Release minimap2-2.9 (r720)

When aligning long reads, we would prefer to align through low-quality
regions. This requires a large Z-drop threshold. However, to find small
inversions, we need to use a small Z-drop. This commit address this
conflict with two Z-drop thresholds. When Z-drop exceeds the smaller
threshold, we perform a local alignment to check if there is a potential
inversion. If there is one, we break the alignment; otherwise we break
the alignment only if Z-drop excess the larger threshold.

This commit also fixes a bug that reported wrong coordinates when the
inversion is on the forward strand (#112).

.travis.yml

@@ -10,10 +10,6 @@ matrix:
       python: "2.7"
       before_install: pip install cython
       script: python setup.py build_ext
-    - language: python
-      python: "3.3"
-      before_install: pip install cython
-      script: python setup.py build_ext
     - language: python
       python: "3.5"
       before_install: pip install cython

Makefile

@@ -1,17 +1,24 @@
 CFLAGS=		-g -Wall -O2 -Wc++-compat
 CPPFLAGS=	-DHAVE_KALLOC
 INCLUDES=
-OBJS=		kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o index.o chain.o align.o hit.o map.o format.o pe.o ksw2_ll_sse.o
+OBJS=		kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o options.o index.o chain.o align.o hit.o map.o format.o pe.o esterr.o ksw2_ll_sse.o
 PROG=		minimap2
 PROG_EXTRA=	sdust minimap2-lite
 LIBS=		-lm -lz -lpthread
 
+ifeq ($(arm_neon),)
 ifeq ($(sse2only),)
 	OBJS+=ksw2_extz2_sse41.o ksw2_extd2_sse41.o ksw2_exts2_sse41.o ksw2_extz2_sse2.o ksw2_extd2_sse2.o ksw2_exts2_sse2.o ksw2_dispatch.o
 else
 	OBJS+=ksw2_extz2_sse.o ksw2_extd2_sse.o ksw2_exts2_sse.o
 endif
+else
+    OBJS+=ksw2_extz2_neon.o ksw2_extd2_neon.o ksw2_exts2_neon.o
+    CFLAGS+=-D_FILE_OFFSET_BITS=64 -mfpu=neon -fsigned-char
+    INCLUDES+=-I sse2neon
+endif
 
+.PHONY:all extra clean depend
 .SUFFIXES:.c .o
 
 .c.o:
@@ -33,6 +40,8 @@ libminimap2.a:$(OBJS)
 sdust:sdust.c getopt.o kalloc.o kalloc.h kdq.h kvec.h kseq.h sdust.h
 		$(CC) -D_SDUST_MAIN $(CFLAGS) $< getopt.o kalloc.o -o $@ -lz
 
+# SSE-specific targets on x86/x86_64
+
 ksw2_extz2_sse41.o:ksw2_extz2_sse.c ksw2.h kalloc.h
 		$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
 
@@ -54,8 +63,21 @@ ksw2_exts2_sse2.o:ksw2_exts2_sse.c ksw2.h kalloc.h
 ksw2_dispatch.o:ksw2_dispatch.c ksw2.h
 		$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
 
+# NEON-specific targets on ARM
+
+ksw2_extz2_neon.o:ksw2_extz2_sse.c ksw2.h kalloc.h
+		$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_SSE2_ONLY -D__SSE2__ $(INCLUDES) $< -o $@
+
+ksw2_extd2_neon.o:ksw2_extd2_sse.c ksw2.h kalloc.h
+		$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_SSE2_ONLY -D__SSE2__ $(INCLUDES) $< -o $@
+
+ksw2_exts2_neon.o:ksw2_exts2_sse.c ksw2.h kalloc.h
+		$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_SSE2_ONLY -D__SSE2__ $(INCLUDES) $< -o $@
+
+# other non-file targets
+
 clean:
-		rm -fr gmon.out *.o a.out $(PROG) $(PROG_EXTRA) *~ *.a *.dSYM build dist mappy.so mappy.c python/mappy.c mappy.egg*
+		rm -fr gmon.out *.o a.out $(PROG) $(PROG_EXTRA) *~ *.a *.dSYM build dist mappy*.so mappy.c python/mappy.c mappy.egg*
 
 depend:
 		(LC_ALL=C; export LC_ALL; makedepend -Y -- $(CFLAGS) $(CPPFLAGS) -- *.c)
@@ -65,6 +87,7 @@ depend:
 align.o: minimap.h mmpriv.h bseq.h ksw2.h kalloc.h
 bseq.o: bseq.h kvec.h kalloc.h kseq.h
 chain.o: minimap.h mmpriv.h bseq.h kalloc.h
+esterr.o: mmpriv.h minimap.h bseq.h
 example.o: minimap.h kseq.h
 format.o: kalloc.h mmpriv.h minimap.h bseq.h
 getopt.o: getopt.h
@@ -75,9 +98,12 @@ ksw2_extd2_sse.o: ksw2.h kalloc.h
 ksw2_exts2_sse.o: ksw2.h kalloc.h
 ksw2_extz2_sse.o: ksw2.h kalloc.h
 ksw2_ll_sse.o: ksw2.h kalloc.h
+kthread.o: kthread.h
 main.o: bseq.h minimap.h mmpriv.h getopt.h
 map.o: kthread.h kvec.h kalloc.h sdust.h mmpriv.h minimap.h bseq.h khash.h
-misc.o: minimap.h ksort.h
+map.o: ksort.h
+misc.o: mmpriv.h minimap.h bseq.h ksort.h
+options.o: mmpriv.h minimap.h bseq.h
 pe.o: mmpriv.h minimap.h bseq.h kvec.h kalloc.h ksort.h
 sdust.o: kalloc.h kdq.h kvec.h sdust.h
-sketch.o: kvec.h kalloc.h minimap.h
+sketch.o: kvec.h kalloc.h mmpriv.h minimap.h bseq.h

NEWS.md

@@ -1,3 +1,173 @@
+Release 2.9-r720 (23 February 2018)
+-----------------------------------
+
+This release fixed multiple minor bugs.
+
+* Fixed two bugs that lead to incorrect inversion alignment. Also improved the
+  sensitivity to small inversions by using double Z-drop cutoff (#112).
+
+* Fixed an issue that may cause the end of a query sequence unmapped (#104).
+
+* Added a mappy API to retrieve sequences from the index (#126) and to reverse
+  complement DNA sequences. Fixed a bug where the `best_n` parameter did not
+  work (#117).
+
+* Avoided segmentation fault given incorrect FASTQ input (#111).
+
+* Combined all auxiliary javascripts to paftools.js. Fixed several bugs in
+  these scripts at the same time.
+
+(2.9: 24 February 2018, r720)
+
+
+
+Release 2.8-r672 (1 February 2018)
+----------------------------------
+
+Notable changes in this release include:
+
+ * Speed up short-read alignment by ~10%. The overall mapping accuracy stays
+   the same, but the output alignments are not always identical to v2.7 due to
+   unstable sorting employed during chaining. Long-read alignment is not
+   affected by this change as the speedup is short-read specific.
+
+ * Mappy now supports paired-end short-read alignment (#87). Please see
+   python/README.rst for details.
+
+ * Added option --for-only and --rev-only to perform alignment against the
+   forward or the reverse strand of the reference genome only (#91).
+
+ * Alleviated the issue with undesired diagonal alignment in the self mapping
+   mode (#10). Even if the output is not ideal, it should not interfere with
+   other alignments. Fully resolving the issue is intricate and may require
+   additional heuristic thresholds.
+
+ * Enhanced error checking against incorrect input (#92 and #96).
+
+For long query sequences, minimap2 should output identical alignments to v2.7.
+
+(2.8: 1 February 2018, r672)
+
+
+
+Release 2.7-r654 (9 January 2018)
+---------------------------------
+
+This release fixed a bug in the splice mode and added a few minor features:
+
+ * Fixed a bug that occasionally takes an intron as a long deletion in the
+   splice mode. This was caused by wrong backtracking at the last CIGAR
+   operator. The current fix eliminates the error, but it is not optimal in
+   that it often produces a wrong junction when the last operator is an intron.
+   A future version of minimap2 may improve upon this.
+
+ * Support high-end ARM CPUs that implement the NEON instruction set (#81).
+   This enables minimap2 to work on Raspberry Pi 3 and Odroid XU4.
+
+ * Added a C API to construct a minimizer index from a set of C strings (#80).
+
+ * Check scoring specified on the command line (#79). Due to the 8-bit limit,
+   excessively large score penalties fail minimap2.
+
+For genomic sequences, minimap2 should give identical alignments to v2.6.
+
+(2.7: 9 January 2018, r654)
+
+
+
+Release 2.6-r623 (12 December 2017)
+-----------------------------------
+
+This release adds several features and fixes two minor bugs:
+
+ * Optionally build an index without sequences. This helps to reduce the
+   peak memory for read overlapping and is automatically applied when
+   base-level alignment is not requested.
+
+ * Approximately estimate per-base sequence divergence (i.e. 1-identity)
+   without performing base-level alignment, using a MashMap-like method. The
+   estimate is written to a new dv:f tag.
+
+ * Reduced the number of tiny terminal exons in RNA-seq alignment. The current
+   setting is conservative. Increase --end-seed-pen to drop more such exons.
+
+ * Reduced the peak memory when aligning long query sequences.
+
+ * Fixed a bug that is caused by HPC minimizers longer than 256bp. This should
+   have no effect in practice, but it is recommended to rebuild HPC indices if
+   possible.
+
+ * Fixed a bug when identifying identical hits (#71). This should only affect
+   artifactual reference consisting of near identical sequences.
+
+For genomic sequences, minimap2 should give nearly identical alignments to
+v2.5, except the new dv:f tag.
+
+(2.6: 12 December 2017, r623)
+
+
+
+Release 2.5-r572 (11 November 2017)
+-----------------------------------
+
+This release fixes several bugs and brings a couple of minor improvements:
+
+ * Fixed a severe bug that leads to incorrect mapping coordinates in rare
+   corner cases.
+
+ * Fixed underestimated mapping quality for chimeric alignments when the whole
+   query sequence contain many repetitive minimizers, and for chimeric
+   alignments caused by Z-drop.
+
+ * Fixed two bugs in Python binding: incorrect strand field (#57) and incorrect
+   sequence names for Python3 (#55).
+
+ * Improved mapping accuracy for highly overlapping paired ends.
+
+ * Added option -Y to use soft clipping for supplementary alignments (#56).
+
+(2.5: 11 November 2017, r572)
+
+
+
+Release 2.4-r555 (6 November 2017)
+----------------------------------
+
+As is planned, this release focuses on fine tuning the base algorithm. Notable
+changes include
+
+ * Changed the mapping quality scale to match the scale of BWA-MEM. This makes
+   minimap2 and BWA-MEM achieve similar sensitivity-specificity balance on real
+   short-read data.
+
+ * Improved the accuracy of splice alignment by modeling one additional base
+   close to the GT-AG signal. This model is used by default with `-x splice`.
+   For SIRV control data, however, it is recommended to add `--splice-flank=no`
+   to disable this feature as the SIRV splice signals are slightly different.
+
+ * Tuned the parameters for Nanopore Direct RNA reads. The recommended command
+   line is `-axsplice -k14 -uf` (#46).
+
+ * Fixed a segmentation fault when aligning PacBio reads (#47 and #48). This
+   bug is very rare but it affects all versions of minimap2. It is also
+   recommended to re-index reference genomes created with `map-pb`. For human,
+   two minimizers in an old index are wrong.
+
+ * Changed option `-L` in sync with the final decision of hts-specs: a fake
+   CIGAR takes the form of `<readLen>S<refLen>N`. Note that `-L` only enables
+   future tools to recognize long CIGARs. It is not possible for older tools to
+   work with such alignments in BAM (#43 and #51).
+
+ * Fixed a tiny issue whereby minimap2 may waste 8 bytes per candidate
+   alignment.
+
+The minimap2 technical note hosted at arXiv has also been updated to reflect
+recent changes.
+
+(2.4: 6 November 2017, r555)
+
+
+
 Release 2.3-r531 (22 October 2017)
 ----------------------------------
 
@@ -26,7 +196,7 @@ This release come with many improvements and bug fixes:
 
 This release has implemented all the major features I planned five months ago,
 with the addition of spliced long-read alignment. The next couple of releases
-will focus on fine tuning of base algorithms.
+will focus on fine tuning of the base algorithms.
 
 (2.3: 22 October 2017, r531)
 

README.md

@@ -1,23 +1,25 @@
-[![Release](https://img.shields.io/badge/Release-v2.3-blue.svg?style=flat)](https://github.com/lh3/minimap2/releases)
+[![GitHub Downloads](https://img.shields.io/github/downloads/lh3/minimap2/total.svg?style=social&logo=github&label=Download)](https://github.com/lh3/minimap2/releases)
-[![BioConda](https://img.shields.io/conda/vn/bioconda/minimap2.svg?style=flat)](https://anaconda.org/bioconda/minimap2)
+[![BioConda Install](https://img.shields.io/conda/dn/bioconda/minimap2.svg?style=flag&label=BioConda%20install)](https://anaconda.org/bioconda/minimap2)
 [![PyPI](https://img.shields.io/pypi/v/mappy.svg?style=flat)](https://pypi.python.org/pypi/mappy)
-[![Python Version](https://img.shields.io/pypi/pyversions/mappy.svg?style=flat)](https://pypi.python.org/pypi/mappy)
-[![License](https://img.shields.io/badge/License-MIT-blue.svg?style=flat)](LICENSE.txt)
 [![Build Status](https://travis-ci.org/lh3/minimap2.svg?branch=master)](https://travis-ci.org/lh3/minimap2)
-[![Downloads](https://img.shields.io/github/downloads/lh3/minimap2/total.svg?style=flat)](https://github.com/lh3/minimap2/releases)
 ## <a name="started"></a>Getting Started
 ```sh
 git clone https://github.com/lh3/minimap2
 cd minimap2 && make
-# long reads against a reference genome
+# long sequences against a reference genome
 ./minimap2 -a test/MT-human.fa test/MT-orang.fa > test.sam
 # create an index first and then map
 ./minimap2 -d MT-human.mmi test/MT-human.fa
 ./minimap2 -a MT-human.mmi test/MT-orang.fa > test.sam
-# long-read overlap (no test data)
+# use presets (no test data)
-./minimap2 -x ava-pb your-reads.fa your-reads.fa > overlaps.paf
+./minimap2 -ax map-pb ref.fa pacbio.fq.gz > aln.sam       # PacBio genomic reads
-# spliced alignment (no test data)
+./minimap2 -ax map-ont ref.fa ont.fq.gz > aln.sam         # Oxford Nanopore genomic reads
-./minimap2 -ax splice ref.fa rna-seq-reads.fa > spliced.sam
+./minimap2 -ax sr ref.fa read1.fa read2.fa > aln.sam      # short genomic paired-end reads
+./minimap2 -ax splice ref.fa rna-reads.fa > aln.sam       # spliced long reads
+./minimap2 -ax splice -k14 -uf ref.fa reads.fa > aln.sam  # Nanopore Direct RNA-seq
+./minimap2 -cx asm5 asm1.fa asm2.fa > aln.paf             # intra-species asm-to-asm alignment
+./minimap2 -x ava-pb reads.fa reads.fa > overlaps.paf     # PacBio read overlap
+./minimap2 -x ava-ont reads.fa reads.fa > overlaps.paf    # Nanopore read overlap
 # man page for detailed command line options
 man ./minimap2.1
 ```
@@ -34,9 +36,9 @@ man ./minimap2.1
     - [Map short accurate genomic reads](#short-genomic)
     - [Full genome/assembly alignment](#full-genome)
   - [Advanced features](#advanced)
-    - [Working CIGARs with >65535 operations](#long-cigar)
+    - [Working with >65535 CIGAR operations](#long-cigar)
     - [The cs optional tag](#cs)
-    - [Evaluation scripts](#eval)
+    - [Working with the PAF format](#paftools)
   - [Algorithm overview](#algo)
   - [Getting help](#help)
   - [Citing minimap2](#cite)
@@ -63,18 +65,21 @@ Detailed evaluations are available from the [minimap2 preprint][preprint].
 
 ### <a name="install"></a>Installation
 
-Minimap2 only works on x86-64 CPUs. You can acquire precompiled binaries from
+Minimap2 is optimized for x86-64 CPUs. You can acquire precompiled binaries from
 the [release page][release] with:
 ```sh
-wget --no-check-certificate -O- https://github.com/lh3/minimap2/releases/download/v2.2/minimap2-2.2_x64-linux.tar.bz2 \
+curl -L https://github.com/lh3/minimap2/releases/download/v2.9/minimap2-2.9_x64-linux.tar.bz2 \
   | tar -jxvf -
-./minimap2-2.2_x64-linux/minimap2
+./minimap2-2.9_x64-linux/minimap2
 ```
 If you want to compile from the source, you need to have a C compiler, GNU make
 and zlib development files installed. Then type `make` in the source code
 directory to compile. If you see compilation errors, try `make sse2only=1`
 to disable SSE4 code, which will make minimap2 slightly slower.
 
+Minimap2 also works with ARM CPUs supporting the NEON instruction sets. To
+compile, use `make arm_neon=1`.
+
 ### <a name="general"></a>General usage
 
 Without any options, minimap2 takes a reference database and a query sequence
@@ -132,14 +137,44 @@ Nanopore reads.
 #### <a name="map-long-splice"></a>Map long mRNA/cDNA reads
 
 ```sh
-minimap2 -ax splice ref.fa spliced.fq > aln.sam      # strand unknown
+minimap2 -ax splice -uf ref.fa iso-seq.fq > aln.sam          # PacBio Iso-seq/traditional cDNA
-minimap2 -ax splice -uf ref.fa spliced.fq > aln.sam  # assuming transcript strand
+minimap2 -ax splice ref.fa nanopore-cdna.fa > aln.sam        # Nanopore 2D cDNA-seq
+minimap2 -ax splice -uf -k14 ref.fa direct-rna.fq > aln.sam  # Nanopore Direct RNA-seq
+minimap2 -ax splice --splice-flank=no SIRV.fa SIRV-seq.fa    # mapping against SIRV control
 ```
-This command line has been tested on PacBio Iso-Seq reads and Nanopore 2D cDNA
+There are different long-read RNA-seq technologies, including tranditional
-reads, and been shown to work with Nanopore 1D Direct RNA reads by others. Like
+full-length cDNA, EST, PacBio Iso-seq, Nanopore 2D cDNA-seq and Direct RNA-seq.
-typical RNA-seq mappers, minimap2 represents an intron with the `N` CIGAR
+They produce data of varying quality and properties. By default, `-x splice`
-operator. For spliced reads, minimap2 will try to infer the strand relative to
+assumes the read orientation relative to the transcript strand is unknown. It
-transcript and may write the strand to the `ts` SAM/PAF tag.
+tries two rounds of alignment to infer the orientation and write the strand to
+the `ts` SAM/PAF tag if possible. For Iso-seq, Direct RNA-seq and tranditional
+full-length cDNAs, it would be desired to apply `-u f` to force minimap2 to
+consider the forward transcript strand only. This speeds up alignment with
+slight improvement to accuracy. For noisy Nanopore Direct RNA-seq reads, it is
+recommended to use a smaller k-mer size for increased sensitivity to the first
+or the last exons.
+
+Minimap2 rates an alignment by the score of the max-scoring sub-segment,
+*excluding* introns, and marks the best alignment as primary in SAM. When a
+spliced gene also has unspliced pseudogenes, minimap2 does not intentionally
+prefer spliced alignment, though in practice it more often marks the spliced
+alignment as the primary. By default, minimap2 outputs up to five secondary
+alignments (i.e. likely pseudogenes in the context of RNA-seq mapping). This
+can be tuned with option **-N**.
+
+For long RNA-seq reads, minimap2 may produce chimeric alignments potentially
+caused by gene fusions/structural variations or by an intron longer than the
+max intron length **-G** (200k by default). For now, it is not recommended to
+apply an excessively large **-G** as this slows down minimap2 and sometimes
+leads to false alignments.
+
+It is worth noting that by default `-x splice` prefers GT[A/G]..[C/T]AG
+over GT[C/T]..[A/G]AG, and then over other splicing signals. Considering
+one additional base improves the junction accuracy for noisy reads, but
+reduces the accuracy when aligning against the widely used SIRV control data.
+This is because SIRV does not honor the evolutionarily conservative splicing
+signal. If you are studying SIRV, you may apply `--splice-flank=no` to let
+minimap2 only model GT..AG, ignoring the additional base.
 
 #### <a name="long-overlap"></a>Find overlaps between long reads
 
@@ -179,7 +214,7 @@ according to the sequence divergence.
 
 ### <a name="advanced"></a>Advanced features
 
-#### <a name="long-cigar"></a>Working CIGARs with >65535 operations
+#### <a name="long-cigar"></a>Working with >65535 CIGAR operations
 
 Due to a design flaw, BAM does not work with CIGAR strings with >65535
 operations (SAM and CRAM work). However, for ultra-long nanopore reads minimap2
@@ -191,10 +226,8 @@ To avoid this issue, you can add option `-L` at the minimap2 command line.
 This option moves a long CIGAR to the `CG` tag and leaves a fully clipped CIGAR
 at the SAM CIGAR column. Current tools that don't read CIGAR (e.g. merging and
 sorting) still work with such BAM records; tools that read CIGAR will
-effectively ignore these records. I have pull requests to the SAM spec, htslib,
+effectively ignore these records. It has been decided that future tools will
-htsjdk, bedtools2, Rsamtools and igv.js. If they are accepted, future versions
+will seamlessly recognize long-cigar records generated by option `-L`.
-of these tools will seamlessly recognize long-cigar records generated by option
-`-L`.
 
 **TD;DR**: if you work with ultra-long reads and use tools that only process
 BAM files, please add option `-L`.
@@ -223,26 +256,13 @@ the alignment. The above example will become
 `=CGATCG-ata=AATAGAGTAG+gtc=GAAT*at=GCA`. The long form of `cs` encodes both
 reference and query sequences in one string.
 
-#### <a name="eval"></a>Evaluation scripts
+#### <a name="paftools"></a>Working with the PAF format
 
-Minimap2 comes with several (java)scripts for evaluating the accuracy of
+Minimap2 also comes with a (java)script [paftools.js](misc/paftools.js) that
-minimap2. These scripts require the [k8][k8] javascript shell to run.
+processes alignments in the PAF format. It calls variants from
-Recent minimap2 binary release tar-balls contain a copy of k8 executable, a
+assembly-to-reference alignment, lifts over BED files based on alignment,
-single file. Here are a few examples on how to use these scripts:
+converts between formats and provides utilities for various evaluations. For
-
+details, please see [misc/README.md](misc/README.md).
-```sh
-# Generate reads from PBSIM alignment (truth encoded in read names)
-k8 misc/sim-pbsim.js ref.fa.fai pbsim-aln.maf > pbsim-reads.fq
-# Generate reads from mason2 alignment (not tested for simulated SVs)
-k8 misc/sim-mason2.js mason2-aln.sam > mason2-reads.fq
-# Evaluate mapping accuracy with ROC-like curve
-k8 misc/sim-eval.js my-aln.sam.gz > result.txt
-k8 misc/sim-eval.js my-aln.paf.gz > result.txt
-# Collect alignment statistics
-k8 misc/mapstat.js my-aln.sam > result.txt
-# Compare spliced junctions to existing gene annotations
-k8 misc/intron-eval.js anno.gtf my-spliced-aln.sam > result.txt
-```
 
 ### <a name="algo"></a>Algorithm overview
 
@@ -290,7 +310,7 @@ highlighted in bold. The description may help to tune minimap2 parameters.
 
 ### <a name="help"></a>Getting help
 
-Manpage [minimap2.1](minimap2.1) provides detailed description of minimap2
+Manpage [minimap2.1][manpage] provides detailed description of minimap2
 command line options and optional tags. If you encounter bugs or have further
 questions or requests, you can raise an issue at the [issue page][issue].
 There is not a specific mailing list for the time being.
@@ -322,12 +342,9 @@ mappy` or [from BioConda][mappyconda] via `conda install -c bioconda mappy`.
   regions where seed positions may be suboptimal. This should not be a big
   concern because even the optimal alignment may be wrong in such regions.
 
-* Minimap2 requires SSE2 instructions to compile. It is possible to add
+* Minimap2 requires SSE2 instructions on x86 CPUs or NEON on ARM CPUs. It is
-  non-SSE2 support, but it would make minimap2 slower by several times.
+  possible to add non-SIMD support, but it would make minimap2 slower by
-
+  several times.
-In general, minimap2 is a young project with most code written since June, 2017.
-It may have bugs and room for improvements. Bug reports and suggestions are
-warmly welcomed.
 
 
 
@@ -344,3 +361,4 @@ warmly welcomed.
 [mappyconda]: https://anaconda.org/bioconda/mappy
 [issue]: https://github.com/lh3/minimap2/issues
 [k8]: https://github.com/attractivechaos/k8
+[manpage]: https://lh3.github.io/minimap2/minimap2.html

align.c

@@ -1,6 +1,7 @@
 #include <assert.h>
 #include <string.h>
 #include <stdlib.h>
+#include <math.h>
 #include "minimap.h"
 #include "mmpriv.h"
 #include "ksw2.h"
@@ -27,39 +28,63 @@ static inline void mm_seq_rev(uint32_t len, uint8_t *seq)
 		t = seq[i], seq[i] = seq[len - 1 - i], seq[len - 1 - i] = t;
 }
 
-static inline int test_zdrop_aux(int32_t score, int i, int j, int32_t *max, int *max_i, int *max_j, int e, int zdrop)
+static inline void update_max_zdrop(int32_t score, int i, int j, int32_t *max, int *max_i, int *max_j, int e, int *max_zdrop, int pos[2][2])
 {
 	if (score < *max) {
 		int li = i - *max_i;
 		int lj = j - *max_j;
 		int diff = li > lj? li - lj : lj - li;
-		if (*max - score > zdrop + diff * e)
+		int z = *max - score - diff * e;
-			return 1;
+		if (z > *max_zdrop) {
+			*max_zdrop = z;
+			pos[0][0] = *max_i, pos[0][1] = i + 1;
+			pos[1][0] = *max_j, pos[1][1] = j + 1;
+		}
 	} else *max = score, *max_i = i, *max_j = j;
-	return 0;
 }
 
-static int mm_check_zdrop(const uint8_t *qseq, const uint8_t *tseq, uint32_t n_cigar, uint32_t *cigar, const int8_t *mat, int8_t q, int8_t e, int zdrop)
+static int mm_test_zdrop(void *km, const mm_mapopt_t *opt, const uint8_t *qseq, const uint8_t *tseq, uint32_t n_cigar, uint32_t *cigar, const int8_t *mat)
 {
 	uint32_t k;
-	int32_t score = 0, max = 0, max_i = -1, max_j = -1, i = 0, j = 0;
+	int32_t score = 0, max = INT32_MIN, max_i = -1, max_j = -1, i = 0, j = 0, max_zdrop = 0;
-	for (k = 0; k < n_cigar; ++k) {
+	int pos[2][2] = {{-1, -1}, {-1, -1}}, q_len, t_len;
+
+	// find the score and the region where score drops most along diagonal
+	for (k = 0, score = 0; k < n_cigar; ++k) {
 		uint32_t l, op = cigar[k]&0xf, len = cigar[k]>>4;
 		if (op == 0) {
 			for (l = 0; l < len; ++l) {
 				score += mat[tseq[i + l] * 5 + qseq[j + l]];
-				if (test_zdrop_aux(score, i+l, j+l, &max, &max_i, &max_j, e, zdrop)) return 1;
+				update_max_zdrop(score, i+l, j+l, &max, &max_i, &max_j, opt->e, &max_zdrop, pos);
 			}
 			i += len, j += len;
-		} else if (op == 1) {
+		} else if (op == 1 || op == 2 || op == 3) {
-			score -= q + e * len, j += len;
+			score -= opt->q + opt->e * len;
-			if (test_zdrop_aux(score, i, j, &max, &max_i, &max_j, e, zdrop)) return 1;
+			if (op == 1) j += len; // insertion
-		} else if (op == 2 || op == 3) {
+			else i += len;         // deletion
-			score -= q + e * len, i += len;
+			update_max_zdrop(score, i, j, &max, &max_i, &max_j, opt->e, &max_zdrop, pos);
-			if (test_zdrop_aux(score, i, j, &max, &max_i, &max_j, e, zdrop)) return 1;
 		}
 	}
-	return 0;
+
+	// test if there is an inversion in the most dropped region
+	q_len = pos[1][1] - pos[1][0], t_len = pos[0][1] - pos[0][0];
+	if (!(opt->flag&(MM_F_SPLICE|MM_F_SR|MM_F_FOR_ONLY|MM_F_REV_ONLY)) && max_zdrop > opt->zdrop_inv && q_len < opt->max_gap && t_len < opt->max_gap) {
+		uint8_t *qseq2;
+		void *qp;
+		int q_off, t_off;
+		qseq2 = (uint8_t*)kmalloc(km, q_len);
+		for (i = 0; i < q_len; ++i) {
+			int c = qseq[pos[1][1] - i - 1];
+			qseq2[i] = c >= 4? 4 : 3 - c;
+		}
+		qp = ksw_ll_qinit(km, 2, q_len, qseq2, 5, mat);
+		score = ksw_ll_i16(qp, t_len, tseq + pos[0][0], opt->q, opt->e, &q_off, &t_off);
+		kfree(km, qseq2);
+		kfree(km, qp);
+		if (score >= opt->min_chain_score * opt->a && score >= opt->min_dp_max)
+			return 2; // there is a potential inversion
+	}
+	return max_zdrop > opt->zdrop? 1 : 0;
 }
 
 static void mm_fix_cigar(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq, int *qshift, int *tshift)
@@ -110,14 +135,17 @@ static void mm_fix_cigar(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq,
 	}
 	if ((p->cigar[0]&0xf) == 1 || (p->cigar[0]&0xf) == 2) { // get rid of leading I or D
 		int32_t l = p->cigar[0] >> 4;
-		if ((p->cigar[0]&0xf) == 1) r->qs += l, *qshift = l;
+		if ((p->cigar[0]&0xf) == 1) {
-		else r->rs += l, *tshift = l;
+			if (r->rev) r->qe -= l;
+			else r->qs += l;
+			*qshift = l;
+		} else r->rs += l, *tshift = l;
 		--p->n_cigar;
 		memmove(p->cigar, p->cigar + 1, p->n_cigar * 4);
 	}
 }
 
-static void mm_update_extra(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *qual, const uint8_t *tseq, const int8_t *mat, int8_t q, int8_t e)
+static void mm_update_extra(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq, const int8_t *mat, int8_t q, int8_t e)
 {
 	uint32_t k, l, toff = 0, qoff = 0;
 	int32_t s = 0, max = 0, qshift, tshift;
@@ -130,27 +158,21 @@ static void mm_update_extra(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *qu
 		uint32_t op = p->cigar[k]&0xf, len = p->cigar[k]>>4;
 		if (op == 0) { // match/mismatch
 			int n_ambi = 0, n_diff = 0;
-			float n_diff2 = 0.0f;
 			for (l = 0; l < len; ++l) {
 				int cq = qseq[qoff + l], ct = tseq[toff + l];
 				if (ct > 3 || cq > 3) ++n_ambi;
-				else if (ct != cq) {
+				else if (ct != cq) ++n_diff;
-					++n_diff;
-					n_diff2 += qual == 0 || qual[qoff + l] >= 20? 1.0f : .05f * qual[qoff + l];
-				}
 				s += mat[ct * 5 + cq];
 				if (s < 0) s = 0;
 				else max = max > s? max : s;
 			}
 			r->blen += len - n_ambi, r->mlen += len - (n_ambi + n_diff), p->n_ambi += n_ambi;
-			p->n_diff2 += n_diff2, p->blen2 += len - n_ambi;
 			toff += len, qoff += len;
 		} else if (op == 1) { // insertion
 			int n_ambi = 0;
 			for (l = 0; l < len; ++l)
 				if (qseq[qoff + l] > 3) ++n_ambi;
 			r->blen += len - n_ambi, p->n_ambi += n_ambi;
-			p->n_diff2 += 1.0f, ++p->blen2;
 			s -= q + e * len;
 			if (s < 0) s = 0;
 			qoff += len;
@@ -159,7 +181,6 @@ static void mm_update_extra(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *qu
 			for (l = 0; l < len; ++l)
 				if (tseq[toff + l] > 3) ++n_ambi;
 			r->blen += len - n_ambi, p->n_ambi += n_ambi;
-			p->n_diff2 += 1.0f, ++p->blen2;
 			s -= q + e * len;
 			if (s < 0) s = 0;
 			toff += len;
@@ -196,9 +217,8 @@ static void mm_append_cigar(mm_reg1_t *r, uint32_t n_cigar, uint32_t *cigar) //
 	}
 }
 
-static void mm_align_pair(void *km, const mm_mapopt_t *opt, int qlen, const uint8_t *qseq, int tlen, const uint8_t *tseq, const int8_t *mat, int w, int end_bonus, int flag, ksw_extz_t *ez)
+static void mm_align_pair(void *km, const mm_mapopt_t *opt, int qlen, const uint8_t *qseq, int tlen, const uint8_t *tseq, const int8_t *mat, int w, int end_bonus, int zdrop, int flag, ksw_extz_t *ez)
 {
-	int zdrop = opt->zdrop;
 	if (mm_dbg_flag & MM_DBG_PRINT_ALN_SEQ) {
 		int i;
 		fprintf(stderr, "===> q=(%d,%d), e=(%d,%d), bw=%d, flag=%d, zdrop=%d <===\n", opt->q, opt->q2, opt->e, opt->e2, w, flag, opt->zdrop);
@@ -213,6 +233,13 @@ static void mm_align_pair(void *km, const mm_mapopt_t *opt, int qlen, const uint
 		ksw_extz2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, w, zdrop, end_bonus, flag, ez);
 	else
 		ksw_extd2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->e2, w, zdrop, end_bonus, flag, ez);
+	if (mm_dbg_flag & MM_DBG_PRINT_ALN_SEQ) {
+		int i;
+		fprintf(stderr, "score=%d, cigar=", ez->score);
+		for (i = 0; i < ez->n_cigar; ++i)
+			fprintf(stderr, "%d%c", ez->cigar[i]>>4, "MIDN"[ez->cigar[i]&0xf]);
+		fprintf(stderr, "\n");
+	}
 }
 
 static inline int mm_get_hplen_back(const mm_idx_t *mi, uint32_t rid, uint32_t x)
@@ -226,7 +253,7 @@ static inline int mm_get_hplen_back(const mm_idx_t *mi, uint32_t rid, uint32_t x
 
 static inline void mm_adjust_minier(const mm_idx_t *mi, uint8_t *const qseq0[2], mm128_t *a, int32_t *r, int32_t *q)
 {
-	if (mi->is_hpc) {
+	if (mi->flag & MM_I_HPC) {
 		const uint8_t *qseq = qseq0[a->x>>63];
 		int i, c;
 		*q = (int32_t)a->y;
@@ -287,33 +314,39 @@ static void mm_filter_bad_seeds(void *km, int as1, int cnt1, mm128_t *a, int min
 	kfree(km, K);
 }
 
-static void mm_fix_bad_ends(const mm_reg1_t *r, const mm128_t *a, int bw, int32_t *as, int32_t *cnt)
+static void mm_fix_bad_ends(const mm_reg1_t *r, const mm128_t *a, int bw, int min_match, int32_t *as, int32_t *cnt)
 {
-	int32_t i, l;
+	int32_t i, l, m;
 	*as = r->as, *cnt = r->cnt;
 	if (r->cnt < 3) return;
-	l = a[r->as].y >> 32 & 0xff;
+	m = l = a[r->as].y >> 32 & 0xff;
 	for (i = r->as + 1; i < r->as + r->cnt - 1; ++i) {
 		int32_t lq, lr, min, max;
+		int32_t q_span = a[i].y >> 32 & 0xff;
+		if (a[i].y & MM_SEED_LONG_JOIN) break;
 		lr = (int32_t)a[i].x - (int32_t)a[i-1].x;
 		lq = (int32_t)a[i].y - (int32_t)a[i-1].y;
 		min = lr < lq? lr : lq;
 		max = lr > lq? lr : lq;
 		if (max - min > l >> 1) *as = i;
 		l += min;
-		if (l >= bw << 1) break;
+		m += min < q_span? min : q_span;
+		if (l >= bw << 1 || (m >= min_match && m >= bw) || m >= r->mlen >> 1) break;
 	}
 	*cnt = r->as + r->cnt - *as;
-	l = a[r->as + r->cnt - 1].y >> 32 & 0xff;
+	m = l = a[r->as + r->cnt - 1].y >> 32 & 0xff;
 	for (i = r->as + r->cnt - 2; i > *as; --i) {
 		int32_t lq, lr, min, max;
+		int32_t q_span = a[i+1].y >> 32 & 0xff;
+		if (a[i+1].y & MM_SEED_LONG_JOIN) break;
 		lr = (int32_t)a[i+1].x - (int32_t)a[i].x;
 		lq = (int32_t)a[i+1].y - (int32_t)a[i].y;
 		min = lr < lq? lr : lq;
 		max = lr > lq? lr : lq;
 		if (max - min > l >> 1) *cnt = i + 1 - *as;
 		l += min;
-		if (l >= bw) break;
+		m += min < q_span? min : q_span;
+		if (l >= bw << 1 || (m >= min_match && m >= bw) || m >= r->mlen >> 1) break;
 	}
 }
 
@@ -345,7 +378,49 @@ static void mm_max_stretch(const mm_mapopt_t *opt, const mm_reg1_t *r, const mm1
 	*as = max_i, *cnt = max_len;
 }
 
-static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, uint8_t *qseq0[2], uint8_t *qual0[2], mm_reg1_t *r, mm_reg1_t *r2, int n_a, mm128_t *a, ksw_extz_t *ez, int splice_flag)
+static int mm_seed_ext_score(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, const int8_t mat[25], int qlen, uint8_t *qseq0[2], const mm128_t *a)
+{
+	uint8_t *qseq, *tseq;
+	int q_span = a->y>>32&0xff, qs, qe, rs, re, rid, score, q_off, t_off, ext_len = opt->anchor_ext_len;
+	void *qp;
+	rid = a->x<<1>>33;
+	re = (uint32_t)a->x + 1, rs = re - q_span;
+	qe = (uint32_t)a->y + 1, qs = qe - q_span;
+	rs = rs - ext_len > 0? rs - ext_len : 0;
+	qs = qs - ext_len > 0? qs - ext_len : 0;
+	re = re + ext_len < mi->seq[rid].len? re + ext_len : mi->seq[rid].len;
+	qe = qe + ext_len < qlen? qe + ext_len : qlen;
+	tseq = (uint8_t*)kmalloc(km, re - rs);
+	mm_idx_getseq(mi, rid, rs, re, tseq);
+	qseq = qseq0[a->x>>63] + qs;
+	qp = ksw_ll_qinit(km, 2, qe - qs, qseq, 5, mat);
+	score = ksw_ll_i16(qp, re - rs, tseq, opt->q, opt->e, &q_off, &t_off);
+	kfree(km, tseq);
+	kfree(km, qp);
+	return score;
+}
+
+static void mm_fix_bad_ends_splice(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, const mm_reg1_t *r, const int8_t mat[25], int qlen, uint8_t *qseq0[2], const mm128_t *a, int *as1, int *cnt1)
+{ // this assumes a very crude k-mer based mode; it is not necessary to use a good model just for filtering bounary exons
+	int score;
+	double log_gap;
+	*as1 = r->as, *cnt1 = r->cnt;
+	if (r->cnt < 3) return;
+	log_gap = log((int32_t)a[r->as + 1].x - (int32_t)a[r->as].x);
+	if ((a[r->as].y>>32&0xff) < log_gap + opt->anchor_ext_shift) {
+		score = mm_seed_ext_score(km, opt, mi, mat, qlen, qseq0, &a[r->as]);
+		if ((double)score / mat[0] < log_gap + opt->anchor_ext_shift) // a more exact format is "score < log_4(gap) + shift"
+			++(*as1), --(*cnt1);
+	}
+	log_gap = log((int32_t)a[r->as + r->cnt - 1].x - (int32_t)a[r->as + r->cnt - 2].x);
+	if ((a[r->as + r->cnt - 1].y>>32&0xff) < log_gap + opt->anchor_ext_shift) {
+		score = mm_seed_ext_score(km, opt, mi, mat, qlen, qseq0, &a[r->as + r->cnt - 1]);
+		if ((double)score / mat[0] < log_gap + opt->anchor_ext_shift)
+			--(*cnt1);
+	}
+}
+
+static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, uint8_t *qseq0[2], mm_reg1_t *r, mm_reg1_t *r2, int n_a, mm128_t *a, ksw_extz_t *ez, int splice_flag)
 {
 	int is_sr = !!(opt->flag & MM_F_SR), is_splice = !!(opt->flag & MM_F_SPLICE);
 	int32_t rid = a[r->as].x<<1>>33, rev = a[r->as].x>>63, as1, cnt1;
@@ -355,23 +430,25 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
 	int32_t rs1, qs1, re1, qe1;
 	int8_t mat[25];
 
-	if (is_sr) assert(!mi->is_hpc); // HPC won't work with SR because with HPC we can't easily tell if there is a gap
+	if (is_sr) assert(!(mi->flag & MM_I_HPC)); // HPC won't work with SR because with HPC we can't easily tell if there is a gap
 
 	r2->cnt = 0;
 	if (r->cnt == 0) return;
 	ksw_gen_simple_mat(5, mat, opt->a, opt->b);
 	bw = (int)(opt->bw * 1.5 + 1.);
 
