 -04:00
Heng Li 83a535f148 dev-r1084: fixed flag integer overflow 2021-07-19 11:52:18 -04:00
Heng Li f3af29a8aa don't add a new command 2021-07-19 10:57:48 -04:00
Heng Li cf7eaef367 refactor and prepare for a new command 2021-07-19 00:36:17 -04:00
Heng Li 2411887d8e rename 2021-07-19 00:30:16 -04:00
Heng Li 1a8373bb84 dev-r1080: fixed negative dp_max 2021-07-18 21:07:14 -04:00
Heng Li 161ae7ff73 dev-r1079: per-read error rate
more tuning needed
2021-07-18 20:38:53 -04:00
Heng Li 8a6edab847 dev-r1078: decoupling ranking penalty 2021-07-18 16:22:48 -04:00
Heng Li 15118dd521 output #mismatches/#dels/#ins in view 2021-07-18 15:13:40 -04:00
Heng Li 2546999639 dev-r1076: log gap penalty 2021-07-17 18:23:59 -04:00
Heng Li 52fafe0fed updated pbsim to pbsim2 2021-07-17 18:18:26 -04:00
Heng Li 5f449c5cae fixed potential integer overflows 2021-07-16 17:20:05 -04:00
Heng Li b046052d82 Merge branch 'master' into utec 2021-07-16 13:32:47 -04:00
Jason Stajich 5cc3d2239f missing target object files from Makefile.simde to fix issue #779 2021-07-07 23:07:27 -04:00
Heng Li 581f2d7123 Release minimap2-2.21 (r1071) 2021-07-06 13:18:55 -04:00
Heng Li 52dbd439bc r1080: re-versioning 2021-07-02 20:26:13 -04:00
John Marshall 260a68d232 Use #defines for CIGAR operators in C code
Give the CIGAR constants names to clarify the code. So that ksw2.h
remains self-contained, define KSW_* versions of the CIGAR operators
it needs for use within ksw2.h. Other code should in general use the
full set of MM_CIGAR_* constants in minimap.h.
2021-07-02 13:03:03 -04:00
John Marshall 177eef259d Use the full MIDNSHP=X string whenever printing CIGAR strings
Define MM_CIGAR_STR to the full string of CIGAR operators (including
the 'B' operator as well) and use it throughout the C code.

It would be possible to use it from the Cython code too, but it's easier
to keep that as a Cython string literal to avoid adding extra runtime
code to handle locale conversion.
2021-07-02 13:03:03 -04:00
Heng Li 459ce04c84 r1069: fixed a regression in comparison to v2.18
for PE short reads. An interesting omission. Resolves #776
2021-07-02 11:45:21 -04:00
Heng Li e6cce019e4 r1068: fixed a bug caused by 3f71478
Resolves #752 (again)
2021-06-30 19:20:06 -04:00
Heng Li 7025b0b941 Merge branch 'master' of github.com:lh3/minimap2 2021-06-16 10:18:40 -04:00
Heng Li fe6a0bb337 r1064: fixed another uninitialized condition
This one should also be harmless. It affects a min value, but that value is not
actually used.
2021-06-16 10:16:36 -04:00
Heng Li 3f7147864b r1063: fixed an uninitialized access (#752)
This one is harmless.
2021-06-16 09:27:30 -04:00
Torsten Houwaart c83589b9ea Update README.md
Clarification on approximate mapping
2021-06-10 09:36:39 -04:00
Heng Li ce7a59f412 Fixed a typo in README
I just hate my butterfly keyboard!
2021-05-27 15:43:04 -04:00
Heng Li 15471bd629 Release minimap2-2.20 (r1061) 2021-05-27 15:26:04 -04:00
Heng Li ca19463268 r1060: safer ways to use -rNUM1,NUM2 2021-05-27 10:55:13 -04:00
Heng Li 4f8d1bc360 r1059: with --rmq, use the larger bandwidth 2021-05-26 23:01:49 -04:00
Heng Li 1776c0c645 missing seed.c in setup.py
Ok, I am not going to re-release again...
2021-05-26 21:36:09 -04:00
Heng Li 9febf532c1 Release minimap2-2.19 (r1057) 2021-05-26 21:23:42 -04:00
Heng Li cec23131e4 fixed a python compilation error
Caused by chain.c -> lchain.c
2021-05-26 21:20:48 -04:00
Heng Li ef09ccf104 Release minimap2-2.19 (r1055) 2021-05-26 21:01:03 -04:00
Heng Li e74dfd1aa9 r1054: fixed a memory leak 2021-05-26 12:32:04 -04:00
Heng Li f31705bb4a r1053: made junceval work with PAF 2021-05-26 11:54:46 -04:00
Heng Li 41d7ccb191 r1052: default -g to 5k 2021-05-24 16:46:16 -04:00
Heng Li 34a41197d7 r1051: added two internal parameters
rmq_rescue_size and rmq_rescue_ratio
2021-05-24 16:38:45 -04:00
Heng Li 9626b3e716 r1050: -r accepts two bandwidths 2021-05-24 16:29:21 -04:00
Heng Li 379728726a r1049: removed the long-join heuristics 2021-05-24 16:21:40 -04:00
Heng Li 4f91558160 r1048: rescue long gaps 2021-05-24 16:09:09 -04:00
Heng Li ec3bc6efd7 r1047: make gap penalty proportional to k-mer
closer to the older minimap2
2021-05-24 13:18:17 -04:00
Heng Li 8ec8866100 Merge branch 'master' into dev-rmq 2021-05-23 21:01:04 -04:00
Heng Li 9e7247cff9 sync python with recent changes 2021-05-23 21:00:15 -04:00
Ariel Erijman cd66777bfb small typo 2021-05-23 13:09:55 -04:00
Heng Li 5d7d25e92d Merge remote-tracking branch 'origin/master' 2021-05-23 13:08:52 -04:00
Heng Li 2a3793bbd2 clarify that map-hifi is for HEAD only
Resolves #747
2021-05-23 13:08:15 -04:00
Heng Li f97008a10e Merge branch 'master' into dev-rmq 2021-05-20 19:36:33 -04:00
Cornelius Roemer 10502e2a78 Fixed typo in Readme.md
deltion -> deletion
2021-05-14 15:38:30 -04:00
Don Kirkby 4422c0c6f9 Typo fix in Python README.
Thanks for sharing minimap2. Here's a little fix.
2021-05-14 15:38:12 -04:00
Heng Li 42a11e1d58 Changed Travis to Github Actions in README 2021-05-10 12:58:25 -04:00
Heng Li 76df351fa8 added github action 2021-05-10 12:55:58 -04:00
Heng Li d065d3bead Merge branch 'master' into dev-rmq 2021-05-10 12:42:57 -04:00
Heng Li ac146fe7bc r1035: failed to index under the --frag=yes mode
Resolves #734
2021-05-10 12:36:48 -04:00
Heng Li 6c96078ed0 r1034: changed multiple defaults; updated manpage 2021-05-03 22:51:34 -04:00
Heng Li bbb4f97e52 support RMQ 2021-05-03 09:27:04 -04:00
Heng Li b7f4d8a0f4 removed the old minimap2 chaining 2021-05-02 18:55:37 -04:00
Heng Li e81927e7a1 prepare to backport unimap/minigraph chaining 2021-05-02 18:25:49 -04:00
Heng Li f7dc5799c5 clarify CLR when necessary 2021-05-01 15:56:33 -04:00
Heng Li 817cb81cb0 Updated README for the HiFi preset 2021-05-01 15:47:25 -04:00
Heng Li 0f5608c4a4 r1028: backport minigraph -U 2021-05-01 15:41:39 -04:00
Heng Li e8823a3709 r1027: renamed hifi to map-hifi; changed default 2021-05-01 15:22:51 -04:00
Heng Li 7edeec67b0 r1026: fixed bugs in seed sampling add hifi 2021-05-01 15:07:56 -04:00
Heng Li feb92d32ea r1025: seed rescuring 2021-04-30 17:33:16 -04:00
Heng Li cdbd96be0c a bit refactoring for future changes 2021-04-30 11:24:53 -04:00
Heng Li ba52c79024 added code of conduct 2021-04-22 17:30:30 -04:00
Heng Li cd9ccfa069 r1022: check INDEL lengths in simple cases 2021-04-11 22:07:00 -04:00
Heng Li 86b716448c larger window size for longer INDELs 2021-04-11 16:08:29 -04:00
Heng Li 9ab95be1bb update END when it is not there 2021-04-11 12:59:21 -04:00
Heng Li b51e859945 make sure ins/del match 2021-04-11 11:47:14 -04:00
Heng Li a9037dc16c r1018: scripts for SV evaluation 2021-04-11 01:08:17 -04:00
Heng Li 9729fa99ad removed mappy.c 2021-04-09 13:48:16 -04:00
Heng Li b6ff332de1 Release minimap2-2.18 (r1015) 2021-04-09 13:33:34 -04:00
Heng Li 77abafaaf3 prepare for release 2021-04-09 13:18:56 -04:00
Heng Li 507d39af15 r1013: changed to a more accurate similarity est
Based on DOI:10.1101/2021.01.15.426881. One minimap2 reviewer suggested the
right formula to me but I thought the difference would be insignificant. I was
wrong.
2021-04-08 13:57:53 -04:00
Heng Li 827ca4b461 r1012: fixed an off-by-one bug; resolves #489 2021-04-07 23:31:31 -04:00
Marcus Stoiber d3dde2fdd4 Convert from spaces to tabs. 2021-04-05 11:55:10 -04:00
Marcus Stoiber 7db2e8d21a Convert python install from build_ext to setuptools setup_requires. 2021-04-05 11:55:10 -04:00
Heng Li 0b41dd26a2 r1009: fixed a compiler warning 2021-04-05 11:43:13 -04:00
Heng Li 2b47846cd6 r1008: don't parse space in BED 2021-04-05 11:41:00 -04:00
Heng Li 67dd906a80 bump travis python version to 3.9 2021-03-23 09:12:49 -04:00
Heng Li 1b0bb7b0ba require overlap ratio when considering centromere 2021-03-11 19:11:44 -05:00
Heng Li 1c4b7e8a48 explained --junc-bed in README 2021-03-06 19:44:24 -05:00
Heng Li ecbc399fa2 improved sveval 2021-03-06 19:44:13 -05:00
Heng Li 4dfd495cc2 added sveval 2021-02-15 14:49:36 -05:00
Heng Li 194b457e79 option to print errors only 2021-02-07 12:58:03 -05:00
Heng Li 75c8933511 evaluate large-scale misjoins 2021-02-07 12:34:13 -05:00
Heng Li 1025993469 print number of errors on each read 2021-01-29 14:08:21 -05:00
Heng Li a3253d1a6b added a command for simple VCF statistics 2021-01-14 12:24:38 -05:00
Heng Li 2da649d1d7 Merge remote-tracking branch 'origin/master' 2020-11-15 18:47:15 -05:00
Heng Li f995f55610 added --mask-len for #659 2020-08-21 11:12:50 -04:00
Armin Töpfer c9874e2dc5 Initialize r->p if ez->zdropped 2020-06-12 09:22:18 -04:00
Heng Li 28a37a017a added utg error correction 2020-05-01 00:45:05 -04:00
Heng Li ccb0f7b05d added a new Makefile for simde 2020-04-25 22:43:29 -04:00
mbrcic 66db9da7d8 changed preprocessor conditionals for SIMDe 2020-04-22 19:50:59 +02:00
Heng Li cd2b19035b r987: position on for strand wrongly outputted 2020-04-22 10:31:25 -04:00
Heng Li 9c0e2c67f8 r986: don't estimate dv with --qstrand 2020-04-21 13:21:03 -04:00
Heng Li da7109fd29 r985: optionally report cs/cg on the query strand
PAF only; not well tested
2020-04-21 12:37:35 -04:00
mbrcic 2b3403f094 fix for Neon after test. 2020-04-21 02:08:21 +02:00
mbrcic 3e16e4e39d Added documentation entry for added functionality, simde and no_simd. 2020-04-21 01:36:19 +02:00
mbrcic f47e8a525e SIMDe made optional. Include paths changes for SIMDe. 2020-04-21 01:08:32 +02:00
mbrcic c172df7d2d fix for Neon 2020-04-20 21:14:15 +02:00
mbrcic 9e6fdd376b Changed sse2neon with SIMDe. Added building non-SIMD version. 2020-04-20 18:28:06 +02:00
Heng Li 29f67a1666 r982: more accurate sum; output errors 2020-04-14 16:18:53 -04:00
Heng Li adde608a42 Merge remote-tracking branch 'refs/remotes/origin/master' 2020-04-14 15:52:57 -04:00
Heng Li f10dff78dc r981: asmgene to check duplicate genes 2020-04-14 15:52:36 -04:00
Jun Aruga d97bba9f27 travis: added arm64 test. 2020-04-13 08:33:03 -04:00
Heng Li 50775362bb r980: support auNGA 2020-04-10 21:36:59 -04:00
Heng Li 0a5e386359 r979: fixed asmgene wrong report. Resolves #581. 2020-04-06 19:57:15 -04:00
Heng Li cb56fb762a Merge branch 'master' of github.com:lh3/minimap2 2020-03-22 19:17:01 -04:00
Heng Li e2451e497a r975: asmstat without CIGAR/NM 2020-03-22 19:16:43 -04:00
Jared Simpson d2de282d21 remove second definition of kstring 2020-03-02 13:18:37 -05:00
Jared Simpson 48cb80ea94 change kstring_t integer storage size
This is for compatibility with kstring_t in htslib.
2020-02-28 09:35:51 -05:00
Heng Li 6a4b9f9082 r974: more informative msg on wrong FASTQ records
Resolves #510
2020-01-21 10:56:59 -05:00
Heng Li a7a01fe5bd r973: fixed compiling errors caused 2020-01-21 10:43:31 -05:00
Heng Li 9dceae59a0 r972: renamed --alt-diff to --alt-drop 2020-01-21 10:33:39 -05:00
Heng Li 20a3987082 Merge branch 'master' into alt 2020-01-21 09:17:50 -05:00
Heng Li eb3ed6993d support ALT mapping 2020-01-21 09:17:50 -05:00
Heng Li 7996f04008 r972: fixed negative de:f caused by ambiguous base 2020-01-21 09:14:37 -05:00
Heng Li d2e14705e7 r968: allow large mini_batch; resolves #491 2020-01-18 12:24:44 -05:00
Heng Li 24f50f38e8 r967: no duplicated @SQ lines with --split-prefix
resolves #527 and #400
2020-01-18 12:01:28 -05:00
Heng Li 04e015d803 r966: minimap2 returns 1 on file failure (#532) 2020-01-18 10:58:59 -05:00
Heng Li 040f74102c r965: added --chain-gap-scale for #540 2020-01-18 10:29:33 -05:00
Heng Li cdb7857841 r963: --junc-bonus not working; resolves #513 2020-01-06 22:03:50 -05:00
Heng Li 3c0d05d272 r962: abort given wrong RG line; resolves #541 2020-01-06 21:53:21 -05:00
Heng Li 47b646acbf r961: print indexed length 2020-01-06 21:13:33 -05:00
Heng Li a79cb3e991 Merge remote-tracking branch 'origin/master' 2019-12-23 17:33:56 -05:00
Heng Li 367aed4271 added the asan and tsan targets to Makefile 2019-12-23 17:33:10 -05:00
xdudiagnoa 081df6ac7d Fix example.c seq read logic
for every idx should map all input seqs
2019-11-11 00:46:07 -05:00
Torsten Seemann a3e7a575fb Add splice:hq to --help 2019-11-11 00:45:13 -05:00
Heng Li d90583b83c r954: fixed two potential undef behaviors (#443) 2019-07-18 09:17:08 -04:00
Heng Li 7fc03b0c32 r953: krealloc is buggy
Its use in minimap2 didn't trigger the bug, so the older minimap2 is still ok.
2019-07-18 09:13:30 -04:00
John Marshall 20c104ce8d Report errno on file opening failures and I/O errors
Add the underlying operating system error (usually "No such file" or
"Out of space" respectively, but highly informative when it is not)
to these error messages.
2019-07-17 09:04:02 -04:00
Marcus Stoiber 238b6bb3ea Fix memory leak in mappy.aligner.map. 2019-07-08 09:50:54 -04:00
Heng Li e026e18439 added the description of "SA" tag. Closes #438 2019-07-01 09:18:33 -04:00
Heng Li 58c2251b18 compatibility with GenBank GTP (resolves $422) 2019-06-11 09:16:03 -04:00
Heng Li 03dc8d5d97 test if index is built for #413 2019-06-07 09:11:11 -04:00
Heng Li 5cb61f8ee6 added FAQ 2019-06-06 10:47:33 -04:00
Heng Li c16a1742a3 Er... Tavis doesn't have python 3.7. 2019-05-11 20:06:48 -04:00
Heng Li 4bd5a018c2 test python 3.7 instead of 3.6 2019-05-11 20:05:06 -04:00
Heng Li 05974c80f1 r943: allow long ref name for --split-index
Resolved #394.
2019-05-10 15:39:41 -04:00
Heng Li 7bc87b4175 Release minimap2-2.17 (r941) 2019-05-04 23:49:17 -04:00
Heng Li 6762368cf0 r940: added the splice:hq preset
for high-quality CCS/mRNA splice alignment
2019-05-04 14:00:31 -04:00
Heng Li c2aec88b84 r938: added --sam-hit-only; resolved #377 2019-04-30 22:40:36 -04:00
Heng Li 97f67a2a0a r937: enlarge mm_mapopt_t::flag to 64 bits 2019-04-30 22:30:32 -04:00
Heng Li 189555503a potentially fix issue #372
Needs someone to confirm
2019-04-30 21:49:51 -04:00
Heng Li 69af86657e r935: fixed a cigar like 5I6D7I; resolved #392 2019-04-30 21:35:24 -04:00
Heng Li 49c6d83a8e r934: --junc-bed to read BED12 2019-04-28 20:12:28 -04:00
Heng Li f64e426a5a r933: resume versioning 2019-04-28 17:05:37 -04:00
Heng Li 2bb8cbbeef updated manpage 2019-04-28 17:02:49 -04:00
Heng Li e80759c97a --junc-bed apparently working
Also fixed an issue with splice alignment in the reverse strand, though this
should have a very minor effect in practice.
2019-04-28 16:47:12 -04:00
Heng Li f4c844b143 fixed a few simple bugs and leaks 2019-04-28 16:47:12 -04:00
Heng Li be171aa2dc implemented in exts; testing is the next 2019-04-28 16:47:12 -04:00
Heng Li cdc730d573 gff2bed to output junction BED 2019-04-28 16:47:12 -04:00
Heng Li 6420acca6d BED I/O 2019-04-28 16:47:12 -04:00
John Marshall 371bc9513a SAM TLEN should be 0 when either read is unmapped
this_rid/this_pos will be copied from r_prev(=r_next)'s values when this
read is unmapped (i.e., r is NULL). In this case, we can write RNEXT as
'=' but should not calculate TLEN from these placeholder values.
Similarly when the mate is unmapped (i.e., r_next is NULL).

Fixes #365.
2019-04-05 09:36:46 -04:00
Heng Li 169216bfff manpage was wrongly marked as "dirty" 2019-02-28 15:58:12 -05:00
Heng Li 6b391e3373 Release minimap2-2.16 (r922) 2019-02-28 15:49:24 -05:00
Heng Li 55e39c2d30 r921: output unmapped reads in full PAF 2019-02-27 15:03:19 -05:00
Kevin Chan 90b7b83ec7 fix typo in command line help 2019-02-27 14:46:57 -05:00
Heng Li d431dc0181 r917: added --max-chain-iter to avoid worst case
Resolves #324
2019-02-27 14:41:01 -05:00
Heng Li ccf1680aaf make it explicit that -x is preferred for prebuilt 2019-02-27 12:43:33 -05:00
Heng Li ea84fc0a53 r917: fixed a bug in command-line parsing
Resolves #344
2019-02-27 11:22:58 -05:00
Heng Li 19208fb06b r916: support long cs in sam-to-paf conversion 2019-02-17 09:35:23 -05:00
Heng Li e02bebd96d r915: fixed a bug caused by the latest change 2019-02-14 10:04:04 -05:00
Heng Li 32ab6ce15b r914: fixed two harmless division by 0
Resolves #326
2019-02-12 19:30:49 -05:00
Heng Li 1739a260fb r913: output tag "rl", length of unseedable regs 2019-02-05 14:19:17 -05:00
Heng Li aaf3233818 added mappy.Aligner.seq_names to return seq names
Resolves #312
2019-01-29 12:53:20 -05:00
Heng Li 8b05880f73 r911: option -o to output to file (#319) 2019-01-29 10:42:20 -05:00
Heng Li eba237f39d r910: meaningful error message (#320)
when minimap2 fails to create temporary files
2019-01-29 10:29:27 -05:00
Heng Li a8e1e3cbb8 updated citation with page numbers 2019-01-26 17:59:36 -05:00
Heng Li 597212b9f3 r908: added an assertion to detect a potential bug
as in #311
2019-01-23 11:18:50 -05:00
Heng Li 30abcf3cf9 r907: copy tag "cs" in sam2paf
Resolves #310
2019-01-13 17:52:31 -05:00
Heng Li 48e230f40d r906: de tag is wrongly calculated given "N"
Resolves #309
2019-01-11 19:39:09 -05:00
Heng Li c404f49569 Release minimap2-2.15 (r905) 2019-01-10 12:34:45 -05:00
Heng Li cf2bae6e9b r904: fixed a corner-case segfault. Resolves #307. 2019-01-10 09:57:05 -05:00
Heng Li 5b2fdfff9c r895: option in asmgene to count autosomal only 2018-12-14 10:36:47 -05:00
Heng Li ea2b1c5b2a r894: added --max-qlen to filter out long query 2018-12-12 12:27:32 -05:00
Heng Li eef1cee9b7 r893: added paftools.js vcfpair 2018-12-01 18:53:03 -05:00
Heng Li 2c52364527 r892: avoid de:f:0.0000 2018-11-24 21:54:28 -05:00
Heng Li 128476efc9 r891: compute gap-compressed divergence 2018-11-24 21:50:49 -05:00
Heng Li 1b3a6a0fe5 r890: removed "register" (#261) 2018-11-19 13:57:31 -05:00
Heng Li 83a8ee7038 r888: fixed incorrect CIGAR when --eqx in use
This was caused by mm_fix_cigar() which may change query/target offset in very
rare cases. Generating EQX has to beware of this change.

Resolves #266
2018-11-18 14:22:29 -05:00
Heng Li 62bbadf668 r887: fixed a bug in asmgene 2018-11-11 21:35:19 -05:00
Heng Li 91f548b497 r886: fixed two minor typos
Resolves #264
Resolves #265
2018-11-08 12:04:14 -05:00
Heng Li cdaf46665a r885: compute dup with asmstat 2018-11-07 00:26:05 -05:00
Heng Li 6596c63dcd r884: for C++ compatibility (#261) 2018-11-06 22:07:11 -05:00
Heng Li 59f23f7579 Release minimap2-2.14 (r883) 2018-11-06 00:03:16 -05:00
Heng Li 5e55e397e9 r882: guard against -E0 (#263) 2018-11-05 23:36:12 -05:00
Heng Li 88c421e8de r881: a recent change reduces sr accuracy 2018-11-05 22:03:59 -05:00
Heng Li 3db5bfe6e5 r880: fixed false wrong FASTA/Q alert 2018-11-05 20:52:07 -05:00
Heng Li 83dfdd5f50 draft release note 2018-11-05 20:07:57 -05:00
Heng Li 8a2b1cd4c9 updated mappy for extra option max_sw_mat 2018-11-05 19:28:44 -05:00
Heng Li 1ede8ca170 r877: renamed cap-sw-mat to cap-sw-mem 2018-11-05 11:46:38 -05:00
Heng Li 13981404e2 r876: skip DP if taking too much RAM (#259) 2018-11-05 11:43:10 -05:00
Heng Li fd64dd26f6 r875: warn given incorrect FASTA/Q
resolves #252
resolves #255
2018-11-05 10:02:44 -05:00
Heng Li 24df95e4b8 r874: don't call x86_simd() so often
This takes a few percent of time in profiler.
2018-11-05 09:20:35 -05:00
Heng Li a8ee48c2ce r873: comforming to C99/C11; resolves #261 2018-11-05 08:25:07 -05:00
Heng Li 09e089c3dc r872: choose the longest isoform 2018-11-04 23:48:50 -05:00
Heng Li e46cbb7d84 r871: print erroneous genes 2018-11-04 20:37:06 -05:00
Heng Li 57ec73ec6c r870: separate <50% and <10% 2018-11-04 19:31:25 -05:00
Heng Li 9e27575387 r869: classify incomplete genes 2018-11-04 19:21:55 -05:00
Heng Li b4ad8d8bf0 added asmgene
improvements coming; not made public yet
2018-11-04 17:24:05 -05:00
Heng Li e315b9fada hidden options to control bp calculation 2018-11-04 16:36:04 -05:00
Heng Li 42baf287a4 r866: fixed a typo; resolves #262 2018-10-30 09:11:55 -04:00
Heng Li 2ceba22a7a fixed a typo in manpage 2018-10-28 11:51:02 -04:00
Heng Li 9ed56b4a25 r860: MD/cs not working with --eqx 2018-10-26 23:23:53 -04:00
Heng Li ecb6c5c36c Document --no-pairing (#256) 2018-10-23 10:00:21 -04:00
Heng Li 377c7099a8 r858: fixed a bug; resolves #254 2018-10-22 22:47:11 -04:00
Heng Li 51e2abfa60 clarify that minimap2 may miss small exons 2018-10-22 11:16:16 -04:00
Heng Li 7b0a49732e r856: wrongly reported for an unrecognized option
Resolved #250
2018-10-19 20:07:14 -04:00
Heng Li 20268a6068 updated the copyright holder 2018-10-18 11:11:17 -04:00
Heng Li d04ac068fd r852: a minor when large --end-bonus is in use
We may use a large --end-bonus to mimic end-to-end alignment. In the short-read
mode, the candidate alignment region may be out of the band, which leads to
truncated alignment.
2018-10-15 21:28:27 -04:00
Heng Li 5d5d392c02 Release minimap2-2.13 (r850) 2018-10-11 13:18:31 -04:00
Heng Li 170863e553 r849: option -P doesn't work
I don't know why I haven't found it at the beginning.
2018-10-04 16:11:59 -04:00
Heng Li 97f97306a4 r847: guard against -N0 2018-09-27 15:13:44 -04:00
Heng Li 1077b7ddc8 r846: added --hard-mask-level for #244 2018-09-27 14:46:26 -04:00
Heng Li c57b59f02f r845: log peak memory 2018-09-23 20:27:49 -04:00
Torsten Seemann 34be359e25 Add -s sample option for VCF output 2018-09-19 18:24:47 -04:00
Heng Li 8b12da8b0f removed a useless dependency (not in repo) 2018-09-17 13:59:25 -04:00
Heng Li c63a33904f r836: fixed an integer overflow
Forgot this one.
2018-09-14 23:29:31 -04:00
Heng Li 70b0fede64 r835: improved help message. Resolved #232 2018-09-14 22:29:25 -04:00
Heng Li 0b681e51e7 Merge remote-tracking branch 'remotes/origin/master' 2018-09-14 22:22:20 -04:00
Heng Li 7d80d6de4a r832: fixed outdated -L. Resolved #231 and #233 2018-09-14 22:21:33 -04:00
Chris Rands 791e89ce0f PEP8 and other minor styles changes 2018-09-12 10:58:56 -04:00
Heng Li 98c48a1c45 Fixed wrong version links in the cookbook 2018-09-03 09:07:34 -04:00
Heng Li 63d397120a removed getopt.c from MANIFEST 2018-09-01 21:30:46 -04:00
Heng Li 7998fe9906 r829: replaced musl's getopt with ketopt 2018-09-01 21:18:02 -04:00
Heng Li 3a119d606f r828: --MD to support spliced alignment 2018-08-22 10:47:45 -04:00
Heng Li a5eafb75f9 Release minimap2-2.12 (r827) 2018-08-06 12:44:39 -04:00
Heng Li 9a567e4b37 allow mappy to change scoring 2018-08-06 09:52:13 -04:00
Heng Li 8e606bcc06 added a -C5 example to Getting Started 2018-08-06 09:08:33 -04:00
Heng Li a1b7219b5d explain added parameters 2018-08-05 21:32:05 -04:00
Heng Li b0f39a1a61 r823: mappy to index a single sequence 2018-08-05 20:57:05 -04:00
Heng Li 5ab6538757 r822: added option --no-end-flt 2018-08-05 19:42:12 -04:00
Heng Li b32296e18f r821: fixed memory when -y is used 2018-07-31 15:14:37 -04:00
Heng Li 99ecdf7b5d mappy to support arm64 (#203) 2018-07-24 23:53:02 -04:00
Heng Li ff9917a1c4 r819: mappy to support cs/MD 2018-07-24 23:29:55 -04:00
Mark Bicknell 8c064a5f29 Fixed mm_idx_is_idx to return the correct result on Windows. 2018-07-17 09:16:33 -04:00
Heng Li 0e137670fc Merge branch 'split' 2018-07-15 22:24:15 -04:00
Heng Li 395c8d678a r815: fixed a memory leak 2018-07-15 22:11:32 -04:00
Heng Li 830da7fa27 r814: resumed versioning 2018-07-15 11:48:14 -04:00
Heng Li a655cbef86 print SAM header; remove tmp files 2018-07-15 11:03:18 -04:00
Heng Li 4b707aac92 working with toy examples 2018-07-15 10:55:00 -04:00
Heng Li 951c0d1d35 apparently mm_append_cigar() wastes some memory 2018-07-14 23:47:44 -04:00
Heng Li 3545e35a42 pairing in the split-idx mode 2018-07-14 23:43:34 -04:00
Heng Li f3417da838 bugfix: unmapped records are duplicated in output 2018-07-14 22:54:05 -04:00
Heng Li e5277dbf5c code backup 2018-07-14 22:52:36 -04:00
Heng Li 1a55227d5a write hits to tmp files (unfinished) 2018-07-14 12:15:10 -04:00
Heng Li 5cfa621b2d use unmapped records 2018-07-07 12:49:15 -05:00
Heng Li a609a07f8c optionally output unmapped query in PAF 2018-07-07 10:26:08 -05:00
Heng Li bcf92b3c46 compute query coverage 2018-07-06 21:52:01 -05:00
Heng Li 097378ab90 reworked break point counting 2018-07-06 09:46:26 -04:00
Heng Li 10bbbe28c5 added asmstat 2018-07-05 13:22:32 -04:00
Hyeshik Chang c92a6866f3 Release the GIL to allow native Python threading. 2018-07-05 08:00:27 -04:00
Maël Kerbiriou 6908dc59a5 --splice implied when searching for splicing sites on single strand 2018-07-05 07:41:26 -04:00
Heng Li 50dae10421 paftools call to show statistics on longer indels 2018-07-03 14:28:09 -04:00
Heng Li 0517972d02 Release minimap2-2.11 (r797) 2018-06-21 00:04:08 -04:00
Heng Li d46e68e6ad r796: don't use ssize_t 2018-06-20 12:45:27 -04:00
Heng Li 2584a4149a r295: use -r2000 for ava-ont, NOT for ava-pb 2018-06-20 12:24:43 -04:00
Heng Li 66674afd09 r794: fixed a bug in seed filtering 2018-06-20 10:26:29 -04:00
Heng Li e9ca0c9dab added __version__; resolved #165
Not sure if this is the right way. Apparently working.
2018-06-19 15:40:26 -04:00
Heng Li 7e6e8ca73f r792: fixed -Wextra warnings and resolved #184 2018-06-19 15:26:58 -04:00
Ilya Kolpakov 408e098859 fix deserialization of zero-length reference names 2018-06-19 14:46:05 -04:00
Ilya Kolpakov 57f37551f8 expose mm_idx_is_idx, mm_idx_load and mm_idx_dump 2018-06-19 14:46:05 -04:00
Ilya Kolpakov 4c66b689c3 fix serialization of empty names in mm_idx_dump 2018-06-19 14:46:05 -04:00
mvdbeek 1bde2cf076 Allow setting max_frag_len on a per alignment level 2018-06-19 14:39:30 -04:00
mvdbeek 31fc0f218a Allow setting max_frag_len parameter in Aligner class 2018-06-19 14:39:30 -04:00
Aaron Wenger 3d3bcc29a8 Fix CIGAR reallocation with --eqx
Fix the logic that calculates the number of CIGAR entries when
match "M" entries are expanded into "=" and "X".  The number
of entries depends not on the number of mismatches but rather
on the number of transitions between "=" to "X".
2018-06-19 14:37:41 -04:00
Hasindu Gamaarachchi 99dcd75f64 added support for 64 bit ARM architectures 2018-06-19 14:28:45 -04:00
Heng Li 154d2caf5b r784: support the =/X CIGAR operators (#156) 2018-05-30 16:11:22 -04:00
Heng Li a3afeec0b2 r783: reverted to r781 (#155) 2018-05-30 15:25:34 -04:00
Heng Li 3573784b4d r782: no mask a chain having long ref ovlp (#155) 2018-05-30 13:53:45 -04:00
Heng Li 872f300955 r781: fixed the buggy heapmerge (resolves #166) 2018-05-30 11:55:14 -04:00
Heng Li d7b61a039e updated citation 2018-05-30 11:11:55 -04:00
Heng Li 248158a3e1 Resolved #168: citing the manpage for cs 2018-05-30 11:03:16 -04:00
Heng Li 9f4309c376 r777: avoid skipping too many seeds 2018-05-11 10:25:18 -04:00
Heng Li 463f9309f9 Merge branch 'hot-fix' into fix-long-gap 2018-05-11 10:13:19 -04:00
Heng Li abe989e355 the previous fix on int overflow is incomplete 2018-05-11 10:12:57 -04:00
Heng Li 881b4ca3a2 r774: Merge branch 'hot-fix' into fix-long-gap 2018-05-11 10:02:17 -04:00
Heng Li 10c6dd2551 r773: fixed an integer overflow 2018-05-11 10:01:23 -04:00
Heng Li 7ec6721c44 r772: option -Y not working 2018-05-11 10:00:11 -04:00
Heng Li e61812ee55 reduced gap len to trigger bad seed filtering 2018-05-01 16:17:21 -04:00
Heng Li 734ac379bb r770: matching N bases not working properly (#155) 2018-04-30 19:55:23 -04:00
Heng Li 759f8e4ac9 r769: filter out seeds breaking long gaps 2018-04-24 15:37:37 -04:00
Heng Li aef7b0744c r768: shortened preset; added dv tag (#25)
Also added asm20 to command line help (#151)
2018-04-24 12:48:54 -04:00
Heng Li 39f836eac8 r767: don't crash when there is no "cg" (#153) 2018-04-24 12:32:37 -04:00
Heng Li cbeb86dad6 Merge remote-tracking branch 'origin/master' 2018-04-10 09:12:26 -04:00
Heng Li 372c90ceb5 r764: fixed incorrect inversion mapq (#148) 2018-04-10 09:11:49 -04:00
apregier 2e2e69107c Small bugfix for paftools.js
The bug resulted in the wrong coverage being printed in some cases.
2018-04-04 16:29:54 -04:00
Heng Li ee4cd089f7 r763: fine control long join flank len (#128) 2018-03-29 14:16:58 -04:00
Heng Li 2d7ec75d50 Release minimap2-2.10 (r761) 2018-03-27 11:45:44 -04:00
Heng Li 7938ed4893 fixed two mappy warnings 2018-03-26 15:12:54 -04:00
Heng Li 4740423afa Merge remote-tracking branch 'origin/master' 2018-03-26 14:37:17 -04:00
Heng Li 1776311a9b updated cookbook 2018-03-26 14:37:02 -04:00
Heng Li c1a3e05cb0 Merge pull request #138 from zingdle/patch-1
Fix typo in README.md
2018-03-26 07:50:39 -04:00
zingdle ecb6703d4a Update README.md
Fix typo.
TD;DR -> TL;DR
2018-03-26 14:54:52 +08:00
Heng Li 0bf97a367b r755: junceval to only evaluate chromosomes 2018-03-24 23:10:06 -04:00
Heng Li 1c504d72e4 r754: option to only change name 2018-03-23 12:27:11 -04:00
Heng Li 5ef9580b17 r753: change bandwidth in ava-ont to 2000bp 2018-03-23 10:15:23 -04:00
Heng Li 08bd2123b6 r752: option to copy comments to output (#136) 2018-03-23 10:04:33 -04:00
Heng Li 8766d286df r751: optionally output MD (#118) 2018-03-22 14:15:33 -04:00
Heng Li 623b5d9d48 r750: check puts() return (#132 & #103) 2018-03-22 11:31:58 -04:00
Heng Li 18659118cd r749: don't print version etc at low verbose 2018-03-22 11:10:55 -04:00
Heng Li d1050f4eaf r748: optionally to use system getopt() (#134) 2018-03-19 11:18:26 -04:00
Heng Li b81d45510e Revision v2 2018-03-16 11:18:06 -04:00
Heng Li d135feb1a5 response to reviewers' comments, round 2 2018-03-15 21:59:57 -04:00
Heng Li 242ff4e91d r745: junceval - recognize "-" as file name 2018-03-15 12:51:46 -04:00
Heng Li 7a0c1316ce added more examples to cookbook 2018-03-12 22:24:22 -04:00
Heng Li 77ebd479f4 r743: added VCF output to "call" 2018-03-12 21:51:31 -04:00
Heng Li e3f226a9d9 working on section "Full-Genome Alignment"
found an apparent bug in paftools.js call. To debug...
2018-03-12 16:12:18 -04:00
Heng Li bdc615c1d4 r741: added --min-occ-floor to improve #107 2018-03-12 14:32:27 -04:00
Heng Li ad1beaf255 backup; not finished 2018-03-12 13:20:25 -04:00
Heng Li de0480ac5b finished section "Read Overlap" 2018-03-12 13:05:51 -04:00
Heng Li f2866533a8 finished "mapping genomic reads" 2018-03-12 12:50:21 -04:00
Heng Li 0173850ef0 don't use bullets - they are hard to read 2018-03-12 12:42:13 -04:00
Heng Li acea3594fb updated cookbook 2018-03-12 12:39:57 -04:00
Heng Li f78a247749 Started to work on a cookbook 2018-03-12 12:00:44 -04:00
Heng Li ccaf12e1a2 r734: removed debugging print in call() 2018-03-09 23:46:21 -05:00
Heng Li 96b132c97d fixed a bug/typo in Aligner.seq() (#126) 2018-03-08 19:12:12 -05:00
Heng Li 70428ca3a8 speedup tag parsing for sam2paf 2018-03-02 10:17:55 -05:00
Heng Li 9aea79d621 faster tag parsing 2018-03-02 10:09:14 -05:00
Heng Li 1770988627 make calling work with sam2paf output 2018-03-02 10:03:06 -05:00
Heng Li 2bfdad34bb minor cleanup to last commit 2018-03-02 01:07:37 -05:00
Heng Li 953766cedd generate cs; not carefully tested 2018-03-02 00:14:55 -05:00
Heng Li dc61301d9f sam2paf cleanup 2018-03-01 21:58:12 -05:00
Heng Li 19e05a099d for clarity 2018-03-01 18:25:29 -05:00
Heng Li 0238caa8b1 clarify minimap2 not working for >2Gbp seq #129 2018-03-01 18:23:40 -05:00
Heng Li a22ebb9836 use SSE compiler flags more precisely (#127) 2018-02-26 09:51:01 -05:00
Heng Li eeb314edd6 Release minimap2-2.9 (r720) 2018-02-24 09:31:09 -05:00
Heng Li 83c57a9d98 r719: fixed bad memory access 2018-02-23 17:27:41 -05:00
Heng Li 24a4808826 r718: retrieve sequence from the index 2018-02-23 10:18:26 -05:00
Heng Li 29ed675ee5 bugfix: in-place revcomp() not working 2018-02-20 11:05:54 -05:00
Heng Li 7dc7097208 added reverse complement 2018-02-20 09:41:25 -05:00
Heng Li f434653432 added peakrss(); not used for now 2018-02-17 20:40:31 -05:00
Heng Li 090361c25b fixed a typo in mappy (#117) 2018-02-16 21:10:57 -05:00
Heng Li e1f18690f6 paftools-r713: fixed bug for cov1 regions 2018-02-16 12:20:46 -05:00
Heng Li 54a42aafe5 keep documents in sync 2018-02-15 17:21:09 -05:00
Heng Li 8fc5f8dc90 r711: assign proper mapq to primary inversions 2018-02-15 14:34:59 -05:00
Heng Li a0d62519c1 r710: fixed incorrect inversion coordinate (#112) 2018-02-15 14:23:42 -05:00
Heng Li b71c01b316 added test data for inversions 2018-02-15 11:04:27 -05:00
Heng Li 1372977a37 r708: implemented double Z-drop thresholds (#112)
When aligning long reads, we would prefer to align through low-quality
regions. This requires a large Z-drop threshold. However, to find small
inversions, we need to use a small Z-drop. This commit address this
conflict with two Z-drop thresholds. When Z-drop exceeds the smaller
threshold, we perform a local alignment to check if there is a potential
inversion. If there is one, we break the alignment; otherwise we break
the alignment only if Z-drop excess the larger threshold.

This commit also fixes a bug that reported wrong coordinates when the
inversion is on the forward strand (#112).
2018-02-15 10:50:49 -05:00
Heng Li c0e0d5d84b r707: bugfix for inversions on rev strand (#112) 2018-02-14 14:09:03 -05:00
Heng Li b328795051 r706: don't segfault upon wrong FASTA/Q (#111)
The lack of robustness cost me several hours to identify.
2018-02-13 10:00:22 -05:00
Heng Li 3b17d62ccd minor doc improvements 2018-02-12 22:27:02 -05:00
Heng Li 874b8c4795 rework misc/README; progressing but unfinished 2018-02-12 22:06:05 -05:00
Heng Li 7ef5490884 r703: added --max-clip-ratio
still testing the option
2018-02-12 13:29:18 -05:00
Heng Li f66de7df59 updated paftools revision number to r702 2018-02-12 11:39:04 -05:00
Heng Li fbbd4e0968 changed output messages for clarity 2018-02-12 11:32:32 -05:00
Heng Li 8c89ba005e merged cnt-feat into paftools 2018-02-12 11:29:42 -05:00
Heng Li 50775a1e6f added liftOver
tested on a few toy examples
2018-02-12 11:12:23 -05:00
Heng Li 87cf650168 r697: fixed wrong #mapped reads in junceval 2018-02-09 18:45:57 -05:00
Heng Li 6e65c5e631 Revision 1 2018-02-09 17:39:02 -05:00
Heng Li a58b05a61b extend the section on genome alignment 2018-02-09 13:59:00 -05:00
Heng Li 42dab6319b don't call SNPs involving 'n' 2018-02-09 13:27:17 -05:00
Heng Li 8428809369 convert MUMmer's delta to PAF 2018-02-09 12:14:28 -05:00
Heng Li 642af5591e merged intron-eval into paftools 2018-02-09 11:07:14 -05:00
Heng Li 2025a6279a merged gff2bed and mapstat to paftools 2018-02-09 10:47:12 -05:00
Heng Li 3465b04724 merged a few converters to paftools 2018-02-09 10:23:30 -05:00
Heng Li 66c5e71fa8 merging scripts into one long script 2018-02-09 10:00:35 -05:00
Heng Li 01560f1db0 Revision v1, to be submitted 2018-02-07 11:07:08 -05:00
Heng Li 39535565ee first round of revision 2018-02-06 16:19:22 -05:00
Heng Li a8d476c6ad r686: end seed trimming don't go over long join 2018-02-06 11:31:32 -05:00
Heng Li 29b4a1786c r685: tune end seed filter again 2018-02-05 11:48:22 -05:00
Heng Li dbf284b2d9 r684: separate end score from min_chain_score 2018-02-05 11:40:38 -05:00
Heng Li 3df5015668 General doc improvements 2018-02-02 21:45:46 -05:00
Heng Li 756379bf83 Documented paf2diff.js (more to come later) 2018-02-02 14:43:58 -05:00
Heng Li 41fd8a966a Documented ov-eval.js 2018-02-02 14:18:18 -05:00
Heng Li 86e4933b1a Added TOC 2018-02-02 14:12:30 -05:00
Heng Li a633a744b6 more doc in misc 2018-02-02 14:07:17 -05:00
Heng Li ddc31f57ba Documented some k8 scripts; more coming 2018-02-02 13:57:08 -05:00
Heng Li 35d3e064bf r677: reduce the change of missing hits
that are close to end of alignments. It is still possible to create examples
that fail the heuristic.
2018-02-02 10:35:33 -05:00
Heng Li 997ab9bb2e Fixed the description of --dual 2018-02-01 15:11:51 -05:00
Heng Li 53ce317e59 Release minimap2-2.8 (r672) 2018-02-01 12:50:20 -05:00
Heng Li da6947cfa3 r671: cleanup command line options 2018-01-31 13:59:52 -05:00
Heng Li 46d6349af4 r670: added PE support to mappy
and minor code cleanup
2018-01-31 11:33:08 -05:00
Heng Li 12a5a5fa3c r669: improved self chain extension (#10)
This has not fully resolved #10, only alleviated the issue.
2018-01-30 20:05:02 -05:00
Heng Li ad18fa490d fixed typos 2018-01-30 10:11:50 -05:00
Heng Li 43bfa6199d r667: warn if one query file has fewer records #92 2018-01-28 17:36:21 -05:00
Heng Li 72b9b0e3b6 r666: report if >=3 query files in SR mode #92 2018-01-28 17:15:57 -05:00
Heng Li 6205fa6f21 document --heap-sort 2018-01-26 15:15:40 -05:00
Heng Li d676a5314b r664: use --heat-sort for sr by default 2018-01-26 12:25:42 -05:00
Heng Li dfc78b39d3 refactor the old sorting 2018-01-26 09:37:48 -05:00
Heng Li 7b57c9a619 heap sort working on MT 2018-01-26 09:21:45 -05:00
Heng Li 123bc1d91d put option operations in another file 2018-01-26 08:38:37 -05:00
Heng Li dd18307e66 code backup 2018-01-25 21:52:49 -05:00
Heng Li 543fa12e68 r659: for C++ compatibility 2018-01-19 10:40:18 -05:00
Heng Li af1a871270 r658: gives a warning if -N0 is used 2018-01-19 08:33:20 -05:00
Heng Li 2b71181a37 r657: check -p (#96)
Well, in principle, every option should be checked. Will do when someone raise
issues...
2018-01-19 01:03:38 -05:00
Heng Li 0454e6be91 explain -M in the manpage 2018-01-18 11:47:11 -05:00
Heng Li 33f8157961 r655: options to map to one strand of the ref #91 2018-01-16 10:34:30 -05:00
Heng Li eecc06086f Released minimap2-2.7 (r654) 2018-01-09 13:16:00 -05:00
Heng Li dfea113f28 r653: the last change may write "N" wrongly 2018-01-08 11:33:53 -05:00
Heng Li 1842d7f5b5 allow to exclude regions 2018-01-07 22:35:56 -05:00
Heng Li f5cfd439ee r651: incorrectly treat introns as deletions
This happened when the last operation during backtracking is an intron.
2018-01-07 19:42:50 -05:00
Heng Li 248b43cc47 work with targets in BED12 2018-01-07 19:39:25 -05:00
Heng Li bf72969ab1 added a bed counter
I know there are tools for this purpose, but they don't quite meet my exact
need.
2018-01-07 15:19:18 -05:00
Heng Li 7b5a601d48 support paired-end reads
this gives unnecessary warnings, which will be fixed later.
2018-01-07 13:53:26 -05:00
Heng Li 405d531100 don't test python v3.3 2018-01-05 22:17:00 -05:00
Heng Li e9607fcd9b allow to convert read names
ONT read names are just too long and too hard to compress
2018-01-05 22:05:15 -05:00
Heng Li a465a920ec bug in block starts; added color and short-name 2018-01-05 21:45:56 -05:00
Heng Li b20839be77 more robust ID conversion 2018-01-05 17:55:24 -05:00
Heng Li 209beb9955 convert EnsEMBL to UCSC name (optional) 2018-01-05 17:41:18 -05:00
Heng Li cfe87f50c1 convert GTF/GFF3 to BED12 2018-01-05 17:10:43 -05:00
Heng Li 680b971bb0 deleted duplicated entries 2018-01-01 19:52:21 -05:00
Heng Li 6b0d3c1fa8 added PHONY and comments to makefile 2017-12-30 20:54:11 -05:00
Heng Li dc9e3dcf4a r639: changed -O/-E validation 2017-12-30 20:39:29 -05:00
Heng Li cc75c12905 r638: disabled scoring checking
I haven't figured out the exact bounds...
2017-12-30 07:50:40 -05:00
Heng Li f159e1c2d3 new section on HPC k-mers 2017-12-24 19:11:23 -05:00
Heng Li 3a375d3436 renamed paf2ovlp to ov-eval 2017-12-24 18:04:00 -05:00
Heng Li 626f10e0d0 evaluate sensitivity in the same script 2017-12-24 17:55:42 -05:00
Heng Li b997578078 find reads overlaps based on reference alignment 2017-12-24 17:20:27 -05:00
Heng Li ce8a48d715 fixed two minor typos in references 2017-12-24 13:14:47 -05:00
Heng Li 99879e9e75 a new section on estimating sequence divergence 2017-12-24 12:57:38 -05:00
Heng Li c969d1a1ce updated direct RNA-seq results; cite syndip
and a few minor changes
2017-12-24 11:06:17 -05:00
Heng Li fcac296c4a clarify ARM-NEON support in README 2017-12-18 23:01:44 -05:00
Heng Li e420b17496 r629: API to construct index from strings 2017-12-18 22:29:46 -05:00
Heng Li 23a846c594 Merge pull request #81 from hasindu2008/master
minimap2 on ARM processors
2017-12-16 09:40:41 -05:00
Hasindu Gamaarachchi 8995e2e078 added support for arm neon 2017-12-15 17:42:19 +11:00
Heng Li ab345e600b r626: function to check incorrect scoring system 2017-12-13 12:23:43 -05:00
Heng Li d003a00d71 r625: HPC sketch still has one minor issue 2017-12-13 09:40:42 -05:00
Heng Li ae85dcde76 added esterr.o dependencies 2017-12-13 09:01:48 -05:00
Heng Li eb819c29e8 Release minimap2-2.6 (r623) 2017-12-12 11:09:59 -05:00
Heng Li fb630de40a r622: fixed bug in sdust due to recent refactor 2017-12-11 15:32:28 -05:00
Heng Li 43960a8ca7 r621: --print-qname also shows kalloc status 2017-12-11 12:30:08 -05:00
Heng Li f6608fe99c r620: revamped thread-local memory management
* Don't preallocate sdust_buf or minizer list. kalloc should be fast enough -
  benchmarks needed to confirm.

* Fixed a memory leak caused by divergence estimate (post v2.5)

* Reset the kalloc buffer after mapping a long query. This reduces peak memory
  when large chunks of memory are allocated, at the cost of performance, though.
2017-12-11 12:11:10 -05:00
Heng Li 98a6e52c06 r618: heuristics to avoid tiny terminal exons 2017-12-11 00:57:55 -05:00
Heng Li 824712a4ee r617: removed some unused code 2017-12-10 17:54:50 -05:00
Heng Li 0e42628ef6 r611: document --idx-no-seq; better inv aln 2017-12-08 13:16:18 -05:00
Heng Li 98a999fe44 r611: added pseudocount when est divergence 2017-12-08 12:57:57 -05:00
Heng Li fec7bd713f r610: warning if db sequence is 0-lengthed (#69) 2017-12-07 21:05:39 -05:00
Heng Li 2f693e8ca4 r609: bugfix - SDUST masking not working 2017-12-07 11:45:38 -05:00
Heng Li 704ff9f4c6 r607: estimate sequence divergence
Currently using the simplest method. There may be a more accurate estimate.
2017-12-06 16:14:39 -05:00
Heng Li 68c63f2d68 r606: fixed a sketch bug for long 256bp k-mer
sketch() writes {-1,-1} to the output array.
2017-12-06 16:13:29 -05:00
Heng Li 76206f574f support both SAM and PAF as input 2017-12-02 21:57:19 -05:00
Heng Li e575f884e1 convert spliced PAF to BED 2017-12-02 21:23:41 -05:00
Heng Li 571161d5a2 changed badges 2017-12-01 16:16:27 -05:00
Heng Li 07d41efc2b explain secondary/supplementary aln for RNA-seq 2017-11-30 23:02:20 -05:00
Heng Li 984f7846c0 r601: bugfix - a similar issue to r600
This bug unsets the alignment score of suboptimal alignments.
2017-11-30 11:51:34 -05:00
Heng Li af1d6afba9 r600: bugfix - missing secondary alignments (#71)
This should very rarely happen to typical data, but has a higher chance in
artifactual data.
2017-11-30 11:34:10 -05:00
Heng Li cbdb6c069f when there are incorrect anno, warn but not abort 2017-11-24 12:48:49 -05:00
Heng Li 35b6d9f7d5 direct manpage to HTML 2017-11-24 11:05:20 -05:00
Heng Li 39a9666246 convert PAF to LAST's cigar output
also added the support of BLAST-like output for "--cs=short".
2017-11-18 20:30:44 -05:00
Heng Li 662d05dc02 fixed incorrect var coordinate 2017-11-12 20:25:33 -05:00
Heng Li 379457c18b use mapq threshold 2017-11-12 19:01:34 -05:00
Heng Li 03169d590b print cov-1 regions (not BED output any more) 2017-11-12 18:45:49 -05:00
Heng Li 8c8d446820 find regions covered by one contig 2017-11-12 18:41:01 -05:00
Heng Li 0ddb064f17 dnadiff-like script; improvement coming 2017-11-12 15:07:29 -05:00
Heng Li 131cfc6938 r574: build index without sequences 2017-11-11 21:38:38 -05:00
Heng Li 2f463b1db0 r573: prepare to generalize index 2017-11-11 19:54:06 -05:00
Heng Li 3b518271ee Release minimap2-2.5 (r572) 2017-11-11 11:29:28 -05:00
Heng Li 481d8239e9 Merge pull request #57 from cjw85/strand_typo
Fix typo in strand property
2017-11-10 20:36:19 -05:00
cwright 4f77b0c1ed Fix typo in strand property 2017-11-11 01:18:44 +00:00
Heng Li d7a31e40e6 r569: last commit is buggy 2017-11-09 23:20:41 -05:00
Heng Li dd18cd75de r568: revert - don't take max(dp_max, dp_score) 2017-11-09 23:12:48 -05:00
Heng Li 99a2709913 r567: minor change to #56 2017-11-09 19:17:45 -05:00
Heng Li 032068a747 Merge pull request #56 from mvdbeek/softclipping
Implement -Y for soft clipping of supp. alignments
2017-11-09 19:12:47 -05:00
mvdbeek 1cb0bf4bef Implement -Y for soft clipping of supp. alignments
I tried to base this on bwa-mem and it seems to work for sam alignments.
2017-11-09 19:22:36 +01:00
Heng Li 422b43374e Merge pull request #55 from martinghunt/fix_python3_strings
Bug fix with byte strings in Python3
2017-11-09 09:37:41 -05:00
martinghunt 29a26e3eea Bug fix with byte strings in Python3 2017-11-09 13:57:15 +00:00
Heng Li a7b38f6900 r562: fixed a severe bug: wrong query start 2017-11-08 22:31:05 -05:00
Heng Li e896c9ec05 r559: prefer a chain involving more segments 2017-11-08 13:22:16 -05:00
Heng Li 98ba8928c6 r558: dp_max no less than dp_score 2017-11-08 10:06:10 -05:00
Heng Li bcf8462d20 Merge pull request #52 from cvdelannoy/patch-1
Update README.md
2017-11-08 07:50:31 -05:00
Carlos de Lannoy c047c852ce Update README.md
25: changed -x ava-one to -x ava-ont
2017-11-08 13:07:01 +01:00
Heng Li b24d68ae9f r557: fixed another mapq underestimate
When a chain is split during base-level alignment, its chaining score is
reduced. However, the chaining score of its suboptimal chain remains the same.
This leads to underestimated mapping quality.
2017-11-07 23:20:49 -05:00
Heng Li 65deedfa96 r556: bugfix - underestimate mapq for split aln 2017-11-07 22:37:12 -05:00
Heng Li 21a46ba652 Release minimap2-2.4 (r555) 2017-11-06 12:54:02 -05:00
Heng Li 1617b87ee1 this will become version 3 at arXiv 2017-11-06 10:57:12 -05:00
Heng Li 2191ac58ad two discussion paragraphs; need one more 2017-11-05 12:27:52 -05:00
Heng Li fa5a645ca5 r552: fixed a tiny typo on struct packing
The old packing wastes memory, thought very small.
2017-11-05 08:27:26 -05:00
Heng Li c2b09356b8 moved conclusion to result; need new discussion 2017-11-04 22:19:46 -04:00
Heng Li a3f0aa1d5b r550: fixed -L issues with secondary and supp aln 2017-11-04 12:13:38 -04:00
Heng Li 52ffbc9e0c added bowtie2 and snap versions 2017-11-02 15:51:23 -04:00
Heng Li a9790c0f1d added two bowtie2 numbers for comparison 2017-11-02 15:44:48 -04:00
Heng Li d0ac78ac08 updated the tech note 2017-11-02 15:37:24 -04:00
Heng Li 22290db3e4 r546: minor mapQ tuning 2017-11-01 13:20:39 -04:00
Heng Li cd24dc8834 r545: removed option -i, not working well 2017-10-31 22:23:27 -04:00
Heng Li b8e758df0f r544: increased PE mapQ 2017-10-31 16:55:02 -04:00
Heng Li 311fa90030 r543: applied some sr mapq changes to long reads 2017-10-31 15:24:05 -04:00
Heng Li fb8a1b5536 r542: tuning mapQ calculation 2017-10-31 14:25:09 -04:00
Heng Li 7f11f4c4d4 Instructions on different long RNA-seq techs 2017-10-29 13:58:25 -04:00
Heng Li 285eb0da05 r540: removed a buggy debugging line 2017-10-29 00:02:41 -04:00
Heng Li 192217a10c r539: use --splice-flank=yes by default
In human/mouse, the GTr..yAG pattern occurs to 91/92% of all GT-AG introns.
Modeling r..y clearly leads to higher accuracy. However, in SIRV, this
percentage is reduced to ~60%. The default "--splice --splice-flank=yes"
leads to lower accuracy. If someone benchmark minimap2 on SIRV, this would be
bad, but minimap2 is developed for practical applications, not for benchmarks.
I will live with that.
2017-10-28 22:29:55 -04:00
Heng Li f22a94e868 r538: fixed a long existing bug in HPC k-mer (#47)
This bug may lead to a wrong minimizer when a HPC k-mer is longer than 256bp.
When there is a seed match involving this wrong HPC k-mer, the correct seed
sequences do not match in fact. This violates the assumption in align.c and
subsequently causes a segfault, which is what #47 has caught. This bug lurked
in the earliest piece of code and affected all released minimap2 versions so
far. It is extremely rare and does not affect the prebuilt GRCh37/38 indices.
2017-10-28 19:21:10 -04:00
Heng Li 79b0caca95 r537: model the next base to GT/AG
[PMID:18688272] shows that the base following GT tends to be A or G (i.e. R) in
both human and yeast, and that the base preceeding AG tends to be C or T (i.e.
Y). In the new model, we pay no cost to GTr..yAG, but we pay half of the cost
if there is no r or y. This improves the junction accuracy when mapping to
human and mouse and decreases the accuacy when mapping to SIRV. My guess is
that SIRV does not honor this trend. Need to investigate in future.

Also in this commit, --cost-non-gt-ag is aliased to -C. The default is changed
to 9 instead of 5. I also added --splice-flank to enable the above model. This
may become the default once I confirm my hypothesis on SIRV.
2017-10-28 00:25:01 -04:00
Heng Li afc2f2e84b r536: removed an unnecessary assert() 2017-10-24 21:08:54 -04:00
Heng Li e6f66f2f3b disabled download counts
seems not working any more
2017-10-24 14:40:08 -04:00
Heng Li 70735098e2 fixed a typo in README 2017-10-24 14:39:33 -04:00
Heng Li d4b5dfc297 r533: added --no-pairing
to prevent the use of any pairing information for paired-end reads.
2017-10-23 14:09:32 -04:00
Heng Li 5acd709524 updated the download link to v2.3 2017-10-23 13:43:31 -04:00
Heng Li 306e4541f8 Released minimap2-2.3 (r531) 2017-10-22 23:13:35 -04:00
Heng Li 1dd221ad82 a bit more on short read mapping
The tech note still needs improvement. Will do that after the release of v2.3.
2017-10-22 18:38:35 -04:00
Heng Li c6b6392b70 minor wording changes 2017-10-21 23:46:36 -04:00
Heng Li dc37aee881 minor wording changes 2017-10-21 23:38:05 -04:00
Heng Li 37e627aa98 note on long cigar in README 2017-10-21 22:28:06 -04:00
Heng Li beeb806829 r526: fixed a bug when HPC is in use
It happened when the query HPC minimizer is longer than the reference HPC
minimizer close to the beginning of a contig. We may get a negative coordinate,
which causes an assertion failure.
2017-10-21 19:54:04 -04:00
Heng Li be7f3c4ffe r525: fixed a bug in chaining; handle ovlp ends 2017-10-20 21:34:52 -04:00
Heng Li bd04372873 r524: reverted to bwa-mem end bonus
and reduced the cost of clipping when filtering by identity
2017-10-20 16:57:31 -04:00
Heng Li 15ed0712c2 r523: fixed a performance bug in ksw2_ll
Wont' affect accuracy.
2017-10-20 13:00:10 -04:00
Heng Li 55dcbefe87 updated text (unfinished) 2017-10-20 12:44:54 -04:00
Heng Li 8abba332ad replaced mapQ plot with sr roc
figure legend and text to be updated later
2017-10-19 23:43:17 -04:00
Heng Li 4683da2455 r520: added option -L to write long cigar to CG 2017-10-17 17:32:44 -04:00
Heng Li ffd953029f r519: fixed a severe bug that misses long alns 2017-10-17 15:52:36 -04:00
Heng Li 04cf4ebf5e r518: increased the default -K to 500M
This helps multi-thread performance for ultra-long reads.
2017-10-17 13:21:29 -04:00
Heng Li 25ffd72690 r517: replaced --print-2nd with --secondary 2017-10-17 11:41:56 -04:00
Heng Li aa2d9d4e1b r516: throw a warning if -N0 is used 2017-10-16 14:55:35 -04:00
Heng Li addb61bcb2 r515: more conservative hit exclusion
When a hit covers a long query subsequence that has not been covered by better
primary hits, this hit is more likely to become a new primary hit.
2017-10-16 13:58:01 -04:00
Heng Li b24c9c90c7 updated mappy and example.c 2017-10-16 11:15:07 -04:00
Heng Li adf6cd7f52 r513: merged pre- and post-cigar blen and mlen
This saves a bit memory and is cleaner.
2017-10-16 10:55:18 -04:00
Heng Li e6f525edaf r512: option to filter poorly aligned reads 2017-10-16 10:38:22 -04:00
Heng Li 858213d513 r511: fixed wrong primary sam record 2017-10-12 23:02:18 -04:00
Heng Li dea3b60918 r510: fixed an off-by-1 bug for unmapped mate 2017-10-12 17:31:13 -04:00
Heng Li 7c555f9b7e r508: use two I/O threads for mapping
-x sr applies this option by default
2017-10-12 14:56:01 -04:00
Heng Li 2801ed9b4b r507: -K not working as is intended (#36) 2017-10-12 14:16:05 -04:00
Heng Li 27025c70a7 added evaluation scripts to README 2017-10-12 12:55:10 -04:00
Heng Li 9bafbe4e70 added Getting help and cs 2017-10-12 12:40:52 -04:00
Heng Li ce06188203 r506: fixed a memory leak 2017-10-12 10:12:22 -04:00
Heng Li 9862a75cd3 r505: a bit code simplification 2017-10-11 21:54:32 -04:00
Heng Li 3073f4a758 r504: better heuristics to reduce excessive ext 2017-10-11 21:42:11 -04:00
Heng Li ba6ddda6b0 Merge pull request #35 from mcshane/sam_fix
fix sam output for some unmapped queries
2017-10-11 20:09:16 -04:00
Heng Li 9364bc64d7 r501: added end_bonus to extz2 2017-10-11 09:39:41 -04:00
Shane McCarthy 5498565157 fix sam output for some unmapped queries 2017-10-11 08:46:24 +01:00
Heng Li 65abdb8f3c r500: temporarily disabled region trunc
because it is causing other problems.
2017-10-11 00:16:04 -04:00
Heng Li 7345621759 r499: end bonus working; DP region needs improve! 2017-10-11 00:14:25 -04:00
Heng Li ca632f907b r498: fixed a bug when merging like "4I5I" 2017-10-10 21:22:37 -04:00
Heng Li 6c78a980b6 r497: the previous change not working at the ends 2017-10-10 17:32:28 -04:00
Heng Li c217eecdb7 r496: avoid DP extending into another chain
When deciding the region for DP, exclude regions in the adjacent chain
2017-10-10 17:25:12 -04:00
Heng Li 13b66aad4d r495: fix impropriate CIGAR
1. Not left aligned
2. In one case, 50M24D50M becomes 24D100M. The leading D needs to be removed.
3. Avoid identical hits after DP
2017-10-10 11:59:44 -04:00
Heng Li 46fa520db9 r494: simpler and better SR gap filling
Still one thing to do: left alignment
2017-10-09 22:02:30 -04:00
Heng Li 1e53610fb4 r493: reduced calling extd2 for ungapped aln
Still need to improve in case of 3I5M3D
2017-10-09 21:13:34 -04:00
Heng Li 9396d9e11b r452: typo in the last commit 2017-10-09 10:05:32 -04:00
Heng Li 198849a716 r491: an ambiguous base costs the same as gap ext 2017-10-09 09:59:42 -04:00
Heng Li 9fea4d16b3 r490: improved short-read extension heuristic
Now we find the best scoring ungapped seeded segment and then extend from it.
There is no gap filling for short reads.
2017-10-08 21:36:34 -04:00
Heng Li f9415628a8 r489: don't use approximate zdrop
it doesn't work well
2017-10-08 19:29:09 -04:00
Heng Li 61e56c941d r488: parameter to control max fragment length 2017-10-07 23:54:32 -04:00
Heng Li f150257a0d r487: demote "map10k"; improved README 2017-10-07 19:19:40 -04:00
Heng Li bf2d4f7aec r486: treat "U" as "T" for RNA reads (#33) 2017-10-07 18:53:25 -04:00
Heng Li 47b86e765b minor wording changes 2017-10-06 15:34:20 -04:00
Heng Li 56acf6ee28 completed README rewrite 2017-10-06 14:26:02 -04:00
Heng Li 4f6244bd4a revamped README; not finished yet 2017-10-06 13:02:25 -04:00
Heng Li c6384ed2c8 r482: increased short-read bandwidth to 100
This has very minor effect on speed.
2017-10-06 10:20:32 -04:00
Heng Li 2833a9c255 150bp mason2 simulation 2017-10-06 09:46:59 -04:00
Heng Li de2fcc1bf3 updated the mappy 2017-10-05 17:10:07 -04:00
Heng Li e0baf1ad54 r479: a bit code cleanup 2017-10-05 16:15:14 -04:00
Heng Li f266092699 r478: simplied useless code, a tiny bit 2017-10-05 15:56:00 -04:00
Heng Li 9c5767f9ed r477: renamed multi_seg to frag_mode 2017-10-05 15:48:17 -04:00
Heng Li ae2adf04d4 r476: multi-file fragment mode working 2017-10-05 15:39:26 -04:00
Heng Li b839758335 r475: added --cs=none; updated manpage 2017-10-05 15:27:37 -04:00
Heng Li f4a5d3a692 r474: replaced -S and --cs-no-equal with --cs 2017-10-05 15:03:03 -04:00
Heng Li 3ff6eda3a4 r473: don't count introns into blen 2017-10-05 14:37:21 -04:00
Heng Li 1a90bc8603 r472: fixed a bug when printing MAPQ/CIGAR 2017-10-05 12:46:11 -04:00
Heng Li abf2a90363 r471: all SAM features implemented; more tests! 2017-10-05 12:37:30 -04:00
Heng Li 5ab99eb26e more accurate SAM flag 2017-10-05 10:59:38 -04:00
Heng Li 7cc4f6f965 r469: first step towards PE SAM 2017-10-05 10:38:09 -04:00
Heng Li 16e6e589a8 r468: replaced ^ with ~ in cs 2017-10-04 22:17:12 -04:00
Heng Li 9aba11769c r467: added : (equal length) and ^ (intron) ops 2017-10-04 21:55:37 -04:00
Heng Li 7d50e646dd r466: detect multi-part index more smartly
though it might not work in an extremely rare case: the end of a sequence ends
at X*16384 and it is the last sequence in a batch. This can be resolved by
never letting the kstream_t buffer empty.
2017-10-04 17:32:58 -04:00
Heng Li 1554149158 r465: apply option -x before other options 2017-10-04 13:52:28 -04:00
Heng Li 19c39e704f r464: fixed a bug in pairing, due to randomization 2017-10-04 13:37:40 -04:00
Heng Li 2581c44a21 r463: optionally disable secondary hits 2017-10-04 13:24:41 -04:00
Heng Li 5babf41a38 r462: SAM primary flag not properly set 2017-10-04 13:11:29 -04:00
Heng Li 2a1e738a94 r461: randomize repetitive hits 2017-10-04 13:05:18 -04:00
Heng Li cf55c84056 r460: added option --no-long-join 2017-10-04 12:08:44 -04:00
Heng Li 841763ec24 Merge branch 'master' into sr 2017-10-04 11:42:44 -04:00
Heng Li 95eb1dec36 r458: fixed wrong chr for inversion aln (#30) 2017-10-04 11:32:06 -04:00
Heng Li 0fd0f2aed1 r457: fixed a bug on parsing -f 2017-09-30 00:00:44 -04:00
Heng Li ee9b2773a8 r456: min chain score should >k-mer length
or chain_dp() wastes time on unnecessarily sorting chains with one k-mer.
2017-09-29 22:33:55 -04:00
Heng Li 340483821e r455: set max_occ on command line 2017-09-29 22:18:43 -04:00
Heng Li 04fb2c2ec0 r454: rechain with higher max_occ if no good chain 2017-09-29 19:24:32 -04:00
Heng Li 0d4ecd19ee r453: avoid duplicated strcmp() for ava 2017-09-28 15:52:05 -04:00
Heng Li 0c63325985 r452: fixed - -G not working with -x sr 2017-09-28 14:28:12 -04:00
Heng Li 2a554a92e9 r451: changed rep_len mapq heuristic 2017-09-28 14:23:14 -04:00
Heng Li 935a6e6064 r450: differentiate exact repeats via mapq 2017-09-27 23:51:05 -04:00
Heng Li a13691d00d eval script works with /[12] in SAM 2017-09-27 23:33:59 -04:00
Heng Li 8301222174 r448: fixed a bug when computing PE quality 2017-09-27 21:54:07 -04:00
Heng Li 9541052564 r447: paired-end mapping quality
not as good as I would hope...
2017-09-27 15:39:25 -04:00
Heng Li 7e0d70bfd3 r445: pair coordinate adjustment working
Next: mapq adjustment, which will be tricky...
2017-09-27 15:38:18 -04:00
Heng Li a349d85280 r444: changed the way orientation is specified
The old model doesn't work with RF or RR orientation. The new model only works
with paired-end reads. For >2 segments, only FF is supported.
2017-09-27 12:33:10 -04:00
Heng Li f611edf6f2 r443: don't filter small cm for split seg 2017-09-26 16:17:58 -04:00
Heng Li 1b1dd0cd57 r442: default max_gap to 200 in the sr mode 2017-09-26 13:31:01 -04:00
Heng Li 92ec8bd859 added the /1 or /2 suffix 2017-09-26 12:04:35 -04:00
Heng Li 55d1e4f638 r440: better chain filtering for PE reads 2017-09-26 11:03:36 -04:00
Heng Li 64c0ad6b35 r439: use splice-like chain gap cost between segs
This improves accuracy
2017-09-25 16:04:38 -04:00
Heng Li 9538c985aa r438: fixed a rare case that leads to missing hits
It is a bug in chaining.
2017-09-25 14:59:34 -04:00
Heng Li 8f25cfa36e r437: fixed uninialized memory on rep_len 2017-09-25 14:22:45 -04:00
Heng Li 81008dd371 r436: working on short reads
The result is mixed - lots of room for tuning
2017-09-25 14:06:29 -04:00
Heng Li 3bb66e1ed3 multi-seg working on toy examples 2017-09-25 13:42:04 -04:00
Heng Li a742f10164 get multi-seg code ready; probably not working yet 2017-09-24 15:17:17 -04:00
Heng Li f0951141a1 allow to read multiple files interleaved 2017-09-24 14:33:05 -04:00
Heng Li 84bbc47152 two arrays should be freed with kfree(0,)
though in the current code, they are strictly equivalent.
2017-09-23 10:43:22 -04:00
Heng Li 5400191097 get batch sequence reader ready for paired-end 2017-09-22 09:56:31 -04:00
Heng Li ef84e8b4e7 Merge branch 'master' into sr 2017-09-20 23:56:06 -04:00
Heng Li 1c948e0d1d added GMAP iso-seq numbers 2017-09-20 23:54:02 -04:00
Heng Li 997011458c fixed uninitialized value due to last commit 2017-09-20 15:10:48 -04:00
Heng Li 19d8eca3a1 moved array shrinking into chain_dp() 2017-09-20 14:58:57 -04:00
Heng Li 9943e5fdd0 backup 2017-09-20 14:35:46 -04:00
Heng Li 5b39a1b34b Merge branch 'master' into sr 2017-09-20 12:24:08 -04:00
Heng Li e3b5802b2e r424: reduce memory for long query seqs 2017-09-20 12:22:13 -04:00
Heng Li 03d6894517 backup 2017-09-20 11:47:46 -04:00
Heng Li 645db3350e Merge branch 'master' into sr 2017-09-20 11:15:14 -04:00
Heng Li 75e6bbc9f6 r421: removed the MM_F_SPLICE_BOTH mode
In the default splice mode, minimap2 applies two rounds of spliced alignment:
first assuming GT-AG to be the splice signal across all splicing sites and then
assuming CT-AC to be the signal. This is the idea strategy.

In the MM_F_SPLICE_BOTH mode, minimap2 applies one round of spliced alignment,
assuming GT-AG and CT-AC to be the splice signals AT THE SAME TIME. This will
be faster but less accurate. I don't think anyone would like to run minimap2 in
this mode, so I am removing it for clarity.
2017-09-20 11:11:53 -04:00
Heng Li 7a9b4db874 replaced --approx-ext with --sr
--sr disables Z-drop and may come with other heurstics
2017-09-20 10:51:18 -04:00
Heng Li 4979e66ff0 Merge branch 'master' into sr 2017-09-20 10:20:31 -04:00
Heng Li a686461e83 added github downloads counts 2017-09-20 10:11:58 -04:00
Heng Li fd14618e61 no effective changes 2017-09-20 10:11:05 -04:00
Heng Li 5caadc28b4 Merge branch 'master' into sr 2017-09-19 22:31:14 -04:00
Heng Li 56014ba3db avoid assertion failure given 0-length reads 2017-09-19 22:30:32 -04:00
Heng Li b99c22840f r414: avoid assertion failure for 0-length reads 2017-09-19 22:21:27 -04:00
Heng Li c04420698e fixed an uninitialized value 2017-09-19 16:21:21 -04:00
Heng Li fb1bcc0084 early exploration 2017-09-19 16:18:28 -04:00
Heng Li 11081c6c27 r411: refactored kalloc for clarity
The new version is closer to K&R's original implementation.
2017-09-18 19:49:15 -04:00
Heng Li 60485790b4 updated version number in README 2017-09-17 20:25:54 -04:00
Heng Li ea5a0cd17d Release minimap2-2.2 (r409) 2017-09-17 20:08:47 -04:00
Heng Li ffff953e2c added python version badge 2017-09-17 17:15:55 -04:00
Heng Li 48705e9bfa don't build for python-3.0 (unavailable in travis) 2017-09-17 17:07:42 -04:00
Heng Li cf93e5c0a1 more functional minimap2.py; added categories 2017-09-17 17:06:39 -04:00
Heng Li 0b660c70e2 syntax error 2017-09-17 16:02:06 -04:00
Heng Li 5715c423ff exposed timer and verbose-level to mappy 2017-09-17 15:21:36 -04:00
Heng Li c8a019fae8 exposed fasta/q reader to mappy 2017-09-17 14:41:59 -04:00
Heng Li e9c57f6d8b r402: exposed kseq (for API in mappy later) 2017-09-17 13:09:16 -04:00
Heng Li 3edf2a9130 renamed mm2-lite.py to minimap2.py 2017-09-17 09:41:37 -04:00
Heng Li 89151b2588 added python 3.6 test 2017-09-17 00:55:31 -04:00
Heng Li cc0a538bd3 try python3 in travis 2017-09-17 00:49:16 -04:00
Heng Li e9e86f5a48 try python build again 2017-09-17 00:46:39 -04:00
Heng Li c0779f0359 revert to the old travis
can't get cython working...
2017-09-17 00:40:18 -04:00
Heng Li 875ea06302 install cython with travis 2017-09-17 00:37:09 -04:00
Heng Li 2c7007a11b try again 2017-09-17 00:31:15 -04:00
Heng Li fc87b767ba travis for python (test) 2017-09-17 00:28:34 -04:00
Heng Li dba8b50ee9 change python version to rc1 2017-09-17 00:08:54 -04:00
Heng Li d5012a1b17 this is embarrassing: rename again to mappy 2017-09-17 00:05:30 -04:00
Heng Li eaaf53c9b8 bumped version number
due to conflict with PyPI (already uploaded)
2017-09-16 23:51:49 -04:00
Heng Li ef46a8aed4 remaining minimap2=>mmappy in doc 2017-09-16 23:49:02 -04:00
Heng Li 28fd3d63fd renamed module name from minimap2 to mmappy
minimap2 clashed with minimap2 from conda
2017-09-16 23:29:41 -04:00
Heng Li 06b79c4a52 Merge branch 'master' of github.com:lh3/minimap2 2017-09-16 22:53:34 -04:00
Heng Li 8cdaae0935 fixed a few typos
eh... a missing fix
2017-09-16 22:53:24 -04:00
Heng Li 38aa9aa9a7 eh... a missing fix 2017-09-16 22:52:52 -04:00
Heng Li f8cb865ec5 fixed a few typos 2017-09-16 22:52:26 -04:00
Heng Li 1d90742b35 fixed hyperlink 2017-09-16 22:46:30 -04:00
Heng Li 5103cea7d3 load python README.rst into setup.py 2017-09-16 22:43:52 -04:00
Heng Li 7da9a08a6f reformat 2017-09-16 22:36:19 -04:00
Heng Li ddc2c6f279 change to rst for PyPI 2017-09-16 22:29:52 -04:00
Heng Li 7e98b18ba2 for python3 compatibility 2017-09-16 20:37:49 -04:00
Heng Li 3544c60c71 allow to test if index is present 2017-09-16 20:09:17 -04:00
Heng Li 6b66ec6167 minor 2017-09-16 19:55:33 -04:00
Heng Li cb7fb77bb9 python documentation 2017-09-16 19:50:52 -04:00
Heng Li 322e5a16e5 minor tweaks to python 2017-09-16 18:11:43 -04:00
Heng Li 10bd4079d1 fixed a bug on rev strand; added example 2017-09-16 17:51:13 -04:00
Heng Li b22703a354 improvement to the python binding 2017-09-16 11:14:01 -04:00
Heng Li 7e34bea7ab minor 2017-09-16 09:30:00 -04:00
Heng Li c07f9f9a49 r372: default mm_verbose to 1, and change in main 2017-09-16 09:14:34 -04:00
Heng Li 446bde214d first python version 2017-09-16 08:44:47 -04:00
Heng Li 5966e5d6e4 make reader_open() work even if idxopt is NULL 2017-09-15 11:29:49 -04:00
Heng Li 14b853499f r369: updated example with the latest API 2017-09-14 22:44:10 -04:00
Heng Li 75ff7ceec5 r368: API documentation 2017-09-14 22:23:04 -04:00
Heng Li e2823d4aee r367: index reader optionally writes index 2017-09-14 21:18:13 -04:00
Heng Li eb00521d9b redesigned indexing and option APIs 2017-09-14 17:02:01 -04:00
Heng Li 0f7455cefa r365: documented the "sr" preset 2017-09-14 12:57:21 -04:00
Heng Li 4d3768bf26 r364: improved the mapq heuristics
* use repetitive seed lengths, not counts
* compute n_sub to higher accuracy
* use bwa-mem mapq heuristic as a backup

For short single-end reads, minimap2's ROC is not as good as bwa-mem's, but is
close.
2017-09-14 12:37:03 -04:00
Heng Li 47e9d76ca1 further mapq tuning 2017-09-14 10:46:14 -04:00
Heng Li f4a8766283 r362: fixed overestimated chaining score
Caused by ilog2_32(0)=-1. This bug was fixed once and reoccurred as I was
tuning the score function but forgot to apply the fix.
2017-09-14 10:15:22 -04:00
Heng Li 6a82a21dee r361: improved mapq for short reads 2017-09-13 15:32:39 -04:00
Heng Li 3c91d652dd r360: allow to set integer max occ 2017-09-13 11:37:00 -04:00
Heng Li 1b44275802 Merge branch 'master' into sr 2017-09-13 11:10:23 -04:00
Heng Li 2f2b11624a reverted to the Travis badge as it is faster 2017-09-13 10:50:03 -04:00
Heng Li cb57bd6146 updated badges 2017-09-13 10:46:25 -04:00
Heng Li 885db1233d updated badges
for fun
2017-09-13 10:29:41 -04:00
Heng Li 2bf2f137dd added a license badge 2017-09-13 10:03:15 -04:00
Heng Li 8706f6bdf8 Merge branch 'master' into sr 2017-09-12 22:37:46 -04:00
Heng Li 2028e8c266 show bioconda version 2017-09-12 16:21:49 -04:00
Heng Li 0cc8d277ba changed to the "install with conda" badge 2017-09-12 16:20:01 -04:00
Heng Li 14f0cce4e2 malformatted conda badge 2017-09-12 16:17:07 -04:00
Heng Li 8ddbf7169f added bioconda download link 2017-09-12 16:16:26 -04:00
Heng Li d7f2ac1d4f better parameters for short reads
It turns out the key problem is not the minimizer density. It is the max
occurrence that tends to affect results more, especially sensitivity. There is
still lots of work to do, but for now, it seems a good start.
2017-09-12 16:11:23 -04:00
Heng Li eea9e851d8 Merge branch 'dev' into short 2017-09-11 09:32:28 -04:00
Heng Li c7c3585531 r347: merged mm_map_frag() into mm_map()
mm_map_frag() was separated due to an earlier design that has been rejected.
2017-09-10 15:02:55 -04:00
Heng Li 87a278d06a Merge branch 'dev' into short 2017-09-09 08:49:58 -04:00
Heng Li 59c822b722 removed some commented code
which *might* return at some time later
2017-09-09 08:38:39 -04:00
Heng Li f422175e4e r344: avoid unnecessary refName retrieval 2017-09-08 22:44:14 -04:00
Heng Li 709b6ec1f1 increase seed occurrences 2017-09-08 22:42:39 -04:00
Heng Li 0031158936 Merge branch 'master' into short 2017-09-07 11:41:32 -04:00
Heng Li f9ccc522cd Merge branch 'master' into short 2017-09-03 11:58:15 -04:00
Heng Li c4080aaf7e Merge branch 'master' into short 2017-08-28 07:02:22 +08:00
Heng Li 079ec0d283 r271: added "short" preset; for testing only 2017-08-07 15:30:05 -04:00
82 changed files with 14765 additions and 3188 deletions
+21
View File
@@ -0,0 +1,21 @@
name: CI
on:
push:
branches:
- master
pull_request:
jobs:
build:
runs-on: ubuntu-latest
strategy:
matrix:
compiler: [gcc, clang]
steps:
- name: Checkout minimap2
uses: actions/checkout@v2
- name: Compile with ${{ matrix.compiler }}
run: make CC=${{ matrix.compiler }}
+2
View File
@@ -4,3 +4,5 @@
*.a
*.o
*.dSYM
minimap2
mappy.c
+3
View File
@@ -0,0 +1,3 @@
[submodule "lib/simde"]
path = lib/simde
url = https://github.com/nemequ/simde.git
+24 -5
View File
@@ -1,5 +1,24 @@
language: c
compiler:
- gcc
- clang
script: make
matrix:
include:
- language: c
compiler: gcc
script: make
- language: c
compiler: clang
script: make
- arch: arm64
language: c
compiler: gcc
script: make arm_neon=1 aarch64=1
- language: python
python: "2.7"
before_install: pip install cython
script: python setup.py build_ext
- language: python
python: "3.5"
before_install: pip install cython
script: python setup.py build_ext
- language: python
python: "3.9"
before_install: pip install cython
script: python setup.py build_ext
+46
View File
@@ -0,0 +1,46 @@
#### 1. Alignment different with option `-a` or `-c`?
Without `-a`, `-c` or `--cs`, minimap2 only finds *approximate* mapping
locations without detailed base alignment. In particular, the start and end
positions of the alignment are impricise. With one of those options, minimap2
will perform base alignment, which is generally more accurate but is much
slower.
#### 2. How to map Illumina short reads to noisy long reads?
No good solutions. The better approach is to assemble short reads into contigs
and then map noisy reads to contigs.
#### 3. The output SAM doesn't have a header.
By default, minimap2 indexes 4 billion reference bases (4Gb) in a batch and map
all reads against each reference batch. Given a reference longer than 4Gb,
minimap2 is unable to see all the sequences and thus can't produce a correct
SAM header. In this case, minimap2 doesn't output any SAM header. There are two
solutions to this issue. First, you may increase option `-I` to, for example,
`-I8g` to index more reference bases in a batch. This is preferred if your
machine has enough memory. Second, if your machines doesn't have enough memory
to hold the reference index, you can use the `--split-prefix` option in a
command line like:
```sh
minimap2 -ax map-ont --split-prefix=tmp ref.fa reads.fq
```
This second approach uses less memory, but it is slower and requires temporary
disk space.
#### 4. The output SAM is malformatted.
This typically happens when you use nohup to wrap a minimap2 command line.
Nohup is discouraged as it breaks piping. If you have to use nohup, please
specify an output file with option `-o`.
#### 5. How to output one alignment per read?
You can use `--secondary=no` to suppress secondary alignments (aka multiple
mappings), but you can't suppress supplementary alignment (aka split or
chimeric alignment) this way. You can use samtools to filter out these
alignments:
```sh
minimap2 -ax map-out ref.fa reads.fq | samtools view -F0x900
```
However, this is discouraged as supplementary alignment is informative.
+2 -1
View File
@@ -1,6 +1,7 @@
The MIT License
Copyright (c) 2017 Broad Institute, Inc.
Copyright (c) 2018- Dana-Farber Cancer Institute
2017-2018 Broad Institute, Inc.
