Compare commits

...
405 Commits
Author SHA1 Message Date
Heng Li 79c9cc186b Release minimap2-2.30 (r1287) 2025-06-15 17:54:11 -04:00
Heng Li ea4c8935bd added one more example
This shows STAR doesn't try to match the GTR..YAG consensus.
2025-06-03 20:22:14 -04:00
Heng Li 3187782b1a r1285: better --spsc support 2025-05-26 15:47:14 -04:00
Heng Li 005c9a1f6b exoneval may skip terminal exons in aa mode 2025-05-17 23:06:41 -04:00
Heng Li 1fd85be6e2 Release minimap2-2.29 (r1283) 2025-04-18 13:41:47 -04:00
Heng Li e616b0dacf drafted the release notes 2025-04-18 13:17:13 -04:00
Heng Li b58b97423a r1281: with --write-junc, ignore aln with low mapQ 2025-04-17 21:46:54 -04:00
Heng Li df9e650346 r1280: heuristic to avoid aligning full introns
This speeds up alignment a lot
2025-04-16 23:38:39 -04:00
Heng Li 7a540c37ca r1278: reduced --min-dp-len to 20 for splice:sr
30% reduced time at 0.01% more junction errors
2025-04-16 21:55:59 -04:00
Heng Li c19e3ccb86 r1277: don't apply rescored filtering with -P
Since v2.19-ish, minimap2 rescores base alignment based on the best alignment
of a read. This heuristic sometimes improve the mapping accuracy of the best
alignment but may too aggressively filter weaker hits.

Resolve #969
2025-04-14 22:26:47 -04:00
Heng Li 94d171b01e r1276: skip unnecessary reverse spliced alignment
for short-read RNA-seq only
2025-04-14 14:57:23 -04:00
Heng Li ff312a2957 documented 2-pass in README 2025-04-13 17:14:44 -04:00
Heng Li 01ccedd5a0 r1275: renamed --jump-pass1 to --pass1
Also documented 2-pass
2025-04-13 17:07:39 -04:00
Heng Li 819b3bf017 r1274: a little better pass-1
Also fixed a bug in jump
2025-04-13 13:55:15 -04:00
Heng Li e88110463a r1273: reading pass1 junctions works
but we need extra logic when using them. Tomorrow.
2025-04-13 00:47:28 -04:00
Heng Li fb81e150f2 r1272: support pass-1 junction processing
NOT tested yet
2025-04-12 23:15:04 -04:00
Heng Li d930ea94ad r1271: code refactoring in prep for 2-pass 2025-04-11 17:20:34 -04:00
Heng Li a832a42f6f r1270: fixed ts tag for PE reads
this also fixed the wrong --write-junc
2025-04-11 01:08:16 -04:00
Heng Li a5411fc3c0 r1269: added --write-junc
in preparation for 2-pass
2025-04-11 01:00:15 -04:00
Heng Li bd03d975fc r1268: avoid extra small introns 2025-04-07 23:32:56 -04:00
Heng Li 9c3c4b1ce8 r1267: penalize introns without signals 2025-04-07 09:51:33 -04:00
Heng Li 3542a3d153 r1266: fine tune mapq for short RNA-seq reads 2025-04-07 00:57:39 -04:00
Heng Li 75619c7b51 r1265: prefer spliced alignment
mapq needs to be elevated
2025-04-07 00:31:04 -04:00
Heng Li fbb9c0fcba r1264: added --jump-min-match, default to 3
To match STAR
2025-04-06 23:18:55 -04:00
Heng Li af094640e5 r1263: ~5-10% performance improvement
Via larger batches and more short-read heuristics. Identical alignment on 2
million reads. Short DNA-seq read alignment may be improved in corner cases.
2025-04-06 20:48:55 -04:00
Heng Li d43f356ef9 fixed minor grammar issues 2025-04-06 18:35:46 -04:00
Heng Li 38acd6617f r1261: code clean up; renamed --jump-bed to -j
Also added --pairing to replace --no-pairing and --pe-ind-chain
2025-04-06 18:32:58 -04:00
Heng Li 3d351267a0 document --jump-bed 2025-04-06 17:43:11 -04:00
Heng Li 54a4718c9b r1259: --jump-bed now functional 2025-04-06 17:12:49 -04:00
Heng Li dbc12b2838 r1258: update blen, mlen and dp_max0 2025-04-06 15:26:01 -04:00
Heng Li 2ed264db4e r1257: fixed the sorting of BED files 2025-04-06 10:53:16 -04:00
Heng Li a8094ad859 r1256: working for one example, but still buggy 2025-04-06 10:33:57 -04:00
Heng Li 1877818239 r1255: moved jump code to a separate file 2025-04-06 09:33:51 -04:00
Heng Li 9ede5c4255 backup 2025-04-06 00:07:15 -04:00
Heng Li 405511fe8d Merge branch 'master' into junc-jump 2025-04-04 16:37:39 -04:00
Heng Li dd90d9dde6 caution that the splice:sr is experimental 2025-04-04 16:34:40 -04:00
Heng Li a8c567b5e9 r1251: read junctions for jumps 2025-04-04 16:23:19 -04:00
Heng Li d9d3c0cc3f refactored --junc-bed 2025-04-03 21:02:50 -04:00
Heng Li cbe8d61ca4 r1249: remove redundant junctions in --junc-bed 2025-04-03 20:43:06 -04:00
Heng Li 9d06cef13e r1248: support --end-bonus in splice mode
but this is not enabled by default for now
2025-04-02 21:39:41 -04:00
Heng Li 924fc4d671 minor 2025-04-02 13:06:03 -04:00
Heng Li fc2d1e95b3 document splice:sr in README 2025-04-02 11:24:44 -04:00
Heng Li bbf0bb871b r1245: allow shorter hits for splice:sr 2025-04-02 00:13:37 -04:00
Heng Li 83e9b2e28c r1242: append /[12] to read name in --frag mode
Resolve #1079
2025-04-01 10:48:15 -04:00
Heng Li e816fd071c r1241: error out on unintended --score-N
Resolve #1226
2025-04-01 10:12:53 -04:00
Heng Li a955b1f31d documented zd; resolve #1108 2025-04-01 09:34:05 -04:00
Heng Li 54fa925e2e r1240: fixed wrong logging information
resolve #1192
2025-04-01 09:17:39 -04:00
Heng Li d4a396c5c3 r1239: resovled #963 2025-03-31 23:15:34 -04:00
Heng Li bdf46f5786 r1238: resolve #589 2025-03-31 23:08:37 -04:00
Heng Li f536b69b81 r1237: documented -x splice:sr 2025-03-30 21:47:47 -04:00
Heng Li 4b8b4418df r1236: support paired-end short-read RNA-seq 2025-03-30 19:30:19 -04:00
Heng Li ce30004e02 r1235: allow --splice and --frag at the same time
This seems to largely work, though the accuracy is reduced and no pairs are
proper. More investigation needed for practical uses.
2025-03-30 16:32:38 -04:00
Heng Li 54f8e5f7d6 r1234: added splice:sr for SE RNA-seq 2025-03-30 15:54:12 -04:00
Heng Li 2857de7dbd Merge remote-tracking branch 'remotes/origin/master' 2025-03-29 22:44:26 -04:00
Heng Li e18935fbad r1230: make juncevla work for paired-end SAM 2025-03-29 22:43:44 -04:00
Chang Y 74ebfb2532 fix error (#1223) 2025-03-21 18:21:15 -04:00
Martin Grigorov a0cbe2e4d2 Add CI job for Linux & Mac ARM64 too (#1205)
* Add CI job for Linux ARM64 too

Signed-off-by: Martin Tzvetanov Grigorov <mgrigorov@apache.org>

* Add build job for Mac ARM64 too

Signed-off-by: Martin Tzvetanov Grigorov <mgrigorov@apache.org>

* Pass "arm_neon=1 aarch64=1" when building on ARM64

Signed-off-by: Martin Tzvetanov Grigorov <mgrigorov@apache.org>

* change aarch64 to arm64 for the Mac ARM64 check

Signed-off-by: Martin Tzvetanov Grigorov <mgrigorov@apache.org>

---------

Signed-off-by: Martin Tzvetanov Grigorov <mgrigorov@apache.org>
2025-03-21 18:19:26 -04:00
Heng Li 618d33515e more condition on length differences 2024-11-17 19:45:46 -05:00
Heng Li a10d4f4496 merge colinear blocks 2024-11-17 15:17:13 -05:00
Heng Li 1eea2fee11 a new script to cluster similar sequences 2024-11-16 16:39:13 -05:00
Heng Li 1d346d56bc Merge remote-tracking branch 'remotes/origin/master' 2024-11-16 16:36:07 -05:00
Heng Li 46750de966 not working well and rarely used in practice 2024-11-16 16:35:24 -05:00
Leon Rauschning 7d8bbb74a8 Add sc_ambi and max_chain_skip parameters to mappy.pyx (#1240)
* add sc_ambi option to cython interface

* add max_gaplen param

* set max_chain_skip to arg instead of forcing 255
2024-11-15 08:56:36 -05:00
James Webber c6db201b38 Update README.md (#1245)
fixed documentation for paftools
2024-11-15 08:54:25 -05:00
Rob PatroandRob Patro 358a39850f Allow passing read name to mappy (#1260)
* Allow passing read name to mappy

This adds the (optional) ability to pass the read
name to the mappy `map` method.  Without the
read name, the call to `map` can sometimes give
different output than the command line version
of `minimap2` because of the way minimap uses
the hash of the read name to break ties in ordering
hits.  This can affect which / if certain
supplementary alignments are generated, and even
which / if non-primary alignments are generated.

* Pass name directly to mm_map_aux

Get rid of additional function, and always
accept the name parameter in the mm_map_aux
function (can be nullptr if not available).

---------

Co-authored-by: Rob Patro <rob@newton>
2024-11-15 08:51:10 -05:00
Heng Li fcb5d5e6eb r1221: warn about file reading errors
Resolves #1229
2024-10-15 22:44:06 -04:00
Heng Li 95807a2224 added "junc_pen" to python accordingly 2024-10-13 23:58:33 -04:00
Heng Li a4c93e9377 support X and = in mapeval 2024-10-12 23:31:17 -04:00
Heng Li 7d69334e69 Merge remote-tracking branch 'remotes/origin/master' 2024-10-12 23:28:38 -04:00
Heng Li 3e1ab2951d document --spsc 2024-10-12 23:27:46 -04:00
Heng Li 68179ed195 r1215: scoring apparently works 2024-10-12 22:29:27 -04:00
Heng Li d1f4c8d232 implemented ksw scoring; not tested 2024-10-11 23:58:18 -04:00
Heng Li 8efe83b744 fill the junction array
modifying ksw will be the next
2024-10-11 23:22:23 -04:00
Heng Li 042c8d4d71 added --junc-pen; it does nothing for now 2024-10-11 21:27:25 -04:00
Heng Li e4e1f7843b backup for spsc 2024-10-10 22:43:50 -04:00
Marcus Fedarko 69e3629916 Mention in man page that CIGAR strings in SA tags are approximate (#1213)
* Mention approx CIGAR strings in man page #724

* Fix FAQ typo
2024-05-22 15:58:33 -04:00
Heng Li 0cc3cdca27 ignore filtered SVs in sveval 2024-04-07 17:12:31 -04:00
Heng Li 8170693de3 Release minimap2-2.28 (r1209) 2024-03-27 10:57:17 -04:00
Heng Li e3d8c708ac r1208: reverted RMQ gap coefficient
Such that minimap2 can give the same alignment in other modes
2024-03-27 08:48:10 -04:00
Heng Li 119bdc6029 r1207: reduced cap_kalloc from 1G to 500M
This reduces the peak memory.
2024-03-20 15:53:12 -04:00
Heng Li 89d4d219cd r1206: enabled RMQ for lr:hqae
Also fixed a bug in determining inner_dist for RMQ. It should have no effect on
previous presets.
2024-03-20 15:29:54 -04:00
Heng Li f51ff1abac r1205: updated lr:hqae 2024-03-20 14:06:59 -04:00
Heng Li 27b254ed6f backup; DON'T USE!!! 2024-03-20 10:21:10 -04:00
Heng Li c881b14ba5 r1203: added preset lr:hqae 2024-03-20 00:25:57 -04:00
Heng Li f18dadb1c4 r1202: halved RMQ gap cost 2024-03-19 23:47:54 -04:00
Heng Li a83b8fe7cc r1201: renamed --dbg-seed-freq to --dbg-seed-occ 2024-03-19 21:53:09 -04:00
Heng Li c22bfe7722 r1200: added --rmq-inner and --dbg-seed-freq 2024-03-19 21:52:07 -04:00
Heng Li 12d441ea22 Merge remote-tracking branch 'origin/master' 2024-03-19 21:47:52 -04:00
Heng Li c7433c2811 r1197: sam2paf to output primary only 2024-03-19 21:47:31 -04:00
Joyjit Daw 5279377544 Fix MD generation check in SAM writing (#1181)
The existing logic checked for is_MD == 1, but
the function is called with a bitwise operator check
which does not evaluate to 1.
2024-03-19 19:20:21 -04:00
Heng Li acab05781e Merge remote-tracking branch 'remotes/origin/master' 2024-03-19 09:56:13 -04:00
Heng Li 98c23bc6d2 r1194: output NM in sam2paf 2024-03-19 09:55:16 -04:00
kojix2 9b0ff2418c Fix mm_mapopt_t in Mappy (#1177)
Add transition. Related to #1069
2024-03-13 22:15:46 -04:00
Heng Li b6762503a9 Release minimap2-2.27 (r1193) 2024-03-12 13:20:07 -04:00
Heng Li 9667468e89 NEWS draft 2024-03-11 22:46:47 -04:00
Heng Li ba60aac6f6 r1191: fixed wrong reverse() and revcomp()
due to k8 incompatibility. Resolves #1161
2024-03-11 22:09:01 -04:00
Heng Li fcd4df2a73 r1190: output unadjusted dp_max to ms:i
This was an oversight affecting v2.22+. The latest minimap2 ranks hits and
estimates mapping quality with an adjusted alignment score (see the minimap2
update paper). This score however is not calculated when there is only one hit.
As a result, the ms:i tag varies depends on other sequences in the reference
genome, which is confusing. This change lets minimap2 to output the unadjusted
score at ms:i. At present, the adjusted score is not outputted.

Resolves #1146
2024-03-11 17:19:13 -04:00
Heng Li 0efc886012 r1189: fixed an out-of-memory issue
Resolves #1166
2024-03-11 10:14:20 -04:00
Heng Li 940388f8e4 r1188: added --ds to output tag ds
Adapted from minigraph
2024-03-10 15:01:13 -04:00
Heng Li 23d2674c39 r1187: set stage for the ds tag; not added yet 2024-03-10 14:12:56 -04:00
Heng Li a12673611f Merge remote-tracking branch 'origin/master' 2024-03-10 13:49:30 -04:00
Heng Li 8140259974 r1183: added lr:hq; fixed transition
* Added the lr:hq preset suggested by Nanopore developers (#1127)
 * Fixed transition scoring. It did not work with presets.
 * Cleaned up preset documentation
2024-03-10 13:47:34 -04:00
blawrence-ont f3e59fc2a0 Avoid NULL pointer dereference (#1154)
If the allocated region is 0 bytes then it's unsafe to dereference it.

Fixes #1147.
2024-01-24 12:32:05 -05:00
Pesho Ivanov fc2e1607d7 Update paftools.js (#1145)
In mapeval "-Q INT" reports wrong alignments with mapQ>=INT, not with mapQ>INT
2024-01-03 09:06:08 -05:00
Heng Li bc588c0eeb r1182: improved paftools.js compatibility
Older k8/v8 can't use large memory. The previous change read large FASTA as
strings and might have problems. The new change tests k8 version.
2023-10-30 16:37:29 -04:00
Heng Li ab717023b6 reverted to the previous paftools.js 2023-10-30 16:24:18 -04:00
Heng Li 9506e7ac3f r1180: paftools.js call compatibility with k8-1.0 2023-10-28 15:54:37 -04:00
Heng Li ce03fbc275 Merge remote-tracking branch 'remotes/origin/master' 2023-10-24 09:53:51 -04:00
Heng Li 98a3aa1b39 document --secondary-seq in manpage
Resolve #1122
2023-10-24 09:52:39 -04:00
Donaim ae05f8485f Add bw_long option to mappy's Aligner class (#1124)
The Minimap2 behavior was found to handle sequences with large
deletions differently when upgraded from v2.17 to v2.26, causing
potential issues in projects mapping extensive deletions of ~1200 base
pairs. The originally suggested solution of setting `-r 500,500` was
observed to be partially non-applicable since the Python Wrapper,
`mappy`, only allowed manipulation of parameter `bw`.

In response to issue #1111, where this was originally reported,
this commit introduces a modification in the Python wrapper,
`mappy`. Until now, `mappy` only allowed manipulation of the `bw`
parameter, preventing the suggested fix of setting `-r 500,500`.

This commit introduces a modification in the Python wrapper to include
the `bw_long` option in the `Aligner` class. Consequently, both
parameters `bw` and `bw_long` can be manipulated, thereby allowing the
desired Minimap2 behavior encountered in version 2.17. As a result,
this patch ensures consistent handling of sequences containing large
deletions irrespective of the version upgrade."

Closes #1111
2023-10-24 09:23:06 -04:00
Aaron Darlingandkoadman ace990c381 Illumina Complete Long Read presets (#1069)
* Implements a transition-aware alignment scoring scheme and configuration presets for ICLR

* Fix to enable use of general scoring matrix in ksw as suggested by lh3

---------

Co-authored-by: koadman <>
2023-06-04 11:06:15 -04:00
Heng Li e28a55be86 Release minimap2-2.26 (r1175) 2023-04-29 12:21:09 -04:00
Heng Li f8d46a7a30 Revert #868 and use the old setup.py 2023-04-29 11:48:41 -04:00
Heng Li 4483f89ee5 Release minimap2-2.25 (r1173) 2023-04-25 12:44:52 -04:00
Heng Li f1b3c7ad06 added -ldl for asan on some linux 2023-04-25 11:14:15 -04:00
Heng Li 180faa3594 r1171: add operator priority explicit with ()
I can never remember the operator priority of & and &&
2023-04-21 11:09:07 -04:00
Mikhail KolmogorovandHeng Li 704fbc6f5c An option to output SEQ field for secondary alignment (#687)
* a new option --secondary-seq to output SEQ field for secondary alignments

* comments removed

* Fixed a conflict in #687

---------

Co-authored-by: Heng Li <lh3@me.com>
2023-04-21 11:06:13 -04:00
Heng Li fc24c8a348 r1169: improved kexpand compatibility 2023-04-21 10:53:23 -04:00
Chris Seymour e68d868806 use updated kalloc macros (#1051)
* use updated kalloc macros

* review

* get the reference

* store the reference

* last one
2023-04-21 10:45:53 -04:00
Alex Payne c3d461e22a mappy check index flags before mapping
mappy creates a CIGAR string by default (`-c` flag) and so is
incompatible with indexes that are created using the `--idx-no-seq`
flag.

The previous implementation of mappy did not check for the `MM_I_NO_SEQ`
flag and would seg fault when attempting to map a read or retrieve a
reference sequence from the index. This patch adds a check to both
`mappy.Aligner.seq` and `mappy.Aligner.map` and returns `None` if there
is no index sequences. I've chose `None` as this is inline with the
behaviour of mappy for reads that do not align/retreiving sequences that
aren't in the index, however it might be better to raise an exception so
that this error is distinct and can be communicated to the caller.
2023-04-19 21:49:58 -04:00
Heng Li c41518ae85 r1166: sync kalloc with miniwfa and miniprot 2023-04-19 21:38:47 -04:00
Chris Seymour 819d843e3c make mm_tbuf_t public 2023-04-19 21:32:23 -04:00
Heng Li 5e7242303c r1164: changed the syntax of -J 2023-04-07 22:54:33 -04:00
Heng Li a026c69b89 r1163: increased the default -I to 8G
To reduce accidental errors when mapping against diploid human assemblies.
2023-04-07 01:22:22 -04:00
Heng Li ea2042a577 r1162: fixed a typo; also increased splice pen
Now slightly better on ISO-seq
2023-04-07 01:19:18 -04:00
Heng Li 1834b1fd42 r1161: merged the simple and complex models 2023-04-06 23:42:50 -04:00
Heng Li 7ced0f16a0 r1160: splice model code cleanup 2023-04-06 23:32:06 -04:00
Heng Li 35732f3025 Merge branch 'master' into splice-model 2023-04-06 21:09:18 -04:00
Alberto Zeni a6fab118c5 Fixed alignment result final update when computing the exact max value 2023-04-06 21:05:24 -04:00
Chris Seymour 6ce0dd8b70 move MM_VERSION define to minimap.h 2023-03-17 20:58:43 +01:00
Nils Homer 1d3c3eef03 Add HD header ilne to SAM output
#905
2023-02-14 09:12:03 -05:00
Heng Li 01b98e8e52 r1155: fixed a bug on parsing --rmq
resolves #1010
2023-01-17 09:09:25 -05:00
Heng Li 16b8d50199 removed debugging code 2023-01-06 11:16:09 -05:00
Heng Li 226fd6114c fixed a wrong comment. Resolves #997 2022-11-30 09:22:39 -05:00
Heng Li 822ccd1733 r1152: evaluate base Sn and Sp 2022-11-01 21:58:45 -04:00
Heng Li f67849c9af r1151: added exoneval 2022-11-01 21:10:35 -04:00
Heng Li b0b199f503 r1150: the prev impl counted one less submer 2022-10-21 21:00:22 -04:00
Heng Li c2f07ff2ac r1149: implemented random open syncmer
On the mm2-update dataset, -j8 leads to sparser k-mer selection at higher
accuracy. The speed becomes a little slower. There seems a benefit but not a
big one.
2022-10-21 19:07:28 -04:00
Heng Li cefd0d9f6c removed -b0 (a typo) 2022-10-21 17:37:04 -04:00
Heng Li 2a319c89aa support ##PAF lines in GFF3 2022-10-07 19:34:25 -04:00
Heng Li 85a5260408 correctly parse ##PAF lines in GFF3 (for miniprot) 2022-10-07 19:33:27 -04:00
Heng Li 6c2cbf7903 miniprot-like splice model
slightly worse on iso-seq and slightly better on direct-RNA
2022-10-06 09:10:17 -04:00
Heng Li 5aa4355ca8 extract junctions from GFF 2022-09-21 12:57:40 -04:00
Heng Li 6ed7263670 junceval for plain junction BED as input 2022-09-10 23:18:08 -04:00
Heng Li 315795eefd skip unmapped lines 2022-09-10 08:48:57 -04:00
Heng Li fc6869a9e8 r1141: junceval to support miniprot output 2022-09-09 16:28:23 -04:00
Heng Li 6252e5e367 sync with tag changes in miniprot 2022-09-09 14:48:17 -04:00
Heng Li 843729df1e output CDS and stop_codon 2022-09-09 12:09:38 -04:00
Heng Li 195c98fa46 output dist from end instead 2022-09-08 23:35:48 -04:00
Heng Li a2e6659d9b output more info 2022-09-08 23:18:13 -04:00
Heng Li e450f161bb added paf2gff 2022-09-08 22:33:21 -04:00
Heng Li 15cade0f06 added longcs2fa 2022-07-18 22:24:48 -04:00
Heng Li 767556b6f0 clarify multi-part index in option -I (#301) 2022-06-13 15:50:15 -04:00
Heng Li 50a26a60a6 option to keep Ensembl_canonical only 2022-05-14 11:18:06 -04:00
Heng Li 31de4fd1bc r1132: document misjoin output
Also additional check of centromeric breakpoints
2022-05-11 21:39:29 -04:00
Heng Li e018caea32 added the second minimap2 paper 2022-03-01 11:05:09 -05:00
Heng Li 7c02742fa8 removed travis CI 2022-03-01 11:01:13 -05:00
Chris Wright a41f5d1eeb Fix indentation 2022-03-01 10:41:01 -05:00
Chris Wright ed3d0eb328 fix undefined variable 2022-03-01 10:41:01 -05:00
Chris Wright e6d166a314 Build mappy via Makefile and libminimap2.a 2022-03-01 10:41:01 -05:00
Heng Li 06fedaadd0 typo on simde 2021-12-26 15:38:06 -05:00
Heng Li fe35e679e9 Release minimap2-2.24 (r1122) 2021-12-26 15:14:54 -05:00
Heng Li e25aa5ee74 r1121: change bw_long to bw if bw is longer
Resolve #852
2021-12-26 14:37:31 -05:00
Heng Li 3bde3450a0 r1121: updated obsolete settings in manpage
Resolve #851
2021-12-26 14:33:14 -05:00
Heng Li 36942ff711 r1119: fixed a typo in the new chaining code
Not affecting v2.23
2021-12-25 12:46:26 -05:00
Heng Li d3a89d34d4 r1118: use -r1k,100k for asm* modes 2021-12-23 20:43:54 -05:00
Heng Li c8f0a35c40 r1117: added --no-hash-name for deterministic 2021-11-24 16:49:48 -05:00
Heng Li fcaadc22b7 r1116: cut long chains at weak points 2021-11-20 19:07:44 -05:00
Heng Li db37fc43a7 r1115: prepare for chain breaking 2021-11-20 13:42:44 -05:00
Heng Li a8f1fa8ea3 r1114: retain more candidate inversion alignments 2021-11-18 21:37:10 -05:00
Heng Li b276772890 r1112: added --print-chains for debugging 2021-11-18 21:26:41 -05:00
Heng Li d0cff3eb36 Release minimap2-2.23 (r1111) 2021-11-18 17:11:48 -05:00
Heng Li ac334639ce r1110: default --cap-kalloc=1g; test more inv
See #816 and #823
2021-10-11 14:45:15 -04:00
Heng Li 546623dcb4 r1109: disable chain_skip_scale by default
Enabling the option slows down alignment, possibly because it fragments chains
in difficult regions.
2021-10-04 21:24:35 -04:00
Heng Li 39bdd45875 r1108: fixed missing inversions for #816 and #806 2021-10-04 16:34:30 -04:00
Heng Li aefa2c0d86 added --chain-skip-scale 2021-10-01 16:58:03 -04:00
Heng Li 7ee62dae1d updated manuscript 2021-10-01 11:42:36 -04:00
Heng Li 05a8a45d44 r1105: avoid long running time occasionally (#771)
Caused by highly repetitive minimizers on a query sequence. The solution is to
filter out these query minimizers.
2021-08-15 19:43:01 -04:00
Heng Li cc14d1afdf fixed typos 2021-08-08 11:18:02 -04:00
Heng Li bb3048b2a0 removed one extra sentence 2021-08-07 16:55:02 -04:00
Heng Li 5113ca2628 improved manuscript 2021-08-07 16:01:15 -04:00
Heng Li 7358a1ead1 Release minimap2-2.22 (r1101) 2021-08-07 11:30:31 -04:00
Heng Li 32f552957e Merge remote-tracking branch 'remotes/origin/master' 2021-08-07 10:40:02 -04:00
Heng Li a05edfa5ec a different ending sentence 2021-08-07 10:38:48 -04:00
Heng Li 8e81145817 finished the first draft 2021-08-07 00:33:31 -04:00
Heng Li e37f5ffe39 finished results 2021-08-07 00:06:28 -04:00
Heng Li 8a1d52bcbe r1094: for --split-prefix update max_dp at the end 2021-08-06 21:40:43 -04:00
Heng Li f7271a7c24 expose mapQ threshold to command line of pafcmp 2021-08-06 19:41:46 -04:00
Heng Li 70393eb46e minimap2 update manuscript 2021-08-06 19:41:17 -04:00
Heng Li 9d049f0562 added pafcmp 2021-08-05 12:41:21 -04:00
Heng Li 5180b70ff3 r1090: log wall-clock time for each read 2021-08-04 17:45:09 -04:00
Heng Li 2392e54fe2 r1089: fixed an unusual memory leak (#749)
This is more apparent when there are many candidate chains. Although only a
small numbers of them are extended, they are still occupying memory. A
realloc() solves this problem. This is a long existiing issue.
2021-08-04 17:07:00 -04:00
Heng Li 629c11728e output the number of mismatches 2021-08-04 17:05:06 -04:00
Ryan Lim 59488f0271 call mm_idx_destroy at the end of loop to fix memory leak 2021-07-26 18:25:08 -04:00
Heng Li 7e33fde82b dev-r1087: added --cap-kalloc 2021-07-19 21:20:04 -04:00
Heng Li c4fe52fb07 reduced the default -l and -b 2021-07-19 17:25:11 -04:00
Heng Li ead1cfbaca output for binning 2021-07-19 14:56:33 -04:00
Heng Li 83a535f148 dev-r1084: fixed flag integer overflow 2021-07-19 11:52:18 -04:00
Heng Li f3af29a8aa don't add a new command 2021-07-19 10:57:48 -04:00
Heng Li cf7eaef367 refactor and prepare for a new command 2021-07-19 00:36:17 -04:00
Heng Li 2411887d8e rename 2021-07-19 00:30:16 -04:00
Heng Li 1a8373bb84 dev-r1080: fixed negative dp_max 2021-07-18 21:07:14 -04:00
Heng Li 161ae7ff73 dev-r1079: per-read error rate
more tuning needed
2021-07-18 20:38:53 -04:00
Heng Li 8a6edab847 dev-r1078: decoupling ranking penalty 2021-07-18 16:22:48 -04:00
Heng Li 15118dd521 output #mismatches/#dels/#ins in view 2021-07-18 15:13:40 -04:00
Heng Li 2546999639 dev-r1076: log gap penalty 2021-07-17 18:23:59 -04:00
Heng Li 52fafe0fed updated pbsim to pbsim2 2021-07-17 18:18:26 -04:00
Heng Li 5f449c5cae fixed potential integer overflows 2021-07-16 17:20:05 -04:00
Heng Li b046052d82 Merge branch 'master' into utec 2021-07-16 13:32:47 -04:00
Jason Stajich 5cc3d2239f missing target object files from Makefile.simde to fix issue #779 2021-07-07 23:07:27 -04:00
Heng Li 581f2d7123 Release minimap2-2.21 (r1071) 2021-07-06 13:18:55 -04:00
Heng Li 52dbd439bc r1080: re-versioning 2021-07-02 20:26:13 -04:00
John Marshall 260a68d232 Use #defines for CIGAR operators in C code
Give the CIGAR constants names to clarify the code. So that ksw2.h
remains self-contained, define KSW_* versions of the CIGAR operators
it needs for use within ksw2.h. Other code should in general use the
full set of MM_CIGAR_* constants in minimap.h.
2021-07-02 13:03:03 -04:00
John Marshall 177eef259d Use the full MIDNSHP=X string whenever printing CIGAR strings
Define MM_CIGAR_STR to the full string of CIGAR operators (including
the 'B' operator as well) and use it throughout the C code.

It would be possible to use it from the Cython code too, but it's easier
to keep that as a Cython string literal to avoid adding extra runtime
code to handle locale conversion.
2021-07-02 13:03:03 -04:00
Heng Li 459ce04c84 r1069: fixed a regression in comparison to v2.18
for PE short reads. An interesting omission. Resolves #776
2021-07-02 11:45:21 -04:00
Heng Li e6cce019e4 r1068: fixed a bug caused by 3f71478
Resolves #752 (again)
2021-06-30 19:20:06 -04:00
Heng Li 7025b0b941 Merge branch 'master' of github.com:lh3/minimap2 2021-06-16 10:18:40 -04:00
Heng Li fe6a0bb337 r1064: fixed another uninitialized condition
This one should also be harmless. It affects a min value, but that value is not
actually used.
2021-06-16 10:16:36 -04:00
Heng Li 3f7147864b r1063: fixed an uninitialized access (#752)
This one is harmless.
2021-06-16 09:27:30 -04:00
Torsten Houwaart c83589b9ea Update README.md
Clarification on approximate mapping
2021-06-10 09:36:39 -04:00
Heng Li ce7a59f412 Fixed a typo in README
I just hate my butterfly keyboard!
2021-05-27 15:43:04 -04:00
Heng Li 15471bd629 Release minimap2-2.20 (r1061) 2021-05-27 15:26:04 -04:00
Heng Li ca19463268 r1060: safer ways to use -rNUM1,NUM2 2021-05-27 10:55:13 -04:00
Heng Li 4f8d1bc360 r1059: with --rmq, use the larger bandwidth 2021-05-26 23:01:49 -04:00
Heng Li 1776c0c645 missing seed.c in setup.py
Ok, I am not going to re-release again...
2021-05-26 21:36:09 -04:00
Heng Li 9febf532c1 Release minimap2-2.19 (r1057) 2021-05-26 21:23:42 -04:00
Heng Li cec23131e4 fixed a python compilation error
Caused by chain.c -> lchain.c
2021-05-26 21:20:48 -04:00
Heng Li ef09ccf104 Release minimap2-2.19 (r1055) 2021-05-26 21:01:03 -04:00
Heng Li e74dfd1aa9 r1054: fixed a memory leak 2021-05-26 12:32:04 -04:00
Heng Li f31705bb4a r1053: made junceval work with PAF 2021-05-26 11:54:46 -04:00
Heng Li 41d7ccb191 r1052: default -g to 5k 2021-05-24 16:46:16 -04:00
Heng Li 34a41197d7 r1051: added two internal parameters
rmq_rescue_size and rmq_rescue_ratio
2021-05-24 16:38:45 -04:00
Heng Li 9626b3e716 r1050: -r accepts two bandwidths 2021-05-24 16:29:21 -04:00
Heng Li 379728726a r1049: removed the long-join heuristics 2021-05-24 16:21:40 -04:00
Heng Li 4f91558160 r1048: rescue long gaps 2021-05-24 16:09:09 -04:00
Heng Li ec3bc6efd7 r1047: make gap penalty proportional to k-mer
closer to the older minimap2
2021-05-24 13:18:17 -04:00
Heng Li 8ec8866100 Merge branch 'master' into dev-rmq 2021-05-23 21:01:04 -04:00
Heng Li 9e7247cff9 sync python with recent changes 2021-05-23 21:00:15 -04:00
Ariel Erijman cd66777bfb small typo 2021-05-23 13:09:55 -04:00
Heng Li 5d7d25e92d Merge remote-tracking branch 'origin/master' 2021-05-23 13:08:52 -04:00
Heng Li 2a3793bbd2 clarify that map-hifi is for HEAD only
Resolves #747
2021-05-23 13:08:15 -04:00
Heng Li f97008a10e Merge branch 'master' into dev-rmq 2021-05-20 19:36:33 -04:00
Cornelius Roemer 10502e2a78 Fixed typo in Readme.md
deltion -> deletion
2021-05-14 15:38:30 -04:00
Don Kirkby 4422c0c6f9 Typo fix in Python README.
Thanks for sharing minimap2. Here's a little fix.
2021-05-14 15:38:12 -04:00
Heng Li 42a11e1d58 Changed Travis to Github Actions in README 2021-05-10 12:58:25 -04:00
Heng Li 76df351fa8 added github action 2021-05-10 12:55:58 -04:00
Heng Li d065d3bead Merge branch 'master' into dev-rmq 2021-05-10 12:42:57 -04:00
Heng Li ac146fe7bc r1035: failed to index under the --frag=yes mode
Resolves #734
2021-05-10 12:36:48 -04:00
Heng Li 6c96078ed0 r1034: changed multiple defaults; updated manpage 2021-05-03 22:51:34 -04:00
Heng Li bbb4f97e52 support RMQ 2021-05-03 09:27:04 -04:00
Heng Li b7f4d8a0f4 removed the old minimap2 chaining 2021-05-02 18:55:37 -04:00
Heng Li e81927e7a1 prepare to backport unimap/minigraph chaining 2021-05-02 18:25:49 -04:00
Heng Li f7dc5799c5 clarify CLR when necessary 2021-05-01 15:56:33 -04:00
Heng Li 817cb81cb0 Updated README for the HiFi preset 2021-05-01 15:47:25 -04:00
Heng Li 0f5608c4a4 r1028: backport minigraph -U 2021-05-01 15:41:39 -04:00
Heng Li e8823a3709 r1027: renamed hifi to map-hifi; changed default 2021-05-01 15:22:51 -04:00
Heng Li 7edeec67b0 r1026: fixed bugs in seed sampling add hifi 2021-05-01 15:07:56 -04:00
Heng Li feb92d32ea r1025: seed rescuring 2021-04-30 17:33:16 -04:00
Heng Li cdbd96be0c a bit refactoring for future changes 2021-04-30 11:24:53 -04:00
Heng Li ba52c79024 added code of conduct 2021-04-22 17:30:30 -04:00
Heng Li cd9ccfa069 r1022: check INDEL lengths in simple cases 2021-04-11 22:07:00 -04:00
Heng Li 86b716448c larger window size for longer INDELs 2021-04-11 16:08:29 -04:00
Heng Li 9ab95be1bb update END when it is not there 2021-04-11 12:59:21 -04:00
Heng Li b51e859945 make sure ins/del match 2021-04-11 11:47:14 -04:00
Heng Li a9037dc16c r1018: scripts for SV evaluation 2021-04-11 01:08:17 -04:00
Heng Li 9729fa99ad removed mappy.c 2021-04-09 13:48:16 -04:00
Heng Li b6ff332de1 Release minimap2-2.18 (r1015) 2021-04-09 13:33:34 -04:00
Heng Li 77abafaaf3 prepare for release 2021-04-09 13:18:56 -04:00
Heng Li 507d39af15 r1013: changed to a more accurate similarity est
Based on DOI:10.1101/2021.01.15.426881. One minimap2 reviewer suggested the
right formula to me but I thought the difference would be insignificant. I was
wrong.
2021-04-08 13:57:53 -04:00
Heng Li 827ca4b461 r1012: fixed an off-by-one bug; resolves #489 2021-04-07 23:31:31 -04:00
Marcus Stoiber d3dde2fdd4 Convert from spaces to tabs. 2021-04-05 11:55:10 -04:00
Marcus Stoiber 7db2e8d21a Convert python install from build_ext to setuptools setup_requires. 2021-04-05 11:55:10 -04:00
Heng Li 0b41dd26a2 r1009: fixed a compiler warning 2021-04-05 11:43:13 -04:00
Heng Li 2b47846cd6 r1008: don't parse space in BED 2021-04-05 11:41:00 -04:00
Heng Li 67dd906a80 bump travis python version to 3.9 2021-03-23 09:12:49 -04:00
Heng Li 1b0bb7b0ba require overlap ratio when considering centromere 2021-03-11 19:11:44 -05:00
Heng Li 1c4b7e8a48 explained --junc-bed in README 2021-03-06 19:44:24 -05:00
Heng Li ecbc399fa2 improved sveval 2021-03-06 19:44:13 -05:00
Heng Li 4dfd495cc2 added sveval 2021-02-15 14:49:36 -05:00
Heng Li 194b457e79 option to print errors only 2021-02-07 12:58:03 -05:00
Heng Li 75c8933511 evaluate large-scale misjoins 2021-02-07 12:34:13 -05:00
Heng Li 1025993469 print number of errors on each read 2021-01-29 14:08:21 -05:00
Heng Li a3253d1a6b added a command for simple VCF statistics 2021-01-14 12:24:38 -05:00
Heng Li 2da649d1d7 Merge remote-tracking branch 'origin/master' 2020-11-15 18:47:15 -05:00
Heng Li f995f55610 added --mask-len for #659 2020-08-21 11:12:50 -04:00
Armin Töpfer c9874e2dc5 Initialize r->p if ez->zdropped 2020-06-12 09:22:18 -04:00
Heng Li 28a37a017a added utg error correction 2020-05-01 00:45:05 -04:00
Heng Li ccb0f7b05d added a new Makefile for simde 2020-04-25 22:43:29 -04:00
mbrcic 66db9da7d8 changed preprocessor conditionals for SIMDe 2020-04-22 19:50:59 +02:00
Heng Li cd2b19035b r987: position on for strand wrongly outputted 2020-04-22 10:31:25 -04:00
Heng Li 9c0e2c67f8 r986: don't estimate dv with --qstrand 2020-04-21 13:21:03 -04:00
Heng Li da7109fd29 r985: optionally report cs/cg on the query strand
PAF only; not well tested
2020-04-21 12:37:35 -04:00
mbrcic 2b3403f094 fix for Neon after test. 2020-04-21 02:08:21 +02:00
mbrcic 3e16e4e39d Added documentation entry for added functionality, simde and no_simd. 2020-04-21 01:36:19 +02:00
mbrcic f47e8a525e SIMDe made optional. Include paths changes for SIMDe. 2020-04-21 01:08:32 +02:00
mbrcic c172df7d2d fix for Neon 2020-04-20 21:14:15 +02:00
mbrcic 9e6fdd376b Changed sse2neon with SIMDe. Added building non-SIMD version. 2020-04-20 18:28:06 +02:00
Heng Li 29f67a1666 r982: more accurate sum; output errors 2020-04-14 16:18:53 -04:00
Heng Li adde608a42 Merge remote-tracking branch 'refs/remotes/origin/master' 2020-04-14 15:52:57 -04:00
Heng Li f10dff78dc r981: asmgene to check duplicate genes 2020-04-14 15:52:36 -04:00
Jun Aruga d97bba9f27 travis: added arm64 test. 2020-04-13 08:33:03 -04:00
Heng Li 50775362bb r980: support auNGA 2020-04-10 21:36:59 -04:00
Heng Li 0a5e386359 r979: fixed asmgene wrong report. Resolves #581. 2020-04-06 19:57:15 -04:00
Heng Li cb56fb762a Merge branch 'master' of github.com:lh3/minimap2 2020-03-22 19:17:01 -04:00
Heng Li e2451e497a r975: asmstat without CIGAR/NM 2020-03-22 19:16:43 -04:00
Jared Simpson d2de282d21 remove second definition of kstring 2020-03-02 13:18:37 -05:00
Jared Simpson 48cb80ea94 change kstring_t integer storage size
This is for compatibility with kstring_t in htslib.
2020-02-28 09:35:51 -05:00
Heng Li 6a4b9f9082 r974: more informative msg on wrong FASTQ records
Resolves #510
2020-01-21 10:56:59 -05:00
Heng Li a7a01fe5bd r973: fixed compiling errors caused 2020-01-21 10:43:31 -05:00
Heng Li 9dceae59a0 r972: renamed --alt-diff to --alt-drop 2020-01-21 10:33:39 -05:00
Heng Li 20a3987082 Merge branch 'master' into alt 2020-01-21 09:17:50 -05:00
Heng Li eb3ed6993d support ALT mapping 2020-01-21 09:17:50 -05:00
Heng Li 7996f04008 r972: fixed negative de:f caused by ambiguous base 2020-01-21 09:14:37 -05:00
Heng Li d2e14705e7 r968: allow large mini_batch; resolves #491 2020-01-18 12:24:44 -05:00
Heng Li 24f50f38e8 r967: no duplicated @SQ lines with --split-prefix
resolves #527 and #400
2020-01-18 12:01:28 -05:00
Heng Li 04e015d803 r966: minimap2 returns 1 on file failure (#532) 2020-01-18 10:58:59 -05:00
Heng Li 040f74102c r965: added --chain-gap-scale for #540 2020-01-18 10:29:33 -05:00
Heng Li cdb7857841 r963: --junc-bonus not working; resolves #513 2020-01-06 22:03:50 -05:00
Heng Li 3c0d05d272 r962: abort given wrong RG line; resolves #541 2020-01-06 21:53:21 -05:00
Heng Li 47b646acbf r961: print indexed length 2020-01-06 21:13:33 -05:00
Heng Li a79cb3e991 Merge remote-tracking branch 'origin/master' 2019-12-23 17:33:56 -05:00
Heng Li 367aed4271 added the asan and tsan targets to Makefile 2019-12-23 17:33:10 -05:00
xdudiagnoa 081df6ac7d Fix example.c seq read logic
for every idx should map all input seqs
2019-11-11 00:46:07 -05:00
Torsten Seemann a3e7a575fb Add splice:hq to --help 2019-11-11 00:45:13 -05:00
Heng Li d90583b83c r954: fixed two potential undef behaviors (#443) 2019-07-18 09:17:08 -04:00
Heng Li 7fc03b0c32 r953: krealloc is buggy
Its use in minimap2 didn't trigger the bug, so the older minimap2 is still ok.
2019-07-18 09:13:30 -04:00
John Marshall 20c104ce8d Report errno on file opening failures and I/O errors
Add the underlying operating system error (usually "No such file" or
"Out of space" respectively, but highly informative when it is not)
to these error messages.
2019-07-17 09:04:02 -04:00
Marcus Stoiber 238b6bb3ea Fix memory leak in mappy.aligner.map. 2019-07-08 09:50:54 -04:00
Heng Li e026e18439 added the description of "SA" tag. Closes #438 2019-07-01 09:18:33 -04:00
Heng Li 58c2251b18 compatibility with GenBank GTP (resolves $422) 2019-06-11 09:16:03 -04:00
Heng Li 03dc8d5d97 test if index is built for #413 2019-06-07 09:11:11 -04:00
Heng Li 5cb61f8ee6 added FAQ 2019-06-06 10:47:33 -04:00
Heng Li c16a1742a3 Er... Tavis doesn't have python 3.7. 2019-05-11 20:06:48 -04:00
Heng Li 4bd5a018c2 test python 3.7 instead of 3.6 2019-05-11 20:05:06 -04:00
Heng Li 05974c80f1 r943: allow long ref name for --split-index
Resolved #394.
2019-05-10 15:39:41 -04:00
Heng Li 7bc87b4175 Release minimap2-2.17 (r941) 2019-05-04 23:49:17 -04:00
Heng Li 6762368cf0 r940: added the splice:hq preset
for high-quality CCS/mRNA splice alignment
2019-05-04 14:00:31 -04:00
Heng Li c2aec88b84 r938: added --sam-hit-only; resolved #377 2019-04-30 22:40:36 -04:00
Heng Li 97f67a2a0a r937: enlarge mm_mapopt_t::flag to 64 bits 2019-04-30 22:30:32 -04:00
Heng Li 189555503a potentially fix issue #372
Needs someone to confirm
2019-04-30 21:49:51 -04:00
Heng Li 69af86657e r935: fixed a cigar like 5I6D7I; resolved #392 2019-04-30 21:35:24 -04:00
Heng Li 49c6d83a8e r934: --junc-bed to read BED12 2019-04-28 20:12:28 -04:00
Heng Li f64e426a5a r933: resume versioning 2019-04-28 17:05:37 -04:00
Heng Li 2bb8cbbeef updated manpage 2019-04-28 17:02:49 -04:00
Heng Li e80759c97a --junc-bed apparently working
Also fixed an issue with splice alignment in the reverse strand, though this
should have a very minor effect in practice.
2019-04-28 16:47:12 -04:00
Heng Li f4c844b143 fixed a few simple bugs and leaks 2019-04-28 16:47:12 -04:00
Heng Li be171aa2dc implemented in exts; testing is the next 2019-04-28 16:47:12 -04:00
Heng Li cdc730d573 gff2bed to output junction BED 2019-04-28 16:47:12 -04:00
Heng Li 6420acca6d BED I/O 2019-04-28 16:47:12 -04:00
John Marshall 371bc9513a SAM TLEN should be 0 when either read is unmapped
this_rid/this_pos will be copied from r_prev(=r_next)'s values when this
read is unmapped (i.e., r is NULL). In this case, we can write RNEXT as
'=' but should not calculate TLEN from these placeholder values.
Similarly when the mate is unmapped (i.e., r_next is NULL).

Fixes #365.
2019-04-05 09:36:46 -04:00
Heng Li 169216bfff manpage was wrongly marked as "dirty" 2019-02-28 15:58:12 -05:00
Heng Li 6b391e3373 Release minimap2-2.16 (r922) 2019-02-28 15:49:24 -05:00
Heng Li 55e39c2d30 r921: output unmapped reads in full PAF 2019-02-27 15:03:19 -05:00
Kevin Chan 90b7b83ec7 fix typo in command line help 2019-02-27 14:46:57 -05:00
Heng Li d431dc0181 r917: added --max-chain-iter to avoid worst case
Resolves #324
2019-02-27 14:41:01 -05:00
Heng Li ccf1680aaf make it explicit that -x is preferred for prebuilt 2019-02-27 12:43:33 -05:00
Heng Li ea84fc0a53 r917: fixed a bug in command-line parsing
Resolves #344
2019-02-27 11:22:58 -05:00
Heng Li 19208fb06b r916: support long cs in sam-to-paf conversion 2019-02-17 09:35:23 -05:00
Heng Li e02bebd96d r915: fixed a bug caused by the latest change 2019-02-14 10:04:04 -05:00
Heng Li 32ab6ce15b r914: fixed two harmless division by 0
Resolves #326
2019-02-12 19:30:49 -05:00
Heng Li 1739a260fb r913: output tag "rl", length of unseedable regs 2019-02-05 14:19:17 -05:00
Heng Li aaf3233818 added mappy.Aligner.seq_names to return seq names
Resolves #312
2019-01-29 12:53:20 -05:00
Heng Li 8b05880f73 r911: option -o to output to file (#319) 2019-01-29 10:42:20 -05:00
Heng Li eba237f39d r910: meaningful error message (#320)
when minimap2 fails to create temporary files
2019-01-29 10:29:27 -05:00
Heng Li a8e1e3cbb8 updated citation with page numbers 2019-01-26 17:59:36 -05:00
Heng Li 597212b9f3 r908: added an assertion to detect a potential bug
as in #311
2019-01-23 11:18:50 -05:00
Heng Li 30abcf3cf9 r907: copy tag "cs" in sam2paf
Resolves #310
2019-01-13 17:52:31 -05:00
Heng Li 48e230f40d r906: de tag is wrongly calculated given "N"
Resolves #309
2019-01-11 19:39:09 -05:00
Heng Li c404f49569 Release minimap2-2.15 (r905) 2019-01-10 12:34:45 -05:00
Heng Li cf2bae6e9b r904: fixed a corner-case segfault. Resolves #307. 2019-01-10 09:57:05 -05:00
Heng Li 5b2fdfff9c r895: option in asmgene to count autosomal only 2018-12-14 10:36:47 -05:00
Heng Li ea2b1c5b2a r894: added --max-qlen to filter out long query 2018-12-12 12:27:32 -05:00
Heng Li eef1cee9b7 r893: added paftools.js vcfpair 2018-12-01 18:53:03 -05:00
Heng Li 2c52364527 r892: avoid de:f:0.0000 2018-11-24 21:54:28 -05:00
Heng Li 128476efc9 r891: compute gap-compressed divergence 2018-11-24 21:50:49 -05:00
Heng Li 1b3a6a0fe5 r890: removed "register" (#261) 2018-11-19 13:57:31 -05:00
Heng Li 83a8ee7038 r888: fixed incorrect CIGAR when --eqx in use
This was caused by mm_fix_cigar() which may change query/target offset in very
rare cases. Generating EQX has to beware of this change.

