Compare commits

...
108 Commits
Author SHA1 Message Date
Heng Li 3c28777e7e Release minimap2-2.31 (r1302) 2026-05-19 18:39:04 -04:00
Heng Li d8371a403b removed duplicate check in sim2bed 2026-04-25 00:35:59 -04:00
Heng LiandClaude Opus 4.5 e5066c7976 added sim2bed to convert simulated read names to BED
Co-Authored-By: Claude Opus 4.5 <noreply@anthropic.com>
2026-04-25 00:22:26 -04:00
Heng Liandgemini-cli f8381755f1 r1299: fix wrong subchain selection
This and the last bug were both reported by Jeremy Wang.

Co-authored-by: gemini-cli <gemini-cli@users.noreply.github.com>
2026-04-24 16:17:45 -04:00
Heng Li 80d92c686f r1298: fixed out-of-bound local alignment
I believe this would not lead to memory violation; it may occasionally include
a few base beyond the intended alignment start/end.
2026-04-24 13:25:19 -04:00
Heng Li 37a650f58c output simulated identity with badread 2026-04-14 12:49:35 -04:00
Heng Li 4ca5a951ca command line help 2026-04-13 23:52:07 -04:00
Heng Li dd5b2c04b8 Merge remote-tracking branch 'remotes/origin/master' 2026-04-13 23:43:43 -04:00
Heng Li ca6f4dc5e2 convert badread output to evaluation format 2026-04-13 23:43:11 -04:00
blawrence-ont de3c6ec646 Fix use-after-free in mappy (#1345)
mm_map_aux() takes in |b._b| which can end up reallocating |km| at the
end of mm_map_frag_core(). Since the address of |km| is cached before
those calls it ends up pointing to freed memory.

This can result in a crash as seen in #1183, however it also happens to
Just Work most of the time since the new allocation often lands at the
same address as the old one. Preloading ASAN or a similar replacement
allocator that doesn't have that behaviour results in a reliable crash.
2026-02-13 12:14:56 -05:00
Heng Li e2542e6425 Merge remote-tracking branch 'remotes/origin/master' 2025-12-12 11:39:33 -05:00
Heng Li 9bb4d2bed4 r1290: support ds in Python 2025-12-12 11:39:01 -05:00
Alex Leonard 6d49eb690f convert unmapped reads in sam2paf (#1324) 2025-10-05 19:43:23 -04:00
Heng Li bd0cba5012 upgrade arm64-linux to v3 2025-09-09 13:52:16 -04:00
Heng Li 370f3f8236 add an alert about phishing 2025-09-09 11:23:09 -04:00
Heng Li 79c9cc186b Release minimap2-2.30 (r1287) 2025-06-15 17:54:11 -04:00
Heng Li ea4c8935bd added one more example
This shows STAR doesn't try to match the GTR..YAG consensus.
2025-06-03 20:22:14 -04:00
Heng Li 3187782b1a r1285: better --spsc support 2025-05-26 15:47:14 -04:00
Heng Li 005c9a1f6b exoneval may skip terminal exons in aa mode 2025-05-17 23:06:41 -04:00
Heng Li 1fd85be6e2 Release minimap2-2.29 (r1283) 2025-04-18 13:41:47 -04:00
Heng Li e616b0dacf drafted the release notes 2025-04-18 13:17:13 -04:00
Heng Li b58b97423a r1281: with --write-junc, ignore aln with low mapQ 2025-04-17 21:46:54 -04:00
Heng Li df9e650346 r1280: heuristic to avoid aligning full introns
This speeds up alignment a lot
2025-04-16 23:38:39 -04:00
Heng Li 7a540c37ca r1278: reduced --min-dp-len to 20 for splice:sr
30% reduced time at 0.01% more junction errors
2025-04-16 21:55:59 -04:00
Heng Li c19e3ccb86 r1277: don't apply rescored filtering with -P
Since v2.19-ish, minimap2 rescores base alignment based on the best alignment
of a read. This heuristic sometimes improve the mapping accuracy of the best
alignment but may too aggressively filter weaker hits.

Resolve #969
2025-04-14 22:26:47 -04:00
Heng Li 94d171b01e r1276: skip unnecessary reverse spliced alignment
for short-read RNA-seq only
2025-04-14 14:57:23 -04:00
Heng Li ff312a2957 documented 2-pass in README 2025-04-13 17:14:44 -04:00
Heng Li 01ccedd5a0 r1275: renamed --jump-pass1 to --pass1
Also documented 2-pass
2025-04-13 17:07:39 -04:00
Heng Li 819b3bf017 r1274: a little better pass-1
Also fixed a bug in jump
2025-04-13 13:55:15 -04:00
Heng Li e88110463a r1273: reading pass1 junctions works
but we need extra logic when using them. Tomorrow.
2025-04-13 00:47:28 -04:00
Heng Li fb81e150f2 r1272: support pass-1 junction processing
NOT tested yet
2025-04-12 23:15:04 -04:00
Heng Li d930ea94ad r1271: code refactoring in prep for 2-pass 2025-04-11 17:20:34 -04:00
Heng Li a832a42f6f r1270: fixed ts tag for PE reads
this also fixed the wrong --write-junc
2025-04-11 01:08:16 -04:00
Heng Li a5411fc3c0 r1269: added --write-junc
in preparation for 2-pass
2025-04-11 01:00:15 -04:00
Heng Li bd03d975fc r1268: avoid extra small introns 2025-04-07 23:32:56 -04:00
Heng Li 9c3c4b1ce8 r1267: penalize introns without signals 2025-04-07 09:51:33 -04:00
Heng Li 3542a3d153 r1266: fine tune mapq for short RNA-seq reads 2025-04-07 00:57:39 -04:00
Heng Li 75619c7b51 r1265: prefer spliced alignment
mapq needs to be elevated
2025-04-07 00:31:04 -04:00
Heng Li fbb9c0fcba r1264: added --jump-min-match, default to 3
To match STAR
2025-04-06 23:18:55 -04:00
Heng Li af094640e5 r1263: ~5-10% performance improvement
Via larger batches and more short-read heuristics. Identical alignment on 2
million reads. Short DNA-seq read alignment may be improved in corner cases.
2025-04-06 20:48:55 -04:00
Heng Li d43f356ef9 fixed minor grammar issues 2025-04-06 18:35:46 -04:00
Heng Li 38acd6617f r1261: code clean up; renamed --jump-bed to -j
Also added --pairing to replace --no-pairing and --pe-ind-chain
2025-04-06 18:32:58 -04:00
Heng Li 3d351267a0 document --jump-bed 2025-04-06 17:43:11 -04:00
Heng Li 54a4718c9b r1259: --jump-bed now functional 2025-04-06 17:12:49 -04:00
Heng Li dbc12b2838 r1258: update blen, mlen and dp_max0 2025-04-06 15:26:01 -04:00
Heng Li 2ed264db4e r1257: fixed the sorting of BED files 2025-04-06 10:53:16 -04:00
Heng Li a8094ad859 r1256: working for one example, but still buggy 2025-04-06 10:33:57 -04:00
Heng Li 1877818239 r1255: moved jump code to a separate file 2025-04-06 09:33:51 -04:00
Heng Li 9ede5c4255 backup 2025-04-06 00:07:15 -04:00
Heng Li 405511fe8d Merge branch 'master' into junc-jump 2025-04-04 16:37:39 -04:00
Heng Li dd90d9dde6 caution that the splice:sr is experimental 2025-04-04 16:34:40 -04:00
Heng Li a8c567b5e9 r1251: read junctions for jumps 2025-04-04 16:23:19 -04:00
Heng Li d9d3c0cc3f refactored --junc-bed 2025-04-03 21:02:50 -04:00
Heng Li cbe8d61ca4 r1249: remove redundant junctions in --junc-bed 2025-04-03 20:43:06 -04:00
Heng Li 9d06cef13e r1248: support --end-bonus in splice mode
but this is not enabled by default for now
2025-04-02 21:39:41 -04:00
Heng Li 924fc4d671 minor 2025-04-02 13:06:03 -04:00
Heng Li fc2d1e95b3 document splice:sr in README 2025-04-02 11:24:44 -04:00
Heng Li bbf0bb871b r1245: allow shorter hits for splice:sr 2025-04-02 00:13:37 -04:00
Heng Li 83e9b2e28c r1242: append /[12] to read name in --frag mode
Resolve #1079
2025-04-01 10:48:15 -04:00
Heng Li e816fd071c r1241: error out on unintended --score-N
Resolve #1226
2025-04-01 10:12:53 -04:00
Heng Li a955b1f31d documented zd; resolve #1108 2025-04-01 09:34:05 -04:00
Heng Li 54fa925e2e r1240: fixed wrong logging information
resolve #1192
2025-04-01 09:17:39 -04:00
Heng Li d4a396c5c3 r1239: resovled #963 2025-03-31 23:15:34 -04:00
Heng Li bdf46f5786 r1238: resolve #589 2025-03-31 23:08:37 -04:00
Heng Li f536b69b81 r1237: documented -x splice:sr 2025-03-30 21:47:47 -04:00
Heng Li 4b8b4418df r1236: support paired-end short-read RNA-seq 2025-03-30 19:30:19 -04:00
Heng Li ce30004e02 r1235: allow --splice and --frag at the same time
This seems to largely work, though the accuracy is reduced and no pairs are
proper. More investigation needed for practical uses.
2025-03-30 16:32:38 -04:00
Heng Li 54f8e5f7d6 r1234: added splice:sr for SE RNA-seq 2025-03-30 15:54:12 -04:00
Heng Li 2857de7dbd Merge remote-tracking branch 'remotes/origin/master' 2025-03-29 22:44:26 -04:00
Heng Li e18935fbad r1230: make juncevla work for paired-end SAM 2025-03-29 22:43:44 -04:00
Chang Y 74ebfb2532 fix error (#1223) 2025-03-21 18:21:15 -04:00
Martin Grigorov a0cbe2e4d2 Add CI job for Linux & Mac ARM64 too (#1205)
* Add CI job for Linux ARM64 too

Signed-off-by: Martin Tzvetanov Grigorov <mgrigorov@apache.org>

* Add build job for Mac ARM64 too

Signed-off-by: Martin Tzvetanov Grigorov <mgrigorov@apache.org>

* Pass "arm_neon=1 aarch64=1" when building on ARM64

Signed-off-by: Martin Tzvetanov Grigorov <mgrigorov@apache.org>

* change aarch64 to arm64 for the Mac ARM64 check

Signed-off-by: Martin Tzvetanov Grigorov <mgrigorov@apache.org>

---------

Signed-off-by: Martin Tzvetanov Grigorov <mgrigorov@apache.org>
2025-03-21 18:19:26 -04:00
Heng Li 618d33515e more condition on length differences 2024-11-17 19:45:46 -05:00
Heng Li a10d4f4496 merge colinear blocks 2024-11-17 15:17:13 -05:00
Heng Li 1eea2fee11 a new script to cluster similar sequences 2024-11-16 16:39:13 -05:00
Heng Li 1d346d56bc Merge remote-tracking branch 'remotes/origin/master' 2024-11-16 16:36:07 -05:00
Heng Li 46750de966 not working well and rarely used in practice 2024-11-16 16:35:24 -05:00
Leon Rauschning 7d8bbb74a8 Add sc_ambi and max_chain_skip parameters to mappy.pyx (#1240)
* add sc_ambi option to cython interface

* add max_gaplen param

* set max_chain_skip to arg instead of forcing 255
2024-11-15 08:56:36 -05:00
James Webber c6db201b38 Update README.md (#1245)
fixed documentation for paftools
2024-11-15 08:54:25 -05:00
Rob PatroandRob Patro 358a39850f Allow passing read name to mappy (#1260)
* Allow passing read name to mappy

This adds the (optional) ability to pass the read
name to the mappy `map` method.  Without the
read name, the call to `map` can sometimes give
different output than the command line version
of `minimap2` because of the way minimap uses
the hash of the read name to break ties in ordering
hits.  This can affect which / if certain
supplementary alignments are generated, and even
which / if non-primary alignments are generated.

* Pass name directly to mm_map_aux

Get rid of additional function, and always
accept the name parameter in the mm_map_aux
function (can be nullptr if not available).

---------

Co-authored-by: Rob Patro <rob@newton>
2024-11-15 08:51:10 -05:00
Heng Li fcb5d5e6eb r1221: warn about file reading errors
Resolves #1229
2024-10-15 22:44:06 -04:00
Heng Li 95807a2224 added "junc_pen" to python accordingly 2024-10-13 23:58:33 -04:00
Heng Li a4c93e9377 support X and = in mapeval 2024-10-12 23:31:17 -04:00
Heng Li 7d69334e69 Merge remote-tracking branch 'remotes/origin/master' 2024-10-12 23:28:38 -04:00
Heng Li 3e1ab2951d document --spsc 2024-10-12 23:27:46 -04:00
Heng Li 68179ed195 r1215: scoring apparently works 2024-10-12 22:29:27 -04:00
Heng Li d1f4c8d232 implemented ksw scoring; not tested 2024-10-11 23:58:18 -04:00
Heng Li 8efe83b744 fill the junction array
modifying ksw will be the next
2024-10-11 23:22:23 -04:00
Heng Li 042c8d4d71 added --junc-pen; it does nothing for now 2024-10-11 21:27:25 -04:00
Heng Li e4e1f7843b backup for spsc 2024-10-10 22:43:50 -04:00
Marcus Fedarko 69e3629916 Mention in man page that CIGAR strings in SA tags are approximate (#1213)
* Mention approx CIGAR strings in man page #724

