Compare commits

..
185 Commits
Author SHA1 Message Date
Heng Li 79c9cc186b Release minimap2-2.30 (r1287) 2025-06-15 17:54:11 -04:00
Heng Li ea4c8935bd added one more example
This shows STAR doesn't try to match the GTR..YAG consensus.
2025-06-03 20:22:14 -04:00
Heng Li 3187782b1a r1285: better --spsc support 2025-05-26 15:47:14 -04:00
Heng Li 005c9a1f6b exoneval may skip terminal exons in aa mode 2025-05-17 23:06:41 -04:00
Heng Li 1fd85be6e2 Release minimap2-2.29 (r1283) 2025-04-18 13:41:47 -04:00
Heng Li e616b0dacf drafted the release notes 2025-04-18 13:17:13 -04:00
Heng Li b58b97423a r1281: with --write-junc, ignore aln with low mapQ 2025-04-17 21:46:54 -04:00
Heng Li df9e650346 r1280: heuristic to avoid aligning full introns
This speeds up alignment a lot
2025-04-16 23:38:39 -04:00
Heng Li 7a540c37ca r1278: reduced --min-dp-len to 20 for splice:sr
30% reduced time at 0.01% more junction errors
2025-04-16 21:55:59 -04:00
Heng Li c19e3ccb86 r1277: don't apply rescored filtering with -P
Since v2.19-ish, minimap2 rescores base alignment based on the best alignment
of a read. This heuristic sometimes improve the mapping accuracy of the best
alignment but may too aggressively filter weaker hits.

Resolve #969
2025-04-14 22:26:47 -04:00
Heng Li 94d171b01e r1276: skip unnecessary reverse spliced alignment
for short-read RNA-seq only
2025-04-14 14:57:23 -04:00
Heng Li ff312a2957 documented 2-pass in README 2025-04-13 17:14:44 -04:00
Heng Li 01ccedd5a0 r1275: renamed --jump-pass1 to --pass1
Also documented 2-pass
2025-04-13 17:07:39 -04:00
Heng Li 819b3bf017 r1274: a little better pass-1
Also fixed a bug in jump
2025-04-13 13:55:15 -04:00
Heng Li e88110463a r1273: reading pass1 junctions works
but we need extra logic when using them. Tomorrow.
2025-04-13 00:47:28 -04:00
Heng Li fb81e150f2 r1272: support pass-1 junction processing
NOT tested yet
2025-04-12 23:15:04 -04:00
Heng Li d930ea94ad r1271: code refactoring in prep for 2-pass 2025-04-11 17:20:34 -04:00
Heng Li a832a42f6f r1270: fixed ts tag for PE reads
this also fixed the wrong --write-junc
2025-04-11 01:08:16 -04:00
Heng Li a5411fc3c0 r1269: added --write-junc
in preparation for 2-pass
2025-04-11 01:00:15 -04:00
Heng Li bd03d975fc r1268: avoid extra small introns 2025-04-07 23:32:56 -04:00
Heng Li 9c3c4b1ce8 r1267: penalize introns without signals 2025-04-07 09:51:33 -04:00
Heng Li 3542a3d153 r1266: fine tune mapq for short RNA-seq reads 2025-04-07 00:57:39 -04:00
Heng Li 75619c7b51 r1265: prefer spliced alignment
mapq needs to be elevated
2025-04-07 00:31:04 -04:00
Heng Li fbb9c0fcba r1264: added --jump-min-match, default to 3
To match STAR
2025-04-06 23:18:55 -04:00
Heng Li af094640e5 r1263: ~5-10% performance improvement
Via larger batches and more short-read heuristics. Identical alignment on 2
million reads. Short DNA-seq read alignment may be improved in corner cases.
2025-04-06 20:48:55 -04:00
Heng Li d43f356ef9 fixed minor grammar issues 2025-04-06 18:35:46 -04:00
Heng Li 38acd6617f r1261: code clean up; renamed --jump-bed to -j
Also added --pairing to replace --no-pairing and --pe-ind-chain
2025-04-06 18:32:58 -04:00
Heng Li 3d351267a0 document --jump-bed 2025-04-06 17:43:11 -04:00
Heng Li 54a4718c9b r1259: --jump-bed now functional 2025-04-06 17:12:49 -04:00
Heng Li dbc12b2838 r1258: update blen, mlen and dp_max0 2025-04-06 15:26:01 -04:00
Heng Li 2ed264db4e r1257: fixed the sorting of BED files 2025-04-06 10:53:16 -04:00
Heng Li a8094ad859 r1256: working for one example, but still buggy 2025-04-06 10:33:57 -04:00
Heng Li 1877818239 r1255: moved jump code to a separate file 2025-04-06 09:33:51 -04:00
Heng Li 9ede5c4255 backup 2025-04-06 00:07:15 -04:00
Heng Li 405511fe8d Merge branch 'master' into junc-jump 2025-04-04 16:37:39 -04:00
Heng Li dd90d9dde6 caution that the splice:sr is experimental 2025-04-04 16:34:40 -04:00
Heng Li a8c567b5e9 r1251: read junctions for jumps 2025-04-04 16:23:19 -04:00
Heng Li d9d3c0cc3f refactored --junc-bed 2025-04-03 21:02:50 -04:00
Heng Li cbe8d61ca4 r1249: remove redundant junctions in --junc-bed 2025-04-03 20:43:06 -04:00
Heng Li 9d06cef13e r1248: support --end-bonus in splice mode
but this is not enabled by default for now
2025-04-02 21:39:41 -04:00
Heng Li 924fc4d671 minor 2025-04-02 13:06:03 -04:00
Heng Li fc2d1e95b3 document splice:sr in README 2025-04-02 11:24:44 -04:00
Heng Li bbf0bb871b r1245: allow shorter hits for splice:sr 2025-04-02 00:13:37 -04:00
Heng Li 83e9b2e28c r1242: append /[12] to read name in --frag mode
Resolve #1079
2025-04-01 10:48:15 -04:00
Heng Li e816fd071c r1241: error out on unintended --score-N
Resolve #1226
2025-04-01 10:12:53 -04:00
Heng Li a955b1f31d documented zd; resolve #1108 2025-04-01 09:34:05 -04:00
Heng Li 54fa925e2e r1240: fixed wrong logging information
resolve #1192
2025-04-01 09:17:39 -04:00
Heng Li d4a396c5c3 r1239: resovled #963 2025-03-31 23:15:34 -04:00
Heng Li bdf46f5786 r1238: resolve #589 2025-03-31 23:08:37 -04:00
Heng Li f536b69b81 r1237: documented -x splice:sr 2025-03-30 21:47:47 -04:00
Heng Li 4b8b4418df r1236: support paired-end short-read RNA-seq 2025-03-30 19:30:19 -04:00
Heng Li ce30004e02 r1235: allow --splice and --frag at the same time
This seems to largely work, though the accuracy is reduced and no pairs are
proper. More investigation needed for practical uses.
2025-03-30 16:32:38 -04:00
Heng Li 54f8e5f7d6 r1234: added splice:sr for SE RNA-seq 2025-03-30 15:54:12 -04:00
Heng Li 2857de7dbd Merge remote-tracking branch 'remotes/origin/master' 2025-03-29 22:44:26 -04:00
Heng Li e18935fbad r1230: make juncevla work for paired-end SAM 2025-03-29 22:43:44 -04:00
Chang Y 74ebfb2532 fix error (#1223) 2025-03-21 18:21:15 -04:00
Martin Grigorov a0cbe2e4d2 Add CI job for Linux & Mac ARM64 too (#1205)
* Add CI job for Linux ARM64 too

Signed-off-by: Martin Tzvetanov Grigorov <mgrigorov@apache.org>

* Add build job for Mac ARM64 too

Signed-off-by: Martin Tzvetanov Grigorov <mgrigorov@apache.org>

* Pass "arm_neon=1 aarch64=1" when building on ARM64

Signed-off-by: Martin Tzvetanov Grigorov <mgrigorov@apache.org>

* change aarch64 to arm64 for the Mac ARM64 check

Signed-off-by: Martin Tzvetanov Grigorov <mgrigorov@apache.org>

---------

Signed-off-by: Martin Tzvetanov Grigorov <mgrigorov@apache.org>
2025-03-21 18:19:26 -04:00
Heng Li 618d33515e more condition on length differences 2024-11-17 19:45:46 -05:00
Heng Li a10d4f4496 merge colinear blocks 2024-11-17 15:17:13 -05:00
Heng Li 1eea2fee11 a new script to cluster similar sequences 2024-11-16 16:39:13 -05:00
Heng Li 1d346d56bc Merge remote-tracking branch 'remotes/origin/master' 2024-11-16 16:36:07 -05:00
Heng Li 46750de966 not working well and rarely used in practice 2024-11-16 16:35:24 -05:00
Leon Rauschning 7d8bbb74a8 Add sc_ambi and max_chain_skip parameters to mappy.pyx (#1240)
* add sc_ambi option to cython interface

* add max_gaplen param

* set max_chain_skip to arg instead of forcing 255
2024-11-15 08:56:36 -05:00
James Webber c6db201b38 Update README.md (#1245)
fixed documentation for paftools
2024-11-15 08:54:25 -05:00
Rob PatroandRob Patro 358a39850f Allow passing read name to mappy (#1260)
* Allow passing read name to mappy

This adds the (optional) ability to pass the read
name to the mappy `map` method.  Without the
read name, the call to `map` can sometimes give
different output than the command line version
of `minimap2` because of the way minimap uses
the hash of the read name to break ties in ordering
hits.  This can affect which / if certain
supplementary alignments are generated, and even
which / if non-primary alignments are generated.

* Pass name directly to mm_map_aux

Get rid of additional function, and always
accept the name parameter in the mm_map_aux
function (can be nullptr if not available).

---------

Co-authored-by: Rob Patro <rob@newton>
2024-11-15 08:51:10 -05:00
Heng Li fcb5d5e6eb r1221: warn about file reading errors
Resolves #1229
2024-10-15 22:44:06 -04:00
Heng Li 95807a2224 added "junc_pen" to python accordingly 2024-10-13 23:58:33 -04:00
Heng Li a4c93e9377 support X and = in mapeval 2024-10-12 23:31:17 -04:00
Heng Li 7d69334e69 Merge remote-tracking branch 'remotes/origin/master' 2024-10-12 23:28:38 -04:00
Heng Li 3e1ab2951d document --spsc 2024-10-12 23:27:46 -04:00
Heng Li 68179ed195 r1215: scoring apparently works 2024-10-12 22:29:27 -04:00
Heng Li d1f4c8d232 implemented ksw scoring; not tested 2024-10-11 23:58:18 -04:00
Heng Li 8efe83b744 fill the junction array
modifying ksw will be the next
2024-10-11 23:22:23 -04:00
Heng Li 042c8d4d71 added --junc-pen; it does nothing for now 2024-10-11 21:27:25 -04:00
Heng Li e4e1f7843b backup for spsc 2024-10-10 22:43:50 -04:00
Marcus Fedarko 69e3629916 Mention in man page that CIGAR strings in SA tags are approximate (#1213)
* Mention approx CIGAR strings in man page #724

* Fix FAQ typo
2024-05-22 15:58:33 -04:00
Heng Li 0cc3cdca27 ignore filtered SVs in sveval 2024-04-07 17:12:31 -04:00
Heng Li 8170693de3 Release minimap2-2.28 (r1209) 2024-03-27 10:57:17 -04:00
Heng Li e3d8c708ac r1208: reverted RMQ gap coefficient
Such that minimap2 can give the same alignment in other modes
2024-03-27 08:48:10 -04:00
Heng Li 119bdc6029 r1207: reduced cap_kalloc from 1G to 500M
This reduces the peak memory.
2024-03-20 15:53:12 -04:00
Heng Li 89d4d219cd r1206: enabled RMQ for lr:hqae
Also fixed a bug in determining inner_dist for RMQ. It should have no effect on
previous presets.
2024-03-20 15:29:54 -04:00
Heng Li f51ff1abac r1205: updated lr:hqae 2024-03-20 14:06:59 -04:00
Heng Li 27b254ed6f backup; DON'T USE!!! 2024-03-20 10:21:10 -04:00
Heng Li c881b14ba5 r1203: added preset lr:hqae 2024-03-20 00:25:57 -04:00
Heng Li f18dadb1c4 r1202: halved RMQ gap cost 2024-03-19 23:47:54 -04:00
Heng Li a83b8fe7cc r1201: renamed --dbg-seed-freq to --dbg-seed-occ 2024-03-19 21:53:09 -04:00
Heng Li c22bfe7722 r1200: added --rmq-inner and --dbg-seed-freq 2024-03-19 21:52:07 -04:00
Heng Li 12d441ea22 Merge remote-tracking branch 'origin/master' 2024-03-19 21:47:52 -04:00
Heng Li c7433c2811 r1197: sam2paf to output primary only 2024-03-19 21:47:31 -04:00
Joyjit Daw 5279377544 Fix MD generation check in SAM writing (#1181)
The existing logic checked for is_MD == 1, but
the function is called with a bitwise operator check
which does not evaluate to 1.
2024-03-19 19:20:21 -04:00
Heng Li acab05781e Merge remote-tracking branch 'remotes/origin/master' 2024-03-19 09:56:13 -04:00
Heng Li 98c23bc6d2 r1194: output NM in sam2paf 2024-03-19 09:55:16 -04:00
kojix2 9b0ff2418c Fix mm_mapopt_t in Mappy (#1177)
Add transition. Related to #1069
2024-03-13 22:15:46 -04:00
Heng Li b6762503a9 Release minimap2-2.27 (r1193) 2024-03-12 13:20:07 -04:00
Heng Li 9667468e89 NEWS draft 2024-03-11 22:46:47 -04:00
Heng Li ba60aac6f6 r1191: fixed wrong reverse() and revcomp()
due to k8 incompatibility. Resolves #1161
2024-03-11 22:09:01 -04:00
Heng Li fcd4df2a73 r1190: output unadjusted dp_max to ms:i
This was an oversight affecting v2.22+. The latest minimap2 ranks hits and
estimates mapping quality with an adjusted alignment score (see the minimap2
update paper). This score however is not calculated when there is only one hit.
As a result, the ms:i tag varies depends on other sequences in the reference
genome, which is confusing. This change lets minimap2 to output the unadjusted
score at ms:i. At present, the adjusted score is not outputted.

Resolves #1146
2024-03-11 17:19:13 -04:00
Heng Li 0efc886012 r1189: fixed an out-of-memory issue
Resolves #1166
2024-03-11 10:14:20 -04:00
Heng Li 940388f8e4 r1188: added --ds to output tag ds
Adapted from minigraph
2024-03-10 15:01:13 -04:00
Heng Li 23d2674c39 r1187: set stage for the ds tag; not added yet 2024-03-10 14:12:56 -04:00
Heng Li a12673611f Merge remote-tracking branch 'origin/master' 2024-03-10 13:49:30 -04:00
Heng Li 8140259974 r1183: added lr:hq; fixed transition
* Added the lr:hq preset suggested by Nanopore developers (#1127)
 * Fixed transition scoring. It did not work with presets.
 * Cleaned up preset documentation
2024-03-10 13:47:34 -04:00
blawrence-ont f3e59fc2a0 Avoid NULL pointer dereference (#1154)
If the allocated region is 0 bytes then it's unsafe to dereference it.

Fixes #1147.
2024-01-24 12:32:05 -05:00
Pesho Ivanov fc2e1607d7 Update paftools.js (#1145)
In mapeval "-Q INT" reports wrong alignments with mapQ>=INT, not with mapQ>INT
2024-01-03 09:06:08 -05:00
Heng Li bc588c0eeb r1182: improved paftools.js compatibility
Older k8/v8 can't use large memory. The previous change read large FASTA as
strings and might have problems. The new change tests k8 version.
2023-10-30 16:37:29 -04:00
Heng Li ab717023b6 reverted to the previous paftools.js 2023-10-30 16:24:18 -04:00
Heng Li 9506e7ac3f r1180: paftools.js call compatibility with k8-1.0 2023-10-28 15:54:37 -04:00
Heng Li ce03fbc275 Merge remote-tracking branch 'remotes/origin/master' 2023-10-24 09:53:51 -04:00
Heng Li 98a3aa1b39 document --secondary-seq in manpage
Resolve #1122
2023-10-24 09:52:39 -04:00
Donaim ae05f8485f Add bw_long option to mappy's Aligner class (#1124)
The Minimap2 behavior was found to handle sequences with large
deletions differently when upgraded from v2.17 to v2.26, causing
potential issues in projects mapping extensive deletions of ~1200 base
pairs. The originally suggested solution of setting `-r 500,500` was
observed to be partially non-applicable since the Python Wrapper,
`mappy`, only allowed manipulation of parameter `bw`.

In response to issue #1111, where this was originally reported,
this commit introduces a modification in the Python wrapper,
`mappy`. Until now, `mappy` only allowed manipulation of the `bw`
parameter, preventing the suggested fix of setting `-r 500,500`.

This commit introduces a modification in the Python wrapper to include
the `bw_long` option in the `Aligner` class. Consequently, both
parameters `bw` and `bw_long` can be manipulated, thereby allowing the
desired Minimap2 behavior encountered in version 2.17. As a result,
this patch ensures consistent handling of sequences containing large
deletions irrespective of the version upgrade."

Closes #1111
2023-10-24 09:23:06 -04:00
Aaron Darlingandkoadman ace990c381 Illumina Complete Long Read presets (#1069)
* Implements a transition-aware alignment scoring scheme and configuration presets for ICLR

* Fix to enable use of general scoring matrix in ksw as suggested by lh3

---------

Co-authored-by: koadman <>
2023-06-04 11:06:15 -04:00
Heng Li e28a55be86 Release minimap2-2.26 (r1175) 2023-04-29 12:21:09 -04:00
Heng Li f8d46a7a30 Revert #868 and use the old setup.py 2023-04-29 11:48:41 -04:00
Heng Li 4483f89ee5 Release minimap2-2.25 (r1173) 2023-04-25 12:44:52 -04:00
Heng Li f1b3c7ad06 added -ldl for asan on some linux 2023-04-25 11:14:15 -04:00
Heng Li 180faa3594 r1171: add operator priority explicit with ()
I can never remember the operator priority of & and &&
2023-04-21 11:09:07 -04:00
Mikhail KolmogorovandHeng Li 704fbc6f5c An option to output SEQ field for secondary alignment (#687)
* a new option --secondary-seq to output SEQ field for secondary alignments

* comments removed

* Fixed a conflict in #687

---------

Co-authored-by: Heng Li <lh3@me.com>
2023-04-21 11:06:13 -04:00
Heng Li fc24c8a348 r1169: improved kexpand compatibility 2023-04-21 10:53:23 -04:00
Chris Seymour e68d868806 use updated kalloc macros (#1051)
* use updated kalloc macros

* review

* get the reference

* store the reference

* last one
2023-04-21 10:45:53 -04:00
Alex Payne c3d461e22a mappy check index flags before mapping
mappy creates a CIGAR string by default (`-c` flag) and so is
incompatible with indexes that are created using the `--idx-no-seq`
flag.

