mirror of
https://github.com/lh3/minimap2.git
synced 2026-10-04 21:38:12 +08:00
Compare commits
270
Commits
| Author | SHA1 | Date | |
|---|---|---|---|
|
|
79c9cc186b | ||
|
|
ea4c8935bd | ||
|
|
3187782b1a | ||
|
|
005c9a1f6b | ||
|
|
1fd85be6e2 | ||
|
|
e616b0dacf | ||
|
|
b58b97423a | ||
|
|
df9e650346 | ||
|
|
7a540c37ca | ||
|
|
c19e3ccb86 | ||
|
|
94d171b01e | ||
|
|
ff312a2957 | ||
|
|
01ccedd5a0 | ||
|
|
819b3bf017 | ||
|
|
e88110463a | ||
|
|
fb81e150f2 | ||
|
|
d930ea94ad | ||
|
|
a832a42f6f | ||
|
|
a5411fc3c0 | ||
|
|
bd03d975fc | ||
|
|
9c3c4b1ce8 | ||
|
|
3542a3d153 | ||
|
|
75619c7b51 | ||
|
|
fbb9c0fcba | ||
|
|
af094640e5 | ||
|
|
d43f356ef9 | ||
|
|
38acd6617f | ||
|
|
3d351267a0 | ||
|
|
54a4718c9b | ||
|
|
dbc12b2838 | ||
|
|
2ed264db4e | ||
|
|
a8094ad859 | ||
|
|
1877818239 | ||
|
|
9ede5c4255 | ||
|
|
405511fe8d | ||
|
|
dd90d9dde6 | ||
|
|
a8c567b5e9 | ||
|
|
d9d3c0cc3f | ||
|
|
cbe8d61ca4 | ||
|
|
9d06cef13e | ||
|
|
924fc4d671 | ||
|
|
fc2d1e95b3 | ||
|
|
bbf0bb871b | ||
|
|
83e9b2e28c | ||
|
|
e816fd071c | ||
|
|
a955b1f31d | ||
|
|
54fa925e2e | ||
|
|
d4a396c5c3 | ||
|
|
bdf46f5786 | ||
|
|
f536b69b81 | ||
|
|
4b8b4418df | ||
|
|
ce30004e02 | ||
|
|
54f8e5f7d6 | ||
|
|
2857de7dbd | ||
|
|
e18935fbad | ||
|
|
74ebfb2532 | ||
|
|
a0cbe2e4d2 | ||
|
|
618d33515e | ||
|
|
a10d4f4496 | ||
|
|
1eea2fee11 | ||
|
|
1d346d56bc | ||
|
|
46750de966 | ||
|
|
7d8bbb74a8 | ||
|
|
c6db201b38 | ||
|
|
358a39850f | ||
|
|
fcb5d5e6eb | ||
|
|
95807a2224 | ||
|
|
a4c93e9377 | ||
|
|
7d69334e69 | ||
|
|
3e1ab2951d | ||
|
|
68179ed195 | ||
|
|
d1f4c8d232 | ||
|
|
8efe83b744 | ||
|
|
042c8d4d71 | ||
|
|
e4e1f7843b | ||
|
|
69e3629916 | ||
|
|
0cc3cdca27 | ||
|
|
8170693de3 | ||
|
|
e3d8c708ac | ||
|
|
119bdc6029 | ||
|
|
89d4d219cd | ||
|
|
f51ff1abac | ||
|
|
27b254ed6f | ||
|
|
c881b14ba5 | ||
|
|
f18dadb1c4 | ||
|
|
a83b8fe7cc | ||
|
|
c22bfe7722 | ||
|
|
12d441ea22 | ||
|
|
c7433c2811 | ||
|
|
5279377544 | ||
|
|
acab05781e | ||
|
|
98c23bc6d2 | ||
|
|
9b0ff2418c | ||
|
|
b6762503a9 | ||
|
|
9667468e89 | ||
|
|
ba60aac6f6 | ||
|
|
fcd4df2a73 | ||
|
|
0efc886012 | ||
|
|
940388f8e4 | ||
|
|
23d2674c39 | ||
|
|
a12673611f | ||
|
|
8140259974 | ||
|
|
f3e59fc2a0 | ||
|
|
fc2e1607d7 | ||
|
|
bc588c0eeb | ||
|
|
ab717023b6 | ||
|
|
9506e7ac3f | ||
|
|
ce03fbc275 | ||
|
|
98a3aa1b39 | ||
|
|
ae05f8485f | ||
|
|
ace990c381 | ||
|
|
e28a55be86 | ||
|
|
f8d46a7a30 | ||
|
|
4483f89ee5 | ||
|
|
f1b3c7ad06 | ||
|
|
180faa3594 | ||
|
|
704fbc6f5c | ||
|
|
fc24c8a348 | ||
|
|
e68d868806 | ||
|
|
c3d461e22a | ||
|
|
c41518ae85 | ||
|
|
819d843e3c | ||
|
|
5e7242303c | ||
|
|
a026c69b89 | ||
|
|
ea2042a577 | ||
|
|
1834b1fd42 | ||
|
|
7ced0f16a0 | ||
|
|
35732f3025 | ||
|
|
a6fab118c5 | ||
|
|
6ce0dd8b70 | ||
|
|
1d3c3eef03 | ||
|
|
01b98e8e52 | ||
|
|
16b8d50199 | ||
|
|
226fd6114c | ||
|
|
822ccd1733 | ||
|
|
f67849c9af | ||
|
|
b0b199f503 | ||
|
|
c2f07ff2ac | ||
|
|
cefd0d9f6c | ||
|
|
2a319c89aa | ||
|
|
85a5260408 | ||
|
|
6c2cbf7903 | ||
|
|
5aa4355ca8 | ||
|
|
6ed7263670 | ||
|
|
315795eefd | ||
|
|
fc6869a9e8 | ||
|
|
6252e5e367 | ||
|
|
843729df1e | ||
|
|
195c98fa46 | ||
|
|
a2e6659d9b | ||
|
|
e450f161bb | ||
|
|
15cade0f06 | ||
|
|
767556b6f0 | ||
|
|
50a26a60a6 | ||
|
|
31de4fd1bc | ||
|
|
e018caea32 | ||
|
|
7c02742fa8 | ||
|
|
a41f5d1eeb | ||
|
|
ed3d0eb328 | ||
|
|
e6d166a314 | ||
|
|
06fedaadd0 | ||
|
|
fe35e679e9 | ||
|
|
e25aa5ee74 | ||
|
|
3bde3450a0 | ||
|
|
36942ff711 | ||
|
|
d3a89d34d4 | ||
|
|
c8f0a35c40 | ||
|
|
fcaadc22b7 | ||
|
|
db37fc43a7 | ||
|
|
a8f1fa8ea3 | ||
|
|
b276772890 | ||
|
|
d0cff3eb36 | ||
|
|
ac334639ce | ||
|
|
546623dcb4 | ||
|
|
39bdd45875 | ||
|
|
aefa2c0d86 | ||
|
|
7ee62dae1d | ||
|
|
05a8a45d44 | ||
|
|
cc14d1afdf | ||
|
|
bb3048b2a0 | ||
|
|
5113ca2628 | ||
|
|
7358a1ead1 | ||
|
|
32f552957e | ||
|
|
a05edfa5ec | ||
|
|
8e81145817 | ||
|
|
e37f5ffe39 | ||
|
|
8a1d52bcbe | ||
|
|
f7271a7c24 | ||
|
|
70393eb46e | ||
|
|
9d049f0562 | ||
|
|
5180b70ff3 | ||
|
|
2392e54fe2 | ||
|
|
629c11728e | ||
|
|
59488f0271 | ||
|
|
7e33fde82b | ||
|
|
c4fe52fb07 | ||
|
|
ead1cfbaca | ||
|
|
83a535f148 | ||
|
|
f3af29a8aa | ||
|
|
cf7eaef367 | ||
|
|
2411887d8e | ||
|
|
1a8373bb84 | ||
|
|
161ae7ff73 | ||
|
|
8a6edab847 | ||
|
|
15118dd521 | ||
|
|
2546999639 | ||
|
|
52fafe0fed | ||
|
|
5f449c5cae | ||
|
|
b046052d82 | ||
|
|
5cc3d2239f | ||
|
|
581f2d7123 | ||
|
|
52dbd439bc | ||
|
|
260a68d232 | ||
|
|
177eef259d | ||
|
|
459ce04c84 | ||
|
|
e6cce019e4 | ||
|
|
7025b0b941 | ||
|
|
fe6a0bb337 | ||
|
|
3f7147864b | ||
|
|
c83589b9ea | ||
|
|
ce7a59f412 | ||
|
|
15471bd629 | ||
|
|
ca19463268 | ||
|
|
4f8d1bc360 | ||
|
|
1776c0c645 | ||
|
|
9febf532c1 | ||
|
|
cec23131e4 | ||
|
|
ef09ccf104 | ||
|
|
e74dfd1aa9 | ||
|
|
f31705bb4a | ||
|
|
41d7ccb191 | ||
|
|
34a41197d7 | ||
|
|
9626b3e716 | ||
|
|
379728726a | ||
|
|
4f91558160 | ||
|
|
ec3bc6efd7 | ||
|
|
8ec8866100 | ||
|
|
9e7247cff9 | ||
|
|
cd66777bfb | ||
|
|
5d7d25e92d | ||
|
|
2a3793bbd2 | ||
|
|
f97008a10e | ||
|
|
10502e2a78 | ||
|
|
4422c0c6f9 | ||
|
|
42a11e1d58 | ||
|
|
76df351fa8 | ||
|
|
d065d3bead | ||
|
|
ac146fe7bc | ||
|
|
6c96078ed0 | ||
|
|
bbb4f97e52 | ||
|
|
b7f4d8a0f4 | ||
|
|
e81927e7a1 | ||
|
|
f7dc5799c5 | ||
|
|
817cb81cb0 | ||
|
|
0f5608c4a4 | ||
|
|
e8823a3709 | ||
|
|
7edeec67b0 | ||
|
|
feb92d32ea | ||
|
|
cdbd96be0c | ||
|
|
ba52c79024 | ||
|
|
cd9ccfa069 | ||
|
|
86b716448c | ||
|
|
9ab95be1bb | ||
|
|
b51e859945 | ||
|
|
a9037dc16c | ||
|
|
9729fa99ad | ||
|
|
28a37a017a | ||
|
|
cd2b19035b | ||
|
|
9c0e2c67f8 | ||
|
|
da7109fd29 |
@@ -0,0 +1,68 @@
|
||||
name: CI
|
||||
|
||||
on:
|
||||
push:
|
||||
branches:
|
||||
- master
|
||||
pull_request:
|
||||
|
||||
jobs:
|
||||
build-linux-x8664:
|
||||
name: Linux x86_64
|
||||
runs-on: ubuntu-latest
|
||||
strategy:
|
||||
matrix:
|
||||
compiler: [gcc, clang]
|
||||
|
||||
steps:
|
||||
- name: Checkout minimap2
|
||||
uses: actions/checkout@v4
|
||||
|
||||
- name: Compile with ${{ matrix.compiler }}
|
||||
run: |
|
||||
make CC=${{ matrix.compiler }}
|
||||
file minimap2 | grep x86-64
|
||||
|
||||
build-linux-aarch64:
|
||||
name: Linux aarch64
|
||||
runs-on: ubuntu-latest
|
||||
strategy:
|
||||
matrix:
|
||||
compiler: [gcc]
|
||||
|
||||
steps:
|
||||
- name: Checkout
|
||||
uses: actions/checkout@v4
|
||||
|
||||
- name: Compile with ${{ matrix.compiler }}
|
||||
uses: uraimo/run-on-arch-action@v2
|
||||
with:
|
||||
arch: aarch64
|
||||
distro: ubuntu22.04
|
||||
githubToken: ${{ github.token }}
|
||||
dockerRunArgs: |
|
||||
--volume "${PWD}:/minimap2"
|
||||
install: |
|
||||
apt-get update -q -y
|
||||
apt-get install -q -y make ${{ matrix.compiler }} zlib1g-dev file
|
||||
run: |
|
||||
cd /minimap2
|
||||
make CC=${{ matrix.compiler }} arm_neon=1 aarch64=1 -j
|
||||
file minimap2 | grep aarch64
|
||||
|
||||
build-mac-arm64:
|
||||
name: Mac ARM64
|
||||
runs-on: macos-14
|
||||
strategy:
|
||||
matrix:
|
||||
compiler: [clang]
|
||||
|
||||
steps:
|
||||
- name: Checkout minimap2
|
||||
uses: actions/checkout@v4
|
||||
|
||||
- name: Compile with ${{ matrix.compiler }}
|
||||
run: |
|
||||
make CC=${{ matrix.compiler }} arm_neon=1 aarch64=1 -j
|
||||
file minimap2 | grep arm64
|
||||
|
||||
@@ -1,6 +1,3 @@
|
||||
[submodule "lib/simde"]
|
||||
path = lib/simde
|
||||
url = https://github.com/nemequ/simde.git
|
||||
[submodule "ext/TAL"]
|
||||
path = ext/TAL
|
||||
url = https://github.com/IntelLabs/Trans-Omics-Acceleration-Library.git
|
||||
|
||||
-24
@@ -1,24 +0,0 @@
|
||||
matrix:
|
||||
include:
|
||||
- language: c
|
||||
compiler: gcc
|
||||
script: make
|
||||
- language: c
|
||||
compiler: clang
|
||||
script: make
|
||||
- arch: arm64
|
||||
language: c
|
||||
compiler: gcc
|
||||
script: make arm_neon=1 aarch64=1
|
||||
- language: python
|
||||
python: "2.7"
|
||||
before_install: pip install cython
|
||||
script: python setup.py build_ext
|
||||
- language: python
|
||||
python: "3.5"
|
||||
before_install: pip install cython
|
||||
script: python setup.py build_ext
|
||||
- language: python
|
||||
python: "3.9"
|
||||
before_install: pip install cython
|
||||
script: python setup.py build_ext
|
||||
@@ -2,7 +2,7 @@
|
||||
|
||||
Without `-a`, `-c` or `--cs`, minimap2 only finds *approximate* mapping
|
||||
locations without detailed base alignment. In particular, the start and end
|
||||
positions of the alignment are impricise. With one of those options, minimap2
|
||||
positions of the alignment are imprecise. With one of those options, minimap2
|
||||
will perform base alignment, which is generally more accurate but is much
|
||||
slower.
|
||||
|
||||
|
||||
@@ -4,7 +4,6 @@ include ksw2_dispatch.c
|
||||
include main.c
|
||||
include README.md
|
||||
include sse2neon/emmintrin.h
|
||||
include python/mappy.c
|
||||
include python/cmappy.h
|
||||
include python/cmappy.pxd
|
||||
include python/mappy.pyx
|
||||
|
||||
@@ -1,74 +1,20 @@
|
||||
|
||||
## /* The MIT License
|
||||
##
|
||||
## Copyright (c) 2018- Dana-Farber Cancer Institute
|
||||
## 2017-2018 Broad Institute, Inc.
|
||||
##
|
||||
## Permission is hereby granted, free of charge, to any person obtaining
|
||||
## a copy of this software and associated documentation files (the
|
||||
## "Software"), to deal in the Software without restriction, including
|
||||
## without limitation the rights to use, copy, modify, merge, publish,
|
||||
## distribute, sublicense, and/or sell copies of the Software, and to
|
||||
## permit persons to whom the Software is furnished to do so, subject to
|
||||
## the following conditions:
|
||||
##
|
||||
## The above copyright notice and this permission notice shall be
|
||||
## included in all copies or substantial portions of the Software.
|
||||
##
|
||||
## THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
|
||||
## EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
|
||||
## MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
|
||||
## NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS
|
||||
## BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN
|
||||
## ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN
|
||||
## CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
|
||||
## SOFTWARE.
|
||||
## Modified Copyright (C) 2021 Intel Corporation
|
||||
## Contacts: Saurabh Kalikar <saurabh.kalikar@intel.com>;
|
||||
## Vasimuddin Md <vasimuddin.md@intel.com>; Sanchit Misra <sanchit.misra@intel.com>;
|
||||
## Chirag Jain <chirag@iisc.ac.in>; Heng Li <hli@jimmy.harvard.edu>
|
||||
## */
|
||||
##
|
||||
CFLAGS= -Wall -O2 -Wc++-compat #-Wextra
|
||||
CPPFLAGS= -DHAVE_KALLOC -march=native
|
||||
|
||||
OPT_FLAGS= -DVECTORIZED_CHAINING -DALIGN_AVX
|
||||
|
||||
ifeq ($(lhash), 1)
|
||||
OPT_FLAGS+= -DLISA_HASH -DUINT64 -DVECTORIZE
|
||||
endif
|
||||
|
||||
ifeq ($(manual_profile), 1)
|
||||
CPPFLAGS+= -DMANUAL_PROFILING
|
||||
endif
|
||||
|
||||
ifeq ($(use_avx2), 1)
|
||||
OPT_FLAGS+= -DAPPLY_AVX2
|
||||
endif
|
||||
|
||||
ifeq ($(disable_output), 1)
|
||||
CPPFLAGS+= -DDISABLE_OUTPUT
|
||||
endif
|
||||
|
||||
ifeq ($(no_opt),)
|
||||
CPPFLAGS+= $(OPT_FLAGS)
|
||||
endif
|
||||
|
||||
INCLUDES= -I./ext/TAL/src/LISA-hash -I./ext/TAL/src/dynamic-programming
|
||||
|
||||
OBJS= kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o options.o index.o chain.o align.o hit.o map.o format.o pe.o esterr.o splitidx.o ksw2_ll_sse.o
|
||||
CFLAGS= -g -Wall -O2 -Wc++-compat #-Wextra
|
||||
CPPFLAGS= -DHAVE_KALLOC
|
||||
INCLUDES=
|
||||
OBJS= kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o options.o index.o \
|
||||
lchain.o align.o hit.o seed.o jump.o map.o format.o pe.o esterr.o splitidx.o \
|
||||
ksw2_ll_sse.o
|
||||
PROG= minimap2
|
||||
PROG_EXTRA= sdust minimap2-lite
|
||||
LIBS= -lm -lz -lpthread
|
||||
LIBS= -lm -lz -lpthread
|
||||
|
||||
CC=$(CXX)
|
||||
ifeq ($(CC), g++)
|
||||
CC=g++ -std=c++11
|
||||
ifneq ($(aarch64),)
|
||||
arm_neon=1
|
||||
endif
|
||||
|
||||
ifeq ($(arm_neon),) # if arm_neon is not defined
|
||||
ifeq ($(sse2only),) # if sse2only is not defined
|
||||
OBJS+=ksw2_extz2_sse41.o ksw2_extd2_sse41.o ksw2_exts2_sse41.o ksw2_extz2_sse2.o ksw2_extd2_sse2.o ksw2_exts2_sse2.o ksw2_dispatch.o ksw2_extd2_avx.o
|
||||
OBJS+=ksw2_extz2_sse41.o ksw2_extd2_sse41.o ksw2_exts2_sse41.o ksw2_extz2_sse2.o ksw2_extd2_sse2.o ksw2_exts2_sse2.o ksw2_dispatch.o
|
||||
else # if sse2only is defined
|
||||
OBJS+=ksw2_extz2_sse.o ksw2_extd2_sse.o ksw2_exts2_sse.o
|
||||
endif
|
||||
@@ -84,12 +30,12 @@ endif
|
||||
|
||||
ifneq ($(asan),)
|
||||
CFLAGS+=-fsanitize=address
|
||||
LIBS+=-fsanitize=address
|
||||
LIBS+=-fsanitize=address -ldl
|
||||
endif
|
||||
|
||||
ifneq ($(tsan),)
|
||||
CFLAGS+=-fsanitize=thread
|
||||
LIBS+=-fsanitize=thread
|
||||
LIBS+=-fsanitize=thread -ldl
|
||||
endif
|
||||
|
||||
.PHONY:all extra clean depend
|
||||
@@ -114,17 +60,6 @@ libminimap2.a:$(OBJS)
|
||||
sdust:sdust.c kalloc.o kalloc.h kdq.h kvec.h kseq.h ketopt.h sdust.h
|
||||
$(CC) -D_SDUST_MAIN $(CFLAGS) $< kalloc.o -o $@ -lz
|
||||
|
||||
multi:
|
||||
$(MAKE) clean
|
||||
$(MAKE)
|
||||
mv minimap2 mm2-fast
|
||||
$(MAKE) clean
|
||||
$(MAKE) lhash=1
|
||||
mv minimap2 mm2-fast-lhash
|
||||
$(MAKE) clean
|
||||
$(MAKE) no_opt=1
|
||||
mv minimap2 mm2-fast-no-opt
|
||||
|
||||
# SSE-specific targets on x86/x86_64
|
||||
|
||||
ifeq ($(arm_neon),) # if arm_neon is defined, compile this target with the default setting (i.e. no -msse2)
|
||||
@@ -174,26 +109,29 @@ depend:
|
||||
|
||||
# DO NOT DELETE
|
||||
|
||||
align.o: minimap.h mmpriv.h bseq.h ksw2.h kalloc.h
|
||||
align.o: minimap.h mmpriv.h bseq.h kseq.h ksw2.h kalloc.h
|
||||
bseq.o: bseq.h kvec.h kalloc.h kseq.h
|
||||
chain.o: minimap.h mmpriv.h bseq.h kalloc.h
|
||||
esterr.o: mmpriv.h minimap.h bseq.h
|
||||
esterr.o: mmpriv.h minimap.h bseq.h kseq.h
|
||||
example.o: minimap.h kseq.h
|
||||
format.o: kalloc.h mmpriv.h minimap.h bseq.h
|
||||
hit.o: mmpriv.h minimap.h bseq.h kalloc.h khash.h
|
||||
index.o: kthread.h bseq.h minimap.h mmpriv.h kvec.h kalloc.h khash.h
|
||||
format.o: kalloc.h mmpriv.h minimap.h bseq.h kseq.h
|
||||
hit.o: mmpriv.h minimap.h bseq.h kseq.h kalloc.h khash.h
|
||||
index.o: kthread.h bseq.h minimap.h mmpriv.h kseq.h ksw2.h kalloc.h kvec.h
|
||||
index.o: khash.h ksort.h
|
||||
jump.o: mmpriv.h minimap.h bseq.h kseq.h
|
||||
kalloc.o: kalloc.h
|
||||
ksw2_extd2_sse.o: ksw2.h kalloc.h
|
||||
ksw2_exts2_sse.o: ksw2.h kalloc.h
|
||||
ksw2_extz2_sse.o: ksw2.h kalloc.h
|
||||
ksw2_ll_sse.o: ksw2.h kalloc.h
|
||||
kthread.o: kthread.h
|
||||
main.o: bseq.h minimap.h mmpriv.h ketopt.h
|
||||
map.o: kthread.h kvec.h kalloc.h sdust.h mmpriv.h minimap.h bseq.h khash.h
|
||||
map.o: ksort.h
|
||||
misc.o: mmpriv.h minimap.h bseq.h ksort.h
|
||||
options.o: mmpriv.h minimap.h bseq.h
|
||||
pe.o: mmpriv.h minimap.h bseq.h kvec.h kalloc.h ksort.h
|
||||
sdust.o: kalloc.h kdq.h kvec.h ketopt.h sdust.h
|
||||
sketch.o: kvec.h kalloc.h mmpriv.h minimap.h bseq.h
|
||||
splitidx.o: mmpriv.h minimap.h bseq.h
|
||||
lchain.o: mmpriv.h minimap.h bseq.h kseq.h kalloc.h krmq.h
|
||||
main.o: bseq.h minimap.h mmpriv.h kseq.h ketopt.h
|
||||
map.o: kthread.h kvec.h kalloc.h sdust.h mmpriv.h minimap.h bseq.h kseq.h
|
||||
map.o: khash.h ksort.h
|
||||
misc.o: mmpriv.h minimap.h bseq.h kseq.h ksort.h
|
||||
options.o: mmpriv.h minimap.h bseq.h kseq.h
|
||||
pe.o: mmpriv.h minimap.h bseq.h kseq.h kvec.h kalloc.h ksort.h
|
||||
sdust.o: kalloc.h kdq.h kvec.h sdust.h
|
||||
seed.o: mmpriv.h minimap.h bseq.h kseq.h kalloc.h ksort.h
|
||||
sketch.o: kvec.h kalloc.h mmpriv.h minimap.h bseq.h kseq.h
|
||||
splitidx.o: mmpriv.h minimap.h bseq.h kseq.h
|
||||
|
||||
+1
-1
@@ -1,7 +1,7 @@
|
||||
CFLAGS= -g -Wall -O2 -Wc++-compat #-Wextra
|
||||
CPPFLAGS= -DHAVE_KALLOC -DUSE_SIMDE -DSIMDE_ENABLE_NATIVE_ALIASES
|
||||
INCLUDES= -Ilib/simde
|
||||
OBJS= kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o options.o index.o chain.o align.o hit.o map.o format.o pe.o esterr.o splitidx.o \
|
||||
OBJS= kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o options.o index.o lchain.o align.o hit.o map.o format.o pe.o seed.o esterr.o splitidx.o \
|
||||
ksw2_extz2_simde.o ksw2_extd2_simde.o ksw2_exts2_simde.o ksw2_ll_simde.o
|
||||
PROG= minimap2
|
||||
PROG_EXTRA= sdust minimap2-lite
|
||||
|
||||
@@ -1,3 +1,290 @@
|
||||
Release 2.30-r1287 (15 June 2025)
|
||||
---------------------------------
|
||||
|
||||
Notable changes:
|
||||
|
||||
* Improvement: consolidated `--spsc`.
|
||||
|
||||
* Deprecation: subcommands `splice2bed`, `gff2bed`, `gff2junc`, `junceval` and
|
||||
`exoneval` in `paftools.js` are deprecated by minigff. They will remain
|
||||
indefinitely for backward compatibility.
|
||||
|
||||
(2.30: 15 June 2025, r1287)
|
||||
|
||||
|
||||
|
||||
Release 2.29-r1283 (18 April 2025)
|
||||
----------------------------------
|
||||
|
||||
Notable changes to minimap2:
|
||||
|
||||
* New feature: added the `splice:sr` preset for short RNA-seq read alignment.
|
||||
Users may use `-j` to specify known gene annotation to improve spliced
|
||||
alignment close to the ends of short reads. Also added `--write-junc` and
|
||||
`--pass1` for 2-pass short-read RNA-seq alignment.
|
||||
|
||||
* Experimental feature: read splice scores from a file specified by `--spsc`
|
||||
and consider the scores during base alignment. The feature makes it possible
|
||||
to apply advanced splice models and to improve spliced alignment.
|
||||
|
||||
* Change: adjusted the mapping quality calculation for spliced alignment.
|
||||
|
||||
* Bugfixes: a) missing overlap alignment when base alignment is requested
|
||||
(#969); b) incorrect summary information for long genomes (#1192); c)
|
||||
missing parameter check for `--score-N` (#1226).
|
||||
|
||||
* Improvement: a) warn about absent junction files (#1229); b) report an error
|
||||
if a wrong preset prefixed with "splice" is specified (#589).
|
||||
|
||||
Notable changes to mappy:
|
||||
|
||||
* Improvement: allow passing read name (#1260)
|
||||
|
||||
* Improvement: exposed score for ambiguous bases (#1240)
|
||||
|
||||
Minimap2 now supports short/long genomic/RNA-seq read alignment along with
|
||||
contig alignment and all-vs-all read overlapping. It produces identical genomic
|
||||
long-read or contig alignment to v2.27. Short genomic read alignment and the
|
||||
mapping quality of long RNA-seq read alignment may slightly differ in very rare
|
||||
cases.
|
||||
|
||||
(2.29: 18 April 2025, r1283)
|
||||
|
||||
|
||||
|
||||
Release 2.28-r1209 (27 March 2024)
|
||||
----------------------------------
|
||||
|
||||
Notable changes to minimap2:
|
||||
|
||||
* Bugfix: `--MD` was not working properly due to the addition of `--ds` in the
|
||||
last release (#1181 and #1182).
|
||||
|
||||
* New feature: added an experimental preset `lq:hqae` for aligning accurate
|
||||
long reads back to their assembly. It has been observed that `map-hifi` and
|
||||
`lr:hq` may produce many wrong alignments around centromeres when accurate
|
||||
long reads (PacBio HiFi or Nanopore duplex/Q20+) are mapped to a diploid
|
||||
assembly constructed from them. This new preset produces much more accurate
|
||||
alignment. It is still experimental and may be subjective to changes in
|
||||
future.
|
||||
|
||||
* Change: reduced the default `--cap-kalloc` to 500m to lower the peak
|
||||
memory consumption (#855).
|
||||
|
||||
Notable changes to mappy:
|
||||
|
||||
* Bugfix: mappy option struct was out of sync with minimap2 (#1177).
|
||||
|
||||
Minimap2 should output identical alignments to v2.27.
|
||||
|
||||
(2.28: 27 March 2024, r1209)
|
||||
|
||||
|
||||
|
||||
Release 2.27-r1193 (12 March 2024)
|
||||
----------------------------------
|
||||
|
||||
Notable changes to minimap2:
|
||||
|
||||
* New feature: added the `lr:hq` preset for accurate long reads at ~1% error
|
||||
rate. This was suggested by Oxford Nanopore developers (#1127). It is not
|
||||
clear if this preset also works well for PacBio HiFi reads.
|
||||
|
||||
* New feature: added the `map-iclr` preset for Illumina Complete Long Reads
|
||||
(#1069), provided by Illumina developers.
|
||||
|
||||
* New feature: added option `-b` to specify mismatch penalty for base
|
||||
transitions (i.e. A-to-G or C-to-T changes).
|
||||
|
||||
* New feature: added option `--ds` to generate a new `ds:Z` tag that
|
||||
indicates uncertainty in INDEL positions. It is an extension to `cs`. The
|
||||
`mgutils-es6.js` script in minigraph parses `ds`.
|
||||
|
||||
* Bugfix: avoided a NULL pointer dereference (#1154). This would not have an
|
||||
effect on most systems but would still be good to fix.
|
||||
|
||||
* Bugfix: reverted the value of `ms:i` to pre-2.22 versions (#1146). This was
|
||||
an oversight. See fcd4df2 for details.
|
||||
|
||||
Notable changes to paftools.js and mappy:
|
||||
|
||||
* New feature: expose `bw_long` to mappy's Aligner class (#1124).
|
||||
|
||||
* Bugfix: fixed several compatibility issues with k8 v1.0 (#1161 and #1166).
|
||||
Subcommands "call", "pbsim2fq" and "mason2fq" were not working with v1.0.
|
||||
|
||||
Minimap2 should output identical alignments to v2.26, except the ms tag.
|
||||
|
||||
(2.27: 12 March 2024, r1193)
|
||||
|
||||
|
||||
|
||||
Release 2.26-r1175 (29 April 2023)
|
||||
----------------------------------
|
||||
|
||||
Fixed the broken Python package. This is the only change.
|
||||
|
||||
(2.26: 25 April 2023, r1173)
|
||||
|
||||
|
||||
|
||||
Release 2.25-r1173 (25 April 2023)
|
||||
----------------------------------
|
||||
|
||||
Notable changes:
|
||||
|
||||
* Improvement: use the miniprot splice model for RNA-seq alignment by default.
|
||||
This model considers non-GT-AG splice sites and leads to slightly higher
|
||||
(<0.1%) accuracy and sensitivity on real human data.
|
||||
|
||||
* Change: increased the default `-I` to `8G` such that minimap2 would create a
|
||||
uni-part index for a pair of mammalian genomes. This change may increase the
|
||||
memory for all-vs-all read overlap alignment given large datasets.
|
||||
|
||||
* New feature: output the sequences in secondary alignments with option
|
||||
`--secondary-seq` (#687).
|
||||
|
||||
* Bugfix: --rmq was not parsed correctly (#1010)
|
||||
|
||||
* Bugfix: possibly incorrect coordinate when applying end bonus to the target
|
||||
sequence (#1025). This is a ksw2 bug. It does not affect minimap2 as
|
||||
minimap2 is not using the affected feature.
|
||||
|
||||
* Improvement: incorporated several changes for better compatibility with
|
||||
Windows (#1051) and for minimap2 integration at Oxford Nanopore Technologies
|
||||
(#1048 and #1033).
|
||||
|
||||
* Improvement: output the HD-line in SAM output (#1019).
|
||||
|
||||
* Improvement: check minimap2 index file in mappy to prevent segmentation
|
||||
fault for certain indices (#1008).
|
||||
|
||||
For genomic sequences, minimap2 should give identical output to v2.24.
|
||||
Long-read RNA-seq alignment may occasionally differ from previous versions.
|
||||
|
||||
(2.25: 25 April 2023, r1173)
|
||||
|
||||
|
||||
|
||||
Release 2.24-r1122 (26 December 2021)
|
||||
-------------------------------------
|
||||
|
||||
This release improves alignment around long poorly aligned regions. Older
|
||||
minimap2 may chain through such regions in rare cases which may result in
|
||||
missing alignments later. The issue has become worse since the the change of
|
||||
the chaining algorithm in v2.19. v2.23 implements an incomplete remedy. This
|
||||
release provides a better solution with a X-drop-like heuristic and by enabling
|
||||
two-bandwidth chaining in the assembly mode.
|
||||
|
||||
(2.24: 26 December 2021, r1122)
|
||||
|
||||
|
||||
|
||||
Release 2.23-r1111 (18 November 2021)
|
||||
-------------------------------------
|
||||
|
||||
Notable changes:
|
||||
|
||||
* Bugfix: fixed missing alignments around long inversions (#806 and #816).
|
||||
This bug affected v2.19 through v2.22.
|
||||
|
||||
* Improvement: avoid extremely long mapping time for pathologic reads with
|
||||
highly repeated k-mers not in the reference (#771). Use --q-occ-frac=0
|
||||
to disable the new heuristic.
|
||||
|
||||
* Change: use --cap-kalloc=1g by default.
|
||||
|
||||
(2.23: 18 November 2021, r1111)
|
||||
|
||||
|
||||
|
||||
Release 2.22-r1101 (7 August 2021)
|
||||
----------------------------------
|
||||
|
||||
When choosing the best alignment, this release uses logarithm gap penalty and
|
||||
query-specific mismatch penalty. It improves the sensitivity to long INDELs in
|
||||
repetitive regions.
|
||||
|
||||
Other notable changes:
|
||||
|
||||
* Bugfix: fixed an indirect memory leak that may waste a large amount of
|
||||
memory given highly repetitive reference such as a 16S RNA database (#749).
|
||||
All versions of minimap2 have this issue.
|
||||
|
||||
* New feature: added --cap-kalloc to reduce the peak memory. This option is
|
||||
not enabled by default but may become the default in future releases.
|
||||
|
||||
Known issue:
|
||||
|
||||
* Minimap2 may take a long time to map a read (#771). So far it is not clear
|
||||
if this happens to v2.18 and earlier versions.
|
||||
|
||||
(2.22: 7 August 2021, r1101)
|
||||
|
||||
|
||||
|
||||
Release 2.21-r1071 (6 July 2021)
|
||||
--------------------------------
|
||||
|
||||
This release fixed a regression in short-read mapping introduced in v2.19
|
||||
(#776). It also fixed invalid comparisons of uninitialized variables, though
|
||||
these are harmless (#752). Long-read alignment should be identical to v2.20.
|
||||
|
||||
(2.21: 6 July 2021, r1071)
|
||||
|
||||
|
||||
|
||||
Release 2.20-r1061 (27 May 2021)
|
||||
--------------------------------
|
||||
|
||||
This release fixed a bug in the Python module and improves the command-line
|
||||
compatibiliity with v2.18. In v2.19, if `-r` is specified with an `asm*` preset,
|
||||
users would get alignments more fragmented than v2.18. This could be an issue
|
||||
for existing pipelines specifying `-r`. This release resolves this issue.
|
||||
|
||||
(2.20: 27 May 2021, r1061)
|
||||
|
||||
|
||||
|
||||
Release 2.19-r1057 (26 May 2021)
|
||||
--------------------------------
|
||||
|
||||
This release includes a few important improvements backported from unimap:
|
||||
|
||||
* Improvement: more contiguous alignment through long INDELs. This is enabled
|
||||
by the minigraph chaining algorithm. All `asm*` presets now use the new
|
||||
algorithm. They can find INDELs up to 100kb and may be faster for
|
||||
chromosome-long contigs. The default mode and `map*` presets use this
|
||||
algorithm to replace the long-join heuristic.
|
||||
|
||||
* Improvement: better alignment in highly repetitive regions by rescuing
|
||||
high-occurrence seeds. If the distance between two adjacent seeds is too
|
||||
large, attempt to choose a fraction of high-occurrence seeds in-between.
|
||||
Minimap2 now produces fewer clippings and alignment break points in long
|
||||
satellite regions.
|
||||
|
||||
* Improvement: allow to specify an interval of k-mer occurrences with `-U`.
|
||||
For repeat-rich genomes, the automatic k-mer occurrence threshold determined
|
||||
by `-f` may be too large and makes alignment impractically slow. The new
|
||||
option protects against such cases. Enabled for `asm*` and `map-hifi`.
|
||||
|
||||
* New feature: added the `map-hifi` preset for maping PacBio High-Fidelity
|
||||
(HiFi) reads.
|
||||
|
||||
* Change to the default: apply `--cap-sw-mem=100m` for genomic alignment.
|
||||
|
||||
* Bugfix: minimap2 could not generate an index file with `-xsr` (#734).
|
||||
|
||||
This release represents the most signficant algorithmic change since v2.1 in
|
||||
2017. With features backported from unimap, minimap2 now has similar power to
|
||||
unimap for contig alignment. Unimap will remain an experimental project and is
|
||||
no longer recommended over minimap2. Sorry for reverting the recommendation in
|
||||
short time.
|
||||
|
||||
(2.19: 26 May 2021, r1057)
|
||||
|
||||
|
||||
|
||||
Release 2.18-r1015 (9 April 2021)
|
||||
---------------------------------
|
||||
|
||||
|
||||
@@ -1,77 +1,7 @@
|
||||
## mm2-fast
|
||||
### Introduction
|
||||
mm2-fast is an accelerated implementation of minimap2 on modern CPUs. mm2-fast accelerates all the three major modules of minimap2: (a) seeding, (b) chaining, and (c) pairwise alignment, achieving up to 3.5x speedup over minimap2.
|
||||
mm2-fast is a drop-in replacement of minimap2, providing the same functionality with the exact same output.
|
||||
In the current version, all the modules are optimized using **AVX-512** vectorization. Detailed benchmark results are available in our [preprint](https://doi.org/10.1101/2021.07.21.453294).
|
||||
|
||||
### System requirement
|
||||
Operating System: Linux
|
||||
mm2-fast was tested using g++ (GCC) 9.2.0 and icpc version 19.1.3.304
|
||||
Architecture: x86\_64 CPUs with [AVX512](https://en.wikipedia.org/wiki/AVX-512)
|
||||
Memory requirement: ~30GB for human genome
|
||||
|
||||
### Installation
|
||||
Clone the *fast-contrib* branch from minimap2 github page. The source code can be compiled by simple using *make* command. It only takes a few seconds.
|
||||
```
|
||||
git clone --recursive https://github.com/lh3/minimap2.git -b fast-contrib mm2-fast
|
||||
cd mm2-fast
|
||||
make
|
||||
```
|
||||
|
||||
### Usage
|
||||
The usage of mm2-fast is same as minimap2. Here is an example of mapping ONT reads with test data.
|
||||
```sh
|
||||
./minimap2 -ax map-ont test/MT-human.fa test/MT-orang.fa > mm2-fast_output
|
||||
```
|
||||
|
||||
### Accuracy evaluation
|
||||
As mm2-fast is an accelerated version of minimap2-v2.18, the output of mm2-fast can be verified against minimap2-v2.18. Note that AVX512-based chaining in mm2-fast by default runs with a chaining parameter *max-skip=infinity* for higher chaining precision. Therefore, for correctness verification, minimap2 should run with a larger value of *max-skip* parameter. Follow the below steps to verify the accuracy of mm2-fast.
|
||||
```sh
|
||||
git clone https://github.com/lh3/minimap2.git -b v2.18
|
||||
cd minimap2 && make
|
||||
./minimap2 -ax map-ont test/MT-human.fa test/MT-orang.fa --max-chain-skip=1000000 > minimap2_output
|
||||
```
|
||||
The output generated by minimap2 and mm2-fast should match.
|
||||
```sh
|
||||
diff minimap2_output mm2-fast_output > diff_result
|
||||
```
|
||||
The file diff\_result should show a clean-diff with the difference of 2 lines, i.e., the lines containing the command-line parameters for minimap2 and mm2-fast.
|
||||
|
||||
### Advanced options
|
||||
The default compilation using make applies two optimizations: AVX512 vectorized chaining and alignment, and learned-indexes based seeding is disabled by default as it requires availability of [Rust](https://en.wikipedia.org/wiki/Rust_(programming_language)). This is because the learned hash-table uses an external training library that runs on Rust. Rust is trivial to install, see https://rustup.rs/ and add its path to .bashrc file. Rust installation only takes a few seconds. Following are the steps to enable learned hash table optimization in mm2-fast:
|
||||
```sh
|
||||
# Start by building learned hash table index for optimized seeding module
|
||||
./build_rmi.sh test/MT-human.fa map-ont ##Takes two arguments: 1. path-to-reference-seq-file 2. preset.
|
||||
##For human genome, this step should take around 20-30 minutes to finish.
|
||||
|
||||
# Next, compile and run the mapping phase
|
||||
make clean && make lhash=1
|
||||
./minimap2 -ax map-ont test/MT-human.fa test/MT-orang.fa > mm2-fast-lhash_output
|
||||
```
|
||||
To compile mm2-fast with all optimizations turned off and switch back to default minimap2, use the following command during compilation. This could be useful for debugging.
|
||||
```sh
|
||||
make clean && make no_opt=1
|
||||
```
|
||||
mm2-fast includes preliminary support for AVX2 architecture. Currently, chaining step is not optimized for AVX2 but the seeding and alignment steps are available. To try mm2-fast on AVX2 systems, use the following command to compile.
|
||||
```sh
|
||||
make clean && make lhash=1 use_avx2=1
|
||||
```
|
||||
### Performance
|
||||
We have observed up to 3.5x speedup across datasets (please refer to the paper for more details). For example, for the randomly sampled 100K reads from ["HG002\_GM24385\_1\_2\_3\_Guppy\_3.6.0\_prom.fastq.gz"](https://precision.fda.gov/challenges/10/view), minimap2 takes 80 seconds, while mm2-fast takes 38 seconds to map against the human genome on a 28 cores Intel® Xeon® Platinum 8280 CPUs. Our sampled datasets with 100K reads are available [here](https://drive.google.com/drive/folders/1131j7ejHdT7QZnjxLcTLi5qqwYcfFbuv).
|
||||
|
||||
### Future Plans
|
||||
The current version of mm2-fast is based on minimap2-v2.18. We are planning to apply our optimizations to minimap2 master branch.
|
||||
### Citations
|
||||
["Accelerating long-read analysis on modern CPUs"](https://doi.org/10.1101/2021.07.21.453294); Saurabh Kalikar, Chirag Jain, Vasimuddin Md, Sanchit Misra; BioRxiv 2021
|
||||
|
||||
---
|
||||
The original README content of minimap2 follows.
|
||||
|
||||
|
||||
[](https://github.com/lh3/minimap2/releases)
|
||||
[](https://anaconda.org/bioconda/minimap2)
|
||||
[](https://pypi.python.org/pypi/mappy)
|
||||
[](https://travis-ci.org/lh3/minimap2)
|
||||
[](https://github.com/lh3/minimap2/actions)
|
||||
## <a name="started"></a>Getting Started
|
||||
```sh
|
||||
git clone https://github.com/lh3/minimap2
|
||||
@@ -82,23 +12,23 @@ cd minimap2 && make
|
||||
./minimap2 -x map-ont -d MT-human-ont.mmi test/MT-human.fa
|
||||
./minimap2 -a MT-human-ont.mmi test/MT-orang.fa > test.sam
|
||||
# use presets (no test data)
|
||||
./minimap2 -ax map-pb ref.fa pacbio.fq.gz > aln.sam # PacBio genomic reads
|
||||
./minimap2 -ax map-pb ref.fa pacbio.fq.gz > aln.sam # PacBio CLR genomic reads
|
||||
./minimap2 -ax map-ont ref.fa ont.fq.gz > aln.sam # Oxford Nanopore genomic reads
|
||||
./minimap2 -ax asm20 ref.fa pacbio-ccs.fq.gz > aln.sam # PacBio CCS genomic reads
|
||||
./minimap2 -ax map-hifi ref.fa pacbio-ccs.fq.gz > aln.sam # PacBio HiFi/CCS genomic reads (v2.19+)
|
||||
./minimap2 -ax lr:hq ref.fa ont-Q20.fq.gz > aln.sam # Nanopore Q20 genomic reads (v2.27+)
|
||||
./minimap2 -ax sr ref.fa read1.fa read2.fa > aln.sam # short genomic paired-end reads
|
||||
./minimap2 -ax splice ref.fa rna-reads.fa > aln.sam # spliced long reads (strand unknown)
|
||||
./minimap2 -ax splice -uf -k14 ref.fa reads.fa > aln.sam # noisy Nanopore Direct RNA-seq
|
||||
./minimap2 -ax splice:hq -uf ref.fa query.fa > aln.sam # Final PacBio Iso-seq or traditional cDNA
|
||||
./minimap2 -ax splice --junc-bed anno.bed12 ref.fa query.fa > aln.sam # prioritize on annotated junctions
|
||||
./minimap2 -ax splice -uf -k14 ref.fa reads.fa > aln.sam # noisy Nanopore direct RNA-seq
|
||||
./minimap2 -ax splice:hq -uf ref.fa query.fa > aln.sam # PacBio Kinnex/Iso-seq (RNA-seq)
|
||||
./minimap2 -ax splice --junc-bed=anno.bed12 ref.fa query.fa > aln.sam # use annotated junctions
|
||||
./minimap2 -ax splice:sr ref.fa r1.fq r2.fq > aln.sam # short-read RNA-seq (v2.29+)
|
||||
./minimap2 -ax splice:sr -j anno.bed12 ref.fa r1.fq r2.fq > aln.sam
|
||||
./minimap2 -cx asm5 asm1.fa asm2.fa > aln.paf # intra-species asm-to-asm alignment
|
||||
./minimap2 -x ava-pb reads.fa reads.fa > overlaps.paf # PacBio read overlap
|
||||
./minimap2 -x ava-ont reads.fa reads.fa > overlaps.paf # Nanopore read overlap
|
||||
# man page for detailed command line options
|
||||
man ./minimap2.1
|
||||
```
|
||||
[Unimap][unimap] is recommended for aligning long contigs against a reference
|
||||
genome. It often takes less wall-clock time and is much more sensitive to long
|
||||
insertions and deletions.
|
||||
|
||||
## Table of Contents
|
||||
|
||||
@@ -110,7 +40,8 @@ insertions and deletions.
|
||||
- [Map long noisy genomic reads](#map-long-genomic)
|
||||
- [Map long mRNA/cDNA reads](#map-long-splice)
|
||||
- [Find overlaps between long reads](#long-overlap)
|
||||
- [Map short accurate genomic reads](#short-genomic)
|
||||
- [Map short genomic reads](#short-genomic)
|
||||
- [Map short RNA-seq reads](#short-rna-seq)
|
||||
- [Full genome/assembly alignment](#full-genome)
|
||||
- [Advanced features](#advanced)
|
||||
- [Working with >65535 CIGAR operations](#long-cigar)
|
||||
@@ -146,8 +77,8 @@ Detailed evaluations are available from the [minimap2 paper][doi] or the
|
||||
Minimap2 is optimized for x86-64 CPUs. You can acquire precompiled binaries from
|
||||
the [release page][release] with:
|
||||
```sh
|
||||
curl -L https://github.com/lh3/minimap2/releases/download/v2.18/minimap2-2.18_x64-linux.tar.bz2 | tar -jxvf -
|
||||
./minimap2-2.18_x64-linux/minimap2
|
||||
curl -L https://github.com/lh3/minimap2/releases/download/v2.30/minimap2-2.30_x64-linux.tar.bz2 | tar -jxvf -
|
||||
./minimap2-2.30_x64-linux/minimap2
|
||||
```
|
||||
If you want to compile from the source, you need to have a C compiler, GNU make
|
||||
and zlib development files installed. Then type `make` in the source code
|
||||
@@ -168,7 +99,7 @@ with the ARM related command lines given above.
|
||||
|
||||
Without any options, minimap2 takes a reference database and a query sequence
|
||||
file as input and produce approximate mapping, without base-level alignment
|
||||
(i.e. no CIGAR), in the [PAF format][paf]:
|
||||
(i.e. coordinates are only approximate and no CIGAR in output), in the [PAF format][paf]:
|
||||
```sh
|
||||
minimap2 ref.fa query.fq > approx-mapping.paf
|
||||
```
|
||||
@@ -209,14 +140,17 @@ parameters at the same time. The default setting is the same as `map-ont`.
|
||||
#### <a name="map-long-genomic"></a>Map long noisy genomic reads
|
||||
|
||||
```sh
|
||||
minimap2 -ax map-pb ref.fa pacbio-reads.fq > aln.sam # for PacBio subreads
|
||||
minimap2 -ax map-pb ref.fa pacbio-reads.fq > aln.sam # for PacBio CLR reads
|
||||
minimap2 -ax map-ont ref.fa ont-reads.fq > aln.sam # for Oxford Nanopore reads
|
||||
minimap2 -ax map-iclr ref.fa iclr-reads.fq > aln.sam # for Illumina Complete Long Reads
|
||||
```
|
||||
The difference between `map-pb` and `map-ont` is that `map-pb` uses
|
||||
homopolymer-compressed (HPC) minimizers as seeds, while `map-ont` uses ordinary
|
||||
minimizers as seeds. Emperical evaluation suggests HPC minimizers improve
|
||||
performance and sensitivity when aligning PacBio reads, but hurt when aligning
|
||||
Nanopore reads.
|
||||
minimizers as seeds. Empirical evaluation suggests HPC minimizers improve
|
||||
performance and sensitivity when aligning PacBio CLR reads, but hurt when aligning
|
||||
Nanopore reads. `map-iclr` uses an adjusted alignment scoring matrix that
|
||||
accounts for the low overall error rate in the reads, with transversion errors
|
||||
being less frequent than transitions.
|
||||
|
||||
#### <a name="map-long-splice"></a>Map long mRNA/cDNA reads
|
||||
|
||||
@@ -240,9 +174,8 @@ or the last exons.
|
||||
|
||||
Minimap2 rates an alignment by the score of the max-scoring sub-segment,
|
||||
*excluding* introns, and marks the best alignment as primary in SAM. When a
|
||||
spliced gene also has unspliced pseudogenes, minimap2 does not intentionally
|
||||
prefer spliced alignment, though in practice it more often marks the spliced
|
||||
alignment as the primary. By default, minimap2 outputs up to five secondary
|
||||
spliced gene also has unspliced pseudogenes, minimap2 slightly prefers
|
||||
the spliced alignment. By default, minimap2 outputs up to five secondary
|
||||
alignments (i.e. likely pseudogenes in the context of RNA-seq mapping). This
|
||||
can be tuned with option **-N**.
|
||||
|
||||
@@ -273,10 +206,14 @@ bonus score (tuned by `--junc-bonus`) if an aligned junction matches a junction
|
||||
in the annotation. Option `--junc-bed` also takes 5-column BED, including the
|
||||
strand field. In this case, each line indicates an oriented junction.
|
||||
|
||||
**Note:** `--junc-bed` is intended for long noisy RNA-seq reads only.
|
||||
Applying the option to short RNA-seq reads would increase run time with little
|
||||
improvement to junction accuracy.
|
||||
|
||||
#### <a name="long-overlap"></a>Find overlaps between long reads
|
||||
|
||||
```sh
|
||||
minimap2 -x ava-pb reads.fq reads.fq > ovlp.paf # PacBio read overlap
|
||||
minimap2 -x ava-pb reads.fq reads.fq > ovlp.paf # PacBio CLR read overlap
|
||||
minimap2 -x ava-ont reads.fq reads.fq > ovlp.paf # Oxford Nanopore read overlap
|
||||
```
|
||||
Similarly, `ava-pb` uses HPC minimizers while `ava-ont` uses ordinary
|
||||
@@ -285,7 +222,7 @@ the overlapping mode because it is slow and may produce false positive
|
||||
overlaps. However, if performance is not a concern, you may try to add `-a` or
|
||||
`-c` anyway.
|
||||
|
||||
#### <a name="short-genomic"></a>Map short accurate genomic reads
|
||||
#### <a name="short-genomic"></a>Map short genomic reads
|
||||
|
||||
```sh
|
||||
minimap2 -ax sr ref.fa reads-se.fq > aln.sam # single-end alignment
|
||||
@@ -298,8 +235,18 @@ be paired if they are adjacent in the input stream and have the same name (with
|
||||
the `/[0-9]` suffix trimmed if present). Single- and paired-end reads can be
|
||||
mixed.
|
||||
|
||||
Minimap2 does not work well with short spliced reads. There are many capable
|
||||
RNA-seq mappers for short reads.
|
||||
#### <a name="short-rna-seq"></a>Map short RNA-seq reads
|
||||
|
||||
```sh
|
||||
minimap2 -ax splice:sr ref.fa reads-se.fq.gz > aln.sam # single-end
|
||||
minimap2 -ax splice:sr ref.fa r1.fq.gz r2.fq.gz > aln.sam # paired-end
|
||||
minimap2 -ax splice:sr -j anno.bed ref.fa r1.fq r2.fq > aln.sam # use annotation
|
||||
# 2-pass alignment
|
||||
minimap2 -x splice:sr -j anno.bed --write-junc ref.fa r1.fq r2.fq > junc.bed
|
||||
minimap2 -ax splice:sr -j anno.bed --pass1=junc.bed ref.fa r1.fq r2.fq > aln.sam
|
||||
```
|
||||
The new preset `splice:sr` was added in v2.29. It functions similarly to `sr`
|
||||
except that it performs spliced alignment.
|
||||
|
||||
#### <a name="full-genome"></a>Full genome/assembly alignment
|
||||
|
||||
@@ -323,7 +270,7 @@ To avoid this issue, you can add option `-L` at the minimap2 command line.
|
||||
This option moves a long CIGAR to the `CG` tag and leaves a fully clipped CIGAR
|
||||
at the SAM CIGAR column. Current tools that don't read CIGAR (e.g. merging and
|
||||
sorting) still work with such BAM records; tools that read CIGAR will
|
||||
effectively ignore these records. It has been decided that future tools will
|
||||
effectively ignore these records. It has been decided that future tools
|
||||
will seamlessly recognize long-cigar records generated by option `-L`.