* Fix FAQ typo
2024-05-22 15:58:33 -04:00
Heng Li 0cc3cdca27 ignore filtered SVs in sveval 2024-04-07 17:12:31 -04:00
Heng Li 8170693de3 Release minimap2-2.28 (r1209) 2024-03-27 10:57:17 -04:00
Heng Li e3d8c708ac r1208: reverted RMQ gap coefficient
Such that minimap2 can give the same alignment in other modes
2024-03-27 08:48:10 -04:00
Heng Li 119bdc6029 r1207: reduced cap_kalloc from 1G to 500M
This reduces the peak memory.
2024-03-20 15:53:12 -04:00
Heng Li 89d4d219cd r1206: enabled RMQ for lr:hqae
Also fixed a bug in determining inner_dist for RMQ. It should have no effect on
previous presets.
2024-03-20 15:29:54 -04:00
Heng Li f51ff1abac r1205: updated lr:hqae 2024-03-20 14:06:59 -04:00
Heng Li 27b254ed6f backup; DON'T USE!!! 2024-03-20 10:21:10 -04:00
Heng Li c881b14ba5 r1203: added preset lr:hqae 2024-03-20 00:25:57 -04:00
Heng Li f18dadb1c4 r1202: halved RMQ gap cost 2024-03-19 23:47:54 -04:00
Heng Li a83b8fe7cc r1201: renamed --dbg-seed-freq to --dbg-seed-occ 2024-03-19 21:53:09 -04:00
Heng Li c22bfe7722 r1200: added --rmq-inner and --dbg-seed-freq 2024-03-19 21:52:07 -04:00
Heng Li 12d441ea22 Merge remote-tracking branch 'origin/master' 2024-03-19 21:47:52 -04:00
Heng Li c7433c2811 r1197: sam2paf to output primary only 2024-03-19 21:47:31 -04:00
Joyjit Daw 5279377544 Fix MD generation check in SAM writing (#1181)
The existing logic checked for is_MD == 1, but
the function is called with a bitwise operator check
which does not evaluate to 1.
2024-03-19 19:20:21 -04:00
Heng Li acab05781e Merge remote-tracking branch 'remotes/origin/master' 2024-03-19 09:56:13 -04:00
Heng Li 98c23bc6d2 r1194: output NM in sam2paf 2024-03-19 09:55:16 -04:00
kojix2 9b0ff2418c Fix mm_mapopt_t in Mappy (#1177)
Add transition. Related to #1069
2024-03-13 22:15:46 -04:00
38 changed files with 1733 additions and 577 deletions
+50 -3
View File
@@ -7,7 +7,8 @@ on:
pull_request:
jobs:
build:
build-linux-x8664:
name: Linux x86_64
runs-on: ubuntu-latest
strategy:
matrix:
@@ -15,7 +16,53 @@ jobs:
steps:
- name: Checkout minimap2
uses: actions/checkout@v2
uses: actions/checkout@v4
- name: Compile with ${{ matrix.compiler }}
run: make CC=${{ matrix.compiler }}
run: |
make CC=${{ matrix.compiler }}
file minimap2 | grep x86-64
build-linux-aarch64:
name: Linux aarch64
runs-on: ubuntu-latest
strategy:
matrix:
compiler: [gcc]
steps:
- name: Checkout
uses: actions/checkout@v4
- name: Compile with ${{ matrix.compiler }}
uses: uraimo/run-on-arch-action@v3
with:
arch: aarch64
distro: ubuntu22.04
githubToken: ${{ github.token }}
dockerRunArgs: |
--volume "${PWD}:/minimap2"
install: |
apt-get update -q -y
apt-get install -q -y make ${{ matrix.compiler }} zlib1g-dev file
run: |
cd /minimap2
make CC=${{ matrix.compiler }} arm_neon=1 aarch64=1 -j
file minimap2 | grep aarch64
build-mac-arm64:
name: Mac ARM64
runs-on: macos-14
strategy:
matrix:
compiler: [clang]
steps:
- name: Checkout minimap2
uses: actions/checkout@v4
- name: Compile with ${{ matrix.compiler }}
run: |
make CC=${{ matrix.compiler }} arm_neon=1 aarch64=1 -j
file minimap2 | grep arm64
+1 -1
View File
@@ -2,7 +2,7 @@
Without `-a`, `-c` or `--cs`, minimap2 only finds *approximate* mapping
locations without detailed base alignment. In particular, the start and end
positions of the alignment are impricise. With one of those options, minimap2
positions of the alignment are imprecise. With one of those options, minimap2
will perform base alignment, which is generally more accurate but is much
slower.
+5 -4
View File
@@ -2,7 +2,7 @@ CFLAGS= -g -Wall -O2 -Wc++-compat #-Wextra
CPPFLAGS= -DHAVE_KALLOC
INCLUDES=
OBJS= kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o options.o index.o \
lchain.o align.o hit.o seed.o map.o format.o pe.o esterr.o splitidx.o \
lchain.o align.o hit.o seed.o jump.o map.o format.o pe.o esterr.o splitidx.o \
ksw2_ll_sse.o
PROG= minimap2
PROG_EXTRA= sdust minimap2-lite
@@ -102,7 +102,7 @@ ksw2_exts2_neon.o:ksw2_exts2_sse.c ksw2.h kalloc.h
# other non-file targets
clean:
rm -fr gmon.out *.o a.out $(PROG) $(PROG_EXTRA) *~ *.a *.dSYM build dist mappy*.so mappy.c python/mappy.c mappy.egg*
rm -fr gmon.out *.o a.out $(PROG) $(PROG_EXTRA) *~ *.a *.dSYM build dist mappy*.so mappy.c python/mappy.c mappy.egg* .eggs
depend:
(LC_ALL=C; export LC_ALL; makedepend -Y -- $(CFLAGS) $(CPPFLAGS) -- *.c)
@@ -115,8 +115,9 @@ esterr.o: mmpriv.h minimap.h bseq.h kseq.h
example.o: minimap.h kseq.h
format.o: kalloc.h mmpriv.h minimap.h bseq.h kseq.h
hit.o: mmpriv.h minimap.h bseq.h kseq.h kalloc.h khash.h
index.o: kthread.h bseq.h minimap.h mmpriv.h kseq.h kvec.h kalloc.h khash.h
index.o: ksort.h
index.o: kthread.h bseq.h minimap.h mmpriv.h kseq.h ksw2.h kalloc.h kvec.h
index.o: khash.h ksort.h
jump.o: mmpriv.h minimap.h bseq.h kseq.h
kalloc.o: kalloc.h
ksw2_extd2_sse.o: ksw2.h kalloc.h
ksw2_exts2_sse.o: ksw2.h kalloc.h
+116
View File
@@ -1,3 +1,119 @@
Release 2.31-r1302 (19 May 2026)
--------------------------------
Notable changes to minimap2:
* Bugfix: supplementary and secondary alignments were occasionally flagged
incorrectly.
* Bugfix: Smith-Waterman alignment for inversion alignment led to an
out-of-bound access in rare cases.
Changes to paftools.js:
* New feature: new `sim2bed` subcommand to get a BED file from simulated
reads.
* New feature: new `badread2fa` subcommand to format reads simulated by
the Badread simulator.
Change to the python binding:
* New feature: mappy optionally writes the `ds` tag.
* Bugfix: a use-after-free error (#1345)
The two bugs in minimap2 had existed for years. They were caught by Jeremy Wang
at UNC when he ported minimap2 to Rust. Due to the two bug fixes, this version
occasionally produces alignment different from the last version.
(2.31: 19 May 2026, r1302)
Release 2.30-r1287 (15 June 2025)
---------------------------------
Notable changes:
* Improvement: consolidated `--spsc`.
* Deprecation: subcommands `splice2bed`, `gff2bed`, `gff2junc`, `junceval` and
`exoneval` in `paftools.js` are deprecated by minigff. They will remain
indefinitely for backward compatibility.
(2.30: 15 June 2025, r1287)
Release 2.29-r1283 (18 April 2025)
----------------------------------
Notable changes to minimap2:
* New feature: added the `splice:sr` preset for short RNA-seq read alignment.
Users may use `-j` to specify known gene annotation to improve spliced
alignment close to the ends of short reads. Also added `--write-junc` and
`--pass1` for 2-pass short-read RNA-seq alignment.
* Experimental feature: read splice scores from a file specified by `--spsc`
and consider the scores during base alignment. The feature makes it possible
to apply advanced splice models and to improve spliced alignment.
* Change: adjusted the mapping quality calculation for spliced alignment.
* Bugfixes: a) missing overlap alignment when base alignment is requested
(#969); b) incorrect summary information for long genomes (#1192); c)
missing parameter check for `--score-N` (#1226).
* Improvement: a) warn about absent junction files (#1229); b) report an error
if a wrong preset prefixed with "splice" is specified (#589).
Notable changes to mappy:
* Improvement: allow passing read name (#1260)
* Improvement: exposed score for ambiguous bases (#1240)
Minimap2 now supports short/long genomic/RNA-seq read alignment along with
contig alignment and all-vs-all read overlapping. It produces identical genomic
long-read or contig alignment to v2.27. Short genomic read alignment and the
mapping quality of long RNA-seq read alignment may slightly differ in very rare
cases.
(2.29: 18 April 2025, r1283)
Release 2.28-r1209 (27 March 2024)
----------------------------------
Notable changes to minimap2:
* Bugfix: `--MD` was not working properly due to the addition of `--ds` in the
last release (#1181 and #1182).
* New feature: added an experimental preset `lq:hqae` for aligning accurate
long reads back to their assembly. It has been observed that `map-hifi` and
`lr:hq` may produce many wrong alignments around centromeres when accurate
long reads (PacBio HiFi or Nanopore duplex/Q20+) are mapped to a diploid
assembly constructed from them. This new preset produces much more accurate
alignment. It is still experimental and may be subjective to changes in
future.
* Change: reduced the default `--cap-kalloc` to 500m to lower the peak
memory consumption (#855).
Notable changes to mappy:
* Bugfix: mappy option struct was out of sync with minimap2 (#1177).
Minimap2 should output identical alignments to v2.27.
(2.28: 27 March 2024, r1209)
Release 2.27-r1193 (12 March 2024)
----------------------------------
+31 -14
View File
@@ -3,6 +3,7 @@
[![PyPI](https://img.shields.io/pypi/v/mappy.svg?style=flat)](https://pypi.python.org/pypi/mappy)
[![Build Status](https://github.com/lh3/minimap2/actions/workflows/ci.yaml/badge.svg)](https://github.com/lh3/minimap2/actions)
## <a name="started"></a>Getting Started
**ALERT:** `minimap2.com` is a [phishing site](https://github.com/lh3/minimap2/issues/1316). Please don't use anything from that website.
```sh
git clone https://github.com/lh3/minimap2
cd minimap2 && make
@@ -14,13 +15,15 @@ cd minimap2 && make
# use presets (no test data)
./minimap2 -ax map-pb ref.fa pacbio.fq.gz > aln.sam # PacBio CLR genomic reads
./minimap2 -ax map-ont ref.fa ont.fq.gz > aln.sam # Oxford Nanopore genomic reads
./minimap2 -ax map-hifi ref.fa pacbio-ccs.fq.gz > aln.sam # PacBio HiFi/CCS genomic reads (v2.19 or later)
./minimap2 -ax lr:hq ref.fa ont-Q20.fq.gz > aln.sam # Nanopore Q20 genomic reads (v2.27 or later)
./minimap2 -ax map-hifi ref.fa pacbio-ccs.fq.gz > aln.sam # PacBio HiFi/CCS genomic reads (v2.19+)
./minimap2 -ax lr:hq ref.fa ont-Q20.fq.gz > aln.sam # Nanopore Q20 genomic reads (v2.27+)
./minimap2 -ax sr ref.fa read1.fa read2.fa > aln.sam # short genomic paired-end reads
./minimap2 -ax splice ref.fa rna-reads.fa > aln.sam # spliced long reads (strand unknown)
./minimap2 -ax splice -uf -k14 ref.fa reads.fa > aln.sam # noisy Nanopore Direct RNA-seq
./minimap2 -ax splice:hq -uf ref.fa query.fa > aln.sam # Final PacBio Iso-seq or traditional cDNA
./minimap2 -ax splice --junc-bed anno.bed12 ref.fa query.fa > aln.sam # prioritize on annotated junctions
./minimap2 -ax splice -uf -k14 ref.fa reads.fa > aln.sam # noisy Nanopore direct RNA-seq
./minimap2 -ax splice:hq -uf ref.fa query.fa > aln.sam # PacBio Kinnex/Iso-seq (RNA-seq)
./minimap2 -ax splice --junc-bed=anno.bed12 ref.fa query.fa > aln.sam # use annotated junctions
./minimap2 -ax splice:sr ref.fa r1.fq r2.fq > aln.sam # short-read RNA-seq (v2.29+)
./minimap2 -ax splice:sr -j anno.bed12 ref.fa r1.fq r2.fq > aln.sam
./minimap2 -cx asm5 asm1.fa asm2.fa > aln.paf # intra-species asm-to-asm alignment
./minimap2 -x ava-pb reads.fa reads.fa > overlaps.paf # PacBio read overlap
./minimap2 -x ava-ont reads.fa reads.fa > overlaps.paf # Nanopore read overlap
@@ -38,7 +41,8 @@ man ./minimap2.1
- [Map long noisy genomic reads](#map-long-genomic)
- [Map long mRNA/cDNA reads](#map-long-splice)
- [Find overlaps between long reads](#long-overlap)
- [Map short accurate genomic reads](#short-genomic)
- [Map short genomic reads](#short-genomic)
- [Map short RNA-seq reads](#short-rna-seq)
- [Full genome/assembly alignment](#full-genome)
- [Advanced features](#advanced)
- [Working with >65535 CIGAR operations](#long-cigar)
@@ -74,8 +78,8 @@ Detailed evaluations are available from the [minimap2 paper][doi] or the
Minimap2 is optimized for x86-64 CPUs. You can acquire precompiled binaries from
the [release page][release] with:
```sh
curl -L https://github.com/lh3/minimap2/releases/download/v2.27/minimap2-2.27_x64-linux.tar.bz2 | tar -jxvf -
./minimap2-2.27_x64-linux/minimap2
curl -L https://github.com/lh3/minimap2/releases/download/v2.31/minimap2-2.31_x64-linux.tar.bz2 | tar -jxvf -
./minimap2-2.31_x64-linux/minimap2
```
If you want to compile from the source, you need to have a C compiler, GNU make
and zlib development files installed. Then type `make` in the source code
@@ -171,9 +175,8 @@ or the last exons.
Minimap2 rates an alignment by the score of the max-scoring sub-segment,
*excluding* introns, and marks the best alignment as primary in SAM. When a
spliced gene also has unspliced pseudogenes, minimap2 does not intentionally
prefer spliced alignment, though in practice it more often marks the spliced
alignment as the primary. By default, minimap2 outputs up to five secondary
spliced gene also has unspliced pseudogenes, minimap2 slightly prefers
the spliced alignment. By default, minimap2 outputs up to five secondary
alignments (i.e. likely pseudogenes in the context of RNA-seq mapping). This
can be tuned with option **-N**.
@@ -204,6 +207,10 @@ bonus score (tuned by `--junc-bonus`) if an aligned junction matches a junction
in the annotation. Option `--junc-bed` also takes 5-column BED, including the
strand field. In this case, each line indicates an oriented junction.
**Note:** `--junc-bed` is intended for long noisy RNA-seq reads only.
Applying the option to short RNA-seq reads would increase run time with little
improvement to junction accuracy.
#### <a name="long-overlap"></a>Find overlaps between long reads
```sh
@@ -216,7 +223,7 @@ the overlapping mode because it is slow and may produce false positive
overlaps. However, if performance is not a concern, you may try to add `-a` or
`-c` anyway.
#### <a name="short-genomic"></a>Map short accurate genomic reads
#### <a name="short-genomic"></a>Map short genomic reads
```sh
minimap2 -ax sr ref.fa reads-se.fq > aln.sam # single-end alignment
@@ -229,8 +236,18 @@ be paired if they are adjacent in the input stream and have the same name (with
the `/[0-9]` suffix trimmed if present). Single- and paired-end reads can be
mixed.
Minimap2 does not work well with short spliced reads. There are many capable
RNA-seq mappers for short reads.
#### <a name="short-rna-seq"></a>Map short RNA-seq reads
```sh
minimap2 -ax splice:sr ref.fa reads-se.fq.gz > aln.sam # single-end
minimap2 -ax splice:sr ref.fa r1.fq.gz r2.fq.gz > aln.sam # paired-end
minimap2 -ax splice:sr -j anno.bed ref.fa r1.fq r2.fq > aln.sam # use annotation
# 2-pass alignment
minimap2 -x splice:sr -j anno.bed --write-junc ref.fa r1.fq r2.fq > junc.bed
minimap2 -ax splice:sr -j anno.bed --pass1=junc.bed ref.fa r1.fq r2.fq > aln.sam
```
The new preset `splice:sr` was added in v2.29. It functions similarly to `sr`
except that it performs spliced alignment.
#### <a name="full-genome"></a>Full genome/assembly alignment
+136 -52
View File
@@ -6,6 +6,8 @@
#include "mmpriv.h"
#include "ksw2.h"
#define MM_MAX_QLEN_FLANK 100
static void ksw_gen_simple_mat(int m, int8_t *mat, int8_t a, int8_t b, int8_t sc_ambi)
{
int i, j;
@@ -258,7 +260,7 @@ static void mm_update_extra(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *ts
if (p == 0) return;
mm_fix_cigar(r, qseq, tseq, &qshift, &tshift);
qseq += qshift, tseq += tshift; // qseq and tseq may be shifted due to the removal of leading I/D
r->blen = r->mlen = 0;
r->blen = r->mlen = 0, r->is_spliced = 0;
for (k = 0; k < p->n_cigar; ++k) {
uint32_t op = p->cigar[k]&0xf, len = p->cigar[k]>>4;
if (op == MM_CIGAR_MATCH) {
@@ -292,7 +294,7 @@ static void mm_update_extra(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *ts
if (s < 0) s = 0;
toff += len;
} else if (op == MM_CIGAR_N_SKIP) {
toff += len;
r->is_spliced = 1, toff += len;
}
}
p->dp_max = p->dp_max0 = (int32_t)(max + .499);
@@ -300,9 +302,8 @@ static void mm_update_extra(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *ts
if (is_eqx) mm_update_cigar_eqx(r, qseq, tseq); // NB: it has to be called here as changes to qseq and tseq are not returned
}
static void mm_append_cigar(mm_reg1_t *r, uint32_t n_cigar, uint32_t *cigar) // TODO: this calls the libc realloc()
void mm_enlarge_cigar(mm_reg1_t *r, uint32_t n_cigar) // TODO: this calls the libc realloc()
{
mm_extra_t *p;
if (n_cigar == 0) return;
if (r->p == 0) {
uint32_t capacity = n_cigar + sizeof(mm_extra_t)/4;
@@ -314,6 +315,13 @@ static void mm_append_cigar(mm_reg1_t *r, uint32_t n_cigar, uint32_t *cigar) //
kroundup32(r->p->capacity);
r->p = (mm_extra_t*)realloc(r->p, r->p->capacity * 4);
}
}
static void mm_append_cigar(mm_reg1_t *r, uint32_t n_cigar, const uint32_t *cigar)
{
mm_extra_t *p;
if (n_cigar == 0) return;
mm_enlarge_cigar(r, n_cigar);
p = r->p;
if (p->n_cigar > 0 && (p->cigar[p->n_cigar-1]&0xf) == (cigar[0]&0xf)) { // same CIGAR op at the boundary
p->cigar[p->n_cigar-1] += cigar[0]>>4<<4;
@@ -325,29 +333,31 @@ static void mm_append_cigar(mm_reg1_t *r, uint32_t n_cigar, uint32_t *cigar) //
}
}
static void mm_align_pair(void *km, const mm_mapopt_t *opt, int qlen, const uint8_t *qseq, int tlen, const uint8_t *tseq, const uint8_t *junc, const int8_t *mat, int w, int end_bonus, int zdrop, int flag, ksw_extz_t *ez)
static void mm_align_pair(void *km, const mm_mapopt_t *opt, int qlen, const uint8_t *qseq, int tlen, const uint8_t *tseq, const uint8_t *junc,
const int8_t *mat, int w, int end_bonus, int zdrop, int ksw_flag, ksw_extz_t *ez)
{
if (mm_dbg_flag & MM_DBG_PRINT_ALN_SEQ) {
int i;
fprintf(stderr, "===> q=(%d,%d), e=(%d,%d), bw=%d, flag=%d, zdrop=%d <===\n", opt->q, opt->q2, opt->e, opt->e2, w, flag, opt->zdrop);
fprintf(stderr, "===> q=(%d,%d), e=(%d,%d), bw=%d, ksw_flag=%d, zdrop=%d, end_bonus=%d <===\n", opt->q, opt->q2, opt->e, opt->e2, w, ksw_flag, opt->zdrop, end_bonus);
for (i = 0; i < tlen; ++i) fputc("ACGTN"[tseq[i]], stderr);
fputc('\n', stderr);
for (i = 0; i < qlen; ++i) fputc("ACGTN"[qseq[i]], stderr);
fputc('\n', stderr);
}
if (opt->transition != 0 && opt->b != opt->transition)
flag |= KSW_EZ_GENERIC_SC;
if (opt->max_sw_mat > 0 && (int64_t)tlen * qlen > opt->max_sw_mat) {
ksw_flag |= KSW_EZ_GENERIC_SC;
if (opt->max_sw_mat > 0 && (int64_t)tlen * qlen > opt->max_sw_mat) { // too much memory; skip alignment
ksw_reset_extz(ez);
ez->zdropped = 1;
} else if (opt->flag & MM_F_SPLICE) {
int flag_tmp = flag;
if (!(opt->flag & MM_F_SPLICE_OLD)) flag_tmp |= KSW_EZ_SPLICE_CMPLX;
ksw_exts2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->noncan, zdrop, opt->junc_bonus, flag_tmp, junc, ez);
} else if (opt->q == opt->q2 && opt->e == opt->e2)
ksw_extz2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, w, zdrop, end_bonus, flag, ez);
else
ksw_extd2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->e2, w, zdrop, end_bonus, flag, ez);
} else if (opt->flag & MM_F_SPLICE) { // spliced alignment
assert((ksw_flag & KSW_EZ_SPLICE_FOR) == 0 || (ksw_flag & KSW_EZ_SPLICE_REV) == 0);
if (!(opt->flag & MM_F_SPLICE_OLD)) ksw_flag |= KSW_EZ_SPLICE_CMPLX;
ksw_exts2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->noncan, zdrop, end_bonus, opt->junc_bonus, opt->junc_pen, ksw_flag, junc, ez);
} else if (opt->q == opt->q2 && opt->e == opt->e2) { // affine gap
ksw_extz2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, w, zdrop, end_bonus, ksw_flag, ez);
} else { // dual affine gap
ksw_extd2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->e2, w, zdrop, end_bonus, ksw_flag, ez);
}
if (mm_dbg_flag & MM_DBG_PRINT_ALN_SEQ) {
int i;
fprintf(stderr, "score=%d, cigar=", ez->score);
@@ -357,6 +367,45 @@ static void mm_align_pair(void *km, const mm_mapopt_t *opt, int qlen, const uint
}
}
static int mm_align_sr_rna(void *km, const mm_mapopt_t *opt, int qlen, const uint8_t *qseq, int tlen, const uint8_t *tseq, const uint8_t *junc, uint8_t *tseq2, uint8_t *junc2,
const int8_t *mat, int w, int end_bonus, int zdrop, int ksw_flag, ksw_extz_t *ez)
{
int32_t ilen = opt->q2 * 2, tlen2 = qlen * 2 + ilen;
int32_t i, ll = 0, lr = 0, nn = 0, n_ins = 0;
if (!(opt->flag & MM_F_SPLICE)) return 0; // only for spliced alignment
if (qlen > MM_MAX_QLEN_FLANK || qlen * 2 + ilen > tlen) return 0; // the query sequence can't be too long and the target sequence must be long enough
for (i = 0; i < qlen; ++i) // exact match length from the left
if (qseq[i] == tseq[i] && qseq[i] < 4)
++ll;
for (i = 0; i < qlen; ++i) // exact match length from the right
if (qseq[qlen - 1 - i] == tseq[tlen - 1 - i] && qseq[qlen - 1 - i] < 4)
++lr;
if (qlen - (ll + lr) > 9) return 0; // qlen may be smaller than ll+lr
memcpy(tseq2, tseq, qlen);
memset(&tseq2[qlen], 4, ilen);
memcpy(&tseq2[qlen + ilen], &tseq[tlen - qlen], qlen);
if (junc) {
memcpy(junc2, junc, qlen);
memset(&junc2[qlen], 0, ilen);
memcpy(&junc2[qlen + ilen], &junc[tlen - qlen], qlen);
}
if (!(opt->flag & MM_F_SPLICE_OLD)) ksw_flag |= KSW_EZ_SPLICE_CMPLX;