The previous implementation of mappy did not check for the `MM_I_NO_SEQ`
flag and would seg fault when attempting to map a read or retrieve a
reference sequence from the index. This patch adds a check to both
`mappy.Aligner.seq` and `mappy.Aligner.map` and returns `None` if there
is no index sequences. I've chose `None` as this is inline with the
behaviour of mappy for reads that do not align/retreiving sequences that
aren't in the index, however it might be better to raise an exception so
that this error is distinct and can be communicated to the caller.
2023-04-19 21:49:58 -04:00
Heng Li c41518ae85 r1166: sync kalloc with miniwfa and miniprot 2023-04-19 21:38:47 -04:00
Chris Seymour 819d843e3c make mm_tbuf_t public 2023-04-19 21:32:23 -04:00
Heng Li 5e7242303c r1164: changed the syntax of -J 2023-04-07 22:54:33 -04:00
Heng Li a026c69b89 r1163: increased the default -I to 8G
To reduce accidental errors when mapping against diploid human assemblies.
2023-04-07 01:22:22 -04:00
Heng Li ea2042a577 r1162: fixed a typo; also increased splice pen
Now slightly better on ISO-seq
2023-04-07 01:19:18 -04:00
Heng Li 1834b1fd42 r1161: merged the simple and complex models 2023-04-06 23:42:50 -04:00
Heng Li 7ced0f16a0 r1160: splice model code cleanup 2023-04-06 23:32:06 -04:00
Heng Li 35732f3025 Merge branch 'master' into splice-model 2023-04-06 21:09:18 -04:00
Alberto Zeni a6fab118c5 Fixed alignment result final update when computing the exact max value 2023-04-06 21:05:24 -04:00
Chris Seymour 6ce0dd8b70 move MM_VERSION define to minimap.h 2023-03-17 20:58:43 +01:00
Nils Homer 1d3c3eef03 Add HD header ilne to SAM output
#905
2023-02-14 09:12:03 -05:00
Heng Li 01b98e8e52 r1155: fixed a bug on parsing --rmq
resolves #1010
2023-01-17 09:09:25 -05:00
Heng Li 16b8d50199 removed debugging code 2023-01-06 11:16:09 -05:00
Heng Li 226fd6114c fixed a wrong comment. Resolves #997 2022-11-30 09:22:39 -05:00
Heng Li 822ccd1733 r1152: evaluate base Sn and Sp 2022-11-01 21:58:45 -04:00
Heng Li f67849c9af r1151: added exoneval 2022-11-01 21:10:35 -04:00
Heng Li b0b199f503 r1150: the prev impl counted one less submer 2022-10-21 21:00:22 -04:00
Heng Li c2f07ff2ac r1149: implemented random open syncmer
On the mm2-update dataset, -j8 leads to sparser k-mer selection at higher
accuracy. The speed becomes a little slower. There seems a benefit but not a
big one.
2022-10-21 19:07:28 -04:00
Heng Li cefd0d9f6c removed -b0 (a typo) 2022-10-21 17:37:04 -04:00
Heng Li 2a319c89aa support ##PAF lines in GFF3 2022-10-07 19:34:25 -04:00
Heng Li 85a5260408 correctly parse ##PAF lines in GFF3 (for miniprot) 2022-10-07 19:33:27 -04:00
Heng Li 6c2cbf7903 miniprot-like splice model
slightly worse on iso-seq and slightly better on direct-RNA
2022-10-06 09:10:17 -04:00
Heng Li 5aa4355ca8 extract junctions from GFF 2022-09-21 12:57:40 -04:00
Heng Li 6ed7263670 junceval for plain junction BED as input 2022-09-10 23:18:08 -04:00
Heng Li 315795eefd skip unmapped lines 2022-09-10 08:48:57 -04:00
Heng Li fc6869a9e8 r1141: junceval to support miniprot output 2022-09-09 16:28:23 -04:00
Heng Li 6252e5e367 sync with tag changes in miniprot 2022-09-09 14:48:17 -04:00
Heng Li 843729df1e output CDS and stop_codon 2022-09-09 12:09:38 -04:00
Heng Li 195c98fa46 output dist from end instead 2022-09-08 23:35:48 -04:00
Heng Li a2e6659d9b output more info 2022-09-08 23:18:13 -04:00
Heng Li e450f161bb added paf2gff 2022-09-08 22:33:21 -04:00
Heng Li 15cade0f06 added longcs2fa 2022-07-18 22:24:48 -04:00
Heng Li 767556b6f0 clarify multi-part index in option -I (#301) 2022-06-13 15:50:15 -04:00
Heng Li 50a26a60a6 option to keep Ensembl_canonical only 2022-05-14 11:18:06 -04:00
Heng Li 31de4fd1bc r1132: document misjoin output
Also additional check of centromeric breakpoints
2022-05-11 21:39:29 -04:00
Heng Li e018caea32 added the second minimap2 paper 2022-03-01 11:05:09 -05:00
Heng Li 7c02742fa8 removed travis CI 2022-03-01 11:01:13 -05:00
Chris Wright a41f5d1eeb Fix indentation 2022-03-01 10:41:01 -05:00
Chris Wright ed3d0eb328 fix undefined variable 2022-03-01 10:41:01 -05:00
Chris Wright e6d166a314 Build mappy via Makefile and libminimap2.a 2022-03-01 10:41:01 -05:00
Heng Li 06fedaadd0 typo on simde 2021-12-26 15:38:06 -05:00
Heng Li fe35e679e9 Release minimap2-2.24 (r1122) 2021-12-26 15:14:54 -05:00
Heng Li e25aa5ee74 r1121: change bw_long to bw if bw is longer
Resolve #852
2021-12-26 14:37:31 -05:00
Heng Li 3bde3450a0 r1121: updated obsolete settings in manpage
Resolve #851
2021-12-26 14:33:14 -05:00
Heng Li 36942ff711 r1119: fixed a typo in the new chaining code
Not affecting v2.23
2021-12-25 12:46:26 -05:00
Heng Li d3a89d34d4 r1118: use -r1k,100k for asm* modes 2021-12-23 20:43:54 -05:00
Heng Li c8f0a35c40 r1117: added --no-hash-name for deterministic 2021-11-24 16:49:48 -05:00
Heng Li fcaadc22b7 r1116: cut long chains at weak points 2021-11-20 19:07:44 -05:00
Heng Li db37fc43a7 r1115: prepare for chain breaking 2021-11-20 13:42:44 -05:00
Heng Li a8f1fa8ea3 r1114: retain more candidate inversion alignments 2021-11-18 21:37:10 -05:00
Heng Li b276772890 r1112: added --print-chains for debugging 2021-11-18 21:26:41 -05:00
Heng Li d0cff3eb36 Release minimap2-2.23 (r1111) 2021-11-18 17:11:48 -05:00
Heng Li ac334639ce r1110: default --cap-kalloc=1g; test more inv
See #816 and #823
2021-10-11 14:45:15 -04:00
Heng Li 546623dcb4 r1109: disable chain_skip_scale by default
Enabling the option slows down alignment, possibly because it fragments chains
in difficult regions.
2021-10-04 21:24:35 -04:00
Heng Li 39bdd45875 r1108: fixed missing inversions for #816 and #806 2021-10-04 16:34:30 -04:00
Heng Li aefa2c0d86 added --chain-skip-scale 2021-10-01 16:58:03 -04:00
Heng Li 7ee62dae1d updated manuscript 2021-10-01 11:42:36 -04:00
Heng Li 05a8a45d44 r1105: avoid long running time occasionally (#771)
Caused by highly repetitive minimizers on a query sequence. The solution is to
filter out these query minimizers.
2021-08-15 19:43:01 -04:00
Heng Li cc14d1afdf fixed typos 2021-08-08 11:18:02 -04:00
Heng Li bb3048b2a0 removed one extra sentence 2021-08-07 16:55:02 -04:00
Heng Li 5113ca2628 improved manuscript 2021-08-07 16:01:15 -04:00
Heng Li 7358a1ead1 Release minimap2-2.22 (r1101) 2021-08-07 11:30:31 -04:00
Heng Li 32f552957e Merge remote-tracking branch 'remotes/origin/master' 2021-08-07 10:40:02 -04:00
Ryan Lim 59488f0271 call mm_idx_destroy at the end of loop to fix memory leak 2021-07-26 18:25:08 -04:00
Jason Stajich 5cc3d2239f missing target object files from Makefile.simde to fix issue #779 2021-07-07 23:07:27 -04:00
44 changed files with 2948 additions and 853 deletions
+50 -3
View File
@@ -7,7 +7,8 @@ on:
pull_request:
jobs:
build:
build-linux-x8664:
name: Linux x86_64
runs-on: ubuntu-latest
strategy:
matrix:
@@ -15,7 +16,53 @@ jobs:
steps:
- name: Checkout minimap2
uses: actions/checkout@v2
uses: actions/checkout@v4
- name: Compile with ${{ matrix.compiler }}
run: make CC=${{ matrix.compiler }}
run: |
make CC=${{ matrix.compiler }}
file minimap2 | grep x86-64
build-linux-aarch64:
name: Linux aarch64
runs-on: ubuntu-latest
strategy:
matrix:
compiler: [gcc]
steps:
- name: Checkout
uses: actions/checkout@v4
- name: Compile with ${{ matrix.compiler }}
uses: uraimo/run-on-arch-action@v2
with:
arch: aarch64
distro: ubuntu22.04
githubToken: ${{ github.token }}
dockerRunArgs: |
--volume "${PWD}:/minimap2"
install: |
apt-get update -q -y
apt-get install -q -y make ${{ matrix.compiler }} zlib1g-dev file
run: |
cd /minimap2
make CC=${{ matrix.compiler }} arm_neon=1 aarch64=1 -j
file minimap2 | grep aarch64
build-mac-arm64:
name: Mac ARM64
runs-on: macos-14
strategy:
matrix:
compiler: [clang]
steps:
- name: Checkout minimap2
uses: actions/checkout@v4
- name: Compile with ${{ matrix.compiler }}
run: |
make CC=${{ matrix.compiler }} arm_neon=1 aarch64=1 -j
file minimap2 | grep arm64
-24
View File
@@ -1,24 +0,0 @@
matrix:
include:
- language: c
compiler: gcc
script: make
- language: c
compiler: clang
script: make
- arch: arm64
language: c
compiler: gcc
script: make arm_neon=1 aarch64=1
- language: python
python: "2.7"
before_install: pip install cython
script: python setup.py build_ext
- language: python
python: "3.5"
before_install: pip install cython
script: python setup.py build_ext
- language: python
python: "3.9"
before_install: pip install cython
script: python setup.py build_ext
+1 -1
View File
@@ -2,7 +2,7 @@
Without `-a`, `-c` or `--cs`, minimap2 only finds *approximate* mapping
locations without detailed base alignment. In particular, the start and end
positions of the alignment are impricise. With one of those options, minimap2
positions of the alignment are imprecise. With one of those options, minimap2
will perform base alignment, which is generally more accurate but is much
slower.
+10 -5
View File
@@ -2,12 +2,16 @@ CFLAGS= -g -Wall -O2 -Wc++-compat #-Wextra
CPPFLAGS= -DHAVE_KALLOC
INCLUDES=
OBJS= kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o options.o index.o \
lchain.o align.o hit.o seed.o map.o format.o pe.o esterr.o splitidx.o \
lchain.o align.o hit.o seed.o jump.o map.o format.o pe.o esterr.o splitidx.o \
ksw2_ll_sse.o
PROG= minimap2
PROG_EXTRA= sdust minimap2-lite
LIBS= -lm -lz -lpthread
ifneq ($(aarch64),)
arm_neon=1
endif
ifeq ($(arm_neon),) # if arm_neon is not defined
ifeq ($(sse2only),) # if sse2only is not defined
OBJS+=ksw2_extz2_sse41.o ksw2_extd2_sse41.o ksw2_exts2_sse41.o ksw2_extz2_sse2.o ksw2_extd2_sse2.o ksw2_exts2_sse2.o ksw2_dispatch.o
@@ -26,12 +30,12 @@ endif
ifneq ($(asan),)
CFLAGS+=-fsanitize=address
LIBS+=-fsanitize=address
LIBS+=-fsanitize=address -ldl
endif
ifneq ($(tsan),)
CFLAGS+=-fsanitize=thread
LIBS+=-fsanitize=thread
LIBS+=-fsanitize=thread -ldl
endif
.PHONY:all extra clean depend
@@ -111,8 +115,9 @@ esterr.o: mmpriv.h minimap.h bseq.h kseq.h
example.o: minimap.h kseq.h
format.o: kalloc.h mmpriv.h minimap.h bseq.h kseq.h
hit.o: mmpriv.h minimap.h bseq.h kseq.h kalloc.h khash.h
index.o: kthread.h bseq.h minimap.h mmpriv.h kseq.h kvec.h kalloc.h khash.h
index.o: ksort.h
index.o: kthread.h bseq.h minimap.h mmpriv.h kseq.h ksw2.h kalloc.h kvec.h
index.o: khash.h ksort.h
jump.o: mmpriv.h minimap.h bseq.h kseq.h
kalloc.o: kalloc.h
ksw2_extd2_sse.o: ksw2.h kalloc.h
ksw2_exts2_sse.o: ksw2.h kalloc.h
+1 -1
View File
@@ -1,7 +1,7 @@
CFLAGS= -g -Wall -O2 -Wc++-compat #-Wextra
CPPFLAGS= -DHAVE_KALLOC -DUSE_SIMDE -DSIMDE_ENABLE_NATIVE_ALIASES
INCLUDES= -Ilib/simde
OBJS= kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o options.o index.o chain.o align.o hit.o map.o format.o pe.o esterr.o splitidx.o \
OBJS= kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o options.o index.o lchain.o align.o hit.o map.o format.o pe.o seed.o esterr.o splitidx.o \
ksw2_extz2_simde.o ksw2_extd2_simde.o ksw2_exts2_simde.o ksw2_ll_simde.o
PROG= minimap2
PROG_EXTRA= sdust minimap2-lite
+226 -1
View File
@@ -1,3 +1,228 @@
Release 2.30-r1287 (15 June 2025)
---------------------------------
Notable changes:
* Improvement: consolidated `--spsc`.
* Deprecation: subcommands `splice2bed`, `gff2bed`, `gff2junc`, `junceval` and
`exoneval` in `paftools.js` are deprecated by minigff. They will remain
indefinitely for backward compatibility.
(2.30: 15 June 2025, r1287)
Release 2.29-r1283 (18 April 2025)
----------------------------------
Notable changes to minimap2:
* New feature: added the `splice:sr` preset for short RNA-seq read alignment.
Users may use `-j` to specify known gene annotation to improve spliced
alignment close to the ends of short reads. Also added `--write-junc` and
`--pass1` for 2-pass short-read RNA-seq alignment.
* Experimental feature: read splice scores from a file specified by `--spsc`
and consider the scores during base alignment. The feature makes it possible
to apply advanced splice models and to improve spliced alignment.
* Change: adjusted the mapping quality calculation for spliced alignment.
* Bugfixes: a) missing overlap alignment when base alignment is requested
(#969); b) incorrect summary information for long genomes (#1192); c)
missing parameter check for `--score-N` (#1226).
* Improvement: a) warn about absent junction files (#1229); b) report an error
if a wrong preset prefixed with "splice" is specified (#589).
Notable changes to mappy:
* Improvement: allow passing read name (#1260)
* Improvement: exposed score for ambiguous bases (#1240)
Minimap2 now supports short/long genomic/RNA-seq read alignment along with
contig alignment and all-vs-all read overlapping. It produces identical genomic
long-read or contig alignment to v2.27. Short genomic read alignment and the
mapping quality of long RNA-seq read alignment may slightly differ in very rare
cases.
(2.29: 18 April 2025, r1283)
Release 2.28-r1209 (27 March 2024)
----------------------------------
Notable changes to minimap2:
* Bugfix: `--MD` was not working properly due to the addition of `--ds` in the
last release (#1181 and #1182).
* New feature: added an experimental preset `lq:hqae` for aligning accurate
long reads back to their assembly. It has been observed that `map-hifi` and
`lr:hq` may produce many wrong alignments around centromeres when accurate
long reads (PacBio HiFi or Nanopore duplex/Q20+) are mapped to a diploid
assembly constructed from them. This new preset produces much more accurate
alignment. It is still experimental and may be subjective to changes in
future.
* Change: reduced the default `--cap-kalloc` to 500m to lower the peak
memory consumption (#855).
Notable changes to mappy:
* Bugfix: mappy option struct was out of sync with minimap2 (#1177).
Minimap2 should output identical alignments to v2.27.
(2.28: 27 March 2024, r1209)
Release 2.27-r1193 (12 March 2024)
----------------------------------
Notable changes to minimap2:
* New feature: added the `lr:hq` preset for accurate long reads at ~1% error
rate. This was suggested by Oxford Nanopore developers (#1127). It is not
clear if this preset also works well for PacBio HiFi reads.
* New feature: added the `map-iclr` preset for Illumina Complete Long Reads
(#1069), provided by Illumina developers.
* New feature: added option `-b` to specify mismatch penalty for base
transitions (i.e. A-to-G or C-to-T changes).
* New feature: added option `--ds` to generate a new `ds:Z` tag that
indicates uncertainty in INDEL positions. It is an extension to `cs`. The
`mgutils-es6.js` script in minigraph parses `ds`.
* Bugfix: avoided a NULL pointer dereference (#1154). This would not have an
effect on most systems but would still be good to fix.
* Bugfix: reverted the value of `ms:i` to pre-2.22 versions (#1146). This was
an oversight. See fcd4df2 for details.
Notable changes to paftools.js and mappy:
* New feature: expose `bw_long` to mappy's Aligner class (#1124).
* Bugfix: fixed several compatibility issues with k8 v1.0 (#1161 and #1166).
Subcommands "call", "pbsim2fq" and "mason2fq" were not working with v1.0.
Minimap2 should output identical alignments to v2.26, except the ms tag.
(2.27: 12 March 2024, r1193)
Release 2.26-r1175 (29 April 2023)
----------------------------------
Fixed the broken Python package. This is the only change.
(2.26: 25 April 2023, r1173)
Release 2.25-r1173 (25 April 2023)
----------------------------------
Notable changes:
* Improvement: use the miniprot splice model for RNA-seq alignment by default.
This model considers non-GT-AG splice sites and leads to slightly higher
(<0.1%) accuracy and sensitivity on real human data.
* Change: increased the default `-I` to `8G` such that minimap2 would create a
uni-part index for a pair of mammalian genomes. This change may increase the
memory for all-vs-all read overlap alignment given large datasets.
* New feature: output the sequences in secondary alignments with option
`--secondary-seq` (#687).
* Bugfix: --rmq was not parsed correctly (#1010)
* Bugfix: possibly incorrect coordinate when applying end bonus to the target
sequence (#1025). This is a ksw2 bug. It does not affect minimap2 as
minimap2 is not using the affected feature.
* Improvement: incorporated several changes for better compatibility with
Windows (#1051) and for minimap2 integration at Oxford Nanopore Technologies
(#1048 and #1033).
* Improvement: output the HD-line in SAM output (#1019).
* Improvement: check minimap2 index file in mappy to prevent segmentation
fault for certain indices (#1008).
For genomic sequences, minimap2 should give identical output to v2.24.
Long-read RNA-seq alignment may occasionally differ from previous versions.
(2.25: 25 April 2023, r1173)
Release 2.24-r1122 (26 December 2021)
-------------------------------------
This release improves alignment around long poorly aligned regions. Older
minimap2 may chain through such regions in rare cases which may result in
missing alignments later. The issue has become worse since the the change of
the chaining algorithm in v2.19. v2.23 implements an incomplete remedy. This
release provides a better solution with a X-drop-like heuristic and by enabling
two-bandwidth chaining in the assembly mode.
(2.24: 26 December 2021, r1122)
Release 2.23-r1111 (18 November 2021)
-------------------------------------
Notable changes:
* Bugfix: fixed missing alignments around long inversions (#806 and #816).
This bug affected v2.19 through v2.22.
* Improvement: avoid extremely long mapping time for pathologic reads with
highly repeated k-mers not in the reference (#771). Use --q-occ-frac=0
to disable the new heuristic.
* Change: use --cap-kalloc=1g by default.
(2.23: 18 November 2021, r1111)
Release 2.22-r1101 (7 August 2021)
----------------------------------
When choosing the best alignment, this release uses logarithm gap penalty and
query-specific mismatch penalty. It improves the sensitivity to long INDELs in
repetitive regions.
Other notable changes:
* Bugfix: fixed an indirect memory leak that may waste a large amount of
memory given highly repetitive reference such as a 16S RNA database (#749).
All versions of minimap2 have this issue.
* New feature: added --cap-kalloc to reduce the peak memory. This option is
not enabled by default but may become the default in future releases.
Known issue:
* Minimap2 may take a long time to map a read (#771). So far it is not clear
if this happens to v2.18 and earlier versions.
(2.22: 7 August 2021, r1101)
Release 2.21-r1071 (6 July 2021)
--------------------------------
@@ -5,7 +230,7 @@ This release fixed a regression in short-read mapping introduced in v2.19
(#776). It also fixed invalid comparisons of uninitialized variables, though
these are harmless (#752). Long-read alignment should be identical to v2.20.
(2.21: 6 July 2021)
(2.21: 6 July 2021, r1071)
+42 -17
View File
@@ -14,13 +14,15 @@ cd minimap2 && make
# use presets (no test data)
./minimap2 -ax map-pb ref.fa pacbio.fq.gz > aln.sam # PacBio CLR genomic reads
./minimap2 -ax map-ont ref.fa ont.fq.gz > aln.sam # Oxford Nanopore genomic reads
./minimap2 -ax map-hifi ref.fa pacbio-ccs.fq.gz > aln.sam # PacBio HiFi/CCS genomic reads (v2.19 or later)
./minimap2 -ax asm20 ref.fa pacbio-ccs.fq.gz > aln.sam # PacBio HiFi/CCS genomic reads (v2.18 or earlier)
./minimap2 -ax map-hifi ref.fa pacbio-ccs.fq.gz > aln.sam # PacBio HiFi/CCS genomic reads (v2.19+)
./minimap2 -ax lr:hq ref.fa ont-Q20.fq.gz > aln.sam # Nanopore Q20 genomic reads (v2.27+)
./minimap2 -ax sr ref.fa read1.fa read2.fa > aln.sam # short genomic paired-end reads
./minimap2 -ax splice ref.fa rna-reads.fa > aln.sam # spliced long reads (strand unknown)
./minimap2 -ax splice -uf -k14 ref.fa reads.fa > aln.sam # noisy Nanopore Direct RNA-seq
./minimap2 -ax splice:hq -uf ref.fa query.fa > aln.sam # Final PacBio Iso-seq or traditional cDNA
./minimap2 -ax splice --junc-bed anno.bed12 ref.fa query.fa > aln.sam # prioritize on annotated junctions
./minimap2 -ax splice -uf -k14 ref.fa reads.fa > aln.sam # noisy Nanopore direct RNA-seq
./minimap2 -ax splice:hq -uf ref.fa query.fa > aln.sam # PacBio Kinnex/Iso-seq (RNA-seq)
./minimap2 -ax splice --junc-bed=anno.bed12 ref.fa query.fa > aln.sam # use annotated junctions
./minimap2 -ax splice:sr ref.fa r1.fq r2.fq > aln.sam # short-read RNA-seq (v2.29+)
./minimap2 -ax splice:sr -j anno.bed12 ref.fa r1.fq r2.fq > aln.sam
./minimap2 -cx asm5 asm1.fa asm2.fa > aln.paf # intra-species asm-to-asm alignment
./minimap2 -x ava-pb reads.fa reads.fa > overlaps.paf # PacBio read overlap
./minimap2 -x ava-ont reads.fa reads.fa > overlaps.paf # Nanopore read overlap
@@ -38,7 +40,8 @@ man ./minimap2.1
- [Map long noisy genomic reads](#map-long-genomic)
- [Map long mRNA/cDNA reads](#map-long-splice)
- [Find overlaps between long reads](#long-overlap)
- [Map short accurate genomic reads](#short-genomic)
- [Map short genomic reads](#short-genomic)
- [Map short RNA-seq reads](#short-rna-seq)
- [Full genome/assembly alignment](#full-genome)
- [Advanced features](#advanced)
- [Working with >65535 CIGAR operations](#long-cigar)
@@ -74,8 +77,8 @@ Detailed evaluations are available from the [minimap2 paper][doi] or the
Minimap2 is optimized for x86-64 CPUs. You can acquire precompiled binaries from
the [release page][release] with:
```sh
curl -L https://github.com/lh3/minimap2/releases/download/v2.21/minimap2-2.21_x64-linux.tar.bz2 | tar -jxvf -
./minimap2-2.21_x64-linux/minimap2
curl -L https://github.com/lh3/minimap2/releases/download/v2.30/minimap2-2.30_x64-linux.tar.bz2 | tar -jxvf -
./minimap2-2.30_x64-linux/minimap2
```
If you want to compile from the source, you need to have a C compiler, GNU make
and zlib development files installed. Then type `make` in the source code
@@ -139,12 +142,15 @@ parameters at the same time. The default setting is the same as `map-ont`.
```sh
minimap2 -ax map-pb ref.fa pacbio-reads.fq > aln.sam # for PacBio CLR reads
minimap2 -ax map-ont ref.fa ont-reads.fq > aln.sam # for Oxford Nanopore reads
minimap2 -ax map-iclr ref.fa iclr-reads.fq > aln.sam # for Illumina Complete Long Reads
```
The difference between `map-pb` and `map-ont` is that `map-pb` uses
homopolymer-compressed (HPC) minimizers as seeds, while `map-ont` uses ordinary
minimizers as seeds. Emperical evaluation suggests HPC minimizers improve
minimizers as seeds. Empirical evaluation suggests HPC minimizers improve
performance and sensitivity when aligning PacBio CLR reads, but hurt when aligning
Nanopore reads.
Nanopore reads. `map-iclr` uses an adjusted alignment scoring matrix that
accounts for the low overall error rate in the reads, with transversion errors
being less frequent than transitions.
#### <a name="map-long-splice"></a>Map long mRNA/cDNA reads
@@ -168,9 +174,8 @@ or the last exons.
Minimap2 rates an alignment by the score of the max-scoring sub-segment,
*excluding* introns, and marks the best alignment as primary in SAM. When a
spliced gene also has unspliced pseudogenes, minimap2 does not intentionally
prefer spliced alignment, though in practice it more often marks the spliced
alignment as the primary. By default, minimap2 outputs up to five secondary
spliced gene also has unspliced pseudogenes, minimap2 slightly prefers
the spliced alignment. By default, minimap2 outputs up to five secondary
alignments (i.e. likely pseudogenes in the context of RNA-seq mapping). This
can be tuned with option **-N**.
@@ -201,6 +206,10 @@ bonus score (tuned by `--junc-bonus`) if an aligned junction matches a junction
in the annotation. Option `--junc-bed` also takes 5-column BED, including the
strand field. In this case, each line indicates an oriented junction.
**Note:** `--junc-bed` is intended for long noisy RNA-seq reads only.
Applying the option to short RNA-seq reads would increase run time with little
improvement to junction accuracy.
#### <a name="long-overlap"></a>Find overlaps between long reads
```sh
@@ -213,7 +222,7 @@ the overlapping mode because it is slow and may produce false positive
overlaps. However, if performance is not a concern, you may try to add `-a` or
`-c` anyway.
#### <a name="short-genomic"></a>Map short accurate genomic reads
#### <a name="short-genomic"></a>Map short genomic reads
```sh
minimap2 -ax sr ref.fa reads-se.fq > aln.sam # single-end alignment
@@ -226,8 +235,18 @@ be paired if they are adjacent in the input stream and have the same name (with
the `/[0-9]` suffix trimmed if present). Single- and paired-end reads can be
mixed.
Minimap2 does not work well with short spliced reads. There are many capable
RNA-seq mappers for short reads.
#### <a name="short-rna-seq"></a>Map short RNA-seq reads
```sh
minimap2 -ax splice:sr ref.fa reads-se.fq.gz > aln.sam # single-end
minimap2 -ax splice:sr ref.fa r1.fq.gz r2.fq.gz > aln.sam # paired-end
minimap2 -ax splice:sr -j anno.bed ref.fa r1.fq r2.fq > aln.sam # use annotation
# 2-pass alignment
minimap2 -x splice:sr -j anno.bed --write-junc ref.fa r1.fq r2.fq > junc.bed
minimap2 -ax splice:sr -j anno.bed --pass1=junc.bed ref.fa r1.fq r2.fq > aln.sam
```
The new preset `splice:sr` was added in v2.29. It functions similarly to `sr`
except that it performs spliced alignment.
#### <a name="full-genome"></a>Full genome/assembly alignment
@@ -350,6 +369,11 @@ If you use minimap2 in your work, please cite:
> Li, H. (2018). Minimap2: pairwise alignment for nucleotide sequences.
> *Bioinformatics*, **34**:3094-3100. [doi:10.1093/bioinformatics/bty191][doi]
and/or:
> Li, H. (2021). New strategies to improve minimap2 alignment accuracy.
> *Bioinformatics*, **37**:4572-4574. [doi:10.1093/bioinformatics/btab705][doi2]
## <a name="dguide"></a>Developers' Guide
Minimap2 is not only a command line tool, but also a programming library.
@@ -399,5 +423,6 @@ mappy` or [from BioConda][mappyconda] via `conda install -c bioconda mappy`.
[manpage]: https://lh3.github.io/minimap2/minimap2.html
[manpage-cs]: https://lh3.github.io/minimap2/minimap2.html#10
[doi]: https://doi.org/10.1093/bioinformatics/bty191
[smide]: https://github.com/nemequ/simde
[doi2]: https://doi.org/10.1093/bioinformatics/btab705
[simde]: https://github.com/nemequ/simde
[unimap]: https://github.com/lh3/unimap
+144 -44
View File
@@ -6,6 +6,8 @@
#include "mmpriv.h"
#include "ksw2.h"
#define MM_MAX_QLEN_FLANK 100
static void ksw_gen_simple_mat(int m, int8_t *mat, int8_t a, int8_t b, int8_t sc_ambi)
{
int i, j;
@@ -21,6 +23,18 @@ static void ksw_gen_simple_mat(int m, int8_t *mat, int8_t a, int8_t b, int8_t sc
mat[(m - 1) * m + j] = sc_ambi;
}
static void ksw_gen_ts_mat(int m, int8_t *mat, int8_t a, int8_t b, int8_t transition, int8_t sc_ambi)
{
assert(m == 5);
ksw_gen_simple_mat(m, mat, a, b, sc_ambi);
if (transition == 0 || transition == b) return;
transition = transition > 0? -transition : transition;
mat[0 * m + 2] = transition; // A->G
mat[1 * m + 3] = transition; // C->T
mat[2 * m + 0] = transition; // G->A
mat[3 * m + 1] = transition; // T->C
}
static inline void mm_seq_rev(uint32_t len, uint8_t *seq)
{
uint32_t i;
@@ -246,7 +260,7 @@ static void mm_update_extra(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *ts
if (p == 0) return;
mm_fix_cigar(r, qseq, tseq, &qshift, &tshift);
qseq += qshift, tseq += tshift; // qseq and tseq may be shifted due to the removal of leading I/D
r->blen = r->mlen = 0;
r->blen = r->mlen = 0, r->is_spliced = 0;
for (k = 0; k < p->n_cigar; ++k) {
uint32_t op = p->cigar[k]&0xf, len = p->cigar[k]>>4;
if (op == MM_CIGAR_MATCH) {
@@ -280,17 +294,16 @@ static void mm_update_extra(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *ts
if (s < 0) s = 0;
toff += len;
} else if (op == MM_CIGAR_N_SKIP) {
toff += len;
r->is_spliced = 1, toff += len;
}
}
p->dp_max = (int32_t)(max + .499);
p->dp_max = p->dp_max0 = (int32_t)(max + .499);
assert(qoff == r->qe - r->qs && toff == r->re - r->rs);
if (is_eqx) mm_update_cigar_eqx(r, qseq, tseq); // NB: it has to be called here as changes to qseq and tseq are not returned
}
static void mm_append_cigar(mm_reg1_t *r, uint32_t n_cigar, uint32_t *cigar) // TODO: this calls the libc realloc()
void mm_enlarge_cigar(mm_reg1_t *r, uint32_t n_cigar) // TODO: this calls the libc realloc()
{
mm_extra_t *p;
if (n_cigar == 0) return;
if (r->p == 0) {
uint32_t capacity = n_cigar + sizeof(mm_extra_t)/4;
@@ -302,6 +315,13 @@ static void mm_append_cigar(mm_reg1_t *r, uint32_t n_cigar, uint32_t *cigar) //
kroundup32(r->p->capacity);
r->p = (mm_extra_t*)realloc(r->p, r->p->capacity * 4);
}
}
static void mm_append_cigar(mm_reg1_t *r, uint32_t n_cigar, const uint32_t *cigar)
{
mm_extra_t *p;
if (n_cigar == 0) return;
mm_enlarge_cigar(r, n_cigar);
p = r->p;
if (p->n_cigar > 0 && (p->cigar[p->n_cigar-1]&0xf) == (cigar[0]&0xf)) { // same CIGAR op at the boundary
p->cigar[p->n_cigar-1] += cigar[0]>>4<<4;
@@ -313,25 +333,31 @@ static void mm_append_cigar(mm_reg1_t *r, uint32_t n_cigar, uint32_t *cigar) //
}
}
static void mm_align_pair(void *km, const mm_mapopt_t *opt, int qlen, const uint8_t *qseq, int tlen, const uint8_t *tseq, const uint8_t *junc, const int8_t *mat, int w, int end_bonus, int zdrop, int flag, ksw_extz_t *ez)
static void mm_align_pair(void *km, const mm_mapopt_t *opt, int qlen, const uint8_t *qseq, int tlen, const uint8_t *tseq, const uint8_t *junc,
const int8_t *mat, int w, int end_bonus, int zdrop, int ksw_flag, ksw_extz_t *ez)
{
if (mm_dbg_flag & MM_DBG_PRINT_ALN_SEQ) {
int i;
fprintf(stderr, "===> q=(%d,%d), e=(%d,%d), bw=%d, flag=%d, zdrop=%d <===\n", opt->q, opt->q2, opt->e, opt->e2, w, flag, opt->zdrop);
fprintf(stderr, "===> q=(%d,%d), e=(%d,%d), bw=%d, ksw_flag=%d, zdrop=%d, end_bonus=%d <===\n", opt->q, opt->q2, opt->e, opt->e2, w, ksw_flag, opt->zdrop, end_bonus);
for (i = 0; i < tlen; ++i) fputc("ACGTN"[tseq[i]], stderr);
fputc('\n', stderr);
for (i = 0; i < qlen; ++i) fputc("ACGTN"[qseq[i]], stderr);
fputc('\n', stderr);
}
if (opt->max_sw_mat > 0 && (int64_t)tlen * qlen > opt->max_sw_mat) {
if (opt->transition != 0 && opt->b != opt->transition)
ksw_flag |= KSW_EZ_GENERIC_SC;
if (opt->max_sw_mat > 0 && (int64_t)tlen * qlen > opt->max_sw_mat) { // too much memory; skip alignment
ksw_reset_extz(ez);
ez->zdropped = 1;
} else if (opt->flag & MM_F_SPLICE)
ksw_exts2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->noncan, zdrop, opt->junc_bonus, flag, junc, ez);
else if (opt->q == opt->q2 && opt->e == opt->e2)
ksw_extz2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, w, zdrop, end_bonus, flag, ez);
else
ksw_extd2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->e2, w, zdrop, end_bonus, flag, ez);
} else if (opt->flag & MM_F_SPLICE) { // spliced alignment
assert((ksw_flag & KSW_EZ_SPLICE_FOR) == 0 || (ksw_flag & KSW_EZ_SPLICE_REV) == 0);
if (!(opt->flag & MM_F_SPLICE_OLD)) ksw_flag |= KSW_EZ_SPLICE_CMPLX;
ksw_exts2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->noncan, zdrop, end_bonus, opt->junc_bonus, opt->junc_pen, ksw_flag, junc, ez);
} else if (opt->q == opt->q2 && opt->e == opt->e2) { // affine gap
ksw_extz2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, w, zdrop, end_bonus, ksw_flag, ez);
} else { // dual affine gap
ksw_extd2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->e2, w, zdrop, end_bonus, ksw_flag, ez);
}
if (mm_dbg_flag & MM_DBG_PRINT_ALN_SEQ) {
int i;
fprintf(stderr, "score=%d, cigar=", ez->score);
@@ -341,6 +367,45 @@ static void mm_align_pair(void *km, const mm_mapopt_t *opt, int qlen, const uint
}
}
static int mm_align_sr_rna(void *km, const mm_mapopt_t *opt, int qlen, const uint8_t *qseq, int tlen, const uint8_t *tseq, const uint8_t *junc, uint8_t *tseq2, uint8_t *junc2,
const int8_t *mat, int w, int end_bonus, int zdrop, int ksw_flag, ksw_extz_t *ez)
{
int32_t ilen = opt->q2 * 2, tlen2 = qlen * 2 + ilen;
int32_t i, ll = 0, lr = 0, nn = 0, n_ins = 0;
if (!(opt->flag & MM_F_SPLICE)) return 0; // only for spliced alignment
if (qlen > MM_MAX_QLEN_FLANK || qlen * 2 + ilen > tlen) return 0; // the query sequence can't be too long and the target sequence must be long enough
for (i = 0; i < qlen; ++i) // exact match length from the left
if (qseq[i] == tseq[i] && qseq[i] < 4)
++ll;
for (i = 0; i < qlen; ++i) // exact match length from the right
if (qseq[qlen - 1 - i] == tseq[tlen - 1 - i] && qseq[qlen - 1 - i] < 4)
++lr;
if (qlen - (ll + lr) > 9) return 0; // qlen may be smaller than ll+lr
memcpy(tseq2, tseq, qlen);
memset(&tseq2[qlen], 4, ilen);
memcpy(&tseq2[qlen + ilen], &tseq[tlen - qlen], qlen);
if (junc) {
memcpy(junc2, junc, qlen);
memset(&junc2[qlen], 0, ilen);
memcpy(&junc2[qlen + ilen], &junc[tlen - qlen], qlen);
}
if (!(opt->flag & MM_F_SPLICE_OLD)) ksw_flag |= KSW_EZ_SPLICE_CMPLX;
ksw_exts2_sse(km, qlen, qseq, tlen2, tseq2, 5, mat, opt->q, opt->e, opt->q2, opt->noncan, zdrop, end_bonus, opt->junc_bonus, opt->junc_pen, ksw_flag, junc2, ez);
if (ez->zdropped) return 0;
if ((ez->cigar[0]&0xf) != KSW_CIGAR_MATCH || (ez->cigar[ez->n_cigar-1]&0xf) != KSW_CIGAR_MATCH) return 0;
for (i = 0; i < ez->n_cigar; ++i) { // count the number of introns in the alignment
if ((ez->cigar[i]&0xf) == KSW_CIGAR_N_SKIP)
++nn;
else if ((ez->cigar[i]&0xf) == KSW_CIGAR_INS)
++n_ins;
}
if (nn != 1 || n_ins > 0) return 0; // the heuristic only works when there is exactly one intron
for (i = 0; i < ez->n_cigar; ++i)
if ((ez->cigar[i]&0xf) == KSW_CIGAR_N_SKIP)
ez->cigar[i] += (tlen - tlen2) << 4;
return 1;
}
static inline int mm_get_hplen_back(const mm_idx_t *mi, uint32_t rid, uint32_t x)
{
int64_t i, off0 = mi->seq[rid].offset, off = off0 + x;
@@ -570,12 +635,19 @@ static void mm_fix_bad_ends_splice(void *km, const mm_mapopt_t *opt, const mm_id
}
}
static inline void mm_get_junc(const mm_idx_t *mi, int32_t ctg, int32_t st, int32_t en, int32_t rev, uint8_t *junc)