|
||||
|
||||
**TL;DR**: if you work with ultra-long reads and use tools that only process
|
||||
@@ -344,7 +291,7 @@ CGATCGATAAATAGAGTAG---GAATAGCA
|
||||
CGATCG---AATAGAGTAGGTCGAATtGCA
|
||||
```
|
||||
is represented as `:6-ata:10+gtc:4*at:3`, where `:[0-9]+` represents an
|
||||
identical block, `-ata` represents a deltion, `+gtc` an insertion and `*at`
|
||||
identical block, `-ata` represents a deletion, `+gtc` an insertion and `*at`
|
||||
indicates reference base `a` is substituted with a query base `t`. It is
|
||||
similar to the `MD` SAM tag but is standalone and easier to parse.
|
||||
|
||||
@@ -422,6 +369,11 @@ If you use minimap2 in your work, please cite:
|
||||
> Li, H. (2018). Minimap2: pairwise alignment for nucleotide sequences.
|
||||
> *Bioinformatics*, **34**:3094-3100. [doi:10.1093/bioinformatics/bty191][doi]
|
||||
|
||||
and/or:
|
||||
|
||||
> Li, H. (2021). New strategies to improve minimap2 alignment accuracy.
|
||||
> *Bioinformatics*, **37**:4572-4574. [doi:10.1093/bioinformatics/btab705][doi2]
|
||||
|
||||
## <a name="dguide"></a>Developers' Guide
|
||||
|
||||
Minimap2 is not only a command line tool, but also a programming library.
|
||||
@@ -471,5 +423,6 @@ mappy` or [from BioConda][mappyconda] via `conda install -c bioconda mappy`.
|
||||
[manpage]: https://lh3.github.io/minimap2/minimap2.html
|
||||
[manpage-cs]: https://lh3.github.io/minimap2/minimap2.html#10
|
||||
[doi]: https://doi.org/10.1093/bioinformatics/bty191
|
||||
[smide]: https://github.com/nemequ/simde
|
||||
[doi2]: https://doi.org/10.1093/bioinformatics/btab705
|
||||
[simde]: https://github.com/nemequ/simde
|
||||
[unimap]: https://github.com/lh3/unimap
|
||||
|
||||
@@ -1,33 +1,3 @@
|
||||
/* The MIT License
|
||||
|
||||
Copyright (c) 2018- Dana-Farber Cancer Institute
|
||||
2017-2018 Broad Institute, Inc.
|
||||
|
||||
Permission is hereby granted, free of charge, to any person obtaining
|
||||
a copy of this software and associated documentation files (the
|
||||
"Software"), to deal in the Software without restriction, including
|
||||
without limitation the rights to use, copy, modify, merge, publish,
|
||||
distribute, sublicense, and/or sell copies of the Software, and to
|
||||
permit persons to whom the Software is furnished to do so, subject to
|
||||
the following conditions:
|
||||
|
||||
The above copyright notice and this permission notice shall be
|
||||
included in all copies or substantial portions of the Software.
|
||||
|
||||
THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
|
||||
EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
|
||||
MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
|
||||
NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS
|
||||
BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN
|
||||
ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN
|
||||
CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
|
||||
SOFTWARE.
|
||||
Modified Copyright (C) 2021 Intel Corporation
|
||||
Contacts: Saurabh Kalikar <saurabh.kalikar@intel.com>;
|
||||
Vasimuddin Md <vasimuddin.md@intel.com>; Sanchit Misra <sanchit.misra@intel.com>;
|
||||
Chirag Jain <chirag@iisc.ac.in>; Heng Li <hli@jimmy.harvard.edu>
|
||||
*/
|
||||
|
||||
#include <assert.h>
|
||||
#include <string.h>
|
||||
#include <stdlib.h>
|
||||
@@ -35,9 +5,9 @@ Modified Copyright (C) 2021 Intel Corporation
|
||||
#include "minimap.h"
|
||||
#include "mmpriv.h"
|
||||
#include "ksw2.h"
|
||||
#include "ksw2_extd2_avx.h"
|
||||
#include <x86intrin.h>
|
||||
extern uint64_t alignment_time;
|
||||
|
||||
#define MM_MAX_QLEN_FLANK 100
|
||||
|
||||
static void ksw_gen_simple_mat(int m, int8_t *mat, int8_t a, int8_t b, int8_t sc_ambi)
|
||||
{
|
||||
int i, j;
|
||||
@@ -53,6 +23,18 @@ static void ksw_gen_simple_mat(int m, int8_t *mat, int8_t a, int8_t b, int8_t sc
|
||||
mat[(m - 1) * m + j] = sc_ambi;
|
||||
}
|
||||
|
||||
static void ksw_gen_ts_mat(int m, int8_t *mat, int8_t a, int8_t b, int8_t transition, int8_t sc_ambi)
|
||||
{
|
||||
assert(m == 5);
|
||||
ksw_gen_simple_mat(m, mat, a, b, sc_ambi);
|
||||
if (transition == 0 || transition == b) return;
|
||||
transition = transition > 0? -transition : transition;
|
||||
mat[0 * m + 2] = transition; // A->G
|
||||
mat[1 * m + 3] = transition; // C->T
|
||||
mat[2 * m + 0] = transition; // G->A
|
||||
mat[3 * m + 1] = transition; // T->C
|
||||
}
|
||||
|
||||
static inline void mm_seq_rev(uint32_t len, uint8_t *seq)
|
||||
{
|
||||
uint32_t i;
|
||||
@@ -85,16 +67,16 @@ static int mm_test_zdrop(void *km, const mm_mapopt_t *opt, const uint8_t *qseq,
|
||||
// find the score and the region where score drops most along diagonal
|
||||
for (k = 0, score = 0; k < n_cigar; ++k) {
|
||||
uint32_t l, op = cigar[k]&0xf, len = cigar[k]>>4;
|
||||
if (op == 0) {
|
||||
if (op == MM_CIGAR_MATCH) {
|
||||
for (l = 0; l < len; ++l) {
|
||||
score += mat[tseq[i + l] * 5 + qseq[j + l]];
|
||||
update_max_zdrop(score, i+l, j+l, &max, &max_i, &max_j, opt->e, &max_zdrop, pos);
|
||||
}
|
||||
i += len, j += len;
|
||||
} else if (op == 1 || op == 2 || op == 3) {
|
||||
} else if (op == MM_CIGAR_INS || op == MM_CIGAR_DEL || op == MM_CIGAR_N_SKIP) {
|
||||
score -= opt->q + opt->e * len;
|
||||
if (op == 1) j += len; // insertion
|
||||
else i += len; // deletion
|
||||
if (op == MM_CIGAR_INS) j += len;
|
||||
else i += len;
|
||||
update_max_zdrop(score, i, j, &max, &max_i, &max_j, opt->e, &max_zdrop, pos);
|
||||
}
|
||||
}
|
||||
@@ -130,12 +112,12 @@ static void mm_fix_cigar(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq,
|
||||
for (k = 0; k < p->n_cigar; ++k) { // indel left alignment
|
||||
uint32_t op = p->cigar[k]&0xf, len = p->cigar[k]>>4;
|
||||
if (len == 0) to_shrink = 1;
|
||||
if (op == 0) {
|
||||
if (op == MM_CIGAR_MATCH) {
|
||||
toff += len, qoff += len;
|
||||
} else if (op == 1 || op == 2) { // insertion or deletion
|
||||
} else if (op == MM_CIGAR_INS || op == MM_CIGAR_DEL) {
|
||||
if (k > 0 && k < p->n_cigar - 1 && (p->cigar[k-1]&0xf) == 0 && (p->cigar[k+1]&0xf) == 0) {
|
||||
int l, prev_len = p->cigar[k-1] >> 4;
|
||||
if (op == 1) {
|
||||
if (op == MM_CIGAR_INS) {
|
||||
for (l = 0; l < prev_len; ++l)
|
||||
if (qseq[qoff - 1 - l] != qseq[qoff + len - 1 - l])
|
||||
break;
|
||||
@@ -148,9 +130,9 @@ static void mm_fix_cigar(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq,
|
||||
p->cigar[k-1] -= l<<4, p->cigar[k+1] += l<<4, qoff -= l, toff -= l;
|
||||
if (l == prev_len) to_shrink = 1;
|
||||
}
|
||||
if (op == 1) qoff += len;
|
||||
if (op == MM_CIGAR_INS) qoff += len;
|
||||
else toff += len;
|
||||
} else if (op == 3) {
|
||||
} else if (op == MM_CIGAR_N_SKIP) {
|
||||
toff += len;
|
||||
}
|
||||
}
|
||||
@@ -160,13 +142,13 @@ static void mm_fix_cigar(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq,
|
||||
uint32_t l, s[3] = {0,0,0};
|
||||
for (l = k; l < p->n_cigar; ++l) { // count number of adjacent I and D
|
||||
uint32_t op = p->cigar[l]&0xf;
|
||||
if (op == 1 || op == 2 || p->cigar[l]>>4 == 0)
|
||||
if (op == MM_CIGAR_INS || op == MM_CIGAR_DEL || p->cigar[l]>>4 == 0)
|
||||
s[op] += p->cigar[l] >> 4;
|
||||
else break;
|
||||
}
|
||||
if (s[1] > 0 && s[2] > 0 && l - k > 2) { // turn to a single I and a single D
|
||||
p->cigar[k] = s[1]<<4|1;
|
||||
p->cigar[k+1] = s[2]<<4|2;
|
||||
p->cigar[k] = s[1]<<4|MM_CIGAR_INS;
|
||||
p->cigar[k+1] = s[2]<<4|MM_CIGAR_DEL;
|
||||
for (k += 2; k < l; ++k)
|
||||
p->cigar[k] &= 0xf;
|
||||
to_shrink = 1;
|
||||
@@ -186,9 +168,9 @@ static void mm_fix_cigar(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq,
|
||||
else p->cigar[k+1] += p->cigar[k]>>4<<4; // add length to the next CIGAR operator
|
||||
p->n_cigar = l;
|
||||
}
|
||||
if ((p->cigar[0]&0xf) == 1 || (p->cigar[0]&0xf) == 2) { // get rid of leading I or D
|
||||
if ((p->cigar[0]&0xf) == MM_CIGAR_INS || (p->cigar[0]&0xf) == MM_CIGAR_DEL) { // get rid of leading I or D
|
||||
int32_t l = p->cigar[0] >> 4;
|
||||
if ((p->cigar[0]&0xf) == 1) {
|
||||
if ((p->cigar[0]&0xf) == MM_CIGAR_INS) {
|
||||
if (r->rev) r->qe -= l;
|
||||
else r->qs += l;
|
||||
*qshift = l;
|
||||
@@ -206,7 +188,7 @@ static void mm_update_cigar_eqx(mm_reg1_t *r, const uint8_t *qseq, const uint8_t
|
||||
if (r->p == 0) return;
|
||||
for (k = 0; k < r->p->n_cigar; ++k) {
|
||||
uint32_t op = r->p->cigar[k]&0xf, len = r->p->cigar[k]>>4;
|
||||
if (op == 0) {
|
||||
if (op == MM_CIGAR_MATCH) {
|
||||
while (len > 0) {
|
||||
for (l = 0; l < len && qseq[qoff + l] == tseq[toff + l]; ++l) {} // run of "="; TODO: N<=>N is converted to "="
|
||||
if (l > 0) { ++n_EQX; len -= l; toff += l; qoff += l; }
|
||||
@@ -215,11 +197,11 @@ static void mm_update_cigar_eqx(mm_reg1_t *r, const uint8_t *qseq, const uint8_t
|
||||
if (l > 0) { ++n_EQX; len -= l; toff += l; qoff += l; }
|
||||
}
|
||||
++n_M;
|
||||
} else if (op == 1) { // insertion
|
||||
} else if (op == MM_CIGAR_INS) {
|
||||
qoff += len;
|
||||
} else if (op == 2) { // deletion
|
||||
} else if (op == MM_CIGAR_DEL) {
|
||||
toff += len;
|
||||
} else if (op == 3) { // intron
|
||||
} else if (op == MM_CIGAR_N_SKIP) {
|
||||
toff += len;
|
||||
}
|
||||
}
|
||||
@@ -227,7 +209,7 @@ static void mm_update_cigar_eqx(mm_reg1_t *r, const uint8_t *qseq, const uint8_t
|
||||
if (n_EQX == n_M) {
|
||||
for (k = 0; k < r->p->n_cigar; ++k) {
|
||||
uint32_t op = r->p->cigar[k]&0xf, len = r->p->cigar[k]>>4;
|
||||
if (op == 0) r->p->cigar[k] = len << 4 | 7;
|
||||
if (op == MM_CIGAR_MATCH) r->p->cigar[k] = len << 4 | MM_CIGAR_EQ_MATCH;
|
||||
}
|
||||
return;
|
||||
}
|
||||
@@ -241,25 +223,25 @@ static void mm_update_cigar_eqx(mm_reg1_t *r, const uint8_t *qseq, const uint8_t
|
||||
toff = qoff = m = 0;
|
||||
for (k = 0; k < r->p->n_cigar; ++k) {
|
||||
uint32_t op = r->p->cigar[k]&0xf, len = r->p->cigar[k]>>4;
|
||||
if (op == 0) { // match/mismatch
|
||||
if (op == MM_CIGAR_MATCH) {
|
||||
while (len > 0) {
|
||||
// match
|
||||
for (l = 0; l < len && qseq[qoff + l] == tseq[toff + l]; ++l) {}
|
||||
if (l > 0) p->cigar[m++] = l << 4 | 7;
|
||||
if (l > 0) p->cigar[m++] = l << 4 | MM_CIGAR_EQ_MATCH;
|
||||
len -= l;
|
||||
toff += l, qoff += l;
|
||||
// mismatch
|
||||
for (l = 0; l < len && qseq[qoff + l] != tseq[toff + l]; ++l) {}
|
||||
if (l > 0) p->cigar[m++] = l << 4 | 8;
|
||||
if (l > 0) p->cigar[m++] = l << 4 | MM_CIGAR_X_MISMATCH;
|
||||
len -= l;
|
||||
toff += l, qoff += l;
|
||||
}
|
||||
continue;
|
||||
} else if (op == 1) { // insertion
|
||||
} else if (op == MM_CIGAR_INS) {
|
||||
qoff += len;
|
||||
} else if (op == 2) { // deletion
|
||||
} else if (op == MM_CIGAR_DEL) {
|
||||
toff += len;
|
||||
} else if (op == 3) { // intron
|
||||
} else if (op == MM_CIGAR_N_SKIP) {
|
||||
toff += len;
|
||||
}
|
||||
p->cigar[m++] = r->p->cigar[k];
|
||||
@@ -269,18 +251,19 @@ static void mm_update_cigar_eqx(mm_reg1_t *r, const uint8_t *qseq, const uint8_t
|
||||
r->p = p;
|
||||
}
|
||||
|
||||
static void mm_update_extra(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq, const int8_t *mat, int8_t q, int8_t e, int is_eqx)
|
||||
static void mm_update_extra(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *tseq, const int8_t *mat, int8_t q, int8_t e, int is_eqx, int log_gap)
|
||||
{
|
||||
uint32_t k, l;
|
||||
int32_t s = 0, max = 0, qshift, tshift, toff = 0, qoff = 0;
|
||||
int32_t qshift, tshift, toff = 0, qoff = 0;
|
||||
double s = 0.0, max = 0.0;
|
||||
mm_extra_t *p = r->p;
|
||||
if (p == 0) return;
|
||||
mm_fix_cigar(r, qseq, tseq, &qshift, &tshift);
|
||||
qseq += qshift, tseq += tshift; // qseq and tseq may be shifted due to the removal of leading I/D
|
||||
r->blen = r->mlen = 0;
|
||||
r->blen = r->mlen = 0, r->is_spliced = 0;
|
||||
for (k = 0; k < p->n_cigar; ++k) {
|
||||
uint32_t op = p->cigar[k]&0xf, len = p->cigar[k]>>4;
|
||||
if (op == 0) { // match/mismatch
|
||||
if (op == MM_CIGAR_MATCH) {
|
||||
int n_ambi = 0, n_diff = 0;
|
||||
for (l = 0; l < len; ++l) {
|
||||
int cq = qseq[qoff + l], ct = tseq[toff + l];
|
||||
@@ -292,34 +275,35 @@ static void mm_update_extra(mm_reg1_t *r, const uint8_t *qseq, const uint8_t *ts
|
||||
}
|
||||
r->blen += len - n_ambi, r->mlen += len - (n_ambi + n_diff), p->n_ambi += n_ambi;
|
||||
toff += len, qoff += len;
|
||||
} else if (op == 1) { // insertion
|
||||
} else if (op == MM_CIGAR_INS) {
|
||||
int n_ambi = 0;
|
||||
for (l = 0; l < len; ++l)
|
||||
if (qseq[qoff + l] > 3) ++n_ambi;
|
||||
r->blen += len - n_ambi, p->n_ambi += n_ambi;
|
||||
s -= q + e * len;
|
||||
if (log_gap) s -= q + (double)e * mg_log2(1.0 + len);
|
||||
else s -= q + e;
|
||||
if (s < 0) s = 0;
|
||||
qoff += len;
|
||||
} else if (op == 2) { // deletion
|
||||
} else if (op == MM_CIGAR_DEL) {
|
||||
int n_ambi = 0;
|
||||
for (l = 0; l < len; ++l)
|
||||
if (tseq[toff + l] > 3) ++n_ambi;
|
||||
r->blen += len - n_ambi, p->n_ambi += n_ambi;
|
||||
s -= q + e * len;
|
||||
if (log_gap) s -= q + (double)e * mg_log2(1.0 + len);
|
||||
else s -= q + e;
|
||||
if (s < 0) s = 0;
|
||||
toff += len;
|
||||
} else if (op == 3) { // intron
|
||||
toff += len;
|
||||
} else if (op == MM_CIGAR_N_SKIP) {
|
||||
r->is_spliced = 1, toff += len;
|
||||
}
|
||||
}
|
||||
p->dp_max = max;
|
||||
p->dp_max = p->dp_max0 = (int32_t)(max + .499);
|
||||
assert(qoff == r->qe - r->qs && toff == r->re - r->rs);
|
||||
if (is_eqx) mm_update_cigar_eqx(r, qseq, tseq); // NB: it has to be called here as changes to qseq and tseq are not returned
|
||||
}
|
||||
|
||||
static void mm_append_cigar(mm_reg1_t *r, uint32_t n_cigar, uint32_t *cigar) // TODO: this calls the libc realloc()
|
||||
void mm_enlarge_cigar(mm_reg1_t *r, uint32_t n_cigar) // TODO: this calls the libc realloc()
|
||||
{
|
||||
mm_extra_t *p;
|
||||
if (n_cigar == 0) return;
|
||||
if (r->p == 0) {
|
||||
uint32_t capacity = n_cigar + sizeof(mm_extra_t)/4;
|
||||
@@ -331,6 +315,13 @@ static void mm_append_cigar(mm_reg1_t *r, uint32_t n_cigar, uint32_t *cigar) //
|
||||
kroundup32(r->p->capacity);
|
||||
r->p = (mm_extra_t*)realloc(r->p, r->p->capacity * 4);
|
||||
}
|
||||
}
|
||||
|
||||
static void mm_append_cigar(mm_reg1_t *r, uint32_t n_cigar, const uint32_t *cigar)
|
||||
{
|
||||
mm_extra_t *p;
|
||||
if (n_cigar == 0) return;
|
||||
mm_enlarge_cigar(r, n_cigar);
|
||||
p = r->p;
|
||||
if (p->n_cigar > 0 && (p->cigar[p->n_cigar-1]&0xf) == (cigar[0]&0xf)) { // same CIGAR op at the boundary
|
||||
p->cigar[p->n_cigar-1] += cigar[0]>>4<<4;
|
||||
@@ -342,49 +333,77 @@ static void mm_append_cigar(mm_reg1_t *r, uint32_t n_cigar, uint32_t *cigar) //
|
||||
}
|
||||
}
|
||||
|
||||
static void mm_align_pair(void *km, const mm_mapopt_t *opt, int qlen, const uint8_t *qseq, int tlen, const uint8_t *tseq, const uint8_t *junc, const int8_t *mat, int w, int end_bonus, int zdrop, int flag, ksw_extz_t *ez)
|
||||
static void mm_align_pair(void *km, const mm_mapopt_t *opt, int qlen, const uint8_t *qseq, int tlen, const uint8_t *tseq, const uint8_t *junc,
|
||||
const int8_t *mat, int w, int end_bonus, int zdrop, int ksw_flag, ksw_extz_t *ez)
|
||||
{
|
||||
#ifdef MANUAL_PROFILING
|
||||
uint64_t align_start = __rdtsc();
|
||||
#endif
|
||||
|
||||
if (mm_dbg_flag & MM_DBG_PRINT_ALN_SEQ) {
|
||||
int i;
|
||||
fprintf(stderr, "===> q=(%d,%d), e=(%d,%d), bw=%d, flag=%d, zdrop=%d <===\n", opt->q, opt->q2, opt->e, opt->e2, w, flag, opt->zdrop);
|
||||
fprintf(stderr, "===> q=(%d,%d), e=(%d,%d), bw=%d, ksw_flag=%d, zdrop=%d, end_bonus=%d <===\n", opt->q, opt->q2, opt->e, opt->e2, w, ksw_flag, opt->zdrop, end_bonus);
|
||||
for (i = 0; i < tlen; ++i) fputc("ACGTN"[tseq[i]], stderr);
|
||||
fputc('\n', stderr);
|
||||
for (i = 0; i < qlen; ++i) fputc("ACGTN"[qseq[i]], stderr);
|
||||
fputc('\n', stderr);
|
||||
}
|
||||
if (opt->max_sw_mat > 0 && (int64_t)tlen * qlen > opt->max_sw_mat) {
|
||||
if (opt->transition != 0 && opt->b != opt->transition)
|
||||
ksw_flag |= KSW_EZ_GENERIC_SC;
|
||||
if (opt->max_sw_mat > 0 && (int64_t)tlen * qlen > opt->max_sw_mat) { // too much memory; skip alignment
|
||||
ksw_reset_extz(ez);
|
||||
ez->zdropped = 1;
|
||||
} else if (opt->flag & MM_F_SPLICE)
|
||||
ksw_exts2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->noncan, zdrop, opt->junc_bonus, flag, junc, ez);
|
||||
else if (opt->q == opt->q2 && opt->e == opt->e2)
|
||||
ksw_extz2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, w, zdrop, end_bonus, flag, ez);
|
||||
else{
|
||||
#if defined (ALIGN_AVX) && (defined(__AVX512BW__) || (defined(__AVX2__) && defined(APPLY_AVX2)))
|
||||
#ifdef __AVX512BW__
|
||||
|
||||
ksw_extd2_avx512(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->e2, w, zdrop, end_bonus, flag, ez);
|
||||
#elif __AVX2__
|
||||
ksw_extd2_avx2(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->e2, w, zdrop, end_bonus, flag, ez);
|
||||
#endif
|
||||
#else
|
||||
ksw_extd2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->e2, w, zdrop, end_bonus, flag, ez);
|
||||
#endif
|
||||
}
|
||||
} else if (opt->flag & MM_F_SPLICE) { // spliced alignment
|
||||
assert((ksw_flag & KSW_EZ_SPLICE_FOR) == 0 || (ksw_flag & KSW_EZ_SPLICE_REV) == 0);
|
||||
if (!(opt->flag & MM_F_SPLICE_OLD)) ksw_flag |= KSW_EZ_SPLICE_CMPLX;
|
||||
ksw_exts2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->noncan, zdrop, end_bonus, opt->junc_bonus, opt->junc_pen, ksw_flag, junc, ez);
|
||||
} else if (opt->q == opt->q2 && opt->e == opt->e2) { // affine gap
|
||||
ksw_extz2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, w, zdrop, end_bonus, ksw_flag, ez);
|
||||
} else { // dual affine gap
|
||||
ksw_extd2_sse(km, qlen, qseq, tlen, tseq, 5, mat, opt->q, opt->e, opt->q2, opt->e2, w, zdrop, end_bonus, ksw_flag, ez);
|
||||
}
|
||||
if (mm_dbg_flag & MM_DBG_PRINT_ALN_SEQ) {
|
||||
int i;
|
||||
fprintf(stderr, "score=%d, cigar=", ez->score);
|
||||
for (i = 0; i < ez->n_cigar; ++i)
|
||||
fprintf(stderr, "%d%c", ez->cigar[i]>>4, "MIDN"[ez->cigar[i]&0xf]);
|
||||
fprintf(stderr, "%d%c", ez->cigar[i]>>4, MM_CIGAR_STR[ez->cigar[i]&0xf]);
|
||||
fprintf(stderr, "\n");
|
||||
}
|
||||
#ifdef MANUAL_PROFILING
|
||||
alignment_time += (__rdtsc() - align_start);
|
||||
#endif
|
||||
}
|
||||
|
||||
static int mm_align_sr_rna(void *km, const mm_mapopt_t *opt, int qlen, const uint8_t *qseq, int tlen, const uint8_t *tseq, const uint8_t *junc, uint8_t *tseq2, uint8_t *junc2,
|
||||
const int8_t *mat, int w, int end_bonus, int zdrop, int ksw_flag, ksw_extz_t *ez)
|
||||
{
|
||||
int32_t ilen = opt->q2 * 2, tlen2 = qlen * 2 + ilen;
|
||||
int32_t i, ll = 0, lr = 0, nn = 0, n_ins = 0;
|
||||
if (!(opt->flag & MM_F_SPLICE)) return 0; // only for spliced alignment
|
||||
if (qlen > MM_MAX_QLEN_FLANK || qlen * 2 + ilen > tlen) return 0; // the query sequence can't be too long and the target sequence must be long enough
|
||||
for (i = 0; i < qlen; ++i) // exact match length from the left
|
||||
if (qseq[i] == tseq[i] && qseq[i] < 4)
|
||||
++ll;
|
||||
for (i = 0; i < qlen; ++i) // exact match length from the right
|
||||
if (qseq[qlen - 1 - i] == tseq[tlen - 1 - i] && qseq[qlen - 1 - i] < 4)
|
||||
++lr;
|
||||
if (qlen - (ll + lr) > 9) return 0; // qlen may be smaller than ll+lr
|
||||
memcpy(tseq2, tseq, qlen);
|
||||
memset(&tseq2[qlen], 4, ilen);
|
||||
memcpy(&tseq2[qlen + ilen], &tseq[tlen - qlen], qlen);
|
||||
if (junc) {
|
||||
memcpy(junc2, junc, qlen);
|
||||
memset(&junc2[qlen], 0, ilen);
|
||||
memcpy(&junc2[qlen + ilen], &junc[tlen - qlen], qlen);
|
||||
}
|
||||
if (!(opt->flag & MM_F_SPLICE_OLD)) ksw_flag |= KSW_EZ_SPLICE_CMPLX;
|
||||
ksw_exts2_sse(km, qlen, qseq, tlen2, tseq2, 5, mat, opt->q, opt->e, opt->q2, opt->noncan, zdrop, end_bonus, opt->junc_bonus, opt->junc_pen, ksw_flag, junc2, ez);
|
||||
if (ez->zdropped) return 0;
|
||||
if ((ez->cigar[0]&0xf) != KSW_CIGAR_MATCH || (ez->cigar[ez->n_cigar-1]&0xf) != KSW_CIGAR_MATCH) return 0;
|
||||
for (i = 0; i < ez->n_cigar; ++i) { // count the number of introns in the alignment
|
||||
if ((ez->cigar[i]&0xf) == KSW_CIGAR_N_SKIP)
|
||||
++nn;
|
||||
else if ((ez->cigar[i]&0xf) == KSW_CIGAR_INS)
|
||||
++n_ins;
|
||||
}
|
||||
if (nn != 1 || n_ins > 0) return 0; // the heuristic only works when there is exactly one intron
|
||||
for (i = 0; i < ez->n_cigar; ++i)
|
||||
if ((ez->cigar[i]&0xf) == KSW_CIGAR_N_SKIP)
|
||||
ez->cigar[i] += (tlen - tlen2) << 4;
|
||||
return 1;
|
||||
}
|
||||
|
||||
static inline int mm_get_hplen_back(const mm_idx_t *mi, uint32_t rid, uint32_t x)
|
||||
@@ -582,8 +601,13 @@ static int mm_seed_ext_score(void *km, const mm_mapopt_t *opt, const mm_idx_t *m
|
||||
re = re + ext_len < (int32_t)mi->seq[rid].len? re + ext_len : mi->seq[rid].len;
|
||||
qe = qe + ext_len < qlen? qe + ext_len : qlen;
|
||||
tseq = (uint8_t*)kmalloc(km, re - rs);
|
||||
mm_idx_getseq(mi, rid, rs, re, tseq);
|
||||
qseq = qseq0[a->x>>63] + qs;
|
||||
if (opt->flag & MM_F_QSTRAND) {
|
||||
qseq = qseq0[0] + qs;
|
||||
mm_idx_getseq2(mi, a->x>>63, rid, rs, re, tseq);
|
||||
} else {
|
||||
qseq = qseq0[a->x>>63] + qs;
|
||||
mm_idx_getseq(mi, rid, rs, re, tseq);
|
||||
}
|
||||
qp = ksw_ll_qinit(km, 2, qe - qs, qseq, 5, mat);
|
||||
score = ksw_ll_i16(qp, re - rs, tseq, opt->q, opt->e, &q_off, &t_off);
|
||||
kfree(km, tseq);
|
||||
@@ -611,12 +635,19 @@ static void mm_fix_bad_ends_splice(void *km, const mm_mapopt_t *opt, const mm_id
|
||||
}
|
||||
}
|
||||
|
||||
static inline void mm_get_junc(const mm_idx_t *mi, int32_t ctg, int32_t st, int32_t en, int32_t rev, uint8_t *junc)
|
||||
{
|
||||
if (mi->spsc) mm_idx_spsc_get(mi, ctg, st, en, rev, junc);
|
||||
else if (mi->I) mm_idx_bed_junc(mi, ctg, st, en, junc);
|
||||
else memset(junc, 0, en - st);
|
||||
}
|
||||
|
||||
static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, uint8_t *qseq0[2], mm_reg1_t *r, mm_reg1_t *r2, int n_a, mm128_t *a, ksw_extz_t *ez, int splice_flag)
|
||||
{
|
||||
int is_sr = !!(opt->flag & MM_F_SR), is_splice = !!(opt->flag & MM_F_SPLICE);
|
||||
int is_sr = !!(opt->flag & MM_F_SR), is_splice = !!(opt->flag & MM_F_SPLICE), is_sr_rna = (!!(opt->flag & MM_F_SR_RNA) && is_splice);
|
||||
int32_t rid = a[r->as].x<<1>>33, rev = a[r->as].x>>63, as1, cnt1;
|
||||
uint8_t *tseq, *qseq, *junc;
|
||||
int32_t i, l, bw, dropped = 0, extra_flag = 0, rs0, re0, qs0, qe0;
|
||||
uint8_t *tseq, *qseq, *junc, *tseq2 = 0, *junc2 = 0;
|
||||
int32_t i, l, bw, bw_long, dropped = 0, ksw_flag = 0, rs0, re0, qs0, qe0;
|
||||
int32_t rs, re, qs, qe;
|
||||
int32_t rs1, qs1, re1, qe1;
|
||||
int8_t mat[25];
|
||||
@@ -625,8 +656,10 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
|
||||
|
||||
r2->cnt = 0;
|
||||
if (r->cnt == 0) return;
|
||||
ksw_gen_simple_mat(5, mat, opt->a, opt->b, opt->sc_ambi);
|
||||
ksw_gen_ts_mat(5, mat, opt->a, opt->b, opt->transition, opt->sc_ambi);
|
||||
bw = (int)(opt->bw * 1.5 + 1.);
|
||||
bw_long = (int)(opt->bw_long * 1.5 + 1.);
|
||||
if (bw_long < bw) bw_long = bw;
|
||||
|
||||
if (is_sr && !(mi->flag & MM_I_HPC)) {
|
||||
mm_max_stretch(r, a, &as1, &cnt1);
|
||||
@@ -649,9 +682,10 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
|
||||
assert(cnt1 > 0);
|
||||
|
||||
if (is_splice) {
|
||||
if (splice_flag & MM_F_SPLICE_FOR) extra_flag |= rev? KSW_EZ_SPLICE_REV : KSW_EZ_SPLICE_FOR;
|
||||
if (splice_flag & MM_F_SPLICE_REV) extra_flag |= rev? KSW_EZ_SPLICE_FOR : KSW_EZ_SPLICE_REV;
|
||||
if (opt->flag & MM_F_SPLICE_FLANK) extra_flag |= KSW_EZ_SPLICE_FLANK;
|
||||
if (splice_flag & MM_F_SPLICE_FOR) ksw_flag |= rev? KSW_EZ_SPLICE_REV : KSW_EZ_SPLICE_FOR;
|
||||
if (splice_flag & MM_F_SPLICE_REV) ksw_flag |= rev? KSW_EZ_SPLICE_FOR : KSW_EZ_SPLICE_REV;
|
||||
if (opt->flag & MM_F_SPLICE_FLANK) ksw_flag |= KSW_EZ_SPLICE_FLANK;
|
||||
if (mi->spsc) ksw_flag |= KSW_EZ_SPLICE_SCORE;
|
||||
}
|
||||
|
||||
/* Look for the start and end of regions to perform DP. This sounds easy
|
||||
@@ -736,14 +770,25 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
|
||||
tseq = (uint8_t*)kmalloc(km, re0 - rs0);
|
||||
junc = (uint8_t*)kmalloc(km, re0 - rs0);
|
||||
|
||||
if (is_sr_rna) {
|
||||
int32_t max_tlen2 = MM_MAX_QLEN_FLANK * 2 + opt->q2 * 2;
|
||||
tseq2 = Kmalloc(km, uint8_t, max_tlen2 * 2);
|
||||
junc2 = tseq2 + max_tlen2;
|
||||
}
|
||||
|
||||
if (qs > 0 && rs > 0) { // left extension; probably the condition can be changed to "qs > qs0 && rs > rs0"
|
||||
qseq = &qseq0[rev][qs0];
|
||||
mm_idx_getseq(mi, rid, rs0, rs, tseq);
|
||||
mm_idx_bed_junc(mi, rid, rs0, rs, junc);
|
||||
if (opt->flag & MM_F_QSTRAND) {
|
||||
qseq = &qseq0[0][qs0];
|
||||
mm_idx_getseq2(mi, rev, rid, rs0, rs, tseq);
|
||||
} else {
|
||||
qseq = &qseq0[rev][qs0];
|
||||
mm_idx_getseq(mi, rid, rs0, rs, tseq);
|
||||
}
|
||||
mm_get_junc(mi, rid, rs0, rs, !!(ksw_flag&KSW_EZ_SPLICE_REV), junc);
|
||||
mm_seq_rev(qs - qs0, qseq);
|
||||
mm_seq_rev(rs - rs0, tseq);
|
||||
mm_seq_rev(rs - rs0, junc);
|
||||
mm_align_pair(km, opt, qs - qs0, qseq, rs - rs0, tseq, junc, mat, bw, opt->end_bonus, r->split_inv? opt->zdrop_inv : opt->zdrop, extra_flag|KSW_EZ_EXTZ_ONLY|KSW_EZ_RIGHT|KSW_EZ_REV_CIGAR, ez);
|
||||
mm_align_pair(km, opt, qs - qs0, qseq, rs - rs0, tseq, junc, mat, bw, opt->end_bonus, r->split_inv? opt->zdrop_inv : opt->zdrop, ksw_flag|KSW_EZ_EXTZ_ONLY|KSW_EZ_RIGHT|KSW_EZ_REV_CIGAR, ez);
|
||||
if (ez->n_cigar > 0) {
|
||||
mm_append_cigar(r, ez->n_cigar, ez->cigar);
|
||||
r->p->dp_score += ez->max;
|
||||
@@ -755,35 +800,48 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
|
||||
re1 = rs, qe1 = qs;
|
||||
assert(qs1 >= 0 && rs1 >= 0);
|
||||
|
||||
for (i = is_sr? cnt1 - 1 : 1; i < cnt1; ++i) { // gap filling
|
||||
for (i = is_sr? cnt1 - 1 : 1; i < cnt1; ++i) { // gap filling; for short genomic reads, fill from the first seed to the last
|
||||
if ((a[as1+i].y & (MM_SEED_IGNORE|MM_SEED_TANDEM)) && i != cnt1 - 1) continue;
|
||||
if (is_sr && !(mi->flag & MM_I_HPC)) {
|
||||
re = (int32_t)a[as1 + i].x + 1;
|
||||
qe = (int32_t)a[as1 + i].y + 1;
|
||||
} else mm_adjust_minier(mi, qseq0, &a[as1 + i], &re, &qe);
|
||||
re1 = re, qe1 = qe;
|
||||
if (i == cnt1 - 1 || (a[as1+i].y&MM_SEED_LONG_JOIN) || (qe - qs >= opt->min_ksw_len && re - rs >= opt->min_ksw_len)) {
|
||||
int j, bw1 = bw, zdrop_code;
|
||||
if (i == cnt1 - 1 || (a[as1+i].y&MM_SEED_LONG_JOIN) || (qe - qs >= opt->min_ksw_len && re - rs >= opt->min_ksw_len)) { // gap filling
|
||||
int j, bw1 = bw_long, zdrop_code;
|
||||
if (a[as1+i].y & MM_SEED_LONG_JOIN)
|
||||
bw1 = qe - qs > re - rs? qe - qs : re - rs;
|
||||
// perform alignment
|
||||
qseq = &qseq0[rev][qs];
|
||||
mm_idx_getseq(mi, rid, rs, re, tseq);
|
||||
mm_idx_bed_junc(mi, rid, rs, re, junc);
|
||||
if (is_sr) { // perform ungapped alignment
|
||||
if (opt->flag & MM_F_QSTRAND) {
|
||||
qseq = &qseq0[0][qs];
|
||||
mm_idx_getseq2(mi, rev, rid, rs, re, tseq);
|
||||
} else {
|
||||
qseq = &qseq0[rev][qs];
|
||||
mm_idx_getseq(mi, rid, rs, re, tseq);
|
||||
}
|
||||
mm_get_junc(mi, rid, rs, re, !!(ksw_flag&KSW_EZ_SPLICE_REV), junc);
|
||||
if (is_sr || (is_sr_rna && qe - qs == re - rs)) { // perform ungapped alignment
|
||||
int32_t max_gapped_score = (qe - qs - 2) * opt->a - 2 * (opt->q + opt->e);
|
||||
assert(qe - qs == re - rs);
|
||||
ksw_reset_extz(ez);
|
||||
for (j = 0, ez->score = 0; j < qe - qs; ++j) {
|
||||
if (qseq[j] >= 4 || tseq[j] >= 4) ez->score += opt->e2;
|
||||
if (qseq[j] >= 4 || tseq[j] >= 4) ez->score += opt->sc_ambi > 0? -opt->sc_ambi : opt->sc_ambi;
|
||||
else ez->score += qseq[j] == tseq[j]? opt->a : -opt->b;
|
||||
}
|
||||
ez->cigar = ksw_push_cigar(km, &ez->n_cigar, &ez->m_cigar, ez->cigar, 0, qe - qs);
|
||||
if (ez->score > max_gapped_score)
|
||||
ez->cigar = ksw_push_cigar(km, &ez->n_cigar, &ez->m_cigar, ez->cigar, MM_CIGAR_MATCH, qe - qs);
|
||||
else
|
||||
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, junc, mat, bw1, -1, opt->zdrop, ksw_flag|KSW_EZ_APPROX_MAX, ez);
|
||||
} else { // perform normal gapped alignment
|
||||
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, junc, mat, bw1, -1, opt->zdrop, extra_flag|KSW_EZ_APPROX_MAX, ez); // first pass: with approximate Z-drop
|
||||
int32_t skip_full = 0;
|
||||
if (is_sr_rna)
|
||||
skip_full = mm_align_sr_rna(km, opt, qe - qs, qseq, re - rs, tseq, junc, tseq2, junc2, mat, bw1, -1, opt->zdrop, ksw_flag|KSW_EZ_APPROX_MAX, ez);
|
||||
if (!skip_full)
|
||||
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, junc, mat, bw1, -1, opt->zdrop, ksw_flag|KSW_EZ_APPROX_MAX, ez); // first pass: with approximate Z-drop
|
||||
}
|
||||
// test Z-drop and inversion Z-drop
|
||||
if ((zdrop_code = mm_test_zdrop(km, opt, qseq, tseq, ez->n_cigar, ez->cigar, mat)) != 0)
|
||||
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, junc, mat, bw1, -1, zdrop_code == 2? opt->zdrop_inv : opt->zdrop, extra_flag, ez); // second pass: lift approximate
|
||||
mm_align_pair(km, opt, qe - qs, qseq, re - rs, tseq, junc, mat, bw1, -1, zdrop_code == 2? opt->zdrop_inv : opt->zdrop, ksw_flag, ez); // second pass: lift approximate
|
||||
// update CIGAR
|
||||
if (ez->n_cigar > 0)
|
||||
mm_append_cigar(r, ez->n_cigar, ez->cigar);
|
||||
@@ -804,7 +862,7 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
|
||||
re1 = rs + (ez->max_t + 1);
|
||||
qe1 = qs + (ez->max_q + 1);
|
||||
if (cnt1 - (j + 1) >= opt->min_cnt) {
|
||||
mm_split_reg(r, r2, as1 + j + 1 - r->as, qlen, a);
|
||||
mm_split_reg(r, r2, as1 + j + 1 - r->as, qlen, a, !!(opt->flag&MM_F_QSTRAND));
|
||||
if (zdrop_code == 2) r2->split_inv = 1;
|
||||
}
|
||||
break;
|
||||
@@ -814,10 +872,15 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
|
||||
}
|
||||
|
||||
if (!dropped && qe < qe0 && re < re0) { // right extension
|
||||
qseq = &qseq0[rev][qe];
|
||||
mm_idx_getseq(mi, rid, re, re0, tseq);
|
||||
mm_idx_bed_junc(mi, rid, re, re0, junc);
|
||||
mm_align_pair(km, opt, qe0 - qe, qseq, re0 - re, tseq, junc, mat, bw, opt->end_bonus, opt->zdrop, extra_flag|KSW_EZ_EXTZ_ONLY, ez);
|
||||
if (opt->flag & MM_F_QSTRAND) {
|
||||
qseq = &qseq0[0][qe];
|
||||
mm_idx_getseq2(mi, rev, rid, re, re0, tseq);
|
||||
} else {
|
||||
qseq = &qseq0[rev][qe];
|
||||
mm_idx_getseq(mi, rid, re, re0, tseq);
|
||||
}
|
||||
mm_get_junc(mi, rid, re, re0, !!(ksw_flag&KSW_EZ_SPLICE_REV), junc);
|
||||
mm_align_pair(km, opt, qe0 - qe, qseq, re0 - re, tseq, junc, mat, bw, opt->end_bonus, opt->zdrop, ksw_flag|KSW_EZ_EXTZ_ONLY, ez);
|
||||
if (ez->n_cigar > 0) {
|
||||
mm_append_cigar(r, ez->n_cigar, ez->cigar);
|
||||
r->p->dp_score += ez->max;
|
||||
@@ -828,23 +891,30 @@ static void mm_align1(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int
|
||||
assert(qe1 <= qlen);
|
||||
|
||||
r->rs = rs1, r->re = re1;
|
||||
if (rev) r->qs = qlen - qe1, r->qe = qlen - qs1;
|
||||
else r->qs = qs1, r->qe = qe1;
|
||||
if (!rev || (opt->flag & MM_F_QSTRAND)) r->qs = qs1, r->qe = qe1;
|
||||
else r->qs = qlen - qe1, r->qe = qlen - qs1;
|
||||
|
||||
assert(re1 - rs1 <= re0 - rs0);
|
||||
if (r->p) {
|
||||
mm_idx_getseq(mi, rid, rs1, re1, tseq);
|
||||
mm_update_extra(r, &qseq0[r->rev][qs1], tseq, mat, opt->q, opt->e, opt->flag & MM_F_EQX);
|
||||
if (opt->flag & MM_F_QSTRAND) {
|
||||
mm_idx_getseq2(mi, r->rev, rid, rs1, re1, tseq);
|
||||
qseq = &qseq0[0][qs1];
|
||||
} else {
|
||||
mm_idx_getseq(mi, rid, rs1, re1, tseq);
|
||||
qseq = &qseq0[r->rev][qs1];
|
||||
}
|
||||
mm_update_extra(r, qseq, tseq, mat, opt->q, opt->e, opt->flag & MM_F_EQX, !(is_sr || is_sr_rna));
|
||||
if (rev && r->p->trans_strand)
|
||||
r->p->trans_strand ^= 3; // flip to the read strand
|
||||
}
|
||||
|
||||
if (tseq2) kfree(km, tseq2);
|
||||
kfree(km, tseq);
|
||||
kfree(km, junc);
|
||||
}
|
||||
|
||||
static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, uint8_t *qseq0[2], const mm_reg1_t *r1, const mm_reg1_t *r2, mm_reg1_t *r_inv, ksw_extz_t *ez)
|
||||
{
|
||||
{ // NB: this doesn't work with the qstrand mode
|
||||
int tl, ql, score, ret = 0, q_off, t_off;
|
||||
uint8_t *tseq, *qseq;
|
||||
int8_t mat[25];
|
||||
@@ -860,7 +930,7 @@ static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, i
|
||||
if (ql < opt->min_chain_score || ql > opt->max_gap) return 0;
|
||||
if (tl < opt->min_chain_score || tl > opt->max_gap) return 0;
|
||||
|
||||
ksw_gen_simple_mat(5, mat, opt->a, opt->b, opt->sc_ambi);
|
||||
ksw_gen_ts_mat(5, mat, opt->a, opt->b, opt->transition, opt->sc_ambi);
|
||||
tseq = (uint8_t*)kmalloc(km, tl);
|
||||
mm_idx_getseq(mi, r1->rid, r1->re, r2->rs, tseq);
|
||||
qseq = r1->rev? &qseq0[0][r2->qe] : &qseq0[1][qlen - r2->qs];
|
||||
@@ -893,7 +963,7 @@ static int mm_align1_inv(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, i
|
||||
}
|
||||
r_inv->rs = r1->re + t_off;
|
||||
r_inv->re = r_inv->rs + ez->max_t + 1;
|
||||
mm_update_extra(r_inv, &qseq[q_off], &tseq[t_off], mat, opt->q, opt->e, opt->flag & MM_F_EQX);
|
||||
mm_update_extra(r_inv, &qseq[q_off], &tseq[t_off], mat, opt->q, opt->e, opt->flag & MM_F_EQX, !(opt->flag & (MM_F_SR|MM_F_SR_RNA)));
|
||||
ret = 1;
|
||||
end_align1_inv:
|
||||
kfree(km, tseq);
|
||||
@@ -910,6 +980,71 @@ static inline mm_reg1_t *mm_insert_reg(const mm_reg1_t *r, int i, int *n_regs, m
|
||||
return regs;
|
||||
}
|
||||
|
||||
static inline void mm_count_gaps(const mm_reg1_t *r, int32_t *n_gap_, int32_t *n_gapo_)
|
||||
{
|
||||
uint32_t i;
|
||||
int32_t n_gapo = 0, n_gap = 0;
|
||||
*n_gap_ = *n_gapo_ = -1;
|
||||
if (r->p == 0) return;
|
||||
for (i = 0; i < r->p->n_cigar; ++i) {
|
||||
int32_t op = r->p->cigar[i] & 0xf, len = r->p->cigar[i] >> 4;
|
||||
if (op == MM_CIGAR_INS || op == MM_CIGAR_DEL)
|
||||
++n_gapo, n_gap += len;
|
||||
}
|
||||
*n_gap_ = n_gap, *n_gapo_ = n_gapo;
|
||||
}
|
||||
|
||||
double mm_event_identity(const mm_reg1_t *r)
|
||||
{
|
||||
int32_t n_gap, n_gapo;
|
||||
if (r->p == 0) return -1.0f;
|
||||
mm_count_gaps(r, &n_gap, &n_gapo);
|
||||
return (double)r->mlen / (r->blen + r->p->n_ambi - n_gap + n_gapo);
|
||||
}
|
||||
|
||||
static int32_t mm_recal_max_dp(const mm_reg1_t *r, double b2, int32_t match_sc)
|
||||
{
|
||||
uint32_t i;
|
||||
int32_t n_gap = 0, n_mis;
|
||||
double gap_cost = 0.0;
|
||||
if (r->p == 0) return -1;
|
||||
for (i = 0; i < r->p->n_cigar; ++i) {
|
||||
int32_t op = r->p->cigar[i] & 0xf, len = r->p->cigar[i] >> 4;
|
||||
if (op == MM_CIGAR_INS || op == MM_CIGAR_DEL) {
|
||||
gap_cost += b2 + (double)mg_log2(1.0 + len);
|
||||
n_gap += len;
|
||||
}
|
||||
}
|
||||
n_mis = r->blen + r->p->n_ambi - r->mlen - n_gap;
|
||||
return (int32_t)(match_sc * (r->mlen - b2 * n_mis - gap_cost) + .499);
|
||||
}
|
||||
|
||||
void mm_update_dp_max(int qlen, int n_regs, mm_reg1_t *regs, float frac, int a, int b)
|
||||
{
|
||||
int32_t max = -1, max2 = -1, i, max_i = -1;
|
||||
double div, b2;
|
||||
if (n_regs < 2) return;
|
||||
for (i = 0; i < n_regs; ++i) {
|
||||
mm_reg1_t *r = ®s[i];
|
||||
if (r->p == 0) continue;
|
||||
if (r->p->dp_max > max) max2 = max, max = r->p->dp_max, max_i = i;
|
||||
else if (r->p->dp_max > max2) max2 = r->p->dp_max;
|
||||
}
|
||||
if (max_i < 0 || max < 0 || max2 < 0) return;
|
||||
if (regs[max_i].qe - regs[max_i].qs < (double)qlen * frac) return;
|
||||
if (max2 < (double)max * frac) return;
|
||||
div = 1. - mm_event_identity(®s[max_i]);
|
||||
if (div < 0.02) div = 0.02;
|
||||
b2 = 0.5 / div; // max value: 25
|
||||
if (b2 * a < b) b2 = (double)a / b;
|
||||
for (i = 0; i < n_regs; ++i) {
|
||||
mm_reg1_t *r = ®s[i];
|
||||
if (r->p == 0) continue;
|
||||
r->p->dp_max = mm_recal_max_dp(r, b2, a);
|
||||
if (r->p->dp_max < 0) r->p->dp_max = 0;
|
||||
}
|
||||
}
|
||||
|
||||
mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a)
|
||||
{
|
||||
extern unsigned char seq_nt4_table[256];
|
||||
@@ -929,31 +1064,43 @@ mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *m
|
||||
n_a = mm_squeeze_a(km, n_regs, regs, a);
|
||||
memset(&ez, 0, sizeof(ksw_extz_t));
|
||||
for (i = 0; i < n_regs; ++i) {
|
||||
mm_reg1_t r2;
|
||||
mm_reg1_t r2; // only used for inversion
|
||||
if ((opt->flag&MM_F_SPLICE) && (opt->flag&MM_F_SPLICE_FOR) && (opt->flag&MM_F_SPLICE_REV)) { // then do two rounds of alignments for both strands
|
||||
mm_reg1_t s[2], s2[2];
|
||||
int which, trans_strand;
|
||||
mm_reg1_t s[2], s2[2], *r;
|
||||
s[0] = s[1] = regs[i];
|
||||
mm_align1(km, opt, mi, qlen, qseq0, &s[0], &s2[0], n_a, a, &ez, MM_F_SPLICE_FOR);
|
||||
mm_align1(km, opt, mi, qlen, qseq0, &s[1], &s2[1], n_a, a, &ez, MM_F_SPLICE_REV);
|
||||
if (s[0].p->dp_score > s[1].p->dp_score) which = 0, trans_strand = 1;
|
||||
else if (s[0].p->dp_score < s[1].p->dp_score) which = 1, trans_strand = 2;
|
||||
else trans_strand = 3, which = (qlen + s[0].p->dp_score) & 1; // randomly choose a strand, effectively
|
||||
if (which == 0) {
|
||||
mm_align1(km, opt, mi, qlen, qseq0, &s[0], &s2[0], n_a, a, &ez, MM_F_SPLICE_FOR); // assume the transcript is on the + strand of the genome
|
||||
if ((opt->flag&MM_F_SR_RNA) && regs[i].qe - regs[i].qs == regs[i].re - regs[i].rs && s[0].qe - s[0].qs == s[0].re - s[0].rs && s[0].qs == 0 && s[0].qe == qlen) {
|
||||
regs[i] = s[0], r2 = s2[0];
|
||||
free(s[1].p);
|
||||
regs[i].p->trans_strand = 0;
|
||||
} else {
|
||||
regs[i] = s[1], r2 = s2[1];
|
||||
free(s[0].p);
|
||||
int which, trans_strand;
|
||||
mm_align1(km, opt, mi, qlen, qseq0, &s[1], &s2[1], n_a, a, &ez, MM_F_SPLICE_REV); // assume the transcript on the - strand
|
||||
if (s[0].p->dp_score > s[1].p->dp_score) which = 0, trans_strand = 1;
|
||||
else if (s[0].p->dp_score < s[1].p->dp_score) which = 1, trans_strand = 2;
|
||||
else trans_strand = 3, which = (qlen + s[0].p->dp_score) & 1; // randomly choose a strand, effectively
|
||||
if (which == 0) {
|
||||
regs[i] = s[0], r2 = s2[0];
|
||||
free(s[1].p);
|
||||
} else {
|
||||
regs[i] = s[1], r2 = s2[1];
|
||||
free(s[0].p);
|
||||
}
|
||||
r = ®s[i];
|
||||
r->p->trans_strand = trans_strand;
|
||||
if (r->is_spliced) {
|
||||
if (trans_strand == 1 || trans_strand == 2) // this is an *approximate* way to tell if there are splice signals.
