Compare commits

...
342 Commits
Author SHA1 Message Date
Heng Li 7358a1ead1 Release minimap2-2.22 (r1101) 2021-08-07 11:30:31 -04:00
Heng Li 32f552957e Merge remote-tracking branch 'remotes/origin/master' 2021-08-07 10:40:02 -04:00
Heng Li a05edfa5ec a different ending sentence 2021-08-07 10:38:48 -04:00
Heng Li 8e81145817 finished the first draft 2021-08-07 00:33:31 -04:00
Heng Li e37f5ffe39 finished results 2021-08-07 00:06:28 -04:00
Heng Li 8a1d52bcbe r1094: for --split-prefix update max_dp at the end 2021-08-06 21:40:43 -04:00
Heng Li f7271a7c24 expose mapQ threshold to command line of pafcmp 2021-08-06 19:41:46 -04:00
Heng Li 70393eb46e minimap2 update manuscript 2021-08-06 19:41:17 -04:00
Heng Li 9d049f0562 added pafcmp 2021-08-05 12:41:21 -04:00
Heng Li 5180b70ff3 r1090: log wall-clock time for each read 2021-08-04 17:45:09 -04:00
Heng Li 2392e54fe2 r1089: fixed an unusual memory leak (#749)
This is more apparent when there are many candidate chains. Although only a
small numbers of them are extended, they are still occupying memory. A
realloc() solves this problem. This is a long existiing issue.
2021-08-04 17:07:00 -04:00
Heng Li 629c11728e output the number of mismatches 2021-08-04 17:05:06 -04:00
Ryan Lim 59488f0271 call mm_idx_destroy at the end of loop to fix memory leak 2021-07-26 18:25:08 -04:00
Heng Li 7e33fde82b dev-r1087: added --cap-kalloc 2021-07-19 21:20:04 -04:00
Heng Li c4fe52fb07 reduced the default -l and -b 2021-07-19 17:25:11 -04:00
Heng Li ead1cfbaca output for binning 2021-07-19 14:56:33 -04:00
Heng Li 83a535f148 dev-r1084: fixed flag integer overflow 2021-07-19 11:52:18 -04:00
Heng Li f3af29a8aa don't add a new command 2021-07-19 10:57:48 -04:00
Heng Li cf7eaef367 refactor and prepare for a new command 2021-07-19 00:36:17 -04:00
Heng Li 2411887d8e rename 2021-07-19 00:30:16 -04:00
Heng Li 1a8373bb84 dev-r1080: fixed negative dp_max 2021-07-18 21:07:14 -04:00
Heng Li 161ae7ff73 dev-r1079: per-read error rate
more tuning needed
2021-07-18 20:38:53 -04:00
Heng Li 8a6edab847 dev-r1078: decoupling ranking penalty 2021-07-18 16:22:48 -04:00
Heng Li 15118dd521 output #mismatches/#dels/#ins in view 2021-07-18 15:13:40 -04:00
Heng Li 2546999639 dev-r1076: log gap penalty 2021-07-17 18:23:59 -04:00
Heng Li 52fafe0fed updated pbsim to pbsim2 2021-07-17 18:18:26 -04:00
Heng Li 5f449c5cae fixed potential integer overflows 2021-07-16 17:20:05 -04:00
Heng Li b046052d82 Merge branch 'master' into utec 2021-07-16 13:32:47 -04:00
Jason Stajich 5cc3d2239f missing target object files from Makefile.simde to fix issue #779 2021-07-07 23:07:27 -04:00
Heng Li 581f2d7123 Release minimap2-2.21 (r1071) 2021-07-06 13:18:55 -04:00
Heng Li 52dbd439bc r1080: re-versioning 2021-07-02 20:26:13 -04:00
John Marshall 260a68d232 Use #defines for CIGAR operators in C code
Give the CIGAR constants names to clarify the code. So that ksw2.h
remains self-contained, define KSW_* versions of the CIGAR operators
it needs for use within ksw2.h. Other code should in general use the
full set of MM_CIGAR_* constants in minimap.h.
2021-07-02 13:03:03 -04:00
John Marshall 177eef259d Use the full MIDNSHP=X string whenever printing CIGAR strings
Define MM_CIGAR_STR to the full string of CIGAR operators (including
the 'B' operator as well) and use it throughout the C code.

It would be possible to use it from the Cython code too, but it's easier
to keep that as a Cython string literal to avoid adding extra runtime
code to handle locale conversion.
2021-07-02 13:03:03 -04:00
Heng Li 459ce04c84 r1069: fixed a regression in comparison to v2.18
for PE short reads. An interesting omission. Resolves #776
2021-07-02 11:45:21 -04:00
Heng Li e6cce019e4 r1068: fixed a bug caused by 3f71478
Resolves #752 (again)
2021-06-30 19:20:06 -04:00
Heng Li 7025b0b941 Merge branch 'master' of github.com:lh3/minimap2 2021-06-16 10:18:40 -04:00
Heng Li fe6a0bb337 r1064: fixed another uninitialized condition
This one should also be harmless. It affects a min value, but that value is not
actually used.
2021-06-16 10:16:36 -04:00
Heng Li 3f7147864b r1063: fixed an uninitialized access (#752)
This one is harmless.
2021-06-16 09:27:30 -04:00
Torsten Houwaart c83589b9ea Update README.md
Clarification on approximate mapping
2021-06-10 09:36:39 -04:00
Heng Li ce7a59f412 Fixed a typo in README
I just hate my butterfly keyboard!
2021-05-27 15:43:04 -04:00
Heng Li 15471bd629 Release minimap2-2.20 (r1061) 2021-05-27 15:26:04 -04:00
Heng Li ca19463268 r1060: safer ways to use -rNUM1,NUM2 2021-05-27 10:55:13 -04:00
Heng Li 4f8d1bc360 r1059: with --rmq, use the larger bandwidth 2021-05-26 23:01:49 -04:00
Heng Li 1776c0c645 missing seed.c in setup.py
Ok, I am not going to re-release again...
2021-05-26 21:36:09 -04:00
Heng Li 9febf532c1 Release minimap2-2.19 (r1057) 2021-05-26 21:23:42 -04:00
Heng Li cec23131e4 fixed a python compilation error
Caused by chain.c -> lchain.c
2021-05-26 21:20:48 -04:00
Heng Li ef09ccf104 Release minimap2-2.19 (r1055) 2021-05-26 21:01:03 -04:00
Heng Li e74dfd1aa9 r1054: fixed a memory leak 2021-05-26 12:32:04 -04:00
Heng Li f31705bb4a r1053: made junceval work with PAF 2021-05-26 11:54:46 -04:00
Heng Li 41d7ccb191 r1052: default -g to 5k 2021-05-24 16:46:16 -04:00
Heng Li 34a41197d7 r1051: added two internal parameters
rmq_rescue_size and rmq_rescue_ratio
2021-05-24 16:38:45 -04:00
Heng Li 9626b3e716 r1050: -r accepts two bandwidths 2021-05-24 16:29:21 -04:00
Heng Li 379728726a r1049: removed the long-join heuristics 2021-05-24 16:21:40 -04:00
Heng Li 4f91558160 r1048: rescue long gaps 2021-05-24 16:09:09 -04:00
Heng Li ec3bc6efd7 r1047: make gap penalty proportional to k-mer
closer to the older minimap2
2021-05-24 13:18:17 -04:00
Heng Li 8ec8866100 Merge branch 'master' into dev-rmq 2021-05-23 21:01:04 -04:00
Heng Li 9e7247cff9 sync python with recent changes 2021-05-23 21:00:15 -04:00
Ariel Erijman cd66777bfb small typo 2021-05-23 13:09:55 -04:00
Heng Li 5d7d25e92d Merge remote-tracking branch 'origin/master' 2021-05-23 13:08:52 -04:00
Heng Li 2a3793bbd2 clarify that map-hifi is for HEAD only
Resolves #747
2021-05-23 13:08:15 -04:00
Heng Li f97008a10e Merge branch 'master' into dev-rmq 2021-05-20 19:36:33 -04:00
Cornelius Roemer 10502e2a78 Fixed typo in Readme.md
deltion -> deletion
2021-05-14 15:38:30 -04:00
Don Kirkby 4422c0c6f9 Typo fix in Python README.
Thanks for sharing minimap2. Here's a little fix.
2021-05-14 15:38:12 -04:00
Heng Li 42a11e1d58 Changed Travis to Github Actions in README 2021-05-10 12:58:25 -04:00
Heng Li 76df351fa8 added github action 2021-05-10 12:55:58 -04:00
Heng Li d065d3bead Merge branch 'master' into dev-rmq 2021-05-10 12:42:57 -04:00
Heng Li ac146fe7bc r1035: failed to index under the --frag=yes mode
Resolves #734
2021-05-10 12:36:48 -04:00
Heng Li 6c96078ed0 r1034: changed multiple defaults; updated manpage 2021-05-03 22:51:34 -04:00
Heng Li bbb4f97e52 support RMQ 2021-05-03 09:27:04 -04:00
Heng Li b7f4d8a0f4 removed the old minimap2 chaining 2021-05-02 18:55:37 -04:00
Heng Li e81927e7a1 prepare to backport unimap/minigraph chaining 2021-05-02 18:25:49 -04:00
Heng Li f7dc5799c5 clarify CLR when necessary 2021-05-01 15:56:33 -04:00
Heng Li 817cb81cb0 Updated README for the HiFi preset 2021-05-01 15:47:25 -04:00
Heng Li 0f5608c4a4 r1028: backport minigraph -U 2021-05-01 15:41:39 -04:00
Heng Li e8823a3709 r1027: renamed hifi to map-hifi; changed default 2021-05-01 15:22:51 -04:00
Heng Li 7edeec67b0 r1026: fixed bugs in seed sampling add hifi 2021-05-01 15:07:56 -04:00
Heng Li feb92d32ea r1025: seed rescuring 2021-04-30 17:33:16 -04:00
Heng Li cdbd96be0c a bit refactoring for future changes 2021-04-30 11:24:53 -04:00
Heng Li ba52c79024 added code of conduct 2021-04-22 17:30:30 -04:00
Heng Li cd9ccfa069 r1022: check INDEL lengths in simple cases 2021-04-11 22:07:00 -04:00
Heng Li 86b716448c larger window size for longer INDELs 2021-04-11 16:08:29 -04:00
Heng Li 9ab95be1bb update END when it is not there 2021-04-11 12:59:21 -04:00
Heng Li b51e859945 make sure ins/del match 2021-04-11 11:47:14 -04:00
Heng Li a9037dc16c r1018: scripts for SV evaluation 2021-04-11 01:08:17 -04:00
Heng Li 9729fa99ad removed mappy.c 2021-04-09 13:48:16 -04:00
Heng Li b6ff332de1 Release minimap2-2.18 (r1015) 2021-04-09 13:33:34 -04:00
Heng Li 77abafaaf3 prepare for release 2021-04-09 13:18:56 -04:00
Heng Li 507d39af15 r1013: changed to a more accurate similarity est
Based on DOI:10.1101/2021.01.15.426881. One minimap2 reviewer suggested the
right formula to me but I thought the difference would be insignificant. I was
wrong.
2021-04-08 13:57:53 -04:00
Heng Li 827ca4b461 r1012: fixed an off-by-one bug; resolves #489 2021-04-07 23:31:31 -04:00
Marcus Stoiber d3dde2fdd4 Convert from spaces to tabs. 2021-04-05 11:55:10 -04:00
Marcus Stoiber 7db2e8d21a Convert python install from build_ext to setuptools setup_requires. 2021-04-05 11:55:10 -04:00
Heng Li 0b41dd26a2 r1009: fixed a compiler warning 2021-04-05 11:43:13 -04:00
Heng Li 2b47846cd6 r1008: don't parse space in BED 2021-04-05 11:41:00 -04:00
Heng Li 67dd906a80 bump travis python version to 3.9 2021-03-23 09:12:49 -04:00
Heng Li 1b0bb7b0ba require overlap ratio when considering centromere 2021-03-11 19:11:44 -05:00
Heng Li 1c4b7e8a48 explained --junc-bed in README 2021-03-06 19:44:24 -05:00
Heng Li ecbc399fa2 improved sveval 2021-03-06 19:44:13 -05:00
Heng Li 4dfd495cc2 added sveval 2021-02-15 14:49:36 -05:00
Heng Li 194b457e79 option to print errors only 2021-02-07 12:58:03 -05:00
Heng Li 75c8933511 evaluate large-scale misjoins 2021-02-07 12:34:13 -05:00
Heng Li 1025993469 print number of errors on each read 2021-01-29 14:08:21 -05:00
Heng Li a3253d1a6b added a command for simple VCF statistics 2021-01-14 12:24:38 -05:00
Heng Li 2da649d1d7 Merge remote-tracking branch 'origin/master' 2020-11-15 18:47:15 -05:00
Heng Li f995f55610 added --mask-len for #659 2020-08-21 11:12:50 -04:00
Armin Töpfer c9874e2dc5 Initialize r->p if ez->zdropped 2020-06-12 09:22:18 -04:00
Heng Li 28a37a017a added utg error correction 2020-05-01 00:45:05 -04:00
Heng Li ccb0f7b05d added a new Makefile for simde 2020-04-25 22:43:29 -04:00
mbrcic 66db9da7d8 changed preprocessor conditionals for SIMDe 2020-04-22 19:50:59 +02:00
Heng Li cd2b19035b r987: position on for strand wrongly outputted 2020-04-22 10:31:25 -04:00
Heng Li 9c0e2c67f8 r986: don't estimate dv with --qstrand 2020-04-21 13:21:03 -04:00
Heng Li da7109fd29 r985: optionally report cs/cg on the query strand
PAF only; not well tested
2020-04-21 12:37:35 -04:00
mbrcic 2b3403f094 fix for Neon after test. 2020-04-21 02:08:21 +02:00
mbrcic 3e16e4e39d Added documentation entry for added functionality, simde and no_simd. 2020-04-21 01:36:19 +02:00
mbrcic f47e8a525e SIMDe made optional. Include paths changes for SIMDe. 2020-04-21 01:08:32 +02:00
mbrcic c172df7d2d fix for Neon 2020-04-20 21:14:15 +02:00
mbrcic 9e6fdd376b Changed sse2neon with SIMDe. Added building non-SIMD version. 2020-04-20 18:28:06 +02:00
Heng Li 29f67a1666 r982: more accurate sum; output errors 2020-04-14 16:18:53 -04:00
Heng Li adde608a42 Merge remote-tracking branch 'refs/remotes/origin/master' 2020-04-14 15:52:57 -04:00
Heng Li f10dff78dc r981: asmgene to check duplicate genes 2020-04-14 15:52:36 -04:00
Jun Aruga d97bba9f27 travis: added arm64 test. 2020-04-13 08:33:03 -04:00
Heng Li 50775362bb r980: support auNGA 2020-04-10 21:36:59 -04:00
Heng Li 0a5e386359 r979: fixed asmgene wrong report. Resolves #581. 2020-04-06 19:57:15 -04:00
Heng Li cb56fb762a Merge branch 'master' of github.com:lh3/minimap2 2020-03-22 19:17:01 -04:00
Heng Li e2451e497a r975: asmstat without CIGAR/NM 2020-03-22 19:16:43 -04:00
Jared Simpson d2de282d21 remove second definition of kstring 2020-03-02 13:18:37 -05:00
Jared Simpson 48cb80ea94 change kstring_t integer storage size
This is for compatibility with kstring_t in htslib.
2020-02-28 09:35:51 -05:00
Heng Li 6a4b9f9082 r974: more informative msg on wrong FASTQ records
Resolves #510
2020-01-21 10:56:59 -05:00
Heng Li a7a01fe5bd r973: fixed compiling errors caused 2020-01-21 10:43:31 -05:00
Heng Li 9dceae59a0 r972: renamed --alt-diff to --alt-drop 2020-01-21 10:33:39 -05:00
Heng Li 20a3987082 Merge branch 'master' into alt 2020-01-21 09:17:50 -05:00
Heng Li eb3ed6993d support ALT mapping 2020-01-21 09:17:50 -05:00
Heng Li 7996f04008 r972: fixed negative de:f caused by ambiguous base 2020-01-21 09:14:37 -05:00
Heng Li d2e14705e7 r968: allow large mini_batch; resolves #491 2020-01-18 12:24:44 -05:00
Heng Li 24f50f38e8 r967: no duplicated @SQ lines with --split-prefix
resolves #527 and #400
2020-01-18 12:01:28 -05:00
Heng Li 04e015d803 r966: minimap2 returns 1 on file failure (#532) 2020-01-18 10:58:59 -05:00
Heng Li 040f74102c r965: added --chain-gap-scale for #540 2020-01-18 10:29:33 -05:00
Heng Li cdb7857841 r963: --junc-bonus not working; resolves #513 2020-01-06 22:03:50 -05:00
Heng Li 3c0d05d272 r962: abort given wrong RG line; resolves #541 2020-01-06 21:53:21 -05:00
Heng Li 47b646acbf r961: print indexed length 2020-01-06 21:13:33 -05:00
Heng Li a79cb3e991 Merge remote-tracking branch 'origin/master' 2019-12-23 17:33:56 -05:00
Heng Li 367aed4271 added the asan and tsan targets to Makefile 2019-12-23 17:33:10 -05:00
xdudiagnoa 081df6ac7d Fix example.c seq read logic
for every idx should map all input seqs
2019-11-11 00:46:07 -05:00
Torsten Seemann a3e7a575fb Add splice:hq to --help 2019-11-11 00:45:13 -05:00
Heng Li d90583b83c r954: fixed two potential undef behaviors (#443) 2019-07-18 09:17:08 -04:00
Heng Li 7fc03b0c32 r953: krealloc is buggy
Its use in minimap2 didn't trigger the bug, so the older minimap2 is still ok.
2019-07-18 09:13:30 -04:00
John Marshall 20c104ce8d Report errno on file opening failures and I/O errors
Add the underlying operating system error (usually "No such file" or
"Out of space" respectively, but highly informative when it is not)
to these error messages.
2019-07-17 09:04:02 -04:00
Marcus Stoiber 238b6bb3ea Fix memory leak in mappy.aligner.map. 2019-07-08 09:50:54 -04:00
Heng Li e026e18439 added the description of "SA" tag. Closes #438 2019-07-01 09:18:33 -04:00
Heng Li 58c2251b18 compatibility with GenBank GTP (resolves $422) 2019-06-11 09:16:03 -04:00
Heng Li 03dc8d5d97 test if index is built for #413 2019-06-07 09:11:11 -04:00
Heng Li 5cb61f8ee6 added FAQ 2019-06-06 10:47:33 -04:00
Heng Li c16a1742a3 Er... Tavis doesn't have python 3.7. 2019-05-11 20:06:48 -04:00
Heng Li 4bd5a018c2 test python 3.7 instead of 3.6 2019-05-11 20:05:06 -04:00
Heng Li 05974c80f1 r943: allow long ref name for --split-index
Resolved #394.
2019-05-10 15:39:41 -04:00
Heng Li 7bc87b4175 Release minimap2-2.17 (r941) 2019-05-04 23:49:17 -04:00
Heng Li 6762368cf0 r940: added the splice:hq preset
for high-quality CCS/mRNA splice alignment
2019-05-04 14:00:31 -04:00
Heng Li c2aec88b84 r938: added --sam-hit-only; resolved #377 2019-04-30 22:40:36 -04:00
Heng Li 97f67a2a0a r937: enlarge mm_mapopt_t::flag to 64 bits 2019-04-30 22:30:32 -04:00
Heng Li 189555503a potentially fix issue #372
Needs someone to confirm
2019-04-30 21:49:51 -04:00
Heng Li 69af86657e r935: fixed a cigar like 5I6D7I; resolved #392 2019-04-30 21:35:24 -04:00
Heng Li 49c6d83a8e r934: --junc-bed to read BED12 2019-04-28 20:12:28 -04:00
Heng Li f64e426a5a r933: resume versioning 2019-04-28 17:05:37 -04:00
Heng Li 2bb8cbbeef updated manpage 2019-04-28 17:02:49 -04:00
Heng Li e80759c97a --junc-bed apparently working
Also fixed an issue with splice alignment in the reverse strand, though this
should have a very minor effect in practice.
2019-04-28 16:47:12 -04:00
Heng Li f4c844b143 fixed a few simple bugs and leaks 2019-04-28 16:47:12 -04:00
Heng Li be171aa2dc implemented in exts; testing is the next 2019-04-28 16:47:12 -04:00
Heng Li cdc730d573 gff2bed to output junction BED 2019-04-28 16:47:12 -04:00
Heng Li 6420acca6d BED I/O 2019-04-28 16:47:12 -04:00
John Marshall 371bc9513a SAM TLEN should be 0 when either read is unmapped
this_rid/this_pos will be copied from r_prev(=r_next)'s values when this
read is unmapped (i.e., r is NULL). In this case, we can write RNEXT as
'=' but should not calculate TLEN from these placeholder values.
Similarly when the mate is unmapped (i.e., r_next is NULL).

Fixes #365.
2019-04-05 09:36:46 -04:00
Heng Li 169216bfff manpage was wrongly marked as "dirty" 2019-02-28 15:58:12 -05:00
Heng Li 6b391e3373 Release minimap2-2.16 (r922) 2019-02-28 15:49:24 -05:00
Heng Li 55e39c2d30 r921: output unmapped reads in full PAF 2019-02-27 15:03:19 -05:00
Kevin Chan 90b7b83ec7 fix typo in command line help 2019-02-27 14:46:57 -05:00
Heng Li d431dc0181 r917: added --max-chain-iter to avoid worst case
Resolves #324
2019-02-27 14:41:01 -05:00
Heng Li ccf1680aaf make it explicit that -x is preferred for prebuilt 2019-02-27 12:43:33 -05:00
Heng Li ea84fc0a53 r917: fixed a bug in command-line parsing
Resolves #344
2019-02-27 11:22:58 -05:00
Heng Li 19208fb06b r916: support long cs in sam-to-paf conversion 2019-02-17 09:35:23 -05:00
Heng Li e02bebd96d r915: fixed a bug caused by the latest change 2019-02-14 10:04:04 -05:00
Heng Li 32ab6ce15b r914: fixed two harmless division by 0
Resolves #326
2019-02-12 19:30:49 -05:00
Heng Li 1739a260fb r913: output tag "rl", length of unseedable regs 2019-02-05 14:19:17 -05:00
Heng Li aaf3233818 added mappy.Aligner.seq_names to return seq names
Resolves #312
2019-01-29 12:53:20 -05:00
Heng Li 8b05880f73 r911: option -o to output to file (#319) 2019-01-29 10:42:20 -05:00
Heng Li eba237f39d r910: meaningful error message (#320)
when minimap2 fails to create temporary files
2019-01-29 10:29:27 -05:00
Heng Li a8e1e3cbb8 updated citation with page numbers 2019-01-26 17:59:36 -05:00
Heng Li 597212b9f3 r908: added an assertion to detect a potential bug
as in #311
2019-01-23 11:18:50 -05:00
Heng Li 30abcf3cf9 r907: copy tag "cs" in sam2paf
Resolves #310
2019-01-13 17:52:31 -05:00
Heng Li 48e230f40d r906: de tag is wrongly calculated given "N"
Resolves #309
2019-01-11 19:39:09 -05:00
Heng Li c404f49569 Release minimap2-2.15 (r905) 2019-01-10 12:34:45 -05:00
Heng Li cf2bae6e9b r904: fixed a corner-case segfault. Resolves #307. 2019-01-10 09:57:05 -05:00
Heng Li 5b2fdfff9c r895: option in asmgene to count autosomal only 2018-12-14 10:36:47 -05:00
Heng Li ea2b1c5b2a r894: added --max-qlen to filter out long query 2018-12-12 12:27:32 -05:00
Heng Li eef1cee9b7 r893: added paftools.js vcfpair 2018-12-01 18:53:03 -05:00
Heng Li 2c52364527 r892: avoid de:f:0.0000 2018-11-24 21:54:28 -05:00
Heng Li 128476efc9 r891: compute gap-compressed divergence 2018-11-24 21:50:49 -05:00
Heng Li 1b3a6a0fe5 r890: removed "register" (#261) 2018-11-19 13:57:31 -05:00
Heng Li 83a8ee7038 r888: fixed incorrect CIGAR when --eqx in use
This was caused by mm_fix_cigar() which may change query/target offset in very
rare cases. Generating EQX has to beware of this change.

Resolves #266
2018-11-18 14:22:29 -05:00
Heng Li 62bbadf668 r887: fixed a bug in asmgene 2018-11-11 21:35:19 -05:00
Heng Li 91f548b497 r886: fixed two minor typos
Resolves #264
Resolves #265
2018-11-08 12:04:14 -05:00
Heng Li cdaf46665a r885: compute dup with asmstat 2018-11-07 00:26:05 -05:00
Heng Li 6596c63dcd r884: for C++ compatibility (#261) 2018-11-06 22:07:11 -05:00
Heng Li 59f23f7579 Release minimap2-2.14 (r883) 2018-11-06 00:03:16 -05:00
Heng Li 5e55e397e9 r882: guard against -E0 (#263) 2018-11-05 23:36:12 -05:00
Heng Li 88c421e8de r881: a recent change reduces sr accuracy 2018-11-05 22:03:59 -05:00
Heng Li 3db5bfe6e5 r880: fixed false wrong FASTA/Q alert 2018-11-05 20:52:07 -05:00
Heng Li 83dfdd5f50 draft release note 2018-11-05 20:07:57 -05:00
Heng Li 8a2b1cd4c9 updated mappy for extra option max_sw_mat 2018-11-05 19:28:44 -05:00
Heng Li 1ede8ca170 r877: renamed cap-sw-mat to cap-sw-mem 2018-11-05 11:46:38 -05:00
Heng Li 13981404e2 r876: skip DP if taking too much RAM (#259) 2018-11-05 11:43:10 -05:00
Heng Li fd64dd26f6 r875: warn given incorrect FASTA/Q
resolves #252
resolves #255
2018-11-05 10:02:44 -05:00
Heng Li 24df95e4b8 r874: don't call x86_simd() so often
This takes a few percent of time in profiler.
2018-11-05 09:20:35 -05:00
Heng Li a8ee48c2ce r873: comforming to C99/C11; resolves #261 2018-11-05 08:25:07 -05:00
Heng Li 09e089c3dc r872: choose the longest isoform 2018-11-04 23:48:50 -05:00
Heng Li e46cbb7d84 r871: print erroneous genes 2018-11-04 20:37:06 -05:00
Heng Li 57ec73ec6c r870: separate <50% and <10% 2018-11-04 19:31:25 -05:00
Heng Li 9e27575387 r869: classify incomplete genes 2018-11-04 19:21:55 -05:00
Heng Li b4ad8d8bf0 added asmgene
improvements coming; not made public yet
2018-11-04 17:24:05 -05:00
Heng Li e315b9fada hidden options to control bp calculation 2018-11-04 16:36:04 -05:00
Heng Li 42baf287a4 r866: fixed a typo; resolves #262 2018-10-30 09:11:55 -04:00
Heng Li 2ceba22a7a fixed a typo in manpage 2018-10-28 11:51:02 -04:00
Heng Li 9ed56b4a25 r860: MD/cs not working with --eqx 2018-10-26 23:23:53 -04:00
Heng Li ecb6c5c36c Document --no-pairing (#256) 2018-10-23 10:00:21 -04:00
Heng Li 377c7099a8 r858: fixed a bug; resolves #254 2018-10-22 22:47:11 -04:00
Heng Li 51e2abfa60 clarify that minimap2 may miss small exons 2018-10-22 11:16:16 -04:00
Heng Li 7b0a49732e r856: wrongly reported for an unrecognized option
Resolved #250
2018-10-19 20:07:14 -04:00
Heng Li 20268a6068 updated the copyright holder 2018-10-18 11:11:17 -04:00
Heng Li d04ac068fd r852: a minor when large --end-bonus is in use
We may use a large --end-bonus to mimic end-to-end alignment. In the short-read
mode, the candidate alignment region may be out of the band, which leads to
truncated alignment.
2018-10-15 21:28:27 -04:00
Heng Li 5d5d392c02 Release minimap2-2.13 (r850) 2018-10-11 13:18:31 -04:00
Heng Li 170863e553 r849: option -P doesn't work
I don't know why I haven't found it at the beginning.
2018-10-04 16:11:59 -04:00
Heng Li 97f97306a4 r847: guard against -N0 2018-09-27 15:13:44 -04:00
Heng Li 1077b7ddc8 r846: added --hard-mask-level for #244 2018-09-27 14:46:26 -04:00
Heng Li c57b59f02f r845: log peak memory 2018-09-23 20:27:49 -04:00
Torsten Seemann 34be359e25 Add -s sample option for VCF output 2018-09-19 18:24:47 -04:00
Heng Li 8b12da8b0f removed a useless dependency (not in repo) 2018-09-17 13:59:25 -04:00
Heng Li c63a33904f r836: fixed an integer overflow
Forgot this one.
2018-09-14 23:29:31 -04:00
Heng Li 70b0fede64 r835: improved help message. Resolved #232 2018-09-14 22:29:25 -04:00
Heng Li 0b681e51e7 Merge remote-tracking branch 'remotes/origin/master' 2018-09-14 22:22:20 -04:00
Heng Li 7d80d6de4a r832: fixed outdated -L. Resolved #231 and #233 2018-09-14 22:21:33 -04:00
Chris Rands 791e89ce0f PEP8 and other minor styles changes 2018-09-12 10:58:56 -04:00
Heng Li 98c48a1c45 Fixed wrong version links in the cookbook 2018-09-03 09:07:34 -04:00
Heng Li 63d397120a removed getopt.c from MANIFEST 2018-09-01 21:30:46 -04:00
Heng Li 7998fe9906 r829: replaced musl's getopt with ketopt 2018-09-01 21:18:02 -04:00
Heng Li 3a119d606f r828: --MD to support spliced alignment 2018-08-22 10:47:45 -04:00
Heng Li a5eafb75f9 Release minimap2-2.12 (r827) 2018-08-06 12:44:39 -04:00
Heng Li 9a567e4b37 allow mappy to change scoring 2018-08-06 09:52:13 -04:00
Heng Li 8e606bcc06 added a -C5 example to Getting Started 2018-08-06 09:08:33 -04:00
Heng Li a1b7219b5d explain added parameters 2018-08-05 21:32:05 -04:00
Heng Li b0f39a1a61 r823: mappy to index a single sequence 2018-08-05 20:57:05 -04:00
Heng Li 5ab6538757 r822: added option --no-end-flt 2018-08-05 19:42:12 -04:00
Heng Li b32296e18f r821: fixed memory when -y is used 2018-07-31 15:14:37 -04:00
Heng Li 99ecdf7b5d mappy to support arm64 (#203) 2018-07-24 23:53:02 -04:00
Heng Li ff9917a1c4 r819: mappy to support cs/MD 2018-07-24 23:29:55 -04:00
Mark Bicknell 8c064a5f29 Fixed mm_idx_is_idx to return the correct result on Windows. 2018-07-17 09:16:33 -04:00
Heng Li 0e137670fc Merge branch 'split' 2018-07-15 22:24:15 -04:00
Heng Li 395c8d678a r815: fixed a memory leak 2018-07-15 22:11:32 -04:00
Heng Li 830da7fa27 r814: resumed versioning 2018-07-15 11:48:14 -04:00
Heng Li a655cbef86 print SAM header; remove tmp files 2018-07-15 11:03:18 -04:00
Heng Li 4b707aac92 working with toy examples 2018-07-15 10:55:00 -04:00
Heng Li 951c0d1d35 apparently mm_append_cigar() wastes some memory 2018-07-14 23:47:44 -04:00
Heng Li 3545e35a42 pairing in the split-idx mode 2018-07-14 23:43:34 -04:00
Heng Li f3417da838 bugfix: unmapped records are duplicated in output 2018-07-14 22:54:05 -04:00
Heng Li e5277dbf5c code backup 2018-07-14 22:52:36 -04:00
Heng Li 1a55227d5a write hits to tmp files (unfinished) 2018-07-14 12:15:10 -04:00
Heng Li 5cfa621b2d use unmapped records 2018-07-07 12:49:15 -05:00
Heng Li a609a07f8c optionally output unmapped query in PAF 2018-07-07 10:26:08 -05:00
Heng Li bcf92b3c46 compute query coverage 2018-07-06 21:52:01 -05:00
Heng Li 097378ab90 reworked break point counting 2018-07-06 09:46:26 -04:00
Heng Li 10bbbe28c5 added asmstat 2018-07-05 13:22:32 -04:00
Hyeshik Chang c92a6866f3 Release the GIL to allow native Python threading. 2018-07-05 08:00:27 -04:00
Maël Kerbiriou 6908dc59a5 --splice implied when searching for splicing sites on single strand 2018-07-05 07:41:26 -04:00
Heng Li 50dae10421 paftools call to show statistics on longer indels 2018-07-03 14:28:09 -04:00
Heng Li 0517972d02 Release minimap2-2.11 (r797) 2018-06-21 00:04:08 -04:00
Heng Li d46e68e6ad r796: don't use ssize_t 2018-06-20 12:45:27 -04:00
Heng Li 2584a4149a r295: use -r2000 for ava-ont, NOT for ava-pb 2018-06-20 12:24:43 -04:00
Heng Li 66674afd09 r794: fixed a bug in seed filtering 2018-06-20 10:26:29 -04:00
Heng Li e9ca0c9dab added __version__; resolved #165
Not sure if this is the right way. Apparently working.
2018-06-19 15:40:26 -04:00
Heng Li 7e6e8ca73f r792: fixed -Wextra warnings and resolved #184 2018-06-19 15:26:58 -04:00
Ilya Kolpakov 408e098859 fix deserialization of zero-length reference names 2018-06-19 14:46:05 -04:00
Ilya Kolpakov 57f37551f8 expose mm_idx_is_idx, mm_idx_load and mm_idx_dump 2018-06-19 14:46:05 -04:00
Ilya Kolpakov 4c66b689c3 fix serialization of empty names in mm_idx_dump 2018-06-19 14:46:05 -04:00
mvdbeek 1bde2cf076 Allow setting max_frag_len on a per alignment level 2018-06-19 14:39:30 -04:00
mvdbeek 31fc0f218a Allow setting max_frag_len parameter in Aligner class 2018-06-19 14:39:30 -04:00
Aaron Wenger 3d3bcc29a8 Fix CIGAR reallocation with --eqx
Fix the logic that calculates the number of CIGAR entries when
match "M" entries are expanded into "=" and "X".  The number
of entries depends not on the number of mismatches but rather
on the number of transitions between "=" to "X".
2018-06-19 14:37:41 -04:00
Hasindu Gamaarachchi 99dcd75f64 added support for 64 bit ARM architectures 2018-06-19 14:28:45 -04:00
Heng Li 154d2caf5b r784: support the =/X CIGAR operators (#156) 2018-05-30 16:11:22 -04:00
Heng Li a3afeec0b2 r783: reverted to r781 (#155) 2018-05-30 15:25:34 -04:00
Heng Li 3573784b4d r782: no mask a chain having long ref ovlp (#155) 2018-05-30 13:53:45 -04:00
Heng Li 872f300955 r781: fixed the buggy heapmerge (resolves #166) 2018-05-30 11:55:14 -04:00
Heng Li d7b61a039e updated citation 2018-05-30 11:11:55 -04:00
Heng Li 248158a3e1 Resolved #168: citing the manpage for cs 2018-05-30 11:03:16 -04:00
Heng Li 9f4309c376 r777: avoid skipping too many seeds 2018-05-11 10:25:18 -04:00
Heng Li 463f9309f9 Merge branch 'hot-fix' into fix-long-gap 2018-05-11 10:13:19 -04:00
Heng Li abe989e355 the previous fix on int overflow is incomplete 2018-05-11 10:12:57 -04:00
Heng Li 881b4ca3a2 r774: Merge branch 'hot-fix' into fix-long-gap 2018-05-11 10:02:17 -04:00
Heng Li 10c6dd2551 r773: fixed an integer overflow 2018-05-11 10:01:23 -04:00
Heng Li 7ec6721c44 r772: option -Y not working 2018-05-11 10:00:11 -04:00
Heng Li e61812ee55 reduced gap len to trigger bad seed filtering 2018-05-01 16:17:21 -04:00
Heng Li 734ac379bb r770: matching N bases not working properly (#155) 2018-04-30 19:55:23 -04:00
Heng Li 759f8e4ac9 r769: filter out seeds breaking long gaps 2018-04-24 15:37:37 -04:00
Heng Li aef7b0744c r768: shortened preset; added dv tag (#25)
Also added asm20 to command line help (#151)
2018-04-24 12:48:54 -04:00
Heng Li 39f836eac8 r767: don't crash when there is no "cg" (#153) 2018-04-24 12:32:37 -04:00
Heng Li cbeb86dad6 Merge remote-tracking branch 'origin/master' 2018-04-10 09:12:26 -04:00
Heng Li 372c90ceb5 r764: fixed incorrect inversion mapq (#148) 2018-04-10 09:11:49 -04:00
apregier 2e2e69107c Small bugfix for paftools.js
The bug resulted in the wrong coverage being printed in some cases.
2018-04-04 16:29:54 -04:00
Heng Li ee4cd089f7 r763: fine control long join flank len (#128) 2018-03-29 14:16:58 -04:00
Heng Li 2d7ec75d50 Release minimap2-2.10 (r761) 2018-03-27 11:45:44 -04:00
Heng Li 7938ed4893 fixed two mappy warnings 2018-03-26 15:12:54 -04:00
Heng Li 4740423afa Merge remote-tracking branch 'origin/master' 2018-03-26 14:37:17 -04:00
Heng Li 1776311a9b updated cookbook 2018-03-26 14:37:02 -04:00
Heng Li c1a3e05cb0 Merge pull request #138 from zingdle/patch-1
Fix typo in README.md
2018-03-26 07:50:39 -04:00
zingdle ecb6703d4a Update README.md
Fix typo.
TD;DR -> TL;DR
2018-03-26 14:54:52 +08:00
Heng Li 0bf97a367b r755: junceval to only evaluate chromosomes 2018-03-24 23:10:06 -04:00
Heng Li 1c504d72e4 r754: option to only change name 2018-03-23 12:27:11 -04:00
Heng Li 5ef9580b17 r753: change bandwidth in ava-ont to 2000bp 2018-03-23 10:15:23 -04:00
Heng Li 08bd2123b6 r752: option to copy comments to output (#136) 2018-03-23 10:04:33 -04:00
Heng Li 8766d286df r751: optionally output MD (#118) 2018-03-22 14:15:33 -04:00
Heng Li 623b5d9d48 r750: check puts() return (#132 & #103) 2018-03-22 11:31:58 -04:00
Heng Li 18659118cd r749: don't print version etc at low verbose 2018-03-22 11:10:55 -04:00
Heng Li d1050f4eaf r748: optionally to use system getopt() (#134) 2018-03-19 11:18:26 -04:00
Heng Li b81d45510e Revision v2 2018-03-16 11:18:06 -04:00
Heng Li d135feb1a5 response to reviewers' comments, round 2 2018-03-15 21:59:57 -04:00
Heng Li 242ff4e91d r745: junceval - recognize "-" as file name 2018-03-15 12:51:46 -04:00
Heng Li 7a0c1316ce added more examples to cookbook 2018-03-12 22:24:22 -04:00
Heng Li 77ebd479f4 r743: added VCF output to "call" 2018-03-12 21:51:31 -04:00
Heng Li e3f226a9d9 working on section "Full-Genome Alignment"
found an apparent bug in paftools.js call. To debug...
2018-03-12 16:12:18 -04:00
Heng Li bdc615c1d4 r741: added --min-occ-floor to improve #107 2018-03-12 14:32:27 -04:00
Heng Li ad1beaf255 backup; not finished 2018-03-12 13:20:25 -04:00
Heng Li de0480ac5b finished section "Read Overlap" 2018-03-12 13:05:51 -04:00
Heng Li f2866533a8 finished "mapping genomic reads" 2018-03-12 12:50:21 -04:00
Heng Li 0173850ef0 don't use bullets - they are hard to read 2018-03-12 12:42:13 -04:00
Heng Li acea3594fb updated cookbook 2018-03-12 12:39:57 -04:00
Heng Li f78a247749 Started to work on a cookbook 2018-03-12 12:00:44 -04:00
Heng Li ccaf12e1a2 r734: removed debugging print in call() 2018-03-09 23:46:21 -05:00
Heng Li 96b132c97d fixed a bug/typo in Aligner.seq() (#126) 2018-03-08 19:12:12 -05:00
Heng Li 70428ca3a8 speedup tag parsing for sam2paf 2018-03-02 10:17:55 -05:00
Heng Li 9aea79d621 faster tag parsing 2018-03-02 10:09:14 -05:00
Heng Li 1770988627 make calling work with sam2paf output 2018-03-02 10:03:06 -05:00
Heng Li 2bfdad34bb minor cleanup to last commit 2018-03-02 01:07:37 -05:00
Heng Li 953766cedd generate cs; not carefully tested 2018-03-02 00:14:55 -05:00
Heng Li dc61301d9f sam2paf cleanup 2018-03-01 21:58:12 -05:00
Heng Li 19e05a099d for clarity 2018-03-01 18:25:29 -05:00
Heng Li 0238caa8b1 clarify minimap2 not working for >2Gbp seq #129 2018-03-01 18:23:40 -05:00
Heng Li a22ebb9836 use SSE compiler flags more precisely (#127) 2018-02-26 09:51:01 -05:00
60 changed files with 6501 additions and 1412 deletions
+21
View File
@@ -0,0 +1,21 @@
name: CI
on:
push:
branches:
- master
pull_request:
jobs:
build:
runs-on: ubuntu-latest
strategy:
matrix:
compiler: [gcc, clang]
steps:
- name: Checkout minimap2
uses: actions/checkout@v2
- name: Compile with ${{ matrix.compiler }}
run: make CC=${{ matrix.compiler }}
+3
View File
@@ -0,0 +1,3 @@
[submodule "lib/simde"]
path = lib/simde
url = https://github.com/nemequ/simde.git
+5 -1
View File
@@ -6,6 +6,10 @@ matrix:
- language: c - language: c
compiler: clang compiler: clang
script: make script: make
- arch: arm64
language: c
compiler: gcc
script: make arm_neon=1 aarch64=1
- language: python - language: python
python: "2.7" python: "2.7"
before_install: pip install cython before_install: pip install cython
@@ -15,6 +19,6 @@ matrix:
before_install: pip install cython before_install: pip install cython
script: python setup.py build_ext script: python setup.py build_ext
- language: python - language: python
python: "3.6" python: "3.9"
before_install: pip install cython before_install: pip install cython
script: python setup.py build_ext script: python setup.py build_ext
+46
View File
@@ -0,0 +1,46 @@
#### 1. Alignment different with option `-a` or `-c`?
Without `-a`, `-c` or `--cs`, minimap2 only finds *approximate* mapping
locations without detailed base alignment. In particular, the start and end
positions of the alignment are impricise. With one of those options, minimap2
will perform base alignment, which is generally more accurate but is much
slower.
#### 2. How to map Illumina short reads to noisy long reads?
No good solutions. The better approach is to assemble short reads into contigs
and then map noisy reads to contigs.
#### 3. The output SAM doesn't have a header.
By default, minimap2 indexes 4 billion reference bases (4Gb) in a batch and map
all reads against each reference batch. Given a reference longer than 4Gb,
minimap2 is unable to see all the sequences and thus can't produce a correct
SAM header. In this case, minimap2 doesn't output any SAM header. There are two
solutions to this issue. First, you may increase option `-I` to, for example,
`-I8g` to index more reference bases in a batch. This is preferred if your
machine has enough memory. Second, if your machines doesn't have enough memory
to hold the reference index, you can use the `--split-prefix` option in a
command line like:
```sh
minimap2 -ax map-ont --split-prefix=tmp ref.fa reads.fq
```
This second approach uses less memory, but it is slower and requires temporary
disk space.
#### 4. The output SAM is malformatted.
This typically happens when you use nohup to wrap a minimap2 command line.
Nohup is discouraged as it breaks piping. If you have to use nohup, please
specify an output file with option `-o`.
#### 5. How to output one alignment per read?
You can use `--secondary=no` to suppress secondary alignments (aka multiple
mappings), but you can't suppress supplementary alignment (aka split or
chimeric alignment) this way. You can use samtools to filter out these
alignments:
```sh
minimap2 -ax map-out ref.fa reads.fq | samtools view -F0x900
```
However, this is discouraged as supplementary alignment is informative.
+2 -1
View File
@@ -1,6 +1,7 @@
The MIT License The MIT License
Copyright (c) 2017 Broad Institute, Inc. Copyright (c) 2018- Dana-Farber Cancer Institute
2017-2018 Broad Institute, Inc.
Permission is hereby granted, free of charge, to any person obtaining Permission is hereby granted, free of charge, to any person obtaining
a copy of this software and associated documentation files (the a copy of this software and associated documentation files (the
+1 -2
View File
@@ -1,10 +1,9 @@
include *.h include *.h
include Makefile include Makefile
include ksw2_dispatch.c include ksw2_dispatch.c
include getopt.c
include main.c include main.c
include README.md include README.md
include python/mappy.c include sse2neon/emmintrin.h
include python/cmappy.h include python/cmappy.h
include python/cmappy.pxd include python/cmappy.pxd
include python/mappy.pyx include python/mappy.pyx
+55 -32
View File
@@ -1,21 +1,37 @@
CFLAGS= -g -Wall -O2 -Wc++-compat CFLAGS= -g -Wall -O2 -Wc++-compat #-Wextra
CPPFLAGS= -DHAVE_KALLOC CPPFLAGS= -DHAVE_KALLOC
INCLUDES= INCLUDES=
OBJS= kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o options.o index.o chain.o align.o hit.o map.o format.o pe.o esterr.o ksw2_ll_sse.o OBJS= kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o options.o index.o \
lchain.o align.o hit.o seed.o map.o format.o pe.o esterr.o splitidx.o \
ksw2_ll_sse.o
PROG= minimap2 PROG= minimap2
PROG_EXTRA= sdust minimap2-lite PROG_EXTRA= sdust minimap2-lite
LIBS= -lm -lz -lpthread LIBS= -lm -lz -lpthread
ifeq ($(arm_neon),) ifeq ($(arm_neon),) # if arm_neon is not defined
ifeq ($(sse2only),) ifeq ($(sse2only),) # if sse2only is not defined
OBJS+=ksw2_extz2_sse41.o ksw2_extd2_sse41.o ksw2_exts2_sse41.o ksw2_extz2_sse2.o ksw2_extd2_sse2.o ksw2_exts2_sse2.o ksw2_dispatch.o OBJS+=ksw2_extz2_sse41.o ksw2_extd2_sse41.o ksw2_exts2_sse41.o ksw2_extz2_sse2.o ksw2_extd2_sse2.o ksw2_exts2_sse2.o ksw2_dispatch.o
else else # if sse2only is defined
OBJS+=ksw2_extz2_sse.o ksw2_extd2_sse.o ksw2_exts2_sse.o OBJS+=ksw2_extz2_sse.o ksw2_extd2_sse.o ksw2_exts2_sse.o
endif endif
else else # if arm_neon is defined
OBJS+=ksw2_extz2_neon.o ksw2_extd2_neon.o ksw2_exts2_neon.o OBJS+=ksw2_extz2_neon.o ksw2_extd2_neon.o ksw2_exts2_neon.o
CFLAGS+=-D_FILE_OFFSET_BITS=64 -mfpu=neon -fsigned-char
INCLUDES+=-Isse2neon INCLUDES+=-Isse2neon
ifeq ($(aarch64),) #if aarch64 is not defined
CFLAGS+=-D_FILE_OFFSET_BITS=64 -mfpu=neon -fsigned-char
else #if aarch64 is defined
CFLAGS+=-D_FILE_OFFSET_BITS=64 -fsigned-char
endif
endif
ifneq ($(asan),)
CFLAGS+=-fsanitize=address
LIBS+=-fsanitize=address
endif
ifneq ($(tsan),)
CFLAGS+=-fsanitize=thread
LIBS+=-fsanitize=thread
endif endif
.PHONY:all extra clean depend .PHONY:all extra clean depend
@@ -28,8 +44,8 @@ all:$(PROG)
extra:all $(PROG_EXTRA) extra:all $(PROG_EXTRA)
minimap2:main.o getopt.o libminimap2.a minimap2:main.o libminimap2.a
$(CC) $(CFLAGS) main.o getopt.o -o $@ -L. -lminimap2 $(LIBS) $(CC) $(CFLAGS) main.o -o $@ -L. -lminimap2 $(LIBS)
minimap2-lite:example.o libminimap2.a minimap2-lite:example.o libminimap2.a
$(CC) $(CFLAGS) $< -o $@ -L. -lminimap2 $(LIBS) $(CC) $(CFLAGS) $< -o $@ -L. -lminimap2 $(LIBS)
@@ -37,31 +53,36 @@ minimap2-lite:example.o libminimap2.a
libminimap2.a:$(OBJS) libminimap2.a:$(OBJS)
$(AR) -csru $@ $(OBJS) $(AR) -csru $@ $(OBJS)
sdust:sdust.c getopt.o kalloc.o kalloc.h kdq.h kvec.h kseq.h sdust.h sdust:sdust.c kalloc.o kalloc.h kdq.h kvec.h kseq.h ketopt.h sdust.h
$(CC) -D_SDUST_MAIN $(CFLAGS) $< getopt.o kalloc.o -o $@ -lz $(CC) -D_SDUST_MAIN $(CFLAGS) $< kalloc.o -o $@ -lz
# SSE-specific targets on x86/x86_64 # SSE-specific targets on x86/x86_64
ifeq ($(arm_neon),) # if arm_neon is defined, compile this target with the default setting (i.e. no -msse2)
ksw2_ll_sse.o:ksw2_ll_sse.c ksw2.h kalloc.h
$(CC) -c $(CFLAGS) -msse2 $(CPPFLAGS) $(INCLUDES) $< -o $@
endif
ksw2_extz2_sse41.o:ksw2_extz2_sse.c ksw2.h kalloc.h ksw2_extz2_sse41.o:ksw2_extz2_sse.c ksw2.h kalloc.h
$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@ $(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
ksw2_extz2_sse2.o:ksw2_extz2_sse.c ksw2.h kalloc.h ksw2_extz2_sse2.o:ksw2_extz2_sse.c ksw2.h kalloc.h
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@ $(CC) -c $(CFLAGS) -msse2 -mno-sse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
ksw2_extd2_sse41.o:ksw2_extd2_sse.c ksw2.h kalloc.h ksw2_extd2_sse41.o:ksw2_extd2_sse.c ksw2.h kalloc.h
$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@ $(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
ksw2_extd2_sse2.o:ksw2_extd2_sse.c ksw2.h kalloc.h ksw2_extd2_sse2.o:ksw2_extd2_sse.c ksw2.h kalloc.h
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@ $(CC) -c $(CFLAGS) -msse2 -mno-sse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
ksw2_exts2_sse41.o:ksw2_exts2_sse.c ksw2.h kalloc.h ksw2_exts2_sse41.o:ksw2_exts2_sse.c ksw2.h kalloc.h
$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@ $(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
ksw2_exts2_sse2.o:ksw2_exts2_sse.c ksw2.h kalloc.h ksw2_exts2_sse2.o:ksw2_exts2_sse.c ksw2.h kalloc.h
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@ $(CC) -c $(CFLAGS) -msse2 -mno-sse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
ksw2_dispatch.o:ksw2_dispatch.c ksw2.h ksw2_dispatch.o:ksw2_dispatch.c ksw2.h
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@ $(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
# NEON-specific targets on ARM # NEON-specific targets on ARM
@@ -84,26 +105,28 @@ depend:
# DO NOT DELETE # DO NOT DELETE
align.o: minimap.h mmpriv.h bseq.h ksw2.h kalloc.h align.o: minimap.h mmpriv.h bseq.h kseq.h ksw2.h kalloc.h
bseq.o: bseq.h kvec.h kalloc.h kseq.h bseq.o: bseq.h kvec.h kalloc.h kseq.h
chain.o: minimap.h mmpriv.h bseq.h kalloc.h esterr.o: mmpriv.h minimap.h bseq.h kseq.h
esterr.o: mmpriv.h minimap.h bseq.h
example.o: minimap.h kseq.h example.o: minimap.h kseq.h
format.o: kalloc.h mmpriv.h minimap.h bseq.h format.o: kalloc.h mmpriv.h minimap.h bseq.h kseq.h
getopt.o: getopt.h hit.o: mmpriv.h minimap.h bseq.h kseq.h kalloc.h khash.h
hit.o: mmpriv.h minimap.h bseq.h kalloc.h khash.h index.o: kthread.h bseq.h minimap.h mmpriv.h kseq.h kvec.h kalloc.h khash.h
index.o: kthread.h bseq.h minimap.h mmpriv.h kvec.h kalloc.h khash.h index.o: ksort.h
kalloc.o: kalloc.h kalloc.o: kalloc.h
ksw2_extd2_sse.o: ksw2.h kalloc.h ksw2_extd2_sse.o: ksw2.h kalloc.h
ksw2_exts2_sse.o: ksw2.h kalloc.h ksw2_exts2_sse.o: ksw2.h kalloc.h
ksw2_extz2_sse.o: ksw2.h kalloc.h ksw2_extz2_sse.o: ksw2.h kalloc.h
ksw2_ll_sse.o: ksw2.h kalloc.h ksw2_ll_sse.o: ksw2.h kalloc.h
kthread.o: kthread.h kthread.o: kthread.h
main.o: bseq.h minimap.h mmpriv.h getopt.h lchain.o: mmpriv.h minimap.h bseq.h kseq.h kalloc.h krmq.h
map.o: kthread.h kvec.h kalloc.h sdust.h mmpriv.h minimap.h bseq.h khash.h main.o: bseq.h minimap.h mmpriv.h kseq.h ketopt.h
map.o: ksort.h map.o: kthread.h kvec.h kalloc.h sdust.h mmpriv.h minimap.h bseq.h kseq.h
misc.o: mmpriv.h minimap.h bseq.h ksort.h map.o: khash.h ksort.h
options.o: mmpriv.h minimap.h bseq.h misc.o: mmpriv.h minimap.h bseq.h kseq.h ksort.h
pe.o: mmpriv.h minimap.h bseq.h kvec.h kalloc.h ksort.h options.o: mmpriv.h minimap.h bseq.h kseq.h
pe.o: mmpriv.h minimap.h bseq.h kseq.h kvec.h kalloc.h ksort.h
sdust.o: kalloc.h kdq.h kvec.h sdust.h sdust.o: kalloc.h kdq.h kvec.h sdust.h
sketch.o: kvec.h kalloc.h mmpriv.h minimap.h bseq.h seed.o: mmpriv.h minimap.h bseq.h kseq.h kalloc.h ksort.h
sketch.o: kvec.h kalloc.h mmpriv.h minimap.h bseq.h kseq.h
splitidx.o: mmpriv.h minimap.h bseq.h kseq.h
+97
View File
@@ -0,0 +1,97 @@
CFLAGS= -g -Wall -O2 -Wc++-compat #-Wextra
CPPFLAGS= -DHAVE_KALLOC -DUSE_SIMDE -DSIMDE_ENABLE_NATIVE_ALIASES
INCLUDES= -Ilib/simde
OBJS= kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o options.o index.o lchain.o align.o hit.o map.o format.o pe.o seed.o esterr.o splitidx.o \
ksw2_extz2_simde.o ksw2_extd2_simde.o ksw2_exts2_simde.o ksw2_ll_simde.o
PROG= minimap2
PROG_EXTRA= sdust minimap2-lite
LIBS= -lm -lz -lpthread
ifneq ($(arm_neon),) # if arm_neon is defined
ifeq ($(aarch64),) #if aarch64 is not defined
CFLAGS+=-D_FILE_OFFSET_BITS=64 -mfpu=neon -fsigned-char
else #if aarch64 is defined
CFLAGS+=-D_FILE_OFFSET_BITS=64 -fsigned-char
endif
endif
ifneq ($(asan),)
CFLAGS+=-fsanitize=address
LIBS+=-fsanitize=address
endif
ifneq ($(tsan),)
CFLAGS+=-fsanitize=thread
LIBS+=-fsanitize=thread
endif
.PHONY:all extra clean depend
.SUFFIXES:.c .o
.c.o:
$(CC) -c $(CFLAGS) $(CPPFLAGS) $(INCLUDES) $< -o $@
all:$(PROG)
extra:all $(PROG_EXTRA)
minimap2:main.o libminimap2.a
$(CC) $(CFLAGS) main.o -o $@ -L. -lminimap2 $(LIBS)
minimap2-lite:example.o libminimap2.a
$(CC) $(CFLAGS) $< -o $@ -L. -lminimap2 $(LIBS)
libminimap2.a:$(OBJS)
$(AR) -csru $@ $(OBJS)
sdust:sdust.c kalloc.o kalloc.h kdq.h kvec.h kseq.h ketopt.h sdust.h
$(CC) -D_SDUST_MAIN $(CFLAGS) $< kalloc.o -o $@ -lz
ksw2_ll_simde.o:ksw2_ll_sse.c ksw2.h kalloc.h
$(CC) -c $(CFLAGS) -msse2 $(CPPFLAGS) $(INCLUDES) $< -o $@
ksw2_extz2_simde.o:ksw2_extz2_sse.c ksw2.h kalloc.h
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) $(INCLUDES) $< -o $@
ksw2_extd2_simde.o:ksw2_extd2_sse.c ksw2.h kalloc.h
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) $(INCLUDES) $< -o $@
ksw2_exts2_simde.o:ksw2_exts2_sse.c ksw2.h kalloc.h
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) $(INCLUDES) $< -o $@
# other non-file targets
clean:
rm -fr gmon.out *.o a.out $(PROG) $(PROG_EXTRA) *~ *.a *.dSYM build dist mappy*.so mappy.c python/mappy.c mappy.egg*
depend:
(LC_ALL=C; export LC_ALL; makedepend -Y -- $(CFLAGS) $(CPPFLAGS) -- *.c)
# DO NOT DELETE
align.o: minimap.h mmpriv.h bseq.h kseq.h ksw2.h kalloc.h
bseq.o: bseq.h kvec.h kalloc.h kseq.h
chain.o: minimap.h mmpriv.h bseq.h kseq.h kalloc.h
esterr.o: mmpriv.h minimap.h bseq.h kseq.h
example.o: minimap.h kseq.h
format.o: kalloc.h mmpriv.h minimap.h bseq.h kseq.h
hit.o: mmpriv.h minimap.h bseq.h kseq.h kalloc.h khash.h
index.o: kthread.h bseq.h minimap.h mmpriv.h kseq.h kvec.h kalloc.h khash.h
index.o: ksort.h
kalloc.o: kalloc.h
ksw2_extd2_sse.o: ksw2.h kalloc.h
ksw2_exts2_sse.o: ksw2.h kalloc.h
ksw2_extz2_sse.o: ksw2.h kalloc.h
ksw2_ll_sse.o: ksw2.h kalloc.h
kthread.o: kthread.h
main.o: bseq.h minimap.h mmpriv.h kseq.h ketopt.h
map.o: kthread.h kvec.h kalloc.h sdust.h mmpriv.h minimap.h bseq.h kseq.h
map.o: khash.h ksort.h
misc.o: mmpriv.h minimap.h bseq.h kseq.h ksort.h
options.o: mmpriv.h minimap.h bseq.h kseq.h
pe.o: mmpriv.h minimap.h bseq.h kseq.h kvec.h kalloc.h ksort.h
sdust.o: kalloc.h kdq.h kvec.h sdust.h
self-chain.o: minimap.h kseq.h
sketch.o: kvec.h kalloc.h mmpriv.h minimap.h bseq.h kseq.h
splitidx.o: mmpriv.h minimap.h bseq.h kseq.h
+461
View File
@@ -1,3 +1,464 @@
Release 2.22-r1101 (7 August 2021)
----------------------------------
When choosing the best alignment, this release uses logarithm gap penalty and
query-specific mismatch penalty. It improves the sensitivity to long INDELs in
repetitive regions.
Other notable changes:
* Bugfix: fixed an indirect memory leak that may waste a large amount of
memory given highly repetitive reference such as a 16S RNA database (#749).
All versions of minimap2 have this issue.
* New feature: added --cap-kalloc to reduce the peak memory. This option is
not enabled by default but may become the default in future releases.
Known issue:
* Minimap2 may take a long time to map a read (#771). So far it is not clear
if this happens to v2.18 and earlier versions.
(2.22: 7 August 2021, r1101)
Release 2.21-r1071 (6 July 2021)
--------------------------------
This release fixed a regression in short-read mapping introduced in v2.19
(#776). It also fixed invalid comparisons of uninitialized variables, though
these are harmless (#752). Long-read alignment should be identical to v2.20.
(2.21: 6 July 2021, r1071)
Release 2.20-r1061 (27 May 2021)
--------------------------------
This release fixed a bug in the Python module and improves the command-line
compatibiliity with v2.18. In v2.19, if `-r` is specified with an `asm*` preset,
users would get alignments more fragmented than v2.18. This could be an issue
for existing pipelines specifying `-r`. This release resolves this issue.
(2.20: 27 May 2021, r1061)
Release 2.19-r1057 (26 May 2021)
--------------------------------
This release includes a few important improvements backported from unimap:
* Improvement: more contiguous alignment through long INDELs. This is enabled
by the minigraph chaining algorithm. All `asm*` presets now use the new
algorithm. They can find INDELs up to 100kb and may be faster for
chromosome-long contigs. The default mode and `map*` presets use this
algorithm to replace the long-join heuristic.
* Improvement: better alignment in highly repetitive regions by rescuing
high-occurrence seeds. If the distance between two adjacent seeds is too
large, attempt to choose a fraction of high-occurrence seeds in-between.
Minimap2 now produces fewer clippings and alignment break points in long
satellite regions.
* Improvement: allow to specify an interval of k-mer occurrences with `-U`.
For repeat-rich genomes, the automatic k-mer occurrence threshold determined
by `-f` may be too large and makes alignment impractically slow. The new
option protects against such cases. Enabled for `asm*` and `map-hifi`.
* New feature: added the `map-hifi` preset for maping PacBio High-Fidelity
(HiFi) reads.
* Change to the default: apply `--cap-sw-mem=100m` for genomic alignment.
* Bugfix: minimap2 could not generate an index file with `-xsr` (#734).
This release represents the most signficant algorithmic change since v2.1 in
2017. With features backported from unimap, minimap2 now has similar power to
unimap for contig alignment. Unimap will remain an experimental project and is
no longer recommended over minimap2. Sorry for reverting the recommendation in
short time.
(2.19: 26 May 2021, r1057)
Release 2.18-r1015 (9 April 2021)
---------------------------------
This release fixes multiple rare bugs in minimap2 and adds additional
functionality to paftools.js.
Changes to minimap2:
* Bugfix: a rare segfault caused by an off-by-one error (#489)
* Bugfix: minimap2 segfaulted due to an uninitilized variable (#622 and #625).
* Bugfix: minimap2 parsed spaces as field separators in BED (#721). This led
to issues when the BED name column contains spaces.
* Bugfix: minimap2 `--split-prefix` did not work with long reference names
(#394).
* Bugfix: option `--junc-bonus` didn't work (#513)
* Bugfix: minimap2 didn't return 1 on I/O errors (#532)
* Bugfix: the `de:f` tag (sequence divergence) could be negative if there were
ambiguous bases
* Bugfix: fixed two undefined behaviors caused by calling memcpy() on
zero-length blocks (#443)
* Bugfix: there were duplicated SAM @SQ lines if option `--split-prefix` is in
use (#400 and #527)
* Bugfix: option -K had to be smaller than 2 billion (#491). This was caused
by a 32-bit integer overflow.
* Improvement: optionally compile against SIMDe (#597). Minimap2 should work
with IBM POWER CPUs, though this has not been tested. To compile with SIMDe,
please use `make -f Makefile.simde`.
* Improvement: more informative error message for I/O errors (#454) and for
FASTQ parsing errors (#510)
* Improvement: abort given malformatted RG line (#541)
* Improvement: better formula to estimate the `dv:f` tag (approximate sequence
divergence). See DOI:10.1101/2021.01.15.426881.
* New feature: added the `--mask-len` option to fine control the removal of
redundant hits (#659). The default behavior is unchanged.
Changes to mappy:
* Bugfix: mappy caused segmentation fault if the reference index is not
present (#413).
* Bugfix: fixed a memory leak via 238b6bb3
* Change: always require Cython to compile the mappy module (#723). Older
mappy packages at PyPI bundled the C source code generated by Cython such
that end users did not need to install Cython to compile mappy. However, as
Python 3.9 is breaking backward compatibility, older mappy does not work
with Python 3.9 anymore. We have to add this Cython dependency as a
workaround.
Changes to paftools.js:
* Bugfix: the "part10-" line from asmgene was wrong (#581)
* Improvement: compatibility with GTF files from GenBank (#422)
* New feature: asmgene also checks missing multi-copy genes
* New feature: added the misjoin command to evaluate large-scale misjoins and
megabase-long inversions.
Although given the many bug fixes and minor improvements, the core algorithm
stays the same. This version of minimap2 produces nearly identical alignments
to v2.17 except very rare corner cases.
Now unimap is recommended over minimap2 for aligning long contigs against a
reference genome. It often takes less wall-clock time and is much more
sensitive to long insertions and deletions.
(2.18: 9 April 2021, r1015)
Release 2.17-r941 (4 May 2019)
------------------------------
Changes since the last release:
* Fixed flawed CIGARs like `5I6D7I` (#392).
* Bugfix: TLEN should be 0 when either end is unmapped (#373 and #365).
* Bugfix: mappy is unable to write index (#372).
* Added option `--junc-bed` to load known gene annotations in the BED12
format. Minimap2 prefers annotated junctions over novel junctions (#197 and
#348). GTF can be converted to BED12 with `paftools.js gff2bed`.
* Added option `--sam-hit-only` to suppress unmapped hits in SAM (#377).
* Added preset `splice:hq` for high-quality CCS or mRNA sequences. It applies
better scoring and improves the sensitivity to small exons. This preset may
introduce false small introns, but the overall accuracy should be higher.
This version produces nearly identical alignments to v2.16, except for CIGARs
affected by the bug mentioned above.
(2.17: 5 May 2019, r941)
Release 2.16-r922 (28 February 2019)
------------------------------------
This release is 50% faster for mapping ultra-long nanopore reads at comparable
accuracy. For short-read mapping, long-read overlapping and ordinary long-read
mapping, the performance and accuracy remain similar. This speedup is achieved
with a new heuristic to limit the number of chaining iterations (#324). Users
can disable the heuristic by increasing a new option `--max-chain-iter` to a
huge number.
Other changes to minimap2:
* Implemented option `--paf-no-hit` to output unmapped query sequences in PAF.
The strand and reference name columns are both `*` at an unmapped line. The
hidden option is available in earlier minimap2 but had a different 2-column
output format instead of PAF.
* Fixed a bug that leads to wrongly calculated `de` tags when ambiguous bases
are involved (#309). This bug only affects v2.15.
* Fixed a bug when parsing command-line option `--splice` (#344). This bug was
introduced in v2.13.
* Fixed two division-by-zero cases (#326). They don't affect final alignments
because the results of the divisions are not used in both case.
* Added an option `-o` to output alignments to a specified file. It is still
recommended to use UNIX pipes for on-the-fly conversion or compression.
* Output a new `rl` tag to give the length of query regions harboring
repetitive seeds.
Changes to paftool.js:
* Added a new option to convert the MD tag to the long form of the cs tag.
Changes to mappy:
* Added the `mappy.Aligner.seq_names` method to return sequence names (#312).
For NA12878 ultra-long reads, this release changes the alignments of <0.1% of
reads in comparison to v2.15. All these reads have highly fragmented alignments
and are likely to be problematic anyway. For shorter or well aligned reads,
this release should produce mostly identical alignments to v2.15.
(2.16: 28 February 2019, r922)
Release 2.15-r905 (10 January 2019)
-----------------------------------
Changes to minimap2:
* Fixed a rare segmentation fault when option -H is in use (#307). This may
happen when there are very long homopolymers towards the 5'-end of a read.
* Fixed wrong CIGARs when option --eqx is used (#266).
* Fixed a typo in the base encoding table (#264). This should have no
practical effect.
* Fixed a typo in the example code (#265).
* Improved the C++ compatibility by removing "register" (#261). However,
minimap2 still can't be compiled in the pedantic C++ mode (#306).
* Output a new "de" tag for gap-compressed sequence divergence.
Changes to paftools.js:
* Added "asmgene" to evaluate the completeness of an assembly by measuring the
uniquely mapped single-copy genes. This command learns the idea of BUSCO.
* Added "vcfpair" to call a phased VCF from phased whole-genome assemblies. An
earlier version of this script is used to produce the ground truth for the
syndip benchmark [PMID:30013044].
This release produces identical alignment coordinates and CIGARs in comparison
to v2.14. Users are advised to upgrade due to the several bug fixes.
(2.15: 10 Janurary 2019, r905)
Release 2.14-r883 (5 November 2018)
-----------------------------------
Notable changes:
* Fixed two minor bugs caused by typos (#254 and #266).
* Fixed a bug that made minimap2 abort when --eqx was used together with --MD
or --cs (#257).
* Added --cap-sw-mem to cap the size of DP matrices (#259). Base alignment may
take a lot of memory in the splicing mode. This may lead to issues when we
run minimap2 on a cluster with a hard memory limit. The new option avoids
unlimited memory usage at the cost of missing a few long introns.
* Conforming to C99 and C11 when possible (#261).
* Warn about malformatted FASTA or FASTQ (#252 and #255).
This release occasionally produces base alignments different from v2.13. The
overall alignment accuracy remain similar.
(2.14: 5 November 2018, r883)
Release 2.13-r850 (11 October 2018)
-----------------------------------
Changes to minimap2:
* Fixed wrongly formatted SAM when -L is in use (#231 and #233).
* Fixed an integer overflow in rare cases.
* Added --hard-mask-level to fine control split alignments (#244).
* Made --MD work with spliced alignment (#139).
* Replaced musl's getopt with ketopt for portability.
* Log peak memory usage on exit.
This release should produce alignments identical to v2.12 and v2.11.
(2.13: 11 October 2018, r850)
Release 2.12-r827 (6 August 2018)
---------------------------------
Changes to minimap2:
* Added option --split-prefix to write proper alignments (correct mapping
quality and clustered query sequences) given a multi-part index (#141 and
#189; mostly by @hasindu2008).