Permission is hereby granted, free of charge, to any person obtaining
a copy of this software and associated documentation files (the
+10
View File
@@ -0,0 +1,10 @@
include *.h
include Makefile
include ksw2_dispatch.c
include main.c
include README.md
include sse2neon/emmintrin.h
include python/cmappy.h
include python/cmappy.pxd
include python/mappy.pyx
include python/README.rst
+77 -28
View File
@@ -1,18 +1,40 @@
CC= gcc
CFLAGS= -g -Wall -O2 -Wc++-compat
CFLAGS= -g -Wall -O2 -Wc++-compat #-Wextra
CPPFLAGS= -DHAVE_KALLOC
INCLUDES=
OBJS= kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o index.o chain.o align.o hit.o map.o format.o ksw2_ll_sse.o
OBJS= kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o options.o index.o \
lchain.o align.o hit.o seed.o map.o format.o pe.o esterr.o splitidx.o \
ksw2_ll_sse.o
PROG= minimap2
PROG_EXTRA= sdust minimap2-lite
LIBS= -lm -lz -lpthread
ifeq ($(sse2only),)
ifeq ($(arm_neon),) # if arm_neon is not defined
ifeq ($(sse2only),) # if sse2only is not defined
OBJS+=ksw2_extz2_sse41.o ksw2_extd2_sse41.o ksw2_exts2_sse41.o ksw2_extz2_sse2.o ksw2_extd2_sse2.o ksw2_exts2_sse2.o ksw2_dispatch.o
else
else # if sse2only is defined
OBJS+=ksw2_extz2_sse.o ksw2_extd2_sse.o ksw2_exts2_sse.o
endif
else # if arm_neon is defined
OBJS+=ksw2_extz2_neon.o ksw2_extd2_neon.o ksw2_exts2_neon.o
INCLUDES+=-Isse2neon
ifeq ($(aarch64),) #if aarch64 is not defined
CFLAGS+=-D_FILE_OFFSET_BITS=64 -mfpu=neon -fsigned-char
else #if aarch64 is defined
CFLAGS+=-D_FILE_OFFSET_BITS=64 -fsigned-char
endif
endif
ifneq ($(asan),)
CFLAGS+=-fsanitize=address
LIBS+=-fsanitize=address
endif
ifneq ($(tsan),)
CFLAGS+=-fsanitize=thread
LIBS+=-fsanitize=thread
endif
.PHONY:all extra clean depend
.SUFFIXES:.c .o
.c.o:
@@ -22,8 +44,8 @@ all:$(PROG)
extra:all $(PROG_EXTRA)
minimap2:main.o getopt.o libminimap2.a
$(CC) $(CFLAGS) main.o getopt.o -o $@ -L. -lminimap2 $(LIBS)
minimap2:main.o libminimap2.a
$(CC) $(CFLAGS) main.o -o $@ -L. -lminimap2 $(LIBS)
minimap2-lite:example.o libminimap2.a
$(CC) $(CFLAGS) $< -o $@ -L. -lminimap2 $(LIBS)
@@ -31,53 +53,80 @@ minimap2-lite:example.o libminimap2.a
libminimap2.a:$(OBJS)
$(AR) -csru $@ $(OBJS)
sdust:sdust.c getopt.o kalloc.o kalloc.h kdq.h kvec.h kseq.h sdust.h
$(CC) -D_SDUST_MAIN $(CFLAGS) $< getopt.o kalloc.o -o $@ -lz
sdust:sdust.c kalloc.o kalloc.h kdq.h kvec.h kseq.h ketopt.h sdust.h
$(CC) -D_SDUST_MAIN $(CFLAGS) $< kalloc.o -o $@ -lz
# SSE-specific targets on x86/x86_64
ifeq ($(arm_neon),) # if arm_neon is defined, compile this target with the default setting (i.e. no -msse2)
ksw2_ll_sse.o:ksw2_ll_sse.c ksw2.h kalloc.h
$(CC) -c $(CFLAGS) -msse2 $(CPPFLAGS) $(INCLUDES) $< -o $@
endif
ksw2_extz2_sse41.o:ksw2_extz2_sse.c ksw2.h kalloc.h
$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
ksw2_extz2_sse2.o:ksw2_extz2_sse.c ksw2.h kalloc.h
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
$(CC) -c $(CFLAGS) -msse2 -mno-sse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
ksw2_extd2_sse41.o:ksw2_extd2_sse.c ksw2.h kalloc.h
$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
ksw2_extd2_sse2.o:ksw2_extd2_sse.c ksw2.h kalloc.h
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
$(CC) -c $(CFLAGS) -msse2 -mno-sse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
ksw2_exts2_sse41.o:ksw2_exts2_sse.c ksw2.h kalloc.h
$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
ksw2_exts2_sse2.o:ksw2_exts2_sse.c ksw2.h kalloc.h
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
$(CC) -c $(CFLAGS) -msse2 -mno-sse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
ksw2_dispatch.o:ksw2_dispatch.c ksw2.h
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
# NEON-specific targets on ARM
ksw2_extz2_neon.o:ksw2_extz2_sse.c ksw2.h kalloc.h
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_SSE2_ONLY -D__SSE2__ $(INCLUDES) $< -o $@
ksw2_extd2_neon.o:ksw2_extd2_sse.c ksw2.h kalloc.h
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_SSE2_ONLY -D__SSE2__ $(INCLUDES) $< -o $@
ksw2_exts2_neon.o:ksw2_exts2_sse.c ksw2.h kalloc.h
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_SSE2_ONLY -D__SSE2__ $(INCLUDES) $< -o $@
# other non-file targets
clean:
rm -fr gmon.out *.o a.out $(PROG) $(PROG_EXTRA) *~ *.a *.dSYM session*
rm -fr gmon.out *.o a.out $(PROG) $(PROG_EXTRA) *~ *.a *.dSYM build dist mappy*.so mappy.c python/mappy.c mappy.egg*
depend:
(LC_ALL=C; export LC_ALL; makedepend -Y -- $(CFLAGS) $(CPPFLAGS) -- *.c)
# DO NOT DELETE
align.o: minimap.h mmpriv.h bseq.h ksw2.h kalloc.h
bseq.o: bseq.h kseq.h
chain.o: minimap.h mmpriv.h bseq.h kalloc.h
align.o: minimap.h mmpriv.h bseq.h kseq.h ksw2.h kalloc.h
bseq.o: bseq.h kvec.h kalloc.h kseq.h
esterr.o: mmpriv.h minimap.h bseq.h kseq.h
example.o: minimap.h kseq.h
format.o: kalloc.h mmpriv.h minimap.h bseq.h
getopt.o: getopt.h
hit.o: mmpriv.h minimap.h bseq.h kalloc.h
index.o: kthread.h bseq.h minimap.h mmpriv.h kvec.h kalloc.h khash.h
format.o: kalloc.h mmpriv.h minimap.h bseq.h kseq.h
hit.o: mmpriv.h minimap.h bseq.h kseq.h kalloc.h khash.h
index.o: kthread.h bseq.h minimap.h mmpriv.h kseq.h kvec.h kalloc.h khash.h
index.o: ksort.h
kalloc.o: kalloc.h
ksw2_extd2_sse.o: ksw2.h kalloc.h
ksw2_exts2_sse.o: ksw2.h kalloc.h
ksw2_extz2_sse.o: ksw2.h kalloc.h
ksw2_ll_sse.o: ksw2.h kalloc.h
main.o: bseq.h minimap.h mmpriv.h getopt.h
map.o: kthread.h kvec.h kalloc.h sdust.h mmpriv.h minimap.h bseq.h
misc.o: minimap.h ksort.h
kthread.o: kthread.h
lchain.o: mmpriv.h minimap.h bseq.h kseq.h kalloc.h krmq.h
main.o: bseq.h minimap.h mmpriv.h kseq.h ketopt.h
map.o: kthread.h kvec.h kalloc.h sdust.h mmpriv.h minimap.h bseq.h kseq.h
map.o: khash.h ksort.h
misc.o: mmpriv.h minimap.h bseq.h kseq.h ksort.h
options.o: mmpriv.h minimap.h bseq.h kseq.h
pe.o: mmpriv.h minimap.h bseq.h kseq.h kvec.h kalloc.h ksort.h
sdust.o: kalloc.h kdq.h kvec.h sdust.h
sketch.o: kvec.h kalloc.h minimap.h
seed.o: mmpriv.h minimap.h bseq.h kseq.h kalloc.h ksort.h
sketch.o: kvec.h kalloc.h mmpriv.h minimap.h bseq.h kseq.h
splitidx.o: mmpriv.h minimap.h bseq.h kseq.h
+97
View File
@@ -0,0 +1,97 @@
CFLAGS= -g -Wall -O2 -Wc++-compat #-Wextra
CPPFLAGS= -DHAVE_KALLOC -DUSE_SIMDE -DSIMDE_ENABLE_NATIVE_ALIASES
INCLUDES= -Ilib/simde
OBJS= kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o options.o index.o lchain.o align.o hit.o map.o format.o pe.o seed.o esterr.o splitidx.o \
ksw2_extz2_simde.o ksw2_extd2_simde.o ksw2_exts2_simde.o ksw2_ll_simde.o
PROG= minimap2
PROG_EXTRA= sdust minimap2-lite
LIBS= -lm -lz -lpthread
ifneq ($(arm_neon),) # if arm_neon is defined
ifeq ($(aarch64),) #if aarch64 is not defined
CFLAGS+=-D_FILE_OFFSET_BITS=64 -mfpu=neon -fsigned-char
else #if aarch64 is defined
CFLAGS+=-D_FILE_OFFSET_BITS=64 -fsigned-char
endif
endif
ifneq ($(asan),)
CFLAGS+=-fsanitize=address
LIBS+=-fsanitize=address
endif
ifneq ($(tsan),)
CFLAGS+=-fsanitize=thread
LIBS+=-fsanitize=thread
endif
.PHONY:all extra clean depend
.SUFFIXES:.c .o
.c.o:
$(CC) -c $(CFLAGS) $(CPPFLAGS) $(INCLUDES) $< -o $@
all:$(PROG)
extra:all $(PROG_EXTRA)
minimap2:main.o libminimap2.a
$(CC) $(CFLAGS) main.o -o $@ -L. -lminimap2 $(LIBS)
minimap2-lite:example.o libminimap2.a
$(CC) $(CFLAGS) $< -o $@ -L. -lminimap2 $(LIBS)
libminimap2.a:$(OBJS)
$(AR) -csru $@ $(OBJS)
sdust:sdust.c kalloc.o kalloc.h kdq.h kvec.h kseq.h ketopt.h sdust.h
$(CC) -D_SDUST_MAIN $(CFLAGS) $< kalloc.o -o $@ -lz
ksw2_ll_simde.o:ksw2_ll_sse.c ksw2.h kalloc.h
$(CC) -c $(CFLAGS) -msse2 $(CPPFLAGS) $(INCLUDES) $< -o $@
ksw2_extz2_simde.o:ksw2_extz2_sse.c ksw2.h kalloc.h
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) $(INCLUDES) $< -o $@
ksw2_extd2_simde.o:ksw2_extd2_sse.c ksw2.h kalloc.h
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) $(INCLUDES) $< -o $@
ksw2_exts2_simde.o:ksw2_exts2_sse.c ksw2.h kalloc.h
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) $(INCLUDES) $< -o $@
# other non-file targets
clean:
rm -fr gmon.out *.o a.out $(PROG) $(PROG_EXTRA) *~ *.a *.dSYM build dist mappy*.so mappy.c python/mappy.c mappy.egg*
depend:
(LC_ALL=C; export LC_ALL; makedepend -Y -- $(CFLAGS) $(CPPFLAGS) -- *.c)
# DO NOT DELETE
align.o: minimap.h mmpriv.h bseq.h kseq.h ksw2.h kalloc.h
bseq.o: bseq.h kvec.h kalloc.h kseq.h
chain.o: minimap.h mmpriv.h bseq.h kseq.h kalloc.h
esterr.o: mmpriv.h minimap.h bseq.h kseq.h
example.o: minimap.h kseq.h
format.o: kalloc.h mmpriv.h minimap.h bseq.h kseq.h
hit.o: mmpriv.h minimap.h bseq.h kseq.h kalloc.h khash.h
index.o: kthread.h bseq.h minimap.h mmpriv.h kseq.h kvec.h kalloc.h khash.h
index.o: ksort.h
kalloc.o: kalloc.h
ksw2_extd2_sse.o: ksw2.h kalloc.h
ksw2_exts2_sse.o: ksw2.h kalloc.h
ksw2_extz2_sse.o: ksw2.h kalloc.h
ksw2_ll_sse.o: ksw2.h kalloc.h
kthread.o: kthread.h
main.o: bseq.h minimap.h mmpriv.h kseq.h ketopt.h
map.o: kthread.h kvec.h kalloc.h sdust.h mmpriv.h minimap.h bseq.h kseq.h
map.o: khash.h ksort.h
misc.o: mmpriv.h minimap.h bseq.h kseq.h ksort.h
options.o: mmpriv.h minimap.h bseq.h kseq.h
pe.o: mmpriv.h minimap.h bseq.h kseq.h kvec.h kalloc.h ksort.h
sdust.o: kalloc.h kdq.h kvec.h sdust.h
self-chain.o: minimap.h kseq.h
sketch.o: kvec.h kalloc.h mmpriv.h minimap.h bseq.h kseq.h
splitidx.o: mmpriv.h minimap.h bseq.h kseq.h
+726
View File
@@ -1,3 +1,729 @@
Release 2.24-r1122 (26 December 2021)
-------------------------------------
This release improves alignment around long poorly aligned regions. Older
minimap2 may chain through such regions in rare cases which may result in
missing alignments later. The issue has become worse since the the change of
the chaining algorithm in v2.19. v2.23 implements an incomplete remedy. This
release provides a better solution with a X-drop-like heuristic and by enabling
two-bandwidth chaining in the assembly mode.
(2.24: 26 December 2021, r1122)
Release 2.23-r1111 (18 November 2021)
-------------------------------------
Notable changes:
* Bugfix: fixed missing alignments around long inversions (#806 and #816).
This bug affected v2.19 through v2.22.
* Improvement: avoid extremely long mapping time for pathologic reads with
highly repeated k-mers not in the reference (#771). Use --q-occ-frac=0
to disable the new heuristic.
* Change: use --cap-kalloc=1g by default.
(2.23: 18 November 2021, r1111)
Release 2.22-r1101 (7 August 2021)
----------------------------------
When choosing the best alignment, this release uses logarithm gap penalty and
query-specific mismatch penalty. It improves the sensitivity to long INDELs in
repetitive regions.
Other notable changes:
* Bugfix: fixed an indirect memory leak that may waste a large amount of
memory given highly repetitive reference such as a 16S RNA database (#749).
All versions of minimap2 have this issue.
* New feature: added --cap-kalloc to reduce the peak memory. This option is
not enabled by default but may become the default in future releases.
Known issue:
* Minimap2 may take a long time to map a read (#771). So far it is not clear
if this happens to v2.18 and earlier versions.
(2.22: 7 August 2021, r1101)
Release 2.21-r1071 (6 July 2021)
--------------------------------
This release fixed a regression in short-read mapping introduced in v2.19
(#776). It also fixed invalid comparisons of uninitialized variables, though
these are harmless (#752). Long-read alignment should be identical to v2.20.
(2.21: 6 July 2021, r1071)
Release 2.20-r1061 (27 May 2021)
--------------------------------
This release fixed a bug in the Python module and improves the command-line
compatibiliity with v2.18. In v2.19, if `-r` is specified with an `asm*` preset,
users would get alignments more fragmented than v2.18. This could be an issue
for existing pipelines specifying `-r`. This release resolves this issue.
(2.20: 27 May 2021, r1061)
Release 2.19-r1057 (26 May 2021)
--------------------------------
This release includes a few important improvements backported from unimap:
* Improvement: more contiguous alignment through long INDELs. This is enabled
by the minigraph chaining algorithm. All `asm*` presets now use the new
algorithm. They can find INDELs up to 100kb and may be faster for
chromosome-long contigs. The default mode and `map*` presets use this
algorithm to replace the long-join heuristic.
* Improvement: better alignment in highly repetitive regions by rescuing
high-occurrence seeds. If the distance between two adjacent seeds is too
large, attempt to choose a fraction of high-occurrence seeds in-between.
Minimap2 now produces fewer clippings and alignment break points in long
satellite regions.
* Improvement: allow to specify an interval of k-mer occurrences with `-U`.
For repeat-rich genomes, the automatic k-mer occurrence threshold determined
by `-f` may be too large and makes alignment impractically slow. The new
option protects against such cases. Enabled for `asm*` and `map-hifi`.
* New feature: added the `map-hifi` preset for maping PacBio High-Fidelity
(HiFi) reads.
* Change to the default: apply `--cap-sw-mem=100m` for genomic alignment.
* Bugfix: minimap2 could not generate an index file with `-xsr` (#734).
This release represents the most signficant algorithmic change since v2.1 in
2017. With features backported from unimap, minimap2 now has similar power to
unimap for contig alignment. Unimap will remain an experimental project and is
no longer recommended over minimap2. Sorry for reverting the recommendation in
short time.
(2.19: 26 May 2021, r1057)
Release 2.18-r1015 (9 April 2021)
---------------------------------
This release fixes multiple rare bugs in minimap2 and adds additional
functionality to paftools.js.
Changes to minimap2:
* Bugfix: a rare segfault caused by an off-by-one error (#489)
* Bugfix: minimap2 segfaulted due to an uninitilized variable (#622 and #625).
* Bugfix: minimap2 parsed spaces as field separators in BED (#721). This led
to issues when the BED name column contains spaces.
* Bugfix: minimap2 `--split-prefix` did not work with long reference names
(#394).
* Bugfix: option `--junc-bonus` didn't work (#513)
* Bugfix: minimap2 didn't return 1 on I/O errors (#532)
* Bugfix: the `de:f` tag (sequence divergence) could be negative if there were
ambiguous bases
* Bugfix: fixed two undefined behaviors caused by calling memcpy() on
zero-length blocks (#443)
* Bugfix: there were duplicated SAM @SQ lines if option `--split-prefix` is in
use (#400 and #527)
* Bugfix: option -K had to be smaller than 2 billion (#491). This was caused
by a 32-bit integer overflow.
* Improvement: optionally compile against SIMDe (#597). Minimap2 should work
with IBM POWER CPUs, though this has not been tested. To compile with SIMDe,
please use `make -f Makefile.simde`.
* Improvement: more informative error message for I/O errors (#454) and for
FASTQ parsing errors (#510)
* Improvement: abort given malformatted RG line (#541)
* Improvement: better formula to estimate the `dv:f` tag (approximate sequence
divergence). See DOI:10.1101/2021.01.15.426881.
* New feature: added the `--mask-len` option to fine control the removal of
redundant hits (#659). The default behavior is unchanged.
Changes to mappy:
* Bugfix: mappy caused segmentation fault if the reference index is not
present (#413).
* Bugfix: fixed a memory leak via 238b6bb3
* Change: always require Cython to compile the mappy module (#723). Older
mappy packages at PyPI bundled the C source code generated by Cython such
that end users did not need to install Cython to compile mappy. However, as
Python 3.9 is breaking backward compatibility, older mappy does not work
with Python 3.9 anymore. We have to add this Cython dependency as a
workaround.
Changes to paftools.js:
* Bugfix: the "part10-" line from asmgene was wrong (#581)
* Improvement: compatibility with GTF files from GenBank (#422)
* New feature: asmgene also checks missing multi-copy genes
* New feature: added the misjoin command to evaluate large-scale misjoins and
megabase-long inversions.
Although given the many bug fixes and minor improvements, the core algorithm
stays the same. This version of minimap2 produces nearly identical alignments
to v2.17 except very rare corner cases.
Now unimap is recommended over minimap2 for aligning long contigs against a
reference genome. It often takes less wall-clock time and is much more
sensitive to long insertions and deletions.
(2.18: 9 April 2021, r1015)
Release 2.17-r941 (4 May 2019)
------------------------------
Changes since the last release:
* Fixed flawed CIGARs like `5I6D7I` (#392).
* Bugfix: TLEN should be 0 when either end is unmapped (#373 and #365).
* Bugfix: mappy is unable to write index (#372).
* Added option `--junc-bed` to load known gene annotations in the BED12
format. Minimap2 prefers annotated junctions over novel junctions (#197 and
#348). GTF can be converted to BED12 with `paftools.js gff2bed`.
* Added option `--sam-hit-only` to suppress unmapped hits in SAM (#377).
* Added preset `splice:hq` for high-quality CCS or mRNA sequences. It applies
better scoring and improves the sensitivity to small exons. This preset may
introduce false small introns, but the overall accuracy should be higher.
This version produces nearly identical alignments to v2.16, except for CIGARs
affected by the bug mentioned above.
(2.17: 5 May 2019, r941)
Release 2.16-r922 (28 February 2019)
------------------------------------
This release is 50% faster for mapping ultra-long nanopore reads at comparable
accuracy. For short-read mapping, long-read overlapping and ordinary long-read
mapping, the performance and accuracy remain similar. This speedup is achieved
with a new heuristic to limit the number of chaining iterations (#324). Users
can disable the heuristic by increasing a new option `--max-chain-iter` to a
huge number.
Other changes to minimap2:
* Implemented option `--paf-no-hit` to output unmapped query sequences in PAF.
The strand and reference name columns are both `*` at an unmapped line. The
hidden option is available in earlier minimap2 but had a different 2-column
output format instead of PAF.
* Fixed a bug that leads to wrongly calculated `de` tags when ambiguous bases
are involved (#309). This bug only affects v2.15.
* Fixed a bug when parsing command-line option `--splice` (#344). This bug was
introduced in v2.13.
* Fixed two division-by-zero cases (#326). They don't affect final alignments
because the results of the divisions are not used in both case.
* Added an option `-o` to output alignments to a specified file. It is still
recommended to use UNIX pipes for on-the-fly conversion or compression.
* Output a new `rl` tag to give the length of query regions harboring
repetitive seeds.
Changes to paftool.js:
* Added a new option to convert the MD tag to the long form of the cs tag.
Changes to mappy:
* Added the `mappy.Aligner.seq_names` method to return sequence names (#312).
For NA12878 ultra-long reads, this release changes the alignments of <0.1% of
reads in comparison to v2.15. All these reads have highly fragmented alignments
and are likely to be problematic anyway. For shorter or well aligned reads,
this release should produce mostly identical alignments to v2.15.
(2.16: 28 February 2019, r922)
Release 2.15-r905 (10 January 2019)
-----------------------------------
Changes to minimap2:
* Fixed a rare segmentation fault when option -H is in use (#307). This may
happen when there are very long homopolymers towards the 5'-end of a read.
* Fixed wrong CIGARs when option --eqx is used (#266).
* Fixed a typo in the base encoding table (#264). This should have no
practical effect.
* Fixed a typo in the example code (#265).
* Improved the C++ compatibility by removing "register" (#261). However,
minimap2 still can't be compiled in the pedantic C++ mode (#306).
* Output a new "de" tag for gap-compressed sequence divergence.
Changes to paftools.js:
* Added "asmgene" to evaluate the completeness of an assembly by measuring the
uniquely mapped single-copy genes. This command learns the idea of BUSCO.
* Added "vcfpair" to call a phased VCF from phased whole-genome assemblies. An
earlier version of this script is used to produce the ground truth for the
syndip benchmark [PMID:30013044].
This release produces identical alignment coordinates and CIGARs in comparison
to v2.14. Users are advised to upgrade due to the several bug fixes.
(2.15: 10 Janurary 2019, r905)
Release 2.14-r883 (5 November 2018)
-----------------------------------
Notable changes:
* Fixed two minor bugs caused by typos (#254 and #266).
* Fixed a bug that made minimap2 abort when --eqx was used together with --MD
or --cs (#257).
* Added --cap-sw-mem to cap the size of DP matrices (#259). Base alignment may
take a lot of memory in the splicing mode. This may lead to issues when we
run minimap2 on a cluster with a hard memory limit. The new option avoids
unlimited memory usage at the cost of missing a few long introns.
* Conforming to C99 and C11 when possible (#261).
* Warn about malformatted FASTA or FASTQ (#252 and #255).
This release occasionally produces base alignments different from v2.13. The
overall alignment accuracy remain similar.
(2.14: 5 November 2018, r883)
Release 2.13-r850 (11 October 2018)
-----------------------------------
Changes to minimap2:
* Fixed wrongly formatted SAM when -L is in use (#231 and #233).
* Fixed an integer overflow in rare cases.
* Added --hard-mask-level to fine control split alignments (#244).
* Made --MD work with spliced alignment (#139).
* Replaced musl's getopt with ketopt for portability.
* Log peak memory usage on exit.
This release should produce alignments identical to v2.12 and v2.11.
(2.13: 11 October 2018, r850)
Release 2.12-r827 (6 August 2018)
---------------------------------
Changes to minimap2:
* Added option --split-prefix to write proper alignments (correct mapping
quality and clustered query sequences) given a multi-part index (#141 and
#189; mostly by @hasindu2008).
* Fixed a memory leak when option -y is in use.
Changes to mappy:
* Support the MD/cs tag (#183 and #203).
* Allow mappy to index a single sequence, to add extra flags and to change the
scoring system.
Minimap2 should produce alignments identical to v2.11.
(2.12: 6 August 2018, r827)
Release 2.11-r797 (20 June 2018)
--------------------------------
Changes to minimap2:
* Improved alignment accuracy in low-complexity regions for SV calling. Thank
@armintoepfer for multiple offline examples.
* Added option --eqx to encode sequence match/mismatch with the =/X CIGAR
operators (#156, #157 and #175).
* When compiled with VC++, minimap2 generated wrong alignments due to a
comparison between a signed integer and an unsigned integer (#184). Also
fixed warnings reported by "clang -Wextra".
* Fixed incorrect anchor filtering due to a missing 64- to 32-bit cast.
* Fixed incorrect mapping quality for inversions (#148).
* Fixed incorrect alignment involving ambiguous bases (#155).
* Fixed incorrect presets: option `-r 2000` is intended to be used with
ava-ont, not ava-pb. The bug was introduced in 2.10.
* Fixed a bug when --for-only/--rev-only is used together with --sr or
--heap-sort=yes (#166).
* Fixed option -Y that was not working in the previous releases.
* Added option --lj-min-ratio to fine control the alignment of long gaps
found by the "long-join" heuristic (#128).
* Exposed `mm_idx_is_idx`, `mm_idx_load` and `mm_idx_dump` C APIs (#177).
Also fixed a bug when indexing without reference names (this feature is not
exposed to the command line).
Changes to mappy:
* Added `__version__` (#165).
* Exposed the maximum fragment length parameter to mappy (#174).
Changes to paftools:
* Don't crash when there is no "cg" tag (#153).
* Fixed wrong coverage report by "paftools.js call" (#145).
This version may produce slightly different base-level alignment. The overall
alignment statistics should remain similar.
(2.11: 20 June 2018, r797)
Release 2.10-r761 (27 March 2018)
---------------------------------
Changes to minimap2:
* Optionally output the MD tag for compatibility with existing tools (#63,
#118 and #137).
* Use SSE compiler flags more precisely to prevent compiling errors on certain
machines (#127).
* Added option --min-occ-floor to set a minimum occurrence threshold. Presets
intended for assembly-to-reference alignment set this option to 100. This
option alleviates issues with regions having high copy numbers (#107).
* Exit with non-zero code on file writing errors (e.g. disk full; #103 and
#132).
* Added option -y to copy FASTA/FASTQ comments in query sequences to the
output (#136).
* Added the asm20 preset for alignments between genomes at 5-10% sequence
divergence.
* Changed the band-width in the ava-ont preset from 500 to 2000. Oxford
Nanopore reads may contain long deletion sequencing errors that break
chaining.
Changes to mappy, the Python binding:
* Fixed a typo in Align.seq() (#126).
Changes to paftools.js, the companion script:
* Command sam2paf now converts the MD tag to cs.
* Support VCF output for assembly-to-reference variant calling (#109).
This version should produce identical alignment for read overlapping, RNA-seq
read mapping, and genomic read mapping. We have also added a cook book to show
the variety uses of minimap2 on real datasets. Please see cookbook.md in the
minimap2 source code directory.
(2.10: 27 March 2017, r761)
Release 2.9-r720 (23 February 2018)
-----------------------------------
This release fixed multiple minor bugs.
* Fixed two bugs that lead to incorrect inversion alignment. Also improved the
sensitivity to small inversions by using double Z-drop cutoff (#112).
* Fixed an issue that may cause the end of a query sequence unmapped (#104).
* Added a mappy API to retrieve sequences from the index (#126) and to reverse
complement DNA sequences. Fixed a bug where the `best_n` parameter did not
work (#117).
* Avoided segmentation fault given incorrect FASTQ input (#111).
* Combined all auxiliary javascripts to paftools.js. Fixed several bugs in
these scripts at the same time.
(2.9: 24 February 2018, r720)
Release 2.8-r672 (1 February 2018)
----------------------------------
Notable changes in this release include:
* Speed up short-read alignment by ~10%. The overall mapping accuracy stays
the same, but the output alignments are not always identical to v2.7 due to
unstable sorting employed during chaining. Long-read alignment is not
affected by this change as the speedup is short-read specific.
* Mappy now supports paired-end short-read alignment (#87). Please see
python/README.rst for details.
* Added option --for-only and --rev-only to perform alignment against the
forward or the reverse strand of the reference genome only (#91).
* Alleviated the issue with undesired diagonal alignment in the self mapping
mode (#10). Even if the output is not ideal, it should not interfere with
other alignments. Fully resolving the issue is intricate and may require
additional heuristic thresholds.
* Enhanced error checking against incorrect input (#92 and #96).
For long query sequences, minimap2 should output identical alignments to v2.7.
(2.8: 1 February 2018, r672)
Release 2.7-r654 (9 January 2018)
---------------------------------
This release fixed a bug in the splice mode and added a few minor features:
* Fixed a bug that occasionally takes an intron as a long deletion in the
splice mode. This was caused by wrong backtracking at the last CIGAR
operator. The current fix eliminates the error, but it is not optimal in
that it often produces a wrong junction when the last operator is an intron.
A future version of minimap2 may improve upon this.
* Support high-end ARM CPUs that implement the NEON instruction set (#81).
This enables minimap2 to work on Raspberry Pi 3 and Odroid XU4.
* Added a C API to construct a minimizer index from a set of C strings (#80).
* Check scoring specified on the command line (#79). Due to the 8-bit limit,
excessively large score penalties fail minimap2.
For genomic sequences, minimap2 should give identical alignments to v2.6.
(2.7: 9 January 2018, r654)
Release 2.6-r623 (12 December 2017)
-----------------------------------
This release adds several features and fixes two minor bugs:
* Optionally build an index without sequences. This helps to reduce the
peak memory for read overlapping and is automatically applied when
base-level alignment is not requested.
* Approximately estimate per-base sequence divergence (i.e. 1-identity)
without performing base-level alignment, using a MashMap-like method. The
estimate is written to a new dv:f tag.
* Reduced the number of tiny terminal exons in RNA-seq alignment. The current
setting is conservative. Increase --end-seed-pen to drop more such exons.
* Reduced the peak memory when aligning long query sequences.
* Fixed a bug that is caused by HPC minimizers longer than 256bp. This should
have no effect in practice, but it is recommended to rebuild HPC indices if
possible.
* Fixed a bug when identifying identical hits (#71). This should only affect
artifactual reference consisting of near identical sequences.
For genomic sequences, minimap2 should give nearly identical alignments to
v2.5, except the new dv:f tag.
(2.6: 12 December 2017, r623)
Release 2.5-r572 (11 November 2017)
-----------------------------------
This release fixes several bugs and brings a couple of minor improvements:
* Fixed a severe bug that leads to incorrect mapping coordinates in rare
corner cases.
* Fixed underestimated mapping quality for chimeric alignments when the whole
query sequence contain many repetitive minimizers, and for chimeric
alignments caused by Z-drop.
* Fixed two bugs in Python binding: incorrect strand field (#57) and incorrect
sequence names for Python3 (#55).
* Improved mapping accuracy for highly overlapping paired ends.
* Added option -Y to use soft clipping for supplementary alignments (#56).
(2.5: 11 November 2017, r572)
Release 2.4-r555 (6 November 2017)
----------------------------------
As is planned, this release focuses on fine tuning the base algorithm. Notable
changes include
* Changed the mapping quality scale to match the scale of BWA-MEM. This makes
minimap2 and BWA-MEM achieve similar sensitivity-specificity balance on real
short-read data.
* Improved the accuracy of splice alignment by modeling one additional base
close to the GT-AG signal. This model is used by default with `-x splice`.
For SIRV control data, however, it is recommended to add `--splice-flank=no`
to disable this feature as the SIRV splice signals are slightly different.
* Tuned the parameters for Nanopore Direct RNA reads. The recommended command
line is `-axsplice -k14 -uf` (#46).
* Fixed a segmentation fault when aligning PacBio reads (#47 and #48). This
bug is very rare but it affects all versions of minimap2. It is also
recommended to re-index reference genomes created with `map-pb`. For human,
two minimizers in an old index are wrong.
* Changed option `-L` in sync with the final decision of hts-specs: a fake
CIGAR takes the form of `<readLen>S<refLen>N`. Note that `-L` only enables
future tools to recognize long CIGARs. It is not possible for older tools to
work with such alignments in BAM (#43 and #51).
* Fixed a tiny issue whereby minimap2 may waste 8 bytes per candidate
alignment.
The minimap2 technical note hosted at arXiv has also been updated to reflect
recent changes.
(2.4: 6 November 2017, r555)
Release 2.3-r531 (22 October 2017)
----------------------------------
This release come with many improvements and bug fixes:
* The **sr** preset now supports paired-end short-read alignment. Minimap2 is
3-4 times as fast as BWA-MEM, but is slightly less accurate on simulated
reads.
* Meticulous improvements to assembly-to-assembly alignment (special thanks to
Alexey Gurevich from the QUAST team): a) apply a small penalty to matches
between ambiguous bases; b) reduce missing alignments due to spurious
overlaps; c) introduce the short form of the `cs` tag, an improvement to the
SAM MD tag.
* Make sure gaps are always left-aligned.
* Recognize `U` bases from Oxford Nanopore Direct RNA-seq (#33).
* Fixed slightly wrong chaining score. Fixed slightly inaccurate coordinates
for split alignment.
* Fixed multiple reported bugs: 1) wrong reference name for inversion
alignment (#30); 2) redundant SQ lines when multiple query files are
specified (#39); 3) non-functioning option `-K` (#36).
This release has implemented all the major features I planned five months ago,
with the addition of spliced long-read alignment. The next couple of releases
will focus on fine tuning of the base algorithms.
(2.3: 22 October 2017, r531)
Release 2.2-r409 (17 September 2017)
------------------------------------
This is a feature release. It improves single-end short-read alignment and
comes with Python bindings. Detailed changes include:
* Added the **sr** preset for single-end short-read alignment. In this mode,
minimap2 runs faster than BWA-MEM, but is slightly less accurate on
simulated data sets. Paired-end alignment is not supported as of now.
* Improved mapping quality estimate with more accurate identification of
repetitive hits. This mainly helps short-read alignment.
* Implemented **mappy**, a Python binding for minimap2, which is available
from PyPI and can be installed with `pip install --user mappy`. Python users
can perform read alignment without the minimap2 executable.
* Restructured the indexing APIs and documented key minimap2 APIs in the
header file minimap.h. Updated example.c with the new APIs. Old APIs still
work but may become deprecated in future.
This release may output alignments different from the previous version, though
the overall alignment statistics, such as the number of aligned bases and long
gaps, remain close.
(2.2: 17 September 2017, r409)
Release 2.1.1-r341 (6 September 2017)
-------------------------------------
+330 -44
View File
@@ -1,56 +1,300 @@
[![Build Status](https://travis-ci.org/lh3/minimap2.svg?branch=master)](https://travis-ci.org/lh3/minimap2)
## Getting Started
[![GitHub Downloads](https://img.shields.io/github/downloads/lh3/minimap2/total.svg?style=social&logo=github&label=Download)](https://github.com/lh3/minimap2/releases)
[![BioConda Install](https://img.shields.io/conda/dn/bioconda/minimap2.svg?style=flag&label=BioConda%20install)](https://anaconda.org/bioconda/minimap2)
[![PyPI](https://img.shields.io/pypi/v/mappy.svg?style=flat)](https://pypi.python.org/pypi/mappy)
[![Build Status](https://github.com/lh3/minimap2/actions/workflows/ci.yaml/badge.svg)](https://github.com/lh3/minimap2/actions)
## <a name="started"></a>Getting Started
```sh
git clone https://github.com/lh3/minimap2
cd minimap2 && make
# long reads against a reference genome
./minimap2 -ax map10k test/MT-human.fa test/MT-orang.fa > test.sam
# long sequences against a reference genome
./minimap2 -a test/MT-human.fa test/MT-orang.fa > test.sam
# create an index first and then map
./minimap2 -x map10k -d MT-human.mmi test/MT-human.fa
./minimap2 -ax map10k MT-human.mmi test/MT-orang.fa > test.sam
# long-read overlap (no test data)
./minimap2 -x ava-pb your-reads.fa your-reads.fa > overlaps.paf
# spliced alignment (no test data)
./minimap2 -ax splice ref.fa rna-seq-reads.fa > spliced.sam
# man page
./minimap2 -x map-ont -d MT-human-ont.mmi test/MT-human.fa
./minimap2 -a MT-human-ont.mmi test/MT-orang.fa > test.sam
# use presets (no test data)
./minimap2 -ax map-pb ref.fa pacbio.fq.gz > aln.sam # PacBio CLR genomic reads
./minimap2 -ax map-ont ref.fa ont.fq.gz > aln.sam # Oxford Nanopore genomic reads
./minimap2 -ax map-hifi ref.fa pacbio-ccs.fq.gz > aln.sam # PacBio HiFi/CCS genomic reads (v2.19 or later)
./minimap2 -ax asm20 ref.fa pacbio-ccs.fq.gz > aln.sam # PacBio HiFi/CCS genomic reads (v2.18 or earlier)
./minimap2 -ax sr ref.fa read1.fa read2.fa > aln.sam # short genomic paired-end reads
./minimap2 -ax splice ref.fa rna-reads.fa > aln.sam # spliced long reads (strand unknown)
./minimap2 -ax splice -uf -k14 ref.fa reads.fa > aln.sam # noisy Nanopore Direct RNA-seq
./minimap2 -ax splice:hq -uf ref.fa query.fa > aln.sam # Final PacBio Iso-seq or traditional cDNA
./minimap2 -ax splice --junc-bed anno.bed12 ref.fa query.fa > aln.sam # prioritize on annotated junctions
./minimap2 -cx asm5 asm1.fa asm2.fa > aln.paf # intra-species asm-to-asm alignment
./minimap2 -x ava-pb reads.fa reads.fa > overlaps.paf # PacBio read overlap
./minimap2 -x ava-ont reads.fa reads.fa > overlaps.paf # Nanopore read overlap
# man page for detailed command line options
man ./minimap2.1
```
## Introduction
## Table of Contents
Minimap2 is a fast sequence mapping and alignment program that can find
overlaps between long noisy reads, or map long reads or their assemblies to a
reference genome optionally with detailed alignment (i.e. CIGAR). At present,
it works efficiently with query sequences from a few kilobases to ~100
megabases in length at an error rate ~15%. Minimap2 outputs in the [PAF][paf] or
the [SAM format][sam]. On limited test data sets, minimap2 is over 20 times
faster than most other long-read aligners. It will replace BWA-MEM for long
reads and contig alignment.
- [Getting Started](#started)
- [Users' Guide](#uguide)
- [Installation](#install)
- [General usage](#general)
- [Use cases](#cases)
- [Map long noisy genomic reads](#map-long-genomic)
- [Map long mRNA/cDNA reads](#map-long-splice)
- [Find overlaps between long reads](#long-overlap)
- [Map short accurate genomic reads](#short-genomic)
- [Full genome/assembly alignment](#full-genome)
- [Advanced features](#advanced)
- [Working with >65535 CIGAR operations](#long-cigar)
- [The cs optional tag](#cs)
- [Working with the PAF format](#paftools)
- [Algorithm overview](#algo)
- [Getting help](#help)
- [Citing minimap2](#cite)
- [Developers' Guide](#dguide)
- [Limitations](#limit)
Minimap2 is the successor of [minimap][minimap]. It uses a similar
minimizer-based indexing and seeding algorithm, and improves the original
minimap with homopolyer-compressed k-mers (see also [SMARTdenovo][smartdenovo]
and [longISLND][longislnd]), better chaining and the ability to produce CIGAR
with fast extension alignment (see also [libgaba][gaba] and [ksw2][ksw2]) and
piece-wise affine gap cost.
## <a name="uguide"></a>Users' Guide
If you use minimap2 in your work, please consider to cite:
Minimap2 is a versatile sequence alignment program that aligns DNA or mRNA
sequences against a large reference database. Typical use cases include: (1)
mapping PacBio or Oxford Nanopore genomic reads to the human genome; (2)
finding overlaps between long reads with error rate up to ~15%; (3)
splice-aware alignment of PacBio Iso-Seq or Nanopore cDNA or Direct RNA reads
against a reference genome; (4) aligning Illumina single- or paired-end reads;
(5) assembly-to-assembly alignment; (6) full-genome alignment between two
closely related species with divergence below ~15%.
> Li, H. (2017). Minimap2: fast pairwise alignment for long DNA sequences. [arXiv:1708.01492](https://arxiv.org/abs/1708.01492).
For ~10kb noisy reads sequences, minimap2 is tens of times faster than
mainstream long-read mappers such as BLASR, BWA-MEM, NGMLR and GMAP. It is more
accurate on simulated long reads and produces biologically meaningful alignment
ready for downstream analyses. For >100bp Illumina short reads, minimap2 is
three times as fast as BWA-MEM and Bowtie2, and as accurate on simulated data.
Detailed evaluations are available from the [minimap2 paper][doi] or the
[preprint][preprint].
## Installation
### <a name="install"></a>Installation
For modern x86-64 CPUs, just type `make` in the source code directory. This
will compile a binary `minimap2` which you can copy to your desired location.
If you see compilation errors, try `make sse2only=1` to disable SSE4. Minimap2
will run a little slower. At present, minimap2 does not work with non-x86 CPUs
or ancient CPUs that do not support SSE2. SSE2 is critical to the performance
of minimap2.
Minimap2 is optimized for x86-64 CPUs. You can acquire precompiled binaries from
the [release page][release] with:
```sh
curl -L https://github.com/lh3/minimap2/releases/download/v2.24/minimap2-2.24_x64-linux.tar.bz2 | tar -jxvf -
./minimap2-2.24_x64-linux/minimap2
```
If you want to compile from the source, you need to have a C compiler, GNU make
and zlib development files installed. Then type `make` in the source code
directory to compile. If you see compilation errors, try `make sse2only=1`
to disable SSE4 code, which will make minimap2 slightly slower.
## Algorithm Overview
Minimap2 also works with ARM CPUs supporting the NEON instruction sets. To
compile for 32 bit ARM architectures (such as ARMv7), use `make arm_neon=1`. To
compile for for 64 bit ARM architectures (such as ARMv8), use `make arm_neon=1
aarch64=1`.
Minimap2 can use [SIMD Everywhere (SIMDe)][simde] library for porting
implementation to the different SIMD instruction sets. To compile using SIMDe,
use `make -f Makefile.simde`. To compile for ARM CPUs, use `Makefile.simde`
with the ARM related command lines given above.
### <a name="general"></a>General usage
Without any options, minimap2 takes a reference database and a query sequence
file as input and produce approximate mapping, without base-level alignment
(i.e. coordinates are only approximate and no CIGAR in output), in the [PAF format][paf]:
```sh
minimap2 ref.fa query.fq > approx-mapping.paf
```
You can ask minimap2 to generate CIGAR at the `cg` tag of PAF with:
```sh
minimap2 -c ref.fa query.fq > alignment.paf
```
or to output alignments in the [SAM format][sam]:
```sh
minimap2 -a ref.fa query.fq > alignment.sam
```
Minimap2 seamlessly works with gzip'd FASTA and FASTQ formats as input. You
don't need to convert between FASTA and FASTQ or decompress gzip'd files first.
For the human reference genome, minimap2 takes a few minutes to generate a
minimizer index for the reference before mapping. To reduce indexing time, you
can optionally save the index with option **-d** and replace the reference
sequence file with the index file on the minimap2 command line:
```sh
minimap2 -d ref.mmi ref.fa # indexing
minimap2 -a ref.mmi reads.fq > alignment.sam # alignment
```
***Importantly***, it should be noted that once you build the index, indexing
parameters such as **-k**, **-w**, **-H** and **-I** can't be changed during
mapping. If you are running minimap2 for different data types, you will
probably need to keep multiple indexes generated with different parameters.
This makes minimap2 different from BWA which always uses the same index
regardless of query data types.
### <a name="cases"></a>Use cases
Minimap2 uses the same base algorithm for all applications. However, due to the
different data types it supports (e.g. short vs long reads; DNA vs mRNA reads),
minimap2 needs to be tuned for optimal performance and accuracy. It is usually
recommended to choose a preset with option **-x**, which sets multiple
parameters at the same time. The default setting is the same as `map-ont`.
#### <a name="map-long-genomic"></a>Map long noisy genomic reads
```sh
minimap2 -ax map-pb ref.fa pacbio-reads.fq > aln.sam # for PacBio CLR reads
minimap2 -ax map-ont ref.fa ont-reads.fq > aln.sam # for Oxford Nanopore reads
```
The difference between `map-pb` and `map-ont` is that `map-pb` uses
homopolymer-compressed (HPC) minimizers as seeds, while `map-ont` uses ordinary
minimizers as seeds. Emperical evaluation suggests HPC minimizers improve
performance and sensitivity when aligning PacBio CLR reads, but hurt when aligning
Nanopore reads.
#### <a name="map-long-splice"></a>Map long mRNA/cDNA reads
```sh
minimap2 -ax splice:hq -uf ref.fa iso-seq.fq > aln.sam # PacBio Iso-seq/traditional cDNA
minimap2 -ax splice ref.fa nanopore-cdna.fa > aln.sam # Nanopore 2D cDNA-seq
minimap2 -ax splice -uf -k14 ref.fa direct-rna.fq > aln.sam # Nanopore Direct RNA-seq
minimap2 -ax splice --splice-flank=no SIRV.fa SIRV-seq.fa # mapping against SIRV control
```
There are different long-read RNA-seq technologies, including tranditional
full-length cDNA, EST, PacBio Iso-seq, Nanopore 2D cDNA-seq and Direct RNA-seq.
They produce data of varying quality and properties. By default, `-x splice`
assumes the read orientation relative to the transcript strand is unknown. It
tries two rounds of alignment to infer the orientation and write the strand to
the `ts` SAM/PAF tag if possible. For Iso-seq, Direct RNA-seq and tranditional
full-length cDNAs, it would be desired to apply `-u f` to force minimap2 to
consider the forward transcript strand only. This speeds up alignment with
slight improvement to accuracy. For noisy Nanopore Direct RNA-seq reads, it is
recommended to use a smaller k-mer size for increased sensitivity to the first
or the last exons.
Minimap2 rates an alignment by the score of the max-scoring sub-segment,
*excluding* introns, and marks the best alignment as primary in SAM. When a
spliced gene also has unspliced pseudogenes, minimap2 does not intentionally
prefer spliced alignment, though in practice it more often marks the spliced
alignment as the primary. By default, minimap2 outputs up to five secondary
alignments (i.e. likely pseudogenes in the context of RNA-seq mapping). This
can be tuned with option **-N**.
For long RNA-seq reads, minimap2 may produce chimeric alignments potentially
caused by gene fusions/structural variations or by an intron longer than the
max intron length **-G** (200k by default). For now, it is not recommended to
apply an excessively large **-G** as this slows down minimap2 and sometimes
leads to false alignments.
It is worth noting that by default `-x splice` prefers GT[A/G]..[C/T]AG
over GT[C/T]..[A/G]AG, and then over other splicing signals. Considering
one additional base improves the junction accuracy for noisy reads, but
reduces the accuracy when aligning against the widely used SIRV control data.
This is because SIRV does not honor the evolutionarily conservative splicing
signal. If you are studying SIRV, you may apply `--splice-flank=no` to let
minimap2 only model GT..AG, ignoring the additional base.
Since v2.17, minimap2 can optionally take annotated genes as input and
prioritize on annotated splice junctions. To use this feature, you can
```sh
paftools.js gff2bed anno.gff > anno.bed
minimap2 -ax splice --junc-bed anno.bed ref.fa query.fa > aln.sam
```
Here, `anno.gff` is the gene annotation in the GTF or GFF3 format (`gff2bed`
automatically tests the format). The output of `gff2bed` is in the 12-column
BED format, or the BED12 format. With the `--junc-bed` option, minimap2 adds a
bonus score (tuned by `--junc-bonus`) if an aligned junction matches a junction
in the annotation. Option `--junc-bed` also takes 5-column BED, including the
strand field. In this case, each line indicates an oriented junction.
#### <a name="long-overlap"></a>Find overlaps between long reads
```sh
minimap2 -x ava-pb reads.fq reads.fq > ovlp.paf # PacBio CLR read overlap
minimap2 -x ava-ont reads.fq reads.fq > ovlp.paf # Oxford Nanopore read overlap
```
Similarly, `ava-pb` uses HPC minimizers while `ava-ont` uses ordinary
minimizers. It is usually not recommended to perform base-level alignment in
the overlapping mode because it is slow and may produce false positive
overlaps. However, if performance is not a concern, you may try to add `-a` or
`-c` anyway.
#### <a name="short-genomic"></a>Map short accurate genomic reads
```sh
minimap2 -ax sr ref.fa reads-se.fq > aln.sam # single-end alignment
minimap2 -ax sr ref.fa read1.fq read2.fq > aln.sam # paired-end alignment
minimap2 -ax sr ref.fa reads-interleaved.fq > aln.sam # paired-end alignment
```
When two read files are specified, minimap2 reads from each file in turn and
merge them into an interleaved stream internally. Two reads are considered to
be paired if they are adjacent in the input stream and have the same name (with
the `/[0-9]` suffix trimmed if present). Single- and paired-end reads can be
mixed.
Minimap2 does not work well with short spliced reads. There are many capable
RNA-seq mappers for short reads.
#### <a name="full-genome"></a>Full genome/assembly alignment
```sh
minimap2 -ax asm5 ref.fa asm.fa > aln.sam # assembly to assembly/ref alignment
```
For cross-species full-genome alignment, the scoring system needs to be tuned
according to the sequence divergence.
### <a name="advanced"></a>Advanced features
#### <a name="long-cigar"></a>Working with >65535 CIGAR operations
Due to a design flaw, BAM does not work with CIGAR strings with >65535
operations (SAM and CRAM work). However, for ultra-long nanopore reads minimap2
may align ~1% of read bases with long CIGARs beyond the capability of BAM. If
you convert such SAM/CRAM to BAM, Picard and recent samtools will throw an
error and abort. Older samtools and other tools may create corrupted BAM.
To avoid this issue, you can add option `-L` at the minimap2 command line.
This option moves a long CIGAR to the `CG` tag and leaves a fully clipped CIGAR
at the SAM CIGAR column. Current tools that don't read CIGAR (e.g. merging and
sorting) still work with such BAM records; tools that read CIGAR will
effectively ignore these records. It has been decided that future tools
will seamlessly recognize long-cigar records generated by option `-L`.
**TL;DR**: if you work with ultra-long reads and use tools that only process
BAM files, please add option `-L`.
#### <a name="cs"></a>The cs optional tag
The `cs` SAM/PAF tag encodes bases at mismatches and INDELs. It matches regular
expression `/(:[0-9]+|\*[a-z][a-z]|[=\+\-][A-Za-z]+)+/`. Like CIGAR, `cs`
consists of series of operations. Each leading character specifies the
operation; the following sequence is the one involved in the operation.
The `cs` tag is enabled by command line option `--cs`. The following alignment,
for example:
```txt
CGATCGATAAATAGAGTAG---GAATAGCA
|||||| |||||||||| |||| |||
CGATCG---AATAGAGTAGGTCGAATtGCA
```
is represented as `:6-ata:10+gtc:4*at:3`, where `:[0-9]+` represents an
identical block, `-ata` represents a deletion, `+gtc` an insertion and `*at`
indicates reference base `a` is substituted with a query base `t`. It is
similar to the `MD` SAM tag but is standalone and easier to parse.
If `--cs=long` is used, the `cs` string also contains identical sequences in
the alignment. The above example will become
`=CGATCG-ata=AATAGAGTAG+gtc=GAAT*at=GCA`. The long form of `cs` encodes both
reference and query sequences in one string. The `cs` tag also encodes intron
positions and splicing signals (see the [minimap2 manpage][manpage-cs] for
details).
#### <a name="paftools"></a>Working with the PAF format
Minimap2 also comes with a (java)script [paftools.js](misc/paftools.js) that
processes alignments in the PAF format. It calls variants from
assembly-to-reference alignment, lifts over BED files based on alignment,
converts between formats and provides utilities for various evaluations. For
details, please see [misc/README.md](misc/README.md).
### <a name="algo"></a>Algorithm overview
In the following, minimap2 command line options have a dash ahead and are
highlighted in bold.
highlighted in bold. The description may help to tune minimap2 parameters.
1. Read **-I** [=*4G*] reference bases, extract (**-k**,**-w**)-minimizers and
index them in a hash table.
@@ -91,20 +335,51 @@ highlighted in bold.
9. If there are more reference sequences, reopen the query file from the start
and go to step 1; otherwise stop.
## Limitations
### <a name="help"></a>Getting help
Manpage [minimap2.1][manpage] provides detailed description of minimap2
command line options and optional tags. The [FAQ](FAQ.md) page answers several
frequently asked questions. If you encounter bugs or have further questions or
requests, you can raise an issue at the [issue page][issue]. There is not a
specific mailing list for the time being.
### <a name="cite"></a>Citing minimap2
If you use minimap2 in your work, please cite:
> Li, H. (2018). Minimap2: pairwise alignment for nucleotide sequences.
> *Bioinformatics*, **34**:3094-3100. [doi:10.1093/bioinformatics/bty191][doi]
## <a name="dguide"></a>Developers' Guide
Minimap2 is not only a command line tool, but also a programming library.
It provides C APIs to build/load index and to align sequences against the
index. File [example.c](example.c) demonstrates typical uses of C APIs. Header
file [minimap.h](minimap.h) gives more detailed API documentation. Minimap2
aims to keep APIs in this header stable. File [mmpriv.h](mmpriv.h) contains
additional private APIs which may be subjected to changes frequently.
This repository also provides Python bindings to a subset of C APIs. File
[python/README.rst](python/README.rst) gives the full documentation;
[python/minimap2.py](python/minimap2.py) shows an example. This Python
extension, mappy, is also [available from PyPI][mappypypi] via `pip install
mappy` or [from BioConda][mappyconda] via `conda install -c bioconda mappy`.
## <a name="limit"></a>Limitations
* Minimap2 may produce suboptimal alignments through long low-complexity
regions where seed positions may be suboptimal. This should not be a big
concern because even the optimal alignment may be wrong in such regions.
* Minimap2 does not work well with Illumina short reads as of now.
* Minimap2 requires SSE2 instructions on x86 CPUs or NEON on ARM CPUs. It is
possible to add non-SIMD support, but it would make minimap2 slower by
several times.
* Minimap2 requires SSE2 instructions to compile. It is possible to add
non-SSE2 support, but it would make minimap2 slower by several times.
* Minimap2 does not work with a single query or database sequence ~2
billion bases or longer (2,147,483,647 to be exact). The total length of all
sequences can well exceed this threshold.
In general, minimap2 is a young project with most code written since June, 2017.
It may have bugs and room for improvements. Bug reports and suggestions are
warmly welcomed.
* Minimap2 often misses small exons.
@@ -115,3 +390,14 @@ warmly welcomed.
[longislnd]: https://www.ncbi.nlm.nih.gov/pubmed/27667791
[gaba]: https://github.com/ocxtal/libgaba
[ksw2]: https://github.com/lh3/ksw2
[preprint]: https://arxiv.org/abs/1708.01492
[release]: https://github.com/lh3/minimap2/releases
[mappypypi]: https://pypi.python.org/pypi/mappy
[mappyconda]: https://anaconda.org/bioconda/mappy
[issue]: https://github.com/lh3/minimap2/issues
[k8]: https://github.com/attractivechaos/k8
[manpage]: https://lh3.github.io/minimap2/minimap2.html
[manpage-cs]: https://lh3.github.io/minimap2/minimap2.html#10
[doi]: https://doi.org/10.1093/bioinformatics/bty191
[smide]: https://github.com/nemequ/simde
[unimap]: https://github.com/lh3/unimap
+666 -144
View File
File diff suppressed because it is too large Load Diff
+127 -20
View File
@@ -1,22 +1,45 @@
#include <zlib.h>
#include <stdio.h>
#include <stdlib.h>
#include <string.h>
#include <assert.h>
#define __STDC_LIMIT_MACROS
#include "bseq.h"
#include "kvec.h"
#include "kseq.h"
KSEQ_INIT(gzFile, gzread)
KSEQ_INIT2(, gzFile, gzread)
unsigned char seq_comp_table[256] = {
0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,
32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47,
48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63,
64, 'T', 'V', 'G', 'H', 'E', 'F', 'C', 'D', 'I', 'J', 'M', 'L', 'K', 'N', 'O',
'P', 'Q', 'Y', 'S', 'A', 'A', 'B', 'W', 'X', 'R', 'Z', 91, 92, 93, 94, 95,
96, 't', 'v', 'g', 'h', 'e', 'f', 'c', 'd', 'i', 'j', 'm', 'l', 'k', 'n', 'o',
'p', 'q', 'y', 's', 'a', 'a', 'b', 'w', 'x', 'r', 'z', 123, 124, 125, 126, 127,
128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143,
144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159,
160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175,
176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191,
192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207,
208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223,
224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239,
240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255
};
#define CHECK_PAIR_THRES 1000000
struct mm_bseq_file_s {
gzFile fp;
kseq_t *ks;
mm_bseq1_t s;
};
mm_bseq_file_t *mm_bseq_open(const char *fn)
{
mm_bseq_file_t *fp;
gzFile f;
f = fn && strcmp(fn, "-")? gzopen(fn, "r") : gzdopen(fileno(stdin), "r");
f = fn && strcmp(fn, "-")? gzopen(fn, "r") : gzdopen(0, "r");
if (f == 0) return 0;
fp = (mm_bseq_file_t*)calloc(1, sizeof(mm_bseq_file_t));
fp->fp = f;
@@ -31,32 +54,116 @@ void mm_bseq_close(mm_bseq_file_t *fp)
free(fp);
}
mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int chunk_size, int with_qual, int *n_)
static inline char *kstrdup(const kstring_t *s)
{
int size = 0, m, n;
mm_bseq1_t *seqs;
char *t;
t = (char*)malloc(s->l + 1);
memcpy(t, s->s, s->l + 1);
return t;
}
static inline void kseq2bseq(kseq_t *ks, mm_bseq1_t *s, int with_qual, int with_comment)
{
int i;
if (ks->name.l == 0)
fprintf(stderr, "[WARNING]\033[1;31m empty sequence name in the input.\033[0m\n");
s->name = kstrdup(&ks->name);
s->seq = kstrdup(&ks->seq);
for (i = 0; i < (int)ks->seq.l; ++i) // convert U to T
if (s->seq[i] == 'u' || s->seq[i] == 'U')
--s->seq[i];
s->qual = with_qual && ks->qual.l? kstrdup(&ks->qual) : 0;
s->comment = with_comment && ks->comment.l? kstrdup(&ks->comment) : 0;
s->l_seq = ks->seq.l;
}
mm_bseq1_t *mm_bseq_read3(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int with_comment, int frag_mode, int *n_)
{
int64_t size = 0;
int ret;
kvec_t(mm_bseq1_t) a = {0,0,0};
kseq_t *ks = fp->ks;
m = n = 0; seqs = 0;
while (kseq_read(ks) >= 0) {
*n_ = 0;
if (fp->s.seq) {
kv_resize(mm_bseq1_t, 0, a, 256);
kv_push(mm_bseq1_t, 0, a, fp->s);
size = fp->s.l_seq;
memset(&fp->s, 0, sizeof(mm_bseq1_t));
}
while ((ret = kseq_read(ks)) >= 0) {
mm_bseq1_t *s;
assert(ks->seq.l <= INT32_MAX);
if (n >= m) {
m = m? m<<1 : 256;
seqs = (mm_bseq1_t*)realloc(seqs, m * sizeof(mm_bseq1_t));
if (a.m == 0) kv_resize(mm_bseq1_t, 0, a, 256);
kv_pushp(mm_bseq1_t, 0, a, &s);
kseq2bseq(ks, s, with_qual, with_comment);
size += s->l_seq;
if (size >= chunk_size) {
if (frag_mode && a.a[a.n-1].l_seq < CHECK_PAIR_THRES) {
while ((ret = kseq_read(ks)) >= 0) {
kseq2bseq(ks, &fp->s, with_qual, with_comment);
if (mm_qname_same(fp->s.name, a.a[a.n-1].name)) {
kv_push(mm_bseq1_t, 0, a, fp->s);
memset(&fp->s, 0, sizeof(mm_bseq1_t));
} else break;
}
}
break;
}
}
if (ret < -1) {
if (a.n) fprintf(stderr, "[WARNING]\033[1;31m failed to parse the FASTA/FASTQ record next to '%s'. Continue anyway.\033[0m\n", a.a[a.n-1].name);
else fprintf(stderr, "[WARNING]\033[1;31m failed to parse the first FASTA/FASTQ record. Continue anyway.\033[0m\n");
}
*n_ = a.n;
return a.a;
}
mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int frag_mode, int *n_)
{
return mm_bseq_read3(fp, chunk_size, with_qual, 0, frag_mode, n_);
}
mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int *n_)
{
return mm_bseq_read2(fp, chunk_size, with_qual, 0, n_);
}
mm_bseq1_t *mm_bseq_read_frag2(int n_fp, mm_bseq_file_t **fp, int64_t chunk_size, int with_qual, int with_comment, int *n_)
{
int i;
int64_t size = 0;
kvec_t(mm_bseq1_t) a = {0,0,0};
*n_ = 0;
if (n_fp < 1) return 0;
while (1) {
int n_read = 0;
for (i = 0; i < n_fp; ++i)
if (kseq_read(fp[i]->ks) >= 0)
++n_read;
if (n_read < n_fp) {
if (n_read > 0)
fprintf(stderr, "[W::%s]\033[1;31m query files have different number of records; extra records skipped.\033[0m\n", __func__);
break; // some file reaches the end
}
if (a.m == 0) kv_resize(mm_bseq1_t, 0, a, 256);
for (i = 0; i < n_fp; ++i) {
mm_bseq1_t *s;
kv_pushp(mm_bseq1_t, 0, a, &s);
kseq2bseq(fp[i]->ks, s, with_qual, with_comment);
size += s->l_seq;
}
s = &seqs[n];
s->name = strdup(ks->name.s);
s->seq = strdup(ks->seq.s);
s->qual = with_qual && ks->qual.l? strdup(ks->qual.s) : 0;
s->l_seq = ks->seq.l;
size += seqs[n++].l_seq;
if (size >= chunk_size) break;
}
*n_ = n;
return seqs;
*n_ = a.n;
return a.a;
}
mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int64_t chunk_size, int with_qual, int *n_)
{
return mm_bseq_read_frag2(n_fp, fp, chunk_size, with_qual, 0, n_);
}
int mm_bseq_eof(mm_bseq_file_t *fp)
{
return ks_eof(fp->ks->f);
return (ks_eof(fp->ks->f) && fp->s.seq == 0);
}
+37 -2
View File
@@ -2,6 +2,7 @@
#define MM_BSEQ_H
#include <stdint.h>
#include <string.h>
#ifdef __cplusplus
extern "C" {
@@ -12,15 +13,49 @@ typedef struct mm_bseq_file_s mm_bseq_file_t;
typedef struct {
int l_seq, rid;
char *name, *seq, *qual;
char *name, *seq, *qual, *comment;
} mm_bseq1_t;
mm_bseq_file_t *mm_bseq_open(const char *fn);
void mm_bseq_close(mm_bseq_file_t *fp);
mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int chunk_size, int with_qual, int *n_);
mm_bseq1_t *mm_bseq_read3(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int with_comment, int frag_mode, int *n_);
mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int frag_mode, int *n_);
mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int *n_);
mm_bseq1_t *mm_bseq_read_frag2(int n_fp, mm_bseq_file_t **fp, int64_t chunk_size, int with_qual, int with_comment, int *n_);
mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int64_t chunk_size, int with_qual, int *n_);
int mm_bseq_eof(mm_bseq_file_t *fp);
extern unsigned char seq_nt4_table[256];
extern unsigned char seq_comp_table[256];
static inline int mm_qname_len(const char *s)
{
int l;
l = strlen(s);
return l >= 3 && s[l-1] >= '0' && s[l-1] <= '9' && s[l-2] == '/'? l - 2 : l;
}
static inline int mm_qname_same(const char *s1, const char *s2)
{
int l1, l2;
l1 = mm_qname_len(s1);
l2 = mm_qname_len(s2);
return (l1 == l2 && strncmp(s1, s2, l1) == 0);
}
static inline void mm_revcomp_bseq(mm_bseq1_t *s)
{
int i, t, l = s->l_seq;
for (i = 0; i < l>>1; ++i) {
t = s->seq[l - i - 1];
s->seq[l - i - 1] = seq_comp_table[(uint8_t)s->seq[i]];
s->seq[i] = seq_comp_table[t];
}
if (l&1) s->seq[l>>1] = seq_comp_table[(uint8_t)s->seq[l>>1]];
if (s->qual)
for (i = 0; i < l>>1; ++i)
t = s->qual[l - i - 1], s->qual[l - i - 1] = s->qual[i], s->qual[i] = t;
}
#ifdef __cplusplus
}
-149
View File
@@ -1,149 +0,0 @@
#include <stdint.h>
#include <string.h>
#include <stdio.h>
#include "minimap.h"
#include "mmpriv.h"
#include "kalloc.h"
static const char LogTable256[256] = {
#define LT(n) n, n, n, n, n, n, n, n, n, n, n, n, n, n, n, n
-1, 0, 1, 1, 2, 2, 2, 2, 3, 3, 3, 3, 3, 3, 3, 3,
LT(4), LT(5), LT(5), LT(6), LT(6), LT(6), LT(6),
LT(7), LT(7), LT(7), LT(7), LT(7), LT(7), LT(7), LT(7)
};
static inline int ilog2_32(uint32_t v)
{
register uint32_t t, tt;
if ((tt = v>>16)) return (t = tt>>8) ? 24 + LogTable256[t] : 16 + LogTable256[tt];
return (t = v>>8) ? 8 + LogTable256[t] : LogTable256[v];
}
int mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int min_cnt, int min_sc, int is_cdna, int64_t n, mm128_t *a, uint64_t **_u, void *km)
{ // TODO: make sure this works when n has more than 32 bits
int32_t st = 0, k, *f, *p, *t, *v, n_u, n_v;
int64_t i, j;
uint64_t *u, *u2, sum_qspan = 0;
float avg_qspan;
mm128_t *b, *w;
if (_u) *_u = 0;
f = (int32_t*)kmalloc(km, n * 4);
p = (int32_t*)kmalloc(km, n * 4);
t = (int32_t*)kmalloc(km, n * 4);
v = (int32_t*)kmalloc(km, n * 4);
memset(t, 0, n * 4);
for (i = 0; i < n; ++i) sum_qspan += a[i].y>>32&0xff;
avg_qspan = (float)sum_qspan / n;
// fill the score and backtrack arrays
for (i = 0; i < n; ++i) {
uint64_t ri = a[i].x;
int32_t qi = (int32_t)a[i].y, q_span = a[i].y>>32&0xff; // NB: only 8 bits of span is used!!!
int32_t max_f = q_span, max_j = -1, n_skip = 0, min_d, max_f_past = -INT32_MAX;
while (st < i && ri - a[st].x > max_dist_x) ++st;
for (j = i - 1; j >= st; --j) {
int64_t dr = ri - a[j].x;
int32_t dq = qi - (int32_t)a[j].y, dd, sc;
if (dr == 0 || dq <= 0 || dq > max_dist_y) continue;
dd = dr > dq? dr - dq : dq - dr;
if (dd > bw) continue;
max_f_past = max_f_past > f[j]? max_f_past : f[j];
min_d = dq < dr? dq : dr;
sc = min_d > q_span? q_span : dq < dr? dq : dr;
if (is_cdna) {
int c_log, c_lin;
c_lin = (int)(dd * .01 * avg_qspan);
c_log = ilog2_32(dd);
if (dr > dq) sc -= c_lin < c_log? c_lin : c_log;
else sc -= c_lin + (c_log>>1);
} else sc -= (int)(dd * .01 * avg_qspan) + (ilog2_32(dd)>>1);
sc += f[j];
if (sc > max_f) {
max_f = sc, max_j = j;
if (n_skip > 0) --n_skip;
} else if (t[j] == i) {
if (++n_skip > max_skip)
break;
}
if (p[j] >= 0) t[p[j]] = i;
}
f[i] = max_f, p[i] = max_j, v[i] = max_f_past; // v[] keeps the max score in the previous chain
}
// find the ending positions of chains
memset(t, 0, n * 4);
for (i = 0; i < n; ++i)
if (p[i] >= 0) t[p[i]] = 1;
for (i = n_u = 0; i < n; ++i)
if (t[i] == 0 && v[i] >= min_sc)
++n_u;
if (n_u == 0) {
kfree(km, f); kfree(km, p); kfree(km, t); kfree(km, v);
return 0;
}
u = (uint64_t*)kmalloc(km, n_u * 8);
for (i = n_u = 0; i < n; ++i) {
if (t[i] == 0 && v[i] >= min_sc) {
j = i;
while (j >= 0 && f[j] < v[j]) j = p[j]; // find the point that maximizes f[]
if (j < 0) j = i; // TODO: this should really be assert(j>=0)
u[n_u++] = (uint64_t)f[j] << 32 | j;
}
}
radix_sort_64(u, u + n_u);
for (i = 0; i < n_u>>1; ++i) { // reverse, s.t. the highest scoring chain is the first
uint64_t t = u[i];
u[i] = u[n_u - i - 1], u[n_u - i - 1] = t;
}
// backtrack
memset(t, 0, n * 4);
for (i = n_v = k = 0; i < n_u; ++i) { // starting from the highest score
int32_t n_v0 = n_v, k0 = k;
j = (int32_t)u[i];
do {
v[n_v++] = j;
t[j] = 1;
j = p[j];
} while (j >= 0 && t[j] == 0);
if (j < 0) {
if (n_v - n_v0 >= min_cnt) u[k++] = u[i]>>32<<32 | (n_v - n_v0);
} else if ((int32_t)(u[i]>>32) - f[j] >= min_sc) {
if (n_v - n_v0 >= min_cnt) u[k++] = ((u[i]>>32) - f[j]) << 32 | (n_v - n_v0);
}
if (k0 == k) n_v = n_v0; // no new chain added, reset
}
n_u = k, *_u = u; // NB: note that u[] may not be sorted by score here
// free
kfree(km, f); kfree(km, p); kfree(km, t);
// write the result to b[]
b = (mm128_t*)kmalloc(km, n_v * sizeof(mm128_t));
for (i = 0, k = 0; i < n_u; ++i) {
int32_t k0 = k, ni = (int32_t)u[i];
for (j = 0; j < ni; ++j)
b[k] = a[v[k0 + (ni - j - 1)]], ++k;
}
kfree(km, v);
// sort u[] and a[] by a[].x, such that adjacent chains may be joined (required by mm_join_long)
w = (mm128_t*)kmalloc(km, n_u * sizeof(mm128_t));
for (i = k = 0; i < n_u; ++i) {
w[i].x = b[k].x, w[i].y = (uint64_t)k<<32|i;
k += (int32_t)u[i];
}
radix_sort_128x(w, w + n_u);
u2 = (uint64_t*)kmalloc(km, n_u * 8);
for (i = k = 0; i < n_u; ++i) {
int32_t j = (int32_t)w[i].y, n = (int32_t)u[j];
u2[i] = u[j];
memcpy(&a[k], &b[w[i].y>>32], n * sizeof(mm128_t));
k += n;
}
memcpy(u, u2, n_u * 8);
kfree(km, b); kfree(km, w); kfree(km, u2);
return n_u;
}
+30
View File
@@ -0,0 +1,30 @@
## Contributor Code of Conduct
As contributors and maintainers of this project, we pledge to respect all
people who contribute through reporting issues, posting feature requests,
updating documentation, submitting pull requests or patches, and other
activities.
We are committed to making participation in this project a harassment-free
experience for everyone, regardless of level of experience, gender, gender
identity and expression, sexual orientation, disability, personal appearance,
body size, race, age, or religion.
Examples of unacceptable behavior by participants include the use of sexual
language or imagery, derogatory comments or personal attacks, trolling, public
or private harassment, insults, or other unprofessional conduct.
Project maintainers have the right and responsibility to remove, edit, or
reject comments, commits, code, wiki edits, issues, and other contributions
that are not aligned to this Code of Conduct. Project maintainers or
contributors who do not follow the Code of Conduct may be removed from the
project team.
Instances of abusive, harassing, or otherwise unacceptable behavior may be
reported by opening an issue or contacting the maintainer via email.
This Code of Conduct is adapted from the [Contributor Covenant][cc], [version
1.0.0][v1].
[cc]: http://contributor-covenant.org/
[v1]: http://contributor-covenant.org/version/1/0/0/
+243
View File
@@ -0,0 +1,243 @@
## Table of Contents
- [Introduction & Installation](#intro)
- [Mapping Genomic Reads](#map-reads)
* [Mapping long reads](#map-pb)
* [Mapping Illumina paired-end reads](#map-sr)
* [Evaluating mapping accuracy with simulated reads (for developers)](#mapeval)
- [Mapping Long RNA-seq Reads](#map-rna)
* [Mapping Nanopore 2D cDNA reads](#map-ont-cdna-2d)
* [Mapping Nanopore direct-RNA reads](#map-direct-rna)
* [Mapping PacBio Iso-seq reads](#map-iso-seq)
- [Full-Genome Alignment](#genome-aln)
* [Intra-species assembly alignment](#asm-to-ref)
* [Cross-species full-genome alignment](#x-species)
* [Eyeballing alignment](#view-aln)
* [Calling variants from assembly-to-reference alignment](#asm-var)
* [Constructing self-homology map](#hom-map)
* [Lift Over (for developers)](#liftover)
- [Read Overlap](#read-overlap)
* [Long-read overlap](#long-read-overlap)
* [Evaluating overlap sensitivity (for developers)](#ov-eval)
## <a name="intro"></a>Introduction & Installation
This cookbook walks you through a variety of applications of minimap2 and its
companion script `paftools.js`. All data here are freely available from the
minimap2 release page at version tag [v2.10][v2.10]. Some examples only work
with v2.10 or later.
To acquire the data used in this cookbook and to install minimap2 and paftools,
please follow the command lines below:
```sh
# install minimap2 executables
curl -L https://github.com/lh3/minimap2/releases/download/v2.24/minimap2-2.24_x64-linux.tar.bz2 | tar jxf -
cp minimap2-2.24_x64-linux/{minimap2,k8,paftools.js} . # copy executables
export PATH="$PATH:"`pwd` # put the current directory on PATH
# download example datasets
curl -L https://github.com/lh3/minimap2/releases/download/v2.10/cookbook-data.tgz | tar zxf -
```
## <a name="map-reads"></a>Mapping Genomic Reads
### <a name="map-pb"></a>Mapping long reads
```sh
minimap2 -ax map-pb -t4 ecoli_ref.fa ecoli_p6_25x_canu.fa > mapped.sam
```
Alternatively, you can create a minimap2 index first and then map:
```sh
minimap2 -x map-pb -d ecoli-pb.mmi ecoli_ref.fa # create an index
minimap2 -ax map-pb ecoli-pb.mmi ecoli_p6_25x_canu.fa > mapped.sam
```
This will save you a couple of minutes when you map against the human genome.
**HOWEVER**, key algorithm parameters such as the k-mer length and window
size can't be changed after indexing. Minimap2 will give you a warning if
parameters used in a pre-built index doesn't match parameters on the command
line. **Please always make sure you are using an intended pre-built index.**
### <a name="map-sr"></a>Mapping Illumina paired-end reads:
```sh
minimap2 -ax sr -t4 ecoli_ref.fa ecoli_mason_1.fq ecoli_mason_2.fq > mapped-sr.sam
```
### <a name="mapeval"></a>Evaluating mapping accuracy with simulated reads (for developers)
```sh
minimap2 -ax sr ecoli_ref.fa ecoli_mason_1.fq ecoli_mason_2.fq | paftools.js mapeval -
```
The output is:
```
Q 60 19712 0 0.000000000 19712
Q 0 282 219 0.010953286 19994
U 6
```
where a `U`-line gives the number of unmapped reads (for SAM input only); a
`Q`-line gives:
1. Mapping quality (mapQ) threshold
2. Number of mapped reads between this threshold and the previous mapQ threshold.
3. Number of wrong mappings in the same mapQ interval
4. Accumulative mapping error rate
5. Accumulative number of mappings
For `paftools.js mapeval` to work, you need to encode the true read positions
in read names in the right format. For [pbsim2][pbsim] and [mason2][mason2], we
provide scripts to generate the right format. Simulated reads in this cookbook
were created with the following command lines:
```sh
# in the pbsim2 source code directory:
src/pbsim --depth 1 --length-min 5000 --length-mean 20000 --accuracy-mean 0.95 --hmm_model data/R94.model ../ecoli_ref.fa
paftools.js pbsim2fq ../ecoli_ref.fa.fai sd_0001.maf > ../ecoli_pbsim.fa
# mason2 simulation
mason_simulator --illumina-prob-mismatch-scale 2.5 -ir ecoli_ref.fa -n 10000 -o tmp-l.fq -or tmp-r.fq -oa tmp.sam
paftools.js mason2fq tmp.sam | seqtk seq -1 > ecoli_mason_1.fq
paftools.js mason2fq tmp.sam | seqtk seq -2 > ecoli_mason_2.fq
```
## <a name="map-rna"></a>Mapping Long RNA-seq Reads
### <a name="map-ont-cdna-2d"></a>Mapping Nanopore 2D cDNA reads
```sh
minimap2 -ax splice SIRV_E2.fa SIRV_ont-cdna.fa > aln.sam
```
You can compare the alignment to the true annotations with:
```sh
paftools.js junceval SIRV_E2C.gtf aln.sam
```
It gives the percentage of introns found in the annotation. For SIRV data, it
is possible to achieve higher junction accuracy with
```sh
minimap2 -ax splice --splice-flank=no SIRV_E2.fa SIRV_ont-cdna.fa | paftools.js junceval SIRV_E2C.gtf
```
This is because minimap2 models one additional evolutionarily conserved base
around a canonical junction, but SIRV doesn't honor this signal. Option
`--splice-flank=no` asks minimap2 no to model this additional base.
In the output a tag `ts:A:+` indicates that the read strand is the same as the
transcript strand; `ts:A:-` indicates the read strand is opposite to the
transcript strand. This tag is inferred from the GT-AG signal and is thus only
available to spliced reads.
### <a name="map-direct-rna"></a>Mapping Nanopore direct-RNA reads
```sh
minimap2 -ax splice -k14 -uf SIRV_E2.fa SIRV_ont-drna.fa > aln.sam
```
Direct-RNA reads are noisier, so we use a shorter k-mer for improved
sensitivity. Here, option `-uf` forces minimap2 to map reads to the forward
transcript strand only because direct-RNA reads are stranded. Again, applying
`--splice-flank=no` helps junction accuracy for SIRV data.
### <a name="map-iso-seq"></a>Mapping PacBio Iso-seq reads
```sh
minimap2 -ax splice -uf -C5 SIRV_E2.fa SIRV_iso-seq.fq > aln.sam
```
Option `-C5` reduces the penalty on non-canonical splicing sites. It helps
to align such sites correctly for data with low error rate such as Iso-seq
reads and traditional cDNAs. On this example, minimap2 makes one junction
error. Applying `--splice-flank=no` fixes this alignment error.
Note that the command line above is optimized for the final Iso-seq reads.
PacBio's Iso-seq pipeline produces intermediate sequences at varying quality.
For example, some intermediate reads are not stranded. For these reads, option
`-uf` will lead to more errors. Please revise the minimap2 command line
accordingly.
## <a name="genome-aln"></a>Full-Genome Alignment
### <a name="asm-to-ref"></a>Intra-species assembly alignment
```sh
# option "--cs" is recommended as paftools.js may need it
minimap2 -cx asm5 --cs ecoli_ref.fa ecoli_canu.fa > ecoli_canu.paf
```
Here `ecoli_canu.fa` is the Canu assembly of `ecoli_p6_25x_canu.fa`. This
command line outputs alignments in the [PAF format][paf]. Use `-a` instead of
`-c` to get output in the SAM format.
### <a name="x-species"></a>Cross-species full-genome alignment
```sh
minimap2 -cx asm20 --cs ecoli_ref.fa ecoli_O104:H4.fa > ecoli_O104:H4.paf
sort -k6,6 -k8,8n ecoli_O104:H4.paf | paftools.js call -f ecoli_ref.fa -L10000 -l1000 - > out.vcf
```
Minimap2 has three presets for full-genome alignment: "asm5" for sequence
divergence below 1%, "asm10" for divergence around a couple of percent and
"asm20" for divergence not more than 10%. In theory, with the right setting,
minimap2 should work for sequence pairs with sequence divergence up to ~15%,
but this has not been carefully evaluated.
### <a name="view-aln"></a>Eyeballing alignment
```sh
# option "--cs" required; minimap2-r741 or higher required for the "asm20" preset
minimap2 -cx asm20 --cs ecoli_ref.fa ecoli_O104:H4.fa | paftools.js view - | less -S
```
This prints the alignment in a BLAST-like format.
### <a name="asm-var"></a>Calling variants from assembly-to-reference alignment
```sh
# don't forget the "--cs" option; otherwise it doesn't work
minimap2 -cx asm5 --cs ecoli_ref.fa ecoli_canu.fa \
| sort -k6,6 -k8,8n \
| paftools.js call -f ecoli_ref.fa - > out.vcf
```
Without option `-f`, `paftools.js call` outputs in a custom format. In this
format, lines starting with `R` give the regions covered by one contig only.
This information is not available in the VCF output.
### <a name="hom-map"></a>Constructing self-homology map
```sh
minimap2 -DP -k19 -w19 -m200 ecoli_ref.fa ecoli_ref.fa > out.paf
```
Option `-D` asks minimap2 to ignore anchors from perfect self match and `-P`
outputs all chains. For large nomes, we don't recommend to perform base-level
alignment (with `-c`, `-a` or `--cs`) when `-P` is applied. This is because
base-alignment is slow and occasionally gives wrong alignments close to the
diagonal of a dotter plot. For E. coli, though, base-alignment is still fast.
### <a name="liftover"></a>Lift over (for developers)
```sh
minimap2 -cx asm5 --cs ecoli_ref.fa ecoli_canu.fa > ecoli_canu.paf
echo -e 'tig00000001\t200000\t300000' | paftools.js liftover ecoli_canu.paf -
```
This lifts over a region on query sequences to one or multiple regions on
reference sequences. Note that this paftools.js command may not be efficient
enough to lift millions of regions.
## <a name="read-overlap"></a>Read Overlap
### <a name="long-read-overlap"></a>Long read overlap
```sh
# For pacbio reads:
minimap2 -x ava-pb ecoli_p6_25x_canu.fa ecoli_p6_25x_canu.fa > overlap.paf
# For Nanopore reads (ava-ont also works with PacBio but not as good):
minimap2 -x ava-ont -r 10000 ecoli_p6_25x_canu.fa ecoli_p6_25x_canu.fa > overlap.paf
# If you have miniasm installed:
miniasm -f ecoli_p6_25x_canu.fa overlap.paf > asm.gfa
```
Here we explicitly applied `-r 10000`. We are considering to set this as the
default for the `ava-ont` mode as this seems to improve the contiguity for
nanopore read assembly (Loman, personal communication).
*Minimap2 doesn't work well with short-read overlap.*
### <a name="ov-eval"></a>Evaluating overlap sensitivity (for developers)
```sh
# read to reference mapping
minimap2 -cx map-pb ecoli_ref.fa ecoli_p6_25x_canu.fa > to-ref.paf
# evaluate overlap sensitivity
sort -k6,6 -k8,8n to-ref.paf | paftools.js ov-eval - overlap.paf
```
You can see that for PacBio reads, minimap2 achieves higher overlap sensitivity
with `-x ava-pb` (99% vs 93% with `-x ava-ont`).