|
||||
r->p->dp_max += (opt->a + opt->b) + ((opt->a + opt->b) >> 1);
|
||||
else if (trans_strand == 3)
|
||||
r->p->dp_max -= opt->a + opt->b;
|
||||
}
|
||||
}
|
||||
regs[i].p->trans_strand = trans_strand;
|
||||
} else { // one round of alignment
|
||||
mm_align1(km, opt, mi, qlen, qseq0, ®s[i], &r2, n_a, a, &ez, opt->flag);
|
||||
if (opt->flag&MM_F_SPLICE)
|
||||
regs[i].p->trans_strand = opt->flag&MM_F_SPLICE_FOR? 1 : 2;
|
||||
}
|
||||
if (r2.cnt > 0) regs = mm_insert_reg(&r2, i, &n_regs, regs);
|
||||
if (i > 0 && regs[i].split_inv) {
|
||||
if (i > 0 && regs[i].split_inv && !(opt->flag & MM_F_NO_INV)) {
|
||||
if (mm_align1_inv(km, opt, mi, qlen, qseq0, ®s[i-1], ®s[i], &r2, &ez)) {
|
||||
regs = mm_insert_reg(&r2, i, &n_regs, regs);
|
||||
++i; // skip the inserted INV alignment
|
||||
@@ -964,6 +1111,10 @@ mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *m
|
||||
kfree(km, qseq0[0]);
|
||||
kfree(km, ez.cigar);
|
||||
mm_filter_regs(opt, qlen, n_regs_, regs);
|
||||
if (!(opt->flag&(MM_F_SR|MM_F_SR_RNA|MM_F_ALL_CHAINS)) && !opt->split_prefix && qlen >= opt->rank_min_len) {
|
||||
mm_update_dp_max(qlen, *n_regs_, regs, opt->rank_frac, opt->a, opt->b);
|
||||
mm_filter_regs(opt, qlen, n_regs_, regs);
|
||||
}
|
||||
mm_hit_sort(km, n_regs_, regs, opt->alt_drop);
|
||||
return regs;
|
||||
}
|
||||
|
||||
@@ -1,16 +0,0 @@
|
||||
ref_data=$1
|
||||
preset=$2
|
||||
|
||||
make clean && make no_opt=1
|
||||
touch temp_read.fastq
|
||||
./minimap2 -ax $2 $1 temp_read.fastq -Z 1 >/dev/null
|
||||
|
||||
kv_file=$1"_"$2"_minimizers_key_value_sorted"
|
||||
|
||||
full_path=`readlink -f $kv_file`
|
||||
|
||||
cd ./ext/TAL
|
||||
make lisa_hash
|
||||
./build-lisa-hash-index $full_path
|
||||
|
||||
rm ../../temp_read.fastq
|
||||
@@ -1,265 +0,0 @@
|
||||
/* The MIT License
|
||||
|
||||
Copyright (c) 2018- Dana-Farber Cancer Institute
|
||||
2017-2018 Broad Institute, Inc.
|
||||
|
||||
Permission is hereby granted, free of charge, to any person obtaining
|
||||
a copy of this software and associated documentation files (the
|
||||
"Software"), to deal in the Software without restriction, including
|
||||
without limitation the rights to use, copy, modify, merge, publish,
|
||||
distribute, sublicense, and/or sell copies of the Software, and to
|
||||
permit persons to whom the Software is furnished to do so, subject to
|
||||
the following conditions:
|
||||
|
||||
The above copyright notice and this permission notice shall be
|
||||
included in all copies or substantial portions of the Software.
|
||||
|
||||
THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
|
||||
EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
|
||||
MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
|
||||
NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS
|
||||
BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN
|
||||
ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN
|
||||
CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
|
||||
SOFTWARE.
|
||||
Modified Copyright (C) 2021 Intel Corporation
|
||||
Contacts: Saurabh Kalikar <saurabh.kalikar@intel.com>;
|
||||
Vasimuddin Md <vasimuddin.md@intel.com>; Sanchit Misra <sanchit.misra@intel.com>;
|
||||
Chirag Jain <chirag@iisc.ac.in>; Heng Li <hli@jimmy.harvard.edu>
|
||||
*/
|
||||
#include <stdint.h>
|
||||
#include <string.h>
|
||||
#include <stdio.h>
|
||||
#include "minimap.h"
|
||||
#include "mmpriv.h"
|
||||
#include "kalloc.h"
|
||||
|
||||
#if defined(VECTORIZED_CHAINING) && defined(__AVX512BW__)
|
||||
#include "parallel_chaining_32_bit.h"
|
||||
#endif
|
||||
|
||||
static const char LogTable256[256] = {
|
||||
#define LT(n) n, n, n, n, n, n, n, n, n, n, n, n, n, n, n, n
|
||||
-1, 0, 1, 1, 2, 2, 2, 2, 3, 3, 3, 3, 3, 3, 3, 3,
|
||||
LT(4), LT(5), LT(5), LT(6), LT(6), LT(6), LT(6),
|
||||
LT(7), LT(7), LT(7), LT(7), LT(7), LT(7), LT(7), LT(7)
|
||||
};
|
||||
|
||||
static inline int ilog2_32(uint32_t v)
|
||||
{
|
||||
uint32_t t, tt;
|
||||
if ((tt = v>>16)) return (t = tt>>8) ? 24 + LogTable256[t] : 16 + LogTable256[tt];
|
||||
return (t = v>>8) ? 8 + LogTable256[t] : LogTable256[v];
|
||||
}
|
||||
|
||||
|
||||
mm128_t *mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int max_iter, int min_cnt, int min_sc, float gap_scale, int is_cdna, int n_segs, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km)
|
||||
{ // TODO: make sure this works when n has more than 32 bits
|
||||
int32_t k, *p, *t, *v, n_u, n_v;
|
||||
uint32_t *f;
|
||||
int64_t i, j;
|
||||
uint64_t *u, *u2;
|
||||
mm128_t *b, *w;
|
||||
|
||||
if (_u) *_u = 0, *n_u_ = 0;
|
||||
if (n == 0 || a == 0) {
|
||||
kfree(km, a);
|
||||
return 0;
|
||||
}
|
||||
f = (uint32_t*)kmalloc(km, n * 4);
|
||||
p = (int32_t*)kmalloc(km, n * 4);
|
||||
t = (int32_t*)kmalloc(km, n * 4);
|
||||
v = (int32_t*)kmalloc(km, n * 4);
|
||||
memset(t, 0, n * 4);
|
||||
#if defined(VECTORIZED_CHAINING) && defined(__AVX512BW__)
|
||||
/* Allocation for debugging
|
||||
f_avx = (uint32_t*)kmalloc(km, n * 4);
|
||||
p_avx = (int32_t*)kmalloc(km, n * 4);
|
||||
*/
|
||||
anchor_t* anchors = (anchor_t*)malloc(n* sizeof(anchor_t));
|
||||
for (i = 0; i < n; ++i) {
|
||||
uint64_t ri = a[i].x;
|
||||
int32_t qi = (int32_t)a[i].y, q_span = a[i].y>>32&0xff; // NB: only 8 bits of span is used!!!
|
||||
anchors[i].r = ri;
|
||||
anchors[i].q = qi;
|
||||
anchors[i].l = q_span;
|
||||
}
|
||||
num_bits_t *anchor_r, *anchor_q, *anchor_l;
|
||||
create_SoA_Anchors_32_bit(anchors, n, anchor_r, anchor_q, anchor_l);
|
||||
|
||||
dp_chain obj(max_dist_x, max_dist_y, bw, max_skip, max_iter, gap_scale, is_cdna, n_segs);
|
||||
obj.mm_dp_vectorized(n, &anchors[0], anchor_r, anchor_q, anchor_l, f, p, v, max_dist_x, max_dist_y, NULL, NULL);
|
||||
|
||||
// -16 is due to extra padding at the start of arrays
|
||||
anchor_r -= 16; anchor_q -= 16; anchor_l -= 16;
|
||||
free(anchor_r);
|
||||
free(anchor_q);
|
||||
free(anchor_l);
|
||||
free(anchors);
|
||||
#else
|
||||
int64_t st = 0;
|
||||
uint64_t sum_qspan = 0;
|
||||
float avg_qspan;
|
||||
for (i = 0; i < n; ++i) sum_qspan += a[i].y>>32&0xff;
|
||||
avg_qspan = (float)sum_qspan / n;
|
||||
|
||||
// fill the score and backtrack arrays
|
||||
for (i = 0; i < n; ++i) {
|
||||
uint64_t ri = a[i].x;
|
||||
int64_t max_j = -1;
|
||||
int32_t qi = (int32_t)a[i].y, q_span = a[i].y>>32&0xff; // NB: only 8 bits of span is used!!!
|
||||
int32_t max_f = q_span, n_skip = 0, min_d;
|
||||
int32_t sidi = (a[i].y & MM_SEED_SEG_MASK) >> MM_SEED_SEG_SHIFT;
|
||||
while (st < i && ri > a[st].x + max_dist_x) ++st;
|
||||
if (i - st > max_iter) st = i - max_iter;
|
||||
for (j = i - 1; j >= st; --j) {
|
||||
int64_t dr = ri - a[j].x;
|
||||
int32_t dq = qi - (int32_t)a[j].y, dd, sc, log_dd, gap_cost;
|
||||
int32_t sidj = (a[j].y & MM_SEED_SEG_MASK) >> MM_SEED_SEG_SHIFT;
|
||||
if ((sidi == sidj && dr == 0) || dq <= 0) continue; // don't skip if an anchor is used by multiple segments; see below
|
||||
if ((sidi == sidj && dq > max_dist_y) || dq > max_dist_x) continue;
|
||||
dd = dr > dq? dr - dq : dq - dr;
|
||||
if (sidi == sidj && dd > bw) continue;
|
||||
if (n_segs > 1 && !is_cdna && sidi == sidj && dr > max_dist_y) continue;
|
||||
min_d = dq < dr? dq : dr;
|
||||
sc = min_d > q_span? q_span : dq < dr? dq : dr;
|
||||
log_dd = dd? ilog2_32(dd) : 0;
|
||||
gap_cost = 0;
|
||||
if (is_cdna || sidi != sidj) {
|
||||
int c_log, c_lin;
|
||||
c_lin = (int)(dd * .01 * avg_qspan);
|
||||
c_log = log_dd;
|
||||
if (sidi != sidj && dr == 0) ++sc; // possibly due to overlapping paired ends; give a minor bonus
|
||||
else if (dr > dq || sidi != sidj) gap_cost = c_lin < c_log? c_lin : c_log;
|
||||
else gap_cost = c_lin + (c_log>>1);
|
||||
} else gap_cost = (int)(dd * .01 * avg_qspan) + (log_dd>>1);
|
||||
sc -= (int)((double)gap_cost * gap_scale + .499);
|
||||
sc += f[j];
|
||||
if (sc > max_f) {
|
||||
max_f = sc, max_j = j;
|
||||
if (n_skip > 0) --n_skip;
|
||||
} else if (t[j] == i) {
|
||||
if (++n_skip > max_skip)
|
||||
break;
|
||||
}
|
||||
if (p[j] >= 0) t[p[j]] = i;
|
||||
}
|
||||
f[i] = max_f, p[i] = max_j;
|
||||
v[i] = max_j >= 0 && v[max_j] > max_f? v[max_j] : max_f; // v[] keeps the peak score up to i; f[] is the score ending at i, not always the peak
|
||||
}
|
||||
|
||||
#if 0
|
||||
for (i = 0; i < n; ++i) {
|
||||
assert(f[i] == f_avx[i] && p[i] == p_avx[i]);
|
||||
|
||||
//if(! (f[i] == f_avx[i] && p[i] == p_avx[i]))
|
||||
{
|
||||
#if 0
|
||||
fprintf(stderr, "mm2-score:\n");
|
||||
for (int itt = 0; itt < n; ++itt) {
|
||||
fprintf(stderr, "%ld %ld \n", f[itt], p[itt]);
|
||||
}
|
||||
fprintf(stderr, "mm2-simd-score:\n");
|
||||
for (int itt = 0; itt < n; ++itt) {
|
||||
fprintf(stderr, "%ld %ld \n", f_avx[itt], p_avx[itt]);
|
||||
}
|
||||
fprintf(stderr, "anchors:\n");
|
||||
fprintf(stderr, "%lld\n", n);
|
||||
for (int itt = 0; itt < n; ++itt) {
|
||||
uint64_t ri = a[itt].x;
|
||||
int32_t qi = (int32_t)a[itt].y, q_span = a[itt].y>>32&0xff; // NB: only 8 bits of span is used!!!
|
||||
fprintf(stderr, "%llu %ld %ld\n", ri, qi, q_span);
|
||||
}
|
||||
//exit(0);
|
||||
#endif
|
||||
}
|
||||
|
||||
}
|
||||
#if 0
|
||||
fprintf(stderr, "%llu\n", n);
|
||||
for (int itt = 0; itt < n; ++itt) {
|
||||
uint64_t ri = a[itt].x;
|
||||
int32_t qi = (int32_t)a[itt].y, q_span = a[itt].y>>32&0xff; // NB: only 8 bits of span is used!!!
|
||||
fprintf(stderr, "%llu %ld %ld\n", ri, qi, q_span);
|
||||
}
|
||||
|
||||
#endif
|
||||
kfree(km, f_avx); kfree(km, p_avx);
|
||||
#endif
|
||||
#endif
|
||||
// find the ending positions of chains
|
||||
memset(t, 0, n * 4);
|
||||
for (i = 0; i < n; ++i)
|
||||
if (p[i] >= 0) t[p[i]] = 1;
|
||||
for (i = n_u = 0; i < n; ++i)
|
||||
if (t[i] == 0 && v[i] >= min_sc)
|
||||
++n_u;
|
||||
if (n_u == 0) {
|
||||
kfree(km, a); kfree(km, f); kfree(km, p); kfree(km, t); kfree(km, v);
|
||||
return 0;
|
||||
}
|
||||
u = (uint64_t*)kmalloc(km, n_u * 8);
|
||||
for (i = n_u = 0; i < n; ++i) {
|
||||
if (t[i] == 0 && v[i] >= min_sc) {
|
||||
j = i;
|
||||
while (j >= 0 && f[j] < v[j]) j = p[j]; // find the peak that maximizes f[]
|
||||
if (j < 0) j = i; // TODO: this should really be assert(j>=0)
|
||||
u[n_u++] = (uint64_t)f[j] << 32 | j;
|
||||
}
|
||||
}
|
||||
radix_sort_64(u, u + n_u);
|
||||
for (i = 0; i < n_u>>1; ++i) { // reverse, s.t. the highest scoring chain is the first
|
||||
uint64_t t = u[i];
|
||||
u[i] = u[n_u - i - 1], u[n_u - i - 1] = t;
|
||||
}
|
||||
|
||||
// backtrack
|
||||
memset(t, 0, n * 4);
|
||||
for (i = n_v = k = 0; i < n_u; ++i) { // starting from the highest score
|
||||
int32_t n_v0 = n_v, k0 = k;
|
||||
j = (int32_t)u[i];
|
||||
do {
|
||||
v[n_v++] = j;
|
||||
t[j] = 1;
|
||||
j = p[j];
|
||||
} while (j >= 0 && t[j] == 0);
|
||||
if (j < 0) {
|
||||
if (n_v - n_v0 >= min_cnt) u[k++] = u[i]>>32<<32 | (n_v - n_v0);
|
||||
} else if ((int32_t)(u[i]>>32) - f[j] >= min_sc) {
|
||||
if (n_v - n_v0 >= min_cnt) u[k++] = ((u[i]>>32) - f[j]) << 32 | (n_v - n_v0);
|
||||
}
|
||||
if (k0 == k) n_v = n_v0; // no new chain added, reset
|
||||
}
|
||||
*n_u_ = n_u = k, *_u = u; // NB: note that u[] may not be sorted by score here
|
||||
|
||||
// free temporary arrays
|
||||
kfree(km, f); kfree(km, p); kfree(km, t);
|
||||
|
||||
// write the result to b[]
|
||||
b = (mm128_t*)kmalloc(km, n_v * sizeof(mm128_t));
|
||||
for (i = 0, k = 0; i < n_u; ++i) {
|
||||
int32_t k0 = k, ni = (int32_t)u[i];
|
||||
for (j = 0; j < ni; ++j)
|
||||
b[k] = a[v[k0 + (ni - j - 1)]], ++k;
|
||||
}
|
||||
kfree(km, v);
|
||||
|
||||
// sort u[] and a[] by a[].x, such that adjacent chains may be joined (required by mm_join_long)
|
||||
w = (mm128_t*)kmalloc(km, n_u * sizeof(mm128_t));
|
||||
for (i = k = 0; i < n_u; ++i) {
|
||||
w[i].x = b[k].x, w[i].y = (uint64_t)k<<32|i;
|
||||
k += (int32_t)u[i];
|
||||
}
|
||||
radix_sort_128x(w, w + n_u);
|
||||
u2 = (uint64_t*)kmalloc(km, n_u * 8);
|
||||
for (i = k = 0; i < n_u; ++i) {
|
||||
int32_t j = (int32_t)w[i].y, n = (int32_t)u[j];
|
||||
u2[i] = u[j];
|
||||
memcpy(&a[k], &b[w[i].y>>32], n * sizeof(mm128_t));
|
||||
k += n;
|
||||
}
|
||||
if (n_u) memcpy(u, u2, n_u * 8);
|
||||
if (k) memcpy(b, a, k * sizeof(mm128_t)); // write _a_ to _b_ and deallocate _a_ because _a_ is oversized, sometimes a lot
|
||||
kfree(km, a); kfree(km, w); kfree(km, u2);
|
||||
return b;
|
||||
}
|
||||
@@ -0,0 +1,30 @@
|
||||
## Contributor Code of Conduct
|
||||
|
||||
As contributors and maintainers of this project, we pledge to respect all
|
||||
people who contribute through reporting issues, posting feature requests,
|
||||
updating documentation, submitting pull requests or patches, and other
|
||||
activities.
|
||||
|
||||
We are committed to making participation in this project a harassment-free
|
||||
experience for everyone, regardless of level of experience, gender, gender
|
||||
identity and expression, sexual orientation, disability, personal appearance,
|
||||
body size, race, age, or religion.
|
||||
|
||||
Examples of unacceptable behavior by participants include the use of sexual
|
||||
language or imagery, derogatory comments or personal attacks, trolling, public
|
||||
or private harassment, insults, or other unprofessional conduct.
|
||||
|
||||
Project maintainers have the right and responsibility to remove, edit, or
|
||||
reject comments, commits, code, wiki edits, issues, and other contributions
|
||||
that are not aligned to this Code of Conduct. Project maintainers or
|
||||
contributors who do not follow the Code of Conduct may be removed from the
|
||||
project team.
|
||||
|
||||
Instances of abusive, harassing, or otherwise unacceptable behavior may be
|
||||
reported by opening an issue or contacting the maintainer via email.
|
||||
|
||||
This Code of Conduct is adapted from the [Contributor Covenant][cc], [version
|
||||
1.0.0][v1].
|
||||
|
||||
[cc]: http://contributor-covenant.org/
|
||||
[v1]: http://contributor-covenant.org/version/1/0/0/
|
||||
+6
-6
@@ -31,8 +31,8 @@ To acquire the data used in this cookbook and to install minimap2 and paftools,
|
||||
please follow the command lines below:
|
||||
```sh
|
||||
# install minimap2 executables
|
||||
curl -L https://github.com/lh3/minimap2/releases/download/v2.18/minimap2-2.18_x64-linux.tar.bz2 | tar jxf -
|
||||
cp minimap2-2.18_x64-linux/{minimap2,k8,paftools.js} . # copy executables
|
||||
curl -L https://github.com/lh3/minimap2/releases/download/v2.30/minimap2-2.30_x64-linux.tar.bz2 | tar jxf -
|
||||
cp minimap2-2.30_x64-linux/{minimap2,k8,paftools.js} . # copy executables
|
||||
export PATH="$PATH:"`pwd` # put the current directory on PATH
|
||||
# download example datasets
|
||||
curl -L https://github.com/lh3/minimap2/releases/download/v2.10/cookbook-data.tgz | tar zxf -
|
||||
@@ -80,12 +80,12 @@ where a `U`-line gives the number of unmapped reads (for SAM input only); a
|
||||
5. Accumulative number of mappings
|
||||
|
||||
For `paftools.js mapeval` to work, you need to encode the true read positions
|
||||
in read names in the right format. For [PBSIM][pbsim] and [mason2][mason2], we
|
||||
in read names in the right format. For [pbsim2][pbsim] and [mason2][mason2], we
|
||||
provide scripts to generate the right format. Simulated reads in this cookbook
|
||||
were created with the following command lines:
|
||||
```sh
|
||||
# in PBSIM source code directory:
|
||||
src/pbsim ../ecoli_ref.fa --depth 1 --sample-fastq sample/sample.fastq
|
||||
# in the pbsim2 source code directory:
|
||||
src/pbsim --depth 1 --length-min 5000 --length-mean 20000 --accuracy-mean 0.95 --hmm_model data/R94.model ../ecoli_ref.fa
|
||||
paftools.js pbsim2fq ../ecoli_ref.fa.fai sd_0001.maf > ../ecoli_pbsim.fa
|
||||
|
||||
# mason2 simulation
|
||||
@@ -237,7 +237,7 @@ with `-x ava-pb` (99% vs 93% with `-x ava-ont`).
|
||||
|
||||
|
||||
|
||||
[pbsim]: https://github.com/pfaucon/PBSIM-PacBio-Simulator
|
||||
[pbsim]: https://github.com/yukiteruono/pbsim2
|
||||
[mason2]: https://github.com/seqan/seqan/tree/master/apps/mason2
|
||||
[paf]: https://github.com/lh3/miniasm/blob/master/PAF.md
|
||||
[v2.10]: https://github.com/lh3/minimap2/releases/tag/v2.10
|
||||
|
||||
@@ -47,7 +47,7 @@ int main(int argc, char *argv[])
|
||||
printf("%s\t%d\t%d\t%d\t%c\t", ks->name.s, ks->seq.l, r->qs, r->qe, "+-"[r->rev]);
|
||||
printf("%s\t%d\t%d\t%d\t%d\t%d\t%d\tcg:Z:", mi->seq[r->rid].name, mi->seq[r->rid].len, r->rs, r->re, r->mlen, r->blen, r->mapq);
|
||||
for (i = 0; i < r->p->n_cigar; ++i) // IMPORTANT: this gives the CIGAR in the aligned regions. NO soft/hard clippings!
|
||||
printf("%d%c", r->p->cigar[i]>>4, "MIDNSH"[r->p->cigar[i]&0xf]);
|
||||
printf("%d%c", r->p->cigar[i]>>4, MM_CIGAR_STR[r->p->cigar[i]&0xf]);
|
||||
putchar('\n');
|
||||
free(r->p);
|
||||
}
|
||||
|
||||
-1
Submodule ext/TAL deleted from 6f82aa4c6a
@@ -119,6 +119,7 @@ int mm_write_sam_hdr(const mm_idx_t *idx, const char *rg, const char *ver, int a
|
||||
{
|
||||
kstring_t str = {0,0,0};
|
||||
int ret = 0;
|
||||
mm_sprintf_lite(&str, "@HD\tVN:1.6\tSO:unsorted\tGO:query\n");
|
||||
if (idx) {
|
||||
uint32_t i;
|
||||
for (i = 0; i < idx->n_seq; ++i)
|
||||
@@ -138,14 +139,52 @@ int mm_write_sam_hdr(const mm_idx_t *idx, const char *rg, const char *ver, int a
|
||||
return ret;
|
||||
}
|
||||
|
||||
static void write_cs_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq, const mm_reg1_t *r, char *tmp, int no_iden, int write_tag)
|
||||
static void write_indel_ds(kstring_t *str, int64_t len, const uint8_t *seq, int64_t ll, int64_t lr) // write an indel to ds; adapted from minigraph
|
||||
{
|
||||
int i, q_off, t_off;
|
||||
if (write_tag) mm_sprintf_lite(s, "\tcs:Z:");
|
||||
int64_t i;
|
||||
if (ll + lr >= len) {
|
||||
mm_sprintf_lite(str, "[");
|
||||
for (i = 0; i < len; ++i)
|
||||
mm_sprintf_lite(str, "%c", "acgtn"[seq[i]]);
|
||||
mm_sprintf_lite(str, "]");
|
||||
} else {
|
||||
int64_t k = 0;
|
||||
if (ll > 0) {
|
||||
mm_sprintf_lite(str, "[");
|
||||
for (i = 0; i < ll; ++i)
|
||||
mm_sprintf_lite(str, "%c", "acgtn"[seq[k+i]]);
|
||||
mm_sprintf_lite(str, "]");
|
||||
k += ll;
|
||||
}
|
||||
for (i = 0; i < len - lr - ll; ++i)
|
||||
mm_sprintf_lite(str, "%c", "acgtn"[seq[k+i]]);
|
||||
k += len - lr - ll;
|
||||
if (lr > 0) {
|
||||
mm_sprintf_lite(str, "[");
|
||||
for (i = 0; i < lr; ++i)
|
||||
mm_sprintf_lite(str, "%c", "acgtn"[seq[k+i]]);
|
||||
mm_sprintf_lite(str, "]");
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
static void write_cs_ds_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq, const mm_reg1_t *r, char *tmp, int no_iden, int is_ds, int write_tag)
|
||||
{
|
||||
int i, q_off, t_off, q_len = 0, t_len = 0;
|
||||
if (write_tag) mm_sprintf_lite(s, "\t%cs:Z:", is_ds? 'd' : 'c');
|
||||
for (i = 0; i < (int)r->p->n_cigar; ++i) {
|
||||
int op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
|
||||
if (op == MM_CIGAR_MATCH || op == MM_CIGAR_EQ_MATCH || op == MM_CIGAR_X_MISMATCH)
|
||||
q_len += len, t_len += len;
|
||||
else if (op == MM_CIGAR_INS)
|
||||
q_len += len;
|
||||
else if (op == MM_CIGAR_DEL || op == MM_CIGAR_N_SKIP)
|
||||
t_len += len;
|
||||
}
|
||||
for (i = q_off = t_off = 0; i < (int)r->p->n_cigar; ++i) {
|
||||
int j, op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
|
||||
assert((op >= 0 && op <= 3) || op == 7 || op == 8);
|
||||
if (op == 0 || op == 7 || op == 8) { // match
|
||||
assert((op >= MM_CIGAR_MATCH && op <= MM_CIGAR_N_SKIP) || op == MM_CIGAR_EQ_MATCH || op == MM_CIGAR_X_MISMATCH);
|
||||
if (op == MM_CIGAR_MATCH || op == MM_CIGAR_EQ_MATCH || op == MM_CIGAR_X_MISMATCH) {
|
||||
int l_tmp = 0;
|
||||
for (j = 0; j < len; ++j) {
|
||||
if (qseq[q_off + j] != tseq[t_off + j]) {
|
||||
@@ -166,15 +205,43 @@ static void write_cs_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq
|
||||
} else mm_sprintf_lite(s, ":%d", l_tmp);
|
||||
}
|
||||
q_off += len, t_off += len;
|
||||
} else if (op == 1) { // insertion to ref
|
||||
for (j = 0, tmp[len] = 0; j < len; ++j)
|
||||
tmp[j] = "acgtn"[qseq[q_off + j]];
|
||||
mm_sprintf_lite(s, "+%s", tmp);
|
||||
} else if (op == MM_CIGAR_INS) {
|
||||
if (is_ds) {
|
||||
int z, ll, lr, y = q_off;
|
||||
for (z = 1; z <= len; ++z)
|
||||
if (y - z < 0 || qseq[y + len - z] != qseq[y - z])
|
||||
break;
|
||||
lr = z - 1;
|
||||
for (z = 0; z < len; ++z)
|
||||
if (y + len + z >= q_len || qseq[y + len + z] != qseq[y + z])
|
||||
break;
|
||||
ll = z;
|
||||
mm_sprintf_lite(s, "+");
|
||||
write_indel_ds(s, len, &qseq[y], ll, lr);
|
||||
} else {
|
||||
for (j = 0, tmp[len] = 0; j < len; ++j)
|
||||
tmp[j] = "acgtn"[qseq[q_off + j]];
|
||||
mm_sprintf_lite(s, "+%s", tmp);
|
||||
}
|
||||
q_off += len;
|
||||
} else if (op == 2) { // deletion from ref
|
||||
for (j = 0, tmp[len] = 0; j < len; ++j)
|
||||
tmp[j] = "acgtn"[tseq[t_off + j]];
|
||||
mm_sprintf_lite(s, "-%s", tmp);
|
||||
} else if (op == MM_CIGAR_DEL) {
|
||||
if (is_ds) {
|
||||
int z, ll, lr, x = t_off;
|
||||
for (z = 1; z <= len; ++z)
|
||||
if (x - z < 0 || tseq[x + len - z] != tseq[x - z])
|
||||
break;
|
||||
lr = z - 1;
|
||||
for (z = 0; z < len; ++z)
|
||||
if (x + len + z >= t_len || tseq[x + z] != tseq[x + len + z])
|
||||
break;
|
||||
ll = z;
|
||||
mm_sprintf_lite(s, "-");
|
||||
write_indel_ds(s, len, &tseq[x], ll, lr);
|
||||
} else {
|
||||
for (j = 0, tmp[len] = 0; j < len; ++j)
|
||||
tmp[j] = "acgtn"[tseq[t_off + j]];
|
||||
mm_sprintf_lite(s, "-%s", tmp);
|
||||
}
|
||||
t_off += len;
|
||||
} else { // intron
|
||||
assert(len >= 2);
|
||||
@@ -186,14 +253,60 @@ static void write_cs_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq
|
||||
assert(t_off == r->re - r->rs && q_off == r->qe - r->qs);
|
||||
}
|
||||
|
||||
static inline void revcomp_splice(uint8_t s[2])
|
||||
{
|
||||
uint8_t c = s[1] < 4? 3 - s[1] : 4;
|
||||
s[1] = s[0] < 4? 3 - s[0] : 4;
|
||||
s[0] = c;
|
||||
}
|
||||
|
||||
void mm_write_junc(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r)
|
||||
{
|
||||
int32_t i, t_off, swritten = 0;
|
||||
s->l = 0;
|
||||
if (!r->is_spliced || r->p == 0) return; // no junctions
|
||||
if (r->p->trans_strand != 1 && r->p->trans_strand != 2) return; // no preferred strand
|
||||
for (i = 0, t_off = r->rs; i < (int)r->p->n_cigar; ++i) {
|
||||
int op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
|
||||
if (op == MM_CIGAR_MATCH || op == MM_CIGAR_EQ_MATCH || op == MM_CIGAR_X_MISMATCH || op == MM_CIGAR_DEL) {
|
||||
t_off += len;
|
||||
} else if (op == MM_CIGAR_N_SKIP) { // intron
|
||||
uint8_t donor[2], acceptor[2];
|
||||
int32_t score1 = 0, score2 = 0, rev;
|
||||
assert(len >= 2);
|
||||
rev = (r->p->trans_strand == 2) ^ r->rev;
|
||||
if (!rev) {
|
||||
mm_idx_getseq(mi, r->rid, t_off, t_off + 2, donor);
|
||||
mm_idx_getseq(mi, r->rid, t_off + len - 2, t_off + len, acceptor);
|
||||
} else {
|
||||
mm_idx_getseq(mi, r->rid, t_off, t_off + 2, acceptor);
|
||||
mm_idx_getseq(mi, r->rid, t_off + len - 2, t_off + len, donor);
|
||||
revcomp_splice(donor);
|
||||
revcomp_splice(acceptor);
|
||||
}
|
||||
//fprintf(stderr, "%c%c-%c%c\n", "ACGTN"[donor[0]], "ACGTN"[donor[1]], "ACGTN"[acceptor[0]], "ACGTN"[acceptor[1]]);
|
||||
if (donor[0] == 2 && donor[1] == 3) score1 = 3;
|
||||
else if (donor[0] == 2 && donor[1] == 1) score1 = 2;
|
||||
else if (donor[0] == 0 && donor[1] == 3) score1 = 1;
|
||||
if (acceptor[0] == 0 && acceptor[1] == 2) score2 = 3;
|
||||
else if (acceptor[0] == 0 && acceptor[1] == 1) score2 = 1;
|
||||
if (swritten) mm_sprintf_lite(s, "\n");
|
||||
else swritten = 1;
|
||||
mm_sprintf_lite(s, "%s\t%d\t%d\t%s\t%d\t%c", mi->seq[r->rid].name, t_off, t_off + len, t->name, score1 + score2, "+-"[rev]);
|
||||
t_off += len;
|
||||
}
|
||||
}
|
||||
assert(t_off == r->re);
|
||||
}
|
||||
|
||||
static void write_MD_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq, const mm_reg1_t *r, char *tmp, int write_tag)
|
||||
{
|
||||
int i, q_off, t_off, l_MD = 0;
|
||||
if (write_tag) mm_sprintf_lite(s, "\tMD:Z:");
|
||||
for (i = q_off = t_off = 0; i < (int)r->p->n_cigar; ++i) {
|
||||
int j, op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
|
||||
assert((op >= 0 && op <= 3) || op == 7 || op == 8);
|
||||
if (op == 0 || op == 7 || op == 8) { // match
|
||||
assert((op >= MM_CIGAR_MATCH && op <= MM_CIGAR_N_SKIP) || op == MM_CIGAR_EQ_MATCH || op == MM_CIGAR_X_MISMATCH);
|
||||
if (op == MM_CIGAR_MATCH || op == MM_CIGAR_EQ_MATCH || op == MM_CIGAR_X_MISMATCH) {
|
||||
for (j = 0; j < len; ++j) {
|
||||
if (qseq[q_off + j] != tseq[t_off + j]) {
|
||||
mm_sprintf_lite(s, "%d%c", l_MD, "ACGTN"[tseq[t_off + j]]);
|
||||
@@ -201,15 +314,15 @@ static void write_MD_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq
|
||||
} else ++l_MD;
|
||||
}
|
||||
q_off += len, t_off += len;
|
||||
} else if (op == 1) { // insertion to ref
|
||||
} else if (op == MM_CIGAR_INS) {
|
||||
q_off += len;
|
||||
} else if (op == 2) { // deletion from ref
|
||||
} else if (op == MM_CIGAR_DEL) {
|
||||
for (j = 0, tmp[len] = 0; j < len; ++j)
|
||||
tmp[j] = "ACGTN"[tseq[t_off + j]];
|
||||
mm_sprintf_lite(s, "%d^%s", l_MD, tmp);
|
||||
l_MD = 0;
|
||||
t_off += len;
|
||||
} else if (op == 3) { // reference skip
|
||||
} else if (op == MM_CIGAR_N_SKIP) {
|
||||
t_off += len;
|
||||
}
|
||||
}
|
||||
@@ -217,7 +330,7 @@ static void write_MD_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq
|
||||
assert(t_off == r->re - r->rs && q_off == r->qe - r->qs);
|
||||
}
|
||||
|
||||
static void write_cs_or_MD(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int no_iden, int is_MD, int write_tag)
|
||||
static void write_cs_ds_or_MD(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int no_iden, int is_MD, int is_ds, int write_tag, int is_qstrand)
|
||||
{
|
||||
extern unsigned char seq_nt4_table[256];
|
||||
int i;
|
||||
@@ -227,29 +340,35 @@ static void write_cs_or_MD(void *km, kstring_t *s, const mm_idx_t *mi, const mm_
|
||||
qseq = (uint8_t*)kmalloc(km, r->qe - r->qs);
|
||||
tseq = (uint8_t*)kmalloc(km, r->re - r->rs);
|
||||
tmp = (char*)kmalloc(km, r->re - r->rs > r->qe - r->qs? r->re - r->rs + 1 : r->qe - r->qs + 1);
|
||||
mm_idx_getseq(mi, r->rid, r->rs, r->re, tseq);
|
||||
if (!r->rev) {
|
||||
if (is_qstrand) {
|
||||
mm_idx_getseq2(mi, r->rev, r->rid, r->rs, r->re, tseq);
|
||||
for (i = r->qs; i < r->qe; ++i)
|
||||
qseq[i - r->qs] = seq_nt4_table[(uint8_t)t->seq[i]];
|
||||
} else {
|
||||
for (i = r->qs; i < r->qe; ++i) {
|
||||
uint8_t c = seq_nt4_table[(uint8_t)t->seq[i]];
|
||||
qseq[r->qe - i - 1] = c >= 4? 4 : 3 - c;
|
||||
mm_idx_getseq(mi, r->rid, r->rs, r->re, tseq);
|
||||
if (!r->rev) {
|
||||
for (i = r->qs; i < r->qe; ++i)
|
||||
qseq[i - r->qs] = seq_nt4_table[(uint8_t)t->seq[i]];
|
||||
} else {
|
||||
for (i = r->qs; i < r->qe; ++i) {
|
||||
uint8_t c = seq_nt4_table[(uint8_t)t->seq[i]];
|
||||
qseq[r->qe - i - 1] = c >= 4? 4 : 3 - c;
|
||||
}
|
||||
}
|
||||
}
|
||||
if (is_MD) write_MD_core(s, tseq, qseq, r, tmp, write_tag);
|
||||
else write_cs_core(s, tseq, qseq, r, tmp, no_iden, write_tag);
|
||||
else write_cs_ds_core(s, tseq, qseq, r, tmp, no_iden, is_ds, write_tag);
|
||||
kfree(km, qseq); kfree(km, tseq); kfree(km, tmp);
|
||||
}
|
||||
|
||||
int mm_gen_cs_or_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int is_MD, int no_iden)
|
||||
int mm_gen_cs_or_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int is_MD, int no_iden, int is_qstrand)
|
||||
{
|
||||
mm_bseq1_t t;
|
||||
kstring_t str;
|
||||
str.s = *buf, str.l = 0, str.m = *max_len;
|
||||
t.l_seq = strlen(seq);
|
||||
t.seq = (char*)seq;
|
||||
write_cs_or_MD(km, &str, mi, &t, r, no_iden, is_MD, 0);
|
||||
write_cs_ds_or_MD(km, &str, mi, &t, r, no_iden, is_MD, 0, 0, is_qstrand);
|
||||
*max_len = str.m;
|
||||
*buf = str.s;
|
||||
return str.l;
|
||||
@@ -257,24 +376,12 @@ int mm_gen_cs_or_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, cons
|
||||
|
||||
int mm_gen_cs(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int no_iden)
|
||||
{
|
||||
return mm_gen_cs_or_MD(km, buf, max_len, mi, r, seq, 0, no_iden);
|
||||
return mm_gen_cs_or_MD(km, buf, max_len, mi, r, seq, 0, no_iden, 0);
|
||||
}
|
||||
|
||||
int mm_gen_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq)
|
||||
{
|
||||
return mm_gen_cs_or_MD(km, buf, max_len, mi, r, seq, 1, 0);
|
||||
}
|
||||
|
||||
double mm_event_identity(const mm_reg1_t *r)
|
||||
{
|
||||
int32_t i, n_gapo = 0, n_gap = 0;
|
||||
if (r->p == 0) return -1.0f;
|
||||
for (i = 0; i < r->p->n_cigar; ++i) {
|
||||
int32_t op = r->p->cigar[i] & 0xf, len = r->p->cigar[i] >> 4;
|
||||
if (op == 1 || op == 2)
|
||||
++n_gapo, n_gap += len;
|
||||
}
|
||||
return (double)r->mlen / (r->blen + r->p->n_ambi - n_gap + n_gapo);
|
||||
return mm_gen_cs_or_MD(km, buf, max_len, mi, r, seq, 1, 0, 0);
|
||||
}
|
||||
|
||||
static inline void write_tags(kstring_t *s, const mm_reg1_t *r)
|
||||
@@ -283,7 +390,7 @@ static inline void write_tags(kstring_t *s, const mm_reg1_t *r)
|
||||
if (r->id == r->parent) type = r->inv? 'I' : 'P';
|
||||
else type = r->inv? 'i' : 'S';
|
||||
if (r->p) {
|
||||
mm_sprintf_lite(s, "\tNM:i:%d\tms:i:%d\tAS:i:%d\tnn:i:%d", r->blen - r->mlen + r->p->n_ambi, r->p->dp_max, r->p->dp_score, r->p->n_ambi);
|
||||
mm_sprintf_lite(s, "\tNM:i:%d\tms:i:%d\tAS:i:%d\tnn:i:%d", r->blen - r->mlen + r->p->n_ambi, r->p->dp_max0, r->p->dp_score, r->p->n_ambi);
|
||||
if (r->p->trans_strand == 1 || r->p->trans_strand == 2)
|
||||
mm_sprintf_lite(s, "\tts:A:%c", "?+-?"[r->p->trans_strand]);
|
||||
}
|
||||
@@ -305,18 +412,25 @@ static inline void write_tags(kstring_t *s, const mm_reg1_t *r)
|
||||
if (r->split) mm_sprintf_lite(s, "\tzd:i:%d", r->split);
|
||||
}
|
||||
|
||||
void mm_write_paf3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int opt_flag, int rep_len)
|
||||
void mm_write_paf4(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag, int rep_len, int n_seg, int seg_idx)
|
||||
{
|
||||
s->l = 0;
|
||||
mm_sprintf_lite(s, "%s", t->name);
|
||||
if ((opt_flag & MM_F_FRAG_MODE) && n_seg >= 2 && seg_idx >= 0)
|
||||
mm_sprintf_lite(s, "/%d", seg_idx + 1);
|
||||
if (r == 0) {
|
||||
mm_sprintf_lite(s, "%s\t%d\t0\t0\t*\t*\t0\t0\t0\t0\t0\t0", t->name, t->l_seq);
|
||||
mm_sprintf_lite(s, "\t%d\t0\t0\t*\t*\t0\t0\t0\t0\t0\t0", t->l_seq);
|
||||
if (rep_len >= 0) mm_sprintf_lite(s, "\trl:i:%d", rep_len);
|
||||
return;
|
||||
}
|
||||
mm_sprintf_lite(s, "%s\t%d\t%d\t%d\t%c\t", t->name, t->l_seq, r->qs, r->qe, "+-"[r->rev]);
|
||||
mm_sprintf_lite(s, "\t%d\t%d\t%d\t%c\t", t->l_seq, r->qs, r->qe, "+-"[r->rev]);
|
||||
if (mi->seq[r->rid].name) mm_sprintf_lite(s, "%s", mi->seq[r->rid].name);
|
||||
else mm_sprintf_lite(s, "%d", r->rid);
|
||||
mm_sprintf_lite(s, "\t%d\t%d\t%d", mi->seq[r->rid].len, r->rs, r->re);
|
||||
mm_sprintf_lite(s, "\t%d", mi->seq[r->rid].len);
|
||||
if ((opt_flag & MM_F_QSTRAND) && r->rev)
|
||||
mm_sprintf_lite(s, "\t%d\t%d", mi->seq[r->rid].len - r->re, mi->seq[r->rid].len - r->rs);
|
||||
else
|
||||
mm_sprintf_lite(s, "\t%d\t%d", r->rs, r->re);
|
||||
mm_sprintf_lite(s, "\t%d\t%d", r->mlen, r->blen);
|
||||
mm_sprintf_lite(s, "\t%d", r->mapq);
|
||||
write_tags(s, r);
|
||||
@@ -325,15 +439,20 @@ void mm_write_paf3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const
|
||||
uint32_t k;
|
||||
mm_sprintf_lite(s, "\tcg:Z:");
|
||||
for (k = 0; k < r->p->n_cigar; ++k)
|
||||
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDNSHP=XB"[r->p->cigar[k]&0xf]);
|
||||
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, MM_CIGAR_STR[r->p->cigar[k]&0xf]);
|
||||
}
|
||||
if (r->p && (opt_flag & (MM_F_OUT_CS|MM_F_OUT_MD)))
|
||||
write_cs_or_MD(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG), opt_flag&MM_F_OUT_MD, 1);
|
||||
if (r->p && (opt_flag & (MM_F_OUT_CS|MM_F_OUT_DS|MM_F_OUT_MD)))
|
||||
write_cs_ds_or_MD(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG), !!(opt_flag&MM_F_OUT_MD), !!(opt_flag&MM_F_OUT_DS), 1, !!(opt_flag&MM_F_QSTRAND));
|
||||
if ((opt_flag & MM_F_COPY_COMMENT) && t->comment)
|
||||
mm_sprintf_lite(s, "\t%s", t->comment);
|
||||
}
|
||||
|
||||
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int opt_flag)
|
||||
void mm_write_paf3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag, int rep_len)
|
||||
{
|
||||
mm_write_paf4(s, mi, t, r, km, opt_flag, rep_len, 0, 0);
|
||||
}
|
||||
|
||||
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag)
|
||||
{
|
||||
mm_write_paf3(s, mi, t, r, km, opt_flag, -1);
|
||||
}
|
||||
@@ -362,7 +481,7 @@ static inline const mm_reg1_t *get_sam_pri(int n_regs, const mm_reg1_t *regs)
|
||||
return NULL;
|
||||
}
|
||||
|
||||
static void write_sam_cigar(kstring_t *s, int sam_flag, int in_tag, int qlen, const mm_reg1_t *r, int opt_flag)
|
||||
static void write_sam_cigar(kstring_t *s, int sam_flag, int in_tag, int qlen, const mm_reg1_t *r, int64_t opt_flag)
|
||||
{
|
||||
if (r->p == 0) {
|
||||
mm_sprintf_lite(s, "*");
|
||||
@@ -371,24 +490,26 @@ static void write_sam_cigar(kstring_t *s, int sam_flag, int in_tag, int qlen, co
|
||||
clip_len[0] = r->rev? qlen - r->qe : r->qs;
|
||||
clip_len[1] = r->rev? r->qs : qlen - r->qe;
|
||||
if (in_tag) {
|
||||
int clip_char = (sam_flag&0x800) && !(opt_flag&MM_F_SOFTCLIP)? 5 : 4;
|
||||
int clip_char = (((sam_flag&0x800) || ((sam_flag&0x100) && (opt_flag&MM_F_SECONDARY_SEQ))) &&
|
||||
!(opt_flag&MM_F_SOFTCLIP)) ? 5 : 4;
|
||||
mm_sprintf_lite(s, "\tCG:B:I");
|
||||
if (clip_len[0]) mm_sprintf_lite(s, ",%u", clip_len[0]<<4|clip_char);
|
||||
for (k = 0; k < r->p->n_cigar; ++k)
|
||||
mm_sprintf_lite(s, ",%u", r->p->cigar[k]);
|
||||
if (clip_len[1]) mm_sprintf_lite(s, ",%u", clip_len[1]<<4|clip_char);
|
||||
} else {
|
||||
int clip_char = (sam_flag&0x800) && !(opt_flag&MM_F_SOFTCLIP)? 'H' : 'S';
|
||||
int clip_char = (((sam_flag&0x800) || ((sam_flag&0x100) && (opt_flag&MM_F_SECONDARY_SEQ))) &&
|
||||
!(opt_flag&MM_F_SOFTCLIP)) ? 'H' : 'S';
|
||||
assert(clip_len[0] < qlen && clip_len[1] < qlen);
|
||||
if (clip_len[0]) mm_sprintf_lite(s, "%d%c", clip_len[0], clip_char);
|
||||
for (k = 0; k < r->p->n_cigar; ++k)
|
||||
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDNSHP=XB"[r->p->cigar[k]&0xf]);
|
||||
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, MM_CIGAR_STR[r->p->cigar[k]&0xf]);
|
||||
if (clip_len[1]) mm_sprintf_lite(s, "%d%c", clip_len[1], clip_char);
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
void mm_write_sam3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regss, const mm_reg1_t *const* regss, void *km, int opt_flag, int rep_len)
|
||||
void mm_write_sam3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regss, const mm_reg1_t *const* regss, void *km, int64_t opt_flag, int rep_len)
|
||||
{
|
||||
const int max_bam_cigar_op = 65535;
|
||||
int flag, n_regs = n_regss[seg_idx], cigar_in_tag = 0;
|
||||
@@ -453,7 +574,7 @@ void mm_write_sam3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
|
||||
if (cigar_in_tag) {
|
||||
int slen;
|
||||
if ((flag & 0x900) == 0 || (opt_flag & MM_F_SOFTCLIP)) slen = t->l_seq;
|
||||
else if (flag & 0x100) slen = 0;
|
||||
else if ((flag & 0x100) && !(opt_flag & MM_F_SECONDARY_SEQ)) slen = 0;
|
||||
else slen = r->qe - r->qs;
|
||||
mm_sprintf_lite(s, "%dS%dN", slen, r->re - r->rs);
|
||||
} else write_sam_cigar(s, flag, 0, t->l_seq, r, opt_flag);
|
||||
@@ -494,7 +615,7 @@ void mm_write_sam3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
|
||||
mm_sprintf_lite(s, "\t");
|
||||
if (t->qual) sam_write_sq(s, t->qual, t->l_seq, r->rev, 0);
|
||||
else mm_sprintf_lite(s, "*");
|
||||
} else if (flag & 0x100) {
|
||||
} else if ((flag & 0x100) && !(opt_flag & MM_F_SECONDARY_SEQ)){
|
||||
mm_sprintf_lite(s, "*\t*");
|
||||
} else {
|
||||
sam_write_sq(s, t->seq + r->qs, r->qe - r->qs, r->rev, r->rev);
|
||||
@@ -534,8 +655,8 @@ void mm_write_sam3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
|
||||
}
|
||||
}
|
||||
}
|
||||
if (r->p && (opt_flag & (MM_F_OUT_CS|MM_F_OUT_MD)))
|
||||
write_cs_or_MD(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG), opt_flag&MM_F_OUT_MD, 1);
|
||||
if (r->p && (opt_flag & (MM_F_OUT_CS|MM_F_OUT_DS|MM_F_OUT_MD)))
|
||||
write_cs_ds_or_MD(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG), opt_flag&MM_F_OUT_MD, !!(opt_flag&MM_F_OUT_DS), 1, 0);
|
||||
if (cigar_in_tag)
|
||||
write_sam_cigar(s, flag, 1, t->l_seq, r, opt_flag);
|
||||
}
|
||||
@@ -547,7 +668,7 @@ void mm_write_sam3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
|
||||
s->s[s->l] = 0; // we always have room for an extra byte (see str_enlarge)
|
||||
}
|
||||
|
||||
void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regss, const mm_reg1_t *const* regss, void *km, int opt_flag)
|
||||
void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regss, const mm_reg1_t *const* regss, void *km, int64_t opt_flag)
|
||||
{
|
||||
mm_write_sam3(s, mi, t, seg_idx, reg_idx, n_seg, n_regss, regss, km, opt_flag, -1);
|
||||
}
|
||||
|
||||
@@ -20,14 +20,14 @@ static inline void mm_cal_fuzzy_len(mm_reg1_t *r, const mm128_t *a)
|
||||
}
|
||||
}
|
||||
|
||||
static inline void mm_reg_set_coor(mm_reg1_t *r, int32_t qlen, const mm128_t *a)
|
||||
static inline void mm_reg_set_coor(mm_reg1_t *r, int32_t qlen, const mm128_t *a, int is_qstrand)
|
||||
{ // NB: r->as and r->cnt MUST BE set correctly for this function to work
|
||||
int32_t k = r->as, q_span = (int32_t)(a[k].y>>32&0xff);
|
||||
r->rev = a[k].x>>63;
|
||||
r->rid = a[k].x<<1>>33;
|
||||
r->rs = (int32_t)a[k].x + 1 > q_span? (int32_t)a[k].x + 1 - q_span : 0; // NB: target span may be shorter, so this test is necessary
|
||||
r->re = (int32_t)a[k + r->cnt - 1].x + 1;
|
||||
if (!r->rev) {
|
||||
if (!r->rev || is_qstrand) {
|
||||
r->qs = (int32_t)a[k].y + 1 - q_span;
|
||||
r->qe = (int32_t)a[k + r->cnt - 1].y + 1;
|
||||
} else {
|
||||
@@ -49,13 +49,13 @@ static inline uint64_t hash64(uint64_t key)
|
||||
return key;
|
||||
}
|
||||
|
||||
mm_reg1_t *mm_gen_regs(void *km, uint32_t hash, int qlen, int n_u, uint64_t *u, mm128_t *a) // convert chains to hits
|
||||
mm_reg1_t *mm_gen_regs(void *km, uint32_t hash, int qlen, int n_u, uint64_t *u, mm128_t *a, int is_qstrand) // convert chains to hits
|
||||
{
|
||||
mm128_t *z, tmp;
|
||||
mm_reg1_t *r;
|
||||
int i, k;
|
||||
|
||||
if (n_u == 0) return 0;
|
||||
if (n_u <= 0) return 0;
|
||||
|
||||
// sort by score
|
||||
z = (mm128_t*)kmalloc(km, n_u * 16);
|
||||
@@ -81,7 +81,7 @@ mm_reg1_t *mm_gen_regs(void *km, uint32_t hash, int qlen, int n_u, uint64_t *u,
|
||||
ri->cnt = (int32_t)z[i].y;
|
||||
ri->as = z[i].y >> 32;
|
||||
ri->div = -1.0f;
|
||||
mm_reg_set_coor(ri, qlen, a);
|
||||
mm_reg_set_coor(ri, qlen, a, is_qstrand);
|
||||
}
|
||||
kfree(km, z);
|
||||
return r;
|
||||
@@ -103,7 +103,7 @@ static inline int mm_alt_score(int score, float alt_diff_frac)
|
||||
return score > 0? score : 1;
|
||||
}
|
||||
|
||||
void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a)
|
||||
void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a, int is_qstrand)
|
||||
{
|
||||
if (n <= 0 || n >= r->cnt) return;
|
||||
*r2 = *r;
|
||||
@@ -115,10 +115,10 @@ void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a)
|
||||
r2->score = (int32_t)(r->score * ((float)r2->cnt / r->cnt) + .499);
|
||||
r2->as = r->as + n;
|
||||
if (r->parent == r->id) r2->parent = MM_PARENT_TMP_PRI;
|
||||
mm_reg_set_coor(r2, qlen, a);
|
||||
mm_reg_set_coor(r2, qlen, a, is_qstrand);
|
||||
r->cnt -= r2->cnt;
|
||||
r->score -= r2->score;
|
||||
mm_reg_set_coor(r, qlen, a);
|
||||
mm_reg_set_coor(r, qlen, a, is_qstrand);
|
||||
r->split |= 1, r2->split |= 2;
|
||||
}
|
||||
|
||||
@@ -252,7 +252,7 @@ void mm_sync_regs(void *km, int n_regs, mm_reg1_t *regs) // keep mm_reg1_t::{id,
|
||||
mm_set_sam_pri(n_regs, regs);
|
||||
}
|
||||
|
||||
void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int *n_, mm_reg1_t *r)
|
||||
void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int check_strand, int min_strand_sc, int *n_, mm_reg1_t *r)
|
||||
{
|
||||
if (pri_ratio > 0.0f && *n_ > 0) {
|
||||
int i, k, n = *n_, n_2nd = 0;
|
||||
@@ -264,6 +264,9 @@ void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int *n_,
|
||||
if (!(r[i].qs == r[p].qs && r[i].qe == r[p].qe && r[i].rid == r[p].rid && r[i].rs == r[p].rs && r[i].re == r[p].re)) // not identical hits
|
||||
r[k++] = r[i], ++n_2nd;
|
||||
else if (r[i].p) free(r[i].p);
|
||||
} else if (check_strand && n_2nd < best_n && r[i].score > min_strand_sc && r[i].rev != r[p].rev) {
|
||||
r[i].strand_retained = 1;
|
||||
r[k++] = r[i], ++n_2nd;
|
||||
} else if (r[i].p) free(r[i].p);
|
||||
}
|
||||
if (k != n) mm_sync_regs(km, k, r); // removing hits requires sync()
|
||||
@@ -271,6 +274,19 @@ void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int *n_,
|
||||
}
|
||||
}
|
||||
|
||||
int mm_filter_strand_retained(int n_regs, mm_reg1_t *r)
|
||||
{
|
||||
int i, k;
|
||||
for (i = k = 0; i < n_regs; ++i) {
|
||||
int p = r[i].parent;
|
||||
if (!r[i].strand_retained || r[i].div < r[p].div * 5.0f || r[i].div < 0.01f) {
|
||||
if (k < i) r[k++] = r[i];
|
||||
else ++k;
|
||||
}
|
||||
}
|
||||
return k;
|
||||
}
|
||||
|
||||
void mm_filter_regs(const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs)
|
||||
{ // NB: after this call, mm_reg1_t::parent can be -1 if its parent filtered out
|
||||
int i, k;
|
||||
@@ -312,64 +328,6 @@ int mm_squeeze_a(void *km, int n_regs, mm_reg1_t *regs, mm128_t *a)
|
||||
return as;
|
||||
}
|
||||
|
||||
void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs_, mm_reg1_t *regs, mm128_t *a)
|
||||
{
|
||||
int i, n_aux, n_regs = *n_regs_, n_drop = 0;
|
||||
uint64_t *aux;
|
||||
|
||||
if (n_regs < 2) return; // nothing to join
|
||||
mm_squeeze_a(km, n_regs, regs, a);
|
||||
|
||||
aux = (uint64_t*)kmalloc(km, n_regs * 8);
|
||||
for (i = n_aux = 0; i < n_regs; ++i)
|
||||
if (regs[i].parent == i || regs[i].parent < 0)
|
||||
aux[n_aux++] = (uint64_t)regs[i].as << 32 | i;
|
||||
radix_sort_64(aux, aux + n_aux);
|
||||
|
||||
for (i = n_aux - 1; i >= 1; --i) {
|
||||
mm_reg1_t *r0 = ®s[(int32_t)aux[i-1]], *r1 = ®s[(int32_t)aux[i]];
|
||||
mm128_t *a0e, *a1s;
|
||||
int max_gap, min_gap, sc_thres, min_flank_len;
|
||||
|
||||
// test
|
||||
if (r0->as + r0->cnt != r1->as) continue; // not adjacent in a[]
|
||||
if (r0->rid != r1->rid || r0->rev != r1->rev) continue; // make sure on the same target and strand
|
||||
a0e = &a[r0->as + r0->cnt - 1];
|
||||
a1s = &a[r1->as];
|
||||
if (a1s->x <= a0e->x || (int32_t)a1s->y <= (int32_t)a0e->y) continue; // keep colinearity
|
||||
max_gap = min_gap = (int32_t)a1s->y - (int32_t)a0e->y;
|
||||
max_gap = a0e->x + max_gap > a1s->x? max_gap : a1s->x - a0e->x;
|
||||
min_gap = a0e->x + min_gap < a1s->x? min_gap : a1s->x - a0e->x;
|
||||
if (max_gap > opt->max_join_long || min_gap > opt->max_join_short) continue;
|
||||
sc_thres = (int)((float)opt->min_join_flank_sc / opt->max_join_long * max_gap + .499);
|
||||
if (r0->score < sc_thres || r1->score < sc_thres) continue; // require good flanking chains
|
||||
min_flank_len = (int)(max_gap * opt->min_join_flank_ratio);
|
||||
if (r0->re - r0->rs < min_flank_len || r0->qe - r0->qs < min_flank_len) continue; // require enough flanking length
|
||||
if (r1->re - r1->rs < min_flank_len || r1->qe - r1->qs < min_flank_len) continue;
|
||||
|
||||
// all conditions satisfied; join
|
||||
a[r1->as].y |= MM_SEED_LONG_JOIN;
|
||||
r0->cnt += r1->cnt, r0->score += r1->score;
|
||||
mm_reg_set_coor(r0, qlen, a);
|
||||
r1->cnt = 0;
|
||||
r1->parent = r0->id;
|
||||
++n_drop;
|
||||
}
|
||||
kfree(km, aux);
|
||||
|
||||
if (n_drop > 0) { // then fix the hits hierarchy
|
||||
for (i = 0; i < n_regs; ++i) { // adjust the mm_reg1_t::parent
|
||||
mm_reg1_t *r = ®s[i];
|
||||
if (r->parent >= 0 && r->id != r->parent) { // fix for secondary hits only
|
||||
if (regs[r->parent].parent >= 0 && regs[r->parent].parent != r->parent)
|
||||
r->parent = regs[r->parent].parent;
|
||||
}
|
||||
}
|
||||
mm_filter_regs(opt, qlen, n_regs_, regs);
|
||||
mm_sync_regs(km, *n_regs_, regs);
|
||||
}
|
||||
}
|
||||
|
||||
mm_seg_t *mm_seg_gen(void *km, uint32_t hash, int n_segs, const int *qlens, int n_regs0, const mm_reg1_t *regs0, int *n_regs, mm_reg1_t **regs, const mm128_t *a)
|
||||
{
|
||||
int s, i, j, acc_qlen[MM_MAX_SEG+1], qlen_sum = 0;
|
||||
@@ -416,7 +374,7 @@ mm_seg_t *mm_seg_gen(void *km, uint32_t hash, int n_segs, const int *qlens, int
|
||||
}
|
||||
}
|
||||
for (s = 0; s < n_segs; ++s) {
|
||||
regs[s] = mm_gen_regs(km, hash, qlens[s], seg[s].n_u, seg[s].u, seg[s].a);
|
||||
regs[s] = mm_gen_regs(km, hash, qlens[s], seg[s].n_u, seg[s].u, seg[s].a, 0);
|
||||
n_regs[s] = seg[s].n_u;
|
||||
for (i = 0; i < n_regs[s]; ++i) {
|
||||
regs[s][i].seg_split = 1;
|
||||
@@ -460,16 +418,19 @@ static void mm_set_inv_mapq(void *km, int n_regs, mm_reg1_t *regs)
|
||||
kfree(km, aux);
|
||||
}
|
||||
|
||||
void mm_set_mapq(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr)
|
||||
void mm_set_mapq2(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr, int is_splice)
|
||||
{
|
||||
static const float q_coef = 40.0f;
|
||||
int64_t sum_sc = 0;
|
||||
float uniq_ratio;
|
||||
int i;
|
||||
int i, n_2nd_splice = 0;
|
||||
if (n_regs == 0) return;
|
||||
for (i = 0; i < n_regs; ++i)
|
||||
for (i = 0; i < n_regs; ++i) {
|
||||
if (regs[i].parent == regs[i].id)
|
||||
sum_sc += regs[i].score;
|
||||
else if (regs[i].is_spliced)
|
||||
++n_2nd_splice;
|
||||
}
|
||||
uniq_ratio = (float)sum_sc / (sum_sc + rep_len);
|
||||
for (i = 0; i < n_regs; ++i) {
|
||||
mm_reg1_t *r = ®s[i];
|
||||
@@ -482,13 +443,18 @@ void mm_set_mapq(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int ma
|
||||
pen_cm = pen_s1 < pen_cm? pen_s1 : pen_cm;
|
||||
subsc = r->subsc > min_chain_sc? r->subsc : min_chain_sc;
|
||||
if (r->p && r->p->dp_max2 > 0 && r->p->dp_max > 0) {
|
||||
float identity = (float)r->mlen / r->blen;
|
||||
float x = (float)r->p->dp_max2 * subsc / r->p->dp_max / r->score0;
|
||||
float x, identity = (float)r->mlen / r->blen;
|
||||
if (is_sr && is_splice)
|
||||
x = (float)r->p->dp_max2 / r->p->dp_max; // ignore chaining score; for short RNA-seq reads, unspliced chaining score tends to be higher
|
||||
else
|
||||
x = (float)r->p->dp_max2 * subsc / r->p->dp_max / r->score0;
|
||||
mapq = (int)(identity * pen_cm * q_coef * (1.0f - x * x) * logf((float)r->p->dp_max / match_sc));
|
||||
if (!is_sr) {
|
||||
int mapq_alt = (int)(6.02f * identity * identity * (r->p->dp_max - r->p->dp_max2) / match_sc + .499f); // BWA-MEM like mapQ, mostly for short reads
|
||||
mapq = mapq < mapq_alt? mapq : mapq_alt; // in case the long-read heuristic fails
|
||||
}
|
||||
if (is_splice && is_sr && r->is_spliced && n_2nd_splice == 0)
|
||||
mapq += 10;
|
||||
} else {
|
||||
float x = (float)subsc / r->score0;
|
||||
if (r->p) {
|
||||
|
||||
@@ -1,37 +1,4 @@
|
||||
/* The MIT License
|
||||
|
||||
Copyright (c) 2018- Dana-Farber Cancer Institute
|
||||
2017-2018 Broad Institute, Inc.