ksw_exts2_sse(km, qlen, qseq, tlen2, tseq2, 5, mat, opt->q, opt->e, opt->q2, opt->noncan, zdrop, end_bonus, opt->junc_bonus, opt->junc_pen, ksw_flag, junc2, ez);
if (ez->zdropped) return 0;
if ((ez->cigar[0]&0xf) != KSW_CIGAR_MATCH || (ez->cigar[ez->n_cigar-1]&0xf) != KSW_CIGAR_MATCH) return 0;
for (i = 0; i < ez->n_cigar; ++i) { // count the number of introns in the alignment
if ((ez->cigar[i]&0xf) == KSW_CIGAR_N_SKIP)
++nn;
else if ((ez->cigar[i]&0xf) == KSW_CIGAR_INS)
++n_ins;
}
if (nn != 1 || n_ins > 0) return 0; // the heuristic only works when there is exactly one intron
for (i = 0; i < ez->n_cigar; ++i)
if ((ez->cigar[i]&0xf) == KSW_CIGAR_N_SKIP)
ez->cigar[i] += (tlen - tlen2) << 4;
return 1;
}
static inline int mm_get_hplen_back(const mm_idx_t *mi, uint32_t rid, uint32_t x)
{
int64_t i, off0 = mi->seq[rid].offset, off = off0 + x;
@@ -586,12 +635,19 @@ static void mm_fix_bad_ends_splice(void *km, const mm_mapopt_t *opt, const mm_id
}
}
static inline void mm_get_junc(const mm_idx_t *mi, int32_t ctg, int32_t st, int32_t en, int32_t rev, uint8_t *junc)
{
if (mi->spsc) mm_idx_spsc_get(mi, ctg, st, en, rev, junc);
else if (mi->I) mm_idx_bed_junc(mi, ctg, st, en, junc);
else memset(junc, 0, en - st);
}
static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, uint8_t *qseq0[2], mm_reg1_t *r, mm_reg1_t *r2, int n_a, mm128_t *a, ksw_extz_t *ez, int splice_flag)
{
int is_sr = !!(opt->flag & MM_F_SR), is_splice = !!(opt->flag & MM_F_SPLICE);
int is_sr = !!(opt->flag & MM_F_SR), is_splice = !!(opt->flag & MM_F_SPLICE), is_sr_rna = (!!(opt->flag & MM_F_SR_RNA) && is_splice);
int32_t rid = a[r->as].x<<1>>33, rev = a[r->as].x>>63, as1, cnt1;
uint8_t *tseq, *qseq, *junc;
int32_t i, l, bw, bw_long, dropped = 0, extra_flag = 0, rs0, re0, qs0, qe0;
uint8_t *tseq, *qseq, *junc, *tseq2 = 0, *junc2 = 0;
int32_t i, l, bw, bw_long, dropped = 0, ksw_flag = 0, rs0, re0, qs0, qe0;
int32_t rs, re, qs, qe;
int32_t rs1, qs1, re1, qe1;
int8_t mat[25];
@@ -626,9 +682,10 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
assert(cnt1 > 0);
if (is_splice) {
if (splice_flag & MM_F_SPLICE_FOR) extra_flag |= rev? KSW_EZ_SPLICE_REV : KSW_EZ_SPLICE_FOR;
if (splice_flag & MM_F_SPLICE_REV) extra_flag |= rev? KSW_EZ_SPLICE_FOR : KSW_EZ_SPLICE_REV;
if (opt->flag & MM_F_SPLICE_FLANK) extra_flag |= KSW_EZ_SPLICE_FLANK;
if (splice_flag & MM_F_SPLICE_FOR) ksw_flag |= rev? KSW_EZ_SPLICE_REV : KSW_EZ_SPLICE_FOR;
if (splice_flag & MM_F_SPLICE_REV) ksw_flag |= rev? KSW_EZ_SPLICE_FOR : KSW_EZ_SPLICE_REV;
if (opt->flag & MM_F_SPLICE_FLANK) ksw_flag |= KSW_EZ_SPLICE_FLANK;
if (mi->spsc) ksw_flag |= KSW_EZ_SPLICE_SCORE;
}
/* Look for the start and end of regions to perform DP. This sounds easy
@@ -713,6 +770,12 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
tseq = (uint8_t*)kmalloc(km, re0 - rs0);
junc = (uint8_t*)kmalloc(km, re0 - rs0);
if (is_sr_rna) {
int32_t max_tlen2 = MM_MAX_QLEN_FLANK * 2 + opt->q2 * 2;
tseq2 = Kmalloc(km, uint8_t, max_tlen2 * 2);
junc2 = tseq2 + max_tlen2;
}
if (qs > 0 && rs > 0) { // left extension; probably the condition can be changed to "qs > qs0 && rs > rs0"
if (opt->flag & MM_F_QSTRAND) {
qseq = &qseq0[0][qs0];
@@ -721,11 +784,11 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
qseq = &qseq0[rev][qs0];
mm_idx_getseq(mi, rid, rs0, rs, tseq);
}
mm_idx_bed_junc(mi, rid, rs0, rs, junc);
mm_get_junc(mi, rid, rs0, rs, !!(ksw_flag&KSW_EZ_SPLICE_REV), junc);
mm_seq_rev(qs - qs0, qseq);
mm_seq_rev(rs - rs0, tseq);
mm_seq_rev(rs - rs0, junc);
mm_align_pair(km, opt, qs - qs0, qseq, rs - rs0, tseq, junc, mat, bw, opt->end_bonus, r->split_inv? opt->zdrop_inv : opt->zdrop, extra_flag|KSW_EZ_EXTZ_ONLY|KSW_EZ_RIGHT|KSW_EZ_REV_CIGAR, ez);
mm_align_pair(km, opt, qs - qs0, qseq, rs - rs0, tseq, junc, mat, bw, opt->end_bonus, r->split_inv? opt->zdrop_inv : opt->zdrop, ksw_flag|KSW_EZ_EXTZ_ONLY|KSW_EZ_RIGHT|KSW_EZ_REV_CIGAR, ez);
if (ez->n_cigar > 0) {
mm_append_cigar(r, ez->n_cigar, ez->cigar);
r->p->dp_score += ez->max;
@@ -737,14 +800,14 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
re1 = rs, qe1 = qs;
assert(qs1 >= 0 && rs1 >= 0);
for (i = is_sr? cnt1 - 1 : 1; i < cnt1; ++i) { // gap filling
for (i = is_sr? cnt1 - 1 : 1; i < cnt1; ++i) { // gap filling; for short genomic reads, fill from the first seed to the last
if ((a[as1+i].y & (MM_SEED_IGNORE|MM_SEED_TANDEM)) && i != cnt1 - 1) continue;
if (is_sr && !(mi->flag & MM_I_HPC)) {
re = (int32_t)a[as1 + i].x + 1;
qe = (int32_t)a[as1 + i].y + 1;
} else mm_adjust_minier(mi, qseq0, &a[as1 + i], &re, &qe);
re1 = re, qe1 = qe;
if (i == cnt1 - 1 || (a[as1+i].y&MM_SEED_LONG_JOIN) || (qe - qs >= opt->min_ksw_len && re - rs >= opt->min_ksw_len)) {
if (i == cnt1 - 1 || (a[as1+i].y&MM_SEED_LONG_JOIN) || (qe - qs >= opt->min_ksw_len && re - rs >= opt->min_ksw_len)) { // gap filling
int j, bw1 = bw_long, zdrop_code;
if (a[as1+i].y & MM_SEED_LONG_JOIN)
bw1 = qe - qs > re - rs? qe - qs : re - rs;
@@ -756,21 +819,29 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
qseq = &qseq0[rev][qs];
mm_idx_getseq(mi, rid, rs, re, tseq);
}
mm_idx_bed_junc(mi, rid, rs, re, junc);
if (is_sr) { // perform ungapped alignment
mm_get_junc(mi, rid, rs, re, !!(ksw_flag&KSW_EZ_SPLICE_REV), junc);
if (is_sr || (is_sr_rna && qe - qs == re - rs)) { // perform ungapped alignment
int32_t max_gapped_score = (qe - qs - 2) * opt->a - 2 * (opt->q + opt->e);
assert(qe - qs == re - rs);
ksw_reset_extz(ez);
for (j = 0, ez->score = 0; j < qe - qs; ++j) {
if (qseq[j] >= 4 || tseq[j] >= 4) ez->score += opt->e2;
if (qseq[j] >= 4 || tseq[j] >= 4) ez->score += opt->sc_ambi > 0? -opt->sc_ambi : opt->sc_ambi;
else ez->score += qseq[j] == tseq[j]? opt->a : -opt->b;
}
ez->cigar = ksw_push_cigar(km, &ez->n_cigar, &ez->m_cigar, ez->cigar, MM_CIGAR_MATCH, qe - qs);
if (ez->score > max_gapped_score)
ez->cigar = ksw_push_cigar(km, &ez->n_cigar, &ez->m_cigar, ez->cigar, MM_CIGAR_MATCH, qe - qs);
else
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, junc, mat, bw1, -1, opt->zdrop, ksw_flag|KSW_EZ_APPROX_MAX, ez);
} else { // perform normal gapped alignment
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, junc, mat, bw1, -1, opt->zdrop, extra_flag|KSW_EZ_APPROX_MAX, ez); // first pass: with approximate Z-drop
int32_t skip_full = 0;
if (is_sr_rna)
skip_full = mm_align_sr_rna(km, opt, qe - qs, qseq, re - rs, tseq, junc, tseq2, junc2, mat, bw1, -1, opt->zdrop, ksw_flag|KSW_EZ_APPROX_MAX, ez);
if (!skip_full)
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, junc, mat, bw1, -1, opt->zdrop, ksw_flag|KSW_EZ_APPROX_MAX, ez); // first pass: with approximate Z-drop
}
// test Z-drop and inversion Z-drop
if ((zdrop_code = mm_test_zdrop(km, opt, qseq, tseq, ez->n_cigar, ez->cigar, mat)) != 0)
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, junc, mat, bw1, -1, zdrop_code == 2? opt->zdrop_inv : opt->zdrop, extra_flag, ez); // second pass: lift approximate
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, junc, mat, bw1, -1, zdrop_code == 2? opt->zdrop_inv : opt->zdrop, ksw_flag, ez); // second pass: lift approximate
// update CIGAR
if (ez->n_cigar > 0)
mm_append_cigar(r, ez->n_cigar, ez->cigar);
@@ -808,8 +879,8 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
qseq = &qseq0[rev][qe];
mm_idx_getseq(mi, rid, re, re0, tseq);
}
mm_idx_bed_junc(mi, rid, re, re0, junc);
mm_align_pair(km, opt, qe0 - qe, qseq, re0 - re, tseq, junc, mat, bw, opt->end_bonus, opt->zdrop, extra_flag|KSW_EZ_EXTZ_ONLY, ez);
mm_get_junc(mi, rid, re, re0, !!(ksw_flag&KSW_EZ_SPLICE_REV), junc);
mm_align_pair(km, opt, qe0 - qe, qseq, re0 - re, tseq, junc, mat, bw, opt->end_bonus, opt->zdrop, ksw_flag|KSW_EZ_EXTZ_ONLY, ez);
if (ez->n_cigar > 0) {
mm_append_cigar(r, ez->n_cigar, ez->cigar);
r->p->dp_score += ez->max;
@@ -832,11 +903,12 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
mm_idx_getseq(mi, rid, rs1, re1, tseq);
qseq = &qseq0[r->rev][qs1];
}
mm_update_extra(r, qseq, tseq, mat, opt->q, opt->e, opt->flag & MM_F_EQX, !(opt->flag & MM_F_SR));
mm_update_extra(r, qseq, tseq, mat, opt->q, opt->e, opt->flag & MM_F_EQX, !(is_sr || is_sr_rna));
if (rev && r->p->trans_strand)
r->p->trans_strand ^= 3; // flip to the read strand
}
if (tseq2) kfree(km, tseq2);
kfree(km, tseq);
kfree(km, junc);
}
@@ -891,7 +963,7 @@ static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, i
}
r_inv->rs = r1->re + t_off;
r_inv->re = r_inv->rs + ez->max_t + 1;
mm_update_extra(r_inv, &qseq[q_off], &tseq[t_off], mat, opt->q, opt->e, opt->flag & MM_F_EQX, !(opt->flag & MM_F_SR));
mm_update_extra(r_inv, &qseq[q_off], &tseq[t_off], mat, opt->q, opt->e, opt->flag & MM_F_EQX, !(opt->flag & (MM_F_SR|MM_F_SR_RNA)));
ret = 1;
end_align1_inv:
kfree(km, tseq);
@@ -933,14 +1005,14 @@ double mm_event_identity(const mm_reg1_t *r)
static int32_t mm_recal_max_dp(const mm_reg1_t *r, double b2, int32_t match_sc)
{
uint32_t i;
int32_t n_gap = 0, n_gapo = 0, n_mis;
int32_t n_gap = 0, n_mis;
double gap_cost = 0.0;
if (r->p == 0) return -1;
for (i = 0; i < r->p->n_cigar; ++i) {
int32_t op = r->p->cigar[i] & 0xf, len = r->p->cigar[i] >> 4;
if (op == MM_CIGAR_INS || op == MM_CIGAR_DEL) {
gap_cost += b2 + (double)mg_log2(1.0 + len);
++n_gapo, n_gap += len;
n_gap += len;
}
}
n_mis = r->blen + r->p->n_ambi - r->mlen - n_gap;
@@ -992,24 +1064,36 @@ mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *m
n_a = mm_squeeze_a(km, n_regs, regs, a);
memset(&ez, 0, sizeof(ksw_extz_t));
for (i = 0; i < n_regs; ++i) {
mm_reg1_t r2;
mm_reg1_t r2; // only used for inversion
if ((opt->flag&MM_F_SPLICE) && (opt->flag&MM_F_SPLICE_FOR) && (opt->flag&MM_F_SPLICE_REV)) { // then do two rounds of alignments for both strands
mm_reg1_t s[2], s2[2];
int which, trans_strand;
mm_reg1_t s[2], s2[2], *r;
s[0] = s[1] = regs[i];
mm_align1(km, opt, mi, qlen, qseq0, &s[0], &s2[0], n_a, a, &ez, MM_F_SPLICE_FOR);
mm_align1(km, opt, mi, qlen, qseq0, &s[1], &s2[1], n_a, a, &ez, MM_F_SPLICE_REV);
if (s[0].p->dp_score > s[1].p->dp_score) which = 0, trans_strand = 1;
else if (s[0].p->dp_score < s[1].p->dp_score) which = 1, trans_strand = 2;
else trans_strand = 3, which = (qlen + s[0].p->dp_score) & 1; // randomly choose a strand, effectively
if (which == 0) {
mm_align1(km, opt, mi, qlen, qseq0, &s[0], &s2[0], n_a, a, &ez, MM_F_SPLICE_FOR); // assume the transcript is on the + strand of the genome
if ((opt->flag&MM_F_SR_RNA) && regs[i].qe - regs[i].qs == regs[i].re - regs[i].rs && s[0].qe - s[0].qs == s[0].re - s[0].rs && s[0].qs == 0 && s[0].qe == qlen) {
regs[i] = s[0], r2 = s2[0];
free(s[1].p);
regs[i].p->trans_strand = 0;
} else {
regs[i] = s[1], r2 = s2[1];
free(s[0].p);
int which, trans_strand;
mm_align1(km, opt, mi, qlen, qseq0, &s[1], &s2[1], n_a, a, &ez, MM_F_SPLICE_REV); // assume the transcript on the - strand
if (s[0].p->dp_score > s[1].p->dp_score) which = 0, trans_strand = 1;
else if (s[0].p->dp_score < s[1].p->dp_score) which = 1, trans_strand = 2;
else trans_strand = 3, which = (qlen + s[0].p->dp_score) & 1; // randomly choose a strand, effectively
if (which == 0) {
regs[i] = s[0], r2 = s2[0];
free(s[1].p);
} else {
regs[i] = s[1], r2 = s2[1];
free(s[0].p);
}
r = &regs[i];
r->p->trans_strand = trans_strand;
if (r->is_spliced) {
if (trans_strand == 1 || trans_strand == 2) // this is an *approximate* way to tell if there are splice signals.
r->p->dp_max += (opt->a + opt->b) + ((opt->a + opt->b) >> 1);
else if (trans_strand == 3)
r->p->dp_max -= opt->a + opt->b;
}
}
regs[i].p->trans_strand = trans_strand;
} else { // one round of alignment
mm_align1(km, opt, mi, qlen, qseq0, &regs[i], &r2, n_a, a, &ez, opt->flag);
if (opt->flag&MM_F_SPLICE)
@@ -1027,7 +1111,7 @@ mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *m
kfree(km, qseq0[0]);
kfree(km, ez.cigar);
mm_filter_regs(opt, qlen, n_regs_, regs);
if (!(opt->flag&MM_F_SR) && !opt->split_prefix && qlen >= opt->rank_min_len) {
if (!(opt->flag&(MM_F_SR|MM_F_SR_RNA|MM_F_ALL_CHAINS)) && !opt->split_prefix && qlen >= opt->rank_min_len) {
mm_update_dp_max(qlen, *n_regs_, regs, opt->rank_frac, opt->a, opt->b);
mm_filter_regs(opt, qlen, n_regs_, regs);
}
+2 -2
View File
@@ -31,8 +31,8 @@ To acquire the data used in this cookbook and to install minimap2 and paftools,
please follow the command lines below:
```sh
# install minimap2 executables
curl -L https://github.com/lh3/minimap2/releases/download/v2.27/minimap2-2.27_x64-linux.tar.bz2 | tar jxf -
cp minimap2-2.27_x64-linux/{minimap2,k8,paftools.js} . # copy executables
curl -L https://github.com/lh3/minimap2/releases/download/v2.31/minimap2-2.31_x64-linux.tar.bz2 | tar jxf -
cp minimap2-2.31_x64-linux/{minimap2,k8,paftools.js} . # copy executables
export PATH="$PATH:"`pwd` # put the current directory on PATH
# download example datasets
curl -L https://github.com/lh3/minimap2/releases/download/v2.10/cookbook-data.tgz | tar zxf -
+71 -7
View File
@@ -253,6 +253,52 @@ static void write_cs_ds_core(kstring_t *s, const uint8_t *tseq, const uint8_t *q
assert(t_off == r->re - r->rs && q_off == r->qe - r->qs);
}
static inline void revcomp_splice(uint8_t s[2])
{
uint8_t c = s[1] < 4? 3 - s[1] : 4;
s[1] = s[0] < 4? 3 - s[0] : 4;
s[0] = c;
}
void mm_write_junc(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r)
{
int32_t i, t_off, swritten = 0;
s->l = 0;
if (!r->is_spliced || r->p == 0) return; // no junctions
if (r->p->trans_strand != 1 && r->p->trans_strand != 2) return; // no preferred strand
for (i = 0, t_off = r->rs; i < (int)r->p->n_cigar; ++i) {
int op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
if (op == MM_CIGAR_MATCH || op == MM_CIGAR_EQ_MATCH || op == MM_CIGAR_X_MISMATCH || op == MM_CIGAR_DEL) {
t_off += len;
} else if (op == MM_CIGAR_N_SKIP) { // intron
uint8_t donor[2], acceptor[2];
int32_t score1 = 0, score2 = 0, rev;
assert(len >= 2);
rev = (r->p->trans_strand == 2) ^ r->rev;
if (!rev) {
mm_idx_getseq(mi, r->rid, t_off, t_off + 2, donor);
mm_idx_getseq(mi, r->rid, t_off + len - 2, t_off + len, acceptor);
} else {
mm_idx_getseq(mi, r->rid, t_off, t_off + 2, acceptor);
mm_idx_getseq(mi, r->rid, t_off + len - 2, t_off + len, donor);
revcomp_splice(donor);
revcomp_splice(acceptor);
}
//fprintf(stderr, "%c%c-%c%c\n", "ACGTN"[donor[0]], "ACGTN"[donor[1]], "ACGTN"[acceptor[0]], "ACGTN"[acceptor[1]]);
if (donor[0] == 2 && donor[1] == 3) score1 = 3;
else if (donor[0] == 2 && donor[1] == 1) score1 = 2;
else if (donor[0] == 0 && donor[1] == 3) score1 = 1;
if (acceptor[0] == 0 && acceptor[1] == 2) score2 = 3;
else if (acceptor[0] == 0 && acceptor[1] == 1) score2 = 1;
if (swritten) mm_sprintf_lite(s, "\n");
else swritten = 1;
mm_sprintf_lite(s, "%s\t%d\t%d\t%s\t%d\t%c", mi->seq[r->rid].name, t_off, t_off + len, t->name, score1 + score2, "+-"[rev]);
t_off += len;
}
}
assert(t_off == r->re);
}
static void write_MD_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq, const mm_reg1_t *r, char *tmp, int write_tag)
{
int i, q_off, t_off, l_MD = 0;
@@ -310,29 +356,39 @@ static void write_cs_ds_or_MD(void *km, kstring_t *s, const mm_idx_t *mi, const
}
}
}
if (is_MD == 1) write_MD_core(s, tseq, qseq, r, tmp, write_tag);
if (is_MD) write_MD_core(s, tseq, qseq, r, tmp, write_tag);
else write_cs_ds_core(s, tseq, qseq, r, tmp, no_iden, is_ds, write_tag);
kfree(km, qseq); kfree(km, tseq); kfree(km, tmp);
}
int mm_gen_cs_or_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int is_MD, int no_iden, int is_qstrand)
int mm_gen_cs_ds_or_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int is_MD, int is_ds, int no_iden, int is_qstrand)
{
mm_bseq1_t t;
kstring_t str;
str.s = *buf, str.l = 0, str.m = *max_len;
t.l_seq = strlen(seq);
t.seq = (char*)seq;
write_cs_ds_or_MD(km, &str, mi, &t, r, no_iden, is_MD, 0, 0, is_qstrand);
write_cs_ds_or_MD(km, &str, mi, &t, r, no_iden, is_MD, is_ds, 0, is_qstrand);
*max_len = str.m;
*buf = str.s;
return str.l;
}
int mm_gen_cs_or_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int is_MD, int no_iden, int is_qstrand)
{
return mm_gen_cs_ds_or_MD(km, buf, max_len, mi, r, seq, is_MD, 0, no_iden, is_qstrand);
}
int mm_gen_cs(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int no_iden)
{
return mm_gen_cs_or_MD(km, buf, max_len, mi, r, seq, 0, no_iden, 0);
}
int mm_gen_ds(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int no_iden)
{
return mm_gen_cs_ds_or_MD(km, buf, max_len, mi, r, seq, 0, 1, no_iden, 0);
}
int mm_gen_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq)
{
return mm_gen_cs_or_MD(km, buf, max_len, mi, r, seq, 1, 0, 0);
@@ -366,15 +422,18 @@ static inline void write_tags(kstring_t *s, const mm_reg1_t *r)
if (r->split) mm_sprintf_lite(s, "\tzd:i:%d", r->split);
}
void mm_write_paf3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag, int rep_len)
void mm_write_paf4(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag, int rep_len, int n_seg, int seg_idx)
{
s->l = 0;
mm_sprintf_lite(s, "%s", t->name);
if ((opt_flag & MM_F_FRAG_MODE) && n_seg >= 2 && seg_idx >= 0)
mm_sprintf_lite(s, "/%d", seg_idx + 1);
if (r == 0) {
mm_sprintf_lite(s, "%s\t%d\t0\t0\t*\t*\t0\t0\t0\t0\t0\t0", t->name, t->l_seq);
mm_sprintf_lite(s, "\t%d\t0\t0\t*\t*\t0\t0\t0\t0\t0\t0", t->l_seq);
if (rep_len >= 0) mm_sprintf_lite(s, "\trl:i:%d", rep_len);
return;
}
mm_sprintf_lite(s, "%s\t%d\t%d\t%d\t%c\t", t->name, t->l_seq, r->qs, r->qe, "+-"[r->rev]);
mm_sprintf_lite(s, "\t%d\t%d\t%d\t%c\t", t->l_seq, r->qs, r->qe, "+-"[r->rev]);
if (mi->seq[r->rid].name) mm_sprintf_lite(s, "%s", mi->seq[r->rid].name);
else mm_sprintf_lite(s, "%d", r->rid);
mm_sprintf_lite(s, "\t%d", mi->seq[r->rid].len);
@@ -393,11 +452,16 @@ void mm_write_paf3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, MM_CIGAR_STR[r->p->cigar[k]&0xf]);
}
if (r->p && (opt_flag & (MM_F_OUT_CS|MM_F_OUT_DS|MM_F_OUT_MD)))
write_cs_ds_or_MD(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG), opt_flag&MM_F_OUT_MD, !!(opt_flag&MM_F_OUT_DS), 1, !!(opt_flag&MM_F_QSTRAND));
write_cs_ds_or_MD(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG), !!(opt_flag&MM_F_OUT_MD), !!(opt_flag&MM_F_OUT_DS), 1, !!(opt_flag&MM_F_QSTRAND));
if ((opt_flag & MM_F_COPY_COMMENT) && t->comment)
mm_sprintf_lite(s, "\t%s", t->comment);
}
void mm_write_paf3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag, int rep_len)
{
mm_write_paf4(s, mi, t, r, km, opt_flag, rep_len, 0, 0);
}
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag)
{
mm_write_paf3(s, mi, t, r, km, opt_flag, -1);
+33 -14
View File
@@ -55,7 +55,7 @@ mm_reg1_t *mm_gen_regs(void *km, uint32_t hash, int qlen, int n_u, uint64_t *u,
mm_reg1_t *r;
int i, k;
if (n_u == 0) return 0;
if (n_u <= 0) return 0;
// sort by score
z = (mm128_t*)kmalloc(km, n_u * 16);
@@ -256,19 +256,25 @@ void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int chec
{
if (pri_ratio > 0.0f && *n_ > 0) {
int i, k, n = *n_, n_2nd = 0;
for (i = k = 0; i < n; ++i) {
uint8_t *keep = (uint8_t*)kmalloc(km, n);
for (i = 0; i < n; ++i) {
int p = r[i].parent;
keep[i] = 0;
if (p == i || r[i].inv) { // primary or inversion
r[k++] = r[i];
keep[i] = 1;
} else if ((r[i].score >= r[p].score * pri_ratio || r[i].score + min_diff >= r[p].score) && n_2nd < best_n) {
if (!(r[i].qs == r[p].qs && r[i].qe == r[p].qe && r[i].rid == r[p].rid && r[i].rs == r[p].rs && r[i].re == r[p].re)) // not identical hits
r[k++] = r[i], ++n_2nd;
else if (r[i].p) free(r[i].p);
keep[i] = 1, ++n_2nd;
} else if (check_strand && n_2nd < best_n && r[i].score > min_strand_sc && r[i].rev != r[p].rev) {
r[i].strand_retained = 1;
r[k++] = r[i], ++n_2nd;
} else if (r[i].p) free(r[i].p);
keep[i] = 1, ++n_2nd;
}
}
for (i = k = 0; i < n; ++i) {
if (keep[i]) r[k++] = r[i];
else if (r[i].p) free(r[i].p);
}
kfree(km, keep);
if (k != n) mm_sync_regs(km, k, r); // removing hits requires sync()
*n_ = k;
}
@@ -277,13 +283,18 @@ void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int chec
int mm_filter_strand_retained(int n_regs, mm_reg1_t *r)
{
int i, k;
for (i = k = 0; i < n_regs; ++i) {
uint8_t *keep = (uint8_t*)malloc(n_regs);
for (i = 0; i < n_regs; ++i) {
int p = r[i].parent;
if (!r[i].strand_retained || r[i].div < r[p].div * 5.0f || r[i].div < 0.01f) {
keep[i] = (!r[i].strand_retained || r[i].div < r[p].div * 5.0f || r[i].div < 0.01f);
}
for (i = k = 0; i < n_regs; ++i) {
if (keep[i]) {
if (k < i) r[k++] = r[i];
else ++k;
}
}
free(keep);
return k;
}
@@ -418,16 +429,19 @@ static void mm_set_inv_mapq(void *km, int n_regs, mm_reg1_t *regs)
kfree(km, aux);
}
void mm_set_mapq(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr)