[pbsim]: https://github.com/yukiteruono/pbsim2
[mason2]: https://github.com/seqan/seqan/tree/master/apps/mason2
[paf]: https://github.com/lh3/miniasm/blob/master/PAF.md
[v2.10]: https://github.com/lh3/minimap2/releases/tag/v2.10
+64
View File
@@ -0,0 +1,64 @@
#include <math.h>
#include <stdio.h>
#include <stdlib.h>
#include <assert.h>
#include "mmpriv.h"
static inline int32_t get_for_qpos(int32_t qlen, const mm128_t *a)
{
int32_t x = (int32_t)a->y;
int32_t q_span = a->y>>32 & 0xff;
if (a->x>>63)
x = qlen - 1 - (x + 1 - q_span); // revert the position to the forward strand of query
return x;
}
static int get_mini_idx(int qlen, const mm128_t *a, int32_t n, const uint64_t *mini_pos)
{
int32_t x, L = 0, R = n - 1;
x = get_for_qpos(qlen, a);
while (L <= R) { // binary search
int32_t m = ((uint64_t)L + R) >> 1;
int32_t y = (int32_t)mini_pos[m];
if (y < x) L = m + 1;
else if (y > x) R = m - 1;
else return m;
}
return -1;
}
void mm_est_err(const mm_idx_t *mi, int qlen, int n_regs, mm_reg1_t *regs, const mm128_t *a, int32_t n, const uint64_t *mini_pos)
{
int i;
uint64_t sum_k = 0;
float avg_k;
if (n == 0) return;
for (i = 0; i < n; ++i)
sum_k += mini_pos[i] >> 32 & 0xff;
avg_k = (float)sum_k / n;
for (i = 0; i < n_regs; ++i) {
mm_reg1_t *r = &regs[i];
int32_t st, en, j, k, n_match, n_tot, l_ref;
r->div = -1.0f;
if (r->cnt == 0) continue;
st = en = get_mini_idx(qlen, r->rev? &a[r->as + r->cnt - 1] : &a[r->as], n, mini_pos);
if (st < 0) {
if (mm_verbose >= 2)
fprintf(stderr, "[WARNING] logic inconsistency in mm_est_err(). Please contact the developer.\n");
continue;
}
l_ref = mi->seq[r->rid].len;
for (k = 1, j = st + 1, n_match = 1; j < n && k < r->cnt; ++j) {
int32_t x;
x = get_for_qpos(qlen, r->rev? &a[r->as + r->cnt - 1 - k] : &a[r->as + k]);
if (x == (int32_t)mini_pos[j])
++k, en = j, ++n_match;
}
n_tot = en - st + 1;
if (r->qs > avg_k && r->rs > avg_k) ++n_tot;
if (qlen - r->qs > avg_k && l_ref - r->re > avg_k) ++n_tot;
r->div = n_match >= n_tot? 0.0f : (float)(1.0 - pow((double)n_match / n_tot, 1.0 / avg_k));
}
}
+34 -34
View File
@@ -11,53 +11,53 @@ KSEQ_INIT(gzFile, gzread)
int main(int argc, char *argv[])
{
mm_idxopt_t iopt;
mm_mapopt_t mopt;
int n_threads = 3;
mm_verbose = 2; // disable message output to stderr
mm_set_opt(0, &iopt, &mopt);
mopt.flag |= MM_F_CIGAR; // perform alignment
if (argc < 3) {
fprintf(stderr, "Usage: minimap2-lite <target.fa> <query.fa>\n");
return 1;
}
// open query file for reading; you may use your favorite FASTA/Q parser
gzFile f = gzopen(argv[2], "r");
assert(f);
kseq_t *ks = kseq_init(f);
// create index for target; we are creating one index for all target sequence
int n_threads = 4, w = 10, k = 15, is_hpc = 0;
mm_idx_t *mi = mm_idx_build(argv[1], w, k, is_hpc, n_threads);
assert(mi);
// mapping
mm_mapopt_t opt;
mm_mapopt_init(&opt); // initialize mapping parameters
mm_mapopt_update(&opt, mi); // this sets the maximum minimizer occurrence; TODO: set a better default in mm_mapopt_init()!
opt.flag |= MM_F_CIGAR; // perform alignment
mm_tbuf_t *tbuf = mm_tbuf_init(); // thread buffer; for multi-threading, allocate one tbuf for each thread
while (kseq_read(ks) >= 0) { // each kseq_read() call reads one query sequence
mm_reg1_t *reg;
int j, i, n_reg;
// get all hits for the query
reg = mm_map(mi, ks->seq.l, ks->seq.s, &n_reg, tbuf, &opt, 0);
// traverse hits and print them out
for (j = 0; j < n_reg; ++j) {
mm_reg1_t *r = &reg[j];
assert(r->p); // with MM_F_CIGAR, this should not be NULL
printf("%s\t%d\t%d\t%d\t%c\t", ks->name.s, ks->seq.l, r->qs, r->qe, "+-"[r->rev]);
printf("%s\t%d\t%d\t%d\t%d\t%d\t%d\tcg:Z:", mi->seq[r->rid].name, mi->seq[r->rid].len, r->rs, r->re,
r->p->blen - r->p->n_ambi - r->p->n_diff, r->p->blen, r->mapq);
for (i = 0; i < r->p->n_cigar; ++i) // IMPORTANT: this gives the CIGAR in the aligned regions. NO soft/hard clippings!
printf("%d%c", r->p->cigar[i]>>4, "MIDSHN"[r->p->cigar[i]&0xf]);
putchar('\n');
free(r->p);
// open index reader
mm_idx_reader_t *r = mm_idx_reader_open(argv[1], &iopt, 0);
mm_idx_t *mi;
while ((mi = mm_idx_reader_read(r, n_threads)) != 0) { // traverse each part of the index
mm_mapopt_update(&mopt, mi); // this sets the maximum minimizer occurrence; TODO: set a better default in mm_mapopt_init()!
mm_tbuf_t *tbuf = mm_tbuf_init(); // thread buffer; for multi-threading, allocate one tbuf for each thread
gzrewind(f);
kseq_rewind(ks);
while (kseq_read(ks) >= 0) { // each kseq_read() call reads one query sequence
mm_reg1_t *reg;
int j, i, n_reg;
reg = mm_map(mi, ks->seq.l, ks->seq.s, &n_reg, tbuf, &mopt, 0); // get all hits for the query
for (j = 0; j < n_reg; ++j) { // traverse hits and print them out
mm_reg1_t *r = &reg[j];
assert(r->p); // with MM_F_CIGAR, this should not be NULL
printf("%s\t%d\t%d\t%d\t%c\t", ks->name.s, ks->seq.l, r->qs, r->qe, "+-"[r->rev]);
printf("%s\t%d\t%d\t%d\t%d\t%d\t%d\tcg:Z:", mi->seq[r->rid].name, mi->seq[r->rid].len, r->rs, r->re, r->mlen, r->blen, r->mapq);
for (i = 0; i < r->p->n_cigar; ++i) // IMPORTANT: this gives the CIGAR in the aligned regions. NO soft/hard clippings!
printf("%d%c", r->p->cigar[i]>>4, MM_CIGAR_STR[r->p->cigar[i]&0xf]);
putchar('\n');
free(r->p);
}
free(reg);
}
free(reg);
mm_tbuf_destroy(tbuf);
mm_idx_destroy(mi);
}
mm_tbuf_destroy(tbuf);
// deallocate index and close the query file
mm_idx_destroy(mi);
kseq_destroy(ks);
mm_idx_reader_close(r); // close the index reader
kseq_destroy(ks); // close the query file
gzclose(f);
return 0;
}
+328 -83
View File
@@ -43,6 +43,13 @@ static void mm_sprintf_lite(kstring_t *s, const char *fmt, ...)
if (c < 0) buf[l++] = '-';
str_enlarge(s, l);
for (i = l - 1; i >= 0; --i) s->s[s->l++] = buf[i];
} else if (*p == 'u') {
int i, l = 0;
uint32_t x;
x = va_arg(ap, uint32_t);
do { buf[l++] = x%10 + '0'; x /= 10; } while (x > 0);
str_enlarge(s, l);
for (i = l - 1; i >= 0; --i) s->s[s->l++] = buf[i];
} else if (*p == 's') {
char *r = va_arg(ap, char*);
str_copy(s, r, r + strlen(r));
@@ -72,11 +79,11 @@ static char *mm_escape(char *s)
return s;
}
static void sam_write_rg_line(kstring_t *str, const char *s)
static int sam_write_rg_line(kstring_t *str, const char *s)
{
char *p, *q, *r, *rg_line = 0;
memset(mm_rg_id, 0, 256);
if (s == 0) return;
if (s == 0) return 0;
if (strstr(s, "@RG") != s) {
if (mm_verbose >= 1) fprintf(stderr, "[ERROR] the read group line is not started with @RG\n");
goto err_set_rg;
@@ -85,7 +92,8 @@ static void sam_write_rg_line(kstring_t *str, const char *s)
if (mm_verbose >= 1) fprintf(stderr, "[ERROR] the read group line contained literal <tab> characters -- replace with escaped tabs: \\t\n");
goto err_set_rg;
}
rg_line = strdup(s);
rg_line = (char*)malloc(strlen(s) + 1);
strcpy(rg_line, s);
mm_escape(rg_line);
if ((p = strstr(rg_line, "\tID:")) == 0) {
if (mm_verbose >= 1) fprintf(stderr, "[ERROR] no ID within the read group line\n");
@@ -100,15 +108,23 @@ static void sam_write_rg_line(kstring_t *str, const char *s)
for (q = p, r = mm_rg_id; *q && *q != '\t' && *q != '\n'; ++q)
*r++ = *q;
mm_sprintf_lite(str, "%s\n", rg_line);
return 0;
err_set_rg:
free(rg_line);
return -1;
}
void mm_write_sam_hdr_no_SQ(const char *rg, const char *ver, int argc, char *argv[])
int mm_write_sam_hdr(const mm_idx_t *idx, const char *rg, const char *ver, int argc, char *argv[])
{
kstring_t str = {0,0,0};
sam_write_rg_line(&str, rg);
int ret = 0;
if (idx) {
uint32_t i;
for (i = 0; i < idx->n_seq; ++i)
mm_sprintf_lite(&str, "@SQ\tSN:%s\tLN:%d\n", idx->seq[i].name, idx->seq[i].len);
}
if (rg) ret = sam_write_rg_line(&str, rg);
mm_sprintf_lite(&str, "@PG\tID:minimap2\tPN:minimap2");
if (ver) mm_sprintf_lite(&str, "\tVN:%s", ver);
if (argc > 1) {
@@ -117,159 +133,361 @@ void mm_write_sam_hdr_no_SQ(const char *rg, const char *ver, int argc, char *arg
for (i = 1; i < argc; ++i)
mm_sprintf_lite(&str, " %s", argv[i]);
}
mm_sprintf_lite(&str, "\n");
fputs(str.s, stdout);
mm_err_puts(str.s);
free(str.s);
return ret;
}
static void write_cs(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r)
static void write_cs_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq, const mm_reg1_t *r, char *tmp, int no_iden, int write_tag)
{
extern unsigned char seq_nt4_table[256];
int i, q_off, t_off;
uint8_t *qseq, *tseq;
char *tmp;
if (r->p == 0) return;
mm_sprintf_lite(s, "\tcs:Z:");
qseq = (uint8_t*)kmalloc(km, r->qe - r->qs);
tseq = (uint8_t*)kmalloc(km, r->re - r->rs);
tmp = (char*)kmalloc(km, r->re - r->rs > r->qe - r->qs? r->re - r->rs + 1 : r->qe - r->qs + 1);
mm_idx_getseq(mi, r->rid, r->rs, r->re, tseq);
if (!r->rev) {
for (i = r->qs; i < r->qe; ++i)
qseq[i - r->qs] = seq_nt4_table[(uint8_t)t->seq[i]];
} else {
for (i = r->qs; i < r->qe; ++i) {
uint8_t c = seq_nt4_table[(uint8_t)t->seq[i]];
qseq[r->qe - i - 1] = c >= 4? 4 : 3 - c;
}
}
for (i = q_off = t_off = 0; i < r->p->n_cigar; ++i) {
if (write_tag) mm_sprintf_lite(s, "\tcs:Z:");
for (i = q_off = t_off = 0; i < (int)r->p->n_cigar; ++i) {
int j, op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
assert(op >= 0 && op <= 2);
if (op == 0) {
assert((op >= MM_CIGAR_MATCH && op <= MM_CIGAR_N_SKIP) || op == MM_CIGAR_EQ_MATCH || op == MM_CIGAR_X_MISMATCH);
if (op == MM_CIGAR_MATCH || op == MM_CIGAR_EQ_MATCH || op == MM_CIGAR_X_MISMATCH) {
int l_tmp = 0;
for (j = 0; j < len; ++j) {
if (qseq[q_off + j] != tseq[t_off + j]) {
if (l_tmp > 0) {
tmp[l_tmp] = 0;
mm_sprintf_lite(s, "=%s", tmp);
if (!no_iden) {
tmp[l_tmp] = 0;
mm_sprintf_lite(s, "=%s", tmp);
} else mm_sprintf_lite(s, ":%d", l_tmp);
l_tmp = 0;
}
mm_sprintf_lite(s, "*%c%c", "acgtn"[tseq[t_off + j]], "acgtn"[qseq[q_off + j]]);
} else tmp[l_tmp++] = "ACGTN"[qseq[q_off + j]];
}
if (l_tmp > 0) {
tmp[l_tmp] = 0;
mm_sprintf_lite(s, "=%s", tmp);
if (!no_iden) {
tmp[l_tmp] = 0;
mm_sprintf_lite(s, "=%s", tmp);
} else mm_sprintf_lite(s, ":%d", l_tmp);
}
q_off += len, t_off += len;
} else if (op == 1) {
} else if (op == MM_CIGAR_INS) {
for (j = 0, tmp[len] = 0; j < len; ++j)
tmp[j] = "acgtn"[qseq[q_off + j]];
mm_sprintf_lite(s, "+%s", tmp);
q_off += len;
} else if (op == 2) {
} else if (op == MM_CIGAR_DEL) {
for (j = 0, tmp[len] = 0; j < len; ++j)
tmp[j] = "acgtn"[tseq[t_off + j]];
mm_sprintf_lite(s, "-%s", tmp);
t_off += len;
} else { // intron
assert(len >= 2);
mm_sprintf_lite(s, "~%c%c%d%c%c", "acgtn"[tseq[t_off]], "acgtn"[tseq[t_off+1]],
len, "acgtn"[tseq[t_off+len-2]], "acgtn"[tseq[t_off+len-1]]);
t_off += len;
}
}
assert(t_off == r->re - r->rs && q_off == r->qe - r->qs);
}
static void write_MD_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq, const mm_reg1_t *r, char *tmp, int write_tag)
{
int i, q_off, t_off, l_MD = 0;
if (write_tag) mm_sprintf_lite(s, "\tMD:Z:");
for (i = q_off = t_off = 0; i < (int)r->p->n_cigar; ++i) {
int j, op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
assert((op >= MM_CIGAR_MATCH && op <= MM_CIGAR_N_SKIP) || op == MM_CIGAR_EQ_MATCH || op == MM_CIGAR_X_MISMATCH);
if (op == MM_CIGAR_MATCH || op == MM_CIGAR_EQ_MATCH || op == MM_CIGAR_X_MISMATCH) {
for (j = 0; j < len; ++j) {
if (qseq[q_off + j] != tseq[t_off + j]) {
mm_sprintf_lite(s, "%d%c", l_MD, "ACGTN"[tseq[t_off + j]]);
l_MD = 0;
} else ++l_MD;
}
q_off += len, t_off += len;
} else if (op == MM_CIGAR_INS) {
q_off += len;
} else if (op == MM_CIGAR_DEL) {
for (j = 0, tmp[len] = 0; j < len; ++j)
tmp[j] = "ACGTN"[tseq[t_off + j]];
mm_sprintf_lite(s, "%d^%s", l_MD, tmp);
l_MD = 0;
t_off += len;
} else if (op == MM_CIGAR_N_SKIP) {
t_off += len;
}
}
if (l_MD > 0) mm_sprintf_lite(s, "%d", l_MD);
assert(t_off == r->re - r->rs && q_off == r->qe - r->qs);
}
static void write_cs_or_MD(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int no_iden, int is_MD, int write_tag, int is_qstrand)
{
extern unsigned char seq_nt4_table[256];
int i;
uint8_t *qseq, *tseq;
char *tmp;
if (r->p == 0) return;
qseq = (uint8_t*)kmalloc(km, r->qe - r->qs);
tseq = (uint8_t*)kmalloc(km, r->re - r->rs);
tmp = (char*)kmalloc(km, r->re - r->rs > r->qe - r->qs? r->re - r->rs + 1 : r->qe - r->qs + 1);
if (is_qstrand) {
mm_idx_getseq2(mi, r->rev, r->rid, r->rs, r->re, tseq);
for (i = r->qs; i < r->qe; ++i)
qseq[i - r->qs] = seq_nt4_table[(uint8_t)t->seq[i]];
} else {
mm_idx_getseq(mi, r->rid, r->rs, r->re, tseq);
if (!r->rev) {
for (i = r->qs; i < r->qe; ++i)
qseq[i - r->qs] = seq_nt4_table[(uint8_t)t->seq[i]];
} else {
for (i = r->qs; i < r->qe; ++i) {
uint8_t c = seq_nt4_table[(uint8_t)t->seq[i]];
qseq[r->qe - i - 1] = c >= 4? 4 : 3 - c;
}
}
}
if (is_MD) write_MD_core(s, tseq, qseq, r, tmp, write_tag);
else write_cs_core(s, tseq, qseq, r, tmp, no_iden, write_tag);
kfree(km, qseq); kfree(km, tseq); kfree(km, tmp);
}
int mm_gen_cs_or_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int is_MD, int no_iden, int is_qstrand)
{
mm_bseq1_t t;
kstring_t str;
str.s = *buf, str.l = 0, str.m = *max_len;
t.l_seq = strlen(seq);
t.seq = (char*)seq;
write_cs_or_MD(km, &str, mi, &t, r, no_iden, is_MD, 0, is_qstrand);
*max_len = str.m;
*buf = str.s;
return str.l;
}
int mm_gen_cs(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int no_iden)
{
return mm_gen_cs_or_MD(km, buf, max_len, mi, r, seq, 0, no_iden, 0);
}
int mm_gen_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq)
{
return mm_gen_cs_or_MD(km, buf, max_len, mi, r, seq, 1, 0, 0);
}
static inline void write_tags(kstring_t *s, const mm_reg1_t *r)
{
int type = r->inv? 'I' : r->id == r->parent? 'P' : 'S';
mm_sprintf_lite(s, "\ttp:A:%c\tcm:i:%d\ts1:i:%d", type, r->cnt, r->score);
if (r->parent == r->id) mm_sprintf_lite(s, "\ts2:i:%d", r->subsc);
if (r->split) mm_sprintf_lite(s, "\tzd:i:%d", r->split);
int type;
if (r->id == r->parent) type = r->inv? 'I' : 'P';
else type = r->inv? 'i' : 'S';
if (r->p) {
mm_sprintf_lite(s, "\tNM:i:%d\tms:i:%d\tAS:i:%d\tnn:i:%d", r->p->n_diff, r->p->dp_max, r->p->dp_score, r->p->n_ambi);
mm_sprintf_lite(s, "\tNM:i:%d\tms:i:%d\tAS:i:%d\tnn:i:%d", r->blen - r->mlen + r->p->n_ambi, r->p->dp_max, r->p->dp_score, r->p->n_ambi);
if (r->p->trans_strand == 1 || r->p->trans_strand == 2)
mm_sprintf_lite(s, "\tts:A:%c", "?+-?"[r->p->trans_strand]);
}
mm_sprintf_lite(s, "\ttp:A:%c\tcm:i:%d\ts1:i:%d", type, r->cnt, r->score);
if (r->parent == r->id) mm_sprintf_lite(s, "\ts2:i:%d", r->subsc);
if (r->p) {
char buf[16];
double div;
div = 1.0 - mm_event_identity(r);
if (div == 0.0) buf[0] = '0', buf[1] = 0;
else snprintf(buf, 16, "%.4f", 1.0 - mm_event_identity(r));
mm_sprintf_lite(s, "\tde:f:%s", buf);
} else if (r->div >= 0.0f && r->div <= 1.0f) {
char buf[16];
if (r->div == 0.0f) buf[0] = '0', buf[1] = 0;
else snprintf(buf, 16, "%.4f", r->div);
mm_sprintf_lite(s, "\tdv:f:%s", buf);
}
if (r->split) mm_sprintf_lite(s, "\tzd:i:%d", r->split);
}
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int opt_flag)
void mm_write_paf3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag, int rep_len)
{
s->l = 0;
if (r == 0) {
mm_sprintf_lite(s, "%s\t%d\t0\t0\t*\t*\t0\t0\t0\t0\t0\t0", t->name, t->l_seq);
if (rep_len >= 0) mm_sprintf_lite(s, "\trl:i:%d", rep_len);
return;
}
mm_sprintf_lite(s, "%s\t%d\t%d\t%d\t%c\t", t->name, t->l_seq, r->qs, r->qe, "+-"[r->rev]);
if (mi->seq[r->rid].name) mm_sprintf_lite(s, "%s", mi->seq[r->rid].name);
else mm_sprintf_lite(s, "%d", r->rid);
mm_sprintf_lite(s, "\t%d\t%d\t%d", mi->seq[r->rid].len, r->rs, r->re);
if (r->p) mm_sprintf_lite(s, "\t%d\t%d", r->p->blen - r->p->n_ambi - r->p->n_diff, r->p->blen);
else mm_sprintf_lite(s, "\t%d\t%d", r->fuzzy_mlen, r->fuzzy_blen);
mm_sprintf_lite(s, "\t%d", mi->seq[r->rid].len);
if ((opt_flag & MM_F_QSTRAND) && r->rev)
mm_sprintf_lite(s, "\t%d\t%d", mi->seq[r->rid].len - r->re, mi->seq[r->rid].len - r->rs);
else
mm_sprintf_lite(s, "\t%d\t%d", r->rs, r->re);
mm_sprintf_lite(s, "\t%d\t%d", r->mlen, r->blen);
mm_sprintf_lite(s, "\t%d", r->mapq);
write_tags(s, r);
if (rep_len >= 0) mm_sprintf_lite(s, "\trl:i:%d", rep_len);
if (r->p && (opt_flag & MM_F_OUT_CG)) {
uint32_t k;
mm_sprintf_lite(s, "\tcg:Z:");
for (k = 0; k < r->p->n_cigar; ++k)
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDN"[r->p->cigar[k]&0xf]);
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, MM_CIGAR_STR[r->p->cigar[k]&0xf]);
}
if (r->p && (opt_flag & MM_F_OUT_CS))
write_cs(km, s, mi, t, r);
if (r->p && (opt_flag & (MM_F_OUT_CS|MM_F_OUT_MD)))
write_cs_or_MD(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG), opt_flag&MM_F_OUT_MD, 1, !!(opt_flag&MM_F_QSTRAND));
if ((opt_flag & MM_F_COPY_COMMENT) && t->comment)
mm_sprintf_lite(s, "\t%s", t->comment);
}
static char comp_tab[] = {
0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,
32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47,
48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63,
64, 'T', 'V', 'G', 'H', 'E', 'F', 'C', 'D', 'I', 'J', 'M', 'L', 'K', 'N', 'O',
'P', 'Q', 'Y', 'S', 'A', 'A', 'B', 'W', 'X', 'R', 'Z', 91, 92, 93, 94, 95,
64, 't', 'v', 'g', 'h', 'e', 'f', 'c', 'd', 'i', 'j', 'm', 'l', 'k', 'n', 'o',
'p', 'q', 'y', 's', 'a', 'a', 'b', 'w', 'x', 'r', 'z', 123, 124, 125, 126, 127
};
void mm_write_sam_SQ(const mm_idx_t *idx)
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag)
{
uint32_t i;
for (i = 0; i < idx->n_seq; ++i)
printf("@SQ\tSN:%s\tLN:%d\n", idx->seq[i].name, idx->seq[i].len);
mm_write_paf3(s, mi, t, r, km, opt_flag, -1);
}
static void sam_write_sq(kstring_t *s, char *seq, int l, int rev, int comp)
{
extern unsigned char seq_comp_table[256];
if (rev) {
int i;
str_enlarge(s, l);
for (i = 0; i < l; ++i) {
int c = seq[l - 1 - i];
s->s[s->l + i] = c < 128 && comp? comp_tab[c] : c;
s->s[s->l + i] = c < 128 && comp? seq_comp_table[c] : c;
}
s->l += l;
} else str_copy(s, seq, seq + l);
}
void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int n_regs, const mm_reg1_t *regs)
static inline const mm_reg1_t *get_sam_pri(int n_regs, const mm_reg1_t *regs)
{
int flag = 0;
int i;
for (i = 0; i < n_regs; ++i)
if (regs[i].sam_pri)
return &regs[i];
assert(n_regs == 0);
return NULL;
}
static void write_sam_cigar(kstring_t *s, int sam_flag, int in_tag, int qlen, const mm_reg1_t *r, int64_t opt_flag)
{
if (r->p == 0) {
mm_sprintf_lite(s, "*");
} else {
uint32_t k, clip_len[2];
clip_len[0] = r->rev? qlen - r->qe : r->qs;
clip_len[1] = r->rev? r->qs : qlen - r->qe;
if (in_tag) {
int clip_char = (sam_flag&0x800) && !(opt_flag&MM_F_SOFTCLIP)? 5 : 4;
mm_sprintf_lite(s, "\tCG:B:I");
if (clip_len[0]) mm_sprintf_lite(s, ",%u", clip_len[0]<<4|clip_char);
for (k = 0; k < r->p->n_cigar; ++k)
mm_sprintf_lite(s, ",%u", r->p->cigar[k]);
if (clip_len[1]) mm_sprintf_lite(s, ",%u", clip_len[1]<<4|clip_char);
} else {
int clip_char = (sam_flag&0x800) && !(opt_flag&MM_F_SOFTCLIP)? 'H' : 'S';
assert(clip_len[0] < qlen && clip_len[1] < qlen);
if (clip_len[0]) mm_sprintf_lite(s, "%d%c", clip_len[0], clip_char);
for (k = 0; k < r->p->n_cigar; ++k)
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, MM_CIGAR_STR[r->p->cigar[k]&0xf]);
if (clip_len[1]) mm_sprintf_lite(s, "%d%c", clip_len[1], clip_char);
}
}
}
void mm_write_sam3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regss, const mm_reg1_t *const* regss, void *km, int64_t opt_flag, int rep_len)
{
const int max_bam_cigar_op = 65535;
int flag, n_regs = n_regss[seg_idx], cigar_in_tag = 0;
int this_rid = -1, this_pos = -1;
const mm_reg1_t *regs = regss[seg_idx], *r_prev = NULL, *r_next;
const mm_reg1_t *r = n_regs > 0 && reg_idx < n_regs && reg_idx >= 0? &regs[reg_idx] : NULL;
// find the primary of the previous and the next segments, if they are mapped
if (n_seg > 1) {
int i, next_sid = (seg_idx + 1) % n_seg;
r_next = get_sam_pri(n_regss[next_sid], regss[next_sid]);
if (n_seg > 2) {
for (i = 1; i <= n_seg - 1; ++i) {
int prev_sid = (seg_idx + n_seg - i) % n_seg;
if (n_regss[prev_sid] > 0) {
r_prev = get_sam_pri(n_regss[prev_sid], regss[prev_sid]);
break;
}
}
} else r_prev = r_next;
} else r_prev = r_next = NULL;
// write QNAME
s->l = 0;
mm_sprintf_lite(s, "%s", t->name);
if (n_seg > 1) s->l = mm_qname_len(t->name); // trim the suffix like /1 or /2
// write flag
flag = n_seg > 1? 0x1 : 0x0;
if (r == 0) {
flag |= 0x4;
} else {
if (r->rev) flag |= 0x10;
if (r->parent != r->id) flag |= 0x100;
else if (!r->sam_pri) flag |= 0x800;
}
if (n_seg > 1) {
if (r && r->proper_frag) flag |= 0x2; // TODO: this doesn't work when there are more than 2 segments
if (seg_idx == 0) flag |= 0x40;
else if (seg_idx == n_seg - 1) flag |= 0x80;
if (r_next == NULL) flag |= 0x8;
else if (r_next->rev) flag |= 0x20;
}
mm_sprintf_lite(s, "\t%d", flag);
// write coordinate, MAPQ and CIGAR
if (r == 0) {
if (r_prev) {
this_rid = r_prev->rid, this_pos = r_prev->rs;
mm_sprintf_lite(s, "\t%s\t%d\t0\t*", mi->seq[this_rid].name, this_pos+1);
} else mm_sprintf_lite(s, "\t*\t0\t0\t*");
} else {
this_rid = r->rid, this_pos = r->rs;
mm_sprintf_lite(s, "\t%s\t%d\t%d\t", mi->seq[r->rid].name, r->rs+1, r->mapq);
if ((opt_flag & MM_F_LONG_CIGAR) && r->p && r->p->n_cigar > max_bam_cigar_op - 2) {
int n_cigar = r->p->n_cigar;
if (r->qs != 0) ++n_cigar;
if (r->qe != t->l_seq) ++n_cigar;
if (n_cigar > max_bam_cigar_op)
cigar_in_tag = 1;
}
if (cigar_in_tag) {
int slen;
if ((flag & 0x900) == 0 || (opt_flag & MM_F_SOFTCLIP)) slen = t->l_seq;
else if (flag & 0x100) slen = 0;
else slen = r->qe - r->qs;
mm_sprintf_lite(s, "%dS%dN", slen, r->re - r->rs);
} else write_sam_cigar(s, flag, 0, t->l_seq, r, opt_flag);
}
// write mate positions
if (n_seg > 1) {
int tlen = 0;
if (this_rid >= 0 && r_next) {
if (this_rid == r_next->rid) {
if (r) {
int this_pos5 = r->rev? r->re - 1 : this_pos;
int next_pos5 = r_next->rev? r_next->re - 1 : r_next->rs;
tlen = next_pos5 - this_pos5;
}
mm_sprintf_lite(s, "\t=\t");
} else mm_sprintf_lite(s, "\t%s\t", mi->seq[r_next->rid].name);
mm_sprintf_lite(s, "%d\t", r_next->rs + 1);
} else if (r_next) { // && this_rid < 0
mm_sprintf_lite(s, "\t%s\t%d\t", mi->seq[r_next->rid].name, r_next->rs + 1);
} else if (this_rid >= 0) { // && r_next == NULL
mm_sprintf_lite(s, "\t=\t%d\t", this_pos + 1); // next segment will take r's coordinate
} else mm_sprintf_lite(s, "\t*\t0\t"); // neither has coordinates
if (tlen > 0) ++tlen;
else if (tlen < 0) --tlen;
mm_sprintf_lite(s, "%d\t", tlen);
} else mm_sprintf_lite(s, "\t*\t0\t0\t");
// write SEQ and QUAL
if (r == 0) {
mm_sprintf_lite(s, "%s\t4\t*\t0\t0\t*\t*\t0\t0\t", t->name);
sam_write_sq(s, t->seq, t->l_seq, 0, 0);
mm_sprintf_lite(s, "\t");
if (t->qual) sam_write_sq(s, t->qual, t->l_seq, 0, 0);
else mm_sprintf_lite(s, "*");
} else {
if (r->rev) flag |= 0x10;
if (r->parent != r->id) flag |= 0x100;
else if (!r->sam_pri) flag |= 0x800;
mm_sprintf_lite(s, "%s\t%d\t%s\t%d\t%d\t", t->name, flag, mi->seq[r->rid].name, r->rs+1, r->mapq);
if (r->p) { // actually this should always be true for SAM output
uint32_t k, clip_len = r->rev? t->l_seq - r->qe : r->qs;
int clip_char = (flag&0x800)? 'H' : 'S';
if (clip_len) mm_sprintf_lite(s, "%d%c", clip_len, clip_char);
for (k = 0; k < r->p->n_cigar; ++k)
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDN"[r->p->cigar[k]&0xf]);
clip_len = r->rev? r->qs : t->l_seq - r->qe;
if (clip_len) mm_sprintf_lite(s, "%d%c", clip_len, clip_char);
} else mm_sprintf_lite(s, "*");
mm_sprintf_lite(s, "\t*\t0\t0\t");
if ((flag & 0x900) == 0) {
if ((flag & 0x900) == 0 || (opt_flag & MM_F_SOFTCLIP)) {
sam_write_sq(s, t->seq, t->l_seq, r->rev, r->rev);
mm_sprintf_lite(s, "\t");
if (t->qual) sam_write_sq(s, t->qual, t->l_seq, r->rev, 0);
@@ -282,8 +500,13 @@ void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const m
if (t->qual) sam_write_sq(s, t->qual + r->qs, r->qe - r->qs, r->rev, 0);
else mm_sprintf_lite(s, "*");
}
}
// write tags
if (mm_rg_id[0]) mm_sprintf_lite(s, "\tRG:Z:%s", mm_rg_id);
if (n_seg > 2) mm_sprintf_lite(s, "\tFI:i:%d", seg_idx);
if (r) {
write_tags(s, r);
if (mm_rg_id[0]) mm_sprintf_lite(s, "\tRG:Z:%s", mm_rg_id);
if (r->parent == r->id && r->p && n_regs > 1 && regs && r >= regs && r - regs < n_regs) { // supplementary aln may exist
int i, n_sa = 0; // n_sa: number of SA fields
for (i = 0; i < n_regs; ++i)
@@ -305,10 +528,32 @@ void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const m
if (l_I) mm_sprintf_lite(s, "%dI", l_I);
if (l_D) mm_sprintf_lite(s, "%dD", l_D);
if (clip3) mm_sprintf_lite(s, "%dS", clip3);
mm_sprintf_lite(s, ",%d,%d;", q->mapq, q->p->n_diff);
mm_sprintf_lite(s, ",%d,%d;", q->mapq, q->blen - q->mlen + q->p->n_ambi);
}
}
}
if (r->p && (opt_flag & (MM_F_OUT_CS|MM_F_OUT_MD)))
write_cs_or_MD(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG), opt_flag&MM_F_OUT_MD, 1, 0);
if (cigar_in_tag)
write_sam_cigar(s, flag, 1, t->l_seq, r, opt_flag);
}
if (rep_len >= 0) mm_sprintf_lite(s, "\trl:i:%d", rep_len);
if ((opt_flag & MM_F_COPY_COMMENT) && t->comment)
mm_sprintf_lite(s, "\t%s", t->comment);
s->s[s->l] = 0; // we always have room for an extra byte (see str_enlarge)
}
void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regss, const mm_reg1_t *const* regss, void *km, int64_t opt_flag)
{
mm_write_sam3(s, mi, t, seg_idx, reg_idx, n_seg, n_regss, regss, km, opt_flag, -1);
}
void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int n_regs, const mm_reg1_t *regs)
{
int i;
for (i = 0; i < n_regs; ++i)
if (r == &regs[i]) break;
mm_write_sam2(s, mi, t, 0, i, 1, &n_regs, &regs, NULL, 0);
}
-216
View File
@@ -1,216 +0,0 @@
#include <stddef.h>
#include <stdio.h>
#include <string.h>
#include "getopt.h"
char *optarg;
int optind=1, opterr=1, optopt, __optpos, optreset=0;
#define optpos __optpos
static void __getopt_msg(const char *a, const char *b, const char *c, size_t l)
{
FILE *f = stderr;
#if !defined(WIN32) && !defined(_WIN32)
flockfile(f);
#endif
fputs(a, f);
fwrite(b, strlen(b), 1, f);
fwrite(c, 1, l, f);
fputc('\n', f);
#if !defined(WIN32) && !defined(_WIN32)
funlockfile(f);
#endif
}
int getopt(int argc, char * const argv[], const char *optstring)
{
int i, c, d;
int k, l;
char *optchar;
if (!optind || optreset) {
optreset = 0;
__optpos = 0;
optind = 1;
}
if (optind >= argc || !argv[optind])
return -1;
if (argv[optind][0] != '-') {
if (optstring[0] == '-') {
optarg = argv[optind++];
return 1;
}
return -1;
}
if (!argv[optind][1])
return -1;
if (argv[optind][1] == '-' && !argv[optind][2])
return optind++, -1;
if (!optpos) optpos++;
c = argv[optind][optpos], k = 1;
optchar = argv[optind]+optpos;
optopt = c;
optpos += k;
if (!argv[optind][optpos]) {
optind++;
optpos = 0;
}
if (optstring[0] == '-' || optstring[0] == '+')
optstring++;
i = 0;
d = 0;
do {
d = optstring[i], l = 1;
if (l>0) i+=l; else i++;
} while (l && d != c);
if (d != c) {
if (optstring[0] != ':' && opterr)
__getopt_msg(argv[0], ": unrecognized option: ", optchar, k);
return '?';
}
if (optstring[i] == ':') {
if (optstring[i+1] == ':') optarg = 0;
else if (optind >= argc) {
if (optstring[0] == ':') return ':';
if (opterr) __getopt_msg(argv[0],
": option requires an argument: ",
optchar, k);
return '?';
}
if (optstring[i+1] != ':' || optpos) {
optarg = argv[optind++] + optpos;
optpos = 0;
}
}
return c;
}
static void permute(char *const *argv, int dest, int src)
{
char **av = (char **)argv;
char *tmp = av[src];
int i;
for (i=src; i>dest; i--)
av[i] = av[i-1];
av[dest] = tmp;
}
static int __getopt_long_core(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx, int longonly)
{
optarg = 0;
if (longopts && argv[optind][0] == '-' &&
((longonly && argv[optind][1] && argv[optind][1] != '-') ||
(argv[optind][1] == '-' && argv[optind][2])))
{
int colon = optstring[optstring[0]=='+'||optstring[0]=='-']==':';
int i, cnt, match;
char *opt;
for (cnt=i=0; longopts[i].name; i++) {
const char *name = longopts[i].name;
opt = argv[optind]+1;
if (*opt == '-') opt++;
for (; *name && *name == *opt; name++, opt++);
if (*opt && *opt != '=') continue;
match = i;
if (!*name) {
cnt = 1;
break;
}
cnt++;
}
if (cnt==1) {
i = match;
optind++;
optopt = longopts[i].val;
if (*opt == '=') {
if (!longopts[i].has_arg) {
if (colon || !opterr)
return '?';
__getopt_msg(argv[0],
": option does not take an argument: ",
longopts[i].name,
strlen(longopts[i].name));
return '?';
}
optarg = opt+1;
} else if (longopts[i].has_arg == required_argument) {
if (!(optarg = argv[optind])) {
if (colon) return ':';
if (!opterr) return '?';
__getopt_msg(argv[0],
": option requires an argument: ",
longopts[i].name,
strlen(longopts[i].name));
return '?';
}
optind++;
}
if (idx) *idx = i;
if (longopts[i].flag) {
*longopts[i].flag = longopts[i].val;
return 0;
}
return longopts[i].val;
}
if (argv[optind][1] == '-') {
if (!colon && opterr)
__getopt_msg(argv[0], cnt ?
": option is ambiguous: " :
": unrecognized option: ",
argv[optind]+2,
strlen(argv[optind]+2));
optind++;
return '?';
}
}
return getopt(argc, argv, optstring);
}
static int __getopt_long(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx, int longonly)
{
int ret, skipped, resumed;
if (!optind || optreset) {
optreset = 0;
__optpos = 0;
optind = 1;
}
if (optind >= argc || !argv[optind]) return -1;
skipped = optind;
if (optstring[0] != '+' && optstring[0] != '-') {
int i;
for (i=optind; ; i++) {
if (i >= argc || !argv[i]) return -1;
if (argv[i][0] == '-' && argv[i][1]) break;
}
optind = i;
}
resumed = optind;
ret = __getopt_long_core(argc, argv, optstring, longopts, idx, longonly);
if (resumed > skipped) {
int i, cnt = optind-resumed;
for (i=0; i<cnt; i++)
permute(argv, skipped, optind-1);
optind = skipped + cnt;
}
return ret;
}
int getopt_long(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx)
{
return __getopt_long(argc, argv, optstring, longopts, idx, 0);
}
int getopt_long_only(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx)
{
return __getopt_long(argc, argv, optstring, longopts, idx, 1);
}
-53
View File
@@ -1,53 +0,0 @@
/*
Copyright 2005-2014 Rich Felker, et al.
Permission is hereby granted, free of charge, to any person obtaining
a copy of this software and associated documentation files (the
"Software"), to deal in the Software without restriction, including
without limitation the rights to use, copy, modify, merge, publish,
distribute, sublicense, and/or sell copies of the Software, and to
permit persons to whom the Software is furnished to do so, subject to
the following conditions:
The above copyright notice and this permission notice shall be
included in all copies or substantial portions of the Software.
THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT.
IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY
CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT,
TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE
SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
*/
#ifndef _GETOPT_H
#define _GETOPT_H
#ifdef __cplusplus
extern "C" {
#endif
int getopt(int, char * const [], const char *);
extern char *optarg;
extern int optind, opterr, optopt, optreset;
struct option {
const char *name;
int has_arg;
int *flag;
int val;
};
int getopt_long(int, char *const *, const char *, const struct option *, int *);
int getopt_long_only(int, char *const *, const char *, const struct option *, int *);
#define no_argument 0
#define required_argument 1
#define optional_argument 2
#ifdef __cplusplus
}
#endif
#endif
+250 -95
View File
@@ -1,31 +1,33 @@
#include <string.h>
#include <stdlib.h>
#include <math.h>
#include "mmpriv.h"
#include "kalloc.h"
#include "khash.h"
static inline void mm_cal_fuzzy_len(mm_reg1_t *r, const mm128_t *a)
{
int i;
r->fuzzy_mlen = r->fuzzy_blen = 0;
r->mlen = r->blen = 0;
if (r->cnt <= 0) return;
r->fuzzy_mlen = r->fuzzy_blen = a[r->as].y>>32&0xff;
r->mlen = r->blen = a[r->as].y>>32&0xff;
for (i = r->as + 1; i < r->as + r->cnt; ++i) {
int span = a[i].y>>32&0xff;
int tl = (int32_t)a[i].x - (int32_t)a[i-1].x;
int ql = (int32_t)a[i].y - (int32_t)a[i-1].y;
r->fuzzy_blen += tl > ql? tl : ql;
r->fuzzy_mlen += tl > span && ql > span? span : tl < ql? tl : ql;
r->blen += tl > ql? tl : ql;
r->mlen += tl > span && ql > span? span : tl < ql? tl : ql;
}
}
static inline void mm_reg_set_coor(mm_reg1_t *r, int32_t qlen, const mm128_t *a)
static inline void mm_reg_set_coor(mm_reg1_t *r, int32_t qlen, const mm128_t *a, int is_qstrand)
{ // NB: r->as and r->cnt MUST BE set correctly for this function to work
int32_t k = r->as, q_span = (int32_t)(a[k].y>>32&0xff);
r->rev = a[k].x>>63;
r->rid = a[k].x<<1>>33;
r->rs = (int32_t)a[k].x + 1 > q_span? (int32_t)a[k].x + 1 - q_span : 0; // NB: target span may be shorter, so this test is necessary
r->re = (int32_t)a[k + r->cnt - 1].x + 1;
if (!r->rev) {
if (!r->rev || is_qstrand) {
r->qs = (int32_t)a[k].y + 1 - q_span;
r->qe = (int32_t)a[k + r->cnt - 1].y + 1;
} else {
@@ -35,7 +37,19 @@ static inline void mm_reg_set_coor(mm_reg1_t *r, int32_t qlen, const mm128_t *a)
mm_cal_fuzzy_len(r, a);
}
mm_reg1_t *mm_gen_regs(void *km, int qlen, int n_u, uint64_t *u, mm128_t *a) // convert chains to hits
static inline uint64_t hash64(uint64_t key)
{
key = (~key + (key << 21));
key = key ^ key >> 24;
key = ((key + (key << 3)) + (key << 8));
key = key ^ key >> 14;
key = ((key + (key << 2)) + (key << 4));
key = key ^ key >> 28;
key = (key + (key << 31));
return key;
}
mm_reg1_t *mm_gen_regs(void *km, uint32_t hash, int qlen, int n_u, uint64_t *u, mm128_t *a, int is_qstrand) // convert chains to hits
{
mm128_t *z, tmp;
mm_reg1_t *r;
@@ -46,7 +60,9 @@ mm_reg1_t *mm_gen_regs(void *km, int qlen, int n_u, uint64_t *u, mm128_t *a) //
// sort by score
z = (mm128_t*)kmalloc(km, n_u * 16);
for (i = k = 0; i < n_u; ++i) {
z[i].x = u[i] >> 32;
uint32_t h;
h = (uint32_t)hash64((hash64(a[k].x) + hash64(a[k].y)) ^ hash);
z[i].x = u[i] ^ h; // u[i] -- higher 32 bits: chain score; lower 32 bits: number of seeds in the chain
z[i].y = (uint64_t)k << 32 | (int32_t)u[i];
k += (int32_t)u[i];
}
@@ -60,82 +76,141 @@ mm_reg1_t *mm_gen_regs(void *km, int qlen, int n_u, uint64_t *u, mm128_t *a) //
mm_reg1_t *ri = &r[i];
ri->id = i;
ri->parent = MM_PARENT_UNSET;
ri->score = z[i].x;
ri->score = ri->score0 = z[i].x >> 32;
ri->hash = (uint32_t)z[i].x;
ri->cnt = (int32_t)z[i].y;
ri->as = z[i].y >> 32;
mm_reg_set_coor(ri, qlen, a);
ri->div = -1.0f;
mm_reg_set_coor(ri, qlen, a, is_qstrand);
}
kfree(km, z);
return r;
}
void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a)
void mm_mark_alt(const mm_idx_t *mi, int n, mm_reg1_t *r)
{
int i;
if (mi->n_alt == 0) return;
for (i = 0; i < n; ++i)
if (mi->seq[r[i].rid].is_alt)
r[i].is_alt = 1;
}
static inline int mm_alt_score(int score, float alt_diff_frac)
{
if (score < 0) return score;
score = (int)(score * (1.0 - alt_diff_frac) + .499);
return score > 0? score : 1;
}
void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a, int is_qstrand)
{
if (n <= 0 || n >= r->cnt) return;
*r2 = *r;
r2->id = -1;
r2->sam_pri = 0;
r2->p = 0;
r2->split_inv = 0;
r2->cnt = r->cnt - n;
r2->score = (int32_t)(r->score * ((float)r2->cnt / r->cnt) + .499);
r2->as = r->as + n;
if (r->parent == r->id) r2->parent = MM_PARENT_TMP_PRI;
mm_reg_set_coor(r2, qlen, a);
mm_reg_set_coor(r2, qlen, a, is_qstrand);
r->cnt -= r2->cnt;
r->score -= r2->score;
mm_reg_set_coor(r, qlen, a);
mm_reg_set_coor(r, qlen, a, is_qstrand);
r->split |= 1, r2->split |= 2;
}
void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r) // and compute mm_reg1_t::subsc
void mm_set_parent(void *km, float mask_level, int mask_len, int n, mm_reg1_t *r, int sub_diff, int hard_mask_level, float alt_diff_frac) // and compute mm_reg1_t::subsc
{
int i, j, k, *w;
uint64_t *cov;
if (n <= 0) return;
for (i = 0; i < n; ++i) r[i].id = i;
cov = (uint64_t*)kmalloc(km, n * sizeof(uint64_t));
w = (int*)kmalloc(km, n * sizeof(int));
w[0] = 0, r[0].parent = 0;
for (i = 1, k = 1; i < n; ++i) {
mm_reg1_t *ri = &r[i];
int si = ri->qs, ei = ri->qe;
for (j = 0; j < k; ++j) {
int si = ri->qs, ei = ri->qe, n_cov = 0, uncov_len = 0;
if (hard_mask_level) goto skip_uncov;
for (j = 0; j < k; ++j) { // traverse existing primary hits to find overlapping hits
mm_reg1_t *rp = &r[w[j]];
int sj = rp->qs, ej = rp->qe;
int min = ej - sj < ei - si? ej - sj : ei - si;
int ol = si < sj? (ei < sj? 0 : ei < ej? ei - sj : ej - sj) : (ej < si? 0 : ej < ei? ej - si : ei - si);
if (ol > mask_level * min) {
if (ej <= si || sj >= ei) continue;
if (sj < si) sj = si;
if (ej > ei) ej = ei;
cov[n_cov++] = (uint64_t)sj<<32 | ej;
}
if (n_cov == 0) {
goto set_parent_test; // no overlapping primary hits; then i is a new primary hit
} else if (n_cov > 0) { // there are overlapping primary hits; find the length not covered by existing primary hits
int j, x = si;
radix_sort_64(cov, cov + n_cov);
for (j = 0; j < n_cov; ++j) {
if ((int)(cov[j]>>32) > x) uncov_len += (cov[j]>>32) - x;
x = (int32_t)cov[j] > x? (int32_t)cov[j] : x;
}
if (ei > x) uncov_len += ei - x;
}
skip_uncov:
for (j = 0; j < k; ++j) { // traverse existing primary hits again
mm_reg1_t *rp = &r[w[j]];
int sj = rp->qs, ej = rp->qe, min, max, ol;
if (ej <= si || sj >= ei) continue; // no overlap
min = ej - sj < ei - si? ej - sj : ei - si;
max = ej - sj > ei - si? ej - sj : ei - si;
ol = si < sj? (ei < sj? 0 : ei < ej? ei - sj : ej - sj) : (ej < si? 0 : ej < ei? ej - si : ei - si); // overlap length; TODO: this can be simplified
if ((float)ol / min - (float)uncov_len / max > mask_level && uncov_len <= mask_len) { // then this is a secondary hit
int cnt_sub = 0, sci = ri->score;
ri->parent = rp->parent;
rp->subsc = rp->subsc > ri->score? rp->subsc : ri->score;
if (rp->p && ri->p)
rp->p->dp_max2 = rp->p->dp_max2 > ri->p->dp_max? rp->p->dp_max2 : ri->p->dp_max;
if (!rp->is_alt && ri->is_alt) sci = mm_alt_score(sci, alt_diff_frac);
rp->subsc = rp->subsc > sci? rp->subsc : sci;
if (ri->cnt >= rp->cnt) cnt_sub = 1;
if (rp->p && ri->p && (rp->rid != ri->rid || rp->rs != ri->rs || rp->re != ri->re || ol != min)) { // the last condition excludes identical hits after DP
sci = ri->p->dp_max;
if (!rp->is_alt && ri->is_alt) sci = mm_alt_score(sci, alt_diff_frac);
rp->p->dp_max2 = rp->p->dp_max2 > sci? rp->p->dp_max2 : sci;
if (rp->p->dp_max - ri->p->dp_max <= sub_diff) cnt_sub = 1;
}
if (cnt_sub) ++rp->n_sub;
break;
}
}
if (j == k) w[k++] = i, ri->parent = i;
set_parent_test:
if (j == k) w[k++] = i, ri->parent = i, ri->n_sub = 0;
}
kfree(km, cov);
kfree(km, w);
}
void mm_hit_sort_by_dp(void *km, int *n_regs, mm_reg1_t *r)
void mm_hit_sort(void *km, int *n_regs, mm_reg1_t *r, float alt_diff_frac)
{
int32_t i, n_aux, n = *n_regs;
uint64_t *aux;
int32_t i, n_aux, n = *n_regs, has_cigar = 0, no_cigar = 0;
mm128_t *aux;
mm_reg1_t *t;
if (n <= 1) return;
aux = (uint64_t*)kmalloc(km, n * 8);
aux = (mm128_t*)kmalloc(km, n * 16);
t = (mm_reg1_t*)kmalloc(km, n * sizeof(mm_reg1_t));
for (i = n_aux = 0; i < n; ++i) {
if (r[i].inv || r[i].cnt > 0) { // squeeze out elements with cnt==0 (soft deleted)
assert(r[i].p);
aux[n_aux++] = (uint64_t)r[i].p->dp_max << 32 | i;
int score;
if (r[i].p) score = r[i].p->dp_max, has_cigar = 1;
else score = r[i].score, no_cigar = 1;
if (r[i].is_alt) score = mm_alt_score(score, alt_diff_frac);
aux[n_aux].x = (uint64_t)score << 32 | r[i].hash;
aux[n_aux++].y = i;
} else if (r[i].p) {
free(r[i].p);
r[i].p = 0;
}
}
radix_sort_64(aux, aux + n_aux);
assert(has_cigar + no_cigar == 1);
radix_sort_128x(aux, aux + n_aux);
for (i = n_aux - 1; i >= 0; --i)
t[n_aux - 1 - i] = r[(int32_t)aux[i]];
t[n_aux - 1 - i] = r[aux[i].y];
memcpy(r, t, sizeof(mm_reg1_t) * n_aux);
*n_regs = n_aux;
kfree(km, aux);
@@ -177,30 +252,52 @@ void mm_sync_regs(void *km, int n_regs, mm_reg1_t *regs) // keep mm_reg1_t::{id,
mm_set_sam_pri(n_regs, regs);
}
void mm_select_sub(void *km, float mask_level, float pri_ratio, int min_diff, int best_n, int *n_, mm_reg1_t *r)
void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int check_strand, int min_strand_sc, int *n_, mm_reg1_t *r)
{
if (pri_ratio > 0.0f && *n_ > 0) {
int i, k, n = *n_, n_2nd = 0;
for (i = k = 0; i < n; ++i)
if (r[i].parent == i) r[k++] = r[i];
else if ((r[i].score >= r[r[i].parent].score * pri_ratio || r[i].score + min_diff >= r[r[i].parent].score) && n_2nd++ < best_n)
for (i = k = 0; i < n; ++i) {
int p = r[i].parent;
if (p == i || r[i].inv) { // primary or inversion
r[k++] = r[i];
else if (r[i].p) free(r[i].p);
} else if ((r[i].score >= r[p].score * pri_ratio || r[i].score + min_diff >= r[p].score) && n_2nd < best_n) {
if (!(r[i].qs == r[p].qs && r[i].qe == r[p].qe && r[i].rid == r[p].rid && r[i].rs == r[p].rs && r[i].re == r[p].re)) // not identical hits
r[k++] = r[i], ++n_2nd;
else if (r[i].p) free(r[i].p);
} else if (check_strand && n_2nd < best_n && r[i].score > min_strand_sc && r[i].rev != r[p].rev) {
r[i].strand_retained = 1;
r[k++] = r[i], ++n_2nd;
} else if (r[i].p) free(r[i].p);
}
if (k != n) mm_sync_regs(km, k, r); // removing hits requires sync()
*n_ = k;
}
}
void mm_filter_regs(void *km, const mm_mapopt_t *opt, int *n_regs, mm_reg1_t *regs)
int mm_filter_strand_retained(int n_regs, mm_reg1_t *r)
{
int i, k;
for (i = k = 0; i < n_regs; ++i) {
int p = r[i].parent;
if (!r[i].strand_retained || r[i].div < r[p].div * 5.0f || r[i].div < 0.01f) {
if (k < i) r[k++] = r[i];
else ++k;
}
}
return k;
}
void mm_filter_regs(const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs)
{ // NB: after this call, mm_reg1_t::parent can be -1 if its parent filtered out
int i, k;
for (i = k = 0; i < *n_regs; ++i) {
mm_reg1_t *r = &regs[i];
int flt = 0;
if (!r->inv && r->cnt < opt->min_cnt) flt = 1;
if (r->p) {
if (r->p->blen - r->p->n_ambi - r->p->n_diff < opt->min_chain_score) flt = 1;
if (!r->inv && !r->seg_split && r->cnt < opt->min_cnt) flt = 1;
if (r->p) { // these filters are only applied when base-alignment is available
if (r->mlen < opt->min_chain_score) flt = 1;
else if (r->p->dp_max < opt->min_dp_max) flt = 1;
else if (r->qs > qlen * opt->max_clip_ratio && qlen - r->qe > qlen * opt->max_clip_ratio) flt = 1;
if (flt) free(r->p);
}
if (!flt) {
@@ -231,81 +328,139 @@ int mm_squeeze_a(void *km, int n_regs, mm_reg1_t *regs, mm128_t *a)
return as;
}
void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs_, mm_reg1_t *regs, mm128_t *a)
mm_seg_t *mm_seg_gen(void *km, uint32_t hash, int n_segs, const int *qlens, int n_regs0, const mm_reg1_t *regs0, int *n_regs, mm_reg1_t **regs, const mm128_t *a)
{
int i, n_aux, n_regs = *n_regs_, n_drop = 0;
uint64_t *aux;
int s, i, j, acc_qlen[MM_MAX_SEG+1], qlen_sum = 0;
mm_seg_t *seg;
if (n_regs < 2) return; // nothing to join
mm_squeeze_a(km, n_regs, regs, a);
assert(n_segs <= MM_MAX_SEG);
for (s = 1, acc_qlen[0] = 0; s < n_segs; ++s)
acc_qlen[s] = acc_qlen[s-1] + qlens[s-1];
qlen_sum = acc_qlen[n_segs - 1] + qlens[n_segs - 1];
aux = (uint64_t*)kmalloc(km, n_regs * 8);
for (i = n_aux = 0; i < n_regs; ++i)
if (regs[i].parent == i || regs[i].parent < 0)
aux[n_aux++] = (uint64_t)regs[i].as << 32 | i;
radix_sort_64(aux, aux + n_aux);
for (i = n_aux - 1; i >= 1; --i) {
mm_reg1_t *r0 = &regs[(int32_t)aux[i-1]], *r1 = &regs[(int32_t)aux[i]];
mm128_t *a0e, *a1s;
int max_gap, min_gap, sc_thres;
// test
if (r0->as + r0->cnt != r1->as) continue; // not adjacent in a[]
if (r0->rid != r1->rid || r0->rev != r1->rev) continue; // make sure on the same target and strand
a0e = &a[r0->as + r0->cnt - 1];
a1s = &a[r1->as];
if (a1s->x <= a0e->x || (int32_t)a1s->y <= (int32_t)a0e->y) continue; // keep colinearity
max_gap = min_gap = (int32_t)a1s->y - (int32_t)a0e->y;
max_gap = max_gap > a1s->x - a0e->x? max_gap : a1s->x - a0e->x;
min_gap = min_gap < a1s->x - a0e->x? min_gap : a1s->x - a0e->x;
if (max_gap > opt->max_join_long || min_gap > opt->max_join_short) continue;
sc_thres = (int)((float)opt->min_join_flank_sc / opt->max_join_long * max_gap + .499);
if (r0->score < sc_thres || r1->score < sc_thres) continue; // require good flanking chains
if (r0->re - r0->rs < max_gap>>1 || r0->qe - r0->qs < max_gap>>1) continue; // require enough flanking length
if (r1->re - r1->rs < max_gap>>1 || r1->qe - r1->qs < max_gap>>1) continue;
// all conditions satisfied; join
a[r1->as].y |= MM_SEED_LONG_JOIN;
r0->cnt += r1->cnt, r0->score += r1->score;
mm_reg_set_coor(r0, qlen, a);
r1->cnt = 0;
r1->parent = r0->id;
++n_drop;
seg = (mm_seg_t*)kcalloc(km, n_segs, sizeof(mm_seg_t));
for (s = 0; s < n_segs; ++s) {
seg[s].u = (uint64_t*)kmalloc(km, n_regs0 * 8);
for (i = 0; i < n_regs0; ++i)
seg[s].u[i] = (uint64_t)regs0[i].score << 32;
}
kfree(km, aux);
if (n_drop > 0) { // then fix the hits hierarchy
for (i = 0; i < n_regs; ++i) { // adjust the mm_reg1_t::parent
mm_reg1_t *r = &regs[i];
if (r->parent >= 0 && r->id != r->parent) { // fix for secondary hits only
if (regs[r->parent].parent >= 0 && regs[r->parent].parent != r->parent)
r->parent = regs[r->parent].parent;
}
for (i = 0; i < n_regs0; ++i) {
const mm_reg1_t *r = &regs0[i];
for (j = 0; j < r->cnt; ++j) {
int sid = (a[r->as + j].y&MM_SEED_SEG_MASK)>>MM_SEED_SEG_SHIFT;
++seg[sid].u[i];
++seg[sid].n_a;
}
mm_filter_regs(km, opt, n_regs_, regs);
mm_sync_regs(km, *n_regs_, regs);
}
for (s = 0; s < n_segs; ++s) {
mm_seg_t *sr = &seg[s];
for (i = 0, sr->n_u = 0; i < n_regs0; ++i) // squeeze out zero-length per-segment chains
if ((int32_t)sr->u[i] != 0)
sr->u[sr->n_u++] = sr->u[i];
sr->a = (mm128_t*)kmalloc(km, sr->n_a * sizeof(mm128_t));
sr->n_a = 0;
}
for (i = 0; i < n_regs0; ++i) {
const mm_reg1_t *r = &regs0[i];
for (j = 0; j < r->cnt; ++j) {
int sid = (a[r->as + j].y&MM_SEED_SEG_MASK)>>MM_SEED_SEG_SHIFT;
mm128_t a1 = a[r->as + j];
// on reverse strand, the segment position is:
// x_for_cat = qlen_sum - 1 - (int32_t)a1.y - 1 + q_span
// (int32_t)new_a1.y = qlens[sid] - (x_for_cat - acc_qlen[sid] + 1 - q_span) - 1 = (int32_t)a1.y - (qlen_sum - (qlens[sid] + acc_qlen[sid]))
a1.y -= a1.x>>63? qlen_sum - (qlens[sid] + acc_qlen[sid]) : acc_qlen[sid];
seg[sid].a[seg[sid].n_a++] = a1;
}
}
for (s = 0; s < n_segs; ++s) {
regs[s] = mm_gen_regs(km, hash, qlens[s], seg[s].n_u, seg[s].u, seg[s].a, 0);
n_regs[s] = seg[s].n_u;
for (i = 0; i < n_regs[s]; ++i) {
regs[s][i].seg_split = 1;
regs[s][i].seg_id = s;
}
}
return seg;
}
void mm_set_mapq(int n_regs, mm_reg1_t *regs, int min_chain_sc)
void mm_seg_free(void *km, int n_segs, mm_seg_t *segs)
{
static const float q_coef = 30.0f;
int i;
for (i = 0; i < n_segs; ++i) kfree(km, segs[i].u);
for (i = 0; i < n_segs; ++i) kfree(km, segs[i].a);
kfree(km, segs);
}
static void mm_set_inv_mapq(void *km, int n_regs, mm_reg1_t *regs)
{
int i, n_aux;
mm128_t *aux;
if (n_regs < 3) return;
for (i = 0; i < n_regs; ++i)
if (regs[i].inv) break;
if (i == n_regs) return; // no inversion hits
aux = (mm128_t*)kmalloc(km, n_regs * 16);
for (i = n_aux = 0; i < n_regs; ++i)
if (regs[i].parent == i || regs[i].parent < 0)
aux[n_aux].y = i, aux[n_aux++].x = (uint64_t)regs[i].rid << 32 | regs[i].rs;
radix_sort_128x(aux, aux + n_aux);
for (i = 1; i < n_aux - 1; ++i) {
mm_reg1_t *inv = &regs[aux[i].y];
if (inv->inv) {
mm_reg1_t *l = &regs[aux[i-1].y];
mm_reg1_t *r = &regs[aux[i+1].y];
inv->mapq = l->mapq < r->mapq? l->mapq : r->mapq;
}
}
kfree(km, aux);
}
void mm_set_mapq(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr)
{
static const float q_coef = 40.0f;
int64_t sum_sc = 0;
float uniq_ratio;
int i;
if (n_regs == 0) return;
for (i = 0; i < n_regs; ++i)
if (regs[i].parent == regs[i].id)
sum_sc += regs[i].score;
uniq_ratio = (float)sum_sc / (sum_sc + rep_len);
for (i = 0; i < n_regs; ++i) {
mm_reg1_t *r = &regs[i];
if (r->inv) {
r->mapq = 0;
} else if (r->parent == r->id) {
int mapq, subsc;
float pen_cm = r->cnt >= 10? 1.0f : 0.1f * r->cnt;
float pen_s1 = (r->score > 100? 1.0f : 0.01f * r->score) * uniq_ratio;
float pen_cm = r->cnt > 10? 1.0f : 0.1f * r->cnt;
pen_cm = pen_s1 < pen_cm? pen_s1 : pen_cm;
subsc = r->subsc > min_chain_sc? r->subsc : min_chain_sc;
if (r->p && r->p->dp_max2 > 0 && r->p->dp_max > 0) {
float identity = (float)(r->p->blen - r->p->n_diff - r->p->n_ambi) / (r->p->blen - r->p->n_ambi);
mapq = (int)(identity * pen_cm * q_coef * (1. - (float)r->p->dp_max2 * subsc / r->p->dp_max / r->score) * logf(r->score));
} else mapq = (int)(pen_cm * q_coef * (1. - (float)subsc / r->score) * logf(r->score));
float identity = (float)r->mlen / r->blen;
float x = (float)r->p->dp_max2 * subsc / r->p->dp_max / r->score0;
mapq = (int)(identity * pen_cm * q_coef * (1.0f - x * x) * logf((float)r->p->dp_max / match_sc));
if (!is_sr) {
int mapq_alt = (int)(6.02f * identity * identity * (r->p->dp_max - r->p->dp_max2) / match_sc + .499f); // BWA-MEM like mapQ, mostly for short reads
mapq = mapq < mapq_alt? mapq : mapq_alt; // in case the long-read heuristic fails
}
} else {
float x = (float)subsc / r->score0;
if (r->p) {
float identity = (float)r->mlen / r->blen;
mapq = (int)(identity * pen_cm * q_coef * (1.0f - x) * logf((float)r->p->dp_max / match_sc));
} else {
mapq = (int)(pen_cm * q_coef * (1.0f - x) * logf(r->score));
}
}
mapq -= (int)(4.343f * logf(r->n_sub + 1) + .499f);
mapq = mapq > 0? mapq : 0;
r->mapq = mapq < 60? mapq : 60;
if (r->p && r->p->dp_max > r->p->dp_max2 && r->mapq == 0) r->mapq = 1;
} else r->mapq = 0;
}
mm_set_inv_mapq(km, n_regs, regs);
}
+405 -61
View File
@@ -7,6 +7,7 @@
#endif
#include <fcntl.h>
#include <stdio.h>
#define __STDC_LIMIT_MACROS
#include "kthread.h"
#include "bseq.h"
#include "minimap.h"
@@ -19,15 +20,34 @@
KHASH_INIT(idx, uint64_t, uint64_t, 1, idx_hash, idx_eq)
typedef khash_t(idx) idxhash_t;
KHASH_MAP_INIT_STR(str, uint32_t)
#define kroundup64(x) (--(x), (x)|=(x)>>1, (x)|=(x)>>2, (x)|=(x)>>4, (x)|=(x)>>8, (x)|=(x)>>16, (x)|=(x)>>32, ++(x))
mm_idx_t *mm_idx_init(int w, int k, int b, int is_hpc)
typedef struct mm_idx_bucket_s {
mm128_v a; // (minimizer, position) array
int32_t n; // size of the _p_ array
uint64_t *p; // position array for minimizers appearing >1 times
void *h; // hash table indexing _p_ and minimizers appearing once
} mm_idx_bucket_t;
typedef struct {
int32_t st, en, max; // max is not used for now
int32_t score:30, strand:2;
} mm_idx_intv1_t;
typedef struct mm_idx_intv_s {
int32_t n, m;
mm_idx_intv1_t *a;
} mm_idx_intv_t;
mm_idx_t *mm_idx_init(int w, int k, int b, int flag)
{
mm_idx_t *mi;
if (k*2 < b) b = k * 2;
if (w < 1) w = 1;
mi = (mm_idx_t*)calloc(1, sizeof(mm_idx_t));
mi->w = w, mi->k = k, mi->b = b, mi->is_hpc = is_hpc;
mi->w = w, mi->k = k, mi->b = b, mi->flag = flag;
mi->B = (mm_idx_bucket_t*)calloc(1<<b, sizeof(mm_idx_bucket_t));
if (!(mm_dbg_flag & 1)) mi->km = km_init();
return mi;
@@ -35,12 +55,20 @@ mm_idx_t *mm_idx_init(int w, int k, int b, int is_hpc)
void mm_idx_destroy(mm_idx_t *mi)
{
int i;
uint32_t i;
if (mi == 0) return;
for (i = 0; i < 1<<mi->b; ++i) {
free(mi->B[i].p);
free(mi->B[i].a.a);
kh_destroy(idx, (idxhash_t*)mi->B[i].h);
if (mi->h) kh_destroy(str, (khash_t(str)*)mi->h);
if (mi->B) {
for (i = 0; i < 1U<<mi->b; ++i) {
free(mi->B[i].p);
free(mi->B[i].a.a);
kh_destroy(idx, (idxhash_t*)mi->B[i].h);
}
}
if (mi->I) {
for (i = 0; i < mi->n_seq; ++i)
free(mi->I[i].a);
free(mi->I);
}
if (!mi->km) {
for (i = 0; i < mi->n_seq; ++i)
@@ -71,14 +99,15 @@ const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n)
void mm_idx_stat(const mm_idx_t *mi)
{
int i, n = 0, n1 = 0;
int n = 0, n1 = 0;
uint32_t i;
uint64_t sum = 0, len = 0;
fprintf(stderr, "[M::%s] kmer size: %d; skip: %d; is_HPC: %d; #seq: %d\n", __func__, mi->k, mi->w, mi->is_hpc, mi->n_seq);
fprintf(stderr, "[M::%s] kmer size: %d; skip: %d; is_hpc: %d; #seq: %d\n", __func__, mi->k, mi->w, mi->flag&MM_I_HPC, mi->n_seq);
for (i = 0; i < mi->n_seq; ++i)
len += mi->seq[i].len;
for (i = 0; i < 1<<mi->b; ++i)
for (i = 0; i < 1U<<mi->b; ++i)
if (mi->B[i].h) n += kh_size((idxhash_t*)mi->B[i].h);
for (i = 0; i < 1<<mi->b; ++i) {
for (i = 0; i < 1U<<mi->b; ++i) {
idxhash_t *h = (idxhash_t*)mi->B[i].h;
khint_t k;
if (h == 0) continue;
@@ -88,8 +117,36 @@ void mm_idx_stat(const mm_idx_t *mi)
if (kh_key(h, k)&1) ++n1;
}
}
fprintf(stderr, "[M::%s::%.3f*%.2f] distinct minimizers: %d (%.2f%% are singletons); average occurrences: %.3lf; average spacing: %.3lf\n",
__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), n, 100.0*n1/n, (double)sum / n, (double)len / sum);
fprintf(stderr, "[M::%s::%.3f*%.2f] distinct minimizers: %d (%.2f%% are singletons); average occurrences: %.3lf; average spacing: %.3lf; total length: %ld\n",
__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), n, 100.0*n1/n, (double)sum / n, (double)len / sum, (long)len);
}
int mm_idx_index_name(mm_idx_t *mi)
{
khash_t(str) *h;
uint32_t i;
int has_dup = 0, absent;
if (mi->h) return 0;
h = kh_init(str);
for (i = 0; i < mi->n_seq; ++i) {
khint_t k;
k = kh_put(str, h, mi->seq[i].name, &absent);
if (absent) kh_val(h, k) = i;
else has_dup = 1;
}
mi->h = h;
if (has_dup && mm_verbose >= 2)
fprintf(stderr, "[WARNING] some database sequences have identical sequence names\n");
return has_dup;
}
int mm_idx_name2id(const mm_idx_t *mi, const char *name)
{
khash_t(str) *h = (khash_t(str)*)mi->h;
khint_t k;
if (h == 0) return -2;
k = kh_get(str, h, name);
return k == kh_end(h)? -1 : kh_val(h, k);
}
int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq)
@@ -104,13 +161,35 @@ int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, ui
return en - st;
}
uint32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f)
int mm_idx_getseq_rev(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq)
{
uint64_t i, st1, en1;
const mm_idx_seq_t *s;
if (rid >= mi->n_seq || st >= mi->seq[rid].len) return -1;
s = &mi->seq[rid];
if (en > s->len) en = s->len;
st1 = s->offset + (s->len - en);
en1 = s->offset + (s->len - st);
for (i = st1; i < en1; ++i) {
uint8_t c = mm_seq4_get(mi->S, i);
seq[en1 - i - 1] = c < 4? 3 - c : c;
}
return en - st;
}
int mm_idx_getseq2(const mm_idx_t *mi, int is_rev, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq)
{
if (is_rev) return mm_idx_getseq_rev(mi, rid, st, en, seq);
else return mm_idx_getseq(mi, rid, st, en, seq);
}
int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f)
{
int i;
size_t n = 0;
uint32_t thres;
khint_t *a, k;
if (f <= 0.) return UINT32_MAX;
if (f <= 0.) return INT32_MAX;
for (i = 0; i < 1<<mi->b; ++i)
if (mi->B[i].h) n += kh_size((idxhash_t*)mi->B[i].h);
a = (uint32_t*)malloc(n * 4);
@@ -133,7 +212,8 @@ uint32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f)
static void worker_post(void *g, long i, int tid)
{
int j, start_a, start_p, n, n_keys;
int n, n_keys;
size_t j, start_a, start_p;
idxhash_t *h;
mm_idx_t *mi = (mm_idx_t*)g;
mm_idx_bucket_t *b = &mi->B[i];
@@ -161,7 +241,7 @@ static void worker_post(void *g, long i, int tid)
int absent;
mm128_t *p = &b->a.a[j-1];
itr = kh_put(idx, h, p->x>>8>>mi->b<<1, &absent);
assert(absent && j - start_a == n);
assert(absent && j == start_a + n);
if (n == 1) {
kh_key(h, itr) |= 1;
kh_val(h, itr) = p->y;
@@ -177,10 +257,10 @@ static void worker_post(void *g, long i, int tid)
} else ++n;
}
b->h = h;
assert(b->n == start_p);
assert(b->n == (int32_t)start_p);
// deallocate and clear b->a
free(b->a.a);
kfree(0, b->a.a);
b->a.n = b->a.m = 0, b->a.a = 0;
}
@@ -198,7 +278,7 @@ static void mm_idx_post(mm_idx_t *mi, int n_threads)
#include "bseq.h"
typedef struct {
int mini_batch_size, keep_name;
int mini_batch_size;
uint64_t batch_size, sum_len;
mm_bseq_file_t *fp;
mm_idx_t *mi;
@@ -230,7 +310,6 @@ static void *worker_pipeline(void *shared, int step, void *in)
s->seq = mm_bseq_read(p->fp, p->mini_batch_size, 0, &s->n_seq); // read a mini-batch
if (s->seq) {
uint32_t old_m, m;
uint64_t sum_len, old_max_len, max_len;
assert((uint64_t)p->mi->n_seq + s->n_seq <= UINT32_MAX); // to prevent integer overflow
// make room for p->mi->seq
old_m = p->mi->n_seq, m = p->mi->n_seq + s->n_seq;
@@ -238,30 +317,35 @@ static void *worker_pipeline(void *shared, int step, void *in)
if (old_m != m)
p->mi->seq = (mm_idx_seq_t*)krealloc(p->mi->km, p->mi->seq, m * sizeof(mm_idx_seq_t));
// make room for p->mi->S
for (i = 0, sum_len = 0; i < s->n_seq; ++i) sum_len += s->seq[i].l_seq;
old_max_len = (p->sum_len + 7) / 8;
max_len = (p->sum_len + sum_len + 7) / 8;
kroundup64(old_max_len); kroundup64(max_len);
if (old_max_len != max_len) {
p->mi->S = (uint32_t*)realloc(p->mi->S, max_len * 4);
memset(&p->mi->S[old_max_len], 0, 4 * (max_len - old_max_len));
if (!(p->mi->flag & MM_I_NO_SEQ)) {
uint64_t sum_len, old_max_len, max_len;
for (i = 0, sum_len = 0; i < s->n_seq; ++i) sum_len += s->seq[i].l_seq;
old_max_len = (p->sum_len + 7) / 8;
max_len = (p->sum_len + sum_len + 7) / 8;
kroundup64(old_max_len); kroundup64(max_len);
if (old_max_len != max_len) {
p->mi->S = (uint32_t*)realloc(p->mi->S, max_len * 4);
memset(&p->mi->S[old_max_len], 0, 4 * (max_len - old_max_len));
}
}
// populate p->mi->seq
for (i = 0; i < s->n_seq; ++i) {
mm_idx_seq_t *seq = &p->mi->seq[p->mi->n_seq];
uint32_t j;
if (p->keep_name) {
assert(strlen(s->seq[i].name) <= 254); // a long query name breaks BAM
if (!(p->mi->flag & MM_I_NO_NAME)) {
seq->name = (char*)kmalloc(p->mi->km, strlen(s->seq[i].name) + 1);
strcpy(seq->name, s->seq[i].name);
} else seq->name = 0;
seq->len = s->seq[i].l_seq;
seq->offset = p->sum_len;
seq->is_alt = 0;
// copy the sequence
for (j = 0; j < seq->len; ++j) { // TODO: this is not the fastest way, but let's first see if speed matters here
uint64_t o = p->sum_len + j;
int c = seq_nt4_table[(uint8_t)s->seq[i].seq[j]];
mm_seq4_set(p->mi->S, o, c);
if (!(p->mi->flag & MM_I_NO_SEQ)) {
for (j = 0; j < seq->len; ++j) { // TODO: this is not the fastest way, but let's first see if speed matters here
uint64_t o = p->sum_len + j;
int c = seq_nt4_table[(uint8_t)s->seq[i].seq[j]];
mm_seq4_set(p->mi->S, o, c);
}
}
// update p->sum_len and p->mi->n_seq
p->sum_len += seq->len;
@@ -273,7 +357,10 @@ static void *worker_pipeline(void *shared, int step, void *in)
step_t *s = (step_t*)in;
for (i = 0; i < s->n_seq; ++i) {
mm_bseq1_t *t = &s->seq[i];
mm_sketch(0, t->seq, t->l_seq, p->mi->w, p->mi->k, t->rid, p->mi->is_hpc, &s->a);
if (t->l_seq > 0)
mm_sketch(0, t->seq, t->l_seq, p->mi->w, p->mi->k, t->rid, p->mi->flag&MM_I_HPC, &s->a);
else if (mm_verbose >= 2)
fprintf(stderr, "[WARNING] the length database sequence '%s' is 0\n", t->name);
free(t->seq); free(t->name);
}
free(s->seq); s->seq = 0;
@@ -281,21 +368,20 @@ static void *worker_pipeline(void *shared, int step, void *in)
} else if (step == 2) { // dispatch sketch to buckets
step_t *s = (step_t*)in;
mm_idx_add(p->mi, s->a.n, s->a.a);
free(s->a.a); free(s);
kfree(0, s->a.a); free(s);
}
return 0;
}
mm_idx_t *mm_idx_gen(mm_bseq_file_t *fp, int w, int k, int b, int is_hpc, int mini_batch_size, int n_threads, uint64_t batch_size, int keep_name)
mm_idx_t *mm_idx_gen(mm_bseq_file_t *fp, int w, int k, int b, int flag, int mini_batch_size, int n_threads, uint64_t batch_size)
{
pipeline_t pl;
if (fp == 0 || mm_bseq_eof(fp)) return 0;
memset(&pl, 0, sizeof(pipeline_t));
pl.mini_batch_size = mini_batch_size < batch_size? mini_batch_size : batch_size;
pl.keep_name = keep_name;
pl.mini_batch_size = (uint64_t)mini_batch_size < batch_size? mini_batch_size : batch_size;
pl.batch_size = batch_size;
pl.fp = fp;
pl.mi = mm_idx_init(w, k, b, is_hpc);
pl.mi = mm_idx_init(w, k, b, flag);
kt_pipeline(n_threads < 3? n_threads : 3, worker_pipeline, &pl, 3);
if (mm_verbose >= 3)
@@ -308,17 +394,67 @@ mm_idx_t *mm_idx_gen(mm_bseq_file_t *fp, int w, int k, int b, int is_hpc, int mi
return pl.mi;
}
mm_idx_t *mm_idx_build(const char *fn, int w, int k, int is_hpc, int n_threads) // a simpler interface
mm_idx_t *mm_idx_build(const char *fn, int w, int k, int flag, int n_threads) // a simpler interface; deprecated
{
mm_bseq_file_t *fp;
mm_idx_t *mi;
fp = mm_bseq_open(fn);
if (fp == 0) return 0;
mi = mm_idx_gen(fp, w, k, MM_IDX_DEF_B, is_hpc, 1<<18, n_threads, UINT64_MAX, 1);
mi = mm_idx_gen(fp, w, k, 14, flag, 1<<18, n_threads, UINT64_MAX);
mm_bseq_close(fp);
return mi;
}
mm_idx_t *mm_idx_str(int w, int k, int is_hpc, int bucket_bits, int n, const char **seq, const char **name)
{
uint64_t sum_len = 0;
mm128_v a = {0,0,0};
mm_idx_t *mi;
khash_t(str) *h;
int i, flag = 0;
if (n <= 0) return 0;
for (i = 0; i < n; ++i) // get the total length
sum_len += strlen(seq[i]);
if (is_hpc) flag |= MM_I_HPC;
if (name == 0) flag |= MM_I_NO_NAME;
if (bucket_bits < 0) bucket_bits = 14;
mi = mm_idx_init(w, k, bucket_bits, flag);
mi->n_seq = n;
mi->seq = (mm_idx_seq_t*)kcalloc(mi->km, n, sizeof(mm_idx_seq_t)); // ->seq is allocated from km
mi->S = (uint32_t*)calloc((sum_len + 7) / 8, 4);
mi->h = h = kh_init(str);
for (i = 0, sum_len = 0; i < n; ++i) {
const char *s = seq[i];
mm_idx_seq_t *p = &mi->seq[i];
uint32_t j;
if (name && name[i]) {
int absent;
p->name = (char*)kmalloc(mi->km, strlen(name[i]) + 1);
strcpy(p->name, name[i]);
kh_put(str, h, p->name, &absent);
assert(absent);
}
p->offset = sum_len;
p->len = strlen(s);
p->is_alt = 0;
for (j = 0; j < p->len; ++j) {
int c = seq_nt4_table[(uint8_t)s[j]];
uint64_t o = sum_len + j;
mm_seq4_set(mi->S, o, c);
}
sum_len += p->len;
if (p->len > 0) {
a.n = 0;
mm_sketch(0, s, p->len, w, k, i, is_hpc, &a);
mm_idx_add(mi, a.n, a.a);
}
}
free(a.a);
mm_idx_post(mi, 1);
return mi;
}
/*************
* index I/O *
*************/
@@ -326,17 +462,20 @@ mm_idx_t *mm_idx_build(const char *fn, int w, int k, int is_hpc, int n_threads)
void mm_idx_dump(FILE *fp, const mm_idx_t *mi)
{
uint64_t sum_len = 0;
uint32_t x[5];
int i;
uint32_t x[5], i;
x[0] = mi->w, x[1] = mi->k, x[2] = mi->b, x[3] = mi->n_seq, x[4] = mi->is_hpc;
x[0] = mi->w, x[1] = mi->k, x[2] = mi->b, x[3] = mi->n_seq, x[4] = mi->flag;
fwrite(MM_IDX_MAGIC, 1, 4, fp);
fwrite(x, 4, 5, fp);
for (i = 0; i < mi->n_seq; ++i) {
uint8_t l;
l = strlen(mi->seq[i].name);
fwrite(&l, 1, 1, fp);
fwrite(mi->seq[i].name, 1, l, fp);
if (mi->seq[i].name) {
uint8_t l = strlen(mi->seq[i].name);
fwrite(&l, 1, 1, fp);
fwrite(mi->seq[i].name, 1, l, fp);
} else {
uint8_t l = 0;
fwrite(&l, 1, 1, fp);
}
fwrite(&mi->seq[i].len, 4, 1, fp);
sum_len += mi->seq[i].len;
}
@@ -356,15 +495,15 @@ void mm_idx_dump(FILE *fp, const mm_idx_t *mi)
fwrite(x, 8, 2, fp);
}
}
fwrite(mi->S, 4, (sum_len + 7) / 8, fp);
if (!(mi->flag & MM_I_NO_SEQ))
fwrite(mi->S, 4, (sum_len + 7) / 8, fp);
fflush(fp);
}
mm_idx_t *mm_idx_load(FILE *fp)
{
int i;
char magic[4];
uint32_t x[5];
uint32_t x[5], i;
uint64_t sum_len = 0;
mm_idx_t *mi;
@@ -378,11 +517,14 @@ mm_idx_t *mm_idx_load(FILE *fp)
uint8_t l;
mm_idx_seq_t *s = &mi->seq[i];
fread(&l, 1, 1, fp);
s->name = (char*)kmalloc(mi->km, l + 1);
fread(s->name, 1, l, fp);
s->name[l] = 0;
if (l) {
s->name = (char*)kmalloc(mi->km, l + 1);
fread(s->name, 1, l, fp);
s->name[l] = 0;
}
fread(&s->len, 4, 1, fp);
s->offset = sum_len;
s->is_alt = 0;
sum_len += s->len;
}
for (i = 0; i < 1<<mi->b; ++i) {
@@ -406,26 +548,228 @@ mm_idx_t *mm_idx_load(FILE *fp)
kh_val(h, k) = x[1];
}
}
mi->S = (uint32_t*)malloc((sum_len + 7) / 8 * 4);
fread(mi->S, 4, (sum_len + 7) / 8, fp);
if (!(mi->flag & MM_I_NO_SEQ)) {
mi->S = (uint32_t*)malloc((sum_len + 7) / 8 * 4);
fread(mi->S, 4, (sum_len + 7) / 8, fp);
}
return mi;
}
int mm_idx_is_idx(const char *fn)
int64_t mm_idx_is_idx(const char *fn)
{
int fd, is_idx = 0;
off_t ret;
int64_t ret, off_end;
char magic[4];
if (strcmp(fn, "-") == 0) return 0; // read from pipe; not an index
fd = open(fn, O_RDONLY);
if (fd < 0) return -1; // error
if ((ret = lseek(fd, 0, SEEK_END)) >= 4) {
#ifdef WIN32
if ((off_end = _lseeki64(fd, 0, SEEK_END)) >= 4) {
_lseeki64(fd, 0, SEEK_SET);
#else
if ((off_end = lseek(fd, 0, SEEK_END)) >= 4) {
lseek(fd, 0, SEEK_SET);
#endif // WIN32
ret = read(fd, magic, 4);
if (ret == 4 && strncmp(magic, MM_IDX_MAGIC, 4) == 0)
is_idx = 1;
}
close(fd);
return is_idx;
return is_idx? off_end : 0;
}
mm_idx_reader_t *mm_idx_reader_open(const char *fn, const mm_idxopt_t *opt, const char *fn_out)
{
int64_t is_idx;
mm_idx_reader_t *r;
is_idx = mm_idx_is_idx(fn);
if (is_idx < 0) return 0; // failed to open the index
r = (mm_idx_reader_t*)calloc(1, sizeof(mm_idx_reader_t));
r->is_idx = is_idx;
if (opt) r->opt = *opt;
else mm_idxopt_init(&r->opt);
if (r->is_idx) {
r->fp.idx = fopen(fn, "rb");
r->idx_size = is_idx;
} else r->fp.seq = mm_bseq_open(fn);
if (fn_out) r->fp_out = fopen(fn_out, "wb");
return r;
}
void mm_idx_reader_close(mm_idx_reader_t *r)
{
if (r->is_idx) fclose(r->fp.idx);
else mm_bseq_close(r->fp.seq);
if (r->fp_out) fclose(r->fp_out);
free(r);
}
mm_idx_t *mm_idx_reader_read(mm_idx_reader_t *r, int n_threads)
{
mm_idx_t *mi;
if (r->is_idx) {
mi = mm_idx_load(r->fp.idx);
if (mi && mm_verbose >= 2 && (mi->k != r->opt.k || mi->w != r->opt.w || (mi->flag&MM_I_HPC) != (r->opt.flag&MM_I_HPC)))
fprintf(stderr, "[WARNING]\033[1;31m Indexing parameters (-k, -w or -H) overridden by parameters used in the prebuilt index.\033[0m\n");
} else
mi = mm_idx_gen(r->fp.seq, r->opt.w, r->opt.k, r->opt.bucket_bits, r->opt.flag, r->opt.mini_batch_size, n_threads, r->opt.batch_size);
if (mi) {
if (r->fp_out) mm_idx_dump(r->fp_out, mi);
mi->index = r->n_parts++;
}
return mi;
}
int mm_idx_reader_eof(const mm_idx_reader_t *r) // TODO: in extremely rare cases, mm_bseq_eof() might not work
{
return r->is_idx? (feof(r->fp.idx) || ftell(r->fp.idx) == r->idx_size) : mm_bseq_eof(r->fp.seq);
}
#include <ctype.h>
#include <zlib.h>
#include "ksort.h"
#include "kseq.h"
KSTREAM_DECLARE(gzFile, gzread)
int mm_idx_alt_read(mm_idx_t *mi, const char *fn)
{
int n_alt = 0;
gzFile fp;
kstream_t *ks;
kstring_t str = {0,0,0};
fp = fn && strcmp(fn, "-")? gzopen(fn, "r") : gzdopen(fileno(stdin), "r");
if (fp == 0) return -1;
ks = ks_init(fp);
if (mi->h == 0) mm_idx_index_name(mi);
while (ks_getuntil(ks, KS_SEP_LINE, &str, 0) >= 0) {
char *p;
int id;
for (p = str.s; *p && !isspace(*p); ++p) { }
*p = 0;
id = mm_idx_name2id(mi, str.s);
if (id >= 0) mi->seq[id].is_alt = 1, ++n_alt;
}
mi->n_alt = n_alt;
if (mm_verbose >= 3)
fprintf(stderr, "[M::%s] found %d ALT contigs\n", __func__, n_alt);
return n_alt;
}
#define sort_key_bed(a) ((a).st)
KRADIX_SORT_INIT(bed, mm_idx_intv1_t, sort_key_bed, 4)
mm_idx_intv_t *mm_idx_read_bed(const mm_idx_t *mi, const char *fn, int read_junc)
{
gzFile fp;
kstream_t *ks;
kstring_t str = {0,0,0};
mm_idx_intv_t *I;
fp = fn && strcmp(fn, "-")? gzopen(fn, "r") : gzdopen(fileno(stdin), "r");
if (fp == 0) return 0;
I = (mm_idx_intv_t*)calloc(mi->n_seq, sizeof(*I));
ks = ks_init(fp);
while (ks_getuntil(ks, KS_SEP_LINE, &str, 0) >= 0) {
mm_idx_intv_t *r;
mm_idx_intv1_t t = {-1,-1,-1,-1,0};
char *p, *q, *bl, *bs;
int32_t i, id = -1, n_blk = 0;
for (p = q = str.s, i = 0;; ++p) {
if (*p == 0 || *p == '\t') {
int32_t c = *p;
*p = 0;
if (i == 0) { // chr
id = mm_idx_name2id(mi, q);
if (id < 0) break; // unknown name; TODO: throw a warning
} else if (i == 1) { // start
t.st = atol(q); // TODO: watch out integer overflow!
if (t.st < 0) break;
} else if (i == 2) { // end
t.en = atol(q);
if (t.en < 0) break;
} else if (i == 4) { // BED score
t.score = atol(q);
} else if (i == 5) { // strand
t.strand = *q == '+'? 1 : *q == '-'? -1 : 0;
} else if (i == 9) {
if (!isdigit(*q)) break;
n_blk = atol(q);
} else if (i == 10) {
bl = q;
} else if (i == 11) {
bs = q;
break;
}
if (c == 0) break;
++i, q = p + 1;
}
}
if (id < 0 || t.st < 0 || t.st >= t.en) continue;
r = &I[id];
if (i >= 11 && read_junc) { // BED12
int32_t st, sz, en;
st = strtol(bs, &bs, 10); ++bs;
sz = strtol(bl, &bl, 10); ++bl;
en = t.st + st + sz;
for (i = 1; i < n_blk; ++i) {
mm_idx_intv1_t s = t;
if (r->n == r->m) {
r->m = r->m? r->m + (r->m>>1) : 16;
r->a = (mm_idx_intv1_t*)realloc(r->a, sizeof(*r->a) * r->m);
}
st = strtol(bs, &bs, 10); ++bs;
sz = strtol(bl, &bl, 10); ++bl;
s.st = en, s.en = t.st + st;
en = t.st + st + sz;
if (s.en > s.st) r->a[r->n++] = s;
}
} else {
if (r->n == r->m) {
r->m = r->m? r->m + (r->m>>1) : 16;
r->a = (mm_idx_intv1_t*)realloc(r->a, sizeof(*r->a) * r->m);
}
r->a[r->n++] = t;
}
}
free(str.s);
ks_destroy(ks);
gzclose(fp);
return I;
}
int mm_idx_bed_read(mm_idx_t *mi, const char *fn, int read_junc)
{
int32_t i;
if (mi->h == 0) mm_idx_index_name(mi);
mi->I = mm_idx_read_bed(mi, fn, read_junc);
if (mi->I == 0) return -1;
for (i = 0; i < mi->n_seq; ++i) // TODO: eliminate redundant intervals
radix_sort_bed(mi->I[i].a, mi->I[i].a + mi->I[i].n);
return 0;
}
int mm_idx_bed_junc(const mm_idx_t *mi, int32_t ctg, int32_t st, int32_t en, uint8_t *s)
{
int32_t i, left, right;
mm_idx_intv_t *r;
memset(s, 0, en - st);
if (mi->I == 0 || ctg < 0 || ctg >= mi->n_seq) return -1;
r = &mi->I[ctg];
left = 0, right = r->n;
while (right > left) {
int32_t mid = left + ((right - left) >> 1);
if (r->a[mid].st >= st) right = mid;
else left = mid + 1;
}
for (i = left; i < r->n; ++i) {
if (st <= r->a[i].st && en >= r->a[i].en && r->a[i].strand != 0) {
if (r->a[i].strand > 0) {
s[r->a[i].st - st] |= 1, s[r->a[i].en - 1 - st] |= 2;
} else {
s[r->a[i].st - st] |= 8, s[r->a[i].en - 1 - st] |= 4;
}
}
}
return left;
}
+127 -136
View File
@@ -1,175 +1,151 @@
#include <stdio.h>
#include <stdlib.h>
#include <string.h>
#include <limits.h>
#include "kalloc.h"
/* The whole thing is: ("@" for the kheader_t of the block, "-" for free
* memory, and "+" for allocated memory. One char for one unit.)
*
* This region is core 1. This region is core 2.
/* In kalloc, a *core* is a large chunk of contiguous memory. Each core is
* associated with a master header, which keeps the size of the current core
* and the pointer to next core. Kalloc allocates small *blocks* of memory from
* the cores and organizes free memory blocks in a circular single-linked list.
*
* @-------@++++++@++++++++++++@------------ @----------@++++++++++++@+++++++@------------
* | | | |
* p=p->ptr->ptr->ptr->ptr p->ptr p->ptr->ptr p->ptr->ptr->ptr
* In the following diagram, "@" stands for the header of a free block (of type
* header_t), "#" for the header of an allocated block (of type size_t), "-"
* for free memory, and "+" for allocated memory.
*
* master This region is core 1. master This region is core 2.
