mirror of
https://github.com/lh3/minimap2.git
synced 2026-09-26 09:58:13 +08:00
Compare commits
| Author | SHA1 | Date | |
|---|---|---|---|
|
|
b6ff332de1 | ||
|
|
77abafaaf3 | ||
|
|
507d39af15 | ||
|
|
827ca4b461 | ||
|
|
d3dde2fdd4 | ||
|
|
7db2e8d21a | ||
|
|
0b41dd26a2 | ||
|
|
2b47846cd6 | ||
|
|
67dd906a80 | ||
|
|
1b0bb7b0ba | ||
|
|
1c4b7e8a48 | ||
|
|
ecbc399fa2 | ||
|
|
4dfd495cc2 | ||
|
|
194b457e79 | ||
|
|
75c8933511 | ||
|
|
1025993469 | ||
|
|
a3253d1a6b | ||
|
|
2da649d1d7 | ||
|
|
f995f55610 | ||
|
|
c9874e2dc5 | ||
|
|
ccb0f7b05d | ||
|
|
66db9da7d8 | ||
|
|
2b3403f094 | ||
|
|
3e16e4e39d | ||
|
|
f47e8a525e | ||
|
|
c172df7d2d | ||
|
|
9e6fdd376b | ||
|
|
29f67a1666 | ||
|
|
adde608a42 | ||
|
|
f10dff78dc | ||
|
|
d97bba9f27 | ||
|
|
50775362bb | ||
|
|
0a5e386359 | ||
|
|
cb56fb762a | ||
|
|
e2451e497a | ||
|
|
d2de282d21 | ||
|
|
48cb80ea94 | ||
|
|
6a4b9f9082 | ||
|
|
a7a01fe5bd | ||
|
|
9dceae59a0 | ||
|
|
20a3987082 | ||
|
|
eb3ed6993d | ||
|
|
7996f04008 | ||
|
|
d2e14705e7 | ||
|
|
24f50f38e8 | ||
|
|
04e015d803 | ||
|
|
040f74102c | ||
|
|
cdb7857841 | ||
|
|
3c0d05d272 | ||
|
|
47b646acbf | ||
|
|
a79cb3e991 | ||
|
|
367aed4271 | ||
|
|
081df6ac7d | ||
|
|
a3e7a575fb | ||
|
|
d90583b83c | ||
|
|
7fc03b0c32 | ||
|
|
20c104ce8d | ||
|
|
238b6bb3ea | ||
|
|
e026e18439 | ||
|
|
58c2251b18 | ||
|
|
03dc8d5d97 | ||
|
|
5cb61f8ee6 | ||
|
|
c16a1742a3 | ||
|
|
4bd5a018c2 | ||
|
|
05974c80f1 | ||
|
|
7bc87b4175 | ||
|
|
6762368cf0 | ||
|
|
c2aec88b84 | ||
|
|
97f67a2a0a | ||
|
|
189555503a | ||
|
|
69af86657e | ||
|
|
49c6d83a8e | ||
|
|
f64e426a5a | ||
|
|
2bb8cbbeef | ||
|
|
e80759c97a | ||
|
|
f4c844b143 | ||
|
|
be171aa2dc | ||
|
|
cdc730d573 | ||
|
|
6420acca6d | ||
|
|
371bc9513a | ||
|
|
169216bfff | ||
|
|
6b391e3373 | ||
|
|
55e39c2d30 | ||
|
|
90b7b83ec7 | ||
|
|
d431dc0181 | ||
|
|
ccf1680aaf | ||
|
|
ea84fc0a53 | ||
|
|
19208fb06b | ||
|
|
e02bebd96d | ||
|
|
32ab6ce15b | ||
|
|
1739a260fb | ||
|
|
aaf3233818 | ||
|
|
8b05880f73 | ||
|
|
eba237f39d | ||
|
|
a8e1e3cbb8 | ||
|
|
597212b9f3 | ||
|
|
30abcf3cf9 | ||
|
|
48e230f40d | ||
|
|
c404f49569 | ||
|
|
cf2bae6e9b | ||
|
|
5b2fdfff9c | ||
|
|
ea2b1c5b2a | ||
|
|
eef1cee9b7 | ||
|
|
2c52364527 | ||
|
|
128476efc9 | ||
|
|
1b3a6a0fe5 | ||
|
|
83a8ee7038 | ||
|
|
62bbadf668 | ||
|
|
91f548b497 | ||
|
|
cdaf46665a | ||
|
|
6596c63dcd | ||
|
|
59f23f7579 | ||
|
|
5e55e397e9 | ||
|
|
88c421e8de | ||
|
|
3db5bfe6e5 | ||
|
|
83dfdd5f50 | ||
|
|
8a2b1cd4c9 | ||
|
|
1ede8ca170 | ||
|
|
13981404e2 | ||
|
|
fd64dd26f6 | ||
|
|
24df95e4b8 | ||
|
|
a8ee48c2ce | ||
|
|
09e089c3dc | ||
|
|
e46cbb7d84 | ||
|
|
57ec73ec6c | ||
|
|
9e27575387 | ||
|
|
b4ad8d8bf0 | ||
|
|
e315b9fada | ||
|
|
42baf287a4 | ||
|
|
2ceba22a7a | ||
|
|
9ed56b4a25 | ||
|
|
ecb6c5c36c | ||
|
|
377c7099a8 | ||
|
|
51e2abfa60 | ||
|
|
7b0a49732e | ||
|
|
20268a6068 | ||
|
|
d04ac068fd | ||
|
|
5d5d392c02 | ||
|
|
170863e553 | ||
|
|
97f97306a4 | ||
|
|
1077b7ddc8 | ||
|
|
c57b59f02f | ||
|
|
34be359e25 | ||
|
|
8b12da8b0f | ||
|
|
c63a33904f | ||
|
|
70b0fede64 | ||
|
|
0b681e51e7 | ||
|
|
7d80d6de4a | ||
|
|
791e89ce0f | ||
|
|
98c48a1c45 | ||
|
|
63d397120a | ||
|
|
7998fe9906 | ||
|
|
3a119d606f | ||
|
|
a5eafb75f9 | ||
|
|
9a567e4b37 | ||
|
|
8e606bcc06 | ||
|
|
a1b7219b5d | ||
|
|
b0f39a1a61 | ||
|
|
5ab6538757 | ||
|
|
b32296e18f | ||
|
|
99ecdf7b5d | ||
|
|
ff9917a1c4 | ||
|
|
8c064a5f29 | ||
|
|
0e137670fc | ||
|
|
395c8d678a | ||
|
|
830da7fa27 | ||
|
|
a655cbef86 | ||
|
|
4b707aac92 | ||
|
|
951c0d1d35 | ||
|
|
3545e35a42 | ||
|
|
f3417da838 | ||
|
|
e5277dbf5c | ||
|
|
1a55227d5a | ||
|
|
5cfa621b2d | ||
|
|
a609a07f8c | ||
|
|
bcf92b3c46 | ||
|
|
097378ab90 | ||
|
|
10bbbe28c5 | ||
|
|
c92a6866f3 | ||
|
|
6908dc59a5 | ||
|
|
50dae10421 | ||
|
|
0517972d02 | ||
|
|
d46e68e6ad | ||
|
|
2584a4149a | ||
|
|
66674afd09 | ||
|
|
e9ca0c9dab | ||
|
|
7e6e8ca73f | ||
|
|
408e098859 | ||
|
|
57f37551f8 | ||
|
|
4c66b689c3 | ||
|
|
1bde2cf076 | ||
|
|
31fc0f218a | ||
|
|
3d3bcc29a8 | ||
|
|
99dcd75f64 | ||
|
|
154d2caf5b | ||
|
|
a3afeec0b2 | ||
|
|
3573784b4d | ||
|
|
872f300955 | ||
|
|
d7b61a039e | ||
|
|
248158a3e1 | ||
|
|
9f4309c376 | ||
|
|
463f9309f9 | ||
|
|
abe989e355 | ||
|
|
881b4ca3a2 | ||
|
|
10c6dd2551 | ||
|
|
7ec6721c44 | ||
|
|
e61812ee55 | ||
|
|
734ac379bb | ||
|
|
759f8e4ac9 | ||
|
|
aef7b0744c | ||
|
|
39f836eac8 | ||
|
|
cbeb86dad6 | ||
|
|
372c90ceb5 | ||
|
|
2e2e69107c | ||
|
|
ee4cd089f7 | ||
|
|
2d7ec75d50 | ||
|
|
7938ed4893 | ||
|
|
4740423afa | ||
|
|
1776311a9b | ||
|
|
c1a3e05cb0 | ||
|
|
ecb6703d4a | ||
|
|
0bf97a367b | ||
|
|
1c504d72e4 | ||
|
|
5ef9580b17 | ||
|
|
08bd2123b6 | ||
|
|
8766d286df | ||
|
|
623b5d9d48 | ||
|
|
18659118cd | ||
|
|
d1050f4eaf | ||
|
|
b81d45510e | ||
|
|
d135feb1a5 | ||
|
|
242ff4e91d | ||
|
|
7a0c1316ce | ||
|
|
77ebd479f4 | ||
|
|
e3f226a9d9 | ||
|
|
bdc615c1d4 | ||
|
|
ad1beaf255 | ||
|
|
de0480ac5b | ||
|
|
f2866533a8 | ||
|
|
0173850ef0 | ||
|
|
acea3594fb | ||
|
|
f78a247749 | ||
|
|
ccaf12e1a2 | ||
|
|
96b132c97d | ||
|
|
70428ca3a8 | ||
|
|
9aea79d621 | ||
|
|
1770988627 | ||
|
|
2bfdad34bb | ||
|
|
953766cedd | ||
|
|
dc61301d9f | ||
|
|
19e05a099d | ||
|
|
0238caa8b1 | ||
|
|
a22ebb9836 | ||
|
|
eeb314edd6 | ||
|
|
83c57a9d98 | ||
|
|
24a4808826 | ||
|
|
29ed675ee5 | ||
|
|
7dc7097208 | ||
|
|
f434653432 | ||
|
|
090361c25b | ||
|
|
e1f18690f6 | ||
|
|
54a42aafe5 | ||
|
|
8fc5f8dc90 | ||
|
|
a0d62519c1 | ||
|
|
b71c01b316 | ||
|
|
1372977a37 | ||
|
|
c0e0d5d84b | ||
|
|
b328795051 | ||
|
|
3b17d62ccd | ||
|
|
874b8c4795 | ||
|
|
7ef5490884 | ||
|
|
f66de7df59 | ||
|
|
fbbd4e0968 | ||
|
|
8c89ba005e | ||
|
|
50775a1e6f | ||
|
|
87cf650168 | ||
|
|
6e65c5e631 | ||
|
|
a58b05a61b | ||
|
|
42dab6319b | ||
|
|
8428809369 | ||
|
|
642af5591e | ||
|
|
2025a6279a | ||
|
|
3465b04724 | ||
|
|
66c5e71fa8 | ||
|
|
01560f1db0 | ||
|
|
39535565ee | ||
|
|
a8d476c6ad | ||
|
|
29b4a1786c | ||
|
|
dbf284b2d9 | ||
|
|
3df5015668 | ||
|
|
756379bf83 | ||
|
|
41fd8a966a | ||
|
|
86e4933b1a | ||
|
|
a633a744b6 | ||
|
|
ddc31f57ba | ||
|
|
35d3e064bf | ||
|
|
997ab9bb2e | ||
|
|
53ce317e59 | ||
|
|
da6947cfa3 | ||
|
|
46d6349af4 | ||
|
|
12a5a5fa3c | ||
|
|
ad18fa490d | ||
|
|
43bfa6199d | ||
|
|
72b9b0e3b6 | ||
|
|
6205fa6f21 | ||
|
|
d676a5314b | ||
|
|
dfc78b39d3 | ||
|
|
7b57c9a619 | ||
|
|
123bc1d91d | ||
|
|
dd18307e66 | ||
|
|
543fa12e68 | ||
|
|
af1a871270 | ||
|
|
2b71181a37 | ||
|
|
0454e6be91 | ||
|
|
33f8157961 | ||
|
|
eecc06086f | ||
|
|
dfea113f28 | ||
|
|
1842d7f5b5 | ||
|
|
f5cfd439ee | ||
|
|
248b43cc47 | ||
|
|
bf72969ab1 | ||
|
|
7b5a601d48 | ||
|
|
405d531100 | ||
|
|
e9607fcd9b | ||
|
|
a465a920ec | ||
|
|
b20839be77 | ||
|
|
209beb9955 | ||
|
|
cfe87f50c1 | ||
|
|
680b971bb0 | ||
|
|
6b0d3c1fa8 | ||
|
|
dc9e3dcf4a | ||
|
|
cc75c12905 | ||
|
|
f159e1c2d3 | ||
|
|
3a375d3436 | ||
|
|
626f10e0d0 | ||
|
|
b997578078 | ||
|
|
ce8a48d715 | ||
|
|
99879e9e75 | ||
|
|
c969d1a1ce | ||
|
|
fcac296c4a | ||
|
|
e420b17496 | ||
|
|
23a846c594 | ||
|
|
8995e2e078 | ||
|
|
ab345e600b | ||
|
|
d003a00d71 | ||
|
|
ae85dcde76 | ||
|
|
eb819c29e8 | ||
|
|
fb630de40a | ||
|
|
43960a8ca7 | ||
|
|
f6608fe99c | ||
|
|
98a6e52c06 | ||
|
|
824712a4ee | ||
|
|
0e42628ef6 | ||
|
|
98a999fe44 | ||
|
|
fec7bd713f | ||
|
|
2f693e8ca4 | ||
|
|
704ff9f4c6 | ||
|
|
68c63f2d68 | ||
|
|
76206f574f | ||
|
|
e575f884e1 | ||
|
|
571161d5a2 | ||
|
|
07d41efc2b | ||
|
|
984f7846c0 | ||
|
|
af1d6afba9 | ||
|
|
cbdb6c069f | ||
|
|
35b6d9f7d5 | ||
|
|
39a9666246 | ||
|
|
662d05dc02 | ||
|
|
379457c18b | ||
|
|
03169d590b | ||
|
|
8c8d446820 | ||
|
|
0ddb064f17 | ||
|
|
131cfc6938 | ||
|
|
2f463b1db0 | ||
|
|
3b518271ee | ||
|
|
481d8239e9 | ||
|
|
4f77b0c1ed | ||
|
|
d7a31e40e6 | ||
|
|
dd18cd75de | ||
|
|
99a2709913 | ||
|
|
032068a747 | ||
|
|
1cb0bf4bef | ||
|
|
422b43374e | ||
|
|
29a26e3eea | ||
|
|
a7b38f6900 | ||
|
|
e896c9ec05 | ||
|
|
98ba8928c6 | ||
|
|
bcf8462d20 | ||
|
|
c047c852ce | ||
|
|
b24d68ae9f | ||
|
|
65deedfa96 | ||
|
|
21a46ba652 | ||
|
|
1617b87ee1 | ||
|
|
2191ac58ad | ||
|
|
fa5a645ca5 | ||
|
|
c2b09356b8 | ||
|
|
a3f0aa1d5b | ||
|
|
52ffbc9e0c | ||
|
|
a9790c0f1d | ||
|
|
d0ac78ac08 | ||
|
|
22290db3e4 | ||
|
|
cd24dc8834 | ||
|
|
b8e758df0f | ||
|
|
311fa90030 | ||
|
|
fb8a1b5536 | ||
|
|
7f11f4c4d4 | ||
|
|
285eb0da05 | ||
|
|
192217a10c | ||
|
|
f22a94e868 | ||
|
|
79b0caca95 | ||
|
|
afc2f2e84b | ||
|
|
e6f66f2f3b | ||
|
|
70735098e2 | ||
|
|
d4b5dfc297 | ||
|
|
5acd709524 |
@@ -0,0 +1,3 @@
|
||||
[submodule "lib/simde"]
|
||||
path = lib/simde
|
||||
url = https://github.com/nemequ/simde.git
|
||||
+5
-5
@@ -6,19 +6,19 @@ matrix:
|
||||
- language: c
|
||||
compiler: clang
|
||||
script: make
|
||||
- arch: arm64
|
||||
language: c
|
||||
compiler: gcc
|
||||
script: make arm_neon=1 aarch64=1
|
||||
- language: python
|
||||
python: "2.7"
|
||||
before_install: pip install cython
|
||||
script: python setup.py build_ext
|
||||
- language: python
|
||||
python: "3.3"
|
||||
before_install: pip install cython
|
||||
script: python setup.py build_ext
|
||||
- language: python
|
||||
python: "3.5"
|
||||
before_install: pip install cython
|
||||
script: python setup.py build_ext
|
||||
- language: python
|
||||
python: "3.6"
|
||||
python: "3.9"
|
||||
before_install: pip install cython
|
||||
script: python setup.py build_ext
|
||||
|
||||
@@ -0,0 +1,46 @@
|
||||
#### 1. Alignment different with option `-a` or `-c`?
|
||||
|
||||
Without `-a`, `-c` or `--cs`, minimap2 only finds *approximate* mapping
|
||||
locations without detailed base alignment. In particular, the start and end
|
||||
positions of the alignment are impricise. With one of those options, minimap2
|
||||
will perform base alignment, which is generally more accurate but is much
|
||||
slower.
|
||||
|
||||
#### 2. How to map Illumina short reads to noisy long reads?
|
||||
|
||||
No good solutions. The better approach is to assemble short reads into contigs
|
||||
and then map noisy reads to contigs.
|
||||
|
||||
#### 3. The output SAM doesn't have a header.
|
||||
|
||||
By default, minimap2 indexes 4 billion reference bases (4Gb) in a batch and map
|
||||
all reads against each reference batch. Given a reference longer than 4Gb,
|
||||
minimap2 is unable to see all the sequences and thus can't produce a correct
|
||||
SAM header. In this case, minimap2 doesn't output any SAM header. There are two
|
||||
solutions to this issue. First, you may increase option `-I` to, for example,
|
||||
`-I8g` to index more reference bases in a batch. This is preferred if your
|
||||
machine has enough memory. Second, if your machines doesn't have enough memory
|
||||
to hold the reference index, you can use the `--split-prefix` option in a
|
||||
command line like:
|
||||
```sh
|
||||
minimap2 -ax map-ont --split-prefix=tmp ref.fa reads.fq
|
||||
```
|
||||
This second approach uses less memory, but it is slower and requires temporary
|
||||
disk space.
|
||||
|
||||
#### 4. The output SAM is malformatted.
|
||||
|
||||
This typically happens when you use nohup to wrap a minimap2 command line.
|
||||
Nohup is discouraged as it breaks piping. If you have to use nohup, please
|
||||
specify an output file with option `-o`.
|
||||
|
||||
#### 5. How to output one alignment per read?
|
||||
|
||||
You can use `--secondary=no` to suppress secondary alignments (aka multiple
|
||||
mappings), but you can't suppress supplementary alignment (aka split or
|
||||
chimeric alignment) this way. You can use samtools to filter out these
|
||||
alignments:
|
||||
```sh
|
||||
minimap2 -ax map-out ref.fa reads.fq | samtools view -F0x900
|
||||
```
|
||||
However, this is discouraged as supplementary alignment is informative.
|
||||
+2
-1
@@ -1,6 +1,7 @@
|
||||
The MIT License
|
||||
|
||||
Copyright (c) 2017 Broad Institute, Inc.
|
||||
Copyright (c) 2018- Dana-Farber Cancer Institute
|
||||
2017-2018 Broad Institute, Inc.
|
||||
|
||||
Permission is hereby granted, free of charge, to any person obtaining
|
||||
a copy of this software and associated documentation files (the
|
||||
|
||||
+1
-1
@@ -1,9 +1,9 @@
|
||||
include *.h
|
||||
include Makefile
|
||||
include ksw2_dispatch.c
|
||||
include getopt.c
|
||||
include main.c
|
||||
include README.md
|
||||
include sse2neon/emmintrin.h
|
||||
include python/mappy.c
|
||||
include python/cmappy.h
|
||||
include python/cmappy.pxd
|
||||
|
||||
@@ -1,17 +1,38 @@
|
||||
CFLAGS= -g -Wall -O2 -Wc++-compat
|
||||
CFLAGS= -g -Wall -O2 -Wc++-compat #-Wextra
|
||||
CPPFLAGS= -DHAVE_KALLOC
|
||||
INCLUDES=
|
||||
OBJS= kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o index.o chain.o align.o hit.o map.o format.o pe.o ksw2_ll_sse.o
|
||||
OBJS= kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o options.o index.o chain.o align.o hit.o map.o format.o pe.o esterr.o splitidx.o ksw2_ll_sse.o
|
||||
PROG= minimap2
|
||||
PROG_EXTRA= sdust minimap2-lite
|
||||
LIBS= -lm -lz -lpthread
|
||||
|
||||
ifeq ($(sse2only),)
|
||||
ifeq ($(arm_neon),) # if arm_neon is not defined
|
||||
ifeq ($(sse2only),) # if sse2only is not defined
|
||||
OBJS+=ksw2_extz2_sse41.o ksw2_extd2_sse41.o ksw2_exts2_sse41.o ksw2_extz2_sse2.o ksw2_extd2_sse2.o ksw2_exts2_sse2.o ksw2_dispatch.o
|
||||
else
|
||||
else # if sse2only is defined
|
||||
OBJS+=ksw2_extz2_sse.o ksw2_extd2_sse.o ksw2_exts2_sse.o
|
||||
endif
|
||||
else # if arm_neon is defined
|
||||
OBJS+=ksw2_extz2_neon.o ksw2_extd2_neon.o ksw2_exts2_neon.o
|
||||
INCLUDES+=-Isse2neon
|
||||
ifeq ($(aarch64),) #if aarch64 is not defined
|
||||
CFLAGS+=-D_FILE_OFFSET_BITS=64 -mfpu=neon -fsigned-char
|
||||
else #if aarch64 is defined
|
||||
CFLAGS+=-D_FILE_OFFSET_BITS=64 -fsigned-char
|
||||
endif
|
||||
endif
|
||||
|
||||
ifneq ($(asan),)
|
||||
CFLAGS+=-fsanitize=address
|
||||
LIBS+=-fsanitize=address
|
||||
endif
|
||||
|
||||
ifneq ($(tsan),)
|
||||
CFLAGS+=-fsanitize=thread
|
||||
LIBS+=-fsanitize=thread
|
||||
endif
|
||||
|
||||
.PHONY:all extra clean depend
|
||||
.SUFFIXES:.c .o
|
||||
|
||||
.c.o:
|
||||
@@ -21,8 +42,8 @@ all:$(PROG)
|
||||
|
||||
extra:all $(PROG_EXTRA)
|
||||
|
||||
minimap2:main.o getopt.o libminimap2.a
|
||||
$(CC) $(CFLAGS) main.o getopt.o -o $@ -L. -lminimap2 $(LIBS)
|
||||
minimap2:main.o libminimap2.a
|
||||
$(CC) $(CFLAGS) main.o -o $@ -L. -lminimap2 $(LIBS)
|
||||
|
||||
minimap2-lite:example.o libminimap2.a
|
||||
$(CC) $(CFLAGS) $< -o $@ -L. -lminimap2 $(LIBS)
|
||||
@@ -30,32 +51,52 @@ minimap2-lite:example.o libminimap2.a
|
||||
libminimap2.a:$(OBJS)
|
||||
$(AR) -csru $@ $(OBJS)
|
||||
|
||||
sdust:sdust.c getopt.o kalloc.o kalloc.h kdq.h kvec.h kseq.h sdust.h
|
||||
$(CC) -D_SDUST_MAIN $(CFLAGS) $< getopt.o kalloc.o -o $@ -lz
|
||||
sdust:sdust.c kalloc.o kalloc.h kdq.h kvec.h kseq.h ketopt.h sdust.h
|
||||
$(CC) -D_SDUST_MAIN $(CFLAGS) $< kalloc.o -o $@ -lz
|
||||
|
||||
# SSE-specific targets on x86/x86_64
|
||||
|
||||
ifeq ($(arm_neon),) # if arm_neon is defined, compile this target with the default setting (i.e. no -msse2)
|
||||
ksw2_ll_sse.o:ksw2_ll_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c $(CFLAGS) -msse2 $(CPPFLAGS) $(INCLUDES) $< -o $@
|
||||
endif
|
||||
|
||||
ksw2_extz2_sse41.o:ksw2_extz2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_extz2_sse2.o:ksw2_extz2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
|
||||
$(CC) -c $(CFLAGS) -msse2 -mno-sse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_extd2_sse41.o:ksw2_extd2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_extd2_sse2.o:ksw2_extd2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
|
||||
$(CC) -c $(CFLAGS) -msse2 -mno-sse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_exts2_sse41.o:ksw2_exts2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_exts2_sse2.o:ksw2_exts2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
|
||||
$(CC) -c $(CFLAGS) -msse2 -mno-sse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_dispatch.o:ksw2_dispatch.c ksw2.h
|
||||
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||
|
||||
# NEON-specific targets on ARM
|
||||
|
||||
ksw2_extz2_neon.o:ksw2_extz2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_SSE2_ONLY -D__SSE2__ $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_extd2_neon.o:ksw2_extd2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_SSE2_ONLY -D__SSE2__ $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_exts2_neon.o:ksw2_exts2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_SSE2_ONLY -D__SSE2__ $(INCLUDES) $< -o $@
|
||||
|
||||
# other non-file targets
|
||||
|
||||
clean:
|
||||
rm -fr gmon.out *.o a.out $(PROG) $(PROG_EXTRA) *~ *.a *.dSYM build dist mappy.so mappy.c python/mappy.c mappy.egg*
|
||||
rm -fr gmon.out *.o a.out $(PROG) $(PROG_EXTRA) *~ *.a *.dSYM build dist mappy*.so mappy.c python/mappy.c mappy.egg*
|
||||
|
||||
depend:
|
||||
(LC_ALL=C; export LC_ALL; makedepend -Y -- $(CFLAGS) $(CPPFLAGS) -- *.c)
|
||||
@@ -65,9 +106,9 @@ depend:
|
||||
align.o: minimap.h mmpriv.h bseq.h ksw2.h kalloc.h
|
||||
bseq.o: bseq.h kvec.h kalloc.h kseq.h
|
||||
chain.o: minimap.h mmpriv.h bseq.h kalloc.h
|
||||
esterr.o: mmpriv.h minimap.h bseq.h
|
||||
example.o: minimap.h kseq.h
|
||||
format.o: kalloc.h mmpriv.h minimap.h bseq.h
|
||||
getopt.o: getopt.h
|
||||
hit.o: mmpriv.h minimap.h bseq.h kalloc.h khash.h
|
||||
index.o: kthread.h bseq.h minimap.h mmpriv.h kvec.h kalloc.h khash.h
|
||||
kalloc.o: kalloc.h
|
||||
@@ -75,9 +116,13 @@ ksw2_extd2_sse.o: ksw2.h kalloc.h
|
||||
ksw2_exts2_sse.o: ksw2.h kalloc.h
|
||||
ksw2_extz2_sse.o: ksw2.h kalloc.h
|
||||
ksw2_ll_sse.o: ksw2.h kalloc.h
|
||||
main.o: bseq.h minimap.h mmpriv.h getopt.h
|
||||
kthread.o: kthread.h
|
||||
main.o: bseq.h minimap.h mmpriv.h ketopt.h
|
||||
map.o: kthread.h kvec.h kalloc.h sdust.h mmpriv.h minimap.h bseq.h khash.h
|
||||
misc.o: minimap.h ksort.h
|
||||
map.o: ksort.h
|
||||
misc.o: mmpriv.h minimap.h bseq.h ksort.h
|
||||
options.o: mmpriv.h minimap.h bseq.h
|
||||
pe.o: mmpriv.h minimap.h bseq.h kvec.h kalloc.h ksort.h
|
||||
sdust.o: kalloc.h kdq.h kvec.h sdust.h
|
||||
sketch.o: kvec.h kalloc.h minimap.h
|
||||
sdust.o: kalloc.h kdq.h kvec.h ketopt.h sdust.h
|
||||
sketch.o: kvec.h kalloc.h mmpriv.h minimap.h bseq.h
|
||||
splitidx.o: mmpriv.h minimap.h bseq.h
|
||||
|
||||
@@ -0,0 +1,97 @@
|
||||
CFLAGS= -g -Wall -O2 -Wc++-compat #-Wextra
|
||||
CPPFLAGS= -DHAVE_KALLOC -DUSE_SIMDE -DSIMDE_ENABLE_NATIVE_ALIASES
|
||||
INCLUDES= -Ilib/simde
|
||||
OBJS= kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o options.o index.o chain.o align.o hit.o map.o format.o pe.o esterr.o splitidx.o \
|
||||
ksw2_extz2_simde.o ksw2_extd2_simde.o ksw2_exts2_simde.o ksw2_ll_simde.o
|
||||
PROG= minimap2
|
||||
PROG_EXTRA= sdust minimap2-lite
|
||||
LIBS= -lm -lz -lpthread
|
||||
|
||||
|
||||
ifneq ($(arm_neon),) # if arm_neon is defined
|
||||
ifeq ($(aarch64),) #if aarch64 is not defined
|
||||
CFLAGS+=-D_FILE_OFFSET_BITS=64 -mfpu=neon -fsigned-char
|
||||
else #if aarch64 is defined
|
||||
CFLAGS+=-D_FILE_OFFSET_BITS=64 -fsigned-char
|
||||
endif
|
||||
endif
|
||||
|
||||
ifneq ($(asan),)
|
||||
CFLAGS+=-fsanitize=address
|
||||
LIBS+=-fsanitize=address
|
||||
endif
|
||||
|
||||
ifneq ($(tsan),)
|
||||
CFLAGS+=-fsanitize=thread
|
||||
LIBS+=-fsanitize=thread
|
||||
endif
|
||||
|
||||
.PHONY:all extra clean depend
|
||||
.SUFFIXES:.c .o
|
||||
|
||||
.c.o:
|
||||
$(CC) -c $(CFLAGS) $(CPPFLAGS) $(INCLUDES) $< -o $@
|
||||
|
||||
all:$(PROG)
|
||||
|
||||
extra:all $(PROG_EXTRA)
|
||||
|
||||
minimap2:main.o libminimap2.a
|
||||
$(CC) $(CFLAGS) main.o -o $@ -L. -lminimap2 $(LIBS)
|
||||
|
||||
minimap2-lite:example.o libminimap2.a
|
||||
$(CC) $(CFLAGS) $< -o $@ -L. -lminimap2 $(LIBS)
|
||||
|
||||
libminimap2.a:$(OBJS)
|
||||
$(AR) -csru $@ $(OBJS)
|
||||
|
||||
sdust:sdust.c kalloc.o kalloc.h kdq.h kvec.h kseq.h ketopt.h sdust.h
|
||||
$(CC) -D_SDUST_MAIN $(CFLAGS) $< kalloc.o -o $@ -lz
|
||||
|
||||
ksw2_ll_simde.o:ksw2_ll_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c $(CFLAGS) -msse2 $(CPPFLAGS) $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_extz2_simde.o:ksw2_extz2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_extd2_simde.o:ksw2_extd2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_exts2_simde.o:ksw2_exts2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) $(INCLUDES) $< -o $@
|
||||
|
||||
# other non-file targets
|
||||
|
||||
clean:
|
||||
rm -fr gmon.out *.o a.out $(PROG) $(PROG_EXTRA) *~ *.a *.dSYM build dist mappy*.so mappy.c python/mappy.c mappy.egg*
|
||||
|
||||
depend:
|
||||
(LC_ALL=C; export LC_ALL; makedepend -Y -- $(CFLAGS) $(CPPFLAGS) -- *.c)
|
||||
|
||||
# DO NOT DELETE
|
||||
|
||||
align.o: minimap.h mmpriv.h bseq.h kseq.h ksw2.h kalloc.h
|
||||
bseq.o: bseq.h kvec.h kalloc.h kseq.h
|
||||
chain.o: minimap.h mmpriv.h bseq.h kseq.h kalloc.h
|
||||
esterr.o: mmpriv.h minimap.h bseq.h kseq.h
|
||||
example.o: minimap.h kseq.h
|
||||
format.o: kalloc.h mmpriv.h minimap.h bseq.h kseq.h
|
||||
hit.o: mmpriv.h minimap.h bseq.h kseq.h kalloc.h khash.h
|
||||
index.o: kthread.h bseq.h minimap.h mmpriv.h kseq.h kvec.h kalloc.h khash.h
|
||||
index.o: ksort.h
|
||||
kalloc.o: kalloc.h
|
||||
ksw2_extd2_sse.o: ksw2.h kalloc.h
|
||||
ksw2_exts2_sse.o: ksw2.h kalloc.h
|
||||
ksw2_extz2_sse.o: ksw2.h kalloc.h
|
||||
ksw2_ll_sse.o: ksw2.h kalloc.h
|
||||
kthread.o: kthread.h
|
||||
main.o: bseq.h minimap.h mmpriv.h kseq.h ketopt.h
|
||||
map.o: kthread.h kvec.h kalloc.h sdust.h mmpriv.h minimap.h bseq.h kseq.h
|
||||
map.o: khash.h ksort.h
|
||||
misc.o: mmpriv.h minimap.h bseq.h kseq.h ksort.h
|
||||
options.o: mmpriv.h minimap.h bseq.h kseq.h
|
||||
pe.o: mmpriv.h minimap.h bseq.h kseq.h kvec.h kalloc.h ksort.h
|
||||
sdust.o: kalloc.h kdq.h kvec.h sdust.h
|
||||
self-chain.o: minimap.h kseq.h
|
||||
sketch.o: kvec.h kalloc.h mmpriv.h minimap.h bseq.h kseq.h
|
||||
splitidx.o: mmpriv.h minimap.h bseq.h kseq.h
|
||||
@@ -1,3 +1,547 @@
|
||||
Release 2.18-r1015 (9 April 2021)
|
||||
---------------------------------
|
||||
|
||||
This release fixes multiple rare bugs in minimap2 and adds additional
|
||||
functionality to paftools.js.
|
||||
|
||||
Changes to minimap2:
|
||||
|
||||
* Bugfix: a rare segfault caused by an off-by-one error (#489)
|
||||
|
||||
* Bugfix: minimap2 segfaulted due to an uninitilized variable (#622 and #625).
|
||||
|
||||
* Bugfix: minimap2 parsed spaces as field separators in BED (#721). This led
|
||||
to issues when the BED name column contains spaces.
|
||||
|
||||
* Bugfix: minimap2 `--split-prefix` did not work with long reference names
|
||||
(#394).
|
||||
|
||||
* Bugfix: option `--junc-bonus` didn't work (#513)
|
||||
|
||||
* Bugfix: minimap2 didn't return 1 on I/O errors (#532)
|
||||
|
||||
* Bugfix: the `de:f` tag (sequence divergence) could be negative if there were
|
||||
ambiguous bases
|
||||
|
||||
* Bugfix: fixed two undefined behaviors caused by calling memcpy() on
|
||||
zero-length blocks (#443)
|
||||
|
||||
* Bugfix: there were duplicated SAM @SQ lines if option `--split-prefix` is in
|
||||
use (#400 and #527)
|
||||
|
||||
* Bugfix: option -K had to be smaller than 2 billion (#491). This was caused
|
||||
by a 32-bit integer overflow.
|
||||
|
||||
* Improvement: optionally compile against SIMDe (#597). Minimap2 should work
|
||||
with IBM POWER CPUs, though this has not been tested. To compile with SIMDe,
|
||||
please use `make -f Makefile.simde`.
|
||||
|
||||
* Improvement: more informative error message for I/O errors (#454) and for
|
||||
FASTQ parsing errors (#510)
|
||||
|
||||
* Improvement: abort given malformatted RG line (#541)
|
||||
|
||||
* Improvement: better formula to estimate the `dv:f` tag (approximate sequence
|
||||
divergence). See DOI:10.1101/2021.01.15.426881.
|
||||
|
||||
* New feature: added the `--mask-len` option to fine control the removal of
|
||||
redundant hits (#659). The default behavior is unchanged.
|
||||
|
||||
Changes to mappy:
|
||||
|
||||
* Bugfix: mappy caused segmentation fault if the reference index is not
|
||||
present (#413).
|
||||
|
||||
* Bugfix: fixed a memory leak via 238b6bb3
|
||||
|
||||
* Change: always require Cython to compile the mappy module (#723). Older
|
||||
mappy packages at PyPI bundled the C source code generated by Cython such
|
||||
that end users did not need to install Cython to compile mappy. However, as
|
||||
Python 3.9 is breaking backward compatibility, older mappy does not work
|
||||
with Python 3.9 anymore. We have to add this Cython dependency as a
|
||||
workaround.
|
||||
|
||||
Changes to paftools.js:
|
||||
|
||||
* Bugfix: the "part10-" line from asmgene was wrong (#581)
|
||||
|
||||
* Improvement: compatibility with GTF files from GenBank (#422)
|
||||
|
||||
* New feature: asmgene also checks missing multi-copy genes
|
||||
|
||||
* New feature: added the misjoin command to evaluate large-scale misjoins and
|
||||
megabase-long inversions.
|
||||
|
||||
Although given the many bug fixes and minor improvements, the core algorithm
|
||||
stays the same. This version of minimap2 produces nearly identical alignments
|
||||
to v2.17 except very rare corner cases.
|
||||
|
||||
Now unimap is recommended over minimap2 for aligning long contigs against a
|
||||
reference genome. It often takes less wall-clock time and is much more
|
||||
sensitive to long insertions and deletions.
|
||||
|
||||
(2.18: 9 April 2021, r1015)
|
||||
|
||||
|
||||
|
||||
Release 2.17-r941 (4 May 2019)
|
||||
------------------------------
|
||||
|
||||
Changes since the last release:
|
||||
|
||||
* Fixed flawed CIGARs like `5I6D7I` (#392).
|
||||
|
||||
* Bugfix: TLEN should be 0 when either end is unmapped (#373 and #365).
|
||||
|
||||
* Bugfix: mappy is unable to write index (#372).
|
||||
|
||||
* Added option `--junc-bed` to load known gene annotations in the BED12
|
||||
format. Minimap2 prefers annotated junctions over novel junctions (#197 and
|
||||
#348). GTF can be converted to BED12 with `paftools.js gff2bed`.
|
||||
|
||||
* Added option `--sam-hit-only` to suppress unmapped hits in SAM (#377).
|
||||
|
||||
* Added preset `splice:hq` for high-quality CCS or mRNA sequences. It applies
|
||||
better scoring and improves the sensitivity to small exons. This preset may
|
||||
introduce false small introns, but the overall accuracy should be higher.
|
||||
|
||||
This version produces nearly identical alignments to v2.16, except for CIGARs
|
||||
affected by the bug mentioned above.
|
||||
|
||||
(2.17: 5 May 2019, r941)
|
||||
|
||||
|
||||
|
||||
Release 2.16-r922 (28 February 2019)
|
||||
------------------------------------
|
||||
|
||||
This release is 50% faster for mapping ultra-long nanopore reads at comparable
|
||||
accuracy. For short-read mapping, long-read overlapping and ordinary long-read
|
||||
mapping, the performance and accuracy remain similar. This speedup is achieved
|
||||
with a new heuristic to limit the number of chaining iterations (#324). Users
|
||||
can disable the heuristic by increasing a new option `--max-chain-iter` to a
|
||||
huge number.
|
||||
|
||||
Other changes to minimap2:
|
||||
|
||||
* Implemented option `--paf-no-hit` to output unmapped query sequences in PAF.
|
||||
The strand and reference name columns are both `*` at an unmapped line. The
|
||||
hidden option is available in earlier minimap2 but had a different 2-column
|
||||
output format instead of PAF.
|
||||
|
||||
* Fixed a bug that leads to wrongly calculated `de` tags when ambiguous bases
|
||||
are involved (#309). This bug only affects v2.15.
|
||||
|
||||
* Fixed a bug when parsing command-line option `--splice` (#344). This bug was
|
||||
introduced in v2.13.
|
||||
|
||||
* Fixed two division-by-zero cases (#326). They don't affect final alignments
|
||||
because the results of the divisions are not used in both case.
|
||||
|
||||
* Added an option `-o` to output alignments to a specified file. It is still
|
||||
recommended to use UNIX pipes for on-the-fly conversion or compression.
|
||||
|
||||
* Output a new `rl` tag to give the length of query regions harboring
|
||||
repetitive seeds.
|
||||
|
||||
Changes to paftool.js:
|
||||
|
||||
* Added a new option to convert the MD tag to the long form of the cs tag.
|
||||
|
||||
Changes to mappy:
|
||||
|
||||
* Added the `mappy.Aligner.seq_names` method to return sequence names (#312).
|
||||
|
||||
For NA12878 ultra-long reads, this release changes the alignments of <0.1% of
|
||||
reads in comparison to v2.15. All these reads have highly fragmented alignments
|
||||
and are likely to be problematic anyway. For shorter or well aligned reads,
|
||||
this release should produce mostly identical alignments to v2.15.
|
||||
|
||||
(2.16: 28 February 2019, r922)
|
||||
|
||||
|
||||
|
||||
Release 2.15-r905 (10 January 2019)
|
||||
-----------------------------------
|
||||
|
||||
Changes to minimap2:
|
||||
|
||||
* Fixed a rare segmentation fault when option -H is in use (#307). This may
|
||||
happen when there are very long homopolymers towards the 5'-end of a read.
|
||||
|
||||
* Fixed wrong CIGARs when option --eqx is used (#266).
|
||||
|
||||
* Fixed a typo in the base encoding table (#264). This should have no
|
||||
practical effect.
|
||||
|
||||
* Fixed a typo in the example code (#265).
|
||||
|
||||
* Improved the C++ compatibility by removing "register" (#261). However,
|
||||
minimap2 still can't be compiled in the pedantic C++ mode (#306).
|
||||
|
||||
* Output a new "de" tag for gap-compressed sequence divergence.
|
||||
|
||||
Changes to paftools.js:
|
||||
|
||||
* Added "asmgene" to evaluate the completeness of an assembly by measuring the
|
||||
uniquely mapped single-copy genes. This command learns the idea of BUSCO.
|
||||
|
||||
* Added "vcfpair" to call a phased VCF from phased whole-genome assemblies. An
|
||||
earlier version of this script is used to produce the ground truth for the
|
||||
syndip benchmark [PMID:30013044].
|
||||
|
||||
This release produces identical alignment coordinates and CIGARs in comparison
|
||||
to v2.14. Users are advised to upgrade due to the several bug fixes.
|
||||
|
||||
(2.15: 10 Janurary 2019, r905)
|
||||
|
||||
|
||||
|
||||
Release 2.14-r883 (5 November 2018)
|
||||
-----------------------------------
|
||||
|
||||
Notable changes:
|
||||
|
||||
* Fixed two minor bugs caused by typos (#254 and #266).
|
||||
|
||||
* Fixed a bug that made minimap2 abort when --eqx was used together with --MD
|
||||
or --cs (#257).
|
||||
|
||||
* Added --cap-sw-mem to cap the size of DP matrices (#259). Base alignment may
|
||||
take a lot of memory in the splicing mode. This may lead to issues when we
|
||||
run minimap2 on a cluster with a hard memory limit. The new option avoids
|
||||
unlimited memory usage at the cost of missing a few long introns.
|
||||
|
||||
* Conforming to C99 and C11 when possible (#261).
|
||||
|
||||
* Warn about malformatted FASTA or FASTQ (#252 and #255).
|
||||
|
||||
This release occasionally produces base alignments different from v2.13. The
|
||||
overall alignment accuracy remain similar.
|
||||
|
||||
(2.14: 5 November 2018, r883)
|
||||
|
||||
|
||||
|
||||
Release 2.13-r850 (11 October 2018)
|
||||
-----------------------------------
|
||||
|
||||
Changes to minimap2:
|
||||
|
||||
* Fixed wrongly formatted SAM when -L is in use (#231 and #233).
|
||||
|
||||
* Fixed an integer overflow in rare cases.
|
||||
|
||||
* Added --hard-mask-level to fine control split alignments (#244).
|
||||
|
||||
* Made --MD work with spliced alignment (#139).
|
||||
|
||||
* Replaced musl's getopt with ketopt for portability.
|
||||
|
||||
* Log peak memory usage on exit.
|
||||
|
||||
This release should produce alignments identical to v2.12 and v2.11.
|
||||
|
||||
(2.13: 11 October 2018, r850)
|
||||
|
||||
|
||||
|
||||
Release 2.12-r827 (6 August 2018)
|
||||
---------------------------------
|
||||
|
||||
Changes to minimap2:
|
||||
|
||||
* Added option --split-prefix to write proper alignments (correct mapping
|
||||
quality and clustered query sequences) given a multi-part index (#141 and
|
||||
#189; mostly by @hasindu2008).
|
||||
|
||||
* Fixed a memory leak when option -y is in use.
|
||||
|
||||
Changes to mappy:
|
||||
|
||||
* Support the MD/cs tag (#183 and #203).
|
||||
|
||||
* Allow mappy to index a single sequence, to add extra flags and to change the
|
||||
scoring system.
|
||||
|
||||
Minimap2 should produce alignments identical to v2.11.
|
||||
|
||||
(2.12: 6 August 2018, r827)
|
||||
|
||||
|
||||
|
||||
Release 2.11-r797 (20 June 2018)
|
||||
--------------------------------
|
||||
|
||||
Changes to minimap2:
|
||||
|
||||
* Improved alignment accuracy in low-complexity regions for SV calling. Thank
|
||||
@armintoepfer for multiple offline examples.
|
||||
|
||||
* Added option --eqx to encode sequence match/mismatch with the =/X CIGAR
|
||||
operators (#156, #157 and #175).
|
||||
|
||||
* When compiled with VC++, minimap2 generated wrong alignments due to a
|
||||
comparison between a signed integer and an unsigned integer (#184). Also
|
||||
fixed warnings reported by "clang -Wextra".
|
||||
|
||||
* Fixed incorrect anchor filtering due to a missing 64- to 32-bit cast.
|
||||
|
||||
* Fixed incorrect mapping quality for inversions (#148).
|
||||
|
||||
* Fixed incorrect alignment involving ambiguous bases (#155).
|
||||
|
||||
* Fixed incorrect presets: option `-r 2000` is intended to be used with
|
||||
ava-ont, not ava-pb. The bug was introduced in 2.10.
|
||||
|
||||
* Fixed a bug when --for-only/--rev-only is used together with --sr or
|
||||
--heap-sort=yes (#166).
|
||||
|
||||
* Fixed option -Y that was not working in the previous releases.
|
||||
|
||||
* Added option --lj-min-ratio to fine control the alignment of long gaps
|
||||
found by the "long-join" heuristic (#128).
|
||||
|
||||
* Exposed `mm_idx_is_idx`, `mm_idx_load` and `mm_idx_dump` C APIs (#177).
|
||||
Also fixed a bug when indexing without reference names (this feature is not
|
||||
exposed to the command line).
|
||||
|
||||
Changes to mappy:
|
||||
|
||||
* Added `__version__` (#165).
|
||||
|
||||
* Exposed the maximum fragment length parameter to mappy (#174).
|
||||
|
||||
Changes to paftools:
|
||||
|
||||
* Don't crash when there is no "cg" tag (#153).
|
||||
|
||||
* Fixed wrong coverage report by "paftools.js call" (#145).
|
||||
|
||||
This version may produce slightly different base-level alignment. The overall
|
||||
alignment statistics should remain similar.
|
||||
|
||||
(2.11: 20 June 2018, r797)
|
||||
|
||||
|
||||
|
||||
Release 2.10-r761 (27 March 2018)
|
||||
---------------------------------
|
||||
|
||||
Changes to minimap2:
|
||||
|
||||
* Optionally output the MD tag for compatibility with existing tools (#63,
|
||||
#118 and #137).
|
||||
|
||||
* Use SSE compiler flags more precisely to prevent compiling errors on certain
|
||||
machines (#127).
|
||||
|
||||
* Added option --min-occ-floor to set a minimum occurrence threshold. Presets
|
||||
intended for assembly-to-reference alignment set this option to 100. This
|
||||
option alleviates issues with regions having high copy numbers (#107).
|
||||
|
||||
* Exit with non-zero code on file writing errors (e.g. disk full; #103 and
|
||||
#132).
|
||||
|
||||
* Added option -y to copy FASTA/FASTQ comments in query sequences to the
|
||||
output (#136).
|
||||
|
||||
* Added the asm20 preset for alignments between genomes at 5-10% sequence
|
||||
divergence.
|
||||
|
||||
* Changed the band-width in the ava-ont preset from 500 to 2000. Oxford
|
||||
Nanopore reads may contain long deletion sequencing errors that break
|
||||
chaining.
|
||||
|
||||
Changes to mappy, the Python binding:
|
||||
|
||||
* Fixed a typo in Align.seq() (#126).
|
||||
|
||||
Changes to paftools.js, the companion script:
|
||||
|
||||
* Command sam2paf now converts the MD tag to cs.
|
||||
|
||||
* Support VCF output for assembly-to-reference variant calling (#109).
|
||||
|
||||
This version should produce identical alignment for read overlapping, RNA-seq
|
||||
read mapping, and genomic read mapping. We have also added a cook book to show
|
||||
the variety uses of minimap2 on real datasets. Please see cookbook.md in the
|
||||
minimap2 source code directory.
|
||||
|
||||
(2.10: 27 March 2017, r761)
|
||||
|
||||
|
||||
|
||||
Release 2.9-r720 (23 February 2018)
|
||||
-----------------------------------
|
||||
|
||||
This release fixed multiple minor bugs.
|
||||
|
||||
* Fixed two bugs that lead to incorrect inversion alignment. Also improved the
|
||||
sensitivity to small inversions by using double Z-drop cutoff (#112).
|
||||
|
||||
* Fixed an issue that may cause the end of a query sequence unmapped (#104).
|
||||
|
||||
* Added a mappy API to retrieve sequences from the index (#126) and to reverse
|
||||
complement DNA sequences. Fixed a bug where the `best_n` parameter did not
|
||||
work (#117).
|
||||
|
||||
* Avoided segmentation fault given incorrect FASTQ input (#111).
|
||||
|
||||
* Combined all auxiliary javascripts to paftools.js. Fixed several bugs in
|
||||
these scripts at the same time.
|
||||
|
||||
(2.9: 24 February 2018, r720)
|
||||
|
||||
|
||||
|
||||
Release 2.8-r672 (1 February 2018)
|
||||
----------------------------------
|
||||
|
||||
Notable changes in this release include:
|
||||
|
||||
* Speed up short-read alignment by ~10%. The overall mapping accuracy stays
|
||||
the same, but the output alignments are not always identical to v2.7 due to
|
||||
unstable sorting employed during chaining. Long-read alignment is not
|
||||
affected by this change as the speedup is short-read specific.
|
||||
|
||||
* Mappy now supports paired-end short-read alignment (#87). Please see
|
||||
python/README.rst for details.
|
||||
|
||||
* Added option --for-only and --rev-only to perform alignment against the
|
||||
forward or the reverse strand of the reference genome only (#91).
|
||||
|
||||
* Alleviated the issue with undesired diagonal alignment in the self mapping
|
||||
mode (#10). Even if the output is not ideal, it should not interfere with
|
||||
other alignments. Fully resolving the issue is intricate and may require
|
||||
additional heuristic thresholds.
|
||||
|
||||
* Enhanced error checking against incorrect input (#92 and #96).
|
||||
|
||||
For long query sequences, minimap2 should output identical alignments to v2.7.
|
||||
|
||||
(2.8: 1 February 2018, r672)
|
||||
|
||||
|
||||
|
||||
Release 2.7-r654 (9 January 2018)
|
||||
---------------------------------
|
||||
|
||||
This release fixed a bug in the splice mode and added a few minor features:
|
||||
|
||||
* Fixed a bug that occasionally takes an intron as a long deletion in the
|
||||
splice mode. This was caused by wrong backtracking at the last CIGAR
|
||||
operator. The current fix eliminates the error, but it is not optimal in
|
||||
that it often produces a wrong junction when the last operator is an intron.
|
||||
A future version of minimap2 may improve upon this.
|
||||
|
||||
* Support high-end ARM CPUs that implement the NEON instruction set (#81).
|
||||
This enables minimap2 to work on Raspberry Pi 3 and Odroid XU4.
|
||||
|
||||
* Added a C API to construct a minimizer index from a set of C strings (#80).
|
||||
|
||||
* Check scoring specified on the command line (#79). Due to the 8-bit limit,
|
||||
excessively large score penalties fail minimap2.
|
||||
|
||||
For genomic sequences, minimap2 should give identical alignments to v2.6.
|
||||
|
||||
(2.7: 9 January 2018, r654)
|
||||
|
||||
|
||||
|
||||
Release 2.6-r623 (12 December 2017)
|
||||
-----------------------------------
|
||||
|
||||
This release adds several features and fixes two minor bugs:
|
||||
|
||||
* Optionally build an index without sequences. This helps to reduce the
|
||||
peak memory for read overlapping and is automatically applied when
|
||||
base-level alignment is not requested.
|
||||
|
||||
* Approximately estimate per-base sequence divergence (i.e. 1-identity)
|
||||
without performing base-level alignment, using a MashMap-like method. The
|
||||
estimate is written to a new dv:f tag.
|
||||
|
||||
* Reduced the number of tiny terminal exons in RNA-seq alignment. The current
|
||||
setting is conservative. Increase --end-seed-pen to drop more such exons.
|
||||
|
||||
* Reduced the peak memory when aligning long query sequences.
|
||||
|
||||
* Fixed a bug that is caused by HPC minimizers longer than 256bp. This should
|
||||
have no effect in practice, but it is recommended to rebuild HPC indices if
|
||||
possible.
|
||||
|
||||
* Fixed a bug when identifying identical hits (#71). This should only affect
|
||||
artifactual reference consisting of near identical sequences.
|
||||
|
||||
For genomic sequences, minimap2 should give nearly identical alignments to
|
||||
v2.5, except the new dv:f tag.
|
||||
|
||||
(2.6: 12 December 2017, r623)
|
||||
|
||||
|
||||
|
||||
Release 2.5-r572 (11 November 2017)
|
||||
-----------------------------------
|
||||
|
||||
This release fixes several bugs and brings a couple of minor improvements:
|
||||
|
||||
* Fixed a severe bug that leads to incorrect mapping coordinates in rare
|
||||
corner cases.
|
||||
|
||||
* Fixed underestimated mapping quality for chimeric alignments when the whole
|
||||
query sequence contain many repetitive minimizers, and for chimeric
|
||||
alignments caused by Z-drop.
|
||||
|
||||
* Fixed two bugs in Python binding: incorrect strand field (#57) and incorrect
|
||||
sequence names for Python3 (#55).
|
||||
|
||||
* Improved mapping accuracy for highly overlapping paired ends.
|
||||
|
||||
* Added option -Y to use soft clipping for supplementary alignments (#56).
|
||||
|
||||
(2.5: 11 November 2017, r572)
|
||||
|
||||
|
||||
|
||||
Release 2.4-r555 (6 November 2017)
|
||||
----------------------------------
|
||||
|
||||
As is planned, this release focuses on fine tuning the base algorithm. Notable
|
||||
changes include
|
||||
|
||||
* Changed the mapping quality scale to match the scale of BWA-MEM. This makes
|
||||
minimap2 and BWA-MEM achieve similar sensitivity-specificity balance on real
|
||||
short-read data.
|
||||
|
||||
* Improved the accuracy of splice alignment by modeling one additional base
|
||||
close to the GT-AG signal. This model is used by default with `-x splice`.
|
||||
For SIRV control data, however, it is recommended to add `--splice-flank=no`
|
||||
to disable this feature as the SIRV splice signals are slightly different.
|
||||
|
||||
* Tuned the parameters for Nanopore Direct RNA reads. The recommended command
|
||||
line is `-axsplice -k14 -uf` (#46).
|
||||
|
||||
* Fixed a segmentation fault when aligning PacBio reads (#47 and #48). This
|
||||
bug is very rare but it affects all versions of minimap2. It is also
|
||||
recommended to re-index reference genomes created with `map-pb`. For human,
|
||||
two minimizers in an old index are wrong.
|
||||
|
||||
* Changed option `-L` in sync with the final decision of hts-specs: a fake
|
||||
CIGAR takes the form of `<readLen>S<refLen>N`. Note that `-L` only enables
|
||||
future tools to recognize long CIGARs. It is not possible for older tools to
|
||||
work with such alignments in BAM (#43 and #51).
|
||||
|
||||
* Fixed a tiny issue whereby minimap2 may waste 8 bytes per candidate
|
||||
alignment.
|
||||
|
||||
The minimap2 technical note hosted at arXiv has also been updated to reflect
|
||||
recent changes.
|
||||
|
||||
(2.4: 6 November 2017, r555)
|
||||
|
||||
|
||||
|
||||
Release 2.3-r531 (22 October 2017)
|
||||
----------------------------------
|
||||
|
||||
@@ -26,7 +570,7 @@ This release come with many improvements and bug fixes:
|
||||
|
||||
This release has implemented all the major features I planned five months ago,
|
||||
with the addition of spliced long-read alignment. The next couple of releases
|
||||
will focus on fine tuning of base algorithms.
|
||||
will focus on fine tuning of the base algorithms.
|
||||
|
||||
(2.3: 22 October 2017, r531)
|
||||
|
||||
|
||||
@@ -1,26 +1,35 @@
|
||||
[](https://github.com/lh3/minimap2/releases)
|
||||
[](https://anaconda.org/bioconda/minimap2)
|
||||
[](https://github.com/lh3/minimap2/releases)
|
||||
[](https://anaconda.org/bioconda/minimap2)
|
||||
[](https://pypi.python.org/pypi/mappy)
|
||||
[](https://pypi.python.org/pypi/mappy)
|
||||
[](LICENSE.txt)
|
||||
[](https://travis-ci.org/lh3/minimap2)
|
||||
[](https://github.com/lh3/minimap2/releases)
|
||||
## <a name="started"></a>Getting Started
|
||||
```sh
|
||||
git clone https://github.com/lh3/minimap2
|
||||
cd minimap2 && make
|
||||
# long reads against a reference genome
|
||||
# long sequences against a reference genome
|
||||
./minimap2 -a test/MT-human.fa test/MT-orang.fa > test.sam
|
||||
# create an index first and then map
|
||||
./minimap2 -d MT-human.mmi test/MT-human.fa
|
||||
./minimap2 -a MT-human.mmi test/MT-orang.fa > test.sam
|
||||
# long-read overlap (no test data)
|
||||
./minimap2 -x ava-pb your-reads.fa your-reads.fa > overlaps.paf
|
||||
# spliced alignment (no test data)
|
||||
./minimap2 -ax splice ref.fa rna-seq-reads.fa > spliced.sam
|
||||
./minimap2 -x map-ont -d MT-human-ont.mmi test/MT-human.fa
|
||||
./minimap2 -a MT-human-ont.mmi test/MT-orang.fa > test.sam
|
||||
# use presets (no test data)
|
||||
./minimap2 -ax map-pb ref.fa pacbio.fq.gz > aln.sam # PacBio genomic reads
|
||||
./minimap2 -ax map-ont ref.fa ont.fq.gz > aln.sam # Oxford Nanopore genomic reads
|
||||
./minimap2 -ax asm20 ref.fa pacbio-ccs.fq.gz > aln.sam # PacBio CCS genomic reads
|
||||
./minimap2 -ax sr ref.fa read1.fa read2.fa > aln.sam # short genomic paired-end reads
|
||||
./minimap2 -ax splice ref.fa rna-reads.fa > aln.sam # spliced long reads (strand unknown)
|
||||
./minimap2 -ax splice -uf -k14 ref.fa reads.fa > aln.sam # noisy Nanopore Direct RNA-seq
|
||||
./minimap2 -ax splice:hq -uf ref.fa query.fa > aln.sam # Final PacBio Iso-seq or traditional cDNA
|
||||
./minimap2 -ax splice --junc-bed anno.bed12 ref.fa query.fa > aln.sam # prioritize on annotated junctions
|
||||
./minimap2 -cx asm5 asm1.fa asm2.fa > aln.paf # intra-species asm-to-asm alignment
|
||||
./minimap2 -x ava-pb reads.fa reads.fa > overlaps.paf # PacBio read overlap
|
||||
./minimap2 -x ava-ont reads.fa reads.fa > overlaps.paf # Nanopore read overlap
|
||||
# man page for detailed command line options
|
||||
man ./minimap2.1
|
||||
```
|
||||
[Unimap][unimap] is recommended for aligning long contigs against a reference
|
||||
genome. It often takes less wall-clock time and is much more sensitive to long
|
||||
insertions and deletions.
|
||||
|
||||
## Table of Contents
|
||||
|
||||
- [Getting Started](#started)
|
||||
@@ -34,9 +43,9 @@ man ./minimap2.1
|
||||
- [Map short accurate genomic reads](#short-genomic)
|
||||
- [Full genome/assembly alignment](#full-genome)
|
||||
- [Advanced features](#advanced)
|
||||
- [Working CIGARs with >65535 operations](#long-cigar)
|
||||
- [Working with >65535 CIGAR operations](#long-cigar)
|
||||
- [The cs optional tag](#cs)
|
||||
- [Evaluation scripts](#eval)
|
||||
- [Working with the PAF format](#paftools)
|
||||
- [Algorithm overview](#algo)
|
||||
- [Getting help](#help)
|
||||
- [Citing minimap2](#cite)
|
||||
@@ -59,22 +68,32 @@ mainstream long-read mappers such as BLASR, BWA-MEM, NGMLR and GMAP. It is more
|
||||
accurate on simulated long reads and produces biologically meaningful alignment
|
||||
ready for downstream analyses. For >100bp Illumina short reads, minimap2 is
|
||||
three times as fast as BWA-MEM and Bowtie2, and as accurate on simulated data.
|
||||
Detailed evaluations are available from the [minimap2 preprint][preprint].
|
||||
Detailed evaluations are available from the [minimap2 paper][doi] or the
|
||||
[preprint][preprint].
|
||||
|
||||
### <a name="install"></a>Installation
|
||||
|
||||
Minimap2 only works on x86-64 CPUs. You can acquire precompiled binaries from
|
||||
Minimap2 is optimized for x86-64 CPUs. You can acquire precompiled binaries from
|
||||
the [release page][release] with:
|
||||
```sh
|
||||
wget --no-check-certificate -O- https://github.com/lh3/minimap2/releases/download/v2.2/minimap2-2.2_x64-linux.tar.bz2 \
|
||||
| tar -jxvf -
|
||||
./minimap2-2.2_x64-linux/minimap2
|
||||
curl -L https://github.com/lh3/minimap2/releases/download/v2.18/minimap2-2.18_x64-linux.tar.bz2 | tar -jxvf -
|
||||
./minimap2-2.18_x64-linux/minimap2
|
||||
```
|
||||
If you want to compile from the source, you need to have a C compiler, GNU make
|
||||
and zlib development files installed. Then type `make` in the source code
|
||||
directory to compile. If you see compilation errors, try `make sse2only=1`
|
||||
to disable SSE4 code, which will make minimap2 slightly slower.
|
||||
|
||||
Minimap2 also works with ARM CPUs supporting the NEON instruction sets. To
|
||||
compile for 32 bit ARM architectures (such as ARMv7), use `make arm_neon=1`. To
|
||||
compile for for 64 bit ARM architectures (such as ARMv8), use `make arm_neon=1
|
||||
aarch64=1`.
|
||||
|
||||
Minimap2 can use [SIMD Everywhere (SIMDe)][simde] library for porting
|
||||
implementation to the different SIMD instruction sets. To compile using SIMDe,
|
||||
use `make -f Makefile.simde`. To compile for ARM CPUs, use `Makefile.simde`
|
||||
with the ARM related command lines given above.
|
||||
|
||||
### <a name="general"></a>General usage
|
||||
|
||||
Without any options, minimap2 takes a reference database and a query sequence
|
||||
@@ -132,14 +151,57 @@ Nanopore reads.
|
||||
#### <a name="map-long-splice"></a>Map long mRNA/cDNA reads
|
||||
|
||||
```sh
|
||||
minimap2 -ax splice ref.fa spliced.fq > aln.sam # strand unknown
|
||||
minimap2 -ax splice -uf ref.fa spliced.fq > aln.sam # assuming transcript strand
|
||||
minimap2 -ax splice:hq -uf ref.fa iso-seq.fq > aln.sam # PacBio Iso-seq/traditional cDNA
|
||||
minimap2 -ax splice ref.fa nanopore-cdna.fa > aln.sam # Nanopore 2D cDNA-seq
|
||||
minimap2 -ax splice -uf -k14 ref.fa direct-rna.fq > aln.sam # Nanopore Direct RNA-seq
|
||||
minimap2 -ax splice --splice-flank=no SIRV.fa SIRV-seq.fa # mapping against SIRV control
|
||||
```
|
||||
This command line has been tested on PacBio Iso-Seq reads and Nanopore 2D cDNA
|
||||
reads, and been shown to work with Nanopore 1D Direct RNA reads by others. Like
|
||||
typical RNA-seq mappers, minimap2 represents an intron with the `N` CIGAR
|
||||
operator. For spliced reads, minimap2 will try to infer the strand relative to
|
||||
transcript and may write the strand to the `ts` SAM/PAF tag.
|
||||
There are different long-read RNA-seq technologies, including tranditional
|
||||
full-length cDNA, EST, PacBio Iso-seq, Nanopore 2D cDNA-seq and Direct RNA-seq.
|
||||
They produce data of varying quality and properties. By default, `-x splice`
|
||||
assumes the read orientation relative to the transcript strand is unknown. It
|
||||
tries two rounds of alignment to infer the orientation and write the strand to
|
||||
the `ts` SAM/PAF tag if possible. For Iso-seq, Direct RNA-seq and tranditional
|
||||
full-length cDNAs, it would be desired to apply `-u f` to force minimap2 to
|
||||
consider the forward transcript strand only. This speeds up alignment with
|
||||
slight improvement to accuracy. For noisy Nanopore Direct RNA-seq reads, it is
|
||||
recommended to use a smaller k-mer size for increased sensitivity to the first
|
||||
or the last exons.
|
||||
|
||||
Minimap2 rates an alignment by the score of the max-scoring sub-segment,
|
||||
*excluding* introns, and marks the best alignment as primary in SAM. When a
|
||||
spliced gene also has unspliced pseudogenes, minimap2 does not intentionally
|
||||
prefer spliced alignment, though in practice it more often marks the spliced
|
||||
alignment as the primary. By default, minimap2 outputs up to five secondary
|
||||
alignments (i.e. likely pseudogenes in the context of RNA-seq mapping). This
|
||||
can be tuned with option **-N**.
|
||||
|
||||
For long RNA-seq reads, minimap2 may produce chimeric alignments potentially
|
||||
caused by gene fusions/structural variations or by an intron longer than the
|
||||
max intron length **-G** (200k by default). For now, it is not recommended to
|
||||
apply an excessively large **-G** as this slows down minimap2 and sometimes
|
||||
leads to false alignments.
|
||||
|
||||
It is worth noting that by default `-x splice` prefers GT[A/G]..[C/T]AG
|
||||
over GT[C/T]..[A/G]AG, and then over other splicing signals. Considering
|
||||
one additional base improves the junction accuracy for noisy reads, but
|
||||
reduces the accuracy when aligning against the widely used SIRV control data.
|
||||
This is because SIRV does not honor the evolutionarily conservative splicing
|
||||
signal. If you are studying SIRV, you may apply `--splice-flank=no` to let
|
||||
minimap2 only model GT..AG, ignoring the additional base.
|
||||
|
||||
Since v2.17, minimap2 can optionally take annotated genes as input and
|
||||
prioritize on annotated splice junctions. To use this feature, you can
|
||||
```sh
|
||||
paftools.js gff2bed anno.gff > anno.bed
|
||||
minimap2 -ax splice --junc-bed anno.bed ref.fa query.fa > aln.sam
|
||||
```
|
||||
Here, `anno.gff` is the gene annotation in the GTF or GFF3 format (`gff2bed`
|
||||
automatically tests the format). The output of `gff2bed` is in the 12-column
|
||||
BED format, or the BED12 format. With the `--junc-bed` option, minimap2 adds a
|
||||
bonus score (tuned by `--junc-bonus`) if an aligned junction matches a junction
|
||||
in the annotation. Option `--junc-bed` also takes 5-column BED, including the
|
||||
strand field. In this case, each line indicates an oriented junction.
|
||||
|
||||
#### <a name="long-overlap"></a>Find overlaps between long reads
|
||||
|
||||
@@ -179,7 +241,7 @@ according to the sequence divergence.
|
||||
|
||||
### <a name="advanced"></a>Advanced features
|
||||
|
||||
#### <a name="long-cigar"></a>Working CIGARs with >65535 operations
|
||||
#### <a name="long-cigar"></a>Working with >65535 CIGAR operations
|
||||
|
||||
Due to a design flaw, BAM does not work with CIGAR strings with >65535
|
||||
operations (SAM and CRAM work). However, for ultra-long nanopore reads minimap2
|
||||
@@ -191,12 +253,10 @@ To avoid this issue, you can add option `-L` at the minimap2 command line.
|
||||
This option moves a long CIGAR to the `CG` tag and leaves a fully clipped CIGAR
|
||||
at the SAM CIGAR column. Current tools that don't read CIGAR (e.g. merging and
|
||||
sorting) still work with such BAM records; tools that read CIGAR will
|
||||
effectively ignore these records. I have pull requests to the SAM spec, htslib,
|
||||
htsjdk, bedtools2, Rsamtools and igv.js. If they are accepted, future versions
|
||||
of these tools will seamlessly recognize long-cigar records generated by option
|
||||
`-L`.
|
||||
effectively ignore these records. It has been decided that future tools will
|
||||
will seamlessly recognize long-cigar records generated by option `-L`.
|
||||
|
||||
**TD;DR**: if you work with ultra-long reads and use tools that only process
|
||||
**TL;DR**: if you work with ultra-long reads and use tools that only process
|
||||
BAM files, please add option `-L`.
|
||||
|
||||
#### <a name="cs"></a>The cs optional tag
|
||||
@@ -221,28 +281,17 @@ similar to the `MD` SAM tag but is standalone and easier to parse.
|
||||
If `--cs=long` is used, the `cs` string also contains identical sequences in
|
||||
the alignment. The above example will become
|
||||
`=CGATCG-ata=AATAGAGTAG+gtc=GAAT*at=GCA`. The long form of `cs` encodes both
|
||||
reference and query sequences in one string.
|
||||
reference and query sequences in one string. The `cs` tag also encodes intron
|
||||
positions and splicing signals (see the [minimap2 manpage][manpage-cs] for
|
||||
details).
|
||||
|
||||
#### <a name="eval"></a>Evaluation scripts
|
||||
#### <a name="paftools"></a>Working with the PAF format
|
||||
|
||||
Minimap2 comes with several (java)scripts for evaluating the accuracy of
|
||||
minimap2. These scripts require the [k8][k8] javascript shell to run.
|
||||
Recent minimap2 binary release tar-balls contain a copy of k8 executable, a
|
||||
single file. Here are a few examples on how to use these scripts:
|
||||
|
||||
```sh
|
||||
# Generate reads from PBSIM alignment (truth encoded in read names)
|
||||
k8 misc/sim-pbsim.js ref.fa.fai pbsim-aln.maf > pbsim-reads.fq
|
||||
# Generate reads from mason2 alignment (not tested for simulated SVs)
|
||||
k8 misc/sim-mason2.js mason2-aln.sam > mason2-reads.fq
|
||||
# Evaluate mapping accuracy with ROC-like curve
|
||||
k8 misc/sim-eval.js my-aln.sam.gz > result.txt
|
||||
k8 misc/sim-eval.js my-aln.paf.gz > result.txt
|
||||
# Collect alignment statistics
|
||||
k8 misc/mapstat.js my-aln.sam > result.txt
|
||||
# Compare spliced junctions to existing gene annotations
|
||||
k8 misc/intron-eval.js anno.gtf my-spliced-aln.sam > result.txt
|
||||
```
|
||||
Minimap2 also comes with a (java)script [paftools.js](misc/paftools.js) that
|
||||
processes alignments in the PAF format. It calls variants from
|
||||
assembly-to-reference alignment, lifts over BED files based on alignment,
|
||||
converts between formats and provides utilities for various evaluations. For
|
||||
details, please see [misc/README.md](misc/README.md).
|
||||
|
||||
### <a name="algo"></a>Algorithm overview
|
||||
|
||||
@@ -290,16 +339,18 @@ highlighted in bold. The description may help to tune minimap2 parameters.
|
||||
|
||||
### <a name="help"></a>Getting help
|
||||
|
||||
Manpage [minimap2.1](minimap2.1) provides detailed description of minimap2
|
||||
command line options and optional tags. If you encounter bugs or have further
|
||||
questions or requests, you can raise an issue at the [issue page][issue].
|
||||
There is not a specific mailing list for the time being.
|
||||
Manpage [minimap2.1][manpage] provides detailed description of minimap2
|
||||
command line options and optional tags. The [FAQ](FAQ.md) page answers several
|
||||
frequently asked questions. If you encounter bugs or have further questions or
|
||||
requests, you can raise an issue at the [issue page][issue]. There is not a
|
||||
specific mailing list for the time being.
|
||||
|
||||
### <a name="cite"></a>Citing minimap2
|
||||
|
||||
If you use minimap2 in your work, please consider to cite:
|
||||
If you use minimap2 in your work, please cite:
|
||||
|
||||
> Li, H. (2017). Minimap2: fast pairwise alignment for long nucleotide sequences. [arXiv:1708.01492][preprint]
|
||||
> Li, H. (2018). Minimap2: pairwise alignment for nucleotide sequences.
|
||||
> *Bioinformatics*, **34**:3094-3100. [doi:10.1093/bioinformatics/bty191][doi]
|
||||
|
||||
## <a name="dguide"></a>Developers' Guide
|
||||
|
||||
@@ -322,12 +373,15 @@ mappy` or [from BioConda][mappyconda] via `conda install -c bioconda mappy`.
|
||||
regions where seed positions may be suboptimal. This should not be a big
|
||||
concern because even the optimal alignment may be wrong in such regions.
|
||||
|
||||
* Minimap2 requires SSE2 instructions to compile. It is possible to add
|
||||
non-SSE2 support, but it would make minimap2 slower by several times.
|
||||
* Minimap2 requires SSE2 instructions on x86 CPUs or NEON on ARM CPUs. It is
|
||||
possible to add non-SIMD support, but it would make minimap2 slower by
|
||||
several times.
|
||||
|
||||
In general, minimap2 is a young project with most code written since June, 2017.
|
||||
It may have bugs and room for improvements. Bug reports and suggestions are
|
||||
warmly welcomed.
|
||||
* Minimap2 does not work with a single query or database sequence ~2
|
||||
billion bases or longer (2,147,483,647 to be exact). The total length of all
|
||||
sequences can well exceed this threshold.
|
||||
|
||||
* Minimap2 often misses small exons.
|
||||
|
||||
|
||||
|
||||
@@ -344,3 +398,8 @@ warmly welcomed.