{
if (mi->spsc) mm_idx_spsc_get(mi, ctg, st, en, rev, junc);
else if (mi->I) mm_idx_bed_junc(mi, ctg, st, en, junc);
else memset(junc, 0, en - st);
}
static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, uint8_t *qseq0[2], mm_reg1_t *r, mm_reg1_t *r2, int n_a, mm128_t *a, ksw_extz_t *ez, int splice_flag)
{
int is_sr = !!(opt->flag & MM_F_SR), is_splice = !!(opt->flag & MM_F_SPLICE);
int is_sr = !!(opt->flag & MM_F_SR), is_splice = !!(opt->flag & MM_F_SPLICE), is_sr_rna = (!!(opt->flag & MM_F_SR_RNA) && is_splice);
int32_t rid = a[r->as].x<<1>>33, rev = a[r->as].x>>63, as1, cnt1;
uint8_t *tseq, *qseq, *junc;
int32_t i, l, bw, bw_long, dropped = 0, extra_flag = 0, rs0, re0, qs0, qe0;
uint8_t *tseq, *qseq, *junc, *tseq2 = 0, *junc2 = 0;
int32_t i, l, bw, bw_long, dropped = 0, ksw_flag = 0, rs0, re0, qs0, qe0;
int32_t rs, re, qs, qe;
int32_t rs1, qs1, re1, qe1;
int8_t mat[25];
@@ -584,7 +656,7 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
r2->cnt = 0;
if (r->cnt == 0) return;
ksw_gen_simple_mat(5, mat, opt->a, opt->b, opt->sc_ambi);
ksw_gen_ts_mat(5, mat, opt->a, opt->b, opt->transition, opt->sc_ambi);
bw = (int)(opt->bw * 1.5 + 1.);
bw_long = (int)(opt->bw_long * 1.5 + 1.);
if (bw_long < bw) bw_long = bw;
@@ -610,9 +682,10 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
assert(cnt1 > 0);
if (is_splice) {
if (splice_flag & MM_F_SPLICE_FOR) extra_flag |= rev? KSW_EZ_SPLICE_REV : KSW_EZ_SPLICE_FOR;
if (splice_flag & MM_F_SPLICE_REV) extra_flag |= rev? KSW_EZ_SPLICE_FOR : KSW_EZ_SPLICE_REV;
if (opt->flag & MM_F_SPLICE_FLANK) extra_flag |= KSW_EZ_SPLICE_FLANK;
if (splice_flag & MM_F_SPLICE_FOR) ksw_flag |= rev? KSW_EZ_SPLICE_REV : KSW_EZ_SPLICE_FOR;
if (splice_flag & MM_F_SPLICE_REV) ksw_flag |= rev? KSW_EZ_SPLICE_FOR : KSW_EZ_SPLICE_REV;
if (opt->flag & MM_F_SPLICE_FLANK) ksw_flag |= KSW_EZ_SPLICE_FLANK;
if (mi->spsc) ksw_flag |= KSW_EZ_SPLICE_SCORE;
}
/* Look for the start and end of regions to perform DP. This sounds easy
@@ -697,6 +770,12 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
tseq = (uint8_t*)kmalloc(km, re0 - rs0);
junc = (uint8_t*)kmalloc(km, re0 - rs0);
if (is_sr_rna) {
int32_t max_tlen2 = MM_MAX_QLEN_FLANK * 2 + opt->q2 * 2;
tseq2 = Kmalloc(km, uint8_t, max_tlen2 * 2);
junc2 = tseq2 + max_tlen2;
}
if (qs > 0 && rs > 0) { // left extension; probably the condition can be changed to "qs > qs0 && rs > rs0"
if (opt->flag & MM_F_QSTRAND) {
qseq = &qseq0[0][qs0];
@@ -705,11 +784,11 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
qseq = &qseq0[rev][qs0];
mm_idx_getseq(mi, rid, rs0, rs, tseq);
}
mm_idx_bed_junc(mi, rid, rs0, rs, junc);
mm_get_junc(mi, rid, rs0, rs, !!(ksw_flag&KSW_EZ_SPLICE_REV), junc);
mm_seq_rev(qs - qs0, qseq);
mm_seq_rev(rs - rs0, tseq);
mm_seq_rev(rs - rs0, junc);
mm_align_pair(km, opt, qs - qs0, qseq, rs - rs0, tseq, junc, mat, bw, opt->end_bonus, r->split_inv? opt->zdrop_inv : opt->zdrop, extra_flag|KSW_EZ_EXTZ_ONLY|KSW_EZ_RIGHT|KSW_EZ_REV_CIGAR, ez);
mm_align_pair(km, opt, qs - qs0, qseq, rs - rs0, tseq, junc, mat, bw, opt->end_bonus, r->split_inv? opt->zdrop_inv : opt->zdrop, ksw_flag|KSW_EZ_EXTZ_ONLY|KSW_EZ_RIGHT|KSW_EZ_REV_CIGAR, ez);
if (ez->n_cigar > 0) {
mm_append_cigar(r, ez->n_cigar, ez->cigar);
r->p->dp_score += ez->max;
@@ -721,14 +800,14 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
re1 = rs, qe1 = qs;
assert(qs1 >= 0 && rs1 >= 0);
for (i = is_sr? cnt1 - 1 : 1; i < cnt1; ++i) { // gap filling
for (i = is_sr? cnt1 - 1 : 1; i < cnt1; ++i) { // gap filling; for short genomic reads, fill from the first seed to the last
if ((a[as1+i].y & (MM_SEED_IGNORE|MM_SEED_TANDEM)) && i != cnt1 - 1) continue;
if (is_sr && !(mi->flag & MM_I_HPC)) {
re = (int32_t)a[as1 + i].x + 1;
qe = (int32_t)a[as1 + i].y + 1;
} else mm_adjust_minier(mi, qseq0, &a[as1 + i], &re, &qe);
re1 = re, qe1 = qe;
if (i == cnt1 - 1 || (a[as1+i].y&MM_SEED_LONG_JOIN) || (qe - qs >= opt->min_ksw_len && re - rs >= opt->min_ksw_len)) {
if (i == cnt1 - 1 || (a[as1+i].y&MM_SEED_LONG_JOIN) || (qe - qs >= opt->min_ksw_len && re - rs >= opt->min_ksw_len)) { // gap filling
int j, bw1 = bw_long, zdrop_code;
if (a[as1+i].y & MM_SEED_LONG_JOIN)
bw1 = qe - qs > re - rs? qe - qs : re - rs;
@@ -740,21 +819,29 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
qseq = &qseq0[rev][qs];
mm_idx_getseq(mi, rid, rs, re, tseq);
}
mm_idx_bed_junc(mi, rid, rs, re, junc);
if (is_sr) { // perform ungapped alignment
mm_get_junc(mi, rid, rs, re, !!(ksw_flag&KSW_EZ_SPLICE_REV), junc);
if (is_sr || (is_sr_rna && qe - qs == re - rs)) { // perform ungapped alignment
int32_t max_gapped_score = (qe - qs - 2) * opt->a - 2 * (opt->q + opt->e);
assert(qe - qs == re - rs);
ksw_reset_extz(ez);
for (j = 0, ez->score = 0; j < qe - qs; ++j) {
if (qseq[j] >= 4 || tseq[j] >= 4) ez->score += opt->e2;
if (qseq[j] >= 4 || tseq[j] >= 4) ez->score += opt->sc_ambi > 0? -opt->sc_ambi : opt->sc_ambi;
else ez->score += qseq[j] == tseq[j]? opt->a : -opt->b;
}
if (ez->score > max_gapped_score)
ez->cigar = ksw_push_cigar(km, &ez->n_cigar, &ez->m_cigar, ez->cigar, MM_CIGAR_MATCH, qe - qs);
else
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, junc, mat, bw1, -1, opt->zdrop, ksw_flag|KSW_EZ_APPROX_MAX, ez);
} else { // perform normal gapped alignment
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, junc, mat, bw1, -1, opt->zdrop, extra_flag|KSW_EZ_APPROX_MAX, ez); // first pass: with approximate Z-drop
int32_t skip_full = 0;
if (is_sr_rna)
skip_full = mm_align_sr_rna(km, opt, qe - qs, qseq, re - rs, tseq, junc, tseq2, junc2, mat, bw1, -1, opt->zdrop, ksw_flag|KSW_EZ_APPROX_MAX, ez);
if (!skip_full)
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, junc, mat, bw1, -1, opt->zdrop, ksw_flag|KSW_EZ_APPROX_MAX, ez); // first pass: with approximate Z-drop
}
// test Z-drop and inversion Z-drop
if ((zdrop_code = mm_test_zdrop(km, opt, qseq, tseq, ez->n_cigar, ez->cigar, mat)) != 0)
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, junc, mat, bw1, -1, zdrop_code == 2? opt->zdrop_inv : opt->zdrop, extra_flag, ez); // second pass: lift approximate
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, junc, mat, bw1, -1, zdrop_code == 2? opt->zdrop_inv : opt->zdrop, ksw_flag, ez); // second pass: lift approximate
// update CIGAR
if (ez->n_cigar > 0)
mm_append_cigar(r, ez->n_cigar, ez->cigar);
@@ -792,8 +879,8 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
qseq = &qseq0[rev][qe];
mm_idx_getseq(mi, rid, re, re0, tseq);
}
mm_idx_bed_junc(mi, rid, re, re0, junc);
mm_align_pair(km, opt, qe0 - qe, qseq, re0 - re, tseq, junc, mat, bw, opt->end_bonus, opt->zdrop, extra_flag|KSW_EZ_EXTZ_ONLY, ez);
mm_get_junc(mi, rid, re, re0, !!(ksw_flag&KSW_EZ_SPLICE_REV), junc);
mm_align_pair(km, opt, qe0 - qe, qseq, re0 - re, tseq, junc, mat, bw, opt->end_bonus, opt->zdrop, ksw_flag|KSW_EZ_EXTZ_ONLY, ez);
if (ez->n_cigar > 0) {
mm_append_cigar(r, ez->n_cigar, ez->cigar);
r->p->dp_score += ez->max;
@@ -816,11 +903,12 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
mm_idx_getseq(mi, rid, rs1, re1, tseq);
qseq = &qseq0[r->rev][qs1];
}
mm_update_extra(r, qseq, tseq, mat, opt->q, opt->e, opt->flag & MM_F_EQX, !(opt->flag & MM_F_SR));
mm_update_extra(r, qseq, tseq, mat, opt->q, opt->e, opt->flag & MM_F_EQX, !(is_sr || is_sr_rna));
if (rev && r->p->trans_strand)
r->p->trans_strand ^= 3; // flip to the read strand
}
if (tseq2) kfree(km, tseq2);
kfree(km, tseq);
kfree(km, junc);
}
@@ -842,7 +930,7 @@ static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, i
if (ql < opt->min_chain_score || ql > opt->max_gap) return 0;
if (tl < opt->min_chain_score || tl > opt->max_gap) return 0;
ksw_gen_simple_mat(5, mat, opt->a, opt->b, opt->sc_ambi);
ksw_gen_ts_mat(5, mat, opt->a, opt->b, opt->transition, opt->sc_ambi);
tseq = (uint8_t*)kmalloc(km, tl);
mm_idx_getseq(mi, r1->rid, r1->re, r2->rs, tseq);
qseq = r1->rev? &qseq0[0][r2->qe] : &qseq0[1][qlen - r2->qs];
@@ -875,7 +963,7 @@ static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, i
}
r_inv->rs = r1->re + t_off;
r_inv->re = r_inv->rs + ez->max_t + 1;
mm_update_extra(r_inv, &qseq[q_off], &tseq[t_off], mat, opt->q, opt->e, opt->flag & MM_F_EQX, !(opt->flag & MM_F_SR));
mm_update_extra(r_inv, &qseq[q_off], &tseq[t_off], mat, opt->q, opt->e, opt->flag & MM_F_EQX, !(opt->flag & (MM_F_SR|MM_F_SR_RNA)));
ret = 1;
end_align1_inv:
kfree(km, tseq);
@@ -917,14 +1005,14 @@ double mm_event_identity(const mm_reg1_t *r)
static int32_t mm_recal_max_dp(const mm_reg1_t *r, double b2, int32_t match_sc)
{
uint32_t i;
int32_t n_gap = 0, n_gapo = 0, n_mis;
int32_t n_gap = 0, n_mis;
double gap_cost = 0.0;
if (r->p == 0) return -1;
for (i = 0; i < r->p->n_cigar; ++i) {
int32_t op = r->p->cigar[i] & 0xf, len = r->p->cigar[i] >> 4;
if (op == MM_CIGAR_INS || op == MM_CIGAR_DEL) {
gap_cost += b2 + (double)mg_log2(1.0 + len);
++n_gapo, n_gap += len;
n_gap += len;
}
}
n_mis = r->blen + r->p->n_ambi - r->mlen - n_gap;
@@ -976,13 +1064,17 @@ mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *m
n_a = mm_squeeze_a(km, n_regs, regs, a);
memset(&ez, 0, sizeof(ksw_extz_t));
for (i = 0; i < n_regs; ++i) {
mm_reg1_t r2;
mm_reg1_t r2; // only used for inversion
if ((opt->flag&MM_F_SPLICE) && (opt->flag&MM_F_SPLICE_FOR) && (opt->flag&MM_F_SPLICE_REV)) { // then do two rounds of alignments for both strands
mm_reg1_t s[2], s2[2];
int which, trans_strand;
mm_reg1_t s[2], s2[2], *r;
s[0] = s[1] = regs[i];
mm_align1(km, opt, mi, qlen, qseq0, &s[0], &s2[0], n_a, a, &ez, MM_F_SPLICE_FOR);
mm_align1(km, opt, mi, qlen, qseq0, &s[1], &s2[1], n_a, a, &ez, MM_F_SPLICE_REV);
mm_align1(km, opt, mi, qlen, qseq0, &s[0], &s2[0], n_a, a, &ez, MM_F_SPLICE_FOR); // assume the transcript is on the + strand of the genome
if ((opt->flag&MM_F_SR_RNA) && regs[i].qe - regs[i].qs == regs[i].re - regs[i].rs && s[0].qe - s[0].qs == s[0].re - s[0].rs && s[0].qs == 0 && s[0].qe == qlen) {
regs[i] = s[0], r2 = s2[0];
regs[i].p->trans_strand = 0;
} else {
int which, trans_strand;
mm_align1(km, opt, mi, qlen, qseq0, &s[1], &s2[1], n_a, a, &ez, MM_F_SPLICE_REV); // assume the transcript on the - strand
if (s[0].p->dp_score > s[1].p->dp_score) which = 0, trans_strand = 1;
else if (s[0].p->dp_score < s[1].p->dp_score) which = 1, trans_strand = 2;
else trans_strand = 3, which = (qlen + s[0].p->dp_score) & 1; // randomly choose a strand, effectively
@@ -993,7 +1085,15 @@ mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *m
regs[i] = s[1], r2 = s2[1];
free(s[0].p);
}
regs[i].p->trans_strand = trans_strand;
r = &regs[i];
r->p->trans_strand = trans_strand;
if (r->is_spliced) {
if (trans_strand == 1 || trans_strand == 2) // this is an *approximate* way to tell if there are splice signals.
r->p->dp_max += (opt->a + opt->b) + ((opt->a + opt->b) >> 1);
else if (trans_strand == 3)
r->p->dp_max -= opt->a + opt->b;
}
}
} else { // one round of alignment
mm_align1(km, opt, mi, qlen, qseq0, &regs[i], &r2, n_a, a, &ez, opt->flag);
if (opt->flag&MM_F_SPLICE)
@@ -1011,7 +1111,7 @@ mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *m
kfree(km, qseq0[0]);
kfree(km, ez.cigar);
mm_filter_regs(opt, qlen, n_regs_, regs);
if (!(opt->flag&MM_F_SR) && !opt->split_prefix && qlen >= opt->rank_min_len) {
if (!(opt->flag&(MM_F_SR|MM_F_SR_RNA|MM_F_ALL_CHAINS)) && !opt->split_prefix && qlen >= opt->rank_min_len) {
mm_update_dp_max(qlen, *n_regs_, regs, opt->rank_frac, opt->a, opt->b);
mm_filter_regs(opt, qlen, n_regs_, regs);
}
+2 -2
View File
@@ -31,8 +31,8 @@ To acquire the data used in this cookbook and to install minimap2 and paftools,
please follow the command lines below:
```sh
# install minimap2 executables
curl -L https://github.com/lh3/minimap2/releases/download/v2.21/minimap2-2.21_x64-linux.tar.bz2 | tar jxf -
cp minimap2-2.21_x64-linux/{minimap2,k8,paftools.js} . # copy executables
curl -L https://github.com/lh3/minimap2/releases/download/v2.30/minimap2-2.30_x64-linux.tar.bz2 | tar jxf -
cp minimap2-2.30_x64-linux/{minimap2,k8,paftools.js} . # copy executables
export PATH="$PATH:"`pwd` # put the current directory on PATH
# download example datasets
curl -L https://github.com/lh3/minimap2/releases/download/v2.10/cookbook-data.tgz | tar zxf -
+141 -18
View File
@@ -119,6 +119,7 @@ int mm_write_sam_hdr(const mm_idx_t *idx, const char *rg, const char *ver, int a
{
kstring_t str = {0,0,0};
int ret = 0;
mm_sprintf_lite(&str, "@HD\tVN:1.6\tSO:unsorted\tGO:query\n");
if (idx) {
uint32_t i;
for (i = 0; i < idx->n_seq; ++i)
@@ -138,10 +139,48 @@ int mm_write_sam_hdr(const mm_idx_t *idx, const char *rg, const char *ver, int a
return ret;
}
static void write_cs_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq, const mm_reg1_t *r, char *tmp, int no_iden, int write_tag)
static void write_indel_ds(kstring_t *str, int64_t len, const uint8_t *seq, int64_t ll, int64_t lr) // write an indel to ds; adapted from minigraph
{
int i, q_off, t_off;
if (write_tag) mm_sprintf_lite(s, "\tcs:Z:");
int64_t i;
if (ll + lr >= len) {
mm_sprintf_lite(str, "[");
for (i = 0; i < len; ++i)
mm_sprintf_lite(str, "%c", "acgtn"[seq[i]]);
mm_sprintf_lite(str, "]");
} else {
int64_t k = 0;
if (ll > 0) {
mm_sprintf_lite(str, "[");
for (i = 0; i < ll; ++i)
mm_sprintf_lite(str, "%c", "acgtn"[seq[k+i]]);
mm_sprintf_lite(str, "]");
k += ll;
}
for (i = 0; i < len - lr - ll; ++i)
mm_sprintf_lite(str, "%c", "acgtn"[seq[k+i]]);
k += len - lr - ll;
if (lr > 0) {
mm_sprintf_lite(str, "[");
for (i = 0; i < lr; ++i)
mm_sprintf_lite(str, "%c", "acgtn"[seq[k+i]]);
mm_sprintf_lite(str, "]");
}
}
}
static void write_cs_ds_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq, const mm_reg1_t *r, char *tmp, int no_iden, int is_ds, int write_tag)
{
int i, q_off, t_off, q_len = 0, t_len = 0;
if (write_tag) mm_sprintf_lite(s, "\t%cs:Z:", is_ds? 'd' : 'c');
for (i = 0; i < (int)r->p->n_cigar; ++i) {
int op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
if (op == MM_CIGAR_MATCH || op == MM_CIGAR_EQ_MATCH || op == MM_CIGAR_X_MISMATCH)
q_len += len, t_len += len;
else if (op == MM_CIGAR_INS)
q_len += len;
else if (op == MM_CIGAR_DEL || op == MM_CIGAR_N_SKIP)
t_len += len;
}
for (i = q_off = t_off = 0; i < (int)r->p->n_cigar; ++i) {
int j, op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
assert((op >= MM_CIGAR_MATCH && op <= MM_CIGAR_N_SKIP) || op == MM_CIGAR_EQ_MATCH || op == MM_CIGAR_X_MISMATCH);
@@ -167,14 +206,42 @@ static void write_cs_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq
}
q_off += len, t_off += len;
} else if (op == MM_CIGAR_INS) {
if (is_ds) {
int z, ll, lr, y = q_off;
for (z = 1; z <= len; ++z)
if (y - z < 0 || qseq[y + len - z] != qseq[y - z])
break;
lr = z - 1;
for (z = 0; z < len; ++z)
if (y + len + z >= q_len || qseq[y + len + z] != qseq[y + z])
break;
ll = z;
mm_sprintf_lite(s, "+");
write_indel_ds(s, len, &qseq[y], ll, lr);
} else {
for (j = 0, tmp[len] = 0; j < len; ++j)
tmp[j] = "acgtn"[qseq[q_off + j]];
mm_sprintf_lite(s, "+%s", tmp);
}
q_off += len;
} else if (op == MM_CIGAR_DEL) {
if (is_ds) {
int z, ll, lr, x = t_off;
for (z = 1; z <= len; ++z)
if (x - z < 0 || tseq[x + len - z] != tseq[x - z])
break;
lr = z - 1;
for (z = 0; z < len; ++z)
if (x + len + z >= t_len || tseq[x + z] != tseq[x + len + z])
break;
ll = z;
mm_sprintf_lite(s, "-");
write_indel_ds(s, len, &tseq[x], ll, lr);
} else {
for (j = 0, tmp[len] = 0; j < len; ++j)
tmp[j] = "acgtn"[tseq[t_off + j]];
mm_sprintf_lite(s, "-%s", tmp);
}
t_off += len;
} else { // intron
assert(len >= 2);
@@ -186,6 +253,52 @@ static void write_cs_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq
assert(t_off == r->re - r->rs && q_off == r->qe - r->qs);
}
static inline void revcomp_splice(uint8_t s[2])
{
uint8_t c = s[1] < 4? 3 - s[1] : 4;
s[1] = s[0] < 4? 3 - s[0] : 4;
s[0] = c;
}
void mm_write_junc(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r)
{
int32_t i, t_off, swritten = 0;
s->l = 0;
if (!r->is_spliced || r->p == 0) return; // no junctions
if (r->p->trans_strand != 1 && r->p->trans_strand != 2) return; // no preferred strand
for (i = 0, t_off = r->rs; i < (int)r->p->n_cigar; ++i) {
int op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
if (op == MM_CIGAR_MATCH || op == MM_CIGAR_EQ_MATCH || op == MM_CIGAR_X_MISMATCH || op == MM_CIGAR_DEL) {
t_off += len;
} else if (op == MM_CIGAR_N_SKIP) { // intron
uint8_t donor[2], acceptor[2];
int32_t score1 = 0, score2 = 0, rev;
assert(len >= 2);
rev = (r->p->trans_strand == 2) ^ r->rev;
if (!rev) {
mm_idx_getseq(mi, r->rid, t_off, t_off + 2, donor);
mm_idx_getseq(mi, r->rid, t_off + len - 2, t_off + len, acceptor);
} else {
mm_idx_getseq(mi, r->rid, t_off, t_off + 2, acceptor);
mm_idx_getseq(mi, r->rid, t_off + len - 2, t_off + len, donor);
revcomp_splice(donor);
revcomp_splice(acceptor);
}
//fprintf(stderr, "%c%c-%c%c\n", "ACGTN"[donor[0]], "ACGTN"[donor[1]], "ACGTN"[acceptor[0]], "ACGTN"[acceptor[1]]);
if (donor[0] == 2 && donor[1] == 3) score1 = 3;
else if (donor[0] == 2 && donor[1] == 1) score1 = 2;
else if (donor[0] == 0 && donor[1] == 3) score1 = 1;
if (acceptor[0] == 0 && acceptor[1] == 2) score2 = 3;
else if (acceptor[0] == 0 && acceptor[1] == 1) score2 = 1;
if (swritten) mm_sprintf_lite(s, "\n");
else swritten = 1;
mm_sprintf_lite(s, "%s\t%d\t%d\t%s\t%d\t%c", mi->seq[r->rid].name, t_off, t_off + len, t->name, score1 + score2, "+-"[rev]);
t_off += len;
}
}
assert(t_off == r->re);
}
static void write_MD_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq, const mm_reg1_t *r, char *tmp, int write_tag)
{
int i, q_off, t_off, l_MD = 0;
@@ -217,7 +330,7 @@ static void write_MD_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq
assert(t_off == r->re - r->rs && q_off == r->qe - r->qs);
}
static void write_cs_or_MD(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int no_iden, int is_MD, int write_tag, int is_qstrand)
static void write_cs_ds_or_MD(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int no_iden, int is_MD, int is_ds, int write_tag, int is_qstrand)
{
extern unsigned char seq_nt4_table[256];
int i;
@@ -244,7 +357,7 @@ static void write_cs_or_MD(void *km, kstring_t *s, const mm_idx_t *mi, const mm_
}
}
if (is_MD) write_MD_core(s, tseq, qseq, r, tmp, write_tag);
else write_cs_core(s, tseq, qseq, r, tmp, no_iden, write_tag);
else write_cs_ds_core(s, tseq, qseq, r, tmp, no_iden, is_ds, write_tag);
kfree(km, qseq); kfree(km, tseq); kfree(km, tmp);
}
@@ -255,7 +368,7 @@ int mm_gen_cs_or_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, cons
str.s = *buf, str.l = 0, str.m = *max_len;
t.l_seq = strlen(seq);
t.seq = (char*)seq;
write_cs_or_MD(km, &str, mi, &t, r, no_iden, is_MD, 0, is_qstrand);
write_cs_ds_or_MD(km, &str, mi, &t, r, no_iden, is_MD, 0, 0, is_qstrand);
*max_len = str.m;
*buf = str.s;
return str.l;
@@ -277,7 +390,7 @@ static inline void write_tags(kstring_t *s, const mm_reg1_t *r)
if (r->id == r->parent) type = r->inv? 'I' : 'P';
else type = r->inv? 'i' : 'S';
if (r->p) {
mm_sprintf_lite(s, "\tNM:i:%d\tms:i:%d\tAS:i:%d\tnn:i:%d", r->blen - r->mlen + r->p->n_ambi, r->p->dp_max, r->p->dp_score, r->p->n_ambi);
mm_sprintf_lite(s, "\tNM:i:%d\tms:i:%d\tAS:i:%d\tnn:i:%d", r->blen - r->mlen + r->p->n_ambi, r->p->dp_max0, r->p->dp_score, r->p->n_ambi);
if (r->p->trans_strand == 1 || r->p->trans_strand == 2)
mm_sprintf_lite(s, "\tts:A:%c", "?+-?"[r->p->trans_strand]);
}
@@ -299,15 +412,18 @@ static inline void write_tags(kstring_t *s, const mm_reg1_t *r)
if (r->split) mm_sprintf_lite(s, "\tzd:i:%d", r->split);
}
void mm_write_paf3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag, int rep_len)
void mm_write_paf4(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag, int rep_len, int n_seg, int seg_idx)
{
s->l = 0;
mm_sprintf_lite(s, "%s", t->name);
if ((opt_flag & MM_F_FRAG_MODE) && n_seg >= 2 && seg_idx >= 0)
mm_sprintf_lite(s, "/%d", seg_idx + 1);
if (r == 0) {
mm_sprintf_lite(s, "%s\t%d\t0\t0\t*\t*\t0\t0\t0\t0\t0\t0", t->name, t->l_seq);
mm_sprintf_lite(s, "\t%d\t0\t0\t*\t*\t0\t0\t0\t0\t0\t0", t->l_seq);
if (rep_len >= 0) mm_sprintf_lite(s, "\trl:i:%d", rep_len);
return;
}
mm_sprintf_lite(s, "%s\t%d\t%d\t%d\t%c\t", t->name, t->l_seq, r->qs, r->qe, "+-"[r->rev]);
mm_sprintf_lite(s, "\t%d\t%d\t%d\t%c\t", t->l_seq, r->qs, r->qe, "+-"[r->rev]);
if (mi->seq[r->rid].name) mm_sprintf_lite(s, "%s", mi->seq[r->rid].name);
else mm_sprintf_lite(s, "%d", r->rid);
mm_sprintf_lite(s, "\t%d", mi->seq[r->rid].len);
@@ -325,12 +441,17 @@ void mm_write_paf3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const
for (k = 0; k < r->p->n_cigar; ++k)
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, MM_CIGAR_STR[r->p->cigar[k]&0xf]);
}
if (r->p && (opt_flag & (MM_F_OUT_CS|MM_F_OUT_MD)))
write_cs_or_MD(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG), opt_flag&MM_F_OUT_MD, 1, !!(opt_flag&MM_F_QSTRAND));
if (r->p && (opt_flag & (MM_F_OUT_CS|MM_F_OUT_DS|MM_F_OUT_MD)))
write_cs_ds_or_MD(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG), !!(opt_flag&MM_F_OUT_MD), !!(opt_flag&MM_F_OUT_DS), 1, !!(opt_flag&MM_F_QSTRAND));
if ((opt_flag & MM_F_COPY_COMMENT) && t->comment)
mm_sprintf_lite(s, "\t%s", t->comment);
}
void mm_write_paf3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag, int rep_len)
{
mm_write_paf4(s, mi, t, r, km, opt_flag, rep_len, 0, 0);
}
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag)
{
mm_write_paf3(s, mi, t, r, km, opt_flag, -1);
@@ -369,14 +490,16 @@ static void write_sam_cigar(kstring_t *s, int sam_flag, int in_tag, int qlen, co
clip_len[0] = r->rev? qlen - r->qe : r->qs;
clip_len[1] = r->rev? r->qs : qlen - r->qe;
if (in_tag) {
int clip_char = (sam_flag&0x800) && !(opt_flag&MM_F_SOFTCLIP)? 5 : 4;
int clip_char = (((sam_flag&0x800) || ((sam_flag&0x100) && (opt_flag&MM_F_SECONDARY_SEQ))) &&
!(opt_flag&MM_F_SOFTCLIP)) ? 5 : 4;
mm_sprintf_lite(s, "\tCG:B:I");
if (clip_len[0]) mm_sprintf_lite(s, ",%u", clip_len[0]<<4|clip_char);
for (k = 0; k < r->p->n_cigar; ++k)
mm_sprintf_lite(s, ",%u", r->p->cigar[k]);
if (clip_len[1]) mm_sprintf_lite(s, ",%u", clip_len[1]<<4|clip_char);
} else {
int clip_char = (sam_flag&0x800) && !(opt_flag&MM_F_SOFTCLIP)? 'H' : 'S';
int clip_char = (((sam_flag&0x800) || ((sam_flag&0x100) && (opt_flag&MM_F_SECONDARY_SEQ))) &&
!(opt_flag&MM_F_SOFTCLIP)) ? 'H' : 'S';
assert(clip_len[0] < qlen && clip_len[1] < qlen);
if (clip_len[0]) mm_sprintf_lite(s, "%d%c", clip_len[0], clip_char);
for (k = 0; k < r->p->n_cigar; ++k)
@@ -451,7 +574,7 @@ void mm_write_sam3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
if (cigar_in_tag) {
int slen;
if ((flag & 0x900) == 0 || (opt_flag & MM_F_SOFTCLIP)) slen = t->l_seq;
else if (flag & 0x100) slen = 0;
else if ((flag & 0x100) && !(opt_flag & MM_F_SECONDARY_SEQ)) slen = 0;
else slen = r->qe - r->qs;
mm_sprintf_lite(s, "%dS%dN", slen, r->re - r->rs);
} else write_sam_cigar(s, flag, 0, t->l_seq, r, opt_flag);
@@ -492,7 +615,7 @@ void mm_write_sam3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
mm_sprintf_lite(s, "\t");
if (t->qual) sam_write_sq(s, t->qual, t->l_seq, r->rev, 0);
else mm_sprintf_lite(s, "*");
} else if (flag & 0x100) {
} else if ((flag & 0x100) && !(opt_flag & MM_F_SECONDARY_SEQ)){
mm_sprintf_lite(s, "*\t*");
} else {
sam_write_sq(s, t->seq + r->qs, r->qe - r->qs, r->rev, r->rev);
@@ -532,8 +655,8 @@ void mm_write_sam3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
}
}
}
if (r->p && (opt_flag & (MM_F_OUT_CS|MM_F_OUT_MD)))
write_cs_or_MD(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG), opt_flag&MM_F_OUT_MD, 1, 0);
if (r->p && (opt_flag & (MM_F_OUT_CS|MM_F_OUT_DS|MM_F_OUT_MD)))
write_cs_ds_or_MD(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG), opt_flag&MM_F_OUT_MD, !!(opt_flag&MM_F_OUT_DS), 1, 0);
if (cigar_in_tag)
write_sam_cigar(s, flag, 1, t->l_seq, r, opt_flag);
}
+31 -7
View File
@@ -55,7 +55,7 @@ mm_reg1_t *mm_gen_regs(void *km, uint32_t hash, int qlen, int n_u, uint64_t *u,
mm_reg1_t *r;
int i, k;
if (n_u == 0) return 0;
if (n_u <= 0) return 0;
// sort by score
z = (mm128_t*)kmalloc(km, n_u * 16);
@@ -252,7 +252,7 @@ void mm_sync_regs(void *km, int n_regs, mm_reg1_t *regs) // keep mm_reg1_t::{id,
mm_set_sam_pri(n_regs, regs);
}
void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int *n_, mm_reg1_t *r)
void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int check_strand, int min_strand_sc, int *n_, mm_reg1_t *r)
{
if (pri_ratio > 0.0f && *n_ > 0) {
int i, k, n = *n_, n_2nd = 0;
@@ -264,6 +264,9 @@ void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int *n_,
if (!(r[i].qs == r[p].qs && r[i].qe == r[p].qe && r[i].rid == r[p].rid && r[i].rs == r[p].rs && r[i].re == r[p].re)) // not identical hits
r[k++] = r[i], ++n_2nd;
else if (r[i].p) free(r[i].p);
} else if (check_strand && n_2nd < best_n && r[i].score > min_strand_sc && r[i].rev != r[p].rev) {
r[i].strand_retained = 1;
r[k++] = r[i], ++n_2nd;
} else if (r[i].p) free(r[i].p);
}
if (k != n) mm_sync_regs(km, k, r); // removing hits requires sync()
@@ -271,6 +274,19 @@ void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int *n_,
}
}
int mm_filter_strand_retained(int n_regs, mm_reg1_t *r)
{
int i, k;
for (i = k = 0; i < n_regs; ++i) {
int p = r[i].parent;
if (!r[i].strand_retained || r[i].div < r[p].div * 5.0f || r[i].div < 0.01f) {
if (k < i) r[k++] = r[i];
else ++k;
}
}
return k;
}
void mm_filter_regs(const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs)
{ // NB: after this call, mm_reg1_t::parent can be -1 if its parent filtered out
int i, k;
@@ -402,16 +418,19 @@ static void mm_set_inv_mapq(void *km, int n_regs, mm_reg1_t *regs)
kfree(km, aux);
}
void mm_set_mapq(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr)
void mm_set_mapq2(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr, int is_splice)
{
static const float q_coef = 40.0f;
int64_t sum_sc = 0;
float uniq_ratio;
int i;
int i, n_2nd_splice = 0;
if (n_regs == 0) return;
for (i = 0; i < n_regs; ++i)
for (i = 0; i < n_regs; ++i) {
if (regs[i].parent == regs[i].id)
sum_sc += regs[i].score;
else if (regs[i].is_spliced)
++n_2nd_splice;
}
uniq_ratio = (float)sum_sc / (sum_sc + rep_len);
for (i = 0; i < n_regs; ++i) {
mm_reg1_t *r = &regs[i];
@@ -424,13 +443,18 @@ void mm_set_mapq(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int ma
pen_cm = pen_s1 < pen_cm? pen_s1 : pen_cm;
subsc = r->subsc > min_chain_sc? r->subsc : min_chain_sc;
if (r->p && r->p->dp_max2 > 0 && r->p->dp_max > 0) {
float identity = (float)r->mlen / r->blen;
float x = (float)r->p->dp_max2 * subsc / r->p->dp_max / r->score0;
float x, identity = (float)r->mlen / r->blen;
if (is_sr && is_splice)
x = (float)r->p->dp_max2 / r->p->dp_max; // ignore chaining score; for short RNA-seq reads, unspliced chaining score tends to be higher
else
x = (float)r->p->dp_max2 * subsc / r->p->dp_max / r->score0;
mapq = (int)(identity * pen_cm * q_coef * (1.0f - x * x) * logf((float)r->p->dp_max / match_sc));
if (!is_sr) {
int mapq_alt = (int)(6.02f * identity * identity * (r->p->dp_max - r->p->dp_max2) / match_sc + .499f); // BWA-MEM like mapQ, mostly for short reads
mapq = mapq < mapq_alt? mapq : mapq_alt; // in case the long-read heuristic fails
}
if (is_splice && is_sr && r->is_spliced && n_2nd_splice == 0)
mapq += 10;
} else {
float x = (float)subsc / r->score0;
if (r->p) {
+312 -13
View File
@@ -12,6 +12,7 @@
#include "bseq.h"
#include "minimap.h"
#include "mmpriv.h"
#include "ksw2.h"
#include "kvec.h"
#include "khash.h"
@@ -32,7 +33,7 @@ typedef struct mm_idx_bucket_s {
} mm_idx_bucket_t;
typedef struct {
int32_t st, en, max; // max is not used for now
int32_t st, en, cnt;
int32_t score:30, strand:2;
} mm_idx_intv1_t;
@@ -41,6 +42,11 @@ typedef struct mm_idx_intv_s {
mm_idx_intv1_t *a;
} mm_idx_intv_t;
typedef struct mm_idx_jjump_s {
int32_t n, m;
mm_idx_jjump1_t *a;
} mm_idx_jjump_t;
mm_idx_t *mm_idx_init(int w, int k, int b, int flag)
{
mm_idx_t *mi;
@@ -65,11 +71,17 @@ void mm_idx_destroy(mm_idx_t *mi)
kh_destroy(idx, (idxhash_t*)mi->B[i].h);
}
}
if (mi->spsc) free(mi->spsc);
if (mi->I) {
for (i = 0; i < mi->n_seq; ++i)
free(mi->I[i].a);
free(mi->I);
}
if (mi->J) {
for (i = 0; i < mi->n_seq; ++i)
free(mi->J[i].a);
free(mi->J);
}
if (!mi->km) {
for (i = 0; i < mi->n_seq; ++i)
free(mi->seq[i].name);
@@ -99,7 +111,7 @@ const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n)
void mm_idx_stat(const mm_idx_t *mi)
{
int n = 0, n1 = 0;
int64_t n = 0, n1 = 0;
uint32_t i;
uint64_t sum = 0, len = 0;
fprintf(stderr, "[M::%s] kmer size: %d; skip: %d; is_hpc: %d; #seq: %d\n", __func__, mi->k, mi->w, mi->flag&MM_I_HPC, mi->n_seq);
@@ -117,8 +129,8 @@ void mm_idx_stat(const mm_idx_t *mi)
if (kh_key(h, k)&1) ++n1;
}
}
fprintf(stderr, "[M::%s::%.3f*%.2f] distinct minimizers: %d (%.2f%% are singletons); average occurrences: %.3lf; average spacing: %.3lf; total length: %ld\n",
__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), n, 100.0*n1/n, (double)sum / n, (double)len / sum, (long)len);
fprintf(stderr, "[M::%s::%.3f*%.2f] distinct minimizers: %ld (%.2f%% are singletons); average occurrences: %.3lf; average spacing: %.3lf; total length: %ld\n",
__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), (long)n, 100.0*n1/n, (double)sum / n, (double)len / sum, (long)len);
}
int mm_idx_index_name(mm_idx_t *mi)
@@ -192,6 +204,7 @@ int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f)
if (f <= 0.) return INT32_MAX;
for (i = 0; i < 1<<mi->b; ++i)
if (mi->B[i].h) n += kh_size((idxhash_t*)mi->B[i].h);
if (n == 0) return INT32_MAX;
a = (uint32_t*)malloc(n * 4);
for (i = n = 0; i < 1<<mi->b; ++i) {
idxhash_t *h = (idxhash_t*)mi->B[i].h;
@@ -656,10 +669,17 @@ int mm_idx_alt_read(mm_idx_t *mi, const char *fn)
return n_alt;
}
/***************
* BED reading *
***************/
#define sort_key_bed(a) ((a).st)
KRADIX_SORT_INIT(bed, mm_idx_intv1_t, sort_key_bed, 4)
mm_idx_intv_t *mm_idx_read_bed(const mm_idx_t *mi, const char *fn, int read_junc)
#define sort_key_end(a) ((a).en)
KRADIX_SORT_INIT(end, mm_idx_intv1_t, sort_key_end, 4)
static mm_idx_intv_t *mm_idx_bed_read_core(const mm_idx_t *mi, const char *fn, int read_junc, int min_sc)
{
gzFile fp;
kstream_t *ks;
@@ -668,7 +688,7 @@ mm_idx_intv_t *mm_idx_read_bed(const mm_idx_t *mi, const char *fn, int read_junc
fp = fn && strcmp(fn, "-")? gzopen(fn, "r") : gzdopen(fileno(stdin), "r");
if (fp == 0) return 0;
I = (mm_idx_intv_t*)calloc(mi->n_seq, sizeof(*I));
I = CALLOC(mm_idx_intv_t, mi->n_seq);
ks = ks_init(fp);
while (ks_getuntil(ks, KS_SEP_LINE, &str, 0) >= 0) {
mm_idx_intv_t *r;
@@ -689,7 +709,7 @@ mm_idx_intv_t *mm_idx_read_bed(const mm_idx_t *mi, const char *fn, int read_junc
t.en = atol(q);
if (t.en < 0) break;
} else if (i == 4) { // BED score
t.score = atol(q);
t.score = *q >= '0' && *q <= '9'? atol(q) : -1;
} else if (i == 5) { // strand
t.strand = *q == '+'? 1 : *q == '-'? -1 : 0;
} else if (i == 9) {
@@ -705,7 +725,8 @@ mm_idx_intv_t *mm_idx_read_bed(const mm_idx_t *mi, const char *fn, int read_junc
++i, q = p + 1;
}
}
if (id < 0 || t.st < 0 || t.st >= t.en) continue;
if (id < 0 || t.st < 0 || t.st >= t.en) continue; // contig ID not found, or other problems
if (min_sc > 0 && t.score < min_sc) continue;
r = &I[id];
if (i >= 11 && read_junc) { // BED12
int32_t st, sz, en;
@@ -738,14 +759,44 @@ mm_idx_intv_t *mm_idx_read_bed(const mm_idx_t *mi, const char *fn, int read_junc
return I;
}
static mm_idx_intv_t *mm_idx_bed_read_merge(const mm_idx_t *mi, const char *fn, int read_junc, int min_sc)
{
long n = 0, n0 = 0;
int32_t i;
mm_idx_intv_t *I;
I = mm_idx_bed_read_core(mi, fn, read_junc, min_sc);
if (I == 0) return 0;
for (i = 0; i < mi->n_seq; ++i) {
int32_t j, j0, k;
mm_idx_intv_t *intv = &I[i];
n0 += intv->n;
radix_sort_bed(intv->a, intv->a + intv->n); // sort by st
for (j = 1, j0 = 0; j <= intv->n; ++j) { // sort by st and then by end
if (j == intv->n || intv->a[j].st != intv->a[j0].st) {
radix_sort_end(intv->a + j0, intv->a + j);
j0 = j;
}
}
for (j = 1, j0 = 0, k = 0; j <= intv->n; ++j) { // merge intervals with the same (st, en)
if (j == intv->n || intv->a[j].st != intv->a[j0].st || intv->a[j].en != intv->a[j0].en) {
intv->a[k] = intv->a[j0];
intv->a[k++].cnt = j - j0;
j0 = j;
}
}
intv->a = REALLOC(mm_idx_intv1_t, intv->a, k);
intv->n = intv->m = k;
n += k;
}
if (mm_verbose >= 3)
fprintf(stderr, "[%s] read %ld introns, %ld of which are non-redundant\n", __func__, n0, n);
return I;
}
int mm_idx_bed_read(mm_idx_t *mi, const char *fn, int read_junc)
{
int32_t i;
if (mi->h == 0) mm_idx_index_name(mi);
mi->I = mm_idx_read_bed(mi, fn, read_junc);
if (mi->I == 0) return -1;
for (i = 0; i < mi->n_seq; ++i) // TODO: eliminate redundant intervals
radix_sort_bed(mi->I[i].a, mi->I[i].a + mi->I[i].n);
mi->I = mm_idx_bed_read_merge(mi, fn, read_junc, -1);
return 0;
}
@@ -773,3 +824,251 @@ int mm_idx_bed_junc(const mm_idx_t *mi, int32_t ctg, int32_t st, int32_t en, uin
}
return left;
}
/*********************************
* Reading junctions for jumping *
*********************************/
#define sort_key_jj(a) ((a).off)
KRADIX_SORT_INIT(jj, mm_idx_jjump1_t, sort_key_jj, 4)
#define sort_key_jj2(a) ((a).off2)
KRADIX_SORT_INIT(jj2, mm_idx_jjump1_t, sort_key_jj2, 4)
static void sort_jjump(mm_idx_jjump_t *jj2)
{
int32_t j0, j, k;
if (jj2 == 0 || jj2->n == 0) return;
radix_sort_jj(jj2->a, jj2->a + jj2->n);
for (j0 = 0, j = 1; j <= jj2->n; ++j) {
if (j == jj2->n || jj2->a[j0].off != jj2->a[j].off) {
radix_sort_jj2(jj2->a + j0, jj2->a + j);
j0 = j;
}
}
// the actual merge
for (j0 = 0, j = 1, k = 0; j <= jj2->n; ++j) {
if (j == jj2->n || jj2->a[j0].off != jj2->a[j].off || jj2->a[j0].off2 != jj2->a[j].off2) {
int32_t t, cnt = 0;
uint16_t flag = 0;
for (t = j0; t < j; ++t) cnt += jj2->a[t].cnt, flag |= jj2->a[t].flag;