|
||||
|
||||
Permission is hereby granted, free of charge, to any person obtaining
|
||||
a copy of this software and associated documentation files (the
|
||||
"Software"), to deal in the Software without restriction, including
|
||||
without limitation the rights to use, copy, modify, merge, publish,
|
||||
distribute, sublicense, and/or sell copies of the Software, and to
|
||||
permit persons to whom the Software is furnished to do so, subject to
|
||||
the following conditions:
|
||||
|
||||
The above copyright notice and this permission notice shall be
|
||||
included in all copies or substantial portions of the Software.
|
||||
|
||||
THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
|
||||
EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
|
||||
MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
|
||||
NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS
|
||||
BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN
|
||||
ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN
|
||||
CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
|
||||
SOFTWARE.
|
||||
Modified Copyright (C) 2021 Intel Corporation
|
||||
Contacts: Saurabh Kalikar <saurabh.kalikar@intel.com>;
|
||||
Vasimuddin Md <vasimuddin.md@intel.com>; Sanchit Misra <sanchit.misra@intel.com>;
|
||||
Chirag Jain <chirag@iisc.ac.in>; Heng Li <hli@jimmy.harvard.edu>
|
||||
*/
|
||||
#include <stdlib.h>
|
||||
#include<map>
|
||||
#include <vector>
|
||||
#include <fstream>
|
||||
using namespace std;
|
||||
#include <assert.h>
|
||||
#if defined(WIN32) || defined(_WIN32)
|
||||
#include <io.h> // for open(2)
|
||||
@@ -45,6 +12,7 @@ using namespace std;
|
||||
#include "bseq.h"
|
||||
#include "minimap.h"
|
||||
#include "mmpriv.h"
|
||||
#include "ksw2.h"
|
||||
#include "kvec.h"
|
||||
#include "khash.h"
|
||||
|
||||
@@ -65,7 +33,7 @@ typedef struct mm_idx_bucket_s {
|
||||
} mm_idx_bucket_t;
|
||||
|
||||
typedef struct {
|
||||
int32_t st, en, max; // max is not used for now
|
||||
int32_t st, en, cnt;
|
||||
int32_t score:30, strand:2;
|
||||
} mm_idx_intv1_t;
|
||||
|
||||
@@ -74,6 +42,11 @@ typedef struct mm_idx_intv_s {
|
||||
mm_idx_intv1_t *a;
|
||||
} mm_idx_intv_t;
|
||||
|
||||
typedef struct mm_idx_jjump_s {
|
||||
int32_t n, m;
|
||||
mm_idx_jjump1_t *a;
|
||||
} mm_idx_jjump_t;
|
||||
|
||||
mm_idx_t *mm_idx_init(int w, int k, int b, int flag)
|
||||
{
|
||||
mm_idx_t *mi;
|
||||
@@ -86,37 +59,6 @@ mm_idx_t *mm_idx_init(int w, int k, int b, int flag)
|
||||
return mi;
|
||||
}
|
||||
|
||||
|
||||
void mm_idx_destroy_mm_hash(mm_idx_t *mi)
|
||||
{
|
||||
uint32_t i;
|
||||
if (mi == 0) return;
|
||||
if (mi->h) kh_destroy(str, (khash_t(str)*)mi->h);
|
||||
if (mi->B) {
|
||||
for (i = 0; i < 1U<<mi->b; ++i) {
|
||||
free(mi->B[i].p);
|
||||
free(mi->B[i].a.a);
|
||||
kh_destroy(idx, (idxhash_t*)mi->B[i].h);
|
||||
}
|
||||
}
|
||||
}
|
||||
void mm_idx_destroy_seq(mm_idx_t *mi)
|
||||
{
|
||||
uint32_t i;
|
||||
if (mi->I) {
|
||||
for (i = 0; i < mi->n_seq; ++i)
|
||||
free(mi->I[i].a);
|
||||
free(mi->I);
|
||||
}
|
||||
if (!mi->km) {
|
||||
for (i = 0; i < mi->n_seq; ++i)
|
||||
free(mi->seq[i].name);
|
||||
free(mi->seq);
|
||||
} else km_destroy(mi->km);
|
||||
free(mi->B); free(mi->S); free(mi);
|
||||
}
|
||||
|
||||
|
||||
void mm_idx_destroy(mm_idx_t *mi)
|
||||
{
|
||||
uint32_t i;
|
||||
@@ -129,11 +71,17 @@ void mm_idx_destroy(mm_idx_t *mi)
|
||||
kh_destroy(idx, (idxhash_t*)mi->B[i].h);
|
||||
}
|
||||
}
|
||||
if (mi->spsc) free(mi->spsc);
|
||||
if (mi->I) {
|
||||
for (i = 0; i < mi->n_seq; ++i)
|
||||
free(mi->I[i].a);
|
||||
free(mi->I);
|
||||
}
|
||||
if (mi->J) {
|
||||
for (i = 0; i < mi->n_seq; ++i)
|
||||
free(mi->J[i].a);
|
||||
free(mi->J);
|
||||
}
|
||||
if (!mi->km) {
|
||||
for (i = 0; i < mi->n_seq; ++i)
|
||||
free(mi->seq[i].name);
|
||||
@@ -161,84 +109,9 @@ const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n)
|
||||
}
|
||||
}
|
||||
|
||||
//Output minimap2's hash table entries
|
||||
void mm_idx_dump_hash(const char* f_name, const mm_idx_t *mi)
|
||||
{
|
||||
std::map<uint64_t, vector<uint64_t>> m;
|
||||
|
||||
ofstream f(f_name);
|
||||
fprintf(stderr, "Building sorted key-val map\n");
|
||||
|
||||
uint32_t i,j;
|
||||
uint64_t num_values = 0;
|
||||
for (i = 0; i < 1U<<mi->b; ++i) {
|
||||
|
||||
|
||||
//fprintf(stderr, "BucketID %lu \n", i);
|
||||
idxhash_t *h = (idxhash_t*)mi->B[i].h;
|
||||
khint_t k;
|
||||
if (h == 0) continue;
|
||||
for (k = 0; k < kh_end(h); ++k){
|
||||
if (kh_exist(h, k)) {
|
||||
uint64_t key = kh_key(h, k), bucket_id = i;
|
||||
key = key>>1;
|
||||
|
||||
key = key<<mi->b | bucket_id;
|
||||
|
||||
if(kh_key(h, k)&1)
|
||||
{
|
||||
//print key value
|
||||
//fprintf(stderr, "%llu %llu %llu\n", key, kh_val(h, k), 0);
|
||||
m[key].push_back(kh_val(h, k));
|
||||
}
|
||||
else
|
||||
{ // print key
|
||||
uint32_t n = (uint32_t)kh_val(h, k);
|
||||
//fprintf(stderr, "%llu %llu %llu ", key, kh_val(h, k), n);
|
||||
// for 0 to lsb 32 val
|
||||
// print b->p[msb 32 of val]
|
||||
for(j = 0; j < n; j++)
|
||||
{
|
||||
//fprintf(stderr, "%llu ", mi->B[i].p[(kh_val(h, k)>>32) + j]);
|
||||
m[key].push_back(mi->B[i].p[(kh_val(h, k)>>32) + j]);
|
||||
}
|
||||
}
|
||||
}
|
||||
}
|
||||
}
|
||||
fprintf(stderr, "Storing hash to %s \n", f_name);
|
||||
vector<uint64_t> key_list;
|
||||
key_list.push_back(m.size());
|
||||
for(auto k : m){
|
||||
key_list.push_back(k.first);
|
||||
f<<k.first << " "<<k.second.size()<<endl;
|
||||
for(int j = 0; j < k.second.size(); j++){
|
||||
f<<k.second[j]<<" ";
|
||||
num_values++;
|
||||
}
|
||||
f<<endl;
|
||||
}
|
||||
f.close();
|
||||
string size_file_name = (string) f_name + "_size";
|
||||
ofstream size_f(size_file_name);
|
||||
size_f<<m.size()<<" "<<num_values;
|
||||
size_f.close();
|
||||
|
||||
string prefix = (string)f_name + "_keys";
|
||||
string keys_bin_file_name = prefix + ".uint64";
|
||||
ofstream wf(keys_bin_file_name, ios::out | ios::binary);
|
||||
wf.write((char*)&key_list[0], (key_list.size())*sizeof(uint64_t));
|
||||
wf.close();
|
||||
|
||||
key_list.clear();
|
||||
m.clear();
|
||||
|
||||
}
|
||||
|
||||
|
||||
void mm_idx_stat(const mm_idx_t *mi)
|
||||
{
|
||||
int n = 0, n1 = 0;
|
||||
int64_t n = 0, n1 = 0;
|
||||
uint32_t i;
|
||||
uint64_t sum = 0, len = 0;
|
||||
fprintf(stderr, "[M::%s] kmer size: %d; skip: %d; is_hpc: %d; #seq: %d\n", __func__, mi->k, mi->w, mi->flag&MM_I_HPC, mi->n_seq);
|
||||
@@ -256,8 +129,8 @@ void mm_idx_stat(const mm_idx_t *mi)
|
||||
if (kh_key(h, k)&1) ++n1;
|
||||
}
|
||||
}
|
||||
fprintf(stderr, "[M::%s::%.3f*%.2f] distinct minimizers: %d (%.2f%% are singletons); average occurrences: %.3lf; average spacing: %.3lf; total length: %ld\n",
|
||||
__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), n, 100.0*n1/n, (double)sum / n, (double)len / sum, (long)len);
|
||||
fprintf(stderr, "[M::%s::%.3f*%.2f] distinct minimizers: %ld (%.2f%% are singletons); average occurrences: %.3lf; average spacing: %.3lf; total length: %ld\n",
|
||||
__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), (long)n, 100.0*n1/n, (double)sum / n, (double)len / sum, (long)len);
|
||||
}
|
||||
|
||||
int mm_idx_index_name(mm_idx_t *mi)
|
||||
@@ -300,6 +173,28 @@ int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, ui
|
||||
return en - st;
|
||||
}
|
||||
|
||||
int mm_idx_getseq_rev(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq)
|
||||
{
|
||||
uint64_t i, st1, en1;
|
||||
const mm_idx_seq_t *s;
|
||||
if (rid >= mi->n_seq || st >= mi->seq[rid].len) return -1;
|
||||
s = &mi->seq[rid];
|
||||
if (en > s->len) en = s->len;
|
||||
st1 = s->offset + (s->len - en);
|
||||
en1 = s->offset + (s->len - st);
|
||||
for (i = st1; i < en1; ++i) {
|
||||
uint8_t c = mm_seq4_get(mi->S, i);
|
||||
seq[en1 - i - 1] = c < 4? 3 - c : c;
|
||||
}
|
||||
return en - st;
|
||||
}
|
||||
|
||||
int mm_idx_getseq2(const mm_idx_t *mi, int is_rev, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq)
|
||||
{
|
||||
if (is_rev) return mm_idx_getseq_rev(mi, rid, st, en, seq);
|
||||
else return mm_idx_getseq(mi, rid, st, en, seq);
|
||||
}
|
||||
|
||||
int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f)
|
||||
{
|
||||
int i;
|
||||
@@ -309,6 +204,7 @@ int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f)
|
||||
if (f <= 0.) return INT32_MAX;
|
||||
for (i = 0; i < 1<<mi->b; ++i)
|
||||
if (mi->B[i].h) n += kh_size((idxhash_t*)mi->B[i].h);
|
||||
if (n == 0) return INT32_MAX;
|
||||
a = (uint32_t*)malloc(n * 4);
|
||||
for (i = n = 0; i < 1<<mi->b; ++i) {
|
||||
idxhash_t *h = (idxhash_t*)mi->B[i].h;
|
||||
@@ -773,10 +669,17 @@ int mm_idx_alt_read(mm_idx_t *mi, const char *fn)
|
||||
return n_alt;
|
||||
}
|
||||
|
||||
/***************
|
||||
* BED reading *
|
||||
***************/
|
||||
|
||||
#define sort_key_bed(a) ((a).st)
|
||||
KRADIX_SORT_INIT(bed, mm_idx_intv1_t, sort_key_bed, 4)
|
||||
|
||||
mm_idx_intv_t *mm_idx_read_bed(const mm_idx_t *mi, const char *fn, int read_junc)
|
||||
#define sort_key_end(a) ((a).en)
|
||||
KRADIX_SORT_INIT(end, mm_idx_intv1_t, sort_key_end, 4)
|
||||
|
||||
static mm_idx_intv_t *mm_idx_bed_read_core(const mm_idx_t *mi, const char *fn, int read_junc, int min_sc)
|
||||
{
|
||||
gzFile fp;
|
||||
kstream_t *ks;
|
||||
@@ -785,7 +688,7 @@ mm_idx_intv_t *mm_idx_read_bed(const mm_idx_t *mi, const char *fn, int read_junc
|
||||
|
||||
fp = fn && strcmp(fn, "-")? gzopen(fn, "r") : gzdopen(fileno(stdin), "r");
|
||||
if (fp == 0) return 0;
|
||||
I = (mm_idx_intv_t*)calloc(mi->n_seq, sizeof(*I));
|
||||
I = CALLOC(mm_idx_intv_t, mi->n_seq);
|
||||
ks = ks_init(fp);
|
||||
while (ks_getuntil(ks, KS_SEP_LINE, &str, 0) >= 0) {
|
||||
mm_idx_intv_t *r;
|
||||
@@ -806,7 +709,7 @@ mm_idx_intv_t *mm_idx_read_bed(const mm_idx_t *mi, const char *fn, int read_junc
|
||||
t.en = atol(q);
|
||||
if (t.en < 0) break;
|
||||
} else if (i == 4) { // BED score
|
||||
t.score = atol(q);
|
||||
t.score = *q >= '0' && *q <= '9'? atol(q) : -1;
|
||||
} else if (i == 5) { // strand
|
||||
t.strand = *q == '+'? 1 : *q == '-'? -1 : 0;
|
||||
} else if (i == 9) {
|
||||
@@ -822,7 +725,8 @@ mm_idx_intv_t *mm_idx_read_bed(const mm_idx_t *mi, const char *fn, int read_junc
|
||||
++i, q = p + 1;
|
||||
}
|
||||
}
|
||||
if (id < 0 || t.st < 0 || t.st >= t.en) continue;
|
||||
if (id < 0 || t.st < 0 || t.st >= t.en) continue; // contig ID not found, or other problems
|
||||
if (min_sc > 0 && t.score < min_sc) continue;
|
||||
r = &I[id];
|
||||
if (i >= 11 && read_junc) { // BED12
|
||||
int32_t st, sz, en;
|
||||
@@ -855,14 +759,44 @@ mm_idx_intv_t *mm_idx_read_bed(const mm_idx_t *mi, const char *fn, int read_junc
|
||||
return I;
|
||||
}
|
||||
|
||||
static mm_idx_intv_t *mm_idx_bed_read_merge(const mm_idx_t *mi, const char *fn, int read_junc, int min_sc)
|
||||
{
|
||||
long n = 0, n0 = 0;
|
||||
int32_t i;
|
||||
mm_idx_intv_t *I;
|
||||
I = mm_idx_bed_read_core(mi, fn, read_junc, min_sc);
|
||||
if (I == 0) return 0;
|
||||
for (i = 0; i < mi->n_seq; ++i) {
|
||||
int32_t j, j0, k;
|
||||
mm_idx_intv_t *intv = &I[i];
|
||||
n0 += intv->n;
|
||||
radix_sort_bed(intv->a, intv->a + intv->n); // sort by st
|
||||
for (j = 1, j0 = 0; j <= intv->n; ++j) { // sort by st and then by end
|
||||
if (j == intv->n || intv->a[j].st != intv->a[j0].st) {
|
||||
radix_sort_end(intv->a + j0, intv->a + j);
|
||||
j0 = j;
|
||||
}
|
||||
}
|
||||
for (j = 1, j0 = 0, k = 0; j <= intv->n; ++j) { // merge intervals with the same (st, en)
|
||||
if (j == intv->n || intv->a[j].st != intv->a[j0].st || intv->a[j].en != intv->a[j0].en) {
|
||||
intv->a[k] = intv->a[j0];
|
||||
intv->a[k++].cnt = j - j0;
|
||||
j0 = j;
|
||||
}
|
||||
}
|
||||
intv->a = REALLOC(mm_idx_intv1_t, intv->a, k);
|
||||
intv->n = intv->m = k;
|
||||
n += k;
|
||||
}
|
||||
if (mm_verbose >= 3)
|
||||
fprintf(stderr, "[%s] read %ld introns, %ld of which are non-redundant\n", __func__, n0, n);
|
||||
return I;
|
||||
}
|
||||
|
||||
int mm_idx_bed_read(mm_idx_t *mi, const char *fn, int read_junc)
|
||||
{
|
||||
int32_t i;
|
||||
if (mi->h == 0) mm_idx_index_name(mi);
|
||||
mi->I = mm_idx_read_bed(mi, fn, read_junc);
|
||||
if (mi->I == 0) return -1;
|
||||
for (i = 0; i < mi->n_seq; ++i) // TODO: eliminate redundant intervals
|
||||
radix_sort_bed(mi->I[i].a, mi->I[i].a + mi->I[i].n);
|
||||
mi->I = mm_idx_bed_read_merge(mi, fn, read_junc, -1);
|
||||
return 0;
|
||||
}
|
||||
|
||||
@@ -890,3 +824,251 @@ int mm_idx_bed_junc(const mm_idx_t *mi, int32_t ctg, int32_t st, int32_t en, uin
|
||||
}
|
||||
return left;
|
||||
}
|
||||
|
||||
/*********************************
|
||||
* Reading junctions for jumping *
|
||||
*********************************/
|
||||
|
||||
#define sort_key_jj(a) ((a).off)
|
||||
KRADIX_SORT_INIT(jj, mm_idx_jjump1_t, sort_key_jj, 4)
|
||||
|
||||
#define sort_key_jj2(a) ((a).off2)
|
||||
KRADIX_SORT_INIT(jj2, mm_idx_jjump1_t, sort_key_jj2, 4)
|
||||
|
||||
static void sort_jjump(mm_idx_jjump_t *jj2)
|
||||
{
|
||||
int32_t j0, j, k;
|
||||
if (jj2 == 0 || jj2->n == 0) return;
|
||||
radix_sort_jj(jj2->a, jj2->a + jj2->n);
|
||||
for (j0 = 0, j = 1; j <= jj2->n; ++j) {
|
||||
if (j == jj2->n || jj2->a[j0].off != jj2->a[j].off) {
|
||||
radix_sort_jj2(jj2->a + j0, jj2->a + j);
|
||||
j0 = j;
|
||||
}
|
||||
}
|
||||
// the actual merge
|
||||
for (j0 = 0, j = 1, k = 0; j <= jj2->n; ++j) {
|
||||
if (j == jj2->n || jj2->a[j0].off != jj2->a[j].off || jj2->a[j0].off2 != jj2->a[j].off2) {
|
||||
int32_t t, cnt = 0;
|
||||
uint16_t flag = 0;
|
||||
for (t = j0; t < j; ++t) cnt += jj2->a[t].cnt, flag |= jj2->a[t].flag;
|
||||
jj2->a[k] = jj2->a[j0];
|
||||
jj2->a[k].cnt = cnt;
|
||||
jj2->a[k++].flag = flag;
|
||||
j0 = j;
|
||||
}
|
||||
}
|
||||
jj2->n = k;
|
||||
jj2->a = REALLOC(mm_idx_jjump1_t, jj2->a, k);
|
||||
}
|
||||
|
||||
static mm_idx_jjump_t *mm_idx_bed2jjump(const mm_idx_t *mi, const mm_idx_intv_t *I, uint16_t flag)
|
||||
{
|
||||
int32_t i;
|
||||
mm_idx_jjump_t *J;
|
||||
J = CALLOC(mm_idx_jjump_t, mi->n_seq);
|
||||
for (i = 0; i < mi->n_seq; ++i) {
|
||||
int32_t j, k;
|
||||
const mm_idx_intv_t *intv = &I[i];
|
||||
mm_idx_jjump_t *jj = &J[i];
|
||||
jj->n = intv->n * 2;
|
||||
jj->a = CALLOC(mm_idx_jjump1_t, jj->n);
|
||||
for (j = k = 0; j < intv->n; ++j) {
|
||||
jj->a[k].off = intv->a[j].st, jj->a[k].off2 = intv->a[j].en, jj->a[k].cnt = intv->a[j].cnt, jj->a[k].strand = intv->a[j].strand, jj->a[k++].flag = flag;
|
||||
jj->a[k].off = intv->a[j].en, jj->a[k].off2 = intv->a[j].st, jj->a[k].cnt = intv->a[j].cnt, jj->a[k].strand = intv->a[j].strand, jj->a[k++].flag = flag;
|
||||
}
|
||||
sort_jjump(jj);
|
||||
}
|
||||
return J;
|
||||
}
|
||||
|
||||
static mm_idx_jjump_t *mm_idx_jjump_merge(const mm_idx_t *mi, const mm_idx_jjump_t *J0, const mm_idx_jjump_t *J1)
|
||||
{
|
||||
int32_t i;
|
||||
mm_idx_jjump_t *J2;
|
||||
J2 = CALLOC(mm_idx_jjump_t, mi->n_seq);
|
||||
for (i = 0; i < mi->n_seq; ++i) {
|
||||
int32_t j, k;
|
||||
const mm_idx_jjump_t *jj0 = &J0[i], *jj1 = &J1[i];
|
||||
mm_idx_jjump_t *jj2 = &J2[i];
|
||||
jj2->n = jj0->n + jj1->n;
|
||||
jj2->a = CALLOC(mm_idx_jjump1_t, jj2->n);
|
||||
for (j = k = 0; j < jj0->n; ++j) jj2->a[k++] = jj0->a[j];
|
||||
for (j = 0; j < jj1->n; ++j) jj2->a[k++] = jj1->a[j];
|
||||
sort_jjump(jj2);
|
||||
}
|
||||
return J2;
|
||||
}
|
||||
|
||||
int mm_idx_jjump_read(mm_idx_t *mi, const char *fn, int flag, int min_sc)
|
||||
{
|
||||
int32_t i, j, n_anno = 0, n_misc = 0;
|
||||
mm_idx_intv_t *I;
|
||||
mm_idx_jjump_t *J;
|
||||
if (mi->h == 0) mm_idx_index_name(mi);
|
||||
I = mm_idx_bed_read_merge(mi, fn, 1, min_sc);
|
||||
J = mm_idx_bed2jjump(mi, I, flag);
|
||||
for (i = 0; i < mi->n_seq; ++i) free(I[i].a);
|
||||
free(I);
|
||||
if (mi->J) {
|
||||
mm_idx_jjump_t *J2;
|
||||
J2 = mm_idx_jjump_merge(mi, mi->J, J);
|
||||
for (i = 0; i < mi->n_seq; ++i) {
|
||||
free(mi->J[i].a); free(J[i].a);
|
||||
}
|
||||
free(mi->J); free(J);
|
||||
mi->J = J2;
|
||||
} else mi->J = J;
|
||||
for (i = 0; i < mi->n_seq; ++i) {
|
||||
for (j = 0; j < mi->J[i].n; ++j)
|
||||
if (mi->J[i].a[j].flag & MM_JUNC_ANNO) ++n_anno;
|
||||
else ++n_misc;
|
||||
}
|
||||
if (mm_verbose >= 3)
|
||||
fprintf(stderr, "[%s] there are %d annotated and %d other splice positions in the index\n", __func__, n_anno, n_misc);
|
||||
return 0;
|
||||
}
|
||||
|
||||
static int32_t mm_idx_jump_get_core(int32_t n, const mm_idx_jjump1_t *a, int32_t x) // similar to mm_idx_find_intv()
|
||||
{
|
||||
int32_t s = 0, e = n;
|
||||
if (n == 0) return -1;
|
||||
if (x < a[0].off) return -1;
|
||||
while (s < e) {
|
||||
int32_t mid = s + (e - s) / 2;
|
||||
if (x >= a[mid].off && (mid + 1 >= n || x < a[mid+1].off)) return mid;
|
||||
else if (x < a[mid].off) e = mid;
|
||||
else s = mid + 1;
|
||||
}
|
||||
assert(0);
|
||||
}
|
||||
|
||||
const mm_idx_jjump1_t *mm_idx_jump_get(const mm_idx_t *db, int32_t cid, int32_t st, int32_t en, int32_t *n)
|
||||
{
|
||||
mm_idx_jjump_t *s;
|
||||
int32_t l, r;
|
||||
*n = 0;
|
||||
if (cid >= db->n_seq || cid < 0 || db->J == 0) return 0;
|
||||
if (en < 0 || en > db->seq[cid].len) en = db->seq[cid].len;
|
||||
s = &db->J[cid];
|
||||
if (s->n == 0) return 0;
|
||||
l = mm_idx_jump_get_core(s->n, s->a, st);
|
||||
r = mm_idx_jump_get_core(s->n, s->a, en);
|
||||
*n = r - l;
|
||||
return &s->a[l + 1];
|
||||
}
|
||||
|
||||
/****************
|
||||
* splice score *
|
||||
****************/
|
||||
|
||||
typedef struct mm_idx_spsc_s {
|
||||
uint32_t n, m;
|
||||
uint64_t *a; // pos<<56 | score<<1 | acceptor
|
||||
} mm_idx_spsc_t;
|
||||
|
||||
int32_t mm_idx_spsc_read2(mm_idx_t *idx, const char *fn, int32_t max_sc, float scale)
|
||||
{
|
||||
gzFile fp;
|
||||
kstring_t str = {0,0,0};
|
||||
kstream_t *ks;
|
||||
int32_t dret, j;
|
||||
int64_t n_read = 0;
|
||||
|
||||
fp = fn && strcmp(fn, "-") != 0? gzopen(fn, "rb") : gzdopen(0, "rb");
|
||||
if (fp == 0) return -1;
|
||||
if (idx->h == 0) mm_idx_index_name(idx);
|
||||
if (max_sc > 63) max_sc = 63;
|
||||
idx->spsc = Kcalloc(0, mm_idx_spsc_t, idx->n_seq * 2);
|
||||
ks = ks_init(fp);
|
||||
while (ks_getuntil(ks, KS_SEP_LINE, &str, &dret) >= 0) {
|
||||
mm_idx_spsc_t *s;
|
||||
char *p, *q, *name = 0;
|
||||
int32_t i, type = -1, strand = 0, cid = -1, score = -1;
|
||||
int64_t pos = -1;
|
||||
for (i = 0, p = q = str.s;; ++p) {
|
||||
if (*p == '\t' || *p == 0) {
|
||||
int c = *p;
|
||||
*p = 0;
|
||||
if (i == 0) {
|
||||
name = q;
|
||||
} else if (i == 1) {
|
||||
pos = atol(q);
|
||||
} else if (i == 2) {
|
||||
strand = *q == '+'? 1 : '-'? -1 : 0;
|
||||
} else if (i == 3) {
|
||||
type = *q == 'D'? 0 : *q == 'A'? 1 : -1;
|
||||
} else if (i == 4) {
|
||||
score = atoi(q);
|
||||
break;
|
||||
}
|
||||
if (c == 0) break;
|
||||
q = p + 1, ++i;
|
||||
}
|
||||
}
|
||||
if (i < 4) continue; // not enough fields
|
||||
if (scale > 0.0f && scale < 1.0f)
|
||||
score = score > 0.0f? (int)(score * scale + .499) : (int)(score * scale - .499);
|
||||
if (score > max_sc) score = max_sc;
|
||||
if (score < -max_sc) score = -max_sc;
|
||||
cid = mm_idx_name2id(idx, name);
|
||||
if (cid < 0 || type < 0 || strand == 0 || pos < 0) continue; // FIXME: give a warning!
|
||||
s = &idx->spsc[cid << 1 | (strand > 0? 0 : 1)];
|
||||
Kgrow(0, uint64_t, s->a, s->n, s->m);
|
||||
if (pos > 0 && pos < idx->seq[cid].len) { // ignore scores at the ends
|
||||
s->a[s->n++] = (uint64_t)pos << 8 | (score + KSW_SPSC_OFFSET) << 1 | type;
|
||||
++n_read;
|
||||
}
|
||||
}
|
||||
ks_destroy(ks);
|
||||
gzclose(fp);
|
||||
for (j = 0; j < idx->n_seq * 2; ++j) {
|
||||
mm_idx_spsc_t *s = &idx->spsc[j];
|
||||
if (s->n > 0)
|
||||
radix_sort_64(s->a, s->a + s->n);
|
||||
}
|
||||
if (mm_verbose >= 3)
|
||||
fprintf(stderr, "[M::%s] read %ld splice scores\n", __func__, (long)n_read);
|
||||
return 0;
|
||||
}
|
||||
|
||||
int32_t mm_idx_spsc_read(mm_idx_t *idx, const char *fn, int32_t max_sc)
|
||||
{
|
||||
return mm_idx_spsc_read2(idx, fn, max_sc, 1.0f);
|
||||
}
|
||||
|
||||
static int32_t mm_idx_find_intv(int32_t n, const uint64_t *a, int64_t x)
|
||||
{
|
||||
int32_t s = 0, e = n;
|
||||
if (n == 0) return -1;
|
||||
if (x < a[0]>>8) return -1;
|
||||
while (s < e) {
|
||||
int32_t mid = s + (e - s) / 2;
|
||||
if (x >= a[mid]>>8 && (mid + 1 >= n || x < a[mid+1]>>8)) return mid;
|
||||
else if (x < a[mid]>>8) e = mid;
|
||||
else s = mid + 1;
|
||||
}
|
||||
assert(0);
|
||||
}
|
||||
|
||||
int64_t mm_idx_spsc_get(const mm_idx_t *db, int32_t cid, int64_t st, int64_t en, int32_t rev, uint8_t *sc)
|
||||
{
|
||||
const mm_idx_spsc_t *s;
|
||||
if (cid >= db->n_seq || cid < 0 || db->spsc == 0) return -1;
|
||||
if (en < 0 || en > db->seq[cid].len) en = db->seq[cid].len;
|
||||
memset(sc, 0xff, en - st);
|
||||
s = &db->spsc[cid << 1 | (!!rev)];
|
||||
if (s->n > 0) {
|
||||
int32_t j, l, r;
|
||||
l = mm_idx_find_intv(s->n, s->a, st);
|
||||
r = mm_idx_find_intv(s->n, s->a, en);
|
||||
for (j = l + 1; j <= r; ++j) {
|
||||
int64_t x = (s->a[j]>>8) - st;
|
||||
uint8_t score = s->a[j] & 0xff;
|
||||
assert(x <= en - st);
|
||||
if (x == en - st) continue;
|
||||
if (sc[x] == 0xff || sc[x] < score) sc[x] = score;
|
||||
}
|
||||
}
|
||||
return en - st;
|
||||
}
|
||||
|
||||
@@ -0,0 +1,201 @@
|
||||
#include <stdio.h>
|
||||
#include "mmpriv.h"
|
||||
#include "kalloc.h"
|
||||
|
||||
#define MM_MIN_EXON_LEN 20
|
||||
|
||||
static int32_t mm_jump_check(void *km, const mm_idx_t *mi, int32_t qlen, const uint8_t *qseq0, const mm_reg1_t *r, int32_t ext, int32_t is_left) // TODO: check close N
|
||||
{
|
||||
int32_t clip, clen, e = !r->rev ^ !is_left; // 0 for left of the alignment; 1 for right
|
||||
uint32_t cigar;
|
||||
if (!r->p || r->p->n_cigar <= 0) return -1; // only working with CIGAR
|
||||
clip = e == 0? r->qs : qlen - r->qe;
|
||||
cigar = r->p->cigar[is_left? 0 : r->p->n_cigar - 1];
|
||||
clen = (cigar&0xf) == MM_CIGAR_MATCH? cigar>>4 : 0;
|
||||
if (clen <= ext) return -1;
|
||||
if (is_left) {
|
||||
if (clip >= r->rs) return -1; // no space to jump
|
||||
} else {
|
||||
if (clip >= mi->seq[r->rid].len - r->re) return -1; // no space to jump
|
||||
}
|
||||
return 0;
|
||||
}
|
||||
|
||||
static uint8_t *mm_jump_get_qseq_seq(void *km, int32_t qlen, const uint8_t *qseq0, const mm_reg1_t *r, int32_t is_left, int32_t ql0, uint8_t *qseq)
|
||||
{
|
||||
extern unsigned char seq_nt4_table[256];
|
||||
int32_t i, k = 0;
|
||||
if (!r->rev) {
|
||||
if (is_left)
|
||||
for (i = 0; i < ql0; ++i)
|
||||
qseq[k++] = seq_nt4_table[(uint8_t)qseq0[i]];
|
||||
else
|
||||
for (i = qlen - ql0; i < qlen; ++i)
|
||||
qseq[k++] = seq_nt4_table[(uint8_t)qseq0[i]];
|
||||
} else {
|
||||
if (is_left)
|
||||
for (i = qlen - 1; i >= qlen - ql0; --i) {
|
||||
uint8_t c = seq_nt4_table[(uint8_t)qseq0[i]];
|
||||
qseq[k++] = c >= 4? c : 3 - c;
|
||||
}
|
||||
else
|
||||
for (i = ql0 - 1; i >= 0; --i) {
|
||||
uint8_t c = seq_nt4_table[(uint8_t)qseq0[i]];
|
||||
qseq[k++] = c >= 4? c : 3 - c;
|
||||
}
|
||||
}
|
||||
return qseq;
|
||||
}
|
||||
|
||||
static void mm_jump_split_left(void *km, const mm_idx_t *mi, const mm_mapopt_t *opt, int32_t qlen, const uint8_t *qseq0, mm_reg1_t *r, int32_t ts_strand)
|
||||
{
|
||||
uint8_t *tseq = 0, *qseq = 0;
|
||||
int32_t i, n, l, i0, m, mm0;
|
||||
int32_t i0_anno = -1, n_anno = 0, mm0_anno = 0, i0_misc = -1, n_misc = 0, mm0_misc = 0;
|
||||
int32_t ext = 1 + (opt->b + opt->a - 1) / opt->a + 1;
|
||||
int32_t clip = !r->rev? r->qs : qlen - r->qe;
|
||||
int32_t extt = clip < ext? clip : ext;
|
||||
const mm_idx_jjump1_t *a;
|
||||
|
||||
if (mm_jump_check(km, mi, qlen, qseq0, r, ext + MM_MIN_EXON_LEN, 1) < 0) return;
|
||||
a = mm_idx_jump_get(mi, r->rid, r->rs - extt, r->rs + ext, &n);
|
||||
if (n == 0) return;
|
||||
|
||||
for (i = 0; i < n; ++i) { // traverse possible jumps
|
||||
const mm_idx_jjump1_t *ai = &a[i];
|
||||
int32_t tlen, tl1, j, mm1, mm2;
|
||||
assert(ai->off >= r->rs - extt && ai->off <= r->rs + ext);
|
||||
if (ts_strand * ai->strand < 0) continue; // wrong strand
|
||||
if (ai->off2 >= ai->off) continue; // wrong direction
|
||||
if (ai->off - ai->off2 < 6) continue; // intron too small
|
||||
if (ai->off2 < clip + ext) continue; // not long enough
|
||||
if (tseq == 0) {
|
||||
tseq = Kcalloc(km, uint8_t, (clip + ext) * 2); // tseq and qseq are allocated together
|
||||
qseq = tseq + clip + ext;
|
||||
mm_jump_get_qseq_seq(km, qlen, qseq0, r, 1, clip + ext, qseq);
|
||||
}
|
||||
tl1 = clip + (ai->off - r->rs);
|
||||
tlen = mm_idx_getseq2(mi, 0, r->rid, ai->off, r->rs + ext, &tseq[tl1]);
|
||||
assert(tlen == r->rs + ext - ai->off);
|
||||
tlen = mm_idx_getseq2(mi, 0, r->rid, ai->off2 - tl1, ai->off2, tseq);
|
||||
assert(tlen == tl1);
|
||||
for (j = 0, mm1 = 0; j < tl1; ++j)
|
||||
if (qseq[j] != tseq[j] || qseq[j] > 3 || tseq[j] > 3)
|
||||
++mm1;
|
||||
for (mm2 = 0; j < clip + ext; ++j)
|
||||
if (qseq[j] != tseq[j] || qseq[j] > 3 || tseq[j] > 3)
|
||||
++mm2;
|
||||
if (mm1 == 0 && mm2 <= 1) {
|
||||
if (ai->flag & MM_JUNC_ANNO)
|
||||
i0_anno = i, mm0_anno = mm1 + mm2, ++n_anno; // i0 points to the rightmost i
|
||||
else
|
||||
i0_misc = i, mm0_misc = mm1 + mm2, ++n_misc;
|
||||
}
|
||||
}
|
||||
if (n_anno > 0) m = n_anno, i0 = i0_anno, mm0 = mm0_anno;
|
||||
else m = n_misc, i0 = i0_misc, mm0 = mm0_misc;
|
||||
kfree(km, tseq);
|
||||
|
||||
l = m > 0? a[i0].off - r->rs : 0; // may be negative
|
||||
if (m == 1 && clip + l >= opt->jump_min_match) { // add one more exon
|
||||
mm_enlarge_cigar(r, 2);
|
||||
memmove(r->p->cigar + 2, r->p->cigar, r->p->n_cigar * 4);
|
||||
r->p->cigar[0] = (clip + l) << 4 | MM_CIGAR_MATCH;
|
||||
r->p->cigar[1] = (a[i0].off - a[i0].off2) << 4 | MM_CIGAR_N_SKIP;
|
||||
r->p->cigar[2] = ((r->p->cigar[2]>>4) - l) << 4 | MM_CIGAR_MATCH;
|
||||
r->p->n_cigar += 2;
|
||||
r->rs = a[i0].off2 - (clip + l);
|
||||
if (!r->rev) r->qs = 0;
|
||||
else r->qe = qlen;
|
||||
r->blen += clip, r->mlen += clip - mm0;
|
||||
r->p->dp_max0 += (clip - mm0) * opt->a - mm0 * opt->b;
|
||||
r->p->dp_max += (clip - mm0) * opt->a - mm0 * opt->b;
|
||||
if (!r->is_spliced) r->is_spliced = 1, r->p->dp_max += (opt->a + opt->b) + ((opt->a + opt->b) >> 1);
|
||||
} else if (m > 0 && a[i0].off > r->rs) { // trim by l; l is always positive
|
||||
r->p->cigar[0] -= l << 4 | MM_CIGAR_MATCH;
|
||||
r->rs += l;
|
||||
if (!r->rev) r->qs += l;
|
||||
else r->qe -= l;
|
||||
}
|
||||
}
|
||||
|
||||
static void mm_jump_split_right(void *km, const mm_idx_t *mi, const mm_mapopt_t *opt, int32_t qlen, const uint8_t *qseq0, mm_reg1_t *r, int32_t ts_strand)
|
||||
{
|
||||
uint8_t *tseq = 0, *qseq = 0;
|
||||
int32_t i, n, l, i0, m, mm0;
|
||||
int32_t i0_anno = -1, n_anno = 0, mm0_anno = 0, i0_misc = -1, n_misc = 0, mm0_misc = 0;
|
||||
int32_t ext = 1 + (opt->b + opt->a - 1) / opt->a + 1;
|
||||
int32_t clip = !r->rev? qlen - r->qe : r->qs;
|
||||
int32_t extt = clip < ext? clip : ext;
|
||||
const mm_idx_jjump1_t *a;
|
||||
|
||||
if (mm_jump_check(km, mi, qlen, qseq0, r, ext + MM_MIN_EXON_LEN, 0) < 0) return;
|
||||
a = mm_idx_jump_get(mi, r->rid, r->re - ext, r->re + extt, &n);
|
||||
if (n == 0) return;
|
||||
|
||||
for (i = 0; i < n; ++i) { // traverse possible jumps
|
||||
const mm_idx_jjump1_t *ai = &a[i];
|
||||
int32_t tlen, tl1, j, mm1, mm2;
|
||||
assert(ai->off >= r->re - ext && ai->off <= r->re + extt);
|
||||
if (ts_strand * ai->strand < 0) continue; // wrong strand
|
||||
if (ai->off2 <= ai->off) continue; // wrong direction
|
||||
if (ai->off2 - ai->off < 6) continue; // intron too small
|
||||
if (ai->off2 + clip + ext > mi->seq[r->rid].len) continue; // not long enough
|
||||
if (tseq == 0) {
|
||||
tseq = Kcalloc(km, uint8_t, (clip + ext) * 2); // tseq and qseq are allocated together
|
||||
qseq = tseq + clip + ext;
|
||||
mm_jump_get_qseq_seq(km, qlen, qseq0, r, 0, clip + ext, qseq);
|
||||
}
|
||||
tl1 = clip + (r->re - ai->off);
|
||||
tlen = mm_idx_getseq2(mi, 0, r->rid, r->re - ext, ai->off, tseq);
|
||||
assert(tlen == ai->off - (r->re - ext));
|
||||
tlen = mm_idx_getseq2(mi, 0, r->rid, ai->off2, ai->off2 + tl1, &tseq[clip + ext - tl1]);
|
||||
assert(tlen == tl1);
|
||||
for (j = 0, mm2 = 0; j < clip + ext - tl1; ++j)
|
||||
if (qseq[j] != tseq[j] || qseq[j] > 3 || tseq[j] > 3)
|
||||
++mm2;
|
||||
for (mm1 = 0; j < clip + ext; ++j)
|
||||
if (qseq[j] != tseq[j] || qseq[j] > 3 || tseq[j] > 3)
|
||||
++mm1;
|
||||
if (mm1 == 0 && mm2 <= 1) {
|
||||
if (ai->flag & MM_JUNC_ANNO) {
|
||||
if (i0_anno < 0) i0_anno = i, mm0_anno = mm1 + mm2;
|
||||
++n_anno;
|
||||
} else {
|
||||
if (i0_misc < 0) i0_misc = i, mm0_misc = mm1 + mm2;
|
||||
++n_misc;
|
||||
}
|
||||
}
|
||||
}
|
||||
if (n_anno > 0) m = n_anno, i0 = i0_anno, mm0 = mm0_anno;
|
||||
else m = n_misc, i0 = i0_misc, mm0 = mm0_misc;
|
||||
kfree(km, tseq);
|
||||
|
||||
l = m > 0? r->re - a[i0].off : 0; // may be negative
|
||||
if (m == 1 && clip + l >= opt->jump_min_match) { // add one more exon
|
||||
mm_enlarge_cigar(r, 2);
|
||||
r->p->cigar[r->p->n_cigar - 1] = ((r->p->cigar[r->p->n_cigar - 1]>>4) - l) << 4 | MM_CIGAR_MATCH;
|
||||
r->p->cigar[r->p->n_cigar] = (a[i0].off2 - a[i0].off) << 4 | MM_CIGAR_N_SKIP;
|
||||
r->p->cigar[r->p->n_cigar + 1] = (clip + l) << 4 | MM_CIGAR_MATCH;
|
||||
r->p->n_cigar += 2;
|
||||
r->re = a[i0].off2 + (clip + l);
|
||||
if (!r->rev) r->qe = qlen;
|
||||
else r->qs = 0;
|
||||
r->blen += clip, r->mlen += clip - mm0;
|
||||
r->p->dp_max0 += (clip - mm0) * opt->a - mm0 * opt->b;
|
||||
r->p->dp_max += (clip - mm0) * opt->a - mm0 * opt->b;
|
||||
if (!r->is_spliced) r->is_spliced = 1, r->p->dp_max += (opt->a + opt->b) + ((opt->a + opt->b) >> 1);
|
||||
} else if (m > 0 && r->re > a[i0].off) { // trim by l; l is always positive
|
||||
r->p->cigar[r->p->n_cigar - 1] -= l << 4 | MM_CIGAR_MATCH;
|
||||
r->re -= l;
|
||||
if (!r->rev) r->qe -= l;
|
||||
else r->qs += l;
|
||||
}
|
||||
}
|
||||
|
||||
void mm_jump_split(void *km, const mm_idx_t *mi, const mm_mapopt_t *opt, int32_t qlen, const uint8_t *qseq, mm_reg1_t *r, int32_t ts_strand)
|
||||
{
|
||||
assert((opt->flag & MM_F_EQX) == 0);
|
||||
mm_jump_split_left(km, mi, opt, qlen, qseq, r, ts_strand);
|
||||
mm_jump_split_right(km, mi, opt, qlen, qseq, r, ts_strand);
|
||||
}
|
||||
@@ -40,7 +40,8 @@ void *km_init2(void *km_par, size_t min_core_size)
|
||||
kmem_t *km;
|
||||
km = (kmem_t*)kcalloc(km_par, 1, sizeof(kmem_t));
|
||||
km->par = km_par;
|
||||
km->min_core_size = min_core_size > 0? min_core_size : 0x80000;
|
||||
if (km_par) km->min_core_size = min_core_size > 0? min_core_size : ((kmem_t*)km_par)->min_core_size - 2;
|
||||
else km->min_core_size = min_core_size > 0? min_core_size : 0x80000;
|
||||
return (void*)km;
|
||||
}
|
||||
|
||||
@@ -183,6 +184,16 @@ void *krealloc(void *_km, void *ap, size_t n_bytes) // TODO: this can be made mo
|
||||
return q;
|
||||
}
|
||||
|
||||
void *krelocate(void *km, void *ap, size_t n_bytes)
|
||||
{
|
||||
void *p;
|
||||
if (km == 0 || ap == 0) return ap;
|
||||
p = kmalloc(km, n_bytes);
|
||||
memcpy(p, ap, n_bytes);
|
||||
kfree(km, ap);
|
||||
return p;
|
||||
}
|
||||
|
||||
void km_stat(const void *_km, km_stat_t *s)
|
||||
{
|
||||
kmem_t *km = (kmem_t*)_km;
|
||||
@@ -203,3 +214,11 @@ void km_stat(const void *_km, km_stat_t *s)
|
||||
s->largest = s->largest > size? s->largest : size;
|
||||
}
|
||||
}
|
||||
|
||||
void km_stat_print(const void *km)
|
||||
{
|
||||
km_stat_t st;
|
||||
km_stat(km, &st);
|
||||
fprintf(stderr, "[km_stat] cap=%ld, avail=%ld, largest=%ld, n_core=%ld, n_block=%ld\n",
|
||||
st.capacity, st.available, st.largest, st.n_blocks, st.n_cores);
|
||||
}
|
||||
|
||||
@@ -13,6 +13,7 @@ typedef struct {
|
||||
|
||||
void *kmalloc(void *km, size_t size);
|
||||
void *krealloc(void *km, void *ptr, size_t size);
|
||||
void *krelocate(void *km, void *ap, size_t n_bytes);
|
||||
void *kcalloc(void *km, size_t count, size_t size);
|
||||
void kfree(void *km, void *ptr);
|
||||
|
||||
@@ -20,11 +21,29 @@ void *km_init(void);
|
||||
void *km_init2(void *km_par, size_t min_core_size);
|
||||
void km_destroy(void *km);
|
||||
void km_stat(const void *_km, km_stat_t *s);
|
||||
void km_stat_print(const void *km);
|
||||
|
||||
#ifdef __cplusplus
|
||||
}
|
||||
#endif
|
||||
|
||||
#define Kmalloc(km, type, cnt) ((type*)kmalloc((km), (cnt) * sizeof(type)))
|
||||
#define Kcalloc(km, type, cnt) ((type*)kcalloc((km), (cnt), sizeof(type)))
|
||||
#define Krealloc(km, type, ptr, cnt) ((type*)krealloc((km), (ptr), (cnt) * sizeof(type)))
|
||||
|
||||
#define Kgrow(km, type, ptr, __i, __m) do { \
|
||||
if ((__i) >= (__m)) { \
|
||||
(__m) = (__i) + 1; \
|
||||
(__m) += ((__m)>>1) + 16; \
|
||||
(ptr) = Krealloc(km, type, ptr, (__m)); \
|
||||
} \
|
||||
} while (0)
|
||||
|
||||
#define Kexpand(km, type, a, m) do { \
|
||||
(m) = (m) >= 4? (m) + ((m)>>1) : 16; \
|
||||
(a) = Krealloc(km, type, (a), (m)); \
|
||||
} while (0)
|
||||
|
||||
#define KMALLOC(km, ptr, len) ((ptr) = (__typeof__(ptr))kmalloc((km), (len) * sizeof(*(ptr))))
|
||||
#define KCALLOC(km, ptr, len) ((ptr) = (__typeof__(ptr))kcalloc((km), (len), sizeof(*(ptr))))
|
||||
#define KREALLOC(km, ptr, len) ((ptr) = (__typeof__(ptr))krealloc((km), (ptr), (len) * sizeof(*(ptr))))
|
||||
@@ -34,4 +53,43 @@ void km_stat(const void *_km, km_stat_t *s);
|
||||
KREALLOC((km), (a), (m)); \
|
||||
} while (0)
|
||||
|
||||
#ifndef klib_unused
|
||||
#if (defined __clang__ && __clang_major__ >= 3) || (defined __GNUC__ && __GNUC__ >= 3)
|
||||
#define klib_unused __attribute__ ((__unused__))
|
||||
#else
|
||||
#define klib_unused
|
||||
#endif
|
||||
#endif /* klib_unused */
|
||||
|
||||
#define KALLOC_POOL_INIT2(SCOPE, name, kmptype_t) \
|
||||
typedef struct { \
|
||||
size_t cnt, n, max; \
|
||||
kmptype_t **buf; \
|
||||
void *km; \
|
||||
} kmp_##name##_t; \
|
||||
SCOPE kmp_##name##_t *kmp_init_##name(void *km) { \
|
||||
kmp_##name##_t *mp; \
|
||||
mp = Kcalloc(km, kmp_##name##_t, 1); \
|
||||
mp->km = km; \
|
||||
return mp; \
|
||||
} \
|
||||
SCOPE void kmp_destroy_##name(kmp_##name##_t *mp) { \
|
||||
size_t k; \
|
||||
for (k = 0; k < mp->n; ++k) kfree(mp->km, mp->buf[k]); \
|
||||
kfree(mp->km, mp->buf); kfree(mp->km, mp); \
|
||||
} \
|
||||
SCOPE kmptype_t *kmp_alloc_##name(kmp_##name##_t *mp) { \
|
||||
++mp->cnt; \
|
||||
if (mp->n == 0) return (kmptype_t*)kcalloc(mp->km, 1, sizeof(kmptype_t)); \
|
||||
return mp->buf[--mp->n]; \
|
||||
} \
|
||||
SCOPE void kmp_free_##name(kmp_##name##_t *mp, kmptype_t *p) { \
|
||||
--mp->cnt; \
|
||||
if (mp->n == mp->max) Kexpand(mp->km, kmptype_t*, mp->buf, mp->max); \
|
||||
mp->buf[mp->n++] = p; \
|
||||
}
|
||||
|
||||
#define KALLOC_POOL_INIT(name, kmptype_t) \
|
||||
KALLOC_POOL_INIT2(static inline klib_unused, name, kmptype_t)
|
||||
|
||||
#endif
|
||||
|
||||
@@ -0,0 +1,474 @@
|
||||
/* The MIT License
|
||||
|
||||
Copyright (c) 2019 by Attractive Chaos <attractor@live.co.uk>
|
||||
|
||||
Permission is hereby granted, free of charge, to any person obtaining
|
||||
a copy of this software and associated documentation files (the
|
||||
"Software"), to deal in the Software without restriction, including
|
||||
without limitation the rights to use, copy, modify, merge, publish,
|
||||
distribute, sublicense, and/or sell copies of the Software, and to
|
||||
permit persons to whom the Software is furnished to do so, subject to
|
||||
the following conditions:
|
||||
|
||||
The above copyright notice and this permission notice shall be
|
||||
included in all copies or substantial portions of the Software.