* Fixed a memory leak when option -y is in use.
Changes to mappy:
* Support the MD/cs tag (#183 and #203).
* Allow mappy to index a single sequence, to add extra flags and to change the
scoring system.
Minimap2 should produce alignments identical to v2.11.
(2.12: 6 August 2018, r827)
Release 2.11-r797 (20 June 2018)
--------------------------------
Changes to minimap2:
* Improved alignment accuracy in low-complexity regions for SV calling. Thank
@armintoepfer for multiple offline examples.
* Added option --eqx to encode sequence match/mismatch with the =/X CIGAR
operators (#156, #157 and #175).
* When compiled with VC++, minimap2 generated wrong alignments due to a
comparison between a signed integer and an unsigned integer (#184). Also
fixed warnings reported by "clang -Wextra".
* Fixed incorrect anchor filtering due to a missing 64- to 32-bit cast.
* Fixed incorrect mapping quality for inversions (#148).
* Fixed incorrect alignment involving ambiguous bases (#155).
* Fixed incorrect presets: option `-r 2000` is intended to be used with
ava-ont, not ava-pb. The bug was introduced in 2.10.
* Fixed a bug when --for-only/--rev-only is used together with --sr or
--heap-sort=yes (#166).
* Fixed option -Y that was not working in the previous releases.
* Added option --lj-min-ratio to fine control the alignment of long gaps
found by the "long-join" heuristic (#128).
* Exposed `mm_idx_is_idx`, `mm_idx_load` and `mm_idx_dump` C APIs (#177).
Also fixed a bug when indexing without reference names (this feature is not
exposed to the command line).
Changes to mappy:
* Added `__version__` (#165).
* Exposed the maximum fragment length parameter to mappy (#174).
Changes to paftools:
* Don't crash when there is no "cg" tag (#153).
* Fixed wrong coverage report by "paftools.js call" (#145).
This version may produce slightly different base-level alignment. The overall
alignment statistics should remain similar.
(2.11: 20 June 2018, r797)
Release 2.10-r761 (27 March 2018)
---------------------------------
Changes to minimap2:
* Optionally output the MD tag for compatibility with existing tools (#63,
#118 and #137).
* Use SSE compiler flags more precisely to prevent compiling errors on certain
machines (#127).
* Added option --min-occ-floor to set a minimum occurrence threshold. Presets
intended for assembly-to-reference alignment set this option to 100. This
option alleviates issues with regions having high copy numbers (#107).
* Exit with non-zero code on file writing errors (e.g. disk full; #103 and
#132).
* Added option -y to copy FASTA/FASTQ comments in query sequences to the
output (#136).
* Added the asm20 preset for alignments between genomes at 5-10% sequence
divergence.
* Changed the band-width in the ava-ont preset from 500 to 2000. Oxford
Nanopore reads may contain long deletion sequencing errors that break
chaining.
Changes to mappy, the Python binding:
* Fixed a typo in Align.seq() (#126).
Changes to paftools.js, the companion script:
* Command sam2paf now converts the MD tag to cs.
* Support VCF output for assembly-to-reference variant calling (#109).
This version should produce identical alignment for read overlapping, RNA-seq
read mapping, and genomic read mapping. We have also added a cook book to show
the variety uses of minimap2 on real datasets. Please see cookbook.md in the
minimap2 source code directory.
(2.10: 27 March 2017, r761)
Release 2.9-r720 (23 February 2018) Release 2.9-r720 (23 February 2018)
----------------------------------- -----------------------------------
+64 -25
View File
@@ -1,7 +1,7 @@
[![GitHub Downloads](https://img.shields.io/github/downloads/lh3/minimap2/total.svg?style=social&logo=github&label=Download)](https://github.com/lh3/minimap2/releases) [![GitHub Downloads](https://img.shields.io/github/downloads/lh3/minimap2/total.svg?style=social&logo=github&label=Download)](https://github.com/lh3/minimap2/releases)
[![BioConda Install](https://img.shields.io/conda/dn/bioconda/minimap2.svg?style=flag&label=BioConda%20install)](https://anaconda.org/bioconda/minimap2) [![BioConda Install](https://img.shields.io/conda/dn/bioconda/minimap2.svg?style=flag&label=BioConda%20install)](https://anaconda.org/bioconda/minimap2)
[![PyPI](https://img.shields.io/pypi/v/mappy.svg?style=flat)](https://pypi.python.org/pypi/mappy) [![PyPI](https://img.shields.io/pypi/v/mappy.svg?style=flat)](https://pypi.python.org/pypi/mappy)
[![Build Status](https://travis-ci.org/lh3/minimap2.svg?branch=master)](https://travis-ci.org/lh3/minimap2) [![Build Status](https://github.com/lh3/minimap2/actions/workflows/ci.yaml/badge.svg)](https://github.com/lh3/minimap2/actions)
## <a name="started"></a>Getting Started ## <a name="started"></a>Getting Started
```sh ```sh
git clone https://github.com/lh3/minimap2 git clone https://github.com/lh3/minimap2
@@ -9,20 +9,25 @@ cd minimap2 && make
# long sequences against a reference genome # long sequences against a reference genome
./minimap2 -a test/MT-human.fa test/MT-orang.fa > test.sam ./minimap2 -a test/MT-human.fa test/MT-orang.fa > test.sam
# create an index first and then map # create an index first and then map
./minimap2 -d MT-human.mmi test/MT-human.fa ./minimap2 -x map-ont -d MT-human-ont.mmi test/MT-human.fa
./minimap2 -a MT-human.mmi test/MT-orang.fa > test.sam ./minimap2 -a MT-human-ont.mmi test/MT-orang.fa > test.sam
# use presets (no test data) # use presets (no test data)
./minimap2 -ax map-pb ref.fa pacbio.fq.gz > aln.sam # PacBio genomic reads ./minimap2 -ax map-pb ref.fa pacbio.fq.gz > aln.sam # PacBio CLR genomic reads
./minimap2 -ax map-ont ref.fa ont.fq.gz > aln.sam # Oxford Nanopore genomic reads ./minimap2 -ax map-ont ref.fa ont.fq.gz > aln.sam # Oxford Nanopore genomic reads
./minimap2 -ax map-hifi ref.fa pacbio-ccs.fq.gz > aln.sam # PacBio HiFi/CCS genomic reads (v2.19 or later)
./minimap2 -ax asm20 ref.fa pacbio-ccs.fq.gz > aln.sam # PacBio HiFi/CCS genomic reads (v2.18 or earlier)
./minimap2 -ax sr ref.fa read1.fa read2.fa > aln.sam # short genomic paired-end reads ./minimap2 -ax sr ref.fa read1.fa read2.fa > aln.sam # short genomic paired-end reads
./minimap2 -ax splice ref.fa rna-reads.fa > aln.sam # spliced long reads ./minimap2 -ax splice ref.fa rna-reads.fa > aln.sam # spliced long reads (strand unknown)
./minimap2 -ax splice -k14 -uf ref.fa reads.fa > aln.sam # Nanopore Direct RNA-seq ./minimap2 -ax splice -uf -k14 ref.fa reads.fa > aln.sam # noisy Nanopore Direct RNA-seq
./minimap2 -ax splice:hq -uf ref.fa query.fa > aln.sam # Final PacBio Iso-seq or traditional cDNA
./minimap2 -ax splice --junc-bed anno.bed12 ref.fa query.fa > aln.sam # prioritize on annotated junctions
./minimap2 -cx asm5 asm1.fa asm2.fa > aln.paf # intra-species asm-to-asm alignment ./minimap2 -cx asm5 asm1.fa asm2.fa > aln.paf # intra-species asm-to-asm alignment
./minimap2 -x ava-pb reads.fa reads.fa > overlaps.paf # PacBio read overlap ./minimap2 -x ava-pb reads.fa reads.fa > overlaps.paf # PacBio read overlap
./minimap2 -x ava-ont reads.fa reads.fa > overlaps.paf # Nanopore read overlap ./minimap2 -x ava-ont reads.fa reads.fa > overlaps.paf # Nanopore read overlap
# man page for detailed command line options # man page for detailed command line options
man ./minimap2.1 man ./minimap2.1
``` ```
## Table of Contents ## Table of Contents
- [Getting Started](#started) - [Getting Started](#started)
@@ -61,16 +66,16 @@ mainstream long-read mappers such as BLASR, BWA-MEM, NGMLR and GMAP. It is more
accurate on simulated long reads and produces biologically meaningful alignment accurate on simulated long reads and produces biologically meaningful alignment
ready for downstream analyses. For >100bp Illumina short reads, minimap2 is ready for downstream analyses. For >100bp Illumina short reads, minimap2 is
three times as fast as BWA-MEM and Bowtie2, and as accurate on simulated data. three times as fast as BWA-MEM and Bowtie2, and as accurate on simulated data.
Detailed evaluations are available from the [minimap2 preprint][preprint]. Detailed evaluations are available from the [minimap2 paper][doi] or the
[preprint][preprint].
### <a name="install"></a>Installation ### <a name="install"></a>Installation
Minimap2 is optimized for x86-64 CPUs. You can acquire precompiled binaries from Minimap2 is optimized for x86-64 CPUs. You can acquire precompiled binaries from
the [release page][release] with: the [release page][release] with:
```sh ```sh
curl -L https://github.com/lh3/minimap2/releases/download/v2.9/minimap2-2.9_x64-linux.tar.bz2 \ curl -L https://github.com/lh3/minimap2/releases/download/v2.22/minimap2-2.22_x64-linux.tar.bz2 | tar -jxvf -
| tar -jxvf - ./minimap2-2.22_x64-linux/minimap2
./minimap2-2.9_x64-linux/minimap2
``` ```
If you want to compile from the source, you need to have a C compiler, GNU make If you want to compile from the source, you need to have a C compiler, GNU make
and zlib development files installed. Then type `make` in the source code and zlib development files installed. Then type `make` in the source code
@@ -78,13 +83,20 @@ directory to compile. If you see compilation errors, try `make sse2only=1`
to disable SSE4 code, which will make minimap2 slightly slower. to disable SSE4 code, which will make minimap2 slightly slower.
Minimap2 also works with ARM CPUs supporting the NEON instruction sets. To Minimap2 also works with ARM CPUs supporting the NEON instruction sets. To
compile, use `make arm_neon=1`. compile for 32 bit ARM architectures (such as ARMv7), use `make arm_neon=1`. To
compile for for 64 bit ARM architectures (such as ARMv8), use `make arm_neon=1
aarch64=1`.
Minimap2 can use [SIMD Everywhere (SIMDe)][simde] library for porting
implementation to the different SIMD instruction sets. To compile using SIMDe,
use `make -f Makefile.simde`. To compile for ARM CPUs, use `Makefile.simde`
with the ARM related command lines given above.
### <a name="general"></a>General usage ### <a name="general"></a>General usage
Without any options, minimap2 takes a reference database and a query sequence Without any options, minimap2 takes a reference database and a query sequence
file as input and produce approximate mapping, without base-level alignment file as input and produce approximate mapping, without base-level alignment
(i.e. no CIGAR), in the [PAF format][paf]: (i.e. coordinates are only approximate and no CIGAR in output), in the [PAF format][paf]:
```sh ```sh
minimap2 ref.fa query.fq > approx-mapping.paf minimap2 ref.fa query.fq > approx-mapping.paf
``` ```
@@ -125,19 +137,19 @@ parameters at the same time. The default setting is the same as `map-ont`.
#### <a name="map-long-genomic"></a>Map long noisy genomic reads #### <a name="map-long-genomic"></a>Map long noisy genomic reads
```sh ```sh
minimap2 -ax map-pb ref.fa pacbio-reads.fq > aln.sam # for PacBio subreads minimap2 -ax map-pb ref.fa pacbio-reads.fq > aln.sam # for PacBio CLR reads
minimap2 -ax map-ont ref.fa ont-reads.fq > aln.sam # for Oxford Nanopore reads minimap2 -ax map-ont ref.fa ont-reads.fq > aln.sam # for Oxford Nanopore reads
``` ```
The difference between `map-pb` and `map-ont` is that `map-pb` uses The difference between `map-pb` and `map-ont` is that `map-pb` uses
homopolymer-compressed (HPC) minimizers as seeds, while `map-ont` uses ordinary homopolymer-compressed (HPC) minimizers as seeds, while `map-ont` uses ordinary
minimizers as seeds. Emperical evaluation suggests HPC minimizers improve minimizers as seeds. Emperical evaluation suggests HPC minimizers improve
performance and sensitivity when aligning PacBio reads, but hurt when aligning performance and sensitivity when aligning PacBio CLR reads, but hurt when aligning
Nanopore reads. Nanopore reads.
#### <a name="map-long-splice"></a>Map long mRNA/cDNA reads #### <a name="map-long-splice"></a>Map long mRNA/cDNA reads
```sh ```sh
minimap2 -ax splice -uf ref.fa iso-seq.fq > aln.sam # PacBio Iso-seq/traditional cDNA minimap2 -ax splice:hq -uf ref.fa iso-seq.fq > aln.sam # PacBio Iso-seq/traditional cDNA
minimap2 -ax splice ref.fa nanopore-cdna.fa > aln.sam # Nanopore 2D cDNA-seq minimap2 -ax splice ref.fa nanopore-cdna.fa > aln.sam # Nanopore 2D cDNA-seq
minimap2 -ax splice -uf -k14 ref.fa direct-rna.fq > aln.sam # Nanopore Direct RNA-seq minimap2 -ax splice -uf -k14 ref.fa direct-rna.fq > aln.sam # Nanopore Direct RNA-seq
minimap2 -ax splice --splice-flank=no SIRV.fa SIRV-seq.fa # mapping against SIRV control minimap2 -ax splice --splice-flank=no SIRV.fa SIRV-seq.fa # mapping against SIRV control
@@ -176,10 +188,23 @@ This is because SIRV does not honor the evolutionarily conservative splicing
signal. If you are studying SIRV, you may apply `--splice-flank=no` to let signal. If you are studying SIRV, you may apply `--splice-flank=no` to let
minimap2 only model GT..AG, ignoring the additional base. minimap2 only model GT..AG, ignoring the additional base.
Since v2.17, minimap2 can optionally take annotated genes as input and
prioritize on annotated splice junctions. To use this feature, you can
```sh
paftools.js gff2bed anno.gff > anno.bed
minimap2 -ax splice --junc-bed anno.bed ref.fa query.fa > aln.sam
```
Here, `anno.gff` is the gene annotation in the GTF or GFF3 format (`gff2bed`
automatically tests the format). The output of `gff2bed` is in the 12-column
BED format, or the BED12 format. With the `--junc-bed` option, minimap2 adds a
bonus score (tuned by `--junc-bonus`) if an aligned junction matches a junction
in the annotation. Option `--junc-bed` also takes 5-column BED, including the
strand field. In this case, each line indicates an oriented junction.
#### <a name="long-overlap"></a>Find overlaps between long reads #### <a name="long-overlap"></a>Find overlaps between long reads
```sh ```sh
minimap2 -x ava-pb reads.fq reads.fq > ovlp.paf # PacBio read overlap minimap2 -x ava-pb reads.fq reads.fq > ovlp.paf # PacBio CLR read overlap
minimap2 -x ava-ont reads.fq reads.fq > ovlp.paf # Oxford Nanopore read overlap minimap2 -x ava-ont reads.fq reads.fq > ovlp.paf # Oxford Nanopore read overlap
``` ```
Similarly, `ava-pb` uses HPC minimizers while `ava-ont` uses ordinary Similarly, `ava-pb` uses HPC minimizers while `ava-ont` uses ordinary
@@ -226,10 +251,10 @@ To avoid this issue, you can add option `-L` at the minimap2 command line.
This option moves a long CIGAR to the `CG` tag and leaves a fully clipped CIGAR This option moves a long CIGAR to the `CG` tag and leaves a fully clipped CIGAR
at the SAM CIGAR column. Current tools that don't read CIGAR (e.g. merging and at the SAM CIGAR column. Current tools that don't read CIGAR (e.g. merging and
sorting) still work with such BAM records; tools that read CIGAR will sorting) still work with such BAM records; tools that read CIGAR will
effectively ignore these records. It has been decided that future tools will effectively ignore these records. It has been decided that future tools
will seamlessly recognize long-cigar records generated by option `-L`. will seamlessly recognize long-cigar records generated by option `-L`.
**TD;DR**: if you work with ultra-long reads and use tools that only process **TL;DR**: if you work with ultra-long reads and use tools that only process
BAM files, please add option `-L`. BAM files, please add option `-L`.
#### <a name="cs"></a>The cs optional tag #### <a name="cs"></a>The cs optional tag
@@ -247,14 +272,16 @@ CGATCGATAAATAGAGTAG---GAATAGCA
CGATCG---AATAGAGTAGGTCGAATtGCA CGATCG---AATAGAGTAGGTCGAATtGCA
``` ```
is represented as `:6-ata:10+gtc:4*at:3`, where `:[0-9]+` represents an is represented as `:6-ata:10+gtc:4*at:3`, where `:[0-9]+` represents an
identical block, `-ata` represents a deltion, `+gtc` an insertion and `*at` identical block, `-ata` represents a deletion, `+gtc` an insertion and `*at`
indicates reference base `a` is substituted with a query base `t`. It is indicates reference base `a` is substituted with a query base `t`. It is
similar to the `MD` SAM tag but is standalone and easier to parse. similar to the `MD` SAM tag but is standalone and easier to parse.
If `--cs=long` is used, the `cs` string also contains identical sequences in If `--cs=long` is used, the `cs` string also contains identical sequences in
the alignment. The above example will become the alignment. The above example will become
`=CGATCG-ata=AATAGAGTAG+gtc=GAAT*at=GCA`. The long form of `cs` encodes both `=CGATCG-ata=AATAGAGTAG+gtc=GAAT*at=GCA`. The long form of `cs` encodes both
reference and query sequences in one string. reference and query sequences in one string. The `cs` tag also encodes intron
positions and splicing signals (see the [minimap2 manpage][manpage-cs] for
details).
#### <a name="paftools"></a>Working with the PAF format #### <a name="paftools"></a>Working with the PAF format
@@ -311,15 +338,17 @@ highlighted in bold. The description may help to tune minimap2 parameters.
### <a name="help"></a>Getting help ### <a name="help"></a>Getting help
Manpage [minimap2.1][manpage] provides detailed description of minimap2 Manpage [minimap2.1][manpage] provides detailed description of minimap2
command line options and optional tags. If you encounter bugs or have further command line options and optional tags. The [FAQ](FAQ.md) page answers several
questions or requests, you can raise an issue at the [issue page][issue]. frequently asked questions. If you encounter bugs or have further questions or
There is not a specific mailing list for the time being. requests, you can raise an issue at the [issue page][issue]. There is not a
specific mailing list for the time being.
### <a name="cite"></a>Citing minimap2 ### <a name="cite"></a>Citing minimap2
If you use minimap2 in your work, please consider to cite: If you use minimap2 in your work, please cite:
> Li, H. (2017). Minimap2: fast pairwise alignment for long nucleotide sequences. [arXiv:1708.01492][preprint] > Li, H. (2018). Minimap2: pairwise alignment for nucleotide sequences.
> *Bioinformatics*, **34**:3094-3100. [doi:10.1093/bioinformatics/bty191][doi]
## <a name="dguide"></a>Developers' Guide ## <a name="dguide"></a>Developers' Guide
@@ -346,6 +375,12 @@ mappy` or [from BioConda][mappyconda] via `conda install -c bioconda mappy`.
possible to add non-SIMD support, but it would make minimap2 slower by possible to add non-SIMD support, but it would make minimap2 slower by
several times. several times.
* Minimap2 does not work with a single query or database sequence ~2
billion bases or longer (2,147,483,647 to be exact). The total length of all
sequences can well exceed this threshold.
* Minimap2 often misses small exons.
[paf]: https://github.com/lh3/miniasm/blob/master/PAF.md [paf]: https://github.com/lh3/miniasm/blob/master/PAF.md
@@ -362,3 +397,7 @@ mappy` or [from BioConda][mappyconda] via `conda install -c bioconda mappy`.
[issue]: https://github.com/lh3/minimap2/issues [issue]: https://github.com/lh3/minimap2/issues
[k8]: https://github.com/attractivechaos/k8 [k8]: https://github.com/attractivechaos/k8
[manpage]: https://lh3.github.io/minimap2/minimap2.html [manpage]: https://lh3.github.io/minimap2/minimap2.html
[manpage-cs]: https://lh3.github.io/minimap2/minimap2.html#10
[doi]: https://doi.org/10.1093/bioinformatics/bty191
[smide]: https://github.com/nemequ/simde
[unimap]: https://github.com/lh3/unimap
+329 -70
View File
@@ -6,18 +6,19 @@
#include "mmpriv.h" #include "mmpriv.h"
#include "ksw2.h" #include "ksw2.h"
static void ksw_gen_simple_mat(int m, int8_t *mat, int8_t a, int8_t b) static void ksw_gen_simple_mat(int m, int8_t *mat, int8_t a, int8_t b, int8_t sc_ambi)
{ {
int i, j; int i, j;
a = a < 0? -a : a; a = a < 0? -a : a;
b = b > 0? -b : b; b = b > 0? -b : b;
sc_ambi = sc_ambi > 0? -sc_ambi : sc_ambi;
for (i = 0; i < m - 1; ++i) { for (i = 0; i < m - 1; ++i) {
for (j = 0; j < m - 1; ++j) for (j = 0; j < m - 1; ++j)
mat[i * m + j] = i == j? a : b; mat[i * m + j] = i == j? a : b;
mat[i * m + m - 1] = 0; mat[i * m + m - 1] = sc_ambi;
} }
for (j = 0; j < m; ++j) for (j = 0; j < m; ++j)
mat[(m - 1) * m + j] = 0; mat[(m - 1) * m + j] = sc_ambi;
} }
static inline void mm_seq_rev(uint32_t len, uint8_t *seq) static inline void mm_seq_rev(uint32_t len, uint8_t *seq)
@@ -37,8 +38,8 @@ static inline void update_max_zdrop(int32_t score, int i, int j, int32_t *max, i
int z = *max - score - diff * e; int z = *max - score - diff * e;
if (z > *max_zdrop) { if (z > *max_zdrop) {
*max_zdrop = z; *max_zdrop = z;
pos[0][0] = *max_i, pos[0][1] = i + 1; pos[0][0] = *max_i, pos[0][1] = i;
pos[1][0] = *max_j, pos[1][1] = j + 1; pos[1][0] = *max_j, pos[1][1] = j;
} }
} else *max = score, *max_i = i, *max_j = j; } else *max = score, *max_i = i, *max_j = j;
} }
@@ -52,16 +53,16 @@ static int mm_test_zdrop(void *km, const mm_mapopt_t *opt, const uint8_t *qseq,
// find the score and the region where score drops most along diagonal // find the score and the region where score drops most along diagonal
for (k = 0, score = 0; k < n_cigar; ++k) { for (k = 0, score = 0; k < n_cigar; ++k) {
uint32_t l, op = cigar[k]&0xf, len = cigar[k]>>4; uint32_t l, op = cigar[k]&0xf, len = cigar[k]>>4;
if (op == 0) { if (op == MM_CIGAR_MATCH) {
for (l = 0; l < len; ++l) { for (l = 0; l < len; ++l) {
score += mat[tseq[i + l] * 5 + qseq[j + l]]; score += mat[tseq[i + l] * 5 + qseq[j + l]];
update_max_zdrop(score, i+l, j+l, &max, &max_i, &max_j, opt->e, &max_zdrop, pos); update_max_zdrop(score, i+l, j+l, &max, &max_i, &max_j, opt->e, &max_zdrop, pos);
} }
i += len, j += len; i += len, j += len;
} else if (op == 1 || op == 2 || op == 3) { } else if (op == MM_CIGAR_INS || op == MM_CIGAR_DEL || op == MM_CIGAR_N_SKIP) {
score -= opt->q + opt->e * len; score -= opt->q + opt->e * len;
if (op == 1) j += len; // insertion if (op == MM_CIGAR_INS) j += len;
else i += len; // deletion else i += len;
update_max_zdrop(score, i, j, &max, &max_i, &max_j, opt->e, &max_zdrop, pos); update_max_zdrop(score, i, j, &max, &max_i, &max_j, opt->e, &max_zdrop, pos);
} }
} }
@@ -90,18 +91,19 @@ static int mm_test_zdrop(void *km, const mm_mapopt_t *opt, const uint8_t *qseq,
static void mm_fix_cigar(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq, int *qshift, int *tshift) static void mm_fix_cigar(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq, int *qshift, int *tshift)
{ {
mm_extra_t *p = r->p; mm_extra_t *p = r->p;
int32_t k, toff = 0, qoff = 0, to_shrink = 0; int32_t toff = 0, qoff = 0, to_shrink = 0;
uint32_t k;
*qshift = *tshift = 0; *qshift = *tshift = 0;
if (p->n_cigar <= 1) return; if (p->n_cigar <= 1) return;
for (k = 0; k < p->n_cigar; ++k) { // indel left alignment for (k = 0; k < p->n_cigar; ++k) { // indel left alignment
uint32_t op = p->cigar[k]&0xf, len = p->cigar[k]>>4; uint32_t op = p->cigar[k]&0xf, len = p->cigar[k]>>4;
if (len == 0) to_shrink = 1; if (len == 0) to_shrink = 1;
if (op == 0) { if (op == MM_CIGAR_MATCH) {
toff += len, qoff += len; toff += len, qoff += len;
} else if (op == 1 || op == 2) { // insertion or deletion } else if (op == MM_CIGAR_INS || op == MM_CIGAR_DEL) {
if (k > 0 && k < p->n_cigar - 1 && (p->cigar[k-1]&0xf) == 0 && (p->cigar[k+1]&0xf) == 0) { if (k > 0 && k < p->n_cigar - 1 && (p->cigar[k-1]&0xf) == 0 && (p->cigar[k+1]&0xf) == 0) {
int l, prev_len = p->cigar[k-1] >> 4; int l, prev_len = p->cigar[k-1] >> 4;
if (op == 1) { if (op == MM_CIGAR_INS) {
for (l = 0; l < prev_len; ++l) for (l = 0; l < prev_len; ++l)
if (qseq[qoff - 1 - l] != qseq[qoff + len - 1 - l]) if (qseq[qoff - 1 - l] != qseq[qoff + len - 1 - l])
break; break;
@@ -114,13 +116,32 @@ static void mm_fix_cigar(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq,
p->cigar[k-1] -= l<<4, p->cigar[k+1] += l<<4, qoff -= l, toff -= l; p->cigar[k-1] -= l<<4, p->cigar[k+1] += l<<4, qoff -= l, toff -= l;
if (l == prev_len) to_shrink = 1; if (l == prev_len) to_shrink = 1;
} }
if (op == 1) qoff += len; if (op == MM_CIGAR_INS) qoff += len;
else toff += len; else toff += len;
} else if (op == 3) { } else if (op == MM_CIGAR_N_SKIP) {
toff += len; toff += len;
} }
} }
assert(qoff == r->qe - r->qs && toff == r->re - r->rs); assert(qoff == r->qe - r->qs && toff == r->re - r->rs);
for (k = 0; k < p->n_cigar - 2; ++k) { // fix CIGAR like 5I6D7I
if ((p->cigar[k]&0xf) > 0 && (p->cigar[k]&0xf) + (p->cigar[k+1]&0xf) == 3) {
uint32_t l, s[3] = {0,0,0};
for (l = k; l < p->n_cigar; ++l) { // count number of adjacent I and D
uint32_t op = p->cigar[l]&0xf;
if (op == MM_CIGAR_INS || op == MM_CIGAR_DEL || p->cigar[l]>>4 == 0)
s[op] += p->cigar[l] >> 4;
else break;
}
if (s[1] > 0 && s[2] > 0 && l - k > 2) { // turn to a single I and a single D
p->cigar[k] = s[1]<<4|MM_CIGAR_INS;
p->cigar[k+1] = s[2]<<4|MM_CIGAR_DEL;
for (k += 2; k < l; ++k)
p->cigar[k] &= 0xf;
to_shrink = 1;
}
k = l;
}
}
if (to_shrink) { // squeeze out zero-length operations if (to_shrink) { // squeeze out zero-length operations
int32_t l = 0; int32_t l = 0;
for (k = 0; k < p->n_cigar; ++k) // squeeze out zero-length operations for (k = 0; k < p->n_cigar; ++k) // squeeze out zero-length operations
@@ -133,9 +154,9 @@ static void mm_fix_cigar(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq,
else p->cigar[k+1] += p->cigar[k]>>4<<4; // add length to the next CIGAR operator else p->cigar[k+1] += p->cigar[k]>>4<<4; // add length to the next CIGAR operator
p->n_cigar = l; p->n_cigar = l;
} }
if ((p->cigar[0]&0xf) == 1 || (p->cigar[0]&0xf) == 2) { // get rid of leading I or D if ((p->cigar[0]&0xf) == MM_CIGAR_INS || (p->cigar[0]&0xf) == MM_CIGAR_DEL) { // get rid of leading I or D
int32_t l = p->cigar[0] >> 4; int32_t l = p->cigar[0] >> 4;
if ((p->cigar[0]&0xf) == 1) { if ((p->cigar[0]&0xf) == MM_CIGAR_INS) {
if (r->rev) r->qe -= l; if (r->rev) r->qe -= l;
else r->qs += l; else r->qs += l;
*qshift = l; *qshift = l;
@@ -145,10 +166,82 @@ static void mm_fix_cigar(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq,
} }
} }
static void mm_update_extra(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq, const int8_t *mat, int8_t q, int8_t e) static void mm_update_cigar_eqx(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq) // written by @armintoepfer
{ {
uint32_t k, l, toff = 0, qoff = 0; uint32_t n_EQX = 0;
int32_t s = 0, max = 0, qshift, tshift; uint32_t k, l, m, cap, toff = 0, qoff = 0, n_M = 0;
mm_extra_t *p;
if (r->p == 0) return;
for (k = 0; k < r->p->n_cigar; ++k) {
uint32_t op = r->p->cigar[k]&0xf, len = r->p->cigar[k]>>4;
if (op == MM_CIGAR_MATCH) {
while (len > 0) {
for (l = 0; l < len && qseq[qoff + l] == tseq[toff + l]; ++l) {} // run of "="; TODO: N<=>N is converted to "="
if (l > 0) { ++n_EQX; len -= l; toff += l; qoff += l; }
for (l = 0; l < len && qseq[qoff + l] != tseq[toff + l]; ++l) {} // run of "X"
if (l > 0) { ++n_EQX; len -= l; toff += l; qoff += l; }
}
++n_M;
} else if (op == MM_CIGAR_INS) {
qoff += len;
} else if (op == MM_CIGAR_DEL) {
toff += len;
} else if (op == MM_CIGAR_N_SKIP) {
toff += len;
}
}
// update in-place if we can
if (n_EQX == n_M) {
for (k = 0; k < r->p->n_cigar; ++k) {
uint32_t op = r->p->cigar[k]&0xf, len = r->p->cigar[k]>>4;
if (op == MM_CIGAR_MATCH) r->p->cigar[k] = len << 4 | MM_CIGAR_EQ_MATCH;
}
return;
}
// allocate new storage
cap = r->p->n_cigar + (n_EQX - n_M) + sizeof(mm_extra_t);
kroundup32(cap);
p = (mm_extra_t*)calloc(cap, 4);
memcpy(p, r->p, sizeof(mm_extra_t));
p->capacity = cap;
// update cigar while copying
toff = qoff = m = 0;
for (k = 0; k < r->p->n_cigar; ++k) {
uint32_t op = r->p->cigar[k]&0xf, len = r->p->cigar[k]>>4;
if (op == MM_CIGAR_MATCH) {
while (len > 0) {
// match
for (l = 0; l < len && qseq[qoff + l] == tseq[toff + l]; ++l) {}
if (l > 0) p->cigar[m++] = l << 4 | MM_CIGAR_EQ_MATCH;
len -= l;
toff += l, qoff += l;
// mismatch
for (l = 0; l < len && qseq[qoff + l] != tseq[toff + l]; ++l) {}
if (l > 0) p->cigar[m++] = l << 4 | MM_CIGAR_X_MISMATCH;
len -= l;
toff += l, qoff += l;
}
continue;
} else if (op == MM_CIGAR_INS) {
qoff += len;
} else if (op == MM_CIGAR_DEL) {
toff += len;
} else if (op == MM_CIGAR_N_SKIP) {
toff += len;
}
p->cigar[m++] = r->p->cigar[k];
}
p->n_cigar = m;
free(r->p);
r->p = p;
}
static void mm_update_extra(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq, const int8_t *mat, int8_t q, int8_t e, int is_eqx, int log_gap)
{
uint32_t k, l;
int32_t qshift, tshift, toff = 0, qoff = 0;
double s = 0.0, max = 0.0;
mm_extra_t *p = r->p; mm_extra_t *p = r->p;
if (p == 0) return; if (p == 0) return;
mm_fix_cigar(r, qseq, tseq, &qshift, &tshift); mm_fix_cigar(r, qseq, tseq, &qshift, &tshift);
@@ -156,7 +249,7 @@ static void mm_update_extra(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *ts
r->blen = r->mlen = 0; r->blen = r->mlen = 0;
for (k = 0; k < p->n_cigar; ++k) { for (k = 0; k < p->n_cigar; ++k) {
uint32_t op = p->cigar[k]&0xf, len = p->cigar[k]>>4; uint32_t op = p->cigar[k]&0xf, len = p->cigar[k]>>4;
if (op == 0) { // match/mismatch if (op == MM_CIGAR_MATCH) {
int n_ambi = 0, n_diff = 0; int n_ambi = 0, n_diff = 0;
for (l = 0; l < len; ++l) { for (l = 0; l < len; ++l) {
int cq = qseq[qoff + l], ct = tseq[toff + l]; int cq = qseq[qoff + l], ct = tseq[toff + l];
@@ -168,28 +261,31 @@ static void mm_update_extra(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *ts
} }
r->blen += len - n_ambi, r->mlen += len - (n_ambi + n_diff), p->n_ambi += n_ambi; r->blen += len - n_ambi, r->mlen += len - (n_ambi + n_diff), p->n_ambi += n_ambi;
toff += len, qoff += len; toff += len, qoff += len;
} else if (op == 1) { // insertion } else if (op == MM_CIGAR_INS) {
int n_ambi = 0; int n_ambi = 0;
for (l = 0; l < len; ++l) for (l = 0; l < len; ++l)
if (qseq[qoff + l] > 3) ++n_ambi; if (qseq[qoff + l] > 3) ++n_ambi;
r->blen += len - n_ambi, p->n_ambi += n_ambi; r->blen += len - n_ambi, p->n_ambi += n_ambi;
s -= q + e * len; if (log_gap) s -= q + (double)e * mg_log2(1.0 + len);
else s -= q + e;
if (s < 0) s = 0; if (s < 0) s = 0;
qoff += len; qoff += len;
} else if (op == 2) { // deletion } else if (op == MM_CIGAR_DEL) {
int n_ambi = 0; int n_ambi = 0;
for (l = 0; l < len; ++l) for (l = 0; l < len; ++l)
if (tseq[toff + l] > 3) ++n_ambi; if (tseq[toff + l] > 3) ++n_ambi;
r->blen += len - n_ambi, p->n_ambi += n_ambi; r->blen += len - n_ambi, p->n_ambi += n_ambi;
s -= q + e * len; if (log_gap) s -= q + (double)e * mg_log2(1.0 + len);
else s -= q + e;
if (s < 0) s = 0; if (s < 0) s = 0;
toff += len; toff += len;
} else if (op == 3) { // intron } else if (op == MM_CIGAR_N_SKIP) {
toff += len; toff += len;
} }
} }
p->dp_max = max; p->dp_max = (int32_t)(max + .499);
assert(qoff == r->qe - r->qs && toff == r->re - r->rs); assert(qoff == r->qe - r->qs && toff == r->re - r->rs);
if (is_eqx) mm_update_cigar_eqx(r, qseq, tseq); // NB: it has to be called here as changes to qseq and tseq are not returned
} }
static void mm_append_cigar(mm_reg1_t *r, uint32_t n_cigar, uint32_t *cigar) // TODO: this calls the libc realloc() static void mm_append_cigar(mm_reg1_t *r, uint32_t n_cigar, uint32_t *cigar) // TODO: this calls the libc realloc()
@@ -197,12 +293,12 @@ static void mm_append_cigar(mm_reg1_t *r, uint32_t n_cigar, uint32_t *cigar) //
mm_extra_t *p; mm_extra_t *p;
if (n_cigar == 0) return; if (n_cigar == 0) return;
if (r->p == 0) { if (r->p == 0) {
uint32_t capacity = n_cigar + sizeof(mm_extra_t); uint32_t capacity = n_cigar + sizeof(mm_extra_t)/4;
kroundup32(capacity); kroundup32(capacity);
r->p = (mm_extra_t*)calloc(capacity, 4); r->p = (mm_extra_t*)calloc(capacity, 4);
r->p->capacity = capacity; r->p->capacity = capacity;
} else if (r->p->n_cigar + n_cigar + sizeof(mm_extra_t) > r->p->capacity) { } else if (r->p->n_cigar + n_cigar + sizeof(mm_extra_t)/4 > r->p->capacity) {
r->p->capacity = r->p->n_cigar + n_cigar + sizeof(mm_extra_t); r->p->capacity = r->p->n_cigar + n_cigar + sizeof(mm_extra_t)/4;
kroundup32(r->p->capacity); kroundup32(r->p->capacity);
r->p = (mm_extra_t*)realloc(r->p, r->p->capacity * 4); r->p = (mm_extra_t*)realloc(r->p, r->p->capacity * 4);
} }
@@ -217,7 +313,7 @@ static void mm_append_cigar(mm_reg1_t *r, uint32_t n_cigar, uint32_t *cigar) //
} }
} }
static void mm_align_pair(void *km, const mm_mapopt_t *opt, int qlen, const uint8_t *qseq, int tlen, const uint8_t *tseq, const int8_t *mat, int w, int end_bonus, int zdrop, int flag, ksw_extz_t *ez) static void mm_align_pair(void *km, const mm_mapopt_t *opt, int qlen, const uint8_t *qseq, int tlen, const uint8_t *tseq, const uint8_t *junc, const int8_t *mat, int w, int end_bonus, int zdrop, int flag, ksw_extz_t *ez)
{ {
if (mm_dbg_flag & MM_DBG_PRINT_ALN_SEQ) { if (mm_dbg_flag & MM_DBG_PRINT_ALN_SEQ) {
int i; int i;
@@ -227,8 +323,11 @@ static void mm_align_pair(void *km, const mm_mapopt_t *opt, int qlen, const uint
for (i = 0; i < qlen; ++i) fputc("ACGTN"[qseq[i]], stderr); for (i = 0; i < qlen; ++i) fputc("ACGTN"[qseq[i]], stderr);
fputc('\n', stderr); fputc('\n', stderr);
} }
if (opt->flag & MM_F_SPLICE) if (opt->max_sw_mat > 0 && (int64_t)tlen * qlen > opt->max_sw_mat) {
ksw_exts2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->noncan, zdrop, flag, ez); ksw_reset_extz(ez);
ez->zdropped = 1;
} else if (opt->flag & MM_F_SPLICE)
ksw_exts2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->noncan, zdrop, opt->junc_bonus, flag, junc, ez);
else if (opt->q == opt->q2 && opt->e == opt->e2) else if (opt->q == opt->q2 && opt->e == opt->e2)
ksw_extz2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, w, zdrop, end_bonus, flag, ez); ksw_extz2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, w, zdrop, end_bonus, flag, ez);
else else
@@ -237,7 +336,7 @@ static void mm_align_pair(void *km, const mm_mapopt_t *opt, int qlen, const uint
int i; int i;
fprintf(stderr, "score=%d, cigar=", ez->score); fprintf(stderr, "score=%d, cigar=", ez->score);
for (i = 0; i < ez->n_cigar; ++i) for (i = 0; i < ez->n_cigar; ++i)
fprintf(stderr, "%d%c", ez->cigar[i]>>4, "MIDN"[ez->cigar[i]&0xf]); fprintf(stderr, "%d%c", ez->cigar[i]>>4, MM_CIGAR_STR[ez->cigar[i]&0xf]);
fprintf(stderr, "\n"); fprintf(stderr, "\n");
} }
} }
@@ -268,20 +367,30 @@ static inline void mm_adjust_minier(const mm_idx_t *mi, uint8_t *const qseq0[2],
} }
} }
static void mm_filter_bad_seeds(void *km, int as1, int cnt1, mm128_t *a, int min_gap, int diff_thres, int max_ext_len, int max_ext_cnt) static int *collect_long_gaps(void *km, int as1, int cnt1, mm128_t *a, int min_gap, int *n_)
{ {
int max_st, max_en, n, i, k, max, *K; int i, n, *K;
*n_ = 0;
for (i = 1, n = 0; i < cnt1; ++i) { // count the number of gaps longer than min_gap for (i = 1, n = 0; i < cnt1; ++i) { // count the number of gaps longer than min_gap
int gap = ((int32_t)a[as1 + i].y - a[as1 + i - 1].y) - ((int32_t)a[as1 + i].x - a[as1 + i - 1].x); int gap = ((int32_t)a[as1 + i].y - a[as1 + i - 1].y) - ((int32_t)a[as1 + i].x - a[as1 + i - 1].x);
if (gap < -min_gap || gap > min_gap) ++n; if (gap < -min_gap || gap > min_gap) ++n;
} }
if (n <= 1) return; if (n <= 1) return 0;
K = (int*)kmalloc(km, n * sizeof(int)); K = (int*)kmalloc(km, n * sizeof(int));
for (i = 1, n = 0; i < cnt1; ++i) { // store the positions of long gaps for (i = 1, n = 0; i < cnt1; ++i) { // store the positions of long gaps
int gap = ((int32_t)a[as1 + i].y - a[as1 + i - 1].y) - ((int32_t)a[as1 + i].x - a[as1 + i - 1].x); int gap = ((int32_t)a[as1 + i].y - a[as1 + i - 1].y) - ((int32_t)a[as1 + i].x - a[as1 + i - 1].x);
if (gap < -min_gap || gap > min_gap) if (gap < -min_gap || gap > min_gap)
K[n++] = i; K[n++] = i;
} }
*n_ = n;
return K;
}
static void mm_filter_bad_seeds(void *km, int as1, int cnt1, mm128_t *a, int min_gap, int diff_thres, int max_ext_len, int max_ext_cnt)
{
int max_st, max_en, n, i, k, max, *K;
K = collect_long_gaps(km, as1, cnt1, a, min_gap, &n);
if (K == 0) return;
max = 0, max_st = max_en = -1; max = 0, max_st = max_en = -1;
for (k = 0;; ++k) { // traverse long gaps for (k = 0;; ++k) { // traverse long gaps
int gap, l, n_ins = 0, n_del = 0, qs, rs, max_diff = 0, max_diff_l = -1; int gap, l, n_ins = 0, n_del = 0, qs, rs, max_diff = 0, max_diff_l = -1;
@@ -293,7 +402,7 @@ static void mm_filter_bad_seeds(void *km, int as1, int cnt1, mm128_t *a, int min
if (k == n) break; if (k == n) break;
} }
i = K[k]; i = K[k];
gap = ((int32_t)a[as1 + i].y - a[as1 + i - 1].y) - ((int32_t)a[as1 + i].x - a[as1 + i - 1].x); gap = ((int32_t)a[as1 + i].y - (int32_t)a[as1 + i - 1].y) - (int32_t)(a[as1 + i].x - a[as1 + i - 1].x);
if (gap > 0) n_ins += gap; if (gap > 0) n_ins += gap;
else n_del += -gap; else n_del += -gap;
qs = (int32_t)a[as1 + i - 1].y; qs = (int32_t)a[as1 + i - 1].y;
@@ -301,7 +410,7 @@ static void mm_filter_bad_seeds(void *km, int as1, int cnt1, mm128_t *a, int min
for (l = k + 1; l < n && l <= k + max_ext_cnt; ++l) { for (l = k + 1; l < n && l <= k + max_ext_cnt; ++l) {
int j = K[l], diff; int j = K[l], diff;
if ((int32_t)a[as1 + j].y - qs > max_ext_len || (int32_t)a[as1 + j].x - rs > max_ext_len) break; if ((int32_t)a[as1 + j].y - qs > max_ext_len || (int32_t)a[as1 + j].x - rs > max_ext_len) break;
gap = ((int32_t)a[as1 + j].y - (int32_t)a[as1 + j - 1].y) - (a[as1 + j].x - a[as1 + j - 1].x); gap = ((int32_t)a[as1 + j].y - (int32_t)a[as1 + j - 1].y) - (int32_t)(a[as1 + j].x - a[as1 + j - 1].x);
if (gap > 0) n_ins += gap; if (gap > 0) n_ins += gap;
else n_del += -gap; else n_del += -gap;
diff = n_ins + n_del - abs(n_ins - n_del); diff = n_ins + n_del - abs(n_ins - n_del);
@@ -314,6 +423,42 @@ static void mm_filter_bad_seeds(void *km, int as1, int cnt1, mm128_t *a, int min
kfree(km, K); kfree(km, K);
} }
static void mm_filter_bad_seeds_alt(void *km, int as1, int cnt1, mm128_t *a, int min_gap, int max_ext)
{
int n, k, *K;
K = collect_long_gaps(km, as1, cnt1, a, min_gap, &n);
if (K == 0) return;
for (k = 0; k < n;) {
int i = K[k], l;
int gap1 = ((int32_t)a[as1 + i].y - (int32_t)a[as1 + i - 1].y) - ((int32_t)a[as1 + i].x - (int32_t)a[as1 + i - 1].x);
int re1 = (int32_t)a[as1 + i].x;
int qe1 = (int32_t)a[as1 + i].y;
gap1 = gap1 > 0? gap1 : -gap1;
for (l = k + 1; l < n; ++l) {
int j = K[l], gap2, q_span_pre, rs2, qs2, m;
if ((int32_t)a[as1 + j].y - qe1 > max_ext || (int32_t)a[as1 + j].x - re1 > max_ext) break;
gap2 = ((int32_t)a[as1 + j].y - (int32_t)a[as1 + j - 1].y) - (int32_t)(a[as1 + j].x - a[as1 + j - 1].x);
q_span_pre = a[as1 + j - 1].y >> 32 & 0xff;
rs2 = (int32_t)a[as1 + j - 1].x + q_span_pre;
qs2 = (int32_t)a[as1 + j - 1].y + q_span_pre;
m = rs2 - re1 < qs2 - qe1? rs2 - re1 : qs2 - qe1;
gap2 = gap2 > 0? gap2 : -gap2;
if (m > gap1 + gap2) break;
re1 = (int32_t)a[as1 + j].x;
qe1 = (int32_t)a[as1 + j].y;
gap1 = gap2;
}
if (l > k + 1) {
int j, end = K[l - 1];
for (j = K[k]; j < end; ++j)
a[as1 + j].y |= MM_SEED_IGNORE;
a[as1 + end].y |= MM_SEED_LONG_JOIN;
}
k = l;
}
kfree(km, K);
}
static void mm_fix_bad_ends(const mm_reg1_t *r, const mm128_t *a, int bw, int min_match, int32_t *as, int32_t *cnt) static void mm_fix_bad_ends(const mm_reg1_t *r, const mm128_t *a, int bw, int min_match, int32_t *as, int32_t *cnt)
{ {
int32_t i, l, m; int32_t i, l, m;
@@ -350,7 +495,7 @@ static void mm_fix_bad_ends(const mm_reg1_t *r, const mm128_t *a, int bw, int mi
} }
} }
static void mm_max_stretch(const mm_mapopt_t *opt, const mm_reg1_t *r, const mm128_t *a, int32_t *as, int32_t *cnt) static void mm_max_stretch(const mm_reg1_t *r, const mm128_t *a, int32_t *as, int32_t *cnt)
{ {
int32_t i, score, max_score, len, max_i, max_len; int32_t i, score, max_score, len, max_i, max_len;
@@ -388,11 +533,16 @@ static int mm_seed_ext_score(void *km, const mm_mapopt_t *opt, const mm_idx_t *m
qe = (uint32_t)a->y + 1, qs = qe - q_span; qe = (uint32_t)a->y + 1, qs = qe - q_span;
rs = rs - ext_len > 0? rs - ext_len : 0; rs = rs - ext_len > 0? rs - ext_len : 0;
qs = qs - ext_len > 0? qs - ext_len : 0; qs = qs - ext_len > 0? qs - ext_len : 0;
re = re + ext_len < mi->seq[rid].len? re + ext_len : mi->seq[rid].len; re = re + ext_len < (int32_t)mi->seq[rid].len? re + ext_len : mi->seq[rid].len;
qe = qe + ext_len < qlen? qe + ext_len : qlen; qe = qe + ext_len < qlen? qe + ext_len : qlen;
tseq = (uint8_t*)kmalloc(km, re - rs); tseq = (uint8_t*)kmalloc(km, re - rs);
mm_idx_getseq(mi, rid, rs, re, tseq); if (opt->flag & MM_F_QSTRAND) {
qseq = qseq0[0] + qs;
mm_idx_getseq2(mi, a->x>>63, rid, rs, re, tseq);
} else {
qseq = qseq0[a->x>>63] + qs; qseq = qseq0[a->x>>63] + qs;
mm_idx_getseq(mi, rid, rs, re, tseq);
}
qp = ksw_ll_qinit(km, 2, qe - qs, qseq, 5, mat); qp = ksw_ll_qinit(km, 2, qe - qs, qseq, 5, mat);
score = ksw_ll_i16(qp, re - rs, tseq, opt->q, opt->e, &q_off, &t_off); score = ksw_ll_i16(qp, re - rs, tseq, opt->q, opt->e, &q_off, &t_off);
kfree(km, tseq); kfree(km, tseq);
@@ -424,8 +574,8 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
{ {
int is_sr = !!(opt->flag & MM_F_SR), is_splice = !!(opt->flag & MM_F_SPLICE); int is_sr = !!(opt->flag & MM_F_SR), is_splice = !!(opt->flag & MM_F_SPLICE);
int32_t rid = a[r->as].x<<1>>33, rev = a[r->as].x>>63, as1, cnt1; int32_t rid = a[r->as].x<<1>>33, rev = a[r->as].x>>63, as1, cnt1;
uint8_t *tseq, *qseq; uint8_t *tseq, *qseq, *junc;
int32_t i, l, bw, dropped = 0, extra_flag = 0, rs0, re0, qs0, qe0; int32_t i, l, bw, bw_long, dropped = 0, extra_flag = 0, rs0, re0, qs0, qe0;
int32_t rs, re, qs, qe; int32_t rs, re, qs, qe;
int32_t rs1, qs1, re1, qe1; int32_t rs1, qs1, re1, qe1;
int8_t mat[25]; int8_t mat[25];
@@ -434,22 +584,26 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
r2->cnt = 0; r2->cnt = 0;
if (r->cnt == 0) return; if (r->cnt == 0) return;
ksw_gen_simple_mat(5, mat, opt->a, opt->b); ksw_gen_simple_mat(5, mat, opt->a, opt->b, opt->sc_ambi);
bw = (int)(opt->bw * 1.5 + 1.); bw = (int)(opt->bw * 1.5 + 1.);
bw_long = (int)(opt->bw_long * 1.5 + 1.);
if (bw_long < bw) bw_long = bw;
if (is_sr && !(mi->flag & MM_I_HPC)) { if (is_sr && !(mi->flag & MM_I_HPC)) {
mm_max_stretch(opt, r, a, &as1, &cnt1); mm_max_stretch(r, a, &as1, &cnt1);
rs = (int32_t)a[as1].x + 1 - (int32_t)(a[as1].y>>32&0xff); rs = (int32_t)a[as1].x + 1 - (int32_t)(a[as1].y>>32&0xff);
qs = (int32_t)a[as1].y + 1 - (int32_t)(a[as1].y>>32&0xff); qs = (int32_t)a[as1].y + 1 - (int32_t)(a[as1].y>>32&0xff);
re = (int32_t)a[as1+cnt1-1].x + 1; re = (int32_t)a[as1+cnt1-1].x + 1;
qe = (int32_t)a[as1+cnt1-1].y + 1; qe = (int32_t)a[as1+cnt1-1].y + 1;
} else { } else {
if (is_splice) { if (!(opt->flag & MM_F_NO_END_FLT)) {
if (is_splice)
mm_fix_bad_ends_splice(km, opt, mi, r, mat, qlen, qseq0, a, &as1, &cnt1); mm_fix_bad_ends_splice(km, opt, mi, r, mat, qlen, qseq0, a, &as1, &cnt1);
} else { else
mm_fix_bad_ends(r, a, opt->bw, opt->min_chain_score * 2, &as1, &cnt1); mm_fix_bad_ends(r, a, opt->bw, opt->min_chain_score * 2, &as1, &cnt1);
} } else as1 = r->as, cnt1 = r->cnt;
mm_filter_bad_seeds(km, as1, cnt1, a, 10, 40, opt->max_gap>>1, 10); mm_filter_bad_seeds(km, as1, cnt1, a, 10, 40, opt->max_gap>>1, 10);
mm_filter_bad_seeds_alt(km, as1, cnt1, a, 30, opt->max_gap>>1);
mm_adjust_minier(mi, qseq0, &a[as1], &rs, &qs); mm_adjust_minier(mi, qseq0, &a[as1], &rs, &qs);
mm_adjust_minier(mi, qseq0, &a[as1 + cnt1 - 1], &re, &qe); mm_adjust_minier(mi, qseq0, &a[as1 + cnt1 - 1], &re, &qe);
} }
@@ -473,7 +627,7 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
rs0 = rs - l > 0? rs - l : 0; rs0 = rs - l > 0? rs - l : 0;
l = qlen - qe; l = qlen - qe;
l += l * opt->a + opt->end_bonus > opt->q? (l * opt->a + opt->end_bonus - opt->q) / opt->e : 0; l += l * opt->a + opt->end_bonus > opt->q? (l * opt->a + opt->end_bonus - opt->q) / opt->e : 0;
re0 = re + l < mi->seq[rid].len? re + l : mi->seq[rid].len; re0 = re + l < (int32_t)mi->seq[rid].len? re + l : mi->seq[rid].len;
} else { } else {
// compute rs0 and qs0 // compute rs0 and qs0
rs0 = (int32_t)a[r->as].x + 1 - (int32_t)(a[r->as].y>>32&0xff); rs0 = (int32_t)a[r->as].x + 1 - (int32_t)(a[r->as].y>>32&0xff);
@@ -488,6 +642,7 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
if (++l > opt->min_cnt) { if (++l > opt->min_cnt) {
l = rs0 - x > qs0 - y? rs0 - x : qs0 - y; l = rs0 - x > qs0 - y? rs0 - x : qs0 - y;
rs1 = rs0 - l, qs1 = qs0 - l; rs1 = rs0 - l, qs1 = qs0 - l;
if (rs1 < 0) rs1 = 0; // not strictly necessary; better have this guard for explicit
break; break;
} }
} }
@@ -501,6 +656,7 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
l = l < rs? l : rs; l = l < rs? l : rs;
rs1 = rs1 > rs - l? rs1 : rs - l; rs1 = rs1 > rs - l? rs1 : rs - l;
rs0 = rs0 < rs1? rs0 : rs1; rs0 = rs0 < rs1? rs0 : rs1;
rs0 = rs0 < rs? rs0 : rs;
} else rs0 = rs, qs0 = qs; } else rs0 = rs, qs0 = qs;
// compute re0 and qe0 // compute re0 and qe0
re0 = (int32_t)a[r->as + r->cnt - 1].x + 1; re0 = (int32_t)a[r->as + r->cnt - 1].x + 1;
@@ -517,13 +673,13 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
} }
} }
} }
if (qe < qlen && re < mi->seq[rid].len) { if (qe < qlen && re < (int32_t)mi->seq[rid].len) {
l = qlen - qe < opt->max_gap? qlen - qe : opt->max_gap; l = qlen - qe < opt->max_gap? qlen - qe : opt->max_gap;
qe1 = qe1 < qe + l? qe1 : qe + l; qe1 = qe1 < qe + l? qe1 : qe + l;
qe0 = qe0 > qe1? qe0 : qe1; // at least include qe0 qe0 = qe0 > qe1? qe0 : qe1; // at least include qe0
l += l * opt->a > opt->q? (l * opt->a - opt->q) / opt->e : 0; l += l * opt->a > opt->q? (l * opt->a - opt->q) / opt->e : 0;
l = l < opt->max_gap? l : opt->max_gap; l = l < opt->max_gap? l : opt->max_gap;
l = l < mi->seq[rid].len - re? l : mi->seq[rid].len - re; l = l < (int32_t)mi->seq[rid].len - re? l : mi->seq[rid].len - re;
re1 = re1 < re + l? re1 : re + l; re1 = re1 < re + l? re1 : re + l;
re0 = re0 > re1? re0 : re1; re0 = re0 > re1? re0 : re1;
} else re0 = re, qe0 = qe; } else re0 = re, qe0 = qe;
@@ -539,13 +695,21 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
assert(re0 > rs0); assert(re0 > rs0);
tseq = (uint8_t*)kmalloc(km, re0 - rs0); tseq = (uint8_t*)kmalloc(km, re0 - rs0);
junc = (uint8_t*)kmalloc(km, re0 - rs0);
if (qs > 0 && rs > 0) { // left extension if (qs > 0 && rs > 0) { // left extension; probably the condition can be changed to "qs > qs0 && rs > rs0"
if (opt->flag & MM_F_QSTRAND) {
qseq = &qseq0[0][qs0];
mm_idx_getseq2(mi, rev, rid, rs0, rs, tseq);
} else {
qseq = &qseq0[rev][qs0]; qseq = &qseq0[rev][qs0];
mm_idx_getseq(mi, rid, rs0, rs, tseq); mm_idx_getseq(mi, rid, rs0, rs, tseq);
}
mm_idx_bed_junc(mi, rid, rs0, rs, junc);
mm_seq_rev(qs - qs0, qseq); mm_seq_rev(qs - qs0, qseq);
mm_seq_rev(rs - rs0, tseq); mm_seq_rev(rs - rs0, tseq);
mm_align_pair(km, opt, qs - qs0, qseq, rs - rs0, tseq, mat, bw, opt->end_bonus, r->split_inv? opt->zdrop_inv : opt->zdrop, extra_flag|KSW_EZ_EXTZ_ONLY|KSW_EZ_RIGHT|KSW_EZ_REV_CIGAR, ez); mm_seq_rev(rs - rs0, junc);
mm_align_pair(km, opt, qs - qs0, qseq, rs - rs0, tseq, junc, mat, bw, opt->end_bonus, r->split_inv? opt->zdrop_inv : opt->zdrop, extra_flag|KSW_EZ_EXTZ_ONLY|KSW_EZ_RIGHT|KSW_EZ_REV_CIGAR, ez);
if (ez->n_cigar > 0) { if (ez->n_cigar > 0) {
mm_append_cigar(r, ez->n_cigar, ez->cigar); mm_append_cigar(r, ez->n_cigar, ez->cigar);
r->p->dp_score += ez->max; r->p->dp_score += ez->max;
@@ -565,12 +729,18 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
} else mm_adjust_minier(mi, qseq0, &a[as1 + i], &re, &qe); } else mm_adjust_minier(mi, qseq0, &a[as1 + i], &re, &qe);
re1 = re, qe1 = qe; re1 = re, qe1 = qe;
if (i == cnt1 - 1 || (a[as1+i].y&MM_SEED_LONG_JOIN) || (qe - qs >= opt->min_ksw_len && re - rs >= opt->min_ksw_len)) { if (i == cnt1 - 1 || (a[as1+i].y&MM_SEED_LONG_JOIN) || (qe - qs >= opt->min_ksw_len && re - rs >= opt->min_ksw_len)) {
int j, bw1 = bw, zdrop_code; int j, bw1 = bw_long, zdrop_code;
if (a[as1+i].y & MM_SEED_LONG_JOIN) if (a[as1+i].y & MM_SEED_LONG_JOIN)
bw1 = qe - qs > re - rs? qe - qs : re - rs; bw1 = qe - qs > re - rs? qe - qs : re - rs;
// perform alignment // perform alignment
if (opt->flag & MM_F_QSTRAND) {
qseq = &qseq0[0][qs];
mm_idx_getseq2(mi, rev, rid, rs, re, tseq);
} else {
qseq = &qseq0[rev][qs]; qseq = &qseq0[rev][qs];
mm_idx_getseq(mi, rid, rs, re, tseq); mm_idx_getseq(mi, rid, rs, re, tseq);
}
mm_idx_bed_junc(mi, rid, rs, re, junc);
if (is_sr) { // perform ungapped alignment if (is_sr) { // perform ungapped alignment
assert(qe - qs == re - rs); assert(qe - qs == re - rs);
ksw_reset_extz(ez); ksw_reset_extz(ez);
@@ -578,17 +748,24 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
if (qseq[j] >= 4 || tseq[j] >= 4) ez->score += opt->e2; if (qseq[j] >= 4 || tseq[j] >= 4) ez->score += opt->e2;
else ez->score += qseq[j] == tseq[j]? opt->a : -opt->b; else ez->score += qseq[j] == tseq[j]? opt->a : -opt->b;
} }
ez->cigar = ksw_push_cigar(km, &ez->n_cigar, &ez->m_cigar, ez->cigar, 0, qe - qs); ez->cigar = ksw_push_cigar(km, &ez->n_cigar, &ez->m_cigar, ez->cigar, MM_CIGAR_MATCH, qe - qs);
} else { // perform normal gapped alignment } else { // perform normal gapped alignment
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, mat, bw1, -1, opt->zdrop, extra_flag|KSW_EZ_APPROX_MAX, ez); // first pass: with approximate Z-drop mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, junc, mat, bw1, -1, opt->zdrop, extra_flag|KSW_EZ_APPROX_MAX, ez); // first pass: with approximate Z-drop
} }
// test Z-drop and inversion Z-drop // test Z-drop and inversion Z-drop
if ((zdrop_code = mm_test_zdrop(km, opt, qseq, tseq, ez->n_cigar, ez->cigar, mat)) != 0) if ((zdrop_code = mm_test_zdrop(km, opt, qseq, tseq, ez->n_cigar, ez->cigar, mat)) != 0)
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, mat, bw1, -1, zdrop_code == 2? opt->zdrop_inv : opt->zdrop, extra_flag, ez); // second pass: lift approximate mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, junc, mat, bw1, -1, zdrop_code == 2? opt->zdrop_inv : opt->zdrop, extra_flag, ez); // second pass: lift approximate
// update CIGAR // update CIGAR
if (ez->n_cigar > 0) if (ez->n_cigar > 0)
mm_append_cigar(r, ez->n_cigar, ez->cigar); mm_append_cigar(r, ez->n_cigar, ez->cigar);
if (ez->zdropped) { // truncated by Z-drop; TODO: sometimes Z-drop kicks in because the next seed placement is wrong. This can be fixed in principle. if (ez->zdropped) { // truncated by Z-drop; TODO: sometimes Z-drop kicks in because the next seed placement is wrong. This can be fixed in principle.