|
||||
[mappyconda]: https://anaconda.org/bioconda/mappy
|
||||
[issue]: https://github.com/lh3/minimap2/issues
|
||||
[k8]: https://github.com/attractivechaos/k8
|
||||
[manpage]: https://lh3.github.io/minimap2/minimap2.html
|
||||
[manpage-cs]: https://lh3.github.io/minimap2/minimap2.html#10
|
||||
[doi]: https://doi.org/10.1093/bioinformatics/bty191
|
||||
[smide]: https://github.com/nemequ/simde
|
||||
[unimap]: https://github.com/lh3/unimap
|
||||
|
||||
@@ -1,22 +1,24 @@
|
||||
#include <assert.h>
|
||||
#include <string.h>
|
||||
#include <stdlib.h>
|
||||
#include <math.h>
|
||||
#include "minimap.h"
|
||||
#include "mmpriv.h"
|
||||
#include "ksw2.h"
|
||||
|
||||
static void ksw_gen_simple_mat(int m, int8_t *mat, int8_t a, int8_t b)
|
||||
static void ksw_gen_simple_mat(int m, int8_t *mat, int8_t a, int8_t b, int8_t sc_ambi)
|
||||
{
|
||||
int i, j;
|
||||
a = a < 0? -a : a;
|
||||
b = b > 0? -b : b;
|
||||
sc_ambi = sc_ambi > 0? -sc_ambi : sc_ambi;
|
||||
for (i = 0; i < m - 1; ++i) {
|
||||
for (j = 0; j < m - 1; ++j)
|
||||
mat[i * m + j] = i == j? a : b;
|
||||
mat[i * m + m - 1] = 0;
|
||||
mat[i * m + m - 1] = sc_ambi;
|
||||
}
|
||||
for (j = 0; j < m; ++j)
|
||||
mat[(m - 1) * m + j] = 0;
|
||||
mat[(m - 1) * m + j] = sc_ambi;
|
||||
}
|
||||
|
||||
static inline void mm_seq_rev(uint32_t len, uint8_t *seq)
|
||||
@@ -27,45 +29,70 @@ static inline void mm_seq_rev(uint32_t len, uint8_t *seq)
|
||||
t = seq[i], seq[i] = seq[len - 1 - i], seq[len - 1 - i] = t;
|
||||
}
|
||||
|
||||
static inline int test_zdrop_aux(int32_t score, int i, int j, int32_t *max, int *max_i, int *max_j, int e, int zdrop)
|
||||
static inline void update_max_zdrop(int32_t score, int i, int j, int32_t *max, int *max_i, int *max_j, int e, int *max_zdrop, int pos[2][2])
|
||||
{
|
||||
if (score < *max) {
|
||||
int li = i - *max_i;
|
||||
int lj = j - *max_j;
|
||||
int diff = li > lj? li - lj : lj - li;
|
||||
if (*max - score > zdrop + diff * e)
|
||||
return 1;
|
||||
int z = *max - score - diff * e;
|
||||
if (z > *max_zdrop) {
|
||||
*max_zdrop = z;
|
||||
pos[0][0] = *max_i, pos[0][1] = i;
|
||||
pos[1][0] = *max_j, pos[1][1] = j;
|
||||
}
|
||||
} else *max = score, *max_i = i, *max_j = j;
|
||||
return 0;
|
||||
}
|
||||
|
||||
static int mm_check_zdrop(const uint8_t *qseq, const uint8_t *tseq, uint32_t n_cigar, uint32_t *cigar, const int8_t *mat, int8_t q, int8_t e, int zdrop)
|
||||
static int mm_test_zdrop(void *km, const mm_mapopt_t *opt, const uint8_t *qseq, const uint8_t *tseq, uint32_t n_cigar, uint32_t *cigar, const int8_t *mat)
|
||||
{
|
||||
uint32_t k;
|
||||
int32_t score = 0, max = 0, max_i = -1, max_j = -1, i = 0, j = 0;
|
||||
for (k = 0; k < n_cigar; ++k) {
|
||||
int32_t score = 0, max = INT32_MIN, max_i = -1, max_j = -1, i = 0, j = 0, max_zdrop = 0;
|
||||
int pos[2][2] = {{-1, -1}, {-1, -1}}, q_len, t_len;
|
||||
|
||||
// find the score and the region where score drops most along diagonal
|
||||
for (k = 0, score = 0; k < n_cigar; ++k) {
|
||||
uint32_t l, op = cigar[k]&0xf, len = cigar[k]>>4;
|
||||
if (op == 0) {
|
||||
for (l = 0; l < len; ++l) {
|
||||
score += mat[tseq[i + l] * 5 + qseq[j + l]];
|
||||
if (test_zdrop_aux(score, i+l, j+l, &max, &max_i, &max_j, e, zdrop)) return 1;
|
||||
update_max_zdrop(score, i+l, j+l, &max, &max_i, &max_j, opt->e, &max_zdrop, pos);
|
||||
}
|
||||
i += len, j += len;
|
||||
} else if (op == 1) {
|
||||
score -= q + e * len, j += len;
|
||||
if (test_zdrop_aux(score, i, j, &max, &max_i, &max_j, e, zdrop)) return 1;
|
||||
} else if (op == 2 || op == 3) {
|
||||
score -= q + e * len, i += len;
|
||||
if (test_zdrop_aux(score, i, j, &max, &max_i, &max_j, e, zdrop)) return 1;
|
||||
} else if (op == 1 || op == 2 || op == 3) {
|
||||
score -= opt->q + opt->e * len;
|
||||
if (op == 1) j += len; // insertion
|
||||
else i += len; // deletion
|
||||
update_max_zdrop(score, i, j, &max, &max_i, &max_j, opt->e, &max_zdrop, pos);
|
||||
}
|
||||
}
|
||||
return 0;
|
||||
|
||||
// test if there is an inversion in the most dropped region
|
||||
q_len = pos[1][1] - pos[1][0], t_len = pos[0][1] - pos[0][0];
|
||||
if (!(opt->flag&(MM_F_SPLICE|MM_F_SR|MM_F_FOR_ONLY|MM_F_REV_ONLY)) && max_zdrop > opt->zdrop_inv && q_len < opt->max_gap && t_len < opt->max_gap) {
|
||||
uint8_t *qseq2;
|
||||
void *qp;
|
||||
int q_off, t_off;
|
||||
qseq2 = (uint8_t*)kmalloc(km, q_len);
|
||||
for (i = 0; i < q_len; ++i) {
|
||||
int c = qseq[pos[1][1] - i - 1];
|
||||
qseq2[i] = c >= 4? 4 : 3 - c;
|
||||
}
|
||||
qp = ksw_ll_qinit(km, 2, q_len, qseq2, 5, mat);
|
||||
score = ksw_ll_i16(qp, t_len, tseq + pos[0][0], opt->q, opt->e, &q_off, &t_off);
|
||||
kfree(km, qseq2);
|
||||
kfree(km, qp);
|
||||
if (score >= opt->min_chain_score * opt->a && score >= opt->min_dp_max)
|
||||
return 2; // there is a potential inversion
|
||||
}
|
||||
return max_zdrop > opt->zdrop? 1 : 0;
|
||||
}
|
||||
|
||||
static void mm_fix_cigar(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq, int *qshift, int *tshift)
|
||||
{
|
||||
mm_extra_t *p = r->p;
|
||||
int32_t k, toff = 0, qoff = 0, to_shrink = 0;
|
||||
int32_t toff = 0, qoff = 0, to_shrink = 0;
|
||||
uint32_t k;
|
||||
*qshift = *tshift = 0;
|
||||
if (p->n_cigar <= 1) return;
|
||||
for (k = 0; k < p->n_cigar; ++k) { // indel left alignment
|
||||
@@ -96,6 +123,25 @@ static void mm_fix_cigar(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq,
|
||||
}
|
||||
}
|
||||
assert(qoff == r->qe - r->qs && toff == r->re - r->rs);
|
||||
for (k = 0; k < p->n_cigar - 2; ++k) { // fix CIGAR like 5I6D7I
|
||||
if ((p->cigar[k]&0xf) > 0 && (p->cigar[k]&0xf) + (p->cigar[k+1]&0xf) == 3) {
|
||||
uint32_t l, s[3] = {0,0,0};
|
||||
for (l = k; l < p->n_cigar; ++l) { // count number of adjacent I and D
|
||||
uint32_t op = p->cigar[l]&0xf;
|
||||
if (op == 1 || op == 2 || p->cigar[l]>>4 == 0)
|
||||
s[op] += p->cigar[l] >> 4;
|
||||
else break;
|
||||
}
|
||||
if (s[1] > 0 && s[2] > 0 && l - k > 2) { // turn to a single I and a single D
|
||||
p->cigar[k] = s[1]<<4|1;
|
||||
p->cigar[k+1] = s[2]<<4|2;
|
||||
for (k += 2; k < l; ++k)
|
||||
p->cigar[k] &= 0xf;
|
||||
to_shrink = 1;
|
||||
}
|
||||
k = l;
|
||||
}
|
||||
}
|
||||
if (to_shrink) { // squeeze out zero-length operations
|
||||
int32_t l = 0;
|
||||
for (k = 0; k < p->n_cigar; ++k) // squeeze out zero-length operations
|
||||
@@ -110,17 +156,91 @@ static void mm_fix_cigar(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq,
|
||||
}
|
||||
if ((p->cigar[0]&0xf) == 1 || (p->cigar[0]&0xf) == 2) { // get rid of leading I or D
|
||||
int32_t l = p->cigar[0] >> 4;
|
||||
if ((p->cigar[0]&0xf) == 1) r->qs += l, *qshift = l;
|
||||
else r->rs += l, *tshift = l;
|
||||
if ((p->cigar[0]&0xf) == 1) {
|
||||
if (r->rev) r->qe -= l;
|
||||
else r->qs += l;
|
||||
*qshift = l;
|
||||
} else r->rs += l, *tshift = l;
|
||||
--p->n_cigar;
|
||||
memmove(p->cigar, p->cigar + 1, p->n_cigar * 4);
|
||||
}
|
||||
}
|
||||
|
||||
static void mm_update_extra(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *qual, const uint8_t *tseq, const int8_t *mat, int8_t q, int8_t e)
|
||||
static void mm_update_cigar_eqx(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq) // written by @armintoepfer
|
||||
{
|
||||
uint32_t k, l, toff = 0, qoff = 0;
|
||||
int32_t s = 0, max = 0, qshift, tshift;
|
||||
uint32_t n_EQX = 0;
|
||||
uint32_t k, l, m, cap, toff = 0, qoff = 0, n_M = 0;
|
||||
mm_extra_t *p;
|
||||
if (r->p == 0) return;
|
||||
for (k = 0; k < r->p->n_cigar; ++k) {
|
||||
uint32_t op = r->p->cigar[k]&0xf, len = r->p->cigar[k]>>4;
|
||||
if (op == 0) {
|
||||
while (len > 0) {
|
||||
for (l = 0; l < len && qseq[qoff + l] == tseq[toff + l]; ++l) {} // run of "="; TODO: N<=>N is converted to "="
|
||||
if (l > 0) { ++n_EQX; len -= l; toff += l; qoff += l; }
|
||||
|
||||
for (l = 0; l < len && qseq[qoff + l] != tseq[toff + l]; ++l) {} // run of "X"
|
||||
if (l > 0) { ++n_EQX; len -= l; toff += l; qoff += l; }
|
||||
}
|
||||
++n_M;
|
||||
} else if (op == 1) { // insertion
|
||||
qoff += len;
|
||||
} else if (op == 2) { // deletion
|
||||
toff += len;
|
||||
} else if (op == 3) { // intron
|
||||
toff += len;
|
||||
}
|
||||
}
|
||||
// update in-place if we can
|
||||
if (n_EQX == n_M) {
|
||||
for (k = 0; k < r->p->n_cigar; ++k) {
|
||||
uint32_t op = r->p->cigar[k]&0xf, len = r->p->cigar[k]>>4;
|
||||
if (op == 0) r->p->cigar[k] = len << 4 | 7;
|
||||
}
|
||||
return;
|
||||
}
|
||||
// allocate new storage
|
||||
cap = r->p->n_cigar + (n_EQX - n_M) + sizeof(mm_extra_t);
|
||||
kroundup32(cap);
|
||||
p = (mm_extra_t*)calloc(cap, 4);
|
||||
memcpy(p, r->p, sizeof(mm_extra_t));
|
||||
p->capacity = cap;
|
||||
// update cigar while copying
|
||||
toff = qoff = m = 0;
|
||||
for (k = 0; k < r->p->n_cigar; ++k) {
|
||||
uint32_t op = r->p->cigar[k]&0xf, len = r->p->cigar[k]>>4;
|
||||
if (op == 0) { // match/mismatch
|
||||
while (len > 0) {
|
||||
// match
|
||||
for (l = 0; l < len && qseq[qoff + l] == tseq[toff + l]; ++l) {}
|
||||
if (l > 0) p->cigar[m++] = l << 4 | 7;
|
||||
len -= l;
|
||||
toff += l, qoff += l;
|
||||
// mismatch
|
||||
for (l = 0; l < len && qseq[qoff + l] != tseq[toff + l]; ++l) {}
|
||||
if (l > 0) p->cigar[m++] = l << 4 | 8;
|
||||
len -= l;
|
||||
toff += l, qoff += l;
|
||||
}
|
||||
continue;
|
||||
} else if (op == 1) { // insertion
|
||||
qoff += len;
|
||||
} else if (op == 2) { // deletion
|
||||
toff += len;
|
||||
} else if (op == 3) { // intron
|
||||
toff += len;
|
||||
}
|
||||
p->cigar[m++] = r->p->cigar[k];
|
||||
}
|
||||
p->n_cigar = m;
|
||||
free(r->p);
|
||||
r->p = p;
|
||||
}
|
||||
|
||||
static void mm_update_extra(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq, const int8_t *mat, int8_t q, int8_t e, int is_eqx)
|
||||
{
|
||||
uint32_t k, l;
|
||||
int32_t s = 0, max = 0, qshift, tshift, toff = 0, qoff = 0;
|
||||
mm_extra_t *p = r->p;
|
||||
if (p == 0) return;
|
||||
mm_fix_cigar(r, qseq, tseq, &qshift, &tshift);
|
||||
@@ -130,27 +250,21 @@ static void mm_update_extra(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *qu
|
||||
uint32_t op = p->cigar[k]&0xf, len = p->cigar[k]>>4;
|
||||
if (op == 0) { // match/mismatch
|
||||
int n_ambi = 0, n_diff = 0;
|
||||
float n_diff2 = 0.0f;
|
||||
for (l = 0; l < len; ++l) {
|
||||
int cq = qseq[qoff + l], ct = tseq[toff + l];
|
||||
if (ct > 3 || cq > 3) ++n_ambi;
|
||||
else if (ct != cq) {
|
||||
++n_diff;
|
||||
n_diff2 += qual == 0 || qual[qoff + l] >= 20? 1.0f : .05f * qual[qoff + l];
|
||||
}
|
||||
else if (ct != cq) ++n_diff;
|
||||
s += mat[ct * 5 + cq];
|
||||
if (s < 0) s = 0;
|
||||
else max = max > s? max : s;
|
||||
}
|
||||
r->blen += len - n_ambi, r->mlen += len - (n_ambi + n_diff), p->n_ambi += n_ambi;
|
||||
p->n_diff2 += n_diff2, p->blen2 += len - n_ambi;
|
||||
toff += len, qoff += len;
|
||||
} else if (op == 1) { // insertion
|
||||
int n_ambi = 0;
|
||||
for (l = 0; l < len; ++l)
|
||||
if (qseq[qoff + l] > 3) ++n_ambi;
|
||||
r->blen += len - n_ambi, p->n_ambi += n_ambi;
|
||||
p->n_diff2 += 1.0f, ++p->blen2;
|
||||
s -= q + e * len;
|
||||
if (s < 0) s = 0;
|
||||
qoff += len;
|
||||
@@ -159,7 +273,6 @@ static void mm_update_extra(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *qu
|
||||
for (l = 0; l < len; ++l)
|
||||
if (tseq[toff + l] > 3) ++n_ambi;
|
||||
r->blen += len - n_ambi, p->n_ambi += n_ambi;
|
||||
p->n_diff2 += 1.0f, ++p->blen2;
|
||||
s -= q + e * len;
|
||||
if (s < 0) s = 0;
|
||||
toff += len;
|
||||
@@ -169,6 +282,7 @@ static void mm_update_extra(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *qu
|
||||
}
|
||||
p->dp_max = max;
|
||||
assert(qoff == r->qe - r->qs && toff == r->re - r->rs);
|
||||
if (is_eqx) mm_update_cigar_eqx(r, qseq, tseq); // NB: it has to be called here as changes to qseq and tseq are not returned
|
||||
}
|
||||
|
||||
static void mm_append_cigar(mm_reg1_t *r, uint32_t n_cigar, uint32_t *cigar) // TODO: this calls the libc realloc()
|
||||
@@ -176,12 +290,12 @@ static void mm_append_cigar(mm_reg1_t *r, uint32_t n_cigar, uint32_t *cigar) //
|
||||
mm_extra_t *p;
|
||||
if (n_cigar == 0) return;
|
||||
if (r->p == 0) {
|
||||
uint32_t capacity = n_cigar + sizeof(mm_extra_t);
|
||||
uint32_t capacity = n_cigar + sizeof(mm_extra_t)/4;
|
||||
kroundup32(capacity);
|
||||
r->p = (mm_extra_t*)calloc(capacity, 4);
|
||||
r->p->capacity = capacity;
|
||||
} else if (r->p->n_cigar + n_cigar + sizeof(mm_extra_t) > r->p->capacity) {
|
||||
r->p->capacity = r->p->n_cigar + n_cigar + sizeof(mm_extra_t);
|
||||
} else if (r->p->n_cigar + n_cigar + sizeof(mm_extra_t)/4 > r->p->capacity) {
|
||||
r->p->capacity = r->p->n_cigar + n_cigar + sizeof(mm_extra_t)/4;
|
||||
kroundup32(r->p->capacity);
|
||||
r->p = (mm_extra_t*)realloc(r->p, r->p->capacity * 4);
|
||||
}
|
||||
@@ -196,9 +310,8 @@ static void mm_append_cigar(mm_reg1_t *r, uint32_t n_cigar, uint32_t *cigar) //
|
||||
}
|
||||
}
|
||||
|
||||
static void mm_align_pair(void *km, const mm_mapopt_t *opt, int qlen, const uint8_t *qseq, int tlen, const uint8_t *tseq, const int8_t *mat, int w, int end_bonus, int flag, ksw_extz_t *ez)
|
||||
static void mm_align_pair(void *km, const mm_mapopt_t *opt, int qlen, const uint8_t *qseq, int tlen, const uint8_t *tseq, const uint8_t *junc, const int8_t *mat, int w, int end_bonus, int zdrop, int flag, ksw_extz_t *ez)
|
||||
{
|
||||
int zdrop = opt->zdrop;
|
||||
if (mm_dbg_flag & MM_DBG_PRINT_ALN_SEQ) {
|
||||
int i;
|
||||
fprintf(stderr, "===> q=(%d,%d), e=(%d,%d), bw=%d, flag=%d, zdrop=%d <===\n", opt->q, opt->q2, opt->e, opt->e2, w, flag, opt->zdrop);
|
||||
@@ -207,12 +320,22 @@ static void mm_align_pair(void *km, const mm_mapopt_t *opt, int qlen, const uint
|
||||
for (i = 0; i < qlen; ++i) fputc("ACGTN"[qseq[i]], stderr);
|
||||
fputc('\n', stderr);
|
||||
}
|
||||
if (opt->flag & MM_F_SPLICE)
|
||||
ksw_exts2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->noncan, zdrop, flag, ez);
|
||||
if (opt->max_sw_mat > 0 && (int64_t)tlen * qlen > opt->max_sw_mat) {
|
||||
ksw_reset_extz(ez);
|
||||
ez->zdropped = 1;
|
||||
} else if (opt->flag & MM_F_SPLICE)
|
||||
ksw_exts2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->noncan, zdrop, opt->junc_bonus, flag, junc, ez);
|
||||
else if (opt->q == opt->q2 && opt->e == opt->e2)
|
||||
ksw_extz2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, w, zdrop, end_bonus, flag, ez);
|
||||
else
|
||||
ksw_extd2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->e2, w, zdrop, end_bonus, flag, ez);
|
||||
if (mm_dbg_flag & MM_DBG_PRINT_ALN_SEQ) {
|
||||
int i;
|
||||
fprintf(stderr, "score=%d, cigar=", ez->score);
|
||||
for (i = 0; i < ez->n_cigar; ++i)
|
||||
fprintf(stderr, "%d%c", ez->cigar[i]>>4, "MIDN"[ez->cigar[i]&0xf]);
|
||||
fprintf(stderr, "\n");
|
||||
}
|
||||
}
|
||||
|
||||
static inline int mm_get_hplen_back(const mm_idx_t *mi, uint32_t rid, uint32_t x)
|
||||
@@ -226,7 +349,7 @@ static inline int mm_get_hplen_back(const mm_idx_t *mi, uint32_t rid, uint32_t x
|
||||
|
||||
static inline void mm_adjust_minier(const mm_idx_t *mi, uint8_t *const qseq0[2], mm128_t *a, int32_t *r, int32_t *q)
|
||||
{
|
||||
if (mi->is_hpc) {
|
||||
if (mi->flag & MM_I_HPC) {
|
||||
const uint8_t *qseq = qseq0[a->x>>63];
|
||||
int i, c;
|
||||
*q = (int32_t)a->y;
|
||||
@@ -241,20 +364,30 @@ static inline void mm_adjust_minier(const mm_idx_t *mi, uint8_t *const qseq0[2],
|
||||
}
|
||||
}
|
||||
|
||||
static void mm_filter_bad_seeds(void *km, int as1, int cnt1, mm128_t *a, int min_gap, int diff_thres, int max_ext_len, int max_ext_cnt)
|
||||
static int *collect_long_gaps(void *km, int as1, int cnt1, mm128_t *a, int min_gap, int *n_)
|
||||
{
|
||||
int max_st, max_en, n, i, k, max, *K;
|
||||
int i, n, *K;
|
||||
*n_ = 0;
|
||||
for (i = 1, n = 0; i < cnt1; ++i) { // count the number of gaps longer than min_gap
|
||||
int gap = ((int32_t)a[as1 + i].y - a[as1 + i - 1].y) - ((int32_t)a[as1 + i].x - a[as1 + i - 1].x);
|
||||
if (gap < -min_gap || gap > min_gap) ++n;
|
||||
}
|
||||
if (n <= 1) return;
|
||||
if (n <= 1) return 0;
|
||||
K = (int*)kmalloc(km, n * sizeof(int));
|
||||
for (i = 1, n = 0; i < cnt1; ++i) { // store the positions of long gaps
|
||||
int gap = ((int32_t)a[as1 + i].y - a[as1 + i - 1].y) - ((int32_t)a[as1 + i].x - a[as1 + i - 1].x);
|
||||
if (gap < -min_gap || gap > min_gap)
|
||||
K[n++] = i;
|
||||
}
|
||||
*n_ = n;
|
||||
return K;
|
||||
}
|
||||
|
||||
static void mm_filter_bad_seeds(void *km, int as1, int cnt1, mm128_t *a, int min_gap, int diff_thres, int max_ext_len, int max_ext_cnt)
|
||||
{
|
||||
int max_st, max_en, n, i, k, max, *K;
|
||||
K = collect_long_gaps(km, as1, cnt1, a, min_gap, &n);
|
||||
if (K == 0) return;
|
||||
max = 0, max_st = max_en = -1;
|
||||
for (k = 0;; ++k) { // traverse long gaps
|
||||
int gap, l, n_ins = 0, n_del = 0, qs, rs, max_diff = 0, max_diff_l = -1;
|
||||
@@ -266,7 +399,7 @@ static void mm_filter_bad_seeds(void *km, int as1, int cnt1, mm128_t *a, int min
|
||||
if (k == n) break;
|
||||
}
|
||||
i = K[k];
|
||||
gap = ((int32_t)a[as1 + i].y - a[as1 + i - 1].y) - ((int32_t)a[as1 + i].x - a[as1 + i - 1].x);
|
||||
gap = ((int32_t)a[as1 + i].y - (int32_t)a[as1 + i - 1].y) - (int32_t)(a[as1 + i].x - a[as1 + i - 1].x);
|
||||
if (gap > 0) n_ins += gap;
|
||||
else n_del += -gap;
|
||||
qs = (int32_t)a[as1 + i - 1].y;
|
||||
@@ -274,7 +407,7 @@ static void mm_filter_bad_seeds(void *km, int as1, int cnt1, mm128_t *a, int min
|
||||
for (l = k + 1; l < n && l <= k + max_ext_cnt; ++l) {
|
||||
int j = K[l], diff;
|
||||
if ((int32_t)a[as1 + j].y - qs > max_ext_len || (int32_t)a[as1 + j].x - rs > max_ext_len) break;
|
||||
gap = ((int32_t)a[as1 + j].y - (int32_t)a[as1 + j - 1].y) - (a[as1 + j].x - a[as1 + j - 1].x);
|
||||
gap = ((int32_t)a[as1 + j].y - (int32_t)a[as1 + j - 1].y) - (int32_t)(a[as1 + j].x - a[as1 + j - 1].x);
|
||||
if (gap > 0) n_ins += gap;
|
||||
else n_del += -gap;
|
||||
diff = n_ins + n_del - abs(n_ins - n_del);
|
||||
@@ -287,37 +420,79 @@ static void mm_filter_bad_seeds(void *km, int as1, int cnt1, mm128_t *a, int min
|
||||
kfree(km, K);
|
||||
}
|
||||
|
||||
static void mm_fix_bad_ends(const mm_reg1_t *r, const mm128_t *a, int bw, int32_t *as, int32_t *cnt)
|
||||
static void mm_filter_bad_seeds_alt(void *km, int as1, int cnt1, mm128_t *a, int min_gap, int max_ext)
|
||||
{
|
||||
int32_t i, l;
|
||||
int n, k, *K;
|
||||
K = collect_long_gaps(km, as1, cnt1, a, min_gap, &n);
|
||||
if (K == 0) return;
|
||||
for (k = 0; k < n;) {
|
||||
int i = K[k], l;
|
||||
int gap1 = ((int32_t)a[as1 + i].y - (int32_t)a[as1 + i - 1].y) - ((int32_t)a[as1 + i].x - (int32_t)a[as1 + i - 1].x);
|
||||
int re1 = (int32_t)a[as1 + i].x;
|
||||
int qe1 = (int32_t)a[as1 + i].y;
|
||||
gap1 = gap1 > 0? gap1 : -gap1;
|
||||
for (l = k + 1; l < n; ++l) {
|
||||
int j = K[l], gap2, q_span_pre, rs2, qs2, m;
|
||||
if ((int32_t)a[as1 + j].y - qe1 > max_ext || (int32_t)a[as1 + j].x - re1 > max_ext) break;
|
||||
gap2 = ((int32_t)a[as1 + j].y - (int32_t)a[as1 + j - 1].y) - (int32_t)(a[as1 + j].x - a[as1 + j - 1].x);
|
||||
q_span_pre = a[as1 + j - 1].y >> 32 & 0xff;
|
||||
rs2 = (int32_t)a[as1 + j - 1].x + q_span_pre;
|
||||
qs2 = (int32_t)a[as1 + j - 1].y + q_span_pre;
|
||||
m = rs2 - re1 < qs2 - qe1? rs2 - re1 : qs2 - qe1;
|
||||
gap2 = gap2 > 0? gap2 : -gap2;
|
||||
if (m > gap1 + gap2) break;
|
||||
re1 = (int32_t)a[as1 + j].x;
|
||||
qe1 = (int32_t)a[as1 + j].y;
|
||||
gap1 = gap2;
|
||||
}
|
||||
if (l > k + 1) {
|
||||
int j, end = K[l - 1];
|
||||
for (j = K[k]; j < end; ++j)
|
||||
a[as1 + j].y |= MM_SEED_IGNORE;
|
||||
a[as1 + end].y |= MM_SEED_LONG_JOIN;
|
||||
}
|
||||
k = l;
|
||||
}
|
||||
kfree(km, K);
|
||||
}
|
||||
|
||||
static void mm_fix_bad_ends(const mm_reg1_t *r, const mm128_t *a, int bw, int min_match, int32_t *as, int32_t *cnt)
|
||||
{
|
||||
int32_t i, l, m;
|
||||
*as = r->as, *cnt = r->cnt;
|
||||
if (r->cnt < 3) return;
|
||||
l = a[r->as].y >> 32 & 0xff;
|
||||
m = l = a[r->as].y >> 32 & 0xff;
|
||||
for (i = r->as + 1; i < r->as + r->cnt - 1; ++i) {
|
||||
int32_t lq, lr, min, max;
|
||||
int32_t q_span = a[i].y >> 32 & 0xff;
|
||||
if (a[i].y & MM_SEED_LONG_JOIN) break;
|
||||
lr = (int32_t)a[i].x - (int32_t)a[i-1].x;
|
||||
lq = (int32_t)a[i].y - (int32_t)a[i-1].y;
|
||||
min = lr < lq? lr : lq;
|
||||
max = lr > lq? lr : lq;
|
||||
if (max - min > l >> 1) *as = i;
|
||||
l += min;
|
||||
if (l >= bw << 1) break;
|
||||
m += min < q_span? min : q_span;
|
||||
if (l >= bw << 1 || (m >= min_match && m >= bw) || m >= r->mlen >> 1) break;
|
||||
}
|
||||
*cnt = r->as + r->cnt - *as;
|
||||
l = a[r->as + r->cnt - 1].y >> 32 & 0xff;
|
||||
m = l = a[r->as + r->cnt - 1].y >> 32 & 0xff;
|
||||
for (i = r->as + r->cnt - 2; i > *as; --i) {
|
||||
int32_t lq, lr, min, max;
|
||||
int32_t q_span = a[i+1].y >> 32 & 0xff;
|
||||
if (a[i+1].y & MM_SEED_LONG_JOIN) break;
|
||||
lr = (int32_t)a[i+1].x - (int32_t)a[i].x;
|
||||
lq = (int32_t)a[i+1].y - (int32_t)a[i].y;
|
||||
min = lr < lq? lr : lq;
|
||||
max = lr > lq? lr : lq;
|
||||
if (max - min > l >> 1) *cnt = i + 1 - *as;
|
||||
l += min;
|
||||
if (l >= bw) break;
|
||||
m += min < q_span? min : q_span;
|
||||
if (l >= bw << 1 || (m >= min_match && m >= bw) || m >= r->mlen >> 1) break;
|
||||
}
|
||||
}
|
||||
|
||||
static void mm_max_stretch(const mm_mapopt_t *opt, const mm_reg1_t *r, const mm128_t *a, int32_t *as, int32_t *cnt)
|
||||
static void mm_max_stretch(const mm_reg1_t *r, const mm128_t *a, int32_t *as, int32_t *cnt)
|
||||
{
|
||||
int32_t i, score, max_score, len, max_i, max_len;
|
||||
|
||||
@@ -345,34 +520,80 @@ static void mm_max_stretch(const mm_mapopt_t *opt, const mm_reg1_t *r, const mm1
|
||||
*as = max_i, *cnt = max_len;
|
||||
}
|
||||
|
||||
static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, uint8_t *qseq0[2], uint8_t *qual0[2], mm_reg1_t *r, mm_reg1_t *r2, int n_a, mm128_t *a, ksw_extz_t *ez, int splice_flag)
|
||||
static int mm_seed_ext_score(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, const int8_t mat[25], int qlen, uint8_t *qseq0[2], const mm128_t *a)
|
||||
{
|
||||
uint8_t *qseq, *tseq;
|
||||
int q_span = a->y>>32&0xff, qs, qe, rs, re, rid, score, q_off, t_off, ext_len = opt->anchor_ext_len;
|
||||
void *qp;
|
||||
rid = a->x<<1>>33;
|
||||
re = (uint32_t)a->x + 1, rs = re - q_span;
|
||||
qe = (uint32_t)a->y + 1, qs = qe - q_span;
|
||||
rs = rs - ext_len > 0? rs - ext_len : 0;
|
||||
qs = qs - ext_len > 0? qs - ext_len : 0;
|
||||
re = re + ext_len < (int32_t)mi->seq[rid].len? re + ext_len : mi->seq[rid].len;
|
||||
qe = qe + ext_len < qlen? qe + ext_len : qlen;
|
||||
tseq = (uint8_t*)kmalloc(km, re - rs);
|
||||
mm_idx_getseq(mi, rid, rs, re, tseq);
|
||||
qseq = qseq0[a->x>>63] + qs;
|
||||
qp = ksw_ll_qinit(km, 2, qe - qs, qseq, 5, mat);
|
||||
score = ksw_ll_i16(qp, re - rs, tseq, opt->q, opt->e, &q_off, &t_off);
|
||||
kfree(km, tseq);
|
||||
kfree(km, qp);
|
||||
return score;
|
||||
}
|
||||
|
||||
static void mm_fix_bad_ends_splice(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, const mm_reg1_t *r, const int8_t mat[25], int qlen, uint8_t *qseq0[2], const mm128_t *a, int *as1, int *cnt1)
|
||||
{ // this assumes a very crude k-mer based mode; it is not necessary to use a good model just for filtering bounary exons
|
||||
int score;
|
||||
double log_gap;
|
||||
*as1 = r->as, *cnt1 = r->cnt;
|
||||
if (r->cnt < 3) return;
|
||||
log_gap = log((int32_t)a[r->as + 1].x - (int32_t)a[r->as].x);
|
||||
if ((a[r->as].y>>32&0xff) < log_gap + opt->anchor_ext_shift) {
|
||||
score = mm_seed_ext_score(km, opt, mi, mat, qlen, qseq0, &a[r->as]);
|
||||
if ((double)score / mat[0] < log_gap + opt->anchor_ext_shift) // a more exact format is "score < log_4(gap) + shift"
|
||||
++(*as1), --(*cnt1);
|
||||
}
|
||||
log_gap = log((int32_t)a[r->as + r->cnt - 1].x - (int32_t)a[r->as + r->cnt - 2].x);
|
||||
if ((a[r->as + r->cnt - 1].y>>32&0xff) < log_gap + opt->anchor_ext_shift) {
|
||||
score = mm_seed_ext_score(km, opt, mi, mat, qlen, qseq0, &a[r->as + r->cnt - 1]);
|
||||
if ((double)score / mat[0] < log_gap + opt->anchor_ext_shift)
|
||||
--(*cnt1);
|
||||
}
|
||||
}
|
||||
|
||||
static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, uint8_t *qseq0[2], mm_reg1_t *r, mm_reg1_t *r2, int n_a, mm128_t *a, ksw_extz_t *ez, int splice_flag)
|
||||
{
|
||||
int is_sr = !!(opt->flag & MM_F_SR), is_splice = !!(opt->flag & MM_F_SPLICE);
|
||||
int32_t rid = a[r->as].x<<1>>33, rev = a[r->as].x>>63, as1, cnt1;
|
||||
uint8_t *tseq, *qseq;
|
||||
uint8_t *tseq, *qseq, *junc;
|
||||
int32_t i, l, bw, dropped = 0, extra_flag = 0, rs0, re0, qs0, qe0;
|
||||
int32_t rs, re, qs, qe;
|
||||
int32_t rs1, qs1, re1, qe1;
|
||||
int8_t mat[25];
|
||||
|
||||
if (is_sr) assert(!mi->is_hpc); // HPC won't work with SR because with HPC we can't easily tell if there is a gap
|
||||
if (is_sr) assert(!(mi->flag & MM_I_HPC)); // HPC won't work with SR because with HPC we can't easily tell if there is a gap
|
||||
|
||||
r2->cnt = 0;
|
||||
if (r->cnt == 0) return;
|
||||
ksw_gen_simple_mat(5, mat, opt->a, opt->b);
|
||||
ksw_gen_simple_mat(5, mat, opt->a, opt->b, opt->sc_ambi);
|
||||
bw = (int)(opt->bw * 1.5 + 1.);
|
||||
|
||||
if (is_sr && !mi->is_hpc) {
|
||||
mm_max_stretch(opt, r, a, &as1, &cnt1);
|
||||
if (is_sr && !(mi->flag & MM_I_HPC)) {
|
||||
mm_max_stretch(r, a, &as1, &cnt1);
|
||||
rs = (int32_t)a[as1].x + 1 - (int32_t)(a[as1].y>>32&0xff);
|
||||
qs = (int32_t)a[as1].y + 1 - (int32_t)(a[as1].y>>32&0xff);
|
||||
re = (int32_t)a[as1+cnt1-1].x + 1;
|
||||
qe = (int32_t)a[as1+cnt1-1].y + 1;
|
||||
} else {
|
||||
if (!is_splice)
|
||||
mm_fix_bad_ends(r, a, opt->bw, &as1, &cnt1);
|
||||
else as1 = r->as, cnt1 = r->cnt;
|
||||
if (!(opt->flag & MM_F_NO_END_FLT)) {
|
||||
if (is_splice)
|
||||
mm_fix_bad_ends_splice(km, opt, mi, r, mat, qlen, qseq0, a, &as1, &cnt1);
|
||||
else
|
||||
mm_fix_bad_ends(r, a, opt->bw, opt->min_chain_score * 2, &as1, &cnt1);
|
||||
} else as1 = r->as, cnt1 = r->cnt;
|
||||
mm_filter_bad_seeds(km, as1, cnt1, a, 10, 40, opt->max_gap>>1, 10);
|
||||
mm_filter_bad_seeds_alt(km, as1, cnt1, a, 30, opt->max_gap>>1);
|
||||
mm_adjust_minier(mi, qseq0, &a[as1], &rs, &qs);
|
||||
mm_adjust_minier(mi, qseq0, &a[as1 + cnt1 - 1], &re, &qe);
|
||||
}
|
||||
@@ -381,6 +602,7 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
|
||||
if (is_splice) {
|
||||
if (splice_flag & MM_F_SPLICE_FOR) extra_flag |= rev? KSW_EZ_SPLICE_REV : KSW_EZ_SPLICE_FOR;
|
||||
if (splice_flag & MM_F_SPLICE_REV) extra_flag |= rev? KSW_EZ_SPLICE_FOR : KSW_EZ_SPLICE_REV;
|
||||
if (opt->flag & MM_F_SPLICE_FLANK) extra_flag |= KSW_EZ_SPLICE_FLANK;
|
||||
}
|
||||
|
||||
/* Look for the start and end of regions to perform DP. This sounds easy
|
||||
@@ -395,7 +617,7 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
|
||||
rs0 = rs - l > 0? rs - l : 0;
|
||||
l = qlen - qe;
|
||||
l += l * opt->a + opt->end_bonus > opt->q? (l * opt->a + opt->end_bonus - opt->q) / opt->e : 0;
|
||||
re0 = re + l < mi->seq[rid].len? re + l : mi->seq[rid].len;
|
||||
re0 = re + l < (int32_t)mi->seq[rid].len? re + l : mi->seq[rid].len;
|
||||
} else {
|
||||
// compute rs0 and qs0
|
||||
rs0 = (int32_t)a[r->as].x + 1 - (int32_t)(a[r->as].y>>32&0xff);
|
||||
@@ -410,6 +632,7 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
|
||||
if (++l > opt->min_cnt) {
|
||||
l = rs0 - x > qs0 - y? rs0 - x : qs0 - y;
|
||||
rs1 = rs0 - l, qs1 = qs0 - l;
|
||||
if (rs1 < 0) rs1 = 0; // not strictly necessary; better have this guard for explicit
|
||||
break;
|
||||
}
|
||||
}
|
||||
@@ -423,6 +646,7 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
|
||||
l = l < rs? l : rs;
|
||||
rs1 = rs1 > rs - l? rs1 : rs - l;
|
||||
rs0 = rs0 < rs1? rs0 : rs1;
|
||||
rs0 = rs0 < rs? rs0 : rs;
|
||||
} else rs0 = rs, qs0 = qs;
|
||||
// compute re0 and qe0
|
||||
re0 = (int32_t)a[r->as + r->cnt - 1].x + 1;
|
||||
@@ -439,27 +663,38 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
|
||||
}
|
||||
}
|
||||
}
|
||||
if (qe < qlen && re < mi->seq[rid].len) {
|
||||
if (qe < qlen && re < (int32_t)mi->seq[rid].len) {
|
||||
l = qlen - qe < opt->max_gap? qlen - qe : opt->max_gap;
|
||||
qe1 = qe1 < qe + l? qe1 : qe + l;
|
||||
qe0 = qe0 > qe1? qe0 : qe1; // at least include qe0
|
||||
l += l * opt->a > opt->q? (l * opt->a - opt->q) / opt->e : 0;
|
||||
l = l < opt->max_gap? l : opt->max_gap;
|
||||
l = l < mi->seq[rid].len - re? l : mi->seq[rid].len - re;
|
||||
l = l < (int32_t)mi->seq[rid].len - re? l : mi->seq[rid].len - re;
|
||||
re1 = re1 < re + l? re1 : re + l;
|
||||
re0 = re0 > re1? re0 : re1;
|
||||
} else re0 = re, qe0 = qe;
|
||||
}
|
||||
if (a[r->as].y & MM_SEED_SELF) {
|
||||
int max_ext = r->qs > r->rs? r->qs - r->rs : r->rs - r->qs;
|
||||
if (r->rs - rs0 > max_ext) rs0 = r->rs - max_ext;
|
||||
if (r->qs - qs0 > max_ext) qs0 = r->qs - max_ext;
|
||||
max_ext = r->qe > r->re? r->qe - r->re : r->re - r->qe;
|
||||
if (re0 - r->re > max_ext) re0 = r->re + max_ext;
|
||||
if (qe0 - r->qe > max_ext) qe0 = r->qe + max_ext;
|
||||
}
|
||||
|
||||
assert(re0 > rs0);
|
||||
tseq = (uint8_t*)kmalloc(km, re0 - rs0);
|
||||
junc = (uint8_t*)kmalloc(km, re0 - rs0);
|
||||
|
||||
if (qs > 0 && rs > 0) { // left extension
|
||||
if (qs > 0 && rs > 0) { // left extension; probably the condition can be changed to "qs > qs0 && rs > rs0"
|
||||
qseq = &qseq0[rev][qs0];
|
||||
mm_idx_getseq(mi, rid, rs0, rs, tseq);
|
||||
mm_idx_bed_junc(mi, rid, rs0, rs, junc);
|
||||
mm_seq_rev(qs - qs0, qseq);
|
||||
mm_seq_rev(rs - rs0, tseq);
|
||||
mm_align_pair(km, opt, qs - qs0, qseq, rs - rs0, tseq, mat, bw, opt->end_bonus, extra_flag|KSW_EZ_EXTZ_ONLY|KSW_EZ_RIGHT|KSW_EZ_REV_CIGAR, ez);
|
||||
mm_seq_rev(rs - rs0, junc);
|
||||
mm_align_pair(km, opt, qs - qs0, qseq, rs - rs0, tseq, junc, mat, bw, opt->end_bonus, r->split_inv? opt->zdrop_inv : opt->zdrop, extra_flag|KSW_EZ_EXTZ_ONLY|KSW_EZ_RIGHT|KSW_EZ_REV_CIGAR, ez);
|
||||
if (ez->n_cigar > 0) {
|
||||
mm_append_cigar(r, ez->n_cigar, ez->cigar);
|
||||
r->p->dp_score += ez->max;
|
||||
@@ -473,17 +708,19 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
|
||||
|
||||
for (i = is_sr? cnt1 - 1 : 1; i < cnt1; ++i) { // gap filling
|
||||
if ((a[as1+i].y & (MM_SEED_IGNORE|MM_SEED_TANDEM)) && i != cnt1 - 1) continue;
|
||||
if (is_sr && !mi->is_hpc) {
|
||||
if (is_sr && !(mi->flag & MM_I_HPC)) {
|
||||
re = (int32_t)a[as1 + i].x + 1;
|
||||
qe = (int32_t)a[as1 + i].y + 1;
|
||||
} else mm_adjust_minier(mi, qseq0, &a[as1 + i], &re, &qe);
|
||||
re1 = re, qe1 = qe;
|
||||
if (i == cnt1 - 1 || (a[as1+i].y&MM_SEED_LONG_JOIN) || (qe - qs >= opt->min_ksw_len && re - rs >= opt->min_ksw_len)) {
|
||||
int j, bw1 = bw;
|
||||
int j, bw1 = bw, zdrop_code;
|
||||
if (a[as1+i].y & MM_SEED_LONG_JOIN)
|
||||
bw1 = qe - qs > re - rs? qe - qs : re - rs;
|
||||
// perform alignment
|
||||
qseq = &qseq0[rev][qs];
|
||||
mm_idx_getseq(mi, rid, rs, re, tseq);
|
||||
mm_idx_bed_junc(mi, rid, rs, re, junc);
|
||||
if (is_sr) { // perform ungapped alignment
|
||||
assert(qe - qs == re - rs);
|
||||
ksw_reset_extz(ez);
|
||||
@@ -493,13 +730,22 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
|
||||
}
|
||||
ez->cigar = ksw_push_cigar(km, &ez->n_cigar, &ez->m_cigar, ez->cigar, 0, qe - qs);
|
||||
} else { // perform normal gapped alignment
|
||||
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, mat, bw1, -1, extra_flag|KSW_EZ_APPROX_MAX, ez); // first pass: with approximate Z-drop
|
||||
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, junc, mat, bw1, -1, opt->zdrop, extra_flag|KSW_EZ_APPROX_MAX, ez); // first pass: with approximate Z-drop
|
||||
}
|
||||
if (mm_check_zdrop(qseq, tseq, ez->n_cigar, ez->cigar, mat, opt->q, opt->e, opt->zdrop))
|
||||
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, mat, bw1, -1, extra_flag, ez); // second pass: lift approximate
|
||||
// test Z-drop and inversion Z-drop
|
||||
if ((zdrop_code = mm_test_zdrop(km, opt, qseq, tseq, ez->n_cigar, ez->cigar, mat)) != 0)
|
||||
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, junc, mat, bw1, -1, zdrop_code == 2? opt->zdrop_inv : opt->zdrop, extra_flag, ez); // second pass: lift approximate
|
||||
// update CIGAR
|
||||
if (ez->n_cigar > 0)
|
||||
mm_append_cigar(r, ez->n_cigar, ez->cigar);
|
||||
if (ez->zdropped) { // truncated by Z-drop; TODO: sometimes Z-drop kicks in because the next seed placement is wrong. This can be fixed in principle.
|
||||
if (!r->p) {
|
||||
assert(ez->n_cigar == 0);
|
||||
uint32_t capacity = sizeof(mm_extra_t)/4;
|
||||
kroundup32(capacity);
|
||||
r->p = (mm_extra_t*)calloc(capacity, 4);
|
||||
r->p->capacity = capacity;
|
||||
}
|
||||
for (j = i - 1; j >= 0; --j)
|
||||
if ((int32_t)a[as1 + j].x <= rs + ez->max_t)
|
||||
break;
|
||||
@@ -508,8 +754,10 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
|
||||
r->p->dp_score += ez->max;
|
||||
re1 = rs + (ez->max_t + 1);
|
||||
qe1 = qs + (ez->max_q + 1);
|
||||
if (cnt1 - (j + 1) >= opt->min_cnt)
|
||||
if (cnt1 - (j + 1) >= opt->min_cnt) {
|
||||
mm_split_reg(r, r2, as1 + j + 1 - r->as, qlen, a);
|
||||
if (zdrop_code == 2) r2->split_inv = 1;
|
||||
}
|
||||
break;
|
||||
} else r->p->dp_score += ez->score;
|
||||
rs = re, qs = qe;
|
||||
@@ -519,7 +767,8 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
|
||||
if (!dropped && qe < qe0 && re < re0) { // right extension
|
||||
qseq = &qseq0[rev][qe];
|
||||
mm_idx_getseq(mi, rid, re, re0, tseq);
|
||||
mm_align_pair(km, opt, qe0 - qe, qseq, re0 - re, tseq, mat, bw, opt->end_bonus, extra_flag|KSW_EZ_EXTZ_ONLY, ez);
|
||||
mm_idx_bed_junc(mi, rid, re, re0, junc);
|
||||
mm_align_pair(km, opt, qe0 - qe, qseq, re0 - re, tseq, junc, mat, bw, opt->end_bonus, opt->zdrop, extra_flag|KSW_EZ_EXTZ_ONLY, ez);
|
||||
if (ez->n_cigar > 0) {
|
||||
mm_append_cigar(r, ez->n_cigar, ez->cigar);
|
||||
r->p->dp_score += ez->max;
|
||||
@@ -536,18 +785,19 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
|
||||
assert(re1 - rs1 <= re0 - rs0);
|
||||
if (r->p) {
|
||||
mm_idx_getseq(mi, rid, rs1, re1, tseq);
|
||||
mm_update_extra(r, &qseq0[r->rev][qs1], qual0[r->rev]? &qual0[r->rev][qs1] : 0, tseq, mat, opt->q, opt->e);
|
||||
mm_update_extra(r, &qseq0[r->rev][qs1], tseq, mat, opt->q, opt->e, opt->flag & MM_F_EQX);
|
||||
if (rev && r->p->trans_strand)
|
||||
r->p->trans_strand ^= 3; // flip to the read strand
|
||||
}
|
||||
|
||||
kfree(km, tseq);
|
||||
kfree(km, junc);
|
||||
}
|
||||
|
||||
static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, uint8_t *qseq0[2], uint8_t *qual0[2], const mm_reg1_t *r1, const mm_reg1_t *r2, mm_reg1_t *r_inv, ksw_extz_t *ez)
|
||||
static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, uint8_t *qseq0[2], const mm_reg1_t *r1, const mm_reg1_t *r2, mm_reg1_t *r_inv, ksw_extz_t *ez)
|
||||
{
|
||||
int tl, ql, score, ret = 0, q_off, t_off;
|
||||
uint8_t *tseq, *qseq, *qual;
|
||||
uint8_t *tseq, *qseq;
|
||||
int8_t mat[25];
|
||||
void *qp;
|
||||
|
||||
@@ -556,16 +806,15 @@ static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, i
|
||||
if (r1->id != r1->parent && r1->parent != MM_PARENT_TMP_PRI) return 0;
|
||||
if (r2->id != r2->parent && r2->parent != MM_PARENT_TMP_PRI) return 0;
|
||||
if (r1->rid != r2->rid || r1->rev != r2->rev) return 0;
|
||||
ql = r2->qs - r1->qe;
|
||||
ql = r1->rev? r1->qs - r2->qe : r2->qs - r1->qe;
|
||||
tl = r2->rs - r1->re;
|
||||
if (ql < opt->min_chain_score || ql > opt->max_gap) return 0;
|
||||
if (tl < opt->min_chain_score || tl > opt->max_gap) return 0;
|
||||
|
||||
ksw_gen_simple_mat(5, mat, opt->a, opt->b);
|
||||
ksw_gen_simple_mat(5, mat, opt->a, opt->b, opt->sc_ambi);
|
||||
tseq = (uint8_t*)kmalloc(km, tl);
|
||||
mm_idx_getseq(mi, r1->rid, r1->re, r2->rs, tseq);
|
||||
qseq = &qseq0[!r1->rev][qlen - r2->qs];
|
||||
qual = qual0[!r1->rev]? &qseq0[!r1->rev][qlen - r2->qs] : 0;
|
||||
qseq = r1->rev? &qseq0[0][r2->qe] : &qseq0[1][qlen - r2->qs];
|
||||
|
||||
mm_seq_rev(ql, qseq);
|
||||
mm_seq_rev(tl, tseq);
|
||||
@@ -576,7 +825,7 @@ static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, i
|
||||
mm_seq_rev(tl, tseq);
|
||||
if (score < opt->min_dp_max) goto end_align1_inv;
|
||||
q_off = ql - (q_off + 1), t_off = tl - (t_off + 1);
|
||||
mm_align_pair(km, opt, ql - q_off, qseq + q_off, tl - t_off, tseq + t_off, mat, (int)(opt->bw * 1.5), -1, KSW_EZ_EXTZ_ONLY, ez);
|
||||
mm_align_pair(km, opt, ql - q_off, qseq + q_off, tl - t_off, tseq + t_off, 0, mat, (int)(opt->bw * 1.5), -1, opt->zdrop, KSW_EZ_EXTZ_ONLY, ez);
|
||||
if (ez->n_cigar == 0) goto end_align1_inv; // should never be here
|
||||
mm_append_cigar(r_inv, ez->n_cigar, ez->cigar);
|
||||
r_inv->p->dp_score = ez->max;
|
||||
@@ -585,9 +834,17 @@ static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, i
|
||||
r_inv->inv = 1;
|
||||
r_inv->rev = !r1->rev;
|
||||
r_inv->rid = r1->rid;
|
||||
r_inv->qs = r1->qe + q_off, r_inv->qe = r_inv->qs + ez->max_q + 1;
|
||||
r_inv->rs = r1->re + t_off, r_inv->re = r_inv->rs + ez->max_t + 1;
|
||||
mm_update_extra(r_inv, &qseq[q_off], qual? &qual[q_off] : 0, &tseq[t_off], mat, opt->q, opt->e);
|
||||
r_inv->div = -1.0f;
|
||||
if (r_inv->rev == 0) {
|
||||
r_inv->qs = r2->qe + q_off;
|
||||
r_inv->qe = r_inv->qs + ez->max_q + 1;
|
||||
} else {
|
||||
r_inv->qe = r2->qs - q_off;
|
||||
r_inv->qs = r_inv->qe - (ez->max_q + 1);
|
||||
}
|
||||
r_inv->rs = r1->re + t_off;
|
||||
r_inv->re = r_inv->rs + ez->max_t + 1;
|
||||
mm_update_extra(r_inv, &qseq[q_off], &tseq[t_off], mat, opt->q, opt->e, opt->flag & MM_F_EQX);
|
||||
ret = 1;
|
||||
end_align1_inv:
|
||||
kfree(km, tseq);
|
||||
@@ -604,11 +861,11 @@ static inline mm_reg1_t *mm_insert_reg(const mm_reg1_t *r, int i, int *n_regs, m
|
||||
return regs;
|
||||
}
|
||||
|
||||
mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, const char *qual, int *n_regs_, mm_reg1_t *regs, mm128_t *a)
|
||||
mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a)
|
||||
{
|
||||
extern unsigned char seq_nt4_table[256];
|
||||
int32_t i, n_regs = *n_regs_, n_a;
|
||||
uint8_t *qseq0[2], *qual0[2];
|
||||
uint8_t *qseq0[2];
|
||||
ksw_extz_t ez;
|
||||
|
||||
// encode the query sequence
|
||||
@@ -618,12 +875,6 @@ mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *m
|
||||
qseq0[0][i] = seq_nt4_table[(uint8_t)qstr[i]];
|
||||
qseq0[1][qlen - 1 - i] = qseq0[0][i] < 4? 3 - qseq0[0][i] : 4;
|
||||
}
|
||||
if (qual) {
|
||||
qual0[0] = (uint8_t*)kmalloc(km, qlen * 2);
|
||||
qual0[1] = qual0[0] + qlen;
|
||||
for (i = 0; i < qlen; ++i)
|
||||
qual0[0][i] = qual0[1][qlen - 1 - i] = qual[i] - 33;
|
||||
} else qual0[0] = qual0[1] = 0;
|
||||
|
||||
// align through seed hits
|
||||
n_a = mm_squeeze_a(km, n_regs, regs, a);
|
||||
@@ -634,8 +885,8 @@ mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *m
|
||||
mm_reg1_t s[2], s2[2];
|
||||
int which, trans_strand;
|
||||
s[0] = s[1] = regs[i];
|
||||
mm_align1(km, opt, mi, qlen, qseq0, qual0, &s[0], &s2[0], n_a, a, &ez, MM_F_SPLICE_FOR);
|
||||
mm_align1(km, opt, mi, qlen, qseq0, qual0, &s[1], &s2[1], n_a, a, &ez, MM_F_SPLICE_REV);
|
||||
mm_align1(km, opt, mi, qlen, qseq0, &s[0], &s2[0], n_a, a, &ez, MM_F_SPLICE_FOR);
|
||||
mm_align1(km, opt, mi, qlen, qseq0, &s[1], &s2[1], n_a, a, &ez, MM_F_SPLICE_REV);
|
||||
if (s[0].p->dp_score > s[1].p->dp_score) which = 0, trans_strand = 1;
|
||||
else if (s[0].p->dp_score < s[1].p->dp_score) which = 1, trans_strand = 2;
|
||||
else trans_strand = 3, which = (qlen + s[0].p->dp_score) & 1; // randomly choose a strand, effectively
|
||||
@@ -648,13 +899,13 @@ mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *m
|
||||
}
|
||||
regs[i].p->trans_strand = trans_strand;
|
||||
} else { // one round of alignment
|
||||
mm_align1(km, opt, mi, qlen, qseq0, qual0, ®s[i], &r2, n_a, a, &ez, opt->flag);
|
||||
mm_align1(km, opt, mi, qlen, qseq0, ®s[i], &r2, n_a, a, &ez, opt->flag);
|
||||
if (opt->flag&MM_F_SPLICE)
|
||||
regs[i].p->trans_strand = opt->flag&MM_F_SPLICE_FOR? 1 : 2;
|
||||
}
|
||||
if (r2.cnt > 0) regs = mm_insert_reg(&r2, i, &n_regs, regs);
|
||||
if (!(opt->flag&MM_F_SPLICE) && !(opt->flag&MM_F_SR) && i > 0) { // don't try inversion alignment for -xsplice or -xsr
|
||||
if (mm_align1_inv(km, opt, mi, qlen, qseq0, qual0, ®s[i-1], ®s[i], &r2, &ez)) {
|
||||
if (i > 0 && regs[i].split_inv) {
|
||||
if (mm_align1_inv(km, opt, mi, qlen, qseq0, ®s[i-1], ®s[i], &r2, &ez)) {
|
||||
regs = mm_insert_reg(&r2, i, &n_regs, regs);
|
||||
++i; // skip the inserted INV alignment
|
||||
}
|
||||
@@ -662,9 +913,8 @@ mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *m
|
||||
}
|
||||
*n_regs_ = n_regs;
|
||||
kfree(km, qseq0[0]);
|
||||
if (qual0[0]) kfree(km, qual0[0]);
|
||||
kfree(km, ez.cigar);
|
||||
mm_filter_regs(km, opt, n_regs_, regs);
|
||||
mm_hit_sort_by_dp(km, n_regs_, regs);
|
||||
mm_filter_regs(opt, qlen, n_regs_, regs);
|
||||
mm_hit_sort(km, n_regs_, regs, opt->alt_drop);
|
||||
return regs;
|
||||
}
|
||||
|
||||
@@ -2,6 +2,7 @@
|
||||
#include <stdio.h>
|
||||
#include <stdlib.h>
|
||||
#include <assert.h>
|
||||
#define __STDC_LIMIT_MACROS
|
||||
#include "bseq.h"
|
||||
#include "kvec.h"
|
||||
#include "kseq.h"
|
||||
@@ -14,7 +15,7 @@ unsigned char seq_comp_table[256] = {
|
||||
48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63,
|
||||
64, 'T', 'V', 'G', 'H', 'E', 'F', 'C', 'D', 'I', 'J', 'M', 'L', 'K', 'N', 'O',
|
||||
'P', 'Q', 'Y', 'S', 'A', 'A', 'B', 'W', 'X', 'R', 'Z', 91, 92, 93, 94, 95,
|
||||
64, 't', 'v', 'g', 'h', 'e', 'f', 'c', 'd', 'i', 'j', 'm', 'l', 'k', 'n', 'o',
|
||||
96, 't', 'v', 'g', 'h', 'e', 'f', 'c', 'd', 'i', 'j', 'm', 'l', 'k', 'n', 'o',
|
||||
'p', 'q', 'y', 's', 'a', 'a', 'b', 'w', 'x', 'r', 'z', 123, 124, 125, 126, 127,
|
||||
128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143,
|
||||
144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159,
|
||||
@@ -38,7 +39,7 @@ mm_bseq_file_t *mm_bseq_open(const char *fn)
|
||||
{
|
||||
mm_bseq_file_t *fp;
|
||||
gzFile f;
|
||||
f = fn && strcmp(fn, "-")? gzopen(fn, "r") : gzdopen(fileno(stdin), "r");
|
||||
f = fn && strcmp(fn, "-")? gzopen(fn, "r") : gzdopen(0, "r");
|
||||
if (f == 0) return 0;
|
||||
fp = (mm_bseq_file_t*)calloc(1, sizeof(mm_bseq_file_t));
|
||||
fp->fp = f;
|
||||
@@ -53,21 +54,33 @@ void mm_bseq_close(mm_bseq_file_t *fp)
|
||||
free(fp);
|
||||
}
|
||||
|
||||
static inline void kseq2bseq(kseq_t *ks, mm_bseq1_t *s, int with_qual)
|
||||
static inline char *kstrdup(const kstring_t *s)
|
||||
{
|
||||
char *t;
|
||||
t = (char*)malloc(s->l + 1);
|
||||
memcpy(t, s->s, s->l + 1);
|
||||
return t;
|
||||
}
|
||||
|
||||
static inline void kseq2bseq(kseq_t *ks, mm_bseq1_t *s, int with_qual, int with_comment)
|
||||
{
|
||||
int i;
|
||||
s->name = strdup(ks->name.s);
|
||||
s->seq = strdup(ks->seq.s);
|
||||
for (i = 0; i < ks->seq.l; ++i) // convert U to T
|
||||
if (ks->name.l == 0)
|
||||
fprintf(stderr, "[WARNING]\033[1;31m empty sequence name in the input.\033[0m\n");
|
||||
s->name = kstrdup(&ks->name);
|
||||
s->seq = kstrdup(&ks->seq);
|
||||
for (i = 0; i < (int)ks->seq.l; ++i) // convert U to T
|
||||
if (s->seq[i] == 'u' || s->seq[i] == 'U')
|
||||
--s->seq[i];
|
||||
s->qual = with_qual && ks->qual.l? strdup(ks->qual.s) : 0;
|
||||
s->qual = with_qual && ks->qual.l? kstrdup(&ks->qual) : 0;
|
||||
s->comment = with_comment && ks->comment.l? kstrdup(&ks->comment) : 0;
|
||||
s->l_seq = ks->seq.l;
|
||||
}
|
||||
|
||||
mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int frag_mode, int *n_)
|
||||
mm_bseq1_t *mm_bseq_read3(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int with_comment, int frag_mode, int *n_)
|
||||
{
|
||||
int64_t size = 0;
|
||||
int ret;
|
||||
kvec_t(mm_bseq1_t) a = {0,0,0};
|
||||
kseq_t *ks = fp->ks;
|
||||
*n_ = 0;
|
||||
@@ -77,17 +90,17 @@ mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int
|
||||
size = fp->s.l_seq;
|
||||
memset(&fp->s, 0, sizeof(mm_bseq1_t));
|
||||
}
|
||||
while (kseq_read(ks) >= 0) {
|
||||
while ((ret = kseq_read(ks)) >= 0) {
|
||||
mm_bseq1_t *s;
|
||||
assert(ks->seq.l <= INT32_MAX);
|
||||
if (a.m == 0) kv_resize(mm_bseq1_t, 0, a, 256);
|
||||
kv_pushp(mm_bseq1_t, 0, a, &s);
|
||||
kseq2bseq(ks, s, with_qual);
|
||||
kseq2bseq(ks, s, with_qual, with_comment);
|
||||
size += s->l_seq;
|
||||
if (size >= chunk_size) {
|
||||
if (frag_mode && a.a[a.n-1].l_seq < CHECK_PAIR_THRES) {
|
||||
while (kseq_read(ks) >= 0) {
|
||||
kseq2bseq(ks, &fp->s, with_qual);
|
||||
while ((ret = kseq_read(ks)) >= 0) {
|
||||
kseq2bseq(ks, &fp->s, with_qual, with_comment);
|
||||
if (mm_qname_same(fp->s.name, a.a[a.n-1].name)) {
|
||||
kv_push(mm_bseq1_t, 0, a, fp->s);
|
||||
memset(&fp->s, 0, sizeof(mm_bseq1_t));
|
||||
@@ -97,16 +110,25 @@ mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int
|
||||
break;
|
||||
}
|
||||
}
|
||||
if (ret < -1) {
|
||||
if (a.n) fprintf(stderr, "[WARNING]\033[1;31m failed to parse the FASTA/FASTQ record next to '%s'. Continue anyway.\033[0m\n", a.a[a.n-1].name);
|
||||
else fprintf(stderr, "[WARNING]\033[1;31m failed to parse the first FASTA/FASTQ record. Continue anyway.\033[0m\n");
|
||||
}
|
||||
*n_ = a.n;
|
||||
return a.a;
|
||||
}
|
||||
|
||||
mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int chunk_size, int with_qual, int *n_)
|
||||
mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int frag_mode, int *n_)
|
||||
{
|
||||
return mm_bseq_read3(fp, chunk_size, with_qual, 0, frag_mode, n_);
|
||||
}
|
||||
|
||||
mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int *n_)
|
||||
{
|
||||
return mm_bseq_read2(fp, chunk_size, with_qual, 0, n_);
|
||||
}
|
||||
|
||||
mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int *n_)
|
||||
mm_bseq1_t *mm_bseq_read_frag2(int n_fp, mm_bseq_file_t **fp, int64_t chunk_size, int with_qual, int with_comment, int *n_)
|
||||
{
|
||||
int i;
|
||||
int64_t size = 0;
|
||||
@@ -114,15 +136,20 @@ mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int
|
||||
*n_ = 0;
|
||||
if (n_fp < 1) return 0;
|
||||
while (1) {
|
||||
int n_read = 0;
|
||||
for (i = 0; i < n_fp; ++i)
|
||||
if (kseq_read(fp[i]->ks) < 0)
|
||||
break;
|
||||
if (i != n_fp) break; // some file reaches the end
|
||||
if (kseq_read(fp[i]->ks) >= 0)
|
||||
++n_read;
|
||||
if (n_read < n_fp) {
|
||||
if (n_read > 0)
|
||||
fprintf(stderr, "[W::%s]\033[1;31m query files have different number of records; extra records skipped.\033[0m\n", __func__);
|
||||
break; // some file reaches the end
|
||||
}
|
||||
if (a.m == 0) kv_resize(mm_bseq1_t, 0, a, 256);
|
||||
for (i = 0; i < n_fp; ++i) {
|
||||
mm_bseq1_t *s;
|
||||
kv_pushp(mm_bseq1_t, 0, a, &s);
|
||||
kseq2bseq(fp[i]->ks, s, with_qual);
|
||||
kseq2bseq(fp[i]->ks, s, with_qual, with_comment);
|
||||
size += s->l_seq;
|
||||
}
|
||||
if (size >= chunk_size) break;
|
||||
@@ -131,6 +158,11 @@ mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int
|
||||
return a.a;
|
||||
}
|
||||
|
||||
mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int64_t chunk_size, int with_qual, int *n_)
|
||||
{
|
||||
return mm_bseq_read_frag2(n_fp, fp, chunk_size, with_qual, 0, n_);
|
||||
}
|
||||
|
||||
int mm_bseq_eof(mm_bseq_file_t *fp)
|
||||
{
|
||||
return (ks_eof(fp->ks->f) && fp->s.seq == 0);
|
||||
|
||||
@@ -13,14 +13,16 @@ typedef struct mm_bseq_file_s mm_bseq_file_t;
|
||||
|
||||
typedef struct {
|
||||
int l_seq, rid;
|
||||
char *name, *seq, *qual;
|
||||
char *name, *seq, *qual, *comment;
|
||||
} mm_bseq1_t;
|
||||
|
||||
mm_bseq_file_t *mm_bseq_open(const char *fn);
|
||||
void mm_bseq_close(mm_bseq_file_t *fp);
|
||||
mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int frag_mode, int *n_);
|
||||
mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int chunk_size, int with_qual, int *n_);
|
||||
mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int *n_);
|
||||
mm_bseq1_t *mm_bseq_read3(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int with_comment, int frag_mode, int *n_);
|
||||
mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int frag_mode, int *n_);
|
||||
mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int *n_);
|
||||
mm_bseq1_t *mm_bseq_read_frag2(int n_fp, mm_bseq_file_t **fp, int64_t chunk_size, int with_qual, int with_comment, int *n_);
|
||||
mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int64_t chunk_size, int with_qual, int *n_);
|
||||
int mm_bseq_eof(mm_bseq_file_t *fp);
|
||||
|
||||
extern unsigned char seq_nt4_table[256];
|
||||
|
||||
@@ -14,12 +14,12 @@ static const char LogTable256[256] = {
|
||||
|
||||
static inline int ilog2_32(uint32_t v)
|
||||
{
|
||||
register uint32_t t, tt;
|
||||
uint32_t t, tt;
|
||||
if ((tt = v>>16)) return (t = tt>>8) ? 24 + LogTable256[t] : 16 + LogTable256[tt];
|
||||
return (t = v>>8) ? 8 + LogTable256[t] : LogTable256[v];
|
||||
}
|
||||
|
||||
mm128_t *mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int min_cnt, int min_sc, int is_cdna, int n_segs, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km)
|
||||
mm128_t *mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int max_iter, int min_cnt, int min_sc, float gap_scale, int is_cdna, int n_segs, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km)
|
||||
{ // TODO: make sure this works when n has more than 32 bits
|
||||
int32_t k, *f, *p, *t, *v, n_u, n_v;
|
||||
int64_t i, j, st = 0;
|
||||
@@ -28,6 +28,10 @@ mm128_t *mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int m
|
||||
mm128_t *b, *w;
|
||||
|
||||
if (_u) *_u = 0, *n_u_ = 0;
|
||||
if (n == 0 || a == 0) {
|
||||
kfree(km, a);
|
||||
return 0;
|
||||
}
|
||||
f = (int32_t*)kmalloc(km, n * 4);
|
||||
p = (int32_t*)kmalloc(km, n * 4);
|
||||
t = (int32_t*)kmalloc(km, n * 4);
|
||||
@@ -44,12 +48,13 @@ mm128_t *mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int m
|
||||
int32_t qi = (int32_t)a[i].y, q_span = a[i].y>>32&0xff; // NB: only 8 bits of span is used!!!
|
||||
int32_t max_f = q_span, n_skip = 0, min_d;
|
||||
int32_t sidi = (a[i].y & MM_SEED_SEG_MASK) >> MM_SEED_SEG_SHIFT;
|
||||
while (st < i && ri - a[st].x > max_dist_x) ++st;
|
||||
while (st < i && ri > a[st].x + max_dist_x) ++st;
|
||||
if (i - st > max_iter) st = i - max_iter;
|
||||
for (j = i - 1; j >= st; --j) {
|
||||
int64_t dr = ri - a[j].x;
|
||||
int32_t dq = qi - (int32_t)a[j].y, dd, sc, log_dd;
|
||||
int32_t dq = qi - (int32_t)a[j].y, dd, sc, log_dd, gap_cost;
|
||||
int32_t sidj = (a[j].y & MM_SEED_SEG_MASK) >> MM_SEED_SEG_SHIFT;
|
||||
if (dr == 0 || dq <= 0) continue;
|
||||
if ((sidi == sidj && dr == 0) || dq <= 0) continue; // don't skip if an anchor is used by multiple segments; see below
|
||||
if ((sidi == sidj && dq > max_dist_y) || dq > max_dist_x) continue;
|
||||
dd = dr > dq? dr - dq : dq - dr;
|
||||
if (sidi == sidj && dd > bw) continue;
|
||||
@@ -57,13 +62,16 @@ mm128_t *mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int m
|
||||
min_d = dq < dr? dq : dr;
|
||||
sc = min_d > q_span? q_span : dq < dr? dq : dr;
|
||||
log_dd = dd? ilog2_32(dd) : 0;
|
||||
gap_cost = 0;
|
||||
if (is_cdna || sidi != sidj) {
|
||||
int c_log, c_lin;
|
||||
c_lin = (int)(dd * .01 * avg_qspan);
|
||||
c_log = log_dd;
|
||||
if (dr > dq || sidi != sidj) sc -= c_lin < c_log? c_lin : c_log;
|
||||
else sc -= c_lin + (c_log>>1);
|
||||
} else sc -= (int)(dd * .01 * avg_qspan) + (log_dd>>1);
|
||||
if (sidi != sidj && dr == 0) ++sc; // possibly due to overlapping paired ends; give a minor bonus
|
||||
else if (dr > dq || sidi != sidj) gap_cost = c_lin < c_log? c_lin : c_log;
|
||||
else gap_cost = c_lin + (c_log>>1);
|
||||
} else gap_cost = (int)(dd * .01 * avg_qspan) + (log_dd>>1);
|
||||
sc -= (int)((double)gap_cost * gap_scale + .499);
|
||||
sc += f[j];
|
||||
if (sc > max_f) {
|
||||
max_f = sc, max_j = j;
|
||||
@@ -149,8 +157,8 @@ mm128_t *mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int m
|
||||
memcpy(&a[k], &b[w[i].y>>32], n * sizeof(mm128_t));
|
||||
k += n;
|
||||
}
|
||||
memcpy(u, u2, n_u * 8);
|
||||
memcpy(b, a, k * sizeof(mm128_t)); // write _a_ to _b_ and deallocate _a_ because _a_ is oversized, sometimes a lot
|
||||
if (n_u) memcpy(u, u2, n_u * 8);
|
||||
if (k) memcpy(b, a, k * sizeof(mm128_t)); // write _a_ to _b_ and deallocate _a_ because _a_ is oversized, sometimes a lot
|
||||
kfree(km, a); kfree(km, w); kfree(km, u2);
|
||||
return b;
|
||||
}
|
||||
|
||||
+243
@@ -0,0 +1,243 @@
|
||||
## Table of Contents
|
||||
|
||||
- [Introduction & Installation](#intro)
|
||||
- [Mapping Genomic Reads](#map-reads)
|
||||
* [Mapping long reads](#map-pb)
|
||||
* [Mapping Illumina paired-end reads](#map-sr)
|
||||
* [Evaluating mapping accuracy with simulated reads (for developers)](#mapeval)
|
||||
- [Mapping Long RNA-seq Reads](#map-rna)
|
||||
* [Mapping Nanopore 2D cDNA reads](#map-ont-cdna-2d)
|
||||
* [Mapping Nanopore direct-RNA reads](#map-direct-rna)
|
||||
* [Mapping PacBio Iso-seq reads](#map-iso-seq)
|
||||
- [Full-Genome Alignment](#genome-aln)
|
||||
* [Intra-species assembly alignment](#asm-to-ref)
|
||||
* [Cross-species full-genome alignment](#x-species)
|
||||
* [Eyeballing alignment](#view-aln)
|
||||
* [Calling variants from assembly-to-reference alignment](#asm-var)
|
||||
* [Constructing self-homology map](#hom-map)
|
||||
* [Lift Over (for developers)](#liftover)
|
||||
- [Read Overlap](#read-overlap)
|
||||
* [Long-read overlap](#long-read-overlap)
|
||||
* [Evaluating overlap sensitivity (for developers)](#ov-eval)
|
||||
|
||||
## <a name="intro"></a>Introduction & Installation
|
||||
|
||||
This cookbook walks you through a variety of applications of minimap2 and its
|
||||
companion script `paftools.js`. All data here are freely available from the
|
||||
minimap2 release page at version tag [v2.10][v2.10]. Some examples only work
|
||||
with v2.10 or later.
|
||||
|
||||
To acquire the data used in this cookbook and to install minimap2 and paftools,
|
||||
please follow the command lines below:
|
||||
```sh
|
||||
# install minimap2 executables
|
||||
curl -L https://github.com/lh3/minimap2/releases/download/v2.18/minimap2-2.18_x64-linux.tar.bz2 | tar jxf -
|
||||
cp minimap2-2.18_x64-linux/{minimap2,k8,paftools.js} . # copy executables
|
||||
export PATH="$PATH:"`pwd` # put the current directory on PATH
|
||||
# download example datasets
|
||||
curl -L https://github.com/lh3/minimap2/releases/download/v2.10/cookbook-data.tgz | tar zxf -
|
||||
```
|
||||
|
||||
## <a name="map-reads"></a>Mapping Genomic Reads
|
||||
|
||||
### <a name="map-pb"></a>Mapping long reads
|
||||
```sh
|
||||
minimap2 -ax map-pb -t4 ecoli_ref.fa ecoli_p6_25x_canu.fa > mapped.sam
|
||||
```
|
||||
Alternatively, you can create a minimap2 index first and then map:
|
||||
```sh
|
||||
minimap2 -x map-pb -d ecoli-pb.mmi ecoli_ref.fa # create an index
|
||||
minimap2 -ax map-pb ecoli-pb.mmi ecoli_p6_25x_canu.fa > mapped.sam
|
||||
```
|
||||
This will save you a couple of minutes when you map against the human genome.
|
||||
**HOWEVER**, key algorithm parameters such as the k-mer length and window
|
||||
size can't be changed after indexing. Minimap2 will give you a warning if
|
||||
parameters used in a pre-built index doesn't match parameters on the command
|
||||
line. **Please always make sure you are using an intended pre-built index.**
|
||||
|
||||
### <a name="map-sr"></a>Mapping Illumina paired-end reads:
|
||||
```sh
|
||||
minimap2 -ax sr -t4 ecoli_ref.fa ecoli_mason_1.fq ecoli_mason_2.fq > mapped-sr.sam
|
||||
```
|
||||
|
||||
### <a name="mapeval"></a>Evaluating mapping accuracy with simulated reads (for developers)
|
||||
```sh
|
||||
minimap2 -ax sr ecoli_ref.fa ecoli_mason_1.fq ecoli_mason_2.fq | paftools.js mapeval -
|
||||
```
|
||||
The output is:
|
||||
```
|
||||
Q 60 19712 0 0.000000000 19712
|
||||
Q 0 282 219 0.010953286 19994
|
||||
U 6
|
||||
```
|
||||
where a `U`-line gives the number of unmapped reads (for SAM input only); a
|
||||
`Q`-line gives:
|
||||
|
||||
1. Mapping quality (mapQ) threshold
|
||||
2. Number of mapped reads between this threshold and the previous mapQ threshold.
|
||||
3. Number of wrong mappings in the same mapQ interval
|
||||
4. Accumulative mapping error rate
|
||||
5. Accumulative number of mappings
|
||||
|
||||
For `paftools.js mapeval` to work, you need to encode the true read positions
|
||||
in read names in the right format. For [PBSIM][pbsim] and [mason2][mason2], we
|
||||
provide scripts to generate the right format. Simulated reads in this cookbook
|
||||
were created with the following command lines:
|
||||
```sh
|
||||
# in PBSIM source code directory:
|
||||
src/pbsim ../ecoli_ref.fa --depth 1 --sample-fastq sample/sample.fastq
|
||||
paftools.js pbsim2fq ../ecoli_ref.fa.fai sd_0001.maf > ../ecoli_pbsim.fa
|
||||
|
||||
# mason2 simulation
|
||||
mason_simulator --illumina-prob-mismatch-scale 2.5 -ir ecoli_ref.fa -n 10000 -o tmp-l.fq -or tmp-r.fq -oa tmp.sam
|
||||
paftools.js mason2fq tmp.sam | seqtk seq -1 > ecoli_mason_1.fq
|
||||
paftools.js mason2fq tmp.sam | seqtk seq -2 > ecoli_mason_2.fq
|
||||
```
|
||||
|
||||
|
||||
|
||||
## <a name="map-rna"></a>Mapping Long RNA-seq Reads
|
||||
|
||||
### <a name="map-ont-cdna-2d"></a>Mapping Nanopore 2D cDNA reads
|
||||
```sh
|
||||
minimap2 -ax splice SIRV_E2.fa SIRV_ont-cdna.fa > aln.sam
|
||||
```
|
||||
You can compare the alignment to the true annotations with:
|
||||
```sh
|
||||
paftools.js junceval SIRV_E2C.gtf aln.sam
|
||||
```
|
||||
It gives the percentage of introns found in the annotation. For SIRV data, it
|
||||
is possible to achieve higher junction accuracy with
|
||||
```sh
|
||||
minimap2 -ax splice --splice-flank=no SIRV_E2.fa SIRV_ont-cdna.fa | paftools.js junceval SIRV_E2C.gtf
|
||||
```
|
||||
This is because minimap2 models one additional evolutionarily conserved base
|
||||
around a canonical junction, but SIRV doesn't honor this signal. Option
|
||||
`--splice-flank=no` asks minimap2 no to model this additional base.
|
||||
|
||||
In the output a tag `ts:A:+` indicates that the read strand is the same as the
|
||||
transcript strand; `ts:A:-` indicates the read strand is opposite to the
|
||||
transcript strand. This tag is inferred from the GT-AG signal and is thus only
|
||||
available to spliced reads.
|
||||
|
||||
### <a name="map-direct-rna"></a>Mapping Nanopore direct-RNA reads
|
||||
```sh
|
||||
minimap2 -ax splice -k14 -uf SIRV_E2.fa SIRV_ont-drna.fa > aln.sam
|
||||
```
|
||||
Direct-RNA reads are noisier, so we use a shorter k-mer for improved
|
||||
sensitivity. Here, option `-uf` forces minimap2 to map reads to the forward
|
||||
transcript strand only because direct-RNA reads are stranded. Again, applying
|
||||
`--splice-flank=no` helps junction accuracy for SIRV data.
|
||||
|
||||
### <a name="map-iso-seq"></a>Mapping PacBio Iso-seq reads
|
||||
```sh
|
||||
minimap2 -ax splice -uf -C5 SIRV_E2.fa SIRV_iso-seq.fq > aln.sam
|
||||
```
|
||||
Option `-C5` reduces the penalty on non-canonical splicing sites. It helps
|
||||
to align such sites correctly for data with low error rate such as Iso-seq
|
||||
reads and traditional cDNAs. On this example, minimap2 makes one junction
|
||||
error. Applying `--splice-flank=no` fixes this alignment error.
|
||||
|
||||
Note that the command line above is optimized for the final Iso-seq reads.
|
||||
PacBio's Iso-seq pipeline produces intermediate sequences at varying quality.
|
||||
For example, some intermediate reads are not stranded. For these reads, option
|
||||
`-uf` will lead to more errors. Please revise the minimap2 command line
|
||||
accordingly.
|
||||
|
||||
|
||||
|
||||
## <a name="genome-aln"></a>Full-Genome Alignment
|
||||
|
||||
### <a name="asm-to-ref"></a>Intra-species assembly alignment
|
||||
```sh
|
||||
# option "--cs" is recommended as paftools.js may need it
|
||||
minimap2 -cx asm5 --cs ecoli_ref.fa ecoli_canu.fa > ecoli_canu.paf
|
||||
```
|
||||
Here `ecoli_canu.fa` is the Canu assembly of `ecoli_p6_25x_canu.fa`. This
|
||||
command line outputs alignments in the [PAF format][paf]. Use `-a` instead of
|
||||
`-c` to get output in the SAM format.
|
||||
|
||||
### <a name="x-species"></a>Cross-species full-genome alignment
|
||||
```sh
|
||||
minimap2 -cx asm20 --cs ecoli_ref.fa ecoli_O104:H4.fa > ecoli_O104:H4.paf
|
||||
sort -k6,6 -k8,8n ecoli_O104:H4.paf | paftools.js call -f ecoli_ref.fa -L10000 -l1000 - > out.vcf
|
||||
```
|
||||
Minimap2 has three presets for full-genome alignment: "asm5" for sequence
|
||||
divergence below 1%, "asm10" for divergence around a couple of percent and
|
||||
"asm20" for divergence not more than 10%. In theory, with the right setting,
|
||||
minimap2 should work for sequence pairs with sequence divergence up to ~15%,
|
||||
but this has not been carefully evaluated.
|
||||
|
||||
### <a name="view-aln"></a>Eyeballing alignment
|
||||
```sh
|
||||
# option "--cs" required; minimap2-r741 or higher required for the "asm20" preset
|
||||
minimap2 -cx asm20 --cs ecoli_ref.fa ecoli_O104:H4.fa | paftools.js view - | less -S
|
||||
```
|
||||
This prints the alignment in a BLAST-like format.
|
||||
|
||||
### <a name="asm-var"></a>Calling variants from assembly-to-reference alignment
|
||||
```sh
|
||||
# don't forget the "--cs" option; otherwise it doesn't work
|
||||
minimap2 -cx asm5 --cs ecoli_ref.fa ecoli_canu.fa \
|
||||
| sort -k6,6 -k8,8n \
|
||||
| paftools.js call -f ecoli_ref.fa - > out.vcf
|
||||
```
|
||||
Without option `-f`, `paftools.js call` outputs in a custom format. In this
|
||||
format, lines starting with `R` give the regions covered by one contig only.
|
||||
This information is not available in the VCF output.
|
||||
|
||||
### <a name="hom-map"></a>Constructing self-homology map
|
||||
```sh
|
||||
minimap2 -DP -k19 -w19 -m200 ecoli_ref.fa ecoli_ref.fa > out.paf
|
||||
```
|
||||
Option `-D` asks minimap2 to ignore anchors from perfect self match and `-P`
|
||||
outputs all chains. For large nomes, we don't recommend to perform base-level
|
||||
alignment (with `-c`, `-a` or `--cs`) when `-P` is applied. This is because
|
||||
base-alignment is slow and occasionally gives wrong alignments close to the
|
||||
diagonal of a dotter plot. For E. coli, though, base-alignment is still fast.
|
||||
|
||||
### <a name="liftover"></a>Lift over (for developers)
|
||||
```sh
|
||||
minimap2 -cx asm5 --cs ecoli_ref.fa ecoli_canu.fa > ecoli_canu.paf
|
||||
echo -e 'tig00000001\t200000\t300000' | paftools.js liftover ecoli_canu.paf -
|
||||
```
|
||||
This lifts over a region on query sequences to one or multiple regions on
|
||||
reference sequences. Note that this paftools.js command may not be efficient
|
||||
enough to lift millions of regions.
|
||||
|
||||
|
||||
|
||||
## <a name="read-overlap"></a>Read Overlap
|
||||
|
||||
### <a name="long-read-overlap"></a>Long read overlap
|
||||
```sh
|
||||
# For pacbio reads:
|
||||
minimap2 -x ava-pb ecoli_p6_25x_canu.fa ecoli_p6_25x_canu.fa > overlap.paf
|
||||
# For Nanopore reads (ava-ont also works with PacBio but not as good):
|
||||
minimap2 -x ava-ont -r 10000 ecoli_p6_25x_canu.fa ecoli_p6_25x_canu.fa > overlap.paf
|
||||
# If you have miniasm installed:
|
||||
miniasm -f ecoli_p6_25x_canu.fa overlap.paf > asm.gfa
|
||||
```
|
||||
Here we explicitly applied `-r 10000`. We are considering to set this as the
|
||||
default for the `ava-ont` mode as this seems to improve the contiguity for
|
||||
nanopore read assembly (Loman, personal communication).
|
||||
|
||||
*Minimap2 doesn't work well with short-read overlap.*
|
||||
|
||||
### <a name="ov-eval"></a>Evaluating overlap sensitivity (for developers)
|
||||
|
||||
```sh
|
||||
# read to reference mapping
|
||||
minimap2 -cx map-pb ecoli_ref.fa ecoli_p6_25x_canu.fa > to-ref.paf
|
||||
# evaluate overlap sensitivity
|
||||
sort -k6,6 -k8,8n to-ref.paf | paftools.js ov-eval - overlap.paf
|
||||
```
|
||||
You can see that for PacBio reads, minimap2 achieves higher overlap sensitivity
|
||||
with `-x ava-pb` (99% vs 93% with `-x ava-ont`).