* | |
* *@-------#++++++#++++++++++++@-------- *@----------#++++++++++++#+++++++@------------
* | | | |
* p=p->ptr->ptr->ptr->ptr p->ptr p->ptr->ptr p->ptr->ptr->ptr
*/
#define PTR(p) ((size_t*)((size_t*)p)[1])
typedef struct _allocated_t {
struct _allocated_t *next;
size_t *ptr;
} allocated_t;
typedef struct header_t {
size_t size;
struct header_t *ptr;
} header_t;
typedef struct {
size_t base[2], *loop_head;
allocated_t list_head, *list_tail;
size_t total_allocated;
void *par;
size_t min_core_size;
header_t base, *loop_head, *core_head; /* base is a zero-sized block always kept in the loop */
} kmem_t;
void *km_init()
{
return calloc(1, sizeof(kmem_t));
}
static void kerror(const char *s)
static void panic(const char *s)
{
fprintf(stderr, "%s\n", s);
exit(1);
abort();
}
static size_t *morecore(kmem_t *km, size_t nu)
void *km_init2(void *km_par, size_t min_core_size)
{
size_t rnu, *up;
rnu = (nu + 0xfffff) & (~(size_t)0xfffff);
up = (size_t*)malloc(rnu * sizeof(size_t));
if (!up) { /* fail to allocate memory */
km_stat(km);
fprintf(stderr, "[morecore] %lu bytes requested but not available.\n", (unsigned long)rnu * sizeof(size_t));
exit(1);
}
/* put the pointer in km->list_head */
if (km->list_tail == 0) km->list_tail = &km->list_head;
km->list_tail->ptr = up;
km->list_tail->next = (allocated_t*)calloc(1, sizeof(allocated_t));
km->list_tail = km->list_tail->next;
km->total_allocated += rnu * sizeof(size_t);
*up = rnu; /* the size of the current block, and in this case the block is the same as the new core */
kfree(km, up + 1); /* initialize the new "core" */
return km->loop_head;
kmem_t *km;
km = (kmem_t*)kcalloc(km_par, 1, sizeof(kmem_t));
km->par = km_par;
km->min_core_size = min_core_size > 0? min_core_size : 0x80000;
return (void*)km;
}
void *km_init(void) { return km_init2(0, 0); }
void km_destroy(void *_km)
{
kmem_t *km = (kmem_t*)_km;
allocated_t *p, *q;
if (km == 0) return;
p = &km->list_head;
do {
q = p->next;
free(p->ptr);
if (p != &km->list_head) free(p);
void *km_par;
header_t *p, *q;
if (km == NULL) return;
km_par = km->par;
for (p = km->core_head; p != NULL;) {
q = p->ptr;
kfree(km_par, p);
p = q;
} while (p && p->next);
if (p != &km->list_head) free(p);
free(km);
}
kfree(km_par, km);
}
void kfree(void *_km, void *ap)
static header_t *morecore(kmem_t *km, size_t nu)
{
size_t *p, *q;
header_t *q;
size_t bytes, *p;
nu = (nu + 1 + (km->min_core_size - 1)) / km->min_core_size * km->min_core_size; /* the first +1 for core header */
bytes = nu * sizeof(header_t);
q = (header_t*)kmalloc(km->par, bytes);
if (!q) panic("[morecore] insufficient memory");
q->ptr = km->core_head, q->size = nu, km->core_head = q;
p = (size_t*)(q + 1);
*p = nu - 1; /* the size of the free block; -1 because the first unit is used for the core header */
kfree(km, p + 1); /* initialize the new "core"; NB: the core header is not looped. */
return km->loop_head;
}
void kfree(void *_km, void *ap) /* kfree() also adds a new core to the circular list */
{
header_t *p, *q;
kmem_t *km = (kmem_t*)_km;
if (!ap) return;
if (km == 0) {
if (km == NULL) {
free(ap);
return;
}
p = (size_t*)ap - 1; /* *p is the size of the current block */
p = (header_t*)((size_t*)ap - 1);
p->size = *((size_t*)ap - 1);
/* Find the pointer that points to the block to be freed. The following loop can stop on two conditions:
*
* a) "p>q && p<q->ptr": @------@++++++++@+++++++@------- @---------------@+++++++@-------
* a) "p>q && p<q->ptr": @------#++++++++#+++++++@------- @---------------#+++++++@-------
* (can also be in | | | -> | |
* two cores) q p q->ptr q q->ptr
*
* @-------- @+++++++++@-------- @-------- @------------------
* @-------- #+++++++++@-------- @-------- @------------------
* | | | -> | |
* q p q->ptr q q->ptr
*
* b) "q>=q->ptr && (p>q || p<q->ptr)": @-------@+++++ @--------@+++++++ @-------@+++++ @----------------
* b) "q>=q->ptr && (p>q || p<q->ptr)": @-------#+++++ @--------#+++++++ @-------#+++++ @----------------
* | | | -> | |
* q->ptr q p q->ptr q
*
* @+++++++@----- @++++++++@------- @------------- @++++++++@-------
* #+++++++@----- #++++++++@------- @------------- #++++++++@-------
* | | | -> | |
* p q->ptr q q->ptr q
*/
for (q = km->loop_head; !(p > q && p < PTR(q)); q = PTR(q))
if (q >= PTR(q) && (p > q || p < PTR(q))) break;
if (p + (*p) == PTR(q)) { /* two adjacent blocks, merge p and q->ptr (the 2nd and 4th cases) */
*p += *PTR(q); /* this is the new q->ptr size */
p[1] = (size_t)PTR(PTR(q)); /* this is the new q->ptr->ptr */
/* p is actually the new q->ptr. The actual change happens a few lines below. */
} else if (p + (*p) > PTR(q) && PTR(q) >= p) { /* the end of the allocated block is in the next free block */
kerror("[kfree] The end of the allocated block enters a free block.");
} else p[1] = (size_t)PTR(q); /* backup q->ptr */
for (q = km->loop_head; !(p > q && p < q->ptr); q = q->ptr)
if (q >= q->ptr && (p > q || p < q->ptr)) break;
if (p + p->size == q->ptr) { /* two adjacent blocks, merge p and q->ptr (the 2nd and 4th cases) */
p->size += q->ptr->size;
p->ptr = q->ptr->ptr;
} else if (p + p->size > q->ptr && q->ptr >= p) {
panic("[kfree] The end of the allocated block enters a free block.");
} else p->ptr = q->ptr; /* backup q->ptr */
if (q + (*q) == p) { /* two adjacent blocks, merge q and p (the other two cases) */
*q += *p;
q[1] = (size_t)PTR(p);
if (q + q->size == p) { /* two adjacent blocks, merge q and p (the other two cases) */
q->size += p->size;
q->ptr = p->ptr;
km->loop_head = q;
} else if (q + (*q) > p && p >= q) { /* the end of a free block in the allocated block */
kerror("[kfree] The end of a free block enters the allocated block.");
} else km->loop_head = p, q[1] = (size_t)p; /* in two cores, cannot be merged */
}
void *krealloc(void *_km, void *ap, size_t n_bytes)
{
kmem_t *km = (kmem_t*)_km;
size_t n_units, *p, *q;
if (n_bytes == 0) {
kfree(km, ap); return 0;
}
if (km == 0) return realloc(ap, n_bytes);
if (!ap) return kmalloc(km, n_bytes);
n_units = 1 + (n_bytes + sizeof(size_t) - 1) / sizeof(size_t);
p = (size_t*)ap - 1;
if (*p >= n_units) return ap; /* TODO: this prevents shrinking */
q = (size_t*)kmalloc(km, n_bytes);
memcpy(q, ap, (*p - 1) * sizeof(size_t));
kfree(km, ap);
return q;
} else if (q + q->size > p && p >= q) {
panic("[kfree] The end of a free block enters the allocated block.");
} else km->loop_head = p, q->ptr = p; /* in two cores, cannot be merged; create a new block in the list */
}
void *kmalloc(void *_km, size_t n_bytes)
{
kmem_t *km = (kmem_t*)_km;
size_t n_units, *p, *q;
size_t n_units;
header_t *p, *q;
if (n_bytes == 0) return 0;
if (km == 0) return malloc(n_bytes);
/* "n_units" means the number of units. The size of one unit equals to sizeof(kheader_t).
* "1" is the kheader_t of a block, which is always required. */
n_units = 1 + (n_bytes + sizeof(size_t) - 1) / sizeof(size_t);
if (n_units&1) ++n_units; /* make n_units an even number, or it will segfault if only one unit remains */
if (km == NULL) return malloc(n_bytes);
n_units = (n_bytes + sizeof(size_t) + sizeof(header_t) - 1) / sizeof(header_t); /* header+n_bytes requires at least this number of units */
if (!(q = km->loop_head)) { /* the first time when kmalloc() is called, intialization */
km->base[1] = (size_t)(km->loop_head = q = km->base); *q = 0;
}
for (p = PTR(q);; q = p, p = PTR(p)) { /* search for a suitable block */
if (*p >= n_units) { /* p->size if the size of current block. This line means the current block is large enough. */
if (*p == n_units) q[1] = (size_t)PTR(p); /* no need to split the block */
else { /* split the block */
/* memory is allocated at the end of the block */
*p -= n_units; /* reduce the size of the free block */
p += *p; /* skip to the kheader_t of the allocated block */
*p = n_units; /* set the size */
if (!(q = km->loop_head)) /* the first time when kmalloc() is called, intialize it */
q = km->loop_head = km->base.ptr = &km->base;
for (p = q->ptr;; q = p, p = p->ptr) { /* search for a suitable block */
if (p->size >= n_units) { /* p->size if the size of current block. This line means the current block is large enough. */
if (p->size == n_units) q->ptr = p->ptr; /* no need to split the block */
else { /* split the block. NB: memory is allocated at the end of the block! */
p->size -= n_units; /* reduce the size of the free block */
p += p->size; /* p points to the allocated block */
*(size_t*)p = n_units; /* set the size */
}
km->loop_head = q; /* set the end of chain */
return p + 1; /* skip the kheader_t */
return (size_t*)p + 1;
}
if (p == km->loop_head) { /* then ask for more "cores" */
if ((p = morecore(km, n_units)) == 0) return 0;
@@ -182,33 +158,48 @@ void *kcalloc(void *_km, size_t count, size_t size)
kmem_t *km = (kmem_t*)_km;
void *p;
if (size == 0 || count == 0) return 0;
if (km == 0) return calloc(count, size);
if (km == NULL) return calloc(count, size);
p = kmalloc(km, count * size);
memset(p, 0, count * size);
return p;
}
void km_stat(const void *_km)
void *krealloc(void *_km, void *ap, size_t n_bytes) // TODO: this can be made more efficient in principle
{
kmem_t *km = (kmem_t*)_km;
unsigned n_blocks, n_units;
size_t max_block = 0, *p, *q;
float frag;
size_t cap, *p, *q;
if (km == 0 || !(p = km->loop_head)) return;
n_blocks = n_units = 0;
do {
q = PTR(p);
if (*p > max_block) max_block = *p;
n_units += *p;
if (p + (*p) > q && q > p)
kerror("[kr_stat] The end of a free block enters another free block.");
p = q;
++n_blocks;
} while (p != km->loop_head);
--n_blocks;
frag = 1.0/1024.0 * n_units * sizeof(size_t) / n_blocks;
fprintf(stderr, "[kr_stat] tot=%lu, free=%lu, n_block=%u, max_block=%lu, frag_len=%.3fK\n",
(unsigned long)km->total_allocated, (unsigned long)n_units * sizeof(size_t), n_blocks, (unsigned long)max_block * sizeof(size_t), frag);
if (n_bytes == 0) {
kfree(km, ap); return 0;
}
if (km == NULL) return realloc(ap, n_bytes);
if (ap == NULL) return kmalloc(km, n_bytes);
p = (size_t*)ap - 1;
cap = (*p) * sizeof(header_t) - sizeof(size_t);
if (cap >= n_bytes) return ap; /* TODO: this prevents shrinking */
q = (size_t*)kmalloc(km, n_bytes);
memcpy(q, ap, cap);
kfree(km, ap);
return q;
}
void km_stat(const void *_km, km_stat_t *s)
{
kmem_t *km = (kmem_t*)_km;
header_t *p;
memset(s, 0, sizeof(km_stat_t));
if (km == NULL || km->loop_head == NULL) return;
for (p = km->loop_head;; p = p->ptr) {
s->available += p->size * sizeof(header_t);
if (p->size != 0) ++s->n_blocks; /* &kmem_t::base is always one of the cores. It is zero-sized. */
if (p->ptr > p && p + p->size > p->ptr)
panic("[km_stat] The end of a free block enters another free block.");
if (p->ptr == km->loop_head) break;
}
for (p = km->core_head; p != NULL; p = p->ptr) {
size_t size = p->size * sizeof(header_t);
++s->n_cores;
s->capacity += size;
s->largest = s->largest > size? s->largest : size;
}
}
+55 -5
View File
@@ -1,26 +1,76 @@
#ifndef _KALLOC_H_
#define _KALLOC_H_
#include <stdlib.h>
#define km_size(x) (*(((size_t*)(x))-1) * sizeof(size_t))
#include <stddef.h> /* for size_t */
#ifdef __cplusplus
extern "C" {
#endif
typedef struct {
size_t capacity, available, n_blocks, n_cores, largest;
} km_stat_t;
void *kmalloc(void *km, size_t size);
void *krealloc(void *km, void *ptr, size_t size);
void *kcalloc(void *km, size_t count, size_t size);
void kfree(void *km, void *ptr);
void *km_init(void);
void *km_init2(void *km_par, size_t min_core_size);
void km_destroy(void *km);
void km_stat(const void *km); // TODO: return numbers instead of print to stderr
void km_stat(const void *_km, km_stat_t *s);
#ifdef __cplusplus
}
#endif
#define KMALLOC(km, ptr, len) ((ptr) = (__typeof__(ptr))kmalloc((km), (len) * sizeof(*(ptr))))
#define KCALLOC(km, ptr, len) ((ptr) = (__typeof__(ptr))kcalloc((km), (len), sizeof(*(ptr))))
#define KREALLOC(km, ptr, len) ((ptr) = (__typeof__(ptr))krealloc((km), (ptr), (len) * sizeof(*(ptr))))
#define KEXPAND(km, a, m) do { \
(m) = (m) >= 4? (m) + ((m)>>1) : 16; \
KREALLOC((km), (a), (m)); \
} while (0)
#ifndef klib_unused
#if (defined __clang__ && __clang_major__ >= 3) || (defined __GNUC__ && __GNUC__ >= 3)
#define klib_unused __attribute__ ((__unused__))
#else
#define klib_unused
#endif
#endif /* klib_unused */
#define KALLOC_POOL_INIT2(SCOPE, name, kmptype_t) \
typedef struct { \
size_t cnt, n, max; \
kmptype_t **buf; \
void *km; \
} kmp_##name##_t; \
SCOPE kmp_##name##_t *kmp_init_##name(void *km) { \
kmp_##name##_t *mp; \
KCALLOC(km, mp, 1); \
mp->km = km; \
return mp; \
} \
SCOPE void kmp_destroy_##name(kmp_##name##_t *mp) { \
size_t k; \
for (k = 0; k < mp->n; ++k) kfree(mp->km, mp->buf[k]); \
kfree(mp->km, mp->buf); kfree(mp->km, mp); \
} \
SCOPE kmptype_t *kmp_alloc_##name(kmp_##name##_t *mp) { \
++mp->cnt; \
if (mp->n == 0) return (kmptype_t*)kcalloc(mp->km, 1, sizeof(kmptype_t)); \
return mp->buf[--mp->n]; \
} \
SCOPE void kmp_free_##name(kmp_##name##_t *mp, kmptype_t *p) { \
--mp->cnt; \
if (mp->n == mp->max) KEXPAND(mp->km, mp->buf, mp->max); \
mp->buf[mp->n++] = p; \
}
#define KALLOC_POOL_INIT(name, kmptype_t) \
KALLOC_POOL_INIT2(static inline klib_unused, name, kmptype_t)
#endif
+120
View File
@@ -0,0 +1,120 @@
#ifndef KETOPT_H
#define KETOPT_H
#include <string.h> /* for strchr() and strncmp() */
#define ko_no_argument 0
#define ko_required_argument 1
#define ko_optional_argument 2
typedef struct {
int ind; /* equivalent to optind */
int opt; /* equivalent to optopt */
char *arg; /* equivalent to optarg */
int longidx; /* index of a long option; or -1 if short */
/* private variables not intended for external uses */
int i, pos, n_args;
} ketopt_t;
typedef struct {
char *name;
int has_arg;
int val;
} ko_longopt_t;
static ketopt_t KETOPT_INIT = { 1, 0, 0, -1, 1, 0, 0 };
static void ketopt_permute(char *argv[], int j, int n) /* move argv[j] over n elements to the left */
{
int k;
char *p = argv[j];
for (k = 0; k < n; ++k)
argv[j - k] = argv[j - k - 1];
argv[j - k] = p;
}
/**
* Parse command-line options and arguments
*
* This fuction has a similar interface to GNU's getopt_long(). Each call
* parses one option and returns the option name. s->arg points to the option
* argument if present. The function returns -1 when all command-line arguments
* are parsed. In this case, s->ind is the index of the first non-option
* argument.
*
* @param s status; shall be initialized to KETOPT_INIT on the first call
* @param argc length of argv[]
* @param argv list of command-line arguments; argv[0] is ignored
* @param permute non-zero to move options ahead of non-option arguments
* @param ostr option string
* @param longopts long options
*
* @return ASCII for a short option; ko_longopt_t::val for a long option; -1 if
* argv[] is fully processed; '?' for an unknown option or an ambiguous
* long option; ':' if an option argument is missing
*/
static int ketopt(ketopt_t *s, int argc, char *argv[], int permute, const char *ostr, const ko_longopt_t *longopts)
{
int opt = -1, i0, j;
if (permute) {
while (s->i < argc && (argv[s->i][0] != '-' || argv[s->i][1] == '\0'))
++s->i, ++s->n_args;
}
s->arg = 0, s->longidx = -1, i0 = s->i;
if (s->i >= argc || argv[s->i][0] != '-' || argv[s->i][1] == '\0') {
s->ind = s->i - s->n_args;
return -1;
}
if (argv[s->i][0] == '-' && argv[s->i][1] == '-') { /* "--" or a long option */
if (argv[s->i][2] == '\0') { /* a bare "--" */
ketopt_permute(argv, s->i, s->n_args);
++s->i, s->ind = s->i - s->n_args;
return -1;
}
s->opt = 0, opt = '?', s->pos = -1;
if (longopts) { /* parse long options */
int k, n_exact = 0, n_partial = 0;
const ko_longopt_t *o = 0, *o_exact = 0, *o_partial = 0;
for (j = 2; argv[s->i][j] != '\0' && argv[s->i][j] != '='; ++j) {} /* find the end of the option name */
for (k = 0; longopts[k].name != 0; ++k)
if (strncmp(&argv[s->i][2], longopts[k].name, j - 2) == 0) {
if (longopts[k].name[j - 2] == 0) ++n_exact, o_exact = &longopts[k];
else ++n_partial, o_partial = &longopts[k];
}
if (n_exact > 1 || (n_exact == 0 && n_partial > 1)) return '?';
o = n_exact == 1? o_exact : n_partial == 1? o_partial : 0;
if (o) {
s->opt = opt = o->val, s->longidx = o - longopts;
if (argv[s->i][j] == '=') s->arg = &argv[s->i][j + 1];
if (o->has_arg == 1 && argv[s->i][j] == '\0') {
if (s->i < argc - 1) s->arg = argv[++s->i];
else opt = ':'; /* missing option argument */
}
}
}
} else { /* a short option */
char *p;
if (s->pos == 0) s->pos = 1;
opt = s->opt = argv[s->i][s->pos++];
p = strchr((char*)ostr, opt);
if (p == 0) {
opt = '?'; /* unknown option */
} else if (p[1] == ':') {
if (argv[s->i][s->pos] == 0) {
if (s->i < argc - 1) s->arg = argv[++s->i];
else opt = ':'; /* missing option argument */
} else s->arg = &argv[s->i][s->pos];
s->pos = -1;
}
}
if (s->pos < 0 || argv[s->i][s->pos] == 0) {
++s->i, s->pos = 0;
if (s->n_args > 0) /* permute */
for (j = i0; j < s->i; ++j)
ketopt_permute(argv, j, s->n_args);
}
s->ind = s->i - s->n_args;
return opt;
}
#endif
+474
View File
@@ -0,0 +1,474 @@
/* The MIT License
Copyright (c) 2019 by Attractive Chaos <attractor@live.co.uk>
Permission is hereby granted, free of charge, to any person obtaining
a copy of this software and associated documentation files (the
"Software"), to deal in the Software without restriction, including
without limitation the rights to use, copy, modify, merge, publish,
distribute, sublicense, and/or sell copies of the Software, and to
permit persons to whom the Software is furnished to do so, subject to
the following conditions:
The above copyright notice and this permission notice shall be
included in all copies or substantial portions of the Software.
THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS
BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN
ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN
CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
SOFTWARE.
*/
/* An example:
#include <stdio.h>
#include <string.h>
#include <stdlib.h>
#include "krmq.h"
struct my_node {
char key;
KRMQ_HEAD(struct my_node) head;
};
#define my_cmp(p, q) (((q)->key < (p)->key) - ((p)->key < (q)->key))
KRMQ_INIT(my, struct my_node, head, my_cmp)
int main(void) {
const char *str = "MNOLKQOPHIA"; // from wiki, except a duplicate
struct my_node *root = 0;
int i, l = strlen(str);
for (i = 0; i < l; ++i) { // insert in the input order
struct my_node *q, *p = malloc(sizeof(*p));
p->key = str[i];
q = krmq_insert(my, &root, p, 0);
if (p != q) free(p); // if already present, free
}
krmq_itr_t(my) itr;
krmq_itr_first(my, root, &itr); // place at first
do { // traverse
const struct my_node *p = krmq_at(&itr);
putchar(p->key);
free((void*)p); // free node
} while (krmq_itr_next(my, &itr));
putchar('\n');
return 0;
}
*/
#ifndef KRMQ_H
#define KRMQ_H
#ifdef __STRICT_ANSI__
#define inline __inline__
#endif
#define KRMQ_MAX_DEPTH 64
#define krmq_size(head, p) ((p)? (p)->head.size : 0)
#define krmq_size_child(head, q, i) ((q)->head.p[(i)]? (q)->head.p[(i)]->head.size : 0)
#define KRMQ_HEAD(__type) \
struct { \
__type *p[2], *s; \
signed char balance; /* balance factor */ \
unsigned size; /* #elements in subtree */ \
}
#define __KRMQ_FIND(suf, __scope, __type, __head, __cmp) \
__scope __type *krmq_find_##suf(const __type *root, const __type *x, unsigned *cnt_) { \
const __type *p = root; \
unsigned cnt = 0; \
while (p != 0) { \
int cmp; \
cmp = __cmp(x, p); \
if (cmp >= 0) cnt += krmq_size_child(__head, p, 0) + 1; \
if (cmp < 0) p = p->__head.p[0]; \
else if (cmp > 0) p = p->__head.p[1]; \
else break; \
} \
if (cnt_) *cnt_ = cnt; \
return (__type*)p; \
} \
__scope __type *krmq_interval_##suf(const __type *root, const __type *x, __type **lower, __type **upper) { \
const __type *p = root, *l = 0, *u = 0; \
while (p != 0) { \
int cmp; \
cmp = __cmp(x, p); \
if (cmp < 0) u = p, p = p->__head.p[0]; \
else if (cmp > 0) l = p, p = p->__head.p[1]; \
else { l = u = p; break; } \
} \
if (lower) *lower = (__type*)l; \
if (upper) *upper = (__type*)u; \
return (__type*)p; \
}
#define __KRMQ_RMQ(suf, __scope, __type, __head, __cmp, __lt2) \
__scope __type *krmq_rmq_##suf(const __type *root, const __type *lo, const __type *up) { /* CLOSED interval */ \
const __type *p = root, *path[2][KRMQ_MAX_DEPTH], *min; \
int plen[2] = {0, 0}, pcmp[2][KRMQ_MAX_DEPTH], i, cmp, lca; \
if (root == 0) return 0; \
while (p) { \
cmp = __cmp(lo, p); \
path[0][plen[0]] = p, pcmp[0][plen[0]++] = cmp; \
if (cmp < 0) p = p->__head.p[0]; \
else if (cmp > 0) p = p->__head.p[1]; \
else break; \
} \
p = root; \
while (p) { \
cmp = __cmp(up, p); \
path[1][plen[1]] = p, pcmp[1][plen[1]++] = cmp; \
if (cmp < 0) p = p->__head.p[0]; \
else if (cmp > 0) p = p->__head.p[1]; \
else break; \
} \
for (i = 0; i < plen[0] && i < plen[1]; ++i) /* find the LCA */ \
if (path[0][i] == path[1][i] && pcmp[0][i] <= 0 && pcmp[1][i] >= 0) \
break; \
if (i == plen[0] || i == plen[1]) return 0; /* no elements in the closed interval */ \
lca = i, min = path[0][lca]; \
for (i = lca + 1; i < plen[0]; ++i) { \
if (pcmp[0][i] <= 0) { \
if (__lt2(path[0][i], min)) min = path[0][i]; \
if (path[0][i]->__head.p[1] && __lt2(path[0][i]->__head.p[1]->__head.s, min)) \
min = path[0][i]->__head.p[1]->__head.s; \
} \
} \
for (i = lca + 1; i < plen[1]; ++i) { \
if (pcmp[1][i] >= 0) { \
if (__lt2(path[1][i], min)) min = path[1][i]; \
if (path[1][i]->__head.p[0] && __lt2(path[1][i]->__head.p[0]->__head.s, min)) \
min = path[1][i]->__head.p[0]->__head.s; \
} \
} \
return (__type*)min; \
}
#define __KRMQ_ROTATE(suf, __type, __head, __lt2) \
/* */ \
static inline void krmq_update_min_##suf(__type *p, const __type *q, const __type *r) { \
p->__head.s = !q || __lt2(p, q->__head.s)? p : q->__head.s; \
p->__head.s = !r || __lt2(p->__head.s, r->__head.s)? p->__head.s : r->__head.s; \
} \
/* one rotation: (a,(b,c)q)p => ((a,b)p,c)q */ \
static inline __type *krmq_rotate1_##suf(__type *p, int dir) { /* dir=0 to left; dir=1 to right */ \
int opp = 1 - dir; /* opposite direction */ \
__type *q = p->__head.p[opp], *s = p->__head.s; \
unsigned size_p = p->__head.size; \
p->__head.size -= q->__head.size - krmq_size_child(__head, q, dir); \
q->__head.size = size_p; \
krmq_update_min_##suf(p, p->__head.p[dir], q->__head.p[dir]); \
q->__head.s = s; \
p->__head.p[opp] = q->__head.p[dir]; \
q->__head.p[dir] = p; \
return q; \
} \
/* two consecutive rotations: (a,((b,c)r,d)q)p => ((a,b)p,(c,d)q)r */ \
static inline __type *krmq_rotate2_##suf(__type *p, int dir) { \
int b1, opp = 1 - dir; \
__type *q = p->__head.p[opp], *r = q->__head.p[dir], *s = p->__head.s; \
unsigned size_x_dir = krmq_size_child(__head, r, dir); \
r->__head.size = p->__head.size; \
p->__head.size -= q->__head.size - size_x_dir; \
q->__head.size -= size_x_dir + 1; \
krmq_update_min_##suf(p, p->__head.p[dir], r->__head.p[dir]); \
krmq_update_min_##suf(q, q->__head.p[opp], r->__head.p[opp]); \
r->__head.s = s; \
p->__head.p[opp] = r->__head.p[dir]; \
r->__head.p[dir] = p; \
q->__head.p[dir] = r->__head.p[opp]; \
r->__head.p[opp] = q; \
b1 = dir == 0? +1 : -1; \
if (r->__head.balance == b1) q->__head.balance = 0, p->__head.balance = -b1; \
else if (r->__head.balance == 0) q->__head.balance = p->__head.balance = 0; \
else q->__head.balance = b1, p->__head.balance = 0; \
r->__head.balance = 0; \
return r; \
}
#define __KRMQ_INSERT(suf, __scope, __type, __head, __cmp, __lt2) \
__scope __type *krmq_insert_##suf(__type **root_, __type *x, unsigned *cnt_) { \
unsigned char stack[KRMQ_MAX_DEPTH]; \
__type *path[KRMQ_MAX_DEPTH]; \
__type *bp, *bq; \
__type *p, *q, *r = 0; /* _r_ is potentially the new root */ \
int i, which = 0, top, b1, path_len; \
unsigned cnt = 0; \
bp = *root_, bq = 0; \
/* find the insertion location */ \
for (p = bp, q = bq, top = path_len = 0; p; q = p, p = p->__head.p[which]) { \
int cmp; \
cmp = __cmp(x, p); \
if (cmp >= 0) cnt += krmq_size_child(__head, p, 0) + 1; \
if (cmp == 0) { \
if (cnt_) *cnt_ = cnt; \
return p; \
} \
if (p->__head.balance != 0) \
bq = q, bp = p, top = 0; \
stack[top++] = which = (cmp > 0); \
path[path_len++] = p; \
} \
if (cnt_) *cnt_ = cnt; \
x->__head.balance = 0, x->__head.size = 1, x->__head.p[0] = x->__head.p[1] = 0, x->__head.s = x; \
if (q == 0) *root_ = x; \
else q->__head.p[which] = x; \
if (bp == 0) return x; \
for (i = 0; i < path_len; ++i) ++path[i]->__head.size; \
for (i = path_len - 1; i >= 0; --i) { \
krmq_update_min_##suf(path[i], path[i]->__head.p[0], path[i]->__head.p[1]); \
if (path[i]->__head.s != x) break; \
} \
for (p = bp, top = 0; p != x; p = p->__head.p[stack[top]], ++top) /* update balance factors */ \
if (stack[top] == 0) --p->__head.balance; \
else ++p->__head.balance; \
if (bp->__head.balance > -2 && bp->__head.balance < 2) return x; /* no re-balance needed */ \
/* re-balance */ \
which = (bp->__head.balance < 0); \
b1 = which == 0? +1 : -1; \
q = bp->__head.p[1 - which]; \
if (q->__head.balance == b1) { \
r = krmq_rotate1_##suf(bp, which); \
q->__head.balance = bp->__head.balance = 0; \
} else r = krmq_rotate2_##suf(bp, which); \
if (bq == 0) *root_ = r; \
else bq->__head.p[bp != bq->__head.p[0]] = r; \
return x; \
}
#define __KRMQ_ERASE(suf, __scope, __type, __head, __cmp, __lt2) \
__scope __type *krmq_erase_##suf(__type **root_, const __type *x, unsigned *cnt_) { \
__type *p, *path[KRMQ_MAX_DEPTH], fake; \
unsigned char dir[KRMQ_MAX_DEPTH]; \
int i, d = 0, cmp; \
unsigned cnt = 0; \
fake = **root_, fake.__head.p[0] = *root_, fake.__head.p[1] = 0; \
if (cnt_) *cnt_ = 0; \
if (x) { \
for (cmp = -1, p = &fake; cmp; cmp = __cmp(x, p)) { \
int which = (cmp > 0); \
if (cmp > 0) cnt += krmq_size_child(__head, p, 0) + 1; \
dir[d] = which; \
path[d++] = p; \
p = p->__head.p[which]; \
if (p == 0) { \
if (cnt_) *cnt_ = 0; \
return 0; \
} \
} \
cnt += krmq_size_child(__head, p, 0) + 1; /* because p==x is not counted */ \
} else { \
for (p = &fake, cnt = 1; p; p = p->__head.p[0]) \
dir[d] = 0, path[d++] = p; \
p = path[--d]; \
} \
if (cnt_) *cnt_ = cnt; \
for (i = 1; i < d; ++i) --path[i]->__head.size; \
if (p->__head.p[1] == 0) { /* ((1,.)2,3)4 => (1,3)4; p=2 */ \
path[d-1]->__head.p[dir[d-1]] = p->__head.p[0]; \
} else { \
__type *q = p->__head.p[1]; \
if (q->__head.p[0] == 0) { /* ((1,2)3,4)5 => ((1)2,4)5; p=3,q=2 */ \
q->__head.p[0] = p->__head.p[0]; \
q->__head.balance = p->__head.balance; \
path[d-1]->__head.p[dir[d-1]] = q; \
path[d] = q, dir[d++] = 1; \
q->__head.size = p->__head.size - 1; \
} else { /* ((1,((.,2)3,4)5)6,7)8 => ((1,(2,4)5)3,7)8; p=6 */ \
__type *r; \
int e = d++; /* backup _d_ */\
for (;;) { \
dir[d] = 0; \
path[d++] = q; \
r = q->__head.p[0]; \
if (r->__head.p[0] == 0) break; \
q = r; \
} \
r->__head.p[0] = p->__head.p[0]; \
q->__head.p[0] = r->__head.p[1]; \
r->__head.p[1] = p->__head.p[1]; \
r->__head.balance = p->__head.balance; \
path[e-1]->__head.p[dir[e-1]] = r; \
path[e] = r, dir[e] = 1; \
for (i = e + 1; i < d; ++i) --path[i]->__head.size; \
r->__head.size = p->__head.size - 1; \
} \
} \
for (i = d - 1; i >= 0; --i) /* not sure why adding condition "path[i]->__head.s==p" doesn't work */ \
krmq_update_min_##suf(path[i], path[i]->__head.p[0], path[i]->__head.p[1]); \
while (--d > 0) { \
__type *q = path[d]; \
int which, other, b1 = 1, b2 = 2; \
which = dir[d], other = 1 - which; \
if (which) b1 = -b1, b2 = -b2; \
q->__head.balance += b1; \
if (q->__head.balance == b1) break; \
else if (q->__head.balance == b2) { \
__type *r = q->__head.p[other]; \
if (r->__head.balance == -b1) { \
path[d-1]->__head.p[dir[d-1]] = krmq_rotate2_##suf(q, which); \
} else { \
path[d-1]->__head.p[dir[d-1]] = krmq_rotate1_##suf(q, which); \
if (r->__head.balance == 0) { \
r->__head.balance = -b1; \
q->__head.balance = b1; \
break; \
} else r->__head.balance = q->__head.balance = 0; \
} \
} \
} \
*root_ = fake.__head.p[0]; \
return p; \
}
#define krmq_free(__type, __head, __root, __free) do { \
__type *_p, *_q; \
for (_p = __root; _p; _p = _q) { \
if (_p->__head.p[0] == 0) { \
_q = _p->__head.p[1]; \
__free(_p); \
} else { \
_q = _p->__head.p[0]; \
_p->__head.p[0] = _q->__head.p[1]; \
_q->__head.p[1] = _p; \
} \
} \
} while (0)
#define __KRMQ_ITR(suf, __scope, __type, __head, __cmp) \
struct krmq_itr_##suf { \
const __type *stack[KRMQ_MAX_DEPTH], **top; \
}; \
__scope void krmq_itr_first_##suf(const __type *root, struct krmq_itr_##suf *itr) { \
const __type *p; \
for (itr->top = itr->stack - 1, p = root; p; p = p->__head.p[0]) \
*++itr->top = p; \
} \
__scope int krmq_itr_find_##suf(const __type *root, const __type *x, struct krmq_itr_##suf *itr) { \
const __type *p = root; \
itr->top = itr->stack - 1; \
while (p != 0) { \
int cmp; \
*++itr->top = p; \
cmp = __cmp(x, p); \
if (cmp < 0) p = p->__head.p[0]; \
else if (cmp > 0) p = p->__head.p[1]; \
else break; \
} \
return p? 1 : 0; \
} \
__scope int krmq_itr_next_bidir_##suf(struct krmq_itr_##suf *itr, int dir) { \
const __type *p; \
if (itr->top < itr->stack) return 0; \
dir = !!dir; \
p = (*itr->top)->__head.p[dir]; \
if (p) { /* go down */ \
for (; p; p = p->__head.p[!dir]) \
*++itr->top = p; \
return 1; \
} else { /* go up */ \
do { \
p = *itr->top--; \
} while (itr->top >= itr->stack && p == (*itr->top)->__head.p[dir]); \
return itr->top < itr->stack? 0 : 1; \
} \
} \
/**
* Insert a node to the tree
*
* @param suf name suffix used in KRMQ_INIT()
* @param proot pointer to the root of the tree (in/out: root may change)
* @param x node to insert (in)
* @param cnt number of nodes smaller than or equal to _x_; can be NULL (out)
*
* @return _x_ if not present in the tree, or the node equal to x.
*/
#define krmq_insert(suf, proot, x, cnt) krmq_insert_##suf(proot, x, cnt)
/**
* Find a node in the tree
*
* @param suf name suffix used in KRMQ_INIT()
* @param root root of the tree
* @param x node value to find (in)
* @param cnt number of nodes smaller than or equal to _x_; can be NULL (out)
*
* @return node equal to _x_ if present, or NULL if absent
*/
#define krmq_find(suf, root, x, cnt) krmq_find_##suf(root, x, cnt)
#define krmq_interval(suf, root, x, lower, upper) krmq_interval_##suf(root, x, lower, upper)
#define krmq_rmq(suf, root, lo, up) krmq_rmq_##suf(root, lo, up)
/**
* Delete a node from the tree
*
* @param suf name suffix used in KRMQ_INIT()
* @param proot pointer to the root of the tree (in/out: root may change)
* @param x node value to delete; if NULL, delete the first node (in)
*
* @return node removed from the tree if present, or NULL if absent
*/
#define krmq_erase(suf, proot, x, cnt) krmq_erase_##suf(proot, x, cnt)
#define krmq_erase_first(suf, proot) krmq_erase_##suf(proot, 0, 0)
#define krmq_itr_t(suf) struct krmq_itr_##suf
/**
* Place the iterator at the smallest object
*
* @param suf name suffix used in KRMQ_INIT()
* @param root root of the tree
* @param itr iterator
*/
#define krmq_itr_first(suf, root, itr) krmq_itr_first_##suf(root, itr)
/**
* Place the iterator at the object equal to or greater than the query
*
* @param suf name suffix used in KRMQ_INIT()
* @param root root of the tree
* @param x query (in)
* @param itr iterator (out)
*
* @return 1 if find; 0 otherwise. krmq_at(itr) is NULL if and only if query is
* larger than all objects in the tree
*/
#define krmq_itr_find(suf, root, x, itr) krmq_itr_find_##suf(root, x, itr)
/**
* Move to the next object in order
*
* @param itr iterator (modified)
*
* @return 1 if there is a next object; 0 otherwise
*/
#define krmq_itr_next(suf, itr) krmq_itr_next_bidir_##suf(itr, 1)
#define krmq_itr_prev(suf, itr) krmq_itr_next_bidir_##suf(itr, 0)
/**
* Return the pointer at the iterator
*
* @param itr iterator
*
* @return pointer if present; NULL otherwise
*/
#define krmq_at(itr) ((itr)->top < (itr)->stack? 0 : *(itr)->top)
#define KRMQ_INIT2(suf, __scope, __type, __head, __cmp, __lt2) \
__KRMQ_FIND(suf, __scope, __type, __head, __cmp) \
__KRMQ_RMQ(suf, __scope, __type, __head, __cmp, __lt2) \
__KRMQ_ROTATE(suf, __type, __head, __lt2) \
__KRMQ_INSERT(suf, __scope, __type, __head, __cmp, __lt2) \
__KRMQ_ERASE(suf, __scope, __type, __head, __cmp, __lt2) \
__KRMQ_ITR(suf, __scope, __type, __head, __cmp)
#define KRMQ_INIT(suf, __type, __head, __cmp, __lt2) \
KRMQ_INIT2(suf,, __type, __head, __cmp, __lt2)
#endif
+10 -2
View File
@@ -37,6 +37,14 @@
#define KS_SEP_LINE 2 // line separator: "\n" (Unix) or "\r\n" (Windows)
#define KS_SEP_MAX 2
#ifndef klib_unused
#if (defined __clang__ && __clang_major__ >= 3) || (defined __GNUC__ && __GNUC__ >= 3)
#define klib_unused __attribute__ ((__unused__))
#else
#define klib_unused
#endif
#endif /* klib_unused */
#define __KS_TYPE(type_t) \
typedef struct __kstream_t { \
int begin, end; \
@@ -64,7 +72,7 @@
}
#define __KS_INLINED(__read) \
static inline int ks_getc(kstream_t *ks) \
static inline klib_unused int ks_getc(kstream_t *ks) \
{ \
if (ks->is_eof && ks->begin >= ks->end) return -1; \
if (ks->begin >= ks->end) { \
@@ -81,7 +89,7 @@
#ifndef KSTRING_T
#define KSTRING_T kstring_t
typedef struct __kstring_t {
unsigned l, m;
size_t l, m;
char *s;
} kstring_t;
#endif
+19 -2
View File
@@ -37,9 +37,26 @@ typedef struct {
int depth;
} ks_isort_stack_t;
#define KSORT_SWAP(type_t, a, b) { register type_t t=(a); (a)=(b); (b)=t; }
#define KSORT_SWAP(type_t, a, b) { type_t t=(a); (a)=(b); (b)=t; }
#define KSORT_INIT(name, type_t, __sort_lt) \
#define KSORT_INIT(name, type_t, __sort_lt) \
void ks_heapdown_##name(size_t i, size_t n, type_t l[]) \
{ \
size_t k = i; \
type_t tmp = l[i]; \
while ((k = (k << 1) + 1) < n) { \
if (k != n - 1 && __sort_lt(l[k], l[k+1])) ++k; \
if (__sort_lt(l[k], tmp)) break; \
l[i] = l[k]; i = k; \
} \
l[i] = tmp; \
} \
void ks_heapmake_##name(size_t lsize, type_t l[]) \
{ \
size_t i; \
for (i = (lsize >> 1) - 1; i != (size_t)(-1); --i) \
ks_heapdown_##name(i, lsize, l); \
} \
type_t ks_ksmall_##name(size_t n, type_t arr[], size_t kk) \
{ \
type_t *low, *high, *k, *ll, *hh, *mid; \
+26 -14
View File
@@ -14,6 +14,14 @@
#define KSW_EZ_REV_CIGAR 0x80 // reverse CIGAR in the output
#define KSW_EZ_SPLICE_FOR 0x100
#define KSW_EZ_SPLICE_REV 0x200
#define KSW_EZ_SPLICE_FLANK 0x400
// The subset of CIGAR operators used by ksw code.
// Use MM_CIGAR_* from minimap.h if you need the full list.
#define KSW_CIGAR_MATCH 0
#define KSW_CIGAR_INS 1
#define KSW_CIGAR_DEL 2
#define KSW_CIGAR_N_SKIP 3
#ifdef __cplusplus
extern "C" {
@@ -26,6 +34,7 @@ typedef struct {
int mte, mte_q; // max score when reaching the end of target
int score; // max score reaching both ends; may be KSW_NEG_INF
int m_cigar, n_cigar;
int reach_end;
uint32_t *cigar;
} ksw_extz_t;
@@ -46,17 +55,20 @@ typedef struct {
* @param flag flag (see KSW_EZ_* macros)
* @param ez (out) scores and cigar
*/
void ksw_extz(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int flag, ksw_extz_t *ez);
void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int flag, ksw_extz_t *ez);
void ksw_extz(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int w, int zdrop, int flag, ksw_extz_t *ez);
void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
void ksw_extd(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t gapo, int8_t gape, int8_t gapo2, int8_t gape2, int w, int zdrop, int flag, ksw_extz_t *ez);
void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t gapo, int8_t gape, int8_t gapo2, int8_t gape2, int w, int zdrop, int flag, ksw_extz_t *ez);
int8_t gapo, int8_t gape, int8_t gapo2, int8_t gape2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t gapo, int8_t gape, int8_t gapo2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez);
int8_t gapo, int8_t gape, int8_t gapo2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez);
void ksw_extf2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t mch, int8_t mis, int8_t e, int w, int xdrop, ksw_extz_t *ez);
@@ -111,7 +123,7 @@ static inline uint32_t *ksw_push_cigar(void *km, int *n_cigar, int *m_cigar, uin
// bit 0-2: which type gets the max - 0 for H, 1 for E, 2 for F, 3 for \tilde{E} and 4 for \tilde{F}
// bit 3/0x08: 1 if a continuation on the E state (bit 5/0x20 for a continuation on \tilde{E})
// bit 4/0x10: 1 if a continuation on the F state (bit 6/0x40 for a continuation on \tilde{F})
static inline void ksw_backtrack(void *km, int is_rot, int is_rev, int with_N, const uint8_t *p, const int *off, const int *off_end, int n_col, int i0, int j0,
static inline void ksw_backtrack(void *km, int is_rot, int is_rev, int min_intron_len, const uint8_t *p, const int *off, const int *off_end, int n_col, int i0, int j0,
int *m_cigar_, int *n_cigar_, uint32_t **cigar_)
{ // p[] - lower 3 bits: which type gets the max; bit
int n_cigar = 0, m_cigar = *m_cigar_, i = i0, j = j0, r, state = 0;
@@ -122,23 +134,23 @@ static inline void ksw_backtrack(void *km, int is_rot, int is_rev, int with_N, c
r = i + j;
if (i < off[r]) force_state = 2;
if (off_end && i > off_end[r]) force_state = 1;
tmp = force_state < 0? p[r * n_col + i - off[r]] : 0;
tmp = force_state < 0? p[(size_t)r * n_col + i - off[r]] : 0;
} else {
if (j < off[i]) force_state = 2;
if (off_end && j > off_end[i]) force_state = 1;
tmp = force_state < 0? p[i * n_col + j - off[i]] : 0;
tmp = force_state < 0? p[(size_t)i * n_col + j - off[i]] : 0;
}
if (state == 0) state = tmp & 7; // if requesting the H state, find state one maximizes it.
else if (!(tmp >> (state + 2) & 1)) state = 0; // if requesting other states, _state_ stays the same if it is a continuation; otherwise, set to H
if (state == 0) state = tmp & 7; // TODO: probably this line can be merged into the "else if" line right above; not 100% sure
if (force_state >= 0) state = force_state;
if (state == 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 0, 1), --i, --j; // match
else if (state == 1 || (state == 3 && !with_N)) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 2, 1), --i; // deletion
else if (state == 3 && with_N) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 3, 1), --i; // intron
else cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 1, 1), --j; // insertion
if (state == 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, KSW_CIGAR_MATCH, 1), --i, --j;
else if (state == 1 || (state == 3 && min_intron_len <= 0)) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, KSW_CIGAR_DEL, 1), --i;
else if (state == 3 && min_intron_len > 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, KSW_CIGAR_N_SKIP, 1), --i;
else cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, KSW_CIGAR_INS, 1), --j;
}
if (i >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 2, i + 1); // first deletion
if (j >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 1, j + 1); // first insertion
if (i >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, min_intron_len > 0 && i >= min_intron_len? KSW_CIGAR_N_SKIP : KSW_CIGAR_DEL, i + 1); // first deletion
if (j >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, KSW_CIGAR_INS, j + 1); // first insertion
if (!is_rev)
for (i = 0; i < n_cigar>>1; ++i) // reverse CIGAR
tmp = cigar[i], cigar[i] = cigar[n_cigar-1-i], cigar[n_cigar-1-i] = tmp;
@@ -149,7 +161,7 @@ static inline void ksw_reset_extz(ksw_extz_t *ez)
{
ez->max_q = ez->max_t = ez->mqe_t = ez->mte_q = -1;
ez->max = 0, ez->score = ez->mqe = ez->mte = KSW_NEG_INF;
ez->n_cigar = 0, ez->zdropped = 0;
ez->n_cigar = 0, ez->zdropped = 0, ez->reach_end = 0;
}
static inline int ksw_apply_zdrop(ksw_extz_t *ez, int is_rot, int32_t H, int a, int b, int zdrop, int8_t e)
+29 -30
View File
@@ -17,18 +17,20 @@
void __cpuidex(int cpuid[4], int func_id, int subfunc_id)
{
#if defined(__x86_64__)
asm volatile ("cpuid"
__asm__ volatile ("cpuid"
: "=a" (cpuid[0]), "=b" (cpuid[1]), "=c" (cpuid[2]), "=d" (cpuid[3])
: "0" (func_id), "2" (subfunc_id));
#else // on 32bit, ebx can NOT be used as PIC code
asm volatile ("xchgl %%ebx, %1; cpuid; xchgl %%ebx, %1"
__asm__ volatile ("xchgl %%ebx, %1; cpuid; xchgl %%ebx, %1"
: "=a" (cpuid[0]), "=r" (cpuid[1]), "=c" (cpuid[2]), "=d" (cpuid[3])
: "0" (func_id), "2" (subfunc_id));
#endif
}
#endif
int x86_simd(void)
static int ksw_simd = -1;
static int x86_simd(void)
{
int flag = 0, cpuid[4], max_id;
__cpuidex(cpuid, 0, 0);
@@ -50,48 +52,45 @@ int x86_simd(void)
return flag;
}
void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int flag, ksw_extz_t *ez)
void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez)
{
extern void ksw_extz2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int flag, ksw_extz_t *ez);
extern void ksw_extz2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int flag, ksw_extz_t *ez);
unsigned simd;
simd = x86_simd();
if (simd & SIMD_SSE4_1)
ksw_extz2_sse41(km, qlen, query, tlen, target, m, mat, q, e, w, zdrop, flag, ez);
else if (simd & SIMD_SSE2)
ksw_extz2_sse2(km, qlen, query, tlen, target, m, mat, q, e, w, zdrop, flag, ez);
extern void ksw_extz2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
extern void ksw_extz2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
if (ksw_simd < 0) ksw_simd = x86_simd();
if (ksw_simd & SIMD_SSE4_1)
ksw_extz2_sse41(km, qlen, query, tlen, target, m, mat, q, e, w, zdrop, end_bonus, flag, ez);
else if (ksw_simd & SIMD_SSE2)
ksw_extz2_sse2(km, qlen, query, tlen, target, m, mat, q, e, w, zdrop, end_bonus, flag, ez);
else abort();
}
void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int flag, ksw_extz_t *ez)
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez)
{
extern void ksw_extd2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int flag, ksw_extz_t *ez);
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
extern void ksw_extd2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int flag, ksw_extz_t *ez);
unsigned simd;
simd = x86_simd();
if (simd & SIMD_SSE4_1)
ksw_extd2_sse41(km, qlen, query, tlen, target, m, mat, q, e, q2, e2, w, zdrop, flag, ez);
else if (simd & SIMD_SSE2)
ksw_extd2_sse2(km, qlen, query, tlen, target, m, mat, q, e, q2, e2, w, zdrop, flag, ez);
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
if (ksw_simd < 0) ksw_simd = x86_simd();
if (ksw_simd & SIMD_SSE4_1)
ksw_extd2_sse41(km, qlen, query, tlen, target, m, mat, q, e, q2, e2, w, zdrop, end_bonus, flag, ez);
else if (ksw_simd & SIMD_SSE2)
ksw_extd2_sse2(km, qlen, query, tlen, target, m, mat, q, e, q2, e2, w, zdrop, end_bonus, flag, ez);
else abort();
}
void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez)
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez)
{
extern void ksw_exts2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez);
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez);
extern void ksw_exts2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez);
unsigned simd;
simd = x86_simd();
if (simd & SIMD_SSE4_1)
ksw_exts2_sse41(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, flag, ez);
else if (simd & SIMD_SSE2)
ksw_exts2_sse2(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, flag, ez);
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez);
if (ksw_simd < 0) ksw_simd = x86_simd();
if (ksw_simd & SIMD_SSE4_1)
ksw_exts2_sse41(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, junc_bonus, flag, junc, ez);
else if (ksw_simd & SIMD_SSE2)
ksw_exts2_sse2(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, junc_bonus, flag, junc, ez);
else abort();
}
#endif
+25 -11
View File
@@ -4,27 +4,35 @@
#include "ksw2.h"
#ifdef __SSE2__
#ifdef USE_SIMDE
#include <simde/x86/sse2.h>
#else
#include <emmintrin.h>
#endif
#ifdef KSW_SSE2_ONLY
#undef __SSE4_1__
#endif
#ifdef __SSE4_1__
#ifdef USE_SIMDE
#include <simde/x86/sse4.1.h>
#else
#include <smmintrin.h>
#endif
#endif
#ifdef KSW_CPU_DISPATCH
#ifdef __SSE4_1__
void ksw_extd2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int flag, ksw_extz_t *ez)
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez)
#else
void ksw_extd2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int flag, ksw_extz_t *ez)
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez)
#endif
#else
void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int flag, ksw_extz_t *ez)
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez)
#endif // ~KSW_CPU_DISPATCH
{
#define __dp_code_block1 \
@@ -61,7 +69,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
int with_cigar = !(flag&KSW_EZ_SCORE_ONLY), approx_max = !!(flag&KSW_EZ_APPROX_MAX);
int32_t *H = 0, H0 = 0, last_H0_t = 0;
uint8_t *qr, *sf, *mem, *mem2 = 0;
__m128i q_, q2_, qe_, qe2_, zero_, sc_mch_, sc_mis_, m1_;
__m128i q_, q2_, qe_, qe2_, zero_, sc_mch_, sc_mis_, m1_, sc_N_;
__m128i *u, *v, *x, *y, *x2, *y2, *s, *p = 0;
ksw_reset_extz(ez);
@@ -76,6 +84,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
qe2_ = _mm_set1_epi8(q2 + e2);
sc_mch_ = _mm_set1_epi8(mat[0]);
sc_mis_ = _mm_set1_epi8(mat[1]);
sc_N_ = mat[m*m-1] == 0? _mm_set1_epi8(-e2) : _mm_set1_epi8(mat[m*m-1]);
m1_ = _mm_set1_epi8(m - 1); // wildcard
if (w < 0) w = tlen > qlen? tlen : qlen;
@@ -110,7 +119,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
for (t = 0; t < tlen_ * 16; ++t) H[t] = KSW_NEG_INF;
}
if (with_cigar) {
mem2 = (uint8_t*)kmalloc(km, ((qlen + tlen - 1) * n_col_ + 1) * 16);
mem2 = (uint8_t*)kmalloc(km, ((size_t)(qlen + tlen - 1) * n_col_ + 1) * 16);
p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4);
off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int) * 2);
off_end = off + qlen + tlen - 1;
@@ -162,10 +171,11 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
tmp = _mm_cmpeq_epi8(sq, st);
#ifdef __SSE4_1__
tmp = _mm_blendv_epi8(sc_mis_, sc_mch_, tmp);
tmp = _mm_blendv_epi8(tmp, sc_N_, mask);
#else
tmp = _mm_or_si128(_mm_andnot_si128(tmp, sc_mis_), _mm_and_si128(tmp, sc_mch_));
tmp = _mm_or_si128(_mm_andnot_si128(tmp, sc_mis_), _mm_and_si128(tmp, sc_mch_));
tmp = _mm_or_si128(_mm_andnot_si128(mask, tmp), _mm_and_si128(mask, sc_N_));
#endif
tmp = _mm_andnot_si128(mask, tmp);
_mm_storeu_si128((__m128i*)((int8_t*)s + t), tmp);
}
} else {
@@ -216,7 +226,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
#endif
}
} else if (!(flag&KSW_EZ_RIGHT)) { // gap left-alignment
__m128i *pr = p + r * n_col_ - st_;
__m128i *pr = p + (size_t)r * n_col_ - st_;
off[r] = st, off_end[r] = en;
for (t = st_; t <= en_; ++t) {
__m128i d, z, a, b, a2, b2, xt1, x2t1, vt1, ut, tmp;
@@ -263,7 +273,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
_mm_store_si128(&pr[t], d);
}
} else { // gap right-alignment
__m128i *pr = p + r * n_col_ - st_;
__m128i *pr = p + (size_t)r * n_col_ - st_;
off[r] = st, off_end[r] = en;
for (t = st_; t <= en_; ++t) {
__m128i d, z, a, b, a2, b2, xt1, x2t1, vt1, ut, tmp;
@@ -378,10 +388,14 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
if (!approx_max) kfree(km, H);
if (with_cigar) { // backtrack
int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY))
if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY)) {
ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
else if (ez->max_t >= 0 && ez->max_q >= 0)
} else if (!ez->zdropped && (flag&KSW_EZ_EXTZ_ONLY) && ez->mqe + end_bonus > (int)ez->max) {
ez->reach_end = 1;
ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, ez->mqe_t, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
} else if (ez->max_t >= 0 && ez->max_q >= 0) {
ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
}
kfree(km, mem2); kfree(km, off);
}
}
+66 -21
View File
@@ -4,27 +4,34 @@
#include "ksw2.h"
#ifdef __SSE2__
#ifdef USE_SIMDE
#include <simde/x86/sse2.h>
#else
#include <emmintrin.h>
#endif
#ifdef KSW_SSE2_ONLY
#undef __SSE4_1__
#endif
#ifdef __SSE4_1__
#ifdef USE_SIMDE
#include <simde/x86/sse4.1.h>
#else
#include <smmintrin.h>
#endif
#endif
#ifdef KSW_CPU_DISPATCH
#ifdef __SSE4_1__
void ksw_exts2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez)
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez)
#else
void ksw_exts2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez)
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez)
#endif
#else
void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez)
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez)
#endif // ~KSW_CPU_DISPATCH
{
#define __dp_code_block1 \
@@ -59,7 +66,7 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
int with_cigar = !(flag&KSW_EZ_SCORE_ONLY), approx_max = !!(flag&KSW_EZ_APPROX_MAX);
int32_t *H = 0, H0 = 0, last_H0_t = 0;
uint8_t *qr, *sf, *mem, *mem2 = 0;
__m128i q_, q2_, qe_, zero_, sc_mch_, sc_mis_, m1_;
__m128i q_, q2_, qe_, zero_, sc_mch_, sc_mis_, sc_N_, m1_;
__m128i *u, *v, *x, *y, *x2, *s, *p = 0, *donor, *acceptor;
ksw_reset_extz(ez);
@@ -71,6 +78,7 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
qe_ = _mm_set1_epi8(q + e);
sc_mch_ = _mm_set1_epi8(mat[0]);
sc_mis_ = _mm_set1_epi8(mat[1]);
sc_N_ = mat[m*m-1] == 0? _mm_set1_epi8(-e) : _mm_set1_epi8(mat[m*m-1]);
m1_ = _mm_set1_epi8(m - 1); // wildcard
tlen_ = (tlen + 15) / 16;
@@ -99,7 +107,7 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
for (t = 0; t < tlen_ * 16; ++t) H[t] = KSW_NEG_INF;
}
if (with_cigar) {
mem2 = (uint8_t*)kmalloc(km, ((qlen + tlen - 1) * n_col_ + 1) * 16);
mem2 = (uint8_t*)kmalloc(km, ((size_t)(qlen + tlen - 1) * n_col_ + 1) * 16);
p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4);
off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int) * 2);
off_end = off + qlen + tlen - 1;
@@ -110,19 +118,55 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
// set the donor and acceptor arrays. TODO: this assumes 0/1/2/3 encoding!
if (flag & (KSW_EZ_SPLICE_FOR|KSW_EZ_SPLICE_REV)) {
int semi_cost = flag&KSW_EZ_SPLICE_FLANK? -noncan/2 : 0; // GTr or yAG is worth 0.5 bit; see PMID:18688272
memset(donor, -noncan, tlen_ * 16);
for (t = 0; t < tlen - 2; ++t) {
int is_can = 0; // is a canonical site
if ((flag & KSW_EZ_SPLICE_FOR) && target[t+1] == 2 && target[t+2] == 3) is_can = 1;
if ((flag & KSW_EZ_SPLICE_REV) && target[t+1] == 1 && target[t+2] == 3) is_can = 1;
if (is_can) ((int8_t*)donor)[t] = 0;
}
memset(acceptor, -noncan, tlen_ * 16);
for (t = 2; t < tlen; ++t) {
int is_can = 0;
if ((flag & KSW_EZ_SPLICE_FOR) && target[t-1] == 0 && target[t] == 2) is_can = 1;
if ((flag & KSW_EZ_SPLICE_REV) && target[t-1] == 0 && target[t] == 1) is_can = 1;
if (is_can) ((int8_t*)acceptor)[t] = 0;
if (!(flag & KSW_EZ_REV_CIGAR)) {
for (t = 0; t < tlen - 4; ++t) {
int can_type = 0; // type of canonical site: 0=none, 1=GT/AG only, 2=GTr/yAG
if ((flag & KSW_EZ_SPLICE_FOR) && target[t+1] == 2 && target[t+2] == 3) can_type = 1; // GTr...
if ((flag & KSW_EZ_SPLICE_REV) && target[t+1] == 1 && target[t+2] == 3) can_type = 1; // CTr...
if (can_type && (target[t+3] == 0 || target[t+3] == 2)) can_type = 2;
if (can_type) ((int8_t*)donor)[t] = can_type == 2? 0 : semi_cost;
}
if (junc)
for (t = 0; t < tlen - 1; ++t)
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t+1]&1)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t+1]&8)))
((int8_t*)donor)[t] += junc_bonus;
for (t = 2; t < tlen; ++t) {
int can_type = 0;
if ((flag & KSW_EZ_SPLICE_FOR) && target[t-1] == 0 && target[t] == 2) can_type = 1; // ...yAG
if ((flag & KSW_EZ_SPLICE_REV) && target[t-1] == 0 && target[t] == 1) can_type = 1; // ...yAC
if (can_type && (target[t-2] == 1 || target[t-2] == 3)) can_type = 2;
if (can_type) ((int8_t*)acceptor)[t] = can_type == 2? 0 : semi_cost;
}
if (junc)
for (t = 0; t < tlen; ++t)
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t]&2)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t]&4)))
((int8_t*)acceptor)[t] += junc_bonus;
} else {
for (t = 0; t < tlen - 4; ++t) {
int can_type = 0; // type of canonical site: 0=none, 1=GT/AG only, 2=GTr/yAG
if ((flag & KSW_EZ_SPLICE_FOR) && target[t+1] == 2 && target[t+2] == 0) can_type = 1; // GAy...
if ((flag & KSW_EZ_SPLICE_REV) && target[t+1] == 1 && target[t+2] == 0) can_type = 1; // CAy...
if (can_type && (target[t+3] == 1 || target[t+3] == 3)) can_type = 2;
if (can_type) ((int8_t*)donor)[t] = can_type == 2? 0 : semi_cost;
}
if (junc)
for (t = 0; t < tlen - 1; ++t)
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t+1]&2)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t+1]&4)))
((int8_t*)donor)[t] += junc_bonus;
for (t = 2; t < tlen; ++t) {
int can_type = 0;
if ((flag & KSW_EZ_SPLICE_FOR) && target[t-1] == 3 && target[t] == 2) can_type = 1; // ...rTG
if ((flag & KSW_EZ_SPLICE_REV) && target[t-1] == 3 && target[t] == 1) can_type = 1; // ...rTC
if (can_type && (target[t-2] == 0 || target[t-2] == 2)) can_type = 2;
if (can_type) ((int8_t*)acceptor)[t] = can_type == 2? 0 : semi_cost;
}
if (junc)
for (t = 0; t < tlen; ++t)
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t]&1)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t]&8)))
((int8_t*)acceptor)[t] += junc_bonus;
}
}
@@ -159,10 +203,11 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
tmp = _mm_cmpeq_epi8(sq, st);
#ifdef __SSE4_1__
tmp = _mm_blendv_epi8(sc_mis_, sc_mch_, tmp);
tmp = _mm_blendv_epi8(tmp, sc_N_, mask);
#else
tmp = _mm_or_si128(_mm_andnot_si128(tmp, sc_mis_), _mm_and_si128(tmp, sc_mch_));
tmp = _mm_or_si128(_mm_andnot_si128(tmp, sc_mis_), _mm_and_si128(tmp, sc_mch_));
tmp = _mm_or_si128(_mm_andnot_si128(mask, tmp), _mm_and_si128(mask, sc_N_));
#endif
tmp = _mm_andnot_si128(mask, tmp);
_mm_storeu_si128((__m128i*)((int8_t*)s + t), tmp);
}
} else {
@@ -362,9 +407,9 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
if (with_cigar) { // backtrack
int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY))
ksw_backtrack(km, 1, rev_cigar, 1, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
ksw_backtrack(km, 1, rev_cigar, long_thres, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
else if (ez->max_t >= 0 && ez->max_q >= 0)
ksw_backtrack(km, 1, rev_cigar, 1, (uint8_t*)p, off, off_end, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
ksw_backtrack(km, 1, rev_cigar, long_thres, (uint8_t*)p, off, off_end, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
kfree(km, mem2); kfree(km, off);
}
}
+25 -11
View File
@@ -3,24 +3,32 @@
#include "ksw2.h"
#ifdef __SSE2__
#ifdef USE_SIMDE
#include <simde/x86/sse2.h>
#else
#include <emmintrin.h>
#endif
#ifdef KSW_SSE2_ONLY
#undef __SSE4_1__
#endif
#ifdef __SSE4_1__
#ifdef USE_SIMDE
#include <simde/x86/sse4.1.h>
#else
#include <smmintrin.h>
#endif
#endif
#ifdef KSW_CPU_DISPATCH
#ifdef __SSE4_1__
void ksw_extz2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int flag, ksw_extz_t *ez)
void ksw_extz2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez)
#else
void ksw_extz2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int flag, ksw_extz_t *ez)
void ksw_extz2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez)
#endif
#else
void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int flag, ksw_extz_t *ez)
void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez)
#endif // ~KSW_CPU_DISPATCH
{
#define __dp_code_block1 \
@@ -50,7 +58,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
int with_cigar = !(flag&KSW_EZ_SCORE_ONLY), approx_max = !!(flag&KSW_EZ_APPROX_MAX);
int32_t *H = 0, H0 = 0, last_H0_t = 0;
uint8_t *qr, *sf, *mem, *mem2 = 0;
__m128i q_, qe2_, zero_, flag1_, flag2_, flag8_, flag16_, sc_mch_, sc_mis_, m1_, max_sc_;
__m128i q_, qe2_, zero_, flag1_, flag2_, flag8_, flag16_, sc_mch_, sc_mis_, sc_N_, m1_, max_sc_;
__m128i *u, *v, *x, *y, *s, *p = 0;
ksw_reset_extz(ez);
@@ -65,6 +73,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
flag16_ = _mm_set1_epi8(0x10);
sc_mch_ = _mm_set1_epi8(mat[0]);
sc_mis_ = _mm_set1_epi8(mat[1]);
sc_N_ = mat[m*m-1] == 0? _mm_set1_epi8(-e) : _mm_set1_epi8(mat[m*m-1]);
m1_ = _mm_set1_epi8(m - 1); // wildcard
max_sc_ = _mm_set1_epi8(mat[0] + (q + e) * 2);
@@ -88,7 +97,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
for (t = 0; t < tlen_ * 16; ++t) H[t] = KSW_NEG_INF;
}
if (with_cigar) {
mem2 = (uint8_t*)kmalloc(km, ((qlen + tlen - 1) * n_col_ + 1) * 16);
mem2 = (uint8_t*)kmalloc(km, ((size_t)(qlen + tlen - 1) * n_col_ + 1) * 16);
p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4);
off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int) * 2);
off_end = off + qlen + tlen - 1;
@@ -130,10 +139,11 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
tmp = _mm_cmpeq_epi8(sq, st);
#ifdef __SSE4_1__
tmp = _mm_blendv_epi8(sc_mis_, sc_mch_, tmp);
tmp = _mm_blendv_epi8(tmp, sc_N_, mask);
#else
tmp = _mm_or_si128(_mm_andnot_si128(tmp, sc_mis_), _mm_and_si128(tmp, sc_mch_));
tmp = _mm_or_si128(_mm_andnot_si128(tmp, sc_mis_), _mm_and_si128(tmp, sc_mch_));
tmp = _mm_or_si128(_mm_andnot_si128(mask, tmp), _mm_and_si128(mask, sc_N_));
#endif
tmp = _mm_andnot_si128(mask, tmp);
_mm_storeu_si128((__m128i*)((uint8_t*)s + t), tmp);
}
} else {
@@ -167,7 +177,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
#endif
}
} else if (!(flag&KSW_EZ_RIGHT)) { // gap left-alignment
__m128i *pr = p + r * n_col_ - st_;
__m128i *pr = p + (size_t)r * n_col_ - st_;
off[r] = st, off_end[r] = en;
for (t = st_; t <= en_; ++t) {
__m128i d, z, a, b, xt1, vt1, ut, tmp;
@@ -193,7 +203,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
_mm_store_si128(&pr[t], d);
}
} else { // gap right-alignment
__m128i *pr = p + r * n_col_ - st_;
__m128i *pr = p + (size_t)r * n_col_ - st_;
off[r] = st, off_end[r] = en;
for (t = st_; t <= en_; ++t) {
__m128i d, z, a, b, xt1, vt1, ut, tmp;
@@ -289,10 +299,14 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
if (!approx_max) kfree(km, H);
if (with_cigar) { // backtrack
int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY))
if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY)) {
ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
else if (ez->max_t >= 0 && ez->max_q >= 0)
} else if (!ez->zdropped && (flag&KSW_EZ_EXTZ_ONLY) && ez->mqe + end_bonus > (int)ez->max) {
ez->reach_end = 1;
ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, ez->mqe_t, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
} else if (ez->max_t >= 0 && ez->max_q >= 0) {
ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
}
kfree(km, mem2); kfree(km, off);
}
}
+7 -2
View File
@@ -1,9 +1,14 @@
#include <stdlib.h>
#include <stdint.h>
#include <string.h>
#include <emmintrin.h>
#include "ksw2.h"
#ifdef USE_SIMDE
#include <simde/x86/sse2.h>
#else
#include <emmintrin.h>
#endif
#ifdef __GNUC__
#define LIKELY(x) __builtin_expect((x),1)
#define UNLIKELY(x) __builtin_expect((x),0)
@@ -122,7 +127,7 @@ int ksw_ll_i16(void *q_, int tlen, const uint8_t *target, int _gapo, int _gape,
f = _mm_max_epi16(f, h);
h = _mm_load_si128(H0 + j);
}
for (k = 0; LIKELY(k < 16); ++k) {
for (k = 0; LIKELY(k < 8); ++k) {
f = _mm_slli_si128(f, 2);
for (j = 0; LIKELY(j < slen); ++j) {
h = _mm_load_si128(H1 + j);
+1
View File
@@ -2,6 +2,7 @@
#include <stdlib.h>
#include <limits.h>
#include <stdint.h>
#include "kthread.h"
#if (defined(WIN32) || defined(_WIN32)) && defined(_MSC_VER)
#define __sync_fetch_and_add(ptr, addend) _InterlockedExchangeAdd((void*)ptr, addend)
+369
View File
@@ -0,0 +1,369 @@
#include <stdint.h>
#include <string.h>
#include <stdio.h>
#include <assert.h>
#include "mmpriv.h"
#include "kalloc.h"
#include "krmq.h"
static int64_t mg_chain_bk_end(int32_t max_drop, const mm128_t *z, const int32_t *f, const int64_t *p, int32_t *t, int64_t k)
{
int64_t i = z[k].y, end_i = -1, max_i = i;
int32_t max_s = 0;
if (i < 0 || t[i] != 0) return i;
do {
int32_t s;
t[i] = 2;
end_i = i = p[i];
s = i < 0? z[k].x : (int32_t)z[k].x - f[i];
if (s > max_s) max_s = s, max_i = i;
else if (max_s - s > max_drop) break;
} while (i >= 0 && t[i] == 0);
for (i = z[k].y; i >= 0 && i != end_i; i = p[i]) // reset modified t[]
t[i] = 0;
return max_i;
}
uint64_t *mg_chain_backtrack(void *km, int64_t n, const int32_t *f, const int64_t *p, int32_t *v, int32_t *t, int32_t min_cnt, int32_t min_sc, int32_t max_drop, int32_t *n_u_, int32_t *n_v_)
{
mm128_t *z;
uint64_t *u;
int64_t i, k, n_z, n_v;
int32_t n_u;
*n_u_ = *n_v_ = 0;
for (i = 0, n_z = 0; i < n; ++i) // precompute n_z
if (f[i] >= min_sc) ++n_z;
if (n_z == 0) return 0;
KMALLOC(km, z, n_z);
for (i = 0, k = 0; i < n; ++i) // populate z[]
if (f[i] >= min_sc) z[k].x = f[i], z[k++].y = i;
radix_sort_128x(z, z + n_z);
memset(t, 0, n * 4);
for (k = n_z - 1, n_v = n_u = 0; k >= 0; --k) { // precompute n_u
if (t[z[k].y] == 0) {
int64_t n_v0 = n_v, end_i;
int32_t sc;
end_i = mg_chain_bk_end(max_drop, z, f, p, t, k);
for (i = z[k].y; i != end_i; i = p[i])
++n_v, t[i] = 1;
sc = i < 0? z[k].x : (int32_t)z[k].x - f[i];
if (sc >= min_sc && n_v > n_v0 && n_v - n_v0 >= min_cnt)
++n_u;
else n_v = n_v0;
}
}
KMALLOC(km, u, n_u);
memset(t, 0, n * 4);
for (k = n_z - 1, n_v = n_u = 0; k >= 0; --k) { // populate u[]
if (t[z[k].y] == 0) {
int64_t n_v0 = n_v, end_i;
int32_t sc;
end_i = mg_chain_bk_end(max_drop, z, f, p, t, k);
for (i = z[k].y; i != end_i; i = p[i])
v[n_v++] = i, t[i] = 1;
sc = i < 0? z[k].x : (int32_t)z[k].x - f[i];
if (sc >= min_sc && n_v > n_v0 && n_v - n_v0 >= min_cnt)
u[n_u++] = (uint64_t)sc << 32 | (n_v - n_v0);
else n_v = n_v0;
}
}
kfree(km, z);
assert(n_v < INT32_MAX);
*n_u_ = n_u, *n_v_ = n_v;
return u;
}
static mm128_t *compact_a(void *km, int32_t n_u, uint64_t *u, int32_t n_v, int32_t *v, mm128_t *a)
{
mm128_t *b, *w;
uint64_t *u2;
int64_t i, j, k;
// write the result to b[]
KMALLOC(km, b, n_v);
for (i = 0, k = 0; i < n_u; ++i) {
int32_t k0 = k, ni = (int32_t)u[i];
for (j = 0; j < ni; ++j)
b[k++] = a[v[k0 + (ni - j - 1)]];
}
kfree(km, v);
// sort u[] and a[] by the target position, such that adjacent chains may be joined
KMALLOC(km, w, n_u);
for (i = k = 0; i < n_u; ++i) {
w[i].x = b[k].x, w[i].y = (uint64_t)k<<32|i;
k += (int32_t)u[i];
}
radix_sort_128x(w, w + n_u);
KMALLOC(km, u2, n_u);
for (i = k = 0; i < n_u; ++i) {
int32_t j = (int32_t)w[i].y, n = (int32_t)u[j];
u2[i] = u[j];
memcpy(&a[k], &b[w[i].y>>32], n * sizeof(mm128_t));
k += n;
}
memcpy(u, u2, n_u * 8);
memcpy(b, a, k * sizeof(mm128_t)); // write _a_ to _b_ and deallocate _a_ because _a_ is oversized, sometimes a lot
kfree(km, a); kfree(km, w); kfree(km, u2);
return b;
}
static inline int32_t comput_sc(const mm128_t *ai, const mm128_t *aj, int32_t max_dist_x, int32_t max_dist_y, int32_t bw, float chn_pen_gap, float chn_pen_skip, int is_cdna, int n_seg)
{
int32_t dq = (int32_t)ai->y - (int32_t)aj->y, dr, dd, dg, q_span, sc;
int32_t sidi = (ai->y & MM_SEED_SEG_MASK) >> MM_SEED_SEG_SHIFT;
int32_t sidj = (aj->y & MM_SEED_SEG_MASK) >> MM_SEED_SEG_SHIFT;
if (dq <= 0 || dq > max_dist_x) return INT32_MIN;
dr = (int32_t)(ai->x - aj->x);
if (sidi == sidj && (dr == 0 || dq > max_dist_y)) return INT32_MIN;
dd = dr > dq? dr - dq : dq - dr;
if (sidi == sidj && dd > bw) return INT32_MIN;
if (n_seg > 1 && !is_cdna && sidi == sidj && dr > max_dist_y) return INT32_MIN;
dg = dr < dq? dr : dq;
q_span = aj->y>>32&0xff;
sc = q_span < dg? q_span : dg;
if (dd || dg > q_span) {
float lin_pen, log_pen;
lin_pen = chn_pen_gap * (float)dd + chn_pen_skip * (float)dg;
log_pen = dd >= 1? mg_log2(dd + 1) : 0.0f; // mg_log2() only works for dd>=2
if (is_cdna || sidi != sidj) {
if (sidi != sidj && dr == 0) ++sc; // possibly due to overlapping paired ends; give a minor bonus
else if (dr > dq || sidi != sidj) sc -= (int)(lin_pen < log_pen? lin_pen : log_pen); // deletion or jump between paired ends
else sc -= (int)(lin_pen + .5f * log_pen);
} else sc -= (int)(lin_pen + .5f * log_pen);
}
return sc;
}
/* Input:
* a[].x: tid<<33 | rev<<32 | tpos
* a[].y: flags<<40 | q_span<<32 | q_pos
* Output:
* n_u: #chains
* u[]: score<<32 | #anchors (sum of lower 32 bits of u[] is the returned length of a[])
* input a[] is deallocated on return
*/
mm128_t *mg_lchain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int max_iter, int min_cnt, int min_sc, float chn_pen_gap, float chn_pen_skip,
int is_cdna, int n_seg, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km)
{ // TODO: make sure this works when n has more than 32 bits
int32_t *f, *t, *v, n_u, n_v, mmax_f = 0, max_drop = bw;
int64_t *p, i, j, max_ii, st = 0, n_iter = 0;
uint64_t *u;
if (_u) *_u = 0, *n_u_ = 0;
if (n == 0 || a == 0) {
kfree(km, a);
return 0;
}
if (max_dist_x < bw) max_dist_x = bw;
if (max_dist_y < bw && !is_cdna) max_dist_y = bw;
if (is_cdna) max_drop = INT32_MAX;
KMALLOC(km, p, n);
KMALLOC(km, f, n);
KMALLOC(km, v, n);
KCALLOC(km, t, n);
// fill the score and backtrack arrays
for (i = 0, max_ii = -1; i < n; ++i) {
int64_t max_j = -1, end_j;
int32_t max_f = a[i].y>>32&0xff, n_skip = 0;
while (st < i && (a[i].x>>32 != a[st].x>>32 || a[i].x > a[st].x + max_dist_x)) ++st;
if (i - st > max_iter) st = i - max_iter;
for (j = i - 1; j >= st; --j) {
int32_t sc;
sc = comput_sc(&a[i], &a[j], max_dist_x, max_dist_y, bw, chn_pen_gap, chn_pen_skip, is_cdna, n_seg);
++n_iter;
if (sc == INT32_MIN) continue;
sc += f[j];
if (sc > max_f) {
max_f = sc, max_j = j;
if (n_skip > 0) --n_skip;
} else if (t[j] == (int32_t)i) {
if (++n_skip > max_skip)
break;
}
if (p[j] >= 0) t[p[j]] = i;
}
end_j = j;
if (max_ii < 0 || a[i].x - a[max_ii].x > (int64_t)max_dist_x) {
int32_t max = INT32_MIN;
max_ii = -1;
for (j = i - 1; j >= st; --j)
if (max < f[j]) max = f[j], max_ii = j;
}
if (max_ii >= 0 && max_ii < end_j) {
int32_t tmp;
tmp = comput_sc(&a[i], &a[max_ii], max_dist_x, max_dist_y, bw, chn_pen_gap, chn_pen_skip, is_cdna, n_seg);
if (tmp != INT32_MIN && max_f < tmp + f[max_ii])
max_f = tmp + f[max_ii], max_j = max_ii;
}
f[i] = max_f, p[i] = max_j;
v[i] = max_j >= 0 && v[max_j] > max_f? v[max_j] : max_f; // v[] keeps the peak score up to i; f[] is the score ending at i, not always the peak
if (max_ii < 0 || (a[i].x - a[max_ii].x <= (int64_t)max_dist_x && f[max_ii] < f[i]))
max_ii = i;
if (mmax_f < max_f) mmax_f = max_f;
}
u = mg_chain_backtrack(km, n, f, p, v, t, min_cnt, min_sc, max_drop, &n_u, &n_v);
*n_u_ = n_u, *_u = u; // NB: note that u[] may not be sorted by score here
kfree(km, p); kfree(km, f); kfree(km, t);
if (n_u == 0) {
kfree(km, a); kfree(km, v);
return 0;
}
return compact_a(km, n_u, u, n_v, v, a);
}
typedef struct lc_elem_s {
int32_t y;
int64_t i;
double pri;
KRMQ_HEAD(struct lc_elem_s) head;
} lc_elem_t;
#define lc_elem_cmp(a, b) ((a)->y < (b)->y? -1 : (a)->y > (b)->y? 1 : ((a)->i > (b)->i) - ((a)->i < (b)->i))
#define lc_elem_lt2(a, b) ((a)->pri < (b)->pri)
KRMQ_INIT(lc_elem, lc_elem_t, head, lc_elem_cmp, lc_elem_lt2)
KALLOC_POOL_INIT(rmq, lc_elem_t)
static inline int32_t comput_sc_simple(const mm128_t *ai, const mm128_t *aj, float chn_pen_gap, float chn_pen_skip, int32_t *exact, int32_t *width)
{
int32_t dq = (int32_t)ai->y - (int32_t)aj->y, dr, dd, dg, q_span, sc;
dr = (int32_t)(ai->x - aj->x);
*width = dd = dr > dq? dr - dq : dq - dr;
dg = dr < dq? dr : dq;
q_span = aj->y>>32&0xff;
sc = q_span < dg? q_span : dg;
if (exact) *exact = (dd == 0 && dg <= q_span);
if (dd || dq > q_span) {
float lin_pen, log_pen;
lin_pen = chn_pen_gap * (float)dd + chn_pen_skip * (float)dg;
log_pen = dd >= 1? mg_log2(dd + 1) : 0.0f; // mg_log2() only works for dd>=2
sc -= (int)(lin_pen + .5f * log_pen);
}
return sc;
}
mm128_t *mg_lchain_rmq(int max_dist, int max_dist_inner, int bw, int max_chn_skip, int cap_rmq_size, int min_cnt, int min_sc, float chn_pen_gap, float chn_pen_skip,
int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km)
{
int32_t *f,*t, *v, n_u, n_v, mmax_f = 0, max_rmq_size = 0, max_drop = bw;
int64_t *p, i, i0, st = 0, st_inner = 0, n_iter = 0;
uint64_t *u;
lc_elem_t *root = 0, *root_inner = 0;
void *mem_mp = 0;
kmp_rmq_t *mp;
if (_u) *_u = 0, *n_u_ = 0;
if (n == 0 || a == 0) {
kfree(km, a);
return 0;
}
if (max_dist < bw) max_dist = bw;
if (max_dist_inner <= 0 || max_dist_inner >= max_dist) max_dist_inner = 0;
KMALLOC(km, p, n);
KMALLOC(km, f, n);
KCALLOC(km, t, n);
KMALLOC(km, v, n);
mem_mp = km_init2(km, 0x10000);
mp = kmp_init_rmq(mem_mp);
// fill the score and backtrack arrays
for (i = i0 = 0; i < n; ++i) {
int64_t max_j = -1;
int32_t q_span = a[i].y>>32&0xff, max_f = q_span;
lc_elem_t s, *q, *r, lo, hi;
// add in-range anchors
if (i0 < i && a[i0].x != a[i].x) {
int64_t j;
for (j = i0; j < i; ++j) {
q = kmp_alloc_rmq(mp);
q->y = (int32_t)a[j].y, q->i = j, q->pri = -(f[j] + 0.5 * chn_pen_gap * ((int32_t)a[j].x + (int32_t)a[j].y));
krmq_insert(lc_elem, &root, q, 0);
if (max_dist_inner > 0) {
r = kmp_alloc_rmq(mp);
*r = *q;
krmq_insert(lc_elem, &root_inner, r, 0);
}
}
i0 = i;
}
// get rid of active chains out of range
while (st < i && (a[i].x>>32 != a[st].x>>32 || a[i].x > a[st].x + max_dist || krmq_size(head, root) > cap_rmq_size)) {
s.y = (int32_t)a[st].y, s.i = st;
if ((q = krmq_find(lc_elem, root, &s, 0)) != 0) {
q = krmq_erase(lc_elem, &root, q, 0);
kmp_free_rmq(mp, q);
}
++st;
}
if (max_dist_inner > 0) { // similar to the block above, but applied to the inner tree
while (st_inner < i && (a[i].x>>32 != a[st_inner].x>>32 || a[i].x > a[st_inner].x + max_dist_inner || krmq_size(head, root_inner) > cap_rmq_size)) {
s.y = (int32_t)a[st_inner].y, s.i = st_inner;
if ((q = krmq_find(lc_elem, root_inner, &s, 0)) != 0) {
q = krmq_erase(lc_elem, &root_inner, q, 0);
kmp_free_rmq(mp, q);
}
++st_inner;
}
}
// RMQ
lo.i = INT32_MAX, lo.y = (int32_t)a[i].y - max_dist;
hi.i = 0, hi.y = (int32_t)a[i].y;
if ((q = krmq_rmq(lc_elem, root, &lo, &hi)) != 0) {
int32_t sc, exact, width, n_skip = 0;
int64_t j = q->i;
assert(q->y >= lo.y && q->y <= hi.y);
sc = f[j] + comput_sc_simple(&a[i], &a[j], chn_pen_gap, chn_pen_skip, &exact, &width);
if (width <= bw && sc > max_f) max_f = sc, max_j = j;
if (!exact && root_inner && (int32_t)a[i].y > 0) {
lc_elem_t *lo, *hi;
s.y = (int32_t)a[i].y - 1, s.i = n;
krmq_interval(lc_elem, root_inner, &s, &lo, &hi);
if (lo) {
const lc_elem_t *q;
int32_t width, n_rmq_iter = 0;
krmq_itr_t(lc_elem) itr;
krmq_itr_find(lc_elem, root_inner, lo, &itr);
while ((q = krmq_at(&itr)) != 0) {
if (q->y < (int32_t)a[i].y - max_dist_inner) break;
++n_rmq_iter;
j = q->i;
sc = f[j] + comput_sc_simple(&a[i], &a[j], chn_pen_gap, chn_pen_skip, 0, &width);
if (width <= bw) {
if (sc > max_f) {
max_f = sc, max_j = j;
if (n_skip > 0) --n_skip;
} else if (t[j] == (int32_t)i) {
if (++n_skip > max_chn_skip)
break;
}
if (p[j] >= 0) t[p[j]] = i;
}
if (!krmq_itr_prev(lc_elem, &itr)) break;
}
n_iter += n_rmq_iter;
}
}
}
// set max
assert(max_j < 0 || (a[max_j].x < a[i].x && (int32_t)a[max_j].y < (int32_t)a[i].y));
f[i] = max_f, p[i] = max_j;
v[i] = max_j >= 0 && v[max_j] > max_f? v[max_j] : max_f; // v[] keeps the peak score up to i; f[] is the score ending at i, not always the peak
if (mmax_f < max_f) mmax_f = max_f;
if (max_rmq_size < krmq_size(head, root)) max_rmq_size = krmq_size(head, root);
}
km_destroy(mem_mp);
u = mg_chain_backtrack(km, n, f, p, v, t, min_cnt, min_sc, max_drop, &n_u, &n_v);
*n_u_ = n_u, *_u = u; // NB: note that u[] may not be sorted by score here
kfree(km, p); kfree(km, f); kfree(km, t);
if (n_u == 0) {
kfree(km, a); kfree(km, v);
return 0;
}
return compact_a(km, n_u, u, n_v, v, a);
}
Submodule
+1
Submodule lib/simde added at b30129b3b4
+372 -192
View File
@@ -1,12 +1,13 @@
#include <stdlib.h>
#include <stdio.h>
#include <string.h>
#include <errno.h>
#include "bseq.h"
#include "minimap.h"
#include "mmpriv.h"
#include "getopt.h"
#include "ketopt.h"
#define MM_VERSION "2.1.1-r341"
#define MM_VERSION "2.24-r1122"
#ifdef __linux__
#include <sys/resource.h>
@@ -22,258 +23,437 @@ void liftrlimit()
void liftrlimit() {}
#endif
static struct option long_options[] = {
{ "bucket-bits", required_argument, 0, 0 },
{ "mb-size", required_argument, 0, 'K' },
{ "int-rname", no_argument, 0, 0 },
{ "no-kalloc", no_argument, 0, 0 },
{ "print-qname", no_argument, 0, 0 },
{ "no-self", no_argument, 0, 0 },
{ "print-seed", no_argument, 0, 0 },
{ "max-chain-skip", required_argument, 0, 0 },
{ "min-dp-len", required_argument, 0, 0 },
{ "print-aln-seq", no_argument, 0, 0 },
{ "splice", no_argument, 0, 0 },
{ "cost-non-gt-ag", required_argument, 0, 0 },
{ "no-sam-sq", no_argument, 0, 0 },
{ "help", no_argument, 0, 'h' },
{ "max-intron-len", required_argument, 0, 'G' },
{ "version", no_argument, 0, 'V' },
{ "min-count", required_argument, 0, 'n' },
{ "min-chain-score",required_argument, 0, 'm' },
{ "mask-level", required_argument, 0, 'M' },
{ "min-dp-score", required_argument, 0, 's' },
{ "sam", no_argument, 0, 'a' },
{ 0, 0, 0, 0}
static ko_longopt_t long_options[] = {
{ "bucket-bits", ko_required_argument, 300 },
{ "mb-size", ko_required_argument, 'K' },
{ "seed", ko_required_argument, 302 },
{ "no-kalloc", ko_no_argument, 303 },
{ "print-qname", ko_no_argument, 304 },
{ "no-self", ko_no_argument, 'D' },
{ "print-seeds", ko_no_argument, 306 },
{ "max-chain-skip", ko_required_argument, 307 },
{ "min-dp-len", ko_required_argument, 308 },
{ "print-aln-seq", ko_no_argument, 309 },
{ "splice", ko_no_argument, 310 },
{ "cost-non-gt-ag", ko_required_argument, 'C' },
{ "no-long-join", ko_no_argument, 312 },
{ "sr", ko_no_argument, 313 },
{ "frag", ko_required_argument, 314 },
{ "secondary", ko_required_argument, 315 },
{ "cs", ko_optional_argument, 316 },
{ "end-bonus", ko_required_argument, 317 },
{ "no-pairing", ko_no_argument, 318 },
{ "splice-flank", ko_required_argument, 319 },
{ "idx-no-seq", ko_no_argument, 320 },
{ "end-seed-pen", ko_required_argument, 321 },
{ "for-only", ko_no_argument, 322 },
{ "rev-only", ko_no_argument, 323 },
{ "heap-sort", ko_required_argument, 324 },
{ "all-chain", ko_no_argument, 'P' },
{ "dual", ko_required_argument, 326 },
{ "max-clip-ratio", ko_required_argument, 327 },
{ "min-occ-floor", ko_required_argument, 328 },
{ "MD", ko_no_argument, 329 },
{ "lj-min-ratio", ko_required_argument, 330 },