Resolves #266
2018-11-18 14:22:29 -05:00
Heng Li 62bbadf668 r887: fixed a bug in asmgene 2018-11-11 21:35:19 -05:00
Heng Li 91f548b497 r886: fixed two minor typos
Resolves #264
Resolves #265
2018-11-08 12:04:14 -05:00
Heng Li cdaf46665a r885: compute dup with asmstat 2018-11-07 00:26:05 -05:00
Heng Li 6596c63dcd r884: for C++ compatibility (#261) 2018-11-06 22:07:11 -05:00
Heng Li 59f23f7579 Release minimap2-2.14 (r883) 2018-11-06 00:03:16 -05:00
Heng Li 5e55e397e9 r882: guard against -E0 (#263) 2018-11-05 23:36:12 -05:00
Heng Li 88c421e8de r881: a recent change reduces sr accuracy 2018-11-05 22:03:59 -05:00
Heng Li 3db5bfe6e5 r880: fixed false wrong FASTA/Q alert 2018-11-05 20:52:07 -05:00
Heng Li 83dfdd5f50 draft release note 2018-11-05 20:07:57 -05:00
Heng Li 8a2b1cd4c9 updated mappy for extra option max_sw_mat 2018-11-05 19:28:44 -05:00
Heng Li 1ede8ca170 r877: renamed cap-sw-mat to cap-sw-mem 2018-11-05 11:46:38 -05:00
Heng Li 13981404e2 r876: skip DP if taking too much RAM (#259) 2018-11-05 11:43:10 -05:00
Heng Li fd64dd26f6 r875: warn given incorrect FASTA/Q
resolves #252
resolves #255
2018-11-05 10:02:44 -05:00
Heng Li 24df95e4b8 r874: don't call x86_simd() so often
This takes a few percent of time in profiler.
2018-11-05 09:20:35 -05:00
Heng Li a8ee48c2ce r873: comforming to C99/C11; resolves #261 2018-11-05 08:25:07 -05:00
Heng Li 09e089c3dc r872: choose the longest isoform 2018-11-04 23:48:50 -05:00
Heng Li e46cbb7d84 r871: print erroneous genes 2018-11-04 20:37:06 -05:00
Heng Li 57ec73ec6c r870: separate <50% and <10% 2018-11-04 19:31:25 -05:00
Heng Li 9e27575387 r869: classify incomplete genes 2018-11-04 19:21:55 -05:00
Heng Li b4ad8d8bf0 added asmgene
improvements coming; not made public yet
2018-11-04 17:24:05 -05:00
Heng Li e315b9fada hidden options to control bp calculation 2018-11-04 16:36:04 -05:00
Heng Li 42baf287a4 r866: fixed a typo; resolves #262 2018-10-30 09:11:55 -04:00
Heng Li 2ceba22a7a fixed a typo in manpage 2018-10-28 11:51:02 -04:00
Heng Li 9ed56b4a25 r860: MD/cs not working with --eqx 2018-10-26 23:23:53 -04:00
Heng Li ecb6c5c36c Document --no-pairing (#256) 2018-10-23 10:00:21 -04:00
Heng Li 377c7099a8 r858: fixed a bug; resolves #254 2018-10-22 22:47:11 -04:00
Heng Li 51e2abfa60 clarify that minimap2 may miss small exons 2018-10-22 11:16:16 -04:00
Heng Li 7b0a49732e r856: wrongly reported for an unrecognized option
Resolved #250
2018-10-19 20:07:14 -04:00
60 changed files with 6833 additions and 1117 deletions
+68
View File
@@ -0,0 +1,68 @@
name: CI
on:
push:
branches:
- master
pull_request:
jobs:
build-linux-x8664:
name: Linux x86_64
runs-on: ubuntu-latest
strategy:
matrix:
compiler: [gcc, clang]
steps:
- name: Checkout minimap2
uses: actions/checkout@v4
- name: Compile with ${{ matrix.compiler }}
run: |
make CC=${{ matrix.compiler }}
file minimap2 | grep x86-64
build-linux-aarch64:
name: Linux aarch64
runs-on: ubuntu-latest
strategy:
matrix:
compiler: [gcc]
steps:
- name: Checkout
uses: actions/checkout@v4
- name: Compile with ${{ matrix.compiler }}
uses: uraimo/run-on-arch-action@v2
with:
arch: aarch64
distro: ubuntu22.04
githubToken: ${{ github.token }}
dockerRunArgs: |
--volume "${PWD}:/minimap2"
install: |
apt-get update -q -y
apt-get install -q -y make ${{ matrix.compiler }} zlib1g-dev file
run: |
cd /minimap2
make CC=${{ matrix.compiler }} arm_neon=1 aarch64=1 -j
file minimap2 | grep aarch64
build-mac-arm64:
name: Mac ARM64
runs-on: macos-14
strategy:
matrix:
compiler: [clang]
steps:
- name: Checkout minimap2
uses: actions/checkout@v4
- name: Compile with ${{ matrix.compiler }}
run: |
make CC=${{ matrix.compiler }} arm_neon=1 aarch64=1 -j
file minimap2 | grep arm64
+3
View File
@@ -0,0 +1,3 @@
[submodule "lib/simde"]
path = lib/simde
url = https://github.com/nemequ/simde.git
-20
View File
@@ -1,20 +0,0 @@
matrix:
include:
- language: c
compiler: gcc
script: make
- language: c
compiler: clang
script: make
- language: python
python: "2.7"
before_install: pip install cython
script: python setup.py build_ext
- language: python
python: "3.5"
before_install: pip install cython
script: python setup.py build_ext
- language: python
python: "3.6"
before_install: pip install cython
script: python setup.py build_ext
+46
View File
@@ -0,0 +1,46 @@
#### 1. Alignment different with option `-a` or `-c`?
Without `-a`, `-c` or `--cs`, minimap2 only finds *approximate* mapping
locations without detailed base alignment. In particular, the start and end
positions of the alignment are imprecise. With one of those options, minimap2
will perform base alignment, which is generally more accurate but is much
slower.
#### 2. How to map Illumina short reads to noisy long reads?
No good solutions. The better approach is to assemble short reads into contigs
and then map noisy reads to contigs.
#### 3. The output SAM doesn't have a header.
By default, minimap2 indexes 4 billion reference bases (4Gb) in a batch and map
all reads against each reference batch. Given a reference longer than 4Gb,
minimap2 is unable to see all the sequences and thus can't produce a correct
SAM header. In this case, minimap2 doesn't output any SAM header. There are two
solutions to this issue. First, you may increase option `-I` to, for example,
`-I8g` to index more reference bases in a batch. This is preferred if your
machine has enough memory. Second, if your machines doesn't have enough memory
to hold the reference index, you can use the `--split-prefix` option in a
command line like:
```sh
minimap2 -ax map-ont --split-prefix=tmp ref.fa reads.fq
```
This second approach uses less memory, but it is slower and requires temporary
disk space.
#### 4. The output SAM is malformatted.
This typically happens when you use nohup to wrap a minimap2 command line.
Nohup is discouraged as it breaks piping. If you have to use nohup, please
specify an output file with option `-o`.
#### 5. How to output one alignment per read?
You can use `--secondary=no` to suppress secondary alignments (aka multiple
mappings), but you can't suppress supplementary alignment (aka split or
chimeric alignment) this way. You can use samtools to filter out these
alignments:
```sh
minimap2 -ax map-out ref.fa reads.fq | samtools view -F0x900
```
However, this is discouraged as supplementary alignment is informative.
-1
View File
@@ -4,7 +4,6 @@ include ksw2_dispatch.c
include main.c include main.c
include README.md include README.md
include sse2neon/emmintrin.h include sse2neon/emmintrin.h
include python/mappy.c
include python/cmappy.h include python/cmappy.h
include python/cmappy.pxd include python/cmappy.pxd
include python/mappy.pyx include python/mappy.pyx
+35 -16
View File
@@ -1,11 +1,17 @@
CFLAGS= -g -Wall -O2 -Wc++-compat #-Wextra CFLAGS= -g -Wall -O2 -Wc++-compat #-Wextra
CPPFLAGS= -DHAVE_KALLOC CPPFLAGS= -DHAVE_KALLOC
INCLUDES= INCLUDES=
OBJS= kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o options.o index.o chain.o align.o hit.o map.o format.o pe.o esterr.o splitidx.o ksw2_ll_sse.o OBJS= kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o options.o index.o \
lchain.o align.o hit.o seed.o jump.o map.o format.o pe.o esterr.o splitidx.o \
ksw2_ll_sse.o
PROG= minimap2 PROG= minimap2
PROG_EXTRA= sdust minimap2-lite PROG_EXTRA= sdust minimap2-lite
LIBS= -lm -lz -lpthread LIBS= -lm -lz -lpthread
ifneq ($(aarch64),)
arm_neon=1
endif
ifeq ($(arm_neon),) # if arm_neon is not defined ifeq ($(arm_neon),) # if arm_neon is not defined
ifeq ($(sse2only),) # if sse2only is not defined ifeq ($(sse2only),) # if sse2only is not defined
OBJS+=ksw2_extz2_sse41.o ksw2_extd2_sse41.o ksw2_exts2_sse41.o ksw2_extz2_sse2.o ksw2_extd2_sse2.o ksw2_exts2_sse2.o ksw2_dispatch.o OBJS+=ksw2_extz2_sse41.o ksw2_extd2_sse41.o ksw2_exts2_sse41.o ksw2_extz2_sse2.o ksw2_extd2_sse2.o ksw2_exts2_sse2.o ksw2_dispatch.o
@@ -22,6 +28,16 @@ else #if aarch64 is defined
endif endif
endif endif
ifneq ($(asan),)
CFLAGS+=-fsanitize=address
LIBS+=-fsanitize=address -ldl
endif
ifneq ($(tsan),)
CFLAGS+=-fsanitize=thread
LIBS+=-fsanitize=thread -ldl
endif
.PHONY:all extra clean depend .PHONY:all extra clean depend
.SUFFIXES:.c .o .SUFFIXES:.c .o
@@ -93,26 +109,29 @@ depend:
# DO NOT DELETE # DO NOT DELETE
align.o: minimap.h mmpriv.h bseq.h ksw2.h kalloc.h align.o: minimap.h mmpriv.h bseq.h kseq.h ksw2.h kalloc.h
bseq.o: bseq.h kvec.h kalloc.h kseq.h bseq.o: bseq.h kvec.h kalloc.h kseq.h
chain.o: minimap.h mmpriv.h bseq.h kalloc.h esterr.o: mmpriv.h minimap.h bseq.h kseq.h
esterr.o: mmpriv.h minimap.h bseq.h
example.o: minimap.h kseq.h example.o: minimap.h kseq.h
format.o: kalloc.h mmpriv.h minimap.h bseq.h format.o: kalloc.h mmpriv.h minimap.h bseq.h kseq.h
hit.o: mmpriv.h minimap.h bseq.h kalloc.h khash.h hit.o: mmpriv.h minimap.h bseq.h kseq.h kalloc.h khash.h
index.o: kthread.h bseq.h minimap.h mmpriv.h kvec.h kalloc.h khash.h index.o: kthread.h bseq.h minimap.h mmpriv.h kseq.h ksw2.h kalloc.h kvec.h
index.o: khash.h ksort.h
jump.o: mmpriv.h minimap.h bseq.h kseq.h
kalloc.o: kalloc.h kalloc.o: kalloc.h
ksw2_extd2_sse.o: ksw2.h kalloc.h ksw2_extd2_sse.o: ksw2.h kalloc.h
ksw2_exts2_sse.o: ksw2.h kalloc.h ksw2_exts2_sse.o: ksw2.h kalloc.h
ksw2_extz2_sse.o: ksw2.h kalloc.h ksw2_extz2_sse.o: ksw2.h kalloc.h
ksw2_ll_sse.o: ksw2.h kalloc.h ksw2_ll_sse.o: ksw2.h kalloc.h
kthread.o: kthread.h kthread.o: kthread.h
main.o: bseq.h minimap.h mmpriv.h ketopt.h lchain.o: mmpriv.h minimap.h bseq.h kseq.h kalloc.h krmq.h
map.o: kthread.h kvec.h kalloc.h sdust.h mmpriv.h minimap.h bseq.h khash.h main.o: bseq.h minimap.h mmpriv.h kseq.h ketopt.h
map.o: ksort.h map.o: kthread.h kvec.h kalloc.h sdust.h mmpriv.h minimap.h bseq.h kseq.h
misc.o: mmpriv.h minimap.h bseq.h ksort.h map.o: khash.h ksort.h
options.o: mmpriv.h minimap.h bseq.h misc.o: mmpriv.h minimap.h bseq.h kseq.h ksort.h
pe.o: mmpriv.h minimap.h bseq.h kvec.h kalloc.h ksort.h options.o: mmpriv.h minimap.h bseq.h kseq.h
sdust.o: kalloc.h kdq.h kvec.h ketopt.h sdust.h pe.o: mmpriv.h minimap.h bseq.h kseq.h kvec.h kalloc.h ksort.h
sketch.o: kvec.h kalloc.h mmpriv.h minimap.h bseq.h sdust.o: kalloc.h kdq.h kvec.h sdust.h
splitidx.o: mmpriv.h minimap.h bseq.h seed.o: mmpriv.h minimap.h bseq.h kseq.h kalloc.h ksort.h
sketch.o: kvec.h kalloc.h mmpriv.h minimap.h bseq.h kseq.h
splitidx.o: mmpriv.h minimap.h bseq.h kseq.h
+97
View File
@@ -0,0 +1,97 @@
CFLAGS= -g -Wall -O2 -Wc++-compat #-Wextra
CPPFLAGS= -DHAVE_KALLOC -DUSE_SIMDE -DSIMDE_ENABLE_NATIVE_ALIASES
INCLUDES= -Ilib/simde
OBJS= kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o options.o index.o lchain.o align.o hit.o map.o format.o pe.o seed.o esterr.o splitidx.o \
ksw2_extz2_simde.o ksw2_extd2_simde.o ksw2_exts2_simde.o ksw2_ll_simde.o
PROG= minimap2
PROG_EXTRA= sdust minimap2-lite
LIBS= -lm -lz -lpthread
ifneq ($(arm_neon),) # if arm_neon is defined
ifeq ($(aarch64),) #if aarch64 is not defined
CFLAGS+=-D_FILE_OFFSET_BITS=64 -mfpu=neon -fsigned-char
else #if aarch64 is defined
CFLAGS+=-D_FILE_OFFSET_BITS=64 -fsigned-char
endif
endif
ifneq ($(asan),)
CFLAGS+=-fsanitize=address
LIBS+=-fsanitize=address
endif
ifneq ($(tsan),)
CFLAGS+=-fsanitize=thread
LIBS+=-fsanitize=thread
endif
.PHONY:all extra clean depend
.SUFFIXES:.c .o
.c.o:
$(CC) -c $(CFLAGS) $(CPPFLAGS) $(INCLUDES) $< -o $@
all:$(PROG)
extra:all $(PROG_EXTRA)
minimap2:main.o libminimap2.a
$(CC) $(CFLAGS) main.o -o $@ -L. -lminimap2 $(LIBS)
minimap2-lite:example.o libminimap2.a
$(CC) $(CFLAGS) $< -o $@ -L. -lminimap2 $(LIBS)
libminimap2.a:$(OBJS)
$(AR) -csru $@ $(OBJS)
sdust:sdust.c kalloc.o kalloc.h kdq.h kvec.h kseq.h ketopt.h sdust.h
$(CC) -D_SDUST_MAIN $(CFLAGS) $< kalloc.o -o $@ -lz
ksw2_ll_simde.o:ksw2_ll_sse.c ksw2.h kalloc.h
$(CC) -c $(CFLAGS) -msse2 $(CPPFLAGS) $(INCLUDES) $< -o $@
ksw2_extz2_simde.o:ksw2_extz2_sse.c ksw2.h kalloc.h
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) $(INCLUDES) $< -o $@
ksw2_extd2_simde.o:ksw2_extd2_sse.c ksw2.h kalloc.h
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) $(INCLUDES) $< -o $@
ksw2_exts2_simde.o:ksw2_exts2_sse.c ksw2.h kalloc.h
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) $(INCLUDES) $< -o $@
# other non-file targets
clean:
rm -fr gmon.out *.o a.out $(PROG) $(PROG_EXTRA) *~ *.a *.dSYM build dist mappy*.so mappy.c python/mappy.c mappy.egg*
depend:
(LC_ALL=C; export LC_ALL; makedepend -Y -- $(CFLAGS) $(CPPFLAGS) -- *.c)
# DO NOT DELETE
align.o: minimap.h mmpriv.h bseq.h kseq.h ksw2.h kalloc.h
bseq.o: bseq.h kvec.h kalloc.h kseq.h
chain.o: minimap.h mmpriv.h bseq.h kseq.h kalloc.h
esterr.o: mmpriv.h minimap.h bseq.h kseq.h
example.o: minimap.h kseq.h
format.o: kalloc.h mmpriv.h minimap.h bseq.h kseq.h
hit.o: mmpriv.h minimap.h bseq.h kseq.h kalloc.h khash.h
index.o: kthread.h bseq.h minimap.h mmpriv.h kseq.h kvec.h kalloc.h khash.h
index.o: ksort.h
kalloc.o: kalloc.h
ksw2_extd2_sse.o: ksw2.h kalloc.h
ksw2_exts2_sse.o: ksw2.h kalloc.h
ksw2_extz2_sse.o: ksw2.h kalloc.h
ksw2_ll_sse.o: ksw2.h kalloc.h
kthread.o: kthread.h
main.o: bseq.h minimap.h mmpriv.h kseq.h ketopt.h
map.o: kthread.h kvec.h kalloc.h sdust.h mmpriv.h minimap.h bseq.h kseq.h
map.o: khash.h ksort.h
misc.o: mmpriv.h minimap.h bseq.h kseq.h ksort.h
options.o: mmpriv.h minimap.h bseq.h kseq.h
pe.o: mmpriv.h minimap.h bseq.h kseq.h kvec.h kalloc.h ksort.h
sdust.o: kalloc.h kdq.h kvec.h sdust.h
self-chain.o: minimap.h kseq.h
sketch.o: kvec.h kalloc.h mmpriv.h minimap.h bseq.h kseq.h
splitidx.o: mmpriv.h minimap.h bseq.h kseq.h
+512
View File
@@ -1,3 +1,515 @@
Release 2.30-r1287 (15 June 2025)
---------------------------------
Notable changes:
* Improvement: consolidated `--spsc`.
* Deprecation: subcommands `splice2bed`, `gff2bed`, `gff2junc`, `junceval` and
`exoneval` in `paftools.js` are deprecated by minigff. They will remain
indefinitely for backward compatibility.
(2.30: 15 June 2025, r1287)
Release 2.29-r1283 (18 April 2025)
----------------------------------
Notable changes to minimap2:
* New feature: added the `splice:sr` preset for short RNA-seq read alignment.
Users may use `-j` to specify known gene annotation to improve spliced
alignment close to the ends of short reads. Also added `--write-junc` and
`--pass1` for 2-pass short-read RNA-seq alignment.
* Experimental feature: read splice scores from a file specified by `--spsc`
and consider the scores during base alignment. The feature makes it possible
to apply advanced splice models and to improve spliced alignment.
* Change: adjusted the mapping quality calculation for spliced alignment.
* Bugfixes: a) missing overlap alignment when base alignment is requested
(#969); b) incorrect summary information for long genomes (#1192); c)
missing parameter check for `--score-N` (#1226).
* Improvement: a) warn about absent junction files (#1229); b) report an error
if a wrong preset prefixed with "splice" is specified (#589).
Notable changes to mappy:
* Improvement: allow passing read name (#1260)
* Improvement: exposed score for ambiguous bases (#1240)
Minimap2 now supports short/long genomic/RNA-seq read alignment along with
contig alignment and all-vs-all read overlapping. It produces identical genomic
long-read or contig alignment to v2.27. Short genomic read alignment and the
mapping quality of long RNA-seq read alignment may slightly differ in very rare
cases.
(2.29: 18 April 2025, r1283)
Release 2.28-r1209 (27 March 2024)
----------------------------------
Notable changes to minimap2:
* Bugfix: `--MD` was not working properly due to the addition of `--ds` in the
last release (#1181 and #1182).
* New feature: added an experimental preset `lq:hqae` for aligning accurate
long reads back to their assembly. It has been observed that `map-hifi` and
`lr:hq` may produce many wrong alignments around centromeres when accurate
long reads (PacBio HiFi or Nanopore duplex/Q20+) are mapped to a diploid
assembly constructed from them. This new preset produces much more accurate
alignment. It is still experimental and may be subjective to changes in
future.
* Change: reduced the default `--cap-kalloc` to 500m to lower the peak
memory consumption (#855).
Notable changes to mappy:
* Bugfix: mappy option struct was out of sync with minimap2 (#1177).
Minimap2 should output identical alignments to v2.27.
(2.28: 27 March 2024, r1209)
Release 2.27-r1193 (12 March 2024)
----------------------------------
Notable changes to minimap2:
* New feature: added the `lr:hq` preset for accurate long reads at ~1% error
rate. This was suggested by Oxford Nanopore developers (#1127). It is not
clear if this preset also works well for PacBio HiFi reads.
* New feature: added the `map-iclr` preset for Illumina Complete Long Reads
(#1069), provided by Illumina developers.
* New feature: added option `-b` to specify mismatch penalty for base
transitions (i.e. A-to-G or C-to-T changes).
* New feature: added option `--ds` to generate a new `ds:Z` tag that
indicates uncertainty in INDEL positions. It is an extension to `cs`. The
`mgutils-es6.js` script in minigraph parses `ds`.
* Bugfix: avoided a NULL pointer dereference (#1154). This would not have an
effect on most systems but would still be good to fix.
* Bugfix: reverted the value of `ms:i` to pre-2.22 versions (#1146). This was
an oversight. See fcd4df2 for details.
Notable changes to paftools.js and mappy:
* New feature: expose `bw_long` to mappy's Aligner class (#1124).
* Bugfix: fixed several compatibility issues with k8 v1.0 (#1161 and #1166).
Subcommands "call", "pbsim2fq" and "mason2fq" were not working with v1.0.
Minimap2 should output identical alignments to v2.26, except the ms tag.
(2.27: 12 March 2024, r1193)
Release 2.26-r1175 (29 April 2023)
----------------------------------
Fixed the broken Python package. This is the only change.
(2.26: 25 April 2023, r1173)
Release 2.25-r1173 (25 April 2023)
----------------------------------
Notable changes:
* Improvement: use the miniprot splice model for RNA-seq alignment by default.
This model considers non-GT-AG splice sites and leads to slightly higher
(<0.1%) accuracy and sensitivity on real human data.
* Change: increased the default `-I` to `8G` such that minimap2 would create a
uni-part index for a pair of mammalian genomes. This change may increase the
memory for all-vs-all read overlap alignment given large datasets.
* New feature: output the sequences in secondary alignments with option
`--secondary-seq` (#687).
* Bugfix: --rmq was not parsed correctly (#1010)
* Bugfix: possibly incorrect coordinate when applying end bonus to the target
sequence (#1025). This is a ksw2 bug. It does not affect minimap2 as
minimap2 is not using the affected feature.
* Improvement: incorporated several changes for better compatibility with
Windows (#1051) and for minimap2 integration at Oxford Nanopore Technologies
(#1048 and #1033).
* Improvement: output the HD-line in SAM output (#1019).
* Improvement: check minimap2 index file in mappy to prevent segmentation
fault for certain indices (#1008).
For genomic sequences, minimap2 should give identical output to v2.24.
Long-read RNA-seq alignment may occasionally differ from previous versions.
(2.25: 25 April 2023, r1173)
Release 2.24-r1122 (26 December 2021)
-------------------------------------
This release improves alignment around long poorly aligned regions. Older
minimap2 may chain through such regions in rare cases which may result in
missing alignments later. The issue has become worse since the the change of
the chaining algorithm in v2.19. v2.23 implements an incomplete remedy. This
release provides a better solution with a X-drop-like heuristic and by enabling
two-bandwidth chaining in the assembly mode.
(2.24: 26 December 2021, r1122)
Release 2.23-r1111 (18 November 2021)
-------------------------------------
Notable changes:
* Bugfix: fixed missing alignments around long inversions (#806 and #816).
This bug affected v2.19 through v2.22.
* Improvement: avoid extremely long mapping time for pathologic reads with
highly repeated k-mers not in the reference (#771). Use --q-occ-frac=0
to disable the new heuristic.
* Change: use --cap-kalloc=1g by default.
(2.23: 18 November 2021, r1111)
Release 2.22-r1101 (7 August 2021)
----------------------------------
When choosing the best alignment, this release uses logarithm gap penalty and
query-specific mismatch penalty. It improves the sensitivity to long INDELs in
repetitive regions.
Other notable changes:
* Bugfix: fixed an indirect memory leak that may waste a large amount of
memory given highly repetitive reference such as a 16S RNA database (#749).
All versions of minimap2 have this issue.
* New feature: added --cap-kalloc to reduce the peak memory. This option is
not enabled by default but may become the default in future releases.
Known issue:
* Minimap2 may take a long time to map a read (#771). So far it is not clear
if this happens to v2.18 and earlier versions.
(2.22: 7 August 2021, r1101)
Release 2.21-r1071 (6 July 2021)
--------------------------------
This release fixed a regression in short-read mapping introduced in v2.19
(#776). It also fixed invalid comparisons of uninitialized variables, though
these are harmless (#752). Long-read alignment should be identical to v2.20.
(2.21: 6 July 2021, r1071)
Release 2.20-r1061 (27 May 2021)
--------------------------------
This release fixed a bug in the Python module and improves the command-line
compatibiliity with v2.18. In v2.19, if `-r` is specified with an `asm*` preset,
users would get alignments more fragmented than v2.18. This could be an issue
for existing pipelines specifying `-r`. This release resolves this issue.
(2.20: 27 May 2021, r1061)
Release 2.19-r1057 (26 May 2021)
--------------------------------
This release includes a few important improvements backported from unimap:
* Improvement: more contiguous alignment through long INDELs. This is enabled
by the minigraph chaining algorithm. All `asm*` presets now use the new
algorithm. They can find INDELs up to 100kb and may be faster for
chromosome-long contigs. The default mode and `map*` presets use this
algorithm to replace the long-join heuristic.
* Improvement: better alignment in highly repetitive regions by rescuing
high-occurrence seeds. If the distance between two adjacent seeds is too
large, attempt to choose a fraction of high-occurrence seeds in-between.
Minimap2 now produces fewer clippings and alignment break points in long
satellite regions.
* Improvement: allow to specify an interval of k-mer occurrences with `-U`.
For repeat-rich genomes, the automatic k-mer occurrence threshold determined
by `-f` may be too large and makes alignment impractically slow. The new
option protects against such cases. Enabled for `asm*` and `map-hifi`.
* New feature: added the `map-hifi` preset for maping PacBio High-Fidelity
(HiFi) reads.
* Change to the default: apply `--cap-sw-mem=100m` for genomic alignment.
* Bugfix: minimap2 could not generate an index file with `-xsr` (#734).
This release represents the most signficant algorithmic change since v2.1 in
2017. With features backported from unimap, minimap2 now has similar power to
unimap for contig alignment. Unimap will remain an experimental project and is
no longer recommended over minimap2. Sorry for reverting the recommendation in
short time.
(2.19: 26 May 2021, r1057)
Release 2.18-r1015 (9 April 2021)
---------------------------------
This release fixes multiple rare bugs in minimap2 and adds additional
functionality to paftools.js.
Changes to minimap2:
* Bugfix: a rare segfault caused by an off-by-one error (#489)
* Bugfix: minimap2 segfaulted due to an uninitilized variable (#622 and #625).
* Bugfix: minimap2 parsed spaces as field separators in BED (#721). This led
to issues when the BED name column contains spaces.
* Bugfix: minimap2 `--split-prefix` did not work with long reference names
(#394).
* Bugfix: option `--junc-bonus` didn't work (#513)
* Bugfix: minimap2 didn't return 1 on I/O errors (#532)
* Bugfix: the `de:f` tag (sequence divergence) could be negative if there were
ambiguous bases
* Bugfix: fixed two undefined behaviors caused by calling memcpy() on
zero-length blocks (#443)
* Bugfix: there were duplicated SAM @SQ lines if option `--split-prefix` is in
use (#400 and #527)
* Bugfix: option -K had to be smaller than 2 billion (#491). This was caused
by a 32-bit integer overflow.
* Improvement: optionally compile against SIMDe (#597). Minimap2 should work
with IBM POWER CPUs, though this has not been tested. To compile with SIMDe,
please use `make -f Makefile.simde`.
* Improvement: more informative error message for I/O errors (#454) and for
FASTQ parsing errors (#510)
* Improvement: abort given malformatted RG line (#541)
* Improvement: better formula to estimate the `dv:f` tag (approximate sequence
divergence). See DOI:10.1101/2021.01.15.426881.
* New feature: added the `--mask-len` option to fine control the removal of
redundant hits (#659). The default behavior is unchanged.
Changes to mappy:
* Bugfix: mappy caused segmentation fault if the reference index is not
present (#413).
* Bugfix: fixed a memory leak via 238b6bb3
* Change: always require Cython to compile the mappy module (#723). Older
mappy packages at PyPI bundled the C source code generated by Cython such
that end users did not need to install Cython to compile mappy. However, as
Python 3.9 is breaking backward compatibility, older mappy does not work
with Python 3.9 anymore. We have to add this Cython dependency as a
workaround.
Changes to paftools.js:
* Bugfix: the "part10-" line from asmgene was wrong (#581)
* Improvement: compatibility with GTF files from GenBank (#422)
* New feature: asmgene also checks missing multi-copy genes
* New feature: added the misjoin command to evaluate large-scale misjoins and
megabase-long inversions.
Although given the many bug fixes and minor improvements, the core algorithm
stays the same. This version of minimap2 produces nearly identical alignments
to v2.17 except very rare corner cases.
Now unimap is recommended over minimap2 for aligning long contigs against a
reference genome. It often takes less wall-clock time and is much more
sensitive to long insertions and deletions.
(2.18: 9 April 2021, r1015)
Release 2.17-r941 (4 May 2019)
------------------------------
Changes since the last release:
* Fixed flawed CIGARs like `5I6D7I` (#392).
* Bugfix: TLEN should be 0 when either end is unmapped (#373 and #365).
* Bugfix: mappy is unable to write index (#372).
* Added option `--junc-bed` to load known gene annotations in the BED12
format. Minimap2 prefers annotated junctions over novel junctions (#197 and
#348). GTF can be converted to BED12 with `paftools.js gff2bed`.
* Added option `--sam-hit-only` to suppress unmapped hits in SAM (#377).
* Added preset `splice:hq` for high-quality CCS or mRNA sequences. It applies
better scoring and improves the sensitivity to small exons. This preset may
introduce false small introns, but the overall accuracy should be higher.
This version produces nearly identical alignments to v2.16, except for CIGARs
affected by the bug mentioned above.
(2.17: 5 May 2019, r941)
Release 2.16-r922 (28 February 2019)
------------------------------------
This release is 50% faster for mapping ultra-long nanopore reads at comparable
accuracy. For short-read mapping, long-read overlapping and ordinary long-read
mapping, the performance and accuracy remain similar. This speedup is achieved
with a new heuristic to limit the number of chaining iterations (#324). Users
can disable the heuristic by increasing a new option `--max-chain-iter` to a
huge number.
Other changes to minimap2:
* Implemented option `--paf-no-hit` to output unmapped query sequences in PAF.
The strand and reference name columns are both `*` at an unmapped line. The
hidden option is available in earlier minimap2 but had a different 2-column
output format instead of PAF.
* Fixed a bug that leads to wrongly calculated `de` tags when ambiguous bases
are involved (#309). This bug only affects v2.15.
* Fixed a bug when parsing command-line option `--splice` (#344). This bug was
introduced in v2.13.
* Fixed two division-by-zero cases (#326). They don't affect final alignments
because the results of the divisions are not used in both case.
* Added an option `-o` to output alignments to a specified file. It is still
recommended to use UNIX pipes for on-the-fly conversion or compression.
* Output a new `rl` tag to give the length of query regions harboring
repetitive seeds.
Changes to paftool.js:
* Added a new option to convert the MD tag to the long form of the cs tag.
Changes to mappy:
* Added the `mappy.Aligner.seq_names` method to return sequence names (#312).
For NA12878 ultra-long reads, this release changes the alignments of <0.1% of
reads in comparison to v2.15. All these reads have highly fragmented alignments
and are likely to be problematic anyway. For shorter or well aligned reads,
this release should produce mostly identical alignments to v2.15.
(2.16: 28 February 2019, r922)
Release 2.15-r905 (10 January 2019)
-----------------------------------
Changes to minimap2:
* Fixed a rare segmentation fault when option -H is in use (#307). This may
happen when there are very long homopolymers towards the 5'-end of a read.
* Fixed wrong CIGARs when option --eqx is used (#266).
* Fixed a typo in the base encoding table (#264). This should have no
practical effect.
* Fixed a typo in the example code (#265).
* Improved the C++ compatibility by removing "register" (#261). However,
minimap2 still can't be compiled in the pedantic C++ mode (#306).
* Output a new "de" tag for gap-compressed sequence divergence.
Changes to paftools.js:
* Added "asmgene" to evaluate the completeness of an assembly by measuring the
uniquely mapped single-copy genes. This command learns the idea of BUSCO.
* Added "vcfpair" to call a phased VCF from phased whole-genome assemblies. An
earlier version of this script is used to produce the ground truth for the
syndip benchmark [PMID:30013044].
This release produces identical alignment coordinates and CIGARs in comparison
to v2.14. Users are advised to upgrade due to the several bug fixes.
(2.15: 10 Janurary 2019, r905)
Release 2.14-r883 (5 November 2018)
-----------------------------------
Notable changes:
* Fixed two minor bugs caused by typos (#254 and #266).
* Fixed a bug that made minimap2 abort when --eqx was used together with --MD
or --cs (#257).
* Added --cap-sw-mem to cap the size of DP matrices (#259). Base alignment may
take a lot of memory in the splicing mode. This may lead to issues when we
run minimap2 on a cluster with a hard memory limit. The new option avoids
unlimited memory usage at the cost of missing a few long introns.
* Conforming to C99 and C11 when possible (#261).
* Warn about malformatted FASTA or FASTQ (#252 and #255).
This release occasionally produces base alignments different from v2.13. The
overall alignment accuracy remain similar.
(2.14: 5 November 2018, r883)
Release 2.13-r850 (11 October 2018) Release 2.13-r850 (11 October 2018)
----------------------------------- -----------------------------------
+83 -30
View File
@@ -1,7 +1,7 @@
[![GitHub Downloads](https://img.shields.io/github/downloads/lh3/minimap2/total.svg?style=social&logo=github&label=Download)](https://github.com/lh3/minimap2/releases) [![GitHub Downloads](https://img.shields.io/github/downloads/lh3/minimap2/total.svg?style=social&logo=github&label=Download)](https://github.com/lh3/minimap2/releases)
[![BioConda Install](https://img.shields.io/conda/dn/bioconda/minimap2.svg?style=flag&label=BioConda%20install)](https://anaconda.org/bioconda/minimap2) [![BioConda Install](https://img.shields.io/conda/dn/bioconda/minimap2.svg?style=flag&label=BioConda%20install)](https://anaconda.org/bioconda/minimap2)
[![PyPI](https://img.shields.io/pypi/v/mappy.svg?style=flat)](https://pypi.python.org/pypi/mappy) [![PyPI](https://img.shields.io/pypi/v/mappy.svg?style=flat)](https://pypi.python.org/pypi/mappy)
[![Build Status](https://travis-ci.org/lh3/minimap2.svg?branch=master)](https://travis-ci.org/lh3/minimap2) [![Build Status](https://github.com/lh3/minimap2/actions/workflows/ci.yaml/badge.svg)](https://github.com/lh3/minimap2/actions)
## <a name="started"></a>Getting Started ## <a name="started"></a>Getting Started
```sh ```sh
git clone https://github.com/lh3/minimap2 git clone https://github.com/lh3/minimap2
@@ -9,22 +9,27 @@ cd minimap2 && make
# long sequences against a reference genome # long sequences against a reference genome
./minimap2 -a test/MT-human.fa test/MT-orang.fa > test.sam ./minimap2 -a test/MT-human.fa test/MT-orang.fa > test.sam
# create an index first and then map # create an index first and then map
./minimap2 -d MT-human.mmi test/MT-human.fa ./minimap2 -x map-ont -d MT-human-ont.mmi test/MT-human.fa
./minimap2 -a MT-human.mmi test/MT-orang.fa > test.sam ./minimap2 -a MT-human-ont.mmi test/MT-orang.fa > test.sam
# use presets (no test data) # use presets (no test data)
./minimap2 -ax map-pb ref.fa pacbio.fq.gz > aln.sam # PacBio genomic reads ./minimap2 -ax map-pb ref.fa pacbio.fq.gz > aln.sam # PacBio CLR genomic reads
./minimap2 -ax map-ont ref.fa ont.fq.gz > aln.sam # Oxford Nanopore genomic reads ./minimap2 -ax map-ont ref.fa ont.fq.gz > aln.sam # Oxford Nanopore genomic reads
./minimap2 -ax asm20 ref.fa pacbio-ccs.fq.gz > aln.sam # PacBio CCS genomic reads ./minimap2 -ax map-hifi ref.fa pacbio-ccs.fq.gz > aln.sam # PacBio HiFi/CCS genomic reads (v2.19+)
./minimap2 -ax lr:hq ref.fa ont-Q20.fq.gz > aln.sam # Nanopore Q20 genomic reads (v2.27+)
./minimap2 -ax sr ref.fa read1.fa read2.fa > aln.sam # short genomic paired-end reads ./minimap2 -ax sr ref.fa read1.fa read2.fa > aln.sam # short genomic paired-end reads
./minimap2 -ax splice ref.fa rna-reads.fa > aln.sam # spliced long reads (strand unknown) ./minimap2 -ax splice ref.fa rna-reads.fa > aln.sam # spliced long reads (strand unknown)
./minimap2 -ax splice -uf -k14 ref.fa reads.fa > aln.sam # noisy Nanopore Direct RNA-seq ./minimap2 -ax splice -uf -k14 ref.fa reads.fa > aln.sam # noisy Nanopore direct RNA-seq
./minimap2 -ax splice -uf -C5 ref.fa query.fa > aln.sam # Final PacBio Iso-seq or traditional cDNA ./minimap2 -ax splice:hq -uf ref.fa query.fa > aln.sam # PacBio Kinnex/Iso-seq (RNA-seq)
./minimap2 -ax splice --junc-bed=anno.bed12 ref.fa query.fa > aln.sam # use annotated junctions
./minimap2 -ax splice:sr ref.fa r1.fq r2.fq > aln.sam # short-read RNA-seq (v2.29+)
./minimap2 -ax splice:sr -j anno.bed12 ref.fa r1.fq r2.fq > aln.sam
./minimap2 -cx asm5 asm1.fa asm2.fa > aln.paf # intra-species asm-to-asm alignment ./minimap2 -cx asm5 asm1.fa asm2.fa > aln.paf # intra-species asm-to-asm alignment
./minimap2 -x ava-pb reads.fa reads.fa > overlaps.paf # PacBio read overlap ./minimap2 -x ava-pb reads.fa reads.fa > overlaps.paf # PacBio read overlap
./minimap2 -x ava-ont reads.fa reads.fa > overlaps.paf # Nanopore read overlap ./minimap2 -x ava-ont reads.fa reads.fa > overlaps.paf # Nanopore read overlap
# man page for detailed command line options # man page for detailed command line options
man ./minimap2.1 man ./minimap2.1
``` ```
## Table of Contents ## Table of Contents
- [Getting Started](#started) - [Getting Started](#started)
@@ -35,7 +40,8 @@ man ./minimap2.1
- [Map long noisy genomic reads](#map-long-genomic) - [Map long noisy genomic reads](#map-long-genomic)
- [Map long mRNA/cDNA reads](#map-long-splice) - [Map long mRNA/cDNA reads](#map-long-splice)
- [Find overlaps between long reads](#long-overlap) - [Find overlaps between long reads](#long-overlap)
- [Map short accurate genomic reads](#short-genomic) - [Map short genomic reads](#short-genomic)
- [Map short RNA-seq reads](#short-rna-seq)
- [Full genome/assembly alignment](#full-genome) - [Full genome/assembly alignment](#full-genome)
- [Advanced features](#advanced) - [Advanced features](#advanced)
- [Working with >65535 CIGAR operations](#long-cigar) - [Working with >65535 CIGAR operations](#long-cigar)
@@ -71,8 +77,8 @@ Detailed evaluations are available from the [minimap2 paper][doi] or the
Minimap2 is optimized for x86-64 CPUs. You can acquire precompiled binaries from Minimap2 is optimized for x86-64 CPUs. You can acquire precompiled binaries from
the [release page][release] with: the [release page][release] with:
```sh ```sh
curl -L https://github.com/lh3/minimap2/releases/download/v2.13/minimap2-2.13_x64-linux.tar.bz2 | tar -jxvf - curl -L https://github.com/lh3/minimap2/releases/download/v2.30/minimap2-2.30_x64-linux.tar.bz2 | tar -jxvf -
./minimap2-2.13_x64-linux/minimap2 ./minimap2-2.30_x64-linux/minimap2
``` ```
If you want to compile from the source, you need to have a C compiler, GNU make If you want to compile from the source, you need to have a C compiler, GNU make
and zlib development files installed. Then type `make` in the source code and zlib development files installed. Then type `make` in the source code
@@ -80,13 +86,20 @@ directory to compile. If you see compilation errors, try `make sse2only=1`
to disable SSE4 code, which will make minimap2 slightly slower. to disable SSE4 code, which will make minimap2 slightly slower.
Minimap2 also works with ARM CPUs supporting the NEON instruction sets. To Minimap2 also works with ARM CPUs supporting the NEON instruction sets. To
compile for 32 bit ARM architectures (such as ARMv7), use `make arm_neon=1`. To compile for for 64 bit ARM architectures (such as ARMv8), use `make arm_neon=1 aarch64=1`. compile for 32 bit ARM architectures (such as ARMv7), use `make arm_neon=1`. To
compile for for 64 bit ARM architectures (such as ARMv8), use `make arm_neon=1
aarch64=1`.
Minimap2 can use [SIMD Everywhere (SIMDe)][simde] library for porting
implementation to the different SIMD instruction sets. To compile using SIMDe,
use `make -f Makefile.simde`. To compile for ARM CPUs, use `Makefile.simde`
with the ARM related command lines given above.
### <a name="general"></a>General usage ### <a name="general"></a>General usage
Without any options, minimap2 takes a reference database and a query sequence Without any options, minimap2 takes a reference database and a query sequence
file as input and produce approximate mapping, without base-level alignment file as input and produce approximate mapping, without base-level alignment
(i.e. no CIGAR), in the [PAF format][paf]: (i.e. coordinates are only approximate and no CIGAR in output), in the [PAF format][paf]:
```sh ```sh
minimap2 ref.fa query.fq > approx-mapping.paf minimap2 ref.fa query.fq > approx-mapping.paf
``` ```
@@ -127,19 +140,22 @@ parameters at the same time. The default setting is the same as `map-ont`.
#### <a name="map-long-genomic"></a>Map long noisy genomic reads #### <a name="map-long-genomic"></a>Map long noisy genomic reads
```sh ```sh
minimap2 -ax map-pb ref.fa pacbio-reads.fq > aln.sam # for PacBio subreads minimap2 -ax map-pb ref.fa pacbio-reads.fq > aln.sam # for PacBio CLR reads
minimap2 -ax map-ont ref.fa ont-reads.fq > aln.sam # for Oxford Nanopore reads minimap2 -ax map-ont ref.fa ont-reads.fq > aln.sam # for Oxford Nanopore reads
minimap2 -ax map-iclr ref.fa iclr-reads.fq > aln.sam # for Illumina Complete Long Reads
``` ```
The difference between `map-pb` and `map-ont` is that `map-pb` uses The difference between `map-pb` and `map-ont` is that `map-pb` uses
homopolymer-compressed (HPC) minimizers as seeds, while `map-ont` uses ordinary homopolymer-compressed (HPC) minimizers as seeds, while `map-ont` uses ordinary
minimizers as seeds. Emperical evaluation suggests HPC minimizers improve minimizers as seeds. Empirical evaluation suggests HPC minimizers improve
performance and sensitivity when aligning PacBio reads, but hurt when aligning performance and sensitivity when aligning PacBio CLR reads, but hurt when aligning
Nanopore reads. Nanopore reads. `map-iclr` uses an adjusted alignment scoring matrix that
accounts for the low overall error rate in the reads, with transversion errors
being less frequent than transitions.
#### <a name="map-long-splice"></a>Map long mRNA/cDNA reads #### <a name="map-long-splice"></a>Map long mRNA/cDNA reads
```sh ```sh
minimap2 -ax splice -uf -C5 ref.fa iso-seq.fq > aln.sam # PacBio Iso-seq/traditional cDNA minimap2 -ax splice:hq -uf ref.fa iso-seq.fq > aln.sam # PacBio Iso-seq/traditional cDNA
minimap2 -ax splice ref.fa nanopore-cdna.fa > aln.sam # Nanopore 2D cDNA-seq minimap2 -ax splice ref.fa nanopore-cdna.fa > aln.sam # Nanopore 2D cDNA-seq
minimap2 -ax splice -uf -k14 ref.fa direct-rna.fq > aln.sam # Nanopore Direct RNA-seq minimap2 -ax splice -uf -k14 ref.fa direct-rna.fq > aln.sam # Nanopore Direct RNA-seq
minimap2 -ax splice --splice-flank=no SIRV.fa SIRV-seq.fa # mapping against SIRV control minimap2 -ax splice --splice-flank=no SIRV.fa SIRV-seq.fa # mapping against SIRV control
@@ -158,9 +174,8 @@ or the last exons.
Minimap2 rates an alignment by the score of the max-scoring sub-segment, Minimap2 rates an alignment by the score of the max-scoring sub-segment,
*excluding* introns, and marks the best alignment as primary in SAM. When a *excluding* introns, and marks the best alignment as primary in SAM. When a
spliced gene also has unspliced pseudogenes, minimap2 does not intentionally spliced gene also has unspliced pseudogenes, minimap2 slightly prefers
prefer spliced alignment, though in practice it more often marks the spliced the spliced alignment. By default, minimap2 outputs up to five secondary
alignment as the primary. By default, minimap2 outputs up to five secondary
alignments (i.e. likely pseudogenes in the context of RNA-seq mapping). This alignments (i.e. likely pseudogenes in the context of RNA-seq mapping). This
can be tuned with option **-N**. can be tuned with option **-N**.
@@ -178,10 +193,27 @@ This is because SIRV does not honor the evolutionarily conservative splicing
signal. If you are studying SIRV, you may apply `--splice-flank=no` to let signal. If you are studying SIRV, you may apply `--splice-flank=no` to let
minimap2 only model GT..AG, ignoring the additional base. minimap2 only model GT..AG, ignoring the additional base.
Since v2.17, minimap2 can optionally take annotated genes as input and
prioritize on annotated splice junctions. To use this feature, you can
```sh
paftools.js gff2bed anno.gff > anno.bed
minimap2 -ax splice --junc-bed anno.bed ref.fa query.fa > aln.sam
```
Here, `anno.gff` is the gene annotation in the GTF or GFF3 format (`gff2bed`
automatically tests the format). The output of `gff2bed` is in the 12-column
BED format, or the BED12 format. With the `--junc-bed` option, minimap2 adds a
bonus score (tuned by `--junc-bonus`) if an aligned junction matches a junction
in the annotation. Option `--junc-bed` also takes 5-column BED, including the
strand field. In this case, each line indicates an oriented junction.
**Note:** `--junc-bed` is intended for long noisy RNA-seq reads only.
Applying the option to short RNA-seq reads would increase run time with little
improvement to junction accuracy.
#### <a name="long-overlap"></a>Find overlaps between long reads #### <a name="long-overlap"></a>Find overlaps between long reads
```sh ```sh
minimap2 -x ava-pb reads.fq reads.fq > ovlp.paf # PacBio read overlap minimap2 -x ava-pb reads.fq reads.fq > ovlp.paf # PacBio CLR read overlap
minimap2 -x ava-ont reads.fq reads.fq > ovlp.paf # Oxford Nanopore read overlap minimap2 -x ava-ont reads.fq reads.fq > ovlp.paf # Oxford Nanopore read overlap
``` ```
Similarly, `ava-pb` uses HPC minimizers while `ava-ont` uses ordinary Similarly, `ava-pb` uses HPC minimizers while `ava-ont` uses ordinary
@@ -190,7 +222,7 @@ the overlapping mode because it is slow and may produce false positive
overlaps. However, if performance is not a concern, you may try to add `-a` or overlaps. However, if performance is not a concern, you may try to add `-a` or
`-c` anyway. `-c` anyway.
#### <a name="short-genomic"></a>Map short accurate genomic reads #### <a name="short-genomic"></a>Map short genomic reads
```sh ```sh
minimap2 -ax sr ref.fa reads-se.fq > aln.sam # single-end alignment minimap2 -ax sr ref.fa reads-se.fq > aln.sam # single-end alignment
@@ -203,8 +235,18 @@ be paired if they are adjacent in the input stream and have the same name (with
the `/[0-9]` suffix trimmed if present). Single- and paired-end reads can be the `/[0-9]` suffix trimmed if present). Single- and paired-end reads can be
mixed. mixed.
Minimap2 does not work well with short spliced reads. There are many capable #### <a name="short-rna-seq"></a>Map short RNA-seq reads
RNA-seq mappers for short reads.
```sh
minimap2 -ax splice:sr ref.fa reads-se.fq.gz > aln.sam # single-end
minimap2 -ax splice:sr ref.fa r1.fq.gz r2.fq.gz > aln.sam # paired-end
minimap2 -ax splice:sr -j anno.bed ref.fa r1.fq r2.fq > aln.sam # use annotation
# 2-pass alignment
minimap2 -x splice:sr -j anno.bed --write-junc ref.fa r1.fq r2.fq > junc.bed
minimap2 -ax splice:sr -j anno.bed --pass1=junc.bed ref.fa r1.fq r2.fq > aln.sam
```
The new preset `splice:sr` was added in v2.29. It functions similarly to `sr`
except that it performs spliced alignment.
#### <a name="full-genome"></a>Full genome/assembly alignment #### <a name="full-genome"></a>Full genome/assembly alignment
@@ -228,7 +270,7 @@ To avoid this issue, you can add option `-L` at the minimap2 command line.
This option moves a long CIGAR to the `CG` tag and leaves a fully clipped CIGAR This option moves a long CIGAR to the `CG` tag and leaves a fully clipped CIGAR
at the SAM CIGAR column. Current tools that don't read CIGAR (e.g. merging and at the SAM CIGAR column. Current tools that don't read CIGAR (e.g. merging and
sorting) still work with such BAM records; tools that read CIGAR will sorting) still work with such BAM records; tools that read CIGAR will
effectively ignore these records. It has been decided that future tools will effectively ignore these records. It has been decided that future tools
will seamlessly recognize long-cigar records generated by option `-L`. will seamlessly recognize long-cigar records generated by option `-L`.
**TL;DR**: if you work with ultra-long reads and use tools that only process **TL;DR**: if you work with ultra-long reads and use tools that only process
@@ -249,7 +291,7 @@ CGATCGATAAATAGAGTAG---GAATAGCA
CGATCG---AATAGAGTAGGTCGAATtGCA CGATCG---AATAGAGTAGGTCGAATtGCA
``` ```
is represented as `:6-ata:10+gtc:4*at:3`, where `:[0-9]+` represents an is represented as `:6-ata:10+gtc:4*at:3`, where `:[0-9]+` represents an
identical block, `-ata` represents a deltion, `+gtc` an insertion and `*at` identical block, `-ata` represents a deletion, `+gtc` an insertion and `*at`
indicates reference base `a` is substituted with a query base `t`. It is indicates reference base `a` is substituted with a query base `t`. It is
similar to the `MD` SAM tag but is standalone and easier to parse. similar to the `MD` SAM tag but is standalone and easier to parse.
@@ -315,16 +357,22 @@ highlighted in bold. The description may help to tune minimap2 parameters.
### <a name="help"></a>Getting help ### <a name="help"></a>Getting help
Manpage [minimap2.1][manpage] provides detailed description of minimap2 Manpage [minimap2.1][manpage] provides detailed description of minimap2
command line options and optional tags. If you encounter bugs or have further command line options and optional tags. The [FAQ](FAQ.md) page answers several
questions or requests, you can raise an issue at the [issue page][issue]. frequently asked questions. If you encounter bugs or have further questions or
There is not a specific mailing list for the time being. requests, you can raise an issue at the [issue page][issue]. There is not a
specific mailing list for the time being.
### <a name="cite"></a>Citing minimap2 ### <a name="cite"></a>Citing minimap2
If you use minimap2 in your work, please cite: If you use minimap2 in your work, please cite:
> Li, H. (2018). Minimap2: pairwise alignment for nucleotide sequences. > Li, H. (2018). Minimap2: pairwise alignment for nucleotide sequences.
> Bioinformatics. [doi:10.1093/bioinformatics/bty191][doi] > *Bioinformatics*, **34**:3094-3100. [doi:10.1093/bioinformatics/bty191][doi]
and/or:
> Li, H. (2021). New strategies to improve minimap2 alignment accuracy.
> *Bioinformatics*, **37**:4572-4574. [doi:10.1093/bioinformatics/btab705][doi2]
## <a name="dguide"></a>Developers' Guide ## <a name="dguide"></a>Developers' Guide
@@ -355,6 +403,8 @@ mappy` or [from BioConda][mappyconda] via `conda install -c bioconda mappy`.
billion bases or longer (2,147,483,647 to be exact). The total length of all billion bases or longer (2,147,483,647 to be exact). The total length of all
sequences can well exceed this threshold. sequences can well exceed this threshold.
* Minimap2 often misses small exons.
[paf]: https://github.com/lh3/miniasm/blob/master/PAF.md [paf]: https://github.com/lh3/miniasm/blob/master/PAF.md
@@ -373,3 +423,6 @@ mappy` or [from BioConda][mappyconda] via `conda install -c bioconda mappy`.
[manpage]: https://lh3.github.io/minimap2/minimap2.html [manpage]: https://lh3.github.io/minimap2/minimap2.html
[manpage-cs]: https://lh3.github.io/minimap2/minimap2.html#10 [manpage-cs]: https://lh3.github.io/minimap2/minimap2.html#10
[doi]: https://doi.org/10.1093/bioinformatics/bty191 [doi]: https://doi.org/10.1093/bioinformatics/bty191
[doi2]: https://doi.org/10.1093/bioinformatics/btab705
[simde]: https://github.com/nemequ/simde
[unimap]: https://github.com/lh3/unimap
+379 -145
View File
@@ -6,6 +6,8 @@
#include "mmpriv.h" #include "mmpriv.h"
#include "ksw2.h" #include "ksw2.h"
#define MM_MAX_QLEN_FLANK 100
static void ksw_gen_simple_mat(int m, int8_t *mat, int8_t a, int8_t b, int8_t sc_ambi) static void ksw_gen_simple_mat(int m, int8_t *mat, int8_t a, int8_t b, int8_t sc_ambi)
{ {
int i, j; int i, j;
@@ -21,6 +23,18 @@ static void ksw_gen_simple_mat(int m, int8_t *mat, int8_t a, int8_t b, int8_t sc
mat[(m - 1) * m + j] = sc_ambi; mat[(m - 1) * m + j] = sc_ambi;
} }
static void ksw_gen_ts_mat(int m, int8_t *mat, int8_t a, int8_t b, int8_t transition, int8_t sc_ambi)
{
assert(m == 5);
ksw_gen_simple_mat(m, mat, a, b, sc_ambi);
if (transition == 0 || transition == b) return;
transition = transition > 0? -transition : transition;
mat[0 * m + 2] = transition; // A->G
mat[1 * m + 3] = transition; // C->T
mat[2 * m + 0] = transition; // G->A
mat[3 * m + 1] = transition; // T->C
}
static inline void mm_seq_rev(uint32_t len, uint8_t *seq) static inline void mm_seq_rev(uint32_t len, uint8_t *seq)
{ {
uint32_t i; uint32_t i;
@@ -38,8 +52,8 @@ static inline void update_max_zdrop(int32_t score, int i, int j, int32_t *max, i
int z = *max - score - diff * e; int z = *max - score - diff * e;
if (z > *max_zdrop) { if (z > *max_zdrop) {
*max_zdrop = z; *max_zdrop = z;
pos[0][0] = *max_i, pos[0][1] = i + 1; pos[0][0] = *max_i, pos[0][1] = i;
pos[1][0] = *max_j, pos[1][1] = j + 1; pos[1][0] = *max_j, pos[1][1] = j;
} }
} else *max = score, *max_i = i, *max_j = j; } else *max = score, *max_i = i, *max_j = j;
} }
@@ -53,16 +67,16 @@ static int mm_test_zdrop(void *km, const mm_mapopt_t *opt, const uint8_t *qseq,
// find the score and the region where score drops most along diagonal // find the score and the region where score drops most along diagonal
for (k = 0, score = 0; k < n_cigar; ++k) { for (k = 0, score = 0; k < n_cigar; ++k) {
uint32_t l, op = cigar[k]&0xf, len = cigar[k]>>4; uint32_t l, op = cigar[k]&0xf, len = cigar[k]>>4;
if (op == 0) { if (op == MM_CIGAR_MATCH) {
for (l = 0; l < len; ++l) { for (l = 0; l < len; ++l) {
score += mat[tseq[i + l] * 5 + qseq[j + l]]; score += mat[tseq[i + l] * 5 + qseq[j + l]];
update_max_zdrop(score, i+l, j+l, &max, &max_i, &max_j, opt->e, &max_zdrop, pos); update_max_zdrop(score, i+l, j+l, &max, &max_i, &max_j, opt->e, &max_zdrop, pos);
} }
i += len, j += len; i += len, j += len;
} else if (op == 1 || op == 2 || op == 3) { } else if (op == MM_CIGAR_INS || op == MM_CIGAR_DEL || op == MM_CIGAR_N_SKIP) {
score -= opt->q + opt->e * len; score -= opt->q + opt->e * len;
if (op == 1) j += len; // insertion if (op == MM_CIGAR_INS) j += len;
else i += len; // deletion else i += len;
update_max_zdrop(score, i, j, &max, &max_i, &max_j, opt->e, &max_zdrop, pos); update_max_zdrop(score, i, j, &max, &max_i, &max_j, opt->e, &max_zdrop, pos);
} }
} }
@@ -98,12 +112,12 @@ static void mm_fix_cigar(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq,
for (k = 0; k < p->n_cigar; ++k) { // indel left alignment for (k = 0; k < p->n_cigar; ++k) { // indel left alignment
uint32_t op = p->cigar[k]&0xf, len = p->cigar[k]>>4; uint32_t op = p->cigar[k]&0xf, len = p->cigar[k]>>4;
if (len == 0) to_shrink = 1; if (len == 0) to_shrink = 1;
if (op == 0) { if (op == MM_CIGAR_MATCH) {
toff += len, qoff += len; toff += len, qoff += len;
} else if (op == 1 || op == 2) { // insertion or deletion } else if (op == MM_CIGAR_INS || op == MM_CIGAR_DEL) {
if (k > 0 && k < p->n_cigar - 1 && (p->cigar[k-1]&0xf) == 0 && (p->cigar[k+1]&0xf) == 0) { if (k > 0 && k < p->n_cigar - 1 && (p->cigar[k-1]&0xf) == 0 && (p->cigar[k+1]&0xf) == 0) {
int l, prev_len = p->cigar[k-1] >> 4; int l, prev_len = p->cigar[k-1] >> 4;
if (op == 1) { if (op == MM_CIGAR_INS) {
for (l = 0; l < prev_len; ++l) for (l = 0; l < prev_len; ++l)
if (qseq[qoff - 1 - l] != qseq[qoff + len - 1 - l]) if (qseq[qoff - 1 - l] != qseq[qoff + len - 1 - l])
break; break;
@@ -116,13 +130,32 @@ static void mm_fix_cigar(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq,
p->cigar[k-1] -= l<<4, p->cigar[k+1] += l<<4, qoff -= l, toff -= l; p->cigar[k-1] -= l<<4, p->cigar[k+1] += l<<4, qoff -= l, toff -= l;
if (l == prev_len) to_shrink = 1; if (l == prev_len) to_shrink = 1;
} }
if (op == 1) qoff += len; if (op == MM_CIGAR_INS) qoff += len;
else toff += len; else toff += len;
} else if (op == 3) { } else if (op == MM_CIGAR_N_SKIP) {
toff += len; toff += len;
} }
} }
assert(qoff == r->qe - r->qs && toff == r->re - r->rs); assert(qoff == r->qe - r->qs && toff == r->re - r->rs);
for (k = 0; k < p->n_cigar - 2; ++k) { // fix CIGAR like 5I6D7I
if ((p->cigar[k]&0xf) > 0 && (p->cigar[k]&0xf) + (p->cigar[k+1]&0xf) == 3) {
uint32_t l, s[3] = {0,0,0};
for (l = k; l < p->n_cigar; ++l) { // count number of adjacent I and D
uint32_t op = p->cigar[l]&0xf;
if (op == MM_CIGAR_INS || op == MM_CIGAR_DEL || p->cigar[l]>>4 == 0)
s[op] += p->cigar[l] >> 4;
else break;
}
if (s[1] > 0 && s[2] > 0 && l - k > 2) { // turn to a single I and a single D
p->cigar[k] = s[1]<<4|MM_CIGAR_INS;
p->cigar[k+1] = s[2]<<4|MM_CIGAR_DEL;
for (k += 2; k < l; ++k)
p->cigar[k] &= 0xf;
to_shrink = 1;
}
k = l;
}
}
if (to_shrink) { // squeeze out zero-length operations if (to_shrink) { // squeeze out zero-length operations
int32_t l = 0; int32_t l = 0;
for (k = 0; k < p->n_cigar; ++k) // squeeze out zero-length operations for (k = 0; k < p->n_cigar; ++k) // squeeze out zero-length operations
@@ -135,9 +168,9 @@ static void mm_fix_cigar(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq,
else p->cigar[k+1] += p->cigar[k]>>4<<4; // add length to the next CIGAR operator else p->cigar[k+1] += p->cigar[k]>>4<<4; // add length to the next CIGAR operator
p->n_cigar = l; p->n_cigar = l;
} }
if ((p->cigar[0]&0xf) == 1 || (p->cigar[0]&0xf) == 2) { // get rid of leading I or D if ((p->cigar[0]&0xf) == MM_CIGAR_INS || (p->cigar[0]&0xf) == MM_CIGAR_DEL) { // get rid of leading I or D
int32_t l = p->cigar[0] >> 4; int32_t l = p->cigar[0] >> 4;
if ((p->cigar[0]&0xf) == 1) { if ((p->cigar[0]&0xf) == MM_CIGAR_INS) {
if (r->rev) r->qe -= l; if (r->rev) r->qe -= l;
else r->qs += l; else r->qs += l;
*qshift = l; *qshift = l;
@@ -147,78 +180,6 @@ static void mm_fix_cigar(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq,
} }
} }
static void mm_update_extra(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq, const int8_t *mat, int8_t q, int8_t e)
{
uint32_t k, l;
int32_t s = 0, max = 0, qshift, tshift, toff = 0, qoff = 0;
mm_extra_t *p = r->p;
if (p == 0) return;
mm_fix_cigar(r, qseq, tseq, &qshift, &tshift);
qseq += qshift, tseq += tshift; // qseq and tseq may be shifted due to the removal of leading I/D
r->blen = r->mlen = 0;
for (k = 0; k < p->n_cigar; ++k) {
uint32_t op = p->cigar[k]&0xf, len = p->cigar[k]>>4;
if (op == 0) { // match/mismatch
int n_ambi = 0, n_diff = 0;
for (l = 0; l < len; ++l) {
int cq = qseq[qoff + l], ct = tseq[toff + l];
if (ct > 3 || cq > 3) ++n_ambi;
else if (ct != cq) ++n_diff;
s += mat[ct * 5 + cq];
if (s < 0) s = 0;
else max = max > s? max : s;
}
r->blen += len - n_ambi, r->mlen += len - (n_ambi + n_diff), p->n_ambi += n_ambi;
toff += len, qoff += len;
} else if (op == 1) { // insertion
int n_ambi = 0;
for (l = 0; l < len; ++l)
if (qseq[qoff + l] > 3) ++n_ambi;
r->blen += len - n_ambi, p->n_ambi += n_ambi;
s -= q + e * len;
if (s < 0) s = 0;
qoff += len;
} else if (op == 2) { // deletion
int n_ambi = 0;
for (l = 0; l < len; ++l)
if (tseq[toff + l] > 3) ++n_ambi;
r->blen += len - n_ambi, p->n_ambi += n_ambi;
s -= q + e * len;
if (s < 0) s = 0;
toff += len;
} else if (op == 3) { // intron
toff += len;
}
}
p->dp_max = max;
assert(qoff == r->qe - r->qs && toff == r->re - r->rs);
}
static void mm_append_cigar(mm_reg1_t *r, uint32_t n_cigar, uint32_t *cigar) // TODO: this calls the libc realloc()
{
mm_extra_t *p;
if (n_cigar == 0) return;
if (r->p == 0) {
uint32_t capacity = n_cigar + sizeof(mm_extra_t)/4;
kroundup32(capacity);
r->p = (mm_extra_t*)calloc(capacity, 4);
r->p->capacity = capacity;
} else if (r->p->n_cigar + n_cigar + sizeof(mm_extra_t)/4 > r->p->capacity) {