|
||||
|
||||
THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
|
||||
EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
|
||||
MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
|
||||
NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS
|
||||
BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN
|
||||
ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN
|
||||
CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
|
||||
SOFTWARE.
|
||||
*/
|
||||
|
||||
/* An example:
|
||||
|
||||
#include <stdio.h>
|
||||
#include <string.h>
|
||||
#include <stdlib.h>
|
||||
#include "krmq.h"
|
||||
|
||||
struct my_node {
|
||||
char key;
|
||||
KRMQ_HEAD(struct my_node) head;
|
||||
};
|
||||
#define my_cmp(p, q) (((q)->key < (p)->key) - ((p)->key < (q)->key))
|
||||
KRMQ_INIT(my, struct my_node, head, my_cmp)
|
||||
|
||||
int main(void) {
|
||||
const char *str = "MNOLKQOPHIA"; // from wiki, except a duplicate
|
||||
struct my_node *root = 0;
|
||||
int i, l = strlen(str);
|
||||
for (i = 0; i < l; ++i) { // insert in the input order
|
||||
struct my_node *q, *p = malloc(sizeof(*p));
|
||||
p->key = str[i];
|
||||
q = krmq_insert(my, &root, p, 0);
|
||||
if (p != q) free(p); // if already present, free
|
||||
}
|
||||
krmq_itr_t(my) itr;
|
||||
krmq_itr_first(my, root, &itr); // place at first
|
||||
do { // traverse
|
||||
const struct my_node *p = krmq_at(&itr);
|
||||
putchar(p->key);
|
||||
free((void*)p); // free node
|
||||
} while (krmq_itr_next(my, &itr));
|
||||
putchar('\n');
|
||||
return 0;
|
||||
}
|
||||
*/
|
||||
|
||||
#ifndef KRMQ_H
|
||||
#define KRMQ_H
|
||||
|
||||
#ifdef __STRICT_ANSI__
|
||||
#define inline __inline__
|
||||
#endif
|
||||
|
||||
#define KRMQ_MAX_DEPTH 64
|
||||
|
||||
#define krmq_size(head, p) ((p)? (p)->head.size : 0)
|
||||
#define krmq_size_child(head, q, i) ((q)->head.p[(i)]? (q)->head.p[(i)]->head.size : 0)
|
||||
|
||||
#define KRMQ_HEAD(__type) \
|
||||
struct { \
|
||||
__type *p[2], *s; \
|
||||
signed char balance; /* balance factor */ \
|
||||
unsigned size; /* #elements in subtree */ \
|
||||
}
|
||||
|
||||
#define __KRMQ_FIND(suf, __scope, __type, __head, __cmp) \
|
||||
__scope __type *krmq_find_##suf(const __type *root, const __type *x, unsigned *cnt_) { \
|
||||
const __type *p = root; \
|
||||
unsigned cnt = 0; \
|
||||
while (p != 0) { \
|
||||
int cmp; \
|
||||
cmp = __cmp(x, p); \
|
||||
if (cmp >= 0) cnt += krmq_size_child(__head, p, 0) + 1; \
|
||||
if (cmp < 0) p = p->__head.p[0]; \
|
||||
else if (cmp > 0) p = p->__head.p[1]; \
|
||||
else break; \
|
||||
} \
|
||||
if (cnt_) *cnt_ = cnt; \
|
||||
return (__type*)p; \
|
||||
} \
|
||||
__scope __type *krmq_interval_##suf(const __type *root, const __type *x, __type **lower, __type **upper) { \
|
||||
const __type *p = root, *l = 0, *u = 0; \
|
||||
while (p != 0) { \
|
||||
int cmp; \
|
||||
cmp = __cmp(x, p); \
|
||||
if (cmp < 0) u = p, p = p->__head.p[0]; \
|
||||
else if (cmp > 0) l = p, p = p->__head.p[1]; \
|
||||
else { l = u = p; break; } \
|
||||
} \
|
||||
if (lower) *lower = (__type*)l; \
|
||||
if (upper) *upper = (__type*)u; \
|
||||
return (__type*)p; \
|
||||
}
|
||||
|
||||
#define __KRMQ_RMQ(suf, __scope, __type, __head, __cmp, __lt2) \
|
||||
__scope __type *krmq_rmq_##suf(const __type *root, const __type *lo, const __type *up) { /* CLOSED interval */ \
|
||||
const __type *p = root, *path[2][KRMQ_MAX_DEPTH], *min; \
|
||||
int plen[2] = {0, 0}, pcmp[2][KRMQ_MAX_DEPTH], i, cmp, lca; \
|
||||
if (root == 0) return 0; \
|
||||
while (p) { \
|
||||
cmp = __cmp(lo, p); \
|
||||
path[0][plen[0]] = p, pcmp[0][plen[0]++] = cmp; \
|
||||
if (cmp < 0) p = p->__head.p[0]; \
|
||||
else if (cmp > 0) p = p->__head.p[1]; \
|
||||
else break; \
|
||||
} \
|
||||
p = root; \
|
||||
while (p) { \
|
||||
cmp = __cmp(up, p); \
|
||||
path[1][plen[1]] = p, pcmp[1][plen[1]++] = cmp; \
|
||||
if (cmp < 0) p = p->__head.p[0]; \
|
||||
else if (cmp > 0) p = p->__head.p[1]; \
|
||||
else break; \
|
||||
} \
|
||||
for (i = 0; i < plen[0] && i < plen[1]; ++i) /* find the LCA */ \
|
||||
if (path[0][i] == path[1][i] && pcmp[0][i] <= 0 && pcmp[1][i] >= 0) \
|
||||
break; \
|
||||
if (i == plen[0] || i == plen[1]) return 0; /* no elements in the closed interval */ \
|
||||
lca = i, min = path[0][lca]; \
|
||||
for (i = lca + 1; i < plen[0]; ++i) { \
|
||||
if (pcmp[0][i] <= 0) { \
|
||||
if (__lt2(path[0][i], min)) min = path[0][i]; \
|
||||
if (path[0][i]->__head.p[1] && __lt2(path[0][i]->__head.p[1]->__head.s, min)) \
|
||||
min = path[0][i]->__head.p[1]->__head.s; \
|
||||
} \
|
||||
} \
|
||||
for (i = lca + 1; i < plen[1]; ++i) { \
|
||||
if (pcmp[1][i] >= 0) { \
|
||||
if (__lt2(path[1][i], min)) min = path[1][i]; \
|
||||
if (path[1][i]->__head.p[0] && __lt2(path[1][i]->__head.p[0]->__head.s, min)) \
|
||||
min = path[1][i]->__head.p[0]->__head.s; \
|
||||
} \
|
||||
} \
|
||||
return (__type*)min; \
|
||||
}
|
||||
|
||||
#define __KRMQ_ROTATE(suf, __type, __head, __lt2) \
|
||||
/* */ \
|
||||
static inline void krmq_update_min_##suf(__type *p, const __type *q, const __type *r) { \
|
||||
p->__head.s = !q || __lt2(p, q->__head.s)? p : q->__head.s; \
|
||||
p->__head.s = !r || __lt2(p->__head.s, r->__head.s)? p->__head.s : r->__head.s; \
|
||||
} \
|
||||
/* one rotation: (a,(b,c)q)p => ((a,b)p,c)q */ \
|
||||
static inline __type *krmq_rotate1_##suf(__type *p, int dir) { /* dir=0 to left; dir=1 to right */ \
|
||||
int opp = 1 - dir; /* opposite direction */ \
|
||||
__type *q = p->__head.p[opp], *s = p->__head.s; \
|
||||
unsigned size_p = p->__head.size; \
|
||||
p->__head.size -= q->__head.size - krmq_size_child(__head, q, dir); \
|
||||
q->__head.size = size_p; \
|
||||
krmq_update_min_##suf(p, p->__head.p[dir], q->__head.p[dir]); \
|
||||
q->__head.s = s; \
|
||||
p->__head.p[opp] = q->__head.p[dir]; \
|
||||
q->__head.p[dir] = p; \
|
||||
return q; \
|
||||
} \
|
||||
/* two consecutive rotations: (a,((b,c)r,d)q)p => ((a,b)p,(c,d)q)r */ \
|
||||
static inline __type *krmq_rotate2_##suf(__type *p, int dir) { \
|
||||
int b1, opp = 1 - dir; \
|
||||
__type *q = p->__head.p[opp], *r = q->__head.p[dir], *s = p->__head.s; \
|
||||
unsigned size_x_dir = krmq_size_child(__head, r, dir); \
|
||||
r->__head.size = p->__head.size; \
|
||||
p->__head.size -= q->__head.size - size_x_dir; \
|
||||
q->__head.size -= size_x_dir + 1; \
|
||||
krmq_update_min_##suf(p, p->__head.p[dir], r->__head.p[dir]); \
|
||||
krmq_update_min_##suf(q, q->__head.p[opp], r->__head.p[opp]); \
|
||||
r->__head.s = s; \
|
||||
p->__head.p[opp] = r->__head.p[dir]; \
|
||||
r->__head.p[dir] = p; \
|
||||
q->__head.p[dir] = r->__head.p[opp]; \
|
||||
r->__head.p[opp] = q; \
|
||||
b1 = dir == 0? +1 : -1; \
|
||||
if (r->__head.balance == b1) q->__head.balance = 0, p->__head.balance = -b1; \
|
||||
else if (r->__head.balance == 0) q->__head.balance = p->__head.balance = 0; \
|
||||
else q->__head.balance = b1, p->__head.balance = 0; \
|
||||
r->__head.balance = 0; \
|
||||
return r; \
|
||||
}
|
||||
|
||||
#define __KRMQ_INSERT(suf, __scope, __type, __head, __cmp, __lt2) \
|
||||
__scope __type *krmq_insert_##suf(__type **root_, __type *x, unsigned *cnt_) { \
|
||||
unsigned char stack[KRMQ_MAX_DEPTH]; \
|
||||
__type *path[KRMQ_MAX_DEPTH]; \
|
||||
__type *bp, *bq; \
|
||||
__type *p, *q, *r = 0; /* _r_ is potentially the new root */ \
|
||||
int i, which = 0, top, b1, path_len; \
|
||||
unsigned cnt = 0; \
|
||||
bp = *root_, bq = 0; \
|
||||
/* find the insertion location */ \
|
||||
for (p = bp, q = bq, top = path_len = 0; p; q = p, p = p->__head.p[which]) { \
|
||||
int cmp; \
|
||||
cmp = __cmp(x, p); \
|
||||
if (cmp >= 0) cnt += krmq_size_child(__head, p, 0) + 1; \
|
||||
if (cmp == 0) { \
|
||||
if (cnt_) *cnt_ = cnt; \
|
||||
return p; \
|
||||
} \
|
||||
if (p->__head.balance != 0) \
|
||||
bq = q, bp = p, top = 0; \
|
||||
stack[top++] = which = (cmp > 0); \
|
||||
path[path_len++] = p; \
|
||||
} \
|
||||
if (cnt_) *cnt_ = cnt; \
|
||||
x->__head.balance = 0, x->__head.size = 1, x->__head.p[0] = x->__head.p[1] = 0, x->__head.s = x; \
|
||||
if (q == 0) *root_ = x; \
|
||||
else q->__head.p[which] = x; \
|
||||
if (bp == 0) return x; \
|
||||
for (i = 0; i < path_len; ++i) ++path[i]->__head.size; \
|
||||
for (i = path_len - 1; i >= 0; --i) { \
|
||||
krmq_update_min_##suf(path[i], path[i]->__head.p[0], path[i]->__head.p[1]); \
|
||||
if (path[i]->__head.s != x) break; \
|
||||
} \
|
||||
for (p = bp, top = 0; p != x; p = p->__head.p[stack[top]], ++top) /* update balance factors */ \
|
||||
if (stack[top] == 0) --p->__head.balance; \
|
||||
else ++p->__head.balance; \
|
||||
if (bp->__head.balance > -2 && bp->__head.balance < 2) return x; /* no re-balance needed */ \
|
||||
/* re-balance */ \
|
||||
which = (bp->__head.balance < 0); \
|
||||
b1 = which == 0? +1 : -1; \
|
||||
q = bp->__head.p[1 - which]; \
|
||||
if (q->__head.balance == b1) { \
|
||||
r = krmq_rotate1_##suf(bp, which); \
|
||||
q->__head.balance = bp->__head.balance = 0; \
|
||||
} else r = krmq_rotate2_##suf(bp, which); \
|
||||
if (bq == 0) *root_ = r; \
|
||||
else bq->__head.p[bp != bq->__head.p[0]] = r; \
|
||||
return x; \
|
||||
}
|
||||
|
||||
#define __KRMQ_ERASE(suf, __scope, __type, __head, __cmp, __lt2) \
|
||||
__scope __type *krmq_erase_##suf(__type **root_, const __type *x, unsigned *cnt_) { \
|
||||
__type *p, *path[KRMQ_MAX_DEPTH], fake; \
|
||||
unsigned char dir[KRMQ_MAX_DEPTH]; \
|
||||
int i, d = 0, cmp; \
|
||||
unsigned cnt = 0; \
|
||||
fake = **root_, fake.__head.p[0] = *root_, fake.__head.p[1] = 0; \
|
||||
if (cnt_) *cnt_ = 0; \
|
||||
if (x) { \
|
||||
for (cmp = -1, p = &fake; cmp; cmp = __cmp(x, p)) { \
|
||||
int which = (cmp > 0); \
|
||||
if (cmp > 0) cnt += krmq_size_child(__head, p, 0) + 1; \
|
||||
dir[d] = which; \
|
||||
path[d++] = p; \
|
||||
p = p->__head.p[which]; \
|
||||
if (p == 0) { \
|
||||
if (cnt_) *cnt_ = 0; \
|
||||
return 0; \
|
||||
} \
|
||||
} \
|
||||
cnt += krmq_size_child(__head, p, 0) + 1; /* because p==x is not counted */ \
|
||||
} else { \
|
||||
for (p = &fake, cnt = 1; p; p = p->__head.p[0]) \
|
||||
dir[d] = 0, path[d++] = p; \
|
||||
p = path[--d]; \
|
||||
} \
|
||||
if (cnt_) *cnt_ = cnt; \
|
||||
for (i = 1; i < d; ++i) --path[i]->__head.size; \
|
||||
if (p->__head.p[1] == 0) { /* ((1,.)2,3)4 => (1,3)4; p=2 */ \
|
||||
path[d-1]->__head.p[dir[d-1]] = p->__head.p[0]; \
|
||||
} else { \
|
||||
__type *q = p->__head.p[1]; \
|
||||
if (q->__head.p[0] == 0) { /* ((1,2)3,4)5 => ((1)2,4)5; p=3,q=2 */ \
|
||||
q->__head.p[0] = p->__head.p[0]; \
|
||||
q->__head.balance = p->__head.balance; \
|
||||
path[d-1]->__head.p[dir[d-1]] = q; \
|
||||
path[d] = q, dir[d++] = 1; \
|
||||
q->__head.size = p->__head.size - 1; \
|
||||
} else { /* ((1,((.,2)3,4)5)6,7)8 => ((1,(2,4)5)3,7)8; p=6 */ \
|
||||
__type *r; \
|
||||
int e = d++; /* backup _d_ */\
|
||||
for (;;) { \
|
||||
dir[d] = 0; \
|
||||
path[d++] = q; \
|
||||
r = q->__head.p[0]; \
|
||||
if (r->__head.p[0] == 0) break; \
|
||||
q = r; \
|
||||
} \
|
||||
r->__head.p[0] = p->__head.p[0]; \
|
||||
q->__head.p[0] = r->__head.p[1]; \
|
||||
r->__head.p[1] = p->__head.p[1]; \
|
||||
r->__head.balance = p->__head.balance; \
|
||||
path[e-1]->__head.p[dir[e-1]] = r; \
|
||||
path[e] = r, dir[e] = 1; \
|
||||
for (i = e + 1; i < d; ++i) --path[i]->__head.size; \
|
||||
r->__head.size = p->__head.size - 1; \
|
||||
} \
|
||||
} \
|
||||
for (i = d - 1; i >= 0; --i) /* not sure why adding condition "path[i]->__head.s==p" doesn't work */ \
|
||||
krmq_update_min_##suf(path[i], path[i]->__head.p[0], path[i]->__head.p[1]); \
|
||||
while (--d > 0) { \
|
||||
__type *q = path[d]; \
|
||||
int which, other, b1 = 1, b2 = 2; \
|
||||
which = dir[d], other = 1 - which; \
|
||||
if (which) b1 = -b1, b2 = -b2; \
|
||||
q->__head.balance += b1; \
|
||||
if (q->__head.balance == b1) break; \
|
||||
else if (q->__head.balance == b2) { \
|
||||
__type *r = q->__head.p[other]; \
|
||||
if (r->__head.balance == -b1) { \
|
||||
path[d-1]->__head.p[dir[d-1]] = krmq_rotate2_##suf(q, which); \
|
||||
} else { \
|
||||
path[d-1]->__head.p[dir[d-1]] = krmq_rotate1_##suf(q, which); \
|
||||
if (r->__head.balance == 0) { \
|
||||
r->__head.balance = -b1; \
|
||||
q->__head.balance = b1; \
|
||||
break; \
|
||||
} else r->__head.balance = q->__head.balance = 0; \
|
||||
} \
|
||||
} \
|
||||
} \
|
||||
*root_ = fake.__head.p[0]; \
|
||||
return p; \
|
||||
}
|
||||
|
||||
#define krmq_free(__type, __head, __root, __free) do { \
|
||||
__type *_p, *_q; \
|
||||
for (_p = __root; _p; _p = _q) { \
|
||||
if (_p->__head.p[0] == 0) { \
|
||||
_q = _p->__head.p[1]; \
|
||||
__free(_p); \
|
||||
} else { \
|
||||
_q = _p->__head.p[0]; \
|
||||
_p->__head.p[0] = _q->__head.p[1]; \
|
||||
_q->__head.p[1] = _p; \
|
||||
} \
|
||||
} \
|
||||
} while (0)
|
||||
|
||||
#define __KRMQ_ITR(suf, __scope, __type, __head, __cmp) \
|
||||
struct krmq_itr_##suf { \
|
||||
const __type *stack[KRMQ_MAX_DEPTH], **top; \
|
||||
}; \
|
||||
__scope void krmq_itr_first_##suf(const __type *root, struct krmq_itr_##suf *itr) { \
|
||||
const __type *p; \
|
||||
for (itr->top = itr->stack - 1, p = root; p; p = p->__head.p[0]) \
|
||||
*++itr->top = p; \
|
||||
} \
|
||||
__scope int krmq_itr_find_##suf(const __type *root, const __type *x, struct krmq_itr_##suf *itr) { \
|
||||
const __type *p = root; \
|
||||
itr->top = itr->stack - 1; \
|
||||
while (p != 0) { \
|
||||
int cmp; \
|
||||
*++itr->top = p; \
|
||||
cmp = __cmp(x, p); \
|
||||
if (cmp < 0) p = p->__head.p[0]; \
|
||||
else if (cmp > 0) p = p->__head.p[1]; \
|
||||
else break; \
|
||||
} \
|
||||
return p? 1 : 0; \
|
||||
} \
|
||||
__scope int krmq_itr_next_bidir_##suf(struct krmq_itr_##suf *itr, int dir) { \
|
||||
const __type *p; \
|
||||
if (itr->top < itr->stack) return 0; \
|
||||
dir = !!dir; \
|
||||
p = (*itr->top)->__head.p[dir]; \
|
||||
if (p) { /* go down */ \
|
||||
for (; p; p = p->__head.p[!dir]) \
|
||||
*++itr->top = p; \
|
||||
return 1; \
|
||||
} else { /* go up */ \
|
||||
do { \
|
||||
p = *itr->top--; \
|
||||
} while (itr->top >= itr->stack && p == (*itr->top)->__head.p[dir]); \
|
||||
return itr->top < itr->stack? 0 : 1; \
|
||||
} \
|
||||
} \
|
||||
|
||||
/**
|
||||
* Insert a node to the tree
|
||||
*
|
||||
* @param suf name suffix used in KRMQ_INIT()
|
||||
* @param proot pointer to the root of the tree (in/out: root may change)
|
||||
* @param x node to insert (in)
|
||||
* @param cnt number of nodes smaller than or equal to _x_; can be NULL (out)
|
||||
*
|
||||
* @return _x_ if not present in the tree, or the node equal to x.
|
||||
*/
|
||||
#define krmq_insert(suf, proot, x, cnt) krmq_insert_##suf(proot, x, cnt)
|
||||
|
||||
/**
|
||||
* Find a node in the tree
|
||||
*
|
||||
* @param suf name suffix used in KRMQ_INIT()
|
||||
* @param root root of the tree
|
||||
* @param x node value to find (in)
|
||||
* @param cnt number of nodes smaller than or equal to _x_; can be NULL (out)
|
||||
*
|
||||
* @return node equal to _x_ if present, or NULL if absent
|
||||
*/
|
||||
#define krmq_find(suf, root, x, cnt) krmq_find_##suf(root, x, cnt)
|
||||
#define krmq_interval(suf, root, x, lower, upper) krmq_interval_##suf(root, x, lower, upper)
|
||||
#define krmq_rmq(suf, root, lo, up) krmq_rmq_##suf(root, lo, up)
|
||||
|
||||
/**
|
||||
* Delete a node from the tree
|
||||
*
|
||||
* @param suf name suffix used in KRMQ_INIT()
|
||||
* @param proot pointer to the root of the tree (in/out: root may change)
|
||||
* @param x node value to delete; if NULL, delete the first node (in)
|
||||
*
|
||||
* @return node removed from the tree if present, or NULL if absent
|
||||
*/
|
||||
#define krmq_erase(suf, proot, x, cnt) krmq_erase_##suf(proot, x, cnt)
|
||||
#define krmq_erase_first(suf, proot) krmq_erase_##suf(proot, 0, 0)
|
||||
|
||||
#define krmq_itr_t(suf) struct krmq_itr_##suf
|
||||
|
||||
/**
|
||||
* Place the iterator at the smallest object
|
||||
*
|
||||
* @param suf name suffix used in KRMQ_INIT()
|
||||
* @param root root of the tree
|
||||
* @param itr iterator
|
||||
*/
|
||||
#define krmq_itr_first(suf, root, itr) krmq_itr_first_##suf(root, itr)
|
||||
|
||||
/**
|
||||
* Place the iterator at the object equal to or greater than the query
|
||||
*
|
||||
* @param suf name suffix used in KRMQ_INIT()
|
||||
* @param root root of the tree
|
||||
* @param x query (in)
|
||||
* @param itr iterator (out)
|
||||
*
|
||||
* @return 1 if find; 0 otherwise. krmq_at(itr) is NULL if and only if query is
|
||||
* larger than all objects in the tree
|
||||
*/
|
||||
#define krmq_itr_find(suf, root, x, itr) krmq_itr_find_##suf(root, x, itr)
|
||||
|
||||
/**
|
||||
* Move to the next object in order
|
||||
*
|
||||
* @param itr iterator (modified)
|
||||
*
|
||||
* @return 1 if there is a next object; 0 otherwise
|
||||
*/
|
||||
#define krmq_itr_next(suf, itr) krmq_itr_next_bidir_##suf(itr, 1)
|
||||
#define krmq_itr_prev(suf, itr) krmq_itr_next_bidir_##suf(itr, 0)
|
||||
|
||||
/**
|
||||
* Return the pointer at the iterator
|
||||
*
|
||||
* @param itr iterator
|
||||
*
|
||||
* @return pointer if present; NULL otherwise
|
||||
*/
|
||||
#define krmq_at(itr) ((itr)->top < (itr)->stack? 0 : *(itr)->top)
|
||||
|
||||
#define KRMQ_INIT2(suf, __scope, __type, __head, __cmp, __lt2) \
|
||||
__KRMQ_FIND(suf, __scope, __type, __head, __cmp) \
|
||||
__KRMQ_RMQ(suf, __scope, __type, __head, __cmp, __lt2) \
|
||||
__KRMQ_ROTATE(suf, __type, __head, __lt2) \
|
||||
__KRMQ_INSERT(suf, __scope, __type, __head, __cmp, __lt2) \
|
||||
__KRMQ_ERASE(suf, __scope, __type, __head, __cmp, __lt2) \
|
||||
__KRMQ_ITR(suf, __scope, __type, __head, __cmp)
|
||||
|
||||
#define KRMQ_INIT(suf, __type, __head, __cmp, __lt2) \
|
||||
KRMQ_INIT2(suf,, __type, __head, __cmp, __lt2)
|
||||
|
||||
#endif
|
||||
@@ -15,6 +15,17 @@
|
||||
#define KSW_EZ_SPLICE_FOR 0x100
|
||||
#define KSW_EZ_SPLICE_REV 0x200
|
||||
#define KSW_EZ_SPLICE_FLANK 0x400
|
||||
#define KSW_EZ_SPLICE_CMPLX 0x800 // use the miniprot splice model
|
||||
#define KSW_EZ_SPLICE_SCORE 0x1000 // use splice score
|
||||
|
||||
// The subset of CIGAR operators used by ksw code.
|
||||
// Use MM_CIGAR_* from minimap.h if you need the full list.
|
||||
#define KSW_CIGAR_MATCH 0
|
||||
#define KSW_CIGAR_INS 1
|
||||
#define KSW_CIGAR_DEL 2
|
||||
#define KSW_CIGAR_N_SKIP 3
|
||||
|
||||
#define KSW_SPSC_OFFSET 64
|
||||
|
||||
#ifdef __cplusplus
|
||||
extern "C" {
|
||||
@@ -61,7 +72,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
int8_t gapo, int8_t gape, int8_t gapo2, int8_t gape2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
|
||||
|
||||
void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t gapo, int8_t gape, int8_t gapo2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez);
|
||||
int8_t gapo, int8_t gape, int8_t gapo2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez);
|
||||
|
||||
void ksw_extf2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t mch, int8_t mis, int8_t e, int w, int xdrop, ksw_extz_t *ez);
|
||||
|
||||
@@ -137,13 +148,13 @@ static inline void ksw_backtrack(void *km, int is_rot, int is_rev, int min_intro
|
||||
else if (!(tmp >> (state + 2) & 1)) state = 0; // if requesting other states, _state_ stays the same if it is a continuation; otherwise, set to H
|
||||
if (state == 0) state = tmp & 7; // TODO: probably this line can be merged into the "else if" line right above; not 100% sure
|
||||
if (force_state >= 0) state = force_state;
|
||||
if (state == 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 0, 1), --i, --j; // match
|
||||
else if (state == 1 || (state == 3 && min_intron_len <= 0)) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 2, 1), --i; // deletion
|
||||
else if (state == 3 && min_intron_len > 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 3, 1), --i; // intron
|
||||
else cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 1, 1), --j; // insertion
|
||||
if (state == 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, KSW_CIGAR_MATCH, 1), --i, --j;
|
||||
else if (state == 1 || (state == 3 && min_intron_len <= 0)) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, KSW_CIGAR_DEL, 1), --i;
|
||||
else if (state == 3 && min_intron_len > 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, KSW_CIGAR_N_SKIP, 1), --i;
|
||||
else cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, KSW_CIGAR_INS, 1), --j;
|
||||
}
|
||||
if (i >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, min_intron_len > 0 && i >= min_intron_len? 3 : 2, i + 1); // first deletion
|
||||
if (j >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 1, j + 1); // first insertion
|
||||
if (i >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, min_intron_len > 0 && i >= min_intron_len? KSW_CIGAR_N_SKIP : KSW_CIGAR_DEL, i + 1); // first deletion
|
||||
if (j >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, KSW_CIGAR_INS, j + 1); // first insertion
|
||||
if (!is_rev)
|
||||
for (i = 0; i < n_cigar>>1; ++i) // reverse CIGAR
|
||||
tmp = cigar[i], cigar[i] = cigar[n_cigar-1-i], cigar[n_cigar-1-i] = tmp;
|
||||
|
||||
+5
-5
@@ -80,17 +80,17 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
}
|
||||
|
||||
void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez)
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez)
|
||||
{
|
||||
extern void ksw_exts2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez);
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez);
|
||||
extern void ksw_exts2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez);
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez);
|
||||
if (ksw_simd < 0) ksw_simd = x86_simd();
|
||||
if (ksw_simd & SIMD_SSE4_1)
|
||||
ksw_exts2_sse41(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, junc_bonus, flag, junc, ez);
|
||||
ksw_exts2_sse41(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, end_bonus, junc_bonus, junc_pen, flag, junc, ez);
|
||||
else if (ksw_simd & SIMD_SSE2)
|
||||
ksw_exts2_sse2(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, junc_bonus, flag, junc, ez);
|
||||
ksw_exts2_sse2(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, end_bonus, junc_bonus, junc_pen, flag, junc, ez);
|
||||
else abort();
|
||||
}
|
||||
#endif
|
||||
|
||||
-1340
File diff suppressed because it is too large
Load Diff
@@ -1,42 +0,0 @@
|
||||
/* The MIT License
|
||||
|
||||
Copyright (c) 2018- Dana-Farber Cancer Institute
|
||||
2017-2018 Broad Institute, Inc.
|
||||
|
||||
Permission is hereby granted, free of charge, to any person obtaining
|
||||
a copy of this software and associated documentation files (the
|
||||
"Software"), to deal in the Software without restriction, including
|
||||
without limitation the rights to use, copy, modify, merge, publish,
|
||||
distribute, sublicense, and/or sell copies of the Software, and to
|
||||
permit persons to whom the Software is furnished to do so, subject to
|
||||
the following conditions:
|
||||
|
||||
The above copyright notice and this permission notice shall be
|
||||
included in all copies or substantial portions of the Software.
|
||||
|
||||
THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
|
||||
EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
|
||||
MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
|
||||
NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS
|
||||
BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN
|
||||
ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN
|
||||
CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
|
||||
SOFTWARE.
|
||||
Modified Copyright (C) 2021 Intel Corporation
|
||||
Contacts: Saurabh Kalikar <saurabh.kalikar@intel.com>;
|
||||
Vasimuddin Md <vasimuddin.md@intel.com>; Sanchit Misra <sanchit.misra@intel.com>;
|
||||
Chirag Jain <chirag@iisc.ac.in>; Heng Li <hli@jimmy.harvard.edu>
|
||||
*/
|
||||
#include <string.h>
|
||||
#include <stdio.h>
|
||||
#include <assert.h>
|
||||
#include "ksw2.h"
|
||||
#include <immintrin.h>
|
||||
#include <x86intrin.h>
|
||||
#include <smmintrin.h>
|
||||
#include <emmintrin.h>
|
||||
void ksw_extd2_avx512(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
|
||||
|
||||
void ksw_extd2_avx2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
|
||||
+1
-1
@@ -358,7 +358,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
} else H[0] = v8[0] - qe, max_H = H[0], max_t = 0; // special casing r==0
|
||||
// update ez
|
||||
if (en0 == tlen - 1 && H[en0] > ez->mte)
|
||||
ez->mte = H[en0], ez->mte_q = r - en;
|
||||
ez->mte = H[en0], ez->mte_q = r - en0;
|
||||
if (r - st0 == qlen - 1 && H[st0] > ez->mqe)
|
||||
ez->mqe = H[st0], ez->mqe_t = st0;
|
||||
if (ksw_apply_zdrop(ez, 1, max_H, r, max_t, zdrop, e2)) break;
|
||||
|
||||
+95
-45
@@ -24,14 +24,14 @@
|
||||
#ifdef KSW_CPU_DISPATCH
|
||||
#ifdef __SSE4_1__
|
||||
void ksw_exts2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez)
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez)
|
||||
#else
|
||||
void ksw_exts2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez)
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez)
|
||||
#endif
|
||||
#else
|
||||
void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int8_t junc_bonus, int flag, const uint8_t *junc, ksw_extz_t *ez)
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez)
|
||||
#endif // ~KSW_CPU_DISPATCH
|
||||
{
|
||||
#define __dp_code_block1 \
|
||||
@@ -71,6 +71,7 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
|
||||
ksw_reset_extz(ez);
|
||||
if (m <= 1 || qlen <= 0 || tlen <= 0 || q2 <= q + e) return;
|
||||
assert((flag & KSW_EZ_SPLICE_FOR) == 0 || (flag & KSW_EZ_SPLICE_REV) == 0); // can't be both set
|
||||
|
||||
zero_ = _mm_set1_epi8(0);
|
||||
q_ = _mm_set1_epi8(q);
|
||||
@@ -118,55 +119,100 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
|
||||
// set the donor and acceptor arrays. TODO: this assumes 0/1/2/3 encoding!
|
||||
if (flag & (KSW_EZ_SPLICE_FOR|KSW_EZ_SPLICE_REV)) {
|
||||
int semi_cost = flag&KSW_EZ_SPLICE_FLANK? -noncan/2 : 0; // GTr or yAG is worth 0.5 bit; see PMID:18688272
|
||||
memset(donor, -noncan, tlen_ * 16);
|
||||
memset(acceptor, -noncan, tlen_ * 16);
|
||||
const int sp0[4] = { 8, 15, 21, 30 };
|
||||
int sp[4];
|
||||
if (flag & KSW_EZ_SPLICE_CMPLX) {
|
||||
for (t = 0; t < 4; ++t)
|
||||
sp[t] = (int)((double)sp0[t] / 3. + .499);
|
||||
} else {
|
||||
sp[0] = flag&KSW_EZ_SPLICE_FLANK? noncan / 2 : 0;
|
||||
sp[1] = sp[2] = sp[3] = noncan;
|
||||
}
|
||||
memset(donor, -sp[3], tlen_ * 16);
|
||||
memset(acceptor, -sp[3], tlen_ * 16);
|
||||
if (!(flag & KSW_EZ_REV_CIGAR)) {
|
||||
for (t = 0; t < tlen - 4; ++t) {
|
||||
int can_type = 0; // type of canonical site: 0=none, 1=GT/AG only, 2=GTr/yAG
|
||||
if ((flag & KSW_EZ_SPLICE_FOR) && target[t+1] == 2 && target[t+2] == 3) can_type = 1; // GTr...
|
||||
if ((flag & KSW_EZ_SPLICE_REV) && target[t+1] == 1 && target[t+2] == 3) can_type = 1; // CTr...
|
||||
if (can_type && (target[t+3] == 0 || target[t+3] == 2)) can_type = 2;
|
||||
if (can_type) ((int8_t*)donor)[t] = can_type == 2? 0 : semi_cost;
|
||||
int z = 3;
|
||||
if (flag & KSW_EZ_SPLICE_FOR) {
|
||||
if (target[t+1] == 2 && target[t+2] == 3) // |GT.
|
||||
z = target[t+3] == 0 || target[t+3] == 2? -1 : 0; // |GTr or not
|
||||
else if (target[t+1] == 2 && target[t+2] == 1) z = 1; // |GC.
|
||||
else if (target[t+1] == 0 && target[t+2] == 3) z = 2; // |AT.
|
||||
} else if (flag & KSW_EZ_SPLICE_REV) {
|
||||
if (target[t+1] == 1 && target[t+2] == 3) // |CT. (revcomp of .AG|)
|
||||
z = target[t+3] == 0 || target[t+3] == 2? -1 : 0;
|
||||
else if (target[t+1] == 2 && target[t+2] == 3) z = 2; // |GT. (revcomp of .AC|)
|
||||
}
|
||||
((int8_t*)donor)[t] = z < 0? 0 : -sp[z];
|
||||
}
|
||||
if (junc)
|
||||
for (t = 0; t < tlen - 1; ++t)
|
||||
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t+1]&1)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t+1]&8)))
|
||||
((int8_t*)donor)[t] += junc_bonus;
|
||||
for (t = 2; t < tlen; ++t) {
|
||||
int can_type = 0;
|
||||
if ((flag & KSW_EZ_SPLICE_FOR) && target[t-1] == 0 && target[t] == 2) can_type = 1; // ...yAG
|
||||
if ((flag & KSW_EZ_SPLICE_REV) && target[t-1] == 0 && target[t] == 1) can_type = 1; // ...yAC
|
||||
if (can_type && (target[t-2] == 1 || target[t-2] == 3)) can_type = 2;
|
||||
if (can_type) ((int8_t*)acceptor)[t] = can_type == 2? 0 : semi_cost;
|
||||
int z = 3;
|
||||
if (flag & KSW_EZ_SPLICE_FOR) {
|
||||
if (target[t-1] == 0 && target[t] == 2) // .AG|
|
||||
z = target[t-2] == 1 || target[t-2] == 3? -1 : 0; // yAG| or not
|
||||
else if (target[t-1] == 0 && target[t] == 1) z = 2; // .AC|
|
||||
} else if (flag & KSW_EZ_SPLICE_REV) {
|
||||
if (target[t-1] == 0 && target[t] == 1) // .AC| (revcomp of |GT.)
|
||||
z = target[t-2] == 1 || target[t-2] == 3? -1 : 0; // yAC| or not
|
||||
else if (target[t-1] == 2 && target[t] == 1) z = 1; // .GC| (revcomp of |GC.)
|
||||
else if (target[t-1] == 0 && target[t] == 3) z = 2; // .AT| (revcomp of |AT.)
|
||||
}
|
||||
((int8_t*)acceptor)[t] = z < 0? 0 : -sp[z];
|
||||
}
|
||||
if (junc)
|
||||
for (t = 0; t < tlen; ++t)
|
||||
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t]&2)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t]&4)))
|
||||
((int8_t*)acceptor)[t] += junc_bonus;
|
||||
} else {
|
||||
for (t = 0; t < tlen - 4; ++t) {
|
||||
int can_type = 0; // type of canonical site: 0=none, 1=GT/AG only, 2=GTr/yAG
|
||||
if ((flag & KSW_EZ_SPLICE_FOR) && target[t+1] == 2 && target[t+2] == 0) can_type = 1; // GAy...
|
||||
if ((flag & KSW_EZ_SPLICE_REV) && target[t+1] == 1 && target[t+2] == 0) can_type = 1; // CAy...
|
||||
if (can_type && (target[t+3] == 1 || target[t+3] == 3)) can_type = 2;
|
||||
if (can_type) ((int8_t*)donor)[t] = can_type == 2? 0 : semi_cost;
|
||||
int z = 3;
|
||||
if (flag & KSW_EZ_SPLICE_FOR) {
|
||||
if (target[t+1] == 2 && target[t+2] == 0) // |GA. (rev of .AG|)
|
||||
z = target[t+3] == 1 || target[t+3] == 3? -1 : 0;
|
||||
else if (target[t+1] == 1 && target[t+2] == 0) z = 2; // |CA. (rev of .AC|)
|
||||
} else if (flag & KSW_EZ_SPLICE_REV) {
|
||||
if (target[t+1] == 1 && target[t+2] == 0) // |CA. (comp of |GT.)
|
||||
z = target[t+3] == 1 || target[t+3] == 3? -1 : 0;
|
||||
else if (target[t+1] == 1 && target[t+2] == 2) z = 1; // |CG. (comp of |GC.)
|
||||
else if (target[t+1] == 3 && target[t+2] == 0) z = 2; // |TA. (comp of |AT.)
|
||||
}
|
||||
((int8_t*)donor)[t] = z < 0? 0 : -sp[z];
|
||||
}
|
||||
if (junc)
|
||||
for (t = 0; t < tlen - 1; ++t)
|
||||
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t+1]&2)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t+1]&4)))
|
||||
((int8_t*)donor)[t] += junc_bonus;
|
||||
for (t = 2; t < tlen; ++t) {
|
||||
int can_type = 0;
|
||||
if ((flag & KSW_EZ_SPLICE_FOR) && target[t-1] == 3 && target[t] == 2) can_type = 1; // ...rTG
|
||||
if ((flag & KSW_EZ_SPLICE_REV) && target[t-1] == 3 && target[t] == 1) can_type = 1; // ...rTC
|
||||
if (can_type && (target[t-2] == 0 || target[t-2] == 2)) can_type = 2;
|
||||
if (can_type) ((int8_t*)acceptor)[t] = can_type == 2? 0 : semi_cost;
|
||||
int z = 3;
|
||||
if (flag & KSW_EZ_SPLICE_FOR) {
|
||||
if (target[t-1] == 3 && target[t] == 2) // .TG| (rev of |GT.)
|
||||
z = target[t-2] == 0 || target[t-2] == 2? -1 : 0;
|
||||
else if (target[t-1] == 1 && target[t] == 2) z = 1; // .CG| (rev of |GC.)
|
||||
else if (target[t-1] == 3 && target[t] == 0) z = 2; // .TA| (rev of |AT.)