{ "score-N", ko_required_argument, 331 },
{ "eqx", ko_no_argument, 332 },
{ "paf-no-hit", ko_no_argument, 333 },
{ "split-prefix", ko_required_argument, 334 },
{ "no-end-flt", ko_no_argument, 335 },
{ "hard-mask-level",ko_no_argument, 336 },
{ "cap-sw-mem", ko_required_argument, 337 },
{ "max-qlen", ko_required_argument, 338 },
{ "max-chain-iter", ko_required_argument, 339 },
{ "junc-bed", ko_required_argument, 340 },
{ "junc-bonus", ko_required_argument, 341 },
{ "sam-hit-only", ko_no_argument, 342 },
{ "chain-gap-scale",ko_required_argument, 343 },
{ "alt", ko_required_argument, 344 },
{ "alt-drop", ko_required_argument, 345 },
{ "mask-len", ko_required_argument, 346 },
{ "rmq", ko_optional_argument, 347 },
{ "qstrand", ko_no_argument, 348 },
{ "cap-kalloc", ko_required_argument, 349 },
{ "q-occ-frac", ko_required_argument, 350 },
{ "chain-skip-scale",ko_required_argument,351 },
{ "print-chains", ko_no_argument, 352 },
{ "no-hash-name", ko_no_argument, 353 },
{ "help", ko_no_argument, 'h' },
{ "max-intron-len", ko_required_argument, 'G' },
{ "version", ko_no_argument, 'V' },
{ "min-count", ko_required_argument, 'n' },
{ "min-chain-score",ko_required_argument, 'm' },
{ "mask-level", ko_required_argument, 'M' },
{ "min-dp-score", ko_required_argument, 's' },
{ "sam", ko_no_argument, 'a' },
{ 0, 0, 0 }
};
static inline int64_t mm_parse_num(const char *str)
static inline int64_t mm_parse_num2(const char *str, char **q)
{
double x;
char *p;
x = strtod(optarg, &p);
if (*p == 'G' || *p == 'g') x *= 1e9;
else if (*p == 'M' || *p == 'm') x *= 1e6;
else if (*p == 'K' || *p == 'k') x *= 1e3;
x = strtod(str, &p);
if (*p == 'G' || *p == 'g') x *= 1e9, ++p;
else if (*p == 'M' || *p == 'm') x *= 1e6, ++p;
else if (*p == 'K' || *p == 'k') x *= 1e3, ++p;
if (q) *q = p;
return (int64_t)(x + .499);
}
static inline int64_t mm_parse_num(const char *str)
{
return mm_parse_num2(str, 0);
}
static inline void yes_or_no(mm_mapopt_t *opt, int64_t flag, int long_idx, const char *arg, int yes_to_set)
{
if (yes_to_set) {
if (strcmp(arg, "yes") == 0 || strcmp(arg, "y") == 0) opt->flag |= flag;
else if (strcmp(arg, "no") == 0 || strcmp(arg, "n") == 0) opt->flag &= ~flag;
else fprintf(stderr, "[WARNING]\033[1;31m option '--%s' only accepts 'yes' or 'no'.\033[0m\n", long_options[long_idx].name);
} else {
if (strcmp(arg, "yes") == 0 || strcmp(arg, "y") == 0) opt->flag &= ~flag;
else if (strcmp(arg, "no") == 0 || strcmp(arg, "n") == 0) opt->flag |= flag;
else fprintf(stderr, "[WARNING]\033[1;31m option '--%s' only accepts 'yes' or 'no'.\033[0m\n", long_options[long_idx].name);
}
}
int main(int argc, char *argv[])
{
const char *opt_str = "2aSDw:k:K:t:r:f:Vv:g:G:I:d:XT:s:x:Hcp:M:n:z:A:B:O:E:m:N:Qu:R:hF:LC:yYPo:e:U:";
ketopt_t o = KETOPT_INIT;
mm_mapopt_t opt;
int i, c, k = 15, w = -1, bucket_bits = MM_IDX_DEF_B, n_threads = 3, keep_name = 1, is_idx, is_hpc = 0, long_idx, idx_par_set = 0, max_intron_len = 0, n_idx_part = 0;
int minibatch_size = 200000000;
uint64_t batch_size = 4000000000ULL;
mm_bseq_file_t *fp = 0;
char *fnw = 0, *rg = 0, *s;
FILE *fpr = 0, *fpw = 0, *fp_help = stderr;
mm_idxopt_t ipt;
int i, c, n_threads = 3, n_parts, old_best_n = -1;
char *fnw = 0, *rg = 0, *junc_bed = 0, *s, *alt_list = 0;
FILE *fp_help = stderr;
mm_idx_reader_t *idx_rdr;
mm_idx_t *mi;
mm_verbose = 3;
liftrlimit();
mm_realtime0 = realtime();
mm_mapopt_init(&opt);
mm_set_opt(0, &ipt, &opt);
while ((c = getopt_long(argc, argv, "aSw:k:K:t:r:f:Vv:g:G:I:d:XT:s:x:Hcp:M:n:z:A:B:O:E:m:N:Qu:R:h", long_options, &long_idx)) >= 0) {
if (c == 'w') w = atoi(optarg), idx_par_set = 1;
else if (c == 'k') k = atoi(optarg), idx_par_set = 1;
else if (c == 'H') is_hpc = 1, idx_par_set = 1;
else if (c == 'd') fnw = optarg; // the above are indexing related options, except -I
else if (c == 'r') opt.bw = (int)mm_parse_num(optarg);
else if (c == 'f') opt.mid_occ_frac = atof(optarg);
else if (c == 't') n_threads = atoi(optarg);
else if (c == 'v') mm_verbose = atoi(optarg);
else if (c == 'g') opt.max_gap = (int)mm_parse_num(optarg);
else if (c == 'G') max_intron_len = (int)mm_parse_num(optarg);
else if (c == 'N') opt.best_n = atoi(optarg);
else if (c == 'p') opt.pri_ratio = atof(optarg);
else if (c == 'M') opt.mask_level = atof(optarg);
else if (c == 'c') opt.flag |= MM_F_OUT_CG | MM_F_CIGAR;
else if (c == 'S') opt.flag |= MM_F_OUT_CS | MM_F_CIGAR;
else if (c == 'X') opt.flag |= MM_F_AVA | MM_F_NO_SELF;
else if (c == 'a') opt.flag |= MM_F_OUT_SAM | MM_F_CIGAR;
else if (c == 'Q') opt.flag |= MM_F_NO_QUAL;
else if (c == 'T') opt.sdust_thres = atoi(optarg);
else if (c == 'n') opt.min_cnt = atoi(optarg);
else if (c == 'm') opt.min_chain_score = atoi(optarg);
else if (c == 'A') opt.a = atoi(optarg);
else if (c == 'B') opt.b = atoi(optarg);
else if (c == 'z') opt.zdrop = atoi(optarg);
else if (c == 's') opt.min_dp_max = atoi(optarg);
else if (c == 'I') batch_size = mm_parse_num(optarg);
else if (c == 'K') minibatch_size = (int)mm_parse_num(optarg);
else if (c == 'R') rg = optarg;
else if (c == 'h') fp_help = stdout;
else if (c == 0 && long_idx == 0) bucket_bits = atoi(optarg); // --bucket-bits
else if (c == 0 && long_idx == 2) keep_name = 0; // --int-rname
else if (c == 0 && long_idx == 3) mm_dbg_flag |= MM_DBG_NO_KALLOC; // --no-kalloc
else if (c == 0 && long_idx == 4) mm_dbg_flag |= MM_DBG_PRINT_QNAME; // --print-qname
else if (c == 0 && long_idx == 5) opt.flag |= MM_F_NO_SELF; // --no-self
else if (c == 0 && long_idx == 6) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_SEED; // --print-seed
else if (c == 0 && long_idx == 7) opt.max_chain_skip = atoi(optarg); // --max-chain-skip
else if (c == 0 && long_idx == 8) opt.min_ksw_len = atoi(optarg); // --min-dp-len
else if (c == 0 && long_idx == 9) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_ALN_SEQ; // --print-aln-seq
else if (c == 0 && long_idx ==10) opt.flag |= MM_F_SPLICE; // --splice
else if (c == 0 && long_idx ==11) opt.noncan = atoi(optarg); // --cost-non-gt-ag
else if (c == 0 && long_idx ==12) opt.flag |= MM_F_NO_SAM_SQ; // --no-sam-sq
else if (c == 'V') {
puts(MM_VERSION);
return 0;
} else if (c == 'u') {
if (*optarg == 'b') opt.flag |= MM_F_SPLICE_FOR|MM_F_SPLICE_REV;
else if (*optarg == 'B') opt.flag |= MM_F_SPLICE_BOTH;
else if (*optarg == 'f') opt.flag |= MM_F_SPLICE_FOR, opt.flag &= ~MM_F_SPLICE_REV;
else if (*optarg == 'r') opt.flag |= MM_F_SPLICE_REV, opt.flag &= ~MM_F_SPLICE_FOR;
else if (*optarg == 'n') opt.flag &= ~(MM_F_SPLICE_FOR|MM_F_SPLICE_REV);
else {
fprintf(stderr, "[E::%s] unrecognized cDNA direction\n", __func__);
return 1;
}
} else if (c == 'O') {
opt.q = opt.q2 = strtol(optarg, &s, 10);
if (*s == ',') opt.q2 = strtol(s + 1, &s, 10);
} else if (c == 'E') {
opt.e = opt.e2 = strtol(optarg, &s, 10);
if (*s == ',') opt.e2 = strtol(s + 1, &s, 10);
} else if (c == 'x') {
if (strcmp(optarg, "ava-ont") == 0) {
opt.flag |= MM_F_AVA | MM_F_NO_SELF;
opt.min_chain_score = 100, opt.pri_ratio = 0.0f, opt.max_gap = 10000, opt.max_chain_skip = 25;
minibatch_size = 500000000;
k = 15, w = 5;
} else if (strcmp(optarg, "ava-pb") == 0) {
opt.flag |= MM_F_AVA | MM_F_NO_SELF;
opt.min_chain_score = 100, opt.pri_ratio = 0.0f, opt.max_gap = 10000, opt.max_chain_skip = 25;
minibatch_size = 500000000;
is_hpc = 1, k = 19, w = 5;
} else if (strcmp(optarg, "map10k") == 0 || strcmp(optarg, "map-pb") == 0) {
is_hpc = 1, k = 19;
} else if (strcmp(optarg, "map-ont") == 0) {
is_hpc = 0, k = 15;
} else if (strcmp(optarg, "asm5") == 0) {
k = 19, w = 19;
opt.a = 1, opt.b = 19, opt.q = 39, opt.q2 = 81, opt.e = 3, opt.e2 = 1, opt.zdrop = 200;
opt.min_dp_max = 200;
} else if (strcmp(optarg, "asm10") == 0) {
k = 19, w = 19;
opt.a = 1, opt.b = 9, opt.q = 16, opt.q2 = 41, opt.e = 2, opt.e2 = 1, opt.zdrop = 200;
opt.min_dp_max = 200;
} else if (strcmp(optarg, "splice") == 0 || strcmp(optarg, "cdna") == 0) {
k = 15, w = 5;
opt.flag |= MM_F_SPLICE | MM_F_SPLICE_FOR | MM_F_SPLICE_REV;
opt.max_gap = 2000, opt.max_gap_ref = opt.bw = 200000;
opt.a = 1, opt.b = 2, opt.q = 2, opt.e = 1, opt.q2 = 32, opt.e2 = 0;
opt.noncan = 5;
opt.zdrop = 200;
} else {
fprintf(stderr, "[E::%s] unknown preset '%s'\n", __func__, optarg);
while ((c = ketopt(&o, argc, argv, 1, opt_str, long_options)) >= 0) { // test command line options and apply option -x/preset first
if (c == 'x') {
if (mm_set_opt(o.arg, &ipt, &opt) < 0) {
fprintf(stderr, "[ERROR] unknown preset '%s'\n", o.arg);
return 1;
}
} else if (c == ':') {
fprintf(stderr, "[ERROR] missing option argument\n");
return 1;
} else if (c == '?') {
fprintf(stderr, "[ERROR] unknown option in \"%s\"\n", argv[o.i - 1]);
return 1;
}
}
if (w < 0) w = (int)(.6666667 * k + .499);
if ((opt.flag & MM_F_SPLICE) && max_intron_len > 0)
opt.max_gap_ref = opt.bw = max_intron_len;
o = KETOPT_INIT;
if (argc == optind || fp_help == stdout) {
while ((c = ketopt(&o, argc, argv, 1, opt_str, long_options)) >= 0) {
if (c == 'w') ipt.w = atoi(o.arg);
else if (c == 'k') ipt.k = atoi(o.arg);
else if (c == 'H') ipt.flag |= MM_I_HPC;
else if (c == 'd') fnw = o.arg; // the above are indexing related options, except -I
else if (c == 't') n_threads = atoi(o.arg);
else if (c == 'v') mm_verbose = atoi(o.arg);
else if (c == 'g') opt.max_gap = (int)mm_parse_num(o.arg);
else if (c == 'G') mm_mapopt_max_intron_len(&opt, (int)mm_parse_num(o.arg));
else if (c == 'F') opt.max_frag_len = (int)mm_parse_num(o.arg);
else if (c == 'N') old_best_n = opt.best_n, opt.best_n = atoi(o.arg);
else if (c == 'p') opt.pri_ratio = atof(o.arg);
else if (c == 'M') opt.mask_level = atof(o.arg);
else if (c == 'c') opt.flag |= MM_F_OUT_CG | MM_F_CIGAR;
else if (c == 'D') opt.flag |= MM_F_NO_DIAG;
else if (c == 'P') opt.flag |= MM_F_ALL_CHAINS;
else if (c == 'X') opt.flag |= MM_F_ALL_CHAINS | MM_F_NO_DIAG | MM_F_NO_DUAL | MM_F_NO_LJOIN; // -D -P --no-long-join --dual=no
else if (c == 'a') opt.flag |= MM_F_OUT_SAM | MM_F_CIGAR;
else if (c == 'Q') opt.flag |= MM_F_NO_QUAL;
else if (c == 'Y') opt.flag |= MM_F_SOFTCLIP;
else if (c == 'L') opt.flag |= MM_F_LONG_CIGAR;
else if (c == 'y') opt.flag |= MM_F_COPY_COMMENT;
else if (c == 'T') opt.sdust_thres = atoi(o.arg);
else if (c == 'n') opt.min_cnt = atoi(o.arg);
else if (c == 'm') opt.min_chain_score = atoi(o.arg);
else if (c == 'A') opt.a = atoi(o.arg);
else if (c == 'B') opt.b = atoi(o.arg);
else if (c == 's') opt.min_dp_max = atoi(o.arg);
else if (c == 'C') opt.noncan = atoi(o.arg);
else if (c == 'I') ipt.batch_size = mm_parse_num(o.arg);
else if (c == 'K') opt.mini_batch_size = mm_parse_num(o.arg);
else if (c == 'e') opt.occ_dist = mm_parse_num(o.arg);
else if (c == 'R') rg = o.arg;
else if (c == 'h') fp_help = stdout;
else if (c == '2') opt.flag |= MM_F_2_IO_THREADS;
else if (c == 'o') {
if (strcmp(o.arg, "-") != 0) {
if (freopen(o.arg, "wb", stdout) == NULL) {
fprintf(stderr, "[ERROR]\033[1;31m failed to write the output to file '%s'\033[0m: %s\n", o.arg, strerror(errno));
exit(1);
}
}
}
else if (c == 300) ipt.bucket_bits = atoi(o.arg); // --bucket-bits
else if (c == 302) opt.seed = atoi(o.arg); // --seed
else if (c == 303) mm_dbg_flag |= MM_DBG_NO_KALLOC; // --no-kalloc
else if (c == 304) mm_dbg_flag |= MM_DBG_PRINT_QNAME; // --print-qname
else if (c == 306) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_SEED, n_threads = 1; // --print-seed
else if (c == 307) opt.max_chain_skip = atoi(o.arg); // --max-chain-skip
else if (c == 339) opt.max_chain_iter = atoi(o.arg); // --max-chain-iter
else if (c == 308) opt.min_ksw_len = atoi(o.arg); // --min-dp-len
else if (c == 309) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_ALN_SEQ, n_threads = 1; // --print-aln-seq
else if (c == 310) opt.flag |= MM_F_SPLICE; // --splice
else if (c == 312) opt.flag |= MM_F_NO_LJOIN; // --no-long-join
else if (c == 313) opt.flag |= MM_F_SR; // --sr
else if (c == 317) opt.end_bonus = atoi(o.arg); // --end-bonus
else if (c == 318) opt.flag |= MM_F_INDEPEND_SEG; // --no-pairing
else if (c == 320) ipt.flag |= MM_I_NO_SEQ; // --idx-no-seq
else if (c == 321) opt.anchor_ext_shift = atoi(o.arg); // --end-seed-pen
else if (c == 322) opt.flag |= MM_F_FOR_ONLY; // --for-only
else if (c == 323) opt.flag |= MM_F_REV_ONLY; // --rev-only
else if (c == 327) opt.max_clip_ratio = atof(o.arg); // --max-clip-ratio
else if (c == 328) opt.min_mid_occ = atoi(o.arg); // --min-occ-floor
else if (c == 329) opt.flag |= MM_F_OUT_MD; // --MD
else if (c == 331) opt.sc_ambi = atoi(o.arg); // --score-N
else if (c == 332) opt.flag |= MM_F_EQX; // --eqx
else if (c == 333) opt.flag |= MM_F_PAF_NO_HIT; // --paf-no-hit
else if (c == 334) opt.split_prefix = o.arg; // --split-prefix
else if (c == 335) opt.flag |= MM_F_NO_END_FLT; // --no-end-flt
else if (c == 336) opt.flag |= MM_F_HARD_MLEVEL; // --hard-mask-level
else if (c == 337) opt.max_sw_mat = mm_parse_num(o.arg); // --cap-sw-mat
else if (c == 338) opt.max_qlen = mm_parse_num(o.arg); // --max-qlen
else if (c == 340) junc_bed = o.arg; // --junc-bed
else if (c == 341) opt.junc_bonus = atoi(o.arg); // --junc-bonus
else if (c == 342) opt.flag |= MM_F_SAM_HIT_ONLY; // --sam-hit-only
else if (c == 343) opt.chain_gap_scale = atof(o.arg); // --chain-gap-scale
else if (c == 351) opt.chain_skip_scale = atof(o.arg); // --chain-skip-scale
else if (c == 344) alt_list = o.arg; // --alt
else if (c == 345) opt.alt_drop = atof(o.arg); // --alt-drop
else if (c == 346) opt.mask_len = mm_parse_num(o.arg); // --mask-len
else if (c == 348) opt.flag |= MM_F_QSTRAND | MM_F_NO_INV; // --qstrand
else if (c == 349) opt.cap_kalloc = mm_parse_num(o.arg); // --cap-kalloc
else if (c == 350) opt.q_occ_frac = atof(o.arg); // --q-occ-frac
else if (c == 352) mm_dbg_flag |= MM_DBG_PRINT_CHAIN; // --print-chains
else if (c == 353) opt.flag |= MM_F_NO_HASH_NAME; // --no-hash-name
else if (c == 330) {
fprintf(stderr, "[WARNING] \033[1;31m --lj-min-ratio has been deprecated.\033[0m\n");
} else if (c == 314) { // --frag
yes_or_no(&opt, MM_F_FRAG_MODE, o.longidx, o.arg, 1);
} else if (c == 315) { // --secondary
yes_or_no(&opt, MM_F_NO_PRINT_2ND, o.longidx, o.arg, 0);
} else if (c == 316) { // --cs
opt.flag |= MM_F_OUT_CS | MM_F_CIGAR;
if (o.arg == 0 || strcmp(o.arg, "short") == 0) {
opt.flag &= ~MM_F_OUT_CS_LONG;
} else if (strcmp(o.arg, "long") == 0) {
opt.flag |= MM_F_OUT_CS_LONG;
} else if (strcmp(o.arg, "none") == 0) {
opt.flag &= ~MM_F_OUT_CS;
} else if (mm_verbose >= 2) {
fprintf(stderr, "[WARNING]\033[1;31m --cs only takes 'short' or 'long'. Invalid values are assumed to be 'short'.\033[0m\n");
}
} else if (c == 319) { // --splice-flank
yes_or_no(&opt, MM_F_SPLICE_FLANK, o.longidx, o.arg, 1);
} else if (c == 324) { // --heap-sort
yes_or_no(&opt, MM_F_HEAP_SORT, o.longidx, o.arg, 1);
} else if (c == 326) { // --dual
yes_or_no(&opt, MM_F_NO_DUAL, o.longidx, o.arg, 0);
} else if (c == 347) { // --rmq
yes_or_no(&opt, MM_F_RMQ, o.longidx, o.arg, 1);
} else if (c == 'S') {
opt.flag |= MM_F_OUT_CS | MM_F_CIGAR | MM_F_OUT_CS_LONG;
if (mm_verbose >= 2)
fprintf(stderr, "[WARNING]\033[1;31m option -S is deprecated and may be removed in future. Please use --cs=long instead.\033[0m\n");
} else if (c == 'V') {
puts(MM_VERSION);
return 0;
} else if (c == 'r') {
opt.bw = (int)mm_parse_num2(o.arg, &s);
if (*s == ',') opt.bw_long = (int)mm_parse_num2(s + 1, &s);
} else if (c == 'U') {
opt.min_mid_occ = strtol(o.arg, &s, 10);
if (*s == ',') opt.max_mid_occ = strtol(s + 1, &s, 10);
} else if (c == 'f') {
double x;
char *p;
x = strtod(o.arg, &p);
if (x < 1.0) opt.mid_occ_frac = x, opt.mid_occ = 0;
else opt.mid_occ = (int)(x + .499);
if (*p == ',') opt.max_occ = (int)(strtod(p+1, &p) + .499);
} else if (c == 'u') {
if (*o.arg == 'b') opt.flag |= MM_F_SPLICE_FOR|MM_F_SPLICE_REV; // both strands
else if (*o.arg == 'f') opt.flag |= MM_F_SPLICE_FOR, opt.flag &= ~MM_F_SPLICE_REV; // match GT-AG
else if (*o.arg == 'r') opt.flag |= MM_F_SPLICE_REV, opt.flag &= ~MM_F_SPLICE_FOR; // match CT-AC (reverse complement of GT-AG)
else if (*o.arg == 'n') opt.flag &= ~(MM_F_SPLICE_FOR|MM_F_SPLICE_REV); // don't try to match the GT-AG signal
else {
fprintf(stderr, "[ERROR]\033[1;31m unrecognized cDNA direction\033[0m\n");
return 1;
}
} else if (c == 'z') {
opt.zdrop = opt.zdrop_inv = strtol(o.arg, &s, 10);
if (*s == ',') opt.zdrop_inv = strtol(s + 1, &s, 10);
} else if (c == 'O') {
opt.q = opt.q2 = strtol(o.arg, &s, 10);
if (*s == ',') opt.q2 = strtol(s + 1, &s, 10);
} else if (c == 'E') {
opt.e = opt.e2 = strtol(o.arg, &s, 10);
if (*s == ',') opt.e2 = strtol(s + 1, &s, 10);
}
}
if ((opt.flag & MM_F_SPLICE) && (opt.flag & MM_F_FRAG_MODE)) {
fprintf(stderr, "[ERROR]\033[1;31m --splice and --frag should not be specified at the same time.\033[0m\n");
return 1;
}
if (!fnw && !(opt.flag&MM_F_CIGAR))
ipt.flag |= MM_I_NO_SEQ;
if (mm_check_opt(&ipt, &opt) < 0)
return 1;
if (opt.best_n == 0) {
fprintf(stderr, "[WARNING]\033[1;31m changed '-N 0' to '-N %d --secondary=no'.\033[0m\n", old_best_n);
opt.best_n = old_best_n, opt.flag |= MM_F_NO_PRINT_2ND;
}
if (argc == o.ind || fp_help == stdout) {
fprintf(fp_help, "Usage: minimap2 [options] <target.fa>|<target.idx> [query.fa] [...]\n");
fprintf(fp_help, "Options:\n");
fprintf(fp_help, " Indexing:\n");
fprintf(fp_help, " -H use homopolymer-compressed k-mer\n");
fprintf(fp_help, " -k INT k-mer size (no larger than 28) [%d]\n", k);
fprintf(fp_help, " -w INT minizer window size [{-k}*2/3]\n");
fprintf(fp_help, " -H use homopolymer-compressed k-mer (preferrable for PacBio)\n");
fprintf(fp_help, " -k INT k-mer size (no larger than 28) [%d]\n", ipt.k);
fprintf(fp_help, " -w INT minimizer window size [%d]\n", ipt.w);
fprintf(fp_help, " -I NUM split index for every ~NUM input bases [4G]\n");
fprintf(fp_help, " -d FILE dump index to FILE []\n");
fprintf(fp_help, " Mapping:\n");
fprintf(fp_help, " -f FLOAT filter out top FLOAT fraction of repetitive minimizers [%g]\n", opt.mid_occ_frac);
fprintf(fp_help, " -g INT stop chain enlongation if there are no minimizers in INT-bp [%d]\n", opt.max_gap);
fprintf(fp_help, " -r INT bandwidth used in chaining and DP-based alignment [%d]\n", opt.bw);
fprintf(fp_help, " -g NUM stop chain enlongation if there are no minimizers in INT-bp [%d]\n", opt.max_gap);
fprintf(fp_help, " -G NUM max intron length (effective with -xsplice; changing -r) [200k]\n");
fprintf(fp_help, " -F NUM max fragment length (effective with -xsr or in the fragment mode) [800]\n");
fprintf(fp_help, " -r NUM[,NUM] chaining/alignment bandwidth and long-join bandwidth [%d,%d]\n", opt.bw, opt.bw_long);
fprintf(fp_help, " -n INT minimal number of minimizers on a chain [%d]\n", opt.min_cnt);
fprintf(fp_help, " -m INT minimal chaining score (matching bases minus log gap penalty) [%d]\n", opt.min_chain_score);
// fprintf(fp_help, " -T INT SDUST threshold; 0 to disable SDUST [%d]\n", opt.sdust_thres); // TODO: this option is never used; might be buggy
fprintf(fp_help, " -X skip self and dual mappings (for the all-vs-all mode)\n");
fprintf(fp_help, " -p FLOAT min secondary-to-primary score ratio [%g]\n", opt.pri_ratio);
fprintf(fp_help, " -N INT retain at most INT secondary alignments [%d]\n", opt.best_n);
fprintf(fp_help, " -G NUM max intron length (only effective following -x splice) [200k]\n");
fprintf(fp_help, " Alignment:\n");
fprintf(fp_help, " -A INT matching score [%d]\n", opt.a);
fprintf(fp_help, " -B INT mismatch penalty [%d]\n", opt.b);
fprintf(fp_help, " -B INT mismatch penalty (larger value for lower divergence) [%d]\n", opt.b);
fprintf(fp_help, " -O INT[,INT] gap open penalty [%d,%d]\n", opt.q, opt.q2);
fprintf(fp_help, " -E INT[,INT] gap extension penalty; a k-long gap costs min{O1+k*E1,O2+k*E2} [%d,%d]\n", opt.e, opt.e2);
fprintf(fp_help, " -z INT Z-drop score [%d]\n", opt.zdrop);
fprintf(fp_help, " -z INT[,INT] Z-drop score and inversion Z-drop score [%d,%d]\n", opt.zdrop, opt.zdrop_inv);
fprintf(fp_help, " -s INT minimal peak DP alignment score [%d]\n", opt.min_dp_max);
fprintf(fp_help, " -u CHAR how to find GT-AG. f:transcript strand, b:both strands, n:don't match GT-AG [n]\n");
fprintf(fp_help, " Input/Output:\n");
fprintf(fp_help, " -a output in the SAM format (PAF by default)\n");
fprintf(fp_help, " -Q don't output base quality in SAM\n");
fprintf(fp_help, " -o FILE output alignments to FILE [stdout]\n");
fprintf(fp_help, " -L write CIGAR with >65535 ops at the CG tag\n");
fprintf(fp_help, " -R STR SAM read group line in a format like '@RG\\tID:foo\\tSM:bar' []\n");
fprintf(fp_help, " -c output CIGAR in PAF\n");
fprintf(fp_help, " -S output the cs tag in PAF (cs encodes both query and ref sequences)\n");
fprintf(fp_help, " --cs[=STR] output the cs tag; STR is 'short' (if absent) or 'long' [none]\n");
fprintf(fp_help, " --MD output the MD tag\n");
fprintf(fp_help, " --eqx write =/X CIGAR operators\n");
fprintf(fp_help, " -Y use soft clipping for supplementary alignments\n");
fprintf(fp_help, " -t INT number of threads [%d]\n", n_threads);
fprintf(fp_help, " -K NUM minibatch size [200M]\n");
fprintf(fp_help, " -K NUM minibatch size for mapping [500M]\n");
// fprintf(fp_help, " -v INT verbose level [%d]\n", mm_verbose);
fprintf(fp_help, " --version show version number\n");
fprintf(fp_help, " Preset:\n");
fprintf(fp_help, " -x STR preset (recommended to be applied before other options) []\n");
fprintf(fp_help, " map10k/map-pb: -Hk19 (PacBio/ONT vs reference mapping)\n");
fprintf(fp_help, " map-ont: -k15 (slightly more sensitive than 'map10k' for ONT vs reference)\n");
fprintf(fp_help, " asm5: -k19 -w19 -A1 -B19 -O39,81 -E3,1 -s200 -z200 (asm to ref mapping; break at 5%% div.)\n");
fprintf(fp_help, " asm10: -k19 -w19 -A1 -B9 -O16,41 -E2,1 -s200 -z200 (asm to ref mapping; break at 10%% div.)\n");
fprintf(fp_help, " ava-pb: -Hk19 -w5 -Xp0 -m100 -g10000 -K500m --max-chain-skip 25 (PacBio read overlap)\n");
fprintf(fp_help, " ava-ont: -k15 -w5 -Xp0 -m100 -g10000 -K500m --max-chain-skip 25 (ONT read overlap)\n");
fprintf(fp_help, " splice: long-read spliced alignment (see minimap2.1 for details)\n");
fprintf(fp_help, "\nSee `man ./minimap2.1' for detailed description of command-line options.\n");
fprintf(fp_help, " -x STR preset (always applied before other options; see minimap2.1 for details) []\n");
fprintf(fp_help, " - map-pb/map-ont - PacBio CLR/Nanopore vs reference mapping\n");
fprintf(fp_help, " - map-hifi - PacBio HiFi reads vs reference mapping\n");
fprintf(fp_help, " - ava-pb/ava-ont - PacBio/Nanopore read overlap\n");
fprintf(fp_help, " - asm5/asm10/asm20 - asm-to-ref mapping, for ~0.1/1/5%% sequence divergence\n");
fprintf(fp_help, " - splice/splice:hq - long-read/Pacbio-CCS spliced alignment\n");
fprintf(fp_help, " - sr - genomic short-read mapping\n");
fprintf(fp_help, "\nSee `man ./minimap2.1' for detailed description of these and other advanced command-line options.\n");
return fp_help == stdout? 0 : 1;
}
is_idx = mm_idx_is_idx(argv[optind]);
if (is_idx < 0) {
fprintf(stderr, "[ERROR] failed to open file '%s'\n", argv[optind]);
if ((opt.flag & MM_F_SR) && argc - o.ind > 3) {
fprintf(stderr, "[ERROR] incorrect input: in the sr mode, please specify no more than two query files.\n");
return 1;
}
if (!is_idx && fnw == 0 && argc - optind < 2) {
idx_rdr = mm_idx_reader_open(argv[o.ind], &ipt, fnw);
if (idx_rdr == 0) {
fprintf(stderr, "[ERROR] failed to open file '%s': %s\n", argv[o.ind], strerror(errno));
return 1;
}
if (!idx_rdr->is_idx && fnw == 0 && argc - o.ind < 2) {
fprintf(stderr, "[ERROR] missing input: please specify a query file to map or option -d to keep the index\n");
mm_idx_reader_close(idx_rdr);
return 1;
}
if (is_idx) fpr = fopen(argv[optind], "rb");
else fp = mm_bseq_open(argv[optind]);
if (fnw) fpw = fopen(fnw, "wb");
if (opt.flag & MM_F_OUT_SAM)
mm_write_sam_hdr_no_SQ(rg, MM_VERSION, argc, argv);
for (;;) {
mm_idx_t *mi;
if (fpr) {
mi = mm_idx_load(fpr);
if (mi == 0) break;
if (idx_par_set && mm_verbose >= 2 && (mi->k != k || mi->w != w || mi->is_hpc != is_hpc))
fprintf(stderr, "[WARNING] \033[1;31mIndexing parameters on the command line (-k/-w/-H) overridden by parameters in the prebuilt index.\033[0m\n");
} else {
mi = mm_idx_gen(fp, w, k, bucket_bits, is_hpc, minibatch_size, n_threads, batch_size, keep_name);
if (opt.best_n == 0 && (opt.flag&MM_F_CIGAR) && mm_verbose >= 2)
fprintf(stderr, "[WARNING]\033[1;31m `-N 0' reduces alignment accuracy. Please use --secondary=no to suppress secondary alignments.\033[0m\n");
while ((mi = mm_idx_reader_read(idx_rdr, n_threads)) != 0) {
int ret;
if ((opt.flag & MM_F_CIGAR) && (mi->flag & MM_I_NO_SEQ)) {
fprintf(stderr, "[ERROR] the prebuilt index doesn't contain sequences.\n");
mm_idx_destroy(mi);
mm_idx_reader_close(idx_rdr);
return 1;
}
if ((opt.flag & MM_F_OUT_SAM) && idx_rdr->n_parts == 1) {
if (mm_idx_reader_eof(idx_rdr)) {
if (opt.split_prefix == 0)
ret = mm_write_sam_hdr(mi, rg, MM_VERSION, argc, argv);
else
ret = mm_write_sam_hdr(0, rg, MM_VERSION, argc, argv);
} else {
ret = mm_write_sam_hdr(0, rg, MM_VERSION, argc, argv);
if (opt.split_prefix == 0 && mm_verbose >= 2)
fprintf(stderr, "[WARNING]\033[1;31m For a multi-part index, no @SQ lines will be outputted. Please use --split-prefix.\033[0m\n");
}
if (ret != 0) {
mm_idx_destroy(mi);
mm_idx_reader_close(idx_rdr);
return 1;
}
}
if (mi == 0) break;
++n_idx_part;
if (mm_verbose >= 2 && n_idx_part > 1 && (opt.flag&MM_F_OUT_SAM) && !(opt.flag&MM_F_NO_SAM_SQ))
fprintf(stderr, "[WARNING] \033[1;31mSAM output is malformated due to internal @SQ lines. Please add option --no-sam-sq or filter afterwards.\033[0m\n");
if (mm_verbose >= 3)
fprintf(stderr, "[M::%s::%.3f*%.2f] loaded/built the index for %d target sequence(s)\n",
__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), mi->n_seq);
if (fpw) {
mm_idx_dump(fpw, mi);
if (mm_verbose >= 3)
fprintf(stderr, "[M::%s::%.3f*%.2f] dumpped the (partial) index to disk\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0));
}
if (argc != optind + 1) mm_mapopt_update(&opt, mi);
if (argc != o.ind + 1) mm_mapopt_update(&opt, mi);
if (mm_verbose >= 3) mm_idx_stat(mi);
for (i = optind + 1; i < argc; ++i)
mm_map_file(mi, argv[i], &opt, n_threads, minibatch_size);
if (junc_bed) mm_idx_bed_read(mi, junc_bed, 1);
if (alt_list) mm_idx_alt_read(mi, alt_list);
if (argc - (o.ind + 1) == 0) {
mm_idx_destroy(mi);
continue; // no query files
}
ret = 0;
if (!(opt.flag & MM_F_FRAG_MODE)) {
for (i = o.ind + 1; i < argc; ++i) {
ret = mm_map_file(mi, argv[i], &opt, n_threads);
if (ret < 0) break;
}
} else {
ret = mm_map_file_frag(mi, argc - (o.ind + 1), (const char**)&argv[o.ind + 1], &opt, n_threads);
}
mm_idx_destroy(mi);
if (ret < 0) {
fprintf(stderr, "ERROR: failed to map the query file\n");
exit(EXIT_FAILURE);
}
}
if (fpw) fclose(fpw);
if (fpr) fclose(fpr);
if (fp) mm_bseq_close(fp);
n_parts = idx_rdr->n_parts;
mm_idx_reader_close(idx_rdr);
fprintf(stderr, "[M::%s] Version: %s\n", __func__, MM_VERSION);
fprintf(stderr, "[M::%s] CMD:", __func__);
for (i = 0; i < argc; ++i)
fprintf(stderr, " %s", argv[i]);
fprintf(stderr, "\n[M::%s] Real time: %.3f sec; CPU: %.3f sec\n", __func__, realtime() - mm_realtime0, cputime());
if (opt.split_prefix)
mm_split_merge(argc - (o.ind + 1), (const char**)&argv[o.ind + 1], &opt, n_parts);
if (fflush(stdout) == EOF) {
perror("[ERROR] failed to write the results");
exit(EXIT_FAILURE);
}
if (mm_verbose >= 3) {
fprintf(stderr, "[M::%s] Version: %s\n", __func__, MM_VERSION);
fprintf(stderr, "[M::%s] CMD:", __func__);
for (i = 0; i < argc; ++i)
fprintf(stderr, " %s", argv[i]);
fprintf(stderr, "\n[M::%s] Real time: %.3f sec; CPU: %.3f sec; Peak RSS: %.3f GB\n", __func__, realtime() - mm_realtime0, cputime(), peakrss() / 1024.0 / 1024.0 / 1024.0);
}
return 0;
}
+587 -271
View File
@@ -1,65 +1,18 @@
#include <stdlib.h>
#include <string.h>
#include <assert.h>
#include <errno.h>
#include "kthread.h"
#include "kvec.h"
#include "kalloc.h"
#include "sdust.h"
#include "mmpriv.h"
#include "bseq.h"
void mm_mapopt_init(mm_mapopt_t *opt)
{
memset(opt, 0, sizeof(mm_mapopt_t));
opt->max_occ_frac = 1e-5f;
opt->mid_occ_frac = 2e-4f;
opt->sdust_thres = 0;
opt->min_cnt = 3;
opt->min_chain_score = 40;
opt->bw = 500;
opt->max_gap = 5000;
opt->max_gap_ref = -1;
opt->max_chain_skip = 25;
opt->mask_level = 0.5f;
opt->pri_ratio = 0.8f;
opt->best_n = 5;
opt->max_join_long = 20000;
opt->max_join_short = 2000;
opt->min_join_flank_sc = 1000;
opt->a = 2, opt->b = 4, opt->q = 4, opt->e = 2, opt->q2 = 24, opt->e2 = 1;
opt->zdrop = 400;
opt->min_dp_max = opt->min_chain_score * opt->a;
opt->min_ksw_len = 200;
}
void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
{
if (opt->flag & MM_F_SPLICE_BOTH)
opt->flag &= ~(MM_F_SPLICE_FOR|MM_F_SPLICE_REV);
opt->max_occ = mm_idx_cal_max_occ(mi, opt->max_occ_frac);
opt->mid_occ = mm_idx_cal_max_occ(mi, opt->mid_occ_frac);
if (mm_verbose >= 3)
fprintf(stderr, "[M::%s::%.3f*%.2f] mid_occ = %d; max_occ = %d\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0),
opt->mid_occ, opt->max_occ);
}
typedef struct {
uint32_t n:31, is_alloc:1;
uint32_t qpos;
union {
const uint64_t *cr;
uint64_t *r;
} x;
} mm_match_t;
#include "khash.h"
struct mm_tbuf_s {
sdust_buf_t *sdb;
mm128_v mini;
void *km;
int rep_len, frag_gap;
};
mm_tbuf_t *mm_tbuf_init(void)
@@ -67,226 +20,368 @@ mm_tbuf_t *mm_tbuf_init(void)
mm_tbuf_t *b;
b = (mm_tbuf_t*)calloc(1, sizeof(mm_tbuf_t));
if (!(mm_dbg_flag & 1)) b->km = km_init();
b->sdb = sdust_buf_init(b->km);
return b;
}
void mm_tbuf_destroy(mm_tbuf_t *b)
{
if (b == 0) return;
kfree(b->km, b->mini.a);
sdust_buf_destroy(b->sdb);
km_destroy(b->km);
free(b);
}
static void mm_dust_minier(mm128_v *mini, int l_seq, const char *seq, int sdust_thres, sdust_buf_t *sdb)
void *mm_tbuf_get_km(mm_tbuf_t *b)
{
return b->km;
}
static int mm_dust_minier(void *km, int n, mm128_t *a, int l_seq, const char *seq, int sdust_thres)
{
int n_dreg, j, k, u = 0;
const uint64_t *dreg;
if (sdust_thres <= 0 || sdb == 0) return;
sdust_buf_t *sdb;
if (sdust_thres <= 0) return n;
sdb = sdust_buf_init(km);
dreg = sdust_core((const uint8_t*)seq, l_seq, sdust_thres, 64, &n_dreg, sdb);
for (j = k = 0; j < mini->n; ++j) { // squeeze out minimizers that significantly overlap with LCRs
int32_t qpos = (uint32_t)mini->a[j].y>>1, span = mini->a[j].x&0xff;
for (j = k = 0; j < n; ++j) { // squeeze out minimizers that significantly overlap with LCRs
int32_t qpos = (uint32_t)a[j].y>>1, span = a[j].x&0xff;
int32_t s = qpos - (span - 1), e = s + span;
while (u < n_dreg && (uint32_t)dreg[u] <= s) ++u;
if (u < n_dreg && dreg[u]>>32 < e) {
while (u < n_dreg && (int32_t)dreg[u] <= s) ++u;
if (u < n_dreg && (int32_t)(dreg[u]>>32) < e) {
int v, l = 0;
for (v = u; v < n_dreg && dreg[v]>>32 < e; ++v) { // iterate over LCRs overlapping this minimizer
int ss = s > dreg[v]>>32? s : dreg[v]>>32;
int ee = e < (uint32_t)dreg[v]? e : (uint32_t)dreg[v];
for (v = u; v < n_dreg && (int32_t)(dreg[v]>>32) < e; ++v) { // iterate over LCRs overlapping this minimizer
int ss = s > (int32_t)(dreg[v]>>32)? s : dreg[v]>>32;
int ee = e < (int32_t)dreg[v]? e : (uint32_t)dreg[v];
l += ee - ss;
}
if (l <= span>>1) mini->a[k++] = mini->a[j]; // keep the minimizer if less than half of it falls in masked region
}
if (l <= span>>1) a[k++] = a[j]; // keep the minimizer if less than half of it falls in masked region
} else a[k++] = a[j];
}
mini->n = k;
}
#if 0
int mm_pair_thin_core(mm_tbuf_t *b, uint64_t x, int radius, int rel, int st0, int n, const uint64_t *z, uint64_v *a)
{
int i, st = st0, en = n, mid = en - 1;
while (st < en) {
uint64_t y;
mid = st + ((en - st) >> 1);
y = z[mid];
if (y < x && (x - y)>>1 > radius) st = mid + 1;
else if (y >= x && (y - x)>>1 > radius) en = mid;
else break;
}
if (st < en) {
for (en = mid + 1; en < n; ++en)
if (z[en] > x && (z[en] - x)>>1 > radius)
break;
for (st = mid - 1; st >= st0; --st)
if (z[st] < x && (x - z[st])>>1 > radius)
break;
++st;
for (i = st; i < en; ++i) {
uint64_t y = z[i];
if (((x ^ y) & 1) == rel) {
// printf("* %d,%d\n", (uint32_t)x>>1, (uint32_t)y>>1);
kv_push(uint64_t, b->km, *a, y);
}
}
return en;
} else return st < n && z[st] < x? st + 1 : en;
sdust_buf_destroy(sdb);
return k; // the new size
}
void mm_pair_thin(mm_tbuf_t *b, int radius, mm_match_t *m1, mm_match_t *m2)
static void collect_minimizers(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, mm128_v *mv)
{
mm_match_t *m[2];
const uint64_t *z[2];
uint64_v a[2];
int i, n[2], k[2], u = 0, rel = (m1->qpos ^ m2->qpos) & 1;
m[0] = m1, m[1] = m2;
for (i = 0; i < 2; ++i) {
n[i] = m[i]->n;
z[i] = m[i]->x.cr;
k[i] = 0;
kv_init(a[i]);
kv_resize(uint64_t, b->km, a[i], 256);
int i, n, sum = 0;
mv->n = 0;
for (i = n = 0; i < n_segs; ++i) {
size_t j;
mm_sketch(km, seqs[i], qlens[i], mi->w, mi->k, i, mi->flag&MM_I_HPC, mv);
for (j = n; j < mv->n; ++j)
mv->a[j].y += sum << 1;
if (opt->sdust_thres > 0) // mask low-complexity minimizers
mv->n = n + mm_dust_minier(km, mv->n - n, mv->a + n, qlens[i], seqs[i], opt->sdust_thres);
sum += qlens[i], n = mv->n;
}
while (k[0] < n[0] && k[1] < n[1]) {
//printf("%d; %d,%d\n", u, k[0], k[1]);
int v = u^1, dist = (int)(m[v]->qpos>>1) - (int)(m[u]->qpos>>1);
uint64_t x = z[u][k[u]];
int uori = (x ^ m[u]->qpos) & 1, last;
int64_t tpos = x>>1 & 0x7fffffff;
tpos = uori == 0? tpos + dist : tpos - dist;
if (tpos < 0) tpos = 0;
x = x>>32<<32 | tpos<<1 | (x&1);
last = a[v].n;
k[v] = mm_pair_thin_core(b, x, radius, rel, k[v], n[v], z[v], &a[v]);
if (a[v].n > last) kv_push(uint64_t, b->km, a[u], z[u][k[u]]);
++k[u];
u ^= 1;
}
for (i = 0; i < 2; ++i)
m[i]->n = a[i].n, m[i]->x.r = a[i].a, m[i]->is_alloc = 1;
// printf("%d,%d; %d,%d\n", m[0]->qpos>>1, m[1]->qpos>>1, m[0]->n, m[1]->n);
}
#endif
mm_reg1_t *mm_map_frag(const mm_mapopt_t *opt, const mm_idx_t *mi, mm_tbuf_t *b, uint32_t m_st, uint32_t m_en, const char *qname, int qlen, const char *seq, int *n_regs)
{
int i, n = m_en - m_st, j, n_u, max_gap_ref;
int64_t n_a;
uint64_t *u;
mm_match_t *m;
mm128_t *a;
mm_reg1_t *regs;
// convert to local representation
m = (mm_match_t*)kmalloc(b->km, n * sizeof(mm_match_t));
for (i = 0; i < n; ++i) {
int t;
mm128_t *p = &b->mini.a[i + m_st];
m[i].is_alloc = 0;
m[i].qpos = (uint32_t)p->y;
m[i].x.cr = mm_idx_get(mi, p->x>>8, &t);
m[i].n = t;
#include "ksort.h"
#define heap_lt(a, b) ((a).x > (b).x)
KSORT_INIT(heap, mm128_t, heap_lt)
static inline int skip_seed(int flag, uint64_t r, const mm_seed_t *q, const char *qname, int qlen, const mm_idx_t *mi, int *is_self)
{
*is_self = 0;
if (qname && (flag & (MM_F_NO_DIAG|MM_F_NO_DUAL))) {
const mm_idx_seq_t *s = &mi->seq[r>>32];
int cmp;
cmp = strcmp(qname, s->name);
if ((flag&MM_F_NO_DIAG) && cmp == 0 && (int)s->len == qlen) {
if ((uint32_t)r>>1 == (q->q_pos>>1)) return 1; // avoid the diagnonal anchors
if ((r&1) == (q->q_pos&1)) *is_self = 1; // this flag is used to avoid spurious extension on self chain
}
if ((flag&MM_F_NO_DUAL) && cmp > 0) // all-vs-all mode: map once
return 1;
}
#if 0
int last = -1, last2 = -1;
// pair k-mer thinning
for (i = 0; i < n; ++i) {
if (m[i].n >= opt->mid_occ && m[i].n < opt->max_occ) {
if (last2 < 0) last2 = i;
if (last < 0 || m[last].n < m[i].n) last = i;
if (last >= 0 && (m[last].qpos>>1) + (m[last].span>>1) <= m[i].qpos>>1) {
mm_pair_thin(b, opt->bw, &m[last], &m[i]);
last2 = last = -1;
} else if (last2 >= 0 && (m[last2].qpos>>1) + (m[last2].span>>1) <= m[i].qpos>>1) {
mm_pair_thin(b, opt->bw, &m[last2], &m[i]);
last2 = last = -1;
}
if (flag & (MM_F_FOR_ONLY|MM_F_REV_ONLY)) {
if ((r&1) == (q->q_pos&1)) { // forward strand
if (flag & MM_F_REV_ONLY) return 1;
} else {
if (flag & MM_F_FOR_ONLY) return 1;
}
}
#endif
// fill the _a_ array
for (i = 0, n_a = 0; i < n; ++i) // find the length of a[]
if (m[i].n < opt->mid_occ) n_a += m[i].n;
a = (mm128_t*)kmalloc(b->km, n_a * sizeof(mm128_t));
for (i = j = 0; i < n; ++i) {
mm128_t *p = &b->mini.a[i + m_st];
mm_match_t *q = &m[i];
const uint64_t *r = q->x.cr;
int k, q_span = p->x & 0xff, is_tandem = 0;
if (q->n >= opt->mid_occ) continue;
if (i > 0 && p->x>>8 == b->mini.a[m_st + i - 1].x>>8) is_tandem = 1;
if (i < n - 1 && p->x>>8 == b->mini.a[m_st + i + 1].x>>8) is_tandem = 1;
for (k = 0; k < q->n; ++k) {
const char *tname = mi->seq[r[k]>>32].name;
int32_t rpos = (uint32_t)r[k] >> 1;
mm128_t *p;
if (qname && (opt->flag&MM_F_NO_SELF) && strcmp(qname, tname) == 0 && rpos == (q->qpos>>1)) // avoid the diagonal
continue;
if (qname && (opt->flag&MM_F_AVA) && strcmp(qname, tname) > 0) // all-vs-all mode: map once
continue;
p = &a[j++];
if ((r[k]&1) == (q->qpos&1)) { // forward strand
p->x = (r[k]&0xffffffff00000000ULL) | (uint32_t)r[k]>>1;
p->y = (uint64_t)q_span << 32 | q->qpos >> 1;
return 0;
}
static mm128_t *collect_seed_hits_heap(void *km, const mm_mapopt_t *opt, int max_occ, const mm_idx_t *mi, const char *qname, const mm128_v *mv, int qlen, int64_t *n_a, int *rep_len,
int *n_mini_pos, uint64_t **mini_pos)
{
int i, n_m, heap_size = 0;
int64_t j, n_for = 0, n_rev = 0;
mm_seed_t *m;
mm128_t *a, *heap;
m = mm_collect_matches(km, &n_m, qlen, max_occ, opt->max_max_occ, opt->occ_dist, mi, mv, n_a, rep_len, n_mini_pos, mini_pos);
heap = (mm128_t*)kmalloc(km, n_m * sizeof(mm128_t));
a = (mm128_t*)kmalloc(km, *n_a * sizeof(mm128_t));
for (i = 0, heap_size = 0; i < n_m; ++i) {
if (m[i].n > 0) {
heap[heap_size].x = m[i].cr[0];
heap[heap_size].y = (uint64_t)i<<32;
++heap_size;
}
}
ks_heapmake_heap(heap_size, heap);
while (heap_size > 0) {
mm_seed_t *q = &m[heap->y>>32];
mm128_t *p;
uint64_t r = heap->x;
int32_t is_self, rpos = (uint32_t)r >> 1;
if (!skip_seed(opt->flag, r, q, qname, qlen, mi, &is_self)) {
if ((r&1) == (q->q_pos&1)) { // forward strand
p = &a[n_for++];
p->x = (r&0xffffffff00000000ULL) | rpos;
p->y = (uint64_t)q->q_span << 32 | q->q_pos >> 1;
} else { // reverse strand
p->x = 1ULL<<63 | (r[k]&0xffffffff00000000ULL) | (uint32_t)r[k]>>1;
p->y = (uint64_t)q_span << 32 | (qlen - ((q->qpos>>1) + 1 - q_span) - 1);
p = &a[(*n_a) - (++n_rev)];
p->x = 1ULL<<63 | (r&0xffffffff00000000ULL) | rpos;
p->y = (uint64_t)q->q_span << 32 | (qlen - ((q->q_pos>>1) + 1 - q->q_span) - 1);
}
if (is_tandem) p->y |= MM_SEED_TANDEM;
p->y |= (uint64_t)q->seg_id << MM_SEED_SEG_SHIFT;
if (q->is_tandem) p->y |= MM_SEED_TANDEM;
if (is_self) p->y |= MM_SEED_SELF;
}
// update the heap
if ((uint32_t)heap->y < q->n - 1) {
++heap[0].y;
heap[0].x = m[heap[0].y>>32].cr[(uint32_t)heap[0].y];
} else {
heap[0] = heap[heap_size - 1];
--heap_size;
}
ks_heapdown_heap(0, heap_size, heap);
}
kfree(km, m);
kfree(km, heap);
// reverse anchors on the reverse strand, as they are in the descending order
for (j = 0; j < n_rev>>1; ++j) {
mm128_t t = a[(*n_a) - 1 - j];
a[(*n_a) - 1 - j] = a[(*n_a) - (n_rev - j)];
a[(*n_a) - (n_rev - j)] = t;
}
if (*n_a > n_for + n_rev) {
memmove(a + n_for, a + (*n_a) - n_rev, n_rev * sizeof(mm128_t));
*n_a = n_for + n_rev;
}
return a;
}
static mm128_t *collect_seed_hits(void *km, const mm_mapopt_t *opt, int max_occ, const mm_idx_t *mi, const char *qname, const mm128_v *mv, int qlen, int64_t *n_a, int *rep_len,
int *n_mini_pos, uint64_t **mini_pos)
{
int i, n_m;
mm_seed_t *m;
mm128_t *a;
m = mm_collect_matches(km, &n_m, qlen, max_occ, opt->max_max_occ, opt->occ_dist, mi, mv, n_a, rep_len, n_mini_pos, mini_pos);
a = (mm128_t*)kmalloc(km, *n_a * sizeof(mm128_t));
for (i = 0, *n_a = 0; i < n_m; ++i) {
mm_seed_t *q = &m[i];
const uint64_t *r = q->cr;
uint32_t k;
for (k = 0; k < q->n; ++k) {
int32_t is_self, rpos = (uint32_t)r[k] >> 1;
mm128_t *p;
if (skip_seed(opt->flag, r[k], q, qname, qlen, mi, &is_self)) continue;
p = &a[(*n_a)++];
if ((r[k]&1) == (q->q_pos&1)) { // forward strand
p->x = (r[k]&0xffffffff00000000ULL) | rpos;
p->y = (uint64_t)q->q_span << 32 | q->q_pos >> 1;
} else if (!(opt->flag & MM_F_QSTRAND)) { // reverse strand and not in the query-strand mode
p->x = 1ULL<<63 | (r[k]&0xffffffff00000000ULL) | rpos;
p->y = (uint64_t)q->q_span << 32 | (qlen - ((q->q_pos>>1) + 1 - q->q_span) - 1);
} else { // reverse strand; query-strand
int32_t len = mi->seq[r[k]>>32].len;
p->x = 1ULL<<63 | (r[k]&0xffffffff00000000ULL) | (len - (rpos + 1 - q->q_span) - 1); // coordinate only accurate for non-HPC seeds
p->y = (uint64_t)q->q_span << 32 | q->q_pos >> 1;
}
p->y |= (uint64_t)q->seg_id << MM_SEED_SEG_SHIFT;
if (q->is_tandem) p->y |= MM_SEED_TANDEM;
if (is_self) p->y |= MM_SEED_SELF;
}
}
n_a = j;
radix_sort_128x(a, a + n_a);
for (i = 0; i < n; ++i)
if (m[i].is_alloc) kfree(b->km, m[i].x.r);
kfree(b->km, m);
kfree(km, m);
radix_sort_128x(a, a + (*n_a));
return a;
}
if (mm_dbg_flag & MM_DBG_PRINT_SEED)
for (i = 0; i < n_a; ++i)
fprintf(stderr, "SD\t%s\t%d\t%c\t%d\t%d\t%d\n", mi->seq[a[i].x<<1>>33].name, (int32_t)a[i].x, "+-"[a[i].x>>63], (int32_t)a[i].y, (int32_t)(a[i].y>>32&0xff),
i == 0? 0 : ((int32_t)a[i].y - (int32_t)a[i-1].y) - ((int32_t)a[i].x - (int32_t)a[i-1].x));
max_gap_ref = opt->max_gap_ref >= 0? opt->max_gap_ref : opt->max_gap;
n_u = mm_chain_dp(max_gap_ref, opt->max_gap, opt->bw, opt->max_chain_skip, opt->min_cnt, opt->min_chain_score, !!(opt->flag&MM_F_SPLICE), n_a, a, &u, b->km);
regs = mm_gen_regs(b->km, qlen, n_u, u, a);
*n_regs = n_u;
if (mm_dbg_flag & MM_DBG_PRINT_SEED)
for (j = 0; j < n_u; ++j)
for (i = regs[j].as; i < regs[j].as + regs[j].cnt; ++i)
fprintf(stderr, "CN\t%d\t%s\t%d\t%c\t%d\t%d\t%d\n", j, mi->seq[a[i].x<<1>>33].name, (int32_t)a[i].x, "+-"[a[i].x>>63], (int32_t)a[i].y, (int32_t)(a[i].y>>32&0xff),
i == regs[j].as? 0 : ((int32_t)a[i].y - (int32_t)a[i-1].y) - ((int32_t)a[i].x - (int32_t)a[i-1].x));
if (!(opt->flag & MM_F_AVA)) { // don't choose primary mapping(s) for read overlap
mm_set_parent(b->km, opt->mask_level, *n_regs, regs);
mm_select_sub(b->km, opt->mask_level, opt->pri_ratio, mi->k*2, opt->best_n, n_regs, regs);
if (!(opt->flag & MM_F_SPLICE))
mm_join_long(b->km, opt, qlen, n_regs, regs, a); // TODO: this can be applied to all-vs-all in principle
static void chain_post(const mm_mapopt_t *opt, int max_chain_gap_ref, const mm_idx_t *mi, void *km, int qlen, int n_segs, const int *qlens, int *n_regs, mm_reg1_t *regs, mm128_t *a)
{
if (!(opt->flag & MM_F_ALL_CHAINS)) { // don't choose primary mapping(s)
mm_set_parent(km, opt->mask_level, opt->mask_len, *n_regs, regs, opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL, opt->alt_drop);
if (n_segs <= 1) mm_select_sub(km, opt->pri_ratio, mi->k*2, opt->best_n, 1, opt->max_gap * 0.8, n_regs, regs);
else mm_select_sub_multi(km, opt->pri_ratio, 0.2f, 0.7f, max_chain_gap_ref, mi->k*2, opt->best_n, n_segs, qlens, n_regs, regs);
}
if (opt->flag & MM_F_CIGAR) {
regs = mm_align_skeleton(b->km, opt, mi, qlen, seq, n_regs, regs, a); // this calls mm_filter_regs()
if (!(opt->flag & MM_F_AVA)) {
mm_set_parent(b->km, opt->mask_level, *n_regs, regs);
mm_select_sub(b->km, opt->mask_level, opt->pri_ratio, mi->k*2, opt->best_n, n_regs, regs);
mm_set_sam_pri(*n_regs, regs);
}
}
mm_set_mapq(*n_regs, regs, opt->min_chain_score);
}
// free
kfree(b->km, a);
kfree(b->km, u);
static mm_reg1_t *align_regs(const mm_mapopt_t *opt, const mm_idx_t *mi, void *km, int qlen, const char *seq, int *n_regs, mm_reg1_t *regs, mm128_t *a)
{
if (!(opt->flag & MM_F_CIGAR)) return regs;
regs = mm_align_skeleton(km, opt, mi, qlen, seq, n_regs, regs, a); // this calls mm_filter_regs()
if (!(opt->flag & MM_F_ALL_CHAINS)) { // don't choose primary mapping(s)
mm_set_parent(km, opt->mask_level, opt->mask_len, *n_regs, regs, opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL, opt->alt_drop);
mm_select_sub(km, opt->pri_ratio, mi->k*2, opt->best_n, 0, opt->max_gap * 0.8, n_regs, regs);
mm_set_sam_pri(*n_regs, regs);
}
return regs;
}
mm_reg1_t *mm_map(const mm_idx_t *mi, int l_seq, const char *seq, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname)
void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, int *n_regs, mm_reg1_t **regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname)
{
int i, j, rep_len, qlen_sum, n_regs0, n_mini_pos;
int max_chain_gap_qry, max_chain_gap_ref, is_splice = !!(opt->flag & MM_F_SPLICE), is_sr = !!(opt->flag & MM_F_SR);
uint32_t hash;
int64_t n_a;
uint64_t *u, *mini_pos;
mm128_t *a;
mm128_v mv = {0,0,0};
mm_reg1_t *regs0;
km_stat_t kmst;
float chn_pen_gap, chn_pen_skip;
for (i = 0, qlen_sum = 0; i < n_segs; ++i)
qlen_sum += qlens[i], n_regs[i] = 0, regs[i] = 0;
if (qlen_sum == 0 || n_segs <= 0 || n_segs > MM_MAX_SEG) return;
if (opt->max_qlen > 0 && qlen_sum > opt->max_qlen) return;
hash = qname && !(opt->flag & MM_F_NO_HASH_NAME)? __ac_X31_hash_string(qname) : 0;
hash ^= __ac_Wang_hash(qlen_sum) + __ac_Wang_hash(opt->seed);
hash = __ac_Wang_hash(hash);
collect_minimizers(b->km, opt, mi, n_segs, qlens, seqs, &mv);
if (opt->q_occ_frac > 0.0f) mm_seed_mz_flt(b->km, &mv, opt->mid_occ, opt->q_occ_frac);
if (opt->flag & MM_F_HEAP_SORT) a = collect_seed_hits_heap(b->km, opt, opt->mid_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
else a = collect_seed_hits(b->km, opt, opt->mid_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
if (mm_dbg_flag & MM_DBG_PRINT_SEED) {
fprintf(stderr, "RS\t%d\n", rep_len);
for (i = 0; i < n_a; ++i)
fprintf(stderr, "SD\t%s\t%d\t%c\t%d\t%d\t%d\n", mi->seq[a[i].x<<1>>33].name, (int32_t)a[i].x, "+-"[a[i].x>>63], (int32_t)a[i].y, (int32_t)(a[i].y>>32&0xff),
i == 0? 0 : ((int32_t)a[i].y - (int32_t)a[i-1].y) - ((int32_t)a[i].x - (int32_t)a[i-1].x));
}
// set max chaining gap on the query and the reference sequence
if (is_sr)
max_chain_gap_qry = qlen_sum > opt->max_gap? qlen_sum : opt->max_gap;
else max_chain_gap_qry = opt->max_gap;
if (opt->max_gap_ref > 0) {
max_chain_gap_ref = opt->max_gap_ref; // always honor mm_mapopt_t::max_gap_ref if set
} else if (opt->max_frag_len > 0) {
max_chain_gap_ref = opt->max_frag_len - qlen_sum;
if (max_chain_gap_ref < opt->max_gap) max_chain_gap_ref = opt->max_gap;
} else max_chain_gap_ref = opt->max_gap;
chn_pen_gap = opt->chain_gap_scale * 0.01 * mi->k;
chn_pen_skip = opt->chain_skip_scale * 0.01 * mi->k;
if (opt->flag & MM_F_RMQ) {
a = mg_lchain_rmq(opt->max_gap, opt->rmq_inner_dist, opt->bw, opt->max_chain_skip, opt->rmq_size_cap, opt->min_cnt, opt->min_chain_score,
chn_pen_gap, chn_pen_skip, n_a, a, &n_regs0, &u, b->km);
} else {
a = mg_lchain_dp(max_chain_gap_ref, max_chain_gap_qry, opt->bw, opt->max_chain_skip, opt->max_chain_iter, opt->min_cnt, opt->min_chain_score,
chn_pen_gap, chn_pen_skip, is_splice, n_segs, n_a, a, &n_regs0, &u, b->km);
}
if (opt->bw_long > opt->bw && (opt->flag & (MM_F_SPLICE|MM_F_SR|MM_F_NO_LJOIN)) == 0 && n_segs == 1 && n_regs0 > 1) { // re-chain/long-join for long sequences
int32_t st = (int32_t)a[0].y, en = (int32_t)a[(int32_t)u[0] - 1].y;
if (qlen_sum - (en - st) > opt->rmq_rescue_size || en - st > qlen_sum * opt->rmq_rescue_ratio) {
int32_t i;
for (i = 0, n_a = 0; i < n_regs0; ++i) n_a += (int32_t)u[i];
kfree(b->km, u);
radix_sort_128x(a, a + n_a);
a = mg_lchain_rmq(opt->max_gap, opt->rmq_inner_dist, opt->bw_long, opt->max_chain_skip, opt->rmq_size_cap, opt->min_cnt, opt->min_chain_score,
chn_pen_gap, chn_pen_skip, n_a, a, &n_regs0, &u, b->km);
}
} else if (opt->max_occ > opt->mid_occ && rep_len > 0 && !(opt->flag & MM_F_RMQ)) { // re-chain, mostly for short reads
int rechain = 0;
if (n_regs0 > 0) { // test if the best chain has all the segments
int n_chained_segs = 1, max = 0, max_i = -1, max_off = -1, off = 0;
for (i = 0; i < n_regs0; ++i) { // find the best chain
if (max < (int)(u[i]>>32)) max = u[i]>>32, max_i = i, max_off = off;
off += (uint32_t)u[i];
}
for (i = 1; i < (int32_t)u[max_i]; ++i) // count the number of segments in the best chain
if ((a[max_off+i].y&MM_SEED_SEG_MASK) != (a[max_off+i-1].y&MM_SEED_SEG_MASK))
++n_chained_segs;
if (n_chained_segs < n_segs)
rechain = 1;
} else rechain = 1;
if (rechain) { // redo chaining with a higher max_occ threshold
kfree(b->km, a);
kfree(b->km, u);
kfree(b->km, mini_pos);
if (opt->flag & MM_F_HEAP_SORT) a = collect_seed_hits_heap(b->km, opt, opt->max_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
else a = collect_seed_hits(b->km, opt, opt->max_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
a = mg_lchain_dp(max_chain_gap_ref, max_chain_gap_qry, opt->bw, opt->max_chain_skip, opt->max_chain_iter, opt->min_cnt, opt->min_chain_score,
chn_pen_gap, chn_pen_skip, is_splice, n_segs, n_a, a, &n_regs0, &u, b->km);
}
}
b->frag_gap = max_chain_gap_ref;
b->rep_len = rep_len;
regs0 = mm_gen_regs(b->km, hash, qlen_sum, n_regs0, u, a, !!(opt->flag&MM_F_QSTRAND));
if (mi->n_alt) {
mm_mark_alt(mi, n_regs0, regs0);
mm_hit_sort(b->km, &n_regs0, regs0, opt->alt_drop); // this step can be merged into mm_gen_regs(); will do if this shows up in profile
}
if (mm_dbg_flag & (MM_DBG_PRINT_SEED|MM_DBG_PRINT_CHAIN))
for (j = 0; j < n_regs0; ++j)
for (i = regs0[j].as; i < regs0[j].as + regs0[j].cnt; ++i)
fprintf(stderr, "CN\t%d\t%s\t%d\t%c\t%d\t%d\t%d\n", j, mi->seq[a[i].x<<1>>33].name, (int32_t)a[i].x, "+-"[a[i].x>>63], (int32_t)a[i].y, (int32_t)(a[i].y>>32&0xff),
i == regs0[j].as? 0 : ((int32_t)a[i].y - (int32_t)a[i-1].y) - ((int32_t)a[i].x - (int32_t)a[i-1].x));
chain_post(opt, max_chain_gap_ref, mi, b->km, qlen_sum, n_segs, qlens, &n_regs0, regs0, a);
if (!is_sr && !(opt->flag&MM_F_QSTRAND)) {
mm_est_err(mi, qlen_sum, n_regs0, regs0, a, n_mini_pos, mini_pos);
n_regs0 = mm_filter_strand_retained(n_regs0, regs0);
}
if (n_segs == 1) { // uni-segment
regs0 = align_regs(opt, mi, b->km, qlens[0], seqs[0], &n_regs0, regs0, a);
regs0 = (mm_reg1_t*)realloc(regs0, sizeof(*regs0) * n_regs0);
mm_set_mapq(b->km, n_regs0, regs0, opt->min_chain_score, opt->a, rep_len, is_sr);
n_regs[0] = n_regs0, regs[0] = regs0;
} else { // multi-segment
mm_seg_t *seg;
seg = mm_seg_gen(b->km, hash, n_segs, qlens, n_regs0, regs0, n_regs, regs, a); // split fragment chain to separate segment chains
free(regs0);
for (i = 0; i < n_segs; ++i) {
mm_set_parent(b->km, opt->mask_level, opt->mask_len, n_regs[i], regs[i], opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL, opt->alt_drop); // update mm_reg1_t::parent
regs[i] = align_regs(opt, mi, b->km, qlens[i], seqs[i], &n_regs[i], regs[i], seg[i].a);
mm_set_mapq(b->km, n_regs[i], regs[i], opt->min_chain_score, opt->a, rep_len, is_sr);
}
mm_seg_free(b->km, n_segs, seg);
if (n_segs == 2 && opt->pe_ori >= 0 && (opt->flag&MM_F_CIGAR))
mm_pair(b->km, max_chain_gap_ref, opt->pe_bonus, opt->a * 2 + opt->b, opt->a, qlens, n_regs, regs); // pairing
}
kfree(b->km, mv.a);
kfree(b->km, a);
kfree(b->km, u);
kfree(b->km, mini_pos);
if (b->km) {
km_stat(b->km, &kmst);
if (mm_dbg_flag & MM_DBG_PRINT_QNAME)
fprintf(stderr, "QM\t%s\t%d\tcap=%ld,nCore=%ld,largest=%ld\n", qname, qlen_sum, kmst.capacity, kmst.n_cores, kmst.largest);
assert(kmst.n_blocks == kmst.n_cores); // otherwise, there is a memory leak
if (kmst.largest > 1U<<28 || (opt->cap_kalloc > 0 && kmst.capacity > opt->cap_kalloc)) {
if (mm_dbg_flag & MM_DBG_PRINT_QNAME)
fprintf(stderr, "[W::%s] reset thread-local memory after read %s\n", __func__, qname);
km_destroy(b->km);
b->km = km_init();
}
}
}
mm_reg1_t *mm_map(const mm_idx_t *mi, int qlen, const char *seq, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname)
{
mm_reg1_t *regs;
b->mini.n = 0;
mm_sketch(b->km, seq, l_seq, mi->w, mi->k, 0, mi->is_hpc, &b->mini);
if (opt->sdust_thres > 0)
mm_dust_minier(&b->mini, l_seq, seq, opt->sdust_thres, b->sdb);
regs = mm_map_frag(opt, mi, b, 0, b->mini.n, qname, l_seq, seq, n_regs);
mm_map_frag(mi, 1, &qlen, &seq, n_regs, &regs, b, opt, qname);
return regs;
}
@@ -295,39 +390,151 @@ mm_reg1_t *mm_map(const mm_idx_t *mi, int l_seq, const char *seq, int *n_regs, m
**************************/
typedef struct {
int mini_batch_size, n_processed, n_threads;
int n_processed, n_threads, n_fp;
int64_t mini_batch_size;
const mm_mapopt_t *opt;
mm_bseq_file_t *fp;
mm_bseq_file_t **fp;
const mm_idx_t *mi;
kstring_t str;
int n_parts;
uint32_t *rid_shift;
FILE *fp_split, **fp_parts;
} pipeline_t;
typedef struct {
const pipeline_t *p;
int n_seq;
int n_seq, n_frag;
mm_bseq1_t *seq;
int *n_reg;
int *n_reg, *seg_off, *n_seg, *rep_len, *frag_gap;
mm_reg1_t **reg;
mm_tbuf_t **buf;
} step_t;
static void worker_for(void *_data, long i, int tid) // kt_for() callback
{
step_t *step = (step_t*)_data;
step_t *s = (step_t*)_data;
int qlens[MM_MAX_SEG], j, off = s->seg_off[i], pe_ori = s->p->opt->pe_ori;
const char *qseqs[MM_MAX_SEG];
double t = 0.0;
mm_tbuf_t *b = s->buf[tid];
assert(s->n_seg[i] <= MM_MAX_SEG);
if (mm_dbg_flag & MM_DBG_PRINT_QNAME) {
fprintf(stderr, "QR\t%s\t%d\t%d\n", s->seq[off].name, tid, s->seq[off].l_seq);
t = realtime();
}
for (j = 0; j < s->n_seg[i]; ++j) {
if (s->n_seg[i] == 2 && ((j == 0 && (pe_ori>>1&1)) || (j == 1 && (pe_ori&1))))
mm_revcomp_bseq(&s->seq[off + j]);
qlens[j] = s->seq[off + j].l_seq;
qseqs[j] = s->seq[off + j].seq;
}
if (s->p->opt->flag & MM_F_INDEPEND_SEG) {
for (j = 0; j < s->n_seg[i]; ++j) {
mm_map_frag(s->p->mi, 1, &qlens[j], &qseqs[j], &s->n_reg[off+j], &s->reg[off+j], b, s->p->opt, s->seq[off+j].name);
s->rep_len[off + j] = b->rep_len;
s->frag_gap[off + j] = b->frag_gap;
}
} else {
mm_map_frag(s->p->mi, s->n_seg[i], qlens, qseqs, &s->n_reg[off], &s->reg[off], b, s->p->opt, s->seq[off].name);
for (j = 0; j < s->n_seg[i]; ++j) {
s->rep_len[off + j] = b->rep_len;
s->frag_gap[off + j] = b->frag_gap;
}
}
for (j = 0; j < s->n_seg[i]; ++j) // flip the query strand and coordinate to the original read strand
if (s->n_seg[i] == 2 && ((j == 0 && (pe_ori>>1&1)) || (j == 1 && (pe_ori&1)))) {
int k, t;
mm_revcomp_bseq(&s->seq[off + j]);
for (k = 0; k < s->n_reg[off + j]; ++k) {
mm_reg1_t *r = &s->reg[off + j][k];
t = r->qs;
r->qs = qlens[j] - r->qe;
r->qe = qlens[j] - t;
r->rev = !r->rev;
}
}
if (mm_dbg_flag & MM_DBG_PRINT_QNAME)
fprintf(stderr, "QR\t%s\t%d\n", step->seq[i].name, tid);
step->reg[i] = mm_map(step->p->mi, step->seq[i].l_seq, step->seq[i].seq, &step->n_reg[i], step->buf[tid], step->p->opt, step->seq[i].name);
fprintf(stderr, "QT\t%s\t%d\t%.6f\n", s->seq[off].name, tid, realtime() - t);
}
static void merge_hits(step_t *s)
{
int f, i, k0, k, max_seg = 0, *n_reg_part, *rep_len_part, *frag_gap_part, *qlens;
void *km;
FILE **fp = s->p->fp_parts;
const mm_mapopt_t *opt = s->p->opt;
km = km_init();
for (f = 0; f < s->n_frag; ++f)
max_seg = max_seg > s->n_seg[f]? max_seg : s->n_seg[f];
qlens = CALLOC(int, max_seg + s->p->n_parts * 3);
n_reg_part = qlens + max_seg;
rep_len_part = n_reg_part + s->p->n_parts;
frag_gap_part = rep_len_part + s->p->n_parts;
for (f = 0, k = k0 = 0; f < s->n_frag; ++f) {
k0 = k;
for (i = 0; i < s->n_seg[f]; ++i, ++k) {
int j, l, t, rep_len = 0;
qlens[i] = s->seq[k].l_seq;
for (j = 0, s->n_reg[k] = 0; j < s->p->n_parts; ++j) {
mm_err_fread(&n_reg_part[j], sizeof(int), 1, fp[j]);
mm_err_fread(&rep_len_part[j], sizeof(int), 1, fp[j]);
mm_err_fread(&frag_gap_part[j], sizeof(int), 1, fp[j]);
s->n_reg[k] += n_reg_part[j];
if (rep_len < rep_len_part[j])
rep_len = rep_len_part[j];
}
s->reg[k] = CALLOC(mm_reg1_t, s->n_reg[k]);
for (j = 0, l = 0; j < s->p->n_parts; ++j) {
for (t = 0; t < n_reg_part[j]; ++t, ++l) {
mm_reg1_t *r = &s->reg[k][l];
uint32_t capacity;
mm_err_fread(r, sizeof(mm_reg1_t), 1, fp[j]);
r->rid += s->p->rid_shift[j];
if (opt->flag & MM_F_CIGAR) {
mm_err_fread(&capacity, 4, 1, fp[j]);
r->p = (mm_extra_t*)calloc(capacity, 4);
r->p->capacity = capacity;
mm_err_fread(r->p, r->p->capacity, 4, fp[j]);
}
}
}
if (!(opt->flag&MM_F_SR) && s->seq[k].l_seq >= opt->rank_min_len)
mm_update_dp_max(s->seq[k].l_seq, s->n_reg[k], s->reg[k], opt->rank_frac, opt->a, opt->b);
for (j = 0; j < s->n_reg[k]; ++j) {
mm_reg1_t *r = &s->reg[k][j];
if (r->p) r->p->dp_max2 = 0; // reset ->dp_max2 as mm_set_parent() doesn't clear it; necessary with mm_update_dp_max()
r->subsc = 0; // this may not be necessary
r->n_sub = 0; // n_sub will be an underestimate as we don't see all the chains now, but it can't be accurate anyway
}
mm_hit_sort(km, &s->n_reg[k], s->reg[k], opt->alt_drop);
mm_set_parent(km, opt->mask_level, opt->mask_len, s->n_reg[k], s->reg[k], opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL, opt->alt_drop);
if (!(opt->flag & MM_F_ALL_CHAINS)) {
mm_select_sub(km, opt->pri_ratio, s->p->mi->k*2, opt->best_n, 0, opt->max_gap * 0.8, &s->n_reg[k], s->reg[k]);
mm_set_sam_pri(s->n_reg[k], s->reg[k]);
}
mm_set_mapq(km, s->n_reg[k], s->reg[k], opt->min_chain_score, opt->a, rep_len, !!(opt->flag & MM_F_SR));
}
if (s->n_seg[f] == 2 && opt->pe_ori >= 0 && (opt->flag&MM_F_CIGAR))
mm_pair(km, frag_gap_part[0], opt->pe_bonus, opt->a * 2 + opt->b, opt->a, qlens, &s->n_reg[k0], &s->reg[k0]);
}
free(qlens);
km_destroy(km);
}
static void *worker_pipeline(void *shared, int step, void *in)
{
int i, j;
int i, j, k;
pipeline_t *p = (pipeline_t*)shared;
if (step == 0) { // step 0: read sequences
int with_qual = (!!(p->opt->flag & MM_F_OUT_SAM) && !(p->opt->flag & MM_F_NO_QUAL));
int with_comment = !!(p->opt->flag & MM_F_COPY_COMMENT);
int frag_mode = (p->n_fp > 1 || !!(p->opt->flag & MM_F_FRAG_MODE));
step_t *s;
s = (step_t*)calloc(1, sizeof(step_t));
s->seq = mm_bseq_read(p->fp, p->mini_batch_size, with_qual, &s->n_seq);
if (p->n_fp > 1) s->seq = mm_bseq_read_frag2(p->n_fp, p->fp, p->mini_batch_size, with_qual, with_comment, &s->n_seq);
else s->seq = mm_bseq_read3(p->fp[0], p->mini_batch_size, with_qual, with_comment, frag_mode, &s->n_seq);
if (s->seq) {
s->p = p;
for (i = 0; i < s->n_seq; ++i)
@@ -335,12 +542,23 @@ static void *worker_pipeline(void *shared, int step, void *in)
s->buf = (mm_tbuf_t**)calloc(p->n_threads, sizeof(mm_tbuf_t*));
for (i = 0; i < p->n_threads; ++i)
s->buf[i] = mm_tbuf_init();
s->n_reg = (int*)calloc(s->n_seq, sizeof(int));
s->n_reg = (int*)calloc(5 * s->n_seq, sizeof(int));
s->seg_off = s->n_reg + s->n_seq; // seg_off, n_seg, rep_len and frag_gap are allocated together with n_reg
s->n_seg = s->seg_off + s->n_seq;
s->rep_len = s->n_seg + s->n_seq;
s->frag_gap = s->rep_len + s->n_seq;
s->reg = (mm_reg1_t**)calloc(s->n_seq, sizeof(mm_reg1_t*));
for (i = 1, j = 0; i <= s->n_seq; ++i)
if (i == s->n_seq || !frag_mode || !mm_qname_same(s->seq[i-1].name, s->seq[i].name)) {
s->n_seg[s->n_frag] = i - j;
s->seg_off[s->n_frag++] = j;
j = i;
}
return s;
} else free(s);
} else if (step == 1) { // step 1: map
kt_for(p->n_threads, worker_for, in, ((step_t*)in)->n_seq);
if (p->n_parts > 0) merge_hits((step_t*)in);
else kt_for(p->n_threads, worker_for, in, ((step_t*)in)->n_frag);
return in;
} else if (step == 2) { // step 2: output
void *km = 0;
@@ -349,26 +567,51 @@ static void *worker_pipeline(void *shared, int step, void *in)
for (i = 0; i < p->n_threads; ++i) mm_tbuf_destroy(s->buf[i]);
free(s->buf);
if ((p->opt->flag & MM_F_OUT_CS) && !(mm_dbg_flag & MM_DBG_NO_KALLOC)) km = km_init();
for (i = 0; i < s->n_seq; ++i) {
mm_bseq1_t *t = &s->seq[i];
for (j = 0; j < s->n_reg[i]; ++j) {
mm_reg1_t *r = &s->reg[i][j];
if (p->opt->flag & MM_F_OUT_SAM)
mm_write_sam(&p->str, mi, t, r, s->n_reg[i], s->reg[i]);
else
mm_write_paf(&p->str, mi, t, r, km, p->opt->flag);
puts(p->str.s);
for (k = 0; k < s->n_frag; ++k) {
int seg_st = s->seg_off[k], seg_en = s->seg_off[k] + s->n_seg[k];
for (i = seg_st; i < seg_en; ++i) {
mm_bseq1_t *t = &s->seq[i];
if (p->opt->split_prefix && p->n_parts == 0) { // then write to temporary files
mm_err_fwrite(&s->n_reg[i], sizeof(int), 1, p->fp_split);
mm_err_fwrite(&s->rep_len[i], sizeof(int), 1, p->fp_split);
mm_err_fwrite(&s->frag_gap[i], sizeof(int), 1, p->fp_split);
for (j = 0; j < s->n_reg[i]; ++j) {
mm_reg1_t *r = &s->reg[i][j];
mm_err_fwrite(r, sizeof(mm_reg1_t), 1, p->fp_split);
if (p->opt->flag & MM_F_CIGAR) {
mm_err_fwrite(&r->p->capacity, 4, 1, p->fp_split);
mm_err_fwrite(r->p, r->p->capacity, 4, p->fp_split);
}
}
} else if (s->n_reg[i] > 0) { // the query has at least one hit
for (j = 0; j < s->n_reg[i]; ++j) {
mm_reg1_t *r = &s->reg[i][j];
assert(!r->sam_pri || r->id == r->parent);
if ((p->opt->flag & MM_F_NO_PRINT_2ND) && r->id != r->parent)
continue;
if (p->opt->flag & MM_F_OUT_SAM)
mm_write_sam3(&p->str, mi, t, i - seg_st, j, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag, s->rep_len[i]);
else
mm_write_paf3(&p->str, mi, t, r, km, p->opt->flag, s->rep_len[i]);
mm_err_puts(p->str.s);
}
} else if ((p->opt->flag & MM_F_PAF_NO_HIT) || ((p->opt->flag & MM_F_OUT_SAM) && !(p->opt->flag & MM_F_SAM_HIT_ONLY))) { // output an empty hit, if requested
if (p->opt->flag & MM_F_OUT_SAM)
mm_write_sam3(&p->str, mi, t, i - seg_st, -1, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag, s->rep_len[i]);
else
mm_write_paf3(&p->str, mi, t, 0, 0, p->opt->flag, s->rep_len[i]);
mm_err_puts(p->str.s);
}
}
if (s->n_reg[i] == 0 && (p->opt->flag & MM_F_OUT_SAM)) {
mm_write_sam(&p->str, 0, t, 0, 0, 0);
puts(p->str.s);
for (i = seg_st; i < seg_en; ++i) {
for (j = 0; j < s->n_reg[i]; ++j) free(s->reg[i][j].p);
free(s->reg[i]);
free(s->seq[i].seq); free(s->seq[i].name);
if (s->seq[i].qual) free(s->seq[i].qual);
if (s->seq[i].comment) free(s->seq[i].comment);
}
for (j = 0; j < s->n_reg[i]; ++j) free(s->reg[i][j].p);
free(s->reg[i]);
free(s->seq[i].seq); free(s->seq[i].name);
if (s->seq[i].qual) free(s->seq[i].qual);
}
free(s->reg); free(s->n_reg); free(s->seq);
free(s->reg); free(s->n_reg); free(s->seq); // seg_off, n_seg, rep_len and frag_gap were allocated with reg; no memory leak here
km_destroy(km);
if (mm_verbose >= 3)
fprintf(stderr, "[M::%s::%.3f*%.2f] mapped %d sequences\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), s->n_seq);
@@ -377,22 +620,95 @@ static void *worker_pipeline(void *shared, int step, void *in)
return 0;
}
int mm_map_file(const mm_idx_t *idx, const char *fn, const mm_mapopt_t *opt, int n_threads, int mini_batch_size)
static mm_bseq_file_t **open_bseqs(int n, const char **fn)
{
pipeline_t pl;
memset(&pl, 0, sizeof(pipeline_t));
pl.fp = mm_bseq_open(fn);
if (pl.fp == 0) {
if (mm_verbose >= 1)
fprintf(stderr, "ERROR: failed to open file '%s'\n", fn);
return -1;
mm_bseq_file_t **fp;
int i, j;
fp = (mm_bseq_file_t**)calloc(n, sizeof(mm_bseq_file_t*));
for (i = 0; i < n; ++i) {
if ((fp[i] = mm_bseq_open(fn[i])) == 0) {
if (mm_verbose >= 1)
fprintf(stderr, "ERROR: failed to open file '%s': %s\n", fn[i], strerror(errno));
for (j = 0; j < i; ++j)
mm_bseq_close(fp[j]);
free(fp);
return 0;
}
}
return fp;
}
int mm_map_file_frag(const mm_idx_t *idx, int n_segs, const char **fn, const mm_mapopt_t *opt, int n_threads)
{
int i, pl_threads;
pipeline_t pl;
if (n_segs < 1) return -1;
memset(&pl, 0, sizeof(pipeline_t));
pl.n_fp = n_segs;
pl.fp = open_bseqs(pl.n_fp, fn);
if (pl.fp == 0) return -1;
pl.opt = opt, pl.mi = idx;
pl.n_threads = n_threads, pl.mini_batch_size = mini_batch_size;
if ((opt->flag & MM_F_OUT_SAM) && !(opt->flag & MM_F_NO_SAM_SQ))
mm_write_sam_SQ(idx);
kt_pipeline(n_threads == 1? 1 : 2, worker_pipeline, &pl, 3);
pl.n_threads = n_threads > 1? n_threads : 1;
pl.mini_batch_size = opt->mini_batch_size;
if (opt->split_prefix)
pl.fp_split = mm_split_init(opt->split_prefix, idx);
pl_threads = n_threads == 1? 1 : (opt->flag&MM_F_2_IO_THREADS)? 3 : 2;
kt_pipeline(pl_threads, worker_pipeline, &pl, 3);
free(pl.str.s);
mm_bseq_close(pl.fp);
if (pl.fp_split) fclose(pl.fp_split);
for (i = 0; i < pl.n_fp; ++i)
mm_bseq_close(pl.fp[i]);
free(pl.fp);
return 0;
}
int mm_map_file(const mm_idx_t *idx, const char *fn, const mm_mapopt_t *opt, int n_threads)
{
return mm_map_file_frag(idx, 1, &fn, opt, n_threads);
}
int mm_split_merge(int n_segs, const char **fn, const mm_mapopt_t *opt, int n_split_idx)
{
int i;
pipeline_t pl;
mm_idx_t *mi;
if (n_segs < 1 || n_split_idx < 1) return -1;
memset(&pl, 0, sizeof(pipeline_t));
pl.n_fp = n_segs;
pl.fp = open_bseqs(pl.n_fp, fn);
if (pl.fp == 0) return -1;
pl.opt = opt;
pl.mini_batch_size = opt->mini_batch_size;
pl.n_parts = n_split_idx;
pl.fp_parts = CALLOC(FILE*, pl.n_parts);
pl.rid_shift = CALLOC(uint32_t, pl.n_parts);
pl.mi = mi = mm_split_merge_prep(opt->split_prefix, n_split_idx, pl.fp_parts, pl.rid_shift);
if (pl.mi == 0) {
free(pl.fp_parts);
free(pl.rid_shift);
return -1;
}
for (i = n_split_idx - 1; i > 0; --i)
pl.rid_shift[i] = pl.rid_shift[i - 1];
for (pl.rid_shift[0] = 0, i = 1; i < n_split_idx; ++i)
pl.rid_shift[i] += pl.rid_shift[i - 1];
if (opt->flag & MM_F_OUT_SAM)
for (i = 0; i < (int32_t)pl.mi->n_seq; ++i)
printf("@SQ\tSN:%s\tLN:%d\n", pl.mi->seq[i].name, pl.mi->seq[i].len);
kt_pipeline(2, worker_pipeline, &pl, 3);
free(pl.str.s);
mm_idx_destroy(mi);
free(pl.rid_shift);
for (i = 0; i < n_split_idx; ++i)
fclose(pl.fp_parts[i]);
free(pl.fp_parts);
for (i = 0; i < pl.n_fp; ++i)
mm_bseq_close(pl.fp[i]);
free(pl.fp);
mm_split_rm_tmp(opt->split_prefix, n_split_idx);
return 0;
}
+343 -87
View File
@@ -5,147 +5,403 @@
#include <stdio.h>
#include <sys/types.h>
#define MM_IDX_DEF_B 14
#define MM_F_NO_DIAG 0x001 // no exact diagonal hit
#define MM_F_NO_DUAL 0x002 // skip pairs where query name is lexicographically larger than target name
#define MM_F_CIGAR 0x004
#define MM_F_OUT_SAM 0x008
#define MM_F_NO_QUAL 0x010
#define MM_F_OUT_CG 0x020
#define MM_F_OUT_CS 0x040
#define MM_F_SPLICE 0x080 // splice mode
#define MM_F_SPLICE_FOR 0x100 // match GT-AG
#define MM_F_SPLICE_REV 0x200 // match CT-AC, the reverse complement of GT-AG
#define MM_F_NO_LJOIN 0x400
#define MM_F_OUT_CS_LONG 0x800
#define MM_F_SR 0x1000
#define MM_F_FRAG_MODE 0x2000
#define MM_F_NO_PRINT_2ND 0x4000
#define MM_F_2_IO_THREADS 0x8000
#define MM_F_LONG_CIGAR 0x10000
#define MM_F_INDEPEND_SEG 0x20000
#define MM_F_SPLICE_FLANK 0x40000
#define MM_F_SOFTCLIP 0x80000
#define MM_F_FOR_ONLY 0x100000
#define MM_F_REV_ONLY 0x200000
#define MM_F_HEAP_SORT 0x400000
#define MM_F_ALL_CHAINS 0x800000
#define MM_F_OUT_MD 0x1000000
#define MM_F_COPY_COMMENT 0x2000000
#define MM_F_EQX 0x4000000 // use =/X instead of M
#define MM_F_PAF_NO_HIT 0x8000000 // output unmapped reads to PAF
#define MM_F_NO_END_FLT 0x10000000
#define MM_F_HARD_MLEVEL 0x20000000
#define MM_F_SAM_HIT_ONLY 0x40000000
#define MM_F_RMQ (0x80000000LL)
#define MM_F_QSTRAND (0x100000000LL)
#define MM_F_NO_INV (0x200000000LL)
#define MM_F_NO_HASH_NAME (0x400000000LL)
#define MM_F_NO_SELF 0x001
#define MM_F_AVA 0x002
#define MM_F_CIGAR 0x004
#define MM_F_OUT_SAM 0x008
#define MM_F_NO_QUAL 0x010
#define MM_F_OUT_CG 0x020
#define MM_F_OUT_CS 0x040
#define MM_F_SPLICE 0x080
#define MM_F_SPLICE_FOR 0x100
#define MM_F_SPLICE_REV 0x200
#define MM_F_SPLICE_BOTH 0x400
#define MM_F_NO_SAM_SQ 0x800
#define MM_I_HPC 0x1
#define MM_I_NO_SEQ 0x2
#define MM_I_NO_NAME 0x4
#define MM_IDX_MAGIC "MMI\2"
#define MM_MAX_SEG 255
#define MM_CIGAR_MATCH 0
#define MM_CIGAR_INS 1
#define MM_CIGAR_DEL 2
#define MM_CIGAR_N_SKIP 3
#define MM_CIGAR_SOFTCLIP 4
#define MM_CIGAR_HARDCLIP 5
#define MM_CIGAR_PADDING 6
#define MM_CIGAR_EQ_MATCH 7
#define MM_CIGAR_X_MISMATCH 8
#define MM_CIGAR_STR "MIDNSHP=XB"
#ifdef __cplusplus
extern "C" {
#endif
typedef struct {
uint64_t x, y;
} mm128_t;
// emulate 128-bit integers and arrays
typedef struct { uint64_t x, y; } mm128_t;
typedef struct { size_t n, m; mm128_t *a; } mm128_v;
typedef struct { size_t n, m; uint64_t *a; } uint64_v;
typedef struct { size_t n, m; uint32_t *a; } uint32_v;
typedef struct {
mm128_v a; // (minimizer, position) array
int32_t n; // size of the _p_ array
uint64_t *p; // position array for minimizers appearing >1 times
void *h; // hash table indexing _p_ and minimizers appearing once
} mm_idx_bucket_t;
// minimap2 index
typedef struct {
char *name; // name of the db sequence
uint64_t offset; // offset in mm_idx_t::S
uint32_t len; // length
uint32_t is_alt;
} mm_idx_seq_t;
typedef struct {
int32_t b, w, k, is_hpc;
uint32_t n_seq; // number of reference sequences
mm_idx_seq_t *seq; // sequence name, length and offset
uint32_t *S; // 4-bit packed sequence
mm_idx_bucket_t *B; // index
void *km;
int32_t b, w, k, flag;
uint32_t n_seq; // number of reference sequences
int32_t index;
int32_t n_alt;
mm_idx_seq_t *seq; // sequence name, length and offset
uint32_t *S; // 4-bit packed sequence
struct mm_idx_bucket_s *B; // index (hidden)
struct mm_idx_intv_s *I; // intervals (hidden)
void *km, *h;
} mm_idx_t;
// minimap2 alignment
typedef struct {
uint32_t capacity;
int32_t dp_score, dp_max, dp_max2;
uint32_t blen;
uint32_t n_diff;
uint32_t n_ambi:30, trans_strand:2;
uint32_t n_cigar;
uint32_t capacity; // the capacity of cigar[]
int32_t dp_score, dp_max, dp_max2; // DP score; score of the max-scoring segment; score of the best alternate mappings
uint32_t n_ambi:30, trans_strand:2; // number of ambiguous bases; transcript strand: 0 for unknown, 1 for +, 2 for -
uint32_t n_cigar; // number of cigar operations in cigar[]
uint32_t cigar[];
} mm_extra_t;
typedef struct {
int32_t id;
uint32_t cnt:31, rev:1;
uint32_t rid:31, inv:1;
int32_t score;
int32_t qs, qe, rs, re;
int32_t parent, subsc;
int32_t as;
int32_t fuzzy_mlen, fuzzy_blen;
uint32_t mapq:8, split:2, sam_pri:1, n_sub:21; // TODO: n_sub is not used for now
int32_t id; // ID for internal uses (see also parent below)
int32_t cnt; // number of minimizers; if on the reverse strand
int32_t rid; // reference index; if this is an alignment from inversion rescue
int32_t score; // DP alignment score
int32_t qs, qe, rs, re; // query start and end; reference start and end
int32_t parent, subsc; // parent==id if primary; best alternate mapping score
int32_t as; // offset in the a[] array (for internal uses only)
int32_t mlen, blen; // seeded exact match length; seeded alignment block length
int32_t n_sub; // number of suboptimal mappings
int32_t score0; // initial chaining score (before chain merging/spliting)
uint32_t mapq:8, split:2, rev:1, inv:1, sam_pri:1, proper_frag:1, pe_thru:1, seg_split:1, seg_id:8, split_inv:1, is_alt:1, strand_retained:1, dummy:5;
uint32_t hash;
float div;
mm_extra_t *p;
} mm_reg1_t;
// indexing and mapping options
typedef struct {
float max_occ_frac;
float mid_occ_frac;
int sdust_thres; // score threshold for SDUST; 0 to disable
int flag; // see MM_F_* macros
short k, w, flag, bucket_bits;
int64_t mini_batch_size;
uint64_t batch_size;
} mm_idxopt_t;
int bw; // bandwidth
typedef struct {
int64_t flag; // see MM_F_* macros
int seed;
int sdust_thres; // score threshold for SDUST; 0 to disable
int max_qlen; // max query length
int bw, bw_long; // bandwidth
int max_gap, max_gap_ref; // break a chain if there are no minimizers in a max_gap window
int max_chain_skip;
int min_cnt;
int min_chain_score;
int max_frag_len;
int max_chain_skip, max_chain_iter;
int min_cnt; // min number of minimizers on each chain
int min_chain_score; // min chaining score
float chain_gap_scale;
float chain_skip_scale;
int rmq_size_cap, rmq_inner_dist;
int rmq_rescue_size;
float rmq_rescue_ratio;
float mask_level;
int mask_len;
float pri_ratio;
int best_n;
int best_n; // top best_n chains are subjected to DP alignment
int max_join_long, max_join_short;
int min_join_flank_sc;
float alt_drop;
int a, b, q, e, q2, e2; // matching score, mismatch, gap-open and gap-ext penalties
int noncan;
int zdrop;
int min_dp_max;
int sc_ambi; // score when one or both bases are "N"
int noncan; // cost of non-canonical splicing sites
int junc_bonus;
int zdrop, zdrop_inv; // break alignment if alignment score drops too fast along the diagonal
int end_bonus;
int min_dp_max; // drop an alignment if the score of the max scoring segment is below this threshold
int min_ksw_len;
int anchor_ext_len, anchor_ext_shift;
float max_clip_ratio; // drop an alignment if BOTH ends are clipped above this ratio
int max_occ;
int mid_occ;
int rank_min_len;
float rank_frac;
int pe_ori, pe_bonus;
float mid_occ_frac; // only used by mm_mapopt_update(); see below
float q_occ_frac;
int32_t min_mid_occ, max_mid_occ;
int32_t mid_occ; // ignore seeds with occurrences above this threshold
int32_t max_occ, max_max_occ, occ_dist;
int64_t mini_batch_size; // size of a batch of query bases to process in parallel
int64_t max_sw_mat;
int64_t cap_kalloc;
const char *split_prefix;
} mm_mapopt_t;
extern int mm_verbose, mm_dbg_flag;
extern double mm_realtime0;
// index reader
typedef struct {
int is_idx, n_parts;
int64_t idx_size;
mm_idxopt_t opt;
FILE *fp_out;
union {
struct mm_bseq_file_s *seq;
FILE *idx;
} fp;
} mm_idx_reader_t;
struct mm_tbuf_s;
// memory buffer for thread-local storage during mapping
typedef struct mm_tbuf_s mm_tbuf_t;
struct mm_bseq_file_s;
// global variables
extern int mm_verbose, mm_dbg_flag; // verbose level: 0 for no info, 1 for error, 2 for warning, 3 for message (default); debugging flag
extern double mm_realtime0; // wall-clock timer
#define mm_seq4_set(s, i, c) ((s)[(i)>>3] |= (uint32_t)(c) << (((i)&7)<<2))
#define mm_seq4_get(s, i) ((s)[(i)>>3] >> (((i)&7)<<2) & 0xf)
/**
* Set default or preset parameters
*
* @param preset NULL to set all parameters as default; otherwise apply preset to affected parameters
* @param io pointer to indexing parameters
* @param mo pointer to mapping parameters
*
* @return 0 if success; -1 if _present_ unknown
*/
int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo);
int mm_check_opt(const mm_idxopt_t *io, const mm_mapopt_t *mo);
// compute minimizers
void mm_sketch(void *km, const char *str, int len, int w, int k, uint32_t rid, int is_hpc, mm128_v *p);
/**
* Update mm_mapopt_t::mid_occ via mm_mapopt_t::mid_occ_frac
*
* If mm_mapopt_t::mid_occ is 0, this function sets it to a number such that no
* more than mm_mapopt_t::mid_occ_frac of minimizers in the index have a higher
* occurrence.