r->p->capacity = r->p->n_cigar + n_cigar + sizeof(mm_extra_t)/4;
kroundup32(r->p->capacity);
r->p = (mm_extra_t*)realloc(r->p, r->p->capacity * 4);
}
p = r->p;
if (p->n_cigar > 0 && (p->cigar[p->n_cigar-1]&0xf) == (cigar[0]&0xf)) { // same CIGAR op at the boundary
p->cigar[p->n_cigar-1] += cigar[0]>>4<<4;
if (n_cigar > 1) memcpy(p->cigar + p->n_cigar, cigar + 1, (n_cigar - 1) * 4);
p->n_cigar += n_cigar - 1;
} else {
memcpy(p->cigar + p->n_cigar, cigar, n_cigar * 4);
p->n_cigar += n_cigar;
}
}
static void mm_update_cigar_eqx(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq) // written by @armintoepfer static void mm_update_cigar_eqx(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq) // written by @armintoepfer
{ {
uint32_t n_EQX = 0; uint32_t n_EQX = 0;
@@ -227,7 +188,7 @@ static void mm_update_cigar_eqx(mm_reg1_t *r, const uint8_t *qseq, const uint8_t
if (r->p == 0) return; if (r->p == 0) return;
for (k = 0; k < r->p->n_cigar; ++k) { for (k = 0; k < r->p->n_cigar; ++k) {
uint32_t op = r->p->cigar[k]&0xf, len = r->p->cigar[k]>>4; uint32_t op = r->p->cigar[k]&0xf, len = r->p->cigar[k]>>4;
if (op == 0) { if (op == MM_CIGAR_MATCH) {
while (len > 0) { while (len > 0) {
for (l = 0; l < len && qseq[qoff + l] == tseq[toff + l]; ++l) {} // run of "="; TODO: N<=>N is converted to "=" for (l = 0; l < len && qseq[qoff + l] == tseq[toff + l]; ++l) {} // run of "="; TODO: N<=>N is converted to "="
if (l > 0) { ++n_EQX; len -= l; toff += l; qoff += l; } if (l > 0) { ++n_EQX; len -= l; toff += l; qoff += l; }
@@ -236,11 +197,11 @@ static void mm_update_cigar_eqx(mm_reg1_t *r, const uint8_t *qseq, const uint8_t
if (l > 0) { ++n_EQX; len -= l; toff += l; qoff += l; } if (l > 0) { ++n_EQX; len -= l; toff += l; qoff += l; }
} }
++n_M; ++n_M;
} else if (op == 1) { // insertion } else if (op == MM_CIGAR_INS) {
qoff += len; qoff += len;
} else if (op == 2) { // deletion } else if (op == MM_CIGAR_DEL) {
toff += len; toff += len;
} else if (op == 3) { // intron } else if (op == MM_CIGAR_N_SKIP) {
toff += len; toff += len;
} }
} }
@@ -248,7 +209,7 @@ static void mm_update_cigar_eqx(mm_reg1_t *r, const uint8_t *qseq, const uint8_t
if (n_EQX == n_M) { if (n_EQX == n_M) {
for (k = 0; k < r->p->n_cigar; ++k) { for (k = 0; k < r->p->n_cigar; ++k) {
uint32_t op = r->p->cigar[k]&0xf, len = r->p->cigar[k]>>4; uint32_t op = r->p->cigar[k]&0xf, len = r->p->cigar[k]>>4;
if (op == 0) r->p->cigar[k] = len << 4 | 7; if (op == MM_CIGAR_MATCH) r->p->cigar[k] = len << 4 | MM_CIGAR_EQ_MATCH;
} }
return; return;
} }
@@ -262,25 +223,25 @@ static void mm_update_cigar_eqx(mm_reg1_t *r, const uint8_t *qseq, const uint8_t
toff = qoff = m = 0; toff = qoff = m = 0;
for (k = 0; k < r->p->n_cigar; ++k) { for (k = 0; k < r->p->n_cigar; ++k) {
uint32_t op = r->p->cigar[k]&0xf, len = r->p->cigar[k]>>4; uint32_t op = r->p->cigar[k]&0xf, len = r->p->cigar[k]>>4;
if (op == 0) { // match/mismatch if (op == MM_CIGAR_MATCH) {
while (len > 0) { while (len > 0) {
// match // match
for (l = 0; l < len && qseq[qoff + l] == tseq[toff + l]; ++l) {} for (l = 0; l < len && qseq[qoff + l] == tseq[toff + l]; ++l) {}
if (l > 0) p->cigar[m++] = l << 4 | 7; if (l > 0) p->cigar[m++] = l << 4 | MM_CIGAR_EQ_MATCH;
len -= l; len -= l;
toff += l, qoff += l; toff += l, qoff += l;
// mismatch // mismatch
for (l = 0; l < len && qseq[qoff + l] != tseq[toff + l]; ++l) {} for (l = 0; l < len && qseq[qoff + l] != tseq[toff + l]; ++l) {}
if (l > 0) p->cigar[m++] = l << 4 | 8; if (l > 0) p->cigar[m++] = l << 4 | MM_CIGAR_X_MISMATCH;
len -= l; len -= l;
toff += l, qoff += l; toff += l, qoff += l;
} }
continue; continue;
} else if (op == 1) { // insertion } else if (op == MM_CIGAR_INS) {
qoff += len; qoff += len;
} else if (op == 2) { // deletion } else if (op == MM_CIGAR_DEL) {
toff += len; toff += len;
} else if (op == 3) { // intron } else if (op == MM_CIGAR_N_SKIP) {
toff += len; toff += len;
} }
p->cigar[m++] = r->p->cigar[k]; p->cigar[m++] = r->p->cigar[k];
@@ -290,31 +251,161 @@ static void mm_update_cigar_eqx(mm_reg1_t *r, const uint8_t *qseq, const uint8_t
r->p = p; r->p = p;
} }
static void mm_align_pair(void *km, const mm_mapopt_t *opt, int qlen, const uint8_t *qseq, int tlen, const uint8_t *tseq, const int8_t *mat, int w, int end_bonus, int zdrop, int flag, ksw_extz_t *ez) static void mm_update_extra(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq, const int8_t *mat, int8_t q, int8_t e, int is_eqx, int log_gap)
{
uint32_t k, l;
int32_t qshift, tshift, toff = 0, qoff = 0;
double s = 0.0, max = 0.0;
mm_extra_t *p = r->p;
if (p == 0) return;
mm_fix_cigar(r, qseq, tseq, &qshift, &tshift);
qseq += qshift, tseq += tshift; // qseq and tseq may be shifted due to the removal of leading I/D
r->blen = r->mlen = 0, r->is_spliced = 0;
for (k = 0; k < p->n_cigar; ++k) {
uint32_t op = p->cigar[k]&0xf, len = p->cigar[k]>>4;
if (op == MM_CIGAR_MATCH) {
int n_ambi = 0, n_diff = 0;
for (l = 0; l < len; ++l) {
int cq = qseq[qoff + l], ct = tseq[toff + l];
if (ct > 3 || cq > 3) ++n_ambi;
else if (ct != cq) ++n_diff;
s += mat[ct * 5 + cq];
if (s < 0) s = 0;
else max = max > s? max : s;
}
r->blen += len - n_ambi, r->mlen += len - (n_ambi + n_diff), p->n_ambi += n_ambi;
toff += len, qoff += len;
} else if (op == MM_CIGAR_INS) {
int n_ambi = 0;
for (l = 0; l < len; ++l)
if (qseq[qoff + l] > 3) ++n_ambi;
r->blen += len - n_ambi, p->n_ambi += n_ambi;
if (log_gap) s -= q + (double)e * mg_log2(1.0 + len);
else s -= q + e;
if (s < 0) s = 0;
qoff += len;
} else if (op == MM_CIGAR_DEL) {
int n_ambi = 0;
for (l = 0; l < len; ++l)
if (tseq[toff + l] > 3) ++n_ambi;
r->blen += len - n_ambi, p->n_ambi += n_ambi;
if (log_gap) s -= q + (double)e * mg_log2(1.0 + len);
else s -= q + e;
if (s < 0) s = 0;
toff += len;
} else if (op == MM_CIGAR_N_SKIP) {
r->is_spliced = 1, toff += len;
}
}
p->dp_max = p->dp_max0 = (int32_t)(max + .499);
assert(qoff == r->qe - r->qs && toff == r->re - r->rs);
if (is_eqx) mm_update_cigar_eqx(r, qseq, tseq); // NB: it has to be called here as changes to qseq and tseq are not returned
}
void mm_enlarge_cigar(mm_reg1_t *r, uint32_t n_cigar) // TODO: this calls the libc realloc()
{
if (n_cigar == 0) return;
if (r->p == 0) {
uint32_t capacity = n_cigar + sizeof(mm_extra_t)/4;
kroundup32(capacity);
r->p = (mm_extra_t*)calloc(capacity, 4);
r->p->capacity = capacity;
} else if (r->p->n_cigar + n_cigar + sizeof(mm_extra_t)/4 > r->p->capacity) {
r->p->capacity = r->p->n_cigar + n_cigar + sizeof(mm_extra_t)/4;
kroundup32(r->p->capacity);
r->p = (mm_extra_t*)realloc(r->p, r->p->capacity * 4);
}
}
static void mm_append_cigar(mm_reg1_t *r, uint32_t n_cigar, const uint32_t *cigar)
{
mm_extra_t *p;
if (n_cigar == 0) return;
mm_enlarge_cigar(r, n_cigar);
p = r->p;
if (p->n_cigar > 0 && (p->cigar[p->n_cigar-1]&0xf) == (cigar[0]&0xf)) { // same CIGAR op at the boundary
p->cigar[p->n_cigar-1] += cigar[0]>>4<<4;
if (n_cigar > 1) memcpy(p->cigar + p->n_cigar, cigar + 1, (n_cigar - 1) * 4);
p->n_cigar += n_cigar - 1;
} else {
memcpy(p->cigar + p->n_cigar, cigar, n_cigar * 4);
p->n_cigar += n_cigar;
}
}
static void mm_align_pair(void *km, const mm_mapopt_t *opt, int qlen, const uint8_t *qseq, int tlen, const uint8_t *tseq, const uint8_t *junc,
const int8_t *mat, int w, int end_bonus, int zdrop, int ksw_flag, ksw_extz_t *ez)
{ {
if (mm_dbg_flag & MM_DBG_PRINT_ALN_SEQ) { if (mm_dbg_flag & MM_DBG_PRINT_ALN_SEQ) {
int i; int i;
fprintf(stderr, "===> q=(%d,%d), e=(%d,%d), bw=%d, flag=%d, zdrop=%d <===\n", opt->q, opt->q2, opt->e, opt->e2, w, flag, opt->zdrop); fprintf(stderr, "===> q=(%d,%d), e=(%d,%d), bw=%d, ksw_flag=%d, zdrop=%d, end_bonus=%d <===\n", opt->q, opt->q2, opt->e, opt->e2, w, ksw_flag, opt->zdrop, end_bonus);
for (i = 0; i < tlen; ++i) fputc("ACGTN"[tseq[i]], stderr); for (i = 0; i < tlen; ++i) fputc("ACGTN"[tseq[i]], stderr);
fputc('\n', stderr); fputc('\n', stderr);
for (i = 0; i < qlen; ++i) fputc("ACGTN"[qseq[i]], stderr); for (i = 0; i < qlen; ++i) fputc("ACGTN"[qseq[i]], stderr);
fputc('\n', stderr); fputc('\n', stderr);
} }
if (opt->flag & MM_F_SPLICE) if (opt->transition != 0 && opt->b != opt->transition)
ksw_exts2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->noncan, zdrop, flag, ez); ksw_flag |= KSW_EZ_GENERIC_SC;
else if (opt->q == opt->q2 && opt->e == opt->e2) if (opt->max_sw_mat > 0 && (int64_t)tlen * qlen > opt->max_sw_mat) { // too much memory; skip alignment
ksw_extz2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, w, zdrop, end_bonus, flag, ez); ksw_reset_extz(ez);
else ez->zdropped = 1;
ksw_extd2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->e2, w, zdrop, end_bonus, flag, ez); } else if (opt->flag & MM_F_SPLICE) { // spliced alignment
assert((ksw_flag & KSW_EZ_SPLICE_FOR) == 0 || (ksw_flag & KSW_EZ_SPLICE_REV) == 0);
if (!(opt->flag & MM_F_SPLICE_OLD)) ksw_flag |= KSW_EZ_SPLICE_CMPLX;
ksw_exts2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->noncan, zdrop, end_bonus, opt->junc_bonus, opt->junc_pen, ksw_flag, junc, ez);
} else if (opt->q == opt->q2 && opt->e == opt->e2) { // affine gap
ksw_extz2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, w, zdrop, end_bonus, ksw_flag, ez);
} else { // dual affine gap
ksw_extd2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->e2, w, zdrop, end_bonus, ksw_flag, ez);
}
if (mm_dbg_flag & MM_DBG_PRINT_ALN_SEQ) { if (mm_dbg_flag & MM_DBG_PRINT_ALN_SEQ) {
int i; int i;
fprintf(stderr, "score=%d, cigar=", ez->score); fprintf(stderr, "score=%d, cigar=", ez->score);
for (i = 0; i < ez->n_cigar; ++i) for (i = 0; i < ez->n_cigar; ++i)
fprintf(stderr, "%d%c", ez->cigar[i]>>4, "MIDN"[ez->cigar[i]&0xf]); fprintf(stderr, "%d%c", ez->cigar[i]>>4, MM_CIGAR_STR[ez->cigar[i]&0xf]);
fprintf(stderr, "\n"); fprintf(stderr, "\n");
} }
} }
static int mm_align_sr_rna(void *km, const mm_mapopt_t *opt, int qlen, const uint8_t *qseq, int tlen, const uint8_t *tseq, const uint8_t *junc, uint8_t *tseq2, uint8_t *junc2,
const int8_t *mat, int w, int end_bonus, int zdrop, int ksw_flag, ksw_extz_t *ez)
{
int32_t ilen = opt->q2 * 2, tlen2 = qlen * 2 + ilen;
int32_t i, ll = 0, lr = 0, nn = 0, n_ins = 0;
if (!(opt->flag & MM_F_SPLICE)) return 0; // only for spliced alignment
if (qlen > MM_MAX_QLEN_FLANK || qlen * 2 + ilen > tlen) return 0; // the query sequence can't be too long and the target sequence must be long enough
for (i = 0; i < qlen; ++i) // exact match length from the left
if (qseq[i] == tseq[i] && qseq[i] < 4)
++ll;
for (i = 0; i < qlen; ++i) // exact match length from the right
if (qseq[qlen - 1 - i] == tseq[tlen - 1 - i] && qseq[qlen - 1 - i] < 4)
++lr;
if (qlen - (ll + lr) > 9) return 0; // qlen may be smaller than ll+lr
memcpy(tseq2, tseq, qlen);
memset(&tseq2[qlen], 4, ilen);
memcpy(&tseq2[qlen + ilen], &tseq[tlen - qlen], qlen);
if (junc) {
memcpy(junc2, junc, qlen);
memset(&junc2[qlen], 0, ilen);
memcpy(&junc2[qlen + ilen], &junc[tlen - qlen], qlen);
}
if (!(opt->flag & MM_F_SPLICE_OLD)) ksw_flag |= KSW_EZ_SPLICE_CMPLX;
ksw_exts2_sse(km, qlen, qseq, tlen2, tseq2, 5, mat, opt->q, opt->e, opt->q2, opt->noncan, zdrop, end_bonus, opt->junc_bonus, opt->junc_pen, ksw_flag, junc2, ez);
if (ez->zdropped) return 0;
if ((ez->cigar[0]&0xf) != KSW_CIGAR_MATCH || (ez->cigar[ez->n_cigar-1]&0xf) != KSW_CIGAR_MATCH) return 0;
for (i = 0; i < ez->n_cigar; ++i) { // count the number of introns in the alignment
if ((ez->cigar[i]&0xf) == KSW_CIGAR_N_SKIP)
++nn;
else if ((ez->cigar[i]&0xf) == KSW_CIGAR_INS)
++n_ins;
}
if (nn != 1 || n_ins > 0) return 0; // the heuristic only works when there is exactly one intron
for (i = 0; i < ez->n_cigar; ++i)
if ((ez->cigar[i]&0xf) == KSW_CIGAR_N_SKIP)
ez->cigar[i] += (tlen - tlen2) << 4;
return 1;
}
static inline int mm_get_hplen_back(const mm_idx_t *mi, uint32_t rid, uint32_t x) static inline int mm_get_hplen_back(const mm_idx_t *mi, uint32_t rid, uint32_t x)
{ {
int64_t i, off0 = mi->seq[rid].offset, off = off0 + x; int64_t i, off0 = mi->seq[rid].offset, off = off0 + x;
@@ -414,7 +505,7 @@ static void mm_filter_bad_seeds_alt(void *km, int as1, int cnt1, mm128_t *a, int
gap2 = ((int32_t)a[as1 + j].y - (int32_t)a[as1 + j - 1].y) - (int32_t)(a[as1 + j].x - a[as1 + j - 1].x); gap2 = ((int32_t)a[as1 + j].y - (int32_t)a[as1 + j - 1].y) - (int32_t)(a[as1 + j].x - a[as1 + j - 1].x);
q_span_pre = a[as1 + j - 1].y >> 32 & 0xff; q_span_pre = a[as1 + j - 1].y >> 32 & 0xff;
rs2 = (int32_t)a[as1 + j - 1].x + q_span_pre; rs2 = (int32_t)a[as1 + j - 1].x + q_span_pre;
qs2 = (int32_t)a[as1 + j - 1].x + q_span_pre; qs2 = (int32_t)a[as1 + j - 1].y + q_span_pre;
m = rs2 - re1 < qs2 - qe1? rs2 - re1 : qs2 - qe1; m = rs2 - re1 < qs2 - qe1? rs2 - re1 : qs2 - qe1;
gap2 = gap2 > 0? gap2 : -gap2; gap2 = gap2 > 0? gap2 : -gap2;
if (m > gap1 + gap2) break; if (m > gap1 + gap2) break;
@@ -510,8 +601,13 @@ static int mm_seed_ext_score(void *km, const mm_mapopt_t *opt, const mm_idx_t *m
re = re + ext_len < (int32_t)mi->seq[rid].len? re + ext_len : mi->seq[rid].len; re = re + ext_len < (int32_t)mi->seq[rid].len? re + ext_len : mi->seq[rid].len;
qe = qe + ext_len < qlen? qe + ext_len : qlen; qe = qe + ext_len < qlen? qe + ext_len : qlen;
tseq = (uint8_t*)kmalloc(km, re - rs); tseq = (uint8_t*)kmalloc(km, re - rs);
mm_idx_getseq(mi, rid, rs, re, tseq); if (opt->flag & MM_F_QSTRAND) {
qseq = qseq0[0] + qs;
mm_idx_getseq2(mi, a->x>>63, rid, rs, re, tseq);
} else {
qseq = qseq0[a->x>>63] + qs; qseq = qseq0[a->x>>63] + qs;
mm_idx_getseq(mi, rid, rs, re, tseq);
}
qp = ksw_ll_qinit(km, 2, qe - qs, qseq, 5, mat); qp = ksw_ll_qinit(km, 2, qe - qs, qseq, 5, mat);
score = ksw_ll_i16(qp, re - rs, tseq, opt->q, opt->e, &q_off, &t_off); score = ksw_ll_i16(qp, re - rs, tseq, opt->q, opt->e, &q_off, &t_off);
kfree(km, tseq); kfree(km, tseq);
@@ -539,12 +635,19 @@ static void mm_fix_bad_ends_splice(void *km, const mm_mapopt_t *opt, const mm_id
} }
} }
static inline void mm_get_junc(const mm_idx_t *mi, int32_t ctg, int32_t st, int32_t en, int32_t rev, uint8_t *junc)
{
if (mi->spsc) mm_idx_spsc_get(mi, ctg, st, en, rev, junc);
else if (mi->I) mm_idx_bed_junc(mi, ctg, st, en, junc);
else memset(junc, 0, en - st);
}
static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, uint8_t *qseq0[2], mm_reg1_t *r, mm_reg1_t *r2, int n_a, mm128_t *a, ksw_extz_t *ez, int splice_flag) static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, uint8_t *qseq0[2], mm_reg1_t *r, mm_reg1_t *r2, int n_a, mm128_t *a, ksw_extz_t *ez, int splice_flag)
{ {
int is_sr = !!(opt->flag & MM_F_SR), is_splice = !!(opt->flag & MM_F_SPLICE); int is_sr = !!(opt->flag & MM_F_SR), is_splice = !!(opt->flag & MM_F_SPLICE), is_sr_rna = (!!(opt->flag & MM_F_SR_RNA) && is_splice);
int32_t rid = a[r->as].x<<1>>33, rev = a[r->as].x>>63, as1, cnt1; int32_t rid = a[r->as].x<<1>>33, rev = a[r->as].x>>63, as1, cnt1;
uint8_t *tseq, *qseq; uint8_t *tseq, *qseq, *junc, *tseq2 = 0, *junc2 = 0;
int32_t i, l, bw, dropped = 0, extra_flag = 0, rs0, re0, qs0, qe0; int32_t i, l, bw, bw_long, dropped = 0, ksw_flag = 0, rs0, re0, qs0, qe0;
int32_t rs, re, qs, qe; int32_t rs, re, qs, qe;
int32_t rs1, qs1, re1, qe1; int32_t rs1, qs1, re1, qe1;
int8_t mat[25]; int8_t mat[25];
@@ -553,8 +656,10 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
r2->cnt = 0; r2->cnt = 0;
if (r->cnt == 0) return; if (r->cnt == 0) return;
ksw_gen_simple_mat(5, mat, opt->a, opt->b, opt->sc_ambi); ksw_gen_ts_mat(5, mat, opt->a, opt->b, opt->transition, opt->sc_ambi);
bw = (int)(opt->bw * 1.5 + 1.); bw = (int)(opt->bw * 1.5 + 1.);
bw_long = (int)(opt->bw_long * 1.5 + 1.);
if (bw_long < bw) bw_long = bw;
if (is_sr && !(mi->flag & MM_I_HPC)) { if (is_sr && !(mi->flag & MM_I_HPC)) {
mm_max_stretch(r, a, &as1, &cnt1); mm_max_stretch(r, a, &as1, &cnt1);
@@ -577,9 +682,10 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
assert(cnt1 > 0); assert(cnt1 > 0);
if (is_splice) { if (is_splice) {
if (splice_flag & MM_F_SPLICE_FOR) extra_flag |= rev? KSW_EZ_SPLICE_REV : KSW_EZ_SPLICE_FOR; if (splice_flag & MM_F_SPLICE_FOR) ksw_flag |= rev? KSW_EZ_SPLICE_REV : KSW_EZ_SPLICE_FOR;
if (splice_flag & MM_F_SPLICE_REV) extra_flag |= rev? KSW_EZ_SPLICE_FOR : KSW_EZ_SPLICE_REV; if (splice_flag & MM_F_SPLICE_REV) ksw_flag |= rev? KSW_EZ_SPLICE_FOR : KSW_EZ_SPLICE_REV;
if (opt->flag & MM_F_SPLICE_FLANK) extra_flag |= KSW_EZ_SPLICE_FLANK; if (opt->flag & MM_F_SPLICE_FLANK) ksw_flag |= KSW_EZ_SPLICE_FLANK;
if (mi->spsc) ksw_flag |= KSW_EZ_SPLICE_SCORE;
} }
/* Look for the start and end of regions to perform DP. This sounds easy /* Look for the start and end of regions to perform DP. This sounds easy
@@ -591,11 +697,9 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
qs0 = 0, qe0 = qlen; qs0 = 0, qe0 = qlen;
l = qs; l = qs;
l += l * opt->a + opt->end_bonus > opt->q? (l * opt->a + opt->end_bonus - opt->q) / opt->e : 0; l += l * opt->a + opt->end_bonus > opt->q? (l * opt->a + opt->end_bonus - opt->q) / opt->e : 0;
l = l < opt->bw? l : opt->bw;
rs0 = rs - l > 0? rs - l : 0; rs0 = rs - l > 0? rs - l : 0;
l = qlen - qe; l = qlen - qe;
l += l * opt->a + opt->end_bonus > opt->q? (l * opt->a + opt->end_bonus - opt->q) / opt->e : 0; l += l * opt->a + opt->end_bonus > opt->q? (l * opt->a + opt->end_bonus - opt->q) / opt->e : 0;
l = l < opt->bw? l : opt->bw;
re0 = re + l < (int32_t)mi->seq[rid].len? re + l : mi->seq[rid].len; re0 = re + l < (int32_t)mi->seq[rid].len? re + l : mi->seq[rid].len;
} else { } else {
// compute rs0 and qs0 // compute rs0 and qs0
@@ -611,6 +715,7 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
if (++l > opt->min_cnt) { if (++l > opt->min_cnt) {
l = rs0 - x > qs0 - y? rs0 - x : qs0 - y; l = rs0 - x > qs0 - y? rs0 - x : qs0 - y;
rs1 = rs0 - l, qs1 = qs0 - l; rs1 = rs0 - l, qs1 = qs0 - l;
if (rs1 < 0) rs1 = 0; // not strictly necessary; better have this guard for explicit
break; break;
} }
} }
@@ -624,6 +729,7 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
l = l < rs? l : rs; l = l < rs? l : rs;
rs1 = rs1 > rs - l? rs1 : rs - l; rs1 = rs1 > rs - l? rs1 : rs - l;
rs0 = rs0 < rs1? rs0 : rs1; rs0 = rs0 < rs1? rs0 : rs1;
rs0 = rs0 < rs? rs0 : rs;
} else rs0 = rs, qs0 = qs; } else rs0 = rs, qs0 = qs;
// compute re0 and qe0 // compute re0 and qe0
re0 = (int32_t)a[r->as + r->cnt - 1].x + 1; re0 = (int32_t)a[r->as + r->cnt - 1].x + 1;
@@ -662,13 +768,27 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
assert(re0 > rs0); assert(re0 > rs0);
tseq = (uint8_t*)kmalloc(km, re0 - rs0); tseq = (uint8_t*)kmalloc(km, re0 - rs0);
junc = (uint8_t*)kmalloc(km, re0 - rs0);
if (qs > 0 && rs > 0) { // left extension if (is_sr_rna) {
int32_t max_tlen2 = MM_MAX_QLEN_FLANK * 2 + opt->q2 * 2;
tseq2 = Kmalloc(km, uint8_t, max_tlen2 * 2);
junc2 = tseq2 + max_tlen2;
}
if (qs > 0 && rs > 0) { // left extension; probably the condition can be changed to "qs > qs0 && rs > rs0"
if (opt->flag & MM_F_QSTRAND) {
qseq = &qseq0[0][qs0];
mm_idx_getseq2(mi, rev, rid, rs0, rs, tseq);
} else {
qseq = &qseq0[rev][qs0]; qseq = &qseq0[rev][qs0];
mm_idx_getseq(mi, rid, rs0, rs, tseq); mm_idx_getseq(mi, rid, rs0, rs, tseq);
}
mm_get_junc(mi, rid, rs0, rs, !!(ksw_flag&KSW_EZ_SPLICE_REV), junc);
mm_seq_rev(qs - qs0, qseq); mm_seq_rev(qs - qs0, qseq);
mm_seq_rev(rs - rs0, tseq); mm_seq_rev(rs - rs0, tseq);
mm_align_pair(km, opt, qs - qs0, qseq, rs - rs0, tseq, mat, bw, opt->end_bonus, r->split_inv? opt->zdrop_inv : opt->zdrop, extra_flag|KSW_EZ_EXTZ_ONLY|KSW_EZ_RIGHT|KSW_EZ_REV_CIGAR, ez); mm_seq_rev(rs - rs0, junc);
mm_align_pair(km, opt, qs - qs0, qseq, rs - rs0, tseq, junc, mat, bw, opt->end_bonus, r->split_inv? opt->zdrop_inv : opt->zdrop, ksw_flag|KSW_EZ_EXTZ_ONLY|KSW_EZ_RIGHT|KSW_EZ_REV_CIGAR, ez);
if (ez->n_cigar > 0) { if (ez->n_cigar > 0) {
mm_append_cigar(r, ez->n_cigar, ez->cigar); mm_append_cigar(r, ez->n_cigar, ez->cigar);
r->p->dp_score += ez->max; r->p->dp_score += ez->max;
@@ -680,38 +800,59 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
re1 = rs, qe1 = qs; re1 = rs, qe1 = qs;
assert(qs1 >= 0 && rs1 >= 0); assert(qs1 >= 0 && rs1 >= 0);
for (i = is_sr? cnt1 - 1 : 1; i < cnt1; ++i) { // gap filling for (i = is_sr? cnt1 - 1 : 1; i < cnt1; ++i) { // gap filling; for short genomic reads, fill from the first seed to the last
if ((a[as1+i].y & (MM_SEED_IGNORE|MM_SEED_TANDEM)) && i != cnt1 - 1) continue; if ((a[as1+i].y & (MM_SEED_IGNORE|MM_SEED_TANDEM)) && i != cnt1 - 1) continue;
if (is_sr && !(mi->flag & MM_I_HPC)) { if (is_sr && !(mi->flag & MM_I_HPC)) {
re = (int32_t)a[as1 + i].x + 1; re = (int32_t)a[as1 + i].x + 1;
qe = (int32_t)a[as1 + i].y + 1; qe = (int32_t)a[as1 + i].y + 1;
} else mm_adjust_minier(mi, qseq0, &a[as1 + i], &re, &qe); } else mm_adjust_minier(mi, qseq0, &a[as1 + i], &re, &qe);
re1 = re, qe1 = qe; re1 = re, qe1 = qe;
if (i == cnt1 - 1 || (a[as1+i].y&MM_SEED_LONG_JOIN) || (qe - qs >= opt->min_ksw_len && re - rs >= opt->min_ksw_len)) { if (i == cnt1 - 1 || (a[as1+i].y&MM_SEED_LONG_JOIN) || (qe - qs >= opt->min_ksw_len && re - rs >= opt->min_ksw_len)) { // gap filling
int j, bw1 = bw, zdrop_code; int j, bw1 = bw_long, zdrop_code;
if (a[as1+i].y & MM_SEED_LONG_JOIN) if (a[as1+i].y & MM_SEED_LONG_JOIN)
bw1 = qe - qs > re - rs? qe - qs : re - rs; bw1 = qe - qs > re - rs? qe - qs : re - rs;
// perform alignment // perform alignment
if (opt->flag & MM_F_QSTRAND) {
qseq = &qseq0[0][qs];
mm_idx_getseq2(mi, rev, rid, rs, re, tseq);
} else {
qseq = &qseq0[rev][qs]; qseq = &qseq0[rev][qs];
mm_idx_getseq(mi, rid, rs, re, tseq); mm_idx_getseq(mi, rid, rs, re, tseq);
if (is_sr) { // perform ungapped alignment }
mm_get_junc(mi, rid, rs, re, !!(ksw_flag&KSW_EZ_SPLICE_REV), junc);
if (is_sr || (is_sr_rna && qe - qs == re - rs)) { // perform ungapped alignment
int32_t max_gapped_score = (qe - qs - 2) * opt->a - 2 * (opt->q + opt->e);
assert(qe - qs == re - rs); assert(qe - qs == re - rs);
ksw_reset_extz(ez); ksw_reset_extz(ez);
for (j = 0, ez->score = 0; j < qe - qs; ++j) { for (j = 0, ez->score = 0; j < qe - qs; ++j) {
if (qseq[j] >= 4 || tseq[j] >= 4) ez->score += opt->e2; if (qseq[j] >= 4 || tseq[j] >= 4) ez->score += opt->sc_ambi > 0? -opt->sc_ambi : opt->sc_ambi;
else ez->score += qseq[j] == tseq[j]? opt->a : -opt->b; else ez->score += qseq[j] == tseq[j]? opt->a : -opt->b;
} }
ez->cigar = ksw_push_cigar(km, &ez->n_cigar, &ez->m_cigar, ez->cigar, 0, qe - qs); if (ez->score > max_gapped_score)
ez->cigar = ksw_push_cigar(km, &ez->n_cigar, &ez->m_cigar, ez->cigar, MM_CIGAR_MATCH, qe - qs);
else
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, junc, mat, bw1, -1, opt->zdrop, ksw_flag|KSW_EZ_APPROX_MAX, ez);
} else { // perform normal gapped alignment } else { // perform normal gapped alignment
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, mat, bw1, -1, opt->zdrop, extra_flag|KSW_EZ_APPROX_MAX, ez); // first pass: with approximate Z-drop int32_t skip_full = 0;
if (is_sr_rna)
skip_full = mm_align_sr_rna(km, opt, qe - qs, qseq, re - rs, tseq, junc, tseq2, junc2, mat, bw1, -1, opt->zdrop, ksw_flag|KSW_EZ_APPROX_MAX, ez);
if (!skip_full)
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, junc, mat, bw1, -1, opt->zdrop, ksw_flag|KSW_EZ_APPROX_MAX, ez); // first pass: with approximate Z-drop
} }
// test Z-drop and inversion Z-drop // test Z-drop and inversion Z-drop
if ((zdrop_code = mm_test_zdrop(km, opt, qseq, tseq, ez->n_cigar, ez->cigar, mat)) != 0) if ((zdrop_code = mm_test_zdrop(km, opt, qseq, tseq, ez->n_cigar, ez->cigar, mat)) != 0)
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, mat, bw1, -1, zdrop_code == 2? opt->zdrop_inv : opt->zdrop, extra_flag, ez); // second pass: lift approximate mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, junc, mat, bw1, -1, zdrop_code == 2? opt->zdrop_inv : opt->zdrop, ksw_flag, ez); // second pass: lift approximate
// update CIGAR // update CIGAR
if (ez->n_cigar > 0) if (ez->n_cigar > 0)
mm_append_cigar(r, ez->n_cigar, ez->cigar); mm_append_cigar(r, ez->n_cigar, ez->cigar);
if (ez->zdropped) { // truncated by Z-drop; TODO: sometimes Z-drop kicks in because the next seed placement is wrong. This can be fixed in principle. if (ez->zdropped) { // truncated by Z-drop; TODO: sometimes Z-drop kicks in because the next seed placement is wrong. This can be fixed in principle.
if (!r->p) {
assert(ez->n_cigar == 0);
uint32_t capacity = sizeof(mm_extra_t)/4;
kroundup32(capacity);
r->p = (mm_extra_t*)calloc(capacity, 4);
r->p->capacity = capacity;
}
for (j = i - 1; j >= 0; --j) for (j = i - 1; j >= 0; --j)
if ((int32_t)a[as1 + j].x <= rs + ez->max_t) if ((int32_t)a[as1 + j].x <= rs + ez->max_t)
break; break;
@@ -721,7 +862,7 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
re1 = rs + (ez->max_t + 1); re1 = rs + (ez->max_t + 1);
qe1 = qs + (ez->max_q + 1); qe1 = qs + (ez->max_q + 1);
if (cnt1 - (j + 1) >= opt->min_cnt) { if (cnt1 - (j + 1) >= opt->min_cnt) {
mm_split_reg(r, r2, as1 + j + 1 - r->as, qlen, a); mm_split_reg(r, r2, as1 + j + 1 - r->as, qlen, a, !!(opt->flag&MM_F_QSTRAND));
if (zdrop_code == 2) r2->split_inv = 1; if (zdrop_code == 2) r2->split_inv = 1;
} }
break; break;
@@ -731,9 +872,15 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
} }
if (!dropped && qe < qe0 && re < re0) { // right extension if (!dropped && qe < qe0 && re < re0) { // right extension
if (opt->flag & MM_F_QSTRAND) {
qseq = &qseq0[0][qe];
mm_idx_getseq2(mi, rev, rid, re, re0, tseq);
} else {
qseq = &qseq0[rev][qe]; qseq = &qseq0[rev][qe];
mm_idx_getseq(mi, rid, re, re0, tseq); mm_idx_getseq(mi, rid, re, re0, tseq);
mm_align_pair(km, opt, qe0 - qe, qseq, re0 - re, tseq, mat, bw, opt->end_bonus, opt->zdrop, extra_flag|KSW_EZ_EXTZ_ONLY, ez); }
mm_get_junc(mi, rid, re, re0, !!(ksw_flag&KSW_EZ_SPLICE_REV), junc);
mm_align_pair(km, opt, qe0 - qe, qseq, re0 - re, tseq, junc, mat, bw, opt->end_bonus, opt->zdrop, ksw_flag|KSW_EZ_EXTZ_ONLY, ez);
if (ez->n_cigar > 0) { if (ez->n_cigar > 0) {
mm_append_cigar(r, ez->n_cigar, ez->cigar); mm_append_cigar(r, ez->n_cigar, ez->cigar);
r->p->dp_score += ez->max; r->p->dp_score += ez->max;
@@ -744,23 +891,30 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
assert(qe1 <= qlen); assert(qe1 <= qlen);
r->rs = rs1, r->re = re1; r->rs = rs1, r->re = re1;
if (rev) r->qs = qlen - qe1, r->qe = qlen - qs1; if (!rev || (opt->flag & MM_F_QSTRAND)) r->qs = qs1, r->qe = qe1;
else r->qs = qs1, r->qe = qe1; else r->qs = qlen - qe1, r->qe = qlen - qs1;
assert(re1 - rs1 <= re0 - rs0); assert(re1 - rs1 <= re0 - rs0);
if (r->p) { if (r->p) {
if (opt->flag & MM_F_QSTRAND) {
mm_idx_getseq2(mi, r->rev, rid, rs1, re1, tseq);
qseq = &qseq0[0][qs1];
} else {
mm_idx_getseq(mi, rid, rs1, re1, tseq); mm_idx_getseq(mi, rid, rs1, re1, tseq);
mm_update_extra(r, &qseq0[r->rev][qs1], tseq, mat, opt->q, opt->e); qseq = &qseq0[r->rev][qs1];
if (opt->flag & MM_F_EQX) mm_update_cigar_eqx(r, &qseq0[r->rev][qs1], tseq); }
mm_update_extra(r, qseq, tseq, mat, opt->q, opt->e, opt->flag & MM_F_EQX, !(is_sr || is_sr_rna));
if (rev && r->p->trans_strand) if (rev && r->p->trans_strand)
r->p->trans_strand ^= 3; // flip to the read strand r->p->trans_strand ^= 3; // flip to the read strand
} }
if (tseq2) kfree(km, tseq2);
kfree(km, tseq); kfree(km, tseq);
kfree(km, junc);
} }
static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, uint8_t *qseq0[2], const mm_reg1_t *r1, const mm_reg1_t *r2, mm_reg1_t *r_inv, ksw_extz_t *ez) static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, uint8_t *qseq0[2], const mm_reg1_t *r1, const mm_reg1_t *r2, mm_reg1_t *r_inv, ksw_extz_t *ez)
{ { // NB: this doesn't work with the qstrand mode
int tl, ql, score, ret = 0, q_off, t_off; int tl, ql, score, ret = 0, q_off, t_off;
uint8_t *tseq, *qseq; uint8_t *tseq, *qseq;
int8_t mat[25]; int8_t mat[25];
@@ -776,7 +930,7 @@ static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, i
if (ql < opt->min_chain_score || ql > opt->max_gap) return 0; if (ql < opt->min_chain_score || ql > opt->max_gap) return 0;
if (tl < opt->min_chain_score || tl > opt->max_gap) return 0; if (tl < opt->min_chain_score || tl > opt->max_gap) return 0;
ksw_gen_simple_mat(5, mat, opt->a, opt->b, opt->sc_ambi); ksw_gen_ts_mat(5, mat, opt->a, opt->b, opt->transition, opt->sc_ambi);
tseq = (uint8_t*)kmalloc(km, tl); tseq = (uint8_t*)kmalloc(km, tl);
mm_idx_getseq(mi, r1->rid, r1->re, r2->rs, tseq); mm_idx_getseq(mi, r1->rid, r1->re, r2->rs, tseq);
qseq = r1->rev? &qseq0[0][r2->qe] : &qseq0[1][qlen - r2->qs]; qseq = r1->rev? &qseq0[0][r2->qe] : &qseq0[1][qlen - r2->qs];
@@ -790,7 +944,7 @@ static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, i
mm_seq_rev(tl, tseq); mm_seq_rev(tl, tseq);
if (score < opt->min_dp_max) goto end_align1_inv; if (score < opt->min_dp_max) goto end_align1_inv;
q_off = ql - (q_off + 1), t_off = tl - (t_off + 1); q_off = ql - (q_off + 1), t_off = tl - (t_off + 1);
mm_align_pair(km, opt, ql - q_off, qseq + q_off, tl - t_off, tseq + t_off, mat, (int)(opt->bw * 1.5), -1, opt->zdrop, KSW_EZ_EXTZ_ONLY, ez); mm_align_pair(km, opt, ql - q_off, qseq + q_off, tl - t_off, tseq + t_off, 0, mat, (int)(opt->bw * 1.5), -1, opt->zdrop, KSW_EZ_EXTZ_ONLY, ez);
if (ez->n_cigar == 0) goto end_align1_inv; // should never be here if (ez->n_cigar == 0) goto end_align1_inv; // should never be here
mm_append_cigar(r_inv, ez->n_cigar, ez->cigar); mm_append_cigar(r_inv, ez->n_cigar, ez->cigar);
r_inv->p->dp_score = ez->max; r_inv->p->dp_score = ez->max;
@@ -809,8 +963,7 @@ static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, i
} }
r_inv->rs = r1->re + t_off; r_inv->rs = r1->re + t_off;
r_inv->re = r_inv->rs + ez->max_t + 1; r_inv->re = r_inv->rs + ez->max_t + 1;
mm_update_extra(r_inv, &qseq[q_off], &tseq[t_off], mat, opt->q, opt->e); mm_update_extra(r_inv, &qseq[q_off], &tseq[t_off], mat, opt->q, opt->e, opt->flag & MM_F_EQX, !(opt->flag & (MM_F_SR|MM_F_SR_RNA)));
if (opt->flag & MM_F_EQX) mm_update_cigar_eqx(r_inv, &qseq[q_off], &tseq[t_off]);
ret = 1; ret = 1;
end_align1_inv: end_align1_inv:
kfree(km, tseq); kfree(km, tseq);
@@ -827,6 +980,71 @@ static inline mm_reg1_t *mm_insert_reg(const mm_reg1_t *r, int i, int *n_regs, m
return regs; return regs;
} }
static inline void mm_count_gaps(const mm_reg1_t *r, int32_t *n_gap_, int32_t *n_gapo_)
{
uint32_t i;
int32_t n_gapo = 0, n_gap = 0;
*n_gap_ = *n_gapo_ = -1;
if (r->p == 0) return;
for (i = 0; i < r->p->n_cigar; ++i) {
int32_t op = r->p->cigar[i] & 0xf, len = r->p->cigar[i] >> 4;
if (op == MM_CIGAR_INS || op == MM_CIGAR_DEL)
++n_gapo, n_gap += len;
}
*n_gap_ = n_gap, *n_gapo_ = n_gapo;
}
double mm_event_identity(const mm_reg1_t *r)
{
int32_t n_gap, n_gapo;
if (r->p == 0) return -1.0f;
mm_count_gaps(r, &n_gap, &n_gapo);
return (double)r->mlen / (r->blen + r->p->n_ambi - n_gap + n_gapo);
}
static int32_t mm_recal_max_dp(const mm_reg1_t *r, double b2, int32_t match_sc)
{
uint32_t i;
int32_t n_gap = 0, n_mis;
double gap_cost = 0.0;
if (r->p == 0) return -1;
for (i = 0; i < r->p->n_cigar; ++i) {
int32_t op = r->p->cigar[i] & 0xf, len = r->p->cigar[i] >> 4;
if (op == MM_CIGAR_INS || op == MM_CIGAR_DEL) {
gap_cost += b2 + (double)mg_log2(1.0 + len);
n_gap += len;
}
}
n_mis = r->blen + r->p->n_ambi - r->mlen - n_gap;
return (int32_t)(match_sc * (r->mlen - b2 * n_mis - gap_cost) + .499);
}
void mm_update_dp_max(int qlen, int n_regs, mm_reg1_t *regs, float frac, int a, int b)
{
int32_t max = -1, max2 = -1, i, max_i = -1;
double div, b2;
if (n_regs < 2) return;
for (i = 0; i < n_regs; ++i) {
mm_reg1_t *r = &regs[i];
if (r->p == 0) continue;
if (r->p->dp_max > max) max2 = max, max = r->p->dp_max, max_i = i;
else if (r->p->dp_max > max2) max2 = r->p->dp_max;
}
if (max_i < 0 || max < 0 || max2 < 0) return;
if (regs[max_i].qe - regs[max_i].qs < (double)qlen * frac) return;
if (max2 < (double)max * frac) return;
div = 1. - mm_event_identity(&regs[max_i]);
if (div < 0.02) div = 0.02;
b2 = 0.5 / div; // max value: 25
if (b2 * a < b) b2 = (double)a / b;
for (i = 0; i < n_regs; ++i) {
mm_reg1_t *r = &regs[i];
if (r->p == 0) continue;
r->p->dp_max = mm_recal_max_dp(r, b2, a);
if (r->p->dp_max < 0) r->p->dp_max = 0;
}
}
mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a) mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a)
{ {
extern unsigned char seq_nt4_table[256]; extern unsigned char seq_nt4_table[256];
@@ -846,13 +1064,17 @@ mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *m
n_a = mm_squeeze_a(km, n_regs, regs, a); n_a = mm_squeeze_a(km, n_regs, regs, a);
memset(&ez, 0, sizeof(ksw_extz_t)); memset(&ez, 0, sizeof(ksw_extz_t));
for (i = 0; i < n_regs; ++i) { for (i = 0; i < n_regs; ++i) {
mm_reg1_t r2; mm_reg1_t r2; // only used for inversion
if ((opt->flag&MM_F_SPLICE) && (opt->flag&MM_F_SPLICE_FOR) && (opt->flag&MM_F_SPLICE_REV)) { // then do two rounds of alignments for both strands if ((opt->flag&MM_F_SPLICE) && (opt->flag&MM_F_SPLICE_FOR) && (opt->flag&MM_F_SPLICE_REV)) { // then do two rounds of alignments for both strands
mm_reg1_t s[2], s2[2]; mm_reg1_t s[2], s2[2], *r;
int which, trans_strand;
s[0] = s[1] = regs[i]; s[0] = s[1] = regs[i];
mm_align1(km, opt, mi, qlen, qseq0, &s[0], &s2[0], n_a, a, &ez, MM_F_SPLICE_FOR); mm_align1(km, opt, mi, qlen, qseq0, &s[0], &s2[0], n_a, a, &ez, MM_F_SPLICE_FOR); // assume the transcript is on the + strand of the genome
mm_align1(km, opt, mi, qlen, qseq0, &s[1], &s2[1], n_a, a, &ez, MM_F_SPLICE_REV); if ((opt->flag&MM_F_SR_RNA) && regs[i].qe - regs[i].qs == regs[i].re - regs[i].rs && s[0].qe - s[0].qs == s[0].re - s[0].rs && s[0].qs == 0 && s[0].qe == qlen) {
regs[i] = s[0], r2 = s2[0];
regs[i].p->trans_strand = 0;
} else {
int which, trans_strand;
mm_align1(km, opt, mi, qlen, qseq0, &s[1], &s2[1], n_a, a, &ez, MM_F_SPLICE_REV); // assume the transcript on the - strand
if (s[0].p->dp_score > s[1].p->dp_score) which = 0, trans_strand = 1; if (s[0].p->dp_score > s[1].p->dp_score) which = 0, trans_strand = 1;
else if (s[0].p->dp_score < s[1].p->dp_score) which = 1, trans_strand = 2; else if (s[0].p->dp_score < s[1].p->dp_score) which = 1, trans_strand = 2;
else trans_strand = 3, which = (qlen + s[0].p->dp_score) & 1; // randomly choose a strand, effectively else trans_strand = 3, which = (qlen + s[0].p->dp_score) & 1; // randomly choose a strand, effectively
@@ -863,14 +1085,22 @@ mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *m
regs[i] = s[1], r2 = s2[1]; regs[i] = s[1], r2 = s2[1];
free(s[0].p); free(s[0].p);
} }
regs[i].p->trans_strand = trans_strand; r = &regs[i];
r->p->trans_strand = trans_strand;
if (r->is_spliced) {
if (trans_strand == 1 || trans_strand == 2) // this is an *approximate* way to tell if there are splice signals.
r->p->dp_max += (opt->a + opt->b) + ((opt->a + opt->b) >> 1);
else if (trans_strand == 3)
r->p->dp_max -= opt->a + opt->b;
}
}
} else { // one round of alignment } else { // one round of alignment
mm_align1(km, opt, mi, qlen, qseq0, &regs[i], &r2, n_a, a, &ez, opt->flag); mm_align1(km, opt, mi, qlen, qseq0, &regs[i], &r2, n_a, a, &ez, opt->flag);
if (opt->flag&MM_F_SPLICE) if (opt->flag&MM_F_SPLICE)
regs[i].p->trans_strand = opt->flag&MM_F_SPLICE_FOR? 1 : 2; regs[i].p->trans_strand = opt->flag&MM_F_SPLICE_FOR? 1 : 2;
} }
if (r2.cnt > 0) regs = mm_insert_reg(&r2, i, &n_regs, regs); if (r2.cnt > 0) regs = mm_insert_reg(&r2, i, &n_regs, regs);
if (i > 0 && regs[i].split_inv) { if (i > 0 && regs[i].split_inv && !(opt->flag & MM_F_NO_INV)) {
if (mm_align1_inv(km, opt, mi, qlen, qseq0, &regs[i-1], &regs[i], &r2, &ez)) { if (mm_align1_inv(km, opt, mi, qlen, qseq0, &regs[i-1], &regs[i], &r2, &ez)) {
regs = mm_insert_reg(&r2, i, &n_regs, regs); regs = mm_insert_reg(&r2, i, &n_regs, regs);
++i; // skip the inserted INV alignment ++i; // skip the inserted INV alignment
@@ -881,6 +1111,10 @@ mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *m
kfree(km, qseq0[0]); kfree(km, qseq0[0]);
kfree(km, ez.cigar); kfree(km, ez.cigar);
mm_filter_regs(opt, qlen, n_regs_, regs); mm_filter_regs(opt, qlen, n_regs_, regs);
mm_hit_sort(km, n_regs_, regs); if (!(opt->flag&(MM_F_SR|MM_F_SR_RNA|MM_F_ALL_CHAINS)) && !opt->split_prefix && qlen >= opt->rank_min_len) {
mm_update_dp_max(qlen, *n_regs_, regs, opt->rank_frac, opt->a, opt->b);
mm_filter_regs(opt, qlen, n_regs_, regs);
}
mm_hit_sort(km, n_regs_, regs, opt->alt_drop);
return regs; return regs;
} }
+16 -9
View File
@@ -15,7 +15,7 @@ unsigned char seq_comp_table[256] = {
48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63,
64, 'T', 'V', 'G', 'H', 'E', 'F', 'C', 'D', 'I', 'J', 'M', 'L', 'K', 'N', 'O', 64, 'T', 'V', 'G', 'H', 'E', 'F', 'C', 'D', 'I', 'J', 'M', 'L', 'K', 'N', 'O',
'P', 'Q', 'Y', 'S', 'A', 'A', 'B', 'W', 'X', 'R', 'Z', 91, 92, 93, 94, 95, 'P', 'Q', 'Y', 'S', 'A', 'A', 'B', 'W', 'X', 'R', 'Z', 91, 92, 93, 94, 95,
64, 't', 'v', 'g', 'h', 'e', 'f', 'c', 'd', 'i', 'j', 'm', 'l', 'k', 'n', 'o', 96, 't', 'v', 'g', 'h', 'e', 'f', 'c', 'd', 'i', 'j', 'm', 'l', 'k', 'n', 'o',
'p', 'q', 'y', 's', 'a', 'a', 'b', 'w', 'x', 'r', 'z', 123, 124, 125, 126, 127, 'p', 'q', 'y', 's', 'a', 'a', 'b', 'w', 'x', 'r', 'z', 123, 124, 125, 126, 127,
128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143,
144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159,
@@ -39,7 +39,7 @@ mm_bseq_file_t *mm_bseq_open(const char *fn)
{ {
mm_bseq_file_t *fp; mm_bseq_file_t *fp;
gzFile f; gzFile f;
f = fn && strcmp(fn, "-")? gzopen(fn, "r") : gzdopen(fileno(stdin), "r"); f = fn && strcmp(fn, "-")? gzopen(fn, "r") : gzdopen(0, "r");
if (f == 0) return 0; if (f == 0) return 0;
fp = (mm_bseq_file_t*)calloc(1, sizeof(mm_bseq_file_t)); fp = (mm_bseq_file_t*)calloc(1, sizeof(mm_bseq_file_t));
fp->fp = f; fp->fp = f;
@@ -65,6 +65,8 @@ static inline char *kstrdup(const kstring_t *s)
static inline void kseq2bseq(kseq_t *ks, mm_bseq1_t *s, int with_qual, int with_comment) static inline void kseq2bseq(kseq_t *ks, mm_bseq1_t *s, int with_qual, int with_comment)
{ {
int i; int i;
if (ks->name.l == 0)
fprintf(stderr, "[WARNING]\033[1;31m empty sequence name in the input.\033[0m\n");
s->name = kstrdup(&ks->name); s->name = kstrdup(&ks->name);
s->seq = kstrdup(&ks->seq); s->seq = kstrdup(&ks->seq);
for (i = 0; i < (int)ks->seq.l; ++i) // convert U to T for (i = 0; i < (int)ks->seq.l; ++i) // convert U to T
@@ -75,9 +77,10 @@ static inline void kseq2bseq(kseq_t *ks, mm_bseq1_t *s, int with_qual, int with_
s->l_seq = ks->seq.l; s->l_seq = ks->seq.l;
} }
mm_bseq1_t *mm_bseq_read3(mm_bseq_file_t *fp, int chunk_size, int with_qual, int with_comment, int frag_mode, int *n_) mm_bseq1_t *mm_bseq_read3(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int with_comment, int frag_mode, int *n_)
{ {
int64_t size = 0; int64_t size = 0;
int ret;
kvec_t(mm_bseq1_t) a = {0,0,0}; kvec_t(mm_bseq1_t) a = {0,0,0};
kseq_t *ks = fp->ks; kseq_t *ks = fp->ks;
*n_ = 0; *n_ = 0;
@@ -87,7 +90,7 @@ mm_bseq1_t *mm_bseq_read3(mm_bseq_file_t *fp, int chunk_size, int with_qual, int
size = fp->s.l_seq; size = fp->s.l_seq;
memset(&fp->s, 0, sizeof(mm_bseq1_t)); memset(&fp->s, 0, sizeof(mm_bseq1_t));
} }
while (kseq_read(ks) >= 0) { while ((ret = kseq_read(ks)) >= 0) {
mm_bseq1_t *s; mm_bseq1_t *s;
assert(ks->seq.l <= INT32_MAX); assert(ks->seq.l <= INT32_MAX);
if (a.m == 0) kv_resize(mm_bseq1_t, 0, a, 256); if (a.m == 0) kv_resize(mm_bseq1_t, 0, a, 256);
@@ -96,7 +99,7 @@ mm_bseq1_t *mm_bseq_read3(mm_bseq_file_t *fp, int chunk_size, int with_qual, int
size += s->l_seq; size += s->l_seq;
if (size >= chunk_size) { if (size >= chunk_size) {
if (frag_mode && a.a[a.n-1].l_seq < CHECK_PAIR_THRES) { if (frag_mode && a.a[a.n-1].l_seq < CHECK_PAIR_THRES) {
while (kseq_read(ks) >= 0) { while ((ret = kseq_read(ks)) >= 0) {
kseq2bseq(ks, &fp->s, with_qual, with_comment); kseq2bseq(ks, &fp->s, with_qual, with_comment);
if (mm_qname_same(fp->s.name, a.a[a.n-1].name)) { if (mm_qname_same(fp->s.name, a.a[a.n-1].name)) {
kv_push(mm_bseq1_t, 0, a, fp->s); kv_push(mm_bseq1_t, 0, a, fp->s);
@@ -107,21 +110,25 @@ mm_bseq1_t *mm_bseq_read3(mm_bseq_file_t *fp, int chunk_size, int with_qual, int
break; break;
} }
} }
if (ret < -1) {
if (a.n) fprintf(stderr, "[WARNING]\033[1;31m failed to parse the FASTA/FASTQ record next to '%s'. Continue anyway.\033[0m\n", a.a[a.n-1].name);
else fprintf(stderr, "[WARNING]\033[1;31m failed to parse the first FASTA/FASTQ record. Continue anyway.\033[0m\n");
}
*n_ = a.n; *n_ = a.n;
return a.a; return a.a;
} }
mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int frag_mode, int *n_) mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int frag_mode, int *n_)
{ {
return mm_bseq_read3(fp, chunk_size, with_qual, 0, frag_mode, n_); return mm_bseq_read3(fp, chunk_size, with_qual, 0, frag_mode, n_);
} }
mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int chunk_size, int with_qual, int *n_) mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int *n_)
{ {
return mm_bseq_read2(fp, chunk_size, with_qual, 0, n_); return mm_bseq_read2(fp, chunk_size, with_qual, 0, n_);
} }
mm_bseq1_t *mm_bseq_read_frag2(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int with_comment, int *n_) mm_bseq1_t *mm_bseq_read_frag2(int n_fp, mm_bseq_file_t **fp, int64_t chunk_size, int with_qual, int with_comment, int *n_)
{ {
int i; int i;
int64_t size = 0; int64_t size = 0;
@@ -151,7 +158,7 @@ mm_bseq1_t *mm_bseq_read_frag2(int n_fp, mm_bseq_file_t **fp, int chunk_size, in
return a.a; return a.a;
} }
mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int *n_) mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int64_t chunk_size, int with_qual, int *n_)
{ {
return mm_bseq_read_frag2(n_fp, fp, chunk_size, with_qual, 0, n_); return mm_bseq_read_frag2(n_fp, fp, chunk_size, with_qual, 0, n_);
} }
+5 -5
View File
@@ -18,11 +18,11 @@ typedef struct {
mm_bseq_file_t *mm_bseq_open(const char *fn); mm_bseq_file_t *mm_bseq_open(const char *fn);
void mm_bseq_close(mm_bseq_file_t *fp); void mm_bseq_close(mm_bseq_file_t *fp);
mm_bseq1_t *mm_bseq_read3(mm_bseq_file_t *fp, int chunk_size, int with_qual, int with_comment, int frag_mode, int *n_); mm_bseq1_t *mm_bseq_read3(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int with_comment, int frag_mode, int *n_);
mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int frag_mode, int *n_); mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int frag_mode, int *n_);
mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int chunk_size, int with_qual, int *n_); mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int *n_);
mm_bseq1_t *mm_bseq_read_frag2(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int with_comment, int *n_); mm_bseq1_t *mm_bseq_read_frag2(int n_fp, mm_bseq_file_t **fp, int64_t chunk_size, int with_qual, int with_comment, int *n_);
mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int *n_); mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int64_t chunk_size, int with_qual, int *n_);
int mm_bseq_eof(mm_bseq_file_t *fp); int mm_bseq_eof(mm_bseq_file_t *fp);
extern unsigned char seq_nt4_table[256]; extern unsigned char seq_nt4_table[256];
-157
View File
@@ -1,157 +0,0 @@
#include <stdint.h>
#include <string.h>
#include <stdio.h>
#include "minimap.h"
#include "mmpriv.h"
#include "kalloc.h"
static const char LogTable256[256] = {
#define LT(n) n, n, n, n, n, n, n, n, n, n, n, n, n, n, n, n
-1, 0, 1, 1, 2, 2, 2, 2, 3, 3, 3, 3, 3, 3, 3, 3,
LT(4), LT(5), LT(5), LT(6), LT(6), LT(6), LT(6),
LT(7), LT(7), LT(7), LT(7), LT(7), LT(7), LT(7), LT(7)
};
static inline int ilog2_32(uint32_t v)
{
register uint32_t t, tt;
if ((tt = v>>16)) return (t = tt>>8) ? 24 + LogTable256[t] : 16 + LogTable256[tt];
return (t = v>>8) ? 8 + LogTable256[t] : LogTable256[v];
}
mm128_t *mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int min_cnt, int min_sc, int is_cdna, int n_segs, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km)
{ // TODO: make sure this works when n has more than 32 bits
int32_t k, *f, *p, *t, *v, n_u, n_v;
int64_t i, j, st = 0;
uint64_t *u, *u2, sum_qspan = 0;
float avg_qspan;
mm128_t *b, *w;
if (_u) *_u = 0, *n_u_ = 0;
f = (int32_t*)kmalloc(km, n * 4);
p = (int32_t*)kmalloc(km, n * 4);
t = (int32_t*)kmalloc(km, n * 4);
v = (int32_t*)kmalloc(km, n * 4);
memset(t, 0, n * 4);
for (i = 0; i < n; ++i) sum_qspan += a[i].y>>32&0xff;
avg_qspan = (float)sum_qspan / n;
// fill the score and backtrack arrays
for (i = 0; i < n; ++i) {
uint64_t ri = a[i].x;
int64_t max_j = -1;
int32_t qi = (int32_t)a[i].y, q_span = a[i].y>>32&0xff; // NB: only 8 bits of span is used!!!
int32_t max_f = q_span, n_skip = 0, min_d;
int32_t sidi = (a[i].y & MM_SEED_SEG_MASK) >> MM_SEED_SEG_SHIFT;
while (st < i && ri > a[st].x + max_dist_x) ++st;
for (j = i - 1; j >= st; --j) {
int64_t dr = ri - a[j].x;
int32_t dq = qi - (int32_t)a[j].y, dd, sc, log_dd;
int32_t sidj = (a[j].y & MM_SEED_SEG_MASK) >> MM_SEED_SEG_SHIFT;
if ((sidi == sidj && dr == 0) || dq <= 0) continue; // don't skip if an anchor is used by multiple segments; see below
if ((sidi == sidj && dq > max_dist_y) || dq > max_dist_x) continue;
dd = dr > dq? dr - dq : dq - dr;
if (sidi == sidj && dd > bw) continue;
if (n_segs > 1 && !is_cdna && sidi == sidj && dr > max_dist_y) continue;
min_d = dq < dr? dq : dr;
sc = min_d > q_span? q_span : dq < dr? dq : dr;
log_dd = dd? ilog2_32(dd) : 0;
if (is_cdna || sidi != sidj) {
int c_log, c_lin;
c_lin = (int)(dd * .01 * avg_qspan);
c_log = log_dd;
if (sidi != sidj && dr == 0) ++sc; // possibly due to overlapping paired ends; give a minor bonus
else if (dr > dq || sidi != sidj) sc -= c_lin < c_log? c_lin : c_log;
else sc -= c_lin + (c_log>>1);
} else sc -= (int)(dd * .01 * avg_qspan) + (log_dd>>1);
sc += f[j];
if (sc > max_f) {
max_f = sc, max_j = j;
if (n_skip > 0) --n_skip;
} else if (t[j] == i) {
if (++n_skip > max_skip)
break;
}
if (p[j] >= 0) t[p[j]] = i;
}
f[i] = max_f, p[i] = max_j;
v[i] = max_j >= 0 && v[max_j] > max_f? v[max_j] : max_f; // v[] keeps the peak score up to i; f[] is the score ending at i, not always the peak
}
// find the ending positions of chains
memset(t, 0, n * 4);
for (i = 0; i < n; ++i)
if (p[i] >= 0) t[p[i]] = 1;
for (i = n_u = 0; i < n; ++i)
if (t[i] == 0 && v[i] >= min_sc)
++n_u;
if (n_u == 0) {
kfree(km, a); kfree(km, f); kfree(km, p); kfree(km, t); kfree(km, v);
return 0;
}
u = (uint64_t*)kmalloc(km, n_u * 8);
for (i = n_u = 0; i < n; ++i) {
if (t[i] == 0 && v[i] >= min_sc) {
j = i;
while (j >= 0 && f[j] < v[j]) j = p[j]; // find the peak that maximizes f[]
if (j < 0) j = i; // TODO: this should really be assert(j>=0)
u[n_u++] = (uint64_t)f[j] << 32 | j;
}
}
radix_sort_64(u, u + n_u);
for (i = 0; i < n_u>>1; ++i) { // reverse, s.t. the highest scoring chain is the first
uint64_t t = u[i];
u[i] = u[n_u - i - 1], u[n_u - i - 1] = t;
}
// backtrack
memset(t, 0, n * 4);
for (i = n_v = k = 0; i < n_u; ++i) { // starting from the highest score
int32_t n_v0 = n_v, k0 = k;
j = (int32_t)u[i];
do {
v[n_v++] = j;
t[j] = 1;
j = p[j];
} while (j >= 0 && t[j] == 0);
if (j < 0) {
if (n_v - n_v0 >= min_cnt) u[k++] = u[i]>>32<<32 | (n_v - n_v0);
} else if ((int32_t)(u[i]>>32) - f[j] >= min_sc) {
if (n_v - n_v0 >= min_cnt) u[k++] = ((u[i]>>32) - f[j]) << 32 | (n_v - n_v0);
}
if (k0 == k) n_v = n_v0; // no new chain added, reset
}
*n_u_ = n_u = k, *_u = u; // NB: note that u[] may not be sorted by score here
// free temporary arrays
kfree(km, f); kfree(km, p); kfree(km, t);
// write the result to b[]
b = (mm128_t*)kmalloc(km, n_v * sizeof(mm128_t));
for (i = 0, k = 0; i < n_u; ++i) {
int32_t k0 = k, ni = (int32_t)u[i];
for (j = 0; j < ni; ++j)
b[k] = a[v[k0 + (ni - j - 1)]], ++k;
}
kfree(km, v);
// sort u[] and a[] by a[].x, such that adjacent chains may be joined (required by mm_join_long)
w = (mm128_t*)kmalloc(km, n_u * sizeof(mm128_t));
for (i = k = 0; i < n_u; ++i) {
w[i].x = b[k].x, w[i].y = (uint64_t)k<<32|i;
k += (int32_t)u[i];
}
radix_sort_128x(w, w + n_u);
u2 = (uint64_t*)kmalloc(km, n_u * 8);
for (i = k = 0; i < n_u; ++i) {
int32_t j = (int32_t)w[i].y, n = (int32_t)u[j];
u2[i] = u[j];
memcpy(&a[k], &b[w[i].y>>32], n * sizeof(mm128_t));
k += n;
}
memcpy(u, u2, n_u * 8);
memcpy(b, a, k * sizeof(mm128_t)); // write _a_ to _b_ and deallocate _a_ because _a_ is oversized, sometimes a lot
kfree(km, a); kfree(km, w); kfree(km, u2);
return b;
}
+30
View File
@@ -0,0 +1,30 @@
## Contributor Code of Conduct
As contributors and maintainers of this project, we pledge to respect all
people who contribute through reporting issues, posting feature requests,
updating documentation, submitting pull requests or patches, and other
activities.
We are committed to making participation in this project a harassment-free
experience for everyone, regardless of level of experience, gender, gender
identity and expression, sexual orientation, disability, personal appearance,
body size, race, age, or religion.
Examples of unacceptable behavior by participants include the use of sexual
language or imagery, derogatory comments or personal attacks, trolling, public
or private harassment, insults, or other unprofessional conduct.
Project maintainers have the right and responsibility to remove, edit, or
reject comments, commits, code, wiki edits, issues, and other contributions
that are not aligned to this Code of Conduct. Project maintainers or
contributors who do not follow the Code of Conduct may be removed from the
project team.
Instances of abusive, harassing, or otherwise unacceptable behavior may be
reported by opening an issue or contacting the maintainer via email.
This Code of Conduct is adapted from the [Contributor Covenant][cc], [version
1.0.0][v1].
[cc]: http://contributor-covenant.org/
[v1]: http://contributor-covenant.org/version/1/0/0/
+6 -6
View File
@@ -31,8 +31,8 @@ To acquire the data used in this cookbook and to install minimap2 and paftools,
please follow the command lines below: please follow the command lines below:
```sh ```sh
# install minimap2 executables # install minimap2 executables
curl -L https://github.com/lh3/minimap2/releases/download/v2.13/minimap2-2.13_x64-linux.tar.bz2 | tar jxf - curl -L https://github.com/lh3/minimap2/releases/download/v2.30/minimap2-2.30_x64-linux.tar.bz2 | tar jxf -
cp minimap2-2.13_x64-linux/{minimap2,k8,paftools.js} . # copy executables cp minimap2-2.30_x64-linux/{minimap2,k8,paftools.js} . # copy executables
export PATH="$PATH:"`pwd` # put the current directory on PATH export PATH="$PATH:"`pwd` # put the current directory on PATH
# download example datasets # download example datasets
curl -L https://github.com/lh3/minimap2/releases/download/v2.10/cookbook-data.tgz | tar zxf - curl -L https://github.com/lh3/minimap2/releases/download/v2.10/cookbook-data.tgz | tar zxf -
@@ -80,12 +80,12 @@ where a `U`-line gives the number of unmapped reads (for SAM input only); a
5. Accumulative number of mappings 5. Accumulative number of mappings
For `paftools.js mapeval` to work, you need to encode the true read positions For `paftools.js mapeval` to work, you need to encode the true read positions
in read names in the right format. For [PBSIM][pbsim] and [mason2][mason2], we in read names in the right format. For [pbsim2][pbsim] and [mason2][mason2], we
provide scripts to generate the right format. Simulated reads in this cookbook provide scripts to generate the right format. Simulated reads in this cookbook
were created with the following command lines: were created with the following command lines:
```sh ```sh
# in PBSIM source code directory: # in the pbsim2 source code directory:
src/pbsim ../ecoli_ref.fa --depth 1 --sample-fastq sample/sample.fastq src/pbsim --depth 1 --length-min 5000 --length-mean 20000 --accuracy-mean 0.95 --hmm_model data/R94.model ../ecoli_ref.fa
paftools.js pbsim2fq ../ecoli_ref.fa.fai sd_0001.maf > ../ecoli_pbsim.fa paftools.js pbsim2fq ../ecoli_ref.fa.fai sd_0001.maf > ../ecoli_pbsim.fa
# mason2 simulation # mason2 simulation
@@ -237,7 +237,7 @@ with `-x ava-pb` (99% vs 93% with `-x ava-ont`).
[pbsim]: https://github.com/pfaucon/PBSIM-PacBio-Simulator [pbsim]: https://github.com/yukiteruono/pbsim2
[mason2]: https://github.com/seqan/seqan/tree/master/apps/mason2 [mason2]: https://github.com/seqan/seqan/tree/master/apps/mason2
[paf]: https://github.com/lh3/miniasm/blob/master/PAF.md [paf]: https://github.com/lh3/miniasm/blob/master/PAF.md
[v2.10]: https://github.com/lh3/minimap2/releases/tag/v2.10 [v2.10]: https://github.com/lh3/minimap2/releases/tag/v2.10
+1 -1
View File
@@ -59,6 +59,6 @@ void mm_est_err(const mm_idx_t *mi, int qlen, int n_regs, mm_reg1_t *regs, const
n_tot = en - st + 1; n_tot = en - st + 1;
if (r->qs > avg_k && r->rs > avg_k) ++n_tot; if (r->qs > avg_k && r->rs > avg_k) ++n_tot;
if (qlen - r->qs > avg_k && l_ref - r->re > avg_k) ++n_tot; if (qlen - r->qs > avg_k && l_ref - r->re > avg_k) ++n_tot;
r->div = logf((float)n_tot / n_match) / avg_k; r->div = n_match >= n_tot? 0.0f : (float)(1.0 - pow((double)n_match / n_tot, 1.0 / avg_k));
} }
} }
+3 -1
View File
@@ -35,6 +35,8 @@ int main(int argc, char *argv[])
while ((mi = mm_idx_reader_read(r, n_threads)) != 0) { // traverse each part of the index while ((mi = mm_idx_reader_read(r, n_threads)) != 0) { // traverse each part of the index
mm_mapopt_update(&mopt, mi); // this sets the maximum minimizer occurrence; TODO: set a better default in mm_mapopt_init()! mm_mapopt_update(&mopt, mi); // this sets the maximum minimizer occurrence; TODO: set a better default in mm_mapopt_init()!
mm_tbuf_t *tbuf = mm_tbuf_init(); // thread buffer; for multi-threading, allocate one tbuf for each thread mm_tbuf_t *tbuf = mm_tbuf_init(); // thread buffer; for multi-threading, allocate one tbuf for each thread
gzrewind(f);
kseq_rewind(ks);
while (kseq_read(ks) >= 0) { // each kseq_read() call reads one query sequence while (kseq_read(ks) >= 0) { // each kseq_read() call reads one query sequence
mm_reg1_t *reg; mm_reg1_t *reg;
int j, i, n_reg; int j, i, n_reg;
@@ -45,7 +47,7 @@ int main(int argc, char *argv[])
printf("%s\t%d\t%d\t%d\t%c\t", ks->name.s, ks->seq.l, r->qs, r->qe, "+-"[r->rev]); printf("%s\t%d\t%d\t%d\t%c\t", ks->name.s, ks->seq.l, r->qs, r->qe, "+-"[r->rev]);
printf("%s\t%d\t%d\t%d\t%d\t%d\t%d\tcg:Z:", mi->seq[r->rid].name, mi->seq[r->rid].len, r->rs, r->re, r->mlen, r->blen, r->mapq); printf("%s\t%d\t%d\t%d\t%d\t%d\t%d\tcg:Z:", mi->seq[r->rid].name, mi->seq[r->rid].len, r->rs, r->re, r->mlen, r->blen, r->mapq);
for (i = 0; i < r->p->n_cigar; ++i) // IMPORTANT: this gives the CIGAR in the aligned regions. NO soft/hard clippings! for (i = 0; i < r->p->n_cigar; ++i) // IMPORTANT: this gives the CIGAR in the aligned regions. NO soft/hard clippings!
printf("%d%c", r->p->cigar[i]>>4, "MIDSHN"[r->p->cigar[i]&0xf]); printf("%d%c", r->p->cigar[i]>>4, MM_CIGAR_STR[r->p->cigar[i]&0xf]);
putchar('\n'); putchar('\n');
free(r->p); free(r->p);
} }
+207 -48
View File
@@ -79,11 +79,11 @@ static char *mm_escape(char *s)
return s; return s;
} }
static void sam_write_rg_line(kstring_t *str, const char *s) static int sam_write_rg_line(kstring_t *str, const char *s)
{ {
char *p, *q, *r, *rg_line = 0; char *p, *q, *r, *rg_line = 0;
memset(mm_rg_id, 0, 256); memset(mm_rg_id, 0, 256);
if (s == 0) return; if (s == 0) return 0;
if (strstr(s, "@RG") != s) { if (strstr(s, "@RG") != s) {
if (mm_verbose >= 1) fprintf(stderr, "[ERROR] the read group line is not started with @RG\n"); if (mm_verbose >= 1) fprintf(stderr, "[ERROR] the read group line is not started with @RG\n");
goto err_set_rg; goto err_set_rg;
@@ -92,7 +92,8 @@ static void sam_write_rg_line(kstring_t *str, const char *s)
if (mm_verbose >= 1) fprintf(stderr, "[ERROR] the read group line contained literal <tab> characters -- replace with escaped tabs: \\t\n"); if (mm_verbose >= 1) fprintf(stderr, "[ERROR] the read group line contained literal <tab> characters -- replace with escaped tabs: \\t\n");
goto err_set_rg; goto err_set_rg;
} }
rg_line = strdup(s); rg_line = (char*)malloc(strlen(s) + 1);
strcpy(rg_line, s);
mm_escape(rg_line); mm_escape(rg_line);
if ((p = strstr(rg_line, "\tID:")) == 0) { if ((p = strstr(rg_line, "\tID:")) == 0) {
if (mm_verbose >= 1) fprintf(stderr, "[ERROR] no ID within the read group line\n"); if (mm_verbose >= 1) fprintf(stderr, "[ERROR] no ID within the read group line\n");
@@ -107,20 +108,24 @@ static void sam_write_rg_line(kstring_t *str, const char *s)
for (q = p, r = mm_rg_id; *q && *q != '\t' && *q != '\n'; ++q) for (q = p, r = mm_rg_id; *q && *q != '\t' && *q != '\n'; ++q)
*r++ = *q; *r++ = *q;
mm_sprintf_lite(str, "%s\n", rg_line); mm_sprintf_lite(str, "%s\n", rg_line);
return 0;
err_set_rg: err_set_rg:
free(rg_line); free(rg_line);
return -1;
} }
void mm_write_sam_hdr(const mm_idx_t *idx, const char *rg, const char *ver, int argc, char *argv[]) int mm_write_sam_hdr(const mm_idx_t *idx, const char *rg, const char *ver, int argc, char *argv[])
{ {
kstring_t str = {0,0,0}; kstring_t str = {0,0,0};
int ret = 0;
mm_sprintf_lite(&str, "@HD\tVN:1.6\tSO:unsorted\tGO:query\n");
if (idx) { if (idx) {
uint32_t i; uint32_t i;
for (i = 0; i < idx->n_seq; ++i) for (i = 0; i < idx->n_seq; ++i)
mm_sprintf_lite(&str, "@SQ\tSN:%s\tLN:%d\n", idx->seq[i].name, idx->seq[i].len); mm_sprintf_lite(&str, "@SQ\tSN:%s\tLN:%d\n", idx->seq[i].name, idx->seq[i].len);
} }
if (rg) sam_write_rg_line(&str, rg); if (rg) ret = sam_write_rg_line(&str, rg);
mm_sprintf_lite(&str, "@PG\tID:minimap2\tPN:minimap2"); mm_sprintf_lite(&str, "@PG\tID:minimap2\tPN:minimap2");
if (ver) mm_sprintf_lite(&str, "\tVN:%s", ver); if (ver) mm_sprintf_lite(&str, "\tVN:%s", ver);
if (argc > 1) { if (argc > 1) {
@@ -131,16 +136,55 @@ void mm_write_sam_hdr(const mm_idx_t *idx, const char *rg, const char *ver, int
} }
mm_err_puts(str.s); mm_err_puts(str.s);
free(str.s); free(str.s);
return ret;
} }
static void write_cs_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq, const mm_reg1_t *r, char *tmp, int no_iden, int write_tag) static void write_indel_ds(kstring_t *str, int64_t len, const uint8_t *seq, int64_t ll, int64_t lr) // write an indel to ds; adapted from minigraph