jj2->a[k] = jj2->a[j0];
jj2->a[k].cnt = cnt;
jj2->a[k++].flag = flag;
j0 = j;
}
}
jj2->n = k;
jj2->a = REALLOC(mm_idx_jjump1_t, jj2->a, k);
}
static mm_idx_jjump_t *mm_idx_bed2jjump(const mm_idx_t *mi, const mm_idx_intv_t *I, uint16_t flag)
{
int32_t i;
mm_idx_jjump_t *J;
J = CALLOC(mm_idx_jjump_t, mi->n_seq);
for (i = 0; i < mi->n_seq; ++i) {
int32_t j, k;
const mm_idx_intv_t *intv = &I[i];
mm_idx_jjump_t *jj = &J[i];
jj->n = intv->n * 2;
jj->a = CALLOC(mm_idx_jjump1_t, jj->n);
for (j = k = 0; j < intv->n; ++j) {
jj->a[k].off = intv->a[j].st, jj->a[k].off2 = intv->a[j].en, jj->a[k].cnt = intv->a[j].cnt, jj->a[k].strand = intv->a[j].strand, jj->a[k++].flag = flag;
jj->a[k].off = intv->a[j].en, jj->a[k].off2 = intv->a[j].st, jj->a[k].cnt = intv->a[j].cnt, jj->a[k].strand = intv->a[j].strand, jj->a[k++].flag = flag;
}
sort_jjump(jj);
}
return J;
}
static mm_idx_jjump_t *mm_idx_jjump_merge(const mm_idx_t *mi, const mm_idx_jjump_t *J0, const mm_idx_jjump_t *J1)
{
int32_t i;
mm_idx_jjump_t *J2;
J2 = CALLOC(mm_idx_jjump_t, mi->n_seq);
for (i = 0; i < mi->n_seq; ++i) {
int32_t j, k;
const mm_idx_jjump_t *jj0 = &J0[i], *jj1 = &J1[i];
mm_idx_jjump_t *jj2 = &J2[i];
jj2->n = jj0->n + jj1->n;
jj2->a = CALLOC(mm_idx_jjump1_t, jj2->n);
for (j = k = 0; j < jj0->n; ++j) jj2->a[k++] = jj0->a[j];
for (j = 0; j < jj1->n; ++j) jj2->a[k++] = jj1->a[j];
sort_jjump(jj2);
}
return J2;
}
int mm_idx_jjump_read(mm_idx_t *mi, const char *fn, int flag, int min_sc)
{
int32_t i, j, n_anno = 0, n_misc = 0;
mm_idx_intv_t *I;
mm_idx_jjump_t *J;
if (mi->h == 0) mm_idx_index_name(mi);
I = mm_idx_bed_read_merge(mi, fn, 1, min_sc);
J = mm_idx_bed2jjump(mi, I, flag);
for (i = 0; i < mi->n_seq; ++i) free(I[i].a);
free(I);
if (mi->J) {
mm_idx_jjump_t *J2;
J2 = mm_idx_jjump_merge(mi, mi->J, J);
for (i = 0; i < mi->n_seq; ++i) {
free(mi->J[i].a); free(J[i].a);
}
free(mi->J); free(J);
mi->J = J2;
} else mi->J = J;
for (i = 0; i < mi->n_seq; ++i) {
for (j = 0; j < mi->J[i].n; ++j)
if (mi->J[i].a[j].flag & MM_JUNC_ANNO) ++n_anno;
else ++n_misc;
}
if (mm_verbose >= 3)
fprintf(stderr, "[%s] there are %d annotated and %d other splice positions in the index\n", __func__, n_anno, n_misc);
return 0;
}
static int32_t mm_idx_jump_get_core(int32_t n, const mm_idx_jjump1_t *a, int32_t x) // similar to mm_idx_find_intv()
{
int32_t s = 0, e = n;
if (n == 0) return -1;
if (x < a[0].off) return -1;
while (s < e) {
int32_t mid = s + (e - s) / 2;
if (x >= a[mid].off && (mid + 1 >= n || x < a[mid+1].off)) return mid;
else if (x < a[mid].off) e = mid;
else s = mid + 1;
}
assert(0);
}
const mm_idx_jjump1_t *mm_idx_jump_get(const mm_idx_t *db, int32_t cid, int32_t st, int32_t en, int32_t *n)
{
mm_idx_jjump_t *s;
int32_t l, r;
*n = 0;
if (cid >= db->n_seq || cid < 0 || db->J == 0) return 0;
if (en < 0 || en > db->seq[cid].len) en = db->seq[cid].len;
s = &db->J[cid];
if (s->n == 0) return 0;
l = mm_idx_jump_get_core(s->n, s->a, st);
r = mm_idx_jump_get_core(s->n, s->a, en);
*n = r - l;
return &s->a[l + 1];
}
/****************
* splice score *
****************/
typedef struct mm_idx_spsc_s {
uint32_t n, m;
uint64_t *a; // pos<<56 | score<<1 | acceptor
} mm_idx_spsc_t;
int32_t mm_idx_spsc_read2(mm_idx_t *idx, const char *fn, int32_t max_sc, float scale)
{
gzFile fp;
kstring_t str = {0,0,0};
kstream_t *ks;
int32_t dret, j;
int64_t n_read = 0;
fp = fn && strcmp(fn, "-") != 0? gzopen(fn, "rb") : gzdopen(0, "rb");
if (fp == 0) return -1;
if (idx->h == 0) mm_idx_index_name(idx);
if (max_sc > 63) max_sc = 63;
idx->spsc = Kcalloc(0, mm_idx_spsc_t, idx->n_seq * 2);
ks = ks_init(fp);
while (ks_getuntil(ks, KS_SEP_LINE, &str, &dret) >= 0) {
mm_idx_spsc_t *s;
char *p, *q, *name = 0;
int32_t i, type = -1, strand = 0, cid = -1, score = -1;
int64_t pos = -1;
for (i = 0, p = q = str.s;; ++p) {
if (*p == '\t' || *p == 0) {
int c = *p;
*p = 0;
if (i == 0) {
name = q;
} else if (i == 1) {
pos = atol(q);
} else if (i == 2) {
strand = *q == '+'? 1 : '-'? -1 : 0;
} else if (i == 3) {
type = *q == 'D'? 0 : *q == 'A'? 1 : -1;
} else if (i == 4) {
score = atoi(q);
break;
}
if (c == 0) break;
q = p + 1, ++i;
}
}
if (i < 4) continue; // not enough fields
if (scale > 0.0f && scale < 1.0f)
score = score > 0.0f? (int)(score * scale + .499) : (int)(score * scale - .499);
if (score > max_sc) score = max_sc;
if (score < -max_sc) score = -max_sc;
cid = mm_idx_name2id(idx, name);
if (cid < 0 || type < 0 || strand == 0 || pos < 0) continue; // FIXME: give a warning!
s = &idx->spsc[cid << 1 | (strand > 0? 0 : 1)];
Kgrow(0, uint64_t, s->a, s->n, s->m);
if (pos > 0 && pos < idx->seq[cid].len) { // ignore scores at the ends
s->a[s->n++] = (uint64_t)pos << 8 | (score + KSW_SPSC_OFFSET) << 1 | type;
++n_read;
}
}
ks_destroy(ks);
gzclose(fp);
for (j = 0; j < idx->n_seq * 2; ++j) {
mm_idx_spsc_t *s = &idx->spsc[j];
if (s->n > 0)
radix_sort_64(s->a, s->a + s->n);
}
if (mm_verbose >= 3)
fprintf(stderr, "[M::%s] read %ld splice scores\n", __func__, (long)n_read);
return 0;
}
int32_t mm_idx_spsc_read(mm_idx_t *idx, const char *fn, int32_t max_sc)
{
return mm_idx_spsc_read2(idx, fn, max_sc, 1.0f);
}
static int32_t mm_idx_find_intv(int32_t n, const uint64_t *a, int64_t x)
{
int32_t s = 0, e = n;
if (n == 0) return -1;
if (x < a[0]>>8) return -1;
while (s < e) {
int32_t mid = s + (e - s) / 2;
if (x >= a[mid]>>8 && (mid + 1 >= n || x < a[mid+1]>>8)) return mid;
else if (x < a[mid]>>8) e = mid;
else s = mid + 1;
}
assert(0);
}
int64_t mm_idx_spsc_get(const mm_idx_t *db, int32_t cid, int64_t st, int64_t en, int32_t rev, uint8_t *sc)
{
const mm_idx_spsc_t *s;
if (cid >= db->n_seq || cid < 0 || db->spsc == 0) return -1;
if (en < 0 || en > db->seq[cid].len) en = db->seq[cid].len;
memset(sc, 0xff, en - st);
s = &db->spsc[cid << 1 | (!!rev)];
if (s->n > 0) {
int32_t j, l, r;
l = mm_idx_find_intv(s->n, s->a, st);
r = mm_idx_find_intv(s->n, s->a, en);
for (j = l + 1; j <= r; ++j) {
int64_t x = (s->a[j]>>8) - st;
uint8_t score = s->a[j] & 0xff;
assert(x <= en - st);
if (x == en - st) continue;
if (sc[x] == 0xff || sc[x] < score) sc[x] = score;
}
}
return en - st;
}
+201
View File
@@ -0,0 +1,201 @@
#include <stdio.h>
#include "mmpriv.h"
#include "kalloc.h"
#define MM_MIN_EXON_LEN 20
static int32_t mm_jump_check(void *km, const mm_idx_t *mi, int32_t qlen, const uint8_t *qseq0, const mm_reg1_t *r, int32_t ext, int32_t is_left) // TODO: check close N
{
int32_t clip, clen, e = !r->rev ^ !is_left; // 0 for left of the alignment; 1 for right
uint32_t cigar;
if (!r->p || r->p->n_cigar <= 0) return -1; // only working with CIGAR
clip = e == 0? r->qs : qlen - r->qe;
cigar = r->p->cigar[is_left? 0 : r->p->n_cigar - 1];
clen = (cigar&0xf) == MM_CIGAR_MATCH? cigar>>4 : 0;
if (clen <= ext) return -1;
if (is_left) {
if (clip >= r->rs) return -1; // no space to jump
} else {
if (clip >= mi->seq[r->rid].len - r->re) return -1; // no space to jump
}
return 0;
}
static uint8_t *mm_jump_get_qseq_seq(void *km, int32_t qlen, const uint8_t *qseq0, const mm_reg1_t *r, int32_t is_left, int32_t ql0, uint8_t *qseq)
{
extern unsigned char seq_nt4_table[256];
int32_t i, k = 0;
if (!r->rev) {
if (is_left)
for (i = 0; i < ql0; ++i)
qseq[k++] = seq_nt4_table[(uint8_t)qseq0[i]];
else
for (i = qlen - ql0; i < qlen; ++i)
qseq[k++] = seq_nt4_table[(uint8_t)qseq0[i]];
} else {
if (is_left)
for (i = qlen - 1; i >= qlen - ql0; --i) {
uint8_t c = seq_nt4_table[(uint8_t)qseq0[i]];
qseq[k++] = c >= 4? c : 3 - c;
}
else
for (i = ql0 - 1; i >= 0; --i) {
uint8_t c = seq_nt4_table[(uint8_t)qseq0[i]];
qseq[k++] = c >= 4? c : 3 - c;
}
}
return qseq;
}
static void mm_jump_split_left(void *km, const mm_idx_t *mi, const mm_mapopt_t *opt, int32_t qlen, const uint8_t *qseq0, mm_reg1_t *r, int32_t ts_strand)
{
uint8_t *tseq = 0, *qseq = 0;
int32_t i, n, l, i0, m, mm0;
int32_t i0_anno = -1, n_anno = 0, mm0_anno = 0, i0_misc = -1, n_misc = 0, mm0_misc = 0;
int32_t ext = 1 + (opt->b + opt->a - 1) / opt->a + 1;
int32_t clip = !r->rev? r->qs : qlen - r->qe;
int32_t extt = clip < ext? clip : ext;
const mm_idx_jjump1_t *a;
if (mm_jump_check(km, mi, qlen, qseq0, r, ext + MM_MIN_EXON_LEN, 1) < 0) return;
a = mm_idx_jump_get(mi, r->rid, r->rs - extt, r->rs + ext, &n);
if (n == 0) return;
for (i = 0; i < n; ++i) { // traverse possible jumps
const mm_idx_jjump1_t *ai = &a[i];
int32_t tlen, tl1, j, mm1, mm2;
assert(ai->off >= r->rs - extt && ai->off <= r->rs + ext);
if (ts_strand * ai->strand < 0) continue; // wrong strand
if (ai->off2 >= ai->off) continue; // wrong direction
if (ai->off - ai->off2 < 6) continue; // intron too small
if (ai->off2 < clip + ext) continue; // not long enough
if (tseq == 0) {
tseq = Kcalloc(km, uint8_t, (clip + ext) * 2); // tseq and qseq are allocated together
qseq = tseq + clip + ext;
mm_jump_get_qseq_seq(km, qlen, qseq0, r, 1, clip + ext, qseq);
}
tl1 = clip + (ai->off - r->rs);
tlen = mm_idx_getseq2(mi, 0, r->rid, ai->off, r->rs + ext, &tseq[tl1]);
assert(tlen == r->rs + ext - ai->off);
tlen = mm_idx_getseq2(mi, 0, r->rid, ai->off2 - tl1, ai->off2, tseq);
assert(tlen == tl1);
for (j = 0, mm1 = 0; j < tl1; ++j)
if (qseq[j] != tseq[j] || qseq[j] > 3 || tseq[j] > 3)
++mm1;
for (mm2 = 0; j < clip + ext; ++j)
if (qseq[j] != tseq[j] || qseq[j] > 3 || tseq[j] > 3)
++mm2;
if (mm1 == 0 && mm2 <= 1) {
if (ai->flag & MM_JUNC_ANNO)
i0_anno = i, mm0_anno = mm1 + mm2, ++n_anno; // i0 points to the rightmost i
else
i0_misc = i, mm0_misc = mm1 + mm2, ++n_misc;
}
}
if (n_anno > 0) m = n_anno, i0 = i0_anno, mm0 = mm0_anno;
else m = n_misc, i0 = i0_misc, mm0 = mm0_misc;
kfree(km, tseq);
l = m > 0? a[i0].off - r->rs : 0; // may be negative
if (m == 1 && clip + l >= opt->jump_min_match) { // add one more exon
mm_enlarge_cigar(r, 2);
memmove(r->p->cigar + 2, r->p->cigar, r->p->n_cigar * 4);
r->p->cigar[0] = (clip + l) << 4 | MM_CIGAR_MATCH;
r->p->cigar[1] = (a[i0].off - a[i0].off2) << 4 | MM_CIGAR_N_SKIP;
r->p->cigar[2] = ((r->p->cigar[2]>>4) - l) << 4 | MM_CIGAR_MATCH;
r->p->n_cigar += 2;
r->rs = a[i0].off2 - (clip + l);
if (!r->rev) r->qs = 0;
else r->qe = qlen;
r->blen += clip, r->mlen += clip - mm0;
r->p->dp_max0 += (clip - mm0) * opt->a - mm0 * opt->b;
r->p->dp_max += (clip - mm0) * opt->a - mm0 * opt->b;
if (!r->is_spliced) r->is_spliced = 1, r->p->dp_max += (opt->a + opt->b) + ((opt->a + opt->b) >> 1);
} else if (m > 0 && a[i0].off > r->rs) { // trim by l; l is always positive
r->p->cigar[0] -= l << 4 | MM_CIGAR_MATCH;
r->rs += l;
if (!r->rev) r->qs += l;
else r->qe -= l;
}
}
static void mm_jump_split_right(void *km, const mm_idx_t *mi, const mm_mapopt_t *opt, int32_t qlen, const uint8_t *qseq0, mm_reg1_t *r, int32_t ts_strand)
{
uint8_t *tseq = 0, *qseq = 0;
int32_t i, n, l, i0, m, mm0;
int32_t i0_anno = -1, n_anno = 0, mm0_anno = 0, i0_misc = -1, n_misc = 0, mm0_misc = 0;
int32_t ext = 1 + (opt->b + opt->a - 1) / opt->a + 1;
int32_t clip = !r->rev? qlen - r->qe : r->qs;
int32_t extt = clip < ext? clip : ext;
const mm_idx_jjump1_t *a;
if (mm_jump_check(km, mi, qlen, qseq0, r, ext + MM_MIN_EXON_LEN, 0) < 0) return;
a = mm_idx_jump_get(mi, r->rid, r->re - ext, r->re + extt, &n);
if (n == 0) return;
for (i = 0; i < n; ++i) { // traverse possible jumps
const mm_idx_jjump1_t *ai = &a[i];
int32_t tlen, tl1, j, mm1, mm2;
assert(ai->off >= r->re - ext && ai->off <= r->re + extt);
if (ts_strand * ai->strand < 0) continue; // wrong strand
if (ai->off2 <= ai->off) continue; // wrong direction
if (ai->off2 - ai->off < 6) continue; // intron too small
if (ai->off2 + clip + ext > mi->seq[r->rid].len) continue; // not long enough
if (tseq == 0) {
tseq = Kcalloc(km, uint8_t, (clip + ext) * 2); // tseq and qseq are allocated together
qseq = tseq + clip + ext;
mm_jump_get_qseq_seq(km, qlen, qseq0, r, 0, clip + ext, qseq);
}
tl1 = clip + (r->re - ai->off);
tlen = mm_idx_getseq2(mi, 0, r->rid, r->re - ext, ai->off, tseq);
assert(tlen == ai->off - (r->re - ext));
tlen = mm_idx_getseq2(mi, 0, r->rid, ai->off2, ai->off2 + tl1, &tseq[clip + ext - tl1]);
assert(tlen == tl1);
for (j = 0, mm2 = 0; j < clip + ext - tl1; ++j)
if (qseq[j] != tseq[j] || qseq[j] > 3 || tseq[j] > 3)
++mm2;
for (mm1 = 0; j < clip + ext; ++j)
if (qseq[j] != tseq[j] || qseq[j] > 3 || tseq[j] > 3)
++mm1;
if (mm1 == 0 && mm2 <= 1) {
if (ai->flag & MM_JUNC_ANNO) {
if (i0_anno < 0) i0_anno = i, mm0_anno = mm1 + mm2;
++n_anno;
} else {
if (i0_misc < 0) i0_misc = i, mm0_misc = mm1 + mm2;
++n_misc;
}
}
}
if (n_anno > 0) m = n_anno, i0 = i0_anno, mm0 = mm0_anno;
else m = n_misc, i0 = i0_misc, mm0 = mm0_misc;
kfree(km, tseq);
l = m > 0? r->re - a[i0].off : 0; // may be negative
if (m == 1 && clip + l >= opt->jump_min_match) { // add one more exon
mm_enlarge_cigar(r, 2);
r->p->cigar[r->p->n_cigar - 1] = ((r->p->cigar[r->p->n_cigar - 1]>>4) - l) << 4 | MM_CIGAR_MATCH;
r->p->cigar[r->p->n_cigar] = (a[i0].off2 - a[i0].off) << 4 | MM_CIGAR_N_SKIP;
r->p->cigar[r->p->n_cigar + 1] = (clip + l) << 4 | MM_CIGAR_MATCH;
r->p->n_cigar += 2;
r->re = a[i0].off2 + (clip + l);
if (!r->rev) r->qe = qlen;
else r->qs = 0;
r->blen += clip, r->mlen += clip - mm0;
r->p->dp_max0 += (clip - mm0) * opt->a - mm0 * opt->b;
r->p->dp_max += (clip - mm0) * opt->a - mm0 * opt->b;
if (!r->is_spliced) r->is_spliced = 1, r->p->dp_max += (opt->a + opt->b) + ((opt->a + opt->b) >> 1);
} else if (m > 0 && r->re > a[i0].off) { // trim by l; l is always positive
r->p->cigar[r->p->n_cigar - 1] -= l << 4 | MM_CIGAR_MATCH;
r->re -= l;
if (!r->rev) r->qe -= l;
else r->qs += l;
}
}
void mm_jump_split(void *km, const mm_idx_t *mi, const mm_mapopt_t *opt, int32_t qlen, const uint8_t *qseq, mm_reg1_t *r, int32_t ts_strand)
{
assert((opt->flag & MM_F_EQX) == 0);
mm_jump_split_left(km, mi, opt, qlen, qseq, r, ts_strand);
mm_jump_split_right(km, mi, opt, qlen, qseq, r, ts_strand);
}
+20 -1
View File
@@ -40,7 +40,8 @@ void *km_init2(void *km_par, size_t min_core_size)
kmem_t *km;
km = (kmem_t*)kcalloc(km_par, 1, sizeof(kmem_t));
km->par = km_par;
km->min_core_size = min_core_size > 0? min_core_size : 0x80000;
if (km_par) km->min_core_size = min_core_size > 0? min_core_size : ((kmem_t*)km_par)->min_core_size - 2;
else km->min_core_size = min_core_size > 0? min_core_size : 0x80000;
return (void*)km;
}
@@ -183,6 +184,16 @@ void *krealloc(void *_km, void *ap, size_t n_bytes) // TODO: this can be made mo
return q;
}
void *krelocate(void *km, void *ap, size_t n_bytes)
{
void *p;
if (km == 0 || ap == 0) return ap;
p = kmalloc(km, n_bytes);
memcpy(p, ap, n_bytes);
kfree(km, ap);
return p;
}
void km_stat(const void *_km, km_stat_t *s)
{
kmem_t *km = (kmem_t*)_km;
@@ -203,3 +214,11 @@ void km_stat(const void *_km, km_stat_t *s)
s->largest = s->largest > size? s->largest : size;
}
}
void km_stat_print(const void *km)
{
km_stat_t st;
km_stat(km, &st);
fprintf(stderr, "[km_stat] cap=%ld, avail=%ld, largest=%ld, n_core=%ld, n_block=%ld\n",
st.capacity, st.available, st.largest, st.n_blocks, st.n_cores);
}
+21 -2
View File
@@ -13,6 +13,7 @@ typedef struct {
void *kmalloc(void *km, size_t size);
void *krealloc(void *km, void *ptr, size_t size);
void *krelocate(void *km, void *ap, size_t n_bytes);
void *kcalloc(void *km, size_t count, size_t size);
void kfree(void *km, void *ptr);
@@ -20,11 +21,29 @@ void *km_init(void);
void *km_init2(void *km_par, size_t min_core_size);
void km_destroy(void *km);
void km_stat(const void *_km, km_stat_t *s);
void km_stat_print(const void *km);
#ifdef __cplusplus
}
#endif
#define Kmalloc(km, type, cnt) ((type*)kmalloc((km), (cnt) * sizeof(type)))
#define Kcalloc(km, type, cnt) ((type*)kcalloc((km), (cnt), sizeof(type)))
#define Krealloc(km, type, ptr, cnt) ((type*)krealloc((km), (ptr), (cnt) * sizeof(type)))
#define Kgrow(km, type, ptr, __i, __m) do { \
if ((__i) >= (__m)) { \
(__m) = (__i) + 1; \
(__m) += ((__m)>>1) + 16; \
(ptr) = Krealloc(km, type, ptr, (__m)); \
} \
} while (0)
#define Kexpand(km, type, a, m) do { \
(m) = (m) >= 4? (m) + ((m)>>1) : 16; \
(a) = Krealloc(km, type, (a), (m)); \
} while (0)
#define KMALLOC(km, ptr, len) ((ptr) = (__typeof__(ptr))kmalloc((km), (len) * sizeof(*(ptr))))
#define KCALLOC(km, ptr, len) ((ptr) = (__typeof__(ptr))kcalloc((km), (len), sizeof(*(ptr))))
#define KREALLOC(km, ptr, len) ((ptr) = (__typeof__(ptr))krealloc((km), (ptr), (len) * sizeof(*(ptr))))
@@ -50,7 +69,7 @@ void km_stat(const void *_km, km_stat_t *s);
} kmp_##name##_t; \
SCOPE kmp_##name##_t *kmp_init_##name(void *km) { \
kmp_##name##_t *mp; \
KCALLOC(km, mp, 1); \
mp = Kcalloc(km, kmp_##name##_t, 1); \
mp->km = km; \
return mp; \
} \
@@ -66,7 +85,7 @@ void km_stat(const void *_km, km_stat_t *s);
} \
SCOPE void kmp_free_##name(kmp_##name##_t *mp, kmptype_t *p) { \
--mp->cnt; \
if (mp->n == mp->max) KEXPAND(mp->km, mp->buf, mp->max); \
if (mp->n == mp->max) Kexpand(mp->km, kmptype_t*, mp->buf, mp->max); \
mp->buf[mp->n++] = p; \
}
+5 -1
View File
@@ -15,6 +15,8 @@
#define KSW_EZ_SPLICE_FOR 0x100
#define KSW_EZ_SPLICE_REV 0x200
#define KSW_EZ_SPLICE_FLANK 0x400
#define KSW_EZ_SPLICE_CMPLX 0x800 // use the miniprot splice model
#define KSW_EZ_SPLICE_SCORE 0x1000 // use splice score
// The subset of CIGAR operators used by ksw code.
// Use MM_CIGAR_* from minimap.h if you need the full list.
@@ -23,6 +25,8 @@
#define KSW_CIGAR_DEL 2
#define KSW_CIGAR_N_SKIP 3
#define KSW_SPSC_OFFSET 64
#ifdef __cplusplus
extern "C" {
#endif
@@ -68,7 +72,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
int8_t gapo, int8_t gape, int8_t gapo2, int8_t gape2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t gapo, int8_t gape, int8_t gapo2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez);
int8_t gapo, int8_t gape, int8_t gapo2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez);
void ksw_extf2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t mch, int8_t mis, int8_t e, int w, int xdrop, ksw_extz_t *ez);
+5 -5
View File
@@ -80,17 +80,17 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
}
void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez)
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez)
{
extern void ksw_exts2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez);
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez);
extern void ksw_exts2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez);
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez);
if (ksw_simd < 0) ksw_simd = x86_simd();
if (ksw_simd & SIMD_SSE4_1)
ksw_exts2_sse41(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, junc_bonus, flag, junc, ez);
ksw_exts2_sse41(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, end_bonus, junc_bonus, junc_pen, flag, junc, ez);
else if (ksw_simd & SIMD_SSE2)
ksw_exts2_sse2(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, junc_bonus, flag, junc, ez);
ksw_exts2_sse2(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, end_bonus, junc_bonus, junc_pen, flag, junc, ez);
else abort();
}
#endif
+1 -1
View File
@@ -358,7 +358,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
} else H[0] = v8[0] - qe, max_H = H[0], max_t = 0; // special casing r==0
// update ez
if (en0 == tlen - 1 && H[en0] > ez->mte)
ez->mte = H[en0], ez->mte_q = r - en;
ez->mte = H[en0], ez->mte_q = r - en0;
if (r - st0 == qlen - 1 && H[st0] > ez->mqe)
ez->mqe = H[st0], ez->mqe_t = st0;
if (ksw_apply_zdrop(ez, 1, max_H, r, max_t, zdrop, e2)) break;
+89 -39
View File
@@ -24,14 +24,14 @@
#ifdef KSW_CPU_DISPATCH
#ifdef __SSE4_1__
void ksw_exts2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez)
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez)
#else
void ksw_exts2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez)
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez)
#endif
#else
void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez)
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez)
#endif // ~KSW_CPU_DISPATCH
{
#define __dp_code_block1 \
@@ -71,6 +71,7 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
ksw_reset_extz(ez);
if (m <= 1 || qlen <= 0 || tlen <= 0 || q2 <= q + e) return;
assert((flag & KSW_EZ_SPLICE_FOR) == 0 || (flag & KSW_EZ_SPLICE_REV) == 0); // can't be both set
zero_ = _mm_set1_epi8(0);
q_ = _mm_set1_epi8(q);
@@ -118,52 +119,97 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
// set the donor and acceptor arrays. TODO: this assumes 0/1/2/3 encoding!
if (flag & (KSW_EZ_SPLICE_FOR|KSW_EZ_SPLICE_REV)) {
int semi_cost = flag&KSW_EZ_SPLICE_FLANK? -noncan/2 : 0; // GTr or yAG is worth 0.5 bit; see PMID:18688272
memset(donor, -noncan, tlen_ * 16);
memset(acceptor, -noncan, tlen_ * 16);
const int sp0[4] = { 8, 15, 21, 30 };
int sp[4];
if (flag & KSW_EZ_SPLICE_CMPLX) {
for (t = 0; t < 4; ++t)
sp[t] = (int)((double)sp0[t] / 3. + .499);
} else {
sp[0] = flag&KSW_EZ_SPLICE_FLANK? noncan / 2 : 0;
sp[1] = sp[2] = sp[3] = noncan;
}
memset(donor, -sp[3], tlen_ * 16);
memset(acceptor, -sp[3], tlen_ * 16);
if (!(flag & KSW_EZ_REV_CIGAR)) {
for (t = 0; t < tlen - 4; ++t) {
int can_type = 0; // type of canonical site: 0=none, 1=GT/AG only, 2=GTr/yAG
if ((flag & KSW_EZ_SPLICE_FOR) && target[t+1] == 2 && target[t+2] == 3) can_type = 1; // GTr...
if ((flag & KSW_EZ_SPLICE_REV) && target[t+1] == 1 && target[t+2] == 3) can_type = 1; // CTr...
if (can_type && (target[t+3] == 0 || target[t+3] == 2)) can_type = 2;
if (can_type) ((int8_t*)donor)[t] = can_type == 2? 0 : semi_cost;
int z = 3;
if (flag & KSW_EZ_SPLICE_FOR) {
if (target[t+1] == 2 && target[t+2] == 3) // |GT.
z = target[t+3] == 0 || target[t+3] == 2? -1 : 0; // |GTr or not
else if (target[t+1] == 2 && target[t+2] == 1) z = 1; // |GC.
else if (target[t+1] == 0 && target[t+2] == 3) z = 2; // |AT.
} else if (flag & KSW_EZ_SPLICE_REV) {
if (target[t+1] == 1 && target[t+2] == 3) // |CT. (revcomp of .AG|)
z = target[t+3] == 0 || target[t+3] == 2? -1 : 0;
else if (target[t+1] == 2 && target[t+2] == 3) z = 2; // |GT. (revcomp of .AC|)
}
if (junc)
((int8_t*)donor)[t] = z < 0? 0 : -sp[z];
}
for (t = 2; t < tlen; ++t) {
int z = 3;
if (flag & KSW_EZ_SPLICE_FOR) {
if (target[t-1] == 0 && target[t] == 2) // .AG|
z = target[t-2] == 1 || target[t-2] == 3? -1 : 0; // yAG| or not
else if (target[t-1] == 0 && target[t] == 1) z = 2; // .AC|
} else if (flag & KSW_EZ_SPLICE_REV) {
if (target[t-1] == 0 && target[t] == 1) // .AC| (revcomp of |GT.)
z = target[t-2] == 1 || target[t-2] == 3? -1 : 0; // yAC| or not
else if (target[t-1] == 2 && target[t] == 1) z = 1; // .GC| (revcomp of |GC.)
else if (target[t-1] == 0 && target[t] == 3) z = 2; // .AT| (revcomp of |AT.)
}
((int8_t*)acceptor)[t] = z < 0? 0 : -sp[z];
}
} else {
for (t = 0; t < tlen - 4; ++t) {
int z = 3;
if (flag & KSW_EZ_SPLICE_FOR) {
if (target[t+1] == 2 && target[t+2] == 0) // |GA. (rev of .AG|)
z = target[t+3] == 1 || target[t+3] == 3? -1 : 0;
else if (target[t+1] == 1 && target[t+2] == 0) z = 2; // |CA. (rev of .AC|)
} else if (flag & KSW_EZ_SPLICE_REV) {
if (target[t+1] == 1 && target[t+2] == 0) // |CA. (comp of |GT.)
z = target[t+3] == 1 || target[t+3] == 3? -1 : 0;
else if (target[t+1] == 1 && target[t+2] == 2) z = 1; // |CG. (comp of |GC.)
else if (target[t+1] == 3 && target[t+2] == 0) z = 2; // |TA. (comp of |AT.)
}
((int8_t*)donor)[t] = z < 0? 0 : -sp[z];
}
for (t = 2; t < tlen; ++t) {
int z = 3;
if (flag & KSW_EZ_SPLICE_FOR) {
if (target[t-1] == 3 && target[t] == 2) // .TG| (rev of |GT.)
z = target[t-2] == 0 || target[t-2] == 2? -1 : 0;
else if (target[t-1] == 1 && target[t] == 2) z = 1; // .CG| (rev of |GC.)
else if (target[t-1] == 3 && target[t] == 0) z = 2; // .TA| (rev of |AT.)
} else if (flag & KSW_EZ_SPLICE_REV) {
if (target[t-1] == 3 && target[t] == 1) // .TC| (comp of .AG|)
z = target[t-2] == 0 || target[t-2] == 2? -1 : 0;
else if (target[t-1] == 3 && target[t] == 2) z = 2; // .TG| (comp of .AC|)
}
((int8_t*)acceptor)[t] = z < 0? 0 : -sp[z];
}
}
}
if (junc && (flag & KSW_EZ_SPLICE_SCORE)) { // junc[] keeps the donor score
uint8_t donor_val = !!(flag & KSW_EZ_SPLICE_FOR) == !(flag & KSW_EZ_REV_CIGAR)? 0 : 1;
for (t = 0; t < tlen - 1; ++t)
((int8_t*)donor)[t] += junc[t+1] == 0xff || (junc[t+1]&1) != donor_val? -junc_pen : (int8_t)(junc[t+1]>>1) - (int8_t)KSW_SPSC_OFFSET;
for (t = 0; t < tlen - 1; ++t)
((int8_t*)acceptor)[t] += junc[t+1] == 0xff || (junc[t+1]&1) != !donor_val? -junc_pen : (int8_t)(junc[t+1]>>1) - (int8_t)KSW_SPSC_OFFSET;
//for (t = 0; t < tlen - 1; ++t) if (junc[t+1] != 0xff) fprintf(stderr, "Y2\t%d\t%d\t%c\t%d\n", ((int8_t*)donor)[t], ((int8_t*)acceptor)[t], "DA"[junc[t+1]&1], (int8_t)(junc[t+1]>>1) - (int8_t)KSW_SPSC_OFFSET);
} else if (junc) { // junc[] keeps the splice sites
if (!(flag & KSW_EZ_REV_CIGAR)) {
for (t = 0; t < tlen - 1; ++t)
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t+1]&1)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t+1]&8)))
((int8_t*)donor)[t] += junc_bonus;
for (t = 2; t < tlen; ++t) {
int can_type = 0;
if ((flag & KSW_EZ_SPLICE_FOR) && target[t-1] == 0 && target[t] == 2) can_type = 1; // ...yAG
if ((flag & KSW_EZ_SPLICE_REV) && target[t-1] == 0 && target[t] == 1) can_type = 1; // ...yAC
if (can_type && (target[t-2] == 1 || target[t-2] == 3)) can_type = 2;
if (can_type) ((int8_t*)acceptor)[t] = can_type == 2? 0 : semi_cost;
}
if (junc)
for (t = 0; t < tlen; ++t)
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t]&2)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t]&4)))
((int8_t*)acceptor)[t] += junc_bonus;
} else {
for (t = 0; t < tlen - 4; ++t) {
int can_type = 0; // type of canonical site: 0=none, 1=GT/AG only, 2=GTr/yAG
if ((flag & KSW_EZ_SPLICE_FOR) && target[t+1] == 2 && target[t+2] == 0) can_type = 1; // GAy...
if ((flag & KSW_EZ_SPLICE_REV) && target[t+1] == 1 && target[t+2] == 0) can_type = 1; // CAy...
if (can_type && (target[t+3] == 1 || target[t+3] == 3)) can_type = 2;
if (can_type) ((int8_t*)donor)[t] = can_type == 2? 0 : semi_cost;
}
if (junc)
for (t = 0; t < tlen - 1; ++t)
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t+1]&2)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t+1]&4)))
((int8_t*)donor)[t] += junc_bonus;
for (t = 2; t < tlen; ++t) {
int can_type = 0;
if ((flag & KSW_EZ_SPLICE_FOR) && target[t-1] == 3 && target[t] == 2) can_type = 1; // ...rTG
if ((flag & KSW_EZ_SPLICE_REV) && target[t-1] == 3 && target[t] == 1) can_type = 1; // ...rTC
if (can_type && (target[t-2] == 0 || target[t-2] == 2)) can_type = 2;
if (can_type) ((int8_t*)acceptor)[t] = can_type == 2? 0 : semi_cost;
}
if (junc)
for (t = 0; t < tlen; ++t)
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t]&1)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t]&8)))
((int8_t*)acceptor)[t] += junc_bonus;
@@ -376,7 +422,7 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
} else H[0] = v8[0] - qe, max_H = H[0], max_t = 0; // special casing r==0
// update ez
if (en0 == tlen - 1 && H[en0] > ez->mte)
ez->mte = H[en0], ez->mte_q = r - en;
ez->mte = H[en0], ez->mte_q = r - en0;
if (r - st0 == qlen - 1 && H[st0] > ez->mqe)
ez->mqe = H[st0], ez->mqe_t = st0;
if (ksw_apply_zdrop(ez, 1, max_H, r, max_t, zdrop, 0)) break;
@@ -406,10 +452,14 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
if (!approx_max) kfree(km, H);
if (with_cigar) { // backtrack
int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY))
if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY)) {
ksw_backtrack(km, 1, rev_cigar, long_thres, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
else if (ez->max_t >= 0 && ez->max_q >= 0)
} else if (!ez->zdropped && (flag&KSW_EZ_EXTZ_ONLY) && ez->mqe + end_bonus > (int)ez->max) {
ez->reach_end = 1;
ksw_backtrack(km, 1, rev_cigar, long_thres, (uint8_t*)p, off, off_end, n_col_*16, ez->mqe_t, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
} else if (ez->max_t >= 0 && ez->max_q >= 0) {
ksw_backtrack(km, 1, rev_cigar, long_thres, (uint8_t*)p, off, off_end, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
}
kfree(km, mem2); kfree(km, off);
}
}
+1 -1
View File
@@ -269,7 +269,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
} else H[0] = v8[0] - qe - qe, max_H = H[0], max_t = 0; // special casing r==0
// update ez
if (en0 == tlen - 1 && H[en0] > ez->mte)
ez->mte = H[en0], ez->mte_q = r - en;
ez->mte = H[en0], ez->mte_q = r - en0;
if (r - st0 == qlen - 1 && H[st0] > ez->mqe)
ez->mqe = H[st0], ez->mqe_t = st0;
if (ksw_apply_zdrop(ez, 1, max_H, r, max_t, zdrop, e)) break;
+54 -30
View File
@@ -6,7 +6,25 @@
#include "kalloc.h"
#include "krmq.h"
uint64_t *mg_chain_backtrack(void *km, int64_t n, const int32_t *f, const int64_t *p, int32_t *v, int32_t *t, int32_t min_cnt, int32_t min_sc, int32_t *n_u_, int32_t *n_v_)
static int64_t mg_chain_bk_end(int32_t max_drop, const mm128_t *z, const int32_t *f, const int64_t *p, int32_t *t, int64_t k)
{
int64_t i = z[k].y, end_i = -1, max_i = i;
int32_t max_s = 0;
if (i < 0 || t[i] != 0) return i;
do {
int32_t s;
t[i] = 2;
end_i = i = p[i];
s = i < 0? z[k].x : (int32_t)z[k].x - f[i];
if (s > max_s) max_s = s, max_i = i;
else if (max_s - s > max_drop) break;
} while (i >= 0 && t[i] == 0);
for (i = z[k].y; i >= 0 && i != end_i; i = p[i]) // reset modified t[]
t[i] = 0;
return max_i;
}
uint64_t *mg_chain_backtrack(void *km, int64_t n, const int32_t *f, const int64_t *p, int32_t *v, int32_t *t, int32_t min_cnt, int32_t min_sc, int32_t max_drop, int32_t *n_u_, int32_t *n_v_)
{
mm128_t *z;
uint64_t *u;
@@ -17,34 +35,40 @@ uint64_t *mg_chain_backtrack(void *km, int64_t n, const int32_t *f, const int64_
for (i = 0, n_z = 0; i < n; ++i) // precompute n_z
if (f[i] >= min_sc) ++n_z;
if (n_z == 0) return 0;
KMALLOC(km, z, n_z);
z = Kmalloc(km, mm128_t, n_z);
for (i = 0, k = 0; i < n; ++i) // populate z[]
if (f[i] >= min_sc) z[k].x = f[i], z[k++].y = i;
radix_sort_128x(z, z + n_z);
memset(t, 0, n * 4);
for (k = n_z - 1, n_v = n_u = 0; k >= 0; --k) { // precompute n_u
int64_t n_v0 = n_v;
if (t[z[k].y] == 0) {
int64_t n_v0 = n_v, end_i;
int32_t sc;
for (i = z[k].y; i >= 0 && t[i] == 0; i = p[i])
end_i = mg_chain_bk_end(max_drop, z, f, p, t, k);
for (i = z[k].y; i != end_i; i = p[i])
++n_v, t[i] = 1;
sc = i < 0? z[k].x : (int32_t)z[k].x - f[i];
if (sc >= min_sc && n_v > n_v0 && n_v - n_v0 >= min_cnt)
++n_u;
else n_v = n_v0;
}
KMALLOC(km, u, n_u);
}
u = Kmalloc(km, uint64_t, n_u);
memset(t, 0, n * 4);
for (k = n_z - 1, n_v = n_u = 0; k >= 0; --k) { // populate u[]
int64_t n_v0 = n_v;
if (t[z[k].y] == 0) {
int64_t n_v0 = n_v, end_i;
int32_t sc;
for (i = z[k].y; i >= 0 && t[i] == 0; i = p[i])
end_i = mg_chain_bk_end(max_drop, z, f, p, t, k);
for (i = z[k].y; i != end_i; i = p[i])
v[n_v++] = i, t[i] = 1;
sc = i < 0? z[k].x : (int32_t)z[k].x - f[i];
if (sc >= min_sc && n_v > n_v0 && n_v - n_v0 >= min_cnt)
u[n_u++] = (uint64_t)sc << 32 | (n_v - n_v0);
else n_v = n_v0;
}
}
kfree(km, z);
assert(n_v < INT32_MAX);
*n_u_ = n_u, *n_v_ = n_v;
@@ -58,7 +82,7 @@ static mm128_t *compact_a(void *km, int32_t n_u, uint64_t *u, int32_t n_v, int32
int64_t i, j, k;
// write the result to b[]
KMALLOC(km, b, n_v);
b = Kmalloc(km, mm128_t, n_v);
for (i = 0, k = 0; i < n_u; ++i) {
int32_t k0 = k, ni = (int32_t)u[i];
for (j = 0; j < ni; ++j)
@@ -67,13 +91,13 @@ static mm128_t *compact_a(void *km, int32_t n_u, uint64_t *u, int32_t n_v, int32
kfree(km, v);
// sort u[] and a[] by the target position, such that adjacent chains may be joined
KMALLOC(km, w, n_u);
w = Kmalloc(km, mm128_t, n_u);
for (i = k = 0; i < n_u; ++i) {
w[i].x = b[k].x, w[i].y = (uint64_t)k<<32|i;
k += (int32_t)u[i];
}
radix_sort_128x(w, w + n_u);
KMALLOC(km, u2, n_u);
u2 = Kmalloc(km, uint64_t, n_u);
for (i = k = 0; i < n_u; ++i) {
int32_t j = (int32_t)w[i].y, n = (int32_t)u[j];
u2[i] = u[j];
@@ -114,7 +138,7 @@ static inline int32_t comput_sc(const mm128_t *ai, const mm128_t *aj, int32_t ma
}
/* Input:
* a[].x: tid<<33 | rev<<32 | tpos
* a[].x: rev<<63 | tid<<32 | tpos
* a[].y: flags<<40 | q_span<<32 | q_pos
* Output:
* n_u: #chains
@@ -124,8 +148,8 @@ static inline int32_t comput_sc(const mm128_t *ai, const mm128_t *aj, int32_t ma
mm128_t *mg_lchain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int max_iter, int min_cnt, int min_sc, float chn_pen_gap, float chn_pen_skip,
int is_cdna, int n_seg, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km)
{ // TODO: make sure this works when n has more than 32 bits
int32_t *f, *t, *v, n_u, n_v, mmax_f = 0;
int64_t *p, i, j, max_ii, st = 0, n_iter = 0;
int32_t *f, *t, *v, n_u, n_v, mmax_f = 0, max_drop = bw;
int64_t *p, i, j, max_ii, st = 0;
uint64_t *u;
if (_u) *_u = 0, *n_u_ = 0;
@@ -135,10 +159,11 @@ mm128_t *mg_lchain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int
}
if (max_dist_x < bw) max_dist_x = bw;
if (max_dist_y < bw && !is_cdna) max_dist_y = bw;
KMALLOC(km, p, n);
KMALLOC(km, f, n);
KMALLOC(km, v, n);
KCALLOC(km, t, n);
if (is_cdna) max_drop = INT32_MAX;
p = Kmalloc(km, int64_t, n);
f = Kmalloc(km, int32_t, n);
v = Kmalloc(km, int32_t, n);
t = Kcalloc(km, int32_t, n);
// fill the score and backtrack arrays
for (i = 0, max_ii = -1; i < n; ++i) {
@@ -149,7 +174,6 @@ mm128_t *mg_lchain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int
for (j = i - 1; j >= st; --j) {
int32_t sc;
sc = comput_sc(&a[i], &a[j], max_dist_x, max_dist_y, bw, chn_pen_gap, chn_pen_skip, is_cdna, n_seg);
++n_iter;
if (sc == INT32_MIN) continue;
sc += f[j];
if (sc > max_f) {
@@ -179,9 +203,10 @@ mm128_t *mg_lchain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int
if (max_ii < 0 || (a[i].x - a[max_ii].x <= (int64_t)max_dist_x && f[max_ii] < f[i]))
max_ii = i;
if (mmax_f < max_f) mmax_f = max_f;
//fprintf(stderr, "X1\t%ld\t%ld:%d\t%ld\t%ld:%d\t%ld\t%ld\n", (long)i, (long)(a[i].x>>32), (int32_t)a[i].x, (long)max_j, max_j<0?-1L:(long)(a[max_j].x>>32), max_j<0?-1:(int32_t)a[max_j].x, (long)max_f, (long)v[i]);
}