*
* @param opt mapping parameters
* @param mi minimap2 index
*/
void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi);
// minimizer indexing
mm_idx_t *mm_idx_init(int w, int k, int b, int is_hpc);
void mm_idx_destroy(mm_idx_t *mi);
mm_idx_t *mm_idx_gen(struct mm_bseq_file_s *fp, int w, int k, int b, int is_hpc, int mini_batch_size, int n_threads, uint64_t batch_size, int keep_name);
uint32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f);
void mm_idx_stat(const mm_idx_t *idx);
const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n);
int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq);
void mm_mapopt_max_intron_len(mm_mapopt_t *opt, int max_intron_len);
mm_idx_t *mm_idx_build(const char *fn, int w, int k, int is_hpc, int n_threads);
int mm_idx_is_idx(const char *fn);
/**
* Initialize an index reader
*
* @param fn index or fasta/fastq file name (this function tests the file type)
* @param opt indexing parameters
* @param fn_out if not NULL, write built index to this file
*
* @return an index reader on success; NULL if fail to open _fn_
*/
mm_idx_reader_t *mm_idx_reader_open(const char *fn, const mm_idxopt_t *opt, const char *fn_out);
// minimizer index I/O
void mm_idx_dump(FILE *fp, const mm_idx_t *mi);
/**
* Read/build an index
*
* If the input file is an index file, this function reads one part of the
* index and returns. If the input file is a sequence file (fasta or fastq),
* this function constructs the index for about mm_idxopt_t::batch_size bases.
* Importantly, for a huge collection of sequences, this function may only
* return an index for part of sequences. It needs to be repeatedly called
* to traverse the entire index/sequence file.
*
* @param r index reader
* @param n_threads number of threads for constructing index
*
* @return an index on success; NULL if reaching the end of the input file
*/
mm_idx_t *mm_idx_reader_read(mm_idx_reader_t *r, int n_threads);
/**
* Destroy/deallocate an index reader
*
* @param r index reader
*/
void mm_idx_reader_close(mm_idx_reader_t *r);
int mm_idx_reader_eof(const mm_idx_reader_t *r);
/**
* Check whether the file contains a minimap2 index
*
* @param fn file name
*
* @return the file size if fn is an index file; 0 if fn is not.
*/
int64_t mm_idx_is_idx(const char *fn);
/**
* Load a part of an index
*
* Given a uni-part index, this function loads the entire index into memory.
* Given a multi-part index, it loads one part only and places the file pointer
* at the end of that part.
*
* @param fp pointer to FILE object
*
* @return minimap2 index read from fp
*/
mm_idx_t *mm_idx_load(FILE *fp);
// mapping
void mm_mapopt_init(mm_mapopt_t *opt);
void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi);
/**
* Append an index (or one part of a full index) to file
*
* @param fp pointer to FILE object
* @param mi minimap2 index
*/
void mm_idx_dump(FILE *fp, const mm_idx_t *mi);
/**
* Create an index from strings in memory
*
* @param w minimizer window size
* @param k minimizer k-mer size
* @param is_hpc use HPC k-mer if true
* @param bucket_bits number of bits for the first level of the hash table
* @param n number of sequences
* @param seq sequences in A/C/G/T
* @param name sequence names; could be NULL
*
* @return minimap2 index
*/
mm_idx_t *mm_idx_str(int w, int k, int is_hpc, int bucket_bits, int n, const char **seq, const char **name);
/**
* Print index statistics to stderr
*
* @param mi minimap2 index
*/
void mm_idx_stat(const mm_idx_t *idx);
/**
* Destroy/deallocate an index
*
* @param r minimap2 index
*/
void mm_idx_destroy(mm_idx_t *mi);
/**
* Initialize a thread-local buffer for mapping
*
* Each mapping thread requires a buffer specific to the thread (see mm_map()
* below). The primary purpose of this buffer is to reduce frequent heap
* allocations across threads. A buffer shall not be used by two or more
* threads.
*
* @return pointer to a thread-local buffer
*/
mm_tbuf_t *mm_tbuf_init(void);
/**
* Destroy/deallocate a thread-local buffer for mapping
*
* @param b the buffer
*/
void mm_tbuf_destroy(mm_tbuf_t *b);
void *mm_tbuf_get_km(mm_tbuf_t *b);
/**
* Align a query sequence against an index
*
* This function possibly finds multiple alignments of the query sequence.
* The returned array and the mm_reg1_t::p field of each element are allocated
* with malloc().
*
* @param mi minimap2 index
* @param l_seq length of the query sequence
* @param seq the query sequence
* @param n_regs number of hits (out)
* @param b thread-local buffer; two mm_map() calls shall not use one buffer at the same time!
* @param opt mapping parameters
* @param name query name, used for all-vs-all overlapping and debugging
*
* @return an array of hits which need to be deallocated with free() together
* with mm_reg1_t::p of each element. The size is written to _n_regs_.
*/
mm_reg1_t *mm_map(const mm_idx_t *mi, int l_seq, const char *seq, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *name);
int mm_map_file(const mm_idx_t *idx, const char *fn, const mm_mapopt_t *opt, int n_threads, int tbatch_size);
void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, int *n_regs, mm_reg1_t **regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname);
/**
* Align a fasta/fastq file and print alignments to stdout
*
* @param idx minimap2 index
* @param fn fasta/fastq file name
* @param opt mapping parameters
* @param n_threads number of threads
*
* @return 0 on success; -1 if _fn_ can't be read
*/
int mm_map_file(const mm_idx_t *idx, const char *fn, const mm_mapopt_t *opt, int n_threads);
int mm_map_file_frag(const mm_idx_t *idx, int n_segs, const char **fn, const mm_mapopt_t *opt, int n_threads);
/**
* Generate the cs tag (new in 2.12)
*
* @param km memory blocks; set to NULL if unsure
* @param buf buffer to write the cs/MD tag; typicall NULL on the first call
* @param max_len max length of the buffer; typically set to 0 on the first call
* @param mi index
* @param r alignment
* @param seq query sequence
* @param no_iden true to use : instead of =
*
* @return the length of cs
*/
int mm_gen_cs(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int no_iden);
int mm_gen_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq);
// query sequence name and sequence in the minimap2 index
int mm_idx_index_name(mm_idx_t *mi);
int mm_idx_name2id(const mm_idx_t *mi, const char *name);
int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq);
int mm_idx_alt_read(mm_idx_t *mi, const char *fn);
int mm_idx_bed_read(mm_idx_t *mi, const char *fn, int read_junc);
int mm_idx_bed_junc(const mm_idx_t *mi, int32_t ctg, int32_t st, int32_t en, uint8_t *s);
// deprecated APIs for backward compatibility
void mm_mapopt_init(mm_mapopt_t *opt);
mm_idx_t *mm_idx_build(const char *fn, int w, int k, int flag, int n_threads);
#ifdef __cplusplus
}
+396 -84
View File
@@ -1,4 +1,4 @@
.TH minimap2 1 "6 September 2017" "minimap2-2.1.1-r341" "Bioinformatics tools"
.TH minimap2 1 "18 December 2021" "minimap2-2.24 (r1122)" "Bioinformatics tools"
.SH NAME
.PP
minimap2 - mapping and alignment between collections of DNA sequences
@@ -77,7 +77,7 @@ SAM format.
Minimizer k-mer length [15]
.TP
.BI -w \ INT
Minimizer window size [2/3 of k-mer length]. A minimizer is the smallest k-mer
Minimizer window size [10]. A minimizer is the smallest k-mer
in a window of w consecutive k-mers.
.TP
.B -H
@@ -99,6 +99,14 @@ multiple times to map it against each batch of target sequences.
may be ending with k/K/m/M/g/G. NB: mapping quality is incorrect given a
multi-part index.
.TP
.B --idx-no-seq
Don't store target sequences in the index. It saves disk space and memory but
the index generated with this option will not work with
.B -a
or
.BR -c .
When base-level alignment is not requested, this option is automatically applied.
.TP
.BI -d \ FILE
Save the minimizer index of
.I target.fa
@@ -113,21 +121,62 @@ provided as the target sequences, options
.BR -w ,
.B -I
will be effectively overridden by the options stored in the index file.
.TP
.BI --alt \ FILE
List of ALT contigs [null]
.TP
.BI --alt-drop \ FLOAT
Drop ALT hits by
.I FLOAT
fraction when ranking and computing mapping quality [0.15]
.SS Mapping options
.TP 10
.BI -f \ FLOAT
Ignore top
.BI -f \ FLOAT | INT1 [, INT2 ]
If fraction, ignore top
.I FLOAT
fraction of most frequent minimizers [0.0002]
fraction of most frequent minimizers [0.0002]. If integer,
ignore minimizers occuring more than
.I INT1
times.
.I INT2
is only effective in the
.B --sr
or
.B -xsr
mode, which sets the threshold for a second round of seeding.
.TP
.BI -g \ INT
Stop chain enlongation if there are no minimizers in
.IR INT -bp
[10000].
.BI -U \ INT1 [, INT2 ]
Lower and upper bounds of k-mer occurrences [10,1000000]. The final k-mer occurrence threshold is
.RI max{ INT1 ,\ min{ INT2 ,
.BR -f }}.
This option prevents excessively small or large
.B -f
estimated from the input reference. Available since r1034 and deprecating
.B --min-occ-floor
in earlier versions of minimap2.
.TP
.BI -r \ INT
Bandwidth used in chaining and DP-based alignment [1000]. This option
approximately controls the maximum gap size.
.BI --q-occ-frac \ FLOAT
Discard a query minimizer if its occurrence is higher than
.I FLOAT
fraction of query minimizers and than the reference occurrence threshold
[0.01]. Set 0 to disable. Available since r1105.
.TP
.BI -e \ INT
Sample a high-frequency minimizer every
.I INT
basepairs [500].
.TP
.BI -g \ NUM
Stop chain enlongation if there are no minimizers within
.IR NUM -bp
[10k].
.TP
.BI -r \ NUM1 [, NUM2 ]
Bandwidth for chaining and base alignment [500,20k].
.I NUM1
is used for initial chaining and alignment extension;
.I NUM2
for RMQ-based re-chaining and closing gaps in alignments.
.TP
.BI -n \ INT
Discard chains consisting of
@@ -140,20 +189,42 @@ Discard chains with chaining score
[40]. Chaining score equals the approximate number of matching bases minus a
concave gap penalty. It is computed with dynamic programming.
.TP
.B -D
If query sequence name/length are identical to the target name/length, ignore
diagonal anchors. This option also reduces DP-based extension along the
diagonal.
.TP
.B -P
Retain all chains and don't attempt to set primary chains. Options
.B -p
and
.B -N
have no effect when this option is in use.
.TP
.BR --dual = yes | no
If
.BR no ,
skip query-target pairs wherein the query name is lexicographically greater
than the target name [yes]
.TP
.B -X
Perform all-vs-all mapping. In this mode, if the query sequence name is
lexicographically larger than the target sequence name, the hits between them
will be suppressed; if the query sequence name is the same as the target name,
diagonal minimizer hits will also be suppressed.
Equivalent to
.RB ' -DP
.BR --dual = no
.BR --no-long-join '.
Primarily used for all-vs-all read overlapping.
.TP
.BI -p \ FLOAT
Minimal secondary-to-primary score ratio to output secondary mappings [0.8].
Between two chains overlaping over half of the shorter chain (controled by
.BR --mask-level ),
Between two chains overlaping over half of the shorter chain (controlled by
.BR -M ),
the chain with a lower score is secondary to the chain with a higher score.
If the ratio of the scores is below
.IR FLOAT ,
the secondary chain will not be outputted or extended with DP alignment later.
This option has no effect when
.B -X
is applied.
.TP
.BI -N \ INT
Output at most
@@ -163,18 +234,93 @@ secondary alignments [5]. This option has no effect when
is applied.
.TP
.BI -G \ NUM
Maximal intron length in the splice mode [200k]. This option also changes the
bandwidth to
Maximum gap on the reference (effective with
.BR -xsplice / --splice ).
This option also changes the chaining and alignment band width to
.IR NUM .
Increasing this option slows down spliced alignment.
Increasing this option slows down spliced alignment. [200k]
.TP
.BI -F \ NUM
Maximum fragment length (aka insert size; effective with
.BR -xsr / --frag = yes )
[800]
.TP
.BI -M \ FLOAT
Mark as secondary a chain that overlaps with a better chain by
.I FLOAT
or more of the shorter chain [0.5]
.TP
.BR --rmq = no | yes
Use the minigraph chaining algorithm [no]. The minigraph algorithm is better
for aligning contigs through long INDELs.
.TP
.B --hard-mask-level
Honor option
.B -M
and disable a heurstic to save unmapped subsequences and disables
.BR --mask-len .
.TP
.BI --mask-len \ NUM
Keep an alignment if dropping it leaves an unaligned region on query longer than
.IR INT
[inf]. Effective without
.BR --hard-mask-level .
.TP
.BI --max-chain-skip \ INT
A heuristics that stops chaining early [50]. Minimap2 uses dynamic programming
A heuristics that stops chaining early [25]. Minimap2 uses dynamic programming
for chaining. The time complexity is quadratic in the number of seeds. This
option makes minimap2 exits the inner loop if it repeatedly sees seeds already
on chains. Set
.I INT
to a large number to switch off this heurstics.
.TP
.BI --max-chain-iter \ INT
Check up to
.I INT
partial chains during chaining [5000]. This is a heuristic to avoid quadratic
time complexity in the worst case.
.TP
.BI --chain-gap-scale \ FLOAT
Scale of gap cost during chaining [1.0]
.TP
.B --no-long-join
Disable the long gap patching heuristic. When this option is applied, the
maximum alignment gap is mostly controlled by
.BR -r .
.TP
.B --splice
Enable the splice alignment mode.
.TP
.B --sr
Enable short-read alignment heuristics. In the short-read mode, minimap2
applies a second round of chaining with a higher minimizer occurrence threshold
if no good chain is found. In addition, minimap2 attempts to patch gaps between
seeds with ungapped alignment.
.TP
.BI --split-prefix \ STR
Prefix to create temporary files. Typically used for a multi-part index.
.TP
.BR --frag = no | yes
Whether to enable the fragment mode [no]
.TP
.B --for-only
Only map to the forward strand of the reference sequences. For paired-end
reads in the forward-reverse orientation, the first read is mapped to forward
strand of the reference and the second read to the reverse stand.
.TP
.B --rev-only
Only map to the reverse complement strand of the reference sequences.
.TP
.BR --heap-sort = no | yes
If yes, sort anchors with heap merge, instead of radix sort. Heap merge is
faster for short reads, but slower for long reads. [no]
.TP
.B --no-pairing
Treat two reads in a pair as independent reads. The mate related fields in SAM
are still properly populated.
.TP
.B --no-hash-name
Produce the same alignment for identical sequences regardless of their sequence names.
.SS Alignment options
.TP 10
.BI -A \ INT
@@ -194,12 +340,29 @@ Gap extension penalty [2,1]. A gap of length
.I k
costs
.RI min{ O1 + k * E1 , O2 + k * E2 }.
In the splice mode, the second gap penalties are not used.
.TP
.BI -z \ INT
Break an alignment if the running score drops too quickly along the diagonal of
the DP matrix (diagonal X-drop, or Z-drop) [400]. Increasing the value improves
the contiguity of the alignment at the cost of poor alignment in the middle
(e.g. caused by a long inversion).
.BI -C \ INT
Cost for a non-canonical GT-AG splicing (effective with
.BR --splice )
[0]
.TP
.BI -z \ INT1[,INT2]
Truncate an alignment if the running alignment score drops too quickly along
the diagonal of the DP matrix (diagonal X-drop, or Z-drop) [400,200]. If the
drop of score is above
.IR INT2 ,
minimap2 will reverse complement the query in the related region and align
again to test small inversions. Minimap2 truncates alignment if there is an
inversion or the drop of score is greater than
.IR INT1 .
Decrease
.I INT2
to find small inversions at the cost of performance and false positives.
Increase
.I INT1
to improves the contiguity of alignment at the cost of poor alignment in the
middle.
.TP
.BI -s \ INT
Minimal peak DP alignment score to output [40]. The peak score is computed from
@@ -215,25 +378,125 @@ both strands;
.BR n :
no attempt to match GT-AG [n]
.TP
.BI --cost-non-gt-ag \ INT
Cost of non-canonical splicing sites [0].
.BI --end-bonus \ INT
Score bonus when alignment extends to the end of the query sequence [0].
.TP
.BI --score-N \ INT
Score of a mismatch involving ambiguous bases [1].
.TP
.BR --splice-flank = yes | no
Assume the next base to a
.B GT
donor site tends to be A/G (91% in human and 92% in mouse) and the preceding
base to a
.B AG
acceptor tends to be C/T [no].
This trend is evolutionarily conservative, all the way to S. cerevisiae
(PMID:18688272). Specifying this option generally leads to higher junction
accuracy by several percents, so it is applied by default with
.BR --splice .
However, the SIRV control does not honor this trend
(only ~60%). This option reduces accuracy. If you are benchmarking minimap2
on SIRV data, please add
.B --splice-flank=no
to the command line.
.TP
.BR --junc-bed \ FILE
Gene annotations in the BED12 format (aka 12-column BED), or intron positions
in 5-column BED. With this option, minimap2 prefers splicing in annotations.
BED12 file can be converted from GTF/GFF3 with `paftools.js gff2bed anno.gtf'
[].
.TP
.BR --junc-bonus \ INT
Score bonus for a splice donor or acceptor found in annotation (effective with
.BR --junc-bed )
[9].
.TP
.BI --end-seed-pen \ INT
Drop a terminal anchor if
.IR s <log( g )+ INT ,
where
.I s
is the local alignment score around the anchor and
.I g
the length of the terminal gap in the chain. This option is only effective
with
.BR --splice .
It helps to avoid tiny terminal exons. [6]
.TP
.B --no-end-flt
Don't filter seeds towards the ends of chains before performing base-level
alignment.
.TP
.BI --cap-sw-mem \ NUM
Skip alignment if the DP matrix size is above
.IR NUM .
Set 0 to disable [100m].
.TP
.BI --cap-kalloc \ NUM
Free thread-local kalloc memory reservoir if after the alignment the size of the reservoir above
.IR NUM .
Set 0 to disable [0].
.SS Input/output options
.TP 10
.B -a
Generate CIGAR and output alignments in the SAM format. Minimap2 outputs in PAF
by default.
.TP
.BI -o \ FILE
Output alignments to
.I FILE
[stdout].
.TP
.B -Q
Ignore base quality in the input file.
.TP
.B -L
Write CIGAR with >65535 operators at the CG tag. Older tools are unable to
convert alignments with >65535 CIGAR ops to BAM. This option makes minimap2 SAM
compatible with older tools. Newer tools recognizes this tag and reconstruct
the real CIGAR in memory.
.TP
.BI -R \ STR
SAM read group line in a format like
.B @RG\\\\tID:foo\\\\tSM:bar
[].
.TP
.B -y
Copy input FASTA/Q comments to output.
.TP
.B -c
Generate CIGAR. In PAF, the CIGAR is written to the `cg' custom tag.
.TP
.BI --cs[= STR ]
Output the
.B cs
tag.
.I STR
can be either
.I short
or
.IR long .
If no
.I STR
is given,
.I short
is assumed. [none]
.TP
.B --MD
Output the MD tag (see the SAM spec).
.TP
.B --eqx
Output =/X CIGAR operators for sequence match/mismatch.
.TP
.B -Y
In SAM output, use soft clipping for supplementary alignments.
.TP
.BI --seed \ INT
Integer seed for randomizing equally best hits. Minimap2 hashes
.I INT
and read name when choosing between equally best hits. [11]
.TP
.BI -t \ INT
Number of threads [3]. Minimap2 uses at most three threads when indexing target
sequences, and uses up to
@@ -241,27 +504,38 @@ sequences, and uses up to
threads when mapping (the extra thread is for I/O, which is frequently idle and
takes little CPU time).
.TP
.B -2
Use two I/O threads during mapping. By default, minimap2 uses one I/O thread.
When I/O is slow (e.g. piping to gzip, or reading from a slow pipe), the I/O
thread may become the bottleneck. Apply this option to use one thread for input
and another thread for output, at the cost of increased peak RAM.
.TP
.BI -K \ NUM
Number of bases loaded into memory to process in a mini-batch [200M].
Number of bases loaded into memory to process in a mini-batch [500M].
Similar to option
.BR -I ,
K/M/G/k/m/g suffix is accepted. A large
.I NUM
helps load balancing in the multi-threading mode, at the cost of increased
memory. Preset
.B ava-pb
and
.B ava-ont
use
.BR -K500m .
memory.
.TP
.BR --secondary = yes | no
Whether to output secondary alignments [yes]
.TP
.BI --max-qlen \ NUM
Filter out query sequences longer than
.IR NUM .
.TP
.B --paf-no-hit
In PAF, output unmapped queries; the strand and the reference name fields are
set to `*'. Warning: some paftools.js commands may not work with such output
for the moment.
.TP
.B --sam-hit-only
In SAM, don't output unmapped reads.
.TP
.B --version
Print version number to stdout
.TP
.B --no-sam-hdr
Don't output SAM header lines. Use this option if the index consists of
multiple parts; otherwise the SAM output is malformated due to internal header
lines.
.SS Preset options
.TP 10
.BI -x \ STR
@@ -273,59 +547,48 @@ Available
.I STR
are:
.RS
.TP 8
.B map-pb
PacBio/Oxford Nanopore read to reference mapping
.RB ( -Hk19 )
.TP
.B map10k
The same as
.B map-pb
.RB ( -Hk19 )
.TP
.TP 10
.B map-ont
Slightly more sensitive for Oxford Nanopore to reference mapping
.RB ( -k15 ).
For PacBio reads, HPC minimizers consistently leads to faster performance and
more sensitive results in comparison to normal minimizers. For Oxford Nanopore
data, normal minimizers are better, though not much. The effectiveness of HPC
is determined by the sequencing error mode.
Align noisy long reads of ~10% error rate to a reference genome. This is the
default mode.
.TP
.B map-hifi
Align PacBio high-fidelity (HiFi) reads to a reference genome
.RB ( -k19
.B -w19 -U50,500 -g10k -A1 -B4 -O6,26 -E2,1
.BR -s200 ).
.TP
.B map-pb
Align older PacBio continuous long (CLR) reads to a reference genome
.RB ( -Hk19 ).
.TP
.B asm5
Long assembly to reference mapping
.RB ( -k19
.B -w19 -A1 -B19 -O39,81 -E3,1 -s200
.BR -z200 ).
.B -w19 -U50,500 --rmq -r1k,100k -g10k -A1 -B19 -O39,81 -E3,1 -s200 -z200
.BR -N50 ).
Typically, the alignment will not extend to regions with 5% or higher sequence
divergence. Only use this preset if the average divergence is far below 5%.
.TP
.B asm10
Long assembly to reference mapping
.RB ( -k19
.B -w19 -A1 -B9 -O16,41 -E2,1 -s200
.BR -z200 ).
.B -w19 -U50,500 --rmq -r1k,100k -g10k -A1 -B9 -O16,41 -E2,1 -s200 -z200
.BR -N50 ).
Up to 10% sequence divergence.
.TP
.B ava-pb
PacBio all-vs-all overlap mapping
.RB ( -Hk19
.B -w5 -Xp0 -m100 -K500m -g10000 --max-chain-skip
.BR 25 ).
.TP
.B ava-ont
Oxford Nanopore all-vs-all overlap mapping
.RB ( -k15
.B -w5 -Xp0 -m100 -K500m -g10000 --max-chain-skip
.BR 25 ).
Similarly, the major difference from
.B ava-pb
is that this preset is not using HPC minimizers.
.B asm20
Long assembly to reference mapping
.RB ( -k19
.B -w10 -U50,500 --rmq -r1k,100k -g10k -A1 -B4 -O6,26 -E2,1 -s200 -z200
.BR -N50 ).
Up to 20% sequence divergence.
.TP
.B splice
Long-read spliced alignment
.RB ( -k15
.B -w5 --splice -g2000 -G200k -A1 -B2 -O2,32 -E1,0 -z200 -ub --cost-non-gt-ag
.BR 5 ).
.B -w5 --splice -g2k -G200k -A1 -B2 -O2,32 -E1,0 -b0 -C9 -z200 -ub --junc-bonus=9 --cap-sw-mem=0
.BR --splice-flank=yes ).
In the splice mode, 1) long deletions are taken as introns and represented as
the
.RB ` N '
@@ -333,6 +596,31 @@ CIGAR operator; 2) long insertions are disabled; 3) deletion and insertion gap
costs are different during chaining; 4) the computation of the
.RB ` ms '
tag ignores introns to demote hits to pseudogenes.
.TP
.B splice:hq
Long-read splice alignment for PacBio CCS reads
.RB ( -xsplice
.B -C5 -O6,24
.BR -B4 ).
.TP
.B sr
Short single-end reads without splicing
.RB ( -k21
.B -w11 --sr --frag=yes -A2 -B8 -O12,32 -E2,1 -b0 -r100 -p.5 -N20 -f1000,5000 -n2 -m25
.B -s40 -g100 -2K50m --heap-sort=yes
.BR --secondary=no ).
.TP
.B ava-pb
PacBio CLR all-vs-all overlap mapping
.RB ( -Hk19
.B -Xw5 -e0
.BR -m100 ).
.TP
.B ava-ont
Oxford Nanopore all-vs-all overlap mapping
.RB ( -k15
.B -Xw5 -e0 -m100
.BR -r2k ).
.RE
.SS Miscellaneous options
.TP 10
@@ -345,7 +633,7 @@ multi-threading mode.
.B --print-qname
Print query names to stderr, mostly to see which query is crashing minimap2.
.TP
.B --print-seed
.B --print-seeds
Print seed positions to stderr, for debugging only.
.SH OUTPUT FORMAT
.PP
@@ -384,15 +672,42 @@ cb | cb | cb
r | c | l .
Tag Type Description
_
tp A Type of aln: P/primary, S/secondary and I/inversion
tp A Type of aln: P/primary, S/secondary and I,i/inversion
cm i Number of minimizers on the chain
s1 i Chaining score
s2 i Chaining score of the best secondary chain
NM i Total number of mismatches and gaps in the alignment
MD Z To generate the ref sequence in the alignment
AS i DP alignment score
SA Z List of other supplementary alignments
ms i DP score of the max scoring segment in the alignment
nn i Number of ambiguous bases in the alignment
ts A Transcript strand (splice mode only)
cg Z CIGAR string (only in PAF)
cs Z Difference string
dv f Approximate per-base sequence divergence
de f Gap-compressed per-base sequence divergence
rl i Length of query regions harboring repetitive seeds
.TE
.PP
The
.B cs
tag encodes difference sequences in the short form or the entire query
.I AND
reference sequences in the long form. It consists of a series of operations:
.TS
center box;
cb | cb |cb
r | l | l .
Op Regex Description
_
= [ACGTN]+ Identical sequence (long form)
: [0-9]+ Identical sequence length
* [acgtn][acgtn] Substitution: ref to query
+ [acgtn]+ Insertion to the reference
- [acgtn]+ Deletion from the reference
~ [acgtn]{2}[0-9]+[acgtn]{2} Intron length and splice signal
.TE
.SH LIMITATIONS
@@ -403,11 +718,8 @@ where seed positions may be suboptimal. This should not be a big concern
because even the optimal alignment may be wrong in such regions.
.TP
*
Minimap2 does not work well with Illumina short reads as of now.
.TP
*
Minimap2 requires SSE2 instructions to compile. It is possible to add
non-SSE2 support, but it would make minimap2 slower by several times.
Minimap2 requires SSE2 or NEON instructions to compile. It is possible to add
non-SSE2/NEON support, but it would make minimap2 slower by several times.
.SH SEE ALSO
.PP
miniasm(1), minimap(1), bwa(1).
+51 -6
View File
@@ -1,6 +1,7 @@
#include "minimap.h"
#include <stdlib.h>
#include "mmpriv.h"
int mm_verbose = 3;
int mm_verbose = 1;
int mm_dbg_flag = 0;
double mm_realtime0;
@@ -86,26 +87,69 @@ double cputime()
return kernelModeTime + userModeTime;
}
long peakrss(void) { return 0; }
#else
#include <sys/resource.h>
#include <sys/time.h>
double cputime()
double cputime(void)
{
struct rusage r;
getrusage(RUSAGE_SELF, &r);
return r.ru_utime.tv_sec + r.ru_stime.tv_sec + 1e-6 * (r.ru_utime.tv_usec + r.ru_stime.tv_usec);
}
long peakrss(void)
{
struct rusage r;
getrusage(RUSAGE_SELF, &r);
#ifdef __linux__
return r.ru_maxrss * 1024;
#else
return r.ru_maxrss;
#endif
}
#endif /* WIN32 || _WIN32 */
double realtime()
double realtime(void)
{
struct timeval tp;
struct timezone tzp;
gettimeofday(&tp, &tzp);
gettimeofday(&tp, NULL);
return tp.tv_sec + tp.tv_usec * 1e-6;
}
void mm_err_puts(const char *str)
{
int ret;
ret = puts(str);
if (ret == EOF) {
perror("[ERROR] failed to write the results");
exit(EXIT_FAILURE);
}
}
void mm_err_fwrite(const void *p, size_t size, size_t nitems, FILE *fp)
{
int ret;
ret = fwrite(p, size, nitems, fp);
if (ret == EOF) {
perror("[ERROR] failed to write data");
exit(EXIT_FAILURE);
}
}
void mm_err_fread(void *p, size_t size, size_t nitems, FILE *fp)
{
int ret;
ret = fread(p, size, nitems, fp);
if (ret == EOF) {
perror("[ERROR] failed to read data");
exit(EXIT_FAILURE);
}
}
#include "ksort.h"
#define sort_key_128x(a) ((a).x)
@@ -115,3 +159,4 @@ KRADIX_SORT_INIT(128x, mm128_t, sort_key_128x, 8)
KRADIX_SORT_INIT(64, uint64_t, sort_key_64, 8)
KSORT_INIT_GENERIC(uint32_t)
KSORT_INIT_GENERIC(uint64_t)
+170 -19
View File
@@ -1,28 +1,179 @@
The [K8 Javascript shell][k8] is needed to run Javascripts in this directory.
Precompiled k8 binaries for Mac and Linux can be found at the [K8 release
page][k8bin].
## <a name="started"></a>Getting Started
* [paf2aln.js](paf2aln.js): convert PAF to [MAF][maf] or BLAST-like output for
eyeballing. PAF has to be generated with minimap2 option `-S`, which writes
the aligned sequences to the `cs` tag. An example:
```sh
../minimap2 -S ../test/MT-*.fa | k8 paf2aln.js /dev/stdin
```
```sh
# install minimap2
git clone https://github.com/lh3/minimap2
cd minimap2 && make
# install the k8 javascript shell
curl -L https://github.com/attractivechaos/k8/releases/download/v0.2.4/k8-0.2.4.tar.bz2 | tar -jxf -
cp k8-0.2.4/k8-`uname -s` k8 # or copy it to a directory on your $PATH
# export PATH="$PATH:`pwd`:`pwd`/misc" # run this if k8, minimap2 or paftools.js not on your $PATH
minimap2 --cs test/MT-human.fa test/MT-orang.fa | paftools.js view - # view alignment
minimap2 -c test/MT-human.fa test/MT-orang.fa | paftools.js stat - # basic alignment statistics
minimap2 -c --cs test/MT-human.fa test/MT-orang.fa \
| sort -k6,6 -k8,8n | paftools.js call -L15000 - # calling variants from asm-to-ref alignment
minimap2 -c test/MT-human.fa test/MT-orang.fa \
| paftools.js liftover -l10000 - <(echo -e "MT_orang\t2000\t5000") # liftOver
# no test data for the following examples
paftools.js junceval -e anno.gtf splice.sam > out.txt # compare splice junctions to annotations
paftools.js splice2bed anno.gtf > anno.bed # convert GTF/GFF3 to BED12
```
* [mapstat.js](mapstat.js): output basic statistics such as the number of
non-redundant mapped bases, number of split and secondary alignments and
number of long gaps. This scripts seamlessly works with both SAM and PAF.
## Table of Contents
* [sim-pbsim.js](sim-pbsim.js): convert reads simulated with [PBSIM][pbsim] to
FASTA and encode the true mapping positions to read names in a format like
`S1_33!chr1!225258409!225267761!-`.
- [Getting Started](#started)
- [Introduction](#intro)
- [Evaluation](#eval)
- [Evaluating mapping accuracy with simulated reads](#mapeval)
- [Evaluating read overlap sensitivity](#oveval)
- [Calling Variants from Assemblies](#asmvar)
* [sim-eval.js](sim-eval.js): evaluate mapping accuracy for FASTA generated
with [sim-pbsim.js](sim-pbsim.js) or [sim-mason2.js](sim-mason2.js).
## <a name="intro"></a>Introduction
* [sam2paf.js](sam2paf.js): convert SAM to PAF.
paftools.js is a script that processes alignments in the [PAF format][paf],
such as converting between formats, evaluating mapping accuracy, lifting over
BED files based on alignment, and calling variants from assembly-to-assembly
alignment. This script *requires* the [k8 Javascript shell][k8] to run. On
Linux or Mac, you can download the precompiled k8 binary with:
```sh
curl -L https://github.com/attractivechaos/k8/releases/download/v0.2.4/k8-0.2.4.tar.bz2 | tar -jxf -
cp k8-0.2.4/k8-`uname -s` $HOME/bin/k8 # assuming $HOME/bin in your $PATH
```
It is highly recommended to copy the executable `k8` to a directory on your
`$PATH` such as `/usr/bin/env` can find it. Like python scripts, once you
install `k8`, you can launch paftools.js in one of the two ways:
```sh
path/to/paftools.js # only if k8 is on your $PATH
k8 path/to/paftools.js
```
In a nutshell, paftools.js has the following commands:
```
Usage: paftools.js <command> [arguments]
Commands:
view convert PAF to BLAST-like (for eyeballing) or MAF
splice2bed convert spliced alignment in PAF/SAM to BED12
sam2paf convert SAM to PAF
delta2paf convert MUMmer's delta to PAF
gff2bed convert GTF/GFF3 to BED12
stat collect basic mapping information in PAF/SAM
liftover simplistic liftOver
call call variants from asm-to-ref alignment with the cs tag
bedcov compute the number of bases covered
mapeval evaluate mapping accuracy using mason2/PBSIM-simulated FASTQ
mason2fq convert mason2-simulated SAM to FASTQ
pbsim2fq convert PBSIM-simulated MAF to FASTQ
junceval evaluate splice junction consistency with known annotations
ov-eval evaluate read overlap sensitivity using read-to-ref mapping
```
paftools.js seamlessly reads both plain text files and gzip'd text files.
## <a name="eval"></a>Evaluation
### <a name="mapeval"></a>Evaluating mapping accuracy with simulated reads
The **pbsim2fq** command of paftools.js converts the MAF output of [pbsim][pbsim]
to FASTQ and encodes the true mapping position in the read name in a format like
`S1_33!chr1!225258409!225267761!-`. Similarly, the **mason2fq** command
converts [mason2][mason2] simulated SAM to FASTQ.
Command **mapeval** evaluates mapped SAM/PAF. Here is example output:
```
Q 60 32478 0 0.000000000 32478
Q 22 16 1 0.000030775 32494
Q 21 43 1 0.000061468 32537
Q 19 73 1 0.000091996 32610
Q 14 66 1 0.000122414 32676
Q 10 27 3 0.000214048 32703
Q 8 14 1 0.000244521 32717
Q 7 13 2 0.000305530 32730
Q 6 46 1 0.000335611 32776
Q 3 10 1 0.000366010 32786
Q 2 20 2 0.000426751 32806
Q 1 248 94 0.003267381 33054
Q 0 31 17 0.003778147 33085
U 3
```
where each Q-line gives the quality threshold, the number of reads mapped with
mapping quality equal to or greater than the threshold, number of wrong
mappings, accumulative mapping error rate and the accumulative number of
mapped reads. The U-line, if present, gives the number of unmapped reads if
they are present in the SAM file.
Suppose the reported mapping coordinate overlap with the true coordinate like
the following:
```
truth: --------------------
mapper: ----------------------
|<- l1 ->|<-- o -->|<-- l2 -->|
```
Let `r=o/(l1+o+l2)`. The reported mapping is considered correct if `r>0.1` by
default.
### <a name="oveval"></a>Evaluating read overlap sensitivity
Command **ov-eval** takes *sorted* read-to-reference alignment and read
overlaps in PAF as input, and evaluates the sensitivity. For example:
```sh
minimap2 -cx map-pb ref.fa reads.fq.gz | sort -k6,6 -k8,8n > reads-to-ref.paf
minimap2 -x ava-pb reads.fq.gz reads.fq.gz > ovlp.paf
k8 ov-eval.js reads-to-ref.paf ovlp.paf
```
## <a name="asmvar"></a>Calling Variants from Haploid Assemblies
The **call** command of paftools.js calls variants from coordinate-sorted
assembly-to-reference alignment. It calls variants from the [cs tag][cs] and
identifies confident/callable regions as those covered by exactly one contig.
Here are example command lines:
```sh
minimap2 -cx asm5 -t8 --cs ref.fa asm.fa > asm.paf # keeping this file is recommended; --cs required!
sort -k6,6 -k8,8n asm.paf > asm.srt.paf # sort by reference start coordinate
k8 paftools.js call asm.srt.paf > asm.var.txt
```
Here is sample output:
```
V chr1 2276040 2276041 1 60 c g LJII01000171.1 1217409 1217410 +
V chr1 2280409 2280410 1 60 a g LJII01000171.1 1221778 1221779 +
V chr1 2280504 2280505 1 60 a g LJII01000171.1 1221873 1221874 +
R chr1 2325140 2436340
V chr1 2325287 2325287 1 60 - ct LJII01000171.1 1272894 1272896 +
V chr1 2325642 2325644 1 60 tt - LJII01000171.1 1273251 1273251 +
V chr1 2326051 2326052 1 60 c t LJII01000171.1 1273658 1273659 +
V chr1 2326287 2326288 1 60 c t LJII01000171.1 1273894 1273895 +
```
where a line starting with `R` gives regions covered by one query contig, and a
V-line encodes a variant in the following format: chr, start, end, query depth,
mapping quality, REF allele, ALT allele, query name, query start, end and the
query orientation. Generally, you should only look at variants where column 5
is one.
By default, when calling variants, "paftools.js call" ignores alignments 50kb
or shorter; when deriving callable regions, it ignores alignments 10kb or
shorter. It uses two thresholds to avoid edge effects. These defaults are
designed for long-read assemblies. For short reads, both should be reduced.
[paf]: https://github.com/lh3/miniasm/blob/master/PAF.md
[cs]: https://github.com/lh3/minimap2#cs
[k8]: https://github.com/attractivechaos/k8
[k8bin]: https://github.com/attractivechaos/k8/releases
[maf]: https://genome.ucsc.edu/FAQ/FAQformat#format5
[pbsim]: https://github.com/pfaucon/PBSIM-PacBio-Simulator
[mason2]: https://github.com/seqan/seqan/tree/master/apps/mason2
-266
View File
@@ -1,266 +0,0 @@
/*******************************
* Command line option parsing *
*******************************/
var getopt = function(args, ostr) {
var oli; // option letter list index
if (typeof(getopt.place) == 'undefined')
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
if (getopt.place == -1) { // update scanning pointer
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
getopt.place = -1;
return null;
}
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
++getopt.ind;
getopt.place = -1;
return null;
}
}
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
if (getopt.place < 0) ++getopt.ind;
return '?';
}
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
getopt.arg = null;
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
} else { // need an argument
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
getopt.arg = args[getopt.ind].substr(getopt.place);
else if (args.length <= ++getopt.ind) { // no arg
getopt.place = -1;
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
return '?';
} else getopt.arg = args[getopt.ind]; // white space
getopt.place = -1;
++getopt.ind;
}
return optopt;
}
/***********************
* Interval operations *
***********************/
Interval = {};
Interval.sort = function(a)
{
if (typeof a[0] == 'number')
a.sort(function(x, y) { return x - y });
else a.sort(function(x, y) { return x[0] != y[0]? x[0] - y[0] : x[1] - y[1] });
}
Interval.merge = function(a, sorted)
{
if (typeof sorted == 'undefined') sorted = true;
if (!sorted) Interval.sort(a);
var k = 0;
for (var i = 1; i < a.length; ++i) {
if (a[k][1] >= a[i][0])
a[k][1] = a[k][1] > a[i][1]? a[k][1] : a[i][1];
else a[++k] = a[i].slice(0);
}
a.length = k + 1;
}
Interval.index_end = function(a, sorted)
{
if (a.length == 0) return;
if (typeof sorted == 'undefined') sorted = true;
if (!sorted) Interval.sort(a);
a[0].push(0);
var k = 0, k_en = a[0][1];
for (var i = 1; i < a.length; ++i) {
if (k_en <= a[i][0]) {
for (++k; k < i; ++k)
if (a[k][1] > a[i][0])
break;
k_en = a[k][1];
}
a[i].push(k);
}
}
Interval.find_intv = function(a, x)
{
var left = -1, right = a.length;
if (typeof a[0] == 'number') {
while (right - left > 1) {
var mid = left + ((right - left) >> 1);
if (a[mid] > x) right = mid;
else if (a[mid] < x) left = mid;
else return mid;
}
} else {
while (right - left > 1) {
var mid = left + ((right - left) >> 1);
if (a[mid][0] > x) right = mid;
else if (a[mid][0] < x) left = mid;
else return mid;
}
}
return left;
}
Interval.find_ovlp = function(a, st, en)
{
if (a.length == 0 || st >= en) return [];
var l = Interval.find_intv(a, st);
var k = l < 0? 0 : a[l][a[l].length - 1];
var b = [];
for (var i = k; i < a.length; ++i) {
if (a[i][0] >= en) break;
else if (st < a[i][1])
b.push(a[i]);
}
return b;
}
/*****************
* Main function *
*****************/
var c, l_fuzzy = 0, print_ovlp = false, print_err_only = false, first_only = false;
while ((c = getopt(arguments, "l:ep")) != null) {
if (c == 'l') l_fuzzy = parseInt(getopt.arg);
else if (c == 'e') print_err_only = print_ovlp = true;
else if (c == 'p') print_ovlp = true;
}
if (arguments.length - getopt.ind < 2) {
print("Usage: k8 intron-eval.js [options] <gene.gtf> <aln.sam>");
exit(1);
}
var file, buf = new Bytes();
var tr = {};
file = new File(arguments[getopt.ind]);
while (file.readline(buf) >= 0) {
var m, t = buf.toString().split("\t");
if (t[0].charAt(0) == '#') continue;
if (t[2] != 'exon') continue;
var st = parseInt(t[3]) - 1;
var en = parseInt(t[4]);
if ((m = /transcript_id "(\S+)"/.exec(t[8])) == null) continue;
var tid = m[1];
if (tr[tid] == null) tr[tid] = [t[0], t[6], 0, 0, []];
tr[tid][4].push([st, en]);
}
file.close();
var anno = {};
for (var tid in tr) {
var t = tr[tid];
Interval.sort(t[4]);
t[2] = t[4][0][0];
t[3] = t[4][t[4].length - 1][1];
if (anno[t[0]] == null) anno[t[0]] = [];
var s = t[4];
for (var i = 0; i < s.length - 1; ++i) {
if (s[i][1] >= s[i+1][0]) throw Error("ERROR: wrong annotation!");
anno[t[0]].push([s[i][1], s[i+1][0]]);
}
}
tr = null;
for (var chr in anno) {
var e = anno[chr];
if (e.length == 0) continue;
Interval.sort(e);
var k = 0;
for (var i = 1; i < e.length; ++i) // dedup
if (e[i][0] != e[k][0] || e[i][1] != e[k][1])
e[++k] = e[i].slice(0);
e.length = k + 1;
Interval.index_end(e);
}
var n_pri = 0, n_unmapped = 0, n_mapped = 0;
var n_sgl = 0, n_splice = 0, n_splice_hit = 0, n_splice_novel = 0;
file = new File(arguments[getopt.ind+1]);
var last_qname = null;
var re_cigar = /(\d+)([MIDNSHX=])/g;
while (file.readline(buf) >= 0) {
var m, t = buf.toString().split("\t");
if (t[0].charAt(0) == '@') continue;
var flag = parseInt(t[1]);
if (flag&0x100) continue;
if (first_only && last_qname == t[0]) continue;
if (t[2] == '*') {
++n_unmapped;
continue;
} else {
++n_pri;
if (last_qname != t[0]) ++n_mapped;
}
var pos = parseInt(t[3]) - 1, intron = [];
while ((m = re_cigar.exec(t[5])) != null) {
var len = parseInt(m[1]), op = m[2];
if (op == 'N') {
intron.push([pos, pos + len]);
pos += len;
} else if (op == 'M' || op == 'X' || op == '=' || op == 'D') pos += len;
}
if (intron.length == 0) {
++n_sgl;
continue;
}
n_splice += intron.length;
var chr = anno[t[2]];
if (chr != null) {
for (var i = 0; i < intron.length; ++i) {
var o = Interval.find_ovlp(chr, intron[i][0], intron[i][1]);
if (o.length > 0) {
var hit = false;
for (var j = 0; j < o.length; ++j) {
var st_diff = intron[i][0] - o[j][0];
var en_diff = intron[i][1] - o[j][1];
if (st_diff < 0) st_diff = -st_diff;
if (en_diff < 0) en_diff = -en_diff;
if (st_diff <= l_fuzzy && en_diff <= l_fuzzy)
++n_splice_hit, hit = true;
if (hit) break;
}
if (print_ovlp) {
var type = hit? 'C' : 'P';
if (hit && print_err_only) continue;
var x = '[';
for (var j = 0; j < o.length; ++j) {
if (j) x += ', ';
x += '(' + o[j][0] + "," + o[j][1] + ')';
}
x += ']';
print(type, t[0], i+1, t[2], intron[i][0], intron[i][1], x);
}
} else {
++n_splice_novel;
if (print_ovlp)
print('N', t[0], i+1, t[2], intron[i][0], intron[i][1]);
}
}
} else {
n_splice_novel += intron.length;
}
last_qname = t[0];
}
file.close();
buf.destroy();
if (!print_ovlp) {
print("# unmapped reads: " + n_unmapped);
print("# mapped reads: " + n_mapped);
print("# primary alignments: " + n_pri);
print("# singletons: " + n_sgl);
print("# predicted introns: " + n_splice);
print("# non-overlapping introns: " + n_splice_novel);
print("# correct introns: " + n_splice_hit + " (" + (n_splice_hit / n_splice * 100).toFixed(2) + "%)");
}
-183
View File
@@ -1,183 +0,0 @@
var getopt = function(args, ostr) {
var oli; // option letter list index
if (typeof(getopt.place) == 'undefined')
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
if (getopt.place == -1) { // update scanning pointer
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
getopt.place = -1;
return null;
}
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
++getopt.ind;
getopt.place = -1;
return null;
}
}
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
if (getopt.place < 0) ++getopt.ind;
return '?';
}
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
getopt.arg = null;
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
} else { // need an argument
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
getopt.arg = args[getopt.ind].substr(getopt.place);
else if (args.length <= ++getopt.ind) { // no arg
getopt.place = -1;
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
return '?';
} else getopt.arg = args[getopt.ind]; // white space
getopt.place = -1;
++getopt.ind;
}
return optopt;
}
var c, gap_out_len = null;
while ((c = getopt(arguments, "l:")) != null)
if (c == 'l') gap_out_len = parseInt(getopt.arg);
if (getopt.ind == arguments.length) {
print("Usage: k8 mapstat.js [-l gapOutLen] <in.sam>|<in.paf>");
exit(1);
}
var buf = new Bytes();
var file = new File(arguments[getopt.ind]);
var re = /(\d+)([MIDSHNX=])/g;
var lineno = 0, n_pri = 0, n_2nd = 0, n_seq = 0, n_cigar_64k = 0, l_tot = 0, l_cov = 0;
var n_gap = [[0, 0, 0, 0, 0, 0], [0, 0, 0, 0, 0, 0]];
function cov_len(regs)
{
regs.sort(function(a,b) {return a[0]-b[0]});
var st = regs[0][0], en = regs[0][1], l = 0;
for (var i = 1; i < regs.length; ++i) {
if (regs[i][0] < en)
en = en > regs[i][1]? en : regs[i][1];
else l += en - st, st = regs[i][0], en = regs[i][1];
}
l += en - st;
return l;
}
var last = null, last_qlen = null, regs = [];
while (file.readline(buf) >= 0) {
var line = buf.toString();
++lineno;
if (line.charAt(0) != '@') {
var t = line.split("\t", 12);
var m, rs, cigar = null, is_pri = false, is_sam = false, is_rev = false, tname = null;
var atlen = null, aqlen, qs, qe, mapq, ori_qlen;
if (t[4] == '+' || t[4] == '-') { // PAF
if (!/\ts2:i:\d+/.test(line)) {
++n_2nd;
continue;
}
if ((m = /\tcg:Z:(\S+)/.exec(line)) != null)
cigar = m[1];
if (cigar == null) {
warn("WARNING: no CIGAR at line " + lineno);
continue;
}
tname = t[5];
qs = parseInt(t[2]), qe = parseInt(t[3]);
aqlen = qe - qs;
is_rev = t[4] == '+'? false : true;
rs = parseInt(t[7]);
atlen = parseInt(t[8]) - rs;
mapq = parseInt(t[11]);
ori_qlen = parseInt(t[1]);
} else { // SAM
var flag = parseInt(t[1]);
if ((flag & 4) || t[2] == '*' || t[5] == '*') continue;
if (flag & 0x100) {
++n_2nd;
continue;
}
cigar = t[5];
tname = t[2];
rs = parseInt(t[3]) - 1;
mapq = parseInt(t[4]);
aqlen = t[9].length;
is_sam = true;
is_rev = !!(flag&0x10);
}
++n_pri;
if (last != t[0]) {
if (last != null) {
l_tot += last_qlen;
l_cov += cov_len(regs);
}
regs = [];
++n_seq, last = t[0];
}
var M = 0, tl = 0, ql = 0, clip = [0, 0], n_cigar = 0, sclip = 0;
while ((m = re.exec(cigar)) != null) {
var l = parseInt(m[1]);
++n_cigar;
if (m[2] == 'M' || m[2] == '=' || m[2] == 'X') {
tl += l, ql += l, M += l;
} else if (m[2] == 'I' || m[2] == 'D') {
var type;
if (l < 50) type = 0;
else if (l < 100) type = 1;
else if (l < 300) type = 2;
else if (l < 400) type = 3;
else if (l < 1000) type = 4;
else type = 5;
if (m[2] == 'I') ql += l, ++n_gap[0][type];
else tl += l, ++n_gap[1][type];
if (gap_out_len != null && l >= gap_out_len)
print(t[0], ql, is_rev? '-' : '+', tname, rs + tl, m[2], l);
} else if (m[2] == 'N') {
tl += l;
} else if (m[2] == 'S') {
clip[M == 0? 0 : 1] = l, sclip += l;
} else if (m[2] == 'H') {
clip[M == 0? 0 : 1] = l;
}
}
if (n_cigar > 65535) ++n_cigar_64k;
if (ql + sclip != aqlen)
warn("WARNING: aligned query length is inconsistent with CIGAR at line " + lineno + " (" + (ql+sclip) + " != " + aqlen + ")");
if (atlen != null && atlen != tl)
warn("WARNING: aligned reference length is inconsistent with CIGAR at line " + lineno);
if (is_sam) {
qs = clip[is_rev? 1 : 0], qe = qs + ql;
ori_qlen = clip[0] + ql + clip[1];
}
regs.push([qs, qe]);
last_qlen = ori_qlen;
}
}
l_tot += last_qlen;
l_cov += cov_len(regs);
file.close();
buf.destroy();
if (gap_out_len == null) {
print("Number of mapped sequences: " + n_seq);
print("Number of primary alignments: " + n_pri);
print("Number of secondary alignments: " + n_2nd);
print("Number of primary alignments with >65535 CIGAR operations: " + n_cigar_64k);
print("Number of bases in mapped sequences: " + l_tot);
print("Number of mapped bases: " + l_cov);
print("Number of insertions in [0,50): " + n_gap[0][0]);
print("Number of insertions in [50,100): " + n_gap[0][1]);
print("Number of insertions in [100,300): " + n_gap[0][2]);
print("Number of insertions in [300,400): " + n_gap[0][3]);
print("Number of insertions in [400,1000): " + n_gap[0][4]);
print("Number of insertions in [1000,inf): " + n_gap[0][5]);
print("Number of deletions in [0,50): " + n_gap[1][0]);
print("Number of deletions in [50,100): " + n_gap[1][1]);
print("Number of deletions in [100,300): " + n_gap[1][2]);
print("Number of deletions in [300,400): " + n_gap[1][3]);
print("Number of deletions in [400,1000): " + n_gap[1][4]);
print("Number of deletions in [1000,inf): " + n_gap[1][5]);
}
+335
View File
@@ -0,0 +1,335 @@
#!/usr/bin/env k8
var getopt = function(args, ostr) {
var oli; // option letter list index
if (typeof(getopt.place) == 'undefined')
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
if (getopt.place == -1) { // update scanning pointer
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
getopt.place = -1;
return null;
}
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
++getopt.ind;
getopt.place = -1;
return null;
}
}
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
if (getopt.place < 0) ++getopt.ind;
return '?';
}
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
getopt.arg = null;
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
} else { // need an argument
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
getopt.arg = args[getopt.ind].substr(getopt.place);
else if (args.length <= ++getopt.ind) { // no arg
getopt.place = -1;
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
return '?';
} else getopt.arg = args[getopt.ind]; // white space
getopt.place = -1;
++getopt.ind;
}
return optopt;
}
function read_fastx(file, buf)
{
if (file.readline(buf) < 0) return null;
var m, line = buf.toString();
if ((m = /^([>@])(\S+)/.exec(line)) == null)
throw Error("wrong fastx format");
var is_fq = (m[1] == '@');
var name = m[2];
if (file.readline(buf) < 0)
throw Error("missing sequence line");
var seq = buf.toString();
if (is_fq) { // skip quality
file.readline(buf);
file.readline(buf);
}
return [name, seq];
}
function filter_paf(a, opt)
{
if (a.length == 0) return;
var k = 0;
for (var i = 0; i < a.length; ++i) {
var ai = a[i];
if (ai[10] < opt.min_blen) continue;
if (ai[9] < ai[10] * opt.min_iden) continue;
var clip = [0, 0];
if (ai[4] == '+') {
clip[0] = ai[2] < ai[7]? ai[2] : ai[7];
clip[1] = ai[1] - ai[3] < ai[6] - ai[8]? ai[1] - ai[3] : ai[6] - ai[8];
} else {
clip[0] = ai[2] < ai[6] - ai[8]? ai[2] : ai[6] - ai[8];
clip[1] = ai[1] - ai[3] < ai[7]? ai[1] - ai[3] : ai[7];
}
if (clip[0] > opt.max_clip_len || clip[1] > opt.max_clip_len) continue;
a[k++] = ai;
}
a.length = k;
}
function parse_events(t, ev, id, buf)
{
var re = /(:(\d+))|(([\+\-\*])([a-z]+))/g;
var m, cs = null;
for (var j = 12; j < t.length; ++j) {
if ((m = /^cs:Z:(\S+)/.exec(t[j])) != null) {
cs = m[1].toLowerCase();
break;
}
}
if (cs == null) {
warn("Warning: no cs tag for read '" + t[0] + "'");
return;
}
var st = t[2], en = t[3];
var x = st;
while ((m = re.exec(cs)) != null) {
var l;
if (m[2] != null) { // an identitcal match ":\d+"
l = parseInt(m[2]);
// [start, end, type, index, changed_base]
ev.push([x, x + l, 0, id]);
} else {
if (m[4] == '*') {
l = 1;
ev.push([x, x + 1, 1, id, m[5][0]]);
} else if (m[4] == '+') {
l = m[5].length;
ev.push([x, x + l, 2, id]);
} else if (m[4] == '-') {
l = 0;
ev.push([x, x, -1, id, m[5]]);
}
}
x += l;
}
if (x != en)
throw Error("inconsistent cs for read '" + t[0] + "'");
}
function find_het_sub(ev, a, opt)
{
var n = a.length, last0_i = -1, h = [], d = [];
for (var i = 0; i < n; ++i) h[i] = [], d[i] = [];
for (var i = 0; i < ev.length; ++i) {
if (ev[i][2] == 0) {
if (last0_i < 0 || ev[i][0] != ev[last0_i][0]) last0_i = i;
else if (ev[i][1] > ev[last0_i][1])
last0_i = i;
} else if (ev[i][2] == 1 && last0_i >= 0 && ev[i][0] < ev[last0_i][1]) {
if (ev[last0_i][1] - ev[last0_i][0] >= opt.min_mlen) {
if (opt.dbg_ev) print("EV", ev[last0_i].join("\t"), "|", ev[i].join("\t"));
var e0 = ev[last0_i], hl = h[e0[3]];
if (hl.length == 0 || hl[hl.length-1][0] != e0[0])
hl.push([e0[0], e0[1]]);
d[ev[i][3]].push([ev[i][0], e0[1] - e0[0]]);
}
}
}
var b = [];
for (var i = 0; i < n; ++i) {
var sh = 0, dh = 0;
for (var j = 0; j < h[i].length; ++j)
sh += h[i][j][1] - h[i][j][0];
for (var j = 0; j < d[i].length; ++j)
dh += d[i][j][1];
// [start, end, index, #consistent, lenConsistent, #conflictive, lenConflictive, identity, mlen]
b[i] = [a[i][2], a[i][3], i, h[i].length, sh, d[i].length, dh, a[i][9] / a[i][10], a[i][9]];
}
return b;
}
function flt_utg_for_ec(b, opt)
{
var k = 0;
for (var i = 0; i < b.length; ++i) {
var bi = b[i];
if (bi[4] == 0 && bi[6] == 0) b[k++] = bi; // entirely ambiguous
else if (bi[6] < (bi[4] + bi[6]) * opt.max_ratio0) b[k++] = bi;
}
b.length = k;
if (b.length == 0) return;
// find the longest contiguous segment
b.sort(function(x,y) { return x[0]-y[0] });
var st = b[0][0], en = b[0][1], max_st = 0, max_en = 0, max_max_en = en;
for (var i = 1; i < b.length; ++i) {
if (b[i][0] > en) {
if (en - st > max_en - max_st)
max_st = st, max_en = en;
st = b[i][0], en = b[i][1];
} else {
en = en > b[i][1]? en : b[i][1];
}
max_max_en = max_max_en > b[i][1]? max_max_en : b[i][1];
}
if (en - st > max_en - max_st)
max_st = st, max_en = en;
if (max_max_en != en || st != b[0][0]) {
var k = 0;
for (var i = 0; i < b.length; ++i)
if (b[i][0] < max_en && b[i][1] > max_st)
b[k++] = b[i];
b.length = k;
}
}
function flt_utg_for_bin(b, opt) // filter out alignments clearly on the wrong phase
{
var k = 0;
for (var i = 0; i < b.length; ++i) {
var bi = b[i];
if (bi[4] + bi[6] == 0 || bi[4] >= (bi[4] + bi[6]) * opt.max_ratio0) b[k++] = bi;
}
b.length = k;
}
function ec_core(b, n_a, ev, buf, ecb) // error correction
{
var intv = [];
for (var i = 0; i < n_a; ++i)
intv[i] = null;
intv[b[0][2]] = [b[0][0], b[0][1]];
var en = b[0][1];
for (var i = 1; i < b.length; ++i) {
if (b[i][1] <= en) continue;
intv[b[i][2]] = [en, b[i][1]];
en = b[i][1];
}
var k = 0;
ecb.capacity = buf.capacity;
ecb.length = 0;
for (var i = 0; i < ev.length; ++i) {
var e = ev[i], I = intv[e[3]];
if (I == null) continue;
if (e[0] >= I[0] && e[0] < I[1]) { // this is to reduce duplicated events around junctions
//print("X", e.join("\t"));
if (e[2] == 0) {
ecb.length += e[1] - e[0];
for (var j = e[0]; j < e[1]; ++j)
ecb[k++] = buf[j];
} else if (e[2] == 1) {
++ecb.length;
ecb[k++] = e[4].charCodeAt(0);
} else if (e[2] < 0) {
ecb.length += e[4].length;
for (var j = 0; j < e[4].length; ++j)
ecb[k++] = e[4].charCodeAt(j);
} // else, skip e[2] == 2
}
}
if (ecb.length != k) throw Error("BUG!");
}
function process_paf(a, opt, fp_seq, buf, ecb)
{
if (a.length == 0) return;
var len = a[0][1], name = a[0][0], seq = null;
if (len < opt.min_rlen) return;
if (fp_seq) {
var ret;
while ((ret = read_fastx(fp_seq, buf)) != null)
if (ret[0] == a[0][0])
break;
if (ret == null)
throw Error("failed to find sequence for read '" + a[0][0] + "'");
name = ret[0], seq = ret[1];
if (seq.length != len)
throw Error("inconsistent length for read '" + name + "'");
}
filter_paf(a, opt);
if (a.length == 0) return;
var ev = [];
for (var i = 0; i < a.length; ++i)
parse_events(a[i], ev, i, buf);
ev.sort(function(x,y) { return x[0]!=y[0]? x[0]-y[0] : x[2]-y[2] });
if (seq == null) print("SQ", name, a[0][1], a.length);
var b = find_het_sub(ev, a, opt);
if (opt.ec) flt_utg_for_ec(b, opt);
else flt_utg_for_bin(b, opt);
if (seq == null) {
for (var i = 0; i < b.length; ++i) {
var m, ai = a[b[i][2]], score = 0;
for (var j = 10; j < ai.length; ++j)
if ((m = /^AS:i:(\d+)/.exec(ai[j])) != null)
score = m[1];
print("TS", b[i][2], b[i][0], b[i][1], ai.slice(5, 9).join("\t"), b[i].slice(3, 7).join("\t"), score);
}
print("//");
} else { // error correction
if (b.length == 0) return;
buf.set(seq, 0);
ec_core(b, a.length, ev, buf, ecb);
print(">" + name);
print(ecb);
}
}
function main(args)
{
var c, opt = { min_rlen:5000, min_blen:5000, min_iden:0.8, min_mlen:5, max_clip_len:500, max_ratio0:0.25, dbg_ev:false };
while ((c = getopt(args, "l:b:d:m:c:r:E")) != null) {
if (c == 'l') opt.min_rlen = parseInt(getopt.arg);
else if (c == 'b') opt.min_blen = parseInt(getopt.arg);
else if (c == 'd') opt.min_iden = parseFloat(getopt.arg);
else if (c == 'm') opt.min_slen = parseInt(getopt.arg);
else if (c == 'c') opt.max_clip_len = parseInt(getopt.arg);
else if (c == 'r') opt.max_ratio0 = parseFloat(getopt.arg);
else if (c == 'E') opt.dbg_ev = true;
}
if (args.length - getopt.ind < 1) {
print("Usage: mmphase.js [options] <map-with-cs.paf> [reads.fa]");
print("Options:");
print(" -l INT min read length [" + opt.min_rlen + "]");
print(" -b INT min alignment length [" + opt.min_blen + "]");
print(" -d FLOAT min identity [" + opt.min_iden + "]");
print(" -s INT min match length [" + opt.min_mlen + "]");
print(" -c INT max clip length [" + opt.max_clip_len + "]");
print(" -r FLOAT initial ratio for haplotype filtering [" + opt.max_ratio0 + "]");
return 0;
}
opt.ec = args.length - getopt.ind < 2? false : true;
if (!opt.ec) {
print("CC");
print("CC", "SQ qName qLen nHits");
print("CC", "TS index qStart qEnd tName tLen tStart tEnd nConsistent lCons nConflictive lConf score");
print("CC");
}
var buf = new Bytes(), ecb = new Bytes();
var fp_paf = new File(args[getopt.ind]);
var fp_seq = args.length - getopt.ind >= 2? new File(args[getopt.ind+1]) : null;
var a = [];
while (fp_paf.readline(buf) >= 0) {
var t = buf.toString().split("\t");
if (a.length > 0 && a[0][0] != t[0]) {
process_paf(a, opt, fp_seq, buf, ecb);
a.length = 0;
}
for (var i = 1; i <= 3; ++i) t[i] = parseInt(t[i]);
if (t[1] < opt.min_rlen) continue;
for (var i = 6; i <= 10; ++i) t[i] = parseInt(t[i]);
if (t[10] < opt.min_blen) continue;
a.push(t);
}
if (a.length >= 0)
process_paf(a, opt, fp_seq, buf, ecb);
if (fp_seq) fp_seq.close();
fp_paf.close();
ecb.destroy();
buf.destroy();
}
var ret = main(arguments)
exit(ret)
-171
View File
@@ -1,171 +0,0 @@
var getopt = function(args, ostr) {
var oli; // option letter list index
if (typeof(getopt.place) == 'undefined')
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
if (getopt.place == -1) { // update scanning pointer
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
getopt.place = -1;
return null;
}
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
++getopt.ind;
getopt.place = -1;
return null;
}
}
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
if (getopt.place < 0) ++getopt.ind;
return '?';
}
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
getopt.arg = null;
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
} else { // need an argument
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
getopt.arg = args[getopt.ind].substr(getopt.place);
else if (args.length <= ++getopt.ind) { // no arg
getopt.place = -1;
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
return '?';
} else getopt.arg = args[getopt.ind]; // white space
getopt.place = -1;
++getopt.ind;
}
return optopt;
}
var c, maf_out = false, line_len = 80;
while ((c = getopt(arguments, "ml:")) != null) {
if (c == 'm') maf_out = true;
else if (c == 'l') line_len = parseInt(getopt.arg); // TODO: not implemented yet
}
if (line_len == 0) line_len = 0x7fffffff;
if (getopt.ind == arguments.length) {
print("Usage: k8 paf2aln.js [options] <with-cs.paf>");
print("Options:");
print(" -m MAF output (BLAST-like output by default)");
print(" -l INT line length in BLAST-like output [80]");
print("");
print("Note: this script only works when minimap2 is run with option '-S'");
exit(1);
}
function padding_str(x, len, right)
{
var s = x.toString();
if (s.length < len) {
if (right) s += Array(len - s.length + 1).join(" ");
else s = Array(len - s.length + 1).join(" ") + s;
}
return s;
}
function update_aln(s_ref, s_qry, s_mid, type, seq, slen)
{
var l = type == '*'? 1 : seq.length;
if (type == '=') {
s_ref.set(seq);
s_qry.set(seq);
s_mid.set(Array(l+1).join("|"));
slen[0] += l, slen[1] += l;
} else if (type == '*') {
s_ref.set(seq.charAt(0));
s_qry.set(seq.charAt(1));
s_mid.set(' ');
slen[0] += 1, slen[1] += 1;
} else if (type == '+') {
s_ref.set(Array(l+1).join("-"));
s_qry.set(seq);
s_mid.set(Array(l+1).join(" "));
slen[1] += l;
} else if (type == '-') {
s_ref.set(seq);
s_qry.set(Array(l+1).join("-"));
s_mid.set(Array(l+1).join(" "));
slen[0] += l;
}
}
function print_aln(rs, qs, strand, slen, elen, s_ref, s_qry, s_mid)
{
print(["Ref+:", padding_str(rs + slen[0] + 1, 10, false), s_ref.toString(), padding_str(rs + elen[0], 10, true)].join(" "));
print(" " + s_mid.toString());
var st, en;
if (strand == '+') st = qs + slen[1] + 1, en = qs + elen[1];
else st = qs - slen[1], en = qs - elen[1] + 1;
print(["Qry" + strand + ":", padding_str(st, 10, false), s_qry.toString(), padding_str(en , 10, true)].join(" "));
}
var s_ref = new Bytes(), s_qry = new Bytes(), s_mid = new Bytes();
var re = /([=\-\+\*])([A-Za-z]+)/g;
var buf = new Bytes();
var file = new File(arguments[getopt.ind]);
if (maf_out) print("##maf version=1\n");
while (file.readline(buf) >= 0) {
var m, line = buf.toString();
var t = line.split("\t", 12);
if ((m = /\tcs:Z:(\S+)/.exec(line)) == null) continue;
var cs = m[1];
s_ref.length = s_qry.length = s_mid.length = 0;
var slen = [0, 0], elen = [0, 0];
if (maf_out) {
while ((m = re.exec(cs)) != null)
update_aln(s_ref, s_qry, s_mid, m[1], m[2], elen);
if (maf_out) {
var score = (m = /\tAS:i:(\d+)/.exec(line)) != null? parseInt(m[1]) : 0;
var len = t[0].length > t[5].length? t[0].length : t[5].length;
print("a " + score);
print(["s", padding_str(t[5], len, true), padding_str(t[7], 10, false), padding_str(parseInt(t[8]) - parseInt(t[7]), 10, false),
"+", padding_str(t[6], 10, false), s_ref.toString()].join(" "));
var qs, qe, ql = parseInt(t[1]);
if (t[4] == '+') {
qs = parseInt(t[2]);
qe = parseInt(t[3]);
} else {
qs = ql - parseInt(t[3]);
qe = ql - parseInt(t[2]);
}
print(["s", padding_str(t[0], len, true), padding_str(qs, 10, false), padding_str(qe - qs, 10, false),
t[4], padding_str(ql, 10, false), s_qry.toString()].join(" "));
print("");
}
} else {
line = line.replace(/\tc[sg]:Z:\S+/g, "");
print('>' + line);
var rs = parseInt(t[7]), qs = t[4] == '+'? parseInt(t[2]) : parseInt(t[3]);
var n_blocks = 0;
while ((m = re.exec(cs)) != null) {
var start = 0, rest = m[1] == '*'? 1 : m[2].length;
while (rest > 0) {
var l_proc;
if (s_ref.length + rest >= line_len) {
l_proc = line_len - s_ref.length;
update_aln(s_ref, s_qry, s_mid, m[1], m[1] == '*'? m[2] : m[2].substr(start, l_proc), elen);
if (n_blocks > 0) print("");
print_aln(rs, qs, t[4], slen, elen, s_ref, s_qry, s_mid);
++n_blocks;
s_ref.length = s_qry.length = s_mid.length = 0;
slen[0] = elen[0], slen[1] = elen[1];
} else {
l_proc = rest;
update_aln(s_ref, s_qry, s_mid, m[1], m[1] == '*'? m[2] : m[2].substr(start, l_proc), elen);
}
rest -= l_proc, start += l_proc;
}
}
if (s_ref.length > 0) {
if (n_blocks > 0) print("");
print_aln(rs, qs, t[4], slen, elen, s_ref, s_qry, s_mid);
++n_blocks;
}
print("//");
}
}
file.close();
buf.destroy();
s_ref.destroy(); s_qry.destroy(); s_mid.destroy();
+3149
View File
File diff suppressed because it is too large Load Diff
-111
View File
@@ -1,111 +0,0 @@
var getopt = function(args, ostr) {
var oli; // option letter list index
if (typeof(getopt.place) == 'undefined')
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
if (getopt.place == -1) { // update scanning pointer
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
getopt.place = -1;
return null;
}
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
++getopt.ind;
getopt.place = -1;
return null;
}
}
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
if (getopt.place < 0) ++getopt.ind;
return '?';
}
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
getopt.arg = null;
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
} else { // need an argument
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
getopt.arg = args[getopt.ind].substr(getopt.place);
else if (args.length <= ++getopt.ind) { // no arg
getopt.place = -1;
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
return '?';
} else getopt.arg = args[getopt.ind]; // white space
getopt.place = -1;
++getopt.ind;
}
return optopt;
}
var c, pri_only = false;
while ((c = getopt(arguments, "p")) != null)
if (c == 'p') pri_only = true;
var file = arguments.length == getopt.ind? new File() : new File(arguments[getopt.ind]);
var buf = new Bytes();
var re = /(\d+)([MIDSHNX=])/g;
var len = {}, lineno = 0;
while (file.readline(buf) >= 0) {
var m, n_cigar = 0, line = buf.toString();
++lineno;