|
||||
} else if (flag & KSW_EZ_SPLICE_REV) {
|
||||
if (target[t-1] == 3 && target[t] == 1) // .TC| (comp of .AG|)
|
||||
z = target[t-2] == 0 || target[t-2] == 2? -1 : 0;
|
||||
else if (target[t-1] == 3 && target[t] == 2) z = 2; // .TG| (comp of .AC|)
|
||||
}
|
||||
((int8_t*)acceptor)[t] = z < 0? 0 : -sp[z];
|
||||
}
|
||||
if (junc)
|
||||
for (t = 0; t < tlen; ++t)
|
||||
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t]&1)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t]&8)))
|
||||
((int8_t*)acceptor)[t] += junc_bonus;
|
||||
}
|
||||
}
|
||||
|
||||
if (junc && (flag & KSW_EZ_SPLICE_SCORE)) { // junc[] keeps the donor score
|
||||
uint8_t donor_val = !!(flag & KSW_EZ_SPLICE_FOR) == !(flag & KSW_EZ_REV_CIGAR)? 0 : 1;
|
||||
for (t = 0; t < tlen - 1; ++t)
|
||||
((int8_t*)donor)[t] += junc[t+1] == 0xff || (junc[t+1]&1) != donor_val? -junc_pen : (int8_t)(junc[t+1]>>1) - (int8_t)KSW_SPSC_OFFSET;
|
||||
for (t = 0; t < tlen - 1; ++t)
|
||||
((int8_t*)acceptor)[t] += junc[t+1] == 0xff || (junc[t+1]&1) != !donor_val? -junc_pen : (int8_t)(junc[t+1]>>1) - (int8_t)KSW_SPSC_OFFSET;
|
||||
//for (t = 0; t < tlen - 1; ++t) if (junc[t+1] != 0xff) fprintf(stderr, "Y2\t%d\t%d\t%c\t%d\n", ((int8_t*)donor)[t], ((int8_t*)acceptor)[t], "DA"[junc[t+1]&1], (int8_t)(junc[t+1]>>1) - (int8_t)KSW_SPSC_OFFSET);
|
||||
} else if (junc) { // junc[] keeps the splice sites
|
||||
if (!(flag & KSW_EZ_REV_CIGAR)) {
|
||||
for (t = 0; t < tlen - 1; ++t)
|
||||
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t+1]&1)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t+1]&8)))
|
||||
((int8_t*)donor)[t] += junc_bonus;
|
||||
for (t = 0; t < tlen; ++t)
|
||||
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t]&2)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t]&4)))
|
||||
((int8_t*)acceptor)[t] += junc_bonus;
|
||||
} else {
|
||||
for (t = 0; t < tlen - 1; ++t)
|
||||
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t+1]&2)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t+1]&4)))
|
||||
((int8_t*)donor)[t] += junc_bonus;
|
||||
for (t = 0; t < tlen; ++t)
|
||||
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t]&1)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t]&8)))
|
||||
((int8_t*)acceptor)[t] += junc_bonus;
|
||||
}
|
||||
}
|
||||
|
||||
@@ -376,7 +422,7 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
} else H[0] = v8[0] - qe, max_H = H[0], max_t = 0; // special casing r==0
|
||||
// update ez
|
||||
if (en0 == tlen - 1 && H[en0] > ez->mte)
|
||||
ez->mte = H[en0], ez->mte_q = r - en;
|
||||
ez->mte = H[en0], ez->mte_q = r - en0;
|
||||
if (r - st0 == qlen - 1 && H[st0] > ez->mqe)
|
||||
ez->mqe = H[st0], ez->mqe_t = st0;
|
||||
if (ksw_apply_zdrop(ez, 1, max_H, r, max_t, zdrop, 0)) break;
|
||||
@@ -406,10 +452,14 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
if (!approx_max) kfree(km, H);
|
||||
if (with_cigar) { // backtrack
|
||||
int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
|
||||
if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY))
|
||||
if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY)) {
|
||||
ksw_backtrack(km, 1, rev_cigar, long_thres, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||
else if (ez->max_t >= 0 && ez->max_q >= 0)
|
||||
} else if (!ez->zdropped && (flag&KSW_EZ_EXTZ_ONLY) && ez->mqe + end_bonus > (int)ez->max) {
|
||||
ez->reach_end = 1;
|
||||
ksw_backtrack(km, 1, rev_cigar, long_thres, (uint8_t*)p, off, off_end, n_col_*16, ez->mqe_t, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||
} else if (ez->max_t >= 0 && ez->max_q >= 0) {
|
||||
ksw_backtrack(km, 1, rev_cigar, long_thres, (uint8_t*)p, off, off_end, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||
}
|
||||
kfree(km, mem2); kfree(km, off);
|
||||
}
|
||||
}
|
||||
|
||||
+1
-1
@@ -269,7 +269,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
} else H[0] = v8[0] - qe - qe, max_H = H[0], max_t = 0; // special casing r==0
|
||||
// update ez
|
||||
if (en0 == tlen - 1 && H[en0] > ez->mte)
|
||||
ez->mte = H[en0], ez->mte_q = r - en;
|
||||
ez->mte = H[en0], ez->mte_q = r - en0;
|
||||
if (r - st0 == qlen - 1 && H[st0] > ez->mqe)
|
||||
ez->mqe = H[st0], ez->mqe_t = st0;
|
||||
if (ksw_apply_zdrop(ez, 1, max_H, r, max_t, zdrop, e)) break;
|
||||
|
||||
@@ -0,0 +1,368 @@
|
||||
#include <stdint.h>
|
||||
#include <string.h>
|
||||
#include <stdio.h>
|
||||
#include <assert.h>
|
||||
#include "mmpriv.h"
|
||||
#include "kalloc.h"
|
||||
#include "krmq.h"
|
||||
|
||||
static int64_t mg_chain_bk_end(int32_t max_drop, const mm128_t *z, const int32_t *f, const int64_t *p, int32_t *t, int64_t k)
|
||||
{
|
||||
int64_t i = z[k].y, end_i = -1, max_i = i;
|
||||
int32_t max_s = 0;
|
||||
if (i < 0 || t[i] != 0) return i;
|
||||
do {
|
||||
int32_t s;
|
||||
t[i] = 2;
|
||||
end_i = i = p[i];
|
||||
s = i < 0? z[k].x : (int32_t)z[k].x - f[i];
|
||||
if (s > max_s) max_s = s, max_i = i;
|
||||
else if (max_s - s > max_drop) break;
|
||||
} while (i >= 0 && t[i] == 0);
|
||||
for (i = z[k].y; i >= 0 && i != end_i; i = p[i]) // reset modified t[]
|
||||
t[i] = 0;
|
||||
return max_i;
|
||||
}
|
||||
|
||||
uint64_t *mg_chain_backtrack(void *km, int64_t n, const int32_t *f, const int64_t *p, int32_t *v, int32_t *t, int32_t min_cnt, int32_t min_sc, int32_t max_drop, int32_t *n_u_, int32_t *n_v_)
|
||||
{
|
||||
mm128_t *z;
|
||||
uint64_t *u;
|
||||
int64_t i, k, n_z, n_v;
|
||||
int32_t n_u;
|
||||
|
||||
*n_u_ = *n_v_ = 0;
|
||||
for (i = 0, n_z = 0; i < n; ++i) // precompute n_z
|
||||
if (f[i] >= min_sc) ++n_z;
|
||||
if (n_z == 0) return 0;
|
||||
z = Kmalloc(km, mm128_t, n_z);
|
||||
for (i = 0, k = 0; i < n; ++i) // populate z[]
|
||||
if (f[i] >= min_sc) z[k].x = f[i], z[k++].y = i;
|
||||
radix_sort_128x(z, z + n_z);
|
||||
|
||||
memset(t, 0, n * 4);
|
||||
for (k = n_z - 1, n_v = n_u = 0; k >= 0; --k) { // precompute n_u
|
||||
if (t[z[k].y] == 0) {
|
||||
int64_t n_v0 = n_v, end_i;
|
||||
int32_t sc;
|
||||
end_i = mg_chain_bk_end(max_drop, z, f, p, t, k);
|
||||
for (i = z[k].y; i != end_i; i = p[i])
|
||||
++n_v, t[i] = 1;
|
||||
sc = i < 0? z[k].x : (int32_t)z[k].x - f[i];
|
||||
if (sc >= min_sc && n_v > n_v0 && n_v - n_v0 >= min_cnt)
|
||||
++n_u;
|
||||
else n_v = n_v0;
|
||||
}
|
||||
}
|
||||
u = Kmalloc(km, uint64_t, n_u);
|
||||
memset(t, 0, n * 4);
|
||||
for (k = n_z - 1, n_v = n_u = 0; k >= 0; --k) { // populate u[]
|
||||
if (t[z[k].y] == 0) {
|
||||
int64_t n_v0 = n_v, end_i;
|
||||
int32_t sc;
|
||||
end_i = mg_chain_bk_end(max_drop, z, f, p, t, k);
|
||||
for (i = z[k].y; i != end_i; i = p[i])
|
||||
v[n_v++] = i, t[i] = 1;
|
||||
sc = i < 0? z[k].x : (int32_t)z[k].x - f[i];
|
||||
if (sc >= min_sc && n_v > n_v0 && n_v - n_v0 >= min_cnt)
|
||||
u[n_u++] = (uint64_t)sc << 32 | (n_v - n_v0);
|
||||
else n_v = n_v0;
|
||||
}
|
||||
}
|
||||
kfree(km, z);
|
||||
assert(n_v < INT32_MAX);
|
||||
*n_u_ = n_u, *n_v_ = n_v;
|
||||
return u;
|
||||
}
|
||||
|
||||
static mm128_t *compact_a(void *km, int32_t n_u, uint64_t *u, int32_t n_v, int32_t *v, mm128_t *a)
|
||||
{
|
||||
mm128_t *b, *w;
|
||||
uint64_t *u2;
|
||||
int64_t i, j, k;
|
||||
|
||||
// write the result to b[]
|
||||
b = Kmalloc(km, mm128_t, n_v);
|
||||
for (i = 0, k = 0; i < n_u; ++i) {
|
||||
int32_t k0 = k, ni = (int32_t)u[i];
|
||||
for (j = 0; j < ni; ++j)
|
||||
b[k++] = a[v[k0 + (ni - j - 1)]];
|
||||
}
|
||||
kfree(km, v);
|
||||
|
||||
// sort u[] and a[] by the target position, such that adjacent chains may be joined
|
||||
w = Kmalloc(km, mm128_t, n_u);
|
||||
for (i = k = 0; i < n_u; ++i) {
|
||||
w[i].x = b[k].x, w[i].y = (uint64_t)k<<32|i;
|
||||
k += (int32_t)u[i];
|
||||
}
|
||||
radix_sort_128x(w, w + n_u);
|
||||
u2 = Kmalloc(km, uint64_t, n_u);
|
||||
for (i = k = 0; i < n_u; ++i) {
|
||||
int32_t j = (int32_t)w[i].y, n = (int32_t)u[j];
|
||||
u2[i] = u[j];
|
||||
memcpy(&a[k], &b[w[i].y>>32], n * sizeof(mm128_t));
|
||||
k += n;
|
||||
}
|
||||
memcpy(u, u2, n_u * 8);
|
||||
memcpy(b, a, k * sizeof(mm128_t)); // write _a_ to _b_ and deallocate _a_ because _a_ is oversized, sometimes a lot
|
||||
kfree(km, a); kfree(km, w); kfree(km, u2);
|
||||
return b;
|
||||
}
|
||||
|
||||
static inline int32_t comput_sc(const mm128_t *ai, const mm128_t *aj, int32_t max_dist_x, int32_t max_dist_y, int32_t bw, float chn_pen_gap, float chn_pen_skip, int is_cdna, int n_seg)
|
||||
{
|
||||
int32_t dq = (int32_t)ai->y - (int32_t)aj->y, dr, dd, dg, q_span, sc;
|
||||
int32_t sidi = (ai->y & MM_SEED_SEG_MASK) >> MM_SEED_SEG_SHIFT;
|
||||
int32_t sidj = (aj->y & MM_SEED_SEG_MASK) >> MM_SEED_SEG_SHIFT;
|
||||
if (dq <= 0 || dq > max_dist_x) return INT32_MIN;
|
||||
dr = (int32_t)(ai->x - aj->x);
|
||||
if (sidi == sidj && (dr == 0 || dq > max_dist_y)) return INT32_MIN;
|
||||
dd = dr > dq? dr - dq : dq - dr;
|
||||
if (sidi == sidj && dd > bw) return INT32_MIN;
|
||||
if (n_seg > 1 && !is_cdna && sidi == sidj && dr > max_dist_y) return INT32_MIN;
|
||||
dg = dr < dq? dr : dq;
|
||||
q_span = aj->y>>32&0xff;
|
||||
sc = q_span < dg? q_span : dg;
|
||||
if (dd || dg > q_span) {
|
||||
float lin_pen, log_pen;
|
||||
lin_pen = chn_pen_gap * (float)dd + chn_pen_skip * (float)dg;
|
||||
log_pen = dd >= 1? mg_log2(dd + 1) : 0.0f; // mg_log2() only works for dd>=2
|
||||
if (is_cdna || sidi != sidj) {
|
||||
if (sidi != sidj && dr == 0) ++sc; // possibly due to overlapping paired ends; give a minor bonus
|
||||
else if (dr > dq || sidi != sidj) sc -= (int)(lin_pen < log_pen? lin_pen : log_pen); // deletion or jump between paired ends
|
||||
else sc -= (int)(lin_pen + .5f * log_pen);
|
||||
} else sc -= (int)(lin_pen + .5f * log_pen);
|
||||
}
|
||||
return sc;
|
||||
}
|
||||
|
||||
/* Input:
|
||||
* a[].x: rev<<63 | tid<<32 | tpos
|
||||
* a[].y: flags<<40 | q_span<<32 | q_pos
|
||||
* Output:
|
||||
* n_u: #chains
|
||||
* u[]: score<<32 | #anchors (sum of lower 32 bits of u[] is the returned length of a[])
|
||||
* input a[] is deallocated on return
|
||||
*/
|
||||
mm128_t *mg_lchain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int max_iter, int min_cnt, int min_sc, float chn_pen_gap, float chn_pen_skip,
|
||||
int is_cdna, int n_seg, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km)
|
||||
{ // TODO: make sure this works when n has more than 32 bits
|
||||
int32_t *f, *t, *v, n_u, n_v, mmax_f = 0, max_drop = bw;
|
||||
int64_t *p, i, j, max_ii, st = 0;
|
||||
uint64_t *u;
|
||||
|
||||
if (_u) *_u = 0, *n_u_ = 0;
|
||||
if (n == 0 || a == 0) {
|
||||
kfree(km, a);
|
||||
return 0;
|
||||
}
|
||||
if (max_dist_x < bw) max_dist_x = bw;
|
||||
if (max_dist_y < bw && !is_cdna) max_dist_y = bw;
|
||||
if (is_cdna) max_drop = INT32_MAX;
|
||||
p = Kmalloc(km, int64_t, n);
|
||||
f = Kmalloc(km, int32_t, n);
|
||||
v = Kmalloc(km, int32_t, n);
|
||||
t = Kcalloc(km, int32_t, n);
|
||||
|
||||
// fill the score and backtrack arrays
|
||||
for (i = 0, max_ii = -1; i < n; ++i) {
|
||||
int64_t max_j = -1, end_j;
|
||||
int32_t max_f = a[i].y>>32&0xff, n_skip = 0;
|
||||
while (st < i && (a[i].x>>32 != a[st].x>>32 || a[i].x > a[st].x + max_dist_x)) ++st;
|
||||
if (i - st > max_iter) st = i - max_iter;
|
||||
for (j = i - 1; j >= st; --j) {
|
||||
int32_t sc;
|
||||
sc = comput_sc(&a[i], &a[j], max_dist_x, max_dist_y, bw, chn_pen_gap, chn_pen_skip, is_cdna, n_seg);
|
||||
if (sc == INT32_MIN) continue;
|
||||
sc += f[j];
|
||||
if (sc > max_f) {
|
||||
max_f = sc, max_j = j;
|
||||
if (n_skip > 0) --n_skip;
|
||||
} else if (t[j] == (int32_t)i) {
|
||||
if (++n_skip > max_skip)
|
||||
break;
|
||||
}
|
||||
if (p[j] >= 0) t[p[j]] = i;
|
||||
}
|
||||
end_j = j;
|
||||
if (max_ii < 0 || a[i].x - a[max_ii].x > (int64_t)max_dist_x) {
|
||||
int32_t max = INT32_MIN;
|
||||
max_ii = -1;
|
||||
for (j = i - 1; j >= st; --j)
|
||||
if (max < f[j]) max = f[j], max_ii = j;
|
||||
}
|
||||
if (max_ii >= 0 && max_ii < end_j) {
|
||||
int32_t tmp;
|
||||
tmp = comput_sc(&a[i], &a[max_ii], max_dist_x, max_dist_y, bw, chn_pen_gap, chn_pen_skip, is_cdna, n_seg);
|
||||
if (tmp != INT32_MIN && max_f < tmp + f[max_ii])
|
||||
max_f = tmp + f[max_ii], max_j = max_ii;
|
||||
}
|
||||
f[i] = max_f, p[i] = max_j;
|
||||
v[i] = max_j >= 0 && v[max_j] > max_f? v[max_j] : max_f; // v[] keeps the peak score up to i; f[] is the score ending at i, not always the peak
|
||||
if (max_ii < 0 || (a[i].x - a[max_ii].x <= (int64_t)max_dist_x && f[max_ii] < f[i]))
|
||||
max_ii = i;
|
||||
if (mmax_f < max_f) mmax_f = max_f;
|
||||
//fprintf(stderr, "X1\t%ld\t%ld:%d\t%ld\t%ld:%d\t%ld\t%ld\n", (long)i, (long)(a[i].x>>32), (int32_t)a[i].x, (long)max_j, max_j<0?-1L:(long)(a[max_j].x>>32), max_j<0?-1:(int32_t)a[max_j].x, (long)max_f, (long)v[i]);
|
||||
}
|
||||
|
||||
u = mg_chain_backtrack(km, n, f, p, v, t, min_cnt, min_sc, max_drop, &n_u, &n_v);
|
||||
*n_u_ = n_u, *_u = u; // NB: note that u[] may not be sorted by score here
|
||||
kfree(km, p); kfree(km, f); kfree(km, t);
|
||||
if (n_u == 0) {
|
||||
kfree(km, a); kfree(km, v);
|
||||
return 0;
|
||||
}
|
||||
return compact_a(km, n_u, u, n_v, v, a);
|
||||
}
|
||||
|
||||
typedef struct lc_elem_s {
|
||||
int32_t y;
|
||||
int64_t i;
|
||||
double pri;
|
||||
KRMQ_HEAD(struct lc_elem_s) head;
|
||||
} lc_elem_t;
|
||||
|
||||
#define lc_elem_cmp(a, b) ((a)->y < (b)->y? -1 : (a)->y > (b)->y? 1 : ((a)->i > (b)->i) - ((a)->i < (b)->i))
|
||||
#define lc_elem_lt2(a, b) ((a)->pri < (b)->pri)
|
||||
KRMQ_INIT(lc_elem, lc_elem_t, head, lc_elem_cmp, lc_elem_lt2)
|
||||
|
||||
KALLOC_POOL_INIT(rmq, lc_elem_t)
|
||||
|
||||
static inline int32_t comput_sc_simple(const mm128_t *ai, const mm128_t *aj, float chn_pen_gap, float chn_pen_skip, int32_t *exact, int32_t *width)
|
||||
{
|
||||
int32_t dq = (int32_t)ai->y - (int32_t)aj->y, dr, dd, dg, q_span, sc;
|
||||
dr = (int32_t)(ai->x - aj->x);
|
||||
*width = dd = dr > dq? dr - dq : dq - dr;
|
||||
dg = dr < dq? dr : dq;
|
||||
q_span = aj->y>>32&0xff;
|
||||
sc = q_span < dg? q_span : dg;
|
||||
if (exact) *exact = (dd == 0 && dg <= q_span);
|
||||
if (dd || dq > q_span) {
|
||||
float lin_pen, log_pen;
|
||||
lin_pen = chn_pen_gap * (float)dd + chn_pen_skip * (float)dg;
|
||||
log_pen = dd >= 1? mg_log2(dd + 1) : 0.0f; // mg_log2() only works for dd>=2
|
||||
sc -= (int)(lin_pen + .5f * log_pen);
|
||||
}
|
||||
return sc;
|
||||
}
|
||||
|
||||
mm128_t *mg_lchain_rmq(int max_dist, int max_dist_inner, int bw, int max_chn_skip, int cap_rmq_size, int min_cnt, int min_sc, float chn_pen_gap, float chn_pen_skip,
|
||||
int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km)
|
||||
{
|
||||
int32_t *f,*t, *v, n_u, n_v, mmax_f = 0, max_rmq_size = 0, max_drop = bw;
|
||||
int64_t *p, i, i0, st = 0, st_inner = 0;
|
||||
uint64_t *u;
|
||||
lc_elem_t *root = 0, *root_inner = 0;
|
||||
void *mem_mp = 0;
|
||||
kmp_rmq_t *mp;
|
||||
|
||||
if (_u) *_u = 0, *n_u_ = 0;
|
||||
if (n == 0 || a == 0) {
|
||||
kfree(km, a);
|
||||
return 0;
|
||||
}
|
||||
if (max_dist < bw) max_dist = bw;
|
||||
if (max_dist_inner < 0) max_dist_inner = 0;
|
||||
if (max_dist_inner > max_dist) max_dist_inner = max_dist;
|
||||
p = Kmalloc(km, int64_t, n);
|
||||
f = Kmalloc(km, int32_t, n);
|
||||
t = Kcalloc(km, int32_t, n);
|
||||
v = Kmalloc(km, int32_t, n);
|
||||
mem_mp = km_init2(km, 0x10000);
|
||||
mp = kmp_init_rmq(mem_mp);
|
||||
|
||||
// fill the score and backtrack arrays
|
||||
for (i = i0 = 0; i < n; ++i) {
|
||||
int64_t max_j = -1;
|
||||
int32_t q_span = a[i].y>>32&0xff, max_f = q_span;
|
||||
lc_elem_t s, *q, *r, lo, hi;
|
||||
// add in-range anchors
|
||||
if (i0 < i && a[i0].x != a[i].x) {
|
||||
int64_t j;
|
||||
for (j = i0; j < i; ++j) {
|
||||
q = kmp_alloc_rmq(mp);
|
||||
q->y = (int32_t)a[j].y, q->i = j, q->pri = -(f[j] + 0.5 * chn_pen_gap * ((int32_t)a[j].x + (int32_t)a[j].y));
|
||||
krmq_insert(lc_elem, &root, q, 0);
|
||||
if (max_dist_inner > 0) {
|
||||
r = kmp_alloc_rmq(mp);
|
||||
*r = *q;
|
||||
krmq_insert(lc_elem, &root_inner, r, 0);
|
||||
}
|
||||
}
|
||||
i0 = i;
|
||||
}
|
||||
// get rid of active chains out of range
|
||||
while (st < i && (a[i].x>>32 != a[st].x>>32 || a[i].x > a[st].x + max_dist || krmq_size(head, root) > cap_rmq_size)) {
|
||||
s.y = (int32_t)a[st].y, s.i = st;
|
||||
if ((q = krmq_find(lc_elem, root, &s, 0)) != 0) {
|
||||
q = krmq_erase(lc_elem, &root, q, 0);
|
||||
kmp_free_rmq(mp, q);
|
||||
}
|
||||
++st;
|
||||
}
|
||||
if (max_dist_inner > 0) { // similar to the block above, but applied to the inner tree
|
||||
while (st_inner < i && (a[i].x>>32 != a[st_inner].x>>32 || a[i].x > a[st_inner].x + max_dist_inner || krmq_size(head, root_inner) > cap_rmq_size)) {
|
||||
s.y = (int32_t)a[st_inner].y, s.i = st_inner;
|
||||
if ((q = krmq_find(lc_elem, root_inner, &s, 0)) != 0) {
|
||||
q = krmq_erase(lc_elem, &root_inner, q, 0);
|
||||
kmp_free_rmq(mp, q);
|
||||
}
|
||||
++st_inner;
|
||||
}
|
||||
}
|
||||
// RMQ
|
||||
lo.i = INT32_MAX, lo.y = (int32_t)a[i].y - max_dist;
|
||||
hi.i = 0, hi.y = (int32_t)a[i].y;
|
||||
if ((q = krmq_rmq(lc_elem, root, &lo, &hi)) != 0) {
|
||||
int32_t sc, exact, width, n_skip = 0;
|
||||
int64_t j = q->i;
|
||||
assert(q->y >= lo.y && q->y <= hi.y);
|
||||
sc = f[j] + comput_sc_simple(&a[i], &a[j], chn_pen_gap, chn_pen_skip, &exact, &width);
|
||||
if (width <= bw && sc > max_f) max_f = sc, max_j = j;
|
||||
if (!exact && root_inner && (int32_t)a[i].y > 0) {
|
||||
lc_elem_t *lo, *hi;
|
||||
s.y = (int32_t)a[i].y - 1, s.i = n;
|
||||
krmq_interval(lc_elem, root_inner, &s, &lo, &hi);
|
||||
if (lo) {
|
||||
const lc_elem_t *q;
|
||||
int32_t width;
|
||||
krmq_itr_t(lc_elem) itr;
|
||||
krmq_itr_find(lc_elem, root_inner, lo, &itr);
|
||||
while ((q = krmq_at(&itr)) != 0) {
|
||||
if (q->y < (int32_t)a[i].y - max_dist_inner) break;
|
||||
j = q->i;
|
||||
sc = f[j] + comput_sc_simple(&a[i], &a[j], chn_pen_gap, chn_pen_skip, 0, &width);
|
||||
if (width <= bw) {
|
||||
if (sc > max_f) {
|
||||
max_f = sc, max_j = j;
|
||||
if (n_skip > 0) --n_skip;
|
||||
} else if (t[j] == (int32_t)i) {
|
||||
if (++n_skip > max_chn_skip)
|
||||
break;
|
||||
}
|
||||
if (p[j] >= 0) t[p[j]] = i;
|
||||
}
|
||||
if (!krmq_itr_prev(lc_elem, &itr)) break;
|
||||
}
|
||||
}
|
||||
}
|
||||
}
|
||||
// set max
|
||||
assert(max_j < 0 || (a[max_j].x < a[i].x && (int32_t)a[max_j].y < (int32_t)a[i].y));
|
||||
f[i] = max_f, p[i] = max_j;
|
||||
v[i] = max_j >= 0 && v[max_j] > max_f? v[max_j] : max_f; // v[] keeps the peak score up to i; f[] is the score ending at i, not always the peak
|
||||
if (mmax_f < max_f) mmax_f = max_f;
|
||||
if (max_rmq_size < krmq_size(head, root)) max_rmq_size = krmq_size(head, root);
|
||||
}
|
||||
km_destroy(mem_mp);
|
||||
|
||||
u = mg_chain_backtrack(km, n, f, p, v, t, min_cnt, min_sc, max_drop, &n_u, &n_v);
|
||||
*n_u_ = n_u, *_u = u; // NB: note that u[] may not be sorted by score here
|
||||
kfree(km, p); kfree(km, f); kfree(km, t);
|
||||
if (n_u == 0) {
|
||||
kfree(km, a); kfree(km, v);
|
||||
return 0;
|
||||
}
|
||||
return compact_a(km, n_u, u, n_v, v, a);
|
||||
}
|
||||
@@ -1,54 +1,11 @@
|
||||
/* The MIT License
|
||||
|
||||
Copyright (c) 2018- Dana-Farber Cancer Institute
|
||||
2017-2018 Broad Institute, Inc.
|
||||
|
||||
Permission is hereby granted, free of charge, to any person obtaining
|
||||
a copy of this software and associated documentation files (the
|
||||
"Software"), to deal in the Software without restriction, including
|
||||
without limitation the rights to use, copy, modify, merge, publish,
|
||||
distribute, sublicense, and/or sell copies of the Software, and to
|
||||
permit persons to whom the Software is furnished to do so, subject to
|
||||
the following conditions:
|
||||
|
||||
The above copyright notice and this permission notice shall be
|
||||
included in all copies or substantial portions of the Software.
|
||||
|
||||
THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
|
||||
EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
|
||||
MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
|
||||
NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS
|
||||
BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN
|
||||
ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN
|
||||
CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
|
||||
SOFTWARE.
|
||||
Modified Copyright (C) 2021 Intel Corporation
|
||||
Contacts: Saurabh Kalikar <saurabh.kalikar@intel.com>;
|
||||
Vasimuddin Md <vasimuddin.md@intel.com>; Sanchit Misra <sanchit.misra@intel.com>;
|
||||
Chirag Jain <chirag@iisc.ac.in>; Heng Li <hli@jimmy.harvard.edu>
|
||||
*/
|
||||
#include <stdlib.h>
|
||||
#include <stdio.h>
|
||||
#include <string.h>
|
||||
#include <string>
|
||||
#include <errno.h>
|
||||
#include "bseq.h"
|
||||
#include "minimap.h"
|
||||
#include "mmpriv.h"
|
||||
#include "ketopt.h"
|
||||
#include <x86intrin.h>
|
||||
|
||||
#define MM_VERSION "2.18-r1015"
|
||||
using namespace std;
|
||||
|
||||
#ifdef MANUAL_PROFILING
|
||||
uint64_t num_reads = 0, minimizer_hit_time = 0, dp_chaining_time = 0, alignment_time = 0;
|
||||
#endif
|
||||
|
||||
#ifdef LISA_HASH
|
||||
#include "lisa_hash.h"
|
||||
lisa_hash<uint64_t, uint64_t> *lh;
|
||||
#endif
|
||||
|
||||
#ifdef __linux__
|
||||
#include <sys/resource.h>
|
||||
@@ -78,12 +35,12 @@ static ko_longopt_t long_options[] = {
|
||||
{ "splice", ko_no_argument, 310 },
|
||||
{ "cost-non-gt-ag", ko_required_argument, 'C' },
|
||||
{ "no-long-join", ko_no_argument, 312 },
|
||||
{ "sr", ko_no_argument, 313 },
|
||||
{ "sr", ko_optional_argument, 313 },
|
||||
{ "frag", ko_required_argument, 314 },
|
||||
{ "secondary", ko_required_argument, 315 },
|
||||
{ "cs", ko_optional_argument, 316 },
|
||||
{ "end-bonus", ko_required_argument, 317 },
|
||||
{ "no-pairing", ko_no_argument, 318 },
|
||||
{ "no-pairing", ko_no_argument, 318 }, // deprecated but reserved for backward compatibility
|
||||
{ "splice-flank", ko_required_argument, 319 },
|
||||
{ "idx-no-seq", ko_no_argument, 320 },
|
||||
{ "end-seed-pen", ko_required_argument, 321 },
|
||||
@@ -112,6 +69,25 @@ static ko_longopt_t long_options[] = {
|
||||
{ "alt", ko_required_argument, 344 },
|
||||
{ "alt-drop", ko_required_argument, 345 },
|
||||
{ "mask-len", ko_required_argument, 346 },
|
||||
{ "rmq", ko_optional_argument, 347 },
|
||||
{ "qstrand", ko_no_argument, 348 },
|
||||
{ "cap-kalloc", ko_required_argument, 349 },
|
||||
{ "q-occ-frac", ko_required_argument, 350 },
|
||||
{ "chain-skip-scale",ko_required_argument,351 },
|
||||
{ "print-chains", ko_no_argument, 352 },
|
||||
{ "no-hash-name", ko_no_argument, 353 },
|
||||
{ "secondary-seq", ko_no_argument, 354 },
|
||||
{ "ds", ko_no_argument, 355 },
|
||||
{ "rmq-inner", ko_required_argument, 356 },
|
||||
{ "spsc", ko_required_argument, 357 },
|
||||
{ "junc-pen", ko_required_argument, 358 },
|
||||
{ "pairing", ko_required_argument, 359 },
|
||||
{ "jump-min-match", ko_required_argument, 360 },
|
||||
{ "write-junc", ko_no_argument, 361 },
|
||||
{ "pass1", ko_required_argument, 362 },
|
||||
{ "spsc-scale", ko_required_argument, 363 },
|
||||
{ "spsc0", ko_required_argument, 364 },
|
||||
{ "dbg-seed-occ", ko_no_argument, 501 },
|
||||
{ "help", ko_no_argument, 'h' },
|
||||
{ "max-intron-len", ko_required_argument, 'G' },
|
||||
{ "version", ko_no_argument, 'V' },
|
||||
@@ -123,18 +99,24 @@ static ko_longopt_t long_options[] = {
|
||||
{ 0, 0, 0 }
|
||||
};
|
||||
|
||||
static inline int64_t mm_parse_num(const char *str)
|
||||
static inline int64_t mm_parse_num2(const char *str, char **q)
|
||||
{
|
||||
double x;
|
||||
char *p;
|
||||
x = strtod(str, &p);
|
||||
if (*p == 'G' || *p == 'g') x *= 1e9;
|
||||
else if (*p == 'M' || *p == 'm') x *= 1e6;
|
||||
else if (*p == 'K' || *p == 'k') x *= 1e3;
|
||||
if (*p == 'G' || *p == 'g') x *= 1e9, ++p;
|
||||
else if (*p == 'M' || *p == 'm') x *= 1e6, ++p;
|
||||
else if (*p == 'K' || *p == 'k') x *= 1e3, ++p;
|
||||
if (q) *q = p;
|
||||
return (int64_t)(x + .499);
|
||||
}
|
||||
|
||||
static inline void yes_or_no(mm_mapopt_t *opt, int flag, int long_idx, const char *arg, int yes_to_set)
|
||||
static inline int64_t mm_parse_num(const char *str)
|
||||
{
|
||||
return mm_parse_num2(str, 0);
|
||||
}
|
||||
|
||||
static inline void yes_or_no(mm_mapopt_t *opt, int64_t flag, int long_idx, const char *arg, int yes_to_set)
|
||||
{
|
||||
if (yes_to_set) {
|
||||
if (strcmp(arg, "yes") == 0 || strcmp(arg, "y") == 0) opt->flag |= flag;
|
||||
@@ -149,40 +131,13 @@ static inline void yes_or_no(mm_mapopt_t *opt, int flag, int long_idx, const cha
|
||||
|
||||
int main(int argc, char *argv[])
|
||||
{
|
||||
#ifdef LISA_HASH
|
||||
#if VECTORIZE && __AVX512BW__
|
||||
fprintf(stderr, "Using LISA hash with AVX512-vectorized last-mile search.\n");
|
||||
#else
|
||||
fprintf(stderr, "Using LISA hash with sequential last-mile search.\n");
|
||||
#endif
|
||||
#else
|
||||
fprintf(stderr, "Using default hash lookup.\n");
|
||||
#endif
|
||||
|
||||
#if defined(VECTORIZED_CHAINING) && defined(__AVX512BW__)
|
||||
fprintf(stderr, "Using AVX512-vectorized chaining.\n");
|
||||
#else
|
||||
fprintf(stderr, "Using default chaining.\n");
|
||||
#endif
|
||||
|
||||
|
||||
#if defined (ALIGN_AVX) && (defined(__AVX512BW__) || (defined(__AVX2__) && defined(APPLY_AVX2)))
|
||||
#ifdef __AVX512BW__
|
||||
fprintf(stderr, "Using AVX512-vectorized alignment.\n");
|
||||
#elif __AVX2__
|
||||
fprintf(stderr, "Using AVX2-vectorized alignment.\n");
|
||||
#endif
|
||||
#else
|
||||
fprintf(stderr, "Using default SSE-vectorized alignment.\n");
|
||||
#endif
|
||||
|
||||
const char *opt_str = "2aSDw:k:K:t:r:f:Vv:g:G:I:d:XT:s:x:Hcp:M:n:z:A:B:O:E:m:N:Qu:R:hF:LC:yYPo:Z:";
|
||||
const char *opt_str = "2aSDw:k:K:t:r:f:Vv:g:G:I:d:XT:s:x:Hcp:M:n:z:A:B:b:O:E:m:N:Qu:R:hF:LC:yYPo:e:U:J:j:";
|
||||
ketopt_t o = KETOPT_INIT;
|
||||
mm_mapopt_t opt;
|
||||
mm_idxopt_t ipt;
|
||||
int i, c, n_threads = 3, n_parts, old_best_n = -1;
|
||||
uint64_t total_time = 0;
|
||||
char *fnw = 0, *rg = 0, *junc_bed = 0, *s, *alt_list = 0;
|
||||
float spsc_scale = 0.7f;
|
||||
char *fnw = 0, *rg = 0, *fn_bed_junc = 0, *fn_bed_jump = 0, *fn_bed_pass1 = 0, *fn_spsc = 0, *s, *alt_list = 0;
|
||||
FILE *fp_help = stderr;
|
||||
mm_idx_reader_t *idx_rdr;
|
||||
mm_idx_t *mi;
|
||||
@@ -190,13 +145,10 @@ int main(int argc, char *argv[])
|
||||
mm_verbose = 3;
|
||||
liftrlimit();
|
||||
mm_realtime0 = realtime();
|
||||
double mapping_time = realtime();
|
||||
mm_set_opt(0, &ipt, &opt);
|
||||
string preset_arg = "";
|
||||
|
||||
while ((c = ketopt(&o, argc, argv, 1, opt_str, long_options)) >= 0) { // test command line options and apply option -x/preset first
|
||||
if (c == 'x') {
|
||||
preset_arg += (string) o.arg;
|
||||
if (mm_set_opt(o.arg, &ipt, &opt) < 0) {
|
||||
fprintf(stderr, "[ERROR] unknown preset '%s'\n", o.arg);
|
||||
return 1;
|
||||
@@ -213,11 +165,9 @@ int main(int argc, char *argv[])
|
||||
|
||||
while ((c = ketopt(&o, argc, argv, 1, opt_str, long_options)) >= 0) {
|
||||
if (c == 'w') ipt.w = atoi(o.arg);
|
||||
else if (c == 'Z') opt.L_hash = atoi(o.arg);
|
||||
else if (c == 'k') ipt.k = atoi(o.arg);
|
||||
else if (c == 'H') ipt.flag |= MM_I_HPC;
|
||||
else if (c == 'd') fnw = o.arg; // the above are indexing related options, except -I
|
||||
else if (c == 'r') opt.bw = (int)mm_parse_num(o.arg);
|
||||
else if (c == 't') n_threads = atoi(o.arg);
|
||||
else if (c == 'v') mm_verbose = atoi(o.arg);
|
||||
else if (c == 'g') opt.max_gap = (int)mm_parse_num(o.arg);
|
||||
@@ -240,14 +190,22 @@ int main(int argc, char *argv[])
|
||||
else if (c == 'm') opt.min_chain_score = atoi(o.arg);
|
||||
else if (c == 'A') opt.a = atoi(o.arg);
|
||||
else if (c == 'B') opt.b = atoi(o.arg);
|
||||
else if (c == 'b') opt.transition = atoi(o.arg);
|
||||
else if (c == 's') opt.min_dp_max = atoi(o.arg);
|
||||
else if (c == 'C') opt.noncan = atoi(o.arg);
|
||||
else if (c == 'I') ipt.batch_size = mm_parse_num(o.arg);
|
||||
else if (c == 'K') opt.mini_batch_size = mm_parse_num(o.arg);
|
||||
else if (c == 'e') opt.occ_dist = mm_parse_num(o.arg);
|
||||
else if (c == 'R') rg = o.arg;
|
||||
else if (c == 'h') fp_help = stdout;
|
||||
else if (c == '2') opt.flag |= MM_F_2_IO_THREADS;
|
||||
else if (c == 'o') {
|
||||
else if (c == 'j') fn_bed_jump = o.arg;
|
||||
else if (c == 'J') {
|
||||
int t;
|
||||
t = atoi(o.arg);
|
||||
if (t == 0) opt.flag |= MM_F_SPLICE_OLD;
|
||||
else if (t == 1) opt.flag &= ~MM_F_SPLICE_OLD;
|
||||
} else if (c == 'o') {
|
||||
if (strcmp(o.arg, "-") != 0) {
|
||||
if (freopen(o.arg, "wb", stdout) == NULL) {
|
||||
fprintf(stderr, "[ERROR]\033[1;31m failed to write the output to file '%s'\033[0m: %s\n", o.arg, strerror(errno));
|
||||
@@ -266,9 +224,8 @@ int main(int argc, char *argv[])
|
||||
else if (c == 309) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_ALN_SEQ, n_threads = 1; // --print-aln-seq
|
||||
else if (c == 310) opt.flag |= MM_F_SPLICE; // --splice
|
||||
else if (c == 312) opt.flag |= MM_F_NO_LJOIN; // --no-long-join
|
||||
else if (c == 313) opt.flag |= MM_F_SR; // --sr
|
||||
else if (c == 317) opt.end_bonus = atoi(o.arg); // --end-bonus
|
||||
else if (c == 318) opt.flag |= MM_F_INDEPEND_SEG; // --no-pairing
|
||||
else if (c == 318) opt.flag |= MM_F_INDEPEND_SEG; // --no-pairing (deprecated)
|
||||
else if (c == 320) ipt.flag |= MM_I_NO_SEQ; // --idx-no-seq
|
||||
else if (c == 321) opt.anchor_ext_shift = atoi(o.arg); // --end-seed-pen
|
||||
else if (c == 322) opt.flag |= MM_F_FOR_ONLY; // --for-only
|
||||
@@ -276,7 +233,6 @@ int main(int argc, char *argv[])
|
||||
else if (c == 327) opt.max_clip_ratio = atof(o.arg); // --max-clip-ratio
|
||||
else if (c == 328) opt.min_mid_occ = atoi(o.arg); // --min-occ-floor
|
||||
else if (c == 329) opt.flag |= MM_F_OUT_MD; // --MD
|
||||
else if (c == 330) opt.min_join_flank_ratio = atof(o.arg); // --lj-min-ratio
|
||||
else if (c == 331) opt.sc_ambi = atoi(o.arg); // --score-N
|
||||
else if (c == 332) opt.flag |= MM_F_EQX; // --eqx
|
||||
else if (c == 333) opt.flag |= MM_F_PAF_NO_HIT; // --paf-no-hit
|
||||
@@ -285,14 +241,43 @@ int main(int argc, char *argv[])
|
||||
else if (c == 336) opt.flag |= MM_F_HARD_MLEVEL; // --hard-mask-level
|
||||
else if (c == 337) opt.max_sw_mat = mm_parse_num(o.arg); // --cap-sw-mat
|
||||
else if (c == 338) opt.max_qlen = mm_parse_num(o.arg); // --max-qlen
|
||||
else if (c == 340) junc_bed = o.arg; // --junc-bed
|
||||
else if (c == 340) fn_bed_junc = o.arg; // --junc-bed
|
||||
else if (c == 341) opt.junc_bonus = atoi(o.arg); // --junc-bonus
|
||||
else if (c == 342) opt.flag |= MM_F_SAM_HIT_ONLY; // --sam-hit-only
|
||||
else if (c == 343) opt.chain_gap_scale = atof(o.arg); // --chain-gap-scale
|
||||
else if (c == 351) opt.chain_skip_scale = atof(o.arg); // --chain-skip-scale
|
||||
else if (c == 344) alt_list = o.arg; // --alt
|
||||
else if (c == 345) opt.alt_drop = atof(o.arg); // --alt-drop
|
||||
else if (c == 346) opt.mask_len = mm_parse_num(o.arg); // --mask-len
|
||||
else if (c == 314) { // --frag
|
||||
else if (c == 348) opt.flag |= MM_F_QSTRAND | MM_F_NO_INV; // --qstrand
|
||||
else if (c == 349) opt.cap_kalloc = mm_parse_num(o.arg); // --cap-kalloc
|
||||
else if (c == 350) opt.q_occ_frac = atof(o.arg); // --q-occ-frac
|
||||
else if (c == 352) mm_dbg_flag |= MM_DBG_PRINT_CHAIN; // --print-chains
|
||||
else if (c == 353) opt.flag |= MM_F_NO_HASH_NAME; // --no-hash-name
|
||||
else if (c == 354) opt.flag |= MM_F_SECONDARY_SEQ; // --secondary-seq
|
||||
else if (c == 355) opt.flag |= MM_F_OUT_DS; // --ds
|
||||
else if (c == 356) opt.rmq_inner_dist = mm_parse_num(o.arg); // --rmq-inner
|
||||
else if (c == 357) fn_spsc = o.arg; // --spsc
|
||||
else if (c == 360) opt.jump_min_match = mm_parse_num(o.arg); // --jump-min-match
|
||||
else if (c == 361) opt.flag |= MM_F_OUT_JUNC | MM_F_CIGAR; // --write-junc
|
||||
else if (c == 362) fn_bed_pass1 = o.arg; // --jump-pass1
|
||||
else if (c == 501) mm_dbg_flag |= MM_DBG_SEED_FREQ; // --dbg-seed-occ
|
||||
else if (c == 363) spsc_scale = atof(o.arg); // --spsc-scale
|
||||
else if (c == 358 || c == 364) opt.junc_pen = atoi(o.arg); // --junc-pen or --spsc0
|
||||
else if (c == 330) {
|
||||
fprintf(stderr, "[WARNING] \033[1;31m --lj-min-ratio has been deprecated.\033[0m\n");
|
||||
} else if (c == 313) { // --sr
|
||||
if (o.arg == 0 || strcmp(o.arg, "dna") == 0) {
|
||||
opt.flag |= MM_F_SR;
|
||||
} else if (strcmp(o.arg, "rna") == 0) {
|
||||
opt.flag |= MM_F_SR_RNA;
|
||||
} else if (strcmp(o.arg, "no") == 0) {
|
||||
opt.flag &= ~(uint64_t)(MM_F_SR|MM_F_SR_RNA);
|
||||
} else if (mm_verbose >= 2) {
|
||||
opt.flag |= MM_F_SR;
|
||||
fprintf(stderr, "[WARNING]\033[1;31m --sr only takes 'dna' or 'rna'. Invalid values are assumed to be 'dna'.\033[0m\n");
|
||||
}
|
||||
} else if (c == 314) { // --frag
|
||||
yes_or_no(&opt, MM_F_FRAG_MODE, o.longidx, o.arg, 1);
|
||||
} else if (c == 315) { // --secondary
|
||||
yes_or_no(&opt, MM_F_NO_PRINT_2ND, o.longidx, o.arg, 0);
|
||||
@@ -313,6 +298,17 @@ int main(int argc, char *argv[])
|
||||
yes_or_no(&opt, MM_F_HEAP_SORT, o.longidx, o.arg, 1);
|
||||
} else if (c == 326) { // --dual
|
||||
yes_or_no(&opt, MM_F_NO_DUAL, o.longidx, o.arg, 0);
|
||||
} else if (c == 347) { // --rmq
|
||||
if (o.arg) yes_or_no(&opt, MM_F_RMQ, o.longidx, o.arg, 1);
|
||||
else opt.flag |= MM_F_RMQ;
|
||||
} else if (c == 359) { // --pairing
|
||||
if (strcmp(o.arg, "no") == 0) opt.flag |= MM_F_INDEPEND_SEG;
|
||||
else if (strcmp(o.arg, "weak") == 0) opt.flag |= MM_F_WEAK_PAIRING, opt.flag &= ~(uint64_t)MM_F_INDEPEND_SEG;
|
||||
else {
|
||||
if (strcmp(o.arg, "strong") != 0 && mm_verbose >= 2)
|
||||
fprintf(stderr, "[WARNING]\033[1;31m unrecognized argument for --pairing; assuming 'strong'.\033[0m\n");
|
||||
opt.flag &= ~(uint64_t)(MM_F_INDEPEND_SEG|MM_F_WEAK_PAIRING);
|
||||
}
|
||||
} else if (c == 'S') {
|
||||
opt.flag |= MM_F_OUT_CS | MM_F_CIGAR | MM_F_OUT_CS_LONG;
|
||||
if (mm_verbose >= 2)
|
||||
@@ -320,6 +316,12 @@ int main(int argc, char *argv[])
|
||||
} else if (c == 'V') {
|
||||
puts(MM_VERSION);
|
||||
return 0;
|
||||
} else if (c == 'r') {
|
||||
opt.bw = (int)mm_parse_num2(o.arg, &s);
|
||||
if (*s == ',') opt.bw_long = (int)mm_parse_num2(s + 1, &s);
|
||||
} else if (c == 'U') {
|
||||
opt.min_mid_occ = strtol(o.arg, &s, 10);
|
||||
if (*s == ',') opt.max_mid_occ = strtol(s + 1, &s, 10);
|
||||
} else if (c == 'f') {
|
||||
double x;
|
||||
char *p;
|
||||
@@ -347,10 +349,6 @@ int main(int argc, char *argv[])
|
||||
if (*s == ',') opt.e2 = strtol(s + 1, &s, 10);
|
||||
}
|
||||
}
|
||||
if ((opt.flag & MM_F_SPLICE) && (opt.flag & MM_F_FRAG_MODE)) {
|
||||
fprintf(stderr, "[ERROR]\033[1;31m --splice and --frag should not be specified at the same time.\033[0m\n");
|
||||
return 1;
|
||||
}
|
||||
if (!fnw && !(opt.flag&MM_F_CIGAR))
|
||||
ipt.flag |= MM_I_NO_SEQ;
|
||||
if (mm_check_opt(&ipt, &opt) < 0)
|
||||
@@ -367,14 +365,14 @@ int main(int argc, char *argv[])
|
||||
fprintf(fp_help, " -H use homopolymer-compressed k-mer (preferrable for PacBio)\n");
|
||||
fprintf(fp_help, " -k INT k-mer size (no larger than 28) [%d]\n", ipt.k);
|
||||
fprintf(fp_help, " -w INT minimizer window size [%d]\n", ipt.w);
|
||||
fprintf(fp_help, " -I NUM split index for every ~NUM input bases [4G]\n");
|
||||
fprintf(fp_help, " -I NUM split index for every ~NUM input bases [8G]\n");
|
||||
fprintf(fp_help, " -d FILE dump index to FILE []\n");
|
||||
fprintf(fp_help, " Mapping:\n");
|
||||
fprintf(fp_help, " -f FLOAT filter out top FLOAT fraction of repetitive minimizers [%g]\n", opt.mid_occ_frac);
|
||||
fprintf(fp_help, " -g NUM stop chain enlongation if there are no minimizers in INT-bp [%d]\n", opt.max_gap);
|
||||
fprintf(fp_help, " -G NUM max intron length (effective with -xsplice; changing -r) [200k]\n");
|
||||
fprintf(fp_help, " -F NUM max fragment length (effective with -xsr or in the fragment mode) [800]\n");
|
||||
fprintf(fp_help, " -r NUM bandwidth used in chaining and DP-based alignment [%d]\n", opt.bw);
|
||||
fprintf(fp_help, " -r NUM[,NUM] chaining/alignment bandwidth and long-join bandwidth [%d,%d]\n", opt.bw, opt.bw_long);
|
||||
fprintf(fp_help, " -n INT minimal number of minimizers on a chain [%d]\n", opt.min_cnt);
|
||||
fprintf(fp_help, " -m INT minimal chaining score (matching bases minus log gap penalty) [%d]\n", opt.min_chain_score);
|
||||
// fprintf(fp_help, " -T INT SDUST threshold; 0 to disable SDUST [%d]\n", opt.sdust_thres); // TODO: this option is never used; might be buggy
|
||||
@@ -383,12 +381,14 @@ int main(int argc, char *argv[])
|
||||
fprintf(fp_help, " -N INT retain at most INT secondary alignments [%d]\n", opt.best_n);
|
||||
fprintf(fp_help, " Alignment:\n");
|
||||
fprintf(fp_help, " -A INT matching score [%d]\n", opt.a);
|
||||
fprintf(fp_help, " -B INT mismatch penalty [%d]\n", opt.b);
|
||||
fprintf(fp_help, " -B INT mismatch penalty (larger value for lower divergence) [%d]\n", opt.b);
|
||||
fprintf(fp_help, " -O INT[,INT] gap open penalty [%d,%d]\n", opt.q, opt.q2);
|
||||
fprintf(fp_help, " -E INT[,INT] gap extension penalty; a k-long gap costs min{O1+k*E1,O2+k*E2} [%d,%d]\n", opt.e, opt.e2);
|
||||
fprintf(fp_help, " -z INT[,INT] Z-drop score and inversion Z-drop score [%d,%d]\n", opt.zdrop, opt.zdrop_inv);
|
||||
fprintf(fp_help, " -s INT minimal peak DP alignment score [%d]\n", opt.min_dp_max);
|
||||
fprintf(fp_help, " -u CHAR how to find GT-AG. f:transcript strand, b:both strands, n:don't match GT-AG [n]\n");
|
||||
fprintf(fp_help, " -J INT splice mode. 0: original minimap2 model; 1: miniprot model [1]\n");
|
||||
fprintf(fp_help, " -j FILE junctions in BED12 to extend *short* RNA-seq alignment []\n");
|
||||
fprintf(fp_help, " Input/Output:\n");
|
||||
fprintf(fp_help, " -a output in the SAM format (PAF by default)\n");
|
||||
fprintf(fp_help, " -o FILE output alignments to FILE [stdout]\n");
|
||||
@@ -396,20 +396,24 @@ int main(int argc, char *argv[])
|
||||
fprintf(fp_help, " -R STR SAM read group line in a format like '@RG\\tID:foo\\tSM:bar' []\n");
|
||||
fprintf(fp_help, " -c output CIGAR in PAF\n");
|
||||
fprintf(fp_help, " --cs[=STR] output the cs tag; STR is 'short' (if absent) or 'long' [none]\n");
|
||||
fprintf(fp_help, " --ds output the ds tag, which is an extension to cs\n");
|
||||
fprintf(fp_help, " --MD output the MD tag\n");
|
||||
fprintf(fp_help, " --eqx write =/X CIGAR operators\n");
|
||||
fprintf(fp_help, " -Y use soft clipping for supplementary alignments\n");
|
||||
fprintf(fp_help, " -y copy FASTA/Q comments to output SAM\n");
|
||||
fprintf(fp_help, " -t INT number of threads [%d]\n", n_threads);
|
||||
fprintf(fp_help, " -K NUM minibatch size for mapping [500M]\n");
|
||||
// fprintf(fp_help, " -v INT verbose level [%d]\n", mm_verbose);
|
||||
fprintf(fp_help, " --version show version number\n");
|
||||
fprintf(fp_help, " Preset:\n");
|
||||
fprintf(fp_help, " -x STR preset (always applied before other options; see minimap2.1 for details) []\n");
|
||||
fprintf(fp_help, " - map-pb/map-ont - PacBio/Nanopore vs reference mapping\n");
|
||||
fprintf(fp_help, " - ava-pb/ava-ont - PacBio/Nanopore read overlap\n");
|
||||
fprintf(fp_help, " - lr:hq - accurate long reads (error rate <1%%) against a reference genome\n");
|
||||
fprintf(fp_help, " - splice/splice:hq - spliced alignment for long reads/accurate long reads\n");
|
||||
fprintf(fp_help, " - splice:sr - spliced alignment for short RNA-seq reads\n");
|
||||
fprintf(fp_help, " - asm5/asm10/asm20 - asm-to-ref mapping, for ~0.1/1/5%% sequence divergence\n");
|
||||
fprintf(fp_help, " - splice/splice:hq - long-read/Pacbio-CCS spliced alignment\n");
|
||||
fprintf(fp_help, " - sr - genomic short-read mapping\n");
|
||||
fprintf(fp_help, " - sr - short reads against a reference\n");
|
||||
fprintf(fp_help, " - map-pb/map-hifi/map-ont/map-iclr - CLR/HiFi/Nanopore/ICLR vs reference mapping\n");
|
||||
fprintf(fp_help, " - ava-pb/ava-ont - PacBio CLR/Nanopore read overlap\n");
|
||||
fprintf(fp_help, "\nSee `man ./minimap2.1' for detailed description of these and other advanced command-line options.\n");
|
||||
return fp_help == stdout? 0 : 1;
|
||||
}
|
||||
@@ -418,12 +422,7 @@ int main(int argc, char *argv[])
|
||||
fprintf(stderr, "[ERROR] incorrect input: in the sr mode, please specify no more than two query files.\n");
|
||||
return 1;
|
||||
}
|
||||
|
||||
preset_arg = (string)argv[o.ind] + "_" + preset_arg + "_minimizers_key_value_sorted";
|
||||
|
||||
|
||||
idx_rdr = mm_idx_reader_open(argv[o.ind], &ipt, fnw);
|
||||
total_time = __rdtsc();
|
||||
if (idx_rdr == 0) {
|
||||
fprintf(stderr, "[ERROR] failed to open file '%s': %s\n", argv[o.ind], strerror(errno));
|
||||
return 1;
|
||||
@@ -465,25 +464,32 @@ int main(int argc, char *argv[])
|
||||
__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), mi->n_seq);
|
||||
if (argc != o.ind + 1) mm_mapopt_update(&opt, mi);
|
||||
if (mm_verbose >= 3) mm_idx_stat(mi);
|
||||
if(opt.L_hash == 1) {
|
||||
fprintf(stderr, "Generating lisa-hash..\n");
|
||||
mm_idx_dump_hash(preset_arg.c_str(), mi);
|
||||
fprintf(stderr, "Lisa-hash saving done.. \n");
|
||||
exit(0);
|
||||
if (fn_bed_junc) {
|
||||
mm_idx_bed_read(mi, fn_bed_junc, 1);
|
||||
if (mi->I == 0 && mm_verbose >= 2)
|
||||
fprintf(stderr, "[WARNING] failed to load the junction BED file\n");
|
||||
}
|
||||
if (fn_bed_jump) {
|
||||
mm_idx_jjump_read(mi, fn_bed_jump, MM_JUNC_ANNO, -1);
|
||||
if (mi->J == 0 && mm_verbose >= 2)
|
||||
fprintf(stderr, "[WARNING] failed to load the jump BED file\n");
|
||||
}
|
||||
if (fn_bed_pass1) {
|
||||
mm_idx_jjump_read(mi, fn_bed_pass1, MM_JUNC_MISC, 5);
|
||||
if (mi->J == 0 && mm_verbose >= 2)
|
||||
fprintf(stderr, "[WARNING] failed to load the pass-1 jump BED file\n");
|
||||
}
|
||||
if (fn_spsc) {
|
||||
mm_idx_spsc_read2(mi, fn_spsc, mm_max_spsc_bonus(&opt), spsc_scale);
|
||||
if (mi->spsc == 0 && mm_verbose >= 2)
|
||||
fprintf(stderr, "[WARNING] failed to load the splice score file\n");
|
||||
}
|
||||
if (junc_bed) mm_idx_bed_read(mi, junc_bed, 1);
|
||||
if (alt_list) mm_idx_alt_read(mi, alt_list);
|
||||
if (argc - (o.ind + 1) == 0) {
|
||||
mm_idx_destroy(mi);
|
||||
continue; // no query files
|
||||
}
|
||||
ret = 0;
|
||||
#ifdef LISA_HASH
|
||||
fprintf(stderr, "Using LISA_HASH..\n");
|
||||
mm_idx_destroy_mm_hash(mi);
|
||||
char* prefix;
|
||||
lh = new lisa_hash<uint64_t, uint64_t>(preset_arg, prefix);
|
||||
fprintf(stderr, "Loading done.\n");
|
||||
total_time = __rdtsc();
|
||||
fprintf(stderr, "\nIndexing Real time: %.3f sec;\n", realtime() - mapping_time);
|
||||
#endif
|
||||
mapping_time = realtime();
|
||||
if (!(opt.flag & MM_F_FRAG_MODE)) {
|
||||
for (i = o.ind + 1; i < argc; ++i) {
|
||||
ret = mm_map_file(mi, argv[i], &opt, n_threads);
|
||||
@@ -492,15 +498,11 @@ int main(int argc, char *argv[])
|
||||
} else {
|
||||
ret = mm_map_file_frag(mi, argc - (o.ind + 1), (const char**)&argv[o.ind + 1], &opt, n_threads);
|
||||
}
|
||||
mm_idx_destroy(mi);
|
||||
if (ret < 0) {
|
||||
fprintf(stderr, "ERROR: failed to map the query file\n");
|
||||
exit(EXIT_FAILURE);
|
||||
}
|
||||
#ifdef LISA_HASH
|
||||
mm_idx_destroy_seq(mi);
|
||||
#else
|
||||
mm_idx_destroy(mi);
|
||||
#endif
|
||||
}
|
||||
n_parts = idx_rdr->n_parts;
|
||||
mm_idx_reader_close(idx_rdr);
|
||||
@@ -520,14 +522,5 @@ int main(int argc, char *argv[])
|
||||
fprintf(stderr, " %s", argv[i]);
|
||||
fprintf(stderr, "\n[M::%s] Real time: %.3f sec; CPU: %.3f sec; Peak RSS: %.3f GB\n", __func__, realtime() - mm_realtime0, cputime(), peakrss() / 1024.0 / 1024.0 / 1024.0);
|
||||
}
|
||||
|
||||
#ifdef MANUAL_PROFILING
|
||||
fprintf(stderr, "\n Number of reads = %lld Minimizer hit time = %lld dp_chaining time = %lld alignment time = %lld total time = %lld \n", num_reads, minimizer_hit_time, dp_chaining_time, alignment_time, __rdtsc() - total_time);
|
||||
#endif
|
||||
fprintf(stderr, "Total ticks: %lld \n",__rdtsc() - total_time);
|
||||
fprintf(stderr, "\nMapping Real time: %.3f sec;\n", realtime() - mapping_time);
|
||||
#ifdef LISA_HASH
|
||||
delete lh;
|
||||
#endif
|
||||
return 0;
|
||||
return 0;
|
||||
}
|
||||
|
||||
@@ -1,32 +1,3 @@
|
||||
/* The MIT License
|
||||
|
||||
Copyright (c) 2018- Dana-Farber Cancer Institute
|
||||
2017-2018 Broad Institute, Inc.
|
||||
|
||||
Permission is hereby granted, free of charge, to any person obtaining
|
||||
a copy of this software and associated documentation files (the
|
||||
"Software"), to deal in the Software without restriction, including
|
||||
without limitation the rights to use, copy, modify, merge, publish,
|
||||
distribute, sublicense, and/or sell copies of the Software, and to
|
||||
permit persons to whom the Software is furnished to do so, subject to
|
||||
the following conditions:
|
||||
|
||||
The above copyright notice and this permission notice shall be
|
||||
included in all copies or substantial portions of the Software.