-	if (is_sr && !mi->is_hpc) {
+	if (is_sr && !(mi->flag & MM_I_HPC)) {
 		mm_max_stretch(opt, r, a, &as1, &cnt1);
 		rs = (int32_t)a[as1].x + 1 - (int32_t)(a[as1].y>>32&0xff);
 		qs = (int32_t)a[as1].y + 1 - (int32_t)(a[as1].y>>32&0xff);
 		re = (int32_t)a[as1+cnt1-1].x + 1;
 		qe = (int32_t)a[as1+cnt1-1].y + 1;
 	} else {
-		if (!is_splice)
+		if (is_splice) {
-			mm_fix_bad_ends(r, a, opt->bw, &as1, &cnt1);
+			mm_fix_bad_ends_splice(km, opt, mi, r, mat, qlen, qseq0, a, &as1, &cnt1);
-		else as1 = r->as, cnt1 = r->cnt;
+		} else {
+			mm_fix_bad_ends(r, a, opt->bw, opt->min_chain_score * 2, &as1, &cnt1);
+		}
 		mm_filter_bad_seeds(km, as1, cnt1, a, 10, 40, opt->max_gap>>1, 10);
 		mm_adjust_minier(mi, qseq0, &a[as1], &rs, &qs);
 		mm_adjust_minier(mi, qseq0, &a[as1 + cnt1 - 1], &re, &qe);
@@ -381,6 +458,7 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
 	if (is_splice) {
 		if (splice_flag & MM_F_SPLICE_FOR) extra_flag |= rev? KSW_EZ_SPLICE_REV : KSW_EZ_SPLICE_FOR;
 		if (splice_flag & MM_F_SPLICE_REV) extra_flag |= rev? KSW_EZ_SPLICE_FOR : KSW_EZ_SPLICE_REV;
+		if (opt->flag & MM_F_SPLICE_FLANK) extra_flag |= KSW_EZ_SPLICE_FLANK;
 	}
 
 	/* Look for the start and end of regions to perform DP. This sounds easy
@@ -450,6 +528,14 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
 			re0 = re0 > re1? re0 : re1;
 		} else re0 = re, qe0 = qe;
 	}
+	if (a[r->as].y & MM_SEED_SELF) {
+		int max_ext = r->qs > r->rs? r->qs - r->rs : r->rs - r->qs;
+		if (r->rs - rs0 > max_ext) rs0 = r->rs - max_ext;
+		if (r->qs - qs0 > max_ext) qs0 = r->qs - max_ext;
+		max_ext = r->qe > r->re? r->qe - r->re : r->re - r->qe;
+		if (re0 - r->re > max_ext) re0 = r->re + max_ext;
+		if (qe0 - r->qe > max_ext) qe0 = r->qe + max_ext;
+	}
 
 	assert(re0 > rs0);
 	tseq = (uint8_t*)kmalloc(km, re0 - rs0);
@@ -459,7 +545,7 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
 		mm_idx_getseq(mi, rid, rs0, rs, tseq);
 		mm_seq_rev(qs - qs0, qseq);
 		mm_seq_rev(rs - rs0, tseq);
-		mm_align_pair(km, opt, qs - qs0, qseq, rs - rs0, tseq, mat, bw, opt->end_bonus, extra_flag|KSW_EZ_EXTZ_ONLY|KSW_EZ_RIGHT|KSW_EZ_REV_CIGAR, ez);
+		mm_align_pair(km, opt, qs - qs0, qseq, rs - rs0, tseq, mat, bw, opt->end_bonus, r->split_inv? opt->zdrop_inv : opt->zdrop, extra_flag|KSW_EZ_EXTZ_ONLY|KSW_EZ_RIGHT|KSW_EZ_REV_CIGAR, ez);
 		if (ez->n_cigar > 0) {
 			mm_append_cigar(r, ez->n_cigar, ez->cigar);
 			r->p->dp_score += ez->max;
@@ -473,15 +559,16 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
 
 	for (i = is_sr? cnt1 - 1 : 1; i < cnt1; ++i) { // gap filling
 		if ((a[as1+i].y & (MM_SEED_IGNORE|MM_SEED_TANDEM)) && i != cnt1 - 1) continue;
-		if (is_sr && !mi->is_hpc) {
+		if (is_sr && !(mi->flag & MM_I_HPC)) {
 			re = (int32_t)a[as1 + i].x + 1;
 			qe = (int32_t)a[as1 + i].y + 1;
 		} else mm_adjust_minier(mi, qseq0, &a[as1 + i], &re, &qe);
 		re1 = re, qe1 = qe;
 		if (i == cnt1 - 1 || (a[as1+i].y&MM_SEED_LONG_JOIN) || (qe - qs >= opt->min_ksw_len && re - rs >= opt->min_ksw_len)) {
-			int j, bw1 = bw;
+			int j, bw1 = bw, zdrop_code;
 			if (a[as1+i].y & MM_SEED_LONG_JOIN)
 				bw1 = qe - qs > re - rs? qe - qs : re - rs;
+			// perform alignment
 			qseq = &qseq0[rev][qs];
 			mm_idx_getseq(mi, rid, rs, re, tseq);
 			if (is_sr) { // perform ungapped alignment
@@ -493,10 +580,12 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
 				}
 				ez->cigar = ksw_push_cigar(km, &ez->n_cigar, &ez->m_cigar, ez->cigar, 0, qe - qs);
 			} else { // perform normal gapped alignment
-				mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, mat, bw1, -1, extra_flag|KSW_EZ_APPROX_MAX, ez); // first pass: with approximate Z-drop
+				mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, mat, bw1, -1, opt->zdrop, extra_flag|KSW_EZ_APPROX_MAX, ez); // first pass: with approximate Z-drop
 			}
-			if (mm_check_zdrop(qseq, tseq, ez->n_cigar, ez->cigar, mat, opt->q, opt->e, opt->zdrop))
+			// test Z-drop and inversion Z-drop
-				mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, mat, bw1, -1, extra_flag, ez); // second pass: lift approximate
+			if ((zdrop_code = mm_test_zdrop(km, opt, qseq, tseq, ez->n_cigar, ez->cigar, mat)) != 0)
+				mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, mat, bw1, -1, zdrop_code == 2? opt->zdrop_inv : opt->zdrop, extra_flag, ez); // second pass: lift approximate
+			// update CIGAR
 			if (ez->n_cigar > 0)
 				mm_append_cigar(r, ez->n_cigar, ez->cigar);
 			if (ez->zdropped) { // truncated by Z-drop; TODO: sometimes Z-drop kicks in because the next seed placement is wrong. This can be fixed in principle.
@@ -508,8 +597,10 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
 				r->p->dp_score += ez->max;
 				re1 = rs + (ez->max_t + 1);
 				qe1 = qs + (ez->max_q + 1);
-				if (cnt1 - (j + 1) >= opt->min_cnt)
+				if (cnt1 - (j + 1) >= opt->min_cnt) {
 					mm_split_reg(r, r2, as1 + j + 1 - r->as, qlen, a);
+					if (zdrop_code == 2) r2->split_inv = 1;
+				}
 				break;
 			} else r->p->dp_score += ez->score;
 			rs = re, qs = qe;
@@ -519,7 +610,7 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
 	if (!dropped && qe < qe0 && re < re0) { // right extension
 		qseq = &qseq0[rev][qe];
 		mm_idx_getseq(mi, rid, re, re0, tseq);
-		mm_align_pair(km, opt, qe0 - qe, qseq, re0 - re, tseq, mat, bw, opt->end_bonus, extra_flag|KSW_EZ_EXTZ_ONLY, ez);
+		mm_align_pair(km, opt, qe0 - qe, qseq, re0 - re, tseq, mat, bw, opt->end_bonus, opt->zdrop, extra_flag|KSW_EZ_EXTZ_ONLY, ez);
 		if (ez->n_cigar > 0) {
 			mm_append_cigar(r, ez->n_cigar, ez->cigar);
 			r->p->dp_score += ez->max;
@@ -536,7 +627,7 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
 	assert(re1 - rs1 <= re0 - rs0);
 	if (r->p) {
 		mm_idx_getseq(mi, rid, rs1, re1, tseq);
-		mm_update_extra(r, &qseq0[r->rev][qs1], qual0[r->rev]? &qual0[r->rev][qs1] : 0, tseq, mat, opt->q, opt->e);
+		mm_update_extra(r, &qseq0[r->rev][qs1], tseq, mat, opt->q, opt->e);
 		if (rev && r->p->trans_strand)
 			r->p->trans_strand ^= 3; // flip to the read strand
 	}
@@ -544,10 +635,10 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
 	kfree(km, tseq);
 }
 
-static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, uint8_t *qseq0[2], uint8_t *qual0[2], const mm_reg1_t *r1, const mm_reg1_t *r2, mm_reg1_t *r_inv, ksw_extz_t *ez)
+static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, uint8_t *qseq0[2], const mm_reg1_t *r1, const mm_reg1_t *r2, mm_reg1_t *r_inv, ksw_extz_t *ez)
 {
 	int tl, ql, score, ret = 0, q_off, t_off;
-	uint8_t *tseq, *qseq, *qual;
+	uint8_t *tseq, *qseq;
 	int8_t mat[25];
 	void *qp;
 
@@ -556,7 +647,7 @@ static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, i
 	if (r1->id != r1->parent && r1->parent != MM_PARENT_TMP_PRI) return 0;
 	if (r2->id != r2->parent && r2->parent != MM_PARENT_TMP_PRI) return 0;
 	if (r1->rid != r2->rid || r1->rev != r2->rev) return 0;
-	ql = r2->qs - r1->qe;
+	ql = r1->rev? r1->qs - r2->qe : r2->qs - r1->qe;
 	tl = r2->rs - r1->re;
 	if (ql < opt->min_chain_score || ql > opt->max_gap) return 0;
 	if (tl < opt->min_chain_score || tl > opt->max_gap) return 0;
@@ -564,8 +655,7 @@ static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, i
 	ksw_gen_simple_mat(5, mat, opt->a, opt->b);
 	tseq = (uint8_t*)kmalloc(km, tl);
 	mm_idx_getseq(mi, r1->rid, r1->re, r2->rs, tseq);
-	qseq = &qseq0[!r1->rev][qlen - r2->qs];
+	qseq = r1->rev? &qseq0[0][r2->qe] : &qseq0[1][qlen - r2->qs];
-	qual = qual0[!r1->rev]? &qseq0[!r1->rev][qlen - r2->qs] : 0;
 
 	mm_seq_rev(ql, qseq);
 	mm_seq_rev(tl, tseq);
@@ -576,7 +666,7 @@ static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, i
 	mm_seq_rev(tl, tseq);
 	if (score < opt->min_dp_max) goto end_align1_inv;
 	q_off = ql - (q_off + 1), t_off = tl - (t_off + 1);
-	mm_align_pair(km, opt, ql - q_off, qseq + q_off, tl - t_off, tseq + t_off, mat, (int)(opt->bw * 1.5), -1, KSW_EZ_EXTZ_ONLY, ez);
+	mm_align_pair(km, opt, ql - q_off, qseq + q_off, tl - t_off, tseq + t_off, mat, (int)(opt->bw * 1.5), -1, opt->zdrop, KSW_EZ_EXTZ_ONLY, ez);
 	if (ez->n_cigar == 0) goto end_align1_inv; // should never be here
 	mm_append_cigar(r_inv, ez->n_cigar, ez->cigar);
 	r_inv->p->dp_score = ez->max;
@@ -585,9 +675,17 @@ static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, i
 	r_inv->inv = 1;
 	r_inv->rev = !r1->rev;
 	r_inv->rid = r1->rid;
-	r_inv->qs = r1->qe + q_off, r_inv->qe = r_inv->qs + ez->max_q + 1;
+	r_inv->div = -1.0f;
-	r_inv->rs = r1->re + t_off, r_inv->re = r_inv->rs + ez->max_t + 1;
+	if (r_inv->rev == 0) {
-	mm_update_extra(r_inv, &qseq[q_off], qual? &qual[q_off] : 0, &tseq[t_off], mat, opt->q, opt->e);
+		r_inv->qs = r2->qe + q_off;
+		r_inv->qe = r_inv->qs + ez->max_q + 1;
+	} else {
+		r_inv->qe = r2->qs - q_off;
+		r_inv->qs = r_inv->qe - (ez->max_q + 1);
+	}
+	r_inv->rs = r1->re + t_off;
+	r_inv->re = r_inv->rs + ez->max_t + 1;
+	mm_update_extra(r_inv, &qseq[q_off], &tseq[t_off], mat, opt->q, opt->e);
 	ret = 1;
 end_align1_inv:
 	kfree(km, tseq);
@@ -604,11 +702,11 @@ static inline mm_reg1_t *mm_insert_reg(const mm_reg1_t *r, int i, int *n_regs, m
 	return regs;
 }
 
-mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, const char *qual, int *n_regs_, mm_reg1_t *regs, mm128_t *a)
+mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a)
 {
 	extern unsigned char seq_nt4_table[256];
 	int32_t i, n_regs = *n_regs_, n_a;
-	uint8_t *qseq0[2], *qual0[2];
+	uint8_t *qseq0[2];
 	ksw_extz_t ez;
 
 	// encode the query sequence
@@ -618,12 +716,6 @@ mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *m
 		qseq0[0][i] = seq_nt4_table[(uint8_t)qstr[i]];
 		qseq0[1][qlen - 1 - i] = qseq0[0][i] < 4? 3 - qseq0[0][i] : 4;
 	}
-	if (qual) {
-		qual0[0] = (uint8_t*)kmalloc(km, qlen * 2);
-		qual0[1] = qual0[0] + qlen;
-		for (i = 0; i < qlen; ++i)
-			qual0[0][i] = qual0[1][qlen - 1 - i] = qual[i] - 33;
-	} else qual0[0] = qual0[1] = 0;
 
 	// align through seed hits
 	n_a = mm_squeeze_a(km, n_regs, regs, a);
@@ -634,8 +726,8 @@ mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *m
 			mm_reg1_t s[2], s2[2];
 			int which, trans_strand;
 			s[0] = s[1] = regs[i];
-			mm_align1(km, opt, mi, qlen, qseq0, qual0, &s[0], &s2[0], n_a, a, &ez, MM_F_SPLICE_FOR);
+			mm_align1(km, opt, mi, qlen, qseq0, &s[0], &s2[0], n_a, a, &ez, MM_F_SPLICE_FOR);
-			mm_align1(km, opt, mi, qlen, qseq0, qual0, &s[1], &s2[1], n_a, a, &ez, MM_F_SPLICE_REV);
+			mm_align1(km, opt, mi, qlen, qseq0, &s[1], &s2[1], n_a, a, &ez, MM_F_SPLICE_REV);
 			if (s[0].p->dp_score > s[1].p->dp_score) which = 0, trans_strand = 1;
 			else if (s[0].p->dp_score < s[1].p->dp_score) which = 1, trans_strand = 2;
 			else trans_strand = 3, which = (qlen + s[0].p->dp_score) & 1; // randomly choose a strand, effectively
@@ -648,13 +740,13 @@ mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *m
 			}
 			regs[i].p->trans_strand = trans_strand;
 		} else { // one round of alignment
-			mm_align1(km, opt, mi, qlen, qseq0, qual0, &regs[i], &r2, n_a, a, &ez, opt->flag);
+			mm_align1(km, opt, mi, qlen, qseq0, &regs[i], &r2, n_a, a, &ez, opt->flag);
 			if (opt->flag&MM_F_SPLICE)
 				regs[i].p->trans_strand = opt->flag&MM_F_SPLICE_FOR? 1 : 2;
 		}
 		if (r2.cnt > 0) regs = mm_insert_reg(&r2, i, &n_regs, regs);
-		if (!(opt->flag&MM_F_SPLICE) && !(opt->flag&MM_F_SR) && i > 0) { // don't try inversion alignment for -xsplice or -xsr
+		if (i > 0 && regs[i].split_inv) {
-			if (mm_align1_inv(km, opt, mi, qlen, qseq0, qual0, &regs[i-1], &regs[i], &r2, &ez)) {
+			if (mm_align1_inv(km, opt, mi, qlen, qseq0, &regs[i-1], &regs[i], &r2, &ez)) {
 				regs = mm_insert_reg(&r2, i, &n_regs, regs);
 				++i; // skip the inserted INV alignment
 			}
@@ -662,9 +754,8 @@ mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *m
 	}
 	*n_regs_ = n_regs;
 	kfree(km, qseq0[0]);
-	if (qual0[0]) kfree(km, qual0[0]);
 	kfree(km, ez.cigar);
-	mm_filter_regs(km, opt, n_regs_, regs);
+	mm_filter_regs(km, opt, qlen, n_regs_, regs);
 	mm_hit_sort_by_dp(km, n_regs_, regs);
 	return regs;
 }

bseq.c

@@ -2,6 +2,7 @@
 #include <stdio.h>
 #include <stdlib.h>
 #include <assert.h>
+#define __STDC_LIMIT_MACROS
 #include "bseq.h"
 #include "kvec.h"
 #include "kseq.h"
@@ -53,15 +54,23 @@ void mm_bseq_close(mm_bseq_file_t *fp)
 	free(fp);
 }
 
+static inline char *kstrdup(const kstring_t *s)
+{
+	char *t;
+	t = (char*)malloc(s->l + 1);
+	memcpy(t, s->s, s->l + 1);
+	return t;
+}
+
 static inline void kseq2bseq(kseq_t *ks, mm_bseq1_t *s, int with_qual)
 {
 	int i;
-	s->name = strdup(ks->name.s);
+	s->name = kstrdup(&ks->name);
-	s->seq = strdup(ks->seq.s);
+	s->seq = kstrdup(&ks->seq);
 	for (i = 0; i < ks->seq.l; ++i) // convert U to T
 		if (s->seq[i] == 'u' || s->seq[i] == 'U')
 			--s->seq[i];
-	s->qual = with_qual && ks->qual.l? strdup(ks->qual.s) : 0;
+	s->qual = with_qual && ks->qual.l? kstrdup(&ks->qual) : 0;
 	s->l_seq = ks->seq.l;
 }
 
@@ -114,10 +123,15 @@ mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int
 	*n_ = 0;
 	if (n_fp < 1) return 0;
 	while (1) {
+		int n_read = 0;
 		for (i = 0; i < n_fp; ++i)
-			if (kseq_read(fp[i]->ks) < 0)
+			if (kseq_read(fp[i]->ks) >= 0)
-				break;
+				++n_read;
-		if (i != n_fp) break; // some file reaches the end
+		if (n_read < n_fp) {
+			if (n_read > 0)
+				fprintf(stderr, "[W::%s]\033[1;31m query files have different number of records; extra records skipped.\033[0m\n", __func__);
+			break; // some file reaches the end
+		}
 		if (a.m == 0) kv_resize(mm_bseq1_t, 0, a, 256);
 		for (i = 0; i < n_fp; ++i) {
 			mm_bseq1_t *s;

chain.c

@@ -49,7 +49,7 @@ mm128_t *mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int m
 			int64_t dr = ri - a[j].x;
 			int32_t dq = qi - (int32_t)a[j].y, dd, sc, log_dd;
 			int32_t sidj = (a[j].y & MM_SEED_SEG_MASK) >> MM_SEED_SEG_SHIFT;
-			if (dr == 0 || dq <= 0) continue;
+			if ((sidi == sidj && dr == 0) || dq <= 0) continue; // don't skip if an anchor is used by multiple segments; see below
 			if ((sidi == sidj && dq > max_dist_y) || dq > max_dist_x) continue;
 			dd = dr > dq? dr - dq : dq - dr;
 			if (sidi == sidj && dd > bw) continue;
@@ -61,7 +61,8 @@ mm128_t *mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int m
 				int c_log, c_lin;
 				c_lin = (int)(dd * .01 * avg_qspan);
 				c_log = log_dd;
-				if (dr > dq || sidi != sidj) sc -= c_lin < c_log? c_lin : c_log;
+				if (sidi != sidj && dr == 0) ++sc; // possibly due to overlapping paired ends; give a minor bonus
+				else if (dr > dq || sidi != sidj) sc -= c_lin < c_log? c_lin : c_log;
 				else sc -= c_lin + (c_log>>1);
 			} else sc -= (int)(dd * .01 * avg_qspan) + (log_dd>>1);
 			sc += f[j];

esterr.c

@@ -0,0 +1,64 @@
+#include <math.h>
+#include <stdio.h>
+#include <stdlib.h>
+#include <assert.h>
+#include "mmpriv.h"
+
+static inline int32_t get_for_qpos(int32_t qlen, const mm128_t *a)
+{
+	int32_t x = (int32_t)a->y;
+	int32_t q_span = a->y>>32 & 0xff;
+	if (a->x>>63)
+		x = qlen - 1 - (x + 1 - q_span); // revert the position to the forward strand of query
+	return x;
+}
+
+static int get_mini_idx(int qlen, const mm128_t *a, int32_t n, const uint64_t *mini_pos)
+{
+	int32_t x, L = 0, R = n - 1;
+	x = get_for_qpos(qlen, a);
+	while (L <= R) { // binary search
+		int32_t m = ((uint64_t)L + R) >> 1;
+		int32_t y = (int32_t)mini_pos[m];
+		if (y < x) L = m + 1;
+		else if (y > x) R = m - 1;
+		else return m;
+	}
+	return -1;
+}
+
+void mm_est_err(const mm_idx_t *mi, int qlen, int n_regs, mm_reg1_t *regs, const mm128_t *a, int32_t n, const uint64_t *mini_pos)
+{
+	int i;
+	uint64_t sum_k = 0;
+	float avg_k;
+
+	if (n == 0) return;
+	for (i = 0; i < n; ++i)
+		sum_k += mini_pos[i] >> 32 & 0xff;
+	avg_k = (float)sum_k / n;
+
+	for (i = 0; i < n_regs; ++i) {
+		mm_reg1_t *r = &regs[i];
+		int32_t st, en, j, k, n_match, n_tot, l_ref;
+		r->div = -1.0f;
+		if (r->cnt == 0) continue;
+		st = en = get_mini_idx(qlen, r->rev? &a[r->as + r->cnt - 1] : &a[r->as], n, mini_pos);
+		if (st < 0) {
+			if (mm_verbose >= 2)
+				fprintf(stderr, "[WARNING] logic inconsistency in mm_est_err(). Please contact the developer.\n");
+			continue;
+		}
+		l_ref = mi->seq[r->rid].len;
+		for (k = 1, j = st + 1, n_match = 1; j < n && k < r->cnt; ++j) {
+			int32_t x;
+			x = get_for_qpos(qlen, r->rev? &a[r->as + r->cnt - 1 - k] : &a[r->as + k]);
+			if (x == (int32_t)mini_pos[j])
+				++k, en = j, ++n_match;
+		}
+		n_tot = en - st + 1;
+		if (r->qs > avg_k && r->rs > avg_k) ++n_tot;
+		if (qlen - r->qs > avg_k && l_ref - r->re > avg_k) ++n_tot;
+		r->div = logf((float)n_tot / n_match) / avg_k;
+	}
+}

format.c

@@ -202,8 +202,9 @@ static void write_cs(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_
 
 static inline void write_tags(kstring_t *s, const mm_reg1_t *r)
 {
-	int type = r->inv? 'I' : r->id == r->parent? 'P' : 'S';
+	int type;
-	if (r->iden_flt) mm_sprintf_lite(s, "\tom:i:%d", r->mapq);
+	if (r->id == r->parent) type = r->inv? 'I' : 'P';
+	else type = r->inv? 'i' : 'S';
 	if (r->p) {
 		mm_sprintf_lite(s, "\tNM:i:%d\tms:i:%d\tAS:i:%d\tnn:i:%d", r->blen - r->mlen + r->p->n_ambi, r->p->dp_max, r->p->dp_score, r->p->n_ambi);
 		if (r->p->trans_strand == 1 || r->p->trans_strand == 2)
@@ -211,6 +212,12 @@ static inline void write_tags(kstring_t *s, const mm_reg1_t *r)
 	}
 	mm_sprintf_lite(s, "\ttp:A:%c\tcm:i:%d\ts1:i:%d", type, r->cnt, r->score);
 	if (r->parent == r->id) mm_sprintf_lite(s, "\ts2:i:%d", r->subsc);
+	if (r->div >= 0.0f && r->div <= 1.0f) {
+		char buf[8];
+		if (r->div == 0.0f) buf[0] = '0', buf[1] = 0;
+		else sprintf(buf, "%.4f", r->div);
+		mm_sprintf_lite(s, "\tdv:f:%s", buf);
+	}
 	if (r->split) mm_sprintf_lite(s, "\tzd:i:%d", r->split);
 }
 
@@ -258,7 +265,7 @@ static inline const mm_reg1_t *get_sam_pri(int n_regs, const mm_reg1_t *regs)
 	return NULL;
 }
 
-static void write_sam_cigar(kstring_t *s, int sam_flag, int in_tag, int qlen, const mm_reg1_t *r)
+static void write_sam_cigar(kstring_t *s, int sam_flag, int in_tag, int qlen, const mm_reg1_t *r, int opt_flag)
 {
 	if (r->p == 0) {
 		mm_sprintf_lite(s, "*");
@@ -267,14 +274,14 @@ static void write_sam_cigar(kstring_t *s, int sam_flag, int in_tag, int qlen, co
 		clip_len[0] = r->rev? qlen - r->qe : r->qs;
 		clip_len[1] = r->rev? r->qs : qlen - r->qe;
 		if (in_tag) {
-			int clip_char = (sam_flag&0x800)? 5 : 4;
+			int clip_char = (sam_flag&0x800) && !(opt_flag&MM_F_SOFTCLIP)? 5 : 4;
 			mm_sprintf_lite(s, "\tCG:B:I");
 			if (clip_len[0]) mm_sprintf_lite(s, ",%u", clip_len[0]<<4|clip_char);
 			for (k = 0; k < r->p->n_cigar; ++k)
 				mm_sprintf_lite(s, ",%u", r->p->cigar[k]);
 			if (clip_len[1]) mm_sprintf_lite(s, ",%u", clip_len[1]<<4|clip_char);
 		} else {
-			int clip_char = (sam_flag&0x800)? 'H' : 'S';
+			int clip_char = (sam_flag&0x800) && !(opt_flag&MM_F_SOFTCLIP)? 'H' : 'S';
 			if (clip_len[0]) mm_sprintf_lite(s, "%d%c", clip_len[0], clip_char);
 			for (k = 0; k < r->p->n_cigar; ++k)
 				mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDN"[r->p->cigar[k]&0xf]);
@@ -336,9 +343,8 @@ void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
 			mm_sprintf_lite(s, "\t%s\t%d\t0\t*", mi->seq[this_rid].name, this_pos+1);
 		} else mm_sprintf_lite(s, "\t*\t0\t0\t*");
 	} else {
-		int mapq = !r->iden_flt? r->mapq : r->mapq < 3? r->mapq : 3;
 		this_rid = r->rid, this_pos = r->rs, this_rev = r->rev;
-		mm_sprintf_lite(s, "\t%s\t%d\t%d\t", mi->seq[r->rid].name, r->rs+1, mapq);
+		mm_sprintf_lite(s, "\t%s\t%d\t%d\t", mi->seq[r->rid].name, r->rs+1, r->mapq);
 		if ((opt_flag & MM_F_LONG_CIGAR) && r->p && r->p->n_cigar > max_bam_cigar_op - 2) {
 			int n_cigar = r->p->n_cigar;
 			if (r->qs != 0) ++n_cigar;
@@ -346,8 +352,11 @@ void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
 			if (n_cigar > max_bam_cigar_op)
 				cigar_in_tag = 1;
 		}
-		if (cigar_in_tag) mm_sprintf_lite(s, "%dS", t->l_seq);
+		if (cigar_in_tag) {
-		else write_sam_cigar(s, flag, 0, t->l_seq, r);
+			if (flag & 0x100) mm_sprintf_lite(s, "0S"); // secondary alignment
+			else if (flag & 0x800) mm_sprintf_lite(s, "%dS", r->re - r->rs); // supplementary alignment
+			else mm_sprintf_lite(s, "%dS", t->l_seq);
+		} else write_sam_cigar(s, flag, 0, t->l_seq, r, opt_flag);
 	}
 
 	// write mate positions
@@ -380,7 +389,7 @@ void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
 		if (t->qual) sam_write_sq(s, t->qual, t->l_seq, 0, 0);
 		else mm_sprintf_lite(s, "*");
 	} else {
-		if ((flag & 0x900) == 0) {
+		if ((flag & 0x900) == 0 || (opt_flag & MM_F_SOFTCLIP)) {
 			sam_write_sq(s, t->seq, t->l_seq, r->rev, r->rev);
 			mm_sprintf_lite(s, "\t");
 			if (t->qual) sam_write_sq(s, t->qual, t->l_seq, r->rev, 0);
@@ -428,7 +437,7 @@ void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
 		if (r->p && (opt_flag & MM_F_OUT_CS))
 			write_cs(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG));
 		if (cigar_in_tag)
-			write_sam_cigar(s, flag, 1, t->l_seq, r);
+			write_sam_cigar(s, flag, 1, t->l_seq, r, opt_flag);
 	}
 
 	s->s[s->l] = 0; // we always have room for an extra byte (see str_enlarge)

hit.c

@@ -76,10 +76,11 @@ mm_reg1_t *mm_gen_regs(void *km, uint32_t hash, int qlen, int n_u, uint64_t *u,
 		mm_reg1_t *ri = &r[i];
 		ri->id = i;
 		ri->parent = MM_PARENT_UNSET;
-		ri->score = z[i].x >> 32;
+		ri->score = ri->score0 = z[i].x >> 32;
 		ri->hash = (uint32_t)z[i].x;
 		ri->cnt = (int32_t)z[i].y;
 		ri->as = z[i].y >> 32;
+		ri->div = -1.0f;
 		mm_reg_set_coor(ri, qlen, a);
 	}
 	kfree(km, z);
@@ -93,6 +94,7 @@ void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a)
 	r2->id = -1;
 	r2->sam_pri = 0;
 	r2->p = 0;
+	r2->split_inv = 0;
 	r2->cnt = r->cnt - n;
 	r2->score = (int32_t)(r->score * ((float)r2->cnt / r->cnt) + .499);
 	r2->as = r->as + n;
@@ -147,7 +149,7 @@ void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r, int sub_diff
 				ri->parent = rp->parent;
 				rp->subsc = rp->subsc > ri->score? rp->subsc : ri->score;
 				if (ri->cnt >= rp->cnt) cnt_sub = 1;
-				if (rp->p && ri->p && (rp->rs != ri->rs || rp->re != ri->re || ol != min)) { // the last condition excludes identical hits after DP
+				if (rp->p && ri->p && (rp->rid != ri->rid || rp->rs != ri->rs || rp->re != ri->re || ol != min)) { // the last condition excludes identical hits after DP
 					rp->p->dp_max2 = rp->p->dp_max2 > ri->p->dp_max? rp->p->dp_max2 : ri->p->dp_max;
 					if (rp->p->dp_max - ri->p->dp_max <= sub_diff) cnt_sub = 1;
 				}
@@ -234,7 +236,7 @@ void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int *n_,
 			if (p == i || r[i].inv) { // primary or inversion
 				r[k++] = r[i];
 			} else if ((r[i].score >= r[p].score * pri_ratio || r[i].score + min_diff >= r[p].score) && n_2nd < best_n) {
-				if (!(r[i].qs == r[p].qs && r[i].qe == r[p].qe && r[i].rs == r[p].rs && r[i].re == r[p].re)) // not identical hits
+				if (!(r[i].qs == r[p].qs && r[i].qe == r[p].qe && r[i].rid == r[p].rid && r[i].rs == r[p].rs && r[i].re == r[p].re)) // not identical hits
 					r[k++] = r[i], ++n_2nd;
 				else if (r[i].p) free(r[i].p);
 			} else if (r[i].p) free(r[i].p);
@@ -244,16 +246,17 @@ void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int *n_,
 	}
 }
 
-void mm_filter_regs(void *km, const mm_mapopt_t *opt, int *n_regs, mm_reg1_t *regs)
+void mm_filter_regs(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs)
 { // NB: after this call, mm_reg1_t::parent can be -1 if its parent filtered out
 	int i, k;
 	for (i = k = 0; i < *n_regs; ++i) {
 		mm_reg1_t *r = &regs[i];
 		int flt = 0;
 		if (!r->inv && !r->seg_split && r->cnt < opt->min_cnt) flt = 1;
-		if (r->p) {
+		if (r->p) { // these filters are only applied when base-alignment is available
 			if (r->mlen < opt->min_chain_score) flt = 1;
 			else if (r->p->dp_max < opt->min_dp_max) flt = 1;
+			else if (r->qs > qlen * opt->max_clip_ratio && qlen - r->qe > qlen * opt->max_clip_ratio) flt = 1;
 			if (flt) free(r->p);
 		}
 		if (!flt) {
@@ -264,45 +267,6 @@ void mm_filter_regs(void *km, const mm_mapopt_t *opt, int *n_regs, mm_reg1_t *re
 	*n_regs = k;
 }
 
-void mm_filter_by_identity(void *km, int n_regs, mm_reg1_t *regs, float min_iden, int qlen, const char *qual) // TODO: make sure it is not beyond the ends of contigs
-{
-	int i, j, n_aux = 0, en, blen = 0;
-	uint64_t *aux;
-	float n_diff = 0.0f;
-	if (n_regs <= 0) return;
-	for (i = 0; i < n_regs; ++i)
-		if (regs[i].id == regs[i].parent && regs[i].pe_thru) // sequenced through the fragment; don't filter
-			return;
-	for (i = 0; i < n_regs; ++i)
-		if (regs[i].id == regs[i].parent)
-			++n_aux;
-	assert(n_aux >= 1);
-	aux = (uint64_t*)kmalloc(km, n_aux * 8);
-	for (i = 0, n_aux = 0; i < n_regs; ++i)
-		if (regs[i].id == regs[i].parent)
-			aux[n_aux++] = (uint64_t)regs[i].qs<<32 | i;
-	radix_sort_64(aux, aux + n_aux);
-	for (i = 0, en = 0; i < n_aux; ++i) {
-		mm_reg1_t *r = &regs[(int32_t)aux[i]];
-		if (r->qs > en) {
-			for (j = en; j < r->qs; ++j)
-				n_diff += qual == 0 || qual[j] >= 53? .25f : .05f * .25f * (qual[j] - 33);
-			blen += r->qs - en;
-		}
-		assert(r->p);
-		blen += r->p->blen2;
-		n_diff += r->p->n_diff2;
-		en = en > r->qe? en : r->qe;
-	}
-	for (j = en; j < qlen; ++j)
-		n_diff += qual == 0 || qual[j] >= 53? .25f : .05f * .25f * (qual[j] - 33);
-	blen += qlen - en;
-	kfree(km, aux);
-	if (1.0f - n_diff / blen < min_iden)
-		for (i = 0; i < n_regs; ++i)
-			regs[i].iden_flt = 1;
-}
-
 int mm_squeeze_a(void *km, int n_regs, mm_reg1_t *regs, mm128_t *a)
 { // squeeze out regions in a[] that are not referenced by regs[]
 	int i, as = 0;
@@ -375,7 +339,7 @@ void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs_, mm_r
 					r->parent = regs[r->parent].parent;
 			}
 		}
-		mm_filter_regs(km, opt, n_regs_, regs);
+		mm_filter_regs(km, opt, qlen, n_regs_, regs);
 		mm_sync_regs(km, *n_regs_, regs);
 	}
 }
@@ -428,8 +392,10 @@ mm_seg_t *mm_seg_gen(void *km, uint32_t hash, int n_segs, const int *qlens, int
 	for (s = 0; s < n_segs; ++s) {
 		regs[s] = mm_gen_regs(km, hash, qlens[s], seg[s].n_u, seg[s].u, seg[s].a);
 		n_regs[s] = seg[s].n_u;
-		for (i = 0; i < n_regs[s]; ++i)
+		for (i = 0; i < n_regs[s]; ++i) {
 			regs[s][i].seg_split = 1;
+			regs[s][i].seg_id = s;
+		}
 	}
 	return seg;
 }
@@ -442,30 +408,74 @@ void mm_seg_free(void *km, int n_segs, mm_seg_t *segs)
 	kfree(km, segs);
 }
 
-void mm_set_mapq(int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len)
+static void mm_set_inv_mapq(void *km, int n_regs, mm_reg1_t *regs)
+{
+	int i, n_aux;
+	uint64_t *aux;
+	if (n_regs < 3) return;
+	for (i = 0; i < n_regs; ++i)
+		if (regs[i].inv) break;
+	if (i == n_regs) return; // no inversion hits
+
+	aux = (uint64_t*)kmalloc(km, n_regs * 8);
+	for (i = n_aux = 0; i < n_regs; ++i)
+		if (regs[i].parent == i || regs[i].parent < 0)
+			aux[n_aux++] = (uint64_t)regs[i].as << 32 | i;
+	radix_sort_64(aux, aux + n_aux);
+
+	for (i = 1; i < n_aux - 1; ++i) {
+		mm_reg1_t *inv = &regs[(int32_t)aux[i]];
+		if (inv->inv) {
+			mm_reg1_t *l = &regs[(int32_t)aux[i-1]];
+			mm_reg1_t *r = &regs[(int32_t)aux[i+1]];
+			inv->mapq = l->mapq < r->mapq? l->mapq : r->mapq;
+		}
+	}
+	kfree(km, aux);
+}
+
+void mm_set_mapq(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr)
 {
 	static const float q_coef = 40.0f;
+	int64_t sum_sc = 0;
+	float uniq_ratio;
 	int i;
+	for (i = 0; i < n_regs; ++i)
+		if (regs[i].parent == regs[i].id)
+			sum_sc += regs[i].score;
+	uniq_ratio = (float)sum_sc / (sum_sc + rep_len);
 	for (i = 0; i < n_regs; ++i) {
 		mm_reg1_t *r = &regs[i];
 		if (r->inv) {
 			r->mapq = 0;
 		} else if (r->parent == r->id) {
 			int mapq, subsc;
-			float pen_s1 = (r->score > 100? 1.0f : 0.01f * r->score) * ((float)r->score / (r->score + rep_len));
+			float pen_s1 = (r->score > 100? 1.0f : 0.01f * r->score) * uniq_ratio;
 			float pen_cm = r->cnt > 10? 1.0f : 0.1f * r->cnt;
 			pen_cm = pen_s1 < pen_cm? pen_s1 : pen_cm;
 			subsc = r->subsc > min_chain_sc? r->subsc : min_chain_sc;
 			if (r->p && r->p->dp_max2 > 0 && r->p->dp_max > 0) {
 				float identity = (float)r->mlen / r->blen;
-				int mapq_alt = (int)(6.02f * identity * identity * (r->p->dp_max - r->p->dp_max2) / match_sc + .499f); // BWA-MEM like mapQ, mostly for short reads
+				float x = (float)r->p->dp_max2 * subsc / r->p->dp_max / r->score0;
-				mapq = (int)(identity * pen_cm * q_coef * (1. - (float)r->p->dp_max2 * subsc / r->p->dp_max / r->score) * logf(r->score)); // more for long reads
+				mapq = (int)(identity * pen_cm * q_coef * (1.0f - x * x) * logf((float)r->p->dp_max / match_sc));
-				mapq = mapq < mapq_alt? mapq : mapq_alt; // in case the long-read heuristic fails
+				if (!is_sr) {
-			} else mapq = (int)(pen_cm * q_coef * (1. - (float)subsc / r->score) * logf(r->score));
+					int mapq_alt = (int)(6.02f * identity * identity * (r->p->dp_max - r->p->dp_max2) / match_sc + .499f); // BWA-MEM like mapQ, mostly for short reads
+					mapq = mapq < mapq_alt? mapq : mapq_alt; // in case the long-read heuristic fails
+				}
+			} else {
+				float x = (float)subsc / r->score0;
+				if (r->p) {
+					float identity = (float)r->mlen / r->blen;
+					mapq = (int)(identity * pen_cm * q_coef * (1.0f - x) * logf((float)r->p->dp_max / match_sc));
+				} else {
+					mapq = (int)(pen_cm * q_coef * (1.0f - x) * logf(r->score));
+				}
+			}
 			mapq -= (int)(4.343f * logf(r->n_sub + 1) + .499f);
 			mapq = mapq > 0? mapq : 0;
 			r->mapq = mapq < 60? mapq : 60;
 			if (r->p && r->p->dp_max > r->p->dp_max2 && r->mapq == 0) r->mapq = 1;
 		} else r->mapq = 0;
 	}
+	mm_set_inv_mapq(km, n_regs, regs);
 }

index.c

@@ -7,6 +7,7 @@
 #endif
 #include <fcntl.h>
 #include <stdio.h>
+#define __STDC_LIMIT_MACROS
 #include "kthread.h"
 #include "bseq.h"
 #include "minimap.h"
@@ -19,6 +20,8 @@
 KHASH_INIT(idx, uint64_t, uint64_t, 1, idx_hash, idx_eq)
 typedef khash_t(idx) idxhash_t;
 
+KHASH_MAP_INIT_STR(str, uint32_t)
+
 #define kroundup64(x) (--(x), (x)|=(x)>>1, (x)|=(x)>>2, (x)|=(x)>>4, (x)|=(x)>>8, (x)|=(x)>>16, (x)|=(x)>>32, ++(x))
 
 typedef struct mm_idx_bucket_s {
@@ -28,22 +31,13 @@ typedef struct mm_idx_bucket_s {
 	void *h;     // hash table indexing _p_ and minimizers appearing once
 } mm_idx_bucket_t;
 