{ {
int i, q_off, t_off; int64_t i;
if (write_tag) mm_sprintf_lite(s, "\tcs:Z:"); if (ll + lr >= len) {
mm_sprintf_lite(str, "[");
for (i = 0; i < len; ++i)
mm_sprintf_lite(str, "%c", "acgtn"[seq[i]]);
mm_sprintf_lite(str, "]");
} else {
int64_t k = 0;
if (ll > 0) {
mm_sprintf_lite(str, "[");
for (i = 0; i < ll; ++i)
mm_sprintf_lite(str, "%c", "acgtn"[seq[k+i]]);
mm_sprintf_lite(str, "]");
k += ll;
}
for (i = 0; i < len - lr - ll; ++i)
mm_sprintf_lite(str, "%c", "acgtn"[seq[k+i]]);
k += len - lr - ll;
if (lr > 0) {
mm_sprintf_lite(str, "[");
for (i = 0; i < lr; ++i)
mm_sprintf_lite(str, "%c", "acgtn"[seq[k+i]]);
mm_sprintf_lite(str, "]");
}
}
}
static void write_cs_ds_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq, const mm_reg1_t *r, char *tmp, int no_iden, int is_ds, int write_tag)
{
int i, q_off, t_off, q_len = 0, t_len = 0;
if (write_tag) mm_sprintf_lite(s, "\t%cs:Z:", is_ds? 'd' : 'c');
for (i = 0; i < (int)r->p->n_cigar; ++i) {
int op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
if (op == MM_CIGAR_MATCH || op == MM_CIGAR_EQ_MATCH || op == MM_CIGAR_X_MISMATCH)
q_len += len, t_len += len;
else if (op == MM_CIGAR_INS)
q_len += len;
else if (op == MM_CIGAR_DEL || op == MM_CIGAR_N_SKIP)
t_len += len;
}
for (i = q_off = t_off = 0; i < (int)r->p->n_cigar; ++i) { for (i = q_off = t_off = 0; i < (int)r->p->n_cigar; ++i) {
int j, op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4; int j, op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
assert(op >= 0 && op <= 3); assert((op >= MM_CIGAR_MATCH && op <= MM_CIGAR_N_SKIP) || op == MM_CIGAR_EQ_MATCH || op == MM_CIGAR_X_MISMATCH);
if (op == 0) { // match if (op == MM_CIGAR_MATCH || op == MM_CIGAR_EQ_MATCH || op == MM_CIGAR_X_MISMATCH) {
int l_tmp = 0; int l_tmp = 0;
for (j = 0; j < len; ++j) { for (j = 0; j < len; ++j) {
if (qseq[q_off + j] != tseq[t_off + j]) { if (qseq[q_off + j] != tseq[t_off + j]) {
@@ -161,15 +205,43 @@ static void write_cs_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq
} else mm_sprintf_lite(s, ":%d", l_tmp); } else mm_sprintf_lite(s, ":%d", l_tmp);
} }
q_off += len, t_off += len; q_off += len, t_off += len;
} else if (op == 1) { // insertion to ref } else if (op == MM_CIGAR_INS) {
if (is_ds) {
int z, ll, lr, y = q_off;
for (z = 1; z <= len; ++z)
if (y - z < 0 || qseq[y + len - z] != qseq[y - z])
break;
lr = z - 1;
for (z = 0; z < len; ++z)
if (y + len + z >= q_len || qseq[y + len + z] != qseq[y + z])
break;
ll = z;
mm_sprintf_lite(s, "+");
write_indel_ds(s, len, &qseq[y], ll, lr);
} else {
for (j = 0, tmp[len] = 0; j < len; ++j) for (j = 0, tmp[len] = 0; j < len; ++j)
tmp[j] = "acgtn"[qseq[q_off + j]]; tmp[j] = "acgtn"[qseq[q_off + j]];
mm_sprintf_lite(s, "+%s", tmp); mm_sprintf_lite(s, "+%s", tmp);
}
q_off += len; q_off += len;
} else if (op == 2) { // deletion from ref } else if (op == MM_CIGAR_DEL) {
if (is_ds) {
int z, ll, lr, x = t_off;
for (z = 1; z <= len; ++z)
if (x - z < 0 || tseq[x + len - z] != tseq[x - z])
break;
lr = z - 1;
for (z = 0; z < len; ++z)
if (x + len + z >= t_len || tseq[x + z] != tseq[x + len + z])
break;
ll = z;
mm_sprintf_lite(s, "-");
write_indel_ds(s, len, &tseq[x], ll, lr);
} else {
for (j = 0, tmp[len] = 0; j < len; ++j) for (j = 0, tmp[len] = 0; j < len; ++j)
tmp[j] = "acgtn"[tseq[t_off + j]]; tmp[j] = "acgtn"[tseq[t_off + j]];
mm_sprintf_lite(s, "-%s", tmp); mm_sprintf_lite(s, "-%s", tmp);
}
t_off += len; t_off += len;
} else { // intron } else { // intron
assert(len >= 2); assert(len >= 2);
@@ -181,14 +253,60 @@ static void write_cs_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq
assert(t_off == r->re - r->rs && q_off == r->qe - r->qs); assert(t_off == r->re - r->rs && q_off == r->qe - r->qs);
} }
static inline void revcomp_splice(uint8_t s[2])
{
uint8_t c = s[1] < 4? 3 - s[1] : 4;
s[1] = s[0] < 4? 3 - s[0] : 4;
s[0] = c;
}
void mm_write_junc(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r)
{
int32_t i, t_off, swritten = 0;
s->l = 0;
if (!r->is_spliced || r->p == 0) return; // no junctions
if (r->p->trans_strand != 1 && r->p->trans_strand != 2) return; // no preferred strand
for (i = 0, t_off = r->rs; i < (int)r->p->n_cigar; ++i) {
int op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
if (op == MM_CIGAR_MATCH || op == MM_CIGAR_EQ_MATCH || op == MM_CIGAR_X_MISMATCH || op == MM_CIGAR_DEL) {
t_off += len;
} else if (op == MM_CIGAR_N_SKIP) { // intron
uint8_t donor[2], acceptor[2];
int32_t score1 = 0, score2 = 0, rev;
assert(len >= 2);
rev = (r->p->trans_strand == 2) ^ r->rev;
if (!rev) {
mm_idx_getseq(mi, r->rid, t_off, t_off + 2, donor);
mm_idx_getseq(mi, r->rid, t_off + len - 2, t_off + len, acceptor);
} else {
mm_idx_getseq(mi, r->rid, t_off, t_off + 2, acceptor);
mm_idx_getseq(mi, r->rid, t_off + len - 2, t_off + len, donor);
revcomp_splice(donor);
revcomp_splice(acceptor);
}
//fprintf(stderr, "%c%c-%c%c\n", "ACGTN"[donor[0]], "ACGTN"[donor[1]], "ACGTN"[acceptor[0]], "ACGTN"[acceptor[1]]);
if (donor[0] == 2 && donor[1] == 3) score1 = 3;
else if (donor[0] == 2 && donor[1] == 1) score1 = 2;
else if (donor[0] == 0 && donor[1] == 3) score1 = 1;
if (acceptor[0] == 0 && acceptor[1] == 2) score2 = 3;
else if (acceptor[0] == 0 && acceptor[1] == 1) score2 = 1;
if (swritten) mm_sprintf_lite(s, "\n");
else swritten = 1;
mm_sprintf_lite(s, "%s\t%d\t%d\t%s\t%d\t%c", mi->seq[r->rid].name, t_off, t_off + len, t->name, score1 + score2, "+-"[rev]);
t_off += len;
}
}
assert(t_off == r->re);
}
static void write_MD_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq, const mm_reg1_t *r, char *tmp, int write_tag) static void write_MD_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq, const mm_reg1_t *r, char *tmp, int write_tag)
{ {
int i, q_off, t_off, l_MD = 0; int i, q_off, t_off, l_MD = 0;
if (write_tag) mm_sprintf_lite(s, "\tMD:Z:"); if (write_tag) mm_sprintf_lite(s, "\tMD:Z:");
for (i = q_off = t_off = 0; i < (int)r->p->n_cigar; ++i) { for (i = q_off = t_off = 0; i < (int)r->p->n_cigar; ++i) {
int j, op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4; int j, op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
assert(op >= 0 && op <= 3); assert((op >= MM_CIGAR_MATCH && op <= MM_CIGAR_N_SKIP) || op == MM_CIGAR_EQ_MATCH || op == MM_CIGAR_X_MISMATCH);
if (op == 0) { // match if (op == MM_CIGAR_MATCH || op == MM_CIGAR_EQ_MATCH || op == MM_CIGAR_X_MISMATCH) {
for (j = 0; j < len; ++j) { for (j = 0; j < len; ++j) {
if (qseq[q_off + j] != tseq[t_off + j]) { if (qseq[q_off + j] != tseq[t_off + j]) {
mm_sprintf_lite(s, "%d%c", l_MD, "ACGTN"[tseq[t_off + j]]); mm_sprintf_lite(s, "%d%c", l_MD, "ACGTN"[tseq[t_off + j]]);
@@ -196,15 +314,15 @@ static void write_MD_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq
} else ++l_MD; } else ++l_MD;
} }
q_off += len, t_off += len; q_off += len, t_off += len;
} else if (op == 1) { // insertion to ref } else if (op == MM_CIGAR_INS) {
q_off += len; q_off += len;
} else if (op == 2) { // deletion from ref } else if (op == MM_CIGAR_DEL) {
for (j = 0, tmp[len] = 0; j < len; ++j) for (j = 0, tmp[len] = 0; j < len; ++j)
tmp[j] = "ACGTN"[tseq[t_off + j]]; tmp[j] = "ACGTN"[tseq[t_off + j]];
mm_sprintf_lite(s, "%d^%s", l_MD, tmp); mm_sprintf_lite(s, "%d^%s", l_MD, tmp);
l_MD = 0; l_MD = 0;
t_off += len; t_off += len;
} else if (op == 3) { // reference skip } else if (op == MM_CIGAR_N_SKIP) {
t_off += len; t_off += len;
} }
} }
@@ -212,7 +330,7 @@ static void write_MD_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq
assert(t_off == r->re - r->rs && q_off == r->qe - r->qs); assert(t_off == r->re - r->rs && q_off == r->qe - r->qs);
} }
static void write_cs_or_MD(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int no_iden, int is_MD, int write_tag) static void write_cs_ds_or_MD(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int no_iden, int is_MD, int is_ds, int write_tag, int is_qstrand)
{ {
extern unsigned char seq_nt4_table[256]; extern unsigned char seq_nt4_table[256];
int i; int i;
@@ -222,6 +340,11 @@ static void write_cs_or_MD(void *km, kstring_t *s, const mm_idx_t *mi, const mm_
qseq = (uint8_t*)kmalloc(km, r->qe - r->qs); qseq = (uint8_t*)kmalloc(km, r->qe - r->qs);
tseq = (uint8_t*)kmalloc(km, r->re - r->rs); tseq = (uint8_t*)kmalloc(km, r->re - r->rs);
tmp = (char*)kmalloc(km, r->re - r->rs > r->qe - r->qs? r->re - r->rs + 1 : r->qe - r->qs + 1); tmp = (char*)kmalloc(km, r->re - r->rs > r->qe - r->qs? r->re - r->rs + 1 : r->qe - r->qs + 1);
if (is_qstrand) {
mm_idx_getseq2(mi, r->rev, r->rid, r->rs, r->re, tseq);
for (i = r->qs; i < r->qe; ++i)
qseq[i - r->qs] = seq_nt4_table[(uint8_t)t->seq[i]];
} else {
mm_idx_getseq(mi, r->rid, r->rs, r->re, tseq); mm_idx_getseq(mi, r->rid, r->rs, r->re, tseq);
if (!r->rev) { if (!r->rev) {
for (i = r->qs; i < r->qe; ++i) for (i = r->qs; i < r->qe; ++i)
@@ -232,19 +355,20 @@ static void write_cs_or_MD(void *km, kstring_t *s, const mm_idx_t *mi, const mm_
qseq[r->qe - i - 1] = c >= 4? 4 : 3 - c; qseq[r->qe - i - 1] = c >= 4? 4 : 3 - c;
} }
} }
}
if (is_MD) write_MD_core(s, tseq, qseq, r, tmp, write_tag); if (is_MD) write_MD_core(s, tseq, qseq, r, tmp, write_tag);
else write_cs_core(s, tseq, qseq, r, tmp, no_iden, write_tag); else write_cs_ds_core(s, tseq, qseq, r, tmp, no_iden, is_ds, write_tag);
kfree(km, qseq); kfree(km, tseq); kfree(km, tmp); kfree(km, qseq); kfree(km, tseq); kfree(km, tmp);
} }
int mm_gen_cs_or_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int is_MD, int no_iden) int mm_gen_cs_or_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int is_MD, int no_iden, int is_qstrand)
{ {
mm_bseq1_t t; mm_bseq1_t t;
kstring_t str; kstring_t str;
str.s = *buf, str.l = 0, str.m = *max_len; str.s = *buf, str.l = 0, str.m = *max_len;
t.l_seq = strlen(seq); t.l_seq = strlen(seq);
t.seq = (char*)seq; t.seq = (char*)seq;
write_cs_or_MD(km, &str, mi, &t, r, no_iden, is_MD, 0); write_cs_ds_or_MD(km, &str, mi, &t, r, no_iden, is_MD, 0, 0, is_qstrand);
*max_len = str.m; *max_len = str.m;
*buf = str.s; *buf = str.s;
return str.l; return str.l;
@@ -252,12 +376,12 @@ int mm_gen_cs_or_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, cons
int mm_gen_cs(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int no_iden) int mm_gen_cs(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int no_iden)
{ {
return mm_gen_cs_or_MD(km, buf, max_len, mi, r, seq, 0, no_iden); return mm_gen_cs_or_MD(km, buf, max_len, mi, r, seq, 0, no_iden, 0);
} }
int mm_gen_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq) int mm_gen_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq)
{ {
return mm_gen_cs_or_MD(km, buf, max_len, mi, r, seq, 1, 0); return mm_gen_cs_or_MD(km, buf, max_len, mi, r, seq, 1, 0, 0);
} }
static inline void write_tags(kstring_t *s, const mm_reg1_t *r) static inline void write_tags(kstring_t *s, const mm_reg1_t *r)
@@ -266,47 +390,73 @@ static inline void write_tags(kstring_t *s, const mm_reg1_t *r)
if (r->id == r->parent) type = r->inv? 'I' : 'P'; if (r->id == r->parent) type = r->inv? 'I' : 'P';
else type = r->inv? 'i' : 'S'; else type = r->inv? 'i' : 'S';
if (r->p) { if (r->p) {
mm_sprintf_lite(s, "\tNM:i:%d\tms:i:%d\tAS:i:%d\tnn:i:%d", r->blen - r->mlen + r->p->n_ambi, r->p->dp_max, r->p->dp_score, r->p->n_ambi); mm_sprintf_lite(s, "\tNM:i:%d\tms:i:%d\tAS:i:%d\tnn:i:%d", r->blen - r->mlen + r->p->n_ambi, r->p->dp_max0, r->p->dp_score, r->p->n_ambi);
if (r->p->trans_strand == 1 || r->p->trans_strand == 2) if (r->p->trans_strand == 1 || r->p->trans_strand == 2)
mm_sprintf_lite(s, "\tts:A:%c", "?+-?"[r->p->trans_strand]); mm_sprintf_lite(s, "\tts:A:%c", "?+-?"[r->p->trans_strand]);
} }
mm_sprintf_lite(s, "\ttp:A:%c\tcm:i:%d\ts1:i:%d", type, r->cnt, r->score); mm_sprintf_lite(s, "\ttp:A:%c\tcm:i:%d\ts1:i:%d", type, r->cnt, r->score);
if (r->parent == r->id) mm_sprintf_lite(s, "\ts2:i:%d", r->subsc); if (r->parent == r->id) mm_sprintf_lite(s, "\ts2:i:%d", r->subsc);
if (r->div >= 0.0f && r->div <= 1.0f) { if (r->p) {
char buf[8]; char buf[16];
double div;
div = 1.0 - mm_event_identity(r);
if (div == 0.0) buf[0] = '0', buf[1] = 0;
else snprintf(buf, 16, "%.4f", 1.0 - mm_event_identity(r));
mm_sprintf_lite(s, "\tde:f:%s", buf);
} else if (r->div >= 0.0f && r->div <= 1.0f) {
char buf[16];
if (r->div == 0.0f) buf[0] = '0', buf[1] = 0; if (r->div == 0.0f) buf[0] = '0', buf[1] = 0;
else sprintf(buf, "%.4f", r->div); else snprintf(buf, 16, "%.4f", r->div);
mm_sprintf_lite(s, "\tdv:f:%s", buf); mm_sprintf_lite(s, "\tdv:f:%s", buf);
} }
if (r->split) mm_sprintf_lite(s, "\tzd:i:%d", r->split); if (r->split) mm_sprintf_lite(s, "\tzd:i:%d", r->split);
} }
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int opt_flag) void mm_write_paf4(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag, int rep_len, int n_seg, int seg_idx)
{ {
s->l = 0; s->l = 0;
mm_sprintf_lite(s, "%s", t->name);
if ((opt_flag & MM_F_FRAG_MODE) && n_seg >= 2 && seg_idx >= 0)
mm_sprintf_lite(s, "/%d", seg_idx + 1);
if (r == 0) { if (r == 0) {
mm_sprintf_lite(s, "%s\t%d", t->name, t->l_seq); mm_sprintf_lite(s, "\t%d\t0\t0\t*\t*\t0\t0\t0\t0\t0\t0", t->l_seq);
if (rep_len >= 0) mm_sprintf_lite(s, "\trl:i:%d", rep_len);
return; return;
} }
mm_sprintf_lite(s, "%s\t%d\t%d\t%d\t%c\t", t->name, t->l_seq, r->qs, r->qe, "+-"[r->rev]); mm_sprintf_lite(s, "\t%d\t%d\t%d\t%c\t", t->l_seq, r->qs, r->qe, "+-"[r->rev]);
if (mi->seq[r->rid].name) mm_sprintf_lite(s, "%s", mi->seq[r->rid].name); if (mi->seq[r->rid].name) mm_sprintf_lite(s, "%s", mi->seq[r->rid].name);
else mm_sprintf_lite(s, "%d", r->rid); else mm_sprintf_lite(s, "%d", r->rid);
mm_sprintf_lite(s, "\t%d\t%d\t%d", mi->seq[r->rid].len, r->rs, r->re); mm_sprintf_lite(s, "\t%d", mi->seq[r->rid].len);
if ((opt_flag & MM_F_QSTRAND) && r->rev)
mm_sprintf_lite(s, "\t%d\t%d", mi->seq[r->rid].len - r->re, mi->seq[r->rid].len - r->rs);
else
mm_sprintf_lite(s, "\t%d\t%d", r->rs, r->re);
mm_sprintf_lite(s, "\t%d\t%d", r->mlen, r->blen); mm_sprintf_lite(s, "\t%d\t%d", r->mlen, r->blen);
mm_sprintf_lite(s, "\t%d", r->mapq); mm_sprintf_lite(s, "\t%d", r->mapq);
write_tags(s, r); write_tags(s, r);
if (rep_len >= 0) mm_sprintf_lite(s, "\trl:i:%d", rep_len);
if (r->p && (opt_flag & MM_F_OUT_CG)) { if (r->p && (opt_flag & MM_F_OUT_CG)) {
uint32_t k; uint32_t k;
mm_sprintf_lite(s, "\tcg:Z:"); mm_sprintf_lite(s, "\tcg:Z:");
for (k = 0; k < r->p->n_cigar; ++k) for (k = 0; k < r->p->n_cigar; ++k)
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDNSHP=XB"[r->p->cigar[k]&0xf]); mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, MM_CIGAR_STR[r->p->cigar[k]&0xf]);
} }
if (r->p && (opt_flag & (MM_F_OUT_CS|MM_F_OUT_MD))) if (r->p && (opt_flag & (MM_F_OUT_CS|MM_F_OUT_DS|MM_F_OUT_MD)))
write_cs_or_MD(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG), opt_flag&MM_F_OUT_MD, 1); write_cs_ds_or_MD(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG), !!(opt_flag&MM_F_OUT_MD), !!(opt_flag&MM_F_OUT_DS), 1, !!(opt_flag&MM_F_QSTRAND));
if ((opt_flag & MM_F_COPY_COMMENT) && t->comment) if ((opt_flag & MM_F_COPY_COMMENT) && t->comment)
mm_sprintf_lite(s, "\t%s", t->comment); mm_sprintf_lite(s, "\t%s", t->comment);
} }
void mm_write_paf3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag, int rep_len)
{
mm_write_paf4(s, mi, t, r, km, opt_flag, rep_len, 0, 0);
}
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag)
{
mm_write_paf3(s, mi, t, r, km, opt_flag, -1);
}
static void sam_write_sq(kstring_t *s, char *seq, int l, int rev, int comp) static void sam_write_sq(kstring_t *s, char *seq, int l, int rev, int comp)
{ {
extern unsigned char seq_comp_table[256]; extern unsigned char seq_comp_table[256];
@@ -331,7 +481,7 @@ static inline const mm_reg1_t *get_sam_pri(int n_regs, const mm_reg1_t *regs)
return NULL; return NULL;
} }
static void write_sam_cigar(kstring_t *s, int sam_flag, int in_tag, int qlen, const mm_reg1_t *r, int opt_flag) static void write_sam_cigar(kstring_t *s, int sam_flag, int in_tag, int qlen, const mm_reg1_t *r, int64_t opt_flag)
{ {
if (r->p == 0) { if (r->p == 0) {
mm_sprintf_lite(s, "*"); mm_sprintf_lite(s, "*");
@@ -340,27 +490,30 @@ static void write_sam_cigar(kstring_t *s, int sam_flag, int in_tag, int qlen, co
clip_len[0] = r->rev? qlen - r->qe : r->qs; clip_len[0] = r->rev? qlen - r->qe : r->qs;
clip_len[1] = r->rev? r->qs : qlen - r->qe; clip_len[1] = r->rev? r->qs : qlen - r->qe;
if (in_tag) { if (in_tag) {
int clip_char = (sam_flag&0x800) && !(opt_flag&MM_F_SOFTCLIP)? 5 : 4; int clip_char = (((sam_flag&0x800) || ((sam_flag&0x100) && (opt_flag&MM_F_SECONDARY_SEQ))) &&
!(opt_flag&MM_F_SOFTCLIP)) ? 5 : 4;
mm_sprintf_lite(s, "\tCG:B:I"); mm_sprintf_lite(s, "\tCG:B:I");
if (clip_len[0]) mm_sprintf_lite(s, ",%u", clip_len[0]<<4|clip_char); if (clip_len[0]) mm_sprintf_lite(s, ",%u", clip_len[0]<<4|clip_char);
for (k = 0; k < r->p->n_cigar; ++k) for (k = 0; k < r->p->n_cigar; ++k)
mm_sprintf_lite(s, ",%u", r->p->cigar[k]); mm_sprintf_lite(s, ",%u", r->p->cigar[k]);
if (clip_len[1]) mm_sprintf_lite(s, ",%u", clip_len[1]<<4|clip_char); if (clip_len[1]) mm_sprintf_lite(s, ",%u", clip_len[1]<<4|clip_char);
} else { } else {
int clip_char = (sam_flag&0x800) && !(opt_flag&MM_F_SOFTCLIP)? 'H' : 'S'; int clip_char = (((sam_flag&0x800) || ((sam_flag&0x100) && (opt_flag&MM_F_SECONDARY_SEQ))) &&
!(opt_flag&MM_F_SOFTCLIP)) ? 'H' : 'S';
assert(clip_len[0] < qlen && clip_len[1] < qlen);
if (clip_len[0]) mm_sprintf_lite(s, "%d%c", clip_len[0], clip_char); if (clip_len[0]) mm_sprintf_lite(s, "%d%c", clip_len[0], clip_char);
for (k = 0; k < r->p->n_cigar; ++k) for (k = 0; k < r->p->n_cigar; ++k)
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDNSHP=XB"[r->p->cigar[k]&0xf]); mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, MM_CIGAR_STR[r->p->cigar[k]&0xf]);
if (clip_len[1]) mm_sprintf_lite(s, "%d%c", clip_len[1], clip_char); if (clip_len[1]) mm_sprintf_lite(s, "%d%c", clip_len[1], clip_char);
} }
} }
} }
void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regss, const mm_reg1_t *const* regss, void *km, int opt_flag) void mm_write_sam3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regss, const mm_reg1_t *const* regss, void *km, int64_t opt_flag, int rep_len)
{ {
const int max_bam_cigar_op = 65535; const int max_bam_cigar_op = 65535;
int flag, n_regs = n_regss[seg_idx], cigar_in_tag = 0; int flag, n_regs = n_regss[seg_idx], cigar_in_tag = 0;
int this_rid = -1, this_pos = -1, this_rev = 0; int this_rid = -1, this_pos = -1;
const mm_reg1_t *regs = regss[seg_idx], *r_prev = NULL, *r_next; const mm_reg1_t *regs = regss[seg_idx], *r_prev = NULL, *r_next;
const mm_reg1_t *r = n_regs > 0 && reg_idx < n_regs && reg_idx >= 0? &regs[reg_idx] : NULL; const mm_reg1_t *r = n_regs > 0 && reg_idx < n_regs && reg_idx >= 0? &regs[reg_idx] : NULL;
@@ -409,7 +562,7 @@ void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
mm_sprintf_lite(s, "\t%s\t%d\t0\t*", mi->seq[this_rid].name, this_pos+1); mm_sprintf_lite(s, "\t%s\t%d\t0\t*", mi->seq[this_rid].name, this_pos+1);
} else mm_sprintf_lite(s, "\t*\t0\t0\t*"); } else mm_sprintf_lite(s, "\t*\t0\t0\t*");
} else { } else {
this_rid = r->rid, this_pos = r->rs, this_rev = r->rev; this_rid = r->rid, this_pos = r->rs;
mm_sprintf_lite(s, "\t%s\t%d\t%d\t", mi->seq[r->rid].name, r->rs+1, r->mapq); mm_sprintf_lite(s, "\t%s\t%d\t%d\t", mi->seq[r->rid].name, r->rs+1, r->mapq);
if ((opt_flag & MM_F_LONG_CIGAR) && r->p && r->p->n_cigar > max_bam_cigar_op - 2) { if ((opt_flag & MM_F_LONG_CIGAR) && r->p && r->p->n_cigar > max_bam_cigar_op - 2) {
int n_cigar = r->p->n_cigar; int n_cigar = r->p->n_cigar;
@@ -421,7 +574,7 @@ void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
if (cigar_in_tag) { if (cigar_in_tag) {
int slen; int slen;
if ((flag & 0x900) == 0 || (opt_flag & MM_F_SOFTCLIP)) slen = t->l_seq; if ((flag & 0x900) == 0 || (opt_flag & MM_F_SOFTCLIP)) slen = t->l_seq;
else if (flag & 0x100) slen = 0; else if ((flag & 0x100) && !(opt_flag & MM_F_SECONDARY_SEQ)) slen = 0;
else slen = r->qe - r->qs; else slen = r->qe - r->qs;
mm_sprintf_lite(s, "%dS%dN", slen, r->re - r->rs); mm_sprintf_lite(s, "%dS%dN", slen, r->re - r->rs);
} else write_sam_cigar(s, flag, 0, t->l_seq, r, opt_flag); } else write_sam_cigar(s, flag, 0, t->l_seq, r, opt_flag);
@@ -432,17 +585,17 @@ void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
int tlen = 0; int tlen = 0;
if (this_rid >= 0 && r_next) { if (this_rid >= 0 && r_next) {
if (this_rid == r_next->rid) { if (this_rid == r_next->rid) {
int this_pos5 = r && r->rev? r->re - 1 : this_pos; if (r) {
int this_pos5 = r->rev? r->re - 1 : this_pos;
int next_pos5 = r_next->rev? r_next->re - 1 : r_next->rs; int next_pos5 = r_next->rev? r_next->re - 1 : r_next->rs;
tlen = next_pos5 - this_pos5; tlen = next_pos5 - this_pos5;
}
mm_sprintf_lite(s, "\t=\t"); mm_sprintf_lite(s, "\t=\t");
} else mm_sprintf_lite(s, "\t%s\t", mi->seq[r_next->rid].name); } else mm_sprintf_lite(s, "\t%s\t", mi->seq[r_next->rid].name);
mm_sprintf_lite(s, "%d\t", r_next->rs + 1); mm_sprintf_lite(s, "%d\t", r_next->rs + 1);
} else if (r_next) { // && this_rid < 0 } else if (r_next) { // && this_rid < 0
mm_sprintf_lite(s, "\t%s\t%d\t", mi->seq[r_next->rid].name, r_next->rs + 1); mm_sprintf_lite(s, "\t%s\t%d\t", mi->seq[r_next->rid].name, r_next->rs + 1);
} else if (this_rid >= 0) { // && r_next == NULL } else if (this_rid >= 0) { // && r_next == NULL
int this_pos5 = this_rev? r->re - 1 : this_pos; // this_rev is only true when r != NULL
tlen = this_pos - this_pos5; // next_pos5 will be this_pos
mm_sprintf_lite(s, "\t=\t%d\t", this_pos + 1); // next segment will take r's coordinate mm_sprintf_lite(s, "\t=\t%d\t", this_pos + 1); // next segment will take r's coordinate
} else mm_sprintf_lite(s, "\t*\t0\t"); // neither has coordinates } else mm_sprintf_lite(s, "\t*\t0\t"); // neither has coordinates
if (tlen > 0) ++tlen; if (tlen > 0) ++tlen;
@@ -462,7 +615,7 @@ void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
mm_sprintf_lite(s, "\t"); mm_sprintf_lite(s, "\t");
if (t->qual) sam_write_sq(s, t->qual, t->l_seq, r->rev, 0); if (t->qual) sam_write_sq(s, t->qual, t->l_seq, r->rev, 0);
else mm_sprintf_lite(s, "*"); else mm_sprintf_lite(s, "*");
} else if (flag & 0x100) { } else if ((flag & 0x100) && !(opt_flag & MM_F_SECONDARY_SEQ)){
mm_sprintf_lite(s, "*\t*"); mm_sprintf_lite(s, "*\t*");
} else { } else {
sam_write_sq(s, t->seq + r->qs, r->qe - r->qs, r->rev, r->rev); sam_write_sq(s, t->seq + r->qs, r->qe - r->qs, r->rev, r->rev);
@@ -502,11 +655,12 @@ void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
} }
} }
} }
if (r->p && (opt_flag & (MM_F_OUT_CS|MM_F_OUT_MD))) if (r->p && (opt_flag & (MM_F_OUT_CS|MM_F_OUT_DS|MM_F_OUT_MD)))
write_cs_or_MD(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG), opt_flag&MM_F_OUT_MD, 1); write_cs_ds_or_MD(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG), opt_flag&MM_F_OUT_MD, !!(opt_flag&MM_F_OUT_DS), 1, 0);
if (cigar_in_tag) if (cigar_in_tag)
write_sam_cigar(s, flag, 1, t->l_seq, r, opt_flag); write_sam_cigar(s, flag, 1, t->l_seq, r, opt_flag);
} }
if (rep_len >= 0) mm_sprintf_lite(s, "\trl:i:%d", rep_len);
if ((opt_flag & MM_F_COPY_COMMENT) && t->comment) if ((opt_flag & MM_F_COPY_COMMENT) && t->comment)
mm_sprintf_lite(s, "\t%s", t->comment); mm_sprintf_lite(s, "\t%s", t->comment);
@@ -514,6 +668,11 @@ void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
s->s[s->l] = 0; // we always have room for an extra byte (see str_enlarge) s->s[s->l] = 0; // we always have room for an extra byte (see str_enlarge)
} }
void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regss, const mm_reg1_t *const* regss, void *km, int64_t opt_flag)
{
mm_write_sam3(s, mi, t, seg_idx, reg_idx, n_seg, n_regss, regss, km, opt_flag, -1);
}
void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int n_regs, const mm_reg1_t *regs) void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int n_regs, const mm_reg1_t *regs)
{ {
int i; int i;
+70 -86
View File
@@ -20,14 +20,14 @@ static inline void mm_cal_fuzzy_len(mm_reg1_t *r, const mm128_t *a)
} }
} }
static inline void mm_reg_set_coor(mm_reg1_t *r, int32_t qlen, const mm128_t *a) static inline void mm_reg_set_coor(mm_reg1_t *r, int32_t qlen, const mm128_t *a, int is_qstrand)
{ // NB: r->as and r->cnt MUST BE set correctly for this function to work { // NB: r->as and r->cnt MUST BE set correctly for this function to work
int32_t k = r->as, q_span = (int32_t)(a[k].y>>32&0xff); int32_t k = r->as, q_span = (int32_t)(a[k].y>>32&0xff);
r->rev = a[k].x>>63; r->rev = a[k].x>>63;
r->rid = a[k].x<<1>>33; r->rid = a[k].x<<1>>33;
r->rs = (int32_t)a[k].x + 1 > q_span? (int32_t)a[k].x + 1 - q_span : 0; // NB: target span may be shorter, so this test is necessary r->rs = (int32_t)a[k].x + 1 > q_span? (int32_t)a[k].x + 1 - q_span : 0; // NB: target span may be shorter, so this test is necessary
r->re = (int32_t)a[k + r->cnt - 1].x + 1; r->re = (int32_t)a[k + r->cnt - 1].x + 1;
if (!r->rev) { if (!r->rev || is_qstrand) {
r->qs = (int32_t)a[k].y + 1 - q_span; r->qs = (int32_t)a[k].y + 1 - q_span;
r->qe = (int32_t)a[k + r->cnt - 1].y + 1; r->qe = (int32_t)a[k + r->cnt - 1].y + 1;
} else { } else {
@@ -49,13 +49,13 @@ static inline uint64_t hash64(uint64_t key)
return key; return key;
} }
mm_reg1_t *mm_gen_regs(void *km, uint32_t hash, int qlen, int n_u, uint64_t *u, mm128_t *a) // convert chains to hits mm_reg1_t *mm_gen_regs(void *km, uint32_t hash, int qlen, int n_u, uint64_t *u, mm128_t *a, int is_qstrand) // convert chains to hits
{ {
mm128_t *z, tmp; mm128_t *z, tmp;
mm_reg1_t *r; mm_reg1_t *r;
int i, k; int i, k;
if (n_u == 0) return 0; if (n_u <= 0) return 0;
// sort by score // sort by score
z = (mm128_t*)kmalloc(km, n_u * 16); z = (mm128_t*)kmalloc(km, n_u * 16);
@@ -81,13 +81,29 @@ mm_reg1_t *mm_gen_regs(void *km, uint32_t hash, int qlen, int n_u, uint64_t *u,
ri->cnt = (int32_t)z[i].y; ri->cnt = (int32_t)z[i].y;
ri->as = z[i].y >> 32; ri->as = z[i].y >> 32;
ri->div = -1.0f; ri->div = -1.0f;
mm_reg_set_coor(ri, qlen, a); mm_reg_set_coor(ri, qlen, a, is_qstrand);
} }
kfree(km, z); kfree(km, z);
return r; return r;
} }
void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a) void mm_mark_alt(const mm_idx_t *mi, int n, mm_reg1_t *r)
{
int i;
if (mi->n_alt == 0) return;
for (i = 0; i < n; ++i)
if (mi->seq[r[i].rid].is_alt)
r[i].is_alt = 1;
}
static inline int mm_alt_score(int score, float alt_diff_frac)
{
if (score < 0) return score;
score = (int)(score * (1.0 - alt_diff_frac) + .499);
return score > 0? score : 1;
}
void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a, int is_qstrand)
{ {
if (n <= 0 || n >= r->cnt) return; if (n <= 0 || n >= r->cnt) return;
*r2 = *r; *r2 = *r;
@@ -99,14 +115,14 @@ void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a)
r2->score = (int32_t)(r->score * ((float)r2->cnt / r->cnt) + .499); r2->score = (int32_t)(r->score * ((float)r2->cnt / r->cnt) + .499);
r2->as = r->as + n; r2->as = r->as + n;
if (r->parent == r->id) r2->parent = MM_PARENT_TMP_PRI; if (r->parent == r->id) r2->parent = MM_PARENT_TMP_PRI;
mm_reg_set_coor(r2, qlen, a); mm_reg_set_coor(r2, qlen, a, is_qstrand);
r->cnt -= r2->cnt; r->cnt -= r2->cnt;
r->score -= r2->score; r->score -= r2->score;
mm_reg_set_coor(r, qlen, a); mm_reg_set_coor(r, qlen, a, is_qstrand);
r->split |= 1, r2->split |= 2; r->split |= 1, r2->split |= 2;
} }
void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r, int sub_diff, int hard_mask_level) // and compute mm_reg1_t::subsc void mm_set_parent(void *km, float mask_level, int mask_len, int n, mm_reg1_t *r, int sub_diff, int hard_mask_level, float alt_diff_frac) // and compute mm_reg1_t::subsc
{ {
int i, j, k, *w; int i, j, k, *w;
uint64_t *cov; uint64_t *cov;
@@ -146,13 +162,16 @@ skip_uncov:
min = ej - sj < ei - si? ej - sj : ei - si; min = ej - sj < ei - si? ej - sj : ei - si;
max = ej - sj > ei - si? ej - sj : ei - si; max = ej - sj > ei - si? ej - sj : ei - si;
ol = si < sj? (ei < sj? 0 : ei < ej? ei - sj : ej - sj) : (ej < si? 0 : ej < ei? ej - si : ei - si); // overlap length; TODO: this can be simplified ol = si < sj? (ei < sj? 0 : ei < ej? ei - sj : ej - sj) : (ej < si? 0 : ej < ei? ej - si : ei - si); // overlap length; TODO: this can be simplified
if ((float)ol / min - (float)uncov_len / max > mask_level) { if ((float)ol / min - (float)uncov_len / max > mask_level && uncov_len <= mask_len) { // then this is a secondary hit
int cnt_sub = 0; int cnt_sub = 0, sci = ri->score;
ri->parent = rp->parent; ri->parent = rp->parent;
rp->subsc = rp->subsc > ri->score? rp->subsc : ri->score; if (!rp->is_alt && ri->is_alt) sci = mm_alt_score(sci, alt_diff_frac);
rp->subsc = rp->subsc > sci? rp->subsc : sci;
if (ri->cnt >= rp->cnt) cnt_sub = 1; if (ri->cnt >= rp->cnt) cnt_sub = 1;
if (rp->p && ri->p && (rp->rid != ri->rid || rp->rs != ri->rs || rp->re != ri->re || ol != min)) { // the last condition excludes identical hits after DP if (rp->p && ri->p && (rp->rid != ri->rid || rp->rs != ri->rs || rp->re != ri->re || ol != min)) { // the last condition excludes identical hits after DP
rp->p->dp_max2 = rp->p->dp_max2 > ri->p->dp_max? rp->p->dp_max2 : ri->p->dp_max; sci = ri->p->dp_max;
if (!rp->is_alt && ri->is_alt) sci = mm_alt_score(sci, alt_diff_frac);
rp->p->dp_max2 = rp->p->dp_max2 > sci? rp->p->dp_max2 : sci;
if (rp->p->dp_max - ri->p->dp_max <= sub_diff) cnt_sub = 1; if (rp->p->dp_max - ri->p->dp_max <= sub_diff) cnt_sub = 1;
} }
if (cnt_sub) ++rp->n_sub; if (cnt_sub) ++rp->n_sub;
@@ -166,7 +185,7 @@ set_parent_test:
kfree(km, w); kfree(km, w);
} }
void mm_hit_sort(void *km, int *n_regs, mm_reg1_t *r) void mm_hit_sort(void *km, int *n_regs, mm_reg1_t *r, float alt_diff_frac)
{ {
int32_t i, n_aux, n = *n_regs, has_cigar = 0, no_cigar = 0; int32_t i, n_aux, n = *n_regs, has_cigar = 0, no_cigar = 0;
mm128_t *aux; mm128_t *aux;
@@ -177,13 +196,11 @@ void mm_hit_sort(void *km, int *n_regs, mm_reg1_t *r)
t = (mm_reg1_t*)kmalloc(km, n * sizeof(mm_reg1_t)); t = (mm_reg1_t*)kmalloc(km, n * sizeof(mm_reg1_t));
for (i = n_aux = 0; i < n; ++i) { for (i = n_aux = 0; i < n; ++i) {
if (r[i].inv || r[i].cnt > 0) { // squeeze out elements with cnt==0 (soft deleted) if (r[i].inv || r[i].cnt > 0) { // squeeze out elements with cnt==0 (soft deleted)
if (r[i].p) { int score;
aux[n_aux].x = (uint64_t)r[i].p->dp_max << 32 | r[i].hash; if (r[i].p) score = r[i].p->dp_max, has_cigar = 1;
has_cigar = 1; else score = r[i].score, no_cigar = 1;
} else { if (r[i].is_alt) score = mm_alt_score(score, alt_diff_frac);
aux[n_aux].x = (uint64_t)r[i].score << 32 | r[i].hash; aux[n_aux].x = (uint64_t)score << 32 | r[i].hash;
no_cigar = 1;
}
aux[n_aux++].y = i; aux[n_aux++].y = i;
} else if (r[i].p) { } else if (r[i].p) {
free(r[i].p); free(r[i].p);
@@ -235,7 +252,7 @@ void mm_sync_regs(void *km, int n_regs, mm_reg1_t *regs) // keep mm_reg1_t::{id,
mm_set_sam_pri(n_regs, regs); mm_set_sam_pri(n_regs, regs);
} }
void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int *n_, mm_reg1_t *r) void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int check_strand, int min_strand_sc, int *n_, mm_reg1_t *r)
{ {
if (pri_ratio > 0.0f && *n_ > 0) { if (pri_ratio > 0.0f && *n_ > 0) {
int i, k, n = *n_, n_2nd = 0; int i, k, n = *n_, n_2nd = 0;
@@ -247,6 +264,9 @@ void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int *n_,
if (!(r[i].qs == r[p].qs && r[i].qe == r[p].qe && r[i].rid == r[p].rid && r[i].rs == r[p].rs && r[i].re == r[p].re)) // not identical hits if (!(r[i].qs == r[p].qs && r[i].qe == r[p].qe && r[i].rid == r[p].rid && r[i].rs == r[p].rs && r[i].re == r[p].re)) // not identical hits
r[k++] = r[i], ++n_2nd; r[k++] = r[i], ++n_2nd;
else if (r[i].p) free(r[i].p); else if (r[i].p) free(r[i].p);
} else if (check_strand && n_2nd < best_n && r[i].score > min_strand_sc && r[i].rev != r[p].rev) {
r[i].strand_retained = 1;
r[k++] = r[i], ++n_2nd;
} else if (r[i].p) free(r[i].p); } else if (r[i].p) free(r[i].p);
} }
if (k != n) mm_sync_regs(km, k, r); // removing hits requires sync() if (k != n) mm_sync_regs(km, k, r); // removing hits requires sync()
@@ -254,6 +274,19 @@ void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int *n_,
} }
} }
int mm_filter_strand_retained(int n_regs, mm_reg1_t *r)
{
int i, k;
for (i = k = 0; i < n_regs; ++i) {
int p = r[i].parent;
if (!r[i].strand_retained || r[i].div < r[p].div * 5.0f || r[i].div < 0.01f) {
if (k < i) r[k++] = r[i];
else ++k;
}
}
return k;
}
void mm_filter_regs(const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs) void mm_filter_regs(const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs)
{ // NB: after this call, mm_reg1_t::parent can be -1 if its parent filtered out { // NB: after this call, mm_reg1_t::parent can be -1 if its parent filtered out
int i, k; int i, k;
@@ -295,64 +328,6 @@ int mm_squeeze_a(void *km, int n_regs, mm_reg1_t *regs, mm128_t *a)
return as; return as;
} }
void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs_, mm_reg1_t *regs, mm128_t *a)
{
int i, n_aux, n_regs = *n_regs_, n_drop = 0;
uint64_t *aux;
if (n_regs < 2) return; // nothing to join
mm_squeeze_a(km, n_regs, regs, a);
aux = (uint64_t*)kmalloc(km, n_regs * 8);
for (i = n_aux = 0; i < n_regs; ++i)
if (regs[i].parent == i || regs[i].parent < 0)
aux[n_aux++] = (uint64_t)regs[i].as << 32 | i;
radix_sort_64(aux, aux + n_aux);
for (i = n_aux - 1; i >= 1; --i) {
mm_reg1_t *r0 = &regs[(int32_t)aux[i-1]], *r1 = &regs[(int32_t)aux[i]];
mm128_t *a0e, *a1s;
int max_gap, min_gap, sc_thres, min_flank_len;
// test
if (r0->as + r0->cnt != r1->as) continue; // not adjacent in a[]
if (r0->rid != r1->rid || r0->rev != r1->rev) continue; // make sure on the same target and strand
a0e = &a[r0->as + r0->cnt - 1];
a1s = &a[r1->as];
if (a1s->x <= a0e->x || (int32_t)a1s->y <= (int32_t)a0e->y) continue; // keep colinearity
max_gap = min_gap = (int32_t)a1s->y - (int32_t)a0e->y;
max_gap = a0e->x + max_gap > a1s->x? max_gap : a1s->x - a0e->x;
min_gap = a0e->x + min_gap < a1s->x? min_gap : a1s->x - a0e->x;
if (max_gap > opt->max_join_long || min_gap > opt->max_join_short) continue;
sc_thres = (int)((float)opt->min_join_flank_sc / opt->max_join_long * max_gap + .499);
if (r0->score < sc_thres || r1->score < sc_thres) continue; // require good flanking chains
min_flank_len = (int)(max_gap * opt->min_join_flank_ratio);
if (r0->re - r0->rs < min_flank_len || r0->qe - r0->qs < min_flank_len) continue; // require enough flanking length
if (r1->re - r1->rs < min_flank_len || r1->qe - r1->qs < min_flank_len) continue;
// all conditions satisfied; join
a[r1->as].y |= MM_SEED_LONG_JOIN;
r0->cnt += r1->cnt, r0->score += r1->score;
mm_reg_set_coor(r0, qlen, a);
r1->cnt = 0;
r1->parent = r0->id;
++n_drop;
}
kfree(km, aux);
if (n_drop > 0) { // then fix the hits hierarchy
for (i = 0; i < n_regs; ++i) { // adjust the mm_reg1_t::parent
mm_reg1_t *r = &regs[i];
if (r->parent >= 0 && r->id != r->parent) { // fix for secondary hits only
if (regs[r->parent].parent >= 0 && regs[r->parent].parent != r->parent)
r->parent = regs[r->parent].parent;
}
}
mm_filter_regs(opt, qlen, n_regs_, regs);
mm_sync_regs(km, *n_regs_, regs);
}
}
mm_seg_t *mm_seg_gen(void *km, uint32_t hash, int n_segs, const int *qlens, int n_regs0, const mm_reg1_t *regs0, int *n_regs, mm_reg1_t **regs, const mm128_t *a) mm_seg_t *mm_seg_gen(void *km, uint32_t hash, int n_segs, const int *qlens, int n_regs0, const mm_reg1_t *regs0, int *n_regs, mm_reg1_t **regs, const mm128_t *a)
{ {
int s, i, j, acc_qlen[MM_MAX_SEG+1], qlen_sum = 0; int s, i, j, acc_qlen[MM_MAX_SEG+1], qlen_sum = 0;
@@ -399,7 +374,7 @@ mm_seg_t *mm_seg_gen(void *km, uint32_t hash, int n_segs, const int *qlens, int
} }
} }
for (s = 0; s < n_segs; ++s) { for (s = 0; s < n_segs; ++s) {
regs[s] = mm_gen_regs(km, hash, qlens[s], seg[s].n_u, seg[s].u, seg[s].a); regs[s] = mm_gen_regs(km, hash, qlens[s], seg[s].n_u, seg[s].u, seg[s].a, 0);
n_regs[s] = seg[s].n_u; n_regs[s] = seg[s].n_u;
for (i = 0; i < n_regs[s]; ++i) { for (i = 0; i < n_regs[s]; ++i) {
regs[s][i].seg_split = 1; regs[s][i].seg_split = 1;
@@ -443,15 +418,19 @@ static void mm_set_inv_mapq(void *km, int n_regs, mm_reg1_t *regs)
kfree(km, aux); kfree(km, aux);
} }
void mm_set_mapq(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr) void mm_set_mapq2(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr, int is_splice)
{ {
static const float q_coef = 40.0f; static const float q_coef = 40.0f;
int64_t sum_sc = 0; int64_t sum_sc = 0;
float uniq_ratio; float uniq_ratio;
int i; int i, n_2nd_splice = 0;
for (i = 0; i < n_regs; ++i) if (n_regs == 0) return;
for (i = 0; i < n_regs; ++i) {
if (regs[i].parent == regs[i].id) if (regs[i].parent == regs[i].id)
sum_sc += regs[i].score; sum_sc += regs[i].score;
else if (regs[i].is_spliced)
++n_2nd_splice;
}
uniq_ratio = (float)sum_sc / (sum_sc + rep_len); uniq_ratio = (float)sum_sc / (sum_sc + rep_len);
for (i = 0; i < n_regs; ++i) { for (i = 0; i < n_regs; ++i) {
mm_reg1_t *r = &regs[i]; mm_reg1_t *r = &regs[i];
@@ -464,13 +443,18 @@ void mm_set_mapq(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int ma
pen_cm = pen_s1 < pen_cm? pen_s1 : pen_cm; pen_cm = pen_s1 < pen_cm? pen_s1 : pen_cm;
subsc = r->subsc > min_chain_sc? r->subsc : min_chain_sc; subsc = r->subsc > min_chain_sc? r->subsc : min_chain_sc;
if (r->p && r->p->dp_max2 > 0 && r->p->dp_max > 0) { if (r->p && r->p->dp_max2 > 0 && r->p->dp_max > 0) {
float identity = (float)r->mlen / r->blen; float x, identity = (float)r->mlen / r->blen;
float x = (float)r->p->dp_max2 * subsc / r->p->dp_max / r->score0; if (is_sr && is_splice)
x = (float)r->p->dp_max2 / r->p->dp_max; // ignore chaining score; for short RNA-seq reads, unspliced chaining score tends to be higher
else
x = (float)r->p->dp_max2 * subsc / r->p->dp_max / r->score0;
mapq = (int)(identity * pen_cm * q_coef * (1.0f - x * x) * logf((float)r->p->dp_max / match_sc)); mapq = (int)(identity * pen_cm * q_coef * (1.0f - x * x) * logf((float)r->p->dp_max / match_sc));
if (!is_sr) { if (!is_sr) {
int mapq_alt = (int)(6.02f * identity * identity * (r->p->dp_max - r->p->dp_max2) / match_sc + .499f); // BWA-MEM like mapQ, mostly for short reads int mapq_alt = (int)(6.02f * identity * identity * (r->p->dp_max - r->p->dp_max2) / match_sc + .499f); // BWA-MEM like mapQ, mostly for short reads
mapq = mapq < mapq_alt? mapq : mapq_alt; // in case the long-read heuristic fails mapq = mapq < mapq_alt? mapq : mapq_alt; // in case the long-read heuristic fails
} }
if (is_splice && is_sr && r->is_spliced && n_2nd_splice == 0)
mapq += 10;
} else { } else {
float x = (float)subsc / r->score0; float x = (float)subsc / r->score0;
if (r->p) { if (r->p) {
+490 -3
View File
@@ -12,6 +12,7 @@
#include "bseq.h" #include "bseq.h"
#include "minimap.h" #include "minimap.h"
#include "mmpriv.h" #include "mmpriv.h"
#include "ksw2.h"
#include "kvec.h" #include "kvec.h"
#include "khash.h" #include "khash.h"
@@ -31,6 +32,21 @@ typedef struct mm_idx_bucket_s {
void *h; // hash table indexing _p_ and minimizers appearing once void *h; // hash table indexing _p_ and minimizers appearing once
} mm_idx_bucket_t; } mm_idx_bucket_t;
typedef struct {
int32_t st, en, cnt;
int32_t score:30, strand:2;
} mm_idx_intv1_t;
typedef struct mm_idx_intv_s {
int32_t n, m;
mm_idx_intv1_t *a;
} mm_idx_intv_t;
typedef struct mm_idx_jjump_s {
int32_t n, m;
mm_idx_jjump1_t *a;
} mm_idx_jjump_t;
mm_idx_t *mm_idx_init(int w, int k, int b, int flag) mm_idx_t *mm_idx_init(int w, int k, int b, int flag)
{ {
mm_idx_t *mi; mm_idx_t *mi;
@@ -55,6 +71,17 @@ void mm_idx_destroy(mm_idx_t *mi)
kh_destroy(idx, (idxhash_t*)mi->B[i].h); kh_destroy(idx, (idxhash_t*)mi->B[i].h);
} }
} }
if (mi->spsc) free(mi->spsc);
if (mi->I) {
for (i = 0; i < mi->n_seq; ++i)
free(mi->I[i].a);
free(mi->I);
}
if (mi->J) {
for (i = 0; i < mi->n_seq; ++i)
free(mi->J[i].a);
free(mi->J);
}
if (!mi->km) { if (!mi->km) {
for (i = 0; i < mi->n_seq; ++i) for (i = 0; i < mi->n_seq; ++i)
free(mi->seq[i].name); free(mi->seq[i].name);
@@ -84,7 +111,7 @@ const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n)
void mm_idx_stat(const mm_idx_t *mi) void mm_idx_stat(const mm_idx_t *mi)
{ {
int n = 0, n1 = 0; int64_t n = 0, n1 = 0;
uint32_t i; uint32_t i;
uint64_t sum = 0, len = 0; uint64_t sum = 0, len = 0;
fprintf(stderr, "[M::%s] kmer size: %d; skip: %d; is_hpc: %d; #seq: %d\n", __func__, mi->k, mi->w, mi->flag&MM_I_HPC, mi->n_seq); fprintf(stderr, "[M::%s] kmer size: %d; skip: %d; is_hpc: %d; #seq: %d\n", __func__, mi->k, mi->w, mi->flag&MM_I_HPC, mi->n_seq);
@@ -102,8 +129,8 @@ void mm_idx_stat(const mm_idx_t *mi)
if (kh_key(h, k)&1) ++n1; if (kh_key(h, k)&1) ++n1;
} }
} }
fprintf(stderr, "[M::%s::%.3f*%.2f] distinct minimizers: %d (%.2f%% are singletons); average occurrences: %.3lf; average spacing: %.3lf\n", fprintf(stderr, "[M::%s::%.3f*%.2f] distinct minimizers: %ld (%.2f%% are singletons); average occurrences: %.3lf; average spacing: %.3lf; total length: %ld\n",
__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), n, 100.0*n1/n, (double)sum / n, (double)len / sum); __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), (long)n, 100.0*n1/n, (double)sum / n, (double)len / sum, (long)len);
} }
int mm_idx_index_name(mm_idx_t *mi) int mm_idx_index_name(mm_idx_t *mi)
@@ -146,6 +173,28 @@ int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, ui
return en - st; return en - st;
} }
int mm_idx_getseq_rev(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq)
{
uint64_t i, st1, en1;
const mm_idx_seq_t *s;
if (rid >= mi->n_seq || st >= mi->seq[rid].len) return -1;
s = &mi->seq[rid];
if (en > s->len) en = s->len;
st1 = s->offset + (s->len - en);
en1 = s->offset + (s->len - st);
for (i = st1; i < en1; ++i) {
uint8_t c = mm_seq4_get(mi->S, i);
seq[en1 - i - 1] = c < 4? 3 - c : c;
}
return en - st;
}
int mm_idx_getseq2(const mm_idx_t *mi, int is_rev, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq)
{
if (is_rev) return mm_idx_getseq_rev(mi, rid, st, en, seq);
else return mm_idx_getseq(mi, rid, st, en, seq);
}
int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f) int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f)
{ {
int i; int i;
@@ -155,6 +204,7 @@ int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f)
if (f <= 0.) return INT32_MAX; if (f <= 0.) return INT32_MAX;
for (i = 0; i < 1<<mi->b; ++i) for (i = 0; i < 1<<mi->b; ++i)
if (mi->B[i].h) n += kh_size((idxhash_t*)mi->B[i].h); if (mi->B[i].h) n += kh_size((idxhash_t*)mi->B[i].h);
if (n == 0) return INT32_MAX;
a = (uint32_t*)malloc(n * 4); a = (uint32_t*)malloc(n * 4);
for (i = n = 0; i < 1<<mi->b; ++i) { for (i = n = 0; i < 1<<mi->b; ++i) {
idxhash_t *h = (idxhash_t*)mi->B[i].h; idxhash_t *h = (idxhash_t*)mi->B[i].h;
@@ -301,6 +351,7 @@ static void *worker_pipeline(void *shared, int step, void *in)
} else seq->name = 0; } else seq->name = 0;
seq->len = s->seq[i].l_seq; seq->len = s->seq[i].l_seq;
seq->offset = p->sum_len; seq->offset = p->sum_len;
seq->is_alt = 0;
// copy the sequence // copy the sequence
if (!(p->mi->flag & MM_I_NO_SEQ)) { if (!(p->mi->flag & MM_I_NO_SEQ)) {
for (j = 0; j < seq->len; ++j) { // TODO: this is not the fastest way, but let's first see if speed matters here for (j = 0; j < seq->len; ++j) { // TODO: this is not the fastest way, but let's first see if speed matters here
@@ -399,6 +450,7 @@ mm_idx_t *mm_idx_str(int w, int k, int is_hpc, int bucket_bits, int n, const cha
} }
p->offset = sum_len; p->offset = sum_len;
p->len = strlen(s); p->len = strlen(s);
p->is_alt = 0;
for (j = 0; j < p->len; ++j) { for (j = 0; j < p->len; ++j) {
int c = seq_nt4_table[(uint8_t)s[j]]; int c = seq_nt4_table[(uint8_t)s[j]];
uint64_t o = sum_len + j; uint64_t o = sum_len + j;
@@ -485,6 +537,7 @@ mm_idx_t *mm_idx_load(FILE *fp)
} }
fread(&s->len, 4, 1, fp); fread(&s->len, 4, 1, fp);
s->offset = sum_len; s->offset = sum_len;
s->is_alt = 0;
sum_len += s->len; sum_len += s->len;
} }
for (i = 0; i < 1<<mi->b; ++i) { for (i = 0; i < 1<<mi->b; ++i) {
@@ -585,3 +638,437 @@ int mm_idx_reader_eof(const mm_idx_reader_t *r) // TODO: in extremely rare cases
{ {
return r->is_idx? (feof(r->fp.idx) || ftell(r->fp.idx) == r->idx_size) : mm_bseq_eof(r->fp.seq); return r->is_idx? (feof(r->fp.idx) || ftell(r->fp.idx) == r->idx_size) : mm_bseq_eof(r->fp.seq);
} }
#include <ctype.h>
#include <zlib.h>
#include "ksort.h"
#include "kseq.h"
KSTREAM_DECLARE(gzFile, gzread)
int mm_idx_alt_read(mm_idx_t *mi, const char *fn)
{
int n_alt = 0;
gzFile fp;
kstream_t *ks;
kstring_t str = {0,0,0};
fp = fn && strcmp(fn, "-")? gzopen(fn, "r") : gzdopen(fileno(stdin), "r");
if (fp == 0) return -1;
ks = ks_init(fp);
if (mi->h == 0) mm_idx_index_name(mi);
while (ks_getuntil(ks, KS_SEP_LINE, &str, 0) >= 0) {
char *p;
int id;
for (p = str.s; *p && !isspace(*p); ++p) { }
*p = 0;
id = mm_idx_name2id(mi, str.s);
if (id >= 0) mi->seq[id].is_alt = 1, ++n_alt;
}
mi->n_alt = n_alt;
if (mm_verbose >= 3)
fprintf(stderr, "[M::%s] found %d ALT contigs\n", __func__, n_alt);
return n_alt;
}
/***************
* BED reading *
***************/
#define sort_key_bed(a) ((a).st)
KRADIX_SORT_INIT(bed, mm_idx_intv1_t, sort_key_bed, 4)
#define sort_key_end(a) ((a).en)
KRADIX_SORT_INIT(end, mm_idx_intv1_t, sort_key_end, 4)
static mm_idx_intv_t *mm_idx_bed_read_core(const mm_idx_t *mi, const char *fn, int read_junc, int min_sc)
{
gzFile fp;
kstream_t *ks;
kstring_t str = {0,0,0};
mm_idx_intv_t *I;
fp = fn && strcmp(fn, "-")? gzopen(fn, "r") : gzdopen(fileno(stdin), "r");
if (fp == 0) return 0;
I = CALLOC(mm_idx_intv_t, mi->n_seq);
ks = ks_init(fp);
while (ks_getuntil(ks, KS_SEP_LINE, &str, 0) >= 0) {
mm_idx_intv_t *r;
mm_idx_intv1_t t = {-1,-1,-1,-1,0};
char *p, *q, *bl, *bs;
int32_t i, id = -1, n_blk = 0;
for (p = q = str.s, i = 0;; ++p) {
if (*p == 0 || *p == '\t') {
int32_t c = *p;
*p = 0;
if (i == 0) { // chr
id = mm_idx_name2id(mi, q);
if (id < 0) break; // unknown name; TODO: throw a warning
} else if (i == 1) { // start
t.st = atol(q); // TODO: watch out integer overflow!
if (t.st < 0) break;
} else if (i == 2) { // end
t.en = atol(q);
if (t.en < 0) break;
} else if (i == 4) { // BED score
t.score = *q >= '0' && *q <= '9'? atol(q) : -1;
} else if (i == 5) { // strand
t.strand = *q == '+'? 1 : *q == '-'? -1 : 0;
} else if (i == 9) {
if (!isdigit(*q)) break;
n_blk = atol(q);
} else if (i == 10) {
bl = q;
} else if (i == 11) {
bs = q;
break;
}
if (c == 0) break;
++i, q = p + 1;
}
}
if (id < 0 || t.st < 0 || t.st >= t.en) continue; // contig ID not found, or other problems
if (min_sc > 0 && t.score < min_sc) continue;
r = &I[id];
if (i >= 11 && read_junc) { // BED12
int32_t st, sz, en;
st = strtol(bs, &bs, 10); ++bs;
sz = strtol(bl, &bl, 10); ++bl;
en = t.st + st + sz;
for (i = 1; i < n_blk; ++i) {
mm_idx_intv1_t s = t;
if (r->n == r->m) {
r->m = r->m? r->m + (r->m>>1) : 16;
r->a = (mm_idx_intv1_t*)realloc(r->a, sizeof(*r->a) * r->m);
}
st = strtol(bs, &bs, 10); ++bs;
sz = strtol(bl, &bl, 10); ++bl;
s.st = en, s.en = t.st + st;
en = t.st + st + sz;
if (s.en > s.st) r->a[r->n++] = s;
}
} else {
if (r->n == r->m) {
r->m = r->m? r->m + (r->m>>1) : 16;
r->a = (mm_idx_intv1_t*)realloc(r->a, sizeof(*r->a) * r->m);
}
r->a[r->n++] = t;
}
}
free(str.s);
ks_destroy(ks);
gzclose(fp);
return I;
}
static mm_idx_intv_t *mm_idx_bed_read_merge(const mm_idx_t *mi, const char *fn, int read_junc, int min_sc)
{
long n = 0, n0 = 0;
int32_t i;
mm_idx_intv_t *I;
I = mm_idx_bed_read_core(mi, fn, read_junc, min_sc);
if (I == 0) return 0;
for (i = 0; i < mi->n_seq; ++i) {
int32_t j, j0, k;
mm_idx_intv_t *intv = &I[i];
n0 += intv->n;
radix_sort_bed(intv->a, intv->a + intv->n); // sort by st
for (j = 1, j0 = 0; j <= intv->n; ++j) { // sort by st and then by end
if (j == intv->n || intv->a[j].st != intv->a[j0].st) {
radix_sort_end(intv->a + j0, intv->a + j);
j0 = j;
}
}
for (j = 1, j0 = 0, k = 0; j <= intv->n; ++j) { // merge intervals with the same (st, en)
if (j == intv->n || intv->a[j].st != intv->a[j0].st || intv->a[j].en != intv->a[j0].en) {
intv->a[k] = intv->a[j0];
intv->a[k++].cnt = j - j0;
j0 = j;
}
}
intv->a = REALLOC(mm_idx_intv1_t, intv->a, k);
intv->n = intv->m = k;
n += k;
}
if (mm_verbose >= 3)
fprintf(stderr, "[%s] read %ld introns, %ld of which are non-redundant\n", __func__, n0, n);
return I;
}
int mm_idx_bed_read(mm_idx_t *mi, const char *fn, int read_junc)
{
if (mi->h == 0) mm_idx_index_name(mi);
mi->I = mm_idx_bed_read_merge(mi, fn, read_junc, -1);
return 0;
}
int mm_idx_bed_junc(const mm_idx_t *mi, int32_t ctg, int32_t st, int32_t en, uint8_t *s)
{
int32_t i, left, right;
mm_idx_intv_t *r;
memset(s, 0, en - st);
if (mi->I == 0 || ctg < 0 || ctg >= mi->n_seq) return -1;
r = &mi->I[ctg];
left = 0, right = r->n;
while (right > left) {
int32_t mid = left + ((right - left) >> 1);
if (r->a[mid].st >= st) right = mid;
else left = mid + 1;
}
for (i = left; i < r->n; ++i) {
if (st <= r->a[i].st && en >= r->a[i].en && r->a[i].strand != 0) {
if (r->a[i].strand > 0) {
s[r->a[i].st - st] |= 1, s[r->a[i].en - 1 - st] |= 2;
} else {
s[r->a[i].st - st] |= 8, s[r->a[i].en - 1 - st] |= 4;
}
}
}
return left;
}
/*********************************
* Reading junctions for jumping *
*********************************/
#define sort_key_jj(a) ((a).off)
KRADIX_SORT_INIT(jj, mm_idx_jjump1_t, sort_key_jj, 4)
#define sort_key_jj2(a) ((a).off2)
KRADIX_SORT_INIT(jj2, mm_idx_jjump1_t, sort_key_jj2, 4)
static void sort_jjump(mm_idx_jjump_t *jj2)
{
int32_t j0, j, k;
if (jj2 == 0 || jj2->n == 0) return;
radix_sort_jj(jj2->a, jj2->a + jj2->n);
for (j0 = 0, j = 1; j <= jj2->n; ++j) {
if (j == jj2->n || jj2->a[j0].off != jj2->a[j].off) {
radix_sort_jj2(jj2->a + j0, jj2->a + j);
j0 = j;
}
}
// the actual merge
for (j0 = 0, j = 1, k = 0; j <= jj2->n; ++j) {
if (j == jj2->n || jj2->a[j0].off != jj2->a[j].off || jj2->a[j0].off2 != jj2->a[j].off2) {
int32_t t, cnt = 0;
uint16_t flag = 0;
for (t = j0; t < j; ++t) cnt += jj2->a[t].cnt, flag |= jj2->a[t].flag;
jj2->a[k] = jj2->a[j0];
jj2->a[k].cnt = cnt;
jj2->a[k++].flag = flag;
j0 = j;
}
}
jj2->n = k;
jj2->a = REALLOC(mm_idx_jjump1_t, jj2->a, k);
}
static mm_idx_jjump_t *mm_idx_bed2jjump(const mm_idx_t *mi, const mm_idx_intv_t *I, uint16_t flag)
{
int32_t i;
mm_idx_jjump_t *J;
J = CALLOC(mm_idx_jjump_t, mi->n_seq);
for (i = 0; i < mi->n_seq; ++i) {
int32_t j, k;
const mm_idx_intv_t *intv = &I[i];
mm_idx_jjump_t *jj = &J[i];
jj->n = intv->n * 2;
jj->a = CALLOC(mm_idx_jjump1_t, jj->n);
for (j = k = 0; j < intv->n; ++j) {
jj->a[k].off = intv->a[j].st, jj->a[k].off2 = intv->a[j].en, jj->a[k].cnt = intv->a[j].cnt, jj->a[k].strand = intv->a[j].strand, jj->a[k++].flag = flag;
jj->a[k].off = intv->a[j].en, jj->a[k].off2 = intv->a[j].st, jj->a[k].cnt = intv->a[j].cnt, jj->a[k].strand = intv->a[j].strand, jj->a[k++].flag = flag;
}
sort_jjump(jj);
}
return J;
}
static mm_idx_jjump_t *mm_idx_jjump_merge(const mm_idx_t *mi, const mm_idx_jjump_t *J0, const mm_idx_jjump_t *J1)
{
int32_t i;
mm_idx_jjump_t *J2;
J2 = CALLOC(mm_idx_jjump_t, mi->n_seq);
for (i = 0; i < mi->n_seq; ++i) {
int32_t j, k;
const mm_idx_jjump_t *jj0 = &J0[i], *jj1 = &J1[i];
mm_idx_jjump_t *jj2 = &J2[i];
jj2->n = jj0->n + jj1->n;
jj2->a = CALLOC(mm_idx_jjump1_t, jj2->n);
for (j = k = 0; j < jj0->n; ++j) jj2->a[k++] = jj0->a[j];
for (j = 0; j < jj1->n; ++j) jj2->a[k++] = jj1->a[j];
sort_jjump(jj2);
}
return J2;
}
int mm_idx_jjump_read(mm_idx_t *mi, const char *fn, int flag, int min_sc)
{
int32_t i, j, n_anno = 0, n_misc = 0;
mm_idx_intv_t *I;
mm_idx_jjump_t *J;
if (mi->h == 0) mm_idx_index_name(mi);
I = mm_idx_bed_read_merge(mi, fn, 1, min_sc);
J = mm_idx_bed2jjump(mi, I, flag);
for (i = 0; i < mi->n_seq; ++i) free(I[i].a);
free(I);
if (mi->J) {
mm_idx_jjump_t *J2;
J2 = mm_idx_jjump_merge(mi, mi->J, J);
for (i = 0; i < mi->n_seq; ++i) {
free(mi->J[i].a); free(J[i].a);
}
free(mi->J); free(J);
mi->J = J2;
} else mi->J = J;
for (i = 0; i < mi->n_seq; ++i) {
for (j = 0; j < mi->J[i].n; ++j)
if (mi->J[i].a[j].flag & MM_JUNC_ANNO) ++n_anno;
else ++n_misc;
}
if (mm_verbose >= 3)
fprintf(stderr, "[%s] there are %d annotated and %d other splice positions in the index\n", __func__, n_anno, n_misc);
return 0;
}
static int32_t mm_idx_jump_get_core(int32_t n, const mm_idx_jjump1_t *a, int32_t x) // similar to mm_idx_find_intv()
{
int32_t s = 0, e = n;
if (n == 0) return -1;
if (x < a[0].off) return -1;
while (s < e) {
int32_t mid = s + (e - s) / 2;
if (x >= a[mid].off && (mid + 1 >= n || x < a[mid+1].off)) return mid;
else if (x < a[mid].off) e = mid;
else s = mid + 1;
}
assert(0);
}
const mm_idx_jjump1_t *mm_idx_jump_get(const mm_idx_t *db, int32_t cid, int32_t st, int32_t en, int32_t *n)
{
mm_idx_jjump_t *s;
int32_t l, r;
*n = 0;
if (cid >= db->n_seq || cid < 0 || db->J == 0) return 0;
if (en < 0 || en > db->seq[cid].len) en = db->seq[cid].len;
s = &db->J[cid];
if (s->n == 0) return 0;
l = mm_idx_jump_get_core(s->n, s->a, st);
r = mm_idx_jump_get_core(s->n, s->a, en);
*n = r - l;
return &s->a[l + 1];
}
/****************
* splice score *
****************/
typedef struct mm_idx_spsc_s {
uint32_t n, m;
uint64_t *a; // pos<<56 | score<<1 | acceptor
} mm_idx_spsc_t;
int32_t mm_idx_spsc_read2(mm_idx_t *idx, const char *fn, int32_t max_sc, float scale)
{
gzFile fp;
kstring_t str = {0,0,0};
kstream_t *ks;
int32_t dret, j;
int64_t n_read = 0;
fp = fn && strcmp(fn, "-") != 0? gzopen(fn, "rb") : gzdopen(0, "rb");
if (fp == 0) return -1;
if (idx->h == 0) mm_idx_index_name(idx);
if (max_sc > 63) max_sc = 63;
idx->spsc = Kcalloc(0, mm_idx_spsc_t, idx->n_seq * 2);
ks = ks_init(fp);
while (ks_getuntil(ks, KS_SEP_LINE, &str, &dret) >= 0) {
mm_idx_spsc_t *s;
char *p, *q, *name = 0;
int32_t i, type = -1, strand = 0, cid = -1, score = -1;
int64_t pos = -1;
for (i = 0, p = q = str.s;; ++p) {
if (*p == '\t' || *p == 0) {
int c = *p;
*p = 0;
if (i == 0) {
name = q;
} else if (i == 1) {
pos = atol(q);
} else if (i == 2) {
strand = *q == '+'? 1 : '-'? -1 : 0;
} else if (i == 3) {
type = *q == 'D'? 0 : *q == 'A'? 1 : -1;
} else if (i == 4) {
score = atoi(q);
break;
}
if (c == 0) break;
q = p + 1, ++i;
}
}
if (i < 4) continue; // not enough fields
if (scale > 0.0f && scale < 1.0f)
score = score > 0.0f? (int)(score * scale + .499) : (int)(score * scale - .499);
if (score > max_sc) score = max_sc;
if (score < -max_sc) score = -max_sc;
cid = mm_idx_name2id(idx, name);
if (cid < 0 || type < 0 || strand == 0 || pos < 0) continue; // FIXME: give a warning!
s = &idx->spsc[cid << 1 | (strand > 0? 0 : 1)];
Kgrow(0, uint64_t, s->a, s->n, s->m);
if (pos > 0 && pos < idx->seq[cid].len) { // ignore scores at the ends
s->a[s->n++] = (uint64_t)pos << 8 | (score + KSW_SPSC_OFFSET) << 1 | type;
++n_read;
}
}
ks_destroy(ks);
gzclose(fp);
for (j = 0; j < idx->n_seq * 2; ++j) {
mm_idx_spsc_t *s = &idx->spsc[j];
if (s->n > 0)
radix_sort_64(s->a, s->a + s->n);
}
if (mm_verbose >= 3)
fprintf(stderr, "[M::%s] read %ld splice scores\n", __func__, (long)n_read);
return 0;
}
int32_t mm_idx_spsc_read(mm_idx_t *idx, const char *fn, int32_t max_sc)
{
return mm_idx_spsc_read2(idx, fn, max_sc, 1.0f);
}
static int32_t mm_idx_find_intv(int32_t n, const uint64_t *a, int64_t x)
{
int32_t s = 0, e = n;
if (n == 0) return -1;
if (x < a[0]>>8) return -1;
while (s < e) {
int32_t mid = s + (e - s) / 2;
if (x >= a[mid]>>8 && (mid + 1 >= n || x < a[mid+1]>>8)) return mid;
else if (x < a[mid]>>8) e = mid;
else s = mid + 1;
}
assert(0);
}
int64_t mm_idx_spsc_get(const mm_idx_t *db, int32_t cid, int64_t st, int64_t en, int32_t rev, uint8_t *sc)
{
const mm_idx_spsc_t *s;
if (cid >= db->n_seq || cid < 0 || db->spsc == 0) return -1;
if (en < 0 || en > db->seq[cid].len) en = db->seq[cid].len;
memset(sc, 0xff, en - st);
s = &db->spsc[cid << 1 | (!!rev)];
if (s->n > 0) {
int32_t j, l, r;
l = mm_idx_find_intv(s->n, s->a, st);
r = mm_idx_find_intv(s->n, s->a, en);
for (j = l + 1; j <= r; ++j) {
int64_t x = (s->a[j]>>8) - st;
uint8_t score = s->a[j] & 0xff;
assert(x <= en - st);
if (x == en - st) continue;
if (sc[x] == 0xff || sc[x] < score) sc[x] = score;
}
}
return en - st;
}
+201
View File
@@ -0,0 +1,201 @@
#include <stdio.h>
#include "mmpriv.h"
#include "kalloc.h"
#define MM_MIN_EXON_LEN 20
static int32_t mm_jump_check(void *km, const mm_idx_t *mi, int32_t qlen, const uint8_t *qseq0, const mm_reg1_t *r, int32_t ext, int32_t is_left) // TODO: check close N
{
int32_t clip, clen, e = !r->rev ^ !is_left; // 0 for left of the alignment; 1 for right
uint32_t cigar;
if (!r->p || r->p->n_cigar <= 0) return -1; // only working with CIGAR
clip = e == 0? r->qs : qlen - r->qe;
cigar = r->p->cigar[is_left? 0 : r->p->n_cigar - 1];
clen = (cigar&0xf) == MM_CIGAR_MATCH? cigar>>4 : 0;
if (clen <= ext) return -1;
if (is_left) {
if (clip >= r->rs) return -1; // no space to jump
} else {
if (clip >= mi->seq[r->rid].len - r->re) return -1; // no space to jump
}
return 0;
}
static uint8_t *mm_jump_get_qseq_seq(void *km, int32_t qlen, const uint8_t *qseq0, const mm_reg1_t *r, int32_t is_left, int32_t ql0, uint8_t *qseq)
{
extern unsigned char seq_nt4_table[256];
int32_t i, k = 0;
if (!r->rev) {
if (is_left)
for (i = 0; i < ql0; ++i)
qseq[k++] = seq_nt4_table[(uint8_t)qseq0[i]];
else
for (i = qlen - ql0; i < qlen; ++i)
qseq[k++] = seq_nt4_table[(uint8_t)qseq0[i]];
} else {
if (is_left)
for (i = qlen - 1; i >= qlen - ql0; --i) {
uint8_t c = seq_nt4_table[(uint8_t)qseq0[i]];
qseq[k++] = c >= 4? c : 3 - c;
}
else
for (i = ql0 - 1; i >= 0; --i) {
uint8_t c = seq_nt4_table[(uint8_t)qseq0[i]];
qseq[k++] = c >= 4? c : 3 - c;
}
}
return qseq;
}
static void mm_jump_split_left(void *km, const mm_idx_t *mi, const mm_mapopt_t *opt, int32_t qlen, const uint8_t *qseq0, mm_reg1_t *r, int32_t ts_strand)
{
uint8_t *tseq = 0, *qseq = 0;
int32_t i, n, l, i0, m, mm0;