|
||||
|
||||
THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
|
||||
EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
|
||||
MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
|
||||
NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS
|
||||
BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN
|
||||
ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN
|
||||
CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
|
||||
SOFTWARE.
|
||||
Modified Copyright (C) 2021 Intel Corporation
|
||||
Contacts: Saurabh Kalikar <saurabh.kalikar@intel.com>;
|
||||
Vasimuddin Md <vasimuddin.md@intel.com>; Sanchit Misra <sanchit.misra@intel.com>;
|
||||
Chirag Jain <chirag@iisc.ac.in>; Heng Li <hli@jimmy.harvard.edu>
|
||||
*/
|
||||
#include <stdlib.h>
|
||||
#include <string.h>
|
||||
#include <assert.h>
|
||||
@@ -38,22 +9,6 @@ Modified Copyright (C) 2021 Intel Corporation
|
||||
#include "mmpriv.h"
|
||||
#include "bseq.h"
|
||||
#include "khash.h"
|
||||
#include <x86intrin.h>
|
||||
|
||||
#ifdef LISA_HASH
|
||||
#include "lisa_hash.h"
|
||||
extern lisa_hash<uint64_t, uint64_t> *lh;
|
||||
#endif
|
||||
|
||||
#ifdef MANUAL_PROFILING
|
||||
extern uint64_t num_reads, minimizer_hit_time, dp_chaining_time, alignment_time;
|
||||
#endif
|
||||
|
||||
|
||||
struct mm_tbuf_s {
|
||||
void *km;
|
||||
int rep_len, frag_gap;
|
||||
};
|
||||
|
||||
mm_tbuf_t *mm_tbuf_init(void)
|
||||
{
|
||||
@@ -120,120 +75,7 @@ static void collect_minimizers(void *km, const mm_mapopt_t *opt, const mm_idx_t
|
||||
#define heap_lt(a, b) ((a).x > (b).x)
|
||||
KSORT_INIT(heap, mm128_t, heap_lt)
|
||||
|
||||
typedef struct {
|
||||
uint32_t n;
|
||||
uint32_t q_pos, q_span;
|
||||
uint32_t seg_id:31, is_tandem:1;
|
||||
const uint64_t *cr;
|
||||
} mm_match_t;
|
||||
|
||||
|
||||
#ifdef LISA_HASH
|
||||
static mm_match_t *collect_matches_lisa_hash(void *km, int *_n_m, int max_occ, const mm_idx_t *mi, const mm128_v *mv, int64_t *n_a, int *rep_len, int *n_mini_pos, uint64_t **mini_pos)
|
||||
{
|
||||
uint64_t** cr_batch = (uint64_t**) malloc((mv->n)*sizeof(uint64_t*));
|
||||
int* t_batch = (int*)malloc((mv->n)*sizeof(int));
|
||||
uint64_t* minimizers = (uint64_t*) malloc((mv->n)*sizeof(uint64_t));
|
||||
int64_t* lisa_pos = (int64_t*) malloc((max(32, (int)mv->n))* sizeof(int64_t));
|
||||
|
||||
int rep_st = 0, rep_en = 0, n_m;
|
||||
size_t i;
|
||||
mm_match_t *m;
|
||||
*n_mini_pos = 0;
|
||||
*mini_pos = (uint64_t*)kmalloc(km, mv->n * sizeof(uint64_t));
|
||||
m = (mm_match_t*)kmalloc(km, mv->n * sizeof(mm_match_t));
|
||||
|
||||
for (i = 0; i < mv->n; i++) {
|
||||
mm128_t *p = &mv->a[i];
|
||||
minimizers[i] = p->x>>8;
|
||||
}
|
||||
|
||||
lh->mm_idx_get_batched(minimizers, mv->n, lisa_pos, cr_batch, t_batch);
|
||||
for (i = 0, n_m = 0, *rep_len = 0, *n_a = 0; i < mv->n; ++i) {
|
||||
const uint64_t *cr;
|
||||
mm128_t *p = &mv->a[i];
|
||||
uint32_t q_pos = (uint32_t)p->y, q_span = p->x & 0xff;
|
||||
int t;
|
||||
cr = cr_batch[i]; t = t_batch[i];
|
||||
/*Correctness check for lisa_hash*/
|
||||
#ifdef LISA_HASH_ASSERT
|
||||
int t_minimap2_original;
|
||||
const uint64_t *cr_minimap2_hash = mm_idx_get(mi, p->x>>8, &t);
|
||||
cr_minimap2_hash = mm_idx_get(mi, p->x>>8, &t_minimap2_original);
|
||||
assert(t == t_minimap2_original);
|
||||
#endif
|
||||
if (t >= max_occ) {
|
||||
|
||||
int en = (q_pos >> 1) + 1, st = en - q_span;
|
||||
if (st > rep_en) {
|
||||
*rep_len += rep_en - rep_st;
|
||||
rep_st = st, rep_en = en;
|
||||
} else rep_en = en;
|
||||
} else {
|
||||
#ifdef LISA_HASH_ASSERT
|
||||
//Correctness assertion
|
||||
for(int itr = 0; itr < t; itr++){
|
||||
assert((cr[itr] == cr_minimap2_hash[itr]));
|
||||
}
|
||||
#endif
|
||||
mm_match_t *q = &m[n_m++];
|
||||
q->q_pos = q_pos, q->q_span = q_span, q->cr = cr, q->n = t, q->seg_id = p->y >> 32;
|
||||
q->is_tandem = 0;
|
||||
if (i > 0 && p->x>>8 == mv->a[i - 1].x>>8) q->is_tandem = 1;
|
||||
if (i < mv->n - 1 && p->x>>8 == mv->a[i + 1].x>>8) q->is_tandem = 1;
|
||||
*n_a += q->n;
|
||||
(*mini_pos)[(*n_mini_pos)++] = (uint64_t)q_span<<32 | q_pos>>1;
|
||||
}
|
||||
}
|
||||
|
||||
free(cr_batch);
|
||||
free(t_batch);
|
||||
free(minimizers);
|
||||
free(lisa_pos);
|
||||
|
||||
*rep_len += rep_en - rep_st;
|
||||
*_n_m = n_m;
|
||||
return m;
|
||||
}
|
||||
#endif
|
||||
|
||||
|
||||
static mm_match_t *collect_matches(void *km, int *_n_m, int max_occ, const mm_idx_t *mi, const mm128_v *mv, int64_t *n_a, int *rep_len, int *n_mini_pos, uint64_t **mini_pos)
|
||||
{
|
||||
int rep_st = 0, rep_en = 0, n_m;
|
||||
size_t i;
|
||||
mm_match_t *m;
|
||||
*n_mini_pos = 0;
|
||||
*mini_pos = (uint64_t*)kmalloc(km, mv->n * sizeof(uint64_t));
|
||||
m = (mm_match_t*)kmalloc(km, mv->n * sizeof(mm_match_t));
|
||||
for (i = 0, n_m = 0, *rep_len = 0, *n_a = 0; i < mv->n; ++i) {
|
||||
const uint64_t *cr;
|
||||
mm128_t *p = &mv->a[i];
|
||||
uint32_t q_pos = (uint32_t)p->y, q_span = p->x & 0xff;
|
||||
int t;
|
||||
cr = mm_idx_get(mi, p->x>>8, &t);
|
||||
if (t >= max_occ) {
|
||||
int en = (q_pos >> 1) + 1, st = en - q_span;
|
||||
if (st > rep_en) {
|
||||
*rep_len += rep_en - rep_st;
|
||||
rep_st = st, rep_en = en;
|
||||
} else rep_en = en;
|
||||
} else {
|
||||
mm_match_t *q = &m[n_m++];
|
||||
q->q_pos = q_pos, q->q_span = q_span, q->cr = cr, q->n = t, q->seg_id = p->y >> 32;
|
||||
q->is_tandem = 0;
|
||||
if (i > 0 && p->x>>8 == mv->a[i - 1].x>>8) q->is_tandem = 1;
|
||||
if (i < mv->n - 1 && p->x>>8 == mv->a[i + 1].x>>8) q->is_tandem = 1;
|
||||
*n_a += q->n;
|
||||
(*mini_pos)[(*n_mini_pos)++] = (uint64_t)q_span<<32 | q_pos>>1;
|
||||
}
|
||||
}
|
||||
*rep_len += rep_en - rep_st;
|
||||
*_n_m = n_m;
|
||||
return m;
|
||||
}
|
||||
|
||||
static inline int skip_seed(int flag, uint64_t r, const mm_match_t *q, const char *qname, int qlen, const mm_idx_t *mi, int *is_self)
|
||||
static inline int skip_seed(int flag, uint64_t r, const mm_seed_t *q, const char *qname, int qlen, const mm_idx_t *mi, int *is_self)
|
||||
{
|
||||
*is_self = 0;
|
||||
if (qname && (flag & (MM_F_NO_DIAG|MM_F_NO_DUAL))) {
|
||||
@@ -257,58 +99,15 @@ static inline int skip_seed(int flag, uint64_t r, const mm_match_t *q, const cha
|
||||
return 0;
|
||||
}
|
||||
|
||||
|
||||
static mm128_t *collect_seed_hits(void *km, const mm_mapopt_t *opt, int max_occ, const mm_idx_t *mi, const char *qname, const mm128_v *mv, int qlen, int64_t *n_a, int *rep_len,
|
||||
int *n_mini_pos, uint64_t **mini_pos)
|
||||
{
|
||||
int i, n_m;
|
||||
mm_match_t *m;
|
||||
mm128_t *a;
|
||||
#ifndef LISA_HASH
|
||||
m = collect_matches(km, &n_m, max_occ, mi, mv, n_a, rep_len, n_mini_pos, mini_pos);
|
||||
#else
|
||||
m = collect_matches_lisa_hash(km, &n_m, max_occ, mi, mv, n_a, rep_len, n_mini_pos, mini_pos);
|
||||
#endif
|
||||
|
||||
a = (mm128_t*)kmalloc(km, *n_a * sizeof(mm128_t));
|
||||
for (i = 0, *n_a = 0; i < n_m; ++i) {
|
||||
|
||||
mm_match_t *q = &m[i];
|
||||
const uint64_t *r = q->cr;
|
||||
uint32_t k;
|
||||
for (k = 0; k < q->n; ++k) {
|
||||
uint64_t r_k = r[k];
|
||||
int32_t is_self, rpos = (uint32_t)r_k >> 1;
|
||||
mm128_t *p;
|
||||
if (skip_seed(opt->flag, r_k, q, qname, qlen, mi, &is_self)) continue;
|
||||
p = &a[(*n_a)++];
|
||||
if ((r_k&1) == (q->q_pos&1)) { // forward strand
|
||||
p->x = (r_k & 0xffffffff00000000ULL) | rpos;
|
||||
p->y = (uint64_t)q->q_span << 32 | q->q_pos >> 1;
|
||||
} else { // reverse strand
|
||||
p->x = 1ULL<<63 | (r_k & 0xffffffff00000000ULL) | rpos;
|
||||
p->y = (uint64_t)q->q_span << 32 | (qlen - ((q->q_pos>>1) + 1 - q->q_span) - 1);
|
||||
}
|
||||
p->y |= (uint64_t)q->seg_id << MM_SEED_SEG_SHIFT;
|
||||
if (q->is_tandem) p->y |= MM_SEED_TANDEM;
|
||||
if (is_self) p->y |= MM_SEED_SELF;
|
||||
}
|
||||
}
|
||||
|
||||
kfree(km, m);
|
||||
radix_sort_128x(a, a + (*n_a));
|
||||
return a;
|
||||
}
|
||||
|
||||
static mm128_t *collect_seed_hits_heap(void *km, const mm_mapopt_t *opt, int max_occ, const mm_idx_t *mi, const char *qname, const mm128_v *mv, int qlen, int64_t *n_a, int *rep_len,
|
||||
int *n_mini_pos, uint64_t **mini_pos)
|
||||
{
|
||||
int i, n_m, heap_size = 0;
|
||||
int64_t j, n_for = 0, n_rev = 0;
|
||||
mm_match_t *m;
|
||||
mm_seed_t *m;
|
||||
mm128_t *a, *heap;
|
||||
|
||||
m = collect_matches(km, &n_m, max_occ, mi, mv, n_a, rep_len, n_mini_pos, mini_pos);
|
||||
m = mm_collect_matches(km, &n_m, qlen, max_occ, opt->max_max_occ, opt->occ_dist, mi, mv, n_a, rep_len, n_mini_pos, mini_pos);
|
||||
|
||||
heap = (mm128_t*)kmalloc(km, n_m * sizeof(mm128_t));
|
||||
a = (mm128_t*)kmalloc(km, *n_a * sizeof(mm128_t));
|
||||
@@ -322,7 +121,7 @@ static mm128_t *collect_seed_hits_heap(void *km, const mm_mapopt_t *opt, int max
|
||||
}
|
||||
ks_heapmake_heap(heap_size, heap);
|
||||
while (heap_size > 0) {
|
||||
mm_match_t *q = &m[heap->y>>32];
|
||||
mm_seed_t *q = &m[heap->y>>32];
|
||||
mm128_t *p;
|
||||
uint64_t r = heap->x;
|
||||
int32_t is_self, rpos = (uint32_t)r >> 1;
|
||||
@@ -366,14 +165,50 @@ static mm128_t *collect_seed_hits_heap(void *km, const mm_mapopt_t *opt, int max
|
||||
return a;
|
||||
}
|
||||
|
||||
static mm128_t *collect_seed_hits(void *km, const mm_mapopt_t *opt, int max_occ, const mm_idx_t *mi, const char *qname, const mm128_v *mv, int qlen, int64_t *n_a, int *rep_len,
|
||||
int *n_mini_pos, uint64_t **mini_pos)
|
||||
{
|
||||
int i, n_m;
|
||||
mm_seed_t *m;
|
||||
mm128_t *a;
|
||||
m = mm_collect_matches(km, &n_m, qlen, max_occ, opt->max_max_occ, opt->occ_dist, mi, mv, n_a, rep_len, n_mini_pos, mini_pos);
|
||||
a = (mm128_t*)kmalloc(km, *n_a * sizeof(mm128_t));
|
||||
for (i = 0, *n_a = 0; i < n_m; ++i) {
|
||||
mm_seed_t *q = &m[i];
|
||||
const uint64_t *r = q->cr;
|
||||
uint32_t k;
|
||||
for (k = 0; k < q->n; ++k) {
|
||||
int32_t is_self, rpos = (uint32_t)r[k] >> 1;
|
||||
mm128_t *p;
|
||||
if (skip_seed(opt->flag, r[k], q, qname, qlen, mi, &is_self)) continue;
|
||||
p = &a[(*n_a)++];
|
||||
if ((r[k]&1) == (q->q_pos&1)) { // forward strand
|
||||
p->x = (r[k]&0xffffffff00000000ULL) | rpos;
|
||||
p->y = (uint64_t)q->q_span << 32 | q->q_pos >> 1;
|
||||
} else if (!(opt->flag & MM_F_QSTRAND)) { // reverse strand and not in the query-strand mode
|
||||
p->x = 1ULL<<63 | (r[k]&0xffffffff00000000ULL) | rpos;
|
||||
p->y = (uint64_t)q->q_span << 32 | (qlen - ((q->q_pos>>1) + 1 - q->q_span) - 1);
|
||||
} else { // reverse strand; query-strand
|
||||
int32_t len = mi->seq[r[k]>>32].len;
|
||||
p->x = 1ULL<<63 | (r[k]&0xffffffff00000000ULL) | (len - (rpos + 1 - q->q_span) - 1); // coordinate only accurate for non-HPC seeds
|
||||
p->y = (uint64_t)q->q_span << 32 | q->q_pos >> 1;
|
||||
}
|
||||
p->y |= (uint64_t)q->seg_id << MM_SEED_SEG_SHIFT;
|
||||
if (q->is_tandem) p->y |= MM_SEED_TANDEM;
|
||||
if (is_self) p->y |= MM_SEED_SELF;
|
||||
}
|
||||
}
|
||||
kfree(km, m);
|
||||
radix_sort_128x(a, a + (*n_a));
|
||||
return a;
|
||||
}
|
||||
|
||||
static void chain_post(const mm_mapopt_t *opt, int max_chain_gap_ref, const mm_idx_t *mi, void *km, int qlen, int n_segs, const int *qlens, int *n_regs, mm_reg1_t *regs, mm128_t *a)
|
||||
{
|
||||
if (!(opt->flag & MM_F_ALL_CHAINS)) { // don't choose primary mapping(s)
|
||||
mm_set_parent(km, opt->mask_level, opt->mask_len, *n_regs, regs, opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL, opt->alt_drop);
|
||||
if (n_segs <= 1) mm_select_sub(km, opt->pri_ratio, mi->k*2, opt->best_n, n_regs, regs);
|
||||
if (n_segs <= 1) mm_select_sub(km, opt->pri_ratio, mi->k*2, opt->best_n, 1, opt->max_gap * 0.8, n_regs, regs);
|
||||
else mm_select_sub_multi(km, opt->pri_ratio, 0.2f, 0.7f, max_chain_gap_ref, mi->k*2, opt->best_n, n_segs, qlens, n_regs, regs);
|
||||
if (!(opt->flag & (MM_F_SPLICE|MM_F_SR|MM_F_NO_LJOIN))) // long join not working well without primary chains
|
||||
mm_join_long(km, opt, qlen, n_regs, regs, a);
|
||||
}
|
||||
}
|
||||
|
||||
@@ -383,21 +218,16 @@ static mm_reg1_t *align_regs(const mm_mapopt_t *opt, const mm_idx_t *mi, void *k
|
||||
regs = mm_align_skeleton(km, opt, mi, qlen, seq, n_regs, regs, a); // this calls mm_filter_regs()
|
||||
if (!(opt->flag & MM_F_ALL_CHAINS)) { // don't choose primary mapping(s)
|
||||
mm_set_parent(km, opt->mask_level, opt->mask_len, *n_regs, regs, opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL, opt->alt_drop);
|
||||
mm_select_sub(km, opt->pri_ratio, mi->k*2, opt->best_n, n_regs, regs);
|
||||
mm_select_sub(km, opt->pri_ratio, mi->k*2, opt->best_n, 0, opt->max_gap * 0.8, n_regs, regs);
|
||||
mm_set_sam_pri(*n_regs, regs);
|
||||
}
|
||||
return regs;
|
||||
}
|
||||
|
||||
void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, int *n_regs, mm_reg1_t **regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname)
|
||||
void mm_map_frag_core(const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, int *n_regs, mm_reg1_t **regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname)
|
||||
{
|
||||
|
||||
#ifdef MANUAL_PROFILING
|
||||
num_reads++;
|
||||
#endif
|
||||
|
||||
int i, j, rep_len, qlen_sum, n_regs0, n_mini_pos;
|
||||
int max_chain_gap_qry, max_chain_gap_ref, is_splice = !!(opt->flag & MM_F_SPLICE), is_sr = !!(opt->flag & MM_F_SR);
|
||||
int max_chain_gap_qry, max_chain_gap_ref, is_splice = !!(opt->flag & MM_F_SPLICE), is_sr = !!(opt->flag & MM_F_SR), is_sr_rna = !!(opt->flag & MM_F_SR_RNA);
|
||||
uint32_t hash;
|
||||
int64_t n_a;
|
||||
uint64_t *u, *mini_pos;
|
||||
@@ -405,6 +235,7 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
|
||||
mm128_v mv = {0,0,0};
|
||||
mm_reg1_t *regs0;
|
||||
km_stat_t kmst;
|
||||
float chn_pen_gap, chn_pen_skip;
|
||||
|
||||
for (i = 0, qlen_sum = 0; i < n_segs; ++i)
|
||||
qlen_sum += qlens[i], n_regs[i] = 0, regs[i] = 0;
|
||||
@@ -412,24 +243,15 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
|
||||
if (qlen_sum == 0 || n_segs <= 0 || n_segs > MM_MAX_SEG) return;
|
||||
if (opt->max_qlen > 0 && qlen_sum > opt->max_qlen) return;
|
||||
|
||||
hash = qname? __ac_X31_hash_string(qname) : 0;
|
||||
hash = qname && !(opt->flag & MM_F_NO_HASH_NAME)? __ac_X31_hash_string(qname) : 0;
|
||||
hash ^= __ac_Wang_hash(qlen_sum) + __ac_Wang_hash(opt->seed);
|
||||
hash = __ac_Wang_hash(hash);
|
||||
|
||||
collect_minimizers(b->km, opt, mi, n_segs, qlens, seqs, &mv);
|
||||
if (opt->q_occ_frac > 0.0f) mm_seed_mz_flt(b->km, &mv, opt->mid_occ, opt->q_occ_frac);
|
||||
if (opt->flag & MM_F_HEAP_SORT) a = collect_seed_hits_heap(b->km, opt, opt->mid_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
|
||||
else {
|
||||
else a = collect_seed_hits(b->km, opt, opt->mid_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
|
||||
|
||||
#ifdef MANUAL_PROFILING
|
||||
uint64_t mm_hit_start = __rdtsc();
|
||||
#endif
|
||||
|
||||
a = collect_seed_hits(b->km, opt, opt->mid_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
|
||||
|
||||
#ifdef MANUAL_PROFILING
|
||||
minimizer_hit_time += (__rdtsc() - mm_hit_start);
|
||||
#endif
|
||||
}
|
||||
if (mm_dbg_flag & MM_DBG_PRINT_SEED) {
|
||||
fprintf(stderr, "RS\t%d\n", rep_len);
|
||||
for (i = 0; i < n_a; ++i)
|
||||
@@ -447,17 +269,28 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
|
||||
max_chain_gap_ref = opt->max_frag_len - qlen_sum;
|
||||
if (max_chain_gap_ref < opt->max_gap) max_chain_gap_ref = opt->max_gap;
|
||||
} else max_chain_gap_ref = opt->max_gap;
|
||||
#ifdef MANUAL_PROFILING
|
||||
uint64_t dp_start = __rdtsc();
|
||||
#endif
|
||||
a = mm_chain_dp(max_chain_gap_ref, max_chain_gap_qry, opt->bw, opt->max_chain_skip, opt->max_chain_iter, opt->min_cnt, opt->min_chain_score, opt->chain_gap_scale, is_splice, n_segs, n_a, a, &n_regs0, &u, b->km);
|
||||
|
||||
chn_pen_gap = opt->chain_gap_scale * 0.01 * mi->k;
|
||||
chn_pen_skip = opt->chain_skip_scale * 0.01 * mi->k;
|
||||
if (opt->flag & MM_F_RMQ) {
|
||||
a = mg_lchain_rmq(opt->max_gap, opt->rmq_inner_dist, opt->bw, opt->max_chain_skip, opt->rmq_size_cap, opt->min_cnt, opt->min_chain_score,
|
||||
chn_pen_gap, chn_pen_skip, n_a, a, &n_regs0, &u, b->km);
|
||||
} else {
|
||||
a = mg_lchain_dp(max_chain_gap_ref, max_chain_gap_qry, opt->bw, opt->max_chain_skip, opt->max_chain_iter, opt->min_cnt, opt->min_chain_score,
|
||||
chn_pen_gap, chn_pen_skip, is_splice, n_segs, n_a, a, &n_regs0, &u, b->km);
|
||||
}
|
||||
|
||||
#ifdef MANUAL_PROFILING
|
||||
dp_chaining_time += (__rdtsc() - dp_start);
|
||||
#endif
|
||||
|
||||
if (opt->max_occ > opt->mid_occ && rep_len > 0) {
|
||||
if (opt->bw_long > opt->bw && (opt->flag & (MM_F_SPLICE|MM_F_SR|MM_F_NO_LJOIN)) == 0 && n_segs == 1 && n_regs0 > 1) { // re-chain/long-join for long sequences
|
||||
int32_t st = (int32_t)a[0].y, en = (int32_t)a[(int32_t)u[0] - 1].y;
|
||||
if (qlen_sum - (en - st) > opt->rmq_rescue_size || en - st > qlen_sum * opt->rmq_rescue_ratio) {
|
||||
int32_t i;
|
||||
for (i = 0, n_a = 0; i < n_regs0; ++i) n_a += (int32_t)u[i];
|
||||
kfree(b->km, u);
|
||||
radix_sort_128x(a, a + n_a);
|
||||
a = mg_lchain_rmq(opt->max_gap, opt->rmq_inner_dist, opt->bw_long, opt->max_chain_skip, opt->rmq_size_cap, opt->min_cnt, opt->min_chain_score,
|
||||
chn_pen_gap, chn_pen_skip, n_a, a, &n_regs0, &u, b->km);
|
||||
}
|
||||
} else if (opt->max_occ > opt->mid_occ && rep_len > 0 && !(opt->flag & MM_F_RMQ)) { // re-chain, mostly for short reads
|
||||
int rechain = 0;
|
||||
if (n_regs0 > 0) { // test if the best chain has all the segments
|
||||
int n_chained_segs = 1, max = 0, max_i = -1, max_off = -1, off = 0;
|
||||
@@ -477,31 +310,35 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
|
||||
kfree(b->km, mini_pos);
|
||||
if (opt->flag & MM_F_HEAP_SORT) a = collect_seed_hits_heap(b->km, opt, opt->max_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
|
||||
else a = collect_seed_hits(b->km, opt, opt->max_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
|
||||
|
||||
a = mm_chain_dp(max_chain_gap_ref, max_chain_gap_qry, opt->bw, opt->max_chain_skip, opt->max_chain_iter, opt->min_cnt, opt->min_chain_score, opt->chain_gap_scale, is_splice, n_segs, n_a, a, &n_regs0, &u, b->km);
|
||||
a = mg_lchain_dp(max_chain_gap_ref, max_chain_gap_qry, opt->bw, opt->max_chain_skip, opt->max_chain_iter, opt->min_cnt, opt->min_chain_score,
|
||||
chn_pen_gap, chn_pen_skip, is_splice, n_segs, n_a, a, &n_regs0, &u, b->km);
|
||||
}
|
||||
}
|
||||
b->frag_gap = max_chain_gap_ref;
|
||||
b->rep_len = rep_len;
|
||||
|
||||
regs0 = mm_gen_regs(b->km, hash, qlen_sum, n_regs0, u, a);
|
||||
regs0 = mm_gen_regs(b->km, hash, qlen_sum, n_regs0, u, a, !!(opt->flag&MM_F_QSTRAND));
|
||||
if (mi->n_alt) {
|
||||
mm_mark_alt(mi, n_regs0, regs0);
|
||||
mm_hit_sort(b->km, &n_regs0, regs0, opt->alt_drop); // this step can be merged into mm_gen_regs(); will do if this shows up in profile
|
||||
}
|
||||
|
||||
if (mm_dbg_flag & MM_DBG_PRINT_SEED)
|
||||
if (mm_dbg_flag & (MM_DBG_PRINT_SEED|MM_DBG_PRINT_CHAIN))
|
||||
for (j = 0; j < n_regs0; ++j)
|
||||
for (i = regs0[j].as; i < regs0[j].as + regs0[j].cnt; ++i)
|
||||
fprintf(stderr, "CN\t%d\t%s\t%d\t%c\t%d\t%d\t%d\n", j, mi->seq[a[i].x<<1>>33].name, (int32_t)a[i].x, "+-"[a[i].x>>63], (int32_t)a[i].y, (int32_t)(a[i].y>>32&0xff),
|
||||
i == regs0[j].as? 0 : ((int32_t)a[i].y - (int32_t)a[i-1].y) - ((int32_t)a[i].x - (int32_t)a[i-1].x));
|
||||
|
||||
chain_post(opt, max_chain_gap_ref, mi, b->km, qlen_sum, n_segs, qlens, &n_regs0, regs0, a);
|
||||
if (!is_sr) mm_est_err(mi, qlen_sum, n_regs0, regs0, a, n_mini_pos, mini_pos);
|
||||
if (!is_sr && !(opt->flag&MM_F_QSTRAND)) {
|
||||
mm_est_err(mi, qlen_sum, n_regs0, regs0, a, n_mini_pos, mini_pos);
|
||||
n_regs0 = mm_filter_strand_retained(n_regs0, regs0);
|
||||
}
|
||||
|
||||
if (n_segs == 1) { // uni-segment
|
||||
regs0 = align_regs(opt, mi, b->km, qlens[0], seqs[0], &n_regs0, regs0, a);
|
||||
mm_set_mapq(b->km, n_regs0, regs0, opt->min_chain_score, opt->a, rep_len, is_sr);
|
||||
regs0 = (mm_reg1_t*)realloc(regs0, sizeof(*regs0) * n_regs0);
|
||||
mm_set_mapq2(b->km, n_regs0, regs0, opt->min_chain_score, opt->a, rep_len, is_sr || is_sr_rna, is_splice);
|
||||
n_regs[0] = n_regs0, regs[0] = regs0;
|
||||
} else { // multi-segment
|
||||
mm_seg_t *seg;
|
||||
@@ -510,7 +347,7 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
|
||||
for (i = 0; i < n_segs; ++i) {
|
||||
mm_set_parent(b->km, opt->mask_level, opt->mask_len, n_regs[i], regs[i], opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL, opt->alt_drop); // update mm_reg1_t::parent
|
||||
regs[i] = align_regs(opt, mi, b->km, qlens[i], seqs[i], &n_regs[i], regs[i], seg[i].a);
|
||||
mm_set_mapq(b->km, n_regs[i], regs[i], opt->min_chain_score, opt->a, rep_len, is_sr);
|
||||
mm_set_mapq2(b->km, n_regs[i], regs[i], opt->min_chain_score, opt->a, rep_len, is_sr || is_sr_rna, is_splice);
|
||||
}
|
||||
mm_seg_free(b->km, n_segs, seg);
|
||||
if (n_segs == 2 && opt->pe_ori >= 0 && (opt->flag&MM_F_CIGAR))
|
||||
@@ -522,18 +359,36 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
|
||||
kfree(b->km, u);
|
||||
kfree(b->km, mini_pos);
|
||||
|
||||
if (mi->J && n_segs == 1 && is_splice)
|
||||
for (i = 0; i < n_regs0; ++i)
|
||||
mm_jump_split(b->km, mi, opt, qlens[0], (const uint8_t*)seqs[0], ®s0[i], 0);
|
||||
|
||||
if (b->km) {
|
||||
km_stat(b->km, &kmst);
|
||||
if (mm_dbg_flag & MM_DBG_PRINT_QNAME)
|
||||
fprintf(stderr, "QM\t%s\t%d\tcap=%ld,nCore=%ld,largest=%ld\n", qname, qlen_sum, kmst.capacity, kmst.n_cores, kmst.largest);
|
||||
assert(kmst.n_blocks == kmst.n_cores); // otherwise, there is a memory leak
|
||||
if (kmst.largest > 1U<<28) {
|
||||
if (kmst.largest > 1U<<28 || (opt->cap_kalloc > 0 && kmst.capacity > opt->cap_kalloc)) {
|
||||
if (mm_dbg_flag & MM_DBG_PRINT_QNAME)
|
||||
fprintf(stderr, "[W::%s] reset thread-local memory after read %s\n", __func__, qname);
|
||||
km_destroy(b->km);
|
||||
b->km = km_init();
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, int *n_regs, mm_reg1_t **regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname)
|
||||
{
|
||||
if ((opt->flag & MM_F_WEAK_PAIRING) && n_segs == 2 && opt->pe_ori >= 0 && (opt->flag&MM_F_CIGAR)) {
|
||||
int i;
|
||||
for (i = 0; i < n_segs; ++i)
|
||||
mm_map_frag_core(mi, 1, &qlens[i], &seqs[i], &n_regs[i], ®s[i], b, opt, qname);
|
||||
mm_pair(b->km, opt->max_gap_ref, opt->pe_bonus, opt->a * 2 + opt->b, opt->a, qlens, n_regs, regs);
|
||||
} else {
|
||||
mm_map_frag_core(mi, n_segs, qlens, seqs, n_regs, regs, b, opt, qname);
|
||||
}
|
||||
}
|
||||
|
||||
mm_reg1_t *mm_map(const mm_idx_t *mi, int qlen, const char *seq, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname)
|
||||
{
|
||||
mm_reg1_t *regs;
|
||||
@@ -572,11 +427,13 @@ static void worker_for(void *_data, long i, int tid) // kt_for() callback
|
||||
step_t *s = (step_t*)_data;
|
||||
int qlens[MM_MAX_SEG], j, off = s->seg_off[i], pe_ori = s->p->opt->pe_ori;
|
||||
const char *qseqs[MM_MAX_SEG];
|
||||
double t = 0.0;
|
||||
mm_tbuf_t *b = s->buf[tid];
|
||||
|
||||
assert(s->n_seg[i] <= MM_MAX_SEG);
|
||||
if (mm_dbg_flag & MM_DBG_PRINT_QNAME)
|
||||
if (mm_dbg_flag & MM_DBG_PRINT_QNAME) {
|
||||
fprintf(stderr, "QR\t%s\t%d\t%d\n", s->seq[off].name, tid, s->seq[off].l_seq);
|
||||
t = realtime();
|
||||
}
|
||||
for (j = 0; j < s->n_seg[i]; ++j) {
|
||||
if (s->n_seg[i] == 2 && ((j == 0 && (pe_ori>>1&1)) || (j == 1 && (pe_ori&1))))
|
||||
mm_revcomp_bseq(&s->seq[off + j]);
|
||||
@@ -606,8 +463,14 @@ static void worker_for(void *_data, long i, int tid) // kt_for() callback
|
||||
r->qs = qlens[j] - r->qe;
|
||||
r->qe = qlens[j] - t;
|
||||
r->rev = !r->rev;
|
||||
if (r->p) {
|
||||
if (r->p->trans_strand == 1) r->p->trans_strand = 2;
|
||||
else if (r->p->trans_strand == 2) r->p->trans_strand = 1;
|
||||
}
|
||||
}
|
||||
}
|
||||
if (mm_dbg_flag & MM_DBG_PRINT_QNAME)
|
||||
fprintf(stderr, "QT\t%s\t%d\t%.6f\n", s->seq[off].name, tid, realtime() - t);
|
||||
}
|
||||
|
||||
static void merge_hits(step_t *s)
|
||||
@@ -652,13 +515,21 @@ static void merge_hits(step_t *s)
|
||||
}
|
||||
}
|
||||
}
|
||||
if (!(opt->flag&MM_F_SR) && s->seq[k].l_seq >= opt->rank_min_len)
|
||||
mm_update_dp_max(s->seq[k].l_seq, s->n_reg[k], s->reg[k], opt->rank_frac, opt->a, opt->b);
|
||||
for (j = 0; j < s->n_reg[k]; ++j) {
|
||||
mm_reg1_t *r = &s->reg[k][j];
|
||||
if (r->p) r->p->dp_max2 = 0; // reset ->dp_max2 as mm_set_parent() doesn't clear it; necessary with mm_update_dp_max()
|
||||
r->subsc = 0; // this may not be necessary
|
||||
r->n_sub = 0; // n_sub will be an underestimate as we don't see all the chains now, but it can't be accurate anyway
|
||||
}
|
||||
mm_hit_sort(km, &s->n_reg[k], s->reg[k], opt->alt_drop);
|
||||
mm_set_parent(km, opt->mask_level, opt->mask_len, s->n_reg[k], s->reg[k], opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL, opt->alt_drop);
|
||||
if (!(opt->flag & MM_F_ALL_CHAINS)) {
|
||||
mm_select_sub(km, opt->pri_ratio, s->p->mi->k*2, opt->best_n, &s->n_reg[k], s->reg[k]);
|
||||
mm_select_sub(km, opt->pri_ratio, s->p->mi->k*2, opt->best_n, 0, opt->max_gap * 0.8, &s->n_reg[k], s->reg[k]);
|
||||
mm_set_sam_pri(s->n_reg[k], s->reg[k]);
|
||||
}
|
||||
mm_set_mapq(km, s->n_reg[k], s->reg[k], opt->min_chain_score, opt->a, rep_len, !!(opt->flag & MM_F_SR));
|
||||
mm_set_mapq2(km, s->n_reg[k], s->reg[k], opt->min_chain_score, opt->a, rep_len, !!(opt->flag & (MM_F_SR|MM_F_SR_RNA)), !!(opt->flag & MM_F_SPLICE));
|
||||
}
|
||||
if (s->n_seg[f] == 2 && opt->pe_ori >= 0 && (opt->flag&MM_F_CIGAR))
|
||||
mm_pair(km, frag_gap_part[0], opt->pe_bonus, opt->a * 2 + opt->b, opt->a, qlens, &s->n_reg[k0], &s->reg[k0]);
|
||||
@@ -705,7 +576,6 @@ static void *worker_pipeline(void *shared, int step, void *in)
|
||||
else kt_for(p->n_threads, worker_for, in, ((step_t*)in)->n_frag);
|
||||
return in;
|
||||
} else if (step == 2) { // step 2: output
|
||||
|
||||
void *km = 0;
|
||||
step_t *s = (step_t*)in;
|
||||
const mm_idx_t *mi = p->mi;
|
||||
@@ -714,7 +584,6 @@ static void *worker_pipeline(void *shared, int step, void *in)
|
||||
if ((p->opt->flag & MM_F_OUT_CS) && !(mm_dbg_flag & MM_DBG_NO_KALLOC)) km = km_init();
|
||||
for (k = 0; k < s->n_frag; ++k) {
|
||||
int seg_st = s->seg_off[k], seg_en = s->seg_off[k] + s->n_seg[k];
|
||||
#ifndef DISABLE_OUTPUT
|
||||
for (i = seg_st; i < seg_en; ++i) {
|
||||
mm_bseq1_t *t = &s->seq[i];
|
||||
if (p->opt->split_prefix && p->n_parts == 0) { // then write to temporary files
|
||||
@@ -729,27 +598,33 @@ static void *worker_pipeline(void *shared, int step, void *in)
|
||||
mm_err_fwrite(r->p, r->p->capacity, 4, p->fp_split);
|
||||
}
|
||||
}
|
||||
} else if (p->opt->flag & MM_F_OUT_JUNC) { // extra logic for --write-junc
|
||||
for (j = 0; j < s->n_reg[i]; ++j) {
|
||||
const mm_reg1_t *r = &s->reg[i][j];
|
||||
if (r->id != r->parent || r->mapq < 10) continue;
|
||||
mm_write_junc(&p->str, mi, t, r);
|
||||
if (p->str.l > 0) mm_err_puts(p->str.s);
|
||||
}
|
||||
} else if (s->n_reg[i] > 0) { // the query has at least one hit
|
||||
for (j = 0; j < s->n_reg[i]; ++j) {
|
||||
mm_reg1_t *r = &s->reg[i][j];
|
||||
const mm_reg1_t *r = &s->reg[i][j];
|
||||
assert(!r->sam_pri || r->id == r->parent);
|
||||
if ((p->opt->flag & MM_F_NO_PRINT_2ND) && r->id != r->parent)
|
||||
continue;
|
||||
if (p->opt->flag & MM_F_OUT_SAM)
|
||||
mm_write_sam3(&p->str, mi, t, i - seg_st, j, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag, s->rep_len[i]);
|
||||
else
|
||||
mm_write_paf3(&p->str, mi, t, r, km, p->opt->flag, s->rep_len[i]);
|
||||
mm_write_paf4(&p->str, mi, t, r, km, p->opt->flag, s->rep_len[i], s->n_seg[k], i - seg_st);
|
||||
mm_err_puts(p->str.s);
|
||||
}
|
||||
} else if ((p->opt->flag & MM_F_PAF_NO_HIT) || ((p->opt->flag & MM_F_OUT_SAM) && !(p->opt->flag & MM_F_SAM_HIT_ONLY))) { // output an empty hit, if requested
|
||||
if (p->opt->flag & MM_F_OUT_SAM)
|
||||
mm_write_sam3(&p->str, mi, t, i - seg_st, -1, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag, s->rep_len[i]);
|
||||
else
|
||||
mm_write_paf3(&p->str, mi, t, 0, 0, p->opt->flag, s->rep_len[i]);
|
||||
mm_write_paf4(&p->str, mi, t, 0, 0, p->opt->flag, s->rep_len[i], s->n_seg[k], i - seg_st);
|
||||
mm_err_puts(p->str.s);
|
||||
}
|
||||
}
|
||||
#endif
|
||||
for (i = seg_st; i < seg_en; ++i) {
|
||||
for (j = 0; j < s->n_reg[i]; ++j) free(s->reg[i][j].p);
|
||||
free(s->reg[i]);
|
||||
|
||||
@@ -1,32 +1,3 @@
|
||||
/* The MIT License
|
||||
|
||||
Copyright (c) 2018- Dana-Farber Cancer Institute
|
||||
2017-2018 Broad Institute, Inc.
|
||||
|
||||
Permission is hereby granted, free of charge, to any person obtaining
|
||||
a copy of this software and associated documentation files (the
|
||||
"Software"), to deal in the Software without restriction, including
|
||||
without limitation the rights to use, copy, modify, merge, publish,
|
||||
distribute, sublicense, and/or sell copies of the Software, and to
|
||||
permit persons to whom the Software is furnished to do so, subject to
|
||||
the following conditions:
|
||||
|
||||
The above copyright notice and this permission notice shall be
|
||||
included in all copies or substantial portions of the Software.
|
||||
|
||||
THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
|
||||
EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
|
||||
MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
|
||||
NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS
|
||||
BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN
|
||||
ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN
|
||||
CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
|
||||
SOFTWARE.
|
||||
Modified Copyright (C) 2021 Intel Corporation
|
||||
Contacts: Saurabh Kalikar <saurabh.kalikar@intel.com>;
|
||||
Vasimuddin Md <vasimuddin.md@intel.com>; Sanchit Misra <sanchit.misra@intel.com>;
|
||||
Chirag Jain <chirag@iisc.ac.in>; Heng Li <hli@jimmy.harvard.edu>
|
||||
*/
|
||||
#ifndef MINIMAP2_H
|
||||
#define MINIMAP2_H
|
||||
|
||||
@@ -34,37 +5,49 @@ Modified Copyright (C) 2021 Intel Corporation
|
||||
#include <stdio.h>
|
||||
#include <sys/types.h>
|
||||
|
||||
#define MM_F_NO_DIAG 0x001 // no exact diagonal hit
|
||||
#define MM_F_NO_DUAL 0x002 // skip pairs where query name is lexicographically larger than target name
|
||||
#define MM_F_CIGAR 0x004
|
||||
#define MM_F_OUT_SAM 0x008
|
||||
#define MM_F_NO_QUAL 0x010
|
||||
#define MM_F_OUT_CG 0x020
|
||||
#define MM_F_OUT_CS 0x040
|
||||
#define MM_F_SPLICE 0x080 // splice mode
|
||||
#define MM_F_SPLICE_FOR 0x100 // match GT-AG
|
||||
#define MM_F_SPLICE_REV 0x200 // match CT-AC, the reverse complement of GT-AG
|
||||
#define MM_F_NO_LJOIN 0x400
|
||||
#define MM_F_OUT_CS_LONG 0x800
|
||||
#define MM_F_SR 0x1000
|
||||
#define MM_F_FRAG_MODE 0x2000
|
||||
#define MM_F_NO_PRINT_2ND 0x4000
|
||||
#define MM_F_2_IO_THREADS 0x8000
|
||||
#define MM_F_LONG_CIGAR 0x10000
|
||||
#define MM_F_INDEPEND_SEG 0x20000
|
||||
#define MM_F_SPLICE_FLANK 0x40000
|
||||
#define MM_F_SOFTCLIP 0x80000
|
||||
#define MM_F_FOR_ONLY 0x100000
|
||||
#define MM_F_REV_ONLY 0x200000
|
||||
#define MM_F_HEAP_SORT 0x400000
|
||||
#define MM_F_ALL_CHAINS 0x800000
|
||||
#define MM_F_OUT_MD 0x1000000
|
||||
#define MM_F_COPY_COMMENT 0x2000000
|
||||
#define MM_F_EQX 0x4000000 // use =/X instead of M
|
||||
#define MM_F_PAF_NO_HIT 0x8000000 // output unmapped reads to PAF
|
||||
#define MM_F_NO_END_FLT 0x10000000
|
||||
#define MM_F_HARD_MLEVEL 0x20000000
|
||||
#define MM_F_SAM_HIT_ONLY 0x40000000
|
||||
#define MM_VERSION "2.30-r1287"
|
||||
|
||||
#define MM_F_NO_DIAG (0x001LL) // no exact diagonal hit
|
||||
#define MM_F_NO_DUAL (0x002LL) // skip pairs where query name is lexicographically larger than target name
|
||||
#define MM_F_CIGAR (0x004LL)
|
||||
#define MM_F_OUT_SAM (0x008LL)
|
||||
#define MM_F_NO_QUAL (0x010LL)
|
||||
#define MM_F_OUT_CG (0x020LL)
|
||||
#define MM_F_OUT_CS (0x040LL)
|
||||
#define MM_F_SPLICE (0x080LL) // splice mode
|
||||
#define MM_F_SPLICE_FOR (0x100LL) // match GT-AG
|
||||
#define MM_F_SPLICE_REV (0x200LL) // match CT-AC, the reverse complement of GT-AG
|
||||
#define MM_F_NO_LJOIN (0x400LL)
|
||||
#define MM_F_OUT_CS_LONG (0x800LL)
|
||||
#define MM_F_SR (0x1000LL)
|
||||
#define MM_F_FRAG_MODE (0x2000LL)
|
||||
#define MM_F_NO_PRINT_2ND (0x4000LL)
|
||||
#define MM_F_2_IO_THREADS (0x8000LL)
|
||||
#define MM_F_LONG_CIGAR (0x10000LL)
|
||||
#define MM_F_INDEPEND_SEG (0x20000LL)
|
||||
#define MM_F_SPLICE_FLANK (0x40000LL)
|
||||
#define MM_F_SOFTCLIP (0x80000LL)
|
||||
#define MM_F_FOR_ONLY (0x100000LL)
|
||||
#define MM_F_REV_ONLY (0x200000LL)
|
||||
#define MM_F_HEAP_SORT (0x400000LL)
|
||||
#define MM_F_ALL_CHAINS (0x800000LL)
|
||||
#define MM_F_OUT_MD (0x1000000LL)
|
||||
#define MM_F_COPY_COMMENT (0x2000000LL)
|
||||
#define MM_F_EQX (0x4000000LL) // use =/X instead of M
|
||||
#define MM_F_PAF_NO_HIT (0x8000000LL) // output unmapped reads to PAF
|
||||
#define MM_F_NO_END_FLT (0x10000000LL)
|
||||
#define MM_F_HARD_MLEVEL (0x20000000LL)
|
||||
#define MM_F_SAM_HIT_ONLY (0x40000000LL)
|
||||
#define MM_F_RMQ (0x80000000LL)
|
||||
#define MM_F_QSTRAND (0x100000000LL)
|
||||
#define MM_F_NO_INV (0x200000000LL)
|
||||
#define MM_F_NO_HASH_NAME (0x400000000LL)
|
||||
#define MM_F_SPLICE_OLD (0x800000000LL)
|
||||
#define MM_F_SECONDARY_SEQ (0x1000000000LL) //output SEQ field for seqondary alignments using hard clipping
|
||||
#define MM_F_OUT_DS (0x2000000000LL)
|
||||
#define MM_F_WEAK_PAIRING (0x4000000000LL)
|
||||
#define MM_F_SR_RNA (0x8000000000LL)
|
||||
#define MM_F_OUT_JUNC (0x10000000000LL)
|
||||
|
||||
#define MM_I_HPC 0x1
|
||||
#define MM_I_NO_SEQ 0x2
|
||||
@@ -74,6 +57,18 @@ Modified Copyright (C) 2021 Intel Corporation
|
||||
|
||||
#define MM_MAX_SEG 255
|
||||
|
||||
#define MM_CIGAR_MATCH 0
|
||||
#define MM_CIGAR_INS 1
|
||||
#define MM_CIGAR_DEL 2
|
||||
#define MM_CIGAR_N_SKIP 3
|
||||
#define MM_CIGAR_SOFTCLIP 4
|
||||
#define MM_CIGAR_HARDCLIP 5
|
||||
#define MM_CIGAR_PADDING 6
|
||||
#define MM_CIGAR_EQ_MATCH 7
|
||||
#define MM_CIGAR_X_MISMATCH 8
|
||||
|
||||
#define MM_CIGAR_STR "MIDNSHP=XB"
|
||||
|
||||
#ifdef __cplusplus
|
||||
extern "C" {
|
||||
#endif
|
||||
@@ -99,6 +94,8 @@ typedef struct {
|
||||
uint32_t *S; // 4-bit packed sequence
|
||||
struct mm_idx_bucket_s *B; // index (hidden)
|
||||
struct mm_idx_intv_s *I; // intervals (hidden)
|
||||
struct mm_idx_spsc_s *spsc;// splice score (hidden)
|
||||
struct mm_idx_jjump_s *J; // junctions to create jumps (hidden)
|
||||
void *km, *h;
|
||||
} mm_idx_t;
|
||||
|
||||
@@ -106,6 +103,7 @@ typedef struct {
|
||||
typedef struct {
|
||||
uint32_t capacity; // the capacity of cigar[]
|
||||
int32_t dp_score, dp_max, dp_max2; // DP score; score of the max-scoring segment; score of the best alternate mappings
|
||||
int32_t dp_max0; // DP score before mm_update_dp_max() adjustment
|
||||
uint32_t n_ambi:30, trans_strand:2; // number of ambiguous bases; transcript strand: 0 for unknown, 1 for +, 2 for -
|
||||
uint32_t n_cigar; // number of cigar operations in cigar[]
|
||||
uint32_t cigar[];
|
||||
@@ -122,7 +120,7 @@ typedef struct {
|
||||
int32_t mlen, blen; // seeded exact match length; seeded alignment block length
|
||||
int32_t n_sub; // number of suboptimal mappings
|
||||
int32_t score0; // initial chaining score (before chain merging/spliting)
|
||||
uint32_t mapq:8, split:2, rev:1, inv:1, sam_pri:1, proper_frag:1, pe_thru:1, seg_split:1, seg_id:8, split_inv:1, is_alt:1, dummy:6;
|
||||
uint32_t mapq:8, split:2, rev:1, inv:1, sam_pri:1, proper_frag:1, pe_thru:1, seg_split:1, seg_id:8, split_inv:1, is_alt:1, strand_retained:1, is_spliced:1, dummy:4;
|
||||
uint32_t hash;
|
||||
float div;
|
||||
mm_extra_t *p;
|
||||
@@ -142,29 +140,31 @@ typedef struct {
|
||||
|
||||
int max_qlen; // max query length
|
||||
|
||||
int bw; // bandwidth
|
||||
int bw, bw_long; // bandwidth
|
||||
int max_gap, max_gap_ref; // break a chain if there are no minimizers in a max_gap window
|
||||
int max_frag_len;
|
||||
int max_chain_skip, max_chain_iter;
|
||||
int min_cnt; // min number of minimizers on each chain
|
||||
int min_chain_score; // min chaining score
|
||||
float chain_gap_scale;
|
||||
float chain_skip_scale;
|
||||
int rmq_size_cap, rmq_inner_dist;
|
||||
int rmq_rescue_size;
|
||||
float rmq_rescue_ratio;
|
||||
|
||||
float mask_level;
|
||||
int mask_len;
|
||||
float pri_ratio;
|
||||
int best_n; // top best_n chains are subjected to DP alignment
|
||||
|
||||
int max_join_long, max_join_short;
|
||||
int min_join_flank_sc;
|
||||
float min_join_flank_ratio;
|
||||
|
||||
float alt_drop;
|
||||
|
||||
int a, b, q, e, q2, e2; // matching score, mismatch, gap-open and gap-ext penalties
|
||||
int transition; // transition mismatch score (A:G, C:T)
|
||||
int sc_ambi; // score when one or both bases are "N"
|
||||
int noncan; // cost of non-canonical splicing sites
|
||||
int junc_bonus;
|
||||
int junc_bonus; // bonus for a splice site in annotation
|
||||
int junc_pen; // penalty for GT- or -AG not scored in --spsc
|
||||
int zdrop, zdrop_inv; // break alignment if alignment score drops too fast along the diagonal
|
||||
int end_bonus;
|
||||
int min_dp_max; // drop an alignment if the score of the max scoring segment is below this threshold
|
||||
@@ -172,18 +172,23 @@ typedef struct {
|
||||
int anchor_ext_len, anchor_ext_shift;
|
||||
float max_clip_ratio; // drop an alignment if BOTH ends are clipped above this ratio
|
||||
|
||||
int rank_min_len;
|
||||
float rank_frac;
|
||||
|
||||
int pe_ori, pe_bonus;
|
||||
|
||||
int32_t jump_min_match;
|
||||
|
||||
float mid_occ_frac; // only used by mm_mapopt_update(); see below
|
||||
int32_t min_mid_occ;
|
||||
float q_occ_frac;
|
||||
int32_t min_mid_occ, max_mid_occ;
|
||||
int32_t mid_occ; // ignore seeds with occurrences above this threshold
|
||||
int32_t max_occ;
|
||||
int32_t max_occ, max_max_occ, occ_dist;
|
||||
int64_t mini_batch_size; // size of a batch of query bases to process in parallel
|
||||
int64_t max_sw_mat;
|
||||
int64_t cap_kalloc;
|
||||
|
||||
const char *split_prefix;
|
||||
// Store minimizer hash to a file as key and list of values
|
||||
int L_hash;
|
||||
} mm_mapopt_t;
|
||||
|
||||
// index reader
|
||||
@@ -199,6 +204,11 @@ typedef struct {
|
||||
} mm_idx_reader_t;
|
||||
|
||||
// memory buffer for thread-local storage during mapping
|
||||
struct mm_tbuf_s {
|
||||
void *km;
|
||||
int rep_len, frag_gap;
|
||||
};
|
||||
|
||||
typedef struct mm_tbuf_s mm_tbuf_t;
|
||||
|
||||
// global variables
|
||||
@@ -298,14 +308,6 @@ mm_idx_t *mm_idx_load(FILE *fp);
|
||||
*/
|
||||
void mm_idx_dump(FILE *fp, const mm_idx_t *mi);
|
||||
|
||||
/**
|
||||
* Store hash table from minimap2 index into a file
|
||||
* @param f_name File name for output file
|
||||
* @param mi minimap2 index
|
||||
*/
|
||||
void mm_idx_dump_hash(const char* f_name, const mm_idx_t *mi);
|
||||
|
||||
|
||||
/**
|
||||
* Create an index from strings in memory
|
||||
*
|
||||
@@ -335,21 +337,6 @@ void mm_idx_stat(const mm_idx_t *idx);
|
||||
*/
|
||||
void mm_idx_destroy(mm_idx_t *mi);
|
||||
|
||||
/**
|
||||
* Destroy/deallocate an hash table index
|
||||
*
|
||||
* @param r minimap2 index
|
||||
*/
|
||||
void mm_idx_destroy_mm_hash(mm_idx_t *mi);
|
||||
|
||||
/**
|
||||
* Destroy/deallocate target sequences
|
||||
*
|
||||
* @param r minimap2 index
|
||||
*/
|
||||
void mm_idx_destroy_seq(mm_idx_t *mi);
|
||||
|
||||
|
||||
/**
|
||||
* Initialize a thread-local buffer for mapping
|
||||
*
|
||||
@@ -432,6 +419,11 @@ int mm_idx_alt_read(mm_idx_t *mi, const char *fn);
|
||||
int mm_idx_bed_read(mm_idx_t *mi, const char *fn, int read_junc);
|
||||
int mm_idx_bed_junc(const mm_idx_t *mi, int32_t ctg, int32_t st, int32_t en, uint8_t *s);
|
||||
|
||||
int mm_max_spsc_bonus(const mm_mapopt_t *mo);
|
||||
int32_t mm_idx_spsc_read(mm_idx_t *idx, const char *fn, int32_t max_sc);
|
||||
int32_t mm_idx_spsc_read2(mm_idx_t *idx, const char *fn, int32_t max_sc, float scale);
|
||||
int64_t mm_idx_spsc_get(const mm_idx_t *db, int32_t cid, int64_t st0, int64_t en0, int32_t rev, uint8_t *sc);
|
||||
|
||||
// deprecated APIs for backward compatibility
|
||||
void mm_mapopt_init(mm_mapopt_t *opt);
|
||||
mm_idx_t *mm_idx_build(const char *fn, int w, int k, int flag, int n_threads);
|
||||
|
||||
+236
-94
@@ -1,4 +1,4 @@
|
||||
.TH minimap2 1 "9 April 2021" "minimap2-2.18 (r1015)" "Bioinformatics tools"
|
||||
.TH minimap2 1 "15 June 2025" "minimap2-2.30 (r1287)" "Bioinformatics tools"
|
||||
.SH NAME
|
||||
.PP
|
||||
minimap2 - mapping and alignment between collections of DNA sequences
|
||||
@@ -77,7 +77,7 @@ SAM format.