-void mm_idxopt_init(mm_idxopt_t *opt)
+mm_idx_t *mm_idx_init(int w, int k, int b, int flag)
-{
-	memset(opt, 0, sizeof(mm_idxopt_t));
-	opt->k = 15, opt->w = 10, opt->is_hpc = 0;
-	opt->bucket_bits = 14;
-	opt->mini_batch_size = 50000000;
-	opt->batch_size = 4000000000ULL;
-}
-
-mm_idx_t *mm_idx_init(int w, int k, int b, int is_hpc)
 {
 	mm_idx_t *mi;
 	if (k*2 < b) b = k * 2;
 	if (w < 1) w = 1;
 	mi = (mm_idx_t*)calloc(1, sizeof(mm_idx_t));
-	mi->w = w, mi->k = k, mi->b = b, mi->is_hpc = is_hpc;
+	mi->w = w, mi->k = k, mi->b = b, mi->flag = flag;
 	mi->B = (mm_idx_bucket_t*)calloc(1<<b, sizeof(mm_idx_bucket_t));
 	if (!(mm_dbg_flag & 1)) mi->km = km_init();
 	return mi;
@@ -53,6 +47,7 @@ void mm_idx_destroy(mm_idx_t *mi)
 {
 	int i;
 	if (mi == 0) return;
+	if (mi->h) kh_destroy(str, (khash_t(str)*)mi->h);
 	for (i = 0; i < 1<<mi->b; ++i) {
 		free(mi->B[i].p);
 		free(mi->B[i].a.a);
@@ -89,7 +84,7 @@ void mm_idx_stat(const mm_idx_t *mi)
 {
 	int i, n = 0, n1 = 0;
 	uint64_t sum = 0, len = 0;
-	fprintf(stderr, "[M::%s] kmer size: %d; skip: %d; is_HPC: %d; #seq: %d\n", __func__, mi->k, mi->w, mi->is_hpc, mi->n_seq);
+	fprintf(stderr, "[M::%s] kmer size: %d; skip: %d; is_hpc: %d; #seq: %d\n", __func__, mi->k, mi->w, mi->flag&MM_I_HPC, mi->n_seq);
 	for (i = 0; i < mi->n_seq; ++i)
 		len += mi->seq[i].len;
 	for (i = 0; i < 1<<mi->b; ++i)
@@ -108,6 +103,34 @@ void mm_idx_stat(const mm_idx_t *mi)
 			__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), n, 100.0*n1/n, (double)sum / n, (double)len / sum);
 }
 
+int mm_idx_index_name(mm_idx_t *mi)
+{
+	khash_t(str) *h;
+	uint32_t i;
+	int has_dup = 0, absent;
+	if (mi->h) return 0;
+	h = kh_init(str);
+	for (i = 0; i < mi->n_seq; ++i) {
+		khint_t k;
+		k = kh_put(str, h, mi->seq[i].name, &absent);
+		if (absent) kh_val(h, k) = i;
+		else has_dup = 1;
+	}
+	mi->h = h;
+	if (has_dup && mm_verbose >= 2)
+		fprintf(stderr, "[WARNING] some database sequences have identical sequence names\n");
+	return has_dup;
+}
+
+int mm_idx_name2id(const mm_idx_t *mi, const char *name)
+{
+	khash_t(str) *h = (khash_t(str)*)mi->h;
+	khint_t k;
+	if (h == 0) return -2;
+	k = kh_get(str, h, name);
+	return k == kh_end(h)? -1 : kh_val(h, k);
+}
+
 int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq)
 {
 	uint64_t i, st1, en1;
@@ -214,7 +237,7 @@ static void mm_idx_post(mm_idx_t *mi, int n_threads)
 #include "bseq.h"
 
 typedef struct {
-	int mini_batch_size, keep_name;
+	int mini_batch_size;
 	uint64_t batch_size, sum_len;
 	mm_bseq_file_t *fp;
 	mm_idx_t *mi;
@@ -246,7 +269,6 @@ static void *worker_pipeline(void *shared, int step, void *in)
 		s->seq = mm_bseq_read(p->fp, p->mini_batch_size, 0, &s->n_seq); // read a mini-batch
 		if (s->seq) {
 			uint32_t old_m, m;
-			uint64_t sum_len, old_max_len, max_len;
 			assert((uint64_t)p->mi->n_seq + s->n_seq <= UINT32_MAX); // to prevent integer overflow
 			// make room for p->mi->seq
 			old_m = p->mi->n_seq, m = p->mi->n_seq + s->n_seq;
@@ -254,30 +276,34 @@ static void *worker_pipeline(void *shared, int step, void *in)
 			if (old_m != m)
 				p->mi->seq = (mm_idx_seq_t*)krealloc(p->mi->km, p->mi->seq, m * sizeof(mm_idx_seq_t));
 			// make room for p->mi->S
-			for (i = 0, sum_len = 0; i < s->n_seq; ++i) sum_len += s->seq[i].l_seq;
+			if (!(p->mi->flag & MM_I_NO_SEQ)) {
-			old_max_len = (p->sum_len + 7) / 8;
+				uint64_t sum_len, old_max_len, max_len;
-			max_len = (p->sum_len + sum_len + 7) / 8;
+				for (i = 0, sum_len = 0; i < s->n_seq; ++i) sum_len += s->seq[i].l_seq;
-			kroundup64(old_max_len); kroundup64(max_len);
+				old_max_len = (p->sum_len + 7) / 8;
-			if (old_max_len != max_len) {
+				max_len = (p->sum_len + sum_len + 7) / 8;
-				p->mi->S = (uint32_t*)realloc(p->mi->S, max_len * 4);
+				kroundup64(old_max_len); kroundup64(max_len);
-				memset(&p->mi->S[old_max_len], 0, 4 * (max_len - old_max_len));
+				if (old_max_len != max_len) {
+					p->mi->S = (uint32_t*)realloc(p->mi->S, max_len * 4);
+					memset(&p->mi->S[old_max_len], 0, 4 * (max_len - old_max_len));
+				}
 			}
 			// populate p->mi->seq
 			for (i = 0; i < s->n_seq; ++i) {
 				mm_idx_seq_t *seq = &p->mi->seq[p->mi->n_seq];
 				uint32_t j;
-				if (p->keep_name) {
+				if (!(p->mi->flag & MM_I_NO_NAME)) {
-					assert(strlen(s->seq[i].name) <= 254); // a long query name breaks BAM
 					seq->name = (char*)kmalloc(p->mi->km, strlen(s->seq[i].name) + 1);
 					strcpy(seq->name, s->seq[i].name);
 				} else seq->name = 0;
 				seq->len = s->seq[i].l_seq;
 				seq->offset = p->sum_len;
 				// copy the sequence
-				for (j = 0; j < seq->len; ++j) { // TODO: this is not the fastest way, but let's first see if speed matters here
+				if (!(p->mi->flag & MM_I_NO_SEQ)) {
-					uint64_t o = p->sum_len + j;
+					for (j = 0; j < seq->len; ++j) { // TODO: this is not the fastest way, but let's first see if speed matters here
-					int c = seq_nt4_table[(uint8_t)s->seq[i].seq[j]];
+						uint64_t o = p->sum_len + j;
-					mm_seq4_set(p->mi->S, o, c);
+						int c = seq_nt4_table[(uint8_t)s->seq[i].seq[j]];
+						mm_seq4_set(p->mi->S, o, c);
+					}
 				}
 				// update p->sum_len and p->mi->n_seq
 				p->sum_len += seq->len;
@@ -289,7 +315,10 @@ static void *worker_pipeline(void *shared, int step, void *in)
         step_t *s = (step_t*)in;
 		for (i = 0; i < s->n_seq; ++i) {
 			mm_bseq1_t *t = &s->seq[i];
-			mm_sketch(0, t->seq, t->l_seq, p->mi->w, p->mi->k, t->rid, p->mi->is_hpc, &s->a);
+			if (t->l_seq > 0)
+				mm_sketch(0, t->seq, t->l_seq, p->mi->w, p->mi->k, t->rid, p->mi->flag&MM_I_HPC, &s->a);
+			else if (mm_verbose >= 2)
+				fprintf(stderr, "[WARNING] the length database sequence '%s' is 0\n", t->name);
 			free(t->seq); free(t->name);
 		}
 		free(s->seq); s->seq = 0;
@@ -302,16 +331,15 @@ static void *worker_pipeline(void *shared, int step, void *in)
     return 0;
 }
 
-mm_idx_t *mm_idx_gen(mm_bseq_file_t *fp, int w, int k, int b, int is_hpc, int mini_batch_size, int n_threads, uint64_t batch_size, int keep_name)
+mm_idx_t *mm_idx_gen(mm_bseq_file_t *fp, int w, int k, int b, int flag, int mini_batch_size, int n_threads, uint64_t batch_size)
 {
 	pipeline_t pl;
 	if (fp == 0 || mm_bseq_eof(fp)) return 0;
 	memset(&pl, 0, sizeof(pipeline_t));
 	pl.mini_batch_size = mini_batch_size < batch_size? mini_batch_size : batch_size;
-	pl.keep_name = keep_name;
 	pl.batch_size = batch_size;
 	pl.fp = fp;
-	pl.mi = mm_idx_init(w, k, b, is_hpc);
+	pl.mi = mm_idx_init(w, k, b, flag);
 
 	kt_pipeline(n_threads < 3? n_threads : 3, worker_pipeline, &pl, 3);
 	if (mm_verbose >= 3)
@@ -324,17 +352,60 @@ mm_idx_t *mm_idx_gen(mm_bseq_file_t *fp, int w, int k, int b, int is_hpc, int mi
 	return pl.mi;
 }
 
-mm_idx_t *mm_idx_build(const char *fn, int w, int k, int is_hpc, int n_threads) // a simpler interface
+mm_idx_t *mm_idx_build(const char *fn, int w, int k, int flag, int n_threads) // a simpler interface; deprecated
 {
 	mm_bseq_file_t *fp;
 	mm_idx_t *mi;
 	fp = mm_bseq_open(fn);
 	if (fp == 0) return 0;
-	mi = mm_idx_gen(fp, w, k, 14, is_hpc, 1<<18, n_threads, UINT64_MAX, 1);
+	mi = mm_idx_gen(fp, w, k, 14, flag, 1<<18, n_threads, UINT64_MAX);
 	mm_bseq_close(fp);
 	return mi;
 }
 
+mm_idx_t *mm_idx_str(int w, int k, int is_hpc, int bucket_bits, int n, const char **seq, const char **name)
+{
+	uint64_t sum_len = 0;
+	mm128_v a = {0,0,0};
+	mm_idx_t *mi;
+	int i, flag = 0;
+	if (n <= 0) return 0;
+	for (i = 0; i < n; ++i) // get the total length
+		sum_len += strlen(seq[i]);
+	if (is_hpc) flag |= MM_I_HPC;
+	if (name == 0) flag |= MM_I_NO_NAME;
+	if (bucket_bits < 0) bucket_bits = 14;
+	mi = mm_idx_init(w, k, bucket_bits, flag);
+	mi->n_seq = n;
+	mi->seq = (mm_idx_seq_t*)kcalloc(mi->km, n, sizeof(mm_idx_seq_t)); // ->seq is allocated from km
+	mi->S = (uint32_t*)calloc((sum_len + 7) / 8, 4);
+	for (i = 0, sum_len = 0; i < n; ++i) {
+		const char *s = seq[i];
+		mm_idx_seq_t *p = &mi->seq[i];
+		uint32_t j;
+		if (name && name[i]) {
+			p->name = (char*)kmalloc(mi->km, strlen(name[i]) + 1);
+			strcpy(p->name, name[i]);
+		}
+		p->offset = sum_len;
+		p->len = strlen(s);
+		for (j = 0; j < p->len; ++j) {
+			int c = seq_nt4_table[(uint8_t)s[j]];
+			uint64_t o = sum_len + j;
+			mm_seq4_set(mi->S, o, c);
+		}
+		sum_len += p->len;
+		if (p->len > 0) {
+			a.n = 0;
+			mm_sketch(0, s, p->len, w, k, i, is_hpc, &a);
+			mm_idx_add(mi, a.n, a.a);
+		}
+	}
+	free(a.a);
+	mm_idx_post(mi, 1);
+	return mi;
+}
+
 /*************
  * index I/O *
  *************/
@@ -345,7 +416,7 @@ void mm_idx_dump(FILE *fp, const mm_idx_t *mi)
 	uint32_t x[5];
 	int i;
 
-	x[0] = mi->w, x[1] = mi->k, x[2] = mi->b, x[3] = mi->n_seq, x[4] = mi->is_hpc;
+	x[0] = mi->w, x[1] = mi->k, x[2] = mi->b, x[3] = mi->n_seq, x[4] = mi->flag;
 	fwrite(MM_IDX_MAGIC, 1, 4, fp);
 	fwrite(x, 4, 5, fp);
 	for (i = 0; i < mi->n_seq; ++i) {
@@ -372,7 +443,8 @@ void mm_idx_dump(FILE *fp, const mm_idx_t *mi)
 			fwrite(x, 8, 2, fp);
 		}
 	}
-	fwrite(mi->S, 4, (sum_len + 7) / 8, fp);
+	if (!(mi->flag & MM_I_NO_SEQ))
+		fwrite(mi->S, 4, (sum_len + 7) / 8, fp);
 	fflush(fp);
 }
 
@@ -422,8 +494,10 @@ mm_idx_t *mm_idx_load(FILE *fp)
 			kh_val(h, k) = x[1];
 		}
 	}
-	mi->S = (uint32_t*)malloc((sum_len + 7) / 8 * 4);
+	if (!(mi->flag & MM_I_NO_SEQ)) {
-	fread(mi->S, 4, (sum_len + 7) / 8, fp);
+		mi->S = (uint32_t*)malloc((sum_len + 7) / 8 * 4);
+		fread(mi->S, 4, (sum_len + 7) / 8, fp);
+	}
 	return mi;
 }
 
@@ -477,10 +551,10 @@ mm_idx_t *mm_idx_reader_read(mm_idx_reader_t *r, int n_threads)
 	mm_idx_t *mi;
 	if (r->is_idx) {
 		mi = mm_idx_load(r->fp.idx);
-		if (mi && mm_verbose >= 2 && (mi->k != r->opt.k || mi->w != r->opt.w || mi->is_hpc != r->opt.is_hpc))
+		if (mi && mm_verbose >= 2 && (mi->k != r->opt.k || mi->w != r->opt.w || (mi->flag&MM_I_HPC) != (r->opt.flag&MM_I_HPC)))
 			fprintf(stderr, "[WARNING]\033[1;31m Indexing parameters (-k, -w or -H) overridden by parameters used in the prebuilt index.\033[0m\n");
 	} else
-		mi = mm_idx_gen(r->fp.seq, r->opt.w, r->opt.k, r->opt.bucket_bits, r->opt.is_hpc, r->opt.mini_batch_size, n_threads, r->opt.batch_size, 1);
+		mi = mm_idx_gen(r->fp.seq, r->opt.w, r->opt.k, r->opt.bucket_bits, r->opt.flag, r->opt.mini_batch_size, n_threads, r->opt.batch_size);
 	if (mi) {
 		if (r->fp_out) mm_idx_dump(r->fp_out, mi);
 		++r->n_parts;

kalloc.c

@@ -189,6 +189,10 @@ void km_stat(const void *_km, km_stat_t *s)
 			panic("[km_stat] The end of a free block enters another free block.");
 		if (p->ptr == km->loop_head) break;
 	}
-	for (p = km->core_head; p != NULL; p = p->ptr)
+	for (p = km->core_head; p != NULL; p = p->ptr) {
-		++s->n_cores, s->capacity += p->size * sizeof(header_t);
+		size_t size = p->size * sizeof(header_t);
+		++s->n_cores;
+		s->capacity += size;
+		s->largest = s->largest > size? s->largest : size;
+	}
 }

kalloc.h

@@ -8,7 +8,7 @@ extern "C" {
 #endif
 
 typedef struct {
-	size_t capacity, available, n_blocks, n_cores;
+	size_t capacity, available, n_blocks, n_cores, largest;
 } km_stat_t;
 
 void *kmalloc(void *km, size_t size);

ksort.h

@@ -39,7 +39,24 @@ typedef struct {
 
 #define KSORT_SWAP(type_t, a, b) { register type_t t=(a); (a)=(b); (b)=t; }
 
-#define KSORT_INIT(name, type_t, __sort_lt)								\
+#define KSORT_INIT(name, type_t, __sort_lt) \
+	void ks_heapdown_##name(size_t i, size_t n, type_t l[]) \
+	{ \
+		size_t k = i; \
+		type_t tmp = l[i]; \
+		while ((k = (k << 1) + 1) < n) { \
+			if (k != n - 1 && __sort_lt(l[k], l[k+1])) ++k; \
+			if (__sort_lt(l[k], tmp)) break; \
+			l[i] = l[k]; i = k; \
+		} \
+		l[i] = tmp; \
+	} \
+	void ks_heapmake_##name(size_t lsize, type_t l[]) \
+	{ \
+		size_t i; \
+		for (i = (lsize >> 1) - 1; i != (size_t)(-1); --i) \
+			ks_heapdown_##name(i, lsize, l); \
+	} \
 	type_t ks_ksmall_##name(size_t n, type_t arr[], size_t kk)			\
 	{																	\
 		type_t *low, *high, *k, *ll, *hh, *mid;							\

ksw2.h

@@ -14,6 +14,7 @@
 #define KSW_EZ_REV_CIGAR   0x80 // reverse CIGAR in the output
 #define KSW_EZ_SPLICE_FOR  0x100
 #define KSW_EZ_SPLICE_REV  0x200
+#define KSW_EZ_SPLICE_FLANK 0x400
 
 #ifdef __cplusplus
 extern "C" {
@@ -115,7 +116,7 @@ static inline uint32_t *ksw_push_cigar(void *km, int *n_cigar, int *m_cigar, uin
 //   bit 0-2: which type gets the max - 0 for H, 1 for E, 2 for F, 3 for \tilde{E} and 4 for \tilde{F}
 //   bit 3/0x08: 1 if a continuation on the E state (bit 5/0x20 for a continuation on \tilde{E})
 //   bit 4/0x10: 1 if a continuation on the F state (bit 6/0x40 for a continuation on \tilde{F})
-static inline void ksw_backtrack(void *km, int is_rot, int is_rev, int with_N, const uint8_t *p, const int *off, const int *off_end, int n_col, int i0, int j0,
+static inline void ksw_backtrack(void *km, int is_rot, int is_rev, int min_intron_len, const uint8_t *p, const int *off, const int *off_end, int n_col, int i0, int j0,
 								 int *m_cigar_, int *n_cigar_, uint32_t **cigar_)
 { // p[] - lower 3 bits: which type gets the max; bit
 	int n_cigar = 0, m_cigar = *m_cigar_, i = i0, j = j0, r, state = 0;
@@ -137,11 +138,11 @@ static inline void ksw_backtrack(void *km, int is_rot, int is_rev, int with_N, c
 		if (state == 0) state = tmp & 7; // TODO: probably this line can be merged into the "else if" line right above; not 100% sure
 		if (force_state >= 0) state = force_state;
 		if (state == 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 0, 1), --i, --j; // match
-		else if (state == 1 || (state == 3 && !with_N)) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 2, 1), --i; // deletion
+		else if (state == 1 || (state == 3 && min_intron_len <= 0)) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 2, 1), --i; // deletion
-		else if (state == 3 && with_N) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 3, 1), --i; // intron
+		else if (state == 3 && min_intron_len > 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 3, 1), --i; // intron
 		else cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 1, 1), --j; // insertion
 	}
-	if (i >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 2, i + 1); // first deletion
+	if (i >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, min_intron_len > 0 && i >= min_intron_len? 3 : 2, i + 1); // first deletion
 	if (j >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 1, j + 1); // first insertion
 	if (!is_rev)
 		for (i = 0; i < n_cigar>>1; ++i) // reverse CIGAR

ksw2_exts2_sse.c

@@ -111,19 +111,22 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
 
 	// set the donor and acceptor arrays. TODO: this assumes 0/1/2/3 encoding!
 	if (flag & (KSW_EZ_SPLICE_FOR|KSW_EZ_SPLICE_REV)) {
+		int semi_cost = flag&KSW_EZ_SPLICE_FLANK? -noncan/2 : 0; // GTr or yAG is worth 0.5 bit; see PMID:18688272
 		memset(donor, -noncan, tlen_ * 16);
-		for (t = 0; t < tlen - 2; ++t) {
+		for (t = 0; t < tlen - 4; ++t) {
-			int is_can = 0; // is a canonical site
+			int can_type = 0; // type of canonical site: 0=none, 1=GT/AG only, 2=GTr/yAG
-			if ((flag & KSW_EZ_SPLICE_FOR) && target[t+1] == 2 && target[t+2] == 3) is_can = 1;
+			if ((flag & KSW_EZ_SPLICE_FOR) && target[t+1] == 2 && target[t+2] == 3) can_type = 1; // GTr...
-			if ((flag & KSW_EZ_SPLICE_REV) && target[t+1] == 1 && target[t+2] == 3) is_can = 1;
+			if ((flag & KSW_EZ_SPLICE_REV) && target[t+1] == 1 && target[t+2] == 3) can_type = 1; // CTr...
-			if (is_can) ((int8_t*)donor)[t] = 0;
+			if (can_type && (target[t+3] == 0 || target[t+3] == 2)) can_type = 2;
+			if (can_type) ((int8_t*)donor)[t] = can_type == 2? 0 : semi_cost;
 		}
 		memset(acceptor, -noncan, tlen_ * 16);
 		for (t = 2; t < tlen; ++t) {
-			int is_can = 0;
+			int can_type = 0;
-			if ((flag & KSW_EZ_SPLICE_FOR) && target[t-1] == 0 && target[t] == 2) is_can = 1;
+			if ((flag & KSW_EZ_SPLICE_FOR) && target[t-1] == 0 && target[t] == 2) can_type = 1; // ...yAG
-			if ((flag & KSW_EZ_SPLICE_REV) && target[t-1] == 0 && target[t] == 1) is_can = 1;
+			if ((flag & KSW_EZ_SPLICE_REV) && target[t-1] == 0 && target[t] == 1) can_type = 1; // ...yAC
-			if (is_can) ((int8_t*)acceptor)[t] = 0;
+			if (can_type && (target[t-2] == 1 || target[t-2] == 3)) can_type = 2;
+			if (can_type) ((int8_t*)acceptor)[t] = can_type == 2? 0 : semi_cost;
 		}
 	}
 
@@ -364,9 +367,9 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
 	if (with_cigar) { // backtrack
 		int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
 		if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY))
-			ksw_backtrack(km, 1, rev_cigar, 1, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
+			ksw_backtrack(km, 1, rev_cigar, long_thres, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
 		else if (ez->max_t >= 0 && ez->max_q >= 0)
-			ksw_backtrack(km, 1, rev_cigar, 1, (uint8_t*)p, off, off_end, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
+			ksw_backtrack(km, 1, rev_cigar, long_thres, (uint8_t*)p, off, off_end, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
 		kfree(km, mem2); kfree(km, off);
 	}
 }

kthread.c

@@ -2,6 +2,7 @@
 #include <stdlib.h>
 #include <limits.h>
 #include <stdint.h>
+#include "kthread.h"
 
 #if (defined(WIN32) || defined(_WIN32)) && defined(_MSC_VER)
 #define __sync_fetch_and_add(ptr, addend)     _InterlockedExchangeAdd((void*)ptr, addend)

main.c

@@ -6,7 +6,7 @@
 #include "mmpriv.h"
 #include "getopt.h"
 
-#define MM_VERSION "2.3-r531"
+#define MM_VERSION "2.9-r720"
 
 #ifdef __linux__
 #include <sys/resource.h>
@@ -28,19 +28,29 @@ static struct option long_options[] = {
 	{ "seed",           required_argument, 0, 0 },
 	{ "no-kalloc",      no_argument,       0, 0 },
 	{ "print-qname",    no_argument,       0, 0 },
-	{ "no-self",        no_argument,       0, 0 },
+	{ "no-self",        no_argument,       0, 'D' },
 	{ "print-seeds",    no_argument,       0, 0 },
 	{ "max-chain-skip", required_argument, 0, 0 },
 	{ "min-dp-len",     required_argument, 0, 0 },
 	{ "print-aln-seq",  no_argument,       0, 0 },
 	{ "splice",         no_argument,       0, 0 },
-	{ "cost-non-gt-ag", required_argument, 0, 0 },
+	{ "cost-non-gt-ag", required_argument, 0, 'C' },
 	{ "no-long-join",   no_argument,       0, 0 },
 	{ "sr",             no_argument,       0, 0 },
-	{ "frag",           optional_argument, 0, 0 },
+	{ "frag",           required_argument, 0, 0 },
-	{ "secondary",      optional_argument, 0, 0 },
+	{ "secondary",      required_argument, 0, 0 },
 	{ "cs",             optional_argument, 0, 0 },
 	{ "end-bonus",      required_argument, 0, 0 },
+	{ "no-pairing",     no_argument,       0, 0 },
+	{ "splice-flank",   required_argument, 0, 0 },
+	{ "idx-no-seq",     no_argument,       0, 0 },
+	{ "end-seed-pen",   required_argument, 0, 0 },   // 21
+	{ "for-only",       no_argument,       0, 0 },   // 22
+	{ "rev-only",       no_argument,       0, 0 },   // 23
+	{ "heap-sort",      required_argument, 0, 0 },   // 24
+	{ "all-chain",      no_argument,       0, 'P' },
+	{ "dual",           required_argument, 0, 0 },   // 26
+	{ "max-clip-ratio", required_argument, 0, 0 },   // 27
 	{ "help",           no_argument,       0, 'h' },
 	{ "max-intron-len", required_argument, 0, 'G' },
 	{ "version",        no_argument,       0, 'V' },
@@ -63,9 +73,22 @@ static inline int64_t mm_parse_num(const char *str)
 	return (int64_t)(x + .499);
 }
 
+static inline void yes_or_no(mm_mapopt_t *opt, int flag, int long_idx, const char *arg, int yes_to_set)
+{
+	if (yes_to_set) {
+		if (strcmp(arg, "yes") == 0 || strcmp(arg, "y") == 0) opt->flag |= flag;
+		else if (strcmp(arg, "no") == 0 || strcmp(arg, "n") == 0) opt->flag &= ~flag;
+		else fprintf(stderr, "[WARNING]\033[1;31m option '--%s' only accepts 'yes' or 'no'.\033[0m\n", long_options[long_idx].name);
+	} else {
+		if (strcmp(arg, "yes") == 0 || strcmp(arg, "y") == 0) opt->flag &= ~flag;
+		else if (strcmp(arg, "no") == 0 || strcmp(arg, "n") == 0) opt->flag |= flag;
+		else fprintf(stderr, "[WARNING]\033[1;31m option '--%s' only accepts 'yes' or 'no'.\033[0m\n", long_options[long_idx].name);
+	}
+}
+
 int main(int argc, char *argv[])
 {
-	const char *opt_str = "2aSw:k:K:t:r:f:Vv:g:G:I:d:XT:s:x:Hcp:M:n:z:A:B:O:E:m:N:Qu:R:hF:i:L";
+	const char *opt_str = "2aSDw:k:K:t:r:f:Vv:g:G:I:d:XT:s:x:Hcp:M:n:z:A:B:O:E:m:N:Qu:R:hF:LC:";
 	mm_mapopt_t opt;
 	mm_idxopt_t ipt;
 	int i, c, n_threads = 3, long_idx;
@@ -92,7 +115,7 @@ int main(int argc, char *argv[])
 	while ((c = getopt_long(argc, argv, opt_str, long_options, &long_idx)) >= 0) {
 		if (c == 'w') ipt.w = atoi(optarg);
 		else if (c == 'k') ipt.k = atoi(optarg);
-		else if (c == 'H') ipt.is_hpc = 1;
+		else if (c == 'H') ipt.flag |= MM_I_HPC;
 		else if (c == 'd') fnw = optarg; // the above are indexing related options, except -I
 		else if (c == 'r') opt.bw = (int)mm_parse_num(optarg);
 		else if (c == 't') n_threads = atoi(optarg);
@@ -100,22 +123,24 @@ int main(int argc, char *argv[])
 		else if (c == 'g') opt.max_gap = (int)mm_parse_num(optarg);
 		else if (c == 'G') mm_mapopt_max_intron_len(&opt, (int)mm_parse_num(optarg));
 		else if (c == 'F') opt.max_frag_len = (int)mm_parse_num(optarg);
-		else if (c == 'i') opt.min_iden = atof(optarg);
 		else if (c == 'N') opt.best_n = atoi(optarg);
 		else if (c == 'p') opt.pri_ratio = atof(optarg);
 		else if (c == 'M') opt.mask_level = atof(optarg);
 		else if (c == 'c') opt.flag |= MM_F_OUT_CG | MM_F_CIGAR;
-		else if (c == 'X') opt.flag |= MM_F_AVA | MM_F_NO_SELF;
+		else if (c == 'D') opt.flag |= MM_F_NO_DIAG;
+		else if (c == 'P') opt.flag |= MM_F_ALL_CHAINS;
+		else if (c == 'X') opt.flag |= MM_F_ALL_CHAINS | MM_F_NO_DIAG | MM_F_NO_DUAL | MM_F_NO_LJOIN; // -D -P --no-long-join --dual=no
 		else if (c == 'a') opt.flag |= MM_F_OUT_SAM | MM_F_CIGAR;
 		else if (c == 'Q') opt.flag |= MM_F_NO_QUAL;
+		else if (c == 'Y') opt.flag |= MM_F_SOFTCLIP;
 		else if (c == 'L') opt.flag |= MM_F_LONG_CIGAR;
 		else if (c == 'T') opt.sdust_thres = atoi(optarg);
 		else if (c == 'n') opt.min_cnt = atoi(optarg);
 		else if (c == 'm') opt.min_chain_score = atoi(optarg);
 		else if (c == 'A') opt.a = atoi(optarg);
 		else if (c == 'B') opt.b = atoi(optarg);
-		else if (c == 'z') opt.zdrop = atoi(optarg);
 		else if (c == 's') opt.min_dp_max = atoi(optarg);
+		else if (c == 'C') opt.noncan = atoi(optarg);
 		else if (c == 'I') ipt.batch_size = mm_parse_num(optarg);
 		else if (c == 'K') opt.mini_batch_size = (int)mm_parse_num(optarg);
 		else if (c == 'R') rg = optarg;
@@ -125,24 +150,24 @@ int main(int argc, char *argv[])
 		else if (c == 0 && long_idx == 2) opt.seed = atoi(optarg); // --seed
 		else if (c == 0 && long_idx == 3) mm_dbg_flag |= MM_DBG_NO_KALLOC; // --no-kalloc
 		else if (c == 0 && long_idx == 4) mm_dbg_flag |= MM_DBG_PRINT_QNAME; // --print-qname
-		else if (c == 0 && long_idx == 5) opt.flag |= MM_F_NO_SELF; // --no-self
 		else if (c == 0 && long_idx == 6) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_SEED, n_threads = 1; // --print-seed
 		else if (c == 0 && long_idx == 7) opt.max_chain_skip = atoi(optarg); // --max-chain-skip
 		else if (c == 0 && long_idx == 8) opt.min_ksw_len = atoi(optarg); // --min-dp-len
-		else if (c == 0 && long_idx == 9) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_ALN_SEQ; // --print-aln-seq
+		else if (c == 0 && long_idx == 9) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_ALN_SEQ, n_threads = 1; // --print-aln-seq
 		else if (c == 0 && long_idx ==10) opt.flag |= MM_F_SPLICE; // --splice
-		else if (c == 0 && long_idx ==11) opt.noncan = atoi(optarg); // --cost-non-gt-ag
 		else if (c == 0 && long_idx ==12) opt.flag |= MM_F_NO_LJOIN; // --no-long-join
 		else if (c == 0 && long_idx ==13) opt.flag |= MM_F_SR; // --sr
 		else if (c == 0 && long_idx ==17) opt.end_bonus = atoi(optarg); // --end-bonus
+		else if (c == 0 && long_idx ==18) opt.flag |= MM_F_INDEPEND_SEG; // --no-pairing
+		else if (c == 0 && long_idx ==20) ipt.flag |= MM_I_NO_SEQ; // --idx-no-seq
+		else if (c == 0 && long_idx ==21) opt.anchor_ext_shift = atoi(optarg); // --end-seed-pen
+		else if (c == 0 && long_idx ==22) opt.flag |= MM_F_FOR_ONLY; // --for-only
+		else if (c == 0 && long_idx ==23) opt.flag |= MM_F_REV_ONLY; // --rev-only
+		else if (c == 0 && long_idx ==27) opt.max_clip_ratio = atof(optarg); // --max-clip-ratio
 		else if (c == 0 && long_idx == 14) { // --frag
-			if (optarg == 0 || strcmp(optarg, "yes") == 0 || strcmp(optarg, "y") == 0)
+			yes_or_no(&opt, MM_F_FRAG_MODE, long_idx, optarg, 1);
-				opt.flag |= MM_F_FRAG_MODE;
-			else opt.flag &= ~MM_F_FRAG_MODE;
 		} else if (c == 0 && long_idx == 15) { // --secondary
-			if (optarg == 0 || strcmp(optarg, "yes") == 0 || strcmp(optarg, "y") == 0)
+			yes_or_no(&opt, MM_F_NO_PRINT_2ND, long_idx, optarg, 0);
-				opt.flag &= ~MM_F_NO_PRINT_2ND;
-			else opt.flag |= MM_F_NO_PRINT_2ND;
 		} else if (c == 0 && long_idx == 16) { // --cs
 			opt.flag |= MM_F_OUT_CS | MM_F_CIGAR;
 			if (optarg == 0 || strcmp(optarg, "short") == 0) {
@@ -154,6 +179,12 @@ int main(int argc, char *argv[])
 			} else if (mm_verbose >= 2) {
 				fprintf(stderr, "[WARNING]\033[1;31m --cs only takes 'short' or 'long'. Invalid values are assumed to be 'short'.\033[0m\n");
 			}
+		} else if (c == 0 && long_idx == 19) { // --splice-flank
+			yes_or_no(&opt, MM_F_SPLICE_FLANK, long_idx, optarg, 1);
+		} else if (c == 0 && long_idx == 24) { // --heap-sort
+			yes_or_no(&opt, MM_F_HEAP_SORT, long_idx, optarg, 1);
+		} else if (c == 0 && long_idx == 26) { // --dual
+			yes_or_no(&opt, MM_F_NO_DUAL, long_idx, optarg, 0);
 		} else if (c == 'S') {
 			opt.flag |= MM_F_OUT_CS | MM_F_CIGAR | MM_F_OUT_CS_LONG;
 			if (mm_verbose >= 2)
@@ -177,6 +208,9 @@ int main(int argc, char *argv[])
 				fprintf(stderr, "[ERROR]\033[1;31m unrecognized cDNA direction\033[0m\n");
 				return 1;
 			}
+		} else if (c == 'z') {
+			opt.zdrop = opt.zdrop_inv = strtol(optarg, &s, 10);
+			if (*s == ',') opt.zdrop_inv = strtol(s + 1, &s, 10);
 		} else if (c == 'O') {
 			opt.q = opt.q2 = strtol(optarg, &s, 10);
 			if (*s == ',') opt.q2 = strtol(s + 1, &s, 10);
@@ -189,6 +223,10 @@ int main(int argc, char *argv[])
 		fprintf(stderr, "[ERROR]\033[1;31m --splice and --frag should not be specified at the same time.\033[0m\n");
 		return 1;
 	}
+	if (!fnw && !(opt.flag&MM_F_CIGAR))
+		ipt.flag |= MM_I_NO_SEQ;
+	if (mm_check_opt(&ipt, &opt) < 0)
+		return 1;
 
 	if (argc == optind || fp_help == stdout) {
 		fprintf(fp_help, "Usage: minimap2 [options] <target.fa>|<target.idx> [query.fa] [...]\n");
@@ -216,10 +254,9 @@ int main(int argc, char *argv[])
 		fprintf(fp_help, "    -B INT       mismatch penalty [%d]\n", opt.b);
 		fprintf(fp_help, "    -O INT[,INT] gap open penalty [%d,%d]\n", opt.q, opt.q2);
 		fprintf(fp_help, "    -E INT[,INT] gap extension penalty; a k-long gap costs min{O1+k*E1,O2+k*E2} [%d,%d]\n", opt.e, opt.e2);
-		fprintf(fp_help, "    -z INT       Z-drop score [%d]\n", opt.zdrop);
+		fprintf(fp_help, "    -z INT[,INT] Z-drop score and inversion Z-drop score [%d,%d]\n", opt.zdrop, opt.zdrop_inv);
 		fprintf(fp_help, "    -s INT       minimal peak DP alignment score [%d]\n", opt.min_dp_max);
 		fprintf(fp_help, "    -u CHAR      how to find GT-AG. f:transcript strand, b:both strands, n:don't match GT-AG [n]\n");
-		fprintf(fp_help, "    -i FLOAT     min identity (mapQ reduced to 0 if below) [0]\n");
 		fprintf(fp_help, "  Input/Output:\n");
 		fprintf(fp_help, "    -a           output in the SAM format (PAF by default)\n");
 		fprintf(fp_help, "    -Q           don't output base quality in SAM\n");
@@ -227,6 +264,7 @@ int main(int argc, char *argv[])
 		fprintf(fp_help, "    -R STR       SAM read group line in a format like '@RG\\tID:foo\\tSM:bar' []\n");
 		fprintf(fp_help, "    -c           output CIGAR in PAF\n");
 		fprintf(fp_help, "    --cs[=STR]   output the cs tag; STR is 'short' (if absent) or 'long' [none]\n");
+		fprintf(fp_help, "    -Y           use soft clipping for supplementary alignments\n");
 		fprintf(fp_help, "    -t INT       number of threads [%d]\n", n_threads);
 		fprintf(fp_help, "    -K NUM       minibatch size for mapping [500M]\n");
 //		fprintf(fp_help, "    -v INT       verbose level [%d]\n", mm_verbose);
@@ -237,14 +275,18 @@ int main(int argc, char *argv[])
 		fprintf(fp_help, "                 map-ont: -k15 (Oxford Nanopore vs reference mapping)\n");
 		fprintf(fp_help, "                 asm5: -k19 -w19 -A1 -B19 -O39,81 -E3,1 -s200 -z200 (asm to ref mapping; break at 5%% div.)\n");
 		fprintf(fp_help, "                 asm10: -k19 -w19 -A1 -B9 -O16,41 -E2,1 -s200 -z200 (asm to ref mapping; break at 10%% div.)\n");
-		fprintf(fp_help, "                 ava-pb: -Hk19 -w5 -Xp0 -m100 -g10000 --max-chain-skip 25 (PacBio read overlap)\n");
+		fprintf(fp_help, "                 ava-pb: -Hk19 -Xw5 -m100 -g10000 --max-chain-skip 25 (PacBio read overlap)\n");
-		fprintf(fp_help, "                 ava-ont: -k15 -w5 -Xp0 -m100 -g10000 --max-chain-skip 25 (ONT read overlap)\n");
+		fprintf(fp_help, "                 ava-ont: -k15 -Xw5 -m100 -g10000 --max-chain-skip 25 (ONT read overlap)\n");
 		fprintf(fp_help, "                 splice: long-read spliced alignment (see minimap2.1 for details)\n");
 		fprintf(fp_help, "                 sr: short single-end reads without splicing (see minimap2.1 for details)\n");
 		fprintf(fp_help, "\nSee `man ./minimap2.1' for detailed description of command-line options.\n");
 		return fp_help == stdout? 0 : 1;
 	}
 
+	if ((opt.flag & MM_F_SR) && argc - optind > 3) {
+		fprintf(stderr, "[ERROR] incorrect input: in the sr mode, please specify no more than two query files.\n");
+		return 1;
+	}
 	idx_rdr = mm_idx_reader_open(argv[optind], &ipt, fnw);
 	if (idx_rdr == 0) {
 		fprintf(stderr, "[ERROR] failed to open file '%s'\n", argv[optind]);
@@ -252,11 +294,18 @@ int main(int argc, char *argv[])
 	}
 	if (!idx_rdr->is_idx && fnw == 0 && argc - optind < 2) {
 		fprintf(stderr, "[ERROR] missing input: please specify a query file to map or option -d to keep the index\n");
+		mm_idx_reader_close(idx_rdr);
 		return 1;
 	}
 	if (opt.best_n == 0 && (opt.flag&MM_F_CIGAR) && mm_verbose >= 2)
 		fprintf(stderr, "[WARNING]\033[1;31m `-N 0' reduces alignment accuracy. Please use --secondary=no to suppress secondary alignments.\033[0m\n");
 	while ((mi = mm_idx_reader_read(idx_rdr, n_threads)) != 0) {
+		if ((opt.flag & MM_F_CIGAR) && (mi->flag & MM_I_NO_SEQ)) {
+			fprintf(stderr, "[ERROR] the prebuilt index doesn't contain sequences.\n");
+			mm_idx_destroy(mi);
+			mm_idx_reader_close(idx_rdr);
+			return 1;
+		}
 		if ((opt.flag & MM_F_OUT_SAM) && idx_rdr->n_parts == 1) {
 			if (mm_idx_reader_eof(idx_rdr)) {
 				mm_write_sam_hdr(mi, rg, MM_VERSION, argc, argv);

map.c

@@ -9,121 +9,7 @@
 #include "bseq.h"
 #include "khash.h"
 