u = mg_chain_backtrack(km, n, f, p, v, t, min_cnt, min_sc, &n_u, &n_v);
u = mg_chain_backtrack(km, n, f, p, v, t, min_cnt, min_sc, max_drop, &n_u, &n_v);
*n_u_ = n_u, *_u = u; // NB: note that u[] may not be sorted by score here
kfree(km, p); kfree(km, f); kfree(km, t);
if (n_u == 0) {
@@ -225,8 +250,8 @@ static inline int32_t comput_sc_simple(const mm128_t *ai, const mm128_t *aj, flo
mm128_t *mg_lchain_rmq(int max_dist, int max_dist_inner, int bw, int max_chn_skip, int cap_rmq_size, int min_cnt, int min_sc, float chn_pen_gap, float chn_pen_skip,
int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km)
{
int32_t *f,*t, *v, n_u, n_v, mmax_f = 0, max_rmq_size = 0;
int64_t *p, i, i0, st = 0, st_inner = 0, n_iter = 0;
int32_t *f,*t, *v, n_u, n_v, mmax_f = 0, max_rmq_size = 0, max_drop = bw;
int64_t *p, i, i0, st = 0, st_inner = 0;
uint64_t *u;
lc_elem_t *root = 0, *root_inner = 0;
void *mem_mp = 0;
@@ -238,11 +263,12 @@ mm128_t *mg_lchain_rmq(int max_dist, int max_dist_inner, int bw, int max_chn_ski
return 0;
}
if (max_dist < bw) max_dist = bw;
if (max_dist_inner <= 0 || max_dist_inner >= max_dist) max_dist_inner = 0;
KMALLOC(km, p, n);
KMALLOC(km, f, n);
KCALLOC(km, t, n);
KMALLOC(km, v, n);
if (max_dist_inner < 0) max_dist_inner = 0;
if (max_dist_inner > max_dist) max_dist_inner = max_dist;
p = Kmalloc(km, int64_t, n);
f = Kmalloc(km, int32_t, n);
t = Kcalloc(km, int32_t, n);
v = Kmalloc(km, int32_t, n);
mem_mp = km_init2(km, 0x10000);
mp = kmp_init_rmq(mem_mp);
@@ -300,12 +326,11 @@ mm128_t *mg_lchain_rmq(int max_dist, int max_dist_inner, int bw, int max_chn_ski
krmq_interval(lc_elem, root_inner, &s, &lo, &hi);
if (lo) {
const lc_elem_t *q;
int32_t width, n_rmq_iter = 0;
int32_t width;
krmq_itr_t(lc_elem) itr;
krmq_itr_find(lc_elem, root_inner, lo, &itr);
while ((q = krmq_at(&itr)) != 0) {
if (q->y < (int32_t)a[i].y - max_dist_inner) break;
++n_rmq_iter;
j = q->i;
sc = f[j] + comput_sc_simple(&a[i], &a[j], chn_pen_gap, chn_pen_skip, 0, &width);
if (width <= bw) {
@@ -320,7 +345,6 @@ mm128_t *mg_lchain_rmq(int max_dist, int max_dist_inner, int bw, int max_chn_ski
}
if (!krmq_itr_prev(lc_elem, &itr)) break;
}
n_iter += n_rmq_iter;
}
}
}
@@ -333,7 +357,7 @@ mm128_t *mg_lchain_rmq(int max_dist, int max_dist_inner, int bw, int max_chn_ski
}
km_destroy(mem_mp);
u = mg_chain_backtrack(km, n, f, p, v, t, min_cnt, min_sc, &n_u, &n_v);
u = mg_chain_backtrack(km, n, f, p, v, t, min_cnt, min_sc, max_drop, &n_u, &n_v);
*n_u_ = n_u, *_u = u; // NB: note that u[] may not be sorted by score here
kfree(km, p); kfree(km, f); kfree(km, t);
if (n_u == 0) {
+101 -23
View File
@@ -7,8 +7,6 @@
#include "mmpriv.h"
#include "ketopt.h"
#define MM_VERSION "2.21-dev-r1094-dirty"
#ifdef __linux__
#include <sys/resource.h>
#include <sys/time.h>
@@ -37,12 +35,12 @@ static ko_longopt_t long_options[] = {
{ "splice", ko_no_argument, 310 },
{ "cost-non-gt-ag", ko_required_argument, 'C' },
{ "no-long-join", ko_no_argument, 312 },
{ "sr", ko_no_argument, 313 },
{ "sr", ko_optional_argument, 313 },
{ "frag", ko_required_argument, 314 },
{ "secondary", ko_required_argument, 315 },
{ "cs", ko_optional_argument, 316 },
{ "end-bonus", ko_required_argument, 317 },
{ "no-pairing", ko_no_argument, 318 },
{ "no-pairing", ko_no_argument, 318 }, // deprecated but reserved for backward compatibility
{ "splice-flank", ko_required_argument, 319 },
{ "idx-no-seq", ko_no_argument, 320 },
{ "end-seed-pen", ko_required_argument, 321 },
@@ -74,6 +72,22 @@ static ko_longopt_t long_options[] = {
{ "rmq", ko_optional_argument, 347 },
{ "qstrand", ko_no_argument, 348 },
{ "cap-kalloc", ko_required_argument, 349 },
{ "q-occ-frac", ko_required_argument, 350 },
{ "chain-skip-scale",ko_required_argument,351 },
{ "print-chains", ko_no_argument, 352 },
{ "no-hash-name", ko_no_argument, 353 },
{ "secondary-seq", ko_no_argument, 354 },
{ "ds", ko_no_argument, 355 },
{ "rmq-inner", ko_required_argument, 356 },
{ "spsc", ko_required_argument, 357 },
{ "junc-pen", ko_required_argument, 358 },
{ "pairing", ko_required_argument, 359 },
{ "jump-min-match", ko_required_argument, 360 },
{ "write-junc", ko_no_argument, 361 },
{ "pass1", ko_required_argument, 362 },
{ "spsc-scale", ko_required_argument, 363 },
{ "spsc0", ko_required_argument, 364 },
{ "dbg-seed-occ", ko_no_argument, 501 },
{ "help", ko_no_argument, 'h' },
{ "max-intron-len", ko_required_argument, 'G' },
{ "version", ko_no_argument, 'V' },
@@ -117,12 +131,13 @@ static inline void yes_or_no(mm_mapopt_t *opt, int64_t flag, int long_idx, const
int main(int argc, char *argv[])
{
const char *opt_str = "2aSDw:k:K:t:r:f:Vv:g:G:I:d:XT:s:x:Hcp:M:n:z:A:B:O:E:m:N:Qu:R:hF:LC:yYPo:e:U:";
const char *opt_str = "2aSDw:k:K:t:r:f:Vv:g:G:I:d:XT:s:x:Hcp:M:n:z:A:B:b:O:E:m:N:Qu:R:hF:LC:yYPo:e:U:J:j:";
ketopt_t o = KETOPT_INIT;
mm_mapopt_t opt;
mm_idxopt_t ipt;
int i, c, n_threads = 3, n_parts, old_best_n = -1;
char *fnw = 0, *rg = 0, *junc_bed = 0, *s, *alt_list = 0;
float spsc_scale = 0.7f;
char *fnw = 0, *rg = 0, *fn_bed_junc = 0, *fn_bed_jump = 0, *fn_bed_pass1 = 0, *fn_spsc = 0, *s, *alt_list = 0;
FILE *fp_help = stderr;
mm_idx_reader_t *idx_rdr;
mm_idx_t *mi;
@@ -175,6 +190,7 @@ int main(int argc, char *argv[])
else if (c == 'm') opt.min_chain_score = atoi(o.arg);
else if (c == 'A') opt.a = atoi(o.arg);
else if (c == 'B') opt.b = atoi(o.arg);
else if (c == 'b') opt.transition = atoi(o.arg);
else if (c == 's') opt.min_dp_max = atoi(o.arg);
else if (c == 'C') opt.noncan = atoi(o.arg);
else if (c == 'I') ipt.batch_size = mm_parse_num(o.arg);
@@ -183,7 +199,13 @@ int main(int argc, char *argv[])
else if (c == 'R') rg = o.arg;
else if (c == 'h') fp_help = stdout;
else if (c == '2') opt.flag |= MM_F_2_IO_THREADS;
else if (c == 'o') {
else if (c == 'j') fn_bed_jump = o.arg;
else if (c == 'J') {
int t;
t = atoi(o.arg);
if (t == 0) opt.flag |= MM_F_SPLICE_OLD;
else if (t == 1) opt.flag &= ~MM_F_SPLICE_OLD;
} else if (c == 'o') {
if (strcmp(o.arg, "-") != 0) {
if (freopen(o.arg, "wb", stdout) == NULL) {
fprintf(stderr, "[ERROR]\033[1;31m failed to write the output to file '%s'\033[0m: %s\n", o.arg, strerror(errno));
@@ -202,9 +224,8 @@ int main(int argc, char *argv[])
else if (c == 309) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_ALN_SEQ, n_threads = 1; // --print-aln-seq
else if (c == 310) opt.flag |= MM_F_SPLICE; // --splice
else if (c == 312) opt.flag |= MM_F_NO_LJOIN; // --no-long-join
else if (c == 313) opt.flag |= MM_F_SR; // --sr
else if (c == 317) opt.end_bonus = atoi(o.arg); // --end-bonus
else if (c == 318) opt.flag |= MM_F_INDEPEND_SEG; // --no-pairing
else if (c == 318) opt.flag |= MM_F_INDEPEND_SEG; // --no-pairing (deprecated)
else if (c == 320) ipt.flag |= MM_I_NO_SEQ; // --idx-no-seq
else if (c == 321) opt.anchor_ext_shift = atoi(o.arg); // --end-seed-pen
else if (c == 322) opt.flag |= MM_F_FOR_ONLY; // --for-only
@@ -220,17 +241,42 @@ int main(int argc, char *argv[])
else if (c == 336) opt.flag |= MM_F_HARD_MLEVEL; // --hard-mask-level
else if (c == 337) opt.max_sw_mat = mm_parse_num(o.arg); // --cap-sw-mat
else if (c == 338) opt.max_qlen = mm_parse_num(o.arg); // --max-qlen
else if (c == 340) junc_bed = o.arg; // --junc-bed
else if (c == 340) fn_bed_junc = o.arg; // --junc-bed
else if (c == 341) opt.junc_bonus = atoi(o.arg); // --junc-bonus
else if (c == 342) opt.flag |= MM_F_SAM_HIT_ONLY; // --sam-hit-only
else if (c == 343) opt.chain_gap_scale = atof(o.arg); // --chain-gap-scale
else if (c == 351) opt.chain_skip_scale = atof(o.arg); // --chain-skip-scale
else if (c == 344) alt_list = o.arg; // --alt
else if (c == 345) opt.alt_drop = atof(o.arg); // --alt-drop
else if (c == 346) opt.mask_len = mm_parse_num(o.arg); // --mask-len
else if (c == 348) opt.flag |= MM_F_QSTRAND | MM_F_NO_INV; // --qstrand
else if (c == 349) opt.cap_kalloc = mm_parse_num(o.arg); // --cap-kalloc
else if (c == 350) opt.q_occ_frac = atof(o.arg); // --q-occ-frac
else if (c == 352) mm_dbg_flag |= MM_DBG_PRINT_CHAIN; // --print-chains
else if (c == 353) opt.flag |= MM_F_NO_HASH_NAME; // --no-hash-name
else if (c == 354) opt.flag |= MM_F_SECONDARY_SEQ; // --secondary-seq
else if (c == 355) opt.flag |= MM_F_OUT_DS; // --ds
else if (c == 356) opt.rmq_inner_dist = mm_parse_num(o.arg); // --rmq-inner
else if (c == 357) fn_spsc = o.arg; // --spsc
else if (c == 360) opt.jump_min_match = mm_parse_num(o.arg); // --jump-min-match
else if (c == 361) opt.flag |= MM_F_OUT_JUNC | MM_F_CIGAR; // --write-junc
else if (c == 362) fn_bed_pass1 = o.arg; // --jump-pass1
else if (c == 501) mm_dbg_flag |= MM_DBG_SEED_FREQ; // --dbg-seed-occ
else if (c == 363) spsc_scale = atof(o.arg); // --spsc-scale
else if (c == 358 || c == 364) opt.junc_pen = atoi(o.arg); // --junc-pen or --spsc0
else if (c == 330) {
fprintf(stderr, "[WARNING] \033[1;31m --lj-min-ratio has been deprecated.\033[0m\n");
} else if (c == 313) { // --sr
if (o.arg == 0 || strcmp(o.arg, "dna") == 0) {
opt.flag |= MM_F_SR;
} else if (strcmp(o.arg, "rna") == 0) {
opt.flag |= MM_F_SR_RNA;
} else if (strcmp(o.arg, "no") == 0) {
opt.flag &= ~(uint64_t)(MM_F_SR|MM_F_SR_RNA);
} else if (mm_verbose >= 2) {
opt.flag |= MM_F_SR;
fprintf(stderr, "[WARNING]\033[1;31m --sr only takes 'dna' or 'rna'. Invalid values are assumed to be 'dna'.\033[0m\n");
}
} else if (c == 314) { // --frag
yes_or_no(&opt, MM_F_FRAG_MODE, o.longidx, o.arg, 1);
} else if (c == 315) { // --secondary
@@ -253,7 +299,16 @@ int main(int argc, char *argv[])
} else if (c == 326) { // --dual
yes_or_no(&opt, MM_F_NO_DUAL, o.longidx, o.arg, 0);
} else if (c == 347) { // --rmq
yes_or_no(&opt, MM_F_RMQ, o.longidx, o.arg, 1);
if (o.arg) yes_or_no(&opt, MM_F_RMQ, o.longidx, o.arg, 1);
else opt.flag |= MM_F_RMQ;
} else if (c == 359) { // --pairing
if (strcmp(o.arg, "no") == 0) opt.flag |= MM_F_INDEPEND_SEG;
else if (strcmp(o.arg, "weak") == 0) opt.flag |= MM_F_WEAK_PAIRING, opt.flag &= ~(uint64_t)MM_F_INDEPEND_SEG;
else {
if (strcmp(o.arg, "strong") != 0 && mm_verbose >= 2)
fprintf(stderr, "[WARNING]\033[1;31m unrecognized argument for --pairing; assuming 'strong'.\033[0m\n");
opt.flag &= ~(uint64_t)(MM_F_INDEPEND_SEG|MM_F_WEAK_PAIRING);
}
} else if (c == 'S') {
opt.flag |= MM_F_OUT_CS | MM_F_CIGAR | MM_F_OUT_CS_LONG;
if (mm_verbose >= 2)
@@ -294,10 +349,6 @@ int main(int argc, char *argv[])
if (*s == ',') opt.e2 = strtol(s + 1, &s, 10);
}
}
if ((opt.flag & MM_F_SPLICE) && (opt.flag & MM_F_FRAG_MODE)) {
fprintf(stderr, "[ERROR]\033[1;31m --splice and --frag should not be specified at the same time.\033[0m\n");
return 1;
}
if (!fnw && !(opt.flag&MM_F_CIGAR))
ipt.flag |= MM_I_NO_SEQ;
if (mm_check_opt(&ipt, &opt) < 0)
@@ -314,7 +365,7 @@ int main(int argc, char *argv[])
fprintf(fp_help, " -H use homopolymer-compressed k-mer (preferrable for PacBio)\n");
fprintf(fp_help, " -k INT k-mer size (no larger than 28) [%d]\n", ipt.k);
fprintf(fp_help, " -w INT minimizer window size [%d]\n", ipt.w);
fprintf(fp_help, " -I NUM split index for every ~NUM input bases [4G]\n");
fprintf(fp_help, " -I NUM split index for every ~NUM input bases [8G]\n");
fprintf(fp_help, " -d FILE dump index to FILE []\n");
fprintf(fp_help, " Mapping:\n");
fprintf(fp_help, " -f FLOAT filter out top FLOAT fraction of repetitive minimizers [%g]\n", opt.mid_occ_frac);
@@ -336,6 +387,8 @@ int main(int argc, char *argv[])
fprintf(fp_help, " -z INT[,INT] Z-drop score and inversion Z-drop score [%d,%d]\n", opt.zdrop, opt.zdrop_inv);
fprintf(fp_help, " -s INT minimal peak DP alignment score [%d]\n", opt.min_dp_max);
fprintf(fp_help, " -u CHAR how to find GT-AG. f:transcript strand, b:both strands, n:don't match GT-AG [n]\n");
fprintf(fp_help, " -J INT splice mode. 0: original minimap2 model; 1: miniprot model [1]\n");
fprintf(fp_help, " -j FILE junctions in BED12 to extend *short* RNA-seq alignment []\n");
fprintf(fp_help, " Input/Output:\n");
fprintf(fp_help, " -a output in the SAM format (PAF by default)\n");
fprintf(fp_help, " -o FILE output alignments to FILE [stdout]\n");
@@ -343,21 +396,24 @@ int main(int argc, char *argv[])
fprintf(fp_help, " -R STR SAM read group line in a format like '@RG\\tID:foo\\tSM:bar' []\n");
fprintf(fp_help, " -c output CIGAR in PAF\n");
fprintf(fp_help, " --cs[=STR] output the cs tag; STR is 'short' (if absent) or 'long' [none]\n");
fprintf(fp_help, " --ds output the ds tag, which is an extension to cs\n");
fprintf(fp_help, " --MD output the MD tag\n");
fprintf(fp_help, " --eqx write =/X CIGAR operators\n");
fprintf(fp_help, " -Y use soft clipping for supplementary alignments\n");
fprintf(fp_help, " -y copy FASTA/Q comments to output SAM\n");
fprintf(fp_help, " -t INT number of threads [%d]\n", n_threads);
fprintf(fp_help, " -K NUM minibatch size for mapping [500M]\n");
// fprintf(fp_help, " -v INT verbose level [%d]\n", mm_verbose);
fprintf(fp_help, " --version show version number\n");
fprintf(fp_help, " Preset:\n");
fprintf(fp_help, " -x STR preset (always applied before other options; see minimap2.1 for details) []\n");
fprintf(fp_help, " - map-pb/map-ont - PacBio CLR/Nanopore vs reference mapping\n");
fprintf(fp_help, " - map-hifi - PacBio HiFi reads vs reference mapping\n");
fprintf(fp_help, " - ava-pb/ava-ont - PacBio/Nanopore read overlap\n");
fprintf(fp_help, " - lr:hq - accurate long reads (error rate <1%%) against a reference genome\n");
fprintf(fp_help, " - splice/splice:hq - spliced alignment for long reads/accurate long reads\n");
fprintf(fp_help, " - splice:sr - spliced alignment for short RNA-seq reads\n");
fprintf(fp_help, " - asm5/asm10/asm20 - asm-to-ref mapping, for ~0.1/1/5%% sequence divergence\n");
fprintf(fp_help, " - splice/splice:hq - long-read/Pacbio-CCS spliced alignment\n");
fprintf(fp_help, " - sr - genomic short-read mapping\n");
fprintf(fp_help, " - sr - short reads against a reference\n");
fprintf(fp_help, " - map-pb/map-hifi/map-ont/map-iclr - CLR/HiFi/Nanopore/ICLR vs reference mapping\n");
fprintf(fp_help, " - ava-pb/ava-ont - PacBio CLR/Nanopore read overlap\n");
fprintf(fp_help, "\nSee `man ./minimap2.1' for detailed description of these and other advanced command-line options.\n");
return fp_help == stdout? 0 : 1;
}
@@ -408,9 +464,31 @@ int main(int argc, char *argv[])
__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), mi->n_seq);
if (argc != o.ind + 1) mm_mapopt_update(&opt, mi);
if (mm_verbose >= 3) mm_idx_stat(mi);
if (junc_bed) mm_idx_bed_read(mi, junc_bed, 1);
if (fn_bed_junc) {
mm_idx_bed_read(mi, fn_bed_junc, 1);
if (mi->I == 0 && mm_verbose >= 2)
fprintf(stderr, "[WARNING] failed to load the junction BED file\n");
}
if (fn_bed_jump) {
mm_idx_jjump_read(mi, fn_bed_jump, MM_JUNC_ANNO, -1);
if (mi->J == 0 && mm_verbose >= 2)
fprintf(stderr, "[WARNING] failed to load the jump BED file\n");
}
if (fn_bed_pass1) {
mm_idx_jjump_read(mi, fn_bed_pass1, MM_JUNC_MISC, 5);
if (mi->J == 0 && mm_verbose >= 2)
fprintf(stderr, "[WARNING] failed to load the pass-1 jump BED file\n");
}
if (fn_spsc) {
mm_idx_spsc_read2(mi, fn_spsc, mm_max_spsc_bonus(&opt), spsc_scale);
if (mi->spsc == 0 && mm_verbose >= 2)
fprintf(stderr, "[WARNING] failed to load the splice score file\n");
}
if (alt_list) mm_idx_alt_read(mi, alt_list);
if (argc - (o.ind + 1) == 0) continue; // no query files
if (argc - (o.ind + 1) == 0) {
mm_idx_destroy(mi);
continue; // no query files
}
ret = 0;
if (!(opt.flag & MM_F_FRAG_MODE)) {
for (i = o.ind + 1; i < argc; ++i) {
+51 -23
View File
@@ -10,11 +10,6 @@
#include "bseq.h"
#include "khash.h"
struct mm_tbuf_s {
void *km;
int rep_len, frag_gap;
};
mm_tbuf_t *mm_tbuf_init(void)
{
mm_tbuf_t *b;
@@ -212,7 +207,7 @@ static void chain_post(const mm_mapopt_t *opt, int max_chain_gap_ref, const mm_i
{
if (!(opt->flag & MM_F_ALL_CHAINS)) { // don't choose primary mapping(s)
mm_set_parent(km, opt->mask_level, opt->mask_len, *n_regs, regs, opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL, opt->alt_drop);
if (n_segs <= 1) mm_select_sub(km, opt->pri_ratio, mi->k*2, opt->best_n, n_regs, regs);
if (n_segs <= 1) mm_select_sub(km, opt->pri_ratio, mi->k*2, opt->best_n, 1, opt->max_gap * 0.8, n_regs, regs);
else mm_select_sub_multi(km, opt->pri_ratio, 0.2f, 0.7f, max_chain_gap_ref, mi->k*2, opt->best_n, n_segs, qlens, n_regs, regs);
}
}
@@ -223,16 +218,16 @@ static mm_reg1_t *align_regs(const mm_mapopt_t *opt, const mm_idx_t *mi, void *k
regs = mm_align_skeleton(km, opt, mi, qlen, seq, n_regs, regs, a); // this calls mm_filter_regs()
if (!(opt->flag & MM_F_ALL_CHAINS)) { // don't choose primary mapping(s)
mm_set_parent(km, opt->mask_level, opt->mask_len, *n_regs, regs, opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL, opt->alt_drop);
mm_select_sub(km, opt->pri_ratio, mi->k*2, opt->best_n, n_regs, regs);
mm_select_sub(km, opt->pri_ratio, mi->k*2, opt->best_n, 0, opt->max_gap * 0.8, n_regs, regs);
mm_set_sam_pri(*n_regs, regs);
}
return regs;
}
void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, int *n_regs, mm_reg1_t **regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname)
void mm_map_frag_core(const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, int *n_regs, mm_reg1_t **regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname)
{
int i, j, rep_len, qlen_sum, n_regs0, n_mini_pos;
int max_chain_gap_qry, max_chain_gap_ref, is_splice = !!(opt->flag & MM_F_SPLICE), is_sr = !!(opt->flag & MM_F_SR);
int max_chain_gap_qry, max_chain_gap_ref, is_splice = !!(opt->flag & MM_F_SPLICE), is_sr = !!(opt->flag & MM_F_SR), is_sr_rna = !!(opt->flag & MM_F_SR_RNA);
uint32_t hash;
int64_t n_a;
uint64_t *u, *mini_pos;
@@ -240,6 +235,7 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
mm128_v mv = {0,0,0};
mm_reg1_t *regs0;
km_stat_t kmst;
float chn_pen_gap, chn_pen_skip;
for (i = 0, qlen_sum = 0; i < n_segs; ++i)
qlen_sum += qlens[i], n_regs[i] = 0, regs[i] = 0;
@@ -247,11 +243,12 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
if (qlen_sum == 0 || n_segs <= 0 || n_segs > MM_MAX_SEG) return;
if (opt->max_qlen > 0 && qlen_sum > opt->max_qlen) return;
hash = qname? __ac_X31_hash_string(qname) : 0;
hash = qname && !(opt->flag & MM_F_NO_HASH_NAME)? __ac_X31_hash_string(qname) : 0;
hash ^= __ac_Wang_hash(qlen_sum) + __ac_Wang_hash(opt->seed);
hash = __ac_Wang_hash(hash);
collect_minimizers(b->km, opt, mi, n_segs, qlens, seqs, &mv);
if (opt->q_occ_frac > 0.0f) mm_seed_mz_flt(b->km, &mv, opt->mid_occ, opt->q_occ_frac);
if (opt->flag & MM_F_HEAP_SORT) a = collect_seed_hits_heap(b->km, opt, opt->mid_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
else a = collect_seed_hits(b->km, opt, opt->mid_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
@@ -273,12 +270,14 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
if (max_chain_gap_ref < opt->max_gap) max_chain_gap_ref = opt->max_gap;
} else max_chain_gap_ref = opt->max_gap;
chn_pen_gap = opt->chain_gap_scale * 0.01 * mi->k;
chn_pen_skip = opt->chain_skip_scale * 0.01 * mi->k;
if (opt->flag & MM_F_RMQ) {
a = mg_lchain_rmq(opt->max_gap, opt->rmq_inner_dist, opt->bw, opt->max_chain_skip, opt->rmq_size_cap, opt->min_cnt, opt->min_chain_score,
opt->chain_gap_scale * 0.01 * mi->k, 0.0f, n_a, a, &n_regs0, &u, b->km);
chn_pen_gap, chn_pen_skip, n_a, a, &n_regs0, &u, b->km);
} else {
a = mg_lchain_dp(max_chain_gap_ref, max_chain_gap_qry, opt->bw, opt->max_chain_skip, opt->max_chain_iter, opt->min_cnt, opt->min_chain_score,
opt->chain_gap_scale * 0.01 * mi->k, 0.0f, is_splice, n_segs, n_a, a, &n_regs0, &u, b->km);
chn_pen_gap, chn_pen_skip, is_splice, n_segs, n_a, a, &n_regs0, &u, b->km);
}
if (opt->bw_long > opt->bw && (opt->flag & (MM_F_SPLICE|MM_F_SR|MM_F_NO_LJOIN)) == 0 && n_segs == 1 && n_regs0 > 1) { // re-chain/long-join for long sequences
@@ -289,7 +288,7 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
kfree(b->km, u);
radix_sort_128x(a, a + n_a);
a = mg_lchain_rmq(opt->max_gap, opt->rmq_inner_dist, opt->bw_long, opt->max_chain_skip, opt->rmq_size_cap, opt->min_cnt, opt->min_chain_score,
opt->chain_gap_scale * 0.01 * mi->k, 0.0f, n_a, a, &n_regs0, &u, b->km);
chn_pen_gap, chn_pen_skip, n_a, a, &n_regs0, &u, b->km);
}
} else if (opt->max_occ > opt->mid_occ && rep_len > 0 && !(opt->flag & MM_F_RMQ)) { // re-chain, mostly for short reads
int rechain = 0;
@@ -312,7 +311,7 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
if (opt->flag & MM_F_HEAP_SORT) a = collect_seed_hits_heap(b->km, opt, opt->max_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
else a = collect_seed_hits(b->km, opt, opt->max_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
a = mg_lchain_dp(max_chain_gap_ref, max_chain_gap_qry, opt->bw, opt->max_chain_skip, opt->max_chain_iter, opt->min_cnt, opt->min_chain_score,
opt->chain_gap_scale * 0.01 * mi->k, 0.0f, is_splice, n_segs, n_a, a, &n_regs0, &u, b->km);
chn_pen_gap, chn_pen_skip, is_splice, n_segs, n_a, a, &n_regs0, &u, b->km);
}
}
b->frag_gap = max_chain_gap_ref;
@@ -324,20 +323,22 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
mm_hit_sort(b->km, &n_regs0, regs0, opt->alt_drop); // this step can be merged into mm_gen_regs(); will do if this shows up in profile
}
if (mm_dbg_flag & MM_DBG_PRINT_SEED)
if (mm_dbg_flag & (MM_DBG_PRINT_SEED|MM_DBG_PRINT_CHAIN))
for (j = 0; j < n_regs0; ++j)
for (i = regs0[j].as; i < regs0[j].as + regs0[j].cnt; ++i)
fprintf(stderr, "CN\t%d\t%s\t%d\t%c\t%d\t%d\t%d\n", j, mi->seq[a[i].x<<1>>33].name, (int32_t)a[i].x, "+-"[a[i].x>>63], (int32_t)a[i].y, (int32_t)(a[i].y>>32&0xff),
i == regs0[j].as? 0 : ((int32_t)a[i].y - (int32_t)a[i-1].y) - ((int32_t)a[i].x - (int32_t)a[i-1].x));
chain_post(opt, max_chain_gap_ref, mi, b->km, qlen_sum, n_segs, qlens, &n_regs0, regs0, a);
if (!is_sr && !(opt->flag&MM_F_QSTRAND))
if (!is_sr && !(opt->flag&MM_F_QSTRAND)) {
mm_est_err(mi, qlen_sum, n_regs0, regs0, a, n_mini_pos, mini_pos);
n_regs0 = mm_filter_strand_retained(n_regs0, regs0);
}
if (n_segs == 1) { // uni-segment
regs0 = align_regs(opt, mi, b->km, qlens[0], seqs[0], &n_regs0, regs0, a);
regs0 = (mm_reg1_t*)realloc(regs0, sizeof(*regs0) * n_regs0);
mm_set_mapq(b->km, n_regs0, regs0, opt->min_chain_score, opt->a, rep_len, is_sr);
mm_set_mapq2(b->km, n_regs0, regs0, opt->min_chain_score, opt->a, rep_len, is_sr || is_sr_rna, is_splice);
n_regs[0] = n_regs0, regs[0] = regs0;
} else { // multi-segment
mm_seg_t *seg;
@@ -346,7 +347,7 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
for (i = 0; i < n_segs; ++i) {
mm_set_parent(b->km, opt->mask_level, opt->mask_len, n_regs[i], regs[i], opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL, opt->alt_drop); // update mm_reg1_t::parent
regs[i] = align_regs(opt, mi, b->km, qlens[i], seqs[i], &n_regs[i], regs[i], seg[i].a);
mm_set_mapq(b->km, n_regs[i], regs[i], opt->min_chain_score, opt->a, rep_len, is_sr);
mm_set_mapq2(b->km, n_regs[i], regs[i], opt->min_chain_score, opt->a, rep_len, is_sr || is_sr_rna, is_splice);
}
mm_seg_free(b->km, n_segs, seg);
if (n_segs == 2 && opt->pe_ori >= 0 && (opt->flag&MM_F_CIGAR))
@@ -358,6 +359,10 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
kfree(b->km, u);
kfree(b->km, mini_pos);
if (mi->J && n_segs == 1 && is_splice)
for (i = 0; i < n_regs0; ++i)
mm_jump_split(b->km, mi, opt, qlens[0], (const uint8_t*)seqs[0], &regs0[i], 0);
if (b->km) {
km_stat(b->km, &kmst);
if (mm_dbg_flag & MM_DBG_PRINT_QNAME)
@@ -372,6 +377,18 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
}
}
void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, int *n_regs, mm_reg1_t **regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname)
{
if ((opt->flag & MM_F_WEAK_PAIRING) && n_segs == 2 && opt->pe_ori >= 0 && (opt->flag&MM_F_CIGAR)) {
int i;
for (i = 0; i < n_segs; ++i)
mm_map_frag_core(mi, 1, &qlens[i], &seqs[i], &n_regs[i], &regs[i], b, opt, qname);
mm_pair(b->km, opt->max_gap_ref, opt->pe_bonus, opt->a * 2 + opt->b, opt->a, qlens, n_regs, regs);
} else {
mm_map_frag_core(mi, n_segs, qlens, seqs, n_regs, regs, b, opt, qname);
}
}
mm_reg1_t *mm_map(const mm_idx_t *mi, int qlen, const char *seq, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname)
{
mm_reg1_t *regs;
@@ -446,6 +463,10 @@ static void worker_for(void *_data, long i, int tid) // kt_for() callback
r->qs = qlens[j] - r->qe;
r->qe = qlens[j] - t;
r->rev = !r->rev;
if (r->p) {
if (r->p->trans_strand == 1) r->p->trans_strand = 2;
else if (r->p->trans_strand == 2) r->p->trans_strand = 1;
}
}
}
if (mm_dbg_flag & MM_DBG_PRINT_QNAME)
@@ -505,10 +526,10 @@ static void merge_hits(step_t *s)
mm_hit_sort(km, &s->n_reg[k], s->reg[k], opt->alt_drop);
mm_set_parent(km, opt->mask_level, opt->mask_len, s->n_reg[k], s->reg[k], opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL, opt->alt_drop);
if (!(opt->flag & MM_F_ALL_CHAINS)) {
mm_select_sub(km, opt->pri_ratio, s->p->mi->k*2, opt->best_n, &s->n_reg[k], s->reg[k]);
mm_select_sub(km, opt->pri_ratio, s->p->mi->k*2, opt->best_n, 0, opt->max_gap * 0.8, &s->n_reg[k], s->reg[k]);
mm_set_sam_pri(s->n_reg[k], s->reg[k]);
}
mm_set_mapq(km, s->n_reg[k], s->reg[k], opt->min_chain_score, opt->a, rep_len, !!(opt->flag & MM_F_SR));
mm_set_mapq2(km, s->n_reg[k], s->reg[k], opt->min_chain_score, opt->a, rep_len, !!(opt->flag & (MM_F_SR|MM_F_SR_RNA)), !!(opt->flag & MM_F_SPLICE));
}
if (s->n_seg[f] == 2 && opt->pe_ori >= 0 && (opt->flag&MM_F_CIGAR))
mm_pair(km, frag_gap_part[0], opt->pe_bonus, opt->a * 2 + opt->b, opt->a, qlens, &s->n_reg[k0], &s->reg[k0]);
@@ -577,23 +598,30 @@ static void *worker_pipeline(void *shared, int step, void *in)
mm_err_fwrite(r->p, r->p->capacity, 4, p->fp_split);
}
}
} else if (p->opt->flag & MM_F_OUT_JUNC) { // extra logic for --write-junc
for (j = 0; j < s->n_reg[i]; ++j) {
const mm_reg1_t *r = &s->reg[i][j];
if (r->id != r->parent || r->mapq < 10) continue;
mm_write_junc(&p->str, mi, t, r);
if (p->str.l > 0) mm_err_puts(p->str.s);
}
} else if (s->n_reg[i] > 0) { // the query has at least one hit
for (j = 0; j < s->n_reg[i]; ++j) {
mm_reg1_t *r = &s->reg[i][j];
const mm_reg1_t *r = &s->reg[i][j];
assert(!r->sam_pri || r->id == r->parent);
if ((p->opt->flag & MM_F_NO_PRINT_2ND) && r->id != r->parent)
continue;
if (p->opt->flag & MM_F_OUT_SAM)
mm_write_sam3(&p->str, mi, t, i - seg_st, j, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag, s->rep_len[i]);
else
mm_write_paf3(&p->str, mi, t, r, km, p->opt->flag, s->rep_len[i]);
mm_write_paf4(&p->str, mi, t, r, km, p->opt->flag, s->rep_len[i], s->n_seg[k], i - seg_st);
mm_err_puts(p->str.s);
}
} else if ((p->opt->flag & MM_F_PAF_NO_HIT) || ((p->opt->flag & MM_F_OUT_SAM) && !(p->opt->flag & MM_F_SAM_HIT_ONLY))) { // output an empty hit, if requested
if (p->opt->flag & MM_F_OUT_SAM)
mm_write_sam3(&p->str, mi, t, i - seg_st, -1, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag, s->rep_len[i]);
else
mm_write_paf3(&p->str, mi, t, 0, 0, p->opt->flag, s->rep_len[i]);
mm_write_paf4(&p->str, mi, t, 0, 0, p->opt->flag, s->rep_len[i], s->n_seg[k], i - seg_st);
mm_err_puts(p->str.s);
}
}
+61 -33
View File
@@ -5,40 +5,49 @@
#include <stdio.h>
#include <sys/types.h>
#define MM_F_NO_DIAG 0x001 // no exact diagonal hit
#define MM_F_NO_DUAL 0x002 // skip pairs where query name is lexicographically larger than target name
#define MM_F_CIGAR 0x004
#define MM_F_OUT_SAM 0x008
#define MM_F_NO_QUAL 0x010
#define MM_F_OUT_CG 0x020
#define MM_F_OUT_CS 0x040
#define MM_F_SPLICE 0x080 // splice mode
#define MM_F_SPLICE_FOR 0x100 // match GT-AG
#define MM_F_SPLICE_REV 0x200 // match CT-AC, the reverse complement of GT-AG
#define MM_F_NO_LJOIN 0x400
#define MM_F_OUT_CS_LONG 0x800
#define MM_F_SR 0x1000
#define MM_F_FRAG_MODE 0x2000
#define MM_F_NO_PRINT_2ND 0x4000
#define MM_F_2_IO_THREADS 0x8000
#define MM_F_LONG_CIGAR 0x10000
#define MM_F_INDEPEND_SEG 0x20000
#define MM_F_SPLICE_FLANK 0x40000
#define MM_F_SOFTCLIP 0x80000
#define MM_F_FOR_ONLY 0x100000
#define MM_F_REV_ONLY 0x200000
#define MM_F_HEAP_SORT 0x400000
#define MM_F_ALL_CHAINS 0x800000
#define MM_F_OUT_MD 0x1000000
#define MM_F_COPY_COMMENT 0x2000000
#define MM_F_EQX 0x4000000 // use =/X instead of M
#define MM_F_PAF_NO_HIT 0x8000000 // output unmapped reads to PAF
#define MM_F_NO_END_FLT 0x10000000
#define MM_F_HARD_MLEVEL 0x20000000
#define MM_F_SAM_HIT_ONLY 0x40000000
#define MM_VERSION "2.30-r1287"
#define MM_F_NO_DIAG (0x001LL) // no exact diagonal hit
#define MM_F_NO_DUAL (0x002LL) // skip pairs where query name is lexicographically larger than target name
#define MM_F_CIGAR (0x004LL)
#define MM_F_OUT_SAM (0x008LL)
#define MM_F_NO_QUAL (0x010LL)
#define MM_F_OUT_CG (0x020LL)
#define MM_F_OUT_CS (0x040LL)
#define MM_F_SPLICE (0x080LL) // splice mode
#define MM_F_SPLICE_FOR (0x100LL) // match GT-AG
#define MM_F_SPLICE_REV (0x200LL) // match CT-AC, the reverse complement of GT-AG
#define MM_F_NO_LJOIN (0x400LL)
#define MM_F_OUT_CS_LONG (0x800LL)
#define MM_F_SR (0x1000LL)
#define MM_F_FRAG_MODE (0x2000LL)
#define MM_F_NO_PRINT_2ND (0x4000LL)
#define MM_F_2_IO_THREADS (0x8000LL)
#define MM_F_LONG_CIGAR (0x10000LL)
#define MM_F_INDEPEND_SEG (0x20000LL)
#define MM_F_SPLICE_FLANK (0x40000LL)
#define MM_F_SOFTCLIP (0x80000LL)
#define MM_F_FOR_ONLY (0x100000LL)
#define MM_F_REV_ONLY (0x200000LL)
#define MM_F_HEAP_SORT (0x400000LL)
#define MM_F_ALL_CHAINS (0x800000LL)
#define MM_F_OUT_MD (0x1000000LL)
#define MM_F_COPY_COMMENT (0x2000000LL)
#define MM_F_EQX (0x4000000LL) // use =/X instead of M
#define MM_F_PAF_NO_HIT (0x8000000LL) // output unmapped reads to PAF
#define MM_F_NO_END_FLT (0x10000000LL)
#define MM_F_HARD_MLEVEL (0x20000000LL)
#define MM_F_SAM_HIT_ONLY (0x40000000LL)
#define MM_F_RMQ (0x80000000LL)
#define MM_F_QSTRAND (0x100000000LL)
#define MM_F_NO_INV (0x200000000LL)
#define MM_F_NO_HASH_NAME (0x400000000LL)
#define MM_F_SPLICE_OLD (0x800000000LL)
#define MM_F_SECONDARY_SEQ (0x1000000000LL) //output SEQ field for seqondary alignments using hard clipping
#define MM_F_OUT_DS (0x2000000000LL)
#define MM_F_WEAK_PAIRING (0x4000000000LL)
#define MM_F_SR_RNA (0x8000000000LL)
#define MM_F_OUT_JUNC (0x10000000000LL)
#define MM_I_HPC 0x1
#define MM_I_NO_SEQ 0x2
@@ -85,6 +94,8 @@ typedef struct {
uint32_t *S; // 4-bit packed sequence
struct mm_idx_bucket_s *B; // index (hidden)
struct mm_idx_intv_s *I; // intervals (hidden)
struct mm_idx_spsc_s *spsc;// splice score (hidden)
struct mm_idx_jjump_s *J; // junctions to create jumps (hidden)
void *km, *h;
} mm_idx_t;
@@ -92,6 +103,7 @@ typedef struct {
typedef struct {
uint32_t capacity; // the capacity of cigar[]
int32_t dp_score, dp_max, dp_max2; // DP score; score of the max-scoring segment; score of the best alternate mappings
int32_t dp_max0; // DP score before mm_update_dp_max() adjustment
uint32_t n_ambi:30, trans_strand:2; // number of ambiguous bases; transcript strand: 0 for unknown, 1 for +, 2 for -
uint32_t n_cigar; // number of cigar operations in cigar[]
uint32_t cigar[];
@@ -108,7 +120,7 @@ typedef struct {
int32_t mlen, blen; // seeded exact match length; seeded alignment block length
int32_t n_sub; // number of suboptimal mappings
int32_t score0; // initial chaining score (before chain merging/spliting)
uint32_t mapq:8, split:2, rev:1, inv:1, sam_pri:1, proper_frag:1, pe_thru:1, seg_split:1, seg_id:8, split_inv:1, is_alt:1, dummy:6;
uint32_t mapq:8, split:2, rev:1, inv:1, sam_pri:1, proper_frag:1, pe_thru:1, seg_split:1, seg_id:8, split_inv:1, is_alt:1, strand_retained:1, is_spliced:1, dummy:4;
uint32_t hash;
float div;
mm_extra_t *p;
@@ -135,6 +147,7 @@ typedef struct {
int min_cnt; // min number of minimizers on each chain
int min_chain_score; // min chaining score
float chain_gap_scale;
float chain_skip_scale;
int rmq_size_cap, rmq_inner_dist;
int rmq_rescue_size;
float rmq_rescue_ratio;
@@ -147,9 +160,11 @@ typedef struct {
float alt_drop;
int a, b, q, e, q2, e2; // matching score, mismatch, gap-open and gap-ext penalties
int transition; // transition mismatch score (A:G, C:T)
int sc_ambi; // score when one or both bases are "N"
int noncan; // cost of non-canonical splicing sites
int junc_bonus;
int junc_bonus; // bonus for a splice site in annotation
int junc_pen; // penalty for GT- or -AG not scored in --spsc
int zdrop, zdrop_inv; // break alignment if alignment score drops too fast along the diagonal
int end_bonus;
int min_dp_max; // drop an alignment if the score of the max scoring segment is below this threshold
@@ -162,7 +177,10 @@ typedef struct {
int pe_ori, pe_bonus;
int32_t jump_min_match;
float mid_occ_frac; // only used by mm_mapopt_update(); see below
float q_occ_frac;
int32_t min_mid_occ, max_mid_occ;
int32_t mid_occ; // ignore seeds with occurrences above this threshold
int32_t max_occ, max_max_occ, occ_dist;
@@ -186,6 +204,11 @@ typedef struct {
} mm_idx_reader_t;
// memory buffer for thread-local storage during mapping
struct mm_tbuf_s {
void *km;
int rep_len, frag_gap;
};
typedef struct mm_tbuf_s mm_tbuf_t;
// global variables
@@ -396,6 +419,11 @@ int mm_idx_alt_read(mm_idx_t *mi, const char *fn);
int mm_idx_bed_read(mm_idx_t *mi, const char *fn, int read_junc);
int mm_idx_bed_junc(const mm_idx_t *mi, int32_t ctg, int32_t st, int32_t en, uint8_t *s);
int mm_max_spsc_bonus(const mm_mapopt_t *mo);
int32_t mm_idx_spsc_read(mm_idx_t *idx, const char *fn, int32_t max_sc);
int32_t mm_idx_spsc_read2(mm_idx_t *idx, const char *fn, int32_t max_sc, float scale);
int64_t mm_idx_spsc_get(const mm_idx_t *db, int32_t cid, int64_t st0, int64_t en0, int32_t rev, uint8_t *sc);
// deprecated APIs for backward compatibility
void mm_mapopt_init(mm_mapopt_t *opt);
mm_idx_t *mm_idx_build(const char *fn, int w, int k, int flag, int n_threads);
+181 -48
View File
@@ -1,4 +1,4 @@
.TH minimap2 1 "6 July 2021" "minimap2-2.21 (r1071)" "Bioinformatics tools"