void mm_set_mapq2(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr, int is_splice)
{
static const float q_coef = 40.0f;
int64_t sum_sc = 0;
float uniq_ratio;
int i;
int i, n_2nd_splice = 0;
if (n_regs == 0) return;
for (i = 0; i < n_regs; ++i)
for (i = 0; i < n_regs; ++i) {
if (regs[i].parent == regs[i].id)
sum_sc += regs[i].score;
else if (regs[i].is_spliced)
++n_2nd_splice;
}
uniq_ratio = (float)sum_sc / (sum_sc + rep_len);
for (i = 0; i < n_regs; ++i) {
mm_reg1_t *r = &regs[i];
@@ -440,13 +454,18 @@ void mm_set_mapq(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int ma
pen_cm = pen_s1 < pen_cm? pen_s1 : pen_cm;
subsc = r->subsc > min_chain_sc? r->subsc : min_chain_sc;
if (r->p && r->p->dp_max2 > 0 && r->p->dp_max > 0) {
float identity = (float)r->mlen / r->blen;
float x = (float)r->p->dp_max2 * subsc / r->p->dp_max / r->score0;
float x, identity = (float)r->mlen / r->blen;
if (is_sr && is_splice)
x = (float)r->p->dp_max2 / r->p->dp_max; // ignore chaining score; for short RNA-seq reads, unspliced chaining score tends to be higher
else
x = (float)r->p->dp_max2 * subsc / r->p->dp_max / r->score0;
mapq = (int)(identity * pen_cm * q_coef * (1.0f - x * x) * logf((float)r->p->dp_max / match_sc));
if (!is_sr) {
int mapq_alt = (int)(6.02f * identity * identity * (r->p->dp_max - r->p->dp_max2) / match_sc + .499f); // BWA-MEM like mapQ, mostly for short reads
mapq = mapq < mapq_alt? mapq : mapq_alt; // in case the long-read heuristic fails
}
if (is_splice && is_sr && r->is_spliced && n_2nd_splice == 0)
mapq += 10;
} else {
float x = (float)subsc / r->score0;
if (r->p) {
+311 -13
View File
@@ -12,6 +12,7 @@
#include "bseq.h"
#include "minimap.h"
#include "mmpriv.h"
#include "ksw2.h"
#include "kvec.h"
#include "khash.h"
@@ -32,7 +33,7 @@ typedef struct mm_idx_bucket_s {
} mm_idx_bucket_t;
typedef struct {
int32_t st, en, max; // max is not used for now
int32_t st, en, cnt;
int32_t score:30, strand:2;
} mm_idx_intv1_t;
@@ -41,6 +42,11 @@ typedef struct mm_idx_intv_s {
mm_idx_intv1_t *a;
} mm_idx_intv_t;
typedef struct mm_idx_jjump_s {
int32_t n, m;
mm_idx_jjump1_t *a;
} mm_idx_jjump_t;
mm_idx_t *mm_idx_init(int w, int k, int b, int flag)
{
mm_idx_t *mi;
@@ -65,11 +71,17 @@ void mm_idx_destroy(mm_idx_t *mi)
kh_destroy(idx, (idxhash_t*)mi->B[i].h);
}
}
if (mi->spsc) free(mi->spsc);
if (mi->I) {
for (i = 0; i < mi->n_seq; ++i)
free(mi->I[i].a);
free(mi->I);
}
if (mi->J) {
for (i = 0; i < mi->n_seq; ++i)
free(mi->J[i].a);
free(mi->J);
}
if (!mi->km) {
for (i = 0; i < mi->n_seq; ++i)
free(mi->seq[i].name);
@@ -99,7 +111,7 @@ const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n)
void mm_idx_stat(const mm_idx_t *mi)
{
int n = 0, n1 = 0;
int64_t n = 0, n1 = 0;
uint32_t i;
uint64_t sum = 0, len = 0;
fprintf(stderr, "[M::%s] kmer size: %d; skip: %d; is_hpc: %d; #seq: %d\n", __func__, mi->k, mi->w, mi->flag&MM_I_HPC, mi->n_seq);
@@ -117,8 +129,8 @@ void mm_idx_stat(const mm_idx_t *mi)
if (kh_key(h, k)&1) ++n1;
}
}
fprintf(stderr, "[M::%s::%.3f*%.2f] distinct minimizers: %d (%.2f%% are singletons); average occurrences: %.3lf; average spacing: %.3lf; total length: %ld\n",
__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), n, 100.0*n1/n, (double)sum / n, (double)len / sum, (long)len);
fprintf(stderr, "[M::%s::%.3f*%.2f] distinct minimizers: %ld (%.2f%% are singletons); average occurrences: %.3lf; average spacing: %.3lf; total length: %ld\n",
__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), (long)n, 100.0*n1/n, (double)sum / n, (double)len / sum, (long)len);
}
int mm_idx_index_name(mm_idx_t *mi)
@@ -657,10 +669,17 @@ int mm_idx_alt_read(mm_idx_t *mi, const char *fn)
return n_alt;
}
/***************
* BED reading *
***************/
#define sort_key_bed(a) ((a).st)
KRADIX_SORT_INIT(bed, mm_idx_intv1_t, sort_key_bed, 4)
mm_idx_intv_t *mm_idx_read_bed(const mm_idx_t *mi, const char *fn, int read_junc)
#define sort_key_end(a) ((a).en)
KRADIX_SORT_INIT(end, mm_idx_intv1_t, sort_key_end, 4)
static mm_idx_intv_t *mm_idx_bed_read_core(const mm_idx_t *mi, const char *fn, int read_junc, int min_sc)
{
gzFile fp;
kstream_t *ks;
@@ -669,7 +688,7 @@ mm_idx_intv_t *mm_idx_read_bed(const mm_idx_t *mi, const char *fn, int read_junc
fp = fn && strcmp(fn, "-")? gzopen(fn, "r") : gzdopen(fileno(stdin), "r");
if (fp == 0) return 0;
I = (mm_idx_intv_t*)calloc(mi->n_seq, sizeof(*I));
I = CALLOC(mm_idx_intv_t, mi->n_seq);
ks = ks_init(fp);
while (ks_getuntil(ks, KS_SEP_LINE, &str, 0) >= 0) {
mm_idx_intv_t *r;
@@ -690,7 +709,7 @@ mm_idx_intv_t *mm_idx_read_bed(const mm_idx_t *mi, const char *fn, int read_junc
t.en = atol(q);
if (t.en < 0) break;
} else if (i == 4) { // BED score
t.score = atol(q);
t.score = *q >= '0' && *q <= '9'? atol(q) : -1;
} else if (i == 5) { // strand
t.strand = *q == '+'? 1 : *q == '-'? -1 : 0;
} else if (i == 9) {
@@ -706,7 +725,8 @@ mm_idx_intv_t *mm_idx_read_bed(const mm_idx_t *mi, const char *fn, int read_junc
++i, q = p + 1;
}
}
if (id < 0 || t.st < 0 || t.st >= t.en) continue;
if (id < 0 || t.st < 0 || t.st >= t.en) continue; // contig ID not found, or other problems
if (min_sc > 0 && t.score < min_sc) continue;
r = &I[id];
if (i >= 11 && read_junc) { // BED12
int32_t st, sz, en;
@@ -739,14 +759,44 @@ mm_idx_intv_t *mm_idx_read_bed(const mm_idx_t *mi, const char *fn, int read_junc
return I;
}
static mm_idx_intv_t *mm_idx_bed_read_merge(const mm_idx_t *mi, const char *fn, int read_junc, int min_sc)
{
long n = 0, n0 = 0;
int32_t i;
mm_idx_intv_t *I;
I = mm_idx_bed_read_core(mi, fn, read_junc, min_sc);
if (I == 0) return 0;
for (i = 0; i < mi->n_seq; ++i) {
int32_t j, j0, k;
mm_idx_intv_t *intv = &I[i];
n0 += intv->n;
radix_sort_bed(intv->a, intv->a + intv->n); // sort by st
for (j = 1, j0 = 0; j <= intv->n; ++j) { // sort by st and then by end
if (j == intv->n || intv->a[j].st != intv->a[j0].st) {
radix_sort_end(intv->a + j0, intv->a + j);
j0 = j;
}
}
for (j = 1, j0 = 0, k = 0; j <= intv->n; ++j) { // merge intervals with the same (st, en)
if (j == intv->n || intv->a[j].st != intv->a[j0].st || intv->a[j].en != intv->a[j0].en) {
intv->a[k] = intv->a[j0];
intv->a[k++].cnt = j - j0;
j0 = j;
}
}
intv->a = REALLOC(mm_idx_intv1_t, intv->a, k);
intv->n = intv->m = k;
n += k;
}
if (mm_verbose >= 3)
fprintf(stderr, "[%s] read %ld introns, %ld of which are non-redundant\n", __func__, n0, n);
return I;
}
int mm_idx_bed_read(mm_idx_t *mi, const char *fn, int read_junc)
{
int32_t i;
if (mi->h == 0) mm_idx_index_name(mi);
mi->I = mm_idx_read_bed(mi, fn, read_junc);
if (mi->I == 0) return -1;
for (i = 0; i < mi->n_seq; ++i) // TODO: eliminate redundant intervals
radix_sort_bed(mi->I[i].a, mi->I[i].a + mi->I[i].n);
mi->I = mm_idx_bed_read_merge(mi, fn, read_junc, -1);
return 0;
}
@@ -774,3 +824,251 @@ int mm_idx_bed_junc(const mm_idx_t *mi, int32_t ctg, int32_t st, int32_t en, uin
}
return left;
}
/*********************************
* Reading junctions for jumping *
*********************************/
#define sort_key_jj(a) ((a).off)
KRADIX_SORT_INIT(jj, mm_idx_jjump1_t, sort_key_jj, 4)
#define sort_key_jj2(a) ((a).off2)
KRADIX_SORT_INIT(jj2, mm_idx_jjump1_t, sort_key_jj2, 4)
static void sort_jjump(mm_idx_jjump_t *jj2)
{
int32_t j0, j, k;
if (jj2 == 0 || jj2->n == 0) return;
radix_sort_jj(jj2->a, jj2->a + jj2->n);
for (j0 = 0, j = 1; j <= jj2->n; ++j) {
if (j == jj2->n || jj2->a[j0].off != jj2->a[j].off) {
radix_sort_jj2(jj2->a + j0, jj2->a + j);
j0 = j;
}
}
// the actual merge
for (j0 = 0, j = 1, k = 0; j <= jj2->n; ++j) {
if (j == jj2->n || jj2->a[j0].off != jj2->a[j].off || jj2->a[j0].off2 != jj2->a[j].off2) {
int32_t t, cnt = 0;
uint16_t flag = 0;
for (t = j0; t < j; ++t) cnt += jj2->a[t].cnt, flag |= jj2->a[t].flag;
jj2->a[k] = jj2->a[j0];
jj2->a[k].cnt = cnt;
jj2->a[k++].flag = flag;
j0 = j;
}
}
jj2->n = k;
jj2->a = REALLOC(mm_idx_jjump1_t, jj2->a, k);
}
static mm_idx_jjump_t *mm_idx_bed2jjump(const mm_idx_t *mi, const mm_idx_intv_t *I, uint16_t flag)
{
int32_t i;
mm_idx_jjump_t *J;
J = CALLOC(mm_idx_jjump_t, mi->n_seq);
for (i = 0; i < mi->n_seq; ++i) {
int32_t j, k;
const mm_idx_intv_t *intv = &I[i];
mm_idx_jjump_t *jj = &J[i];
jj->n = intv->n * 2;
jj->a = CALLOC(mm_idx_jjump1_t, jj->n);
for (j = k = 0; j < intv->n; ++j) {
jj->a[k].off = intv->a[j].st, jj->a[k].off2 = intv->a[j].en, jj->a[k].cnt = intv->a[j].cnt, jj->a[k].strand = intv->a[j].strand, jj->a[k++].flag = flag;
jj->a[k].off = intv->a[j].en, jj->a[k].off2 = intv->a[j].st, jj->a[k].cnt = intv->a[j].cnt, jj->a[k].strand = intv->a[j].strand, jj->a[k++].flag = flag;
}
sort_jjump(jj);
}
return J;
}
static mm_idx_jjump_t *mm_idx_jjump_merge(const mm_idx_t *mi, const mm_idx_jjump_t *J0, const mm_idx_jjump_t *J1)
{
int32_t i;
mm_idx_jjump_t *J2;
J2 = CALLOC(mm_idx_jjump_t, mi->n_seq);
for (i = 0; i < mi->n_seq; ++i) {
int32_t j, k;
const mm_idx_jjump_t *jj0 = &J0[i], *jj1 = &J1[i];
mm_idx_jjump_t *jj2 = &J2[i];
jj2->n = jj0->n + jj1->n;
jj2->a = CALLOC(mm_idx_jjump1_t, jj2->n);
for (j = k = 0; j < jj0->n; ++j) jj2->a[k++] = jj0->a[j];
for (j = 0; j < jj1->n; ++j) jj2->a[k++] = jj1->a[j];
sort_jjump(jj2);
}
return J2;
}
int mm_idx_jjump_read(mm_idx_t *mi, const char *fn, int flag, int min_sc)
{
int32_t i, j, n_anno = 0, n_misc = 0;
mm_idx_intv_t *I;
mm_idx_jjump_t *J;
if (mi->h == 0) mm_idx_index_name(mi);
I = mm_idx_bed_read_merge(mi, fn, 1, min_sc);
J = mm_idx_bed2jjump(mi, I, flag);
for (i = 0; i < mi->n_seq; ++i) free(I[i].a);
free(I);
if (mi->J) {
mm_idx_jjump_t *J2;
J2 = mm_idx_jjump_merge(mi, mi->J, J);
for (i = 0; i < mi->n_seq; ++i) {
free(mi->J[i].a); free(J[i].a);
}
free(mi->J); free(J);
mi->J = J2;
} else mi->J = J;
for (i = 0; i < mi->n_seq; ++i) {
for (j = 0; j < mi->J[i].n; ++j)
if (mi->J[i].a[j].flag & MM_JUNC_ANNO) ++n_anno;
else ++n_misc;
}
if (mm_verbose >= 3)
fprintf(stderr, "[%s] there are %d annotated and %d other splice positions in the index\n", __func__, n_anno, n_misc);
return 0;
}
static int32_t mm_idx_jump_get_core(int32_t n, const mm_idx_jjump1_t *a, int32_t x) // similar to mm_idx_find_intv()
{
int32_t s = 0, e = n;
if (n == 0) return -1;
if (x < a[0].off) return -1;
while (s < e) {
int32_t mid = s + (e - s) / 2;
if (x >= a[mid].off && (mid + 1 >= n || x < a[mid+1].off)) return mid;
else if (x < a[mid].off) e = mid;
else s = mid + 1;
}
assert(0);
}
const mm_idx_jjump1_t *mm_idx_jump_get(const mm_idx_t *db, int32_t cid, int32_t st, int32_t en, int32_t *n)
{
mm_idx_jjump_t *s;
int32_t l, r;
*n = 0;
if (cid >= db->n_seq || cid < 0 || db->J == 0) return 0;
if (en < 0 || en > db->seq[cid].len) en = db->seq[cid].len;
s = &db->J[cid];
if (s->n == 0) return 0;
l = mm_idx_jump_get_core(s->n, s->a, st);
r = mm_idx_jump_get_core(s->n, s->a, en);
*n = r - l;
return &s->a[l + 1];
}
/****************
* splice score *
****************/
typedef struct mm_idx_spsc_s {
uint32_t n, m;
uint64_t *a; // pos<<56 | score<<1 | acceptor
} mm_idx_spsc_t;
int32_t mm_idx_spsc_read2(mm_idx_t *idx, const char *fn, int32_t max_sc, float scale)
{
gzFile fp;
kstring_t str = {0,0,0};
kstream_t *ks;
int32_t dret, j;
int64_t n_read = 0;
fp = fn && strcmp(fn, "-") != 0? gzopen(fn, "rb") : gzdopen(0, "rb");
if (fp == 0) return -1;
if (idx->h == 0) mm_idx_index_name(idx);
if (max_sc > 63) max_sc = 63;
idx->spsc = Kcalloc(0, mm_idx_spsc_t, idx->n_seq * 2);
ks = ks_init(fp);
while (ks_getuntil(ks, KS_SEP_LINE, &str, &dret) >= 0) {
mm_idx_spsc_t *s;
char *p, *q, *name = 0;
int32_t i, type = -1, strand = 0, cid = -1, score = -1;
int64_t pos = -1;
for (i = 0, p = q = str.s;; ++p) {
if (*p == '\t' || *p == 0) {
int c = *p;
*p = 0;
if (i == 0) {
name = q;
} else if (i == 1) {
pos = atol(q);
} else if (i == 2) {
strand = *q == '+'? 1 : '-'? -1 : 0;
} else if (i == 3) {
type = *q == 'D'? 0 : *q == 'A'? 1 : -1;
} else if (i == 4) {
score = atoi(q);
break;
}
if (c == 0) break;
q = p + 1, ++i;
}
}
if (i < 4) continue; // not enough fields
if (scale > 0.0f && scale < 1.0f)
score = score > 0.0f? (int)(score * scale + .499) : (int)(score * scale - .499);
if (score > max_sc) score = max_sc;
if (score < -max_sc) score = -max_sc;
cid = mm_idx_name2id(idx, name);
if (cid < 0 || type < 0 || strand == 0 || pos < 0) continue; // FIXME: give a warning!
s = &idx->spsc[cid << 1 | (strand > 0? 0 : 1)];
Kgrow(0, uint64_t, s->a, s->n, s->m);
if (pos > 0 && pos < idx->seq[cid].len) { // ignore scores at the ends
s->a[s->n++] = (uint64_t)pos << 8 | (score + KSW_SPSC_OFFSET) << 1 | type;
++n_read;
}
}
ks_destroy(ks);
gzclose(fp);
for (j = 0; j < idx->n_seq * 2; ++j) {
mm_idx_spsc_t *s = &idx->spsc[j];
if (s->n > 0)
radix_sort_64(s->a, s->a + s->n);
}
if (mm_verbose >= 3)
fprintf(stderr, "[M::%s] read %ld splice scores\n", __func__, (long)n_read);
return 0;
}
int32_t mm_idx_spsc_read(mm_idx_t *idx, const char *fn, int32_t max_sc)
{
return mm_idx_spsc_read2(idx, fn, max_sc, 1.0f);
}
static int32_t mm_idx_find_intv(int32_t n, const uint64_t *a, int64_t x)
{
int32_t s = 0, e = n;
if (n == 0) return -1;
if (x < a[0]>>8) return -1;
while (s < e) {
int32_t mid = s + (e - s) / 2;
if (x >= a[mid]>>8 && (mid + 1 >= n || x < a[mid+1]>>8)) return mid;
else if (x < a[mid]>>8) e = mid;
else s = mid + 1;
}
assert(0);
}
int64_t mm_idx_spsc_get(const mm_idx_t *db, int32_t cid, int64_t st, int64_t en, int32_t rev, uint8_t *sc)
{
const mm_idx_spsc_t *s;
if (cid >= db->n_seq || cid < 0 || db->spsc == 0) return -1;
if (en < 0 || en > db->seq[cid].len) en = db->seq[cid].len;
memset(sc, 0xff, en - st);
s = &db->spsc[cid << 1 | (!!rev)];
if (s->n > 0) {
int32_t j, l, r;
l = mm_idx_find_intv(s->n, s->a, st);
r = mm_idx_find_intv(s->n, s->a, en);
for (j = l + 1; j <= r; ++j) {
int64_t x = (s->a[j]>>8) - st;
uint8_t score = s->a[j] & 0xff;
assert(x <= en - st);
if (x == en - st) continue;
if (sc[x] == 0xff || sc[x] < score) sc[x] = score;
}
}
return en - st;
}
+201
View File
@@ -0,0 +1,201 @@
#include <stdio.h>
#include "mmpriv.h"
#include "kalloc.h"
#define MM_MIN_EXON_LEN 20
static int32_t mm_jump_check(void *km, const mm_idx_t *mi, int32_t qlen, const uint8_t *qseq0, const mm_reg1_t *r, int32_t ext, int32_t is_left) // TODO: check close N
{
int32_t clip, clen, e = !r->rev ^ !is_left; // 0 for left of the alignment; 1 for right
uint32_t cigar;
if (!r->p || r->p->n_cigar <= 0) return -1; // only working with CIGAR
clip = e == 0? r->qs : qlen - r->qe;
cigar = r->p->cigar[is_left? 0 : r->p->n_cigar - 1];
clen = (cigar&0xf) == MM_CIGAR_MATCH? cigar>>4 : 0;
if (clen <= ext) return -1;
if (is_left) {
if (clip >= r->rs) return -1; // no space to jump
} else {
if (clip >= mi->seq[r->rid].len - r->re) return -1; // no space to jump
}
return 0;
}
static uint8_t *mm_jump_get_qseq_seq(void *km, int32_t qlen, const uint8_t *qseq0, const mm_reg1_t *r, int32_t is_left, int32_t ql0, uint8_t *qseq)
{
extern unsigned char seq_nt4_table[256];
int32_t i, k = 0;
if (!r->rev) {
if (is_left)
for (i = 0; i < ql0; ++i)
qseq[k++] = seq_nt4_table[(uint8_t)qseq0[i]];
else
for (i = qlen - ql0; i < qlen; ++i)
qseq[k++] = seq_nt4_table[(uint8_t)qseq0[i]];
} else {
if (is_left)
for (i = qlen - 1; i >= qlen - ql0; --i) {
uint8_t c = seq_nt4_table[(uint8_t)qseq0[i]];
qseq[k++] = c >= 4? c : 3 - c;
}
else
for (i = ql0 - 1; i >= 0; --i) {
uint8_t c = seq_nt4_table[(uint8_t)qseq0[i]];
qseq[k++] = c >= 4? c : 3 - c;
}
}
return qseq;
}
static void mm_jump_split_left(void *km, const mm_idx_t *mi, const mm_mapopt_t *opt, int32_t qlen, const uint8_t *qseq0, mm_reg1_t *r, int32_t ts_strand)
{
uint8_t *tseq = 0, *qseq = 0;
int32_t i, n, l, i0, m, mm0;
int32_t i0_anno = -1, n_anno = 0, mm0_anno = 0, i0_misc = -1, n_misc = 0, mm0_misc = 0;
int32_t ext = 1 + (opt->b + opt->a - 1) / opt->a + 1;
int32_t clip = !r->rev? r->qs : qlen - r->qe;
int32_t extt = clip < ext? clip : ext;
const mm_idx_jjump1_t *a;
if (mm_jump_check(km, mi, qlen, qseq0, r, ext + MM_MIN_EXON_LEN, 1) < 0) return;
a = mm_idx_jump_get(mi, r->rid, r->rs - extt, r->rs + ext, &n);
if (n == 0) return;
for (i = 0; i < n; ++i) { // traverse possible jumps
const mm_idx_jjump1_t *ai = &a[i];
int32_t tlen, tl1, j, mm1, mm2;
assert(ai->off >= r->rs - extt && ai->off <= r->rs + ext);
if (ts_strand * ai->strand < 0) continue; // wrong strand
if (ai->off2 >= ai->off) continue; // wrong direction
if (ai->off - ai->off2 < 6) continue; // intron too small
if (ai->off2 < clip + ext) continue; // not long enough
if (tseq == 0) {
tseq = Kcalloc(km, uint8_t, (clip + ext) * 2); // tseq and qseq are allocated together
qseq = tseq + clip + ext;
mm_jump_get_qseq_seq(km, qlen, qseq0, r, 1, clip + ext, qseq);
}
tl1 = clip + (ai->off - r->rs);
tlen = mm_idx_getseq2(mi, 0, r->rid, ai->off, r->rs + ext, &tseq[tl1]);
assert(tlen == r->rs + ext - ai->off);
tlen = mm_idx_getseq2(mi, 0, r->rid, ai->off2 - tl1, ai->off2, tseq);
assert(tlen == tl1);
for (j = 0, mm1 = 0; j < tl1; ++j)
if (qseq[j] != tseq[j] || qseq[j] > 3 || tseq[j] > 3)
++mm1;
for (mm2 = 0; j < clip + ext; ++j)
if (qseq[j] != tseq[j] || qseq[j] > 3 || tseq[j] > 3)
++mm2;
if (mm1 == 0 && mm2 <= 1) {
if (ai->flag & MM_JUNC_ANNO)
i0_anno = i, mm0_anno = mm1 + mm2, ++n_anno; // i0 points to the rightmost i
else
i0_misc = i, mm0_misc = mm1 + mm2, ++n_misc;
}
}
if (n_anno > 0) m = n_anno, i0 = i0_anno, mm0 = mm0_anno;
else m = n_misc, i0 = i0_misc, mm0 = mm0_misc;
kfree(km, tseq);
l = m > 0? a[i0].off - r->rs : 0; // may be negative
if (m == 1 && clip + l >= opt->jump_min_match) { // add one more exon
mm_enlarge_cigar(r, 2);
memmove(r->p->cigar + 2, r->p->cigar, r->p->n_cigar * 4);
r->p->cigar[0] = (clip + l) << 4 | MM_CIGAR_MATCH;
r->p->cigar[1] = (a[i0].off - a[i0].off2) << 4 | MM_CIGAR_N_SKIP;
r->p->cigar[2] = ((r->p->cigar[2]>>4) - l) << 4 | MM_CIGAR_MATCH;
r->p->n_cigar += 2;
r->rs = a[i0].off2 - (clip + l);
if (!r->rev) r->qs = 0;
else r->qe = qlen;
r->blen += clip, r->mlen += clip - mm0;
r->p->dp_max0 += (clip - mm0) * opt->a - mm0 * opt->b;
r->p->dp_max += (clip - mm0) * opt->a - mm0 * opt->b;
if (!r->is_spliced) r->is_spliced = 1, r->p->dp_max += (opt->a + opt->b) + ((opt->a + opt->b) >> 1);
} else if (m > 0 && a[i0].off > r->rs) { // trim by l; l is always positive
r->p->cigar[0] -= l << 4 | MM_CIGAR_MATCH;
r->rs += l;
if (!r->rev) r->qs += l;
else r->qe -= l;
}
}
static void mm_jump_split_right(void *km, const mm_idx_t *mi, const mm_mapopt_t *opt, int32_t qlen, const uint8_t *qseq0, mm_reg1_t *r, int32_t ts_strand)
{
uint8_t *tseq = 0, *qseq = 0;
int32_t i, n, l, i0, m, mm0;
int32_t i0_anno = -1, n_anno = 0, mm0_anno = 0, i0_misc = -1, n_misc = 0, mm0_misc = 0;
int32_t ext = 1 + (opt->b + opt->a - 1) / opt->a + 1;
int32_t clip = !r->rev? qlen - r->qe : r->qs;
int32_t extt = clip < ext? clip : ext;
const mm_idx_jjump1_t *a;
if (mm_jump_check(km, mi, qlen, qseq0, r, ext + MM_MIN_EXON_LEN, 0) < 0) return;
a = mm_idx_jump_get(mi, r->rid, r->re - ext, r->re + extt, &n);
if (n == 0) return;
for (i = 0; i < n; ++i) { // traverse possible jumps
const mm_idx_jjump1_t *ai = &a[i];
int32_t tlen, tl1, j, mm1, mm2;
assert(ai->off >= r->re - ext && ai->off <= r->re + extt);
if (ts_strand * ai->strand < 0) continue; // wrong strand
if (ai->off2 <= ai->off) continue; // wrong direction
if (ai->off2 - ai->off < 6) continue; // intron too small
if (ai->off2 + clip + ext > mi->seq[r->rid].len) continue; // not long enough
if (tseq == 0) {
tseq = Kcalloc(km, uint8_t, (clip + ext) * 2); // tseq and qseq are allocated together
qseq = tseq + clip + ext;
mm_jump_get_qseq_seq(km, qlen, qseq0, r, 0, clip + ext, qseq);
}
tl1 = clip + (r->re - ai->off);
tlen = mm_idx_getseq2(mi, 0, r->rid, r->re - ext, ai->off, tseq);
assert(tlen == ai->off - (r->re - ext));
tlen = mm_idx_getseq2(mi, 0, r->rid, ai->off2, ai->off2 + tl1, &tseq[clip + ext - tl1]);
assert(tlen == tl1);
for (j = 0, mm2 = 0; j < clip + ext - tl1; ++j)
if (qseq[j] != tseq[j] || qseq[j] > 3 || tseq[j] > 3)
++mm2;
for (mm1 = 0; j < clip + ext; ++j)
if (qseq[j] != tseq[j] || qseq[j] > 3 || tseq[j] > 3)
++mm1;
if (mm1 == 0 && mm2 <= 1) {
if (ai->flag & MM_JUNC_ANNO) {
if (i0_anno < 0) i0_anno = i, mm0_anno = mm1 + mm2;
++n_anno;
} else {
if (i0_misc < 0) i0_misc = i, mm0_misc = mm1 + mm2;
++n_misc;
}
}
}
if (n_anno > 0) m = n_anno, i0 = i0_anno, mm0 = mm0_anno;
else m = n_misc, i0 = i0_misc, mm0 = mm0_misc;
kfree(km, tseq);
l = m > 0? r->re - a[i0].off : 0; // may be negative
if (m == 1 && clip + l >= opt->jump_min_match) { // add one more exon
mm_enlarge_cigar(r, 2);
r->p->cigar[r->p->n_cigar - 1] = ((r->p->cigar[r->p->n_cigar - 1]>>4) - l) << 4 | MM_CIGAR_MATCH;