if (line.charAt(0) == '@') {
if (/^@SQ/.test(line)) {
var name = (m = /\tSN:(\S+)/.exec(line)) != null? m[1] : null;
var l = (m = /\tLN:(\d+)/.exec(line)) != null? parseInt(m[1]) : null;
if (name != null && l != null) len[name] = l;
}
continue;
}
var t = line.split("\t");
var flag = parseInt(t[1]);
if (t[9] != '*' && t[10] != '*' && t[9].length != t[10].length) throw Error("ERROR at line " + lineno + ": inconsistent SEQ and QUAL lengths - " + t[9].length + " != " + t[10].length);
if (t[2] == '*' || (flag&4)) continue;
if (pri_only && (flag&0x100)) continue;
var tlen = len[t[2]];
if (tlen == null) throw Error("ERROR at line " + lineno + ": can't find the length of contig " + t[2]);
var nn = (m = /\tnn:i:(\d+)/.exec(line)) != null? parseInt(m[1]) : 0;
var NM = (m = /\tNM:i:(\d+)/.exec(line)) != null? parseInt(m[1]) : null;
var have_NM = NM == null? false : true;
NM += nn;
var clip = [0, 0], I = [0, 0], D = [0, 0], M = 0, N = 0, ql = 0, tl = 0, mm = 0, ext_cigar = false;
while ((m = re.exec(t[5])) != null) {
var l = parseInt(m[1]);
if (m[2] == 'M') M += l, ql += l, tl += l, ext_cigar = false;
else if (m[2] == 'I') ++I[0], I[1] += l, ql += l;
else if (m[2] == 'D') ++D[0], D[1] += l, tl += l;
else if (m[2] == 'N') N += l, tl += l;
else if (m[2] == 'S') clip[M == 0? 0 : 1] = l, ql += l;
else if (m[2] == 'H') clip[M == 0? 0 : 1] = l;
else if (m[2] == '=') M += l, ql += l, tl += l, ext_cigar = true;
else if (m[2] == 'X') M += l, ql += l, tl += l, mm += l, ext_cigar = true;
++n_cigar;
}
if (n_cigar > 65535)
warn("WARNING at line " + lineno + ": " + n_cigar + " CIGAR operations");
if (tl + parseInt(t[3]) - 1 > tlen) {
warn("WARNING at line " + lineno + ": alignment end position larger than ref length; skipped");
continue;
}
if (t[9] != '*' && t[9].length != ql) {
warn("WARNING at line " + lineno + ": SEQ length inconsistent with CIGAR (" + t[9].length + " != " + ql + "); skipped");
continue;
}
if (!have_NM || ext_cigar) NM = I[1] + D[1] + mm;
if (NM < I[1] + D[1] + mm) {
warn("WARNING at line " + lineno + ": NM is less than the total number of gaps (" + NM + " < " + (I[1]+D[1]+mm) + ")");
NM = I[1] + D[1] + mm;
}
var extra = ["mm:i:"+(NM-I[1]-D[1]), "io:i:"+I[0], "in:i:"+I[1], "do:i:"+D[0], "dn:i:"+D[1]];
var match = M - (NM - I[1] - D[1]);
var blen = M + I[1] + D[1];
var qlen = M + I[1] + clip[0] + clip[1];
var qs, qe;
if (flag&16) qs = clip[1], qe = qlen - clip[0];
else qs = clip[0], qe = qlen - clip[1];
var ts = parseInt(t[3]) - 1, te = ts + M + D[1] + N;
var a = [t[0], qlen, qs, qe, flag&16? '-' : '+', t[2], tlen, ts, te, match, blen, t[4]];
print(a.join("\t"), extra.join("\t"));
}
buf.destroy();
file.close();
-191
View File
@@ -1,191 +0,0 @@
var getopt = function(args, ostr) {
var oli; // option letter list index
if (typeof(getopt.place) == 'undefined')
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
if (getopt.place == -1) { // update scanning pointer
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
getopt.place = -1;
return null;
}
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
++getopt.ind;
getopt.place = -1;
return null;
}
}
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
if (getopt.place < 0) ++getopt.ind;
return '?';
}
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
getopt.arg = null;
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
} else { // need an argument
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
getopt.arg = args[getopt.ind].substr(getopt.place);
else if (args.length <= ++getopt.ind) { // no arg
getopt.place = -1;
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
return '?';
} else getopt.arg = args[getopt.ind]; // white space
getopt.place = -1;
++getopt.ind;
}
return optopt;
}
var c, max_mapq = 60, mode = 0, err_out_q = 256, print_err = false, ovlp_ratio = 0.1, cap_short_mapq = false;
while ((c = getopt(arguments, "Q:r:m:c")) != null) {
if (c == 'Q') err_out_q = parseInt(getopt.arg), print_err = true;
else if (c == 'r') ovlp_ratio = parseFloat(getopt.arg);
else if (c == 'm') mode = parseInt(getopt.arg);
else if (c == 'c') cap_short_mapq = true;
}
var file = arguments.length == getopt.ind? new File() : new File(arguments[getopt.ind]);
var buf = new Bytes();
var tot = [], err = [];
for (var q = 0; q <= max_mapq; ++q)
tot[q] = err[q] = 0;
function is_correct(s, b)
{
if (s[0] != b[0] || s[3] != b[3]) return false;
var o, l;
if (s[1] < b[1]) {
if (s[2] <= b[1]) return false;
o = (s[2] < b[2]? s[2] : b[2]) - b[1];
l = (s[2] > b[2]? s[2] : b[2]) - s[1];
} else {
if (b[2] <= s[1]) return false;
o = (s[2] < b[2]? s[2] : b[2]) - s[1];
l = (s[2] > b[2]? s[2] : b[2]) - b[1];
}
return o/l > ovlp_ratio? true : false;
}
function count_err(qname, a, tot, err, mode)
{
if (a.length == 0) return;
var m, s;
if ((m = /^(\S+)!(\S+)!(\d+)!(\d+)!([\+\-])$/.exec(qname)) != null) { // pbsim single-end reads
s = [m[1], m[2], parseInt(m[3]), parseInt(m[4]), m[5]];
} else if ((m = /^(\S+)!(\S+)!(\d+)_(\d+)!(\d+)_(\d+)!([\+\-])([\+\-])\/([12])$/.exec(qname)) != null) { // mason2 paired-end reads
if (m[9] == '1') {
s = [m[1], m[2], parseInt(m[3]), parseInt(m[5]), m[7]];
} else {
s = [m[1], m[2], parseInt(m[4]), parseInt(m[6]), m[8]];
}
} else throw Error("Failed to parse simulated read names '" + qname + "'");
s.shift(); // skip the orginal read name
if (mode == 0 || mode == 1) { // longest only or first only
var max_i = 0;
if (mode == 0) { // longest only
var max = 0;
for (var i = 0; i < a.length; ++i)
if (a[i][5] > max)
max = a[i][5], max_i = i;
}
var mapq = a[max_i][4];
++tot[mapq];
if (!is_correct(s, a[max_i])) {
if (mapq >= err_out_q)
print('E', qname, a[max_i].join("\t"));
++err[mapq];
}
} else if (mode == 2) { // all primary mode
var max_err_mapq = -1, max_mapq = 0, max_err_i = -1;
if (cap_short_mapq) {
var max = 0, max_q = 0;
for (var i = 0; i < a.length; ++i)
if (a[i][5] > max)
max = a[i][5], max_q = a[i][4];
for (var i = 0; i < a.length; ++i)
a[i][4] = max_q < a[i][4]? max_q : a[i][4];
}
for (var i = 0; i < a.length; ++i) {
max_mapq = max_mapq > a[i][4]? max_mapq : a[i][4];
if (!is_correct(s, a[i]))
if (a[i][4] > max_err_mapq)
max_err_mapq = a[i][4], max_err_i = i;
}
if (max_err_mapq >= 0) {
++tot[max_err_mapq], ++err[max_err_mapq];
if (max_err_mapq >= err_out_q)
print('E', qname, a[max_err_i].join("\t"));
} else ++tot[max_mapq];
}
}
var lineno = 0, last = null, a = [], n_unmapped = null;
var re_cigar = /(\d+)([MIDSHN])/g;
while (file.readline(buf) >= 0) {
var m, line = buf.toString();
++lineno;
if (line[0] != '@') {
var t = line.split("\t");
if (t[4] == '+' || t[4] == '-') { // PAF
if (last != t[0]) {
if (last != null) count_err(last, a, tot, err, mode);
a = [], last = t[0];
}
if (/\ts1:i:\d+/.test(line) && !/\ts2:i:\d+/.test(line)) // secondary alignment in minimap2 PAF
continue;
var mapq = parseInt(t[11]);
if (mapq > max_mapq) mapq = max_mapq;
a.push([t[5], parseInt(t[7]), parseInt(t[8]), t[4], mapq, parseInt(t[9])]);
} else { // SAM
var flag = parseInt(t[1]);
var read_no = flag>>6&0x3;
var qname = read_no == 1 || read_no == 2? t[0] + '/' + read_no : t[0];
if (last != qname) {
if (last != null) count_err(last, a, tot, err, mode);
a = [], last = qname;
}
if (flag&0x100) continue; // secondary alignment
if ((flag&0x4) || t[2] == '*') { // unmapped
if (n_unmapped == null) n_unmapped = 0;
++n_unmapped;
continue;
}
var mapq = parseInt(t[4]);
if (mapq > max_mapq) mapq = max_mapq;
var pos = parseInt(t[3]) - 1, pos_end = pos;
var n_gap = 0, mlen = 0;
while ((m = re_cigar.exec(t[5])) != null) {
var len = parseInt(m[1]);
if (m[2] == 'M') pos_end += len, mlen += len;
else if (m[2] == 'I') n_gap += len;
else if (m[2] == 'D') n_gap += len, pos_end += len;
}
var score = pos_end - pos;
if ((m = /\tNM:i:(\d+)/.exec(line)) != null) {
var NM = parseInt(m[1]);
if (NM >= n_gap) score = mlen - (NM - n_gap);
}
a.push([t[2], pos, pos_end, (flag&16)? '-' : '+', mapq, score]);
}
}
}
if (last != null) count_err(last, a, tot, err, mode);
buf.destroy();
file.close();
var sum_tot = 0, sum_err = 0, q_out = -1, sum_tot2 = 0, sum_err2 = 0;
for (var q = max_mapq; q >= 0; --q) {
if (tot[q] == 0) continue;
if (q_out < 0 || err[q] > 0) {
if (q_out >= 0) print('Q', q_out, sum_tot, sum_err, (sum_err2/sum_tot2).toFixed(9));
sum_tot = sum_err = 0, q_out = q;
}
sum_tot += tot[q], sum_err += err[q];
sum_tot2 += tot[q], sum_err2 += err[q];
}
print('Q', q_out, sum_tot, sum_err, (sum_err2/sum_tot2).toFixed(9));
if (n_unmapped != null) print('U', n_unmapped);
-105
View File
@@ -1,105 +0,0 @@
Bytes.prototype.reverse = function()
{
for (var i = 0; i < this.length>>1; ++i) {
var tmp = this[i];
this[i] = this[this.length - i - 1];
this[this.length - i - 1] = tmp;
}
}
// reverse complement a DNA string
Bytes.prototype.revcomp = function()
{
if (Bytes.rctab == null) {
var s1 = 'WSATUGCYRKMBDHVNwsatugcyrkmbdhvn';
var s2 = 'WSTAACGRYMKVHDBNwstaacgrymkvhdbn';
Bytes.rctab = [];
for (var i = 0; i < 256; ++i) Bytes.rctab[i] = 0;
for (var i = 0; i < s1.length; ++i)
Bytes.rctab[s1.charCodeAt(i)] = s2.charCodeAt(i);
}
for (var i = 0; i < this.length>>1; ++i) {
var tmp = this[this.length - i - 1];
this[this.length - i - 1] = Bytes.rctab[this[i]];
this[i] = Bytes.rctab[tmp];
}
if (this.length&1)
this[this.length>>1] = Bytes.rctab[this[this.length>>1]];
}
if (arguments.length == 0) {
print("Usage: k8 sim-mason2.js <mason.sam>");
exit(1);
}
function print_se(a)
{
print('@' + a.slice(0, 5).join("!") + " " + a[8]);
print(a[5]);
print("+");
print(a[6]);
}
var buf = new Bytes(), buf2 = new Bytes();
var file = new File(arguments[0]);
var re = /(\d+)([MIDSHN])/g;
var last = null;
while (file.readline(buf) >= 0) {
var t = buf.toString().split("\t");
if (t[0].charAt(0) == '@') continue;
var m, l_ref = 0;
while ((m = re.exec(t[5])) != null)
if (m[2] == 'D' || m[2] == 'M' || m[2] == 'N')
l_ref += parseInt(m[1]);
var flag = parseInt(t[1]);
var rev = !!(flag&16);
var seq, qual;
if (rev) {
buf2.length = 0;
buf2.set(t[9], 0);
buf2.revcomp();
seq = buf2.toString();
buf2.set(t[10], 0);
buf2.reverse();
qual = buf2.toString();
} else seq = t[9], qual = t[10];
var qname = t[0];
qname = qname.replace(/^simulated./, "");
var chr = t[2];
var pos = parseInt(t[3]) - 1;
var strand = (flag&16)? '-' : '+';
var read_no = flag&0xc0;
if (read_no == 0x40) read_no = 1;
else if (read_no == 0x80) read_no = 2;
else read_no = 0;
var err = 0, snp = 0, indel = 0;
for (var i = 11; i < t.length; ++i) {
if ((m = /^XE:i:(\d+)/.exec(t[i])) != null) err = m[1];
else if ((m = /^XS:i:(\d+)/.exec(t[i])) != null) snp = m[1];
else if ((m = /^XI:i:(\d+)/.exec(t[i])) != null) indel = m[1];
}
var comment = [err, snp, indel].join(":");
if (last == null) {
last = [qname, chr, pos, pos + l_ref, strand, seq, qual, read_no, comment];
} else if (last[0] != qname) {
print_se(last);
last = [qname, chr, pos, pos + l_ref, strand, seq, qual, read_no, comment];
} else {
if (read_no == 2) { // last[] is the first read
if (last[7] != 1) throw Error("ERROR: can't find read1");
var name = [qname, chr, last[2] + "_" + pos, last[3] + "_" + (pos + l_ref), last[4] + strand].join("!");
print('@' + name + '/1' + ' ' + last[8]); print(last[5]); print("+"); print(last[6]);
print('@' + name + '/2' + ' ' + comment); print(seq); print("+"); print(qual);
} else {
if (last[7] != 2) throw Error("ERROR: can't find read2");
var name = [qname, chr, pos + "_" + last[2], (pos + l_ref) + "_" + last[3], strand + last[4]].join("!");
print('@' + name + '/1' + ' ' + comment); print(seq); print("+"); print(qual);
print('@' + name + '/2' + ' ' + last[8]); print(last[5]); print("+"); print(last[6]);
}
last = null;
}
}
if (last != null) print_se(last);
file.close();
buf.destroy();
buf2.destroy();
-81
View File
@@ -1,81 +0,0 @@
Bytes.prototype.reverse = function()
{
for (var i = 0; i < this.length>>1; ++i) {
var tmp = this[i];
this[i] = this[this.length - i - 1];
this[this.length - i - 1] = tmp;
}
}
// reverse complement a DNA string
Bytes.prototype.revcomp = function()
{
if (Bytes.rctab == null) {
var s1 = 'WSATUGCYRKMBDHVNwsatugcyrkmbdhvn';
var s2 = 'WSTAACGRYMKVHDBNwstaacgrymkvhdbn';
Bytes.rctab = [];
for (var i = 0; i < 256; ++i) Bytes.rctab[i] = 0;
for (var i = 0; i < s1.length; ++i)
Bytes.rctab[s1.charCodeAt(i)] = s2.charCodeAt(i);
}
for (var i = 0; i < this.length>>1; ++i) {
var tmp = this[this.length - i - 1];
this[this.length - i - 1] = Bytes.rctab[this[i]];
this[i] = Bytes.rctab[tmp];
}
if (this.length&1)
this[this.length>>1] = Bytes.rctab[this[this.length>>1]];
}
if (arguments.length < 2) {
print("Usage: k8 sim-pbsim.js <ref.fa.fai> <pbsim1.maf> [[pbsim2.maf] ...]");
exit(1);
}
var file, buf = new Bytes(), buf2 = new Bytes();
file = new File(arguments[0]);
var chr_list = [];
while (file.readline(buf) >= 0) {
var t = buf.toString().split(/\s+/);
chr_list.push(t[0]);
}
file.close();
for (var k = 1; k < arguments.length; ++k) {
var fn = arguments[k];
file = new File(fn);
var state = 0, reg;
while (file.readline(buf) >= 0) {
var line = buf.toString();
if (state == 0 && line.charAt(0) == 'a') {
state = 1;
} else if (state == 1 && line.charAt(0) == 's') {
var t = line.split(/\s+/);
var st = parseInt(t[2]);
reg = [st, st + parseInt(t[3])];
state = 2;
} else if (state == 2 && line.charAt(0) == 's') {
var m, t = line.split(/\s+/);
if ((m = /S(\d+)_\d+/.exec(t[1])) == null) throw Error("Failed to parse the read name");
var chr_id = parseInt(m[1]) - 1;
if (chr_id >= chr_list.length) throw Error("Index outside the chr list");
var name = [t[1], chr_list[chr_id], reg[0], reg[1], t[4]].join("!");
var seq = t[6].replace(/\-/g, "");
if (seq.length != parseInt(t[5])) throw Error("Inconsistent read length");
if (seq.indexOf("NN") < 0) {
if (t[4] == '-') {
buf2.set(seq, 0);
buf2.length = seq.length;
buf2.revcomp();
seq = buf2.toString();
}
print(">" + name);
print(seq);
}
state = 0;
}
}
file.close();
}
buf.destroy();
buf2.destroy();
+88 -21
View File
@@ -4,6 +4,7 @@
#include <assert.h>
#include "minimap.h"
#include "bseq.h"
#include "kseq.h"
#define MM_PARENT_UNSET (-1)
#define MM_PARENT_TMP_PRI (-2)
@@ -12,51 +13,117 @@
#define MM_DBG_PRINT_QNAME 0x2
#define MM_DBG_PRINT_SEED 0x4
#define MM_DBG_PRINT_ALN_SEQ 0x8
#define MM_DBG_PRINT_CHAIN 0x10
#define MM_SEED_LONG_JOIN (1ULL<<40)
#define MM_SEED_IGNORE (1ULL<<41)
#define MM_SEED_TANDEM (1ULL<<42)
#define MM_SEED_SELF (1ULL<<43)
#define MM_SEED_SEG_SHIFT 48
#define MM_SEED_SEG_MASK (0xffULL<<(MM_SEED_SEG_SHIFT))
#ifndef kroundup32
#define kroundup32(x) (--(x), (x)|=(x)>>1, (x)|=(x)>>2, (x)|=(x)>>4, (x)|=(x)>>8, (x)|=(x)>>16, ++(x))
#endif
#define mm_seq4_set(s, i, c) ((s)[(i)>>3] |= (uint32_t)(c) << (((i)&7)<<2))
#define mm_seq4_get(s, i) ((s)[(i)>>3] >> (((i)&7)<<2) & 0xf)
#define MALLOC(type, len) ((type*)malloc((len) * sizeof(type)))
#define CALLOC(type, len) ((type*)calloc((len), sizeof(type)))
#ifdef __cplusplus
extern "C" {
#endif
#ifndef KSTRING_T
#define KSTRING_T kstring_t
typedef struct __kstring_t {
unsigned l, m;
char *s;
} kstring_t;
#endif
typedef struct {
uint32_t n;
uint32_t q_pos;
uint32_t q_span:31, flt:1;
uint32_t seg_id:31, is_tandem:1;
const uint64_t *cr;
} mm_seed_t;
typedef struct {
int n_u, n_a;
uint64_t *u;
mm128_t *a;
} mm_seg_t;
double cputime(void);
double realtime(void);
long peakrss(void);
void radix_sort_128x(mm128_t *beg, mm128_t *end);
void radix_sort_64(uint64_t *beg, uint64_t *end);
uint32_t ks_ksmall_uint32_t(size_t n, uint32_t arr[], size_t kk);
void mm_write_sam_SQ(const mm_idx_t *idx);
void mm_write_sam_hdr_no_SQ(const char *rg, const char *ver, int argc, char *argv[]);
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int opt_flag);
void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int n_regs, const mm_reg1_t *regs);
int mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int min_cnt, int min_sc, int is_cdna, int64_t n, mm128_t *a, uint64_t **_u, void *km);
mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a);
void mm_sketch(void *km, const char *str, int len, int w, int k, uint32_t rid, int is_hpc, mm128_v *p);
mm_reg1_t *mm_gen_regs(void *km, int qlen, int n_u, uint64_t *u, mm128_t *a);
void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a);
mm_seed_t *mm_collect_matches(void *km, int *_n_m, int qlen, int max_occ, int max_max_occ, int dist, const mm_idx_t *mi, const mm128_v *mv, int64_t *n_a, int *rep_len, int *n_mini_pos, uint64_t **mini_pos);
void mm_seed_mz_flt(void *km, mm128_v *mv, int32_t q_occ_max, float q_occ_frac);
double mm_event_identity(const mm_reg1_t *r);
int mm_write_sam_hdr(const mm_idx_t *mi, const char *rg, const char *ver, int argc, char *argv[]);
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag);
void mm_write_paf3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag, int rep_len);
void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int n_regs, const mm_reg1_t *regs);
void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regs, const mm_reg1_t *const* regs, void *km, int64_t opt_flag);
void mm_write_sam3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regss, const mm_reg1_t *const* regss, void *km, int64_t opt_flag, int rep_len);
void mm_idxopt_init(mm_idxopt_t *opt);
const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n);
int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f);
int mm_idx_getseq2(const mm_idx_t *mi, int is_rev, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq);
mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a);
mm_reg1_t *mm_gen_regs(void *km, uint32_t hash, int qlen, int n_u, uint64_t *u, mm128_t *a, int is_qstrand);
mm128_t *mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int max_iter, int min_cnt, int min_sc, float gap_scale,
int is_cdna, int n_segs, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km);
mm128_t *mg_lchain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int max_iter, int min_cnt, int min_sc, float chn_pen_gap, float chn_pen_skip,
int is_cdna, int n_segs, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km);
mm128_t *mg_lchain_rmq(int max_dist, int max_dist_inner, int bw, int max_chn_skip, int cap_rmq_size, int min_cnt, int min_sc, float chn_pen_gap, float chn_pen_skip,
int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km);
void mm_mark_alt(const mm_idx_t *mi, int n, mm_reg1_t *r);
void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a, int is_qstrand);
void mm_sync_regs(void *km, int n_regs, mm_reg1_t *regs);
int mm_squeeze_a(void *km, int n_regs, mm_reg1_t *regs, mm128_t *a);
int mm_set_sam_pri(int n, mm_reg1_t *r);
void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r);
void mm_select_sub(void *km, float mask_level, float pri_ratio, int min_diff, int best_n, int *n_, mm_reg1_t *r);
void mm_filter_regs(void *km, const mm_mapopt_t *opt, int *n_regs, mm_reg1_t *regs);
void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs, mm128_t *a);
void mm_hit_sort_by_dp(void *km, int *n_regs, mm_reg1_t *r);
void mm_set_mapq(int n_regs, mm_reg1_t *regs, int min_chain_sc);
void mm_set_parent(void *km, float mask_level, int mask_len, int n, mm_reg1_t *r, int sub_diff, int hard_mask_level, float alt_diff_frac);
void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int check_strand, int min_strand_sc, int *n_, mm_reg1_t *r);
void mm_select_sub_multi(void *km, float pri_ratio, float pri1, float pri2, int max_gap_ref, int min_diff, int best_n, int n_segs, const int *qlens, int *n_, mm_reg1_t *r);
int mm_filter_strand_retained(int n_regs, mm_reg1_t *r);
void mm_filter_regs(const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs);
void mm_hit_sort(void *km, int *n_regs, mm_reg1_t *r, float alt_diff_frac);
void mm_set_mapq(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr);
void mm_update_dp_max(int qlen, int n_regs, mm_reg1_t *regs, float frac, int a, int b);
void mm_est_err(const mm_idx_t *mi, int qlen, int n_regs, mm_reg1_t *regs, const mm128_t *a, int32_t n, const uint64_t *mini_pos);
mm_seg_t *mm_seg_gen(void *km, uint32_t hash, int n_segs, const int *qlens, int n_regs0, const mm_reg1_t *regs0, int *n_regs, mm_reg1_t **regs, const mm128_t *a);
void mm_seg_free(void *km, int n_segs, mm_seg_t *segs);
void mm_pair(void *km, int max_gap_ref, int dp_bonus, int sub_diff, int match_sc, const int *qlens, int *n_regs, mm_reg1_t **regs);
FILE *mm_split_init(const char *prefix, const mm_idx_t *mi);
mm_idx_t *mm_split_merge_prep(const char *prefix, int n_splits, FILE **fp, uint32_t *n_seq_part);
int mm_split_merge(int n_segs, const char **fn, const mm_mapopt_t *opt, int n_split_idx);
void mm_split_rm_tmp(const char *prefix, int n_splits);
void mm_err_puts(const char *str);
void mm_err_fwrite(const void *p, size_t size, size_t nitems, FILE *fp);
void mm_err_fread(void *p, size_t size, size_t nitems, FILE *fp);
static inline float mg_log2(float x) // NB: this doesn't work when x<2
{
union { float f; uint32_t i; } z = { x };
float log_2 = ((z.i >> 23) & 255) - 128;
z.i &= ~(255 << 23);
z.i += 127 << 23;
log_2 += (-0.34484843f * z.f + 2.02466578f) * z.f - 0.67487759f;
return log_2;
}
#ifdef __cplusplus
}
+234
View File
@@ -0,0 +1,234 @@
#include <stdio.h>
#include <limits.h>
#include "mmpriv.h"
void mm_idxopt_init(mm_idxopt_t *opt)
{
memset(opt, 0, sizeof(mm_idxopt_t));
opt->k = 15, opt->w = 10, opt->flag = 0;
opt->bucket_bits = 14;
opt->mini_batch_size = 50000000;
opt->batch_size = 4000000000ULL;
}
void mm_mapopt_init(mm_mapopt_t *opt)
{
memset(opt, 0, sizeof(mm_mapopt_t));
opt->seed = 11;
opt->mid_occ_frac = 2e-4f;
opt->min_mid_occ = 10;
opt->max_mid_occ = 1000000;
opt->sdust_thres = 0; // no SDUST masking
opt->q_occ_frac = 0.01f;
opt->min_cnt = 3;
opt->min_chain_score = 40;
opt->bw = 500, opt->bw_long = 20000;
opt->max_gap = 5000;
opt->max_gap_ref = -1;
opt->max_chain_skip = 25;
opt->max_chain_iter = 5000;
opt->rmq_inner_dist = 1000;
opt->rmq_size_cap = 100000;
opt->rmq_rescue_size = 1000;
opt->rmq_rescue_ratio = 0.1f;
opt->chain_gap_scale = 0.8f;
opt->chain_skip_scale = 0.0f;
opt->max_max_occ = 4095;
opt->occ_dist = 500;
opt->mask_level = 0.5f;
opt->mask_len = INT_MAX;
opt->pri_ratio = 0.8f;
opt->best_n = 5;
opt->alt_drop = 0.15f;
opt->a = 2, opt->b = 4, opt->q = 4, opt->e = 2, opt->q2 = 24, opt->e2 = 1;
opt->sc_ambi = 1;
opt->zdrop = 400, opt->zdrop_inv = 200;
opt->end_bonus = -1;
opt->min_dp_max = opt->min_chain_score * opt->a;
opt->min_ksw_len = 200;
opt->anchor_ext_len = 20, opt->anchor_ext_shift = 6;
opt->max_clip_ratio = 1.0f;
opt->mini_batch_size = 500000000;
opt->max_sw_mat = 100000000;
opt->cap_kalloc = 1000000000;
opt->rank_min_len = 500;
opt->rank_frac = 0.9f;
opt->pe_ori = 0; // FF
opt->pe_bonus = 33;
}
void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
{
if ((opt->flag & MM_F_SPLICE_FOR) || (opt->flag & MM_F_SPLICE_REV))
opt->flag |= MM_F_SPLICE;
if (opt->mid_occ <= 0) {
opt->mid_occ = mm_idx_cal_max_occ(mi, opt->mid_occ_frac);
if (opt->mid_occ < opt->min_mid_occ)
opt->mid_occ = opt->min_mid_occ;
if (opt->max_mid_occ > opt->min_mid_occ && opt->mid_occ > opt->max_mid_occ)
opt->mid_occ = opt->max_mid_occ;
}
if (opt->bw_long < opt->bw) opt->bw_long = opt->bw;
if (mm_verbose >= 3)
fprintf(stderr, "[M::%s::%.3f*%.2f] mid_occ = %d\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), opt->mid_occ);
}
void mm_mapopt_max_intron_len(mm_mapopt_t *opt, int max_intron_len)
{
if ((opt->flag & MM_F_SPLICE) && max_intron_len > 0)
opt->max_gap_ref = opt->bw = opt->bw_long = max_intron_len;
}
int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
{
if (preset == 0) {
mm_idxopt_init(io);
mm_mapopt_init(mo);
} else if (strcmp(preset, "map-ont") == 0) { // this is the same as the default
} else if (strcmp(preset, "ava-ont") == 0) {
io->flag = 0, io->k = 15, io->w = 5;
mo->flag |= MM_F_ALL_CHAINS | MM_F_NO_DIAG | MM_F_NO_DUAL | MM_F_NO_LJOIN;
mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_chain_skip = 25;
mo->bw = mo->bw_long = 2000;
mo->occ_dist = 0;
} else if (strcmp(preset, "map10k") == 0 || strcmp(preset, "map-pb") == 0) {
io->flag |= MM_I_HPC, io->k = 19;
} else if (strcmp(preset, "ava-pb") == 0) {
io->flag |= MM_I_HPC, io->k = 19, io->w = 5;
mo->flag |= MM_F_ALL_CHAINS | MM_F_NO_DIAG | MM_F_NO_DUAL | MM_F_NO_LJOIN;
mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_chain_skip = 25;
mo->bw_long = mo->bw;
mo->occ_dist = 0;
} else if (strcmp(preset, "map-hifi") == 0 || strcmp(preset, "map-ccs") == 0) {
io->flag = 0, io->k = 19, io->w = 19;
mo->max_gap = 10000;
mo->a = 1, mo->b = 4, mo->q = 6, mo->q2 = 26, mo->e = 2, mo->e2 = 1;
mo->occ_dist = 500;
mo->min_mid_occ = 50, mo->max_mid_occ = 500;
mo->min_dp_max = 200;
} else if (strncmp(preset, "asm", 3) == 0) {
io->flag = 0, io->k = 19, io->w = 19;
mo->bw = 1000, mo->bw_long = 100000;
mo->max_gap = 10000;
mo->flag |= MM_F_RMQ;
mo->min_mid_occ = 50, mo->max_mid_occ = 500;
mo->min_dp_max = 200;
mo->best_n = 50;
if (strcmp(preset, "asm5") == 0) {
mo->a = 1, mo->b = 19, mo->q = 39, mo->q2 = 81, mo->e = 3, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
} else if (strcmp(preset, "asm10") == 0) {
mo->a = 1, mo->b = 9, mo->q = 16, mo->q2 = 41, mo->e = 2, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
} else if (strcmp(preset, "asm20") == 0) {
mo->a = 1, mo->b = 4, mo->q = 6, mo->q2 = 26, mo->e = 2, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
io->w = 10;
} else return -1;
} else if (strcmp(preset, "short") == 0 || strcmp(preset, "sr") == 0) {
io->flag = 0, io->k = 21, io->w = 11;
mo->flag |= MM_F_SR | MM_F_FRAG_MODE | MM_F_NO_PRINT_2ND | MM_F_2_IO_THREADS | MM_F_HEAP_SORT;
mo->pe_ori = 0<<1|1; // FR
mo->a = 2, mo->b = 8, mo->q = 12, mo->e = 2, mo->q2 = 24, mo->e2 = 1;
mo->zdrop = mo->zdrop_inv = 100;
mo->end_bonus = 10;
mo->max_frag_len = 800;
mo->max_gap = 100;
mo->bw = mo->bw_long = 100;
mo->pri_ratio = 0.5f;
mo->min_cnt = 2;
mo->min_chain_score = 25;
mo->min_dp_max = 40;
mo->best_n = 20;
mo->mid_occ = 1000;
mo->max_occ = 5000;
mo->mini_batch_size = 50000000;
} else if (strncmp(preset, "splice", 6) == 0 || strcmp(preset, "cdna") == 0) {
io->flag = 0, io->k = 15, io->w = 5;
mo->flag |= MM_F_SPLICE | MM_F_SPLICE_FOR | MM_F_SPLICE_REV | MM_F_SPLICE_FLANK;
mo->max_sw_mat = 0;
mo->max_gap = 2000, mo->max_gap_ref = mo->bw = mo->bw_long = 200000;
mo->a = 1, mo->b = 2, mo->q = 2, mo->e = 1, mo->q2 = 32, mo->e2 = 0;
mo->noncan = 9;
mo->junc_bonus = 9;
mo->zdrop = 200, mo->zdrop_inv = 100; // because mo->a is halved
if (strcmp(preset, "splice:hq") == 0)
mo->junc_bonus = 5, mo->b = 4, mo->q = 6, mo->q2 = 24;
} else return -1;
return 0;
}
int mm_check_opt(const mm_idxopt_t *io, const mm_mapopt_t *mo)
{
if (mo->bw > mo->bw_long) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m with '-rNUM1,NUM2', NUM1 (%d) can't be larger than NUM2 (%d)\033[0m\n", mo->bw, mo->bw_long);
return -8;
}
if ((mo->flag & MM_F_RMQ) && (mo->flag & (MM_F_SR|MM_F_SPLICE))) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m --rmq doesn't work with --sr or --splice\033[0m\n");
return -7;
}
if (mo->split_prefix && (mo->flag & (MM_F_OUT_CS|MM_F_OUT_MD))) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m --cs or --MD doesn't work with --split-prefix\033[0m\n");
return -6;
}
if (io->k <= 0 || io->w <= 0) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m -k and -w must be positive\033[0m\n");
return -5;
}
if (mo->best_n < 0) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m -N must be no less than 0\033[0m\n");
return -4;
}
if (mo->best_n == 0 && mm_verbose >= 2)
fprintf(stderr, "[WARNING]\033[1;31m '-N 0' reduces mapping accuracy. Please use '--secondary=no' instead.\033[0m\n");
if (mo->pri_ratio < 0.0f || mo->pri_ratio > 1.0f) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m -p must be within 0 and 1 (including 0 and 1)\033[0m\n");
return -4;
}
if ((mo->flag & MM_F_FOR_ONLY) && (mo->flag & MM_F_REV_ONLY)) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m --for-only and --rev-only can't be applied at the same time\033[0m\n");
return -3;
}
if (mo->e <= 0 || mo->q <= 0) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m -O and -E must be positive\033[0m\n");
return -1;
}
if ((mo->q != mo->q2 || mo->e != mo->e2) && !(mo->e > mo->e2 && mo->q + mo->e < mo->q2 + mo->e2)) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m dual gap penalties violating E1>E2 and O1+E1<O2+E2\033[0m\n");
return -2;
}
if ((mo->q + mo->e) + (mo->q2 + mo->e2) > 127) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m scoring system violating ({-O}+{-E})+({-O2}+{-E2}) <= 127\033[0m\n");
return -1;
}
if (mo->zdrop < mo->zdrop_inv) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m Z-drop should not be less than inversion-Z-drop\033[0m\n");
return -5;
}
if ((mo->flag & MM_F_NO_PRINT_2ND) && (mo->flag & MM_F_ALL_CHAINS)) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m -X/-P and --secondary=no can't be applied at the same time\033[0m\n");
return -5;
}
if ((mo->flag & MM_F_QSTRAND) && ((mo->flag & (MM_F_OUT_SAM|MM_F_SPLICE|MM_F_FRAG_MODE)) || (io->flag & MM_I_HPC))) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m --qstrand doesn't work with -a, -H, --frag or --splice\033[0m\n");
return -5;
}
return 0;
}
+177
View File
@@ -0,0 +1,177 @@
#include <stdlib.h>
#include <math.h>
#include "mmpriv.h"
#include "kvec.h"
void mm_select_sub_multi(void *km, float pri_ratio, float pri1, float pri2, int max_gap_ref, int min_diff, int best_n, int n_segs, const int *qlens, int *n_, mm_reg1_t *r)
{
if (pri_ratio > 0.0f && *n_ > 0) {
int i, k, n = *n_, n_2nd = 0;
int max_dist = n_segs == 2? qlens[0] + qlens[1] + max_gap_ref : 0;
for (i = k = 0; i < n; ++i) {
int to_keep = 0;
if (r[i].parent == i) { // primary
to_keep = 1;
} else if (r[i].score + min_diff >= r[r[i].parent].score) {
to_keep = 1;
} else {
mm_reg1_t *p = &r[r[i].parent], *q = &r[i];
if (p->rev == q->rev && p->rid == q->rid && q->re - p->rs < max_dist && p->re - q->rs < max_dist) { // child and parent are close on the ref
if (q->score >= p->score * pri1)
to_keep = 1;
} else {
int is_par_both = (n_segs == 2 && p->qs < qlens[0] && p->qe > qlens[0]);
int is_chi_both = (n_segs == 2 && q->qs < qlens[0] && q->qe > qlens[0]);
if (is_chi_both || is_chi_both == is_par_both) {
if (q->score >= p->score * pri_ratio)
to_keep = 1;
} else { // the remaining case: is_chi_both == 0 && is_par_both == 1
if (q->score >= p->score * pri2)
to_keep = 1;
}
}
}
if (to_keep && r[i].parent != i) {
if (n_2nd++ >= best_n) to_keep = 0; // don't keep if there are too many secondary hits
}
if (to_keep) r[k++] = r[i];
else if (r[i].p) free(r[i].p);
}
if (k != n) mm_sync_regs(km, k, r); // removing hits requires sync()
*n_ = k;
}
}
void mm_set_pe_thru(const int *qlens, int *n_regs, mm_reg1_t **regs)
{
int s, i, n_pri[2], pri[2];
n_pri[0] = n_pri[1] = 0;
pri[0] = pri[1] = -1;
for (s = 0; s < 2; ++s)
for (i = 0; i < n_regs[s]; ++i)
if (regs[s][i].id == regs[s][i].parent)
++n_pri[s], pri[s] = i;
if (n_pri[0] == 1 && n_pri[1] == 1) {
mm_reg1_t *p = &regs[0][pri[0]];
mm_reg1_t *q = &regs[1][pri[1]];
if (p->rid == q->rid && p->rev == q->rev && abs(p->rs - q->rs) < 3 && abs(p->re - q->re) < 3
&& ((p->qs == 0 && qlens[1] - q->qe == 0) || (q->qs == 0 && qlens[0] - p->qe == 0)))
{
p->pe_thru = q->pe_thru = 1;
}
}
}
#include "ksort.h"
typedef struct {
int s, rev;
uint64_t key;
mm_reg1_t *r;
} pair_arr_t;
#define sort_key_pair(a) ((a).key)
KRADIX_SORT_INIT(pair, pair_arr_t, sort_key_pair, 8)
void mm_pair(void *km, int max_gap_ref, int pe_bonus, int sub_diff, int match_sc, const int *qlens, int *n_regs, mm_reg1_t **regs)
{
int i, j, s, n, last[2], dp_thres, segs = 0, max_idx[2];
int64_t max;
pair_arr_t *a;
kvec_t(uint64_t) sc = {0,0,0};
a = (pair_arr_t*)kmalloc(km, (n_regs[0] + n_regs[1]) * sizeof(pair_arr_t));
for (s = n = 0, dp_thres = 0; s < 2; ++s) {
int max = 0;
for (i = 0; i < n_regs[s]; ++i) {
a[n].s = s;
a[n].r = &regs[s][i];
a[n].rev = a[n].r->rev;
a[n].key = (uint64_t)a[n].r->rid << 32 | a[n].r->rs<<1 | (s^a[n].rev);
max = max > a[n].r->p->dp_max? max : a[n].r->p->dp_max;
++n;
segs |= 1<<s;
}
dp_thres += max;
}
if (segs != 3) {
kfree(km, a); // only one end is mapped
return;
}
dp_thres -= pe_bonus;
if (dp_thres < 0) dp_thres = 0;
radix_sort_pair(a, a + n);
max = -1;
max_idx[0] = max_idx[1] = -1;
last[0] = last[1] = -1;
kv_resize(uint64_t, km, sc, (size_t)n);
for (i = 0; i < n; ++i) {
if (a[i].key & 1) { // reverse first read or forward second read
mm_reg1_t *q, *r;
if (last[a[i].rev] < 0) continue;
r = a[i].r;
q = a[last[a[i].rev]].r;
if (r->rid != q->rid || r->rs - q->re > max_gap_ref) continue;
for (j = last[a[i].rev]; j >= 0; --j) {
int64_t score;
if (a[j].rev != a[i].rev || a[j].s == a[i].s) continue;
q = a[j].r;
if (r->rid != q->rid || r->rs - q->re > max_gap_ref) break;
if (r->p->dp_max + q->p->dp_max < dp_thres) continue;
score = (int64_t)(r->p->dp_max + q->p->dp_max) << 32 | (r->hash + q->hash);
if (score > max)
max = score, max_idx[a[j].s] = j, max_idx[a[i].s] = i;
kv_push(uint64_t, km, sc, score);
}
} else { // forward first read or reverse second read
last[a[i].rev] = i;
}
}
if (sc.n > 1)
radix_sort_64(sc.a, sc.a + sc.n);
if (sc.n > 0 && max > 0) { // found at least one pair
int n_sub = 0, mapq_pe;
mm_reg1_t *r[2];
r[0] = a[max_idx[0]].r, r[1] = a[max_idx[1]].r;
r[0]->proper_frag = r[1]->proper_frag = 1;
for (s = 0; s < 2; ++s) {
if (r[s]->id != r[s]->parent) { // then lift to primary and update parent
mm_reg1_t *p = &regs[s][r[s]->parent];
for (i = 0; i < n_regs[s]; ++i)
if (regs[s][i].parent == p->id)
regs[s][i].parent = r[s]->id;
p->mapq = 0;
}
if (!r[s]->sam_pri) { // then sync sam_pri
for (i = 0; i < n_regs[s]; ++i)
regs[s][i].sam_pri = 0;
r[s]->sam_pri = 1;
}
}
mapq_pe = r[0]->mapq > r[1]->mapq? r[0]->mapq : r[1]->mapq;
for (i = 0; i < (int)sc.n; ++i)
if ((sc.a[i]>>32) + sub_diff >= (uint64_t)max>>32)
++n_sub;
if (sc.n > 1) {
int mapq_pe_alt;
mapq_pe_alt = (int)(6.02f * ((max>>32) - (sc.a[sc.n - 2]>>32)) / match_sc - 4.343f * logf(n_sub)); // n_sub > 0 because it counts the optimal, too
mapq_pe = mapq_pe < mapq_pe_alt? mapq_pe : mapq_pe_alt;
}
if (r[0]->mapq < mapq_pe) r[0]->mapq = (int)(.2f * r[0]->mapq + .8f * mapq_pe + .499f);
if (r[1]->mapq < mapq_pe) r[1]->mapq = (int)(.2f * r[1]->mapq + .8f * mapq_pe + .499f);
if (sc.n == 1) {
if (r[0]->mapq < 2) r[0]->mapq = 2;
if (r[1]->mapq < 2) r[1]->mapq = 2;
} else if ((uint64_t)max>>32 > sc.a[sc.n - 2]>>32) {
if (r[0]->mapq < 1) r[0]->mapq = 1;
if (r[1]->mapq < 1) r[1]->mapq = 1;
}
}
kfree(km, a);
kfree(km, sc.a);
mm_set_pe_thru(qlens, n_regs, regs);
}
+196
View File
@@ -0,0 +1,196 @@
==============================
Mappy: Minimap2 Python Binding
==============================
Mappy provides a convenient interface to `minimap2
<https://github.com/lh3/minimap2>`_, a fast and accurate C program to align
genomic and transcribe nucleotide sequences.
Installation
------------
Mappy depends on `zlib <http://zlib.net>`_. It can be installed with `pip
<https://en.wikipedia.org/wiki/Pip_(package_manager)>`_:
.. code:: shell
pip install --user mappy
or from the minimap2 github repo (`Cython <http://cython.org>`_ required):
.. code:: shell
git clone https://github.com/lh3/minimap2
cd minimap2
python setup.py install
Usage
-----
The following Python script demonstrates the key functionality of mappy:
.. code:: python
import mappy as mp
a = mp.Aligner("test/MT-human.fa") # load or build index
if not a: raise Exception("ERROR: failed to load/build index")
s = a.seq("MT_human", 100, 200) # retrieve a subsequence from the index
print(mp.revcomp(s)) # reverse complement
for name, seq, qual in mp.fastx_read("test/MT-orang.fa"): # read a fasta/q sequence
for hit in a.map(seq): # traverse alignments
print("{}\t{}\t{}\t{}".format(hit.ctg, hit.r_st, hit.r_en, hit.cigar_str))
APIs
----
Mappy implements two classes and two global function.
Class mappy.Aligner
~~~~~~~~~~~~~~~~~~~
.. code:: python
mappy.Aligner(fn_idx_in=None, preset=None, ...)
This constructor accepts the following arguments:
* **fn_idx_in**: index or sequence file name. Minimap2 automatically tests the
file type. If a sequence file is provided, minimap2 builds an index. The
sequence file can be optionally gzip'd. This option has no effect if **seq**
is set.
* **seq**: a single sequence to index. The sequence name will be set to
:code:`N/A`.
* **preset**: minimap2 preset. Currently, minimap2 supports the following
presets: **sr** for single-end short reads; **map-pb** for PacBio
read-to-reference mapping; **map-ont** for Oxford Nanopore read mapping;
**splice** for long-read spliced alignment; **asm5** for assembly-to-assembly
alignment; **asm10** for full genome alignment of closely related species. Note
that the Python module does not support all-vs-all read overlapping.
* **k**: k-mer length, no larger than 28
* **w**: minimizer window size, no larger than 255
* **min_cnt**: mininum number of minimizers on a chain
* **min_chain_score**: minimum chaing score
* **bw**: chaining and alignment band width
* **best_n**: max number of alignments to return
* **n_threads**: number of indexing threads; 3 by default
* **extra_flags**: additional flags defined in minimap.h
* **fn_idx_out**: name of file to which the index is written. This parameter
has no effect if **seq** is set.
* **scoring**: scoring system. It is a tuple/list consisting of 4, 6 or 7
positive integers. The first 4 elements specify match scoring, mismatch
penalty, gap open and gap extension penalty. The 5th and 6th elements, if
present, set long-gap open and long-gap extension penalty. The 7th sets a
mismatch penalty involving ambiguous bases.
.. code:: python
mappy.Aligner.map(seq, seq2=None, cs=False, MD=False)
This method aligns :code:`seq` against the index. It is a generator, *yielding*
a series of :code:`mappy.Alignment` objects. If :code:`seq2` is present, mappy
performs paired-end alignment, assuming the two ends are in the FR orientation.
Alignments of the two ends can be distinguished by the :code:`read_num` field
(see Class mappy.Alignment below). Argument :code:`cs` asks mappy to generate
the :code:`cs` tag; :code:`MD` is similar. These two arguments might slightly
degrade performance and are not enabled by default.
.. code:: python
mappy.Aligner.seq(name, start=0, end=0x7fffffff)
This method retrieves a (sub)sequence from the index and returns it as a Python
string. :code:`None` is returned if :code:`name` is not present in the index or
the start/end coordinates are invalid.
.. code:: python
mappy.Aligner.seq_names
This property gives the array of sequence names in the index.
Class mappy.Alignment
~~~~~~~~~~~~~~~~~~~~~
This class describes an alignment. An object of this class has the following
properties:
* **ctg**: name of the reference sequence the query is mapped to
* **ctg_len**: total length of the reference sequence
* **r_st** and **r_en**: start and end positions on the reference
* **q_st** and **q_en**: start and end positions on the query
* **strand**: +1 if on the forward strand; -1 if on the reverse strand
* **mapq**: mapping quality
* **blen**: length of the alignment, including both alignment matches and gaps
but excluding ambiguous bases.
* **mlen**: length of the matching bases in the alignment, excluding ambiguous
base matches.
* **NM**: number of mismatches, gaps and ambiguous positions in the alignment
* **trans_strand**: transcript strand. +1 if on the forward strand; -1 if on the
reverse strand; 0 if unknown
* **is_primary**: if the alignment is primary (typically the best and the first
to generate)
* **read_num**: read number that the alignment corresponds to; 1 for the first
read and 2 for the second read
* **cigar_str**: CIGAR string
* **cigar**: CIGAR returned as an array of shape :code:`(n_cigar,2)`. The two
numbers give the length and the operator of each CIGAR operation.
* **MD**: the :code:`MD` tag as in the SAM format. It is an empty string unless
the :code:`MD` argument is applied when calling :code:`mappy.Aligner.map()`.
* **cs**: the :code:`cs` tag.
An :code:`Alignment` object can be converted to a string with :code:`str()` in
the following format:
::
q_st q_en strand ctg ctg_len r_st r_en mlen blen mapq cg:Z:cigar_str
It is effectively the PAF format without the QueryName and QueryLength columns
(the first two columns in PAF).
Miscellaneous Functions
~~~~~~~~~~~~~~~~~~~~~~~
.. code:: python
mappy.fastx_read(fn, read_comment=False)
This generator function opens a FASTA/FASTQ file and *yields* a
:code:`(name,seq,qual)` tuple for each sequence entry. The input file may be
optionally gzip'd. If :code:`read_comment` is True, this generator yields
a :code:`(name,seq,qual,comment)` tuple instead.
.. code:: python
mappy.revcomp(seq)
Return the reverse complement of DNA string :code:`seq`. This function
recognizes IUB code and preserves the letter cases. Uracil :code:`U` is
complemented to :code:`A`.
+152
View File
@@ -0,0 +1,152 @@
#ifndef CMAPPY_H
#define CMAPPY_H
#include <stdlib.h>
#include <string.h>
#include <zlib.h>
#include "minimap.h"
#include "kseq.h"
KSEQ_DECLARE(gzFile)
typedef struct {
const char *ctg;
int32_t ctg_start, ctg_end;
int32_t qry_start, qry_end;
int32_t blen, mlen, NM, ctg_len;
uint8_t mapq, is_primary;
int8_t strand, trans_strand;
int32_t seg_id;
int32_t n_cigar32;
uint32_t *cigar32;
} mm_hitpy_t;
static inline void mm_reg2hitpy(const mm_idx_t *mi, mm_reg1_t *r, mm_hitpy_t *h)
{
h->ctg = mi->seq[r->rid].name;
h->ctg_len = mi->seq[r->rid].len;
h->ctg_start = r->rs, h->ctg_end = r->re;
h->qry_start = r->qs, h->qry_end = r->qe;
h->strand = r->rev? -1 : 1;
h->mapq = r->mapq;
h->mlen = r->mlen;
h->blen = r->blen;
h->NM = r->blen - r->mlen + r->p->n_ambi;
h->trans_strand = r->p->trans_strand == 1? 1 : r->p->trans_strand == 2? -1 : 0;
h->is_primary = (r->id == r->parent);
h->seg_id = r->seg_id;
h->n_cigar32 = r->p->n_cigar;
h->cigar32 = r->p->cigar;
}
static inline void mm_free_reg1(mm_reg1_t *r)
{
free(r->p);
}
static inline kseq_t *mm_fastx_open(const char *fn)
{
gzFile fp;
fp = fn && strcmp(fn, "-") != 0? gzopen(fn, "r") : gzdopen(fileno(stdin), "r");
return kseq_init(fp);
}
static inline void mm_fastx_close(kseq_t *ks)
{
gzFile fp;
fp = ks->f->f;
kseq_destroy(ks);
gzclose(fp);
}
static inline int mm_verbose_level(int v)
{
if (v >= 0) mm_verbose = v;
return mm_verbose;
}
static inline void mm_reset_timer(void)
{
extern double realtime(void);
mm_realtime0 = realtime();
}
extern unsigned char seq_comp_table[256];
static inline mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char *seq1, const char *seq2, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt)
{
mm_reg1_t *r;
Py_BEGIN_ALLOW_THREADS
if (seq2 == 0) {
r = mm_map(mi, strlen(seq1), seq1, n_regs, b, opt, NULL);
} else {
int _n_regs[2];
mm_reg1_t *regs[2];
char *seq[2];
int i, len[2];
len[0] = strlen(seq1);
len[1] = strlen(seq2);
seq[0] = (char*)seq1;
seq[1] = strdup(seq2);
for (i = 0; i < len[1]>>1; ++i) {
int t = seq[1][len[1] - i - 1];
seq[1][len[1] - i - 1] = seq_comp_table[(uint8_t)seq[1][i]];
seq[1][i] = seq_comp_table[t];
}
if (len[1]&1) seq[1][len[1]>>1] = seq_comp_table[(uint8_t)seq[1][len[1]>>1]];
mm_map_frag(mi, 2, len, (const char**)seq, _n_regs, regs, b, opt, NULL);
for (i = 0; i < _n_regs[1]; ++i)
regs[1][i].rev = !regs[1][i].rev;
*n_regs = _n_regs[0] + _n_regs[1];
regs[0] = (mm_reg1_t*)realloc(regs[0], sizeof(mm_reg1_t) * (*n_regs));
memcpy(&regs[0][_n_regs[0]], regs[1], _n_regs[1] * sizeof(mm_reg1_t));
free(regs[1]);
r = regs[0];
}
Py_END_ALLOW_THREADS
return r;
}
static inline char *mappy_revcomp(int len, const uint8_t *seq)
{
int i;
char *rev;
rev = (char*)malloc(len + 1);
for (i = 0; i < len; ++i)
rev[len - i - 1] = seq_comp_table[seq[i]];
rev[len] = 0;
return rev;
}
static char *mappy_fetch_seq(const mm_idx_t *mi, const char *name, int st, int en, int *len)
{
int i, rid;
char *s;
*len = 0;
rid = mm_idx_name2id(mi, name);
if (rid < 0) return 0;
if ((uint32_t)st >= mi->seq[rid].len || st >= en) return 0;
if (en < 0 || (uint32_t)en > mi->seq[rid].len)
en = mi->seq[rid].len;
s = (char*)malloc(en - st + 1);
*len = mm_idx_getseq(mi, rid, st, en, (uint8_t*)s);
for (i = 0; i < *len; ++i)
s[i] = "ACGTN"[(uint8_t)s[i]];
s[*len] = 0;
return s;
}
static mm_idx_t *mappy_idx_seq(int w, int k, int is_hpc, int bucket_bits, const char *seq, int len)
{
const char *fake_name = "N/A";
char *s;
mm_idx_t *mi;
s = (char*)calloc(len + 1, 1);
memcpy(s, seq, len);
mi = mm_idx_str(w, k, is_hpc, bucket_bits, 1, (const char**)&s, (const char**)&fake_name);
free(s);
return mi;
}
#endif
+153
View File
@@ -0,0 +1,153 @@
from libc.stdint cimport int8_t, uint8_t, int32_t, int64_t, uint32_t, uint64_t
cdef extern from "minimap.h":
#
# Options
#
ctypedef struct mm_idxopt_t:
short k, w, flag, bucket_bits
int64_t mini_batch_size
uint64_t batch_size
ctypedef struct mm_mapopt_t:
int64_t flag
int seed
int sdust_thres
int max_qlen
int bw, bw_long
int max_gap, max_gap_ref
int max_frag_len
int max_chain_skip, max_chain_iter
int min_cnt
int min_chain_score
float chain_gap_scale
float chain_skip_scale
int rmq_size_cap, rmq_inner_dist
int rmq_rescue_size
float rmq_rescue_ratio
float mask_level
int mask_len
float pri_ratio
int best_n
float alt_drop
int a, b, q, e, q2, e2
int sc_ambi
int noncan
int junc_bonus
int zdrop, zdrop_inv
int end_bonus
int min_dp_max
int min_ksw_len
int anchor_ext_len, anchor_ext_shift
float max_clip_ratio
int rank_min_len
float rank_frac
int pe_ori, pe_bonus
float mid_occ_frac
float q_occ_frac
int32_t min_mid_occ
int32_t mid_occ
int32_t max_occ
int64_t mini_batch_size
int64_t max_sw_mat
int64_t cap_kalloc
const char *split_prefix
int mm_set_opt(char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
int mm_verbose
#
# Indexing
#
ctypedef struct mm_idx_seq_t:
char *name
uint64_t offset
uint32_t len
ctypedef struct mm_idx_bucket_t:
pass
ctypedef struct mm_idx_t:
int32_t b, w, k, flag
uint32_t n_seq
mm_idx_seq_t *seq
uint32_t *S
mm_idx_bucket_t *B
void *km
void *h
ctypedef struct mm_idx_reader_t:
pass
mm_idx_reader_t *mm_idx_reader_open(const char *fn, const mm_idxopt_t *opt, const char *fn_out)
mm_idx_t *mm_idx_reader_read(mm_idx_reader_t *r, int n_threads)
void mm_idx_reader_close(mm_idx_reader_t *r)
void mm_idx_destroy(mm_idx_t *mi)
void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
int mm_idx_index_name(mm_idx_t *mi)
#
# Mapping (key struct defined in cmappy.h below)
#
ctypedef struct mm_reg1_t:
pass
ctypedef struct mm_tbuf_t:
pass
mm_tbuf_t *mm_tbuf_init()
void mm_tbuf_destroy(mm_tbuf_t *b)
void *mm_tbuf_get_km(mm_tbuf_t *b)
int mm_gen_cs(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int no_iden)
int mm_gen_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq)
#
# Helper header (because it is hard to expose mm_reg1_t with Cython)
#
cdef extern from "cmappy.h":
ctypedef struct mm_hitpy_t:
const char *ctg
int32_t ctg_start, ctg_end
int32_t qry_start, qry_end
int32_t blen, mlen, NM, ctg_len
uint8_t mapq, is_primary
int8_t strand, trans_strand
int32_t seg_id
int32_t n_cigar32
uint32_t *cigar32
void mm_reg2hitpy(const mm_idx_t *mi, mm_reg1_t *r, mm_hitpy_t *h)
void mm_free_reg1(mm_reg1_t *r)
mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char *seq1, const char *seq2, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt)
char *mappy_fetch_seq(const mm_idx_t *mi, const char *name, int st, int en, int *l)
mm_idx_t *mappy_idx_seq(int w, int k, int is_hpc, int bucket_bits, const char *seq, int l)
ctypedef struct kstring_t:
unsigned l, m
char *s
ctypedef struct kstream_t:
pass
ctypedef struct kseq_t:
kstring_t name, comment, seq, qual
int last_char
kstream_t *f
kseq_t *mm_fastx_open(const char *fn)
void mm_fastx_close(kseq_t *ks)
int kseq_read(kseq_t *seq)
char *mappy_revcomp(int l, const uint8_t *seq)
int mm_verbose_level(int v)
void mm_reset_timer()
+273
View File
@@ -0,0 +1,273 @@
from libc.stdint cimport uint8_t, int8_t
from libc.stdlib cimport free
cimport cmappy
import sys
__version__ = '2.24'
cmappy.mm_reset_timer()
cdef class Alignment:
cdef int _ctg_len, _r_st, _r_en
cdef int _q_st, _q_en
cdef int _NM, _mlen, _blen
cdef int8_t _strand, _trans_strand
cdef uint8_t _mapq, _is_primary
cdef int _seg_id
cdef _ctg, _cigar, _cs, _MD # these are python objects
def __cinit__(self, ctg, cl, cs, ce, strand, qs, qe, mapq, cigar, is_primary, mlen, blen, NM, trans_strand, seg_id, cs_str, MD_str):
self._ctg = ctg if isinstance(ctg, str) else ctg.decode()
self._ctg_len, self._r_st, self._r_en = cl, cs, ce
self._strand, self._q_st, self._q_en = strand, qs, qe
self._NM, self._mlen, self._blen = NM, mlen, blen
self._mapq = mapq
self._cigar = cigar
self._is_primary = is_primary
self._trans_strand = trans_strand
self._seg_id = seg_id
self._cs = cs_str
self._MD = MD_str
@property
def ctg(self): return self._ctg
@property
def ctg_len(self): return self._ctg_len
@property
def r_st(self): return self._r_st
@property
def r_en(self): return self._r_en
@property
def strand(self): return self._strand
@property
def trans_strand(self): return self._trans_strand
@property
def blen(self): return self._blen
@property
def mlen(self): return self._mlen
@property
def NM(self): return self._NM
@property
def is_primary(self): return (self._is_primary != 0)
@property
def q_st(self): return self._q_st
@property
def q_en(self): return self._q_en
@property
def mapq(self): return self._mapq
@property
def cigar(self): return self._cigar
@property
def read_num(self): return self._seg_id + 1
@property
def cs(self): return self._cs
@property
def MD(self): return self._MD
@property
def cigar_str(self):
return "".join(map(lambda x: str(x[0]) + 'MIDNSHP=XB'[x[1]], self._cigar))
def __str__(self):
if self._strand > 0: strand = '+'
elif self._strand < 0: strand = '-'
else: strand = '?'
if self._is_primary != 0: tp = 'tp:A:P'
else: tp = 'tp:A:S'
if self._trans_strand > 0: ts = 'ts:A:+'
elif self._trans_strand < 0: ts = 'ts:A:-'
else: ts = 'ts:A:.'
a = [str(self._q_st), str(self._q_en), strand, self._ctg, str(self._ctg_len), str(self._r_st), str(self._r_en),
str(self._mlen), str(self._blen), str(self._mapq), tp, ts, "cg:Z:" + self.cigar_str]
if self._cs != "": a.append("cs:Z:" + self._cs)
return "\t".join(a)
cdef class ThreadBuffer:
cdef cmappy.mm_tbuf_t *_b
def __cinit__(self):
self._b = cmappy.mm_tbuf_init()
def __dealloc__(self):
cmappy.mm_tbuf_destroy(self._b)
cdef class Aligner:
cdef cmappy.mm_idx_t *_idx
cdef cmappy.mm_idxopt_t idx_opt
cdef cmappy.mm_mapopt_t map_opt
def __cinit__(self, fn_idx_in=None, preset=None, k=None, w=None, min_cnt=None, min_chain_score=None, min_dp_score=None, bw=None, best_n=None, n_threads=3, fn_idx_out=None, max_frag_len=None, extra_flags=None, seq=None, scoring=None):
self._idx = NULL
cmappy.mm_set_opt(NULL, &self.idx_opt, &self.map_opt) # set the default options
if preset is not None:
cmappy.mm_set_opt(str.encode(preset), &self.idx_opt, &self.map_opt) # apply preset
self.map_opt.flag |= 4 # always perform alignment
self.idx_opt.batch_size = 0x7fffffffffffffffL # always build a uni-part index
if k is not None: self.idx_opt.k = k
if w is not None: self.idx_opt.w = w
if min_cnt is not None: self.map_opt.min_cnt = min_cnt
if min_chain_score is not None: self.map_opt.min_chain_score = min_chain_score
if min_dp_score is not None: self.map_opt.min_dp_max = min_dp_score
if bw is not None: self.map_opt.bw = bw
if best_n is not None: self.map_opt.best_n = best_n
if max_frag_len is not None: self.map_opt.max_frag_len = max_frag_len
if extra_flags is not None: self.map_opt.flag |= extra_flags
if scoring is not None and len(scoring) >= 4:
self.map_opt.a, self.map_opt.b = scoring[0], scoring[1]
self.map_opt.q, self.map_opt.e = scoring[2], scoring[3]
self.map_opt.q2, self.map_opt.e2 = self.map_opt.q, self.map_opt.e
if len(scoring) >= 6:
self.map_opt.q2, self.map_opt.e2 = scoring[4], scoring[5]
if len(scoring) >= 7:
self.map_opt.sc_ambi = scoring[6]
cdef cmappy.mm_idx_reader_t *r;
if seq is None:
if fn_idx_out is None:
r = cmappy.mm_idx_reader_open(str.encode(fn_idx_in), &self.idx_opt, NULL)
else:
r = cmappy.mm_idx_reader_open(str.encode(fn_idx_in), &self.idx_opt, str.encode(fn_idx_out))
if r is not NULL:
self._idx = cmappy.mm_idx_reader_read(r, n_threads) # NB: ONLY read the first part
cmappy.mm_idx_reader_close(r)
cmappy.mm_mapopt_update(&self.map_opt, self._idx)
cmappy.mm_idx_index_name(self._idx)
else:
self._idx = cmappy.mappy_idx_seq(self.idx_opt.w, self.idx_opt.k, self.idx_opt.flag&1, self.idx_opt.bucket_bits, str.encode(seq), len(seq))
cmappy.mm_mapopt_update(&self.map_opt, self._idx)
self.map_opt.mid_occ = 1000 # don't filter high-occ seeds
def __dealloc__(self):
if self._idx is not NULL:
cmappy.mm_idx_destroy(self._idx)
def __bool__(self):
return (self._idx != NULL)
def map(self, seq, seq2=None, buf=None, cs=False, MD=False, max_frag_len=None, extra_flags=None):
cdef cmappy.mm_reg1_t *regs
cdef cmappy.mm_hitpy_t h
cdef ThreadBuffer b
cdef int n_regs
cdef char *cs_str = NULL
cdef int l_cs_str, m_cs_str = 0
cdef void *km
cdef cmappy.mm_mapopt_t map_opt
if self._idx == NULL: return
map_opt = self.map_opt
if max_frag_len is not None: map_opt.max_frag_len = max_frag_len
if extra_flags is not None: map_opt.flag |= extra_flags
if self._idx is NULL: return None
if buf is None: b = ThreadBuffer()
else: b = buf
km = cmappy.mm_tbuf_get_km(b._b)
_seq = seq if isinstance(seq, bytes) else seq.encode()
if seq2 is None:
regs = cmappy.mm_map_aux(self._idx, _seq, NULL, &n_regs, b._b, &map_opt)
else:
_seq2 = seq2 if isinstance(seq2, bytes) else seq2.encode()
regs = cmappy.mm_map_aux(self._idx, _seq, _seq2, &n_regs, b._b, &map_opt)
try:
i = 0
while i < n_regs:
cmappy.mm_reg2hitpy(self._idx, &regs[i], &h)
cigar, _cs, _MD = [], '', ''
for k in range(h.n_cigar32): # convert the 32-bit CIGAR encoding to Python array
c = h.cigar32[k]
cigar.append([c>>4, c&0xf])
if cs or MD: # generate the cs and/or the MD tag, if requested
if cs:
l_cs_str = cmappy.mm_gen_cs(km, &cs_str, &m_cs_str, self._idx, &regs[i], _seq, 1)
_cs = cs_str[:l_cs_str] if isinstance(cs_str, str) else cs_str[:l_cs_str].decode()
if MD:
l_cs_str = cmappy.mm_gen_MD(km, &cs_str, &m_cs_str, self._idx, &regs[i], _seq)
_MD = cs_str[:l_cs_str] if isinstance(cs_str, str) else cs_str[:l_cs_str].decode()
yield Alignment(h.ctg, h.ctg_len, h.ctg_start, h.ctg_end, h.strand, h.qry_start, h.qry_end, h.mapq, cigar, h.is_primary, h.mlen, h.blen, h.NM, h.trans_strand, h.seg_id, _cs, _MD)
cmappy.mm_free_reg1(&regs[i])
i += 1
finally:
while i < n_regs:
cmappy.mm_free_reg1(&regs[i])
i += 1
free(regs)
free(cs_str)
def seq(self, str name, int start=0, int end=0x7fffffff):
cdef int l
cdef char *s
if self._idx == NULL: return
s = cmappy.mappy_fetch_seq(self._idx, name.encode(), start, end, &l)
if l == 0: return None
r = s[:l] if isinstance(s, str) else s[:l].decode()
free(s)
return r
@property
def k(self): return self._idx.k
@property
def w(self): return self._idx.w
@property
def n_seq(self): return self._idx.n_seq
@property
def seq_names(self):
cdef char *p
if self._idx == NULL: return
sn = []
for i in range(self._idx.n_seq):
p = self._idx.seq[i].name
s = p if isinstance(p, str) else p.decode()
sn.append(s)
return sn
def fastx_read(fn, read_comment=False):
cdef cmappy.kseq_t *ks
ks = cmappy.mm_fastx_open(str.encode(fn))
if ks is NULL: return None
while cmappy.kseq_read(ks) >= 0:
if ks.qual.l > 0: qual = ks.qual.s if isinstance(ks.qual.s, str) else ks.qual.s.decode()
else: qual = None
name = ks.name.s if isinstance(ks.name.s, str) else ks.name.s.decode()
seq = ks.seq.s if isinstance(ks.seq.s, str) else ks.seq.s.decode()
if read_comment:
if ks.comment.l > 0: comment = ks.comment.s if isinstance(ks.comment.s, str) else ks.comment.s.decode()
else: comment = None
yield name, seq, qual, comment
else:
yield name, seq, qual
cmappy.mm_fastx_close(ks)
def revcomp(seq):
l = len(seq)
bseq = seq if isinstance(seq, bytes) else seq.encode()
cdef char *s = cmappy.mappy_revcomp(l, bseq)
r = s[:l] if isinstance(s, str) else s[:l].decode()
free(s)
return r
def verbose(v=None):
if v is None: v = -1
return cmappy.mm_verbose_level(v)
+39
View File
@@ -0,0 +1,39 @@
#!/usr/bin/env python
import sys
import getopt
import mappy as mp
def main(argv):
opts, args = getopt.getopt(argv[1:], "x:n:m:k:w:r:c")
if len(args) < 2:
print("Usage: minimap2.py [options] <ref.fa>|<ref.mmi> <query.fq>")
print("Options:")
print(" -x STR preset: sr, map-pb, map-ont, asm5, asm10 or splice")
print(" -n INT mininum number of minimizers")
print(" -m INT mininum chaining score")
print(" -k INT k-mer length")
print(" -w INT minimizer window length")
print(" -r INT band width")
print(" -c output the cs tag")
sys.exit(1)
preset = min_cnt = min_sc = k = w = bw = None
out_cs = False
for opt, arg in opts:
if opt == '-x': preset = arg
elif opt == '-n': min_cnt = int(arg)
elif opt == '-m': min_chain_score = int(arg)
elif opt == '-r': bw = int(arg)
elif opt == '-k': k = int(arg)
elif opt == '-w': w = int(arg)
elif opt == '-c': out_cs = True
a = mp.Aligner(args[0], preset=preset, min_cnt=min_cnt, min_chain_score=min_sc, k=k, w=w, bw=bw)
if not a: raise Exception("ERROR: failed to load/build index file '{}'".format(args[0]))
for name, seq, qual in mp.fastx_read(args[1]): # read one sequence
for h in a.map(seq, cs=out_cs): # traverse hits
print('{}\t{}\t{}'.format(name, len(seq), h))
if __name__ == "__main__":
main(sys.argv)
+11 -9
View File
@@ -56,6 +56,7 @@ sdust_buf_t *sdust_buf_init(void *km)
buf = (sdust_buf_t*)kcalloc(km, 1, sizeof(sdust_buf_t));
buf->km = km;
buf->w = kdq_init(int, buf->km);
kdq_resize(int, buf->w, 8);
return buf;
}
@@ -69,10 +70,10 @@ void sdust_buf_destroy(sdust_buf_t *buf)
static inline void shift_window(int t, kdq_t(int) *w, int T, int W, int *L, int *rw, int *rv, int *cw, int *cv)
{
int s;
if (kdq_size(w) >= W - SD_WLEN + 1) { // TODO: is this right for SD_WLEN!=3?
if ((int)kdq_size(w) >= W - SD_WLEN + 1) { // TODO: is this right for SD_WLEN!=3?
s = *kdq_shift(int, w);
*rw -= --cw[s];
if (*L > kdq_size(w))
if (*L > (int)kdq_size(w))
--*L, *rv -= --cv[s];
}
kdq_push(int, w, t);
@@ -113,7 +114,7 @@ static void find_perfect(void *km, perf_intv_v *P, const kdq_t(int) *w, int T, i
r += c[t]++;
new_r = r, new_l = kdq_size(w) - i - 1;
if (new_r * 10 > T * new_l) {
for (j = 0; j < P->n && P->a[j].start >= i + start; ++j) { // find insertion position
for (j = 0; j < (int)P->n && P->a[j].start >= i + start; ++j) { // find insertion position
perf_intv_t *p = &P->a[j];
if (max_r == 0 || p->r * max_l > max_r * p->l)
max_r = p->r, max_l = p->l;
@@ -176,7 +177,7 @@ uint64_t *sdust(void *km, const uint8_t *seq, int l_seq, int T, int W, int *n)
#ifdef _SDUST_MAIN
#include <zlib.h>
#include <stdio.h>
#include "getopt.h"
#include "ketopt.h"
#include "kseq.h"
KSEQ_INIT(gzFile, gzread)
@@ -185,16 +186,17 @@ int main(int argc, char *argv[])
gzFile fp;
kseq_t *ks;
int W = 64, T = 20, c;
ketopt_t o = KETOPT_INIT;
while ((c = getopt(argc, argv, "w:t:")) >= 0) {
if (c == 'w') W = atoi(optarg);
else if (c == 't') T = atoi(optarg);
while ((c = ketopt(&o, argc, argv, 1, "w:t:", 0)) >= 0) {
if (c == 'w') W = atoi(o.arg);
else if (c == 't') T = atoi(o.arg);
}
if (optind == argc) {
if (o.ind == argc) {
fprintf(stderr, "Usage: sdust [-w %d] [-t %d] <in.fa>\n", W, T);
return 1;
}
fp = strcmp(argv[optind], "-")? gzopen(argv[optind], "r") : gzdopen(fileno(stdin), "r");
fp = strcmp(argv[o.ind], "-")? gzopen(argv[o.ind], "r") : gzdopen(fileno(stdin), "r");
ks = kseq_init(fp);
while (kseq_read(ks) >= 0) {
uint64_t *r;
+131
View File
@@ -0,0 +1,131 @@
#include "mmpriv.h"
#include "kalloc.h"
#include "ksort.h"
void mm_seed_mz_flt(void *km, mm128_v *mv, int32_t q_occ_max, float q_occ_frac)
{
mm128_t *a;
size_t i, j, st;
if (mv->n <= q_occ_max || q_occ_frac <= 0.0f || q_occ_max <= 0) return;
KMALLOC(km, a, mv->n);
for (i = 0; i < mv->n; ++i)
a[i].x = mv->a[i].x, a[i].y = i;
radix_sort_128x(a, a + mv->n);
for (st = 0, i = 1; i <= mv->n; ++i) {
if (i == mv->n || a[i].x != a[st].x) {
int32_t cnt = i - st;
if (cnt > q_occ_max && cnt > mv->n * q_occ_frac)
for (j = st; j < i; ++j)
mv->a[a[j].y].x = 0;
st = i;
}
}
kfree(km, a);
for (i = j = 0; i < mv->n; ++i)
if (mv->a[i].x != 0)
mv->a[j++] = mv->a[i];
mv->n = j;
}
mm_seed_t *mm_seed_collect_all(void *km, const mm_idx_t *mi, const mm128_v *mv, int32_t *n_m_)
{
mm_seed_t *m;
size_t i;
int32_t k;
m = (mm_seed_t*)kmalloc(km, mv->n * sizeof(mm_seed_t));
for (i = k = 0; i < mv->n; ++i) {
const uint64_t *cr;
mm_seed_t *q;
mm128_t *p = &mv->a[i];
uint32_t q_pos = (uint32_t)p->y, q_span = p->x & 0xff;
int t;
cr = mm_idx_get(mi, p->x>>8, &t);
if (t == 0) continue;
q = &m[k++];
q->q_pos = q_pos, q->q_span = q_span, q->cr = cr, q->n = t, q->seg_id = p->y >> 32;
q->is_tandem = q->flt = 0;
if (i > 0 && p->x>>8 == mv->a[i - 1].x>>8) q->is_tandem = 1;
if (i < mv->n - 1 && p->x>>8 == mv->a[i + 1].x>>8) q->is_tandem = 1;
}
*n_m_ = k;
return m;
}
#define MAX_MAX_HIGH_OCC 128
void mm_seed_select(int32_t n, mm_seed_t *a, int len, int max_occ, int max_max_occ, int dist)
{ // for high-occ minimizers, choose up to max_high_occ in each high-occ streak
extern void ks_heapdown_uint64_t(size_t i, size_t n, uint64_t*);
extern void ks_heapmake_uint64_t(size_t n, uint64_t*);
int32_t i, last0, m;
uint64_t b[MAX_MAX_HIGH_OCC]; // this is to avoid a heap allocation
if (n == 0 || n == 1) return;
for (i = m = 0; i < n; ++i)
if (a[i].n > max_occ) ++m;
if (m == 0) return; // no high-frequency k-mers; do nothing
for (i = 0, last0 = -1; i <= n; ++i) {
if (i == n || a[i].n <= max_occ) {
if (i - last0 > 1) {
int32_t ps = last0 < 0? 0 : (uint32_t)a[last0].q_pos>>1;
int32_t pe = i == n? len : (uint32_t)a[i].q_pos>>1;
int32_t j, k, st = last0 + 1, en = i;
int32_t max_high_occ = (int32_t)((double)(pe - ps) / dist + .499);
if (max_high_occ > 0) {
if (max_high_occ > MAX_MAX_HIGH_OCC)
max_high_occ = MAX_MAX_HIGH_OCC;
for (j = st, k = 0; j < en && k < max_high_occ; ++j, ++k)
b[k] = (uint64_t)a[j].n<<32 | j;
ks_heapmake_uint64_t(k, b); // initialize the binomial heap
for (; j < en; ++j) { // if there are more, choose top max_high_occ
if (a[j].n < (int32_t)(b[0]>>32)) { // then update the heap
b[0] = (uint64_t)a[j].n<<32 | j;
ks_heapdown_uint64_t(0, k, b);
}
}
for (j = 0; j < k; ++j) a[(uint32_t)b[j]].flt = 1;
}
for (j = st; j < en; ++j) a[j].flt ^= 1;
for (j = st; j < en; ++j)
if (a[j].n > max_max_occ)
a[j].flt = 1;
}
last0 = i;
}
}
}
mm_seed_t *mm_collect_matches(void *km, int *_n_m, int qlen, int max_occ, int max_max_occ, int dist, const mm_idx_t *mi, const mm128_v *mv, int64_t *n_a, int *rep_len, int *n_mini_pos, uint64_t **mini_pos)
{
int rep_st = 0, rep_en = 0, n_m, n_m0;
size_t i;
mm_seed_t *m;
*n_mini_pos = 0;
*mini_pos = (uint64_t*)kmalloc(km, mv->n * sizeof(uint64_t));
m = mm_seed_collect_all(km, mi, mv, &n_m0);
if (dist > 0 && max_max_occ > max_occ) {
mm_seed_select(n_m0, m, qlen, max_occ, max_max_occ, dist);
} else {
for (i = 0; i < n_m0; ++i)
if (m[i].n > max_occ)
m[i].flt = 1;
}
for (i = 0, n_m = 0, *rep_len = 0, *n_a = 0; i < n_m0; ++i) {
mm_seed_t *q = &m[i];
//fprintf(stderr, "X\t%d\t%d\t%d\n", q->q_pos>>1, q->n, q->flt);
if (q->flt) {
int en = (q->q_pos >> 1) + 1, st = en - q->q_span;
if (st > rep_en) {
*rep_len += rep_en - rep_st;
rep_st = st, rep_en = en;
} else rep_en = en;
} else {
*n_a += q->n;
(*mini_pos)[(*n_mini_pos)++] = (uint64_t)q->q_span<<32 | q->q_pos>>1;
m[n_m++] = *q;
}
}
*rep_len += rep_en - rep_st;
*_n_m = n_m;
return m;
}
+55
View File
@@ -0,0 +1,55 @@
try:
from setuptools import setup, Extension
except ImportError:
from distutils.core import setup
from distutils.extension import Extension
import sys, platform
sys.path.append('python')
extra_compile_args = ['-DHAVE_KALLOC']
include_dirs = ["."]