.TH minimap2 1 "15 June 2025" "minimap2-2.30 (r1287)" "Bioinformatics tools"
.SH NAME
.PP
minimap2 - mapping and alignment between collections of DNA sequences
@@ -77,7 +77,7 @@ SAM format.
Minimizer k-mer length [15]
.TP
.BI -w \ INT
Minimizer window size [2/3 of k-mer length]. A minimizer is the smallest k-mer
Minimizer window size [10]. A minimizer is the smallest k-mer
in a window of w consecutive k-mers.
.TP
.B -H
@@ -88,16 +88,17 @@ on the HPC sequence.
.BI -I \ NUM
Load at most
.I NUM
target bases into RAM for indexing [4G]. If there are more than
target bases into RAM for indexing [8G]. If there are more than
.I NUM
bases in
.IR target.fa ,
minimap2 needs to read
.I query.fa
multiple times to map it against each batch of target sequences.
multiple times to map it against each batch of target sequences. This would create a multi-part index.
.I NUM
may be ending with k/K/m/M/g/G. NB: mapping quality is incorrect given a
multi-part index.
multi-part index. See also option
.BR --split-prefix .
.TP
.B --idx-no-seq
Don't store target sequences in the index. It saves disk space and memory but
@@ -151,10 +152,16 @@ Lower and upper bounds of k-mer occurrences [10,1000000]. The final k-mer occurr
.BR -f }}.
This option prevents excessively small or large
.B -f
estimated from the input reference. It deprecates
estimated from the input reference. Available since r1034 and deprecating
.B --min-occ-floor
in earlier versions of minimap2.
.TP
.BI --q-occ-frac \ FLOAT
Discard a query minimizer if its occurrence is higher than
.I FLOAT
fraction of query minimizers and than the reference occurrence threshold
[0.01]. Set 0 to disable. Available since r1105.
.TP
.BI -e \ INT
Sample a high-frequency minimizer every
.I INT
@@ -248,6 +255,11 @@ or more of the shorter chain [0.5]
Use the minigraph chaining algorithm [no]. The minigraph algorithm is better
for aligning contigs through long INDELs.
.TP
.BI --rmq-inner \ NUM
Apply full dynamic programming for anchors within distance
.I NUM
[1000].
.TP
.B --hard-mask-level
Honor option
.B -M
@@ -285,11 +297,13 @@ maximum alignment gap is mostly controlled by
.B --splice
Enable the splice alignment mode.
.TP
.B --sr
Enable short-read alignment heuristics. In the short-read mode, minimap2
applies a second round of chaining with a higher minimizer occurrence threshold
if no good chain is found. In addition, minimap2 attempts to patch gaps between
seeds with ungapped alignment.
.BR --sr [= no | dna | rna ]
Enable short-read alignment heuristics [no]. If this option is used with no argument,
.RB ` dna '
is set. In the DNA short-read mode, minimap2 applies a second round of chaining
with a higher minimizer occurrence threshold if no good chain is found. In
addition, minimap2 attempts to patch gaps between seeds with ungapped
alignment.
.TP
.BI --split-prefix \ STR
Prefix to create temporary files. Typically used for a multi-part index.
@@ -309,9 +323,8 @@ Only map to the reverse complement strand of the reference sequences.
If yes, sort anchors with heap merge, instead of radix sort. Heap merge is
faster for short reads, but slower for long reads. [no]
.TP
.B --no-pairing
Treat two reads in a pair as independent reads. The mate related fields in SAM
are still properly populated.
.B --no-hash-name
Produce the same alignment for identical sequences regardless of their sequence names.
.SS Alignment options
.TP 10
.BI -A \ INT
@@ -320,6 +333,10 @@ Matching score [2]
.BI -B \ INT
Mismatching penalty [4]
.TP
.BI -b \ INT
Mismatching penalty for transitions [same as
.BR -B ].
.TP
.BI -O \ INT1[,INT2]
Gap open penalty [4,24]. If
.I INT2
@@ -333,10 +350,28 @@ costs
.RI min{ O1 + k * E1 , O2 + k * E2 }.
In the splice mode, the second gap penalties are not used.
.TP
.BI -J \ INT
Splice model [1]. 0 for the original minimap2 splice model that always penalizes non-GT-AG splicing;
1 for the miniprot model that considers non-GT-AG. Option
.B -C
has no effect with the default
.BR -J1 .
.TP
.BR -j \ FILE
Junctions used to extend alignment towards ends of reads [].
.I FILE
can be gene annotations in the BED12 format (aka 12-column BED), or intron
positions in 5-column BED with the strand column required. BED12 file can be
converted from GTF/GFF3 with `paftools.js gff2bed anno.gtf'. This option is
intended for short RNA-seq reads, while
.B --junc-bed
for long noisy RNA-seq reads.
.TP
.BI -C \ INT
Cost for a non-canonical GT-AG splicing (effective with
.BR --splice )
[0]
.B --splice
.BR -J0 )
[0].
.TP
.BI -z \ INT1[,INT2]
Truncate an alignment if the running alignment score drops too quickly along
@@ -373,7 +408,16 @@ no attempt to match GT-AG [n]
Score bonus when alignment extends to the end of the query sequence [0].
.TP
.BI --score-N \ INT
Score of a mismatch involving ambiguous bases [1].
Penalty of a mismatch involving ambiguous bases [1].
.TP
.BR --pairing = strong | weak | no
How to pair paired-end reads [strong].
.RB ` no '
for aligning the two ends in a pair independently with no `properly paired' set.
.RB ` weak '
for aligning the two ends independently and then pairing the hits.
.RB ` strong '
for jointly aligning and pairing the two ends.
.TP
.BR --splice-flank = yes | no
Assume the next base to a
@@ -392,16 +436,49 @@ on SIRV data, please add
.B --splice-flank=no
to the command line.
.TP
.BR --spsc \ FILE
Splice scores []. Each line consists of five fields: 1) contig, 2) offset, 3) `+' or `-', 4) `D' or `A', and 5) score,
where offset is the number of bases before a splice junction, `D' indicates the
line corresponds to a donor site and `A' for an acceptor site.
A positive score suggests the junction is preferred and a negative score
suggests the junction is not preferred.
.TP
.BR --spsc0 \ INT
Penalty for positions not in
.I FILE
specified by
.B --spsc
[5]. Effective with
.B --spsc
but not
.BR --junc-bed .
.TP
.BR --spsc-scale \ FLOAT
Scale splice scores in
.B --spsc
by
.IR FLOAT
rounded to the nearest integer [0.7].
.TP
.BR --junc-bed \ FILE
Gene annotations in the BED12 format (aka 12-column BED), or intron positions
in 5-column BED. With this option, minimap2 prefers splicing in annotations.
BED12 file can be converted from GTF/GFF3 with `paftools.js gff2bed anno.gtf'
[].
Junctions to prefer during base alignment [].
Same format as
.BR -j .
It is
.I NOT
recommended to apply this option to short RNA-seq reads. This would increase
run time with little improvement to junction accuracy.
.TP
.BR --junc-bonus \ INT
Score bonus for a splice donor or acceptor found in annotation (effective with
.BR --junc-bed )
[9].
Score bonus for a splice donor or acceptor found in annotation [9]. Effective with
.B --junc-bed
but not
.BR --spsc .
.TP
.BR --jump-min-match \ INT
Minimum matching length to create a jump [3]. Equivalent to
.B STAR
.BR --alignSJDBoverhangMin .
.TP
.BI --end-seed-pen \ INT
Drop a terminal anchor if
@@ -423,6 +500,11 @@ alignment.
Skip alignment if the DP matrix size is above
.IR NUM .
Set 0 to disable [100m].
.TP
.BI --cap-kalloc \ NUM
Free thread-local kalloc memory reservoir if after the alignment the size of the reservoir above
.IR NUM .
Set 0 to disable [500m].
.SS Input/output options
.TP 10
.B -a
@@ -454,20 +536,13 @@ Copy input FASTA/Q comments to output.
.B -c
Generate CIGAR. In PAF, the CIGAR is written to the `cg' custom tag.
.TP
.BI --cs[= STR ]
.BR --cs [= short | long ]
Output the
.B cs
tag.
.I STR
can be either
.I short
or
.IR long .
If no
.I STR
is given,
.I short
is assumed. [none]
If no argument is given,
.RB ` short '
is set. [none]
.TP
.B --MD
Output the MD tag (see the SAM spec).
@@ -478,6 +553,29 @@ Output =/X CIGAR operators for sequence match/mismatch.
.B -Y
In SAM output, use soft clipping for supplementary alignments.
.TP
.B --secondary-seq
In SAM output, show query sequences for secondary alignments.
.TP
.B --write-junc
Output splice junctions in 6-column BED: contig name, start, end,
read name, score and strand. Score is the sum of donor and acceptor scores,
where GT gets 3, GC gets 2 and AT gets 1 at donor sites,
while AG gets 3 and AC gets 1 at acceptor sites.
Alignments with mapping quality below 10 are ignored.
.TP
.BI --pass1 \ FILE
Junctions BED file outputted by
.B --write-junc
[]. Rows with scores lower than 5 are ignored. When both
.B -j
and
.B --pass1
are present, junctions in
.B -j
are preferred over in
.BR --pass1
when there is ambiguity.
.TP
.BI --seed \ INT
Integer seed for randomizing equally best hits. Minimap2 hashes
.I INT
@@ -538,42 +636,70 @@ are:
Align noisy long reads of ~10% error rate to a reference genome. This is the
default mode.
.TP
.B lr:hq
Align accurate long reads (error rate <1%) to a reference genome
.RB ( -k19
.B -w19 -U50,500
.BR -g10k ).
This was recommended by ONT developers for recent Nanopore reads
produced with chemistry v14 that can reach ~99% in accuracy.
It was shown to work better for accurate Nanopore reads
than
.BR map-hifi .
.TP
.B map-hifi
Align PacBio high-fidelity (HiFi) reads to a reference genome
.RB ( -k19
.B -w19 -U50,500 -g10k -A1 -B4 -O6,26 -E2,1
.RB ( -xlr:hq
.B -A1 -B4 -O6,26 -E2,1
.BR -s200 ).
It differs from
.B lr:hq
only in scoring. It has not been tested whether
.B lr:hq
would work better for PacBio HiFi reads.
.TP
.B map-pb
Align older PacBio continuous long (CLR) reads to a reference genome
.RB ( -Hk19 ).
Note that this data type is effectively deprecated by HiFi.
Unless you work on very old data, you probably want to use
.B map-hifi
or
.BR lr:hq .
.TP
.B map-iclr
Align Illumina Complete Long Reads (ICLR) to a reference genome
.RB ( -k19
.B -B6 -b4
.BR -O10,50 ).
This was recommended by Illumina developers.
.TP
.B asm5
Long assembly to reference mapping
.RB ( -k19
.B -w19 -U50,500 --rmq -r100k -g10k -A1 -B19 -O39,81 -E3,1 -s200 -z200
.B -w19 -U50,500 --rmq -r1k,100k -g10k -A1 -B19 -O39,81 -E3,1 -s200 -z200
.BR -N50 ).
Typically, the alignment will not extend to regions with 5% or higher sequence
divergence. Only use this preset if the average divergence is far below 5%.
divergence. Use this preset if the average divergence is not much higher than 0.1%.
.TP
.B asm10
Long assembly to reference mapping
.RB ( -k19
.B -w19 -U50,500 --rmq -r100k -g10k -A1 -B9 -O16,41 -E2,1 -s200 -z200
.B -w19 -U50,500 --rmq -r1k,100k -g10k -A1 -B9 -O16,41 -E2,1 -s200 -z200
.BR -N50 ).
Up to 10% sequence divergence.
Use this if the average divergence is around 1%.
.TP
.B asm20
Long assembly to reference mapping
.RB ( -k19
.B -w10 -U50,500 --rmq -r100k -g10k -A1 -B4 -O6,26 -E2,1 -s200 -z200
.B -w10 -U50,500 --rmq -r1k,100k -g10k -A1 -B4 -O6,26 -E2,1 -s200 -z200
.BR -N50 ).
Up to 20% sequence divergence.
Use this if the average divergence is around several percent.
.TP
.B splice
Long-read spliced alignment
.RB ( -k15
.B -w5 --splice -g2k -G200k -A1 -B2 -O2,32 -E1,0 -b0 -C9 -z200 -ub --junc-bonus=9 --cap-sw-mem=0
.B -w5 --splice -g2k -G200k -A1 -B2 -O2,32 -E1,0 -C9 -z200 -ub --junc-bonus=9 --cap-sw-mem=0
.BR --splice-flank=yes ).
In the splice mode, 1) long deletions are taken as introns and represented as
the
@@ -584,15 +710,21 @@ costs are different during chaining; 4) the computation of the
tag ignores introns to demote hits to pseudogenes.
.TP
.B splice:hq
Long-read splice alignment for PacBio CCS reads
Spliced alignment for accurate long RNA-seq reads such as PacBio iso-seq
.RB ( -xsplice
.B -C5 -O6,24
.BR -B4 ).
.TP
.B splice:sr
Spliced alignment for short RNA-seq reads
.RB ( -xsplice:hq
.B --frag=yes -m25 -s40 -2K100m --heap-sort=yes --pairing=weak --sr=rna --min-dp-len=20
.BR --secondary=no ).
.TP
.B sr
Short single-end reads without splicing
Short-read alignment without splicing
.RB ( -k21
.B -w11 --sr --frag=yes -A2 -B8 -O12,32 -E2,1 -b0 -r100 -p.5 -N20 -f1000,5000 -n2 -m20
.B -w11 --sr --frag=yes -A2 -B8 -O12,32 -E2,1 -r100 -p.5 -N20 -f1000,5000 -n2 -m25
.B -s40 -g100 -2K50m --heap-sort=yes
.BR --secondary=no ).
.TP
@@ -665,7 +797,7 @@ s2 i Chaining score of the best secondary chain
NM i Total number of mismatches and gaps in the alignment
MD Z To generate the ref sequence in the alignment
AS i DP alignment score
SA Z List of other supplementary alignments
SA Z List of other supplementary alignments (with approximate CIGAR strings)
ms i DP score of the max scoring segment in the alignment
nn i Number of ambiguous bases in the alignment
ts A Transcript strand (splice mode only)
@@ -674,6 +806,7 @@ cs Z Difference string
dv f Approximate per-base sequence divergence
de f Gap-compressed per-base sequence divergence
rl i Length of query regions harboring repetitive seeds
zd i Alignment broken due to Z-drop; bit 1: left broken; bit 2: right broken
.TE
.PP
+2 -1
View File
@@ -16,7 +16,8 @@ minimap2 -c test/MT-human.fa test/MT-orang.fa \
| paftools.js liftover -l10000 - <(echo -e "MT_orang\t2000\t5000") # liftOver
# no test data for the following examples
paftools.js junceval -e anno.gtf splice.sam > out.txt # compare splice junctions to annotations
paftools.js splice2bed anno.gtf > anno.bed # convert GTF/GFF3 to BED12
paftools.js splice2bed splice.sam > splice.bed # convert PAF/SAM to BED12
paftools.js gff2bed anno.gtf > anno.bed # convert GTF/GFF3 to BED12
```
## Table of Contents
-335
View File
@@ -1,335 +0,0 @@
#!/usr/bin/env k8
var getopt = function(args, ostr) {
var oli; // option letter list index
if (typeof(getopt.place) == 'undefined')
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
if (getopt.place == -1) { // update scanning pointer
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
getopt.place = -1;
return null;
}
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
++getopt.ind;
getopt.place = -1;
return null;
}
}
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
if (getopt.place < 0) ++getopt.ind;
return '?';
}
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
getopt.arg = null;
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
} else { // need an argument
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
getopt.arg = args[getopt.ind].substr(getopt.place);
else if (args.length <= ++getopt.ind) { // no arg
getopt.place = -1;
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
return '?';
} else getopt.arg = args[getopt.ind]; // white space
getopt.place = -1;
++getopt.ind;
}
return optopt;
}
function read_fastx(file, buf)
{
if (file.readline(buf) < 0) return null;
var m, line = buf.toString();
if ((m = /^([>@])(\S+)/.exec(line)) == null)
throw Error("wrong fastx format");
var is_fq = (m[1] == '@');
var name = m[2];
if (file.readline(buf) < 0)
throw Error("missing sequence line");
var seq = buf.toString();
if (is_fq) { // skip quality
file.readline(buf);
file.readline(buf);
}
return [name, seq];
}
function filter_paf(a, opt)
{
if (a.length == 0) return;
var k = 0;
for (var i = 0; i < a.length; ++i) {
var ai = a[i];
if (ai[10] < opt.min_blen) continue;
if (ai[9] < ai[10] * opt.min_iden) continue;
var clip = [0, 0];
if (ai[4] == '+') {
clip[0] = ai[2] < ai[7]? ai[2] : ai[7];
clip[1] = ai[1] - ai[3] < ai[6] - ai[8]? ai[1] - ai[3] : ai[6] - ai[8];
} else {
clip[0] = ai[2] < ai[6] - ai[8]? ai[2] : ai[6] - ai[8];
clip[1] = ai[1] - ai[3] < ai[7]? ai[1] - ai[3] : ai[7];
}
if (clip[0] > opt.max_clip_len || clip[1] > opt.max_clip_len) continue;
a[k++] = ai;
}
a.length = k;
}
function parse_events(t, ev, id, buf)
{
var re = /(:(\d+))|(([\+\-\*])([a-z]+))/g;
var m, cs = null;
for (var j = 12; j < t.length; ++j) {
if ((m = /^cs:Z:(\S+)/.exec(t[j])) != null) {
cs = m[1].toLowerCase();
break;
}
}
if (cs == null) {
warn("Warning: no cs tag for read '" + t[0] + "'");
return;
}
var st = t[2], en = t[3];
var x = st;
while ((m = re.exec(cs)) != null) {
var l;
if (m[2] != null) { // an identitcal match ":\d+"
l = parseInt(m[2]);
// [start, end, type, index, changed_base]
ev.push([x, x + l, 0, id]);
} else {
if (m[4] == '*') {
l = 1;
ev.push([x, x + 1, 1, id, m[5][0]]);
} else if (m[4] == '+') {
l = m[5].length;
ev.push([x, x + l, 2, id]);
} else if (m[4] == '-') {
l = 0;
ev.push([x, x, -1, id, m[5]]);
}
}
x += l;
}
if (x != en)
throw Error("inconsistent cs for read '" + t[0] + "'");
}
function find_het_sub(ev, a, opt)
{
var n = a.length, last0_i = -1, h = [], d = [];
for (var i = 0; i < n; ++i) h[i] = [], d[i] = [];
for (var i = 0; i < ev.length; ++i) {
if (ev[i][2] == 0) {
if (last0_i < 0 || ev[i][0] != ev[last0_i][0]) last0_i = i;
else if (ev[i][1] > ev[last0_i][1])
last0_i = i;
} else if (ev[i][2] == 1 && last0_i >= 0 && ev[i][0] < ev[last0_i][1]) {
if (ev[last0_i][1] - ev[last0_i][0] >= opt.min_mlen) {
if (opt.dbg_ev) print("EV", ev[last0_i].join("\t"), "|", ev[i].join("\t"));
var e0 = ev[last0_i], hl = h[e0[3]];
if (hl.length == 0 || hl[hl.length-1][0] != e0[0])
hl.push([e0[0], e0[1]]);
d[ev[i][3]].push([ev[i][0], e0[1] - e0[0]]);
}
}
}
var b = [];
for (var i = 0; i < n; ++i) {
var sh = 0, dh = 0;
for (var j = 0; j < h[i].length; ++j)
sh += h[i][j][1] - h[i][j][0];
for (var j = 0; j < d[i].length; ++j)
dh += d[i][j][1];
// [start, end, index, #consistent, lenConsistent, #conflictive, lenConflictive, identity, mlen]
b[i] = [a[i][2], a[i][3], i, h[i].length, sh, d[i].length, dh, a[i][9] / a[i][10], a[i][9]];
}
return b;
}
function flt_utg_for_ec(b, opt)
{
var k = 0;
for (var i = 0; i < b.length; ++i) {
var bi = b[i];
if (bi[4] == 0 && bi[6] == 0) b[k++] = bi; // entirely ambiguous
else if (bi[6] < (bi[4] + bi[6]) * opt.max_ratio0) b[k++] = bi;
}
b.length = k;
if (b.length == 0) return;
// find the longest contiguous segment
b.sort(function(x,y) { return x[0]-y[0] });
var st = b[0][0], en = b[0][1], max_st = 0, max_en = 0, max_max_en = en;
for (var i = 1; i < b.length; ++i) {
if (b[i][0] > en) {
if (en - st > max_en - max_st)
max_st = st, max_en = en;
st = b[i][0], en = b[i][1];
} else {
en = en > b[i][1]? en : b[i][1];
}
max_max_en = max_max_en > b[i][1]? max_max_en : b[i][1];
}
if (en - st > max_en - max_st)
max_st = st, max_en = en;
if (max_max_en != en || st != b[0][0]) {
var k = 0;
for (var i = 0; i < b.length; ++i)
if (b[i][0] < max_en && b[i][1] > max_st)
b[k++] = b[i];
b.length = k;
}
}
function flt_utg_for_bin(b, opt) // filter out alignments clearly on the wrong phase
{
var k = 0;
for (var i = 0; i < b.length; ++i) {
var bi = b[i];
if (bi[4] + bi[6] == 0 || bi[4] >= (bi[4] + bi[6]) * opt.max_ratio0) b[k++] = bi;
}
b.length = k;
}
function ec_core(b, n_a, ev, buf, ecb) // error correction
{
var intv = [];
for (var i = 0; i < n_a; ++i)
intv[i] = null;
intv[b[0][2]] = [b[0][0], b[0][1]];
var en = b[0][1];
for (var i = 1; i < b.length; ++i) {
if (b[i][1] <= en) continue;
intv[b[i][2]] = [en, b[i][1]];
en = b[i][1];
}
var k = 0;
ecb.capacity = buf.capacity;
ecb.length = 0;
for (var i = 0; i < ev.length; ++i) {
var e = ev[i], I = intv[e[3]];
if (I == null) continue;
if (e[0] >= I[0] && e[0] < I[1]) { // this is to reduce duplicated events around junctions
//print("X", e.join("\t"));
if (e[2] == 0) {
ecb.length += e[1] - e[0];
for (var j = e[0]; j < e[1]; ++j)
ecb[k++] = buf[j];
} else if (e[2] == 1) {
++ecb.length;
ecb[k++] = e[4].charCodeAt(0);
} else if (e[2] < 0) {
ecb.length += e[4].length;
for (var j = 0; j < e[4].length; ++j)
ecb[k++] = e[4].charCodeAt(j);
} // else, skip e[2] == 2
}
}
if (ecb.length != k) throw Error("BUG!");
}
function process_paf(a, opt, fp_seq, buf, ecb)
{
if (a.length == 0) return;
var len = a[0][1], name = a[0][0], seq = null;
if (len < opt.min_rlen) return;
if (fp_seq) {
var ret;
while ((ret = read_fastx(fp_seq, buf)) != null)
if (ret[0] == a[0][0])
break;
if (ret == null)
throw Error("failed to find sequence for read '" + a[0][0] + "'");
name = ret[0], seq = ret[1];
if (seq.length != len)
throw Error("inconsistent length for read '" + name + "'");
}
filter_paf(a, opt);
if (a.length == 0) return;
var ev = [];
for (var i = 0; i < a.length; ++i)
parse_events(a[i], ev, i, buf);
ev.sort(function(x,y) { return x[0]!=y[0]? x[0]-y[0] : x[2]-y[2] });
if (seq == null) print("SQ", name, a[0][1], a.length);
var b = find_het_sub(ev, a, opt);
if (opt.ec) flt_utg_for_ec(b, opt);
else flt_utg_for_bin(b, opt);
if (seq == null) {
for (var i = 0; i < b.length; ++i) {
var m, ai = a[b[i][2]], score = 0;
for (var j = 10; j < ai.length; ++j)
if ((m = /^AS:i:(\d+)/.exec(ai[j])) != null)
score = m[1];
print("TS", b[i][2], b[i][0], b[i][1], ai.slice(5, 9).join("\t"), b[i].slice(3, 7).join("\t"), score);
}
print("//");
} else { // error correction
if (b.length == 0) return;
buf.set(seq, 0);
ec_core(b, a.length, ev, buf, ecb);
print(">" + name);
print(ecb);
}
}
function main(args)
{
var c, opt = { min_rlen:5000, min_blen:5000, min_iden:0.8, min_mlen:5, max_clip_len:500, max_ratio0:0.25, dbg_ev:false };
while ((c = getopt(args, "l:b:d:m:c:r:E")) != null) {
if (c == 'l') opt.min_rlen = parseInt(getopt.arg);
else if (c == 'b') opt.min_blen = parseInt(getopt.arg);
else if (c == 'd') opt.min_iden = parseFloat(getopt.arg);
else if (c == 'm') opt.min_slen = parseInt(getopt.arg);
else if (c == 'c') opt.max_clip_len = parseInt(getopt.arg);
else if (c == 'r') opt.max_ratio0 = parseFloat(getopt.arg);
else if (c == 'E') opt.dbg_ev = true;
}
if (args.length - getopt.ind < 1) {
print("Usage: mmphase.js [options] <map-with-cs.paf> [reads.fa]");
print("Options:");
print(" -l INT min read length [" + opt.min_rlen + "]");
print(" -b INT min alignment length [" + opt.min_blen + "]");
print(" -d FLOAT min identity [" + opt.min_iden + "]");
print(" -s INT min match length [" + opt.min_mlen + "]");
print(" -c INT max clip length [" + opt.max_clip_len + "]");
print(" -r FLOAT initial ratio for haplotype filtering [" + opt.max_ratio0 + "]");
return 0;
}
opt.ec = args.length - getopt.ind < 2? false : true;
if (!opt.ec) {
print("CC");
print("CC", "SQ qName qLen nHits");
print("CC", "TS index qStart qEnd tName tLen tStart tEnd nConsistent lCons nConflictive lConf score");
print("CC");
}
var buf = new Bytes(), ecb = new Bytes();
var fp_paf = new File(args[getopt.ind]);
var fp_seq = args.length - getopt.ind >= 2? new File(args[getopt.ind+1]) : null;
var a = [];
while (fp_paf.readline(buf) >= 0) {
var t = buf.toString().split("\t");
if (a.length > 0 && a[0][0] != t[0]) {
process_paf(a, opt, fp_seq, buf, ecb);
a.length = 0;
}
for (var i = 1; i <= 3; ++i) t[i] = parseInt(t[i]);
if (t[1] < opt.min_rlen) continue;
for (var i = 6; i <= 10; ++i) t[i] = parseInt(t[i]);
if (t[10] < opt.min_blen) continue;
a.push(t);
}
if (a.length >= 0)
process_paf(a, opt, fp_seq, buf, ecb);
if (fp_seq) fp_seq.close();
fp_paf.close();
ecb.destroy();
buf.destroy();
}
var ret = main(arguments)
exit(ret)
+241
View File
@@ -0,0 +1,241 @@
#!/usr/bin/env k8
"use strict";
Array.prototype.delete_at = function(i) {
for (let j = i; j < this.length - 1; ++j)
this[j] = this[j + 1];
--this.length;
}
function* getopt(argv, ostr, longopts) {
if (argv.length == 0) return;
let pos = 0, cur = 0;
while (cur < argv.length) {
let lopt = "", opt = "?", arg = "";
while (cur < argv.length) { // skip non-option arguments
if (argv[cur][0] == "-" && argv[cur].length > 1) {
if (argv[cur] == "--") cur = argv.length;
break;
} else ++cur;
}
if (cur == argv.length) break;
let a = argv[cur];
if (a[0] == "-" && a[1] == "-") { // a long option
pos = -1;
let c = 0, k = -1, tmp = "", o;
const pos_eq = a.indexOf("=");
if (pos_eq > 0) {
o = a.substring(2, pos_eq);
arg = a.substring(pos_eq + 1);
} else o = a.substring(2);
for (let i = 0; i < longopts.length; ++i) {
let y = longopts[i];
if (y[y.length - 1] == "=") y = y.substring(0, y.length - 1);
if (o.length <= y.length && o == y.substring(0, o.length)) {
k = i, tmp = y;
++c; // c is the number of matches
if (o == y) { // exact match
c = 1;
break;
}
}
}
if (c == 1) { // find a unique match
lopt = tmp;
if (pos_eq < 0 && longopts[k][longopts[k].length-1] == "=" && cur + 1 < argv.length) {
arg = argv[cur+1];
argv.delete_at(cur + 1);
}
}
} else { // a short option
if (pos == 0) pos = 1;
opt = a[pos++];
let k = ostr.indexOf(opt);
if (k < 0) {
opt = "?";
} else if (k + 1 < ostr.length && ostr[k+1] == ":") { // requiring an argument
if (pos >= a.length) {
arg = argv[cur+1];
argv.delete_at(cur + 1);
} else arg = a.substring(pos);
pos = -1;
}
}
if (pos < 0 || pos >= argv[cur].length) {
argv.delete_at(cur);
pos = 0;
}
if (lopt != "") yield { opt: `--${lopt}`, arg: arg };
else if (opt != "?") yield { opt: `-${opt}`, arg: arg };
else yield { opt: "?", arg: "" };
}
}
function* k8_readline(fn) {
let buf = new Bytes();
let file = new File(fn);
while (file.readline(buf) >= 0) {
yield buf.toString();
}
file.close();
buf.destroy();
}
function merge_hits(b) {
if (b.length == 1)
return { name1:b[0].name1, name2:b[0].name2, len1:b[0].len1, len2:b[0].len2, min_cov:b[0].min_cov, max_cov:b[0].max_cov, cov1:b[0].cov1, cov2:b[0].cov2, s1:b[0].s1, dv:b[0].dv };
b.sort(function(x, y) { return x.st1 - y.st1 });
let f = [], bt = [];
for (let i = 0; i < b.length; ++i)
f[i] = b[i].s1, bt[i] = -1;
for (let i = 0; i < b.length; ++i) {
for (let j = 0; j < i; ++j) {
if (b[j].st2 < b[i].st2) {
if (b[j].en1 >= b[i].en1) continue;
if (b[j].en2 >= b[i].en2) continue;
const ov1 = b[j].en1 <= b[i].st1? 0 : b[i].st1 - b[j].en1;
const li1 = b[i].en1 - b[i].st1;
const s11 = b[i].s1 / li1 * (li1 - ov1);
const ov2 = b[j].en2 <= b[i].st2? 0 : b[i].st2 - b[j].en2;
const li2 = b[i].en2 - b[i].st2;
const s12 = b[i].s1 / li2 * (li2 - ov2);
const s1 = s11 < s12? s11 : s12;
if (f[i] < f[j] + s1)
f[i] = f[j] + s1, bt[i] = j;
}
}
}
let max_i = -1, max_f = 0, d = [];
for (let i = 0; i < b.length; ++i)
if (max_f < f[i])
max_f = f[i], max_i = i;
for (let k = max_i; k >= 0; k = bt[k])
d.push(k);
d = d.reverse();
let dv = 0, tot = 0, cov1 = 0, cov2 = 0, st1 = 0, en1 = 0, st2 = 0, en2 = 0;
for (let k = 0; k < d.length; ++k) {
const i = d[k];
tot += b[i].blen;
dv += b[i].dv * b[i].blen;
if (b[i].st1 > en1) {
cov1 += en1 - st1;
st1 = b[i].st1, en1 = b[i].en1;
} else en1 = en1 > b[i].en1? en1 : b[i].en1;
if (b[i].st2 > en2) {
cov2 += en2 - st2;
st2 = b[i].st2, en2 = b[i].en2;
} else en2 = en2 > b[i].en2? en2 : b[i].en2;
}
dv /= tot;
cov1 = (cov1 + (en1 - st1)) / b[0].len1;
cov2 = (cov2 + (en2 - st2)) / b[0].len2;
const min_cov = cov1 < cov2? cov1 : cov2;
const max_cov = cov1 > cov2? cov1 : cov2;
//warn(d.length, b[0].name1, b[0].name2, min_cov, max_cov);
return { name1:b[0].name1, name2:b[0].name2, len1:b[0].len1, len2:b[0].len2, min_cov:min_cov, max_cov:max_cov, cov1:cov1, cov2:cov2, s1:max_f, dv:dv };
}
function main(args) {
let opt = { min_cov:.9, max_dv:.015, max_diff:20000 };
for (const o of getopt(args, "c:d:e:", [])) {
if (o.opt == '-c') opt.min_cov = parseFloat(o.arg);
else if (o.opt == '-d') opt.max_dv = parseFloat(o.arg);
else if (o.opt == '-e') opt.max_diff = parseFloat(o.arg);
}
if (args.length == 0) {
print("Usage: pafcluster.js [options] <ava.paf>");
print("Options:");
print(` -c FLOAT min coverage [${opt.min_cov}]`);
print(` -d FLOAT max divergence [${opt.max_dv}]`);
print(` -e FLOAT max difference [${opt.max_diff}]`);
return;
}
// read
let a = [], len = {}, name2len = {};
for (const line of k8_readline(args[0])) {
let m, t = line.split("\t");
if (t[4] != "+") continue;
for (let i = 1; i < 4; ++i) t[i] = parseInt(t[i]);
for (let i = 6; i < 11; ++i) t[i] = parseInt(t[i]);
const len1 = t[1], len2 = t[6];
let s1 = -1, dv = -1.0;
for (let i = 12; i < t.length; ++i) {
if ((m = /^(s1|dv):\S:(\S+)/.exec(t[i])) != null) {
if (m[1] == "s1") s1 = parseInt(m[2]);
else if (m[1] == "dv") dv = parseFloat(m[2]);
}
}
if (s1 < 0 || dv < 0) continue;
const cov1 = (parseInt(t[3]) - parseInt(t[2])) / len1;
const cov2 = (parseInt(t[8]) - parseInt(t[7])) / len2;
const min_cov = cov1 < cov2? cov1 : cov2;
const max_cov = cov1 > cov2? cov1 : cov2;
name2len[t[0]] = len1;
name2len[t[5]] = len2;
a.push({ name1:t[0], name2:t[5], len1:len1, len2:len2, min_cov:min_cov, max_cov:max_cov, s1:s1, dv:dv, cov1:cov1, cov2:cov2, st1:t[2], en1:t[3], st2:t[7], en2:t[8], blen:t[10] });
len[t[0]] = len1, len[t[5]] = len2;
}
warn(`Read ${a.length} hits`);
// merge duplicated hits
let h = {};
for (let i = 0; i < a.length; ++i) {
const key = `${a[i].name1}\t${a[i].name2}`;
if (h[key] == null) h[key] = [];
h[key].push(a[i]);
}
a = [];
for (const key in h)
a.push(merge_hits(h[key]));
// core loop
while (a.length > 1) {
// select the sequence with the highest sum of s1
let h = {};
for (let i = 0; i < a.length; ++i) {
if (h[a[i].name1] == null) h[a[i].name1] = 0;
h[a[i].name1] += a[i].s1;
}
let max_s1 = 0, max_name = "";
for (const name in h)
if (max_s1 < h[name])
max_s1 = h[name], max_name = name;
// find contigs in the same group
h = {};
h[max_name] = 1;
for (let i = 0; i < a.length; ++i) {
if (a[i].name1 != max_name && a[i].name2 != max_name)
continue;
const diff1 = a[i].len1 * (1.0 - a[i].cov1);
const diff2 = a[i].len2 * (1.0 - a[i].cov2);
if (a[i].min_cov >= opt.min_cov && a[i].dv <= opt.max_dv && diff1 <= opt.max_diff && diff2 <= opt.max_diff)
h[a[i].name1] = h[a[i].name2] = 1;
}
let n = 0;
for (const key in h) {
++n;
delete name2len[key];
}
print(`SD\t${max_name}\t${n}`);
for (const key in h) print(`CL\t${key}\t${len[key]}`);
print("//");
// filter out redundant hits
let b = [];
for (let i = 0; i < a.length; ++i)
if (h[a[i].name1] == null && h[a[i].name2] == null)
b.push(a[i]);
warn(`Reduced the number of hits from ${a.length} to ${b.length}`);
a = b;
}
// output remaining singletons
for (const key in name2len) {
print(`SD\t${key}\t1`);
print(`CL\t${key}\t${name2len[key]}`);
print(`//`);
}
}
main(arguments);
+635 -27
View File
@@ -1,6 +1,6 @@
#!/usr/bin/env k8
var paftools_version = '2.21-r1071';
var paftools_version = '2.30-r1287';
/*****************************
***** Library functions *****
@@ -133,9 +133,11 @@ Interval.find_ovlp = function(a, st, en)
function fasta_read(fn)
{
var h = {}, gt = '>'.charCodeAt(0);
var h = {}, seqlen = [];
var buf = new Bytes();
var file = fn == '-'? new File() : new File(fn);
var buf = new Bytes(), seq = null, name = null, seqlen = [];
if (typeof k8_version == "undefined") { // for k8-0.x
var seq = null, name = null, gt = '>'.charCodeAt(0);
while (file.readline(buf) >= 0) {
if (buf[0] == gt) {
if (seq != null && name != null) {
@@ -154,6 +156,28 @@ function fasta_read(fn)
seqlen.push([name, seq.length]);
h[name] = seq;
}
} else { // for k8-1.x
var seq = null, name = null;
while (file.readline(buf) >= 0) {
var line = buf.toString();
if (line[0] == ">") {
if (seq != null && name != null) {
seqlen.push([name, seq.length]);
h[name] = new Uint8Array(seq.buffer);
name = seq = null;
}
var m;
if ((m = /^>(\S+)/.exec(line)) != null) {
name = m[1];
seq = new Bytes();
}
} else seq.set(line);
}
if (seq != null && name != null) {
seqlen.push([name, seq.length]);
h[name] = new Uint8Array(seq.buffer);
}
}
buf.destroy();
file.close();
return [h, seqlen];
@@ -161,17 +185,28 @@ function fasta_read(fn)
function fasta_free(fa)
{
if (typeof k8_version == "undefined")
for (var name in fa)
fa[name].destroy();
// FIXME: for k8-1.0, sequences are not freed. This is ok for now but not general.
}
Bytes.prototype.reverse = function()
{
if (typeof k8_version === "undefined") { // k8-0.x
for (var i = 0; i < this.length>>1; ++i) {
var tmp = this[i];
this[i] = this[this.length - i - 1];
this[this.length - i - 1] = tmp;
}
} else { // k8-1.x
var buf = new Uint8Array(this.buffer);
for (var i = 0; i < buf.length>>1; ++i) {
var tmp = buf[i];
buf[i] = buf[buf.length - i - 1];
buf[buf.length - i - 1] = tmp;
}
}
}
// reverse complement a DNA string
@@ -185,6 +220,7 @@ Bytes.prototype.revcomp = function()
for (var i = 0; i < s1.length; ++i)
Bytes.rctab[s1.charCodeAt(i)] = s2.charCodeAt(i);
}
if (typeof k8_version === "undefined") { // k8-0.x
for (var i = 0; i < this.length>>1; ++i) {
var tmp = this[this.length - i - 1];
this[this.length - i - 1] = Bytes.rctab[this[i]];
@@ -192,6 +228,16 @@ Bytes.prototype.revcomp = function()
}
if (this.length&1)
this[this.length>>1] = Bytes.rctab[this[this.length>>1]];
} else { // k8-1.x
var buf = new Uint8Array(this.buffer);
for (var i = 0; i < buf.length>>1; ++i) {
var tmp = buf[buf.length - i - 1];
buf[buf.length - i - 1] = Bytes.rctab[buf[i]];
buf[i] = Bytes.rctab[tmp];
}
if (buf.length&1)
buf[buf.length>>1] = Bytes.rctab[buf[buf.length>>1]];
}
}
/********************
@@ -1532,21 +1578,24 @@ function paf_view(args)
function paf_gff2bed(args)
{
var c, fn_ucsc_fai = null, is_short = false, keep_gff = false, print_junc = false;
while ((c = getopt(args, "u:sgj")) != null) {
var c, fn_ucsc_fai = null, is_short = false, keep_gff = false, print_junc = false, output_gene = false, ens_canon_only = false;
while ((c = getopt(args, "u:sgjGe")) != null) {
if (c == 'u') fn_ucsc_fai = getopt.arg;
else if (c == 's') is_short = true;
else if (c == 'g') keep_gff = true;
else if (c == 'j') print_junc = true;
else if (c == 'G') output_gene = true;
else if (c == 'e') ens_canon_only = true;
}
if (getopt.ind == args.length) {
print("Usage: paftools.js gff2bed [options] <in.gff>");
print("Options:");
print(" -j Output junction BED");
print(" -s Print names in the short form");
print(" -j output junction BED");
print(" -s print names in the short form");
print(" -u FILE hg38.fa.fai for chr name conversion");
print(" -g Output GFF (used with -u)");
print(" -e only show transcript tagged with 'Ensembl_canonical'");
print(" -g output GFF (used with -u)");
exit(1);
}
@@ -1605,8 +1654,10 @@ function paf_gff2bed(args)
print(a[0][0], st, en, name, 1000, a[0][3], cds_st, cds_en, color, a.length, sizes.join(",") + ",", starts.join(",") + ",");
}
var re_gtf = /\b(transcript_id|transcript_type|transcript_biotype|gene_name|gene_id|gbkey|transcript_name) "([^"]+)";/g;
var re_gtf = /\b(transcript_id|transcript_type|transcript_biotype|gene_name|gene_id|gbkey|transcript_name|tag) "([^"]+)";/g;