if (!r->p) {
assert(ez->n_cigar == 0);
uint32_t capacity = sizeof(mm_extra_t)/4;
kroundup32(capacity);
r->p = (mm_extra_t*)calloc(capacity, 4);
r->p->capacity = capacity;
}
for (j = i - 1; j >= 0; --j) for (j = i - 1; j >= 0; --j)
if ((int32_t)a[as1 + j].x <= rs + ez->max_t) if ((int32_t)a[as1 + j].x <= rs + ez->max_t)
break; break;
@@ -598,7 +775,7 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
re1 = rs + (ez->max_t + 1); re1 = rs + (ez->max_t + 1);
qe1 = qs + (ez->max_q + 1); qe1 = qs + (ez->max_q + 1);
if (cnt1 - (j + 1) >= opt->min_cnt) { if (cnt1 - (j + 1) >= opt->min_cnt) {
mm_split_reg(r, r2, as1 + j + 1 - r->as, qlen, a); mm_split_reg(r, r2, as1 + j + 1 - r->as, qlen, a, !!(opt->flag&MM_F_QSTRAND));
if (zdrop_code == 2) r2->split_inv = 1; if (zdrop_code == 2) r2->split_inv = 1;
} }
break; break;
@@ -608,9 +785,15 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
} }
if (!dropped && qe < qe0 && re < re0) { // right extension if (!dropped && qe < qe0 && re < re0) { // right extension
if (opt->flag & MM_F_QSTRAND) {
qseq = &qseq0[0][qe];
mm_idx_getseq2(mi, rev, rid, re, re0, tseq);
} else {
qseq = &qseq0[rev][qe]; qseq = &qseq0[rev][qe];
mm_idx_getseq(mi, rid, re, re0, tseq); mm_idx_getseq(mi, rid, re, re0, tseq);
mm_align_pair(km, opt, qe0 - qe, qseq, re0 - re, tseq, mat, bw, opt->end_bonus, opt->zdrop, extra_flag|KSW_EZ_EXTZ_ONLY, ez); }
mm_idx_bed_junc(mi, rid, re, re0, junc);
mm_align_pair(km, opt, qe0 - qe, qseq, re0 - re, tseq, junc, mat, bw, opt->end_bonus, opt->zdrop, extra_flag|KSW_EZ_EXTZ_ONLY, ez);
if (ez->n_cigar > 0) { if (ez->n_cigar > 0) {
mm_append_cigar(r, ez->n_cigar, ez->cigar); mm_append_cigar(r, ez->n_cigar, ez->cigar);
r->p->dp_score += ez->max; r->p->dp_score += ez->max;
@@ -621,22 +804,29 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
assert(qe1 <= qlen); assert(qe1 <= qlen);
r->rs = rs1, r->re = re1; r->rs = rs1, r->re = re1;
if (rev) r->qs = qlen - qe1, r->qe = qlen - qs1; if (!rev || (opt->flag & MM_F_QSTRAND)) r->qs = qs1, r->qe = qe1;
else r->qs = qs1, r->qe = qe1; else r->qs = qlen - qe1, r->qe = qlen - qs1;
assert(re1 - rs1 <= re0 - rs0); assert(re1 - rs1 <= re0 - rs0);
if (r->p) { if (r->p) {
if (opt->flag & MM_F_QSTRAND) {
mm_idx_getseq2(mi, r->rev, rid, rs1, re1, tseq);
qseq = &qseq0[0][qs1];
} else {
mm_idx_getseq(mi, rid, rs1, re1, tseq); mm_idx_getseq(mi, rid, rs1, re1, tseq);
mm_update_extra(r, &qseq0[r->rev][qs1], tseq, mat, opt->q, opt->e); qseq = &qseq0[r->rev][qs1];
}
mm_update_extra(r, qseq, tseq, mat, opt->q, opt->e, opt->flag & MM_F_EQX, !(opt->flag & MM_F_SR));
if (rev && r->p->trans_strand) if (rev && r->p->trans_strand)
r->p->trans_strand ^= 3; // flip to the read strand r->p->trans_strand ^= 3; // flip to the read strand
} }
kfree(km, tseq); kfree(km, tseq);
kfree(km, junc);
} }
static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, uint8_t *qseq0[2], const mm_reg1_t *r1, const mm_reg1_t *r2, mm_reg1_t *r_inv, ksw_extz_t *ez) static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, uint8_t *qseq0[2], const mm_reg1_t *r1, const mm_reg1_t *r2, mm_reg1_t *r_inv, ksw_extz_t *ez)
{ { // NB: this doesn't work with the qstrand mode
int tl, ql, score, ret = 0, q_off, t_off; int tl, ql, score, ret = 0, q_off, t_off;
uint8_t *tseq, *qseq; uint8_t *tseq, *qseq;
int8_t mat[25]; int8_t mat[25];
@@ -652,7 +842,7 @@ static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, i
if (ql < opt->min_chain_score || ql > opt->max_gap) return 0; if (ql < opt->min_chain_score || ql > opt->max_gap) return 0;
if (tl < opt->min_chain_score || tl > opt->max_gap) return 0; if (tl < opt->min_chain_score || tl > opt->max_gap) return 0;
ksw_gen_simple_mat(5, mat, opt->a, opt->b); ksw_gen_simple_mat(5, mat, opt->a, opt->b, opt->sc_ambi);
tseq = (uint8_t*)kmalloc(km, tl); tseq = (uint8_t*)kmalloc(km, tl);
mm_idx_getseq(mi, r1->rid, r1->re, r2->rs, tseq); mm_idx_getseq(mi, r1->rid, r1->re, r2->rs, tseq);
qseq = r1->rev? &qseq0[0][r2->qe] : &qseq0[1][qlen - r2->qs]; qseq = r1->rev? &qseq0[0][r2->qe] : &qseq0[1][qlen - r2->qs];
@@ -666,7 +856,7 @@ static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, i
mm_seq_rev(tl, tseq); mm_seq_rev(tl, tseq);
if (score < opt->min_dp_max) goto end_align1_inv; if (score < opt->min_dp_max) goto end_align1_inv;
q_off = ql - (q_off + 1), t_off = tl - (t_off + 1); q_off = ql - (q_off + 1), t_off = tl - (t_off + 1);
mm_align_pair(km, opt, ql - q_off, qseq + q_off, tl - t_off, tseq + t_off, mat, (int)(opt->bw * 1.5), -1, opt->zdrop, KSW_EZ_EXTZ_ONLY, ez); mm_align_pair(km, opt, ql - q_off, qseq + q_off, tl - t_off, tseq + t_off, 0, mat, (int)(opt->bw * 1.5), -1, opt->zdrop, KSW_EZ_EXTZ_ONLY, ez);
if (ez->n_cigar == 0) goto end_align1_inv; // should never be here if (ez->n_cigar == 0) goto end_align1_inv; // should never be here
mm_append_cigar(r_inv, ez->n_cigar, ez->cigar); mm_append_cigar(r_inv, ez->n_cigar, ez->cigar);
r_inv->p->dp_score = ez->max; r_inv->p->dp_score = ez->max;
@@ -685,7 +875,7 @@ static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, i
} }
r_inv->rs = r1->re + t_off; r_inv->rs = r1->re + t_off;
r_inv->re = r_inv->rs + ez->max_t + 1; r_inv->re = r_inv->rs + ez->max_t + 1;
mm_update_extra(r_inv, &qseq[q_off], &tseq[t_off], mat, opt->q, opt->e); mm_update_extra(r_inv, &qseq[q_off], &tseq[t_off], mat, opt->q, opt->e, opt->flag & MM_F_EQX, !(opt->flag & MM_F_SR));
ret = 1; ret = 1;
end_align1_inv: end_align1_inv:
kfree(km, tseq); kfree(km, tseq);
@@ -702,6 +892,71 @@ static inline mm_reg1_t *mm_insert_reg(const mm_reg1_t *r, int i, int *n_regs, m
return regs; return regs;
} }
static inline void mm_count_gaps(const mm_reg1_t *r, int32_t *n_gap_, int32_t *n_gapo_)
{
uint32_t i;
int32_t n_gapo = 0, n_gap = 0;
*n_gap_ = *n_gapo_ = -1;
if (r->p == 0) return;
for (i = 0; i < r->p->n_cigar; ++i) {
int32_t op = r->p->cigar[i] & 0xf, len = r->p->cigar[i] >> 4;
if (op == MM_CIGAR_INS || op == MM_CIGAR_DEL)
++n_gapo, n_gap += len;
}
*n_gap_ = n_gap, *n_gapo_ = n_gapo;
}
double mm_event_identity(const mm_reg1_t *r)
{
int32_t n_gap, n_gapo;
if (r->p == 0) return -1.0f;
mm_count_gaps(r, &n_gap, &n_gapo);
return (double)r->mlen / (r->blen + r->p->n_ambi - n_gap + n_gapo);
}
static int32_t mm_recal_max_dp(const mm_reg1_t *r, double b2, int32_t match_sc)
{
uint32_t i;
int32_t n_gap = 0, n_gapo = 0, n_mis;
double gap_cost = 0.0;
if (r->p == 0) return -1;
for (i = 0; i < r->p->n_cigar; ++i) {
int32_t op = r->p->cigar[i] & 0xf, len = r->p->cigar[i] >> 4;
if (op == MM_CIGAR_INS || op == MM_CIGAR_DEL) {
gap_cost += b2 + (double)mg_log2(1.0 + len);
++n_gapo, n_gap += len;
}
}
n_mis = r->blen + r->p->n_ambi - r->mlen - n_gap;
return (int32_t)(match_sc * (r->mlen - b2 * n_mis - gap_cost) + .499);
}
void mm_update_dp_max(int qlen, int n_regs, mm_reg1_t *regs, float frac, int a, int b)
{
int32_t max = -1, max2 = -1, i, max_i = -1;
double div, b2;
if (n_regs < 2) return;
for (i = 0; i < n_regs; ++i) {
mm_reg1_t *r = &regs[i];
if (r->p == 0) continue;
if (r->p->dp_max > max) max2 = max, max = r->p->dp_max, max_i = i;
else if (r->p->dp_max > max2) max2 = r->p->dp_max;
}
if (max_i < 0 || max < 0 || max2 < 0) return;
if (regs[max_i].qe - regs[max_i].qs < (double)qlen * frac) return;
if (max2 < (double)max * frac) return;
div = 1. - mm_event_identity(&regs[max_i]);
if (div < 0.02) div = 0.02;
b2 = 0.5 / div; // max value: 25
if (b2 * a < b) b2 = (double)a / b;
for (i = 0; i < n_regs; ++i) {
mm_reg1_t *r = &regs[i];
if (r->p == 0) continue;
r->p->dp_max = mm_recal_max_dp(r, b2, a);
if (r->p->dp_max < 0) r->p->dp_max = 0;
}
}
mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a) mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a)
{ {
extern unsigned char seq_nt4_table[256]; extern unsigned char seq_nt4_table[256];
@@ -745,7 +1000,7 @@ mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *m
regs[i].p->trans_strand = opt->flag&MM_F_SPLICE_FOR? 1 : 2; regs[i].p->trans_strand = opt->flag&MM_F_SPLICE_FOR? 1 : 2;
} }
if (r2.cnt > 0) regs = mm_insert_reg(&r2, i, &n_regs, regs); if (r2.cnt > 0) regs = mm_insert_reg(&r2, i, &n_regs, regs);
if (i > 0 && regs[i].split_inv) { if (i > 0 && regs[i].split_inv && !(opt->flag & MM_F_NO_INV)) {
if (mm_align1_inv(km, opt, mi, qlen, qseq0, &regs[i-1], &regs[i], &r2, &ez)) { if (mm_align1_inv(km, opt, mi, qlen, qseq0, &regs[i-1], &regs[i], &r2, &ez)) {
regs = mm_insert_reg(&r2, i, &n_regs, regs); regs = mm_insert_reg(&r2, i, &n_regs, regs);
++i; // skip the inserted INV alignment ++i; // skip the inserted INV alignment
@@ -755,7 +1010,11 @@ mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *m
*n_regs_ = n_regs; *n_regs_ = n_regs;
kfree(km, qseq0[0]); kfree(km, qseq0[0]);
kfree(km, ez.cigar); kfree(km, ez.cigar);
mm_filter_regs(km, opt, qlen, n_regs_, regs); mm_filter_regs(opt, qlen, n_regs_, regs);
mm_hit_sort_by_dp(km, n_regs_, regs); if (!(opt->flag&MM_F_SR) && !opt->split_prefix && qlen >= opt->rank_min_len) {
mm_update_dp_max(qlen, *n_regs_, regs, opt->rank_frac, opt->a, opt->b);
mm_filter_regs(opt, qlen, n_regs_, regs);
}
mm_hit_sort(km, n_regs_, regs, opt->alt_drop);
return regs; return regs;
} }
+30 -12
View File
@@ -15,7 +15,7 @@ unsigned char seq_comp_table[256] = {
48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63,
64, 'T', 'V', 'G', 'H', 'E', 'F', 'C', 'D', 'I', 'J', 'M', 'L', 'K', 'N', 'O', 64, 'T', 'V', 'G', 'H', 'E', 'F', 'C', 'D', 'I', 'J', 'M', 'L', 'K', 'N', 'O',
'P', 'Q', 'Y', 'S', 'A', 'A', 'B', 'W', 'X', 'R', 'Z', 91, 92, 93, 94, 95, 'P', 'Q', 'Y', 'S', 'A', 'A', 'B', 'W', 'X', 'R', 'Z', 91, 92, 93, 94, 95,
64, 't', 'v', 'g', 'h', 'e', 'f', 'c', 'd', 'i', 'j', 'm', 'l', 'k', 'n', 'o', 96, 't', 'v', 'g', 'h', 'e', 'f', 'c', 'd', 'i', 'j', 'm', 'l', 'k', 'n', 'o',
'p', 'q', 'y', 's', 'a', 'a', 'b', 'w', 'x', 'r', 'z', 123, 124, 125, 126, 127, 'p', 'q', 'y', 's', 'a', 'a', 'b', 'w', 'x', 'r', 'z', 123, 124, 125, 126, 127,
128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143,
144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159,
@@ -39,7 +39,7 @@ mm_bseq_file_t *mm_bseq_open(const char *fn)
{ {
mm_bseq_file_t *fp; mm_bseq_file_t *fp;
gzFile f; gzFile f;
f = fn && strcmp(fn, "-")? gzopen(fn, "r") : gzdopen(fileno(stdin), "r"); f = fn && strcmp(fn, "-")? gzopen(fn, "r") : gzdopen(0, "r");
if (f == 0) return 0; if (f == 0) return 0;
fp = (mm_bseq_file_t*)calloc(1, sizeof(mm_bseq_file_t)); fp = (mm_bseq_file_t*)calloc(1, sizeof(mm_bseq_file_t));
fp->fp = f; fp->fp = f;
@@ -62,21 +62,25 @@ static inline char *kstrdup(const kstring_t *s)
return t; return t;
} }
static inline void kseq2bseq(kseq_t *ks, mm_bseq1_t *s, int with_qual) static inline void kseq2bseq(kseq_t *ks, mm_bseq1_t *s, int with_qual, int with_comment)
{ {
int i; int i;
if (ks->name.l == 0)
fprintf(stderr, "[WARNING]\033[1;31m empty sequence name in the input.\033[0m\n");
s->name = kstrdup(&ks->name); s->name = kstrdup(&ks->name);
s->seq = kstrdup(&ks->seq); s->seq = kstrdup(&ks->seq);
for (i = 0; i < ks->seq.l; ++i) // convert U to T for (i = 0; i < (int)ks->seq.l; ++i) // convert U to T
if (s->seq[i] == 'u' || s->seq[i] == 'U') if (s->seq[i] == 'u' || s->seq[i] == 'U')
--s->seq[i]; --s->seq[i];
s->qual = with_qual && ks->qual.l? kstrdup(&ks->qual) : 0; s->qual = with_qual && ks->qual.l? kstrdup(&ks->qual) : 0;
s->comment = with_comment && ks->comment.l? kstrdup(&ks->comment) : 0;
s->l_seq = ks->seq.l; s->l_seq = ks->seq.l;
} }
mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int frag_mode, int *n_) mm_bseq1_t *mm_bseq_read3(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int with_comment, int frag_mode, int *n_)
{ {
int64_t size = 0; int64_t size = 0;
int ret;
kvec_t(mm_bseq1_t) a = {0,0,0}; kvec_t(mm_bseq1_t) a = {0,0,0};
kseq_t *ks = fp->ks; kseq_t *ks = fp->ks;
*n_ = 0; *n_ = 0;
@@ -86,17 +90,17 @@ mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int
size = fp->s.l_seq; size = fp->s.l_seq;
memset(&fp->s, 0, sizeof(mm_bseq1_t)); memset(&fp->s, 0, sizeof(mm_bseq1_t));
} }
while (kseq_read(ks) >= 0) { while ((ret = kseq_read(ks)) >= 0) {
mm_bseq1_t *s; mm_bseq1_t *s;
assert(ks->seq.l <= INT32_MAX); assert(ks->seq.l <= INT32_MAX);
if (a.m == 0) kv_resize(mm_bseq1_t, 0, a, 256); if (a.m == 0) kv_resize(mm_bseq1_t, 0, a, 256);
kv_pushp(mm_bseq1_t, 0, a, &s); kv_pushp(mm_bseq1_t, 0, a, &s);
kseq2bseq(ks, s, with_qual); kseq2bseq(ks, s, with_qual, with_comment);
size += s->l_seq; size += s->l_seq;
if (size >= chunk_size) { if (size >= chunk_size) {
if (frag_mode && a.a[a.n-1].l_seq < CHECK_PAIR_THRES) { if (frag_mode && a.a[a.n-1].l_seq < CHECK_PAIR_THRES) {
while (kseq_read(ks) >= 0) { while ((ret = kseq_read(ks)) >= 0) {
kseq2bseq(ks, &fp->s, with_qual); kseq2bseq(ks, &fp->s, with_qual, with_comment);
if (mm_qname_same(fp->s.name, a.a[a.n-1].name)) { if (mm_qname_same(fp->s.name, a.a[a.n-1].name)) {
kv_push(mm_bseq1_t, 0, a, fp->s); kv_push(mm_bseq1_t, 0, a, fp->s);
memset(&fp->s, 0, sizeof(mm_bseq1_t)); memset(&fp->s, 0, sizeof(mm_bseq1_t));
@@ -106,16 +110,25 @@ mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int
break; break;
} }
} }
if (ret < -1) {
if (a.n) fprintf(stderr, "[WARNING]\033[1;31m failed to parse the FASTA/FASTQ record next to '%s'. Continue anyway.\033[0m\n", a.a[a.n-1].name);
else fprintf(stderr, "[WARNING]\033[1;31m failed to parse the first FASTA/FASTQ record. Continue anyway.\033[0m\n");
}
*n_ = a.n; *n_ = a.n;
return a.a; return a.a;
} }
mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int chunk_size, int with_qual, int *n_) mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int frag_mode, int *n_)
{
return mm_bseq_read3(fp, chunk_size, with_qual, 0, frag_mode, n_);
}
mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int *n_)
{ {
return mm_bseq_read2(fp, chunk_size, with_qual, 0, n_); return mm_bseq_read2(fp, chunk_size, with_qual, 0, n_);
} }
mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int *n_) mm_bseq1_t *mm_bseq_read_frag2(int n_fp, mm_bseq_file_t **fp, int64_t chunk_size, int with_qual, int with_comment, int *n_)
{ {
int i; int i;
int64_t size = 0; int64_t size = 0;
@@ -136,7 +149,7 @@ mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int
for (i = 0; i < n_fp; ++i) { for (i = 0; i < n_fp; ++i) {
mm_bseq1_t *s; mm_bseq1_t *s;
kv_pushp(mm_bseq1_t, 0, a, &s); kv_pushp(mm_bseq1_t, 0, a, &s);
kseq2bseq(fp[i]->ks, s, with_qual); kseq2bseq(fp[i]->ks, s, with_qual, with_comment);
size += s->l_seq; size += s->l_seq;
} }
if (size >= chunk_size) break; if (size >= chunk_size) break;
@@ -145,6 +158,11 @@ mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int
return a.a; return a.a;
} }
mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int64_t chunk_size, int with_qual, int *n_)
{
return mm_bseq_read_frag2(n_fp, fp, chunk_size, with_qual, 0, n_);
}
int mm_bseq_eof(mm_bseq_file_t *fp) int mm_bseq_eof(mm_bseq_file_t *fp)
{ {
return (ks_eof(fp->ks->f) && fp->s.seq == 0); return (ks_eof(fp->ks->f) && fp->s.seq == 0);
+6 -4
View File
@@ -13,14 +13,16 @@ typedef struct mm_bseq_file_s mm_bseq_file_t;
typedef struct { typedef struct {
int l_seq, rid; int l_seq, rid;
char *name, *seq, *qual; char *name, *seq, *qual, *comment;
} mm_bseq1_t; } mm_bseq1_t;
mm_bseq_file_t *mm_bseq_open(const char *fn); mm_bseq_file_t *mm_bseq_open(const char *fn);
void mm_bseq_close(mm_bseq_file_t *fp); void mm_bseq_close(mm_bseq_file_t *fp);
mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int frag_mode, int *n_); mm_bseq1_t *mm_bseq_read3(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int with_comment, int frag_mode, int *n_);
mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int chunk_size, int with_qual, int *n_); mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int frag_mode, int *n_);
mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int *n_); mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int *n_);
mm_bseq1_t *mm_bseq_read_frag2(int n_fp, mm_bseq_file_t **fp, int64_t chunk_size, int with_qual, int with_comment, int *n_);
mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int64_t chunk_size, int with_qual, int *n_);
int mm_bseq_eof(mm_bseq_file_t *fp); int mm_bseq_eof(mm_bseq_file_t *fp);
extern unsigned char seq_nt4_table[256]; extern unsigned char seq_nt4_table[256];
-157
View File
@@ -1,157 +0,0 @@
#include <stdint.h>
#include <string.h>
#include <stdio.h>
#include "minimap.h"
#include "mmpriv.h"
#include "kalloc.h"
static const char LogTable256[256] = {
#define LT(n) n, n, n, n, n, n, n, n, n, n, n, n, n, n, n, n
-1, 0, 1, 1, 2, 2, 2, 2, 3, 3, 3, 3, 3, 3, 3, 3,
LT(4), LT(5), LT(5), LT(6), LT(6), LT(6), LT(6),
LT(7), LT(7), LT(7), LT(7), LT(7), LT(7), LT(7), LT(7)
};
static inline int ilog2_32(uint32_t v)
{
register uint32_t t, tt;
if ((tt = v>>16)) return (t = tt>>8) ? 24 + LogTable256[t] : 16 + LogTable256[tt];
return (t = v>>8) ? 8 + LogTable256[t] : LogTable256[v];
}
mm128_t *mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int min_cnt, int min_sc, int is_cdna, int n_segs, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km)
{ // TODO: make sure this works when n has more than 32 bits
int32_t k, *f, *p, *t, *v, n_u, n_v;
int64_t i, j, st = 0;
uint64_t *u, *u2, sum_qspan = 0;
float avg_qspan;
mm128_t *b, *w;
if (_u) *_u = 0, *n_u_ = 0;
f = (int32_t*)kmalloc(km, n * 4);
p = (int32_t*)kmalloc(km, n * 4);
t = (int32_t*)kmalloc(km, n * 4);
v = (int32_t*)kmalloc(km, n * 4);
memset(t, 0, n * 4);
for (i = 0; i < n; ++i) sum_qspan += a[i].y>>32&0xff;
avg_qspan = (float)sum_qspan / n;
// fill the score and backtrack arrays
for (i = 0; i < n; ++i) {
uint64_t ri = a[i].x;
int64_t max_j = -1;
int32_t qi = (int32_t)a[i].y, q_span = a[i].y>>32&0xff; // NB: only 8 bits of span is used!!!
int32_t max_f = q_span, n_skip = 0, min_d;
int32_t sidi = (a[i].y & MM_SEED_SEG_MASK) >> MM_SEED_SEG_SHIFT;
while (st < i && ri - a[st].x > max_dist_x) ++st;
for (j = i - 1; j >= st; --j) {
int64_t dr = ri - a[j].x;
int32_t dq = qi - (int32_t)a[j].y, dd, sc, log_dd;
int32_t sidj = (a[j].y & MM_SEED_SEG_MASK) >> MM_SEED_SEG_SHIFT;
if ((sidi == sidj && dr == 0) || dq <= 0) continue; // don't skip if an anchor is used by multiple segments; see below
if ((sidi == sidj && dq > max_dist_y) || dq > max_dist_x) continue;
dd = dr > dq? dr - dq : dq - dr;
if (sidi == sidj && dd > bw) continue;
if (n_segs > 1 && !is_cdna && sidi == sidj && dr > max_dist_y) continue;
min_d = dq < dr? dq : dr;
sc = min_d > q_span? q_span : dq < dr? dq : dr;
log_dd = dd? ilog2_32(dd) : 0;
if (is_cdna || sidi != sidj) {
int c_log, c_lin;
c_lin = (int)(dd * .01 * avg_qspan);
c_log = log_dd;
if (sidi != sidj && dr == 0) ++sc; // possibly due to overlapping paired ends; give a minor bonus
else if (dr > dq || sidi != sidj) sc -= c_lin < c_log? c_lin : c_log;
else sc -= c_lin + (c_log>>1);
} else sc -= (int)(dd * .01 * avg_qspan) + (log_dd>>1);
sc += f[j];
if (sc > max_f) {
max_f = sc, max_j = j;
if (n_skip > 0) --n_skip;
} else if (t[j] == i) {
if (++n_skip > max_skip)
break;
}
if (p[j] >= 0) t[p[j]] = i;
}
f[i] = max_f, p[i] = max_j;
v[i] = max_j >= 0 && v[max_j] > max_f? v[max_j] : max_f; // v[] keeps the peak score up to i; f[] is the score ending at i, not always the peak
}
// find the ending positions of chains
memset(t, 0, n * 4);
for (i = 0; i < n; ++i)
if (p[i] >= 0) t[p[i]] = 1;
for (i = n_u = 0; i < n; ++i)
if (t[i] == 0 && v[i] >= min_sc)
++n_u;
if (n_u == 0) {
kfree(km, a); kfree(km, f); kfree(km, p); kfree(km, t); kfree(km, v);
return 0;
}
u = (uint64_t*)kmalloc(km, n_u * 8);
for (i = n_u = 0; i < n; ++i) {
if (t[i] == 0 && v[i] >= min_sc) {
j = i;
while (j >= 0 && f[j] < v[j]) j = p[j]; // find the peak that maximizes f[]
if (j < 0) j = i; // TODO: this should really be assert(j>=0)
u[n_u++] = (uint64_t)f[j] << 32 | j;
}
}
radix_sort_64(u, u + n_u);
for (i = 0; i < n_u>>1; ++i) { // reverse, s.t. the highest scoring chain is the first
uint64_t t = u[i];
u[i] = u[n_u - i - 1], u[n_u - i - 1] = t;
}
// backtrack
memset(t, 0, n * 4);
for (i = n_v = k = 0; i < n_u; ++i) { // starting from the highest score
int32_t n_v0 = n_v, k0 = k;
j = (int32_t)u[i];
do {
v[n_v++] = j;
t[j] = 1;
j = p[j];
} while (j >= 0 && t[j] == 0);
if (j < 0) {
if (n_v - n_v0 >= min_cnt) u[k++] = u[i]>>32<<32 | (n_v - n_v0);
} else if ((int32_t)(u[i]>>32) - f[j] >= min_sc) {
if (n_v - n_v0 >= min_cnt) u[k++] = ((u[i]>>32) - f[j]) << 32 | (n_v - n_v0);
}
if (k0 == k) n_v = n_v0; // no new chain added, reset
}
*n_u_ = n_u = k, *_u = u; // NB: note that u[] may not be sorted by score here
// free temporary arrays
kfree(km, f); kfree(km, p); kfree(km, t);
// write the result to b[]
b = (mm128_t*)kmalloc(km, n_v * sizeof(mm128_t));
for (i = 0, k = 0; i < n_u; ++i) {
int32_t k0 = k, ni = (int32_t)u[i];
for (j = 0; j < ni; ++j)
b[k] = a[v[k0 + (ni - j - 1)]], ++k;
}
kfree(km, v);
// sort u[] and a[] by a[].x, such that adjacent chains may be joined (required by mm_join_long)
w = (mm128_t*)kmalloc(km, n_u * sizeof(mm128_t));
for (i = k = 0; i < n_u; ++i) {
w[i].x = b[k].x, w[i].y = (uint64_t)k<<32|i;
k += (int32_t)u[i];
}
radix_sort_128x(w, w + n_u);
u2 = (uint64_t*)kmalloc(km, n_u * 8);
for (i = k = 0; i < n_u; ++i) {
int32_t j = (int32_t)w[i].y, n = (int32_t)u[j];
u2[i] = u[j];
memcpy(&a[k], &b[w[i].y>>32], n * sizeof(mm128_t));
k += n;
}
memcpy(u, u2, n_u * 8);
memcpy(b, a, k * sizeof(mm128_t)); // write _a_ to _b_ and deallocate _a_ because _a_ is oversized, sometimes a lot
kfree(km, a); kfree(km, w); kfree(km, u2);
return b;
}
+30
View File
@@ -0,0 +1,30 @@
## Contributor Code of Conduct
As contributors and maintainers of this project, we pledge to respect all
people who contribute through reporting issues, posting feature requests,
updating documentation, submitting pull requests or patches, and other
activities.
We are committed to making participation in this project a harassment-free
experience for everyone, regardless of level of experience, gender, gender
identity and expression, sexual orientation, disability, personal appearance,
body size, race, age, or religion.
Examples of unacceptable behavior by participants include the use of sexual
language or imagery, derogatory comments or personal attacks, trolling, public
or private harassment, insults, or other unprofessional conduct.
Project maintainers have the right and responsibility to remove, edit, or
reject comments, commits, code, wiki edits, issues, and other contributions
that are not aligned to this Code of Conduct. Project maintainers or
contributors who do not follow the Code of Conduct may be removed from the
project team.
Instances of abusive, harassing, or otherwise unacceptable behavior may be
reported by opening an issue or contacting the maintainer via email.
This Code of Conduct is adapted from the [Contributor Covenant][cc], [version
1.0.0][v1].
[cc]: http://contributor-covenant.org/
[v1]: http://contributor-covenant.org/version/1/0/0/
+243
View File
@@ -0,0 +1,243 @@
## Table of Contents
- [Introduction & Installation](#intro)
- [Mapping Genomic Reads](#map-reads)
* [Mapping long reads](#map-pb)
* [Mapping Illumina paired-end reads](#map-sr)
* [Evaluating mapping accuracy with simulated reads (for developers)](#mapeval)
- [Mapping Long RNA-seq Reads](#map-rna)
* [Mapping Nanopore 2D cDNA reads](#map-ont-cdna-2d)
* [Mapping Nanopore direct-RNA reads](#map-direct-rna)
* [Mapping PacBio Iso-seq reads](#map-iso-seq)
- [Full-Genome Alignment](#genome-aln)
* [Intra-species assembly alignment](#asm-to-ref)
* [Cross-species full-genome alignment](#x-species)
* [Eyeballing alignment](#view-aln)
* [Calling variants from assembly-to-reference alignment](#asm-var)
* [Constructing self-homology map](#hom-map)
* [Lift Over (for developers)](#liftover)
- [Read Overlap](#read-overlap)
* [Long-read overlap](#long-read-overlap)
* [Evaluating overlap sensitivity (for developers)](#ov-eval)
## <a name="intro"></a>Introduction & Installation
This cookbook walks you through a variety of applications of minimap2 and its
companion script `paftools.js`. All data here are freely available from the
minimap2 release page at version tag [v2.10][v2.10]. Some examples only work
with v2.10 or later.
To acquire the data used in this cookbook and to install minimap2 and paftools,
please follow the command lines below:
```sh
# install minimap2 executables
curl -L https://github.com/lh3/minimap2/releases/download/v2.22/minimap2-2.22_x64-linux.tar.bz2 | tar jxf -
cp minimap2-2.22_x64-linux/{minimap2,k8,paftools.js} . # copy executables
export PATH="$PATH:"`pwd` # put the current directory on PATH
# download example datasets
curl -L https://github.com/lh3/minimap2/releases/download/v2.10/cookbook-data.tgz | tar zxf -
```
## <a name="map-reads"></a>Mapping Genomic Reads
### <a name="map-pb"></a>Mapping long reads
```sh
minimap2 -ax map-pb -t4 ecoli_ref.fa ecoli_p6_25x_canu.fa > mapped.sam
```
Alternatively, you can create a minimap2 index first and then map:
```sh
minimap2 -x map-pb -d ecoli-pb.mmi ecoli_ref.fa # create an index
minimap2 -ax map-pb ecoli-pb.mmi ecoli_p6_25x_canu.fa > mapped.sam
```
This will save you a couple of minutes when you map against the human genome.
**HOWEVER**, key algorithm parameters such as the k-mer length and window
size can't be changed after indexing. Minimap2 will give you a warning if
parameters used in a pre-built index doesn't match parameters on the command
line. **Please always make sure you are using an intended pre-built index.**
### <a name="map-sr"></a>Mapping Illumina paired-end reads:
```sh
minimap2 -ax sr -t4 ecoli_ref.fa ecoli_mason_1.fq ecoli_mason_2.fq > mapped-sr.sam
```
### <a name="mapeval"></a>Evaluating mapping accuracy with simulated reads (for developers)
```sh
minimap2 -ax sr ecoli_ref.fa ecoli_mason_1.fq ecoli_mason_2.fq | paftools.js mapeval -
```
The output is:
```
Q 60 19712 0 0.000000000 19712
Q 0 282 219 0.010953286 19994
U 6
```
where a `U`-line gives the number of unmapped reads (for SAM input only); a
`Q`-line gives:
1. Mapping quality (mapQ) threshold
2. Number of mapped reads between this threshold and the previous mapQ threshold.
3. Number of wrong mappings in the same mapQ interval
4. Accumulative mapping error rate
5. Accumulative number of mappings
For `paftools.js mapeval` to work, you need to encode the true read positions
in read names in the right format. For [pbsim2][pbsim] and [mason2][mason2], we
provide scripts to generate the right format. Simulated reads in this cookbook
were created with the following command lines:
```sh
# in the pbsim2 source code directory:
src/pbsim --depth 1 --length-min 5000 --length-mean 20000 --accuracy-mean 0.95 --hmm_model data/R94.model ../ecoli_ref.fa
paftools.js pbsim2fq ../ecoli_ref.fa.fai sd_0001.maf > ../ecoli_pbsim.fa
# mason2 simulation
mason_simulator --illumina-prob-mismatch-scale 2.5 -ir ecoli_ref.fa -n 10000 -o tmp-l.fq -or tmp-r.fq -oa tmp.sam
paftools.js mason2fq tmp.sam | seqtk seq -1 > ecoli_mason_1.fq
paftools.js mason2fq tmp.sam | seqtk seq -2 > ecoli_mason_2.fq
```
## <a name="map-rna"></a>Mapping Long RNA-seq Reads
### <a name="map-ont-cdna-2d"></a>Mapping Nanopore 2D cDNA reads
```sh
minimap2 -ax splice SIRV_E2.fa SIRV_ont-cdna.fa > aln.sam
```
You can compare the alignment to the true annotations with:
```sh
paftools.js junceval SIRV_E2C.gtf aln.sam
```
It gives the percentage of introns found in the annotation. For SIRV data, it
is possible to achieve higher junction accuracy with
```sh
minimap2 -ax splice --splice-flank=no SIRV_E2.fa SIRV_ont-cdna.fa | paftools.js junceval SIRV_E2C.gtf
```
This is because minimap2 models one additional evolutionarily conserved base
around a canonical junction, but SIRV doesn't honor this signal. Option
`--splice-flank=no` asks minimap2 no to model this additional base.
In the output a tag `ts:A:+` indicates that the read strand is the same as the
transcript strand; `ts:A:-` indicates the read strand is opposite to the
transcript strand. This tag is inferred from the GT-AG signal and is thus only
available to spliced reads.
### <a name="map-direct-rna"></a>Mapping Nanopore direct-RNA reads
```sh
minimap2 -ax splice -k14 -uf SIRV_E2.fa SIRV_ont-drna.fa > aln.sam
```
Direct-RNA reads are noisier, so we use a shorter k-mer for improved
sensitivity. Here, option `-uf` forces minimap2 to map reads to the forward
transcript strand only because direct-RNA reads are stranded. Again, applying
`--splice-flank=no` helps junction accuracy for SIRV data.
### <a name="map-iso-seq"></a>Mapping PacBio Iso-seq reads
```sh
minimap2 -ax splice -uf -C5 SIRV_E2.fa SIRV_iso-seq.fq > aln.sam
```
Option `-C5` reduces the penalty on non-canonical splicing sites. It helps
to align such sites correctly for data with low error rate such as Iso-seq
reads and traditional cDNAs. On this example, minimap2 makes one junction
error. Applying `--splice-flank=no` fixes this alignment error.
Note that the command line above is optimized for the final Iso-seq reads.
PacBio's Iso-seq pipeline produces intermediate sequences at varying quality.
For example, some intermediate reads are not stranded. For these reads, option
`-uf` will lead to more errors. Please revise the minimap2 command line
accordingly.
## <a name="genome-aln"></a>Full-Genome Alignment
### <a name="asm-to-ref"></a>Intra-species assembly alignment
```sh
# option "--cs" is recommended as paftools.js may need it
minimap2 -cx asm5 --cs ecoli_ref.fa ecoli_canu.fa > ecoli_canu.paf
```
Here `ecoli_canu.fa` is the Canu assembly of `ecoli_p6_25x_canu.fa`. This
command line outputs alignments in the [PAF format][paf]. Use `-a` instead of
`-c` to get output in the SAM format.
### <a name="x-species"></a>Cross-species full-genome alignment
```sh
minimap2 -cx asm20 --cs ecoli_ref.fa ecoli_O104:H4.fa > ecoli_O104:H4.paf
sort -k6,6 -k8,8n ecoli_O104:H4.paf | paftools.js call -f ecoli_ref.fa -L10000 -l1000 - > out.vcf
```
Minimap2 has three presets for full-genome alignment: "asm5" for sequence
divergence below 1%, "asm10" for divergence around a couple of percent and
"asm20" for divergence not more than 10%. In theory, with the right setting,
minimap2 should work for sequence pairs with sequence divergence up to ~15%,
but this has not been carefully evaluated.
### <a name="view-aln"></a>Eyeballing alignment
```sh
# option "--cs" required; minimap2-r741 or higher required for the "asm20" preset
minimap2 -cx asm20 --cs ecoli_ref.fa ecoli_O104:H4.fa | paftools.js view - | less -S
```
This prints the alignment in a BLAST-like format.
### <a name="asm-var"></a>Calling variants from assembly-to-reference alignment
```sh
# don't forget the "--cs" option; otherwise it doesn't work
minimap2 -cx asm5 --cs ecoli_ref.fa ecoli_canu.fa \
| sort -k6,6 -k8,8n \
| paftools.js call -f ecoli_ref.fa - > out.vcf
```
Without option `-f`, `paftools.js call` outputs in a custom format. In this
format, lines starting with `R` give the regions covered by one contig only.
This information is not available in the VCF output.
### <a name="hom-map"></a>Constructing self-homology map
```sh
minimap2 -DP -k19 -w19 -m200 ecoli_ref.fa ecoli_ref.fa > out.paf
```
Option `-D` asks minimap2 to ignore anchors from perfect self match and `-P`
outputs all chains. For large nomes, we don't recommend to perform base-level
alignment (with `-c`, `-a` or `--cs`) when `-P` is applied. This is because
base-alignment is slow and occasionally gives wrong alignments close to the
diagonal of a dotter plot. For E. coli, though, base-alignment is still fast.
### <a name="liftover"></a>Lift over (for developers)
```sh
minimap2 -cx asm5 --cs ecoli_ref.fa ecoli_canu.fa > ecoli_canu.paf
echo -e 'tig00000001\t200000\t300000' | paftools.js liftover ecoli_canu.paf -
```
This lifts over a region on query sequences to one or multiple regions on
reference sequences. Note that this paftools.js command may not be efficient
enough to lift millions of regions.
## <a name="read-overlap"></a>Read Overlap
### <a name="long-read-overlap"></a>Long read overlap
```sh
# For pacbio reads:
minimap2 -x ava-pb ecoli_p6_25x_canu.fa ecoli_p6_25x_canu.fa > overlap.paf
# For Nanopore reads (ava-ont also works with PacBio but not as good):
minimap2 -x ava-ont -r 10000 ecoli_p6_25x_canu.fa ecoli_p6_25x_canu.fa > overlap.paf
# If you have miniasm installed:
miniasm -f ecoli_p6_25x_canu.fa overlap.paf > asm.gfa
```
Here we explicitly applied `-r 10000`. We are considering to set this as the
default for the `ava-ont` mode as this seems to improve the contiguity for
nanopore read assembly (Loman, personal communication).
*Minimap2 doesn't work well with short-read overlap.*
### <a name="ov-eval"></a>Evaluating overlap sensitivity (for developers)
```sh
# read to reference mapping
minimap2 -cx map-pb ecoli_ref.fa ecoli_p6_25x_canu.fa > to-ref.paf
# evaluate overlap sensitivity
sort -k6,6 -k8,8n to-ref.paf | paftools.js ov-eval - overlap.paf
```
You can see that for PacBio reads, minimap2 achieves higher overlap sensitivity
with `-x ava-pb` (99% vs 93% with `-x ava-ont`).
[pbsim]: https://github.com/yukiteruono/pbsim2
[mason2]: https://github.com/seqan/seqan/tree/master/apps/mason2
[paf]: https://github.com/lh3/miniasm/blob/master/PAF.md
[v2.10]: https://github.com/lh3/minimap2/releases/tag/v2.10
+1 -1
View File
@@ -59,6 +59,6 @@ void mm_est_err(const mm_idx_t *mi, int qlen, int n_regs, mm_reg1_t *regs, const
n_tot = en - st + 1; n_tot = en - st + 1;
if (r->qs > avg_k && r->rs > avg_k) ++n_tot; if (r->qs > avg_k && r->rs > avg_k) ++n_tot;
if (qlen - r->qs > avg_k && l_ref - r->re > avg_k) ++n_tot; if (qlen - r->qs > avg_k && l_ref - r->re > avg_k) ++n_tot;
r->div = logf((float)n_tot / n_match) / avg_k; r->div = n_match >= n_tot? 0.0f : (float)(1.0 - pow((double)n_match / n_tot, 1.0 / avg_k));
} }
} }
+3 -1
View File
@@ -35,6 +35,8 @@ int main(int argc, char *argv[])
while ((mi = mm_idx_reader_read(r, n_threads)) != 0) { // traverse each part of the index while ((mi = mm_idx_reader_read(r, n_threads)) != 0) { // traverse each part of the index
mm_mapopt_update(&mopt, mi); // this sets the maximum minimizer occurrence; TODO: set a better default in mm_mapopt_init()! mm_mapopt_update(&mopt, mi); // this sets the maximum minimizer occurrence; TODO: set a better default in mm_mapopt_init()!
mm_tbuf_t *tbuf = mm_tbuf_init(); // thread buffer; for multi-threading, allocate one tbuf for each thread mm_tbuf_t *tbuf = mm_tbuf_init(); // thread buffer; for multi-threading, allocate one tbuf for each thread
gzrewind(f);
kseq_rewind(ks);
while (kseq_read(ks) >= 0) { // each kseq_read() call reads one query sequence while (kseq_read(ks) >= 0) { // each kseq_read() call reads one query sequence
mm_reg1_t *reg; mm_reg1_t *reg;
int j, i, n_reg; int j, i, n_reg;
@@ -45,7 +47,7 @@ int main(int argc, char *argv[])
printf("%s\t%d\t%d\t%d\t%c\t", ks->name.s, ks->seq.l, r->qs, r->qe, "+-"[r->rev]); printf("%s\t%d\t%d\t%d\t%c\t", ks->name.s, ks->seq.l, r->qs, r->qe, "+-"[r->rev]);
printf("%s\t%d\t%d\t%d\t%d\t%d\t%d\tcg:Z:", mi->seq[r->rid].name, mi->seq[r->rid].len, r->rs, r->re, r->mlen, r->blen, r->mapq); printf("%s\t%d\t%d\t%d\t%d\t%d\t%d\tcg:Z:", mi->seq[r->rid].name, mi->seq[r->rid].len, r->rs, r->re, r->mlen, r->blen, r->mapq);
for (i = 0; i < r->p->n_cigar; ++i) // IMPORTANT: this gives the CIGAR in the aligned regions. NO soft/hard clippings! for (i = 0; i < r->p->n_cigar; ++i) // IMPORTANT: this gives the CIGAR in the aligned regions. NO soft/hard clippings!
printf("%d%c", r->p->cigar[i]>>4, "MIDSHN"[r->p->cigar[i]&0xf]); printf("%d%c", r->p->cigar[i]>>4, MM_CIGAR_STR[r->p->cigar[i]&0xf]);
putchar('\n'); putchar('\n');
free(r->p); free(r->p);
} }
+161 -54
View File
@@ -79,11 +79,11 @@ static char *mm_escape(char *s)
return s; return s;
} }
static void sam_write_rg_line(kstring_t *str, const char *s) static int sam_write_rg_line(kstring_t *str, const char *s)
{ {
char *p, *q, *r, *rg_line = 0; char *p, *q, *r, *rg_line = 0;
memset(mm_rg_id, 0, 256); memset(mm_rg_id, 0, 256);
if (s == 0) return; if (s == 0) return 0;
if (strstr(s, "@RG") != s) { if (strstr(s, "@RG") != s) {
if (mm_verbose >= 1) fprintf(stderr, "[ERROR] the read group line is not started with @RG\n"); if (mm_verbose >= 1) fprintf(stderr, "[ERROR] the read group line is not started with @RG\n");
goto err_set_rg; goto err_set_rg;
@@ -92,7 +92,8 @@ static void sam_write_rg_line(kstring_t *str, const char *s)
if (mm_verbose >= 1) fprintf(stderr, "[ERROR] the read group line contained literal <tab> characters -- replace with escaped tabs: \\t\n"); if (mm_verbose >= 1) fprintf(stderr, "[ERROR] the read group line contained literal <tab> characters -- replace with escaped tabs: \\t\n");
goto err_set_rg; goto err_set_rg;
} }
rg_line = strdup(s); rg_line = (char*)malloc(strlen(s) + 1);
strcpy(rg_line, s);
mm_escape(rg_line); mm_escape(rg_line);
if ((p = strstr(rg_line, "\tID:")) == 0) { if ((p = strstr(rg_line, "\tID:")) == 0) {
if (mm_verbose >= 1) fprintf(stderr, "[ERROR] no ID within the read group line\n"); if (mm_verbose >= 1) fprintf(stderr, "[ERROR] no ID within the read group line\n");
@@ -107,20 +108,23 @@ static void sam_write_rg_line(kstring_t *str, const char *s)
for (q = p, r = mm_rg_id; *q && *q != '\t' && *q != '\n'; ++q) for (q = p, r = mm_rg_id; *q && *q != '\t' && *q != '\n'; ++q)
*r++ = *q; *r++ = *q;
mm_sprintf_lite(str, "%s\n", rg_line); mm_sprintf_lite(str, "%s\n", rg_line);
return 0;
err_set_rg: err_set_rg:
free(rg_line); free(rg_line);
return -1;
} }
void mm_write_sam_hdr(const mm_idx_t *idx, const char *rg, const char *ver, int argc, char *argv[]) int mm_write_sam_hdr(const mm_idx_t *idx, const char *rg, const char *ver, int argc, char *argv[])
{ {
kstring_t str = {0,0,0}; kstring_t str = {0,0,0};
int ret = 0;
if (idx) { if (idx) {
uint32_t i; uint32_t i;
for (i = 0; i < idx->n_seq; ++i) for (i = 0; i < idx->n_seq; ++i)
printf("@SQ\tSN:%s\tLN:%d\n", idx->seq[i].name, idx->seq[i].len); mm_sprintf_lite(&str, "@SQ\tSN:%s\tLN:%d\n", idx->seq[i].name, idx->seq[i].len);
} }
if (rg) sam_write_rg_line(&str, rg); if (rg) ret = sam_write_rg_line(&str, rg);
mm_sprintf_lite(&str, "@PG\tID:minimap2\tPN:minimap2"); mm_sprintf_lite(&str, "@PG\tID:minimap2\tPN:minimap2");
if (ver) mm_sprintf_lite(&str, "\tVN:%s", ver); if (ver) mm_sprintf_lite(&str, "\tVN:%s", ver);
if (argc > 1) { if (argc > 1) {
@@ -129,36 +133,19 @@ void mm_write_sam_hdr(const mm_idx_t *idx, const char *rg, const char *ver, int
for (i = 1; i < argc; ++i) for (i = 1; i < argc; ++i)
mm_sprintf_lite(&str, " %s", argv[i]); mm_sprintf_lite(&str, " %s", argv[i]);
} }
mm_sprintf_lite(&str, "\n"); mm_err_puts(str.s);
fputs(str.s, stdout);
free(str.s); free(str.s);
return ret;
} }
static void write_cs(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int no_iden) static void write_cs_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq, const mm_reg1_t *r, char *tmp, int no_iden, int write_tag)
{ {
extern unsigned char seq_nt4_table[256];
int i, q_off, t_off; int i, q_off, t_off;
uint8_t *qseq, *tseq; if (write_tag) mm_sprintf_lite(s, "\tcs:Z:");
char *tmp; for (i = q_off = t_off = 0; i < (int)r->p->n_cigar; ++i) {
if (r->p == 0) return;
mm_sprintf_lite(s, "\tcs:Z:");
qseq = (uint8_t*)kmalloc(km, r->qe - r->qs);
tseq = (uint8_t*)kmalloc(km, r->re - r->rs);
tmp = (char*)kmalloc(km, r->re - r->rs > r->qe - r->qs? r->re - r->rs + 1 : r->qe - r->qs + 1);
mm_idx_getseq(mi, r->rid, r->rs, r->re, tseq);
if (!r->rev) {
for (i = r->qs; i < r->qe; ++i)
qseq[i - r->qs] = seq_nt4_table[(uint8_t)t->seq[i]];
} else {
for (i = r->qs; i < r->qe; ++i) {
uint8_t c = seq_nt4_table[(uint8_t)t->seq[i]];
qseq[r->qe - i - 1] = c >= 4? 4 : 3 - c;
}
}
for (i = q_off = t_off = 0; i < r->p->n_cigar; ++i) {
int j, op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4; int j, op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
assert(op >= 0 && op <= 3); assert((op >= MM_CIGAR_MATCH && op <= MM_CIGAR_N_SKIP) || op == MM_CIGAR_EQ_MATCH || op == MM_CIGAR_X_MISMATCH);
if (op == 0) { if (op == MM_CIGAR_MATCH || op == MM_CIGAR_EQ_MATCH || op == MM_CIGAR_X_MISMATCH) {
int l_tmp = 0; int l_tmp = 0;
for (j = 0; j < len; ++j) { for (j = 0; j < len; ++j) {
if (qseq[q_off + j] != tseq[t_off + j]) { if (qseq[q_off + j] != tseq[t_off + j]) {
@@ -179,17 +166,17 @@ static void write_cs(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_
} else mm_sprintf_lite(s, ":%d", l_tmp); } else mm_sprintf_lite(s, ":%d", l_tmp);
} }
q_off += len, t_off += len; q_off += len, t_off += len;
} else if (op == 1) { } else if (op == MM_CIGAR_INS) {
for (j = 0, tmp[len] = 0; j < len; ++j) for (j = 0, tmp[len] = 0; j < len; ++j)
tmp[j] = "acgtn"[qseq[q_off + j]]; tmp[j] = "acgtn"[qseq[q_off + j]];
mm_sprintf_lite(s, "+%s", tmp); mm_sprintf_lite(s, "+%s", tmp);
q_off += len; q_off += len;
} else if (op == 2) { } else if (op == MM_CIGAR_DEL) {
for (j = 0, tmp[len] = 0; j < len; ++j) for (j = 0, tmp[len] = 0; j < len; ++j)
tmp[j] = "acgtn"[tseq[t_off + j]]; tmp[j] = "acgtn"[tseq[t_off + j]];
mm_sprintf_lite(s, "-%s", tmp); mm_sprintf_lite(s, "-%s", tmp);
t_off += len; t_off += len;
} else { } else { // intron
assert(len >= 2); assert(len >= 2);
mm_sprintf_lite(s, "~%c%c%d%c%c", "acgtn"[tseq[t_off]], "acgtn"[tseq[t_off+1]], mm_sprintf_lite(s, "~%c%c%d%c%c", "acgtn"[tseq[t_off]], "acgtn"[tseq[t_off+1]],
len, "acgtn"[tseq[t_off+len-2]], "acgtn"[tseq[t_off+len-1]]); len, "acgtn"[tseq[t_off+len-2]], "acgtn"[tseq[t_off+len-1]]);
@@ -197,9 +184,93 @@ static void write_cs(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_
} }
} }
assert(t_off == r->re - r->rs && q_off == r->qe - r->qs); assert(t_off == r->re - r->rs && q_off == r->qe - r->qs);
}
static void write_MD_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq, const mm_reg1_t *r, char *tmp, int write_tag)
{
int i, q_off, t_off, l_MD = 0;
if (write_tag) mm_sprintf_lite(s, "\tMD:Z:");
for (i = q_off = t_off = 0; i < (int)r->p->n_cigar; ++i) {
int j, op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
assert((op >= MM_CIGAR_MATCH && op <= MM_CIGAR_N_SKIP) || op == MM_CIGAR_EQ_MATCH || op == MM_CIGAR_X_MISMATCH);
if (op == MM_CIGAR_MATCH || op == MM_CIGAR_EQ_MATCH || op == MM_CIGAR_X_MISMATCH) {
for (j = 0; j < len; ++j) {
if (qseq[q_off + j] != tseq[t_off + j]) {
mm_sprintf_lite(s, "%d%c", l_MD, "ACGTN"[tseq[t_off + j]]);
l_MD = 0;
} else ++l_MD;
}
q_off += len, t_off += len;
} else if (op == MM_CIGAR_INS) {
q_off += len;
} else if (op == MM_CIGAR_DEL) {
for (j = 0, tmp[len] = 0; j < len; ++j)
tmp[j] = "ACGTN"[tseq[t_off + j]];
mm_sprintf_lite(s, "%d^%s", l_MD, tmp);
l_MD = 0;
t_off += len;
} else if (op == MM_CIGAR_N_SKIP) {
t_off += len;
}
}
if (l_MD > 0) mm_sprintf_lite(s, "%d", l_MD);
assert(t_off == r->re - r->rs && q_off == r->qe - r->qs);
}
static void write_cs_or_MD(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int no_iden, int is_MD, int write_tag, int is_qstrand)
{
extern unsigned char seq_nt4_table[256];
int i;
uint8_t *qseq, *tseq;
char *tmp;
if (r->p == 0) return;
qseq = (uint8_t*)kmalloc(km, r->qe - r->qs);
tseq = (uint8_t*)kmalloc(km, r->re - r->rs);
tmp = (char*)kmalloc(km, r->re - r->rs > r->qe - r->qs? r->re - r->rs + 1 : r->qe - r->qs + 1);
if (is_qstrand) {
mm_idx_getseq2(mi, r->rev, r->rid, r->rs, r->re, tseq);
for (i = r->qs; i < r->qe; ++i)
qseq[i - r->qs] = seq_nt4_table[(uint8_t)t->seq[i]];
} else {
mm_idx_getseq(mi, r->rid, r->rs, r->re, tseq);
if (!r->rev) {
for (i = r->qs; i < r->qe; ++i)
qseq[i - r->qs] = seq_nt4_table[(uint8_t)t->seq[i]];
} else {
for (i = r->qs; i < r->qe; ++i) {
uint8_t c = seq_nt4_table[(uint8_t)t->seq[i]];
qseq[r->qe - i - 1] = c >= 4? 4 : 3 - c;
}
}
}
if (is_MD) write_MD_core(s, tseq, qseq, r, tmp, write_tag);
else write_cs_core(s, tseq, qseq, r, tmp, no_iden, write_tag);
kfree(km, qseq); kfree(km, tseq); kfree(km, tmp); kfree(km, qseq); kfree(km, tseq); kfree(km, tmp);
} }
int mm_gen_cs_or_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int is_MD, int no_iden, int is_qstrand)
{
mm_bseq1_t t;
kstring_t str;
str.s = *buf, str.l = 0, str.m = *max_len;
t.l_seq = strlen(seq);
t.seq = (char*)seq;
write_cs_or_MD(km, &str, mi, &t, r, no_iden, is_MD, 0, is_qstrand);
*max_len = str.m;
*buf = str.s;
return str.l;
}
int mm_gen_cs(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int no_iden)
{
return mm_gen_cs_or_MD(km, buf, max_len, mi, r, seq, 0, no_iden, 0);
}
int mm_gen_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq)
{
return mm_gen_cs_or_MD(km, buf, max_len, mi, r, seq, 1, 0, 0);
}
static inline void write_tags(kstring_t *s, const mm_reg1_t *r) static inline void write_tags(kstring_t *s, const mm_reg1_t *r)
{ {
int type; int type;
@@ -212,33 +283,57 @@ static inline void write_tags(kstring_t *s, const mm_reg1_t *r)
} }
mm_sprintf_lite(s, "\ttp:A:%c\tcm:i:%d\ts1:i:%d", type, r->cnt, r->score); mm_sprintf_lite(s, "\ttp:A:%c\tcm:i:%d\ts1:i:%d", type, r->cnt, r->score);
if (r->parent == r->id) mm_sprintf_lite(s, "\ts2:i:%d", r->subsc); if (r->parent == r->id) mm_sprintf_lite(s, "\ts2:i:%d", r->subsc);
if (r->div >= 0.0f && r->div <= 1.0f) { if (r->p) {
char buf[8]; char buf[16];
double div;
div = 1.0 - mm_event_identity(r);
if (div == 0.0) buf[0] = '0', buf[1] = 0;
else snprintf(buf, 16, "%.4f", 1.0 - mm_event_identity(r));
mm_sprintf_lite(s, "\tde:f:%s", buf);
} else if (r->div >= 0.0f && r->div <= 1.0f) {
char buf[16];
if (r->div == 0.0f) buf[0] = '0', buf[1] = 0; if (r->div == 0.0f) buf[0] = '0', buf[1] = 0;
else sprintf(buf, "%.4f", r->div); else snprintf(buf, 16, "%.4f", r->div);
mm_sprintf_lite(s, "\tdv:f:%s", buf); mm_sprintf_lite(s, "\tdv:f:%s", buf);
} }
if (r->split) mm_sprintf_lite(s, "\tzd:i:%d", r->split); if (r->split) mm_sprintf_lite(s, "\tzd:i:%d", r->split);
} }
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int opt_flag) void mm_write_paf3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag, int rep_len)
{ {
s->l = 0; s->l = 0;
if (r == 0) {
mm_sprintf_lite(s, "%s\t%d\t0\t0\t*\t*\t0\t0\t0\t0\t0\t0", t->name, t->l_seq);
if (rep_len >= 0) mm_sprintf_lite(s, "\trl:i:%d", rep_len);
return;
}
mm_sprintf_lite(s, "%s\t%d\t%d\t%d\t%c\t", t->name, t->l_seq, r->qs, r->qe, "+-"[r->rev]); mm_sprintf_lite(s, "%s\t%d\t%d\t%d\t%c\t", t->name, t->l_seq, r->qs, r->qe, "+-"[r->rev]);
if (mi->seq[r->rid].name) mm_sprintf_lite(s, "%s", mi->seq[r->rid].name); if (mi->seq[r->rid].name) mm_sprintf_lite(s, "%s", mi->seq[r->rid].name);
else mm_sprintf_lite(s, "%d", r->rid); else mm_sprintf_lite(s, "%d", r->rid);
mm_sprintf_lite(s, "\t%d\t%d\t%d", mi->seq[r->rid].len, r->rs, r->re); mm_sprintf_lite(s, "\t%d", mi->seq[r->rid].len);
if ((opt_flag & MM_F_QSTRAND) && r->rev)
mm_sprintf_lite(s, "\t%d\t%d", mi->seq[r->rid].len - r->re, mi->seq[r->rid].len - r->rs);
else
mm_sprintf_lite(s, "\t%d\t%d", r->rs, r->re);
mm_sprintf_lite(s, "\t%d\t%d", r->mlen, r->blen); mm_sprintf_lite(s, "\t%d\t%d", r->mlen, r->blen);
mm_sprintf_lite(s, "\t%d", r->mapq); mm_sprintf_lite(s, "\t%d", r->mapq);
write_tags(s, r); write_tags(s, r);
if (rep_len >= 0) mm_sprintf_lite(s, "\trl:i:%d", rep_len);
if (r->p && (opt_flag & MM_F_OUT_CG)) { if (r->p && (opt_flag & MM_F_OUT_CG)) {
uint32_t k; uint32_t k;
mm_sprintf_lite(s, "\tcg:Z:"); mm_sprintf_lite(s, "\tcg:Z:");
for (k = 0; k < r->p->n_cigar; ++k) for (k = 0; k < r->p->n_cigar; ++k)
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDN"[r->p->cigar[k]&0xf]); mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, MM_CIGAR_STR[r->p->cigar[k]&0xf]);
} }
if (r->p && (opt_flag & MM_F_OUT_CS)) if (r->p && (opt_flag & (MM_F_OUT_CS|MM_F_OUT_MD)))
write_cs(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG)); write_cs_or_MD(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG), opt_flag&MM_F_OUT_MD, 1, !!(opt_flag&MM_F_QSTRAND));
if ((opt_flag & MM_F_COPY_COMMENT) && t->comment)
mm_sprintf_lite(s, "\t%s", t->comment);
}
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag)
{
mm_write_paf3(s, mi, t, r, km, opt_flag, -1);
} }
static void sam_write_sq(kstring_t *s, char *seq, int l, int rev, int comp) static void sam_write_sq(kstring_t *s, char *seq, int l, int rev, int comp)
@@ -265,7 +360,7 @@ static inline const mm_reg1_t *get_sam_pri(int n_regs, const mm_reg1_t *regs)
return NULL; return NULL;
} }
static void write_sam_cigar(kstring_t *s, int sam_flag, int in_tag, int qlen, const mm_reg1_t *r, int opt_flag) static void write_sam_cigar(kstring_t *s, int sam_flag, int in_tag, int qlen, const mm_reg1_t *r, int64_t opt_flag)
{ {
if (r->p == 0) { if (r->p == 0) {
mm_sprintf_lite(s, "*"); mm_sprintf_lite(s, "*");
@@ -282,19 +377,20 @@ static void write_sam_cigar(kstring_t *s, int sam_flag, int in_tag, int qlen, co
if (clip_len[1]) mm_sprintf_lite(s, ",%u", clip_len[1]<<4|clip_char); if (clip_len[1]) mm_sprintf_lite(s, ",%u", clip_len[1]<<4|clip_char);
} else { } else {
int clip_char = (sam_flag&0x800) && !(opt_flag&MM_F_SOFTCLIP)? 'H' : 'S'; int clip_char = (sam_flag&0x800) && !(opt_flag&MM_F_SOFTCLIP)? 'H' : 'S';
assert(clip_len[0] < qlen && clip_len[1] < qlen);
if (clip_len[0]) mm_sprintf_lite(s, "%d%c", clip_len[0], clip_char); if (clip_len[0]) mm_sprintf_lite(s, "%d%c", clip_len[0], clip_char);
for (k = 0; k < r->p->n_cigar; ++k) for (k = 0; k < r->p->n_cigar; ++k)
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDN"[r->p->cigar[k]&0xf]); mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, MM_CIGAR_STR[r->p->cigar[k]&0xf]);
if (clip_len[1]) mm_sprintf_lite(s, "%d%c", clip_len[1], clip_char); if (clip_len[1]) mm_sprintf_lite(s, "%d%c", clip_len[1], clip_char);
} }
} }
} }
void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regss, const mm_reg1_t *const* regss, void *km, int opt_flag) void mm_write_sam3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regss, const mm_reg1_t *const* regss, void *km, int64_t opt_flag, int rep_len)
{ {
const int max_bam_cigar_op = 65535; const int max_bam_cigar_op = 65535;
int flag, n_regs = n_regss[seg_idx], cigar_in_tag = 0; int flag, n_regs = n_regss[seg_idx], cigar_in_tag = 0;
int this_rid = -1, this_pos = -1, this_rev = 0; int this_rid = -1, this_pos = -1;
const mm_reg1_t *regs = regss[seg_idx], *r_prev = NULL, *r_next; const mm_reg1_t *regs = regss[seg_idx], *r_prev = NULL, *r_next;
const mm_reg1_t *r = n_regs > 0 && reg_idx < n_regs && reg_idx >= 0? &regs[reg_idx] : NULL; const mm_reg1_t *r = n_regs > 0 && reg_idx < n_regs && reg_idx >= 0? &regs[reg_idx] : NULL;
@@ -343,7 +439,7 @@ void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
mm_sprintf_lite(s, "\t%s\t%d\t0\t*", mi->seq[this_rid].name, this_pos+1); mm_sprintf_lite(s, "\t%s\t%d\t0\t*", mi->seq[this_rid].name, this_pos+1);
} else mm_sprintf_lite(s, "\t*\t0\t0\t*"); } else mm_sprintf_lite(s, "\t*\t0\t0\t*");
} else { } else {
this_rid = r->rid, this_pos = r->rs, this_rev = r->rev; this_rid = r->rid, this_pos = r->rs;
mm_sprintf_lite(s, "\t%s\t%d\t%d\t", mi->seq[r->rid].name, r->rs+1, r->mapq); mm_sprintf_lite(s, "\t%s\t%d\t%d\t", mi->seq[r->rid].name, r->rs+1, r->mapq);
if ((opt_flag & MM_F_LONG_CIGAR) && r->p && r->p->n_cigar > max_bam_cigar_op - 2) { if ((opt_flag & MM_F_LONG_CIGAR) && r->p && r->p->n_cigar > max_bam_cigar_op - 2) {
int n_cigar = r->p->n_cigar; int n_cigar = r->p->n_cigar;
@@ -353,9 +449,11 @@ void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
cigar_in_tag = 1; cigar_in_tag = 1;
} }
if (cigar_in_tag) { if (cigar_in_tag) {
if (flag & 0x100) mm_sprintf_lite(s, "0S"); // secondary alignment int slen;
else if (flag & 0x800) mm_sprintf_lite(s, "%dS", r->re - r->rs); // supplementary alignment if ((flag & 0x900) == 0 || (opt_flag & MM_F_SOFTCLIP)) slen = t->l_seq;
else mm_sprintf_lite(s, "%dS", t->l_seq); else if (flag & 0x100) slen = 0;
else slen = r->qe - r->qs;
mm_sprintf_lite(s, "%dS%dN", slen, r->re - r->rs);
} else write_sam_cigar(s, flag, 0, t->l_seq, r, opt_flag); } else write_sam_cigar(s, flag, 0, t->l_seq, r, opt_flag);
} }
@@ -364,17 +462,17 @@ void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
int tlen = 0; int tlen = 0;
if (this_rid >= 0 && r_next) { if (this_rid >= 0 && r_next) {
if (this_rid == r_next->rid) { if (this_rid == r_next->rid) {
int this_pos5 = r && r->rev? r->re - 1 : this_pos; if (r) {
int this_pos5 = r->rev? r->re - 1 : this_pos;
int next_pos5 = r_next->rev? r_next->re - 1 : r_next->rs; int next_pos5 = r_next->rev? r_next->re - 1 : r_next->rs;
tlen = next_pos5 - this_pos5; tlen = next_pos5 - this_pos5;
}
mm_sprintf_lite(s, "\t=\t"); mm_sprintf_lite(s, "\t=\t");
} else mm_sprintf_lite(s, "\t%s\t", mi->seq[r_next->rid].name); } else mm_sprintf_lite(s, "\t%s\t", mi->seq[r_next->rid].name);
mm_sprintf_lite(s, "%d\t", r_next->rs + 1); mm_sprintf_lite(s, "%d\t", r_next->rs + 1);
} else if (r_next) { // && this_rid < 0 } else if (r_next) { // && this_rid < 0
mm_sprintf_lite(s, "\t%s\t%d\t", mi->seq[r_next->rid].name, r_next->rs + 1); mm_sprintf_lite(s, "\t%s\t%d\t", mi->seq[r_next->rid].name, r_next->rs + 1);
} else if (this_rid >= 0) { // && r_next == NULL } else if (this_rid >= 0) { // && r_next == NULL
int this_pos5 = this_rev? r->re - 1 : this_pos; // this_rev is only true when r != NULL
tlen = this_pos - this_pos5; // next_pos5 will be this_pos
mm_sprintf_lite(s, "\t=\t%d\t", this_pos + 1); // next segment will take r's coordinate mm_sprintf_lite(s, "\t=\t%d\t", this_pos + 1); // next segment will take r's coordinate
} else mm_sprintf_lite(s, "\t*\t0\t"); // neither has coordinates } else mm_sprintf_lite(s, "\t*\t0\t"); // neither has coordinates
if (tlen > 0) ++tlen; if (tlen > 0) ++tlen;
@@ -434,15 +532,24 @@ void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
} }
} }
} }
if (r->p && (opt_flag & MM_F_OUT_CS)) if (r->p && (opt_flag & (MM_F_OUT_CS|MM_F_OUT_MD)))
write_cs(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG)); write_cs_or_MD(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG), opt_flag&MM_F_OUT_MD, 1, 0);
if (cigar_in_tag) if (cigar_in_tag)
write_sam_cigar(s, flag, 1, t->l_seq, r, opt_flag); write_sam_cigar(s, flag, 1, t->l_seq, r, opt_flag);
} }
if (rep_len >= 0) mm_sprintf_lite(s, "\trl:i:%d", rep_len);
if ((opt_flag & MM_F_COPY_COMMENT) && t->comment)
mm_sprintf_lite(s, "\t%s", t->comment);
s->s[s->l] = 0; // we always have room for an extra byte (see str_enlarge) s->s[s->l] = 0; // we always have room for an extra byte (see str_enlarge)
} }
void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regss, const mm_reg1_t *const* regss, void *km, int64_t opt_flag)
{
mm_write_sam3(s, mi, t, seg_idx, reg_idx, n_seg, n_regss, regss, km, opt_flag, -1);
}
void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int n_regs, const mm_reg1_t *regs) void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int n_regs, const mm_reg1_t *regs)
{ {
int i; int i;
-216
View File
@@ -1,216 +0,0 @@
#include <stddef.h>
#include <stdio.h>
#include <string.h>
#include "getopt.h"
char *optarg;
int optind=1, opterr=1, optopt, __optpos, optreset=0;
#define optpos __optpos
static void __getopt_msg(const char *a, const char *b, const char *c, size_t l)
{
FILE *f = stderr;
#if !defined(WIN32) && !defined(_WIN32)
flockfile(f);
#endif
fputs(a, f);
fwrite(b, strlen(b), 1, f);
fwrite(c, 1, l, f);
fputc('\n', f);
#if !defined(WIN32) && !defined(_WIN32)
funlockfile(f);
#endif
}
int getopt(int argc, char * const argv[], const char *optstring)
{
int i, c, d;
int k, l;
char *optchar;
if (!optind || optreset) {
optreset = 0;
__optpos = 0;
optind = 1;
}
if (optind >= argc || !argv[optind])
return -1;
if (argv[optind][0] != '-') {
if (optstring[0] == '-') {
optarg = argv[optind++];
return 1;
}
return -1;
}
if (!argv[optind][1])
return -1;
if (argv[optind][1] == '-' && !argv[optind][2])
return optind++, -1;
if (!optpos) optpos++;
c = argv[optind][optpos], k = 1;
optchar = argv[optind]+optpos;
optopt = c;
optpos += k;
if (!argv[optind][optpos]) {
optind++;
optpos = 0;
}
if (optstring[0] == '-' || optstring[0] == '+')
optstring++;
i = 0;
d = 0;
do {
d = optstring[i], l = 1;
if (l>0) i+=l; else i++;
} while (l && d != c);
if (d != c) {
if (optstring[0] != ':' && opterr)
__getopt_msg(argv[0], ": unrecognized option: ", optchar, k);
return '?';
}
if (optstring[i] == ':') {
if (optstring[i+1] == ':') optarg = 0;
else if (optind >= argc) {
if (optstring[0] == ':') return ':';
if (opterr) __getopt_msg(argv[0],
": option requires an argument: ",
optchar, k);
return '?';
}
if (optstring[i+1] != ':' || optpos) {
optarg = argv[optind++] + optpos;
optpos = 0;
}
}
return c;
}
static void permute(char *const *argv, int dest, int src)
{
char **av = (char **)argv;
char *tmp = av[src];
int i;
for (i=src; i>dest; i--)
av[i] = av[i-1];
av[dest] = tmp;
}
static int __getopt_long_core(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx, int longonly)
{
optarg = 0;
if (longopts && argv[optind][0] == '-' &&
((longonly && argv[optind][1] && argv[optind][1] != '-') ||
(argv[optind][1] == '-' && argv[optind][2])))
{
int colon = optstring[optstring[0]=='+'||optstring[0]=='-']==':';
int i, cnt, match = -1;
char *opt;
for (cnt=i=0; longopts[i].name; i++) {
const char *name = longopts[i].name;
opt = argv[optind]+1;
if (*opt == '-') opt++;
for (; *name && *name == *opt; name++, opt++);
if (*opt && *opt != '=') continue;
match = i;
if (!*name) {
cnt = 1;
break;
}
cnt++;
}
if (cnt==1) {
i = match;
optind++;
optopt = longopts[i].val;
if (*opt == '=') {
if (!longopts[i].has_arg) {
if (colon || !opterr)
return '?';
__getopt_msg(argv[0],
": option does not take an argument: ",
longopts[i].name,
strlen(longopts[i].name));
return '?';
}
optarg = opt+1;
} else if (longopts[i].has_arg == required_argument) {
if (!(optarg = argv[optind])) {
if (colon) return ':';
if (!opterr) return '?';
__getopt_msg(argv[0],
": option requires an argument: ",
longopts[i].name,
strlen(longopts[i].name));
return '?';
}
optind++;
}
if (idx) *idx = i;
if (longopts[i].flag) {
*longopts[i].flag = longopts[i].val;
return 0;
}
return longopts[i].val;
}
if (argv[optind][1] == '-') {
if (!colon && opterr)
__getopt_msg(argv[0], cnt ?
": option is ambiguous: " :
": unrecognized option: ",
argv[optind]+2,
strlen(argv[optind]+2));
optind++;
return '?';
}
}
return getopt(argc, argv, optstring);
}
static int __getopt_long(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx, int longonly)
{
int ret, skipped, resumed;
if (!optind || optreset) {
optreset = 0;
__optpos = 0;
optind = 1;
}
if (optind >= argc || !argv[optind]) return -1;
skipped = optind;
if (optstring[0] != '+' && optstring[0] != '-') {
int i;
for (i=optind; ; i++) {
if (i >= argc || !argv[i]) return -1;
if (argv[i][0] == '-' && argv[i][1]) break;
}
optind = i;
}
resumed = optind;
ret = __getopt_long_core(argc, argv, optstring, longopts, idx, longonly);
if (resumed > skipped) {
int i, cnt = optind-resumed;
for (i=0; i<cnt; i++)
permute(argv, skipped, optind-1);
optind = skipped + cnt;
}
return ret;
}
int getopt_long(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx)
{
return __getopt_long(argc, argv, optstring, longopts, idx, 0);
}
int getopt_long_only(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx)
{
return __getopt_long(argc, argv, optstring, longopts, idx, 1);
}
-53
View File
@@ -1,53 +0,0 @@
/*
Copyright 2005-2014 Rich Felker, et al.
Permission is hereby granted, free of charge, to any person obtaining
a copy of this software and associated documentation files (the
"Software"), to deal in the Software without restriction, including
without limitation the rights to use, copy, modify, merge, publish,
distribute, sublicense, and/or sell copies of the Software, and to
permit persons to whom the Software is furnished to do so, subject to
the following conditions:
The above copyright notice and this permission notice shall be
included in all copies or substantial portions of the Software.
THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT.
IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY
CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT,
TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE
SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
*/
#ifndef _GETOPT_H
#define _GETOPT_H
#ifdef __cplusplus
extern "C" {
#endif
int getopt(int, char * const [], const char *);
extern char *optarg;
extern int optind, opterr, optopt, optreset;
struct option {
const char *name;
int has_arg;
int *flag;
int val;
};
int getopt_long(int, char *const *, const char *, const struct option *, int *);
int getopt_long_only(int, char *const *, const char *, const struct option *, int *);
#define no_argument 0
#define required_argument 1
#define optional_argument 2
#ifdef __cplusplus
}
#endif
#endif
+53 -84
View File
@@ -20,14 +20,14 @@ static inline void mm_cal_fuzzy_len(mm_reg1_t *r, const mm128_t *a)
} }
} }
static inline void mm_reg_set_coor(mm_reg1_t *r, int32_t qlen, const mm128_t *a) static inline void mm_reg_set_coor(mm_reg1_t *r, int32_t qlen, const mm128_t *a, int is_qstrand)
{ // NB: r->as and r->cnt MUST BE set correctly for this function to work { // NB: r->as and r->cnt MUST BE set correctly for this function to work
int32_t k = r->as, q_span = (int32_t)(a[k].y>>32&0xff); int32_t k = r->as, q_span = (int32_t)(a[k].y>>32&0xff);
r->rev = a[k].x>>63; r->rev = a[k].x>>63;
r->rid = a[k].x<<1>>33; r->rid = a[k].x<<1>>33;
r->rs = (int32_t)a[k].x + 1 > q_span? (int32_t)a[k].x + 1 - q_span : 0; // NB: target span may be shorter, so this test is necessary r->rs = (int32_t)a[k].x + 1 > q_span? (int32_t)a[k].x + 1 - q_span : 0; // NB: target span may be shorter, so this test is necessary
r->re = (int32_t)a[k + r->cnt - 1].x + 1; r->re = (int32_t)a[k + r->cnt - 1].x + 1;
if (!r->rev) { if (!r->rev || is_qstrand) {
r->qs = (int32_t)a[k].y + 1 - q_span; r->qs = (int32_t)a[k].y + 1 - q_span;
r->qe = (int32_t)a[k + r->cnt - 1].y + 1; r->qe = (int32_t)a[k + r->cnt - 1].y + 1;
} else { } else {
@@ -49,7 +49,7 @@ static inline uint64_t hash64(uint64_t key)
return key; return key;
} }
mm_reg1_t *mm_gen_regs(void *km, uint32_t hash, int qlen, int n_u, uint64_t *u, mm128_t *a) // convert chains to hits mm_reg1_t *mm_gen_regs(void *km, uint32_t hash, int qlen, int n_u, uint64_t *u, mm128_t *a, int is_qstrand) // convert chains to hits
{ {
mm128_t *z, tmp; mm128_t *z, tmp;
mm_reg1_t *r; mm_reg1_t *r;
@@ -81,13 +81,29 @@ mm_reg1_t *mm_gen_regs(void *km, uint32_t hash, int qlen, int n_u, uint64_t *u,
ri->cnt = (int32_t)z[i].y; ri->cnt = (int32_t)z[i].y;
ri->as = z[i].y >> 32; ri->as = z[i].y >> 32;
ri->div = -1.0f; ri->div = -1.0f;
mm_reg_set_coor(ri, qlen, a); mm_reg_set_coor(ri, qlen, a, is_qstrand);
} }
kfree(km, z); kfree(km, z);
return r; return r;
} }
void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a) void mm_mark_alt(const mm_idx_t *mi, int n, mm_reg1_t *r)
{
int i;
if (mi->n_alt == 0) return;
for (i = 0; i < n; ++i)
if (mi->seq[r[i].rid].is_alt)
r[i].is_alt = 1;
}
static inline int mm_alt_score(int score, float alt_diff_frac)
{
if (score < 0) return score;
score = (int)(score * (1.0 - alt_diff_frac) + .499);
return score > 0? score : 1;
}
void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a, int is_qstrand)
{ {
if (n <= 0 || n >= r->cnt) return; if (n <= 0 || n >= r->cnt) return;
*r2 = *r; *r2 = *r;
@@ -99,14 +115,14 @@ void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a)
r2->score = (int32_t)(r->score * ((float)r2->cnt / r->cnt) + .499); r2->score = (int32_t)(r->score * ((float)r2->cnt / r->cnt) + .499);
r2->as = r->as + n; r2->as = r->as + n;
if (r->parent == r->id) r2->parent = MM_PARENT_TMP_PRI; if (r->parent == r->id) r2->parent = MM_PARENT_TMP_PRI;
mm_reg_set_coor(r2, qlen, a); mm_reg_set_coor(r2, qlen, a, is_qstrand);
r->cnt -= r2->cnt; r->cnt -= r2->cnt;
r->score -= r2->score; r->score -= r2->score;
mm_reg_set_coor(r, qlen, a); mm_reg_set_coor(r, qlen, a, is_qstrand);
r->split |= 1, r2->split |= 2; r->split |= 1, r2->split |= 2;
} }
void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r, int sub_diff) // and compute mm_reg1_t::subsc void mm_set_parent(void *km, float mask_level, int mask_len, int n, mm_reg1_t *r, int sub_diff, int hard_mask_level, float alt_diff_frac) // and compute mm_reg1_t::subsc
{ {
int i, j, k, *w; int i, j, k, *w;
uint64_t *cov; uint64_t *cov;
@@ -118,6 +134,7 @@ void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r, int sub_diff
for (i = 1, k = 1; i < n; ++i) { for (i = 1, k = 1; i < n; ++i) {
mm_reg1_t *ri = &r[i]; mm_reg1_t *ri = &r[i];
int si = ri->qs, ei = ri->qe, n_cov = 0, uncov_len = 0; int si = ri->qs, ei = ri->qe, n_cov = 0, uncov_len = 0;
if (hard_mask_level) goto skip_uncov;
for (j = 0; j < k; ++j) { // traverse existing primary hits to find overlapping hits for (j = 0; j < k; ++j) { // traverse existing primary hits to find overlapping hits
mm_reg1_t *rp = &r[w[j]]; mm_reg1_t *rp = &r[w[j]];
int sj = rp->qs, ej = rp->qe; int sj = rp->qs, ej = rp->qe;
@@ -132,25 +149,29 @@ void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r, int sub_diff
int j, x = si; int j, x = si;
radix_sort_64(cov, cov + n_cov); radix_sort_64(cov, cov + n_cov);
for (j = 0; j < n_cov; ++j) { for (j = 0; j < n_cov; ++j) {
if (cov[j]>>32 > x) uncov_len += (cov[j]>>32) - x; if ((int)(cov[j]>>32) > x) uncov_len += (cov[j]>>32) - x;
x = (int32_t)cov[j] > x? (int32_t)cov[j] : x; x = (int32_t)cov[j] > x? (int32_t)cov[j] : x;
} }
if (ei > x) uncov_len += ei - x; if (ei > x) uncov_len += ei - x;
} }
skip_uncov:
for (j = 0; j < k; ++j) { // traverse existing primary hits again for (j = 0; j < k; ++j) { // traverse existing primary hits again
mm_reg1_t *rp = &r[w[j]]; mm_reg1_t *rp = &r[w[j]];
int sj = rp->qs, ej = rp->qe, min, max, ol; int sj = rp->qs, ej = rp->qe, min, max, ol;
if (ej <= si || sj >= ei) continue; // no overlap if (ej <= si || sj >= ei) continue; // no overlap
min = ej - sj < ei - si? ej - sj : ei - si; min = ej - sj < ei - si? ej - sj : ei - si;
max = ej - sj > ei - si? ej - sj : ei - si; max = ej - sj > ei - si? ej - sj : ei - si;
ol = si < sj? (ei < sj? 0 : ei < ej? ei - sj : ej - sj) : (ej < si? 0 : ej < ei? ej - si : ei - si); // overlap length ol = si < sj? (ei < sj? 0 : ei < ej? ei - sj : ej - sj) : (ej < si? 0 : ej < ei? ej - si : ei - si); // overlap length; TODO: this can be simplified
if ((float)ol / min - (float)uncov_len / max > mask_level) { if ((float)ol / min - (float)uncov_len / max > mask_level && uncov_len <= mask_len) { // then this is a secondary hit
int cnt_sub = 0; int cnt_sub = 0, sci = ri->score;
ri->parent = rp->parent; ri->parent = rp->parent;
rp->subsc = rp->subsc > ri->score? rp->subsc : ri->score; if (!rp->is_alt && ri->is_alt) sci = mm_alt_score(sci, alt_diff_frac);
rp->subsc = rp->subsc > sci? rp->subsc : sci;
if (ri->cnt >= rp->cnt) cnt_sub = 1; if (ri->cnt >= rp->cnt) cnt_sub = 1;
if (rp->p && ri->p && (rp->rid != ri->rid || rp->rs != ri->rs || rp->re != ri->re || ol != min)) { // the last condition excludes identical hits after DP if (rp->p && ri->p && (rp->rid != ri->rid || rp->rs != ri->rs || rp->re != ri->re || ol != min)) { // the last condition excludes identical hits after DP
rp->p->dp_max2 = rp->p->dp_max2 > ri->p->dp_max? rp->p->dp_max2 : ri->p->dp_max; sci = ri->p->dp_max;
if (!rp->is_alt && ri->is_alt) sci = mm_alt_score(sci, alt_diff_frac);
rp->p->dp_max2 = rp->p->dp_max2 > sci? rp->p->dp_max2 : sci;
if (rp->p->dp_max - ri->p->dp_max <= sub_diff) cnt_sub = 1; if (rp->p->dp_max - ri->p->dp_max <= sub_diff) cnt_sub = 1;
} }
if (cnt_sub) ++rp->n_sub; if (cnt_sub) ++rp->n_sub;
@@ -164,9 +185,9 @@ set_parent_test:
kfree(km, w); kfree(km, w);
} }
void mm_hit_sort_by_dp(void *km, int *n_regs, mm_reg1_t *r) void mm_hit_sort(void *km, int *n_regs, mm_reg1_t *r, float alt_diff_frac)
{ {
int32_t i, n_aux, n = *n_regs; int32_t i, n_aux, n = *n_regs, has_cigar = 0, no_cigar = 0;
mm128_t *aux; mm128_t *aux;
mm_reg1_t *t; mm_reg1_t *t;
@@ -175,14 +196,18 @@ void mm_hit_sort_by_dp(void *km, int *n_regs, mm_reg1_t *r)
t = (mm_reg1_t*)kmalloc(km, n * sizeof(mm_reg1_t)); t = (mm_reg1_t*)kmalloc(km, n * sizeof(mm_reg1_t));
for (i = n_aux = 0; i < n; ++i) { for (i = n_aux = 0; i < n; ++i) {
if (r[i].inv || r[i].cnt > 0) { // squeeze out elements with cnt==0 (soft deleted) if (r[i].inv || r[i].cnt > 0) { // squeeze out elements with cnt==0 (soft deleted)
assert(r[i].p); int score;
aux[n_aux].x = (uint64_t)r[i].p->dp_max << 32 | r[i].hash; if (r[i].p) score = r[i].p->dp_max, has_cigar = 1;
else score = r[i].score, no_cigar = 1;
if (r[i].is_alt) score = mm_alt_score(score, alt_diff_frac);
aux[n_aux].x = (uint64_t)score << 32 | r[i].hash;
aux[n_aux++].y = i; aux[n_aux++].y = i;
} else if (r[i].p) { } else if (r[i].p) {
free(r[i].p); free(r[i].p);
r[i].p = 0; r[i].p = 0;
} }
} }
assert(has_cigar + no_cigar == 1);
radix_sort_128x(aux, aux + n_aux); radix_sort_128x(aux, aux + n_aux);
for (i = n_aux - 1; i >= 0; --i) for (i = n_aux - 1; i >= 0; --i)
t[n_aux - 1 - i] = r[aux[i].y]; t[n_aux - 1 - i] = r[aux[i].y];
@@ -246,7 +271,7 @@ void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int *n_,
} }
} }
void mm_filter_regs(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs) void mm_filter_regs(const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs)
{ // NB: after this call, mm_reg1_t::parent can be -1 if its parent filtered out { // NB: after this call, mm_reg1_t::parent can be -1 if its parent filtered out
int i, k; int i, k;
for (i = k = 0; i < *n_regs; ++i) { for (i = k = 0; i < *n_regs; ++i) {
@@ -287,63 +312,6 @@ int mm_squeeze_a(void *km, int n_regs, mm_reg1_t *regs, mm128_t *a)
return as; return as;
} }
void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs_, mm_reg1_t *regs, mm128_t *a)
{
int i, n_aux, n_regs = *n_regs_, n_drop = 0;
uint64_t *aux;
if (n_regs < 2) return; // nothing to join
mm_squeeze_a(km, n_regs, regs, a);
aux = (uint64_t*)kmalloc(km, n_regs * 8);
for (i = n_aux = 0; i < n_regs; ++i)
if (regs[i].parent == i || regs[i].parent < 0)
aux[n_aux++] = (uint64_t)regs[i].as << 32 | i;
radix_sort_64(aux, aux + n_aux);
for (i = n_aux - 1; i >= 1; --i) {
mm_reg1_t *r0 = &regs[(int32_t)aux[i-1]], *r1 = &regs[(int32_t)aux[i]];
mm128_t *a0e, *a1s;
int max_gap, min_gap, sc_thres;
// test
if (r0->as + r0->cnt != r1->as) continue; // not adjacent in a[]
if (r0->rid != r1->rid || r0->rev != r1->rev) continue; // make sure on the same target and strand
a0e = &a[r0->as + r0->cnt - 1];
a1s = &a[r1->as];
if (a1s->x <= a0e->x || (int32_t)a1s->y <= (int32_t)a0e->y) continue; // keep colinearity
max_gap = min_gap = (int32_t)a1s->y - (int32_t)a0e->y;
max_gap = max_gap > a1s->x - a0e->x? max_gap : a1s->x - a0e->x;
min_gap = min_gap < a1s->x - a0e->x? min_gap : a1s->x - a0e->x;
if (max_gap > opt->max_join_long || min_gap > opt->max_join_short) continue;
sc_thres = (int)((float)opt->min_join_flank_sc / opt->max_join_long * max_gap + .499);
if (r0->score < sc_thres || r1->score < sc_thres) continue; // require good flanking chains
if (r0->re - r0->rs < max_gap>>1 || r0->qe - r0->qs < max_gap>>1) continue; // require enough flanking length
if (r1->re - r1->rs < max_gap>>1 || r1->qe - r1->qs < max_gap>>1) continue;
// all conditions satisfied; join
a[r1->as].y |= MM_SEED_LONG_JOIN;
r0->cnt += r1->cnt, r0->score += r1->score;
mm_reg_set_coor(r0, qlen, a);
r1->cnt = 0;
r1->parent = r0->id;
++n_drop;
}
kfree(km, aux);
if (n_drop > 0) { // then fix the hits hierarchy
for (i = 0; i < n_regs; ++i) { // adjust the mm_reg1_t::parent
mm_reg1_t *r = &regs[i];
if (r->parent >= 0 && r->id != r->parent) { // fix for secondary hits only
if (regs[r->parent].parent >= 0 && regs[r->parent].parent != r->parent)
r->parent = regs[r->parent].parent;
}
}
mm_filter_regs(km, opt, qlen, n_regs_, regs);
mm_sync_regs(km, *n_regs_, regs);
}
}
mm_seg_t *mm_seg_gen(void *km, uint32_t hash, int n_segs, const int *qlens, int n_regs0, const mm_reg1_t *regs0, int *n_regs, mm_reg1_t **regs, const mm128_t *a) mm_seg_t *mm_seg_gen(void *km, uint32_t hash, int n_segs, const int *qlens, int n_regs0, const mm_reg1_t *regs0, int *n_regs, mm_reg1_t **regs, const mm128_t *a)
{ {
int s, i, j, acc_qlen[MM_MAX_SEG+1], qlen_sum = 0; int s, i, j, acc_qlen[MM_MAX_SEG+1], qlen_sum = 0;
@@ -390,7 +358,7 @@ mm_seg_t *mm_seg_gen(void *km, uint32_t hash, int n_segs, const int *qlens, int
} }
} }
for (s = 0; s < n_segs; ++s) { for (s = 0; s < n_segs; ++s) {
regs[s] = mm_gen_regs(km, hash, qlens[s], seg[s].n_u, seg[s].u, seg[s].a); regs[s] = mm_gen_regs(km, hash, qlens[s], seg[s].n_u, seg[s].u, seg[s].a, 0);
n_regs[s] = seg[s].n_u; n_regs[s] = seg[s].n_u;
for (i = 0; i < n_regs[s]; ++i) { for (i = 0; i < n_regs[s]; ++i) {
regs[s][i].seg_split = 1; regs[s][i].seg_split = 1;
@@ -411,23 +379,23 @@ void mm_seg_free(void *km, int n_segs, mm_seg_t *segs)
static void mm_set_inv_mapq(void *km, int n_regs, mm_reg1_t *regs) static void mm_set_inv_mapq(void *km, int n_regs, mm_reg1_t *regs)
{ {
int i, n_aux; int i, n_aux;
uint64_t *aux; mm128_t *aux;
if (n_regs < 3) return; if (n_regs < 3) return;
for (i = 0; i < n_regs; ++i) for (i = 0; i < n_regs; ++i)
if (regs[i].inv) break; if (regs[i].inv) break;
if (i == n_regs) return; // no inversion hits if (i == n_regs) return; // no inversion hits
aux = (uint64_t*)kmalloc(km, n_regs * 8); aux = (mm128_t*)kmalloc(km, n_regs * 16);
for (i = n_aux = 0; i < n_regs; ++i) for (i = n_aux = 0; i < n_regs; ++i)
if (regs[i].parent == i || regs[i].parent < 0) if (regs[i].parent == i || regs[i].parent < 0)
aux[n_aux++] = (uint64_t)regs[i].as << 32 | i; aux[n_aux].y = i, aux[n_aux++].x = (uint64_t)regs[i].rid << 32 | regs[i].rs;
radix_sort_64(aux, aux + n_aux); radix_sort_128x(aux, aux + n_aux);
for (i = 1; i < n_aux - 1; ++i) { for (i = 1; i < n_aux - 1; ++i) {
mm_reg1_t *inv = &regs[(int32_t)aux[i]]; mm_reg1_t *inv = &regs[aux[i].y];
if (inv->inv) { if (inv->inv) {
mm_reg1_t *l = &regs[(int32_t)aux[i-1]]; mm_reg1_t *l = &regs[aux[i-1].y];
mm_reg1_t *r = &regs[(int32_t)aux[i+1]]; mm_reg1_t *r = &regs[aux[i+1].y];
inv->mapq = l->mapq < r->mapq? l->mapq : r->mapq; inv->mapq = l->mapq < r->mapq? l->mapq : r->mapq;
} }
} }
@@ -440,6 +408,7 @@ void mm_set_mapq(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int ma
int64_t sum_sc = 0; int64_t sum_sc = 0;
float uniq_ratio; float uniq_ratio;
int i; int i;
if (n_regs == 0) return;
for (i = 0; i < n_regs; ++i) for (i = 0; i < n_regs; ++i)
if (regs[i].parent == regs[i].id) if (regs[i].parent == regs[i].id)
sum_sc += regs[i].score; sum_sc += regs[i].score;
+226 -19
View File
@@ -31,6 +31,16 @@ typedef struct mm_idx_bucket_s {
void *h; // hash table indexing _p_ and minimizers appearing once void *h; // hash table indexing _p_ and minimizers appearing once
} mm_idx_bucket_t; } mm_idx_bucket_t;
typedef struct {
int32_t st, en, max; // max is not used for now
int32_t score:30, strand:2;
} mm_idx_intv1_t;
typedef struct mm_idx_intv_s {
int32_t n, m;
mm_idx_intv1_t *a;
} mm_idx_intv_t;
mm_idx_t *mm_idx_init(int w, int k, int b, int flag) mm_idx_t *mm_idx_init(int w, int k, int b, int flag)
{ {
mm_idx_t *mi; mm_idx_t *mi;
@@ -45,14 +55,21 @@ mm_idx_t *mm_idx_init(int w, int k, int b, int flag)
void mm_idx_destroy(mm_idx_t *mi) void mm_idx_destroy(mm_idx_t *mi)
{ {
int i; uint32_t i;
if (mi == 0) return; if (mi == 0) return;
if (mi->h) kh_destroy(str, (khash_t(str)*)mi->h); if (mi->h) kh_destroy(str, (khash_t(str)*)mi->h);
for (i = 0; i < 1<<mi->b; ++i) { if (mi->B) {
for (i = 0; i < 1U<<mi->b; ++i) {
free(mi->B[i].p); free(mi->B[i].p);
free(mi->B[i].a.a); free(mi->B[i].a.a);
kh_destroy(idx, (idxhash_t*)mi->B[i].h); kh_destroy(idx, (idxhash_t*)mi->B[i].h);
} }
}
if (mi->I) {
for (i = 0; i < mi->n_seq; ++i)
free(mi->I[i].a);
free(mi->I);
}
if (!mi->km) { if (!mi->km) {
for (i = 0; i < mi->n_seq; ++i) for (i = 0; i < mi->n_seq; ++i)
free(mi->seq[i].name); free(mi->seq[i].name);
@@ -82,14 +99,15 @@ const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n)
void mm_idx_stat(const mm_idx_t *mi) void mm_idx_stat(const mm_idx_t *mi)
{ {
int i, n = 0, n1 = 0; int n = 0, n1 = 0;
uint32_t i;
uint64_t sum = 0, len = 0; uint64_t sum = 0, len = 0;
fprintf(stderr, "[M::%s] kmer size: %d; skip: %d; is_hpc: %d; #seq: %d\n", __func__, mi->k, mi->w, mi->flag&MM_I_HPC, mi->n_seq); fprintf(stderr, "[M::%s] kmer size: %d; skip: %d; is_hpc: %d; #seq: %d\n", __func__, mi->k, mi->w, mi->flag&MM_I_HPC, mi->n_seq);
for (i = 0; i < mi->n_seq; ++i) for (i = 0; i < mi->n_seq; ++i)
len += mi->seq[i].len; len += mi->seq[i].len;
for (i = 0; i < 1<<mi->b; ++i) for (i = 0; i < 1U<<mi->b; ++i)
if (mi->B[i].h) n += kh_size((idxhash_t*)mi->B[i].h); if (mi->B[i].h) n += kh_size((idxhash_t*)mi->B[i].h);
for (i = 0; i < 1<<mi->b; ++i) { for (i = 0; i < 1U<<mi->b; ++i) {
idxhash_t *h = (idxhash_t*)mi->B[i].h; idxhash_t *h = (idxhash_t*)mi->B[i].h;
khint_t k; khint_t k;
if (h == 0) continue; if (h == 0) continue;
@@ -99,8 +117,8 @@ void mm_idx_stat(const mm_idx_t *mi)
if (kh_key(h, k)&1) ++n1; if (kh_key(h, k)&1) ++n1;
} }
} }
fprintf(stderr, "[M::%s::%.3f*%.2f] distinct minimizers: %d (%.2f%% are singletons); average occurrences: %.3lf; average spacing: %.3lf\n", fprintf(stderr, "[M::%s::%.3f*%.2f] distinct minimizers: %d (%.2f%% are singletons); average occurrences: %.3lf; average spacing: %.3lf; total length: %ld\n",
__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), n, 100.0*n1/n, (double)sum / n, (double)len / sum); __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), n, 100.0*n1/n, (double)sum / n, (double)len / sum, (long)len);
} }
int mm_idx_index_name(mm_idx_t *mi) int mm_idx_index_name(mm_idx_t *mi)
@@ -143,6 +161,28 @@ int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, ui
return en - st; return en - st;
} }
int mm_idx_getseq_rev(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq)
{
uint64_t i, st1, en1;
const mm_idx_seq_t *s;
if (rid >= mi->n_seq || st >= mi->seq[rid].len) return -1;
s = &mi->seq[rid];
if (en > s->len) en = s->len;
st1 = s->offset + (s->len - en);
en1 = s->offset + (s->len - st);
for (i = st1; i < en1; ++i) {
uint8_t c = mm_seq4_get(mi->S, i);
seq[en1 - i - 1] = c < 4? 3 - c : c;
}
return en - st;
}
int mm_idx_getseq2(const mm_idx_t *mi, int is_rev, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq)
{
if (is_rev) return mm_idx_getseq_rev(mi, rid, st, en, seq);
else return mm_idx_getseq(mi, rid, st, en, seq);
}
int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f) int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f)
{ {
int i; int i;
@@ -172,7 +212,8 @@ int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f)
static void worker_post(void *g, long i, int tid) static void worker_post(void *g, long i, int tid)
{ {
int j, start_a, start_p, n, n_keys; int n, n_keys;
size_t j, start_a, start_p;
idxhash_t *h; idxhash_t *h;
mm_idx_t *mi = (mm_idx_t*)g; mm_idx_t *mi = (mm_idx_t*)g;
mm_idx_bucket_t *b = &mi->B[i]; mm_idx_bucket_t *b = &mi->B[i];
@@ -200,7 +241,7 @@ static void worker_post(void *g, long i, int tid)
int absent; int absent;
mm128_t *p = &b->a.a[j-1]; mm128_t *p = &b->a.a[j-1];
itr = kh_put(idx, h, p->x>>8>>mi->b<<1, &absent); itr = kh_put(idx, h, p->x>>8>>mi->b<<1, &absent);
assert(absent && j - start_a == n); assert(absent && j == start_a + n);
if (n == 1) { if (n == 1) {
kh_key(h, itr) |= 1; kh_key(h, itr) |= 1;
kh_val(h, itr) = p->y; kh_val(h, itr) = p->y;
@@ -216,7 +257,7 @@ static void worker_post(void *g, long i, int tid)
} else ++n; } else ++n;
} }
b->h = h; b->h = h;
assert(b->n == start_p); assert(b->n == (int32_t)start_p);
// deallocate and clear b->a // deallocate and clear b->a
kfree(0, b->a.a); kfree(0, b->a.a);
@@ -297,6 +338,7 @@ static void *worker_pipeline(void *shared, int step, void *in)
} else seq->name = 0; } else seq->name = 0;
seq->len = s->seq[i].l_seq; seq->len = s->seq[i].l_seq;
seq->offset = p->sum_len; seq->offset = p->sum_len;
seq->is_alt = 0;
// copy the sequence // copy the sequence
if (!(p->mi->flag & MM_I_NO_SEQ)) { if (!(p->mi->flag & MM_I_NO_SEQ)) {
for (j = 0; j < seq->len; ++j) { // TODO: this is not the fastest way, but let's first see if speed matters here for (j = 0; j < seq->len; ++j) { // TODO: this is not the fastest way, but let's first see if speed matters here
@@ -336,7 +378,7 @@ mm_idx_t *mm_idx_gen(mm_bseq_file_t *fp, int w, int k, int b, int flag, int mini
pipeline_t pl; pipeline_t pl;
if (fp == 0 || mm_bseq_eof(fp)) return 0; if (fp == 0 || mm_bseq_eof(fp)) return 0;
memset(&pl, 0, sizeof(pipeline_t)); memset(&pl, 0, sizeof(pipeline_t));
pl.mini_batch_size = mini_batch_size < batch_size? mini_batch_size : batch_size; pl.mini_batch_size = (uint64_t)mini_batch_size < batch_size? mini_batch_size : batch_size;
pl.batch_size = batch_size; pl.batch_size = batch_size;
pl.fp = fp; pl.fp = fp;
pl.mi = mm_idx_init(w, k, b, flag); pl.mi = mm_idx_init(w, k, b, flag);
@@ -368,7 +410,9 @@ mm_idx_t *mm_idx_str(int w, int k, int is_hpc, int bucket_bits, int n, const cha
uint64_t sum_len = 0; uint64_t sum_len = 0;
mm128_v a = {0,0,0}; mm128_v a = {0,0,0};
mm_idx_t *mi; mm_idx_t *mi;
khash_t(str) *h;
int i, flag = 0; int i, flag = 0;
if (n <= 0) return 0; if (n <= 0) return 0;
for (i = 0; i < n; ++i) // get the total length for (i = 0; i < n; ++i) // get the total length
sum_len += strlen(seq[i]); sum_len += strlen(seq[i]);
@@ -379,16 +423,21 @@ mm_idx_t *mm_idx_str(int w, int k, int is_hpc, int bucket_bits, int n, const cha
mi->n_seq = n; mi->n_seq = n;
mi->seq = (mm_idx_seq_t*)kcalloc(mi->km, n, sizeof(mm_idx_seq_t)); // ->seq is allocated from km mi->seq = (mm_idx_seq_t*)kcalloc(mi->km, n, sizeof(mm_idx_seq_t)); // ->seq is allocated from km
mi->S = (uint32_t*)calloc((sum_len + 7) / 8, 4); mi->S = (uint32_t*)calloc((sum_len + 7) / 8, 4);
mi->h = h = kh_init(str);
for (i = 0, sum_len = 0; i < n; ++i) { for (i = 0, sum_len = 0; i < n; ++i) {
const char *s = seq[i]; const char *s = seq[i];
mm_idx_seq_t *p = &mi->seq[i]; mm_idx_seq_t *p = &mi->seq[i];
uint32_t j; uint32_t j;
if (name && name[i]) { if (name && name[i]) {
int absent;
p->name = (char*)kmalloc(mi->km, strlen(name[i]) + 1); p->name = (char*)kmalloc(mi->km, strlen(name[i]) + 1);
strcpy(p->name, name[i]); strcpy(p->name, name[i]);
kh_put(str, h, p->name, &absent);
assert(absent);
} }
p->offset = sum_len; p->offset = sum_len;
p->len = strlen(s); p->len = strlen(s);
p->is_alt = 0;
for (j = 0; j < p->len; ++j) { for (j = 0; j < p->len; ++j) {
int c = seq_nt4_table[(uint8_t)s[j]]; int c = seq_nt4_table[(uint8_t)s[j]];
uint64_t o = sum_len + j; uint64_t o = sum_len + j;
@@ -413,17 +462,20 @@ mm_idx_t *mm_idx_str(int w, int k, int is_hpc, int bucket_bits, int n, const cha
void mm_idx_dump(FILE *fp, const mm_idx_t *mi) void mm_idx_dump(FILE *fp, const mm_idx_t *mi)
{ {
uint64_t sum_len = 0; uint64_t sum_len = 0;
uint32_t x[5]; uint32_t x[5], i;
int i;
x[0] = mi->w, x[1] = mi->k, x[2] = mi->b, x[3] = mi->n_seq, x[4] = mi->flag; x[0] = mi->w, x[1] = mi->k, x[2] = mi->b, x[3] = mi->n_seq, x[4] = mi->flag;
fwrite(MM_IDX_MAGIC, 1, 4, fp); fwrite(MM_IDX_MAGIC, 1, 4, fp);
fwrite(x, 4, 5, fp); fwrite(x, 4, 5, fp);
for (i = 0; i < mi->n_seq; ++i) { for (i = 0; i < mi->n_seq; ++i) {
uint8_t l; if (mi->seq[i].name) {
l = strlen(mi->seq[i].name); uint8_t l = strlen(mi->seq[i].name);
fwrite(&l, 1, 1, fp); fwrite(&l, 1, 1, fp);
fwrite(mi->seq[i].name, 1, l, fp); fwrite(mi->seq[i].name, 1, l, fp);
} else {
uint8_t l = 0;
fwrite(&l, 1, 1, fp);
}
fwrite(&mi->seq[i].len, 4, 1, fp); fwrite(&mi->seq[i].len, 4, 1, fp);
sum_len += mi->seq[i].len; sum_len += mi->seq[i].len;
} }
@@ -450,9 +502,8 @@ void mm_idx_dump(FILE *fp, const mm_idx_t *mi)
mm_idx_t *mm_idx_load(FILE *fp) mm_idx_t *mm_idx_load(FILE *fp)
{ {
int i;
char magic[4]; char magic[4];
uint32_t x[5]; uint32_t x[5], i;
uint64_t sum_len = 0; uint64_t sum_len = 0;
mm_idx_t *mi; mm_idx_t *mi;
@@ -466,11 +517,14 @@ mm_idx_t *mm_idx_load(FILE *fp)
uint8_t l; uint8_t l;
mm_idx_seq_t *s = &mi->seq[i]; mm_idx_seq_t *s = &mi->seq[i];
fread(&l, 1, 1, fp); fread(&l, 1, 1, fp);
if (l) {
s->name = (char*)kmalloc(mi->km, l + 1); s->name = (char*)kmalloc(mi->km, l + 1);
fread(s->name, 1, l, fp); fread(s->name, 1, l, fp);
s->name[l] = 0; s->name[l] = 0;
}
fread(&s->len, 4, 1, fp); fread(&s->len, 4, 1, fp);
s->offset = sum_len; s->offset = sum_len;
s->is_alt = 0;
sum_len += s->len; sum_len += s->len;
} }
for (i = 0; i < 1<<mi->b; ++i) { for (i = 0; i < 1<<mi->b; ++i) {
@@ -504,14 +558,19 @@ mm_idx_t *mm_idx_load(FILE *fp)
int64_t mm_idx_is_idx(const char *fn) int64_t mm_idx_is_idx(const char *fn)
{ {
int fd, is_idx = 0; int fd, is_idx = 0;
off_t ret, off_end; int64_t ret, off_end;
char magic[4]; char magic[4];
if (strcmp(fn, "-") == 0) return 0; // read from pipe; not an index if (strcmp(fn, "-") == 0) return 0; // read from pipe; not an index
fd = open(fn, O_RDONLY); fd = open(fn, O_RDONLY);
if (fd < 0) return -1; // error if (fd < 0) return -1; // error
#ifdef WIN32
if ((off_end = _lseeki64(fd, 0, SEEK_END)) >= 4) {
_lseeki64(fd, 0, SEEK_SET);
#else
if ((off_end = lseek(fd, 0, SEEK_END)) >= 4) { if ((off_end = lseek(fd, 0, SEEK_END)) >= 4) {
lseek(fd, 0, SEEK_SET); lseek(fd, 0, SEEK_SET);
#endif // WIN32
ret = read(fd, magic, 4); ret = read(fd, magic, 4);
if (ret == 4 && strncmp(magic, MM_IDX_MAGIC, 4) == 0) if (ret == 4 && strncmp(magic, MM_IDX_MAGIC, 4) == 0)
is_idx = 1; is_idx = 1;
@@ -557,7 +616,7 @@ mm_idx_t *mm_idx_reader_read(mm_idx_reader_t *r, int n_threads)
mi = mm_idx_gen(r->fp.seq, r->opt.w, r->opt.k, r->opt.bucket_bits, r->opt.flag, r->opt.mini_batch_size, n_threads, r->opt.batch_size); mi = mm_idx_gen(r->fp.seq, r->opt.w, r->opt.k, r->opt.bucket_bits, r->opt.flag, r->opt.mini_batch_size, n_threads, r->opt.batch_size);
if (mi) { if (mi) {
if (r->fp_out) mm_idx_dump(r->fp_out, mi); if (r->fp_out) mm_idx_dump(r->fp_out, mi);
++r->n_parts; mi->index = r->n_parts++;
} }
return mi; return mi;
} }
@@ -566,3 +625,151 @@ int mm_idx_reader_eof(const mm_idx_reader_t *r) // TODO: in extremely rare cases
{ {
return r->is_idx? (feof(r->fp.idx) || ftell(r->fp.idx) == r->idx_size) : mm_bseq_eof(r->fp.seq); return r->is_idx? (feof(r->fp.idx) || ftell(r->fp.idx) == r->idx_size) : mm_bseq_eof(r->fp.seq);
} }
#include <ctype.h>
#include <zlib.h>
#include "ksort.h"
#include "kseq.h"
KSTREAM_DECLARE(gzFile, gzread)
int mm_idx_alt_read(mm_idx_t *mi, const char *fn)
{
int n_alt = 0;
gzFile fp;
kstream_t *ks;
kstring_t str = {0,0,0};
fp = fn && strcmp(fn, "-")? gzopen(fn, "r") : gzdopen(fileno(stdin), "r");
if (fp == 0) return -1;
ks = ks_init(fp);
if (mi->h == 0) mm_idx_index_name(mi);
while (ks_getuntil(ks, KS_SEP_LINE, &str, 0) >= 0) {
char *p;
int id;
for (p = str.s; *p && !isspace(*p); ++p) { }
*p = 0;
id = mm_idx_name2id(mi, str.s);
if (id >= 0) mi->seq[id].is_alt = 1, ++n_alt;
}
mi->n_alt = n_alt;
if (mm_verbose >= 3)
fprintf(stderr, "[M::%s] found %d ALT contigs\n", __func__, n_alt);
return n_alt;
}
#define sort_key_bed(a) ((a).st)
KRADIX_SORT_INIT(bed, mm_idx_intv1_t, sort_key_bed, 4)
mm_idx_intv_t *mm_idx_read_bed(const mm_idx_t *mi, const char *fn, int read_junc)
{
gzFile fp;
kstream_t *ks;
kstring_t str = {0,0,0};
mm_idx_intv_t *I;
fp = fn && strcmp(fn, "-")? gzopen(fn, "r") : gzdopen(fileno(stdin), "r");
if (fp == 0) return 0;
I = (mm_idx_intv_t*)calloc(mi->n_seq, sizeof(*I));
ks = ks_init(fp);
while (ks_getuntil(ks, KS_SEP_LINE, &str, 0) >= 0) {
mm_idx_intv_t *r;
mm_idx_intv1_t t = {-1,-1,-1,-1,0};
char *p, *q, *bl, *bs;
int32_t i, id = -1, n_blk = 0;
for (p = q = str.s, i = 0;; ++p) {
if (*p == 0 || *p == '\t') {
int32_t c = *p;
*p = 0;
if (i == 0) { // chr
id = mm_idx_name2id(mi, q);
if (id < 0) break; // unknown name; TODO: throw a warning
} else if (i == 1) { // start
t.st = atol(q); // TODO: watch out integer overflow!
if (t.st < 0) break;
} else if (i == 2) { // end
t.en = atol(q);
if (t.en < 0) break;
} else if (i == 4) { // BED score
t.score = atol(q);
} else if (i == 5) { // strand
t.strand = *q == '+'? 1 : *q == '-'? -1 : 0;
} else if (i == 9) {
if (!isdigit(*q)) break;
n_blk = atol(q);
} else if (i == 10) {
bl = q;
} else if (i == 11) {
bs = q;
break;
}
if (c == 0) break;
++i, q = p + 1;
}
}
if (id < 0 || t.st < 0 || t.st >= t.en) continue;
r = &I[id];
if (i >= 11 && read_junc) { // BED12
int32_t st, sz, en;
st = strtol(bs, &bs, 10); ++bs;
sz = strtol(bl, &bl, 10); ++bl;
en = t.st + st + sz;
for (i = 1; i < n_blk; ++i) {
mm_idx_intv1_t s = t;
if (r->n == r->m) {
r->m = r->m? r->m + (r->m>>1) : 16;
r->a = (mm_idx_intv1_t*)realloc(r->a, sizeof(*r->a) * r->m);
}
st = strtol(bs, &bs, 10); ++bs;
sz = strtol(bl, &bl, 10); ++bl;
s.st = en, s.en = t.st + st;
en = t.st + st + sz;
if (s.en > s.st) r->a[r->n++] = s;
}
} else {
if (r->n == r->m) {
r->m = r->m? r->m + (r->m>>1) : 16;
r->a = (mm_idx_intv1_t*)realloc(r->a, sizeof(*r->a) * r->m);
}
r->a[r->n++] = t;
}
}
free(str.s);
ks_destroy(ks);
gzclose(fp);
return I;
}
int mm_idx_bed_read(mm_idx_t *mi, const char *fn, int read_junc)
{
int32_t i;
if (mi->h == 0) mm_idx_index_name(mi);
mi->I = mm_idx_read_bed(mi, fn, read_junc);
if (mi->I == 0) return -1;
for (i = 0; i < mi->n_seq; ++i) // TODO: eliminate redundant intervals
radix_sort_bed(mi->I[i].a, mi->I[i].a + mi->I[i].n);
return 0;
}
int mm_idx_bed_junc(const mm_idx_t *mi, int32_t ctg, int32_t st, int32_t en, uint8_t *s)
{
int32_t i, left, right;
mm_idx_intv_t *r;
memset(s, 0, en - st);
if (mi->I == 0 || ctg < 0 || ctg >= mi->n_seq) return -1;
r = &mi->I[ctg];
left = 0, right = r->n;
while (right > left) {
int32_t mid = left + ((right - left) >> 1);
if (r->a[mid].st >= st) right = mid;
else left = mid + 1;
}
for (i = left; i < r->n; ++i) {
if (st <= r->a[i].st && en >= r->a[i].en && r->a[i].strand != 0) {
if (r->a[i].strand > 0) {
s[r->a[i].st - st] |= 1, s[r->a[i].en - 1 - st] |= 2;
} else {
s[r->a[i].st - st] |= 8, s[r->a[i].en - 1 - st] |= 4;
}
}
}
return left;
}
+21 -14
View File
@@ -18,15 +18,14 @@
* | | | | * | | | |
* p=p->ptr->ptr->ptr->ptr p->ptr p->ptr->ptr p->ptr->ptr->ptr * p=p->ptr->ptr->ptr->ptr p->ptr p->ptr->ptr p->ptr->ptr->ptr
*/ */
#define MIN_CORE_SIZE 0x80000
typedef struct header_t { typedef struct header_t {
size_t size; size_t size;
struct header_t *ptr; struct header_t *ptr;
} header_t; } header_t;
typedef struct { typedef struct {
void *par;
size_t min_core_size;
header_t base, *loop_head, *core_head; /* base is a zero-sized block always kept in the loop */ header_t base, *loop_head, *core_head; /* base is a zero-sized block always kept in the loop */
} kmem_t; } kmem_t;
@@ -36,31 +35,39 @@ static void panic(const char *s)
abort(); abort();
} }
void *km_init(void) void *km_init2(void *km_par, size_t min_core_size)
{ {
return calloc(1, sizeof(kmem_t)); kmem_t *km;
km = (kmem_t*)kcalloc(km_par, 1, sizeof(kmem_t));
km->par = km_par;
km->min_core_size = min_core_size > 0? min_core_size : 0x80000;
return (void*)km;
} }
void *km_init(void) { return km_init2(0, 0); }
void km_destroy(void *_km) void km_destroy(void *_km)
{ {
kmem_t *km = (kmem_t*)_km; kmem_t *km = (kmem_t*)_km;
void *km_par;
header_t *p, *q; header_t *p, *q;
if (km == NULL) return; if (km == NULL) return;
km_par = km->par;
for (p = km->core_head; p != NULL;) { for (p = km->core_head; p != NULL;) {
q = p->ptr; q = p->ptr;
free(p); kfree(km_par, p);
p = q; p = q;
} }
free(km); kfree(km_par, km);
} }
static header_t *morecore(kmem_t *km, size_t nu) static header_t *morecore(kmem_t *km, size_t nu)
{ {
header_t *q; header_t *q;
size_t bytes, *p; size_t bytes, *p;
nu = (nu + 1 + (MIN_CORE_SIZE - 1)) / MIN_CORE_SIZE * MIN_CORE_SIZE; /* the first +1 for core header */ nu = (nu + 1 + (km->min_core_size - 1)) / km->min_core_size * km->min_core_size; /* the first +1 for core header */
bytes = nu * sizeof(header_t); bytes = nu * sizeof(header_t);
q = (header_t*)malloc(bytes); q = (header_t*)kmalloc(km->par, bytes);
if (!q) panic("[morecore] insufficient memory"); if (!q) panic("[morecore] insufficient memory");
q->ptr = km->core_head, q->size = nu, km->core_head = q; q->ptr = km->core_head, q->size = nu, km->core_head = q;
p = (size_t*)(q + 1); p = (size_t*)(q + 1);
@@ -125,7 +132,7 @@ void *kmalloc(void *_km, size_t n_bytes)
if (n_bytes == 0) return 0; if (n_bytes == 0) return 0;
if (km == NULL) return malloc(n_bytes); if (km == NULL) return malloc(n_bytes);
n_units = (n_bytes + sizeof(size_t) + sizeof(header_t) - 1) / sizeof(header_t) + 1; n_units = (n_bytes + sizeof(size_t) + sizeof(header_t) - 1) / sizeof(header_t); /* header+n_bytes requires at least this number of units */
if (!(q = km->loop_head)) /* the first time when kmalloc() is called, intialize it */ if (!(q = km->loop_head)) /* the first time when kmalloc() is called, intialize it */
q = km->loop_head = km->base.ptr = &km->base; q = km->loop_head = km->base.ptr = &km->base;
@@ -160,18 +167,18 @@ void *kcalloc(void *_km, size_t count, size_t size)
void *krealloc(void *_km, void *ap, size_t n_bytes) // TODO: this can be made more efficient in principle void *krealloc(void *_km, void *ap, size_t n_bytes) // TODO: this can be made more efficient in principle
{ {
kmem_t *km = (kmem_t*)_km; kmem_t *km = (kmem_t*)_km;
size_t n_units, *p, *q; size_t cap, *p, *q;
if (n_bytes == 0) { if (n_bytes == 0) {
kfree(km, ap); return 0; kfree(km, ap); return 0;
} }
if (km == NULL) return realloc(ap, n_bytes); if (km == NULL) return realloc(ap, n_bytes);
if (ap == NULL) return kmalloc(km, n_bytes); if (ap == NULL) return kmalloc(km, n_bytes);
n_units = (n_bytes + sizeof(size_t) + sizeof(header_t) - 1) / sizeof(header_t);
p = (size_t*)ap - 1; p = (size_t*)ap - 1;
if (*p >= n_units) return ap; /* TODO: this prevents shrinking */ cap = (*p) * sizeof(header_t) - sizeof(size_t);
if (cap >= n_bytes) return ap; /* TODO: this prevents shrinking */
q = (size_t*)kmalloc(km, n_bytes); q = (size_t*)kmalloc(km, n_bytes);
memcpy(q, ap, (*p - 1) * sizeof(header_t)); memcpy(q, ap, cap);
kfree(km, ap); kfree(km, ap);
return q; return q;
} }
+49
View File
@@ -17,6 +17,7 @@ void *kcalloc(void *km, size_t count, size_t size);
void kfree(void *km, void *ptr); void kfree(void *km, void *ptr);
void *km_init(void); void *km_init(void);
void *km_init2(void *km_par, size_t min_core_size);
void km_destroy(void *km); void km_destroy(void *km);
void km_stat(const void *_km, km_stat_t *s); void km_stat(const void *_km, km_stat_t *s);
@@ -24,4 +25,52 @@ void km_stat(const void *_km, km_stat_t *s);
} }
#endif #endif
#define KMALLOC(km, ptr, len) ((ptr) = (__typeof__(ptr))kmalloc((km), (len) * sizeof(*(ptr))))
#define KCALLOC(km, ptr, len) ((ptr) = (__typeof__(ptr))kcalloc((km), (len), sizeof(*(ptr))))
#define KREALLOC(km, ptr, len) ((ptr) = (__typeof__(ptr))krealloc((km), (ptr), (len) * sizeof(*(ptr))))
#define KEXPAND(km, a, m) do { \
(m) = (m) >= 4? (m) + ((m)>>1) : 16; \
KREALLOC((km), (a), (m)); \
} while (0)
#ifndef klib_unused
#if (defined __clang__ && __clang_major__ >= 3) || (defined __GNUC__ && __GNUC__ >= 3)
#define klib_unused __attribute__ ((__unused__))
#else
#define klib_unused
#endif
#endif /* klib_unused */
#define KALLOC_POOL_INIT2(SCOPE, name, kmptype_t) \
typedef struct { \
size_t cnt, n, max; \
kmptype_t **buf; \
void *km; \
} kmp_##name##_t; \
SCOPE kmp_##name##_t *kmp_init_##name(void *km) { \
kmp_##name##_t *mp; \
KCALLOC(km, mp, 1); \
mp->km = km; \
return mp; \
} \
SCOPE void kmp_destroy_##name(kmp_##name##_t *mp) { \
size_t k; \
for (k = 0; k < mp->n; ++k) kfree(mp->km, mp->buf[k]); \
kfree(mp->km, mp->buf); kfree(mp->km, mp); \
} \
SCOPE kmptype_t *kmp_alloc_##name(kmp_##name##_t *mp) { \
++mp->cnt; \
if (mp->n == 0) return (kmptype_t*)kcalloc(mp->km, 1, sizeof(kmptype_t)); \
return mp->buf[--mp->n]; \
} \
SCOPE void kmp_free_##name(kmp_##name##_t *mp, kmptype_t *p) { \
--mp->cnt; \
if (mp->n == mp->max) KEXPAND(mp->km, mp->buf, mp->max); \
mp->buf[mp->n++] = p; \
}
#define KALLOC_POOL_INIT(name, kmptype_t) \
KALLOC_POOL_INIT2(static inline klib_unused, name, kmptype_t)
#endif #endif
+120
View File
@@ -0,0 +1,120 @@
#ifndef KETOPT_H
#define KETOPT_H
#include <string.h> /* for strchr() and strncmp() */
#define ko_no_argument 0
#define ko_required_argument 1
#define ko_optional_argument 2
typedef struct {
int ind; /* equivalent to optind */
int opt; /* equivalent to optopt */
char *arg; /* equivalent to optarg */
int longidx; /* index of a long option; or -1 if short */
/* private variables not intended for external uses */
int i, pos, n_args;
} ketopt_t;
typedef struct {
char *name;
int has_arg;
int val;
} ko_longopt_t;
static ketopt_t KETOPT_INIT = { 1, 0, 0, -1, 1, 0, 0 };
static void ketopt_permute(char *argv[], int j, int n) /* move argv[j] over n elements to the left */
{
int k;
char *p = argv[j];
for (k = 0; k < n; ++k)
argv[j - k] = argv[j - k - 1];
argv[j - k] = p;
}
/**
* Parse command-line options and arguments
*
* This fuction has a similar interface to GNU's getopt_long(). Each call
* parses one option and returns the option name. s->arg points to the option
* argument if present. The function returns -1 when all command-line arguments
* are parsed. In this case, s->ind is the index of the first non-option
* argument.
*
* @param s status; shall be initialized to KETOPT_INIT on the first call
* @param argc length of argv[]
* @param argv list of command-line arguments; argv[0] is ignored
* @param permute non-zero to move options ahead of non-option arguments
* @param ostr option string
* @param longopts long options
*
* @return ASCII for a short option; ko_longopt_t::val for a long option; -1 if
* argv[] is fully processed; '?' for an unknown option or an ambiguous
* long option; ':' if an option argument is missing
*/
static int ketopt(ketopt_t *s, int argc, char *argv[], int permute, const char *ostr, const ko_longopt_t *longopts)
{
int opt = -1, i0, j;
if (permute) {
while (s->i < argc && (argv[s->i][0] != '-' || argv[s->i][1] == '\0'))
++s->i, ++s->n_args;
}
s->arg = 0, s->longidx = -1, i0 = s->i;
if (s->i >= argc || argv[s->i][0] != '-' || argv[s->i][1] == '\0') {
s->ind = s->i - s->n_args;
return -1;
}
if (argv[s->i][0] == '-' && argv[s->i][1] == '-') { /* "--" or a long option */
if (argv[s->i][2] == '\0') { /* a bare "--" */
ketopt_permute(argv, s->i, s->n_args);
++s->i, s->ind = s->i - s->n_args;
return -1;
}
s->opt = 0, opt = '?', s->pos = -1;
if (longopts) { /* parse long options */
int k, n_exact = 0, n_partial = 0;
const ko_longopt_t *o = 0, *o_exact = 0, *o_partial = 0;
for (j = 2; argv[s->i][j] != '\0' && argv[s->i][j] != '='; ++j) {} /* find the end of the option name */
for (k = 0; longopts[k].name != 0; ++k)
if (strncmp(&argv[s->i][2], longopts[k].name, j - 2) == 0) {
if (longopts[k].name[j - 2] == 0) ++n_exact, o_exact = &longopts[k];
else ++n_partial, o_partial = &longopts[k];
}
if (n_exact > 1 || (n_exact == 0 && n_partial > 1)) return '?';
o = n_exact == 1? o_exact : n_partial == 1? o_partial : 0;
if (o) {
s->opt = opt = o->val, s->longidx = o - longopts;
if (argv[s->i][j] == '=') s->arg = &argv[s->i][j + 1];
if (o->has_arg == 1 && argv[s->i][j] == '\0') {
if (s->i < argc - 1) s->arg = argv[++s->i];
else opt = ':'; /* missing option argument */
}
}
}
} else { /* a short option */
char *p;
if (s->pos == 0) s->pos = 1;
opt = s->opt = argv[s->i][s->pos++];
p = strchr((char*)ostr, opt);
if (p == 0) {
opt = '?'; /* unknown option */
} else if (p[1] == ':') {
if (argv[s->i][s->pos] == 0) {
if (s->i < argc - 1) s->arg = argv[++s->i];
else opt = ':'; /* missing option argument */
} else s->arg = &argv[s->i][s->pos];
s->pos = -1;
}
}
if (s->pos < 0 || argv[s->i][s->pos] == 0) {
++s->i, s->pos = 0;
if (s->n_args > 0) /* permute */
for (j = i0; j < s->i; ++j)
ketopt_permute(argv, j, s->n_args);
}
s->ind = s->i - s->n_args;
return opt;
}
#endif
+474
View File
@@ -0,0 +1,474 @@
/* The MIT License
Copyright (c) 2019 by Attractive Chaos <attractor@live.co.uk>
Permission is hereby granted, free of charge, to any person obtaining
a copy of this software and associated documentation files (the
"Software"), to deal in the Software without restriction, including
without limitation the rights to use, copy, modify, merge, publish,
distribute, sublicense, and/or sell copies of the Software, and to
permit persons to whom the Software is furnished to do so, subject to
the following conditions:
The above copyright notice and this permission notice shall be
included in all copies or substantial portions of the Software.
THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS
BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN
ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN
CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
SOFTWARE.
*/
/* An example:
#include <stdio.h>
#include <string.h>
#include <stdlib.h>
#include "krmq.h"
struct my_node {
char key;
KRMQ_HEAD(struct my_node) head;
};
#define my_cmp(p, q) (((q)->key < (p)->key) - ((p)->key < (q)->key))
KRMQ_INIT(my, struct my_node, head, my_cmp)
int main(void) {
const char *str = "MNOLKQOPHIA"; // from wiki, except a duplicate
struct my_node *root = 0;
int i, l = strlen(str);
for (i = 0; i < l; ++i) { // insert in the input order
struct my_node *q, *p = malloc(sizeof(*p));
p->key = str[i];
q = krmq_insert(my, &root, p, 0);
if (p != q) free(p); // if already present, free
}
krmq_itr_t(my) itr;
krmq_itr_first(my, root, &itr); // place at first
do { // traverse
const struct my_node *p = krmq_at(&itr);
putchar(p->key);
free((void*)p); // free node
} while (krmq_itr_next(my, &itr));
putchar('\n');
return 0;
}
*/
#ifndef KRMQ_H
#define KRMQ_H
#ifdef __STRICT_ANSI__
#define inline __inline__
#endif
#define KRMQ_MAX_DEPTH 64
#define krmq_size(head, p) ((p)? (p)->head.size : 0)
#define krmq_size_child(head, q, i) ((q)->head.p[(i)]? (q)->head.p[(i)]->head.size : 0)
#define KRMQ_HEAD(__type) \
struct { \
__type *p[2], *s; \
signed char balance; /* balance factor */ \
unsigned size; /* #elements in subtree */ \
}
#define __KRMQ_FIND(suf, __scope, __type, __head, __cmp) \
__scope __type *krmq_find_##suf(const __type *root, const __type *x, unsigned *cnt_) { \
const __type *p = root; \
unsigned cnt = 0; \
while (p != 0) { \
int cmp; \
cmp = __cmp(x, p); \
if (cmp >= 0) cnt += krmq_size_child(__head, p, 0) + 1; \
if (cmp < 0) p = p->__head.p[0]; \
else if (cmp > 0) p = p->__head.p[1]; \
else break; \
} \
if (cnt_) *cnt_ = cnt; \
return (__type*)p; \
} \
__scope __type *krmq_interval_##suf(const __type *root, const __type *x, __type **lower, __type **upper) { \
const __type *p = root, *l = 0, *u = 0; \
while (p != 0) { \
int cmp; \
cmp = __cmp(x, p); \
if (cmp < 0) u = p, p = p->__head.p[0]; \
else if (cmp > 0) l = p, p = p->__head.p[1]; \
else { l = u = p; break; } \
} \
if (lower) *lower = (__type*)l; \
if (upper) *upper = (__type*)u; \
return (__type*)p; \
}
#define __KRMQ_RMQ(suf, __scope, __type, __head, __cmp, __lt2) \
__scope __type *krmq_rmq_##suf(const __type *root, const __type *lo, const __type *up) { /* CLOSED interval */ \
const __type *p = root, *path[2][KRMQ_MAX_DEPTH], *min; \
int plen[2] = {0, 0}, pcmp[2][KRMQ_MAX_DEPTH], i, cmp, lca; \
if (root == 0) return 0; \
while (p) { \
cmp = __cmp(lo, p); \
path[0][plen[0]] = p, pcmp[0][plen[0]++] = cmp; \
if (cmp < 0) p = p->__head.p[0]; \
else if (cmp > 0) p = p->__head.p[1]; \
else break; \
} \
p = root; \
while (p) { \
cmp = __cmp(up, p); \
path[1][plen[1]] = p, pcmp[1][plen[1]++] = cmp; \
if (cmp < 0) p = p->__head.p[0]; \
else if (cmp > 0) p = p->__head.p[1]; \
else break; \
} \
for (i = 0; i < plen[0] && i < plen[1]; ++i) /* find the LCA */ \
if (path[0][i] == path[1][i] && pcmp[0][i] <= 0 && pcmp[1][i] >= 0) \
break; \
if (i == plen[0] || i == plen[1]) return 0; /* no elements in the closed interval */ \
lca = i, min = path[0][lca]; \
for (i = lca + 1; i < plen[0]; ++i) { \
if (pcmp[0][i] <= 0) { \
if (__lt2(path[0][i], min)) min = path[0][i]; \
if (path[0][i]->__head.p[1] && __lt2(path[0][i]->__head.p[1]->__head.s, min)) \
min = path[0][i]->__head.p[1]->__head.s; \
} \
} \
for (i = lca + 1; i < plen[1]; ++i) { \
if (pcmp[1][i] >= 0) { \
if (__lt2(path[1][i], min)) min = path[1][i]; \
if (path[1][i]->__head.p[0] && __lt2(path[1][i]->__head.p[0]->__head.s, min)) \
min = path[1][i]->__head.p[0]->__head.s; \
} \
} \
return (__type*)min; \
}
#define __KRMQ_ROTATE(suf, __type, __head, __lt2) \
/* */ \
static inline void krmq_update_min_##suf(__type *p, const __type *q, const __type *r) { \
p->__head.s = !q || __lt2(p, q->__head.s)? p : q->__head.s; \
p->__head.s = !r || __lt2(p->__head.s, r->__head.s)? p->__head.s : r->__head.s; \
} \
/* one rotation: (a,(b,c)q)p => ((a,b)p,c)q */ \
static inline __type *krmq_rotate1_##suf(__type *p, int dir) { /* dir=0 to left; dir=1 to right */ \
int opp = 1 - dir; /* opposite direction */ \
__type *q = p->__head.p[opp], *s = p->__head.s; \
unsigned size_p = p->__head.size; \
p->__head.size -= q->__head.size - krmq_size_child(__head, q, dir); \
q->__head.size = size_p; \
krmq_update_min_##suf(p, p->__head.p[dir], q->__head.p[dir]); \
q->__head.s = s; \
p->__head.p[opp] = q->__head.p[dir]; \
q->__head.p[dir] = p; \
return q; \
} \
/* two consecutive rotations: (a,((b,c)r,d)q)p => ((a,b)p,(c,d)q)r */ \
static inline __type *krmq_rotate2_##suf(__type *p, int dir) { \
int b1, opp = 1 - dir; \
__type *q = p->__head.p[opp], *r = q->__head.p[dir], *s = p->__head.s; \
unsigned size_x_dir = krmq_size_child(__head, r, dir); \
r->__head.size = p->__head.size; \
p->__head.size -= q->__head.size - size_x_dir; \
q->__head.size -= size_x_dir + 1; \
krmq_update_min_##suf(p, p->__head.p[dir], r->__head.p[dir]); \
krmq_update_min_##suf(q, q->__head.p[opp], r->__head.p[opp]); \
r->__head.s = s; \
p->__head.p[opp] = r->__head.p[dir]; \
r->__head.p[dir] = p; \
q->__head.p[dir] = r->__head.p[opp]; \
r->__head.p[opp] = q; \
b1 = dir == 0? +1 : -1; \
if (r->__head.balance == b1) q->__head.balance = 0, p->__head.balance = -b1; \
else if (r->__head.balance == 0) q->__head.balance = p->__head.balance = 0; \
else q->__head.balance = b1, p->__head.balance = 0; \
r->__head.balance = 0; \
return r; \
}
#define __KRMQ_INSERT(suf, __scope, __type, __head, __cmp, __lt2) \
__scope __type *krmq_insert_##suf(__type **root_, __type *x, unsigned *cnt_) { \
unsigned char stack[KRMQ_MAX_DEPTH]; \
__type *path[KRMQ_MAX_DEPTH]; \
__type *bp, *bq; \
__type *p, *q, *r = 0; /* _r_ is potentially the new root */ \
int i, which = 0, top, b1, path_len; \
unsigned cnt = 0; \
bp = *root_, bq = 0; \
/* find the insertion location */ \
for (p = bp, q = bq, top = path_len = 0; p; q = p, p = p->__head.p[which]) { \
int cmp; \
cmp = __cmp(x, p); \
if (cmp >= 0) cnt += krmq_size_child(__head, p, 0) + 1; \
if (cmp == 0) { \
if (cnt_) *cnt_ = cnt; \
return p; \
} \
if (p->__head.balance != 0) \
bq = q, bp = p, top = 0; \
stack[top++] = which = (cmp > 0); \
path[path_len++] = p; \
} \
if (cnt_) *cnt_ = cnt; \
x->__head.balance = 0, x->__head.size = 1, x->__head.p[0] = x->__head.p[1] = 0, x->__head.s = x; \
if (q == 0) *root_ = x; \
else q->__head.p[which] = x; \
if (bp == 0) return x; \
for (i = 0; i < path_len; ++i) ++path[i]->__head.size; \
for (i = path_len - 1; i >= 0; --i) { \
krmq_update_min_##suf(path[i], path[i]->__head.p[0], path[i]->__head.p[1]); \
if (path[i]->__head.s != x) break; \
} \
for (p = bp, top = 0; p != x; p = p->__head.p[stack[top]], ++top) /* update balance factors */ \
if (stack[top] == 0) --p->__head.balance; \
else ++p->__head.balance; \
if (bp->__head.balance > -2 && bp->__head.balance < 2) return x; /* no re-balance needed */ \
/* re-balance */ \
which = (bp->__head.balance < 0); \
b1 = which == 0? +1 : -1; \
q = bp->__head.p[1 - which]; \
if (q->__head.balance == b1) { \
r = krmq_rotate1_##suf(bp, which); \
q->__head.balance = bp->__head.balance = 0; \
} else r = krmq_rotate2_##suf(bp, which); \
if (bq == 0) *root_ = r; \
else bq->__head.p[bp != bq->__head.p[0]] = r; \
return x; \
}
#define __KRMQ_ERASE(suf, __scope, __type, __head, __cmp, __lt2) \
__scope __type *krmq_erase_##suf(__type **root_, const __type *x, unsigned *cnt_) { \
__type *p, *path[KRMQ_MAX_DEPTH], fake; \
unsigned char dir[KRMQ_MAX_DEPTH]; \
int i, d = 0, cmp; \
unsigned cnt = 0; \
fake = **root_, fake.__head.p[0] = *root_, fake.__head.p[1] = 0; \
if (cnt_) *cnt_ = 0; \
if (x) { \
for (cmp = -1, p = &fake; cmp; cmp = __cmp(x, p)) { \
int which = (cmp > 0); \
if (cmp > 0) cnt += krmq_size_child(__head, p, 0) + 1; \
dir[d] = which; \
path[d++] = p; \
p = p->__head.p[which]; \
if (p == 0) { \
if (cnt_) *cnt_ = 0; \
return 0; \
} \
} \
cnt += krmq_size_child(__head, p, 0) + 1; /* because p==x is not counted */ \
} else { \
for (p = &fake, cnt = 1; p; p = p->__head.p[0]) \
dir[d] = 0, path[d++] = p; \
p = path[--d]; \
} \
if (cnt_) *cnt_ = cnt; \
for (i = 1; i < d; ++i) --path[i]->__head.size; \
if (p->__head.p[1] == 0) { /* ((1,.)2,3)4 => (1,3)4; p=2 */ \
path[d-1]->__head.p[dir[d-1]] = p->__head.p[0]; \
} else { \
__type *q = p->__head.p[1]; \
if (q->__head.p[0] == 0) { /* ((1,2)3,4)5 => ((1)2,4)5; p=3,q=2 */ \
q->__head.p[0] = p->__head.p[0]; \
q->__head.balance = p->__head.balance; \
path[d-1]->__head.p[dir[d-1]] = q; \
path[d] = q, dir[d++] = 1; \
q->__head.size = p->__head.size - 1; \
} else { /* ((1,((.,2)3,4)5)6,7)8 => ((1,(2,4)5)3,7)8; p=6 */ \
__type *r; \
int e = d++; /* backup _d_ */\
for (;;) { \
dir[d] = 0; \
path[d++] = q; \
r = q->__head.p[0]; \
if (r->__head.p[0] == 0) break; \
q = r; \
} \
r->__head.p[0] = p->__head.p[0]; \
q->__head.p[0] = r->__head.p[1]; \
r->__head.p[1] = p->__head.p[1]; \
r->__head.balance = p->__head.balance; \
path[e-1]->__head.p[dir[e-1]] = r; \
path[e] = r, dir[e] = 1; \
for (i = e + 1; i < d; ++i) --path[i]->__head.size; \
r->__head.size = p->__head.size - 1; \
} \
} \
for (i = d - 1; i >= 0; --i) /* not sure why adding condition "path[i]->__head.s==p" doesn't work */ \
krmq_update_min_##suf(path[i], path[i]->__head.p[0], path[i]->__head.p[1]); \
while (--d > 0) { \
__type *q = path[d]; \
int which, other, b1 = 1, b2 = 2; \
which = dir[d], other = 1 - which; \
if (which) b1 = -b1, b2 = -b2; \
q->__head.balance += b1; \
if (q->__head.balance == b1) break; \
else if (q->__head.balance == b2) { \
__type *r = q->__head.p[other]; \
if (r->__head.balance == -b1) { \
path[d-1]->__head.p[dir[d-1]] = krmq_rotate2_##suf(q, which); \
} else { \
path[d-1]->__head.p[dir[d-1]] = krmq_rotate1_##suf(q, which); \
if (r->__head.balance == 0) { \
r->__head.balance = -b1; \
q->__head.balance = b1; \
break; \
} else r->__head.balance = q->__head.balance = 0; \
} \
} \
} \
*root_ = fake.__head.p[0]; \
return p; \
}
#define krmq_free(__type, __head, __root, __free) do { \
__type *_p, *_q; \
for (_p = __root; _p; _p = _q) { \
if (_p->__head.p[0] == 0) { \
_q = _p->__head.p[1]; \
__free(_p); \
} else { \
_q = _p->__head.p[0]; \
_p->__head.p[0] = _q->__head.p[1]; \
_q->__head.p[1] = _p; \
} \
} \
} while (0)
#define __KRMQ_ITR(suf, __scope, __type, __head, __cmp) \
struct krmq_itr_##suf { \
const __type *stack[KRMQ_MAX_DEPTH], **top; \
}; \
__scope void krmq_itr_first_##suf(const __type *root, struct krmq_itr_##suf *itr) { \
const __type *p; \
for (itr->top = itr->stack - 1, p = root; p; p = p->__head.p[0]) \
*++itr->top = p; \
} \
__scope int krmq_itr_find_##suf(const __type *root, const __type *x, struct krmq_itr_##suf *itr) { \
const __type *p = root; \
itr->top = itr->stack - 1; \
while (p != 0) { \
int cmp; \
*++itr->top = p; \
cmp = __cmp(x, p); \
if (cmp < 0) p = p->__head.p[0]; \
else if (cmp > 0) p = p->__head.p[1]; \
else break; \
} \
return p? 1 : 0; \
} \
__scope int krmq_itr_next_bidir_##suf(struct krmq_itr_##suf *itr, int dir) { \
const __type *p; \
if (itr->top < itr->stack) return 0; \
dir = !!dir; \
p = (*itr->top)->__head.p[dir]; \
if (p) { /* go down */ \
for (; p; p = p->__head.p[!dir]) \
*++itr->top = p; \
return 1; \
} else { /* go up */ \
do { \
p = *itr->top--; \
} while (itr->top >= itr->stack && p == (*itr->top)->__head.p[dir]); \
return itr->top < itr->stack? 0 : 1; \
} \
} \
/**
* Insert a node to the tree
*
* @param suf name suffix used in KRMQ_INIT()
* @param proot pointer to the root of the tree (in/out: root may change)
* @param x node to insert (in)
* @param cnt number of nodes smaller than or equal to _x_; can be NULL (out)
*
* @return _x_ if not present in the tree, or the node equal to x.