r->p->cigar[r->p->n_cigar] = (a[i0].off2 - a[i0].off) << 4 | MM_CIGAR_N_SKIP;
r->p->cigar[r->p->n_cigar + 1] = (clip + l) << 4 | MM_CIGAR_MATCH;
r->p->n_cigar += 2;
r->re = a[i0].off2 + (clip + l);
if (!r->rev) r->qe = qlen;
else r->qs = 0;
r->blen += clip, r->mlen += clip - mm0;
r->p->dp_max0 += (clip - mm0) * opt->a - mm0 * opt->b;
r->p->dp_max += (clip - mm0) * opt->a - mm0 * opt->b;
if (!r->is_spliced) r->is_spliced = 1, r->p->dp_max += (opt->a + opt->b) + ((opt->a + opt->b) >> 1);
} else if (m > 0 && r->re > a[i0].off) { // trim by l; l is always positive
r->p->cigar[r->p->n_cigar - 1] -= l << 4 | MM_CIGAR_MATCH;
r->re -= l;
if (!r->rev) r->qe -= l;
else r->qs += l;
}
}
void mm_jump_split(void *km, const mm_idx_t *mi, const mm_mapopt_t *opt, int32_t qlen, const uint8_t *qseq, mm_reg1_t *r, int32_t ts_strand)
{
assert((opt->flag & MM_F_EQX) == 0);
mm_jump_split_left(km, mi, opt, qlen, qseq, r, ts_strand);
mm_jump_split_right(km, mi, opt, qlen, qseq, r, ts_strand);
}
+8
View File
@@ -31,6 +31,14 @@ void km_stat_print(const void *km);
#define Kcalloc(km, type, cnt) ((type*)kcalloc((km), (cnt), sizeof(type)))
#define Krealloc(km, type, ptr, cnt) ((type*)krealloc((km), (ptr), (cnt) * sizeof(type)))
#define Kgrow(km, type, ptr, __i, __m) do { \
if ((__i) >= (__m)) { \
(__m) = (__i) + 1; \
(__m) += ((__m)>>1) + 16; \
(ptr) = Krealloc(km, type, ptr, (__m)); \
} \
} while (0)
#define Kexpand(km, type, a, m) do { \
(m) = (m) >= 4? (m) + ((m)>>1) : 16; \
(a) = Krealloc(km, type, (a), (m)); \
+5 -2
View File
@@ -15,7 +15,8 @@
#define KSW_EZ_SPLICE_FOR 0x100
#define KSW_EZ_SPLICE_REV 0x200
#define KSW_EZ_SPLICE_FLANK 0x400
#define KSW_EZ_SPLICE_CMPLX 0x800
#define KSW_EZ_SPLICE_CMPLX 0x800 // use the miniprot splice model
#define KSW_EZ_SPLICE_SCORE 0x1000 // use splice score
// The subset of CIGAR operators used by ksw code.
// Use MM_CIGAR_* from minimap.h if you need the full list.
@@ -24,6 +25,8 @@
#define KSW_CIGAR_DEL 2
#define KSW_CIGAR_N_SKIP 3
#define KSW_SPSC_OFFSET 64
#ifdef __cplusplus
extern "C" {
#endif
@@ -69,7 +72,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
int8_t gapo, int8_t gape, int8_t gapo2, int8_t gape2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t gapo, int8_t gape, int8_t gapo2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez);
int8_t gapo, int8_t gape, int8_t gapo2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez);
void ksw_extf2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t mch, int8_t mis, int8_t e, int w, int xdrop, ksw_extz_t *ez);
+5 -5
View File
@@ -80,17 +80,17 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
}
void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez)
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez)
{
extern void ksw_exts2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez);
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez);
extern void ksw_exts2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez);
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez);
if (ksw_simd < 0) ksw_simd = x86_simd();
if (ksw_simd & SIMD_SSE4_1)
ksw_exts2_sse41(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, junc_bonus, flag, junc, ez);
ksw_exts2_sse41(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, end_bonus, junc_bonus, junc_pen, flag, junc, ez);
else if (ksw_simd & SIMD_SSE2)
ksw_exts2_sse2(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, junc_bonus, flag, junc, ez);
ksw_exts2_sse2(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, end_bonus, junc_bonus, junc_pen, flag, junc, ez);
else abort();
}
#endif
+17 -6
View File
@@ -24,14 +24,14 @@
#ifdef KSW_CPU_DISPATCH
#ifdef __SSE4_1__
void ksw_exts2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez)
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez)
#else
void ksw_exts2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez)
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez)
#endif
#else
void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez)
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez)
#endif // ~KSW_CPU_DISPATCH
{
#define __dp_code_block1 \
@@ -191,7 +191,14 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
}
}
if (junc) {
if (junc && (flag & KSW_EZ_SPLICE_SCORE)) { // junc[] keeps the donor score
uint8_t donor_val = !!(flag & KSW_EZ_SPLICE_FOR) == !(flag & KSW_EZ_REV_CIGAR)? 0 : 1;
for (t = 0; t < tlen - 1; ++t)
((int8_t*)donor)[t] += junc[t+1] == 0xff || (junc[t+1]&1) != donor_val? -junc_pen : (int8_t)(junc[t+1]>>1) - (int8_t)KSW_SPSC_OFFSET;
for (t = 0; t < tlen - 1; ++t)
((int8_t*)acceptor)[t] += junc[t+1] == 0xff || (junc[t+1]&1) != !donor_val? -junc_pen : (int8_t)(junc[t+1]>>1) - (int8_t)KSW_SPSC_OFFSET;
//for (t = 0; t < tlen - 1; ++t) if (junc[t+1] != 0xff) fprintf(stderr, "Y2\t%d\t%d\t%c\t%d\n", ((int8_t*)donor)[t], ((int8_t*)acceptor)[t], "DA"[junc[t+1]&1], (int8_t)(junc[t+1]>>1) - (int8_t)KSW_SPSC_OFFSET);
} else if (junc) { // junc[] keeps the splice sites
if (!(flag & KSW_EZ_REV_CIGAR)) {
for (t = 0; t < tlen - 1; ++t)
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t+1]&1)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t+1]&8)))
@@ -445,10 +452,14 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
if (!approx_max) kfree(km, H);
if (with_cigar) { // backtrack
int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY))
if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY)) {
ksw_backtrack(km, 1, rev_cigar, long_thres, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
else if (ez->max_t >= 0 && ez->max_q >= 0)
} else if (!ez->zdropped && (flag&KSW_EZ_EXTZ_ONLY) && ez->mqe + end_bonus > (int)ez->max) {
ez->reach_end = 1;
ksw_backtrack(km, 1, rev_cigar, long_thres, (uint8_t*)p, off, off_end, n_col_*16, ez->mqe_t, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
} else if (ez->max_t >= 0 && ez->max_q >= 0) {
ksw_backtrack(km, 1, rev_cigar, long_thres, (uint8_t*)p, off, off_end, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
}
kfree(km, mem2); kfree(km, off);
}
}
+2 -2
View File
@@ -67,7 +67,7 @@ void *ksw_ll_qinit(void *km, int size, int qlen, const uint8_t *query, int m, co
const int8_t *ma = mat + a * m;
for (i = 0; i < slen; ++i)
for (k = i; k < nlen; k += slen) // p iterations
*t++ = (k >= qlen? 0 : ma[query[k]]) + q->shift;
*t++ = (k >= qlen? -1 : ma[query[k]]) + q->shift;
}
} else {
int16_t *t = (int16_t*)q->qp;
@@ -76,7 +76,7 @@ void *ksw_ll_qinit(void *km, int size, int qlen, const uint8_t *query, int m, co
const int8_t *ma = mat + a * m;
for (i = 0; i < slen; ++i)
for (k = i; k < nlen; k += slen) // p iterations
*t++ = (k >= qlen? 0 : ma[query[k]]);
*t++ = (k >= qlen? -1 : ma[query[k]]);
}
}
return q;
+5 -5
View File
@@ -149,7 +149,7 @@ mm128_t *mg_lchain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int
int is_cdna, int n_seg, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km)
{ // TODO: make sure this works when n has more than 32 bits
int32_t *f, *t, *v, n_u, n_v, mmax_f = 0, max_drop = bw;
int64_t *p, i, j, max_ii, st = 0, n_iter = 0;
int64_t *p, i, j, max_ii, st = 0;
uint64_t *u;
if (_u) *_u = 0, *n_u_ = 0;
@@ -174,7 +174,6 @@ mm128_t *mg_lchain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int
for (j = i - 1; j >= st; --j) {
int32_t sc;
sc = comput_sc(&a[i], &a[j], max_dist_x, max_dist_y, bw, chn_pen_gap, chn_pen_skip, is_cdna, n_seg);
++n_iter;
if (sc == INT32_MIN) continue;
sc += f[j];
if (sc > max_f) {
@@ -204,6 +203,7 @@ mm128_t *mg_lchain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int
if (max_ii < 0 || (a[i].x - a[max_ii].x <= (int64_t)max_dist_x && f[max_ii] < f[i]))
max_ii = i;
if (mmax_f < max_f) mmax_f = max_f;
//fprintf(stderr, "X1\t%ld\t%ld:%d\t%ld\t%ld:%d\t%ld\t%ld\n", (long)i, (long)(a[i].x>>32), (int32_t)a[i].x, (long)max_j, max_j<0?-1L:(long)(a[max_j].x>>32), max_j<0?-1:(int32_t)a[max_j].x, (long)max_f, (long)v[i]);
}
u = mg_chain_backtrack(km, n, f, p, v, t, min_cnt, min_sc, max_drop, &n_u, &n_v);
@@ -263,7 +263,8 @@ mm128_t *mg_lchain_rmq(int max_dist, int max_dist_inner, int bw, int max_chn_ski
return 0;
}
if (max_dist < bw) max_dist = bw;
if (max_dist_inner <= 0 || max_dist_inner >= max_dist) max_dist_inner = 0;
if (max_dist_inner < 0) max_dist_inner = 0;
if (max_dist_inner > max_dist) max_dist_inner = max_dist;
p = Kmalloc(km, int64_t, n);
f = Kmalloc(km, int32_t, n);
t = Kcalloc(km, int32_t, n);
@@ -325,12 +326,11 @@ mm128_t *mg_lchain_rmq(int max_dist, int max_dist_inner, int bw, int max_chn_ski
krmq_interval(lc_elem, root_inner, &s, &lo, &hi);
if (lo) {
const lc_elem_t *q;
int32_t width, n_rmq_iter = 0;
int32_t width;
krmq_itr_t(lc_elem) itr;
krmq_itr_find(lc_elem, root_inner, lo, &itr);
while ((q = krmq_at(&itr)) != 0) {
if (q->y < (int32_t)a[i].y - max_dist_inner) break;
++n_rmq_iter;
j = q->i;
sc = f[j] + comput_sc_simple(&a[i], &a[j], chn_pen_gap, chn_pen_skip, 0, &width);
if (width <= bw) {
Submodule lib/simde deleted from b30129b3b4
+68 -12
View File
@@ -35,12 +35,12 @@ static ko_longopt_t long_options[] = {
{ "splice", ko_no_argument, 310 },
{ "cost-non-gt-ag", ko_required_argument, 'C' },
{ "no-long-join", ko_no_argument, 312 },
{ "sr", ko_no_argument, 313 },
{ "sr", ko_optional_argument, 313 },
{ "frag", ko_required_argument, 314 },
{ "secondary", ko_required_argument, 315 },
{ "cs", ko_optional_argument, 316 },
{ "end-bonus", ko_required_argument, 317 },
{ "no-pairing", ko_no_argument, 318 },
{ "no-pairing", ko_no_argument, 318 }, // deprecated but reserved for backward compatibility
{ "splice-flank", ko_required_argument, 319 },
{ "idx-no-seq", ko_no_argument, 320 },
{ "end-seed-pen", ko_required_argument, 321 },
@@ -78,6 +78,16 @@ static ko_longopt_t long_options[] = {
{ "no-hash-name", ko_no_argument, 353 },
{ "secondary-seq", ko_no_argument, 354 },
{ "ds", ko_no_argument, 355 },
{ "rmq-inner", ko_required_argument, 356 },
{ "spsc", ko_required_argument, 357 },
{ "junc-pen", ko_required_argument, 358 },
{ "pairing", ko_required_argument, 359 },
{ "jump-min-match", ko_required_argument, 360 },
{ "write-junc", ko_no_argument, 361 },
{ "pass1", ko_required_argument, 362 },
{ "spsc-scale", ko_required_argument, 363 },
{ "spsc0", ko_required_argument, 364 },
{ "dbg-seed-occ", ko_no_argument, 501 },
{ "help", ko_no_argument, 'h' },
{ "max-intron-len", ko_required_argument, 'G' },
{ "version", ko_no_argument, 'V' },
@@ -121,12 +131,13 @@ static inline void yes_or_no(mm_mapopt_t *opt, int64_t flag, int long_idx, const
int main(int argc, char *argv[])
{
const char *opt_str = "2aSDw:k:K:t:r:f:Vv:g:G:I:d:XT:s:x:Hcp:M:n:z:A:B:b:O:E:m:N:Qu:R:hF:LC:yYPo:e:U:J:";
const char *opt_str = "2aSDw:k:K:t:r:f:Vv:g:G:I:d:XT:s:x:Hcp:M:n:z:A:B:b:O:E:m:N:Qu:R:hF:LC:yYPo:e:U:J:j:";
ketopt_t o = KETOPT_INIT;
mm_mapopt_t opt;
mm_idxopt_t ipt;
int i, c, n_threads = 3, n_parts, old_best_n = -1;
char *fnw = 0, *rg = 0, *junc_bed = 0, *s, *alt_list = 0;
float spsc_scale = 0.7f;
char *fnw = 0, *rg = 0, *fn_bed_junc = 0, *fn_bed_jump = 0, *fn_bed_pass1 = 0, *fn_spsc = 0, *s, *alt_list = 0;
FILE *fp_help = stderr;
mm_idx_reader_t *idx_rdr;
mm_idx_t *mi;
@@ -188,6 +199,7 @@ int main(int argc, char *argv[])
else if (c == 'R') rg = o.arg;
else if (c == 'h') fp_help = stdout;
else if (c == '2') opt.flag |= MM_F_2_IO_THREADS;
else if (c == 'j') fn_bed_jump = o.arg;
else if (c == 'J') {
int t;
t = atoi(o.arg);
@@ -212,9 +224,8 @@ int main(int argc, char *argv[])
else if (c == 309) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_ALN_SEQ, n_threads = 1; // --print-aln-seq
else if (c == 310) opt.flag |= MM_F_SPLICE; // --splice
else if (c == 312) opt.flag |= MM_F_NO_LJOIN; // --no-long-join
else if (c == 313) opt.flag |= MM_F_SR; // --sr
else if (c == 317) opt.end_bonus = atoi(o.arg); // --end-bonus
else if (c == 318) opt.flag |= MM_F_INDEPEND_SEG; // --no-pairing
else if (c == 318) opt.flag |= MM_F_INDEPEND_SEG; // --no-pairing (deprecated)
else if (c == 320) ipt.flag |= MM_I_NO_SEQ; // --idx-no-seq
else if (c == 321) opt.anchor_ext_shift = atoi(o.arg); // --end-seed-pen
else if (c == 322) opt.flag |= MM_F_FOR_ONLY; // --for-only
@@ -230,7 +241,7 @@ int main(int argc, char *argv[])
else if (c == 336) opt.flag |= MM_F_HARD_MLEVEL; // --hard-mask-level
else if (c == 337) opt.max_sw_mat = mm_parse_num(o.arg); // --cap-sw-mat
else if (c == 338) opt.max_qlen = mm_parse_num(o.arg); // --max-qlen
else if (c == 340) junc_bed = o.arg; // --junc-bed
else if (c == 340) fn_bed_junc = o.arg; // --junc-bed
else if (c == 341) opt.junc_bonus = atoi(o.arg); // --junc-bonus
else if (c == 342) opt.flag |= MM_F_SAM_HIT_ONLY; // --sam-hit-only
else if (c == 343) opt.chain_gap_scale = atof(o.arg); // --chain-gap-scale
@@ -245,8 +256,27 @@ int main(int argc, char *argv[])
else if (c == 353) opt.flag |= MM_F_NO_HASH_NAME; // --no-hash-name
else if (c == 354) opt.flag |= MM_F_SECONDARY_SEQ; // --secondary-seq
else if (c == 355) opt.flag |= MM_F_OUT_DS; // --ds
else if (c == 356) opt.rmq_inner_dist = mm_parse_num(o.arg); // --rmq-inner
else if (c == 357) fn_spsc = o.arg; // --spsc
else if (c == 360) opt.jump_min_match = mm_parse_num(o.arg); // --jump-min-match
else if (c == 361) opt.flag |= MM_F_OUT_JUNC | MM_F_CIGAR; // --write-junc
else if (c == 362) fn_bed_pass1 = o.arg; // --jump-pass1
else if (c == 501) mm_dbg_flag |= MM_DBG_SEED_FREQ; // --dbg-seed-occ
else if (c == 363) spsc_scale = atof(o.arg); // --spsc-scale
else if (c == 358 || c == 364) opt.junc_pen = atoi(o.arg); // --junc-pen or --spsc0
else if (c == 330) {
fprintf(stderr, "[WARNING] \033[1;31m --lj-min-ratio has been deprecated.\033[0m\n");
} else if (c == 313) { // --sr
if (o.arg == 0 || strcmp(o.arg, "dna") == 0) {
opt.flag |= MM_F_SR;
} else if (strcmp(o.arg, "rna") == 0) {
opt.flag |= MM_F_SR_RNA;
} else if (strcmp(o.arg, "no") == 0) {
opt.flag &= ~(uint64_t)(MM_F_SR|MM_F_SR_RNA);
} else if (mm_verbose >= 2) {
opt.flag |= MM_F_SR;
fprintf(stderr, "[WARNING]\033[1;31m --sr only takes 'dna' or 'rna'. Invalid values are assumed to be 'dna'.\033[0m\n");
}
} else if (c == 314) { // --frag
yes_or_no(&opt, MM_F_FRAG_MODE, o.longidx, o.arg, 1);
} else if (c == 315) { // --secondary
@@ -271,6 +301,14 @@ int main(int argc, char *argv[])
} else if (c == 347) { // --rmq
if (o.arg) yes_or_no(&opt, MM_F_RMQ, o.longidx, o.arg, 1);
else opt.flag |= MM_F_RMQ;
} else if (c == 359) { // --pairing
if (strcmp(o.arg, "no") == 0) opt.flag |= MM_F_INDEPEND_SEG;
else if (strcmp(o.arg, "weak") == 0) opt.flag |= MM_F_WEAK_PAIRING, opt.flag &= ~(uint64_t)MM_F_INDEPEND_SEG;
else {
if (strcmp(o.arg, "strong") != 0 && mm_verbose >= 2)
fprintf(stderr, "[WARNING]\033[1;31m unrecognized argument for --pairing; assuming 'strong'.\033[0m\n");
opt.flag &= ~(uint64_t)(MM_F_INDEPEND_SEG|MM_F_WEAK_PAIRING);
}
} else if (c == 'S') {
opt.flag |= MM_F_OUT_CS | MM_F_CIGAR | MM_F_OUT_CS_LONG;
if (mm_verbose >= 2)
@@ -311,10 +349,6 @@ int main(int argc, char *argv[])
if (*s == ',') opt.e2 = strtol(s + 1, &s, 10);
}
}
if ((opt.flag & MM_F_SPLICE) && (opt.flag & MM_F_FRAG_MODE)) {
fprintf(stderr, "[ERROR]\033[1;31m --splice and --frag should not be specified at the same time.\033[0m\n");
return 1;
}
if (!fnw && !(opt.flag&MM_F_CIGAR))
ipt.flag |= MM_I_NO_SEQ;
if (mm_check_opt(&ipt, &opt) < 0)
@@ -354,6 +388,7 @@ int main(int argc, char *argv[])
fprintf(fp_help, " -s INT minimal peak DP alignment score [%d]\n", opt.min_dp_max);
fprintf(fp_help, " -u CHAR how to find GT-AG. f:transcript strand, b:both strands, n:don't match GT-AG [n]\n");
fprintf(fp_help, " -J INT splice mode. 0: original minimap2 model; 1: miniprot model [1]\n");
fprintf(fp_help, " -j FILE junctions in BED12 to extend *short* RNA-seq alignment []\n");
fprintf(fp_help, " Input/Output:\n");
fprintf(fp_help, " -a output in the SAM format (PAF by default)\n");
fprintf(fp_help, " -o FILE output alignments to FILE [stdout]\n");
@@ -365,6 +400,7 @@ int main(int argc, char *argv[])
fprintf(fp_help, " --MD output the MD tag\n");
fprintf(fp_help, " --eqx write =/X CIGAR operators\n");
fprintf(fp_help, " -Y use soft clipping for supplementary alignments\n");
fprintf(fp_help, " -y copy FASTA/Q comments to output SAM\n");
fprintf(fp_help, " -t INT number of threads [%d]\n", n_threads);
fprintf(fp_help, " -K NUM minibatch size for mapping [500M]\n");
// fprintf(fp_help, " -v INT verbose level [%d]\n", mm_verbose);
@@ -373,6 +409,7 @@ int main(int argc, char *argv[])
fprintf(fp_help, " -x STR preset (always applied before other options; see minimap2.1 for details) []\n");
fprintf(fp_help, " - lr:hq - accurate long reads (error rate <1%%) against a reference genome\n");
fprintf(fp_help, " - splice/splice:hq - spliced alignment for long reads/accurate long reads\n");
fprintf(fp_help, " - splice:sr - spliced alignment for short RNA-seq reads\n");
fprintf(fp_help, " - asm5/asm10/asm20 - asm-to-ref mapping, for ~0.1/1/5%% sequence divergence\n");
fprintf(fp_help, " - sr - short reads against a reference\n");
fprintf(fp_help, " - map-pb/map-hifi/map-ont/map-iclr - CLR/HiFi/Nanopore/ICLR vs reference mapping\n");
@@ -427,7 +464,26 @@ int main(int argc, char *argv[])
__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), mi->n_seq);
if (argc != o.ind + 1) mm_mapopt_update(&opt, mi);
if (mm_verbose >= 3) mm_idx_stat(mi);
if (junc_bed) mm_idx_bed_read(mi, junc_bed, 1);
if (fn_bed_junc) {
mm_idx_bed_read(mi, fn_bed_junc, 1);
if (mi->I == 0 && mm_verbose >= 2)
fprintf(stderr, "[WARNING] failed to load the junction BED file\n");
}
if (fn_bed_jump) {
mm_idx_jjump_read(mi, fn_bed_jump, MM_JUNC_ANNO, -1);
if (mi->J == 0 && mm_verbose >= 2)
fprintf(stderr, "[WARNING] failed to load the jump BED file\n");
}
if (fn_bed_pass1) {
mm_idx_jjump_read(mi, fn_bed_pass1, MM_JUNC_MISC, 5);
if (mi->J == 0 && mm_verbose >= 2)
fprintf(stderr, "[WARNING] failed to load the pass-1 jump BED file\n");
}
if (fn_spsc) {
mm_idx_spsc_read2(mi, fn_spsc, mm_max_spsc_bonus(&opt), spsc_scale);
if (mi->spsc == 0 && mm_verbose >= 2)
fprintf(stderr, "[WARNING] failed to load the splice score file\n");
}
if (alt_list) mm_idx_alt_read(mi, alt_list);
if (argc - (o.ind + 1) == 0) {
mm_idx_destroy(mi);
+35 -8
View File
@@ -224,10 +224,10 @@ static mm_reg1_t *align_regs(const mm_mapopt_t *opt, const mm_idx_t *mi, void *k
return regs;
}
void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, int *n_regs, mm_reg1_t **regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname)
void mm_map_frag_core(const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, int *n_regs, mm_reg1_t **regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname)
{
int i, j, rep_len, qlen_sum, n_regs0, n_mini_pos;
int max_chain_gap_qry, max_chain_gap_ref, is_splice = !!(opt->flag & MM_F_SPLICE), is_sr = !!(opt->flag & MM_F_SR);
int max_chain_gap_qry, max_chain_gap_ref, is_splice = !!(opt->flag & MM_F_SPLICE), is_sr = !!(opt->flag & MM_F_SR), is_sr_rna = !!(opt->flag & MM_F_SR_RNA);
uint32_t hash;
int64_t n_a;
uint64_t *u, *mini_pos;
@@ -338,7 +338,7 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
if (n_segs == 1) { // uni-segment
regs0 = align_regs(opt, mi, b->km, qlens[0], seqs[0], &n_regs0, regs0, a);
regs0 = (mm_reg1_t*)realloc(regs0, sizeof(*regs0) * n_regs0);
mm_set_mapq(b->km, n_regs0, regs0, opt->min_chain_score, opt->a, rep_len, is_sr);
mm_set_mapq2(b->km, n_regs0, regs0, opt->min_chain_score, opt->a, rep_len, is_sr || is_sr_rna, is_splice);
n_regs[0] = n_regs0, regs[0] = regs0;
} else { // multi-segment
mm_seg_t *seg;
@@ -347,7 +347,7 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
for (i = 0; i < n_segs; ++i) {
mm_set_parent(b->km, opt->mask_level, opt->mask_len, n_regs[i], regs[i], opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL, opt->alt_drop); // update mm_reg1_t::parent
regs[i] = align_regs(opt, mi, b->km, qlens[i], seqs[i], &n_regs[i], regs[i], seg[i].a);
mm_set_mapq(b->km, n_regs[i], regs[i], opt->min_chain_score, opt->a, rep_len, is_sr);
mm_set_mapq2(b->km, n_regs[i], regs[i], opt->min_chain_score, opt->a, rep_len, is_sr || is_sr_rna, is_splice);
}
mm_seg_free(b->km, n_segs, seg);
if (n_segs == 2 && opt->pe_ori >= 0 && (opt->flag&MM_F_CIGAR))
@@ -359,6 +359,10 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
kfree(b->km, u);
kfree(b->km, mini_pos);
if (mi->J && n_segs == 1 && is_splice)
for (i = 0; i < n_regs0; ++i)
mm_jump_split(b->km, mi, opt, qlens[0], (const uint8_t*)seqs[0], &regs0[i], 0);
if (b->km) {
km_stat(b->km, &kmst);
if (mm_dbg_flag & MM_DBG_PRINT_QNAME)