int32_t i0_anno = -1, n_anno = 0, mm0_anno = 0, i0_misc = -1, n_misc = 0, mm0_misc = 0;
int32_t ext = 1 + (opt->b + opt->a - 1) / opt->a + 1;
int32_t clip = !r->rev? r->qs : qlen - r->qe;
int32_t extt = clip < ext? clip : ext;
const mm_idx_jjump1_t *a;
if (mm_jump_check(km, mi, qlen, qseq0, r, ext + MM_MIN_EXON_LEN, 1) < 0) return;
a = mm_idx_jump_get(mi, r->rid, r->rs - extt, r->rs + ext, &n);
if (n == 0) return;
for (i = 0; i < n; ++i) { // traverse possible jumps
const mm_idx_jjump1_t *ai = &a[i];
int32_t tlen, tl1, j, mm1, mm2;
assert(ai->off >= r->rs - extt && ai->off <= r->rs + ext);
if (ts_strand * ai->strand < 0) continue; // wrong strand
if (ai->off2 >= ai->off) continue; // wrong direction
if (ai->off - ai->off2 < 6) continue; // intron too small
if (ai->off2 < clip + ext) continue; // not long enough
if (tseq == 0) {
tseq = Kcalloc(km, uint8_t, (clip + ext) * 2); // tseq and qseq are allocated together
qseq = tseq + clip + ext;
mm_jump_get_qseq_seq(km, qlen, qseq0, r, 1, clip + ext, qseq);
}
tl1 = clip + (ai->off - r->rs);
tlen = mm_idx_getseq2(mi, 0, r->rid, ai->off, r->rs + ext, &tseq[tl1]);
assert(tlen == r->rs + ext - ai->off);
tlen = mm_idx_getseq2(mi, 0, r->rid, ai->off2 - tl1, ai->off2, tseq);
assert(tlen == tl1);
for (j = 0, mm1 = 0; j < tl1; ++j)
if (qseq[j] != tseq[j] || qseq[j] > 3 || tseq[j] > 3)
++mm1;
for (mm2 = 0; j < clip + ext; ++j)
if (qseq[j] != tseq[j] || qseq[j] > 3 || tseq[j] > 3)
++mm2;
if (mm1 == 0 && mm2 <= 1) {
if (ai->flag & MM_JUNC_ANNO)
i0_anno = i, mm0_anno = mm1 + mm2, ++n_anno; // i0 points to the rightmost i
else
i0_misc = i, mm0_misc = mm1 + mm2, ++n_misc;
}
}
if (n_anno > 0) m = n_anno, i0 = i0_anno, mm0 = mm0_anno;
else m = n_misc, i0 = i0_misc, mm0 = mm0_misc;
kfree(km, tseq);
l = m > 0? a[i0].off - r->rs : 0; // may be negative
if (m == 1 && clip + l >= opt->jump_min_match) { // add one more exon
mm_enlarge_cigar(r, 2);
memmove(r->p->cigar + 2, r->p->cigar, r->p->n_cigar * 4);
r->p->cigar[0] = (clip + l) << 4 | MM_CIGAR_MATCH;
r->p->cigar[1] = (a[i0].off - a[i0].off2) << 4 | MM_CIGAR_N_SKIP;
r->p->cigar[2] = ((r->p->cigar[2]>>4) - l) << 4 | MM_CIGAR_MATCH;
r->p->n_cigar += 2;
r->rs = a[i0].off2 - (clip + l);
if (!r->rev) r->qs = 0;
else r->qe = qlen;
r->blen += clip, r->mlen += clip - mm0;
r->p->dp_max0 += (clip - mm0) * opt->a - mm0 * opt->b;
r->p->dp_max += (clip - mm0) * opt->a - mm0 * opt->b;
if (!r->is_spliced) r->is_spliced = 1, r->p->dp_max += (opt->a + opt->b) + ((opt->a + opt->b) >> 1);
} else if (m > 0 && a[i0].off > r->rs) { // trim by l; l is always positive
r->p->cigar[0] -= l << 4 | MM_CIGAR_MATCH;
r->rs += l;
if (!r->rev) r->qs += l;
else r->qe -= l;
}
}
static void mm_jump_split_right(void *km, const mm_idx_t *mi, const mm_mapopt_t *opt, int32_t qlen, const uint8_t *qseq0, mm_reg1_t *r, int32_t ts_strand)
{
uint8_t *tseq = 0, *qseq = 0;
int32_t i, n, l, i0, m, mm0;
int32_t i0_anno = -1, n_anno = 0, mm0_anno = 0, i0_misc = -1, n_misc = 0, mm0_misc = 0;
int32_t ext = 1 + (opt->b + opt->a - 1) / opt->a + 1;
int32_t clip = !r->rev? qlen - r->qe : r->qs;
int32_t extt = clip < ext? clip : ext;
const mm_idx_jjump1_t *a;
if (mm_jump_check(km, mi, qlen, qseq0, r, ext + MM_MIN_EXON_LEN, 0) < 0) return;
a = mm_idx_jump_get(mi, r->rid, r->re - ext, r->re + extt, &n);
if (n == 0) return;
for (i = 0; i < n; ++i) { // traverse possible jumps
const mm_idx_jjump1_t *ai = &a[i];
int32_t tlen, tl1, j, mm1, mm2;
assert(ai->off >= r->re - ext && ai->off <= r->re + extt);
if (ts_strand * ai->strand < 0) continue; // wrong strand
if (ai->off2 <= ai->off) continue; // wrong direction
if (ai->off2 - ai->off < 6) continue; // intron too small
if (ai->off2 + clip + ext > mi->seq[r->rid].len) continue; // not long enough
if (tseq == 0) {
tseq = Kcalloc(km, uint8_t, (clip + ext) * 2); // tseq and qseq are allocated together
qseq = tseq + clip + ext;
mm_jump_get_qseq_seq(km, qlen, qseq0, r, 0, clip + ext, qseq);
}
tl1 = clip + (r->re - ai->off);
tlen = mm_idx_getseq2(mi, 0, r->rid, r->re - ext, ai->off, tseq);
assert(tlen == ai->off - (r->re - ext));
tlen = mm_idx_getseq2(mi, 0, r->rid, ai->off2, ai->off2 + tl1, &tseq[clip + ext - tl1]);
assert(tlen == tl1);
for (j = 0, mm2 = 0; j < clip + ext - tl1; ++j)
if (qseq[j] != tseq[j] || qseq[j] > 3 || tseq[j] > 3)
++mm2;
for (mm1 = 0; j < clip + ext; ++j)
if (qseq[j] != tseq[j] || qseq[j] > 3 || tseq[j] > 3)
++mm1;
if (mm1 == 0 && mm2 <= 1) {
if (ai->flag & MM_JUNC_ANNO) {
if (i0_anno < 0) i0_anno = i, mm0_anno = mm1 + mm2;
++n_anno;
} else {
if (i0_misc < 0) i0_misc = i, mm0_misc = mm1 + mm2;
++n_misc;
}
}
}
if (n_anno > 0) m = n_anno, i0 = i0_anno, mm0 = mm0_anno;
else m = n_misc, i0 = i0_misc, mm0 = mm0_misc;
kfree(km, tseq);
l = m > 0? r->re - a[i0].off : 0; // may be negative
if (m == 1 && clip + l >= opt->jump_min_match) { // add one more exon
mm_enlarge_cigar(r, 2);
r->p->cigar[r->p->n_cigar - 1] = ((r->p->cigar[r->p->n_cigar - 1]>>4) - l) << 4 | MM_CIGAR_MATCH;
r->p->cigar[r->p->n_cigar] = (a[i0].off2 - a[i0].off) << 4 | MM_CIGAR_N_SKIP;
r->p->cigar[r->p->n_cigar + 1] = (clip + l) << 4 | MM_CIGAR_MATCH;
r->p->n_cigar += 2;
r->re = a[i0].off2 + (clip + l);
if (!r->rev) r->qe = qlen;
else r->qs = 0;
r->blen += clip, r->mlen += clip - mm0;
r->p->dp_max0 += (clip - mm0) * opt->a - mm0 * opt->b;
r->p->dp_max += (clip - mm0) * opt->a - mm0 * opt->b;
if (!r->is_spliced) r->is_spliced = 1, r->p->dp_max += (opt->a + opt->b) + ((opt->a + opt->b) >> 1);
} else if (m > 0 && r->re > a[i0].off) { // trim by l; l is always positive
r->p->cigar[r->p->n_cigar - 1] -= l << 4 | MM_CIGAR_MATCH;
r->re -= l;
if (!r->rev) r->qe -= l;
else r->qs += l;
}
}
void mm_jump_split(void *km, const mm_idx_t *mi, const mm_mapopt_t *opt, int32_t qlen, const uint8_t *qseq, mm_reg1_t *r, int32_t ts_strand)
{
assert((opt->flag & MM_F_EQX) == 0);
mm_jump_split_left(km, mi, opt, qlen, qseq, r, ts_strand);
mm_jump_split_right(km, mi, opt, qlen, qseq, r, ts_strand);
}
+40 -14
View File
@@ -18,15 +18,14 @@
* | | | | * | | | |
* p=p->ptr->ptr->ptr->ptr p->ptr p->ptr->ptr p->ptr->ptr->ptr * p=p->ptr->ptr->ptr->ptr p->ptr p->ptr->ptr p->ptr->ptr->ptr
*/ */
#define MIN_CORE_SIZE 0x80000
typedef struct header_t { typedef struct header_t {
size_t size; size_t size;
struct header_t *ptr; struct header_t *ptr;
} header_t; } header_t;
typedef struct { typedef struct {
void *par;
size_t min_core_size;
header_t base, *loop_head, *core_head; /* base is a zero-sized block always kept in the loop */ header_t base, *loop_head, *core_head; /* base is a zero-sized block always kept in the loop */
} kmem_t; } kmem_t;
@@ -36,31 +35,40 @@ static void panic(const char *s)
abort(); abort();
} }
void *km_init(void) void *km_init2(void *km_par, size_t min_core_size)
{ {
return calloc(1, sizeof(kmem_t)); kmem_t *km;
km = (kmem_t*)kcalloc(km_par, 1, sizeof(kmem_t));
km->par = km_par;
if (km_par) km->min_core_size = min_core_size > 0? min_core_size : ((kmem_t*)km_par)->min_core_size - 2;
else km->min_core_size = min_core_size > 0? min_core_size : 0x80000;
return (void*)km;
} }
void *km_init(void) { return km_init2(0, 0); }
void km_destroy(void *_km) void km_destroy(void *_km)
{ {
kmem_t *km = (kmem_t*)_km; kmem_t *km = (kmem_t*)_km;
void *km_par;
header_t *p, *q; header_t *p, *q;
if (km == NULL) return; if (km == NULL) return;
km_par = km->par;
for (p = km->core_head; p != NULL;) { for (p = km->core_head; p != NULL;) {
q = p->ptr; q = p->ptr;
free(p); kfree(km_par, p);
p = q; p = q;
} }
free(km); kfree(km_par, km);
} }
static header_t *morecore(kmem_t *km, size_t nu) static header_t *morecore(kmem_t *km, size_t nu)
{ {
header_t *q; header_t *q;
size_t bytes, *p; size_t bytes, *p;
nu = (nu + 1 + (MIN_CORE_SIZE - 1)) / MIN_CORE_SIZE * MIN_CORE_SIZE; /* the first +1 for core header */ nu = (nu + 1 + (km->min_core_size - 1)) / km->min_core_size * km->min_core_size; /* the first +1 for core header */
bytes = nu * sizeof(header_t); bytes = nu * sizeof(header_t);
q = (header_t*)malloc(bytes); q = (header_t*)kmalloc(km->par, bytes);
if (!q) panic("[morecore] insufficient memory"); if (!q) panic("[morecore] insufficient memory");
q->ptr = km->core_head, q->size = nu, km->core_head = q; q->ptr = km->core_head, q->size = nu, km->core_head = q;
p = (size_t*)(q + 1); p = (size_t*)(q + 1);
@@ -125,7 +133,7 @@ void *kmalloc(void *_km, size_t n_bytes)
if (n_bytes == 0) return 0; if (n_bytes == 0) return 0;
if (km == NULL) return malloc(n_bytes); if (km == NULL) return malloc(n_bytes);
n_units = (n_bytes + sizeof(size_t) + sizeof(header_t) - 1) / sizeof(header_t) + 1; n_units = (n_bytes + sizeof(size_t) + sizeof(header_t) - 1) / sizeof(header_t); /* header+n_bytes requires at least this number of units */
if (!(q = km->loop_head)) /* the first time when kmalloc() is called, intialize it */ if (!(q = km->loop_head)) /* the first time when kmalloc() is called, intialize it */
q = km->loop_head = km->base.ptr = &km->base; q = km->loop_head = km->base.ptr = &km->base;
@@ -160,22 +168,32 @@ void *kcalloc(void *_km, size_t count, size_t size)
void *krealloc(void *_km, void *ap, size_t n_bytes) // TODO: this can be made more efficient in principle void *krealloc(void *_km, void *ap, size_t n_bytes) // TODO: this can be made more efficient in principle
{ {
kmem_t *km = (kmem_t*)_km; kmem_t *km = (kmem_t*)_km;
size_t n_units, *p, *q; size_t cap, *p, *q;
if (n_bytes == 0) { if (n_bytes == 0) {
kfree(km, ap); return 0; kfree(km, ap); return 0;
} }
if (km == NULL) return realloc(ap, n_bytes); if (km == NULL) return realloc(ap, n_bytes);
if (ap == NULL) return kmalloc(km, n_bytes); if (ap == NULL) return kmalloc(km, n_bytes);
n_units = (n_bytes + sizeof(size_t) + sizeof(header_t) - 1) / sizeof(header_t);
p = (size_t*)ap - 1; p = (size_t*)ap - 1;
if (*p >= n_units) return ap; /* TODO: this prevents shrinking */ cap = (*p) * sizeof(header_t) - sizeof(size_t);
if (cap >= n_bytes) return ap; /* TODO: this prevents shrinking */
q = (size_t*)kmalloc(km, n_bytes); q = (size_t*)kmalloc(km, n_bytes);
memcpy(q, ap, (*p - 1) * sizeof(header_t)); memcpy(q, ap, cap);
kfree(km, ap); kfree(km, ap);
return q; return q;
} }
void *krelocate(void *km, void *ap, size_t n_bytes)
{
void *p;
if (km == 0 || ap == 0) return ap;
p = kmalloc(km, n_bytes);
memcpy(p, ap, n_bytes);
kfree(km, ap);
return p;
}
void km_stat(const void *_km, km_stat_t *s) void km_stat(const void *_km, km_stat_t *s)
{ {
kmem_t *km = (kmem_t*)_km; kmem_t *km = (kmem_t*)_km;
@@ -196,3 +214,11 @@ void km_stat(const void *_km, km_stat_t *s)
s->largest = s->largest > size? s->largest : size; s->largest = s->largest > size? s->largest : size;
} }
} }
void km_stat_print(const void *km)
{
km_stat_t st;
km_stat(km, &st);
fprintf(stderr, "[km_stat] cap=%ld, avail=%ld, largest=%ld, n_core=%ld, n_block=%ld\n",
st.capacity, st.available, st.largest, st.n_blocks, st.n_cores);
}
+68
View File
@@ -13,15 +13,83 @@ typedef struct {
void *kmalloc(void *km, size_t size); void *kmalloc(void *km, size_t size);
void *krealloc(void *km, void *ptr, size_t size); void *krealloc(void *km, void *ptr, size_t size);
void *krelocate(void *km, void *ap, size_t n_bytes);
void *kcalloc(void *km, size_t count, size_t size); void *kcalloc(void *km, size_t count, size_t size);
void kfree(void *km, void *ptr); void kfree(void *km, void *ptr);
void *km_init(void); void *km_init(void);
void *km_init2(void *km_par, size_t min_core_size);
void km_destroy(void *km); void km_destroy(void *km);
void km_stat(const void *_km, km_stat_t *s); void km_stat(const void *_km, km_stat_t *s);
void km_stat_print(const void *km);
#ifdef __cplusplus #ifdef __cplusplus
} }
#endif #endif
#define Kmalloc(km, type, cnt) ((type*)kmalloc((km), (cnt) * sizeof(type)))
#define Kcalloc(km, type, cnt) ((type*)kcalloc((km), (cnt), sizeof(type)))
#define Krealloc(km, type, ptr, cnt) ((type*)krealloc((km), (ptr), (cnt) * sizeof(type)))
#define Kgrow(km, type, ptr, __i, __m) do { \
if ((__i) >= (__m)) { \
(__m) = (__i) + 1; \
(__m) += ((__m)>>1) + 16; \
(ptr) = Krealloc(km, type, ptr, (__m)); \
} \
} while (0)
#define Kexpand(km, type, a, m) do { \
(m) = (m) >= 4? (m) + ((m)>>1) : 16; \
(a) = Krealloc(km, type, (a), (m)); \
} while (0)
#define KMALLOC(km, ptr, len) ((ptr) = (__typeof__(ptr))kmalloc((km), (len) * sizeof(*(ptr))))
#define KCALLOC(km, ptr, len) ((ptr) = (__typeof__(ptr))kcalloc((km), (len), sizeof(*(ptr))))
#define KREALLOC(km, ptr, len) ((ptr) = (__typeof__(ptr))krealloc((km), (ptr), (len) * sizeof(*(ptr))))
#define KEXPAND(km, a, m) do { \
(m) = (m) >= 4? (m) + ((m)>>1) : 16; \
KREALLOC((km), (a), (m)); \
} while (0)
#ifndef klib_unused
#if (defined __clang__ && __clang_major__ >= 3) || (defined __GNUC__ && __GNUC__ >= 3)
#define klib_unused __attribute__ ((__unused__))
#else
#define klib_unused
#endif
#endif /* klib_unused */
#define KALLOC_POOL_INIT2(SCOPE, name, kmptype_t) \
typedef struct { \
size_t cnt, n, max; \
kmptype_t **buf; \
void *km; \
} kmp_##name##_t; \
SCOPE kmp_##name##_t *kmp_init_##name(void *km) { \
kmp_##name##_t *mp; \
mp = Kcalloc(km, kmp_##name##_t, 1); \
mp->km = km; \
return mp; \
} \
SCOPE void kmp_destroy_##name(kmp_##name##_t *mp) { \
size_t k; \
for (k = 0; k < mp->n; ++k) kfree(mp->km, mp->buf[k]); \
kfree(mp->km, mp->buf); kfree(mp->km, mp); \
} \
SCOPE kmptype_t *kmp_alloc_##name(kmp_##name##_t *mp) { \
++mp->cnt; \
if (mp->n == 0) return (kmptype_t*)kcalloc(mp->km, 1, sizeof(kmptype_t)); \
return mp->buf[--mp->n]; \
} \
SCOPE void kmp_free_##name(kmp_##name##_t *mp, kmptype_t *p) { \
--mp->cnt; \
if (mp->n == mp->max) Kexpand(mp->km, kmptype_t*, mp->buf, mp->max); \
mp->buf[mp->n++] = p; \
}
#define KALLOC_POOL_INIT(name, kmptype_t) \
KALLOC_POOL_INIT2(static inline klib_unused, name, kmptype_t)
#endif #endif
+10 -6
View File
@@ -73,13 +73,17 @@ static int ketopt(ketopt_t *s, int argc, char *argv[], int permute, const char *
} }
s->opt = 0, opt = '?', s->pos = -1; s->opt = 0, opt = '?', s->pos = -1;
if (longopts) { /* parse long options */ if (longopts) { /* parse long options */
int k, n_matches = 0; int k, n_exact = 0, n_partial = 0;
const ko_longopt_t *o = 0; const ko_longopt_t *o = 0, *o_exact = 0, *o_partial = 0;
for (j = 2; argv[s->i][j] != '\0' && argv[s->i][j] != '='; ++j) {} /* find the end of the option name */ for (j = 2; argv[s->i][j] != '\0' && argv[s->i][j] != '='; ++j) {} /* find the end of the option name */
for (k = 0; longopts[k].name != 0; ++k) for (k = 0; longopts[k].name != 0; ++k)
if (strncmp(&argv[s->i][2], longopts[k].name, j - 2) == 0) if (strncmp(&argv[s->i][2], longopts[k].name, j - 2) == 0) {
++n_matches, o = &longopts[k]; if (longopts[k].name[j - 2] == 0) ++n_exact, o_exact = &longopts[k];
if (n_matches == 1) { else ++n_partial, o_partial = &longopts[k];
}
if (n_exact > 1 || (n_exact == 0 && n_partial > 1)) return '?';
o = n_exact == 1? o_exact : n_partial == 1? o_partial : 0;
if (o) {
s->opt = opt = o->val, s->longidx = o - longopts; s->opt = opt = o->val, s->longidx = o - longopts;
if (argv[s->i][j] == '=') s->arg = &argv[s->i][j + 1]; if (argv[s->i][j] == '=') s->arg = &argv[s->i][j + 1];
if (o->has_arg == 1 && argv[s->i][j] == '\0') { if (o->has_arg == 1 && argv[s->i][j] == '\0') {
@@ -92,7 +96,7 @@ static int ketopt(ketopt_t *s, int argc, char *argv[], int permute, const char *
char *p; char *p;
if (s->pos == 0) s->pos = 1; if (s->pos == 0) s->pos = 1;
opt = s->opt = argv[s->i][s->pos++]; opt = s->opt = argv[s->i][s->pos++];
p = strchr(ostr, opt); p = strchr((char*)ostr, opt);
if (p == 0) { if (p == 0) {
opt = '?'; /* unknown option */ opt = '?'; /* unknown option */
} else if (p[1] == ':') { } else if (p[1] == ':') {
+474
View File
@@ -0,0 +1,474 @@
/* The MIT License
Copyright (c) 2019 by Attractive Chaos <attractor@live.co.uk>
Permission is hereby granted, free of charge, to any person obtaining
a copy of this software and associated documentation files (the
"Software"), to deal in the Software without restriction, including
without limitation the rights to use, copy, modify, merge, publish,
distribute, sublicense, and/or sell copies of the Software, and to
permit persons to whom the Software is furnished to do so, subject to
the following conditions:
The above copyright notice and this permission notice shall be
included in all copies or substantial portions of the Software.
THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS
BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN
ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN
CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
SOFTWARE.
*/
/* An example:
#include <stdio.h>
#include <string.h>
#include <stdlib.h>
#include "krmq.h"
struct my_node {
char key;
KRMQ_HEAD(struct my_node) head;
};
#define my_cmp(p, q) (((q)->key < (p)->key) - ((p)->key < (q)->key))
KRMQ_INIT(my, struct my_node, head, my_cmp)
int main(void) {
const char *str = "MNOLKQOPHIA"; // from wiki, except a duplicate
struct my_node *root = 0;
int i, l = strlen(str);
for (i = 0; i < l; ++i) { // insert in the input order
struct my_node *q, *p = malloc(sizeof(*p));
p->key = str[i];
q = krmq_insert(my, &root, p, 0);
if (p != q) free(p); // if already present, free
}
krmq_itr_t(my) itr;
krmq_itr_first(my, root, &itr); // place at first
do { // traverse
const struct my_node *p = krmq_at(&itr);
putchar(p->key);
free((void*)p); // free node
} while (krmq_itr_next(my, &itr));
putchar('\n');
return 0;
}
*/
#ifndef KRMQ_H
#define KRMQ_H
#ifdef __STRICT_ANSI__
#define inline __inline__
#endif
#define KRMQ_MAX_DEPTH 64
#define krmq_size(head, p) ((p)? (p)->head.size : 0)
#define krmq_size_child(head, q, i) ((q)->head.p[(i)]? (q)->head.p[(i)]->head.size : 0)
#define KRMQ_HEAD(__type) \
struct { \
__type *p[2], *s; \
signed char balance; /* balance factor */ \
unsigned size; /* #elements in subtree */ \
}
#define __KRMQ_FIND(suf, __scope, __type, __head, __cmp) \
__scope __type *krmq_find_##suf(const __type *root, const __type *x, unsigned *cnt_) { \
const __type *p = root; \
unsigned cnt = 0; \
while (p != 0) { \
int cmp; \
cmp = __cmp(x, p); \
if (cmp >= 0) cnt += krmq_size_child(__head, p, 0) + 1; \
if (cmp < 0) p = p->__head.p[0]; \
else if (cmp > 0) p = p->__head.p[1]; \
else break; \
} \
if (cnt_) *cnt_ = cnt; \
return (__type*)p; \
} \
__scope __type *krmq_interval_##suf(const __type *root, const __type *x, __type **lower, __type **upper) { \
const __type *p = root, *l = 0, *u = 0; \
while (p != 0) { \
int cmp; \
cmp = __cmp(x, p); \
if (cmp < 0) u = p, p = p->__head.p[0]; \
else if (cmp > 0) l = p, p = p->__head.p[1]; \
else { l = u = p; break; } \
} \
if (lower) *lower = (__type*)l; \
if (upper) *upper = (__type*)u; \
return (__type*)p; \
}
#define __KRMQ_RMQ(suf, __scope, __type, __head, __cmp, __lt2) \
__scope __type *krmq_rmq_##suf(const __type *root, const __type *lo, const __type *up) { /* CLOSED interval */ \
const __type *p = root, *path[2][KRMQ_MAX_DEPTH], *min; \
int plen[2] = {0, 0}, pcmp[2][KRMQ_MAX_DEPTH], i, cmp, lca; \
if (root == 0) return 0; \
while (p) { \
cmp = __cmp(lo, p); \
path[0][plen[0]] = p, pcmp[0][plen[0]++] = cmp; \
if (cmp < 0) p = p->__head.p[0]; \
else if (cmp > 0) p = p->__head.p[1]; \
else break; \
} \
p = root; \
while (p) { \
cmp = __cmp(up, p); \
path[1][plen[1]] = p, pcmp[1][plen[1]++] = cmp; \
if (cmp < 0) p = p->__head.p[0]; \
else if (cmp > 0) p = p->__head.p[1]; \
else break; \
} \
for (i = 0; i < plen[0] && i < plen[1]; ++i) /* find the LCA */ \
if (path[0][i] == path[1][i] && pcmp[0][i] <= 0 && pcmp[1][i] >= 0) \
break; \
if (i == plen[0] || i == plen[1]) return 0; /* no elements in the closed interval */ \
lca = i, min = path[0][lca]; \
for (i = lca + 1; i < plen[0]; ++i) { \
if (pcmp[0][i] <= 0) { \
if (__lt2(path[0][i], min)) min = path[0][i]; \
if (path[0][i]->__head.p[1] && __lt2(path[0][i]->__head.p[1]->__head.s, min)) \
min = path[0][i]->__head.p[1]->__head.s; \
} \
} \
for (i = lca + 1; i < plen[1]; ++i) { \
if (pcmp[1][i] >= 0) { \
if (__lt2(path[1][i], min)) min = path[1][i]; \
if (path[1][i]->__head.p[0] && __lt2(path[1][i]->__head.p[0]->__head.s, min)) \
min = path[1][i]->__head.p[0]->__head.s; \
} \
} \
return (__type*)min; \
}
#define __KRMQ_ROTATE(suf, __type, __head, __lt2) \
/* */ \
static inline void krmq_update_min_##suf(__type *p, const __type *q, const __type *r) { \
p->__head.s = !q || __lt2(p, q->__head.s)? p : q->__head.s; \
p->__head.s = !r || __lt2(p->__head.s, r->__head.s)? p->__head.s : r->__head.s; \
} \
/* one rotation: (a,(b,c)q)p => ((a,b)p,c)q */ \
static inline __type *krmq_rotate1_##suf(__type *p, int dir) { /* dir=0 to left; dir=1 to right */ \
int opp = 1 - dir; /* opposite direction */ \
__type *q = p->__head.p[opp], *s = p->__head.s; \
unsigned size_p = p->__head.size; \
p->__head.size -= q->__head.size - krmq_size_child(__head, q, dir); \
q->__head.size = size_p; \
krmq_update_min_##suf(p, p->__head.p[dir], q->__head.p[dir]); \
q->__head.s = s; \
p->__head.p[opp] = q->__head.p[dir]; \
q->__head.p[dir] = p; \
return q; \
} \
/* two consecutive rotations: (a,((b,c)r,d)q)p => ((a,b)p,(c,d)q)r */ \
static inline __type *krmq_rotate2_##suf(__type *p, int dir) { \
int b1, opp = 1 - dir; \
__type *q = p->__head.p[opp], *r = q->__head.p[dir], *s = p->__head.s; \
unsigned size_x_dir = krmq_size_child(__head, r, dir); \
r->__head.size = p->__head.size; \
p->__head.size -= q->__head.size - size_x_dir; \
q->__head.size -= size_x_dir + 1; \
krmq_update_min_##suf(p, p->__head.p[dir], r->__head.p[dir]); \
krmq_update_min_##suf(q, q->__head.p[opp], r->__head.p[opp]); \
r->__head.s = s; \
p->__head.p[opp] = r->__head.p[dir]; \
r->__head.p[dir] = p; \
q->__head.p[dir] = r->__head.p[opp]; \
r->__head.p[opp] = q; \
b1 = dir == 0? +1 : -1; \
if (r->__head.balance == b1) q->__head.balance = 0, p->__head.balance = -b1; \
else if (r->__head.balance == 0) q->__head.balance = p->__head.balance = 0; \
else q->__head.balance = b1, p->__head.balance = 0; \
r->__head.balance = 0; \
return r; \
}
#define __KRMQ_INSERT(suf, __scope, __type, __head, __cmp, __lt2) \
__scope __type *krmq_insert_##suf(__type **root_, __type *x, unsigned *cnt_) { \
unsigned char stack[KRMQ_MAX_DEPTH]; \
__type *path[KRMQ_MAX_DEPTH]; \
__type *bp, *bq; \
__type *p, *q, *r = 0; /* _r_ is potentially the new root */ \
int i, which = 0, top, b1, path_len; \
unsigned cnt = 0; \
bp = *root_, bq = 0; \
/* find the insertion location */ \
for (p = bp, q = bq, top = path_len = 0; p; q = p, p = p->__head.p[which]) { \
int cmp; \
cmp = __cmp(x, p); \
if (cmp >= 0) cnt += krmq_size_child(__head, p, 0) + 1; \
if (cmp == 0) { \
if (cnt_) *cnt_ = cnt; \
return p; \
} \
if (p->__head.balance != 0) \
bq = q, bp = p, top = 0; \
stack[top++] = which = (cmp > 0); \
path[path_len++] = p; \
} \
if (cnt_) *cnt_ = cnt; \
x->__head.balance = 0, x->__head.size = 1, x->__head.p[0] = x->__head.p[1] = 0, x->__head.s = x; \
if (q == 0) *root_ = x; \
else q->__head.p[which] = x; \
if (bp == 0) return x; \
for (i = 0; i < path_len; ++i) ++path[i]->__head.size; \
for (i = path_len - 1; i >= 0; --i) { \
krmq_update_min_##suf(path[i], path[i]->__head.p[0], path[i]->__head.p[1]); \
if (path[i]->__head.s != x) break; \
} \
for (p = bp, top = 0; p != x; p = p->__head.p[stack[top]], ++top) /* update balance factors */ \
if (stack[top] == 0) --p->__head.balance; \
else ++p->__head.balance; \
if (bp->__head.balance > -2 && bp->__head.balance < 2) return x; /* no re-balance needed */ \
/* re-balance */ \
which = (bp->__head.balance < 0); \
b1 = which == 0? +1 : -1; \
q = bp->__head.p[1 - which]; \
if (q->__head.balance == b1) { \
r = krmq_rotate1_##suf(bp, which); \
q->__head.balance = bp->__head.balance = 0; \
} else r = krmq_rotate2_##suf(bp, which); \
if (bq == 0) *root_ = r; \
else bq->__head.p[bp != bq->__head.p[0]] = r; \
return x; \
}
#define __KRMQ_ERASE(suf, __scope, __type, __head, __cmp, __lt2) \
__scope __type *krmq_erase_##suf(__type **root_, const __type *x, unsigned *cnt_) { \
__type *p, *path[KRMQ_MAX_DEPTH], fake; \
unsigned char dir[KRMQ_MAX_DEPTH]; \
int i, d = 0, cmp; \
unsigned cnt = 0; \
fake = **root_, fake.__head.p[0] = *root_, fake.__head.p[1] = 0; \
if (cnt_) *cnt_ = 0; \
if (x) { \
for (cmp = -1, p = &fake; cmp; cmp = __cmp(x, p)) { \
int which = (cmp > 0); \
if (cmp > 0) cnt += krmq_size_child(__head, p, 0) + 1; \
dir[d] = which; \
path[d++] = p; \
p = p->__head.p[which]; \
if (p == 0) { \
if (cnt_) *cnt_ = 0; \
return 0; \
} \
} \
cnt += krmq_size_child(__head, p, 0) + 1; /* because p==x is not counted */ \
} else { \
for (p = &fake, cnt = 1; p; p = p->__head.p[0]) \
dir[d] = 0, path[d++] = p; \
p = path[--d]; \
} \
if (cnt_) *cnt_ = cnt; \
for (i = 1; i < d; ++i) --path[i]->__head.size; \
if (p->__head.p[1] == 0) { /* ((1,.)2,3)4 => (1,3)4; p=2 */ \
path[d-1]->__head.p[dir[d-1]] = p->__head.p[0]; \
} else { \
__type *q = p->__head.p[1]; \
if (q->__head.p[0] == 0) { /* ((1,2)3,4)5 => ((1)2,4)5; p=3,q=2 */ \
q->__head.p[0] = p->__head.p[0]; \
q->__head.balance = p->__head.balance; \
path[d-1]->__head.p[dir[d-1]] = q; \
path[d] = q, dir[d++] = 1; \
q->__head.size = p->__head.size - 1; \
} else { /* ((1,((.,2)3,4)5)6,7)8 => ((1,(2,4)5)3,7)8; p=6 */ \
__type *r; \
int e = d++; /* backup _d_ */\
for (;;) { \
dir[d] = 0; \
path[d++] = q; \
r = q->__head.p[0]; \
if (r->__head.p[0] == 0) break; \
q = r; \
} \
r->__head.p[0] = p->__head.p[0]; \
q->__head.p[0] = r->__head.p[1]; \
r->__head.p[1] = p->__head.p[1]; \
r->__head.balance = p->__head.balance; \
path[e-1]->__head.p[dir[e-1]] = r; \
path[e] = r, dir[e] = 1; \
for (i = e + 1; i < d; ++i) --path[i]->__head.size; \
r->__head.size = p->__head.size - 1; \
} \
} \
for (i = d - 1; i >= 0; --i) /* not sure why adding condition "path[i]->__head.s==p" doesn't work */ \
krmq_update_min_##suf(path[i], path[i]->__head.p[0], path[i]->__head.p[1]); \
while (--d > 0) { \
__type *q = path[d]; \
int which, other, b1 = 1, b2 = 2; \
which = dir[d], other = 1 - which; \
if (which) b1 = -b1, b2 = -b2; \
q->__head.balance += b1; \
if (q->__head.balance == b1) break; \
else if (q->__head.balance == b2) { \
__type *r = q->__head.p[other]; \
if (r->__head.balance == -b1) { \
path[d-1]->__head.p[dir[d-1]] = krmq_rotate2_##suf(q, which); \
} else { \
path[d-1]->__head.p[dir[d-1]] = krmq_rotate1_##suf(q, which); \
if (r->__head.balance == 0) { \
r->__head.balance = -b1; \
q->__head.balance = b1; \
break; \
} else r->__head.balance = q->__head.balance = 0; \
} \
} \
} \
*root_ = fake.__head.p[0]; \
return p; \
}
#define krmq_free(__type, __head, __root, __free) do { \
__type *_p, *_q; \
for (_p = __root; _p; _p = _q) { \
if (_p->__head.p[0] == 0) { \
_q = _p->__head.p[1]; \
__free(_p); \
} else { \
_q = _p->__head.p[0]; \
_p->__head.p[0] = _q->__head.p[1]; \
_q->__head.p[1] = _p; \
} \
} \
} while (0)
#define __KRMQ_ITR(suf, __scope, __type, __head, __cmp) \
struct krmq_itr_##suf { \
const __type *stack[KRMQ_MAX_DEPTH], **top; \
}; \
__scope void krmq_itr_first_##suf(const __type *root, struct krmq_itr_##suf *itr) { \
const __type *p; \
for (itr->top = itr->stack - 1, p = root; p; p = p->__head.p[0]) \
*++itr->top = p; \
} \
__scope int krmq_itr_find_##suf(const __type *root, const __type *x, struct krmq_itr_##suf *itr) { \
const __type *p = root; \
itr->top = itr->stack - 1; \
while (p != 0) { \
int cmp; \
*++itr->top = p; \
cmp = __cmp(x, p); \
if (cmp < 0) p = p->__head.p[0]; \
else if (cmp > 0) p = p->__head.p[1]; \
else break; \
} \
return p? 1 : 0; \
} \
__scope int krmq_itr_next_bidir_##suf(struct krmq_itr_##suf *itr, int dir) { \
const __type *p; \
if (itr->top < itr->stack) return 0; \
dir = !!dir; \
p = (*itr->top)->__head.p[dir]; \
if (p) { /* go down */ \
for (; p; p = p->__head.p[!dir]) \
*++itr->top = p; \
return 1; \
} else { /* go up */ \
do { \
p = *itr->top--; \
} while (itr->top >= itr->stack && p == (*itr->top)->__head.p[dir]); \
return itr->top < itr->stack? 0 : 1; \
} \
} \
/**
* Insert a node to the tree
*
* @param suf name suffix used in KRMQ_INIT()
* @param proot pointer to the root of the tree (in/out: root may change)
* @param x node to insert (in)
* @param cnt number of nodes smaller than or equal to _x_; can be NULL (out)
*
* @return _x_ if not present in the tree, or the node equal to x.
*/
#define krmq_insert(suf, proot, x, cnt) krmq_insert_##suf(proot, x, cnt)
/**
* Find a node in the tree
*
* @param suf name suffix used in KRMQ_INIT()
* @param root root of the tree
* @param x node value to find (in)
* @param cnt number of nodes smaller than or equal to _x_; can be NULL (out)
*
* @return node equal to _x_ if present, or NULL if absent
*/
#define krmq_find(suf, root, x, cnt) krmq_find_##suf(root, x, cnt)
#define krmq_interval(suf, root, x, lower, upper) krmq_interval_##suf(root, x, lower, upper)
#define krmq_rmq(suf, root, lo, up) krmq_rmq_##suf(root, lo, up)
/**
* Delete a node from the tree
*
* @param suf name suffix used in KRMQ_INIT()
* @param proot pointer to the root of the tree (in/out: root may change)
* @param x node value to delete; if NULL, delete the first node (in)
*
* @return node removed from the tree if present, or NULL if absent
*/
#define krmq_erase(suf, proot, x, cnt) krmq_erase_##suf(proot, x, cnt)
#define krmq_erase_first(suf, proot) krmq_erase_##suf(proot, 0, 0)
#define krmq_itr_t(suf) struct krmq_itr_##suf
/**
* Place the iterator at the smallest object
*
* @param suf name suffix used in KRMQ_INIT()
* @param root root of the tree
* @param itr iterator
*/
#define krmq_itr_first(suf, root, itr) krmq_itr_first_##suf(root, itr)
/**
* Place the iterator at the object equal to or greater than the query
*
* @param suf name suffix used in KRMQ_INIT()
* @param root root of the tree
* @param x query (in)
* @param itr iterator (out)
*
* @return 1 if find; 0 otherwise. krmq_at(itr) is NULL if and only if query is
* larger than all objects in the tree
*/
#define krmq_itr_find(suf, root, x, itr) krmq_itr_find_##suf(root, x, itr)
/**
* Move to the next object in order
*
* @param itr iterator (modified)
*
* @return 1 if there is a next object; 0 otherwise
*/
#define krmq_itr_next(suf, itr) krmq_itr_next_bidir_##suf(itr, 1)
#define krmq_itr_prev(suf, itr) krmq_itr_next_bidir_##suf(itr, 0)
/**
* Return the pointer at the iterator
*
* @param itr iterator
*
* @return pointer if present; NULL otherwise
*/
#define krmq_at(itr) ((itr)->top < (itr)->stack? 0 : *(itr)->top)
#define KRMQ_INIT2(suf, __scope, __type, __head, __cmp, __lt2) \
__KRMQ_FIND(suf, __scope, __type, __head, __cmp) \
__KRMQ_RMQ(suf, __scope, __type, __head, __cmp, __lt2) \
__KRMQ_ROTATE(suf, __type, __head, __lt2) \
__KRMQ_INSERT(suf, __scope, __type, __head, __cmp, __lt2) \
__KRMQ_ERASE(suf, __scope, __type, __head, __cmp, __lt2) \
__KRMQ_ITR(suf, __scope, __type, __head, __cmp)
#define KRMQ_INIT(suf, __type, __head, __cmp, __lt2) \
KRMQ_INIT2(suf,, __type, __head, __cmp, __lt2)
#endif
+10 -2
View File
@@ -37,6 +37,14 @@
#define KS_SEP_LINE 2 // line separator: "\n" (Unix) or "\r\n" (Windows) #define KS_SEP_LINE 2 // line separator: "\n" (Unix) or "\r\n" (Windows)
#define KS_SEP_MAX 2 #define KS_SEP_MAX 2
#ifndef klib_unused
#if (defined __clang__ && __clang_major__ >= 3) || (defined __GNUC__ && __GNUC__ >= 3)
#define klib_unused __attribute__ ((__unused__))
#else
#define klib_unused
#endif
#endif /* klib_unused */
#define __KS_TYPE(type_t) \ #define __KS_TYPE(type_t) \
typedef struct __kstream_t { \ typedef struct __kstream_t { \
int begin, end; \ int begin, end; \
@@ -64,7 +72,7 @@
} }
#define __KS_INLINED(__read) \ #define __KS_INLINED(__read) \
static inline int ks_getc(kstream_t *ks) \ static inline klib_unused int ks_getc(kstream_t *ks) \
{ \ { \
if (ks->is_eof && ks->begin >= ks->end) return -1; \ if (ks->is_eof && ks->begin >= ks->end) return -1; \
if (ks->begin >= ks->end) { \ if (ks->begin >= ks->end) { \
@@ -81,7 +89,7 @@
#ifndef KSTRING_T #ifndef KSTRING_T
#define KSTRING_T kstring_t #define KSTRING_T kstring_t
typedef struct __kstring_t { typedef struct __kstring_t {
unsigned l, m; size_t l, m;
char *s; char *s;
} kstring_t; } kstring_t;
#endif #endif
+1 -1
View File
@@ -37,7 +37,7 @@ typedef struct {
int depth; int depth;
} ks_isort_stack_t; } ks_isort_stack_t;
#define KSORT_SWAP(type_t, a, b) { register type_t t=(a); (a)=(b); (b)=t; } #define KSORT_SWAP(type_t, a, b) { type_t t=(a); (a)=(b); (b)=t; }
#define KSORT_INIT(name, type_t, __sort_lt) \ #define KSORT_INIT(name, type_t, __sort_lt) \
void ks_heapdown_##name(size_t i, size_t n, type_t l[]) \ void ks_heapdown_##name(size_t i, size_t n, type_t l[]) \
+18 -7
View File
@@ -15,6 +15,17 @@
#define KSW_EZ_SPLICE_FOR 0x100 #define KSW_EZ_SPLICE_FOR 0x100
#define KSW_EZ_SPLICE_REV 0x200 #define KSW_EZ_SPLICE_REV 0x200
#define KSW_EZ_SPLICE_FLANK 0x400 #define KSW_EZ_SPLICE_FLANK 0x400
#define KSW_EZ_SPLICE_CMPLX 0x800 // use the miniprot splice model
#define KSW_EZ_SPLICE_SCORE 0x1000 // use splice score
// The subset of CIGAR operators used by ksw code.
// Use MM_CIGAR_* from minimap.h if you need the full list.
#define KSW_CIGAR_MATCH 0
#define KSW_CIGAR_INS 1
#define KSW_CIGAR_DEL 2
#define KSW_CIGAR_N_SKIP 3
#define KSW_SPSC_OFFSET 64
#ifdef __cplusplus #ifdef __cplusplus
extern "C" { extern "C" {
@@ -61,7 +72,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
int8_t gapo, int8_t gape, int8_t gapo2, int8_t gape2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez); int8_t gapo, int8_t gape, int8_t gapo2, int8_t gape2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t gapo, int8_t gape, int8_t gapo2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez); int8_t gapo, int8_t gape, int8_t gapo2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez);
void ksw_extf2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t mch, int8_t mis, int8_t e, int w, int xdrop, ksw_extz_t *ez); void ksw_extf2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t mch, int8_t mis, int8_t e, int w, int xdrop, ksw_extz_t *ez);
@@ -137,13 +148,13 @@ static inline void ksw_backtrack(void *km, int is_rot, int is_rev, int min_intro
else if (!(tmp >> (state + 2) & 1)) state = 0; // if requesting other states, _state_ stays the same if it is a continuation; otherwise, set to H else if (!(tmp >> (state + 2) & 1)) state = 0; // if requesting other states, _state_ stays the same if it is a continuation; otherwise, set to H
if (state == 0) state = tmp & 7; // TODO: probably this line can be merged into the "else if" line right above; not 100% sure if (state == 0) state = tmp & 7; // TODO: probably this line can be merged into the "else if" line right above; not 100% sure
if (force_state >= 0) state = force_state; if (force_state >= 0) state = force_state;
if (state == 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 0, 1), --i, --j; // match if (state == 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, KSW_CIGAR_MATCH, 1), --i, --j;
else if (state == 1 || (state == 3 && min_intron_len <= 0)) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 2, 1), --i; // deletion else if (state == 1 || (state == 3 && min_intron_len <= 0)) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, KSW_CIGAR_DEL, 1), --i;
else if (state == 3 && min_intron_len > 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 3, 1), --i; // intron else if (state == 3 && min_intron_len > 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, KSW_CIGAR_N_SKIP, 1), --i;
else cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 1, 1), --j; // insertion else cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, KSW_CIGAR_INS, 1), --j;
} }
if (i >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, min_intron_len > 0 && i >= min_intron_len? 3 : 2, i + 1); // first deletion if (i >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, min_intron_len > 0 && i >= min_intron_len? KSW_CIGAR_N_SKIP : KSW_CIGAR_DEL, i + 1); // first deletion
if (j >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 1, j + 1); // first insertion if (j >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, KSW_CIGAR_INS, j + 1); // first insertion
if (!is_rev) if (!is_rev)
for (i = 0; i < n_cigar>>1; ++i) // reverse CIGAR for (i = 0; i < n_cigar>>1; ++i) // reverse CIGAR
tmp = cigar[i], cigar[i] = cigar[n_cigar-1-i], cigar[n_cigar-1-i] = tmp; tmp = cigar[i], cigar[i] = cigar[n_cigar-1-i], cigar[n_cigar-1-i] = tmp;
+19 -20
View File
@@ -17,18 +17,20 @@
void __cpuidex(int cpuid[4], int func_id, int subfunc_id) void __cpuidex(int cpuid[4], int func_id, int subfunc_id)
{ {
#if defined(__x86_64__) #if defined(__x86_64__)
asm volatile ("cpuid" __asm__ volatile ("cpuid"
: "=a" (cpuid[0]), "=b" (cpuid[1]), "=c" (cpuid[2]), "=d" (cpuid[3]) : "=a" (cpuid[0]), "=b" (cpuid[1]), "=c" (cpuid[2]), "=d" (cpuid[3])
: "0" (func_id), "2" (subfunc_id)); : "0" (func_id), "2" (subfunc_id));
#else // on 32bit, ebx can NOT be used as PIC code #else // on 32bit, ebx can NOT be used as PIC code
asm volatile ("xchgl %%ebx, %1; cpuid; xchgl %%ebx, %1" __asm__ volatile ("xchgl %%ebx, %1; cpuid; xchgl %%ebx, %1"
: "=a" (cpuid[0]), "=r" (cpuid[1]), "=c" (cpuid[2]), "=d" (cpuid[3]) : "=a" (cpuid[0]), "=r" (cpuid[1]), "=c" (cpuid[2]), "=d" (cpuid[3])
: "0" (func_id), "2" (subfunc_id)); : "0" (func_id), "2" (subfunc_id));
#endif #endif
} }
#endif #endif
int x86_simd(void) static int ksw_simd = -1;
static int x86_simd(void)
{ {
int flag = 0, cpuid[4], max_id; int flag = 0, cpuid[4], max_id;
__cpuidex(cpuid, 0, 0); __cpuidex(cpuid, 0, 0);
@@ -54,11 +56,10 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
{ {
extern void ksw_extz2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez); extern void ksw_extz2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
extern void ksw_extz2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez); extern void ksw_extz2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
unsigned simd; if (ksw_simd < 0) ksw_simd = x86_simd();
simd = x86_simd(); if (ksw_simd & SIMD_SSE4_1)
if (simd & SIMD_SSE4_1)
ksw_extz2_sse41(km, qlen, query, tlen, target, m, mat, q, e, w, zdrop, end_bonus, flag, ez); ksw_extz2_sse41(km, qlen, query, tlen, target, m, mat, q, e, w, zdrop, end_bonus, flag, ez);
else if (simd & SIMD_SSE2) else if (ksw_simd & SIMD_SSE2)
ksw_extz2_sse2(km, qlen, query, tlen, target, m, mat, q, e, w, zdrop, end_bonus, flag, ez); ksw_extz2_sse2(km, qlen, query, tlen, target, m, mat, q, e, w, zdrop, end_bonus, flag, ez);
else abort(); else abort();
} }
@@ -70,28 +71,26 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez); int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
extern void ksw_extd2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, extern void ksw_extd2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez); int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
unsigned simd; if (ksw_simd < 0) ksw_simd = x86_simd();
simd = x86_simd(); if (ksw_simd & SIMD_SSE4_1)
if (simd & SIMD_SSE4_1)
ksw_extd2_sse41(km, qlen, query, tlen, target, m, mat, q, e, q2, e2, w, zdrop, end_bonus, flag, ez); ksw_extd2_sse41(km, qlen, query, tlen, target, m, mat, q, e, q2, e2, w, zdrop, end_bonus, flag, ez);
else if (simd & SIMD_SSE2) else if (ksw_simd & SIMD_SSE2)
ksw_extd2_sse2(km, qlen, query, tlen, target, m, mat, q, e, q2, e2, w, zdrop, end_bonus, flag, ez); ksw_extd2_sse2(km, qlen, query, tlen, target, m, mat, q, e, q2, e2, w, zdrop, end_bonus, flag, ez);
else abort(); else abort();
} }
void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez) int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez)
{ {
extern void ksw_exts2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, extern void ksw_exts2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez); int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez);
extern void ksw_exts2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, extern void ksw_exts2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez); int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez);
unsigned simd; if (ksw_simd < 0) ksw_simd = x86_simd();
simd = x86_simd(); if (ksw_simd & SIMD_SSE4_1)
if (simd & SIMD_SSE4_1) ksw_exts2_sse41(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, end_bonus, junc_bonus, junc_pen, flag, junc, ez);
ksw_exts2_sse41(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, flag, ez); else if (ksw_simd & SIMD_SSE2)
else if (simd & SIMD_SSE2) ksw_exts2_sse2(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, end_bonus, junc_bonus, junc_pen, flag, junc, ez);
ksw_exts2_sse2(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, flag, ez);
else abort(); else abort();
} }
#endif #endif
+9 -1
View File
@@ -4,15 +4,23 @@
#include "ksw2.h" #include "ksw2.h"
#ifdef __SSE2__ #ifdef __SSE2__
#ifdef USE_SIMDE
#include <simde/x86/sse2.h>
#else
#include <emmintrin.h> #include <emmintrin.h>
#endif
#ifdef KSW_SSE2_ONLY #ifdef KSW_SSE2_ONLY
#undef __SSE4_1__ #undef __SSE4_1__
#endif #endif
#ifdef __SSE4_1__ #ifdef __SSE4_1__
#ifdef USE_SIMDE
#include <simde/x86/sse4.1.h>
#else
#include <smmintrin.h> #include <smmintrin.h>
#endif #endif
#endif
#ifdef KSW_CPU_DISPATCH #ifdef KSW_CPU_DISPATCH
#ifdef __SSE4_1__ #ifdef __SSE4_1__
@@ -350,7 +358,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
} else H[0] = v8[0] - qe, max_H = H[0], max_t = 0; // special casing r==0 } else H[0] = v8[0] - qe, max_H = H[0], max_t = 0; // special casing r==0
// update ez // update ez
if (en0 == tlen - 1 && H[en0] > ez->mte) if (en0 == tlen - 1 && H[en0] > ez->mte)
ez->mte = H[en0], ez->mte_q = r - en; ez->mte = H[en0], ez->mte_q = r - en0;
if (r - st0 == qlen - 1 && H[st0] > ez->mqe) if (r - st0 == qlen - 1 && H[st0] > ez->mqe)
ez->mqe = H[st0], ez->mqe_t = st0; ez->mqe = H[st0], ez->mqe_t = st0;
if (ksw_apply_zdrop(ez, 1, max_H, r, max_t, zdrop, e2)) break; if (ksw_apply_zdrop(ez, 1, max_H, r, max_t, zdrop, e2)) break;
+110 -20
View File
@@ -4,27 +4,34 @@
#include "ksw2.h" #include "ksw2.h"
#ifdef __SSE2__ #ifdef __SSE2__
#ifdef USE_SIMDE
#include <simde/x86/sse2.h>
#else
#include <emmintrin.h> #include <emmintrin.h>
#endif
#ifdef KSW_SSE2_ONLY #ifdef KSW_SSE2_ONLY
#undef __SSE4_1__ #undef __SSE4_1__
#endif #endif
#ifdef __SSE4_1__ #ifdef __SSE4_1__
#ifdef USE_SIMDE
#include <simde/x86/sse4.1.h>
#else
#include <smmintrin.h> #include <smmintrin.h>
#endif #endif
#endif
#ifdef KSW_CPU_DISPATCH #ifdef KSW_CPU_DISPATCH
#ifdef __SSE4_1__ #ifdef __SSE4_1__
void ksw_exts2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, void ksw_exts2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez) int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez)
#else #else
void ksw_exts2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, void ksw_exts2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez) int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez)
#endif #endif
#else #else
void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez) int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez)
#endif // ~KSW_CPU_DISPATCH #endif // ~KSW_CPU_DISPATCH
{ {
#define __dp_code_block1 \ #define __dp_code_block1 \
@@ -64,6 +71,7 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
ksw_reset_extz(ez); ksw_reset_extz(ez);
if (m <= 1 || qlen <= 0 || tlen <= 0 || q2 <= q + e) return; if (m <= 1 || qlen <= 0 || tlen <= 0 || q2 <= q + e) return;
assert((flag & KSW_EZ_SPLICE_FOR) == 0 || (flag & KSW_EZ_SPLICE_REV) == 0); // can't be both set
zero_ = _mm_set1_epi8(0); zero_ = _mm_set1_epi8(0);
q_ = _mm_set1_epi8(q); q_ = _mm_set1_epi8(q);
@@ -111,22 +119,100 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
// set the donor and acceptor arrays. TODO: this assumes 0/1/2/3 encoding! // set the donor and acceptor arrays. TODO: this assumes 0/1/2/3 encoding!
if (flag & (KSW_EZ_SPLICE_FOR|KSW_EZ_SPLICE_REV)) { if (flag & (KSW_EZ_SPLICE_FOR|KSW_EZ_SPLICE_REV)) {
int semi_cost = flag&KSW_EZ_SPLICE_FLANK? -noncan/2 : 0; // GTr or yAG is worth 0.5 bit; see PMID:18688272 const int sp0[4] = { 8, 15, 21, 30 };
memset(donor, -noncan, tlen_ * 16); int sp[4];
if (flag & KSW_EZ_SPLICE_CMPLX) {
for (t = 0; t < 4; ++t)
sp[t] = (int)((double)sp0[t] / 3. + .499);
} else {
sp[0] = flag&KSW_EZ_SPLICE_FLANK? noncan / 2 : 0;
sp[1] = sp[2] = sp[3] = noncan;
}
memset(donor, -sp[3], tlen_ * 16);
memset(acceptor, -sp[3], tlen_ * 16);
if (!(flag & KSW_EZ_REV_CIGAR)) {
for (t = 0; t < tlen - 4; ++t) { for (t = 0; t < tlen - 4; ++t) {
int can_type = 0; // type of canonical site: 0=none, 1=GT/AG only, 2=GTr/yAG int z = 3;
if ((flag & KSW_EZ_SPLICE_FOR) && target[t+1] == 2 && target[t+2] == 3) can_type = 1; // GTr... if (flag & KSW_EZ_SPLICE_FOR) {
if ((flag & KSW_EZ_SPLICE_REV) && target[t+1] == 1 && target[t+2] == 3) can_type = 1; // CTr... if (target[t+1] == 2 && target[t+2] == 3) // |GT.
if (can_type && (target[t+3] == 0 || target[t+3] == 2)) can_type = 2; z = target[t+3] == 0 || target[t+3] == 2? -1 : 0; // |GTr or not
if (can_type) ((int8_t*)donor)[t] = can_type == 2? 0 : semi_cost; else if (target[t+1] == 2 && target[t+2] == 1) z = 1; // |GC.
else if (target[t+1] == 0 && target[t+2] == 3) z = 2; // |AT.
} else if (flag & KSW_EZ_SPLICE_REV) {
if (target[t+1] == 1 && target[t+2] == 3) // |CT. (revcomp of .AG|)
z = target[t+3] == 0 || target[t+3] == 2? -1 : 0;
else if (target[t+1] == 2 && target[t+2] == 3) z = 2; // |GT. (revcomp of .AC|)
}
((int8_t*)donor)[t] = z < 0? 0 : -sp[z];
} }
memset(acceptor, -noncan, tlen_ * 16);
for (t = 2; t < tlen; ++t) { for (t = 2; t < tlen; ++t) {
int can_type = 0; int z = 3;
if ((flag & KSW_EZ_SPLICE_FOR) && target[t-1] == 0 && target[t] == 2) can_type = 1; // ...yAG if (flag & KSW_EZ_SPLICE_FOR) {
if ((flag & KSW_EZ_SPLICE_REV) && target[t-1] == 0 && target[t] == 1) can_type = 1; // ...yAC if (target[t-1] == 0 && target[t] == 2) // .AG|
if (can_type && (target[t-2] == 1 || target[t-2] == 3)) can_type = 2; z = target[t-2] == 1 || target[t-2] == 3? -1 : 0; // yAG| or not
if (can_type) ((int8_t*)acceptor)[t] = can_type == 2? 0 : semi_cost; else if (target[t-1] == 0 && target[t] == 1) z = 2; // .AC|
} else if (flag & KSW_EZ_SPLICE_REV) {
if (target[t-1] == 0 && target[t] == 1) // .AC| (revcomp of |GT.)
z = target[t-2] == 1 || target[t-2] == 3? -1 : 0; // yAC| or not
else if (target[t-1] == 2 && target[t] == 1) z = 1; // .GC| (revcomp of |GC.)
else if (target[t-1] == 0 && target[t] == 3) z = 2; // .AT| (revcomp of |AT.)
}
((int8_t*)acceptor)[t] = z < 0? 0 : -sp[z];
}
} else {
for (t = 0; t < tlen - 4; ++t) {
int z = 3;
if (flag & KSW_EZ_SPLICE_FOR) {
if (target[t+1] == 2 && target[t+2] == 0) // |GA. (rev of .AG|)
z = target[t+3] == 1 || target[t+3] == 3? -1 : 0;
else if (target[t+1] == 1 && target[t+2] == 0) z = 2; // |CA. (rev of .AC|)
} else if (flag & KSW_EZ_SPLICE_REV) {
if (target[t+1] == 1 && target[t+2] == 0) // |CA. (comp of |GT.)
z = target[t+3] == 1 || target[t+3] == 3? -1 : 0;
else if (target[t+1] == 1 && target[t+2] == 2) z = 1; // |CG. (comp of |GC.)
else if (target[t+1] == 3 && target[t+2] == 0) z = 2; // |TA. (comp of |AT.)
}
((int8_t*)donor)[t] = z < 0? 0 : -sp[z];
}
for (t = 2; t < tlen; ++t) {
int z = 3;
if (flag & KSW_EZ_SPLICE_FOR) {
if (target[t-1] == 3 && target[t] == 2) // .TG| (rev of |GT.)
z = target[t-2] == 0 || target[t-2] == 2? -1 : 0;
else if (target[t-1] == 1 && target[t] == 2) z = 1; // .CG| (rev of |GC.)
else if (target[t-1] == 3 && target[t] == 0) z = 2; // .TA| (rev of |AT.)
} else if (flag & KSW_EZ_SPLICE_REV) {
if (target[t-1] == 3 && target[t] == 1) // .TC| (comp of .AG|)
z = target[t-2] == 0 || target[t-2] == 2? -1 : 0;
else if (target[t-1] == 3 && target[t] == 2) z = 2; // .TG| (comp of .AC|)
}
((int8_t*)acceptor)[t] = z < 0? 0 : -sp[z];
}
}
}
if (junc && (flag & KSW_EZ_SPLICE_SCORE)) { // junc[] keeps the donor score
uint8_t donor_val = !!(flag & KSW_EZ_SPLICE_FOR) == !(flag & KSW_EZ_REV_CIGAR)? 0 : 1;
for (t = 0; t < tlen - 1; ++t)
((int8_t*)donor)[t] += junc[t+1] == 0xff || (junc[t+1]&1) != donor_val? -junc_pen : (int8_t)(junc[t+1]>>1) - (int8_t)KSW_SPSC_OFFSET;
for (t = 0; t < tlen - 1; ++t)
((int8_t*)acceptor)[t] += junc[t+1] == 0xff || (junc[t+1]&1) != !donor_val? -junc_pen : (int8_t)(junc[t+1]>>1) - (int8_t)KSW_SPSC_OFFSET;
//for (t = 0; t < tlen - 1; ++t) if (junc[t+1] != 0xff) fprintf(stderr, "Y2\t%d\t%d\t%c\t%d\n", ((int8_t*)donor)[t], ((int8_t*)acceptor)[t], "DA"[junc[t+1]&1], (int8_t)(junc[t+1]>>1) - (int8_t)KSW_SPSC_OFFSET);
} else if (junc) { // junc[] keeps the splice sites
if (!(flag & KSW_EZ_REV_CIGAR)) {
for (t = 0; t < tlen - 1; ++t)
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t+1]&1)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t+1]&8)))
((int8_t*)donor)[t] += junc_bonus;
for (t = 0; t < tlen; ++t)
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t]&2)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t]&4)))
((int8_t*)acceptor)[t] += junc_bonus;
} else {
for (t = 0; t < tlen - 1; ++t)
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t+1]&2)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t+1]&4)))
((int8_t*)donor)[t] += junc_bonus;
for (t = 0; t < tlen; ++t)
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t]&1)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t]&8)))
((int8_t*)acceptor)[t] += junc_bonus;
} }
} }
@@ -336,7 +422,7 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
} else H[0] = v8[0] - qe, max_H = H[0], max_t = 0; // special casing r==0 } else H[0] = v8[0] - qe, max_H = H[0], max_t = 0; // special casing r==0
// update ez // update ez
if (en0 == tlen - 1 && H[en0] > ez->mte) if (en0 == tlen - 1 && H[en0] > ez->mte)
ez->mte = H[en0], ez->mte_q = r - en; ez->mte = H[en0], ez->mte_q = r - en0;
if (r - st0 == qlen - 1 && H[st0] > ez->mqe) if (r - st0 == qlen - 1 && H[st0] > ez->mqe)
ez->mqe = H[st0], ez->mqe_t = st0; ez->mqe = H[st0], ez->mqe_t = st0;
if (ksw_apply_zdrop(ez, 1, max_H, r, max_t, zdrop, 0)) break; if (ksw_apply_zdrop(ez, 1, max_H, r, max_t, zdrop, 0)) break;
@@ -366,10 +452,14 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
if (!approx_max) kfree(km, H); if (!approx_max) kfree(km, H);
if (with_cigar) { // backtrack if (with_cigar) { // backtrack
int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR); int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY)) if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY)) {
ksw_backtrack(km, 1, rev_cigar, long_thres, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar); ksw_backtrack(km, 1, rev_cigar, long_thres, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
else if (ez->max_t >= 0 && ez->max_q >= 0) } else if (!ez->zdropped && (flag&KSW_EZ_EXTZ_ONLY) && ez->mqe + end_bonus > (int)ez->max) {
ez->reach_end = 1;
ksw_backtrack(km, 1, rev_cigar, long_thres, (uint8_t*)p, off, off_end, n_col_*16, ez->mqe_t, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
} else if (ez->max_t >= 0 && ez->max_q >= 0) {
ksw_backtrack(km, 1, rev_cigar, long_thres, (uint8_t*)p, off, off_end, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar); ksw_backtrack(km, 1, rev_cigar, long_thres, (uint8_t*)p, off, off_end, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
}
kfree(km, mem2); kfree(km, off); kfree(km, mem2); kfree(km, off);
} }
} }
+9 -1
View File
@@ -3,15 +3,23 @@
#include "ksw2.h" #include "ksw2.h"
#ifdef __SSE2__ #ifdef __SSE2__
#ifdef USE_SIMDE
#include <simde/x86/sse2.h>
#else
#include <emmintrin.h> #include <emmintrin.h>
#endif
#ifdef KSW_SSE2_ONLY #ifdef KSW_SSE2_ONLY
#undef __SSE4_1__ #undef __SSE4_1__
#endif #endif
#ifdef __SSE4_1__ #ifdef __SSE4_1__
#ifdef USE_SIMDE
#include <simde/x86/sse4.1.h>
#else
#include <smmintrin.h> #include <smmintrin.h>
#endif #endif
#endif
#ifdef KSW_CPU_DISPATCH #ifdef KSW_CPU_DISPATCH
#ifdef __SSE4_1__ #ifdef __SSE4_1__
@@ -261,7 +269,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
} else H[0] = v8[0] - qe - qe, max_H = H[0], max_t = 0; // special casing r==0 } else H[0] = v8[0] - qe - qe, max_H = H[0], max_t = 0; // special casing r==0
// update ez // update ez
if (en0 == tlen - 1 && H[en0] > ez->mte) if (en0 == tlen - 1 && H[en0] > ez->mte)
ez->mte = H[en0], ez->mte_q = r - en; ez->mte = H[en0], ez->mte_q = r - en0;
if (r - st0 == qlen - 1 && H[st0] > ez->mqe) if (r - st0 == qlen - 1 && H[st0] > ez->mqe)
ez->mqe = H[st0], ez->mqe_t = st0; ez->mqe = H[st0], ez->mqe_t = st0;
if (ksw_apply_zdrop(ez, 1, max_H, r, max_t, zdrop, e)) break; if (ksw_apply_zdrop(ez, 1, max_H, r, max_t, zdrop, e)) break;
+6 -1
View File
@@ -1,9 +1,14 @@
#include <stdlib.h> #include <stdlib.h>
#include <stdint.h> #include <stdint.h>
#include <string.h> #include <string.h>
#include <emmintrin.h>
#include "ksw2.h" #include "ksw2.h"
#ifdef USE_SIMDE
#include <simde/x86/sse2.h>
#else
#include <emmintrin.h>
#endif
#ifdef __GNUC__ #ifdef __GNUC__
#define LIKELY(x) __builtin_expect((x),1) #define LIKELY(x) __builtin_expect((x),1)
#define UNLIKELY(x) __builtin_expect((x),0) #define UNLIKELY(x) __builtin_expect((x),0)
+368
View File
@@ -0,0 +1,368 @@
#include <stdint.h>
#include <string.h>
#include <stdio.h>
#include <assert.h>
#include "mmpriv.h"
#include "kalloc.h"
#include "krmq.h"
static int64_t mg_chain_bk_end(int32_t max_drop, const mm128_t *z, const int32_t *f, const int64_t *p, int32_t *t, int64_t k)
{
int64_t i = z[k].y, end_i = -1, max_i = i;
int32_t max_s = 0;
if (i < 0 || t[i] != 0) return i;
do {
int32_t s;
t[i] = 2;
end_i = i = p[i];
s = i < 0? z[k].x : (int32_t)z[k].x - f[i];
if (s > max_s) max_s = s, max_i = i;
else if (max_s - s > max_drop) break;
} while (i >= 0 && t[i] == 0);
for (i = z[k].y; i >= 0 && i != end_i; i = p[i]) // reset modified t[]
t[i] = 0;
return max_i;
}
uint64_t *mg_chain_backtrack(void *km, int64_t n, const int32_t *f, const int64_t *p, int32_t *v, int32_t *t, int32_t min_cnt, int32_t min_sc, int32_t max_drop, int32_t *n_u_, int32_t *n_v_)
{
mm128_t *z;
uint64_t *u;
int64_t i, k, n_z, n_v;
int32_t n_u;
*n_u_ = *n_v_ = 0;
for (i = 0, n_z = 0; i < n; ++i) // precompute n_z
if (f[i] >= min_sc) ++n_z;
if (n_z == 0) return 0;
z = Kmalloc(km, mm128_t, n_z);
for (i = 0, k = 0; i < n; ++i) // populate z[]
if (f[i] >= min_sc) z[k].x = f[i], z[k++].y = i;
radix_sort_128x(z, z + n_z);
memset(t, 0, n * 4);
for (k = n_z - 1, n_v = n_u = 0; k >= 0; --k) { // precompute n_u
if (t[z[k].y] == 0) {
int64_t n_v0 = n_v, end_i;
int32_t sc;
end_i = mg_chain_bk_end(max_drop, z, f, p, t, k);
for (i = z[k].y; i != end_i; i = p[i])
++n_v, t[i] = 1;
sc = i < 0? z[k].x : (int32_t)z[k].x - f[i];
if (sc >= min_sc && n_v > n_v0 && n_v - n_v0 >= min_cnt)
++n_u;
else n_v = n_v0;
}
}
u = Kmalloc(km, uint64_t, n_u);
memset(t, 0, n * 4);
for (k = n_z - 1, n_v = n_u = 0; k >= 0; --k) { // populate u[]
if (t[z[k].y] == 0) {
int64_t n_v0 = n_v, end_i;
int32_t sc;
end_i = mg_chain_bk_end(max_drop, z, f, p, t, k);
for (i = z[k].y; i != end_i; i = p[i])
v[n_v++] = i, t[i] = 1;
sc = i < 0? z[k].x : (int32_t)z[k].x - f[i];
if (sc >= min_sc && n_v > n_v0 && n_v - n_v0 >= min_cnt)
u[n_u++] = (uint64_t)sc << 32 | (n_v - n_v0);
else n_v = n_v0;
}
}
kfree(km, z);
assert(n_v < INT32_MAX);
*n_u_ = n_u, *n_v_ = n_v;
return u;
}
static mm128_t *compact_a(void *km, int32_t n_u, uint64_t *u, int32_t n_v, int32_t *v, mm128_t *a)
{
mm128_t *b, *w;
uint64_t *u2;
int64_t i, j, k;
// write the result to b[]
b = Kmalloc(km, mm128_t, n_v);
for (i = 0, k = 0; i < n_u; ++i) {
int32_t k0 = k, ni = (int32_t)u[i];
for (j = 0; j < ni; ++j)
b[k++] = a[v[k0 + (ni - j - 1)]];
}
kfree(km, v);
// sort u[] and a[] by the target position, such that adjacent chains may be joined
w = Kmalloc(km, mm128_t, n_u);
for (i = k = 0; i < n_u; ++i) {
w[i].x = b[k].x, w[i].y = (uint64_t)k<<32|i;
k += (int32_t)u[i];
}
radix_sort_128x(w, w + n_u);
u2 = Kmalloc(km, uint64_t, n_u);
for (i = k = 0; i < n_u; ++i) {
int32_t j = (int32_t)w[i].y, n = (int32_t)u[j];
u2[i] = u[j];
memcpy(&a[k], &b[w[i].y>>32], n * sizeof(mm128_t));
k += n;
}
memcpy(u, u2, n_u * 8);
memcpy(b, a, k * sizeof(mm128_t)); // write _a_ to _b_ and deallocate _a_ because _a_ is oversized, sometimes a lot
kfree(km, a); kfree(km, w); kfree(km, u2);
return b;
}
static inline int32_t comput_sc(const mm128_t *ai, const mm128_t *aj, int32_t max_dist_x, int32_t max_dist_y, int32_t bw, float chn_pen_gap, float chn_pen_skip, int is_cdna, int n_seg)
{
int32_t dq = (int32_t)ai->y - (int32_t)aj->y, dr, dd, dg, q_span, sc;
int32_t sidi = (ai->y & MM_SEED_SEG_MASK) >> MM_SEED_SEG_SHIFT;
int32_t sidj = (aj->y & MM_SEED_SEG_MASK) >> MM_SEED_SEG_SHIFT;
if (dq <= 0 || dq > max_dist_x) return INT32_MIN;
dr = (int32_t)(ai->x - aj->x);
if (sidi == sidj && (dr == 0 || dq > max_dist_y)) return INT32_MIN;
dd = dr > dq? dr - dq : dq - dr;
if (sidi == sidj && dd > bw) return INT32_MIN;
if (n_seg > 1 && !is_cdna && sidi == sidj && dr > max_dist_y) return INT32_MIN;
dg = dr < dq? dr : dq;
q_span = aj->y>>32&0xff;
sc = q_span < dg? q_span : dg;
if (dd || dg > q_span) {
float lin_pen, log_pen;
lin_pen = chn_pen_gap * (float)dd + chn_pen_skip * (float)dg;
log_pen = dd >= 1? mg_log2(dd + 1) : 0.0f; // mg_log2() only works for dd>=2
if (is_cdna || sidi != sidj) {
if (sidi != sidj && dr == 0) ++sc; // possibly due to overlapping paired ends; give a minor bonus
else if (dr > dq || sidi != sidj) sc -= (int)(lin_pen < log_pen? lin_pen : log_pen); // deletion or jump between paired ends
else sc -= (int)(lin_pen + .5f * log_pen);
} else sc -= (int)(lin_pen + .5f * log_pen);
}
return sc;
}
/* Input:
* a[].x: rev<<63 | tid<<32 | tpos
* a[].y: flags<<40 | q_span<<32 | q_pos
* Output:
* n_u: #chains
* u[]: score<<32 | #anchors (sum of lower 32 bits of u[] is the returned length of a[])
* input a[] is deallocated on return
*/
mm128_t *mg_lchain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int max_iter, int min_cnt, int min_sc, float chn_pen_gap, float chn_pen_skip,
int is_cdna, int n_seg, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km)