|
||||
|
||||
|
||||
|
||||
[pbsim]: https://github.com/pfaucon/PBSIM-PacBio-Simulator
|
||||
[mason2]: https://github.com/seqan/seqan/tree/master/apps/mason2
|
||||
[paf]: https://github.com/lh3/miniasm/blob/master/PAF.md
|
||||
[v2.10]: https://github.com/lh3/minimap2/releases/tag/v2.10
|
||||
@@ -0,0 +1,64 @@
|
||||
#include <math.h>
|
||||
#include <stdio.h>
|
||||
#include <stdlib.h>
|
||||
#include <assert.h>
|
||||
#include "mmpriv.h"
|
||||
|
||||
static inline int32_t get_for_qpos(int32_t qlen, const mm128_t *a)
|
||||
{
|
||||
int32_t x = (int32_t)a->y;
|
||||
int32_t q_span = a->y>>32 & 0xff;
|
||||
if (a->x>>63)
|
||||
x = qlen - 1 - (x + 1 - q_span); // revert the position to the forward strand of query
|
||||
return x;
|
||||
}
|
||||
|
||||
static int get_mini_idx(int qlen, const mm128_t *a, int32_t n, const uint64_t *mini_pos)
|
||||
{
|
||||
int32_t x, L = 0, R = n - 1;
|
||||
x = get_for_qpos(qlen, a);
|
||||
while (L <= R) { // binary search
|
||||
int32_t m = ((uint64_t)L + R) >> 1;
|
||||
int32_t y = (int32_t)mini_pos[m];
|
||||
if (y < x) L = m + 1;
|
||||
else if (y > x) R = m - 1;
|
||||
else return m;
|
||||
}
|
||||
return -1;
|
||||
}
|
||||
|
||||
void mm_est_err(const mm_idx_t *mi, int qlen, int n_regs, mm_reg1_t *regs, const mm128_t *a, int32_t n, const uint64_t *mini_pos)
|
||||
{
|
||||
int i;
|
||||
uint64_t sum_k = 0;
|
||||
float avg_k;
|
||||
|
||||
if (n == 0) return;
|
||||
for (i = 0; i < n; ++i)
|
||||
sum_k += mini_pos[i] >> 32 & 0xff;
|
||||
avg_k = (float)sum_k / n;
|
||||
|
||||
for (i = 0; i < n_regs; ++i) {
|
||||
mm_reg1_t *r = ®s[i];
|
||||
int32_t st, en, j, k, n_match, n_tot, l_ref;
|
||||
r->div = -1.0f;
|
||||
if (r->cnt == 0) continue;
|
||||
st = en = get_mini_idx(qlen, r->rev? &a[r->as + r->cnt - 1] : &a[r->as], n, mini_pos);
|
||||
if (st < 0) {
|
||||
if (mm_verbose >= 2)
|
||||
fprintf(stderr, "[WARNING] logic inconsistency in mm_est_err(). Please contact the developer.\n");
|
||||
continue;
|
||||
}
|
||||
l_ref = mi->seq[r->rid].len;
|
||||
for (k = 1, j = st + 1, n_match = 1; j < n && k < r->cnt; ++j) {
|
||||
int32_t x;
|
||||
x = get_for_qpos(qlen, r->rev? &a[r->as + r->cnt - 1 - k] : &a[r->as + k]);
|
||||
if (x == (int32_t)mini_pos[j])
|
||||
++k, en = j, ++n_match;
|
||||
}
|
||||
n_tot = en - st + 1;
|
||||
if (r->qs > avg_k && r->rs > avg_k) ++n_tot;
|
||||
if (qlen - r->qs > avg_k && l_ref - r->re > avg_k) ++n_tot;
|
||||
r->div = n_match >= n_tot? 0.0f : (float)(1.0 - pow((double)n_match / n_tot, 1.0 / avg_k));
|
||||
}
|
||||
}
|
||||
@@ -35,6 +35,8 @@ int main(int argc, char *argv[])
|
||||
while ((mi = mm_idx_reader_read(r, n_threads)) != 0) { // traverse each part of the index
|
||||
mm_mapopt_update(&mopt, mi); // this sets the maximum minimizer occurrence; TODO: set a better default in mm_mapopt_init()!
|
||||
mm_tbuf_t *tbuf = mm_tbuf_init(); // thread buffer; for multi-threading, allocate one tbuf for each thread
|
||||
gzrewind(f);
|
||||
kseq_rewind(ks);
|
||||
while (kseq_read(ks) >= 0) { // each kseq_read() call reads one query sequence
|
||||
mm_reg1_t *reg;
|
||||
int j, i, n_reg;
|
||||
@@ -45,7 +47,7 @@ int main(int argc, char *argv[])
|
||||
printf("%s\t%d\t%d\t%d\t%c\t", ks->name.s, ks->seq.l, r->qs, r->qe, "+-"[r->rev]);
|
||||
printf("%s\t%d\t%d\t%d\t%d\t%d\t%d\tcg:Z:", mi->seq[r->rid].name, mi->seq[r->rid].len, r->rs, r->re, r->mlen, r->blen, r->mapq);
|
||||
for (i = 0; i < r->p->n_cigar; ++i) // IMPORTANT: this gives the CIGAR in the aligned regions. NO soft/hard clippings!
|
||||
printf("%d%c", r->p->cigar[i]>>4, "MIDSHN"[r->p->cigar[i]&0xf]);
|
||||
printf("%d%c", r->p->cigar[i]>>4, "MIDNSH"[r->p->cigar[i]&0xf]);
|
||||
putchar('\n');
|
||||
free(r->p);
|
||||
}
|
||||
|
||||
@@ -79,11 +79,11 @@ static char *mm_escape(char *s)
|
||||
return s;
|
||||
}
|
||||
|
||||
static void sam_write_rg_line(kstring_t *str, const char *s)
|
||||
static int sam_write_rg_line(kstring_t *str, const char *s)
|
||||
{
|
||||
char *p, *q, *r, *rg_line = 0;
|
||||
memset(mm_rg_id, 0, 256);
|
||||
if (s == 0) return;
|
||||
if (s == 0) return 0;
|
||||
if (strstr(s, "@RG") != s) {
|
||||
if (mm_verbose >= 1) fprintf(stderr, "[ERROR] the read group line is not started with @RG\n");
|
||||
goto err_set_rg;
|
||||
@@ -92,7 +92,8 @@ static void sam_write_rg_line(kstring_t *str, const char *s)
|
||||
if (mm_verbose >= 1) fprintf(stderr, "[ERROR] the read group line contained literal <tab> characters -- replace with escaped tabs: \\t\n");
|
||||
goto err_set_rg;
|
||||
}
|
||||
rg_line = strdup(s);
|
||||
rg_line = (char*)malloc(strlen(s) + 1);
|
||||
strcpy(rg_line, s);
|
||||
mm_escape(rg_line);
|
||||
if ((p = strstr(rg_line, "\tID:")) == 0) {
|
||||
if (mm_verbose >= 1) fprintf(stderr, "[ERROR] no ID within the read group line\n");
|
||||
@@ -107,20 +108,23 @@ static void sam_write_rg_line(kstring_t *str, const char *s)
|
||||
for (q = p, r = mm_rg_id; *q && *q != '\t' && *q != '\n'; ++q)
|
||||
*r++ = *q;
|
||||
mm_sprintf_lite(str, "%s\n", rg_line);
|
||||
return 0;
|
||||
|
||||
err_set_rg:
|
||||
free(rg_line);
|
||||
return -1;
|
||||
}
|
||||
|
||||
void mm_write_sam_hdr(const mm_idx_t *idx, const char *rg, const char *ver, int argc, char *argv[])
|
||||
int mm_write_sam_hdr(const mm_idx_t *idx, const char *rg, const char *ver, int argc, char *argv[])
|
||||
{
|
||||
kstring_t str = {0,0,0};
|
||||
int ret = 0;
|
||||
if (idx) {
|
||||
uint32_t i;
|
||||
for (i = 0; i < idx->n_seq; ++i)
|
||||
printf("@SQ\tSN:%s\tLN:%d\n", idx->seq[i].name, idx->seq[i].len);
|
||||
mm_sprintf_lite(&str, "@SQ\tSN:%s\tLN:%d\n", idx->seq[i].name, idx->seq[i].len);
|
||||
}
|
||||
if (rg) sam_write_rg_line(&str, rg);
|
||||
if (rg) ret = sam_write_rg_line(&str, rg);
|
||||
mm_sprintf_lite(&str, "@PG\tID:minimap2\tPN:minimap2");
|
||||
if (ver) mm_sprintf_lite(&str, "\tVN:%s", ver);
|
||||
if (argc > 1) {
|
||||
@@ -129,36 +133,19 @@ void mm_write_sam_hdr(const mm_idx_t *idx, const char *rg, const char *ver, int
|
||||
for (i = 1; i < argc; ++i)
|
||||
mm_sprintf_lite(&str, " %s", argv[i]);
|
||||
}
|
||||
mm_sprintf_lite(&str, "\n");
|
||||
fputs(str.s, stdout);
|
||||
mm_err_puts(str.s);
|
||||
free(str.s);
|
||||
return ret;
|
||||
}
|
||||
|
||||
static void write_cs(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int no_iden)
|
||||
static void write_cs_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq, const mm_reg1_t *r, char *tmp, int no_iden, int write_tag)
|
||||
{
|
||||
extern unsigned char seq_nt4_table[256];
|
||||
int i, q_off, t_off;
|
||||
uint8_t *qseq, *tseq;
|
||||
char *tmp;
|
||||
if (r->p == 0) return;
|
||||
mm_sprintf_lite(s, "\tcs:Z:");
|
||||
qseq = (uint8_t*)kmalloc(km, r->qe - r->qs);
|
||||
tseq = (uint8_t*)kmalloc(km, r->re - r->rs);
|
||||
tmp = (char*)kmalloc(km, r->re - r->rs > r->qe - r->qs? r->re - r->rs + 1 : r->qe - r->qs + 1);
|
||||
mm_idx_getseq(mi, r->rid, r->rs, r->re, tseq);
|
||||
if (!r->rev) {
|
||||
for (i = r->qs; i < r->qe; ++i)
|
||||
qseq[i - r->qs] = seq_nt4_table[(uint8_t)t->seq[i]];
|
||||
} else {
|
||||
for (i = r->qs; i < r->qe; ++i) {
|
||||
uint8_t c = seq_nt4_table[(uint8_t)t->seq[i]];
|
||||
qseq[r->qe - i - 1] = c >= 4? 4 : 3 - c;
|
||||
}
|
||||
}
|
||||
for (i = q_off = t_off = 0; i < r->p->n_cigar; ++i) {
|
||||
if (write_tag) mm_sprintf_lite(s, "\tcs:Z:");
|
||||
for (i = q_off = t_off = 0; i < (int)r->p->n_cigar; ++i) {
|
||||
int j, op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
|
||||
assert(op >= 0 && op <= 3);
|
||||
if (op == 0) {
|
||||
assert((op >= 0 && op <= 3) || op == 7 || op == 8);
|
||||
if (op == 0 || op == 7 || op == 8) { // match
|
||||
int l_tmp = 0;
|
||||
for (j = 0; j < len; ++j) {
|
||||
if (qseq[q_off + j] != tseq[t_off + j]) {
|
||||
@@ -179,17 +166,17 @@ static void write_cs(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_
|
||||
} else mm_sprintf_lite(s, ":%d", l_tmp);
|
||||
}
|
||||
q_off += len, t_off += len;
|
||||
} else if (op == 1) {
|
||||
} else if (op == 1) { // insertion to ref
|
||||
for (j = 0, tmp[len] = 0; j < len; ++j)
|
||||
tmp[j] = "acgtn"[qseq[q_off + j]];
|
||||
mm_sprintf_lite(s, "+%s", tmp);
|
||||
q_off += len;
|
||||
} else if (op == 2) {
|
||||
} else if (op == 2) { // deletion from ref
|
||||
for (j = 0, tmp[len] = 0; j < len; ++j)
|
||||
tmp[j] = "acgtn"[tseq[t_off + j]];
|
||||
mm_sprintf_lite(s, "-%s", tmp);
|
||||
t_off += len;
|
||||
} else {
|
||||
} else { // intron
|
||||
assert(len >= 2);
|
||||
mm_sprintf_lite(s, "~%c%c%d%c%c", "acgtn"[tseq[t_off]], "acgtn"[tseq[t_off+1]],
|
||||
len, "acgtn"[tseq[t_off+len-2]], "acgtn"[tseq[t_off+len-1]]);
|
||||
@@ -197,13 +184,104 @@ static void write_cs(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_
|
||||
}
|
||||
}
|
||||
assert(t_off == r->re - r->rs && q_off == r->qe - r->qs);
|
||||
}
|
||||
|
||||
static void write_MD_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq, const mm_reg1_t *r, char *tmp, int write_tag)
|
||||
{
|
||||
int i, q_off, t_off, l_MD = 0;
|
||||
if (write_tag) mm_sprintf_lite(s, "\tMD:Z:");
|
||||
for (i = q_off = t_off = 0; i < (int)r->p->n_cigar; ++i) {
|
||||
int j, op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
|
||||
assert((op >= 0 && op <= 3) || op == 7 || op == 8);
|
||||
if (op == 0 || op == 7 || op == 8) { // match
|
||||
for (j = 0; j < len; ++j) {
|
||||
if (qseq[q_off + j] != tseq[t_off + j]) {
|
||||
mm_sprintf_lite(s, "%d%c", l_MD, "ACGTN"[tseq[t_off + j]]);
|
||||
l_MD = 0;
|
||||
} else ++l_MD;
|
||||
}
|
||||
q_off += len, t_off += len;
|
||||
} else if (op == 1) { // insertion to ref
|
||||
q_off += len;
|
||||
} else if (op == 2) { // deletion from ref
|
||||
for (j = 0, tmp[len] = 0; j < len; ++j)
|
||||
tmp[j] = "ACGTN"[tseq[t_off + j]];
|
||||
mm_sprintf_lite(s, "%d^%s", l_MD, tmp);
|
||||
l_MD = 0;
|
||||
t_off += len;
|
||||
} else if (op == 3) { // reference skip
|
||||
t_off += len;
|
||||
}
|
||||
}
|
||||
if (l_MD > 0) mm_sprintf_lite(s, "%d", l_MD);
|
||||
assert(t_off == r->re - r->rs && q_off == r->qe - r->qs);
|
||||
}
|
||||
|
||||
static void write_cs_or_MD(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int no_iden, int is_MD, int write_tag)
|
||||
{
|
||||
extern unsigned char seq_nt4_table[256];
|
||||
int i;
|
||||
uint8_t *qseq, *tseq;
|
||||
char *tmp;
|
||||
if (r->p == 0) return;
|
||||
qseq = (uint8_t*)kmalloc(km, r->qe - r->qs);
|
||||
tseq = (uint8_t*)kmalloc(km, r->re - r->rs);
|
||||
tmp = (char*)kmalloc(km, r->re - r->rs > r->qe - r->qs? r->re - r->rs + 1 : r->qe - r->qs + 1);
|
||||
mm_idx_getseq(mi, r->rid, r->rs, r->re, tseq);
|
||||
if (!r->rev) {
|
||||
for (i = r->qs; i < r->qe; ++i)
|
||||
qseq[i - r->qs] = seq_nt4_table[(uint8_t)t->seq[i]];
|
||||
} else {
|
||||
for (i = r->qs; i < r->qe; ++i) {
|
||||
uint8_t c = seq_nt4_table[(uint8_t)t->seq[i]];
|
||||
qseq[r->qe - i - 1] = c >= 4? 4 : 3 - c;
|
||||
}
|
||||
}
|
||||
if (is_MD) write_MD_core(s, tseq, qseq, r, tmp, write_tag);
|
||||
else write_cs_core(s, tseq, qseq, r, tmp, no_iden, write_tag);
|
||||
kfree(km, qseq); kfree(km, tseq); kfree(km, tmp);
|
||||
}
|
||||
|
||||
int mm_gen_cs_or_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int is_MD, int no_iden)
|
||||
{
|
||||
mm_bseq1_t t;
|
||||
kstring_t str;
|
||||
str.s = *buf, str.l = 0, str.m = *max_len;
|
||||
t.l_seq = strlen(seq);
|
||||
t.seq = (char*)seq;
|
||||
write_cs_or_MD(km, &str, mi, &t, r, no_iden, is_MD, 0);
|
||||
*max_len = str.m;
|
||||
*buf = str.s;
|
||||
return str.l;
|
||||
}
|
||||
|
||||
int mm_gen_cs(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int no_iden)
|
||||
{
|
||||
return mm_gen_cs_or_MD(km, buf, max_len, mi, r, seq, 0, no_iden);
|
||||
}
|
||||
|
||||
int mm_gen_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq)
|
||||
{
|
||||
return mm_gen_cs_or_MD(km, buf, max_len, mi, r, seq, 1, 0);
|
||||
}
|
||||
|
||||
double mm_event_identity(const mm_reg1_t *r)
|
||||
{
|
||||
int32_t i, n_gapo = 0, n_gap = 0;
|
||||
if (r->p == 0) return -1.0f;
|
||||
for (i = 0; i < r->p->n_cigar; ++i) {
|
||||
int32_t op = r->p->cigar[i] & 0xf, len = r->p->cigar[i] >> 4;
|
||||
if (op == 1 || op == 2)
|
||||
++n_gapo, n_gap += len;
|
||||
}
|
||||
return (double)r->mlen / (r->blen + r->p->n_ambi - n_gap + n_gapo);
|
||||
}
|
||||
|
||||
static inline void write_tags(kstring_t *s, const mm_reg1_t *r)
|
||||
{
|
||||
int type = r->inv? 'I' : r->id == r->parent? 'P' : 'S';
|
||||
if (r->iden_flt) mm_sprintf_lite(s, "\tom:i:%d", r->mapq);
|
||||
int type;
|
||||
if (r->id == r->parent) type = r->inv? 'I' : 'P';
|
||||
else type = r->inv? 'i' : 'S';
|
||||
if (r->p) {
|
||||
mm_sprintf_lite(s, "\tNM:i:%d\tms:i:%d\tAS:i:%d\tnn:i:%d", r->blen - r->mlen + r->p->n_ambi, r->p->dp_max, r->p->dp_score, r->p->n_ambi);
|
||||
if (r->p->trans_strand == 1 || r->p->trans_strand == 2)
|
||||
@@ -211,12 +289,30 @@ static inline void write_tags(kstring_t *s, const mm_reg1_t *r)
|
||||
}
|
||||
mm_sprintf_lite(s, "\ttp:A:%c\tcm:i:%d\ts1:i:%d", type, r->cnt, r->score);
|
||||
if (r->parent == r->id) mm_sprintf_lite(s, "\ts2:i:%d", r->subsc);
|
||||
if (r->p) {
|
||||
char buf[16];
|
||||
double div;
|
||||
div = 1.0 - mm_event_identity(r);
|
||||
if (div == 0.0) buf[0] = '0', buf[1] = 0;
|
||||
else snprintf(buf, 16, "%.4f", 1.0 - mm_event_identity(r));
|
||||
mm_sprintf_lite(s, "\tde:f:%s", buf);
|
||||
} else if (r->div >= 0.0f && r->div <= 1.0f) {
|
||||
char buf[16];
|
||||
if (r->div == 0.0f) buf[0] = '0', buf[1] = 0;
|
||||
else snprintf(buf, 16, "%.4f", r->div);
|
||||
mm_sprintf_lite(s, "\tdv:f:%s", buf);
|
||||
}
|
||||
if (r->split) mm_sprintf_lite(s, "\tzd:i:%d", r->split);
|
||||
}
|
||||
|
||||
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int opt_flag)
|
||||
void mm_write_paf3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int opt_flag, int rep_len)
|
||||
{
|
||||
s->l = 0;
|
||||
if (r == 0) {
|
||||
mm_sprintf_lite(s, "%s\t%d\t0\t0\t*\t*\t0\t0\t0\t0\t0\t0", t->name, t->l_seq);
|
||||
if (rep_len >= 0) mm_sprintf_lite(s, "\trl:i:%d", rep_len);
|
||||
return;
|
||||
}
|
||||
mm_sprintf_lite(s, "%s\t%d\t%d\t%d\t%c\t", t->name, t->l_seq, r->qs, r->qe, "+-"[r->rev]);
|
||||
if (mi->seq[r->rid].name) mm_sprintf_lite(s, "%s", mi->seq[r->rid].name);
|
||||
else mm_sprintf_lite(s, "%d", r->rid);
|
||||
@@ -224,14 +320,22 @@ void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const m
|
||||
mm_sprintf_lite(s, "\t%d\t%d", r->mlen, r->blen);
|
||||
mm_sprintf_lite(s, "\t%d", r->mapq);
|
||||
write_tags(s, r);
|
||||
if (rep_len >= 0) mm_sprintf_lite(s, "\trl:i:%d", rep_len);
|
||||
if (r->p && (opt_flag & MM_F_OUT_CG)) {
|
||||
uint32_t k;
|
||||
mm_sprintf_lite(s, "\tcg:Z:");
|
||||
for (k = 0; k < r->p->n_cigar; ++k)
|
||||
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDN"[r->p->cigar[k]&0xf]);
|
||||
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDNSHP=XB"[r->p->cigar[k]&0xf]);
|
||||
}
|
||||
if (r->p && (opt_flag & MM_F_OUT_CS))
|
||||
write_cs(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG));
|
||||
if (r->p && (opt_flag & (MM_F_OUT_CS|MM_F_OUT_MD)))
|
||||
write_cs_or_MD(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG), opt_flag&MM_F_OUT_MD, 1);
|
||||
if ((opt_flag & MM_F_COPY_COMMENT) && t->comment)
|
||||
mm_sprintf_lite(s, "\t%s", t->comment);
|
||||
}
|
||||
|
||||
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int opt_flag)
|
||||
{
|
||||
mm_write_paf3(s, mi, t, r, km, opt_flag, -1);
|
||||
}
|
||||
|
||||
static void sam_write_sq(kstring_t *s, char *seq, int l, int rev, int comp)
|
||||
@@ -258,7 +362,7 @@ static inline const mm_reg1_t *get_sam_pri(int n_regs, const mm_reg1_t *regs)
|
||||
return NULL;
|
||||
}
|
||||
|
||||
static void write_sam_cigar(kstring_t *s, int sam_flag, int in_tag, int qlen, const mm_reg1_t *r)
|
||||
static void write_sam_cigar(kstring_t *s, int sam_flag, int in_tag, int qlen, const mm_reg1_t *r, int opt_flag)
|
||||
{
|
||||
if (r->p == 0) {
|
||||
mm_sprintf_lite(s, "*");
|
||||
@@ -267,27 +371,28 @@ static void write_sam_cigar(kstring_t *s, int sam_flag, int in_tag, int qlen, co
|
||||
clip_len[0] = r->rev? qlen - r->qe : r->qs;
|
||||
clip_len[1] = r->rev? r->qs : qlen - r->qe;
|
||||
if (in_tag) {
|
||||
int clip_char = (sam_flag&0x800)? 5 : 4;
|
||||
int clip_char = (sam_flag&0x800) && !(opt_flag&MM_F_SOFTCLIP)? 5 : 4;
|
||||
mm_sprintf_lite(s, "\tCG:B:I");
|
||||
if (clip_len[0]) mm_sprintf_lite(s, ",%u", clip_len[0]<<4|clip_char);
|
||||
for (k = 0; k < r->p->n_cigar; ++k)
|
||||
mm_sprintf_lite(s, ",%u", r->p->cigar[k]);
|
||||
if (clip_len[1]) mm_sprintf_lite(s, ",%u", clip_len[1]<<4|clip_char);
|
||||
} else {
|
||||
int clip_char = (sam_flag&0x800)? 'H' : 'S';
|
||||
int clip_char = (sam_flag&0x800) && !(opt_flag&MM_F_SOFTCLIP)? 'H' : 'S';
|
||||
assert(clip_len[0] < qlen && clip_len[1] < qlen);
|
||||
if (clip_len[0]) mm_sprintf_lite(s, "%d%c", clip_len[0], clip_char);
|
||||
for (k = 0; k < r->p->n_cigar; ++k)
|
||||
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDN"[r->p->cigar[k]&0xf]);
|
||||
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDNSHP=XB"[r->p->cigar[k]&0xf]);
|
||||
if (clip_len[1]) mm_sprintf_lite(s, "%d%c", clip_len[1], clip_char);
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regss, const mm_reg1_t *const* regss, void *km, int opt_flag)
|
||||
void mm_write_sam3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regss, const mm_reg1_t *const* regss, void *km, int opt_flag, int rep_len)
|
||||
{
|
||||
const int max_bam_cigar_op = 65535;
|
||||
int flag, n_regs = n_regss[seg_idx], cigar_in_tag = 0;
|
||||
int this_rid = -1, this_pos = -1, this_rev = 0;
|
||||
int this_rid = -1, this_pos = -1;
|
||||
const mm_reg1_t *regs = regss[seg_idx], *r_prev = NULL, *r_next;
|
||||
const mm_reg1_t *r = n_regs > 0 && reg_idx < n_regs && reg_idx >= 0? ®s[reg_idx] : NULL;
|
||||
|
||||
@@ -336,9 +441,8 @@ void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
|
||||
mm_sprintf_lite(s, "\t%s\t%d\t0\t*", mi->seq[this_rid].name, this_pos+1);
|
||||
} else mm_sprintf_lite(s, "\t*\t0\t0\t*");
|
||||
} else {
|
||||
int mapq = !r->iden_flt? r->mapq : r->mapq < 3? r->mapq : 3;
|
||||
this_rid = r->rid, this_pos = r->rs, this_rev = r->rev;
|
||||
mm_sprintf_lite(s, "\t%s\t%d\t%d\t", mi->seq[r->rid].name, r->rs+1, mapq);
|
||||
this_rid = r->rid, this_pos = r->rs;
|
||||
mm_sprintf_lite(s, "\t%s\t%d\t%d\t", mi->seq[r->rid].name, r->rs+1, r->mapq);
|
||||
if ((opt_flag & MM_F_LONG_CIGAR) && r->p && r->p->n_cigar > max_bam_cigar_op - 2) {
|
||||
int n_cigar = r->p->n_cigar;
|
||||
if (r->qs != 0) ++n_cigar;
|
||||
@@ -346,8 +450,13 @@ void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
|
||||
if (n_cigar > max_bam_cigar_op)
|
||||
cigar_in_tag = 1;
|
||||
}
|
||||
if (cigar_in_tag) mm_sprintf_lite(s, "%dS", t->l_seq);
|
||||
else write_sam_cigar(s, flag, 0, t->l_seq, r);
|
||||
if (cigar_in_tag) {
|
||||
int slen;
|
||||
if ((flag & 0x900) == 0 || (opt_flag & MM_F_SOFTCLIP)) slen = t->l_seq;
|
||||
else if (flag & 0x100) slen = 0;
|
||||
else slen = r->qe - r->qs;
|
||||
mm_sprintf_lite(s, "%dS%dN", slen, r->re - r->rs);
|
||||
} else write_sam_cigar(s, flag, 0, t->l_seq, r, opt_flag);
|
||||
}
|
||||
|
||||
// write mate positions
|
||||
@@ -355,17 +464,17 @@ void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
|
||||
int tlen = 0;
|
||||
if (this_rid >= 0 && r_next) {
|
||||
if (this_rid == r_next->rid) {
|
||||
int this_pos5 = r && r->rev? r->re - 1 : this_pos;
|
||||
int next_pos5 = r_next->rev? r_next->re - 1 : r_next->rs;
|
||||
tlen = next_pos5 - this_pos5;
|
||||
if (r) {
|
||||
int this_pos5 = r->rev? r->re - 1 : this_pos;
|
||||
int next_pos5 = r_next->rev? r_next->re - 1 : r_next->rs;
|
||||
tlen = next_pos5 - this_pos5;
|
||||
}
|
||||
mm_sprintf_lite(s, "\t=\t");
|
||||
} else mm_sprintf_lite(s, "\t%s\t", mi->seq[r_next->rid].name);
|
||||
mm_sprintf_lite(s, "%d\t", r_next->rs + 1);
|
||||
} else if (r_next) { // && this_rid < 0
|
||||
mm_sprintf_lite(s, "\t%s\t%d\t", mi->seq[r_next->rid].name, r_next->rs + 1);
|
||||
} else if (this_rid >= 0) { // && r_next == NULL
|
||||
int this_pos5 = this_rev? r->re - 1 : this_pos; // this_rev is only true when r != NULL
|
||||
tlen = this_pos - this_pos5; // next_pos5 will be this_pos
|
||||
mm_sprintf_lite(s, "\t=\t%d\t", this_pos + 1); // next segment will take r's coordinate
|
||||
} else mm_sprintf_lite(s, "\t*\t0\t"); // neither has coordinates
|
||||
if (tlen > 0) ++tlen;
|
||||
@@ -380,7 +489,7 @@ void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
|
||||
if (t->qual) sam_write_sq(s, t->qual, t->l_seq, 0, 0);
|
||||
else mm_sprintf_lite(s, "*");
|
||||
} else {
|
||||
if ((flag & 0x900) == 0) {
|
||||
if ((flag & 0x900) == 0 || (opt_flag & MM_F_SOFTCLIP)) {
|
||||
sam_write_sq(s, t->seq, t->l_seq, r->rev, r->rev);
|
||||
mm_sprintf_lite(s, "\t");
|
||||
if (t->qual) sam_write_sq(s, t->qual, t->l_seq, r->rev, 0);
|
||||
@@ -425,15 +534,24 @@ void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
|
||||
}
|
||||
}
|
||||
}
|
||||
if (r->p && (opt_flag & MM_F_OUT_CS))
|
||||
write_cs(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG));
|
||||
if (r->p && (opt_flag & (MM_F_OUT_CS|MM_F_OUT_MD)))
|
||||
write_cs_or_MD(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG), opt_flag&MM_F_OUT_MD, 1);
|
||||
if (cigar_in_tag)
|
||||
write_sam_cigar(s, flag, 1, t->l_seq, r);
|
||||
write_sam_cigar(s, flag, 1, t->l_seq, r, opt_flag);
|
||||
}
|
||||
if (rep_len >= 0) mm_sprintf_lite(s, "\trl:i:%d", rep_len);
|
||||
|
||||
if ((opt_flag & MM_F_COPY_COMMENT) && t->comment)
|
||||
mm_sprintf_lite(s, "\t%s", t->comment);
|
||||
|
||||
s->s[s->l] = 0; // we always have room for an extra byte (see str_enlarge)
|
||||
}
|
||||
|
||||
void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regss, const mm_reg1_t *const* regss, void *km, int opt_flag)
|
||||
{
|
||||
mm_write_sam3(s, mi, t, seg_idx, reg_idx, n_seg, n_regss, regss, km, opt_flag, -1);
|
||||
}
|
||||
|
||||
void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int n_regs, const mm_reg1_t *regs)
|
||||
{
|
||||
int i;
|
||||
|
||||
@@ -1,216 +0,0 @@
|
||||
#include <stddef.h>
|
||||
#include <stdio.h>
|
||||
#include <string.h>
|
||||
#include "getopt.h"
|
||||
|
||||
char *optarg;
|
||||
int optind=1, opterr=1, optopt, __optpos, optreset=0;
|
||||
|
||||
#define optpos __optpos
|
||||
|
||||
static void __getopt_msg(const char *a, const char *b, const char *c, size_t l)
|
||||
{
|
||||
FILE *f = stderr;
|
||||
#if !defined(WIN32) && !defined(_WIN32)
|
||||
flockfile(f);
|
||||
#endif
|
||||
fputs(a, f);
|
||||
fwrite(b, strlen(b), 1, f);
|
||||
fwrite(c, 1, l, f);
|
||||
fputc('\n', f);
|
||||
#if !defined(WIN32) && !defined(_WIN32)
|
||||
funlockfile(f);
|
||||
#endif
|
||||
}
|
||||
|
||||
int getopt(int argc, char * const argv[], const char *optstring)
|
||||
{
|
||||
int i, c, d;
|
||||
int k, l;
|
||||
char *optchar;
|
||||
|
||||
if (!optind || optreset) {
|
||||
optreset = 0;
|
||||
__optpos = 0;
|
||||
optind = 1;
|
||||
}
|
||||
|
||||
if (optind >= argc || !argv[optind])
|
||||
return -1;
|
||||
|
||||
if (argv[optind][0] != '-') {
|
||||
if (optstring[0] == '-') {
|
||||
optarg = argv[optind++];
|
||||
return 1;
|
||||
}
|
||||
return -1;
|
||||
}
|
||||
|
||||
if (!argv[optind][1])
|
||||
return -1;
|
||||
|
||||
if (argv[optind][1] == '-' && !argv[optind][2])
|
||||
return optind++, -1;
|
||||
|
||||
if (!optpos) optpos++;
|
||||
c = argv[optind][optpos], k = 1;
|
||||
optchar = argv[optind]+optpos;
|
||||
optopt = c;
|
||||
optpos += k;
|
||||
|
||||
if (!argv[optind][optpos]) {
|
||||
optind++;
|
||||
optpos = 0;
|
||||
}
|
||||
|
||||
if (optstring[0] == '-' || optstring[0] == '+')
|
||||
optstring++;
|
||||
|
||||
i = 0;
|
||||
d = 0;
|
||||
do {
|
||||
d = optstring[i], l = 1;
|
||||
if (l>0) i+=l; else i++;
|
||||
} while (l && d != c);
|
||||
|
||||
if (d != c) {
|
||||
if (optstring[0] != ':' && opterr)
|
||||
__getopt_msg(argv[0], ": unrecognized option: ", optchar, k);
|
||||
return '?';
|
||||
}
|
||||
if (optstring[i] == ':') {
|
||||
if (optstring[i+1] == ':') optarg = 0;
|
||||
else if (optind >= argc) {
|
||||
if (optstring[0] == ':') return ':';
|
||||
if (opterr) __getopt_msg(argv[0],
|
||||
": option requires an argument: ",
|
||||
optchar, k);
|
||||
return '?';
|
||||
}
|
||||
if (optstring[i+1] != ':' || optpos) {
|
||||
optarg = argv[optind++] + optpos;
|
||||
optpos = 0;
|
||||
}
|
||||
}
|
||||
return c;
|
||||
}
|
||||
|
||||
static void permute(char *const *argv, int dest, int src)
|
||||
{
|
||||
char **av = (char **)argv;
|
||||
char *tmp = av[src];
|
||||
int i;
|
||||
for (i=src; i>dest; i--)
|
||||
av[i] = av[i-1];
|
||||
av[dest] = tmp;
|
||||
}
|
||||
|
||||
static int __getopt_long_core(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx, int longonly)
|
||||
{
|
||||
optarg = 0;
|
||||
if (longopts && argv[optind][0] == '-' &&
|
||||
((longonly && argv[optind][1] && argv[optind][1] != '-') ||
|
||||
(argv[optind][1] == '-' && argv[optind][2])))
|
||||
{
|
||||
int colon = optstring[optstring[0]=='+'||optstring[0]=='-']==':';
|
||||
int i, cnt, match = -1;
|
||||
char *opt;
|
||||
for (cnt=i=0; longopts[i].name; i++) {
|
||||
const char *name = longopts[i].name;
|
||||
opt = argv[optind]+1;
|
||||
if (*opt == '-') opt++;
|
||||
for (; *name && *name == *opt; name++, opt++);
|
||||
if (*opt && *opt != '=') continue;
|
||||
match = i;
|
||||
if (!*name) {
|
||||
cnt = 1;
|
||||
break;
|
||||
}
|
||||
cnt++;
|
||||
}
|
||||
if (cnt==1) {
|
||||
i = match;
|
||||
optind++;
|
||||
optopt = longopts[i].val;
|
||||
if (*opt == '=') {
|
||||
if (!longopts[i].has_arg) {
|
||||
if (colon || !opterr)
|
||||
return '?';
|
||||
__getopt_msg(argv[0],
|
||||
": option does not take an argument: ",
|
||||
longopts[i].name,
|
||||
strlen(longopts[i].name));
|
||||
return '?';
|
||||
}
|
||||
optarg = opt+1;
|
||||
} else if (longopts[i].has_arg == required_argument) {
|
||||
if (!(optarg = argv[optind])) {
|
||||
if (colon) return ':';
|
||||
if (!opterr) return '?';
|
||||
__getopt_msg(argv[0],
|
||||
": option requires an argument: ",
|
||||
longopts[i].name,
|
||||
strlen(longopts[i].name));
|
||||
return '?';
|
||||
}
|
||||
optind++;
|
||||
}
|
||||
if (idx) *idx = i;
|
||||
if (longopts[i].flag) {
|
||||
*longopts[i].flag = longopts[i].val;
|
||||
return 0;
|
||||
}
|
||||
return longopts[i].val;
|
||||
}
|
||||
if (argv[optind][1] == '-') {
|
||||
if (!colon && opterr)
|
||||
__getopt_msg(argv[0], cnt ?
|
||||
": option is ambiguous: " :
|
||||
": unrecognized option: ",
|
||||
argv[optind]+2,
|
||||
strlen(argv[optind]+2));
|
||||
optind++;
|
||||
return '?';
|
||||
}
|
||||
}
|
||||
return getopt(argc, argv, optstring);
|
||||
}
|
||||
|
||||
static int __getopt_long(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx, int longonly)
|
||||
{
|
||||
int ret, skipped, resumed;
|
||||
if (!optind || optreset) {
|
||||
optreset = 0;
|
||||
__optpos = 0;
|
||||
optind = 1;
|
||||
}
|
||||
if (optind >= argc || !argv[optind]) return -1;
|
||||
skipped = optind;
|
||||
if (optstring[0] != '+' && optstring[0] != '-') {
|
||||
int i;
|
||||
for (i=optind; ; i++) {
|
||||
if (i >= argc || !argv[i]) return -1;
|
||||
if (argv[i][0] == '-' && argv[i][1]) break;
|
||||
}
|
||||
optind = i;
|
||||
}
|
||||
resumed = optind;
|
||||
ret = __getopt_long_core(argc, argv, optstring, longopts, idx, longonly);
|
||||
if (resumed > skipped) {
|
||||
int i, cnt = optind-resumed;
|
||||
for (i=0; i<cnt; i++)
|
||||
permute(argv, skipped, optind-1);
|
||||
optind = skipped + cnt;
|
||||
}
|
||||
return ret;
|
||||
}
|
||||
|
||||
int getopt_long(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx)
|
||||
{
|
||||
return __getopt_long(argc, argv, optstring, longopts, idx, 0);
|
||||
}
|
||||
|
||||
int getopt_long_only(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx)
|
||||
{
|
||||
return __getopt_long(argc, argv, optstring, longopts, idx, 1);
|
||||
}
|
||||
@@ -1,53 +0,0 @@
|
||||
/*
|
||||
Copyright 2005-2014 Rich Felker, et al.
|
||||
|
||||
Permission is hereby granted, free of charge, to any person obtaining
|
||||
a copy of this software and associated documentation files (the
|
||||
"Software"), to deal in the Software without restriction, including
|
||||
without limitation the rights to use, copy, modify, merge, publish,
|
||||
distribute, sublicense, and/or sell copies of the Software, and to
|
||||
permit persons to whom the Software is furnished to do so, subject to
|
||||
the following conditions:
|
||||
|
||||
The above copyright notice and this permission notice shall be
|
||||
included in all copies or substantial portions of the Software.
|
||||
|
||||
THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
|
||||
EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
|
||||
MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT.
|
||||
IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY
|
||||
CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT,
|
||||
TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE
|
||||
SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
|
||||
*/
|
||||
|
||||
#ifndef _GETOPT_H
|
||||
#define _GETOPT_H
|
||||
|
||||
#ifdef __cplusplus
|
||||
extern "C" {
|
||||
#endif
|
||||
|
||||
int getopt(int, char * const [], const char *);
|
||||
extern char *optarg;
|
||||
extern int optind, opterr, optopt, optreset;
|
||||
|
||||
struct option {
|
||||
const char *name;
|
||||
int has_arg;
|
||||
int *flag;
|
||||
int val;
|
||||
};
|
||||
|
||||
int getopt_long(int, char *const *, const char *, const struct option *, int *);
|
||||
int getopt_long_only(int, char *const *, const char *, const struct option *, int *);
|
||||
|
||||
#define no_argument 0
|
||||
#define required_argument 1
|
||||
#define optional_argument 2
|
||||
|
||||
#ifdef __cplusplus
|
||||
}
|
||||
#endif
|
||||
|
||||
#endif
|
||||
@@ -76,16 +76,33 @@ mm_reg1_t *mm_gen_regs(void *km, uint32_t hash, int qlen, int n_u, uint64_t *u,
|
||||
mm_reg1_t *ri = &r[i];
|
||||
ri->id = i;
|
||||
ri->parent = MM_PARENT_UNSET;
|
||||
ri->score = z[i].x >> 32;
|
||||
ri->score = ri->score0 = z[i].x >> 32;
|
||||
ri->hash = (uint32_t)z[i].x;
|
||||
ri->cnt = (int32_t)z[i].y;
|
||||
ri->as = z[i].y >> 32;
|
||||
ri->div = -1.0f;
|
||||
mm_reg_set_coor(ri, qlen, a);
|
||||
}
|
||||
kfree(km, z);
|
||||
return r;
|
||||
}
|
||||
|
||||
void mm_mark_alt(const mm_idx_t *mi, int n, mm_reg1_t *r)
|
||||
{
|
||||
int i;
|
||||
if (mi->n_alt == 0) return;
|
||||
for (i = 0; i < n; ++i)
|
||||
if (mi->seq[r[i].rid].is_alt)
|
||||
r[i].is_alt = 1;
|
||||
}
|
||||
|
||||
static inline int mm_alt_score(int score, float alt_diff_frac)
|
||||
{
|
||||
if (score < 0) return score;
|
||||
score = (int)(score * (1.0 - alt_diff_frac) + .499);
|
||||
return score > 0? score : 1;
|
||||
}
|
||||
|
||||
void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a)
|
||||
{
|
||||
if (n <= 0 || n >= r->cnt) return;
|
||||
@@ -93,6 +110,7 @@ void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a)
|
||||
r2->id = -1;
|
||||
r2->sam_pri = 0;
|
||||
r2->p = 0;
|
||||
r2->split_inv = 0;
|
||||
r2->cnt = r->cnt - n;
|
||||
r2->score = (int32_t)(r->score * ((float)r2->cnt / r->cnt) + .499);
|
||||
r2->as = r->as + n;
|
||||
@@ -104,7 +122,7 @@ void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a)
|
||||
r->split |= 1, r2->split |= 2;
|
||||
}
|
||||
|
||||
void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r, int sub_diff) // and compute mm_reg1_t::subsc
|
||||
void mm_set_parent(void *km, float mask_level, int mask_len, int n, mm_reg1_t *r, int sub_diff, int hard_mask_level, float alt_diff_frac) // and compute mm_reg1_t::subsc
|
||||
{
|
||||
int i, j, k, *w;
|
||||
uint64_t *cov;
|
||||
@@ -116,6 +134,7 @@ void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r, int sub_diff
|
||||
for (i = 1, k = 1; i < n; ++i) {
|
||||
mm_reg1_t *ri = &r[i];
|
||||
int si = ri->qs, ei = ri->qe, n_cov = 0, uncov_len = 0;
|
||||
if (hard_mask_level) goto skip_uncov;
|
||||
for (j = 0; j < k; ++j) { // traverse existing primary hits to find overlapping hits
|
||||
mm_reg1_t *rp = &r[w[j]];
|
||||
int sj = rp->qs, ej = rp->qe;
|
||||
@@ -130,25 +149,29 @@ void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r, int sub_diff
|
||||
int j, x = si;
|
||||
radix_sort_64(cov, cov + n_cov);
|
||||
for (j = 0; j < n_cov; ++j) {
|
||||
if (cov[j]>>32 > x) uncov_len += (cov[j]>>32) - x;
|
||||
if ((int)(cov[j]>>32) > x) uncov_len += (cov[j]>>32) - x;
|
||||
x = (int32_t)cov[j] > x? (int32_t)cov[j] : x;
|
||||
}
|
||||
if (ei > x) uncov_len += ei - x;
|
||||
}
|
||||
skip_uncov:
|
||||
for (j = 0; j < k; ++j) { // traverse existing primary hits again
|
||||
mm_reg1_t *rp = &r[w[j]];
|
||||
int sj = rp->qs, ej = rp->qe, min, max, ol;
|
||||
if (ej <= si || sj >= ei) continue; // no overlap
|
||||
min = ej - sj < ei - si? ej - sj : ei - si;
|
||||
max = ej - sj > ei - si? ej - sj : ei - si;
|
||||
ol = si < sj? (ei < sj? 0 : ei < ej? ei - sj : ej - sj) : (ej < si? 0 : ej < ei? ej - si : ei - si); // overlap length
|
||||
if ((float)ol / min - (float)uncov_len / max > mask_level) {
|
||||
int cnt_sub = 0;
|
||||
ol = si < sj? (ei < sj? 0 : ei < ej? ei - sj : ej - sj) : (ej < si? 0 : ej < ei? ej - si : ei - si); // overlap length; TODO: this can be simplified
|
||||
if ((float)ol / min - (float)uncov_len / max > mask_level && uncov_len <= mask_len) { // then this is a secondary hit
|
||||
int cnt_sub = 0, sci = ri->score;
|
||||
ri->parent = rp->parent;
|
||||
rp->subsc = rp->subsc > ri->score? rp->subsc : ri->score;
|
||||
if (!rp->is_alt && ri->is_alt) sci = mm_alt_score(sci, alt_diff_frac);
|
||||
rp->subsc = rp->subsc > sci? rp->subsc : sci;
|
||||
if (ri->cnt >= rp->cnt) cnt_sub = 1;
|
||||
if (rp->p && ri->p && (rp->rs != ri->rs || rp->re != ri->re || ol != min)) { // the last condition excludes identical hits after DP
|
||||
rp->p->dp_max2 = rp->p->dp_max2 > ri->p->dp_max? rp->p->dp_max2 : ri->p->dp_max;
|
||||
if (rp->p && ri->p && (rp->rid != ri->rid || rp->rs != ri->rs || rp->re != ri->re || ol != min)) { // the last condition excludes identical hits after DP
|
||||
sci = ri->p->dp_max;
|
||||
if (!rp->is_alt && ri->is_alt) sci = mm_alt_score(sci, alt_diff_frac);
|
||||
rp->p->dp_max2 = rp->p->dp_max2 > sci? rp->p->dp_max2 : sci;
|
||||
if (rp->p->dp_max - ri->p->dp_max <= sub_diff) cnt_sub = 1;
|
||||
}
|
||||
if (cnt_sub) ++rp->n_sub;
|
||||
@@ -162,9 +185,9 @@ set_parent_test:
|
||||
kfree(km, w);
|
||||
}
|
||||
|
||||
void mm_hit_sort_by_dp(void *km, int *n_regs, mm_reg1_t *r)
|
||||
void mm_hit_sort(void *km, int *n_regs, mm_reg1_t *r, float alt_diff_frac)
|
||||
{
|
||||
int32_t i, n_aux, n = *n_regs;
|
||||
int32_t i, n_aux, n = *n_regs, has_cigar = 0, no_cigar = 0;
|
||||
mm128_t *aux;
|
||||
mm_reg1_t *t;
|
||||
|
||||
@@ -173,14 +196,18 @@ void mm_hit_sort_by_dp(void *km, int *n_regs, mm_reg1_t *r)
|
||||
t = (mm_reg1_t*)kmalloc(km, n * sizeof(mm_reg1_t));
|
||||
for (i = n_aux = 0; i < n; ++i) {
|
||||
if (r[i].inv || r[i].cnt > 0) { // squeeze out elements with cnt==0 (soft deleted)
|
||||
assert(r[i].p);
|
||||
aux[n_aux].x = (uint64_t)r[i].p->dp_max << 32 | r[i].hash;
|
||||
int score;
|
||||
if (r[i].p) score = r[i].p->dp_max, has_cigar = 1;
|
||||
else score = r[i].score, no_cigar = 1;
|
||||
if (r[i].is_alt) score = mm_alt_score(score, alt_diff_frac);
|
||||
aux[n_aux].x = (uint64_t)score << 32 | r[i].hash;
|
||||
aux[n_aux++].y = i;
|
||||
} else if (r[i].p) {
|
||||
free(r[i].p);
|
||||
r[i].p = 0;
|
||||
}
|
||||
}
|
||||
assert(has_cigar + no_cigar == 1);
|
||||
radix_sort_128x(aux, aux + n_aux);
|
||||
for (i = n_aux - 1; i >= 0; --i)
|
||||
t[n_aux - 1 - i] = r[aux[i].y];
|
||||
@@ -234,7 +261,7 @@ void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int *n_,
|
||||
if (p == i || r[i].inv) { // primary or inversion
|
||||
r[k++] = r[i];
|
||||
} else if ((r[i].score >= r[p].score * pri_ratio || r[i].score + min_diff >= r[p].score) && n_2nd < best_n) {
|
||||
if (!(r[i].qs == r[p].qs && r[i].qe == r[p].qe && r[i].rs == r[p].rs && r[i].re == r[p].re)) // not identical hits
|
||||
if (!(r[i].qs == r[p].qs && r[i].qe == r[p].qe && r[i].rid == r[p].rid && r[i].rs == r[p].rs && r[i].re == r[p].re)) // not identical hits
|
||||
r[k++] = r[i], ++n_2nd;
|
||||
else if (r[i].p) free(r[i].p);
|
||||
} else if (r[i].p) free(r[i].p);
|
||||
@@ -244,16 +271,17 @@ void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int *n_,
|
||||
}
|
||||
}
|
||||
|
||||
void mm_filter_regs(void *km, const mm_mapopt_t *opt, int *n_regs, mm_reg1_t *regs)
|
||||
void mm_filter_regs(const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs)
|
||||
{ // NB: after this call, mm_reg1_t::parent can be -1 if its parent filtered out
|
||||
int i, k;
|
||||
for (i = k = 0; i < *n_regs; ++i) {
|
||||
mm_reg1_t *r = ®s[i];
|
||||
int flt = 0;
|
||||
if (!r->inv && !r->seg_split && r->cnt < opt->min_cnt) flt = 1;
|
||||
if (r->p) {
|
||||
if (r->p) { // these filters are only applied when base-alignment is available
|
||||
if (r->mlen < opt->min_chain_score) flt = 1;
|
||||
else if (r->p->dp_max < opt->min_dp_max) flt = 1;
|
||||
else if (r->qs > qlen * opt->max_clip_ratio && qlen - r->qe > qlen * opt->max_clip_ratio) flt = 1;
|
||||
if (flt) free(r->p);
|
||||
}
|
||||
if (!flt) {
|
||||
@@ -264,45 +292,6 @@ void mm_filter_regs(void *km, const mm_mapopt_t *opt, int *n_regs, mm_reg1_t *re
|
||||
*n_regs = k;
|
||||
}
|
||||
|
||||
void mm_filter_by_identity(void *km, int n_regs, mm_reg1_t *regs, float min_iden, int qlen, const char *qual) // TODO: make sure it is not beyond the ends of contigs
|
||||
{
|
||||
int i, j, n_aux = 0, en, blen = 0;
|
||||
uint64_t *aux;
|
||||
float n_diff = 0.0f;
|
||||
if (n_regs <= 0) return;
|
||||
for (i = 0; i < n_regs; ++i)
|
||||
if (regs[i].id == regs[i].parent && regs[i].pe_thru) // sequenced through the fragment; don't filter
|
||||
return;
|
||||
for (i = 0; i < n_regs; ++i)
|
||||
if (regs[i].id == regs[i].parent)
|
||||
++n_aux;
|
||||
assert(n_aux >= 1);
|
||||
aux = (uint64_t*)kmalloc(km, n_aux * 8);
|
||||
for (i = 0, n_aux = 0; i < n_regs; ++i)
|
||||
if (regs[i].id == regs[i].parent)
|
||||
aux[n_aux++] = (uint64_t)regs[i].qs<<32 | i;
|
||||
radix_sort_64(aux, aux + n_aux);
|
||||
for (i = 0, en = 0; i < n_aux; ++i) {
|
||||
mm_reg1_t *r = ®s[(int32_t)aux[i]];
|
||||
if (r->qs > en) {
|
||||
for (j = en; j < r->qs; ++j)
|
||||
n_diff += qual == 0 || qual[j] >= 53? .25f : .05f * .25f * (qual[j] - 33);
|
||||
blen += r->qs - en;
|
||||
}
|
||||
assert(r->p);
|
||||
blen += r->p->blen2;
|
||||
n_diff += r->p->n_diff2;
|
||||
en = en > r->qe? en : r->qe;
|
||||
}
|
||||
for (j = en; j < qlen; ++j)
|
||||
n_diff += qual == 0 || qual[j] >= 53? .25f : .05f * .25f * (qual[j] - 33);
|
||||
blen += qlen - en;
|
||||
kfree(km, aux);
|
||||
if (1.0f - n_diff / blen < min_iden)
|
||||
for (i = 0; i < n_regs; ++i)
|
||||
regs[i].iden_flt = 1;
|
||||
}
|
||||
|
||||
int mm_squeeze_a(void *km, int n_regs, mm_reg1_t *regs, mm128_t *a)
|
||||
{ // squeeze out regions in a[] that are not referenced by regs[]
|
||||
int i, as = 0;
|
||||
@@ -340,7 +329,7 @@ void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs_, mm_r
|
||||
for (i = n_aux - 1; i >= 1; --i) {
|
||||
mm_reg1_t *r0 = ®s[(int32_t)aux[i-1]], *r1 = ®s[(int32_t)aux[i]];
|
||||
mm128_t *a0e, *a1s;
|
||||
int max_gap, min_gap, sc_thres;
|
||||
int max_gap, min_gap, sc_thres, min_flank_len;
|
||||
|
||||
// test
|
||||
if (r0->as + r0->cnt != r1->as) continue; // not adjacent in a[]
|
||||
@@ -349,13 +338,14 @@ void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs_, mm_r
|
||||
a1s = &a[r1->as];
|
||||
if (a1s->x <= a0e->x || (int32_t)a1s->y <= (int32_t)a0e->y) continue; // keep colinearity
|
||||
max_gap = min_gap = (int32_t)a1s->y - (int32_t)a0e->y;
|
||||
max_gap = max_gap > a1s->x - a0e->x? max_gap : a1s->x - a0e->x;
|
||||
min_gap = min_gap < a1s->x - a0e->x? min_gap : a1s->x - a0e->x;
|
||||
max_gap = a0e->x + max_gap > a1s->x? max_gap : a1s->x - a0e->x;
|
||||
min_gap = a0e->x + min_gap < a1s->x? min_gap : a1s->x - a0e->x;
|
||||
if (max_gap > opt->max_join_long || min_gap > opt->max_join_short) continue;
|
||||
sc_thres = (int)((float)opt->min_join_flank_sc / opt->max_join_long * max_gap + .499);
|
||||
if (r0->score < sc_thres || r1->score < sc_thres) continue; // require good flanking chains
|
||||
if (r0->re - r0->rs < max_gap>>1 || r0->qe - r0->qs < max_gap>>1) continue; // require enough flanking length
|
||||
if (r1->re - r1->rs < max_gap>>1 || r1->qe - r1->qs < max_gap>>1) continue;
|
||||
min_flank_len = (int)(max_gap * opt->min_join_flank_ratio);
|
||||
if (r0->re - r0->rs < min_flank_len || r0->qe - r0->qs < min_flank_len) continue; // require enough flanking length
|
||||
if (r1->re - r1->rs < min_flank_len || r1->qe - r1->qs < min_flank_len) continue;
|
||||
|
||||
// all conditions satisfied; join
|
||||
a[r1->as].y |= MM_SEED_LONG_JOIN;
|
||||
@@ -375,7 +365,7 @@ void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs_, mm_r
|
||||
r->parent = regs[r->parent].parent;
|
||||
}
|
||||
}
|
||||
mm_filter_regs(km, opt, n_regs_, regs);
|
||||
mm_filter_regs(opt, qlen, n_regs_, regs);
|
||||
mm_sync_regs(km, *n_regs_, regs);
|
||||
}
|
||||
}
|
||||
@@ -428,8 +418,10 @@ mm_seg_t *mm_seg_gen(void *km, uint32_t hash, int n_segs, const int *qlens, int
|
||||
for (s = 0; s < n_segs; ++s) {
|
||||
regs[s] = mm_gen_regs(km, hash, qlens[s], seg[s].n_u, seg[s].u, seg[s].a);
|
||||
n_regs[s] = seg[s].n_u;
|
||||
for (i = 0; i < n_regs[s]; ++i)
|
||||
for (i = 0; i < n_regs[s]; ++i) {
|
||||
regs[s][i].seg_split = 1;
|
||||
regs[s][i].seg_id = s;
|
||||
}
|
||||
}
|
||||
return seg;
|
||||
}
|
||||
@@ -442,30 +434,75 @@ void mm_seg_free(void *km, int n_segs, mm_seg_t *segs)
|
||||
kfree(km, segs);
|
||||
}
|
||||
|
||||
void mm_set_mapq(int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len)
|
||||
static void mm_set_inv_mapq(void *km, int n_regs, mm_reg1_t *regs)
|
||||
{
|
||||
int i, n_aux;
|
||||
mm128_t *aux;
|
||||
if (n_regs < 3) return;
|
||||
for (i = 0; i < n_regs; ++i)
|
||||
if (regs[i].inv) break;
|
||||
if (i == n_regs) return; // no inversion hits
|
||||
|
||||
aux = (mm128_t*)kmalloc(km, n_regs * 16);
|
||||
for (i = n_aux = 0; i < n_regs; ++i)
|
||||
if (regs[i].parent == i || regs[i].parent < 0)
|
||||
aux[n_aux].y = i, aux[n_aux++].x = (uint64_t)regs[i].rid << 32 | regs[i].rs;
|
||||
radix_sort_128x(aux, aux + n_aux);
|
||||
|
||||
for (i = 1; i < n_aux - 1; ++i) {
|
||||
mm_reg1_t *inv = ®s[aux[i].y];
|
||||
if (inv->inv) {
|
||||
mm_reg1_t *l = ®s[aux[i-1].y];
|
||||
mm_reg1_t *r = ®s[aux[i+1].y];
|
||||
inv->mapq = l->mapq < r->mapq? l->mapq : r->mapq;
|
||||
}
|
||||
}
|
||||
kfree(km, aux);
|
||||
}
|
||||
|
||||
void mm_set_mapq(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr)
|
||||
{
|
||||
static const float q_coef = 40.0f;
|
||||
int64_t sum_sc = 0;
|
||||
float uniq_ratio;
|
||||
int i;
|
||||
if (n_regs == 0) return;
|
||||
for (i = 0; i < n_regs; ++i)
|
||||
if (regs[i].parent == regs[i].id)
|
||||
sum_sc += regs[i].score;
|
||||
uniq_ratio = (float)sum_sc / (sum_sc + rep_len);
|
||||
for (i = 0; i < n_regs; ++i) {
|
||||
mm_reg1_t *r = ®s[i];
|
||||
if (r->inv) {
|
||||
r->mapq = 0;
|
||||
} else if (r->parent == r->id) {
|
||||
int mapq, subsc;
|
||||
float pen_s1 = (r->score > 100? 1.0f : 0.01f * r->score) * ((float)r->score / (r->score + rep_len));
|
||||
float pen_s1 = (r->score > 100? 1.0f : 0.01f * r->score) * uniq_ratio;
|
||||
float pen_cm = r->cnt > 10? 1.0f : 0.1f * r->cnt;
|
||||
pen_cm = pen_s1 < pen_cm? pen_s1 : pen_cm;
|
||||
subsc = r->subsc > min_chain_sc? r->subsc : min_chain_sc;
|
||||
if (r->p && r->p->dp_max2 > 0 && r->p->dp_max > 0) {
|
||||
float identity = (float)r->mlen / r->blen;
|
||||
int mapq_alt = (int)(6.02f * identity * identity * (r->p->dp_max - r->p->dp_max2) / match_sc + .499f); // BWA-MEM like mapQ, mostly for short reads
|
||||
mapq = (int)(identity * pen_cm * q_coef * (1. - (float)r->p->dp_max2 * subsc / r->p->dp_max / r->score) * logf(r->score)); // more for long reads
|
||||
mapq = mapq < mapq_alt? mapq : mapq_alt; // in case the long-read heuristic fails
|
||||
} else mapq = (int)(pen_cm * q_coef * (1. - (float)subsc / r->score) * logf(r->score));
|
||||
float x = (float)r->p->dp_max2 * subsc / r->p->dp_max / r->score0;
|
||||
mapq = (int)(identity * pen_cm * q_coef * (1.0f - x * x) * logf((float)r->p->dp_max / match_sc));
|
||||
if (!is_sr) {
|
||||
int mapq_alt = (int)(6.02f * identity * identity * (r->p->dp_max - r->p->dp_max2) / match_sc + .499f); // BWA-MEM like mapQ, mostly for short reads
|
||||
mapq = mapq < mapq_alt? mapq : mapq_alt; // in case the long-read heuristic fails
|
||||
}
|
||||
} else {
|
||||
float x = (float)subsc / r->score0;
|
||||
if (r->p) {
|
||||
float identity = (float)r->mlen / r->blen;
|
||||
mapq = (int)(identity * pen_cm * q_coef * (1.0f - x) * logf((float)r->p->dp_max / match_sc));
|
||||
} else {
|
||||
mapq = (int)(pen_cm * q_coef * (1.0f - x) * logf(r->score));
|
||||
}
|
||||
}
|
||||
mapq -= (int)(4.343f * logf(r->n_sub + 1) + .499f);
|
||||
mapq = mapq > 0? mapq : 0;
|
||||
r->mapq = mapq < 60? mapq : 60;
|
||||
if (r->p && r->p->dp_max > r->p->dp_max2 && r->mapq == 0) r->mapq = 1;
|
||||
} else r->mapq = 0;
|
||||
}
|
||||
mm_set_inv_mapq(km, n_regs, regs);
|
||||
}
|
||||
|
||||
@@ -7,6 +7,7 @@
|
||||
#endif
|
||||
#include <fcntl.h>
|
||||
#include <stdio.h>
|
||||
#define __STDC_LIMIT_MACROS
|
||||
#include "kthread.h"
|
||||
#include "bseq.h"
|
||||
#include "minimap.h"
|
||||
@@ -19,6 +20,8 @@
|
||||
KHASH_INIT(idx, uint64_t, uint64_t, 1, idx_hash, idx_eq)
|
||||
typedef khash_t(idx) idxhash_t;
|
||||
|
||||
KHASH_MAP_INIT_STR(str, uint32_t)
|
||||
|
||||
#define kroundup64(x) (--(x), (x)|=(x)>>1, (x)|=(x)>>2, (x)|=(x)>>4, (x)|=(x)>>8, (x)|=(x)>>16, (x)|=(x)>>32, ++(x))
|
||||
|
||||
typedef struct mm_idx_bucket_s {
|
||||
@@ -28,22 +31,23 @@ typedef struct mm_idx_bucket_s {
|
||||
void *h; // hash table indexing _p_ and minimizers appearing once
|
||||
} mm_idx_bucket_t;
|
||||
|
||||
void mm_idxopt_init(mm_idxopt_t *opt)
|
||||
{
|
||||
memset(opt, 0, sizeof(mm_idxopt_t));
|
||||
opt->k = 15, opt->w = 10, opt->is_hpc = 0;
|
||||
opt->bucket_bits = 14;
|
||||
opt->mini_batch_size = 50000000;
|
||||
opt->batch_size = 4000000000ULL;
|
||||
}
|
||||
typedef struct {
|
||||
int32_t st, en, max; // max is not used for now
|
||||
int32_t score:30, strand:2;
|
||||
} mm_idx_intv1_t;
|
||||
|
||||
mm_idx_t *mm_idx_init(int w, int k, int b, int is_hpc)
|
||||
typedef struct mm_idx_intv_s {
|
||||
int32_t n, m;
|
||||
mm_idx_intv1_t *a;
|
||||
} mm_idx_intv_t;
|
||||
|
||||
mm_idx_t *mm_idx_init(int w, int k, int b, int flag)
|
||||
{
|
||||
mm_idx_t *mi;
|
||||
if (k*2 < b) b = k * 2;
|
||||
if (w < 1) w = 1;
|
||||
mi = (mm_idx_t*)calloc(1, sizeof(mm_idx_t));
|
||||
mi->w = w, mi->k = k, mi->b = b, mi->is_hpc = is_hpc;
|
||||
mi->w = w, mi->k = k, mi->b = b, mi->flag = flag;
|
||||
mi->B = (mm_idx_bucket_t*)calloc(1<<b, sizeof(mm_idx_bucket_t));
|
||||
if (!(mm_dbg_flag & 1)) mi->km = km_init();
|
||||
return mi;
|
||||
@@ -51,12 +55,20 @@ mm_idx_t *mm_idx_init(int w, int k, int b, int is_hpc)
|
||||
|
||||
void mm_idx_destroy(mm_idx_t *mi)
|
||||
{
|
||||
int i;
|
||||
uint32_t i;
|
||||
if (mi == 0) return;
|
||||
for (i = 0; i < 1<<mi->b; ++i) {
|
||||
free(mi->B[i].p);
|
||||
free(mi->B[i].a.a);
|
||||
kh_destroy(idx, (idxhash_t*)mi->B[i].h);
|
||||
if (mi->h) kh_destroy(str, (khash_t(str)*)mi->h);
|
||||
if (mi->B) {
|
||||
for (i = 0; i < 1U<<mi->b; ++i) {
|
||||
free(mi->B[i].p);
|
||||
free(mi->B[i].a.a);
|
||||
kh_destroy(idx, (idxhash_t*)mi->B[i].h);
|
||||
}
|
||||
}
|
||||
if (mi->I) {
|
||||
for (i = 0; i < mi->n_seq; ++i)
|
||||
free(mi->I[i].a);
|
||||
free(mi->I);
|
||||
}
|
||||
if (!mi->km) {
|
||||
for (i = 0; i < mi->n_seq; ++i)
|
||||
@@ -87,14 +99,15 @@ const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n)
|
||||
|
||||
void mm_idx_stat(const mm_idx_t *mi)
|
||||
{
|
||||
int i, n = 0, n1 = 0;
|
||||
int n = 0, n1 = 0;
|
||||
uint32_t i;
|
||||
uint64_t sum = 0, len = 0;
|
||||
fprintf(stderr, "[M::%s] kmer size: %d; skip: %d; is_HPC: %d; #seq: %d\n", __func__, mi->k, mi->w, mi->is_hpc, mi->n_seq);
|
||||
fprintf(stderr, "[M::%s] kmer size: %d; skip: %d; is_hpc: %d; #seq: %d\n", __func__, mi->k, mi->w, mi->flag&MM_I_HPC, mi->n_seq);
|
||||
for (i = 0; i < mi->n_seq; ++i)
|
||||
len += mi->seq[i].len;
|
||||
for (i = 0; i < 1<<mi->b; ++i)
|
||||
for (i = 0; i < 1U<<mi->b; ++i)
|
||||
if (mi->B[i].h) n += kh_size((idxhash_t*)mi->B[i].h);
|
||||
for (i = 0; i < 1<<mi->b; ++i) {
|
||||
for (i = 0; i < 1U<<mi->b; ++i) {
|
||||
idxhash_t *h = (idxhash_t*)mi->B[i].h;
|
||||
khint_t k;
|
||||
if (h == 0) continue;
|
||||
@@ -104,8 +117,36 @@ void mm_idx_stat(const mm_idx_t *mi)
|
||||
if (kh_key(h, k)&1) ++n1;
|
||||
}
|
||||
}
|
||||
fprintf(stderr, "[M::%s::%.3f*%.2f] distinct minimizers: %d (%.2f%% are singletons); average occurrences: %.3lf; average spacing: %.3lf\n",
|
||||
__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), n, 100.0*n1/n, (double)sum / n, (double)len / sum);
|
||||
fprintf(stderr, "[M::%s::%.3f*%.2f] distinct minimizers: %d (%.2f%% are singletons); average occurrences: %.3lf; average spacing: %.3lf; total length: %ld\n",
|
||||
__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), n, 100.0*n1/n, (double)sum / n, (double)len / sum, (long)len);
|
||||
}
|
||||
|
||||
int mm_idx_index_name(mm_idx_t *mi)
|
||||
{
|
||||
khash_t(str) *h;
|
||||
uint32_t i;
|
||||
int has_dup = 0, absent;
|
||||
if (mi->h) return 0;
|
||||
h = kh_init(str);
|
||||
for (i = 0; i < mi->n_seq; ++i) {
|
||||
khint_t k;
|
||||
k = kh_put(str, h, mi->seq[i].name, &absent);
|
||||
if (absent) kh_val(h, k) = i;
|
||||
else has_dup = 1;
|
||||
}
|
||||
mi->h = h;
|
||||
if (has_dup && mm_verbose >= 2)
|
||||
fprintf(stderr, "[WARNING] some database sequences have identical sequence names\n");
|
||||
return has_dup;
|
||||
}
|
||||
|
||||
int mm_idx_name2id(const mm_idx_t *mi, const char *name)
|
||||
{
|
||||
khash_t(str) *h = (khash_t(str)*)mi->h;
|
||||
khint_t k;
|
||||
if (h == 0) return -2;
|
||||
k = kh_get(str, h, name);
|
||||
return k == kh_end(h)? -1 : kh_val(h, k);
|
||||
}
|
||||
|
||||
int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq)
|
||||
@@ -149,7 +190,8 @@ int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f)
|
||||
|
||||
static void worker_post(void *g, long i, int tid)
|
||||
{
|
||||
int j, start_a, start_p, n, n_keys;
|
||||
int n, n_keys;
|
||||
size_t j, start_a, start_p;
|
||||
idxhash_t *h;
|
||||
mm_idx_t *mi = (mm_idx_t*)g;
|
||||
mm_idx_bucket_t *b = &mi->B[i];
|
||||
@@ -177,7 +219,7 @@ static void worker_post(void *g, long i, int tid)
|
||||
int absent;
|
||||
mm128_t *p = &b->a.a[j-1];
|
||||
itr = kh_put(idx, h, p->x>>8>>mi->b<<1, &absent);
|
||||
assert(absent && j - start_a == n);
|
||||
assert(absent && j == start_a + n);
|
||||
if (n == 1) {
|
||||
kh_key(h, itr) |= 1;
|
||||
kh_val(h, itr) = p->y;
|
||||
@@ -193,7 +235,7 @@ static void worker_post(void *g, long i, int tid)
|
||||
} else ++n;
|
||||
}
|
||||
b->h = h;
|
||||
assert(b->n == start_p);
|
||||
assert(b->n == (int32_t)start_p);
|
||||
|
||||
// deallocate and clear b->a
|
||||
kfree(0, b->a.a);
|
||||
@@ -214,7 +256,7 @@ static void mm_idx_post(mm_idx_t *mi, int n_threads)
|
||||
#include "bseq.h"
|
||||
|
||||
typedef struct {
|
||||
int mini_batch_size, keep_name;
|
||||
int mini_batch_size;
|
||||
uint64_t batch_size, sum_len;
|
||||
mm_bseq_file_t *fp;
|
||||
mm_idx_t *mi;
|
||||
@@ -246,7 +288,6 @@ static void *worker_pipeline(void *shared, int step, void *in)
|
||||
s->seq = mm_bseq_read(p->fp, p->mini_batch_size, 0, &s->n_seq); // read a mini-batch
|
||||
if (s->seq) {
|
||||
uint32_t old_m, m;
|
||||
uint64_t sum_len, old_max_len, max_len;
|
||||
assert((uint64_t)p->mi->n_seq + s->n_seq <= UINT32_MAX); // to prevent integer overflow
|
||||
// make room for p->mi->seq
|
||||
old_m = p->mi->n_seq, m = p->mi->n_seq + s->n_seq;
|
||||
@@ -254,30 +295,35 @@ static void *worker_pipeline(void *shared, int step, void *in)
|
||||
if (old_m != m)
|
||||
p->mi->seq = (mm_idx_seq_t*)krealloc(p->mi->km, p->mi->seq, m * sizeof(mm_idx_seq_t));
|
||||
// make room for p->mi->S
|
||||
for (i = 0, sum_len = 0; i < s->n_seq; ++i) sum_len += s->seq[i].l_seq;
|
||||
old_max_len = (p->sum_len + 7) / 8;
|
||||
max_len = (p->sum_len + sum_len + 7) / 8;
|
||||
kroundup64(old_max_len); kroundup64(max_len);
|
||||
if (old_max_len != max_len) {
|
||||
p->mi->S = (uint32_t*)realloc(p->mi->S, max_len * 4);
|
||||
memset(&p->mi->S[old_max_len], 0, 4 * (max_len - old_max_len));
|
||||
if (!(p->mi->flag & MM_I_NO_SEQ)) {
|
||||
uint64_t sum_len, old_max_len, max_len;
|
||||
for (i = 0, sum_len = 0; i < s->n_seq; ++i) sum_len += s->seq[i].l_seq;
|
||||
old_max_len = (p->sum_len + 7) / 8;
|
||||
max_len = (p->sum_len + sum_len + 7) / 8;
|
||||
kroundup64(old_max_len); kroundup64(max_len);
|
||||
if (old_max_len != max_len) {
|
||||
p->mi->S = (uint32_t*)realloc(p->mi->S, max_len * 4);
|
||||
memset(&p->mi->S[old_max_len], 0, 4 * (max_len - old_max_len));
|
||||
}
|
||||
}
|
||||
// populate p->mi->seq
|
||||
for (i = 0; i < s->n_seq; ++i) {
|
||||
mm_idx_seq_t *seq = &p->mi->seq[p->mi->n_seq];
|
||||
uint32_t j;
|
||||
if (p->keep_name) {
|
||||
assert(strlen(s->seq[i].name) <= 254); // a long query name breaks BAM
|
||||
if (!(p->mi->flag & MM_I_NO_NAME)) {
|
||||
seq->name = (char*)kmalloc(p->mi->km, strlen(s->seq[i].name) + 1);
|
||||
strcpy(seq->name, s->seq[i].name);
|
||||
} else seq->name = 0;
|
||||
seq->len = s->seq[i].l_seq;
|
||||
seq->offset = p->sum_len;
|
||||
seq->is_alt = 0;
|
||||
// copy the sequence
|
||||
for (j = 0; j < seq->len; ++j) { // TODO: this is not the fastest way, but let's first see if speed matters here
|
||||
uint64_t o = p->sum_len + j;
|
||||
int c = seq_nt4_table[(uint8_t)s->seq[i].seq[j]];
|
||||
mm_seq4_set(p->mi->S, o, c);
|
||||
if (!(p->mi->flag & MM_I_NO_SEQ)) {
|
||||
for (j = 0; j < seq->len; ++j) { // TODO: this is not the fastest way, but let's first see if speed matters here
|
||||
uint64_t o = p->sum_len + j;
|
||||
int c = seq_nt4_table[(uint8_t)s->seq[i].seq[j]];
|
||||
mm_seq4_set(p->mi->S, o, c);
|
||||
}
|
||||
}
|
||||
// update p->sum_len and p->mi->n_seq
|
||||
p->sum_len += seq->len;
|
||||
@@ -289,7 +335,10 @@ static void *worker_pipeline(void *shared, int step, void *in)
|
||||
step_t *s = (step_t*)in;
|
||||
for (i = 0; i < s->n_seq; ++i) {
|
||||
mm_bseq1_t *t = &s->seq[i];
|
||||
mm_sketch(0, t->seq, t->l_seq, p->mi->w, p->mi->k, t->rid, p->mi->is_hpc, &s->a);
|
||||
if (t->l_seq > 0)
|
||||
mm_sketch(0, t->seq, t->l_seq, p->mi->w, p->mi->k, t->rid, p->mi->flag&MM_I_HPC, &s->a);
|
||||
else if (mm_verbose >= 2)
|
||||
fprintf(stderr, "[WARNING] the length database sequence '%s' is 0\n", t->name);
|
||||
free(t->seq); free(t->name);
|
||||
}
|
||||
free(s->seq); s->seq = 0;
|
||||
@@ -302,16 +351,15 @@ static void *worker_pipeline(void *shared, int step, void *in)
|
||||
return 0;
|
||||
}
|
||||
|
||||
mm_idx_t *mm_idx_gen(mm_bseq_file_t *fp, int w, int k, int b, int is_hpc, int mini_batch_size, int n_threads, uint64_t batch_size, int keep_name)
|
||||
mm_idx_t *mm_idx_gen(mm_bseq_file_t *fp, int w, int k, int b, int flag, int mini_batch_size, int n_threads, uint64_t batch_size)
|
||||
{
|
||||
pipeline_t pl;
|
||||
if (fp == 0 || mm_bseq_eof(fp)) return 0;
|
||||
memset(&pl, 0, sizeof(pipeline_t));
|
||||
pl.mini_batch_size = mini_batch_size < batch_size? mini_batch_size : batch_size;
|
||||
pl.keep_name = keep_name;
|
||||
pl.mini_batch_size = (uint64_t)mini_batch_size < batch_size? mini_batch_size : batch_size;
|
||||
pl.batch_size = batch_size;
|
||||
pl.fp = fp;
|
||||
pl.mi = mm_idx_init(w, k, b, is_hpc);
|
||||
pl.mi = mm_idx_init(w, k, b, flag);
|
||||
|
||||
kt_pipeline(n_threads < 3? n_threads : 3, worker_pipeline, &pl, 3);
|
||||
if (mm_verbose >= 3)
|
||||
@@ -324,17 +372,67 @@ mm_idx_t *mm_idx_gen(mm_bseq_file_t *fp, int w, int k, int b, int is_hpc, int mi
|
||||
return pl.mi;
|
||||
}
|
||||
|
||||
mm_idx_t *mm_idx_build(const char *fn, int w, int k, int is_hpc, int n_threads) // a simpler interface
|
||||
mm_idx_t *mm_idx_build(const char *fn, int w, int k, int flag, int n_threads) // a simpler interface; deprecated
|
||||
{
|
||||
mm_bseq_file_t *fp;
|
||||
mm_idx_t *mi;
|
||||
fp = mm_bseq_open(fn);
|
||||
if (fp == 0) return 0;
|
||||
mi = mm_idx_gen(fp, w, k, 14, is_hpc, 1<<18, n_threads, UINT64_MAX, 1);
|
||||
mi = mm_idx_gen(fp, w, k, 14, flag, 1<<18, n_threads, UINT64_MAX);
|
||||
mm_bseq_close(fp);
|
||||
return mi;
|
||||
}
|
||||
|
||||
mm_idx_t *mm_idx_str(int w, int k, int is_hpc, int bucket_bits, int n, const char **seq, const char **name)
|
||||
{
|
||||
uint64_t sum_len = 0;
|
||||
mm128_v a = {0,0,0};
|
||||
mm_idx_t *mi;
|
||||
khash_t(str) *h;
|
||||
int i, flag = 0;
|
||||
|
||||
if (n <= 0) return 0;
|
||||
for (i = 0; i < n; ++i) // get the total length
|
||||
sum_len += strlen(seq[i]);
|
||||
if (is_hpc) flag |= MM_I_HPC;
|
||||
if (name == 0) flag |= MM_I_NO_NAME;
|
||||
if (bucket_bits < 0) bucket_bits = 14;
|
||||
mi = mm_idx_init(w, k, bucket_bits, flag);
|
||||
mi->n_seq = n;
|
||||
mi->seq = (mm_idx_seq_t*)kcalloc(mi->km, n, sizeof(mm_idx_seq_t)); // ->seq is allocated from km
|
||||
mi->S = (uint32_t*)calloc((sum_len + 7) / 8, 4);
|
||||
mi->h = h = kh_init(str);
|
||||
for (i = 0, sum_len = 0; i < n; ++i) {
|
||||
const char *s = seq[i];
|
||||
mm_idx_seq_t *p = &mi->seq[i];
|
||||
uint32_t j;
|
||||
if (name && name[i]) {
|
||||
int absent;
|
||||
p->name = (char*)kmalloc(mi->km, strlen(name[i]) + 1);
|
||||
strcpy(p->name, name[i]);
|
||||
kh_put(str, h, p->name, &absent);
|
||||
assert(absent);
|
||||
}
|
||||
p->offset = sum_len;
|
||||
p->len = strlen(s);
|
||||
p->is_alt = 0;
|
||||
for (j = 0; j < p->len; ++j) {
|
||||
int c = seq_nt4_table[(uint8_t)s[j]];
|
||||
uint64_t o = sum_len + j;
|
||||
mm_seq4_set(mi->S, o, c);
|
||||
}
|
||||
sum_len += p->len;
|
||||
if (p->len > 0) {
|
||||
a.n = 0;
|
||||
mm_sketch(0, s, p->len, w, k, i, is_hpc, &a);
|
||||
mm_idx_add(mi, a.n, a.a);
|
||||
}
|
||||
}
|
||||
free(a.a);
|
||||
mm_idx_post(mi, 1);
|
||||
return mi;
|
||||
}
|
||||
|
||||
/*************
|
||||
* index I/O *
|
||||
*************/
|
||||
@@ -342,17 +440,20 @@ mm_idx_t *mm_idx_build(const char *fn, int w, int k, int is_hpc, int n_threads)
|
||||
void mm_idx_dump(FILE *fp, const mm_idx_t *mi)
|
||||
{
|
||||
uint64_t sum_len = 0;
|
||||
uint32_t x[5];
|
||||
int i;
|
||||
uint32_t x[5], i;
|
||||
|
||||
x[0] = mi->w, x[1] = mi->k, x[2] = mi->b, x[3] = mi->n_seq, x[4] = mi->is_hpc;
|
||||
x[0] = mi->w, x[1] = mi->k, x[2] = mi->b, x[3] = mi->n_seq, x[4] = mi->flag;
|
||||
fwrite(MM_IDX_MAGIC, 1, 4, fp);
|
||||
fwrite(x, 4, 5, fp);
|
||||
for (i = 0; i < mi->n_seq; ++i) {
|
||||
uint8_t l;
|
||||
l = strlen(mi->seq[i].name);
|
||||
fwrite(&l, 1, 1, fp);
|
||||
fwrite(mi->seq[i].name, 1, l, fp);
|
||||
if (mi->seq[i].name) {
|
||||
uint8_t l = strlen(mi->seq[i].name);
|
||||
fwrite(&l, 1, 1, fp);
|
||||
fwrite(mi->seq[i].name, 1, l, fp);
|
||||
} else {
|
||||
uint8_t l = 0;
|
||||
fwrite(&l, 1, 1, fp);
|
||||
}
|
||||
fwrite(&mi->seq[i].len, 4, 1, fp);
|
||||
sum_len += mi->seq[i].len;
|
||||
}
|
||||
@@ -372,15 +473,15 @@ void mm_idx_dump(FILE *fp, const mm_idx_t *mi)
|
||||
fwrite(x, 8, 2, fp);
|
||||
}
|
||||
}
|
||||
fwrite(mi->S, 4, (sum_len + 7) / 8, fp);
|
||||
if (!(mi->flag & MM_I_NO_SEQ))
|
||||
fwrite(mi->S, 4, (sum_len + 7) / 8, fp);
|
||||
fflush(fp);
|
||||
}
|
||||
|
||||
mm_idx_t *mm_idx_load(FILE *fp)
|
||||
{
|
||||
int i;
|
||||
char magic[4];
|
||||
uint32_t x[5];
|
||||
uint32_t x[5], i;
|
||||
uint64_t sum_len = 0;
|
||||
mm_idx_t *mi;
|
||||
|
||||
@@ -394,11 +495,14 @@ mm_idx_t *mm_idx_load(FILE *fp)
|
||||
uint8_t l;
|
||||
mm_idx_seq_t *s = &mi->seq[i];
|
||||
fread(&l, 1, 1, fp);
|
||||
s->name = (char*)kmalloc(mi->km, l + 1);
|
||||
fread(s->name, 1, l, fp);
|
||||
s->name[l] = 0;
|
||||
if (l) {
|
||||
s->name = (char*)kmalloc(mi->km, l + 1);
|
||||
fread(s->name, 1, l, fp);
|
||||
s->name[l] = 0;
|
||||
}
|
||||
fread(&s->len, 4, 1, fp);
|
||||
s->offset = sum_len;
|
||||
s->is_alt = 0;
|
||||
sum_len += s->len;
|
||||
}
|
||||
for (i = 0; i < 1<<mi->b; ++i) {
|
||||
@@ -422,22 +526,29 @@ mm_idx_t *mm_idx_load(FILE *fp)
|
||||
kh_val(h, k) = x[1];
|
||||
}
|
||||
}
|
||||
mi->S = (uint32_t*)malloc((sum_len + 7) / 8 * 4);
|
||||
fread(mi->S, 4, (sum_len + 7) / 8, fp);
|
||||
if (!(mi->flag & MM_I_NO_SEQ)) {
|
||||
mi->S = (uint32_t*)malloc((sum_len + 7) / 8 * 4);
|
||||
fread(mi->S, 4, (sum_len + 7) / 8, fp);
|
||||
}
|
||||
return mi;
|
||||
}
|
||||
|
||||
int64_t mm_idx_is_idx(const char *fn)
|
||||
{
|
||||
int fd, is_idx = 0;
|
||||
off_t ret, off_end;
|
||||
int64_t ret, off_end;
|
||||
char magic[4];
|
||||
|
||||
if (strcmp(fn, "-") == 0) return 0; // read from pipe; not an index
|
||||
fd = open(fn, O_RDONLY);
|
||||
if (fd < 0) return -1; // error
|
||||
#ifdef WIN32
|
||||
if ((off_end = _lseeki64(fd, 0, SEEK_END)) >= 4) {
|
||||
_lseeki64(fd, 0, SEEK_SET);
|
||||
#else
|
||||
if ((off_end = lseek(fd, 0, SEEK_END)) >= 4) {
|
||||
lseek(fd, 0, SEEK_SET);
|
||||
#endif // WIN32
|
||||
ret = read(fd, magic, 4);
|
||||
if (ret == 4 && strncmp(magic, MM_IDX_MAGIC, 4) == 0)
|
||||
is_idx = 1;
|
||||
@@ -477,13 +588,13 @@ mm_idx_t *mm_idx_reader_read(mm_idx_reader_t *r, int n_threads)
|
||||
mm_idx_t *mi;
|
||||
if (r->is_idx) {
|
||||
mi = mm_idx_load(r->fp.idx);
|
||||
if (mi && mm_verbose >= 2 && (mi->k != r->opt.k || mi->w != r->opt.w || mi->is_hpc != r->opt.is_hpc))
|
||||
if (mi && mm_verbose >= 2 && (mi->k != r->opt.k || mi->w != r->opt.w || (mi->flag&MM_I_HPC) != (r->opt.flag&MM_I_HPC)))
|
||||
fprintf(stderr, "[WARNING]\033[1;31m Indexing parameters (-k, -w or -H) overridden by parameters used in the prebuilt index.\033[0m\n");
|
||||
} else
|
||||
mi = mm_idx_gen(r->fp.seq, r->opt.w, r->opt.k, r->opt.bucket_bits, r->opt.is_hpc, r->opt.mini_batch_size, n_threads, r->opt.batch_size, 1);
|
||||
mi = mm_idx_gen(r->fp.seq, r->opt.w, r->opt.k, r->opt.bucket_bits, r->opt.flag, r->opt.mini_batch_size, n_threads, r->opt.batch_size);
|
||||
if (mi) {
|
||||
if (r->fp_out) mm_idx_dump(r->fp_out, mi);
|
||||
++r->n_parts;
|
||||
mi->index = r->n_parts++;
|
||||
}
|
||||
return mi;
|
||||
}
|
||||
@@ -492,3 +603,151 @@ int mm_idx_reader_eof(const mm_idx_reader_t *r) // TODO: in extremely rare cases
|
||||
{
|
||||
return r->is_idx? (feof(r->fp.idx) || ftell(r->fp.idx) == r->idx_size) : mm_bseq_eof(r->fp.seq);
|
||||
}
|
||||
|
||||
#include <ctype.h>
|
||||
#include <zlib.h>
|
||||
#include "ksort.h"
|
||||
#include "kseq.h"
|
||||
KSTREAM_DECLARE(gzFile, gzread)
|
||||
|
||||
int mm_idx_alt_read(mm_idx_t *mi, const char *fn)
|
||||
{
|
||||
int n_alt = 0;
|
||||
gzFile fp;
|
||||
kstream_t *ks;
|
||||
kstring_t str = {0,0,0};
|
||||
fp = fn && strcmp(fn, "-")? gzopen(fn, "r") : gzdopen(fileno(stdin), "r");
|
||||
if (fp == 0) return -1;
|
||||
ks = ks_init(fp);
|
||||
if (mi->h == 0) mm_idx_index_name(mi);
|
||||
while (ks_getuntil(ks, KS_SEP_LINE, &str, 0) >= 0) {
|
||||
char *p;
|
||||
int id;
|
||||
for (p = str.s; *p && !isspace(*p); ++p) { }
|
||||
*p = 0;
|
||||
id = mm_idx_name2id(mi, str.s);
|
||||
if (id >= 0) mi->seq[id].is_alt = 1, ++n_alt;
|
||||
}
|
||||
mi->n_alt = n_alt;
|
||||
if (mm_verbose >= 3)
|
||||
fprintf(stderr, "[M::%s] found %d ALT contigs\n", __func__, n_alt);
|
||||
return n_alt;
|
||||
}
|
||||
|
||||
#define sort_key_bed(a) ((a).st)
|
||||
KRADIX_SORT_INIT(bed, mm_idx_intv1_t, sort_key_bed, 4)
|
||||
|
||||
mm_idx_intv_t *mm_idx_read_bed(const mm_idx_t *mi, const char *fn, int read_junc)
|
||||
{
|
||||
gzFile fp;
|
||||
kstream_t *ks;
|
||||
kstring_t str = {0,0,0};
|
||||
mm_idx_intv_t *I;
|
||||
|
||||
fp = fn && strcmp(fn, "-")? gzopen(fn, "r") : gzdopen(fileno(stdin), "r");
|
||||
if (fp == 0) return 0;
|
||||
I = (mm_idx_intv_t*)calloc(mi->n_seq, sizeof(*I));
|
||||
ks = ks_init(fp);
|
||||
while (ks_getuntil(ks, KS_SEP_LINE, &str, 0) >= 0) {
|
||||
mm_idx_intv_t *r;
|
||||
mm_idx_intv1_t t = {-1,-1,-1,-1,0};
|
||||
char *p, *q, *bl, *bs;
|
||||
int32_t i, id = -1, n_blk = 0;
|
||||
for (p = q = str.s, i = 0;; ++p) {
|
||||
if (*p == 0 || *p == '\t') {
|
||||
int32_t c = *p;
|
||||
*p = 0;
|
||||
if (i == 0) { // chr
|
||||
id = mm_idx_name2id(mi, q);
|
||||
if (id < 0) break; // unknown name; TODO: throw a warning
|
||||
} else if (i == 1) { // start
|
||||
t.st = atol(q); // TODO: watch out integer overflow!