@@ -373,6 +377,18 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
}
}
void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, int *n_regs, mm_reg1_t **regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname)
{
if ((opt->flag & MM_F_WEAK_PAIRING) && n_segs == 2 && opt->pe_ori >= 0 && (opt->flag&MM_F_CIGAR)) {
int i;
for (i = 0; i < n_segs; ++i)
mm_map_frag_core(mi, 1, &qlens[i], &seqs[i], &n_regs[i], &regs[i], b, opt, qname);
mm_pair(b->km, opt->max_gap_ref, opt->pe_bonus, opt->a * 2 + opt->b, opt->a, qlens, n_regs, regs);
} else {
mm_map_frag_core(mi, n_segs, qlens, seqs, n_regs, regs, b, opt, qname);
}
}
mm_reg1_t *mm_map(const mm_idx_t *mi, int qlen, const char *seq, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname)
{
mm_reg1_t *regs;
@@ -447,6 +463,10 @@ static void worker_for(void *_data, long i, int tid) // kt_for() callback
r->qs = qlens[j] - r->qe;
r->qe = qlens[j] - t;
r->rev = !r->rev;
if (r->p) {
if (r->p->trans_strand == 1) r->p->trans_strand = 2;
else if (r->p->trans_strand == 2) r->p->trans_strand = 1;
}
}
}
if (mm_dbg_flag & MM_DBG_PRINT_QNAME)
@@ -509,7 +529,7 @@ static void merge_hits(step_t *s)
mm_select_sub(km, opt->pri_ratio, s->p->mi->k*2, opt->best_n, 0, opt->max_gap * 0.8, &s->n_reg[k], s->reg[k]);
mm_set_sam_pri(s->n_reg[k], s->reg[k]);
}
mm_set_mapq(km, s->n_reg[k], s->reg[k], opt->min_chain_score, opt->a, rep_len, !!(opt->flag & MM_F_SR));
mm_set_mapq2(km, s->n_reg[k], s->reg[k], opt->min_chain_score, opt->a, rep_len, !!(opt->flag & (MM_F_SR|MM_F_SR_RNA)), !!(opt->flag & MM_F_SPLICE));
}
if (s->n_seg[f] == 2 && opt->pe_ori >= 0 && (opt->flag&MM_F_CIGAR))
mm_pair(km, frag_gap_part[0], opt->pe_bonus, opt->a * 2 + opt->b, opt->a, qlens, &s->n_reg[k0], &s->reg[k0]);
@@ -578,23 +598,30 @@ static void *worker_pipeline(void *shared, int step, void *in)
mm_err_fwrite(r->p, r->p->capacity, 4, p->fp_split);
}
}
} else if (p->opt->flag & MM_F_OUT_JUNC) { // extra logic for --write-junc
for (j = 0; j < s->n_reg[i]; ++j) {
const mm_reg1_t *r = &s->reg[i][j];
if (r->id != r->parent || r->mapq < 10) continue;
mm_write_junc(&p->str, mi, t, r);
if (p->str.l > 0) mm_err_puts(p->str.s);
}
} else if (s->n_reg[i] > 0) { // the query has at least one hit
for (j = 0; j < s->n_reg[i]; ++j) {
mm_reg1_t *r = &s->reg[i][j];
const mm_reg1_t *r = &s->reg[i][j];
assert(!r->sam_pri || r->id == r->parent);
if ((p->opt->flag & MM_F_NO_PRINT_2ND) && r->id != r->parent)
continue;
if (p->opt->flag & MM_F_OUT_SAM)
mm_write_sam3(&p->str, mi, t, i - seg_st, j, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag, s->rep_len[i]);
else
mm_write_paf3(&p->str, mi, t, r, km, p->opt->flag, s->rep_len[i]);
mm_write_paf4(&p->str, mi, t, r, km, p->opt->flag, s->rep_len[i], s->n_seg[k], i - seg_st);
mm_err_puts(p->str.s);
}
} else if ((p->opt->flag & MM_F_PAF_NO_HIT) || ((p->opt->flag & MM_F_OUT_SAM) && !(p->opt->flag & MM_F_SAM_HIT_ONLY))) { // output an empty hit, if requested
if (p->opt->flag & MM_F_OUT_SAM)
mm_write_sam3(&p->str, mi, t, i - seg_st, -1, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag, s->rep_len[i]);
else
mm_write_paf3(&p->str, mi, t, 0, 0, p->opt->flag, s->rep_len[i]);
mm_write_paf4(&p->str, mi, t, 0, 0, p->opt->flag, s->rep_len[i], s->n_seg[k], i - seg_st);
mm_err_puts(p->str.s);
}
}
+17 -3
View File
@@ -5,7 +5,7 @@
#include <stdio.h>
#include <sys/types.h>
#define MM_VERSION "2.27-r1193"
#define MM_VERSION "2.31-r1302"
#define MM_F_NO_DIAG (0x001LL) // no exact diagonal hit
#define MM_F_NO_DUAL (0x002LL) // skip pairs where query name is lexicographically larger than target name
@@ -45,6 +45,9 @@
#define MM_F_SPLICE_OLD (0x800000000LL)
#define MM_F_SECONDARY_SEQ (0x1000000000LL) //output SEQ field for seqondary alignments using hard clipping
#define MM_F_OUT_DS (0x2000000000LL)
#define MM_F_WEAK_PAIRING (0x4000000000LL)
#define MM_F_SR_RNA (0x8000000000LL)
#define MM_F_OUT_JUNC (0x10000000000LL)
#define MM_I_HPC 0x1
#define MM_I_NO_SEQ 0x2
@@ -91,6 +94,8 @@ typedef struct {
uint32_t *S; // 4-bit packed sequence
struct mm_idx_bucket_s *B; // index (hidden)
struct mm_idx_intv_s *I; // intervals (hidden)
struct mm_idx_spsc_s *spsc;// splice score (hidden)
struct mm_idx_jjump_s *J; // junctions to create jumps (hidden)
void *km, *h;
} mm_idx_t;
@@ -115,7 +120,7 @@ typedef struct {
int32_t mlen, blen; // seeded exact match length; seeded alignment block length
int32_t n_sub; // number of suboptimal mappings
int32_t score0; // initial chaining score (before chain merging/spliting)
uint32_t mapq:8, split:2, rev:1, inv:1, sam_pri:1, proper_frag:1, pe_thru:1, seg_split:1, seg_id:8, split_inv:1, is_alt:1, strand_retained:1, dummy:5;
uint32_t mapq:8, split:2, rev:1, inv:1, sam_pri:1, proper_frag:1, pe_thru:1, seg_split:1, seg_id:8, split_inv:1, is_alt:1, strand_retained:1, is_spliced:1, dummy:4;
uint32_t hash;
float div;
mm_extra_t *p;
@@ -158,7 +163,8 @@ typedef struct {
int transition; // transition mismatch score (A:G, C:T)
int sc_ambi; // score when one or both bases are "N"
int noncan; // cost of non-canonical splicing sites
int junc_bonus;
int junc_bonus; // bonus for a splice site in annotation
int junc_pen; // penalty for GT- or -AG not scored in --spsc
int zdrop, zdrop_inv; // break alignment if alignment score drops too fast along the diagonal
int end_bonus;
int min_dp_max; // drop an alignment if the score of the max scoring segment is below this threshold
@@ -171,6 +177,8 @@ typedef struct {
int pe_ori, pe_bonus;
int32_t jump_min_match;
float mid_occ_frac; // only used by mm_mapopt_update(); see below
float q_occ_frac;
int32_t min_mid_occ, max_mid_occ;
@@ -400,6 +408,7 @@ int mm_map_file_frag(const mm_idx_t *idx, int n_segs, const char **fn, const mm_
* @return the length of cs
*/
int mm_gen_cs(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int no_iden);
int mm_gen_ds(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int no_iden);
int mm_gen_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq);
// query sequence name and sequence in the minimap2 index
@@ -411,6 +420,11 @@ int mm_idx_alt_read(mm_idx_t *mi, const char *fn);
int mm_idx_bed_read(mm_idx_t *mi, const char *fn, int read_junc);
int mm_idx_bed_junc(const mm_idx_t *mi, int32_t ctg, int32_t st, int32_t en, uint8_t *s);
int mm_max_spsc_bonus(const mm_mapopt_t *mo);
int32_t mm_idx_spsc_read(mm_idx_t *idx, const char *fn, int32_t max_sc);
int32_t mm_idx_spsc_read2(mm_idx_t *idx, const char *fn, int32_t max_sc, float scale);
int64_t mm_idx_spsc_get(const mm_idx_t *db, int32_t cid, int64_t st0, int64_t en0, int32_t rev, uint8_t *sc);
// deprecated APIs for backward compatibility
void mm_mapopt_init(mm_mapopt_t *opt);
mm_idx_t *mm_idx_build(const char *fn, int w, int k, int flag, int n_threads);
+107 -46
View File
@@ -1,4 +1,4 @@
.TH minimap2 1 "12 March 2024" "minimap2-2.27 (r1193)" "Bioinformatics tools"
.TH minimap2 1 "19 May 2026" "minimap2-2.31 (r1302)" "Bioinformatics tools"
.SH NAME
.PP
minimap2 - mapping and alignment between collections of DNA sequences
@@ -79,19 +79,6 @@ Minimizer k-mer length [15]
.BI -w \ INT
Minimizer window size [10]. A minimizer is the smallest k-mer
in a window of w consecutive k-mers.
.TP
.BI -j \ INT
Syncmer submer size [10]. Option
.B -j
and
.B -w
will override each: if
.B -w
is applied after
.BR -j ,
.B -j
will have no effect, and vice versa.
.TP
.B -H
Use homopolymer-compressed (HPC) minimizers. An HPC sequence is constructed by
@@ -268,6 +255,11 @@ or more of the shorter chain [0.5]
Use the minigraph chaining algorithm [no]. The minigraph algorithm is better
for aligning contigs through long INDELs.
.TP
.BI --rmq-inner \ NUM
Apply full dynamic programming for anchors within distance
.I NUM
[1000].
.TP
.B --hard-mask-level
Honor option
.B -M
@@ -305,11 +297,13 @@ maximum alignment gap is mostly controlled by
.B --splice
Enable the splice alignment mode.
.TP
.B --sr
Enable short-read alignment heuristics. In the short-read mode, minimap2
applies a second round of chaining with a higher minimizer occurrence threshold
if no good chain is found. In addition, minimap2 attempts to patch gaps between
seeds with ungapped alignment.
.BR --sr [= no | dna | rna ]
Enable short-read alignment heuristics [no]. If this option is used with no argument,
.RB ` dna '
is set. In the DNA short-read mode, minimap2 applies a second round of chaining
with a higher minimizer occurrence threshold if no good chain is found. In
addition, minimap2 attempts to patch gaps between seeds with ungapped
alignment.
.TP
.BI --split-prefix \ STR
Prefix to create temporary files. Typically used for a multi-part index.
@@ -329,10 +323,6 @@ Only map to the reverse complement strand of the reference sequences.
If yes, sort anchors with heap merge, instead of radix sort. Heap merge is
faster for short reads, but slower for long reads. [no]
.TP
.B --no-pairing
Treat two reads in a pair as independent reads. The mate related fields in SAM
are still properly populated.
.TP
.B --no-hash-name
Produce the same alignment for identical sequences regardless of their sequence names.
.SS Alignment options
@@ -366,7 +356,16 @@ Splice model [1]. 0 for the original minimap2 splice model that always penalizes
.B -C
has no effect with the default
.BR -J1 .
.BR -J0 .
.TP
.BR -j \ FILE
Junctions used to extend alignment towards ends of reads [].
.I FILE
can be gene annotations in the BED12 format (aka 12-column BED), or intron
positions in 5-column BED with the strand column required. BED12 file can be
converted from GTF/GFF3 with `paftools.js gff2bed anno.gtf'. This option is
intended for short RNA-seq reads, while
.B --junc-bed
for long noisy RNA-seq reads.
.TP
.BI -C \ INT
Cost for a non-canonical GT-AG splicing (effective with
@@ -409,7 +408,16 @@ no attempt to match GT-AG [n]
Score bonus when alignment extends to the end of the query sequence [0].
.TP
.BI --score-N \ INT
Score of a mismatch involving ambiguous bases [1].
Penalty of a mismatch involving ambiguous bases [1].
.TP
.BR --pairing = strong | weak | no
How to pair paired-end reads [strong].
.RB ` no '
for aligning the two ends in a pair independently with no `properly paired' set.
.RB ` weak '
for aligning the two ends independently and then pairing the hits.
.RB ` strong '
for jointly aligning and pairing the two ends.
.TP
.BR --splice-flank = yes | no
Assume the next base to a
@@ -428,16 +436,49 @@ on SIRV data, please add
.B --splice-flank=no
to the command line.
.TP
.BR --spsc \ FILE
Splice scores []. Each line consists of five fields: 1) contig, 2) offset, 3) `+' or `-', 4) `D' or `A', and 5) score,
where offset is the number of bases before a splice junction, `D' indicates the
line corresponds to a donor site and `A' for an acceptor site.
A positive score suggests the junction is preferred and a negative score
suggests the junction is not preferred.
.TP
.BR --spsc0 \ INT
Penalty for positions not in
.I FILE
specified by
.B --spsc
[5]. Effective with
.B --spsc
but not
.BR --junc-bed .
.TP
.BR --spsc-scale \ FLOAT
Scale splice scores in
.B --spsc
by
.IR FLOAT
rounded to the nearest integer [0.7].
.TP
.BR --junc-bed \ FILE
Gene annotations in the BED12 format (aka 12-column BED), or intron positions
in 5-column BED. With this option, minimap2 prefers splicing in annotations.
BED12 file can be converted from GTF/GFF3 with `paftools.js gff2bed anno.gtf'
[].
Junctions to prefer during base alignment [].
Same format as
.BR -j .
It is
.I NOT
recommended to apply this option to short RNA-seq reads. This would increase
run time with little improvement to junction accuracy.
.TP
.BR --junc-bonus \ INT
Score bonus for a splice donor or acceptor found in annotation (effective with
.BR --junc-bed )
[9].
Score bonus for a splice donor or acceptor found in annotation [9]. Effective with
.B --junc-bed
but not
.BR --spsc .
.TP
.BR --jump-min-match \ INT
Minimum matching length to create a jump [3]. Equivalent to
.B STAR
.BR --alignSJDBoverhangMin .
.TP
.BI --end-seed-pen \ INT
Drop a terminal anchor if
@@ -463,7 +504,7 @@ Set 0 to disable [100m].
.BI --cap-kalloc \ NUM
Free thread-local kalloc memory reservoir if after the alignment the size of the reservoir above
.IR NUM .
Set 0 to disable [0].
Set 0 to disable [500m].
.SS Input/output options
.TP 10
.B -a
@@ -495,20 +536,13 @@ Copy input FASTA/Q comments to output.
.B -c
Generate CIGAR. In PAF, the CIGAR is written to the `cg' custom tag.
.TP
.BI --cs[= STR ]
.BR --cs [= short | long ]
Output the
.B cs
tag.
.I STR
can be either
.I short
or
.IR long .
If no
.I STR
is given,
.I short
is assumed. [none]
If no argument is given,
.RB ` short '
is set. [none]
.TP
.B --MD
Output the MD tag (see the SAM spec).
@@ -522,6 +556,26 @@ In SAM output, use soft clipping for supplementary alignments.
.B --secondary-seq
In SAM output, show query sequences for secondary alignments.
.TP
.B --write-junc
Output splice junctions in 6-column BED: contig name, start, end,
read name, score and strand. Score is the sum of donor and acceptor scores,
where GT gets 3, GC gets 2 and AT gets 1 at donor sites,
while AG gets 3 and AC gets 1 at acceptor sites.
Alignments with mapping quality below 10 are ignored.
.TP
.BI --pass1 \ FILE
Junctions BED file outputted by
.B --write-junc
[]. Rows with scores lower than 5 are ignored. When both
.B -j
and
.B --pass1
are present, junctions in
.B -j
are preferred over in
.BR --pass1
when there is ambiguity.
.TP
.BI --seed \ INT
Integer seed for randomizing equally best hits. Minimap2 hashes
.I INT
@@ -661,10 +715,16 @@ Spliced alignment for accurate long RNA-seq reads such as PacBio iso-seq
.B -C5 -O6,24
.BR -B4 ).
.TP
.B splice:sr
Spliced alignment for short RNA-seq reads
.RB ( -xsplice:hq
.B --frag=yes -m25 -s40 -2K100m --heap-sort=yes --pairing=weak --sr=rna --min-dp-len=20
.BR --secondary=no ).
.TP
.B sr
Short-read alignment without splicing
.RB ( -k21
.B -w11 --sr --frag=yes -A2 -B8 -O12,32 -E2,1 -b0 -r100 -p.5 -N20 -f1000,5000 -n2 -m25
.B -w11 --sr --frag=yes -A2 -B8 -O12,32 -E2,1 -r100 -p.5 -N20 -f1000,5000 -n2 -m25
.B -s40 -g100 -2K50m --heap-sort=yes
.BR --secondary=no ).
.TP
@@ -737,7 +797,7 @@ s2 i Chaining score of the best secondary chain
NM i Total number of mismatches and gaps in the alignment
MD Z To generate the ref sequence in the alignment
AS i DP alignment score
SA Z List of other supplementary alignments
SA Z List of other supplementary alignments (with approximate CIGAR strings)
ms i DP score of the max scoring segment in the alignment
nn i Number of ambiguous bases in the alignment
ts A Transcript strand (splice mode only)
@@ -746,6 +806,7 @@ cs Z Difference string
dv f Approximate per-base sequence divergence
de f Gap-compressed per-base sequence divergence
rl i Length of query regions harboring repetitive seeds
zd i Alignment broken due to Z-drop; bit 1: left broken; bit 2: right broken
.TE
.PP
+2 -1
View File
@@ -16,7 +16,8 @@ minimap2 -c test/MT-human.fa test/MT-orang.fa \
| paftools.js liftover -l10000 - <(echo -e "MT_orang\t2000\t5000") # liftOver
# no test data for the following examples
paftools.js junceval -e anno.gtf splice.sam > out.txt # compare splice junctions to annotations
paftools.js splice2bed anno.gtf > anno.bed # convert GTF/GFF3 to BED12
paftools.js splice2bed splice.sam > splice.bed # convert PAF/SAM to BED12
paftools.js gff2bed anno.gtf > anno.bed # convert GTF/GFF3 to BED12
```
## Table of Contents
-335
View File
@@ -1,335 +0,0 @@
#!/usr/bin/env k8
var getopt = function(args, ostr) {
var oli; // option letter list index
if (typeof(getopt.place) == 'undefined')
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
if (getopt.place == -1) { // update scanning pointer
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
getopt.place = -1;
return null;
}
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
++getopt.ind;
getopt.place = -1;
return null;
}
}
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
if (getopt.place < 0) ++getopt.ind;
return '?';
}
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
getopt.arg = null;
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
} else { // need an argument
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
getopt.arg = args[getopt.ind].substr(getopt.place);
else if (args.length <= ++getopt.ind) { // no arg
getopt.place = -1;
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
return '?';
} else getopt.arg = args[getopt.ind]; // white space
getopt.place = -1;
++getopt.ind;
}
return optopt;
}
function read_fastx(file, buf)
{
if (file.readline(buf) < 0) return null;
var m, line = buf.toString();
if ((m = /^([>@])(\S+)/.exec(line)) == null)
throw Error("wrong fastx format");
var is_fq = (m[1] == '@');
var name = m[2];
if (file.readline(buf) < 0)
throw Error("missing sequence line");
var seq = buf.toString();
if (is_fq) { // skip quality
file.readline(buf);
file.readline(buf);
}
return [name, seq];
}
function filter_paf(a, opt)
{
if (a.length == 0) return;
var k = 0;
for (var i = 0; i < a.length; ++i) {
var ai = a[i];
if (ai[10] < opt.min_blen) continue;
if (ai[9] < ai[10] * opt.min_iden) continue;
var clip = [0, 0];
if (ai[4] == '+') {
clip[0] = ai[2] < ai[7]? ai[2] : ai[7];
clip[1] = ai[1] - ai[3] < ai[6] - ai[8]? ai[1] - ai[3] : ai[6] - ai[8];
} else {
clip[0] = ai[2] < ai[6] - ai[8]? ai[2] : ai[6] - ai[8];
clip[1] = ai[1] - ai[3] < ai[7]? ai[1] - ai[3] : ai[7];
}
if (clip[0] > opt.max_clip_len || clip[1] > opt.max_clip_len) continue;
a[k++] = ai;
}
a.length = k;
}
function parse_events(t, ev, id, buf)
{
var re = /(:(\d+))|(([\+\-\*])([a-z]+))/g;
var m, cs = null;
for (var j = 12; j < t.length; ++j) {
if ((m = /^cs:Z:(\S+)/.exec(t[j])) != null) {
cs = m[1].toLowerCase();
break;
}
}
if (cs == null) {
warn("Warning: no cs tag for read '" + t[0] + "'");
return;
}
var st = t[2], en = t[3];
var x = st;
while ((m = re.exec(cs)) != null) {
var l;
if (m[2] != null) { // an identitcal match ":\d+"
l = parseInt(m[2]);
// [start, end, type, index, changed_base]
ev.push([x, x + l, 0, id]);
} else {
if (m[4] == '*') {
l = 1;
ev.push([x, x + 1, 1, id, m[5][0]]);
} else if (m[4] == '+') {
l = m[5].length;
ev.push([x, x + l, 2, id]);
} else if (m[4] == '-') {
l = 0;
ev.push([x, x, -1, id, m[5]]);
}
}
x += l;
}
if (x != en)
throw Error("inconsistent cs for read '" + t[0] + "'");
}
function find_het_sub(ev, a, opt)
{
var n = a.length, last0_i = -1, h = [], d = [];
for (var i = 0; i < n; ++i) h[i] = [], d[i] = [];
for (var i = 0; i < ev.length; ++i) {
if (ev[i][2] == 0) {
if (last0_i < 0 || ev[i][0] != ev[last0_i][0]) last0_i = i;
else if (ev[i][1] > ev[last0_i][1])
last0_i = i;
} else if (ev[i][2] == 1 && last0_i >= 0 && ev[i][0] < ev[last0_i][1]) {
if (ev[last0_i][1] - ev[last0_i][0] >= opt.min_mlen) {
if (opt.dbg_ev) print("EV", ev[last0_i].join("\t"), "|", ev[i].join("\t"));
var e0 = ev[last0_i], hl = h[e0[3]];
if (hl.length == 0 || hl[hl.length-1][0] != e0[0])
hl.push([e0[0], e0[1]]);
d[ev[i][3]].push([ev[i][0], e0[1] - e0[0]]);
}
}
}
var b = [];
for (var i = 0; i < n; ++i) {
var sh = 0, dh = 0;
for (var j = 0; j < h[i].length; ++j)
sh += h[i][j][1] - h[i][j][0];
for (var j = 0; j < d[i].length; ++j)
dh += d[i][j][1];
// [start, end, index, #consistent, lenConsistent, #conflictive, lenConflictive, identity, mlen]
b[i] = [a[i][2], a[i][3], i, h[i].length, sh, d[i].length, dh, a[i][9] / a[i][10], a[i][9]];
}
return b;
}
function flt_utg_for_ec(b, opt)
{
var k = 0;
for (var i = 0; i < b.length; ++i) {
var bi = b[i];
if (bi[4] == 0 && bi[6] == 0) b[k++] = bi; // entirely ambiguous
else if (bi[6] < (bi[4] + bi[6]) * opt.max_ratio0) b[k++] = bi;
}
b.length = k;
if (b.length == 0) return;
// find the longest contiguous segment
b.sort(function(x,y) { return x[0]-y[0] });
var st = b[0][0], en = b[0][1], max_st = 0, max_en = 0, max_max_en = en;
for (var i = 1; i < b.length; ++i) {
if (b[i][0] > en) {
if (en - st > max_en - max_st)
max_st = st, max_en = en;
st = b[i][0], en = b[i][1];
} else {
en = en > b[i][1]? en : b[i][1];
}
max_max_en = max_max_en > b[i][1]? max_max_en : b[i][1];
}
if (en - st > max_en - max_st)
max_st = st, max_en = en;
if (max_max_en != en || st != b[0][0]) {
var k = 0;
for (var i = 0; i < b.length; ++i)
if (b[i][0] < max_en && b[i][1] > max_st)
b[k++] = b[i];
b.length = k;
}
}
function flt_utg_for_bin(b, opt) // filter out alignments clearly on the wrong phase
{
var k = 0;
for (var i = 0; i < b.length; ++i) {
var bi = b[i];
if (bi[4] + bi[6] == 0 || bi[4] >= (bi[4] + bi[6]) * opt.max_ratio0) b[k++] = bi;