-void mm_mapopt_init(mm_mapopt_t *opt)
-{
-	memset(opt, 0, sizeof(mm_mapopt_t));
-	opt->seed = 11;
-	opt->mid_occ_frac = 2e-4f;
-	opt->sdust_thres = 0; // no SDUST masking
-
-	opt->min_cnt = 3;
-	opt->min_chain_score = 40;
-	opt->bw = 500;
-	opt->max_gap = 5000;
-	opt->max_gap_ref = -1;
-	opt->max_chain_skip = 25;
-
-	opt->mask_level = 0.5f;
-	opt->pri_ratio = 0.8f;
-	opt->best_n = 5;
-
-	opt->max_join_long = 20000;
-	opt->max_join_short = 2000;
-	opt->min_join_flank_sc = 1000;
-
-	opt->a = 2, opt->b = 4, opt->q = 4, opt->e = 2, opt->q2 = 24, opt->e2 = 1;
-	opt->zdrop = 400;
-	opt->end_bonus = -1;
-	opt->min_dp_max = opt->min_chain_score * opt->a;
-	opt->min_ksw_len = 200;
-	opt->mini_batch_size = 500000000;
-
-	opt->pe_ori = 0; // FF
-	opt->pe_bonus = 33;
-}
-
-void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
-{
-	if ((opt->flag & MM_F_SPLICE_FOR) && (opt->flag & MM_F_SPLICE_REV))
-		opt->flag |= MM_F_SPLICE;
-	if (opt->mid_occ <= 0)
-		opt->mid_occ = mm_idx_cal_max_occ(mi, opt->mid_occ_frac);
-	if (mm_verbose >= 3)
-		fprintf(stderr, "[M::%s::%.3f*%.2f] mid_occ = %d\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), opt->mid_occ);
-}
-
-void mm_mapopt_max_intron_len(mm_mapopt_t *opt, int max_intron_len)
-{
-	if ((opt->flag & MM_F_SPLICE) && max_intron_len > 0)
-		opt->max_gap_ref = opt->bw = max_intron_len;
-}
-
-int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
-{
-	if (preset == 0) {
-		mm_idxopt_init(io);
-		mm_mapopt_init(mo);
-	} else if (strcmp(preset, "ava-ont") == 0) {
-		io->is_hpc = 0, io->k = 15, io->w = 5;
-		mo->flag |= MM_F_AVA | MM_F_NO_SELF;
-		mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_gap = 10000, mo->max_chain_skip = 25;
-	} else if (strcmp(preset, "ava-pb") == 0) {
-		io->is_hpc = 1, io->k = 19, io->w = 5;
-		mo->flag |= MM_F_AVA | MM_F_NO_SELF;
-		mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_gap = 10000, mo->max_chain_skip = 25;
-	} else if (strcmp(preset, "map10k") == 0 || strcmp(preset, "map-pb") == 0) {
-		io->is_hpc = 1, io->k = 19;
-	} else if (strcmp(preset, "map-ont") == 0) {
-		io->is_hpc = 0, io->k = 15;
-	} else if (strcmp(preset, "asm5") == 0) {
-		io->is_hpc = 0, io->k = 19, io->w = 19;
-		mo->a = 1, mo->b = 19, mo->q = 39, mo->q2 = 81, mo->e = 3, mo->e2 = 1, mo->zdrop = 200;
-		mo->min_dp_max = 200;
-		mo->best_n = 50;
-	} else if (strcmp(preset, "asm10") == 0) {
-		io->is_hpc = 0, io->k = 19, io->w = 19;
-		mo->a = 1, mo->b = 9, mo->q = 16, mo->q2 = 41, mo->e = 2, mo->e2 = 1, mo->zdrop = 200;
-		mo->min_dp_max = 200;
-		mo->best_n = 50;
-	} else if (strcmp(preset, "short") == 0 || strcmp(preset, "sr") == 0) {
-		io->is_hpc = 0, io->k = 21, io->w = 11;
-		mo->flag |= MM_F_SR | MM_F_FRAG_MODE | MM_F_NO_PRINT_2ND | MM_F_2_IO_THREADS;
-		mo->pe_ori = 0<<1|1; // FR
-		mo->a = 2, mo->b = 8, mo->q = 12, mo->e = 2, mo->q2 = 24, mo->e2 = 1;
-		mo->zdrop = 100;
-		mo->end_bonus = 10;
-		mo->max_frag_len = 800;
-		mo->max_gap = 100;
-		mo->bw = 100;
-		mo->pri_ratio = 0.5f;
-		mo->min_cnt = 2;
-		mo->min_chain_score = 25;
-		mo->min_dp_max = 40;
-		mo->best_n = 20;
-		mo->mid_occ = 1000;
-		mo->max_occ = 5000;
-		mo->mini_batch_size = 50000000;
-	} else if (strcmp(preset, "splice") == 0 || strcmp(preset, "cdna") == 0) {
-		io->is_hpc = 0, io->k = 15, io->w = 5;
-		mo->flag |= MM_F_SPLICE | MM_F_SPLICE_FOR | MM_F_SPLICE_REV;
-		mo->max_gap = 2000, mo->max_gap_ref = mo->bw = 200000;
-		mo->a = 1, mo->b = 2, mo->q = 2, mo->e = 1, mo->q2 = 32, mo->e2 = 0;
-		mo->noncan = 5;
-		mo->zdrop = 200;
-	} else return -1;
-	return 0;
-}
-
-typedef struct {
-	uint32_t n;
-	uint32_t qpos;
-	uint32_t seg_id;
-	const uint64_t *cr;
-} mm_match_t;
-
 struct mm_tbuf_s {
-	sdust_buf_t *sdb;
-	mm128_v mini;
 	void *km;
 };
 
@@ -132,24 +18,23 @@ mm_tbuf_t *mm_tbuf_init(void)
 	mm_tbuf_t *b;
 	b = (mm_tbuf_t*)calloc(1, sizeof(mm_tbuf_t));
 	if (!(mm_dbg_flag & 1)) b->km = km_init();
-	b->sdb = sdust_buf_init(b->km);
 	return b;
 }
 
 void mm_tbuf_destroy(mm_tbuf_t *b)
 {
 	if (b == 0) return;
-	kfree(b->km, b->mini.a);
-	sdust_buf_destroy(b->sdb);
 	km_destroy(b->km);
 	free(b);
 }
 
-static int mm_dust_minier(int n, mm128_t *a, int l_seq, const char *seq, int sdust_thres, sdust_buf_t *sdb)
+static int mm_dust_minier(void *km, int n, mm128_t *a, int l_seq, const char *seq, int sdust_thres)
 {
 	int n_dreg, j, k, u = 0;
 	const uint64_t *dreg;
-	if (sdust_thres <= 0 || sdb == 0) return n;
+	sdust_buf_t *sdb;
+	if (sdust_thres <= 0) return n;
+	sdb = sdust_buf_init(km);
 	dreg = sdust_core((const uint8_t*)seq, l_seq, sdust_thres, 64, &n_dreg, sdb);
 	for (j = k = 0; j < n; ++j) { // squeeze out minimizers that significantly overlap with LCRs
 		int32_t qpos = (uint32_t)a[j].y>>1, span = a[j].x&0xff;
@@ -163,103 +48,209 @@ static int mm_dust_minier(int n, mm128_t *a, int l_seq, const char *seq, int sdu
 				l += ee - ss;
 			}
 			if (l <= span>>1) a[k++] = a[j]; // keep the minimizer if less than half of it falls in masked region
-		}
+		} else a[k++] = a[j];
 	}
+	sdust_buf_destroy(sdb);
 	return k; // the new size
 }
 
-static void collect_minimizers(const mm_mapopt_t *opt, const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, mm_tbuf_t *b)
+static void collect_minimizers(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, mm128_v *mv)
 {
 	int i, j, n, sum = 0;
-	b->mini.n = 0;
+	mv->n = 0;
 	for (i = n = 0; i < n_segs; ++i) {
-		mm_sketch(b->km, seqs[i], qlens[i], mi->w, mi->k, i, mi->is_hpc, &b->mini);
+		mm_sketch(km, seqs[i], qlens[i], mi->w, mi->k, i, mi->flag&MM_I_HPC, mv);
-		for (j = n; j < b->mini.n; ++j)
+		for (j = n; j < mv->n; ++j)
-			b->mini.a[j].y += sum << 1;
+			mv->a[j].y += sum << 1;
 		if (opt->sdust_thres > 0) // mask low-complexity minimizers
-			b->mini.n = n + mm_dust_minier(b->mini.n - n, b->mini.a + n, qlens[i], seqs[i], opt->sdust_thres, b->sdb);
+			mv->n = n + mm_dust_minier(km, mv->n - n, mv->a + n, qlens[i], seqs[i], opt->sdust_thres);
-		sum += qlens[i], n = b->mini.n;
+		sum += qlens[i], n = mv->n;
 	}
 }
 
-static mm128_t *collect_seed_hits(const mm_mapopt_t *opt, int max_occ, const mm_idx_t *mi, const char *qname, int qlen, int64_t *n_a, int *rep_len, mm_tbuf_t *b)
+#include "ksort.h"
-{
+#define heap_lt(a, b) ((a).x > (b).x)
-	int rep_st = 0, rep_en = 0, i;
+KSORT_INIT(heap, mm128_t, heap_lt)
-	mm_match_t *m;
-	mm128_t *a;
 
-	m = (mm_match_t*)kmalloc(b->km, b->mini.n * sizeof(mm_match_t));
+typedef struct {
-	for (i = 0; i < b->mini.n; ++i) {
+	uint32_t n;
+	uint32_t q_pos, q_span;
+	uint32_t seg_id:31, is_tandem:1;
+	const uint64_t *cr;
+} mm_match_t;
+
+static mm_match_t *collect_matches(void *km, int *_n_m, int max_occ, const mm_idx_t *mi, const mm128_v *mv, int64_t *n_a, int *rep_len, int *n_mini_pos, uint64_t **mini_pos)
+{
+	int i, rep_st = 0, rep_en = 0, n_m;
+	mm_match_t *m;
+	*n_mini_pos = 0;
+	*mini_pos = (uint64_t*)kmalloc(km, mv->n * sizeof(uint64_t));
+	m = (mm_match_t*)kmalloc(km, mv->n * sizeof(mm_match_t));
+	for (i = n_m = 0, *rep_len = 0, *n_a = 0; i < mv->n; ++i) {
+		const uint64_t *cr;
+		mm128_t *p = &mv->a[i];
+		uint32_t q_pos = (uint32_t)p->y, q_span = p->x & 0xff;
 		int t;
-		mm128_t *p = &b->mini.a[i];
+		cr = mm_idx_get(mi, p->x>>8, &t);
-		m[i].qpos = (uint32_t)p->y;
+		if (t >= max_occ) {
-		m[i].cr = mm_idx_get(mi, p->x>>8, &t);
+			int en = (q_pos >> 1) + 1, st = en - q_span;
-		m[i].n = t;
-		m[i].seg_id = p->y >> 32;
-	}
-	for (i = 0, *n_a = 0; i < b->mini.n; ++i) // find the length of a[]
-		if (m[i].n < max_occ) *n_a += m[i].n;
-	a = (mm128_t*)kmalloc(b->km, *n_a * sizeof(mm128_t));
-	for (i = *rep_len = 0, *n_a = 0; i < b->mini.n; ++i) {
-		mm128_t *p = &b->mini.a[i];
-		mm_match_t *q = &m[i];
-		const uint64_t *r = q->cr;
-		int k, q_span = p->x & 0xff, is_tandem = 0;
-		if (q->n >= max_occ) {
-			int en = (q->qpos>>1) + 1, st = en - q_span;
 			if (st > rep_en) {
 				*rep_len += rep_en - rep_st;
 				rep_st = st, rep_en = en;
 			} else rep_en = en;
-			continue;
+		} else {
-		}
+			mm_match_t *q = &m[n_m++];
-		if (i > 0 && p->x>>8 == b->mini.a[i - 1].x>>8) is_tandem = 1;
+			q->q_pos = q_pos, q->q_span = q_span, q->cr = cr, q->n = t, q->seg_id = p->y >> 32;
-		if (i < b->mini.n - 1 && p->x>>8 == b->mini.a[i + 1].x>>8) is_tandem = 1;
+			q->is_tandem = 0;
-		for (k = 0; k < q->n; ++k) {
+			if (i > 0 && p->x>>8 == mv->a[i - 1].x>>8) q->is_tandem = 1;
-			int32_t rpos = (uint32_t)r[k] >> 1;
+			if (i < mv->n - 1 && p->x>>8 == mv->a[i + 1].x>>8) q->is_tandem = 1;
-			mm128_t *p;
+			*n_a += q->n;
-			if (qname && (opt->flag&(MM_F_NO_SELF|MM_F_AVA))) {
+			(*mini_pos)[(*n_mini_pos)++] = (uint64_t)q_span<<32 | q_pos>>1;
-				const char *tname = mi->seq[r[k]>>32].name;
-				int cmp;
-				cmp = strcmp(qname, tname);
-				if ((opt->flag&MM_F_NO_SELF) && cmp == 0 && rpos == (q->qpos>>1)) // avoid the diagonal
-					continue;
-				if ((opt->flag&MM_F_AVA) && cmp > 0) // all-vs-all mode: map once
-					continue;
-			}
-			p = &a[(*n_a)++];
-			if ((r[k]&1) == (q->qpos&1)) { // forward strand
-				p->x = (r[k]&0xffffffff00000000ULL) | rpos;
-				p->y = (uint64_t)q_span << 32 | q->qpos >> 1;
-			} else { // reverse strand
-				p->x = 1ULL<<63 | (r[k]&0xffffffff00000000ULL) | rpos;
-				p->y = (uint64_t)q_span << 32 | (qlen - ((q->qpos>>1) + 1 - q_span) - 1);
-			}
-			p->y |= (uint64_t)q->seg_id << MM_SEED_SEG_SHIFT;
-			if (is_tandem) p->y |= MM_SEED_TANDEM;
 		}
 	}
 	*rep_len += rep_en - rep_st;
-	kfree(b->km, m);
+	*_n_m = n_m;
+	return m;
+}
+
+static inline int skip_seed(int flag, uint64_t r, const mm_match_t *q, const char *qname, int qlen, const mm_idx_t *mi, int *is_self)
+{
+	*is_self = 0;
+	if (qname && (flag & (MM_F_NO_DIAG|MM_F_NO_DUAL))) {
+		const mm_idx_seq_t *s = &mi->seq[r>>32];
+		int cmp;
+		cmp = strcmp(qname, s->name);
+		if ((flag&MM_F_NO_DIAG) && cmp == 0 && s->len == qlen) {
+			if ((uint32_t)r>>1 == (q->q_pos>>1)) return 1; // avoid the diagnonal anchors
+			if ((r&1) == (q->q_pos&1)) *is_self = 1; // this flag is used to avoid spurious extension on self chain
+		}
+		if ((flag&MM_F_NO_DUAL) && cmp > 0) // all-vs-all mode: map once
+			return 1;
+	}
+	if (flag & (MM_F_FOR_ONLY|MM_F_REV_ONLY)) {
+		if ((r&1) == (q->q_pos&1)) { // forward strand
+			if (flag & MM_F_REV_ONLY) return 1;
+		} else {
+			if (flag & MM_F_FOR_ONLY) return 1;
+		}
+	}
+	return 0;
+}
+
+static mm128_t *collect_seed_hits_heap(void *km, const mm_mapopt_t *opt, int max_occ, const mm_idx_t *mi, const char *qname, const mm128_v *mv, int qlen, int64_t *n_a, int *rep_len,
+								  int *n_mini_pos, uint64_t **mini_pos)
+{
+	int i, n_m, heap_size = 0;
+	int64_t j, n_for = 0, n_rev = 0;
+	mm_match_t *m;
+	mm128_t *a, *heap;
+
+	m = collect_matches(km, &n_m, max_occ, mi, mv, n_a, rep_len, n_mini_pos, mini_pos);
+
+	heap = (mm128_t*)kmalloc(km, n_m * sizeof(mm128_t));
+	a = (mm128_t*)kmalloc(km, *n_a * sizeof(mm128_t));
+
+	for (i = 0, heap_size = 0; i < n_m; ++i) {
+		if (m[i].n > 0) {
+			heap[heap_size].x = m[i].cr[0];
+			heap[heap_size].y = (uint64_t)i<<32;
+			++heap_size;
+		}
+	}
+	ks_heapmake_heap(heap_size, heap);
+	while (heap_size > 0) {
+		mm_match_t *q = &m[heap->y>>32];
+		mm128_t *p;
+		uint64_t r = heap->x;
+		int32_t is_self, rpos = (uint32_t)r >> 1;
+		if (skip_seed(opt->flag, r, q, qname, qlen, mi, &is_self)) continue;
+		if ((r&1) == (q->q_pos&1)) { // forward strand
+			p = &a[n_for++];
+			p->x = (r&0xffffffff00000000ULL) | rpos;
+			p->y = (uint64_t)q->q_span << 32 | q->q_pos >> 1;
+		} else { // reverse strand
+			p = &a[(*n_a) - (++n_rev)];
+			p->x = 1ULL<<63 | (r&0xffffffff00000000ULL) | rpos;
+			p->y = (uint64_t)q->q_span << 32 | (qlen - ((q->q_pos>>1) + 1 - q->q_span) - 1);
+		}
+		p->y |= (uint64_t)q->seg_id << MM_SEED_SEG_SHIFT;
+		if (q->is_tandem) p->y |= MM_SEED_TANDEM;
+		if (is_self) p->y |= MM_SEED_SELF;
+		// update the heap
+		if ((uint32_t)heap->y < q->n - 1) {
+			++heap[0].y;
+			heap[0].x = m[heap[0].y>>32].cr[(uint32_t)heap[0].y];
+		} else {
+			heap[0] = heap[heap_size - 1];
+			--heap_size;
+		}
+		ks_heapdown_heap(0, heap_size, heap);
+	}
+	kfree(km, m);
+	kfree(km, heap);
+
+	// reverse anchors on the reverse strand, as they are in the descending order
+	for (j = 0; j < n_rev>>1; ++j) {
+		mm128_t t = a[(*n_a) - 1 - j];
+		a[(*n_a) - 1 - j] = a[(*n_a) - (n_rev - j)];
+		a[(*n_a) - (n_rev - j)] = t;
+	}
+	if (*n_a > n_for + n_rev) {
+		memmove(a + n_for, a + (*n_a) - n_rev, n_rev * sizeof(mm128_t));
+		*n_a = n_for + n_rev;
+	}
+	return a;
+}
+
+static mm128_t *collect_seed_hits(void *km, const mm_mapopt_t *opt, int max_occ, const mm_idx_t *mi, const char *qname, const mm128_v *mv, int qlen, int64_t *n_a, int *rep_len,
+								  int *n_mini_pos, uint64_t **mini_pos)
+{
+	int i, k, n_m;
+	mm_match_t *m;
+	mm128_t *a;
+	m = collect_matches(km, &n_m, max_occ, mi, mv, n_a, rep_len, n_mini_pos, mini_pos);
+	a = (mm128_t*)kmalloc(km, *n_a * sizeof(mm128_t));
+	for (i = 0, *n_a = 0; i < n_m; ++i) {
+		mm_match_t *q = &m[i];
+		const uint64_t *r = q->cr;
+		for (k = 0; k < q->n; ++k) {
+			int32_t is_self, rpos = (uint32_t)r[k] >> 1;
+			mm128_t *p;
+			if (skip_seed(opt->flag, r[k], q, qname, qlen, mi, &is_self)) continue;
+			p = &a[(*n_a)++];
+			if ((r[k]&1) == (q->q_pos&1)) { // forward strand
+				p->x = (r[k]&0xffffffff00000000ULL) | rpos;
+				p->y = (uint64_t)q->q_span << 32 | q->q_pos >> 1;
+			} else { // reverse strand
+				p->x = 1ULL<<63 | (r[k]&0xffffffff00000000ULL) | rpos;
+				p->y = (uint64_t)q->q_span << 32 | (qlen - ((q->q_pos>>1) + 1 - q->q_span) - 1);
+			}
+			p->y |= (uint64_t)q->seg_id << MM_SEED_SEG_SHIFT;
+			if (q->is_tandem) p->y |= MM_SEED_TANDEM;
+			if (is_self) p->y |= MM_SEED_SELF;
+		}
+	}
+	kfree(km, m);
+	radix_sort_128x(a, a + (*n_a));
 	return a;
 }
 
 static void chain_post(const mm_mapopt_t *opt, int max_chain_gap_ref, const mm_idx_t *mi, void *km, int qlen, int n_segs, const int *qlens, int *n_regs, mm_reg1_t *regs, mm128_t *a)
 {
-	if (!(opt->flag & MM_F_AVA)) { // don't choose primary mapping(s) for read overlap
+	if (!(opt->flag & MM_F_ALL_CHAINS)) { // don't choose primary mapping(s)
 		mm_set_parent(km, opt->mask_level, *n_regs, regs, opt->a * 2 + opt->b);
 		if (n_segs <= 1) mm_select_sub(km, opt->pri_ratio, mi->k*2, opt->best_n, n_regs, regs);
 		else mm_select_sub_multi(km, opt->pri_ratio, 0.2f, 0.7f, max_chain_gap_ref, mi->k*2, opt->best_n, n_segs, qlens, n_regs, regs);
-		if (!(opt->flag & MM_F_SPLICE) && !(opt->flag & MM_F_SR) && !(opt->flag & MM_F_NO_LJOIN))
+		if (!(opt->flag & (MM_F_SPLICE|MM_F_SR|MM_F_NO_LJOIN))) // long join not working well without primary chains
 			mm_join_long(km, opt, qlen, n_regs, regs, a);
 	}
 }
 
-static mm_reg1_t *align_regs(const mm_mapopt_t *opt, const mm_idx_t *mi, void *km, int qlen, const char *seq, const char *qual, int *n_regs, mm_reg1_t *regs, mm128_t *a)
+static mm_reg1_t *align_regs(const mm_mapopt_t *opt, const mm_idx_t *mi, void *km, int qlen, const char *seq, int *n_regs, mm_reg1_t *regs, mm128_t *a)
 {
 	if (!(opt->flag & MM_F_CIGAR)) return regs;
-	regs = mm_align_skeleton(km, opt, mi, qlen, seq, qual, n_regs, regs, a); // this calls mm_filter_regs()
+	regs = mm_align_skeleton(km, opt, mi, qlen, seq, n_regs, regs, a); // this calls mm_filter_regs()
-	if (!(opt->flag & MM_F_AVA)) {
+	if (!(opt->flag & MM_F_ALL_CHAINS)) { // don't choose primary mapping(s)
 		mm_set_parent(km, opt->mask_level, *n_regs, regs, opt->a * 2 + opt->b);
 		mm_select_sub(km, opt->pri_ratio, mi->k*2, opt->best_n, n_regs, regs);
 		mm_set_sam_pri(*n_regs, regs);
@@ -267,15 +258,17 @@ static mm_reg1_t *align_regs(const mm_mapopt_t *opt, const mm_idx_t *mi, void *k
 	return regs;
 }
 
-void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, const char **quals, int *n_regs, mm_reg1_t **regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname)
+void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, int *n_regs, mm_reg1_t **regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname)
 {
-	int i, j, rep_len, qlen_sum, n_regs0;
+	int i, j, rep_len, qlen_sum, n_regs0, n_mini_pos;
-	int max_chain_gap_qry, max_chain_gap_ref, is_splice = !!(opt->flag & MM_F_SPLICE);
+	int max_chain_gap_qry, max_chain_gap_ref, is_splice = !!(opt->flag & MM_F_SPLICE), is_sr = !!(opt->flag & MM_F_SR);
 	uint32_t hash;
 	int64_t n_a;
-	uint64_t *u;
+	uint64_t *u, *mini_pos;
 	mm128_t *a;
+	mm128_v mv = {0,0,0};
 	mm_reg1_t *regs0;
+	km_stat_t kmst;
 
 	for (i = 0, qlen_sum = 0; i < n_segs; ++i)
 		qlen_sum += qlens[i], n_regs[i] = 0, regs[i] = 0;
@@ -286,9 +279,9 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
 	hash ^= __ac_Wang_hash(qlen_sum) + __ac_Wang_hash(opt->seed);
 	hash  = __ac_Wang_hash(hash);
 
-	collect_minimizers(opt, mi, n_segs, qlens, seqs, b);
+	collect_minimizers(b->km, opt, mi, n_segs, qlens, seqs, &mv);
-	a = collect_seed_hits(opt, opt->mid_occ, mi, qname, qlen_sum, &n_a, &rep_len, b);
+	if (opt->flag & MM_F_HEAP_SORT) a = collect_seed_hits_heap(b->km, opt, opt->mid_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
-	radix_sort_128x(a, a + n_a);
+	else a = collect_seed_hits(b->km, opt, opt->mid_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
 
 	if (mm_dbg_flag & MM_DBG_PRINT_SEED) {
 		fprintf(stderr, "RS\t%d\n", rep_len);
@@ -298,7 +291,7 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
 	}
 
 	// set max chaining gap on the query and the reference sequence
-	if (opt->flag & MM_F_SR)
+	if (is_sr)
 		max_chain_gap_qry = qlen_sum > opt->max_gap? qlen_sum : opt->max_gap;
 	else max_chain_gap_qry = opt->max_gap;
 	if (opt->max_gap_ref > 0) {
@@ -327,8 +320,9 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
 		if (rechain) { // redo chaining with a higher max_occ threshold
 			kfree(b->km, a);
 			kfree(b->km, u);
-			a = collect_seed_hits(opt, opt->max_occ, mi, qname, qlen_sum, &n_a, &rep_len, b);
+			kfree(b->km, mini_pos);
-			radix_sort_128x(a, a + n_a);
+			if (opt->flag & MM_F_HEAP_SORT) a = collect_seed_hits_heap(b->km, opt, opt->max_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
+			else a = collect_seed_hits(b->km, opt, opt->max_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
 			a = mm_chain_dp(max_chain_gap_ref, max_chain_gap_qry, opt->bw, opt->max_chain_skip, opt->min_cnt, opt->min_chain_score, is_splice, n_segs, n_a, a, &n_regs0, &u, b->km);
 		}
 	}
@@ -342,10 +336,11 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
 						i == regs0[j].as? 0 : ((int32_t)a[i].y - (int32_t)a[i-1].y) - ((int32_t)a[i].x - (int32_t)a[i-1].x));
 
 	chain_post(opt, max_chain_gap_ref, mi, b->km, qlen_sum, n_segs, qlens, &n_regs0, regs0, a);
+	if (!is_sr) mm_est_err(mi, qlen_sum, n_regs0, regs0, a, n_mini_pos, mini_pos);
 
 	if (n_segs == 1) { // uni-segment
-		regs0 = align_regs(opt, mi, b->km, qlens[0], seqs[0], quals? quals[0] : 0, &n_regs0, regs0, a);
+		regs0 = align_regs(opt, mi, b->km, qlens[0], seqs[0], &n_regs0, regs0, a);
-		mm_set_mapq(n_regs0, regs0, opt->min_chain_score, opt->a, rep_len);
+		mm_set_mapq(b->km, n_regs0, regs0, opt->min_chain_score, opt->a, rep_len, is_sr);
 		n_regs[0] = n_regs0, regs[0] = regs0;
 	} else { // multi-segment
 		mm_seg_t *seg;
@@ -353,25 +348,35 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
 		free(regs0);
 		for (i = 0; i < n_segs; ++i) {
 			mm_set_parent(b->km, opt->mask_level, n_regs[i], regs[i], opt->a * 2 + opt->b); // update mm_reg1_t::parent
-			regs[i] = align_regs(opt, mi, b->km, qlens[i], seqs[i], quals? quals[i] : 0, &n_regs[i], regs[i], seg[i].a);
+			regs[i] = align_regs(opt, mi, b->km, qlens[i], seqs[i], &n_regs[i], regs[i], seg[i].a);
-			mm_set_mapq(n_regs[i], regs[i], opt->min_chain_score, opt->a, rep_len);
+			mm_set_mapq(b->km, n_regs[i], regs[i], opt->min_chain_score, opt->a, rep_len, is_sr);
 		}
 		mm_seg_free(b->km, n_segs, seg);
 		if (n_segs == 2 && opt->pe_ori >= 0 && (opt->flag&MM_F_CIGAR))
 			mm_pair(b->km, max_chain_gap_ref, opt->pe_bonus, opt->a * 2 + opt->b, opt->a, qlens, n_regs, regs); // pairing
 	}
-	if (opt->min_iden > 0.0f)
-		for (i = 0; i < n_segs; ++i)
-			mm_filter_by_identity(b->km, n_regs[i], regs[i], opt->min_iden, qlens[i], quals[i]);
 
+	kfree(b->km, mv.a);
 	kfree(b->km, a);
 	kfree(b->km, u);
+	kfree(b->km, mini_pos);
+
+	if (b->km) {
+		km_stat(b->km, &kmst);
+		if (mm_dbg_flag & MM_DBG_PRINT_QNAME)
+			fprintf(stderr, "QM\t%s\t%d\tcap=%ld,nCore=%ld,largest=%ld\n", qname, qlen_sum, kmst.capacity, kmst.n_cores, kmst.largest);
+		assert(kmst.n_blocks == kmst.n_cores); // otherwise, there is a memory leak
+		if (kmst.largest > 1U<<28) {
+			km_destroy(b->km);
+			b->km = km_init();
+		}
+	}
 }
 
 mm_reg1_t *mm_map(const mm_idx_t *mi, int qlen, const char *seq, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname)
 {
 	mm_reg1_t *regs;
-	mm_map_frag(mi, 1, &qlen, &seq, 0, n_regs, &regs, b, opt, qname);
+	mm_map_frag(mi, 1, &qlen, &seq, n_regs, &regs, b, opt, qname);
 	return regs;
 }
 
@@ -399,22 +404,24 @@ typedef struct {
 static void worker_for(void *_data, long i, int tid) // kt_for() callback
 {
     step_t *s = (step_t*)_data;
-	int *qlens, j, off = s->seg_off[i], pe_ori = s->p->opt->pe_ori, is_sr = !!(s->p->opt->flag & MM_F_SR);
+	int qlens[MM_MAX_SEG], j, off = s->seg_off[i], pe_ori = s->p->opt->pe_ori;
-	const char **qseqs, **quals = 0;
+	const char *qseqs[MM_MAX_SEG];
 	mm_tbuf_t *b = s->buf[tid];
+	assert(s->n_seg[i] <= MM_MAX_SEG);
 	if (mm_dbg_flag & MM_DBG_PRINT_QNAME)
-		fprintf(stderr, "QR\t%s\t%d\n", s->seq[off].name, tid);
+		fprintf(stderr, "QR\t%s\t%d\t%d\n", s->seq[off].name, tid, s->seq[off].l_seq);
-	qlens = (int*)kmalloc(b->km, s->n_seg[i] * sizeof(int));
-	qseqs = (const char**)kmalloc(b->km, s->n_seg[i] * sizeof(const char**));
-	quals = (const char**)kmalloc(b->km, s->n_seg[i] * sizeof(const char**));
 	for (j = 0; j < s->n_seg[i]; ++j) {
 		if (s->n_seg[i] == 2 && ((j == 0 && (pe_ori>>1&1)) || (j == 1 && (pe_ori&1))))
 			mm_revcomp_bseq(&s->seq[off + j]);
 		qlens[j] = s->seq[off + j].l_seq;
 		qseqs[j] = s->seq[off + j].seq;
-		quals[j] = is_sr? s->seq[off + j].qual : 0;
 	}
-	mm_map_frag(s->p->mi, s->n_seg[i], qlens, qseqs, quals, &s->n_reg[off], &s->reg[off], b, s->p->opt, s->seq[off].name);
+	if (s->p->opt->flag & MM_F_INDEPEND_SEG) {
+		for (j = 0; j < s->n_seg[i]; ++j)
+			mm_map_frag(s->p->mi, 1, &qlens[j], &qseqs[j], &s->n_reg[off+j], &s->reg[off+j], b, s->p->opt, s->seq[off+j].name);
+	} else {
+		mm_map_frag(s->p->mi, s->n_seg[i], qlens, qseqs, &s->n_reg[off], &s->reg[off], b, s->p->opt, s->seq[off].name);
+	}
 	for (j = 0; j < s->n_seg[i]; ++j) // flip the query strand and coordinate to the original read strand
 		if (s->n_seg[i] == 2 && ((j == 0 && (pe_ori>>1&1)) || (j == 1 && (pe_ori&1)))) {
 			int k, t;
@@ -427,9 +434,6 @@ static void worker_for(void *_data, long i, int tid) // kt_for() callback
 				r->rev = !r->rev;
 			}
 		}
-	kfree(b->km, qlens);
-	kfree(b->km, qseqs);
-	kfree(b->km, quals);
 }
 
 static void *worker_pipeline(void *shared, int step, void *in)

minimap.h

@@ -5,23 +5,34 @@
 #include <stdio.h>
 #include <sys/types.h>
 
-#define MM_F_NO_SELF     0x001
+#define MM_F_NO_DIAG       0x001 // no exact diagonal hit
-#define MM_F_AVA         0x002
+#define MM_F_NO_DUAL       0x002 // skip pairs where query name is lexicographically larger than target name
-#define MM_F_CIGAR       0x004
+#define MM_F_CIGAR         0x004
-#define MM_F_OUT_SAM     0x008
+#define MM_F_OUT_SAM       0x008
-#define MM_F_NO_QUAL     0x010
+#define MM_F_NO_QUAL       0x010
-#define MM_F_OUT_CG      0x020
+#define MM_F_OUT_CG        0x020
-#define MM_F_OUT_CS      0x040
+#define MM_F_OUT_CS        0x040
-#define MM_F_SPLICE      0x080 // splice mode
+#define MM_F_SPLICE        0x080 // splice mode
-#define MM_F_SPLICE_FOR  0x100 // match GT-AG
+#define MM_F_SPLICE_FOR    0x100 // match GT-AG
-#define MM_F_SPLICE_REV  0x200 // match CT-AC, the reverse complement of GT-AG
+#define MM_F_SPLICE_REV    0x200 // match CT-AC, the reverse complement of GT-AG
-#define MM_F_NO_LJOIN    0x400
+#define MM_F_NO_LJOIN      0x400
-#define MM_F_OUT_CS_LONG 0x800
+#define MM_F_OUT_CS_LONG   0x800
-#define MM_F_SR          0x1000
+#define MM_F_SR            0x1000
-#define MM_F_FRAG_MODE   0x2000
+#define MM_F_FRAG_MODE     0x2000
 #define MM_F_NO_PRINT_2ND  0x4000
 #define MM_F_2_IO_THREADS  0x8000
 #define MM_F_LONG_CIGAR    0x10000
+#define MM_F_INDEPEND_SEG  0x20000
+#define MM_F_SPLICE_FLANK  0x40000
+#define MM_F_SOFTCLIP      0x80000
+#define MM_F_FOR_ONLY      0x100000
+#define MM_F_REV_ONLY      0x200000
+#define MM_F_HEAP_SORT     0x400000
+#define MM_F_ALL_CHAINS    0x800000
+
+#define MM_I_HPC          0x1
+#define MM_I_NO_SEQ       0x2
+#define MM_I_NO_NAME      0x4
 
 #define MM_IDX_MAGIC   "MMI\2"
 
@@ -43,12 +54,12 @@ typedef struct {
 } mm_idx_seq_t;
 
 typedef struct {
-	int32_t b, w, k, is_hpc;
+	int32_t b, w, k, flag;
 	uint32_t n_seq;            // number of reference sequences
 	mm_idx_seq_t *seq;         // sequence name, length and offset
 	uint32_t *S;               // 4-bit packed sequence
 	struct mm_idx_bucket_s *B; // index (hidden)
-	void *km;
+	void *km, *h;
 } mm_idx_t;
 
 // minimap2 alignment
@@ -57,29 +68,29 @@ typedef struct {
 	int32_t dp_score, dp_max, dp_max2;  // DP score; score of the max-scoring segment; score of the best alternate mappings
 	uint32_t n_ambi:30, trans_strand:2; // number of ambiguous bases; transcript strand: 0 for unknown, 1 for +, 2 for -
 	uint32_t n_cigar;                   // number of cigar operations in cigar[]
-	float n_diff2;
-	uint32_t blen2;
 	uint32_t cigar[];
 } mm_extra_t;
 
 typedef struct {
-	int32_t id;                     // ID for internal uses (see also parent below)
+	int32_t id;             // ID for internal uses (see also parent below)
-	uint32_t cnt:30, rev:1, seg_split:1; // number of minimizers; if on the reverse strand
+	int32_t cnt;            // number of minimizers; if on the reverse strand
-	uint32_t rid:31, inv:1;         // reference index; if this is an alignment from inversion rescue
+	int32_t rid;            // reference index; if this is an alignment from inversion rescue
-	int32_t score;                  // DP alignment score
+	int32_t score;          // DP alignment score
-	int32_t qs, qe, rs, re;         // query start and end; reference start and end
+	int32_t qs, qe, rs, re; // query start and end; reference start and end
-	int32_t parent, subsc;          // parent==id if primary; best alternate mapping score
+	int32_t parent, subsc;  // parent==id if primary; best alternate mapping score
-	int32_t as;                     // offset in the a[] array (for internal uses only)
+	int32_t as;             // offset in the a[] array (for internal uses only)
-	int32_t mlen, blen;             // seeded exact match length; seeded alignment block length
+	int32_t mlen, blen;     // seeded exact match length; seeded alignment block length
-	uint32_t mapq:8, split:2, n_sub:22; // mapQ; split pattern; number of suboptimal mappings
+	int32_t n_sub;          // number of suboptimal mappings
-	uint32_t sam_pri:1, proper_frag:1, iden_flt:1, pe_thru:1, dummy:29;
+	int32_t score0;         // initial chaining score (before chain merging/spliting)
+	uint32_t mapq:8, split:2, rev:1, inv:1, sam_pri:1, proper_frag:1, pe_thru:1, seg_split:1, seg_id:8, split_inv:1, dummy:7;
 	uint32_t hash;
+	float div;
 	mm_extra_t *p;
 } mm_reg1_t;
 
 // indexing and mapping options
 typedef struct {
-	short k, w, is_hpc, bucket_bits;
+	short k, w, flag, bucket_bits;
 	int mini_batch_size;
 	uint64_t batch_size;
 } mm_idxopt_t;
@@ -99,17 +110,18 @@ typedef struct {
 	float mask_level;
 	float pri_ratio;
 	int best_n;      // top best_n chains are subjected to DP alignment
-	float min_iden;
 
 	int max_join_long, max_join_short;
 	int min_join_flank_sc;
 
 	int a, b, q, e, q2, e2; // matching score, mismatch, gap-open and gap-ext penalties
 	int noncan;      // cost of non-canonical splicing sites
-	int zdrop;       // break alignment if alignment score drops too fast along the diagonal
+	int zdrop, zdrop_inv;   // break alignment if alignment score drops too fast along the diagonal
 	int end_bonus;
 	int min_dp_max;  // drop an alignment if the score of the max scoring segment is below this threshold
 	int min_ksw_len;
+	int anchor_ext_len, anchor_ext_shift;
+	float max_clip_ratio; // drop an alignment if BOTH ends are clipped above this ratio
 
 	int pe_ori, pe_bonus;
 
@@ -148,6 +160,7 @@ extern double mm_realtime0; // wall-clock timer
  * @return 0 if success; -1 if _present_ unknown
  */
 int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo);
+int mm_check_opt(const mm_idxopt_t *io, const mm_mapopt_t *mo);
 
 /**
  * Update mm_mapopt_t::mid_occ via mm_mapopt_t::mid_occ_frac
@@ -200,6 +213,21 @@ void mm_idx_reader_close(mm_idx_reader_t *r);
 
 int mm_idx_reader_eof(const mm_idx_reader_t *r);
 
+/**
+ * Create an index from strings in memory
+ *
+ * @param w            minimizer window size
+ * @param k            minimizer k-mer size
+ * @param is_hpc       use HPC k-mer if true
+ * @param bucket_bits  number of bits for the first level of the hash table
+ * @param n            number of sequences
+ * @param seq          sequences in A/C/G/T
+ * @param name         sequence names; could be NULL
+ *
+ * @return minimap2 index
+ */
+mm_idx_t *mm_idx_str(int w, int k, int is_hpc, int bucket_bits, int n, const char **seq, const char **name);
+
 /**
  * Print index statistics to stderr
  *
@@ -253,6 +281,8 @@ void mm_tbuf_destroy(mm_tbuf_t *b);
  */
 mm_reg1_t *mm_map(const mm_idx_t *mi, int l_seq, const char *seq, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *name);
 
+void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, int *n_regs, mm_reg1_t **regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname);
+
 /**
  * Align a fasta/fastq file and print alignments to stdout
  *
@@ -267,9 +297,14 @@ int mm_map_file(const mm_idx_t *idx, const char *fn, const mm_mapopt_t *opt, int
 
 int mm_map_file_frag(const mm_idx_t *idx, int n_segs, const char **fn, const mm_mapopt_t *opt, int n_threads);
 
+// query sequence name and sequence in the minimap2 index
+int mm_idx_index_name(mm_idx_t *mi);
+int mm_idx_name2id(const mm_idx_t *mi, const char *name);
+int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq);
+
 // deprecated APIs for backward compatibility
 void mm_mapopt_init(mm_mapopt_t *opt);
-mm_idx_t *mm_idx_build(const char *fn, int w, int k, int is_hpc, int n_threads);
+mm_idx_t *mm_idx_build(const char *fn, int w, int k, int flag, int n_threads);
 