if platform.machine() in ["aarch64", "arm64"]:
include_dirs.append("sse2neon/")
extra_compile_args.extend(['-ftree-vectorize', '-DKSW_SSE2_ONLY', '-D__SSE2__'])
else:
extra_compile_args.append('-msse4.1') # WARNING: ancient x86_64 CPUs don't have SSE4
def readme():
with open('python/README.rst') as f:
return f.read()
setup(
name = 'mappy',
version = '2.24',
url = 'https://github.com/lh3/minimap2',
description = 'Minimap2 python binding',
long_description = readme(),
author = 'Heng Li',
author_email = 'lh3@me.com',
license = 'MIT',
keywords = 'sequence-alignment',
scripts = ['python/minimap2.py'],
ext_modules = [Extension('mappy',
sources = ['python/mappy.pyx', 'align.c', 'bseq.c', 'lchain.c', 'seed.c', 'format.c', 'hit.c', 'index.c', 'pe.c', 'options.c',
'ksw2_extd2_sse.c', 'ksw2_exts2_sse.c', 'ksw2_extz2_sse.c', 'ksw2_ll_sse.c',
'kalloc.c', 'kthread.c', 'map.c', 'misc.c', 'sdust.c', 'sketch.c', 'esterr.c', 'splitidx.c'],
depends = ['minimap.h', 'bseq.h', 'kalloc.h', 'kdq.h', 'khash.h', 'kseq.h', 'ksort.h',
'ksw2.h', 'kthread.h', 'kvec.h', 'mmpriv.h', 'sdust.h',
'python/cmappy.h', 'python/cmappy.pxd'],
extra_compile_args = extra_compile_args,
include_dirs = include_dirs,
libraries = ['z', 'm', 'pthread'])],
classifiers = [
'Development Status :: 5 - Production/Stable',
'License :: OSI Approved :: MIT License',
'Operating System :: POSIX',
'Programming Language :: C',
'Programming Language :: Cython',
'Programming Language :: Python :: 2.7',
'Programming Language :: Python :: 3',
'Intended Audience :: Science/Research',
'Topic :: Scientific/Engineering :: Bio-Informatics'],
setup_requires=["cython"])
+22 -21
View File
@@ -2,25 +2,26 @@
#include <stdlib.h>
#include <assert.h>
#include <string.h>
#define __STDC_LIMIT_MACROS
#include "kvec.h"
#include "minimap.h"
#include "mmpriv.h"
unsigned char seq_nt4_table[256] = {
0, 1, 2, 3, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
0, 1, 2, 3, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
4, 0, 4, 1, 4, 4, 4, 2, 4, 4, 4, 4, 4, 4, 4, 4,
4, 4, 4, 4, 3, 3, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
4, 0, 4, 1, 4, 4, 4, 2, 4, 4, 4, 4, 4, 4, 4, 4,
4, 4, 4, 4, 3, 3, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
4, 0, 4, 1, 4, 4, 4, 2, 4, 4, 4, 4, 4, 4, 4, 4,
4, 4, 4, 4, 3, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
4, 0, 4, 1, 4, 4, 4, 2, 4, 4, 4, 4, 4, 4, 4, 4,
4, 4, 4, 4, 3, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4
};
@@ -101,34 +102,34 @@ void mm_sketch(void *km, const char *str, int len, int w, int k, uint32_t rid, i
tq_push(&tq, skip_len);
kmer_span += skip_len;
if (tq.count > k) kmer_span -= tq_shift(&tq);
if (kmer_span >= 256) continue; // make sure $kmer_span does not take more than 8 bits
} else kmer_span = l + 1 < k? l + 1 : k;
kmer[0] = (kmer[0] << 2 | c) & mask; // forward k-mer
kmer[1] = (kmer[1] >> 2) | (3ULL^c) << shift1; // reverse k-mer
if (kmer[0] == kmer[1]) continue; // skip "symmetric k-mers" as we don't know it strand
z = kmer[0] < kmer[1]? 0 : 1; // strand
if (++l >= k) {
++l;
if (l >= k && kmer_span < 256) {
info.x = hash64(kmer[z], mask) << 8 | kmer_span;
info.y = (uint64_t)rid<<32 | (uint32_t)i<<1 | z;
}
} else l = 0, tq.count = tq.front = 0, kmer_span = 0;
buf[buf_pos] = info; // need to do this here as appropriate buf_pos and buf[buf_pos] are needed below
if (l == w + k - 1) { // special case for the first window - because identical k-mers are not stored yet
if (l == w + k - 1 && min.x != UINT64_MAX) { // special case for the first window - because identical k-mers are not stored yet
for (j = buf_pos + 1; j < w; ++j)
if (min.x == buf[j].x && buf[j].y != min.y) kv_push(mm128_t, km, *p, buf[j]);
for (j = 0; j < buf_pos; ++j)
if (min.x == buf[j].x && buf[j].y != min.y) kv_push(mm128_t, km, *p, buf[j]);
}
if (info.x <= min.x) { // a new minimum; then write the old min
if (l >= w + k) kv_push(mm128_t, km, *p, min);
if (l >= w + k && min.x != UINT64_MAX) kv_push(mm128_t, km, *p, min);
min = info, min_pos = buf_pos;
} else if (buf_pos == min_pos) { // old min has moved outside the window
if (l >= w + k - 1) kv_push(mm128_t, km, *p, min);
if (l >= w + k - 1 && min.x != UINT64_MAX) kv_push(mm128_t, km, *p, min);
for (j = buf_pos + 1, min.x = UINT64_MAX; j < w; ++j) // the two loops are necessary when there are identical k-mers
if (min.x >= buf[j].x) min = buf[j], min_pos = j; // >= is important s.t. min is always the closest k-mer
for (j = 0; j <= buf_pos; ++j)
if (min.x >= buf[j].x) min = buf[j], min_pos = j;
if (l >= w + k - 1) { // write identical k-mers
if (l >= w + k - 1 && min.x != UINT64_MAX) { // write identical k-mers
for (j = buf_pos + 1; j < w; ++j) // these two loops make sure the output is sorted
if (min.x == buf[j].x && min.y != buf[j].y) kv_push(mm128_t, km, *p, buf[j]);
for (j = 0; j <= buf_pos; ++j)
+84
View File
@@ -0,0 +1,84 @@
#include <string.h>
#include <assert.h>
#include <stdlib.h>
#include <stdio.h>
#include <errno.h>
#include "mmpriv.h"
FILE *mm_split_init(const char *prefix, const mm_idx_t *mi)
{
char *fn;
FILE *fp;
uint32_t i, k = mi->k;
fn = (char*)calloc(strlen(prefix) + 10, 1);
sprintf(fn, "%s.%.4d.tmp", prefix, mi->index);
if ((fp = fopen(fn, "wb")) == NULL) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m failed to write to temporary file '%s'\033[0m: %s\n", fn, strerror(errno));
exit(1);
}
mm_err_fwrite(&k, 4, 1, fp);
mm_err_fwrite(&mi->n_seq, 4, 1, fp);
for (i = 0; i < mi->n_seq; ++i) {
uint32_t l;
l = strlen(mi->seq[i].name);
mm_err_fwrite(&l, 1, 4, fp);
mm_err_fwrite(mi->seq[i].name, 1, l, fp);
mm_err_fwrite(&mi->seq[i].len, 4, 1, fp);
}
free(fn);
return fp;
}
mm_idx_t *mm_split_merge_prep(const char *prefix, int n_splits, FILE **fp, uint32_t *n_seq_part)
{
mm_idx_t *mi = 0;
char *fn;
int i, j;
if (n_splits < 1) return 0;
fn = CALLOC(char, strlen(prefix) + 10);
for (i = 0; i < n_splits; ++i) {
sprintf(fn, "%s.%.4d.tmp", prefix, i);
if ((fp[i] = fopen(fn, "rb")) == 0) {
if (mm_verbose >= 1)
fprintf(stderr, "ERROR: failed to open temporary file '%s': %s\n", fn, strerror(errno));
for (j = 0; j < i; ++j)
fclose(fp[j]);
free(fn);
return 0;
}
}
free(fn);
mi = CALLOC(mm_idx_t, 1);
for (i = 0; i < n_splits; ++i) {
mm_err_fread(&mi->k, 4, 1, fp[i]); // TODO: check if k is all the same
mm_err_fread(&n_seq_part[i], 4, 1, fp[i]);
mi->n_seq += n_seq_part[i];
}
mi->seq = CALLOC(mm_idx_seq_t, mi->n_seq);
for (i = j = 0; i < n_splits; ++i) {
uint32_t k;
for (k = 0; k < n_seq_part[i]; ++k, ++j) {
uint32_t l;
mm_err_fread(&l, 1, 4, fp[i]);
mi->seq[j].name = (char*)calloc(l + 1, 1);
mm_err_fread(mi->seq[j].name, 1, l, fp[i]);
mm_err_fread(&mi->seq[j].len, 4, 1, fp[i]);
}
}
return mi;
}
void mm_split_rm_tmp(const char *prefix, int n_splits)
{
int i;
char *fn;
fn = CALLOC(char, strlen(prefix) + 10);
for (i = 0; i < n_splits; ++i) {
sprintf(fn, "%s.%.4d.tmp", prefix, i);
remove(fn);
}
free(fn);
}
+1689
View File
File diff suppressed because it is too large Load Diff
+1 -1
View File
@@ -1,4 +1,4 @@
>MT_orang
>MT_orang co:Z:comment
GTTTATGTAGCTTATTCTATCCAAAGCAATGCACTGAAAATGTCTCGACGGGCCCACACG
CCCCATAAACAAATAGGTTTGGTCCTAGCCTTTCTATTAGCTCTTAGTGAGGTTACACAT
GCAAGCATCCCCGCCCCAGTGAGTCGCCCTCCAAGTCACTCTGACTAAGAGGAGCAAGCA
+4
View File
File diff suppressed because one or more lines are too long
+127
View File
@@ -0,0 +1,127 @@
>ref
TGCGGAGGCTGAAGCAACTCCATCTTGGAAGCTAATCTACCATGTTGGCTTCTGATTAAC
ATCAGTTCTGGGAAGGCTTGTAAGATTTCCTGTTTGTCTATTATTTCCTAGGTAAGAGCA
GATACTTACTGTAAATCCTGCCCCTAGATTAAACAACCTTGGTGTTATCGTACTTCCATT
GTCCTATACATCCCTTCGGAATCCCCCTTTCCCTATGGTCCTCAAGCCCTTGGTCTGGGG
AGTAACAGCATAGGGATCAACCATCTCGTCTTGCCACTGCCCGAAATACAGACATGGCTT
CTGTTCCTAAGTCCCTATTCAACTTTTCTTTCTAAGAAACTGGATTTGTCAGCCTCTTTC
TTCACCTCTCAGCTTCCTTGGACTTTGGGGGTAGGTTTGCGTAGACATGCTCACCACAGA
CACAATATCAGCTTCATTCTACAGATGAGGAAGGCAAGCCTTGGGGAGCTTAACCAACTT
GTCGAGACTCATGTATATACCAACACTGAAAAGCAGATATTCCAGACTCCCAGTCATGCC
ACAGGCACACCCCTCAGTGAGAGGTGGGGTTTGTAGTTGAGGCTATTTCCTGCCCAGGGA
GCAGGGAGGCACTCTAGCTTCCCTGAGCTAACGTGGTTCTGCTTGTGTCTGACTTCCAGG
TCTCTGCCCTTTCCAAGCTCACTAGGATGGGCTTCGGGTGTGTCAAATGCCTCAGACAGT
ACAGATCCACACAGAATGGGCATATGCAACCAATCAGTGTCATAAAAAAGAAGGAAATGA
CTCGGGCCCCCTGTGTGTTCAACATGTCGAAGGTATCTGTGCAGCAGAAGAAAGAGGGGC
AAAAGCCCCCAGTGCCACAGGCCAGAGGCAGCAGCTTGGGCCCATGTGGGAGGGTTTGCT
TTCCCCTGCCAAAGTGATGGGCTGCTGCAGCCTGGGGCTTGTGGGAATCCTTCCTGGGCC
TGTGTGGGAAGTGTAGGCAGGGAGAGTGCTGCTTTCCCAAGCTCATCCCAGCTACAGCTA
CCTTTGTGCTCTGGGATTCAGGACCCCCGAGGGGGCTGGCAGGAGAGTCTCTGTTCTCGG
ATGGGTTGTCACCAGGGCATACATGGGAAGTGGGCTCTCTGGAGTCACCCTCCAGGGGAC
AATGCCAATTCCAGACACATTTACTGGAACCCCTACACTGATGACCTTTTGTTGAGGGTT
GAATTATGTCCCCAAAAAAGATACATTGAAGTCCAAACCTCTGGTGTCTATAAATGTGAT
TTTATTTGAAAATGAGGTTTCTATGGACTAAATTGTGTCCCTCCCAAATTCATATTTTGA
AGCCCTAGCCCCCAGTGTGACTATACCTAGAGACAGAGATCTTTAGGAGGTAATTAAGGT
TCAATGAGGTCAGGTGGGTGGGGCCCTAAACCAACAGGAAGGACTGTGGCCTTACTAGAA
AAGGAAGAAAAAGCATTTCCTCTCTTCTAGTATAAAAGGACACAGAAAGAAGGCAGATAT
CTACAAGCCACGAAGAGAGACGTCACTGAGAACTGAATTTGTGTACATTGATCTGGAACT
TCCAGCCTCCAGAACTTGAGAAATACATTTCTGTTGTTTATTTTTTTTTCATGTAATCAA
TTCATTTATCATATATTTATTGAGTGCCTACTATGTGCCAGAGGATACAGCAGTAACAAA
ACTAGGCAAAAATTGTGCCTAAAAGAGGGAAGATGACTTTTCTTAAAGTGTGGAATAAAG
AAAAGTAAGATAGCGGATAGAAGCTTGAAGTGAAAGCAGGTTCACAGGAAGTTTCTTTGG
TCATTTGTTTTGTTTTTAAATAGTGGAAAGATGTATATGTTTATGGAGAAAGATTGCCTT
GAAGATGCAAGAGGAAGAGATGATCAAAATTCAAGAAGAAGCAGAAAGTGATAGAATAAA
GAGCACAAGTGGAGAATTAGTGTTAATGAAAAGAAGGATGCTTCCTTTGATATGAAGTGA
AGGAAGAGAGAATGAGTAAAGACCAAGACTTGAAGTCCCTAGTTTAATAGAGGGAGATTT
CTTCTTTTGATAGCAACAATGGTATTCTGAATTATTTGAAGACATGTCATATTTCTCTTG
TGCCATTTTCCTCCCAGTTTAAACATTCTCATAACCTCTATTCCTCACATGATGTTTTTC
CAGGTCCTTTATTCTTTGGCACTCTCTTCTCTGGACACATTGTATTCTGTCATTGGTCCT
AAAATTTAGATACCCACAATTGAACATACTCCTCTAGATATGGTCTAGCTAATGCAAAAG
AACTGCTGCCTTCCAACTTGTTCAGACATCATATGTTTGTTGTCAAACGCTAAGTTGAGT
TGTTATCTTTTAAGTTTTGTTTTTGTTTTTTTTTTTTTTTTTTAATTCCAAGAGGTGCCC
ACGTTGGCTAAGTACCAAACAGGGTACTAGGGAATTTTACTTCTGAGTTAAATGCCATTC
TAGTTGTTTTTTCTTCATCTCCAGTAAGGTTATCTTTATTCACCAGTTGTTACAATAGCT
GTGGGTCTTGCTTCTCACAGTTTTATGCTGTCTGTGCTATTTTCTCTACTGATCATCACC
ACAATCATTATTGCTTATCATAATTGTTATCTTTATTTTCTCCTTTAATCAAGAATCAGT
CTTCCTTTATCTCATTATTCTCTTTTGCAGGCTTCAGGATAATTATGGTTGGAGTGCACT
GGGGGAACCAGTGCAGCTAAGCTCTGACATCTTTGCATCCCTTTTCCATCTGCTGTTTTG
GCACTCTGGTAGAATAGATAACCTAAAAACGACTTTAAAACATCTAGAAATTTTGGATAA
AATATAACAAACATCCCTTTAAATGCACAACTGATCTTCCATGGAAGTCACAGAAATATA
TAACGCCAAAAAGAAGGGAAGCTGAAACCCAGGGCTGTAAACATGAACATCATCTTCTCT
CCCTTTTTCTTGTGACTTATCTTGTTTTTCTCAGCTTTGGTGCTACCAAGGCTTGACTTT
AATAGGCATTTCCAATCAATGAGAGAATTTCTTTTGCTTTCATCAACAATTCAGTTATTG
ATGTTAACATATATATCATTTGAGTACTTTTCTTTTTTTTATTATTATTATACTTTAAGT
TTTAGGGTCCATGTGCACAATGTGCAGGTTAGTTACGTATGTATACATGTGCCATGCTGG
TGTGCTGCACCCATTAACTCATCATTTAGCATTAGGTATATCTCCTAATGCTATCCCTTC
CCCCTCTCCCCACCCCACAACAGTCCCCAGAGTGTTCCCCTTCCTGTGTCCATGTGTTCT
CATTGTTCAATCCCCATCTATGAGTGAGAACATGCGGTGTTTGGTTTTTTGTCCTTGCAA
TAGTTTACTGAGAATGATGATTTCTAATTTCATCCATGTCCCTAAAGAGCTTCTGCACAG
CAAAAGAAACTACCATCAGAGTGAACAGGCAACCTACAAAATGGGAGAAAATTTTCACAA
CCTGCTCATCTGACAAAGGGCTAATATCCAGAATCTACAATGAACTCAAACAAATTTACA
AGAAAAAAACAAACAACCCCATCAAAAAGTGGGCAAAGGATATGAACAGACACTTCTCAA
AAGAAGACATTTATGCAGCCAAAAGACACATGAAAAAATGCTCATCATCACTGGCCATCA
GAGAAATGCAAACCAAAACCACAATGAGATACCATCTCACACCAGTTAAAATGGCAATCA
TTAAAAAGTCAGGAAACAACAGGTGCTGGAGAGGATGTGGAGAAACAGGAACACTTTTAC
ACTGTTGGTGGGACTGTAAACTAGTTCAACCATTGTGGAAGTCAGTGTGCTGATTCCTCA
GGGATCTAGAACTAGAAATACCATTTGACCCAGCCATCCCATTACTGGGTATATACCCAA
AGGACTATAAATCATGCTGCTATAAAGACACATGCACACGTATGTTTATTGCGGCACTAT
TCACAATAGCAAAGACTTGGAACCAACCCAAATGTCCAACAATGATAGACTGGATTAAGA
AAATGTGGCACATATACACCACGGAATACTGTGCAGCCATAAAAAATGATGAGTTCATGT
CCTTTGTAGGGACACGGATGAAATTGGAAATCATTTCTGTTGTTTAAACCACGAAGTCTA
TGGTATCTGGTTATGACAACCTGAGAATACTAACTCAAGGGTCTTTCGCAGATGTCATTA
AGTTGTTAAAGTGAGGTCATTATGGTGGGTCCTAATCCAAGAGAAGAGATGCATGGACAG
ACGTGCACAACGGGAGGACCAAGCCAAGACACACAGGGAGAATGGCCATGGGAAGATGGA
GGCAGAGATCAAAGTGAGGCACCCACAAGCCAAGAAATGGCAGGAGCTACCAGCAGCTGG
AAGATGCAGAGAAGCATTCCTTCTTAGAGGTTTCAGAGAGAGTATGGTGCTACTGACACC
TTGATTTTGAACTTCTAGTCTCCAGAACTATGAGAGAATAAATTTCTGTTGGTTAAGCCA
TCGAGTTTGTGTAAGTTTGTTATAAGAGCCCTAGGAAATAAACATATCCATTTATTCAGG
AAAGCCTGCTAGAGTGCAAATATTTGGAAAAGATACTACTATGCAAATGTTTGAAAAAGA
TATTGCTCTTGATTCTGCCTTATGGGTTTTTCATTTCTGTAAGCTATTCTCAAAGTTTTG
TTCTTGGACTACTATTGGTAATTAAGACTGCAACATGTTTGGCAACATCAGTTGAGAACT
GTTGCTCTGGGAACGTTTTCGGCAAGCCTCAGCCCTTCTTTTCCCTTGGCTTGCATTGAG
GAGTTAGGTGATACTCTGCTGCTCAGGCCCAGCACCTTTATGGACCGTATTCCCCTGGTG
GAATGACCATCTCTGCTTGCTCTGATTGGCTGTTGGGGTTTTCTAGCATGCCCTATTTAA
TATGTATGATTTATCTCTTACTTCAGTTGGAAGGTACAGTTGCTCTGTAGTTGGCATGCA
GTCATGGTGACTATGAAAATATAAAATAATGTTTTGGTTTACAGACACTTAGAAATAAGT
TGTGTCTCAAAATTGGGTGACTATTCTAGTTATCTGCTACTCAATATCCTTGTGCGAGCC
CTCTTTACCCAGAATCAAACTAAACCATGAGGGGCACTATAGAATGTCACCCCTGGGTCC
AGGATACTATGGGGACTCAGAAGCCAAGCTCCCACTGGGGGATCTAGGGCATGCCCCCAA
GGTAAGATTCCCACCTCTTTGTTCAGCAGGAAGCACCCATCACACAAGGAGGTAGGAATA
AACAAGCATTCGTCAAGAACAAAAGATACAGATGTTCTGCTGGAGCTTGGATACATAGCA
TAAGAGGGAACAGTTCTCACAGGTAAGAGTAAGTTTTCCTCTGGTGGTGACAGTGGGACC
TGTGGGGGAGAGAATTGGGAGTACTGACAGGAAGGCAGAGTGGCTGTCCAAATGAACGGA
TTGTTTGCACATGGCCTTTAGGGCACGTTGTGTTAGCCTTCCATTGCTGCTTATATTAGT
CTGTTTTCACACTGCCCATAAATGCATACCTGAGACTGGATAATTTATAAAGAAAAAGAG
CCTTAATGTACTCATAGTTGCATGTGGCTGGGGAGGCCTCACAATCATGGCAGAAGGTGA
AAGGCACATCTTACATGGAAGCAGACAAGAGAGAATTGAGGACCAAGTGAAAGGGGTTTC
CCCTTATAAAACCATCAGATCACATGAGACTTTTTCACCACCATGAGAACAGTAAGGGGA
AAACTATGCTCATGATTCAATTGTCTCCCACTGGATTCCTCCCACAACACATAGGAATTA
TGGGAGCTAAAATTCAAGATGAGATTTGGGTGAGGACACAGCCAAACCCTATCACTGCTG
TAATCAATTCCCACCAACTTAGTGGCTCGAAACATCACAGATTTATGATCTTATGACGGT
GGAGGTCCCCAAATGGATCTTCTAGGTCTAGAATCAAGGTATCAGCAGACCACTTCTTTT
GGAGGCTCTGGTGGAGAAACCATTTCCTCGCCTTTTCCAGCTTCTAGAGGCTGCCCTTCT
CATTCCTTGGTTCACGGCCACACTCATTTCCATCTCTGCTTCCACTGTGACAACTTCTCT
GCCTCAGACCCTCCTGCTTTGCCTTTGTAAGGACCCTTGTGATGAGATCAGGCCCATCCA
GGATTATCCCTCATCTCAAGACCTTTACCTTAATCACATTTGCAAGGTCTCTTCCACTGT
GTCAGGTAACATTTTCACAGGTTCCAGGGATTAGGGTGTGGACATCTTGGGGAGCTGGAG
GATATTATTTCATCTACCACACACATCTCTACCTTGTACAGGCAAGCACTTGCAAAGTGC
AATGTGATCCTCTGGAGCCACTGTCCTCCCAGAGCTTATATATACTCTGAAAGTCAACTC
TCAGACCACAGCCTCCTGTCCATGCACCACTCTCATCAACACCCCCACCCGAAACACTTT
CACTCCACCCTCTTTGTCCCCTAACTCATGGAGAAGAAAATCTAATTAGTAGGAGTGGAA
TTTGGCTTTCATCTTTACCAGTACTAGAAATATGGTGTGTGTCTTTTTGTAAAAATTCTC
TCAACTAAATTGTTTTTATTAATTTCTGCAAAATGTGAACATCAACTCCCTTCATGTGAA
TGTCAATAAGATTAAATGAGCTGTCTCAGCTCCTAGCCTGTGCAAGCTAACAGCTCAGGA
GATGTTTATTTCTTTCCCTCTTCTTTCCTTAATGAAGCCCTCTCCTTTGACATCTTCAAT
TCTGGAGCGCTTCTTTTCTGAGGCCTTGGCTCCCCCACATTGCCCACCCTTTTCCTGCTC
GTCCACATTTCTGGCTTCTATTCTCTTGTCTTTACCATCTCCCTGAACAATGTTATCCGT
TCCAATGACTTCAACAGTCTCTCCGCTTACATATGATGCCTCTCAAACTCTGATCTCCAA
CTCTTCCAAAGAGCTCTGGACCTTTGTTCCAATTACCTGAAAAACATCTTCTTGGATGTC
CCATTAGCACTGTTAAATCAAACAAGAATTTCCCTCCCTCCTGCCTTGCTGTAGTTCCCC
TAGGGATTCGGTTGTGTGGGAAGATGTGTGGAGAGCTCTTAGTTGACTCCCTTCTCTGCA
GTTCTACCTCTCTAGAGACTTGGAGGACCCACTGTTTCCGCCTCGCTTTTTCAGGCCTAG
AGATTGCTCGCTCCTGGGCTGGCTGCTTCATAATTCCTTATTAGTAGTTTCCCAAGCTTA
CATATCTGTAAATATTTACTTTAGTTAAATTCTCCCCAATTTCCACAATATGTTGGCTGC
ACATGCTTTCTACTAGGAGTCACACAACTATGATAAGAACCAAGAAATATTAGTAAACGT
TTTTTACCATTATTGGCCTATACCCTGGAATAGCCAACAATAACCTAGAACCTATGCAAC
AAGAATATCCAACAAGAACCTAGAGACCTGTCAGTCTATAGGTGGGAACTACAGGATGAG
A
+28
View File
@@ -0,0 +1,28 @@
Q 42 16872292 669 0.000039651 16872292
Q 40 835329 636 0.000073697 17707621
Q 31 6544 2 0.000073783 17714165
Q 30 8882 6 0.000074084 17723047
Q 27 68499 9 0.000074305 17791546
Q 26 132041 81 0.000078277 17923587
Q 25 129378 96 0.000083033 18052965
Q 24 92056 382 0.000103665 18145021
Q 23 14341 402 0.000125720 18159362
Q 22 132838 146 0.000132789 18292200
Q 21 122274 124 0.000138641 18414474
Q 18 112183 103 0.000143361 18526657
Q 17 126981 213 0.000153804 18653638
Q 16 16356 208 0.000164810 18669994
Q 15 42804 782 0.000206223 18712798
Q 14 16026 318 0.000223025 18728824
Q 12 170250 814 0.000264087 18899074
Q 11 48351 1409 0.000337777 18947425
Q 8 1843 311 0.000354156 18949268
Q 7 62266 4435 0.000586276 19011534
Q 6 413997 50057 0.003150647 19425531
Q 5 404 58 0.003153568 19425935
Q 4 704 154 0.003161381 19426639
Q 3 1473 681 0.003196193 19428112
Q 2 17541 16462 0.004039875 19445653
Q 1 534344 354879 0.021693547 19979997
Q 0 11939 9917 0.022176642 19991936
U 8064
+52
View File
@@ -0,0 +1,52 @@
Q 60 18784147 3 0.000000160 18784147
Q 52 19002 1 0.000000213 18803149
Q 50 7152 2 0.000000319 18810301
Q 49 6797 1 0.000000372 18817098
Q 48 52188 2 0.000000477 18869286
Q 47 48775 3 0.000000634 18918061
Q 46 19447 2 0.000000739 18937508
Q 45 25983 3 0.000000896 18963491
Q 44 13455 1 0.000000949 18976946
Q 43 14573 2 0.000001053 18991519
Q 42 8697 4 0.000001263 19000216
Q 41 8645 2 0.000001368 19008861
Q 40 176603 75 0.000005264 19185464
Q 38 2503 2 0.000005368 19187967
Q 37 4117 3 0.000005523 19192084
Q 36 2924 16 0.000006356 19195008
Q 35 2323 8 0.000006772 19197331
Q 34 2344 10 0.000007292 19199675
Q 33 4279 6 0.000007603 19203954
Q 32 2092 4 0.000007810 19206046
Q 31 2625 11 0.000008382 19208671
Q 30 2828 13 0.000009057 19211499
Q 29 1581 1 0.000009108 19213080
Q 28 1543 6 0.000009420 19214623
Q 27 70916 223 0.000020948 19285539
Q 26 1288 16 0.000021777 19286827
Q 25 25551 122 0.000028065 19312378
Q 24 14345 84 0.000032390 19326723
Q 23 7308 87 0.000036878 19334031
Q 22 8358 125 0.000043325 19342389
Q 21 4836 71 0.000046983 19347225
Q 20 5888 123 0.000053325 19353113
Q 19 4656 83 0.000057600 19357769
Q 18 3948 87 0.000062081 19361717
Q 17 4418 114 0.000067954 19366135
Q 16 4226 131 0.000074702 19370361
Q 15 5760 164 0.000083144 19376121
Q 14 4697 257 0.000096384 19380818
Q 13 5246 313 0.000112503 19386064
Q 12 4170 241 0.000124908 19390234
Q 11 4095 304 0.000140557 19394329
Q 10 3857 360 0.000159087 19398186
Q 9 5300 438 0.000181617 19403486
Q 8 4206 572 0.000211050 19407692
Q 7 4676 787 0.000251541 19412368
Q 6 3923 688 0.000286924 19416291
Q 5 3294 708 0.000323333 19419585
Q 4 2936 693 0.000358965 19422521
Q 3 3928 816 0.000400897 19426449
Q 2 2613 810 0.000442533 19429062
Q 1 3515 1188 0.000503587 19432577
Q 0 567423 376636 0.019321100 20000000
+6
View File
@@ -2,3 +2,9 @@
bin/mason_variator -ir hs38.fa -s 1 -ov hs38-s1.vcf --snp-rate 1e-3 --small-indel-rate 2e-4 --sv-indel-rate 0 --sv-inversion-rate 0 --sv-translocation-rate 0 --sv-duplication-rate 0 --max-small-indel-size 10
bin/mason_simulator -ir hs38.fa -iv hs38-s1.vcf -n 1000000 --seed 1 -o s1_1.fq -or s1_2.fq -oa s1.sam --illumina-prob-mismatch-scale 2.5
bin/mason_variator -ir hs38.fa -s 2 -ov hs38-s2.vcf --snp-rate 1e-3 --small-indel-rate 2e-4 --sv-indel-rate 0 --sv-inversion-rate 0 --sv-translocation-rate 0 --sv-duplication-rate 0 --max-small-indel-size 10
bin/mason_simulator -ir hs38.fa -iv hs38-s2.vcf -n 1000000 --seed 2 -o mason-s2_1.fq -or mason-s2_2.fq -oa mason-s2.sam --illumina-prob-mismatch-scale 2.5 --illumina-read-length 150
bin/mason_variator -ir hs38.fa -s 3 -ov hs38-s3.vcf --snp-rate 1e-3 --small-indel-rate 2e-4 --sv-indel-rate 0 --sv-inversion-rate 0 --sv-translocation-rate 0 --sv-duplication-rate 0 --max-small-indel-size 10
bin/mason_simulator -ir hs38.fa -iv hs38-s3.vcf -n 10000000 --seed 3 -o mason-s3_1.fq -or mason-s3_2.fq -oa mason-s3.sam --illumina-prob-mismatch-scale 2.5 --illumina-read-length 150
+214 -15
View File
@@ -61,13 +61,6 @@
Volume = {32},
Year = {2016}}
@misc{Suzuki:2016,
title = {Fast and accurate alignment tool for PacBio and Nanopore long reads},
author = {Hajime Suzuki},
journal = {Unpublished},
howpublished = {\href{https://github.com/ocxtal/minialign}{https://github.com/ocxtal/minialign}},
year = {2016}}
@misc{Ruan:2016,
title = {Ultra-fast de novo assembler using long noisy reads},
author = {Jue Ruan},
@@ -172,14 +165,6 @@
Volume = {29},
Year = {2011}}
@article {Suzuki130633,
author = {Suzuki, Hajime and Kasahara, Masahiro},
title = {Acceleration Of Nucleotide Semi-Global Alignment With Adaptive Banded Dynamic Programming},
year = {2017},
note = {doi:10.1101/130633},
publisher = {Cold Spring Harbor Labs Journals},
journal = {bioRxiv}}
@article{Gotoh:1982aa,
Author = {Gotoh, O},
Journal = {J Mol Biol},
@@ -259,3 +244,217 @@
Title = {{Striped Smith-Waterman speeds database searches six times over other SIMD implementations}},
Volume = {23},
Year = {2007}}
@techreport{Holtgrewe:2010aa,
Address = {Freie Universit{\"a}t Berlin},
Author = {Holtgrewe, M.},
Institution = {Institut f{\"u}r Mathematik und Informatik},
Number = {TR-B-10-06},
Title = {Mason -- a read simulator for second generation sequencing data},
Year = {2010}}
@article{Zaharia:2011aa,
Author = {Zaharia, Matei and others},
Journal = {arXiv:1111:5572},
Title = {Faster and More Accurate Sequence Alignment with {SNAP}},
Year = {2011}}
@article{Irimia:2008aa,
Author = {Irimia, Manuel and Roy, Scott William},
Journal = {PLoS Genet},
Pages = {e1000148},
Title = {Evolutionary convergence on highly-conserved 3' intron structures in intron-poor eukaryotes and insights into the ancestral eukaryotic genome},
Volume = {4},
Year = {2008}}
@article{Depristo:2011vn,
Author = {Depristo, Mark A and others},
Journal = {Nat Genet},
Pages = {491-8},
Title = {A framework for variation discovery and genotyping using next-generation {DNA} sequencing data},
Volume = {43},
Year = {2011}}
@article{Kurtz:2004zr,
Author = {Kurtz, Stefan and others},
Journal = {Genome Biol},
Pages = {R12},
Title = {Versatile and open software for comparing large genomes},
Volume = {5},
Year = {2004}}
@article {Li223297,
author = {Li, Heng and others},
title = {New synthetic-diploid benchmark for accurate variant calling evaluation},
year = {2017},
note = {doi:10.1101/223297},
journal = {bioRxiv}
}
@article{Berlin:2015xy,
Author = {Berlin, Konstantin and others},
Journal = {Nat Biotechnol},
Pages = {623-30},
Title = {Assembling large genomes with single-molecule sequencing and locality-sensitive hashing},
Volume = {33},
Year = {2015}}
@article{Gurevich:2013aa,
Author = {Gurevich, Alexey and others},
Journal = {Bioinformatics},
Pages = {1072-5},
Title = {{QUAST}: quality assessment tool for genome assemblies},
Volume = {29},
Year = {2013}}
@article{Li:2010fk,
Author = {Li, Heng and Durbin, Richard},
Journal = {Bioinformatics},
Pages = {589-95},
Title = {Fast and accurate long-read alignment with {Burrows-Wheeler} transform},
Volume = {26},
Year = {2010}}
@article{Marcais:2018aa,
Author = {Mar{\c c}ais, Guillaume and others},
Journal = {PLoS Comput Biol},
Pages = {e1005944},
Title = {{MUMmer4}: A fast and versatile genome alignment system},
Volume = {14},
Year = {2018}}
@article{Li:2009ys,
Author = {Li, Heng and others},
Journal = {Bioinformatics},
Pages = {2078-9},
Title = {The {Sequence Alignment/Map format and SAMtools}},
Volume = {25},
Year = {2009}}
@article{Suzuki:2018aa,
Author = {Suzuki, Hajime and Kasahara, Masahiro},
Journal = {BMC Bioinformatics},
Pages = {45},
Title = {Introducing difference recurrence relations for faster semi-global alignment of long sequences},
Volume = {19},
Year = {2018}}
@article{Li:2018ab,
Author = {Li, Heng},
Journal = {Bioinformatics},
Pages = {3094-3100},
Title = {Minimap2: pairwise alignment for nucleotide sequences},
Volume = {34},
Year = {2018}}
@article{Jain:2020aa,
Author = {Jain, Chirag and others},
Journal = {Bioinformatics},
Pages = {i111-i118},
Title = {Weighted minimizer sampling improves long read mapping},
Volume = {36},
Year = {2020}}
@article{Miga:2020aa,
Author = {Miga, Karen H and others},
Journal = {Nature},
Pages = {79-84},
Title = {Telomere-to-telomere assembly of a complete human {X} chromosome},
Volume = {585},
Year = {2020}}
@article {Jain2020.11.01.363887,
author = {Jain, Chirag and others},
title = {A long read mapping method for highly repetitive reference sequences},
elocation-id = {2020.11.01.363887},
year = {2020},
doi = {10.1101/2020.11.01.363887},
publisher = {Cold Spring Harbor Laboratory},
URL = {https://www.biorxiv.org/content/early/2020/11/02/2020.11.01.363887},
eprint = {https://www.biorxiv.org/content/early/2020/11/02/2020.11.01.363887.full.pdf},
journal = {bioRxiv}
}
@article{Li:2020aa,
Author = {Li, Heng and others},
Journal = {Genome Biol},
Pages = {265},
Title = {The design and construction of reference pangenome graphs with minigraph},
Volume = {21},
Year = {2020}}
@article{Ren:2021aa,
Author = {Ren, Jingwen and Chaisson, Mark J P},
Journal = {PLoS Comput Biol},
Pages = {e1009078},
Title = {lra: A long read aligner for sequences and contigs},
Volume = {17},
Year = {2021}}
@inproceedings{DBLP:conf/wabi/AbouelhodaO03,
Author = {Mohamed Ibrahim Abouelhoda and Enno Ohlebusch},
Booktitle = {Algorithms in Bioinformatics, Third International Workshop, {WABI} 2003, Budapest, Hungary, September 15-20, 2003, Proceedings},
Crossref = {DBLP:conf/wabi/2003},
Pages = {1--16},
Title = {A Local Chaining Algorithm and Its Applications in Comparative Genomics},
Year = {2003}}
@article{Ono:2021aa,
Author = {Ono, Yukiteru and others},
Journal = {Bioinformatics},
Pages = {589-595},
Title = {{PBSIM2}: a simulator for long-read sequencers with a novel generative model of quality scores},
Volume = {37},
Year = {2021}}
@article{Sedlazeck:2018ab,
Author = {Sedlazeck, Fritz J and others},
Journal = {Nat Methods},
Pages = {461-468},
Title = {Accurate detection of complex structural variations using single-molecule sequencing},
Volume = {15},
Year = {2018}}
@article{Jeffares:2017aa,
Author = {Jeffares, Daniel C and others},
Journal = {Nat Commun},
Pages = {14061},
Title = {Transient structural variations have strong effects on quantitative traits and reproductive isolation in fission yeast},
Volume = {8},
Year = {2017}}
@article{Zook:2020aa,
Author = {Zook, Justin M and others},
Journal = {Nat Biotechnol},
Pages = {1347-1355},
Title = {A robust benchmark for detection of germline large deletions and insertions},
Volume = {38},
Year = {2020}}
@article{Harpak:2017aa,
Author = {Harpak, Arbel and others},
Journal = {Proc Natl Acad Sci U S A},
Pages = {12779-12784},
Title = {Frequent nonallelic gene conversion on the human lineage and its effect on the divergence of gene duplicates},
Volume = {114},
Year = {2017}}
@article{Li:2018aa,
Author = {Li, Heng and others},
Journal = {Nat Methods},
Month = {Aug},
Number = {8},
Pages = {595-597},
Title = {A synthetic-diploid benchmark for accurate variant-calling evaluation},
Volume = {15},
Year = {2018}}
@article{Gu:1995wt,
author = {Gu, X and Li, W H},
journal = {J Mol Evol},
month = {Apr},
number = {4},
pages = {464-73},
title = {The size distribution of insertions and deletions in human and rodent pseudogenes suggests the logarithmic gap penalty for sequence alignment},
volume = {40},
year = {1995}}
+336 -121
View File
@@ -1,6 +1,6 @@
\documentclass{bioinfo}
\copyrightyear{2017}
\pubyear{2017}
\copyrightyear{2018}
\pubyear{2018}
\usepackage{graphicx}
\usepackage{hyperref}
@@ -13,29 +13,37 @@
\usepackage{natbib}
\bibliographystyle{apalike}
\usepackage{hyperref}
\DeclareMathOperator*{\argmax}{argmax}
\begin{document}
\firstpage{1}
\title[Aligning long nucleotide sequences with minimap2]{Minimap2: fast pairwise alignment for long nucleotide sequences}
\title[Aligning nucleotide sequences with minimap2]{Minimap2: pairwise alignment for nucleotide sequences}
\author[Li]{Heng Li}
\address{Broad Institute, 415 Main Street, Cambridge, MA 02142, USA}
\maketitle
\begin{abstract}
\section{Summary:} Minimap2 is a general-purpose mapper to align long noisy DNA
or mRNA sequences against a large reference database. It targets query
sequences of 1kb--100Mb in length with per-base divergence typically below
25\%. For DNA sequence reads, minimap2 is $\sim$30 times faster than many
mainstream long-read aligners and achieves higher accuracy on simulated data.
It also employs concave gap cost and rescues inversions for improved alignment
around potential structural variations. For real long RNA-seq reads, minimap2
is $\sim$40 times faster than peers and produces alignment more consistent with
existing gene annotations.
\section{Motivation:} Recent advances in sequencing technologies promise
ultra-long reads of $\sim$100 kilo bases (kb) in average, full-length mRNA or
cDNA reads in high throughput and genomic contigs over 100 mega bases (Mb) in
length. Existing alignment programs are unable or inefficient to process such data
at scale, which presses for the development of new alignment algorithms.
\section{Results:} Minimap2 is a general-purpose alignment program to map DNA or long
mRNA sequences against a large reference database. It works with accurate short
reads of $\ge$100bp in length, $\ge$1kb genomic reads at error rate $\sim$15\%,
full-length noisy Direct RNA or cDNA reads, and assembly contigs or closely
related full chromosomes of hundreds of megabases in length. Minimap2 does
split-read alignment, employs concave gap cost for long insertions and
deletions (INDELs) and introduces new heuristics to reduce spurious alignments.
It is 3--4 times as fast as mainstream short-read mappers at comparable
accuracy, and is $\ge$30 times faster than long-read genomic or cDNA
mappers at higher accuracy, surpassing most aligners specialized in one type of
alignment.
\section{Availability and implementation:}
\href{https://github.com/lh3/minimap2}{https://github.com/lh3/minimap2}
@@ -56,29 +64,38 @@ the thought that 10kb long sequences should be easier to map than 100bp reads
because we can more effectively skip repetitive regions, which are often the
bottleneck of short-read alignment. We confirmed our speculation by achieving
approximate mapping 50 times faster than BWA-MEM~\citep{Li:2016aa}.
\citet{Suzuki:2016} extended our work with a fast and novel algorithm on
\citet{Suzuki:2018aa} extended our work with a fast and novel algorithm on
generating base-level alignment, which in turn inspired us to develop minimap2
towards higher accuracy and more practical functionality.
with added functionality.
Both SMRT and ONT have been applied to sequence spliced mRNAs (RNA-seq). While
Both SMRT and ONT have been applied to the sequencing of spliced mRNAs (RNA-seq). While
traditional mRNA aligners work~\citep{Wu:2005vn,Iwata:2012aa}, they are not
optimized for long noisy sequence reads and are tens of times slower than
dedicated long-read aligners. When developing minimap2 initially for aligning
genomic DNA only, we realized minor modifications could make it competitive for
aligning mRNAs as well. Minimap2 is a first RNA-seq aligner specifically
designed for long noisy reads.
genomic DNA only, we realized minor modifications could enable the base
algorithm to map mRNAs as well. Minimap2 becomes a first RNA-seq aligner
specifically designed for long noisy reads. We have also extended the original
algorithm to map short reads at a speed faster than several mainstream
short-read mappers.
In this article, we will describe the minimap2 algorithm and its applications
to different types of input sequences. We will evaluate the performance and
accuracy of minimap2 on several simulated and real data sets and demonstrate
the versatility of minimap2.
\begin{methods}
\section{Methods}
Minimap2 follows a typical seed-chain-align procedure as is used by most
full-genome aligners. It collects minimizers~\citep{Roberts:2004fv} of the
reference sequences and indexes them in a hash table. Then for each query
sequence, minimap2 takes query minimizers as \emph{seeds}, finds matches to the
reference, and identifies sets of colinear seeds, which are called
reference sequences and indexes them in a hash table, with the key being the
hash of a minimizer and the value being a list of locations of the minimizer
copies. Then for each query
sequence, minimap2 takes query minimizers as \emph{seeds}, finds exact matches
(i.e. \emph{anchors}) to the reference, and identifies sets of colinear anchors as
\emph{chains}. If base-level alignment is requested, minimap2 applies dynamic
programming (DP) to extend from the ends of chains and to close unseeded
regions between adjacent seeds in chains.
programming (DP) to extend from the ends of chains and to close
regions between adjacent anchors in chains.
Minimap2 uses indexing and seeding algorithms similar to
minimap~\citep{Li:2016aa}, and furthers the predecessor with more accurate
@@ -103,9 +120,15 @@ distance between two anchors is too large); otherwise
\begin{equation}\label{eq:chain-gap}
\beta(j,i)=\gamma_c\big((y_i-y_j)-(x_i-x_j)\big)
\end{equation}
In implementation, a gap of length $l$ costs $\gamma_c(l)=0.01\cdot \bar{w}\cdot
|l|+0.5\log_2|l|$, where $\bar{w}$ is the average seed length. For $m$ anchors, directly computing all $f(\cdot)$ with
Eq.~(\ref{eq:chain}) takes $O(m^2)$ time. Although theoretically faster
In implementation, a gap of length $l$ costs
\[
\gamma_c(l)=\left\{\begin{array}{ll}
0.01\cdot \bar{w}\cdot|l|+0.5\log_2|l| & (l\not=0) \\
0 & (l=0)
\end{array}\right.
\]
where $\bar{w}$ is the average seed length. For $N$ anchors, directly computing all $f(\cdot)$ with
Eq.~(\ref{eq:chain}) takes $O(N^2)$ time. Although theoretically faster
chaining algorithms exist~\citep{Abouelhoda:2005aa}, they
are inapplicable to generic gap cost, complex to implement and usually
associated with a large constant. We introduced a simple heuristic to
@@ -115,23 +138,25 @@ We note that if anchor $i$ is chained to $j$, chaining $i$ to a predecessor
of $j$ is likely to yield a lower score. When evaluating Eq.~(\ref{eq:chain}),
we start from anchor $i-1$ and stop the process if we cannot find a better
score after up to $h$ iterations. This approach reduces the average time to
$O(h\cdot m)$. In practice, we can almost always find the optimal chain with
$O(hN)$. In practice, we can almost always find the optimal chain with
$h=50$; even if the heuristic fails, the optimal chain is often close.
\subsubsection{Backtracking}
Let $P(i)$ be the index of the best predecessor of anchor $i$. It equals 0 if
$f(i)=w_i$ or $\argmax_j\{f(j)+\eta(j,i)-\gamma(j,i)\}$ otherwise. For each
$f(i)=w_i$ or $\argmax_j\{f(j)+\alpha(j,i)-\beta(j,i)\}$ otherwise. For each
anchor $i$ in the descending order of $f(i)$, we apply $P(\cdot)$ repeatedly to
find its predecessor and mark each visited $i$ as `used', until $P(i)=0$ or we
reach an already `used' $i$. This way we find all chains with no anchors used
in more than one chains.
\subsubsection{Identifying primary chains}
\subsubsection{Identifying primary chains}\label{sec:primary}
In the absence of copy number changes, each query segment should not be mapped
to two places in the reference. However, chains found at the previous step may
have significant or complete overlaps due to repeats in the reference.
have significant or complete overlaps due to repeats in the reference~\citep{Li:2010fk}.
Minimap2 used the following procedure to identify \emph{primary chains} that do
not greatly overlap on the query. Let $Q$ be an empty set initially. For each
not greatly overlap on the query.
Let $Q$ be an empty set initially. For each
chain from the best to the worst according to their chaining scores: if on the
query, the chain overlaps with a chain in $Q$ by 50\% or higher percentage of
the shorter chain, mark the chain as secondary to the chain in $Q$; otherwise,
@@ -139,7 +164,64 @@ add the chain to $Q$. In the end, $Q$ contains all the primary chains. We did
not choose a more sophisticated data structure (e.g. range tree or k-d tree)
because this step is not the performance bottleneck.
\subsection{Aligning genomic DNA}
For each primary chain, minimap2 estimates its mapping quality with an
empirical formula:
\[
{\rm mapQ}=40\cdot (1-f_2/f_1)\cdot\min\{1,m/10\}\cdot\log f_1
\]
where $\log$ denotes natural logarithm, $m$ is the number of anchors on the primary chain, $f_1$ is the chaining
score, and $f_2\le f_1$ is the score of the best chain that is secondary to the
primary chain. Intuitively, a chain is assigned to a higher mapping quality if
it is long and its best secondary chain is weak.
\subsubsection{Estimating per-base sequence divergence}
Suppose a query sequence harbors $n$ seeds of length $k$, $m$ of which are
present in a chain. We want to estimate the sequence divergence $\epsilon$
between the query and the reference sequences in the chain. This is useful
when base-level alignment is too expensive to perform.
If we model substitutions with a homogeneous Poisson process along the query
sequence, the probablity of seeing $k$ consecutive bases without substitutions
is $e^{-k\epsilon}$. On the assumption that all $k$-mers are independent of
each other, the likelihood function of $\epsilon$ is
\[
\mathcal{L}(\epsilon|n,m,k)=e^{-m\cdot k\epsilon}(1-e^{-k\epsilon})^{n-m}
\]
The maximum likelihood estimate of $\epsilon$ is
\[
\hat{\epsilon}=\frac{1}{k}\log\frac{n}{m}
\]
In reality, sequencing errors are sometimes clustered and $k$-mers are not
independent of each other, especially when we take minimizers as seeds. These
violate the assumptions in the derivation above. As a result, $\hat{\epsilon}$
is only approximate and can be biased. It also ignores long deletions from the
reference sequence. In practice, fortunately, $\hat{\epsilon}$ is often close
to and strongly correlated with the sequence divergence estimated from
base-level alignments. On the several datasets used in
Section~\ref{sec:long-genomic}, the Spearman correlation coefficient is around
$0.9$.
\subsubsection{Indexing with homopolymer compressed $k$-mers}
SmartDenovo
(\href{https://github.com/ruanjue/smartdenovo}{https://github.com/ruanjue/smartdenovo};
J. Ruan, personal communication) indexes reads with homopolymer-compressed (HPC)
$k$-mers and finds the strategy improves overlap sensitivity for SMRT reads.
Minimap2 adopts the same heuristic.
The HPC string of a string $s$, denoted by ${\rm HPC}(s)$, is constructed by
contracting homopolymers in $s$ to a single base. An HPC $k$-mer of $s$ is a
$k$-long substring of ${\rm HPC}(s)$. For example, suppose $s={\tt GGATTTTCCA}$,
${\rm HPC}(s)={\tt GATCA}$ and the first HPC 4-mer is ${\tt GATC}$.
To demonstrate the effectiveness of HPC $k$-mers, we performed read overlapping
for the example {\it E. coli} SMRT reads from PBcR~\citep{Berlin:2015xy}, using
different types of $k$-mers. With normal 15bp minimizers per 5bp window,
minimap2 finds 90.9\% of $\ge$2kb overlaps inferred from the read-to-reference
alignment. With HPC 19-mers per 5bp window, minimap2 finds 97.4\% of overlaps. It achieves this
higher sensitivity by indexing 1/3 fewer minimizers, which further helps
performance. HPC-based indexing reduces the sensitivity for current ONT reads, though.
\subsection{Aligning genomic DNA}\label{sec:genomic}
\subsubsection{Alignment with 2-piece affine gap cost}
@@ -168,7 +250,7 @@ where $s(i,j)$ is the score between the $i$-th reference base and $j$-th query
base. Eq.~(\ref{eq:ae86}) is a natural extension to the equation under affine
gap cost~\citep{Gotoh:1982aa,Altschul:1986aa}.
\subsubsection{Suzuki's formulation}
\subsubsection{The Suzuki-Kasahara formulation}
When we allow gaps longer than several hundred base pairs, nucleotide-level
alignment is much slower than chaining. SSE acceleration is critical to the
@@ -176,14 +258,14 @@ performance of minimap2. Traditional SSE implementations~\citep{Farrar:2007hs}
based on Eq.~(\ref{eq:ae86}) can achieve 16-way parallelization for short
sequences, but only 4-way parallelization when the peak alignment score reaches
32767. Long sequence alignment may exceed this threshold. Inspired by
\citet{Wu:1996aa} and the following work, \citet{Suzuki:2016} proposed a
\citet{Wu:1996aa} and the following work, \citet{Suzuki:2018aa} proposed a
difference-based formulation that lifted this limitation.
In case of 2-piece gap cost, define
\[
\left\{\begin{array}{ll}
u_{ij}\triangleq H_{ij}-H_{i-1,j} & v_{ij}\triangleq H_{ij}-H_{i,j-1} \\
x_{ij}\triangleq E_{i+1,j}-H_{ij} & \tilde{x}_{ij}\triangleq \tilde{E}_{i+1,j}-\tilde{H}_{ij} \\
y_{ij}\triangleq F_{i,j+1}-H_{ij} & \tilde{y}_{ij}\triangleq \tilde{F}_{i,j+1}-\tilde{H}_{ij}
x_{ij}\triangleq E_{i+1,j}-H_{ij} & \tilde{x}_{ij}\triangleq \tilde{E}_{i+1,j}-H_{ij} \\
y_{ij}\triangleq F_{i,j+1}-H_{ij} & \tilde{y}_{ij}\triangleq \tilde{F}_{i,j+1}-H_{ij}
\end{array}\right.
\]
We can transform Eq.~(\ref{eq:ae86}) to
@@ -243,11 +325,11 @@ y_{rt}&=&\max\{0,y_{r-1,t}+u_{r-1,t}-z_{rt}+q\}-q-e\\
\end{equation*}
In this formulation, cells with the same diagonal index $r$ are independent of
each other. This allows us to fully vectorize the computation of all cells on
the same anti-diagonal in one inner loop. It also simplifies banded alignment,
the same anti-diagonal in one inner loop. It also simplifies banded alignment (500bp band width by default),
which would be difficult with striped vectorization~\citep{Farrar:2007hs}.
On the condition that $q+e<\tilde{q}+\tilde{e}$ and $e>\tilde{e}$, the initial
values in the diagonal-antidiagonal formuation is
values in the diagonal-antidiagonal formuation are
\[
\left\{\begin{array}{l}
x_{r-1,-1}=y_{r-1,r}=-q-e\\
@@ -266,12 +348,19 @@ r\cdot(e-\tilde{e})-(\tilde{q}-q)-\tilde{e} & (r=\lceil\frac{\tilde{q}-q}{e-\til
\]
These can be derived from the initial values for Eq.~(\ref{eq:ae86}).
When performing global alignment, we do not need to compute $H_{rt}$ in each cell.
We use 16-way vectorization throughout the alignment process. When extending
alignments from ends of chains, we need to find the cell $(r,t)$ where $H_{rt}$
reaches the maximum. We resort to 4-way vectorization to compute
$H_{rt}=H_{r-1,t}+u_{rt}$. Because this computation is simple,
Eq.~(\ref{eq:suzuki}) is still the dominant performance bottleneck.
In practice, our 16-way vectorized implementation of global alignment is three
times as fast as Parasail's 4-way vectorization~\citep{Daily:2016aa}. Without
banding, our implementation is slower than Edlib~\citep{Sosic:2017aa}, but with
a 1000bp band, it is considerably faster. When performing global alignment
between anchors, we expect the alignment to stay close to the diagonal of the
DP matrix. Banding is applicable most of time.
DP matrix. Banding is applicable most of the time.
\subsubsection{The Z-drop heuristic}
@@ -295,6 +384,16 @@ alignment between the two subsequences involved in the global alignment, but
this time with the one subsequence reverse complemented. This additional
alignment step may identify short inversions that are missed during chaining.
\subsubsection{Filtering out misplaced anchors}
Due to sequencing errors and local homology, some anchors in a chain may be
wrong. If we blindly align regions between two misplaced anchors, we will
produce a suboptimal alignment. To reduce this artifact, we filter out
anchors that lead to a $>$10bp insertion and a $>$10bp deletion at the same
time, and filter out terminal anchors that lead to a long gap towards the ends
of a chain. These heuristics greatly alleviate the issues with misplaced
anchors, but they are unable to fix all such errors. Local misalignment is a
limitation of minimap2 which we hope to address in future.
\subsection{Aligning spliced sequences}
The algorithm described above can be adapted to spliced alignment. In this
@@ -326,18 +425,24 @@ F_{i,j+1}= \max\{H_{ij}-q,F_{ij}\}-e\\
\tilde{E}_{i+1,j}= \max\{H_{ij}-d(i)-\tilde{q},\tilde{E}_{ij}\}\\
\end{array}\right.
\end{equation}
Let $T$ be the reference sequence. $d(i)$ is the cost of a non-canonical donor
site, which takes 0 if $T[i+1,i+2]={\tt GT}$, or a positive number $p$
otherwise. Similarly, $a(i)$ is the cost of a non-canonical acceptor site, which
takes 0 if $T[i-1,i]={\tt AG}$, or $p$ otherwise. Eq.~(\ref{eq:splice}) is
almost equivalent to the equation used by EXALIN~\citep{Zhang:2006aa} except
that we allow insertions immediately followed by deletions and vice versa; in
addition, we use Suzuki's diagonal formulation in actual implementation.
%Given that $d_i$ and $a_i$
%are a function of the reference sequence, it is possible to incorporate
%splicing signals with more sophisticated models, such as positional weight
%matrices. We have not tried this approach.
Let $T$ be the reference sequence. $d(i)$ is computed as
\[d(i)=\left\{\begin{array}{ll}
0 & \mbox{if $T[i+1,i+3]$ is ${\tt GTA}$ or ${\tt GTG}$} \\
p/2 & \mbox{if $T[i+1,i+3]$ is ${\tt GTC}$ or ${\tt GTT}$} \\
p & \mbox{otherwise}
\end{array}\right.\]
where $T[i,j]$ extracts a substring of $T$ between $i$ and $j$ inclusively.
$d(i)$ penalizes non-canonical donor sites with $p$ and less frequent Eukaryotic
splicing signal ${\tt GT[C/T]}$ with $p/2$~\citep{Irimia:2008aa}. Similarly,
\[a(i)=\left\{\begin{array}{ll}
0 & \mbox{if $T[i-2,i]$ is ${\tt CAG}$ or ${\tt TAG}$} \\
p/2 & \mbox{if $T[i-2,i]$ is ${\tt AAG}$ or ${\tt GAG}$} \\
p & \mbox{otherwise}
\end{array}\right.\]
models the acceptor signal. Eq.~(\ref{eq:splice}) is close to an equation in
\citet{Zhang:2006aa} except that we allow insertions immediately followed by
deletions and vice versa; in addition, we use the Suzuki-Kasahara diagonal
formulation in actual implementation.
If RNA-seq reads are not sequenced from stranded libraries, the read strand
relative to the underlying transcript is unknown. By default, minimap2 aligns
@@ -349,31 +454,65 @@ reads that span canonical splicing sites.
In the spliced alignment mode, minimap2 further increases the density of
minimizers and disables banded alignment. Together with the two-round DP-based
alignment, spliced alignment is several times slower than DNA sequence
alignment, spliced alignment is several times slower than genomic DNA
alignment.
\subsection{Aligning short paired-end reads}
During chaining, minimap2 takes a pair of reads as one fragment with a gap of
unknown length in the middle. It applies a normal gap cost between seeds on the
same read but is a more permissive gap cost between seeds on different reads.
More precisely, the gap cost during chaining is ($l\not=0$):
\[
\gamma_c(l)=\left\{\begin{array}{ll}
0.01\cdot\bar{w}\cdot |l|+0.5\log_2 |l| & \mbox{if two seeds on the same read} \\
\min\{0.01\cdot\bar{w}\cdot|l|,\log_2|l|\} & \mbox{otherwise}
\end{array}\right.
\]
After identifying primary chains (Section~\ref{sec:primary}), we split each
fragment chain into two read chains and perform alignment for each read as in
Section~\ref{sec:genomic}. Finally, we pair hits of each read end to find
consistent paired-end alignments.
\end{methods}
\section{Results}
\subsection{Aligning genomic reads}
Minimap2 is implemented in the C programming language and comes with APIs in
both C and Python. It is distributed under the MIT license, free to both
commercial and academic uses. Minimap2 uses the same base algorithm for all
applications, but it has to apply different sets of parameters depending on
input data types. Similar to BWA-MEM, minimap2 introduces `presets' that
modify multiple parameters with a simple invocation. Detailed settings
and command-line options can be found in the minimap2 manpage. In addition to
the applications evaluated in the following sections, minimap2 also retains
minimap's functionality to find overlaps between long reads and to search
against large multi-species databases such as \emph{nt} from NCBI.
\subsection{Aligning long genomic reads}\label{sec:long-genomic}
\begin{figure}[!tb]
\centering
\includegraphics[width=.5\textwidth]{roc-color.pdf}
\caption{Evaluation on simulated SMRT reads aligned against human genome
GRCh38. 33,088 $\ge$1000bp reads were simulated using pbsim~\citep{Ono:2013aa}
with error profile sampled from file `m131017\_060208\_42213\_*.1.*' downloaded
at \href{http://bit.ly/chm1p5c3}{http://bit.ly/chm1p5c3}. The N50 read length
is 11,628. A read is considered correctly mapped if the true position overlaps
with the best mapping position by 10\% of the read length. All aligners were
run under the default setting for SMRT reads. (a) ROC-like curve. Alignments
are sorted by mapping quality in the descending order. For each mapping quality
threshold, the fraction of alignments with mapping quality above the threshold
and their error rate are plotted. Kart outputted all alignments at mapping
quality 60, so is not shown in the figure. It mapped nearly all reads with
4.1\% of alignments being wrong, less accurate than others. (b) Accumulative
mapping error rate as a function of mapping quality.}\label{fig:eval}
\caption{Evaluation on aligning simulated reads. Simulated reads were mapped
to the primary assembly of human genome GRCh38. A read is considered correctly
mapped if its longest alignment overlaps with the true interval, and the
overlap length is $\ge$10\% of the true interval length. Read alignments are
sorted by mapping quality in the descending order. For each mapping quality
threshold, the fraction of alignments (out of the number of input reads) with
mapping quality above the threshold and their error rate are
plotted along the curve. (a) long-read alignment evaluation. 33,088 $\ge$1000bp
reads were simulated using pbsim~\citep{Ono:2013aa} with error profile sampled
from file `m131017\_060208\_42213\_*.1.*' downloaded at
\href{http://bit.ly/chm1p5c3}{http://bit.ly/chm1p5c3}. The N50 read length is
11,628. Aligners were run under the default setting for SMRT reads.
Kart outputted all alignments at mapping quality 60, so is not shown in the
figure. It mapped nearly all reads with 4.1\% of alignments being wrong, less
accurate than others. (b) short-read alignment evaluation. 10 million pairs of
150bp reads were simulated using mason2~\citep{Holtgrewe:2010aa} with option
`\mbox{--illumina-prob-mismatch-scale 2.5}'. Short-read aligners were run under
the default setting except for changing the maximum fragment length to
800bp.}\label{fig:eval}
\end{figure}
As a sanity check, we evaluated minimap2 on simulated human reads along with
@@ -381,22 +520,20 @@ BLASR~(v1.MC.rc64; \citealp{Chaisson:2012aa}),
BWA-MEM~(v0.7.15; \citealp{Li:2013aa}),
GraphMap~(v0.5.2; \citealp{Sovic:2016aa}),
Kart~(v2.2.5; \citealp{Lin:2017aa}),
minialign~(v0.5.3; \citealp{Suzuki:2016}) and
minialign~(v0.5.3; \href{https://github.com/ocxtal/minialign}{https://github.com/ocxtal/minialign}) and
NGMLR~(v0.2.5; \citealp{Sedlazeck169557}). We excluded rHAT~\citep{Liu:2016ab}
and LAMSA~\citep{Liu:2017aa} because they either
crashed or produced malformatted output. In this evaluation, minimap2 has
higher power to distinguish unique and repetitive hits, and achieves overall
higher mapping accuracy (Fig.~\ref{fig:eval}a). It is still the most accurate
even if we skip DP-based alignment (data not shown), confirming chaining alone
is sufficient to achieve high accuracy for approximate mapping. Minimap2 and
higher mapping accuracy (Fig.~\ref{fig:eval}a). Minimap2 and
NGMLR provide better mapping quality estimate: they rarely give repetitive hits
high mapping quality (Fig.~\ref{fig:eval}b). Apparently, other aligners may
high mapping quality. Apparently, other aligners may
occasionally miss close suboptimal hits and be overconfident in wrong mappings.
On run time, minialign is slightly faster than minimap2 and Kart. They are over
30 times faster than the rest. Minimap2 consumed 6.1GB memory at the peak,
more than BWA-MEM but less than others.
On run time, minimap2 took 200 CPU seconds, comparable to minialign and Kart, and is over
30 times faster than the rest. Minimap2 consumed 6.8GB memory at the peak,
more than BWA-MEM (5.4GB), similar to NGMLR and less than others.
On real human SMRT reads, the relative performance and sensitivity of
On real human SMRT reads, the relative performance and fraction of mapped reads reported by
these aligners are broadly similar to the metrics on simulated data. We are
unable to provide a good estimate of mapping error rate due to the lack of the
truth. On ONT $\sim$100kb human reads~\citep{Jain128835}, BWA-MEM failed.
@@ -406,19 +543,19 @@ confirm the observation by~\citet{Sedlazeck169557} that BWA-MEM often breaks
them into shorter gaps. The issue is much alleviated with minimap2, thanks
to the 2-piece affine gap cost.
\subsection{Aligning spliced reads}
\subsection{Aligning long spliced reads}
We evaluated minimap2 on SIRV control data~(AC:SRR5286959;
\citealp{Byrne:2017aa}) where the truth is known. Minimap2 predicted 59\,916
introns from 11\,017 reads. 93.0\% of splice juctions are precise. We examined
\citealp{Byrne:2017aa}) where the truth is known. Minimap2 predicted 59\,918
introns from 11\,018 reads. 93.8\% of splice juctions are precise. We examined
wrongly predicted junctions and found the majority were caused by clustered
splicing signals (e.g. two adjacent ${\tt GT}$ sites). When INDEL sequencing
errors are frequent, it is difficult to find precise splicing sites in this
case. If we allow up to 10bp distance from true splicing sites, 98.4\% of
aligned introns are approximately correct. Given this observation, we might be
able to improve boundary detection by initializing $d(\cdot)$ and $a(\cdot)$ in
Eq.~(\ref{eq:splice}) with position-specific scoring matrices or more
sophisticated models. We have not tried this approach.
aligned introns are approximately correct. It is worth noting that for SIRV, we
asked minimap2 to model the ${\tt GT..AG}$ splicing signal only without extra
bases. This is because SIRV does not honor the evolutionarily prevalent signal
${\tt GT[A/G]..[C/T]AG}$~\citep{Irimia:2008aa}.
\begin{table}[!tb]
\processtable{Evaluation of junction accuracy on 2D ONT reads}
@@ -427,18 +564,18 @@ sophisticated models. We have not tried this approach.
\toprule
& GMAP & minimap2 & SpAln & STAR\\
\midrule
Run time (CPU min) & 631 & 15.5 & 2\,076 & 33.9 \\
Peak RAM (GByte) & 8.9 & 14.5 & 3.2 & 29.2\vspace{1em}\\
\# aligned reads & 103\,669 & 103\,917 & 103\,711 & 26\,479\\
\# chimeric alignments & 1\,904 & 1\,671 & 0 & 0\\
\# non-spliced alignments & 15\,854 & 14\,483 & 17\,033 & 10\,545\vspace{1em}\\
\# aligned introns & 692\,275 & 694\,237 & 692\,945 & 78\,603 \\
\# novel introns & 11\,239 & 3\,217 & 8\,550 & 1\,214 \\
\% exact introns & 83.8\% & 91.8\% & 87.9\% & 55.2\% \\
\% approx. introns & 91.8\% & 96.5\% & 92.5\% & 82.4\% \\
Run time (CPU min) & 631 & 15.9 & 2\,076 & 33.9 \\
Peak RAM (GByte) & 8.9 & 14.5 & 3.2 & 29.2\vspace{1em}\\
\# aligned reads & 103\,669 & 104\,199 & 103\,711 & 26\,479 \\
\# chimeric alignments & 1\,904 & 1\,488 & 0 & 0 \\
\# non-spliced alignments & 15\,854 & 14\,798 & 17\,033 & 10\,545\vspace{1em}\\
\# aligned introns & 692\,275 & 693\,553 & 692\,945 & 78\,603 \\
\# novel introns & 11\,239 & 3\,113 & 8\,550 & 1\,214 \\
\% exact introns & 83.8\% & 94.0\% & 87.9\% & 55.2\% \\
\% approx. introns & 91.8\% & 96.9\% & 92.5\% & 82.4\% \\
\botrule
\end{tabular}
}{Mouse reads (AC:SRR5286960) were mapped to the primary assembly of mouse
}{Mouse cDNA reads (AC:SRR5286960; R9.4 chemistry) were mapped to the primary assembly of mouse
genome GRCm38 with the following tools and command options: minimap2 (`-ax
splice'); GMAP (`-n 0 --min-intronlength 30 --cross-species'); SpAln (`-Q7 -LS
-S3'); STARlong (according to
@@ -447,7 +584,7 @@ compared to the EnsEMBL gene annotation, release 89. A predicted intron
is \emph{novel} if it has no overlaps with any annotated introns. An intron
is \emph{exact} if it is identical to an annotated intron. An intron is
\emph{approximate} if both its 5'- and 3'-end are within 10bp around the ends
of an annotated intron.}
of an annotated intron. Chimeric alignments are defined in the SAM spec~\citep{Li:2009ys}.}
\end{table}
We next aligned real mouse reads~\citep{Byrne:2017aa} with GMAP~(v2017-06-20;
@@ -456,10 +593,20 @@ STAR~(v2.5.3a; \citealp{Dobin:2013kx}). In general, minimap2 is more
consistent with existing annotations (Table~\ref{tab:intron}): it finds
more junctions with a higher percentage being exactly or approximately correct.
Minimap2 is over 40 times faster than GMAP and SpAln. While STAR is close to
minimap2 in speed, it does not work well with noisy reads. We have also
evaluated spliced aligners on public Iso-Seq data (human Alzheimer brain
from \href{http://bit.ly/isoseqpub}{http://bit.ly/isoseqpub}). The observation
is similar: minimap2 is faster at higher junction accuracy.
minimap2 in speed, it does not work well with noisy reads.
We have also evaluated spliced aligners on a human Nanopore Direct RNA-seq
dataset (\href{http://bit.ly/na12878ont}{http://bit.ly/na12878ont}). Minimap2
aligned 10 million reads in $<$1 wall-clock hour using 16 CPU cores. 94.2\% of
aligned splice junctions consistent with gene annotations. In comparison,
GMAP under option `-k 14 -n 0 --min-intronlength 30 --cross-species' is 160
times slower; 68.7\% of GMAP junctions are found in known gene annotations. The
percentage increases to 84.1\% if an aligned junction within 10bp from an
annotated junction is considered to be correct. On a public Iso-Seq dataset
(human Alzheimer brain from
\href{http://bit.ly/isoseqpub}{http://bit.ly/isoseqpub}), minimap2 is also
faster at higher junction accuracy in comparison to other aligners in
Table~\ref{tab:intron}.
We noted that GMAP and SpAln have not been optimized for noisy reads. We are
showing the best setting we have experimented, but their developers should be
@@ -470,39 +617,107 @@ able to improve their accuracy further.
%{\footnotesize
%\begin{tabular}{lrrrr}
%\toprule
%& GMAP & minimap2 & SpAln & STAR\\
% & GMAP & minimap2 & SpAln & STAR \\ % one GMAP thread took 14 days to align a tiny fraction of reads
%\midrule
%Run time (CPU min) & & 243 & 2\,352 & 1\,647 \\
%\# aligned reads & & 1\,123\,025 & 1\,094\,092 & 682\,452\\
%\# chimeric alignments & & 33\,091 & 0 & 0\\
%\# non-spliced alignments & & 339\,081 & 291\,447 & 272\,536\vspace{1em}\\
%\# aligned introns & & 9\,071\,755 & 9\,208\,564 & 3\,029\,121 \\
%\# novel introns & & 42\,773 & 82\,230 & 17\,791 \\
%\% exact introns & & 94.9\% & 91.7\% & 84.7\% \\
%\% approx. introns&& 96.9\% & 93.4\% & 93.8\% \\
%Run time (CPU min) & - & 243 & 2,352 & 1,647 \\
%\# aligned reads & 1,113,502 & 1,123,025 & 1,094,092 & 682,452 \\
%\# chimeric alignments & 48,927 & 33,091 & 0 & 0 \\
%\# non-spliced alignments & 334,097 & 339,081 & 291,447 & 272,536 \vspace{1em}\\
%\# aligned introns & 8,922,221 & 9,071,755 & 9,208,564 & 3,029,121 \\
%\# novel introns & 48,927 & 42,773 & 82,230 & 17,791 \\
%\% exact introns & 90.6\% & 94.9\% & 91.7\% & 84.7\% \\
%\% approx. introns & 94.0\% & 96.9\% & 93.4\% & 93.8\% \\
%\botrule
%\end{tabular}
%}{}
%\end{table}
\subsection{Aligning short genomic reads}
\section{Conclusion}
We evaluated minimap2 along with Bowtie2~(v2.3.3; \citealt{Langmead:2012fk}), BWA-MEM and
SNAP (v1.0beta23; \citealt{Zaharia:2011aa}). Minimap2 is 3--4 times as fast as Bowtie2 and
BWA-MEM, but is 1.3 times slower than SNAP. Minimap2 is more accurate on this
simulated data set than Bowtie2 and SNAP but less accurate than BWA-MEM
(Fig.~\ref{fig:eval}b). Closer investigation reveals that BWA-MEM achieves
a higher accuracy partly because it tries to locally align a read in a small
region close to its mate. If we disable this feature, BWA-MEM becomes slightly
less accurate than minimap2. We might implement a similar heuristic
in minimap2 in future.
Minimap2 is a fast, accurate and versatile aligner for long nucleotide
sequences. In addition to reference-based read mapping, minimap2 inherits
minimap's functionality to search against huge multi-species databases and to
find read overlaps. On a few test data sets, minimap2 appears to yield slightly
better miniasm assembly~\citep{Li:2016aa}. Minimap2 can also align similar
genomes or different assemblies of the same species. However, full-genome
alignment is an intricate research topic. More thorough evaluations would be
necessary to justify the use of minimap2 for such applications.
To evaluate the accuracy of minimap2 on real data, we aligned human reads
(AC:ERR1341796) with BWA-MEM and minimap2, and called SNPs and small INDELs
with GATK HaplotypeCaller v3.5~\citep{Depristo:2011vn}. This run was sequenced
from experimentally mixed CHM1 and CHM13 cell lines. Both of them are homozygous
across the whole genome and have been \emph{de novo} assembled with SMRT reads
to high quality. This allowed us to construct an independent truth variant
dataset~\citep{Li223297} for
ERR1341796. In this evaluation, minimap2 has higher SNP false negative rate
(FNR; 2.6\% of minimap2 vs 2.3\% of BWA-MEM), but fewer false positive SNPs per
million bases (FPPM; 7.0 vs 8.8), similar INDEL FNR (11.2\% vs 11.3\%) and
similar INDEL FPPM (6.4 vs 6.5). Minimap2 is broadly comparable to BWA-MEM in the
context of small variant calling.
\subsection{Aligning long-read assemblies}
Minimap2 can align a SMRT assembly (AC:GCA\_001297185.1) against GRCh38 in 7
minutes using 8 CPU cores, over 20 times faster than nucmer from
MUMmer4~\citep{Marcais:2018aa}. With the paftools.js script from the minimap2
package, we called 2.67 million single-base substitutions out of 2.78Gbp
genomic regions. The transition-to-transversion ratio (ts/tv) is 2.01. In
comparison, using MUMmer4's dnadiff pipeline, we called 2.86 million
substitutions in 2.83Gbp at ts/tv=1.87. Given that ts/tv averaged across the
human genome is about 2 but ts/tv averaged over random errors is 0.5, the
minimap2 callset arguably has higher precision at lower sensitivity.
The sample being assembled is a female. Minimap2 still called 201 substitutions
on the Y chromosome. These substitutions all come from one contig aligned at
96.8\% sequence identity. The contig could be a segmental duplication
absent from GRCh38. In constrast, dnadiff called 9070 substitutions on the Y
chromosome across 73 SMRT contigs. This again implies our minimap2-based
pipeline has higher precision.
\section{Discussions}
Minimap2 is a versatile mapper and pairwise aligner for nucleotide sequences.
It works with short reads, assembly contigs and long noisy genomic and RNA-seq
reads, and can be used as a read mapper, long-read overlapper or a full-genome
aligner. Minimap2 is also accurate and efficient, often outperforming other
domain-specific alignment tools in terms of both speed and accuracy.
The capability of minimap2 comes from a fast base-level alignment algorithm and
an accurate chaining algorithm. When aligning long query sequences, base-level
alignment is often the performance bottleneck. The Suzuki-Kasahara algorithm
greatly alleviates the bottleneck and enables DP-based splice alignment
involving $>$100kb introns, which was impractically slow ten years ago. The
minimap2 chaining algorithm is fast and highly accurate by itself. In fact,
chaining alone is more accurate than all the other long-read mappers in
Fig.~\ref{fig:eval}a (data not shown). This accuracy helps to reduce downstream
base-level alignment of candidate chains, which is still several times slower than
chaining even with the Suzuki-Kasahara improvement. In addition, taking a
general form, minimap2 chaining can be adapted to non-typical data types such as
spliced reads and multiple reads per fragment. This gives us the opportunity to
extend the same base algorithm to a variety of use cases.
Modern mainstream aligners often use a full-text index, such as suffix array or
FM-index, to index reference sequences. An advantage of this approach is that
we can use exact seeds of arbitrary lengths, which helps to increase seed
uniqueness and reduce unsuccessful extensions. Minimap2 indexes reference
k-mers with a hash table instead. Such fixed-length seeds are inferior to
variable-length seeds in theory, but can be computed much more efficiently in
practice. When a query sequence has multiple seed hits, we can afford to skip
highly repetitive seeds without affecting the final accuracy. This further
alleviates the concern with the seeding uniqueness. At the same time, at low
sequence identity, it is rare to see long seeds anyway. Hash table is the ideal
data structure for mapping long noisy sequences.
\section*{Acknowledgements}
We owe a debt of gratitude to Hajime Suzuki for releasing his masterpiece and
insightful notes before formal publication. We thank M. Schatz, P. Rescheneder
and F. Sedlazeck for pointing out the limitation of BWA-MEM. We are also
grateful to early minimap2 testers who have greatly helped to suggest features
and to fix various issues.
We owe a debt of gratitude to H. Suzuki and M. Kasahara for releasing their
masterpiece and insightful notes before formal publication. We thank M.
Schatz, P. Rescheneder and F. Sedlazeck for pointing out the limitation of
BWA-MEM. We are also grateful to minimap2 users who have greatly helped to
suggest features and to fix various issues.
\paragraph{Funding\textcolon} NHGRI 1R01HG010040-01
\bibliography{minimap2}
+62
View File
@@ -0,0 +1,62 @@
Q 60 18579866 27 0.000001453 18579866
Q 59 27087 4 0.000001666 18606953
Q 58 21435 1 0.000001718 18628388
Q 57 45663 3 0.000001874 18674051
Q 56 36031 2 0.000001978 18710082
Q 55 18499 2 0.000002082 18728581
Q 54 14754 2 0.000002187 18743335
Q 53 25541 2 0.000002291 18768876
Q 52 26397 5 0.000002554 18795273
Q 51 15090 3 0.000002711 18810363
Q 50 13425 11 0.000003294 18823788
Q 49 15175 2 0.000003397 18838963
Q 48 19407 4 0.000003606 18858370
Q 47 11538 16 0.000004452 18869908
Q 46 12558 17 0.000005349 18882466
Q 45 40362 28 0.000006817 18922828
Q 44 10465 13 0.000007500 18933293
Q 43 10098 20 0.000008552 18943391
Q 42 10682 19 0.000009549 18954073
Q 41 9823 11 0.000010125 18963896
Q 40 9685 16 0.000010963 18973581
Q 39 10273 18 0.000011905 18983854
Q 38 9515 18 0.000012847 18993369
Q 37 9474 27 0.000014261 19002843
Q 36 10430 25 0.000015568 19013273
Q 35 9241 34 0.000017348 19022514
Q 34 9162 31 0.000018968 19031676
Q 33 10164 49 0.000021532 19041840
Q 32 9152 55 0.000024408 19050992
Q 31 9252 35 0.000026233 19060244
Q 30 9872 55 0.000029103 19070116
Q 29 8938 65 0.000032496 19079054
Q 28 8951 73 0.000036306 19088005
Q 27 9949 95 0.000041261 19097954
Q 26 9784 97 0.000046316 19107738
Q 25 10126 97 0.000051366 19117864
Q 24 11260 123 0.000057765 19129124
Q 23 10047 114 0.000063691 19139171
Q 22 9661 123 0.000070083 19148832
Q 21 10339 168 0.000078813 19159171
Q 20 17928 193 0.000088804 19177099
Q 19 9842 193 0.000098817 19186941
Q 18 14737 247 0.000111605 19201678
Q 17 10218 238 0.000123934 19211896
Q 16 10271 242 0.000136457 19222167
Q 15 12241 333 0.000153683 19234408
Q 14 9189 336 0.000171070 19243597
Q 13 9493 515 0.000197734 19253090
Q 12 11502 743 0.000236185 19264592
Q 11 8211 507 0.000262390 19272803
Q 10 9133 606 0.000293695 19281936
Q 9 10014 931 0.000341801 19291950
Q 8 8436 698 0.000377816 19300386
Q 7 8443 705 0.000414163 19308829
Q 6 10203 944 0.000462808 19319032
Q 5 6936 756 0.000501760 19325968
Q 4 6732 843 0.000545190 19332700
Q 3 8215 1104 0.000602040 19340915
Q 2 21201 5440 0.000882342 19362116
Q 1 82328 22186 0.002019600 19444444
Q 0 553853 371953 0.020562901 19998297
U 1703
+240
View File
@@ -0,0 +1,240 @@
\documentclass{bioinfo}
\copyrightyear{2021}
\pubyear{2021}
\usepackage{graphicx}
\usepackage{hyperref}
\usepackage{url}
\usepackage{amsmath}
\usepackage[ruled,vlined]{algorithm2e}
\newcommand\mycommfont[1]{\footnotesize\rmfamily{\it #1}}
\SetCommentSty{mycommfont}
\SetKwComment{Comment}{$\triangleright$\ }{}
\usepackage{natbib}
\bibliographystyle{apalike}
\DeclareMathOperator*{\argmax}{argmax}
\begin{document}
\firstpage{1}
\title[Improvements to minimap2]{New strategies to improve minimap2 alignment accuracy}
\author[Li]{Heng Li$^{1,2}$}
\address{$^1$Dana-Farber Cancer Institute, 450 Brookline Ave, Boston, MA 02215, USA,
$^2$Harvard Medical School, 10 Shattuck St, Boston, MA 02215, USA}
\maketitle
\begin{abstract}
\section{Summary:} We present several recent improvements to minimap2, a
versatile pairwise aligner for nucleotide sequences. Now minimap2 v2.22 can
more accurately map long reads to highly repetitive regions and align through
insertions or deletions up to 100kb by default, addressing major weakness in
minimap2 v2.18 or earlier.
\section{Availability and implementation:}
\href{https://github.com/lh3/minimap2}{https://github.com/lh3/minimap2}
\section{Contact:} hli@ds.dfci.harvard.edu
\end{abstract}
\section{Introduction}
Minimap2~\citep{Li:2018ab} is widely used for maping long sequence
reads and assembly contigs. \citet{Jain:2020aa} found minimap2 v2.18 or earlier occasionally
misaligned reads from highly repetitive regions as minimap2 ignored seeds of
high occurrence. They also noticed minimap2 may misplace reads with structural
variations (SVs) in such regions~\citep{Jain2020.11.01.363887}. These
misalignments have become a pressing issue in the advent of
temolere-to-telomore human assembly~\citep{Miga:2020aa}. Meanwhile, old minimap2
was unable to efficiently align long insertions/deletions (INDELs) and often
breaks an alignment around variable-number tandem repeats (VNTRs). This has
inspired new chaining algorithms~\citep{Li:2020aa,Ren:2021aa} which are not
integrated into minimap2. Here we will describe recent efforts implemented
in v2.19 through v2.22 to improve mapping results.
\begin{methods}
\section{Methods}
\subsection{Rescuing high-occurrence $k$-mers}\label{sec:high-occ}
Minimap2 keeps all $k$-mer minimizers~\citep{Roberts:2004fv} during indexing. Its original
implementation only selected low-occurrence minimizers during mapping. The
cutoff is a few hundred for mapping long reads against a human genome. If a
read habors only a few or even no low-occurrence minimizers, it will fail
chaining due to insufficient anchors.
To resolve this issue, we implemented a new heuristic to add additional
minimizers. Suppose we are looking at two adjacent low-occurence $k$-mers
located at position $x_1$ and $x_2$, respectively. If $|x_1-x_2|\ge L$,
minimap2 v2.22 additionally selects $\lfloor|x_1-x_2|/L\rfloor$ minimizers
of the lowest occurrence among minimizers between $x_1$ and $x_2$. Here
parameter $L$ controls the frequency of sampling. It defaults to 500.
This strategy adds necessary anchors at the cost of increasing total alignment
time by a few percent on real data.
\subsection{Aligning through longer INDELs}
The original minimap2 may fail to align long INDELs due to its chaining
heuristics. Briefly, minimap2 applies dynamic programming (DP) to chain
minimizer anchors. This is a quadratic algorithm, slow for chaining
contigs. For acceptable performance, the original minimap2 uses a 500bp band by
default, which means a gap longer than 500bp will stop chaining.
To align through longer gaps, older minimap2 implemented a long-join heurstic as follows.
If there is an INDEL longer than 500bp and the two chains around the INDEL
have no overlaps on either the query or the reference sequence, minimap2 may
join the two short chains later.
This heuristic may fail around VNTRs because short chains
often have overlaps in VNTRs. More subtly, minimap2 may escape the inner DP
loop early, again for performance, if the chaining result is not improved for
50 iterations. When there is a copy number change in a long segmental
duplication, the early escape may break around the event even if users
specify a large band.
In minigraph~\citep{Li:2020aa}, we developed a new chaining algorithm that
finds up to 1kb INDELs with DP-based chaining and goes through longer INDELs with a
subquadratic algorithm~\citep{DBLP:conf/wabi/AbouelhodaO03}. We ported the same
algorithm to minimap2 for contig mapping. For long-read mapping, the minigraph
algorithm is slower. Minimap2 v2.22 still uses the DP-based algorithm to
find short chains and then invokes the minigraph algorithm to rechain anchors in
these short chains. The rechaining step achieves the same goal as long-join
but is more reliable because it can resolve overlaps between short chains. The old
long-join heuristic has since been removed.
\subsection{Properly mapping long reads with SVs}
The original minimap2 ranks an alignment by its Smith-Waterman score and
outputs the best scoring alignment. However, when there are SVs on the read,
the best scoring alignment is sometimes not the correct alignment.
\citet{Jain2020.11.01.363887} resolved this dilemma by altering the mapping
algorithm.
In our view, this problem is rooted in inapropriate scoring: affine-gap penalty
over-penalizes a long INDEL that was often evolutionarily created in one event.
We should not penalize a SV by a function linear in the SV length. Minimap2 v2.22 instead rescores
an alignment with the following scoring function. Suppose an alignment consists
of $M$ matching bases, $N$ substitutions and $G$ gap opens, we empirically
score the alignment with
$$
S=M-\frac{N+G}{2d}-\sum_{i=1}^G\log_2(1+g_i)
$$
where $g_i\ge1$ is the length of the $i$-th gap and
$$
d=\max\left\{\frac{N+G}{M+N+G},0.02\right\}
$$
It approximates per-base sequence divergence except with the smallest value set
to 2\%. As an analogy to affine-gap scoring, the matching score in our scheme
is 1, the mismatch and gap open penalties are both $1/2d$ and the gap extension
penalty is a logarithm function of the gap length~\citep{Gu:1995wt}. Our scoring gives a long SV
a much milder penalty. In terms of time complexity, scoring an alignment is
linear in the length of the alignment. The time spent on rescoring is negligible in
practice.
%If we assume sequences evolve under a duplication-mutation model, we may have a
%better way to choose the best alignment. If a long read can be mapped to $n$
%loci, we can take the read as the template and build a
%pseudo-multi-sequence-alignment (pMSA) of $n+1$ sequences. In this pMSA, we say
%a site on the read is informative if the $n$ reference subsequences differ at
%the position.
\end{methods}
\section{Results}
\begin{table}
\processtable{Evaluation of minimap2 v2.22}
{\footnotesize\label{tab:1}\begin{tabular}{p{4.2cm}rrrr}
\toprule
$[$Benchmark$]$ Metric & v2.22 & v2.18 & Winno & lra \\
\midrule
$[$sim-map$]$ \% mapped reads at Q10 & 97.9 & 97.6 & {\bf 99.0}& 97.3 \\
$[$sim-map$]$ err. rate at Q10 (phredQ) & {\bf 52} & {\bf 52} & 38 & 24 \\
$[$winno-cmp$]$ rate of diff. (phredQ) & {\bf 41} & 37 & truth & 18 \\
$[$winno-cmp$]$ CPU time (hour) & {\bf 5.0} & 5.3 & 71.8 & 13.1 \\
$[$winno-cmp$]$ peak RAM (Gb) & 17.1 & 14.4 & {\bf 9.6} & 12.4 \\
$[$sim-sv$]$ \% false negative rate & {\bf 0.5} & 2.0 & {\bf 0.5} & 1.4 \\
$[$sim-sv$]$ \% false discovery rate & {\bf 0.0} & 0.1 & {\bf 0.0} & 0.1 \\
$[$real-sv-1k$]$ \% false negative rate & {\bf 7.3} & 20.0 & 13.0 & N/A \\
$[$real-sv-1k$]$ \% false discovery rate & 2.7 & {\bf 2.4} & 2.7 & N/A \\
\botrule
\end{tabular}}
{In $[$sim-map$]$, 152,713 reads were simulated from the CHM13 telomere-to-telomere assembly v1.1
(AC: GCA\_009914755.3) with pbsim2~\citep{Ono:2021aa}: ``pbsim2 -{}-hmm\_model R94.model -{}-length-min
5000 -{}-length-mean 20000 -{}-accuracy-mean 0.95''. Alignments of mapping quality
10 or higher were evaluated by ``paftools.js mapeval''. The mapping error rate
is measured in the phred scale: if the error rate is $e$, $-10\log_{10}e$ is
reported in the table. In $[$winno-cmp$]$, 1.39 million CHM13 HiFi reads from
SRR11292121 were mapped against the same CHM13 assembly. 99.3\% of them were mapped by Winnowmap2
at mapping quality 10 or higher and were taken as ground truth to evaluate
minimap2 and lra with ``paftools.js pafcmp''. $[$sim-sv$]$ simulated 1,000
50bp to 1000bp INDELs from chr8 in CHM13 using SURVIVOR~\citep{Jeffares:2017aa} and simulated Nanopore
reads at 30-fold coverage with the same pbsim2 command line. SVs were called with
``sniffles -q 10''~\citep{Sedlazeck:2018ab} and compared to the simulated truth with ``SURVIVOR eval
call.vcf truth.bed 50''. In $[$real-sv-1k$]$, small and long variants were
called by dipcall-0.3~\citep{Li:2018aa} for HG002 assemblies (AC: GCA\_018852605.1 and
GCA\_018852615.1) and compared to the GIAB truth~\citep{Zook:2020aa} using ``truvari -r 2000 -s
1000 -S 400 -{}-multimatch -{}-passonly'' which sets the minimum INDEL size to 1kb in evaluation. }
\end{table}
We evaluated minimap2 v2.22 along with v2.18, Winnowmap2 v2.03 and lra v1.3.2
(Table~\ref{tab:1}), using the default setting of each mapper according to the input data types.
Both versions of minimap2 achieved high mapping accuracy on
simulated Nanopore reads (sim-map). Winnowmap2 aligned more reads at mapping
quality 10 or higher (mapQ10). However, it may occasionally assign a high mapping
quality to a read with multiple identical best alignments. This reduced its
mapping accuracy.
In lack of groud truth for real data, we took Winnowmap2 mapping as ground
truth to evaluate other mappers (winno-cmp in Table~\ref{tab:1}). Out of 1,378,092 reads with mapQ10
alignments by Winnowmap2, minimap2 v2.22 could map all of them. 118 reads, less
than 0.01\% of all reads, were mapped differently by v2.22. 51 of them have
multiple identical best alignments. We believe these are more likely to be
Winnowmap2 errors. Most of the remaining 67 (=118-51) reads have multiple
highly similar but not identical alignments.
Minimap2 v2.18 is less consistent with 275 differences including 30 unmapped
reads mappable by both Winnowmap2 and v2.22.
For the minimizer rescuing parameter $L$ in Section~\ref{sec:high-occ},
we set its default to 500 such that v2.22 has comparable performance to v2.18 given simulated PacBio and Nanopore human reads.
To see the effect of this parameter on real data, we tried several different $L$ values.
v2.22 gave 99 mapping differences at $L=200$,
118 at $L=500$ (default), 167 at $L=750$ and 224 differences at $L=1000$ in comparison to Winnowmap2.
$L=200$ is 28\% slower than the default while $L=1000$ is 9\% faster.
Changing the default minimizer window size (option ``-w'')
and the initial minimizer occurrence cutoff (option ``-f'')
also affects performance and accuracy to a similar magnitude.
The two benchmarks above only evaluate read mappings when there are no variations between the reads and the reference.
To measure the mapping accuracy in the presence of SVs (sim-sv), we reproduced
the results by~\citep{Jain2020.11.01.363887}. Minimap2 v2.22 is as good as
Winnowmap2 now. Note that we were setting the Sniffles mapping quality
threshold to 10 in consistent with the benchmarks above. If we used the
default threshold 20, v2.22 would miss additional five SVs (accounting for
0.5\% of simulated SVs). For four out of these five missing SVs, minimap2 v2.22
mapped more variant reads than Winnowmap2. Sniffles did not call these SVs
because minimap2 tended to give them conservative mapping quality. It is worth
noting that the simulation here only considers a simple scenario in evolution.
Non-allelic gene conversions, which happen often in segmental
duplications~\citep{Harpak:2017aa}, would obscure the optimal mapping
strategies. How much such simple SV simulation informs real-world SV calling
remains a question.
To see if minimap2 v2.22 could improve long INDEL alignment, we ran dipcall on
contig-to-reference alignments and focused on INDELs longer than 1kb
(real-sv-1k). v2.22 is more sensitive at comparable specificity, confirming its
advantage in more contiguous alignment. We could not get dipcall to work well with lra,
so did not report the numbers.
Minimap2 spends most computing time on base alignment. As recent improvements
in v2.22 incur little additional computing and do not change the base alignment
algorithm, the new version has similar performance to older versions. It is
consistently faster than Winnowmap2 by several times. Sometimes simple
heuristics can be as effective as more sophisticated yet slower solutions.
\section*{Acknowledgements}
We thank Arang Rhie and Chirag Jain for providing motivating examples for which
older minimap2 underperforms.
\paragraph{Funding\textcolon} This work is funded by NHGRI grant R01HG010040.
\bibliography{minimap2}
\end{document}
+12 -30
View File
@@ -1,30 +1,12 @@
Q 60 32066 0 0.000000000
Q 40 32 1 0.000031155
Q 38 19 1 0.000062272
Q 36 11 1 0.000093376
Q 35 32 1 0.000124378
Q 33 15 1 0.000155400
Q 32 58 1 0.000186145
Q 27 11 1 0.000217095
Q 26 80 1 0.000247494
Q 21 19 2 0.000309186
Q 20 16 1 0.000339936
Q 19 19 1 0.000370622
Q 18 22 2 0.000432099
Q 17 37 5 0.000585751
Q 15 24 2 0.000646930
Q 14 18 3 0.000738939
Q 13 30 6 0.000922821
Q 12 18 1 0.000953054
Q 11 29 2 0.001013638
Q 10 30 1 0.001043393
Q 9 20 5 0.001196099
Q 8 25 8 0.001440348
Q 7 28 6 0.001622830
Q 6 35 12 0.001988132
Q 5 34 12 0.002352725
Q 4 29 8 0.002594865
Q 3 36 14 0.003018937
Q 2 46 15 0.003471482
Q 1 69 36 0.004558162
Q 0 167 94 0.007377173
Q 60 32084 0 0.000000000 32084
Q 24 318 2 0.000061725 32402
Q 11 98 2 0.000123077 32500
Q 8 37 2 0.000184405 32537
Q 7 37 3 0.000276294 32574
Q 6 40 3 0.000367940 32614
Q 5 34 2 0.000428816 32648
Q 4 37 5 0.000581306 32685
Q 3 28 6 0.000764222 32713
Q 2 38 6 0.000946536 32751
Q 1 50 21 0.001585318 32801
Q 0 286 150 0.006105117 33087
+13 -17
View File
@@ -1,17 +1,13 @@
Q 60 32072 0 0.000000000
Q 43 206 1 0.000030981
Q 27 201 1 0.000061578
Q 15 59 1 0.000092200
Q 12 25 1 0.000122839
Q 11 16 1 0.000153473
Q 10 24 1 0.000184032
Q 9 17 2 0.000245248
Q 8 27 3 0.000336938
Q 7 23 1 0.000367309
Q 6 20 1 0.000397675
Q 5 18 4 0.000519751
Q 4 17 1 0.000550038
Q 3 29 5 0.000702204
Q 2 32 4 0.000823522
Q 1 54 6 0.001004872
Q 0 234 106 0.004202697
Q 60 32477 0 0.000000000 32477
Q 22 16 1 0.000030776 32493
Q 21 44 1 0.000061468 32537
Q 19 73 1 0.000091996 32610
Q 14 66 1 0.000122414 32676
Q 10 26 3 0.000214054 32702
Q 8 14 1 0.000244529 32716
Q 7 13 2 0.000305539 32729
Q 6 47 1 0.000335611 32776
Q 3 10 1 0.000366010 32786
Q 2 20 2 0.000426751 32806
Q 1 248 94 0.003267381 33054
Q 0 31 17 0.003778147 33085
+25 -17
View File
@@ -14,7 +14,7 @@ set size 1.59,1.04
set multiplot layout 1,2
set label "(a)" at graph -0.245,1.06 font "Helvetica-bold,40"
set xlab "Error rate of mapped reads"
set xlab "Error rate of mapped PacBio reads"
set ylab "Fraction of mapped reads" off +1.8
set ytics 0.02
set yran [0.9:1]
@@ -34,19 +34,27 @@ unset label
set origin 0.8,0
set size 0.79,1
set label "(b)" at graph -0.245,1.06 font "Helvetica-bold,40"
unset log
unset format
unset key
set log y
set ylab "Accumulative mapping error rate" off +0
set xlab "Mapping quality"
set yran [1e-5:0.1]
set ytics 1e-5,0.1
set format y "10^{%L}"
set xran [60:0] reverse
plot "<./eval2roc.pl blasr-mc.eval" u 1:2 w lp ls 4, \
"<./eval2roc.pl bwa.eval" u 1:2 t "bwa-mem" w lp ls 2, \
"<./eval2roc.pl graphmap.eval" u 1:2 t "graphmap" w lp ls 3, \
"<./eval2roc.pl minialign.eval" u 1:2 t "minialign" w lp ls 1, \
"<./eval2roc.pl mm2.eval" u 1:2 t "minimap2" w lp ls 6, \
"<./eval2roc.pl ngmlr.eval" u 1:2 t "ngm-lr" w lp ls 5
set xlab "Error rate of mapped short reads"
set key top left
plot "<./eval2roc.pl -n2e7 bowtie2-s3.sam.eval" u 2:3 t "bowtie2" w lp ls 5, \
"<./eval2roc.pl -n2e7 bwa-s3.sam.eval" u 2:3 t "bwa-mem" w lp ls 2, \
"<./eval2roc.pl -n2e7 mm2-s3.sam.eval" u 2:3 t "minimap2" w lp ls 6, \
"<./eval2roc.pl -n2e7 snap-s3.sam.eval" u 2:3 t "snap" w lp ls 3
#unset log
#unset format
#unset key
#set log y
#set ylab "Accumulative mapping error rate" off +0
#set xlab "Mapping quality"
#set yran [1e-5:0.1]
#set ytics 1e-5,0.1
#set format y "10^{%L}"
#set xran [60:0] reverse
#plot "<./eval2roc.pl blasr-mc.eval" u 1:2 w lp ls 4, \
# "<./eval2roc.pl bwa.eval" u 1:2 t "bwa-mem" w lp ls 2, \
# "<./eval2roc.pl graphmap.eval" u 1:2 t "graphmap" w lp ls 3, \
# "<./eval2roc.pl minialign.eval" u 1:2 t "minialign" w lp ls 1, \
# "<./eval2roc.pl mm2.eval" u 1:2 t "minimap2" w lp ls 6, \
# "<./eval2roc.pl ngmlr.eval" u 1:2 t "ngm-lr" w lp ls 5
+62
View File
@@ -0,0 +1,62 @@
Q 60 18993268 10320 0.000543350 18993268
Q 59 33156 216 0.000553756 19026424
Q 58 29982 295 0.000568365 19056406
Q 57 9412 278 0.000582666 19065818
Q 56 11012 228 0.000594281 19076830
Q 55 9968 235 0.000606283 19086798
Q 54 8602 292 0.000621301 19095400
Q 53 6094 259 0.000634662 19101494
Q 52 5026 257 0.000647946 19106520
Q 51 4278 224 0.000659522 19110798
Q 50 3682 178 0.000668708 19114480
Q 49 2750 156 0.000676772 19117230
Q 48 2314 112 0.000682548 19119544
Q 47 2056 96 0.000687495 19121600
Q 46 1658 62 0.000690677 19123258
Q 45 1492 74 0.000694493 19124750
Q 44 1150 56 0.000697379 19125900
Q 43 1062 48 0.000699850 19126962
Q 42 976 60 0.000702951 19127938
Q 41 884 36 0.000704800 19128822
Q 40 708 52 0.000707493 19129530
Q 39 870 26 0.000708819 19130400
Q 38 598 26 0.000710156 19130998
Q 37 542 34 0.000711913 19131540
Q 36 846 50 0.000714495 19132386
Q 35 590 50 0.000717087 19132976
Q 34 550 42 0.000719261 19133526
Q 33 2174 66 0.000722628 19135700
Q 32 876 86 0.000727089 19136576
Q 31 638 104 0.000732500 19137214
Q 30 1718 196 0.000742675 19138932
Q 29 91022 968 0.000789497 19229954
Q 28 12864 781 0.000829556 19242818
Q 27 5806 427 0.000851489 19248624
Q 26 25274 728 0.000888144 19273898
Q 25 7418 680 0.000923070 19281316
Q 24 11800 701 0.000958839 19293116
Q 23 57328 3933 0.001159250 19350444
Q 22 7662 846 0.001202494 19358106
Q 21 5924 617 0.001233989 19364030
Q 20 4623 574 0.001263330 19368653
Q 19 4988 942 0.001311627 19373641
Q 18 3968 793 0.001352282 19377609
Q 17 3630 681 0.001387166 19381239
Q 16 2921 513 0.001413422 19384160
Q 15 2716 424 0.001435095 19386876
Q 14 2366 365 0.001453744 19389242
Q 13 2169 412 0.001474828 19391411
Q 12 2077 360 0.001493233 19393488
Q 11 2016 441 0.001515815 19395504
Q 10 2292 738 0.001553682 19397796
Q 9 4165 1832 0.001647772 19401961
Q 8 3963 1862 0.001743385 19405924
Q 7 3927 1793 0.001835408 19409851
Q 6 3572 1639 0.001919497 19413423
Q 5 3270 1533 0.001998126 19416693
Q 4 3046 1610 0.002080718 19419739
Q 3 251447 125550 0.008436553 19671186
Q 2 24390 13537 0.009113417 19695576
Q 1 124406 86780 0.013434624 19819982
Q 0 171254 153874 0.021016609 19991236
U 8764