}
b.length = k;
}
function ec_core(b, n_a, ev, buf, ecb) // error correction
{
var intv = [];
for (var i = 0; i < n_a; ++i)
intv[i] = null;
intv[b[0][2]] = [b[0][0], b[0][1]];
var en = b[0][1];
for (var i = 1; i < b.length; ++i) {
if (b[i][1] <= en) continue;
intv[b[i][2]] = [en, b[i][1]];
en = b[i][1];
}
var k = 0;
ecb.capacity = buf.capacity;
ecb.length = 0;
for (var i = 0; i < ev.length; ++i) {
var e = ev[i], I = intv[e[3]];
if (I == null) continue;
if (e[0] >= I[0] && e[0] < I[1]) { // this is to reduce duplicated events around junctions
//print("X", e.join("\t"));
if (e[2] == 0) {
ecb.length += e[1] - e[0];
for (var j = e[0]; j < e[1]; ++j)
ecb[k++] = buf[j];
} else if (e[2] == 1) {
++ecb.length;
ecb[k++] = e[4].charCodeAt(0);
} else if (e[2] < 0) {
ecb.length += e[4].length;
for (var j = 0; j < e[4].length; ++j)
ecb[k++] = e[4].charCodeAt(j);
} // else, skip e[2] == 2
}
}
if (ecb.length != k) throw Error("BUG!");
}
function process_paf(a, opt, fp_seq, buf, ecb)
{
if (a.length == 0) return;
var len = a[0][1], name = a[0][0], seq = null;
if (len < opt.min_rlen) return;
if (fp_seq) {
var ret;
while ((ret = read_fastx(fp_seq, buf)) != null)
if (ret[0] == a[0][0])
break;
if (ret == null)
throw Error("failed to find sequence for read '" + a[0][0] + "'");
name = ret[0], seq = ret[1];
if (seq.length != len)
throw Error("inconsistent length for read '" + name + "'");
}
filter_paf(a, opt);
if (a.length == 0) return;
var ev = [];
for (var i = 0; i < a.length; ++i)
parse_events(a[i], ev, i, buf);
ev.sort(function(x,y) { return x[0]!=y[0]? x[0]-y[0] : x[2]-y[2] });
if (seq == null) print("SQ", name, a[0][1], a.length);
var b = find_het_sub(ev, a, opt);
if (opt.ec) flt_utg_for_ec(b, opt);
else flt_utg_for_bin(b, opt);
if (seq == null) {
for (var i = 0; i < b.length; ++i) {
var m, ai = a[b[i][2]], score = 0;
for (var j = 10; j < ai.length; ++j)
if ((m = /^AS:i:(\d+)/.exec(ai[j])) != null)
score = m[1];
print("TS", b[i][2], b[i][0], b[i][1], ai.slice(5, 9).join("\t"), b[i].slice(3, 7).join("\t"), score);
}
print("//");
} else { // error correction
if (b.length == 0) return;
buf.set(seq, 0);
ec_core(b, a.length, ev, buf, ecb);
print(">" + name);
print(ecb);
}
}
function main(args)
{
var c, opt = { min_rlen:5000, min_blen:5000, min_iden:0.8, min_mlen:5, max_clip_len:500, max_ratio0:0.25, dbg_ev:false };
while ((c = getopt(args, "l:b:d:m:c:r:E")) != null) {
if (c == 'l') opt.min_rlen = parseInt(getopt.arg);
else if (c == 'b') opt.min_blen = parseInt(getopt.arg);
else if (c == 'd') opt.min_iden = parseFloat(getopt.arg);
else if (c == 'm') opt.min_slen = parseInt(getopt.arg);
else if (c == 'c') opt.max_clip_len = parseInt(getopt.arg);
else if (c == 'r') opt.max_ratio0 = parseFloat(getopt.arg);
else if (c == 'E') opt.dbg_ev = true;
}
if (args.length - getopt.ind < 1) {
print("Usage: mmphase.js [options] <map-with-cs.paf> [reads.fa]");
print("Options:");
print(" -l INT min read length [" + opt.min_rlen + "]");
print(" -b INT min alignment length [" + opt.min_blen + "]");
print(" -d FLOAT min identity [" + opt.min_iden + "]");
print(" -s INT min match length [" + opt.min_mlen + "]");
print(" -c INT max clip length [" + opt.max_clip_len + "]");
print(" -r FLOAT initial ratio for haplotype filtering [" + opt.max_ratio0 + "]");
return 0;
}
opt.ec = args.length - getopt.ind < 2? false : true;
if (!opt.ec) {
print("CC");
print("CC", "SQ qName qLen nHits");
print("CC", "TS index qStart qEnd tName tLen tStart tEnd nConsistent lCons nConflictive lConf score");
print("CC");
}
var buf = new Bytes(), ecb = new Bytes();
var fp_paf = new File(args[getopt.ind]);
var fp_seq = args.length - getopt.ind >= 2? new File(args[getopt.ind+1]) : null;
var a = [];
while (fp_paf.readline(buf) >= 0) {
var t = buf.toString().split("\t");
if (a.length > 0 && a[0][0] != t[0]) {
process_paf(a, opt, fp_seq, buf, ecb);
a.length = 0;
}
for (var i = 1; i <= 3; ++i) t[i] = parseInt(t[i]);
if (t[1] < opt.min_rlen) continue;
for (var i = 6; i <= 10; ++i) t[i] = parseInt(t[i]);
if (t[10] < opt.min_blen) continue;
a.push(t);
}
if (a.length >= 0)
process_paf(a, opt, fp_seq, buf, ecb);
if (fp_seq) fp_seq.close();
fp_paf.close();
ecb.destroy();
buf.destroy();
}
var ret = main(arguments)
exit(ret)
+241
View File
@@ -0,0 +1,241 @@
#!/usr/bin/env k8
"use strict";
Array.prototype.delete_at = function(i) {
for (let j = i; j < this.length - 1; ++j)
this[j] = this[j + 1];
--this.length;
}
function* getopt(argv, ostr, longopts) {
if (argv.length == 0) return;
let pos = 0, cur = 0;
while (cur < argv.length) {
let lopt = "", opt = "?", arg = "";
while (cur < argv.length) { // skip non-option arguments
if (argv[cur][0] == "-" && argv[cur].length > 1) {
if (argv[cur] == "--") cur = argv.length;
break;
} else ++cur;
}
if (cur == argv.length) break;
let a = argv[cur];
if (a[0] == "-" && a[1] == "-") { // a long option
pos = -1;
let c = 0, k = -1, tmp = "", o;
const pos_eq = a.indexOf("=");
if (pos_eq > 0) {
o = a.substring(2, pos_eq);
arg = a.substring(pos_eq + 1);
} else o = a.substring(2);
for (let i = 0; i < longopts.length; ++i) {
let y = longopts[i];
if (y[y.length - 1] == "=") y = y.substring(0, y.length - 1);
if (o.length <= y.length && o == y.substring(0, o.length)) {
k = i, tmp = y;
++c; // c is the number of matches
if (o == y) { // exact match
c = 1;
break;
}
}
}
if (c == 1) { // find a unique match
lopt = tmp;
if (pos_eq < 0 && longopts[k][longopts[k].length-1] == "=" && cur + 1 < argv.length) {
arg = argv[cur+1];
argv.delete_at(cur + 1);
}
}
} else { // a short option
if (pos == 0) pos = 1;
opt = a[pos++];
let k = ostr.indexOf(opt);
if (k < 0) {
opt = "?";
} else if (k + 1 < ostr.length && ostr[k+1] == ":") { // requiring an argument
if (pos >= a.length) {
arg = argv[cur+1];
argv.delete_at(cur + 1);
} else arg = a.substring(pos);
pos = -1;
}
}
if (pos < 0 || pos >= argv[cur].length) {
argv.delete_at(cur);
pos = 0;
}
if (lopt != "") yield { opt: `--${lopt}`, arg: arg };
else if (opt != "?") yield { opt: `-${opt}`, arg: arg };
else yield { opt: "?", arg: "" };
}
}
function* k8_readline(fn) {
let buf = new Bytes();
let file = new File(fn);
while (file.readline(buf) >= 0) {
yield buf.toString();
}
file.close();
buf.destroy();
}
function merge_hits(b) {
if (b.length == 1)
return { name1:b[0].name1, name2:b[0].name2, len1:b[0].len1, len2:b[0].len2, min_cov:b[0].min_cov, max_cov:b[0].max_cov, cov1:b[0].cov1, cov2:b[0].cov2, s1:b[0].s1, dv:b[0].dv };
b.sort(function(x, y) { return x.st1 - y.st1 });
let f = [], bt = [];
for (let i = 0; i < b.length; ++i)
f[i] = b[i].s1, bt[i] = -1;
for (let i = 0; i < b.length; ++i) {
for (let j = 0; j < i; ++j) {
if (b[j].st2 < b[i].st2) {
if (b[j].en1 >= b[i].en1) continue;
if (b[j].en2 >= b[i].en2) continue;
const ov1 = b[j].en1 <= b[i].st1? 0 : b[i].st1 - b[j].en1;
const li1 = b[i].en1 - b[i].st1;
const s11 = b[i].s1 / li1 * (li1 - ov1);
const ov2 = b[j].en2 <= b[i].st2? 0 : b[i].st2 - b[j].en2;
const li2 = b[i].en2 - b[i].st2;
const s12 = b[i].s1 / li2 * (li2 - ov2);
const s1 = s11 < s12? s11 : s12;
if (f[i] < f[j] + s1)
f[i] = f[j] + s1, bt[i] = j;
}
}
}
let max_i = -1, max_f = 0, d = [];
for (let i = 0; i < b.length; ++i)
if (max_f < f[i])
max_f = f[i], max_i = i;
for (let k = max_i; k >= 0; k = bt[k])
d.push(k);
d = d.reverse();
let dv = 0, tot = 0, cov1 = 0, cov2 = 0, st1 = 0, en1 = 0, st2 = 0, en2 = 0;
for (let k = 0; k < d.length; ++k) {
const i = d[k];
tot += b[i].blen;
dv += b[i].dv * b[i].blen;
if (b[i].st1 > en1) {
cov1 += en1 - st1;
st1 = b[i].st1, en1 = b[i].en1;
} else en1 = en1 > b[i].en1? en1 : b[i].en1;
if (b[i].st2 > en2) {
cov2 += en2 - st2;
st2 = b[i].st2, en2 = b[i].en2;
} else en2 = en2 > b[i].en2? en2 : b[i].en2;
}
dv /= tot;
cov1 = (cov1 + (en1 - st1)) / b[0].len1;
cov2 = (cov2 + (en2 - st2)) / b[0].len2;
const min_cov = cov1 < cov2? cov1 : cov2;
const max_cov = cov1 > cov2? cov1 : cov2;
//warn(d.length, b[0].name1, b[0].name2, min_cov, max_cov);
return { name1:b[0].name1, name2:b[0].name2, len1:b[0].len1, len2:b[0].len2, min_cov:min_cov, max_cov:max_cov, cov1:cov1, cov2:cov2, s1:max_f, dv:dv };
}
function main(args) {
let opt = { min_cov:.9, max_dv:.015, max_diff:20000 };
for (const o of getopt(args, "c:d:e:", [])) {
if (o.opt == '-c') opt.min_cov = parseFloat(o.arg);
else if (o.opt == '-d') opt.max_dv = parseFloat(o.arg);
else if (o.opt == '-e') opt.max_diff = parseFloat(o.arg);
}
if (args.length == 0) {
print("Usage: pafcluster.js [options] <ava.paf>");
print("Options:");
print(` -c FLOAT min coverage [${opt.min_cov}]`);
print(` -d FLOAT max divergence [${opt.max_dv}]`);
print(` -e FLOAT max difference [${opt.max_diff}]`);
return;
}
// read
let a = [], len = {}, name2len = {};
for (const line of k8_readline(args[0])) {
let m, t = line.split("\t");
if (t[4] != "+") continue;
for (let i = 1; i < 4; ++i) t[i] = parseInt(t[i]);
for (let i = 6; i < 11; ++i) t[i] = parseInt(t[i]);
const len1 = t[1], len2 = t[6];
let s1 = -1, dv = -1.0;
for (let i = 12; i < t.length; ++i) {
if ((m = /^(s1|dv):\S:(\S+)/.exec(t[i])) != null) {
if (m[1] == "s1") s1 = parseInt(m[2]);
else if (m[1] == "dv") dv = parseFloat(m[2]);
}
}
if (s1 < 0 || dv < 0) continue;
const cov1 = (parseInt(t[3]) - parseInt(t[2])) / len1;
const cov2 = (parseInt(t[8]) - parseInt(t[7])) / len2;
const min_cov = cov1 < cov2? cov1 : cov2;
const max_cov = cov1 > cov2? cov1 : cov2;
name2len[t[0]] = len1;
name2len[t[5]] = len2;
a.push({ name1:t[0], name2:t[5], len1:len1, len2:len2, min_cov:min_cov, max_cov:max_cov, s1:s1, dv:dv, cov1:cov1, cov2:cov2, st1:t[2], en1:t[3], st2:t[7], en2:t[8], blen:t[10] });
len[t[0]] = len1, len[t[5]] = len2;
}
warn(`Read ${a.length} hits`);
// merge duplicated hits
let h = {};
for (let i = 0; i < a.length; ++i) {
const key = `${a[i].name1}\t${a[i].name2}`;
if (h[key] == null) h[key] = [];
h[key].push(a[i]);
}
a = [];
for (const key in h)
a.push(merge_hits(h[key]));
// core loop
while (a.length > 1) {
// select the sequence with the highest sum of s1
let h = {};
for (let i = 0; i < a.length; ++i) {
if (h[a[i].name1] == null) h[a[i].name1] = 0;
h[a[i].name1] += a[i].s1;
}
let max_s1 = 0, max_name = "";
for (const name in h)
if (max_s1 < h[name])
max_s1 = h[name], max_name = name;
// find contigs in the same group
h = {};
h[max_name] = 1;
for (let i = 0; i < a.length; ++i) {
if (a[i].name1 != max_name && a[i].name2 != max_name)
continue;
const diff1 = a[i].len1 * (1.0 - a[i].cov1);
const diff2 = a[i].len2 * (1.0 - a[i].cov2);
if (a[i].min_cov >= opt.min_cov && a[i].dv <= opt.max_dv && diff1 <= opt.max_diff && diff2 <= opt.max_diff)
h[a[i].name1] = h[a[i].name2] = 1;
}
let n = 0;
for (const key in h) {
++n;
delete name2len[key];
}
print(`SD\t${max_name}\t${n}`);
for (const key in h) print(`CL\t${key}\t${len[key]}`);
print("//");
// filter out redundant hits
let b = [];
for (let i = 0; i < a.length; ++i)
if (h[a[i].name1] == null && h[a[i].name2] == null)
b.push(a[i]);
warn(`Reduced the number of hits from ${a.length} to ${b.length}`);
a = b;
}
// output remaining singletons
for (const key in name2len) {
print(`SD\t${key}\t1`);
print(`CL\t${key}\t${name2len[key]}`);
print(`//`);
}
}
main(arguments);
+122 -8
View File
@@ -1,6 +1,6 @@
#!/usr/bin/env k8
var paftools_version = '2.27-r1193';
var paftools_version = '2.31-r1302';
/*****************************
***** Library functions *****
@@ -1740,15 +1740,19 @@ function paf_gff2bed(args)
function paf_sam2paf(args)
{
var c, pri_only = false, long_cs = false;
while ((c = getopt(args, "pL")) != null) {
var c, pri_only = false, long_cs = false, pri_pri_only = false, allow_unmapped = false;
while ((c = getopt(args, "pPUL")) != null) {
if (c == 'p') pri_only = true;
else if (c == 'P') pri_pri_only = pri_only = true;
else if (c == 'U') allow_unmapped = true;
else if (c == 'L') long_cs = true;
}
if (args.length == getopt.ind) {
print("Usage: paftools.js sam2paf [options] <in.sam>");
print("Options:");
print(" -p convert primary or supplementary alignments only");
print(" -P convert primary alignments only");
print(" -U convert unmapped reads as well");
print(" -L output the cs tag in the long form");
exit(1);
}
@@ -1773,8 +1777,17 @@ function paf_sam2paf(args)
var flag = parseInt(t[1]);
if (t[9] != '*' && t[10] != '*' && t[9].length != t[10].length)
throw Error("at line " + lineno + ": inconsistent SEQ and QUAL lengths - " + t[9].length + " != " + t[10].length);
if (t[2] == '*' || (flag&4) || t[5] == '*') continue;
if (t[2] == '*' || (flag&4) || t[5] == '*') {
if (allow_unmapped) {
// emit an unmapped PAF line instead of skipping
// fields: qname, qlen, qstart, qend, strand, tname, tlen, tstart, tend, n_match, aln_len, mapq
var qlen_val = (t[9] == '*' ? 0 : t[9].length);
print([t[0], qlen_val, 0, 0, '*', '*', 0, 0, 0, 0, 0, 0].join("\t"));
}
continue;
}
if (pri_only && (flag&0x100)) continue;
if (pri_pri_only && (flag&0x900)) continue;
var tlen = ctg_len[t[2]];
if (tlen == null) throw Error("at line " + lineno + ": can't find the length of contig " + t[2]);
// find tags
@@ -1887,7 +1900,10 @@ function paf_sam2paf(args)
// optional tags
var type = flag&0x100? 'S' : 'P';
var tags = ["tp:A:" + type];
if (NM != null) tags.push("mm:i:"+mm);
if (NM != null) {
tags.push("NM:i:"+NM);
tags.push("mm:i:"+mm);
}
tags.push("gn:i:"+(I[1]+D[1]), "go:i:"+(I[0]+D[0]), "cg:Z:" + t[5].replace(/\d+[SH]/g, ''));
if (cs_str != null) tags.push("cs:Z:" + cs_str);
else if (cs.length > 0) tags.push("cs:Z:" + cs.join(""));
@@ -2181,7 +2197,7 @@ function paf_mapeval(args)
}
var lineno = 0, last = null, a = [], n_unmapped = null;
var re_cigar = /(\d+)([MIDSHN])/g;
var re_cigar = /(\d+)([MIDSHN=X])/g;
while (file.readline(buf) >= 0) {
var m, line = buf.toString();
++lineno;
@@ -2219,7 +2235,7 @@ function paf_mapeval(args)
var n_gap = 0, mlen = 0;
while ((m = re_cigar.exec(t[5])) != null) {
var len = parseInt(m[1]);
if (m[2] == 'M') pos_end += len, mlen += len;
if (m[2] == 'M' || m[2] == 'X' || m[2] == '=') pos_end += len, mlen += len;
else if (m[2] == 'I') n_gap += len;
else if (m[2] == 'D') n_gap += len, pos_end += len;
}
@@ -2332,6 +2348,41 @@ function paf_mason2fq(args)
buf2.destroy();
}
// convert Mason read names to BED
function paf_sim2bed(args)
{
if (args.length == 0) {
print("Usage: paftools.js sim2bed <sim.txt>");
exit(1);
}
var buf = new Bytes();
var file = new File(args[0]);
while (file.readline(buf) >= 0) {
var line = buf.toString();
var t = line.split("!");
if (t.length < 5) continue;
var chr = t[1], st, en, strand;
if (t[2].indexOf("_") >= 0) { // mason paired-end
var pos = t[2].split("_");
var end = t[3].split("_");
var m = /^(.)(.)\/([12])$/.exec(t[4]);
if (m == null) continue;
strand = m[3] == "1" ? m[1] : m[2];
var read_no = parseInt(m[3]) - 1;
st = parseInt(pos[read_no]);
en = parseInt(end[read_no]);
} else { // badread/pbsim long reads
st = parseInt(t[2]);
en = parseInt(t[3]);
strand = t[4];
}
if (st > en) { var tmp = st; st = en; en = tmp; }
print([chr, st, en, line, 0, strand].join("\t"));
}
file.close();
buf.destroy();
}
// convert pbsim MAF to FASTQ
function paf_pbsim2fq(args)
{
@@ -2389,6 +2440,53 @@ function paf_pbsim2fq(args)
buf2.destroy();
}
function paf_badread2fa(args)
{
if (args.length < 2) {
print("Usage: paftools.js badread2fa <ref.fa.fai> <badread.fq>");
exit(1);
}
var len = {}, file, buf = new Bytes();
file = new File(args[0]);
while (file.readline(buf) >= 0) {
var t = buf.toString().split("\t");
len[t[0]] = parseInt(t[1]);
}
file.close();
var id = 0, n_discard = 0;
file = new File(args[1]);
while (file.readline(buf) >= 0) {
var line = buf.toString();
var m, tag = '', a = null, is_fq = line[0] == '@'? true : false;
if (!/\schimera\s/.test(line) && (m = /\s(\S+),([+-])strand,(\d+)-(\d+).*read_identity=([0-9\.]+)%/.exec(line)) != null) {
if (len[m[1]] == null) throw Error("failed to find the contig length of " + m[1]);
m[3] = parseInt(m[3]);
m[4] = parseInt(m[4]);
if (m[2] == '+')
a = [ "S" + (id+1), m[1], m[3], m[4], m[2] ];
else
a = [ "S" + (id+1), m[1], len[m[1]] - m[4], len[m[1]] - m[3], m[2] ];
tag = "ri:f:" + m[5];
}
file.readline(buf);
var seq = buf.toString();
if (is_fq) {
file.readline(buf);
file.readline(buf);
}
if (a != null) {
print(">" + a.join("!"), tag);
print(seq);
} else ++n_discard;
++id;
}
file.close();
buf.destroy();
warn("WARNING: discarded " + n_discard + " reads");
}
function paf_junceval(args)
{
var c, l_fuzzy = 0, print_ovlp = false, print_err_only = false, first_only = false, chr_only = false, aa = false, is_bed = false;
@@ -2488,6 +2586,10 @@ function paf_junceval(args)
} else { // SAM
ctg_name = t[2], pos = parseInt(t[3]) - 1, cigar = t[5];
var flag = parseInt(t[1]);
if (flag & 1) {
if (flag & 0x40) qname += '/1';
else if (flag & 0x80) qname += '/2';
}
if (flag&0x100) continue; // secondary
}
@@ -2603,7 +2705,8 @@ function paf_junceval(args)
function paf_exoneval(args) // adapted from paf_junceval()
{
var c, l_fuzzy = 0, print_ovlp = false, print_err_only = false, first_only = false, chr_only = false, aa = false, is_bed = false, use_cds = false, eval_base = false;
while ((c = getopt(args, "l:epcab1ds")) != null) {
var skip_start = false, skip_last = false;
while ((c = getopt(args, "l:epcab1dsft")) != null) {
if (c == 'l') l_fuzzy = parseInt(getopt.arg);
else if (c == 'e') print_err_only = print_ovlp = true;
else if (c == 'p') print_ovlp = true;
@@ -2613,6 +2716,8 @@ function paf_exoneval(args) // adapted from paf_junceval()
else if (c == '1') first_only = true;
else if (c == 'd') use_cds = true;
else if (c == 's') eval_base = true;
else if (c == 'f') skip_start = true;
else if (c == 't') skip_last = skip_start = true;
}
if (args.length - getopt.ind < 1) {
@@ -2625,6 +2730,8 @@ function paf_exoneval(args) // adapted from paf_junceval()
print(" -e print erroreous overlapping exons");
print(" -c only consider alignments to /^(chr)?([0-9]+|X|Y)$/");
print(" -1 only process the first alignment of each query");
print(" -f skip the first exon in the miniprot mode");
print(" -t skip the first and the last exons");
print(" -b BED as input");
print(" -s compute base Sn and Sp (more memory)");
exit(1);
@@ -2754,6 +2861,8 @@ function paf_exoneval(args) // adapted from paf_junceval()
for (var i = tmp_exon.length - 1; i >= 0; --i)
exon.push([pos + (glen - tmp_exon[i][1]), pos + (glen - tmp_exon[i][0])]);
}
if (skip_start) exon.shift();
if (skip_last) exon.pop();
} else {
var tmp_st = pos;
while ((m = re_cigar.exec(cigar)) != null) {
@@ -3234,6 +3343,7 @@ function paf_sveval(args)
if (bed != null && bed[t[0]] == null) continue;
if (t[4] == '<INV>' || t[4] == '<INVDUP>') continue; // no inversion
if (/[\[\]]/.test(t[4])) continue; // no break points
if (t[6] != "." && t[6] != "PASS") continue;
var st = parseInt(t[1]) - 1, en = st + t[3].length;
// parse svlen
var b = _paf_get_alen(t), svlen = b[0];
@@ -3675,7 +3785,9 @@ function main(args)
print(" mapeval evaluate mapping accuracy using mason2/PBSIM-simulated FASTQ");
print(" pafcmp compare two PAF files");
print(" mason2fq convert mason2-simulated SAM to FASTQ");
print(" sim2bed convert mason2-simulated read names to BED");
print(" pbsim2fq convert PBSIM-simulated MAF to FASTQ");
print(" badread2fa convert Baderead FASTQ to FASTA");
print(" junceval evaluate splice junction consistency with known annotations");
print(" exoneval evaluate exon-level consistency with known annotations");
print(" ov-eval evaluate read overlap sensitivity using read-to-ref mapping");
@@ -3700,7 +3812,9 @@ function main(args)
else if (cmd == 'pafcmp') paf_pafcmp(args);
else if (cmd == 'bedcov') paf_bedcov(args);
else if (cmd == 'mason2fq') paf_mason2fq(args);
else if (cmd == 'sim2bed') paf_sim2bed(args);
else if (cmd == 'pbsim2fq') paf_pbsim2fq(args);
else if (cmd == 'badread2fa') paf_badread2fa(args);
else if (cmd == 'junceval') paf_junceval(args);
else if (cmd == 'exoneval') paf_exoneval(args);
else if (cmd == 'ov-eval') paf_ov_eval(args);
+25 -4
View File
@@ -14,6 +14,7 @@
#define MM_DBG_PRINT_SEED 0x4
#define MM_DBG_PRINT_ALN_SEQ 0x8
#define MM_DBG_PRINT_CHAIN 0x10
#define MM_DBG_SEED_FREQ 0x20
#define MM_SEED_LONG_JOIN (1ULL<<40)
#define MM_SEED_IGNORE (1ULL<<41)
@@ -23,6 +24,9 @@
#define MM_SEED_SEG_SHIFT 48
#define MM_SEED_SEG_MASK (0xffULL<<(MM_SEED_SEG_SHIFT))
#define MM_JUNC_ANNO 0x1
#define MM_JUNC_MISC 0x2
#ifndef kroundup32
#define kroundup32(x) (--(x), (x)|=(x)>>1, (x)|=(x)>>2, (x)|=(x)>>4, (x)|=(x)>>8, (x)|=(x)>>16, ++(x))
#endif
@@ -32,6 +36,7 @@