 #ifdef __cplusplus
 }

minimap2.1

@@ -1,4 +1,4 @@
-.TH minimap2 1 "22 October 2017" "minimap2-2.2-dirty (r531)" "Bioinformatics tools"
+.TH minimap2 1 "24 February 2018" "minimap2-2.9 (r720)" "Bioinformatics tools"
 .SH NAME
 .PP
 minimap2 - mapping and alignment between collections of DNA sequences
@@ -99,6 +99,14 @@ multiple times to map it against each batch of target sequences.
 may be ending with k/K/m/M/g/G. NB: mapping quality is incorrect given a
 multi-part index.
 .TP
+.B --idx-no-seq
+Don't store target sequences in the index. It saves disk space and memory but
+the index generated with this option will not work with
+.B -a
+or
+.BR -c .
+When base-level alignment is not requested, this option is automatically applied.
+.TP
 .BI -d \ FILE
 Save the minimizer index of
 .I target.fa
@@ -121,7 +129,7 @@ Ignore top
 fraction of most frequent minimizers [0.0002]
 .TP
 .BI -g \ INT
-Stop chain enlongation if there are no minimizers in
+Stop chain enlongation if there are no minimizers within
 .IR INT -bp
 [10000].
 .TP
@@ -140,11 +148,30 @@ Discard chains with chaining score
 [40]. Chaining score equals the approximate number of matching bases minus a
 concave gap penalty. It is computed with dynamic programming.
 .TP
+.B -D
+If query sequence name/length are identical to the target name/length, ignore
+diagonal anchors. This option also reduces DP-based extension along the
+diagonal.
+.TP
+.B -P
+Retain all chains and don't attempt to set primary chains. Options
+.B -p
+and
+.B -N
+have no effect when this option is in use.
+.TP
+.BR --dual = yes | no
+If
+.BR no ,
+skip query-target pairs wherein the query name is lexicographically greater
+than the target name [yes]
+.TP
 .B -X
-Perform all-vs-all mapping. In this mode, if the query sequence name is
+Equivalent to
-lexicographically larger than the target sequence name, the hits between them
+.RB ' -DP
-will be suppressed; if the query sequence name is the same as the target name,
+.BR --dual = no
-diagonal minimizer hits will also be suppressed.
+.BR --no-long-join '.
+Primarily used for all-vs-all read overlapping.
 .TP
 .BI -p \ FLOAT
 Minimal secondary-to-primary score ratio to output secondary mappings [0.8].
@@ -154,6 +181,9 @@ the chain with a lower score is secondary to the chain with a higher score.
 If the ratio of the scores is below
 .IR FLOAT ,
 the secondary chain will not be outputted or extended with DP alignment later.
+This option has no effect when
+.B -X
+is applied.
 .TP
 .BI -N \ INT
 Output at most
@@ -171,9 +201,14 @@ Increasing this option slows down spliced alignment. [200k]
 .TP
 .BI -F \ NUM
 Maximum fragment length (aka insert size; effective with
-.BR -xsr / --frag)
+.BR -xsr / --frag = yes )
 [800]
 .TP
+.BI -M \ FLOAT
+Mark as secondary a chain that overlaps with a better chain by
+.I FLOAT
+or more of the shorter chain [0.5]
+.TP
 .BI --max-chain-skip \ INT
 A heuristics that stops chaining early [50]. Minimap2 uses dynamic programming
 for chaining. The time complexity is quadratic in the number of seeds. This
@@ -196,8 +231,20 @@ applies a second round of chaining with a higher minimizer occurrence threshold
 if no good chain is found. In addition, minimap2 attempts to patch gaps between
 seeds with ungapped alignment.
 .TP
-.BR --frag [= no | yes ]
+.BR --frag = no | yes
 Whether to enable the fragment mode [no]
+.TP
+.B --for-only
+Only map to the forward strand of the reference sequences. For paired-end
+reads in the forward-reverse orientation, the first read is mapped to forward
+strand of the reference and the second read to the reverse stand.
+.TP
+.B --rev-only
+Only map to the reverse complement strand of the reference sequences.
+.TP
+.BR --heap-sort = no | yes
+If yes, sort anchors with heap merge, instead of radix sort. Heap merge is
+faster for short reads, but slower for long reads. [no]
 .SS Alignment options
 .TP 10
 .BI -A \ INT
@@ -219,11 +266,27 @@ costs
 .RI min{ O1 + k * E1 , O2 + k * E2 }.
 In the splice mode, the second gap penalties are not used.
 .TP
-.BI -z \ INT
+.BI -C \ INT
-Break an alignment if the running score drops too quickly along the diagonal of
+Cost for a non-canonical GT-AG splicing (effective with
-the DP matrix (diagonal X-drop, or Z-drop) [400]. Increasing the value improves
+.BR --splice )
-the contiguity of the alignment at the cost of poor alignment in the middle
+[0]
-(e.g. caused by a long inversion).
+.TP
+.BI -z \ INT1[,INT2]
+Truncate an alignment if the running alignment score drops too quickly along
+the diagonal of the DP matrix (diagonal X-drop, or Z-drop) [400,200]. If the
+drop of score is above
+.IR INT2 ,
+minimap2 will reverse complement the query in the related region and align
+again to test small inversions. Minimap2 truncates alignment if there is an
+inversion or the drop of score is greater than
+.IR INT1 .
+Decrease
+.I INT2
+to find small inversions at the cost of performance and false positives.
+Increase
+.I INT1
+to improves the contiguity of alignment at the cost of poor alignment in the
+middle.
 .TP
 .BI -s \ INT
 Minimal peak DP alignment score to output [40]. The peak score is computed from
@@ -239,11 +302,37 @@ both strands;
 .BR n :
 no attempt to match GT-AG [n]
 .TP
-.BI --cost-non-gt-ag \ INT
-Cost of non-canonical splicing sites [0].
-.TP
 .BI --end-bonus \ INT
-Score bonus when alignment extends to the end of the query sequence [10].
+Score bonus when alignment extends to the end of the query sequence [0].
+.TP
+.BR --splice-flank = yes | no
+Assume the next base to a
+.B GT
+donor site tends to be A/G (91% in human and 92% in mouse) and the preceding
+base to a
+.B AG
+acceptor tends to be C/T [no].
+This trend is evolutionarily conservative, all the way to S. cerevisiae
+(PMID:18688272). Specifying this option generally leads to higher junction
+accuracy by several percents, so it is applied by default with
+.BR --splice .
+However, the SIRV control does not honor this trend
+(only ~60%). This option reduces accuracy. If you are benchmarking minimap2
+on SIRV data, please add
+.B --splice-flank=no
+to the command line.
+.TP
+.BI --end-seed-pen \ INT
+Drop a terminal anchor if
+.IR s <log( g )+ INT ,
+where
+.I s
+is the local alignment score around the anchor and
+.I g
+the length of the terminal gap in the chain. This option is only effective
+with
+.BR --splice .
+It helps to avoid tiny terminal exons. [6]
 .SS Input/output options
 .TP 10
 .B -a
@@ -261,7 +350,7 @@ the real CIGAR in memory.
 .TP
 .BI -R \ STR
 SAM read group line in a format like
-.RB @RG\\\\tID:foo\\\\tSM:bar
+.B @RG\\\\tID:foo\\\\tSM:bar
 [].
 .TP
 .B -c
@@ -282,6 +371,9 @@ is given,
 .I short
 is assumed. [none]
 .TP
+.B -Y
+In SAM output, use soft clipping for supplementary alignments.
+.TP
 .BI --seed \ INT
 Integer seed for randomizing equally best hits. Minimap2 hashes
 .I INT
@@ -309,7 +401,7 @@ K/M/G/k/m/g suffix is accepted. A large
 helps load balancing in the multi-threading mode, at the cost of increased
 memory.
 .TP
-.BR --secondary [= yes | no ]
+.BR --secondary = yes | no
 Whether to output secondary alignments [yes]
 .TP
 .B --version
@@ -356,13 +448,13 @@ Up to 10% sequence divergence.
 .B ava-pb
 PacBio all-vs-all overlap mapping
 .RB ( -Hk19
-.B -w5 -Xp0 -m100 -g10000 --max-chain-skip
+.B -Xw5 -m100 -g10000 --max-chain-skip
 .BR 25 ).
 .TP
 .B ava-ont
 Oxford Nanopore all-vs-all overlap mapping
 .RB ( -k15
-.B -w5 -Xp0 -m100 -g10000 --max-chain-skip
+.B -Xw5 -m100 -g10000 --max-chain-skip
 .BR 25 ).
 Similarly, the major difference from
 .B ava-pb
@@ -371,8 +463,8 @@ is that this preset is not using HPC minimizers.
 .B splice
 Long-read spliced alignment
 .RB ( -k15
-.B -w5 --splice -g2000 -G200k -A1 -B2 -O2,32 -E1,0 -z200 -ub --cost-non-gt-ag
+.B -w5 --splice -g2000 -G200k -A1 -B2 -O2,32 -E1,0 -C9 -z200 -ub
-.BR 5 ).
+.BR --splice-flank=yes ).
 In the splice mode, 1) long deletions are taken as introns and represented as
 the
 .RB ` N '
@@ -384,8 +476,8 @@ tag ignores introns to demote hits to pseudogenes.
 .B sr
 Short single-end reads without splicing
 .RB ( -k21
-.B -w11 --sr --frag -A2 -B8 -O12,32 -E2,1 -r50 -p.5 -N20 -f1000,5000 -n2 -m20
+.B -w11 --sr --frag=yes -A2 -B8 -O12,32 -E2,1 -r50 -p.5 -N20 -f1000,5000 -n2 -m20
-.B -s40 -g200 -2K50m
+.B -s40 -g200 -2K50m --heap-sort=yes
 .BR --secondary=no ).
 .RE
 .SS Miscellaneous options
@@ -438,7 +530,7 @@ cb | cb | cb
 r | c | l .
 Tag	Type	Description
 _
-tp	A	Type of aln: P/primary, S/secondary and I/inversion
+tp	A	Type of aln: P/primary, S/secondary and I,i/inversion
 cm	i	Number of minimizers on the chain
 s1	i	Chaining score
 s2	i	Chaining score of the best secondary chain
@@ -479,8 +571,8 @@ where seed positions may be suboptimal. This should not be a big concern
 because even the optimal alignment may be wrong in such regions.
 .TP
 *
-Minimap2 requires SSE2 instructions to compile. It is possible to add
+Minimap2 requires SSE2 or NEON instructions to compile. It is possible to add
-non-SSE2 support, but it would make minimap2 slower by several times.
+non-SSE2/NEON support, but it would make minimap2 slower by several times.
 .SH SEE ALSO
 .PP
 miniasm(1), minimap(1), bwa(1).

misc.c

@@ -1,4 +1,4 @@
-#include "minimap.h"
+#include "mmpriv.h"
 
 int mm_verbose = 1;
 int mm_dbg_flag = 0;
@@ -86,6 +86,8 @@ double cputime()
 
 	return kernelModeTime + userModeTime;
 }
+
+long peakrss(void) { return 0; }
 #else
 #include <sys/resource.h>
 #include <sys/time.h>
@@ -96,6 +98,18 @@ double cputime(void)
 	getrusage(RUSAGE_SELF, &r);
 	return r.ru_utime.tv_sec + r.ru_stime.tv_sec + 1e-6 * (r.ru_utime.tv_usec + r.ru_stime.tv_usec);
 }
+
+long peakrss(void)
+{
+	struct rusage r;
+	getrusage(RUSAGE_SELF, &r);
+#ifdef __linux__
+	return r.ru_maxrss * 1024;
+#else
+	return r.ru_maxrss;
+#endif
+}
+
 #endif /* WIN32 || _WIN32 */
 
 double realtime(void)

misc/README.md

@@ -1,28 +1,179 @@
-The [K8 Javascript shell][k8] is needed to run Javascripts in this directory.
+## <a name="started"></a>Getting Started
-Precompiled k8 binaries for Mac and Linux can be found at the [K8 release
-page][k8bin].
 
-* [paf2aln.js](paf2aln.js): convert PAF to [MAF][maf] or BLAST-like output for
+```sh
-  eyeballing. PAF has to be generated with minimap2 option `-S`, which writes
+# install minimap2
-  the aligned sequences to the `cs` tag. An example:
+git clone https://github.com/lh3/minimap2
-  ```sh
+cd minimap2 && make
-  ../minimap2 -S ../test/MT-*.fa | k8 paf2aln.js /dev/stdin
+# install the k8 javascript shell
-  ```
+curl -L https://github.com/attractivechaos/k8/releases/download/v0.2.4/k8-0.2.4.tar.bz2 | tar -jxf -
+cp k8-0.2.4/k8-`uname -s` k8              # or copy it to a directory on your $PATH
+# export PATH="$PATH:`pwd`:`pwd`/misc"    # run this if k8, minimap2 or paftools.js not on your $PATH
+minimap2 --cs test/MT-human.fa test/MT-orang.fa | paftools.js view -     # view alignment
+minimap2 -c test/MT-human.fa test/MT-orang.fa | paftools.js stat -       # basic alignment statistics
+minimap2 -c --cs test/MT-human.fa test/MT-orang.fa \
+  | sort -k6,6 -k8,8n | paftools.js call -L15000 -     # calling variants from asm-to-ref alignment
+minimap2 -c test/MT-human.fa test/MT-orang.fa \
+  | paftools.js liftover -l10000 - <(echo -e "MT_orang\t2000\t5000")     # liftOver
+# no test data for the following examples
+paftools.js junceval -e anno.gtf splice.sam > out.txt  # compare splice junctions to annotations
+paftools.js splice2bed anno.gtf > anno.bed             # convert GTF/GFF3 to BED12
+```
 
-* [mapstat.js](mapstat.js): output basic statistics such as the number of
+## Table of Contents
-  non-redundant mapped bases, number of split and secondary alignments and
-  number of long gaps. This scripts seamlessly works with both SAM and PAF.
 
-* [sim-pbsim.js](sim-pbsim.js): convert reads simulated with [PBSIM][pbsim] to
+- [Getting Started](#started)
-  FASTA and encode the true mapping positions to read names in a format like
+- [Introduction](#intro)
-  `S1_33!chr1!225258409!225267761!-`.
+- [Evaluation](#eval)
+  - [Evaluating mapping accuracy with simulated reads](#mapeval)
+  - [Evaluating read overlap sensitivity](#oveval)
+- [Calling Variants from Assemblies](#asmvar)
 
-* [sim-eval.js](sim-eval.js): evaluate mapping accuracy for FASTA generated
+## <a name="intro"></a>Introduction
-  with [sim-pbsim.js](sim-pbsim.js) or [sim-mason2.js](sim-mason2.js).
 
-* [sam2paf.js](sam2paf.js): convert SAM to PAF.
+paftools.js is a script that processes alignments in the [PAF format][paf],
+such as converting between formats, evaluating mapping accuracy, lifting over
+BED files based on alignment, and calling variants from assembly-to-assembly
+alignment. This script *requires* the [k8 Javascript shell][k8] to run. On
+Linux or Mac, you can download the precompiled k8 binary with:
 
+```sh
+curl -L https://github.com/attractivechaos/k8/releases/download/v0.2.4/k8-0.2.4.tar.bz2 | tar -jxf -
+cp k8-0.2.4/k8-`uname -s` $HOME/bin/k8  # assuming $HOME/bin in your $PATH
+```
+
+It is highly recommended to copy the executable `k8` to a directory on your
+`$PATH` such as `/usr/bin/env` can find it. Like python scripts, once you
+install `k8`, you can launch paftools.js in one of the two ways:
+
+```sh
+path/to/paftools.js             # only if k8 is on your $PATH
+k8 path/to/paftools.js
+```
+
+In a nutshell, paftools.js has the following commands:
+
+```
+Usage: paftools.js <command> [arguments]
+Commands:
+  view       convert PAF to BLAST-like (for eyeballing) or MAF
+  splice2bed convert spliced alignment in PAF/SAM to BED12
+  sam2paf    convert SAM to PAF
+  delta2paf  convert MUMmer's delta to PAF
+  gff2bed    convert GTF/GFF3 to BED12
+
+  stat       collect basic mapping information in PAF/SAM
+  liftover   simplistic liftOver
+  call       call variants from asm-to-ref alignment with the cs tag
+  bedcov     compute the number of bases covered
+
+  mapeval    evaluate mapping accuracy using mason2/PBSIM-simulated FASTQ
+  mason2fq   convert mason2-simulated SAM to FASTQ
+  pbsim2fq   convert PBSIM-simulated MAF to FASTQ
+  junceval   evaluate splice junction consistency with known annotations
+  ov-eval    evaluate read overlap sensitivity using read-to-ref mapping
+```
+
+paftools.js seamlessly reads both plain text files and gzip'd text files.
+
+## <a name="eval"></a>Evaluation
+
+### <a name="mapeval"></a>Evaluating mapping accuracy with simulated reads
+
+The **pbsim2fq** command of paftools.js converts the MAF output of [pbsim][pbsim]
+to FASTQ and encodes the true mapping position in the read name in a format like
+`S1_33!chr1!225258409!225267761!-`. Similarly, the **mason2fq** command
+converts [mason2][mason2] simulated SAM to FASTQ.
+
+Command **mapeval** evaluates mapped SAM/PAF. Here is example output:
+
+```
+Q       60      32478   0       0.000000000     32478
+Q       22      16      1       0.000030775     32494
+Q       21      43      1       0.000061468     32537
+Q       19      73      1       0.000091996     32610
+Q       14      66      1       0.000122414     32676
+Q       10      27      3       0.000214048     32703
+Q       8       14      1       0.000244521     32717
+Q       7       13      2       0.000305530     32730
+Q       6       46      1       0.000335611     32776
+Q       3       10      1       0.000366010     32786
+Q       2       20      2       0.000426751     32806
+Q       1       248     94      0.003267381     33054
+Q       0       31      17      0.003778147     33085
+U       3
+```
+
+where each Q-line gives the quality threshold, the number of reads mapped with
+mapping quality equal to or greater than the threshold, number of wrong
+mappings, accumulative mapping error rate and the accumulative number of
+mapped reads. The U-line, if present, gives the number of unmapped reads if
+they are present in the SAM file.
+
+Suppose the reported mapping coordinate overlap with the true coordinate like
+the following:
+
+```
+truth:   --------------------
+mapper:           ----------------------
+         |<- l1 ->|<-- o -->|<-- l2 -->|
+```
+
+Let `r=o/(l1+o+l2)`. The reported mapping is considered correct if `r>0.1` by
+default.
+
+### <a name="oveval"></a>Evaluating read overlap sensitivity
+
+Command **ov-eval** takes *sorted* read-to-reference alignment and read
+overlaps in PAF as input, and evaluates the sensitivity. For example:
+
+```sh
+minimap2 -cx map-pb ref.fa reads.fq.gz | sort -k6,6 -k8,8n > reads-to-ref.paf
+minimap2 -x ava-pb reads.fq.gz reads.fq.gz > ovlp.paf
+k8 ov-eval.js reads-to-ref.paf ovlp.paf
+```
+
+## <a name="asmvar"></a>Calling Variants from Haploid Assemblies
+
+The **call** command of paftools.js calls variants from coordinate-sorted
+assembly-to-reference alignment. It calls variants from the [cs tag][cs] and
+identifies confident/callable regions as those covered by exactly one contig.
+Here are example command lines:
+
+```sh
+minimap2 -cx asm5 -t8 --cs ref.fa asm.fa > asm.paf  # keeping this file is recommended; --cs required!
+sort -k6,6 -k8,8n asm.paf > asm.srt.paf             # sort by reference start coordinate
+k8 paftools.js call asm.srt.paf > asm.var.txt
+```
+
+Here is sample output:
+
+```
+V   chr1    2276040 2276041 1   60  c   g   LJII01000171.1  1217409 1217410 +
+V   chr1    2280409 2280410 1   60  a   g   LJII01000171.1  1221778 1221779 +
+V   chr1    2280504 2280505 1   60  a   g   LJII01000171.1  1221873 1221874 +
+R   chr1    2325140 2436340
+V   chr1    2325287 2325287 1   60  -   ct  LJII01000171.1  1272894 1272896 +
+V   chr1    2325642 2325644 1   60  tt  -   LJII01000171.1  1273251 1273251 +
+V   chr1    2326051 2326052 1   60  c   t   LJII01000171.1  1273658 1273659 +
+V   chr1    2326287 2326288 1   60  c   t   LJII01000171.1  1273894 1273895 +
+```
+
+where a line starting with `R` gives regions covered by one query contig, and a
+V-line encodes a variant in the following format: chr, start, end, query depth,
+mapping quality, REF allele, ALT allele, query name, query start, end and the
+query orientation. Generally, you should only look at variants where column 5
+is one.
+
+By default, when calling variants, "paftools.js call" ignores alignments 50kb
+or shorter; when deriving callable regions, it ignores alignments 10kb or
+shorter.  It uses two thresholds to avoid edge effects. These defaults are
+designed for long-read assemblies. For short reads, both should be reduced.
+
+
+
+[paf]: https://github.com/lh3/miniasm/blob/master/PAF.md
+[cs]: https://github.com/lh3/minimap2#cs
 [k8]: https://github.com/attractivechaos/k8
-[k8bin]: https://github.com/attractivechaos/k8/releases
 [maf]: https://genome.ucsc.edu/FAQ/FAQformat#format5
 [pbsim]: https://github.com/pfaucon/PBSIM-PacBio-Simulator
+[mason2]: https://github.com/seqan/seqan/tree/master/apps/mason2

misc/intron-eval.js

@@ -1,266 +0,0 @@
-/*******************************
- * Command line option parsing *
- *******************************/
-
-var getopt = function(args, ostr) {
-	var oli; // option letter list index
-	if (typeof(getopt.place) == 'undefined')
-		getopt.ind = 0, getopt.arg = null, getopt.place = -1;
-	if (getopt.place == -1) { // update scanning pointer
-		if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
-			getopt.place = -1;
-			return null;
-		}
-		if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
-			++getopt.ind;
-			getopt.place = -1;
-			return null;
-		}
-	}
-	var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
-	if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
-		if (optopt == '-') return null; //  if the user didn't specify '-' as an option, assume it means null.
-		if (getopt.place < 0) ++getopt.ind;
-		return '?';
-	}
-	if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
-		getopt.arg = null;
-		if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
-	} else { // need an argument
-		if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
-			getopt.arg = args[getopt.ind].substr(getopt.place);
-		else if (args.length <= ++getopt.ind) { // no arg
-			getopt.place = -1;
-			if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
-			return '?';
-		} else getopt.arg = args[getopt.ind]; // white space
-		getopt.place = -1;
-		++getopt.ind;
-	}
-	return optopt;
-}
-
-/***********************
- * Interval operations *
- ***********************/
-
-Interval = {};
-
-Interval.sort = function(a)
-{
-	if (typeof a[0] == 'number')
-		a.sort(function(x, y) { return x - y });
-	else a.sort(function(x, y) { return x[0] != y[0]? x[0] - y[0] : x[1] - y[1] });
-}
-
-Interval.merge = function(a, sorted)
-{
-	if (typeof sorted == 'undefined') sorted = true;
-	if (!sorted) Interval.sort(a);
-	var k = 0;
-	for (var i = 1; i < a.length; ++i) {
-		if (a[k][1] >= a[i][0])
-			a[k][1] = a[k][1] > a[i][1]? a[k][1] : a[i][1];
-		else a[++k] = a[i].slice(0);
-	}
-	a.length = k + 1;
-}
-
-Interval.index_end = function(a, sorted)
-{
-	if (a.length == 0) return;
-	if (typeof sorted == 'undefined') sorted = true;
-	if (!sorted) Interval.sort(a);
-	a[0].push(0);
-	var k = 0, k_en = a[0][1];
-	for (var i = 1; i < a.length; ++i) {
-		if (k_en <= a[i][0]) {
-			for (++k; k < i; ++k)
-				if (a[k][1] > a[i][0])
-					break;
-			k_en = a[k][1];
-		}
-		a[i].push(k);
-	}
-}
-
-Interval.find_intv = function(a, x)
-{
-	var left = -1, right = a.length;
-	if (typeof a[0] == 'number') {
-		while (right - left > 1) {
-			var mid = left + ((right - left) >> 1);
-			if (a[mid] > x) right = mid;
-			else if (a[mid] < x) left = mid;
-			else return mid;
-		}
-	} else {
-		while (right - left > 1) {
-			var mid = left + ((right - left) >> 1);
-			if (a[mid][0] > x) right = mid;
-			else if (a[mid][0] < x) left = mid;
-			else return mid;
-		}
-	}
-	return left;
-}
-
-Interval.find_ovlp = function(a, st, en)
-{
-	if (a.length == 0 || st >= en) return [];
-	var l = Interval.find_intv(a, st);
-	var k = l < 0? 0 : a[l][a[l].length - 1];
-	var b = [];
-	for (var i = k; i < a.length; ++i) {
-		if (a[i][0] >= en) break;
-		else if (st < a[i][1])
-			b.push(a[i]);
-	}
-	return b;
-}
-
-/*****************
- * Main function *
- *****************/
-
-var c, l_fuzzy = 0, print_ovlp = false, print_err_only = false, first_only = false;
-while ((c = getopt(arguments, "l:ep")) != null) {
-	if (c == 'l') l_fuzzy = parseInt(getopt.arg);
-	else if (c == 'e') print_err_only = print_ovlp = true;
-	else if (c == 'p') print_ovlp = true;
-}
-
-if (arguments.length - getopt.ind < 2) {
-	print("Usage: k8 intron-eval.js [options] <gene.gtf> <aln.sam>");
-	exit(1);
-}
-
-var file, buf = new Bytes();
-
-var tr = {};
-file = new File(arguments[getopt.ind]);
-while (file.readline(buf) >= 0) {
-	var m, t = buf.toString().split("\t");
-	if (t[0].charAt(0) == '#') continue;
-	if (t[2] != 'exon') continue;
-	var st = parseInt(t[3]) - 1;
-	var en = parseInt(t[4]);
-	if ((m = /transcript_id "(\S+)"/.exec(t[8])) == null) continue;
-	var tid = m[1];
-	if (tr[tid] == null) tr[tid] = [t[0], t[6], 0, 0, []];
-	tr[tid][4].push([st, en]);
-}
-file.close();
-
-var anno = {};
-for (var tid in tr) {
-	var t = tr[tid];
-	Interval.sort(t[4]);
-	t[2] = t[4][0][0];
-	t[3] = t[4][t[4].length - 1][1];
-	if (anno[t[0]] == null) anno[t[0]] = [];
-	var s = t[4];
-	for (var i = 0; i < s.length - 1; ++i) {
-		if (s[i][1] >= s[i+1][0]) throw Error("ERROR: wrong annotation!");
-		anno[t[0]].push([s[i][1], s[i+1][0]]);
-	}
-}
-tr = null;
-
-for (var chr in anno) {
-	var e = anno[chr];
-	if (e.length == 0) continue;
-	Interval.sort(e);
-	var k = 0;
-	for (var i = 1; i < e.length; ++i) // dedup
-		if (e[i][0] != e[k][0] || e[i][1] != e[k][1])
-			e[++k] = e[i].slice(0);
-	e.length = k + 1;
-	Interval.index_end(e);
-}
-
-var n_pri = 0, n_unmapped = 0, n_mapped = 0;
-var n_sgl = 0, n_splice = 0, n_splice_hit = 0, n_splice_novel = 0;
-
-file = new File(arguments[getopt.ind+1]);
-var last_qname = null;
-var re_cigar = /(\d+)([MIDNSHX=])/g;
-while (file.readline(buf) >= 0) {
-	var m, t = buf.toString().split("\t");
-
-	if (t[0].charAt(0) == '@') continue;
-	var flag = parseInt(t[1]);
-	if (flag&0x100) continue;
-	if (first_only && last_qname == t[0]) continue;
-	if (t[2] == '*') {
-		++n_unmapped;
-		continue;
-	} else {
-		++n_pri;
-		if (last_qname != t[0]) ++n_mapped;
-	}
-
-	var pos = parseInt(t[3]) - 1, intron = [];
-	while ((m = re_cigar.exec(t[5])) != null) {
-		var len = parseInt(m[1]), op = m[2];
-		if (op == 'N') {
-			intron.push([pos, pos + len]);
-			pos += len;
-		} else if (op == 'M' || op == 'X' || op == '=' || op == 'D') pos += len;
-	}
-	if (intron.length == 0) {
-		++n_sgl;
-		continue;
-	}
-	n_splice += intron.length;
-
-	var chr = anno[t[2]];
-	if (chr != null) {
-		for (var i = 0; i < intron.length; ++i) {
-			var o = Interval.find_ovlp(chr, intron[i][0], intron[i][1]);
-			if (o.length > 0) {
-				var hit = false;
-				for (var j = 0; j < o.length; ++j) {
-					var st_diff = intron[i][0] - o[j][0];
-					var en_diff = intron[i][1] - o[j][1];
-					if (st_diff < 0) st_diff = -st_diff;
-					if (en_diff < 0) en_diff = -en_diff;
-					if (st_diff <= l_fuzzy && en_diff <= l_fuzzy)
-						++n_splice_hit, hit = true;
-					if (hit) break;
-				}
-				if (print_ovlp) {
-					var type = hit? 'C' : 'P';
-					if (hit && print_err_only) continue;
-					var x = '[';
-					for (var j = 0; j < o.length; ++j) {
-						if (j) x += ', ';
-						x += '(' + o[j][0] + "," + o[j][1] + ')';
-					}
-					x += ']';
-					print(type, t[0], i+1, t[2], intron[i][0], intron[i][1], x);
-				}
-			} else {
-				++n_splice_novel;
-				if (print_ovlp)
-					print('N', t[0], i+1, t[2], intron[i][0], intron[i][1]);
-			}
-		}
-	} else {
-		n_splice_novel += intron.length;
-	}
-	last_qname = t[0];
-}
-file.close();
-
-buf.destroy();
-
-if (!print_ovlp) {
-	print("# unmapped reads: " + n_unmapped);
-	print("# mapped reads: " + n_mapped);
-	print("# primary alignments: " + n_pri);
-	print("# singletons: " + n_sgl);
-	print("# predicted introns: " + n_splice);
-	print("# non-overlapping introns: " + n_splice_novel);
-	print("# correct introns: " + n_splice_hit + " (" + (n_splice_hit / n_splice * 100).toFixed(2) + "%)");
-}

misc/mapstat.js

@@ -1,183 +0,0 @@
-var getopt = function(args, ostr) {
-	var oli; // option letter list index
-	if (typeof(getopt.place) == 'undefined')
-		getopt.ind = 0, getopt.arg = null, getopt.place = -1;
-	if (getopt.place == -1) { // update scanning pointer
-		if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
-			getopt.place = -1;
-			return null;
-		}
-		if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
-			++getopt.ind;
-			getopt.place = -1;
-			return null;
-		}
-	}
-	var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
-	if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
-		if (optopt == '-') return null; //  if the user didn't specify '-' as an option, assume it means null.
-		if (getopt.place < 0) ++getopt.ind;
-		return '?';
-	}
-	if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
-		getopt.arg = null;
-		if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
-	} else { // need an argument
-		if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
-			getopt.arg = args[getopt.ind].substr(getopt.place);
-		else if (args.length <= ++getopt.ind) { // no arg
-			getopt.place = -1;
-			if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
-			return '?';
-		} else getopt.arg = args[getopt.ind]; // white space
-		getopt.place = -1;
-		++getopt.ind;
-	}
-	return optopt;
-}
-
-var c, gap_out_len = null;
-while ((c = getopt(arguments, "l:")) != null)
-	if (c == 'l') gap_out_len = parseInt(getopt.arg);
-
-if (getopt.ind == arguments.length) {
-	print("Usage: k8 mapstat.js [-l gapOutLen] <in.sam>|<in.paf>");
-	exit(1);
-}
-
-var buf = new Bytes();
-var file = new File(arguments[getopt.ind]);
-var re = /(\d+)([MIDSHNX=])/g;
-
-var lineno = 0, n_pri = 0, n_2nd = 0, n_seq = 0, n_cigar_64k = 0, l_tot = 0, l_cov = 0;
-var n_gap = [[0, 0, 0, 0, 0, 0], [0, 0, 0, 0, 0, 0]];
-
-function cov_len(regs)
-{
-	regs.sort(function(a,b) {return a[0]-b[0]});
-	var st = regs[0][0], en = regs[0][1], l = 0;
-	for (var i = 1; i < regs.length; ++i) {
-		if (regs[i][0] < en)
-			en = en > regs[i][1]? en : regs[i][1];
-		else l += en - st, st = regs[i][0], en = regs[i][1];
-	}
-	l += en - st;
-	return l;
-}
-
-var last = null, last_qlen = null, regs = [];
-while (file.readline(buf) >= 0) {
-	var line = buf.toString();
-	++lineno;
-	if (line.charAt(0) != '@') {
-		var t = line.split("\t", 12);
-		var m, rs, cigar = null, is_pri = false, is_sam = false, is_rev = false, tname = null;
-		var atlen = null, aqlen, qs, qe, mapq, ori_qlen;
-		if (t[4] == '+' || t[4] == '-') { // PAF
-			if (!/\ts2:i:\d+/.test(line)) {
-				++n_2nd;
-				continue;
-			}
-			if ((m = /\tcg:Z:(\S+)/.exec(line)) != null)
-				cigar = m[1];
-			if (cigar == null) {
-				warn("WARNING: no CIGAR at line " + lineno);
-				continue;
-			}
-			tname = t[5];
-			qs = parseInt(t[2]), qe = parseInt(t[3]);
-			aqlen = qe - qs;
-			is_rev = t[4] == '+'? false : true;
-			rs = parseInt(t[7]);
-			atlen = parseInt(t[8]) - rs;
-			mapq = parseInt(t[11]);
-			ori_qlen = parseInt(t[1]);
-		} else { // SAM
-			var flag = parseInt(t[1]);
-			if ((flag & 4) || t[2] == '*' || t[5] == '*') continue;
-			if (flag & 0x100) {
-				++n_2nd;
-				continue;
-			}
-			cigar = t[5];
-			tname = t[2];
-			rs = parseInt(t[3]) - 1;
-			mapq = parseInt(t[4]);
-			aqlen = t[9].length;
-			is_sam = true;
-			is_rev = !!(flag&0x10);
-		}
-		++n_pri;
-		if (last != t[0]) {
-			if (last != null) {
-				l_tot += last_qlen;
-				l_cov += cov_len(regs);
-			}
-			regs = [];
-			++n_seq, last = t[0];
-		}
-		var M = 0, tl = 0, ql = 0, clip = [0, 0], n_cigar = 0, sclip = 0;
-		while ((m = re.exec(cigar)) != null) {
-			var l = parseInt(m[1]);
-			++n_cigar;
-			if (m[2] == 'M' || m[2] == '=' || m[2] == 'X') {
-				tl += l, ql += l, M += l;
-			} else if (m[2] == 'I' || m[2] == 'D') {
-				var type;
-				if (l < 50) type = 0;
-				else if (l < 100) type = 1;
-				else if (l < 300) type = 2;
-				else if (l < 400) type = 3;
-				else if (l < 1000) type = 4;
-				else type = 5;
-				if (m[2] == 'I') ql += l, ++n_gap[0][type];
-				else tl += l, ++n_gap[1][type];
-				if (gap_out_len != null && l >= gap_out_len)
-					print(t[0], ql, is_rev? '-' : '+', tname, rs + tl, m[2], l);
-			} else if (m[2] == 'N') {
-				tl += l;
-			} else if (m[2] == 'S') {
-				clip[M == 0? 0 : 1] = l, sclip += l;
-			} else if (m[2] == 'H') {
-				clip[M == 0? 0 : 1] = l;
-			}
-		}
-		if (n_cigar > 65535) ++n_cigar_64k;
-		if (ql + sclip != aqlen)
-			warn("WARNING: aligned query length is inconsistent with CIGAR at line " + lineno + " (" + (ql+sclip) + " != " + aqlen + ")");
-		if (atlen != null && atlen != tl)
-			warn("WARNING: aligned reference length is inconsistent with CIGAR at line " + lineno);
-		if (is_sam) {
-			qs = clip[is_rev? 1 : 0], qe = qs + ql;
-			ori_qlen = clip[0] + ql + clip[1];
-		}
-		regs.push([qs, qe]);
-		last_qlen = ori_qlen;
-	}
-}
-l_tot += last_qlen;
-l_cov += cov_len(regs);
-
-file.close();
-buf.destroy();
-
-if (gap_out_len == null) {
-	print("Number of mapped sequences: " + n_seq);
-	print("Number of primary alignments: " + n_pri);
-	print("Number of secondary alignments: " + n_2nd);
-	print("Number of primary alignments with >65535 CIGAR operations: " + n_cigar_64k);
-	print("Number of bases in mapped sequences: " + l_tot);
-	print("Number of mapped bases: " + l_cov);
-	print("Number of insertions in [0,50): " + n_gap[0][0]);
-	print("Number of insertions in [50,100): " + n_gap[0][1]);
-	print("Number of insertions in [100,300): " + n_gap[0][2]);
-	print("Number of insertions in [300,400): " + n_gap[0][3]);
-	print("Number of insertions in [400,1000): " + n_gap[0][4]);
-	print("Number of insertions in [1000,inf): " + n_gap[0][5]);
-	print("Number of deletions in [0,50): " + n_gap[1][0]);
-	print("Number of deletions in [50,100): " + n_gap[1][1]);
-	print("Number of deletions in [100,300): " + n_gap[1][2]);
-	print("Number of deletions in [300,400): " + n_gap[1][3]);
-	print("Number of deletions in [400,1000): " + n_gap[1][4]);
-	print("Number of deletions in [1000,inf): " + n_gap[1][5]);
-}

misc/paf2aln.js

@@ -1,171 +0,0 @@
-var getopt = function(args, ostr) {
-	var oli; // option letter list index
-	if (typeof(getopt.place) == 'undefined')
-		getopt.ind = 0, getopt.arg = null, getopt.place = -1;
-	if (getopt.place == -1) { // update scanning pointer
-		if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
-			getopt.place = -1;
-			return null;
-		}
-		if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
-			++getopt.ind;
-			getopt.place = -1;
-			return null;
-		}
-	}
-	var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
-	if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
-		if (optopt == '-') return null; //  if the user didn't specify '-' as an option, assume it means null.
-		if (getopt.place < 0) ++getopt.ind;
-		return '?';
-	}
-	if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
-		getopt.arg = null;
-		if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
-	} else { // need an argument
-		if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
-			getopt.arg = args[getopt.ind].substr(getopt.place);
-		else if (args.length <= ++getopt.ind) { // no arg
-			getopt.place = -1;
-			if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
-			return '?';
-		} else getopt.arg = args[getopt.ind]; // white space
-		getopt.place = -1;
-		++getopt.ind;
-	}
-	return optopt;
-}
-
-var c, maf_out = false, line_len = 80;
-while ((c = getopt(arguments, "ml:")) != null) {
-	if (c == 'm') maf_out = true;
-	else if (c == 'l') line_len = parseInt(getopt.arg); // TODO: not implemented yet
-}
-if (line_len == 0) line_len = 0x7fffffff;
-
-if (getopt.ind == arguments.length) {
-	print("Usage: k8 paf2aln.js [options] <with-cs.paf>");
-	print("Options:");
-	print("  -m        MAF output (BLAST-like output by default)");
-	print("  -l INT    line length in BLAST-like output [80]");
-	print("");
-	print("Note: this script only works when minimap2 is run with option '-S'");
-	exit(1);
-}
-
-function padding_str(x, len, right)
-{
-	var s = x.toString();
-	if (s.length < len) {
-		if (right) s += Array(len - s.length + 1).join(" ");
-		else s = Array(len - s.length + 1).join(" ") + s;
-	}
-	return s;
-}
-
-function update_aln(s_ref, s_qry, s_mid, type, seq, slen)
-{
-	var l = type == '*'? 1 : seq.length;
-	if (type == '=') {
-		s_ref.set(seq);
-		s_qry.set(seq);
-		s_mid.set(Array(l+1).join("|"));
-		slen[0] += l, slen[1] += l;
-	} else if (type == '*') {
-		s_ref.set(seq.charAt(0));
-		s_qry.set(seq.charAt(1));
-		s_mid.set(' ');
-		slen[0] += 1, slen[1] += 1;
-	} else if (type == '+') {
-		s_ref.set(Array(l+1).join("-"));
-		s_qry.set(seq);
-		s_mid.set(Array(l+1).join(" "));
-		slen[1] += l;
-	} else if (type == '-') {
-		s_ref.set(seq);
-		s_qry.set(Array(l+1).join("-"));
-		s_mid.set(Array(l+1).join(" "));
-		slen[0] += l;
-	}
-}
-
-function print_aln(rs, qs, strand, slen, elen, s_ref, s_qry, s_mid)
-{
-	print(["Ref+:", padding_str(rs + slen[0] + 1, 10, false), s_ref.toString(), padding_str(rs + elen[0], 10, true)].join(" "));
-	print("                 " + s_mid.toString());
-	var st, en;
-	if (strand == '+') st = qs + slen[1] + 1, en = qs + elen[1];
-	else st = qs - slen[1], en = qs - elen[1] + 1;
-	print(["Qry" + strand + ":", padding_str(st,               10, false), s_qry.toString(), padding_str(en          , 10, true)].join(" "));
-}
-
-var s_ref = new Bytes(), s_qry = new Bytes(), s_mid = new Bytes();
-var re = /([=\-\+\*])([A-Za-z]+)/g;
-
-var buf = new Bytes();
-var file = new File(arguments[getopt.ind]);
-if (maf_out) print("##maf version=1\n");
-while (file.readline(buf) >= 0) {
-	var m, line = buf.toString();
-	var t = line.split("\t", 12);
-	if ((m = /\tcs:Z:(\S+)/.exec(line)) == null) continue;
-	var cs = m[1];
-	s_ref.length = s_qry.length = s_mid.length = 0;
-	var slen = [0, 0], elen = [0, 0];
-	if (maf_out) {
-		while ((m = re.exec(cs)) != null)
-			update_aln(s_ref, s_qry, s_mid, m[1], m[2], elen);
-		if (maf_out) {
-			var score = (m = /\tAS:i:(\d+)/.exec(line)) != null? parseInt(m[1]) : 0;
-			var len = t[0].length > t[5].length? t[0].length : t[5].length;
-			print("a " + score);
-			print(["s", padding_str(t[5], len, true), padding_str(t[7], 10, false), padding_str(parseInt(t[8]) - parseInt(t[7]), 10, false),
-				   "+", padding_str(t[6], 10, false), s_ref.toString()].join(" "));
-			var qs, qe, ql = parseInt(t[1]);
-			if (t[4] == '+') {
-				qs = parseInt(t[2]);
-				qe = parseInt(t[3]);
-			} else {
-				qs = ql - parseInt(t[3]);
-				qe = ql - parseInt(t[2]);
-			}
-			print(["s", padding_str(t[0], len, true), padding_str(qs, 10, false), padding_str(qe - qs, 10, false),
-				   t[4], padding_str(ql, 10, false), s_qry.toString()].join(" "));
-			print("");
-		}
-	} else {
-		line = line.replace(/\tc[sg]:Z:\S+/g, "");
-		print('>' + line);
-		var rs = parseInt(t[7]), qs = t[4] == '+'? parseInt(t[2]) : parseInt(t[3]);
-		var n_blocks = 0;
-		while ((m = re.exec(cs)) != null) {
-			var start = 0, rest = m[1] == '*'? 1 : m[2].length;
-			while (rest > 0) {
-				var l_proc;
-				if (s_ref.length + rest >= line_len) {
-					l_proc = line_len - s_ref.length;
-					update_aln(s_ref, s_qry, s_mid, m[1], m[1] == '*'? m[2] : m[2].substr(start, l_proc), elen);
-					if (n_blocks > 0) print("");
-					print_aln(rs, qs, t[4], slen, elen, s_ref, s_qry, s_mid);
-					++n_blocks;
-					s_ref.length = s_qry.length = s_mid.length = 0;
-					slen[0] = elen[0], slen[1] = elen[1];
-				} else {
-					l_proc = rest;
-					update_aln(s_ref, s_qry, s_mid, m[1], m[1] == '*'? m[2] : m[2].substr(start, l_proc), elen);
-				}
-				rest -= l_proc, start += l_proc;
-			}
-		}
-		if (s_ref.length > 0) {
-			if (n_blocks > 0) print("");
-			print_aln(rs, qs, t[4], slen, elen, s_ref, s_qry, s_mid);
-			++n_blocks;
-		}
-		print("//");
-	}
-}
-file.close();
-buf.destroy();
-
-s_ref.destroy(); s_qry.destroy(); s_mid.destroy();