|
||||
if (t.st < 0) break;
|
||||
} else if (i == 2) { // end
|
||||
t.en = atol(q);
|
||||
if (t.en < 0) break;
|
||||
} else if (i == 4) { // BED score
|
||||
t.score = atol(q);
|
||||
} else if (i == 5) { // strand
|
||||
t.strand = *q == '+'? 1 : *q == '-'? -1 : 0;
|
||||
} else if (i == 9) {
|
||||
if (!isdigit(*q)) break;
|
||||
n_blk = atol(q);
|
||||
} else if (i == 10) {
|
||||
bl = q;
|
||||
} else if (i == 11) {
|
||||
bs = q;
|
||||
break;
|
||||
}
|
||||
if (c == 0) break;
|
||||
++i, q = p + 1;
|
||||
}
|
||||
}
|
||||
if (id < 0 || t.st < 0 || t.st >= t.en) continue;
|
||||
r = &I[id];
|
||||
if (i >= 11 && read_junc) { // BED12
|
||||
int32_t st, sz, en;
|
||||
st = strtol(bs, &bs, 10); ++bs;
|
||||
sz = strtol(bl, &bl, 10); ++bl;
|
||||
en = t.st + st + sz;
|
||||
for (i = 1; i < n_blk; ++i) {
|
||||
mm_idx_intv1_t s = t;
|
||||
if (r->n == r->m) {
|
||||
r->m = r->m? r->m + (r->m>>1) : 16;
|
||||
r->a = (mm_idx_intv1_t*)realloc(r->a, sizeof(*r->a) * r->m);
|
||||
}
|
||||
st = strtol(bs, &bs, 10); ++bs;
|
||||
sz = strtol(bl, &bl, 10); ++bl;
|
||||
s.st = en, s.en = t.st + st;
|
||||
en = t.st + st + sz;
|
||||
if (s.en > s.st) r->a[r->n++] = s;
|
||||
}
|
||||
} else {
|
||||
if (r->n == r->m) {
|
||||
r->m = r->m? r->m + (r->m>>1) : 16;
|
||||
r->a = (mm_idx_intv1_t*)realloc(r->a, sizeof(*r->a) * r->m);
|
||||
}
|
||||
r->a[r->n++] = t;
|
||||
}
|
||||
}
|
||||
free(str.s);
|
||||
ks_destroy(ks);
|
||||
gzclose(fp);
|
||||
return I;
|
||||
}
|
||||
|
||||
int mm_idx_bed_read(mm_idx_t *mi, const char *fn, int read_junc)
|
||||
{
|
||||
int32_t i;
|
||||
if (mi->h == 0) mm_idx_index_name(mi);
|
||||
mi->I = mm_idx_read_bed(mi, fn, read_junc);
|
||||
if (mi->I == 0) return -1;
|
||||
for (i = 0; i < mi->n_seq; ++i) // TODO: eliminate redundant intervals
|
||||
radix_sort_bed(mi->I[i].a, mi->I[i].a + mi->I[i].n);
|
||||
return 0;
|
||||
}
|
||||
|
||||
int mm_idx_bed_junc(const mm_idx_t *mi, int32_t ctg, int32_t st, int32_t en, uint8_t *s)
|
||||
{
|
||||
int32_t i, left, right;
|
||||
mm_idx_intv_t *r;
|
||||
memset(s, 0, en - st);
|
||||
if (mi->I == 0 || ctg < 0 || ctg >= mi->n_seq) return -1;
|
||||
r = &mi->I[ctg];
|
||||
left = 0, right = r->n;
|
||||
while (right > left) {
|
||||
int32_t mid = left + ((right - left) >> 1);
|
||||
if (r->a[mid].st >= st) right = mid;
|
||||
else left = mid + 1;
|
||||
}
|
||||
for (i = left; i < r->n; ++i) {
|
||||
if (st <= r->a[i].st && en >= r->a[i].en && r->a[i].strand != 0) {
|
||||
if (r->a[i].strand > 0) {
|
||||
s[r->a[i].st - st] |= 1, s[r->a[i].en - 1 - st] |= 2;
|
||||
} else {
|
||||
s[r->a[i].st - st] |= 8, s[r->a[i].en - 1 - st] |= 4;
|
||||
}
|
||||
}
|
||||
}
|
||||
return left;
|
||||
}
|
||||
|
||||
@@ -18,15 +18,14 @@
|
||||
* | | | |
|
||||
* p=p->ptr->ptr->ptr->ptr p->ptr p->ptr->ptr p->ptr->ptr->ptr
|
||||
*/
|
||||
|
||||
#define MIN_CORE_SIZE 0x80000
|
||||
|
||||
typedef struct header_t {
|
||||
size_t size;
|
||||
struct header_t *ptr;
|
||||
} header_t;
|
||||
|
||||
typedef struct {
|
||||
void *par;
|
||||
size_t min_core_size;
|
||||
header_t base, *loop_head, *core_head; /* base is a zero-sized block always kept in the loop */
|
||||
} kmem_t;
|
||||
|
||||
@@ -36,31 +35,39 @@ static void panic(const char *s)
|
||||
abort();
|
||||
}
|
||||
|
||||
void *km_init(void)
|
||||
void *km_init2(void *km_par, size_t min_core_size)
|
||||
{
|
||||
return calloc(1, sizeof(kmem_t));
|
||||
kmem_t *km;
|
||||
km = (kmem_t*)kcalloc(km_par, 1, sizeof(kmem_t));
|
||||
km->par = km_par;
|
||||
km->min_core_size = min_core_size > 0? min_core_size : 0x80000;
|
||||
return (void*)km;
|
||||
}
|
||||
|
||||
void *km_init(void) { return km_init2(0, 0); }
|
||||
|
||||
void km_destroy(void *_km)
|
||||
{
|
||||
kmem_t *km = (kmem_t*)_km;
|
||||
void *km_par;
|
||||
header_t *p, *q;
|
||||
if (km == NULL) return;
|
||||
km_par = km->par;
|
||||
for (p = km->core_head; p != NULL;) {
|
||||
q = p->ptr;
|
||||
free(p);
|
||||
kfree(km_par, p);
|
||||
p = q;
|
||||
}
|
||||
free(km);
|
||||
kfree(km_par, km);
|
||||
}
|
||||
|
||||
static header_t *morecore(kmem_t *km, size_t nu)
|
||||
{
|
||||
header_t *q;
|
||||
size_t bytes, *p;
|
||||
nu = (nu + 1 + (MIN_CORE_SIZE - 1)) / MIN_CORE_SIZE * MIN_CORE_SIZE; /* the first +1 for core header */
|
||||
nu = (nu + 1 + (km->min_core_size - 1)) / km->min_core_size * km->min_core_size; /* the first +1 for core header */
|
||||
bytes = nu * sizeof(header_t);
|
||||
q = (header_t*)malloc(bytes);
|
||||
q = (header_t*)kmalloc(km->par, bytes);
|
||||
if (!q) panic("[morecore] insufficient memory");
|
||||
q->ptr = km->core_head, q->size = nu, km->core_head = q;
|
||||
p = (size_t*)(q + 1);
|
||||
@@ -125,7 +132,7 @@ void *kmalloc(void *_km, size_t n_bytes)
|
||||
|
||||
if (n_bytes == 0) return 0;
|
||||
if (km == NULL) return malloc(n_bytes);
|
||||
n_units = (n_bytes + sizeof(size_t) + sizeof(header_t) - 1) / sizeof(header_t) + 1;
|
||||
n_units = (n_bytes + sizeof(size_t) + sizeof(header_t) - 1) / sizeof(header_t); /* header+n_bytes requires at least this number of units */
|
||||
|
||||
if (!(q = km->loop_head)) /* the first time when kmalloc() is called, intialize it */
|
||||
q = km->loop_head = km->base.ptr = &km->base;
|
||||
@@ -160,18 +167,18 @@ void *kcalloc(void *_km, size_t count, size_t size)
|
||||
void *krealloc(void *_km, void *ap, size_t n_bytes) // TODO: this can be made more efficient in principle
|
||||
{
|
||||
kmem_t *km = (kmem_t*)_km;
|
||||
size_t n_units, *p, *q;
|
||||
size_t cap, *p, *q;
|
||||
|
||||
if (n_bytes == 0) {
|
||||
kfree(km, ap); return 0;
|
||||
}
|
||||
if (km == NULL) return realloc(ap, n_bytes);
|
||||
if (ap == NULL) return kmalloc(km, n_bytes);
|
||||
n_units = (n_bytes + sizeof(size_t) + sizeof(header_t) - 1) / sizeof(header_t);
|
||||
p = (size_t*)ap - 1;
|
||||
if (*p >= n_units) return ap; /* TODO: this prevents shrinking */
|
||||
cap = (*p) * sizeof(header_t) - sizeof(size_t);
|
||||
if (cap >= n_bytes) return ap; /* TODO: this prevents shrinking */
|
||||
q = (size_t*)kmalloc(km, n_bytes);
|
||||
memcpy(q, ap, (*p - 1) * sizeof(header_t));
|
||||
memcpy(q, ap, cap);
|
||||
kfree(km, ap);
|
||||
return q;
|
||||
}
|
||||
@@ -189,6 +196,10 @@ void km_stat(const void *_km, km_stat_t *s)
|
||||
panic("[km_stat] The end of a free block enters another free block.");
|
||||
if (p->ptr == km->loop_head) break;
|
||||
}
|
||||
for (p = km->core_head; p != NULL; p = p->ptr)
|
||||
++s->n_cores, s->capacity += p->size * sizeof(header_t);
|
||||
for (p = km->core_head; p != NULL; p = p->ptr) {
|
||||
size_t size = p->size * sizeof(header_t);
|
||||
++s->n_cores;
|
||||
s->capacity += size;
|
||||
s->largest = s->largest > size? s->largest : size;
|
||||
}
|
||||
}
|
||||
|
||||
@@ -8,7 +8,7 @@ extern "C" {
|
||||
#endif
|
||||
|
||||
typedef struct {
|
||||
size_t capacity, available, n_blocks, n_cores;
|
||||
size_t capacity, available, n_blocks, n_cores, largest;
|
||||
} km_stat_t;
|
||||
|
||||
void *kmalloc(void *km, size_t size);
|
||||
@@ -17,6 +17,7 @@ void *kcalloc(void *km, size_t count, size_t size);
|
||||
void kfree(void *km, void *ptr);
|
||||
|
||||
void *km_init(void);
|
||||
void *km_init2(void *km_par, size_t min_core_size);
|
||||
void km_destroy(void *km);
|
||||
void km_stat(const void *_km, km_stat_t *s);
|
||||
|
||||
@@ -24,4 +25,13 @@ void km_stat(const void *_km, km_stat_t *s);
|
||||
}
|
||||
#endif
|
||||
|
||||
#define KMALLOC(km, ptr, len) ((ptr) = (__typeof__(ptr))kmalloc((km), (len) * sizeof(*(ptr))))
|
||||
#define KCALLOC(km, ptr, len) ((ptr) = (__typeof__(ptr))kcalloc((km), (len), sizeof(*(ptr))))
|
||||
#define KREALLOC(km, ptr, len) ((ptr) = (__typeof__(ptr))krealloc((km), (ptr), (len) * sizeof(*(ptr))))
|
||||
|
||||
#define KEXPAND(km, a, m) do { \
|
||||
(m) = (m) >= 4? (m) + ((m)>>1) : 16; \
|
||||
KREALLOC((km), (a), (m)); \
|
||||
} while (0)
|
||||
|
||||
#endif
|
||||
|
||||
@@ -0,0 +1,120 @@
|
||||
#ifndef KETOPT_H
|
||||
#define KETOPT_H
|
||||
|
||||
#include <string.h> /* for strchr() and strncmp() */
|
||||
|
||||
#define ko_no_argument 0
|
||||
#define ko_required_argument 1
|
||||
#define ko_optional_argument 2
|
||||
|
||||
typedef struct {
|
||||
int ind; /* equivalent to optind */
|
||||
int opt; /* equivalent to optopt */
|
||||
char *arg; /* equivalent to optarg */
|
||||
int longidx; /* index of a long option; or -1 if short */
|
||||
/* private variables not intended for external uses */
|
||||
int i, pos, n_args;
|
||||
} ketopt_t;
|
||||
|
||||
typedef struct {
|
||||
char *name;
|
||||
int has_arg;
|
||||
int val;
|
||||
} ko_longopt_t;
|
||||
|
||||
static ketopt_t KETOPT_INIT = { 1, 0, 0, -1, 1, 0, 0 };
|
||||
|
||||
static void ketopt_permute(char *argv[], int j, int n) /* move argv[j] over n elements to the left */
|
||||
{
|
||||
int k;
|
||||
char *p = argv[j];
|
||||
for (k = 0; k < n; ++k)
|
||||
argv[j - k] = argv[j - k - 1];
|
||||
argv[j - k] = p;
|
||||
}
|
||||
|
||||
/**
|
||||
* Parse command-line options and arguments
|
||||
*
|
||||
* This fuction has a similar interface to GNU's getopt_long(). Each call
|
||||
* parses one option and returns the option name. s->arg points to the option
|
||||
* argument if present. The function returns -1 when all command-line arguments
|
||||
* are parsed. In this case, s->ind is the index of the first non-option
|
||||
* argument.
|
||||
*
|
||||
* @param s status; shall be initialized to KETOPT_INIT on the first call
|
||||
* @param argc length of argv[]
|
||||
* @param argv list of command-line arguments; argv[0] is ignored
|
||||
* @param permute non-zero to move options ahead of non-option arguments
|
||||
* @param ostr option string
|
||||
* @param longopts long options
|
||||
*
|
||||
* @return ASCII for a short option; ko_longopt_t::val for a long option; -1 if
|
||||
* argv[] is fully processed; '?' for an unknown option or an ambiguous
|
||||
* long option; ':' if an option argument is missing
|
||||
*/
|
||||
static int ketopt(ketopt_t *s, int argc, char *argv[], int permute, const char *ostr, const ko_longopt_t *longopts)
|
||||
{
|
||||
int opt = -1, i0, j;
|
||||
if (permute) {
|
||||
while (s->i < argc && (argv[s->i][0] != '-' || argv[s->i][1] == '\0'))
|
||||
++s->i, ++s->n_args;
|
||||
}
|
||||
s->arg = 0, s->longidx = -1, i0 = s->i;
|
||||
if (s->i >= argc || argv[s->i][0] != '-' || argv[s->i][1] == '\0') {
|
||||
s->ind = s->i - s->n_args;
|
||||
return -1;
|
||||
}
|
||||
if (argv[s->i][0] == '-' && argv[s->i][1] == '-') { /* "--" or a long option */
|
||||
if (argv[s->i][2] == '\0') { /* a bare "--" */
|
||||
ketopt_permute(argv, s->i, s->n_args);
|
||||
++s->i, s->ind = s->i - s->n_args;
|
||||
return -1;
|
||||
}
|
||||
s->opt = 0, opt = '?', s->pos = -1;
|
||||
if (longopts) { /* parse long options */
|
||||
int k, n_exact = 0, n_partial = 0;
|
||||
const ko_longopt_t *o = 0, *o_exact = 0, *o_partial = 0;
|
||||
for (j = 2; argv[s->i][j] != '\0' && argv[s->i][j] != '='; ++j) {} /* find the end of the option name */
|
||||
for (k = 0; longopts[k].name != 0; ++k)
|
||||
if (strncmp(&argv[s->i][2], longopts[k].name, j - 2) == 0) {
|
||||
if (longopts[k].name[j - 2] == 0) ++n_exact, o_exact = &longopts[k];
|
||||
else ++n_partial, o_partial = &longopts[k];
|
||||
}
|
||||
if (n_exact > 1 || (n_exact == 0 && n_partial > 1)) return '?';
|
||||
o = n_exact == 1? o_exact : n_partial == 1? o_partial : 0;
|
||||
if (o) {
|
||||
s->opt = opt = o->val, s->longidx = o - longopts;
|
||||
if (argv[s->i][j] == '=') s->arg = &argv[s->i][j + 1];
|
||||
if (o->has_arg == 1 && argv[s->i][j] == '\0') {
|
||||
if (s->i < argc - 1) s->arg = argv[++s->i];
|
||||
else opt = ':'; /* missing option argument */
|
||||
}
|
||||
}
|
||||
}
|
||||
} else { /* a short option */
|
||||
char *p;
|
||||
if (s->pos == 0) s->pos = 1;
|
||||
opt = s->opt = argv[s->i][s->pos++];
|
||||
p = strchr((char*)ostr, opt);
|
||||
if (p == 0) {
|
||||
opt = '?'; /* unknown option */
|
||||
} else if (p[1] == ':') {
|
||||
if (argv[s->i][s->pos] == 0) {
|
||||
if (s->i < argc - 1) s->arg = argv[++s->i];
|
||||
else opt = ':'; /* missing option argument */
|
||||
} else s->arg = &argv[s->i][s->pos];
|
||||
s->pos = -1;
|
||||
}
|
||||
}
|
||||
if (s->pos < 0 || argv[s->i][s->pos] == 0) {
|
||||
++s->i, s->pos = 0;
|
||||
if (s->n_args > 0) /* permute */
|
||||
for (j = i0; j < s->i; ++j)
|
||||
ketopt_permute(argv, j, s->n_args);
|
||||
}
|
||||
s->ind = s->i - s->n_args;
|
||||
return opt;
|
||||
}
|
||||
|
||||
#endif
|
||||
@@ -37,6 +37,14 @@
|
||||
#define KS_SEP_LINE 2 // line separator: "\n" (Unix) or "\r\n" (Windows)
|
||||
#define KS_SEP_MAX 2
|
||||
|
||||
#ifndef klib_unused
|
||||
#if (defined __clang__ && __clang_major__ >= 3) || (defined __GNUC__ && __GNUC__ >= 3)
|
||||
#define klib_unused __attribute__ ((__unused__))
|
||||
#else
|
||||
#define klib_unused
|
||||
#endif
|
||||
#endif /* klib_unused */
|
||||
|
||||
#define __KS_TYPE(type_t) \
|
||||
typedef struct __kstream_t { \
|
||||
int begin, end; \
|
||||
@@ -64,7 +72,7 @@
|
||||
}
|
||||
|
||||
#define __KS_INLINED(__read) \
|
||||
static inline int ks_getc(kstream_t *ks) \
|
||||
static inline klib_unused int ks_getc(kstream_t *ks) \
|
||||
{ \
|
||||
if (ks->is_eof && ks->begin >= ks->end) return -1; \
|
||||
if (ks->begin >= ks->end) { \
|
||||
@@ -81,7 +89,7 @@
|
||||
#ifndef KSTRING_T
|
||||
#define KSTRING_T kstring_t
|
||||
typedef struct __kstring_t {
|
||||
unsigned l, m;
|
||||
size_t l, m;
|
||||
char *s;
|
||||
} kstring_t;
|
||||
#endif
|
||||
|
||||
@@ -37,9 +37,26 @@ typedef struct {
|
||||
int depth;
|
||||
} ks_isort_stack_t;
|
||||
|
||||
#define KSORT_SWAP(type_t, a, b) { register type_t t=(a); (a)=(b); (b)=t; }
|
||||
#define KSORT_SWAP(type_t, a, b) { type_t t=(a); (a)=(b); (b)=t; }
|
||||
|
||||
#define KSORT_INIT(name, type_t, __sort_lt) \
|
||||
#define KSORT_INIT(name, type_t, __sort_lt) \
|
||||
void ks_heapdown_##name(size_t i, size_t n, type_t l[]) \
|
||||
{ \
|
||||
size_t k = i; \
|
||||
type_t tmp = l[i]; \
|
||||
while ((k = (k << 1) + 1) < n) { \
|
||||
if (k != n - 1 && __sort_lt(l[k], l[k+1])) ++k; \
|
||||
if (__sort_lt(l[k], tmp)) break; \
|
||||
l[i] = l[k]; i = k; \
|
||||
} \
|
||||
l[i] = tmp; \
|
||||
} \
|
||||
void ks_heapmake_##name(size_t lsize, type_t l[]) \
|
||||
{ \
|
||||
size_t i; \
|
||||
for (i = (lsize >> 1) - 1; i != (size_t)(-1); --i) \
|
||||
ks_heapdown_##name(i, lsize, l); \
|
||||
} \
|
||||
type_t ks_ksmall_##name(size_t n, type_t arr[], size_t kk) \
|
||||
{ \
|
||||
type_t *low, *high, *k, *ll, *hh, *mid; \
|
||||
|
||||
@@ -14,6 +14,7 @@
|
||||
#define KSW_EZ_REV_CIGAR 0x80 // reverse CIGAR in the output
|
||||
#define KSW_EZ_SPLICE_FOR 0x100
|
||||
#define KSW_EZ_SPLICE_REV 0x200
|
||||
#define KSW_EZ_SPLICE_FLANK 0x400
|
||||
|
||||
#ifdef __cplusplus
|
||||
extern "C" {
|
||||
@@ -60,7 +61,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
int8_t gapo, int8_t gape, int8_t gapo2, int8_t gape2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
|
||||
|
||||
void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t gapo, int8_t gape, int8_t gapo2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez);
|
||||
int8_t gapo, int8_t gape, int8_t gapo2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez);
|
||||
|
||||
void ksw_extf2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t mch, int8_t mis, int8_t e, int w, int xdrop, ksw_extz_t *ez);
|
||||
|
||||
@@ -115,7 +116,7 @@ static inline uint32_t *ksw_push_cigar(void *km, int *n_cigar, int *m_cigar, uin
|
||||
// bit 0-2: which type gets the max - 0 for H, 1 for E, 2 for F, 3 for \tilde{E} and 4 for \tilde{F}
|
||||
// bit 3/0x08: 1 if a continuation on the E state (bit 5/0x20 for a continuation on \tilde{E})
|
||||
// bit 4/0x10: 1 if a continuation on the F state (bit 6/0x40 for a continuation on \tilde{F})
|
||||
static inline void ksw_backtrack(void *km, int is_rot, int is_rev, int with_N, const uint8_t *p, const int *off, const int *off_end, int n_col, int i0, int j0,
|
||||
static inline void ksw_backtrack(void *km, int is_rot, int is_rev, int min_intron_len, const uint8_t *p, const int *off, const int *off_end, int n_col, int i0, int j0,
|
||||
int *m_cigar_, int *n_cigar_, uint32_t **cigar_)
|
||||
{ // p[] - lower 3 bits: which type gets the max; bit
|
||||
int n_cigar = 0, m_cigar = *m_cigar_, i = i0, j = j0, r, state = 0;
|
||||
@@ -126,22 +127,22 @@ static inline void ksw_backtrack(void *km, int is_rot, int is_rev, int with_N, c
|
||||
r = i + j;
|
||||
if (i < off[r]) force_state = 2;
|
||||
if (off_end && i > off_end[r]) force_state = 1;
|
||||
tmp = force_state < 0? p[r * n_col + i - off[r]] : 0;
|
||||
tmp = force_state < 0? p[(size_t)r * n_col + i - off[r]] : 0;
|
||||
} else {
|
||||
if (j < off[i]) force_state = 2;
|
||||
if (off_end && j > off_end[i]) force_state = 1;
|
||||
tmp = force_state < 0? p[i * n_col + j - off[i]] : 0;
|
||||
tmp = force_state < 0? p[(size_t)i * n_col + j - off[i]] : 0;
|
||||
}
|
||||
if (state == 0) state = tmp & 7; // if requesting the H state, find state one maximizes it.
|
||||
else if (!(tmp >> (state + 2) & 1)) state = 0; // if requesting other states, _state_ stays the same if it is a continuation; otherwise, set to H
|
||||
if (state == 0) state = tmp & 7; // TODO: probably this line can be merged into the "else if" line right above; not 100% sure
|
||||
if (force_state >= 0) state = force_state;
|
||||
if (state == 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 0, 1), --i, --j; // match
|
||||
else if (state == 1 || (state == 3 && !with_N)) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 2, 1), --i; // deletion
|
||||
else if (state == 3 && with_N) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 3, 1), --i; // intron
|
||||
else if (state == 1 || (state == 3 && min_intron_len <= 0)) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 2, 1), --i; // deletion
|
||||
else if (state == 3 && min_intron_len > 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 3, 1), --i; // intron
|
||||
else cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 1, 1), --j; // insertion
|
||||
}
|
||||
if (i >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 2, i + 1); // first deletion
|
||||
if (i >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, min_intron_len > 0 && i >= min_intron_len? 3 : 2, i + 1); // first deletion
|
||||
if (j >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 1, j + 1); // first insertion
|
||||
if (!is_rev)
|
||||
for (i = 0; i < n_cigar>>1; ++i) // reverse CIGAR
|
||||
|
||||
+19
-20
@@ -17,18 +17,20 @@
|
||||
void __cpuidex(int cpuid[4], int func_id, int subfunc_id)
|
||||
{
|
||||
#if defined(__x86_64__)
|
||||
asm volatile ("cpuid"
|
||||
__asm__ volatile ("cpuid"
|
||||
: "=a" (cpuid[0]), "=b" (cpuid[1]), "=c" (cpuid[2]), "=d" (cpuid[3])
|
||||
: "0" (func_id), "2" (subfunc_id));
|
||||
#else // on 32bit, ebx can NOT be used as PIC code
|
||||
asm volatile ("xchgl %%ebx, %1; cpuid; xchgl %%ebx, %1"
|
||||
__asm__ volatile ("xchgl %%ebx, %1; cpuid; xchgl %%ebx, %1"
|
||||
: "=a" (cpuid[0]), "=r" (cpuid[1]), "=c" (cpuid[2]), "=d" (cpuid[3])
|
||||
: "0" (func_id), "2" (subfunc_id));
|
||||
#endif
|
||||
}
|
||||
#endif
|
||||
|
||||
int x86_simd(void)
|
||||
static int ksw_simd = -1;
|
||||
|
||||
static int x86_simd(void)
|
||||
{
|
||||
int flag = 0, cpuid[4], max_id;
|
||||
__cpuidex(cpuid, 0, 0);
|
||||
@@ -54,11 +56,10 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
{
|
||||
extern void ksw_extz2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
|
||||
extern void ksw_extz2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
|
||||
unsigned simd;
|
||||
simd = x86_simd();
|
||||
if (simd & SIMD_SSE4_1)
|
||||
if (ksw_simd < 0) ksw_simd = x86_simd();
|
||||
if (ksw_simd & SIMD_SSE4_1)
|
||||
ksw_extz2_sse41(km, qlen, query, tlen, target, m, mat, q, e, w, zdrop, end_bonus, flag, ez);
|
||||
else if (simd & SIMD_SSE2)
|
||||
else if (ksw_simd & SIMD_SSE2)
|
||||
ksw_extz2_sse2(km, qlen, query, tlen, target, m, mat, q, e, w, zdrop, end_bonus, flag, ez);
|
||||
else abort();
|
||||
}
|
||||
@@ -70,28 +71,26 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
|
||||
extern void ksw_extd2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
|
||||
unsigned simd;
|
||||
simd = x86_simd();
|
||||
if (simd & SIMD_SSE4_1)
|
||||
if (ksw_simd < 0) ksw_simd = x86_simd();
|
||||
if (ksw_simd & SIMD_SSE4_1)
|
||||
ksw_extd2_sse41(km, qlen, query, tlen, target, m, mat, q, e, q2, e2, w, zdrop, end_bonus, flag, ez);
|
||||
else if (simd & SIMD_SSE2)
|
||||
else if (ksw_simd & SIMD_SSE2)
|
||||
ksw_extd2_sse2(km, qlen, query, tlen, target, m, mat, q, e, q2, e2, w, zdrop, end_bonus, flag, ez);
|
||||
else abort();
|
||||
}
|
||||
|
||||
void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez)
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez)
|
||||
{
|
||||
extern void ksw_exts2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez);
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez);
|
||||
extern void ksw_exts2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez);
|
||||
unsigned simd;
|
||||
simd = x86_simd();
|
||||
if (simd & SIMD_SSE4_1)
|
||||
ksw_exts2_sse41(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, flag, ez);
|
||||
else if (simd & SIMD_SSE2)
|
||||
ksw_exts2_sse2(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, flag, ez);
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez);
|
||||
if (ksw_simd < 0) ksw_simd = x86_simd();
|
||||
if (ksw_simd & SIMD_SSE4_1)
|
||||
ksw_exts2_sse41(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, junc_bonus, flag, junc, ez);
|
||||
else if (ksw_simd & SIMD_SSE2)
|
||||
ksw_exts2_sse2(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, junc_bonus, flag, junc, ez);
|
||||
else abort();
|
||||
}
|
||||
#endif
|
||||
|
||||
+13
-5
@@ -4,15 +4,23 @@
|
||||
#include "ksw2.h"
|
||||
|
||||
#ifdef __SSE2__
|
||||
#ifdef USE_SIMDE
|
||||
#include <simde/x86/sse2.h>
|
||||
#else
|
||||
#include <emmintrin.h>
|
||||
#endif
|
||||
|
||||
#ifdef KSW_SSE2_ONLY
|
||||
#undef __SSE4_1__
|
||||
#endif
|
||||
|
||||
#ifdef __SSE4_1__
|
||||
#ifdef USE_SIMDE
|
||||
#include <simde/x86/sse4.1.h>
|
||||
#else
|
||||
#include <smmintrin.h>
|
||||
#endif
|
||||
#endif
|
||||
|
||||
#ifdef KSW_CPU_DISPATCH
|
||||
#ifdef __SSE4_1__
|
||||
@@ -76,7 +84,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
qe2_ = _mm_set1_epi8(q2 + e2);
|
||||
sc_mch_ = _mm_set1_epi8(mat[0]);
|
||||
sc_mis_ = _mm_set1_epi8(mat[1]);
|
||||
sc_N_ = _mm_set1_epi8(-e2);
|
||||
sc_N_ = mat[m*m-1] == 0? _mm_set1_epi8(-e2) : _mm_set1_epi8(mat[m*m-1]);
|
||||
m1_ = _mm_set1_epi8(m - 1); // wildcard
|
||||
|
||||
if (w < 0) w = tlen > qlen? tlen : qlen;
|
||||
@@ -111,7 +119,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
for (t = 0; t < tlen_ * 16; ++t) H[t] = KSW_NEG_INF;
|
||||
}
|
||||
if (with_cigar) {
|
||||
mem2 = (uint8_t*)kmalloc(km, ((qlen + tlen - 1) * n_col_ + 1) * 16);
|
||||
mem2 = (uint8_t*)kmalloc(km, ((size_t)(qlen + tlen - 1) * n_col_ + 1) * 16);
|
||||
p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4);
|
||||
off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int) * 2);
|
||||
off_end = off + qlen + tlen - 1;
|
||||
@@ -218,7 +226,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
#endif
|
||||
}
|
||||
} else if (!(flag&KSW_EZ_RIGHT)) { // gap left-alignment
|
||||
__m128i *pr = p + r * n_col_ - st_;
|
||||
__m128i *pr = p + (size_t)r * n_col_ - st_;
|
||||
off[r] = st, off_end[r] = en;
|
||||
for (t = st_; t <= en_; ++t) {
|
||||
__m128i d, z, a, b, a2, b2, xt1, x2t1, vt1, ut, tmp;
|
||||
@@ -265,7 +273,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
_mm_store_si128(&pr[t], d);
|
||||
}
|
||||
} else { // gap right-alignment
|
||||
__m128i *pr = p + r * n_col_ - st_;
|
||||
__m128i *pr = p + (size_t)r * n_col_ - st_;
|
||||
off[r] = st, off_end[r] = en;
|
||||
for (t = st_; t <= en_; ++t) {
|
||||
__m128i d, z, a, b, a2, b2, xt1, x2t1, vt1, ut, tmp;
|
||||
@@ -382,7 +390,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
|
||||
if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY)) {
|
||||
ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||
} else if (!ez->zdropped && (flag&KSW_EZ_EXTZ_ONLY) && ez->mqe + end_bonus > ez->max) {
|
||||
} else if (!ez->zdropped && (flag&KSW_EZ_EXTZ_ONLY) && ez->mqe + end_bonus > (int)ez->max) {
|
||||
ez->reach_end = 1;
|
||||
ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, ez->mqe_t, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||
} else if (ez->max_t >= 0 && ez->max_q >= 0) {
|
||||
|
||||
+62
-19
@@ -4,27 +4,34 @@
|
||||
#include "ksw2.h"
|
||||
|
||||
#ifdef __SSE2__
|
||||
#ifdef USE_SIMDE
|
||||
#include <simde/x86/sse2.h>
|
||||
#else
|
||||
#include <emmintrin.h>
|
||||
|
||||
#endif
|
||||
#ifdef KSW_SSE2_ONLY
|
||||
#undef __SSE4_1__
|
||||
#endif
|
||||
|
||||
#ifdef __SSE4_1__
|
||||
#ifdef USE_SIMDE
|
||||
#include <simde/x86/sse4.1.h>
|
||||
#else
|
||||
#include <smmintrin.h>
|
||||
#endif
|
||||
#endif
|
||||
|
||||
#ifdef KSW_CPU_DISPATCH
|
||||
#ifdef __SSE4_1__
|
||||
void ksw_exts2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez)
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez)
|
||||
#else
|
||||
void ksw_exts2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez)
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez)
|
||||
#endif
|
||||
#else
|
||||
void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez)
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez)
|
||||
#endif // ~KSW_CPU_DISPATCH
|
||||
{
|
||||
#define __dp_code_block1 \
|
||||
@@ -71,7 +78,7 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
qe_ = _mm_set1_epi8(q + e);
|
||||
sc_mch_ = _mm_set1_epi8(mat[0]);
|
||||
sc_mis_ = _mm_set1_epi8(mat[1]);
|
||||
sc_N_ = _mm_set1_epi8(-e);
|
||||
sc_N_ = mat[m*m-1] == 0? _mm_set1_epi8(-e) : _mm_set1_epi8(mat[m*m-1]);
|
||||
m1_ = _mm_set1_epi8(m - 1); // wildcard
|
||||
|
||||
tlen_ = (tlen + 15) / 16;
|
||||
@@ -100,7 +107,7 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
for (t = 0; t < tlen_ * 16; ++t) H[t] = KSW_NEG_INF;
|
||||
}
|
||||
if (with_cigar) {
|
||||
mem2 = (uint8_t*)kmalloc(km, ((qlen + tlen - 1) * n_col_ + 1) * 16);
|
||||
mem2 = (uint8_t*)kmalloc(km, ((size_t)(qlen + tlen - 1) * n_col_ + 1) * 16);
|
||||
p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4);
|
||||
off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int) * 2);
|
||||
off_end = off + qlen + tlen - 1;
|
||||
@@ -111,19 +118,55 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
|
||||
// set the donor and acceptor arrays. TODO: this assumes 0/1/2/3 encoding!
|
||||
if (flag & (KSW_EZ_SPLICE_FOR|KSW_EZ_SPLICE_REV)) {
|
||||
int semi_cost = flag&KSW_EZ_SPLICE_FLANK? -noncan/2 : 0; // GTr or yAG is worth 0.5 bit; see PMID:18688272
|
||||
memset(donor, -noncan, tlen_ * 16);
|
||||
for (t = 0; t < tlen - 2; ++t) {
|
||||
int is_can = 0; // is a canonical site
|
||||
if ((flag & KSW_EZ_SPLICE_FOR) && target[t+1] == 2 && target[t+2] == 3) is_can = 1;
|
||||
if ((flag & KSW_EZ_SPLICE_REV) && target[t+1] == 1 && target[t+2] == 3) is_can = 1;
|
||||
if (is_can) ((int8_t*)donor)[t] = 0;
|
||||
}
|
||||
memset(acceptor, -noncan, tlen_ * 16);
|
||||
for (t = 2; t < tlen; ++t) {
|
||||
int is_can = 0;
|
||||
if ((flag & KSW_EZ_SPLICE_FOR) && target[t-1] == 0 && target[t] == 2) is_can = 1;
|
||||
if ((flag & KSW_EZ_SPLICE_REV) && target[t-1] == 0 && target[t] == 1) is_can = 1;
|
||||
if (is_can) ((int8_t*)acceptor)[t] = 0;
|
||||
if (!(flag & KSW_EZ_REV_CIGAR)) {
|
||||
for (t = 0; t < tlen - 4; ++t) {
|
||||
int can_type = 0; // type of canonical site: 0=none, 1=GT/AG only, 2=GTr/yAG
|
||||
if ((flag & KSW_EZ_SPLICE_FOR) && target[t+1] == 2 && target[t+2] == 3) can_type = 1; // GTr...
|
||||
if ((flag & KSW_EZ_SPLICE_REV) && target[t+1] == 1 && target[t+2] == 3) can_type = 1; // CTr...
|
||||
if (can_type && (target[t+3] == 0 || target[t+3] == 2)) can_type = 2;
|
||||
if (can_type) ((int8_t*)donor)[t] = can_type == 2? 0 : semi_cost;
|
||||
}
|
||||
if (junc)
|
||||
for (t = 0; t < tlen - 1; ++t)
|
||||
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t+1]&1)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t+1]&8)))
|
||||
((int8_t*)donor)[t] += junc_bonus;
|
||||
for (t = 2; t < tlen; ++t) {
|
||||
int can_type = 0;
|
||||
if ((flag & KSW_EZ_SPLICE_FOR) && target[t-1] == 0 && target[t] == 2) can_type = 1; // ...yAG
|
||||
if ((flag & KSW_EZ_SPLICE_REV) && target[t-1] == 0 && target[t] == 1) can_type = 1; // ...yAC
|
||||
if (can_type && (target[t-2] == 1 || target[t-2] == 3)) can_type = 2;
|
||||
if (can_type) ((int8_t*)acceptor)[t] = can_type == 2? 0 : semi_cost;
|
||||
}
|
||||
if (junc)
|
||||
for (t = 0; t < tlen; ++t)
|
||||
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t]&2)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t]&4)))
|
||||
((int8_t*)acceptor)[t] += junc_bonus;
|
||||
} else {
|
||||
for (t = 0; t < tlen - 4; ++t) {
|
||||
int can_type = 0; // type of canonical site: 0=none, 1=GT/AG only, 2=GTr/yAG
|
||||
if ((flag & KSW_EZ_SPLICE_FOR) && target[t+1] == 2 && target[t+2] == 0) can_type = 1; // GAy...
|
||||
if ((flag & KSW_EZ_SPLICE_REV) && target[t+1] == 1 && target[t+2] == 0) can_type = 1; // CAy...
|
||||
if (can_type && (target[t+3] == 1 || target[t+3] == 3)) can_type = 2;
|
||||
if (can_type) ((int8_t*)donor)[t] = can_type == 2? 0 : semi_cost;
|
||||
}
|
||||
if (junc)
|
||||
for (t = 0; t < tlen - 1; ++t)
|
||||
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t+1]&2)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t+1]&4)))
|
||||
((int8_t*)donor)[t] += junc_bonus;
|
||||
for (t = 2; t < tlen; ++t) {
|
||||
int can_type = 0;
|
||||
if ((flag & KSW_EZ_SPLICE_FOR) && target[t-1] == 3 && target[t] == 2) can_type = 1; // ...rTG
|
||||
if ((flag & KSW_EZ_SPLICE_REV) && target[t-1] == 3 && target[t] == 1) can_type = 1; // ...rTC
|
||||
if (can_type && (target[t-2] == 0 || target[t-2] == 2)) can_type = 2;
|
||||
if (can_type) ((int8_t*)acceptor)[t] = can_type == 2? 0 : semi_cost;
|
||||
}
|
||||
if (junc)
|
||||
for (t = 0; t < tlen; ++t)
|
||||
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t]&1)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t]&8)))
|
||||
((int8_t*)acceptor)[t] += junc_bonus;
|
||||
}
|
||||
}
|
||||
|
||||
@@ -364,9 +407,9 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
if (with_cigar) { // backtrack
|
||||
int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
|
||||
if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY))
|
||||
ksw_backtrack(km, 1, rev_cigar, 1, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||
ksw_backtrack(km, 1, rev_cigar, long_thres, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||
else if (ez->max_t >= 0 && ez->max_q >= 0)
|
||||
ksw_backtrack(km, 1, rev_cigar, 1, (uint8_t*)p, off, off_end, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||
ksw_backtrack(km, 1, rev_cigar, long_thres, (uint8_t*)p, off, off_end, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||
kfree(km, mem2); kfree(km, off);
|
||||
}
|
||||
}
|
||||
|
||||
+13
-5
@@ -3,15 +3,23 @@
|
||||
#include "ksw2.h"
|
||||
|
||||
#ifdef __SSE2__
|
||||
#ifdef USE_SIMDE
|
||||
#include <simde/x86/sse2.h>
|
||||
#else
|
||||
#include <emmintrin.h>
|
||||
#endif
|
||||
|
||||
#ifdef KSW_SSE2_ONLY
|
||||
#undef __SSE4_1__
|
||||
#endif
|
||||
|
||||
#ifdef __SSE4_1__
|
||||
#ifdef USE_SIMDE
|
||||
#include <simde/x86/sse4.1.h>
|
||||
#else
|
||||
#include <smmintrin.h>
|
||||
#endif
|
||||
#endif
|
||||
|
||||
#ifdef KSW_CPU_DISPATCH
|
||||
#ifdef __SSE4_1__
|
||||
@@ -65,7 +73,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
flag16_ = _mm_set1_epi8(0x10);
|
||||
sc_mch_ = _mm_set1_epi8(mat[0]);
|
||||
sc_mis_ = _mm_set1_epi8(mat[1]);
|
||||
sc_N_ = _mm_set1_epi8(-e);
|
||||
sc_N_ = mat[m*m-1] == 0? _mm_set1_epi8(-e) : _mm_set1_epi8(mat[m*m-1]);
|
||||
m1_ = _mm_set1_epi8(m - 1); // wildcard
|
||||
max_sc_ = _mm_set1_epi8(mat[0] + (q + e) * 2);
|
||||
|
||||
@@ -89,7 +97,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
for (t = 0; t < tlen_ * 16; ++t) H[t] = KSW_NEG_INF;
|
||||
}
|
||||
if (with_cigar) {
|
||||
mem2 = (uint8_t*)kmalloc(km, ((qlen + tlen - 1) * n_col_ + 1) * 16);
|
||||
mem2 = (uint8_t*)kmalloc(km, ((size_t)(qlen + tlen - 1) * n_col_ + 1) * 16);
|
||||
p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4);
|
||||
off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int) * 2);
|
||||
off_end = off + qlen + tlen - 1;
|
||||
@@ -169,7 +177,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
#endif
|
||||
}
|
||||
} else if (!(flag&KSW_EZ_RIGHT)) { // gap left-alignment
|
||||
__m128i *pr = p + r * n_col_ - st_;
|
||||
__m128i *pr = p + (size_t)r * n_col_ - st_;
|
||||
off[r] = st, off_end[r] = en;
|
||||
for (t = st_; t <= en_; ++t) {
|
||||
__m128i d, z, a, b, xt1, vt1, ut, tmp;
|
||||
@@ -195,7 +203,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
_mm_store_si128(&pr[t], d);
|
||||
}
|
||||
} else { // gap right-alignment
|
||||
__m128i *pr = p + r * n_col_ - st_;
|
||||
__m128i *pr = p + (size_t)r * n_col_ - st_;
|
||||
off[r] = st, off_end[r] = en;
|
||||
for (t = st_; t <= en_; ++t) {
|
||||
__m128i d, z, a, b, xt1, vt1, ut, tmp;
|
||||
@@ -293,7 +301,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
|
||||
if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY)) {
|
||||
ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||
} else if (!ez->zdropped && (flag&KSW_EZ_EXTZ_ONLY) && ez->mqe + end_bonus > ez->max) {
|
||||
} else if (!ez->zdropped && (flag&KSW_EZ_EXTZ_ONLY) && ez->mqe + end_bonus > (int)ez->max) {
|
||||
ez->reach_end = 1;
|
||||
ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, ez->mqe_t, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||
} else if (ez->max_t >= 0 && ez->max_q >= 0) {
|
||||
|
||||
+6
-1
@@ -1,9 +1,14 @@
|
||||
#include <stdlib.h>
|
||||
#include <stdint.h>
|
||||
#include <string.h>
|
||||
#include <emmintrin.h>
|
||||
#include "ksw2.h"
|
||||
|
||||
#ifdef USE_SIMDE
|
||||
#include <simde/x86/sse2.h>
|
||||
#else
|
||||
#include <emmintrin.h>
|
||||
#endif
|
||||
|
||||
#ifdef __GNUC__
|
||||
#define LIKELY(x) __builtin_expect((x),1)
|
||||
#define UNLIKELY(x) __builtin_expect((x),0)
|
||||
|
||||
@@ -2,6 +2,7 @@
|
||||
#include <stdlib.h>
|
||||
#include <limits.h>
|
||||
#include <stdint.h>
|
||||
#include "kthread.h"
|
||||
|
||||
#if (defined(WIN32) || defined(_WIN32)) && defined(_MSC_VER)
|
||||
#define __sync_fetch_and_add(ptr, addend) _InterlockedExchangeAdd((void*)ptr, addend)
|
||||
|
||||
Submodule
+1
Submodule lib/simde added at b30129b3b4
@@ -1,12 +1,13 @@
|
||||
#include <stdlib.h>
|
||||
#include <stdio.h>
|
||||
#include <string.h>
|
||||
#include <errno.h>
|
||||
#include "bseq.h"
|
||||
#include "minimap.h"
|
||||
#include "mmpriv.h"
|
||||
#include "getopt.h"
|
||||
#include "ketopt.h"
|
||||
|
||||
#define MM_VERSION "2.3-r531"
|
||||
#define MM_VERSION "2.18-r1015"
|
||||
|
||||
#ifdef __linux__
|
||||
#include <sys/resource.h>
|
||||
@@ -22,54 +23,97 @@ void liftrlimit()
|
||||
void liftrlimit() {}
|
||||
#endif
|
||||
|
||||
static struct option long_options[] = {
|
||||
{ "bucket-bits", required_argument, 0, 0 },
|
||||
{ "mb-size", required_argument, 0, 'K' },
|
||||
{ "seed", required_argument, 0, 0 },
|
||||
{ "no-kalloc", no_argument, 0, 0 },
|
||||
{ "print-qname", no_argument, 0, 0 },
|
||||
{ "no-self", no_argument, 0, 0 },
|
||||
{ "print-seeds", no_argument, 0, 0 },
|
||||
{ "max-chain-skip", required_argument, 0, 0 },
|
||||
{ "min-dp-len", required_argument, 0, 0 },
|
||||
{ "print-aln-seq", no_argument, 0, 0 },
|
||||
{ "splice", no_argument, 0, 0 },
|
||||
{ "cost-non-gt-ag", required_argument, 0, 0 },
|
||||
{ "no-long-join", no_argument, 0, 0 },
|
||||
{ "sr", no_argument, 0, 0 },
|
||||
{ "frag", optional_argument, 0, 0 },
|
||||
{ "secondary", optional_argument, 0, 0 },
|
||||
{ "cs", optional_argument, 0, 0 },
|
||||
{ "end-bonus", required_argument, 0, 0 },
|
||||
{ "help", no_argument, 0, 'h' },
|
||||
{ "max-intron-len", required_argument, 0, 'G' },
|
||||
{ "version", no_argument, 0, 'V' },
|
||||
{ "min-count", required_argument, 0, 'n' },
|
||||
{ "min-chain-score",required_argument, 0, 'm' },
|
||||
{ "mask-level", required_argument, 0, 'M' },
|
||||
{ "min-dp-score", required_argument, 0, 's' },
|
||||
{ "sam", no_argument, 0, 'a' },
|
||||
{ 0, 0, 0, 0}
|
||||
static ko_longopt_t long_options[] = {
|
||||
{ "bucket-bits", ko_required_argument, 300 },
|
||||
{ "mb-size", ko_required_argument, 'K' },
|
||||
{ "seed", ko_required_argument, 302 },
|
||||
{ "no-kalloc", ko_no_argument, 303 },
|
||||
{ "print-qname", ko_no_argument, 304 },
|
||||
{ "no-self", ko_no_argument, 'D' },
|
||||
{ "print-seeds", ko_no_argument, 306 },
|
||||
{ "max-chain-skip", ko_required_argument, 307 },
|
||||
{ "min-dp-len", ko_required_argument, 308 },
|
||||
{ "print-aln-seq", ko_no_argument, 309 },
|
||||
{ "splice", ko_no_argument, 310 },
|
||||
{ "cost-non-gt-ag", ko_required_argument, 'C' },
|
||||
{ "no-long-join", ko_no_argument, 312 },
|
||||
{ "sr", ko_no_argument, 313 },
|
||||
{ "frag", ko_required_argument, 314 },
|
||||
{ "secondary", ko_required_argument, 315 },
|
||||
{ "cs", ko_optional_argument, 316 },
|
||||
{ "end-bonus", ko_required_argument, 317 },
|
||||
{ "no-pairing", ko_no_argument, 318 },
|
||||
{ "splice-flank", ko_required_argument, 319 },
|
||||
{ "idx-no-seq", ko_no_argument, 320 },
|
||||
{ "end-seed-pen", ko_required_argument, 321 },
|
||||
{ "for-only", ko_no_argument, 322 },
|
||||
{ "rev-only", ko_no_argument, 323 },
|
||||
{ "heap-sort", ko_required_argument, 324 },
|
||||
{ "all-chain", ko_no_argument, 'P' },
|
||||
{ "dual", ko_required_argument, 326 },
|
||||
{ "max-clip-ratio", ko_required_argument, 327 },
|
||||
{ "min-occ-floor", ko_required_argument, 328 },
|
||||
{ "MD", ko_no_argument, 329 },
|
||||
{ "lj-min-ratio", ko_required_argument, 330 },
|
||||
{ "score-N", ko_required_argument, 331 },
|
||||
{ "eqx", ko_no_argument, 332 },
|
||||
{ "paf-no-hit", ko_no_argument, 333 },
|
||||
{ "split-prefix", ko_required_argument, 334 },
|
||||
{ "no-end-flt", ko_no_argument, 335 },
|
||||
{ "hard-mask-level",ko_no_argument, 336 },
|
||||
{ "cap-sw-mem", ko_required_argument, 337 },
|
||||
{ "max-qlen", ko_required_argument, 338 },
|
||||
{ "max-chain-iter", ko_required_argument, 339 },
|
||||
{ "junc-bed", ko_required_argument, 340 },
|
||||
{ "junc-bonus", ko_required_argument, 341 },
|
||||
{ "sam-hit-only", ko_no_argument, 342 },
|
||||
{ "chain-gap-scale",ko_required_argument, 343 },
|
||||
{ "alt", ko_required_argument, 344 },
|
||||
{ "alt-drop", ko_required_argument, 345 },
|
||||
{ "mask-len", ko_required_argument, 346 },
|
||||
{ "help", ko_no_argument, 'h' },
|
||||
{ "max-intron-len", ko_required_argument, 'G' },
|
||||
{ "version", ko_no_argument, 'V' },
|
||||
{ "min-count", ko_required_argument, 'n' },
|
||||
{ "min-chain-score",ko_required_argument, 'm' },
|
||||
{ "mask-level", ko_required_argument, 'M' },
|
||||
{ "min-dp-score", ko_required_argument, 's' },
|
||||
{ "sam", ko_no_argument, 'a' },
|
||||
{ 0, 0, 0 }
|
||||
};
|
||||
|
||||
static inline int64_t mm_parse_num(const char *str)
|
||||
{
|
||||
double x;
|
||||
char *p;
|
||||
x = strtod(optarg, &p);
|
||||
x = strtod(str, &p);
|
||||
if (*p == 'G' || *p == 'g') x *= 1e9;
|
||||
else if (*p == 'M' || *p == 'm') x *= 1e6;
|
||||
else if (*p == 'K' || *p == 'k') x *= 1e3;
|
||||
return (int64_t)(x + .499);
|
||||
}
|
||||
|
||||
static inline void yes_or_no(mm_mapopt_t *opt, int flag, int long_idx, const char *arg, int yes_to_set)
|
||||
{
|
||||
if (yes_to_set) {
|
||||
if (strcmp(arg, "yes") == 0 || strcmp(arg, "y") == 0) opt->flag |= flag;
|
||||
else if (strcmp(arg, "no") == 0 || strcmp(arg, "n") == 0) opt->flag &= ~flag;
|
||||
else fprintf(stderr, "[WARNING]\033[1;31m option '--%s' only accepts 'yes' or 'no'.\033[0m\n", long_options[long_idx].name);
|
||||
} else {
|
||||
if (strcmp(arg, "yes") == 0 || strcmp(arg, "y") == 0) opt->flag &= ~flag;
|
||||
else if (strcmp(arg, "no") == 0 || strcmp(arg, "n") == 0) opt->flag |= flag;
|
||||
else fprintf(stderr, "[WARNING]\033[1;31m option '--%s' only accepts 'yes' or 'no'.\033[0m\n", long_options[long_idx].name);
|
||||
}
|
||||
}
|
||||
|
||||
int main(int argc, char *argv[])
|
||||
{
|
||||
const char *opt_str = "2aSw:k:K:t:r:f:Vv:g:G:I:d:XT:s:x:Hcp:M:n:z:A:B:O:E:m:N:Qu:R:hF:i:L";
|
||||
const char *opt_str = "2aSDw:k:K:t:r:f:Vv:g:G:I:d:XT:s:x:Hcp:M:n:z:A:B:O:E:m:N:Qu:R:hF:LC:yYPo:";
|
||||
ketopt_t o = KETOPT_INIT;
|
||||
mm_mapopt_t opt;
|
||||
mm_idxopt_t ipt;
|
||||
int i, c, n_threads = 3, long_idx;
|
||||
char *fnw = 0, *rg = 0, *s;
|
||||
int i, c, n_threads = 3, n_parts, old_best_n = -1;
|
||||
char *fnw = 0, *rg = 0, *junc_bed = 0, *s, *alt_list = 0;
|
||||
FILE *fp_help = stderr;
|
||||
mm_idx_reader_t *idx_rdr;
|
||||
mm_idx_t *mi;
|
||||
@@ -79,81 +123,123 @@ int main(int argc, char *argv[])
|
||||
mm_realtime0 = realtime();
|
||||
mm_set_opt(0, &ipt, &opt);
|
||||
|
||||
while ((c = getopt_long(argc, argv, opt_str, long_options, &long_idx)) >= 0) // apply option -x/preset first
|
||||
while ((c = ketopt(&o, argc, argv, 1, opt_str, long_options)) >= 0) { // test command line options and apply option -x/preset first
|
||||
if (c == 'x') {
|
||||
if (mm_set_opt(optarg, &ipt, &opt) < 0) {
|
||||
fprintf(stderr, "[ERROR] unknown preset '%s'\n", optarg);
|
||||
if (mm_set_opt(o.arg, &ipt, &opt) < 0) {
|
||||
fprintf(stderr, "[ERROR] unknown preset '%s'\n", o.arg);
|
||||
return 1;
|
||||
}
|
||||
break;
|
||||
} else if (c == ':') {
|
||||
fprintf(stderr, "[ERROR] missing option argument\n");
|
||||
return 1;
|
||||
} else if (c == '?') {
|
||||
fprintf(stderr, "[ERROR] unknown option in \"%s\"\n", argv[o.i - 1]);
|
||||
return 1;
|
||||
}
|
||||
optreset = 1;
|
||||
}
|
||||
o = KETOPT_INIT;
|
||||
|
||||
while ((c = getopt_long(argc, argv, opt_str, long_options, &long_idx)) >= 0) {
|
||||
if (c == 'w') ipt.w = atoi(optarg);
|
||||
else if (c == 'k') ipt.k = atoi(optarg);
|
||||
else if (c == 'H') ipt.is_hpc = 1;
|
||||
else if (c == 'd') fnw = optarg; // the above are indexing related options, except -I
|
||||
else if (c == 'r') opt.bw = (int)mm_parse_num(optarg);
|
||||
else if (c == 't') n_threads = atoi(optarg);
|
||||
else if (c == 'v') mm_verbose = atoi(optarg);
|
||||
else if (c == 'g') opt.max_gap = (int)mm_parse_num(optarg);
|
||||
else if (c == 'G') mm_mapopt_max_intron_len(&opt, (int)mm_parse_num(optarg));
|
||||
else if (c == 'F') opt.max_frag_len = (int)mm_parse_num(optarg);
|
||||
else if (c == 'i') opt.min_iden = atof(optarg);
|
||||
else if (c == 'N') opt.best_n = atoi(optarg);
|
||||
else if (c == 'p') opt.pri_ratio = atof(optarg);
|
||||
else if (c == 'M') opt.mask_level = atof(optarg);
|
||||
while ((c = ketopt(&o, argc, argv, 1, opt_str, long_options)) >= 0) {
|
||||
if (c == 'w') ipt.w = atoi(o.arg);
|
||||
else if (c == 'k') ipt.k = atoi(o.arg);
|
||||
else if (c == 'H') ipt.flag |= MM_I_HPC;
|
||||
else if (c == 'd') fnw = o.arg; // the above are indexing related options, except -I
|
||||
else if (c == 'r') opt.bw = (int)mm_parse_num(o.arg);
|
||||
else if (c == 't') n_threads = atoi(o.arg);
|
||||
else if (c == 'v') mm_verbose = atoi(o.arg);
|
||||
else if (c == 'g') opt.max_gap = (int)mm_parse_num(o.arg);
|
||||
else if (c == 'G') mm_mapopt_max_intron_len(&opt, (int)mm_parse_num(o.arg));
|
||||
else if (c == 'F') opt.max_frag_len = (int)mm_parse_num(o.arg);
|
||||
else if (c == 'N') old_best_n = opt.best_n, opt.best_n = atoi(o.arg);
|
||||
else if (c == 'p') opt.pri_ratio = atof(o.arg);
|
||||
else if (c == 'M') opt.mask_level = atof(o.arg);
|
||||
else if (c == 'c') opt.flag |= MM_F_OUT_CG | MM_F_CIGAR;
|
||||
else if (c == 'X') opt.flag |= MM_F_AVA | MM_F_NO_SELF;
|
||||
else if (c == 'D') opt.flag |= MM_F_NO_DIAG;
|
||||
else if (c == 'P') opt.flag |= MM_F_ALL_CHAINS;
|
||||
else if (c == 'X') opt.flag |= MM_F_ALL_CHAINS | MM_F_NO_DIAG | MM_F_NO_DUAL | MM_F_NO_LJOIN; // -D -P --no-long-join --dual=no
|
||||
else if (c == 'a') opt.flag |= MM_F_OUT_SAM | MM_F_CIGAR;
|
||||
else if (c == 'Q') opt.flag |= MM_F_NO_QUAL;
|
||||
else if (c == 'Y') opt.flag |= MM_F_SOFTCLIP;
|
||||
else if (c == 'L') opt.flag |= MM_F_LONG_CIGAR;
|
||||
else if (c == 'T') opt.sdust_thres = atoi(optarg);
|
||||
else if (c == 'n') opt.min_cnt = atoi(optarg);
|
||||
else if (c == 'm') opt.min_chain_score = atoi(optarg);
|
||||
else if (c == 'A') opt.a = atoi(optarg);
|
||||
else if (c == 'B') opt.b = atoi(optarg);
|
||||
else if (c == 'z') opt.zdrop = atoi(optarg);
|
||||
else if (c == 's') opt.min_dp_max = atoi(optarg);
|
||||
else if (c == 'I') ipt.batch_size = mm_parse_num(optarg);
|
||||
else if (c == 'K') opt.mini_batch_size = (int)mm_parse_num(optarg);
|
||||
else if (c == 'R') rg = optarg;
|
||||
else if (c == 'y') opt.flag |= MM_F_COPY_COMMENT;
|
||||
else if (c == 'T') opt.sdust_thres = atoi(o.arg);
|
||||
else if (c == 'n') opt.min_cnt = atoi(o.arg);
|
||||
else if (c == 'm') opt.min_chain_score = atoi(o.arg);
|
||||
else if (c == 'A') opt.a = atoi(o.arg);
|
||||
else if (c == 'B') opt.b = atoi(o.arg);
|
||||
else if (c == 's') opt.min_dp_max = atoi(o.arg);
|
||||
else if (c == 'C') opt.noncan = atoi(o.arg);
|
||||
else if (c == 'I') ipt.batch_size = mm_parse_num(o.arg);
|
||||
else if (c == 'K') opt.mini_batch_size = mm_parse_num(o.arg);
|
||||
else if (c == 'R') rg = o.arg;
|
||||
else if (c == 'h') fp_help = stdout;
|
||||
else if (c == '2') opt.flag |= MM_F_2_IO_THREADS;
|
||||
else if (c == 0 && long_idx == 0) ipt.bucket_bits = atoi(optarg); // --bucket-bits
|
||||
else if (c == 0 && long_idx == 2) opt.seed = atoi(optarg); // --seed
|
||||
else if (c == 0 && long_idx == 3) mm_dbg_flag |= MM_DBG_NO_KALLOC; // --no-kalloc
|
||||
else if (c == 0 && long_idx == 4) mm_dbg_flag |= MM_DBG_PRINT_QNAME; // --print-qname
|
||||
else if (c == 0 && long_idx == 5) opt.flag |= MM_F_NO_SELF; // --no-self
|
||||
else if (c == 0 && long_idx == 6) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_SEED, n_threads = 1; // --print-seed
|
||||
else if (c == 0 && long_idx == 7) opt.max_chain_skip = atoi(optarg); // --max-chain-skip
|
||||
else if (c == 0 && long_idx == 8) opt.min_ksw_len = atoi(optarg); // --min-dp-len
|
||||
else if (c == 0 && long_idx == 9) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_ALN_SEQ; // --print-aln-seq
|
||||
else if (c == 0 && long_idx ==10) opt.flag |= MM_F_SPLICE; // --splice
|
||||
else if (c == 0 && long_idx ==11) opt.noncan = atoi(optarg); // --cost-non-gt-ag
|
||||
else if (c == 0 && long_idx ==12) opt.flag |= MM_F_NO_LJOIN; // --no-long-join
|
||||
else if (c == 0 && long_idx ==13) opt.flag |= MM_F_SR; // --sr
|
||||
else if (c == 0 && long_idx ==17) opt.end_bonus = atoi(optarg); // --end-bonus
|
||||
else if (c == 0 && long_idx == 14) { // --frag
|
||||
if (optarg == 0 || strcmp(optarg, "yes") == 0 || strcmp(optarg, "y") == 0)
|
||||
opt.flag |= MM_F_FRAG_MODE;
|
||||
else opt.flag &= ~MM_F_FRAG_MODE;
|
||||
} else if (c == 0 && long_idx == 15) { // --secondary
|
||||
if (optarg == 0 || strcmp(optarg, "yes") == 0 || strcmp(optarg, "y") == 0)
|
||||
opt.flag &= ~MM_F_NO_PRINT_2ND;
|
||||
else opt.flag |= MM_F_NO_PRINT_2ND;
|
||||
} else if (c == 0 && long_idx == 16) { // --cs
|
||||
else if (c == 'o') {
|
||||
if (strcmp(o.arg, "-") != 0) {
|
||||
if (freopen(o.arg, "wb", stdout) == NULL) {
|
||||
fprintf(stderr, "[ERROR]\033[1;31m failed to write the output to file '%s'\033[0m: %s\n", o.arg, strerror(errno));
|
||||
exit(1);
|
||||
}
|
||||
}
|
||||
}
|
||||
else if (c == 300) ipt.bucket_bits = atoi(o.arg); // --bucket-bits
|
||||
else if (c == 302) opt.seed = atoi(o.arg); // --seed
|
||||
else if (c == 303) mm_dbg_flag |= MM_DBG_NO_KALLOC; // --no-kalloc
|
||||
else if (c == 304) mm_dbg_flag |= MM_DBG_PRINT_QNAME; // --print-qname
|
||||
else if (c == 306) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_SEED, n_threads = 1; // --print-seed
|
||||
else if (c == 307) opt.max_chain_skip = atoi(o.arg); // --max-chain-skip
|
||||
else if (c == 339) opt.max_chain_iter = atoi(o.arg); // --max-chain-iter
|
||||
else if (c == 308) opt.min_ksw_len = atoi(o.arg); // --min-dp-len
|
||||
else if (c == 309) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_ALN_SEQ, n_threads = 1; // --print-aln-seq
|
||||
else if (c == 310) opt.flag |= MM_F_SPLICE; // --splice
|
||||
else if (c == 312) opt.flag |= MM_F_NO_LJOIN; // --no-long-join
|
||||
else if (c == 313) opt.flag |= MM_F_SR; // --sr
|
||||
else if (c == 317) opt.end_bonus = atoi(o.arg); // --end-bonus
|
||||
else if (c == 318) opt.flag |= MM_F_INDEPEND_SEG; // --no-pairing
|
||||
else if (c == 320) ipt.flag |= MM_I_NO_SEQ; // --idx-no-seq
|
||||
else if (c == 321) opt.anchor_ext_shift = atoi(o.arg); // --end-seed-pen
|
||||
else if (c == 322) opt.flag |= MM_F_FOR_ONLY; // --for-only
|
||||
else if (c == 323) opt.flag |= MM_F_REV_ONLY; // --rev-only
|
||||
else if (c == 327) opt.max_clip_ratio = atof(o.arg); // --max-clip-ratio
|
||||
else if (c == 328) opt.min_mid_occ = atoi(o.arg); // --min-occ-floor
|
||||
else if (c == 329) opt.flag |= MM_F_OUT_MD; // --MD
|
||||
else if (c == 330) opt.min_join_flank_ratio = atof(o.arg); // --lj-min-ratio
|
||||
else if (c == 331) opt.sc_ambi = atoi(o.arg); // --score-N
|
||||
else if (c == 332) opt.flag |= MM_F_EQX; // --eqx
|
||||
else if (c == 333) opt.flag |= MM_F_PAF_NO_HIT; // --paf-no-hit
|
||||
else if (c == 334) opt.split_prefix = o.arg; // --split-prefix
|
||||
else if (c == 335) opt.flag |= MM_F_NO_END_FLT; // --no-end-flt
|
||||
else if (c == 336) opt.flag |= MM_F_HARD_MLEVEL; // --hard-mask-level
|
||||
else if (c == 337) opt.max_sw_mat = mm_parse_num(o.arg); // --cap-sw-mat
|
||||
else if (c == 338) opt.max_qlen = mm_parse_num(o.arg); // --max-qlen
|
||||
else if (c == 340) junc_bed = o.arg; // --junc-bed
|
||||
else if (c == 341) opt.junc_bonus = atoi(o.arg); // --junc-bonus
|
||||
else if (c == 342) opt.flag |= MM_F_SAM_HIT_ONLY; // --sam-hit-only
|
||||
else if (c == 343) opt.chain_gap_scale = atof(o.arg); // --chain-gap-scale
|
||||
else if (c == 344) alt_list = o.arg; // --alt
|
||||
else if (c == 345) opt.alt_drop = atof(o.arg); // --alt-drop
|
||||
else if (c == 346) opt.mask_len = mm_parse_num(o.arg); // --mask-len
|
||||
else if (c == 314) { // --frag
|
||||
yes_or_no(&opt, MM_F_FRAG_MODE, o.longidx, o.arg, 1);
|
||||
} else if (c == 315) { // --secondary
|
||||
yes_or_no(&opt, MM_F_NO_PRINT_2ND, o.longidx, o.arg, 0);
|
||||
} else if (c == 316) { // --cs
|
||||
opt.flag |= MM_F_OUT_CS | MM_F_CIGAR;
|
||||
if (optarg == 0 || strcmp(optarg, "short") == 0) {
|
||||
if (o.arg == 0 || strcmp(o.arg, "short") == 0) {
|
||||
opt.flag &= ~MM_F_OUT_CS_LONG;
|
||||
} else if (strcmp(optarg, "long") == 0) {
|
||||
} else if (strcmp(o.arg, "long") == 0) {
|
||||
opt.flag |= MM_F_OUT_CS_LONG;
|
||||
} else if (strcmp(optarg, "none") == 0) {
|
||||
} else if (strcmp(o.arg, "none") == 0) {
|
||||
opt.flag &= ~MM_F_OUT_CS;
|
||||
} else if (mm_verbose >= 2) {
|
||||
fprintf(stderr, "[WARNING]\033[1;31m --cs only takes 'short' or 'long'. Invalid values are assumed to be 'short'.\033[0m\n");
|
||||
}
|
||||
} else if (c == 319) { // --splice-flank
|
||||
yes_or_no(&opt, MM_F_SPLICE_FLANK, o.longidx, o.arg, 1);
|
||||
} else if (c == 324) { // --heap-sort
|
||||
yes_or_no(&opt, MM_F_HEAP_SORT, o.longidx, o.arg, 1);
|
||||
} else if (c == 326) { // --dual
|
||||
yes_or_no(&opt, MM_F_NO_DUAL, o.longidx, o.arg, 0);
|
||||
} else if (c == 'S') {
|
||||
opt.flag |= MM_F_OUT_CS | MM_F_CIGAR | MM_F_OUT_CS_LONG;
|
||||
if (mm_verbose >= 2)
|
||||
@@ -164,24 +250,27 @@ int main(int argc, char *argv[])
|
||||
} else if (c == 'f') {
|
||||
double x;
|
||||
char *p;
|
||||
x = strtod(optarg, &p);
|
||||
x = strtod(o.arg, &p);
|
||||
if (x < 1.0) opt.mid_occ_frac = x, opt.mid_occ = 0;
|
||||
else opt.mid_occ = (int)(x + .499);
|
||||
if (*p == ',') opt.max_occ = (int)(strtod(p+1, &p) + .499);
|
||||
} else if (c == 'u') {
|
||||
if (*optarg == 'b') opt.flag |= MM_F_SPLICE_FOR|MM_F_SPLICE_REV; // both strands
|
||||
else if (*optarg == 'f') opt.flag |= MM_F_SPLICE_FOR, opt.flag &= ~MM_F_SPLICE_REV; // match GT-AG
|
||||
else if (*optarg == 'r') opt.flag |= MM_F_SPLICE_REV, opt.flag &= ~MM_F_SPLICE_FOR; // match CT-AC (reverse complement of GT-AG)
|
||||
else if (*optarg == 'n') opt.flag &= ~(MM_F_SPLICE_FOR|MM_F_SPLICE_REV); // don't try to match the GT-AG signal
|
||||
if (*o.arg == 'b') opt.flag |= MM_F_SPLICE_FOR|MM_F_SPLICE_REV; // both strands
|
||||
else if (*o.arg == 'f') opt.flag |= MM_F_SPLICE_FOR, opt.flag &= ~MM_F_SPLICE_REV; // match GT-AG
|
||||
else if (*o.arg == 'r') opt.flag |= MM_F_SPLICE_REV, opt.flag &= ~MM_F_SPLICE_FOR; // match CT-AC (reverse complement of GT-AG)
|
||||
else if (*o.arg == 'n') opt.flag &= ~(MM_F_SPLICE_FOR|MM_F_SPLICE_REV); // don't try to match the GT-AG signal
|
||||
else {
|
||||
fprintf(stderr, "[ERROR]\033[1;31m unrecognized cDNA direction\033[0m\n");
|
||||
return 1;
|
||||
}
|
||||
} else if (c == 'z') {
|
||||
opt.zdrop = opt.zdrop_inv = strtol(o.arg, &s, 10);
|
||||
if (*s == ',') opt.zdrop_inv = strtol(s + 1, &s, 10);
|
||||
} else if (c == 'O') {
|
||||
opt.q = opt.q2 = strtol(optarg, &s, 10);
|
||||
opt.q = opt.q2 = strtol(o.arg, &s, 10);
|
||||
if (*s == ',') opt.q2 = strtol(s + 1, &s, 10);
|
||||
} else if (c == 'E') {
|
||||
opt.e = opt.e2 = strtol(optarg, &s, 10);
|
||||
opt.e = opt.e2 = strtol(o.arg, &s, 10);
|
||||
if (*s == ',') opt.e2 = strtol(s + 1, &s, 10);
|
||||
}
|
||||
}
|
||||
@@ -189,14 +278,22 @@ int main(int argc, char *argv[])
|
||||
fprintf(stderr, "[ERROR]\033[1;31m --splice and --frag should not be specified at the same time.\033[0m\n");
|
||||
return 1;
|
||||
}
|
||||
if (!fnw && !(opt.flag&MM_F_CIGAR))
|
||||
ipt.flag |= MM_I_NO_SEQ;
|
||||
if (mm_check_opt(&ipt, &opt) < 0)
|
||||
return 1;
|
||||
if (opt.best_n == 0) {
|
||||
fprintf(stderr, "[WARNING]\033[1;31m changed '-N 0' to '-N %d --secondary=no'.\033[0m\n", old_best_n);
|
||||
opt.best_n = old_best_n, opt.flag |= MM_F_NO_PRINT_2ND;
|
||||
}
|
||||
|
||||
if (argc == optind || fp_help == stdout) {
|
||||
if (argc == o.ind || fp_help == stdout) {
|
||||
fprintf(fp_help, "Usage: minimap2 [options] <target.fa>|<target.idx> [query.fa] [...]\n");
|
||||
fprintf(fp_help, "Options:\n");
|
||||
fprintf(fp_help, " Indexing:\n");
|
||||
fprintf(fp_help, " -H use homopolymer-compressed k-mer\n");
|
||||
fprintf(fp_help, " -H use homopolymer-compressed k-mer (preferrable for PacBio)\n");
|
||||
fprintf(fp_help, " -k INT k-mer size (no larger than 28) [%d]\n", ipt.k);
|
||||
fprintf(fp_help, " -w INT minizer window size [%d]\n", ipt.w);
|
||||
fprintf(fp_help, " -w INT minimizer window size [%d]\n", ipt.w);
|
||||
fprintf(fp_help, " -I NUM split index for every ~NUM input bases [4G]\n");
|
||||
fprintf(fp_help, " -d FILE dump index to FILE []\n");
|
||||
fprintf(fp_help, " Mapping:\n");
|
||||
@@ -216,75 +313,114 @@ int main(int argc, char *argv[])
|
||||
fprintf(fp_help, " -B INT mismatch penalty [%d]\n", opt.b);
|
||||
fprintf(fp_help, " -O INT[,INT] gap open penalty [%d,%d]\n", opt.q, opt.q2);
|
||||
fprintf(fp_help, " -E INT[,INT] gap extension penalty; a k-long gap costs min{O1+k*E1,O2+k*E2} [%d,%d]\n", opt.e, opt.e2);
|
||||
fprintf(fp_help, " -z INT Z-drop score [%d]\n", opt.zdrop);
|
||||
fprintf(fp_help, " -z INT[,INT] Z-drop score and inversion Z-drop score [%d,%d]\n", opt.zdrop, opt.zdrop_inv);
|
||||
fprintf(fp_help, " -s INT minimal peak DP alignment score [%d]\n", opt.min_dp_max);
|
||||
fprintf(fp_help, " -u CHAR how to find GT-AG. f:transcript strand, b:both strands, n:don't match GT-AG [n]\n");
|
||||
fprintf(fp_help, " -i FLOAT min identity (mapQ reduced to 0 if below) [0]\n");
|
||||
fprintf(fp_help, " Input/Output:\n");
|
||||
fprintf(fp_help, " -a output in the SAM format (PAF by default)\n");
|
||||
fprintf(fp_help, " -Q don't output base quality in SAM\n");
|
||||
fprintf(fp_help, " -o FILE output alignments to FILE [stdout]\n");
|
||||
fprintf(fp_help, " -L write CIGAR with >65535 ops at the CG tag\n");
|
||||
fprintf(fp_help, " -R STR SAM read group line in a format like '@RG\\tID:foo\\tSM:bar' []\n");
|
||||
fprintf(fp_help, " -c output CIGAR in PAF\n");
|
||||
fprintf(fp_help, " --cs[=STR] output the cs tag; STR is 'short' (if absent) or 'long' [none]\n");
|
||||
fprintf(fp_help, " --MD output the MD tag\n");
|
||||
fprintf(fp_help, " --eqx write =/X CIGAR operators\n");
|
||||
fprintf(fp_help, " -Y use soft clipping for supplementary alignments\n");
|
||||
fprintf(fp_help, " -t INT number of threads [%d]\n", n_threads);
|
||||
fprintf(fp_help, " -K NUM minibatch size for mapping [500M]\n");
|
||||
// fprintf(fp_help, " -v INT verbose level [%d]\n", mm_verbose);