var re_gff3 = /\b(transcript_id|transcript_type|transcript_biotype|gene_name|gene_id|gbkey|transcript_name)=([^;]+)/g;
var re_gtf_gene = /\b(gene_id|gene_type|gene_name) "([^;]+)";/g;
var re_gff3_gene = /\b(gene_id|gene_type|source_gene|gene_biotype|gene_name)=([^;]+);/g;
var buf = new Bytes();
var file = args[getopt.ind] == '-'? new File() : new File(args[getopt.ind]);
@@ -1620,16 +1671,37 @@ function paf_gff2bed(args)
continue;
}
if (t[0].charAt(0) == '#') continue;
if (output_gene) {
var id = null, src = null, biotype = null, type = "", name = "N/A";
if (t[2] != "gene") continue;
while ((m = re_gtf_gene.exec(t[8])) != null) {
if (m[1] == "gene_id") id = m[2];
else if (m[1] == "gene_type") type = m[2];
else if (m[1] == "gene_name") name = m[2];
}
while ((m = re_gff3_gene.exec(t[8])) != null) {
if (m[1] == "gene_id") id = m[2];
else if (m[1] == "source_gene") src = m[2];
else if (m[1] == "gene_type") type = m[2];
else if (m[1] == "gene_biotype") biotype = m[2];
else if (m[1] == "gene_name") name = m[2];
}
if (src != null) id = src;
if (type == "" && biotype != null) type = biotype;
print(t[0], parseInt(t[3]) - 1, t[4], [id, type, name].join("|"), 1000, t[6]);
continue;
}
if (t[2] != "CDS" && t[2] != "exon") continue;
t[3] = parseInt(t[3]) - 1;
t[4] = parseInt(t[4]);
var id = null, type = "", name = "N/A", biotype = "", m, tname = "N/A";
var id = null, type = "", name = "N/A", biotype = "", m, tname = "N/A", ens_canonical = false;
while ((m = re_gtf.exec(t[8])) != null) {
if (m[1] == "transcript_id") id = m[2];
else if (m[1] == "transcript_type") type = m[2];
else if (m[1] == "transcript_biotype" || m[1] == "gbkey") biotype = m[2];
else if (m[1] == "gene_name" || m[1] == "gene_id") name = m[2];
else if (m[1] == "transcript_name") tname = m[2];
else if (m[1] == "tag" && m[2] == "Ensembl_canonical") ens_canonical = true;
}
while ((m = re_gff3.exec(t[8])) != null) {
if (m[1] == "transcript_id") id = m[2];
@@ -1638,6 +1710,7 @@ function paf_gff2bed(args)
else if (m[1] == "gene_name" || m[1] == "gene_id") name = m[2];
else if (m[1] == "transcript_name") tname = m[2];
}
if (ens_canon_only && !ens_canonical) continue;
if (type == "" && biotype != "") type = biotype;
if (id == null) throw Error("No transcript_id");
if (id != last_id) {
@@ -1667,15 +1740,17 @@ function paf_gff2bed(args)
function paf_sam2paf(args)
{
var c, pri_only = false, long_cs = false;
while ((c = getopt(args, "pL")) != null) {
var c, pri_only = false, long_cs = false, pri_pri_only = false;
while ((c = getopt(args, "pPL")) != null) {
if (c == 'p') pri_only = true;
else if (c == 'P') pri_pri_only = pri_only = true;
else if (c == 'L') long_cs = true;
}
if (args.length == getopt.ind) {
print("Usage: paftools.js sam2paf [options] <in.sam>");
print("Options:");
print(" -p convert primary or supplementary alignments only");
print(" -P convert primary alignments only");
print(" -L output the cs tag in the long form");
exit(1);
}
@@ -1702,6 +1777,7 @@ function paf_sam2paf(args)
throw Error("at line " + lineno + ": inconsistent SEQ and QUAL lengths - " + t[9].length + " != " + t[10].length);
if (t[2] == '*' || (flag&4) || t[5] == '*') continue;
if (pri_only && (flag&0x100)) continue;
if (pri_pri_only && (flag&0x900)) continue;
var tlen = ctg_len[t[2]];
if (tlen == null) throw Error("at line " + lineno + ": can't find the length of contig " + t[2]);
// find tags
@@ -1814,7 +1890,10 @@ function paf_sam2paf(args)
// optional tags
var type = flag&0x100? 'S' : 'P';
var tags = ["tp:A:" + type];
if (NM != null) tags.push("mm:i:"+mm);
if (NM != null) {
tags.push("NM:i:"+NM);
tags.push("mm:i:"+mm);
}
tags.push("gn:i:"+(I[1]+D[1]), "go:i:"+(I[0]+D[0]), "cg:Z:" + t[5].replace(/\d+[SH]/g, ''));
if (cs_str != null) tags.push("cs:Z:" + cs_str);
else if (cs.length > 0) tags.push("cs:Z:" + cs.join(""));
@@ -2024,7 +2103,7 @@ function paf_mapeval(args)
warn("Usage: paftools.js mapeval [options] <in.paf>|<in.sam>");
warn("Options:");
warn(" -r FLOAT mapping correct if overlap_length/union_length>FLOAT [" + ovlp_ratio + "]");
warn(" -Q INT print wrong mappings with mapQ>INT [don't print]");
warn(" -Q INT print wrong mappings with mapQ>=INT [don't print]");
warn(" -m INT 0: eval the longest aln only; 1: first aln only; 2: all primary aln [0]");
exit(1);
}
@@ -2108,7 +2187,7 @@ function paf_mapeval(args)
}
var lineno = 0, last = null, a = [], n_unmapped = null;
var re_cigar = /(\d+)([MIDSHN])/g;
var re_cigar = /(\d+)([MIDSHN=X])/g;
while (file.readline(buf) >= 0) {
var m, line = buf.toString();
++lineno;
@@ -2146,7 +2225,7 @@ function paf_mapeval(args)
var n_gap = 0, mlen = 0;
while ((m = re_cigar.exec(t[5])) != null) {
var len = parseInt(m[1]);
if (m[2] == 'M') pos_end += len, mlen += len;
if (m[2] == 'M' || m[2] == 'X' || m[2] == '=') pos_end += len, mlen += len;
else if (m[2] == 'I') n_gap += len;
else if (m[2] == 'D') n_gap += len, pos_end += len;
}
@@ -2318,12 +2397,15 @@ function paf_pbsim2fq(args)
function paf_junceval(args)
{
var c, l_fuzzy = 0, print_ovlp = false, print_err_only = false, first_only = false, chr_only = false;
while ((c = getopt(args, "l:epc")) != null) {
var c, l_fuzzy = 0, print_ovlp = false, print_err_only = false, first_only = false, chr_only = false, aa = false, is_bed = false;
while ((c = getopt(args, "l:epcab1")) != null) {
if (c == 'l') l_fuzzy = parseInt(getopt.arg);
else if (c == 'e') print_err_only = print_ovlp = true;
else if (c == 'p') print_ovlp = true;
else if (c == 'c') chr_only = true;
else if (c == 'a') aa = true;
else if (c == 'b') is_bed = true;
else if (c == '1') first_only = true;
}
if (args.length - getopt.ind < 1) {
@@ -2333,6 +2415,9 @@ function paf_junceval(args)
print(" -p print overlapping introns");
print(" -e print erroreous overlapping introns");
print(" -c only consider alignments to /^(chr)?([0-9]+|X|Y)$/");
print(" -a miniprot PAF as input");
print(" -b BED as input");
print(" -1 only process the first alignment of each query");
exit(1);
}
@@ -2386,13 +2471,17 @@ function paf_junceval(args)
file = getopt.ind+1 >= args.length || args[getopt.ind+1] == '-'? new File() : new File(args[getopt.ind+1]);
var last_qname = null;
var re_cigar = /(\d+)([MIDNSHP=X])/g;
var re_cigar = /(\d+)([MIDNSHP=XFGUV])/g;
while (file.readline(buf) >= 0) {
var m, t = buf.toString().split("\t");
var ctg_name = null, cigar = null, pos = null, qname = t[0];
var ctg_name = null, cigar = null, pos = null, qname;
if (t[0].charAt(0) == '@') continue;
if (t[4] == '+' || t[4] == '-' || t[4] == '*') { // PAF
if (t[0] == "##PAF") t.shift();
qname = t[0];
if (is_bed) {
ctg_name = t[0], pos = parseInt(t[1]), cigar == null;
} else if (t[4] == '+' || t[4] == '-' || t[4] == '*') { // PAF
ctg_name = t[5], pos = parseInt(t[7]);
var type = 'P';
for (i = 12; i < t.length; ++i) {
@@ -2405,6 +2494,10 @@ function paf_junceval(args)
} else { // SAM
ctg_name = t[2], pos = parseInt(t[3]) - 1, cigar = t[5];
var flag = parseInt(t[1]);
if (flag & 1) {
if (flag & 0x40) qname += '/1';
else if (flag & 0x80) qname += '/2';
}
if (flag&0x100) continue; // secondary
}
@@ -2422,6 +2515,36 @@ function paf_junceval(args)
}
var intron = [];
if (is_bed) {
intron.push([pos, parseInt(t[2])]);
} else if (aa) {
var tmp_junc = [], tmp = 0;
while ((m = re_cigar.exec(cigar)) != null) {
var len = parseInt(m[1]), op = m[2];
if (op == 'N') {
tmp_junc.push([tmp, tmp + len]);
tmp += len;
} else if (op == 'U') {
tmp_junc.push([tmp + 1, tmp + len - 2]);
tmp += len;
} else if (op == 'V') {
tmp_junc.push([tmp + 2, tmp + len - 1]);
tmp += len;
} else if (op == 'M' || op == 'X' || op == '=' || op == 'D') {
tmp += len * 3;
} else if (op == 'F' || op == 'G') {
tmp += len;
}
}
if (t[4] == '+') {
for (var i = 0; i < tmp_junc.length; ++i)
intron.push([pos + tmp_junc[i][0], pos + tmp_junc[i][1]]);
} else if (t[4] == '-') {
var glen = parseInt(t[8]) - parseInt(t[7]);
for (var i = tmp_junc.length - 1; i >= 0; --i)
intron.push([pos + (glen - tmp_junc[i][1]), pos + (glen - tmp_junc[i][0])]);
}
} else {
while ((m = re_cigar.exec(cigar)) != null) {
var len = parseInt(m[1]), op = m[2];
if (op == 'N') {
@@ -2429,6 +2552,7 @@ function paf_junceval(args)
pos += len;
} else if (op == 'M' || op == 'X' || op == '=' || op == 'D') pos += len;
}
}
if (intron.length == 0) {
++n_sgl;
continue;
@@ -2486,6 +2610,283 @@ function paf_junceval(args)
}
}
function paf_exoneval(args) // adapted from paf_junceval()
{
var c, l_fuzzy = 0, print_ovlp = false, print_err_only = false, first_only = false, chr_only = false, aa = false, is_bed = false, use_cds = false, eval_base = false;
var skip_start = false, skip_last = false;
while ((c = getopt(args, "l:epcab1dsft")) != null) {
if (c == 'l') l_fuzzy = parseInt(getopt.arg);
else if (c == 'e') print_err_only = print_ovlp = true;
else if (c == 'p') print_ovlp = true;
else if (c == 'c') chr_only = true;
else if (c == 'a') aa = true, use_cds = true;
else if (c == 'b') is_bed = true;
else if (c == '1') first_only = true;
else if (c == 'd') use_cds = true;
else if (c == 's') eval_base = true;
else if (c == 'f') skip_start = true;
else if (c == 't') skip_last = skip_start = true;
}
if (args.length - getopt.ind < 1) {
print("Usage: paftools.js exoneval [options] <gene.gtf> <aln.sam>");
print("Options:");
print(" -l INT tolerance of junction positions (0 for exact) [0]");
print(" -d evaluate coding regions only (exon regions by default)");
print(" -a miniprot PAF as input (force -d)");
print(" -p print overlapping exons");
print(" -e print erroreous overlapping exons");
print(" -c only consider alignments to /^(chr)?([0-9]+|X|Y)$/");
print(" -1 only process the first alignment of each query");
print(" -f skip the first exon in the miniprot mode");
print(" -t skip the first and the last exons");
print(" -b BED as input");
print(" -s compute base Sn and Sp (more memory)");
exit(1);
}
var file, buf = new Bytes();
warn("Reading reference GTF...");
var tr = {};
file = args[getopt.ind] == '-'? new File() : new File(args[getopt.ind]);
while (file.readline(buf) >= 0) {
var m, t = buf.toString().split("\t");
if (t[0].charAt(0) == '#') continue;
if (use_cds) {
if (t[2] != "cds" && t[2] != "CDS") continue;
} else {
if (t[2] != 'exon') continue;
}
var st = parseInt(t[3]) - 1;
var en = parseInt(t[4]);
if ((m = /transcript_id "(\S+)"/.exec(t[8])) == null) continue;
var tid = m[1];
if (tr[tid] == null) tr[tid] = [t[0], t[6], 0, 0, []];
tr[tid][4].push([st, en]); // this keeps transcript
}
file.close();
var anno = {};
for (var tid in tr) { // traverse each transcript
var t = tr[tid];
Interval.sort(t[4]);
t[2] = t[4][0][0];
t[3] = t[4][t[4].length - 1][1];
if (anno[t[0]] == null) anno[t[0]] = [];
var s = t[4];
for (var i = 0; i < s.length; ++i) // traverse each exon
anno[t[0]].push([s[i][0], s[i][1]]);
}
tr = null;
for (var chr in anno) { // index exons
var e = anno[chr];
if (e.length == 0) continue;
Interval.sort(e);
var k = 0;
for (var i = 1; i < e.length; ++i) // dedup
if (e[i][0] != e[k][0] || e[i][1] != e[k][1])
e[++k] = e[i].slice(0);
e.length = k + 1;
Interval.index_end(e);
}
var n_pri = 0, n_unmapped = 0, n_mapped = 0;
var n_exon = 0, n_exon_hit = 0, n_exon_novel = 0;
file = getopt.ind+1 >= args.length || args[getopt.ind+1] == '-'? new File() : new File(args[getopt.ind+1]);
var last_qname = null, qexon = {};
var re_cigar = /(\d+)([MIDNSHP=XFGUV])/g;
warn("Evaluating alignments...");
while (file.readline(buf) >= 0) {
var m, t = buf.toString().split("\t");
var ctg_name = null, cigar = null, pos = null, qname;
if (t[0].charAt(0) == '@') continue;
if (t[0] == "##PAF") t.shift();
qname = t[0];
if (is_bed) {
ctg_name = t[0], pos = parseInt(t[1]), cigar == null;
} else if (t[4] == '+' || t[4] == '-' || t[4] == '*') { // PAF
ctg_name = t[5], pos = parseInt(t[7]);
var type = 'P';
for (i = 12; i < t.length; ++i) {
if ((m = /^(tp:A|cg:Z):(\S+)/.exec(t[i])) != null) {
if (m[1] == 'tp:A') type = m[2];
else cigar = m[2];
}
}
if (type == 'S') continue; // secondary
} else { // SAM
ctg_name = t[2], pos = parseInt(t[3]) - 1, cigar = t[5];
var flag = parseInt(t[1]);
if (flag&0x100) continue; // secondary
}
if (chr_only && !/^(chr)?([0-9]+|X|Y)$/.test(ctg_name)) continue;
if (first_only && last_qname == qname) continue;
if (ctg_name == '*') { // unmapped
++n_unmapped;
continue;
} else {
++n_pri;
if (last_qname != qname) {
++n_mapped;
last_qname = qname;
}
}
var exon = [];
if (is_bed) { // BED
exon.push([pos, parseInt(t[2])]);
} else if (aa) {
var tmp_exon = [], tmp = 0, tmp_st = 0;
while ((m = re_cigar.exec(cigar)) != null) {
var len = parseInt(m[1]), op = m[2];
if (op == 'N') {
tmp_exon.push([tmp_st, tmp]);
tmp_st = tmp + len, tmp += len;
} else if (op == 'U') {
tmp_exon.push([tmp_st, tmp + 1]);
tmp_st = tmp + len - 2, tmp += len;
} else if (op == 'V') {
tmp_exon.push([tmp_st, tmp + 2]);
tmp_st = tmp + len - 1, tmp += len;
} else if (op == 'M' || op == 'X' || op == '=' || op == 'D') {
tmp += len * 3;
} else if (op == 'F' || op == 'G') {
tmp += len;
}
}
tmp_exon.push([tmp_st, tmp]);
if (t[4] == '+') {
for (var i = 0; i < tmp_exon.length; ++i)
exon.push([pos + tmp_exon[i][0], pos + tmp_exon[i][1]]);
} else if (t[4] == '-') { // For protein-to-genome alignment, the coordinates are on the query strand. Need to flip them.
var glen = parseInt(t[8]) - parseInt(t[7]);
for (var i = tmp_exon.length - 1; i >= 0; --i)
exon.push([pos + (glen - tmp_exon[i][1]), pos + (glen - tmp_exon[i][0])]);
}
if (skip_start) exon.shift();
if (skip_last) exon.pop();
} else {
var tmp_st = pos;
while ((m = re_cigar.exec(cigar)) != null) {
var len = parseInt(m[1]), op = m[2];
if (op == 'N') {
exon.push([tmp_st, pos]);
tmp_st = pos + len, pos += len;
} else if (op == 'M' || op == 'X' || op == '=' || op == 'D') pos += len;
}
exon.push([tmp_st, pos]);
}
n_exon += exon.length;
var chr = anno[ctg_name];
if (chr != null) {
for (var i = 0; i < exon.length; ++i) {
if (eval_base) {
if (qexon[ctg_name] == null) qexon[ctg_name] = [];
qexon[ctg_name].push([exon[i][0], exon[i][1]]);
}
var o = Interval.find_ovlp(chr, exon[i][0], exon[i][1]);
if (o.length > 0) {
var hit = false;
for (var j = 0; j < o.length; ++j) {
var st_diff = exon[i][0] - o[j][0];
var en_diff = exon[i][1] - o[j][1];
if (st_diff < 0) st_diff = -st_diff;
if (en_diff < 0) en_diff = -en_diff;
if (st_diff <= l_fuzzy && en_diff <= l_fuzzy)
++n_exon_hit, hit = true;
if (hit) break;
}
if (print_ovlp) {
var type = hit? 'C' : 'P';
if (hit && print_err_only) continue;
var x = '[';
for (var j = 0; j < o.length; ++j) {
if (j) x += ', ';
x += '(' + o[j][0] + "," + o[j][1] + ')';
}
x += ']';
print(type, qname, i+1, ctg_name, exon[i][0], exon[i][1], x);
}
} else {
++n_exon_novel;
if (print_ovlp)
print('N', qname, i+1, ctg_name, exon[i][0], exon[i][1]);
}
}
} else {
n_exon_novel += exon.length;
}
}
file.close();
buf.destroy();
if (!print_ovlp) {
print("# unmapped reads: " + n_unmapped);
print("# mapped reads: " + n_mapped);
print("# primary alignments: " + n_pri);
print("# predicted exons: " + n_exon);
print("# non-overlapping exons: " + n_exon_novel);
print("# correct exons: " + n_exon_hit + " (" + (n_exon_hit / n_exon * 100).toFixed(2) + "%)");
}
function merge_and_index(ex) {
for (var chr in ex) {
var a = [];
e = ex[chr];
Interval.sort(e);
var st = e[0][0], en = e[0][1];
for (var i = 1; i < e.length; ++i) { // merge
if (e[i][0] > en) {
a.push([st, en]);
st = e[i][0], en = e[i][1];
} else {
en = en > e[i][1]? en : e[i][1];
}
}
a.push([st, en]);
Interval.index_end(a);
ex[chr] = a;
}
}
function cal_sn(a0, a1) {
var tot = 0, cov = 0;
for (var chr in a1) {
var e0 = a0[chr], e1 = a1[chr];
for (var i = 0; i < e1.length; ++i)
tot += e1[i][1] - e1[i][0];
if (e0 == null) continue;
for (var i = 0; i < e1.length; ++i) {
var o = Interval.find_ovlp(e0, e1[i][0], e1[i][1]);
for (var j = 0; j < o.length; ++j) { // this only works when there are no overlaps between intervals
var st = e1[i][0] > o[j][0]? e1[i][0] : o[j][0];
var en = e1[i][1] < o[j][1]? e1[i][1] : o[j][1];
cov += en - st;
}
}
}
return [tot, cov];
}
if (eval_base) {
warn("Computing base Sn and Sp...");
merge_and_index(qexon);
merge_and_index(anno);
var sn = cal_sn(qexon, anno);
var sp = cal_sn(anno, qexon);
print("Base Sn: " + sn[1] + " / " + sn[0] + " = " + (sn[1] / sn[0] * 100).toFixed(2) + "%");
print("Base Sp: " + sp[1] + " / " + sp[0] + " = " + (sp[1] / sp[0] * 100).toFixed(2) + "%");
}
}
// evaluate overlap sensitivity
function paf_ov_eval(args)
{
@@ -2681,6 +3082,23 @@ function paf_misjoin(args)
return len < (en - st) * cen_ratio? false : true;
}
function test_cen_point(cen, chr, x) {
var b = cen[chr];
if (b == null) return false;
for (var j = 0; j < b.length; ++j)
if (x >= b[j][0] && x < b[j][1])
return true;
return false;
}
if (show_err || show_long) {
print("C\tJ inter-chromosomal misjoin");
print("C\tj inter-chromosomal misjoin with both breakpoints ending in centromeres");
print("C\tG long gap on the reference genome");
print("C\tg long gap on the reference genome with both breakpoints ending in centromeres");
print("C\tM closed inversion");
print("C");
}
function process(a) {
var k = 0;
for (var i = 0; i < a.length; ++i) {
@@ -2693,14 +3111,17 @@ function paf_misjoin(args)
a = a.sort(function(x,y){return x[2]-y[2]});
if (show_long) for (var i = 0; i < a.length; ++i) print(a[i].join("\t"));
for (var i = 1; i < a.length; ++i) {
var ov = [false, false];
var ov = [false, false], end_cen = [false, false];
ov[0] = test_cen(cen, a[i-1][5], a[i-1][7], a[i-1][8]);
ov[1] = test_cen(cen, a[i][5], a[i][7], a[i][8]);
end_cen[0] = test_cen_point(cen, a[i-1][5], a[i-1][4] == '+'? a[i-1][8] : a[i-1][7]);
end_cen[1] = test_cen_point(cen, a[i][5], a[i][4] == '+'? a[i][7] : a[i][8]);
if (a[i-1][5] != a[i][5]) { // different chr
if (ov[0] || ov[1]) ++n_diff[1];
else if (show_err) {
print("J", a[i-1].slice(0, 12).join("\t"));
print("J", a[i].slice(0, 12).join("\t"));
var label = end_cen[0] && end_cen[1]? 'j' : 'J';
print(label, a[i-1].slice(0, 12).join("\t"));
print(label, a[i].slice(0, 12).join("\t"));
}
++n_diff[0];
} else if (a[i-1][4] == a[i][4]) { // a gap
@@ -2710,8 +3131,9 @@ function paf_misjoin(args)
if (gap > max_gap) {
if (ov[0] || ov[1]) ++n_gap[1];
else if (show_err) {
print("G", a[i-1].slice(0, 12).join("\t"));
print("G", a[i].slice(0, 12).join("\t"));
var label = end_cen[0] && end_cen[1]? 'g' : 'G';
print(label, a[i-1].slice(0, 12).join("\t"));
print(label, a[i].slice(0, 12).join("\t"));
}
++n_gap[0];
}
@@ -2829,6 +3251,7 @@ function paf_sveval(args)
if (bed != null && bed[t[0]] == null) continue;
if (t[4] == '<INV>' || t[4] == '<INVDUP>') continue; // no inversion
if (/[\[\]]/.test(t[4])) continue; // no break points
if (t[6] != "." && t[6] != "PASS") continue;
var st = parseInt(t[1]) - 1, en = st + t[3].length;
// parse svlen
var b = _paf_get_alen(t), svlen = b[0];
@@ -2951,7 +3374,7 @@ function paf_pafcmp(args)
{
var c, opt = { min_len:5000, min_mapq:10, min_ovlp:0.5 };
while ((c = getopt(args, "q:")) != null) {
if (c == 'q') opt.min_mapq = parseInt(opt.arg);
if (c == 'q') opt.min_mapq = parseInt(getopt.arg);
}
var buf = new Bytes();
@@ -3061,6 +3484,183 @@ function paf_pafcmp(args)
buf.destroy();
}
function paf_longcs2seq(args) {
var c, opt = { query:false };
while ((c = getopt(args, "q")) != null)
if (c == 'q') opt.query = true;
if (args.length == getopt.ind) {
print("Usage: paftools.js longcs2seq [-q] <long-cs.paf>");
return;
}
var re_cs = /([:=*+-])(\d+|[A-Za-z]+)/g
var buf = new Bytes();
var file = args[getopt.ind] == "-"? new File() : new File(args[getopt.ind]);
while (file.readline(buf) >= 0) {
var m, cs = null, t = buf.toString().split("\t");
for (var i = 12; i < t.length; ++i)
if ((m = /^cs:Z:(\S+)/.exec(t[i])) != null) {
cs = m[1];
break;
}
if (cs == null) continue;
var ts = "", qs = "";
while ((m = re_cs.exec(cs)) != null) {
if (m[1] == "=") ts += m[2], qs += m[2];
else if (m[1] == "+") qs += m[2].toUpperCase();
else if (m[1] == "-") ts += m[2].toUpperCase();
else if (m[1] == "*") ts += m[2][0].toUpperCase(), qs += m[2][1].toUpperCase();
else if (m[1] == ":") throw Error("Long cs is required");
}
if (opt.query) {
print(">" + t[0] + "_" + t[2] + "_" + t[3]);
print(qs);
} else {
print(">" + t[5] + "_" + t[7] + "_" + t[8]);
print(ts);
}
}
file.close();
buf.destroy();
}
function paf_paf2gff(args) {
var c, opt = { aa:false };
var re_cigar = /(\d+)([A-Z=])/g;
while ((c = getopt(args, "a")) != null) {
if (c == 'a') opt.aa = true;
}
if (args.length == getopt.ind) {
print("Usage: paftools.js paf2gff [-a] <in.paf>");
return;
}
var buf = new Bytes();
var file = args[getopt.ind] == '-'? new File() : new File(args[getopt.ind]);
var hid = 1, last_name = null;
while (file.readline(buf) >= 0) {
var m, t = buf.toString().split("\t");
if (t[5] == '*') continue; // skip unmapped lines
if (t[0] != last_name) last_name = t[0], hid = 1;
else ++hid;
for (var i = 1; i <= 3; ++i) t[i] = parseInt(t[i]);
for (var i = 6; i <= 11; ++i) t[i] = parseInt(t[i]);
var cigar = null, score = null, np = null, dist_stop = null, dist_start = null;
for (var i = 12; i < t.length; ++i) {
if ((m = /^(cg:Z|AS:i|np:i|da:i|do:i):(\S+)/.exec(t[i])) != null) {
if (m[1] == 'cg:Z') cigar = m[2];
else if (m[1] == 'AS:i') score = parseInt(m[2]);
else if (m[1] == 'np:i') np = parseInt(m[2]);
else if (m[1] == 'do:i') dist_stop = parseInt(m[2]);
else if (m[1] == 'da:i') dist_start = parseInt(m[2]);
}
}
if (cigar == null) throw Error("failed to find the cg:Z tag");
if (score == null) throw Error("failed to find the AS:i tag");
var st = 0, en = 0, phase = 0, pseudo = false, fs = 0, a = [];
if (dist_start != null && dist_start == 0)
a.push([t[5], 'paf2gff', 'start_codon', 0, 3, 0, t[4], '.', 0]);
while ((m = re_cigar.exec(cigar)) != null) {
var len = parseInt(m[1]);
if (m[2] == 'M' || m[2] == 'D') {
en += opt.aa? len * 3 : len;
} else if (m[2] == 'F' || m[2] == 'G' || m[2] == 'R') {
en += len, pseudo = true, fs = 1;
} else if (m[2] == 'N') {
a.push([t[5], 'paf2gff', 'exon', st, en, 0, t[4], phase, fs]);
st = en + len, en += len, phase = 0, fs = 0;
} else if (m[2] == 'U') { // ...xGT...AGxx...
a.push([t[5], 'paf2gff', 'exon', st, en + 1, 0, t[4], phase, fs]);
st = en + len - 2, en += len, phase = 2, fs = 0;
} else if (m[2] == 'V') { // ...xxGT...AGx...
a.push([t[5], 'paf2gff', 'exon', st, en + 2, 0, t[4], phase, fs]);
st = en + len - 1, en += len, phase = 1, fs = 0;
}
}
a.push([t[5], 'paf2gff', 'exon', st, en, 0, t[4], phase, fs]);
if (en != t[8] - t[7]) throw Error("inconsistent cigar");
if (dist_stop != null && dist_stop == 0)
a.push([t[5], 'paf2gff', 'stop_codon', en, en + 3, 0, t[4], '.', 0]);
var type = pseudo? 'pseudogene' : 'protein_coding';
var attr = ['transcript_id=' + t[0] + '#' + hid, 'transcript_type=' + type].join(";");
var trans_attr = 'identity=' + (t[9] / t[10]).toFixed(4);
if (np != null) trans_attr += ';positive=' + (np * 3 / t[10]).toFixed(4);
trans_attr += ';aa_start=' + t[2];
trans_attr += ';aa_end=' + (t[1] - t[3]);
if (dist_start != null && dist_start >= 0) trans_attr += ';dist_start_codon=' + dist_start;
if (dist_stop != null && dist_stop >= 0) trans_attr += ';dist_stop_codon=' + dist_stop;
var trans_st = t[7], trans_en = t[8];
if (dist_stop != null && dist_stop == 0) {
if (t[4] == '-') trans_st -= 3;
else trans_en += 3;
}
print([t[5], 'paf2gff', 'transcript', trans_st + 1, trans_en, score, t[4], '.', attr + ';' + trans_attr].join("\t"));
if (opt.aa && t[4] == '-') {
var b = [], len = t[8] - t[7];
for (var i = a.length - 1; i >= 0; --i) {
var x = len - a[i][3];
a[i][3] = len - a[i][4];
a[i][4] = x;
//a[i][7] = a[i][7] == 0? 0 : 3 - a[i][7]; // not sure if this line is needed
b.push(a[i]);
}
a = b;
}
for (var i = 0; i < a.length; ++i) {
if (!pseudo && a[i][2] == "exon") a[i][2] = "CDS";
a[i][3] += t[7] + 1;
a[i][4] += t[7];
a[i][8] = attr + ";frameshift=" + a[i][8];
print(a[i].join("\t"));
}
}
file.close();
buf.destroy();
}
function paf_gff2junc(args) {
var c, feat = "CDS";
while ((c = getopt(args, "f:")) != null) {
if (c == 'f') feat = getopt.arg;
}
if (getopt.ind == args.length) {
print("Usage: paftools.js gff2junc [-f feature] <in.gff3>");
return;
}
var buf = new Bytes();
var file = args[getopt.ind] == "-"? new File() : new File(args[getopt.ind]);
function process_a(a) {
if (a.length < 2) return;
a = a.sort(function(x, y) { return x[4] - y[4] });
for (var i = 1; i < a.length; ++i)
print([a[i][1], a[i-1][5], a[i][4], a[i][0], 0, a[i][7]].join("\t"));
}
var a = [];
while (file.readline(buf) >= 0) {
var m, t = buf.toString().split("\t");
if (t[0][0] == '#') continue;
if (t[2].toLowerCase() != feat.toLowerCase()) continue;
//print(t.join("\t"));
if ((m = /\bParent=([^;]+)/.exec(t[8])) == null) {
warn("Can't find Parent");
continue;
}
t[3] = parseInt(t[3]) - 1;
t[4] = parseInt(t[4]);
t.unshift(m[1]);
if (a.length > 0 && a[0][0] != m[1]) {
process_a(a);
a.length = 0;
a.push(t);
} else a.push(t);
}
process_a(a);
file.close();
buf.destroy();
}
/*************************
***** main function *****
*************************/
@@ -3075,6 +3675,9 @@ function main(args)
print(" sam2paf convert SAM to PAF");
print(" delta2paf convert MUMmer's delta to PAF");
print(" gff2bed convert GTF/GFF3 to BED12");
print(" gff2junc convert GFF3 to junction BED");
print(" longcs2seq convert long-cs PAF to sequences");
// print(" paf2gff convert PAF to GFF3 (tested for miniprot only)");
print("");
print(" stat collect basic mapping information in PAF/SAM");
print(" asmstat collect basic assembly information");
@@ -3092,6 +3695,7 @@ function main(args)
print(" mason2fq convert mason2-simulated SAM to FASTQ");
print(" pbsim2fq convert PBSIM-simulated MAF to FASTQ");
print(" junceval evaluate splice junction consistency with known annotations");
print(" exoneval evaluate exon-level consistency with known annotations");
print(" ov-eval evaluate read overlap sensitivity using read-to-ref mapping");
exit(1);
}
@@ -3102,6 +3706,7 @@ function main(args)
else if (cmd == 'delta2paf') paf_delta2paf(args);
else if (cmd == 'splice2bed') paf_splice2bed(args);
else if (cmd == 'gff2bed') paf_gff2bed(args);
else if (cmd == 'gff2junc') paf_gff2junc(args);
else if (cmd == 'stat') paf_stat(args);
else if (cmd == 'asmstat') paf_asmstat(args);
else if (cmd == 'asmgene') paf_asmgene(args);
@@ -3115,10 +3720,13 @@ function main(args)
else if (cmd == 'mason2fq') paf_mason2fq(args);
else if (cmd == 'pbsim2fq') paf_pbsim2fq(args);
else if (cmd == 'junceval') paf_junceval(args);
else if (cmd == 'exoneval') paf_exoneval(args);
else if (cmd == 'ov-eval') paf_ov_eval(args);
else if (cmd == 'vcfstat') paf_vcfstat(args);
else if (cmd == 'sveval') paf_sveval(args);
else if (cmd == 'vcfsel') paf_vcfsel(args);
else if (cmd == 'longcs2seq') paf_longcs2seq(args);
else if (cmd == 'paf2gff') paf_paf2gff(args);
else if (cmd == 'version') print(paftools_version);
else throw Error("unrecognized command: " + cmd);
}
+29 -5
View File
@@ -13,6 +13,8 @@
#define MM_DBG_PRINT_QNAME 0x2
#define MM_DBG_PRINT_SEED 0x4
#define MM_DBG_PRINT_ALN_SEQ 0x8
#define MM_DBG_PRINT_CHAIN 0x10
#define MM_DBG_SEED_FREQ 0x20
#define MM_SEED_LONG_JOIN (1ULL<<40)
#define MM_SEED_IGNORE (1ULL<<41)
@@ -22,6 +24,9 @@
#define MM_SEED_SEG_SHIFT 48
#define MM_SEED_SEG_MASK (0xffULL<<(MM_SEED_SEG_SHIFT))
#define MM_JUNC_ANNO 0x1
#define MM_JUNC_MISC 0x2
#ifndef kroundup32
#define kroundup32(x) (--(x), (x)|=(x)>>1, (x)|=(x)>>2, (x)|=(x)>>4, (x)|=(x)>>8, (x)|=(x)>>16, ++(x))
#endif
@@ -31,6 +36,7 @@
#define MALLOC(type, len) ((type*)malloc((len) * sizeof(type)))
#define CALLOC(type, len) ((type*)calloc((len), sizeof(type)))
#define REALLOC(type, ptr, cnt) ((type*)realloc((ptr), (cnt) * sizeof(type)))
#ifdef __cplusplus
extern "C" {
@@ -50,6 +56,12 @@ typedef struct {
mm128_t *a;
} mm_seg_t;
typedef struct {
int32_t off, off2, cnt;
int16_t strand;
uint16_t flag;
} mm_idx_jjump1_t;
double cputime(void);
double realtime(void);
long peakrss(void);
@@ -61,24 +73,29 @@ uint32_t ks_ksmall_uint32_t(size_t n, uint32_t arr[], size_t kk);
void mm_sketch(void *km, const char *str, int len, int w, int k, uint32_t rid, int is_hpc, mm128_v *p);
mm_seed_t *mm_collect_matches(void *km, int *_n_m, int qlen, int max_occ, int max_max_occ, int dist, const mm_idx_t *mi, const mm128_v *mv, int64_t *n_a, int *rep_len, int *n_mini_pos, uint64_t **mini_pos);
void mm_seed_mz_flt(void *km, mm128_v *mv, int32_t q_occ_max, float q_occ_frac);
double mm_event_identity(const mm_reg1_t *r);
int mm_write_sam_hdr(const mm_idx_t *mi, const char *rg, const char *ver, int argc, char *argv[]);
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag);
void mm_write_paf3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag, int rep_len);
void mm_write_paf4(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag, int rep_len, int n_seg, int seg_idx);
void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int n_regs, const mm_reg1_t *regs);
void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regs, const mm_reg1_t *const* regs, void *km, int64_t opt_flag);
void mm_write_sam3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regss, const mm_reg1_t *const* regss, void *km, int64_t opt_flag, int rep_len);
void mm_write_junc(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r);
// indexing related in index.c
void mm_idxopt_init(mm_idxopt_t *opt);
const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n);
int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f);
int mm_idx_getseq2(const mm_idx_t *mi, int is_rev, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq);
mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a);
mm_reg1_t *mm_gen_regs(void *km, uint32_t hash, int qlen, int n_u, uint64_t *u, mm128_t *a, int is_qstrand);
int mm_idx_bed_read(mm_idx_t *mi, const char *fn, int read_junc);
int mm_idx_jjump_read(mm_idx_t *mi, const char *fn, int flag, int min_sc);
const mm_idx_jjump1_t *mm_idx_jump_get(const mm_idx_t *db, int32_t cid, int32_t st, int32_t en, int32_t *n);
mm128_t *mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int max_iter, int min_cnt, int min_sc, float gap_scale,
int is_cdna, int n_segs, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km);
// chaining in lchain.c
mm128_t *mg_lchain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int max_iter, int min_cnt, int min_sc, float chn_pen_gap, float chn_pen_skip,
int is_cdna, int n_segs, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km);
mm128_t *mg_lchain_rmq(int max_dist, int max_dist_inner, int bw, int max_chn_skip, int cap_rmq_size, int min_cnt, int min_sc, float chn_pen_gap, float chn_pen_skip,
@@ -90,12 +107,17 @@ void mm_sync_regs(void *km, int n_regs, mm_reg1_t *regs);
int mm_squeeze_a(void *km, int n_regs, mm_reg1_t *regs, mm128_t *a);
int mm_set_sam_pri(int n, mm_reg1_t *r);
void mm_set_parent(void *km, float mask_level, int mask_len, int n, mm_reg1_t *r, int sub_diff, int hard_mask_level, float alt_diff_frac);
void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int *n_, mm_reg1_t *r);
void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int check_strand, int min_strand_sc, int *n_, mm_reg1_t *r);
void mm_select_sub_multi(void *km, float pri_ratio, float pri1, float pri2, int max_gap_ref, int min_diff, int best_n, int n_segs, const int *qlens, int *n_, mm_reg1_t *r);
int mm_filter_strand_retained(int n_regs, mm_reg1_t *r);
void mm_filter_regs(const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs);
void mm_hit_sort(void *km, int *n_regs, mm_reg1_t *r, float alt_diff_frac);
void mm_set_mapq(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr);
void mm_set_mapq2(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr, int is_splice);
void mm_update_dp_max(int qlen, int n_regs, mm_reg1_t *regs, float frac, int a, int b);
void mm_jump_split(void *km, const mm_idx_t *mi, const mm_mapopt_t *opt, int32_t qlen, const uint8_t *qseq, mm_reg1_t *r, int32_t ts_strand);
mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a);
void mm_enlarge_cigar(mm_reg1_t *r, uint32_t n_cigar);
void mm_est_err(const mm_idx_t *mi, int qlen, int n_regs, mm_reg1_t *regs, const mm128_t *a, int32_t n, const uint64_t *mini_pos);
@@ -103,6 +125,8 @@ mm_seg_t *mm_seg_gen(void *km, uint32_t hash, int n_segs, const int *qlens, int
void mm_seg_free(void *km, int n_segs, mm_seg_t *segs);
void mm_pair(void *km, int max_gap_ref, int dp_bonus, int sub_diff, int match_sc, const int *qlens, int *n_regs, mm_reg1_t **regs);
void mm_jump_split(void *km, const mm_idx_t *mi, const mm_mapopt_t *opt, int32_t qlen, const uint8_t *qseq, mm_reg1_t *r, int32_t ts_strand);
FILE *mm_split_init(const char *prefix, const mm_idx_t *mi);
mm_idx_t *mm_split_merge_prep(const char *prefix, int n_splits, FILE **fp, uint32_t *n_seq_part);
int mm_split_merge(int n_segs, const char **fn, const mm_mapopt_t *opt, int n_split_idx);
+56 -9
View File
@@ -8,7 +8,7 @@ void mm_idxopt_init(mm_idxopt_t *opt)
opt->k = 15, opt->w = 10, opt->flag = 0;
opt->bucket_bits = 14;
opt->mini_batch_size = 50000000;
opt->batch_size = 4000000000ULL;
opt->batch_size = 8000000000ULL;
}
void mm_mapopt_init(mm_mapopt_t *opt)
@@ -19,6 +19,7 @@ void mm_mapopt_init(mm_mapopt_t *opt)
opt->min_mid_occ = 10;
opt->max_mid_occ = 1000000;
opt->sdust_thres = 0; // no SDUST masking
opt->q_occ_frac = 0.01f;
opt->min_cnt = 3;
opt->min_chain_score = 40;
@@ -32,6 +33,7 @@ void mm_mapopt_init(mm_mapopt_t *opt)
opt->rmq_rescue_size = 1000;
opt->rmq_rescue_ratio = 0.1f;
opt->chain_gap_scale = 0.8f;
opt->chain_skip_scale = 0.0f;
opt->max_max_occ = 4095;
opt->occ_dist = 500;
@@ -43,6 +45,7 @@ void mm_mapopt_init(mm_mapopt_t *opt)
opt->alt_drop = 0.15f;