misc/sam2paf.js

@@ -1,114 +0,0 @@
-var getopt = function(args, ostr) {
-	var oli; // option letter list index
-	if (typeof(getopt.place) == 'undefined')
-		getopt.ind = 0, getopt.arg = null, getopt.place = -1;
-	if (getopt.place == -1) { // update scanning pointer
-		if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
-			getopt.place = -1;
-			return null;
-		}
-		if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
-			++getopt.ind;
-			getopt.place = -1;
-			return null;
-		}
-	}
-	var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
-	if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
-		if (optopt == '-') return null; //  if the user didn't specify '-' as an option, assume it means null.
-		if (getopt.place < 0) ++getopt.ind;
-		return '?';
-	}
-	if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
-		getopt.arg = null;
-		if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
-	} else { // need an argument
-		if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
-			getopt.arg = args[getopt.ind].substr(getopt.place);
-		else if (args.length <= ++getopt.ind) { // no arg
-			getopt.place = -1;
-			if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
-			return '?';
-		} else getopt.arg = args[getopt.ind]; // white space
-		getopt.place = -1;
-		++getopt.ind;
-	}
-	return optopt;
-}
-
-var c, pri_only = false;
-while ((c = getopt(arguments, "p")) != null)
-	if (c == 'p') pri_only = true;
-
-var file = arguments.length == getopt.ind? new File() : new File(arguments[getopt.ind]);
-var buf = new Bytes();
-var re = /(\d+)([MIDSHNX=])/g;
-
-var len = {}, lineno = 0;
-while (file.readline(buf) >= 0) {
-	var m, n_cigar = 0, line = buf.toString();
-	++lineno;
-	if (line.charAt(0) == '@') {
-		if (/^@SQ/.test(line)) {
-			var name = (m = /\tSN:(\S+)/.exec(line)) != null? m[1] : null;
-			var l = (m = /\tLN:(\d+)/.exec(line)) != null? parseInt(m[1]) : null;
-			if (name != null && l != null) len[name] = l;
-		}
-		continue;
-	}
-	var t = line.split("\t");
-	var flag = parseInt(t[1]);
-	if (t[9] != '*' && t[10] != '*' && t[9].length != t[10].length) throw Error("ERROR at line " + lineno + ": inconsistent SEQ and QUAL lengths - " + t[9].length + " != " + t[10].length);
-	if (t[2] == '*' || (flag&4)) continue;
-	if (pri_only && (flag&0x100)) continue;
-	var tlen = len[t[2]];
-	if (tlen == null) throw Error("ERROR at line " + lineno + ": can't find the length of contig " + t[2]);
-	var nn = (m = /\tnn:i:(\d+)/.exec(line)) != null? parseInt(m[1]) : 0;
-	var NM = (m = /\tNM:i:(\d+)/.exec(line)) != null? parseInt(m[1]) : null;
-	var have_NM = NM == null? false : true;
-	NM += nn;
-	var clip = [0, 0], I = [0, 0], D = [0, 0], M = 0, N = 0, ql = 0, tl = 0, mm = 0, ext_cigar = false;
-	while ((m = re.exec(t[5])) != null) {
-		var l = parseInt(m[1]);
-		if (m[2] == 'M') M += l, ql += l, tl += l, ext_cigar = false;
-		else if (m[2] == 'I') ++I[0], I[1] += l, ql += l;
-		else if (m[2] == 'D') ++D[0], D[1] += l, tl += l;
-		else if (m[2] == 'N') N += l, tl += l;
-		else if (m[2] == 'S') clip[M == 0? 0 : 1] = l, ql += l;
-		else if (m[2] == 'H') clip[M == 0? 0 : 1] = l;
-		else if (m[2] == '=') M += l, ql += l, tl += l, ext_cigar = true;
-		else if (m[2] == 'X') M += l, ql += l, tl += l, mm += l, ext_cigar = true;
-		++n_cigar;
-	}
-	if (n_cigar > 65535)
-		warn("WARNING at line " + lineno + ": " + n_cigar + " CIGAR operations");
-	if (tl + parseInt(t[3]) - 1 > tlen) {
-		warn("WARNING at line " + lineno + ": alignment end position larger than ref length; skipped");
-		continue;
-	}
-	if (t[9] != '*' && t[9].length != ql) {
-		warn("WARNING at line " + lineno + ": SEQ length inconsistent with CIGAR (" + t[9].length + " != " + ql + "); skipped");
-		continue;
-	}
-	if (!have_NM || ext_cigar) NM = I[1] + D[1] + mm;
-	if (NM < I[1] + D[1] + mm) {
-		warn("WARNING at line " + lineno + ": NM is less than the total number of gaps (" + NM + " < " + (I[1]+D[1]+mm) + ")");
-		NM = I[1] + D[1] + mm;
-	}
-	var extra = ["mm:i:"+(NM-I[1]-D[1]), "io:i:"+I[0], "in:i:"+I[1], "do:i:"+D[0], "dn:i:"+D[1]];
-	var match = M - (NM - I[1] - D[1]);
-	var blen = M + I[1] + D[1];
-	var qlen = M + I[1] + clip[0] + clip[1];
-	var qs, qe;
-	if (flag&16) qs = clip[1], qe = qlen - clip[0];
-	else qs = clip[0], qe = qlen - clip[1];
-	var ts = parseInt(t[3]) - 1, te = ts + M + D[1] + N;
-	var qname = t[0];
-	if ((flag&1) && (flag&0x40)) qname += '/1';
-	if ((flag&1) && (flag&0x80)) qname += '/2';
-	var a = [qname, qlen, qs, qe, flag&16? '-' : '+', t[2], tlen, ts, te, match, blen, t[4]];
-	print(a.join("\t"), extra.join("\t"));
-}
-
-buf.destroy();
-file.close();

misc/sim-eval.js

@@ -1,193 +0,0 @@
-var getopt = function(args, ostr) {
-	var oli; // option letter list index
-	if (typeof(getopt.place) == 'undefined')
-		getopt.ind = 0, getopt.arg = null, getopt.place = -1;
-	if (getopt.place == -1) { // update scanning pointer
-		if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
-			getopt.place = -1;
-			return null;
-		}
-		if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
-			++getopt.ind;
-			getopt.place = -1;
-			return null;
-		}
-	}
-	var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
-	if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
-		if (optopt == '-') return null; //  if the user didn't specify '-' as an option, assume it means null.
-		if (getopt.place < 0) ++getopt.ind;
-		return '?';
-	}
-	if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
-		getopt.arg = null;
-		if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
-	} else { // need an argument
-		if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
-			getopt.arg = args[getopt.ind].substr(getopt.place);
-		else if (args.length <= ++getopt.ind) { // no arg
-			getopt.place = -1;
-			if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
-			return '?';
-		} else getopt.arg = args[getopt.ind]; // white space
-		getopt.place = -1;
-		++getopt.ind;
-	}
-	return optopt;
-}
-
-var c, max_mapq = 60, mode = 0, err_out_q = 256, print_err = false, ovlp_ratio = 0.1, cap_short_mapq = false;
-while ((c = getopt(arguments, "Q:r:m:c")) != null) {
-	if (c == 'Q') err_out_q = parseInt(getopt.arg), print_err = true;
-	else if (c == 'r') ovlp_ratio = parseFloat(getopt.arg);
-	else if (c == 'm') mode = parseInt(getopt.arg);
-	else if (c == 'c') cap_short_mapq = true;
-}
-
-var file = arguments.length == getopt.ind? new File() : new File(arguments[getopt.ind]);
-var buf = new Bytes();
-
-var tot = [], err = [];
-for (var q = 0; q <= max_mapq; ++q)
-	tot[q] = err[q] = 0;
-
-function is_correct(s, b)
-{
-	if (s[0] != b[0] || s[3] != b[3]) return false;
-	var o, l;
-	if (s[1] < b[1]) {
-		if (s[2] <= b[1]) return false;
-		o = (s[2] < b[2]? s[2] : b[2]) - b[1];
-		l = (s[2] > b[2]? s[2] : b[2]) - s[1];
-	} else {
-		if (b[2] <= s[1]) return false;
-		o = (s[2] < b[2]? s[2] : b[2]) - s[1];
-		l = (s[2] > b[2]? s[2] : b[2]) - b[1];
-	}
-	return o/l > ovlp_ratio? true : false;
-}
-
-function count_err(qname, a, tot, err, mode)
-{
-	if (a.length == 0) return;
-
-	var m, s;
-	if ((m = /^(\S+)!(\S+)!(\d+)!(\d+)!([\+\-])$/.exec(qname)) != null) { // pbsim single-end reads
-		s = [m[1], m[2], parseInt(m[3]), parseInt(m[4]), m[5]];
-	} else if ((m = /^(\S+)!(\S+)!(\d+)_(\d+)!(\d+)_(\d+)!([\+\-])([\+\-])\/([12])$/.exec(qname)) != null) { // mason2 paired-end reads
-		if (m[9] == '1') {
-			s = [m[1], m[2], parseInt(m[3]), parseInt(m[5]), m[7]];
-		} else {
-			s = [m[1], m[2], parseInt(m[4]), parseInt(m[6]), m[8]];
-		}
-	} else throw Error("Failed to parse simulated read names '" + qname + "'");
-	s.shift(); // skip the orginal read name
-
-	if (mode == 0 || mode == 1) { // longest only or first only
-		var max_i = 0;
-		if (mode == 0) { // longest only
-			var max = 0;
-			for (var i = 0; i < a.length; ++i)
-				if (a[i][5] > max)
-					max = a[i][5], max_i = i;
-		}
-		var mapq = a[max_i][4];
-		++tot[mapq];
-		if (!is_correct(s, a[max_i])) {
-			if (mapq >= err_out_q)
-				print('E', qname, a[max_i].join("\t"));
-			++err[mapq];
-		}
-	} else if (mode == 2) { // all primary mode
-		var max_err_mapq = -1, max_mapq = 0, max_err_i = -1;
-		if (cap_short_mapq) {
-			var max = 0, max_q = 0;
-			for (var i = 0; i < a.length; ++i)
-				if (a[i][5] > max)
-					max = a[i][5], max_q = a[i][4];
-			for (var i = 0; i < a.length; ++i)
-				a[i][4] = max_q < a[i][4]? max_q : a[i][4];
-		}
-		for (var i = 0; i < a.length; ++i) {
-			max_mapq = max_mapq > a[i][4]? max_mapq : a[i][4];
-			if (!is_correct(s, a[i]))
-				if (a[i][4] > max_err_mapq)
-					max_err_mapq = a[i][4], max_err_i = i;
-		}
-		if (max_err_mapq >= 0) {
-			++tot[max_err_mapq], ++err[max_err_mapq];
-			if (max_err_mapq >= err_out_q)
-				print('E', qname, a[max_err_i].join("\t"));
-		} else ++tot[max_mapq];
-	}
-}
-
-var lineno = 0, last = null, a = [], n_unmapped = null;
-var re_cigar = /(\d+)([MIDSHN])/g;
-while (file.readline(buf) >= 0) {
-	var m, line = buf.toString();
-	++lineno;
-	if (line[0] != '@') {
-		var t = line.split("\t");
-		if (t[4] == '+' || t[4] == '-') { // PAF
-			if (last != t[0]) {
-				if (last != null) count_err(last, a, tot, err, mode);
-				a = [], last = t[0];
-			}
-			if (/\ts1:i:\d+/.test(line) && !/\ts2:i:\d+/.test(line)) // secondary alignment in minimap2 PAF
-				continue;
-			var mapq = parseInt(t[11]);
-			if (mapq > max_mapq) mapq = max_mapq;
-			a.push([t[5], parseInt(t[7]), parseInt(t[8]), t[4], mapq, parseInt(t[9])]);
-		} else { // SAM
-			var flag = parseInt(t[1]);
-			var read_no = flag>>6&0x3;
-			var qname = t[0];
-			if (!/\/[12]$/.test(qname))
-				qname = read_no == 1 || read_no == 2? t[0] + '/' + read_no : t[0];
-			if (last != qname) {
-				if (last != null) count_err(last, a, tot, err, mode);
-				a = [], last = qname;
-			}
-			if (flag&0x100) continue; // secondary alignment
-			if ((flag&0x4) || t[2] == '*') { // unmapped
-				if (n_unmapped == null) n_unmapped = 0;
-				++n_unmapped;
-				continue;
-			}
-			var mapq = parseInt(t[4]);
-			if (mapq > max_mapq) mapq = max_mapq;
-			var pos = parseInt(t[3]) - 1, pos_end = pos;
-			var n_gap = 0, mlen = 0;
-			while ((m = re_cigar.exec(t[5])) != null) {
-				var len = parseInt(m[1]);
-				if (m[2] == 'M') pos_end += len, mlen += len;
-				else if (m[2] == 'I') n_gap += len;
-				else if (m[2] == 'D') n_gap += len, pos_end += len;
-			}
-			var score = pos_end - pos;
-			if ((m = /\tNM:i:(\d+)/.exec(line)) != null) {
-				var NM = parseInt(m[1]);
-				if (NM >= n_gap) score = mlen - (NM - n_gap);
-			}
-			a.push([t[2], pos, pos_end, (flag&16)? '-' : '+', mapq, score]);
-		}
-	}
-}
-if (last != null) count_err(last, a, tot, err, mode);
-
-buf.destroy();
-file.close();
-
-var sum_tot = 0, sum_err = 0, q_out = -1, sum_tot2 = 0, sum_err2 = 0;
-for (var q = max_mapq; q >= 0; --q) {
-	if (tot[q] == 0) continue;
-	if (q_out < 0 || err[q] > 0) {
-		if (q_out >= 0) print('Q', q_out, sum_tot, sum_err, (sum_err2/sum_tot2).toFixed(9), sum_tot2);
-		sum_tot = sum_err = 0, q_out = q;
-	}
-	sum_tot += tot[q], sum_err += err[q];
-	sum_tot2 += tot[q], sum_err2 += err[q];
-}
-print('Q', q_out, sum_tot, sum_err, (sum_err2/sum_tot2).toFixed(9), sum_tot2);
-if (n_unmapped != null) print('U', n_unmapped);

misc/sim-mason2.js

@@ -1,105 +0,0 @@
-Bytes.prototype.reverse = function()
-{
-	for (var i = 0; i < this.length>>1; ++i) {
-		var tmp = this[i];
-		this[i] = this[this.length - i - 1];
-		this[this.length - i - 1] = tmp;
-	}
-}
-
-// reverse complement a DNA string
-Bytes.prototype.revcomp = function()
-{
-	if (Bytes.rctab == null) {
-		var s1 = 'WSATUGCYRKMBDHVNwsatugcyrkmbdhvn';
-		var s2 = 'WSTAACGRYMKVHDBNwstaacgrymkvhdbn';
-		Bytes.rctab = [];
-		for (var i = 0; i < 256; ++i) Bytes.rctab[i] = 0;
-		for (var i = 0; i < s1.length; ++i)
-			Bytes.rctab[s1.charCodeAt(i)] = s2.charCodeAt(i);
-	}
-	for (var i = 0; i < this.length>>1; ++i) {
-		var tmp = this[this.length - i - 1];
-		this[this.length - i - 1] = Bytes.rctab[this[i]];
-		this[i] = Bytes.rctab[tmp];
-	}
-	if (this.length&1)
-		this[this.length>>1] = Bytes.rctab[this[this.length>>1]];
-}
-
-if (arguments.length == 0) {
-	print("Usage: k8 sim-mason2.js <mason.sam>");
-	exit(1);
-}
-
-function print_se(a)
-{
-	print('@' + a.slice(0, 5).join("!") + " " + a[8]);
-	print(a[5]);
-	print("+");
-	print(a[6]);
-}
-
-var buf = new Bytes(), buf2 = new Bytes();
-var file = new File(arguments[0]);
-var re = /(\d+)([MIDSHN])/g;
-var last = null;
-while (file.readline(buf) >= 0) {
-	var t = buf.toString().split("\t");
-	if (t[0].charAt(0) == '@') continue;
-	var m, l_ref = 0;
-	while ((m = re.exec(t[5])) != null)
-		if (m[2] == 'D' || m[2] == 'M' || m[2] == 'N')
-			l_ref += parseInt(m[1]);
-	var flag = parseInt(t[1]);
-	var rev = !!(flag&16);
-	var seq, qual;
-	if (rev) {
-		buf2.length = 0;
-		buf2.set(t[9], 0);
-		buf2.revcomp();
-		seq = buf2.toString();
-		buf2.set(t[10], 0);
-		buf2.reverse();
-		qual = buf2.toString();
-	} else seq = t[9], qual = t[10];
-	var qname = t[0];
-	qname = qname.replace(/^simulated./, "");
-	var chr = t[2];
-	var pos = parseInt(t[3]) - 1;
-	var strand = (flag&16)? '-' : '+';
-	var read_no = flag&0xc0;
-	if (read_no == 0x40) read_no = 1;
-	else if (read_no == 0x80) read_no = 2;
-	else read_no = 0;
-	var err = 0, snp = 0, indel = 0;
-	for (var i = 11; i < t.length; ++i) {
-		if ((m = /^XE:i:(\d+)/.exec(t[i])) != null) err = m[1];
-		else if ((m = /^XS:i:(\d+)/.exec(t[i])) != null) snp = m[1];
-		else if ((m = /^XI:i:(\d+)/.exec(t[i])) != null) indel = m[1];
-	}
-	var comment = [err, snp, indel].join(":");
-	if (last == null) {
-		last = [qname, chr, pos, pos + l_ref, strand, seq, qual, read_no, comment];
-	} else if (last[0] != qname) {
-		print_se(last);
-		last = [qname, chr, pos, pos + l_ref, strand, seq, qual, read_no, comment];
-	} else {
-		if (read_no == 2) { // last[] is the first read
-			if (last[7] != 1) throw Error("ERROR: can't find read1");
-			var name = [qname, chr, last[2] + "_" + pos, last[3] + "_" + (pos + l_ref), last[4] + strand].join("!");
-			print('@' + name + '/1' + ' ' + last[8]); print(last[5]); print("+"); print(last[6]);
-			print('@' + name + '/2' + ' ' + comment); print(seq); print("+"); print(qual);
-		} else {
-			if (last[7] != 2) throw Error("ERROR: can't find read2");
-			var name = [qname, chr, pos + "_" + last[2], (pos + l_ref) + "_" + last[3], strand + last[4]].join("!");
-			print('@' + name + '/1' + ' ' + comment); print(seq); print("+"); print(qual);
-			print('@' + name + '/2' + ' ' + last[8]); print(last[5]); print("+"); print(last[6]);
-		}
-		last = null;
-	}
-}
-if (last != null) print_se(last);
-file.close();
-buf.destroy();
-buf2.destroy();

misc/sim-pbsim.js

@@ -1,81 +0,0 @@
-Bytes.prototype.reverse = function()
-{
-	for (var i = 0; i < this.length>>1; ++i) {
-		var tmp = this[i];
-		this[i] = this[this.length - i - 1];
-		this[this.length - i - 1] = tmp;
-	}
-}
-
-// reverse complement a DNA string
-Bytes.prototype.revcomp = function()
-{
-	if (Bytes.rctab == null) {
-		var s1 = 'WSATUGCYRKMBDHVNwsatugcyrkmbdhvn';
-		var s2 = 'WSTAACGRYMKVHDBNwstaacgrymkvhdbn';
-		Bytes.rctab = [];
-		for (var i = 0; i < 256; ++i) Bytes.rctab[i] = 0;
-		for (var i = 0; i < s1.length; ++i)
-			Bytes.rctab[s1.charCodeAt(i)] = s2.charCodeAt(i);
-	}
-	for (var i = 0; i < this.length>>1; ++i) {
-		var tmp = this[this.length - i - 1];
-		this[this.length - i - 1] = Bytes.rctab[this[i]];
-		this[i] = Bytes.rctab[tmp];
-	}
-	if (this.length&1)
-		this[this.length>>1] = Bytes.rctab[this[this.length>>1]];
-}
-
-if (arguments.length < 2) {
-	print("Usage: k8 sim-pbsim.js <ref.fa.fai> <pbsim1.maf> [[pbsim2.maf] ...]");
-	exit(1);
-}
-
-var file, buf = new Bytes(), buf2 = new Bytes();
-file = new File(arguments[0]);
-var chr_list = [];
-while (file.readline(buf) >= 0) {
-	var t = buf.toString().split(/\s+/);
-	chr_list.push(t[0]);
-}
-file.close();
-
-for (var k = 1; k < arguments.length; ++k) {
-	var fn = arguments[k];
-	file = new File(fn);
-	var state = 0, reg;
-	while (file.readline(buf) >= 0) {
-		var line = buf.toString();
-		if (state == 0 && line.charAt(0) == 'a') {
-			state = 1;
-		} else if (state == 1 && line.charAt(0) == 's') {
-			var t = line.split(/\s+/);
-			var st = parseInt(t[2]);
-			reg = [st, st + parseInt(t[3])];
-			state = 2;
-		} else if (state == 2 && line.charAt(0) == 's') {
-			var m, t = line.split(/\s+/);
-			if ((m = /S(\d+)_\d+/.exec(t[1])) == null) throw Error("Failed to parse the read name");
-			var chr_id = parseInt(m[1]) - 1;
-			if (chr_id >= chr_list.length) throw Error("Index outside the chr list");
-			var name = [t[1], chr_list[chr_id], reg[0], reg[1], t[4]].join("!");
-			var seq = t[6].replace(/\-/g, "");
-			if (seq.length != parseInt(t[5])) throw Error("Inconsistent read length");
-			if (seq.indexOf("NN") < 0) {
-				if (t[4] == '-') {
-					buf2.set(seq, 0);
-					buf2.length = seq.length;
-					buf2.revcomp();
-					seq = buf2.toString();
-				}
-				print(">" + name);
-				print(seq);
-			}
-			state = 0;
-		}
-	}
-	file.close();
-}
-buf.destroy();
-buf2.destroy();

mmpriv.h

@@ -16,6 +16,7 @@
 #define MM_SEED_LONG_JOIN  (1ULL<<40)
 #define MM_SEED_IGNORE     (1ULL<<41)
 #define MM_SEED_TANDEM     (1ULL<<42)
+#define MM_SEED_SELF       (1ULL<<43)
 
 #define MM_SEED_SEG_SHIFT  48
 #define MM_SEED_SEG_MASK   (0xffULL<<(MM_SEED_SEG_SHIFT))
@@ -47,6 +48,7 @@ typedef struct {
 
 double cputime(void);
 double realtime(void);
+long peakrss(void);
 
 void radix_sort_128x(mm128_t *beg, mm128_t *end);
 void radix_sort_64(uint64_t *beg, uint64_t *end);
@@ -61,10 +63,9 @@ void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
 
 void mm_idxopt_init(mm_idxopt_t *opt);
 const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n);
-int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq);
 int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f);
 mm128_t *mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int min_cnt, int min_sc, int is_cdna, int n_segs, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km);
-mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, const char *qual, int *n_regs_, mm_reg1_t *regs, mm128_t *a);
+mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a);
 
 mm_reg1_t *mm_gen_regs(void *km, uint32_t hash, int qlen, int n_u, uint64_t *u, mm128_t *a);
 void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a);
@@ -74,11 +75,12 @@ int mm_set_sam_pri(int n, mm_reg1_t *r);
 void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r, int sub_diff);
 void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int *n_, mm_reg1_t *r);
 void mm_select_sub_multi(void *km, float pri_ratio, float pri1, float pri2, int max_gap_ref, int min_diff, int best_n, int n_segs, const int *qlens, int *n_, mm_reg1_t *r);
-void mm_filter_regs(void *km, const mm_mapopt_t *opt, int *n_regs, mm_reg1_t *regs);
+void mm_filter_regs(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs);
-void mm_filter_by_identity(void *km, int n_regs, mm_reg1_t *regs, float min_iden, int qlen, const char *qual);
 void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs, mm128_t *a);
 void mm_hit_sort_by_dp(void *km, int *n_regs, mm_reg1_t *r);
-void mm_set_mapq(int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len);
+void mm_set_mapq(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr);
+
+void mm_est_err(const mm_idx_t *mi, int qlen, int n_regs, mm_reg1_t *regs, const mm128_t *a, int32_t n, const uint64_t *mini_pos);
 
 mm_seg_t *mm_seg_gen(void *km, uint32_t hash, int n_segs, const int *qlens, int n_regs0, const mm_reg1_t *regs0, int *n_regs, mm_reg1_t **regs, const mm128_t *a);
 void mm_seg_free(void *km, int n_segs, mm_seg_t *segs);

options.c

@@ -0,0 +1,155 @@
+#include <stdio.h>
+#include "mmpriv.h"
+
+void mm_idxopt_init(mm_idxopt_t *opt)
+{
+	memset(opt, 0, sizeof(mm_idxopt_t));
+	opt->k = 15, opt->w = 10, opt->flag = 0;
+	opt->bucket_bits = 14;
+	opt->mini_batch_size = 50000000;
+	opt->batch_size = 4000000000ULL;
+}
+
+void mm_mapopt_init(mm_mapopt_t *opt)
+{
+	memset(opt, 0, sizeof(mm_mapopt_t));
+	opt->seed = 11;
+	opt->mid_occ_frac = 2e-4f;
+	opt->sdust_thres = 0; // no SDUST masking
+
+	opt->min_cnt = 3;
+	opt->min_chain_score = 40;
+	opt->bw = 500;
+	opt->max_gap = 5000;
+	opt->max_gap_ref = -1;
+	opt->max_chain_skip = 25;
+
+	opt->mask_level = 0.5f;
+	opt->pri_ratio = 0.8f;
+	opt->best_n = 5;
+
+	opt->max_join_long = 20000;
+	opt->max_join_short = 2000;
+	opt->min_join_flank_sc = 1000;
+
+	opt->a = 2, opt->b = 4, opt->q = 4, opt->e = 2, opt->q2 = 24, opt->e2 = 1;
+	opt->zdrop = 400, opt->zdrop_inv = 200;
+	opt->end_bonus = -1;
+	opt->min_dp_max = opt->min_chain_score * opt->a;
+	opt->min_ksw_len = 200;
+	opt->anchor_ext_len = 20, opt->anchor_ext_shift = 6;
+	opt->max_clip_ratio = 1.0f;
+	opt->mini_batch_size = 500000000;
+
+	opt->pe_ori = 0; // FF
+	opt->pe_bonus = 33;
+}
+
+void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
+{
+	if ((opt->flag & MM_F_SPLICE_FOR) && (opt->flag & MM_F_SPLICE_REV))
+		opt->flag |= MM_F_SPLICE;
+	if (opt->mid_occ <= 0)
+		opt->mid_occ = mm_idx_cal_max_occ(mi, opt->mid_occ_frac);
+	if (mm_verbose >= 3)
+		fprintf(stderr, "[M::%s::%.3f*%.2f] mid_occ = %d\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), opt->mid_occ);
+}
+
+void mm_mapopt_max_intron_len(mm_mapopt_t *opt, int max_intron_len)
+{
+	if ((opt->flag & MM_F_SPLICE) && max_intron_len > 0)
+		opt->max_gap_ref = opt->bw = max_intron_len;
+}
+
+int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
+{
+	if (preset == 0) {
+		mm_idxopt_init(io);
+		mm_mapopt_init(mo);
+	} else if (strcmp(preset, "ava-ont") == 0) {
+		io->flag = 0, io->k = 15, io->w = 5;
+		mo->flag |= MM_F_ALL_CHAINS | MM_F_NO_DIAG | MM_F_NO_DUAL | MM_F_NO_LJOIN;
+		mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_gap = 10000, mo->max_chain_skip = 25;
+	} else if (strcmp(preset, "ava-pb") == 0) {
+		io->flag |= MM_I_HPC, io->k = 19, io->w = 5;
+		mo->flag |= MM_F_ALL_CHAINS | MM_F_NO_DIAG | MM_F_NO_DUAL | MM_F_NO_LJOIN;
+		mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_gap = 10000, mo->max_chain_skip = 25;
+	} else if (strcmp(preset, "map10k") == 0 || strcmp(preset, "map-pb") == 0) {
+		io->flag |= MM_I_HPC, io->k = 19;
+	} else if (strcmp(preset, "map-ont") == 0) {
+		io->flag = 0, io->k = 15;
+	} else if (strcmp(preset, "asm5") == 0) {
+		io->flag = 0, io->k = 19, io->w = 19;
+		mo->a = 1, mo->b = 19, mo->q = 39, mo->q2 = 81, mo->e = 3, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
+		mo->min_dp_max = 200;
+		mo->best_n = 50;
+	} else if (strcmp(preset, "asm10") == 0) {
+		io->flag = 0, io->k = 19, io->w = 19;
+		mo->a = 1, mo->b = 9, mo->q = 16, mo->q2 = 41, mo->e = 2, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
+		mo->min_dp_max = 200;
+		mo->best_n = 50;
+	} else if (strcmp(preset, "short") == 0 || strcmp(preset, "sr") == 0) {
+		io->flag = 0, io->k = 21, io->w = 11;
+		mo->flag |= MM_F_SR | MM_F_FRAG_MODE | MM_F_NO_PRINT_2ND | MM_F_2_IO_THREADS | MM_F_HEAP_SORT;
+		mo->pe_ori = 0<<1|1; // FR
+		mo->a = 2, mo->b = 8, mo->q = 12, mo->e = 2, mo->q2 = 24, mo->e2 = 1;
+		mo->zdrop = mo->zdrop_inv = 100;
+		mo->end_bonus = 10;
+		mo->max_frag_len = 800;
+		mo->max_gap = 100;
+		mo->bw = 100;
+		mo->pri_ratio = 0.5f;
+		mo->min_cnt = 2;
+		mo->min_chain_score = 25;
+		mo->min_dp_max = 40;
+		mo->best_n = 20;
+		mo->mid_occ = 1000;
+		mo->max_occ = 5000;
+		mo->mini_batch_size = 50000000;
+	} else if (strcmp(preset, "splice") == 0 || strcmp(preset, "cdna") == 0) {
+		io->flag = 0, io->k = 15, io->w = 5;
+		mo->flag |= MM_F_SPLICE | MM_F_SPLICE_FOR | MM_F_SPLICE_REV | MM_F_SPLICE_FLANK;
+		mo->max_gap = 2000, mo->max_gap_ref = mo->bw = 200000;
+		mo->a = 1, mo->b = 2, mo->q = 2, mo->e = 1, mo->q2 = 32, mo->e2 = 0;
+		mo->noncan = 9;
+		mo->zdrop = 200, mo->zdrop_inv = 100; // because mo->a is halved
+	} else return -1;
+	return 0;
+}
+
+int mm_check_opt(const mm_idxopt_t *io, const mm_mapopt_t *mo)
+{
+	if (mo->best_n < 0) {
+		if (mm_verbose >= 1)
+			fprintf(stderr, "[ERROR]\033[1;31m -N must be no less than 0\033[0m\n");
+		return -4;
+	}
+	if (mo->best_n == 0 && mm_verbose >= 2)
+		fprintf(stderr, "[WARNING]\033[1;31m '-N 0' reduces mapping accuracy. Please use '--secondary=no' instead.\033[0m\n");
+	if (mo->pri_ratio < 0.0f || mo->pri_ratio > 1.0f) {
+		if (mm_verbose >= 1)
+			fprintf(stderr, "[ERROR]\033[1;31m -p must be within 0 and 1 (including 0 and 1)\033[0m\n");
+		return -4;
+	}
+	if ((mo->flag & MM_F_FOR_ONLY) && (mo->flag & MM_F_REV_ONLY)) {
+		if (mm_verbose >= 1)
+			fprintf(stderr, "[ERROR]\033[1;31m --for-only and --rev-only can't be applied at the same time\033[0m\n");
+		return -3;
+	}
+	if ((mo->q != mo->q2 || mo->e != mo->e2) && !(mo->e > mo->e2 && mo->q + mo->e < mo->q2 + mo->e2)) {
+		if (mm_verbose >= 1)
+			fprintf(stderr, "[ERROR]\033[1;31m dual gap penalties violating E1>E2 and O1+E1<O2+E2\033[0m\n");
+		return -2;
+	}
+	if ((mo->q + mo->e) + (mo->q2 + mo->e2) > 127) {
+		if (mm_verbose >= 1)
+			fprintf(stderr, "[ERROR]\033[1;31m scoring system violating ({-O}+{-E})+({-O2}+{-E2}) <= 127\033[0m\n");
+		return -1;
+	}
+	if (mo->zdrop < mo->zdrop_inv) {
+		if (mm_verbose >= 1)
+			fprintf(stderr, "[ERROR]\033[1;31m Z-drop should not be less than inversion-Z-drop\033[0m\n");
+		return -5;
+	}
+	return 0;
+}

pe.c

@@ -159,8 +159,8 @@ void mm_pair(void *km, int max_gap_ref, int pe_bonus, int sub_diff, int match_sc
 			mapq_pe_alt = (int)(6.02f * ((max>>32) - (sc.a[sc.n - 2]>>32)) / match_sc - 4.343f * logf(n_sub)); // n_sub > 0 because it counts the optimal, too
 			mapq_pe = mapq_pe < mapq_pe_alt? mapq_pe : mapq_pe_alt;
 		}
-		if (r[0]->mapq < mapq_pe) r[0]->mapq = (r[0]->mapq + mapq_pe) / 2;
+		if (r[0]->mapq < mapq_pe) r[0]->mapq = (int)(.2f * r[0]->mapq + .8f * mapq_pe + .499f);
-		if (r[1]->mapq < mapq_pe) r[1]->mapq = (r[1]->mapq + mapq_pe) / 2;
+		if (r[1]->mapq < mapq_pe) r[1]->mapq = (int)(.2f * r[1]->mapq + .8f * mapq_pe + .499f);
 		if (sc.n == 1) {
 			if (r[0]->mapq < 2) r[0]->mapq = 2;
 			if (r[1]->mapq < 2) r[1]->mapq = 2;

python/README.rst

@@ -34,6 +34,8 @@ The following Python script demonstrates the key functionality of mappy:
 	import mappy as mp
 	a = mp.Aligner("test/MT-human.fa")  # load or build index
 	if not a: raise Exception("ERROR: failed to load/build index")
+	s = a.seq("MT_human", 100, 200)     # retrieve a subsequence from the index
+	print(mp.revcomp(s))                # reverse complement
 	for name, seq, qual in mp.fastx_read("test/MT-orang.fa"): # read a fasta/q sequence
 		for hit in a.map(seq): # traverse alignments
 			print("{}\t{}\t{}\t{}".format(hit.ctg, hit.r_st, hit.r_en, hit.cigar_str))
@@ -81,10 +83,21 @@ This constructor accepts the following arguments:
 
 .. code:: python
 
-	mappy.Aligner.map(seq)
+	mappy.Aligner.map(seq, seq2=None)
 
 This method aligns :code:`seq` against the index. It is a generator, *yielding*
-a series of :code:`mappy.Alignment` objects.
+a series of :code:`mappy.Alignment` objects. If :code:`seq2` is present, mappy
+performs paired-end alignment, assuming the two ends are in the FR orientation.
+Alignments of the two ends can be distinguished by the :code:`read_num` field
+(see Class mappy.Alignment below).
+
+.. code:: python
+
+	mappy.Aligner.seq(name, start=0, end=0x7fffffff)
+
+This method retrieves a (sub)sequence from the index and returns it as a Python
+string. :code:`None` is returned if :code:`name` is not present in the index or
+the start/end coordinates are invalid.
 