|
||||
fprintf(fp_help, " --version show version number\n");
|
||||
fprintf(fp_help, " Preset:\n");
|
||||
fprintf(fp_help, " -x STR preset (always applied before other options) []\n");
|
||||
fprintf(fp_help, " map-pb: -Hk19 (PacBio vs reference mapping)\n");
|
||||
fprintf(fp_help, " map-ont: -k15 (Oxford Nanopore vs reference mapping)\n");
|
||||
fprintf(fp_help, " asm5: -k19 -w19 -A1 -B19 -O39,81 -E3,1 -s200 -z200 (asm to ref mapping; break at 5%% div.)\n");
|
||||
fprintf(fp_help, " asm10: -k19 -w19 -A1 -B9 -O16,41 -E2,1 -s200 -z200 (asm to ref mapping; break at 10%% div.)\n");
|
||||
fprintf(fp_help, " ava-pb: -Hk19 -w5 -Xp0 -m100 -g10000 --max-chain-skip 25 (PacBio read overlap)\n");
|
||||
fprintf(fp_help, " ava-ont: -k15 -w5 -Xp0 -m100 -g10000 --max-chain-skip 25 (ONT read overlap)\n");
|
||||
fprintf(fp_help, " splice: long-read spliced alignment (see minimap2.1 for details)\n");
|
||||
fprintf(fp_help, " sr: short single-end reads without splicing (see minimap2.1 for details)\n");
|
||||
fprintf(fp_help, "\nSee `man ./minimap2.1' for detailed description of command-line options.\n");
|
||||
fprintf(fp_help, " -x STR preset (always applied before other options; see minimap2.1 for details) []\n");
|
||||
fprintf(fp_help, " - map-pb/map-ont - PacBio/Nanopore vs reference mapping\n");
|
||||
fprintf(fp_help, " - ava-pb/ava-ont - PacBio/Nanopore read overlap\n");
|
||||
fprintf(fp_help, " - asm5/asm10/asm20 - asm-to-ref mapping, for ~0.1/1/5%% sequence divergence\n");
|
||||
fprintf(fp_help, " - splice/splice:hq - long-read/Pacbio-CCS spliced alignment\n");
|
||||
fprintf(fp_help, " - sr - genomic short-read mapping\n");
|
||||
fprintf(fp_help, "\nSee `man ./minimap2.1' for detailed description of these and other advanced command-line options.\n");
|
||||
return fp_help == stdout? 0 : 1;
|
||||
}
|
||||
|
||||
idx_rdr = mm_idx_reader_open(argv[optind], &ipt, fnw);
|
||||
if (idx_rdr == 0) {
|
||||
fprintf(stderr, "[ERROR] failed to open file '%s'\n", argv[optind]);
|
||||
if ((opt.flag & MM_F_SR) && argc - o.ind > 3) {
|
||||
fprintf(stderr, "[ERROR] incorrect input: in the sr mode, please specify no more than two query files.\n");
|
||||
return 1;
|
||||
}
|
||||
if (!idx_rdr->is_idx && fnw == 0 && argc - optind < 2) {
|
||||
idx_rdr = mm_idx_reader_open(argv[o.ind], &ipt, fnw);
|
||||
if (idx_rdr == 0) {
|
||||
fprintf(stderr, "[ERROR] failed to open file '%s': %s\n", argv[o.ind], strerror(errno));
|
||||
return 1;
|
||||
}
|
||||
if (!idx_rdr->is_idx && fnw == 0 && argc - o.ind < 2) {
|
||||
fprintf(stderr, "[ERROR] missing input: please specify a query file to map or option -d to keep the index\n");
|
||||
mm_idx_reader_close(idx_rdr);
|
||||
return 1;
|
||||
}
|
||||
if (opt.best_n == 0 && (opt.flag&MM_F_CIGAR) && mm_verbose >= 2)
|
||||
fprintf(stderr, "[WARNING]\033[1;31m `-N 0' reduces alignment accuracy. Please use --secondary=no to suppress secondary alignments.\033[0m\n");
|
||||
while ((mi = mm_idx_reader_read(idx_rdr, n_threads)) != 0) {
|
||||
int ret;
|
||||
if ((opt.flag & MM_F_CIGAR) && (mi->flag & MM_I_NO_SEQ)) {
|
||||
fprintf(stderr, "[ERROR] the prebuilt index doesn't contain sequences.\n");
|
||||
mm_idx_destroy(mi);
|
||||
mm_idx_reader_close(idx_rdr);
|
||||
return 1;
|
||||
}
|
||||
if ((opt.flag & MM_F_OUT_SAM) && idx_rdr->n_parts == 1) {
|
||||
if (mm_idx_reader_eof(idx_rdr)) {
|
||||
mm_write_sam_hdr(mi, rg, MM_VERSION, argc, argv);
|
||||
if (opt.split_prefix == 0)
|
||||
ret = mm_write_sam_hdr(mi, rg, MM_VERSION, argc, argv);
|
||||
else
|
||||
ret = mm_write_sam_hdr(0, rg, MM_VERSION, argc, argv);
|
||||
} else {
|
||||
mm_write_sam_hdr(0, rg, MM_VERSION, argc, argv);
|
||||
if (mm_verbose >= 2)
|
||||
fprintf(stderr, "[WARNING]\033[1;31m For a multi-part index, no @SQ lines will be outputted.\033[0m\n");
|
||||
ret = mm_write_sam_hdr(0, rg, MM_VERSION, argc, argv);
|
||||
if (opt.split_prefix == 0 && mm_verbose >= 2)
|
||||
fprintf(stderr, "[WARNING]\033[1;31m For a multi-part index, no @SQ lines will be outputted. Please use --split-prefix.\033[0m\n");
|
||||
}
|
||||
if (ret != 0) {
|
||||
mm_idx_destroy(mi);
|
||||
mm_idx_reader_close(idx_rdr);
|
||||
return 1;
|
||||
}
|
||||
}
|
||||
if (mm_verbose >= 3)
|
||||
fprintf(stderr, "[M::%s::%.3f*%.2f] loaded/built the index for %d target sequence(s)\n",
|
||||
__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), mi->n_seq);
|
||||
if (argc != optind + 1) mm_mapopt_update(&opt, mi);
|
||||
if (argc != o.ind + 1) mm_mapopt_update(&opt, mi);
|
||||
if (mm_verbose >= 3) mm_idx_stat(mi);
|
||||
if (junc_bed) mm_idx_bed_read(mi, junc_bed, 1);
|
||||
if (alt_list) mm_idx_alt_read(mi, alt_list);
|
||||
ret = 0;
|
||||
if (!(opt.flag & MM_F_FRAG_MODE)) {
|
||||
for (i = optind + 1; i < argc; ++i)
|
||||
mm_map_file(mi, argv[i], &opt, n_threads);
|
||||
for (i = o.ind + 1; i < argc; ++i) {
|
||||
ret = mm_map_file(mi, argv[i], &opt, n_threads);
|
||||
if (ret < 0) break;
|
||||
}
|
||||
} else {
|
||||
mm_map_file_frag(mi, argc - (optind + 1), (const char**)&argv[optind + 1], &opt, n_threads);
|
||||
ret = mm_map_file_frag(mi, argc - (o.ind + 1), (const char**)&argv[o.ind + 1], &opt, n_threads);
|
||||
}
|
||||
mm_idx_destroy(mi);
|
||||
if (ret < 0) {
|
||||
fprintf(stderr, "ERROR: failed to map the query file\n");
|
||||
exit(EXIT_FAILURE);
|
||||
}
|
||||
}
|
||||
n_parts = idx_rdr->n_parts;
|
||||
mm_idx_reader_close(idx_rdr);
|
||||
|
||||
fprintf(stderr, "[M::%s] Version: %s\n", __func__, MM_VERSION);
|
||||
fprintf(stderr, "[M::%s] CMD:", __func__);
|
||||
for (i = 0; i < argc; ++i)
|
||||
fprintf(stderr, " %s", argv[i]);
|
||||
fprintf(stderr, "\n[M::%s] Real time: %.3f sec; CPU: %.3f sec\n", __func__, realtime() - mm_realtime0, cputime());
|
||||
if (opt.split_prefix)
|
||||
mm_split_merge(argc - (o.ind + 1), (const char**)&argv[o.ind + 1], &opt, n_parts);
|
||||
|
||||
if (fflush(stdout) == EOF) {
|
||||
perror("[ERROR] failed to write the results");
|
||||
exit(EXIT_FAILURE);
|
||||
}
|
||||
|
||||
if (mm_verbose >= 3) {
|
||||
fprintf(stderr, "[M::%s] Version: %s\n", __func__, MM_VERSION);
|
||||
fprintf(stderr, "[M::%s] CMD:", __func__);
|
||||
for (i = 0; i < argc; ++i)
|
||||
fprintf(stderr, " %s", argv[i]);
|
||||
fprintf(stderr, "\n[M::%s] Real time: %.3f sec; CPU: %.3f sec; Peak RSS: %.3f GB\n", __func__, realtime() - mm_realtime0, cputime(), peakrss() / 1024.0 / 1024.0 / 1024.0);
|
||||
}
|
||||
return 0;
|
||||
}
|
||||
|
||||
@@ -1,6 +1,7 @@
|
||||
#include <stdlib.h>
|
||||
#include <string.h>
|
||||
#include <assert.h>
|
||||
#include <errno.h>
|
||||
#include "kthread.h"
|
||||
#include "kvec.h"
|
||||
#include "kalloc.h"
|
||||
@@ -9,122 +10,9 @@
|
||||
#include "bseq.h"
|
||||
#include "khash.h"
|
||||
|
||||
void mm_mapopt_init(mm_mapopt_t *opt)
|
||||
{
|
||||
memset(opt, 0, sizeof(mm_mapopt_t));
|
||||
opt->seed = 11;
|
||||
opt->mid_occ_frac = 2e-4f;
|
||||
opt->sdust_thres = 0; // no SDUST masking
|
||||
|
||||
opt->min_cnt = 3;
|
||||
opt->min_chain_score = 40;
|
||||
opt->bw = 500;
|
||||
opt->max_gap = 5000;
|
||||
opt->max_gap_ref = -1;
|
||||
opt->max_chain_skip = 25;
|
||||
|
||||
opt->mask_level = 0.5f;
|
||||
opt->pri_ratio = 0.8f;
|
||||
opt->best_n = 5;
|
||||
|
||||
opt->max_join_long = 20000;
|
||||
opt->max_join_short = 2000;
|
||||
opt->min_join_flank_sc = 1000;
|
||||
|
||||
opt->a = 2, opt->b = 4, opt->q = 4, opt->e = 2, opt->q2 = 24, opt->e2 = 1;
|
||||
opt->zdrop = 400;
|
||||
opt->end_bonus = -1;
|
||||
opt->min_dp_max = opt->min_chain_score * opt->a;
|
||||
opt->min_ksw_len = 200;
|
||||
opt->mini_batch_size = 500000000;
|
||||
|
||||
opt->pe_ori = 0; // FF
|
||||
opt->pe_bonus = 33;
|
||||
}
|
||||
|
||||
void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
|
||||
{
|
||||
if ((opt->flag & MM_F_SPLICE_FOR) && (opt->flag & MM_F_SPLICE_REV))
|
||||
opt->flag |= MM_F_SPLICE;
|
||||
if (opt->mid_occ <= 0)
|
||||
opt->mid_occ = mm_idx_cal_max_occ(mi, opt->mid_occ_frac);
|
||||
if (mm_verbose >= 3)
|
||||
fprintf(stderr, "[M::%s::%.3f*%.2f] mid_occ = %d\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), opt->mid_occ);
|
||||
}
|
||||
|
||||
void mm_mapopt_max_intron_len(mm_mapopt_t *opt, int max_intron_len)
|
||||
{
|
||||
if ((opt->flag & MM_F_SPLICE) && max_intron_len > 0)
|
||||
opt->max_gap_ref = opt->bw = max_intron_len;
|
||||
}
|
||||
|
||||
int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
|
||||
{
|
||||
if (preset == 0) {
|
||||
mm_idxopt_init(io);
|
||||
mm_mapopt_init(mo);
|
||||
} else if (strcmp(preset, "ava-ont") == 0) {
|
||||
io->is_hpc = 0, io->k = 15, io->w = 5;
|
||||
mo->flag |= MM_F_AVA | MM_F_NO_SELF;
|
||||
mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_gap = 10000, mo->max_chain_skip = 25;
|
||||
} else if (strcmp(preset, "ava-pb") == 0) {
|
||||
io->is_hpc = 1, io->k = 19, io->w = 5;
|
||||
mo->flag |= MM_F_AVA | MM_F_NO_SELF;
|
||||
mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_gap = 10000, mo->max_chain_skip = 25;
|
||||
} else if (strcmp(preset, "map10k") == 0 || strcmp(preset, "map-pb") == 0) {
|
||||
io->is_hpc = 1, io->k = 19;
|
||||
} else if (strcmp(preset, "map-ont") == 0) {
|
||||
io->is_hpc = 0, io->k = 15;
|
||||
} else if (strcmp(preset, "asm5") == 0) {
|
||||
io->is_hpc = 0, io->k = 19, io->w = 19;
|
||||
mo->a = 1, mo->b = 19, mo->q = 39, mo->q2 = 81, mo->e = 3, mo->e2 = 1, mo->zdrop = 200;
|
||||
mo->min_dp_max = 200;
|
||||
mo->best_n = 50;
|
||||
} else if (strcmp(preset, "asm10") == 0) {
|
||||
io->is_hpc = 0, io->k = 19, io->w = 19;
|
||||
mo->a = 1, mo->b = 9, mo->q = 16, mo->q2 = 41, mo->e = 2, mo->e2 = 1, mo->zdrop = 200;
|
||||
mo->min_dp_max = 200;
|
||||
mo->best_n = 50;
|
||||
} else if (strcmp(preset, "short") == 0 || strcmp(preset, "sr") == 0) {
|
||||
io->is_hpc = 0, io->k = 21, io->w = 11;
|
||||
mo->flag |= MM_F_SR | MM_F_FRAG_MODE | MM_F_NO_PRINT_2ND | MM_F_2_IO_THREADS;
|
||||
mo->pe_ori = 0<<1|1; // FR
|
||||
mo->a = 2, mo->b = 8, mo->q = 12, mo->e = 2, mo->q2 = 24, mo->e2 = 1;
|
||||
mo->zdrop = 100;
|
||||
mo->end_bonus = 10;
|
||||
mo->max_frag_len = 800;
|
||||
mo->max_gap = 100;
|
||||
mo->bw = 100;
|
||||
mo->pri_ratio = 0.5f;
|
||||
mo->min_cnt = 2;
|
||||
mo->min_chain_score = 25;
|
||||
mo->min_dp_max = 40;
|
||||
mo->best_n = 20;
|
||||
mo->mid_occ = 1000;
|
||||
mo->max_occ = 5000;
|
||||
mo->mini_batch_size = 50000000;
|
||||
} else if (strcmp(preset, "splice") == 0 || strcmp(preset, "cdna") == 0) {
|
||||
io->is_hpc = 0, io->k = 15, io->w = 5;
|
||||
mo->flag |= MM_F_SPLICE | MM_F_SPLICE_FOR | MM_F_SPLICE_REV;
|
||||
mo->max_gap = 2000, mo->max_gap_ref = mo->bw = 200000;
|
||||
mo->a = 1, mo->b = 2, mo->q = 2, mo->e = 1, mo->q2 = 32, mo->e2 = 0;
|
||||
mo->noncan = 5;
|
||||
mo->zdrop = 200;
|
||||
} else return -1;
|
||||
return 0;
|
||||
}
|
||||
|
||||
typedef struct {
|
||||
uint32_t n;
|
||||
uint32_t qpos;
|
||||
uint32_t seg_id;
|
||||
const uint64_t *cr;
|
||||
} mm_match_t;
|
||||
|
||||
struct mm_tbuf_s {
|
||||
sdust_buf_t *sdb;
|
||||
mm128_v mini;
|
||||
void *km;
|
||||
int rep_len, frag_gap;
|
||||
};
|
||||
|
||||
mm_tbuf_t *mm_tbuf_init(void)
|
||||
@@ -132,163 +20,280 @@ mm_tbuf_t *mm_tbuf_init(void)
|
||||
mm_tbuf_t *b;
|
||||
b = (mm_tbuf_t*)calloc(1, sizeof(mm_tbuf_t));
|
||||
if (!(mm_dbg_flag & 1)) b->km = km_init();
|
||||
b->sdb = sdust_buf_init(b->km);
|
||||
return b;
|
||||
}
|
||||
|
||||
void mm_tbuf_destroy(mm_tbuf_t *b)
|
||||
{
|
||||
if (b == 0) return;
|
||||
kfree(b->km, b->mini.a);
|
||||
sdust_buf_destroy(b->sdb);
|
||||
km_destroy(b->km);
|
||||
free(b);
|
||||
}
|
||||
|
||||
static int mm_dust_minier(int n, mm128_t *a, int l_seq, const char *seq, int sdust_thres, sdust_buf_t *sdb)
|
||||
void *mm_tbuf_get_km(mm_tbuf_t *b)
|
||||
{
|
||||
return b->km;
|
||||
}
|
||||
|
||||
static int mm_dust_minier(void *km, int n, mm128_t *a, int l_seq, const char *seq, int sdust_thres)
|
||||
{
|
||||
int n_dreg, j, k, u = 0;
|
||||
const uint64_t *dreg;
|
||||
if (sdust_thres <= 0 || sdb == 0) return n;
|
||||
sdust_buf_t *sdb;
|
||||
if (sdust_thres <= 0) return n;
|
||||
sdb = sdust_buf_init(km);
|
||||
dreg = sdust_core((const uint8_t*)seq, l_seq, sdust_thres, 64, &n_dreg, sdb);
|
||||
for (j = k = 0; j < n; ++j) { // squeeze out minimizers that significantly overlap with LCRs
|
||||
int32_t qpos = (uint32_t)a[j].y>>1, span = a[j].x&0xff;
|
||||
int32_t s = qpos - (span - 1), e = s + span;
|
||||
while (u < n_dreg && (uint32_t)dreg[u] <= s) ++u;
|
||||
if (u < n_dreg && dreg[u]>>32 < e) {
|
||||
while (u < n_dreg && (int32_t)dreg[u] <= s) ++u;
|
||||
if (u < n_dreg && (int32_t)(dreg[u]>>32) < e) {
|
||||
int v, l = 0;
|
||||
for (v = u; v < n_dreg && dreg[v]>>32 < e; ++v) { // iterate over LCRs overlapping this minimizer
|
||||
int ss = s > dreg[v]>>32? s : dreg[v]>>32;
|
||||
int ee = e < (uint32_t)dreg[v]? e : (uint32_t)dreg[v];
|
||||
for (v = u; v < n_dreg && (int32_t)(dreg[v]>>32) < e; ++v) { // iterate over LCRs overlapping this minimizer
|
||||
int ss = s > (int32_t)(dreg[v]>>32)? s : dreg[v]>>32;
|
||||
int ee = e < (int32_t)dreg[v]? e : (uint32_t)dreg[v];
|
||||
l += ee - ss;
|
||||
}
|
||||
if (l <= span>>1) a[k++] = a[j]; // keep the minimizer if less than half of it falls in masked region
|
||||
}
|
||||
} else a[k++] = a[j];
|
||||
}
|
||||
sdust_buf_destroy(sdb);
|
||||
return k; // the new size
|
||||
}
|
||||
|
||||
static void collect_minimizers(const mm_mapopt_t *opt, const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, mm_tbuf_t *b)
|
||||
static void collect_minimizers(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, mm128_v *mv)
|
||||
{
|
||||
int i, j, n, sum = 0;
|
||||
b->mini.n = 0;
|
||||
int i, n, sum = 0;
|
||||
mv->n = 0;
|
||||
for (i = n = 0; i < n_segs; ++i) {
|
||||
mm_sketch(b->km, seqs[i], qlens[i], mi->w, mi->k, i, mi->is_hpc, &b->mini);
|
||||
for (j = n; j < b->mini.n; ++j)
|
||||
b->mini.a[j].y += sum << 1;
|
||||
size_t j;
|
||||
mm_sketch(km, seqs[i], qlens[i], mi->w, mi->k, i, mi->flag&MM_I_HPC, mv);
|
||||
for (j = n; j < mv->n; ++j)
|
||||
mv->a[j].y += sum << 1;
|
||||
if (opt->sdust_thres > 0) // mask low-complexity minimizers
|
||||
b->mini.n = n + mm_dust_minier(b->mini.n - n, b->mini.a + n, qlens[i], seqs[i], opt->sdust_thres, b->sdb);
|
||||
sum += qlens[i], n = b->mini.n;
|
||||
mv->n = n + mm_dust_minier(km, mv->n - n, mv->a + n, qlens[i], seqs[i], opt->sdust_thres);
|
||||
sum += qlens[i], n = mv->n;
|
||||
}
|
||||
}
|
||||
|
||||
static mm128_t *collect_seed_hits(const mm_mapopt_t *opt, int max_occ, const mm_idx_t *mi, const char *qname, int qlen, int64_t *n_a, int *rep_len, mm_tbuf_t *b)
|
||||
{
|
||||
int rep_st = 0, rep_en = 0, i;
|
||||
mm_match_t *m;
|
||||
mm128_t *a;
|
||||
#include "ksort.h"
|
||||
#define heap_lt(a, b) ((a).x > (b).x)
|
||||
KSORT_INIT(heap, mm128_t, heap_lt)
|
||||
|
||||
m = (mm_match_t*)kmalloc(b->km, b->mini.n * sizeof(mm_match_t));
|
||||
for (i = 0; i < b->mini.n; ++i) {
|
||||
typedef struct {
|
||||
uint32_t n;
|
||||
uint32_t q_pos, q_span;
|
||||
uint32_t seg_id:31, is_tandem:1;
|
||||
const uint64_t *cr;
|
||||
} mm_match_t;
|
||||
|
||||
static mm_match_t *collect_matches(void *km, int *_n_m, int max_occ, const mm_idx_t *mi, const mm128_v *mv, int64_t *n_a, int *rep_len, int *n_mini_pos, uint64_t **mini_pos)
|
||||
{
|
||||
int rep_st = 0, rep_en = 0, n_m;
|
||||
size_t i;
|
||||
mm_match_t *m;
|
||||
*n_mini_pos = 0;
|
||||
*mini_pos = (uint64_t*)kmalloc(km, mv->n * sizeof(uint64_t));
|
||||
m = (mm_match_t*)kmalloc(km, mv->n * sizeof(mm_match_t));
|
||||
for (i = 0, n_m = 0, *rep_len = 0, *n_a = 0; i < mv->n; ++i) {
|
||||
const uint64_t *cr;
|
||||
mm128_t *p = &mv->a[i];
|
||||
uint32_t q_pos = (uint32_t)p->y, q_span = p->x & 0xff;
|
||||
int t;
|
||||
mm128_t *p = &b->mini.a[i];
|
||||
m[i].qpos = (uint32_t)p->y;
|
||||
m[i].cr = mm_idx_get(mi, p->x>>8, &t);
|
||||
m[i].n = t;
|
||||
m[i].seg_id = p->y >> 32;
|
||||
}
|
||||
for (i = 0, *n_a = 0; i < b->mini.n; ++i) // find the length of a[]
|
||||
if (m[i].n < max_occ) *n_a += m[i].n;
|
||||
a = (mm128_t*)kmalloc(b->km, *n_a * sizeof(mm128_t));
|
||||
for (i = *rep_len = 0, *n_a = 0; i < b->mini.n; ++i) {
|
||||
mm128_t *p = &b->mini.a[i];
|
||||
mm_match_t *q = &m[i];
|
||||
const uint64_t *r = q->cr;
|
||||
int k, q_span = p->x & 0xff, is_tandem = 0;
|
||||
if (q->n >= max_occ) {
|
||||
int en = (q->qpos>>1) + 1, st = en - q_span;
|
||||
cr = mm_idx_get(mi, p->x>>8, &t);
|
||||
if (t >= max_occ) {
|
||||
int en = (q_pos >> 1) + 1, st = en - q_span;
|
||||
if (st > rep_en) {
|
||||
*rep_len += rep_en - rep_st;
|
||||
rep_st = st, rep_en = en;
|
||||
} else rep_en = en;
|
||||
continue;
|
||||
}
|
||||
if (i > 0 && p->x>>8 == b->mini.a[i - 1].x>>8) is_tandem = 1;
|
||||
if (i < b->mini.n - 1 && p->x>>8 == b->mini.a[i + 1].x>>8) is_tandem = 1;
|
||||
for (k = 0; k < q->n; ++k) {
|
||||
int32_t rpos = (uint32_t)r[k] >> 1;
|
||||
mm128_t *p;
|
||||
if (qname && (opt->flag&(MM_F_NO_SELF|MM_F_AVA))) {
|
||||
const char *tname = mi->seq[r[k]>>32].name;
|
||||
int cmp;
|
||||
cmp = strcmp(qname, tname);
|
||||
if ((opt->flag&MM_F_NO_SELF) && cmp == 0 && rpos == (q->qpos>>1)) // avoid the diagonal
|
||||
continue;
|
||||
if ((opt->flag&MM_F_AVA) && cmp > 0) // all-vs-all mode: map once
|
||||
continue;
|
||||
}
|
||||
p = &a[(*n_a)++];
|
||||
if ((r[k]&1) == (q->qpos&1)) { // forward strand
|
||||
p->x = (r[k]&0xffffffff00000000ULL) | rpos;
|
||||
p->y = (uint64_t)q_span << 32 | q->qpos >> 1;
|
||||
} else { // reverse strand
|
||||
p->x = 1ULL<<63 | (r[k]&0xffffffff00000000ULL) | rpos;
|
||||
p->y = (uint64_t)q_span << 32 | (qlen - ((q->qpos>>1) + 1 - q_span) - 1);
|
||||
}
|
||||
p->y |= (uint64_t)q->seg_id << MM_SEED_SEG_SHIFT;
|
||||
if (is_tandem) p->y |= MM_SEED_TANDEM;
|
||||
} else {
|
||||
mm_match_t *q = &m[n_m++];
|
||||
q->q_pos = q_pos, q->q_span = q_span, q->cr = cr, q->n = t, q->seg_id = p->y >> 32;
|
||||
q->is_tandem = 0;
|
||||
if (i > 0 && p->x>>8 == mv->a[i - 1].x>>8) q->is_tandem = 1;
|
||||
if (i < mv->n - 1 && p->x>>8 == mv->a[i + 1].x>>8) q->is_tandem = 1;
|
||||
*n_a += q->n;
|
||||
(*mini_pos)[(*n_mini_pos)++] = (uint64_t)q_span<<32 | q_pos>>1;
|
||||
}
|
||||
}
|
||||
*rep_len += rep_en - rep_st;
|
||||
kfree(b->km, m);
|
||||
*_n_m = n_m;
|
||||
return m;
|
||||
}
|
||||
|
||||
static inline int skip_seed(int flag, uint64_t r, const mm_match_t *q, const char *qname, int qlen, const mm_idx_t *mi, int *is_self)
|
||||
{
|
||||
*is_self = 0;
|
||||
if (qname && (flag & (MM_F_NO_DIAG|MM_F_NO_DUAL))) {
|
||||
const mm_idx_seq_t *s = &mi->seq[r>>32];
|
||||
int cmp;
|
||||
cmp = strcmp(qname, s->name);
|
||||
if ((flag&MM_F_NO_DIAG) && cmp == 0 && (int)s->len == qlen) {
|
||||
if ((uint32_t)r>>1 == (q->q_pos>>1)) return 1; // avoid the diagnonal anchors
|
||||
if ((r&1) == (q->q_pos&1)) *is_self = 1; // this flag is used to avoid spurious extension on self chain
|
||||
}
|
||||
if ((flag&MM_F_NO_DUAL) && cmp > 0) // all-vs-all mode: map once
|
||||
return 1;
|
||||
}
|
||||
if (flag & (MM_F_FOR_ONLY|MM_F_REV_ONLY)) {
|
||||
if ((r&1) == (q->q_pos&1)) { // forward strand
|
||||
if (flag & MM_F_REV_ONLY) return 1;
|
||||
} else {
|
||||
if (flag & MM_F_FOR_ONLY) return 1;
|
||||
}
|
||||
}
|
||||
return 0;
|
||||
}
|
||||
|
||||
static mm128_t *collect_seed_hits_heap(void *km, const mm_mapopt_t *opt, int max_occ, const mm_idx_t *mi, const char *qname, const mm128_v *mv, int qlen, int64_t *n_a, int *rep_len,
|
||||
int *n_mini_pos, uint64_t **mini_pos)
|
||||
{
|
||||
int i, n_m, heap_size = 0;
|
||||
int64_t j, n_for = 0, n_rev = 0;
|
||||
mm_match_t *m;
|
||||
mm128_t *a, *heap;
|
||||
|
||||
m = collect_matches(km, &n_m, max_occ, mi, mv, n_a, rep_len, n_mini_pos, mini_pos);
|
||||
|
||||
heap = (mm128_t*)kmalloc(km, n_m * sizeof(mm128_t));
|
||||
a = (mm128_t*)kmalloc(km, *n_a * sizeof(mm128_t));
|
||||
|
||||
for (i = 0, heap_size = 0; i < n_m; ++i) {
|
||||
if (m[i].n > 0) {
|
||||
heap[heap_size].x = m[i].cr[0];
|
||||
heap[heap_size].y = (uint64_t)i<<32;
|
||||
++heap_size;
|
||||
}
|
||||
}
|
||||
ks_heapmake_heap(heap_size, heap);
|
||||
while (heap_size > 0) {
|
||||
mm_match_t *q = &m[heap->y>>32];
|
||||
mm128_t *p;
|
||||
uint64_t r = heap->x;
|
||||
int32_t is_self, rpos = (uint32_t)r >> 1;
|
||||
if (!skip_seed(opt->flag, r, q, qname, qlen, mi, &is_self)) {
|
||||
if ((r&1) == (q->q_pos&1)) { // forward strand
|
||||
p = &a[n_for++];
|
||||
p->x = (r&0xffffffff00000000ULL) | rpos;
|
||||
p->y = (uint64_t)q->q_span << 32 | q->q_pos >> 1;
|
||||
} else { // reverse strand
|
||||
p = &a[(*n_a) - (++n_rev)];
|
||||
p->x = 1ULL<<63 | (r&0xffffffff00000000ULL) | rpos;
|
||||
p->y = (uint64_t)q->q_span << 32 | (qlen - ((q->q_pos>>1) + 1 - q->q_span) - 1);
|
||||
}
|
||||
p->y |= (uint64_t)q->seg_id << MM_SEED_SEG_SHIFT;
|
||||
if (q->is_tandem) p->y |= MM_SEED_TANDEM;
|
||||
if (is_self) p->y |= MM_SEED_SELF;
|
||||
}
|
||||
// update the heap
|
||||
if ((uint32_t)heap->y < q->n - 1) {
|
||||
++heap[0].y;
|
||||
heap[0].x = m[heap[0].y>>32].cr[(uint32_t)heap[0].y];
|
||||
} else {
|
||||
heap[0] = heap[heap_size - 1];
|
||||
--heap_size;
|
||||
}
|
||||
ks_heapdown_heap(0, heap_size, heap);
|
||||
}
|
||||
kfree(km, m);
|
||||
kfree(km, heap);
|
||||
|
||||
// reverse anchors on the reverse strand, as they are in the descending order
|
||||
for (j = 0; j < n_rev>>1; ++j) {
|
||||
mm128_t t = a[(*n_a) - 1 - j];
|
||||
a[(*n_a) - 1 - j] = a[(*n_a) - (n_rev - j)];
|
||||
a[(*n_a) - (n_rev - j)] = t;
|
||||
}
|
||||
if (*n_a > n_for + n_rev) {
|
||||
memmove(a + n_for, a + (*n_a) - n_rev, n_rev * sizeof(mm128_t));
|
||||
*n_a = n_for + n_rev;
|
||||
}
|
||||
return a;
|
||||
}
|
||||
|
||||
static mm128_t *collect_seed_hits(void *km, const mm_mapopt_t *opt, int max_occ, const mm_idx_t *mi, const char *qname, const mm128_v *mv, int qlen, int64_t *n_a, int *rep_len,
|
||||
int *n_mini_pos, uint64_t **mini_pos)
|
||||
{
|
||||
int i, n_m;
|
||||
mm_match_t *m;
|
||||
mm128_t *a;
|
||||
m = collect_matches(km, &n_m, max_occ, mi, mv, n_a, rep_len, n_mini_pos, mini_pos);
|
||||
a = (mm128_t*)kmalloc(km, *n_a * sizeof(mm128_t));
|
||||
for (i = 0, *n_a = 0; i < n_m; ++i) {
|
||||
mm_match_t *q = &m[i];
|
||||
const uint64_t *r = q->cr;
|
||||
uint32_t k;
|
||||
for (k = 0; k < q->n; ++k) {
|
||||
int32_t is_self, rpos = (uint32_t)r[k] >> 1;
|
||||
mm128_t *p;
|
||||
if (skip_seed(opt->flag, r[k], q, qname, qlen, mi, &is_self)) continue;
|
||||
p = &a[(*n_a)++];
|
||||
if ((r[k]&1) == (q->q_pos&1)) { // forward strand
|
||||
p->x = (r[k]&0xffffffff00000000ULL) | rpos;
|
||||
p->y = (uint64_t)q->q_span << 32 | q->q_pos >> 1;
|
||||
} else { // reverse strand
|
||||
p->x = 1ULL<<63 | (r[k]&0xffffffff00000000ULL) | rpos;
|
||||
p->y = (uint64_t)q->q_span << 32 | (qlen - ((q->q_pos>>1) + 1 - q->q_span) - 1);
|
||||
}
|
||||
p->y |= (uint64_t)q->seg_id << MM_SEED_SEG_SHIFT;
|
||||
if (q->is_tandem) p->y |= MM_SEED_TANDEM;
|
||||
if (is_self) p->y |= MM_SEED_SELF;
|
||||
}
|
||||
}
|
||||
kfree(km, m);
|
||||
radix_sort_128x(a, a + (*n_a));
|
||||
return a;
|
||||
}
|
||||
|
||||
static void chain_post(const mm_mapopt_t *opt, int max_chain_gap_ref, const mm_idx_t *mi, void *km, int qlen, int n_segs, const int *qlens, int *n_regs, mm_reg1_t *regs, mm128_t *a)
|
||||
{
|
||||
if (!(opt->flag & MM_F_AVA)) { // don't choose primary mapping(s) for read overlap
|
||||
mm_set_parent(km, opt->mask_level, *n_regs, regs, opt->a * 2 + opt->b);
|
||||
if (!(opt->flag & MM_F_ALL_CHAINS)) { // don't choose primary mapping(s)
|
||||
mm_set_parent(km, opt->mask_level, opt->mask_len, *n_regs, regs, opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL, opt->alt_drop);
|
||||
if (n_segs <= 1) mm_select_sub(km, opt->pri_ratio, mi->k*2, opt->best_n, n_regs, regs);
|
||||
else mm_select_sub_multi(km, opt->pri_ratio, 0.2f, 0.7f, max_chain_gap_ref, mi->k*2, opt->best_n, n_segs, qlens, n_regs, regs);
|
||||
if (!(opt->flag & MM_F_SPLICE) && !(opt->flag & MM_F_SR) && !(opt->flag & MM_F_NO_LJOIN))
|
||||
if (!(opt->flag & (MM_F_SPLICE|MM_F_SR|MM_F_NO_LJOIN))) // long join not working well without primary chains
|
||||
mm_join_long(km, opt, qlen, n_regs, regs, a);
|
||||
}
|
||||
}
|
||||
|
||||
static mm_reg1_t *align_regs(const mm_mapopt_t *opt, const mm_idx_t *mi, void *km, int qlen, const char *seq, const char *qual, int *n_regs, mm_reg1_t *regs, mm128_t *a)
|
||||
static mm_reg1_t *align_regs(const mm_mapopt_t *opt, const mm_idx_t *mi, void *km, int qlen, const char *seq, int *n_regs, mm_reg1_t *regs, mm128_t *a)
|
||||
{
|
||||
if (!(opt->flag & MM_F_CIGAR)) return regs;
|
||||
regs = mm_align_skeleton(km, opt, mi, qlen, seq, qual, n_regs, regs, a); // this calls mm_filter_regs()
|
||||
if (!(opt->flag & MM_F_AVA)) {
|
||||
mm_set_parent(km, opt->mask_level, *n_regs, regs, opt->a * 2 + opt->b);
|
||||
regs = mm_align_skeleton(km, opt, mi, qlen, seq, n_regs, regs, a); // this calls mm_filter_regs()
|
||||
if (!(opt->flag & MM_F_ALL_CHAINS)) { // don't choose primary mapping(s)
|
||||
mm_set_parent(km, opt->mask_level, opt->mask_len, *n_regs, regs, opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL, opt->alt_drop);
|
||||
mm_select_sub(km, opt->pri_ratio, mi->k*2, opt->best_n, n_regs, regs);
|
||||
mm_set_sam_pri(*n_regs, regs);
|
||||
}
|
||||
return regs;
|
||||
}
|
||||
|
||||
void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, const char **quals, int *n_regs, mm_reg1_t **regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname)
|
||||
void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, int *n_regs, mm_reg1_t **regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname)
|
||||
{
|
||||
int i, j, rep_len, qlen_sum, n_regs0;
|
||||
int max_chain_gap_qry, max_chain_gap_ref, is_splice = !!(opt->flag & MM_F_SPLICE);
|
||||
int i, j, rep_len, qlen_sum, n_regs0, n_mini_pos;
|
||||
int max_chain_gap_qry, max_chain_gap_ref, is_splice = !!(opt->flag & MM_F_SPLICE), is_sr = !!(opt->flag & MM_F_SR);
|
||||
uint32_t hash;
|
||||
int64_t n_a;
|
||||
uint64_t *u;
|
||||
uint64_t *u, *mini_pos;
|
||||
mm128_t *a;
|
||||
mm128_v mv = {0,0,0};
|
||||
mm_reg1_t *regs0;
|
||||
km_stat_t kmst;
|
||||
|
||||
for (i = 0, qlen_sum = 0; i < n_segs; ++i)
|
||||
qlen_sum += qlens[i], n_regs[i] = 0, regs[i] = 0;
|
||||
|
||||
if (qlen_sum == 0 || n_segs <= 0 || n_segs > MM_MAX_SEG) return;
|
||||
if (opt->max_qlen > 0 && qlen_sum > opt->max_qlen) return;
|
||||
|
||||
hash = qname? __ac_X31_hash_string(qname) : 0;
|
||||
hash ^= __ac_Wang_hash(qlen_sum) + __ac_Wang_hash(opt->seed);
|
||||
hash = __ac_Wang_hash(hash);
|
||||
|
||||
collect_minimizers(opt, mi, n_segs, qlens, seqs, b);
|
||||
a = collect_seed_hits(opt, opt->mid_occ, mi, qname, qlen_sum, &n_a, &rep_len, b);
|
||||
radix_sort_128x(a, a + n_a);
|
||||
collect_minimizers(b->km, opt, mi, n_segs, qlens, seqs, &mv);
|
||||
if (opt->flag & MM_F_HEAP_SORT) a = collect_seed_hits_heap(b->km, opt, opt->mid_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
|
||||
else a = collect_seed_hits(b->km, opt, opt->mid_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
|
||||
|
||||
if (mm_dbg_flag & MM_DBG_PRINT_SEED) {
|
||||
fprintf(stderr, "RS\t%d\n", rep_len);
|
||||
@@ -298,7 +303,7 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
|
||||
}
|
||||
|
||||
// set max chaining gap on the query and the reference sequence
|
||||
if (opt->flag & MM_F_SR)
|
||||
if (is_sr)
|
||||
max_chain_gap_qry = qlen_sum > opt->max_gap? qlen_sum : opt->max_gap;
|
||||
else max_chain_gap_qry = opt->max_gap;
|
||||
if (opt->max_gap_ref > 0) {
|
||||
@@ -308,17 +313,17 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
|
||||
if (max_chain_gap_ref < opt->max_gap) max_chain_gap_ref = opt->max_gap;
|
||||
} else max_chain_gap_ref = opt->max_gap;
|
||||
|
||||
a = mm_chain_dp(max_chain_gap_ref, max_chain_gap_qry, opt->bw, opt->max_chain_skip, opt->min_cnt, opt->min_chain_score, is_splice, n_segs, n_a, a, &n_regs0, &u, b->km);
|
||||
a = mm_chain_dp(max_chain_gap_ref, max_chain_gap_qry, opt->bw, opt->max_chain_skip, opt->max_chain_iter, opt->min_cnt, opt->min_chain_score, opt->chain_gap_scale, is_splice, n_segs, n_a, a, &n_regs0, &u, b->km);
|
||||
|
||||
if (opt->max_occ > opt->mid_occ && rep_len > 0) {
|
||||
int rechain = 0;
|
||||
if (n_regs0 > 0) { // test if the best chain has all the segments
|
||||
int n_chained_segs = 1, max = 0, max_i = -1, max_off = -1, off = 0;
|
||||
for (i = 0; i < n_regs0; ++i) { // find the best chain
|
||||
if (max < u[i]>>32) max = u[i]>>32, max_i = i, max_off = off;
|
||||
if (max < (int)(u[i]>>32)) max = u[i]>>32, max_i = i, max_off = off;
|
||||
off += (uint32_t)u[i];
|
||||
}
|
||||
for (i = 1; i < (uint32_t)u[max_i]; ++i) // count the number of segments in the best chain
|
||||
for (i = 1; i < (int32_t)u[max_i]; ++i) // count the number of segments in the best chain
|
||||
if ((a[max_off+i].y&MM_SEED_SEG_MASK) != (a[max_off+i-1].y&MM_SEED_SEG_MASK))
|
||||
++n_chained_segs;
|
||||
if (n_chained_segs < n_segs)
|
||||
@@ -327,13 +332,20 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
|
||||
if (rechain) { // redo chaining with a higher max_occ threshold
|
||||
kfree(b->km, a);
|
||||
kfree(b->km, u);
|
||||
a = collect_seed_hits(opt, opt->max_occ, mi, qname, qlen_sum, &n_a, &rep_len, b);
|
||||
radix_sort_128x(a, a + n_a);
|
||||
a = mm_chain_dp(max_chain_gap_ref, max_chain_gap_qry, opt->bw, opt->max_chain_skip, opt->min_cnt, opt->min_chain_score, is_splice, n_segs, n_a, a, &n_regs0, &u, b->km);
|
||||
kfree(b->km, mini_pos);
|
||||
if (opt->flag & MM_F_HEAP_SORT) a = collect_seed_hits_heap(b->km, opt, opt->max_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
|
||||
else a = collect_seed_hits(b->km, opt, opt->max_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
|
||||
a = mm_chain_dp(max_chain_gap_ref, max_chain_gap_qry, opt->bw, opt->max_chain_skip, opt->max_chain_iter, opt->min_cnt, opt->min_chain_score, opt->chain_gap_scale, is_splice, n_segs, n_a, a, &n_regs0, &u, b->km);
|
||||
}
|
||||
}
|
||||
b->frag_gap = max_chain_gap_ref;
|
||||
b->rep_len = rep_len;
|
||||
|
||||
regs0 = mm_gen_regs(b->km, hash, qlen_sum, n_regs0, u, a);
|
||||
if (mi->n_alt) {
|
||||
mm_mark_alt(mi, n_regs0, regs0);
|
||||
mm_hit_sort(b->km, &n_regs0, regs0, opt->alt_drop); // this step can be merged into mm_gen_regs(); will do if this shows up in profile
|
||||
}
|
||||
|
||||
if (mm_dbg_flag & MM_DBG_PRINT_SEED)
|
||||
for (j = 0; j < n_regs0; ++j)
|
||||
@@ -342,36 +354,47 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
|
||||
i == regs0[j].as? 0 : ((int32_t)a[i].y - (int32_t)a[i-1].y) - ((int32_t)a[i].x - (int32_t)a[i-1].x));
|
||||
|
||||
chain_post(opt, max_chain_gap_ref, mi, b->km, qlen_sum, n_segs, qlens, &n_regs0, regs0, a);
|
||||
if (!is_sr) mm_est_err(mi, qlen_sum, n_regs0, regs0, a, n_mini_pos, mini_pos);
|
||||
|
||||
if (n_segs == 1) { // uni-segment
|
||||
regs0 = align_regs(opt, mi, b->km, qlens[0], seqs[0], quals? quals[0] : 0, &n_regs0, regs0, a);
|
||||
mm_set_mapq(n_regs0, regs0, opt->min_chain_score, opt->a, rep_len);
|
||||
regs0 = align_regs(opt, mi, b->km, qlens[0], seqs[0], &n_regs0, regs0, a);
|
||||
mm_set_mapq(b->km, n_regs0, regs0, opt->min_chain_score, opt->a, rep_len, is_sr);
|
||||
n_regs[0] = n_regs0, regs[0] = regs0;
|
||||
} else { // multi-segment
|
||||
mm_seg_t *seg;
|
||||
seg = mm_seg_gen(b->km, hash, n_segs, qlens, n_regs0, regs0, n_regs, regs, a); // split fragment chain to separate segment chains
|
||||
free(regs0);
|
||||
for (i = 0; i < n_segs; ++i) {
|
||||
mm_set_parent(b->km, opt->mask_level, n_regs[i], regs[i], opt->a * 2 + opt->b); // update mm_reg1_t::parent
|
||||
regs[i] = align_regs(opt, mi, b->km, qlens[i], seqs[i], quals? quals[i] : 0, &n_regs[i], regs[i], seg[i].a);
|
||||
mm_set_mapq(n_regs[i], regs[i], opt->min_chain_score, opt->a, rep_len);
|
||||
mm_set_parent(b->km, opt->mask_level, opt->mask_len, n_regs[i], regs[i], opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL, opt->alt_drop); // update mm_reg1_t::parent
|
||||
regs[i] = align_regs(opt, mi, b->km, qlens[i], seqs[i], &n_regs[i], regs[i], seg[i].a);
|
||||
mm_set_mapq(b->km, n_regs[i], regs[i], opt->min_chain_score, opt->a, rep_len, is_sr);
|
||||
}
|
||||
mm_seg_free(b->km, n_segs, seg);
|
||||
if (n_segs == 2 && opt->pe_ori >= 0 && (opt->flag&MM_F_CIGAR))
|
||||
mm_pair(b->km, max_chain_gap_ref, opt->pe_bonus, opt->a * 2 + opt->b, opt->a, qlens, n_regs, regs); // pairing
|
||||
}
|
||||
if (opt->min_iden > 0.0f)
|
||||
for (i = 0; i < n_segs; ++i)
|
||||
mm_filter_by_identity(b->km, n_regs[i], regs[i], opt->min_iden, qlens[i], quals[i]);
|
||||
|
||||
kfree(b->km, mv.a);
|
||||
kfree(b->km, a);
|
||||
kfree(b->km, u);
|
||||
kfree(b->km, mini_pos);
|
||||
|
||||
if (b->km) {
|
||||
km_stat(b->km, &kmst);
|
||||
if (mm_dbg_flag & MM_DBG_PRINT_QNAME)
|
||||
fprintf(stderr, "QM\t%s\t%d\tcap=%ld,nCore=%ld,largest=%ld\n", qname, qlen_sum, kmst.capacity, kmst.n_cores, kmst.largest);
|
||||
assert(kmst.n_blocks == kmst.n_cores); // otherwise, there is a memory leak
|
||||
if (kmst.largest > 1U<<28) {
|
||||
km_destroy(b->km);
|
||||
b->km = km_init();
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
mm_reg1_t *mm_map(const mm_idx_t *mi, int qlen, const char *seq, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname)
|
||||
{
|
||||
mm_reg1_t *regs;
|
||||
mm_map_frag(mi, 1, &qlen, &seq, 0, n_regs, ®s, b, opt, qname);
|
||||
mm_map_frag(mi, 1, &qlen, &seq, n_regs, ®s, b, opt, qname);
|
||||
return regs;
|
||||
}
|
||||
|
||||
@@ -380,18 +403,23 @@ mm_reg1_t *mm_map(const mm_idx_t *mi, int qlen, const char *seq, int *n_regs, mm
|
||||
**************************/
|
||||
|
||||
typedef struct {
|
||||
int mini_batch_size, n_processed, n_threads, n_fp;
|
||||
int n_processed, n_threads, n_fp;
|
||||
int64_t mini_batch_size;
|
||||
const mm_mapopt_t *opt;
|
||||
mm_bseq_file_t **fp;
|
||||
const mm_idx_t *mi;
|
||||
kstring_t str;
|
||||
|
||||
int n_parts;
|
||||
uint32_t *rid_shift;
|
||||
FILE *fp_split, **fp_parts;
|
||||
} pipeline_t;
|
||||
|
||||
typedef struct {
|
||||
const pipeline_t *p;
|
||||
int n_seq, n_frag;
|
||||
mm_bseq1_t *seq;
|
||||
int *n_reg, *seg_off, *n_seg;
|
||||
int *n_reg, *seg_off, *n_seg, *rep_len, *frag_gap;
|
||||
mm_reg1_t **reg;
|
||||
mm_tbuf_t **buf;
|
||||
} step_t;
|
||||
@@ -399,22 +427,31 @@ typedef struct {
|
||||
static void worker_for(void *_data, long i, int tid) // kt_for() callback
|
||||
{
|
||||
step_t *s = (step_t*)_data;
|
||||
int *qlens, j, off = s->seg_off[i], pe_ori = s->p->opt->pe_ori, is_sr = !!(s->p->opt->flag & MM_F_SR);
|
||||
const char **qseqs, **quals = 0;
|
||||
int qlens[MM_MAX_SEG], j, off = s->seg_off[i], pe_ori = s->p->opt->pe_ori;
|
||||
const char *qseqs[MM_MAX_SEG];
|
||||
mm_tbuf_t *b = s->buf[tid];
|
||||
assert(s->n_seg[i] <= MM_MAX_SEG);
|
||||
if (mm_dbg_flag & MM_DBG_PRINT_QNAME)
|
||||
fprintf(stderr, "QR\t%s\t%d\n", s->seq[off].name, tid);
|
||||
qlens = (int*)kmalloc(b->km, s->n_seg[i] * sizeof(int));
|
||||
qseqs = (const char**)kmalloc(b->km, s->n_seg[i] * sizeof(const char**));
|
||||
quals = (const char**)kmalloc(b->km, s->n_seg[i] * sizeof(const char**));
|
||||
fprintf(stderr, "QR\t%s\t%d\t%d\n", s->seq[off].name, tid, s->seq[off].l_seq);
|
||||
for (j = 0; j < s->n_seg[i]; ++j) {
|
||||
if (s->n_seg[i] == 2 && ((j == 0 && (pe_ori>>1&1)) || (j == 1 && (pe_ori&1))))
|
||||
mm_revcomp_bseq(&s->seq[off + j]);
|
||||
qlens[j] = s->seq[off + j].l_seq;
|
||||
qseqs[j] = s->seq[off + j].seq;
|
||||
quals[j] = is_sr? s->seq[off + j].qual : 0;
|
||||
}
|
||||
mm_map_frag(s->p->mi, s->n_seg[i], qlens, qseqs, quals, &s->n_reg[off], &s->reg[off], b, s->p->opt, s->seq[off].name);
|
||||
if (s->p->opt->flag & MM_F_INDEPEND_SEG) {
|
||||
for (j = 0; j < s->n_seg[i]; ++j) {
|
||||
mm_map_frag(s->p->mi, 1, &qlens[j], &qseqs[j], &s->n_reg[off+j], &s->reg[off+j], b, s->p->opt, s->seq[off+j].name);
|
||||
s->rep_len[off + j] = b->rep_len;
|
||||
s->frag_gap[off + j] = b->frag_gap;
|
||||
}
|
||||
} else {
|
||||
mm_map_frag(s->p->mi, s->n_seg[i], qlens, qseqs, &s->n_reg[off], &s->reg[off], b, s->p->opt, s->seq[off].name);
|
||||
for (j = 0; j < s->n_seg[i]; ++j) {
|
||||
s->rep_len[off + j] = b->rep_len;
|
||||
s->frag_gap[off + j] = b->frag_gap;
|
||||
}
|
||||
}
|
||||
for (j = 0; j < s->n_seg[i]; ++j) // flip the query strand and coordinate to the original read strand
|
||||
if (s->n_seg[i] == 2 && ((j == 0 && (pe_ori>>1&1)) || (j == 1 && (pe_ori&1)))) {
|
||||
int k, t;
|
||||
@@ -427,9 +464,63 @@ static void worker_for(void *_data, long i, int tid) // kt_for() callback
|
||||
r->rev = !r->rev;
|
||||
}
|
||||
}
|
||||
kfree(b->km, qlens);
|
||||
kfree(b->km, qseqs);
|
||||
kfree(b->km, quals);
|
||||
}
|
||||
|
||||
static void merge_hits(step_t *s)
|
||||
{
|
||||
int f, i, k0, k, max_seg = 0, *n_reg_part, *rep_len_part, *frag_gap_part, *qlens;
|
||||
void *km;
|
||||
FILE **fp = s->p->fp_parts;
|
||||
const mm_mapopt_t *opt = s->p->opt;
|
||||
|
||||
km = km_init();
|
||||
for (f = 0; f < s->n_frag; ++f)
|
||||
max_seg = max_seg > s->n_seg[f]? max_seg : s->n_seg[f];
|
||||
qlens = CALLOC(int, max_seg + s->p->n_parts * 3);
|
||||
n_reg_part = qlens + max_seg;
|
||||
rep_len_part = n_reg_part + s->p->n_parts;
|
||||
frag_gap_part = rep_len_part + s->p->n_parts;
|
||||
for (f = 0, k = k0 = 0; f < s->n_frag; ++f) {
|
||||
k0 = k;
|
||||
for (i = 0; i < s->n_seg[f]; ++i, ++k) {
|
||||
int j, l, t, rep_len = 0;
|
||||
qlens[i] = s->seq[k].l_seq;
|
||||
for (j = 0, s->n_reg[k] = 0; j < s->p->n_parts; ++j) {
|
||||
mm_err_fread(&n_reg_part[j], sizeof(int), 1, fp[j]);
|
||||
mm_err_fread(&rep_len_part[j], sizeof(int), 1, fp[j]);
|
||||
mm_err_fread(&frag_gap_part[j], sizeof(int), 1, fp[j]);
|
||||
s->n_reg[k] += n_reg_part[j];
|
||||
if (rep_len < rep_len_part[j])
|
||||
rep_len = rep_len_part[j];
|
||||
}
|
||||
s->reg[k] = CALLOC(mm_reg1_t, s->n_reg[k]);
|
||||
for (j = 0, l = 0; j < s->p->n_parts; ++j) {
|
||||
for (t = 0; t < n_reg_part[j]; ++t, ++l) {
|
||||
mm_reg1_t *r = &s->reg[k][l];
|
||||
uint32_t capacity;
|
||||
mm_err_fread(r, sizeof(mm_reg1_t), 1, fp[j]);
|
||||
r->rid += s->p->rid_shift[j];
|
||||
if (opt->flag & MM_F_CIGAR) {
|
||||
mm_err_fread(&capacity, 4, 1, fp[j]);
|
||||
r->p = (mm_extra_t*)calloc(capacity, 4);
|
||||
r->p->capacity = capacity;
|
||||
mm_err_fread(r->p, r->p->capacity, 4, fp[j]);
|
||||
}
|
||||
}
|
||||
}
|
||||
mm_hit_sort(km, &s->n_reg[k], s->reg[k], opt->alt_drop);
|
||||
mm_set_parent(km, opt->mask_level, opt->mask_len, s->n_reg[k], s->reg[k], opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL, opt->alt_drop);
|
||||
if (!(opt->flag & MM_F_ALL_CHAINS)) {
|
||||
mm_select_sub(km, opt->pri_ratio, s->p->mi->k*2, opt->best_n, &s->n_reg[k], s->reg[k]);
|
||||
mm_set_sam_pri(s->n_reg[k], s->reg[k]);
|
||||
}
|
||||
mm_set_mapq(km, s->n_reg[k], s->reg[k], opt->min_chain_score, opt->a, rep_len, !!(opt->flag & MM_F_SR));
|
||||
}
|
||||
if (s->n_seg[f] == 2 && opt->pe_ori >= 0 && (opt->flag&MM_F_CIGAR))
|
||||
mm_pair(km, frag_gap_part[0], opt->pe_bonus, opt->a * 2 + opt->b, opt->a, qlens, &s->n_reg[k0], &s->reg[k0]);
|
||||
}
|
||||
free(qlens);
|
||||
km_destroy(km);
|
||||
}
|
||||
|
||||
static void *worker_pipeline(void *shared, int step, void *in)
|
||||
@@ -438,11 +529,12 @@ static void *worker_pipeline(void *shared, int step, void *in)
|
||||
pipeline_t *p = (pipeline_t*)shared;
|
||||
if (step == 0) { // step 0: read sequences
|
||||
int with_qual = (!!(p->opt->flag & MM_F_OUT_SAM) && !(p->opt->flag & MM_F_NO_QUAL));
|
||||
int with_comment = !!(p->opt->flag & MM_F_COPY_COMMENT);
|
||||
int frag_mode = (p->n_fp > 1 || !!(p->opt->flag & MM_F_FRAG_MODE));
|
||||
step_t *s;
|
||||
s = (step_t*)calloc(1, sizeof(step_t));
|
||||
if (p->n_fp > 1) s->seq = mm_bseq_read_frag(p->n_fp, p->fp, p->mini_batch_size, with_qual, &s->n_seq);
|
||||
else s->seq = mm_bseq_read2(p->fp[0], p->mini_batch_size, with_qual, frag_mode, &s->n_seq);
|
||||
if (p->n_fp > 1) s->seq = mm_bseq_read_frag2(p->n_fp, p->fp, p->mini_batch_size, with_qual, with_comment, &s->n_seq);
|
||||
else s->seq = mm_bseq_read3(p->fp[0], p->mini_batch_size, with_qual, with_comment, frag_mode, &s->n_seq);
|
||||
if (s->seq) {
|
||||
s->p = p;
|
||||
for (i = 0; i < s->n_seq; ++i)
|
||||
@@ -450,9 +542,11 @@ static void *worker_pipeline(void *shared, int step, void *in)
|
||||
s->buf = (mm_tbuf_t**)calloc(p->n_threads, sizeof(mm_tbuf_t*));
|
||||
for (i = 0; i < p->n_threads; ++i)
|
||||
s->buf[i] = mm_tbuf_init();
|
||||
s->n_reg = (int*)calloc(3 * s->n_seq, sizeof(int));
|
||||
s->seg_off = s->n_reg + s->n_seq; // seg_off and n_seg are allocated together with n_reg
|
||||
s->n_reg = (int*)calloc(5 * s->n_seq, sizeof(int));
|
||||
s->seg_off = s->n_reg + s->n_seq; // seg_off, n_seg, rep_len and frag_gap are allocated together with n_reg
|
||||
s->n_seg = s->seg_off + s->n_seq;
|
||||
s->rep_len = s->n_seg + s->n_seq;
|
||||
s->frag_gap = s->rep_len + s->n_seq;
|
||||
s->reg = (mm_reg1_t**)calloc(s->n_seq, sizeof(mm_reg1_t*));
|
||||
for (i = 1, j = 0; i <= s->n_seq; ++i)
|
||||
if (i == s->n_seq || !frag_mode || !mm_qname_same(s->seq[i-1].name, s->seq[i].name)) {
|
||||
@@ -463,7 +557,8 @@ static void *worker_pipeline(void *shared, int step, void *in)
|
||||
return s;
|
||||
} else free(s);
|
||||
} else if (step == 1) { // step 1: map
|
||||
kt_for(p->n_threads, worker_for, in, ((step_t*)in)->n_frag);
|
||||
if (p->n_parts > 0) merge_hits((step_t*)in);
|
||||
else kt_for(p->n_threads, worker_for, in, ((step_t*)in)->n_frag);
|
||||
return in;
|
||||
} else if (step == 2) { // step 2: output
|
||||
void *km = 0;
|
||||
@@ -476,20 +571,36 @@ static void *worker_pipeline(void *shared, int step, void *in)
|
||||
int seg_st = s->seg_off[k], seg_en = s->seg_off[k] + s->n_seg[k];
|
||||
for (i = seg_st; i < seg_en; ++i) {
|
||||
mm_bseq1_t *t = &s->seq[i];
|
||||
for (j = 0; j < s->n_reg[i]; ++j) {
|
||||
mm_reg1_t *r = &s->reg[i][j];
|
||||
assert(!r->sam_pri || r->id == r->parent);
|
||||
if ((p->opt->flag & MM_F_NO_PRINT_2ND) && r->id != r->parent)
|
||||
continue;
|
||||
if (p->opt->split_prefix && p->n_parts == 0) { // then write to temporary files
|
||||
mm_err_fwrite(&s->n_reg[i], sizeof(int), 1, p->fp_split);
|
||||
mm_err_fwrite(&s->rep_len[i], sizeof(int), 1, p->fp_split);
|
||||
mm_err_fwrite(&s->frag_gap[i], sizeof(int), 1, p->fp_split);
|
||||
for (j = 0; j < s->n_reg[i]; ++j) {
|
||||
mm_reg1_t *r = &s->reg[i][j];
|
||||
mm_err_fwrite(r, sizeof(mm_reg1_t), 1, p->fp_split);
|
||||
if (p->opt->flag & MM_F_CIGAR) {
|
||||
mm_err_fwrite(&r->p->capacity, 4, 1, p->fp_split);
|
||||
mm_err_fwrite(r->p, r->p->capacity, 4, p->fp_split);
|
||||
}
|
||||
}
|
||||
} else if (s->n_reg[i] > 0) { // the query has at least one hit
|
||||
for (j = 0; j < s->n_reg[i]; ++j) {
|
||||
mm_reg1_t *r = &s->reg[i][j];
|
||||
assert(!r->sam_pri || r->id == r->parent);
|
||||
if ((p->opt->flag & MM_F_NO_PRINT_2ND) && r->id != r->parent)
|
||||
continue;
|
||||
if (p->opt->flag & MM_F_OUT_SAM)
|
||||
mm_write_sam3(&p->str, mi, t, i - seg_st, j, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag, s->rep_len[i]);
|
||||
else
|
||||
mm_write_paf3(&p->str, mi, t, r, km, p->opt->flag, s->rep_len[i]);
|
||||
mm_err_puts(p->str.s);
|
||||
}
|
||||
} else if ((p->opt->flag & MM_F_PAF_NO_HIT) || ((p->opt->flag & MM_F_OUT_SAM) && !(p->opt->flag & MM_F_SAM_HIT_ONLY))) { // output an empty hit, if requested
|
||||
if (p->opt->flag & MM_F_OUT_SAM)
|
||||
mm_write_sam2(&p->str, mi, t, i - seg_st, j, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag);
|
||||
mm_write_sam3(&p->str, mi, t, i - seg_st, -1, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag, s->rep_len[i]);
|
||||
else
|
||||
mm_write_paf(&p->str, mi, t, r, km, p->opt->flag);
|
||||
puts(p->str.s);
|
||||
}
|
||||
if (s->n_reg[i] == 0 && (p->opt->flag & MM_F_OUT_SAM)) {
|
||||
mm_write_sam2(&p->str, mi, t, i - seg_st, -1, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag);
|
||||
puts(p->str.s);
|
||||
mm_write_paf3(&p->str, mi, t, 0, 0, p->opt->flag, s->rep_len[i]);
|
||||
mm_err_puts(p->str.s);
|
||||
}
|
||||
}
|
||||
for (i = seg_st; i < seg_en; ++i) {
|
||||
@@ -497,9 +608,10 @@ static void *worker_pipeline(void *shared, int step, void *in)
|
||||
free(s->reg[i]);
|
||||
free(s->seq[i].seq); free(s->seq[i].name);
|
||||
if (s->seq[i].qual) free(s->seq[i].qual);
|
||||
if (s->seq[i].comment) free(s->seq[i].comment);
|
||||
}
|
||||
}
|
||||
free(s->reg); free(s->n_reg); free(s->seq); // seg_off and n_seg were allocated with reg; no memory leak here
|
||||
free(s->reg); free(s->n_reg); free(s->seq); // seg_off, n_seg, rep_len and frag_gap were allocated with reg; no memory leak here
|
||||
km_destroy(km);
|
||||
if (mm_verbose >= 3)
|
||||
fprintf(stderr, "[M::%s::%.3f*%.2f] mapped %d sequences\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), s->n_seq);
|
||||
@@ -508,32 +620,44 @@ static void *worker_pipeline(void *shared, int step, void *in)
|
||||
return 0;
|
||||
}
|
||||
|
||||
static mm_bseq_file_t **open_bseqs(int n, const char **fn)
|
||||
{
|
||||
mm_bseq_file_t **fp;
|
||||
int i, j;
|
||||
fp = (mm_bseq_file_t**)calloc(n, sizeof(mm_bseq_file_t*));
|
||||
for (i = 0; i < n; ++i) {
|
||||
if ((fp[i] = mm_bseq_open(fn[i])) == 0) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "ERROR: failed to open file '%s': %s\n", fn[i], strerror(errno));
|
||||
for (j = 0; j < i; ++j)
|
||||
mm_bseq_close(fp[j]);
|
||||
free(fp);
|
||||
return 0;
|
||||
}
|
||||
}
|
||||
return fp;
|
||||
}
|
||||
|
||||
int mm_map_file_frag(const mm_idx_t *idx, int n_segs, const char **fn, const mm_mapopt_t *opt, int n_threads)
|
||||
{
|
||||
int i, j, pl_threads;
|
||||
int i, pl_threads;
|
||||
pipeline_t pl;
|
||||
if (n_segs < 1) return -1;
|
||||
memset(&pl, 0, sizeof(pipeline_t));
|
||||
pl.n_fp = n_segs;
|
||||
pl.fp = (mm_bseq_file_t**)calloc(n_segs, sizeof(mm_bseq_file_t*));
|
||||
for (i = 0; i < n_segs; ++i) {
|
||||
pl.fp[i] = mm_bseq_open(fn[i]);
|
||||
if (pl.fp[i] == 0) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "ERROR: failed to open file '%s'\n", fn[i]);
|
||||
for (j = 0; j < i; ++j)
|
||||
mm_bseq_close(pl.fp[j]);
|
||||
free(pl.fp);
|
||||
return -1;
|
||||
}
|
||||
}
|
||||
pl.fp = open_bseqs(pl.n_fp, fn);
|
||||
if (pl.fp == 0) return -1;
|
||||
pl.opt = opt, pl.mi = idx;
|
||||
pl.n_threads = n_threads > 1? n_threads : 1;
|
||||
pl.mini_batch_size = opt->mini_batch_size;
|
||||
if (opt->split_prefix)
|
||||
pl.fp_split = mm_split_init(opt->split_prefix, idx);
|
||||
pl_threads = n_threads == 1? 1 : (opt->flag&MM_F_2_IO_THREADS)? 3 : 2;
|
||||
kt_pipeline(pl_threads, worker_pipeline, &pl, 3);
|
||||
|
||||
free(pl.str.s);
|
||||
for (i = 0; i < n_segs; ++i)
|
||||
if (pl.fp_split) fclose(pl.fp_split);
|
||||
for (i = 0; i < pl.n_fp; ++i)
|
||||
mm_bseq_close(pl.fp[i]);
|
||||
free(pl.fp);
|
||||
return 0;
|
||||
@@ -543,3 +667,48 @@ int mm_map_file(const mm_idx_t *idx, const char *fn, const mm_mapopt_t *opt, int
|
||||
{
|
||||
return mm_map_file_frag(idx, 1, &fn, opt, n_threads);
|
||||
}
|
||||
|
||||
int mm_split_merge(int n_segs, const char **fn, const mm_mapopt_t *opt, int n_split_idx)
|
||||
{
|
||||
int i;
|
||||
pipeline_t pl;
|
||||
mm_idx_t *mi;
|
||||
if (n_segs < 1 || n_split_idx < 1) return -1;
|
||||
memset(&pl, 0, sizeof(pipeline_t));
|
||||
pl.n_fp = n_segs;
|
||||
pl.fp = open_bseqs(pl.n_fp, fn);
|
||||
if (pl.fp == 0) return -1;
|
||||
pl.opt = opt;
|
||||
pl.mini_batch_size = opt->mini_batch_size;
|
||||
|
||||
pl.n_parts = n_split_idx;
|
||||
pl.fp_parts = CALLOC(FILE*, pl.n_parts);
|
||||
pl.rid_shift = CALLOC(uint32_t, pl.n_parts);
|
||||
pl.mi = mi = mm_split_merge_prep(opt->split_prefix, n_split_idx, pl.fp_parts, pl.rid_shift);
|
||||
if (pl.mi == 0) {
|
||||
free(pl.fp_parts);
|
||||
free(pl.rid_shift);
|
||||
return -1;
|
||||
}
|
||||
for (i = n_split_idx - 1; i > 0; --i)
|
||||
pl.rid_shift[i] = pl.rid_shift[i - 1];
|
||||
for (pl.rid_shift[0] = 0, i = 1; i < n_split_idx; ++i)
|
||||
pl.rid_shift[i] += pl.rid_shift[i - 1];
|
||||
if (opt->flag & MM_F_OUT_SAM)
|
||||
for (i = 0; i < (int32_t)pl.mi->n_seq; ++i)
|
||||
printf("@SQ\tSN:%s\tLN:%d\n", pl.mi->seq[i].name, pl.mi->seq[i].len);
|
||||
|
||||
kt_pipeline(2, worker_pipeline, &pl, 3);
|
||||
|
||||
free(pl.str.s);
|
||||
mm_idx_destroy(mi);
|
||||
free(pl.rid_shift);
|
||||
for (i = 0; i < n_split_idx; ++i)
|
||||
fclose(pl.fp_parts[i]);
|
||||
free(pl.fp_parts);
|
||||
for (i = 0; i < pl.n_fp; ++i)
|
||||
mm_bseq_close(pl.fp[i]);
|
||||
free(pl.fp);
|
||||
mm_split_rm_tmp(opt->split_prefix, n_split_idx);
|
||||
return 0;
|
||||
}
|
||||
|
||||
@@ -5,23 +5,41 @@
|
||||
#include <stdio.h>
|
||||
#include <sys/types.h>
|
||||
|
||||
#define MM_F_NO_SELF 0x001
|
||||
#define MM_F_AVA 0x002
|
||||
#define MM_F_CIGAR 0x004
|
||||
#define MM_F_OUT_SAM 0x008
|
||||
#define MM_F_NO_QUAL 0x010
|
||||
#define MM_F_OUT_CG 0x020
|
||||
#define MM_F_OUT_CS 0x040
|
||||
#define MM_F_SPLICE 0x080 // splice mode
|
||||
#define MM_F_SPLICE_FOR 0x100 // match GT-AG
|
||||
#define MM_F_SPLICE_REV 0x200 // match CT-AC, the reverse complement of GT-AG
|
||||
#define MM_F_NO_LJOIN 0x400
|
||||
#define MM_F_OUT_CS_LONG 0x800
|
||||
#define MM_F_SR 0x1000
|
||||
#define MM_F_FRAG_MODE 0x2000
|
||||
#define MM_F_NO_DIAG 0x001 // no exact diagonal hit
|
||||
#define MM_F_NO_DUAL 0x002 // skip pairs where query name is lexicographically larger than target name
|
||||
#define MM_F_CIGAR 0x004
|
||||
#define MM_F_OUT_SAM 0x008
|
||||
#define MM_F_NO_QUAL 0x010
|
||||
#define MM_F_OUT_CG 0x020
|
||||
#define MM_F_OUT_CS 0x040
|
||||
#define MM_F_SPLICE 0x080 // splice mode
|
||||
#define MM_F_SPLICE_FOR 0x100 // match GT-AG
|
||||
#define MM_F_SPLICE_REV 0x200 // match CT-AC, the reverse complement of GT-AG
|
||||
#define MM_F_NO_LJOIN 0x400
|
||||
#define MM_F_OUT_CS_LONG 0x800
|
||||
#define MM_F_SR 0x1000
|
||||
#define MM_F_FRAG_MODE 0x2000
|
||||
#define MM_F_NO_PRINT_2ND 0x4000
|
||||
#define MM_F_2_IO_THREADS 0x8000
|
||||
#define MM_F_LONG_CIGAR 0x10000
|
||||
#define MM_F_INDEPEND_SEG 0x20000
|
||||
#define MM_F_SPLICE_FLANK 0x40000
|
||||
#define MM_F_SOFTCLIP 0x80000
|
||||
#define MM_F_FOR_ONLY 0x100000
|
||||
#define MM_F_REV_ONLY 0x200000
|
||||
#define MM_F_HEAP_SORT 0x400000
|
||||
#define MM_F_ALL_CHAINS 0x800000
|
||||
#define MM_F_OUT_MD 0x1000000
|
||||
#define MM_F_COPY_COMMENT 0x2000000
|
||||
#define MM_F_EQX 0x4000000 // use =/X instead of M
|
||||
#define MM_F_PAF_NO_HIT 0x8000000 // output unmapped reads to PAF
|
||||
#define MM_F_NO_END_FLT 0x10000000
|
||||
#define MM_F_HARD_MLEVEL 0x20000000
|
||||
#define MM_F_SAM_HIT_ONLY 0x40000000
|
||||
|
||||
#define MM_I_HPC 0x1
|
||||
#define MM_I_NO_SEQ 0x2
|
||||
#define MM_I_NO_NAME 0x4
|
||||
|
||||
#define MM_IDX_MAGIC "MMI\2"
|
||||
|
||||
@@ -40,15 +58,19 @@ typedef struct {
|
||||
char *name; // name of the db sequence
|
||||
uint64_t offset; // offset in mm_idx_t::S
|
||||
uint32_t len; // length
|
||||
uint32_t is_alt;
|
||||
} mm_idx_seq_t;
|
||||
|
||||
typedef struct {
|
||||
int32_t b, w, k, is_hpc;
|
||||
int32_t b, w, k, flag;
|
||||
uint32_t n_seq; // number of reference sequences
|
||||
int32_t index;
|
||||
int32_t n_alt;
|
||||
mm_idx_seq_t *seq; // sequence name, length and offset
|
||||
uint32_t *S; // 4-bit packed sequence
|
||||
struct mm_idx_bucket_s *B; // index (hidden)
|
||||
void *km;
|
||||
struct mm_idx_intv_s *I; // intervals (hidden)
|
||||
void *km, *h;
|
||||
} mm_idx_t;
|
||||
|
||||
// minimap2 alignment
|
||||
@@ -57,66 +79,80 @@ typedef struct {
|
||||
int32_t dp_score, dp_max, dp_max2; // DP score; score of the max-scoring segment; score of the best alternate mappings
|
||||
uint32_t n_ambi:30, trans_strand:2; // number of ambiguous bases; transcript strand: 0 for unknown, 1 for +, 2 for -
|
||||
uint32_t n_cigar; // number of cigar operations in cigar[]
|
||||
float n_diff2;
|
||||
uint32_t blen2;
|
||||
uint32_t cigar[];
|
||||
} mm_extra_t;
|
||||
|
||||
typedef struct {
|
||||
int32_t id; // ID for internal uses (see also parent below)
|
||||
uint32_t cnt:30, rev:1, seg_split:1; // number of minimizers; if on the reverse strand
|
||||
uint32_t rid:31, inv:1; // reference index; if this is an alignment from inversion rescue
|
||||
int32_t score; // DP alignment score
|
||||
int32_t qs, qe, rs, re; // query start and end; reference start and end
|
||||
int32_t parent, subsc; // parent==id if primary; best alternate mapping score
|
||||
int32_t as; // offset in the a[] array (for internal uses only)
|
||||
int32_t mlen, blen; // seeded exact match length; seeded alignment block length
|
||||
uint32_t mapq:8, split:2, n_sub:22; // mapQ; split pattern; number of suboptimal mappings
|
||||
uint32_t sam_pri:1, proper_frag:1, iden_flt:1, pe_thru:1, dummy:29;
|
||||
int32_t id; // ID for internal uses (see also parent below)
|
||||
int32_t cnt; // number of minimizers; if on the reverse strand
|
||||
int32_t rid; // reference index; if this is an alignment from inversion rescue
|
||||
int32_t score; // DP alignment score
|
||||
int32_t qs, qe, rs, re; // query start and end; reference start and end
|
||||
int32_t parent, subsc; // parent==id if primary; best alternate mapping score
|
||||
int32_t as; // offset in the a[] array (for internal uses only)
|
||||
int32_t mlen, blen; // seeded exact match length; seeded alignment block length
|
||||
int32_t n_sub; // number of suboptimal mappings
|
||||
int32_t score0; // initial chaining score (before chain merging/spliting)
|
||||
uint32_t mapq:8, split:2, rev:1, inv:1, sam_pri:1, proper_frag:1, pe_thru:1, seg_split:1, seg_id:8, split_inv:1, is_alt:1, dummy:6;
|
||||
uint32_t hash;
|
||||
float div;
|
||||
mm_extra_t *p;
|
||||
} mm_reg1_t;
|
||||
|
||||
// indexing and mapping options
|
||||
typedef struct {
|
||||
short k, w, is_hpc, bucket_bits;
|
||||
int mini_batch_size;
|
||||
short k, w, flag, bucket_bits;
|
||||
int64_t mini_batch_size;
|
||||
uint64_t batch_size;
|
||||
} mm_idxopt_t;
|
||||
|
||||
typedef struct {
|
||||
int64_t flag; // see MM_F_* macros
|
||||
int seed;
|
||||
int sdust_thres; // score threshold for SDUST; 0 to disable
|
||||
int flag; // see MM_F_* macros
|
||||
|
||||
int max_qlen; // max query length
|
||||
|
||||
int bw; // bandwidth
|
||||
int max_gap, max_gap_ref; // break a chain if there are no minimizers in a max_gap window
|
||||
int max_frag_len;
|
||||
int max_chain_skip;
|
||||
int max_chain_skip, max_chain_iter;
|
||||
int min_cnt; // min number of minimizers on each chain
|
||||
int min_chain_score; // min chaining score
|
||||
float chain_gap_scale;
|
||||
|
||||
float mask_level;
|
||||
int mask_len;
|
||||
float pri_ratio;
|
||||
int best_n; // top best_n chains are subjected to DP alignment
|
||||
float min_iden;
|
||||
|
||||
int max_join_long, max_join_short;
|
||||
int min_join_flank_sc;
|
||||
float min_join_flank_ratio;
|
||||
|
||||
float alt_drop;
|
||||
|
||||
int a, b, q, e, q2, e2; // matching score, mismatch, gap-open and gap-ext penalties
|
||||
int sc_ambi; // score when one or both bases are "N"
|
||||
int noncan; // cost of non-canonical splicing sites
|
||||
int zdrop; // break alignment if alignment score drops too fast along the diagonal
|
||||
int junc_bonus;
|
||||
int zdrop, zdrop_inv; // break alignment if alignment score drops too fast along the diagonal
|
||||
int end_bonus;
|
||||
int min_dp_max; // drop an alignment if the score of the max scoring segment is below this threshold
|
||||
int min_ksw_len;
|
||||
int anchor_ext_len, anchor_ext_shift;
|
||||
float max_clip_ratio; // drop an alignment if BOTH ends are clipped above this ratio
|
||||
|
||||
int pe_ori, pe_bonus;
|
||||
|
||||
float mid_occ_frac; // only used by mm_mapopt_update(); see below
|
||||
int32_t min_mid_occ;
|
||||
int32_t mid_occ; // ignore seeds with occurrences above this threshold
|
||||
int32_t max_occ;
|
||||
int mini_batch_size; // size of a batch of query bases to process in parallel
|
||||
int64_t mini_batch_size; // size of a batch of query bases to process in parallel
|
||||
int64_t max_sw_mat;
|
||||
|
||||
const char *split_prefix;
|
||||
} mm_mapopt_t;
|
||||
|
||||
// index reader
|
||||
@@ -148,6 +184,7 @@ extern double mm_realtime0; // wall-clock timer
|
||||
* @return 0 if success; -1 if _present_ unknown
|
||||
*/
|
||||
int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo);
|
||||
int mm_check_opt(const mm_idxopt_t *io, const mm_mapopt_t *mo);
|
||||
|
||||
/**
|
||||
* Update mm_mapopt_t::mid_occ via mm_mapopt_t::mid_occ_frac
|
||||
@@ -200,6 +237,51 @@ void mm_idx_reader_close(mm_idx_reader_t *r);
|
||||
|
||||
int mm_idx_reader_eof(const mm_idx_reader_t *r);
|
||||
|
||||
/**
|
||||
* Check whether the file contains a minimap2 index
|
||||
*
|
||||
* @param fn file name
|
||||
*
|
||||
* @return the file size if fn is an index file; 0 if fn is not.