{ // TODO: make sure this works when n has more than 32 bits
int32_t *f, *t, *v, n_u, n_v, mmax_f = 0, max_drop = bw;
int64_t *p, i, j, max_ii, st = 0;
uint64_t *u;
if (_u) *_u = 0, *n_u_ = 0;
if (n == 0 || a == 0) {
kfree(km, a);
return 0;
}
if (max_dist_x < bw) max_dist_x = bw;
if (max_dist_y < bw && !is_cdna) max_dist_y = bw;
if (is_cdna) max_drop = INT32_MAX;
p = Kmalloc(km, int64_t, n);
f = Kmalloc(km, int32_t, n);
v = Kmalloc(km, int32_t, n);
t = Kcalloc(km, int32_t, n);
// fill the score and backtrack arrays
for (i = 0, max_ii = -1; i < n; ++i) {
int64_t max_j = -1, end_j;
int32_t max_f = a[i].y>>32&0xff, n_skip = 0;
while (st < i && (a[i].x>>32 != a[st].x>>32 || a[i].x > a[st].x + max_dist_x)) ++st;
if (i - st > max_iter) st = i - max_iter;
for (j = i - 1; j >= st; --j) {
int32_t sc;
sc = comput_sc(&a[i], &a[j], max_dist_x, max_dist_y, bw, chn_pen_gap, chn_pen_skip, is_cdna, n_seg);
if (sc == INT32_MIN) continue;
sc += f[j];
if (sc > max_f) {
max_f = sc, max_j = j;
if (n_skip > 0) --n_skip;
} else if (t[j] == (int32_t)i) {
if (++n_skip > max_skip)
break;
}
if (p[j] >= 0) t[p[j]] = i;
}
end_j = j;
if (max_ii < 0 || a[i].x - a[max_ii].x > (int64_t)max_dist_x) {
int32_t max = INT32_MIN;
max_ii = -1;
for (j = i - 1; j >= st; --j)
if (max < f[j]) max = f[j], max_ii = j;
}
if (max_ii >= 0 && max_ii < end_j) {
int32_t tmp;
tmp = comput_sc(&a[i], &a[max_ii], max_dist_x, max_dist_y, bw, chn_pen_gap, chn_pen_skip, is_cdna, n_seg);
if (tmp != INT32_MIN && max_f < tmp + f[max_ii])
max_f = tmp + f[max_ii], max_j = max_ii;
}
f[i] = max_f, p[i] = max_j;
v[i] = max_j >= 0 && v[max_j] > max_f? v[max_j] : max_f; // v[] keeps the peak score up to i; f[] is the score ending at i, not always the peak
if (max_ii < 0 || (a[i].x - a[max_ii].x <= (int64_t)max_dist_x && f[max_ii] < f[i]))
max_ii = i;
if (mmax_f < max_f) mmax_f = max_f;
//fprintf(stderr, "X1\t%ld\t%ld:%d\t%ld\t%ld:%d\t%ld\t%ld\n", (long)i, (long)(a[i].x>>32), (int32_t)a[i].x, (long)max_j, max_j<0?-1L:(long)(a[max_j].x>>32), max_j<0?-1:(int32_t)a[max_j].x, (long)max_f, (long)v[i]);
}
u = mg_chain_backtrack(km, n, f, p, v, t, min_cnt, min_sc, max_drop, &n_u, &n_v);
*n_u_ = n_u, *_u = u; // NB: note that u[] may not be sorted by score here
kfree(km, p); kfree(km, f); kfree(km, t);
if (n_u == 0) {
kfree(km, a); kfree(km, v);
return 0;
}
return compact_a(km, n_u, u, n_v, v, a);
}
typedef struct lc_elem_s {
int32_t y;
int64_t i;
double pri;
KRMQ_HEAD(struct lc_elem_s) head;
} lc_elem_t;
#define lc_elem_cmp(a, b) ((a)->y < (b)->y? -1 : (a)->y > (b)->y? 1 : ((a)->i > (b)->i) - ((a)->i < (b)->i))
#define lc_elem_lt2(a, b) ((a)->pri < (b)->pri)
KRMQ_INIT(lc_elem, lc_elem_t, head, lc_elem_cmp, lc_elem_lt2)
KALLOC_POOL_INIT(rmq, lc_elem_t)
static inline int32_t comput_sc_simple(const mm128_t *ai, const mm128_t *aj, float chn_pen_gap, float chn_pen_skip, int32_t *exact, int32_t *width)
{
int32_t dq = (int32_t)ai->y - (int32_t)aj->y, dr, dd, dg, q_span, sc;
dr = (int32_t)(ai->x - aj->x);
*width = dd = dr > dq? dr - dq : dq - dr;
dg = dr < dq? dr : dq;
q_span = aj->y>>32&0xff;
sc = q_span < dg? q_span : dg;
if (exact) *exact = (dd == 0 && dg <= q_span);
if (dd || dq > q_span) {
float lin_pen, log_pen;
lin_pen = chn_pen_gap * (float)dd + chn_pen_skip * (float)dg;
log_pen = dd >= 1? mg_log2(dd + 1) : 0.0f; // mg_log2() only works for dd>=2
sc -= (int)(lin_pen + .5f * log_pen);
}
return sc;
}
mm128_t *mg_lchain_rmq(int max_dist, int max_dist_inner, int bw, int max_chn_skip, int cap_rmq_size, int min_cnt, int min_sc, float chn_pen_gap, float chn_pen_skip,
int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km)
{
int32_t *f,*t, *v, n_u, n_v, mmax_f = 0, max_rmq_size = 0, max_drop = bw;
int64_t *p, i, i0, st = 0, st_inner = 0;
uint64_t *u;
lc_elem_t *root = 0, *root_inner = 0;
void *mem_mp = 0;
kmp_rmq_t *mp;
if (_u) *_u = 0, *n_u_ = 0;
if (n == 0 || a == 0) {
kfree(km, a);
return 0;
}
if (max_dist < bw) max_dist = bw;
if (max_dist_inner < 0) max_dist_inner = 0;
if (max_dist_inner > max_dist) max_dist_inner = max_dist;
p = Kmalloc(km, int64_t, n);
f = Kmalloc(km, int32_t, n);
t = Kcalloc(km, int32_t, n);
v = Kmalloc(km, int32_t, n);
mem_mp = km_init2(km, 0x10000);
mp = kmp_init_rmq(mem_mp);
// fill the score and backtrack arrays
for (i = i0 = 0; i < n; ++i) {
int64_t max_j = -1;
int32_t q_span = a[i].y>>32&0xff, max_f = q_span;
lc_elem_t s, *q, *r, lo, hi;
// add in-range anchors
if (i0 < i && a[i0].x != a[i].x) {
int64_t j;
for (j = i0; j < i; ++j) {
q = kmp_alloc_rmq(mp);
q->y = (int32_t)a[j].y, q->i = j, q->pri = -(f[j] + 0.5 * chn_pen_gap * ((int32_t)a[j].x + (int32_t)a[j].y));
krmq_insert(lc_elem, &root, q, 0);
if (max_dist_inner > 0) {
r = kmp_alloc_rmq(mp);
*r = *q;
krmq_insert(lc_elem, &root_inner, r, 0);
}
}
i0 = i;
}
// get rid of active chains out of range
while (st < i && (a[i].x>>32 != a[st].x>>32 || a[i].x > a[st].x + max_dist || krmq_size(head, root) > cap_rmq_size)) {
s.y = (int32_t)a[st].y, s.i = st;
if ((q = krmq_find(lc_elem, root, &s, 0)) != 0) {
q = krmq_erase(lc_elem, &root, q, 0);
kmp_free_rmq(mp, q);
}
++st;
}
if (max_dist_inner > 0) { // similar to the block above, but applied to the inner tree
while (st_inner < i && (a[i].x>>32 != a[st_inner].x>>32 || a[i].x > a[st_inner].x + max_dist_inner || krmq_size(head, root_inner) > cap_rmq_size)) {
s.y = (int32_t)a[st_inner].y, s.i = st_inner;
if ((q = krmq_find(lc_elem, root_inner, &s, 0)) != 0) {
q = krmq_erase(lc_elem, &root_inner, q, 0);
kmp_free_rmq(mp, q);
}
++st_inner;
}
}
// RMQ
lo.i = INT32_MAX, lo.y = (int32_t)a[i].y - max_dist;
hi.i = 0, hi.y = (int32_t)a[i].y;
if ((q = krmq_rmq(lc_elem, root, &lo, &hi)) != 0) {
int32_t sc, exact, width, n_skip = 0;
int64_t j = q->i;
assert(q->y >= lo.y && q->y <= hi.y);
sc = f[j] + comput_sc_simple(&a[i], &a[j], chn_pen_gap, chn_pen_skip, &exact, &width);
if (width <= bw && sc > max_f) max_f = sc, max_j = j;
if (!exact && root_inner && (int32_t)a[i].y > 0) {
lc_elem_t *lo, *hi;
s.y = (int32_t)a[i].y - 1, s.i = n;
krmq_interval(lc_elem, root_inner, &s, &lo, &hi);
if (lo) {
const lc_elem_t *q;
int32_t width;
krmq_itr_t(lc_elem) itr;
krmq_itr_find(lc_elem, root_inner, lo, &itr);
while ((q = krmq_at(&itr)) != 0) {
if (q->y < (int32_t)a[i].y - max_dist_inner) break;
j = q->i;
sc = f[j] + comput_sc_simple(&a[i], &a[j], chn_pen_gap, chn_pen_skip, 0, &width);
if (width <= bw) {
if (sc > max_f) {
max_f = sc, max_j = j;
if (n_skip > 0) --n_skip;
} else if (t[j] == (int32_t)i) {
if (++n_skip > max_chn_skip)
break;
}
if (p[j] >= 0) t[p[j]] = i;
}
if (!krmq_itr_prev(lc_elem, &itr)) break;
}
}
}
}
// set max
assert(max_j < 0 || (a[max_j].x < a[i].x && (int32_t)a[max_j].y < (int32_t)a[i].y));
f[i] = max_f, p[i] = max_j;
v[i] = max_j >= 0 && v[max_j] > max_f? v[max_j] : max_f; // v[] keeps the peak score up to i; f[] is the score ending at i, not always the peak
if (mmax_f < max_f) mmax_f = max_f;
if (max_rmq_size < krmq_size(head, root)) max_rmq_size = krmq_size(head, root);
}
km_destroy(mem_mp);
u = mg_chain_backtrack(km, n, f, p, v, t, min_cnt, min_sc, max_drop, &n_u, &n_v);
*n_u_ = n_u, *_u = u; // NB: note that u[] may not be sorted by score here
kfree(km, p); kfree(km, f); kfree(km, t);
if (n_u == 0) {
kfree(km, a); kfree(km, v);
return 0;
}
return compact_a(km, n_u, u, n_v, v, a);
}
Submodule
+1
Submodule lib/simde added at b30129b3b4
+186 -39
View File
@@ -1,13 +1,12 @@
#include <stdlib.h> #include <stdlib.h>
#include <stdio.h> #include <stdio.h>
#include <string.h> #include <string.h>
#include <errno.h>
#include "bseq.h" #include "bseq.h"
#include "minimap.h" #include "minimap.h"
#include "mmpriv.h" #include "mmpriv.h"
#include "ketopt.h" #include "ketopt.h"
#define MM_VERSION "2.13-r852-dirty"
#ifdef __linux__ #ifdef __linux__
#include <sys/resource.h> #include <sys/resource.h>
#include <sys/time.h> #include <sys/time.h>
@@ -36,12 +35,12 @@ static ko_longopt_t long_options[] = {
{ "splice", ko_no_argument, 310 }, { "splice", ko_no_argument, 310 },
{ "cost-non-gt-ag", ko_required_argument, 'C' }, { "cost-non-gt-ag", ko_required_argument, 'C' },
{ "no-long-join", ko_no_argument, 312 }, { "no-long-join", ko_no_argument, 312 },
{ "sr", ko_no_argument, 313 }, { "sr", ko_optional_argument, 313 },
{ "frag", ko_required_argument, 314 }, { "frag", ko_required_argument, 314 },
{ "secondary", ko_required_argument, 315 }, { "secondary", ko_required_argument, 315 },
{ "cs", ko_optional_argument, 316 }, { "cs", ko_optional_argument, 316 },
{ "end-bonus", ko_required_argument, 317 }, { "end-bonus", ko_required_argument, 317 },
{ "no-pairing", ko_no_argument, 318 }, { "no-pairing", ko_no_argument, 318 }, // deprecated but reserved for backward compatibility
{ "splice-flank", ko_required_argument, 319 }, { "splice-flank", ko_required_argument, 319 },
{ "idx-no-seq", ko_no_argument, 320 }, { "idx-no-seq", ko_no_argument, 320 },
{ "end-seed-pen", ko_required_argument, 321 }, { "end-seed-pen", ko_required_argument, 321 },
@@ -60,6 +59,35 @@ static ko_longopt_t long_options[] = {
{ "split-prefix", ko_required_argument, 334 }, { "split-prefix", ko_required_argument, 334 },
{ "no-end-flt", ko_no_argument, 335 }, { "no-end-flt", ko_no_argument, 335 },
{ "hard-mask-level",ko_no_argument, 336 }, { "hard-mask-level",ko_no_argument, 336 },
{ "cap-sw-mem", ko_required_argument, 337 },
{ "max-qlen", ko_required_argument, 338 },
{ "max-chain-iter", ko_required_argument, 339 },
{ "junc-bed", ko_required_argument, 340 },
{ "junc-bonus", ko_required_argument, 341 },
{ "sam-hit-only", ko_no_argument, 342 },
{ "chain-gap-scale",ko_required_argument, 343 },
{ "alt", ko_required_argument, 344 },
{ "alt-drop", ko_required_argument, 345 },
{ "mask-len", ko_required_argument, 346 },
{ "rmq", ko_optional_argument, 347 },
{ "qstrand", ko_no_argument, 348 },
{ "cap-kalloc", ko_required_argument, 349 },
{ "q-occ-frac", ko_required_argument, 350 },
{ "chain-skip-scale",ko_required_argument,351 },
{ "print-chains", ko_no_argument, 352 },
{ "no-hash-name", ko_no_argument, 353 },
{ "secondary-seq", ko_no_argument, 354 },
{ "ds", ko_no_argument, 355 },
{ "rmq-inner", ko_required_argument, 356 },
{ "spsc", ko_required_argument, 357 },
{ "junc-pen", ko_required_argument, 358 },
{ "pairing", ko_required_argument, 359 },
{ "jump-min-match", ko_required_argument, 360 },
{ "write-junc", ko_no_argument, 361 },
{ "pass1", ko_required_argument, 362 },
{ "spsc-scale", ko_required_argument, 363 },
{ "spsc0", ko_required_argument, 364 },
{ "dbg-seed-occ", ko_no_argument, 501 },
{ "help", ko_no_argument, 'h' }, { "help", ko_no_argument, 'h' },
{ "max-intron-len", ko_required_argument, 'G' }, { "max-intron-len", ko_required_argument, 'G' },
{ "version", ko_no_argument, 'V' }, { "version", ko_no_argument, 'V' },
@@ -71,18 +99,24 @@ static ko_longopt_t long_options[] = {
{ 0, 0, 0 } { 0, 0, 0 }
}; };
static inline int64_t mm_parse_num(const char *str) static inline int64_t mm_parse_num2(const char *str, char **q)
{ {
double x; double x;
char *p; char *p;
x = strtod(str, &p); x = strtod(str, &p);
if (*p == 'G' || *p == 'g') x *= 1e9; if (*p == 'G' || *p == 'g') x *= 1e9, ++p;
else if (*p == 'M' || *p == 'm') x *= 1e6; else if (*p == 'M' || *p == 'm') x *= 1e6, ++p;
else if (*p == 'K' || *p == 'k') x *= 1e3; else if (*p == 'K' || *p == 'k') x *= 1e3, ++p;
if (q) *q = p;
return (int64_t)(x + .499); return (int64_t)(x + .499);
} }
static inline void yes_or_no(mm_mapopt_t *opt, int flag, int long_idx, const char *arg, int yes_to_set) static inline int64_t mm_parse_num(const char *str)
{
return mm_parse_num2(str, 0);
}
static inline void yes_or_no(mm_mapopt_t *opt, int64_t flag, int long_idx, const char *arg, int yes_to_set)
{ {
if (yes_to_set) { if (yes_to_set) {
if (strcmp(arg, "yes") == 0 || strcmp(arg, "y") == 0) opt->flag |= flag; if (strcmp(arg, "yes") == 0 || strcmp(arg, "y") == 0) opt->flag |= flag;
@@ -97,12 +131,13 @@ static inline void yes_or_no(mm_mapopt_t *opt, int flag, int long_idx, const cha
int main(int argc, char *argv[]) int main(int argc, char *argv[])
{ {
const char *opt_str = "2aSDw:k:K:t:r:f:Vv:g:G:I:d:XT:s:x:Hcp:M:n:z:A:B:O:E:m:N:Qu:R:hF:LC:yYP"; const char *opt_str = "2aSDw:k:K:t:r:f:Vv:g:G:I:d:XT:s:x:Hcp:M:n:z:A:B:b:O:E:m:N:Qu:R:hF:LC:yYPo:e:U:J:j:";
ketopt_t o = KETOPT_INIT; ketopt_t o = KETOPT_INIT;
mm_mapopt_t opt; mm_mapopt_t opt;
mm_idxopt_t ipt; mm_idxopt_t ipt;
int i, c, n_threads = 3, n_parts, old_best_n = -1; int i, c, n_threads = 3, n_parts, old_best_n = -1;
char *fnw = 0, *rg = 0, *s; float spsc_scale = 0.7f;
char *fnw = 0, *rg = 0, *fn_bed_junc = 0, *fn_bed_jump = 0, *fn_bed_pass1 = 0, *fn_spsc = 0, *s, *alt_list = 0;
FILE *fp_help = stderr; FILE *fp_help = stderr;
mm_idx_reader_t *idx_rdr; mm_idx_reader_t *idx_rdr;
mm_idx_t *mi; mm_idx_t *mi;
@@ -122,7 +157,7 @@ int main(int argc, char *argv[])
fprintf(stderr, "[ERROR] missing option argument\n"); fprintf(stderr, "[ERROR] missing option argument\n");
return 1; return 1;
} else if (c == '?') { } else if (c == '?') {
fprintf(stderr, "[ERROR] unknown option in \"%s\"\n", argv[o.i]); fprintf(stderr, "[ERROR] unknown option in \"%s\"\n", argv[o.i - 1]);
return 1; return 1;
} }
} }
@@ -133,7 +168,6 @@ int main(int argc, char *argv[])
else if (c == 'k') ipt.k = atoi(o.arg); else if (c == 'k') ipt.k = atoi(o.arg);
else if (c == 'H') ipt.flag |= MM_I_HPC; else if (c == 'H') ipt.flag |= MM_I_HPC;
else if (c == 'd') fnw = o.arg; // the above are indexing related options, except -I else if (c == 'd') fnw = o.arg; // the above are indexing related options, except -I
else if (c == 'r') opt.bw = (int)mm_parse_num(o.arg);
else if (c == 't') n_threads = atoi(o.arg); else if (c == 't') n_threads = atoi(o.arg);
else if (c == 'v') mm_verbose = atoi(o.arg); else if (c == 'v') mm_verbose = atoi(o.arg);
else if (c == 'g') opt.max_gap = (int)mm_parse_num(o.arg); else if (c == 'g') opt.max_gap = (int)mm_parse_num(o.arg);
@@ -156,26 +190,42 @@ int main(int argc, char *argv[])
else if (c == 'm') opt.min_chain_score = atoi(o.arg); else if (c == 'm') opt.min_chain_score = atoi(o.arg);
else if (c == 'A') opt.a = atoi(o.arg); else if (c == 'A') opt.a = atoi(o.arg);
else if (c == 'B') opt.b = atoi(o.arg); else if (c == 'B') opt.b = atoi(o.arg);
else if (c == 'b') opt.transition = atoi(o.arg);
else if (c == 's') opt.min_dp_max = atoi(o.arg); else if (c == 's') opt.min_dp_max = atoi(o.arg);
else if (c == 'C') opt.noncan = atoi(o.arg); else if (c == 'C') opt.noncan = atoi(o.arg);
else if (c == 'I') ipt.batch_size = mm_parse_num(o.arg); else if (c == 'I') ipt.batch_size = mm_parse_num(o.arg);
else if (c == 'K') opt.mini_batch_size = (int)mm_parse_num(o.arg); else if (c == 'K') opt.mini_batch_size = mm_parse_num(o.arg);
else if (c == 'e') opt.occ_dist = mm_parse_num(o.arg);
else if (c == 'R') rg = o.arg; else if (c == 'R') rg = o.arg;
else if (c == 'h') fp_help = stdout; else if (c == 'h') fp_help = stdout;
else if (c == '2') opt.flag |= MM_F_2_IO_THREADS; else if (c == '2') opt.flag |= MM_F_2_IO_THREADS;
else if (c == 'j') fn_bed_jump = o.arg;
else if (c == 'J') {
int t;
t = atoi(o.arg);
if (t == 0) opt.flag |= MM_F_SPLICE_OLD;
else if (t == 1) opt.flag &= ~MM_F_SPLICE_OLD;
} else if (c == 'o') {
if (strcmp(o.arg, "-") != 0) {
if (freopen(o.arg, "wb", stdout) == NULL) {
fprintf(stderr, "[ERROR]\033[1;31m failed to write the output to file '%s'\033[0m: %s\n", o.arg, strerror(errno));
exit(1);
}
}
}
else if (c == 300) ipt.bucket_bits = atoi(o.arg); // --bucket-bits else if (c == 300) ipt.bucket_bits = atoi(o.arg); // --bucket-bits
else if (c == 302) opt.seed = atoi(o.arg); // --seed else if (c == 302) opt.seed = atoi(o.arg); // --seed
else if (c == 303) mm_dbg_flag |= MM_DBG_NO_KALLOC; // --no-kalloc else if (c == 303) mm_dbg_flag |= MM_DBG_NO_KALLOC; // --no-kalloc
else if (c == 304) mm_dbg_flag |= MM_DBG_PRINT_QNAME; // --print-qname else if (c == 304) mm_dbg_flag |= MM_DBG_PRINT_QNAME; // --print-qname
else if (c == 306) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_SEED, n_threads = 1; // --print-seed else if (c == 306) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_SEED, n_threads = 1; // --print-seed
else if (c == 307) opt.max_chain_skip = atoi(o.arg); // --max-chain-skip else if (c == 307) opt.max_chain_skip = atoi(o.arg); // --max-chain-skip
else if (c == 339) opt.max_chain_iter = atoi(o.arg); // --max-chain-iter
else if (c == 308) opt.min_ksw_len = atoi(o.arg); // --min-dp-len else if (c == 308) opt.min_ksw_len = atoi(o.arg); // --min-dp-len
else if (c == 309) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_ALN_SEQ, n_threads = 1; // --print-aln-seq else if (c == 309) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_ALN_SEQ, n_threads = 1; // --print-aln-seq
else if (c == 310) opt.flag |= MM_F_SPLICE; // --splice else if (c == 310) opt.flag |= MM_F_SPLICE; // --splice
else if (c == 312) opt.flag |= MM_F_NO_LJOIN; // --no-long-join else if (c == 312) opt.flag |= MM_F_NO_LJOIN; // --no-long-join
else if (c == 313) opt.flag |= MM_F_SR; // --sr
else if (c == 317) opt.end_bonus = atoi(o.arg); // --end-bonus else if (c == 317) opt.end_bonus = atoi(o.arg); // --end-bonus
else if (c == 318) opt.flag |= MM_F_INDEPEND_SEG; // --no-pairing else if (c == 318) opt.flag |= MM_F_INDEPEND_SEG; // --no-pairing (deprecated)
else if (c == 320) ipt.flag |= MM_I_NO_SEQ; // --idx-no-seq else if (c == 320) ipt.flag |= MM_I_NO_SEQ; // --idx-no-seq
else if (c == 321) opt.anchor_ext_shift = atoi(o.arg); // --end-seed-pen else if (c == 321) opt.anchor_ext_shift = atoi(o.arg); // --end-seed-pen
else if (c == 322) opt.flag |= MM_F_FOR_ONLY; // --for-only else if (c == 322) opt.flag |= MM_F_FOR_ONLY; // --for-only
@@ -183,14 +233,51 @@ int main(int argc, char *argv[])
else if (c == 327) opt.max_clip_ratio = atof(o.arg); // --max-clip-ratio else if (c == 327) opt.max_clip_ratio = atof(o.arg); // --max-clip-ratio
else if (c == 328) opt.min_mid_occ = atoi(o.arg); // --min-occ-floor else if (c == 328) opt.min_mid_occ = atoi(o.arg); // --min-occ-floor
else if (c == 329) opt.flag |= MM_F_OUT_MD; // --MD else if (c == 329) opt.flag |= MM_F_OUT_MD; // --MD
else if (c == 330) opt.min_join_flank_ratio = atof(o.arg); // --lj-min-ratio
else if (c == 331) opt.sc_ambi = atoi(o.arg); // --score-N else if (c == 331) opt.sc_ambi = atoi(o.arg); // --score-N
else if (c == 332) opt.flag |= MM_F_EQX; // --eqx else if (c == 332) opt.flag |= MM_F_EQX; // --eqx
else if (c == 333) opt.flag |= MM_F_PAF_NO_HIT; // --paf-no-hit else if (c == 333) opt.flag |= MM_F_PAF_NO_HIT; // --paf-no-hit
else if (c == 334) opt.split_prefix = o.arg; // --split-prefix else if (c == 334) opt.split_prefix = o.arg; // --split-prefix
else if (c == 335) opt.flag |= MM_F_NO_END_FLT; // --no-end-flt else if (c == 335) opt.flag |= MM_F_NO_END_FLT; // --no-end-flt
else if (c == 336) opt.flag |= MM_F_HARD_MLEVEL; // --hard-mask-level else if (c == 336) opt.flag |= MM_F_HARD_MLEVEL; // --hard-mask-level
else if (c == 314) { // --frag else if (c == 337) opt.max_sw_mat = mm_parse_num(o.arg); // --cap-sw-mat
else if (c == 338) opt.max_qlen = mm_parse_num(o.arg); // --max-qlen
else if (c == 340) fn_bed_junc = o.arg; // --junc-bed
else if (c == 341) opt.junc_bonus = atoi(o.arg); // --junc-bonus
else if (c == 342) opt.flag |= MM_F_SAM_HIT_ONLY; // --sam-hit-only
else if (c == 343) opt.chain_gap_scale = atof(o.arg); // --chain-gap-scale
else if (c == 351) opt.chain_skip_scale = atof(o.arg); // --chain-skip-scale
else if (c == 344) alt_list = o.arg; // --alt
else if (c == 345) opt.alt_drop = atof(o.arg); // --alt-drop
else if (c == 346) opt.mask_len = mm_parse_num(o.arg); // --mask-len
else if (c == 348) opt.flag |= MM_F_QSTRAND | MM_F_NO_INV; // --qstrand
else if (c == 349) opt.cap_kalloc = mm_parse_num(o.arg); // --cap-kalloc
else if (c == 350) opt.q_occ_frac = atof(o.arg); // --q-occ-frac
else if (c == 352) mm_dbg_flag |= MM_DBG_PRINT_CHAIN; // --print-chains
else if (c == 353) opt.flag |= MM_F_NO_HASH_NAME; // --no-hash-name
else if (c == 354) opt.flag |= MM_F_SECONDARY_SEQ; // --secondary-seq
else if (c == 355) opt.flag |= MM_F_OUT_DS; // --ds
else if (c == 356) opt.rmq_inner_dist = mm_parse_num(o.arg); // --rmq-inner
else if (c == 357) fn_spsc = o.arg; // --spsc
else if (c == 360) opt.jump_min_match = mm_parse_num(o.arg); // --jump-min-match
else if (c == 361) opt.flag |= MM_F_OUT_JUNC | MM_F_CIGAR; // --write-junc
else if (c == 362) fn_bed_pass1 = o.arg; // --jump-pass1
else if (c == 501) mm_dbg_flag |= MM_DBG_SEED_FREQ; // --dbg-seed-occ
else if (c == 363) spsc_scale = atof(o.arg); // --spsc-scale
else if (c == 358 || c == 364) opt.junc_pen = atoi(o.arg); // --junc-pen or --spsc0
else if (c == 330) {
fprintf(stderr, "[WARNING] \033[1;31m --lj-min-ratio has been deprecated.\033[0m\n");
} else if (c == 313) { // --sr
if (o.arg == 0 || strcmp(o.arg, "dna") == 0) {
opt.flag |= MM_F_SR;
} else if (strcmp(o.arg, "rna") == 0) {
opt.flag |= MM_F_SR_RNA;
} else if (strcmp(o.arg, "no") == 0) {
opt.flag &= ~(uint64_t)(MM_F_SR|MM_F_SR_RNA);
} else if (mm_verbose >= 2) {
opt.flag |= MM_F_SR;
fprintf(stderr, "[WARNING]\033[1;31m --sr only takes 'dna' or 'rna'. Invalid values are assumed to be 'dna'.\033[0m\n");
}
} else if (c == 314) { // --frag
yes_or_no(&opt, MM_F_FRAG_MODE, o.longidx, o.arg, 1); yes_or_no(&opt, MM_F_FRAG_MODE, o.longidx, o.arg, 1);
} else if (c == 315) { // --secondary } else if (c == 315) { // --secondary
yes_or_no(&opt, MM_F_NO_PRINT_2ND, o.longidx, o.arg, 0); yes_or_no(&opt, MM_F_NO_PRINT_2ND, o.longidx, o.arg, 0);
@@ -211,6 +298,17 @@ int main(int argc, char *argv[])
yes_or_no(&opt, MM_F_HEAP_SORT, o.longidx, o.arg, 1); yes_or_no(&opt, MM_F_HEAP_SORT, o.longidx, o.arg, 1);
} else if (c == 326) { // --dual } else if (c == 326) { // --dual
yes_or_no(&opt, MM_F_NO_DUAL, o.longidx, o.arg, 0); yes_or_no(&opt, MM_F_NO_DUAL, o.longidx, o.arg, 0);
} else if (c == 347) { // --rmq
if (o.arg) yes_or_no(&opt, MM_F_RMQ, o.longidx, o.arg, 1);
else opt.flag |= MM_F_RMQ;
} else if (c == 359) { // --pairing
if (strcmp(o.arg, "no") == 0) opt.flag |= MM_F_INDEPEND_SEG;
else if (strcmp(o.arg, "weak") == 0) opt.flag |= MM_F_WEAK_PAIRING, opt.flag &= ~(uint64_t)MM_F_INDEPEND_SEG;
else {
if (strcmp(o.arg, "strong") != 0 && mm_verbose >= 2)
fprintf(stderr, "[WARNING]\033[1;31m unrecognized argument for --pairing; assuming 'strong'.\033[0m\n");
opt.flag &= ~(uint64_t)(MM_F_INDEPEND_SEG|MM_F_WEAK_PAIRING);
}
} else if (c == 'S') { } else if (c == 'S') {
opt.flag |= MM_F_OUT_CS | MM_F_CIGAR | MM_F_OUT_CS_LONG; opt.flag |= MM_F_OUT_CS | MM_F_CIGAR | MM_F_OUT_CS_LONG;
if (mm_verbose >= 2) if (mm_verbose >= 2)
@@ -218,6 +316,12 @@ int main(int argc, char *argv[])
} else if (c == 'V') { } else if (c == 'V') {
puts(MM_VERSION); puts(MM_VERSION);
return 0; return 0;
} else if (c == 'r') {
opt.bw = (int)mm_parse_num2(o.arg, &s);
if (*s == ',') opt.bw_long = (int)mm_parse_num2(s + 1, &s);
} else if (c == 'U') {
opt.min_mid_occ = strtol(o.arg, &s, 10);
if (*s == ',') opt.max_mid_occ = strtol(s + 1, &s, 10);
} else if (c == 'f') { } else if (c == 'f') {
double x; double x;
char *p; char *p;
@@ -245,10 +349,6 @@ int main(int argc, char *argv[])
if (*s == ',') opt.e2 = strtol(s + 1, &s, 10); if (*s == ',') opt.e2 = strtol(s + 1, &s, 10);
} }
} }
if ((opt.flag & MM_F_SPLICE) && (opt.flag & MM_F_FRAG_MODE)) {
fprintf(stderr, "[ERROR]\033[1;31m --splice and --frag should not be specified at the same time.\033[0m\n");
return 1;
}
if (!fnw && !(opt.flag&MM_F_CIGAR)) if (!fnw && !(opt.flag&MM_F_CIGAR))
ipt.flag |= MM_I_NO_SEQ; ipt.flag |= MM_I_NO_SEQ;
if (mm_check_opt(&ipt, &opt) < 0) if (mm_check_opt(&ipt, &opt) < 0)
@@ -264,15 +364,15 @@ int main(int argc, char *argv[])
fprintf(fp_help, " Indexing:\n"); fprintf(fp_help, " Indexing:\n");
fprintf(fp_help, " -H use homopolymer-compressed k-mer (preferrable for PacBio)\n"); fprintf(fp_help, " -H use homopolymer-compressed k-mer (preferrable for PacBio)\n");
fprintf(fp_help, " -k INT k-mer size (no larger than 28) [%d]\n", ipt.k); fprintf(fp_help, " -k INT k-mer size (no larger than 28) [%d]\n", ipt.k);
fprintf(fp_help, " -w INT minizer window size [%d]\n", ipt.w); fprintf(fp_help, " -w INT minimizer window size [%d]\n", ipt.w);
fprintf(fp_help, " -I NUM split index for every ~NUM input bases [4G]\n"); fprintf(fp_help, " -I NUM split index for every ~NUM input bases [8G]\n");
fprintf(fp_help, " -d FILE dump index to FILE []\n"); fprintf(fp_help, " -d FILE dump index to FILE []\n");
fprintf(fp_help, " Mapping:\n"); fprintf(fp_help, " Mapping:\n");
fprintf(fp_help, " -f FLOAT filter out top FLOAT fraction of repetitive minimizers [%g]\n", opt.mid_occ_frac); fprintf(fp_help, " -f FLOAT filter out top FLOAT fraction of repetitive minimizers [%g]\n", opt.mid_occ_frac);
fprintf(fp_help, " -g NUM stop chain enlongation if there are no minimizers in INT-bp [%d]\n", opt.max_gap); fprintf(fp_help, " -g NUM stop chain enlongation if there are no minimizers in INT-bp [%d]\n", opt.max_gap);
fprintf(fp_help, " -G NUM max intron length (effective with -xsplice; changing -r) [200k]\n"); fprintf(fp_help, " -G NUM max intron length (effective with -xsplice; changing -r) [200k]\n");
fprintf(fp_help, " -F NUM max fragment length (effective with -xsr or in the fragment mode) [800]\n"); fprintf(fp_help, " -F NUM max fragment length (effective with -xsr or in the fragment mode) [800]\n");
fprintf(fp_help, " -r NUM bandwidth used in chaining and DP-based alignment [%d]\n", opt.bw); fprintf(fp_help, " -r NUM[,NUM] chaining/alignment bandwidth and long-join bandwidth [%d,%d]\n", opt.bw, opt.bw_long);
fprintf(fp_help, " -n INT minimal number of minimizers on a chain [%d]\n", opt.min_cnt); fprintf(fp_help, " -n INT minimal number of minimizers on a chain [%d]\n", opt.min_cnt);
fprintf(fp_help, " -m INT minimal chaining score (matching bases minus log gap penalty) [%d]\n", opt.min_chain_score); fprintf(fp_help, " -m INT minimal chaining score (matching bases minus log gap penalty) [%d]\n", opt.min_chain_score);
// fprintf(fp_help, " -T INT SDUST threshold; 0 to disable SDUST [%d]\n", opt.sdust_thres); // TODO: this option is never used; might be buggy // fprintf(fp_help, " -T INT SDUST threshold; 0 to disable SDUST [%d]\n", opt.sdust_thres); // TODO: this option is never used; might be buggy
@@ -281,33 +381,39 @@ int main(int argc, char *argv[])
fprintf(fp_help, " -N INT retain at most INT secondary alignments [%d]\n", opt.best_n); fprintf(fp_help, " -N INT retain at most INT secondary alignments [%d]\n", opt.best_n);
fprintf(fp_help, " Alignment:\n"); fprintf(fp_help, " Alignment:\n");
fprintf(fp_help, " -A INT matching score [%d]\n", opt.a); fprintf(fp_help, " -A INT matching score [%d]\n", opt.a);
fprintf(fp_help, " -B INT mismatch penalty [%d]\n", opt.b); fprintf(fp_help, " -B INT mismatch penalty (larger value for lower divergence) [%d]\n", opt.b);
fprintf(fp_help, " -O INT[,INT] gap open penalty [%d,%d]\n", opt.q, opt.q2); fprintf(fp_help, " -O INT[,INT] gap open penalty [%d,%d]\n", opt.q, opt.q2);
fprintf(fp_help, " -E INT[,INT] gap extension penalty; a k-long gap costs min{O1+k*E1,O2+k*E2} [%d,%d]\n", opt.e, opt.e2); fprintf(fp_help, " -E INT[,INT] gap extension penalty; a k-long gap costs min{O1+k*E1,O2+k*E2} [%d,%d]\n", opt.e, opt.e2);
fprintf(fp_help, " -z INT[,INT] Z-drop score and inversion Z-drop score [%d,%d]\n", opt.zdrop, opt.zdrop_inv); fprintf(fp_help, " -z INT[,INT] Z-drop score and inversion Z-drop score [%d,%d]\n", opt.zdrop, opt.zdrop_inv);
fprintf(fp_help, " -s INT minimal peak DP alignment score [%d]\n", opt.min_dp_max); fprintf(fp_help, " -s INT minimal peak DP alignment score [%d]\n", opt.min_dp_max);
fprintf(fp_help, " -u CHAR how to find GT-AG. f:transcript strand, b:both strands, n:don't match GT-AG [n]\n"); fprintf(fp_help, " -u CHAR how to find GT-AG. f:transcript strand, b:both strands, n:don't match GT-AG [n]\n");
fprintf(fp_help, " -J INT splice mode. 0: original minimap2 model; 1: miniprot model [1]\n");
fprintf(fp_help, " -j FILE junctions in BED12 to extend *short* RNA-seq alignment []\n");
fprintf(fp_help, " Input/Output:\n"); fprintf(fp_help, " Input/Output:\n");
fprintf(fp_help, " -a output in the SAM format (PAF by default)\n"); fprintf(fp_help, " -a output in the SAM format (PAF by default)\n");
fprintf(fp_help, " -Q don't output base quality in SAM\n"); fprintf(fp_help, " -o FILE output alignments to FILE [stdout]\n");
fprintf(fp_help, " -L write CIGAR with >65535 ops at the CG tag\n"); fprintf(fp_help, " -L write CIGAR with >65535 ops at the CG tag\n");
fprintf(fp_help, " -R STR SAM read group line in a format like '@RG\\tID:foo\\tSM:bar' []\n"); fprintf(fp_help, " -R STR SAM read group line in a format like '@RG\\tID:foo\\tSM:bar' []\n");
fprintf(fp_help, " -c output CIGAR in PAF\n"); fprintf(fp_help, " -c output CIGAR in PAF\n");
fprintf(fp_help, " --cs[=STR] output the cs tag; STR is 'short' (if absent) or 'long' [none]\n"); fprintf(fp_help, " --cs[=STR] output the cs tag; STR is 'short' (if absent) or 'long' [none]\n");
fprintf(fp_help, " --ds output the ds tag, which is an extension to cs\n");
fprintf(fp_help, " --MD output the MD tag\n"); fprintf(fp_help, " --MD output the MD tag\n");
fprintf(fp_help, " --eqx write =/X CIGAR operators\n"); fprintf(fp_help, " --eqx write =/X CIGAR operators\n");
fprintf(fp_help, " -Y use soft clipping for supplementary alignments\n"); fprintf(fp_help, " -Y use soft clipping for supplementary alignments\n");
fprintf(fp_help, " -y copy FASTA/Q comments to output SAM\n");
fprintf(fp_help, " -t INT number of threads [%d]\n", n_threads); fprintf(fp_help, " -t INT number of threads [%d]\n", n_threads);
fprintf(fp_help, " -K NUM minibatch size for mapping [500M]\n"); fprintf(fp_help, " -K NUM minibatch size for mapping [500M]\n");
// fprintf(fp_help, " -v INT verbose level [%d]\n", mm_verbose); // fprintf(fp_help, " -v INT verbose level [%d]\n", mm_verbose);
fprintf(fp_help, " --version show version number\n"); fprintf(fp_help, " --version show version number\n");
fprintf(fp_help, " Preset:\n"); fprintf(fp_help, " Preset:\n");
fprintf(fp_help, " -x STR preset (always applied before other options; see minimap2.1 for details) []\n"); fprintf(fp_help, " -x STR preset (always applied before other options; see minimap2.1 for details) []\n");
fprintf(fp_help, " - map-pb/map-ont: PacBio/Nanopore vs reference mapping\n"); fprintf(fp_help, " - lr:hq - accurate long reads (error rate <1%%) against a reference genome\n");
fprintf(fp_help, " - ava-pb/ava-ont: PacBio/Nanopore read overlap\n"); fprintf(fp_help, " - splice/splice:hq - spliced alignment for long reads/accurate long reads\n");
fprintf(fp_help, " - asm5/asm10/asm20: asm-to-ref mapping, for ~0.1/1/5%% sequence divergence\n"); fprintf(fp_help, " - splice:sr - spliced alignment for short RNA-seq reads\n");
fprintf(fp_help, " - splice: long-read spliced alignment\n"); fprintf(fp_help, " - asm5/asm10/asm20 - asm-to-ref mapping, for ~0.1/1/5%% sequence divergence\n");
fprintf(fp_help, " - sr: genomic short-read mapping\n"); fprintf(fp_help, " - sr - short reads against a reference\n");
fprintf(fp_help, " - map-pb/map-hifi/map-ont/map-iclr - CLR/HiFi/Nanopore/ICLR vs reference mapping\n");
fprintf(fp_help, " - ava-pb/ava-ont - PacBio CLR/Nanopore read overlap\n");
fprintf(fp_help, "\nSee `man ./minimap2.1' for detailed description of these and other advanced command-line options.\n"); fprintf(fp_help, "\nSee `man ./minimap2.1' for detailed description of these and other advanced command-line options.\n");
return fp_help == stdout? 0 : 1; return fp_help == stdout? 0 : 1;
} }
@@ -318,7 +424,7 @@ int main(int argc, char *argv[])
} }
idx_rdr = mm_idx_reader_open(argv[o.ind], &ipt, fnw); idx_rdr = mm_idx_reader_open(argv[o.ind], &ipt, fnw);
if (idx_rdr == 0) { if (idx_rdr == 0) {
fprintf(stderr, "[ERROR] failed to open file '%s'\n", argv[o.ind]); fprintf(stderr, "[ERROR] failed to open file '%s': %s\n", argv[o.ind], strerror(errno));
return 1; return 1;
} }
if (!idx_rdr->is_idx && fnw == 0 && argc - o.ind < 2) { if (!idx_rdr->is_idx && fnw == 0 && argc - o.ind < 2) {
@@ -329,6 +435,7 @@ int main(int argc, char *argv[])
if (opt.best_n == 0 && (opt.flag&MM_F_CIGAR) && mm_verbose >= 2) if (opt.best_n == 0 && (opt.flag&MM_F_CIGAR) && mm_verbose >= 2)
fprintf(stderr, "[WARNING]\033[1;31m `-N 0' reduces alignment accuracy. Please use --secondary=no to suppress secondary alignments.\033[0m\n"); fprintf(stderr, "[WARNING]\033[1;31m `-N 0' reduces alignment accuracy. Please use --secondary=no to suppress secondary alignments.\033[0m\n");
while ((mi = mm_idx_reader_read(idx_rdr, n_threads)) != 0) { while ((mi = mm_idx_reader_read(idx_rdr, n_threads)) != 0) {
int ret;
if ((opt.flag & MM_F_CIGAR) && (mi->flag & MM_I_NO_SEQ)) { if ((opt.flag & MM_F_CIGAR) && (mi->flag & MM_I_NO_SEQ)) {
fprintf(stderr, "[ERROR] the prebuilt index doesn't contain sequences.\n"); fprintf(stderr, "[ERROR] the prebuilt index doesn't contain sequences.\n");
mm_idx_destroy(mi); mm_idx_destroy(mi);
@@ -337,25 +444,65 @@ int main(int argc, char *argv[])
} }
if ((opt.flag & MM_F_OUT_SAM) && idx_rdr->n_parts == 1) { if ((opt.flag & MM_F_OUT_SAM) && idx_rdr->n_parts == 1) {
if (mm_idx_reader_eof(idx_rdr)) { if (mm_idx_reader_eof(idx_rdr)) {
mm_write_sam_hdr(mi, rg, MM_VERSION, argc, argv); if (opt.split_prefix == 0)
ret = mm_write_sam_hdr(mi, rg, MM_VERSION, argc, argv);
else
ret = mm_write_sam_hdr(0, rg, MM_VERSION, argc, argv);
} else { } else {
mm_write_sam_hdr(0, rg, MM_VERSION, argc, argv); ret = mm_write_sam_hdr(0, rg, MM_VERSION, argc, argv);
if (opt.split_prefix == 0 && mm_verbose >= 2) if (opt.split_prefix == 0 && mm_verbose >= 2)
fprintf(stderr, "[WARNING]\033[1;31m For a multi-part index, no @SQ lines will be outputted. Please use --split-prefix.\033[0m\n"); fprintf(stderr, "[WARNING]\033[1;31m For a multi-part index, no @SQ lines will be outputted. Please use --split-prefix.\033[0m\n");
} }
if (ret != 0) {
mm_idx_destroy(mi);
mm_idx_reader_close(idx_rdr);
return 1;
}
} }
if (mm_verbose >= 3) if (mm_verbose >= 3)
fprintf(stderr, "[M::%s::%.3f*%.2f] loaded/built the index for %d target sequence(s)\n", fprintf(stderr, "[M::%s::%.3f*%.2f] loaded/built the index for %d target sequence(s)\n",
__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), mi->n_seq); __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), mi->n_seq);
if (argc != o.ind + 1) mm_mapopt_update(&opt, mi); if (argc != o.ind + 1) mm_mapopt_update(&opt, mi);
if (mm_verbose >= 3) mm_idx_stat(mi); if (mm_verbose >= 3) mm_idx_stat(mi);
if (fn_bed_junc) {
mm_idx_bed_read(mi, fn_bed_junc, 1);
if (mi->I == 0 && mm_verbose >= 2)
fprintf(stderr, "[WARNING] failed to load the junction BED file\n");
}
if (fn_bed_jump) {
mm_idx_jjump_read(mi, fn_bed_jump, MM_JUNC_ANNO, -1);
if (mi->J == 0 && mm_verbose >= 2)
fprintf(stderr, "[WARNING] failed to load the jump BED file\n");
}
if (fn_bed_pass1) {
mm_idx_jjump_read(mi, fn_bed_pass1, MM_JUNC_MISC, 5);
if (mi->J == 0 && mm_verbose >= 2)
fprintf(stderr, "[WARNING] failed to load the pass-1 jump BED file\n");
}
if (fn_spsc) {
mm_idx_spsc_read2(mi, fn_spsc, mm_max_spsc_bonus(&opt), spsc_scale);
if (mi->spsc == 0 && mm_verbose >= 2)
fprintf(stderr, "[WARNING] failed to load the splice score file\n");
}
if (alt_list) mm_idx_alt_read(mi, alt_list);
if (argc - (o.ind + 1) == 0) {
mm_idx_destroy(mi);
continue; // no query files
}
ret = 0;
if (!(opt.flag & MM_F_FRAG_MODE)) { if (!(opt.flag & MM_F_FRAG_MODE)) {
for (i = o.ind + 1; i < argc; ++i) for (i = o.ind + 1; i < argc; ++i) {
mm_map_file(mi, argv[i], &opt, n_threads); ret = mm_map_file(mi, argv[i], &opt, n_threads);
if (ret < 0) break;
}
} else { } else {
mm_map_file_frag(mi, argc - (o.ind + 1), (const char**)&argv[o.ind + 1], &opt, n_threads); ret = mm_map_file_frag(mi, argc - (o.ind + 1), (const char**)&argv[o.ind + 1], &opt, n_threads);
} }
mm_idx_destroy(mi); mm_idx_destroy(mi);
if (ret < 0) {
fprintf(stderr, "ERROR: failed to map the query file\n");
exit(EXIT_FAILURE);
}
} }
n_parts = idx_rdr->n_parts; n_parts = idx_rdr->n_parts;
mm_idx_reader_close(idx_rdr); mm_idx_reader_close(idx_rdr);
@@ -364,7 +511,7 @@ int main(int argc, char *argv[])
mm_split_merge(argc - (o.ind + 1), (const char**)&argv[o.ind + 1], &opt, n_parts); mm_split_merge(argc - (o.ind + 1), (const char**)&argv[o.ind + 1], &opt, n_parts);
if (fflush(stdout) == EOF) { if (fflush(stdout) == EOF) {
fprintf(stderr, "[ERROR] failed to write the results\n"); perror("[ERROR] failed to write the results");
exit(EXIT_FAILURE); exit(EXIT_FAILURE);
} }
+116 -87
View File
@@ -1,6 +1,7 @@
#include <stdlib.h> #include <stdlib.h>
#include <string.h> #include <string.h>
#include <assert.h> #include <assert.h>
#include <errno.h>
#include "kthread.h" #include "kthread.h"
#include "kvec.h" #include "kvec.h"
#include "kalloc.h" #include "kalloc.h"
@@ -9,11 +10,6 @@
#include "bseq.h" #include "bseq.h"
#include "khash.h" #include "khash.h"
struct mm_tbuf_s {
void *km;
int rep_len, frag_gap;
};
mm_tbuf_t *mm_tbuf_init(void) mm_tbuf_t *mm_tbuf_init(void)
{ {
mm_tbuf_t *b; mm_tbuf_t *b;
@@ -79,49 +75,7 @@ static void collect_minimizers(void *km, const mm_mapopt_t *opt, const mm_idx_t
#define heap_lt(a, b) ((a).x > (b).x) #define heap_lt(a, b) ((a).x > (b).x)
KSORT_INIT(heap, mm128_t, heap_lt) KSORT_INIT(heap, mm128_t, heap_lt)
typedef struct { static inline int skip_seed(int flag, uint64_t r, const mm_seed_t *q, const char *qname, int qlen, const mm_idx_t *mi, int *is_self)
uint32_t n;
uint32_t q_pos, q_span;
uint32_t seg_id:31, is_tandem:1;
const uint64_t *cr;
} mm_match_t;
static mm_match_t *collect_matches(void *km, int *_n_m, int max_occ, const mm_idx_t *mi, const mm128_v *mv, int64_t *n_a, int *rep_len, int *n_mini_pos, uint64_t **mini_pos)
{
int rep_st = 0, rep_en = 0, n_m;
size_t i;
mm_match_t *m;
*n_mini_pos = 0;
*mini_pos = (uint64_t*)kmalloc(km, mv->n * sizeof(uint64_t));
m = (mm_match_t*)kmalloc(km, mv->n * sizeof(mm_match_t));
for (i = 0, n_m = 0, *rep_len = 0, *n_a = 0; i < mv->n; ++i) {
const uint64_t *cr;
mm128_t *p = &mv->a[i];
uint32_t q_pos = (uint32_t)p->y, q_span = p->x & 0xff;
int t;
cr = mm_idx_get(mi, p->x>>8, &t);
if (t >= max_occ) {
int en = (q_pos >> 1) + 1, st = en - q_span;
if (st > rep_en) {
*rep_len += rep_en - rep_st;
rep_st = st, rep_en = en;
} else rep_en = en;
} else {
mm_match_t *q = &m[n_m++];
q->q_pos = q_pos, q->q_span = q_span, q->cr = cr, q->n = t, q->seg_id = p->y >> 32;
q->is_tandem = 0;
if (i > 0 && p->x>>8 == mv->a[i - 1].x>>8) q->is_tandem = 1;
if (i < mv->n - 1 && p->x>>8 == mv->a[i + 1].x>>8) q->is_tandem = 1;
*n_a += q->n;
(*mini_pos)[(*n_mini_pos)++] = (uint64_t)q_span<<32 | q_pos>>1;
}
}
*rep_len += rep_en - rep_st;
*_n_m = n_m;
return m;
}
static inline int skip_seed(int flag, uint64_t r, const mm_match_t *q, const char *qname, int qlen, const mm_idx_t *mi, int *is_self)
{ {
*is_self = 0; *is_self = 0;
if (qname && (flag & (MM_F_NO_DIAG|MM_F_NO_DUAL))) { if (qname && (flag & (MM_F_NO_DIAG|MM_F_NO_DUAL))) {
@@ -150,10 +104,10 @@ static mm128_t *collect_seed_hits_heap(void *km, const mm_mapopt_t *opt, int max
{ {
int i, n_m, heap_size = 0; int i, n_m, heap_size = 0;
int64_t j, n_for = 0, n_rev = 0; int64_t j, n_for = 0, n_rev = 0;
mm_match_t *m; mm_seed_t *m;
mm128_t *a, *heap; mm128_t *a, *heap;
m = collect_matches(km, &n_m, max_occ, mi, mv, n_a, rep_len, n_mini_pos, mini_pos); m = mm_collect_matches(km, &n_m, qlen, max_occ, opt->max_max_occ, opt->occ_dist, mi, mv, n_a, rep_len, n_mini_pos, mini_pos);
heap = (mm128_t*)kmalloc(km, n_m * sizeof(mm128_t)); heap = (mm128_t*)kmalloc(km, n_m * sizeof(mm128_t));
a = (mm128_t*)kmalloc(km, *n_a * sizeof(mm128_t)); a = (mm128_t*)kmalloc(km, *n_a * sizeof(mm128_t));
@@ -167,7 +121,7 @@ static mm128_t *collect_seed_hits_heap(void *km, const mm_mapopt_t *opt, int max
} }
ks_heapmake_heap(heap_size, heap); ks_heapmake_heap(heap_size, heap);
while (heap_size > 0) { while (heap_size > 0) {
mm_match_t *q = &m[heap->y>>32]; mm_seed_t *q = &m[heap->y>>32];
mm128_t *p; mm128_t *p;
uint64_t r = heap->x; uint64_t r = heap->x;
int32_t is_self, rpos = (uint32_t)r >> 1; int32_t is_self, rpos = (uint32_t)r >> 1;
@@ -215,12 +169,12 @@ static mm128_t *collect_seed_hits(void *km, const mm_mapopt_t *opt, int max_occ,
int *n_mini_pos, uint64_t **mini_pos) int *n_mini_pos, uint64_t **mini_pos)
{ {
int i, n_m; int i, n_m;
mm_match_t *m; mm_seed_t *m;
mm128_t *a; mm128_t *a;
m = collect_matches(km, &n_m, max_occ, mi, mv, n_a, rep_len, n_mini_pos, mini_pos); m = mm_collect_matches(km, &n_m, qlen, max_occ, opt->max_max_occ, opt->occ_dist, mi, mv, n_a, rep_len, n_mini_pos, mini_pos);
a = (mm128_t*)kmalloc(km, *n_a * sizeof(mm128_t)); a = (mm128_t*)kmalloc(km, *n_a * sizeof(mm128_t));
for (i = 0, *n_a = 0; i < n_m; ++i) { for (i = 0, *n_a = 0; i < n_m; ++i) {
mm_match_t *q = &m[i]; mm_seed_t *q = &m[i];
const uint64_t *r = q->cr; const uint64_t *r = q->cr;
uint32_t k; uint32_t k;
for (k = 0; k < q->n; ++k) { for (k = 0; k < q->n; ++k) {
@@ -231,9 +185,13 @@ static mm128_t *collect_seed_hits(void *km, const mm_mapopt_t *opt, int max_occ,
if ((r[k]&1) == (q->q_pos&1)) { // forward strand if ((r[k]&1) == (q->q_pos&1)) { // forward strand
p->x = (r[k]&0xffffffff00000000ULL) | rpos; p->x = (r[k]&0xffffffff00000000ULL) | rpos;
p->y = (uint64_t)q->q_span << 32 | q->q_pos >> 1; p->y = (uint64_t)q->q_span << 32 | q->q_pos >> 1;
} else { // reverse strand } else if (!(opt->flag & MM_F_QSTRAND)) { // reverse strand and not in the query-strand mode
p->x = 1ULL<<63 | (r[k]&0xffffffff00000000ULL) | rpos; p->x = 1ULL<<63 | (r[k]&0xffffffff00000000ULL) | rpos;
p->y = (uint64_t)q->q_span << 32 | (qlen - ((q->q_pos>>1) + 1 - q->q_span) - 1); p->y = (uint64_t)q->q_span << 32 | (qlen - ((q->q_pos>>1) + 1 - q->q_span) - 1);
} else { // reverse strand; query-strand
int32_t len = mi->seq[r[k]>>32].len;
p->x = 1ULL<<63 | (r[k]&0xffffffff00000000ULL) | (len - (rpos + 1 - q->q_span) - 1); // coordinate only accurate for non-HPC seeds
p->y = (uint64_t)q->q_span << 32 | q->q_pos >> 1;
} }
p->y |= (uint64_t)q->seg_id << MM_SEED_SEG_SHIFT; p->y |= (uint64_t)q->seg_id << MM_SEED_SEG_SHIFT;
if (q->is_tandem) p->y |= MM_SEED_TANDEM; if (q->is_tandem) p->y |= MM_SEED_TANDEM;
@@ -248,11 +206,9 @@ static mm128_t *collect_seed_hits(void *km, const mm_mapopt_t *opt, int max_occ,
static void chain_post(const mm_mapopt_t *opt, int max_chain_gap_ref, const mm_idx_t *mi, void *km, int qlen, int n_segs, const int *qlens, int *n_regs, mm_reg1_t *regs, mm128_t *a) static void chain_post(const mm_mapopt_t *opt, int max_chain_gap_ref, const mm_idx_t *mi, void *km, int qlen, int n_segs, const int *qlens, int *n_regs, mm_reg1_t *regs, mm128_t *a)
{ {
if (!(opt->flag & MM_F_ALL_CHAINS)) { // don't choose primary mapping(s) if (!(opt->flag & MM_F_ALL_CHAINS)) { // don't choose primary mapping(s)
mm_set_parent(km, opt->mask_level, *n_regs, regs, opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL); mm_set_parent(km, opt->mask_level, opt->mask_len, *n_regs, regs, opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL, opt->alt_drop);
if (n_segs <= 1) mm_select_sub(km, opt->pri_ratio, mi->k*2, opt->best_n, n_regs, regs); if (n_segs <= 1) mm_select_sub(km, opt->pri_ratio, mi->k*2, opt->best_n, 1, opt->max_gap * 0.8, n_regs, regs);
else mm_select_sub_multi(km, opt->pri_ratio, 0.2f, 0.7f, max_chain_gap_ref, mi->k*2, opt->best_n, n_segs, qlens, n_regs, regs); else mm_select_sub_multi(km, opt->pri_ratio, 0.2f, 0.7f, max_chain_gap_ref, mi->k*2, opt->best_n, n_segs, qlens, n_regs, regs);
if (!(opt->flag & (MM_F_SPLICE|MM_F_SR|MM_F_NO_LJOIN))) // long join not working well without primary chains
mm_join_long(km, opt, qlen, n_regs, regs, a);
} }
} }
@@ -261,17 +217,17 @@ static mm_reg1_t *align_regs(const mm_mapopt_t *opt, const mm_idx_t *mi, void *k
if (!(opt->flag & MM_F_CIGAR)) return regs; if (!(opt->flag & MM_F_CIGAR)) return regs;
regs = mm_align_skeleton(km, opt, mi, qlen, seq, n_regs, regs, a); // this calls mm_filter_regs() regs = mm_align_skeleton(km, opt, mi, qlen, seq, n_regs, regs, a); // this calls mm_filter_regs()
if (!(opt->flag & MM_F_ALL_CHAINS)) { // don't choose primary mapping(s) if (!(opt->flag & MM_F_ALL_CHAINS)) { // don't choose primary mapping(s)
mm_set_parent(km, opt->mask_level, *n_regs, regs, opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL); mm_set_parent(km, opt->mask_level, opt->mask_len, *n_regs, regs, opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL, opt->alt_drop);
mm_select_sub(km, opt->pri_ratio, mi->k*2, opt->best_n, n_regs, regs); mm_select_sub(km, opt->pri_ratio, mi->k*2, opt->best_n, 0, opt->max_gap * 0.8, n_regs, regs);
mm_set_sam_pri(*n_regs, regs); mm_set_sam_pri(*n_regs, regs);
} }
return regs; return regs;
} }
void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, int *n_regs, mm_reg1_t **regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname) void mm_map_frag_core(const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, int *n_regs, mm_reg1_t **regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname)
{ {
int i, j, rep_len, qlen_sum, n_regs0, n_mini_pos; int i, j, rep_len, qlen_sum, n_regs0, n_mini_pos;
int max_chain_gap_qry, max_chain_gap_ref, is_splice = !!(opt->flag & MM_F_SPLICE), is_sr = !!(opt->flag & MM_F_SR); int max_chain_gap_qry, max_chain_gap_ref, is_splice = !!(opt->flag & MM_F_SPLICE), is_sr = !!(opt->flag & MM_F_SR), is_sr_rna = !!(opt->flag & MM_F_SR_RNA);
uint32_t hash; uint32_t hash;
int64_t n_a; int64_t n_a;
uint64_t *u, *mini_pos; uint64_t *u, *mini_pos;
@@ -279,17 +235,20 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
mm128_v mv = {0,0,0}; mm128_v mv = {0,0,0};
mm_reg1_t *regs0; mm_reg1_t *regs0;
km_stat_t kmst; km_stat_t kmst;
float chn_pen_gap, chn_pen_skip;
for (i = 0, qlen_sum = 0; i < n_segs; ++i) for (i = 0, qlen_sum = 0; i < n_segs; ++i)
qlen_sum += qlens[i], n_regs[i] = 0, regs[i] = 0; qlen_sum += qlens[i], n_regs[i] = 0, regs[i] = 0;
if (qlen_sum == 0 || n_segs <= 0 || n_segs > MM_MAX_SEG) return; if (qlen_sum == 0 || n_segs <= 0 || n_segs > MM_MAX_SEG) return;
if (opt->max_qlen > 0 && qlen_sum > opt->max_qlen) return;
hash = qname? __ac_X31_hash_string(qname) : 0; hash = qname && !(opt->flag & MM_F_NO_HASH_NAME)? __ac_X31_hash_string(qname) : 0;
hash ^= __ac_Wang_hash(qlen_sum) + __ac_Wang_hash(opt->seed); hash ^= __ac_Wang_hash(qlen_sum) + __ac_Wang_hash(opt->seed);
hash = __ac_Wang_hash(hash); hash = __ac_Wang_hash(hash);
collect_minimizers(b->km, opt, mi, n_segs, qlens, seqs, &mv); collect_minimizers(b->km, opt, mi, n_segs, qlens, seqs, &mv);
if (opt->q_occ_frac > 0.0f) mm_seed_mz_flt(b->km, &mv, opt->mid_occ, opt->q_occ_frac);
if (opt->flag & MM_F_HEAP_SORT) a = collect_seed_hits_heap(b->km, opt, opt->mid_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos); if (opt->flag & MM_F_HEAP_SORT) a = collect_seed_hits_heap(b->km, opt, opt->mid_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
else a = collect_seed_hits(b->km, opt, opt->mid_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos); else a = collect_seed_hits(b->km, opt, opt->mid_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
@@ -311,9 +270,27 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
if (max_chain_gap_ref < opt->max_gap) max_chain_gap_ref = opt->max_gap; if (max_chain_gap_ref < opt->max_gap) max_chain_gap_ref = opt->max_gap;
} else max_chain_gap_ref = opt->max_gap; } else max_chain_gap_ref = opt->max_gap;
a = mm_chain_dp(max_chain_gap_ref, max_chain_gap_qry, opt->bw, opt->max_chain_skip, opt->min_cnt, opt->min_chain_score, is_splice, n_segs, n_a, a, &n_regs0, &u, b->km); chn_pen_gap = opt->chain_gap_scale * 0.01 * mi->k;
chn_pen_skip = opt->chain_skip_scale * 0.01 * mi->k;
if (opt->flag & MM_F_RMQ) {
a = mg_lchain_rmq(opt->max_gap, opt->rmq_inner_dist, opt->bw, opt->max_chain_skip, opt->rmq_size_cap, opt->min_cnt, opt->min_chain_score,
chn_pen_gap, chn_pen_skip, n_a, a, &n_regs0, &u, b->km);
} else {
a = mg_lchain_dp(max_chain_gap_ref, max_chain_gap_qry, opt->bw, opt->max_chain_skip, opt->max_chain_iter, opt->min_cnt, opt->min_chain_score,
chn_pen_gap, chn_pen_skip, is_splice, n_segs, n_a, a, &n_regs0, &u, b->km);
}
if (opt->max_occ > opt->mid_occ && rep_len > 0) { if (opt->bw_long > opt->bw && (opt->flag & (MM_F_SPLICE|MM_F_SR|MM_F_NO_LJOIN)) == 0 && n_segs == 1 && n_regs0 > 1) { // re-chain/long-join for long sequences
int32_t st = (int32_t)a[0].y, en = (int32_t)a[(int32_t)u[0] - 1].y;
if (qlen_sum - (en - st) > opt->rmq_rescue_size || en - st > qlen_sum * opt->rmq_rescue_ratio) {
int32_t i;
for (i = 0, n_a = 0; i < n_regs0; ++i) n_a += (int32_t)u[i];
kfree(b->km, u);
radix_sort_128x(a, a + n_a);
a = mg_lchain_rmq(opt->max_gap, opt->rmq_inner_dist, opt->bw_long, opt->max_chain_skip, opt->rmq_size_cap, opt->min_cnt, opt->min_chain_score,
chn_pen_gap, chn_pen_skip, n_a, a, &n_regs0, &u, b->km);
}
} else if (opt->max_occ > opt->mid_occ && rep_len > 0 && !(opt->flag & MM_F_RMQ)) { // re-chain, mostly for short reads
int rechain = 0; int rechain = 0;
if (n_regs0 > 0) { // test if the best chain has all the segments if (n_regs0 > 0) { // test if the best chain has all the segments
int n_chained_segs = 1, max = 0, max_i = -1, max_off = -1, off = 0; int n_chained_segs = 1, max = 0, max_i = -1, max_off = -1, off = 0;
@@ -333,35 +310,44 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
kfree(b->km, mini_pos); kfree(b->km, mini_pos);
if (opt->flag & MM_F_HEAP_SORT) a = collect_seed_hits_heap(b->km, opt, opt->max_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos); if (opt->flag & MM_F_HEAP_SORT) a = collect_seed_hits_heap(b->km, opt, opt->max_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
else a = collect_seed_hits(b->km, opt, opt->max_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos); else a = collect_seed_hits(b->km, opt, opt->max_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
a = mm_chain_dp(max_chain_gap_ref, max_chain_gap_qry, opt->bw, opt->max_chain_skip, opt->min_cnt, opt->min_chain_score, is_splice, n_segs, n_a, a, &n_regs0, &u, b->km); a = mg_lchain_dp(max_chain_gap_ref, max_chain_gap_qry, opt->bw, opt->max_chain_skip, opt->max_chain_iter, opt->min_cnt, opt->min_chain_score,
chn_pen_gap, chn_pen_skip, is_splice, n_segs, n_a, a, &n_regs0, &u, b->km);
} }
} }
b->frag_gap = max_chain_gap_ref; b->frag_gap = max_chain_gap_ref;
b->rep_len = rep_len; b->rep_len = rep_len;
regs0 = mm_gen_regs(b->km, hash, qlen_sum, n_regs0, u, a); regs0 = mm_gen_regs(b->km, hash, qlen_sum, n_regs0, u, a, !!(opt->flag&MM_F_QSTRAND));
if (mi->n_alt) {
mm_mark_alt(mi, n_regs0, regs0);
mm_hit_sort(b->km, &n_regs0, regs0, opt->alt_drop); // this step can be merged into mm_gen_regs(); will do if this shows up in profile
}
if (mm_dbg_flag & MM_DBG_PRINT_SEED) if (mm_dbg_flag & (MM_DBG_PRINT_SEED|MM_DBG_PRINT_CHAIN))
for (j = 0; j < n_regs0; ++j) for (j = 0; j < n_regs0; ++j)
for (i = regs0[j].as; i < regs0[j].as + regs0[j].cnt; ++i) for (i = regs0[j].as; i < regs0[j].as + regs0[j].cnt; ++i)
fprintf(stderr, "CN\t%d\t%s\t%d\t%c\t%d\t%d\t%d\n", j, mi->seq[a[i].x<<1>>33].name, (int32_t)a[i].x, "+-"[a[i].x>>63], (int32_t)a[i].y, (int32_t)(a[i].y>>32&0xff), fprintf(stderr, "CN\t%d\t%s\t%d\t%c\t%d\t%d\t%d\n", j, mi->seq[a[i].x<<1>>33].name, (int32_t)a[i].x, "+-"[a[i].x>>63], (int32_t)a[i].y, (int32_t)(a[i].y>>32&0xff),
i == regs0[j].as? 0 : ((int32_t)a[i].y - (int32_t)a[i-1].y) - ((int32_t)a[i].x - (int32_t)a[i-1].x)); i == regs0[j].as? 0 : ((int32_t)a[i].y - (int32_t)a[i-1].y) - ((int32_t)a[i].x - (int32_t)a[i-1].x));
chain_post(opt, max_chain_gap_ref, mi, b->km, qlen_sum, n_segs, qlens, &n_regs0, regs0, a); chain_post(opt, max_chain_gap_ref, mi, b->km, qlen_sum, n_segs, qlens, &n_regs0, regs0, a);
if (!is_sr) mm_est_err(mi, qlen_sum, n_regs0, regs0, a, n_mini_pos, mini_pos); if (!is_sr && !(opt->flag&MM_F_QSTRAND)) {
mm_est_err(mi, qlen_sum, n_regs0, regs0, a, n_mini_pos, mini_pos);
n_regs0 = mm_filter_strand_retained(n_regs0, regs0);
}
if (n_segs == 1) { // uni-segment if (n_segs == 1) { // uni-segment
regs0 = align_regs(opt, mi, b->km, qlens[0], seqs[0], &n_regs0, regs0, a); regs0 = align_regs(opt, mi, b->km, qlens[0], seqs[0], &n_regs0, regs0, a);
mm_set_mapq(b->km, n_regs0, regs0, opt->min_chain_score, opt->a, rep_len, is_sr); regs0 = (mm_reg1_t*)realloc(regs0, sizeof(*regs0) * n_regs0);
mm_set_mapq2(b->km, n_regs0, regs0, opt->min_chain_score, opt->a, rep_len, is_sr || is_sr_rna, is_splice);
n_regs[0] = n_regs0, regs[0] = regs0; n_regs[0] = n_regs0, regs[0] = regs0;
} else { // multi-segment } else { // multi-segment
mm_seg_t *seg; mm_seg_t *seg;
seg = mm_seg_gen(b->km, hash, n_segs, qlens, n_regs0, regs0, n_regs, regs, a); // split fragment chain to separate segment chains seg = mm_seg_gen(b->km, hash, n_segs, qlens, n_regs0, regs0, n_regs, regs, a); // split fragment chain to separate segment chains
free(regs0); free(regs0);
for (i = 0; i < n_segs; ++i) { for (i = 0; i < n_segs; ++i) {
mm_set_parent(b->km, opt->mask_level, n_regs[i], regs[i], opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL); // update mm_reg1_t::parent mm_set_parent(b->km, opt->mask_level, opt->mask_len, n_regs[i], regs[i], opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL, opt->alt_drop); // update mm_reg1_t::parent
regs[i] = align_regs(opt, mi, b->km, qlens[i], seqs[i], &n_regs[i], regs[i], seg[i].a); regs[i] = align_regs(opt, mi, b->km, qlens[i], seqs[i], &n_regs[i], regs[i], seg[i].a);
mm_set_mapq(b->km, n_regs[i], regs[i], opt->min_chain_score, opt->a, rep_len, is_sr); mm_set_mapq2(b->km, n_regs[i], regs[i], opt->min_chain_score, opt->a, rep_len, is_sr || is_sr_rna, is_splice);
} }
mm_seg_free(b->km, n_segs, seg); mm_seg_free(b->km, n_segs, seg);
if (n_segs == 2 && opt->pe_ori >= 0 && (opt->flag&MM_F_CIGAR)) if (n_segs == 2 && opt->pe_ori >= 0 && (opt->flag&MM_F_CIGAR))
@@ -373,18 +359,36 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
kfree(b->km, u); kfree(b->km, u);
kfree(b->km, mini_pos); kfree(b->km, mini_pos);
if (mi->J && n_segs == 1 && is_splice)
for (i = 0; i < n_regs0; ++i)
mm_jump_split(b->km, mi, opt, qlens[0], (const uint8_t*)seqs[0], &regs0[i], 0);
if (b->km) { if (b->km) {
km_stat(b->km, &kmst); km_stat(b->km, &kmst);
if (mm_dbg_flag & MM_DBG_PRINT_QNAME) if (mm_dbg_flag & MM_DBG_PRINT_QNAME)
fprintf(stderr, "QM\t%s\t%d\tcap=%ld,nCore=%ld,largest=%ld\n", qname, qlen_sum, kmst.capacity, kmst.n_cores, kmst.largest); fprintf(stderr, "QM\t%s\t%d\tcap=%ld,nCore=%ld,largest=%ld\n", qname, qlen_sum, kmst.capacity, kmst.n_cores, kmst.largest);
assert(kmst.n_blocks == kmst.n_cores); // otherwise, there is a memory leak assert(kmst.n_blocks == kmst.n_cores); // otherwise, there is a memory leak
if (kmst.largest > 1U<<28) { if (kmst.largest > 1U<<28 || (opt->cap_kalloc > 0 && kmst.capacity > opt->cap_kalloc)) {
if (mm_dbg_flag & MM_DBG_PRINT_QNAME)
fprintf(stderr, "[W::%s] reset thread-local memory after read %s\n", __func__, qname);
km_destroy(b->km); km_destroy(b->km);
b->km = km_init(); b->km = km_init();
} }
} }
} }
void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, int *n_regs, mm_reg1_t **regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname)
{
if ((opt->flag & MM_F_WEAK_PAIRING) && n_segs == 2 && opt->pe_ori >= 0 && (opt->flag&MM_F_CIGAR)) {
int i;
for (i = 0; i < n_segs; ++i)
mm_map_frag_core(mi, 1, &qlens[i], &seqs[i], &n_regs[i], &regs[i], b, opt, qname);
mm_pair(b->km, opt->max_gap_ref, opt->pe_bonus, opt->a * 2 + opt->b, opt->a, qlens, n_regs, regs);
} else {
mm_map_frag_core(mi, n_segs, qlens, seqs, n_regs, regs, b, opt, qname);
}
}
mm_reg1_t *mm_map(const mm_idx_t *mi, int qlen, const char *seq, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname) mm_reg1_t *mm_map(const mm_idx_t *mi, int qlen, const char *seq, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname)
{ {
mm_reg1_t *regs; mm_reg1_t *regs;
@@ -397,7 +401,8 @@ mm_reg1_t *mm_map(const mm_idx_t *mi, int qlen, const char *seq, int *n_regs, mm
**************************/ **************************/
typedef struct { typedef struct {
int mini_batch_size, n_processed, n_threads, n_fp; int n_processed, n_threads, n_fp;
int64_t mini_batch_size;
const mm_mapopt_t *opt; const mm_mapopt_t *opt;
mm_bseq_file_t **fp; mm_bseq_file_t **fp;
const mm_idx_t *mi; const mm_idx_t *mi;
@@ -422,10 +427,13 @@ static void worker_for(void *_data, long i, int tid) // kt_for() callback
step_t *s = (step_t*)_data; step_t *s = (step_t*)_data;
int qlens[MM_MAX_SEG], j, off = s->seg_off[i], pe_ori = s->p->opt->pe_ori; int qlens[MM_MAX_SEG], j, off = s->seg_off[i], pe_ori = s->p->opt->pe_ori;
const char *qseqs[MM_MAX_SEG]; const char *qseqs[MM_MAX_SEG];
double t = 0.0;
mm_tbuf_t *b = s->buf[tid]; mm_tbuf_t *b = s->buf[tid];
assert(s->n_seg[i] <= MM_MAX_SEG); assert(s->n_seg[i] <= MM_MAX_SEG);
if (mm_dbg_flag & MM_DBG_PRINT_QNAME) if (mm_dbg_flag & MM_DBG_PRINT_QNAME) {
fprintf(stderr, "QR\t%s\t%d\t%d\n", s->seq[off].name, tid, s->seq[off].l_seq); fprintf(stderr, "QR\t%s\t%d\t%d\n", s->seq[off].name, tid, s->seq[off].l_seq);
t = realtime();
}
for (j = 0; j < s->n_seg[i]; ++j) { for (j = 0; j < s->n_seg[i]; ++j) {
if (s->n_seg[i] == 2 && ((j == 0 && (pe_ori>>1&1)) || (j == 1 && (pe_ori&1)))) if (s->n_seg[i] == 2 && ((j == 0 && (pe_ori>>1&1)) || (j == 1 && (pe_ori&1))))
mm_revcomp_bseq(&s->seq[off + j]); mm_revcomp_bseq(&s->seq[off + j]);
@@ -455,9 +463,15 @@ static void worker_for(void *_data, long i, int tid) // kt_for() callback
r->qs = qlens[j] - r->qe; r->qs = qlens[j] - r->qe;
r->qe = qlens[j] - t; r->qe = qlens[j] - t;
r->rev = !r->rev; r->rev = !r->rev;
if (r->p) {
if (r->p->trans_strand == 1) r->p->trans_strand = 2;
else if (r->p->trans_strand == 2) r->p->trans_strand = 1;
} }
} }
} }
if (mm_dbg_flag & MM_DBG_PRINT_QNAME)