*/
#define krmq_insert(suf, proot, x, cnt) krmq_insert_##suf(proot, x, cnt)
/**
* Find a node in the tree
*
* @param suf name suffix used in KRMQ_INIT()
* @param root root of the tree
* @param x node value to find (in)
* @param cnt number of nodes smaller than or equal to _x_; can be NULL (out)
*
* @return node equal to _x_ if present, or NULL if absent
*/
#define krmq_find(suf, root, x, cnt) krmq_find_##suf(root, x, cnt)
#define krmq_interval(suf, root, x, lower, upper) krmq_interval_##suf(root, x, lower, upper)
#define krmq_rmq(suf, root, lo, up) krmq_rmq_##suf(root, lo, up)
/**
* Delete a node from the tree
*
* @param suf name suffix used in KRMQ_INIT()
* @param proot pointer to the root of the tree (in/out: root may change)
* @param x node value to delete; if NULL, delete the first node (in)
*
* @return node removed from the tree if present, or NULL if absent
*/
#define krmq_erase(suf, proot, x, cnt) krmq_erase_##suf(proot, x, cnt)
#define krmq_erase_first(suf, proot) krmq_erase_##suf(proot, 0, 0)
#define krmq_itr_t(suf) struct krmq_itr_##suf
/**
* Place the iterator at the smallest object
*
* @param suf name suffix used in KRMQ_INIT()
* @param root root of the tree
* @param itr iterator
*/
#define krmq_itr_first(suf, root, itr) krmq_itr_first_##suf(root, itr)
/**
* Place the iterator at the object equal to or greater than the query
*
* @param suf name suffix used in KRMQ_INIT()
* @param root root of the tree
* @param x query (in)
* @param itr iterator (out)
*
* @return 1 if find; 0 otherwise. krmq_at(itr) is NULL if and only if query is
* larger than all objects in the tree
*/
#define krmq_itr_find(suf, root, x, itr) krmq_itr_find_##suf(root, x, itr)
/**
* Move to the next object in order
*
* @param itr iterator (modified)
*
* @return 1 if there is a next object; 0 otherwise
*/
#define krmq_itr_next(suf, itr) krmq_itr_next_bidir_##suf(itr, 1)
#define krmq_itr_prev(suf, itr) krmq_itr_next_bidir_##suf(itr, 0)
/**
* Return the pointer at the iterator
*
* @param itr iterator
*
* @return pointer if present; NULL otherwise
*/
#define krmq_at(itr) ((itr)->top < (itr)->stack? 0 : *(itr)->top)
#define KRMQ_INIT2(suf, __scope, __type, __head, __cmp, __lt2) \
__KRMQ_FIND(suf, __scope, __type, __head, __cmp) \
__KRMQ_RMQ(suf, __scope, __type, __head, __cmp, __lt2) \
__KRMQ_ROTATE(suf, __type, __head, __lt2) \
__KRMQ_INSERT(suf, __scope, __type, __head, __cmp, __lt2) \
__KRMQ_ERASE(suf, __scope, __type, __head, __cmp, __lt2) \
__KRMQ_ITR(suf, __scope, __type, __head, __cmp)
#define KRMQ_INIT(suf, __type, __head, __cmp, __lt2) \
KRMQ_INIT2(suf,, __type, __head, __cmp, __lt2)
#endif
+10 -2
View File
@@ -37,6 +37,14 @@
#define KS_SEP_LINE 2 // line separator: "\n" (Unix) or "\r\n" (Windows) #define KS_SEP_LINE 2 // line separator: "\n" (Unix) or "\r\n" (Windows)
#define KS_SEP_MAX 2 #define KS_SEP_MAX 2
#ifndef klib_unused
#if (defined __clang__ && __clang_major__ >= 3) || (defined __GNUC__ && __GNUC__ >= 3)
#define klib_unused __attribute__ ((__unused__))
#else
#define klib_unused
#endif
#endif /* klib_unused */
#define __KS_TYPE(type_t) \ #define __KS_TYPE(type_t) \
typedef struct __kstream_t { \ typedef struct __kstream_t { \
int begin, end; \ int begin, end; \
@@ -64,7 +72,7 @@
} }
#define __KS_INLINED(__read) \ #define __KS_INLINED(__read) \
static inline int ks_getc(kstream_t *ks) \ static inline klib_unused int ks_getc(kstream_t *ks) \
{ \ { \
if (ks->is_eof && ks->begin >= ks->end) return -1; \ if (ks->is_eof && ks->begin >= ks->end) return -1; \
if (ks->begin >= ks->end) { \ if (ks->begin >= ks->end) { \
@@ -81,7 +89,7 @@
#ifndef KSTRING_T #ifndef KSTRING_T
#define KSTRING_T kstring_t #define KSTRING_T kstring_t
typedef struct __kstring_t { typedef struct __kstring_t {
unsigned l, m; size_t l, m;
char *s; char *s;
} kstring_t; } kstring_t;
#endif #endif
+1 -1
View File
@@ -37,7 +37,7 @@ typedef struct {
int depth; int depth;
} ks_isort_stack_t; } ks_isort_stack_t;
#define KSORT_SWAP(type_t, a, b) { register type_t t=(a); (a)=(b); (b)=t; } #define KSORT_SWAP(type_t, a, b) { type_t t=(a); (a)=(b); (b)=t; }
#define KSORT_INIT(name, type_t, __sort_lt) \ #define KSORT_INIT(name, type_t, __sort_lt) \
void ks_heapdown_##name(size_t i, size_t n, type_t l[]) \ void ks_heapdown_##name(size_t i, size_t n, type_t l[]) \
+16 -9
View File
@@ -16,6 +16,13 @@
#define KSW_EZ_SPLICE_REV 0x200 #define KSW_EZ_SPLICE_REV 0x200
#define KSW_EZ_SPLICE_FLANK 0x400 #define KSW_EZ_SPLICE_FLANK 0x400
// The subset of CIGAR operators used by ksw code.
// Use MM_CIGAR_* from minimap.h if you need the full list.
#define KSW_CIGAR_MATCH 0
#define KSW_CIGAR_INS 1
#define KSW_CIGAR_DEL 2
#define KSW_CIGAR_N_SKIP 3
#ifdef __cplusplus #ifdef __cplusplus
extern "C" { extern "C" {
#endif #endif
@@ -61,7 +68,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
int8_t gapo, int8_t gape, int8_t gapo2, int8_t gape2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez); int8_t gapo, int8_t gape, int8_t gapo2, int8_t gape2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t gapo, int8_t gape, int8_t gapo2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez); int8_t gapo, int8_t gape, int8_t gapo2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez);
void ksw_extf2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t mch, int8_t mis, int8_t e, int w, int xdrop, ksw_extz_t *ez); void ksw_extf2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t mch, int8_t mis, int8_t e, int w, int xdrop, ksw_extz_t *ez);
@@ -127,23 +134,23 @@ static inline void ksw_backtrack(void *km, int is_rot, int is_rev, int min_intro
r = i + j; r = i + j;
if (i < off[r]) force_state = 2; if (i < off[r]) force_state = 2;
if (off_end && i > off_end[r]) force_state = 1; if (off_end && i > off_end[r]) force_state = 1;
tmp = force_state < 0? p[r * n_col + i - off[r]] : 0; tmp = force_state < 0? p[(size_t)r * n_col + i - off[r]] : 0;
} else { } else {
if (j < off[i]) force_state = 2; if (j < off[i]) force_state = 2;
if (off_end && j > off_end[i]) force_state = 1; if (off_end && j > off_end[i]) force_state = 1;
tmp = force_state < 0? p[i * n_col + j - off[i]] : 0; tmp = force_state < 0? p[(size_t)i * n_col + j - off[i]] : 0;
} }
if (state == 0) state = tmp & 7; // if requesting the H state, find state one maximizes it. if (state == 0) state = tmp & 7; // if requesting the H state, find state one maximizes it.
else if (!(tmp >> (state + 2) & 1)) state = 0; // if requesting other states, _state_ stays the same if it is a continuation; otherwise, set to H else if (!(tmp >> (state + 2) & 1)) state = 0; // if requesting other states, _state_ stays the same if it is a continuation; otherwise, set to H
if (state == 0) state = tmp & 7; // TODO: probably this line can be merged into the "else if" line right above; not 100% sure if (state == 0) state = tmp & 7; // TODO: probably this line can be merged into the "else if" line right above; not 100% sure
if (force_state >= 0) state = force_state; if (force_state >= 0) state = force_state;
if (state == 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 0, 1), --i, --j; // match if (state == 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, KSW_CIGAR_MATCH, 1), --i, --j;
else if (state == 1 || (state == 3 && min_intron_len <= 0)) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 2, 1), --i; // deletion else if (state == 1 || (state == 3 && min_intron_len <= 0)) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, KSW_CIGAR_DEL, 1), --i;
else if (state == 3 && min_intron_len > 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 3, 1), --i; // intron else if (state == 3 && min_intron_len > 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, KSW_CIGAR_N_SKIP, 1), --i;
else cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 1, 1), --j; // insertion else cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, KSW_CIGAR_INS, 1), --j;
} }
if (i >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, min_intron_len > 0 && i >= min_intron_len? 3 : 2, i + 1); // first deletion if (i >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, min_intron_len > 0 && i >= min_intron_len? KSW_CIGAR_N_SKIP : KSW_CIGAR_DEL, i + 1); // first deletion
if (j >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 1, j + 1); // first insertion if (j >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, KSW_CIGAR_INS, j + 1); // first insertion
if (!is_rev) if (!is_rev)
for (i = 0; i < n_cigar>>1; ++i) // reverse CIGAR for (i = 0; i < n_cigar>>1; ++i) // reverse CIGAR
tmp = cigar[i], cigar[i] = cigar[n_cigar-1-i], cigar[n_cigar-1-i] = tmp; tmp = cigar[i], cigar[i] = cigar[n_cigar-1-i], cigar[n_cigar-1-i] = tmp;
+19 -20
View File
@@ -17,18 +17,20 @@
void __cpuidex(int cpuid[4], int func_id, int subfunc_id) void __cpuidex(int cpuid[4], int func_id, int subfunc_id)
{ {
#if defined(__x86_64__) #if defined(__x86_64__)
asm volatile ("cpuid" __asm__ volatile ("cpuid"
: "=a" (cpuid[0]), "=b" (cpuid[1]), "=c" (cpuid[2]), "=d" (cpuid[3]) : "=a" (cpuid[0]), "=b" (cpuid[1]), "=c" (cpuid[2]), "=d" (cpuid[3])
: "0" (func_id), "2" (subfunc_id)); : "0" (func_id), "2" (subfunc_id));
#else // on 32bit, ebx can NOT be used as PIC code #else // on 32bit, ebx can NOT be used as PIC code
asm volatile ("xchgl %%ebx, %1; cpuid; xchgl %%ebx, %1" __asm__ volatile ("xchgl %%ebx, %1; cpuid; xchgl %%ebx, %1"
: "=a" (cpuid[0]), "=r" (cpuid[1]), "=c" (cpuid[2]), "=d" (cpuid[3]) : "=a" (cpuid[0]), "=r" (cpuid[1]), "=c" (cpuid[2]), "=d" (cpuid[3])
: "0" (func_id), "2" (subfunc_id)); : "0" (func_id), "2" (subfunc_id));
#endif #endif
} }
#endif #endif
int x86_simd(void) static int ksw_simd = -1;
static int x86_simd(void)
{ {
int flag = 0, cpuid[4], max_id; int flag = 0, cpuid[4], max_id;
__cpuidex(cpuid, 0, 0); __cpuidex(cpuid, 0, 0);
@@ -54,11 +56,10 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
{ {
extern void ksw_extz2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez); extern void ksw_extz2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
extern void ksw_extz2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez); extern void ksw_extz2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
unsigned simd; if (ksw_simd < 0) ksw_simd = x86_simd();
simd = x86_simd(); if (ksw_simd & SIMD_SSE4_1)
if (simd & SIMD_SSE4_1)
ksw_extz2_sse41(km, qlen, query, tlen, target, m, mat, q, e, w, zdrop, end_bonus, flag, ez); ksw_extz2_sse41(km, qlen, query, tlen, target, m, mat, q, e, w, zdrop, end_bonus, flag, ez);
else if (simd & SIMD_SSE2) else if (ksw_simd & SIMD_SSE2)
ksw_extz2_sse2(km, qlen, query, tlen, target, m, mat, q, e, w, zdrop, end_bonus, flag, ez); ksw_extz2_sse2(km, qlen, query, tlen, target, m, mat, q, e, w, zdrop, end_bonus, flag, ez);
else abort(); else abort();
} }
@@ -70,28 +71,26 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez); int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
extern void ksw_extd2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, extern void ksw_extd2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez); int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
unsigned simd; if (ksw_simd < 0) ksw_simd = x86_simd();
simd = x86_simd(); if (ksw_simd & SIMD_SSE4_1)
if (simd & SIMD_SSE4_1)
ksw_extd2_sse41(km, qlen, query, tlen, target, m, mat, q, e, q2, e2, w, zdrop, end_bonus, flag, ez); ksw_extd2_sse41(km, qlen, query, tlen, target, m, mat, q, e, q2, e2, w, zdrop, end_bonus, flag, ez);
else if (simd & SIMD_SSE2) else if (ksw_simd & SIMD_SSE2)
ksw_extd2_sse2(km, qlen, query, tlen, target, m, mat, q, e, q2, e2, w, zdrop, end_bonus, flag, ez); ksw_extd2_sse2(km, qlen, query, tlen, target, m, mat, q, e, q2, e2, w, zdrop, end_bonus, flag, ez);
else abort(); else abort();
} }
void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez) int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez)
{ {
extern void ksw_exts2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, extern void ksw_exts2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez); int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez);
extern void ksw_exts2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, extern void ksw_exts2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez); int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez);
unsigned simd; if (ksw_simd < 0) ksw_simd = x86_simd();
simd = x86_simd(); if (ksw_simd & SIMD_SSE4_1)
if (simd & SIMD_SSE4_1) ksw_exts2_sse41(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, junc_bonus, flag, junc, ez);
ksw_exts2_sse41(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, flag, ez); else if (ksw_simd & SIMD_SSE2)
else if (simd & SIMD_SSE2) ksw_exts2_sse2(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, junc_bonus, flag, junc, ez);
ksw_exts2_sse2(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, flag, ez);
else abort(); else abort();
} }
#endif #endif
+13 -5
View File
@@ -4,15 +4,23 @@
#include "ksw2.h" #include "ksw2.h"
#ifdef __SSE2__ #ifdef __SSE2__
#ifdef USE_SIMDE
#include <simde/x86/sse2.h>
#else
#include <emmintrin.h> #include <emmintrin.h>
#endif
#ifdef KSW_SSE2_ONLY #ifdef KSW_SSE2_ONLY
#undef __SSE4_1__ #undef __SSE4_1__
#endif #endif
#ifdef __SSE4_1__ #ifdef __SSE4_1__
#ifdef USE_SIMDE
#include <simde/x86/sse4.1.h>
#else
#include <smmintrin.h> #include <smmintrin.h>
#endif #endif
#endif
#ifdef KSW_CPU_DISPATCH #ifdef KSW_CPU_DISPATCH
#ifdef __SSE4_1__ #ifdef __SSE4_1__
@@ -76,7 +84,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
qe2_ = _mm_set1_epi8(q2 + e2); qe2_ = _mm_set1_epi8(q2 + e2);
sc_mch_ = _mm_set1_epi8(mat[0]); sc_mch_ = _mm_set1_epi8(mat[0]);
sc_mis_ = _mm_set1_epi8(mat[1]); sc_mis_ = _mm_set1_epi8(mat[1]);
sc_N_ = _mm_set1_epi8(-e2); sc_N_ = mat[m*m-1] == 0? _mm_set1_epi8(-e2) : _mm_set1_epi8(mat[m*m-1]);
m1_ = _mm_set1_epi8(m - 1); // wildcard m1_ = _mm_set1_epi8(m - 1); // wildcard
if (w < 0) w = tlen > qlen? tlen : qlen; if (w < 0) w = tlen > qlen? tlen : qlen;
@@ -111,7 +119,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
for (t = 0; t < tlen_ * 16; ++t) H[t] = KSW_NEG_INF; for (t = 0; t < tlen_ * 16; ++t) H[t] = KSW_NEG_INF;
} }
if (with_cigar) { if (with_cigar) {
mem2 = (uint8_t*)kmalloc(km, ((qlen + tlen - 1) * n_col_ + 1) * 16); mem2 = (uint8_t*)kmalloc(km, ((size_t)(qlen + tlen - 1) * n_col_ + 1) * 16);
p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4); p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4);
off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int) * 2); off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int) * 2);
off_end = off + qlen + tlen - 1; off_end = off + qlen + tlen - 1;
@@ -218,7 +226,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
#endif #endif
} }
} else if (!(flag&KSW_EZ_RIGHT)) { // gap left-alignment } else if (!(flag&KSW_EZ_RIGHT)) { // gap left-alignment
__m128i *pr = p + r * n_col_ - st_; __m128i *pr = p + (size_t)r * n_col_ - st_;
off[r] = st, off_end[r] = en; off[r] = st, off_end[r] = en;
for (t = st_; t <= en_; ++t) { for (t = st_; t <= en_; ++t) {
__m128i d, z, a, b, a2, b2, xt1, x2t1, vt1, ut, tmp; __m128i d, z, a, b, a2, b2, xt1, x2t1, vt1, ut, tmp;
@@ -265,7 +273,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
_mm_store_si128(&pr[t], d); _mm_store_si128(&pr[t], d);
} }
} else { // gap right-alignment } else { // gap right-alignment
__m128i *pr = p + r * n_col_ - st_; __m128i *pr = p + (size_t)r * n_col_ - st_;
off[r] = st, off_end[r] = en; off[r] = st, off_end[r] = en;
for (t = st_; t <= en_; ++t) { for (t = st_; t <= en_; ++t) {
__m128i d, z, a, b, a2, b2, xt1, x2t1, vt1, ut, tmp; __m128i d, z, a, b, a2, b2, xt1, x2t1, vt1, ut, tmp;
@@ -382,7 +390,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR); int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY)) { if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY)) {
ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar); ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
} else if (!ez->zdropped && (flag&KSW_EZ_EXTZ_ONLY) && ez->mqe + end_bonus > ez->max) { } else if (!ez->zdropped && (flag&KSW_EZ_EXTZ_ONLY) && ez->mqe + end_bonus > (int)ez->max) {
ez->reach_end = 1; ez->reach_end = 1;
ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, ez->mqe_t, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar); ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, ez->mqe_t, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
} else if (ez->max_t >= 0 && ez->max_q >= 0) { } else if (ez->max_t >= 0 && ez->max_q >= 0) {
+47 -7
View File
@@ -4,27 +4,34 @@
#include "ksw2.h" #include "ksw2.h"
#ifdef __SSE2__ #ifdef __SSE2__
#ifdef USE_SIMDE
#include <simde/x86/sse2.h>
#else
#include <emmintrin.h> #include <emmintrin.h>
#endif
#ifdef KSW_SSE2_ONLY #ifdef KSW_SSE2_ONLY
#undef __SSE4_1__ #undef __SSE4_1__
#endif #endif
#ifdef __SSE4_1__ #ifdef __SSE4_1__
#ifdef USE_SIMDE
#include <simde/x86/sse4.1.h>
#else
#include <smmintrin.h> #include <smmintrin.h>
#endif #endif
#endif
#ifdef KSW_CPU_DISPATCH #ifdef KSW_CPU_DISPATCH
#ifdef __SSE4_1__ #ifdef __SSE4_1__
void ksw_exts2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, void ksw_exts2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez) int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez)
#else #else
void ksw_exts2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, void ksw_exts2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez) int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez)
#endif #endif
#else #else
void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez) int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez)
#endif // ~KSW_CPU_DISPATCH #endif // ~KSW_CPU_DISPATCH
{ {
#define __dp_code_block1 \ #define __dp_code_block1 \
@@ -71,7 +78,7 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
qe_ = _mm_set1_epi8(q + e); qe_ = _mm_set1_epi8(q + e);
sc_mch_ = _mm_set1_epi8(mat[0]); sc_mch_ = _mm_set1_epi8(mat[0]);
sc_mis_ = _mm_set1_epi8(mat[1]); sc_mis_ = _mm_set1_epi8(mat[1]);
sc_N_ = _mm_set1_epi8(-e); sc_N_ = mat[m*m-1] == 0? _mm_set1_epi8(-e) : _mm_set1_epi8(mat[m*m-1]);
m1_ = _mm_set1_epi8(m - 1); // wildcard m1_ = _mm_set1_epi8(m - 1); // wildcard
tlen_ = (tlen + 15) / 16; tlen_ = (tlen + 15) / 16;
@@ -100,7 +107,7 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
for (t = 0; t < tlen_ * 16; ++t) H[t] = KSW_NEG_INF; for (t = 0; t < tlen_ * 16; ++t) H[t] = KSW_NEG_INF;
} }
if (with_cigar) { if (with_cigar) {
mem2 = (uint8_t*)kmalloc(km, ((qlen + tlen - 1) * n_col_ + 1) * 16); mem2 = (uint8_t*)kmalloc(km, ((size_t)(qlen + tlen - 1) * n_col_ + 1) * 16);
p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4); p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4);
off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int) * 2); off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int) * 2);
off_end = off + qlen + tlen - 1; off_end = off + qlen + tlen - 1;
@@ -113,6 +120,8 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
if (flag & (KSW_EZ_SPLICE_FOR|KSW_EZ_SPLICE_REV)) { if (flag & (KSW_EZ_SPLICE_FOR|KSW_EZ_SPLICE_REV)) {
int semi_cost = flag&KSW_EZ_SPLICE_FLANK? -noncan/2 : 0; // GTr or yAG is worth 0.5 bit; see PMID:18688272 int semi_cost = flag&KSW_EZ_SPLICE_FLANK? -noncan/2 : 0; // GTr or yAG is worth 0.5 bit; see PMID:18688272
memset(donor, -noncan, tlen_ * 16); memset(donor, -noncan, tlen_ * 16);
memset(acceptor, -noncan, tlen_ * 16);
if (!(flag & KSW_EZ_REV_CIGAR)) {
for (t = 0; t < tlen - 4; ++t) { for (t = 0; t < tlen - 4; ++t) {
int can_type = 0; // type of canonical site: 0=none, 1=GT/AG only, 2=GTr/yAG int can_type = 0; // type of canonical site: 0=none, 1=GT/AG only, 2=GTr/yAG
if ((flag & KSW_EZ_SPLICE_FOR) && target[t+1] == 2 && target[t+2] == 3) can_type = 1; // GTr... if ((flag & KSW_EZ_SPLICE_FOR) && target[t+1] == 2 && target[t+2] == 3) can_type = 1; // GTr...
@@ -120,7 +129,10 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
if (can_type && (target[t+3] == 0 || target[t+3] == 2)) can_type = 2; if (can_type && (target[t+3] == 0 || target[t+3] == 2)) can_type = 2;
if (can_type) ((int8_t*)donor)[t] = can_type == 2? 0 : semi_cost; if (can_type) ((int8_t*)donor)[t] = can_type == 2? 0 : semi_cost;
} }
memset(acceptor, -noncan, tlen_ * 16); if (junc)
for (t = 0; t < tlen - 1; ++t)
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t+1]&1)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t+1]&8)))
((int8_t*)donor)[t] += junc_bonus;
for (t = 2; t < tlen; ++t) { for (t = 2; t < tlen; ++t) {
int can_type = 0; int can_type = 0;
if ((flag & KSW_EZ_SPLICE_FOR) && target[t-1] == 0 && target[t] == 2) can_type = 1; // ...yAG if ((flag & KSW_EZ_SPLICE_FOR) && target[t-1] == 0 && target[t] == 2) can_type = 1; // ...yAG
@@ -128,6 +140,34 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
if (can_type && (target[t-2] == 1 || target[t-2] == 3)) can_type = 2; if (can_type && (target[t-2] == 1 || target[t-2] == 3)) can_type = 2;
if (can_type) ((int8_t*)acceptor)[t] = can_type == 2? 0 : semi_cost; if (can_type) ((int8_t*)acceptor)[t] = can_type == 2? 0 : semi_cost;
} }
if (junc)
for (t = 0; t < tlen; ++t)
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t]&2)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t]&4)))
((int8_t*)acceptor)[t] += junc_bonus;
} else {
for (t = 0; t < tlen - 4; ++t) {
int can_type = 0; // type of canonical site: 0=none, 1=GT/AG only, 2=GTr/yAG
if ((flag & KSW_EZ_SPLICE_FOR) && target[t+1] == 2 && target[t+2] == 0) can_type = 1; // GAy...
if ((flag & KSW_EZ_SPLICE_REV) && target[t+1] == 1 && target[t+2] == 0) can_type = 1; // CAy...
if (can_type && (target[t+3] == 1 || target[t+3] == 3)) can_type = 2;
if (can_type) ((int8_t*)donor)[t] = can_type == 2? 0 : semi_cost;
}
if (junc)
for (t = 0; t < tlen - 1; ++t)
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t+1]&2)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t+1]&4)))
((int8_t*)donor)[t] += junc_bonus;
for (t = 2; t < tlen; ++t) {
int can_type = 0;
if ((flag & KSW_EZ_SPLICE_FOR) && target[t-1] == 3 && target[t] == 2) can_type = 1; // ...rTG
if ((flag & KSW_EZ_SPLICE_REV) && target[t-1] == 3 && target[t] == 1) can_type = 1; // ...rTC
if (can_type && (target[t-2] == 0 || target[t-2] == 2)) can_type = 2;
if (can_type) ((int8_t*)acceptor)[t] = can_type == 2? 0 : semi_cost;
}
if (junc)
for (t = 0; t < tlen; ++t)
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t]&1)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t]&8)))
((int8_t*)acceptor)[t] += junc_bonus;
}
} }
for (r = 0, last_st = last_en = -1; r < qlen + tlen - 1; ++r) { for (r = 0, last_st = last_en = -1; r < qlen + tlen - 1; ++r) {
+13 -5
View File
@@ -3,15 +3,23 @@
#include "ksw2.h" #include "ksw2.h"
#ifdef __SSE2__ #ifdef __SSE2__
#ifdef USE_SIMDE
#include <simde/x86/sse2.h>
#else
#include <emmintrin.h> #include <emmintrin.h>
#endif
#ifdef KSW_SSE2_ONLY #ifdef KSW_SSE2_ONLY
#undef __SSE4_1__ #undef __SSE4_1__
#endif #endif
#ifdef __SSE4_1__ #ifdef __SSE4_1__
#ifdef USE_SIMDE
#include <simde/x86/sse4.1.h>
#else
#include <smmintrin.h> #include <smmintrin.h>
#endif #endif
#endif
#ifdef KSW_CPU_DISPATCH #ifdef KSW_CPU_DISPATCH
#ifdef __SSE4_1__ #ifdef __SSE4_1__
@@ -65,7 +73,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
flag16_ = _mm_set1_epi8(0x10); flag16_ = _mm_set1_epi8(0x10);
sc_mch_ = _mm_set1_epi8(mat[0]); sc_mch_ = _mm_set1_epi8(mat[0]);
sc_mis_ = _mm_set1_epi8(mat[1]); sc_mis_ = _mm_set1_epi8(mat[1]);
sc_N_ = _mm_set1_epi8(-e); sc_N_ = mat[m*m-1] == 0? _mm_set1_epi8(-e) : _mm_set1_epi8(mat[m*m-1]);
m1_ = _mm_set1_epi8(m - 1); // wildcard m1_ = _mm_set1_epi8(m - 1); // wildcard
max_sc_ = _mm_set1_epi8(mat[0] + (q + e) * 2); max_sc_ = _mm_set1_epi8(mat[0] + (q + e) * 2);
@@ -89,7 +97,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
for (t = 0; t < tlen_ * 16; ++t) H[t] = KSW_NEG_INF; for (t = 0; t < tlen_ * 16; ++t) H[t] = KSW_NEG_INF;
} }
if (with_cigar) { if (with_cigar) {
mem2 = (uint8_t*)kmalloc(km, ((qlen + tlen - 1) * n_col_ + 1) * 16); mem2 = (uint8_t*)kmalloc(km, ((size_t)(qlen + tlen - 1) * n_col_ + 1) * 16);
p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4); p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4);
off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int) * 2); off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int) * 2);
off_end = off + qlen + tlen - 1; off_end = off + qlen + tlen - 1;
@@ -169,7 +177,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
#endif #endif
} }
} else if (!(flag&KSW_EZ_RIGHT)) { // gap left-alignment } else if (!(flag&KSW_EZ_RIGHT)) { // gap left-alignment
__m128i *pr = p + r * n_col_ - st_; __m128i *pr = p + (size_t)r * n_col_ - st_;
off[r] = st, off_end[r] = en; off[r] = st, off_end[r] = en;
for (t = st_; t <= en_; ++t) { for (t = st_; t <= en_; ++t) {
__m128i d, z, a, b, xt1, vt1, ut, tmp; __m128i d, z, a, b, xt1, vt1, ut, tmp;
@@ -195,7 +203,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
_mm_store_si128(&pr[t], d); _mm_store_si128(&pr[t], d);
} }
} else { // gap right-alignment } else { // gap right-alignment
__m128i *pr = p + r * n_col_ - st_; __m128i *pr = p + (size_t)r * n_col_ - st_;
off[r] = st, off_end[r] = en; off[r] = st, off_end[r] = en;
for (t = st_; t <= en_; ++t) { for (t = st_; t <= en_; ++t) {
__m128i d, z, a, b, xt1, vt1, ut, tmp; __m128i d, z, a, b, xt1, vt1, ut, tmp;
@@ -293,7 +301,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR); int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY)) { if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY)) {
ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar); ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
} else if (!ez->zdropped && (flag&KSW_EZ_EXTZ_ONLY) && ez->mqe + end_bonus > ez->max) { } else if (!ez->zdropped && (flag&KSW_EZ_EXTZ_ONLY) && ez->mqe + end_bonus > (int)ez->max) {
ez->reach_end = 1; ez->reach_end = 1;
ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, ez->mqe_t, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar); ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, ez->mqe_t, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
} else if (ez->max_t >= 0 && ez->max_q >= 0) { } else if (ez->max_t >= 0 && ez->max_q >= 0) {
+6 -1
View File
@@ -1,9 +1,14 @@
#include <stdlib.h> #include <stdlib.h>
#include <stdint.h> #include <stdint.h>
#include <string.h> #include <string.h>
#include <emmintrin.h>
#include "ksw2.h" #include "ksw2.h"
#ifdef USE_SIMDE
#include <simde/x86/sse2.h>
#else
#include <emmintrin.h>
#endif
#ifdef __GNUC__ #ifdef __GNUC__
#define LIKELY(x) __builtin_expect((x),1) #define LIKELY(x) __builtin_expect((x),1)
#define UNLIKELY(x) __builtin_expect((x),0) #define UNLIKELY(x) __builtin_expect((x),0)
+344
View File
@@ -0,0 +1,344 @@
#include <stdint.h>
#include <string.h>
#include <stdio.h>
#include <assert.h>
#include "mmpriv.h"
#include "kalloc.h"
#include "krmq.h"
uint64_t *mg_chain_backtrack(void *km, int64_t n, const int32_t *f, const int64_t *p, int32_t *v, int32_t *t, int32_t min_cnt, int32_t min_sc, int32_t *n_u_, int32_t *n_v_)
{
mm128_t *z;
uint64_t *u;
int64_t i, k, n_z, n_v;
int32_t n_u;
*n_u_ = *n_v_ = 0;
for (i = 0, n_z = 0; i < n; ++i) // precompute n_z
if (f[i] >= min_sc) ++n_z;
if (n_z == 0) return 0;
KMALLOC(km, z, n_z);
for (i = 0, k = 0; i < n; ++i) // populate z[]
if (f[i] >= min_sc) z[k].x = f[i], z[k++].y = i;
radix_sort_128x(z, z + n_z);
memset(t, 0, n * 4);
for (k = n_z - 1, n_v = n_u = 0; k >= 0; --k) { // precompute n_u
int64_t n_v0 = n_v;
int32_t sc;
for (i = z[k].y; i >= 0 && t[i] == 0; i = p[i])
++n_v, t[i] = 1;
sc = i < 0? z[k].x : (int32_t)z[k].x - f[i];
if (sc >= min_sc && n_v > n_v0 && n_v - n_v0 >= min_cnt)
++n_u;
else n_v = n_v0;
}
KMALLOC(km, u, n_u);
memset(t, 0, n * 4);
for (k = n_z - 1, n_v = n_u = 0; k >= 0; --k) { // populate u[]
int64_t n_v0 = n_v;
int32_t sc;
for (i = z[k].y; i >= 0 && t[i] == 0; i = p[i])
v[n_v++] = i, t[i] = 1;
sc = i < 0? z[k].x : (int32_t)z[k].x - f[i];
if (sc >= min_sc && n_v > n_v0 && n_v - n_v0 >= min_cnt)
u[n_u++] = (uint64_t)sc << 32 | (n_v - n_v0);
else n_v = n_v0;
}
kfree(km, z);
assert(n_v < INT32_MAX);
*n_u_ = n_u, *n_v_ = n_v;
return u;
}
static mm128_t *compact_a(void *km, int32_t n_u, uint64_t *u, int32_t n_v, int32_t *v, mm128_t *a)
{
mm128_t *b, *w;
uint64_t *u2;
int64_t i, j, k;
// write the result to b[]
KMALLOC(km, b, n_v);
for (i = 0, k = 0; i < n_u; ++i) {
int32_t k0 = k, ni = (int32_t)u[i];
for (j = 0; j < ni; ++j)
b[k++] = a[v[k0 + (ni - j - 1)]];
}
kfree(km, v);
// sort u[] and a[] by the target position, such that adjacent chains may be joined
KMALLOC(km, w, n_u);
for (i = k = 0; i < n_u; ++i) {
w[i].x = b[k].x, w[i].y = (uint64_t)k<<32|i;
k += (int32_t)u[i];
}
radix_sort_128x(w, w + n_u);
KMALLOC(km, u2, n_u);
for (i = k = 0; i < n_u; ++i) {
int32_t j = (int32_t)w[i].y, n = (int32_t)u[j];
u2[i] = u[j];
memcpy(&a[k], &b[w[i].y>>32], n * sizeof(mm128_t));
k += n;
}
memcpy(u, u2, n_u * 8);
memcpy(b, a, k * sizeof(mm128_t)); // write _a_ to _b_ and deallocate _a_ because _a_ is oversized, sometimes a lot
kfree(km, a); kfree(km, w); kfree(km, u2);
return b;
}
static inline int32_t comput_sc(const mm128_t *ai, const mm128_t *aj, int32_t max_dist_x, int32_t max_dist_y, int32_t bw, float chn_pen_gap, float chn_pen_skip, int is_cdna, int n_seg)
{
int32_t dq = (int32_t)ai->y - (int32_t)aj->y, dr, dd, dg, q_span, sc;
int32_t sidi = (ai->y & MM_SEED_SEG_MASK) >> MM_SEED_SEG_SHIFT;
int32_t sidj = (aj->y & MM_SEED_SEG_MASK) >> MM_SEED_SEG_SHIFT;
if (dq <= 0 || dq > max_dist_x) return INT32_MIN;
dr = (int32_t)(ai->x - aj->x);
if (sidi == sidj && (dr == 0 || dq > max_dist_y)) return INT32_MIN;
dd = dr > dq? dr - dq : dq - dr;
if (sidi == sidj && dd > bw) return INT32_MIN;
if (n_seg > 1 && !is_cdna && sidi == sidj && dr > max_dist_y) return INT32_MIN;
dg = dr < dq? dr : dq;
q_span = aj->y>>32&0xff;
sc = q_span < dg? q_span : dg;
if (dd || dg > q_span) {
float lin_pen, log_pen;
lin_pen = chn_pen_gap * (float)dd + chn_pen_skip * (float)dg;
log_pen = dd >= 1? mg_log2(dd + 1) : 0.0f; // mg_log2() only works for dd>=2
if (is_cdna || sidi != sidj) {
if (sidi != sidj && dr == 0) ++sc; // possibly due to overlapping paired ends; give a minor bonus
else if (dr > dq || sidi != sidj) sc -= (int)(lin_pen < log_pen? lin_pen : log_pen); // deletion or jump between paired ends
else sc -= (int)(lin_pen + .5f * log_pen);
} else sc -= (int)(lin_pen + .5f * log_pen);
}
return sc;
}
/* Input:
* a[].x: tid<<33 | rev<<32 | tpos
* a[].y: flags<<40 | q_span<<32 | q_pos
* Output:
* n_u: #chains
* u[]: score<<32 | #anchors (sum of lower 32 bits of u[] is the returned length of a[])
* input a[] is deallocated on return
*/
mm128_t *mg_lchain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int max_iter, int min_cnt, int min_sc, float chn_pen_gap, float chn_pen_skip,
int is_cdna, int n_seg, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km)
{ // TODO: make sure this works when n has more than 32 bits
int32_t *f, *t, *v, n_u, n_v, mmax_f = 0;
int64_t *p, i, j, max_ii, st = 0, n_iter = 0;
uint64_t *u;
if (_u) *_u = 0, *n_u_ = 0;
if (n == 0 || a == 0) {
kfree(km, a);
return 0;
}
if (max_dist_x < bw) max_dist_x = bw;
if (max_dist_y < bw && !is_cdna) max_dist_y = bw;
KMALLOC(km, p, n);
KMALLOC(km, f, n);
KMALLOC(km, v, n);
KCALLOC(km, t, n);
// fill the score and backtrack arrays
for (i = 0, max_ii = -1; i < n; ++i) {
int64_t max_j = -1, end_j;
int32_t max_f = a[i].y>>32&0xff, n_skip = 0;
while (st < i && (a[i].x>>32 != a[st].x>>32 || a[i].x > a[st].x + max_dist_x)) ++st;
if (i - st > max_iter) st = i - max_iter;
for (j = i - 1; j >= st; --j) {
int32_t sc;
sc = comput_sc(&a[i], &a[j], max_dist_x, max_dist_y, bw, chn_pen_gap, chn_pen_skip, is_cdna, n_seg);
++n_iter;
if (sc == INT32_MIN) continue;
sc += f[j];
if (sc > max_f) {
max_f = sc, max_j = j;
if (n_skip > 0) --n_skip;
} else if (t[j] == (int32_t)i) {
if (++n_skip > max_skip)
break;
}
if (p[j] >= 0) t[p[j]] = i;
}
end_j = j;
if (max_ii < 0 || a[i].x - a[max_ii].x > (int64_t)max_dist_x) {
int32_t max = INT32_MIN;
max_ii = -1;
for (j = i - 1; j >= st; --j)
if (max < f[j]) max = f[j], max_ii = j;
}
if (max_ii >= 0 && max_ii < end_j) {
int32_t tmp;
tmp = comput_sc(&a[i], &a[max_ii], max_dist_x, max_dist_y, bw, chn_pen_gap, chn_pen_skip, is_cdna, n_seg);
if (tmp != INT32_MIN && max_f < tmp + f[max_ii])
max_f = tmp + f[max_ii], max_j = max_ii;
}
f[i] = max_f, p[i] = max_j;
v[i] = max_j >= 0 && v[max_j] > max_f? v[max_j] : max_f; // v[] keeps the peak score up to i; f[] is the score ending at i, not always the peak
if (max_ii < 0 || (a[i].x - a[max_ii].x <= (int64_t)max_dist_x && f[max_ii] < f[i]))
max_ii = i;
if (mmax_f < max_f) mmax_f = max_f;
}
u = mg_chain_backtrack(km, n, f, p, v, t, min_cnt, min_sc, &n_u, &n_v);
*n_u_ = n_u, *_u = u; // NB: note that u[] may not be sorted by score here
kfree(km, p); kfree(km, f); kfree(km, t);
if (n_u == 0) {
kfree(km, a); kfree(km, v);
return 0;
}
return compact_a(km, n_u, u, n_v, v, a);
}
typedef struct lc_elem_s {
int32_t y;
int64_t i;
double pri;
KRMQ_HEAD(struct lc_elem_s) head;
} lc_elem_t;
#define lc_elem_cmp(a, b) ((a)->y < (b)->y? -1 : (a)->y > (b)->y? 1 : ((a)->i > (b)->i) - ((a)->i < (b)->i))
#define lc_elem_lt2(a, b) ((a)->pri < (b)->pri)
KRMQ_INIT(lc_elem, lc_elem_t, head, lc_elem_cmp, lc_elem_lt2)
KALLOC_POOL_INIT(rmq, lc_elem_t)
static inline int32_t comput_sc_simple(const mm128_t *ai, const mm128_t *aj, float chn_pen_gap, float chn_pen_skip, int32_t *exact, int32_t *width)
{
int32_t dq = (int32_t)ai->y - (int32_t)aj->y, dr, dd, dg, q_span, sc;
dr = (int32_t)(ai->x - aj->x);
*width = dd = dr > dq? dr - dq : dq - dr;
dg = dr < dq? dr : dq;
q_span = aj->y>>32&0xff;
sc = q_span < dg? q_span : dg;
if (exact) *exact = (dd == 0 && dg <= q_span);
if (dd || dq > q_span) {
float lin_pen, log_pen;
lin_pen = chn_pen_gap * (float)dd + chn_pen_skip * (float)dg;
log_pen = dd >= 1? mg_log2(dd + 1) : 0.0f; // mg_log2() only works for dd>=2
sc -= (int)(lin_pen + .5f * log_pen);
}
return sc;
}
mm128_t *mg_lchain_rmq(int max_dist, int max_dist_inner, int bw, int max_chn_skip, int cap_rmq_size, int min_cnt, int min_sc, float chn_pen_gap, float chn_pen_skip,
int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km)
{
int32_t *f,*t, *v, n_u, n_v, mmax_f = 0, max_rmq_size = 0;
int64_t *p, i, i0, st = 0, st_inner = 0, n_iter = 0;
uint64_t *u;
lc_elem_t *root = 0, *root_inner = 0;
void *mem_mp = 0;
kmp_rmq_t *mp;
if (_u) *_u = 0, *n_u_ = 0;
if (n == 0 || a == 0) {
kfree(km, a);
return 0;
}
if (max_dist < bw) max_dist = bw;
if (max_dist_inner <= 0 || max_dist_inner >= max_dist) max_dist_inner = 0;
KMALLOC(km, p, n);
KMALLOC(km, f, n);
KCALLOC(km, t, n);
KMALLOC(km, v, n);
mem_mp = km_init2(km, 0x10000);
mp = kmp_init_rmq(mem_mp);
// fill the score and backtrack arrays
for (i = i0 = 0; i < n; ++i) {
int64_t max_j = -1;
int32_t q_span = a[i].y>>32&0xff, max_f = q_span;
lc_elem_t s, *q, *r, lo, hi;
// add in-range anchors
if (i0 < i && a[i0].x != a[i].x) {
int64_t j;
for (j = i0; j < i; ++j) {
q = kmp_alloc_rmq(mp);
q->y = (int32_t)a[j].y, q->i = j, q->pri = -(f[j] + 0.5 * chn_pen_gap * ((int32_t)a[j].x + (int32_t)a[j].y));
krmq_insert(lc_elem, &root, q, 0);
if (max_dist_inner > 0) {
r = kmp_alloc_rmq(mp);
*r = *q;
krmq_insert(lc_elem, &root_inner, r, 0);
}
}
i0 = i;
}
// get rid of active chains out of range
while (st < i && (a[i].x>>32 != a[st].x>>32 || a[i].x > a[st].x + max_dist || krmq_size(head, root) > cap_rmq_size)) {
s.y = (int32_t)a[st].y, s.i = st;
if ((q = krmq_find(lc_elem, root, &s, 0)) != 0) {
q = krmq_erase(lc_elem, &root, q, 0);
kmp_free_rmq(mp, q);
}
++st;
}
if (max_dist_inner > 0) { // similar to the block above, but applied to the inner tree
while (st_inner < i && (a[i].x>>32 != a[st_inner].x>>32 || a[i].x > a[st_inner].x + max_dist_inner || krmq_size(head, root_inner) > cap_rmq_size)) {
s.y = (int32_t)a[st_inner].y, s.i = st_inner;
if ((q = krmq_find(lc_elem, root_inner, &s, 0)) != 0) {
q = krmq_erase(lc_elem, &root_inner, q, 0);
kmp_free_rmq(mp, q);
}
++st_inner;
}
}
// RMQ
lo.i = INT32_MAX, lo.y = (int32_t)a[i].y - max_dist;
hi.i = 0, hi.y = (int32_t)a[i].y;
if ((q = krmq_rmq(lc_elem, root, &lo, &hi)) != 0) {
int32_t sc, exact, width, n_skip = 0;
int64_t j = q->i;
assert(q->y >= lo.y && q->y <= hi.y);
sc = f[j] + comput_sc_simple(&a[i], &a[j], chn_pen_gap, chn_pen_skip, &exact, &width);
if (width <= bw && sc > max_f) max_f = sc, max_j = j;
if (!exact && root_inner && (int32_t)a[i].y > 0) {
lc_elem_t *lo, *hi;
s.y = (int32_t)a[i].y - 1, s.i = n;
krmq_interval(lc_elem, root_inner, &s, &lo, &hi);
if (lo) {
const lc_elem_t *q;
int32_t width, n_rmq_iter = 0;
krmq_itr_t(lc_elem) itr;
krmq_itr_find(lc_elem, root_inner, lo, &itr);
while ((q = krmq_at(&itr)) != 0) {
if (q->y < (int32_t)a[i].y - max_dist_inner) break;
++n_rmq_iter;
j = q->i;
sc = f[j] + comput_sc_simple(&a[i], &a[j], chn_pen_gap, chn_pen_skip, 0, &width);
if (width <= bw) {
if (sc > max_f) {
max_f = sc, max_j = j;
if (n_skip > 0) --n_skip;
} else if (t[j] == (int32_t)i) {
if (++n_skip > max_chn_skip)
break;
}
if (p[j] >= 0) t[p[j]] = i;
}
if (!krmq_itr_prev(lc_elem, &itr)) break;
}
n_iter += n_rmq_iter;
}
}
}
// set max
assert(max_j < 0 || (a[max_j].x < a[i].x && (int32_t)a[max_j].y < (int32_t)a[i].y));
f[i] = max_f, p[i] = max_j;
v[i] = max_j >= 0 && v[max_j] > max_f? v[max_j] : max_f; // v[] keeps the peak score up to i; f[] is the score ending at i, not always the peak
if (mmax_f < max_f) mmax_f = max_f;
if (max_rmq_size < krmq_size(head, root)) max_rmq_size = krmq_size(head, root);
}
km_destroy(mem_mp);
u = mg_chain_backtrack(km, n, f, p, v, t, min_cnt, min_sc, &n_u, &n_v);
*n_u_ = n_u, *_u = u; // NB: note that u[] may not be sorted by score here
kfree(km, p); kfree(km, f); kfree(km, t);
if (n_u == 0) {
kfree(km, a); kfree(km, v);
return 0;
}
return compact_a(km, n_u, u, n_v, v, a);
}
Submodule
+1
Submodule lib/simde added at b30129b3b4
+258 -146
View File
@@ -1,12 +1,13 @@
#include <stdlib.h> #include <stdlib.h>
#include <stdio.h> #include <stdio.h>
#include <string.h> #include <string.h>
#include <errno.h>
#include "bseq.h" #include "bseq.h"
#include "minimap.h" #include "minimap.h"
#include "mmpriv.h" #include "mmpriv.h"
#include "getopt.h" #include "ketopt.h"
#define MM_VERSION "2.9-r720" #define MM_VERSION "2.22-r1101"
#ifdef __linux__ #ifdef __linux__
#include <sys/resource.h> #include <sys/resource.h>
@@ -22,58 +23,86 @@ void liftrlimit()
void liftrlimit() {} void liftrlimit() {}
#endif #endif
static struct option long_options[] = { static ko_longopt_t long_options[] = {
{ "bucket-bits", required_argument, 0, 0 }, { "bucket-bits", ko_required_argument, 300 },
{ "mb-size", required_argument, 0, 'K' }, { "mb-size", ko_required_argument, 'K' },
{ "seed", required_argument, 0, 0 }, { "seed", ko_required_argument, 302 },
{ "no-kalloc", no_argument, 0, 0 }, { "no-kalloc", ko_no_argument, 303 },
{ "print-qname", no_argument, 0, 0 }, { "print-qname", ko_no_argument, 304 },
{ "no-self", no_argument, 0, 'D' }, { "no-self", ko_no_argument, 'D' },
{ "print-seeds", no_argument, 0, 0 }, { "print-seeds", ko_no_argument, 306 },
{ "max-chain-skip", required_argument, 0, 0 }, { "max-chain-skip", ko_required_argument, 307 },
{ "min-dp-len", required_argument, 0, 0 }, { "min-dp-len", ko_required_argument, 308 },
{ "print-aln-seq", no_argument, 0, 0 }, { "print-aln-seq", ko_no_argument, 309 },
{ "splice", no_argument, 0, 0 }, { "splice", ko_no_argument, 310 },
{ "cost-non-gt-ag", required_argument, 0, 'C' }, { "cost-non-gt-ag", ko_required_argument, 'C' },
{ "no-long-join", no_argument, 0, 0 }, { "no-long-join", ko_no_argument, 312 },
{ "sr", no_argument, 0, 0 }, { "sr", ko_no_argument, 313 },
{ "frag", required_argument, 0, 0 }, { "frag", ko_required_argument, 314 },
{ "secondary", required_argument, 0, 0 }, { "secondary", ko_required_argument, 315 },
{ "cs", optional_argument, 0, 0 }, { "cs", ko_optional_argument, 316 },
{ "end-bonus", required_argument, 0, 0 }, { "end-bonus", ko_required_argument, 317 },
{ "no-pairing", no_argument, 0, 0 }, { "no-pairing", ko_no_argument, 318 },
{ "splice-flank", required_argument, 0, 0 }, { "splice-flank", ko_required_argument, 319 },
{ "idx-no-seq", no_argument, 0, 0 }, { "idx-no-seq", ko_no_argument, 320 },
{ "end-seed-pen", required_argument, 0, 0 }, // 21 { "end-seed-pen", ko_required_argument, 321 },
{ "for-only", no_argument, 0, 0 }, // 22 { "for-only", ko_no_argument, 322 },
{ "rev-only", no_argument, 0, 0 }, // 23 { "rev-only", ko_no_argument, 323 },
{ "heap-sort", required_argument, 0, 0 }, // 24 { "heap-sort", ko_required_argument, 324 },
{ "all-chain", no_argument, 0, 'P' }, { "all-chain", ko_no_argument, 'P' },
{ "dual", required_argument, 0, 0 }, // 26 { "dual", ko_required_argument, 326 },
{ "max-clip-ratio", required_argument, 0, 0 }, // 27 { "max-clip-ratio", ko_required_argument, 327 },
{ "help", no_argument, 0, 'h' }, { "min-occ-floor", ko_required_argument, 328 },
{ "max-intron-len", required_argument, 0, 'G' }, { "MD", ko_no_argument, 329 },
{ "version", no_argument, 0, 'V' }, { "lj-min-ratio", ko_required_argument, 330 },
{ "min-count", required_argument, 0, 'n' }, { "score-N", ko_required_argument, 331 },
{ "min-chain-score",required_argument, 0, 'm' }, { "eqx", ko_no_argument, 332 },
{ "mask-level", required_argument, 0, 'M' }, { "paf-no-hit", ko_no_argument, 333 },
{ "min-dp-score", required_argument, 0, 's' }, { "split-prefix", ko_required_argument, 334 },
{ "sam", no_argument, 0, 'a' }, { "no-end-flt", ko_no_argument, 335 },
{ 0, 0, 0, 0} { "hard-mask-level",ko_no_argument, 336 },
{ "cap-sw-mem", ko_required_argument, 337 },
{ "max-qlen", ko_required_argument, 338 },
{ "max-chain-iter", ko_required_argument, 339 },
{ "junc-bed", ko_required_argument, 340 },
{ "junc-bonus", ko_required_argument, 341 },
{ "sam-hit-only", ko_no_argument, 342 },
{ "chain-gap-scale",ko_required_argument, 343 },
{ "alt", ko_required_argument, 344 },
{ "alt-drop", ko_required_argument, 345 },
{ "mask-len", ko_required_argument, 346 },
{ "rmq", ko_optional_argument, 347 },
{ "qstrand", ko_no_argument, 348 },
{ "cap-kalloc", ko_required_argument, 349 },
{ "help", ko_no_argument, 'h' },
{ "max-intron-len", ko_required_argument, 'G' },
{ "version", ko_no_argument, 'V' },
{ "min-count", ko_required_argument, 'n' },
{ "min-chain-score",ko_required_argument, 'm' },
{ "mask-level", ko_required_argument, 'M' },
{ "min-dp-score", ko_required_argument, 's' },
{ "sam", ko_no_argument, 'a' },
{ 0, 0, 0 }
}; };
static inline int64_t mm_parse_num(const char *str) static inline int64_t mm_parse_num2(const char *str, char **q)
{ {
double x; double x;
char *p; char *p;
x = strtod(optarg, &p); x = strtod(str, &p);
if (*p == 'G' || *p == 'g') x *= 1e9; if (*p == 'G' || *p == 'g') x *= 1e9, ++p;
else if (*p == 'M' || *p == 'm') x *= 1e6; else if (*p == 'M' || *p == 'm') x *= 1e6, ++p;
else if (*p == 'K' || *p == 'k') x *= 1e3; else if (*p == 'K' || *p == 'k') x *= 1e3, ++p;
if (q) *q = p;
return (int64_t)(x + .499); return (int64_t)(x + .499);
} }
static inline void yes_or_no(mm_mapopt_t *opt, int flag, int long_idx, const char *arg, int yes_to_set) static inline int64_t mm_parse_num(const char *str)
{
return mm_parse_num2(str, 0);
}
static inline void yes_or_no(mm_mapopt_t *opt, int64_t flag, int long_idx, const char *arg, int yes_to_set)
{ {
if (yes_to_set) { if (yes_to_set) {
if (strcmp(arg, "yes") == 0 || strcmp(arg, "y") == 0) opt->flag |= flag; if (strcmp(arg, "yes") == 0 || strcmp(arg, "y") == 0) opt->flag |= flag;
@@ -88,11 +117,12 @@ static inline void yes_or_no(mm_mapopt_t *opt, int flag, int long_idx, const cha
int main(int argc, char *argv[]) int main(int argc, char *argv[])
{ {
const char *opt_str = "2aSDw:k:K:t:r:f:Vv:g:G:I:d:XT:s:x:Hcp:M:n:z:A:B:O:E:m:N:Qu:R:hF:LC:"; const char *opt_str = "2aSDw:k:K:t:r:f:Vv:g:G:I:d:XT:s:x:Hcp:M:n:z:A:B:O:E:m:N:Qu:R:hF:LC:yYPo:e:U:";
ketopt_t o = KETOPT_INIT;
mm_mapopt_t opt; mm_mapopt_t opt;
mm_idxopt_t ipt; mm_idxopt_t ipt;
int i, c, n_threads = 3, long_idx; int i, c, n_threads = 3, n_parts, old_best_n = -1;
char *fnw = 0, *rg = 0, *s; char *fnw = 0, *rg = 0, *junc_bed = 0, *s, *alt_list = 0;
FILE *fp_help = stderr; FILE *fp_help = stderr;
mm_idx_reader_t *idx_rdr; mm_idx_reader_t *idx_rdr;
mm_idx_t *mi; mm_idx_t *mi;
@@ -102,30 +132,35 @@ int main(int argc, char *argv[])
mm_realtime0 = realtime(); mm_realtime0 = realtime();
mm_set_opt(0, &ipt, &opt); mm_set_opt(0, &ipt, &opt);
while ((c = getopt_long(argc, argv, opt_str, long_options, &long_idx)) >= 0) // apply option -x/preset first while ((c = ketopt(&o, argc, argv, 1, opt_str, long_options)) >= 0) { // test command line options and apply option -x/preset first
if (c == 'x') { if (c == 'x') {
if (mm_set_opt(optarg, &ipt, &opt) < 0) { if (mm_set_opt(o.arg, &ipt, &opt) < 0) {
fprintf(stderr, "[ERROR] unknown preset '%s'\n", optarg); fprintf(stderr, "[ERROR] unknown preset '%s'\n", o.arg);
return 1; return 1;
} }
break; } else if (c == ':') {
fprintf(stderr, "[ERROR] missing option argument\n");
return 1;
} else if (c == '?') {
fprintf(stderr, "[ERROR] unknown option in \"%s\"\n", argv[o.i - 1]);
return 1;
} }
optreset = 1; }
o = KETOPT_INIT;
while ((c = getopt_long(argc, argv, opt_str, long_options, &long_idx)) >= 0) { while ((c = ketopt(&o, argc, argv, 1, opt_str, long_options)) >= 0) {
if (c == 'w') ipt.w = atoi(optarg); if (c == 'w') ipt.w = atoi(o.arg);
else if (c == 'k') ipt.k = atoi(optarg); else if (c == 'k') ipt.k = atoi(o.arg);
else if (c == 'H') ipt.flag |= MM_I_HPC; else if (c == 'H') ipt.flag |= MM_I_HPC;
else if (c == 'd') fnw = optarg; // the above are indexing related options, except -I else if (c == 'd') fnw = o.arg; // the above are indexing related options, except -I
else if (c == 'r') opt.bw = (int)mm_parse_num(optarg); else if (c == 't') n_threads = atoi(o.arg);
else if (c == 't') n_threads = atoi(optarg); else if (c == 'v') mm_verbose = atoi(o.arg);
else if (c == 'v') mm_verbose = atoi(optarg); else if (c == 'g') opt.max_gap = (int)mm_parse_num(o.arg);
else if (c == 'g') opt.max_gap = (int)mm_parse_num(optarg); else if (c == 'G') mm_mapopt_max_intron_len(&opt, (int)mm_parse_num(o.arg));
else if (c == 'G') mm_mapopt_max_intron_len(&opt, (int)mm_parse_num(optarg)); else if (c == 'F') opt.max_frag_len = (int)mm_parse_num(o.arg);
else if (c == 'F') opt.max_frag_len = (int)mm_parse_num(optarg); else if (c == 'N') old_best_n = opt.best_n, opt.best_n = atoi(o.arg);
else if (c == 'N') opt.best_n = atoi(optarg); else if (c == 'p') opt.pri_ratio = atof(o.arg);
else if (c == 'p') opt.pri_ratio = atof(optarg); else if (c == 'M') opt.mask_level = atof(o.arg);
else if (c == 'M') opt.mask_level = atof(optarg);
else if (c == 'c') opt.flag |= MM_F_OUT_CG | MM_F_CIGAR; else if (c == 'c') opt.flag |= MM_F_OUT_CG | MM_F_CIGAR;
else if (c == 'D') opt.flag |= MM_F_NO_DIAG; else if (c == 'D') opt.flag |= MM_F_NO_DIAG;
else if (c == 'P') opt.flag |= MM_F_ALL_CHAINS; else if (c == 'P') opt.flag |= MM_F_ALL_CHAINS;
@@ -134,57 +169,91 @@ int main(int argc, char *argv[])
else if (c == 'Q') opt.flag |= MM_F_NO_QUAL; else if (c == 'Q') opt.flag |= MM_F_NO_QUAL;
else if (c == 'Y') opt.flag |= MM_F_SOFTCLIP; else if (c == 'Y') opt.flag |= MM_F_SOFTCLIP;
else if (c == 'L') opt.flag |= MM_F_LONG_CIGAR; else if (c == 'L') opt.flag |= MM_F_LONG_CIGAR;
else if (c == 'T') opt.sdust_thres = atoi(optarg); else if (c == 'y') opt.flag |= MM_F_COPY_COMMENT;
else if (c == 'n') opt.min_cnt = atoi(optarg); else if (c == 'T') opt.sdust_thres = atoi(o.arg);
else if (c == 'm') opt.min_chain_score = atoi(optarg); else if (c == 'n') opt.min_cnt = atoi(o.arg);
else if (c == 'A') opt.a = atoi(optarg); else if (c == 'm') opt.min_chain_score = atoi(o.arg);
else if (c == 'B') opt.b = atoi(optarg); else if (c == 'A') opt.a = atoi(o.arg);
else if (c == 's') opt.min_dp_max = atoi(optarg); else if (c == 'B') opt.b = atoi(o.arg);
else if (c == 'C') opt.noncan = atoi(optarg); else if (c == 's') opt.min_dp_max = atoi(o.arg);
else if (c == 'I') ipt.batch_size = mm_parse_num(optarg); else if (c == 'C') opt.noncan = atoi(o.arg);
else if (c == 'K') opt.mini_batch_size = (int)mm_parse_num(optarg); else if (c == 'I') ipt.batch_size = mm_parse_num(o.arg);
else if (c == 'R') rg = optarg; else if (c == 'K') opt.mini_batch_size = mm_parse_num(o.arg);
else if (c == 'e') opt.occ_dist = mm_parse_num(o.arg);
else if (c == 'R') rg = o.arg;
else if (c == 'h') fp_help = stdout; else if (c == 'h') fp_help = stdout;
else if (c == '2') opt.flag |= MM_F_2_IO_THREADS; else if (c == '2') opt.flag |= MM_F_2_IO_THREADS;
else if (c == 0 && long_idx == 0) ipt.bucket_bits = atoi(optarg); // --bucket-bits else if (c == 'o') {
else if (c == 0 && long_idx == 2) opt.seed = atoi(optarg); // --seed if (strcmp(o.arg, "-") != 0) {
else if (c == 0 && long_idx == 3) mm_dbg_flag |= MM_DBG_NO_KALLOC; // --no-kalloc if (freopen(o.arg, "wb", stdout) == NULL) {
else if (c == 0 && long_idx == 4) mm_dbg_flag |= MM_DBG_PRINT_QNAME; // --print-qname fprintf(stderr, "[ERROR]\033[1;31m failed to write the output to file '%s'\033[0m: %s\n", o.arg, strerror(errno));
else if (c == 0 && long_idx == 6) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_SEED, n_threads = 1; // --print-seed exit(1);
else if (c == 0 && long_idx == 7) opt.max_chain_skip = atoi(optarg); // --max-chain-skip }
else if (c == 0 && long_idx == 8) opt.min_ksw_len = atoi(optarg); // --min-dp-len }
else if (c == 0 && long_idx == 9) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_ALN_SEQ, n_threads = 1; // --print-aln-seq }
else if (c == 0 && long_idx ==10) opt.flag |= MM_F_SPLICE; // --splice else if (c == 300) ipt.bucket_bits = atoi(o.arg); // --bucket-bits
else if (c == 0 && long_idx ==12) opt.flag |= MM_F_NO_LJOIN; // --no-long-join else if (c == 302) opt.seed = atoi(o.arg); // --seed
else if (c == 0 && long_idx ==13) opt.flag |= MM_F_SR; // --sr else if (c == 303) mm_dbg_flag |= MM_DBG_NO_KALLOC; // --no-kalloc
else if (c == 0 && long_idx ==17) opt.end_bonus = atoi(optarg); // --end-bonus else if (c == 304) mm_dbg_flag |= MM_DBG_PRINT_QNAME; // --print-qname
else if (c == 0 && long_idx ==18) opt.flag |= MM_F_INDEPEND_SEG; // --no-pairing else if (c == 306) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_SEED, n_threads = 1; // --print-seed
else if (c == 0 && long_idx ==20) ipt.flag |= MM_I_NO_SEQ; // --idx-no-seq else if (c == 307) opt.max_chain_skip = atoi(o.arg); // --max-chain-skip
else if (c == 0 && long_idx ==21) opt.anchor_ext_shift = atoi(optarg); // --end-seed-pen else if (c == 339) opt.max_chain_iter = atoi(o.arg); // --max-chain-iter
else if (c == 0 && long_idx ==22) opt.flag |= MM_F_FOR_ONLY; // --for-only else if (c == 308) opt.min_ksw_len = atoi(o.arg); // --min-dp-len
else if (c == 0 && long_idx ==23) opt.flag |= MM_F_REV_ONLY; // --rev-only else if (c == 309) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_ALN_SEQ, n_threads = 1; // --print-aln-seq
else if (c == 0 && long_idx ==27) opt.max_clip_ratio = atof(optarg); // --max-clip-ratio else if (c == 310) opt.flag |= MM_F_SPLICE; // --splice
else if (c == 0 && long_idx == 14) { // --frag else if (c == 312) opt.flag |= MM_F_NO_LJOIN; // --no-long-join
yes_or_no(&opt, MM_F_FRAG_MODE, long_idx, optarg, 1); else if (c == 313) opt.flag |= MM_F_SR; // --sr
} else if (c == 0 && long_idx == 15) { // --secondary else if (c == 317) opt.end_bonus = atoi(o.arg); // --end-bonus
yes_or_no(&opt, MM_F_NO_PRINT_2ND, long_idx, optarg, 0); else if (c == 318) opt.flag |= MM_F_INDEPEND_SEG; // --no-pairing
} else if (c == 0 && long_idx == 16) { // --cs else if (c == 320) ipt.flag |= MM_I_NO_SEQ; // --idx-no-seq
else if (c == 321) opt.anchor_ext_shift = atoi(o.arg); // --end-seed-pen
else if (c == 322) opt.flag |= MM_F_FOR_ONLY; // --for-only
else if (c == 323) opt.flag |= MM_F_REV_ONLY; // --rev-only
else if (c == 327) opt.max_clip_ratio = atof(o.arg); // --max-clip-ratio
else if (c == 328) opt.min_mid_occ = atoi(o.arg); // --min-occ-floor
else if (c == 329) opt.flag |= MM_F_OUT_MD; // --MD
else if (c == 331) opt.sc_ambi = atoi(o.arg); // --score-N
else if (c == 332) opt.flag |= MM_F_EQX; // --eqx
else if (c == 333) opt.flag |= MM_F_PAF_NO_HIT; // --paf-no-hit
else if (c == 334) opt.split_prefix = o.arg; // --split-prefix
else if (c == 335) opt.flag |= MM_F_NO_END_FLT; // --no-end-flt
else if (c == 336) opt.flag |= MM_F_HARD_MLEVEL; // --hard-mask-level
else if (c == 337) opt.max_sw_mat = mm_parse_num(o.arg); // --cap-sw-mat
else if (c == 338) opt.max_qlen = mm_parse_num(o.arg); // --max-qlen
else if (c == 340) junc_bed = o.arg; // --junc-bed
else if (c == 341) opt.junc_bonus = atoi(o.arg); // --junc-bonus
else if (c == 342) opt.flag |= MM_F_SAM_HIT_ONLY; // --sam-hit-only
else if (c == 343) opt.chain_gap_scale = atof(o.arg); // --chain-gap-scale
else if (c == 344) alt_list = o.arg; // --alt
else if (c == 345) opt.alt_drop = atof(o.arg); // --alt-drop
else if (c == 346) opt.mask_len = mm_parse_num(o.arg); // --mask-len
else if (c == 348) opt.flag |= MM_F_QSTRAND | MM_F_NO_INV; // --qstrand
else if (c == 349) opt.cap_kalloc = mm_parse_num(o.arg); // --cap-kalloc
else if (c == 330) {
fprintf(stderr, "[WARNING] \033[1;31m --lj-min-ratio has been deprecated.\033[0m\n");
} else if (c == 314) { // --frag
yes_or_no(&opt, MM_F_FRAG_MODE, o.longidx, o.arg, 1);
} else if (c == 315) { // --secondary
yes_or_no(&opt, MM_F_NO_PRINT_2ND, o.longidx, o.arg, 0);
} else if (c == 316) { // --cs
opt.flag |= MM_F_OUT_CS | MM_F_CIGAR; opt.flag |= MM_F_OUT_CS | MM_F_CIGAR;
if (optarg == 0 || strcmp(optarg, "short") == 0) { if (o.arg == 0 || strcmp(o.arg, "short") == 0) {
opt.flag &= ~MM_F_OUT_CS_LONG; opt.flag &= ~MM_F_OUT_CS_LONG;
} else if (strcmp(optarg, "long") == 0) { } else if (strcmp(o.arg, "long") == 0) {
opt.flag |= MM_F_OUT_CS_LONG; opt.flag |= MM_F_OUT_CS_LONG;
} else if (strcmp(optarg, "none") == 0) { } else if (strcmp(o.arg, "none") == 0) {
opt.flag &= ~MM_F_OUT_CS; opt.flag &= ~MM_F_OUT_CS;
} else if (mm_verbose >= 2) { } else if (mm_verbose >= 2) {
fprintf(stderr, "[WARNING]\033[1;31m --cs only takes 'short' or 'long'. Invalid values are assumed to be 'short'.\033[0m\n"); fprintf(stderr, "[WARNING]\033[1;31m --cs only takes 'short' or 'long'. Invalid values are assumed to be 'short'.\033[0m\n");
} }
} else if (c == 0 && long_idx == 19) { // --splice-flank } else if (c == 319) { // --splice-flank
yes_or_no(&opt, MM_F_SPLICE_FLANK, long_idx, optarg, 1); yes_or_no(&opt, MM_F_SPLICE_FLANK, o.longidx, o.arg, 1);
} else if (c == 0 && long_idx == 24) { // --heap-sort } else if (c == 324) { // --heap-sort
yes_or_no(&opt, MM_F_HEAP_SORT, long_idx, optarg, 1); yes_or_no(&opt, MM_F_HEAP_SORT, o.longidx, o.arg, 1);
} else if (c == 0 && long_idx == 26) { // --dual } else if (c == 326) { // --dual
yes_or_no(&opt, MM_F_NO_DUAL, long_idx, optarg, 0); yes_or_no(&opt, MM_F_NO_DUAL, o.longidx, o.arg, 0);
} else if (c == 347) { // --rmq
yes_or_no(&opt, MM_F_RMQ, o.longidx, o.arg, 1);
} else if (c == 'S') { } else if (c == 'S') {
opt.flag |= MM_F_OUT_CS | MM_F_CIGAR | MM_F_OUT_CS_LONG; opt.flag |= MM_F_OUT_CS | MM_F_CIGAR | MM_F_OUT_CS_LONG;
if (mm_verbose >= 2) if (mm_verbose >= 2)
@@ -192,30 +261,36 @@ int main(int argc, char *argv[])
} else if (c == 'V') { } else if (c == 'V') {
puts(MM_VERSION); puts(MM_VERSION);
return 0; return 0;
} else if (c == 'r') {
opt.bw = (int)mm_parse_num2(o.arg, &s);
if (*s == ',') opt.bw_long = (int)mm_parse_num2(s + 1, &s);
} else if (c == 'U') {
opt.min_mid_occ = strtol(o.arg, &s, 10);
if (*s == ',') opt.max_mid_occ = strtol(s + 1, &s, 10);
} else if (c == 'f') { } else if (c == 'f') {
double x; double x;
char *p; char *p;
x = strtod(optarg, &p); x = strtod(o.arg, &p);
if (x < 1.0) opt.mid_occ_frac = x, opt.mid_occ = 0; if (x < 1.0) opt.mid_occ_frac = x, opt.mid_occ = 0;
else opt.mid_occ = (int)(x + .499); else opt.mid_occ = (int)(x + .499);
if (*p == ',') opt.max_occ = (int)(strtod(p+1, &p) + .499); if (*p == ',') opt.max_occ = (int)(strtod(p+1, &p) + .499);
} else if (c == 'u') { } else if (c == 'u') {
if (*optarg == 'b') opt.flag |= MM_F_SPLICE_FOR|MM_F_SPLICE_REV; // both strands if (*o.arg == 'b') opt.flag |= MM_F_SPLICE_FOR|MM_F_SPLICE_REV; // both strands
else if (*optarg == 'f') opt.flag |= MM_F_SPLICE_FOR, opt.flag &= ~MM_F_SPLICE_REV; // match GT-AG else if (*o.arg == 'f') opt.flag |= MM_F_SPLICE_FOR, opt.flag &= ~MM_F_SPLICE_REV; // match GT-AG
else if (*optarg == 'r') opt.flag |= MM_F_SPLICE_REV, opt.flag &= ~MM_F_SPLICE_FOR; // match CT-AC (reverse complement of GT-AG) else if (*o.arg == 'r') opt.flag |= MM_F_SPLICE_REV, opt.flag &= ~MM_F_SPLICE_FOR; // match CT-AC (reverse complement of GT-AG)
else if (*optarg == 'n') opt.flag &= ~(MM_F_SPLICE_FOR|MM_F_SPLICE_REV); // don't try to match the GT-AG signal else if (*o.arg == 'n') opt.flag &= ~(MM_F_SPLICE_FOR|MM_F_SPLICE_REV); // don't try to match the GT-AG signal
else { else {
fprintf(stderr, "[ERROR]\033[1;31m unrecognized cDNA direction\033[0m\n"); fprintf(stderr, "[ERROR]\033[1;31m unrecognized cDNA direction\033[0m\n");