|
||||
*/
|
||||
int64_t mm_idx_is_idx(const char *fn);
|
||||
|
||||
/**
|
||||
* Load a part of an index
|
||||
*
|
||||
* Given a uni-part index, this function loads the entire index into memory.
|
||||
* Given a multi-part index, it loads one part only and places the file pointer
|
||||
* at the end of that part.
|
||||
*
|
||||
* @param fp pointer to FILE object
|
||||
*
|
||||
* @return minimap2 index read from fp
|
||||
*/
|
||||
mm_idx_t *mm_idx_load(FILE *fp);
|
||||
|
||||
/**
|
||||
* Append an index (or one part of a full index) to file
|
||||
*
|
||||
* @param fp pointer to FILE object
|
||||
* @param mi minimap2 index
|
||||
*/
|
||||
void mm_idx_dump(FILE *fp, const mm_idx_t *mi);
|
||||
|
||||
/**
|
||||
* Create an index from strings in memory
|
||||
*
|
||||
* @param w minimizer window size
|
||||
* @param k minimizer k-mer size
|
||||
* @param is_hpc use HPC k-mer if true
|
||||
* @param bucket_bits number of bits for the first level of the hash table
|
||||
* @param n number of sequences
|
||||
* @param seq sequences in A/C/G/T
|
||||
* @param name sequence names; could be NULL
|
||||
*
|
||||
* @return minimap2 index
|
||||
*/
|
||||
mm_idx_t *mm_idx_str(int w, int k, int is_hpc, int bucket_bits, int n, const char **seq, const char **name);
|
||||
|
||||
/**
|
||||
* Print index statistics to stderr
|
||||
*
|
||||
@@ -233,6 +315,8 @@ mm_tbuf_t *mm_tbuf_init(void);
|
||||
*/
|
||||
void mm_tbuf_destroy(mm_tbuf_t *b);
|
||||
|
||||
void *mm_tbuf_get_km(mm_tbuf_t *b);
|
||||
|
||||
/**
|
||||
* Align a query sequence against an index
|
||||
*
|
||||
@@ -253,6 +337,8 @@ void mm_tbuf_destroy(mm_tbuf_t *b);
|
||||
*/
|
||||
mm_reg1_t *mm_map(const mm_idx_t *mi, int l_seq, const char *seq, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *name);
|
||||
|
||||
void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, int *n_regs, mm_reg1_t **regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname);
|
||||
|
||||
/**
|
||||
* Align a fasta/fastq file and print alignments to stdout
|
||||
*
|
||||
@@ -267,9 +353,34 @@ int mm_map_file(const mm_idx_t *idx, const char *fn, const mm_mapopt_t *opt, int
|
||||
|
||||
int mm_map_file_frag(const mm_idx_t *idx, int n_segs, const char **fn, const mm_mapopt_t *opt, int n_threads);
|
||||
|
||||
/**
|
||||
* Generate the cs tag (new in 2.12)
|
||||
*
|
||||
* @param km memory blocks; set to NULL if unsure
|
||||
* @param buf buffer to write the cs/MD tag; typicall NULL on the first call
|
||||
* @param max_len max length of the buffer; typically set to 0 on the first call
|
||||
* @param mi index
|
||||
* @param r alignment
|
||||
* @param seq query sequence
|
||||
* @param no_iden true to use : instead of =
|
||||
*
|
||||
* @return the length of cs
|
||||
*/
|
||||
int mm_gen_cs(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int no_iden);
|
||||
int mm_gen_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq);
|
||||
|
||||
// query sequence name and sequence in the minimap2 index
|
||||
int mm_idx_index_name(mm_idx_t *mi);
|
||||
int mm_idx_name2id(const mm_idx_t *mi, const char *name);
|
||||
int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq);
|
||||
|
||||
int mm_idx_alt_read(mm_idx_t *mi, const char *fn);
|
||||
int mm_idx_bed_read(mm_idx_t *mi, const char *fn, int read_junc);
|
||||
int mm_idx_bed_junc(const mm_idx_t *mi, int32_t ctg, int32_t st, int32_t en, uint8_t *s);
|
||||
|
||||
// deprecated APIs for backward compatibility
|
||||
void mm_mapopt_init(mm_mapopt_t *opt);
|
||||
mm_idx_t *mm_idx_build(const char *fn, int w, int k, int is_hpc, int n_threads);
|
||||
mm_idx_t *mm_idx_build(const char *fn, int w, int k, int flag, int n_threads);
|
||||
|
||||
#ifdef __cplusplus
|
||||
}
|
||||
|
||||
+253
-37
@@ -1,4 +1,4 @@
|
||||
.TH minimap2 1 "22 October 2017" "minimap2-2.2-dirty (r531)" "Bioinformatics tools"
|
||||
.TH minimap2 1 "9 April 2021" "minimap2-2.18 (r1015)" "Bioinformatics tools"
|
||||
.SH NAME
|
||||
.PP
|
||||
minimap2 - mapping and alignment between collections of DNA sequences
|
||||
@@ -99,6 +99,14 @@ multiple times to map it against each batch of target sequences.
|
||||
may be ending with k/K/m/M/g/G. NB: mapping quality is incorrect given a
|
||||
multi-part index.
|
||||
.TP
|
||||
.B --idx-no-seq
|
||||
Don't store target sequences in the index. It saves disk space and memory but
|
||||
the index generated with this option will not work with
|
||||
.B -a
|
||||
or
|
||||
.BR -c .
|
||||
When base-level alignment is not requested, this option is automatically applied.
|
||||
.TP
|
||||
.BI -d \ FILE
|
||||
Save the minimizer index of
|
||||
.I target.fa
|
||||
@@ -113,15 +121,40 @@ provided as the target sequences, options
|
||||
.BR -w ,
|
||||
.B -I
|
||||
will be effectively overridden by the options stored in the index file.
|
||||
.TP
|
||||
.BI --alt \ FILE
|
||||
List of ALT contigs [null]
|
||||
.TP
|
||||
.BI --alt-drop \ FLOAT
|
||||
Drop ALT hits by
|
||||
.I FLOAT
|
||||
fraction when ranking and computing mapping quality [0.15]
|
||||
.SS Mapping options
|
||||
.TP 10
|
||||
.BI -f \ FLOAT
|
||||
Ignore top
|
||||
.BI -f \ FLOAT | INT1 [, INT2 ]
|
||||
If fraction, ignore top
|
||||
.I FLOAT
|
||||
fraction of most frequent minimizers [0.0002]
|
||||
fraction of most frequent minimizers [0.0002]. If integer,
|
||||
ignore minimizers occuring more than
|
||||
.I INT1
|
||||
times.
|
||||
.I INT2
|
||||
is only effective in the
|
||||
.B --sr
|
||||
or
|
||||
.B -xsr
|
||||
mode, which sets the threshold for a second round of seeding.
|
||||
.TP
|
||||
.BI --min-occ-floor \ INT
|
||||
Force minimap2 to always use k-mers occurring
|
||||
.I INT
|
||||
times or less [0]. In effect, the max occurrence threshold is set to
|
||||
the
|
||||
.RI max{ INT ,
|
||||
.BR -f }.
|
||||
.TP
|
||||
.BI -g \ INT
|
||||
Stop chain enlongation if there are no minimizers in
|
||||
Stop chain enlongation if there are no minimizers within
|
||||
.IR INT -bp
|
||||
[10000].
|
||||
.TP
|
||||
@@ -140,20 +173,42 @@ Discard chains with chaining score
|
||||
[40]. Chaining score equals the approximate number of matching bases minus a
|
||||
concave gap penalty. It is computed with dynamic programming.
|
||||
.TP
|
||||
.B -D
|
||||
If query sequence name/length are identical to the target name/length, ignore
|
||||
diagonal anchors. This option also reduces DP-based extension along the
|
||||
diagonal.
|
||||
.TP
|
||||
.B -P
|
||||
Retain all chains and don't attempt to set primary chains. Options
|
||||
.B -p
|
||||
and
|
||||
.B -N
|
||||
have no effect when this option is in use.
|
||||
.TP
|
||||
.BR --dual = yes | no
|
||||
If
|
||||
.BR no ,
|
||||
skip query-target pairs wherein the query name is lexicographically greater
|
||||
than the target name [yes]
|
||||
.TP
|
||||
.B -X
|
||||
Perform all-vs-all mapping. In this mode, if the query sequence name is
|
||||
lexicographically larger than the target sequence name, the hits between them
|
||||
will be suppressed; if the query sequence name is the same as the target name,
|
||||
diagonal minimizer hits will also be suppressed.
|
||||
Equivalent to
|
||||
.RB ' -DP
|
||||
.BR --dual = no
|
||||
.BR --no-long-join '.
|
||||
Primarily used for all-vs-all read overlapping.
|
||||
.TP
|
||||
.BI -p \ FLOAT
|
||||
Minimal secondary-to-primary score ratio to output secondary mappings [0.8].
|
||||
Between two chains overlaping over half of the shorter chain (controlled by
|
||||
.BR --mask-level ),
|
||||
.BR -M ),
|
||||
the chain with a lower score is secondary to the chain with a higher score.
|
||||
If the ratio of the scores is below
|
||||
.IR FLOAT ,
|
||||
the secondary chain will not be outputted or extended with DP alignment later.
|
||||
This option has no effect when
|
||||
.B -X
|
||||
is applied.
|
||||
.TP
|
||||
.BI -N \ INT
|
||||
Output at most
|
||||
@@ -171,22 +226,52 @@ Increasing this option slows down spliced alignment. [200k]
|
||||
.TP
|
||||
.BI -F \ NUM
|
||||
Maximum fragment length (aka insert size; effective with
|
||||
.BR -xsr / --frag)
|
||||
.BR -xsr / --frag = yes )
|
||||
[800]
|
||||
.TP
|
||||
.BI -M \ FLOAT
|
||||
Mark as secondary a chain that overlaps with a better chain by
|
||||
.I FLOAT
|
||||
or more of the shorter chain [0.5]
|
||||
.TP
|
||||
.B --hard-mask-level
|
||||
Honor option
|
||||
.B -M
|
||||
and disable a heurstic to save unmapped subsequences and disables
|
||||
.BR --mask-len .
|
||||
.TP
|
||||
.BI --mask-len \ NUM
|
||||
Keep an alignment if dropping it leaves an unaligned region on query longer than
|
||||
.IR INT
|
||||
[inf]. Effective without
|
||||
.BR --hard-mask-level .
|
||||
.TP
|
||||
.BI --max-chain-skip \ INT
|
||||
A heuristics that stops chaining early [50]. Minimap2 uses dynamic programming
|
||||
A heuristics that stops chaining early [25]. Minimap2 uses dynamic programming
|
||||
for chaining. The time complexity is quadratic in the number of seeds. This
|
||||
option makes minimap2 exits the inner loop if it repeatedly sees seeds already
|
||||
on chains. Set
|
||||
.I INT
|
||||
to a large number to switch off this heurstics.
|
||||
.TP
|
||||
.BI --max-chain-iter \ INT
|
||||
Check up to
|
||||
.I INT
|
||||
partial chains during chaining [5000]. This is a heuristic to avoid quadratic
|
||||
time complexity in the worst case.
|
||||
.TP
|
||||
.BI --chain-gap-scale \ FLOAT
|
||||
Scale of gap cost during chaining [1.0]
|
||||
.TP
|
||||
.B --no-long-join
|
||||
Disable the long gap patching heuristic. When this option is applied, the
|
||||
maximum alignment gap is mostly controlled by
|
||||
.BR -r .
|
||||
.TP
|
||||
.BI --lj-min-ratio \ FLOAT
|
||||
Fraction of query sequence length required to bridge a long gap [0.5]. A
|
||||
smaller value helps to recover longer gaps, at the cost of more false gaps.
|
||||
.TP
|
||||
.B --splice
|
||||
Enable the splice alignment mode.
|
||||
.TP
|
||||
@@ -196,8 +281,27 @@ applies a second round of chaining with a higher minimizer occurrence threshold
|
||||
if no good chain is found. In addition, minimap2 attempts to patch gaps between
|
||||
seeds with ungapped alignment.
|
||||
.TP
|
||||
.BR --frag [= no | yes ]
|
||||
.BI --split-prefix \ STR
|
||||
Prefix to create temporary files. Typically used for a multi-part index.
|
||||
.TP
|
||||
.BR --frag = no | yes
|
||||
Whether to enable the fragment mode [no]
|
||||
.TP
|
||||
.B --for-only
|
||||
Only map to the forward strand of the reference sequences. For paired-end
|
||||
reads in the forward-reverse orientation, the first read is mapped to forward
|
||||
strand of the reference and the second read to the reverse stand.
|
||||
.TP
|
||||
.B --rev-only
|
||||
Only map to the reverse complement strand of the reference sequences.
|
||||
.TP
|
||||
.BR --heap-sort = no | yes
|
||||
If yes, sort anchors with heap merge, instead of radix sort. Heap merge is
|
||||
faster for short reads, but slower for long reads. [no]
|
||||
.TP
|
||||
.B --no-pairing
|
||||
Treat two reads in a pair as independent reads. The mate related fields in SAM
|
||||
are still properly populated.
|
||||
.SS Alignment options
|
||||
.TP 10
|
||||
.BI -A \ INT
|
||||
@@ -219,11 +323,27 @@ costs
|
||||
.RI min{ O1 + k * E1 , O2 + k * E2 }.
|
||||
In the splice mode, the second gap penalties are not used.
|
||||
.TP
|
||||
.BI -z \ INT
|
||||
Break an alignment if the running score drops too quickly along the diagonal of
|
||||
the DP matrix (diagonal X-drop, or Z-drop) [400]. Increasing the value improves
|
||||
the contiguity of the alignment at the cost of poor alignment in the middle
|
||||
(e.g. caused by a long inversion).
|
||||
.BI -C \ INT
|
||||
Cost for a non-canonical GT-AG splicing (effective with
|
||||
.BR --splice )
|
||||
[0]
|
||||
.TP
|
||||
.BI -z \ INT1[,INT2]
|
||||
Truncate an alignment if the running alignment score drops too quickly along
|
||||
the diagonal of the DP matrix (diagonal X-drop, or Z-drop) [400,200]. If the
|
||||
drop of score is above
|
||||
.IR INT2 ,
|
||||
minimap2 will reverse complement the query in the related region and align
|
||||
again to test small inversions. Minimap2 truncates alignment if there is an
|
||||
inversion or the drop of score is greater than
|
||||
.IR INT1 .
|
||||
Decrease
|
||||
.I INT2
|
||||
to find small inversions at the cost of performance and false positives.
|
||||
Increase
|
||||
.I INT1
|
||||
to improves the contiguity of alignment at the cost of poor alignment in the
|
||||
middle.
|
||||
.TP
|
||||
.BI -s \ INT
|
||||
Minimal peak DP alignment score to output [40]. The peak score is computed from
|
||||
@@ -239,17 +359,71 @@ both strands;
|
||||
.BR n :
|
||||
no attempt to match GT-AG [n]
|
||||
.TP
|
||||
.BI --cost-non-gt-ag \ INT
|
||||
Cost of non-canonical splicing sites [0].
|
||||
.TP
|
||||
.BI --end-bonus \ INT
|
||||
Score bonus when alignment extends to the end of the query sequence [10].
|
||||
Score bonus when alignment extends to the end of the query sequence [0].
|
||||
.TP
|
||||
.BI --score-N \ INT
|
||||
Score of a mismatch involving ambiguous bases [1].
|
||||
.TP
|
||||
.BR --splice-flank = yes | no
|
||||
Assume the next base to a
|
||||
.B GT
|
||||
donor site tends to be A/G (91% in human and 92% in mouse) and the preceding
|
||||
base to a
|
||||
.B AG
|
||||
acceptor tends to be C/T [no].
|
||||
This trend is evolutionarily conservative, all the way to S. cerevisiae
|
||||
(PMID:18688272). Specifying this option generally leads to higher junction
|
||||
accuracy by several percents, so it is applied by default with
|
||||
.BR --splice .
|
||||
However, the SIRV control does not honor this trend
|
||||
(only ~60%). This option reduces accuracy. If you are benchmarking minimap2
|
||||
on SIRV data, please add
|
||||
.B --splice-flank=no
|
||||
to the command line.
|
||||
.TP
|
||||
.BR --junc-bed \ FILE
|
||||
Gene annotations in the BED12 format (aka 12-column BED), or intron positions
|
||||
in 5-column BED. With this option, minimap2 prefers splicing in annotations.
|
||||
BED12 file can be converted from GTF/GFF3 with `paftools.js gff2bed anno.gtf'
|
||||
[].
|
||||
.TP
|
||||
.BR --junc-bonus \ INT
|
||||
Score bonus for a splice donor or acceptor found in annotation (effective with
|
||||
.BR --junc-bed )
|
||||
[9].
|
||||
.TP
|
||||
.BI --end-seed-pen \ INT
|
||||
Drop a terminal anchor if
|
||||
.IR s <log( g )+ INT ,
|
||||
where
|
||||
.I s
|
||||
is the local alignment score around the anchor and
|
||||
.I g
|
||||
the length of the terminal gap in the chain. This option is only effective
|
||||
with
|
||||
.BR --splice .
|
||||
It helps to avoid tiny terminal exons. [6]
|
||||
.TP
|
||||
.B --no-end-flt
|
||||
Don't filter seeds towards the ends of chains before performing base-level
|
||||
alignment.
|
||||
.TP
|
||||
.BI --cap-sw-mem \ NUM
|
||||
Skip alignment if the DP matrix size is above
|
||||
.IR NUM .
|
||||
Set 0 to disable [0].
|
||||
.SS Input/output options
|
||||
.TP 10
|
||||
.B -a
|
||||
Generate CIGAR and output alignments in the SAM format. Minimap2 outputs in PAF
|
||||
by default.
|
||||
.TP
|
||||
.BI -o \ FILE
|
||||
Output alignments to
|
||||
.I FILE
|
||||
[stdout].
|
||||
.TP
|
||||
.B -Q
|
||||
Ignore base quality in the input file.
|
||||
.TP
|
||||
@@ -261,9 +435,12 @@ the real CIGAR in memory.
|
||||
.TP
|
||||
.BI -R \ STR
|
||||
SAM read group line in a format like
|
||||
.RB @RG\\\\tID:foo\\\\tSM:bar
|
||||
.B @RG\\\\tID:foo\\\\tSM:bar
|
||||
[].
|
||||
.TP
|
||||
.B -y
|
||||
Copy input FASTA/Q comments to output.
|
||||
.TP
|
||||
.B -c
|
||||
Generate CIGAR. In PAF, the CIGAR is written to the `cg' custom tag.
|
||||
.TP
|
||||
@@ -282,6 +459,15 @@ is given,
|
||||
.I short
|
||||
is assumed. [none]
|
||||
.TP
|
||||
.B --MD
|
||||
Output the MD tag (see the SAM spec).
|
||||
.TP
|
||||
.B --eqx
|
||||
Output =/X CIGAR operators for sequence match/mismatch.
|
||||
.TP
|
||||
.B -Y
|
||||
In SAM output, use soft clipping for supplementary alignments.
|
||||
.TP
|
||||
.BI --seed \ INT
|
||||
Integer seed for randomizing equally best hits. Minimap2 hashes
|
||||
.I INT
|
||||
@@ -309,9 +495,21 @@ K/M/G/k/m/g suffix is accepted. A large
|
||||
helps load balancing in the multi-threading mode, at the cost of increased
|
||||
memory.
|
||||
.TP
|
||||
.BR --secondary [= yes | no ]
|
||||
.BR --secondary = yes | no
|
||||
Whether to output secondary alignments [yes]
|
||||
.TP
|
||||
.BI --max-qlen \ NUM
|
||||
Filter out query sequences longer than
|
||||
.IR NUM .
|
||||
.TP
|
||||
.B --paf-no-hit
|
||||
In PAF, output unmapped queries; the strand and the reference name fields are
|
||||
set to `*'. Warning: some paftools.js commands may not work with such output
|
||||
for the moment.
|
||||
.TP
|
||||
.B --sam-hit-only
|
||||
In SAM, don't output unmapped reads.
|
||||
.TP
|
||||
.B --version
|
||||
Print version number to stdout
|
||||
.SS Preset options
|
||||
@@ -341,28 +539,35 @@ is determined by the sequencing error mode.
|
||||
.B asm5
|
||||
Long assembly to reference mapping
|
||||
.RB ( -k19
|
||||
.B -w19 -A1 -B19 -O39,81 -E3,1 -s200
|
||||
.BR -z200 ).
|
||||
.B -w19 -A1 -B19 -O39,81 -E3,1 -s200 -z200 -N50
|
||||
.BR --min-occ-floor=100 ).
|
||||
Typically, the alignment will not extend to regions with 5% or higher sequence
|
||||
divergence. Only use this preset if the average divergence is far below 5%.
|
||||
.TP
|
||||
.B asm10
|
||||
Long assembly to reference mapping
|
||||
.RB ( -k19
|
||||
.B -w19 -A1 -B9 -O16,41 -E2,1 -s200
|
||||
.BR -z200 ).
|
||||
.B -w19 -A1 -B9 -O16,41 -E2,1 -s200 -z200 -N50
|
||||
.BR --min-occ-floor=100 ).
|
||||
Up to 10% sequence divergence.
|
||||
.TP
|
||||
.B asm20
|
||||
Long assembly to reference mapping
|
||||
.RB ( -k19
|
||||
.B -w10 -A1 -B4 -O6,26 -E2,1 -s200 -z200 -N50
|
||||
.BR --min-occ-floor=100 ).
|
||||
Up to 20% sequence divergence.
|
||||
.TP
|
||||
.B ava-pb
|
||||
PacBio all-vs-all overlap mapping
|
||||
.RB ( -Hk19
|
||||
.B -w5 -Xp0 -m100 -g10000 --max-chain-skip
|
||||
.B -Xw5 -m100 -g10000 --max-chain-skip
|
||||
.BR 25 ).
|
||||
.TP
|
||||
.B ava-ont
|
||||
Oxford Nanopore all-vs-all overlap mapping
|
||||
.RB ( -k15
|
||||
.B -w5 -Xp0 -m100 -g10000 --max-chain-skip
|
||||
.B -Xw5 -m100 -g10000 -r2000 --max-chain-skip
|
||||
.BR 25 ).
|
||||
Similarly, the major difference from
|
||||
.B ava-pb
|
||||
@@ -371,8 +576,8 @@ is that this preset is not using HPC minimizers.
|
||||
.B splice
|
||||
Long-read spliced alignment
|
||||
.RB ( -k15
|
||||
.B -w5 --splice -g2000 -G200k -A1 -B2 -O2,32 -E1,0 -z200 -ub --cost-non-gt-ag
|
||||
.BR 5 ).
|
||||
.B -w5 --splice -g2000 -G200k -A1 -B2 -O2,32 -E1,0 -C9 -z200 -ub --junc-bonus=9
|
||||
.BR --splice-flank=yes ).
|
||||
In the splice mode, 1) long deletions are taken as introns and represented as
|
||||
the
|
||||
.RB ` N '
|
||||
@@ -381,11 +586,17 @@ costs are different during chaining; 4) the computation of the
|
||||
.RB ` ms '
|
||||
tag ignores introns to demote hits to pseudogenes.
|
||||
.TP
|
||||
.B splice:hq
|
||||
Long-read splice alignment for PacBio CCS reads
|
||||
.RB ( -xsplice
|
||||
.B -C5 -O6,24
|
||||
.BR -B4 ).
|
||||
.TP
|
||||
.B sr
|
||||
Short single-end reads without splicing
|
||||
.RB ( -k21
|
||||
.B -w11 --sr --frag -A2 -B8 -O12,32 -E2,1 -r50 -p.5 -N20 -f1000,5000 -n2 -m20
|
||||
.B -s40 -g200 -2K50m
|
||||
.B -w11 --sr --frag=yes -A2 -B8 -O12,32 -E2,1 -r50 -p.5 -N20 -f1000,5000 -n2 -m20
|
||||
.B -s40 -g200 -2K50m --heap-sort=yes
|
||||
.BR --secondary=no ).
|
||||
.RE
|
||||
.SS Miscellaneous options
|
||||
@@ -438,17 +649,22 @@ cb | cb | cb
|
||||
r | c | l .
|
||||
Tag Type Description
|
||||
_
|
||||
tp A Type of aln: P/primary, S/secondary and I/inversion
|
||||
tp A Type of aln: P/primary, S/secondary and I,i/inversion
|
||||
cm i Number of minimizers on the chain
|
||||
s1 i Chaining score
|
||||
s2 i Chaining score of the best secondary chain
|
||||
NM i Total number of mismatches and gaps in the alignment
|
||||
MD Z To generate the ref sequence in the alignment
|
||||
AS i DP alignment score
|
||||
SA Z List of other supplementary alignments
|
||||
ms i DP score of the max scoring segment in the alignment
|
||||
nn i Number of ambiguous bases in the alignment
|
||||
ts A Transcript strand (splice mode only)
|
||||
cg Z CIGAR string (only in PAF)
|
||||
cs Z Difference string
|
||||
dv f Approximate per-base sequence divergence
|
||||
de f Gap-compressed per-base sequence divergence
|
||||
rl i Length of query regions harboring repetitive seeds
|
||||
.TE
|
||||
|
||||
.PP
|
||||
@@ -479,8 +695,8 @@ where seed positions may be suboptimal. This should not be a big concern
|
||||
because even the optimal alignment may be wrong in such regions.
|
||||
.TP
|
||||
*
|
||||
Minimap2 requires SSE2 instructions to compile. It is possible to add
|
||||
non-SSE2 support, but it would make minimap2 slower by several times.
|
||||
Minimap2 requires SSE2 or NEON instructions to compile. It is possible to add
|
||||
non-SSE2/NEON support, but it would make minimap2 slower by several times.
|
||||
.SH SEE ALSO
|
||||
.PP
|
||||
miniasm(1), minimap(1), bwa(1).
|
||||
|
||||
@@ -1,4 +1,5 @@
|
||||
#include "minimap.h"
|
||||
#include <stdlib.h>
|
||||
#include "mmpriv.h"
|
||||
|
||||
int mm_verbose = 1;
|
||||
int mm_dbg_flag = 0;
|
||||
@@ -86,6 +87,8 @@ double cputime()
|
||||
|
||||
return kernelModeTime + userModeTime;
|
||||
}
|
||||
|
||||
long peakrss(void) { return 0; }
|
||||
#else
|
||||
#include <sys/resource.h>
|
||||
#include <sys/time.h>
|
||||
@@ -96,16 +99,57 @@ double cputime(void)
|
||||
getrusage(RUSAGE_SELF, &r);
|
||||
return r.ru_utime.tv_sec + r.ru_stime.tv_sec + 1e-6 * (r.ru_utime.tv_usec + r.ru_stime.tv_usec);
|
||||
}
|
||||
|
||||
long peakrss(void)
|
||||
{
|
||||
struct rusage r;
|
||||
getrusage(RUSAGE_SELF, &r);
|
||||
#ifdef __linux__
|
||||
return r.ru_maxrss * 1024;
|
||||
#else
|
||||
return r.ru_maxrss;
|
||||
#endif
|
||||
}
|
||||
|
||||
#endif /* WIN32 || _WIN32 */
|
||||
|
||||
double realtime(void)
|
||||
{
|
||||
struct timeval tp;
|
||||
struct timezone tzp;
|
||||
gettimeofday(&tp, &tzp);
|
||||
gettimeofday(&tp, NULL);
|
||||
return tp.tv_sec + tp.tv_usec * 1e-6;
|
||||
}
|
||||
|
||||
void mm_err_puts(const char *str)
|
||||
{
|
||||
int ret;
|
||||
ret = puts(str);
|
||||
if (ret == EOF) {
|
||||
perror("[ERROR] failed to write the results");
|
||||
exit(EXIT_FAILURE);
|
||||
}
|
||||
}
|
||||
|
||||
void mm_err_fwrite(const void *p, size_t size, size_t nitems, FILE *fp)
|
||||
{
|
||||
int ret;
|
||||
ret = fwrite(p, size, nitems, fp);
|
||||
if (ret == EOF) {
|
||||
perror("[ERROR] failed to write data");
|
||||
exit(EXIT_FAILURE);
|
||||
}
|
||||
}
|
||||
|
||||
void mm_err_fread(void *p, size_t size, size_t nitems, FILE *fp)
|
||||
{
|
||||
int ret;
|
||||
ret = fread(p, size, nitems, fp);
|
||||
if (ret == EOF) {
|
||||
perror("[ERROR] failed to read data");
|
||||
exit(EXIT_FAILURE);
|
||||
}
|
||||
}
|
||||
|
||||
#include "ksort.h"
|
||||
|
||||
#define sort_key_128x(a) ((a).x)
|
||||
|
||||
+170
-19
@@ -1,28 +1,179 @@
|
||||
The [K8 Javascript shell][k8] is needed to run Javascripts in this directory.
|
||||
Precompiled k8 binaries for Mac and Linux can be found at the [K8 release
|
||||
page][k8bin].
|
||||
## <a name="started"></a>Getting Started
|
||||
|
||||
* [paf2aln.js](paf2aln.js): convert PAF to [MAF][maf] or BLAST-like output for
|
||||
eyeballing. PAF has to be generated with minimap2 option `-S`, which writes
|
||||
the aligned sequences to the `cs` tag. An example:
|
||||
```sh
|
||||
../minimap2 -S ../test/MT-*.fa | k8 paf2aln.js /dev/stdin
|
||||
```
|
||||
```sh
|
||||
# install minimap2
|
||||
git clone https://github.com/lh3/minimap2
|
||||
cd minimap2 && make
|
||||
# install the k8 javascript shell
|
||||
curl -L https://github.com/attractivechaos/k8/releases/download/v0.2.4/k8-0.2.4.tar.bz2 | tar -jxf -
|
||||
cp k8-0.2.4/k8-`uname -s` k8 # or copy it to a directory on your $PATH
|
||||
# export PATH="$PATH:`pwd`:`pwd`/misc" # run this if k8, minimap2 or paftools.js not on your $PATH
|
||||
minimap2 --cs test/MT-human.fa test/MT-orang.fa | paftools.js view - # view alignment
|
||||
minimap2 -c test/MT-human.fa test/MT-orang.fa | paftools.js stat - # basic alignment statistics
|
||||
minimap2 -c --cs test/MT-human.fa test/MT-orang.fa \
|
||||
| sort -k6,6 -k8,8n | paftools.js call -L15000 - # calling variants from asm-to-ref alignment
|
||||
minimap2 -c test/MT-human.fa test/MT-orang.fa \
|
||||
| paftools.js liftover -l10000 - <(echo -e "MT_orang\t2000\t5000") # liftOver
|
||||
# no test data for the following examples
|
||||
paftools.js junceval -e anno.gtf splice.sam > out.txt # compare splice junctions to annotations
|
||||
paftools.js splice2bed anno.gtf > anno.bed # convert GTF/GFF3 to BED12
|
||||
```
|
||||
|
||||
* [mapstat.js](mapstat.js): output basic statistics such as the number of
|
||||
non-redundant mapped bases, number of split and secondary alignments and
|
||||
number of long gaps. This scripts seamlessly works with both SAM and PAF.
|
||||
## Table of Contents
|
||||
|
||||
* [sim-pbsim.js](sim-pbsim.js): convert reads simulated with [PBSIM][pbsim] to
|
||||
FASTA and encode the true mapping positions to read names in a format like
|
||||
`S1_33!chr1!225258409!225267761!-`.
|
||||
- [Getting Started](#started)
|
||||
- [Introduction](#intro)
|
||||
- [Evaluation](#eval)
|
||||
- [Evaluating mapping accuracy with simulated reads](#mapeval)
|
||||
- [Evaluating read overlap sensitivity](#oveval)
|
||||
- [Calling Variants from Assemblies](#asmvar)
|
||||
|
||||
* [sim-eval.js](sim-eval.js): evaluate mapping accuracy for FASTA generated
|
||||
with [sim-pbsim.js](sim-pbsim.js) or [sim-mason2.js](sim-mason2.js).
|
||||
## <a name="intro"></a>Introduction
|
||||
|
||||
* [sam2paf.js](sam2paf.js): convert SAM to PAF.
|
||||
paftools.js is a script that processes alignments in the [PAF format][paf],
|
||||
such as converting between formats, evaluating mapping accuracy, lifting over
|
||||
BED files based on alignment, and calling variants from assembly-to-assembly
|
||||
alignment. This script *requires* the [k8 Javascript shell][k8] to run. On
|
||||
Linux or Mac, you can download the precompiled k8 binary with:
|
||||
|
||||
```sh
|
||||
curl -L https://github.com/attractivechaos/k8/releases/download/v0.2.4/k8-0.2.4.tar.bz2 | tar -jxf -
|
||||
cp k8-0.2.4/k8-`uname -s` $HOME/bin/k8 # assuming $HOME/bin in your $PATH
|
||||
```
|
||||
|
||||
It is highly recommended to copy the executable `k8` to a directory on your
|
||||
`$PATH` such as `/usr/bin/env` can find it. Like python scripts, once you
|
||||
install `k8`, you can launch paftools.js in one of the two ways:
|
||||
|
||||
```sh
|
||||
path/to/paftools.js # only if k8 is on your $PATH
|
||||
k8 path/to/paftools.js
|
||||
```
|
||||
|
||||
In a nutshell, paftools.js has the following commands:
|
||||
|
||||
```
|
||||
Usage: paftools.js <command> [arguments]
|
||||
Commands:
|
||||
view convert PAF to BLAST-like (for eyeballing) or MAF
|
||||
splice2bed convert spliced alignment in PAF/SAM to BED12
|
||||
sam2paf convert SAM to PAF
|
||||
delta2paf convert MUMmer's delta to PAF
|
||||
gff2bed convert GTF/GFF3 to BED12
|
||||
|
||||
stat collect basic mapping information in PAF/SAM
|
||||
liftover simplistic liftOver
|
||||
call call variants from asm-to-ref alignment with the cs tag
|
||||
bedcov compute the number of bases covered
|
||||
|
||||
mapeval evaluate mapping accuracy using mason2/PBSIM-simulated FASTQ
|
||||
mason2fq convert mason2-simulated SAM to FASTQ
|
||||
pbsim2fq convert PBSIM-simulated MAF to FASTQ
|
||||
junceval evaluate splice junction consistency with known annotations
|
||||
ov-eval evaluate read overlap sensitivity using read-to-ref mapping
|
||||
```
|
||||
|
||||
paftools.js seamlessly reads both plain text files and gzip'd text files.
|
||||
|
||||
## <a name="eval"></a>Evaluation
|
||||
|
||||
### <a name="mapeval"></a>Evaluating mapping accuracy with simulated reads
|
||||
|
||||
The **pbsim2fq** command of paftools.js converts the MAF output of [pbsim][pbsim]
|
||||
to FASTQ and encodes the true mapping position in the read name in a format like
|
||||
`S1_33!chr1!225258409!225267761!-`. Similarly, the **mason2fq** command
|
||||
converts [mason2][mason2] simulated SAM to FASTQ.
|
||||
|
||||
Command **mapeval** evaluates mapped SAM/PAF. Here is example output:
|
||||
|
||||
```
|
||||
Q 60 32478 0 0.000000000 32478
|
||||
Q 22 16 1 0.000030775 32494
|
||||
Q 21 43 1 0.000061468 32537
|
||||
Q 19 73 1 0.000091996 32610
|
||||
Q 14 66 1 0.000122414 32676
|
||||
Q 10 27 3 0.000214048 32703
|
||||
Q 8 14 1 0.000244521 32717
|
||||
Q 7 13 2 0.000305530 32730
|
||||
Q 6 46 1 0.000335611 32776
|
||||
Q 3 10 1 0.000366010 32786
|
||||
Q 2 20 2 0.000426751 32806
|
||||
Q 1 248 94 0.003267381 33054
|
||||
Q 0 31 17 0.003778147 33085
|
||||
U 3
|
||||
```
|
||||
|
||||
where each Q-line gives the quality threshold, the number of reads mapped with
|
||||
mapping quality equal to or greater than the threshold, number of wrong
|
||||
mappings, accumulative mapping error rate and the accumulative number of
|
||||
mapped reads. The U-line, if present, gives the number of unmapped reads if
|
||||
they are present in the SAM file.
|
||||
|
||||
Suppose the reported mapping coordinate overlap with the true coordinate like
|
||||
the following:
|
||||
|
||||
```
|
||||
truth: --------------------
|
||||
mapper: ----------------------
|
||||
|<- l1 ->|<-- o -->|<-- l2 -->|
|
||||
```
|
||||
|
||||
Let `r=o/(l1+o+l2)`. The reported mapping is considered correct if `r>0.1` by
|
||||
default.
|
||||
|
||||
### <a name="oveval"></a>Evaluating read overlap sensitivity
|
||||
|
||||
Command **ov-eval** takes *sorted* read-to-reference alignment and read
|
||||
overlaps in PAF as input, and evaluates the sensitivity. For example:
|
||||
|
||||
```sh
|
||||
minimap2 -cx map-pb ref.fa reads.fq.gz | sort -k6,6 -k8,8n > reads-to-ref.paf
|
||||
minimap2 -x ava-pb reads.fq.gz reads.fq.gz > ovlp.paf
|
||||
k8 ov-eval.js reads-to-ref.paf ovlp.paf
|
||||
```
|
||||
|
||||
## <a name="asmvar"></a>Calling Variants from Haploid Assemblies
|
||||
|
||||
The **call** command of paftools.js calls variants from coordinate-sorted
|
||||
assembly-to-reference alignment. It calls variants from the [cs tag][cs] and
|
||||
identifies confident/callable regions as those covered by exactly one contig.
|
||||
Here are example command lines:
|
||||
|
||||
```sh
|
||||
minimap2 -cx asm5 -t8 --cs ref.fa asm.fa > asm.paf # keeping this file is recommended; --cs required!
|
||||
sort -k6,6 -k8,8n asm.paf > asm.srt.paf # sort by reference start coordinate
|
||||
k8 paftools.js call asm.srt.paf > asm.var.txt
|
||||
```
|
||||
|
||||
Here is sample output:
|
||||
|
||||
```
|
||||
V chr1 2276040 2276041 1 60 c g LJII01000171.1 1217409 1217410 +
|
||||
V chr1 2280409 2280410 1 60 a g LJII01000171.1 1221778 1221779 +
|
||||
V chr1 2280504 2280505 1 60 a g LJII01000171.1 1221873 1221874 +
|
||||
R chr1 2325140 2436340
|
||||
V chr1 2325287 2325287 1 60 - ct LJII01000171.1 1272894 1272896 +
|
||||
V chr1 2325642 2325644 1 60 tt - LJII01000171.1 1273251 1273251 +
|
||||
V chr1 2326051 2326052 1 60 c t LJII01000171.1 1273658 1273659 +
|
||||
V chr1 2326287 2326288 1 60 c t LJII01000171.1 1273894 1273895 +
|
||||
```
|
||||
|
||||
where a line starting with `R` gives regions covered by one query contig, and a
|
||||
V-line encodes a variant in the following format: chr, start, end, query depth,
|
||||
mapping quality, REF allele, ALT allele, query name, query start, end and the
|
||||
query orientation. Generally, you should only look at variants where column 5
|
||||
is one.
|
||||
|
||||
By default, when calling variants, "paftools.js call" ignores alignments 50kb
|
||||
or shorter; when deriving callable regions, it ignores alignments 10kb or
|
||||
shorter. It uses two thresholds to avoid edge effects. These defaults are
|
||||
designed for long-read assemblies. For short reads, both should be reduced.
|
||||
|
||||
|
||||
|
||||
[paf]: https://github.com/lh3/miniasm/blob/master/PAF.md
|
||||
[cs]: https://github.com/lh3/minimap2#cs
|
||||
[k8]: https://github.com/attractivechaos/k8
|
||||
[k8bin]: https://github.com/attractivechaos/k8/releases
|
||||
[maf]: https://genome.ucsc.edu/FAQ/FAQformat#format5
|
||||
[pbsim]: https://github.com/pfaucon/PBSIM-PacBio-Simulator
|
||||
[mason2]: https://github.com/seqan/seqan/tree/master/apps/mason2
|
||||
|
||||
@@ -1,266 +0,0 @@
|
||||
/*******************************
|
||||
* Command line option parsing *
|
||||
*******************************/
|
||||
|
||||
var getopt = function(args, ostr) {
|
||||
var oli; // option letter list index
|
||||
if (typeof(getopt.place) == 'undefined')
|
||||
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
|
||||
if (getopt.place == -1) { // update scanning pointer
|
||||
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
|
||||
getopt.place = -1;
|
||||
return null;
|
||||
}
|
||||
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
|
||||
++getopt.ind;
|
||||
getopt.place = -1;
|
||||
return null;
|
||||
}
|
||||
}
|
||||
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
|
||||
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
|
||||
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
|
||||
if (getopt.place < 0) ++getopt.ind;
|
||||
return '?';
|
||||
}
|
||||
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
|
||||
getopt.arg = null;
|
||||
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
|
||||
} else { // need an argument
|
||||
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
|
||||
getopt.arg = args[getopt.ind].substr(getopt.place);
|
||||
else if (args.length <= ++getopt.ind) { // no arg
|
||||
getopt.place = -1;
|
||||
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
|
||||
return '?';
|
||||
} else getopt.arg = args[getopt.ind]; // white space
|
||||
getopt.place = -1;
|
||||
++getopt.ind;
|
||||
}
|
||||
return optopt;
|
||||
}
|
||||
|
||||
/***********************
|
||||
* Interval operations *
|
||||
***********************/
|
||||
|
||||
Interval = {};
|
||||
|
||||
Interval.sort = function(a)
|
||||
{
|
||||
if (typeof a[0] == 'number')
|
||||
a.sort(function(x, y) { return x - y });
|
||||
else a.sort(function(x, y) { return x[0] != y[0]? x[0] - y[0] : x[1] - y[1] });
|
||||
}
|
||||
|
||||
Interval.merge = function(a, sorted)
|
||||
{
|
||||
if (typeof sorted == 'undefined') sorted = true;
|
||||
if (!sorted) Interval.sort(a);
|
||||
var k = 0;
|
||||
for (var i = 1; i < a.length; ++i) {
|
||||
if (a[k][1] >= a[i][0])
|
||||
a[k][1] = a[k][1] > a[i][1]? a[k][1] : a[i][1];
|
||||
else a[++k] = a[i].slice(0);
|
||||
}
|
||||
a.length = k + 1;
|
||||
}
|
||||
|
||||
Interval.index_end = function(a, sorted)
|
||||
{
|
||||
if (a.length == 0) return;
|
||||
if (typeof sorted == 'undefined') sorted = true;
|
||||
if (!sorted) Interval.sort(a);
|
||||
a[0].push(0);
|
||||
var k = 0, k_en = a[0][1];
|
||||
for (var i = 1; i < a.length; ++i) {
|
||||
if (k_en <= a[i][0]) {
|
||||
for (++k; k < i; ++k)
|
||||
if (a[k][1] > a[i][0])
|
||||
break;
|
||||
k_en = a[k][1];
|
||||
}
|
||||
a[i].push(k);
|
||||
}
|
||||
}
|
||||
|
||||
Interval.find_intv = function(a, x)
|
||||
{
|
||||
var left = -1, right = a.length;
|
||||
if (typeof a[0] == 'number') {
|
||||
while (right - left > 1) {
|
||||
var mid = left + ((right - left) >> 1);
|
||||
if (a[mid] > x) right = mid;
|
||||
else if (a[mid] < x) left = mid;
|
||||
else return mid;
|
||||
}
|
||||
} else {
|
||||
while (right - left > 1) {
|
||||
var mid = left + ((right - left) >> 1);
|
||||
if (a[mid][0] > x) right = mid;
|
||||
else if (a[mid][0] < x) left = mid;
|
||||
else return mid;
|
||||
}
|
||||
}
|
||||
return left;
|
||||
}
|
||||
|
||||
Interval.find_ovlp = function(a, st, en)
|
||||
{
|
||||
if (a.length == 0 || st >= en) return [];
|
||||
var l = Interval.find_intv(a, st);
|
||||
var k = l < 0? 0 : a[l][a[l].length - 1];
|
||||
var b = [];
|
||||
for (var i = k; i < a.length; ++i) {
|
||||
if (a[i][0] >= en) break;
|
||||
else if (st < a[i][1])
|
||||
b.push(a[i]);
|
||||
}
|
||||
return b;
|
||||
}
|
||||
|
||||
/*****************
|
||||
* Main function *
|
||||
*****************/
|
||||
|
||||
var c, l_fuzzy = 0, print_ovlp = false, print_err_only = false, first_only = false;
|
||||
while ((c = getopt(arguments, "l:ep")) != null) {
|
||||
if (c == 'l') l_fuzzy = parseInt(getopt.arg);
|
||||
else if (c == 'e') print_err_only = print_ovlp = true;
|
||||
else if (c == 'p') print_ovlp = true;
|
||||
}
|
||||
|
||||
if (arguments.length - getopt.ind < 2) {
|
||||
print("Usage: k8 intron-eval.js [options] <gene.gtf> <aln.sam>");
|
||||
exit(1);
|
||||
}
|
||||
|
||||
var file, buf = new Bytes();
|
||||
|
||||
var tr = {};
|
||||
file = new File(arguments[getopt.ind]);
|
||||
while (file.readline(buf) >= 0) {
|
||||
var m, t = buf.toString().split("\t");
|
||||
if (t[0].charAt(0) == '#') continue;
|
||||
if (t[2] != 'exon') continue;
|
||||
var st = parseInt(t[3]) - 1;
|
||||
var en = parseInt(t[4]);
|
||||
if ((m = /transcript_id "(\S+)"/.exec(t[8])) == null) continue;
|
||||
var tid = m[1];
|
||||
if (tr[tid] == null) tr[tid] = [t[0], t[6], 0, 0, []];
|
||||
tr[tid][4].push([st, en]);
|
||||
}
|
||||
file.close();
|
||||
|
||||
var anno = {};
|
||||
for (var tid in tr) {
|
||||
var t = tr[tid];
|
||||
Interval.sort(t[4]);
|
||||
t[2] = t[4][0][0];
|
||||
t[3] = t[4][t[4].length - 1][1];
|
||||
if (anno[t[0]] == null) anno[t[0]] = [];
|
||||
var s = t[4];
|
||||
for (var i = 0; i < s.length - 1; ++i) {
|
||||
if (s[i][1] >= s[i+1][0]) throw Error("ERROR: wrong annotation!");
|
||||
anno[t[0]].push([s[i][1], s[i+1][0]]);
|
||||
}
|
||||
}
|
||||
tr = null;
|
||||
|
||||
for (var chr in anno) {
|
||||
var e = anno[chr];
|
||||
if (e.length == 0) continue;
|
||||
Interval.sort(e);
|
||||
var k = 0;
|
||||
for (var i = 1; i < e.length; ++i) // dedup
|
||||
if (e[i][0] != e[k][0] || e[i][1] != e[k][1])
|
||||
e[++k] = e[i].slice(0);
|
||||
e.length = k + 1;
|
||||
Interval.index_end(e);
|
||||
}
|
||||
|
||||
var n_pri = 0, n_unmapped = 0, n_mapped = 0;
|
||||
var n_sgl = 0, n_splice = 0, n_splice_hit = 0, n_splice_novel = 0;
|
||||
|
||||
file = new File(arguments[getopt.ind+1]);
|
||||
var last_qname = null;
|
||||
var re_cigar = /(\d+)([MIDNSHX=])/g;
|
||||
while (file.readline(buf) >= 0) {
|
||||
var m, t = buf.toString().split("\t");
|
||||
|
||||
if (t[0].charAt(0) == '@') continue;
|
||||
var flag = parseInt(t[1]);
|
||||
if (flag&0x100) continue;
|
||||
if (first_only && last_qname == t[0]) continue;
|
||||
if (t[2] == '*') {
|
||||
++n_unmapped;
|
||||
continue;
|
||||
} else {
|
||||
++n_pri;
|
||||
if (last_qname != t[0]) ++n_mapped;
|
||||
}
|
||||
|
||||
var pos = parseInt(t[3]) - 1, intron = [];
|
||||
while ((m = re_cigar.exec(t[5])) != null) {
|
||||
var len = parseInt(m[1]), op = m[2];
|
||||
if (op == 'N') {
|
||||
intron.push([pos, pos + len]);
|
||||
pos += len;
|
||||
} else if (op == 'M' || op == 'X' || op == '=' || op == 'D') pos += len;
|
||||
}
|
||||
if (intron.length == 0) {
|
||||
++n_sgl;
|
||||
continue;
|
||||
}
|
||||
n_splice += intron.length;
|
||||
|
||||
var chr = anno[t[2]];
|
||||
if (chr != null) {
|
||||
for (var i = 0; i < intron.length; ++i) {
|
||||
var o = Interval.find_ovlp(chr, intron[i][0], intron[i][1]);
|
||||
if (o.length > 0) {
|
||||
var hit = false;
|
||||
for (var j = 0; j < o.length; ++j) {
|
||||
var st_diff = intron[i][0] - o[j][0];
|
||||
var en_diff = intron[i][1] - o[j][1];
|
||||
if (st_diff < 0) st_diff = -st_diff;
|
||||
if (en_diff < 0) en_diff = -en_diff;
|
||||
if (st_diff <= l_fuzzy && en_diff <= l_fuzzy)
|
||||
++n_splice_hit, hit = true;
|
||||
if (hit) break;
|
||||
}
|
||||
if (print_ovlp) {
|
||||
var type = hit? 'C' : 'P';
|
||||
if (hit && print_err_only) continue;
|
||||
var x = '[';
|
||||
for (var j = 0; j < o.length; ++j) {
|
||||
if (j) x += ', ';
|
||||
x += '(' + o[j][0] + "," + o[j][1] + ')';
|
||||
}
|
||||
x += ']';
|
||||
print(type, t[0], i+1, t[2], intron[i][0], intron[i][1], x);
|
||||
}
|
||||
} else {
|
||||
++n_splice_novel;
|
||||
if (print_ovlp)
|
||||
print('N', t[0], i+1, t[2], intron[i][0], intron[i][1]);
|
||||
}
|
||||
}
|
||||
} else {
|
||||
n_splice_novel += intron.length;
|
||||
}
|
||||
last_qname = t[0];
|
||||
}
|
||||
file.close();
|
||||
|
||||
buf.destroy();
|
||||
|
||||
if (!print_ovlp) {
|
||||
print("# unmapped reads: " + n_unmapped);
|
||||
print("# mapped reads: " + n_mapped);
|
||||
print("# primary alignments: " + n_pri);
|
||||
print("# singletons: " + n_sgl);
|
||||
print("# predicted introns: " + n_splice);
|
||||
print("# non-overlapping introns: " + n_splice_novel);
|
||||
print("# correct introns: " + n_splice_hit + " (" + (n_splice_hit / n_splice * 100).toFixed(2) + "%)");
|
||||
}
|
||||
-183
@@ -1,183 +0,0 @@
|
||||
var getopt = function(args, ostr) {
|
||||
var oli; // option letter list index
|
||||
if (typeof(getopt.place) == 'undefined')
|
||||
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
|
||||
if (getopt.place == -1) { // update scanning pointer
|
||||
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
|
||||
getopt.place = -1;
|
||||
return null;
|
||||
}
|
||||
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
|
||||
++getopt.ind;
|
||||
getopt.place = -1;
|
||||
return null;
|
||||
}
|
||||
}
|
||||
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
|
||||
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
|
||||
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
|
||||
if (getopt.place < 0) ++getopt.ind;
|
||||
return '?';
|
||||
}
|
||||
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
|
||||
getopt.arg = null;
|
||||
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
|
||||
} else { // need an argument
|
||||
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
|
||||
getopt.arg = args[getopt.ind].substr(getopt.place);
|
||||
else if (args.length <= ++getopt.ind) { // no arg
|
||||
getopt.place = -1;
|
||||
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
|
||||
return '?';
|
||||
} else getopt.arg = args[getopt.ind]; // white space
|
||||
getopt.place = -1;
|
||||
++getopt.ind;
|
||||
}
|
||||
return optopt;
|
||||
}
|
||||
|
||||
var c, gap_out_len = null;
|
||||
while ((c = getopt(arguments, "l:")) != null)
|
||||
if (c == 'l') gap_out_len = parseInt(getopt.arg);
|
||||
|
||||
if (getopt.ind == arguments.length) {
|
||||
print("Usage: k8 mapstat.js [-l gapOutLen] <in.sam>|<in.paf>");
|
||||
exit(1);
|
||||
}
|
||||
|
||||
var buf = new Bytes();
|
||||
var file = new File(arguments[getopt.ind]);
|
||||
var re = /(\d+)([MIDSHNX=])/g;
|
||||
|
||||
var lineno = 0, n_pri = 0, n_2nd = 0, n_seq = 0, n_cigar_64k = 0, l_tot = 0, l_cov = 0;
|
||||
var n_gap = [[0, 0, 0, 0, 0, 0], [0, 0, 0, 0, 0, 0]];
|
||||
|
||||
function cov_len(regs)
|
||||
{
|
||||
regs.sort(function(a,b) {return a[0]-b[0]});
|
||||
var st = regs[0][0], en = regs[0][1], l = 0;
|
||||
for (var i = 1; i < regs.length; ++i) {
|
||||
if (regs[i][0] < en)
|
||||
en = en > regs[i][1]? en : regs[i][1];
|
||||
else l += en - st, st = regs[i][0], en = regs[i][1];
|
||||
}
|
||||
l += en - st;
|
||||
return l;
|
||||
}
|
||||
|
||||
var last = null, last_qlen = null, regs = [];
|
||||
while (file.readline(buf) >= 0) {
|
||||
var line = buf.toString();
|
||||
++lineno;
|
||||
if (line.charAt(0) != '@') {
|
||||
var t = line.split("\t", 12);
|
||||
var m, rs, cigar = null, is_pri = false, is_sam = false, is_rev = false, tname = null;
|
||||
var atlen = null, aqlen, qs, qe, mapq, ori_qlen;
|
||||
if (t[4] == '+' || t[4] == '-') { // PAF
|
||||
if (!/\ts2:i:\d+/.test(line)) {
|
||||
++n_2nd;
|
||||
continue;
|
||||
}
|
||||
if ((m = /\tcg:Z:(\S+)/.exec(line)) != null)
|
||||
cigar = m[1];
|
||||
if (cigar == null) {
|
||||
warn("WARNING: no CIGAR at line " + lineno);
|
||||
continue;
|
||||
}
|
||||
tname = t[5];
|
||||
qs = parseInt(t[2]), qe = parseInt(t[3]);
|
||||
aqlen = qe - qs;
|
||||
is_rev = t[4] == '+'? false : true;
|
||||
rs = parseInt(t[7]);
|
||||
atlen = parseInt(t[8]) - rs;
|
||||
mapq = parseInt(t[11]);
|
||||
ori_qlen = parseInt(t[1]);
|
||||
} else { // SAM
|
||||
var flag = parseInt(t[1]);
|
||||
if ((flag & 4) || t[2] == '*' || t[5] == '*') continue;
|
||||
if (flag & 0x100) {
|
||||
++n_2nd;
|
||||
continue;
|
||||
}
|
||||
cigar = t[5];
|
||||
tname = t[2];
|
||||
rs = parseInt(t[3]) - 1;
|
||||
mapq = parseInt(t[4]);
|
||||
aqlen = t[9].length;
|
||||
is_sam = true;
|
||||
is_rev = !!(flag&0x10);
|
||||
}
|
||||
++n_pri;
|
||||
if (last != t[0]) {
|
||||
if (last != null) {
|
||||
l_tot += last_qlen;
|
||||
l_cov += cov_len(regs);
|
||||
}
|
||||
regs = [];
|
||||
++n_seq, last = t[0];
|
||||
}
|
||||
var M = 0, tl = 0, ql = 0, clip = [0, 0], n_cigar = 0, sclip = 0;
|
||||
while ((m = re.exec(cigar)) != null) {
|
||||
var l = parseInt(m[1]);
|
||||
++n_cigar;
|
||||
if (m[2] == 'M' || m[2] == '=' || m[2] == 'X') {
|
||||
tl += l, ql += l, M += l;
|
||||
} else if (m[2] == 'I' || m[2] == 'D') {
|
||||
var type;
|
||||
if (l < 50) type = 0;
|
||||
else if (l < 100) type = 1;
|
||||
else if (l < 300) type = 2;
|
||||
else if (l < 400) type = 3;
|
||||
else if (l < 1000) type = 4;
|
||||
else type = 5;
|
||||
if (m[2] == 'I') ql += l, ++n_gap[0][type];
|
||||
else tl += l, ++n_gap[1][type];
|
||||
if (gap_out_len != null && l >= gap_out_len)
|
||||
print(t[0], ql, is_rev? '-' : '+', tname, rs + tl, m[2], l);
|
||||
} else if (m[2] == 'N') {
|
||||
tl += l;
|
||||
} else if (m[2] == 'S') {
|
||||
clip[M == 0? 0 : 1] = l, sclip += l;
|
||||
} else if (m[2] == 'H') {
|
||||
clip[M == 0? 0 : 1] = l;
|
||||
}
|
||||
}
|
||||
if (n_cigar > 65535) ++n_cigar_64k;
|
||||
if (ql + sclip != aqlen)
|
||||
warn("WARNING: aligned query length is inconsistent with CIGAR at line " + lineno + " (" + (ql+sclip) + " != " + aqlen + ")");
|
||||
if (atlen != null && atlen != tl)
|
||||
warn("WARNING: aligned reference length is inconsistent with CIGAR at line " + lineno);
|
||||
if (is_sam) {
|
||||
qs = clip[is_rev? 1 : 0], qe = qs + ql;
|
||||
ori_qlen = clip[0] + ql + clip[1];
|
||||
}
|
||||
regs.push([qs, qe]);
|
||||
last_qlen = ori_qlen;
|
||||
}
|
||||
}
|
||||
l_tot += last_qlen;
|
||||
l_cov += cov_len(regs);
|
||||
|
||||
file.close();
|
||||
buf.destroy();
|
||||
|
||||
if (gap_out_len == null) {
|
||||
print("Number of mapped sequences: " + n_seq);
|
||||
print("Number of primary alignments: " + n_pri);
|
||||
print("Number of secondary alignments: " + n_2nd);
|
||||
print("Number of primary alignments with >65535 CIGAR operations: " + n_cigar_64k);
|
||||
print("Number of bases in mapped sequences: " + l_tot);
|
||||
print("Number of mapped bases: " + l_cov);
|
||||
print("Number of insertions in [0,50): " + n_gap[0][0]);
|
||||
print("Number of insertions in [50,100): " + n_gap[0][1]);
|
||||
print("Number of insertions in [100,300): " + n_gap[0][2]);
|
||||
print("Number of insertions in [300,400): " + n_gap[0][3]);
|
||||
print("Number of insertions in [400,1000): " + n_gap[0][4]);
|
||||
print("Number of insertions in [1000,inf): " + n_gap[0][5]);
|
||||
print("Number of deletions in [0,50): " + n_gap[1][0]);
|
||||
print("Number of deletions in [50,100): " + n_gap[1][1]);
|
||||
print("Number of deletions in [100,300): " + n_gap[1][2]);
|
||||
print("Number of deletions in [300,400): " + n_gap[1][3]);
|
||||
print("Number of deletions in [400,1000): " + n_gap[1][4]);
|
||||
print("Number of deletions in [1000,inf): " + n_gap[1][5]);
|
||||
}
|
||||
-171
@@ -1,171 +0,0 @@
|
||||
var getopt = function(args, ostr) {
|
||||
var oli; // option letter list index
|
||||
if (typeof(getopt.place) == 'undefined')
|
||||
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
|
||||
if (getopt.place == -1) { // update scanning pointer
|
||||
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
|
||||
getopt.place = -1;
|
||||
return null;
|
||||
}
|
||||
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
|
||||
++getopt.ind;
|
||||
getopt.place = -1;
|
||||
return null;
|
||||
}
|
||||
}
|
||||
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
|
||||
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
|
||||
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
|
||||
if (getopt.place < 0) ++getopt.ind;
|
||||
return '?';
|
||||
}
|
||||
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
|
||||
getopt.arg = null;
|
||||
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
|
||||
} else { // need an argument
|
||||
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
|
||||
getopt.arg = args[getopt.ind].substr(getopt.place);
|
||||
else if (args.length <= ++getopt.ind) { // no arg
|
||||
getopt.place = -1;
|
||||
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
|
||||
return '?';
|
||||
} else getopt.arg = args[getopt.ind]; // white space
|
||||
getopt.place = -1;
|
||||
++getopt.ind;
|
||||
}
|
||||
return optopt;
|
||||
}
|
||||
|
||||
var c, maf_out = false, line_len = 80;
|
||||
while ((c = getopt(arguments, "ml:")) != null) {
|
||||
if (c == 'm') maf_out = true;
|
||||
else if (c == 'l') line_len = parseInt(getopt.arg); // TODO: not implemented yet
|
||||
}
|
||||
if (line_len == 0) line_len = 0x7fffffff;
|
||||
|
||||
if (getopt.ind == arguments.length) {
|
||||
print("Usage: k8 paf2aln.js [options] <with-cs.paf>");
|
||||
print("Options:");
|
||||
print(" -m MAF output (BLAST-like output by default)");
|
||||
print(" -l INT line length in BLAST-like output [80]");
|
||||
print("");
|
||||
print("Note: this script only works when minimap2 is run with option '-S'");
|
||||
exit(1);
|
||||
}
|
||||
|
||||
function padding_str(x, len, right)
|
||||
{
|
||||
var s = x.toString();
|
||||
if (s.length < len) {
|
||||
if (right) s += Array(len - s.length + 1).join(" ");
|
||||
else s = Array(len - s.length + 1).join(" ") + s;
|
||||
}
|
||||
return s;
|
||||
}
|
||||
|
||||
function update_aln(s_ref, s_qry, s_mid, type, seq, slen)
|
||||
{
|
||||
var l = type == '*'? 1 : seq.length;
|
||||
if (type == '=') {
|
||||
s_ref.set(seq);
|
||||
s_qry.set(seq);
|
||||
s_mid.set(Array(l+1).join("|"));
|
||||
slen[0] += l, slen[1] += l;
|
||||
} else if (type == '*') {
|
||||
s_ref.set(seq.charAt(0));
|
||||
s_qry.set(seq.charAt(1));
|
||||
s_mid.set(' ');
|
||||
slen[0] += 1, slen[1] += 1;
|
||||
} else if (type == '+') {
|
||||
s_ref.set(Array(l+1).join("-"));
|
||||
s_qry.set(seq);
|
||||
s_mid.set(Array(l+1).join(" "));
|
||||
slen[1] += l;
|
||||
} else if (type == '-') {
|
||||
s_ref.set(seq);
|
||||
s_qry.set(Array(l+1).join("-"));
|
||||
s_mid.set(Array(l+1).join(" "));
|
||||
slen[0] += l;
|
||||
}
|
||||
}
|
||||
|
||||
function print_aln(rs, qs, strand, slen, elen, s_ref, s_qry, s_mid)
|
||||
{
|
||||
print(["Ref+:", padding_str(rs + slen[0] + 1, 10, false), s_ref.toString(), padding_str(rs + elen[0], 10, true)].join(" "));
|
||||
print(" " + s_mid.toString());
|
||||
var st, en;
|
||||
if (strand == '+') st = qs + slen[1] + 1, en = qs + elen[1];
|
||||
else st = qs - slen[1], en = qs - elen[1] + 1;
|
||||
print(["Qry" + strand + ":", padding_str(st, 10, false), s_qry.toString(), padding_str(en , 10, true)].join(" "));
|
||||
}
|
||||
|
||||
var s_ref = new Bytes(), s_qry = new Bytes(), s_mid = new Bytes();
|
||||
var re = /([=\-\+\*])([A-Za-z]+)/g;
|
||||
|
||||
var buf = new Bytes();
|
||||
var file = new File(arguments[getopt.ind]);
|
||||
if (maf_out) print("##maf version=1\n");
|
||||
while (file.readline(buf) >= 0) {
|
||||
var m, line = buf.toString();
|
||||
var t = line.split("\t", 12);
|
||||
if ((m = /\tcs:Z:(\S+)/.exec(line)) == null) continue;
|
||||
var cs = m[1];
|
||||
s_ref.length = s_qry.length = s_mid.length = 0;
|
||||
var slen = [0, 0], elen = [0, 0];
|
||||
if (maf_out) {
|
||||
while ((m = re.exec(cs)) != null)
|
||||
update_aln(s_ref, s_qry, s_mid, m[1], m[2], elen);
|
||||
if (maf_out) {
|
||||
var score = (m = /\tAS:i:(\d+)/.exec(line)) != null? parseInt(m[1]) : 0;
|
||||
var len = t[0].length > t[5].length? t[0].length : t[5].length;
|
||||
print("a " + score);
|
||||
print(["s", padding_str(t[5], len, true), padding_str(t[7], 10, false), padding_str(parseInt(t[8]) - parseInt(t[7]), 10, false),
|
||||
"+", padding_str(t[6], 10, false), s_ref.toString()].join(" "));
|
||||
var qs, qe, ql = parseInt(t[1]);
|
||||
if (t[4] == '+') {
|
||||
qs = parseInt(t[2]);
|
||||
qe = parseInt(t[3]);
|
||||
} else {
|
||||
qs = ql - parseInt(t[3]);
|
||||
qe = ql - parseInt(t[2]);
|
||||
}
|
||||
print(["s", padding_str(t[0], len, true), padding_str(qs, 10, false), padding_str(qe - qs, 10, false),
|
||||
t[4], padding_str(ql, 10, false), s_qry.toString()].join(" "));
|
||||
print("");
|
||||
}
|
||||
} else {
|
||||
line = line.replace(/\tc[sg]:Z:\S+/g, "");
|
||||
print('>' + line);
|
||||
var rs = parseInt(t[7]), qs = t[4] == '+'? parseInt(t[2]) : parseInt(t[3]);
|
||||
var n_blocks = 0;
|
||||
while ((m = re.exec(cs)) != null) {
|
||||
var start = 0, rest = m[1] == '*'? 1 : m[2].length;
|
||||
while (rest > 0) {
|
||||
var l_proc;
|
||||
if (s_ref.length + rest >= line_len) {
|
||||
l_proc = line_len - s_ref.length;
|
||||
update_aln(s_ref, s_qry, s_mid, m[1], m[1] == '*'? m[2] : m[2].substr(start, l_proc), elen);
|
||||
if (n_blocks > 0) print("");
|
||||
print_aln(rs, qs, t[4], slen, elen, s_ref, s_qry, s_mid);
|
||||
++n_blocks;
|
||||
s_ref.length = s_qry.length = s_mid.length = 0;
|
||||
slen[0] = elen[0], slen[1] = elen[1];
|
||||
} else {
|
||||
l_proc = rest;
|
||||
update_aln(s_ref, s_qry, s_mid, m[1], m[1] == '*'? m[2] : m[2].substr(start, l_proc), elen);
|
||||
}
|
||||
rest -= l_proc, start += l_proc;
|
||||
}
|
||||
}
|
||||
if (s_ref.length > 0) {
|
||||
if (n_blocks > 0) print("");
|
||||
print_aln(rs, qs, t[4], slen, elen, s_ref, s_qry, s_mid);
|
||||
++n_blocks;
|
||||
}
|
||||
print("//");
|
||||
}
|
||||
}
|
||||
file.close();
|
||||
buf.destroy();
|
||||
|
||||
s_ref.destroy(); s_qry.destroy(); s_mid.destroy();
|
||||
Executable
+2892
File diff suppressed because it is too large
Load Diff
-114
@@ -1,114 +0,0 @@
|
||||
var getopt = function(args, ostr) {
|
||||
var oli; // option letter list index
|
||||
if (typeof(getopt.place) == 'undefined')
|
||||
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
|
||||
if (getopt.place == -1) { // update scanning pointer
|
||||
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
|
||||
getopt.place = -1;
|
||||
return null;
|
||||
}
|
||||
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
|
||||
++getopt.ind;
|
||||
getopt.place = -1;
|
||||
return null;
|
||||
}
|
||||
}
|
||||
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
|
||||
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
|
||||
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
|
||||
if (getopt.place < 0) ++getopt.ind;
|
||||
return '?';
|
||||
}
|
||||
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
|
||||
getopt.arg = null;
|
||||
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
|
||||
} else { // need an argument
|
||||
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
|
||||
getopt.arg = args[getopt.ind].substr(getopt.place);
|
||||
else if (args.length <= ++getopt.ind) { // no arg
|
||||
getopt.place = -1;
|
||||
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
|
||||
return '?';
|
||||
} else getopt.arg = args[getopt.ind]; // white space
|
||||
getopt.place = -1;
|
||||
++getopt.ind;
|
||||
}
|
||||
return optopt;
|
||||
}
|
||||
|
||||
var c, pri_only = false;
|
||||
while ((c = getopt(arguments, "p")) != null)
|
||||
if (c == 'p') pri_only = true;
|
||||
|
||||
var file = arguments.length == getopt.ind? new File() : new File(arguments[getopt.ind]);
|
||||
var buf = new Bytes();
|
||||
var re = /(\d+)([MIDSHNX=])/g;
|
||||
|
||||
var len = {}, lineno = 0;
|
||||
while (file.readline(buf) >= 0) {
|
||||
var m, n_cigar = 0, line = buf.toString();
|
||||
++lineno;
|
||||
if (line.charAt(0) == '@') {
|
||||
if (/^@SQ/.test(line)) {
|
||||
var name = (m = /\tSN:(\S+)/.exec(line)) != null? m[1] : null;
|
||||
var l = (m = /\tLN:(\d+)/.exec(line)) != null? parseInt(m[1]) : null;
|
||||
if (name != null && l != null) len[name] = l;
|
||||
}
|
||||
continue;
|
||||
}
|
||||
var t = line.split("\t");
|
||||
var flag = parseInt(t[1]);
|
||||
if (t[9] != '*' && t[10] != '*' && t[9].length != t[10].length) throw Error("ERROR at line " + lineno + ": inconsistent SEQ and QUAL lengths - " + t[9].length + " != " + t[10].length);
|
||||
if (t[2] == '*' || (flag&4)) continue;
|
||||
if (pri_only && (flag&0x100)) continue;
|
||||
var tlen = len[t[2]];
|
||||
if (tlen == null) throw Error("ERROR at line " + lineno + ": can't find the length of contig " + t[2]);
|
||||
var nn = (m = /\tnn:i:(\d+)/.exec(line)) != null? parseInt(m[1]) : 0;
|
||||
var NM = (m = /\tNM:i:(\d+)/.exec(line)) != null? parseInt(m[1]) : null;
|
||||
var have_NM = NM == null? false : true;
|
||||
NM += nn;
|
||||
var clip = [0, 0], I = [0, 0], D = [0, 0], M = 0, N = 0, ql = 0, tl = 0, mm = 0, ext_cigar = false;
|
||||
while ((m = re.exec(t[5])) != null) {
|
||||
var l = parseInt(m[1]);
|
||||
if (m[2] == 'M') M += l, ql += l, tl += l, ext_cigar = false;
|
||||
else if (m[2] == 'I') ++I[0], I[1] += l, ql += l;
|
||||
else if (m[2] == 'D') ++D[0], D[1] += l, tl += l;
|
||||
else if (m[2] == 'N') N += l, tl += l;
|
||||
else if (m[2] == 'S') clip[M == 0? 0 : 1] = l, ql += l;
|
||||
else if (m[2] == 'H') clip[M == 0? 0 : 1] = l;
|
||||
else if (m[2] == '=') M += l, ql += l, tl += l, ext_cigar = true;
|
||||
else if (m[2] == 'X') M += l, ql += l, tl += l, mm += l, ext_cigar = true;
|
||||
++n_cigar;
|
||||
}
|
||||
if (n_cigar > 65535)
|
||||
warn("WARNING at line " + lineno + ": " + n_cigar + " CIGAR operations");
|
||||
if (tl + parseInt(t[3]) - 1 > tlen) {
|
||||
warn("WARNING at line " + lineno + ": alignment end position larger than ref length; skipped");
|
||||
continue;
|
||||
}
|
||||
if (t[9] != '*' && t[9].length != ql) {
|
||||
warn("WARNING at line " + lineno + ": SEQ length inconsistent with CIGAR (" + t[9].length + " != " + ql + "); skipped");
|
||||
continue;
|
||||
}
|
||||
if (!have_NM || ext_cigar) NM = I[1] + D[1] + mm;
|
||||
if (NM < I[1] + D[1] + mm) {
|
||||
warn("WARNING at line " + lineno + ": NM is less than the total number of gaps (" + NM + " < " + (I[1]+D[1]+mm) + ")");
|
||||
NM = I[1] + D[1] + mm;
|
||||
}
|
||||
var extra = ["mm:i:"+(NM-I[1]-D[1]), "io:i:"+I[0], "in:i:"+I[1], "do:i:"+D[0], "dn:i:"+D[1]];
|
||||
var match = M - (NM - I[1] - D[1]);
|
||||
var blen = M + I[1] + D[1];
|
||||
var qlen = M + I[1] + clip[0] + clip[1];
|
||||
var qs, qe;
|
||||
if (flag&16) qs = clip[1], qe = qlen - clip[0];
|
||||