fprintf(stderr, "QT\t%s\t%d\t%.6f\n", s->seq[off].name, tid, realtime() - t);
}
static void merge_hits(step_t *s) static void merge_hits(step_t *s)
{ {
@@ -501,13 +515,21 @@ static void merge_hits(step_t *s)
} }
} }
} }
mm_hit_sort(km, &s->n_reg[k], s->reg[k]); if (!(opt->flag&MM_F_SR) && s->seq[k].l_seq >= opt->rank_min_len)
mm_set_parent(km, opt->mask_level, s->n_reg[k], s->reg[k], opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL); mm_update_dp_max(s->seq[k].l_seq, s->n_reg[k], s->reg[k], opt->rank_frac, opt->a, opt->b);
for (j = 0; j < s->n_reg[k]; ++j) {
mm_reg1_t *r = &s->reg[k][j];
if (r->p) r->p->dp_max2 = 0; // reset ->dp_max2 as mm_set_parent() doesn't clear it; necessary with mm_update_dp_max()
r->subsc = 0; // this may not be necessary
r->n_sub = 0; // n_sub will be an underestimate as we don't see all the chains now, but it can't be accurate anyway
}
mm_hit_sort(km, &s->n_reg[k], s->reg[k], opt->alt_drop);
mm_set_parent(km, opt->mask_level, opt->mask_len, s->n_reg[k], s->reg[k], opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL, opt->alt_drop);
if (!(opt->flag & MM_F_ALL_CHAINS)) { if (!(opt->flag & MM_F_ALL_CHAINS)) {
mm_select_sub(km, opt->pri_ratio, s->p->mi->k*2, opt->best_n, &s->n_reg[k], s->reg[k]); mm_select_sub(km, opt->pri_ratio, s->p->mi->k*2, opt->best_n, 0, opt->max_gap * 0.8, &s->n_reg[k], s->reg[k]);
mm_set_sam_pri(s->n_reg[k], s->reg[k]); mm_set_sam_pri(s->n_reg[k], s->reg[k]);
} }
mm_set_mapq(km, s->n_reg[k], s->reg[k], opt->min_chain_score, opt->a, rep_len, !!(opt->flag & MM_F_SR)); mm_set_mapq2(km, s->n_reg[k], s->reg[k], opt->min_chain_score, opt->a, rep_len, !!(opt->flag & (MM_F_SR|MM_F_SR_RNA)), !!(opt->flag & MM_F_SPLICE));
} }
if (s->n_seg[f] == 2 && opt->pe_ori >= 0 && (opt->flag&MM_F_CIGAR)) if (s->n_seg[f] == 2 && opt->pe_ori >= 0 && (opt->flag&MM_F_CIGAR))
mm_pair(km, frag_gap_part[0], opt->pe_bonus, opt->a * 2 + opt->b, opt->a, qlens, &s->n_reg[k0], &s->reg[k0]); mm_pair(km, frag_gap_part[0], opt->pe_bonus, opt->a * 2 + opt->b, opt->a, qlens, &s->n_reg[k0], &s->reg[k0]);
@@ -576,23 +598,30 @@ static void *worker_pipeline(void *shared, int step, void *in)
mm_err_fwrite(r->p, r->p->capacity, 4, p->fp_split); mm_err_fwrite(r->p, r->p->capacity, 4, p->fp_split);
} }
} }
} else if (p->opt->flag & MM_F_OUT_JUNC) { // extra logic for --write-junc
for (j = 0; j < s->n_reg[i]; ++j) {
const mm_reg1_t *r = &s->reg[i][j];
if (r->id != r->parent || r->mapq < 10) continue;
mm_write_junc(&p->str, mi, t, r);
if (p->str.l > 0) mm_err_puts(p->str.s);
}
} else if (s->n_reg[i] > 0) { // the query has at least one hit } else if (s->n_reg[i] > 0) { // the query has at least one hit
for (j = 0; j < s->n_reg[i]; ++j) { for (j = 0; j < s->n_reg[i]; ++j) {
mm_reg1_t *r = &s->reg[i][j]; const mm_reg1_t *r = &s->reg[i][j];
assert(!r->sam_pri || r->id == r->parent); assert(!r->sam_pri || r->id == r->parent);
if ((p->opt->flag & MM_F_NO_PRINT_2ND) && r->id != r->parent) if ((p->opt->flag & MM_F_NO_PRINT_2ND) && r->id != r->parent)
continue; continue;
if (p->opt->flag & MM_F_OUT_SAM) if (p->opt->flag & MM_F_OUT_SAM)
mm_write_sam2(&p->str, mi, t, i - seg_st, j, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag); mm_write_sam3(&p->str, mi, t, i - seg_st, j, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag, s->rep_len[i]);
else else
mm_write_paf(&p->str, mi, t, r, km, p->opt->flag); mm_write_paf4(&p->str, mi, t, r, km, p->opt->flag, s->rep_len[i], s->n_seg[k], i - seg_st);
mm_err_puts(p->str.s); mm_err_puts(p->str.s);
} }
} else if (p->opt->flag & (MM_F_OUT_SAM|MM_F_PAF_NO_HIT)) { // output an empty hit, if requested } else if ((p->opt->flag & MM_F_PAF_NO_HIT) || ((p->opt->flag & MM_F_OUT_SAM) && !(p->opt->flag & MM_F_SAM_HIT_ONLY))) { // output an empty hit, if requested
if (p->opt->flag & MM_F_OUT_SAM) if (p->opt->flag & MM_F_OUT_SAM)
mm_write_sam2(&p->str, mi, t, i - seg_st, -1, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag); mm_write_sam3(&p->str, mi, t, i - seg_st, -1, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag, s->rep_len[i]);
else else
mm_write_paf(&p->str, mi, t, 0, 0, p->opt->flag); mm_write_paf4(&p->str, mi, t, 0, 0, p->opt->flag, s->rep_len[i], s->n_seg[k], i - seg_st);
mm_err_puts(p->str.s); mm_err_puts(p->str.s);
} }
} }
@@ -621,7 +650,7 @@ static mm_bseq_file_t **open_bseqs(int n, const char **fn)
for (i = 0; i < n; ++i) { for (i = 0; i < n; ++i) {
if ((fp[i] = mm_bseq_open(fn[i])) == 0) { if ((fp[i] = mm_bseq_open(fn[i])) == 0) {
if (mm_verbose >= 1) if (mm_verbose >= 1)
fprintf(stderr, "ERROR: failed to open file '%s'\n", fn[i]); fprintf(stderr, "ERROR: failed to open file '%s': %s\n", fn[i], strerror(errno));
for (j = 0; j < i; ++j) for (j = 0; j < i; ++j)
mm_bseq_close(fp[j]); mm_bseq_close(fp[j]);
free(fp); free(fp);
+103 -41
View File
@@ -5,36 +5,49 @@
#include <stdio.h> #include <stdio.h>
#include <sys/types.h> #include <sys/types.h>
#define MM_F_NO_DIAG 0x001 // no exact diagonal hit #define MM_VERSION "2.30-r1287"
#define MM_F_NO_DUAL 0x002 // skip pairs where query name is lexicographically larger than target name
#define MM_F_CIGAR 0x004 #define MM_F_NO_DIAG (0x001LL) // no exact diagonal hit
#define MM_F_OUT_SAM 0x008 #define MM_F_NO_DUAL (0x002LL) // skip pairs where query name is lexicographically larger than target name
#define MM_F_NO_QUAL 0x010 #define MM_F_CIGAR (0x004LL)
#define MM_F_OUT_CG 0x020 #define MM_F_OUT_SAM (0x008LL)
#define MM_F_OUT_CS 0x040 #define MM_F_NO_QUAL (0x010LL)
#define MM_F_SPLICE 0x080 // splice mode #define MM_F_OUT_CG (0x020LL)
#define MM_F_SPLICE_FOR 0x100 // match GT-AG #define MM_F_OUT_CS (0x040LL)
#define MM_F_SPLICE_REV 0x200 // match CT-AC, the reverse complement of GT-AG #define MM_F_SPLICE (0x080LL) // splice mode
#define MM_F_NO_LJOIN 0x400 #define MM_F_SPLICE_FOR (0x100LL) // match GT-AG
#define MM_F_OUT_CS_LONG 0x800 #define MM_F_SPLICE_REV (0x200LL) // match CT-AC, the reverse complement of GT-AG
#define MM_F_SR 0x1000 #define MM_F_NO_LJOIN (0x400LL)
#define MM_F_FRAG_MODE 0x2000 #define MM_F_OUT_CS_LONG (0x800LL)
#define MM_F_NO_PRINT_2ND 0x4000 #define MM_F_SR (0x1000LL)
#define MM_F_2_IO_THREADS 0x8000 #define MM_F_FRAG_MODE (0x2000LL)
#define MM_F_LONG_CIGAR 0x10000 #define MM_F_NO_PRINT_2ND (0x4000LL)
#define MM_F_INDEPEND_SEG 0x20000 #define MM_F_2_IO_THREADS (0x8000LL)
#define MM_F_SPLICE_FLANK 0x40000 #define MM_F_LONG_CIGAR (0x10000LL)
#define MM_F_SOFTCLIP 0x80000 #define MM_F_INDEPEND_SEG (0x20000LL)
#define MM_F_FOR_ONLY 0x100000 #define MM_F_SPLICE_FLANK (0x40000LL)
#define MM_F_REV_ONLY 0x200000 #define MM_F_SOFTCLIP (0x80000LL)
#define MM_F_HEAP_SORT 0x400000 #define MM_F_FOR_ONLY (0x100000LL)
#define MM_F_ALL_CHAINS 0x800000 #define MM_F_REV_ONLY (0x200000LL)
#define MM_F_OUT_MD 0x1000000 #define MM_F_HEAP_SORT (0x400000LL)
#define MM_F_COPY_COMMENT 0x2000000 #define MM_F_ALL_CHAINS (0x800000LL)
#define MM_F_EQX 0x4000000 // use =/X instead of M #define MM_F_OUT_MD (0x1000000LL)
#define MM_F_PAF_NO_HIT 0x8000000 // output unmapped reads to PAF #define MM_F_COPY_COMMENT (0x2000000LL)
#define MM_F_NO_END_FLT 0x10000000 #define MM_F_EQX (0x4000000LL) // use =/X instead of M
#define MM_F_HARD_MLEVEL 0x20000000 #define MM_F_PAF_NO_HIT (0x8000000LL) // output unmapped reads to PAF
#define MM_F_NO_END_FLT (0x10000000LL)
#define MM_F_HARD_MLEVEL (0x20000000LL)
#define MM_F_SAM_HIT_ONLY (0x40000000LL)
#define MM_F_RMQ (0x80000000LL)
#define MM_F_QSTRAND (0x100000000LL)
#define MM_F_NO_INV (0x200000000LL)
#define MM_F_NO_HASH_NAME (0x400000000LL)
#define MM_F_SPLICE_OLD (0x800000000LL)
#define MM_F_SECONDARY_SEQ (0x1000000000LL) //output SEQ field for seqondary alignments using hard clipping
#define MM_F_OUT_DS (0x2000000000LL)
#define MM_F_WEAK_PAIRING (0x4000000000LL)
#define MM_F_SR_RNA (0x8000000000LL)
#define MM_F_OUT_JUNC (0x10000000000LL)
#define MM_I_HPC 0x1 #define MM_I_HPC 0x1
#define MM_I_NO_SEQ 0x2 #define MM_I_NO_SEQ 0x2
@@ -44,6 +57,18 @@
#define MM_MAX_SEG 255 #define MM_MAX_SEG 255
#define MM_CIGAR_MATCH 0
#define MM_CIGAR_INS 1
#define MM_CIGAR_DEL 2
#define MM_CIGAR_N_SKIP 3
#define MM_CIGAR_SOFTCLIP 4
#define MM_CIGAR_HARDCLIP 5
#define MM_CIGAR_PADDING 6
#define MM_CIGAR_EQ_MATCH 7
#define MM_CIGAR_X_MISMATCH 8
#define MM_CIGAR_STR "MIDNSHP=XB"
#ifdef __cplusplus #ifdef __cplusplus
extern "C" { extern "C" {
#endif #endif
@@ -57,15 +82,20 @@ typedef struct {
char *name; // name of the db sequence char *name; // name of the db sequence
uint64_t offset; // offset in mm_idx_t::S uint64_t offset; // offset in mm_idx_t::S
uint32_t len; // length uint32_t len; // length
uint32_t is_alt;
} mm_idx_seq_t; } mm_idx_seq_t;
typedef struct { typedef struct {
int32_t b, w, k, flag; int32_t b, w, k, flag;
uint32_t n_seq; // number of reference sequences uint32_t n_seq; // number of reference sequences
int32_t index; int32_t index;
int32_t n_alt;
mm_idx_seq_t *seq; // sequence name, length and offset mm_idx_seq_t *seq; // sequence name, length and offset
uint32_t *S; // 4-bit packed sequence uint32_t *S; // 4-bit packed sequence
struct mm_idx_bucket_s *B; // index (hidden) struct mm_idx_bucket_s *B; // index (hidden)
struct mm_idx_intv_s *I; // intervals (hidden)
struct mm_idx_spsc_s *spsc;// splice score (hidden)
struct mm_idx_jjump_s *J; // junctions to create jumps (hidden)
void *km, *h; void *km, *h;
} mm_idx_t; } mm_idx_t;
@@ -73,6 +103,7 @@ typedef struct {
typedef struct { typedef struct {
uint32_t capacity; // the capacity of cigar[] uint32_t capacity; // the capacity of cigar[]
int32_t dp_score, dp_max, dp_max2; // DP score; score of the max-scoring segment; score of the best alternate mappings int32_t dp_score, dp_max, dp_max2; // DP score; score of the max-scoring segment; score of the best alternate mappings
int32_t dp_max0; // DP score before mm_update_dp_max() adjustment
uint32_t n_ambi:30, trans_strand:2; // number of ambiguous bases; transcript strand: 0 for unknown, 1 for +, 2 for - uint32_t n_ambi:30, trans_strand:2; // number of ambiguous bases; transcript strand: 0 for unknown, 1 for +, 2 for -
uint32_t n_cigar; // number of cigar operations in cigar[] uint32_t n_cigar; // number of cigar operations in cigar[]
uint32_t cigar[]; uint32_t cigar[];
@@ -89,7 +120,7 @@ typedef struct {
int32_t mlen, blen; // seeded exact match length; seeded alignment block length int32_t mlen, blen; // seeded exact match length; seeded alignment block length
int32_t n_sub; // number of suboptimal mappings int32_t n_sub; // number of suboptimal mappings
int32_t score0; // initial chaining score (before chain merging/spliting) int32_t score0; // initial chaining score (before chain merging/spliting)
uint32_t mapq:8, split:2, rev:1, inv:1, sam_pri:1, proper_frag:1, pe_thru:1, seg_split:1, seg_id:8, split_inv:1, dummy:7; uint32_t mapq:8, split:2, rev:1, inv:1, sam_pri:1, proper_frag:1, pe_thru:1, seg_split:1, seg_id:8, split_inv:1, is_alt:1, strand_retained:1, is_spliced:1, dummy:4;
uint32_t hash; uint32_t hash;
float div; float div;
mm_extra_t *p; mm_extra_t *p;
@@ -98,33 +129,42 @@ typedef struct {
// indexing and mapping options // indexing and mapping options
typedef struct { typedef struct {
short k, w, flag, bucket_bits; short k, w, flag, bucket_bits;
int mini_batch_size; int64_t mini_batch_size;
uint64_t batch_size; uint64_t batch_size;
} mm_idxopt_t; } mm_idxopt_t;
typedef struct { typedef struct {
int64_t flag; // see MM_F_* macros
int seed; int seed;
int sdust_thres; // score threshold for SDUST; 0 to disable int sdust_thres; // score threshold for SDUST; 0 to disable
int flag; // see MM_F_* macros
int bw; // bandwidth int max_qlen; // max query length
int bw, bw_long; // bandwidth
int max_gap, max_gap_ref; // break a chain if there are no minimizers in a max_gap window int max_gap, max_gap_ref; // break a chain if there are no minimizers in a max_gap window
int max_frag_len; int max_frag_len;
int max_chain_skip; int max_chain_skip, max_chain_iter;
int min_cnt; // min number of minimizers on each chain int min_cnt; // min number of minimizers on each chain
int min_chain_score; // min chaining score int min_chain_score; // min chaining score
float chain_gap_scale;
float chain_skip_scale;
int rmq_size_cap, rmq_inner_dist;
int rmq_rescue_size;
float rmq_rescue_ratio;
float mask_level; float mask_level;
int mask_len;
float pri_ratio; float pri_ratio;
int best_n; // top best_n chains are subjected to DP alignment int best_n; // top best_n chains are subjected to DP alignment
int max_join_long, max_join_short; float alt_drop;
int min_join_flank_sc;
float min_join_flank_ratio;
int a, b, q, e, q2, e2; // matching score, mismatch, gap-open and gap-ext penalties int a, b, q, e, q2, e2; // matching score, mismatch, gap-open and gap-ext penalties
int transition; // transition mismatch score (A:G, C:T)
int sc_ambi; // score when one or both bases are "N" int sc_ambi; // score when one or both bases are "N"
int noncan; // cost of non-canonical splicing sites int noncan; // cost of non-canonical splicing sites
int junc_bonus; // bonus for a splice site in annotation
int junc_pen; // penalty for GT- or -AG not scored in --spsc
int zdrop, zdrop_inv; // break alignment if alignment score drops too fast along the diagonal int zdrop, zdrop_inv; // break alignment if alignment score drops too fast along the diagonal
int end_bonus; int end_bonus;
int min_dp_max; // drop an alignment if the score of the max scoring segment is below this threshold int min_dp_max; // drop an alignment if the score of the max scoring segment is below this threshold
@@ -132,13 +172,21 @@ typedef struct {
int anchor_ext_len, anchor_ext_shift; int anchor_ext_len, anchor_ext_shift;
float max_clip_ratio; // drop an alignment if BOTH ends are clipped above this ratio float max_clip_ratio; // drop an alignment if BOTH ends are clipped above this ratio
int rank_min_len;
float rank_frac;
int pe_ori, pe_bonus; int pe_ori, pe_bonus;
int32_t jump_min_match;
float mid_occ_frac; // only used by mm_mapopt_update(); see below float mid_occ_frac; // only used by mm_mapopt_update(); see below
int32_t min_mid_occ; float q_occ_frac;
int32_t min_mid_occ, max_mid_occ;
int32_t mid_occ; // ignore seeds with occurrences above this threshold int32_t mid_occ; // ignore seeds with occurrences above this threshold
int32_t max_occ; int32_t max_occ, max_max_occ, occ_dist;
int mini_batch_size; // size of a batch of query bases to process in parallel int64_t mini_batch_size; // size of a batch of query bases to process in parallel
int64_t max_sw_mat;
int64_t cap_kalloc;
const char *split_prefix; const char *split_prefix;
} mm_mapopt_t; } mm_mapopt_t;
@@ -156,6 +204,11 @@ typedef struct {
} mm_idx_reader_t; } mm_idx_reader_t;
// memory buffer for thread-local storage during mapping // memory buffer for thread-local storage during mapping
struct mm_tbuf_s {
void *km;
int rep_len, frag_gap;
};
typedef struct mm_tbuf_s mm_tbuf_t; typedef struct mm_tbuf_s mm_tbuf_t;
// global variables // global variables
@@ -362,6 +415,15 @@ int mm_idx_index_name(mm_idx_t *mi);
int mm_idx_name2id(const mm_idx_t *mi, const char *name); int mm_idx_name2id(const mm_idx_t *mi, const char *name);
int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq); int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq);
int mm_idx_alt_read(mm_idx_t *mi, const char *fn);
int mm_idx_bed_read(mm_idx_t *mi, const char *fn, int read_junc);
int mm_idx_bed_junc(const mm_idx_t *mi, int32_t ctg, int32_t st, int32_t en, uint8_t *s);
int mm_max_spsc_bonus(const mm_mapopt_t *mo);
int32_t mm_idx_spsc_read(mm_idx_t *idx, const char *fn, int32_t max_sc);
int32_t mm_idx_spsc_read2(mm_idx_t *idx, const char *fn, int32_t max_sc, float scale);
int64_t mm_idx_spsc_get(const mm_idx_t *db, int32_t cid, int64_t st0, int64_t en0, int32_t rev, uint8_t *sc);
// deprecated APIs for backward compatibility // deprecated APIs for backward compatibility
void mm_mapopt_init(mm_mapopt_t *opt); void mm_mapopt_init(mm_mapopt_t *opt);
mm_idx_t *mm_idx_build(const char *fn, int w, int k, int flag, int n_threads); mm_idx_t *mm_idx_build(const char *fn, int w, int k, int flag, int n_threads);
+295 -83
View File
@@ -1,4 +1,4 @@
.TH minimap2 1 "11 October 2018" "minimap2-2.13 (r850)" "Bioinformatics tools" .TH minimap2 1 "15 June 2025" "minimap2-2.30 (r1287)" "Bioinformatics tools"
.SH NAME .SH NAME
.PP .PP
minimap2 - mapping and alignment between collections of DNA sequences minimap2 - mapping and alignment between collections of DNA sequences
@@ -77,7 +77,7 @@ SAM format.
Minimizer k-mer length [15] Minimizer k-mer length [15]
.TP .TP
.BI -w \ INT .BI -w \ INT
Minimizer window size [2/3 of k-mer length]. A minimizer is the smallest k-mer Minimizer window size [10]. A minimizer is the smallest k-mer
in a window of w consecutive k-mers. in a window of w consecutive k-mers.
.TP .TP
.B -H .B -H
@@ -88,16 +88,17 @@ on the HPC sequence.
.BI -I \ NUM .BI -I \ NUM
Load at most Load at most
.I NUM .I NUM
target bases into RAM for indexing [4G]. If there are more than target bases into RAM for indexing [8G]. If there are more than
.I NUM .I NUM
bases in bases in
.IR target.fa , .IR target.fa ,
minimap2 needs to read minimap2 needs to read
.I query.fa .I query.fa
multiple times to map it against each batch of target sequences. multiple times to map it against each batch of target sequences. This would create a multi-part index.
.I NUM .I NUM
may be ending with k/K/m/M/g/G. NB: mapping quality is incorrect given a may be ending with k/K/m/M/g/G. NB: mapping quality is incorrect given a
multi-part index. multi-part index. See also option
.BR --split-prefix .
.TP .TP
.B --idx-no-seq .B --idx-no-seq
Don't store target sequences in the index. It saves disk space and memory but Don't store target sequences in the index. It saves disk space and memory but
@@ -121,6 +122,14 @@ provided as the target sequences, options
.BR -w , .BR -w ,
.B -I .B -I
will be effectively overridden by the options stored in the index file. will be effectively overridden by the options stored in the index file.
.TP
.BI --alt \ FILE
List of ALT contigs [null]
.TP
.BI --alt-drop \ FLOAT
Drop ALT hits by
.I FLOAT
fraction when ranking and computing mapping quality [0.15]
.SS Mapping options .SS Mapping options
.TP 10 .TP 10
.BI -f \ FLOAT | INT1 [, INT2 ] .BI -f \ FLOAT | INT1 [, INT2 ]
@@ -137,22 +146,38 @@ or
.B -xsr .B -xsr
mode, which sets the threshold for a second round of seeding. mode, which sets the threshold for a second round of seeding.
.TP .TP
.BI --min-occ-floor \ INT .BI -U \ INT1 [, INT2 ]
Force minimap2 to always use k-mers occurring Lower and upper bounds of k-mer occurrences [10,1000000]. The final k-mer occurrence threshold is
.RI max{ INT1 ,\ min{ INT2 ,
.BR -f }}.
This option prevents excessively small or large
.B -f
estimated from the input reference. Available since r1034 and deprecating
.B --min-occ-floor
in earlier versions of minimap2.
.TP
.BI --q-occ-frac \ FLOAT
Discard a query minimizer if its occurrence is higher than
.I FLOAT
fraction of query minimizers and than the reference occurrence threshold
[0.01]. Set 0 to disable. Available since r1105.
.TP
.BI -e \ INT
Sample a high-frequency minimizer every
.I INT .I INT
times or less [0]. In effect, the max occurrence threshold is set to basepairs [500].
the
.RI max{ INT ,
.BR -f }.
.TP .TP
.BI -g \ INT .BI -g \ NUM
Stop chain enlongation if there are no minimizers within Stop chain enlongation if there are no minimizers within
.IR INT -bp .IR NUM -bp
[10000]. [10k].
.TP .TP
.BI -r \ INT .BI -r \ NUM1 [, NUM2 ]
Bandwidth used in chaining and DP-based alignment [500]. This option Bandwidth for chaining and base alignment [500,20k].
approximately controls the maximum gap size. .I NUM1
is used for initial chaining and alignment extension;
.I NUM2
for RMQ-based re-chaining and closing gaps in alignments.
.TP .TP
.BI -n \ INT .BI -n \ INT
Discard chains consisting of Discard chains consisting of
@@ -226,36 +251,59 @@ Mark as secondary a chain that overlaps with a better chain by
.I FLOAT .I FLOAT
or more of the shorter chain [0.5] or more of the shorter chain [0.5]
.TP .TP
.BR --rmq = no | yes
Use the minigraph chaining algorithm [no]. The minigraph algorithm is better
for aligning contigs through long INDELs.
.TP
.BI --rmq-inner \ NUM
Apply full dynamic programming for anchors within distance
.I NUM
[1000].
.TP
.B --hard-mask-level .B --hard-mask-level
Honor option Honor option
.B -M .B -M
and disable a heurstic to save unmapped subsequences. and disable a heurstic to save unmapped subsequences and disables
.BR --mask-len .
.TP
.BI --mask-len \ NUM
Keep an alignment if dropping it leaves an unaligned region on query longer than
.IR INT
[inf]. Effective without
.BR --hard-mask-level .
.TP .TP
.BI --max-chain-skip \ INT .BI --max-chain-skip \ INT
A heuristics that stops chaining early [50]. Minimap2 uses dynamic programming A heuristics that stops chaining early [25]. Minimap2 uses dynamic programming
for chaining. The time complexity is quadratic in the number of seeds. This for chaining. The time complexity is quadratic in the number of seeds. This
option makes minimap2 exits the inner loop if it repeatedly sees seeds already option makes minimap2 exits the inner loop if it repeatedly sees seeds already
on chains. Set on chains. Set
.I INT .I INT
to a large number to switch off this heurstics. to a large number to switch off this heurstics.
.TP .TP
.BI --max-chain-iter \ INT
Check up to
.I INT
partial chains during chaining [5000]. This is a heuristic to avoid quadratic
time complexity in the worst case.
.TP
.BI --chain-gap-scale \ FLOAT
Scale of gap cost during chaining [1.0]
.TP
.B --no-long-join .B --no-long-join
Disable the long gap patching heuristic. When this option is applied, the Disable the long gap patching heuristic. When this option is applied, the
maximum alignment gap is mostly controlled by maximum alignment gap is mostly controlled by
.BR -r . .BR -r .
.TP .TP
.BI --lj-min-ratio \ FLOAT
Fraction of query sequence length required to bridge a long gap [0.5]. A
smaller value helps to recover longer gaps, at the cost of more false gaps.
.TP
.B --splice .B --splice
Enable the splice alignment mode. Enable the splice alignment mode.
.TP .TP
.B --sr .BR --sr [= no | dna | rna ]
Enable short-read alignment heuristics. In the short-read mode, minimap2 Enable short-read alignment heuristics [no]. If this option is used with no argument,
applies a second round of chaining with a higher minimizer occurrence threshold .RB ` dna '
if no good chain is found. In addition, minimap2 attempts to patch gaps between is set. In the DNA short-read mode, minimap2 applies a second round of chaining
seeds with ungapped alignment. with a higher minimizer occurrence threshold if no good chain is found. In
addition, minimap2 attempts to patch gaps between seeds with ungapped
alignment.
.TP .TP
.BI --split-prefix \ STR .BI --split-prefix \ STR
Prefix to create temporary files. Typically used for a multi-part index. Prefix to create temporary files. Typically used for a multi-part index.
@@ -274,6 +322,9 @@ Only map to the reverse complement strand of the reference sequences.
.BR --heap-sort = no | yes .BR --heap-sort = no | yes
If yes, sort anchors with heap merge, instead of radix sort. Heap merge is If yes, sort anchors with heap merge, instead of radix sort. Heap merge is
faster for short reads, but slower for long reads. [no] faster for short reads, but slower for long reads. [no]
.TP
.B --no-hash-name
Produce the same alignment for identical sequences regardless of their sequence names.
.SS Alignment options .SS Alignment options
.TP 10 .TP 10
.BI -A \ INT .BI -A \ INT
@@ -282,6 +333,10 @@ Matching score [2]
.BI -B \ INT .BI -B \ INT
Mismatching penalty [4] Mismatching penalty [4]
.TP .TP
.BI -b \ INT
Mismatching penalty for transitions [same as
.BR -B ].
.TP
.BI -O \ INT1[,INT2] .BI -O \ INT1[,INT2]
Gap open penalty [4,24]. If Gap open penalty [4,24]. If
.I INT2 .I INT2
@@ -295,10 +350,28 @@ costs
.RI min{ O1 + k * E1 , O2 + k * E2 }. .RI min{ O1 + k * E1 , O2 + k * E2 }.
In the splice mode, the second gap penalties are not used. In the splice mode, the second gap penalties are not used.
.TP .TP
.BI -J \ INT
Splice model [1]. 0 for the original minimap2 splice model that always penalizes non-GT-AG splicing;
1 for the miniprot model that considers non-GT-AG. Option
.B -C
has no effect with the default
.BR -J1 .
.TP
.BR -j \ FILE
Junctions used to extend alignment towards ends of reads [].
.I FILE
can be gene annotations in the BED12 format (aka 12-column BED), or intron
positions in 5-column BED with the strand column required. BED12 file can be
converted from GTF/GFF3 with `paftools.js gff2bed anno.gtf'. This option is
intended for short RNA-seq reads, while
.B --junc-bed
for long noisy RNA-seq reads.
.TP
.BI -C \ INT .BI -C \ INT
Cost for a non-canonical GT-AG splicing (effective with Cost for a non-canonical GT-AG splicing (effective with
.BR --splice ) .B --splice
[0] .BR -J0 )
[0].
.TP .TP
.BI -z \ INT1[,INT2] .BI -z \ INT1[,INT2]
Truncate an alignment if the running alignment score drops too quickly along Truncate an alignment if the running alignment score drops too quickly along
@@ -335,7 +408,16 @@ no attempt to match GT-AG [n]
Score bonus when alignment extends to the end of the query sequence [0]. Score bonus when alignment extends to the end of the query sequence [0].
.TP .TP
.BI --score-N \ INT .BI --score-N \ INT
Score of a mismatch involving ambiguous bases [1]. Penalty of a mismatch involving ambiguous bases [1].
.TP
.BR --pairing = strong | weak | no
How to pair paired-end reads [strong].
.RB ` no '
for aligning the two ends in a pair independently with no `properly paired' set.
.RB ` weak '
for aligning the two ends independently and then pairing the hits.
.RB ` strong '
for jointly aligning and pairing the two ends.
.TP .TP
.BR --splice-flank = yes | no .BR --splice-flank = yes | no
Assume the next base to a Assume the next base to a
@@ -354,6 +436,50 @@ on SIRV data, please add
.B --splice-flank=no .B --splice-flank=no
to the command line. to the command line.
.TP .TP
.BR --spsc \ FILE
Splice scores []. Each line consists of five fields: 1) contig, 2) offset, 3) `+' or `-', 4) `D' or `A', and 5) score,
where offset is the number of bases before a splice junction, `D' indicates the
line corresponds to a donor site and `A' for an acceptor site.
A positive score suggests the junction is preferred and a negative score
suggests the junction is not preferred.
.TP
.BR --spsc0 \ INT
Penalty for positions not in
.I FILE
specified by
.B --spsc
[5]. Effective with
.B --spsc
but not
.BR --junc-bed .
.TP
.BR --spsc-scale \ FLOAT
Scale splice scores in
.B --spsc
by
.IR FLOAT
rounded to the nearest integer [0.7].
.TP
.BR --junc-bed \ FILE
Junctions to prefer during base alignment [].
Same format as
.BR -j .
It is
.I NOT
recommended to apply this option to short RNA-seq reads. This would increase
run time with little improvement to junction accuracy.
.TP
.BR --junc-bonus \ INT
Score bonus for a splice donor or acceptor found in annotation [9]. Effective with
.B --junc-bed
but not
.BR --spsc .
.TP
.BR --jump-min-match \ INT
Minimum matching length to create a jump [3]. Equivalent to
.B STAR
.BR --alignSJDBoverhangMin .
.TP
.BI --end-seed-pen \ INT .BI --end-seed-pen \ INT
Drop a terminal anchor if Drop a terminal anchor if
.IR s <log( g )+ INT , .IR s <log( g )+ INT ,
@@ -369,12 +495,27 @@ It helps to avoid tiny terminal exons. [6]
.B --no-end-flt .B --no-end-flt
Don't filter seeds towards the ends of chains before performing base-level Don't filter seeds towards the ends of chains before performing base-level
alignment. alignment.
.TP
.BI --cap-sw-mem \ NUM
Skip alignment if the DP matrix size is above
.IR NUM .
Set 0 to disable [100m].
.TP
.BI --cap-kalloc \ NUM
Free thread-local kalloc memory reservoir if after the alignment the size of the reservoir above
.IR NUM .
Set 0 to disable [500m].
.SS Input/output options .SS Input/output options
.TP 10 .TP 10
.B -a .B -a
Generate CIGAR and output alignments in the SAM format. Minimap2 outputs in PAF Generate CIGAR and output alignments in the SAM format. Minimap2 outputs in PAF
by default. by default.
.TP .TP
.BI -o \ FILE
Output alignments to
.I FILE
[stdout].
.TP
.B -Q .B -Q
Ignore base quality in the input file. Ignore base quality in the input file.
.TP .TP
@@ -395,20 +536,13 @@ Copy input FASTA/Q comments to output.
.B -c .B -c
Generate CIGAR. In PAF, the CIGAR is written to the `cg' custom tag. Generate CIGAR. In PAF, the CIGAR is written to the `cg' custom tag.
.TP .TP
.BI --cs[= STR ] .BR --cs [= short | long ]
Output the Output the
.B cs .B cs
tag. tag.
.I STR If no argument is given,
can be either .RB ` short '
.I short is set. [none]
or
.IR long .
If no
.I STR
is given,
.I short
is assumed. [none]
.TP .TP
.B --MD .B --MD
Output the MD tag (see the SAM spec). Output the MD tag (see the SAM spec).
@@ -419,6 +553,29 @@ Output =/X CIGAR operators for sequence match/mismatch.
.B -Y .B -Y
In SAM output, use soft clipping for supplementary alignments. In SAM output, use soft clipping for supplementary alignments.
.TP .TP
.B --secondary-seq
In SAM output, show query sequences for secondary alignments.
.TP
.B --write-junc
Output splice junctions in 6-column BED: contig name, start, end,
read name, score and strand. Score is the sum of donor and acceptor scores,
where GT gets 3, GC gets 2 and AT gets 1 at donor sites,
while AG gets 3 and AC gets 1 at acceptor sites.
Alignments with mapping quality below 10 are ignored.
.TP
.BI --pass1 \ FILE
Junctions BED file outputted by
.B --write-junc
[]. Rows with scores lower than 5 are ignored. When both
.B -j
and
.B --pass1
are present, junctions in
.B -j
are preferred over in
.BR --pass1
when there is ambiguity.
.TP
.BI --seed \ INT .BI --seed \ INT
Integer seed for randomizing equally best hits. Minimap2 hashes Integer seed for randomizing equally best hits. Minimap2 hashes
.I INT .I INT
@@ -449,6 +606,18 @@ memory.
.BR --secondary = yes | no .BR --secondary = yes | no
Whether to output secondary alignments [yes] Whether to output secondary alignments [yes]
.TP .TP
.BI --max-qlen \ NUM
Filter out query sequences longer than
.IR NUM .
.TP
.B --paf-no-hit
In PAF, output unmapped queries; the strand and the reference name fields are
set to `*'. Warning: some paftools.js commands may not work with such output
for the moment.
.TP
.B --sam-hit-only
In SAM, don't output unmapped reads.
.TP
.B --version .B --version
Print version number to stdout Print version number to stdout
.SS Preset options .SS Preset options
@@ -462,60 +631,75 @@ Available
.I STR .I STR
are: are:
.RS .RS
.TP 8 .TP 10
.B map-pb
PacBio/Oxford Nanopore read to reference mapping
.RB ( -Hk19 )
.TP
.B map-ont .B map-ont
Slightly more sensitive for Oxford Nanopore to reference mapping Align noisy long reads of ~10% error rate to a reference genome. This is the
.RB ( -k15 ). default mode.
For PacBio reads, HPC minimizers consistently leads to faster performance and .TP
more sensitive results in comparison to normal minimizers. For Oxford Nanopore .B lr:hq
data, normal minimizers are better, though not much. The effectiveness of HPC Align accurate long reads (error rate <1%) to a reference genome
is determined by the sequencing error mode. .RB ( -k19
.B -w19 -U50,500
.BR -g10k ).
This was recommended by ONT developers for recent Nanopore reads
produced with chemistry v14 that can reach ~99% in accuracy.
It was shown to work better for accurate Nanopore reads
than
.BR map-hifi .
.TP
.B map-hifi
Align PacBio high-fidelity (HiFi) reads to a reference genome
.RB ( -xlr:hq
.B -A1 -B4 -O6,26 -E2,1
.BR -s200 ).
It differs from
.B lr:hq
only in scoring. It has not been tested whether
.B lr:hq
would work better for PacBio HiFi reads.
.TP
.B map-pb
Align older PacBio continuous long (CLR) reads to a reference genome
.RB ( -Hk19 ).
Note that this data type is effectively deprecated by HiFi.
Unless you work on very old data, you probably want to use
.B map-hifi
or
.BR lr:hq .
.TP
.B map-iclr
Align Illumina Complete Long Reads (ICLR) to a reference genome
.RB ( -k19
.B -B6 -b4
.BR -O10,50 ).
This was recommended by Illumina developers.
.TP .TP
.B asm5 .B asm5
Long assembly to reference mapping Long assembly to reference mapping
.RB ( -k19 .RB ( -k19
.B -w19 -A1 -B19 -O39,81 -E3,1 -s200 -z200 .B -w19 -U50,500 --rmq -r1k,100k -g10k -A1 -B19 -O39,81 -E3,1 -s200 -z200
.BR --min-occ-floor=100 ). .BR -N50 ).
Typically, the alignment will not extend to regions with 5% or higher sequence Typically, the alignment will not extend to regions with 5% or higher sequence
divergence. Only use this preset if the average divergence is far below 5%. divergence. Use this preset if the average divergence is not much higher than 0.1%.
.TP .TP
.B asm10 .B asm10
Long assembly to reference mapping Long assembly to reference mapping
.RB ( -k19 .RB ( -k19
.B -w19 -A1 -B9 -O16,41 -E2,1 -s200 -z200 .B -w19 -U50,500 --rmq -r1k,100k -g10k -A1 -B9 -O16,41 -E2,1 -s200 -z200
.BR --min-occ-floor=100 ). .BR -N50 ).
Up to 10% sequence divergence. Use this if the average divergence is around 1%.
.TP .TP
.B asm20 .B asm20
Long assembly to reference mapping Long assembly to reference mapping
.RB ( -k19 .RB ( -k19
.B -w10 -A1 -B6 -O6,26 -E2,1 -s200 -z200 .B -w10 -U50,500 --rmq -r1k,100k -g10k -A1 -B4 -O6,26 -E2,1 -s200 -z200
.BR --min-occ-floor=100 ). .BR -N50 ).
Up to 20% sequence divergence. Use this if the average divergence is around several percent.
.TP
.B ava-pb
PacBio all-vs-all overlap mapping
.RB ( -Hk19
.B -Xw5 -m100 -g10000 --max-chain-skip
.BR 25 ).
.TP
.B ava-ont
Oxford Nanopore all-vs-all overlap mapping
.RB ( -k15
.B -Xw5 -m100 -g10000 -r2000 --max-chain-skip
.BR 25 ).
Similarly, the major difference from
.B ava-pb
is that this preset is not using HPC minimizers.
.TP .TP
.B splice .B splice
Long-read spliced alignment Long-read spliced alignment
.RB ( -k15 .RB ( -k15
.B -w5 --splice -g2000 -G200k -A1 -B2 -O2,32 -E1,0 -C9 -z200 -ub .B -w5 --splice -g2k -G200k -A1 -B2 -O2,32 -E1,0 -C9 -z200 -ub --junc-bonus=9 --cap-sw-mem=0
.BR --splice-flank=yes ). .BR --splice-flank=yes ).
In the splice mode, 1) long deletions are taken as introns and represented as In the splice mode, 1) long deletions are taken as introns and represented as
the the
@@ -525,12 +709,36 @@ costs are different during chaining; 4) the computation of the
.RB ` ms ' .RB ` ms '
tag ignores introns to demote hits to pseudogenes. tag ignores introns to demote hits to pseudogenes.
.TP .TP
.B sr .B splice:hq
Short single-end reads without splicing Spliced alignment for accurate long RNA-seq reads such as PacBio iso-seq
.RB ( -k21 .RB ( -xsplice
.B -w11 --sr --frag=yes -A2 -B8 -O12,32 -E2,1 -r50 -p.5 -N20 -f1000,5000 -n2 -m20 .B -C5 -O6,24
.B -s40 -g200 -2K50m --heap-sort=yes .BR -B4 ).
.TP
.B splice:sr
Spliced alignment for short RNA-seq reads
.RB ( -xsplice:hq
.B --frag=yes -m25 -s40 -2K100m --heap-sort=yes --pairing=weak --sr=rna --min-dp-len=20
.BR --secondary=no ). .BR --secondary=no ).
.TP
.B sr
Short-read alignment without splicing
.RB ( -k21
.B -w11 --sr --frag=yes -A2 -B8 -O12,32 -E2,1 -r100 -p.5 -N20 -f1000,5000 -n2 -m25
.B -s40 -g100 -2K50m --heap-sort=yes
.BR --secondary=no ).
.TP
.B ava-pb
PacBio CLR all-vs-all overlap mapping
.RB ( -Hk19
.B -Xw5 -e0
.BR -m100 ).
.TP
.B ava-ont
Oxford Nanopore all-vs-all overlap mapping
.RB ( -k15
.B -Xw5 -e0 -m100
.BR -r2k ).
.RE .RE
.SS Miscellaneous options .SS Miscellaneous options
.TP 10 .TP 10
@@ -589,12 +797,16 @@ s2 i Chaining score of the best secondary chain
NM i Total number of mismatches and gaps in the alignment NM i Total number of mismatches and gaps in the alignment
MD Z To generate the ref sequence in the alignment MD Z To generate the ref sequence in the alignment
AS i DP alignment score AS i DP alignment score
SA Z List of other supplementary alignments (with approximate CIGAR strings)
ms i DP score of the max scoring segment in the alignment ms i DP score of the max scoring segment in the alignment
nn i Number of ambiguous bases in the alignment nn i Number of ambiguous bases in the alignment
ts A Transcript strand (splice mode only) ts A Transcript strand (splice mode only)
cg Z CIGAR string (only in PAF) cg Z CIGAR string (only in PAF)
cs Z Difference string cs Z Difference string
dv f Approximate per-base sequence divergence dv f Approximate per-base sequence divergence
de f Gap-compressed per-base sequence divergence
rl i Length of query regions harboring repetitive seeds
zd i Alignment broken due to Z-drop; bit 1: left broken; bit 2: right broken
.TE .TE
.PP .PP
+5 -5
View File
@@ -116,8 +116,7 @@ long peakrss(void)
double realtime(void) double realtime(void)
{ {
struct timeval tp; struct timeval tp;
struct timezone tzp; gettimeofday(&tp, NULL);
gettimeofday(&tp, &tzp);
return tp.tv_sec + tp.tv_usec * 1e-6; return tp.tv_sec + tp.tv_usec * 1e-6;
} }
@@ -126,7 +125,7 @@ void mm_err_puts(const char *str)
int ret; int ret;
ret = puts(str); ret = puts(str);
if (ret == EOF) { if (ret == EOF) {
fprintf(stderr, "[ERROR] failed to write the results\n"); perror("[ERROR] failed to write the results");
exit(EXIT_FAILURE); exit(EXIT_FAILURE);
} }
} }
@@ -136,7 +135,7 @@ void mm_err_fwrite(const void *p, size_t size, size_t nitems, FILE *fp)
int ret; int ret;
ret = fwrite(p, size, nitems, fp); ret = fwrite(p, size, nitems, fp);
if (ret == EOF) { if (ret == EOF) {
fprintf(stderr, "[ERROR] failed to write data\n"); perror("[ERROR] failed to write data");
exit(EXIT_FAILURE); exit(EXIT_FAILURE);
} }
} }
@@ -146,7 +145,7 @@ void mm_err_fread(void *p, size_t size, size_t nitems, FILE *fp)
int ret; int ret;
ret = fread(p, size, nitems, fp); ret = fread(p, size, nitems, fp);
if (ret == EOF) { if (ret == EOF) {
fprintf(stderr, "[ERROR] failed to read data\n"); perror("[ERROR] failed to read data");
exit(EXIT_FAILURE); exit(EXIT_FAILURE);
} }
} }
@@ -160,3 +159,4 @@ KRADIX_SORT_INIT(128x, mm128_t, sort_key_128x, 8)
KRADIX_SORT_INIT(64, uint64_t, sort_key_64, 8) KRADIX_SORT_INIT(64, uint64_t, sort_key_64, 8)
KSORT_INIT_GENERIC(uint32_t) KSORT_INIT_GENERIC(uint32_t)
KSORT_INIT_GENERIC(uint64_t)
+2 -1
View File
@@ -16,7 +16,8 @@ minimap2 -c test/MT-human.fa test/MT-orang.fa \
| paftools.js liftover -l10000 - <(echo -e "MT_orang\t2000\t5000") # liftOver | paftools.js liftover -l10000 - <(echo -e "MT_orang\t2000\t5000") # liftOver
# no test data for the following examples # no test data for the following examples
paftools.js junceval -e anno.gtf splice.sam > out.txt # compare splice junctions to annotations paftools.js junceval -e anno.gtf splice.sam > out.txt # compare splice junctions to annotations
paftools.js splice2bed anno.gtf > anno.bed # convert GTF/GFF3 to BED12 paftools.js splice2bed splice.sam > splice.bed # convert PAF/SAM to BED12
paftools.js gff2bed anno.gtf > anno.bed # convert GTF/GFF3 to BED12
``` ```
## Table of Contents ## Table of Contents
+241
View File
@@ -0,0 +1,241 @@
#!/usr/bin/env k8
"use strict";
Array.prototype.delete_at = function(i) {
for (let j = i; j < this.length - 1; ++j)
this[j] = this[j + 1];
--this.length;
}
function* getopt(argv, ostr, longopts) {
if (argv.length == 0) return;
let pos = 0, cur = 0;
while (cur < argv.length) {
let lopt = "", opt = "?", arg = "";
while (cur < argv.length) { // skip non-option arguments
if (argv[cur][0] == "-" && argv[cur].length > 1) {
if (argv[cur] == "--") cur = argv.length;
break;
} else ++cur;
}
if (cur == argv.length) break;
let a = argv[cur];
if (a[0] == "-" && a[1] == "-") { // a long option
pos = -1;
let c = 0, k = -1, tmp = "", o;
const pos_eq = a.indexOf("=");
if (pos_eq > 0) {
o = a.substring(2, pos_eq);
arg = a.substring(pos_eq + 1);
} else o = a.substring(2);
for (let i = 0; i < longopts.length; ++i) {
let y = longopts[i];
if (y[y.length - 1] == "=") y = y.substring(0, y.length - 1);
if (o.length <= y.length && o == y.substring(0, o.length)) {
k = i, tmp = y;
++c; // c is the number of matches
if (o == y) { // exact match
c = 1;
break;
}
}
}
if (c == 1) { // find a unique match
lopt = tmp;
if (pos_eq < 0 && longopts[k][longopts[k].length-1] == "=" && cur + 1 < argv.length) {
arg = argv[cur+1];
argv.delete_at(cur + 1);
}
}
} else { // a short option
if (pos == 0) pos = 1;
opt = a[pos++];
let k = ostr.indexOf(opt);
if (k < 0) {
opt = "?";
} else if (k + 1 < ostr.length && ostr[k+1] == ":") { // requiring an argument
if (pos >= a.length) {
arg = argv[cur+1];
argv.delete_at(cur + 1);
} else arg = a.substring(pos);
pos = -1;
}
}
if (pos < 0 || pos >= argv[cur].length) {
argv.delete_at(cur);
pos = 0;
}
if (lopt != "") yield { opt: `--${lopt}`, arg: arg };
else if (opt != "?") yield { opt: `-${opt}`, arg: arg };
else yield { opt: "?", arg: "" };
}
}
function* k8_readline(fn) {
let buf = new Bytes();
let file = new File(fn);
while (file.readline(buf) >= 0) {
yield buf.toString();
}
file.close();
buf.destroy();
}
function merge_hits(b) {
if (b.length == 1)
return { name1:b[0].name1, name2:b[0].name2, len1:b[0].len1, len2:b[0].len2, min_cov:b[0].min_cov, max_cov:b[0].max_cov, cov1:b[0].cov1, cov2:b[0].cov2, s1:b[0].s1, dv:b[0].dv };
b.sort(function(x, y) { return x.st1 - y.st1 });
let f = [], bt = [];
for (let i = 0; i < b.length; ++i)
f[i] = b[i].s1, bt[i] = -1;
for (let i = 0; i < b.length; ++i) {
for (let j = 0; j < i; ++j) {
if (b[j].st2 < b[i].st2) {
if (b[j].en1 >= b[i].en1) continue;
if (b[j].en2 >= b[i].en2) continue;
const ov1 = b[j].en1 <= b[i].st1? 0 : b[i].st1 - b[j].en1;
const li1 = b[i].en1 - b[i].st1;
const s11 = b[i].s1 / li1 * (li1 - ov1);
const ov2 = b[j].en2 <= b[i].st2? 0 : b[i].st2 - b[j].en2;
const li2 = b[i].en2 - b[i].st2;
const s12 = b[i].s1 / li2 * (li2 - ov2);
const s1 = s11 < s12? s11 : s12;
if (f[i] < f[j] + s1)
f[i] = f[j] + s1, bt[i] = j;
}
}
}
let max_i = -1, max_f = 0, d = [];
for (let i = 0; i < b.length; ++i)
if (max_f < f[i])
max_f = f[i], max_i = i;
for (let k = max_i; k >= 0; k = bt[k])
d.push(k);
d = d.reverse();
let dv = 0, tot = 0, cov1 = 0, cov2 = 0, st1 = 0, en1 = 0, st2 = 0, en2 = 0;
for (let k = 0; k < d.length; ++k) {
const i = d[k];
tot += b[i].blen;
dv += b[i].dv * b[i].blen;
if (b[i].st1 > en1) {
cov1 += en1 - st1;
st1 = b[i].st1, en1 = b[i].en1;
} else en1 = en1 > b[i].en1? en1 : b[i].en1;
if (b[i].st2 > en2) {
cov2 += en2 - st2;
st2 = b[i].st2, en2 = b[i].en2;
} else en2 = en2 > b[i].en2? en2 : b[i].en2;
}
dv /= tot;
cov1 = (cov1 + (en1 - st1)) / b[0].len1;
cov2 = (cov2 + (en2 - st2)) / b[0].len2;
const min_cov = cov1 < cov2? cov1 : cov2;
const max_cov = cov1 > cov2? cov1 : cov2;
//warn(d.length, b[0].name1, b[0].name2, min_cov, max_cov);
return { name1:b[0].name1, name2:b[0].name2, len1:b[0].len1, len2:b[0].len2, min_cov:min_cov, max_cov:max_cov, cov1:cov1, cov2:cov2, s1:max_f, dv:dv };
}
function main(args) {
let opt = { min_cov:.9, max_dv:.015, max_diff:20000 };
for (const o of getopt(args, "c:d:e:", [])) {
if (o.opt == '-c') opt.min_cov = parseFloat(o.arg);
else if (o.opt == '-d') opt.max_dv = parseFloat(o.arg);
else if (o.opt == '-e') opt.max_diff = parseFloat(o.arg);
}
if (args.length == 0) {
print("Usage: pafcluster.js [options] <ava.paf>");
print("Options:");
print(` -c FLOAT min coverage [${opt.min_cov}]`);
print(` -d FLOAT max divergence [${opt.max_dv}]`);
print(` -e FLOAT max difference [${opt.max_diff}]`);
return;
}
// read
let a = [], len = {}, name2len = {};
for (const line of k8_readline(args[0])) {
let m, t = line.split("\t");
if (t[4] != "+") continue;
for (let i = 1; i < 4; ++i) t[i] = parseInt(t[i]);
for (let i = 6; i < 11; ++i) t[i] = parseInt(t[i]);
const len1 = t[1], len2 = t[6];
let s1 = -1, dv = -1.0;
for (let i = 12; i < t.length; ++i) {
if ((m = /^(s1|dv):\S:(\S+)/.exec(t[i])) != null) {
if (m[1] == "s1") s1 = parseInt(m[2]);
else if (m[1] == "dv") dv = parseFloat(m[2]);
}
}
if (s1 < 0 || dv < 0) continue;
const cov1 = (parseInt(t[3]) - parseInt(t[2])) / len1;
const cov2 = (parseInt(t[8]) - parseInt(t[7])) / len2;
const min_cov = cov1 < cov2? cov1 : cov2;
const max_cov = cov1 > cov2? cov1 : cov2;
name2len[t[0]] = len1;
name2len[t[5]] = len2;
a.push({ name1:t[0], name2:t[5], len1:len1, len2:len2, min_cov:min_cov, max_cov:max_cov, s1:s1, dv:dv, cov1:cov1, cov2:cov2, st1:t[2], en1:t[3], st2:t[7], en2:t[8], blen:t[10] });
len[t[0]] = len1, len[t[5]] = len2;
}
warn(`Read ${a.length} hits`);
// merge duplicated hits
let h = {};
for (let i = 0; i < a.length; ++i) {
const key = `${a[i].name1}\t${a[i].name2}`;
if (h[key] == null) h[key] = [];
h[key].push(a[i]);
}
a = [];
for (const key in h)
a.push(merge_hits(h[key]));
// core loop
while (a.length > 1) {
// select the sequence with the highest sum of s1
let h = {};
for (let i = 0; i < a.length; ++i) {
if (h[a[i].name1] == null) h[a[i].name1] = 0;
h[a[i].name1] += a[i].s1;
}
let max_s1 = 0, max_name = "";
for (const name in h)
if (max_s1 < h[name])
max_s1 = h[name], max_name = name;
// find contigs in the same group
h = {};
h[max_name] = 1;
for (let i = 0; i < a.length; ++i) {
if (a[i].name1 != max_name && a[i].name2 != max_name)
continue;
const diff1 = a[i].len1 * (1.0 - a[i].cov1);
const diff2 = a[i].len2 * (1.0 - a[i].cov2);
if (a[i].min_cov >= opt.min_cov && a[i].dv <= opt.max_dv && diff1 <= opt.max_diff && diff2 <= opt.max_diff)
h[a[i].name1] = h[a[i].name2] = 1;
}
let n = 0;
for (const key in h) {
++n;
delete name2len[key];
}
print(`SD\t${max_name}\t${n}`);
for (const key in h) print(`CL\t${key}\t${len[key]}`);
print("//");
// filter out redundant hits
let b = [];
for (let i = 0; i < a.length; ++i)
if (h[a[i].name1] == null && h[a[i].name2] == null)
b.push(a[i]);
warn(`Reduced the number of hits from ${a.length} to ${b.length}`);
a = b;
}
// output remaining singletons
for (const key in name2len) {
print(`SD\t${key}\t1`);
print(`CL\t${key}\t${name2len[key]}`);
print(`//`);
}
}
main(arguments);
+1584 -75
View File
File diff suppressed because it is too large Load Diff
+68 -20
View File
@@ -4,6 +4,7 @@
#include <assert.h> #include <assert.h>
#include "minimap.h" #include "minimap.h"
#include "bseq.h" #include "bseq.h"
#include "kseq.h"
#define MM_PARENT_UNSET (-1) #define MM_PARENT_UNSET (-1)
#define MM_PARENT_TMP_PRI (-2) #define MM_PARENT_TMP_PRI (-2)
@@ -12,6 +13,8 @@
#define MM_DBG_PRINT_QNAME 0x2 #define MM_DBG_PRINT_QNAME 0x2
#define MM_DBG_PRINT_SEED 0x4 #define MM_DBG_PRINT_SEED 0x4
#define MM_DBG_PRINT_ALN_SEQ 0x8 #define MM_DBG_PRINT_ALN_SEQ 0x8
#define MM_DBG_PRINT_CHAIN 0x10
#define MM_DBG_SEED_FREQ 0x20
#define MM_SEED_LONG_JOIN (1ULL<<40) #define MM_SEED_LONG_JOIN (1ULL<<40)
#define MM_SEED_IGNORE (1ULL<<41) #define MM_SEED_IGNORE (1ULL<<41)
@@ -21,6 +24,9 @@
#define MM_SEED_SEG_SHIFT 48 #define MM_SEED_SEG_SHIFT 48
#define MM_SEED_SEG_MASK (0xffULL<<(MM_SEED_SEG_SHIFT)) #define MM_SEED_SEG_MASK (0xffULL<<(MM_SEED_SEG_SHIFT))
#define MM_JUNC_ANNO 0x1
#define MM_JUNC_MISC 0x2
#ifndef kroundup32 #ifndef kroundup32
#define kroundup32(x) (--(x), (x)|=(x)>>1, (x)|=(x)>>2, (x)|=(x)>>4, (x)|=(x)>>8, (x)|=(x)>>16, ++(x)) #define kroundup32(x) (--(x), (x)|=(x)>>1, (x)|=(x)>>2, (x)|=(x)>>4, (x)|=(x)>>8, (x)|=(x)>>16, ++(x))
#endif #endif
@@ -30,18 +36,19 @@
#define MALLOC(type, len) ((type*)malloc((len) * sizeof(type))) #define MALLOC(type, len) ((type*)malloc((len) * sizeof(type)))
#define CALLOC(type, len) ((type*)calloc((len), sizeof(type))) #define CALLOC(type, len) ((type*)calloc((len), sizeof(type)))
#define REALLOC(type, ptr, cnt) ((type*)realloc((ptr), (cnt) * sizeof(type)))
#ifdef __cplusplus #ifdef __cplusplus
extern "C" { extern "C" {
#endif #endif
#ifndef KSTRING_T typedef struct {
#define KSTRING_T kstring_t uint32_t n;
typedef struct __kstring_t { uint32_t q_pos;
unsigned l, m; uint32_t q_span:31, flt:1;
char *s; uint32_t seg_id:31, is_tandem:1;
} kstring_t; const uint64_t *cr;
#endif } mm_seed_t;
typedef struct { typedef struct {
int n_u, n_a; int n_u, n_a;
@@ -49,6 +56,12 @@ typedef struct {
mm128_t *a; mm128_t *a;
} mm_seg_t; } mm_seg_t;
typedef struct {
int32_t off, off2, cnt;
int16_t strand;
uint16_t flag;
} mm_idx_jjump1_t;
double cputime(void); double cputime(void);
double realtime(void); double realtime(void);
long peakrss(void); long peakrss(void);
@@ -59,29 +72,52 @@ uint32_t ks_ksmall_uint32_t(size_t n, uint32_t arr[], size_t kk);
void mm_sketch(void *km, const char *str, int len, int w, int k, uint32_t rid, int is_hpc, mm128_v *p); void mm_sketch(void *km, const char *str, int len, int w, int k, uint32_t rid, int is_hpc, mm128_v *p);
void mm_write_sam_hdr(const mm_idx_t *mi, const char *rg, const char *ver, int argc, char *argv[]); mm_seed_t *mm_collect_matches(void *km, int *_n_m, int qlen, int max_occ, int max_max_occ, int dist, const mm_idx_t *mi, const mm128_v *mv, int64_t *n_a, int *rep_len, int *n_mini_pos, uint64_t **mini_pos);
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int opt_flag); void mm_seed_mz_flt(void *km, mm128_v *mv, int32_t q_occ_max, float q_occ_frac);
void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int n_regs, const mm_reg1_t *regs);
void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regs, const mm_reg1_t *const* regs, void *km, int opt_flag);
double mm_event_identity(const mm_reg1_t *r);
int mm_write_sam_hdr(const mm_idx_t *mi, const char *rg, const char *ver, int argc, char *argv[]);
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag);
void mm_write_paf3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag, int rep_len);
void mm_write_paf4(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag, int rep_len, int n_seg, int seg_idx);
void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int n_regs, const mm_reg1_t *regs);
void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regs, const mm_reg1_t *const* regs, void *km, int64_t opt_flag);
void mm_write_sam3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regss, const mm_reg1_t *const* regss, void *km, int64_t opt_flag, int rep_len);
void mm_write_junc(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r);
// indexing related in index.c
void mm_idxopt_init(mm_idxopt_t *opt); void mm_idxopt_init(mm_idxopt_t *opt);
const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n); const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n);
int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f); int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f);
mm128_t *mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int min_cnt, int min_sc, int is_cdna, int n_segs, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km); int mm_idx_getseq2(const mm_idx_t *mi, int is_rev, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq);
mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a); mm_reg1_t *mm_gen_regs(void *km, uint32_t hash, int qlen, int n_u, uint64_t *u, mm128_t *a, int is_qstrand);
int mm_idx_bed_read(mm_idx_t *mi, const char *fn, int read_junc);
int mm_idx_jjump_read(mm_idx_t *mi, const char *fn, int flag, int min_sc);
const mm_idx_jjump1_t *mm_idx_jump_get(const mm_idx_t *db, int32_t cid, int32_t st, int32_t en, int32_t *n);
mm_reg1_t *mm_gen_regs(void *km, uint32_t hash, int qlen, int n_u, uint64_t *u, mm128_t *a); // chaining in lchain.c
void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a); mm128_t *mg_lchain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int max_iter, int min_cnt, int min_sc, float chn_pen_gap, float chn_pen_skip,
int is_cdna, int n_segs, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km);
mm128_t *mg_lchain_rmq(int max_dist, int max_dist_inner, int bw, int max_chn_skip, int cap_rmq_size, int min_cnt, int min_sc, float chn_pen_gap, float chn_pen_skip,
int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km);
void mm_mark_alt(const mm_idx_t *mi, int n, mm_reg1_t *r);
void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a, int is_qstrand);
void mm_sync_regs(void *km, int n_regs, mm_reg1_t *regs); void mm_sync_regs(void *km, int n_regs, mm_reg1_t *regs);
int mm_squeeze_a(void *km, int n_regs, mm_reg1_t *regs, mm128_t *a); int mm_squeeze_a(void *km, int n_regs, mm_reg1_t *regs, mm128_t *a);
int mm_set_sam_pri(int n, mm_reg1_t *r); int mm_set_sam_pri(int n, mm_reg1_t *r);
void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r, int sub_diff, int hard_mask_level); void mm_set_parent(void *km, float mask_level, int mask_len, int n, mm_reg1_t *r, int sub_diff, int hard_mask_level, float alt_diff_frac);
void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int *n_, mm_reg1_t *r); void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int check_strand, int min_strand_sc, int *n_, mm_reg1_t *r);
void mm_select_sub_multi(void *km, float pri_ratio, float pri1, float pri2, int max_gap_ref, int min_diff, int best_n, int n_segs, const int *qlens, int *n_, mm_reg1_t *r); void mm_select_sub_multi(void *km, float pri_ratio, float pri1, float pri2, int max_gap_ref, int min_diff, int best_n, int n_segs, const int *qlens, int *n_, mm_reg1_t *r);
int mm_filter_strand_retained(int n_regs, mm_reg1_t *r);
void mm_filter_regs(const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs); void mm_filter_regs(const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs);
void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs, mm128_t *a); void mm_hit_sort(void *km, int *n_regs, mm_reg1_t *r, float alt_diff_frac);
void mm_hit_sort(void *km, int *n_regs, mm_reg1_t *r); void mm_set_mapq2(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr, int is_splice);
void mm_set_mapq(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr); void mm_update_dp_max(int qlen, int n_regs, mm_reg1_t *regs, float frac, int a, int b);
void mm_jump_split(void *km, const mm_idx_t *mi, const mm_mapopt_t *opt, int32_t qlen, const uint8_t *qseq, mm_reg1_t *r, int32_t ts_strand);
mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a);
void mm_enlarge_cigar(mm_reg1_t *r, uint32_t n_cigar);
void mm_est_err(const mm_idx_t *mi, int qlen, int n_regs, mm_reg1_t *regs, const mm128_t *a, int32_t n, const uint64_t *mini_pos); void mm_est_err(const mm_idx_t *mi, int qlen, int n_regs, mm_reg1_t *regs, const mm128_t *a, int32_t n, const uint64_t *mini_pos);
@@ -89,6 +125,8 @@ mm_seg_t *mm_seg_gen(void *km, uint32_t hash, int n_segs, const int *qlens, int
void mm_seg_free(void *km, int n_segs, mm_seg_t *segs); void mm_seg_free(void *km, int n_segs, mm_seg_t *segs);
void mm_pair(void *km, int max_gap_ref, int dp_bonus, int sub_diff, int match_sc, const int *qlens, int *n_regs, mm_reg1_t **regs); void mm_pair(void *km, int max_gap_ref, int dp_bonus, int sub_diff, int match_sc, const int *qlens, int *n_regs, mm_reg1_t **regs);
void mm_jump_split(void *km, const mm_idx_t *mi, const mm_mapopt_t *opt, int32_t qlen, const uint8_t *qseq, mm_reg1_t *r, int32_t ts_strand);
FILE *mm_split_init(const char *prefix, const mm_idx_t *mi); FILE *mm_split_init(const char *prefix, const mm_idx_t *mi);
mm_idx_t *mm_split_merge_prep(const char *prefix, int n_splits, FILE **fp, uint32_t *n_seq_part); mm_idx_t *mm_split_merge_prep(const char *prefix, int n_splits, FILE **fp, uint32_t *n_seq_part);
int mm_split_merge(int n_segs, const char **fn, const mm_mapopt_t *opt, int n_split_idx); int mm_split_merge(int n_segs, const char **fn, const mm_mapopt_t *opt, int n_split_idx);
@@ -98,6 +136,16 @@ void mm_err_puts(const char *str);
void mm_err_fwrite(const void *p, size_t size, size_t nitems, FILE *fp); void mm_err_fwrite(const void *p, size_t size, size_t nitems, FILE *fp);
void mm_err_fread(void *p, size_t size, size_t nitems, FILE *fp); void mm_err_fread(void *p, size_t size, size_t nitems, FILE *fp);
static inline float mg_log2(float x) // NB: this doesn't work when x<2
{
union { float f; uint32_t i; } z = { x };
float log_2 = ((z.i >> 23) & 255) - 128;
z.i &= ~(255 << 23);
z.i += 127 << 23;
log_2 += (-0.34484843f * z.f + 2.02466578f) * z.f - 0.67487759f;
return log_2;
}
#ifdef __cplusplus #ifdef __cplusplus
} }
#endif #endif
+123 -29
View File
@@ -1,4 +1,5 @@
#include <stdio.h> #include <stdio.h>
#include <limits.h>
#include "mmpriv.h" #include "mmpriv.h"
void mm_idxopt_init(mm_idxopt_t *opt) void mm_idxopt_init(mm_idxopt_t *opt)
@@ -7,7 +8,7 @@ void mm_idxopt_init(mm_idxopt_t *opt)
opt->k = 15, opt->w = 10, opt->flag = 0; opt->k = 15, opt->w = 10, opt->flag = 0;
opt->bucket_bits = 14; opt->bucket_bits = 14;
opt->mini_batch_size = 50000000; opt->mini_batch_size = 50000000;
opt->batch_size = 4000000000ULL; opt->batch_size = 8000000000ULL;
} }
void mm_mapopt_init(mm_mapopt_t *opt) void mm_mapopt_init(mm_mapopt_t *opt)
@@ -15,25 +16,36 @@ void mm_mapopt_init(mm_mapopt_t *opt)
memset(opt, 0, sizeof(mm_mapopt_t)); memset(opt, 0, sizeof(mm_mapopt_t));
opt->seed = 11; opt->seed = 11;
opt->mid_occ_frac = 2e-4f; opt->mid_occ_frac = 2e-4f;
opt->min_mid_occ = 10;
opt->max_mid_occ = 1000000;
opt->sdust_thres = 0; // no SDUST masking opt->sdust_thres = 0; // no SDUST masking
opt->q_occ_frac = 0.01f;
opt->min_cnt = 3; opt->min_cnt = 3;
opt->min_chain_score = 40; opt->min_chain_score = 40;
opt->bw = 500; opt->bw = 500, opt->bw_long = 20000;
opt->max_gap = 5000; opt->max_gap = 5000;
opt->max_gap_ref = -1; opt->max_gap_ref = -1;
opt->max_chain_skip = 25; opt->max_chain_skip = 25;
opt->max_chain_iter = 5000;
opt->rmq_inner_dist = 1000;
opt->rmq_size_cap = 100000;
opt->rmq_rescue_size = 1000;
opt->rmq_rescue_ratio = 0.1f;
opt->chain_gap_scale = 0.8f;
opt->chain_skip_scale = 0.0f;
opt->max_max_occ = 4095;
opt->occ_dist = 500;
opt->mask_level = 0.5f; opt->mask_level = 0.5f;
opt->mask_len = INT_MAX;
opt->pri_ratio = 0.8f; opt->pri_ratio = 0.8f;
opt->best_n = 5; opt->best_n = 5;