return 1; return 1;
} }
} else if (c == 'z') { } else if (c == 'z') {
opt.zdrop = opt.zdrop_inv = strtol(optarg, &s, 10); opt.zdrop = opt.zdrop_inv = strtol(o.arg, &s, 10);
if (*s == ',') opt.zdrop_inv = strtol(s + 1, &s, 10); if (*s == ',') opt.zdrop_inv = strtol(s + 1, &s, 10);
} else if (c == 'O') { } else if (c == 'O') {
opt.q = opt.q2 = strtol(optarg, &s, 10); opt.q = opt.q2 = strtol(o.arg, &s, 10);
if (*s == ',') opt.q2 = strtol(s + 1, &s, 10); if (*s == ',') opt.q2 = strtol(s + 1, &s, 10);
} else if (c == 'E') { } else if (c == 'E') {
opt.e = opt.e2 = strtol(optarg, &s, 10); opt.e = opt.e2 = strtol(o.arg, &s, 10);
if (*s == ',') opt.e2 = strtol(s + 1, &s, 10); if (*s == ',') opt.e2 = strtol(s + 1, &s, 10);
} }
} }
@@ -227,14 +302,18 @@ int main(int argc, char *argv[])
ipt.flag |= MM_I_NO_SEQ; ipt.flag |= MM_I_NO_SEQ;
if (mm_check_opt(&ipt, &opt) < 0) if (mm_check_opt(&ipt, &opt) < 0)
return 1; return 1;
if (opt.best_n == 0) {
fprintf(stderr, "[WARNING]\033[1;31m changed '-N 0' to '-N %d --secondary=no'.\033[0m\n", old_best_n);
opt.best_n = old_best_n, opt.flag |= MM_F_NO_PRINT_2ND;
}
if (argc == optind || fp_help == stdout) { if (argc == o.ind || fp_help == stdout) {
fprintf(fp_help, "Usage: minimap2 [options] <target.fa>|<target.idx> [query.fa] [...]\n"); fprintf(fp_help, "Usage: minimap2 [options] <target.fa>|<target.idx> [query.fa] [...]\n");
fprintf(fp_help, "Options:\n"); fprintf(fp_help, "Options:\n");
fprintf(fp_help, " Indexing:\n"); fprintf(fp_help, " Indexing:\n");
fprintf(fp_help, " -H use homopolymer-compressed k-mer\n"); fprintf(fp_help, " -H use homopolymer-compressed k-mer (preferrable for PacBio)\n");
fprintf(fp_help, " -k INT k-mer size (no larger than 28) [%d]\n", ipt.k); fprintf(fp_help, " -k INT k-mer size (no larger than 28) [%d]\n", ipt.k);
fprintf(fp_help, " -w INT minizer window size [%d]\n", ipt.w); fprintf(fp_help, " -w INT minimizer window size [%d]\n", ipt.w);
fprintf(fp_help, " -I NUM split index for every ~NUM input bases [4G]\n"); fprintf(fp_help, " -I NUM split index for every ~NUM input bases [4G]\n");
fprintf(fp_help, " -d FILE dump index to FILE []\n"); fprintf(fp_help, " -d FILE dump index to FILE []\n");
fprintf(fp_help, " Mapping:\n"); fprintf(fp_help, " Mapping:\n");
@@ -242,7 +321,7 @@ int main(int argc, char *argv[])
fprintf(fp_help, " -g NUM stop chain enlongation if there are no minimizers in INT-bp [%d]\n", opt.max_gap); fprintf(fp_help, " -g NUM stop chain enlongation if there are no minimizers in INT-bp [%d]\n", opt.max_gap);
fprintf(fp_help, " -G NUM max intron length (effective with -xsplice; changing -r) [200k]\n"); fprintf(fp_help, " -G NUM max intron length (effective with -xsplice; changing -r) [200k]\n");
fprintf(fp_help, " -F NUM max fragment length (effective with -xsr or in the fragment mode) [800]\n"); fprintf(fp_help, " -F NUM max fragment length (effective with -xsr or in the fragment mode) [800]\n");
fprintf(fp_help, " -r NUM bandwidth used in chaining and DP-based alignment [%d]\n", opt.bw); fprintf(fp_help, " -r NUM[,NUM] chaining/alignment bandwidth and long-join bandwidth [%d,%d]\n", opt.bw, opt.bw_long);
fprintf(fp_help, " -n INT minimal number of minimizers on a chain [%d]\n", opt.min_cnt); fprintf(fp_help, " -n INT minimal number of minimizers on a chain [%d]\n", opt.min_cnt);
fprintf(fp_help, " -m INT minimal chaining score (matching bases minus log gap penalty) [%d]\n", opt.min_chain_score); fprintf(fp_help, " -m INT minimal chaining score (matching bases minus log gap penalty) [%d]\n", opt.min_chain_score);
// fprintf(fp_help, " -T INT SDUST threshold; 0 to disable SDUST [%d]\n", opt.sdust_thres); // TODO: this option is never used; might be buggy // fprintf(fp_help, " -T INT SDUST threshold; 0 to disable SDUST [%d]\n", opt.sdust_thres); // TODO: this option is never used; might be buggy
@@ -251,7 +330,7 @@ int main(int argc, char *argv[])
fprintf(fp_help, " -N INT retain at most INT secondary alignments [%d]\n", opt.best_n); fprintf(fp_help, " -N INT retain at most INT secondary alignments [%d]\n", opt.best_n);
fprintf(fp_help, " Alignment:\n"); fprintf(fp_help, " Alignment:\n");
fprintf(fp_help, " -A INT matching score [%d]\n", opt.a); fprintf(fp_help, " -A INT matching score [%d]\n", opt.a);
fprintf(fp_help, " -B INT mismatch penalty [%d]\n", opt.b); fprintf(fp_help, " -B INT mismatch penalty (larger value for lower divergence) [%d]\n", opt.b);
fprintf(fp_help, " -O INT[,INT] gap open penalty [%d,%d]\n", opt.q, opt.q2); fprintf(fp_help, " -O INT[,INT] gap open penalty [%d,%d]\n", opt.q, opt.q2);
fprintf(fp_help, " -E INT[,INT] gap extension penalty; a k-long gap costs min{O1+k*E1,O2+k*E2} [%d,%d]\n", opt.e, opt.e2); fprintf(fp_help, " -E INT[,INT] gap extension penalty; a k-long gap costs min{O1+k*E1,O2+k*E2} [%d,%d]\n", opt.e, opt.e2);
fprintf(fp_help, " -z INT[,INT] Z-drop score and inversion Z-drop score [%d,%d]\n", opt.zdrop, opt.zdrop_inv); fprintf(fp_help, " -z INT[,INT] Z-drop score and inversion Z-drop score [%d,%d]\n", opt.zdrop, opt.zdrop_inv);
@@ -259,40 +338,40 @@ int main(int argc, char *argv[])
fprintf(fp_help, " -u CHAR how to find GT-AG. f:transcript strand, b:both strands, n:don't match GT-AG [n]\n"); fprintf(fp_help, " -u CHAR how to find GT-AG. f:transcript strand, b:both strands, n:don't match GT-AG [n]\n");
fprintf(fp_help, " Input/Output:\n"); fprintf(fp_help, " Input/Output:\n");
fprintf(fp_help, " -a output in the SAM format (PAF by default)\n"); fprintf(fp_help, " -a output in the SAM format (PAF by default)\n");
fprintf(fp_help, " -Q don't output base quality in SAM\n"); fprintf(fp_help, " -o FILE output alignments to FILE [stdout]\n");
fprintf(fp_help, " -L write CIGAR with >65535 ops at the CG tag\n"); fprintf(fp_help, " -L write CIGAR with >65535 ops at the CG tag\n");
fprintf(fp_help, " -R STR SAM read group line in a format like '@RG\\tID:foo\\tSM:bar' []\n"); fprintf(fp_help, " -R STR SAM read group line in a format like '@RG\\tID:foo\\tSM:bar' []\n");
fprintf(fp_help, " -c output CIGAR in PAF\n"); fprintf(fp_help, " -c output CIGAR in PAF\n");
fprintf(fp_help, " --cs[=STR] output the cs tag; STR is 'short' (if absent) or 'long' [none]\n"); fprintf(fp_help, " --cs[=STR] output the cs tag; STR is 'short' (if absent) or 'long' [none]\n");
fprintf(fp_help, " --MD output the MD tag\n");
fprintf(fp_help, " --eqx write =/X CIGAR operators\n");
fprintf(fp_help, " -Y use soft clipping for supplementary alignments\n"); fprintf(fp_help, " -Y use soft clipping for supplementary alignments\n");
fprintf(fp_help, " -t INT number of threads [%d]\n", n_threads); fprintf(fp_help, " -t INT number of threads [%d]\n", n_threads);
fprintf(fp_help, " -K NUM minibatch size for mapping [500M]\n"); fprintf(fp_help, " -K NUM minibatch size for mapping [500M]\n");
// fprintf(fp_help, " -v INT verbose level [%d]\n", mm_verbose); // fprintf(fp_help, " -v INT verbose level [%d]\n", mm_verbose);
fprintf(fp_help, " --version show version number\n"); fprintf(fp_help, " --version show version number\n");
fprintf(fp_help, " Preset:\n"); fprintf(fp_help, " Preset:\n");
fprintf(fp_help, " -x STR preset (always applied before other options) []\n"); fprintf(fp_help, " -x STR preset (always applied before other options; see minimap2.1 for details) []\n");
fprintf(fp_help, " map-pb: -Hk19 (PacBio vs reference mapping)\n"); fprintf(fp_help, " - map-pb/map-ont - PacBio CLR/Nanopore vs reference mapping\n");
fprintf(fp_help, " map-ont: -k15 (Oxford Nanopore vs reference mapping)\n"); fprintf(fp_help, " - map-hifi - PacBio HiFi reads vs reference mapping\n");
fprintf(fp_help, " asm5: -k19 -w19 -A1 -B19 -O39,81 -E3,1 -s200 -z200 (asm to ref mapping; break at 5%% div.)\n"); fprintf(fp_help, " - ava-pb/ava-ont - PacBio/Nanopore read overlap\n");
fprintf(fp_help, " asm10: -k19 -w19 -A1 -B9 -O16,41 -E2,1 -s200 -z200 (asm to ref mapping; break at 10%% div.)\n"); fprintf(fp_help, " - asm5/asm10/asm20 - asm-to-ref mapping, for ~0.1/1/5%% sequence divergence\n");
fprintf(fp_help, " ava-pb: -Hk19 -Xw5 -m100 -g10000 --max-chain-skip 25 (PacBio read overlap)\n"); fprintf(fp_help, " - splice/splice:hq - long-read/Pacbio-CCS spliced alignment\n");
fprintf(fp_help, " ava-ont: -k15 -Xw5 -m100 -g10000 --max-chain-skip 25 (ONT read overlap)\n"); fprintf(fp_help, " - sr - genomic short-read mapping\n");
fprintf(fp_help, " splice: long-read spliced alignment (see minimap2.1 for details)\n"); fprintf(fp_help, "\nSee `man ./minimap2.1' for detailed description of these and other advanced command-line options.\n");
fprintf(fp_help, " sr: short single-end reads without splicing (see minimap2.1 for details)\n");
fprintf(fp_help, "\nSee `man ./minimap2.1' for detailed description of command-line options.\n");
return fp_help == stdout? 0 : 1; return fp_help == stdout? 0 : 1;
} }
if ((opt.flag & MM_F_SR) && argc - optind > 3) { if ((opt.flag & MM_F_SR) && argc - o.ind > 3) {
fprintf(stderr, "[ERROR] incorrect input: in the sr mode, please specify no more than two query files.\n"); fprintf(stderr, "[ERROR] incorrect input: in the sr mode, please specify no more than two query files.\n");
return 1; return 1;
} }
idx_rdr = mm_idx_reader_open(argv[optind], &ipt, fnw); idx_rdr = mm_idx_reader_open(argv[o.ind], &ipt, fnw);
if (idx_rdr == 0) { if (idx_rdr == 0) {
fprintf(stderr, "[ERROR] failed to open file '%s'\n", argv[optind]); fprintf(stderr, "[ERROR] failed to open file '%s': %s\n", argv[o.ind], strerror(errno));
return 1; return 1;
} }
if (!idx_rdr->is_idx && fnw == 0 && argc - optind < 2) { if (!idx_rdr->is_idx && fnw == 0 && argc - o.ind < 2) {
fprintf(stderr, "[ERROR] missing input: please specify a query file to map or option -d to keep the index\n"); fprintf(stderr, "[ERROR] missing input: please specify a query file to map or option -d to keep the index\n");
mm_idx_reader_close(idx_rdr); mm_idx_reader_close(idx_rdr);
return 1; return 1;
@@ -300,6 +379,7 @@ int main(int argc, char *argv[])
if (opt.best_n == 0 && (opt.flag&MM_F_CIGAR) && mm_verbose >= 2) if (opt.best_n == 0 && (opt.flag&MM_F_CIGAR) && mm_verbose >= 2)
fprintf(stderr, "[WARNING]\033[1;31m `-N 0' reduces alignment accuracy. Please use --secondary=no to suppress secondary alignments.\033[0m\n"); fprintf(stderr, "[WARNING]\033[1;31m `-N 0' reduces alignment accuracy. Please use --secondary=no to suppress secondary alignments.\033[0m\n");
while ((mi = mm_idx_reader_read(idx_rdr, n_threads)) != 0) { while ((mi = mm_idx_reader_read(idx_rdr, n_threads)) != 0) {
int ret;
if ((opt.flag & MM_F_CIGAR) && (mi->flag & MM_I_NO_SEQ)) { if ((opt.flag & MM_F_CIGAR) && (mi->flag & MM_I_NO_SEQ)) {
fprintf(stderr, "[ERROR] the prebuilt index doesn't contain sequences.\n"); fprintf(stderr, "[ERROR] the prebuilt index doesn't contain sequences.\n");
mm_idx_destroy(mi); mm_idx_destroy(mi);
@@ -308,32 +388,64 @@ int main(int argc, char *argv[])
} }
if ((opt.flag & MM_F_OUT_SAM) && idx_rdr->n_parts == 1) { if ((opt.flag & MM_F_OUT_SAM) && idx_rdr->n_parts == 1) {
if (mm_idx_reader_eof(idx_rdr)) { if (mm_idx_reader_eof(idx_rdr)) {
mm_write_sam_hdr(mi, rg, MM_VERSION, argc, argv); if (opt.split_prefix == 0)
ret = mm_write_sam_hdr(mi, rg, MM_VERSION, argc, argv);
else
ret = mm_write_sam_hdr(0, rg, MM_VERSION, argc, argv);
} else { } else {
mm_write_sam_hdr(0, rg, MM_VERSION, argc, argv); ret = mm_write_sam_hdr(0, rg, MM_VERSION, argc, argv);
if (mm_verbose >= 2) if (opt.split_prefix == 0 && mm_verbose >= 2)
fprintf(stderr, "[WARNING]\033[1;31m For a multi-part index, no @SQ lines will be outputted.\033[0m\n"); fprintf(stderr, "[WARNING]\033[1;31m For a multi-part index, no @SQ lines will be outputted. Please use --split-prefix.\033[0m\n");
}
if (ret != 0) {
mm_idx_destroy(mi);
mm_idx_reader_close(idx_rdr);
return 1;
} }
} }
if (mm_verbose >= 3) if (mm_verbose >= 3)
fprintf(stderr, "[M::%s::%.3f*%.2f] loaded/built the index for %d target sequence(s)\n", fprintf(stderr, "[M::%s::%.3f*%.2f] loaded/built the index for %d target sequence(s)\n",
__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), mi->n_seq); __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), mi->n_seq);
if (argc != optind + 1) mm_mapopt_update(&opt, mi); if (argc != o.ind + 1) mm_mapopt_update(&opt, mi);
if (mm_verbose >= 3) mm_idx_stat(mi); if (mm_verbose >= 3) mm_idx_stat(mi);
if (junc_bed) mm_idx_bed_read(mi, junc_bed, 1);
if (alt_list) mm_idx_alt_read(mi, alt_list);
if (argc - (o.ind + 1) == 0) {
mm_idx_destroy(mi);
continue; // no query files
}
ret = 0;
if (!(opt.flag & MM_F_FRAG_MODE)) { if (!(opt.flag & MM_F_FRAG_MODE)) {
for (i = optind + 1; i < argc; ++i) for (i = o.ind + 1; i < argc; ++i) {
mm_map_file(mi, argv[i], &opt, n_threads); ret = mm_map_file(mi, argv[i], &opt, n_threads);
if (ret < 0) break;
}
} else { } else {
mm_map_file_frag(mi, argc - (optind + 1), (const char**)&argv[optind + 1], &opt, n_threads); ret = mm_map_file_frag(mi, argc - (o.ind + 1), (const char**)&argv[o.ind + 1], &opt, n_threads);
} }
mm_idx_destroy(mi); mm_idx_destroy(mi);
if (ret < 0) {
fprintf(stderr, "ERROR: failed to map the query file\n");
exit(EXIT_FAILURE);
} }
}
n_parts = idx_rdr->n_parts;
mm_idx_reader_close(idx_rdr); mm_idx_reader_close(idx_rdr);
if (opt.split_prefix)
mm_split_merge(argc - (o.ind + 1), (const char**)&argv[o.ind + 1], &opt, n_parts);
if (fflush(stdout) == EOF) {
perror("[ERROR] failed to write the results");
exit(EXIT_FAILURE);
}
if (mm_verbose >= 3) {
fprintf(stderr, "[M::%s] Version: %s\n", __func__, MM_VERSION); fprintf(stderr, "[M::%s] Version: %s\n", __func__, MM_VERSION);
fprintf(stderr, "[M::%s] CMD:", __func__); fprintf(stderr, "[M::%s] CMD:", __func__);
for (i = 0; i < argc; ++i) for (i = 0; i < argc; ++i)
fprintf(stderr, " %s", argv[i]); fprintf(stderr, " %s", argv[i]);
fprintf(stderr, "\n[M::%s] Real time: %.3f sec; CPU: %.3f sec\n", __func__, realtime() - mm_realtime0, cputime()); fprintf(stderr, "\n[M::%s] Real time: %.3f sec; CPU: %.3f sec; Peak RSS: %.3f GB\n", __func__, realtime() - mm_realtime0, cputime(), peakrss() / 1024.0 / 1024.0 / 1024.0);
}
return 0; return 0;
} }
+260 -101
View File
@@ -1,6 +1,7 @@
#include <stdlib.h> #include <stdlib.h>
#include <string.h> #include <string.h>
#include <assert.h> #include <assert.h>
#include <errno.h>
#include "kthread.h" #include "kthread.h"
#include "kvec.h" #include "kvec.h"
#include "kalloc.h" #include "kalloc.h"
@@ -11,6 +12,7 @@
struct mm_tbuf_s { struct mm_tbuf_s {
void *km; void *km;
int rep_len, frag_gap;
}; };
mm_tbuf_t *mm_tbuf_init(void) mm_tbuf_t *mm_tbuf_init(void)
@@ -28,6 +30,11 @@ void mm_tbuf_destroy(mm_tbuf_t *b)
free(b); free(b);
} }
void *mm_tbuf_get_km(mm_tbuf_t *b)
{
return b->km;
}
static int mm_dust_minier(void *km, int n, mm128_t *a, int l_seq, const char *seq, int sdust_thres) static int mm_dust_minier(void *km, int n, mm128_t *a, int l_seq, const char *seq, int sdust_thres)
{ {
int n_dreg, j, k, u = 0; int n_dreg, j, k, u = 0;
@@ -39,12 +46,12 @@ static int mm_dust_minier(void *km, int n, mm128_t *a, int l_seq, const char *se
for (j = k = 0; j < n; ++j) { // squeeze out minimizers that significantly overlap with LCRs for (j = k = 0; j < n; ++j) { // squeeze out minimizers that significantly overlap with LCRs
int32_t qpos = (uint32_t)a[j].y>>1, span = a[j].x&0xff; int32_t qpos = (uint32_t)a[j].y>>1, span = a[j].x&0xff;
int32_t s = qpos - (span - 1), e = s + span; int32_t s = qpos - (span - 1), e = s + span;
while (u < n_dreg && (uint32_t)dreg[u] <= s) ++u; while (u < n_dreg && (int32_t)dreg[u] <= s) ++u;
if (u < n_dreg && dreg[u]>>32 < e) { if (u < n_dreg && (int32_t)(dreg[u]>>32) < e) {
int v, l = 0; int v, l = 0;
for (v = u; v < n_dreg && dreg[v]>>32 < e; ++v) { // iterate over LCRs overlapping this minimizer for (v = u; v < n_dreg && (int32_t)(dreg[v]>>32) < e; ++v) { // iterate over LCRs overlapping this minimizer
int ss = s > dreg[v]>>32? s : dreg[v]>>32; int ss = s > (int32_t)(dreg[v]>>32)? s : dreg[v]>>32;
int ee = e < (uint32_t)dreg[v]? e : (uint32_t)dreg[v]; int ee = e < (int32_t)dreg[v]? e : (uint32_t)dreg[v];
l += ee - ss; l += ee - ss;
} }
if (l <= span>>1) a[k++] = a[j]; // keep the minimizer if less than half of it falls in masked region if (l <= span>>1) a[k++] = a[j]; // keep the minimizer if less than half of it falls in masked region
@@ -56,9 +63,10 @@ static int mm_dust_minier(void *km, int n, mm128_t *a, int l_seq, const char *se
static void collect_minimizers(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, mm128_v *mv) static void collect_minimizers(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, mm128_v *mv)
{ {
int i, j, n, sum = 0; int i, n, sum = 0;
mv->n = 0; mv->n = 0;
for (i = n = 0; i < n_segs; ++i) { for (i = n = 0; i < n_segs; ++i) {
size_t j;
mm_sketch(km, seqs[i], qlens[i], mi->w, mi->k, i, mi->flag&MM_I_HPC, mv); mm_sketch(km, seqs[i], qlens[i], mi->w, mi->k, i, mi->flag&MM_I_HPC, mv);
for (j = n; j < mv->n; ++j) for (j = n; j < mv->n; ++j)
mv->a[j].y += sum << 1; mv->a[j].y += sum << 1;
@@ -72,55 +80,14 @@ static void collect_minimizers(void *km, const mm_mapopt_t *opt, const mm_idx_t
#define heap_lt(a, b) ((a).x > (b).x) #define heap_lt(a, b) ((a).x > (b).x)
KSORT_INIT(heap, mm128_t, heap_lt) KSORT_INIT(heap, mm128_t, heap_lt)
typedef struct { static inline int skip_seed(int flag, uint64_t r, const mm_seed_t *q, const char *qname, int qlen, const mm_idx_t *mi, int *is_self)
uint32_t n;
uint32_t q_pos, q_span;
uint32_t seg_id:31, is_tandem:1;
const uint64_t *cr;
} mm_match_t;
static mm_match_t *collect_matches(void *km, int *_n_m, int max_occ, const mm_idx_t *mi, const mm128_v *mv, int64_t *n_a, int *rep_len, int *n_mini_pos, uint64_t **mini_pos)
{
int i, rep_st = 0, rep_en = 0, n_m;
mm_match_t *m;
*n_mini_pos = 0;
*mini_pos = (uint64_t*)kmalloc(km, mv->n * sizeof(uint64_t));
m = (mm_match_t*)kmalloc(km, mv->n * sizeof(mm_match_t));
for (i = n_m = 0, *rep_len = 0, *n_a = 0; i < mv->n; ++i) {
const uint64_t *cr;
mm128_t *p = &mv->a[i];
uint32_t q_pos = (uint32_t)p->y, q_span = p->x & 0xff;
int t;
cr = mm_idx_get(mi, p->x>>8, &t);
if (t >= max_occ) {
int en = (q_pos >> 1) + 1, st = en - q_span;
if (st > rep_en) {
*rep_len += rep_en - rep_st;
rep_st = st, rep_en = en;
} else rep_en = en;
} else {
mm_match_t *q = &m[n_m++];
q->q_pos = q_pos, q->q_span = q_span, q->cr = cr, q->n = t, q->seg_id = p->y >> 32;
q->is_tandem = 0;
if (i > 0 && p->x>>8 == mv->a[i - 1].x>>8) q->is_tandem = 1;
if (i < mv->n - 1 && p->x>>8 == mv->a[i + 1].x>>8) q->is_tandem = 1;
*n_a += q->n;
(*mini_pos)[(*n_mini_pos)++] = (uint64_t)q_span<<32 | q_pos>>1;
}
}
*rep_len += rep_en - rep_st;
*_n_m = n_m;
return m;
}
static inline int skip_seed(int flag, uint64_t r, const mm_match_t *q, const char *qname, int qlen, const mm_idx_t *mi, int *is_self)
{ {
*is_self = 0; *is_self = 0;
if (qname && (flag & (MM_F_NO_DIAG|MM_F_NO_DUAL))) { if (qname && (flag & (MM_F_NO_DIAG|MM_F_NO_DUAL))) {
const mm_idx_seq_t *s = &mi->seq[r>>32]; const mm_idx_seq_t *s = &mi->seq[r>>32];
int cmp; int cmp;
cmp = strcmp(qname, s->name); cmp = strcmp(qname, s->name);
if ((flag&MM_F_NO_DIAG) && cmp == 0 && s->len == qlen) { if ((flag&MM_F_NO_DIAG) && cmp == 0 && (int)s->len == qlen) {
if ((uint32_t)r>>1 == (q->q_pos>>1)) return 1; // avoid the diagnonal anchors if ((uint32_t)r>>1 == (q->q_pos>>1)) return 1; // avoid the diagnonal anchors
if ((r&1) == (q->q_pos&1)) *is_self = 1; // this flag is used to avoid spurious extension on self chain if ((r&1) == (q->q_pos&1)) *is_self = 1; // this flag is used to avoid spurious extension on self chain
} }
@@ -142,10 +109,10 @@ static mm128_t *collect_seed_hits_heap(void *km, const mm_mapopt_t *opt, int max
{ {
int i, n_m, heap_size = 0; int i, n_m, heap_size = 0;
int64_t j, n_for = 0, n_rev = 0; int64_t j, n_for = 0, n_rev = 0;
mm_match_t *m; mm_seed_t *m;
mm128_t *a, *heap; mm128_t *a, *heap;
m = collect_matches(km, &n_m, max_occ, mi, mv, n_a, rep_len, n_mini_pos, mini_pos); m = mm_collect_matches(km, &n_m, qlen, max_occ, opt->max_max_occ, opt->occ_dist, mi, mv, n_a, rep_len, n_mini_pos, mini_pos);
heap = (mm128_t*)kmalloc(km, n_m * sizeof(mm128_t)); heap = (mm128_t*)kmalloc(km, n_m * sizeof(mm128_t));
a = (mm128_t*)kmalloc(km, *n_a * sizeof(mm128_t)); a = (mm128_t*)kmalloc(km, *n_a * sizeof(mm128_t));
@@ -159,11 +126,11 @@ static mm128_t *collect_seed_hits_heap(void *km, const mm_mapopt_t *opt, int max
} }
ks_heapmake_heap(heap_size, heap); ks_heapmake_heap(heap_size, heap);
while (heap_size > 0) { while (heap_size > 0) {
mm_match_t *q = &m[heap->y>>32]; mm_seed_t *q = &m[heap->y>>32];
mm128_t *p; mm128_t *p;
uint64_t r = heap->x; uint64_t r = heap->x;
int32_t is_self, rpos = (uint32_t)r >> 1; int32_t is_self, rpos = (uint32_t)r >> 1;
if (skip_seed(opt->flag, r, q, qname, qlen, mi, &is_self)) continue; if (!skip_seed(opt->flag, r, q, qname, qlen, mi, &is_self)) {
if ((r&1) == (q->q_pos&1)) { // forward strand if ((r&1) == (q->q_pos&1)) { // forward strand
p = &a[n_for++]; p = &a[n_for++];
p->x = (r&0xffffffff00000000ULL) | rpos; p->x = (r&0xffffffff00000000ULL) | rpos;
@@ -176,6 +143,7 @@ static mm128_t *collect_seed_hits_heap(void *km, const mm_mapopt_t *opt, int max
p->y |= (uint64_t)q->seg_id << MM_SEED_SEG_SHIFT; p->y |= (uint64_t)q->seg_id << MM_SEED_SEG_SHIFT;
if (q->is_tandem) p->y |= MM_SEED_TANDEM; if (q->is_tandem) p->y |= MM_SEED_TANDEM;
if (is_self) p->y |= MM_SEED_SELF; if (is_self) p->y |= MM_SEED_SELF;
}
// update the heap // update the heap
if ((uint32_t)heap->y < q->n - 1) { if ((uint32_t)heap->y < q->n - 1) {
++heap[0].y; ++heap[0].y;
@@ -205,14 +173,15 @@ static mm128_t *collect_seed_hits_heap(void *km, const mm_mapopt_t *opt, int max
static mm128_t *collect_seed_hits(void *km, const mm_mapopt_t *opt, int max_occ, const mm_idx_t *mi, const char *qname, const mm128_v *mv, int qlen, int64_t *n_a, int *rep_len, static mm128_t *collect_seed_hits(void *km, const mm_mapopt_t *opt, int max_occ, const mm_idx_t *mi, const char *qname, const mm128_v *mv, int qlen, int64_t *n_a, int *rep_len,
int *n_mini_pos, uint64_t **mini_pos) int *n_mini_pos, uint64_t **mini_pos)
{ {
int i, k, n_m; int i, n_m;
mm_match_t *m; mm_seed_t *m;
mm128_t *a; mm128_t *a;
m = collect_matches(km, &n_m, max_occ, mi, mv, n_a, rep_len, n_mini_pos, mini_pos); m = mm_collect_matches(km, &n_m, qlen, max_occ, opt->max_max_occ, opt->occ_dist, mi, mv, n_a, rep_len, n_mini_pos, mini_pos);
a = (mm128_t*)kmalloc(km, *n_a * sizeof(mm128_t)); a = (mm128_t*)kmalloc(km, *n_a * sizeof(mm128_t));
for (i = 0, *n_a = 0; i < n_m; ++i) { for (i = 0, *n_a = 0; i < n_m; ++i) {
mm_match_t *q = &m[i]; mm_seed_t *q = &m[i];
const uint64_t *r = q->cr; const uint64_t *r = q->cr;
uint32_t k;
for (k = 0; k < q->n; ++k) { for (k = 0; k < q->n; ++k) {
int32_t is_self, rpos = (uint32_t)r[k] >> 1; int32_t is_self, rpos = (uint32_t)r[k] >> 1;
mm128_t *p; mm128_t *p;
@@ -221,9 +190,13 @@ static mm128_t *collect_seed_hits(void *km, const mm_mapopt_t *opt, int max_occ,
if ((r[k]&1) == (q->q_pos&1)) { // forward strand if ((r[k]&1) == (q->q_pos&1)) { // forward strand
p->x = (r[k]&0xffffffff00000000ULL) | rpos; p->x = (r[k]&0xffffffff00000000ULL) | rpos;
p->y = (uint64_t)q->q_span << 32 | q->q_pos >> 1; p->y = (uint64_t)q->q_span << 32 | q->q_pos >> 1;
} else { // reverse strand } else if (!(opt->flag & MM_F_QSTRAND)) { // reverse strand and not in the query-strand mode
p->x = 1ULL<<63 | (r[k]&0xffffffff00000000ULL) | rpos; p->x = 1ULL<<63 | (r[k]&0xffffffff00000000ULL) | rpos;
p->y = (uint64_t)q->q_span << 32 | (qlen - ((q->q_pos>>1) + 1 - q->q_span) - 1); p->y = (uint64_t)q->q_span << 32 | (qlen - ((q->q_pos>>1) + 1 - q->q_span) - 1);
} else { // reverse strand; query-strand
int32_t len = mi->seq[r[k]>>32].len;
p->x = 1ULL<<63 | (r[k]&0xffffffff00000000ULL) | (len - (rpos + 1 - q->q_span) - 1); // coordinate only accurate for non-HPC seeds
p->y = (uint64_t)q->q_span << 32 | q->q_pos >> 1;
} }
p->y |= (uint64_t)q->seg_id << MM_SEED_SEG_SHIFT; p->y |= (uint64_t)q->seg_id << MM_SEED_SEG_SHIFT;
if (q->is_tandem) p->y |= MM_SEED_TANDEM; if (q->is_tandem) p->y |= MM_SEED_TANDEM;
@@ -238,11 +211,9 @@ static mm128_t *collect_seed_hits(void *km, const mm_mapopt_t *opt, int max_occ,
static void chain_post(const mm_mapopt_t *opt, int max_chain_gap_ref, const mm_idx_t *mi, void *km, int qlen, int n_segs, const int *qlens, int *n_regs, mm_reg1_t *regs, mm128_t *a) static void chain_post(const mm_mapopt_t *opt, int max_chain_gap_ref, const mm_idx_t *mi, void *km, int qlen, int n_segs, const int *qlens, int *n_regs, mm_reg1_t *regs, mm128_t *a)
{ {
if (!(opt->flag & MM_F_ALL_CHAINS)) { // don't choose primary mapping(s) if (!(opt->flag & MM_F_ALL_CHAINS)) { // don't choose primary mapping(s)
mm_set_parent(km, opt->mask_level, *n_regs, regs, opt->a * 2 + opt->b); mm_set_parent(km, opt->mask_level, opt->mask_len, *n_regs, regs, opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL, opt->alt_drop);
if (n_segs <= 1) mm_select_sub(km, opt->pri_ratio, mi->k*2, opt->best_n, n_regs, regs); if (n_segs <= 1) mm_select_sub(km, opt->pri_ratio, mi->k*2, opt->best_n, n_regs, regs);
else mm_select_sub_multi(km, opt->pri_ratio, 0.2f, 0.7f, max_chain_gap_ref, mi->k*2, opt->best_n, n_segs, qlens, n_regs, regs); else mm_select_sub_multi(km, opt->pri_ratio, 0.2f, 0.7f, max_chain_gap_ref, mi->k*2, opt->best_n, n_segs, qlens, n_regs, regs);
if (!(opt->flag & (MM_F_SPLICE|MM_F_SR|MM_F_NO_LJOIN))) // long join not working well without primary chains
mm_join_long(km, opt, qlen, n_regs, regs, a);
} }
} }
@@ -251,7 +222,7 @@ static mm_reg1_t *align_regs(const mm_mapopt_t *opt, const mm_idx_t *mi, void *k
if (!(opt->flag & MM_F_CIGAR)) return regs; if (!(opt->flag & MM_F_CIGAR)) return regs;
regs = mm_align_skeleton(km, opt, mi, qlen, seq, n_regs, regs, a); // this calls mm_filter_regs() regs = mm_align_skeleton(km, opt, mi, qlen, seq, n_regs, regs, a); // this calls mm_filter_regs()
if (!(opt->flag & MM_F_ALL_CHAINS)) { // don't choose primary mapping(s) if (!(opt->flag & MM_F_ALL_CHAINS)) { // don't choose primary mapping(s)
mm_set_parent(km, opt->mask_level, *n_regs, regs, opt->a * 2 + opt->b); mm_set_parent(km, opt->mask_level, opt->mask_len, *n_regs, regs, opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL, opt->alt_drop);
mm_select_sub(km, opt->pri_ratio, mi->k*2, opt->best_n, n_regs, regs); mm_select_sub(km, opt->pri_ratio, mi->k*2, opt->best_n, n_regs, regs);
mm_set_sam_pri(*n_regs, regs); mm_set_sam_pri(*n_regs, regs);
} }
@@ -274,6 +245,7 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
qlen_sum += qlens[i], n_regs[i] = 0, regs[i] = 0; qlen_sum += qlens[i], n_regs[i] = 0, regs[i] = 0;
if (qlen_sum == 0 || n_segs <= 0 || n_segs > MM_MAX_SEG) return; if (qlen_sum == 0 || n_segs <= 0 || n_segs > MM_MAX_SEG) return;
if (opt->max_qlen > 0 && qlen_sum > opt->max_qlen) return;
hash = qname? __ac_X31_hash_string(qname) : 0; hash = qname? __ac_X31_hash_string(qname) : 0;
hash ^= __ac_Wang_hash(qlen_sum) + __ac_Wang_hash(opt->seed); hash ^= __ac_Wang_hash(qlen_sum) + __ac_Wang_hash(opt->seed);
@@ -301,17 +273,33 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
if (max_chain_gap_ref < opt->max_gap) max_chain_gap_ref = opt->max_gap; if (max_chain_gap_ref < opt->max_gap) max_chain_gap_ref = opt->max_gap;
} else max_chain_gap_ref = opt->max_gap; } else max_chain_gap_ref = opt->max_gap;
a = mm_chain_dp(max_chain_gap_ref, max_chain_gap_qry, opt->bw, opt->max_chain_skip, opt->min_cnt, opt->min_chain_score, is_splice, n_segs, n_a, a, &n_regs0, &u, b->km); if (opt->flag & MM_F_RMQ) {
a = mg_lchain_rmq(opt->max_gap, opt->rmq_inner_dist, opt->bw, opt->max_chain_skip, opt->rmq_size_cap, opt->min_cnt, opt->min_chain_score,
opt->chain_gap_scale * 0.01 * mi->k, 0.0f, n_a, a, &n_regs0, &u, b->km);
} else {
a = mg_lchain_dp(max_chain_gap_ref, max_chain_gap_qry, opt->bw, opt->max_chain_skip, opt->max_chain_iter, opt->min_cnt, opt->min_chain_score,
opt->chain_gap_scale * 0.01 * mi->k, 0.0f, is_splice, n_segs, n_a, a, &n_regs0, &u, b->km);
}
if (opt->max_occ > opt->mid_occ && rep_len > 0) { if (opt->bw_long > opt->bw && (opt->flag & (MM_F_SPLICE|MM_F_SR|MM_F_NO_LJOIN)) == 0 && n_segs == 1 && n_regs0 > 1) { // re-chain/long-join for long sequences
int32_t st = (int32_t)a[0].y, en = (int32_t)a[(int32_t)u[0] - 1].y;
if (qlen_sum - (en - st) > opt->rmq_rescue_size || en - st > qlen_sum * opt->rmq_rescue_ratio) {
int32_t i;
for (i = 0, n_a = 0; i < n_regs0; ++i) n_a += (int32_t)u[i];
kfree(b->km, u);
radix_sort_128x(a, a + n_a);
a = mg_lchain_rmq(opt->max_gap, opt->rmq_inner_dist, opt->bw_long, opt->max_chain_skip, opt->rmq_size_cap, opt->min_cnt, opt->min_chain_score,
opt->chain_gap_scale * 0.01 * mi->k, 0.0f, n_a, a, &n_regs0, &u, b->km);
}
} else if (opt->max_occ > opt->mid_occ && rep_len > 0 && !(opt->flag & MM_F_RMQ)) { // re-chain, mostly for short reads
int rechain = 0; int rechain = 0;
if (n_regs0 > 0) { // test if the best chain has all the segments if (n_regs0 > 0) { // test if the best chain has all the segments
int n_chained_segs = 1, max = 0, max_i = -1, max_off = -1, off = 0; int n_chained_segs = 1, max = 0, max_i = -1, max_off = -1, off = 0;
for (i = 0; i < n_regs0; ++i) { // find the best chain for (i = 0; i < n_regs0; ++i) { // find the best chain
if (max < u[i]>>32) max = u[i]>>32, max_i = i, max_off = off; if (max < (int)(u[i]>>32)) max = u[i]>>32, max_i = i, max_off = off;
off += (uint32_t)u[i]; off += (uint32_t)u[i];
} }
for (i = 1; i < (uint32_t)u[max_i]; ++i) // count the number of segments in the best chain for (i = 1; i < (int32_t)u[max_i]; ++i) // count the number of segments in the best chain
if ((a[max_off+i].y&MM_SEED_SEG_MASK) != (a[max_off+i-1].y&MM_SEED_SEG_MASK)) if ((a[max_off+i].y&MM_SEED_SEG_MASK) != (a[max_off+i-1].y&MM_SEED_SEG_MASK))
++n_chained_segs; ++n_chained_segs;
if (n_chained_segs < n_segs) if (n_chained_segs < n_segs)
@@ -323,11 +311,18 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
kfree(b->km, mini_pos); kfree(b->km, mini_pos);
if (opt->flag & MM_F_HEAP_SORT) a = collect_seed_hits_heap(b->km, opt, opt->max_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos); if (opt->flag & MM_F_HEAP_SORT) a = collect_seed_hits_heap(b->km, opt, opt->max_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
else a = collect_seed_hits(b->km, opt, opt->max_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos); else a = collect_seed_hits(b->km, opt, opt->max_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
a = mm_chain_dp(max_chain_gap_ref, max_chain_gap_qry, opt->bw, opt->max_chain_skip, opt->min_cnt, opt->min_chain_score, is_splice, n_segs, n_a, a, &n_regs0, &u, b->km); a = mg_lchain_dp(max_chain_gap_ref, max_chain_gap_qry, opt->bw, opt->max_chain_skip, opt->max_chain_iter, opt->min_cnt, opt->min_chain_score,
opt->chain_gap_scale * 0.01 * mi->k, 0.0f, is_splice, n_segs, n_a, a, &n_regs0, &u, b->km);
} }
} }
b->frag_gap = max_chain_gap_ref;
b->rep_len = rep_len;
regs0 = mm_gen_regs(b->km, hash, qlen_sum, n_regs0, u, a); regs0 = mm_gen_regs(b->km, hash, qlen_sum, n_regs0, u, a, !!(opt->flag&MM_F_QSTRAND));
if (mi->n_alt) {
mm_mark_alt(mi, n_regs0, regs0);
mm_hit_sort(b->km, &n_regs0, regs0, opt->alt_drop); // this step can be merged into mm_gen_regs(); will do if this shows up in profile
}
if (mm_dbg_flag & MM_DBG_PRINT_SEED) if (mm_dbg_flag & MM_DBG_PRINT_SEED)
for (j = 0; j < n_regs0; ++j) for (j = 0; j < n_regs0; ++j)
@@ -336,10 +331,12 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
i == regs0[j].as? 0 : ((int32_t)a[i].y - (int32_t)a[i-1].y) - ((int32_t)a[i].x - (int32_t)a[i-1].x)); i == regs0[j].as? 0 : ((int32_t)a[i].y - (int32_t)a[i-1].y) - ((int32_t)a[i].x - (int32_t)a[i-1].x));
chain_post(opt, max_chain_gap_ref, mi, b->km, qlen_sum, n_segs, qlens, &n_regs0, regs0, a); chain_post(opt, max_chain_gap_ref, mi, b->km, qlen_sum, n_segs, qlens, &n_regs0, regs0, a);
if (!is_sr) mm_est_err(mi, qlen_sum, n_regs0, regs0, a, n_mini_pos, mini_pos); if (!is_sr && !(opt->flag&MM_F_QSTRAND))
mm_est_err(mi, qlen_sum, n_regs0, regs0, a, n_mini_pos, mini_pos);
if (n_segs == 1) { // uni-segment if (n_segs == 1) { // uni-segment
regs0 = align_regs(opt, mi, b->km, qlens[0], seqs[0], &n_regs0, regs0, a); regs0 = align_regs(opt, mi, b->km, qlens[0], seqs[0], &n_regs0, regs0, a);
regs0 = (mm_reg1_t*)realloc(regs0, sizeof(*regs0) * n_regs0);
mm_set_mapq(b->km, n_regs0, regs0, opt->min_chain_score, opt->a, rep_len, is_sr); mm_set_mapq(b->km, n_regs0, regs0, opt->min_chain_score, opt->a, rep_len, is_sr);
n_regs[0] = n_regs0, regs[0] = regs0; n_regs[0] = n_regs0, regs[0] = regs0;
} else { // multi-segment } else { // multi-segment
@@ -347,7 +344,7 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
seg = mm_seg_gen(b->km, hash, n_segs, qlens, n_regs0, regs0, n_regs, regs, a); // split fragment chain to separate segment chains seg = mm_seg_gen(b->km, hash, n_segs, qlens, n_regs0, regs0, n_regs, regs, a); // split fragment chain to separate segment chains
free(regs0); free(regs0);
for (i = 0; i < n_segs; ++i) { for (i = 0; i < n_segs; ++i) {
mm_set_parent(b->km, opt->mask_level, n_regs[i], regs[i], opt->a * 2 + opt->b); // update mm_reg1_t::parent mm_set_parent(b->km, opt->mask_level, opt->mask_len, n_regs[i], regs[i], opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL, opt->alt_drop); // update mm_reg1_t::parent
regs[i] = align_regs(opt, mi, b->km, qlens[i], seqs[i], &n_regs[i], regs[i], seg[i].a); regs[i] = align_regs(opt, mi, b->km, qlens[i], seqs[i], &n_regs[i], regs[i], seg[i].a);
mm_set_mapq(b->km, n_regs[i], regs[i], opt->min_chain_score, opt->a, rep_len, is_sr); mm_set_mapq(b->km, n_regs[i], regs[i], opt->min_chain_score, opt->a, rep_len, is_sr);
} }
@@ -366,7 +363,9 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
if (mm_dbg_flag & MM_DBG_PRINT_QNAME) if (mm_dbg_flag & MM_DBG_PRINT_QNAME)
fprintf(stderr, "QM\t%s\t%d\tcap=%ld,nCore=%ld,largest=%ld\n", qname, qlen_sum, kmst.capacity, kmst.n_cores, kmst.largest); fprintf(stderr, "QM\t%s\t%d\tcap=%ld,nCore=%ld,largest=%ld\n", qname, qlen_sum, kmst.capacity, kmst.n_cores, kmst.largest);
assert(kmst.n_blocks == kmst.n_cores); // otherwise, there is a memory leak assert(kmst.n_blocks == kmst.n_cores); // otherwise, there is a memory leak
if (kmst.largest > 1U<<28) { if (kmst.largest > 1U<<28 || (opt->cap_kalloc > 0 && kmst.capacity > opt->cap_kalloc)) {
if (mm_dbg_flag & MM_DBG_PRINT_QNAME)
fprintf(stderr, "[W::%s] reset thread-local memory after read %s\n", __func__, qname);
km_destroy(b->km); km_destroy(b->km);
b->km = km_init(); b->km = km_init();
} }
@@ -385,18 +384,23 @@ mm_reg1_t *mm_map(const mm_idx_t *mi, int qlen, const char *seq, int *n_regs, mm
**************************/ **************************/
typedef struct { typedef struct {
int mini_batch_size, n_processed, n_threads, n_fp; int n_processed, n_threads, n_fp;
int64_t mini_batch_size;
const mm_mapopt_t *opt; const mm_mapopt_t *opt;
mm_bseq_file_t **fp; mm_bseq_file_t **fp;
const mm_idx_t *mi; const mm_idx_t *mi;
kstring_t str; kstring_t str;
int n_parts;
uint32_t *rid_shift;
FILE *fp_split, **fp_parts;
} pipeline_t; } pipeline_t;
typedef struct { typedef struct {
const pipeline_t *p; const pipeline_t *p;
int n_seq, n_frag; int n_seq, n_frag;
mm_bseq1_t *seq; mm_bseq1_t *seq;
int *n_reg, *seg_off, *n_seg; int *n_reg, *seg_off, *n_seg, *rep_len, *frag_gap;
mm_reg1_t **reg; mm_reg1_t **reg;
mm_tbuf_t **buf; mm_tbuf_t **buf;
} step_t; } step_t;
@@ -406,10 +410,13 @@ static void worker_for(void *_data, long i, int tid) // kt_for() callback
step_t *s = (step_t*)_data; step_t *s = (step_t*)_data;
int qlens[MM_MAX_SEG], j, off = s->seg_off[i], pe_ori = s->p->opt->pe_ori; int qlens[MM_MAX_SEG], j, off = s->seg_off[i], pe_ori = s->p->opt->pe_ori;
const char *qseqs[MM_MAX_SEG]; const char *qseqs[MM_MAX_SEG];
double t = 0.0;
mm_tbuf_t *b = s->buf[tid]; mm_tbuf_t *b = s->buf[tid];
assert(s->n_seg[i] <= MM_MAX_SEG); assert(s->n_seg[i] <= MM_MAX_SEG);
if (mm_dbg_flag & MM_DBG_PRINT_QNAME) if (mm_dbg_flag & MM_DBG_PRINT_QNAME) {
fprintf(stderr, "QR\t%s\t%d\t%d\n", s->seq[off].name, tid, s->seq[off].l_seq); fprintf(stderr, "QR\t%s\t%d\t%d\n", s->seq[off].name, tid, s->seq[off].l_seq);
t = realtime();
}
for (j = 0; j < s->n_seg[i]; ++j) { for (j = 0; j < s->n_seg[i]; ++j) {
if (s->n_seg[i] == 2 && ((j == 0 && (pe_ori>>1&1)) || (j == 1 && (pe_ori&1)))) if (s->n_seg[i] == 2 && ((j == 0 && (pe_ori>>1&1)) || (j == 1 && (pe_ori&1))))
mm_revcomp_bseq(&s->seq[off + j]); mm_revcomp_bseq(&s->seq[off + j]);
@@ -417,10 +424,17 @@ static void worker_for(void *_data, long i, int tid) // kt_for() callback
qseqs[j] = s->seq[off + j].seq; qseqs[j] = s->seq[off + j].seq;
} }
if (s->p->opt->flag & MM_F_INDEPEND_SEG) { if (s->p->opt->flag & MM_F_INDEPEND_SEG) {
for (j = 0; j < s->n_seg[i]; ++j) for (j = 0; j < s->n_seg[i]; ++j) {
mm_map_frag(s->p->mi, 1, &qlens[j], &qseqs[j], &s->n_reg[off+j], &s->reg[off+j], b, s->p->opt, s->seq[off+j].name); mm_map_frag(s->p->mi, 1, &qlens[j], &qseqs[j], &s->n_reg[off+j], &s->reg[off+j], b, s->p->opt, s->seq[off+j].name);
s->rep_len[off + j] = b->rep_len;
s->frag_gap[off + j] = b->frag_gap;
}
} else { } else {
mm_map_frag(s->p->mi, s->n_seg[i], qlens, qseqs, &s->n_reg[off], &s->reg[off], b, s->p->opt, s->seq[off].name); mm_map_frag(s->p->mi, s->n_seg[i], qlens, qseqs, &s->n_reg[off], &s->reg[off], b, s->p->opt, s->seq[off].name);
for (j = 0; j < s->n_seg[i]; ++j) {
s->rep_len[off + j] = b->rep_len;
s->frag_gap[off + j] = b->frag_gap;
}
} }
for (j = 0; j < s->n_seg[i]; ++j) // flip the query strand and coordinate to the original read strand for (j = 0; j < s->n_seg[i]; ++j) // flip the query strand and coordinate to the original read strand
if (s->n_seg[i] == 2 && ((j == 0 && (pe_ori>>1&1)) || (j == 1 && (pe_ori&1)))) { if (s->n_seg[i] == 2 && ((j == 0 && (pe_ori>>1&1)) || (j == 1 && (pe_ori&1)))) {
@@ -434,6 +448,73 @@ static void worker_for(void *_data, long i, int tid) // kt_for() callback
r->rev = !r->rev; r->rev = !r->rev;
} }
} }
if (mm_dbg_flag & MM_DBG_PRINT_QNAME)
fprintf(stderr, "QT\t%s\t%d\t%.6f\n", s->seq[off].name, tid, realtime() - t);
}
static void merge_hits(step_t *s)
{
int f, i, k0, k, max_seg = 0, *n_reg_part, *rep_len_part, *frag_gap_part, *qlens;
void *km;
FILE **fp = s->p->fp_parts;
const mm_mapopt_t *opt = s->p->opt;
km = km_init();
for (f = 0; f < s->n_frag; ++f)
max_seg = max_seg > s->n_seg[f]? max_seg : s->n_seg[f];
qlens = CALLOC(int, max_seg + s->p->n_parts * 3);
n_reg_part = qlens + max_seg;
rep_len_part = n_reg_part + s->p->n_parts;
frag_gap_part = rep_len_part + s->p->n_parts;
for (f = 0, k = k0 = 0; f < s->n_frag; ++f) {
k0 = k;
for (i = 0; i < s->n_seg[f]; ++i, ++k) {
int j, l, t, rep_len = 0;
qlens[i] = s->seq[k].l_seq;
for (j = 0, s->n_reg[k] = 0; j < s->p->n_parts; ++j) {
mm_err_fread(&n_reg_part[j], sizeof(int), 1, fp[j]);
mm_err_fread(&rep_len_part[j], sizeof(int), 1, fp[j]);
mm_err_fread(&frag_gap_part[j], sizeof(int), 1, fp[j]);
s->n_reg[k] += n_reg_part[j];
if (rep_len < rep_len_part[j])
rep_len = rep_len_part[j];
}
s->reg[k] = CALLOC(mm_reg1_t, s->n_reg[k]);
for (j = 0, l = 0; j < s->p->n_parts; ++j) {
for (t = 0; t < n_reg_part[j]; ++t, ++l) {
mm_reg1_t *r = &s->reg[k][l];
uint32_t capacity;
mm_err_fread(r, sizeof(mm_reg1_t), 1, fp[j]);
r->rid += s->p->rid_shift[j];
if (opt->flag & MM_F_CIGAR) {
mm_err_fread(&capacity, 4, 1, fp[j]);
r->p = (mm_extra_t*)calloc(capacity, 4);
r->p->capacity = capacity;
mm_err_fread(r->p, r->p->capacity, 4, fp[j]);
}
}
}
if (!(opt->flag&MM_F_SR) && s->seq[k].l_seq >= opt->rank_min_len)
mm_update_dp_max(s->seq[k].l_seq, s->n_reg[k], s->reg[k], opt->rank_frac, opt->a, opt->b);
for (j = 0; j < s->n_reg[k]; ++j) {
mm_reg1_t *r = &s->reg[k][j];
if (r->p) r->p->dp_max2 = 0; // reset ->dp_max2 as mm_set_parent() doesn't clear it; necessary with mm_update_dp_max()
r->subsc = 0; // this may not be necessary
r->n_sub = 0; // n_sub will be an underestimate as we don't see all the chains now, but it can't be accurate anyway
}
mm_hit_sort(km, &s->n_reg[k], s->reg[k], opt->alt_drop);
mm_set_parent(km, opt->mask_level, opt->mask_len, s->n_reg[k], s->reg[k], opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL, opt->alt_drop);
if (!(opt->flag & MM_F_ALL_CHAINS)) {
mm_select_sub(km, opt->pri_ratio, s->p->mi->k*2, opt->best_n, &s->n_reg[k], s->reg[k]);
mm_set_sam_pri(s->n_reg[k], s->reg[k]);
}
mm_set_mapq(km, s->n_reg[k], s->reg[k], opt->min_chain_score, opt->a, rep_len, !!(opt->flag & MM_F_SR));
}
if (s->n_seg[f] == 2 && opt->pe_ori >= 0 && (opt->flag&MM_F_CIGAR))
mm_pair(km, frag_gap_part[0], opt->pe_bonus, opt->a * 2 + opt->b, opt->a, qlens, &s->n_reg[k0], &s->reg[k0]);
}
free(qlens);
km_destroy(km);
} }
static void *worker_pipeline(void *shared, int step, void *in) static void *worker_pipeline(void *shared, int step, void *in)
@@ -442,11 +523,12 @@ static void *worker_pipeline(void *shared, int step, void *in)
pipeline_t *p = (pipeline_t*)shared; pipeline_t *p = (pipeline_t*)shared;
if (step == 0) { // step 0: read sequences if (step == 0) { // step 0: read sequences
int with_qual = (!!(p->opt->flag & MM_F_OUT_SAM) && !(p->opt->flag & MM_F_NO_QUAL)); int with_qual = (!!(p->opt->flag & MM_F_OUT_SAM) && !(p->opt->flag & MM_F_NO_QUAL));
int with_comment = !!(p->opt->flag & MM_F_COPY_COMMENT);
int frag_mode = (p->n_fp > 1 || !!(p->opt->flag & MM_F_FRAG_MODE)); int frag_mode = (p->n_fp > 1 || !!(p->opt->flag & MM_F_FRAG_MODE));
step_t *s; step_t *s;
s = (step_t*)calloc(1, sizeof(step_t)); s = (step_t*)calloc(1, sizeof(step_t));
if (p->n_fp > 1) s->seq = mm_bseq_read_frag(p->n_fp, p->fp, p->mini_batch_size, with_qual, &s->n_seq); if (p->n_fp > 1) s->seq = mm_bseq_read_frag2(p->n_fp, p->fp, p->mini_batch_size, with_qual, with_comment, &s->n_seq);
else s->seq = mm_bseq_read2(p->fp[0], p->mini_batch_size, with_qual, frag_mode, &s->n_seq); else s->seq = mm_bseq_read3(p->fp[0], p->mini_batch_size, with_qual, with_comment, frag_mode, &s->n_seq);
if (s->seq) { if (s->seq) {
s->p = p; s->p = p;
for (i = 0; i < s->n_seq; ++i) for (i = 0; i < s->n_seq; ++i)
@@ -454,9 +536,11 @@ static void *worker_pipeline(void *shared, int step, void *in)
s->buf = (mm_tbuf_t**)calloc(p->n_threads, sizeof(mm_tbuf_t*)); s->buf = (mm_tbuf_t**)calloc(p->n_threads, sizeof(mm_tbuf_t*));
for (i = 0; i < p->n_threads; ++i) for (i = 0; i < p->n_threads; ++i)
s->buf[i] = mm_tbuf_init(); s->buf[i] = mm_tbuf_init();
s->n_reg = (int*)calloc(3 * s->n_seq, sizeof(int)); s->n_reg = (int*)calloc(5 * s->n_seq, sizeof(int));
s->seg_off = s->n_reg + s->n_seq; // seg_off and n_seg are allocated together with n_reg s->seg_off = s->n_reg + s->n_seq; // seg_off, n_seg, rep_len and frag_gap are allocated together with n_reg
s->n_seg = s->seg_off + s->n_seq; s->n_seg = s->seg_off + s->n_seq;
s->rep_len = s->n_seg + s->n_seq;
s->frag_gap = s->rep_len + s->n_seq;
s->reg = (mm_reg1_t**)calloc(s->n_seq, sizeof(mm_reg1_t*)); s->reg = (mm_reg1_t**)calloc(s->n_seq, sizeof(mm_reg1_t*));
for (i = 1, j = 0; i <= s->n_seq; ++i) for (i = 1, j = 0; i <= s->n_seq; ++i)
if (i == s->n_seq || !frag_mode || !mm_qname_same(s->seq[i-1].name, s->seq[i].name)) { if (i == s->n_seq || !frag_mode || !mm_qname_same(s->seq[i-1].name, s->seq[i].name)) {
@@ -467,7 +551,8 @@ static void *worker_pipeline(void *shared, int step, void *in)
return s; return s;
} else free(s); } else free(s);
} else if (step == 1) { // step 1: map } else if (step == 1) { // step 1: map
kt_for(p->n_threads, worker_for, in, ((step_t*)in)->n_frag); if (p->n_parts > 0) merge_hits((step_t*)in);
else kt_for(p->n_threads, worker_for, in, ((step_t*)in)->n_frag);
return in; return in;
} else if (step == 2) { // step 2: output } else if (step == 2) { // step 2: output
void *km = 0; void *km = 0;
@@ -480,20 +565,36 @@ static void *worker_pipeline(void *shared, int step, void *in)
int seg_st = s->seg_off[k], seg_en = s->seg_off[k] + s->n_seg[k]; int seg_st = s->seg_off[k], seg_en = s->seg_off[k] + s->n_seg[k];
for (i = seg_st; i < seg_en; ++i) { for (i = seg_st; i < seg_en; ++i) {
mm_bseq1_t *t = &s->seq[i]; mm_bseq1_t *t = &s->seq[i];
if (p->opt->split_prefix && p->n_parts == 0) { // then write to temporary files
mm_err_fwrite(&s->n_reg[i], sizeof(int), 1, p->fp_split);
mm_err_fwrite(&s->rep_len[i], sizeof(int), 1, p->fp_split);
mm_err_fwrite(&s->frag_gap[i], sizeof(int), 1, p->fp_split);
for (j = 0; j < s->n_reg[i]; ++j) {
mm_reg1_t *r = &s->reg[i][j];
mm_err_fwrite(r, sizeof(mm_reg1_t), 1, p->fp_split);
if (p->opt->flag & MM_F_CIGAR) {
mm_err_fwrite(&r->p->capacity, 4, 1, p->fp_split);
mm_err_fwrite(r->p, r->p->capacity, 4, p->fp_split);
}
}
} else if (s->n_reg[i] > 0) { // the query has at least one hit
for (j = 0; j < s->n_reg[i]; ++j) { for (j = 0; j < s->n_reg[i]; ++j) {
mm_reg1_t *r = &s->reg[i][j]; mm_reg1_t *r = &s->reg[i][j];
assert(!r->sam_pri || r->id == r->parent); assert(!r->sam_pri || r->id == r->parent);
if ((p->opt->flag & MM_F_NO_PRINT_2ND) && r->id != r->parent) if ((p->opt->flag & MM_F_NO_PRINT_2ND) && r->id != r->parent)
continue; continue;
if (p->opt->flag & MM_F_OUT_SAM) if (p->opt->flag & MM_F_OUT_SAM)
mm_write_sam2(&p->str, mi, t, i - seg_st, j, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag); mm_write_sam3(&p->str, mi, t, i - seg_st, j, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag, s->rep_len[i]);
else else
mm_write_paf(&p->str, mi, t, r, km, p->opt->flag); mm_write_paf3(&p->str, mi, t, r, km, p->opt->flag, s->rep_len[i]);
puts(p->str.s); mm_err_puts(p->str.s);
} }
if (s->n_reg[i] == 0 && (p->opt->flag & MM_F_OUT_SAM)) { } else if ((p->opt->flag & MM_F_PAF_NO_HIT) || ((p->opt->flag & MM_F_OUT_SAM) && !(p->opt->flag & MM_F_SAM_HIT_ONLY))) { // output an empty hit, if requested
mm_write_sam2(&p->str, mi, t, i - seg_st, -1, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag); if (p->opt->flag & MM_F_OUT_SAM)
puts(p->str.s); mm_write_sam3(&p->str, mi, t, i - seg_st, -1, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag, s->rep_len[i]);
else
mm_write_paf3(&p->str, mi, t, 0, 0, p->opt->flag, s->rep_len[i]);
mm_err_puts(p->str.s);
} }
} }
for (i = seg_st; i < seg_en; ++i) { for (i = seg_st; i < seg_en; ++i) {
@@ -501,9 +602,10 @@ static void *worker_pipeline(void *shared, int step, void *in)
free(s->reg[i]); free(s->reg[i]);
free(s->seq[i].seq); free(s->seq[i].name); free(s->seq[i].seq); free(s->seq[i].name);
if (s->seq[i].qual) free(s->seq[i].qual); if (s->seq[i].qual) free(s->seq[i].qual);
if (s->seq[i].comment) free(s->seq[i].comment);
} }
} }
free(s->reg); free(s->n_reg); free(s->seq); // seg_off and n_seg were allocated with reg; no memory leak here free(s->reg); free(s->n_reg); free(s->seq); // seg_off, n_seg, rep_len and frag_gap were allocated with reg; no memory leak here
km_destroy(km); km_destroy(km);
if (mm_verbose >= 3) if (mm_verbose >= 3)
fprintf(stderr, "[M::%s::%.3f*%.2f] mapped %d sequences\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), s->n_seq); fprintf(stderr, "[M::%s::%.3f*%.2f] mapped %d sequences\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), s->n_seq);
@@ -512,32 +614,44 @@ static void *worker_pipeline(void *shared, int step, void *in)
return 0; return 0;
} }
static mm_bseq_file_t **open_bseqs(int n, const char **fn)
{
mm_bseq_file_t **fp;
int i, j;
fp = (mm_bseq_file_t**)calloc(n, sizeof(mm_bseq_file_t*));
for (i = 0; i < n; ++i) {
if ((fp[i] = mm_bseq_open(fn[i])) == 0) {
if (mm_verbose >= 1)
fprintf(stderr, "ERROR: failed to open file '%s': %s\n", fn[i], strerror(errno));
for (j = 0; j < i; ++j)
mm_bseq_close(fp[j]);
free(fp);
return 0;
}
}
return fp;
}
int mm_map_file_frag(const mm_idx_t *idx, int n_segs, const char **fn, const mm_mapopt_t *opt, int n_threads) int mm_map_file_frag(const mm_idx_t *idx, int n_segs, const char **fn, const mm_mapopt_t *opt, int n_threads)
{ {
int i, j, pl_threads; int i, pl_threads;
pipeline_t pl; pipeline_t pl;
if (n_segs < 1) return -1; if (n_segs < 1) return -1;
memset(&pl, 0, sizeof(pipeline_t)); memset(&pl, 0, sizeof(pipeline_t));
pl.n_fp = n_segs; pl.n_fp = n_segs;
pl.fp = (mm_bseq_file_t**)calloc(n_segs, sizeof(mm_bseq_file_t*)); pl.fp = open_bseqs(pl.n_fp, fn);
for (i = 0; i < n_segs; ++i) { if (pl.fp == 0) return -1;
pl.fp[i] = mm_bseq_open(fn[i]);
if (pl.fp[i] == 0) {
if (mm_verbose >= 1)
fprintf(stderr, "ERROR: failed to open file '%s'\n", fn[i]);
for (j = 0; j < i; ++j)
mm_bseq_close(pl.fp[j]);
free(pl.fp);
return -1;
}
}
pl.opt = opt, pl.mi = idx; pl.opt = opt, pl.mi = idx;
pl.n_threads = n_threads > 1? n_threads : 1; pl.n_threads = n_threads > 1? n_threads : 1;
pl.mini_batch_size = opt->mini_batch_size; pl.mini_batch_size = opt->mini_batch_size;
if (opt->split_prefix)
pl.fp_split = mm_split_init(opt->split_prefix, idx);
pl_threads = n_threads == 1? 1 : (opt->flag&MM_F_2_IO_THREADS)? 3 : 2; pl_threads = n_threads == 1? 1 : (opt->flag&MM_F_2_IO_THREADS)? 3 : 2;
kt_pipeline(pl_threads, worker_pipeline, &pl, 3); kt_pipeline(pl_threads, worker_pipeline, &pl, 3);
free(pl.str.s); free(pl.str.s);
for (i = 0; i < n_segs; ++i) if (pl.fp_split) fclose(pl.fp_split);
for (i = 0; i < pl.n_fp; ++i)
mm_bseq_close(pl.fp[i]); mm_bseq_close(pl.fp[i]);
free(pl.fp); free(pl.fp);
return 0; return 0;
@@ -547,3 +661,48 @@ int mm_map_file(const mm_idx_t *idx, const char *fn, const mm_mapopt_t *opt, int
{ {
return mm_map_file_frag(idx, 1, &fn, opt, n_threads); return mm_map_file_frag(idx, 1, &fn, opt, n_threads);
} }
int mm_split_merge(int n_segs, const char **fn, const mm_mapopt_t *opt, int n_split_idx)
{
int i;
pipeline_t pl;
mm_idx_t *mi;
if (n_segs < 1 || n_split_idx < 1) return -1;
memset(&pl, 0, sizeof(pipeline_t));
pl.n_fp = n_segs;
pl.fp = open_bseqs(pl.n_fp, fn);
if (pl.fp == 0) return -1;
pl.opt = opt;
pl.mini_batch_size = opt->mini_batch_size;
pl.n_parts = n_split_idx;
pl.fp_parts = CALLOC(FILE*, pl.n_parts);
pl.rid_shift = CALLOC(uint32_t, pl.n_parts);
pl.mi = mi = mm_split_merge_prep(opt->split_prefix, n_split_idx, pl.fp_parts, pl.rid_shift);
if (pl.mi == 0) {
free(pl.fp_parts);
free(pl.rid_shift);
return -1;
}
for (i = n_split_idx - 1; i > 0; --i)
pl.rid_shift[i] = pl.rid_shift[i - 1];
for (pl.rid_shift[0] = 0, i = 1; i < n_split_idx; ++i)
pl.rid_shift[i] += pl.rid_shift[i - 1];
if (opt->flag & MM_F_OUT_SAM)
for (i = 0; i < (int32_t)pl.mi->n_seq; ++i)
printf("@SQ\tSN:%s\tLN:%d\n", pl.mi->seq[i].name, pl.mi->seq[i].len);
kt_pipeline(2, worker_pipeline, &pl, 3);
free(pl.str.s);
mm_idx_destroy(mi);
free(pl.rid_shift);
for (i = 0; i < n_split_idx; ++i)
fclose(pl.fp_parts[i]);
free(pl.fp_parts);
for (i = 0; i < pl.n_fp; ++i)
mm_bseq_close(pl.fp[i]);
free(pl.fp);
mm_split_rm_tmp(opt->split_prefix, n_split_idx);
return 0;
}
+103 -9
View File
@@ -29,6 +29,16 @@
#define MM_F_REV_ONLY 0x200000 #define MM_F_REV_ONLY 0x200000
#define MM_F_HEAP_SORT 0x400000 #define MM_F_HEAP_SORT 0x400000
#define MM_F_ALL_CHAINS 0x800000 #define MM_F_ALL_CHAINS 0x800000
#define MM_F_OUT_MD 0x1000000
#define MM_F_COPY_COMMENT 0x2000000
#define MM_F_EQX 0x4000000 // use =/X instead of M
#define MM_F_PAF_NO_HIT 0x8000000 // output unmapped reads to PAF
#define MM_F_NO_END_FLT 0x10000000
#define MM_F_HARD_MLEVEL 0x20000000
#define MM_F_SAM_HIT_ONLY 0x40000000
#define MM_F_RMQ (0x80000000LL)
#define MM_F_QSTRAND (0x100000000LL)
#define MM_F_NO_INV (0x200000000LL)
#define MM_I_HPC 0x1 #define MM_I_HPC 0x1
#define MM_I_NO_SEQ 0x2 #define MM_I_NO_SEQ 0x2
@@ -38,6 +48,18 @@
#define MM_MAX_SEG 255 #define MM_MAX_SEG 255
#define MM_CIGAR_MATCH 0
#define MM_CIGAR_INS 1
#define MM_CIGAR_DEL 2
#define MM_CIGAR_N_SKIP 3
#define MM_CIGAR_SOFTCLIP 4
#define MM_CIGAR_HARDCLIP 5
#define MM_CIGAR_PADDING 6
#define MM_CIGAR_EQ_MATCH 7
#define MM_CIGAR_X_MISMATCH 8
#define MM_CIGAR_STR "MIDNSHP=XB"
#ifdef __cplusplus #ifdef __cplusplus
extern "C" { extern "C" {
#endif #endif
@@ -51,14 +73,18 @@ typedef struct {
char *name; // name of the db sequence char *name; // name of the db sequence
uint64_t offset; // offset in mm_idx_t::S uint64_t offset; // offset in mm_idx_t::S
uint32_t len; // length uint32_t len; // length
uint32_t is_alt;
} mm_idx_seq_t; } mm_idx_seq_t;
typedef struct { typedef struct {
int32_t b, w, k, flag; int32_t b, w, k, flag;
uint32_t n_seq; // number of reference sequences uint32_t n_seq; // number of reference sequences
int32_t index;
int32_t n_alt;
mm_idx_seq_t *seq; // sequence name, length and offset mm_idx_seq_t *seq; // sequence name, length and offset
uint32_t *S; // 4-bit packed sequence uint32_t *S; // 4-bit packed sequence
struct mm_idx_bucket_s *B; // index (hidden) struct mm_idx_bucket_s *B; // index (hidden)
struct mm_idx_intv_s *I; // intervals (hidden)
void *km, *h; void *km, *h;
} mm_idx_t; } mm_idx_t;
@@ -82,7 +108,7 @@ typedef struct {
int32_t mlen, blen; // seeded exact match length; seeded alignment block length int32_t mlen, blen; // seeded exact match length; seeded alignment block length
int32_t n_sub; // number of suboptimal mappings int32_t n_sub; // number of suboptimal mappings
int32_t score0; // initial chaining score (before chain merging/spliting) int32_t score0; // initial chaining score (before chain merging/spliting)
uint32_t mapq:8, split:2, rev:1, inv:1, sam_pri:1, proper_frag:1, pe_thru:1, seg_split:1, seg_id:8, split_inv:1, dummy:7; uint32_t mapq:8, split:2, rev:1, inv:1, sam_pri:1, proper_frag:1, pe_thru:1, seg_split:1, seg_id:8, split_inv:1, is_alt:1, dummy:6;
uint32_t hash; uint32_t hash;
float div; float div;
mm_extra_t *p; mm_extra_t *p;
@@ -91,31 +117,39 @@ typedef struct {
// indexing and mapping options // indexing and mapping options
typedef struct { typedef struct {
short k, w, flag, bucket_bits; short k, w, flag, bucket_bits;
int mini_batch_size; int64_t mini_batch_size;
uint64_t batch_size; uint64_t batch_size;
} mm_idxopt_t; } mm_idxopt_t;
typedef struct { typedef struct {
int64_t flag; // see MM_F_* macros
int seed; int seed;
int sdust_thres; // score threshold for SDUST; 0 to disable int sdust_thres; // score threshold for SDUST; 0 to disable
int flag; // see MM_F_* macros
int bw; // bandwidth int max_qlen; // max query length
int bw, bw_long; // bandwidth
int max_gap, max_gap_ref; // break a chain if there are no minimizers in a max_gap window int max_gap, max_gap_ref; // break a chain if there are no minimizers in a max_gap window
int max_frag_len; int max_frag_len;
int max_chain_skip; int max_chain_skip, max_chain_iter;
int min_cnt; // min number of minimizers on each chain int min_cnt; // min number of minimizers on each chain
int min_chain_score; // min chaining score int min_chain_score; // min chaining score
float chain_gap_scale;
int rmq_size_cap, rmq_inner_dist;
int rmq_rescue_size;
float rmq_rescue_ratio;
float mask_level; float mask_level;
int mask_len;
float pri_ratio; float pri_ratio;
int best_n; // top best_n chains are subjected to DP alignment int best_n; // top best_n chains are subjected to DP alignment
int max_join_long, max_join_short; float alt_drop;
int min_join_flank_sc;
int a, b, q, e, q2, e2; // matching score, mismatch, gap-open and gap-ext penalties int a, b, q, e, q2, e2; // matching score, mismatch, gap-open and gap-ext penalties
int sc_ambi; // score when one or both bases are "N"
int noncan; // cost of non-canonical splicing sites int noncan; // cost of non-canonical splicing sites
int junc_bonus;
int zdrop, zdrop_inv; // break alignment if alignment score drops too fast along the diagonal int zdrop, zdrop_inv; // break alignment if alignment score drops too fast along the diagonal
int end_bonus; int end_bonus;
int min_dp_max; // drop an alignment if the score of the max scoring segment is below this threshold int min_dp_max; // drop an alignment if the score of the max scoring segment is below this threshold
@@ -123,12 +157,20 @@ typedef struct {
int anchor_ext_len, anchor_ext_shift; int anchor_ext_len, anchor_ext_shift;
float max_clip_ratio; // drop an alignment if BOTH ends are clipped above this ratio float max_clip_ratio; // drop an alignment if BOTH ends are clipped above this ratio
int rank_min_len;
float rank_frac;
int pe_ori, pe_bonus; int pe_ori, pe_bonus;
float mid_occ_frac; // only used by mm_mapopt_update(); see below float mid_occ_frac; // only used by mm_mapopt_update(); see below
int32_t min_mid_occ, max_mid_occ;
int32_t mid_occ; // ignore seeds with occurrences above this threshold int32_t mid_occ; // ignore seeds with occurrences above this threshold
int32_t max_occ; int32_t max_occ, max_max_occ, occ_dist;
int mini_batch_size; // size of a batch of query bases to process in parallel int64_t mini_batch_size; // size of a batch of query bases to process in parallel
int64_t max_sw_mat;
int64_t cap_kalloc;
const char *split_prefix;
} mm_mapopt_t; } mm_mapopt_t;
// index reader // index reader
@@ -213,6 +255,36 @@ void mm_idx_reader_close(mm_idx_reader_t *r);
int mm_idx_reader_eof(const mm_idx_reader_t *r); int mm_idx_reader_eof(const mm_idx_reader_t *r);
/**
* Check whether the file contains a minimap2 index
*
* @param fn file name
*
* @return the file size if fn is an index file; 0 if fn is not.