else qs = clip[0], qe = qlen - clip[1];
|
||||
var ts = parseInt(t[3]) - 1, te = ts + M + D[1] + N;
|
||||
var qname = t[0];
|
||||
if ((flag&1) && (flag&0x40)) qname += '/1';
|
||||
if ((flag&1) && (flag&0x80)) qname += '/2';
|
||||
var a = [qname, qlen, qs, qe, flag&16? '-' : '+', t[2], tlen, ts, te, match, blen, t[4]];
|
||||
print(a.join("\t"), extra.join("\t"));
|
||||
}
|
||||
|
||||
buf.destroy();
|
||||
file.close();
|
||||
@@ -1,193 +0,0 @@
|
||||
var getopt = function(args, ostr) {
|
||||
var oli; // option letter list index
|
||||
if (typeof(getopt.place) == 'undefined')
|
||||
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
|
||||
if (getopt.place == -1) { // update scanning pointer
|
||||
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
|
||||
getopt.place = -1;
|
||||
return null;
|
||||
}
|
||||
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
|
||||
++getopt.ind;
|
||||
getopt.place = -1;
|
||||
return null;
|
||||
}
|
||||
}
|
||||
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
|
||||
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
|
||||
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
|
||||
if (getopt.place < 0) ++getopt.ind;
|
||||
return '?';
|
||||
}
|
||||
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
|
||||
getopt.arg = null;
|
||||
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
|
||||
} else { // need an argument
|
||||
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
|
||||
getopt.arg = args[getopt.ind].substr(getopt.place);
|
||||
else if (args.length <= ++getopt.ind) { // no arg
|
||||
getopt.place = -1;
|
||||
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
|
||||
return '?';
|
||||
} else getopt.arg = args[getopt.ind]; // white space
|
||||
getopt.place = -1;
|
||||
++getopt.ind;
|
||||
}
|
||||
return optopt;
|
||||
}
|
||||
|
||||
var c, max_mapq = 60, mode = 0, err_out_q = 256, print_err = false, ovlp_ratio = 0.1, cap_short_mapq = false;
|
||||
while ((c = getopt(arguments, "Q:r:m:c")) != null) {
|
||||
if (c == 'Q') err_out_q = parseInt(getopt.arg), print_err = true;
|
||||
else if (c == 'r') ovlp_ratio = parseFloat(getopt.arg);
|
||||
else if (c == 'm') mode = parseInt(getopt.arg);
|
||||
else if (c == 'c') cap_short_mapq = true;
|
||||
}
|
||||
|
||||
var file = arguments.length == getopt.ind? new File() : new File(arguments[getopt.ind]);
|
||||
var buf = new Bytes();
|
||||
|
||||
var tot = [], err = [];
|
||||
for (var q = 0; q <= max_mapq; ++q)
|
||||
tot[q] = err[q] = 0;
|
||||
|
||||
function is_correct(s, b)
|
||||
{
|
||||
if (s[0] != b[0] || s[3] != b[3]) return false;
|
||||
var o, l;
|
||||
if (s[1] < b[1]) {
|
||||
if (s[2] <= b[1]) return false;
|
||||
o = (s[2] < b[2]? s[2] : b[2]) - b[1];
|
||||
l = (s[2] > b[2]? s[2] : b[2]) - s[1];
|
||||
} else {
|
||||
if (b[2] <= s[1]) return false;
|
||||
o = (s[2] < b[2]? s[2] : b[2]) - s[1];
|
||||
l = (s[2] > b[2]? s[2] : b[2]) - b[1];
|
||||
}
|
||||
return o/l > ovlp_ratio? true : false;
|
||||
}
|
||||
|
||||
function count_err(qname, a, tot, err, mode)
|
||||
{
|
||||
if (a.length == 0) return;
|
||||
|
||||
var m, s;
|
||||
if ((m = /^(\S+)!(\S+)!(\d+)!(\d+)!([\+\-])$/.exec(qname)) != null) { // pbsim single-end reads
|
||||
s = [m[1], m[2], parseInt(m[3]), parseInt(m[4]), m[5]];
|
||||
} else if ((m = /^(\S+)!(\S+)!(\d+)_(\d+)!(\d+)_(\d+)!([\+\-])([\+\-])\/([12])$/.exec(qname)) != null) { // mason2 paired-end reads
|
||||
if (m[9] == '1') {
|
||||
s = [m[1], m[2], parseInt(m[3]), parseInt(m[5]), m[7]];
|
||||
} else {
|
||||
s = [m[1], m[2], parseInt(m[4]), parseInt(m[6]), m[8]];
|
||||
}
|
||||
} else throw Error("Failed to parse simulated read names '" + qname + "'");
|
||||
s.shift(); // skip the orginal read name
|
||||
|
||||
if (mode == 0 || mode == 1) { // longest only or first only
|
||||
var max_i = 0;
|
||||
if (mode == 0) { // longest only
|
||||
var max = 0;
|
||||
for (var i = 0; i < a.length; ++i)
|
||||
if (a[i][5] > max)
|
||||
max = a[i][5], max_i = i;
|
||||
}
|
||||
var mapq = a[max_i][4];
|
||||
++tot[mapq];
|
||||
if (!is_correct(s, a[max_i])) {
|
||||
if (mapq >= err_out_q)
|
||||
print('E', qname, a[max_i].join("\t"));
|
||||
++err[mapq];
|
||||
}
|
||||
} else if (mode == 2) { // all primary mode
|
||||
var max_err_mapq = -1, max_mapq = 0, max_err_i = -1;
|
||||
if (cap_short_mapq) {
|
||||
var max = 0, max_q = 0;
|
||||
for (var i = 0; i < a.length; ++i)
|
||||
if (a[i][5] > max)
|
||||
max = a[i][5], max_q = a[i][4];
|
||||
for (var i = 0; i < a.length; ++i)
|
||||
a[i][4] = max_q < a[i][4]? max_q : a[i][4];
|
||||
}
|
||||
for (var i = 0; i < a.length; ++i) {
|
||||
max_mapq = max_mapq > a[i][4]? max_mapq : a[i][4];
|
||||
if (!is_correct(s, a[i]))
|
||||
if (a[i][4] > max_err_mapq)
|
||||
max_err_mapq = a[i][4], max_err_i = i;
|
||||
}
|
||||
if (max_err_mapq >= 0) {
|
||||
++tot[max_err_mapq], ++err[max_err_mapq];
|
||||
if (max_err_mapq >= err_out_q)
|
||||
print('E', qname, a[max_err_i].join("\t"));
|
||||
} else ++tot[max_mapq];
|
||||
}
|
||||
}
|
||||
|
||||
var lineno = 0, last = null, a = [], n_unmapped = null;
|
||||
var re_cigar = /(\d+)([MIDSHN])/g;
|
||||
while (file.readline(buf) >= 0) {
|
||||
var m, line = buf.toString();
|
||||
++lineno;
|
||||
if (line[0] != '@') {
|
||||
var t = line.split("\t");
|
||||
if (t[4] == '+' || t[4] == '-') { // PAF
|
||||
if (last != t[0]) {
|
||||
if (last != null) count_err(last, a, tot, err, mode);
|
||||
a = [], last = t[0];
|
||||
}
|
||||
if (/\ts1:i:\d+/.test(line) && !/\ts2:i:\d+/.test(line)) // secondary alignment in minimap2 PAF
|
||||
continue;
|
||||
var mapq = parseInt(t[11]);
|
||||
if (mapq > max_mapq) mapq = max_mapq;
|
||||
a.push([t[5], parseInt(t[7]), parseInt(t[8]), t[4], mapq, parseInt(t[9])]);
|
||||
} else { // SAM
|
||||
var flag = parseInt(t[1]);
|
||||
var read_no = flag>>6&0x3;
|
||||
var qname = t[0];
|
||||
if (!/\/[12]$/.test(qname))
|
||||
qname = read_no == 1 || read_no == 2? t[0] + '/' + read_no : t[0];
|
||||
if (last != qname) {
|
||||
if (last != null) count_err(last, a, tot, err, mode);
|
||||
a = [], last = qname;
|
||||
}
|
||||
if (flag&0x100) continue; // secondary alignment
|
||||
if ((flag&0x4) || t[2] == '*') { // unmapped
|
||||
if (n_unmapped == null) n_unmapped = 0;
|
||||
++n_unmapped;
|
||||
continue;
|
||||
}
|
||||
var mapq = parseInt(t[4]);
|
||||
if (mapq > max_mapq) mapq = max_mapq;
|
||||
var pos = parseInt(t[3]) - 1, pos_end = pos;
|
||||
var n_gap = 0, mlen = 0;
|
||||
while ((m = re_cigar.exec(t[5])) != null) {
|
||||
var len = parseInt(m[1]);
|
||||
if (m[2] == 'M') pos_end += len, mlen += len;
|
||||
else if (m[2] == 'I') n_gap += len;
|
||||
else if (m[2] == 'D') n_gap += len, pos_end += len;
|
||||
}
|
||||
var score = pos_end - pos;
|
||||
if ((m = /\tNM:i:(\d+)/.exec(line)) != null) {
|
||||
var NM = parseInt(m[1]);
|
||||
if (NM >= n_gap) score = mlen - (NM - n_gap);
|
||||
}
|
||||
a.push([t[2], pos, pos_end, (flag&16)? '-' : '+', mapq, score]);
|
||||
}
|
||||
}
|
||||
}
|
||||
if (last != null) count_err(last, a, tot, err, mode);
|
||||
|
||||
buf.destroy();
|
||||
file.close();
|
||||
|
||||
var sum_tot = 0, sum_err = 0, q_out = -1, sum_tot2 = 0, sum_err2 = 0;
|
||||
for (var q = max_mapq; q >= 0; --q) {
|
||||
if (tot[q] == 0) continue;
|
||||
if (q_out < 0 || err[q] > 0) {
|
||||
if (q_out >= 0) print('Q', q_out, sum_tot, sum_err, (sum_err2/sum_tot2).toFixed(9), sum_tot2);
|
||||
sum_tot = sum_err = 0, q_out = q;
|
||||
}
|
||||
sum_tot += tot[q], sum_err += err[q];
|
||||
sum_tot2 += tot[q], sum_err2 += err[q];
|
||||
}
|
||||
print('Q', q_out, sum_tot, sum_err, (sum_err2/sum_tot2).toFixed(9), sum_tot2);
|
||||
if (n_unmapped != null) print('U', n_unmapped);
|
||||
@@ -1,105 +0,0 @@
|
||||
Bytes.prototype.reverse = function()
|
||||
{
|
||||
for (var i = 0; i < this.length>>1; ++i) {
|
||||
var tmp = this[i];
|
||||
this[i] = this[this.length - i - 1];
|
||||
this[this.length - i - 1] = tmp;
|
||||
}
|
||||
}
|
||||
|
||||
// reverse complement a DNA string
|
||||
Bytes.prototype.revcomp = function()
|
||||
{
|
||||
if (Bytes.rctab == null) {
|
||||
var s1 = 'WSATUGCYRKMBDHVNwsatugcyrkmbdhvn';
|
||||
var s2 = 'WSTAACGRYMKVHDBNwstaacgrymkvhdbn';
|
||||
Bytes.rctab = [];
|
||||
for (var i = 0; i < 256; ++i) Bytes.rctab[i] = 0;
|
||||
for (var i = 0; i < s1.length; ++i)
|
||||
Bytes.rctab[s1.charCodeAt(i)] = s2.charCodeAt(i);
|
||||
}
|
||||
for (var i = 0; i < this.length>>1; ++i) {
|
||||
var tmp = this[this.length - i - 1];
|
||||
this[this.length - i - 1] = Bytes.rctab[this[i]];
|
||||
this[i] = Bytes.rctab[tmp];
|
||||
}
|
||||
if (this.length&1)
|
||||
this[this.length>>1] = Bytes.rctab[this[this.length>>1]];
|
||||
}
|
||||
|
||||
if (arguments.length == 0) {
|
||||
print("Usage: k8 sim-mason2.js <mason.sam>");
|
||||
exit(1);
|
||||
}
|
||||
|
||||
function print_se(a)
|
||||
{
|
||||
print('@' + a.slice(0, 5).join("!") + " " + a[8]);
|
||||
print(a[5]);
|
||||
print("+");
|
||||
print(a[6]);
|
||||
}
|
||||
|
||||
var buf = new Bytes(), buf2 = new Bytes();
|
||||
var file = new File(arguments[0]);
|
||||
var re = /(\d+)([MIDSHN])/g;
|
||||
var last = null;
|
||||
while (file.readline(buf) >= 0) {
|
||||
var t = buf.toString().split("\t");
|
||||
if (t[0].charAt(0) == '@') continue;
|
||||
var m, l_ref = 0;
|
||||
while ((m = re.exec(t[5])) != null)
|
||||
if (m[2] == 'D' || m[2] == 'M' || m[2] == 'N')
|
||||
l_ref += parseInt(m[1]);
|
||||
var flag = parseInt(t[1]);
|
||||
var rev = !!(flag&16);
|
||||
var seq, qual;
|
||||
if (rev) {
|
||||
buf2.length = 0;
|
||||
buf2.set(t[9], 0);
|
||||
buf2.revcomp();
|
||||
seq = buf2.toString();
|
||||
buf2.set(t[10], 0);
|
||||
buf2.reverse();
|
||||
qual = buf2.toString();
|
||||
} else seq = t[9], qual = t[10];
|
||||
var qname = t[0];
|
||||
qname = qname.replace(/^simulated./, "");
|
||||
var chr = t[2];
|
||||
var pos = parseInt(t[3]) - 1;
|
||||
var strand = (flag&16)? '-' : '+';
|
||||
var read_no = flag&0xc0;
|
||||
if (read_no == 0x40) read_no = 1;
|
||||
else if (read_no == 0x80) read_no = 2;
|
||||
else read_no = 0;
|
||||
var err = 0, snp = 0, indel = 0;
|
||||
for (var i = 11; i < t.length; ++i) {
|
||||
if ((m = /^XE:i:(\d+)/.exec(t[i])) != null) err = m[1];
|
||||
else if ((m = /^XS:i:(\d+)/.exec(t[i])) != null) snp = m[1];
|
||||
else if ((m = /^XI:i:(\d+)/.exec(t[i])) != null) indel = m[1];
|
||||
}
|
||||
var comment = [err, snp, indel].join(":");
|
||||
if (last == null) {
|
||||
last = [qname, chr, pos, pos + l_ref, strand, seq, qual, read_no, comment];
|
||||
} else if (last[0] != qname) {
|
||||
print_se(last);
|
||||
last = [qname, chr, pos, pos + l_ref, strand, seq, qual, read_no, comment];
|
||||
} else {
|
||||
if (read_no == 2) { // last[] is the first read
|
||||
if (last[7] != 1) throw Error("ERROR: can't find read1");
|
||||
var name = [qname, chr, last[2] + "_" + pos, last[3] + "_" + (pos + l_ref), last[4] + strand].join("!");
|
||||
print('@' + name + '/1' + ' ' + last[8]); print(last[5]); print("+"); print(last[6]);
|
||||
print('@' + name + '/2' + ' ' + comment); print(seq); print("+"); print(qual);
|
||||
} else {
|
||||
if (last[7] != 2) throw Error("ERROR: can't find read2");
|
||||
var name = [qname, chr, pos + "_" + last[2], (pos + l_ref) + "_" + last[3], strand + last[4]].join("!");
|
||||
print('@' + name + '/1' + ' ' + comment); print(seq); print("+"); print(qual);
|
||||
print('@' + name + '/2' + ' ' + last[8]); print(last[5]); print("+"); print(last[6]);
|
||||
}
|
||||
last = null;
|
||||
}
|
||||
}
|
||||
if (last != null) print_se(last);
|
||||
file.close();
|
||||
buf.destroy();
|
||||
buf2.destroy();
|
||||
@@ -1,81 +0,0 @@
|
||||
Bytes.prototype.reverse = function()
|
||||
{
|
||||
for (var i = 0; i < this.length>>1; ++i) {
|
||||
var tmp = this[i];
|
||||
this[i] = this[this.length - i - 1];
|
||||
this[this.length - i - 1] = tmp;
|
||||
}
|
||||
}
|
||||
|
||||
// reverse complement a DNA string
|
||||
Bytes.prototype.revcomp = function()
|
||||
{
|
||||
if (Bytes.rctab == null) {
|
||||
var s1 = 'WSATUGCYRKMBDHVNwsatugcyrkmbdhvn';
|
||||
var s2 = 'WSTAACGRYMKVHDBNwstaacgrymkvhdbn';
|
||||
Bytes.rctab = [];
|
||||
for (var i = 0; i < 256; ++i) Bytes.rctab[i] = 0;
|
||||
for (var i = 0; i < s1.length; ++i)
|
||||
Bytes.rctab[s1.charCodeAt(i)] = s2.charCodeAt(i);
|
||||
}
|
||||
for (var i = 0; i < this.length>>1; ++i) {
|
||||
var tmp = this[this.length - i - 1];
|
||||
this[this.length - i - 1] = Bytes.rctab[this[i]];
|
||||
this[i] = Bytes.rctab[tmp];
|
||||
}
|
||||
if (this.length&1)
|
||||
this[this.length>>1] = Bytes.rctab[this[this.length>>1]];
|
||||
}
|
||||
|
||||
if (arguments.length < 2) {
|
||||
print("Usage: k8 sim-pbsim.js <ref.fa.fai> <pbsim1.maf> [[pbsim2.maf] ...]");
|
||||
exit(1);
|
||||
}
|
||||
|
||||
var file, buf = new Bytes(), buf2 = new Bytes();
|
||||
file = new File(arguments[0]);
|
||||
var chr_list = [];
|
||||
while (file.readline(buf) >= 0) {
|
||||
var t = buf.toString().split(/\s+/);
|
||||
chr_list.push(t[0]);
|
||||
}
|
||||
file.close();
|
||||
|
||||
for (var k = 1; k < arguments.length; ++k) {
|
||||
var fn = arguments[k];
|
||||
file = new File(fn);
|
||||
var state = 0, reg;
|
||||
while (file.readline(buf) >= 0) {
|
||||
var line = buf.toString();
|
||||
if (state == 0 && line.charAt(0) == 'a') {
|
||||
state = 1;
|
||||
} else if (state == 1 && line.charAt(0) == 's') {
|
||||
var t = line.split(/\s+/);
|
||||
var st = parseInt(t[2]);
|
||||
reg = [st, st + parseInt(t[3])];
|
||||
state = 2;
|
||||
} else if (state == 2 && line.charAt(0) == 's') {
|
||||
var m, t = line.split(/\s+/);
|
||||
if ((m = /S(\d+)_\d+/.exec(t[1])) == null) throw Error("Failed to parse the read name");
|
||||
var chr_id = parseInt(m[1]) - 1;
|
||||
if (chr_id >= chr_list.length) throw Error("Index outside the chr list");
|
||||
var name = [t[1], chr_list[chr_id], reg[0], reg[1], t[4]].join("!");
|
||||
var seq = t[6].replace(/\-/g, "");
|
||||
if (seq.length != parseInt(t[5])) throw Error("Inconsistent read length");
|
||||
if (seq.indexOf("NN") < 0) {
|
||||
if (t[4] == '-') {
|
||||
buf2.set(seq, 0);
|
||||
buf2.length = seq.length;
|
||||
buf2.revcomp();
|
||||
seq = buf2.toString();
|
||||
}
|
||||
print(">" + name);
|
||||
print(seq);
|
||||
}
|
||||
state = 0;
|
||||
}
|
||||
}
|
||||
file.close();
|
||||
}
|
||||
buf.destroy();
|
||||
buf2.destroy();
|
||||
@@ -4,6 +4,7 @@
|
||||
#include <assert.h>
|
||||
#include "minimap.h"
|
||||
#include "bseq.h"
|
||||
#include "kseq.h"
|
||||
|
||||
#define MM_PARENT_UNSET (-1)
|
||||
#define MM_PARENT_TMP_PRI (-2)
|
||||
@@ -16,6 +17,7 @@
|
||||
#define MM_SEED_LONG_JOIN (1ULL<<40)
|
||||
#define MM_SEED_IGNORE (1ULL<<41)
|
||||
#define MM_SEED_TANDEM (1ULL<<42)
|
||||
#define MM_SEED_SELF (1ULL<<43)
|
||||
|
||||
#define MM_SEED_SEG_SHIFT 48
|
||||
#define MM_SEED_SEG_MASK (0xffULL<<(MM_SEED_SEG_SHIFT))
|
||||
@@ -27,18 +29,13 @@
|
||||
#define mm_seq4_set(s, i, c) ((s)[(i)>>3] |= (uint32_t)(c) << (((i)&7)<<2))
|
||||
#define mm_seq4_get(s, i) ((s)[(i)>>3] >> (((i)&7)<<2) & 0xf)
|
||||
|
||||
#define MALLOC(type, len) ((type*)malloc((len) * sizeof(type)))
|
||||
#define CALLOC(type, len) ((type*)calloc((len), sizeof(type)))
|
||||
|
||||
#ifdef __cplusplus
|
||||
extern "C" {
|
||||
#endif
|
||||
|
||||
#ifndef KSTRING_T
|
||||
#define KSTRING_T kstring_t
|
||||
typedef struct __kstring_t {
|
||||
unsigned l, m;
|
||||
char *s;
|
||||
} kstring_t;
|
||||
#endif
|
||||
|
||||
typedef struct {
|
||||
int n_u, n_a;
|
||||
uint64_t *u;
|
||||
@@ -47,6 +44,7 @@ typedef struct {
|
||||
|
||||
double cputime(void);
|
||||
double realtime(void);
|
||||
long peakrss(void);
|
||||
|
||||
void radix_sort_128x(mm128_t *beg, mm128_t *end);
|
||||
void radix_sort_64(uint64_t *beg, uint64_t *end);
|
||||
@@ -54,36 +52,48 @@ uint32_t ks_ksmall_uint32_t(size_t n, uint32_t arr[], size_t kk);
|
||||
|
||||
void mm_sketch(void *km, const char *str, int len, int w, int k, uint32_t rid, int is_hpc, mm128_v *p);
|
||||
|
||||
void mm_write_sam_hdr(const mm_idx_t *mi, const char *rg, const char *ver, int argc, char *argv[]);
|
||||
int mm_write_sam_hdr(const mm_idx_t *mi, const char *rg, const char *ver, int argc, char *argv[]);
|
||||
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int opt_flag);
|
||||
void mm_write_paf3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int opt_flag, int rep_len);
|
||||
void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int n_regs, const mm_reg1_t *regs);
|
||||
void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regs, const mm_reg1_t *const* regs, void *km, int opt_flag);
|
||||
void mm_write_sam3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regss, const mm_reg1_t *const* regss, void *km, int opt_flag, int rep_len);
|
||||
|
||||
void mm_idxopt_init(mm_idxopt_t *opt);
|
||||
const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n);
|
||||
int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq);
|
||||
int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f);
|
||||
mm128_t *mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int min_cnt, int min_sc, int is_cdna, int n_segs, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km);
|
||||
mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, const char *qual, int *n_regs_, mm_reg1_t *regs, mm128_t *a);
|
||||
mm128_t *mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int max_iter, int min_cnt, int min_sc, float gap_scale, int is_cdna, int n_segs, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km);
|
||||
mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a);
|
||||
|
||||
mm_reg1_t *mm_gen_regs(void *km, uint32_t hash, int qlen, int n_u, uint64_t *u, mm128_t *a);
|
||||
void mm_mark_alt(const mm_idx_t *mi, int n, mm_reg1_t *r);
|
||||
void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a);
|
||||
void mm_sync_regs(void *km, int n_regs, mm_reg1_t *regs);
|
||||
int mm_squeeze_a(void *km, int n_regs, mm_reg1_t *regs, mm128_t *a);
|
||||
int mm_set_sam_pri(int n, mm_reg1_t *r);
|
||||
void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r, int sub_diff);
|
||||
void mm_set_parent(void *km, float mask_level, int mask_len, int n, mm_reg1_t *r, int sub_diff, int hard_mask_level, float alt_diff_frac);
|
||||
void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int *n_, mm_reg1_t *r);
|
||||
void mm_select_sub_multi(void *km, float pri_ratio, float pri1, float pri2, int max_gap_ref, int min_diff, int best_n, int n_segs, const int *qlens, int *n_, mm_reg1_t *r);
|
||||
void mm_filter_regs(void *km, const mm_mapopt_t *opt, int *n_regs, mm_reg1_t *regs);
|
||||
void mm_filter_by_identity(void *km, int n_regs, mm_reg1_t *regs, float min_iden, int qlen, const char *qual);
|
||||
void mm_filter_regs(const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs);
|
||||
void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs, mm128_t *a);
|
||||
void mm_hit_sort_by_dp(void *km, int *n_regs, mm_reg1_t *r);
|
||||
void mm_set_mapq(int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len);
|
||||
void mm_hit_sort(void *km, int *n_regs, mm_reg1_t *r, float alt_diff_frac);
|
||||
void mm_set_mapq(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr);
|
||||
|
||||
void mm_est_err(const mm_idx_t *mi, int qlen, int n_regs, mm_reg1_t *regs, const mm128_t *a, int32_t n, const uint64_t *mini_pos);
|
||||
|
||||
mm_seg_t *mm_seg_gen(void *km, uint32_t hash, int n_segs, const int *qlens, int n_regs0, const mm_reg1_t *regs0, int *n_regs, mm_reg1_t **regs, const mm128_t *a);
|
||||
void mm_seg_free(void *km, int n_segs, mm_seg_t *segs);
|
||||
void mm_pair(void *km, int max_gap_ref, int dp_bonus, int sub_diff, int match_sc, const int *qlens, int *n_regs, mm_reg1_t **regs);
|
||||
|
||||
FILE *mm_split_init(const char *prefix, const mm_idx_t *mi);
|
||||
mm_idx_t *mm_split_merge_prep(const char *prefix, int n_splits, FILE **fp, uint32_t *n_seq_part);
|
||||
int mm_split_merge(int n_segs, const char **fn, const mm_mapopt_t *opt, int n_split_idx);
|
||||
void mm_split_rm_tmp(const char *prefix, int n_splits);
|
||||
|
||||
void mm_err_puts(const char *str);
|
||||
void mm_err_fwrite(const void *p, size_t size, size_t nitems, FILE *fp);
|
||||
void mm_err_fread(void *p, size_t size, size_t nitems, FILE *fp);
|
||||
|
||||
#ifdef __cplusplus
|
||||
}
|
||||
#endif
|
||||
|
||||
@@ -0,0 +1,197 @@
|
||||
#include <stdio.h>
|
||||
#include <limits.h>
|
||||
#include "mmpriv.h"
|
||||
|
||||
void mm_idxopt_init(mm_idxopt_t *opt)
|
||||
{
|
||||
memset(opt, 0, sizeof(mm_idxopt_t));
|
||||
opt->k = 15, opt->w = 10, opt->flag = 0;
|
||||
opt->bucket_bits = 14;
|
||||
opt->mini_batch_size = 50000000;
|
||||
opt->batch_size = 4000000000ULL;
|
||||
}
|
||||
|
||||
void mm_mapopt_init(mm_mapopt_t *opt)
|
||||
{
|
||||
memset(opt, 0, sizeof(mm_mapopt_t));
|
||||
opt->seed = 11;
|
||||
opt->mid_occ_frac = 2e-4f;
|
||||
opt->sdust_thres = 0; // no SDUST masking
|
||||
|
||||
opt->min_cnt = 3;
|
||||
opt->min_chain_score = 40;
|
||||
opt->bw = 500;
|
||||
opt->max_gap = 5000;
|
||||
opt->max_gap_ref = -1;
|
||||
opt->max_chain_skip = 25;
|
||||
opt->max_chain_iter = 5000;
|
||||
opt->chain_gap_scale = 1.0f;
|
||||
|
||||
opt->mask_level = 0.5f;
|
||||
opt->mask_len = INT_MAX;
|
||||
opt->pri_ratio = 0.8f;
|
||||
opt->best_n = 5;
|
||||
|
||||
opt->max_join_long = 20000;
|
||||
opt->max_join_short = 2000;
|
||||
opt->min_join_flank_sc = 1000;
|
||||
opt->min_join_flank_ratio = 0.5f;
|
||||
|
||||
opt->alt_drop = 0.15f;
|
||||
|
||||
opt->a = 2, opt->b = 4, opt->q = 4, opt->e = 2, opt->q2 = 24, opt->e2 = 1;
|
||||
opt->sc_ambi = 1;
|
||||
opt->zdrop = 400, opt->zdrop_inv = 200;
|
||||
opt->end_bonus = -1;
|
||||
opt->min_dp_max = opt->min_chain_score * opt->a;
|
||||
opt->min_ksw_len = 200;
|
||||
opt->anchor_ext_len = 20, opt->anchor_ext_shift = 6;
|
||||
opt->max_clip_ratio = 1.0f;
|
||||
opt->mini_batch_size = 500000000;
|
||||
|
||||
opt->pe_ori = 0; // FF
|
||||
opt->pe_bonus = 33;
|
||||
}
|
||||
|
||||
void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
|
||||
{
|
||||
if ((opt->flag & MM_F_SPLICE_FOR) || (opt->flag & MM_F_SPLICE_REV))
|
||||
opt->flag |= MM_F_SPLICE;
|
||||
if (opt->mid_occ <= 0)
|
||||
opt->mid_occ = mm_idx_cal_max_occ(mi, opt->mid_occ_frac);
|
||||
if (opt->mid_occ < opt->min_mid_occ)
|
||||
opt->mid_occ = opt->min_mid_occ;
|
||||
if (mm_verbose >= 3)
|
||||
fprintf(stderr, "[M::%s::%.3f*%.2f] mid_occ = %d\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), opt->mid_occ);
|
||||
}
|
||||
|
||||
void mm_mapopt_max_intron_len(mm_mapopt_t *opt, int max_intron_len)
|
||||
{
|
||||
if ((opt->flag & MM_F_SPLICE) && max_intron_len > 0)
|
||||
opt->max_gap_ref = opt->bw = max_intron_len;
|
||||
}
|
||||
|
||||
int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
|
||||
{
|
||||
if (preset == 0) {
|
||||
mm_idxopt_init(io);
|
||||
mm_mapopt_init(mo);
|
||||
} else if (strcmp(preset, "ava-ont") == 0) {
|
||||
io->flag = 0, io->k = 15, io->w = 5;
|
||||
mo->flag |= MM_F_ALL_CHAINS | MM_F_NO_DIAG | MM_F_NO_DUAL | MM_F_NO_LJOIN;
|
||||
mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_gap = 10000, mo->max_chain_skip = 25;
|
||||
mo->bw = 2000;
|
||||
} else if (strcmp(preset, "ava-pb") == 0) {
|
||||
io->flag |= MM_I_HPC, io->k = 19, io->w = 5;
|
||||
mo->flag |= MM_F_ALL_CHAINS | MM_F_NO_DIAG | MM_F_NO_DUAL | MM_F_NO_LJOIN;
|
||||
mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_gap = 10000, mo->max_chain_skip = 25;
|
||||
} else if (strcmp(preset, "map10k") == 0 || strcmp(preset, "map-pb") == 0) {
|
||||
io->flag |= MM_I_HPC, io->k = 19;
|
||||
} else if (strcmp(preset, "map-ont") == 0) {
|
||||
io->flag = 0, io->k = 15;
|
||||
} else if (strcmp(preset, "asm5") == 0) {
|
||||
io->flag = 0, io->k = 19, io->w = 19;
|
||||
mo->a = 1, mo->b = 19, mo->q = 39, mo->q2 = 81, mo->e = 3, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
|
||||
mo->min_mid_occ = 100;
|
||||
mo->min_dp_max = 200;
|
||||
mo->best_n = 50;
|
||||
} else if (strcmp(preset, "asm10") == 0) {
|
||||
io->flag = 0, io->k = 19, io->w = 19;
|
||||
mo->a = 1, mo->b = 9, mo->q = 16, mo->q2 = 41, mo->e = 2, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
|
||||
mo->min_mid_occ = 100;
|
||||
mo->min_dp_max = 200;
|
||||
mo->best_n = 50;
|
||||
} else if (strcmp(preset, "asm20") == 0) {
|
||||
io->flag = 0, io->k = 19, io->w = 10;
|
||||
mo->a = 1, mo->b = 4, mo->q = 6, mo->q2 = 26, mo->e = 2, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
|
||||
mo->min_mid_occ = 100;
|
||||
mo->min_dp_max = 200;
|
||||
mo->best_n = 50;
|
||||
} else if (strcmp(preset, "short") == 0 || strcmp(preset, "sr") == 0) {
|
||||
io->flag = 0, io->k = 21, io->w = 11;
|
||||
mo->flag |= MM_F_SR | MM_F_FRAG_MODE | MM_F_NO_PRINT_2ND | MM_F_2_IO_THREADS | MM_F_HEAP_SORT;
|
||||
mo->pe_ori = 0<<1|1; // FR
|
||||
mo->a = 2, mo->b = 8, mo->q = 12, mo->e = 2, mo->q2 = 24, mo->e2 = 1;
|
||||
mo->zdrop = mo->zdrop_inv = 100;
|
||||
mo->end_bonus = 10;
|
||||
mo->max_frag_len = 800;
|
||||
mo->max_gap = 100;
|
||||
mo->bw = 100;
|
||||
mo->pri_ratio = 0.5f;
|
||||
mo->min_cnt = 2;
|
||||
mo->min_chain_score = 25;
|
||||
mo->min_dp_max = 40;
|
||||
mo->best_n = 20;
|
||||
mo->mid_occ = 1000;
|
||||
mo->max_occ = 5000;
|
||||
mo->mini_batch_size = 50000000;
|
||||
} else if (strncmp(preset, "splice", 6) == 0 || strcmp(preset, "cdna") == 0) {
|
||||
io->flag = 0, io->k = 15, io->w = 5;
|
||||
mo->flag |= MM_F_SPLICE | MM_F_SPLICE_FOR | MM_F_SPLICE_REV | MM_F_SPLICE_FLANK;
|
||||
mo->max_gap = 2000, mo->max_gap_ref = mo->bw = 200000;
|
||||
mo->a = 1, mo->b = 2, mo->q = 2, mo->e = 1, mo->q2 = 32, mo->e2 = 0;
|
||||
mo->noncan = 9;
|
||||
mo->junc_bonus = 9;
|
||||
mo->zdrop = 200, mo->zdrop_inv = 100; // because mo->a is halved
|
||||
if (strcmp(preset, "splice:hq") == 0)
|
||||
mo->junc_bonus = 5, mo->b = 4, mo->q = 6, mo->q2 = 24;
|
||||
} else return -1;
|
||||
return 0;
|
||||
}
|
||||
|
||||
int mm_check_opt(const mm_idxopt_t *io, const mm_mapopt_t *mo)
|
||||
{
|
||||
if (mo->split_prefix && (mo->flag & (MM_F_OUT_CS|MM_F_OUT_MD))) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "[ERROR]\033[1;31m --cs or --MD doesn't work with --split-prefix\033[0m\n");
|
||||
return -6;
|
||||
}
|
||||
if (io->k <= 0 || io->w <= 0) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "[ERROR]\033[1;31m -k and -w must be positive\033[0m\n");
|
||||
return -5;
|
||||
}
|
||||
if (mo->best_n < 0) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "[ERROR]\033[1;31m -N must be no less than 0\033[0m\n");
|
||||
return -4;
|
||||
}
|
||||
if (mo->best_n == 0 && mm_verbose >= 2)
|
||||
fprintf(stderr, "[WARNING]\033[1;31m '-N 0' reduces mapping accuracy. Please use '--secondary=no' instead.\033[0m\n");
|
||||
if (mo->pri_ratio < 0.0f || mo->pri_ratio > 1.0f) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "[ERROR]\033[1;31m -p must be within 0 and 1 (including 0 and 1)\033[0m\n");
|
||||
return -4;
|
||||
}
|
||||
if ((mo->flag & MM_F_FOR_ONLY) && (mo->flag & MM_F_REV_ONLY)) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "[ERROR]\033[1;31m --for-only and --rev-only can't be applied at the same time\033[0m\n");
|
||||
return -3;
|
||||
}
|
||||
if (mo->e <= 0 || mo->q <= 0) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "[ERROR]\033[1;31m -O and -E must be positive\033[0m\n");
|
||||
return -1;
|
||||
}
|
||||
if ((mo->q != mo->q2 || mo->e != mo->e2) && !(mo->e > mo->e2 && mo->q + mo->e < mo->q2 + mo->e2)) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "[ERROR]\033[1;31m dual gap penalties violating E1>E2 and O1+E1<O2+E2\033[0m\n");
|
||||
return -2;
|
||||
}
|
||||
if ((mo->q + mo->e) + (mo->q2 + mo->e2) > 127) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "[ERROR]\033[1;31m scoring system violating ({-O}+{-E})+({-O2}+{-E2}) <= 127\033[0m\n");
|
||||
return -1;
|
||||
}
|
||||
if (mo->zdrop < mo->zdrop_inv) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "[ERROR]\033[1;31m Z-drop should not be less than inversion-Z-drop\033[0m\n");
|
||||
return -5;
|
||||
}
|
||||
if ((mo->flag & MM_F_NO_PRINT_2ND) && (mo->flag & MM_F_ALL_CHAINS)) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "[ERROR]\033[1;31m -X/-P and --secondary=no can't be applied at the same time\033[0m\n");
|
||||
return -5;
|
||||
}
|
||||
return 0;
|
||||
}
|
||||
@@ -54,7 +54,7 @@ void mm_set_pe_thru(const int *qlens, int *n_regs, mm_reg1_t **regs)
|
||||
if (n_pri[0] == 1 && n_pri[1] == 1) {
|
||||
mm_reg1_t *p = ®s[0][pri[0]];
|
||||
mm_reg1_t *q = ®s[1][pri[1]];
|
||||
if (p->rid == q->rid && p->rev == q->rev && abs(p->rs - q->rs) < 3 && abs(p->re - p->re) < 3
|
||||
if (p->rid == q->rid && p->rev == q->rev && abs(p->rs - q->rs) < 3 && abs(p->re - q->re) < 3
|
||||
&& ((p->qs == 0 && qlens[1] - q->qe == 0) || (q->qs == 0 && qlens[0] - p->qe == 0)))
|
||||
{
|
||||
p->pe_thru = q->pe_thru = 1;
|
||||
@@ -105,7 +105,7 @@ void mm_pair(void *km, int max_gap_ref, int pe_bonus, int sub_diff, int match_sc
|
||||
max = -1;
|
||||
max_idx[0] = max_idx[1] = -1;
|
||||
last[0] = last[1] = -1;
|
||||
kv_resize(uint64_t, km, sc, n);
|
||||
kv_resize(uint64_t, km, sc, (size_t)n);
|
||||
for (i = 0; i < n; ++i) {
|
||||
if (a[i].key & 1) { // reverse first read or forward second read
|
||||
mm_reg1_t *q, *r;
|
||||
@@ -151,20 +151,20 @@ void mm_pair(void *km, int max_gap_ref, int pe_bonus, int sub_diff, int match_sc
|
||||
}
|
||||
}
|
||||
mapq_pe = r[0]->mapq > r[1]->mapq? r[0]->mapq : r[1]->mapq;
|
||||
for (i = 0; i < sc.n; ++i)
|
||||
if ((sc.a[i]>>32) + sub_diff >= max>>32)
|
||||
for (i = 0; i < (int)sc.n; ++i)
|
||||
if ((sc.a[i]>>32) + sub_diff >= (uint64_t)max>>32)
|
||||
++n_sub;
|
||||
if (sc.n > 1) {
|
||||
int mapq_pe_alt;
|
||||
mapq_pe_alt = (int)(6.02f * ((max>>32) - (sc.a[sc.n - 2]>>32)) / match_sc - 4.343f * logf(n_sub)); // n_sub > 0 because it counts the optimal, too
|
||||
mapq_pe = mapq_pe < mapq_pe_alt? mapq_pe : mapq_pe_alt;
|
||||
}
|
||||
if (r[0]->mapq < mapq_pe) r[0]->mapq = (r[0]->mapq + mapq_pe) / 2;
|
||||
if (r[1]->mapq < mapq_pe) r[1]->mapq = (r[1]->mapq + mapq_pe) / 2;
|
||||
if (r[0]->mapq < mapq_pe) r[0]->mapq = (int)(.2f * r[0]->mapq + .8f * mapq_pe + .499f);
|
||||
if (r[1]->mapq < mapq_pe) r[1]->mapq = (int)(.2f * r[1]->mapq + .8f * mapq_pe + .499f);
|
||||
if (sc.n == 1) {
|
||||
if (r[0]->mapq < 2) r[0]->mapq = 2;
|
||||
if (r[1]->mapq < 2) r[1]->mapq = 2;
|
||||
} else if (max>>32 > sc.a[sc.n - 2]>>32) {
|
||||
} else if ((uint64_t)max>>32 > sc.a[sc.n - 2]>>32) {
|
||||
if (r[0]->mapq < 1) r[0]->mapq = 1;
|
||||
if (r[1]->mapq < 1) r[1]->mapq = 1;
|
||||
}
|
||||
|
||||
+61
-10
@@ -34,6 +34,8 @@ The following Python script demonstrates the key functionality of mappy:
|
||||
import mappy as mp
|
||||
a = mp.Aligner("test/MT-human.fa") # load or build index
|
||||
if not a: raise Exception("ERROR: failed to load/build index")
|
||||
s = a.seq("MT_human", 100, 200) # retrieve a subsequence from the index
|
||||
print(mp.revcomp(s)) # reverse complement
|
||||
for name, seq, qual in mp.fastx_read("test/MT-orang.fa"): # read a fasta/q sequence
|
||||
for hit in a.map(seq): # traverse alignments
|
||||
print("{}\t{}\t{}\t{}".format(hit.ctg, hit.r_st, hit.r_en, hit.cigar_str))
|
||||
@@ -41,20 +43,24 @@ The following Python script demonstrates the key functionality of mappy:
|
||||
APIs
|
||||
----
|
||||
|
||||
Mappy implements two classes and one global function.
|
||||
Mappy implements two classes and two global function.
|
||||
|
||||
Class mappy.Aligner
|
||||
~~~~~~~~~~~~~~~~~~~
|
||||
|
||||
.. code:: python
|
||||
|
||||
mappy.Aligner(fn_idx_in, preset=None, ...)
|
||||
mappy.Aligner(fn_idx_in=None, preset=None, ...)
|
||||
|
||||
This constructor accepts the following arguments:
|
||||
|
||||
* **fn_idx_in**: index or sequence file name. Minimap2 automatically tests the
|
||||
file type. If a sequence file is provided, minimap2 builds an index. The
|
||||
sequence file can be optionally gzip'd.
|
||||
sequence file can be optionally gzip'd. This option has no effect if **seq**
|
||||
is set.
|
||||
|
||||
* **seq**: a single sequence to index. The sequence name will be set to
|
||||
:code:`N/A`.
|
||||
|
||||
* **preset**: minimap2 preset. Currently, minimap2 supports the following
|
||||
presets: **sr** for single-end short reads; **map-pb** for PacBio
|
||||
@@ -77,14 +83,42 @@ This constructor accepts the following arguments:
|
||||
|
||||
* **n_threads**: number of indexing threads; 3 by default
|
||||
|
||||
* **fn_idx_out**: name of file to which the index is written
|
||||
* **extra_flags**: additional flags defined in minimap.h
|
||||
|
||||
* **fn_idx_out**: name of file to which the index is written. This parameter
|
||||
has no effect if **seq** is set.
|
||||
|
||||
* **scoring**: scoring system. It is a tuple/list consisting of 4, 6 or 7
|
||||
positive integers. The first 4 elements specify match scoring, mismatch
|
||||
penalty, gap open and gap extension penalty. The 5th and 6th elements, if
|
||||
present, set long-gap open and long-gap extension penalty. The 7th sets a
|
||||
mismatch penalty involving ambiguous bases.
|
||||
|
||||
.. code:: python
|
||||
|
||||
mappy.Aligner.map(seq)
|
||||
mappy.Aligner.map(seq, seq2=None, cs=False, MD=False)
|
||||
|
||||
This method aligns :code:`seq` against the index. It is a generator, *yielding*
|
||||
a series of :code:`mappy.Alignment` objects.
|
||||
a series of :code:`mappy.Alignment` objects. If :code:`seq2` is present, mappy
|
||||
performs paired-end alignment, assuming the two ends are in the FR orientation.
|
||||
Alignments of the two ends can be distinguished by the :code:`read_num` field
|
||||
(see Class mappy.Alignment below). Argument :code:`cs` asks mappy to generate
|
||||
the :code:`cs` tag; :code:`MD` is similar. These two arguments might slightly
|
||||
degrade performance and are not enabled by default.
|
||||
|
||||
.. code:: python
|
||||
|
||||
mappy.Aligner.seq(name, start=0, end=0x7fffffff)
|
||||
|
||||
This method retrieves a (sub)sequence from the index and returns it as a Python
|
||||
string. :code:`None` is returned if :code:`name` is not present in the index or
|
||||
the start/end coordinates are invalid.
|
||||
|
||||
.. code:: python
|
||||
|
||||
mappy.Aligner.seq_names
|
||||
|
||||
This property gives the array of sequence names in the index.
|
||||
|
||||
Class mappy.Alignment
|
||||
~~~~~~~~~~~~~~~~~~~~~
|
||||
@@ -118,11 +152,19 @@ properties:
|
||||
* **is_primary**: if the alignment is primary (typically the best and the first
|
||||
to generate)
|
||||
|
||||
* **read_num**: read number that the alignment corresponds to; 1 for the first
|
||||
read and 2 for the second read
|
||||
|
||||
* **cigar_str**: CIGAR string
|
||||
|
||||
* **cigar**: CIGAR returned as an array of shape :code:`(n_cigar,2)`. The two
|
||||
numbers give the length and the operator of each CIGAR operation.
|
||||
|
||||
* **MD**: the :code:`MD` tag as in the SAM format. It is an empty string unless
|
||||
the :code:`MD` argument is applied when calling :code:`mappy.Aligner.map()`.
|
||||
|
||||
* **cs**: the :code:`cs` tag.
|
||||
|
||||
An :code:`Alignment` object can be converted to a string with :code:`str()` in
|
||||
the following format:
|
||||
|
||||
@@ -133,13 +175,22 @@ the following format:
|
||||
It is effectively the PAF format without the QueryName and QueryLength columns
|
||||
(the first two columns in PAF).
|
||||
|
||||
Function mappy.fastx_read
|
||||
~~~~~~~~~~~~~~~~~~~~~~~~~
|
||||
Miscellaneous Functions
|
||||
~~~~~~~~~~~~~~~~~~~~~~~
|
||||
|
||||
.. code:: python
|
||||
|
||||
mappy.fastx_read(fn)
|
||||
mappy.fastx_read(fn, read_comment=False)
|
||||
|
||||
This generator function opens a FASTA/FASTQ file and *yields* a
|
||||
:code:`(name,seq,qual)` tuple for each sequence entry. The input file may be
|
||||
optionally gzip'd.
|
||||
optionally gzip'd. If :code:`read_comment` is True, this generator yields
|
||||
a :code:`(name,seq,qual,comment)` tuple instead.
|
||||
|
||||
.. code:: python
|
||||
|
||||
mappy.revcomp(seq)
|
||||
|
||||
Return the reverse complement of DNA string :code:`seq`. This function
|
||||
recognizes IUB code and preserves the letter cases. Uracil :code:`U` is
|
||||
complemented to :code:`A`.
|
||||
|
||||
@@ -15,6 +15,7 @@ typedef struct {
|
||||
int32_t blen, mlen, NM, ctg_len;
|
||||
uint8_t mapq, is_primary;
|
||||
int8_t strand, trans_strand;
|
||||
int32_t seg_id;
|
||||
int32_t n_cigar32;
|
||||
uint32_t *cigar32;
|
||||
} mm_hitpy_t;
|
||||
@@ -32,6 +33,7 @@ static inline void mm_reg2hitpy(const mm_idx_t *mi, mm_reg1_t *r, mm_hitpy_t *h)
|
||||
h->NM = r->blen - r->mlen + r->p->n_ambi;
|
||||
h->trans_strand = r->p->trans_strand == 1? 1 : r->p->trans_strand == 2? -1 : 0;
|
||||
h->is_primary = (r->id == r->parent);
|
||||
h->seg_id = r->seg_id;
|
||||
h->n_cigar32 = r->p->n_cigar;
|
||||
h->cigar32 = r->p->cigar;
|
||||
}
|
||||
@@ -68,4 +70,83 @@ static inline void mm_reset_timer(void)
|
||||
mm_realtime0 = realtime();
|
||||
}
|
||||
|
||||
extern unsigned char seq_comp_table[256];
|
||||
static inline mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char *seq1, const char *seq2, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt)
|
||||
{
|
||||
mm_reg1_t *r;
|
||||
|
||||
Py_BEGIN_ALLOW_THREADS
|
||||
if (seq2 == 0) {
|
||||
r = mm_map(mi, strlen(seq1), seq1, n_regs, b, opt, NULL);
|
||||
} else {
|
||||
int _n_regs[2];
|
||||
mm_reg1_t *regs[2];
|
||||
char *seq[2];
|
||||
int i, len[2];
|
||||
|
||||
len[0] = strlen(seq1);
|
||||
len[1] = strlen(seq2);
|
||||
seq[0] = (char*)seq1;
|
||||
seq[1] = strdup(seq2);
|
||||
for (i = 0; i < len[1]>>1; ++i) {
|
||||
int t = seq[1][len[1] - i - 1];
|
||||
seq[1][len[1] - i - 1] = seq_comp_table[(uint8_t)seq[1][i]];
|
||||
seq[1][i] = seq_comp_table[t];
|
||||
}
|
||||
if (len[1]&1) seq[1][len[1]>>1] = seq_comp_table[(uint8_t)seq[1][len[1]>>1]];
|
||||
mm_map_frag(mi, 2, len, (const char**)seq, _n_regs, regs, b, opt, NULL);
|
||||
for (i = 0; i < _n_regs[1]; ++i)
|
||||
regs[1][i].rev = !regs[1][i].rev;
|
||||
*n_regs = _n_regs[0] + _n_regs[1];
|
||||
regs[0] = (mm_reg1_t*)realloc(regs[0], sizeof(mm_reg1_t) * (*n_regs));
|
||||
memcpy(®s[0][_n_regs[0]], regs[1], _n_regs[1] * sizeof(mm_reg1_t));
|
||||
free(regs[1]);
|
||||
r = regs[0];
|
||||
}
|
||||
Py_END_ALLOW_THREADS
|
||||
|
||||
return r;
|
||||
}
|
||||
|
||||
static inline char *mappy_revcomp(int len, const uint8_t *seq)
|
||||
{
|
||||
int i;
|
||||
char *rev;
|
||||
rev = (char*)malloc(len + 1);
|
||||
for (i = 0; i < len; ++i)
|
||||
rev[len - i - 1] = seq_comp_table[seq[i]];
|
||||
rev[len] = 0;
|
||||
return rev;
|
||||
}
|
||||
|
||||
static char *mappy_fetch_seq(const mm_idx_t *mi, const char *name, int st, int en, int *len)
|
||||
{
|
||||
int i, rid;
|
||||
char *s;
|
||||
*len = 0;
|
||||
rid = mm_idx_name2id(mi, name);
|
||||
if (rid < 0) return 0;
|
||||
if ((uint32_t)st >= mi->seq[rid].len || st >= en) return 0;
|
||||
if (en < 0 || (uint32_t)en > mi->seq[rid].len)
|
||||
en = mi->seq[rid].len;
|
||||
s = (char*)malloc(en - st + 1);
|
||||
*len = mm_idx_getseq(mi, rid, st, en, (uint8_t*)s);
|
||||
for (i = 0; i < *len; ++i)
|
||||
s[i] = "ACGTN"[(uint8_t)s[i]];
|
||||
s[*len] = 0;
|
||||
return s;
|
||||
}
|
||||
|
||||
static mm_idx_t *mappy_idx_seq(int w, int k, int is_hpc, int bucket_bits, const char *seq, int len)
|
||||
{
|
||||
const char *fake_name = "N/A";
|
||||
char *s;
|
||||
mm_idx_t *mi;
|
||||
s = (char*)calloc(len + 1, 1);
|
||||
memcpy(s, seq, len);
|
||||
mi = mm_idx_str(w, k, is_hpc, bucket_bits, 1, (const char**)&s, (const char**)&fake_name);
|
||||
free(s);
|
||||
return mi;
|
||||
}
|
||||
|
||||
#endif
|
||||
|
||||
+30
-9
@@ -5,37 +5,48 @@ cdef extern from "minimap.h":
|
||||
# Options
|
||||
#
|
||||
ctypedef struct mm_idxopt_t:
|
||||
short k, w, is_hpc, bucket_bits
|
||||
int mini_batch_size
|
||||
short k, w, flag, bucket_bits
|
||||
int64_t mini_batch_size
|
||||
uint64_t batch_size
|
||||
|
||||
ctypedef struct mm_mapopt_t:
|
||||
int64_t flag
|
||||
int seed
|
||||
int sdust_thres
|
||||
int flag
|
||||
int max_qlen
|
||||
int bw
|
||||
int max_gap, max_gap_ref
|
||||
int max_frag_len
|
||||
int max_chain_skip
|
||||
int max_chain_skip, max_chain_iter
|
||||
int min_cnt
|
||||
int min_chain_score
|
||||
float chain_gap_scale
|
||||
float mask_level
|
||||
int mask_len
|
||||
float pri_ratio
|
||||
int best_n
|
||||
float min_iden
|
||||
int max_join_long, max_join_short
|
||||
int min_join_flank_sc
|
||||
float min_join_flank_ratio
|
||||
float alt_drop
|
||||
int a, b, q, e, q2, e2
|
||||
int sc_ambi
|
||||
int noncan
|
||||
int zdrop
|
||||
int junc_bonus
|
||||
int zdrop, zdrop_inv
|
||||
int end_bonus
|
||||
int min_dp_max
|
||||
int min_ksw_len
|
||||
int anchor_ext_len, anchor_ext_shift
|
||||
float max_clip_ratio
|
||||
int pe_ori, pe_bonus
|
||||
float mid_occ_frac
|
||||
int32_t min_mid_occ
|
||||
int32_t mid_occ
|
||||
int32_t max_occ
|
||||
int mini_batch_size
|
||||
int64_t mini_batch_size
|
||||
int64_t max_sw_mat
|
||||
const char *split_prefix
|
||||
|
||||
int mm_set_opt(char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
|
||||
int mm_verbose
|
||||
@@ -52,12 +63,13 @@ cdef extern from "minimap.h":
|
||||
pass
|
||||
|
||||
ctypedef struct mm_idx_t:
|
||||
int32_t b, w, k, is_hpc
|
||||
int32_t b, w, k, flag
|
||||
uint32_t n_seq
|
||||
mm_idx_seq_t *seq
|
||||
uint32_t *S
|
||||
mm_idx_bucket_t *B
|
||||
void *km
|
||||
void *h
|
||||
|
||||
ctypedef struct mm_idx_reader_t:
|
||||
pass
|
||||
@@ -68,6 +80,8 @@ cdef extern from "minimap.h":
|
||||
void mm_idx_destroy(mm_idx_t *mi)
|
||||
void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
|
||||
|
||||
int mm_idx_index_name(mm_idx_t *mi)
|
||||
|
||||
#
|
||||
# Mapping (key struct defined in cmappy.h below)
|
||||
#
|
||||
@@ -79,7 +93,9 @@ cdef extern from "minimap.h":
|
||||
|
||||
mm_tbuf_t *mm_tbuf_init()
|
||||
void mm_tbuf_destroy(mm_tbuf_t *b)
|
||||
mm_reg1_t *mm_map(const mm_idx_t *mi, int l_seq, const char *seq, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *name)
|
||||
void *mm_tbuf_get_km(mm_tbuf_t *b)
|
||||
int mm_gen_cs(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int no_iden)
|
||||
int mm_gen_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq)
|
||||
|
||||
#
|
||||
# Helper header (because it is hard to expose mm_reg1_t with Cython)
|
||||
@@ -92,11 +108,15 @@ cdef extern from "cmappy.h":
|
||||
int32_t blen, mlen, NM, ctg_len
|
||||
uint8_t mapq, is_primary
|
||||
int8_t strand, trans_strand
|
||||
int32_t seg_id
|
||||
int32_t n_cigar32
|
||||
uint32_t *cigar32
|
||||
|
||||
void mm_reg2hitpy(const mm_idx_t *mi, mm_reg1_t *r, mm_hitpy_t *h)
|
||||
void mm_free_reg1(mm_reg1_t *r)
|
||||
mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char *seq1, const char *seq2, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt)
|
||||
char *mappy_fetch_seq(const mm_idx_t *mi, const char *name, int st, int en, int *l)
|
||||
mm_idx_t *mappy_idx_seq(int w, int k, int is_hpc, int bucket_bits, const char *seq, int l)
|
||||
|
||||
ctypedef struct kstring_t:
|
||||
unsigned l, m
|
||||
@@ -114,5 +134,6 @@ cdef extern from "cmappy.h":
|
||||
void mm_fastx_close(kseq_t *ks)
|
||||
int kseq_read(kseq_t *seq)
|
||||
|
||||
char *mappy_revcomp(int l, const uint8_t *seq)
|
||||
int mm_verbose_level(int v)
|
||||
void mm_reset_timer()
|
||||
|
||||
+141
-28
@@ -1,6 +1,9 @@
|
||||
from libc.stdint cimport uint8_t, int8_t
|
||||
from libc.stdlib cimport free
|
||||
cimport cmappy
|
||||
import sys
|
||||
|
||||
__version__ = '2.18'
|
||||
|
||||
cmappy.mm_reset_timer()
|
||||
|
||||
@@ -10,16 +13,21 @@ cdef class Alignment:
|
||||
cdef int _NM, _mlen, _blen
|
||||
cdef int8_t _strand, _trans_strand
|
||||
cdef uint8_t _mapq, _is_primary
|
||||
cdef _ctg, _cigar # these are python objects
|
||||
cdef int _seg_id
|
||||
cdef _ctg, _cigar, _cs, _MD # these are python objects
|
||||
|
||||
def __cinit__(self, ctg, cl, cs, ce, strand, qs, qe, mapq, cigar, is_primary, mlen, blen, NM, trans_strand):
|
||||
self._ctg, self._ctg_len, self._r_st, self._r_en = str(ctg), cl, cs, ce
|
||||
def __cinit__(self, ctg, cl, cs, ce, strand, qs, qe, mapq, cigar, is_primary, mlen, blen, NM, trans_strand, seg_id, cs_str, MD_str):
|
||||
self._ctg = ctg if isinstance(ctg, str) else ctg.decode()
|
||||
self._ctg_len, self._r_st, self._r_en = cl, cs, ce
|
||||
self._strand, self._q_st, self._q_en = strand, qs, qe
|
||||
self._NM, self._mlen, self._blen = NM, mlen, blen
|
||||
self._mapq = mapq
|
||||
self._cigar = cigar
|
||||
self._is_primary = is_primary
|
||||
self._trans_strand = trans_strand
|
||||
self._seg_id = seg_id
|
||||
self._cs = cs_str
|
||||
self._MD = MD_str
|
||||
|
||||
@property
|
||||
def ctg(self): return self._ctg
|
||||
@@ -34,7 +42,7 @@ cdef class Alignment:
|
||||
def r_en(self): return self._r_en
|
||||
|
||||
@property
|
||||
def strand(self): return self.strand
|
||||
def strand(self): return self._strand
|
||||
|
||||
@property
|
||||
def trans_strand(self): return self._trans_strand
|
||||
@@ -63,6 +71,15 @@ cdef class Alignment:
|
||||
@property
|
||||
def cigar(self): return self._cigar
|
||||
|
||||
@property
|
||||
def read_num(self): return self._seg_id + 1
|
||||
|
||||
@property
|
||||
def cs(self): return self._cs
|
||||
|
||||
@property
|
||||
def MD(self): return self._MD
|
||||
|
||||
@property
|
||||
def cigar_str(self):
|
||||
return "".join(map(lambda x: str(x[0]) + 'MIDNSH'[x[1]], self._cigar))
|
||||
@@ -76,8 +93,10 @@ cdef class Alignment:
|
||||
if self._trans_strand > 0: ts = 'ts:A:+'
|
||||
elif self._trans_strand < 0: ts = 'ts:A:-'
|
||||
else: ts = 'ts:A:.'
|
||||
return "\t".join([str(self._q_st), str(self._q_en), strand, self._ctg, str(self._ctg_len), str(self._r_st), str(self._r_en),
|
||||
str(self._mlen), str(self._blen), str(self._mapq), tp, ts, "cg:Z:" + self.cigar_str])
|
||||
a = [str(self._q_st), str(self._q_en), strand, self._ctg, str(self._ctg_len), str(self._r_st), str(self._r_en),
|
||||
str(self._mlen), str(self._blen), str(self._mapq), tp, ts, "cg:Z:" + self.cigar_str]
|
||||
if self._cs != "": a.append("cs:Z:" + self._cs)
|
||||
return "\t".join(a)
|
||||
|
||||
cdef class ThreadBuffer:
|
||||
cdef cmappy.mm_tbuf_t *_b
|
||||
@@ -93,7 +112,8 @@ cdef class Aligner:
|
||||
cdef cmappy.mm_idxopt_t idx_opt
|
||||
cdef cmappy.mm_mapopt_t map_opt
|
||||
|
||||
def __cinit__(self, fn_idx_in, preset=None, k=None, w=None, min_cnt=None, min_chain_score=None, min_dp_score=None, bw=None, best_n=None, n_threads=3, fn_idx_out=None):
|
||||
def __cinit__(self, fn_idx_in=None, preset=None, k=None, w=None, min_cnt=None, min_chain_score=None, min_dp_score=None, bw=None, best_n=None, n_threads=3, fn_idx_out=None, max_frag_len=None, extra_flags=None, seq=None, scoring=None):
|
||||
self._idx = NULL
|
||||
cmappy.mm_set_opt(NULL, &self.idx_opt, &self.map_opt) # set the default options
|
||||
if preset is not None:
|
||||
cmappy.mm_set_opt(str.encode(preset), &self.idx_opt, &self.map_opt) # apply preset
|
||||
@@ -105,17 +125,34 @@ cdef class Aligner:
|
||||
if min_chain_score is not None: self.map_opt.min_chain_score = min_chain_score
|
||||
if min_dp_score is not None: self.map_opt.min_dp_max = min_dp_score
|
||||
if bw is not None: self.map_opt.bw = bw
|
||||
if best_n is not None: self.best_n = best_n
|
||||
if best_n is not None: self.map_opt.best_n = best_n
|
||||
if max_frag_len is not None: self.map_opt.max_frag_len = max_frag_len
|
||||
if extra_flags is not None: self.map_opt.flag |= extra_flags
|
||||
if scoring is not None and len(scoring) >= 4:
|
||||
self.map_opt.a, self.map_opt.b = scoring[0], scoring[1]
|
||||
self.map_opt.q, self.map_opt.e = scoring[2], scoring[3]
|
||||
self.map_opt.q2, self.map_opt.e2 = self.map_opt.q, self.map_opt.e
|
||||
if len(scoring) >= 6:
|
||||
self.map_opt.q2, self.map_opt.e2 = scoring[4], scoring[5]
|
||||
if len(scoring) >= 7:
|
||||
self.map_opt.sc_ambi = scoring[6]
|
||||
|
||||
cdef cmappy.mm_idx_reader_t *r;
|
||||
if fn_idx_out is None:
|
||||
r = cmappy.mm_idx_reader_open(str.encode(fn_idx_in), &self.idx_opt, NULL)
|
||||
|
||||
if seq is None:
|
||||
if fn_idx_out is None:
|
||||
r = cmappy.mm_idx_reader_open(str.encode(fn_idx_in), &self.idx_opt, NULL)
|
||||
else:
|
||||
r = cmappy.mm_idx_reader_open(str.encode(fn_idx_in), &self.idx_opt, str.encode(fn_idx_out))
|
||||
if r is not NULL:
|
||||
self._idx = cmappy.mm_idx_reader_read(r, n_threads) # NB: ONLY read the first part
|
||||
cmappy.mm_idx_reader_close(r)
|
||||
cmappy.mm_mapopt_update(&self.map_opt, self._idx)
|
||||
cmappy.mm_idx_index_name(self._idx)
|
||||
else:
|
||||
r = cmappy.mm_idx_reader_open(str.encode(fn_idx_in), &self.idx_opt, fn_idx_out)
|
||||
if r is not NULL:
|
||||
self._idx = cmappy.mm_idx_reader_read(r, n_threads) # NB: ONLY read the first part
|
||||
cmappy.mm_idx_reader_close(r)
|
||||
self._idx = cmappy.mappy_idx_seq(self.idx_opt.w, self.idx_opt.k, self.idx_opt.flag&1, self.idx_opt.bucket_bits, str.encode(seq), len(seq))
|
||||
cmappy.mm_mapopt_update(&self.map_opt, self._idx)
|
||||
self.map_opt.mid_occ = 1000 # don't filter high-occ seeds
|
||||
|
||||
def __dealloc__(self):
|
||||
if self._idx is not NULL:
|
||||
@@ -124,37 +161,113 @@ cdef class Aligner:
|
||||
def __bool__(self):
|
||||
return (self._idx != NULL)
|
||||
|
||||
def map(self, seq, buf=None):
|
||||
def map(self, seq, seq2=None, buf=None, cs=False, MD=False, max_frag_len=None, extra_flags=None):
|
||||
cdef cmappy.mm_reg1_t *regs
|
||||
cdef cmappy.mm_hitpy_t h
|
||||
cdef ThreadBuffer b
|
||||
cdef int n_regs
|
||||
cdef char *cs_str = NULL
|
||||
cdef int l_cs_str, m_cs_str = 0
|
||||
cdef void *km
|
||||
cdef cmappy.mm_mapopt_t map_opt
|
||||
|
||||
if self._idx == NULL: return
|
||||
map_opt = self.map_opt
|
||||
if max_frag_len is not None: map_opt.max_frag_len = max_frag_len
|
||||
if extra_flags is not None: map_opt.flag |= extra_flags
|
||||
|
||||
if self._idx is NULL: return None
|
||||
if buf is None: b = ThreadBuffer()
|
||||
else: b = buf
|
||||
regs = cmappy.mm_map(self._idx, len(seq), str.encode(seq), &n_regs, b._b, &self.map_opt, NULL)
|
||||
km = cmappy.mm_tbuf_get_km(b._b)
|
||||
|
||||
for i in range(n_regs):
|
||||
cmappy.mm_reg2hitpy(self._idx, ®s[i], &h)
|
||||
cigar = []
|
||||
for k in range(h.n_cigar32):
|
||||
c = h.cigar32[k]
|
||||
cigar.append([c>>4, c&0xf])
|
||||
yield Alignment(h.ctg, h.ctg_len, h.ctg_start, h.ctg_end, h.strand, h.qry_start, h.qry_end, h.mapq, cigar, h.is_primary, h.mlen, h.blen, h.NM, h.trans_strand)
|
||||
cmappy.mm_free_reg1(®s[i])
|
||||
free(regs)
|
||||
_seq = seq if isinstance(seq, bytes) else seq.encode()
|
||||
if seq2 is None:
|
||||
regs = cmappy.mm_map_aux(self._idx, _seq, NULL, &n_regs, b._b, &map_opt)
|
||||
else:
|
||||
_seq2 = seq2 if isinstance(seq2, bytes) else seq2.encode()
|
||||
regs = cmappy.mm_map_aux(self._idx, _seq, _seq2, &n_regs, b._b, &map_opt)
|
||||
|
||||
def fastx_read(fn):
|
||||
try:
|
||||
i = 0
|
||||
while i < n_regs:
|
||||
cmappy.mm_reg2hitpy(self._idx, ®s[i], &h)
|
||||
cigar, _cs, _MD = [], '', ''
|
||||
for k in range(h.n_cigar32): # convert the 32-bit CIGAR encoding to Python array
|
||||
c = h.cigar32[k]
|
||||
cigar.append([c>>4, c&0xf])
|
||||
if cs or MD: # generate the cs and/or the MD tag, if requested
|
||||
if cs:
|
||||
l_cs_str = cmappy.mm_gen_cs(km, &cs_str, &m_cs_str, self._idx, ®s[i], _seq, 1)
|
||||
_cs = cs_str[:l_cs_str] if isinstance(cs_str, str) else cs_str[:l_cs_str].decode()
|
||||
if MD:
|
||||
l_cs_str = cmappy.mm_gen_MD(km, &cs_str, &m_cs_str, self._idx, ®s[i], _seq)
|
||||
_MD = cs_str[:l_cs_str] if isinstance(cs_str, str) else cs_str[:l_cs_str].decode()
|
||||
yield Alignment(h.ctg, h.ctg_len, h.ctg_start, h.ctg_end, h.strand, h.qry_start, h.qry_end, h.mapq, cigar, h.is_primary, h.mlen, h.blen, h.NM, h.trans_strand, h.seg_id, _cs, _MD)
|
||||
cmappy.mm_free_reg1(®s[i])
|
||||
i += 1
|
||||
finally:
|
||||
while i < n_regs:
|
||||
cmappy.mm_free_reg1(®s[i])
|
||||
i += 1
|
||||
free(regs)
|
||||
free(cs_str)
|
||||
|
||||
def seq(self, str name, int start=0, int end=0x7fffffff):
|
||||
cdef int l
|
||||
cdef char *s
|
||||
if self._idx == NULL: return
|
||||
s = cmappy.mappy_fetch_seq(self._idx, name.encode(), start, end, &l)
|
||||
if l == 0: return None
|
||||
r = s[:l] if isinstance(s, str) else s[:l].decode()
|
||||
free(s)
|
||||
return r
|
||||
|
||||
@property
|
||||
def k(self): return self._idx.k
|
||||
|
||||
@property
|
||||
def w(self): return self._idx.w
|
||||
|
||||
@property
|
||||
def n_seq(self): return self._idx.n_seq
|
||||
|
||||
@property
|
||||
def seq_names(self):
|
||||
cdef char *p
|
||||
if self._idx == NULL: return
|
||||
sn = []
|
||||
for i in range(self._idx.n_seq):
|
||||
p = self._idx.seq[i].name
|
||||
s = p if isinstance(p, str) else p.decode()
|
||||
sn.append(s)
|
||||
return sn
|
||||
|
||||
def fastx_read(fn, read_comment=False):
|
||||
cdef cmappy.kseq_t *ks
|
||||
ks = cmappy.mm_fastx_open(str.encode(fn))
|
||||
if ks is NULL: return None
|
||||
while cmappy.kseq_read(ks) >= 0:
|
||||
if ks.qual.l > 0: qual = str(ks.qual.s)
|
||||
if ks.qual.l > 0: qual = ks.qual.s if isinstance(ks.qual.s, str) else ks.qual.s.decode()
|
||||
else: qual = None
|
||||
yield str(ks.name.s), str(ks.seq.s), qual
|
||||
name = ks.name.s if isinstance(ks.name.s, str) else ks.name.s.decode()
|
||||
seq = ks.seq.s if isinstance(ks.seq.s, str) else ks.seq.s.decode()
|
||||
if read_comment:
|
||||
if ks.comment.l > 0: comment = ks.comment.s if isinstance(ks.comment.s, str) else ks.comment.s.decode()
|
||||
else: comment = None
|
||||
yield name, seq, qual, comment
|
||||
else:
|
||||
yield name, seq, qual
|
||||
cmappy.mm_fastx_close(ks)
|
||||
|
||||
def revcomp(seq):
|
||||
l = len(seq)
|
||||
bseq = seq if isinstance(seq, bytes) else seq.encode()
|
||||
cdef char *s = cmappy.mappy_revcomp(l, bseq)
|
||||
r = s[:l] if isinstance(s, str) else s[:l].decode()
|
||||
free(s)
|
||||
return r
|
||||
|
||||
def verbose(v=None):
|
||||
if v is None: v = -1
|
||||
return cmappy.mm_verbose_level(v)
|
||||
|
||||
+8
-4
@@ -1,10 +1,11 @@
|
||||
#!/usr/bin/env python
|
||||
|
||||
import sys, getopt
|
||||
import sys
|
||||
import getopt
|
||||
import mappy as mp
|
||||
|
||||
def main(argv):
|
||||
opts, args = getopt.getopt(argv[1:], "x:n:m:k:w:r:")
|
||||
opts, args = getopt.getopt(argv[1:], "x:n:m:k:w:r:c")
|
||||
if len(args) < 2:
|
||||
print("Usage: minimap2.py [options] <ref.fa>|<ref.mmi> <query.fq>")
|
||||
print("Options:")
|
||||
@@ -14,9 +15,11 @@ def main(argv):
|
||||
print(" -k INT k-mer length")
|
||||
print(" -w INT minimizer window length")
|
||||
print(" -r INT band width")
|
||||
print(" -c output the cs tag")
|
||||
sys.exit(1)
|
||||
|
||||
preset, min_cnt, min_sc, k, w, bw = None, None, None, None, None, None
|
||||
preset = min_cnt = min_sc = k = w = bw = None
|
||||
out_cs = False
|
||||
for opt, arg in opts:
|
||||
if opt == '-x': preset = arg
|
||||
elif opt == '-n': min_cnt = int(arg)
|
||||
@@ -24,11 +27,12 @@ def main(argv):
|
||||
elif opt == '-r': bw = int(arg)
|
||||
elif opt == '-k': k = int(arg)
|
||||
elif opt == '-w': w = int(arg)
|
||||
elif opt == '-c': out_cs = True
|
||||
|
||||
a = mp.Aligner(args[0], preset=preset, min_cnt=min_cnt, min_chain_score=min_sc, k=k, w=w, bw=bw)
|
||||
if not a: raise Exception("ERROR: failed to load/build index file '{}'".format(args[0]))
|
||||
for name, seq, qual in mp.fastx_read(args[1]): # read one sequence
|
||||
for h in a.map(seq): # traverse hits
|
||||
for h in a.map(seq, cs=out_cs): # traverse hits
|
||||
print('{}\t{}\t{}'.format(name, len(seq), h))
|
||||
|
||||
if __name__ == "__main__":
|
||||
|
||||
@@ -56,6 +56,7 @@ sdust_buf_t *sdust_buf_init(void *km)
|
||||
buf = (sdust_buf_t*)kcalloc(km, 1, sizeof(sdust_buf_t));
|
||||
buf->km = km;
|
||||
buf->w = kdq_init(int, buf->km);
|
||||
kdq_resize(int, buf->w, 8);
|
||||
return buf;
|
||||
}
|
||||
|
||||
@@ -69,10 +70,10 @@ void sdust_buf_destroy(sdust_buf_t *buf)
|
||||
static inline void shift_window(int t, kdq_t(int) *w, int T, int W, int *L, int *rw, int *rv, int *cw, int *cv)
|
||||
{
|
||||
int s;
|
||||
if (kdq_size(w) >= W - SD_WLEN + 1) { // TODO: is this right for SD_WLEN!=3?
|
||||
if ((int)kdq_size(w) >= W - SD_WLEN + 1) { // TODO: is this right for SD_WLEN!=3?
|
||||
s = *kdq_shift(int, w);
|
||||
*rw -= --cw[s];
|
||||
if (*L > kdq_size(w))
|
||||
if (*L > (int)kdq_size(w))
|
||||
--*L, *rv -= --cv[s];
|
||||
}
|
||||
kdq_push(int, w, t);
|
||||
@@ -113,7 +114,7 @@ static void find_perfect(void *km, perf_intv_v *P, const kdq_t(int) *w, int T, i
|
||||
r += c[t]++;
|
||||
new_r = r, new_l = kdq_size(w) - i - 1;
|
||||
if (new_r * 10 > T * new_l) {
|
||||
for (j = 0; j < P->n && P->a[j].start >= i + start; ++j) { // find insertion position
|
||||
for (j = 0; j < (int)P->n && P->a[j].start >= i + start; ++j) { // find insertion position
|
||||
perf_intv_t *p = &P->a[j];
|
||||
if (max_r == 0 || p->r * max_l > max_r * p->l)
|
||||
max_r = p->r, max_l = p->l;
|
||||
@@ -176,7 +177,7 @@ uint64_t *sdust(void *km, const uint8_t *seq, int l_seq, int T, int W, int *n)
|
||||
#ifdef _SDUST_MAIN
|
||||
#include <zlib.h>
|
||||
#include <stdio.h>
|
||||
#include "getopt.h"
|
||||
#include "ketopt.h"
|
||||
#include "kseq.h"
|
||||
KSEQ_INIT(gzFile, gzread)
|
||||
|
||||
@@ -185,16 +186,17 @@ int main(int argc, char *argv[])
|
||||
gzFile fp;
|
||||
kseq_t *ks;
|
||||
int W = 64, T = 20, c;
|
||||
ketopt_t o = KETOPT_INIT;
|
||||
|
||||
while ((c = getopt(argc, argv, "w:t:")) >= 0) {
|
||||
if (c == 'w') W = atoi(optarg);
|
||||
else if (c == 't') T = atoi(optarg);
|
||||
while ((c = ketopt(&o, argc, argv, 1, "w:t:", 0)) >= 0) {
|
||||
if (c == 'w') W = atoi(o.arg);
|
||||
else if (c == 't') T = atoi(o.arg);
|
||||
}
|
||||
if (optind == argc) {
|
||||
if (o.ind == argc) {
|
||||
fprintf(stderr, "Usage: sdust [-w %d] [-t %d] <in.fa>\n", W, T);
|
||||
return 1;
|
||||
}
|
||||
fp = strcmp(argv[optind], "-")? gzopen(argv[optind], "r") : gzdopen(fileno(stdin), "r");
|
||||
fp = strcmp(argv[o.ind], "-")? gzopen(argv[o.ind], "r") : gzdopen(fileno(stdin), "r");
|
||||
ks = kseq_init(fp);
|
||||
while (kseq_read(ks) >= 0) {
|
||||
uint64_t *r;
|
||||
|
||||
@@ -4,26 +4,26 @@ except ImportError:
|
||||
from distutils.core import setup
|
||||
from distutils.extension import Extension
|
||||
|
||||
cmdclass = {}
|
||||
import sys, platform
|
||||
|
||||
try:
|
||||
from Cython.Build import build_ext
|
||||
except ImportError: # without Cython
|
||||
module_src = 'python/mappy.c'
|
||||
else: # with Cython
|
||||
module_src = 'python/mappy.pyx'
|
||||
cmdclass['build_ext'] = build_ext
|
||||
|
||||
import sys
|
||||
sys.path.append('python')
|
||||
|
||||
extra_compile_args = ['-DHAVE_KALLOC']
|
||||
include_dirs = ["."]