#define MALLOC(type, len) ((type*)malloc((len) * sizeof(type)))
#define CALLOC(type, len) ((type*)calloc((len), sizeof(type)))
#define REALLOC(type, ptr, cnt) ((type*)realloc((ptr), (cnt) * sizeof(type)))
#ifdef __cplusplus
extern "C" {
@@ -51,6 +56,12 @@ typedef struct {
mm128_t *a;
} mm_seg_t;
typedef struct {
int32_t off, off2, cnt;
int16_t strand;
uint16_t flag;
} mm_idx_jjump1_t;
double cputime(void);
double realtime(void);
long peakrss(void);
@@ -68,19 +79,23 @@ double mm_event_identity(const mm_reg1_t *r);
int mm_write_sam_hdr(const mm_idx_t *mi, const char *rg, const char *ver, int argc, char *argv[]);
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag);
void mm_write_paf3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag, int rep_len);
void mm_write_paf4(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag, int rep_len, int n_seg, int seg_idx);
void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int n_regs, const mm_reg1_t *regs);
void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regs, const mm_reg1_t *const* regs, void *km, int64_t opt_flag);
void mm_write_sam3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regss, const mm_reg1_t *const* regss, void *km, int64_t opt_flag, int rep_len);
void mm_write_junc(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r);
// indexing related in index.c
void mm_idxopt_init(mm_idxopt_t *opt);
const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n);
int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f);
int mm_idx_getseq2(const mm_idx_t *mi, int is_rev, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq);
mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a);
mm_reg1_t *mm_gen_regs(void *km, uint32_t hash, int qlen, int n_u, uint64_t *u, mm128_t *a, int is_qstrand);
int mm_idx_bed_read(mm_idx_t *mi, const char *fn, int read_junc);
int mm_idx_jjump_read(mm_idx_t *mi, const char *fn, int flag, int min_sc);
const mm_idx_jjump1_t *mm_idx_jump_get(const mm_idx_t *db, int32_t cid, int32_t st, int32_t en, int32_t *n);
mm128_t *mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int max_iter, int min_cnt, int min_sc, float gap_scale,
int is_cdna, int n_segs, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km);
// chaining in lchain.c
mm128_t *mg_lchain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int max_iter, int min_cnt, int min_sc, float chn_pen_gap, float chn_pen_skip,
int is_cdna, int n_segs, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km);
mm128_t *mg_lchain_rmq(int max_dist, int max_dist_inner, int bw, int max_chn_skip, int cap_rmq_size, int min_cnt, int min_sc, float chn_pen_gap, float chn_pen_skip,
@@ -97,8 +112,12 @@ void mm_select_sub_multi(void *km, float pri_ratio, float pri1, float pri2, int
int mm_filter_strand_retained(int n_regs, mm_reg1_t *r);
void mm_filter_regs(const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs);
void mm_hit_sort(void *km, int *n_regs, mm_reg1_t *r, float alt_diff_frac);
void mm_set_mapq(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr);
void mm_set_mapq2(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr, int is_splice);
void mm_update_dp_max(int qlen, int n_regs, mm_reg1_t *regs, float frac, int a, int b);
void mm_jump_split(void *km, const mm_idx_t *mi, const mm_mapopt_t *opt, int32_t qlen, const uint8_t *qseq, mm_reg1_t *r, int32_t ts_strand);
mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a);
void mm_enlarge_cigar(mm_reg1_t *r, uint32_t n_cigar);
void mm_est_err(const mm_idx_t *mi, int qlen, int n_regs, mm_reg1_t *regs, const mm128_t *a, int32_t n, const uint64_t *mini_pos);
@@ -106,6 +125,8 @@ mm_seg_t *mm_seg_gen(void *km, uint32_t hash, int n_segs, const int *qlens, int
void mm_seg_free(void *km, int n_segs, mm_seg_t *segs);
void mm_pair(void *km, int max_gap_ref, int dp_bonus, int sub_diff, int match_sc, const int *qlens, int *n_regs, mm_reg1_t **regs);
void mm_jump_split(void *km, const mm_idx_t *mi, const mm_mapopt_t *opt, int32_t qlen, const uint8_t *qseq, mm_reg1_t *r, int32_t ts_strand);
FILE *mm_split_init(const char *prefix, const mm_idx_t *mi);
mm_idx_t *mm_split_merge_prep(const char *prefix, int n_splits, FILE **fp, uint32_t *n_seq_part);
int mm_split_merge(int n_segs, const char **fn, const mm_mapopt_t *opt, int n_split_idx);
+36 -3
View File
@@ -55,13 +55,15 @@ void mm_mapopt_init(mm_mapopt_t *opt)
opt->max_clip_ratio = 1.0f;
opt->mini_batch_size = 500000000;
opt->max_sw_mat = 100000000;
opt->cap_kalloc = 1000000000;
opt->cap_kalloc = 500000000;
opt->rank_min_len = 500;
opt->rank_frac = 0.9f;
opt->pe_ori = 0; // FF
opt->pe_bonus = 33;
opt->jump_min_match = 3;
}
void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
@@ -114,6 +116,14 @@ int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
mo->a = 1, mo->b = 4, mo->q = 6, mo->q2 = 26, mo->e = 2, mo->e2 = 1;
mo->min_dp_max = 200;
}
} else if (strcmp(preset, "lr:hqae") == 0) { // high-quality assembly evaluation
io->flag = 0, io->k = 25, io->w = 51;
mo->flag |= MM_F_RMQ;
mo->min_mid_occ = 50, mo->max_mid_occ = 500;
mo->rmq_inner_dist = 5000;
mo->occ_dist = 200;
mo->best_n = 100;
mo->chain_gap_scale = 5.0f;
} else if (strcmp(preset, "map-iclr-prerender") == 0) {
io->flag = 0, io->k = 15;
mo->b = 6, mo->transition = 1;
@@ -156,7 +166,7 @@ int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
mo->mid_occ = 1000;
mo->max_occ = 5000;
mo->mini_batch_size = 50000000;
} else if (strncmp(preset, "splice", 6) == 0 || strcmp(preset, "cdna") == 0) {
} else if (strcmp(preset, "splice") == 0 || strcmp(preset, "splice:hq") == 0 || strcmp(preset, "splice:sr") == 0 || strcmp(preset, "cdna") == 0) {
io->flag = 0, io->k = 15, io->w = 5;
mo->flag |= MM_F_SPLICE | MM_F_SPLICE_FOR | MM_F_SPLICE_REV | MM_F_SPLICE_FLANK;
mo->max_sw_mat = 0;
@@ -164,13 +174,31 @@ int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
mo->a = 1, mo->b = 2, mo->q = 2, mo->e = 1, mo->q2 = 32, mo->e2 = 0;
mo->noncan = 9;
mo->junc_bonus = 9;
mo->junc_pen = 5;
mo->zdrop = 200, mo->zdrop_inv = 100; // because mo->a is halved
if (strcmp(preset, "splice:hq") == 0)
if (strcmp(preset, "splice:hq") == 0) {
mo->noncan = 5, mo->b = 4, mo->q = 6, mo->q2 = 24;
} else if (strcmp(preset, "splice:sr") == 0) {
mo->flag |= MM_F_NO_PRINT_2ND | MM_F_2_IO_THREADS | MM_F_HEAP_SORT | MM_F_FRAG_MODE | MM_F_WEAK_PAIRING | MM_F_SR_RNA;
mo->noncan = 5, mo->b = 4, mo->q = 6, mo->q2 = 24;
mo->min_chain_score = 25;
mo->min_dp_max = 40;
mo->min_ksw_len = 20;
mo->pe_ori = 0<<1|1; // FR
mo->best_n = 10;
mo->mini_batch_size = 100000000;
}
} else return -1;
return 0;
}
int mm_max_spsc_bonus(const mm_mapopt_t *mo)
{
int max_sc = (mo->q2 + 1) / 2 - 1;
max_sc = max_sc > mo->q2 - mo->q? max_sc : mo->q2 - mo->q;
return max_sc;
}
int mm_check_opt(const mm_idxopt_t *io, const mm_mapopt_t *mo)
{
if (mo->bw > mo->bw_long) {
@@ -225,6 +253,11 @@ int mm_check_opt(const mm_idxopt_t *io, const mm_mapopt_t *mo)
fprintf(stderr, "[ERROR]\033[1;31m scoring system violating ({-O}+{-E})+({-O2}+{-E2}) <= 127\033[0m\n");
return -1;
}
if (mo->sc_ambi < 0 || mo->sc_ambi >= mo->b) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m --score-N should be within [0,{-B})\033[0m\n");
return -1;
}
if (mo->zdrop < mo->zdrop_inv) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m Z-drop should not be less than inversion-Z-drop\033[0m\n");
+7 -2
View File
@@ -8,7 +8,8 @@ void mm_select_sub_multi(void *km, float pri_ratio, float pri1, float pri2, int
if (pri_ratio > 0.0f && *n_ > 0) {
int i, k, n = *n_, n_2nd = 0;
int max_dist = n_segs == 2? qlens[0] + qlens[1] + max_gap_ref : 0;
for (i = k = 0; i < n; ++i) {
uint8_t *keep = (uint8_t*)kmalloc(km, n);
for (i = 0; i < n; ++i) {
int to_keep = 0;
if (r[i].parent == i) { // primary
to_keep = 1;
@@ -34,9 +35,13 @@ void mm_select_sub_multi(void *km, float pri_ratio, float pri1, float pri2, int
if (to_keep && r[i].parent != i) {
if (n_2nd++ >= best_n) to_keep = 0; // don't keep if there are too many secondary hits
}
if (to_keep) r[k++] = r[i];
keep[i] = to_keep;
}
for (i = k = 0; i < n; ++i) {
if (keep[i]) r[k++] = r[i];
else if (r[i].p) free(r[i].p);
}
kfree(km, keep);
if (k != n) mm_sync_regs(km, k, r); // removing hits requires sync()
*n_ = k;
}
+3 -3
View File
@@ -71,13 +71,13 @@ static inline void mm_reset_timer(void)
}
extern unsigned char seq_comp_table[256];
static inline mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char *seq1, const char *seq2, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt)
static inline mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char* seqname, const char *seq1, const char *seq2, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt)
{
mm_reg1_t *r;
Py_BEGIN_ALLOW_THREADS
if (seq2 == 0) {
r = mm_map(mi, strlen(seq1), seq1, n_regs, b, opt, NULL);
r = mm_map(mi, strlen(seq1), seq1, n_regs, b, opt, seqname);
} else {
int _n_regs[2];
mm_reg1_t *regs[2];
@@ -94,7 +94,7 @@ static inline mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char *seq1, const
seq[1][i] = seq_comp_table[t];
}
if (len[1]&1) seq[1][len[1]>>1] = seq_comp_table[(uint8_t)seq[1][len[1]>>1]];
mm_map_frag(mi, 2, len, (const char**)seq, _n_regs, regs, b, opt, NULL);
mm_map_frag(mi, 2, len, (const char**)seq, _n_regs, regs, b, opt, seqname);
for (i = 0; i < _n_regs[1]; ++i)
regs[1][i].rev = !regs[1][i].rev;
*n_regs = _n_regs[0] + _n_regs[1];
+6 -2
View File
@@ -36,9 +36,10 @@ cdef extern from "minimap.h":
float alt_drop
int a, b, q, e, q2, e2
int transition
int sc_ambi
int noncan
int junc_bonus
int junc_bonus, junc_pen
int zdrop, zdrop_inv
int end_bonus
int min_dp_max
@@ -51,6 +52,8 @@ cdef extern from "minimap.h":
int pe_ori, pe_bonus
int jump_min_match;
float mid_occ_frac
float q_occ_frac
int32_t min_mid_occ
@@ -109,6 +112,7 @@ cdef extern from "minimap.h":
void mm_tbuf_destroy(mm_tbuf_t *b)
void *mm_tbuf_get_km(mm_tbuf_t *b)
int mm_gen_cs(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int no_iden)
int mm_gen_ds(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int no_iden)
int mm_gen_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq)
#
@@ -128,7 +132,7 @@ cdef extern from "cmappy.h":
void mm_reg2hitpy(const mm_idx_t *mi, mm_reg1_t *r, mm_hitpy_t *h)
void mm_free_reg1(mm_reg1_t *r)
mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char *seq1, const char *seq2, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt)
mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char* seqname, const char *seq1, const char *seq2, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt)
char *mappy_fetch_seq(const mm_idx_t *mi, const char *name, int st, int en, int *l)
mm_idx_t *mappy_idx_seq(int w, int k, int is_hpc, int bucket_bits, const char *seq, int l)
+34 -13
View File
@@ -3,7 +3,7 @@ from libc.stdlib cimport free
cimport cmappy
import sys
__version__ = '2.27'
__version__ = '2.31'
cmappy.mm_reset_timer()
@@ -14,9 +14,9 @@ cdef class Alignment:
cdef int8_t _strand, _trans_strand
cdef uint8_t _mapq, _is_primary
cdef int _seg_id
cdef _ctg, _cigar, _cs, _MD # these are python objects
cdef _ctg, _cigar, _cs, _ds, _MD # these are python objects
def __cinit__(self, ctg, cl, cs, ce, strand, qs, qe, mapq, cigar, is_primary, mlen, blen, NM, trans_strand, seg_id, cs_str, MD_str):
def __cinit__(self, ctg, cl, cs, ce, strand, qs, qe, mapq, cigar, is_primary, mlen, blen, NM, trans_strand, seg_id, cs_str, ds_str, MD_str):
self._ctg = ctg if isinstance(ctg, str) else ctg.decode()
self._ctg_len, self._r_st, self._r_en = cl, cs, ce
self._strand, self._q_st, self._q_en = strand, qs, qe
@@ -27,6 +27,7 @@ cdef class Alignment:
self._trans_strand = trans_strand
self._seg_id = seg_id
self._cs = cs_str
self._ds = ds_str
self._MD = MD_str
@property
@@ -77,6 +78,9 @@ cdef class Alignment:
@property
def cs(self): return self._cs
@property
def ds(self): return self._ds
@property
def MD(self): return self._MD
@@ -96,6 +100,8 @@ cdef class Alignment:
a = [str(self._q_st), str(self._q_en), strand, self._ctg, str(self._ctg_len), str(self._r_st), str(self._r_en),
str(self._mlen), str(self._blen), str(self._mapq), tp, ts, "cg:Z:" + self.cigar_str]
if self._cs != "": a.append("cs:Z:" + self._cs)
if self._ds != "": a.append("ds:Z:" + self._ds)
if self._MD != "": a.append("MD:Z:" + self._MD)
return "\t".join(a)
cdef class ThreadBuffer:
@@ -112,7 +118,7 @@ cdef class Aligner:
cdef cmappy.mm_idxopt_t idx_opt
cdef cmappy.mm_mapopt_t map_opt
def __cinit__(self, fn_idx_in=None, preset=None, k=None, w=None, min_cnt=None, min_chain_score=None, min_dp_score=None, bw=None, bw_long=None, best_n=None, n_threads=3, fn_idx_out=None, max_frag_len=None, extra_flags=None, seq=None, scoring=None):
def __cinit__(self, fn_idx_in=None, preset=None, k=None, w=None, min_cnt=None, min_chain_score=None, min_dp_score=None, bw=None, bw_long=None, best_n=None, n_threads=3, fn_idx_out=None, max_frag_len=None, extra_flags=None, seq=None, scoring=None, sc_ambi=None, max_chain_skip=None):
self._idx = NULL
cmappy.mm_set_opt(NULL, &self.idx_opt, &self.map_opt) # set the default options
if preset is not None:
@@ -137,6 +143,8 @@ cdef class Aligner:
self.map_opt.q2, self.map_opt.e2 = scoring[4], scoring[5]
if len(scoring) >= 7:
self.map_opt.sc_ambi = scoring[6]
if sc_ambi is not None: self.map_opt.sc_ambi = sc_ambi
if max_chain_skip is not None: self.map_opt.max_chain_skip = max_chain_skip
cdef cmappy.mm_idx_reader_t *r;
@@ -162,7 +170,7 @@ cdef class Aligner:
def __bool__(self):
return (self._idx != NULL)
def map(self, seq, seq2=None, buf=None, cs=False, MD=False, max_frag_len=None, extra_flags=None):
def map(self, seq, seq2=None, name=None, buf=None, cs=False, ds=False, MD=False, max_frag_len=None, extra_flags=None):
cdef cmappy.mm_reg1_t *regs
cdef cmappy.mm_hitpy_t h
cdef ThreadBuffer b
@@ -181,31 +189,44 @@ cdef class Aligner:
if self._idx is NULL: return None
if buf is None: b = ThreadBuffer()
else: b = buf
km = cmappy.mm_tbuf_get_km(b._b)
_seq = seq if isinstance(seq, bytes) else seq.encode()
if name is not None:
_name = name if isinstance(name, bytes) else name.encode()
if seq2 is None:
regs = cmappy.mm_map_aux(self._idx, _seq, NULL, &n_regs, b._b, &map_opt)
if name is None:
regs = cmappy.mm_map_aux(self._idx, NULL, _seq, NULL, &n_regs, b._b, &map_opt)
else:
regs = cmappy.mm_map_aux(self._idx, _name, _seq, NULL, &n_regs, b._b, &map_opt)
else:
_seq2 = seq2 if isinstance(seq2, bytes) else seq2.encode()
regs = cmappy.mm_map_aux(self._idx, _seq, _seq2, &n_regs, b._b, &map_opt)
if name is None:
regs = cmappy.mm_map_aux(self._idx, NULL, _seq, _seq2, &n_regs, b._b, &map_opt)
else:
regs = cmappy.mm_map_aux(self._idx, _name, _seq, _seq2, &n_regs, b._b, &map_opt)
try:
i = 0
while i < n_regs:
cmappy.mm_reg2hitpy(self._idx, &regs[i], &h)
cigar, _cs, _MD = [], '', ''
cigar, _cs, _ds, _MD = [], '', '', ''
for k in range(h.n_cigar32): # convert the 32-bit CIGAR encoding to Python array
c = h.cigar32[k]
cigar.append([c>>4, c&0xf])
if cs or MD: # generate the cs and/or the MD tag, if requested
if cs or ds or MD: # generate the cs/ds and/or the MD tag, if requested
km = cmappy.mm_tbuf_get_km(b._b)
_cur_seq = _seq2 if h.seg_id > 0 and seq2 is not None else _seq
if cs:
l_cs_str = cmappy.mm_gen_cs(km, &cs_str, &m_cs_str, self._idx, &regs[i], _seq, 1)
l_cs_str = cmappy.mm_gen_cs(km, &cs_str, &m_cs_str, self._idx, &regs[i], _cur_seq, 1)
_cs = cs_str[:l_cs_str] if isinstance(cs_str, str) else cs_str[:l_cs_str].decode()
if ds:
l_cs_str = cmappy.mm_gen_ds(km, &cs_str, &m_cs_str, self._idx, &regs[i], _cur_seq, 1)
_ds = cs_str[:l_cs_str] if isinstance(cs_str, str) else cs_str[:l_cs_str].decode()
if MD:
l_cs_str = cmappy.mm_gen_MD(km, &cs_str, &m_cs_str, self._idx, &regs[i], _seq)
l_cs_str = cmappy.mm_gen_MD(km, &cs_str, &m_cs_str, self._idx, &regs[i], _cur_seq)
_MD = cs_str[:l_cs_str] if isinstance(cs_str, str) else cs_str[:l_cs_str].decode()
yield Alignment(h.ctg, h.ctg_len, h.ctg_start, h.ctg_end, h.strand, h.qry_start, h.qry_end, h.mapq, cigar, h.is_primary, h.mlen, h.blen, h.NM, h.trans_strand, h.seg_id, _cs, _MD)
yield Alignment(h.ctg, h.ctg_len, h.ctg_start, h.ctg_end, h.strand, h.qry_start, h.qry_end, h.mapq, cigar, h.is_primary, h.mlen, h.blen, h.NM, h.trans_strand, h.seg_id, _cs, _ds, _MD)
cmappy.mm_free_reg1(&regs[i])
i += 1
finally:
+7 -3
View File
@@ -5,7 +5,7 @@ import getopt
import mappy as mp
def main(argv):
opts, args = getopt.getopt(argv[1:], "x:n:m:k:w:r:c")
opts, args = getopt.getopt(argv[1:], "x:n:m:k:w:r:cdM")
if len(args) < 2:
print("Usage: minimap2.py [options] <ref.fa>|<ref.mmi> <query.fq>")
print("Options:")
@@ -16,10 +16,12 @@ def main(argv):
print(" -w INT minimizer window length")
print(" -r INT band width")
print(" -c output the cs tag")
print(" -d output the ds tag")
print(" -M output the MD tag")
sys.exit(1)
preset = min_cnt = min_sc = k = w = bw = None
out_cs = False
out_cs = out_ds = out_MD = False
for opt, arg in opts:
if opt == '-x': preset = arg
elif opt == '-n': min_cnt = int(arg)
@@ -28,11 +30,13 @@ def main(argv):
elif opt == '-k': k = int(arg)
elif opt == '-w': w = int(arg)
elif opt == '-c': out_cs = True
elif opt == '-d': out_ds = True
elif opt == '-M': out_MD = True
a = mp.Aligner(args[0], preset=preset, min_cnt=min_cnt, min_chain_score=min_sc, k=k, w=w, bw=bw)
if not a: raise Exception("ERROR: failed to load/build index file '{}'".format(args[0]))
for name, seq, qual in mp.fastx_read(args[1]): # read one sequence
for h in a.map(seq, cs=out_cs): # traverse hits
for h in a.map(seq, cs=out_cs, ds=out_ds, MD=out_MD): # traverse hits
print('{}\t{}\t{}'.format(name, len(seq), h))
if __name__ == "__main__":
+2 -1
View File
@@ -112,7 +112,8 @@ mm_seed_t *mm_collect_matches(void *km, int *_n_m, int qlen, int max_occ, int ma
}
for (i = 0, n_m = 0, *rep_len = 0, *n_a = 0; i < n_m0; ++i) {
mm_seed_t *q = &m[i];
//fprintf(stderr, "X\t%d\t%d\t%d\n", q->q_pos>>1, q->n, q->flt);
if (mm_dbg_flag & MM_DBG_SEED_FREQ)
fprintf(stderr, "SF\t%d\t%d\t%d\n", q->q_pos>>1, q->n, q->flt);
if (q->flt) {
int en = (q->q_pos >> 1) + 1, st = en - q->q_span;
if (st > rep_en) {
+2 -2
View File
@@ -23,7 +23,7 @@ def readme():
setup(
name = 'mappy',
version = '2.27',
version = '2.31',
url = 'https://github.com/lh3/minimap2',
description = 'Minimap2 python binding',
long_description = readme(),
@@ -33,7 +33,7 @@ setup(
keywords = 'sequence-alignment',
scripts = ['python/minimap2.py'],
ext_modules = [Extension('mappy',
sources = ['python/mappy.pyx', 'align.c', 'bseq.c', 'lchain.c', 'seed.c', 'format.c', 'hit.c', 'index.c', 'pe.c', 'options.c',
sources = ['python/mappy.pyx', 'align.c', 'bseq.c', 'lchain.c', 'seed.c', 'format.c', 'hit.c', 'index.c', 'pe.c', 'jump.c', 'options.c',
'ksw2_extd2_sse.c', 'ksw2_exts2_sse.c', 'ksw2_extz2_sse.c', 'ksw2_ll_sse.c',
'kalloc.c', 'kthread.c', 'map.c', 'misc.c', 'sdust.c', 'sketch.c', 'esterr.c', 'splitidx.c'],
depends = ['minimap.h', 'bseq.h', 'kalloc.h', 'kdq.h', 'khash.h', 'kseq.h', 'ksort.h',
+5
View File
@@ -0,0 +1,5 @@
mm2: TGTTATCCCTAGGGTAACTTGTTCCGTTGGTCAAGTTATTGGATCAATTGAGTATAGTAGTGCACTCAC......................................................................................................................................CACTTGGAGCCATTCATACAGGTCCCTATTTAAGGAACAAGTGATTATGCTACCTTTGCACGGTT
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
ref: TGTTATCCCTAGGGTAACTTGTTCCGTTGGTCAAGTTATTGGATCAATTGAGTATAGTAGTGCACTCACctGCTTCGCTTTGACTGGTGAAGTCTTAGCATGTACTGCTCGGAGGTTGGGTTCTGCTCCGAGGTCGCCCCAACCGAAATTTTTAATGCAGGTTTGGTAGTTTAGGACCTGTGGGTTTGTTAGGCTAACCTCacCACTTGGAGCCATTCATACAGGTCCCTATTTAAGGAACAAGTGATTATGCTACCTTTGCACGGTT
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
sta: TGTTATCCCTAGGGTAACTTGTTCCGTTGGTCAAGTTATTGGATCAATTGAGTATAGTAGTGCA......................................................................................................................................CTCACCACTTGGAGCCATTCATACAGGTCCCTATTTAAGGAACAAGTGATTATGCTACCTTTGCACGGTT
+5
View File
@@ -0,0 +1,5 @@
>query
AACCGTGCAAAGGTAGCATAATCACTTGTTCCTTAAATAGGGACCTGTATGAATGGCTCC
AAGTG
GTGAGTGCA
CTACTATACTCAATTGATCCAATAACTTGACCAACGGAACAAGTTACCCTAGGGATAACA
+10
View File
@@ -0,0 +1,10 @@
>ref
TGATCCAACATCGAGGTCGTAAACCCTATTGTTGATATGGACTCTAGAATAGGATTGCGC
TGTTATCCCTAGGGTAACTTGTTCCGTTGGTCAAGTTATTGGATCAATTGAGTATAGTAG
TGCACTCAC
ctGCTTCGCTTTGACTGGTGAAGTCTTAGCATGTACTGCTCGGAGGTTGGGTTCTGCTCC
GAGGTCGCCCCAACCGAAATTTTTAATGCAGGTTTGGTAGTTTAGGACCTGTGGGTTTGT
TAGGCTAACCTCac
CACTTGGAGCCATTCATACAGGTCCCTATTTAAGGAACAAGTGATTATGCTACCTTTGCA
CGGTTAGGGTACCGCGGCCGTTAAACATGTGTCACTGGGCAGGCGGTGCCTCTAATACTG
GTGAT