*/
int64_t mm_idx_is_idx(const char *fn);
/**
* Load a part of an index
*
* Given a uni-part index, this function loads the entire index into memory.
* Given a multi-part index, it loads one part only and places the file pointer
* at the end of that part.
*
* @param fp pointer to FILE object
*
* @return minimap2 index read from fp
*/
mm_idx_t *mm_idx_load(FILE *fp);
/**
* Append an index (or one part of a full index) to file
*
* @param fp pointer to FILE object
* @param mi minimap2 index
*/
void mm_idx_dump(FILE *fp, const mm_idx_t *mi);
/** /**
* Create an index from strings in memory * Create an index from strings in memory
* *
@@ -261,6 +333,8 @@ mm_tbuf_t *mm_tbuf_init(void);
*/ */
void mm_tbuf_destroy(mm_tbuf_t *b); void mm_tbuf_destroy(mm_tbuf_t *b);
void *mm_tbuf_get_km(mm_tbuf_t *b);
/** /**
* Align a query sequence against an index * Align a query sequence against an index
* *
@@ -297,11 +371,31 @@ int mm_map_file(const mm_idx_t *idx, const char *fn, const mm_mapopt_t *opt, int
int mm_map_file_frag(const mm_idx_t *idx, int n_segs, const char **fn, const mm_mapopt_t *opt, int n_threads); int mm_map_file_frag(const mm_idx_t *idx, int n_segs, const char **fn, const mm_mapopt_t *opt, int n_threads);
/**
* Generate the cs tag (new in 2.12)
*
* @param km memory blocks; set to NULL if unsure
* @param buf buffer to write the cs/MD tag; typicall NULL on the first call
* @param max_len max length of the buffer; typically set to 0 on the first call
* @param mi index
* @param r alignment
* @param seq query sequence
* @param no_iden true to use : instead of =
*
* @return the length of cs
*/
int mm_gen_cs(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int no_iden);
int mm_gen_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq);
// query sequence name and sequence in the minimap2 index // query sequence name and sequence in the minimap2 index
int mm_idx_index_name(mm_idx_t *mi); int mm_idx_index_name(mm_idx_t *mi);
int mm_idx_name2id(const mm_idx_t *mi, const char *name); int mm_idx_name2id(const mm_idx_t *mi, const char *name);
int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq); int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq);
int mm_idx_alt_read(mm_idx_t *mi, const char *fn);
int mm_idx_bed_read(mm_idx_t *mi, const char *fn, int read_junc);
int mm_idx_bed_junc(const mm_idx_t *mi, int32_t ctg, int32_t st, int32_t en, uint8_t *s);
// deprecated APIs for backward compatibility // deprecated APIs for backward compatibility
void mm_mapopt_init(mm_mapopt_t *opt); void mm_mapopt_init(mm_mapopt_t *opt);
mm_idx_t *mm_idx_build(const char *fn, int w, int k, int flag, int n_threads); mm_idx_t *mm_idx_build(const char *fn, int w, int k, int flag, int n_threads);
+182 -44
View File
@@ -1,4 +1,4 @@
.TH minimap2 1 "24 February 2018" "minimap2-2.9 (r720)" "Bioinformatics tools" .TH minimap2 1 "7 August 2021" "minimap2-2.22 (r1101)" "Bioinformatics tools"
.SH NAME .SH NAME
.PP .PP
minimap2 - mapping and alignment between collections of DNA sequences minimap2 - mapping and alignment between collections of DNA sequences
@@ -121,21 +121,56 @@ provided as the target sequences, options
.BR -w , .BR -w ,
.B -I .B -I
will be effectively overridden by the options stored in the index file. will be effectively overridden by the options stored in the index file.
.TP
.BI --alt \ FILE
List of ALT contigs [null]
.TP
.BI --alt-drop \ FLOAT
Drop ALT hits by
.I FLOAT
fraction when ranking and computing mapping quality [0.15]
.SS Mapping options .SS Mapping options
.TP 10 .TP 10
.BI -f \ FLOAT .BI -f \ FLOAT | INT1 [, INT2 ]
Ignore top If fraction, ignore top
.I FLOAT .I FLOAT
fraction of most frequent minimizers [0.0002] fraction of most frequent minimizers [0.0002]. If integer,
ignore minimizers occuring more than
.I INT1
times.
.I INT2
is only effective in the
.B --sr
or
.B -xsr
mode, which sets the threshold for a second round of seeding.
.TP .TP
.BI -g \ INT .BI -U \ INT1 [, INT2 ]
Lower and upper bounds of k-mer occurrences [10,1000000]. The final k-mer occurrence threshold is
.RI max{ INT1 ,\ min{ INT2 ,
.BR -f }}.
This option prevents excessively small or large
.B -f
estimated from the input reference. It deprecates
.B --min-occ-floor
in earlier versions of minimap2.
.TP
.BI -e \ INT
Sample a high-frequency minimizer every
.I INT
basepairs [500].
.TP
.BI -g \ NUM
Stop chain enlongation if there are no minimizers within Stop chain enlongation if there are no minimizers within
.IR INT -bp .IR NUM -bp
[10000]. [10k].
.TP .TP
.BI -r \ INT .BI -r \ NUM1 [, NUM2 ]
Bandwidth used in chaining and DP-based alignment [500]. This option Bandwidth for chaining and base alignment [500,20k].
approximately controls the maximum gap size. .I NUM1
is used for initial chaining and alignment extension;
.I NUM2
for RMQ-based re-chaining and closing gaps in alignments.
.TP .TP
.BI -n \ INT .BI -n \ INT
Discard chains consisting of Discard chains consisting of
@@ -176,7 +211,7 @@ Primarily used for all-vs-all read overlapping.
.BI -p \ FLOAT .BI -p \ FLOAT
Minimal secondary-to-primary score ratio to output secondary mappings [0.8]. Minimal secondary-to-primary score ratio to output secondary mappings [0.8].
Between two chains overlaping over half of the shorter chain (controlled by Between two chains overlaping over half of the shorter chain (controlled by
.BR --mask-level ), .BR -M ),
the chain with a lower score is secondary to the chain with a higher score. the chain with a lower score is secondary to the chain with a higher score.
If the ratio of the scores is below If the ratio of the scores is below
.IR FLOAT , .IR FLOAT ,
@@ -209,14 +244,39 @@ Mark as secondary a chain that overlaps with a better chain by
.I FLOAT .I FLOAT
or more of the shorter chain [0.5] or more of the shorter chain [0.5]
.TP .TP
.BR --rmq = no | yes
Use the minigraph chaining algorithm [no]. The minigraph algorithm is better
for aligning contigs through long INDELs.
.TP
.B --hard-mask-level
Honor option
.B -M
and disable a heurstic to save unmapped subsequences and disables
.BR --mask-len .
.TP
.BI --mask-len \ NUM
Keep an alignment if dropping it leaves an unaligned region on query longer than
.IR INT
[inf]. Effective without
.BR --hard-mask-level .
.TP
.BI --max-chain-skip \ INT .BI --max-chain-skip \ INT
A heuristics that stops chaining early [50]. Minimap2 uses dynamic programming A heuristics that stops chaining early [25]. Minimap2 uses dynamic programming
for chaining. The time complexity is quadratic in the number of seeds. This for chaining. The time complexity is quadratic in the number of seeds. This
option makes minimap2 exits the inner loop if it repeatedly sees seeds already option makes minimap2 exits the inner loop if it repeatedly sees seeds already
on chains. Set on chains. Set
.I INT .I INT
to a large number to switch off this heurstics. to a large number to switch off this heurstics.
.TP .TP
.BI --max-chain-iter \ INT
Check up to
.I INT
partial chains during chaining [5000]. This is a heuristic to avoid quadratic
time complexity in the worst case.
.TP
.BI --chain-gap-scale \ FLOAT
Scale of gap cost during chaining [1.0]
.TP
.B --no-long-join .B --no-long-join
Disable the long gap patching heuristic. When this option is applied, the Disable the long gap patching heuristic. When this option is applied, the
maximum alignment gap is mostly controlled by maximum alignment gap is mostly controlled by
@@ -231,6 +291,9 @@ applies a second round of chaining with a higher minimizer occurrence threshold
if no good chain is found. In addition, minimap2 attempts to patch gaps between if no good chain is found. In addition, minimap2 attempts to patch gaps between
seeds with ungapped alignment. seeds with ungapped alignment.
.TP .TP
.BI --split-prefix \ STR
Prefix to create temporary files. Typically used for a multi-part index.
.TP
.BR --frag = no | yes .BR --frag = no | yes
Whether to enable the fragment mode [no] Whether to enable the fragment mode [no]
.TP .TP
@@ -245,6 +308,10 @@ Only map to the reverse complement strand of the reference sequences.
.BR --heap-sort = no | yes .BR --heap-sort = no | yes
If yes, sort anchors with heap merge, instead of radix sort. Heap merge is If yes, sort anchors with heap merge, instead of radix sort. Heap merge is
faster for short reads, but slower for long reads. [no] faster for short reads, but slower for long reads. [no]
.TP
.B --no-pairing
Treat two reads in a pair as independent reads. The mate related fields in SAM
are still properly populated.
.SS Alignment options .SS Alignment options
.TP 10 .TP 10
.BI -A \ INT .BI -A \ INT
@@ -305,6 +372,9 @@ no attempt to match GT-AG [n]
.BI --end-bonus \ INT .BI --end-bonus \ INT
Score bonus when alignment extends to the end of the query sequence [0]. Score bonus when alignment extends to the end of the query sequence [0].
.TP .TP
.BI --score-N \ INT
Score of a mismatch involving ambiguous bases [1].
.TP
.BR --splice-flank = yes | no .BR --splice-flank = yes | no
Assume the next base to a Assume the next base to a
.B GT .B GT
@@ -322,6 +392,17 @@ on SIRV data, please add
.B --splice-flank=no .B --splice-flank=no
to the command line. to the command line.
.TP .TP
.BR --junc-bed \ FILE
Gene annotations in the BED12 format (aka 12-column BED), or intron positions
in 5-column BED. With this option, minimap2 prefers splicing in annotations.
BED12 file can be converted from GTF/GFF3 with `paftools.js gff2bed anno.gtf'
[].
.TP
.BR --junc-bonus \ INT
Score bonus for a splice donor or acceptor found in annotation (effective with
.BR --junc-bed )
[9].
.TP
.BI --end-seed-pen \ INT .BI --end-seed-pen \ INT
Drop a terminal anchor if Drop a terminal anchor if
.IR s <log( g )+ INT , .IR s <log( g )+ INT ,
@@ -333,12 +414,31 @@ the length of the terminal gap in the chain. This option is only effective
with with
.BR --splice . .BR --splice .
It helps to avoid tiny terminal exons. [6] It helps to avoid tiny terminal exons. [6]
.TP
.B --no-end-flt
Don't filter seeds towards the ends of chains before performing base-level
alignment.
.TP
.BI --cap-sw-mem \ NUM
Skip alignment if the DP matrix size is above
.IR NUM .
Set 0 to disable [100m].
.TP
.BI --cap-kalloc \ NUM
Free thread-local kalloc memory reservoir if after the alignment the size of the reservoir above
.IR NUM .
Set 0 to disable [0].
.SS Input/output options .SS Input/output options
.TP 10 .TP 10
.B -a .B -a
Generate CIGAR and output alignments in the SAM format. Minimap2 outputs in PAF Generate CIGAR and output alignments in the SAM format. Minimap2 outputs in PAF
by default. by default.
.TP .TP
.BI -o \ FILE
Output alignments to
.I FILE
[stdout].
.TP
.B -Q .B -Q
Ignore base quality in the input file. Ignore base quality in the input file.
.TP .TP
@@ -353,6 +453,9 @@ SAM read group line in a format like
.B @RG\\\\tID:foo\\\\tSM:bar .B @RG\\\\tID:foo\\\\tSM:bar
[]. [].
.TP .TP
.B -y
Copy input FASTA/Q comments to output.
.TP
.B -c .B -c
Generate CIGAR. In PAF, the CIGAR is written to the `cg' custom tag. Generate CIGAR. In PAF, the CIGAR is written to the `cg' custom tag.
.TP .TP
@@ -371,6 +474,12 @@ is given,
.I short .I short
is assumed. [none] is assumed. [none]
.TP .TP
.B --MD
Output the MD tag (see the SAM spec).
.TP
.B --eqx
Output =/X CIGAR operators for sequence match/mismatch.
.TP
.B -Y .B -Y
In SAM output, use soft clipping for supplementary alignments. In SAM output, use soft clipping for supplementary alignments.
.TP .TP
@@ -404,6 +513,18 @@ memory.
.BR --secondary = yes | no .BR --secondary = yes | no
Whether to output secondary alignments [yes] Whether to output secondary alignments [yes]
.TP .TP
.BI --max-qlen \ NUM
Filter out query sequences longer than
.IR NUM .
.TP
.B --paf-no-hit
In PAF, output unmapped queries; the strand and the reference name fields are
set to `*'. Warning: some paftools.js commands may not work with such output
for the moment.
.TP
.B --sam-hit-only
In SAM, don't output unmapped reads.
.TP
.B --version .B --version
Print version number to stdout Print version number to stdout
.SS Preset options .SS Preset options
@@ -417,53 +538,47 @@ Available
.I STR .I STR
are: are:
.RS .RS
.TP 8 .TP 10
.B map-pb
PacBio/Oxford Nanopore read to reference mapping
.RB ( -Hk19 )
.TP
.B map-ont .B map-ont
Slightly more sensitive for Oxford Nanopore to reference mapping Align noisy long reads of ~10% error rate to a reference genome. This is the
.RB ( -k15 ). default mode.
For PacBio reads, HPC minimizers consistently leads to faster performance and .TP
more sensitive results in comparison to normal minimizers. For Oxford Nanopore .B map-hifi
data, normal minimizers are better, though not much. The effectiveness of HPC Align PacBio high-fidelity (HiFi) reads to a reference genome
is determined by the sequencing error mode. .RB ( -k19
.B -w19 -U50,500 -g10k -A1 -B4 -O6,26 -E2,1
.BR -s200 ).
.TP
.B map-pb
Align older PacBio continuous long (CLR) reads to a reference genome
.RB ( -Hk19 ).
.TP .TP
.B asm5 .B asm5
Long assembly to reference mapping Long assembly to reference mapping
.RB ( -k19 .RB ( -k19
.B -w19 -A1 -B19 -O39,81 -E3,1 -s200 .B -w19 -U50,500 --rmq -r100k -g10k -A1 -B19 -O39,81 -E3,1 -s200 -z200
.BR -z200 ). .BR -N50 ).
Typically, the alignment will not extend to regions with 5% or higher sequence Typically, the alignment will not extend to regions with 5% or higher sequence
divergence. Only use this preset if the average divergence is far below 5%. divergence. Only use this preset if the average divergence is far below 5%.
.TP .TP
.B asm10 .B asm10
Long assembly to reference mapping Long assembly to reference mapping
.RB ( -k19 .RB ( -k19
.B -w19 -A1 -B9 -O16,41 -E2,1 -s200 .B -w19 -U50,500 --rmq -r100k -g10k -A1 -B9 -O16,41 -E2,1 -s200 -z200
.BR -z200 ). .BR -N50 ).
Up to 10% sequence divergence. Up to 10% sequence divergence.
.TP .TP
.B ava-pb .B asm20
PacBio all-vs-all overlap mapping Long assembly to reference mapping
.RB ( -Hk19 .RB ( -k19
.B -Xw5 -m100 -g10000 --max-chain-skip .B -w10 -U50,500 --rmq -r100k -g10k -A1 -B4 -O6,26 -E2,1 -s200 -z200
.BR 25 ). .BR -N50 ).
.TP Up to 20% sequence divergence.
.B ava-ont
Oxford Nanopore all-vs-all overlap mapping
.RB ( -k15
.B -Xw5 -m100 -g10000 --max-chain-skip
.BR 25 ).
Similarly, the major difference from
.B ava-pb
is that this preset is not using HPC minimizers.
.TP .TP
.B splice .B splice
Long-read spliced alignment Long-read spliced alignment
.RB ( -k15 .RB ( -k15
.B -w5 --splice -g2000 -G200k -A1 -B2 -O2,32 -E1,0 -C9 -z200 -ub .B -w5 --splice -g2k -G200k -A1 -B2 -O2,32 -E1,0 -b0 -C9 -z200 -ub --junc-bonus=9 --cap-sw-mem=0
.BR --splice-flank=yes ). .BR --splice-flank=yes ).
In the splice mode, 1) long deletions are taken as introns and represented as In the splice mode, 1) long deletions are taken as introns and represented as
the the
@@ -473,12 +588,30 @@ costs are different during chaining; 4) the computation of the
.RB ` ms ' .RB ` ms '
tag ignores introns to demote hits to pseudogenes. tag ignores introns to demote hits to pseudogenes.
.TP .TP
.B splice:hq
Long-read splice alignment for PacBio CCS reads
.RB ( -xsplice
.B -C5 -O6,24
.BR -B4 ).
.TP
.B sr .B sr
Short single-end reads without splicing Short single-end reads without splicing
.RB ( -k21 .RB ( -k21
.B -w11 --sr --frag=yes -A2 -B8 -O12,32 -E2,1 -r50 -p.5 -N20 -f1000,5000 -n2 -m20 .B -w11 --sr --frag=yes -A2 -B8 -O12,32 -E2,1 -b0 -r100 -p.5 -N20 -f1000,5000 -n2 -m20
.B -s40 -g200 -2K50m --heap-sort=yes .B -s40 -g100 -2K50m --heap-sort=yes
.BR --secondary=no ). .BR --secondary=no ).
.TP
.B ava-pb
PacBio CLR all-vs-all overlap mapping
.RB ( -Hk19
.B -Xw5 -e0
.BR -m100 ).
.TP
.B ava-ont
Oxford Nanopore all-vs-all overlap mapping
.RB ( -k15
.B -Xw5 -e0 -m100
.BR -r2k ).
.RE .RE
.SS Miscellaneous options .SS Miscellaneous options
.TP 10 .TP 10
@@ -535,12 +668,17 @@ cm i Number of minimizers on the chain
s1 i Chaining score s1 i Chaining score
s2 i Chaining score of the best secondary chain s2 i Chaining score of the best secondary chain
NM i Total number of mismatches and gaps in the alignment NM i Total number of mismatches and gaps in the alignment
MD Z To generate the ref sequence in the alignment
AS i DP alignment score AS i DP alignment score
SA Z List of other supplementary alignments
ms i DP score of the max scoring segment in the alignment ms i DP score of the max scoring segment in the alignment
nn i Number of ambiguous bases in the alignment nn i Number of ambiguous bases in the alignment
ts A Transcript strand (splice mode only) ts A Transcript strand (splice mode only)
cg Z CIGAR string (only in PAF) cg Z CIGAR string (only in PAF)
cs Z Difference string cs Z Difference string
dv f Approximate per-base sequence divergence
de f Gap-compressed per-base sequence divergence
rl i Length of query regions harboring repetitive seeds
.TE .TE
.PP .PP
+33 -2
View File
@@ -1,3 +1,4 @@
#include <stdlib.h>
#include "mmpriv.h" #include "mmpriv.h"
int mm_verbose = 1; int mm_verbose = 1;
@@ -115,11 +116,40 @@ long peakrss(void)
double realtime(void) double realtime(void)
{ {
struct timeval tp; struct timeval tp;
struct timezone tzp; gettimeofday(&tp, NULL);
gettimeofday(&tp, &tzp);
return tp.tv_sec + tp.tv_usec * 1e-6; return tp.tv_sec + tp.tv_usec * 1e-6;
} }
void mm_err_puts(const char *str)
{
int ret;
ret = puts(str);
if (ret == EOF) {
perror("[ERROR] failed to write the results");
exit(EXIT_FAILURE);
}
}
void mm_err_fwrite(const void *p, size_t size, size_t nitems, FILE *fp)
{
int ret;
ret = fwrite(p, size, nitems, fp);
if (ret == EOF) {
perror("[ERROR] failed to write data");
exit(EXIT_FAILURE);
}
}
void mm_err_fread(void *p, size_t size, size_t nitems, FILE *fp)
{
int ret;
ret = fread(p, size, nitems, fp);
if (ret == EOF) {
perror("[ERROR] failed to read data");
exit(EXIT_FAILURE);
}
}
#include "ksort.h" #include "ksort.h"
#define sort_key_128x(a) ((a).x) #define sort_key_128x(a) ((a).x)
@@ -129,3 +159,4 @@ KRADIX_SORT_INIT(128x, mm128_t, sort_key_128x, 8)
KRADIX_SORT_INIT(64, uint64_t, sort_key_64, 8) KRADIX_SORT_INIT(64, uint64_t, sort_key_64, 8)
KSORT_INIT_GENERIC(uint32_t) KSORT_INIT_GENERIC(uint32_t)
KSORT_INIT_GENERIC(uint64_t)
+335
View File
@@ -0,0 +1,335 @@
#!/usr/bin/env k8
var getopt = function(args, ostr) {
var oli; // option letter list index
if (typeof(getopt.place) == 'undefined')
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
if (getopt.place == -1) { // update scanning pointer
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
getopt.place = -1;
return null;
}
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
++getopt.ind;
getopt.place = -1;
return null;
}
}
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
if (getopt.place < 0) ++getopt.ind;
return '?';
}
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
getopt.arg = null;
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
} else { // need an argument
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
getopt.arg = args[getopt.ind].substr(getopt.place);
else if (args.length <= ++getopt.ind) { // no arg
getopt.place = -1;
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
return '?';
} else getopt.arg = args[getopt.ind]; // white space
getopt.place = -1;
++getopt.ind;
}
return optopt;
}
function read_fastx(file, buf)
{
if (file.readline(buf) < 0) return null;
var m, line = buf.toString();
if ((m = /^([>@])(\S+)/.exec(line)) == null)
throw Error("wrong fastx format");
var is_fq = (m[1] == '@');
var name = m[2];
if (file.readline(buf) < 0)
throw Error("missing sequence line");
var seq = buf.toString();
if (is_fq) { // skip quality
file.readline(buf);
file.readline(buf);
}
return [name, seq];
}
function filter_paf(a, opt)
{
if (a.length == 0) return;
var k = 0;
for (var i = 0; i < a.length; ++i) {
var ai = a[i];
if (ai[10] < opt.min_blen) continue;
if (ai[9] < ai[10] * opt.min_iden) continue;
var clip = [0, 0];
if (ai[4] == '+') {
clip[0] = ai[2] < ai[7]? ai[2] : ai[7];
clip[1] = ai[1] - ai[3] < ai[6] - ai[8]? ai[1] - ai[3] : ai[6] - ai[8];
} else {
clip[0] = ai[2] < ai[6] - ai[8]? ai[2] : ai[6] - ai[8];
clip[1] = ai[1] - ai[3] < ai[7]? ai[1] - ai[3] : ai[7];
}
if (clip[0] > opt.max_clip_len || clip[1] > opt.max_clip_len) continue;
a[k++] = ai;
}
a.length = k;
}
function parse_events(t, ev, id, buf)
{
var re = /(:(\d+))|(([\+\-\*])([a-z]+))/g;
var m, cs = null;
for (var j = 12; j < t.length; ++j) {
if ((m = /^cs:Z:(\S+)/.exec(t[j])) != null) {
cs = m[1].toLowerCase();
break;
}
}
if (cs == null) {
warn("Warning: no cs tag for read '" + t[0] + "'");
return;
}
var st = t[2], en = t[3];
var x = st;
while ((m = re.exec(cs)) != null) {
var l;
if (m[2] != null) { // an identitcal match ":\d+"
l = parseInt(m[2]);
// [start, end, type, index, changed_base]
ev.push([x, x + l, 0, id]);
} else {
if (m[4] == '*') {
l = 1;
ev.push([x, x + 1, 1, id, m[5][0]]);
} else if (m[4] == '+') {
l = m[5].length;
ev.push([x, x + l, 2, id]);
} else if (m[4] == '-') {
l = 0;
ev.push([x, x, -1, id, m[5]]);
}
}
x += l;
}
if (x != en)
throw Error("inconsistent cs for read '" + t[0] + "'");
}
function find_het_sub(ev, a, opt)
{
var n = a.length, last0_i = -1, h = [], d = [];
for (var i = 0; i < n; ++i) h[i] = [], d[i] = [];
for (var i = 0; i < ev.length; ++i) {
if (ev[i][2] == 0) {
if (last0_i < 0 || ev[i][0] != ev[last0_i][0]) last0_i = i;
else if (ev[i][1] > ev[last0_i][1])
last0_i = i;
} else if (ev[i][2] == 1 && last0_i >= 0 && ev[i][0] < ev[last0_i][1]) {
if (ev[last0_i][1] - ev[last0_i][0] >= opt.min_mlen) {
if (opt.dbg_ev) print("EV", ev[last0_i].join("\t"), "|", ev[i].join("\t"));
var e0 = ev[last0_i], hl = h[e0[3]];
if (hl.length == 0 || hl[hl.length-1][0] != e0[0])
hl.push([e0[0], e0[1]]);
d[ev[i][3]].push([ev[i][0], e0[1] - e0[0]]);
}
}
}
var b = [];
for (var i = 0; i < n; ++i) {
var sh = 0, dh = 0;
for (var j = 0; j < h[i].length; ++j)
sh += h[i][j][1] - h[i][j][0];
for (var j = 0; j < d[i].length; ++j)
dh += d[i][j][1];
// [start, end, index, #consistent, lenConsistent, #conflictive, lenConflictive, identity, mlen]
b[i] = [a[i][2], a[i][3], i, h[i].length, sh, d[i].length, dh, a[i][9] / a[i][10], a[i][9]];
}
return b;
}
function flt_utg_for_ec(b, opt)
{
var k = 0;
for (var i = 0; i < b.length; ++i) {
var bi = b[i];
if (bi[4] == 0 && bi[6] == 0) b[k++] = bi; // entirely ambiguous
else if (bi[6] < (bi[4] + bi[6]) * opt.max_ratio0) b[k++] = bi;
}
b.length = k;
if (b.length == 0) return;
// find the longest contiguous segment
b.sort(function(x,y) { return x[0]-y[0] });
var st = b[0][0], en = b[0][1], max_st = 0, max_en = 0, max_max_en = en;
for (var i = 1; i < b.length; ++i) {
if (b[i][0] > en) {
if (en - st > max_en - max_st)
max_st = st, max_en = en;
st = b[i][0], en = b[i][1];
} else {
en = en > b[i][1]? en : b[i][1];
}
max_max_en = max_max_en > b[i][1]? max_max_en : b[i][1];
}
if (en - st > max_en - max_st)
max_st = st, max_en = en;
if (max_max_en != en || st != b[0][0]) {
var k = 0;
for (var i = 0; i < b.length; ++i)
if (b[i][0] < max_en && b[i][1] > max_st)
b[k++] = b[i];
b.length = k;
}
}
function flt_utg_for_bin(b, opt) // filter out alignments clearly on the wrong phase
{
var k = 0;
for (var i = 0; i < b.length; ++i) {
var bi = b[i];
if (bi[4] + bi[6] == 0 || bi[4] >= (bi[4] + bi[6]) * opt.max_ratio0) b[k++] = bi;
}
b.length = k;
}
function ec_core(b, n_a, ev, buf, ecb) // error correction
{
var intv = [];
for (var i = 0; i < n_a; ++i)
intv[i] = null;
intv[b[0][2]] = [b[0][0], b[0][1]];
var en = b[0][1];
for (var i = 1; i < b.length; ++i) {
if (b[i][1] <= en) continue;
intv[b[i][2]] = [en, b[i][1]];
en = b[i][1];
}
var k = 0;
ecb.capacity = buf.capacity;
ecb.length = 0;
for (var i = 0; i < ev.length; ++i) {
var e = ev[i], I = intv[e[3]];
if (I == null) continue;
if (e[0] >= I[0] && e[0] < I[1]) { // this is to reduce duplicated events around junctions
//print("X", e.join("\t"));
if (e[2] == 0) {
ecb.length += e[1] - e[0];
for (var j = e[0]; j < e[1]; ++j)
ecb[k++] = buf[j];
} else if (e[2] == 1) {
++ecb.length;
ecb[k++] = e[4].charCodeAt(0);
} else if (e[2] < 0) {
ecb.length += e[4].length;
for (var j = 0; j < e[4].length; ++j)
ecb[k++] = e[4].charCodeAt(j);
} // else, skip e[2] == 2
}
}
if (ecb.length != k) throw Error("BUG!");
}
function process_paf(a, opt, fp_seq, buf, ecb)
{
if (a.length == 0) return;
var len = a[0][1], name = a[0][0], seq = null;
if (len < opt.min_rlen) return;
if (fp_seq) {
var ret;
while ((ret = read_fastx(fp_seq, buf)) != null)
if (ret[0] == a[0][0])
break;
if (ret == null)
throw Error("failed to find sequence for read '" + a[0][0] + "'");
name = ret[0], seq = ret[1];
if (seq.length != len)
throw Error("inconsistent length for read '" + name + "'");
}
filter_paf(a, opt);
if (a.length == 0) return;
var ev = [];
for (var i = 0; i < a.length; ++i)
parse_events(a[i], ev, i, buf);
ev.sort(function(x,y) { return x[0]!=y[0]? x[0]-y[0] : x[2]-y[2] });
if (seq == null) print("SQ", name, a[0][1], a.length);
var b = find_het_sub(ev, a, opt);
if (opt.ec) flt_utg_for_ec(b, opt);
else flt_utg_for_bin(b, opt);
if (seq == null) {
for (var i = 0; i < b.length; ++i) {
var m, ai = a[b[i][2]], score = 0;
for (var j = 10; j < ai.length; ++j)
if ((m = /^AS:i:(\d+)/.exec(ai[j])) != null)
score = m[1];
print("TS", b[i][2], b[i][0], b[i][1], ai.slice(5, 9).join("\t"), b[i].slice(3, 7).join("\t"), score);
}
print("//");
} else { // error correction
if (b.length == 0) return;
buf.set(seq, 0);
ec_core(b, a.length, ev, buf, ecb);
print(">" + name);
print(ecb);
}
}
function main(args)
{
var c, opt = { min_rlen:5000, min_blen:5000, min_iden:0.8, min_mlen:5, max_clip_len:500, max_ratio0:0.25, dbg_ev:false };
while ((c = getopt(args, "l:b:d:m:c:r:E")) != null) {
if (c == 'l') opt.min_rlen = parseInt(getopt.arg);
else if (c == 'b') opt.min_blen = parseInt(getopt.arg);
else if (c == 'd') opt.min_iden = parseFloat(getopt.arg);
else if (c == 'm') opt.min_slen = parseInt(getopt.arg);
else if (c == 'c') opt.max_clip_len = parseInt(getopt.arg);
else if (c == 'r') opt.max_ratio0 = parseFloat(getopt.arg);
else if (c == 'E') opt.dbg_ev = true;
}
if (args.length - getopt.ind < 1) {
print("Usage: mmphase.js [options] <map-with-cs.paf> [reads.fa]");
print("Options:");
print(" -l INT min read length [" + opt.min_rlen + "]");
print(" -b INT min alignment length [" + opt.min_blen + "]");
print(" -d FLOAT min identity [" + opt.min_iden + "]");
print(" -s INT min match length [" + opt.min_mlen + "]");
print(" -c INT max clip length [" + opt.max_clip_len + "]");
print(" -r FLOAT initial ratio for haplotype filtering [" + opt.max_ratio0 + "]");
return 0;
}
opt.ec = args.length - getopt.ind < 2? false : true;
if (!opt.ec) {
print("CC");
print("CC", "SQ qName qLen nHits");
print("CC", "TS index qStart qEnd tName tLen tStart tEnd nConsistent lCons nConflictive lConf score");
print("CC");
}
var buf = new Bytes(), ecb = new Bytes();
var fp_paf = new File(args[getopt.ind]);
var fp_seq = args.length - getopt.ind >= 2? new File(args[getopt.ind+1]) : null;
var a = [];
while (fp_paf.readline(buf) >= 0) {
var t = buf.toString().split("\t");
if (a.length > 0 && a[0][0] != t[0]) {
process_paf(a, opt, fp_seq, buf, ecb);
a.length = 0;
}
for (var i = 1; i <= 3; ++i) t[i] = parseInt(t[i]);
if (t[1] < opt.min_rlen) continue;
for (var i = 6; i <= 10; ++i) t[i] = parseInt(t[i]);
if (t[10] < opt.min_blen) continue;
a.push(t);
}
if (a.length >= 0)
process_paf(a, opt, fp_seq, buf, ecb);
if (fp_seq) fp_seq.close();
fp_paf.close();
ecb.destroy();
buf.destroy();
}
var ret = main(arguments)
exit(ret)
+1358 -102
View File
File diff suppressed because it is too large Load Diff
+53 -17
View File
@@ -4,6 +4,7 @@
#include <assert.h> #include <assert.h>
#include "minimap.h" #include "minimap.h"
#include "bseq.h" #include "bseq.h"
#include "kseq.h"
#define MM_PARENT_UNSET (-1) #define MM_PARENT_UNSET (-1)
#define MM_PARENT_TMP_PRI (-2) #define MM_PARENT_TMP_PRI (-2)
@@ -28,17 +29,20 @@
#define mm_seq4_set(s, i, c) ((s)[(i)>>3] |= (uint32_t)(c) << (((i)&7)<<2)) #define mm_seq4_set(s, i, c) ((s)[(i)>>3] |= (uint32_t)(c) << (((i)&7)<<2))
#define mm_seq4_get(s, i) ((s)[(i)>>3] >> (((i)&7)<<2) & 0xf) #define mm_seq4_get(s, i) ((s)[(i)>>3] >> (((i)&7)<<2) & 0xf)
#define MALLOC(type, len) ((type*)malloc((len) * sizeof(type)))
#define CALLOC(type, len) ((type*)calloc((len), sizeof(type)))
#ifdef __cplusplus #ifdef __cplusplus
extern "C" { extern "C" {
#endif #endif
#ifndef KSTRING_T typedef struct {
#define KSTRING_T kstring_t uint32_t n;
typedef struct __kstring_t { uint32_t q_pos;
unsigned l, m; uint32_t q_span:31, flt:1;
char *s; uint32_t seg_id:31, is_tandem:1;
} kstring_t; const uint64_t *cr;
#endif } mm_seed_t;
typedef struct { typedef struct {
int n_u, n_a; int n_u, n_a;
@@ -56,29 +60,42 @@ uint32_t ks_ksmall_uint32_t(size_t n, uint32_t arr[], size_t kk);
void mm_sketch(void *km, const char *str, int len, int w, int k, uint32_t rid, int is_hpc, mm128_v *p); void mm_sketch(void *km, const char *str, int len, int w, int k, uint32_t rid, int is_hpc, mm128_v *p);
void mm_write_sam_hdr(const mm_idx_t *mi, const char *rg, const char *ver, int argc, char *argv[]); mm_seed_t *mm_collect_matches(void *km, int *_n_m, int qlen, int max_occ, int max_max_occ, int dist, const mm_idx_t *mi, const mm128_v *mv, int64_t *n_a, int *rep_len, int *n_mini_pos, uint64_t **mini_pos);
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int opt_flag);
double mm_event_identity(const mm_reg1_t *r);
int mm_write_sam_hdr(const mm_idx_t *mi, const char *rg, const char *ver, int argc, char *argv[]);
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag);
void mm_write_paf3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag, int rep_len);
void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int n_regs, const mm_reg1_t *regs); void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int n_regs, const mm_reg1_t *regs);
void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regs, const mm_reg1_t *const* regs, void *km, int opt_flag); void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regs, const mm_reg1_t *const* regs, void *km, int64_t opt_flag);
void mm_write_sam3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regss, const mm_reg1_t *const* regss, void *km, int64_t opt_flag, int rep_len);
void mm_idxopt_init(mm_idxopt_t *opt); void mm_idxopt_init(mm_idxopt_t *opt);
const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n); const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n);
int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f); int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f);
mm128_t *mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int min_cnt, int min_sc, int is_cdna, int n_segs, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km); int mm_idx_getseq2(const mm_idx_t *mi, int is_rev, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq);
mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a); mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a);
mm_reg1_t *mm_gen_regs(void *km, uint32_t hash, int qlen, int n_u, uint64_t *u, mm128_t *a, int is_qstrand);
mm_reg1_t *mm_gen_regs(void *km, uint32_t hash, int qlen, int n_u, uint64_t *u, mm128_t *a); mm128_t *mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int max_iter, int min_cnt, int min_sc, float gap_scale,
void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a); int is_cdna, int n_segs, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km);
mm128_t *mg_lchain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int max_iter, int min_cnt, int min_sc, float chn_pen_gap, float chn_pen_skip,
int is_cdna, int n_segs, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km);
mm128_t *mg_lchain_rmq(int max_dist, int max_dist_inner, int bw, int max_chn_skip, int cap_rmq_size, int min_cnt, int min_sc, float chn_pen_gap, float chn_pen_skip,
int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km);
void mm_mark_alt(const mm_idx_t *mi, int n, mm_reg1_t *r);
void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a, int is_qstrand);
void mm_sync_regs(void *km, int n_regs, mm_reg1_t *regs); void mm_sync_regs(void *km, int n_regs, mm_reg1_t *regs);
int mm_squeeze_a(void *km, int n_regs, mm_reg1_t *regs, mm128_t *a); int mm_squeeze_a(void *km, int n_regs, mm_reg1_t *regs, mm128_t *a);
int mm_set_sam_pri(int n, mm_reg1_t *r); int mm_set_sam_pri(int n, mm_reg1_t *r);
void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r, int sub_diff); void mm_set_parent(void *km, float mask_level, int mask_len, int n, mm_reg1_t *r, int sub_diff, int hard_mask_level, float alt_diff_frac);
void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int *n_, mm_reg1_t *r); void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int *n_, mm_reg1_t *r);
void mm_select_sub_multi(void *km, float pri_ratio, float pri1, float pri2, int max_gap_ref, int min_diff, int best_n, int n_segs, const int *qlens, int *n_, mm_reg1_t *r); void mm_select_sub_multi(void *km, float pri_ratio, float pri1, float pri2, int max_gap_ref, int min_diff, int best_n, int n_segs, const int *qlens, int *n_, mm_reg1_t *r);
void mm_filter_regs(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs); void mm_filter_regs(const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs);
void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs, mm128_t *a); void mm_hit_sort(void *km, int *n_regs, mm_reg1_t *r, float alt_diff_frac);
void mm_hit_sort_by_dp(void *km, int *n_regs, mm_reg1_t *r);
void mm_set_mapq(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr); void mm_set_mapq(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr);
void mm_update_dp_max(int qlen, int n_regs, mm_reg1_t *regs, float frac, int a, int b);
void mm_est_err(const mm_idx_t *mi, int qlen, int n_regs, mm_reg1_t *regs, const mm128_t *a, int32_t n, const uint64_t *mini_pos); void mm_est_err(const mm_idx_t *mi, int qlen, int n_regs, mm_reg1_t *regs, const mm128_t *a, int32_t n, const uint64_t *mini_pos);
@@ -86,6 +103,25 @@ mm_seg_t *mm_seg_gen(void *km, uint32_t hash, int n_segs, const int *qlens, int
void mm_seg_free(void *km, int n_segs, mm_seg_t *segs); void mm_seg_free(void *km, int n_segs, mm_seg_t *segs);
void mm_pair(void *km, int max_gap_ref, int dp_bonus, int sub_diff, int match_sc, const int *qlens, int *n_regs, mm_reg1_t **regs); void mm_pair(void *km, int max_gap_ref, int dp_bonus, int sub_diff, int match_sc, const int *qlens, int *n_regs, mm_reg1_t **regs);
FILE *mm_split_init(const char *prefix, const mm_idx_t *mi);
mm_idx_t *mm_split_merge_prep(const char *prefix, int n_splits, FILE **fp, uint32_t *n_seq_part);
int mm_split_merge(int n_segs, const char **fn, const mm_mapopt_t *opt, int n_split_idx);
void mm_split_rm_tmp(const char *prefix, int n_splits);
void mm_err_puts(const char *str);
void mm_err_fwrite(const void *p, size_t size, size_t nitems, FILE *fp);
void mm_err_fread(void *p, size_t size, size_t nitems, FILE *fp);
static inline float mg_log2(float x) // NB: this doesn't work when x<2
{
union { float f; uint32_t i; } z = { x };
float log_2 = ((z.i >> 23) & 255) - 128;
z.i &= ~(255 << 23);
z.i += 127 << 23;
log_2 += (-0.34484843f * z.f + 2.02466578f) * z.f - 0.67487759f;
return log_2;
}
#ifdef __cplusplus #ifdef __cplusplus
} }
#endif #endif
+97 -22
View File
@@ -1,4 +1,5 @@
#include <stdio.h> #include <stdio.h>
#include <limits.h>
#include "mmpriv.h" #include "mmpriv.h"
void mm_idxopt_init(mm_idxopt_t *opt) void mm_idxopt_init(mm_idxopt_t *opt)
@@ -15,24 +16,34 @@ void mm_mapopt_init(mm_mapopt_t *opt)
memset(opt, 0, sizeof(mm_mapopt_t)); memset(opt, 0, sizeof(mm_mapopt_t));
opt->seed = 11; opt->seed = 11;
opt->mid_occ_frac = 2e-4f; opt->mid_occ_frac = 2e-4f;
opt->min_mid_occ = 10;
opt->max_mid_occ = 1000000;
opt->sdust_thres = 0; // no SDUST masking opt->sdust_thres = 0; // no SDUST masking
opt->min_cnt = 3; opt->min_cnt = 3;
opt->min_chain_score = 40; opt->min_chain_score = 40;
opt->bw = 500; opt->bw = 500, opt->bw_long = 20000;
opt->max_gap = 5000; opt->max_gap = 5000;
opt->max_gap_ref = -1; opt->max_gap_ref = -1;
opt->max_chain_skip = 25; opt->max_chain_skip = 25;
opt->max_chain_iter = 5000;
opt->rmq_inner_dist = 1000;
opt->rmq_size_cap = 100000;
opt->rmq_rescue_size = 1000;
opt->rmq_rescue_ratio = 0.1f;
opt->chain_gap_scale = 0.8f;
opt->max_max_occ = 4095;
opt->occ_dist = 500;
opt->mask_level = 0.5f; opt->mask_level = 0.5f;
opt->mask_len = INT_MAX;
opt->pri_ratio = 0.8f; opt->pri_ratio = 0.8f;
opt->best_n = 5; opt->best_n = 5;
opt->max_join_long = 20000; opt->alt_drop = 0.15f;
opt->max_join_short = 2000;
opt->min_join_flank_sc = 1000;
opt->a = 2, opt->b = 4, opt->q = 4, opt->e = 2, opt->q2 = 24, opt->e2 = 1; opt->a = 2, opt->b = 4, opt->q = 4, opt->e = 2, opt->q2 = 24, opt->e2 = 1;
opt->sc_ambi = 1;
opt->zdrop = 400, opt->zdrop_inv = 200; opt->zdrop = 400, opt->zdrop_inv = 200;
opt->end_bonus = -1; opt->end_bonus = -1;
opt->min_dp_max = opt->min_chain_score * opt->a; opt->min_dp_max = opt->min_chain_score * opt->a;
@@ -40,6 +51,10 @@ void mm_mapopt_init(mm_mapopt_t *opt)
opt->anchor_ext_len = 20, opt->anchor_ext_shift = 6; opt->anchor_ext_len = 20, opt->anchor_ext_shift = 6;
opt->max_clip_ratio = 1.0f; opt->max_clip_ratio = 1.0f;
opt->mini_batch_size = 500000000; opt->mini_batch_size = 500000000;
opt->max_sw_mat = 100000000;
opt->rank_min_len = 500;
opt->rank_frac = 0.9f;
opt->pe_ori = 0; // FF opt->pe_ori = 0; // FF
opt->pe_bonus = 33; opt->pe_bonus = 33;
@@ -47,10 +62,15 @@ void mm_mapopt_init(mm_mapopt_t *opt)
void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi) void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
{ {
if ((opt->flag & MM_F_SPLICE_FOR) && (opt->flag & MM_F_SPLICE_REV)) if ((opt->flag & MM_F_SPLICE_FOR) || (opt->flag & MM_F_SPLICE_REV))
opt->flag |= MM_F_SPLICE; opt->flag |= MM_F_SPLICE;
if (opt->mid_occ <= 0) if (opt->mid_occ <= 0) {
opt->mid_occ = mm_idx_cal_max_occ(mi, opt->mid_occ_frac); opt->mid_occ = mm_idx_cal_max_occ(mi, opt->mid_occ_frac);
if (opt->mid_occ < opt->min_mid_occ)
opt->mid_occ = opt->min_mid_occ;
if (opt->max_mid_occ > opt->min_mid_occ && opt->mid_occ > opt->max_mid_occ)
opt->mid_occ = opt->max_mid_occ;
}
if (mm_verbose >= 3) if (mm_verbose >= 3)
fprintf(stderr, "[M::%s::%.3f*%.2f] mid_occ = %d\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), opt->mid_occ); fprintf(stderr, "[M::%s::%.3f*%.2f] mid_occ = %d\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), opt->mid_occ);
} }
@@ -58,7 +78,7 @@ void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
void mm_mapopt_max_intron_len(mm_mapopt_t *opt, int max_intron_len) void mm_mapopt_max_intron_len(mm_mapopt_t *opt, int max_intron_len)
{ {
if ((opt->flag & MM_F_SPLICE) && max_intron_len > 0) if ((opt->flag & MM_F_SPLICE) && max_intron_len > 0)
opt->max_gap_ref = opt->bw = max_intron_len; opt->max_gap_ref = opt->bw = opt->bw_long = max_intron_len;
} }
int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo) int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
@@ -66,28 +86,44 @@ int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
if (preset == 0) { if (preset == 0) {
mm_idxopt_init(io); mm_idxopt_init(io);
mm_mapopt_init(mo); mm_mapopt_init(mo);
} else if (strcmp(preset, "map-ont") == 0) { // this is the same as the default
} else if (strcmp(preset, "ava-ont") == 0) { } else if (strcmp(preset, "ava-ont") == 0) {
io->flag = 0, io->k = 15, io->w = 5; io->flag = 0, io->k = 15, io->w = 5;
mo->flag |= MM_F_ALL_CHAINS | MM_F_NO_DIAG | MM_F_NO_DUAL | MM_F_NO_LJOIN; mo->flag |= MM_F_ALL_CHAINS | MM_F_NO_DIAG | MM_F_NO_DUAL | MM_F_NO_LJOIN;
mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_gap = 10000, mo->max_chain_skip = 25; mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_chain_skip = 25;
mo->bw = mo->bw_long = 2000;
mo->occ_dist = 0;
} else if (strcmp(preset, "map10k") == 0 || strcmp(preset, "map-pb") == 0) {
io->flag |= MM_I_HPC, io->k = 19;
} else if (strcmp(preset, "ava-pb") == 0) { } else if (strcmp(preset, "ava-pb") == 0) {
io->flag |= MM_I_HPC, io->k = 19, io->w = 5; io->flag |= MM_I_HPC, io->k = 19, io->w = 5;
mo->flag |= MM_F_ALL_CHAINS | MM_F_NO_DIAG | MM_F_NO_DUAL | MM_F_NO_LJOIN; mo->flag |= MM_F_ALL_CHAINS | MM_F_NO_DIAG | MM_F_NO_DUAL | MM_F_NO_LJOIN;
mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_gap = 10000, mo->max_chain_skip = 25; mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_chain_skip = 25;
} else if (strcmp(preset, "map10k") == 0 || strcmp(preset, "map-pb") == 0) { mo->bw_long = mo->bw;
io->flag |= MM_I_HPC, io->k = 19; mo->occ_dist = 0;
} else if (strcmp(preset, "map-ont") == 0) { } else if (strcmp(preset, "map-hifi") == 0 || strcmp(preset, "map-ccs") == 0) {
io->flag = 0, io->k = 15;
} else if (strcmp(preset, "asm5") == 0) {
io->flag = 0, io->k = 19, io->w = 19; io->flag = 0, io->k = 19, io->w = 19;
mo->max_gap = 10000;
mo->a = 1, mo->b = 4, mo->q = 6, mo->q2 = 26, mo->e = 2, mo->e2 = 1;
mo->occ_dist = 500;
mo->min_mid_occ = 50, mo->max_mid_occ = 500;
mo->min_dp_max = 200;
} else if (strncmp(preset, "asm", 3) == 0) {
io->flag = 0, io->k = 19, io->w = 19;
mo->bw = mo->bw_long = 100000;
mo->max_gap = 10000;
mo->flag |= MM_F_RMQ;
mo->min_mid_occ = 50, mo->max_mid_occ = 500;
mo->min_dp_max = 200;
mo->best_n = 50;
if (strcmp(preset, "asm5") == 0) {
mo->a = 1, mo->b = 19, mo->q = 39, mo->q2 = 81, mo->e = 3, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200; mo->a = 1, mo->b = 19, mo->q = 39, mo->q2 = 81, mo->e = 3, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
mo->min_dp_max = 200;
mo->best_n = 50;
} else if (strcmp(preset, "asm10") == 0) { } else if (strcmp(preset, "asm10") == 0) {
io->flag = 0, io->k = 19, io->w = 19;
mo->a = 1, mo->b = 9, mo->q = 16, mo->q2 = 41, mo->e = 2, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200; mo->a = 1, mo->b = 9, mo->q = 16, mo->q2 = 41, mo->e = 2, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
mo->min_dp_max = 200; } else if (strcmp(preset, "asm20") == 0) {
mo->best_n = 50; mo->a = 1, mo->b = 4, mo->q = 6, mo->q2 = 26, mo->e = 2, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
io->w = 10;
} else return -1;
} else if (strcmp(preset, "short") == 0 || strcmp(preset, "sr") == 0) { } else if (strcmp(preset, "short") == 0 || strcmp(preset, "sr") == 0) {
io->flag = 0, io->k = 21, io->w = 11; io->flag = 0, io->k = 21, io->w = 11;
mo->flag |= MM_F_SR | MM_F_FRAG_MODE | MM_F_NO_PRINT_2ND | MM_F_2_IO_THREADS | MM_F_HEAP_SORT; mo->flag |= MM_F_SR | MM_F_FRAG_MODE | MM_F_NO_PRINT_2ND | MM_F_2_IO_THREADS | MM_F_HEAP_SORT;
@@ -97,7 +133,7 @@ int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
mo->end_bonus = 10; mo->end_bonus = 10;
mo->max_frag_len = 800; mo->max_frag_len = 800;
mo->max_gap = 100; mo->max_gap = 100;
mo->bw = 100; mo->bw = mo->bw_long = 100;
mo->pri_ratio = 0.5f; mo->pri_ratio = 0.5f;
mo->min_cnt = 2; mo->min_cnt = 2;
mo->min_chain_score = 25; mo->min_chain_score = 25;
@@ -106,19 +142,43 @@ int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
mo->mid_occ = 1000; mo->mid_occ = 1000;
mo->max_occ = 5000; mo->max_occ = 5000;
mo->mini_batch_size = 50000000; mo->mini_batch_size = 50000000;
} else if (strcmp(preset, "splice") == 0 || strcmp(preset, "cdna") == 0) { } else if (strncmp(preset, "splice", 6) == 0 || strcmp(preset, "cdna") == 0) {
io->flag = 0, io->k = 15, io->w = 5; io->flag = 0, io->k = 15, io->w = 5;
mo->flag |= MM_F_SPLICE | MM_F_SPLICE_FOR | MM_F_SPLICE_REV | MM_F_SPLICE_FLANK; mo->flag |= MM_F_SPLICE | MM_F_SPLICE_FOR | MM_F_SPLICE_REV | MM_F_SPLICE_FLANK;
mo->max_gap = 2000, mo->max_gap_ref = mo->bw = 200000; mo->max_sw_mat = 0;
mo->max_gap = 2000, mo->max_gap_ref = mo->bw = mo->bw_long = 200000;
mo->a = 1, mo->b = 2, mo->q = 2, mo->e = 1, mo->q2 = 32, mo->e2 = 0; mo->a = 1, mo->b = 2, mo->q = 2, mo->e = 1, mo->q2 = 32, mo->e2 = 0;
mo->noncan = 9; mo->noncan = 9;
mo->junc_bonus = 9;
mo->zdrop = 200, mo->zdrop_inv = 100; // because mo->a is halved mo->zdrop = 200, mo->zdrop_inv = 100; // because mo->a is halved
if (strcmp(preset, "splice:hq") == 0)
mo->junc_bonus = 5, mo->b = 4, mo->q = 6, mo->q2 = 24;
} else return -1; } else return -1;
return 0; return 0;
} }
int mm_check_opt(const mm_idxopt_t *io, const mm_mapopt_t *mo) int mm_check_opt(const mm_idxopt_t *io, const mm_mapopt_t *mo)
{ {
if (mo->bw > mo->bw_long) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m with '-rNUM1,NUM2', NUM1 (%d) can't be larger than NUM2 (%d)\033[0m\n", mo->bw, mo->bw_long);
return -8;
}
if ((mo->flag & MM_F_RMQ) && (mo->flag & (MM_F_SR|MM_F_SPLICE))) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m --rmq doesn't work with --sr or --splice\033[0m\n");
return -7;
}
if (mo->split_prefix && (mo->flag & (MM_F_OUT_CS|MM_F_OUT_MD))) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m --cs or --MD doesn't work with --split-prefix\033[0m\n");
return -6;
}
if (io->k <= 0 || io->w <= 0) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m -k and -w must be positive\033[0m\n");
return -5;
}
if (mo->best_n < 0) { if (mo->best_n < 0) {
if (mm_verbose >= 1) if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m -N must be no less than 0\033[0m\n"); fprintf(stderr, "[ERROR]\033[1;31m -N must be no less than 0\033[0m\n");
@@ -136,6 +196,11 @@ int mm_check_opt(const mm_idxopt_t *io, const mm_mapopt_t *mo)
fprintf(stderr, "[ERROR]\033[1;31m --for-only and --rev-only can't be applied at the same time\033[0m\n"); fprintf(stderr, "[ERROR]\033[1;31m --for-only and --rev-only can't be applied at the same time\033[0m\n");
return -3; return -3;
} }
if (mo->e <= 0 || mo->q <= 0) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m -O and -E must be positive\033[0m\n");
return -1;
}
if ((mo->q != mo->q2 || mo->e != mo->e2) && !(mo->e > mo->e2 && mo->q + mo->e < mo->q2 + mo->e2)) { if ((mo->q != mo->q2 || mo->e != mo->e2) && !(mo->e > mo->e2 && mo->q + mo->e < mo->q2 + mo->e2)) {
if (mm_verbose >= 1) if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m dual gap penalties violating E1>E2 and O1+E1<O2+E2\033[0m\n"); fprintf(stderr, "[ERROR]\033[1;31m dual gap penalties violating E1>E2 and O1+E1<O2+E2\033[0m\n");
@@ -151,5 +216,15 @@ int mm_check_opt(const mm_idxopt_t *io, const mm_mapopt_t *mo)
fprintf(stderr, "[ERROR]\033[1;31m Z-drop should not be less than inversion-Z-drop\033[0m\n"); fprintf(stderr, "[ERROR]\033[1;31m Z-drop should not be less than inversion-Z-drop\033[0m\n");
return -5; return -5;
} }
if ((mo->flag & MM_F_NO_PRINT_2ND) && (mo->flag & MM_F_ALL_CHAINS)) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m -X/-P and --secondary=no can't be applied at the same time\033[0m\n");
return -5;
}
if ((mo->flag & MM_F_QSTRAND) && ((mo->flag & (MM_F_OUT_SAM|MM_F_SPLICE|MM_F_FRAG_MODE)) || (io->flag & MM_I_HPC))) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m --qstrand doesn't work with -a, -H, --frag or --splice\033[0m\n");
return -5;
}
return 0; return 0;
} }
+5 -5
View File
@@ -54,7 +54,7 @@ void mm_set_pe_thru(const int *qlens, int *n_regs, mm_reg1_t **regs)
if (n_pri[0] == 1 && n_pri[1] == 1) { if (n_pri[0] == 1 && n_pri[1] == 1) {
mm_reg1_t *p = &regs[0][pri[0]]; mm_reg1_t *p = &regs[0][pri[0]];
mm_reg1_t *q = &regs[1][pri[1]]; mm_reg1_t *q = &regs[1][pri[1]];
if (p->rid == q->rid && p->rev == q->rev && abs(p->rs - q->rs) < 3 && abs(p->re - p->re) < 3 if (p->rid == q->rid && p->rev == q->rev && abs(p->rs - q->rs) < 3 && abs(p->re - q->re) < 3
&& ((p->qs == 0 && qlens[1] - q->qe == 0) || (q->qs == 0 && qlens[0] - p->qe == 0))) && ((p->qs == 0 && qlens[1] - q->qe == 0) || (q->qs == 0 && qlens[0] - p->qe == 0)))
{ {
p->pe_thru = q->pe_thru = 1; p->pe_thru = q->pe_thru = 1;
@@ -105,7 +105,7 @@ void mm_pair(void *km, int max_gap_ref, int pe_bonus, int sub_diff, int match_sc
max = -1; max = -1;
max_idx[0] = max_idx[1] = -1; max_idx[0] = max_idx[1] = -1;
last[0] = last[1] = -1; last[0] = last[1] = -1;
kv_resize(uint64_t, km, sc, n); kv_resize(uint64_t, km, sc, (size_t)n);
for (i = 0; i < n; ++i) { for (i = 0; i < n; ++i) {
if (a[i].key & 1) { // reverse first read or forward second read if (a[i].key & 1) { // reverse first read or forward second read
mm_reg1_t *q, *r; mm_reg1_t *q, *r;
@@ -151,8 +151,8 @@ void mm_pair(void *km, int max_gap_ref, int pe_bonus, int sub_diff, int match_sc
} }
} }
mapq_pe = r[0]->mapq > r[1]->mapq? r[0]->mapq : r[1]->mapq; mapq_pe = r[0]->mapq > r[1]->mapq? r[0]->mapq : r[1]->mapq;
for (i = 0; i < sc.n; ++i) for (i = 0; i < (int)sc.n; ++i)
if ((sc.a[i]>>32) + sub_diff >= max>>32) if ((sc.a[i]>>32) + sub_diff >= (uint64_t)max>>32)
++n_sub; ++n_sub;
if (sc.n > 1) { if (sc.n > 1) {
int mapq_pe_alt; int mapq_pe_alt;
@@ -164,7 +164,7 @@ void mm_pair(void *km, int max_gap_ref, int pe_bonus, int sub_diff, int match_sc
if (sc.n == 1) { if (sc.n == 1) {
if (r[0]->mapq < 2) r[0]->mapq = 2; if (r[0]->mapq < 2) r[0]->mapq = 2;
if (r[1]->mapq < 2) r[1]->mapq = 2; if (r[1]->mapq < 2) r[1]->mapq = 2;
} else if (max>>32 > sc.a[sc.n - 2]>>32) { } else if ((uint64_t)max>>32 > sc.a[sc.n - 2]>>32) {
if (r[0]->mapq < 1) r[0]->mapq = 1; if (r[0]->mapq < 1) r[0]->mapq = 1;
if (r[1]->mapq < 1) r[1]->mapq = 1; if (r[1]->mapq < 1) r[1]->mapq = 1;
} }
+33 -7
View File
@@ -43,20 +43,24 @@ The following Python script demonstrates the key functionality of mappy:
APIs APIs
---- ----
Mappy implements two classes and one global function. Mappy implements two classes and two global function.
Class mappy.Aligner Class mappy.Aligner
~~~~~~~~~~~~~~~~~~~ ~~~~~~~~~~~~~~~~~~~
.. code:: python .. code:: python
mappy.Aligner(fn_idx_in, preset=None, ...) mappy.Aligner(fn_idx_in=None, preset=None, ...)
This constructor accepts the following arguments: This constructor accepts the following arguments:
* **fn_idx_in**: index or sequence file name. Minimap2 automatically tests the * **fn_idx_in**: index or sequence file name. Minimap2 automatically tests the
file type. If a sequence file is provided, minimap2 builds an index. The file type. If a sequence file is provided, minimap2 builds an index. The
sequence file can be optionally gzip'd. sequence file can be optionally gzip'd. This option has no effect if **seq**
is set.
* **seq**: a single sequence to index. The sequence name will be set to
:code:`N/A`.
* **preset**: minimap2 preset. Currently, minimap2 supports the following * **preset**: minimap2 preset. Currently, minimap2 supports the following
presets: **sr** for single-end short reads; **map-pb** for PacBio presets: **sr** for single-end short reads; **map-pb** for PacBio
@@ -79,17 +83,28 @@ This constructor accepts the following arguments:
* **n_threads**: number of indexing threads; 3 by default * **n_threads**: number of indexing threads; 3 by default
* **fn_idx_out**: name of file to which the index is written * **extra_flags**: additional flags defined in minimap.h
* **fn_idx_out**: name of file to which the index is written. This parameter
has no effect if **seq** is set.
* **scoring**: scoring system. It is a tuple/list consisting of 4, 6 or 7
positive integers. The first 4 elements specify match scoring, mismatch
penalty, gap open and gap extension penalty. The 5th and 6th elements, if
present, set long-gap open and long-gap extension penalty. The 7th sets a
mismatch penalty involving ambiguous bases.
.. code:: python .. code:: python
mappy.Aligner.map(seq, seq2=None) mappy.Aligner.map(seq, seq2=None, cs=False, MD=False)
This method aligns :code:`seq` against the index. It is a generator, *yielding* This method aligns :code:`seq` against the index. It is a generator, *yielding*
a series of :code:`mappy.Alignment` objects. If :code:`seq2` is present, mappy a series of :code:`mappy.Alignment` objects. If :code:`seq2` is present, mappy
performs paired-end alignment, assuming the two ends are in the FR orientation. performs paired-end alignment, assuming the two ends are in the FR orientation.
Alignments of the two ends can be distinguished by the :code:`read_num` field Alignments of the two ends can be distinguished by the :code:`read_num` field
(see Class mappy.Alignment below). (see Class mappy.Alignment below). Argument :code:`cs` asks mappy to generate
the :code:`cs` tag; :code:`MD` is similar. These two arguments might slightly
degrade performance and are not enabled by default.
.. code:: python .. code:: python
@@ -99,6 +114,12 @@ This method retrieves a (sub)sequence from the index and returns it as a Python
string. :code:`None` is returned if :code:`name` is not present in the index or string. :code:`None` is returned if :code:`name` is not present in the index or
the start/end coordinates are invalid. the start/end coordinates are invalid.
.. code:: python
mappy.Aligner.seq_names
This property gives the array of sequence names in the index.
Class mappy.Alignment Class mappy.Alignment
~~~~~~~~~~~~~~~~~~~~~ ~~~~~~~~~~~~~~~~~~~~~
@@ -123,7 +144,7 @@ properties:
* **mlen**: length of the matching bases in the alignment, excluding ambiguous * **mlen**: length of the matching bases in the alignment, excluding ambiguous
base matches. base matches.
* **NM**: number of mismatches, gaps and ambiguous poistions in the alignment * **NM**: number of mismatches, gaps and ambiguous positions in the alignment
* **trans_strand**: transcript strand. +1 if on the forward strand; -1 if on the * **trans_strand**: transcript strand. +1 if on the forward strand; -1 if on the
reverse strand; 0 if unknown reverse strand; 0 if unknown
@@ -139,6 +160,11 @@ properties:
* **cigar**: CIGAR returned as an array of shape :code:`(n_cigar,2)`. The two * **cigar**: CIGAR returned as an array of shape :code:`(n_cigar,2)`. The two
numbers give the length and the operator of each CIGAR operation. numbers give the length and the operator of each CIGAR operation.
* **MD**: the :code:`MD` tag as in the SAM format. It is an empty string unless
the :code:`MD` argument is applied when calling :code:`mappy.Aligner.map()`.
* **cs**: the :code:`cs` tag.