 Class mappy.Alignment
 ~~~~~~~~~~~~~~~~~~~~~
@@ -118,6 +131,9 @@ properties:
 * **is_primary**: if the alignment is primary (typically the best and the first
   to generate)
 
+* **read_num**: read number that the alignment corresponds to; 1 for the first
+  read and 2 for the second read
+
 * **cigar_str**: CIGAR string
 
 * **cigar**: CIGAR returned as an array of shape :code:`(n_cigar,2)`. The two
@@ -133,13 +149,22 @@ the following format:
 It is effectively the PAF format without the QueryName and QueryLength columns
 (the first two columns in PAF).
 
-Function mappy.fastx_read
+Miscellaneous Functions
-~~~~~~~~~~~~~~~~~~~~~~~~~
+~~~~~~~~~~~~~~~~~~~~~~~
 
 .. code:: python
 
-	mappy.fastx_read(fn)
+	mappy.fastx_read(fn, read_comment=False)
 
 This generator function opens a FASTA/FASTQ file and *yields* a
 :code:`(name,seq,qual)` tuple for each sequence entry. The input file may be
-optionally gzip'd.
+optionally gzip'd. If :code:`read_comment` is True, this generator yields
+a :code:`(name,seq,qual,comment)` tuple instead.
+
+.. code:: python
+
+	mappy.revcomp(seq)
+
+Return the reverse complement of DNA string :code:`seq`. This function
+recognizes IUB code and preserves the letter cases. Uracil :code:`U` is
+complemented to :code:`A`.

python/cmappy.h

@@ -15,6 +15,7 @@ typedef struct {
 	int32_t blen, mlen, NM, ctg_len;
 	uint8_t mapq, is_primary;
 	int8_t strand, trans_strand;
+	int32_t seg_id;
 	int32_t n_cigar32;
 	uint32_t *cigar32;
 } mm_hitpy_t;
@@ -32,6 +33,7 @@ static inline void mm_reg2hitpy(const mm_idx_t *mi, mm_reg1_t *r, mm_hitpy_t *h)
 	h->NM = r->blen - r->mlen + r->p->n_ambi;
 	h->trans_strand = r->p->trans_strand == 1? 1 : r->p->trans_strand == 2? -1 : 0;
 	h->is_primary = (r->id == r->parent);
+	h->seg_id = r->seg_id;
 	h->n_cigar32 = r->p->n_cigar;
 	h->cigar32 = r->p->cigar;
 }
@@ -68,4 +70,64 @@ static inline void mm_reset_timer(void)
 	mm_realtime0 = realtime();
 }
 
+extern unsigned char seq_comp_table[256];
+static inline mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char *seq1, const char *seq2, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt)
+{
+	if (seq2 == 0) {
+		return mm_map(mi, strlen(seq1), seq1, n_regs, b, opt, NULL);
+	} else {
+		int _n_regs[2];
+		mm_reg1_t *regs[2];
+		char *seq[2];
+		int i, len[2];
+		len[0] = strlen(seq1);
+		len[1] = strlen(seq2);
+		seq[0] = (char*)seq1;
+		seq[1] = strdup(seq2);
+		for (i = 0; i < len[1]>>1; ++i) {
+			int t = seq[1][len[1] - i - 1];
+			seq[1][len[1] - i - 1] = seq_comp_table[(uint8_t)seq[1][i]];
+			seq[1][i] = seq_comp_table[t];
+		}
+		if (len[1]&1) seq[1][len[1]>>1] = seq_comp_table[(uint8_t)seq[1][len[1]>>1]];
+		mm_map_frag(mi, 2, len, (const char**)seq, _n_regs, regs, b, opt, NULL);
+		for (i = 0; i < _n_regs[1]; ++i)
+			regs[1][i].rev = !regs[1][i].rev;
+		*n_regs = _n_regs[0] + _n_regs[1];
+		regs[0] = (mm_reg1_t*)realloc(regs[0], sizeof(mm_reg1_t) * (*n_regs));
+		memcpy(&regs[0][_n_regs[0]], regs[1], _n_regs[1] * sizeof(mm_reg1_t));
+		free(regs[1]);
+		return regs[0];
+	}
+}
+
+static inline char *mappy_revcomp(int len, const uint8_t *seq)
+{
+	int i;
+	char *rev;
+	rev = (char*)malloc(len + 1);
+	for (i = 0; i < len; ++i)
+		rev[len - i - 1] = seq_comp_table[seq[i]];
+	rev[len] = 0;
+	return rev;
+}
+
+static char *mappy_fetch_seq(const mm_idx_t *mi, const char *name, int st, int en, int *len)
+{
+	int i, rid;
+	char *s;
+	*len = 0;
+	rid = mm_idx_name2id(mi, name);
+	if (rid < 0) return 0;
+	if (st >= mi->seq[i].len || st >= en) return 0;
+	if (en < 0 || en > mi->seq[i].len)
+		en = mi->seq[i].len;
+	s = (char*)malloc(en - st + 1);
+	*len = mm_idx_getseq(mi, rid, st, en, s);
+	for (i = 0; i < *len; ++i)
+		s[i] = "ACGTN"[(uint8_t)s[i]];
+	s[*len] = 0;
+	return s;
+}
+
 #endif

python/cmappy.pxd

@@ -5,7 +5,7 @@ cdef extern from "minimap.h":
 	# Options
 	#
 	ctypedef struct mm_idxopt_t:
-		short k, w, is_hpc, bucket_bits
+		short k, w, flag, bucket_bits
 		int mini_batch_size
 		uint64_t batch_size
 
@@ -22,15 +22,16 @@ cdef extern from "minimap.h":
 		float mask_level
 		float pri_ratio
 		int best_n
-		float min_iden
 		int max_join_long, max_join_short
 		int min_join_flank_sc
 		int a, b, q, e, q2, e2
 		int noncan
-		int zdrop
+		int zdrop, zdrop_inv
 		int end_bonus
 		int min_dp_max
 		int min_ksw_len
+		int anchor_ext_len, anchor_ext_shift
+		float max_clip_ratio
 		int pe_ori, pe_bonus
 		float mid_occ_frac
 		int32_t mid_occ
@@ -52,12 +53,12 @@ cdef extern from "minimap.h":
 		pass
 
 	ctypedef struct mm_idx_t:
-		int32_t b, w, k, is_hpc
+		int32_t b, w, k, flag
 		uint32_t n_seq
 		mm_idx_seq_t *seq
 		uint32_t *S
 		mm_idx_bucket_t *B
-		void *km
+		void *km, *h
 
 	ctypedef struct mm_idx_reader_t:
 		pass
@@ -68,6 +69,8 @@ cdef extern from "minimap.h":
 	void mm_idx_destroy(mm_idx_t *mi)
 	void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
 
+	int mm_idx_index_name(mm_idx_t *mi)
+
 	#
 	# Mapping (key struct defined in cmappy.h below)
 	#
@@ -79,7 +82,6 @@ cdef extern from "minimap.h":
 
 	mm_tbuf_t *mm_tbuf_init()
 	void mm_tbuf_destroy(mm_tbuf_t *b)
-	mm_reg1_t *mm_map(const mm_idx_t *mi, int l_seq, const char *seq, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *name)
 
 #
 # Helper header (because it is hard to expose mm_reg1_t with Cython)
@@ -92,11 +94,14 @@ cdef extern from "cmappy.h":
 		int32_t blen, mlen, NM, ctg_len
 		uint8_t mapq, is_primary
 		int8_t strand, trans_strand
+		int32_t seg_id
 		int32_t n_cigar32
 		uint32_t *cigar32
 
 	void mm_reg2hitpy(const mm_idx_t *mi, mm_reg1_t *r, mm_hitpy_t *h)
 	void mm_free_reg1(mm_reg1_t *r)
+	mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char *seq1, const char *seq2, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt)
+	char *mappy_fetch_seq(const mm_idx_t *mi, const char *name, int st, int en, int *l)
 
 	ctypedef struct kstring_t:
 		unsigned l, m
@@ -114,5 +119,6 @@ cdef extern from "cmappy.h":
 	void mm_fastx_close(kseq_t *ks)
 	int kseq_read(kseq_t *seq)
 
+	char *mappy_revcomp(int l, const uint8_t *seq)
 	int mm_verbose_level(int v)
 	void mm_reset_timer()

python/mappy.pyx

@@ -1,6 +1,7 @@
 from libc.stdint cimport uint8_t, int8_t
 from libc.stdlib cimport free
 cimport cmappy
+import sys
 
 cmappy.mm_reset_timer()
 
@@ -10,16 +11,19 @@ cdef class Alignment:
 	cdef int _NM, _mlen, _blen
 	cdef int8_t _strand, _trans_strand
 	cdef uint8_t _mapq, _is_primary
+	cdef int _seg_id
 	cdef _ctg, _cigar # these are python objects
 
-	def __cinit__(self, ctg, cl, cs, ce, strand, qs, qe, mapq, cigar, is_primary, mlen, blen, NM, trans_strand):
+	def __cinit__(self, ctg, cl, cs, ce, strand, qs, qe, mapq, cigar, is_primary, mlen, blen, NM, trans_strand, seg_id):
-		self._ctg, self._ctg_len, self._r_st, self._r_en = str(ctg), cl, cs, ce
+		self._ctg = ctg if isinstance(ctg, str) else ctg.decode()
+		self._ctg_len, self._r_st, self._r_en = cl, cs, ce
 		self._strand, self._q_st, self._q_en = strand, qs, qe
 		self._NM, self._mlen, self._blen = NM, mlen, blen
 		self._mapq = mapq
 		self._cigar = cigar
 		self._is_primary = is_primary
 		self._trans_strand = trans_strand
+		self._seg_id = seg_id
 
 	@property
 	def ctg(self): return self._ctg
@@ -34,7 +38,7 @@ cdef class Alignment:
 	def r_en(self): return self._r_en
 
 	@property
-	def strand(self): return self.strand
+	def strand(self): return self._strand
 
 	@property
 	def trans_strand(self): return self._trans_strand
@@ -63,6 +67,9 @@ cdef class Alignment:
 	@property
 	def cigar(self): return self._cigar
 
+	@property
+	def read_num(self): return self._seg_id + 1
+
 	@property
 	def cigar_str(self):
 		return "".join(map(lambda x: str(x[0]) + 'MIDNSH'[x[1]], self._cigar))
@@ -105,7 +112,7 @@ cdef class Aligner:
 		if min_chain_score is not None: self.map_opt.min_chain_score = min_chain_score
 		if min_dp_score is not None: self.map_opt.min_dp_max = min_dp_score
 		if bw is not None: self.map_opt.bw = bw
-		if best_n is not None: self.best_n = best_n
+		if best_n is not None: self.map_opt.best_n = best_n
 
 		cdef cmappy.mm_idx_reader_t *r;
 		if fn_idx_out is None:
@@ -116,6 +123,7 @@ cdef class Aligner:
 			self._idx = cmappy.mm_idx_reader_read(r, n_threads) # NB: ONLY read the first part
 			cmappy.mm_idx_reader_close(r)
 			cmappy.mm_mapopt_update(&self.map_opt, self._idx)
+			cmappy.mm_idx_index_name(self._idx)
 
 	def __dealloc__(self):
 		if self._idx is not NULL:
@@ -124,7 +132,7 @@ cdef class Aligner:
 	def __bool__(self):
 		return (self._idx != NULL)
 
-	def map(self, seq, buf=None):
+	def map(self, seq, seq2=None, buf=None):
 		cdef cmappy.mm_reg1_t *regs
 		cdef cmappy.mm_hitpy_t h
 		cdef ThreadBuffer b
@@ -133,7 +141,13 @@ cdef class Aligner:
 		if self._idx is NULL: return None
 		if buf is None: b = ThreadBuffer()
 		else: b = buf
-		regs = cmappy.mm_map(self._idx, len(seq), str.encode(seq), &n_regs, b._b, &self.map_opt, NULL)
+
+		_seq = seq if isinstance(seq, bytes) else seq.encode()
+		if seq2 is None:
+			regs = cmappy.mm_map_aux(self._idx, _seq, NULL,  &n_regs, b._b, &self.map_opt)
+		else:
+			_seq2 = seq2 if isinstance(seq2, bytes) else seq2.encode()
+			regs = cmappy.mm_map_aux(self._idx, _seq, _seq2, &n_regs, b._b, &self.map_opt)
 
 		for i in range(n_regs):
 			cmappy.mm_reg2hitpy(self._idx, &regs[i], &h)
@@ -141,20 +155,52 @@ cdef class Aligner:
 			for k in range(h.n_cigar32):
 				c = h.cigar32[k]
 				cigar.append([c>>4, c&0xf])
-			yield Alignment(h.ctg, h.ctg_len, h.ctg_start, h.ctg_end, h.strand, h.qry_start, h.qry_end, h.mapq, cigar, h.is_primary, h.mlen, h.blen, h.NM, h.trans_strand)
+			yield Alignment(h.ctg, h.ctg_len, h.ctg_start, h.ctg_end, h.strand, h.qry_start, h.qry_end, h.mapq, cigar, h.is_primary, h.mlen, h.blen, h.NM, h.trans_strand, h.seg_id)
 			cmappy.mm_free_reg1(&regs[i])
 		free(regs)
 
-def fastx_read(fn):
+	def seq(self, str name, int start=0, int end=0x7fffffff):
+		cdef int l
+		cdef char *s = cmappy.mappy_fetch_seq(self._idx, name.encode(), start, end, &l)
+		if l == 0: return None
+		r = s[:l] if isinstance(s, str) else s[:l].decode()
+		free(s)
+		return r
+
+	@property
+	def k(self): return self._idx.k
+
+	@property
+	def w(self): return self._idx.w
+
+	@property
+	def n_seq(self): return self._idx.n_seq
+
+def fastx_read(fn, read_comment=False):
 	cdef cmappy.kseq_t *ks
 	ks = cmappy.mm_fastx_open(str.encode(fn))
 	if ks is NULL: return None
 	while cmappy.kseq_read(ks) >= 0:
-		if ks.qual.l > 0: qual = str(ks.qual.s)
+		if ks.qual.l > 0: qual = ks.qual.s if isinstance(ks.qual.s, str) else ks.qual.s.decode()
 		else: qual = None
-		yield str(ks.name.s), str(ks.seq.s), qual
+		name = ks.name.s if isinstance(ks.name.s, str) else ks.name.s.decode()
+		seq = ks.seq.s if isinstance(ks.seq.s, str) else ks.seq.s.decode()
+		if read_comment:
+			if ks.comment.l > 0: comment = ks.comment.s if isinstance(ks.comment.s, str) else ks.comment.s.decode()
+			else: comment = None
+			yield name, seq, qual, comment
+		else:
+			yield name, seq, qual
 	cmappy.mm_fastx_close(ks)
 
+def revcomp(seq):
+	l = len(seq)
+	bseq = seq if isinstance(seq, bytes) else seq.encode()
+	cdef char *s = cmappy.mappy_revcomp(l, bseq)
+	r = s[:l] if isinstance(s, str) else s[:l].decode()
+	free(s)
+	return r
+
 def verbose(v=None):
 	if v is None: v = -1
 	return cmappy.mm_verbose_level(v)

sdust.c

@@ -56,6 +56,7 @@ sdust_buf_t *sdust_buf_init(void *km)
 	buf = (sdust_buf_t*)kcalloc(km, 1, sizeof(sdust_buf_t));
 	buf->km = km;
 	buf->w = kdq_init(int, buf->km);
+	kdq_resize(int, buf->w, 8);
 	return buf;
 }
 

setup.py

@@ -23,7 +23,7 @@ def readme():
 
 setup(
 	name = 'mappy',
-	version = '2.3',
+	version = '2.9',
 	url = 'https://github.com/lh3/minimap2',
 	description = 'Minimap2 python binding',
 	long_description = readme(),
@@ -33,17 +33,17 @@ setup(
 	keywords = 'sequence-alignment',
 	scripts = ['python/minimap2.py'],
     ext_modules = [Extension('mappy',
-		sources = [module_src, 'align.c', 'bseq.c', 'chain.c', 'format.c', 'hit.c', 'index.c', 'pe.c',
+		sources = [module_src, 'align.c', 'bseq.c', 'chain.c', 'format.c', 'hit.c', 'index.c', 'pe.c', 'options.c',
 				   'ksw2_extd2_sse.c', 'ksw2_exts2_sse.c', 'ksw2_extz2_sse.c', 'ksw2_ll_sse.c',
-				   'kalloc.c', 'kthread.c', 'map.c', 'misc.c', 'sdust.c', 'sketch.c'],
+				   'kalloc.c', 'kthread.c', 'map.c', 'misc.c', 'sdust.c', 'sketch.c', 'esterr.c'],
 		depends = ['minimap.h', 'bseq.h', 'kalloc.h', 'kdq.h', 'khash.h', 'kseq.h', 'ksort.h',
 				   'ksw2.h', 'kthread.h', 'kvec.h', 'mmpriv.h', 'sdust.h',
 				   'python/cmappy.h', 'python/cmappy.pxd'],
-		extra_compile_args = ['-msse4'], # WARNING: ancient x86_64 CPUs don't have SSE4
+		extra_compile_args = ['-DHAVE_KALLOC', '-msse4'], # WARNING: ancient x86_64 CPUs don't have SSE4
 		include_dirs = ['.'],
 		libraries = ['z', 'm', 'pthread'])],
 	classifiers = [
-		'Development Status :: 4 - Beta',
+		'Development Status :: 5 - Production/Stable',
 		'License :: OSI Approved :: MIT License',
 		'Operating System :: POSIX',
 		'Programming Language :: C',

sketch.c

@@ -2,8 +2,9 @@
 #include <stdlib.h>
 #include <assert.h>
 #include <string.h>
+#define __STDC_LIMIT_MACROS
 #include "kvec.h"
-#include "minimap.h"
+#include "mmpriv.h"
 
 unsigned char seq_nt4_table[256] = {
 	0, 1, 2, 3,  4, 4, 4, 4,  4, 4, 4, 4,  4, 4, 4, 4,
@@ -101,34 +102,34 @@ void mm_sketch(void *km, const char *str, int len, int w, int k, uint32_t rid, i
 				tq_push(&tq, skip_len);
 				kmer_span += skip_len;
 				if (tq.count > k) kmer_span -= tq_shift(&tq);
-				if (kmer_span >= 256) continue; // make sure $kmer_span does not take more than 8 bits
 			} else kmer_span = l + 1 < k? l + 1 : k;
 			kmer[0] = (kmer[0] << 2 | c) & mask;           // forward k-mer
 			kmer[1] = (kmer[1] >> 2) | (3ULL^c) << shift1; // reverse k-mer
 			if (kmer[0] == kmer[1]) continue; // skip "symmetric k-mers" as we don't know it strand
 			z = kmer[0] < kmer[1]? 0 : 1; // strand
-			if (++l >= k) {
+			++l;
+			if (l >= k && kmer_span < 256) {
 				info.x = hash64(kmer[z], mask) << 8 | kmer_span;
 				info.y = (uint64_t)rid<<32 | (uint32_t)i<<1 | z;
 			}
 		} else l = 0, tq.count = tq.front = 0, kmer_span = 0;
 		buf[buf_pos] = info; // need to do this here as appropriate buf_pos and buf[buf_pos] are needed below
-		if (l == w + k - 1) { // special case for the first window - because identical k-mers are not stored yet
+		if (l == w + k - 1 && min.x != UINT64_MAX) { // special case for the first window - because identical k-mers are not stored yet
 			for (j = buf_pos + 1; j < w; ++j)
 				if (min.x == buf[j].x && buf[j].y != min.y) kv_push(mm128_t, km, *p, buf[j]);
 			for (j = 0; j < buf_pos; ++j)
 				if (min.x == buf[j].x && buf[j].y != min.y) kv_push(mm128_t, km, *p, buf[j]);
 		}
 		if (info.x <= min.x) { // a new minimum; then write the old min
-			if (l >= w + k) kv_push(mm128_t, km, *p, min);
+			if (l >= w + k && min.x != UINT64_MAX) kv_push(mm128_t, km, *p, min);
 			min = info, min_pos = buf_pos;
 		} else if (buf_pos == min_pos) { // old min has moved outside the window
-			if (l >= w + k - 1) kv_push(mm128_t, km, *p, min);
+			if (l >= w + k - 1 && min.x != UINT64_MAX) kv_push(mm128_t, km, *p, min);
 			for (j = buf_pos + 1, min.x = UINT64_MAX; j < w; ++j) // the two loops are necessary when there are identical k-mers
 				if (min.x >= buf[j].x) min = buf[j], min_pos = j; // >= is important s.t. min is always the closest k-mer
 			for (j = 0; j <= buf_pos; ++j)
 				if (min.x >= buf[j].x) min = buf[j], min_pos = j;
-			if (l >= w + k - 1) { // write identical k-mers
+			if (l >= w + k - 1 && min.x != UINT64_MAX) { // write identical k-mers
 				for (j = buf_pos + 1; j < w; ++j) // these two loops make sure the output is sorted
 					if (min.x == buf[j].x && min.y != buf[j].y) kv_push(mm128_t, km, *p, buf[j]);
 				for (j = 0; j <= buf_pos; ++j)

test/t-inv.fa

@@ -0,0 +1,127 @@
+>ref
+TGCGGAGGCTGAAGCAACTCCATCTTGGAAGCTAATCTACCATGTTGGCTTCTGATTAAC
+ATCAGTTCTGGGAAGGCTTGTAAGATTTCCTGTTTGTCTATTATTTCCTAGGTAAGAGCA
+GATACTTACTGTAAATCCTGCCCCTAGATTAAACAACCTTGGTGTTATCGTACTTCCATT
+GTCCTATACATCCCTTCGGAATCCCCCTTTCCCTATGGTCCTCAAGCCCTTGGTCTGGGG
+AGTAACAGCATAGGGATCAACCATCTCGTCTTGCCACTGCCCGAAATACAGACATGGCTT
+CTGTTCCTAAGTCCCTATTCAACTTTTCTTTCTAAGAAACTGGATTTGTCAGCCTCTTTC
+TTCACCTCTCAGCTTCCTTGGACTTTGGGGGTAGGTTTGCGTAGACATGCTCACCACAGA
+CACAATATCAGCTTCATTCTACAGATGAGGAAGGCAAGCCTTGGGGAGCTTAACCAACTT
+GTCGAGACTCATGTATATACCAACACTGAAAAGCAGATATTCCAGACTCCCAGTCATGCC
+ACAGGCACACCCCTCAGTGAGAGGTGGGGTTTGTAGTTGAGGCTATTTCCTGCCCAGGGA
+GCAGGGAGGCACTCTAGCTTCCCTGAGCTAACGTGGTTCTGCTTGTGTCTGACTTCCAGG
+TCTCTGCCCTTTCCAAGCTCACTAGGATGGGCTTCGGGTGTGTCAAATGCCTCAGACAGT
+ACAGATCCACACAGAATGGGCATATGCAACCAATCAGTGTCATAAAAAAGAAGGAAATGA
+CTCGGGCCCCCTGTGTGTTCAACATGTCGAAGGTATCTGTGCAGCAGAAGAAAGAGGGGC
+AAAAGCCCCCAGTGCCACAGGCCAGAGGCAGCAGCTTGGGCCCATGTGGGAGGGTTTGCT
+TTCCCCTGCCAAAGTGATGGGCTGCTGCAGCCTGGGGCTTGTGGGAATCCTTCCTGGGCC
+TGTGTGGGAAGTGTAGGCAGGGAGAGTGCTGCTTTCCCAAGCTCATCCCAGCTACAGCTA
+CCTTTGTGCTCTGGGATTCAGGACCCCCGAGGGGGCTGGCAGGAGAGTCTCTGTTCTCGG
+ATGGGTTGTCACCAGGGCATACATGGGAAGTGGGCTCTCTGGAGTCACCCTCCAGGGGAC
+AATGCCAATTCCAGACACATTTACTGGAACCCCTACACTGATGACCTTTTGTTGAGGGTT
+GAATTATGTCCCCAAAAAAGATACATTGAAGTCCAAACCTCTGGTGTCTATAAATGTGAT
+TTTATTTGAAAATGAGGTTTCTATGGACTAAATTGTGTCCCTCCCAAATTCATATTTTGA
+AGCCCTAGCCCCCAGTGTGACTATACCTAGAGACAGAGATCTTTAGGAGGTAATTAAGGT
+TCAATGAGGTCAGGTGGGTGGGGCCCTAAACCAACAGGAAGGACTGTGGCCTTACTAGAA
+AAGGAAGAAAAAGCATTTCCTCTCTTCTAGTATAAAAGGACACAGAAAGAAGGCAGATAT
+CTACAAGCCACGAAGAGAGACGTCACTGAGAACTGAATTTGTGTACATTGATCTGGAACT
+TCCAGCCTCCAGAACTTGAGAAATACATTTCTGTTGTTTATTTTTTTTTCATGTAATCAA
+TTCATTTATCATATATTTATTGAGTGCCTACTATGTGCCAGAGGATACAGCAGTAACAAA
+ACTAGGCAAAAATTGTGCCTAAAAGAGGGAAGATGACTTTTCTTAAAGTGTGGAATAAAG
+AAAAGTAAGATAGCGGATAGAAGCTTGAAGTGAAAGCAGGTTCACAGGAAGTTTCTTTGG
+TCATTTGTTTTGTTTTTAAATAGTGGAAAGATGTATATGTTTATGGAGAAAGATTGCCTT
+GAAGATGCAAGAGGAAGAGATGATCAAAATTCAAGAAGAAGCAGAAAGTGATAGAATAAA
+GAGCACAAGTGGAGAATTAGTGTTAATGAAAAGAAGGATGCTTCCTTTGATATGAAGTGA
+AGGAAGAGAGAATGAGTAAAGACCAAGACTTGAAGTCCCTAGTTTAATAGAGGGAGATTT
+CTTCTTTTGATAGCAACAATGGTATTCTGAATTATTTGAAGACATGTCATATTTCTCTTG
+TGCCATTTTCCTCCCAGTTTAAACATTCTCATAACCTCTATTCCTCACATGATGTTTTTC
+CAGGTCCTTTATTCTTTGGCACTCTCTTCTCTGGACACATTGTATTCTGTCATTGGTCCT
+AAAATTTAGATACCCACAATTGAACATACTCCTCTAGATATGGTCTAGCTAATGCAAAAG
+AACTGCTGCCTTCCAACTTGTTCAGACATCATATGTTTGTTGTCAAACGCTAAGTTGAGT
+TGTTATCTTTTAAGTTTTGTTTTTGTTTTTTTTTTTTTTTTTTAATTCCAAGAGGTGCCC
+ACGTTGGCTAAGTACCAAACAGGGTACTAGGGAATTTTACTTCTGAGTTAAATGCCATTC
+TAGTTGTTTTTTCTTCATCTCCAGTAAGGTTATCTTTATTCACCAGTTGTTACAATAGCT
+GTGGGTCTTGCTTCTCACAGTTTTATGCTGTCTGTGCTATTTTCTCTACTGATCATCACC
+ACAATCATTATTGCTTATCATAATTGTTATCTTTATTTTCTCCTTTAATCAAGAATCAGT
+CTTCCTTTATCTCATTATTCTCTTTTGCAGGCTTCAGGATAATTATGGTTGGAGTGCACT
+GGGGGAACCAGTGCAGCTAAGCTCTGACATCTTTGCATCCCTTTTCCATCTGCTGTTTTG
+GCACTCTGGTAGAATAGATAACCTAAAAACGACTTTAAAACATCTAGAAATTTTGGATAA
+AATATAACAAACATCCCTTTAAATGCACAACTGATCTTCCATGGAAGTCACAGAAATATA
+TAACGCCAAAAAGAAGGGAAGCTGAAACCCAGGGCTGTAAACATGAACATCATCTTCTCT
+CCCTTTTTCTTGTGACTTATCTTGTTTTTCTCAGCTTTGGTGCTACCAAGGCTTGACTTT
+AATAGGCATTTCCAATCAATGAGAGAATTTCTTTTGCTTTCATCAACAATTCAGTTATTG
+ATGTTAACATATATATCATTTGAGTACTTTTCTTTTTTTTATTATTATTATACTTTAAGT
+TTTAGGGTCCATGTGCACAATGTGCAGGTTAGTTACGTATGTATACATGTGCCATGCTGG
+TGTGCTGCACCCATTAACTCATCATTTAGCATTAGGTATATCTCCTAATGCTATCCCTTC
+CCCCTCTCCCCACCCCACAACAGTCCCCAGAGTGTTCCCCTTCCTGTGTCCATGTGTTCT
+CATTGTTCAATCCCCATCTATGAGTGAGAACATGCGGTGTTTGGTTTTTTGTCCTTGCAA
+TAGTTTACTGAGAATGATGATTTCTAATTTCATCCATGTCCCTAAAGAGCTTCTGCACAG
+CAAAAGAAACTACCATCAGAGTGAACAGGCAACCTACAAAATGGGAGAAAATTTTCACAA
+CCTGCTCATCTGACAAAGGGCTAATATCCAGAATCTACAATGAACTCAAACAAATTTACA
+AGAAAAAAACAAACAACCCCATCAAAAAGTGGGCAAAGGATATGAACAGACACTTCTCAA
+AAGAAGACATTTATGCAGCCAAAAGACACATGAAAAAATGCTCATCATCACTGGCCATCA
+GAGAAATGCAAACCAAAACCACAATGAGATACCATCTCACACCAGTTAAAATGGCAATCA
+TTAAAAAGTCAGGAAACAACAGGTGCTGGAGAGGATGTGGAGAAACAGGAACACTTTTAC
+ACTGTTGGTGGGACTGTAAACTAGTTCAACCATTGTGGAAGTCAGTGTGCTGATTCCTCA
+GGGATCTAGAACTAGAAATACCATTTGACCCAGCCATCCCATTACTGGGTATATACCCAA
+AGGACTATAAATCATGCTGCTATAAAGACACATGCACACGTATGTTTATTGCGGCACTAT
+TCACAATAGCAAAGACTTGGAACCAACCCAAATGTCCAACAATGATAGACTGGATTAAGA
+AAATGTGGCACATATACACCACGGAATACTGTGCAGCCATAAAAAATGATGAGTTCATGT
+CCTTTGTAGGGACACGGATGAAATTGGAAATCATTTCTGTTGTTTAAACCACGAAGTCTA
+TGGTATCTGGTTATGACAACCTGAGAATACTAACTCAAGGGTCTTTCGCAGATGTCATTA
+AGTTGTTAAAGTGAGGTCATTATGGTGGGTCCTAATCCAAGAGAAGAGATGCATGGACAG
+ACGTGCACAACGGGAGGACCAAGCCAAGACACACAGGGAGAATGGCCATGGGAAGATGGA
+GGCAGAGATCAAAGTGAGGCACCCACAAGCCAAGAAATGGCAGGAGCTACCAGCAGCTGG
+AAGATGCAGAGAAGCATTCCTTCTTAGAGGTTTCAGAGAGAGTATGGTGCTACTGACACC
+TTGATTTTGAACTTCTAGTCTCCAGAACTATGAGAGAATAAATTTCTGTTGGTTAAGCCA
+TCGAGTTTGTGTAAGTTTGTTATAAGAGCCCTAGGAAATAAACATATCCATTTATTCAGG
+AAAGCCTGCTAGAGTGCAAATATTTGGAAAAGATACTACTATGCAAATGTTTGAAAAAGA
+TATTGCTCTTGATTCTGCCTTATGGGTTTTTCATTTCTGTAAGCTATTCTCAAAGTTTTG
+TTCTTGGACTACTATTGGTAATTAAGACTGCAACATGTTTGGCAACATCAGTTGAGAACT
+GTTGCTCTGGGAACGTTTTCGGCAAGCCTCAGCCCTTCTTTTCCCTTGGCTTGCATTGAG
+GAGTTAGGTGATACTCTGCTGCTCAGGCCCAGCACCTTTATGGACCGTATTCCCCTGGTG
+GAATGACCATCTCTGCTTGCTCTGATTGGCTGTTGGGGTTTTCTAGCATGCCCTATTTAA
+TATGTATGATTTATCTCTTACTTCAGTTGGAAGGTACAGTTGCTCTGTAGTTGGCATGCA
+GTCATGGTGACTATGAAAATATAAAATAATGTTTTGGTTTACAGACACTTAGAAATAAGT
+TGTGTCTCAAAATTGGGTGACTATTCTAGTTATCTGCTACTCAATATCCTTGTGCGAGCC
+CTCTTTACCCAGAATCAAACTAAACCATGAGGGGCACTATAGAATGTCACCCCTGGGTCC
+AGGATACTATGGGGACTCAGAAGCCAAGCTCCCACTGGGGGATCTAGGGCATGCCCCCAA
+GGTAAGATTCCCACCTCTTTGTTCAGCAGGAAGCACCCATCACACAAGGAGGTAGGAATA
+AACAAGCATTCGTCAAGAACAAAAGATACAGATGTTCTGCTGGAGCTTGGATACATAGCA
+TAAGAGGGAACAGTTCTCACAGGTAAGAGTAAGTTTTCCTCTGGTGGTGACAGTGGGACC
+TGTGGGGGAGAGAATTGGGAGTACTGACAGGAAGGCAGAGTGGCTGTCCAAATGAACGGA
+TTGTTTGCACATGGCCTTTAGGGCACGTTGTGTTAGCCTTCCATTGCTGCTTATATTAGT
+CTGTTTTCACACTGCCCATAAATGCATACCTGAGACTGGATAATTTATAAAGAAAAAGAG
+CCTTAATGTACTCATAGTTGCATGTGGCTGGGGAGGCCTCACAATCATGGCAGAAGGTGA
+AAGGCACATCTTACATGGAAGCAGACAAGAGAGAATTGAGGACCAAGTGAAAGGGGTTTC
+CCCTTATAAAACCATCAGATCACATGAGACTTTTTCACCACCATGAGAACAGTAAGGGGA
+AAACTATGCTCATGATTCAATTGTCTCCCACTGGATTCCTCCCACAACACATAGGAATTA
+TGGGAGCTAAAATTCAAGATGAGATTTGGGTGAGGACACAGCCAAACCCTATCACTGCTG
+TAATCAATTCCCACCAACTTAGTGGCTCGAAACATCACAGATTTATGATCTTATGACGGT
+GGAGGTCCCCAAATGGATCTTCTAGGTCTAGAATCAAGGTATCAGCAGACCACTTCTTTT
+GGAGGCTCTGGTGGAGAAACCATTTCCTCGCCTTTTCCAGCTTCTAGAGGCTGCCCTTCT
+CATTCCTTGGTTCACGGCCACACTCATTTCCATCTCTGCTTCCACTGTGACAACTTCTCT
+GCCTCAGACCCTCCTGCTTTGCCTTTGTAAGGACCCTTGTGATGAGATCAGGCCCATCCA
+GGATTATCCCTCATCTCAAGACCTTTACCTTAATCACATTTGCAAGGTCTCTTCCACTGT
+GTCAGGTAACATTTTCACAGGTTCCAGGGATTAGGGTGTGGACATCTTGGGGAGCTGGAG
+GATATTATTTCATCTACCACACACATCTCTACCTTGTACAGGCAAGCACTTGCAAAGTGC
+AATGTGATCCTCTGGAGCCACTGTCCTCCCAGAGCTTATATATACTCTGAAAGTCAACTC
+TCAGACCACAGCCTCCTGTCCATGCACCACTCTCATCAACACCCCCACCCGAAACACTTT
+CACTCCACCCTCTTTGTCCCCTAACTCATGGAGAAGAAAATCTAATTAGTAGGAGTGGAA
+TTTGGCTTTCATCTTTACCAGTACTAGAAATATGGTGTGTGTCTTTTTGTAAAAATTCTC
+TCAACTAAATTGTTTTTATTAATTTCTGCAAAATGTGAACATCAACTCCCTTCATGTGAA
+TGTCAATAAGATTAAATGAGCTGTCTCAGCTCCTAGCCTGTGCAAGCTAACAGCTCAGGA
+GATGTTTATTTCTTTCCCTCTTCTTTCCTTAATGAAGCCCTCTCCTTTGACATCTTCAAT
+TCTGGAGCGCTTCTTTTCTGAGGCCTTGGCTCCCCCACATTGCCCACCCTTTTCCTGCTC
+GTCCACATTTCTGGCTTCTATTCTCTTGTCTTTACCATCTCCCTGAACAATGTTATCCGT
+TCCAATGACTTCAACAGTCTCTCCGCTTACATATGATGCCTCTCAAACTCTGATCTCCAA
+CTCTTCCAAAGAGCTCTGGACCTTTGTTCCAATTACCTGAAAAACATCTTCTTGGATGTC
+CCATTAGCACTGTTAAATCAAACAAGAATTTCCCTCCCTCCTGCCTTGCTGTAGTTCCCC
+TAGGGATTCGGTTGTGTGGGAAGATGTGTGGAGAGCTCTTAGTTGACTCCCTTCTCTGCA
+GTTCTACCTCTCTAGAGACTTGGAGGACCCACTGTTTCCGCCTCGCTTTTTCAGGCCTAG
+AGATTGCTCGCTCCTGGGCTGGCTGCTTCATAATTCCTTATTAGTAGTTTCCCAAGCTTA
+CATATCTGTAAATATTTACTTTAGTTAAATTCTCCCCAATTTCCACAATATGTTGGCTGC
+ACATGCTTTCTACTAGGAGTCACACAACTATGATAAGAACCAAGAAATATTAGTAAACGT
+TTTTTACCATTATTGGCCTATACCCTGGAATAGCCAACAATAACCTAGAACCTATGCAAC
+AAGAATATCCAACAAGAACCTAGAGACCTGTCAGTCTATAGGTGGGAACTACAGGATGAG
+A

tex/minimap2.bib

@@ -268,16 +268,72 @@
 	Title = {Mason -- a read simulator for second generation sequencing data},
 	Year = {2010}}
 
-@article{Langmead:2012fk,
-	Author = {Langmead, Ben and Salzberg, Steven L},
-	Journal = {Nat Methods},
-	Pages = {357-9},
-	Title = {Fast gapped-read alignment with Bowtie 2},
-	Volume = {9},
-	Year = {2012}}
-
 @article{Zaharia:2011aa,
 	Author = {Zaharia, Matei and others},
 	Journal = {arXiv:1111:5572},
-	Title = {Faster and More Accurate Sequence Alignment with SNAP},
+	Title = {Faster and More Accurate Sequence Alignment with {SNAP}},
 	Year = {2011}}
+
+@article{Irimia:2008aa,
+	Author = {Irimia, Manuel and Roy, Scott William},
+	Journal = {PLoS Genet},
+	Pages = {e1000148},
+	Title = {Evolutionary convergence on highly-conserved 3' intron structures in intron-poor eukaryotes and insights into the ancestral eukaryotic genome},
+	Volume = {4},
+	Year = {2008}}
+
+@article{Depristo:2011vn,
+	Author = {Depristo, Mark A and others},
+	Journal = {Nat Genet},
+	Pages = {491-8},
+	Title = {A framework for variation discovery and genotyping using next-generation {DNA} sequencing data},
+	Volume = {43},
+	Year = {2011}}
+
+@article{Kurtz:2004zr,
+	Author = {Kurtz, Stefan and others},
+	Journal = {Genome Biol},
+	Pages = {R12},
+	Title = {Versatile and open software for comparing large genomes},
+	Volume = {5},
+	Year = {2004}}
+
+@article {Li223297,
+	author = {Li, Heng and others},
+	title = {New synthetic-diploid benchmark for accurate variant calling evaluation},
+	year = {2017},
+	note = {doi:10.1101/223297},
+	journal = {bioRxiv}
+}
+
+@article{Berlin:2015xy,
+	Author = {Berlin, Konstantin and others},
+	Journal = {Nat Biotechnol},
+	Pages = {623-30},
+	Title = {Assembling large genomes with single-molecule sequencing and locality-sensitive hashing},
+	Volume = {33},
+	Year = {2015}}
+
+@article{Gurevich:2013aa,
+	Author = {Gurevich, Alexey and others},
+	Journal = {Bioinformatics},
+	Pages = {1072-5},
+	Title = {{QUAST}: quality assessment tool for genome assemblies},
+	Volume = {29},
+	Year = {2013}}
+
+@article{Li:2010fk,
+	Author = {Li, Heng and Durbin, Richard},
+	Journal = {Bioinformatics},
+	Pages = {589-95},
+	Title = {Fast and accurate long-read alignment with {Burrows-Wheeler} transform},
+	Volume = {26},
+	Year = {2010}}
+
+@article{Marcais:2018aa,
+	Author = {Mar{\c c}ais, Guillaume and others},
+	Journal = {PLoS Comput Biol},
+	Pages = {e1005944},
+	Title = {{MUMmer4}: A fast and versatile genome alignment system},
+	Volume = {14},
+	Year = {2018}}

tex/minimap2.tex

@@ -1,6 +1,6 @@
 \documentclass{bioinfo}
-\copyrightyear{2017}
+\copyrightyear{2018}
-\pubyear{2017}
+\pubyear{2018}
 
 \usepackage{graphicx}
 \usepackage{hyperref}
@@ -13,7 +13,6 @@
 
 \usepackage{natbib}
 \bibliographystyle{apalike}
-\usepackage{hyperref}
 
 \DeclareMathOperator*{\argmax}{argmax}
 
@@ -31,19 +30,20 @@
 \section{Motivation:} Recent advances in sequencing technologies promise
 ultra-long reads of $\sim$100 kilo bases (kb) in average, full-length mRNA or
 cDNA reads in high throughput and genomic contigs over 100 mega bases (Mb) in
-length. Existing alignment tools are unable or inefficient to process such data
+length. Existing alignment programs are unable or inefficient to process such data
 at scale, which presses for the development of new alignment algorithms.
 
-\section{Results:} Minimap2 is a general-purpose aligner to map DNA or long
+\section{Results:} Minimap2 is a general-purpose alignment program to map DNA or long
 mRNA sequences against a large reference database. It works with accurate short
 reads of $\ge$100bp in length, $\ge$1kb genomic reads at error rate $\sim$15\%,
 full-length noisy Direct RNA or cDNA reads, and assembly contigs or closely
 related full chromosomes of hundreds of megabases in length. Minimap2 does
 split-read alignment, employs concave gap cost for long insertions and
 deletions (INDELs) and introduces new heuristics to reduce spurious alignments.
-It is 3--4 times faster than mainstream short-read mappers at comparable
+It is 3--4 times as fast as mainstream short-read mappers at comparable
-accuracy and $\ge$30 times faster at higher accuracy for both genomic and mRNA
+accuracy, and is $\ge$30 times faster than long-read genomic or cDNA
-reads, surpassing most aligners specialized in one type of alignment.
+mappers at higher accuracy, surpassing most aligners specialized in one type of
+alignment.
 
 \section{Availability and implementation:}
 \href{https://github.com/lh3/minimap2}{https://github.com/lh3/minimap2}
@@ -64,17 +64,24 @@ the thought that 10kb long sequences should be easier to map than 100bp reads
 because we can more effectively skip repetitive regions, which are often the
 bottleneck of short-read alignment. We confirmed our speculation by achieving
 approximate mapping 50 times faster than BWA-MEM~\citep{Li:2016aa}.
-\citet{Suzuki:2016} extended our work with a fast and novel algorithm on
+\citet{Suzuki130633} extended our work with a fast and novel algorithm on
 generating base-level alignment, which in turn inspired us to develop minimap2
-towards higher accuracy and more practical functionality.
+with added functionality.
 
 Both SMRT and ONT have been applied to the sequencing of spliced mRNAs (RNA-seq). While
 traditional mRNA aligners work~\citep{Wu:2005vn,Iwata:2012aa}, they are not
 optimized for long noisy sequence reads and are tens of times slower than
 dedicated long-read aligners. When developing minimap2 initially for aligning
-genomic DNA only, we realized minor modifications could make it competitive for
+genomic DNA only, we realized minor modifications could enable the base
-aligning mRNAs as well. Minimap2 is a first RNA-seq aligner specifically
+algorithm to map mRNAs as well. Minimap2 becomes a first RNA-seq aligner
-designed for long noisy reads.
+specifically designed for long noisy reads. We have also extended the original
+algorithm to map short reads at a speed faster than several mainstream
+short-read mappers.
+
+In this article, we will describe the minimap2 algorithm and its applications
+to different types of input sequences. We will evaluate the performance and
+accuracy of minimap2 on several simulated and real data sets and demonstrate
+the versatility of minimap2.
 
 \begin{methods}
 \section{Methods}
@@ -82,11 +89,11 @@ designed for long noisy reads.
 Minimap2 follows a typical seed-chain-align procedure as is used by most
 full-genome aligners. It collects minimizers~\citep{Roberts:2004fv} of the
 reference sequences and indexes them in a hash table. Then for each query
-sequence, minimap2 takes query minimizers as \emph{seeds}, finds matches to the
+sequence, minimap2 takes query minimizers as \emph{seeds}, finds exact matches
-reference, and identifies sets of colinear seeds, which are called
+(i.e. \emph{anchors}) to the reference, and identifies sets of colinear anchors as
 \emph{chains}. If base-level alignment is requested, minimap2 applies dynamic
-programming (DP) to extend from the ends of chains and to close unseeded
+programming (DP) to extend from the ends of chains and to close
-regions between adjacent seeds in chains.
+regions between adjacent anchors in chains.
 
 Minimap2 uses indexing and seeding algorithms similar to
 minimap~\citep{Li:2016aa}, and furthers the predecessor with more accurate
@@ -111,12 +118,12 @@ distance between two anchors is too large); otherwise
 \begin{equation}\label{eq:chain-gap}
 \beta(j,i)=\gamma_c\big((y_i-y_j)-(x_i-x_j)\big)
 \end{equation}
-In implementation, a gap of length $l$ costs
+In implementation, a gap of length $l\not=0$ costs
 \[
 \gamma_c(l)=0.01\cdot \bar{w}\cdot|l|+0.5\log_2|l|
 \]
-where $\bar{w}$ is the average seed length. For $m$ anchors, directly computing all $f(\cdot)$ with
+where $\bar{w}$ is the average seed length. For $N$ anchors, directly computing all $f(\cdot)$ with
-Eq.~(\ref{eq:chain}) takes $O(m^2)$ time. Although theoretically faster
+Eq.~(\ref{eq:chain}) takes $O(N^2)$ time. Although theoretically faster
 chaining algorithms exist~\citep{Abouelhoda:2005aa}, they
 are inapplicable to generic gap cost, complex to implement and usually
 associated with a large constant. We introduced a simple heuristic to
@@ -126,12 +133,12 @@ We note that if anchor $i$ is chained to $j$, chaining $i$ to a predecessor
 of $j$ is likely to yield a lower score. When evaluating Eq.~(\ref{eq:chain}),
 we start from anchor $i-1$ and stop the process if we cannot find a better
 score after up to $h$ iterations. This approach reduces the average time to
-$O(h\cdot m)$. In practice, we can almost always find the optimal chain with
+$O(hN)$. In practice, we can almost always find the optimal chain with
 $h=50$; even if the heuristic fails, the optimal chain is often close.
 
 \subsubsection{Backtracking}
 Let $P(i)$ be the index of the best predecessor of anchor $i$. It equals 0 if
-$f(i)=w_i$ or $\argmax_j\{f(j)+\eta(j,i)-\gamma(j,i)\}$ otherwise. For each
+$f(i)=w_i$ or $\argmax_j\{f(j)+\alpha(j,i)-\beta(j,i)\}$ otherwise. For each
 anchor $i$ in the descending order of $f(i)$, we apply $P(\cdot)$ repeatedly to
 find its predecessor and mark each visited $i$ as `used', until $P(i)=0$ or we
 reach an already `used' $i$. This way we find all chains with no anchors used
@@ -140,9 +147,11 @@ in more than one chains.
 \subsubsection{Identifying primary chains}\label{sec:primary}
 In the absence of copy number changes, each query segment should not be mapped
 to two places in the reference. However, chains found at the previous step may
-have significant or complete overlaps due to repeats in the reference.
+have significant or complete overlaps due to repeats in the reference~\citep{Li:2010fk}.