opt->max_join_long = 20000; opt->alt_drop = 0.15f;
opt->max_join_short = 2000;
opt->min_join_flank_sc = 1000;
opt->min_join_flank_ratio = 0.5f;
opt->a = 2, opt->b = 4, opt->q = 4, opt->e = 2, opt->q2 = 24, opt->e2 = 1; opt->a = 2, opt->b = 4, opt->q = 4, opt->e = 2, opt->q2 = 24, opt->e2 = 1;
opt->transition = 0;
opt->sc_ambi = 1; opt->sc_ambi = 1;
opt->zdrop = 400, opt->zdrop_inv = 200; opt->zdrop = 400, opt->zdrop_inv = 200;
opt->end_bonus = -1; opt->end_bonus = -1;
@@ -42,19 +54,30 @@ void mm_mapopt_init(mm_mapopt_t *opt)
opt->anchor_ext_len = 20, opt->anchor_ext_shift = 6; opt->anchor_ext_len = 20, opt->anchor_ext_shift = 6;
opt->max_clip_ratio = 1.0f; opt->max_clip_ratio = 1.0f;
opt->mini_batch_size = 500000000; opt->mini_batch_size = 500000000;
opt->max_sw_mat = 100000000;
opt->cap_kalloc = 500000000;
opt->rank_min_len = 500;
opt->rank_frac = 0.9f;
opt->pe_ori = 0; // FF opt->pe_ori = 0; // FF
opt->pe_bonus = 33; opt->pe_bonus = 33;
opt->jump_min_match = 3;
} }
void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi) void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
{ {
if ((opt->flag & MM_F_SPLICE_FOR) || (opt->flag & MM_F_SPLICE_REV)) if ((opt->flag & MM_F_SPLICE_FOR) || (opt->flag & MM_F_SPLICE_REV))
opt->flag |= MM_F_SPLICE; opt->flag |= MM_F_SPLICE;
if (opt->mid_occ <= 0) if (opt->mid_occ <= 0) {
opt->mid_occ = mm_idx_cal_max_occ(mi, opt->mid_occ_frac); opt->mid_occ = mm_idx_cal_max_occ(mi, opt->mid_occ_frac);
if (opt->mid_occ < opt->min_mid_occ) if (opt->mid_occ < opt->min_mid_occ)
opt->mid_occ = opt->min_mid_occ; opt->mid_occ = opt->min_mid_occ;
if (opt->max_mid_occ > opt->min_mid_occ && opt->mid_occ > opt->max_mid_occ)
opt->mid_occ = opt->max_mid_occ;
}
if (opt->bw_long < opt->bw) opt->bw_long = opt->bw;
if (mm_verbose >= 3) if (mm_verbose >= 3)
fprintf(stderr, "[M::%s::%.3f*%.2f] mid_occ = %d\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), opt->mid_occ); fprintf(stderr, "[M::%s::%.3f*%.2f] mid_occ = %d\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), opt->mid_occ);
} }
@@ -62,7 +85,7 @@ void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
void mm_mapopt_max_intron_len(mm_mapopt_t *opt, int max_intron_len) void mm_mapopt_max_intron_len(mm_mapopt_t *opt, int max_intron_len)
{ {
if ((opt->flag & MM_F_SPLICE) && max_intron_len > 0) if ((opt->flag & MM_F_SPLICE) && max_intron_len > 0)
opt->max_gap_ref = opt->bw = max_intron_len; opt->max_gap_ref = opt->bw = opt->bw_long = max_intron_len;
} }
int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo) int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
@@ -70,37 +93,61 @@ int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
if (preset == 0) { if (preset == 0) {
mm_idxopt_init(io); mm_idxopt_init(io);
mm_mapopt_init(mo); mm_mapopt_init(mo);
} else if (strcmp(preset, "lr") == 0 || strcmp(preset, "map-ont") == 0) { // this is the same as the default
} else if (strcmp(preset, "ava-ont") == 0) { } else if (strcmp(preset, "ava-ont") == 0) {
io->flag = 0, io->k = 15, io->w = 5; io->flag = 0, io->k = 15, io->w = 5;
mo->flag |= MM_F_ALL_CHAINS | MM_F_NO_DIAG | MM_F_NO_DUAL | MM_F_NO_LJOIN; mo->flag |= MM_F_ALL_CHAINS | MM_F_NO_DIAG | MM_F_NO_DUAL | MM_F_NO_LJOIN;
mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_gap = 10000, mo->max_chain_skip = 25; mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_chain_skip = 25;
mo->bw = 2000; mo->bw = mo->bw_long = 2000;
mo->occ_dist = 0;
} else if (strcmp(preset, "map10k") == 0 || strcmp(preset, "map-pb") == 0) {
io->flag |= MM_I_HPC, io->k = 19;
} else if (strcmp(preset, "ava-pb") == 0) { } else if (strcmp(preset, "ava-pb") == 0) {
io->flag |= MM_I_HPC, io->k = 19, io->w = 5; io->flag |= MM_I_HPC, io->k = 19, io->w = 5;
mo->flag |= MM_F_ALL_CHAINS | MM_F_NO_DIAG | MM_F_NO_DUAL | MM_F_NO_LJOIN; mo->flag |= MM_F_ALL_CHAINS | MM_F_NO_DIAG | MM_F_NO_DUAL | MM_F_NO_LJOIN;
mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_gap = 10000, mo->max_chain_skip = 25; mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_chain_skip = 25;
} else if (strcmp(preset, "map10k") == 0 || strcmp(preset, "map-pb") == 0) { mo->bw_long = mo->bw;
io->flag |= MM_I_HPC, io->k = 19; mo->occ_dist = 0;
} else if (strcmp(preset, "map-ont") == 0) { } else if (strcmp(preset, "lr:hq") == 0 || strcmp(preset, "map-hifi") == 0 || strcmp(preset, "map-ccs") == 0) {
io->flag = 0, io->k = 19, io->w = 19;
mo->max_gap = 10000;
mo->min_mid_occ = 50, mo->max_mid_occ = 500;
if (strcmp(preset, "map-hifi") == 0 || strcmp(preset, "map-ccs") == 0) {
mo->a = 1, mo->b = 4, mo->q = 6, mo->q2 = 26, mo->e = 2, mo->e2 = 1;
mo->min_dp_max = 200;
}
} else if (strcmp(preset, "lr:hqae") == 0) { // high-quality assembly evaluation
io->flag = 0, io->k = 25, io->w = 51;
mo->flag |= MM_F_RMQ;
mo->min_mid_occ = 50, mo->max_mid_occ = 500;
mo->rmq_inner_dist = 5000;
mo->occ_dist = 200;
mo->best_n = 100;
mo->chain_gap_scale = 5.0f;
} else if (strcmp(preset, "map-iclr-prerender") == 0) {
io->flag = 0, io->k = 15; io->flag = 0, io->k = 15;
} else if (strcmp(preset, "asm5") == 0) { mo->b = 6, mo->transition = 1;
mo->q = 10, mo->q2 = 50;
} else if (strcmp(preset, "map-iclr") == 0) {
io->flag = 0, io->k = 19;
mo->b = 6, mo->transition = 4;
mo->q = 10, mo->q2 = 50;
} else if (strncmp(preset, "asm", 3) == 0) {
io->flag = 0, io->k = 19, io->w = 19; io->flag = 0, io->k = 19, io->w = 19;
mo->bw = 1000, mo->bw_long = 100000;
mo->max_gap = 10000;
mo->flag |= MM_F_RMQ;
mo->min_mid_occ = 50, mo->max_mid_occ = 500;
mo->min_dp_max = 200;
mo->best_n = 50;
if (strcmp(preset, "asm5") == 0) {
mo->a = 1, mo->b = 19, mo->q = 39, mo->q2 = 81, mo->e = 3, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200; mo->a = 1, mo->b = 19, mo->q = 39, mo->q2 = 81, mo->e = 3, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
mo->min_mid_occ = 100;
mo->min_dp_max = 200;
mo->best_n = 50;
} else if (strcmp(preset, "asm10") == 0) { } else if (strcmp(preset, "asm10") == 0) {
io->flag = 0, io->k = 19, io->w = 19;
mo->a = 1, mo->b = 9, mo->q = 16, mo->q2 = 41, mo->e = 2, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200; mo->a = 1, mo->b = 9, mo->q = 16, mo->q2 = 41, mo->e = 2, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
mo->min_mid_occ = 100;
mo->min_dp_max = 200;
mo->best_n = 50;
} else if (strcmp(preset, "asm20") == 0) { } else if (strcmp(preset, "asm20") == 0) {
io->flag = 0, io->k = 19, io->w = 10;
mo->a = 1, mo->b = 4, mo->q = 6, mo->q2 = 26, mo->e = 2, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200; mo->a = 1, mo->b = 4, mo->q = 6, mo->q2 = 26, mo->e = 2, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
mo->min_mid_occ = 100; io->w = 10;
mo->min_dp_max = 200; } else return -1;
mo->best_n = 50;
} else if (strcmp(preset, "short") == 0 || strcmp(preset, "sr") == 0) { } else if (strcmp(preset, "short") == 0 || strcmp(preset, "sr") == 0) {
io->flag = 0, io->k = 21, io->w = 11; io->flag = 0, io->k = 21, io->w = 11;
mo->flag |= MM_F_SR | MM_F_FRAG_MODE | MM_F_NO_PRINT_2ND | MM_F_2_IO_THREADS | MM_F_HEAP_SORT; mo->flag |= MM_F_SR | MM_F_FRAG_MODE | MM_F_NO_PRINT_2ND | MM_F_2_IO_THREADS | MM_F_HEAP_SORT;
@@ -110,7 +157,7 @@ int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
mo->end_bonus = 10; mo->end_bonus = 10;
mo->max_frag_len = 800; mo->max_frag_len = 800;
mo->max_gap = 100; mo->max_gap = 100;
mo->bw = 100; mo->bw = mo->bw_long = 100;
mo->pri_ratio = 0.5f; mo->pri_ratio = 0.5f;
mo->min_cnt = 2; mo->min_cnt = 2;
mo->min_chain_score = 25; mo->min_chain_score = 25;
@@ -119,19 +166,51 @@ int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
mo->mid_occ = 1000; mo->mid_occ = 1000;
mo->max_occ = 5000; mo->max_occ = 5000;
mo->mini_batch_size = 50000000; mo->mini_batch_size = 50000000;
} else if (strcmp(preset, "splice") == 0 || strcmp(preset, "cdna") == 0) { } else if (strcmp(preset, "splice") == 0 || strcmp(preset, "splice:hq") == 0 || strcmp(preset, "splice:sr") == 0 || strcmp(preset, "cdna") == 0) {
io->flag = 0, io->k = 15, io->w = 5; io->flag = 0, io->k = 15, io->w = 5;
mo->flag |= MM_F_SPLICE | MM_F_SPLICE_FOR | MM_F_SPLICE_REV | MM_F_SPLICE_FLANK; mo->flag |= MM_F_SPLICE | MM_F_SPLICE_FOR | MM_F_SPLICE_REV | MM_F_SPLICE_FLANK;
mo->max_gap = 2000, mo->max_gap_ref = mo->bw = 200000; mo->max_sw_mat = 0;
mo->max_gap = 2000, mo->max_gap_ref = mo->bw = mo->bw_long = 200000;
mo->a = 1, mo->b = 2, mo->q = 2, mo->e = 1, mo->q2 = 32, mo->e2 = 0; mo->a = 1, mo->b = 2, mo->q = 2, mo->e = 1, mo->q2 = 32, mo->e2 = 0;
mo->noncan = 9; mo->noncan = 9;
mo->junc_bonus = 9;
mo->junc_pen = 5;
mo->zdrop = 200, mo->zdrop_inv = 100; // because mo->a is halved mo->zdrop = 200, mo->zdrop_inv = 100; // because mo->a is halved
if (strcmp(preset, "splice:hq") == 0) {
mo->noncan = 5, mo->b = 4, mo->q = 6, mo->q2 = 24;
} else if (strcmp(preset, "splice:sr") == 0) {
mo->flag |= MM_F_NO_PRINT_2ND | MM_F_2_IO_THREADS | MM_F_HEAP_SORT | MM_F_FRAG_MODE | MM_F_WEAK_PAIRING | MM_F_SR_RNA;
mo->noncan = 5, mo->b = 4, mo->q = 6, mo->q2 = 24;
mo->min_chain_score = 25;
mo->min_dp_max = 40;
mo->min_ksw_len = 20;
mo->pe_ori = 0<<1|1; // FR
mo->best_n = 10;
mo->mini_batch_size = 100000000;
}
} else return -1; } else return -1;
return 0; return 0;
} }
int mm_max_spsc_bonus(const mm_mapopt_t *mo)
{
int max_sc = (mo->q2 + 1) / 2 - 1;
max_sc = max_sc > mo->q2 - mo->q? max_sc : mo->q2 - mo->q;
return max_sc;
}
int mm_check_opt(const mm_idxopt_t *io, const mm_mapopt_t *mo) int mm_check_opt(const mm_idxopt_t *io, const mm_mapopt_t *mo)
{ {
if (mo->bw > mo->bw_long) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m with '-rNUM1,NUM2', NUM1 (%d) can't be larger than NUM2 (%d)\033[0m\n", mo->bw, mo->bw_long);
return -8;
}
if ((mo->flag & MM_F_RMQ) && (mo->flag & (MM_F_SR|MM_F_SPLICE))) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m --rmq doesn't work with --sr or --splice\033[0m\n");
return -7;
}
if (mo->split_prefix && (mo->flag & (MM_F_OUT_CS|MM_F_OUT_MD))) { if (mo->split_prefix && (mo->flag & (MM_F_OUT_CS|MM_F_OUT_MD))) {
if (mm_verbose >= 1) if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m --cs or --MD doesn't work with --split-prefix\033[0m\n"); fprintf(stderr, "[ERROR]\033[1;31m --cs or --MD doesn't work with --split-prefix\033[0m\n");
@@ -159,6 +238,11 @@ int mm_check_opt(const mm_idxopt_t *io, const mm_mapopt_t *mo)
fprintf(stderr, "[ERROR]\033[1;31m --for-only and --rev-only can't be applied at the same time\033[0m\n"); fprintf(stderr, "[ERROR]\033[1;31m --for-only and --rev-only can't be applied at the same time\033[0m\n");
return -3; return -3;
} }
if (mo->e <= 0 || mo->q <= 0) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m -O and -E must be positive\033[0m\n");
return -1;
}
if ((mo->q != mo->q2 || mo->e != mo->e2) && !(mo->e > mo->e2 && mo->q + mo->e < mo->q2 + mo->e2)) { if ((mo->q != mo->q2 || mo->e != mo->e2) && !(mo->e > mo->e2 && mo->q + mo->e < mo->q2 + mo->e2)) {
if (mm_verbose >= 1) if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m dual gap penalties violating E1>E2 and O1+E1<O2+E2\033[0m\n"); fprintf(stderr, "[ERROR]\033[1;31m dual gap penalties violating E1>E2 and O1+E1<O2+E2\033[0m\n");
@@ -169,6 +253,11 @@ int mm_check_opt(const mm_idxopt_t *io, const mm_mapopt_t *mo)
fprintf(stderr, "[ERROR]\033[1;31m scoring system violating ({-O}+{-E})+({-O2}+{-E2}) <= 127\033[0m\n"); fprintf(stderr, "[ERROR]\033[1;31m scoring system violating ({-O}+{-E})+({-O2}+{-E2}) <= 127\033[0m\n");
return -1; return -1;
} }
if (mo->sc_ambi < 0 || mo->sc_ambi >= mo->b) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m --score-N should be within [0,{-B})\033[0m\n");
return -1;
}
if (mo->zdrop < mo->zdrop_inv) { if (mo->zdrop < mo->zdrop_inv) {
if (mm_verbose >= 1) if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m Z-drop should not be less than inversion-Z-drop\033[0m\n"); fprintf(stderr, "[ERROR]\033[1;31m Z-drop should not be less than inversion-Z-drop\033[0m\n");
@@ -179,5 +268,10 @@ int mm_check_opt(const mm_idxopt_t *io, const mm_mapopt_t *mo)
fprintf(stderr, "[ERROR]\033[1;31m -X/-P and --secondary=no can't be applied at the same time\033[0m\n"); fprintf(stderr, "[ERROR]\033[1;31m -X/-P and --secondary=no can't be applied at the same time\033[0m\n");
return -5; return -5;
} }
if ((mo->flag & MM_F_QSTRAND) && ((mo->flag & (MM_F_OUT_SAM|MM_F_SPLICE|MM_F_FRAG_MODE)) || (io->flag & MM_I_HPC))) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m --qstrand doesn't work with -a, -H, --frag or --splice\033[0m\n");
return -5;
}
return 0; return 0;
} }
+1 -1
View File
@@ -54,7 +54,7 @@ void mm_set_pe_thru(const int *qlens, int *n_regs, mm_reg1_t **regs)
if (n_pri[0] == 1 && n_pri[1] == 1) { if (n_pri[0] == 1 && n_pri[1] == 1) {
mm_reg1_t *p = &regs[0][pri[0]]; mm_reg1_t *p = &regs[0][pri[0]];
mm_reg1_t *q = &regs[1][pri[1]]; mm_reg1_t *q = &regs[1][pri[1]];
if (p->rid == q->rid && p->rev == q->rev && abs(p->rs - q->rs) < 3 && abs(p->re - p->re) < 3 if (p->rid == q->rid && p->rev == q->rev && abs(p->rs - q->rs) < 3 && abs(p->re - q->re) < 3
&& ((p->qs == 0 && qlens[1] - q->qe == 0) || (q->qs == 0 && qlens[0] - p->qe == 0))) && ((p->qs == 0 && qlens[1] - q->qe == 0) || (q->qs == 0 && qlens[0] - p->qe == 0)))
{ {
p->pe_thru = q->pe_thru = 1; p->pe_thru = q->pe_thru = 1;
+2
View File
@@ -0,0 +1,2 @@
[build-system]
requires = ["setuptools", "wheel", "Cython"]
+10 -2
View File
@@ -77,7 +77,9 @@ This constructor accepts the following arguments:
* **min_chain_score**: minimum chaing score * **min_chain_score**: minimum chaing score
* **bw**: chaining and alignment band width * **bw**: chaining and alignment band width (initial chaining and extension)
* **bw_long**: chaining and alignment band width (RMQ-based rechaining and closing gaps)
* **best_n**: max number of alignments to return * **best_n**: max number of alignments to return
@@ -114,6 +116,12 @@ This method retrieves a (sub)sequence from the index and returns it as a Python
string. :code:`None` is returned if :code:`name` is not present in the index or string. :code:`None` is returned if :code:`name` is not present in the index or
the start/end coordinates are invalid. the start/end coordinates are invalid.
.. code:: python
mappy.Aligner.seq_names
This property gives the array of sequence names in the index.
Class mappy.Alignment Class mappy.Alignment
~~~~~~~~~~~~~~~~~~~~~ ~~~~~~~~~~~~~~~~~~~~~
@@ -138,7 +146,7 @@ properties:
* **mlen**: length of the matching bases in the alignment, excluding ambiguous * **mlen**: length of the matching bases in the alignment, excluding ambiguous
base matches. base matches.
* **NM**: number of mismatches, gaps and ambiguous poistions in the alignment * **NM**: number of mismatches, gaps and ambiguous positions in the alignment
* **trans_strand**: transcript strand. +1 if on the forward strand; -1 if on the * **trans_strand**: transcript strand. +1 if on the forward strand; -1 if on the
reverse strand; 0 if unknown reverse strand; 0 if unknown
+3 -3
View File
@@ -71,13 +71,13 @@ static inline void mm_reset_timer(void)
} }
extern unsigned char seq_comp_table[256]; extern unsigned char seq_comp_table[256];
static inline mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char *seq1, const char *seq2, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt) static inline mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char* seqname, const char *seq1, const char *seq2, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt)
{ {
mm_reg1_t *r; mm_reg1_t *r;
Py_BEGIN_ALLOW_THREADS Py_BEGIN_ALLOW_THREADS
if (seq2 == 0) { if (seq2 == 0) {
r = mm_map(mi, strlen(seq1), seq1, n_regs, b, opt, NULL); r = mm_map(mi, strlen(seq1), seq1, n_regs, b, opt, seqname);
} else { } else {
int _n_regs[2]; int _n_regs[2];
mm_reg1_t *regs[2]; mm_reg1_t *regs[2];
@@ -94,7 +94,7 @@ static inline mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char *seq1, const
seq[1][i] = seq_comp_table[t]; seq[1][i] = seq_comp_table[t];
} }
if (len[1]&1) seq[1][len[1]>>1] = seq_comp_table[(uint8_t)seq[1][len[1]>>1]]; if (len[1]&1) seq[1][len[1]>>1] = seq_comp_table[(uint8_t)seq[1][len[1]>>1]];
mm_map_frag(mi, 2, len, (const char**)seq, _n_regs, regs, b, opt, NULL); mm_map_frag(mi, 2, len, (const char**)seq, _n_regs, regs, b, opt, seqname);
for (i = 0; i < _n_regs[1]; ++i) for (i = 0; i < _n_regs[1]; ++i)
regs[1][i].rev = !regs[1][i].rev; regs[1][i].rev = !regs[1][i].rev;
*n_regs = _n_regs[0] + _n_regs[1]; *n_regs = _n_regs[0] + _n_regs[1];
+32 -9
View File
@@ -6,40 +6,63 @@ cdef extern from "minimap.h":
# #
ctypedef struct mm_idxopt_t: ctypedef struct mm_idxopt_t:
short k, w, flag, bucket_bits short k, w, flag, bucket_bits
int mini_batch_size int64_t mini_batch_size
uint64_t batch_size uint64_t batch_size
ctypedef struct mm_mapopt_t: ctypedef struct mm_mapopt_t:
int64_t flag
int seed int seed
int sdust_thres int sdust_thres
int flag
int bw int max_qlen
int bw, bw_long
int max_gap, max_gap_ref int max_gap, max_gap_ref
int max_frag_len int max_frag_len
int max_chain_skip int max_chain_skip, max_chain_iter
int min_cnt int min_cnt
int min_chain_score int min_chain_score
float chain_gap_scale
float chain_skip_scale
int rmq_size_cap, rmq_inner_dist
int rmq_rescue_size
float rmq_rescue_ratio
float mask_level float mask_level
int mask_len
float pri_ratio float pri_ratio
int best_n int best_n
int max_join_long, max_join_short
int min_join_flank_sc float alt_drop
float min_join_flank_ratio;
int a, b, q, e, q2, e2 int a, b, q, e, q2, e2
int transition
int sc_ambi int sc_ambi
int noncan int noncan
int junc_bonus, junc_pen
int zdrop, zdrop_inv int zdrop, zdrop_inv
int end_bonus int end_bonus
int min_dp_max int min_dp_max
int min_ksw_len int min_ksw_len
int anchor_ext_len, anchor_ext_shift int anchor_ext_len, anchor_ext_shift
float max_clip_ratio float max_clip_ratio
int rank_min_len
float rank_frac
int pe_ori, pe_bonus int pe_ori, pe_bonus
int jump_min_match;
float mid_occ_frac float mid_occ_frac
float q_occ_frac
int32_t min_mid_occ int32_t min_mid_occ
int32_t mid_occ int32_t mid_occ
int32_t max_occ int32_t max_occ
int mini_batch_size int64_t mini_batch_size
int64_t max_sw_mat
int64_t cap_kalloc
const char *split_prefix const char *split_prefix
int mm_set_opt(char *preset, mm_idxopt_t *io, mm_mapopt_t *mo) int mm_set_opt(char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
@@ -108,7 +131,7 @@ cdef extern from "cmappy.h":
void mm_reg2hitpy(const mm_idx_t *mi, mm_reg1_t *r, mm_hitpy_t *h) void mm_reg2hitpy(const mm_idx_t *mi, mm_reg1_t *r, mm_hitpy_t *h)
void mm_free_reg1(mm_reg1_t *r) void mm_free_reg1(mm_reg1_t *r)
mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char *seq1, const char *seq2, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt) mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char* seqname, const char *seq1, const char *seq2, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt)
char *mappy_fetch_seq(const mm_idx_t *mi, const char *name, int st, int en, int *l) char *mappy_fetch_seq(const mm_idx_t *mi, const char *name, int st, int en, int *l)
mm_idx_t *mappy_idx_seq(int w, int k, int is_hpc, int bucket_bits, const char *seq, int l) mm_idx_t *mappy_idx_seq(int w, int k, int is_hpc, int bucket_bits, const char *seq, int l)
+49 -11
View File
@@ -3,7 +3,7 @@ from libc.stdlib cimport free
cimport cmappy cimport cmappy
import sys import sys
__version__ = '2.13' __version__ = '2.30'
cmappy.mm_reset_timer() cmappy.mm_reset_timer()
@@ -82,7 +82,7 @@ cdef class Alignment:
@property @property
def cigar_str(self): def cigar_str(self):
return "".join(map(lambda x: str(x[0]) + 'MIDNSH'[x[1]], self._cigar)) return "".join(map(lambda x: str(x[0]) + 'MIDNSHP=XB'[x[1]], self._cigar))
def __str__(self): def __str__(self):
if self._strand > 0: strand = '+' if self._strand > 0: strand = '+'
@@ -96,6 +96,7 @@ cdef class Alignment:
a = [str(self._q_st), str(self._q_en), strand, self._ctg, str(self._ctg_len), str(self._r_st), str(self._r_en), a = [str(self._q_st), str(self._q_en), strand, self._ctg, str(self._ctg_len), str(self._r_st), str(self._r_en),
str(self._mlen), str(self._blen), str(self._mapq), tp, ts, "cg:Z:" + self.cigar_str] str(self._mlen), str(self._blen), str(self._mapq), tp, ts, "cg:Z:" + self.cigar_str]
if self._cs != "": a.append("cs:Z:" + self._cs) if self._cs != "": a.append("cs:Z:" + self._cs)
if self._MD != "": a.append("MD:Z:" + self._MD)
return "\t".join(a) return "\t".join(a)
cdef class ThreadBuffer: cdef class ThreadBuffer:
@@ -112,7 +113,8 @@ cdef class Aligner:
cdef cmappy.mm_idxopt_t idx_opt cdef cmappy.mm_idxopt_t idx_opt
cdef cmappy.mm_mapopt_t map_opt cdef cmappy.mm_mapopt_t map_opt
def __cinit__(self, fn_idx_in=None, preset=None, k=None, w=None, min_cnt=None, min_chain_score=None, min_dp_score=None, bw=None, best_n=None, n_threads=3, fn_idx_out=None, max_frag_len=None, extra_flags=None, seq=None, scoring=None): def __cinit__(self, fn_idx_in=None, preset=None, k=None, w=None, min_cnt=None, min_chain_score=None, min_dp_score=None, bw=None, bw_long=None, best_n=None, n_threads=3, fn_idx_out=None, max_frag_len=None, extra_flags=None, seq=None, scoring=None, sc_ambi=None, max_chain_skip=None):
self._idx = NULL
cmappy.mm_set_opt(NULL, &self.idx_opt, &self.map_opt) # set the default options cmappy.mm_set_opt(NULL, &self.idx_opt, &self.map_opt) # set the default options
if preset is not None: if preset is not None:
cmappy.mm_set_opt(str.encode(preset), &self.idx_opt, &self.map_opt) # apply preset cmappy.mm_set_opt(str.encode(preset), &self.idx_opt, &self.map_opt) # apply preset
@@ -124,6 +126,7 @@ cdef class Aligner:
if min_chain_score is not None: self.map_opt.min_chain_score = min_chain_score if min_chain_score is not None: self.map_opt.min_chain_score = min_chain_score
if min_dp_score is not None: self.map_opt.min_dp_max = min_dp_score if min_dp_score is not None: self.map_opt.min_dp_max = min_dp_score
if bw is not None: self.map_opt.bw = bw if bw is not None: self.map_opt.bw = bw
if bw_long is not None: self.map_opt.bw_long = bw_long
if best_n is not None: self.map_opt.best_n = best_n if best_n is not None: self.map_opt.best_n = best_n
if max_frag_len is not None: self.map_opt.max_frag_len = max_frag_len if max_frag_len is not None: self.map_opt.max_frag_len = max_frag_len
if extra_flags is not None: self.map_opt.flag |= extra_flags if extra_flags is not None: self.map_opt.flag |= extra_flags
@@ -135,6 +138,8 @@ cdef class Aligner:
self.map_opt.q2, self.map_opt.e2 = scoring[4], scoring[5] self.map_opt.q2, self.map_opt.e2 = scoring[4], scoring[5]
if len(scoring) >= 7: if len(scoring) >= 7:
self.map_opt.sc_ambi = scoring[6] self.map_opt.sc_ambi = scoring[6]
if sc_ambi is not None: self.map_opt.sc_ambi = sc_ambi
if max_chain_skip is not None: self.map_opt.max_chain_skip = max_chain_skip
cdef cmappy.mm_idx_reader_t *r; cdef cmappy.mm_idx_reader_t *r;
@@ -142,7 +147,7 @@ cdef class Aligner:
if fn_idx_out is None: if fn_idx_out is None:
r = cmappy.mm_idx_reader_open(str.encode(fn_idx_in), &self.idx_opt, NULL) r = cmappy.mm_idx_reader_open(str.encode(fn_idx_in), &self.idx_opt, NULL)
else: else:
r = cmappy.mm_idx_reader_open(str.encode(fn_idx_in), &self.idx_opt, fn_idx_out) r = cmappy.mm_idx_reader_open(str.encode(fn_idx_in), &self.idx_opt, str.encode(fn_idx_out))
if r is not NULL: if r is not NULL:
self._idx = cmappy.mm_idx_reader_read(r, n_threads) # NB: ONLY read the first part self._idx = cmappy.mm_idx_reader_read(r, n_threads) # NB: ONLY read the first part
cmappy.mm_idx_reader_close(r) cmappy.mm_idx_reader_close(r)
@@ -160,7 +165,7 @@ cdef class Aligner:
def __bool__(self): def __bool__(self):
return (self._idx != NULL) return (self._idx != NULL)
def map(self, seq, seq2=None, buf=None, cs=False, MD=False, max_frag_len=None, extra_flags=None): def map(self, seq, seq2=None, name=None, buf=None, cs=False, MD=False, max_frag_len=None, extra_flags=None):
cdef cmappy.mm_reg1_t *regs cdef cmappy.mm_reg1_t *regs
cdef cmappy.mm_hitpy_t h cdef cmappy.mm_hitpy_t h
cdef ThreadBuffer b cdef ThreadBuffer b
@@ -170,6 +175,8 @@ cdef class Aligner:
cdef void *km cdef void *km
cdef cmappy.mm_mapopt_t map_opt cdef cmappy.mm_mapopt_t map_opt
if self._idx == NULL: return
if ((self.map_opt.flag & 4) and (self._idx.flag & 2)): return
map_opt = self.map_opt map_opt = self.map_opt
if max_frag_len is not None: map_opt.max_frag_len = max_frag_len if max_frag_len is not None: map_opt.max_frag_len = max_frag_len
if extra_flags is not None: map_opt.flag |= extra_flags if extra_flags is not None: map_opt.flag |= extra_flags
@@ -180,33 +187,53 @@ cdef class Aligner:
km = cmappy.mm_tbuf_get_km(b._b) km = cmappy.mm_tbuf_get_km(b._b)
_seq = seq if isinstance(seq, bytes) else seq.encode() _seq = seq if isinstance(seq, bytes) else seq.encode()
if name is not None:
_name = name if isinstance(name, bytes) else name.encode()
if seq2 is None: if seq2 is None:
regs = cmappy.mm_map_aux(self._idx, _seq, NULL, &n_regs, b._b, &map_opt) if name is None:
regs = cmappy.mm_map_aux(self._idx, NULL, _seq, NULL, &n_regs, b._b, &map_opt)
else:
regs = cmappy.mm_map_aux(self._idx, _name, _seq, NULL, &n_regs, b._b, &map_opt)
else: else:
_seq2 = seq2 if isinstance(seq2, bytes) else seq2.encode() _seq2 = seq2 if isinstance(seq2, bytes) else seq2.encode()
regs = cmappy.mm_map_aux(self._idx, _seq, _seq2, &n_regs, b._b, &map_opt) if name is None:
regs = cmappy.mm_map_aux(self._idx, NULL, _seq, _seq2, &n_regs, b._b, &map_opt)
else:
regs = cmappy.mm_map_aux(self._idx, _name, _seq, _seq2, &n_regs, b._b, &map_opt)
for i in range(n_regs): try:
i = 0
while i < n_regs:
cmappy.mm_reg2hitpy(self._idx, &regs[i], &h) cmappy.mm_reg2hitpy(self._idx, &regs[i], &h)
cigar, _cs, _MD = [], '', '' cigar, _cs, _MD = [], '', ''
for k in range(h.n_cigar32): # convert the 32-bit CIGAR encoding to Python array for k in range(h.n_cigar32): # convert the 32-bit CIGAR encoding to Python array
c = h.cigar32[k] c = h.cigar32[k]
cigar.append([c>>4, c&0xf]) cigar.append([c>>4, c&0xf])
if cs or MD: # generate the cs and/or the MD tag, if requested if cs or MD: # generate the cs and/or the MD tag, if requested
_cur_seq = _seq2 if h.seg_id > 0 and seq2 is not None else _seq
if cs: if cs:
l_cs_str = cmappy.mm_gen_cs(km, &cs_str, &m_cs_str, self._idx, &regs[i], _seq, 1) l_cs_str = cmappy.mm_gen_cs(km, &cs_str, &m_cs_str, self._idx, &regs[i], _cur_seq, 1)
_cs = cs_str[:l_cs_str] if isinstance(cs_str, str) else cs_str[:l_cs_str].decode() _cs = cs_str[:l_cs_str] if isinstance(cs_str, str) else cs_str[:l_cs_str].decode()
if MD: if MD:
l_cs_str = cmappy.mm_gen_MD(km, &cs_str, &m_cs_str, self._idx, &regs[i], _seq) l_cs_str = cmappy.mm_gen_MD(km, &cs_str, &m_cs_str, self._idx, &regs[i], _cur_seq)
_MD = cs_str[:l_cs_str] if isinstance(cs_str, str) else cs_str[:l_cs_str].decode() _MD = cs_str[:l_cs_str] if isinstance(cs_str, str) else cs_str[:l_cs_str].decode()
yield Alignment(h.ctg, h.ctg_len, h.ctg_start, h.ctg_end, h.strand, h.qry_start, h.qry_end, h.mapq, cigar, h.is_primary, h.mlen, h.blen, h.NM, h.trans_strand, h.seg_id, _cs, _MD) yield Alignment(h.ctg, h.ctg_len, h.ctg_start, h.ctg_end, h.strand, h.qry_start, h.qry_end, h.mapq, cigar, h.is_primary, h.mlen, h.blen, h.NM, h.trans_strand, h.seg_id, _cs, _MD)
cmappy.mm_free_reg1(&regs[i]) cmappy.mm_free_reg1(&regs[i])
i += 1
finally:
while i < n_regs:
cmappy.mm_free_reg1(&regs[i])
i += 1
free(regs) free(regs)
free(cs_str) free(cs_str)
def seq(self, str name, int start=0, int end=0x7fffffff): def seq(self, str name, int start=0, int end=0x7fffffff):
cdef int l cdef int l
cdef char *s = cmappy.mappy_fetch_seq(self._idx, name.encode(), start, end, &l) cdef char *s
if self._idx == NULL: return
if ((self.map_opt.flag & 4) and (self._idx.flag & 2)): return
s = cmappy.mappy_fetch_seq(self._idx, name.encode(), start, end, &l)
if l == 0: return None if l == 0: return None
r = s[:l] if isinstance(s, str) else s[:l].decode() r = s[:l] if isinstance(s, str) else s[:l].decode()
free(s) free(s)
@@ -221,6 +248,17 @@ cdef class Aligner:
@property @property
def n_seq(self): return self._idx.n_seq def n_seq(self): return self._idx.n_seq
@property
def seq_names(self):
cdef char *p
if self._idx == NULL: return
sn = []
for i in range(self._idx.n_seq):
p = self._idx.seq[i].name
s = p if isinstance(p, str) else p.decode()
sn.append(s)
return sn
def fastx_read(fn, read_comment=False): def fastx_read(fn, read_comment=False):
cdef cmappy.kseq_t *ks cdef cmappy.kseq_t *ks
ks = cmappy.mm_fastx_open(str.encode(fn)) ks = cmappy.mm_fastx_open(str.encode(fn))
+5 -3
View File
@@ -5,7 +5,7 @@ import getopt
import mappy as mp import mappy as mp
def main(argv): def main(argv):
opts, args = getopt.getopt(argv[1:], "x:n:m:k:w:r:c") opts, args = getopt.getopt(argv[1:], "x:n:m:k:w:r:cM")
if len(args) < 2: if len(args) < 2:
print("Usage: minimap2.py [options] <ref.fa>|<ref.mmi> <query.fq>") print("Usage: minimap2.py [options] <ref.fa>|<ref.mmi> <query.fq>")
print("Options:") print("Options:")
@@ -16,10 +16,11 @@ def main(argv):
print(" -w INT minimizer window length") print(" -w INT minimizer window length")
print(" -r INT band width") print(" -r INT band width")
print(" -c output the cs tag") print(" -c output the cs tag")
print(" -M output the MD tag")
sys.exit(1) sys.exit(1)
preset = min_cnt = min_sc = k = w = bw = None preset = min_cnt = min_sc = k = w = bw = None
out_cs = False out_cs = out_MD = False
for opt, arg in opts: for opt, arg in opts:
if opt == '-x': preset = arg if opt == '-x': preset = arg
elif opt == '-n': min_cnt = int(arg) elif opt == '-n': min_cnt = int(arg)
@@ -28,11 +29,12 @@ def main(argv):
elif opt == '-k': k = int(arg) elif opt == '-k': k = int(arg)
elif opt == '-w': w = int(arg) elif opt == '-w': w = int(arg)
elif opt == '-c': out_cs = True elif opt == '-c': out_cs = True
elif opt == '-M': out_MD = True
a = mp.Aligner(args[0], preset=preset, min_cnt=min_cnt, min_chain_score=min_sc, k=k, w=w, bw=bw) a = mp.Aligner(args[0], preset=preset, min_cnt=min_cnt, min_chain_score=min_sc, k=k, w=w, bw=bw)
if not a: raise Exception("ERROR: failed to load/build index file '{}'".format(args[0])) if not a: raise Exception("ERROR: failed to load/build index file '{}'".format(args[0]))
for name, seq, qual in mp.fastx_read(args[1]): # read one sequence for name, seq, qual in mp.fastx_read(args[1]): # read one sequence
for h in a.map(seq, cs=out_cs): # traverse hits for h in a.map(seq, cs=out_cs, MD=out_MD): # traverse hits
print('{}\t{}\t{}'.format(name, len(seq), h)) print('{}\t{}\t{}'.format(name, len(seq), h))
if __name__ == "__main__": if __name__ == "__main__":
+132
View File
@@ -0,0 +1,132 @@
#include "mmpriv.h"
#include "kalloc.h"
#include "ksort.h"
void mm_seed_mz_flt(void *km, mm128_v *mv, int32_t q_occ_max, float q_occ_frac)
{
mm128_t *a;
size_t i, j, st;
if (mv->n <= q_occ_max || q_occ_frac <= 0.0f || q_occ_max <= 0) return;
a = Kmalloc(km, mm128_t, mv->n);
for (i = 0; i < mv->n; ++i)
a[i].x = mv->a[i].x, a[i].y = i;
radix_sort_128x(a, a + mv->n);
for (st = 0, i = 1; i <= mv->n; ++i) {
if (i == mv->n || a[i].x != a[st].x) {
int32_t cnt = i - st;
if (cnt > q_occ_max && cnt > mv->n * q_occ_frac)
for (j = st; j < i; ++j)
mv->a[a[j].y].x = 0;
st = i;
}
}
kfree(km, a);
for (i = j = 0; i < mv->n; ++i)
if (mv->a[i].x != 0)
mv->a[j++] = mv->a[i];
mv->n = j;
}
mm_seed_t *mm_seed_collect_all(void *km, const mm_idx_t *mi, const mm128_v *mv, int32_t *n_m_)
{
mm_seed_t *m;
size_t i;
int32_t k;
m = (mm_seed_t*)kmalloc(km, mv->n * sizeof(mm_seed_t));
for (i = k = 0; i < mv->n; ++i) {
const uint64_t *cr;
mm_seed_t *q;
mm128_t *p = &mv->a[i];
uint32_t q_pos = (uint32_t)p->y, q_span = p->x & 0xff;
int t;
cr = mm_idx_get(mi, p->x>>8, &t);
if (t == 0) continue;
q = &m[k++];
q->q_pos = q_pos, q->q_span = q_span, q->cr = cr, q->n = t, q->seg_id = p->y >> 32;
q->is_tandem = q->flt = 0;
if (i > 0 && p->x>>8 == mv->a[i - 1].x>>8) q->is_tandem = 1;
if (i < mv->n - 1 && p->x>>8 == mv->a[i + 1].x>>8) q->is_tandem = 1;
}
*n_m_ = k;
return m;
}
#define MAX_MAX_HIGH_OCC 128
void mm_seed_select(int32_t n, mm_seed_t *a, int len, int max_occ, int max_max_occ, int dist)
{ // for high-occ minimizers, choose up to max_high_occ in each high-occ streak
extern void ks_heapdown_uint64_t(size_t i, size_t n, uint64_t*);
extern void ks_heapmake_uint64_t(size_t n, uint64_t*);
int32_t i, last0, m;
uint64_t b[MAX_MAX_HIGH_OCC]; // this is to avoid a heap allocation
if (n == 0 || n == 1) return;
for (i = m = 0; i < n; ++i)
if (a[i].n > max_occ) ++m;
if (m == 0) return; // no high-frequency k-mers; do nothing
for (i = 0, last0 = -1; i <= n; ++i) {
if (i == n || a[i].n <= max_occ) {
if (i - last0 > 1) {
int32_t ps = last0 < 0? 0 : (uint32_t)a[last0].q_pos>>1;
int32_t pe = i == n? len : (uint32_t)a[i].q_pos>>1;
int32_t j, k, st = last0 + 1, en = i;
int32_t max_high_occ = (int32_t)((double)(pe - ps) / dist + .499);
if (max_high_occ > 0) {
if (max_high_occ > MAX_MAX_HIGH_OCC)
max_high_occ = MAX_MAX_HIGH_OCC;
for (j = st, k = 0; j < en && k < max_high_occ; ++j, ++k)
b[k] = (uint64_t)a[j].n<<32 | j;
ks_heapmake_uint64_t(k, b); // initialize the binomial heap
for (; j < en; ++j) { // if there are more, choose top max_high_occ
if (a[j].n < (int32_t)(b[0]>>32)) { // then update the heap
b[0] = (uint64_t)a[j].n<<32 | j;
ks_heapdown_uint64_t(0, k, b);
}
}
for (j = 0; j < k; ++j) a[(uint32_t)b[j]].flt = 1;
}
for (j = st; j < en; ++j) a[j].flt ^= 1;
for (j = st; j < en; ++j)
if (a[j].n > max_max_occ)
a[j].flt = 1;
}
last0 = i;
}
}
}
mm_seed_t *mm_collect_matches(void *km, int *_n_m, int qlen, int max_occ, int max_max_occ, int dist, const mm_idx_t *mi, const mm128_v *mv, int64_t *n_a, int *rep_len, int *n_mini_pos, uint64_t **mini_pos)
{
int rep_st = 0, rep_en = 0, n_m, n_m0;
size_t i;
mm_seed_t *m;
*n_mini_pos = 0;
*mini_pos = (uint64_t*)kmalloc(km, mv->n * sizeof(uint64_t));
m = mm_seed_collect_all(km, mi, mv, &n_m0);
if (dist > 0 && max_max_occ > max_occ) {
mm_seed_select(n_m0, m, qlen, max_occ, max_max_occ, dist);
} else {
for (i = 0; i < n_m0; ++i)
if (m[i].n > max_occ)
m[i].flt = 1;
}
for (i = 0, n_m = 0, *rep_len = 0, *n_a = 0; i < n_m0; ++i) {
mm_seed_t *q = &m[i];
if (mm_dbg_flag & MM_DBG_SEED_FREQ)
fprintf(stderr, "SF\t%d\t%d\t%d\n", q->q_pos>>1, q->n, q->flt);
if (q->flt) {
int en = (q->q_pos >> 1) + 1, st = en - q->q_span;
if (st > rep_en) {
*rep_len += rep_en - rep_st;
rep_st = st, rep_en = en;
} else rep_en = en;
} else {
*n_a += q->n;
(*mini_pos)[(*n_mini_pos)++] = (uint64_t)q->q_span<<32 | q->q_pos>>1;
m[n_m++] = *q;
}
}
*rep_len += rep_en - rep_st;
*_n_m = n_m;
return m;
}
+3 -13
View File
@@ -4,16 +4,6 @@ except ImportError:
from distutils.core import setup from distutils.core import setup
from distutils.extension import Extension from distutils.extension import Extension
cmdclass = {}
try:
from Cython.Build import build_ext
except ImportError: # without Cython
module_src = 'python/mappy.c'
else: # with Cython
module_src = 'python/mappy.pyx'
cmdclass['build_ext'] = build_ext
import sys, platform import sys, platform
sys.path.append('python') sys.path.append('python')
@@ -33,7 +23,7 @@ def readme():
setup( setup(
name = 'mappy', name = 'mappy',
version = '2.13', version = '2.30',
url = 'https://github.com/lh3/minimap2', url = 'https://github.com/lh3/minimap2',
description = 'Minimap2 python binding', description = 'Minimap2 python binding',
long_description = readme(), long_description = readme(),
@@ -43,7 +33,7 @@ setup(
keywords = 'sequence-alignment', keywords = 'sequence-alignment',
scripts = ['python/minimap2.py'], scripts = ['python/minimap2.py'],
ext_modules = [Extension('mappy', ext_modules = [Extension('mappy',
sources = [module_src, 'align.c', 'bseq.c', 'chain.c', 'format.c', 'hit.c', 'index.c', 'pe.c', 'options.c', sources = ['python/mappy.pyx', 'align.c', 'bseq.c', 'lchain.c', 'seed.c', 'format.c', 'hit.c', 'index.c', 'pe.c', 'jump.c', 'options.c',
'ksw2_extd2_sse.c', 'ksw2_exts2_sse.c', 'ksw2_extz2_sse.c', 'ksw2_ll_sse.c', 'ksw2_extd2_sse.c', 'ksw2_exts2_sse.c', 'ksw2_extz2_sse.c', 'ksw2_ll_sse.c',
'kalloc.c', 'kthread.c', 'map.c', 'misc.c', 'sdust.c', 'sketch.c', 'esterr.c', 'splitidx.c'], 'kalloc.c', 'kthread.c', 'map.c', 'misc.c', 'sdust.c', 'sketch.c', 'esterr.c', 'splitidx.c'],
depends = ['minimap.h', 'bseq.h', 'kalloc.h', 'kdq.h', 'khash.h', 'kseq.h', 'ksort.h', depends = ['minimap.h', 'bseq.h', 'kalloc.h', 'kdq.h', 'khash.h', 'kseq.h', 'ksort.h',
@@ -62,4 +52,4 @@ setup(
'Programming Language :: Python :: 3', 'Programming Language :: Python :: 3',
'Intended Audience :: Science/Research', 'Intended Audience :: Science/Research',
'Topic :: Scientific/Engineering :: Bio-Informatics'], 'Topic :: Scientific/Engineering :: Bio-Informatics'],
cmdclass = cmdclass) setup_requires=["cython"])
+11 -7
View File
@@ -2,6 +2,7 @@
#include <assert.h> #include <assert.h>
#include <stdlib.h> #include <stdlib.h>
#include <stdio.h> #include <stdio.h>
#include <errno.h>
#include "mmpriv.h" #include "mmpriv.h"
FILE *mm_split_init(const char *prefix, const mm_idx_t *mi) FILE *mm_split_init(const char *prefix, const mm_idx_t *mi)
@@ -11,14 +12,17 @@ FILE *mm_split_init(const char *prefix, const mm_idx_t *mi)
uint32_t i, k = mi->k; uint32_t i, k = mi->k;
fn = (char*)calloc(strlen(prefix) + 10, 1); fn = (char*)calloc(strlen(prefix) + 10, 1);
sprintf(fn, "%s.%.4d.tmp", prefix, mi->index); sprintf(fn, "%s.%.4d.tmp", prefix, mi->index);
fp = fopen(fn, "wb"); if ((fp = fopen(fn, "wb")) == NULL) {
assert(fp); if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m failed to write to temporary file '%s'\033[0m: %s\n", fn, strerror(errno));
exit(1);
}
mm_err_fwrite(&k, 4, 1, fp); mm_err_fwrite(&k, 4, 1, fp);
mm_err_fwrite(&mi->n_seq, 4, 1, fp); mm_err_fwrite(&mi->n_seq, 4, 1, fp);
for (i = 0; i < mi->n_seq; ++i) { for (i = 0; i < mi->n_seq; ++i) {
uint8_t l; uint32_t l;
l = strlen(mi->seq[i].name); l = strlen(mi->seq[i].name);
mm_err_fwrite(&l, 1, 1, fp); mm_err_fwrite(&l, 1, 4, fp);
mm_err_fwrite(mi->seq[i].name, 1, l, fp); mm_err_fwrite(mi->seq[i].name, 1, l, fp);
mm_err_fwrite(&mi->seq[i].len, 4, 1, fp); mm_err_fwrite(&mi->seq[i].len, 4, 1, fp);
} }
@@ -38,7 +42,7 @@ mm_idx_t *mm_split_merge_prep(const char *prefix, int n_splits, FILE **fp, uint3
sprintf(fn, "%s.%.4d.tmp", prefix, i); sprintf(fn, "%s.%.4d.tmp", prefix, i);
if ((fp[i] = fopen(fn, "rb")) == 0) { if ((fp[i] = fopen(fn, "rb")) == 0) {
if (mm_verbose >= 1) if (mm_verbose >= 1)
fprintf(stderr, "ERROR: failed to open temporary file '%s'\n", fn); fprintf(stderr, "ERROR: failed to open temporary file '%s': %s\n", fn, strerror(errno));
for (j = 0; j < i; ++j) for (j = 0; j < i; ++j)
fclose(fp[j]); fclose(fp[j]);
free(fn); free(fn);
@@ -57,8 +61,8 @@ mm_idx_t *mm_split_merge_prep(const char *prefix, int n_splits, FILE **fp, uint3
for (i = j = 0; i < n_splits; ++i) { for (i = j = 0; i < n_splits; ++i) {
uint32_t k; uint32_t k;
for (k = 0; k < n_seq_part[i]; ++k, ++j) { for (k = 0; k < n_seq_part[i]; ++k, ++j) {
uint8_t l; uint32_t l;
mm_err_fread(&l, 1, 1, fp[i]); mm_err_fread(&l, 1, 4, fp[i]);
mi->seq[j].name = (char*)calloc(l + 1, 1); mi->seq[j].name = (char*)calloc(l + 1, 1);
mm_err_fread(mi->seq[j].name, 1, l, fp[i]); mm_err_fread(mi->seq[j].name, 1, l, fp[i]);
mm_err_fread(&mi->seq[j].len, 4, 1, fp[i]); mm_err_fread(&mi->seq[j].len, 4, 1, fp[i]);
+5
View File
@@ -0,0 +1,5 @@
mm2: TGTTATCCCTAGGGTAACTTGTTCCGTTGGTCAAGTTATTGGATCAATTGAGTATAGTAGTGCACTCAC......................................................................................................................................CACTTGGAGCCATTCATACAGGTCCCTATTTAAGGAACAAGTGATTATGCTACCTTTGCACGGTT
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
ref: TGTTATCCCTAGGGTAACTTGTTCCGTTGGTCAAGTTATTGGATCAATTGAGTATAGTAGTGCACTCACctGCTTCGCTTTGACTGGTGAAGTCTTAGCATGTACTGCTCGGAGGTTGGGTTCTGCTCCGAGGTCGCCCCAACCGAAATTTTTAATGCAGGTTTGGTAGTTTAGGACCTGTGGGTTTGTTAGGCTAACCTCacCACTTGGAGCCATTCATACAGGTCCCTATTTAAGGAACAAGTGATTATGCTACCTTTGCACGGTT
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
sta: TGTTATCCCTAGGGTAACTTGTTCCGTTGGTCAAGTTATTGGATCAATTGAGTATAGTAGTGCA......................................................................................................................................CTCACCACTTGGAGCCATTCATACAGGTCCCTATTTAAGGAACAAGTGATTATGCTACCTTTGCACGGTT
+5
View File
@@ -0,0 +1,5 @@
>query
AACCGTGCAAAGGTAGCATAATCACTTGTTCCTTAAATAGGGACCTGTATGAATGGCTCC
AAGTG
GTGAGTGCA
CTACTATACTCAATTGATCCAATAACTTGACCAACGGAACAAGTTACCCTAGGGATAACA
+10
View File
@@ -0,0 +1,10 @@
>ref
TGATCCAACATCGAGGTCGTAAACCCTATTGTTGATATGGACTCTAGAATAGGATTGCGC
TGTTATCCCTAGGGTAACTTGTTCCGTTGGTCAAGTTATTGGATCAATTGAGTATAGTAG
TGCACTCAC
ctGCTTCGCTTTGACTGGTGAAGTCTTAGCATGTACTGCTCGGAGGTTGGGTTCTGCTCC
GAGGTCGCCCCAACCGAAATTTTTAATGCAGGTTTGGTAGTTTAGGACCTGTGGGTTTGT
TAGGCTAACCTCac
CACTTGGAGCCATTCATACAGGTCCCTATTTAAGGAACAAGTGATTATGCTACCTTTGCA
CGGTTAGGGTACCGCGGCCGTTAAACATGTGTCACTGGGCAGGCGGTGCCTCTAATACTG
GTGAT
+120
View File
@@ -338,3 +338,123 @@
Title = {Introducing difference recurrence relations for faster semi-global alignment of long sequences}, Title = {Introducing difference recurrence relations for faster semi-global alignment of long sequences},
Volume = {19}, Volume = {19},
Year = {2018}} Year = {2018}}
@article{Li:2018ab,
Author = {Li, Heng},
Journal = {Bioinformatics},
Pages = {3094-3100},
Title = {Minimap2: pairwise alignment for nucleotide sequences},
Volume = {34},
Year = {2018}}
@article{Jain:2020aa,
Author = {Jain, Chirag and others},
Journal = {Bioinformatics},
Pages = {i111-i118},
Title = {Weighted minimizer sampling improves long read mapping},
Volume = {36},
Year = {2020}}
@article{Miga:2020aa,
Author = {Miga, Karen H and others},
Journal = {Nature},
Pages = {79-84},
Title = {Telomere-to-telomere assembly of a complete human {X} chromosome},
Volume = {585},
Year = {2020}}
@article {Jain2020.11.01.363887,
author = {Jain, Chirag and others},
title = {A long read mapping method for highly repetitive reference sequences},
elocation-id = {2020.11.01.363887},
year = {2020},
doi = {10.1101/2020.11.01.363887},
publisher = {Cold Spring Harbor Laboratory},
URL = {https://www.biorxiv.org/content/early/2020/11/02/2020.11.01.363887},
eprint = {https://www.biorxiv.org/content/early/2020/11/02/2020.11.01.363887.full.pdf},
journal = {bioRxiv}
}
@article{Li:2020aa,
Author = {Li, Heng and others},
Journal = {Genome Biol},
Pages = {265},
Title = {The design and construction of reference pangenome graphs with minigraph},
Volume = {21},
Year = {2020}}
@article{Ren:2021aa,
Author = {Ren, Jingwen and Chaisson, Mark J P},
Journal = {PLoS Comput Biol},
Pages = {e1009078},
Title = {lra: A long read aligner for sequences and contigs},
Volume = {17},
Year = {2021}}
@inproceedings{DBLP:conf/wabi/AbouelhodaO03,
Author = {Mohamed Ibrahim Abouelhoda and Enno Ohlebusch},
Booktitle = {Algorithms in Bioinformatics, Third International Workshop, {WABI} 2003, Budapest, Hungary, September 15-20, 2003, Proceedings},
Crossref = {DBLP:conf/wabi/2003},
Pages = {1--16},
Title = {A Local Chaining Algorithm and Its Applications in Comparative Genomics},
Year = {2003}}
@article{Ono:2021aa,
Author = {Ono, Yukiteru and others},
Journal = {Bioinformatics},
Pages = {589-595},
Title = {{PBSIM2}: a simulator for long-read sequencers with a novel generative model of quality scores},
Volume = {37},
Year = {2021}}
@article{Sedlazeck:2018ab,
Author = {Sedlazeck, Fritz J and others},
Journal = {Nat Methods},
Pages = {461-468},
Title = {Accurate detection of complex structural variations using single-molecule sequencing},
Volume = {15},
Year = {2018}}
@article{Jeffares:2017aa,
Author = {Jeffares, Daniel C and others},
Journal = {Nat Commun},
Pages = {14061},
Title = {Transient structural variations have strong effects on quantitative traits and reproductive isolation in fission yeast},
Volume = {8},
Year = {2017}}
@article{Zook:2020aa,
Author = {Zook, Justin M and others},
Journal = {Nat Biotechnol},
Pages = {1347-1355},
Title = {A robust benchmark for detection of germline large deletions and insertions},
Volume = {38},
Year = {2020}}
@article{Harpak:2017aa,
Author = {Harpak, Arbel and others},
Journal = {Proc Natl Acad Sci U S A},
Pages = {12779-12784},
Title = {Frequent nonallelic gene conversion on the human lineage and its effect on the divergence of gene duplicates},
Volume = {114},
Year = {2017}}
@article{Li:2018aa,
Author = {Li, Heng and others},
Journal = {Nat Methods},
Month = {Aug},
Number = {8},
Pages = {595-597},
Title = {A synthetic-diploid benchmark for accurate variant-calling evaluation},
Volume = {15},
Year = {2018}}
@article{Gu:1995wt,
author = {Gu, X and Li, W H},
journal = {J Mol Evol},
month = {Apr},
number = {4},
pages = {464-73},
title = {The size distribution of insertions and deletions in human and rodent pseudogenes suggests the logarithmic gap penalty for sequence alignment},
volume = {40},
year = {1995}}
+240
View File
@@ -0,0 +1,240 @@
\documentclass{bioinfo}
\copyrightyear{2021}
\pubyear{2021}
\usepackage{graphicx}
\usepackage{hyperref}
\usepackage{url}
\usepackage{amsmath}
\usepackage[ruled,vlined]{algorithm2e}
\newcommand\mycommfont[1]{\footnotesize\rmfamily{\it #1}}
\SetCommentSty{mycommfont}
\SetKwComment{Comment}{$\triangleright$\ }{}
\usepackage{natbib}
\bibliographystyle{apalike}
\DeclareMathOperator*{\argmax}{argmax}
\begin{document}
\firstpage{1}
\title[Improvements to minimap2]{New strategies to improve minimap2 alignment accuracy}
\author[Li]{Heng Li$^{1,2}$}
\address{$^1$Dana-Farber Cancer Institute, 450 Brookline Ave, Boston, MA 02215, USA,
$^2$Harvard Medical School, 10 Shattuck St, Boston, MA 02215, USA}
\maketitle
\begin{abstract}
\section{Summary:} We present several recent improvements to minimap2, a
versatile pairwise aligner for nucleotide sequences. Now minimap2 v2.22 can
more accurately map long reads to highly repetitive regions and align through
insertions or deletions up to 100kb by default, addressing major weakness in
minimap2 v2.18 or earlier.
\section{Availability and implementation:}
\href{https://github.com/lh3/minimap2}{https://github.com/lh3/minimap2}
\section{Contact:} hli@ds.dfci.harvard.edu
\end{abstract}
\section{Introduction}
Minimap2~\citep{Li:2018ab} is widely used for maping long sequence
reads and assembly contigs. \citet{Jain:2020aa} found minimap2 v2.18 or earlier occasionally
misaligned reads from highly repetitive regions as minimap2 ignored seeds of
high occurrence. They also noticed minimap2 may misplace reads with structural
variations (SVs) in such regions~\citep{Jain2020.11.01.363887}. These
misalignments have become a pressing issue in the advent of
temolere-to-telomore human assembly~\citep{Miga:2020aa}. Meanwhile, old minimap2
was unable to efficiently align long insertions/deletions (INDELs) and often
breaks an alignment around variable-number tandem repeats (VNTRs). This has
inspired new chaining algorithms~\citep{Li:2020aa,Ren:2021aa} which are not
integrated into minimap2. Here we will describe recent efforts implemented
in v2.19 through v2.22 to improve mapping results.
\begin{methods}
\section{Methods}
\subsection{Rescuing high-occurrence $k$-mers}\label{sec:high-occ}
Minimap2 keeps all $k$-mer minimizers~\citep{Roberts:2004fv} during indexing. Its original
implementation only selected low-occurrence minimizers during mapping. The
cutoff is a few hundred for mapping long reads against a human genome. If a
read habors only a few or even no low-occurrence minimizers, it will fail
chaining due to insufficient anchors.
To resolve this issue, we implemented a new heuristic to add additional
minimizers. Suppose we are looking at two adjacent low-occurence $k$-mers
located at position $x_1$ and $x_2$, respectively. If $|x_1-x_2|\ge L$,
minimap2 v2.22 additionally selects $\lfloor|x_1-x_2|/L\rfloor$ minimizers
of the lowest occurrence among minimizers between $x_1$ and $x_2$. Here
parameter $L$ controls the frequency of sampling. It defaults to 500.
This strategy adds necessary anchors at the cost of increasing total alignment
time by a few percent on real data.
\subsection{Aligning through longer INDELs}
The original minimap2 may fail to align long INDELs due to its chaining
heuristics. Briefly, minimap2 applies dynamic programming (DP) to chain
minimizer anchors. This is a quadratic algorithm, slow for chaining
contigs. For acceptable performance, the original minimap2 uses a 500bp band by
default, which means a gap longer than 500bp will stop chaining.
To align through longer gaps, older minimap2 implemented a long-join heurstic as follows.
If there is an INDEL longer than 500bp and the two chains around the INDEL
have no overlaps on either the query or the reference sequence, minimap2 may
join the two short chains later.
This heuristic may fail around VNTRs because short chains
often have overlaps in VNTRs. More subtly, minimap2 may escape the inner DP
loop early, again for performance, if the chaining result is not improved for
50 iterations. When there is a copy number change in a long segmental
duplication, the early escape may break around the event even if users
specify a large band.
In minigraph~\citep{Li:2020aa}, we developed a new chaining algorithm that
finds up to 1kb INDELs with DP-based chaining and goes through longer INDELs with a
subquadratic algorithm~\citep{DBLP:conf/wabi/AbouelhodaO03}. We ported the same
algorithm to minimap2 for contig mapping. For long-read mapping, the minigraph
algorithm is slower. Minimap2 v2.22 still uses the DP-based algorithm to
find short chains and then invokes the minigraph algorithm to rechain anchors in
these short chains. The rechaining step achieves the same goal as long-join
but is more reliable because it can resolve overlaps between short chains. The old
long-join heuristic has since been removed.
\subsection{Properly mapping long reads with SVs}
The original minimap2 ranks an alignment by its Smith-Waterman score and
outputs the best scoring alignment. However, when there are SVs on the read,
the best scoring alignment is sometimes not the correct alignment.
\citet{Jain2020.11.01.363887} resolved this dilemma by altering the mapping
algorithm.
In our view, this problem is rooted in inapropriate scoring: affine-gap penalty
over-penalizes a long INDEL that was often evolutionarily created in one event.
We should not penalize a SV by a function linear in the SV length. Minimap2 v2.22 instead rescores
an alignment with the following scoring function. Suppose an alignment consists
of $M$ matching bases, $N$ substitutions and $G$ gap opens, we empirically
score the alignment with
$$
S=M-\frac{N+G}{2d}-\sum_{i=1}^G\log_2(1+g_i)
$$
where $g_i\ge1$ is the length of the $i$-th gap and
$$
d=\max\left\{\frac{N+G}{M+N+G},0.02\right\}
$$
It approximates per-base sequence divergence except with the smallest value set
to 2\%. As an analogy to affine-gap scoring, the matching score in our scheme
is 1, the mismatch and gap open penalties are both $1/2d$ and the gap extension
penalty is a logarithm function of the gap length~\citep{Gu:1995wt}. Our scoring gives a long SV
a much milder penalty. In terms of time complexity, scoring an alignment is
linear in the length of the alignment. The time spent on rescoring is negligible in
practice.
%If we assume sequences evolve under a duplication-mutation model, we may have a
%better way to choose the best alignment. If a long read can be mapped to $n$
%loci, we can take the read as the template and build a
%pseudo-multi-sequence-alignment (pMSA) of $n+1$ sequences. In this pMSA, we say
%a site on the read is informative if the $n$ reference subsequences differ at
%the position.
\end{methods}
\section{Results}
\begin{table}
\processtable{Evaluation of minimap2 v2.22}
{\footnotesize\label{tab:1}\begin{tabular}{p{4.2cm}rrrr}
\toprule
$[$Benchmark$]$ Metric & v2.22 & v2.18 & Winno & lra \\
\midrule
$[$sim-map$]$ \% mapped reads at Q10 & 97.9 & 97.6 & {\bf 99.0}& 97.3 \\
$[$sim-map$]$ err. rate at Q10 (phredQ) & {\bf 52} & {\bf 52} & 38 & 24 \\
$[$winno-cmp$]$ rate of diff. (phredQ) & {\bf 41} & 37 & truth & 18 \\
$[$winno-cmp$]$ CPU time (hour) & {\bf 5.0} & 5.3 & 71.8 & 13.1 \\
$[$winno-cmp$]$ peak RAM (Gb) & 17.1 & 14.4 & {\bf 9.6} & 12.4 \\
$[$sim-sv$]$ \% false negative rate & {\bf 0.5} & 2.0 & {\bf 0.5} & 1.4 \\
$[$sim-sv$]$ \% false discovery rate & {\bf 0.0} & 0.1 & {\bf 0.0} & 0.1 \\
$[$real-sv-1k$]$ \% false negative rate & {\bf 7.3} & 20.0 & 13.0 & N/A \\
$[$real-sv-1k$]$ \% false discovery rate & 2.7 & {\bf 2.4} & 2.7 & N/A \\
\botrule
\end{tabular}}
{In $[$sim-map$]$, 152,713 reads were simulated from the CHM13 telomere-to-telomere assembly v1.1
(AC: GCA\_009914755.3) with pbsim2~\citep{Ono:2021aa}: ``pbsim2 -{}-hmm\_model R94.model -{}-length-min
5000 -{}-length-mean 20000 -{}-accuracy-mean 0.95''. Alignments of mapping quality
10 or higher were evaluated by ``paftools.js mapeval''. The mapping error rate
is measured in the phred scale: if the error rate is $e$, $-10\log_{10}e$ is
reported in the table. In $[$winno-cmp$]$, 1.39 million CHM13 HiFi reads from
SRR11292121 were mapped against the same CHM13 assembly. 99.3\% of them were mapped by Winnowmap2
at mapping quality 10 or higher and were taken as ground truth to evaluate
minimap2 and lra with ``paftools.js pafcmp''. $[$sim-sv$]$ simulated 1,000
50bp to 1000bp INDELs from chr8 in CHM13 using SURVIVOR~\citep{Jeffares:2017aa} and simulated Nanopore
reads at 30-fold coverage with the same pbsim2 command line. SVs were called with
``sniffles -q 10''~\citep{Sedlazeck:2018ab} and compared to the simulated truth with ``SURVIVOR eval
call.vcf truth.bed 50''. In $[$real-sv-1k$]$, small and long variants were
called by dipcall-0.3~\citep{Li:2018aa} for HG002 assemblies (AC: GCA\_018852605.1 and
GCA\_018852615.1) and compared to the GIAB truth~\citep{Zook:2020aa} using ``truvari -r 2000 -s
1000 -S 400 -{}-multimatch -{}-passonly'' which sets the minimum INDEL size to 1kb in evaluation. }
\end{table}
We evaluated minimap2 v2.22 along with v2.18, Winnowmap2 v2.03 and lra v1.3.2
(Table~\ref{tab:1}), using the default setting of each mapper according to the input data types.
Both versions of minimap2 achieved high mapping accuracy on
simulated Nanopore reads (sim-map). Winnowmap2 aligned more reads at mapping
quality 10 or higher (mapQ10). However, it may occasionally assign a high mapping
quality to a read with multiple identical best alignments. This reduced its
mapping accuracy.
In lack of groud truth for real data, we took Winnowmap2 mapping as ground
truth to evaluate other mappers (winno-cmp in Table~\ref{tab:1}). Out of 1,378,092 reads with mapQ10
alignments by Winnowmap2, minimap2 v2.22 could map all of them. 118 reads, less
than 0.01\% of all reads, were mapped differently by v2.22. 51 of them have
multiple identical best alignments. We believe these are more likely to be
Winnowmap2 errors. Most of the remaining 67 (=118-51) reads have multiple
highly similar but not identical alignments.
Minimap2 v2.18 is less consistent with 275 differences including 30 unmapped
reads mappable by both Winnowmap2 and v2.22.
For the minimizer rescuing parameter $L$ in Section~\ref{sec:high-occ},
we set its default to 500 such that v2.22 has comparable performance to v2.18 given simulated PacBio and Nanopore human reads.
To see the effect of this parameter on real data, we tried several different $L$ values.
v2.22 gave 99 mapping differences at $L=200$,
118 at $L=500$ (default), 167 at $L=750$ and 224 differences at $L=1000$ in comparison to Winnowmap2.
$L=200$ is 28\% slower than the default while $L=1000$ is 9\% faster.
Changing the default minimizer window size (option ``-w'')
and the initial minimizer occurrence cutoff (option ``-f'')
also affects performance and accuracy to a similar magnitude.
The two benchmarks above only evaluate read mappings when there are no variations between the reads and the reference.
To measure the mapping accuracy in the presence of SVs (sim-sv), we reproduced
the results by~\citep{Jain2020.11.01.363887}. Minimap2 v2.22 is as good as
Winnowmap2 now. Note that we were setting the Sniffles mapping quality
threshold to 10 in consistent with the benchmarks above. If we used the
default threshold 20, v2.22 would miss additional five SVs (accounting for
0.5\% of simulated SVs). For four out of these five missing SVs, minimap2 v2.22
mapped more variant reads than Winnowmap2. Sniffles did not call these SVs
because minimap2 tended to give them conservative mapping quality. It is worth
noting that the simulation here only considers a simple scenario in evolution.
Non-allelic gene conversions, which happen often in segmental
duplications~\citep{Harpak:2017aa}, would obscure the optimal mapping
strategies. How much such simple SV simulation informs real-world SV calling
remains a question.
To see if minimap2 v2.22 could improve long INDEL alignment, we ran dipcall on
contig-to-reference alignments and focused on INDELs longer than 1kb
(real-sv-1k). v2.22 is more sensitive at comparable specificity, confirming its
advantage in more contiguous alignment. We could not get dipcall to work well with lra,
so did not report the numbers.
Minimap2 spends most computing time on base alignment. As recent improvements
in v2.22 incur little additional computing and do not change the base alignment
algorithm, the new version has similar performance to older versions. It is
consistently faster than Winnowmap2 by several times. Sometimes simple
heuristics can be as effective as more sophisticated yet slower solutions.
\section*{Acknowledgements}
We thank Arang Rhie and Chirag Jain for providing motivating examples for which
older minimap2 underperforms.
\paragraph{Funding\textcolon} This work is funded by NHGRI grant R01HG010040.
\bibliography{minimap2}
\end{document}