|
||||
|
||||
if platform.machine() in ["aarch64", "arm64"]:
|
||||
include_dirs.append("sse2neon/")
|
||||
extra_compile_args.extend(['-ftree-vectorize', '-DKSW_SSE2_ONLY', '-D__SSE2__'])
|
||||
else:
|
||||
extra_compile_args.append('-msse4.1') # WARNING: ancient x86_64 CPUs don't have SSE4
|
||||
|
||||
def readme():
|
||||
with open('python/README.rst') as f:
|
||||
return f.read()
|
||||
with open('python/README.rst') as f:
|
||||
return f.read()
|
||||
|
||||
setup(
|
||||
name = 'mappy',
|
||||
version = '2.3',
|
||||
version = '2.18',
|
||||
url = 'https://github.com/lh3/minimap2',
|
||||
description = 'Minimap2 python binding',
|
||||
long_description = readme(),
|
||||
@@ -32,18 +32,18 @@ setup(
|
||||
license = 'MIT',
|
||||
keywords = 'sequence-alignment',
|
||||
scripts = ['python/minimap2.py'],
|
||||
ext_modules = [Extension('mappy',
|
||||
sources = [module_src, 'align.c', 'bseq.c', 'chain.c', 'format.c', 'hit.c', 'index.c', 'pe.c',
|
||||
ext_modules = [Extension('mappy',
|
||||
sources = ['python/mappy.pyx', 'align.c', 'bseq.c', 'chain.c', 'format.c', 'hit.c', 'index.c', 'pe.c', 'options.c',
|
||||
'ksw2_extd2_sse.c', 'ksw2_exts2_sse.c', 'ksw2_extz2_sse.c', 'ksw2_ll_sse.c',
|
||||
'kalloc.c', 'kthread.c', 'map.c', 'misc.c', 'sdust.c', 'sketch.c'],
|
||||
'kalloc.c', 'kthread.c', 'map.c', 'misc.c', 'sdust.c', 'sketch.c', 'esterr.c', 'splitidx.c'],
|
||||
depends = ['minimap.h', 'bseq.h', 'kalloc.h', 'kdq.h', 'khash.h', 'kseq.h', 'ksort.h',
|
||||
'ksw2.h', 'kthread.h', 'kvec.h', 'mmpriv.h', 'sdust.h',
|
||||
'python/cmappy.h', 'python/cmappy.pxd'],
|
||||
extra_compile_args = ['-msse4'], # WARNING: ancient x86_64 CPUs don't have SSE4
|
||||
include_dirs = ['.'],
|
||||
extra_compile_args = extra_compile_args,
|
||||
include_dirs = include_dirs,
|
||||
libraries = ['z', 'm', 'pthread'])],
|
||||
classifiers = [
|
||||
'Development Status :: 4 - Beta',
|
||||
'Development Status :: 5 - Production/Stable',
|
||||
'License :: OSI Approved :: MIT License',
|
||||
'Operating System :: POSIX',
|
||||
'Programming Language :: C',
|
||||
@@ -52,4 +52,4 @@ setup(
|
||||
'Programming Language :: Python :: 3',
|
||||
'Intended Audience :: Science/Research',
|
||||
'Topic :: Scientific/Engineering :: Bio-Informatics'],
|
||||
cmdclass = cmdclass)
|
||||
setup_requires=["cython"])
|
||||
|
||||
@@ -2,8 +2,9 @@
|
||||
#include <stdlib.h>
|
||||
#include <assert.h>
|
||||
#include <string.h>
|
||||
#define __STDC_LIMIT_MACROS
|
||||
#include "kvec.h"
|
||||
#include "minimap.h"
|
||||
#include "mmpriv.h"
|
||||
|
||||
unsigned char seq_nt4_table[256] = {
|
||||
0, 1, 2, 3, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
|
||||
@@ -101,34 +102,34 @@ void mm_sketch(void *km, const char *str, int len, int w, int k, uint32_t rid, i
|
||||
tq_push(&tq, skip_len);
|
||||
kmer_span += skip_len;
|
||||
if (tq.count > k) kmer_span -= tq_shift(&tq);
|
||||
if (kmer_span >= 256) continue; // make sure $kmer_span does not take more than 8 bits
|
||||
} else kmer_span = l + 1 < k? l + 1 : k;
|
||||
kmer[0] = (kmer[0] << 2 | c) & mask; // forward k-mer
|
||||
kmer[1] = (kmer[1] >> 2) | (3ULL^c) << shift1; // reverse k-mer
|
||||
if (kmer[0] == kmer[1]) continue; // skip "symmetric k-mers" as we don't know it strand
|
||||
z = kmer[0] < kmer[1]? 0 : 1; // strand
|
||||
if (++l >= k) {
|
||||
++l;
|
||||
if (l >= k && kmer_span < 256) {
|
||||
info.x = hash64(kmer[z], mask) << 8 | kmer_span;
|
||||
info.y = (uint64_t)rid<<32 | (uint32_t)i<<1 | z;
|
||||
}
|
||||
} else l = 0, tq.count = tq.front = 0, kmer_span = 0;
|
||||
buf[buf_pos] = info; // need to do this here as appropriate buf_pos and buf[buf_pos] are needed below
|
||||
if (l == w + k - 1) { // special case for the first window - because identical k-mers are not stored yet
|
||||
if (l == w + k - 1 && min.x != UINT64_MAX) { // special case for the first window - because identical k-mers are not stored yet
|
||||
for (j = buf_pos + 1; j < w; ++j)
|
||||
if (min.x == buf[j].x && buf[j].y != min.y) kv_push(mm128_t, km, *p, buf[j]);
|
||||
for (j = 0; j < buf_pos; ++j)
|
||||
if (min.x == buf[j].x && buf[j].y != min.y) kv_push(mm128_t, km, *p, buf[j]);
|
||||
}
|
||||
if (info.x <= min.x) { // a new minimum; then write the old min
|
||||
if (l >= w + k) kv_push(mm128_t, km, *p, min);
|
||||
if (l >= w + k && min.x != UINT64_MAX) kv_push(mm128_t, km, *p, min);
|
||||
min = info, min_pos = buf_pos;
|
||||
} else if (buf_pos == min_pos) { // old min has moved outside the window
|
||||
if (l >= w + k - 1) kv_push(mm128_t, km, *p, min);
|
||||
if (l >= w + k - 1 && min.x != UINT64_MAX) kv_push(mm128_t, km, *p, min);
|
||||
for (j = buf_pos + 1, min.x = UINT64_MAX; j < w; ++j) // the two loops are necessary when there are identical k-mers
|
||||
if (min.x >= buf[j].x) min = buf[j], min_pos = j; // >= is important s.t. min is always the closest k-mer
|
||||
for (j = 0; j <= buf_pos; ++j)
|
||||
if (min.x >= buf[j].x) min = buf[j], min_pos = j;
|
||||
if (l >= w + k - 1) { // write identical k-mers
|
||||
if (l >= w + k - 1 && min.x != UINT64_MAX) { // write identical k-mers
|
||||
for (j = buf_pos + 1; j < w; ++j) // these two loops make sure the output is sorted
|
||||
if (min.x == buf[j].x && min.y != buf[j].y) kv_push(mm128_t, km, *p, buf[j]);
|
||||
for (j = 0; j <= buf_pos; ++j)
|
||||
|
||||
+84
@@ -0,0 +1,84 @@
|
||||
#include <string.h>
|
||||
#include <assert.h>
|
||||
#include <stdlib.h>
|
||||
#include <stdio.h>
|
||||
#include <errno.h>
|
||||
#include "mmpriv.h"
|
||||
|
||||
FILE *mm_split_init(const char *prefix, const mm_idx_t *mi)
|
||||
{
|
||||
char *fn;
|
||||
FILE *fp;
|
||||
uint32_t i, k = mi->k;
|
||||
fn = (char*)calloc(strlen(prefix) + 10, 1);
|
||||
sprintf(fn, "%s.%.4d.tmp", prefix, mi->index);
|
||||
if ((fp = fopen(fn, "wb")) == NULL) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "[ERROR]\033[1;31m failed to write to temporary file '%s'\033[0m: %s\n", fn, strerror(errno));
|
||||
exit(1);
|
||||
}
|
||||
mm_err_fwrite(&k, 4, 1, fp);
|
||||
mm_err_fwrite(&mi->n_seq, 4, 1, fp);
|
||||
for (i = 0; i < mi->n_seq; ++i) {
|
||||
uint32_t l;
|
||||
l = strlen(mi->seq[i].name);
|
||||
mm_err_fwrite(&l, 1, 4, fp);
|
||||
mm_err_fwrite(mi->seq[i].name, 1, l, fp);
|
||||
mm_err_fwrite(&mi->seq[i].len, 4, 1, fp);
|
||||
}
|
||||
free(fn);
|
||||
return fp;
|
||||
}
|
||||
|
||||
mm_idx_t *mm_split_merge_prep(const char *prefix, int n_splits, FILE **fp, uint32_t *n_seq_part)
|
||||
{
|
||||
mm_idx_t *mi = 0;
|
||||
char *fn;
|
||||
int i, j;
|
||||
|
||||
if (n_splits < 1) return 0;
|
||||
fn = CALLOC(char, strlen(prefix) + 10);
|
||||
for (i = 0; i < n_splits; ++i) {
|
||||
sprintf(fn, "%s.%.4d.tmp", prefix, i);
|
||||
if ((fp[i] = fopen(fn, "rb")) == 0) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "ERROR: failed to open temporary file '%s': %s\n", fn, strerror(errno));
|
||||
for (j = 0; j < i; ++j)
|
||||
fclose(fp[j]);
|
||||
free(fn);
|
||||
return 0;
|
||||
}
|
||||
}
|
||||
free(fn);
|
||||
|
||||
mi = CALLOC(mm_idx_t, 1);
|
||||
for (i = 0; i < n_splits; ++i) {
|
||||
mm_err_fread(&mi->k, 4, 1, fp[i]); // TODO: check if k is all the same
|
||||
mm_err_fread(&n_seq_part[i], 4, 1, fp[i]);
|
||||
mi->n_seq += n_seq_part[i];
|
||||
}
|
||||
mi->seq = CALLOC(mm_idx_seq_t, mi->n_seq);
|
||||
for (i = j = 0; i < n_splits; ++i) {
|
||||
uint32_t k;
|
||||
for (k = 0; k < n_seq_part[i]; ++k, ++j) {
|
||||
uint32_t l;
|
||||
mm_err_fread(&l, 1, 4, fp[i]);
|
||||
mi->seq[j].name = (char*)calloc(l + 1, 1);
|
||||
mm_err_fread(mi->seq[j].name, 1, l, fp[i]);
|
||||
mm_err_fread(&mi->seq[j].len, 4, 1, fp[i]);
|
||||
}
|
||||
}
|
||||
return mi;
|
||||
}
|
||||
|
||||
void mm_split_rm_tmp(const char *prefix, int n_splits)
|
||||
{
|
||||
int i;
|
||||
char *fn;
|
||||
fn = CALLOC(char, strlen(prefix) + 10);
|
||||
for (i = 0; i < n_splits; ++i) {
|
||||
sprintf(fn, "%s.%.4d.tmp", prefix, i);
|
||||
remove(fn);
|
||||
}
|
||||
free(fn);
|
||||
}
|
||||
File diff suppressed because it is too large
Load Diff
+1
-1
@@ -1,4 +1,4 @@
|
||||
>MT_orang
|
||||
>MT_orang co:Z:comment
|
||||
GTTTATGTAGCTTATTCTATCCAAAGCAATGCACTGAAAATGTCTCGACGGGCCCACACG
|
||||
CCCCATAAACAAATAGGTTTGGTCCTAGCCTTTCTATTAGCTCTTAGTGAGGTTACACAT
|
||||
GCAAGCATCCCCGCCCCAGTGAGTCGCCCTCCAAGTCACTCTGACTAAGAGGAGCAAGCA
|
||||
|
||||
File diff suppressed because one or more lines are too long
+127
@@ -0,0 +1,127 @@
|
||||
>ref
|
||||
TGCGGAGGCTGAAGCAACTCCATCTTGGAAGCTAATCTACCATGTTGGCTTCTGATTAAC
|
||||
ATCAGTTCTGGGAAGGCTTGTAAGATTTCCTGTTTGTCTATTATTTCCTAGGTAAGAGCA
|
||||
GATACTTACTGTAAATCCTGCCCCTAGATTAAACAACCTTGGTGTTATCGTACTTCCATT
|
||||
GTCCTATACATCCCTTCGGAATCCCCCTTTCCCTATGGTCCTCAAGCCCTTGGTCTGGGG
|
||||
AGTAACAGCATAGGGATCAACCATCTCGTCTTGCCACTGCCCGAAATACAGACATGGCTT
|
||||
CTGTTCCTAAGTCCCTATTCAACTTTTCTTTCTAAGAAACTGGATTTGTCAGCCTCTTTC
|
||||
TTCACCTCTCAGCTTCCTTGGACTTTGGGGGTAGGTTTGCGTAGACATGCTCACCACAGA
|
||||
CACAATATCAGCTTCATTCTACAGATGAGGAAGGCAAGCCTTGGGGAGCTTAACCAACTT
|
||||
GTCGAGACTCATGTATATACCAACACTGAAAAGCAGATATTCCAGACTCCCAGTCATGCC
|
||||
ACAGGCACACCCCTCAGTGAGAGGTGGGGTTTGTAGTTGAGGCTATTTCCTGCCCAGGGA
|
||||
GCAGGGAGGCACTCTAGCTTCCCTGAGCTAACGTGGTTCTGCTTGTGTCTGACTTCCAGG
|
||||
TCTCTGCCCTTTCCAAGCTCACTAGGATGGGCTTCGGGTGTGTCAAATGCCTCAGACAGT
|
||||
ACAGATCCACACAGAATGGGCATATGCAACCAATCAGTGTCATAAAAAAGAAGGAAATGA
|
||||
CTCGGGCCCCCTGTGTGTTCAACATGTCGAAGGTATCTGTGCAGCAGAAGAAAGAGGGGC
|
||||
AAAAGCCCCCAGTGCCACAGGCCAGAGGCAGCAGCTTGGGCCCATGTGGGAGGGTTTGCT
|
||||
TTCCCCTGCCAAAGTGATGGGCTGCTGCAGCCTGGGGCTTGTGGGAATCCTTCCTGGGCC
|
||||
TGTGTGGGAAGTGTAGGCAGGGAGAGTGCTGCTTTCCCAAGCTCATCCCAGCTACAGCTA
|
||||
CCTTTGTGCTCTGGGATTCAGGACCCCCGAGGGGGCTGGCAGGAGAGTCTCTGTTCTCGG
|
||||
ATGGGTTGTCACCAGGGCATACATGGGAAGTGGGCTCTCTGGAGTCACCCTCCAGGGGAC
|
||||
AATGCCAATTCCAGACACATTTACTGGAACCCCTACACTGATGACCTTTTGTTGAGGGTT
|
||||
GAATTATGTCCCCAAAAAAGATACATTGAAGTCCAAACCTCTGGTGTCTATAAATGTGAT
|
||||
TTTATTTGAAAATGAGGTTTCTATGGACTAAATTGTGTCCCTCCCAAATTCATATTTTGA
|
||||
AGCCCTAGCCCCCAGTGTGACTATACCTAGAGACAGAGATCTTTAGGAGGTAATTAAGGT
|
||||
TCAATGAGGTCAGGTGGGTGGGGCCCTAAACCAACAGGAAGGACTGTGGCCTTACTAGAA
|
||||
AAGGAAGAAAAAGCATTTCCTCTCTTCTAGTATAAAAGGACACAGAAAGAAGGCAGATAT
|
||||
CTACAAGCCACGAAGAGAGACGTCACTGAGAACTGAATTTGTGTACATTGATCTGGAACT
|
||||
TCCAGCCTCCAGAACTTGAGAAATACATTTCTGTTGTTTATTTTTTTTTCATGTAATCAA
|
||||
TTCATTTATCATATATTTATTGAGTGCCTACTATGTGCCAGAGGATACAGCAGTAACAAA
|
||||
ACTAGGCAAAAATTGTGCCTAAAAGAGGGAAGATGACTTTTCTTAAAGTGTGGAATAAAG
|
||||
AAAAGTAAGATAGCGGATAGAAGCTTGAAGTGAAAGCAGGTTCACAGGAAGTTTCTTTGG
|
||||
TCATTTGTTTTGTTTTTAAATAGTGGAAAGATGTATATGTTTATGGAGAAAGATTGCCTT
|
||||
GAAGATGCAAGAGGAAGAGATGATCAAAATTCAAGAAGAAGCAGAAAGTGATAGAATAAA
|
||||
GAGCACAAGTGGAGAATTAGTGTTAATGAAAAGAAGGATGCTTCCTTTGATATGAAGTGA
|
||||
AGGAAGAGAGAATGAGTAAAGACCAAGACTTGAAGTCCCTAGTTTAATAGAGGGAGATTT
|
||||
CTTCTTTTGATAGCAACAATGGTATTCTGAATTATTTGAAGACATGTCATATTTCTCTTG
|
||||
TGCCATTTTCCTCCCAGTTTAAACATTCTCATAACCTCTATTCCTCACATGATGTTTTTC
|
||||
CAGGTCCTTTATTCTTTGGCACTCTCTTCTCTGGACACATTGTATTCTGTCATTGGTCCT
|
||||
AAAATTTAGATACCCACAATTGAACATACTCCTCTAGATATGGTCTAGCTAATGCAAAAG
|
||||
AACTGCTGCCTTCCAACTTGTTCAGACATCATATGTTTGTTGTCAAACGCTAAGTTGAGT
|
||||
TGTTATCTTTTAAGTTTTGTTTTTGTTTTTTTTTTTTTTTTTTAATTCCAAGAGGTGCCC
|
||||
ACGTTGGCTAAGTACCAAACAGGGTACTAGGGAATTTTACTTCTGAGTTAAATGCCATTC
|
||||
TAGTTGTTTTTTCTTCATCTCCAGTAAGGTTATCTTTATTCACCAGTTGTTACAATAGCT
|
||||
GTGGGTCTTGCTTCTCACAGTTTTATGCTGTCTGTGCTATTTTCTCTACTGATCATCACC
|
||||
ACAATCATTATTGCTTATCATAATTGTTATCTTTATTTTCTCCTTTAATCAAGAATCAGT
|
||||
CTTCCTTTATCTCATTATTCTCTTTTGCAGGCTTCAGGATAATTATGGTTGGAGTGCACT
|
||||
GGGGGAACCAGTGCAGCTAAGCTCTGACATCTTTGCATCCCTTTTCCATCTGCTGTTTTG
|
||||
GCACTCTGGTAGAATAGATAACCTAAAAACGACTTTAAAACATCTAGAAATTTTGGATAA
|
||||
AATATAACAAACATCCCTTTAAATGCACAACTGATCTTCCATGGAAGTCACAGAAATATA
|
||||
TAACGCCAAAAAGAAGGGAAGCTGAAACCCAGGGCTGTAAACATGAACATCATCTTCTCT
|
||||
CCCTTTTTCTTGTGACTTATCTTGTTTTTCTCAGCTTTGGTGCTACCAAGGCTTGACTTT
|
||||
AATAGGCATTTCCAATCAATGAGAGAATTTCTTTTGCTTTCATCAACAATTCAGTTATTG
|
||||
ATGTTAACATATATATCATTTGAGTACTTTTCTTTTTTTTATTATTATTATACTTTAAGT
|
||||
TTTAGGGTCCATGTGCACAATGTGCAGGTTAGTTACGTATGTATACATGTGCCATGCTGG
|
||||
TGTGCTGCACCCATTAACTCATCATTTAGCATTAGGTATATCTCCTAATGCTATCCCTTC
|
||||
CCCCTCTCCCCACCCCACAACAGTCCCCAGAGTGTTCCCCTTCCTGTGTCCATGTGTTCT
|
||||
CATTGTTCAATCCCCATCTATGAGTGAGAACATGCGGTGTTTGGTTTTTTGTCCTTGCAA
|
||||
TAGTTTACTGAGAATGATGATTTCTAATTTCATCCATGTCCCTAAAGAGCTTCTGCACAG
|
||||
CAAAAGAAACTACCATCAGAGTGAACAGGCAACCTACAAAATGGGAGAAAATTTTCACAA
|
||||
CCTGCTCATCTGACAAAGGGCTAATATCCAGAATCTACAATGAACTCAAACAAATTTACA
|
||||
AGAAAAAAACAAACAACCCCATCAAAAAGTGGGCAAAGGATATGAACAGACACTTCTCAA
|
||||
AAGAAGACATTTATGCAGCCAAAAGACACATGAAAAAATGCTCATCATCACTGGCCATCA
|
||||
GAGAAATGCAAACCAAAACCACAATGAGATACCATCTCACACCAGTTAAAATGGCAATCA
|
||||
TTAAAAAGTCAGGAAACAACAGGTGCTGGAGAGGATGTGGAGAAACAGGAACACTTTTAC
|
||||
ACTGTTGGTGGGACTGTAAACTAGTTCAACCATTGTGGAAGTCAGTGTGCTGATTCCTCA
|
||||
GGGATCTAGAACTAGAAATACCATTTGACCCAGCCATCCCATTACTGGGTATATACCCAA
|
||||
AGGACTATAAATCATGCTGCTATAAAGACACATGCACACGTATGTTTATTGCGGCACTAT
|
||||
TCACAATAGCAAAGACTTGGAACCAACCCAAATGTCCAACAATGATAGACTGGATTAAGA
|
||||
AAATGTGGCACATATACACCACGGAATACTGTGCAGCCATAAAAAATGATGAGTTCATGT
|
||||
CCTTTGTAGGGACACGGATGAAATTGGAAATCATTTCTGTTGTTTAAACCACGAAGTCTA
|
||||
TGGTATCTGGTTATGACAACCTGAGAATACTAACTCAAGGGTCTTTCGCAGATGTCATTA
|
||||
AGTTGTTAAAGTGAGGTCATTATGGTGGGTCCTAATCCAAGAGAAGAGATGCATGGACAG
|
||||
ACGTGCACAACGGGAGGACCAAGCCAAGACACACAGGGAGAATGGCCATGGGAAGATGGA
|
||||
GGCAGAGATCAAAGTGAGGCACCCACAAGCCAAGAAATGGCAGGAGCTACCAGCAGCTGG
|
||||
AAGATGCAGAGAAGCATTCCTTCTTAGAGGTTTCAGAGAGAGTATGGTGCTACTGACACC
|
||||
TTGATTTTGAACTTCTAGTCTCCAGAACTATGAGAGAATAAATTTCTGTTGGTTAAGCCA
|
||||
TCGAGTTTGTGTAAGTTTGTTATAAGAGCCCTAGGAAATAAACATATCCATTTATTCAGG
|
||||
AAAGCCTGCTAGAGTGCAAATATTTGGAAAAGATACTACTATGCAAATGTTTGAAAAAGA
|
||||
TATTGCTCTTGATTCTGCCTTATGGGTTTTTCATTTCTGTAAGCTATTCTCAAAGTTTTG
|
||||
TTCTTGGACTACTATTGGTAATTAAGACTGCAACATGTTTGGCAACATCAGTTGAGAACT
|
||||
GTTGCTCTGGGAACGTTTTCGGCAAGCCTCAGCCCTTCTTTTCCCTTGGCTTGCATTGAG
|
||||
GAGTTAGGTGATACTCTGCTGCTCAGGCCCAGCACCTTTATGGACCGTATTCCCCTGGTG
|
||||
GAATGACCATCTCTGCTTGCTCTGATTGGCTGTTGGGGTTTTCTAGCATGCCCTATTTAA
|
||||
TATGTATGATTTATCTCTTACTTCAGTTGGAAGGTACAGTTGCTCTGTAGTTGGCATGCA
|
||||
GTCATGGTGACTATGAAAATATAAAATAATGTTTTGGTTTACAGACACTTAGAAATAAGT
|
||||
TGTGTCTCAAAATTGGGTGACTATTCTAGTTATCTGCTACTCAATATCCTTGTGCGAGCC
|
||||
CTCTTTACCCAGAATCAAACTAAACCATGAGGGGCACTATAGAATGTCACCCCTGGGTCC
|
||||
AGGATACTATGGGGACTCAGAAGCCAAGCTCCCACTGGGGGATCTAGGGCATGCCCCCAA
|
||||
GGTAAGATTCCCACCTCTTTGTTCAGCAGGAAGCACCCATCACACAAGGAGGTAGGAATA
|
||||
AACAAGCATTCGTCAAGAACAAAAGATACAGATGTTCTGCTGGAGCTTGGATACATAGCA
|
||||
TAAGAGGGAACAGTTCTCACAGGTAAGAGTAAGTTTTCCTCTGGTGGTGACAGTGGGACC
|
||||
TGTGGGGGAGAGAATTGGGAGTACTGACAGGAAGGCAGAGTGGCTGTCCAAATGAACGGA
|
||||
TTGTTTGCACATGGCCTTTAGGGCACGTTGTGTTAGCCTTCCATTGCTGCTTATATTAGT
|
||||
CTGTTTTCACACTGCCCATAAATGCATACCTGAGACTGGATAATTTATAAAGAAAAAGAG
|
||||
CCTTAATGTACTCATAGTTGCATGTGGCTGGGGAGGCCTCACAATCATGGCAGAAGGTGA
|
||||
AAGGCACATCTTACATGGAAGCAGACAAGAGAGAATTGAGGACCAAGTGAAAGGGGTTTC
|
||||
CCCTTATAAAACCATCAGATCACATGAGACTTTTTCACCACCATGAGAACAGTAAGGGGA
|
||||
AAACTATGCTCATGATTCAATTGTCTCCCACTGGATTCCTCCCACAACACATAGGAATTA
|
||||
TGGGAGCTAAAATTCAAGATGAGATTTGGGTGAGGACACAGCCAAACCCTATCACTGCTG
|
||||
TAATCAATTCCCACCAACTTAGTGGCTCGAAACATCACAGATTTATGATCTTATGACGGT
|
||||
GGAGGTCCCCAAATGGATCTTCTAGGTCTAGAATCAAGGTATCAGCAGACCACTTCTTTT
|
||||
GGAGGCTCTGGTGGAGAAACCATTTCCTCGCCTTTTCCAGCTTCTAGAGGCTGCCCTTCT
|
||||
CATTCCTTGGTTCACGGCCACACTCATTTCCATCTCTGCTTCCACTGTGACAACTTCTCT
|
||||
GCCTCAGACCCTCCTGCTTTGCCTTTGTAAGGACCCTTGTGATGAGATCAGGCCCATCCA
|
||||
GGATTATCCCTCATCTCAAGACCTTTACCTTAATCACATTTGCAAGGTCTCTTCCACTGT
|
||||
GTCAGGTAACATTTTCACAGGTTCCAGGGATTAGGGTGTGGACATCTTGGGGAGCTGGAG
|
||||
GATATTATTTCATCTACCACACACATCTCTACCTTGTACAGGCAAGCACTTGCAAAGTGC
|
||||
AATGTGATCCTCTGGAGCCACTGTCCTCCCAGAGCTTATATATACTCTGAAAGTCAACTC
|
||||
TCAGACCACAGCCTCCTGTCCATGCACCACTCTCATCAACACCCCCACCCGAAACACTTT
|
||||
CACTCCACCCTCTTTGTCCCCTAACTCATGGAGAAGAAAATCTAATTAGTAGGAGTGGAA
|
||||
TTTGGCTTTCATCTTTACCAGTACTAGAAATATGGTGTGTGTCTTTTTGTAAAAATTCTC
|
||||
TCAACTAAATTGTTTTTATTAATTTCTGCAAAATGTGAACATCAACTCCCTTCATGTGAA
|
||||
TGTCAATAAGATTAAATGAGCTGTCTCAGCTCCTAGCCTGTGCAAGCTAACAGCTCAGGA
|
||||
GATGTTTATTTCTTTCCCTCTTCTTTCCTTAATGAAGCCCTCTCCTTTGACATCTTCAAT
|
||||
TCTGGAGCGCTTCTTTTCTGAGGCCTTGGCTCCCCCACATTGCCCACCCTTTTCCTGCTC
|
||||
GTCCACATTTCTGGCTTCTATTCTCTTGTCTTTACCATCTCCCTGAACAATGTTATCCGT
|
||||
TCCAATGACTTCAACAGTCTCTCCGCTTACATATGATGCCTCTCAAACTCTGATCTCCAA
|
||||
CTCTTCCAAAGAGCTCTGGACCTTTGTTCCAATTACCTGAAAAACATCTTCTTGGATGTC
|
||||
CCATTAGCACTGTTAAATCAAACAAGAATTTCCCTCCCTCCTGCCTTGCTGTAGTTCCCC
|
||||
TAGGGATTCGGTTGTGTGGGAAGATGTGTGGAGAGCTCTTAGTTGACTCCCTTCTCTGCA
|
||||
GTTCTACCTCTCTAGAGACTTGGAGGACCCACTGTTTCCGCCTCGCTTTTTCAGGCCTAG
|
||||
AGATTGCTCGCTCCTGGGCTGGCTGCTTCATAATTCCTTATTAGTAGTTTCCCAAGCTTA
|
||||
CATATCTGTAAATATTTACTTTAGTTAAATTCTCCCCAATTTCCACAATATGTTGGCTGC
|
||||
ACATGCTTTCTACTAGGAGTCACACAACTATGATAAGAACCAAGAAATATTAGTAAACGT
|
||||
TTTTTACCATTATTGGCCTATACCCTGGAATAGCCAACAATAACCTAGAACCTATGCAAC
|
||||
AAGAATATCCAACAAGAACCTAGAGACCTGTCAGTCTATAGGTGGGAACTACAGGATGAG
|
||||
A
|
||||
+81
-24
@@ -61,13 +61,6 @@
|
||||
Volume = {32},
|
||||
Year = {2016}}
|
||||
|
||||
@misc{Suzuki:2016,
|
||||
title = {Fast and accurate alignment tool for PacBio and Nanopore long reads},
|
||||
author = {Hajime Suzuki},
|
||||
journal = {Unpublished},
|
||||
howpublished = {\href{https://github.com/ocxtal/minialign}{https://github.com/ocxtal/minialign}},
|
||||
year = {2016}}
|
||||
|
||||
@misc{Ruan:2016,
|
||||
title = {Ultra-fast de novo assembler using long noisy reads},
|
||||
author = {Jue Ruan},
|
||||
@@ -172,14 +165,6 @@
|
||||
Volume = {29},
|
||||
Year = {2011}}
|
||||
|
||||
@article {Suzuki130633,
|
||||
author = {Suzuki, Hajime and Kasahara, Masahiro},
|
||||
title = {Acceleration Of Nucleotide Semi-Global Alignment With Adaptive Banded Dynamic Programming},
|
||||
year = {2017},
|
||||
note = {doi:10.1101/130633},
|
||||
publisher = {Cold Spring Harbor Labs Journals},
|
||||
journal = {bioRxiv}}
|
||||
|
||||
@article{Gotoh:1982aa,
|
||||
Author = {Gotoh, O},
|
||||
Journal = {J Mol Biol},
|
||||
@@ -268,16 +253,88 @@
|
||||
Title = {Mason -- a read simulator for second generation sequencing data},
|
||||
Year = {2010}}
|
||||
|
||||
@article{Langmead:2012fk,
|
||||
Author = {Langmead, Ben and Salzberg, Steven L},
|
||||
Journal = {Nat Methods},
|
||||
Pages = {357-9},
|
||||
Title = {Fast gapped-read alignment with Bowtie 2},
|
||||
Volume = {9},
|
||||
Year = {2012}}
|
||||
|
||||
@article{Zaharia:2011aa,
|
||||
Author = {Zaharia, Matei and others},
|
||||
Journal = {arXiv:1111:5572},
|
||||
Title = {Faster and More Accurate Sequence Alignment with SNAP},
|
||||
Title = {Faster and More Accurate Sequence Alignment with {SNAP}},
|
||||
Year = {2011}}
|
||||
|
||||
@article{Irimia:2008aa,
|
||||
Author = {Irimia, Manuel and Roy, Scott William},
|
||||
Journal = {PLoS Genet},
|
||||
Pages = {e1000148},
|
||||
Title = {Evolutionary convergence on highly-conserved 3' intron structures in intron-poor eukaryotes and insights into the ancestral eukaryotic genome},
|
||||
Volume = {4},
|
||||
Year = {2008}}
|
||||
|
||||
@article{Depristo:2011vn,
|
||||
Author = {Depristo, Mark A and others},
|
||||
Journal = {Nat Genet},
|
||||
Pages = {491-8},
|
||||
Title = {A framework for variation discovery and genotyping using next-generation {DNA} sequencing data},
|
||||
Volume = {43},
|
||||
Year = {2011}}
|
||||
|
||||
@article{Kurtz:2004zr,
|
||||
Author = {Kurtz, Stefan and others},
|
||||
Journal = {Genome Biol},
|
||||
Pages = {R12},
|
||||
Title = {Versatile and open software for comparing large genomes},
|
||||
Volume = {5},
|
||||
Year = {2004}}
|
||||
|
||||
@article {Li223297,
|
||||
author = {Li, Heng and others},
|
||||
title = {New synthetic-diploid benchmark for accurate variant calling evaluation},
|
||||
year = {2017},
|
||||
note = {doi:10.1101/223297},
|
||||
journal = {bioRxiv}
|
||||
}
|
||||
|
||||
@article{Berlin:2015xy,
|
||||
Author = {Berlin, Konstantin and others},
|
||||
Journal = {Nat Biotechnol},
|
||||
Pages = {623-30},
|
||||
Title = {Assembling large genomes with single-molecule sequencing and locality-sensitive hashing},
|
||||
Volume = {33},
|
||||
Year = {2015}}
|
||||
|
||||
@article{Gurevich:2013aa,
|
||||
Author = {Gurevich, Alexey and others},
|
||||
Journal = {Bioinformatics},
|
||||
Pages = {1072-5},
|
||||
Title = {{QUAST}: quality assessment tool for genome assemblies},
|
||||
Volume = {29},
|
||||
Year = {2013}}
|
||||
|
||||
@article{Li:2010fk,
|
||||
Author = {Li, Heng and Durbin, Richard},
|
||||
Journal = {Bioinformatics},
|
||||
Pages = {589-95},
|
||||
Title = {Fast and accurate long-read alignment with {Burrows-Wheeler} transform},
|
||||
Volume = {26},
|
||||
Year = {2010}}
|
||||
|
||||
@article{Marcais:2018aa,
|
||||
Author = {Mar{\c c}ais, Guillaume and others},
|
||||
Journal = {PLoS Comput Biol},
|
||||
Pages = {e1005944},
|
||||
Title = {{MUMmer4}: A fast and versatile genome alignment system},
|
||||
Volume = {14},
|
||||
Year = {2018}}
|
||||
|
||||
@article{Li:2009ys,
|
||||
Author = {Li, Heng and others},
|
||||
Journal = {Bioinformatics},
|
||||
Pages = {2078-9},
|
||||
Title = {The {Sequence Alignment/Map format and SAMtools}},
|
||||
Volume = {25},
|
||||
Year = {2009}}
|
||||
|
||||
@article{Suzuki:2018aa,
|
||||
Author = {Suzuki, Hajime and Kasahara, Masahiro},
|
||||
Journal = {BMC Bioinformatics},
|
||||
Pages = {45},
|
||||
Title = {Introducing difference recurrence relations for faster semi-global alignment of long sequences},
|
||||
Volume = {19},
|
||||
Year = {2018}}
|
||||
|
||||
+274
-101
@@ -1,6 +1,6 @@
|
||||
\documentclass{bioinfo}
|
||||
\copyrightyear{2017}
|
||||
\pubyear{2017}
|
||||
\copyrightyear{2018}
|
||||
\pubyear{2018}
|
||||
|
||||
\usepackage{graphicx}
|
||||
\usepackage{hyperref}
|
||||
@@ -13,14 +13,13 @@
|
||||
|
||||
\usepackage{natbib}
|
||||
\bibliographystyle{apalike}
|
||||
\usepackage{hyperref}
|
||||
|
||||
\DeclareMathOperator*{\argmax}{argmax}
|
||||
|
||||
\begin{document}
|
||||
\firstpage{1}
|
||||
|
||||
\title[Aligning nucleotide sequences with minimap2]{Minimap2: versatile pairwise alignment for nucleotide sequences}
|
||||
\title[Aligning nucleotide sequences with minimap2]{Minimap2: pairwise alignment for nucleotide sequences}
|
||||
\author[Li]{Heng Li}
|
||||
\address{Broad Institute, 415 Main Street, Cambridge, MA 02142, USA}
|
||||
|
||||
@@ -31,19 +30,20 @@
|
||||
\section{Motivation:} Recent advances in sequencing technologies promise
|
||||
ultra-long reads of $\sim$100 kilo bases (kb) in average, full-length mRNA or
|
||||
cDNA reads in high throughput and genomic contigs over 100 mega bases (Mb) in
|
||||
length. Existing alignment tools are unable or inefficient to process such data
|
||||
length. Existing alignment programs are unable or inefficient to process such data
|
||||
at scale, which presses for the development of new alignment algorithms.
|
||||
|
||||
\section{Results:} Minimap2 is a general-purpose aligner to map DNA or long
|
||||
\section{Results:} Minimap2 is a general-purpose alignment program to map DNA or long
|
||||
mRNA sequences against a large reference database. It works with accurate short
|
||||
reads of $\ge$100bp in length, $\ge$1kb genomic reads at error rate $\sim$15\%,
|
||||
full-length noisy Direct RNA or cDNA reads, and assembly contigs or closely
|
||||
related full chromosomes of hundreds of megabases in length. Minimap2 does
|
||||
split-read alignment, employs concave gap cost for long insertions and
|
||||
deletions (INDELs) and introduces new heuristics to reduce spurious alignments.
|
||||
It is 3--4 times faster than mainstream short-read mappers at comparable
|
||||
accuracy and $\ge$30 times faster at higher accuracy for both genomic and mRNA
|
||||
reads, surpassing most aligners specialized in one type of alignment.
|
||||
It is 3--4 times as fast as mainstream short-read mappers at comparable
|
||||
accuracy, and is $\ge$30 times faster than long-read genomic or cDNA
|
||||
mappers at higher accuracy, surpassing most aligners specialized in one type of
|
||||
alignment.
|
||||
|
||||
\section{Availability and implementation:}
|
||||
\href{https://github.com/lh3/minimap2}{https://github.com/lh3/minimap2}
|
||||
@@ -64,29 +64,38 @@ the thought that 10kb long sequences should be easier to map than 100bp reads
|
||||
because we can more effectively skip repetitive regions, which are often the
|
||||
bottleneck of short-read alignment. We confirmed our speculation by achieving
|
||||
approximate mapping 50 times faster than BWA-MEM~\citep{Li:2016aa}.
|
||||
\citet{Suzuki:2016} extended our work with a fast and novel algorithm on
|
||||
\citet{Suzuki:2018aa} extended our work with a fast and novel algorithm on
|
||||
generating base-level alignment, which in turn inspired us to develop minimap2
|
||||
towards higher accuracy and more practical functionality.
|
||||
with added functionality.
|
||||
|
||||
Both SMRT and ONT have been applied to the sequencing of spliced mRNAs (RNA-seq). While
|
||||
traditional mRNA aligners work~\citep{Wu:2005vn,Iwata:2012aa}, they are not
|
||||
optimized for long noisy sequence reads and are tens of times slower than
|
||||
dedicated long-read aligners. When developing minimap2 initially for aligning
|
||||
genomic DNA only, we realized minor modifications could make it competitive for
|
||||
aligning mRNAs as well. Minimap2 is a first RNA-seq aligner specifically
|
||||
designed for long noisy reads.
|
||||
genomic DNA only, we realized minor modifications could enable the base
|
||||
algorithm to map mRNAs as well. Minimap2 becomes a first RNA-seq aligner
|
||||
specifically designed for long noisy reads. We have also extended the original
|
||||
algorithm to map short reads at a speed faster than several mainstream
|
||||
short-read mappers.
|
||||
|
||||
In this article, we will describe the minimap2 algorithm and its applications
|
||||
to different types of input sequences. We will evaluate the performance and
|
||||
accuracy of minimap2 on several simulated and real data sets and demonstrate
|
||||
the versatility of minimap2.
|
||||
|
||||
\begin{methods}
|
||||
\section{Methods}
|
||||
|
||||
Minimap2 follows a typical seed-chain-align procedure as is used by most
|
||||
full-genome aligners. It collects minimizers~\citep{Roberts:2004fv} of the
|
||||
reference sequences and indexes them in a hash table. Then for each query
|
||||
sequence, minimap2 takes query minimizers as \emph{seeds}, finds matches to the
|
||||
reference, and identifies sets of colinear seeds, which are called
|
||||
reference sequences and indexes them in a hash table, with the key being the
|
||||
hash of a minimizer and the value being a list of locations of the minimizer
|
||||
copies. Then for each query
|
||||
sequence, minimap2 takes query minimizers as \emph{seeds}, finds exact matches
|
||||
(i.e. \emph{anchors}) to the reference, and identifies sets of colinear anchors as
|
||||
\emph{chains}. If base-level alignment is requested, minimap2 applies dynamic
|
||||
programming (DP) to extend from the ends of chains and to close unseeded
|
||||
regions between adjacent seeds in chains.
|
||||
programming (DP) to extend from the ends of chains and to close
|
||||
regions between adjacent anchors in chains.
|
||||
|
||||
Minimap2 uses indexing and seeding algorithms similar to
|
||||
minimap~\citep{Li:2016aa}, and furthers the predecessor with more accurate
|
||||
@@ -113,10 +122,13 @@ distance between two anchors is too large); otherwise
|
||||
\end{equation}
|
||||
In implementation, a gap of length $l$ costs
|
||||
\[
|
||||
\gamma_c(l)=0.01\cdot \bar{w}\cdot|l|+0.5\log_2|l|
|
||||
\gamma_c(l)=\left\{\begin{array}{ll}
|
||||
0.01\cdot \bar{w}\cdot|l|+0.5\log_2|l| & (l\not=0) \\
|
||||
0 & (l=0)
|
||||
\end{array}\right.
|
||||
\]
|
||||
where $\bar{w}$ is the average seed length. For $m$ anchors, directly computing all $f(\cdot)$ with
|
||||
Eq.~(\ref{eq:chain}) takes $O(m^2)$ time. Although theoretically faster
|
||||
where $\bar{w}$ is the average seed length. For $N$ anchors, directly computing all $f(\cdot)$ with
|
||||
Eq.~(\ref{eq:chain}) takes $O(N^2)$ time. Although theoretically faster
|
||||
chaining algorithms exist~\citep{Abouelhoda:2005aa}, they
|
||||
are inapplicable to generic gap cost, complex to implement and usually
|
||||
associated with a large constant. We introduced a simple heuristic to
|
||||
@@ -126,12 +138,12 @@ We note that if anchor $i$ is chained to $j$, chaining $i$ to a predecessor
|
||||
of $j$ is likely to yield a lower score. When evaluating Eq.~(\ref{eq:chain}),
|
||||
we start from anchor $i-1$ and stop the process if we cannot find a better
|
||||
score after up to $h$ iterations. This approach reduces the average time to
|
||||
$O(h\cdot m)$. In practice, we can almost always find the optimal chain with
|
||||
$O(hN)$. In practice, we can almost always find the optimal chain with
|
||||
$h=50$; even if the heuristic fails, the optimal chain is often close.
|
||||
|
||||
\subsubsection{Backtracking}
|
||||
Let $P(i)$ be the index of the best predecessor of anchor $i$. It equals 0 if
|
||||
$f(i)=w_i$ or $\argmax_j\{f(j)+\eta(j,i)-\gamma(j,i)\}$ otherwise. For each
|
||||
$f(i)=w_i$ or $\argmax_j\{f(j)+\alpha(j,i)-\beta(j,i)\}$ otherwise. For each
|
||||
anchor $i$ in the descending order of $f(i)$, we apply $P(\cdot)$ repeatedly to
|
||||
find its predecessor and mark each visited $i$ as `used', until $P(i)=0$ or we
|
||||
reach an already `used' $i$. This way we find all chains with no anchors used
|
||||
@@ -140,9 +152,11 @@ in more than one chains.
|
||||
\subsubsection{Identifying primary chains}\label{sec:primary}
|
||||
In the absence of copy number changes, each query segment should not be mapped
|
||||
to two places in the reference. However, chains found at the previous step may
|
||||
have significant or complete overlaps due to repeats in the reference.
|
||||
have significant or complete overlaps due to repeats in the reference~\citep{Li:2010fk}.
|
||||
Minimap2 used the following procedure to identify \emph{primary chains} that do
|
||||
not greatly overlap on the query. Let $Q$ be an empty set initially. For each
|
||||
not greatly overlap on the query.
|
||||
|
||||
Let $Q$ be an empty set initially. For each
|
||||
chain from the best to the worst according to their chaining scores: if on the
|
||||
query, the chain overlaps with a chain in $Q$ by 50\% or higher percentage of
|
||||
the shorter chain, mark the chain as secondary to the chain in $Q$; otherwise,
|
||||
@@ -150,6 +164,63 @@ add the chain to $Q$. In the end, $Q$ contains all the primary chains. We did
|
||||
not choose a more sophisticated data structure (e.g. range tree or k-d tree)
|
||||
because this step is not the performance bottleneck.
|
||||
|
||||
For each primary chain, minimap2 estimates its mapping quality with an
|
||||
empirical formula:
|
||||
\[
|
||||
{\rm mapQ}=40\cdot (1-f_2/f_1)\cdot\min\{1,m/10\}\cdot\log f_1
|
||||
\]
|
||||
where $\log$ denotes natural logarithm, $m$ is the number of anchors on the primary chain, $f_1$ is the chaining
|
||||
score, and $f_2\le f_1$ is the score of the best chain that is secondary to the
|
||||
primary chain. Intuitively, a chain is assigned to a higher mapping quality if
|
||||
it is long and its best secondary chain is weak.
|
||||
|
||||
\subsubsection{Estimating per-base sequence divergence}
|
||||
Suppose a query sequence harbors $n$ seeds of length $k$, $m$ of which are
|
||||
present in a chain. We want to estimate the sequence divergence $\epsilon$
|
||||
between the query and the reference sequences in the chain. This is useful
|
||||
when base-level alignment is too expensive to perform.
|
||||
|
||||
If we model substitutions with a homogeneous Poisson process along the query
|
||||
sequence, the probablity of seeing $k$ consecutive bases without substitutions
|
||||
is $e^{-k\epsilon}$. On the assumption that all $k$-mers are independent of
|
||||
each other, the likelihood function of $\epsilon$ is
|
||||
\[
|
||||
\mathcal{L}(\epsilon|n,m,k)=e^{-m\cdot k\epsilon}(1-e^{-k\epsilon})^{n-m}
|
||||
\]
|
||||
The maximum likelihood estimate of $\epsilon$ is
|
||||
\[
|
||||
\hat{\epsilon}=\frac{1}{k}\log\frac{n}{m}
|
||||
\]
|
||||
In reality, sequencing errors are sometimes clustered and $k$-mers are not
|
||||
independent of each other, especially when we take minimizers as seeds. These
|
||||
violate the assumptions in the derivation above. As a result, $\hat{\epsilon}$
|
||||
is only approximate and can be biased. It also ignores long deletions from the
|
||||
reference sequence. In practice, fortunately, $\hat{\epsilon}$ is often close
|
||||
to and strongly correlated with the sequence divergence estimated from
|
||||
base-level alignments. On the several datasets used in
|
||||
Section~\ref{sec:long-genomic}, the Spearman correlation coefficient is around
|
||||
$0.9$.
|
||||
|
||||
\subsubsection{Indexing with homopolymer compressed $k$-mers}
|
||||
SmartDenovo
|
||||
(\href{https://github.com/ruanjue/smartdenovo}{https://github.com/ruanjue/smartdenovo};
|
||||
J. Ruan, personal communication) indexes reads with homopolymer-compressed (HPC)
|
||||
$k$-mers and finds the strategy improves overlap sensitivity for SMRT reads.
|
||||
Minimap2 adopts the same heuristic.
|
||||
|
||||
The HPC string of a string $s$, denoted by ${\rm HPC}(s)$, is constructed by
|
||||
contracting homopolymers in $s$ to a single base. An HPC $k$-mer of $s$ is a
|
||||
$k$-long substring of ${\rm HPC}(s)$. For example, suppose $s={\tt GGATTTTCCA}$,
|
||||
${\rm HPC}(s)={\tt GATCA}$ and the first HPC 4-mer is ${\tt GATC}$.
|
||||
|
||||
To demonstrate the effectiveness of HPC $k$-mers, we performed read overlapping
|
||||
for the example {\it E. coli} SMRT reads from PBcR~\citep{Berlin:2015xy}, using
|
||||
different types of $k$-mers. With normal 15bp minimizers per 5bp window,
|
||||
minimap2 finds 90.9\% of $\ge$2kb overlaps inferred from the read-to-reference
|
||||
alignment. With HPC 19-mers per 5bp window, minimap2 finds 97.4\% of overlaps. It achieves this
|
||||
higher sensitivity by indexing 1/3 fewer minimizers, which further helps
|
||||
performance. HPC-based indexing reduces the sensitivity for current ONT reads, though.
|
||||
|
||||
\subsection{Aligning genomic DNA}\label{sec:genomic}
|
||||
|
||||
\subsubsection{Alignment with 2-piece affine gap cost}
|
||||
@@ -179,7 +250,7 @@ where $s(i,j)$ is the score between the $i$-th reference base and $j$-th query
|
||||
base. Eq.~(\ref{eq:ae86}) is a natural extension to the equation under affine
|
||||
gap cost~\citep{Gotoh:1982aa,Altschul:1986aa}.
|
||||
|
||||
\subsubsection{Suzuki's formulation}
|
||||
\subsubsection{The Suzuki-Kasahara formulation}
|
||||
|
||||
When we allow gaps longer than several hundred base pairs, nucleotide-level
|
||||
alignment is much slower than chaining. SSE acceleration is critical to the
|
||||
@@ -187,14 +258,14 @@ performance of minimap2. Traditional SSE implementations~\citep{Farrar:2007hs}
|
||||
based on Eq.~(\ref{eq:ae86}) can achieve 16-way parallelization for short
|
||||
sequences, but only 4-way parallelization when the peak alignment score reaches
|
||||
32767. Long sequence alignment may exceed this threshold. Inspired by
|
||||
\citet{Wu:1996aa} and the following work, \citet{Suzuki:2016} proposed a
|
||||
\citet{Wu:1996aa} and the following work, \citet{Suzuki:2018aa} proposed a
|
||||
difference-based formulation that lifted this limitation.
|
||||
In case of 2-piece gap cost, define
|
||||
\[
|
||||
\left\{\begin{array}{ll}
|
||||
u_{ij}\triangleq H_{ij}-H_{i-1,j} & v_{ij}\triangleq H_{ij}-H_{i,j-1} \\
|
||||
x_{ij}\triangleq E_{i+1,j}-H_{ij} & \tilde{x}_{ij}\triangleq \tilde{E}_{i+1,j}-\tilde{H}_{ij} \\
|
||||
y_{ij}\triangleq F_{i,j+1}-H_{ij} & \tilde{y}_{ij}\triangleq \tilde{F}_{i,j+1}-\tilde{H}_{ij}
|
||||
x_{ij}\triangleq E_{i+1,j}-H_{ij} & \tilde{x}_{ij}\triangleq \tilde{E}_{i+1,j}-H_{ij} \\
|
||||
y_{ij}\triangleq F_{i,j+1}-H_{ij} & \tilde{y}_{ij}\triangleq \tilde{F}_{i,j+1}-H_{ij}
|
||||
\end{array}\right.
|
||||
\]
|
||||
We can transform Eq.~(\ref{eq:ae86}) to
|
||||
@@ -254,11 +325,11 @@ y_{rt}&=&\max\{0,y_{r-1,t}+u_{r-1,t}-z_{rt}+q\}-q-e\\
|
||||
\end{equation*}
|
||||
In this formulation, cells with the same diagonal index $r$ are independent of
|
||||
each other. This allows us to fully vectorize the computation of all cells on
|
||||
the same anti-diagonal in one inner loop. It also simplifies banded alignment,
|
||||
the same anti-diagonal in one inner loop. It also simplifies banded alignment (500bp band width by default),
|
||||
which would be difficult with striped vectorization~\citep{Farrar:2007hs}.
|
||||
|
||||
On the condition that $q+e<\tilde{q}+\tilde{e}$ and $e>\tilde{e}$, the initial
|
||||
values in the diagonal-antidiagonal formuation is
|
||||
values in the diagonal-antidiagonal formuation are
|
||||
\[
|
||||
\left\{\begin{array}{l}
|
||||
x_{r-1,-1}=y_{r-1,r}=-q-e\\
|
||||
@@ -277,12 +348,19 @@ r\cdot(e-\tilde{e})-(\tilde{q}-q)-\tilde{e} & (r=\lceil\frac{\tilde{q}-q}{e-\til
|
||||
\]
|
||||
These can be derived from the initial values for Eq.~(\ref{eq:ae86}).
|
||||
|
||||
When performing global alignment, we do not need to compute $H_{rt}$ in each cell.
|
||||
We use 16-way vectorization throughout the alignment process. When extending
|
||||
alignments from ends of chains, we need to find the cell $(r,t)$ where $H_{rt}$
|
||||
reaches the maximum. We resort to 4-way vectorization to compute
|
||||
$H_{rt}=H_{r-1,t}+u_{rt}$. Because this computation is simple,
|
||||
Eq.~(\ref{eq:suzuki}) is still the dominant performance bottleneck.
|
||||
|
||||
In practice, our 16-way vectorized implementation of global alignment is three
|
||||
times as fast as Parasail's 4-way vectorization~\citep{Daily:2016aa}. Without
|
||||
banding, our implementation is slower than Edlib~\citep{Sosic:2017aa}, but with
|
||||
a 1000bp band, it is considerably faster. When performing global alignment
|
||||
between anchors, we expect the alignment to stay close to the diagonal of the
|
||||
DP matrix. Banding is applicable most of time.
|
||||
DP matrix. Banding is applicable most of the time.
|
||||
|
||||
\subsubsection{The Z-drop heuristic}
|
||||
|
||||
@@ -306,6 +384,16 @@ alignment between the two subsequences involved in the global alignment, but
|
||||
this time with the one subsequence reverse complemented. This additional
|
||||
alignment step may identify short inversions that are missed during chaining.
|
||||
|
||||
\subsubsection{Filtering out misplaced anchors}
|
||||
Due to sequencing errors and local homology, some anchors in a chain may be
|
||||
wrong. If we blindly align regions between two misplaced anchors, we will
|
||||
produce a suboptimal alignment. To reduce this artifact, we filter out
|
||||
anchors that lead to a $>$10bp insertion and a $>$10bp deletion at the same
|
||||
time, and filter out terminal anchors that lead to a long gap towards the ends
|
||||
of a chain. These heuristics greatly alleviate the issues with misplaced
|
||||
anchors, but they are unable to fix all such errors. Local misalignment is a
|
||||
limitation of minimap2 which we hope to address in future.
|
||||
|
||||
\subsection{Aligning spliced sequences}
|
||||
|
||||
The algorithm described above can be adapted to spliced alignment. In this
|
||||
@@ -337,18 +425,24 @@ F_{i,j+1}= \max\{H_{ij}-q,F_{ij}\}-e\\
|
||||
\tilde{E}_{i+1,j}= \max\{H_{ij}-d(i)-\tilde{q},\tilde{E}_{ij}\}\\
|
||||
\end{array}\right.
|
||||
\end{equation}
|
||||
Let $T$ be the reference sequence. $d(i)$ is the cost of a non-canonical donor
|
||||
site, which takes 0 if $T[i+1,i+2]={\tt GT}$, or a positive number $p$
|
||||
otherwise. Similarly, $a(i)$ is the cost of a non-canonical acceptor site, which
|
||||
takes 0 if $T[i-1,i]={\tt AG}$, or $p$ otherwise. Eq.~(\ref{eq:splice}) is
|
||||
almost equivalent to the equation used by EXALIN~\citep{Zhang:2006aa} except
|
||||
that we allow insertions immediately followed by deletions and vice versa; in
|
||||
addition, we use Suzuki's diagonal formulation in actual implementation.
|
||||
|
||||
%Given that $d_i$ and $a_i$
|
||||
%are a function of the reference sequence, it is possible to incorporate
|
||||
%splicing signals with more sophisticated models, such as positional weight
|
||||
%matrices. We have not tried this approach.
|
||||
Let $T$ be the reference sequence. $d(i)$ is computed as
|
||||
\[d(i)=\left\{\begin{array}{ll}
|
||||
0 & \mbox{if $T[i+1,i+3]$ is ${\tt GTA}$ or ${\tt GTG}$} \\
|
||||
p/2 & \mbox{if $T[i+1,i+3]$ is ${\tt GTC}$ or ${\tt GTT}$} \\
|
||||
p & \mbox{otherwise}
|
||||
\end{array}\right.\]
|
||||
where $T[i,j]$ extracts a substring of $T$ between $i$ and $j$ inclusively.
|
||||
$d(i)$ penalizes non-canonical donor sites with $p$ and less frequent Eukaryotic
|
||||
splicing signal ${\tt GT[C/T]}$ with $p/2$~\citep{Irimia:2008aa}. Similarly,
|
||||
\[a(i)=\left\{\begin{array}{ll}
|
||||
0 & \mbox{if $T[i-2,i]$ is ${\tt CAG}$ or ${\tt TAG}$} \\
|
||||
p/2 & \mbox{if $T[i-2,i]$ is ${\tt AAG}$ or ${\tt GAG}$} \\
|
||||
p & \mbox{otherwise}
|
||||
\end{array}\right.\]
|
||||
models the acceptor signal. Eq.~(\ref{eq:splice}) is close to an equation in
|
||||
\citet{Zhang:2006aa} except that we allow insertions immediately followed by
|
||||
deletions and vice versa; in addition, we use the Suzuki-Kasahara diagonal
|
||||
formulation in actual implementation.
|
||||
|
||||
If RNA-seq reads are not sequenced from stranded libraries, the read strand
|
||||
relative to the underlying transcript is unknown. By default, minimap2 aligns
|
||||
@@ -360,18 +454,18 @@ reads that span canonical splicing sites.
|
||||
|
||||
In the spliced alignment mode, minimap2 further increases the density of
|
||||
minimizers and disables banded alignment. Together with the two-round DP-based
|
||||
alignment, spliced alignment is several times slower than DNA sequence
|
||||
alignment, spliced alignment is several times slower than genomic DNA
|
||||
alignment.
|
||||
|
||||
\subsection{Aligning short paired-end reads}
|
||||
|
||||
During chainging, minimap2 takes a pair of reads as one read with a gap of
|
||||
During chaining, minimap2 takes a pair of reads as one fragment with a gap of
|
||||
unknown length in the middle. It applies a normal gap cost between seeds on the
|
||||
same read but is a more permissive gap cost between seeds on different reads.
|
||||
More precisely, the gap cost during chaining is:
|
||||
More precisely, the gap cost during chaining is ($l\not=0$):
|
||||
\[
|
||||
\gamma_c(l)=\left\{\begin{array}{ll}
|
||||
0.01\cdot\bar{w}\cdot l+0.5\log_2 l & \mbox{if two seeds on the same read} \\
|
||||
0.01\cdot\bar{w}\cdot |l|+0.5\log_2 |l| & \mbox{if two seeds on the same read} \\
|
||||
\min\{0.01\cdot\bar{w}\cdot|l|,\log_2|l|\} & \mbox{otherwise}
|
||||
\end{array}\right.
|
||||
\]
|
||||
@@ -384,26 +478,40 @@ consistent paired-end alignments.
|
||||
|
||||
\section{Results}
|
||||
|
||||
\subsection{Aligning long genomic reads}
|
||||
Minimap2 is implemented in the C programming language and comes with APIs in
|
||||
both C and Python. It is distributed under the MIT license, free to both
|
||||
commercial and academic uses. Minimap2 uses the same base algorithm for all
|
||||
applications, but it has to apply different sets of parameters depending on
|
||||
input data types. Similar to BWA-MEM, minimap2 introduces `presets' that
|
||||
modify multiple parameters with a simple invocation. Detailed settings
|
||||
and command-line options can be found in the minimap2 manpage. In addition to
|
||||
the applications evaluated in the following sections, minimap2 also retains
|
||||
minimap's functionality to find overlaps between long reads and to search
|
||||
against large multi-species databases such as \emph{nt} from NCBI.
|
||||
|
||||
\subsection{Aligning long genomic reads}\label{sec:long-genomic}
|
||||
|
||||
\begin{figure}[!tb]
|
||||
\centering
|
||||
\includegraphics[width=.5\textwidth]{roc-color.pdf}
|
||||
\caption{Evaluation on aligning simulated reads. Simulated reads were mapped
|
||||
to the primary assembly of human genome GRCh38. A read is considered correctly
|
||||
mapped if the true position overlaps with the best mapping position by 10\% of
|
||||
the read length. Read alignments are sorted by mapping quality in the
|
||||
descending order. For each mapping quality threshold, the fraction of
|
||||
alignments with mapping quality above the threshold and their error rate are
|
||||
mapped if its longest alignment overlaps with the true interval, and the
|
||||
overlap length is $\ge$10\% of the true interval length. Read alignments are
|
||||
sorted by mapping quality in the descending order. For each mapping quality
|
||||
threshold, the fraction of alignments (out of the number of input reads) with
|
||||
mapping quality above the threshold and their error rate are
|
||||
plotted along the curve. (a) long-read alignment evaluation. 33,088 $\ge$1000bp
|
||||
reads were simulated using pbsim~\citep{Ono:2013aa} with error profile sampled
|
||||
from file `m131017\_060208\_42213\_*.1.*' downloaded at
|
||||
\href{http://bit.ly/chm1p5c3}{http://bit.ly/chm1p5c3}. The N50 read length is
|
||||
11,628. Aligners were run under the default setting for SMRT reads.
|
||||
(b) short-read alignment evaluation. 10 million pairs of 150bp reads were
|
||||
simulated using mason2~\citep{Holtgrewe:2010aa} with option
|
||||
`\mbox{--illumina-prob-mismatch-scale 2.5}'. Short-read aligners were run under the
|
||||
default setting except for changing the maximum fragment length to
|
||||
Kart outputted all alignments at mapping quality 60, so is not shown in the
|
||||
figure. It mapped nearly all reads with 4.1\% of alignments being wrong, less
|
||||
accurate than others. (b) short-read alignment evaluation. 10 million pairs of
|
||||
150bp reads were simulated using mason2~\citep{Holtgrewe:2010aa} with option
|
||||
`\mbox{--illumina-prob-mismatch-scale 2.5}'. Short-read aligners were run under
|
||||
the default setting except for changing the maximum fragment length to
|
||||
800bp.}\label{fig:eval}
|
||||
\end{figure}
|
||||
|
||||
@@ -412,22 +520,20 @@ BLASR~(v1.MC.rc64; \citealp{Chaisson:2012aa}),
|
||||
BWA-MEM~(v0.7.15; \citealp{Li:2013aa}),
|
||||
GraphMap~(v0.5.2; \citealp{Sovic:2016aa}),
|
||||
Kart~(v2.2.5; \citealp{Lin:2017aa}),
|
||||
minialign~(v0.5.3; \citealp{Suzuki:2016}) and
|
||||
minialign~(v0.5.3; \href{https://github.com/ocxtal/minialign}{https://github.com/ocxtal/minialign}) and
|
||||
NGMLR~(v0.2.5; \citealp{Sedlazeck169557}). We excluded rHAT~\citep{Liu:2016ab}
|
||||
and LAMSA~\citep{Liu:2017aa} because they either
|
||||
crashed or produced malformatted output. In this evaluation, minimap2 has
|
||||
higher power to distinguish unique and repetitive hits, and achieves overall
|
||||
higher mapping accuracy (Fig.~\ref{fig:eval}a). It is still the most accurate
|
||||
even if we skip DP-based alignment (data not shown), confirming chaining alone
|
||||
is sufficient to achieve high accuracy for approximate mapping. Minimap2 and
|
||||
higher mapping accuracy (Fig.~\ref{fig:eval}a). Minimap2 and
|
||||
NGMLR provide better mapping quality estimate: they rarely give repetitive hits
|
||||
high mapping quality. Apparently, other aligners may
|
||||
occasionally miss close suboptimal hits and be overconfident in wrong mappings.
|
||||
On run time, minialign is slightly faster than minimap2 and Kart. They are over
|
||||
30 times faster than the rest. Minimap2 consumed 6.1GB memory at the peak,
|
||||
more than BWA-MEM but less than others.
|
||||
On run time, minimap2 took 200 CPU seconds, comparable to minialign and Kart, and is over
|
||||
30 times faster than the rest. Minimap2 consumed 6.8GB memory at the peak,
|
||||
more than BWA-MEM (5.4GB), similar to NGMLR and less than others.
|
||||
|
||||
On real human SMRT reads, the relative performance and sensitivity of
|
||||
On real human SMRT reads, the relative performance and fraction of mapped reads reported by
|
||||
these aligners are broadly similar to the metrics on simulated data. We are
|
||||
unable to provide a good estimate of mapping error rate due to the lack of the
|
||||
truth. On ONT $\sim$100kb human reads~\citep{Jain128835}, BWA-MEM failed.
|
||||
@@ -440,16 +546,16 @@ to the 2-piece affine gap cost.
|
||||
\subsection{Aligning long spliced reads}
|
||||
|
||||
We evaluated minimap2 on SIRV control data~(AC:SRR5286959;
|
||||
\citealp{Byrne:2017aa}) where the truth is known. Minimap2 predicted 59\,916
|
||||
introns from 11\,017 reads. 93.0\% of splice juctions are precise. We examined
|
||||
\citealp{Byrne:2017aa}) where the truth is known. Minimap2 predicted 59\,918
|
||||
introns from 11\,018 reads. 93.8\% of splice juctions are precise. We examined
|
||||
wrongly predicted junctions and found the majority were caused by clustered
|
||||
splicing signals (e.g. two adjacent ${\tt GT}$ sites). When INDEL sequencing
|
||||
errors are frequent, it is difficult to find precise splicing sites in this
|
||||
case. If we allow up to 10bp distance from true splicing sites, 98.4\% of
|
||||
aligned introns are approximately correct. Given this observation, we might be
|
||||
able to improve boundary detection by initializing $d(\cdot)$ and $a(\cdot)$ in
|
||||
Eq.~(\ref{eq:splice}) with position-specific scoring matrices or more
|
||||
sophisticated models. We have not tried this approach.
|
||||
aligned introns are approximately correct. It is worth noting that for SIRV, we
|
||||
asked minimap2 to model the ${\tt GT..AG}$ splicing signal only without extra
|
||||
bases. This is because SIRV does not honor the evolutionarily prevalent signal
|
||||
${\tt GT[A/G]..[C/T]AG}$~\citep{Irimia:2008aa}.
|
||||
|
||||
\begin{table}[!tb]
|
||||
\processtable{Evaluation of junction accuracy on 2D ONT reads}
|
||||
@@ -460,16 +566,16 @@ sophisticated models. We have not tried this approach.
|
||||
\midrule
|
||||
Run time (CPU min) & 631 & 15.9 & 2\,076 & 33.9 \\
|
||||
Peak RAM (GByte) & 8.9 & 14.5 & 3.2 & 29.2\vspace{1em}\\
|
||||
\# aligned reads & 103\,669 & 104\,200 & 103\,711 & 26\,479 \\
|
||||
\# aligned reads & 103\,669 & 104\,199 & 103\,711 & 26\,479 \\
|
||||
\# chimeric alignments & 1\,904 & 1\,488 & 0 & 0 \\
|
||||
\# non-spliced alignments & 15\,854 & 14\,639 & 17\,033 & 10\,545\vspace{1em}\\
|
||||
\# aligned introns & 692\,275 & 694\,103 & 692\,945 & 78\,603 \\
|
||||
\# novel introns & 11\,239 & 3\,207 & 8\,550 & 1\,214 \\
|
||||
\% exact introns & 83.8\% & 91.7\% & 87.9\% & 55.2\% \\
|
||||
\% approx. introns & 91.8\% & 96.5\% & 92.5\% & 82.4\% \\
|
||||
\# non-spliced alignments & 15\,854 & 14\,798 & 17\,033 & 10\,545\vspace{1em}\\
|
||||
\# aligned introns & 692\,275 & 693\,553 & 692\,945 & 78\,603 \\
|
||||
\# novel introns & 11\,239 & 3\,113 & 8\,550 & 1\,214 \\
|
||||
\% exact introns & 83.8\% & 94.0\% & 87.9\% & 55.2\% \\
|
||||
\% approx. introns & 91.8\% & 96.9\% & 92.5\% & 82.4\% \\
|
||||
\botrule
|
||||
\end{tabular}
|
||||
}{Mouse reads (AC:SRR5286960) were mapped to the primary assembly of mouse
|
||||
}{Mouse cDNA reads (AC:SRR5286960; R9.4 chemistry) were mapped to the primary assembly of mouse
|
||||
genome GRCm38 with the following tools and command options: minimap2 (`-ax
|
||||
splice'); GMAP (`-n 0 --min-intronlength 30 --cross-species'); SpAln (`-Q7 -LS
|
||||
-S3'); STARlong (according to
|
||||
@@ -478,7 +584,7 @@ compared to the EnsEMBL gene annotation, release 89. A predicted intron
|
||||
is \emph{novel} if it has no overlaps with any annotated introns. An intron
|
||||
is \emph{exact} if it is identical to an annotated intron. An intron is
|
||||
\emph{approximate} if both its 5'- and 3'-end are within 10bp around the ends
|
||||
of an annotated intron.}
|
||||
of an annotated intron. Chimeric alignments are defined in the SAM spec~\citep{Li:2009ys}.}
|
||||
\end{table}
|
||||
|
||||
We next aligned real mouse reads~\citep{Byrne:2017aa} with GMAP~(v2017-06-20;
|
||||
@@ -487,10 +593,20 @@ STAR~(v2.5.3a; \citealp{Dobin:2013kx}). In general, minimap2 is more
|
||||
consistent with existing annotations (Table~\ref{tab:intron}): it finds
|
||||
more junctions with a higher percentage being exactly or approximately correct.
|
||||
Minimap2 is over 40 times faster than GMAP and SpAln. While STAR is close to
|
||||
minimap2 in speed, it does not work well with noisy reads. We have also
|
||||
evaluated spliced aligners on public Iso-Seq data (human Alzheimer brain
|
||||
from \href{http://bit.ly/isoseqpub}{http://bit.ly/isoseqpub}). The observation
|
||||
is similar: minimap2 is faster at higher junction accuracy.
|
||||
minimap2 in speed, it does not work well with noisy reads.
|
||||
|
||||
We have also evaluated spliced aligners on a human Nanopore Direct RNA-seq
|
||||
dataset (\href{http://bit.ly/na12878ont}{http://bit.ly/na12878ont}). Minimap2
|
||||
aligned 10 million reads in $<$1 wall-clock hour using 16 CPU cores. 94.2\% of
|
||||
aligned splice junctions consistent with gene annotations. In comparison,
|
||||
GMAP under option `-k 14 -n 0 --min-intronlength 30 --cross-species' is 160
|
||||
times slower; 68.7\% of GMAP junctions are found in known gene annotations. The
|
||||
percentage increases to 84.1\% if an aligned junction within 10bp from an
|
||||
annotated junction is considered to be correct. On a public Iso-Seq dataset
|
||||
(human Alzheimer brain from
|
||||
\href{http://bit.ly/isoseqpub}{http://bit.ly/isoseqpub}), minimap2 is also
|
||||
faster at higher junction accuracy in comparison to other aligners in
|
||||
Table~\ref{tab:intron}.
|
||||
|
||||
We noted that GMAP and SpAln have not been optimized for noisy reads. We are
|
||||
showing the best setting we have experimented, but their developers should be
|
||||
@@ -518,33 +634,90 @@ able to improve their accuracy further.
|
||||
|
||||
\subsection{Aligning short genomic reads}
|
||||
|
||||
We evaluated minimap2 along with Bowtie2~\citep{Langmead:2012fk}, BWA-MEM and
|
||||
SNAP~\citep{Zaharia:2011aa}. Minimap2 is 3--4 times as fast as Bowtie2 and
|
||||
We evaluated minimap2 along with Bowtie2~(v2.3.3; \citealt{Langmead:2012fk}), BWA-MEM and
|
||||
SNAP (v1.0beta23; \citealt{Zaharia:2011aa}). Minimap2 is 3--4 times as fast as Bowtie2 and
|
||||
BWA-MEM, but is 1.3 times slower than SNAP. Minimap2 is more accurate on this
|
||||
simulated data set than Bowtie2 and SNAP but less accurate than BWA-MEM
|
||||
(Fig.~\ref{fig:eval}b). Closer investigation reveals that BWA-MEM achieves
|
||||
a higher accuracy partly because it tries to locally align a read in a small
|
||||
region close to its mate. If we disable this feature, BWA-MEM becomes slightly
|
||||
less accurate than minimap2. We might consider to implement a similar heuristic
|
||||
less accurate than minimap2. We might implement a similar heuristic
|
||||
in minimap2 in future.
|
||||
|
||||
\section{Conclusion}
|
||||
To evaluate the accuracy of minimap2 on real data, we aligned human reads
|
||||
(AC:ERR1341796) with BWA-MEM and minimap2, and called SNPs and small INDELs
|
||||
with GATK HaplotypeCaller v3.5~\citep{Depristo:2011vn}. This run was sequenced
|
||||
from experimentally mixed CHM1 and CHM13 cell lines. Both of them are homozygous
|
||||
across the whole genome and have been \emph{de novo} assembled with SMRT reads
|
||||
to high quality. This allowed us to construct an independent truth variant
|
||||
dataset~\citep{Li223297} for
|
||||
ERR1341796. In this evaluation, minimap2 has higher SNP false negative rate
|
||||
(FNR; 2.6\% of minimap2 vs 2.3\% of BWA-MEM), but fewer false positive SNPs per
|
||||
million bases (FPPM; 7.0 vs 8.8), similar INDEL FNR (11.2\% vs 11.3\%) and
|
||||
similar INDEL FPPM (6.4 vs 6.5). Minimap2 is broadly comparable to BWA-MEM in the
|
||||
context of small variant calling.
|
||||
|
||||
Minimap2 is a fast, accurate and versatile aligner for long nucleotide
|
||||
sequences. In addition to reference-based read mapping, minimap2 inherits
|
||||
minimap's functionality to search against huge multi-species databases and to
|
||||
find read overlaps. On a few test data sets, minimap2 appears to yield slightly
|
||||
better miniasm assembly~\citep{Li:2016aa}. Minimap2 can also align similar
|
||||
genomes or different assemblies of the same species. However, full-genome
|
||||
alignment is an intricate research topic. More thorough evaluations would be
|
||||
necessary to justify the use of minimap2 for such applications.
|
||||
\subsection{Aligning long-read assemblies}
|
||||
|
||||
Minimap2 can align a SMRT assembly (AC:GCA\_001297185.1) against GRCh38 in 7
|
||||
minutes using 8 CPU cores, over 20 times faster than nucmer from
|
||||
MUMmer4~\citep{Marcais:2018aa}. With the paftools.js script from the minimap2
|
||||
package, we called 2.67 million single-base substitutions out of 2.78Gbp
|
||||
genomic regions. The transition-to-transversion ratio (ts/tv) is 2.01. In
|
||||
comparison, using MUMmer4's dnadiff pipeline, we called 2.86 million
|
||||
substitutions in 2.83Gbp at ts/tv=1.87. Given that ts/tv averaged across the
|
||||
human genome is about 2 but ts/tv averaged over random errors is 0.5, the
|
||||
minimap2 callset arguably has higher precision at lower sensitivity.
|
||||
|
||||
The sample being assembled is a female. Minimap2 still called 201 substitutions
|
||||
on the Y chromosome. These substitutions all come from one contig aligned at
|
||||
96.8\% sequence identity. The contig could be a segmental duplication
|
||||
absent from GRCh38. In constrast, dnadiff called 9070 substitutions on the Y
|
||||
chromosome across 73 SMRT contigs. This again implies our minimap2-based
|
||||
pipeline has higher precision.
|
||||
|
||||
\section{Discussions}
|
||||
|
||||
Minimap2 is a versatile mapper and pairwise aligner for nucleotide sequences.
|
||||
It works with short reads, assembly contigs and long noisy genomic and RNA-seq
|
||||
reads, and can be used as a read mapper, long-read overlapper or a full-genome
|
||||
aligner. Minimap2 is also accurate and efficient, often outperforming other
|
||||
domain-specific alignment tools in terms of both speed and accuracy.
|
||||
|
||||
The capability of minimap2 comes from a fast base-level alignment algorithm and
|
||||
an accurate chaining algorithm. When aligning long query sequences, base-level
|
||||
alignment is often the performance bottleneck. The Suzuki-Kasahara algorithm
|
||||
greatly alleviates the bottleneck and enables DP-based splice alignment
|
||||
involving $>$100kb introns, which was impractically slow ten years ago. The
|
||||
minimap2 chaining algorithm is fast and highly accurate by itself. In fact,
|
||||
chaining alone is more accurate than all the other long-read mappers in
|
||||
Fig.~\ref{fig:eval}a (data not shown). This accuracy helps to reduce downstream
|
||||
base-level alignment of candidate chains, which is still several times slower than
|
||||
chaining even with the Suzuki-Kasahara improvement. In addition, taking a
|
||||
general form, minimap2 chaining can be adapted to non-typical data types such as
|
||||
spliced reads and multiple reads per fragment. This gives us the opportunity to
|
||||
extend the same base algorithm to a variety of use cases.
|
||||
|
||||
Modern mainstream aligners often use a full-text index, such as suffix array or
|
||||
FM-index, to index reference sequences. An advantage of this approach is that
|
||||
we can use exact seeds of arbitrary lengths, which helps to increase seed
|
||||
uniqueness and reduce unsuccessful extensions. Minimap2 indexes reference
|
||||
k-mers with a hash table instead. Such fixed-length seeds are inferior to
|
||||
variable-length seeds in theory, but can be computed much more efficiently in
|
||||
practice. When a query sequence has multiple seed hits, we can afford to skip
|
||||
highly repetitive seeds without affecting the final accuracy. This further
|
||||
alleviates the concern with the seeding uniqueness. At the same time, at low
|
||||
sequence identity, it is rare to see long seeds anyway. Hash table is the ideal
|
||||
data structure for mapping long noisy sequences.
|
||||
|
||||
\section*{Acknowledgements}
|
||||
We owe a debt of gratitude to Hajime Suzuki for releasing his masterpiece and
|
||||
insightful notes before formal publication. We thank M. Schatz, P. Rescheneder
|
||||
and F. Sedlazeck for pointing out the limitation of BWA-MEM. We are also
|
||||
grateful to early minimap2 testers who have greatly helped to suggest features
|
||||
and to fix various issues.
|
||||
We owe a debt of gratitude to H. Suzuki and M. Kasahara for releasing their
|
||||
masterpiece and insightful notes before formal publication. We thank M.
|
||||
Schatz, P. Rescheneder and F. Sedlazeck for pointing out the limitation of
|
||||
BWA-MEM. We are also grateful to minimap2 users who have greatly helped to
|
||||
suggest features and to fix various issues.
|
||||
|
||||
\paragraph{Funding\textcolon} NHGRI 1R01HG010040-01
|
||||
|
||||
\bibliography{minimap2}
|
||||
|
||||
|
||||
+61
-59
@@ -1,60 +1,62 @@
|
||||
Q 60 18345673 8 0.000000436 18345673
|
||||
Q 59 33966 4 0.000000653 18379639
|
||||
Q 58 34178 1 0.000000706 18413817
|
||||
Q 56 49138 1 0.000000758 18462955
|
||||
Q 54 22442 4 0.000000974 18485397
|
||||
Q 53 19070 2 0.000001081 18504467
|
||||
Q 52 14169 3 0.000001242 18518636
|
||||
Q 51 13233 4 0.000001457 18531869
|
||||
Q 50 12133 2 0.000001564 18544002
|
||||
Q 49 11138 4 0.000001778 18555140
|
||||
Q 48 11174 8 0.000002208 18566314
|
||||
Q 47 17139 4 0.000002422 18583453
|
||||
Q 46 20428 10 0.000002956 18603881
|
||||
Q 45 16503 3 0.000003115 18620384
|
||||
Q 44 11933 6 0.000003435 18632317
|
||||
Q 43 25392 11 0.000004020 18657709
|
||||
Q 42 16734 9 0.000004498 18674443
|
||||
Q 41 13826 10 0.000005030 18688269
|
||||
Q 40 13023 10 0.000005561 18701292
|
||||
Q 39 12686 10 0.000006092 18713978
|
||||
Q 38 17275 4 0.000006300 18731253
|
||||
Q 37 17241 2 0.000006401 18748494
|
||||
Q 36 12458 12 0.000007036 18760952
|
||||
Q 35 11981 5 0.000007298 18772933
|
||||
Q 34 12004 11 0.000007879 18784937
|
||||
Q 33 12111 7 0.000008246 18797048
|
||||
Q 32 11782 9 0.000008719 18808830
|
||||
Q 31 11811 7 0.000009086 18820641
|
||||
Q 30 33507 32 0.000010767 18854148
|
||||
Q 29 11243 21 0.000011874 18865391
|
||||
Q 28 10779 17 0.000012767 18876170
|
||||
Q 27 15733 24 0.000014027 18891903
|
||||
Q 26 16762 40 0.000016130 18908665
|
||||
Q 25 13811 49 0.000018708 18922476
|
||||
Q 24 14141 46 0.000021123 18936617
|
||||
Q 23 13429 55 0.000024010 18950046
|
||||
Q 22 13116 26 0.000025365 18963162
|
||||
Q 21 13436 46 0.000027771 18976598
|
||||
Q 20 13441 55 0.000030648 18990039
|
||||
Q 19 12988 53 0.000033416 19003027
|
||||
Q 18 13353 51 0.000036074 19016380
|
||||
Q 17 13782 77 0.000040094 19030162
|
||||
Q 16 14065 94 0.000045001 19044227
|
||||
Q 15 14044 124 0.000051474 19058271
|
||||
Q 14 14714 140 0.000058774 19072985
|
||||
Q 13 17459 197 0.000069040 19090444
|
||||
Q 12 17339 259 0.000082532 19107783
|
||||
Q 11 17381 280 0.000097097 19125164
|
||||
Q 10 17732 295 0.000112418 19142896
|
||||
Q 9 17959 416 0.000134023 19160855
|
||||
Q 8 18234 530 0.000161530 19179089
|
||||
Q 7 19048 514 0.000188143 19198137
|
||||
Q 6 19722 656 0.000222085 19217859
|
||||
Q 5 19753 775 0.000262143 19237612
|
||||
Q 4 19818 1030 0.000315359 19257430
|
||||
Q 3 17088 1100 0.000372149 19274518
|
||||
Q 2 43045 6708 0.000718569 19317563
|
||||
Q 1 126377 25255 0.002012761 19443940
|
||||
Q 0 554357 372087 0.020562901 19998297
|
||||
Q 60 18579866 27 0.000001453 18579866
|
||||
Q 59 27087 4 0.000001666 18606953
|
||||
Q 58 21435 1 0.000001718 18628388
|
||||
Q 57 45663 3 0.000001874 18674051
|
||||
Q 56 36031 2 0.000001978 18710082
|
||||
Q 55 18499 2 0.000002082 18728581
|
||||
Q 54 14754 2 0.000002187 18743335
|
||||
Q 53 25541 2 0.000002291 18768876
|
||||
Q 52 26397 5 0.000002554 18795273
|
||||
Q 51 15090 3 0.000002711 18810363
|
||||
Q 50 13425 11 0.000003294 18823788
|
||||
Q 49 15175 2 0.000003397 18838963
|
||||
Q 48 19407 4 0.000003606 18858370
|
||||
Q 47 11538 16 0.000004452 18869908
|
||||
Q 46 12558 17 0.000005349 18882466
|
||||
Q 45 40362 28 0.000006817 18922828
|
||||
Q 44 10465 13 0.000007500 18933293
|
||||
Q 43 10098 20 0.000008552 18943391
|
||||
Q 42 10682 19 0.000009549 18954073
|
||||
Q 41 9823 11 0.000010125 18963896
|
||||
Q 40 9685 16 0.000010963 18973581
|
||||
Q 39 10273 18 0.000011905 18983854
|
||||
Q 38 9515 18 0.000012847 18993369
|
||||
Q 37 9474 27 0.000014261 19002843
|
||||
Q 36 10430 25 0.000015568 19013273
|
||||
Q 35 9241 34 0.000017348 19022514
|
||||
Q 34 9162 31 0.000018968 19031676
|
||||
Q 33 10164 49 0.000021532 19041840
|
||||
Q 32 9152 55 0.000024408 19050992
|
||||
Q 31 9252 35 0.000026233 19060244
|
||||
Q 30 9872 55 0.000029103 19070116
|
||||
Q 29 8938 65 0.000032496 19079054
|
||||
Q 28 8951 73 0.000036306 19088005
|
||||
Q 27 9949 95 0.000041261 19097954
|
||||
Q 26 9784 97 0.000046316 19107738
|
||||
Q 25 10126 97 0.000051366 19117864
|
||||
Q 24 11260 123 0.000057765 19129124
|
||||
Q 23 10047 114 0.000063691 19139171
|
||||
Q 22 9661 123 0.000070083 19148832
|
||||
Q 21 10339 168 0.000078813 19159171
|
||||
Q 20 17928 193 0.000088804 19177099
|
||||
Q 19 9842 193 0.000098817 19186941
|
||||
Q 18 14737 247 0.000111605 19201678
|
||||
Q 17 10218 238 0.000123934 19211896
|
||||
Q 16 10271 242 0.000136457 19222167
|
||||
Q 15 12241 333 0.000153683 19234408
|
||||
Q 14 9189 336 0.000171070 19243597
|
||||
Q 13 9493 515 0.000197734 19253090
|
||||
Q 12 11502 743 0.000236185 19264592
|
||||
Q 11 8211 507 0.000262390 19272803
|
||||
Q 10 9133 606 0.000293695 19281936
|
||||
Q 9 10014 931 0.000341801 19291950
|
||||
Q 8 8436 698 0.000377816 19300386
|
||||
Q 7 8443 705 0.000414163 19308829
|
||||
Q 6 10203 944 0.000462808 19319032
|
||||
Q 5 6936 756 0.000501760 19325968
|
||||
Q 4 6732 843 0.000545190 19332700
|
||||
Q 3 8215 1104 0.000602040 19340915
|
||||
Q 2 21201 5440 0.000882342 19362116
|
||||
Q 1 82328 22186 0.002019600 19444444
|
||||
Q 0 553853 371953 0.020562901 19998297
|
||||
U 1703
|
||||
|
||||
+12
-30
@@ -1,30 +1,12 @@
|
||||
Q 60 32066 0 0.000000000
|
||||
Q 40 32 1 0.000031155
|
||||
Q 38 19 1 0.000062272
|
||||
Q 36 11 1 0.000093376
|
||||
Q 35 32 1 0.000124378
|
||||
Q 33 15 1 0.000155400
|
||||
Q 32 58 1 0.000186145
|
||||
Q 27 11 1 0.000217095
|
||||
Q 26 80 1 0.000247494
|
||||
Q 21 19 2 0.000309186
|
||||
Q 20 16 1 0.000339936
|
||||
Q 19 19 1 0.000370622
|
||||
Q 18 22 2 0.000432099
|
||||
Q 17 37 5 0.000585751
|
||||
Q 15 24 2 0.000646930
|
||||
Q 14 18 3 0.000738939
|
||||
Q 13 30 6 0.000922821
|
||||
Q 12 18 1 0.000953054
|
||||
Q 11 29 2 0.001013638
|
||||
Q 10 30 1 0.001043393
|
||||
Q 9 20 5 0.001196099
|
||||
Q 8 25 8 0.001440348
|
||||
Q 7 28 6 0.001622830
|
||||
Q 6 35 12 0.001988132
|
||||
Q 5 34 12 0.002352725
|
||||
Q 4 29 8 0.002594865
|
||||
Q 3 36 14 0.003018937
|
||||
Q 2 46 15 0.003471482
|
||||
Q 1 69 36 0.004558162
|
||||
Q 0 167 94 0.007377173
|
||||
Q 60 32084 0 0.000000000 32084
|
||||
Q 24 318 2 0.000061725 32402
|
||||
Q 11 98 2 0.000123077 32500
|
||||
Q 8 37 2 0.000184405 32537
|
||||
Q 7 37 3 0.000276294 32574
|
||||
Q 6 40 3 0.000367940 32614
|
||||
Q 5 34 2 0.000428816 32648
|
||||
Q 4 37 5 0.000581306 32685
|
||||
Q 3 28 6 0.000764222 32713
|
||||
Q 2 38 6 0.000946536 32751
|
||||
Q 1 50 21 0.001585318 32801
|
||||
Q 0 286 150 0.006105117 33087
|
||||
|
||||
+12
-8
@@ -1,9 +1,13 @@
|
||||
Q 60 32226 0 0.000000000 32226
|
||||
Q 20 267 1 0.000030776 32493
|
||||
Q 10 34 1 0.000061487 32527
|
||||
Q 9 118 1 0.000091898 32645
|
||||
Q 5 27 2 0.000153036 32672
|
||||
Q 4 68 2 0.000213806 32740
|
||||
Q 1 314 101 0.003267381 33054
|
||||
Q 60 32477 0 0.000000000 32477
|
||||
Q 22 16 1 0.000030776 32493
|
||||
Q 21 44 1 0.000061468 32537
|
||||
Q 19 73 1 0.000091996 32610
|
||||
Q 14 66 1 0.000122414 32676
|
||||
Q 10 26 3 0.000214054 32702
|
||||
Q 8 14 1 0.000244529 32716
|
||||
Q 7 13 2 0.000305539 32729
|
||||
Q 6 47 1 0.000335611 32776
|
||||
Q 3 10 1 0.000366010 32786
|
||||
Q 2 20 2 0.000426751 32806
|
||||
Q 1 248 94 0.003267381 33054
|
||||
Q 0 31 17 0.003778147 33085
|
||||
U 3
|
||||
|
||||
Reference in New Issue
Block a user