opt->a = 2, opt->b = 4, opt->q = 4, opt->e = 2, opt->q2 = 24, opt->e2 = 1;
opt->transition = 0;
opt->sc_ambi = 1;
opt->zdrop = 400, opt->zdrop_inv = 200;
opt->end_bonus = -1;
@@ -52,12 +55,15 @@ void mm_mapopt_init(mm_mapopt_t *opt)
opt->max_clip_ratio = 1.0f;
opt->mini_batch_size = 500000000;
opt->max_sw_mat = 100000000;
opt->cap_kalloc = 500000000;
opt->rank_min_len = 500;
opt->rank_frac = 0.9f;
opt->pe_ori = 0; // FF
opt->pe_bonus = 33;
opt->jump_min_match = 3;
}
void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
@@ -71,6 +77,7 @@ void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
if (opt->max_mid_occ > opt->min_mid_occ && opt->mid_occ > opt->max_mid_occ)
opt->mid_occ = opt->max_mid_occ;
}
if (opt->bw_long < opt->bw) opt->bw_long = opt->bw;
if (mm_verbose >= 3)
fprintf(stderr, "[M::%s::%.3f*%.2f] mid_occ = %d\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), opt->mid_occ);
}
@@ -86,7 +93,7 @@ int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
if (preset == 0) {
mm_idxopt_init(io);
mm_mapopt_init(mo);
} else if (strcmp(preset, "map-ont") == 0) { // this is the same as the default
} else if (strcmp(preset, "lr") == 0 || strcmp(preset, "map-ont") == 0) { // this is the same as the default
} else if (strcmp(preset, "ava-ont") == 0) {
io->flag = 0, io->k = 15, io->w = 5;
mo->flag |= MM_F_ALL_CHAINS | MM_F_NO_DIAG | MM_F_NO_DUAL | MM_F_NO_LJOIN;
@@ -101,16 +108,33 @@ int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_chain_skip = 25;
mo->bw_long = mo->bw;
mo->occ_dist = 0;
} else if (strcmp(preset, "map-hifi") == 0 || strcmp(preset, "map-ccs") == 0) {
} else if (strcmp(preset, "lr:hq") == 0 || strcmp(preset, "map-hifi") == 0 || strcmp(preset, "map-ccs") == 0) {
io->flag = 0, io->k = 19, io->w = 19;
mo->max_gap = 10000;
mo->a = 1, mo->b = 4, mo->q = 6, mo->q2 = 26, mo->e = 2, mo->e2 = 1;
mo->occ_dist = 500;
mo->min_mid_occ = 50, mo->max_mid_occ = 500;
if (strcmp(preset, "map-hifi") == 0 || strcmp(preset, "map-ccs") == 0) {
mo->a = 1, mo->b = 4, mo->q = 6, mo->q2 = 26, mo->e = 2, mo->e2 = 1;
mo->min_dp_max = 200;
}
} else if (strcmp(preset, "lr:hqae") == 0) { // high-quality assembly evaluation
io->flag = 0, io->k = 25, io->w = 51;
mo->flag |= MM_F_RMQ;
mo->min_mid_occ = 50, mo->max_mid_occ = 500;
mo->rmq_inner_dist = 5000;
mo->occ_dist = 200;
mo->best_n = 100;
mo->chain_gap_scale = 5.0f;
} else if (strcmp(preset, "map-iclr-prerender") == 0) {
io->flag = 0, io->k = 15;
mo->b = 6, mo->transition = 1;
mo->q = 10, mo->q2 = 50;
} else if (strcmp(preset, "map-iclr") == 0) {
io->flag = 0, io->k = 19;
mo->b = 6, mo->transition = 4;
mo->q = 10, mo->q2 = 50;
} else if (strncmp(preset, "asm", 3) == 0) {
io->flag = 0, io->k = 19, io->w = 19;
mo->bw = mo->bw_long = 100000;
mo->bw = 1000, mo->bw_long = 100000;
mo->max_gap = 10000;
mo->flag |= MM_F_RMQ;
mo->min_mid_occ = 50, mo->max_mid_occ = 500;
@@ -142,7 +166,7 @@ int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
mo->mid_occ = 1000;
mo->max_occ = 5000;
mo->mini_batch_size = 50000000;
} else if (strncmp(preset, "splice", 6) == 0 || strcmp(preset, "cdna") == 0) {
} else if (strcmp(preset, "splice") == 0 || strcmp(preset, "splice:hq") == 0 || strcmp(preset, "splice:sr") == 0 || strcmp(preset, "cdna") == 0) {
io->flag = 0, io->k = 15, io->w = 5;
mo->flag |= MM_F_SPLICE | MM_F_SPLICE_FOR | MM_F_SPLICE_REV | MM_F_SPLICE_FLANK;
mo->max_sw_mat = 0;
@@ -150,13 +174,31 @@ int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
mo->a = 1, mo->b = 2, mo->q = 2, mo->e = 1, mo->q2 = 32, mo->e2 = 0;
mo->noncan = 9;
mo->junc_bonus = 9;
mo->junc_pen = 5;
mo->zdrop = 200, mo->zdrop_inv = 100; // because mo->a is halved
if (strcmp(preset, "splice:hq") == 0)
mo->junc_bonus = 5, mo->b = 4, mo->q = 6, mo->q2 = 24;
if (strcmp(preset, "splice:hq") == 0) {
mo->noncan = 5, mo->b = 4, mo->q = 6, mo->q2 = 24;
} else if (strcmp(preset, "splice:sr") == 0) {
mo->flag |= MM_F_NO_PRINT_2ND | MM_F_2_IO_THREADS | MM_F_HEAP_SORT | MM_F_FRAG_MODE | MM_F_WEAK_PAIRING | MM_F_SR_RNA;
mo->noncan = 5, mo->b = 4, mo->q = 6, mo->q2 = 24;
mo->min_chain_score = 25;
mo->min_dp_max = 40;
mo->min_ksw_len = 20;
mo->pe_ori = 0<<1|1; // FR
mo->best_n = 10;
mo->mini_batch_size = 100000000;
}
} else return -1;
return 0;
}
int mm_max_spsc_bonus(const mm_mapopt_t *mo)
{
int max_sc = (mo->q2 + 1) / 2 - 1;
max_sc = max_sc > mo->q2 - mo->q? max_sc : mo->q2 - mo->q;
return max_sc;
}
int mm_check_opt(const mm_idxopt_t *io, const mm_mapopt_t *mo)
{
if (mo->bw > mo->bw_long) {
@@ -211,6 +253,11 @@ int mm_check_opt(const mm_idxopt_t *io, const mm_mapopt_t *mo)
fprintf(stderr, "[ERROR]\033[1;31m scoring system violating ({-O}+{-E})+({-O2}+{-E2}) <= 127\033[0m\n");
return -1;
}
if (mo->sc_ambi < 0 || mo->sc_ambi >= mo->b) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m --score-N should be within [0,{-B})\033[0m\n");
return -1;
}
if (mo->zdrop < mo->zdrop_inv) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m Z-drop should not be less than inversion-Z-drop\033[0m\n");
+2
View File
@@ -0,0 +1,2 @@
[build-system]
requires = ["setuptools", "wheel", "Cython"]
+3 -1
View File
@@ -77,7 +77,9 @@ This constructor accepts the following arguments:
* **min_chain_score**: minimum chaing score
* **bw**: chaining and alignment band width
* **bw**: chaining and alignment band width (initial chaining and extension)
* **bw_long**: chaining and alignment band width (RMQ-based rechaining and closing gaps)
* **best_n**: max number of alignments to return
+3 -3
View File
@@ -71,13 +71,13 @@ static inline void mm_reset_timer(void)
}
extern unsigned char seq_comp_table[256];
static inline mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char *seq1, const char *seq2, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt)
static inline mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char* seqname, const char *seq1, const char *seq2, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt)
{
mm_reg1_t *r;
Py_BEGIN_ALLOW_THREADS
if (seq2 == 0) {
r = mm_map(mi, strlen(seq1), seq1, n_regs, b, opt, NULL);
r = mm_map(mi, strlen(seq1), seq1, n_regs, b, opt, seqname);
} else {
int _n_regs[2];
mm_reg1_t *regs[2];
@@ -94,7 +94,7 @@ static inline mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char *seq1, const
seq[1][i] = seq_comp_table[t];
}
if (len[1]&1) seq[1][len[1]>>1] = seq_comp_table[(uint8_t)seq[1][len[1]>>1]];
mm_map_frag(mi, 2, len, (const char**)seq, _n_regs, regs, b, opt, NULL);
mm_map_frag(mi, 2, len, (const char**)seq, _n_regs, regs, b, opt, seqname);
for (i = 0; i < _n_regs[1]; ++i)
regs[1][i].rev = !regs[1][i].rev;
*n_regs = _n_regs[0] + _n_regs[1];
+11 -2
View File
@@ -23,6 +23,7 @@ cdef extern from "minimap.h":
int min_cnt
int min_chain_score
float chain_gap_scale
float chain_skip_scale
int rmq_size_cap, rmq_inner_dist
int rmq_rescue_size
float rmq_rescue_ratio
@@ -35,9 +36,10 @@ cdef extern from "minimap.h":
float alt_drop
int a, b, q, e, q2, e2
int transition
int sc_ambi
int noncan
int junc_bonus
int junc_bonus, junc_pen
int zdrop, zdrop_inv
int end_bonus
int min_dp_max
@@ -45,14 +47,21 @@ cdef extern from "minimap.h":
int anchor_ext_len, anchor_ext_shift
float max_clip_ratio
int rank_min_len
float rank_frac
int pe_ori, pe_bonus
int jump_min_match;
float mid_occ_frac
float q_occ_frac
int32_t min_mid_occ
int32_t mid_occ
int32_t max_occ
int64_t mini_batch_size
int64_t max_sw_mat
int64_t cap_kalloc
const char *split_prefix
@@ -122,7 +131,7 @@ cdef extern from "cmappy.h":
void mm_reg2hitpy(const mm_idx_t *mi, mm_reg1_t *r, mm_hitpy_t *h)
void mm_free_reg1(mm_reg1_t *r)
mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char *seq1, const char *seq2, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt)
mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char* seqname, const char *seq1, const char *seq2, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt)
char *mappy_fetch_seq(const mm_idx_t *mi, const char *name, int st, int en, int *l)
mm_idx_t *mappy_idx_seq(int w, int k, int is_hpc, int bucket_bits, const char *seq, int l)
+23 -7
View File
@@ -3,7 +3,7 @@ from libc.stdlib cimport free
cimport cmappy
import sys
__version__ = '2.21'
__version__ = '2.30'
cmappy.mm_reset_timer()
@@ -96,6 +96,7 @@ cdef class Alignment:
a = [str(self._q_st), str(self._q_en), strand, self._ctg, str(self._ctg_len), str(self._r_st), str(self._r_en),
str(self._mlen), str(self._blen), str(self._mapq), tp, ts, "cg:Z:" + self.cigar_str]
if self._cs != "": a.append("cs:Z:" + self._cs)
if self._MD != "": a.append("MD:Z:" + self._MD)
return "\t".join(a)
cdef class ThreadBuffer:
@@ -112,7 +113,7 @@ cdef class Aligner:
cdef cmappy.mm_idxopt_t idx_opt
cdef cmappy.mm_mapopt_t map_opt
def __cinit__(self, fn_idx_in=None, preset=None, k=None, w=None, min_cnt=None, min_chain_score=None, min_dp_score=None, bw=None, best_n=None, n_threads=3, fn_idx_out=None, max_frag_len=None, extra_flags=None, seq=None, scoring=None):
def __cinit__(self, fn_idx_in=None, preset=None, k=None, w=None, min_cnt=None, min_chain_score=None, min_dp_score=None, bw=None, bw_long=None, best_n=None, n_threads=3, fn_idx_out=None, max_frag_len=None, extra_flags=None, seq=None, scoring=None, sc_ambi=None, max_chain_skip=None):
self._idx = NULL
cmappy.mm_set_opt(NULL, &self.idx_opt, &self.map_opt) # set the default options
if preset is not None:
@@ -125,6 +126,7 @@ cdef class Aligner:
if min_chain_score is not None: self.map_opt.min_chain_score = min_chain_score
if min_dp_score is not None: self.map_opt.min_dp_max = min_dp_score
if bw is not None: self.map_opt.bw = bw
if bw_long is not None: self.map_opt.bw_long = bw_long
if best_n is not None: self.map_opt.best_n = best_n
if max_frag_len is not None: self.map_opt.max_frag_len = max_frag_len
if extra_flags is not None: self.map_opt.flag |= extra_flags
@@ -136,6 +138,8 @@ cdef class Aligner:
self.map_opt.q2, self.map_opt.e2 = scoring[4], scoring[5]
if len(scoring) >= 7:
self.map_opt.sc_ambi = scoring[6]
if sc_ambi is not None: self.map_opt.sc_ambi = sc_ambi
if max_chain_skip is not None: self.map_opt.max_chain_skip = max_chain_skip
cdef cmappy.mm_idx_reader_t *r;
@@ -161,7 +165,7 @@ cdef class Aligner:
def __bool__(self):
return (self._idx != NULL)
def map(self, seq, seq2=None, buf=None, cs=False, MD=False, max_frag_len=None, extra_flags=None):
def map(self, seq, seq2=None, name=None, buf=None, cs=False, MD=False, max_frag_len=None, extra_flags=None):
cdef cmappy.mm_reg1_t *regs
cdef cmappy.mm_hitpy_t h
cdef ThreadBuffer b
@@ -172,6 +176,7 @@ cdef class Aligner:
cdef cmappy.mm_mapopt_t map_opt
if self._idx == NULL: return
if ((self.map_opt.flag & 4) and (self._idx.flag & 2)): return
map_opt = self.map_opt
if max_frag_len is not None: map_opt.max_frag_len = max_frag_len
if extra_flags is not None: map_opt.flag |= extra_flags
@@ -182,11 +187,20 @@ cdef class Aligner:
km = cmappy.mm_tbuf_get_km(b._b)
_seq = seq if isinstance(seq, bytes) else seq.encode()
if name is not None:
_name = name if isinstance(name, bytes) else name.encode()
if seq2 is None:
regs = cmappy.mm_map_aux(self._idx, _seq, NULL, &n_regs, b._b, &map_opt)
if name is None:
regs = cmappy.mm_map_aux(self._idx, NULL, _seq, NULL, &n_regs, b._b, &map_opt)
else:
regs = cmappy.mm_map_aux(self._idx, _name, _seq, NULL, &n_regs, b._b, &map_opt)
else:
_seq2 = seq2 if isinstance(seq2, bytes) else seq2.encode()
regs = cmappy.mm_map_aux(self._idx, _seq, _seq2, &n_regs, b._b, &map_opt)
if name is None:
regs = cmappy.mm_map_aux(self._idx, NULL, _seq, _seq2, &n_regs, b._b, &map_opt)
else:
regs = cmappy.mm_map_aux(self._idx, _name, _seq, _seq2, &n_regs, b._b, &map_opt)
try:
i = 0
@@ -197,11 +211,12 @@ cdef class Aligner:
c = h.cigar32[k]
cigar.append([c>>4, c&0xf])
if cs or MD: # generate the cs and/or the MD tag, if requested
_cur_seq = _seq2 if h.seg_id > 0 and seq2 is not None else _seq
if cs:
l_cs_str = cmappy.mm_gen_cs(km, &cs_str, &m_cs_str, self._idx, &regs[i], _seq, 1)
l_cs_str = cmappy.mm_gen_cs(km, &cs_str, &m_cs_str, self._idx, &regs[i], _cur_seq, 1)
_cs = cs_str[:l_cs_str] if isinstance(cs_str, str) else cs_str[:l_cs_str].decode()
if MD:
l_cs_str = cmappy.mm_gen_MD(km, &cs_str, &m_cs_str, self._idx, &regs[i], _seq)
l_cs_str = cmappy.mm_gen_MD(km, &cs_str, &m_cs_str, self._idx, &regs[i], _cur_seq)
_MD = cs_str[:l_cs_str] if isinstance(cs_str, str) else cs_str[:l_cs_str].decode()
yield Alignment(h.ctg, h.ctg_len, h.ctg_start, h.ctg_end, h.strand, h.qry_start, h.qry_end, h.mapq, cigar, h.is_primary, h.mlen, h.blen, h.NM, h.trans_strand, h.seg_id, _cs, _MD)
cmappy.mm_free_reg1(&regs[i])
@@ -217,6 +232,7 @@ cdef class Aligner:
cdef int l
cdef char *s
if self._idx == NULL: return
if ((self.map_opt.flag & 4) and (self._idx.flag & 2)): return
s = cmappy.mappy_fetch_seq(self._idx, name.encode(), start, end, &l)
if l == 0: return None
r = s[:l] if isinstance(s, str) else s[:l].decode()
+5 -3
View File
@@ -5,7 +5,7 @@ import getopt
import mappy as mp
def main(argv):
opts, args = getopt.getopt(argv[1:], "x:n:m:k:w:r:c")
opts, args = getopt.getopt(argv[1:], "x:n:m:k:w:r:cM")
if len(args) < 2:
print("Usage: minimap2.py [options] <ref.fa>|<ref.mmi> <query.fq>")
print("Options:")
@@ -16,10 +16,11 @@ def main(argv):
print(" -w INT minimizer window length")
print(" -r INT band width")
print(" -c output the cs tag")
print(" -M output the MD tag")
sys.exit(1)
preset = min_cnt = min_sc = k = w = bw = None
out_cs = False
out_cs = out_MD = False
for opt, arg in opts:
if opt == '-x': preset = arg
elif opt == '-n': min_cnt = int(arg)
@@ -28,11 +29,12 @@ def main(argv):
elif opt == '-k': k = int(arg)
elif opt == '-w': w = int(arg)
elif opt == '-c': out_cs = True
elif opt == '-M': out_MD = True
a = mp.Aligner(args[0], preset=preset, min_cnt=min_cnt, min_chain_score=min_sc, k=k, w=w, bw=bw)
if not a: raise Exception("ERROR: failed to load/build index file '{}'".format(args[0]))
for name, seq, qual in mp.fastx_read(args[1]): # read one sequence
for h in a.map(seq, cs=out_cs): # traverse hits
for h in a.map(seq, cs=out_cs, MD=out_MD): # traverse hits
print('{}\t{}\t{}'.format(name, len(seq), h))
if __name__ == "__main__":
+27 -1
View File
@@ -2,6 +2,31 @@
#include "kalloc.h"
#include "ksort.h"
void mm_seed_mz_flt(void *km, mm128_v *mv, int32_t q_occ_max, float q_occ_frac)
{
mm128_t *a;
size_t i, j, st;
if (mv->n <= q_occ_max || q_occ_frac <= 0.0f || q_occ_max <= 0) return;
a = Kmalloc(km, mm128_t, mv->n);
for (i = 0; i < mv->n; ++i)
a[i].x = mv->a[i].x, a[i].y = i;
radix_sort_128x(a, a + mv->n);
for (st = 0, i = 1; i <= mv->n; ++i) {
if (i == mv->n || a[i].x != a[st].x) {
int32_t cnt = i - st;
if (cnt > q_occ_max && cnt > mv->n * q_occ_frac)
for (j = st; j < i; ++j)
mv->a[a[j].y].x = 0;
st = i;
}
}
kfree(km, a);
for (i = j = 0; i < mv->n; ++i)
if (mv->a[i].x != 0)
mv->a[j++] = mv->a[i];
mv->n = j;
}
mm_seed_t *mm_seed_collect_all(void *km, const mm_idx_t *mi, const mm128_v *mv, int32_t *n_m_)
{
mm_seed_t *m;
@@ -87,7 +112,8 @@ mm_seed_t *mm_collect_matches(void *km, int *_n_m, int qlen, int max_occ, int ma
}
for (i = 0, n_m = 0, *rep_len = 0, *n_a = 0; i < n_m0; ++i) {
mm_seed_t *q = &m[i];
//fprintf(stderr, "X\t%d\t%d\t%d\n", q->q_pos>>1, q->n, q->flt);
if (mm_dbg_flag & MM_DBG_SEED_FREQ)
fprintf(stderr, "SF\t%d\t%d\t%d\n", q->q_pos>>1, q->n, q->flt);
if (q->flt) {
int en = (q->q_pos >> 1) + 1, st = en - q->q_span;
if (st > rep_en) {
+2 -2
View File
@@ -23,7 +23,7 @@ def readme():
setup(
name = 'mappy',
version = '2.21',
version = '2.30',
url = 'https://github.com/lh3/minimap2',
description = 'Minimap2 python binding',
long_description = readme(),
@@ -33,7 +33,7 @@ setup(
keywords = 'sequence-alignment',
scripts = ['python/minimap2.py'],
ext_modules = [Extension('mappy',
sources = ['python/mappy.pyx', 'align.c', 'bseq.c', 'lchain.c', 'seed.c', 'format.c', 'hit.c', 'index.c', 'pe.c', 'options.c',
sources = ['python/mappy.pyx', 'align.c', 'bseq.c', 'lchain.c', 'seed.c', 'format.c', 'hit.c', 'index.c', 'pe.c', 'jump.c', 'options.c',
'ksw2_extd2_sse.c', 'ksw2_exts2_sse.c', 'ksw2_extz2_sse.c', 'ksw2_ll_sse.c',
'kalloc.c', 'kthread.c', 'map.c', 'misc.c', 'sdust.c', 'sketch.c', 'esterr.c', 'splitidx.c'],
depends = ['minimap.h', 'bseq.h', 'kalloc.h', 'kdq.h', 'khash.h', 'kseq.h', 'ksort.h',
+5
View File
@@ -0,0 +1,5 @@
mm2: TGTTATCCCTAGGGTAACTTGTTCCGTTGGTCAAGTTATTGGATCAATTGAGTATAGTAGTGCACTCAC......................................................................................................................................CACTTGGAGCCATTCATACAGGTCCCTATTTAAGGAACAAGTGATTATGCTACCTTTGCACGGTT
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
ref: TGTTATCCCTAGGGTAACTTGTTCCGTTGGTCAAGTTATTGGATCAATTGAGTATAGTAGTGCACTCACctGCTTCGCTTTGACTGGTGAAGTCTTAGCATGTACTGCTCGGAGGTTGGGTTCTGCTCCGAGGTCGCCCCAACCGAAATTTTTAATGCAGGTTTGGTAGTTTAGGACCTGTGGGTTTGTTAGGCTAACCTCacCACTTGGAGCCATTCATACAGGTCCCTATTTAAGGAACAAGTGATTATGCTACCTTTGCACGGTT
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
sta: TGTTATCCCTAGGGTAACTTGTTCCGTTGGTCAAGTTATTGGATCAATTGAGTATAGTAGTGCA......................................................................................................................................CTCACCACTTGGAGCCATTCATACAGGTCCCTATTTAAGGAACAAGTGATTATGCTACCTTTGCACGGTT
+5
View File
@@ -0,0 +1,5 @@
>query
AACCGTGCAAAGGTAGCATAATCACTTGTTCCTTAAATAGGGACCTGTATGAATGGCTCC
AAGTG
GTGAGTGCA
CTACTATACTCAATTGATCCAATAACTTGACCAACGGAACAAGTTACCCTAGGGATAACA
+10
View File
@@ -0,0 +1,10 @@
>ref
TGATCCAACATCGAGGTCGTAAACCCTATTGTTGATATGGACTCTAGAATAGGATTGCGC
TGTTATCCCTAGGGTAACTTGTTCCGTTGGTCAAGTTATTGGATCAATTGAGTATAGTAG
TGCACTCAC
ctGCTTCGCTTTGACTGGTGAAGTCTTAGCATGTACTGCTCGGAGGTTGGGTTCTGCTCC
GAGGTCGCCCCAACCGAAATTTTTAATGCAGGTTTGGTAGTTTAGGACCTGTGGGTTTGT
TAGGCTAACCTCac
CACTTGGAGCCATTCATACAGGTCCCTATTTAAGGAACAAGTGATTATGCTACCTTTGCA
CGGTTAGGGTACCGCGGCCGTTAAACATGTGTCACTGGGCAGGCGGTGCCTCTAATACTG
GTGAT
+10 -1
View File
@@ -370,7 +370,6 @@
year = {2020},
doi = {10.1101/2020.11.01.363887},
publisher = {Cold Spring Harbor Laboratory},
abstract = {About 5-10\% of the human genome remains inaccessible for functional analysis due to the presence of repetitive sequences such as segmental duplications and tandem repeat arrays. To enable high-quality resequencing of personal genomes, it is crucial to support end-to-end genome variant discovery using repeat-aware read mapping methods. In this study, we highlight the fact that existing long read mappers often yield incorrect alignments and variant calls within long, near-identical repeats, as they remain vulnerable to allelic bias. In the presence of a non-reference allele within a repeat, a read sampled from that region could be mapped to an incorrect repeat copy because the standard pairwise sequence alignment scoring system penalizes true variants.To address the above problem, we propose a novel, long read mapping method that addresses allelic bias by making use of minimal confidently alignable substrings (MCASs). MCASs are formulated as minimal length substrings of a read that have unique alignments to a reference locus with sufficient mapping confidence (i.e., a mapping quality score above a user-specified threshold). This approach treats each read mapping as a collection of confident sub-alignments, which is more tolerant of structural variation and more sensitive to paralog-specific variants (PSVs) within repeats. We mathematically define MCASs and discuss an exact algorithm as well as a practical heuristic to compute them. The proposed method, referred to as Winnowmap2, is evaluated using simulated as well as real long read benchmarks using the recently completed gapless assemblies of human chromosomes X and 8 as a reference. We show that Winnowmap2 successfully addresses the issue of allelic bias, enabling more accurate downstream variant calls in repetitive sequences. As an example, using simulated PacBio HiFi reads and structural variants in chromosome 8, Winnowmap2 alignments achieved the lowest false-negative and false-positive rates (1.89\%, 1.89\%) for calling structural variants within near-identical repeats compared to minimap2 (39.62\%, 5.88\%) and NGMLR (56.60\%, 36.11\%) respectively.Winnowmap2 code is accessible at https://github.com/marbl/WinnowmapCompeting Interest StatementThe authors have declared no competing interest.},
URL = {https://www.biorxiv.org/content/early/2020/11/02/2020.11.01.363887},
eprint = {https://www.biorxiv.org/content/early/2020/11/02/2020.11.01.363887.full.pdf},
journal = {bioRxiv}
@@ -449,3 +448,13 @@
Title = {A synthetic-diploid benchmark for accurate variant-calling evaluation},
Volume = {15},
Year = {2018}}
@article{Gu:1995wt,
author = {Gu, X and Li, W H},
journal = {J Mol Evol},
month = {Apr},
number = {4},
pages = {464-73},
title = {The size distribution of insertions and deletions in human and rodent pseudogenes suggests the logarithmic gap penalty for sequence alignment},
volume = {40},
year = {1995}}
+55 -40
View File
@@ -57,8 +57,8 @@ in v2.19 through v2.22 to improve mapping results.
\begin{methods}
\section{Methods}
\subsection{Rescuing high-occurrence $k$-mers}
Minimap2 keeps all $k$-mer minimizers during indexing. Its original
\subsection{Rescuing high-occurrence $k$-mers}\label{sec:high-occ}
Minimap2 keeps all $k$-mer minimizers~\citep{Roberts:2004fv} during indexing. Its original
implementation only selected low-occurrence minimizers during mapping. The
cutoff is a few hundred for mapping long reads against a human genome. If a
read habors only a few or even no low-occurrence minimizers, it will fail
@@ -66,23 +66,24 @@ chaining due to insufficient anchors.
To resolve this issue, we implemented a new heuristic to add additional
minimizers. Suppose we are looking at two adjacent low-occurence $k$-mers
located at position $x_1$ and $x_2$, respectively. If $|x_1-x_2|\ge500$,
minimap2 v2.22 additionally selects $\lfloor|x_1-x_2|/500\rfloor$ minimizers
of the lowest occurrence among minimizers between $x_1$ and $x_2$.
We use a binary heap data
structure to select minimizers of the lowest occurrence in this interval.
located at position $x_1$ and $x_2$, respectively. If $|x_1-x_2|\ge L$,
minimap2 v2.22 additionally selects $\lfloor|x_1-x_2|/L\rfloor$ minimizers
of the lowest occurrence among minimizers between $x_1$ and $x_2$. Here
parameter $L$ controls the frequency of sampling. It defaults to 500.
This strategy adds necessary anchors at the cost of increasing total alignment
time by a few percent on real data.
\subsection{Aligning through longer INDELs}
The original minimap2 may fail to align long INDELs due to its chaining
heuristics. Briefly, minimap2 applies dynamic programming (DP) to chain
minimizer anchors. This is a quadratic algorithm, which is slow for chaining
minimizer anchors. This is a quadratic algorithm, slow for chaining
contigs. For acceptable performance, the original minimap2 uses a 500bp band by
default. If there is an INDEL longer than 500bp and the two chains around the INDEL
default, which means a gap longer than 500bp will stop chaining.
To align through longer gaps, older minimap2 implemented a long-join heurstic as follows.
If there is an INDEL longer than 500bp and the two chains around the INDEL
have no overlaps on either the query or the reference sequence, minimap2 may
join the two short chains later at a later step. We call it the
long-join heuristic. This heuristic may fail around VNTRs because short chains
join the two short chains later.
This heuristic may fail around VNTRs because short chains
often have overlaps in VNTRs. More subtly, minimap2 may escape the inner DP
loop early, again for performance, if the chaining result is not improved for
50 iterations. When there is a copy number change in a long segmental
@@ -90,13 +91,13 @@ duplication, the early escape may break around the event even if users
specify a large band.
In minigraph~\citep{Li:2020aa}, we developed a new chaining algorithm that
finds short INDELs with DP-based chaining and goes through long INDELs with a
finds up to 1kb INDELs with DP-based chaining and goes through longer INDELs with a
subquadratic algorithm~\citep{DBLP:conf/wabi/AbouelhodaO03}. We ported the same
algorithm to minimap2 for contig mapping. For long-read mapping, the minigraph
algorithm is slower. Minimap2 v2.22 now still uses the DP-based algorithm to
algorithm is slower. Minimap2 v2.22 still uses the DP-based algorithm to
find short chains and then invokes the minigraph algorithm to rechain anchors in
these short chains. The rechaining step achieves the same goal as long-join
but is more reliable as it can resolve overlaps between short chains. The old
but is more reliable because it can resolve overlaps between short chains. The old
long-join heuristic has since been removed.
\subsection{Properly mapping long reads with SVs}
@@ -106,25 +107,25 @@ the best scoring alignment is sometimes not the correct alignment.
\citet{Jain2020.11.01.363887} resolved this dilemma by altering the mapping
algorithm.
In our view, this problem is rooted in impropriate scoring: affine-gap penalty
In our view, this problem is rooted in inapropriate scoring: affine-gap penalty
over-penalizes a long INDEL that was often evolutionarily created in one event.
We should not penalize a SV linearly in its length. Minimap2 v2.22 rescores
We should not penalize a SV by a function linear in the SV length. Minimap2 v2.22 instead rescores
an alignment with the following scoring function. Suppose an alignment consists
of $M$ matching bases, $N$ substitutions and $G$ gap opens, we empirically
score the alignment with
$$
M-\frac{N+G}{2d}-\sum_{i=1}^G\log_2(1+g_i)
S=M-\frac{N+G}{2d}-\sum_{i=1}^G\log_2(1+g_i)
$$
where $g_i\ge1$ is the length of the $i$-th gap and
$$
d=\max\left\{\frac{N+G}{M+N+G},0.02\right\}
$$
Here $d$ approximates per-base sequence divergence with the smallest value set
It approximates per-base sequence divergence except with the smallest value set
to 2\%. As an analogy to affine-gap scoring, the matching score in our scheme
is 1, the mismatch and gap open penalties are both $1/2d$ and the gap extension
penalty is a logarithm function of the gap length. Our scoring gives a long SV
penalty is a logarithm function of the gap length~\citep{Gu:1995wt}. Our scoring gives a long SV
a much milder penalty. In terms of time complexity, scoring an alignment is
linear in the length of the alignment. Time spent on rescoring is negligible in
linear in the length of the alignment. The time spent on rescoring is negligible in
practice.
%If we assume sequences evolve under a duplication-mutation model, we may have a
@@ -144,9 +145,11 @@ practice.
\toprule
$[$Benchmark$]$ Metric & v2.22 & v2.18 & Winno & lra \\
\midrule
$[$sim-map$]$ \% mapped reads at Q10 & 97.9 & 97.6 & {\bf 99.0} & 97.3 \\
$[$sim-map$]$ \% mapped reads at Q10 & 97.9 & 97.6 & {\bf 99.0}& 97.3 \\
$[$sim-map$]$ err. rate at Q10 (phredQ) & {\bf 52} & {\bf 52} & 38 & 24 \\
$[$winno-cmp$]$ rate of diff. (phredQ) & {\bf 41} & 37 & N/A & 18 \\
$[$winno-cmp$]$ rate of diff. (phredQ) & {\bf 41} & 37 & truth & 18 \\
$[$winno-cmp$]$ CPU time (hour) & {\bf 5.0} & 5.3 & 71.8 & 13.1 \\
$[$winno-cmp$]$ peak RAM (Gb) & 17.1 & 14.4 & {\bf 9.6} & 12.4 \\
$[$sim-sv$]$ \% false negative rate & {\bf 0.5} & 2.0 & {\bf 0.5} & 1.4 \\
$[$sim-sv$]$ \% false discovery rate & {\bf 0.0} & 0.1 & {\bf 0.0} & 0.1 \\
$[$real-sv-1k$]$ \% false negative rate & {\bf 7.3} & 20.0 & 13.0 & N/A \\
@@ -159,11 +162,11 @@ $[$real-sv-1k$]$ \% false discovery rate & 2.7 & {\bf 2.4} & 2.7 & N/A \\
10 or higher were evaluated by ``paftools.js mapeval''. The mapping error rate
is measured in the phred scale: if the error rate is $e$, $-10\log_{10}e$ is
reported in the table. In $[$winno-cmp$]$, 1.39 million CHM13 HiFi reads from
SRR11292121 were mapped against CHM13. 99.3\% of them were mapped by Winnowmap2
SRR11292121 were mapped against the same CHM13 assembly. 99.3\% of them were mapped by Winnowmap2
at mapping quality 10 or higher and were taken as ground truth to evaluate
minimap2 and lra with ``paftools.js pafcmp''. $[$sim-sv$]$ simulated 1,000
50bp to 1000bp INDELs from chr8 in CHM13 using SURVIVOR~\citep{Jeffares:2017aa} and simulated Nanopore
reads at 30 folds with the same pbsim2 command line. SVs were called with
reads at 30-fold coverage with the same pbsim2 command line. SVs were called with
``sniffles -q 10''~\citep{Sedlazeck:2018ab} and compared to the simulated truth with ``SURVIVOR eval
call.vcf truth.bed 50''. In $[$real-sv-1k$]$, small and long variants were
called by dipcall-0.3~\citep{Li:2018aa} for HG002 assemblies (AC: GCA\_018852605.1 and
@@ -172,31 +175,44 @@ GCA\_018852615.1) and compared to the GIAB truth~\citep{Zook:2020aa} using ``tru
\end{table}
We evaluated minimap2 v2.22 along with v2.18, Winnowmap2 v2.03 and lra v1.3.2
(Table~\ref{tab:1}). Both versions of minimap2 achieved high mapping accuracy on
(Table~\ref{tab:1}), using the default setting of each mapper according to the input data types.
Both versions of minimap2 achieved high mapping accuracy on
simulated Nanopore reads (sim-map). Winnowmap2 aligned more reads at mapping
quality 10 or higher (mapQ10). However, it may occasionally assign a high mapping
quality to a read with multiple identical best alignments. This reduced its
mapping accuracy.
In lack of groud truth for real data, so we took Winnowmap2 mapping as ground
truth to evaluate other mappers (winno-cmp). Out of 1,378,092 reads with mapQ10
In lack of groud truth for real data, we took Winnowmap2 mapping as ground
truth to evaluate other mappers (winno-cmp in Table~\ref{tab:1}). Out of 1,378,092 reads with mapQ10
alignments by Winnowmap2, minimap2 v2.22 could map all of them. 118 reads, less
than 0.01\% of all reads, were mapped differently by v2.22. 51 of them have
multiple identical best alignments. We believe these are more likely to be
Winnowmap2 errors. Most of the remaining 67 (=118-51) reads have multiple
highly similar but not identical alignments. We are not sure what are real
mapping errors.
highly similar but not identical alignments.
Minimap2 v2.18 is less consistent with 275 differences including 30 unmapped
reads mappable by both Winnowmap2 and v2.22.
The two benchmarks above only evaluate read mappings without variations.
For the minimizer rescuing parameter $L$ in Section~\ref{sec:high-occ},
we set its default to 500 such that v2.22 has comparable performance to v2.18 given simulated PacBio and Nanopore human reads.
To see the effect of this parameter on real data, we tried several different $L$ values.
v2.22 gave 99 mapping differences at $L=200$,
118 at $L=500$ (default), 167 at $L=750$ and 224 differences at $L=1000$ in comparison to Winnowmap2.
$L=200$ is 28\% slower than the default while $L=1000$ is 9\% faster.
Changing the default minimizer window size (option ``-w'')
and the initial minimizer occurrence cutoff (option ``-f'')
also affects performance and accuracy to a similar magnitude.
The two benchmarks above only evaluate read mappings when there are no variations between the reads and the reference.
To measure the mapping accuracy in the presence of SVs (sim-sv), we reproduced
the results by~\citep{Jain2020.11.01.363887}. Minimap2 v2.22 is as good as
Winnowmap2 now. Note that we were setting the Sniffles mapping quality
threshold to 10 in consistent with the benchmarks above. If we used the
default threshold 20, v2.22 would miss additional 0.5\% SVs, suggesting
minimap2 v2.22 could map variant reads correctly but with conservative mapping
quality. This observation is more about the interaction between mappers and
callers. Furthermore, the simulation here only considers a simple scenario in
evolution. Non-allelic gene conversions, which happen often in segmental
default threshold 20, v2.22 would miss additional five SVs (accounting for
0.5\% of simulated SVs). For four out of these five missing SVs, minimap2 v2.22
mapped more variant reads than Winnowmap2. Sniffles did not call these SVs
because minimap2 tended to give them conservative mapping quality. It is worth
noting that the simulation here only considers a simple scenario in evolution.
Non-allelic gene conversions, which happen often in segmental
duplications~\citep{Harpak:2017aa}, would obscure the optimal mapping
strategies. How much such simple SV simulation informs real-world SV calling
remains a question.
@@ -204,18 +220,17 @@ remains a question.
To see if minimap2 v2.22 could improve long INDEL alignment, we ran dipcall on
contig-to-reference alignments and focused on INDELs longer than 1kb
(real-sv-1k). v2.22 is more sensitive at comparable specificity, confirming its
advantage in more contiguous alignment. lra is supposed to handle long INDELs
better, too. However, we could not get lra to work well with dipcall, so did
not report the numbers.
advantage in more contiguous alignment. We could not get dipcall to work well with lra,
so did not report the numbers.
Minimap2 spends most computing time on base alignment. As recent improvements
in v2.22 incur little additional computing and do not change the base alignment
algorithm, the new version has similar performance to older verions. It is
algorithm, the new version has similar performance to older versions. It is
consistently faster than Winnowmap2 by several times. Sometimes simple
heuristics can be as effective as more sophisticated yet slower solutions.
\section*{Acknowledgements}
We thank Arang Rhie and Chirag Jain for providing motivating examples where
We thank Arang Rhie and Chirag Jain for providing motivating examples for which
older minimap2 underperforms.
\paragraph{Funding\textcolon} This work is funded by NHGRI grant R01HG010040.