 Minimap2 used the following procedure to identify \emph{primary chains} that do
-not greatly overlap on the query. Let $Q$ be an empty set initially. For each
+not greatly overlap on the query.
+
+Let $Q$ be an empty set initially. For each
 chain from the best to the worst according to their chaining scores: if on the
 query, the chain overlaps with a chain in $Q$ by 50\% or higher percentage of
 the shorter chain, mark the chain as secondary to the chain in $Q$; otherwise,
@@ -150,6 +159,63 @@ add the chain to $Q$. In the end, $Q$ contains all the primary chains. We did
 not choose a more sophisticated data structure (e.g. range tree or k-d tree)
 because this step is not the performance bottleneck.
 
+For each primary chain, minimap2 estimates its mapping quality with an
+empirical formula:
+\[
+{\rm mapQ}=40\cdot (1-f_2/f_1)\cdot\min\{1,m/10\}\cdot\log f_1
+\]
+where $m$ is the number of anchors on the primary chain, $f_1$ is the chaining
+score, and $f_2\le f_1$ is the score of the best chain that is secondary to the
+primary chain. Intuitively, a chain is assigned to a higher mapping quality if
+it is long and its best secondary chain is weak.
+
+\subsubsection{Estimating per-base sequence divergence}
+Suppose a query sequence harbors $n$ seeds of length $k$, $m$ of which are
+present in a chain. We want to estimate the sequence divergence $\epsilon$
+between the query and the reference sequences in the chain. This is useful
+when base-level alignment is too expensive to perform.
+
+If we model substitutions with a homogeneous Poisson process along the query
+sequence, the probablity of seeing $k$ consecutive bases without substitutions
+is $e^{-k\epsilon}$. On the assumption that all $k$-mers are independent of
+each other, the likelihood function of $\epsilon$ is
+\[
+\mathcal{L}(\epsilon|n,m,k)=e^{-m\cdot k\epsilon}(1-e^{-k\epsilon})^{n-m}
+\]
+The maximum likelihood estimate of $\epsilon$ is
+\[
+\hat{\epsilon}=\frac{1}{k}\log\frac{n}{m}
+\]
+In reality, sequencing errors are sometimes clustered and $k$-mers are not
+independent of each other, especially when we take minimizers as seeds. These
+violate the assumptions in the derivation above. As a result, $\hat{\epsilon}$
+is only approximate and can be biased. It also ignores long deletions from the
+reference sequence. In practice, fortunately, $\hat{\epsilon}$ is often close
+to and strongly correlated with the sequence divergence estimated from
+base-level alignments. On the several datasets used in
+Section~\ref{sec:long-genomic}, the Spearman correlation coefficient is around
+$0.9$.
+
+\subsubsection{Indexing with homopolymer compressed $k$-mers}
+SmartDenovo
+(\href{https://github.com/ruanjue/smartdenovo}{https://github.com/ruanjue/smartdenovo};
+J. Ruan, personal communication) indexes reads with homopolymer-compressed (HPC)
+$k$-mers and finds the strategy improves overlap sensitivity for SMRT reads.
+Minimap2 adopts the same heuristic.
+
+The HPC string of a string $s$, denoted by ${\rm HPC}(s)$, is constructed by
+contracting homopolymers in $s$ to a single base.  An HPC $k$-mer of $s$ is a
+$k$-long substring of ${\rm HPC}(s)$. For example, suppose $s={\tt GGATTTTCCA}$,
+${\rm HPC}(s)={\tt GATCA}$ and the first HPC 4-mer is ${\tt GATC}$.
+
+To demonstrate the effectiveness of HPC $k$-mers, we performed read overlapping
+for the example {\it E. coli} SMRT reads from PBcR~\citep{Berlin:2015xy}, using
+different types of $k$-mers. With normal 15bp minimizers per 5bp window,
+minimap2 finds 90.9\% of $\ge$2kb overlaps inferred from the read-to-reference
+alignment. With HPC 19-mers per 5bp window, minimap2 finds 97.4\% of overlaps. It achieves this
+higher sensitivity by indexing 1/3 fewer minimizers, which further helps
+performance. HPC-based indexing reduces the sensitivity for current ONT reads, though.
+
 \subsection{Aligning genomic DNA}\label{sec:genomic}
 
 \subsubsection{Alignment with 2-piece affine gap cost}
@@ -179,7 +245,7 @@ where $s(i,j)$ is the score between the $i$-th reference base and $j$-th query
 base. Eq.~(\ref{eq:ae86}) is a natural extension to the equation under affine
 gap cost~\citep{Gotoh:1982aa,Altschul:1986aa}.
 
-\subsubsection{Suzuki's formulation}
+\subsubsection{The Suzuki-Kasahara formulation}
 
 When we allow gaps longer than several hundred base pairs, nucleotide-level
 alignment is much slower than chaining. SSE acceleration is critical to the
@@ -187,14 +253,14 @@ performance of minimap2. Traditional SSE implementations~\citep{Farrar:2007hs}
 based on Eq.~(\ref{eq:ae86}) can achieve 16-way parallelization for short
 sequences, but only 4-way parallelization when the peak alignment score reaches
 32767. Long sequence alignment may exceed this threshold. Inspired by
-\citet{Wu:1996aa} and the following work, \citet{Suzuki:2016} proposed a
+\citet{Wu:1996aa} and the following work, \citet{Suzuki130633} proposed a
 difference-based formulation that lifted this limitation.
 In case of 2-piece gap cost, define
 \[
 \left\{\begin{array}{ll}
 u_{ij}\triangleq H_{ij}-H_{i-1,j} & v_{ij}\triangleq H_{ij}-H_{i,j-1} \\
-x_{ij}\triangleq E_{i+1,j}-H_{ij} & \tilde{x}_{ij}\triangleq \tilde{E}_{i+1,j}-\tilde{H}_{ij} \\
+x_{ij}\triangleq E_{i+1,j}-H_{ij} & \tilde{x}_{ij}\triangleq \tilde{E}_{i+1,j}-H_{ij} \\
-y_{ij}\triangleq F_{i,j+1}-H_{ij} & \tilde{y}_{ij}\triangleq \tilde{F}_{i,j+1}-\tilde{H}_{ij}
+y_{ij}\triangleq F_{i,j+1}-H_{ij} & \tilde{y}_{ij}\triangleq \tilde{F}_{i,j+1}-H_{ij}
 \end{array}\right.
 \]
 We can transform Eq.~(\ref{eq:ae86}) to
@@ -258,7 +324,7 @@ the same anti-diagonal in one inner loop. It also simplifies banded alignment,
 which would be difficult with striped vectorization~\citep{Farrar:2007hs}.
 
 On the condition that $q+e<\tilde{q}+\tilde{e}$ and $e>\tilde{e}$, the initial
-values in the diagonal-antidiagonal formuation is
+values in the diagonal-antidiagonal formuation are
 \[
 \left\{\begin{array}{l}
 x_{r-1,-1}=y_{r-1,r}=-q-e\\
@@ -277,6 +343,13 @@ r\cdot(e-\tilde{e})-(\tilde{q}-q)-\tilde{e} & (r=\lceil\frac{\tilde{q}-q}{e-\til
 \]
 These can be derived from the initial values for Eq.~(\ref{eq:ae86}).
 
+When performing global alignment, we do not need to compute $H_{rt}$ in each cell.
+We use 16-way vectorization throughout the alignment process. When extending
+alignments from ends of chains, we need to find the cell $(r,t)$ where $H_{rt}$
+reaches the maximum. We resort to 4-way vectorization to compute
+$H_{rt}=H_{r-1,t}+u_{rt}$. Because this computation is simple,
+Eq.~(\ref{eq:suzuki}) is still the dominant performance bottleneck.
+
 In practice, our 16-way vectorized implementation of global alignment is three
 times as fast as Parasail's 4-way vectorization~\citep{Daily:2016aa}.  Without
 banding, our implementation is slower than Edlib~\citep{Sosic:2017aa}, but with
@@ -306,6 +379,16 @@ alignment between the two subsequences involved in the global alignment, but
 this time with the one subsequence reverse complemented. This additional
 alignment step may identify short inversions that are missed during chaining.
 
+\subsubsection{Filtering out misplaced anchors}
+Due to sequencing errors and local homology, some anchors in a chain may be
+wrong. If we blindly align regions between two misplaced anchors, we will
+produce a suboptimal alignment. To reduce this artifact, we filter out
+anchors that lead to a $>$10bp insertion and a $>$10bp deletion at the same
+time, and filter out terminal anchors that lead to a long gap towards the ends
+of a chain. These heuristics greatly alleviate the issues with misplaced
+anchors, but they are unable to fix all such errors. Local misalignment is a
+limitation of minimap2 which we hope to address in future.
+
 \subsection{Aligning spliced sequences}
 
 The algorithm described above can be adapted to spliced alignment. In this
@@ -337,18 +420,24 @@ F_{i,j+1}= \max\{H_{ij}-q,F_{ij}\}-e\\
 \tilde{E}_{i+1,j}= \max\{H_{ij}-d(i)-\tilde{q},\tilde{E}_{ij}\}\\
 \end{array}\right.
 \end{equation}
-Let $T$ be the reference sequence. $d(i)$ is the cost of a non-canonical donor
+Let $T$ be the reference sequence. $d(i)$ is computed as
-site, which takes 0 if $T[i+1,i+2]={\tt GT}$, or a positive number $p$
+\[d(i)=\left\{\begin{array}{ll}
-otherwise. Similarly, $a(i)$ is the cost of a non-canonical acceptor site, which
+0 & \mbox{if $T[i+1,i+3]$ is ${\tt GTA}$ or ${\tt GTG}$} \\
-takes 0 if $T[i-1,i]={\tt AG}$, or $p$ otherwise. Eq.~(\ref{eq:splice}) is
+p/2 & \mbox{if $T[i+1,i+3]$ is ${\tt GTC}$ or ${\tt GTT}$} \\
-almost equivalent to the equation used by EXALIN~\citep{Zhang:2006aa} except
+p & \mbox{otherwise}
-that we allow insertions immediately followed by deletions and vice versa; in
+\end{array}\right.\]
-addition, we use Suzuki's diagonal formulation in actual implementation.
+where $T[i,j]$ extracts a substring of $T$ between $i$ and $j$ inclusively.
-
+$d(i)$ penalizes non-canonical donor sites with $p$ and less frequent Eukaryotic
-%Given that $d_i$ and $a_i$
+splicing signal ${\tt GT[C/T]}$ with $p/2$~\citep{Irimia:2008aa}. Similarly,
-%are a function of the reference sequence, it is possible to incorporate
+\[a(i)=\left\{\begin{array}{ll}
-%splicing signals with more sophisticated models, such as positional weight
+0 & \mbox{if $T[i-2,i]$ is ${\tt CAG}$ or ${\tt TAG}$} \\
-%matrices. We have not tried this approach.
+p/2 & \mbox{if $T[i-2,i]$ is ${\tt AAG}$ or ${\tt GAG}$} \\
+p & \mbox{otherwise}
+\end{array}\right.\]
+models the acceptor signal. Eq.~(\ref{eq:splice}) is close to an equation in
+\citet{Zhang:2006aa} except that we allow insertions immediately followed by
+deletions and vice versa; in addition, we use the Suzuki-Kasahara diagonal
+formulation in actual implementation.
 
 If RNA-seq reads are not sequenced from stranded libraries, the read strand
 relative to the underlying transcript is unknown. By default, minimap2 aligns
@@ -360,18 +449,18 @@ reads that span canonical splicing sites.
 
 In the spliced alignment mode, minimap2 further increases the density of
 minimizers and disables banded alignment. Together with the two-round DP-based
-alignment, spliced alignment is several times slower than DNA sequence
+alignment, spliced alignment is several times slower than genomic DNA
 alignment.
 
 \subsection{Aligning short paired-end reads}
 
-During chainging, minimap2 takes a pair of reads as one read with a gap of
+During chaining, minimap2 takes a pair of reads as one fragment with a gap of
 unknown length in the middle. It applies a normal gap cost between seeds on the
 same read but is a more permissive gap cost between seeds on different reads.
-More precisely, the gap cost during chaining is:
+More precisely, the gap cost during chaining is ($l\not=0$):
 \[
 \gamma_c(l)=\left\{\begin{array}{ll}
-0.01\cdot\bar{w}\cdot l+0.5\log_2 l & \mbox{if two seeds on the same read} \\
+0.01\cdot\bar{w}\cdot |l|+0.5\log_2 |l| & \mbox{if two seeds on the same read} \\
 \min\{0.01\cdot\bar{w}\cdot|l|,\log_2|l|\} & \mbox{otherwise}
 \end{array}\right.
 \]
@@ -384,26 +473,40 @@ consistent paired-end alignments.
 
 \section{Results}
 
-\subsection{Aligning long genomic reads}
+Minimap2 is implemented in the C programming language and comes with APIs in
+both C and Python. It is distributed under the MIT license, free to both
+commercial and academic uses. Minimap2 uses the same base algorithm for all
+applications, but it has to apply different sets of parameters depending on
+input data types. Similar to BWA-MEM, minimap2 introduces `presets' that
+modify multiple parameters with a simple invokation. Detailed settings
+and command-line options can be found in the minimap2 manpage. In addition to
+the applications evaluated in the following sections, minimap2 also retains
+minimap's functionality to find overlaps between long reads and to search
+against large multi-species databases such as \emph{nt} from NCBI.
+
+\subsection{Aligning long genomic reads}\label{sec:long-genomic}
 
 \begin{figure}[!tb]
 \centering
 \includegraphics[width=.5\textwidth]{roc-color.pdf}
 \caption{Evaluation on aligning simulated reads. Simulated reads were mapped 
 to the primary assembly of human genome GRCh38. A read is considered correctly
-mapped if the true position overlaps with the best mapping position by 10\% of
+mapped if its longest alignment overlaps with the true interval, and the
-the read length. Read alignments are sorted by mapping quality in the
+overlap length is $\ge$10\% of the true interval length.  Read alignments are
-descending order. For each mapping quality threshold, the fraction of
+sorted by mapping quality in the descending order. For each mapping quality
-alignments with mapping quality above the threshold and their error rate are
+threshold, the fraction of alignments (out of the number of input reads) with
+mapping quality above the threshold and their error rate are
 plotted along the curve. (a) long-read alignment evaluation. 33,088 $\ge$1000bp
 reads were simulated using pbsim~\citep{Ono:2013aa} with error profile sampled
 from file `m131017\_060208\_42213\_*.1.*' downloaded at
 \href{http://bit.ly/chm1p5c3}{http://bit.ly/chm1p5c3}. The N50 read length is
 11,628. Aligners were run under the default setting for SMRT reads.
-(b) short-read alignment evaluation. 10 million pairs of 150bp reads were
+Kart outputted all alignments at mapping quality 60, so is not shown in the
-simulated using mason2~\citep{Holtgrewe:2010aa} with option
+figure. It mapped nearly all reads with 4.1\% of alignments being wrong, less
-`\mbox{--illumina-prob-mismatch-scale 2.5}'. Short-read aligners were run under the
+accurate than others.  (b) short-read alignment evaluation. 10 million pairs of
-default setting except for changing the maximum fragment length to
+150bp reads were simulated using mason2~\citep{Holtgrewe:2010aa} with option
+`\mbox{--illumina-prob-mismatch-scale 2.5}'. Short-read aligners were run under
+the default setting except for changing the maximum fragment length to
 800bp.}\label{fig:eval}
 \end{figure}
 
@@ -412,22 +515,20 @@ BLASR~(v1.MC.rc64; \citealp{Chaisson:2012aa}),
 BWA-MEM~(v0.7.15; \citealp{Li:2013aa}),
 GraphMap~(v0.5.2; \citealp{Sovic:2016aa}),
 Kart~(v2.2.5; \citealp{Lin:2017aa}),
-minialign~(v0.5.3; \citealp{Suzuki:2016}) and
+minialign~(v0.5.3; \href{https://github.com/ocxtal/minialign}{https://github.com/ocxtal/minialign}) and
 NGMLR~(v0.2.5; \citealp{Sedlazeck169557}). We excluded rHAT~\citep{Liu:2016ab}
 and LAMSA~\citep{Liu:2017aa} because they either
 crashed or produced malformatted output. In this evaluation, minimap2 has
 higher power to distinguish unique and repetitive hits, and achieves overall
-higher mapping accuracy (Fig.~\ref{fig:eval}a). It is still the most accurate
+higher mapping accuracy (Fig.~\ref{fig:eval}a). Minimap2 and
-even if we skip DP-based alignment (data not shown), confirming chaining alone
-is sufficient to achieve high accuracy for approximate mapping. Minimap2 and
 NGMLR provide better mapping quality estimate: they rarely give repetitive hits
 high mapping quality.  Apparently, other aligners may
 occasionally miss close suboptimal hits and be overconfident in wrong mappings.
-On run time, minialign is slightly faster than minimap2 and Kart. They are over
+On run time, minimap2 took 200 CPU seconds, comparable to minialign and Kart, and is over
-30 times faster than the rest.  Minimap2 consumed 6.1GB memory at the peak,
+30 times faster than the rest.  Minimap2 consumed 6.8GB memory at the peak,
-more than BWA-MEM but less than others.
+more than BWA-MEM (5.4GB), similar to NGMLR and less than others.
 
-On real human SMRT reads, the relative performance and sensitivity of
+On real human SMRT reads, the relative performance and fraction of mapped reads reported by
 these aligners are broadly similar to the metrics on simulated data. We are
 unable to provide a good estimate of mapping error rate due to the lack of the
 truth.  On ONT $\sim$100kb human reads~\citep{Jain128835}, BWA-MEM failed.
@@ -440,16 +541,16 @@ to the 2-piece affine gap cost.
 \subsection{Aligning long spliced reads}
 
 We evaluated minimap2 on SIRV control data~(AC:SRR5286959;
-\citealp{Byrne:2017aa}) where the truth is known. Minimap2 predicted 59\,916
+\citealp{Byrne:2017aa}) where the truth is known. Minimap2 predicted 59\,918
-introns from 11\,017 reads. 93.0\% of splice juctions are precise. We examined
+introns from 11\,018 reads. 93.8\% of splice juctions are precise. We examined
 wrongly predicted junctions and found the majority were caused by clustered
 splicing signals (e.g. two adjacent ${\tt GT}$ sites). When INDEL sequencing
 errors are frequent, it is difficult to find precise splicing sites in this
 case. If we allow up to 10bp distance from true splicing sites, 98.4\% of
-aligned introns are approximately correct.  Given this observation, we might be
+aligned introns are approximately correct. It is worth noting that for SIRV, we
-able to improve boundary detection by initializing $d(\cdot)$ and $a(\cdot)$ in
+asked minimap2 to model the ${\tt GT..AG}$ splicing signal only without extra
-Eq.~(\ref{eq:splice}) with position-specific scoring matrices or more
+bases. This is because SIRV does not honor the evolutionarily prevalent signal
-sophisticated models. We have not tried this approach.
+${\tt GT[A/G]..[C/T]AG}$~\citep{Irimia:2008aa}.
 
 \begin{table}[!tb]
 \processtable{Evaluation of junction accuracy on 2D ONT reads}
@@ -460,16 +561,16 @@ sophisticated models. We have not tried this approach.
 \midrule
 Run time (CPU min)        & 631      & 15.9     & 2\,076   & 33.9 \\
 Peak RAM (GByte)          & 8.9      & 14.5     & 3.2      & 29.2\vspace{1em}\\
-\# aligned reads          & 103\,669 & 104\,200 & 103\,711 & 26\,479 \\
+\# aligned reads          & 103\,669 & 104\,199 & 103\,711 & 26\,479 \\
 \# chimeric alignments    & 1\,904   & 1\,488   & 0        & 0 \\
-\# non-spliced alignments & 15\,854  & 14\,639  & 17\,033  & 10\,545\vspace{1em}\\
+\# non-spliced alignments & 15\,854  & 14\,798  & 17\,033  & 10\,545\vspace{1em}\\
-\# aligned introns        & 692\,275 & 694\,103 & 692\,945 & 78\,603 \\
+\# aligned introns        & 692\,275 & 693\,553 & 692\,945 & 78\,603 \\
-\# novel introns          & 11\,239  & 3\,207   & 8\,550   & 1\,214 \\
+\# novel introns          & 11\,239  & 3\,113   & 8\,550   & 1\,214 \\
-\% exact introns          & 83.8\%   & 91.7\%   & 87.9\%   & 55.2\% \\
+\% exact introns          & 83.8\%   & 94.0\%   & 87.9\%   & 55.2\% \\
-\% approx. introns        & 91.8\%   & 96.5\%   & 92.5\%   & 82.4\% \\
+\% approx. introns        & 91.8\%   & 96.9\%   & 92.5\%   & 82.4\% \\
 \botrule
 \end{tabular}
-}{Mouse reads (AC:SRR5286960) were mapped to the primary assembly of mouse
+}{Mouse reads (AC:SRR5286960; R9.4 chemistry) were mapped to the primary assembly of mouse
 genome GRCm38 with the following tools and command options: minimap2 (`-ax
 splice'); GMAP (`-n 0 --min-intronlength 30 --cross-species'); SpAln (`-Q7 -LS
 -S3'); STARlong (according to
@@ -487,10 +588,20 @@ STAR~(v2.5.3a; \citealp{Dobin:2013kx}). In general, minimap2 is more
 consistent with existing annotations (Table~\ref{tab:intron}): it finds
 more junctions with a higher percentage being exactly or approximately correct.
 Minimap2 is over 40 times faster than GMAP and SpAln. While STAR is close to
-minimap2 in speed, it does not work well with noisy reads.  We have also
+minimap2 in speed, it does not work well with noisy reads.
-evaluated spliced aligners on public Iso-Seq data (human Alzheimer brain
+
-from \href{http://bit.ly/isoseqpub}{http://bit.ly/isoseqpub}). The observation
+We have also evaluated spliced aligners on a human Nanopore Direct RNA-seq
-is similar: minimap2 is faster at higher junction accuracy.
+dataset (\href{http://bit.ly/na12878ont}{http://bit.ly/na12878ont}). Minimap2
+aligned 10 million reads in $<$1 wall-clock hour using 16 CPU cores. 94.2\% of
+aligned splice junctions consistent with gene annotations. In comparison,
+GMAP under option `-k 14 -n 0 --min-intronlength 30 --cross-species' is 160
+times slower; 68.7\% of GMAP junctions are found in known gene annotations. The
+percentage increases to 84.1\% if an aligned junction within 10bp from an
+annotated junction is considered to be correct. On a public Iso-Seq dataset
+(human Alzheimer brain from
+\href{http://bit.ly/isoseqpub}{http://bit.ly/isoseqpub}), minimap2 is also
+faster at higher junction accuracy in comparison to other aligners in
+Table~\ref{tab:intron}.
 
 We noted that GMAP and SpAln have not been optimized for noisy reads. We are
 showing the best setting we have experimented, but their developers should be
@@ -518,33 +629,88 @@ able to improve their accuracy further.
 
 \subsection{Aligning short genomic reads}
 
-We evaluated minimap2 along with Bowtie2~\citep{Langmead:2012fk}, BWA-MEM and
+We evaluated minimap2 along with Bowtie2~(v2.3.3; \citealt{Langmead:2012fk}), BWA-MEM and
-SNAP~\citep{Zaharia:2011aa}. Minimap2 is 3--4 times as fast as Bowtie2 and
+SNAP (v1.0beta23; \citealt{Zaharia:2011aa}). Minimap2 is 3--4 times as fast as Bowtie2 and
 BWA-MEM, but is 1.3 times slower than SNAP. Minimap2 is more accurate on this
 simulated data set than Bowtie2 and SNAP but less accurate than BWA-MEM
 (Fig.~\ref{fig:eval}b). Closer investigation reveals that BWA-MEM achieves
 a higher accuracy partly because it tries to locally align a read in a small
 region close to its mate. If we disable this feature, BWA-MEM becomes slightly
-less accurate than minimap2. We might consider to implement a similar heuristic
+less accurate than minimap2. We might implement a similar heuristic
 in minimap2 in future.
 
-\section{Conclusion}
+To evaluate the accuracy of minimap2 on real data, we aligned human reads
+(AC:ERR1341796) with BWA-MEM and minimap2, and called SNPs and small INDELs
+with GATK HaplotypeCaller v3.5~\citep{Depristo:2011vn}. This run was sequenced
+from experimentally mixed CHM1 and CHM13 cell lines. Both of them are homozygous
+across the whole genome and have been \emph{de novo} assembled with SMRT reads
+to high quality. This allowed us to construct an independent truth variant
+dataset~\citep{Li223297} for
+ERR1341796. In this evaluation, minimap2 has higher SNP false negative rate
+(FNR; 2.5\% of minimap2 vs 2.2\% of BWA-MEM), but fewer false positive SNPs per
+million bases (FPPM; 3.0 vs 3.9), lower 2--50bp INDEL FNR (7.3\% vs 7.5\%) and
+similar INDEL FPPM (both 1.0). Minimap2 is broadly similar to BWA-MEM in the
+context of small variant calling.
 
-Minimap2 is a fast, accurate and versatile aligner for long nucleotide
+\subsection{Aligning long-read assemblies}
-sequences.  In addition to reference-based read mapping, minimap2 inherits
+
-minimap's functionality to search against huge multi-species databases and to
+Minimap2 can align a SMRT assembly (AC:GCA\_001297185.1) against GRCh38 in 7
-find read overlaps. On a few test data sets, minimap2 appears to yield slightly
+minutes using 8 CPU cores, over 20 times faster than nucmer from
-better miniasm assembly~\citep{Li:2016aa}. Minimap2 can also align similar
+MUMmer4~\citep{Marcais:2018aa}. With the paftools.js script from the minimap2
-genomes or different assemblies of the same species. However, full-genome
+package, we called 2.67 million single-base substitutions out of 2.78Gbp
-alignment is an intricate research topic. More thorough evaluations would be
+genomic regions. The transition-to-transversion ratio (ts/tv) is 2.01. In
-necessary to justify the use of minimap2 for such applications.
+comparison, using MUMmer4's dnadiff pipeline, we called 2.86 million
+substitutions in 2.83Gbp at ts/tv=1.87. Given that ts/tv averaged across the
+human genome is about 2 but ts/tv averaged over random errors is 0.5, the
+minimap2 callset arguably has higher precision at lower sensitivity.
+
+The sample being assembled is a female. Minimap2 still called 201 substitutions
+on the Y chromosome. These substitutions all come from one contig aligned at
+96.8\% sequence identity. The contig could be a segmental duplication
+absent from GRCh38. In constrast, dnadiff called 9070 substitutions on the Y
+chromosome across 73 SMRT contigs. This again implies our minimap2-based
+pipeline has higher precision.
+
+\section{Discussions}
+
+Minimap2 is a versatile mapper and pairwise aligner for nucleotide sequences.
+It works with short reads, assembly contigs and long noisy genomic and RNA-seq
+reads, and can be used as a read mapper, long-read overlapper or a full-genome
+aligner. Minimap2 is also accurate and efficient, often outperforming other
+domain-specific alignment tools in terms of both speed and accuracy.
+
+The capability of minimap2 comes from a fast base-level alignment algorithm and
+an accurate chaining algorithm. When aligning long query sequences, base-level
+alignment is often the performance bottleneck. The Suzuki-Kasahara algorithm
+greatly alleviates the bottleneck and enables DP-based splice alignment
+involving $>$100kb introns, which was impractically slow ten years ago.  The
+minimap2 chaining algorithm is fast and highly accurate by itself.  In fact,
+chaining alone is more accurate than all the other long-read mappers in
+Fig.~\ref{fig:eval}a (data not shown). This accuracy helps to reduce downstream
+base-level alignment of candidate chains, which is still times slower than
+chaining even with the Suzuki-Kasahara improvement. In addition, taking a
+general form, minimap2 chaining can be adapted to non-typical data types such as
+spliced reads and multiple reads per fragment. This gives us the opportunity to
+extend the same base algorithm to a variety of use cases.
+
+Modern mainstream aligners often use a full-text index, such as suffix array or
+FM-index, to index reference sequences. An advantage of this approach is that
+we can use exact seeds of arbitrary lengths, which helps to increase seed
+uniqueness and reduce unsuccessful extensions. Minimap2 indexes reference
+k-mers with a hash table instead. Such fixed-length seeds are inferior to
+variable-length seeds in theory, but can be computed much more efficiently in
+practice. When a query sequence has multiple seed hits, we can afford to skip
+highly repetitive seeds without affecting the final accuracy. This further
+alleviates the concern with the seeding uniqueness. At the same time, at low
+sequence identity, it is rare to see long seeds anyway. Hash table is the ideal
+data structure for mapping long noisy sequences.
 
 \section*{Acknowledgements}
-We owe a debt of gratitude to Hajime Suzuki for releasing his masterpiece and
+We owe a debt of gratitude to H. Suzuki and M. Kasahara for releasing their
-insightful notes before formal publication. We thank M. Schatz, P. Rescheneder
+masterpiece and insightful notes before formal publication. We thank M.
-and F.  Sedlazeck for pointing out the limitation of BWA-MEM. We are also
+Schatz, P. Rescheneder and F. Sedlazeck for pointing out the limitation of
-grateful to early minimap2 testers who have greatly helped to suggest features
+BWA-MEM. We are also grateful to minimap2 users who have greatly helped to
-and to fix various issues.
+suggest features and to fix various issues.
 
 \bibliography{minimap2}
 

tex/mm2-s3.sam.eval

@@ -1,60 +1,62 @@
-Q	60	18345673	8	0.000000436	18345673
+Q	60	18579866	27	0.000001453	18579866
-Q	59	33966	4	0.000000653	18379639
+Q	59	27087	4	0.000001666	18606953
-Q	58	34178	1	0.000000706	18413817
+Q	58	21435	1	0.000001718	18628388
-Q	56	49138	1	0.000000758	18462955
+Q	57	45663	3	0.000001874	18674051
-Q	54	22442	4	0.000000974	18485397
+Q	56	36031	2	0.000001978	18710082
-Q	53	19070	2	0.000001081	18504467
+Q	55	18499	2	0.000002082	18728581
-Q	52	14169	3	0.000001242	18518636
+Q	54	14754	2	0.000002187	18743335
-Q	51	13233	4	0.000001457	18531869
+Q	53	25541	2	0.000002291	18768876
-Q	50	12133	2	0.000001564	18544002
+Q	52	26397	5	0.000002554	18795273
-Q	49	11138	4	0.000001778	18555140
+Q	51	15090	3	0.000002711	18810363
-Q	48	11174	8	0.000002208	18566314
+Q	50	13425	11	0.000003294	18823788
-Q	47	17139	4	0.000002422	18583453
+Q	49	15175	2	0.000003397	18838963
-Q	46	20428	10	0.000002956	18603881
+Q	48	19407	4	0.000003606	18858370
-Q	45	16503	3	0.000003115	18620384
+Q	47	11538	16	0.000004452	18869908
-Q	44	11933	6	0.000003435	18632317
+Q	46	12558	17	0.000005349	18882466
-Q	43	25392	11	0.000004020	18657709
+Q	45	40362	28	0.000006817	18922828
-Q	42	16734	9	0.000004498	18674443
+Q	44	10465	13	0.000007500	18933293
-Q	41	13826	10	0.000005030	18688269
+Q	43	10098	20	0.000008552	18943391
-Q	40	13023	10	0.000005561	18701292
+Q	42	10682	19	0.000009549	18954073
-Q	39	12686	10	0.000006092	18713978
+Q	41	9823	11	0.000010125	18963896
-Q	38	17275	4	0.000006300	18731253
+Q	40	9685	16	0.000010963	18973581
-Q	37	17241	2	0.000006401	18748494
+Q	39	10273	18	0.000011905	18983854
-Q	36	12458	12	0.000007036	18760952
+Q	38	9515	18	0.000012847	18993369
-Q	35	11981	5	0.000007298	18772933
+Q	37	9474	27	0.000014261	19002843
-Q	34	12004	11	0.000007879	18784937
+Q	36	10430	25	0.000015568	19013273
-Q	33	12111	7	0.000008246	18797048
+Q	35	9241	34	0.000017348	19022514
-Q	32	11782	9	0.000008719	18808830
+Q	34	9162	31	0.000018968	19031676
-Q	31	11811	7	0.000009086	18820641
+Q	33	10164	49	0.000021532	19041840
-Q	30	33507	32	0.000010767	18854148
+Q	32	9152	55	0.000024408	19050992
-Q	29	11243	21	0.000011874	18865391
+Q	31	9252	35	0.000026233	19060244
-Q	28	10779	17	0.000012767	18876170
+Q	30	9872	55	0.000029103	19070116
-Q	27	15733	24	0.000014027	18891903
+Q	29	8938	65	0.000032496	19079054
-Q	26	16762	40	0.000016130	18908665
+Q	28	8951	73	0.000036306	19088005
-Q	25	13811	49	0.000018708	18922476
+Q	27	9949	95	0.000041261	19097954
-Q	24	14141	46	0.000021123	18936617
+Q	26	9784	97	0.000046316	19107738
-Q	23	13429	55	0.000024010	18950046
+Q	25	10126	97	0.000051366	19117864
-Q	22	13116	26	0.000025365	18963162
+Q	24	11260	123	0.000057765	19129124
-Q	21	13436	46	0.000027771	18976598
+Q	23	10047	114	0.000063691	19139171
-Q	20	13441	55	0.000030648	18990039
+Q	22	9661	123	0.000070083	19148832
-Q	19	12988	53	0.000033416	19003027
+Q	21	10339	168	0.000078813	19159171
-Q	18	13353	51	0.000036074	19016380
+Q	20	17928	193	0.000088804	19177099
-Q	17	13782	77	0.000040094	19030162
+Q	19	9842	193	0.000098817	19186941
-Q	16	14065	94	0.000045001	19044227
+Q	18	14737	247	0.000111605	19201678
-Q	15	14044	124	0.000051474	19058271
+Q	17	10218	238	0.000123934	19211896
-Q	14	14714	140	0.000058774	19072985
+Q	16	10271	242	0.000136457	19222167
-Q	13	17459	197	0.000069040	19090444
+Q	15	12241	333	0.000153683	19234408
-Q	12	17339	259	0.000082532	19107783
+Q	14	9189	336	0.000171070	19243597
-Q	11	17381	280	0.000097097	19125164
+Q	13	9493	515	0.000197734	19253090
-Q	10	17732	295	0.000112418	19142896
+Q	12	11502	743	0.000236185	19264592
-Q	9	17959	416	0.000134023	19160855
+Q	11	8211	507	0.000262390	19272803
-Q	8	18234	530	0.000161530	19179089
+Q	10	9133	606	0.000293695	19281936
-Q	7	19048	514	0.000188143	19198137
+Q	9	10014	931	0.000341801	19291950
-Q	6	19722	656	0.000222085	19217859
+Q	8	8436	698	0.000377816	19300386
-Q	5	19753	775	0.000262143	19237612
+Q	7	8443	705	0.000414163	19308829
-Q	4	19818	1030	0.000315359	19257430
+Q	6	10203	944	0.000462808	19319032
-Q	3	17088	1100	0.000372149	19274518
+Q	5	6936	756	0.000501760	19325968
-Q	2	43045	6708	0.000718569	19317563
+Q	4	6732	843	0.000545190	19332700
-Q	1	126377	25255	0.002012761	19443940
+Q	3	8215	1104	0.000602040	19340915
-Q	0	554357	372087	0.020562901	19998297
+Q	2	21201	5440	0.000882342	19362116
+Q	1	82328	22186	0.002019600	19444444
+Q	0	553853	371953	0.020562901	19998297
 U	1703

tex/mm2.approx.eval

@@ -1,30 +1,12 @@
-Q	60	32066	0	0.000000000
+Q	60	32084	0	0.000000000	32084
-Q	40	32	1	0.000031155
+Q	24	318	2	0.000061725	32402
-Q	38	19	1	0.000062272
+Q	11	98	2	0.000123077	32500
-Q	36	11	1	0.000093376
+Q	8	37	2	0.000184405	32537
-Q	35	32	1	0.000124378
+Q	7	37	3	0.000276294	32574
-Q	33	15	1	0.000155400
+Q	6	40	3	0.000367940	32614
-Q	32	58	1	0.000186145
+Q	5	34	2	0.000428816	32648
-Q	27	11	1	0.000217095
+Q	4	37	5	0.000581306	32685
-Q	26	80	1	0.000247494
+Q	3	28	6	0.000764222	32713
-Q	21	19	2	0.000309186
+Q	2	38	6	0.000946536	32751
-Q	20	16	1	0.000339936
+Q	1	50	21	0.001585318	32801
-Q	19	19	1	0.000370622
+Q	0	286	150	0.006105117	33087
-Q	18	22	2	0.000432099
-Q	17	37	5	0.000585751
-Q	15	24	2	0.000646930
-Q	14	18	3	0.000738939
-Q	13	30	6	0.000922821
-Q	12	18	1	0.000953054
-Q	11	29	2	0.001013638
-Q	10	30	1	0.001043393
-Q	9	20	5	0.001196099
-Q	8	25	8	0.001440348
-Q	7	28	6	0.001622830
-Q	6	35	12	0.001988132
-Q	5	34	12	0.002352725
-Q	4	29	8	0.002594865
-Q	3	36	14	0.003018937
-Q	2	46	15	0.003471482
-Q	1	69	36	0.004558162
-Q	0	167	94	0.007377173

tex/mm2.eval

@@ -1,9 +1,13 @@
-Q	60	32226	0	0.000000000	32226
+Q	60	32477	0	0.000000000	32477
-Q	20	267	1	0.000030776	32493
+Q	22	16	1	0.000030776	32493
-Q	10	34	1	0.000061487	32527
+Q	21	44	1	0.000061468	32537
-Q	9	118	1	0.000091898	32645
+Q	19	73	1	0.000091996	32610
-Q	5	27	2	0.000153036	32672
+Q	14	66	1	0.000122414	32676
-Q	4	68	2	0.000213806	32740
+Q	10	26	3	0.000214054	32702
-Q	1	314	101	0.003267381	33054
+Q	8	14	1	0.000244529	32716
+Q	7	13	2	0.000305539	32729
+Q	6	47	1	0.000335611	32776
+Q	3	10	1	0.000366010	32786
+Q	2	20	2	0.000426751	32806
+Q	1	248	94	0.003267381	33054
 Q	0	31	17	0.003778147	33085
-U	3