An :code:`Alignment` object can be converted to a string with :code:`str()` in An :code:`Alignment` object can be converted to a string with :code:`str()` in
the following format: the following format:
+25 -6
View File
@@ -73,13 +73,17 @@ static inline void mm_reset_timer(void)
extern unsigned char seq_comp_table[256]; extern unsigned char seq_comp_table[256];
static inline mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char *seq1, const char *seq2, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt) static inline mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char *seq1, const char *seq2, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt)
{ {
mm_reg1_t *r;
Py_BEGIN_ALLOW_THREADS
if (seq2 == 0) { if (seq2 == 0) {
return mm_map(mi, strlen(seq1), seq1, n_regs, b, opt, NULL); r = mm_map(mi, strlen(seq1), seq1, n_regs, b, opt, NULL);
} else { } else {
int _n_regs[2]; int _n_regs[2];
mm_reg1_t *regs[2]; mm_reg1_t *regs[2];
char *seq[2]; char *seq[2];
int i, len[2]; int i, len[2];
len[0] = strlen(seq1); len[0] = strlen(seq1);
len[1] = strlen(seq2); len[1] = strlen(seq2);
seq[0] = (char*)seq1; seq[0] = (char*)seq1;
@@ -97,8 +101,11 @@ static inline mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char *seq1, const
regs[0] = (mm_reg1_t*)realloc(regs[0], sizeof(mm_reg1_t) * (*n_regs)); regs[0] = (mm_reg1_t*)realloc(regs[0], sizeof(mm_reg1_t) * (*n_regs));
memcpy(&regs[0][_n_regs[0]], regs[1], _n_regs[1] * sizeof(mm_reg1_t)); memcpy(&regs[0][_n_regs[0]], regs[1], _n_regs[1] * sizeof(mm_reg1_t));
free(regs[1]); free(regs[1]);
return regs[0]; r = regs[0];
} }
Py_END_ALLOW_THREADS
return r;
} }
static inline char *mappy_revcomp(int len, const uint8_t *seq) static inline char *mappy_revcomp(int len, const uint8_t *seq)
@@ -119,15 +126,27 @@ static char *mappy_fetch_seq(const mm_idx_t *mi, const char *name, int st, int e
*len = 0; *len = 0;
rid = mm_idx_name2id(mi, name); rid = mm_idx_name2id(mi, name);
if (rid < 0) return 0; if (rid < 0) return 0;
if (st >= mi->seq[i].len || st >= en) return 0; if ((uint32_t)st >= mi->seq[rid].len || st >= en) return 0;
if (en < 0 || en > mi->seq[i].len) if (en < 0 || (uint32_t)en > mi->seq[rid].len)
en = mi->seq[i].len; en = mi->seq[rid].len;
s = (char*)malloc(en - st + 1); s = (char*)malloc(en - st + 1);
*len = mm_idx_getseq(mi, rid, st, en, s); *len = mm_idx_getseq(mi, rid, st, en, (uint8_t*)s);
for (i = 0; i < *len; ++i) for (i = 0; i < *len; ++i)
s[i] = "ACGTN"[(uint8_t)s[i]]; s[i] = "ACGTN"[(uint8_t)s[i]];
s[*len] = 0; s[*len] = 0;
return s; return s;
} }
static mm_idx_t *mappy_idx_seq(int w, int k, int is_hpc, int bucket_bits, const char *seq, int len)
{
const char *fake_name = "N/A";
char *s;
mm_idx_t *mi;
s = (char*)calloc(len + 1, 1);
memcpy(s, seq, len);
mi = mm_idx_str(w, k, is_hpc, bucket_bits, 1, (const char**)&s, (const char**)&fake_name);
free(s);
return mi;
}
#endif #endif
+35 -8
View File
@@ -6,37 +6,59 @@ cdef extern from "minimap.h":
# #
ctypedef struct mm_idxopt_t: ctypedef struct mm_idxopt_t:
short k, w, flag, bucket_bits short k, w, flag, bucket_bits
int mini_batch_size int64_t mini_batch_size
uint64_t batch_size uint64_t batch_size
ctypedef struct mm_mapopt_t: ctypedef struct mm_mapopt_t:
int64_t flag
int seed int seed
int sdust_thres int sdust_thres
int flag
int bw int max_qlen
int bw, bw_long
int max_gap, max_gap_ref int max_gap, max_gap_ref
int max_frag_len int max_frag_len
int max_chain_skip int max_chain_skip, max_chain_iter
int min_cnt int min_cnt
int min_chain_score int min_chain_score
float chain_gap_scale
int rmq_size_cap, rmq_inner_dist
int rmq_rescue_size
float rmq_rescue_ratio
float mask_level float mask_level
int mask_len
float pri_ratio float pri_ratio
int best_n int best_n
int max_join_long, max_join_short
int min_join_flank_sc float alt_drop
int a, b, q, e, q2, e2 int a, b, q, e, q2, e2
int sc_ambi
int noncan int noncan
int junc_bonus
int zdrop, zdrop_inv int zdrop, zdrop_inv
int end_bonus int end_bonus
int min_dp_max int min_dp_max
int min_ksw_len int min_ksw_len
int anchor_ext_len, anchor_ext_shift int anchor_ext_len, anchor_ext_shift
float max_clip_ratio float max_clip_ratio
int rank_min_len
float rank_frac
int pe_ori, pe_bonus int pe_ori, pe_bonus
float mid_occ_frac float mid_occ_frac
int32_t min_mid_occ
int32_t mid_occ int32_t mid_occ
int32_t max_occ int32_t max_occ
int mini_batch_size int64_t mini_batch_size
int64_t max_sw_mat
int64_t cap_kalloc
const char *split_prefix
int mm_set_opt(char *preset, mm_idxopt_t *io, mm_mapopt_t *mo) int mm_set_opt(char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
int mm_verbose int mm_verbose
@@ -58,7 +80,8 @@ cdef extern from "minimap.h":
mm_idx_seq_t *seq mm_idx_seq_t *seq
uint32_t *S uint32_t *S
mm_idx_bucket_t *B mm_idx_bucket_t *B
void *km, *h void *km
void *h
ctypedef struct mm_idx_reader_t: ctypedef struct mm_idx_reader_t:
pass pass
@@ -82,6 +105,9 @@ cdef extern from "minimap.h":
mm_tbuf_t *mm_tbuf_init() mm_tbuf_t *mm_tbuf_init()
void mm_tbuf_destroy(mm_tbuf_t *b) void mm_tbuf_destroy(mm_tbuf_t *b)
void *mm_tbuf_get_km(mm_tbuf_t *b)
int mm_gen_cs(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int no_iden)
int mm_gen_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq)
# #
# Helper header (because it is hard to expose mm_reg1_t with Cython) # Helper header (because it is hard to expose mm_reg1_t with Cython)
@@ -102,6 +128,7 @@ cdef extern from "cmappy.h":
void mm_free_reg1(mm_reg1_t *r) void mm_free_reg1(mm_reg1_t *r)
mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char *seq1, const char *seq2, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt) mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char *seq1, const char *seq2, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt)
char *mappy_fetch_seq(const mm_idx_t *mi, const char *name, int st, int en, int *l) char *mappy_fetch_seq(const mm_idx_t *mi, const char *name, int st, int en, int *l)
mm_idx_t *mappy_idx_seq(int w, int k, int is_hpc, int bucket_bits, const char *seq, int l)
ctypedef struct kstring_t: ctypedef struct kstring_t:
unsigned l, m unsigned l, m
+82 -15
View File
@@ -3,6 +3,8 @@ from libc.stdlib cimport free
cimport cmappy cimport cmappy
import sys import sys
__version__ = '2.22'
cmappy.mm_reset_timer() cmappy.mm_reset_timer()
cdef class Alignment: cdef class Alignment:
@@ -12,9 +14,9 @@ cdef class Alignment:
cdef int8_t _strand, _trans_strand cdef int8_t _strand, _trans_strand
cdef uint8_t _mapq, _is_primary cdef uint8_t _mapq, _is_primary
cdef int _seg_id cdef int _seg_id
cdef _ctg, _cigar # these are python objects cdef _ctg, _cigar, _cs, _MD # these are python objects
def __cinit__(self, ctg, cl, cs, ce, strand, qs, qe, mapq, cigar, is_primary, mlen, blen, NM, trans_strand, seg_id): def __cinit__(self, ctg, cl, cs, ce, strand, qs, qe, mapq, cigar, is_primary, mlen, blen, NM, trans_strand, seg_id, cs_str, MD_str):
self._ctg = ctg if isinstance(ctg, str) else ctg.decode() self._ctg = ctg if isinstance(ctg, str) else ctg.decode()
self._ctg_len, self._r_st, self._r_en = cl, cs, ce self._ctg_len, self._r_st, self._r_en = cl, cs, ce
self._strand, self._q_st, self._q_en = strand, qs, qe self._strand, self._q_st, self._q_en = strand, qs, qe
@@ -24,6 +26,8 @@ cdef class Alignment:
self._is_primary = is_primary self._is_primary = is_primary
self._trans_strand = trans_strand self._trans_strand = trans_strand
self._seg_id = seg_id self._seg_id = seg_id
self._cs = cs_str
self._MD = MD_str
@property @property
def ctg(self): return self._ctg def ctg(self): return self._ctg
@@ -70,9 +74,15 @@ cdef class Alignment:
@property @property
def read_num(self): return self._seg_id + 1 def read_num(self): return self._seg_id + 1
@property
def cs(self): return self._cs
@property
def MD(self): return self._MD
@property @property
def cigar_str(self): def cigar_str(self):
return "".join(map(lambda x: str(x[0]) + 'MIDNSH'[x[1]], self._cigar)) return "".join(map(lambda x: str(x[0]) + 'MIDNSHP=XB'[x[1]], self._cigar))
def __str__(self): def __str__(self):
if self._strand > 0: strand = '+' if self._strand > 0: strand = '+'
@@ -83,8 +93,10 @@ cdef class Alignment:
if self._trans_strand > 0: ts = 'ts:A:+' if self._trans_strand > 0: ts = 'ts:A:+'
elif self._trans_strand < 0: ts = 'ts:A:-' elif self._trans_strand < 0: ts = 'ts:A:-'
else: ts = 'ts:A:.' else: ts = 'ts:A:.'
return "\t".join([str(self._q_st), str(self._q_en), strand, self._ctg, str(self._ctg_len), str(self._r_st), str(self._r_en), a = [str(self._q_st), str(self._q_en), strand, self._ctg, str(self._ctg_len), str(self._r_st), str(self._r_en),
str(self._mlen), str(self._blen), str(self._mapq), tp, ts, "cg:Z:" + self.cigar_str]) str(self._mlen), str(self._blen), str(self._mapq), tp, ts, "cg:Z:" + self.cigar_str]
if self._cs != "": a.append("cs:Z:" + self._cs)
return "\t".join(a)
cdef class ThreadBuffer: cdef class ThreadBuffer:
cdef cmappy.mm_tbuf_t *_b cdef cmappy.mm_tbuf_t *_b
@@ -100,7 +112,8 @@ cdef class Aligner:
cdef cmappy.mm_idxopt_t idx_opt cdef cmappy.mm_idxopt_t idx_opt
cdef cmappy.mm_mapopt_t map_opt cdef cmappy.mm_mapopt_t map_opt
def __cinit__(self, fn_idx_in, preset=None, k=None, w=None, min_cnt=None, min_chain_score=None, min_dp_score=None, bw=None, best_n=None, n_threads=3, fn_idx_out=None): def __cinit__(self, fn_idx_in=None, preset=None, k=None, w=None, min_cnt=None, min_chain_score=None, min_dp_score=None, bw=None, best_n=None, n_threads=3, fn_idx_out=None, max_frag_len=None, extra_flags=None, seq=None, scoring=None):
self._idx = NULL
cmappy.mm_set_opt(NULL, &self.idx_opt, &self.map_opt) # set the default options cmappy.mm_set_opt(NULL, &self.idx_opt, &self.map_opt) # set the default options
if preset is not None: if preset is not None:
cmappy.mm_set_opt(str.encode(preset), &self.idx_opt, &self.map_opt) # apply preset cmappy.mm_set_opt(str.encode(preset), &self.idx_opt, &self.map_opt) # apply preset
@@ -113,17 +126,33 @@ cdef class Aligner:
if min_dp_score is not None: self.map_opt.min_dp_max = min_dp_score if min_dp_score is not None: self.map_opt.min_dp_max = min_dp_score
if bw is not None: self.map_opt.bw = bw if bw is not None: self.map_opt.bw = bw
if best_n is not None: self.map_opt.best_n = best_n if best_n is not None: self.map_opt.best_n = best_n
if max_frag_len is not None: self.map_opt.max_frag_len = max_frag_len
if extra_flags is not None: self.map_opt.flag |= extra_flags
if scoring is not None and len(scoring) >= 4:
self.map_opt.a, self.map_opt.b = scoring[0], scoring[1]
self.map_opt.q, self.map_opt.e = scoring[2], scoring[3]
self.map_opt.q2, self.map_opt.e2 = self.map_opt.q, self.map_opt.e
if len(scoring) >= 6:
self.map_opt.q2, self.map_opt.e2 = scoring[4], scoring[5]
if len(scoring) >= 7:
self.map_opt.sc_ambi = scoring[6]
cdef cmappy.mm_idx_reader_t *r; cdef cmappy.mm_idx_reader_t *r;
if seq is None:
if fn_idx_out is None: if fn_idx_out is None:
r = cmappy.mm_idx_reader_open(str.encode(fn_idx_in), &self.idx_opt, NULL) r = cmappy.mm_idx_reader_open(str.encode(fn_idx_in), &self.idx_opt, NULL)
else: else:
r = cmappy.mm_idx_reader_open(str.encode(fn_idx_in), &self.idx_opt, fn_idx_out) r = cmappy.mm_idx_reader_open(str.encode(fn_idx_in), &self.idx_opt, str.encode(fn_idx_out))
if r is not NULL: if r is not NULL:
self._idx = cmappy.mm_idx_reader_read(r, n_threads) # NB: ONLY read the first part self._idx = cmappy.mm_idx_reader_read(r, n_threads) # NB: ONLY read the first part
cmappy.mm_idx_reader_close(r) cmappy.mm_idx_reader_close(r)
cmappy.mm_mapopt_update(&self.map_opt, self._idx) cmappy.mm_mapopt_update(&self.map_opt, self._idx)
cmappy.mm_idx_index_name(self._idx) cmappy.mm_idx_index_name(self._idx)
else:
self._idx = cmappy.mappy_idx_seq(self.idx_opt.w, self.idx_opt.k, self.idx_opt.flag&1, self.idx_opt.bucket_bits, str.encode(seq), len(seq))
cmappy.mm_mapopt_update(&self.map_opt, self._idx)
self.map_opt.mid_occ = 1000 # don't filter high-occ seeds
def __dealloc__(self): def __dealloc__(self):
if self._idx is not NULL: if self._idx is not NULL:
@@ -132,36 +161,63 @@ cdef class Aligner:
def __bool__(self): def __bool__(self):
return (self._idx != NULL) return (self._idx != NULL)
def map(self, seq, seq2=None, buf=None): def map(self, seq, seq2=None, buf=None, cs=False, MD=False, max_frag_len=None, extra_flags=None):
cdef cmappy.mm_reg1_t *regs cdef cmappy.mm_reg1_t *regs
cdef cmappy.mm_hitpy_t h cdef cmappy.mm_hitpy_t h
cdef ThreadBuffer b cdef ThreadBuffer b
cdef int n_regs cdef int n_regs
cdef char *cs_str = NULL
cdef int l_cs_str, m_cs_str = 0
cdef void *km
cdef cmappy.mm_mapopt_t map_opt
if self._idx == NULL: return
map_opt = self.map_opt
if max_frag_len is not None: map_opt.max_frag_len = max_frag_len
if extra_flags is not None: map_opt.flag |= extra_flags
if self._idx is NULL: return None if self._idx is NULL: return None
if buf is None: b = ThreadBuffer() if buf is None: b = ThreadBuffer()
else: b = buf else: b = buf
km = cmappy.mm_tbuf_get_km(b._b)
_seq = seq if isinstance(seq, bytes) else seq.encode() _seq = seq if isinstance(seq, bytes) else seq.encode()
if seq2 is None: if seq2 is None:
regs = cmappy.mm_map_aux(self._idx, _seq, NULL, &n_regs, b._b, &self.map_opt) regs = cmappy.mm_map_aux(self._idx, _seq, NULL, &n_regs, b._b, &map_opt)
else: else:
_seq2 = seq2 if isinstance(seq2, bytes) else seq2.encode() _seq2 = seq2 if isinstance(seq2, bytes) else seq2.encode()
regs = cmappy.mm_map_aux(self._idx, _seq, _seq2, &n_regs, b._b, &self.map_opt) regs = cmappy.mm_map_aux(self._idx, _seq, _seq2, &n_regs, b._b, &map_opt)
for i in range(n_regs): try:
i = 0
while i < n_regs:
cmappy.mm_reg2hitpy(self._idx, &regs[i], &h) cmappy.mm_reg2hitpy(self._idx, &regs[i], &h)
cigar = [] cigar, _cs, _MD = [], '', ''
for k in range(h.n_cigar32): for k in range(h.n_cigar32): # convert the 32-bit CIGAR encoding to Python array
c = h.cigar32[k] c = h.cigar32[k]
cigar.append([c>>4, c&0xf]) cigar.append([c>>4, c&0xf])
yield Alignment(h.ctg, h.ctg_len, h.ctg_start, h.ctg_end, h.strand, h.qry_start, h.qry_end, h.mapq, cigar, h.is_primary, h.mlen, h.blen, h.NM, h.trans_strand, h.seg_id) if cs or MD: # generate the cs and/or the MD tag, if requested
if cs:
l_cs_str = cmappy.mm_gen_cs(km, &cs_str, &m_cs_str, self._idx, &regs[i], _seq, 1)
_cs = cs_str[:l_cs_str] if isinstance(cs_str, str) else cs_str[:l_cs_str].decode()
if MD:
l_cs_str = cmappy.mm_gen_MD(km, &cs_str, &m_cs_str, self._idx, &regs[i], _seq)
_MD = cs_str[:l_cs_str] if isinstance(cs_str, str) else cs_str[:l_cs_str].decode()
yield Alignment(h.ctg, h.ctg_len, h.ctg_start, h.ctg_end, h.strand, h.qry_start, h.qry_end, h.mapq, cigar, h.is_primary, h.mlen, h.blen, h.NM, h.trans_strand, h.seg_id, _cs, _MD)
cmappy.mm_free_reg1(&regs[i]) cmappy.mm_free_reg1(&regs[i])
i += 1
finally:
while i < n_regs:
cmappy.mm_free_reg1(&regs[i])
i += 1
free(regs) free(regs)
free(cs_str)
def seq(self, str name, int start=0, int end=0x7fffffff): def seq(self, str name, int start=0, int end=0x7fffffff):
cdef int l cdef int l
cdef char *s = cmappy.mappy_fetch_seq(self._idx, name.encode(), start, end, &l) cdef char *s
if self._idx == NULL: return
s = cmappy.mappy_fetch_seq(self._idx, name.encode(), start, end, &l)
if l == 0: return None if l == 0: return None
r = s[:l] if isinstance(s, str) else s[:l].decode() r = s[:l] if isinstance(s, str) else s[:l].decode()
free(s) free(s)
@@ -176,6 +232,17 @@ cdef class Aligner:
@property @property
def n_seq(self): return self._idx.n_seq def n_seq(self): return self._idx.n_seq
@property
def seq_names(self):
cdef char *p
if self._idx == NULL: return
sn = []
for i in range(self._idx.n_seq):
p = self._idx.seq[i].name
s = p if isinstance(p, str) else p.decode()
sn.append(s)
return sn
def fastx_read(fn, read_comment=False): def fastx_read(fn, read_comment=False):
cdef cmappy.kseq_t *ks cdef cmappy.kseq_t *ks
ks = cmappy.mm_fastx_open(str.encode(fn)) ks = cmappy.mm_fastx_open(str.encode(fn))
+8 -4
View File
@@ -1,10 +1,11 @@
#!/usr/bin/env python #!/usr/bin/env python
import sys, getopt import sys
import getopt
import mappy as mp import mappy as mp
def main(argv): def main(argv):
opts, args = getopt.getopt(argv[1:], "x:n:m:k:w:r:") opts, args = getopt.getopt(argv[1:], "x:n:m:k:w:r:c")
if len(args) < 2: if len(args) < 2:
print("Usage: minimap2.py [options] <ref.fa>|<ref.mmi> <query.fq>") print("Usage: minimap2.py [options] <ref.fa>|<ref.mmi> <query.fq>")
print("Options:") print("Options:")
@@ -14,9 +15,11 @@ def main(argv):
print(" -k INT k-mer length") print(" -k INT k-mer length")
print(" -w INT minimizer window length") print(" -w INT minimizer window length")
print(" -r INT band width") print(" -r INT band width")
print(" -c output the cs tag")
sys.exit(1) sys.exit(1)
preset, min_cnt, min_sc, k, w, bw = None, None, None, None, None, None preset = min_cnt = min_sc = k = w = bw = None
out_cs = False
for opt, arg in opts: for opt, arg in opts:
if opt == '-x': preset = arg if opt == '-x': preset = arg
elif opt == '-n': min_cnt = int(arg) elif opt == '-n': min_cnt = int(arg)
@@ -24,11 +27,12 @@ def main(argv):
elif opt == '-r': bw = int(arg) elif opt == '-r': bw = int(arg)
elif opt == '-k': k = int(arg) elif opt == '-k': k = int(arg)
elif opt == '-w': w = int(arg) elif opt == '-w': w = int(arg)
elif opt == '-c': out_cs = True
a = mp.Aligner(args[0], preset=preset, min_cnt=min_cnt, min_chain_score=min_sc, k=k, w=w, bw=bw) a = mp.Aligner(args[0], preset=preset, min_cnt=min_cnt, min_chain_score=min_sc, k=k, w=w, bw=bw)
if not a: raise Exception("ERROR: failed to load/build index file '{}'".format(args[0])) if not a: raise Exception("ERROR: failed to load/build index file '{}'".format(args[0]))
for name, seq, qual in mp.fastx_read(args[1]): # read one sequence for name, seq, qual in mp.fastx_read(args[1]): # read one sequence
for h in a.map(seq): # traverse hits for h in a.map(seq, cs=out_cs): # traverse hits
print('{}\t{}\t{}'.format(name, len(seq), h)) print('{}\t{}\t{}'.format(name, len(seq), h))
if __name__ == "__main__": if __name__ == "__main__":
+10 -9
View File
@@ -70,10 +70,10 @@ void sdust_buf_destroy(sdust_buf_t *buf)
static inline void shift_window(int t, kdq_t(int) *w, int T, int W, int *L, int *rw, int *rv, int *cw, int *cv) static inline void shift_window(int t, kdq_t(int) *w, int T, int W, int *L, int *rw, int *rv, int *cw, int *cv)
{ {
int s; int s;
if (kdq_size(w) >= W - SD_WLEN + 1) { // TODO: is this right for SD_WLEN!=3? if ((int)kdq_size(w) >= W - SD_WLEN + 1) { // TODO: is this right for SD_WLEN!=3?
s = *kdq_shift(int, w); s = *kdq_shift(int, w);
*rw -= --cw[s]; *rw -= --cw[s];
if (*L > kdq_size(w)) if (*L > (int)kdq_size(w))
--*L, *rv -= --cv[s]; --*L, *rv -= --cv[s];
} }
kdq_push(int, w, t); kdq_push(int, w, t);
@@ -114,7 +114,7 @@ static void find_perfect(void *km, perf_intv_v *P, const kdq_t(int) *w, int T, i
r += c[t]++; r += c[t]++;
new_r = r, new_l = kdq_size(w) - i - 1; new_r = r, new_l = kdq_size(w) - i - 1;
if (new_r * 10 > T * new_l) { if (new_r * 10 > T * new_l) {
for (j = 0; j < P->n && P->a[j].start >= i + start; ++j) { // find insertion position for (j = 0; j < (int)P->n && P->a[j].start >= i + start; ++j) { // find insertion position
perf_intv_t *p = &P->a[j]; perf_intv_t *p = &P->a[j];
if (max_r == 0 || p->r * max_l > max_r * p->l) if (max_r == 0 || p->r * max_l > max_r * p->l)
max_r = p->r, max_l = p->l; max_r = p->r, max_l = p->l;
@@ -177,7 +177,7 @@ uint64_t *sdust(void *km, const uint8_t *seq, int l_seq, int T, int W, int *n)
#ifdef _SDUST_MAIN #ifdef _SDUST_MAIN
#include <zlib.h> #include <zlib.h>
#include <stdio.h> #include <stdio.h>
#include "getopt.h" #include "ketopt.h"
#include "kseq.h" #include "kseq.h"
KSEQ_INIT(gzFile, gzread) KSEQ_INIT(gzFile, gzread)
@@ -186,16 +186,17 @@ int main(int argc, char *argv[])
gzFile fp; gzFile fp;
kseq_t *ks; kseq_t *ks;
int W = 64, T = 20, c; int W = 64, T = 20, c;
ketopt_t o = KETOPT_INIT;
while ((c = getopt(argc, argv, "w:t:")) >= 0) { while ((c = ketopt(&o, argc, argv, 1, "w:t:", 0)) >= 0) {
if (c == 'w') W = atoi(optarg); if (c == 'w') W = atoi(o.arg);
else if (c == 't') T = atoi(optarg); else if (c == 't') T = atoi(o.arg);
} }
if (optind == argc) { if (o.ind == argc) {
fprintf(stderr, "Usage: sdust [-w %d] [-t %d] <in.fa>\n", W, T); fprintf(stderr, "Usage: sdust [-w %d] [-t %d] <in.fa>\n", W, T);
return 1; return 1;
} }
fp = strcmp(argv[optind], "-")? gzopen(argv[optind], "r") : gzdopen(fileno(stdin), "r"); fp = strcmp(argv[o.ind], "-")? gzopen(argv[o.ind], "r") : gzdopen(fileno(stdin), "r");
ks = kseq_init(fp); ks = kseq_init(fp);
while (kseq_read(ks) >= 0) { while (kseq_read(ks) >= 0) {
uint64_t *r; uint64_t *r;
+106
View File
@@ -0,0 +1,106 @@
#include "mmpriv.h"
#include "kalloc.h"
#include "ksort.h"
mm_seed_t *mm_seed_collect_all(void *km, const mm_idx_t *mi, const mm128_v *mv, int32_t *n_m_)
{
mm_seed_t *m;
size_t i;
int32_t k;
m = (mm_seed_t*)kmalloc(km, mv->n * sizeof(mm_seed_t));
for (i = k = 0; i < mv->n; ++i) {
const uint64_t *cr;
mm_seed_t *q;
mm128_t *p = &mv->a[i];
uint32_t q_pos = (uint32_t)p->y, q_span = p->x & 0xff;
int t;
cr = mm_idx_get(mi, p->x>>8, &t);
if (t == 0) continue;
q = &m[k++];
q->q_pos = q_pos, q->q_span = q_span, q->cr = cr, q->n = t, q->seg_id = p->y >> 32;
q->is_tandem = q->flt = 0;
if (i > 0 && p->x>>8 == mv->a[i - 1].x>>8) q->is_tandem = 1;
if (i < mv->n - 1 && p->x>>8 == mv->a[i + 1].x>>8) q->is_tandem = 1;
}
*n_m_ = k;
return m;
}
#define MAX_MAX_HIGH_OCC 128
void mm_seed_select(int32_t n, mm_seed_t *a, int len, int max_occ, int max_max_occ, int dist)
{ // for high-occ minimizers, choose up to max_high_occ in each high-occ streak
extern void ks_heapdown_uint64_t(size_t i, size_t n, uint64_t*);
extern void ks_heapmake_uint64_t(size_t n, uint64_t*);
int32_t i, last0, m;
uint64_t b[MAX_MAX_HIGH_OCC]; // this is to avoid a heap allocation
if (n == 0 || n == 1) return;
for (i = m = 0; i < n; ++i)
if (a[i].n > max_occ) ++m;
if (m == 0) return; // no high-frequency k-mers; do nothing
for (i = 0, last0 = -1; i <= n; ++i) {
if (i == n || a[i].n <= max_occ) {
if (i - last0 > 1) {
int32_t ps = last0 < 0? 0 : (uint32_t)a[last0].q_pos>>1;
int32_t pe = i == n? len : (uint32_t)a[i].q_pos>>1;
int32_t j, k, st = last0 + 1, en = i;
int32_t max_high_occ = (int32_t)((double)(pe - ps) / dist + .499);
if (max_high_occ > 0) {
if (max_high_occ > MAX_MAX_HIGH_OCC)
max_high_occ = MAX_MAX_HIGH_OCC;
for (j = st, k = 0; j < en && k < max_high_occ; ++j, ++k)
b[k] = (uint64_t)a[j].n<<32 | j;
ks_heapmake_uint64_t(k, b); // initialize the binomial heap
for (; j < en; ++j) { // if there are more, choose top max_high_occ
if (a[j].n < (int32_t)(b[0]>>32)) { // then update the heap
b[0] = (uint64_t)a[j].n<<32 | j;
ks_heapdown_uint64_t(0, k, b);
}
}
for (j = 0; j < k; ++j) a[(uint32_t)b[j]].flt = 1;
}
for (j = st; j < en; ++j) a[j].flt ^= 1;
for (j = st; j < en; ++j)
if (a[j].n > max_max_occ)
a[j].flt = 1;
}
last0 = i;
}
}
}
mm_seed_t *mm_collect_matches(void *km, int *_n_m, int qlen, int max_occ, int max_max_occ, int dist, const mm_idx_t *mi, const mm128_v *mv, int64_t *n_a, int *rep_len, int *n_mini_pos, uint64_t **mini_pos)
{
int rep_st = 0, rep_en = 0, n_m, n_m0;
size_t i;
mm_seed_t *m;
*n_mini_pos = 0;
*mini_pos = (uint64_t*)kmalloc(km, mv->n * sizeof(uint64_t));
m = mm_seed_collect_all(km, mi, mv, &n_m0);
if (dist > 0 && max_max_occ > max_occ) {
mm_seed_select(n_m0, m, qlen, max_occ, max_max_occ, dist);
} else {
for (i = 0; i < n_m0; ++i)
if (m[i].n > max_occ)
m[i].flt = 1;
}
for (i = 0, n_m = 0, *rep_len = 0, *n_a = 0; i < n_m0; ++i) {
mm_seed_t *q = &m[i];
//fprintf(stderr, "X\t%d\t%d\t%d\n", q->q_pos>>1, q->n, q->flt);
if (q->flt) {
int en = (q->q_pos >> 1) + 1, st = en - q->q_span;
if (st > rep_en) {
*rep_len += rep_en - rep_st;
rep_st = st, rep_en = en;
} else rep_en = en;
} else {
*n_a += q->n;
(*mini_pos)[(*n_mini_pos)++] = (uint64_t)q->q_span<<32 | q->q_pos>>1;
m[n_m++] = *q;
}
}
*rep_len += rep_en - rep_st;
*_n_m = n_m;
return m;
}
+16 -16
View File
@@ -4,26 +4,26 @@ except ImportError:
from distutils.core import setup from distutils.core import setup
from distutils.extension import Extension from distutils.extension import Extension
cmdclass = {} import sys, platform
try:
from Cython.Build import build_ext
except ImportError: # without Cython
module_src = 'python/mappy.c'
else: # with Cython
module_src = 'python/mappy.pyx'
cmdclass['build_ext'] = build_ext
import sys
sys.path.append('python') sys.path.append('python')
extra_compile_args = ['-DHAVE_KALLOC']
include_dirs = ["."]
if platform.machine() in ["aarch64", "arm64"]:
include_dirs.append("sse2neon/")
extra_compile_args.extend(['-ftree-vectorize', '-DKSW_SSE2_ONLY', '-D__SSE2__'])
else:
extra_compile_args.append('-msse4.1') # WARNING: ancient x86_64 CPUs don't have SSE4
def readme(): def readme():
with open('python/README.rst') as f: with open('python/README.rst') as f:
return f.read() return f.read()
setup( setup(
name = 'mappy', name = 'mappy',
version = '2.9', version = '2.22',
url = 'https://github.com/lh3/minimap2', url = 'https://github.com/lh3/minimap2',
description = 'Minimap2 python binding', description = 'Minimap2 python binding',
long_description = readme(), long_description = readme(),
@@ -33,14 +33,14 @@ setup(
keywords = 'sequence-alignment', keywords = 'sequence-alignment',
scripts = ['python/minimap2.py'], scripts = ['python/minimap2.py'],
ext_modules = [Extension('mappy', ext_modules = [Extension('mappy',
sources = [module_src, 'align.c', 'bseq.c', 'chain.c', 'format.c', 'hit.c', 'index.c', 'pe.c', 'options.c', sources = ['python/mappy.pyx', 'align.c', 'bseq.c', 'lchain.c', 'seed.c', 'format.c', 'hit.c', 'index.c', 'pe.c', 'options.c',
'ksw2_extd2_sse.c', 'ksw2_exts2_sse.c', 'ksw2_extz2_sse.c', 'ksw2_ll_sse.c', 'ksw2_extd2_sse.c', 'ksw2_exts2_sse.c', 'ksw2_extz2_sse.c', 'ksw2_ll_sse.c',
'kalloc.c', 'kthread.c', 'map.c', 'misc.c', 'sdust.c', 'sketch.c', 'esterr.c'], 'kalloc.c', 'kthread.c', 'map.c', 'misc.c', 'sdust.c', 'sketch.c', 'esterr.c', 'splitidx.c'],
depends = ['minimap.h', 'bseq.h', 'kalloc.h', 'kdq.h', 'khash.h', 'kseq.h', 'ksort.h', depends = ['minimap.h', 'bseq.h', 'kalloc.h', 'kdq.h', 'khash.h', 'kseq.h', 'ksort.h',
'ksw2.h', 'kthread.h', 'kvec.h', 'mmpriv.h', 'sdust.h', 'ksw2.h', 'kthread.h', 'kvec.h', 'mmpriv.h', 'sdust.h',
'python/cmappy.h', 'python/cmappy.pxd'], 'python/cmappy.h', 'python/cmappy.pxd'],
extra_compile_args = ['-DHAVE_KALLOC', '-msse4'], # WARNING: ancient x86_64 CPUs don't have SSE4 extra_compile_args = extra_compile_args,
include_dirs = ['.'], include_dirs = include_dirs,
libraries = ['z', 'm', 'pthread'])], libraries = ['z', 'm', 'pthread'])],
classifiers = [ classifiers = [
'Development Status :: 5 - Production/Stable', 'Development Status :: 5 - Production/Stable',
@@ -52,4 +52,4 @@ setup(
'Programming Language :: Python :: 3', 'Programming Language :: Python :: 3',
'Intended Audience :: Science/Research', 'Intended Audience :: Science/Research',
'Topic :: Scientific/Engineering :: Bio-Informatics'], 'Topic :: Scientific/Engineering :: Bio-Informatics'],
cmdclass = cmdclass) setup_requires=["cython"])
+84
View File
@@ -0,0 +1,84 @@
#include <string.h>
#include <assert.h>
#include <stdlib.h>
#include <stdio.h>
#include <errno.h>
#include "mmpriv.h"
FILE *mm_split_init(const char *prefix, const mm_idx_t *mi)
{
char *fn;
FILE *fp;
uint32_t i, k = mi->k;
fn = (char*)calloc(strlen(prefix) + 10, 1);
sprintf(fn, "%s.%.4d.tmp", prefix, mi->index);
if ((fp = fopen(fn, "wb")) == NULL) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m failed to write to temporary file '%s'\033[0m: %s\n", fn, strerror(errno));
exit(1);
}
mm_err_fwrite(&k, 4, 1, fp);
mm_err_fwrite(&mi->n_seq, 4, 1, fp);
for (i = 0; i < mi->n_seq; ++i) {
uint32_t l;
l = strlen(mi->seq[i].name);
mm_err_fwrite(&l, 1, 4, fp);
mm_err_fwrite(mi->seq[i].name, 1, l, fp);
mm_err_fwrite(&mi->seq[i].len, 4, 1, fp);
}
free(fn);
return fp;
}
mm_idx_t *mm_split_merge_prep(const char *prefix, int n_splits, FILE **fp, uint32_t *n_seq_part)
{
mm_idx_t *mi = 0;
char *fn;
int i, j;
if (n_splits < 1) return 0;
fn = CALLOC(char, strlen(prefix) + 10);
for (i = 0; i < n_splits; ++i) {
sprintf(fn, "%s.%.4d.tmp", prefix, i);
if ((fp[i] = fopen(fn, "rb")) == 0) {
if (mm_verbose >= 1)
fprintf(stderr, "ERROR: failed to open temporary file '%s': %s\n", fn, strerror(errno));
for (j = 0; j < i; ++j)
fclose(fp[j]);
free(fn);
return 0;
}
}
free(fn);
mi = CALLOC(mm_idx_t, 1);
for (i = 0; i < n_splits; ++i) {
mm_err_fread(&mi->k, 4, 1, fp[i]); // TODO: check if k is all the same
mm_err_fread(&n_seq_part[i], 4, 1, fp[i]);
mi->n_seq += n_seq_part[i];
}
mi->seq = CALLOC(mm_idx_seq_t, mi->n_seq);
for (i = j = 0; i < n_splits; ++i) {
uint32_t k;
for (k = 0; k < n_seq_part[i]; ++k, ++j) {
uint32_t l;
mm_err_fread(&l, 1, 4, fp[i]);
mi->seq[j].name = (char*)calloc(l + 1, 1);
mm_err_fread(mi->seq[j].name, 1, l, fp[i]);
mm_err_fread(&mi->seq[j].len, 4, 1, fp[i]);
}
}
return mi;
}
void mm_split_rm_tmp(const char *prefix, int n_splits)
{
int i;
char *fn;
fn = CALLOC(char, strlen(prefix) + 10);
for (i = 0; i < n_splits; ++i) {
sprintf(fn, "%s.%.4d.tmp", prefix, i);
remove(fn);
}
free(fn);
}
+1 -1
View File
@@ -1,4 +1,4 @@
>MT_orang >MT_orang co:Z:comment
GTTTATGTAGCTTATTCTATCCAAAGCAATGCACTGAAAATGTCTCGACGGGCCCACACG GTTTATGTAGCTTATTCTATCCAAAGCAATGCACTGAAAATGTCTCGACGGGCCCACACG
CCCCATAAACAAATAGGTTTGGTCCTAGCCTTTCTATTAGCTCTTAGTGAGGTTACACAT CCCCATAAACAAATAGGTTTGGTCCTAGCCTTTCTATTAGCTCTTAGTGAGGTTACACAT
GCAAGCATCCCCGCCCCAGTGAGTCGCCCTCCAAGTCACTCTGACTAAGAGGAGCAAGCA GCAAGCATCCCCGCCCCAGTGAGTCGCCCTCCAAGTCACTCTGACTAAGAGGAGCAAGCA
+127 -15
View File
@@ -61,13 +61,6 @@
Volume = {32}, Volume = {32},
Year = {2016}} Year = {2016}}
@misc{Suzuki:2016,
title = {Fast and accurate alignment tool for PacBio and Nanopore long reads},
author = {Hajime Suzuki},
journal = {Unpublished},
howpublished = {\href{https://github.com/ocxtal/minialign}{https://github.com/ocxtal/minialign}},
year = {2016}}
@misc{Ruan:2016, @misc{Ruan:2016,
title = {Ultra-fast de novo assembler using long noisy reads}, title = {Ultra-fast de novo assembler using long noisy reads},
author = {Jue Ruan}, author = {Jue Ruan},
@@ -172,14 +165,6 @@
Volume = {29}, Volume = {29},
Year = {2011}} Year = {2011}}
@article {Suzuki130633,
author = {Suzuki, Hajime and Kasahara, Masahiro},
title = {Acceleration Of Nucleotide Semi-Global Alignment With Adaptive Banded Dynamic Programming},
year = {2017},
note = {doi:10.1101/130633},
publisher = {Cold Spring Harbor Labs Journals},
journal = {bioRxiv}}
@article{Gotoh:1982aa, @article{Gotoh:1982aa,
Author = {Gotoh, O}, Author = {Gotoh, O},
Journal = {J Mol Biol}, Journal = {J Mol Biol},
@@ -337,3 +322,130 @@
Title = {{MUMmer4}: A fast and versatile genome alignment system}, Title = {{MUMmer4}: A fast and versatile genome alignment system},
Volume = {14}, Volume = {14},
Year = {2018}} Year = {2018}}
@article{Li:2009ys,
Author = {Li, Heng and others},
Journal = {Bioinformatics},
Pages = {2078-9},
Title = {The {Sequence Alignment/Map format and SAMtools}},
Volume = {25},
Year = {2009}}
@article{Suzuki:2018aa,
Author = {Suzuki, Hajime and Kasahara, Masahiro},
Journal = {BMC Bioinformatics},
Pages = {45},
Title = {Introducing difference recurrence relations for faster semi-global alignment of long sequences},
Volume = {19},
Year = {2018}}
@article{Li:2018ab,
Author = {Li, Heng},
Journal = {Bioinformatics},
Pages = {3094-3100},
Title = {Minimap2: pairwise alignment for nucleotide sequences},
Volume = {34},
Year = {2018}}
@article{Jain:2020aa,
Author = {Jain, Chirag and others},
Journal = {Bioinformatics},
Pages = {i111-i118},
Title = {Weighted minimizer sampling improves long read mapping},
Volume = {36},
Year = {2020}}
@article{Miga:2020aa,
Author = {Miga, Karen H and others},
Journal = {Nature},
Pages = {79-84},
Title = {Telomere-to-telomere assembly of a complete human {X} chromosome},
Volume = {585},
Year = {2020}}
@article {Jain2020.11.01.363887,
author = {Jain, Chirag and others},
title = {A long read mapping method for highly repetitive reference sequences},
elocation-id = {2020.11.01.363887},
year = {2020},
doi = {10.1101/2020.11.01.363887},
publisher = {Cold Spring Harbor Laboratory},
abstract = {About 5-10\% of the human genome remains inaccessible for functional analysis due to the presence of repetitive sequences such as segmental duplications and tandem repeat arrays. To enable high-quality resequencing of personal genomes, it is crucial to support end-to-end genome variant discovery using repeat-aware read mapping methods. In this study, we highlight the fact that existing long read mappers often yield incorrect alignments and variant calls within long, near-identical repeats, as they remain vulnerable to allelic bias. In the presence of a non-reference allele within a repeat, a read sampled from that region could be mapped to an incorrect repeat copy because the standard pairwise sequence alignment scoring system penalizes true variants.To address the above problem, we propose a novel, long read mapping method that addresses allelic bias by making use of minimal confidently alignable substrings (MCASs). MCASs are formulated as minimal length substrings of a read that have unique alignments to a reference locus with sufficient mapping confidence (i.e., a mapping quality score above a user-specified threshold). This approach treats each read mapping as a collection of confident sub-alignments, which is more tolerant of structural variation and more sensitive to paralog-specific variants (PSVs) within repeats. We mathematically define MCASs and discuss an exact algorithm as well as a practical heuristic to compute them. The proposed method, referred to as Winnowmap2, is evaluated using simulated as well as real long read benchmarks using the recently completed gapless assemblies of human chromosomes X and 8 as a reference. We show that Winnowmap2 successfully addresses the issue of allelic bias, enabling more accurate downstream variant calls in repetitive sequences. As an example, using simulated PacBio HiFi reads and structural variants in chromosome 8, Winnowmap2 alignments achieved the lowest false-negative and false-positive rates (1.89\%, 1.89\%) for calling structural variants within near-identical repeats compared to minimap2 (39.62\%, 5.88\%) and NGMLR (56.60\%, 36.11\%) respectively.Winnowmap2 code is accessible at https://github.com/marbl/WinnowmapCompeting Interest StatementThe authors have declared no competing interest.},
URL = {https://www.biorxiv.org/content/early/2020/11/02/2020.11.01.363887},
eprint = {https://www.biorxiv.org/content/early/2020/11/02/2020.11.01.363887.full.pdf},
journal = {bioRxiv}
}
@article{Li:2020aa,
Author = {Li, Heng and others},
Journal = {Genome Biol},
Pages = {265},
Title = {The design and construction of reference pangenome graphs with minigraph},
Volume = {21},
Year = {2020}}
@article{Ren:2021aa,
Author = {Ren, Jingwen and Chaisson, Mark J P},
Journal = {PLoS Comput Biol},
Pages = {e1009078},
Title = {lra: A long read aligner for sequences and contigs},
Volume = {17},
Year = {2021}}
@inproceedings{DBLP:conf/wabi/AbouelhodaO03,
Author = {Mohamed Ibrahim Abouelhoda and Enno Ohlebusch},
Booktitle = {Algorithms in Bioinformatics, Third International Workshop, {WABI} 2003, Budapest, Hungary, September 15-20, 2003, Proceedings},
Crossref = {DBLP:conf/wabi/2003},
Pages = {1--16},
Title = {A Local Chaining Algorithm and Its Applications in Comparative Genomics},
Year = {2003}}
@article{Ono:2021aa,
Author = {Ono, Yukiteru and others},
Journal = {Bioinformatics},
Pages = {589-595},
Title = {{PBSIM2}: a simulator for long-read sequencers with a novel generative model of quality scores},
Volume = {37},
Year = {2021}}
@article{Sedlazeck:2018ab,
Author = {Sedlazeck, Fritz J and others},
Journal = {Nat Methods},
Pages = {461-468},
Title = {Accurate detection of complex structural variations using single-molecule sequencing},
Volume = {15},
Year = {2018}}
@article{Jeffares:2017aa,
Author = {Jeffares, Daniel C and others},
Journal = {Nat Commun},
Pages = {14061},
Title = {Transient structural variations have strong effects on quantitative traits and reproductive isolation in fission yeast},
Volume = {8},
Year = {2017}}
@article{Zook:2020aa,
Author = {Zook, Justin M and others},
Journal = {Nat Biotechnol},
Pages = {1347-1355},
Title = {A robust benchmark for detection of germline large deletions and insertions},
Volume = {38},
Year = {2020}}
@article{Harpak:2017aa,
Author = {Harpak, Arbel and others},
Journal = {Proc Natl Acad Sci U S A},
Pages = {12779-12784},
Title = {Frequent nonallelic gene conversion on the human lineage and its effect on the divergence of gene duplicates},
Volume = {114},
Year = {2017}}
@article{Li:2018aa,
Author = {Li, Heng and others},
Journal = {Nat Methods},
Month = {Aug},
Number = {8},
Pages = {595-597},
Title = {A synthetic-diploid benchmark for accurate variant-calling evaluation},
Volume = {15},
Year = {2018}}
+23 -16
View File
@@ -19,7 +19,7 @@
\begin{document} \begin{document}
\firstpage{1} \firstpage{1}
\title[Aligning nucleotide sequences with minimap2]{Minimap2: versatile pairwise alignment for nucleotide sequences} \title[Aligning nucleotide sequences with minimap2]{Minimap2: pairwise alignment for nucleotide sequences}
\author[Li]{Heng Li} \author[Li]{Heng Li}
\address{Broad Institute, 415 Main Street, Cambridge, MA 02142, USA} \address{Broad Institute, 415 Main Street, Cambridge, MA 02142, USA}
@@ -64,7 +64,7 @@ the thought that 10kb long sequences should be easier to map than 100bp reads
because we can more effectively skip repetitive regions, which are often the because we can more effectively skip repetitive regions, which are often the
bottleneck of short-read alignment. We confirmed our speculation by achieving bottleneck of short-read alignment. We confirmed our speculation by achieving
approximate mapping 50 times faster than BWA-MEM~\citep{Li:2016aa}. approximate mapping 50 times faster than BWA-MEM~\citep{Li:2016aa}.
\citet{Suzuki130633} extended our work with a fast and novel algorithm on \citet{Suzuki:2018aa} extended our work with a fast and novel algorithm on
generating base-level alignment, which in turn inspired us to develop minimap2 generating base-level alignment, which in turn inspired us to develop minimap2
with added functionality. with added functionality.
@@ -88,7 +88,9 @@ the versatility of minimap2.
Minimap2 follows a typical seed-chain-align procedure as is used by most Minimap2 follows a typical seed-chain-align procedure as is used by most
full-genome aligners. It collects minimizers~\citep{Roberts:2004fv} of the full-genome aligners. It collects minimizers~\citep{Roberts:2004fv} of the
reference sequences and indexes them in a hash table. Then for each query reference sequences and indexes them in a hash table, with the key being the
hash of a minimizer and the value being a list of locations of the minimizer
copies. Then for each query
sequence, minimap2 takes query minimizers as \emph{seeds}, finds exact matches sequence, minimap2 takes query minimizers as \emph{seeds}, finds exact matches
(i.e. \emph{anchors}) to the reference, and identifies sets of colinear anchors as (i.e. \emph{anchors}) to the reference, and identifies sets of colinear anchors as
\emph{chains}. If base-level alignment is requested, minimap2 applies dynamic \emph{chains}. If base-level alignment is requested, minimap2 applies dynamic
@@ -118,9 +120,12 @@ distance between two anchors is too large); otherwise
\begin{equation}\label{eq:chain-gap} \begin{equation}\label{eq:chain-gap}
\beta(j,i)=\gamma_c\big((y_i-y_j)-(x_i-x_j)\big) \beta(j,i)=\gamma_c\big((y_i-y_j)-(x_i-x_j)\big)
\end{equation} \end{equation}
In implementation, a gap of length $l\not=0$ costs In implementation, a gap of length $l$ costs
\[ \[
\gamma_c(l)=0.01\cdot \bar{w}\cdot|l|+0.5\log_2|l| \gamma_c(l)=\left\{\begin{array}{ll}
0.01\cdot \bar{w}\cdot|l|+0.5\log_2|l| & (l\not=0) \\
0 & (l=0)
\end{array}\right.
\] \]
where $\bar{w}$ is the average seed length. For $N$ anchors, directly computing all $f(\cdot)$ with where $\bar{w}$ is the average seed length. For $N$ anchors, directly computing all $f(\cdot)$ with
Eq.~(\ref{eq:chain}) takes $O(N^2)$ time. Although theoretically faster Eq.~(\ref{eq:chain}) takes $O(N^2)$ time. Although theoretically faster
@@ -164,7 +169,7 @@ empirical formula:
\[ \[
{\rm mapQ}=40\cdot (1-f_2/f_1)\cdot\min\{1,m/10\}\cdot\log f_1 {\rm mapQ}=40\cdot (1-f_2/f_1)\cdot\min\{1,m/10\}\cdot\log f_1
\] \]
where $m$ is the number of anchors on the primary chain, $f_1$ is the chaining where $\log$ denotes natural logarithm, $m$ is the number of anchors on the primary chain, $f_1$ is the chaining
score, and $f_2\le f_1$ is the score of the best chain that is secondary to the score, and $f_2\le f_1$ is the score of the best chain that is secondary to the
primary chain. Intuitively, a chain is assigned to a higher mapping quality if primary chain. Intuitively, a chain is assigned to a higher mapping quality if
it is long and its best secondary chain is weak. it is long and its best secondary chain is weak.
@@ -253,7 +258,7 @@ performance of minimap2. Traditional SSE implementations~\citep{Farrar:2007hs}
based on Eq.~(\ref{eq:ae86}) can achieve 16-way parallelization for short based on Eq.~(\ref{eq:ae86}) can achieve 16-way parallelization for short
sequences, but only 4-way parallelization when the peak alignment score reaches sequences, but only 4-way parallelization when the peak alignment score reaches
32767. Long sequence alignment may exceed this threshold. Inspired by 32767. Long sequence alignment may exceed this threshold. Inspired by
\citet{Wu:1996aa} and the following work, \citet{Suzuki130633} proposed a \citet{Wu:1996aa} and the following work, \citet{Suzuki:2018aa} proposed a
difference-based formulation that lifted this limitation. difference-based formulation that lifted this limitation.
In case of 2-piece gap cost, define In case of 2-piece gap cost, define
\[ \[
@@ -320,7 +325,7 @@ y_{rt}&=&\max\{0,y_{r-1,t}+u_{r-1,t}-z_{rt}+q\}-q-e\\
\end{equation*} \end{equation*}
In this formulation, cells with the same diagonal index $r$ are independent of In this formulation, cells with the same diagonal index $r$ are independent of
each other. This allows us to fully vectorize the computation of all cells on each other. This allows us to fully vectorize the computation of all cells on
the same anti-diagonal in one inner loop. It also simplifies banded alignment, the same anti-diagonal in one inner loop. It also simplifies banded alignment (500bp band width by default),
which would be difficult with striped vectorization~\citep{Farrar:2007hs}. which would be difficult with striped vectorization~\citep{Farrar:2007hs}.
On the condition that $q+e<\tilde{q}+\tilde{e}$ and $e>\tilde{e}$, the initial On the condition that $q+e<\tilde{q}+\tilde{e}$ and $e>\tilde{e}$, the initial
@@ -355,7 +360,7 @@ times as fast as Parasail's 4-way vectorization~\citep{Daily:2016aa}. Without
banding, our implementation is slower than Edlib~\citep{Sosic:2017aa}, but with banding, our implementation is slower than Edlib~\citep{Sosic:2017aa}, but with
a 1000bp band, it is considerably faster. When performing global alignment a 1000bp band, it is considerably faster. When performing global alignment
between anchors, we expect the alignment to stay close to the diagonal of the between anchors, we expect the alignment to stay close to the diagonal of the
DP matrix. Banding is applicable most of time. DP matrix. Banding is applicable most of the time.
\subsubsection{The Z-drop heuristic} \subsubsection{The Z-drop heuristic}
@@ -478,7 +483,7 @@ both C and Python. It is distributed under the MIT license, free to both
commercial and academic uses. Minimap2 uses the same base algorithm for all commercial and academic uses. Minimap2 uses the same base algorithm for all
applications, but it has to apply different sets of parameters depending on applications, but it has to apply different sets of parameters depending on
input data types. Similar to BWA-MEM, minimap2 introduces `presets' that input data types. Similar to BWA-MEM, minimap2 introduces `presets' that
modify multiple parameters with a simple invokation. Detailed settings modify multiple parameters with a simple invocation. Detailed settings
and command-line options can be found in the minimap2 manpage. In addition to and command-line options can be found in the minimap2 manpage. In addition to
the applications evaluated in the following sections, minimap2 also retains the applications evaluated in the following sections, minimap2 also retains
minimap's functionality to find overlaps between long reads and to search minimap's functionality to find overlaps between long reads and to search
@@ -570,7 +575,7 @@ Peak RAM (GByte) & 8.9 & 14.5 & 3.2 & 29.2\vspace{1em}\\
\% approx. introns & 91.8\% & 96.9\% & 92.5\% & 82.4\% \\ \% approx. introns & 91.8\% & 96.9\% & 92.5\% & 82.4\% \\
\botrule \botrule
\end{tabular} \end{tabular}
}{Mouse reads (AC:SRR5286960; R9.4 chemistry) were mapped to the primary assembly of mouse }{Mouse cDNA reads (AC:SRR5286960; R9.4 chemistry) were mapped to the primary assembly of mouse
genome GRCm38 with the following tools and command options: minimap2 (`-ax genome GRCm38 with the following tools and command options: minimap2 (`-ax
splice'); GMAP (`-n 0 --min-intronlength 30 --cross-species'); SpAln (`-Q7 -LS splice'); GMAP (`-n 0 --min-intronlength 30 --cross-species'); SpAln (`-Q7 -LS
-S3'); STARlong (according to -S3'); STARlong (according to
@@ -579,7 +584,7 @@ compared to the EnsEMBL gene annotation, release 89. A predicted intron
is \emph{novel} if it has no overlaps with any annotated introns. An intron is \emph{novel} if it has no overlaps with any annotated introns. An intron
is \emph{exact} if it is identical to an annotated intron. An intron is is \emph{exact} if it is identical to an annotated intron. An intron is
\emph{approximate} if both its 5'- and 3'-end are within 10bp around the ends \emph{approximate} if both its 5'- and 3'-end are within 10bp around the ends
of an annotated intron.} of an annotated intron. Chimeric alignments are defined in the SAM spec~\citep{Li:2009ys}.}
\end{table} \end{table}
We next aligned real mouse reads~\citep{Byrne:2017aa} with GMAP~(v2017-06-20; We next aligned real mouse reads~\citep{Byrne:2017aa} with GMAP~(v2017-06-20;
@@ -647,9 +652,9 @@ across the whole genome and have been \emph{de novo} assembled with SMRT reads
to high quality. This allowed us to construct an independent truth variant to high quality. This allowed us to construct an independent truth variant
dataset~\citep{Li223297} for dataset~\citep{Li223297} for
ERR1341796. In this evaluation, minimap2 has higher SNP false negative rate ERR1341796. In this evaluation, minimap2 has higher SNP false negative rate
(FNR; 2.5\% of minimap2 vs 2.2\% of BWA-MEM), but fewer false positive SNPs per (FNR; 2.6\% of minimap2 vs 2.3\% of BWA-MEM), but fewer false positive SNPs per
million bases (FPPM; 3.0 vs 3.9), lower 2--50bp INDEL FNR (7.3\% vs 7.5\%) and million bases (FPPM; 7.0 vs 8.8), similar INDEL FNR (11.2\% vs 11.3\%) and
similar INDEL FPPM (both 1.0). Minimap2 is broadly similar to BWA-MEM in the similar INDEL FPPM (6.4 vs 6.5). Minimap2 is broadly comparable to BWA-MEM in the
context of small variant calling. context of small variant calling.
\subsection{Aligning long-read assemblies} \subsection{Aligning long-read assemblies}
@@ -687,7 +692,7 @@ involving $>$100kb introns, which was impractically slow ten years ago. The
minimap2 chaining algorithm is fast and highly accurate by itself. In fact, minimap2 chaining algorithm is fast and highly accurate by itself. In fact,
chaining alone is more accurate than all the other long-read mappers in chaining alone is more accurate than all the other long-read mappers in
Fig.~\ref{fig:eval}a (data not shown). This accuracy helps to reduce downstream Fig.~\ref{fig:eval}a (data not shown). This accuracy helps to reduce downstream
base-level alignment of candidate chains, which is still times slower than base-level alignment of candidate chains, which is still several times slower than
chaining even with the Suzuki-Kasahara improvement. In addition, taking a chaining even with the Suzuki-Kasahara improvement. In addition, taking a
general form, minimap2 chaining can be adapted to non-typical data types such as general form, minimap2 chaining can be adapted to non-typical data types such as
spliced reads and multiple reads per fragment. This gives us the opportunity to spliced reads and multiple reads per fragment. This gives us the opportunity to
@@ -712,6 +717,8 @@ Schatz, P. Rescheneder and F. Sedlazeck for pointing out the limitation of
BWA-MEM. We are also grateful to minimap2 users who have greatly helped to BWA-MEM. We are also grateful to minimap2 users who have greatly helped to
suggest features and to fix various issues. suggest features and to fix various issues.
\paragraph{Funding\textcolon} NHGRI 1R01HG010040-01
\bibliography{minimap2} \bibliography{minimap2}
\end{document} \end{document}
+225
View File
@@ -0,0 +1,225 @@
\documentclass{bioinfo}
\copyrightyear{2021}
\pubyear{2021}
\usepackage{graphicx}
\usepackage{hyperref}
\usepackage{url}
\usepackage{amsmath}
\usepackage[ruled,vlined]{algorithm2e}
\newcommand\mycommfont[1]{\footnotesize\rmfamily{\it #1}}
\SetCommentSty{mycommfont}
\SetKwComment{Comment}{$\triangleright$\ }{}
\usepackage{natbib}
\bibliographystyle{apalike}
\DeclareMathOperator*{\argmax}{argmax}
\begin{document}
\firstpage{1}
\title[Improvements to minimap2]{New strategies to improve minimap2 alignment accuracy}
\author[Li]{Heng Li$^{1,2}$}
\address{$^1$Dana-Farber Cancer Institute, 450 Brookline Ave, Boston, MA 02215, USA,
$^2$Harvard Medical School, 10 Shattuck St, Boston, MA 02215, USA}
\maketitle
\begin{abstract}
\section{Summary:} We present several recent improvements to minimap2, a
versatile pairwise aligner for nucleotide sequences. Now minimap2 v2.22 can
more accurately map long reads to highly repetitive regions and align through
insertions or deletions up to 100kb by default, addressing major weakness in
minimap2 v2.18 or earlier.
\section{Availability and implementation:}
\href{https://github.com/lh3/minimap2}{https://github.com/lh3/minimap2}
\section{Contact:} hli@ds.dfci.harvard.edu
\end{abstract}
\section{Introduction}
Minimap2~\citep{Li:2018ab} is widely used for maping long sequence
reads and assembly contigs. \citet{Jain:2020aa} found minimap2 v2.18 or earlier occasionally
misaligned reads from highly repetitive regions as minimap2 ignored seeds of
high occurrence. They also noticed minimap2 may misplace reads with structural
variations (SVs) in such regions~\citep{Jain2020.11.01.363887}. These
misalignments have become a pressing issue in the advent of
temolere-to-telomore human assembly~\citep{Miga:2020aa}. Meanwhile, old minimap2
was unable to efficiently align long insertions/deletions (INDELs) and often
breaks an alignment around variable-number tandem repeats (VNTRs). This has
inspired new chaining algorithms~\citep{Li:2020aa,Ren:2021aa} which are not
integrated into minimap2. Here we will describe recent efforts implemented
in v2.19 through v2.22 to improve mapping results.
\begin{methods}
\section{Methods}
\subsection{Rescuing high-occurrence $k$-mers}
Minimap2 keeps all $k$-mer minimizers during indexing. Its original
implementation only selected low-occurrence minimizers during mapping. The
cutoff is a few hundred for mapping long reads against a human genome. If a
read habors only a few or even no low-occurrence minimizers, it will fail
chaining due to insufficient anchors.
To resolve this issue, we implemented a new heuristic to add additional
minimizers. Suppose we are looking at two adjacent low-occurence $k$-mers
located at position $x_1$ and $x_2$, respectively. If $|x_1-x_2|\ge500$,
minimap2 v2.22 additionally selects $\lfloor|x_1-x_2|/500\rfloor$ minimizers
of the lowest occurrence among minimizers between $x_1$ and $x_2$.
We use a binary heap data
structure to select minimizers of the lowest occurrence in this interval.
This strategy adds necessary anchors at the cost of increasing total alignment
time by a few percent on real data.
\subsection{Aligning through longer INDELs}
The original minimap2 may fail to align long INDELs due to its chaining
heuristics. Briefly, minimap2 applies dynamic programming (DP) to chain
minimizer anchors. This is a quadratic algorithm, which is slow for chaining
contigs. For acceptable performance, the original minimap2 uses a 500bp band by
default. If there is an INDEL longer than 500bp and the two chains around the INDEL
have no overlaps on either the query or the reference sequence, minimap2 may
join the two short chains later at a later step. We call it the
long-join heuristic. This heuristic may fail around VNTRs because short chains
often have overlaps in VNTRs. More subtly, minimap2 may escape the inner DP
loop early, again for performance, if the chaining result is not improved for
50 iterations. When there is a copy number change in a long segmental
duplication, the early escape may break around the event even if users
specify a large band.
In minigraph~\citep{Li:2020aa}, we developed a new chaining algorithm that
finds short INDELs with DP-based chaining and goes through long INDELs with a
subquadratic algorithm~\citep{DBLP:conf/wabi/AbouelhodaO03}. We ported the same
algorithm to minimap2 for contig mapping. For long-read mapping, the minigraph
algorithm is slower. Minimap2 v2.22 now still uses the DP-based algorithm to
find short chains and then invokes the minigraph algorithm to rechain anchors in
these short chains. The rechaining step achieves the same goal as long-join
but is more reliable as it can resolve overlaps between short chains. The old
long-join heuristic has since been removed.
\subsection{Properly mapping long reads with SVs}
The original minimap2 ranks an alignment by its Smith-Waterman score and
outputs the best scoring alignment. However, when there are SVs on the read,
the best scoring alignment is sometimes not the correct alignment.
\citet{Jain2020.11.01.363887} resolved this dilemma by altering the mapping
algorithm.
In our view, this problem is rooted in impropriate scoring: affine-gap penalty
over-penalizes a long INDEL that was often evolutionarily created in one event.
We should not penalize a SV linearly in its length. Minimap2 v2.22 rescores
an alignment with the following scoring function. Suppose an alignment consists
of $M$ matching bases, $N$ substitutions and $G$ gap opens, we empirically
score the alignment with
$$
M-\frac{N+G}{2d}-\sum_{i=1}^G\log_2(1+g_i)
$$
where $g_i\ge1$ is the length of the $i$-th gap and
$$
d=\max\left\{\frac{N+G}{M+N+G},0.02\right\}
$$
Here $d$ approximates per-base sequence divergence with the smallest value set
to 2\%. As an analogy to affine-gap scoring, the matching score in our scheme
is 1, the mismatch and gap open penalties are both $1/2d$ and the gap extension
penalty is a logarithm function of the gap length. Our scoring gives a long SV
a much milder penalty. In terms of time complexity, scoring an alignment is
linear in the length of the alignment. Time spent on rescoring is negligible in
practice.
%If we assume sequences evolve under a duplication-mutation model, we may have a
%better way to choose the best alignment. If a long read can be mapped to $n$
%loci, we can take the read as the template and build a
%pseudo-multi-sequence-alignment (pMSA) of $n+1$ sequences. In this pMSA, we say
%a site on the read is informative if the $n$ reference subsequences differ at
%the position.
\end{methods}
\section{Results}
\begin{table}
\processtable{Evaluation of minimap2 v2.22}
{\footnotesize\label{tab:1}\begin{tabular}{p{4.2cm}rrrr}
\toprule
$[$Benchmark$]$ Metric & v2.22 & v2.18 & Winno & lra \\
\midrule
$[$sim-map$]$ \% mapped reads at Q10 & 97.9 & 97.6 & {\bf 99.0} & 97.3 \\
$[$sim-map$]$ err. rate at Q10 (phredQ) & {\bf 52} & {\bf 52} & 38 & 24 \\
$[$winno-cmp$]$ rate of diff. (phredQ) & {\bf 41} & 37 & N/A & 18 \\
$[$sim-sv$]$ \% false negative rate & {\bf 0.5} & 2.0 & {\bf 0.5} & 1.4 \\
$[$sim-sv$]$ \% false discovery rate & {\bf 0.0} & 0.1 & {\bf 0.0} & 0.1 \\
$[$real-sv-1k$]$ \% false negative rate & {\bf 7.3} & 20.0 & 13.0 & N/A \\
$[$real-sv-1k$]$ \% false discovery rate & 2.7 & {\bf 2.4} & 2.7 & N/A \\
\botrule
\end{tabular}}
{In $[$sim-map$]$, 152,713 reads were simulated from the CHM13 telomere-to-telomere assembly v1.1
(AC: GCA\_009914755.3) with pbsim2~\citep{Ono:2021aa}: ``pbsim2 -{}-hmm\_model R94.model -{}-length-min
5000 -{}-length-mean 20000 -{}-accuracy-mean 0.95''. Alignments of mapping quality
10 or higher were evaluated by ``paftools.js mapeval''. The mapping error rate
is measured in the phred scale: if the error rate is $e$, $-10\log_{10}e$ is
reported in the table. In $[$winno-cmp$]$, 1.39 million CHM13 HiFi reads from
SRR11292121 were mapped against CHM13. 99.3\% of them were mapped by Winnowmap2
at mapping quality 10 or higher and were taken as ground truth to evaluate
minimap2 and lra with ``paftools.js pafcmp''. $[$sim-sv$]$ simulated 1,000
50bp to 1000bp INDELs from chr8 in CHM13 using SURVIVOR~\citep{Jeffares:2017aa} and simulated Nanopore
reads at 30 folds with the same pbsim2 command line. SVs were called with
``sniffles -q 10''~\citep{Sedlazeck:2018ab} and compared to the simulated truth with ``SURVIVOR eval
call.vcf truth.bed 50''. In $[$real-sv-1k$]$, small and long variants were
called by dipcall-0.3~\citep{Li:2018aa} for HG002 assemblies (AC: GCA\_018852605.1 and
GCA\_018852615.1) and compared to the GIAB truth~\citep{Zook:2020aa} using ``truvari -r 2000 -s
1000 -S 400 -{}-multimatch -{}-passonly'' which sets the minimum INDEL size to 1kb in evaluation. }
\end{table}
We evaluated minimap2 v2.22 along with v2.18, Winnowmap2 v2.03 and lra v1.3.2
(Table~\ref{tab:1}). Both versions of minimap2 achieved high mapping accuracy on
simulated Nanopore reads (sim-map). Winnowmap2 aligned more reads at mapping
quality 10 or higher (mapQ10). However, it may occasionally assign a high mapping
quality to a read with multiple identical best alignments. This reduced its
mapping accuracy.
In lack of groud truth for real data, so we took Winnowmap2 mapping as ground
truth to evaluate other mappers (winno-cmp). Out of 1,378,092 reads with mapQ10
alignments by Winnowmap2, minimap2 v2.22 could map all of them. 118 reads, less
than 0.01\% of all reads, were mapped differently by v2.22. 51 of them have
multiple identical best alignments. We believe these are more likely to be
Winnowmap2 errors. Most of the remaining 67 (=118-51) reads have multiple
highly similar but not identical alignments. We are not sure what are real
mapping errors.
The two benchmarks above only evaluate read mappings without variations.
To measure the mapping accuracy in the presence of SVs (sim-sv), we reproduced
the results by~\citep{Jain2020.11.01.363887}. Minimap2 v2.22 is as good as
Winnowmap2 now. Note that we were setting the Sniffles mapping quality
threshold to 10 in consistent with the benchmarks above. If we used the
default threshold 20, v2.22 would miss additional 0.5\% SVs, suggesting
minimap2 v2.22 could map variant reads correctly but with conservative mapping
quality. This observation is more about the interaction between mappers and
callers. Furthermore, the simulation here only considers a simple scenario in
evolution. Non-allelic gene conversions, which happen often in segmental
duplications~\citep{Harpak:2017aa}, would obscure the optimal mapping
strategies. How much such simple SV simulation informs real-world SV calling
remains a question.
To see if minimap2 v2.22 could improve long INDEL alignment, we ran dipcall on
contig-to-reference alignments and focused on INDELs longer than 1kb
(real-sv-1k). v2.22 is more sensitive at comparable specificity, confirming its
advantage in more contiguous alignment. lra is supposed to handle long INDELs
better, too. However, we could not get lra to work well with dipcall, so did
not report the numbers.
Minimap2 spends most computing time on base alignment. As recent improvements
in v2.22 incur little additional computing and do not change the base alignment
algorithm, the new version has similar performance to older verions. It is
consistently faster than Winnowmap2 by several times. Sometimes simple
heuristics can be as effective as more sophisticated yet slower solutions.
\section*{Acknowledgements}
We thank Arang Rhie and Chirag Jain for providing motivating examples where
older minimap2 underperforms.
\paragraph{Funding\textcolon} This work is funded by NHGRI grant R01HG010040.
\bibliography{minimap2}
\end{document}