|
||||
Minimizer k-mer length [15]
|
||||
.TP
|
||||
.BI -w \ INT
|
||||
Minimizer window size [2/3 of k-mer length]. A minimizer is the smallest k-mer
|
||||
Minimizer window size [10]. A minimizer is the smallest k-mer
|
||||
in a window of w consecutive k-mers.
|
||||
.TP
|
||||
.B -H
|
||||
@@ -88,16 +88,17 @@ on the HPC sequence.
|
||||
.BI -I \ NUM
|
||||
Load at most
|
||||
.I NUM
|
||||
target bases into RAM for indexing [4G]. If there are more than
|
||||
target bases into RAM for indexing [8G]. If there are more than
|
||||
.I NUM
|
||||
bases in
|
||||
.IR target.fa ,
|
||||
minimap2 needs to read
|
||||
.I query.fa
|
||||
multiple times to map it against each batch of target sequences.
|
||||
multiple times to map it against each batch of target sequences. This would create a multi-part index.
|
||||
.I NUM
|
||||
may be ending with k/K/m/M/g/G. NB: mapping quality is incorrect given a
|
||||
multi-part index.
|
||||
multi-part index. See also option
|
||||
.BR --split-prefix .
|
||||
.TP
|
||||
.B --idx-no-seq
|
||||
Don't store target sequences in the index. It saves disk space and memory but
|
||||
@@ -145,22 +146,38 @@ or
|
||||
.B -xsr
|
||||
mode, which sets the threshold for a second round of seeding.
|
||||
.TP
|
||||
.BI --min-occ-floor \ INT
|
||||
Force minimap2 to always use k-mers occurring
|
||||
.BI -U \ INT1 [, INT2 ]
|
||||
Lower and upper bounds of k-mer occurrences [10,1000000]. The final k-mer occurrence threshold is
|
||||
.RI max{ INT1 ,\ min{ INT2 ,
|
||||
.BR -f }}.
|
||||
This option prevents excessively small or large
|
||||
.B -f
|
||||
estimated from the input reference. Available since r1034 and deprecating
|
||||
.B --min-occ-floor
|
||||
in earlier versions of minimap2.
|
||||
.TP
|
||||
.BI --q-occ-frac \ FLOAT
|
||||
Discard a query minimizer if its occurrence is higher than
|
||||
.I FLOAT
|
||||
fraction of query minimizers and than the reference occurrence threshold
|
||||
[0.01]. Set 0 to disable. Available since r1105.
|
||||
.TP
|
||||
.BI -e \ INT
|
||||
Sample a high-frequency minimizer every
|
||||
.I INT
|
||||
times or less [0]. In effect, the max occurrence threshold is set to
|
||||
the
|
||||
.RI max{ INT ,
|
||||
.BR -f }.
|
||||
basepairs [500].
|
||||
.TP
|
||||
.BI -g \ INT
|
||||
.BI -g \ NUM
|
||||
Stop chain enlongation if there are no minimizers within
|
||||
.IR INT -bp
|
||||
[10000].
|
||||
.IR NUM -bp
|
||||
[10k].
|
||||
.TP
|
||||
.BI -r \ INT
|
||||
Bandwidth used in chaining and DP-based alignment [500]. This option
|
||||
approximately controls the maximum gap size.
|
||||
.BI -r \ NUM1 [, NUM2 ]
|
||||
Bandwidth for chaining and base alignment [500,20k].
|
||||
.I NUM1
|
||||
is used for initial chaining and alignment extension;
|
||||
.I NUM2
|
||||
for RMQ-based re-chaining and closing gaps in alignments.
|
||||
.TP
|
||||
.BI -n \ INT
|
||||
Discard chains consisting of
|
||||
@@ -234,6 +251,15 @@ Mark as secondary a chain that overlaps with a better chain by
|
||||
.I FLOAT
|
||||
or more of the shorter chain [0.5]
|
||||
.TP
|
||||
.BR --rmq = no | yes
|
||||
Use the minigraph chaining algorithm [no]. The minigraph algorithm is better
|
||||
for aligning contigs through long INDELs.
|
||||
.TP
|
||||
.BI --rmq-inner \ NUM
|
||||
Apply full dynamic programming for anchors within distance
|
||||
.I NUM
|
||||
[1000].
|
||||
.TP
|
||||
.B --hard-mask-level
|
||||
Honor option
|
||||
.B -M
|
||||
@@ -268,18 +294,16 @@ Disable the long gap patching heuristic. When this option is applied, the
|
||||
maximum alignment gap is mostly controlled by
|
||||
.BR -r .
|
||||
.TP
|
||||
.BI --lj-min-ratio \ FLOAT
|
||||
Fraction of query sequence length required to bridge a long gap [0.5]. A
|
||||
smaller value helps to recover longer gaps, at the cost of more false gaps.
|
||||
.TP
|
||||
.B --splice
|
||||
Enable the splice alignment mode.
|
||||
.TP
|
||||
.B --sr
|
||||
Enable short-read alignment heuristics. In the short-read mode, minimap2
|
||||
applies a second round of chaining with a higher minimizer occurrence threshold
|
||||
if no good chain is found. In addition, minimap2 attempts to patch gaps between
|
||||
seeds with ungapped alignment.
|
||||
.BR --sr [= no | dna | rna ]
|
||||
Enable short-read alignment heuristics [no]. If this option is used with no argument,
|
||||
.RB ` dna '
|
||||
is set. In the DNA short-read mode, minimap2 applies a second round of chaining
|
||||
with a higher minimizer occurrence threshold if no good chain is found. In
|
||||
addition, minimap2 attempts to patch gaps between seeds with ungapped
|
||||
alignment.
|
||||
.TP
|
||||
.BI --split-prefix \ STR
|
||||
Prefix to create temporary files. Typically used for a multi-part index.
|
||||
@@ -299,9 +323,8 @@ Only map to the reverse complement strand of the reference sequences.
|
||||
If yes, sort anchors with heap merge, instead of radix sort. Heap merge is
|
||||
faster for short reads, but slower for long reads. [no]
|
||||
.TP
|
||||
.B --no-pairing
|
||||
Treat two reads in a pair as independent reads. The mate related fields in SAM
|
||||
are still properly populated.
|
||||
.B --no-hash-name
|
||||
Produce the same alignment for identical sequences regardless of their sequence names.
|
||||
.SS Alignment options
|
||||
.TP 10
|
||||
.BI -A \ INT
|
||||
@@ -310,6 +333,10 @@ Matching score [2]
|
||||
.BI -B \ INT
|
||||
Mismatching penalty [4]
|
||||
.TP
|
||||
.BI -b \ INT
|
||||
Mismatching penalty for transitions [same as
|
||||
.BR -B ].
|
||||
.TP
|
||||
.BI -O \ INT1[,INT2]
|
||||
Gap open penalty [4,24]. If
|
||||
.I INT2
|
||||
@@ -323,10 +350,28 @@ costs
|
||||
.RI min{ O1 + k * E1 , O2 + k * E2 }.
|
||||
In the splice mode, the second gap penalties are not used.
|
||||
.TP
|
||||
.BI -J \ INT
|
||||
Splice model [1]. 0 for the original minimap2 splice model that always penalizes non-GT-AG splicing;
|
||||
1 for the miniprot model that considers non-GT-AG. Option
|
||||
.B -C
|
||||
has no effect with the default
|
||||
.BR -J1 .
|
||||
.TP
|
||||
.BR -j \ FILE
|
||||
Junctions used to extend alignment towards ends of reads [].
|
||||
.I FILE
|
||||
can be gene annotations in the BED12 format (aka 12-column BED), or intron
|
||||
positions in 5-column BED with the strand column required. BED12 file can be
|
||||
converted from GTF/GFF3 with `paftools.js gff2bed anno.gtf'. This option is
|
||||
intended for short RNA-seq reads, while
|
||||
.B --junc-bed
|
||||
for long noisy RNA-seq reads.
|
||||
.TP
|
||||
.BI -C \ INT
|
||||
Cost for a non-canonical GT-AG splicing (effective with
|
||||
.BR --splice )
|
||||
[0]
|
||||
.B --splice
|
||||
.BR -J0 )
|
||||
[0].
|
||||
.TP
|
||||
.BI -z \ INT1[,INT2]
|
||||
Truncate an alignment if the running alignment score drops too quickly along
|
||||
@@ -363,7 +408,16 @@ no attempt to match GT-AG [n]
|
||||
Score bonus when alignment extends to the end of the query sequence [0].
|
||||
.TP
|
||||
.BI --score-N \ INT
|
||||
Score of a mismatch involving ambiguous bases [1].
|
||||
Penalty of a mismatch involving ambiguous bases [1].
|
||||
.TP
|
||||
.BR --pairing = strong | weak | no
|
||||
How to pair paired-end reads [strong].
|
||||
.RB ` no '
|
||||
for aligning the two ends in a pair independently with no `properly paired' set.
|
||||
.RB ` weak '
|
||||
for aligning the two ends independently and then pairing the hits.
|
||||
.RB ` strong '
|
||||
for jointly aligning and pairing the two ends.
|
||||
.TP
|
||||
.BR --splice-flank = yes | no
|
||||
Assume the next base to a
|
||||
@@ -382,16 +436,49 @@ on SIRV data, please add
|
||||
.B --splice-flank=no
|
||||
to the command line.
|
||||
.TP
|
||||
.BR --spsc \ FILE
|
||||
Splice scores []. Each line consists of five fields: 1) contig, 2) offset, 3) `+' or `-', 4) `D' or `A', and 5) score,
|
||||
where offset is the number of bases before a splice junction, `D' indicates the
|
||||
line corresponds to a donor site and `A' for an acceptor site.
|
||||
A positive score suggests the junction is preferred and a negative score
|
||||
suggests the junction is not preferred.
|
||||
.TP
|
||||
.BR --spsc0 \ INT
|
||||
Penalty for positions not in
|
||||
.I FILE
|
||||
specified by
|
||||
.B --spsc
|
||||
[5]. Effective with
|
||||
.B --spsc
|
||||
but not
|
||||
.BR --junc-bed .
|
||||
.TP
|
||||
.BR --spsc-scale \ FLOAT
|
||||
Scale splice scores in
|
||||
.B --spsc
|
||||
by
|
||||
.IR FLOAT
|
||||
rounded to the nearest integer [0.7].
|
||||
.TP
|
||||
.BR --junc-bed \ FILE
|
||||
Gene annotations in the BED12 format (aka 12-column BED), or intron positions
|
||||
in 5-column BED. With this option, minimap2 prefers splicing in annotations.
|
||||
BED12 file can be converted from GTF/GFF3 with `paftools.js gff2bed anno.gtf'
|
||||
[].
|
||||
Junctions to prefer during base alignment [].
|
||||
Same format as
|
||||
.BR -j .
|
||||
It is
|
||||
.I NOT
|
||||
recommended to apply this option to short RNA-seq reads. This would increase
|
||||
run time with little improvement to junction accuracy.
|
||||
.TP
|
||||
.BR --junc-bonus \ INT
|
||||
Score bonus for a splice donor or acceptor found in annotation (effective with
|
||||
.BR --junc-bed )
|
||||
[9].
|
||||
Score bonus for a splice donor or acceptor found in annotation [9]. Effective with
|
||||
.B --junc-bed
|
||||
but not
|
||||
.BR --spsc .
|
||||
.TP
|
||||
.BR --jump-min-match \ INT
|
||||
Minimum matching length to create a jump [3]. Equivalent to
|
||||
.B STAR
|
||||
.BR --alignSJDBoverhangMin .
|
||||
.TP
|
||||
.BI --end-seed-pen \ INT
|
||||
Drop a terminal anchor if
|
||||
@@ -412,7 +499,12 @@ alignment.
|
||||
.BI --cap-sw-mem \ NUM
|
||||
Skip alignment if the DP matrix size is above
|
||||
.IR NUM .
|
||||
Set 0 to disable [0].
|
||||
Set 0 to disable [100m].
|
||||
.TP
|
||||
.BI --cap-kalloc \ NUM
|
||||
Free thread-local kalloc memory reservoir if after the alignment the size of the reservoir above
|
||||
.IR NUM .
|
||||
Set 0 to disable [500m].
|
||||
.SS Input/output options
|
||||
.TP 10
|
||||
.B -a
|
||||
@@ -444,20 +536,13 @@ Copy input FASTA/Q comments to output.
|
||||
.B -c
|
||||
Generate CIGAR. In PAF, the CIGAR is written to the `cg' custom tag.
|
||||
.TP
|
||||
.BI --cs[= STR ]
|
||||
.BR --cs [= short | long ]
|
||||
Output the
|
||||
.B cs
|
||||
tag.
|
||||
.I STR
|
||||
can be either
|
||||
.I short
|
||||
or
|
||||
.IR long .
|
||||
If no
|
||||
.I STR
|
||||
is given,
|
||||
.I short
|
||||
is assumed. [none]
|
||||
If no argument is given,
|
||||
.RB ` short '
|
||||
is set. [none]
|
||||
.TP
|
||||
.B --MD
|
||||
Output the MD tag (see the SAM spec).
|
||||
@@ -468,6 +553,29 @@ Output =/X CIGAR operators for sequence match/mismatch.
|
||||
.B -Y
|
||||
In SAM output, use soft clipping for supplementary alignments.
|
||||
.TP
|
||||
.B --secondary-seq
|
||||
In SAM output, show query sequences for secondary alignments.
|
||||
.TP
|
||||
.B --write-junc
|
||||
Output splice junctions in 6-column BED: contig name, start, end,
|
||||
read name, score and strand. Score is the sum of donor and acceptor scores,
|
||||
where GT gets 3, GC gets 2 and AT gets 1 at donor sites,
|
||||
while AG gets 3 and AC gets 1 at acceptor sites.
|
||||
Alignments with mapping quality below 10 are ignored.
|
||||
.TP
|
||||
.BI --pass1 \ FILE
|
||||
Junctions BED file outputted by
|
||||
.B --write-junc
|
||||
[]. Rows with scores lower than 5 are ignored. When both
|
||||
.B -j
|
||||
and
|
||||
.B --pass1
|
||||
are present, junctions in
|
||||
.B -j
|
||||
are preferred over in
|
||||
.BR --pass1
|
||||
when there is ambiguity.
|
||||
.TP
|
||||
.BI --seed \ INT
|
||||
Integer seed for randomizing equally best hits. Minimap2 hashes
|
||||
.I INT
|
||||
@@ -523,60 +631,75 @@ Available
|
||||
.I STR
|
||||
are:
|
||||
.RS
|
||||
.TP 8
|
||||
.B map-pb
|
||||
PacBio/Oxford Nanopore read to reference mapping
|
||||
.RB ( -Hk19 )
|
||||
.TP
|
||||
.TP 10
|
||||
.B map-ont
|
||||
Slightly more sensitive for Oxford Nanopore to reference mapping
|
||||
.RB ( -k15 ).
|
||||
For PacBio reads, HPC minimizers consistently leads to faster performance and
|
||||
more sensitive results in comparison to normal minimizers. For Oxford Nanopore
|
||||
data, normal minimizers are better, though not much. The effectiveness of HPC
|
||||
is determined by the sequencing error mode.
|
||||
Align noisy long reads of ~10% error rate to a reference genome. This is the
|
||||
default mode.
|
||||
.TP
|
||||
.B lr:hq
|
||||
Align accurate long reads (error rate <1%) to a reference genome
|
||||
.RB ( -k19
|
||||
.B -w19 -U50,500
|
||||
.BR -g10k ).
|
||||
This was recommended by ONT developers for recent Nanopore reads
|
||||
produced with chemistry v14 that can reach ~99% in accuracy.
|
||||
It was shown to work better for accurate Nanopore reads
|
||||
than
|
||||
.BR map-hifi .
|
||||
.TP
|
||||
.B map-hifi
|
||||
Align PacBio high-fidelity (HiFi) reads to a reference genome
|
||||
.RB ( -xlr:hq
|
||||
.B -A1 -B4 -O6,26 -E2,1
|
||||
.BR -s200 ).
|
||||
It differs from
|
||||
.B lr:hq
|
||||
only in scoring. It has not been tested whether
|
||||
.B lr:hq
|
||||
would work better for PacBio HiFi reads.
|
||||
.TP
|
||||
.B map-pb
|
||||
Align older PacBio continuous long (CLR) reads to a reference genome
|
||||
.RB ( -Hk19 ).
|
||||
Note that this data type is effectively deprecated by HiFi.
|
||||
Unless you work on very old data, you probably want to use
|
||||
.B map-hifi
|
||||
or
|
||||
.BR lr:hq .
|
||||
.TP
|
||||
.B map-iclr
|
||||
Align Illumina Complete Long Reads (ICLR) to a reference genome
|
||||
.RB ( -k19
|
||||
.B -B6 -b4
|
||||
.BR -O10,50 ).
|
||||
This was recommended by Illumina developers.
|
||||
.TP
|
||||
.B asm5
|
||||
Long assembly to reference mapping
|
||||
.RB ( -k19
|
||||
.B -w19 -A1 -B19 -O39,81 -E3,1 -s200 -z200 -N50
|
||||
.BR --min-occ-floor=100 ).
|
||||
.B -w19 -U50,500 --rmq -r1k,100k -g10k -A1 -B19 -O39,81 -E3,1 -s200 -z200
|
||||
.BR -N50 ).
|
||||
Typically, the alignment will not extend to regions with 5% or higher sequence
|
||||
divergence. Only use this preset if the average divergence is far below 5%.
|
||||
divergence. Use this preset if the average divergence is not much higher than 0.1%.
|
||||
.TP
|
||||
.B asm10
|
||||
Long assembly to reference mapping
|
||||
.RB ( -k19
|
||||
.B -w19 -A1 -B9 -O16,41 -E2,1 -s200 -z200 -N50
|
||||
.BR --min-occ-floor=100 ).
|
||||
Up to 10% sequence divergence.
|
||||
.B -w19 -U50,500 --rmq -r1k,100k -g10k -A1 -B9 -O16,41 -E2,1 -s200 -z200
|
||||
.BR -N50 ).
|
||||
Use this if the average divergence is around 1%.
|
||||
.TP
|
||||
.B asm20
|
||||
Long assembly to reference mapping
|
||||
.RB ( -k19
|
||||
.B -w10 -A1 -B4 -O6,26 -E2,1 -s200 -z200 -N50
|
||||
.BR --min-occ-floor=100 ).
|
||||
Up to 20% sequence divergence.
|
||||
.TP
|
||||
.B ava-pb
|
||||
PacBio all-vs-all overlap mapping
|
||||
.RB ( -Hk19
|
||||
.B -Xw5 -m100 -g10000 --max-chain-skip
|
||||
.BR 25 ).
|
||||
.TP
|
||||
.B ava-ont
|
||||
Oxford Nanopore all-vs-all overlap mapping
|
||||
.RB ( -k15
|
||||
.B -Xw5 -m100 -g10000 -r2000 --max-chain-skip
|
||||
.BR 25 ).
|
||||
Similarly, the major difference from
|
||||
.B ava-pb
|
||||
is that this preset is not using HPC minimizers.
|
||||
.B -w10 -U50,500 --rmq -r1k,100k -g10k -A1 -B4 -O6,26 -E2,1 -s200 -z200
|
||||
.BR -N50 ).
|
||||
Use this if the average divergence is around several percent.
|
||||
.TP
|
||||
.B splice
|
||||
Long-read spliced alignment
|
||||
.RB ( -k15
|
||||
.B -w5 --splice -g2000 -G200k -A1 -B2 -O2,32 -E1,0 -C9 -z200 -ub --junc-bonus=9
|
||||
.B -w5 --splice -g2k -G200k -A1 -B2 -O2,32 -E1,0 -C9 -z200 -ub --junc-bonus=9 --cap-sw-mem=0
|
||||
.BR --splice-flank=yes ).
|
||||
In the splice mode, 1) long deletions are taken as introns and represented as
|
||||
the
|
||||
@@ -587,17 +710,35 @@ costs are different during chaining; 4) the computation of the
|
||||
tag ignores introns to demote hits to pseudogenes.
|
||||
.TP
|
||||
.B splice:hq
|
||||
Long-read splice alignment for PacBio CCS reads
|
||||
Spliced alignment for accurate long RNA-seq reads such as PacBio iso-seq
|
||||
.RB ( -xsplice
|
||||
.B -C5 -O6,24
|
||||
.BR -B4 ).
|
||||
.TP
|
||||
.B sr
|
||||
Short single-end reads without splicing
|
||||
.RB ( -k21
|
||||
.B -w11 --sr --frag=yes -A2 -B8 -O12,32 -E2,1 -r50 -p.5 -N20 -f1000,5000 -n2 -m20
|
||||
.B -s40 -g200 -2K50m --heap-sort=yes
|
||||
.B splice:sr
|
||||
Spliced alignment for short RNA-seq reads
|
||||
.RB ( -xsplice:hq
|
||||
.B --frag=yes -m25 -s40 -2K100m --heap-sort=yes --pairing=weak --sr=rna --min-dp-len=20
|
||||
.BR --secondary=no ).
|
||||
.TP
|
||||
.B sr
|
||||
Short-read alignment without splicing
|
||||
.RB ( -k21
|
||||
.B -w11 --sr --frag=yes -A2 -B8 -O12,32 -E2,1 -r100 -p.5 -N20 -f1000,5000 -n2 -m25
|
||||
.B -s40 -g100 -2K50m --heap-sort=yes
|
||||
.BR --secondary=no ).
|
||||
.TP
|
||||
.B ava-pb
|
||||
PacBio CLR all-vs-all overlap mapping
|
||||
.RB ( -Hk19
|
||||
.B -Xw5 -e0
|
||||
.BR -m100 ).
|
||||
.TP
|
||||
.B ava-ont
|
||||
Oxford Nanopore all-vs-all overlap mapping
|
||||
.RB ( -k15
|
||||
.B -Xw5 -e0 -m100
|
||||
.BR -r2k ).
|
||||
.RE
|
||||
.SS Miscellaneous options
|
||||
.TP 10
|
||||
@@ -656,7 +797,7 @@ s2 i Chaining score of the best secondary chain
|
||||
NM i Total number of mismatches and gaps in the alignment
|
||||
MD Z To generate the ref sequence in the alignment
|
||||
AS i DP alignment score
|
||||
SA Z List of other supplementary alignments
|
||||
SA Z List of other supplementary alignments (with approximate CIGAR strings)
|
||||
ms i DP score of the max scoring segment in the alignment
|
||||
nn i Number of ambiguous bases in the alignment
|
||||
ts A Transcript strand (splice mode only)
|
||||
@@ -665,6 +806,7 @@ cs Z Difference string
|
||||
dv f Approximate per-base sequence divergence
|
||||
de f Gap-compressed per-base sequence divergence
|
||||
rl i Length of query regions harboring repetitive seeds
|
||||
zd i Alignment broken due to Z-drop; bit 1: left broken; bit 2: right broken
|
||||
.TE
|
||||
|
||||
.PP
|
||||
|
||||
@@ -159,3 +159,4 @@ KRADIX_SORT_INIT(128x, mm128_t, sort_key_128x, 8)
|
||||
KRADIX_SORT_INIT(64, uint64_t, sort_key_64, 8)
|
||||
|
||||
KSORT_INIT_GENERIC(uint32_t)
|
||||
KSORT_INIT_GENERIC(uint64_t)
|
||||
|
||||
+2
-1
@@ -16,7 +16,8 @@ minimap2 -c test/MT-human.fa test/MT-orang.fa \
|
||||
| paftools.js liftover -l10000 - <(echo -e "MT_orang\t2000\t5000") # liftOver
|
||||
# no test data for the following examples
|
||||
paftools.js junceval -e anno.gtf splice.sam > out.txt # compare splice junctions to annotations
|
||||
paftools.js splice2bed anno.gtf > anno.bed # convert GTF/GFF3 to BED12
|
||||
paftools.js splice2bed splice.sam > splice.bed # convert PAF/SAM to BED12
|
||||
paftools.js gff2bed anno.gtf > anno.bed # convert GTF/GFF3 to BED12
|
||||
```
|
||||
|
||||
## Table of Contents
|
||||
|
||||
Executable
+241
@@ -0,0 +1,241 @@
|
||||
#!/usr/bin/env k8
|
||||
|
||||
"use strict";
|
||||
|
||||
Array.prototype.delete_at = function(i) {
|
||||
for (let j = i; j < this.length - 1; ++j)
|
||||
this[j] = this[j + 1];
|
||||
--this.length;
|
||||
}
|
||||
|
||||
function* getopt(argv, ostr, longopts) {
|
||||
if (argv.length == 0) return;
|
||||
let pos = 0, cur = 0;
|
||||
while (cur < argv.length) {
|
||||
let lopt = "", opt = "?", arg = "";
|
||||
while (cur < argv.length) { // skip non-option arguments
|
||||
if (argv[cur][0] == "-" && argv[cur].length > 1) {
|
||||
if (argv[cur] == "--") cur = argv.length;
|
||||
break;
|
||||
} else ++cur;
|
||||
}
|
||||
if (cur == argv.length) break;
|
||||
let a = argv[cur];
|
||||
if (a[0] == "-" && a[1] == "-") { // a long option
|
||||
pos = -1;
|
||||
let c = 0, k = -1, tmp = "", o;
|
||||
const pos_eq = a.indexOf("=");
|
||||
if (pos_eq > 0) {
|
||||
o = a.substring(2, pos_eq);
|
||||
arg = a.substring(pos_eq + 1);
|
||||
} else o = a.substring(2);
|
||||
for (let i = 0; i < longopts.length; ++i) {
|
||||
let y = longopts[i];
|
||||
if (y[y.length - 1] == "=") y = y.substring(0, y.length - 1);
|
||||
if (o.length <= y.length && o == y.substring(0, o.length)) {
|
||||
k = i, tmp = y;
|
||||
++c; // c is the number of matches
|
||||
if (o == y) { // exact match
|
||||
c = 1;
|
||||
break;
|
||||
}
|
||||
}
|
||||
}
|
||||
if (c == 1) { // find a unique match
|
||||
lopt = tmp;
|
||||
if (pos_eq < 0 && longopts[k][longopts[k].length-1] == "=" && cur + 1 < argv.length) {
|
||||
arg = argv[cur+1];
|
||||
argv.delete_at(cur + 1);
|
||||
}
|
||||
}
|
||||
} else { // a short option
|
||||
if (pos == 0) pos = 1;
|
||||
opt = a[pos++];
|
||||
let k = ostr.indexOf(opt);
|
||||
if (k < 0) {
|
||||
opt = "?";
|
||||
} else if (k + 1 < ostr.length && ostr[k+1] == ":") { // requiring an argument
|
||||
if (pos >= a.length) {
|
||||
arg = argv[cur+1];
|
||||
argv.delete_at(cur + 1);
|
||||
} else arg = a.substring(pos);
|
||||
pos = -1;
|
||||
}
|
||||
}
|
||||
if (pos < 0 || pos >= argv[cur].length) {
|
||||
argv.delete_at(cur);
|
||||
pos = 0;
|
||||
}
|
||||
if (lopt != "") yield { opt: `--${lopt}`, arg: arg };
|
||||
else if (opt != "?") yield { opt: `-${opt}`, arg: arg };
|
||||
else yield { opt: "?", arg: "" };
|
||||
}
|
||||
}
|
||||
|
||||
function* k8_readline(fn) {
|
||||
let buf = new Bytes();
|
||||
let file = new File(fn);
|
||||
while (file.readline(buf) >= 0) {
|
||||
yield buf.toString();
|
||||
}
|
||||
file.close();
|
||||
buf.destroy();
|
||||
}
|
||||
|
||||
function merge_hits(b) {
|
||||
if (b.length == 1)
|
||||
return { name1:b[0].name1, name2:b[0].name2, len1:b[0].len1, len2:b[0].len2, min_cov:b[0].min_cov, max_cov:b[0].max_cov, cov1:b[0].cov1, cov2:b[0].cov2, s1:b[0].s1, dv:b[0].dv };
|
||||
b.sort(function(x, y) { return x.st1 - y.st1 });
|
||||
let f = [], bt = [];
|
||||
for (let i = 0; i < b.length; ++i)
|
||||
f[i] = b[i].s1, bt[i] = -1;
|
||||
for (let i = 0; i < b.length; ++i) {
|
||||
for (let j = 0; j < i; ++j) {
|
||||
if (b[j].st2 < b[i].st2) {
|
||||
if (b[j].en1 >= b[i].en1) continue;
|
||||
if (b[j].en2 >= b[i].en2) continue;
|
||||
const ov1 = b[j].en1 <= b[i].st1? 0 : b[i].st1 - b[j].en1;
|
||||
const li1 = b[i].en1 - b[i].st1;
|
||||
const s11 = b[i].s1 / li1 * (li1 - ov1);
|
||||
const ov2 = b[j].en2 <= b[i].st2? 0 : b[i].st2 - b[j].en2;
|
||||
const li2 = b[i].en2 - b[i].st2;
|
||||
const s12 = b[i].s1 / li2 * (li2 - ov2);
|
||||
const s1 = s11 < s12? s11 : s12;
|
||||
if (f[i] < f[j] + s1)
|
||||
f[i] = f[j] + s1, bt[i] = j;
|
||||
}
|
||||
}
|
||||
}
|
||||
let max_i = -1, max_f = 0, d = [];
|
||||
for (let i = 0; i < b.length; ++i)
|
||||
if (max_f < f[i])
|
||||
max_f = f[i], max_i = i;
|
||||
for (let k = max_i; k >= 0; k = bt[k])
|
||||
d.push(k);
|
||||
d = d.reverse();
|
||||
let dv = 0, tot = 0, cov1 = 0, cov2 = 0, st1 = 0, en1 = 0, st2 = 0, en2 = 0;
|
||||
for (let k = 0; k < d.length; ++k) {
|
||||
const i = d[k];
|
||||
tot += b[i].blen;
|
||||
dv += b[i].dv * b[i].blen;
|
||||
if (b[i].st1 > en1) {
|
||||
cov1 += en1 - st1;
|
||||
st1 = b[i].st1, en1 = b[i].en1;
|
||||
} else en1 = en1 > b[i].en1? en1 : b[i].en1;
|
||||
if (b[i].st2 > en2) {
|
||||
cov2 += en2 - st2;
|
||||
st2 = b[i].st2, en2 = b[i].en2;
|
||||
} else en2 = en2 > b[i].en2? en2 : b[i].en2;
|
||||
}
|
||||
dv /= tot;
|
||||
cov1 = (cov1 + (en1 - st1)) / b[0].len1;
|
||||
cov2 = (cov2 + (en2 - st2)) / b[0].len2;
|
||||
const min_cov = cov1 < cov2? cov1 : cov2;
|
||||
const max_cov = cov1 > cov2? cov1 : cov2;
|
||||
//warn(d.length, b[0].name1, b[0].name2, min_cov, max_cov);
|
||||
return { name1:b[0].name1, name2:b[0].name2, len1:b[0].len1, len2:b[0].len2, min_cov:min_cov, max_cov:max_cov, cov1:cov1, cov2:cov2, s1:max_f, dv:dv };
|
||||
}
|
||||
|
||||
function main(args) {
|
||||
let opt = { min_cov:.9, max_dv:.015, max_diff:20000 };
|
||||
for (const o of getopt(args, "c:d:e:", [])) {
|
||||
if (o.opt == '-c') opt.min_cov = parseFloat(o.arg);
|
||||
else if (o.opt == '-d') opt.max_dv = parseFloat(o.arg);
|
||||
else if (o.opt == '-e') opt.max_diff = parseFloat(o.arg);
|
||||
}
|
||||
if (args.length == 0) {
|
||||
print("Usage: pafcluster.js [options] <ava.paf>");
|
||||
print("Options:");
|
||||
print(` -c FLOAT min coverage [${opt.min_cov}]`);
|
||||
print(` -d FLOAT max divergence [${opt.max_dv}]`);
|
||||
print(` -e FLOAT max difference [${opt.max_diff}]`);
|
||||
return;
|
||||
}
|
||||
|
||||
// read
|
||||
let a = [], len = {}, name2len = {};
|
||||
for (const line of k8_readline(args[0])) {
|
||||
let m, t = line.split("\t");
|
||||
if (t[4] != "+") continue;
|
||||
for (let i = 1; i < 4; ++i) t[i] = parseInt(t[i]);
|
||||
for (let i = 6; i < 11; ++i) t[i] = parseInt(t[i]);
|
||||
const len1 = t[1], len2 = t[6];
|
||||
let s1 = -1, dv = -1.0;
|
||||
for (let i = 12; i < t.length; ++i) {
|
||||
if ((m = /^(s1|dv):\S:(\S+)/.exec(t[i])) != null) {
|
||||
if (m[1] == "s1") s1 = parseInt(m[2]);
|
||||
else if (m[1] == "dv") dv = parseFloat(m[2]);
|
||||
}
|
||||
}
|
||||
if (s1 < 0 || dv < 0) continue;
|
||||
const cov1 = (parseInt(t[3]) - parseInt(t[2])) / len1;
|
||||
const cov2 = (parseInt(t[8]) - parseInt(t[7])) / len2;
|
||||
const min_cov = cov1 < cov2? cov1 : cov2;
|
||||
const max_cov = cov1 > cov2? cov1 : cov2;
|
||||
name2len[t[0]] = len1;
|
||||
name2len[t[5]] = len2;
|
||||
a.push({ name1:t[0], name2:t[5], len1:len1, len2:len2, min_cov:min_cov, max_cov:max_cov, s1:s1, dv:dv, cov1:cov1, cov2:cov2, st1:t[2], en1:t[3], st2:t[7], en2:t[8], blen:t[10] });
|
||||
len[t[0]] = len1, len[t[5]] = len2;
|
||||
}
|
||||
warn(`Read ${a.length} hits`);
|
||||
|
||||
// merge duplicated hits
|
||||
let h = {};
|
||||
for (let i = 0; i < a.length; ++i) {
|
||||
const key = `${a[i].name1}\t${a[i].name2}`;
|
||||
if (h[key] == null) h[key] = [];
|
||||
h[key].push(a[i]);
|
||||
}
|
||||
a = [];
|
||||
for (const key in h)
|
||||
a.push(merge_hits(h[key]));
|
||||
|
||||
// core loop
|
||||
while (a.length > 1) {
|
||||
// select the sequence with the highest sum of s1
|
||||
let h = {};
|
||||
for (let i = 0; i < a.length; ++i) {
|
||||
if (h[a[i].name1] == null) h[a[i].name1] = 0;
|
||||
h[a[i].name1] += a[i].s1;
|
||||
}
|
||||
let max_s1 = 0, max_name = "";
|
||||
for (const name in h)
|
||||
if (max_s1 < h[name])
|
||||
max_s1 = h[name], max_name = name;
|
||||
// find contigs in the same group
|
||||
h = {};
|
||||
h[max_name] = 1;
|
||||
for (let i = 0; i < a.length; ++i) {
|
||||
if (a[i].name1 != max_name && a[i].name2 != max_name)
|
||||
continue;
|
||||
const diff1 = a[i].len1 * (1.0 - a[i].cov1);
|
||||
const diff2 = a[i].len2 * (1.0 - a[i].cov2);
|
||||
if (a[i].min_cov >= opt.min_cov && a[i].dv <= opt.max_dv && diff1 <= opt.max_diff && diff2 <= opt.max_diff)
|
||||
h[a[i].name1] = h[a[i].name2] = 1;
|
||||
}
|
||||
let n = 0;
|
||||
for (const key in h) {
|
||||
++n;
|
||||
delete name2len[key];
|
||||
}
|
||||
print(`SD\t${max_name}\t${n}`);
|
||||
for (const key in h) print(`CL\t${key}\t${len[key]}`);
|
||||
print("//");
|
||||
// filter out redundant hits
|
||||
let b = [];
|
||||
for (let i = 0; i < a.length; ++i)
|
||||
if (h[a[i].name1] == null && h[a[i].name2] == null)
|
||||
b.push(a[i]);
|
||||
warn(`Reduced the number of hits from ${a.length} to ${b.length}`);
|
||||
a = b;
|
||||
}
|
||||
|
||||
// output remaining singletons
|
||||
for (const key in name2len) {
|
||||
print(`SD\t${key}\t1`);
|
||||
print(`CL\t${key}\t${name2len[key]}`);
|
||||
print(`//`);
|
||||
}
|
||||
}
|
||||
|
||||
main(arguments);
|
||||
+940
-98
File diff suppressed because it is too large
Load Diff
@@ -13,6 +13,8 @@
|
||||
#define MM_DBG_PRINT_QNAME 0x2
|
||||
#define MM_DBG_PRINT_SEED 0x4
|
||||
#define MM_DBG_PRINT_ALN_SEQ 0x8
|
||||
#define MM_DBG_PRINT_CHAIN 0x10
|
||||
#define MM_DBG_SEED_FREQ 0x20
|
||||
|
||||
#define MM_SEED_LONG_JOIN (1ULL<<40)
|
||||
#define MM_SEED_IGNORE (1ULL<<41)
|
||||
@@ -22,6 +24,9 @@
|
||||
#define MM_SEED_SEG_SHIFT 48
|
||||
#define MM_SEED_SEG_MASK (0xffULL<<(MM_SEED_SEG_SHIFT))
|
||||
|
||||
#define MM_JUNC_ANNO 0x1
|
||||
#define MM_JUNC_MISC 0x2
|
||||
|
||||
#ifndef kroundup32
|
||||
#define kroundup32(x) (--(x), (x)|=(x)>>1, (x)|=(x)>>2, (x)|=(x)>>4, (x)|=(x)>>8, (x)|=(x)>>16, ++(x))
|
||||
#endif
|
||||
@@ -31,17 +36,32 @@
|
||||
|
||||
#define MALLOC(type, len) ((type*)malloc((len) * sizeof(type)))
|
||||
#define CALLOC(type, len) ((type*)calloc((len), sizeof(type)))
|
||||
#define REALLOC(type, ptr, cnt) ((type*)realloc((ptr), (cnt) * sizeof(type)))
|
||||
|
||||
#ifdef __cplusplus
|
||||
extern "C" {
|
||||
#endif
|
||||
|
||||
typedef struct {
|
||||
uint32_t n;
|
||||
uint32_t q_pos;
|
||||
uint32_t q_span:31, flt:1;
|
||||
uint32_t seg_id:31, is_tandem:1;
|
||||
const uint64_t *cr;
|
||||
} mm_seed_t;
|
||||
|
||||
typedef struct {
|
||||
int n_u, n_a;
|
||||
uint64_t *u;
|
||||
mm128_t *a;
|
||||
} mm_seg_t;
|
||||
|
||||
typedef struct {
|
||||
int32_t off, off2, cnt;
|
||||
int16_t strand;
|
||||
uint16_t flag;
|
||||
} mm_idx_jjump1_t;
|
||||
|
||||
double cputime(void);
|
||||
double realtime(void);
|
||||
long peakrss(void);
|
||||
@@ -52,32 +72,52 @@ uint32_t ks_ksmall_uint32_t(size_t n, uint32_t arr[], size_t kk);
|
||||
|
||||
void mm_sketch(void *km, const char *str, int len, int w, int k, uint32_t rid, int is_hpc, mm128_v *p);
|
||||
|
||||
int mm_write_sam_hdr(const mm_idx_t *mi, const char *rg, const char *ver, int argc, char *argv[]);
|
||||
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int opt_flag);
|
||||
void mm_write_paf3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int opt_flag, int rep_len);
|
||||
void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int n_regs, const mm_reg1_t *regs);
|
||||
void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regs, const mm_reg1_t *const* regs, void *km, int opt_flag);
|
||||
void mm_write_sam3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regss, const mm_reg1_t *const* regss, void *km, int opt_flag, int rep_len);
|
||||
mm_seed_t *mm_collect_matches(void *km, int *_n_m, int qlen, int max_occ, int max_max_occ, int dist, const mm_idx_t *mi, const mm128_v *mv, int64_t *n_a, int *rep_len, int *n_mini_pos, uint64_t **mini_pos);
|
||||
void mm_seed_mz_flt(void *km, mm128_v *mv, int32_t q_occ_max, float q_occ_frac);
|
||||
|
||||
double mm_event_identity(const mm_reg1_t *r);
|
||||
int mm_write_sam_hdr(const mm_idx_t *mi, const char *rg, const char *ver, int argc, char *argv[]);
|
||||
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag);
|
||||
void mm_write_paf3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag, int rep_len);
|
||||
void mm_write_paf4(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag, int rep_len, int n_seg, int seg_idx);
|
||||
void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int n_regs, const mm_reg1_t *regs);
|
||||
void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regs, const mm_reg1_t *const* regs, void *km, int64_t opt_flag);
|
||||
void mm_write_sam3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regss, const mm_reg1_t *const* regss, void *km, int64_t opt_flag, int rep_len);
|
||||
void mm_write_junc(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r);
|
||||
|
||||
// indexing related in index.c
|
||||
void mm_idxopt_init(mm_idxopt_t *opt);
|
||||
const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n);
|
||||
int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f);
|
||||
mm128_t *mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int max_iter, int min_cnt, int min_sc, float gap_scale, int is_cdna, int n_segs, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km);
|
||||
mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a);
|
||||
int mm_idx_getseq2(const mm_idx_t *mi, int is_rev, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq);
|
||||
mm_reg1_t *mm_gen_regs(void *km, uint32_t hash, int qlen, int n_u, uint64_t *u, mm128_t *a, int is_qstrand);
|
||||
int mm_idx_bed_read(mm_idx_t *mi, const char *fn, int read_junc);
|
||||
int mm_idx_jjump_read(mm_idx_t *mi, const char *fn, int flag, int min_sc);
|
||||
const mm_idx_jjump1_t *mm_idx_jump_get(const mm_idx_t *db, int32_t cid, int32_t st, int32_t en, int32_t *n);
|
||||
|
||||
// chaining in lchain.c
|
||||
mm128_t *mg_lchain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int max_iter, int min_cnt, int min_sc, float chn_pen_gap, float chn_pen_skip,
|
||||
int is_cdna, int n_segs, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km);
|
||||
mm128_t *mg_lchain_rmq(int max_dist, int max_dist_inner, int bw, int max_chn_skip, int cap_rmq_size, int min_cnt, int min_sc, float chn_pen_gap, float chn_pen_skip,
|
||||
int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km);
|
||||
|
||||
mm_reg1_t *mm_gen_regs(void *km, uint32_t hash, int qlen, int n_u, uint64_t *u, mm128_t *a);
|
||||
void mm_mark_alt(const mm_idx_t *mi, int n, mm_reg1_t *r);
|
||||
void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a);
|
||||
void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a, int is_qstrand);
|
||||
void mm_sync_regs(void *km, int n_regs, mm_reg1_t *regs);
|
||||
int mm_squeeze_a(void *km, int n_regs, mm_reg1_t *regs, mm128_t *a);
|
||||
int mm_set_sam_pri(int n, mm_reg1_t *r);
|
||||
void mm_set_parent(void *km, float mask_level, int mask_len, int n, mm_reg1_t *r, int sub_diff, int hard_mask_level, float alt_diff_frac);
|
||||
void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int *n_, mm_reg1_t *r);
|
||||
void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int check_strand, int min_strand_sc, int *n_, mm_reg1_t *r);
|
||||
void mm_select_sub_multi(void *km, float pri_ratio, float pri1, float pri2, int max_gap_ref, int min_diff, int best_n, int n_segs, const int *qlens, int *n_, mm_reg1_t *r);
|
||||
int mm_filter_strand_retained(int n_regs, mm_reg1_t *r);
|
||||
void mm_filter_regs(const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs);
|
||||
void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs, mm128_t *a);
|
||||
void mm_hit_sort(void *km, int *n_regs, mm_reg1_t *r, float alt_diff_frac);
|
||||
void mm_set_mapq(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr);
|
||||
void mm_set_mapq2(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr, int is_splice);
|
||||
void mm_update_dp_max(int qlen, int n_regs, mm_reg1_t *regs, float frac, int a, int b);
|
||||
void mm_jump_split(void *km, const mm_idx_t *mi, const mm_mapopt_t *opt, int32_t qlen, const uint8_t *qseq, mm_reg1_t *r, int32_t ts_strand);
|
||||
|
||||
mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a);
|
||||
void mm_enlarge_cigar(mm_reg1_t *r, uint32_t n_cigar);
|
||||
|
||||
void mm_est_err(const mm_idx_t *mi, int qlen, int n_regs, mm_reg1_t *regs, const mm128_t *a, int32_t n, const uint64_t *mini_pos);
|
||||
|
||||
@@ -85,6 +125,8 @@ mm_seg_t *mm_seg_gen(void *km, uint32_t hash, int n_segs, const int *qlens, int
|
||||
void mm_seg_free(void *km, int n_segs, mm_seg_t *segs);
|
||||
void mm_pair(void *km, int max_gap_ref, int dp_bonus, int sub_diff, int match_sc, const int *qlens, int *n_regs, mm_reg1_t **regs);
|
||||
|
||||
void mm_jump_split(void *km, const mm_idx_t *mi, const mm_mapopt_t *opt, int32_t qlen, const uint8_t *qseq, mm_reg1_t *r, int32_t ts_strand);
|
||||
|
||||
FILE *mm_split_init(const char *prefix, const mm_idx_t *mi);
|
||||
mm_idx_t *mm_split_merge_prep(const char *prefix, int n_splits, FILE **fp, uint32_t *n_seq_part);
|
||||
int mm_split_merge(int n_segs, const char **fn, const mm_mapopt_t *opt, int n_split_idx);
|
||||
@@ -94,6 +136,16 @@ void mm_err_puts(const char *str);
|
||||
void mm_err_fwrite(const void *p, size_t size, size_t nitems, FILE *fp);
|
||||
void mm_err_fread(void *p, size_t size, size_t nitems, FILE *fp);
|
||||
|
||||
static inline float mg_log2(float x) // NB: this doesn't work when x<2
|
||||
{
|
||||
union { float f; uint32_t i; } z = { x };
|
||||
float log_2 = ((z.i >> 23) & 255) - 128;
|
||||
z.i &= ~(255 << 23);
|
||||
z.i += 127 << 23;
|
||||
log_2 += (-0.34484843f * z.f + 2.02466578f) * z.f - 0.67487759f;
|
||||
return log_2;
|
||||
}
|
||||
|
||||
#ifdef __cplusplus
|
||||
}
|
||||
#endif
|
||||
|
||||
@@ -8,7 +8,7 @@ void mm_idxopt_init(mm_idxopt_t *opt)
|
||||
opt->k = 15, opt->w = 10, opt->flag = 0;
|
||||
opt->bucket_bits = 14;
|
||||
opt->mini_batch_size = 50000000;
|
||||
opt->batch_size = 4000000000ULL;
|
||||
opt->batch_size = 8000000000ULL;
|
||||
}
|
||||
|
||||
void mm_mapopt_init(mm_mapopt_t *opt)
|
||||
@@ -16,30 +16,36 @@ void mm_mapopt_init(mm_mapopt_t *opt)
|
||||
memset(opt, 0, sizeof(mm_mapopt_t));
|
||||
opt->seed = 11;
|
||||
opt->mid_occ_frac = 2e-4f;
|
||||
opt->min_mid_occ = 10;
|
||||
opt->max_mid_occ = 1000000;
|
||||
opt->sdust_thres = 0; // no SDUST masking
|
||||
opt->q_occ_frac = 0.01f;
|
||||
|
||||
opt->min_cnt = 3;
|
||||
opt->min_chain_score = 40;
|
||||
opt->bw = 500;
|
||||
opt->bw = 500, opt->bw_long = 20000;
|
||||
opt->max_gap = 5000;
|
||||
opt->max_gap_ref = -1;
|
||||
opt->max_chain_skip = 25;
|
||||
opt->max_chain_iter = 5000;
|
||||
opt->chain_gap_scale = 1.0f;
|
||||
opt->rmq_inner_dist = 1000;
|
||||
opt->rmq_size_cap = 100000;
|
||||
opt->rmq_rescue_size = 1000;
|
||||
opt->rmq_rescue_ratio = 0.1f;
|
||||
opt->chain_gap_scale = 0.8f;
|
||||
opt->chain_skip_scale = 0.0f;
|
||||
opt->max_max_occ = 4095;
|
||||
opt->occ_dist = 500;
|
||||
|
||||
opt->mask_level = 0.5f;
|
||||
opt->mask_len = INT_MAX;
|
||||
opt->pri_ratio = 0.8f;
|
||||
opt->best_n = 5;
|
||||
|
||||
opt->max_join_long = 20000;
|
||||
opt->max_join_short = 2000;
|
||||
opt->min_join_flank_sc = 1000;
|
||||
opt->min_join_flank_ratio = 0.5f;
|
||||
|
||||
opt->alt_drop = 0.15f;
|
||||
|
||||
opt->a = 2, opt->b = 4, opt->q = 4, opt->e = 2, opt->q2 = 24, opt->e2 = 1;
|
||||
opt->transition = 0;
|
||||
opt->sc_ambi = 1;
|
||||
opt->zdrop = 400, opt->zdrop_inv = 200;
|
||||
opt->end_bonus = -1;
|
||||
@@ -48,19 +54,30 @@ void mm_mapopt_init(mm_mapopt_t *opt)
|
||||
opt->anchor_ext_len = 20, opt->anchor_ext_shift = 6;
|
||||
opt->max_clip_ratio = 1.0f;
|
||||
opt->mini_batch_size = 500000000;
|
||||
opt->max_sw_mat = 100000000;
|
||||
opt->cap_kalloc = 500000000;
|
||||
|
||||
opt->rank_min_len = 500;
|
||||
opt->rank_frac = 0.9f;
|
||||
|
||||
opt->pe_ori = 0; // FF
|
||||
opt->pe_bonus = 33;
|
||||
|
||||
opt->jump_min_match = 3;
|
||||
}
|
||||
|
||||
void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
|
||||
{
|
||||
if ((opt->flag & MM_F_SPLICE_FOR) || (opt->flag & MM_F_SPLICE_REV))
|
||||
opt->flag |= MM_F_SPLICE;
|
||||
if (opt->mid_occ <= 0)
|
||||
if (opt->mid_occ <= 0) {
|
||||
opt->mid_occ = mm_idx_cal_max_occ(mi, opt->mid_occ_frac);
|
||||
if (opt->mid_occ < opt->min_mid_occ)
|
||||
opt->mid_occ = opt->min_mid_occ;
|
||||
if (opt->mid_occ < opt->min_mid_occ)
|
||||
opt->mid_occ = opt->min_mid_occ;
|
||||
if (opt->max_mid_occ > opt->min_mid_occ && opt->mid_occ > opt->max_mid_occ)
|
||||
opt->mid_occ = opt->max_mid_occ;
|
||||
}
|
||||
if (opt->bw_long < opt->bw) opt->bw_long = opt->bw;
|
||||
if (mm_verbose >= 3)
|
||||
fprintf(stderr, "[M::%s::%.3f*%.2f] mid_occ = %d\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), opt->mid_occ);
|
||||
}
|
||||
@@ -68,7 +85,7 @@ void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
|
||||
void mm_mapopt_max_intron_len(mm_mapopt_t *opt, int max_intron_len)
|
||||
{
|
||||
if ((opt->flag & MM_F_SPLICE) && max_intron_len > 0)
|
||||
opt->max_gap_ref = opt->bw = max_intron_len;
|
||||
opt->max_gap_ref = opt->bw = opt->bw_long = max_intron_len;
|
||||
}
|
||||
|
||||
int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
|
||||
@@ -76,37 +93,61 @@ int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
|
||||
if (preset == 0) {
|
||||
mm_idxopt_init(io);
|
||||
mm_mapopt_init(mo);
|
||||
} else if (strcmp(preset, "lr") == 0 || strcmp(preset, "map-ont") == 0) { // this is the same as the default
|
||||
} else if (strcmp(preset, "ava-ont") == 0) {
|
||||
io->flag = 0, io->k = 15, io->w = 5;
|
||||
mo->flag |= MM_F_ALL_CHAINS | MM_F_NO_DIAG | MM_F_NO_DUAL | MM_F_NO_LJOIN;
|
||||
mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_gap = 10000, mo->max_chain_skip = 25;
|
||||
mo->bw = 2000;
|
||||
mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_chain_skip = 25;
|
||||
mo->bw = mo->bw_long = 2000;
|
||||
mo->occ_dist = 0;
|
||||
} else if (strcmp(preset, "map10k") == 0 || strcmp(preset, "map-pb") == 0) {
|
||||
io->flag |= MM_I_HPC, io->k = 19;
|
||||
} else if (strcmp(preset, "ava-pb") == 0) {
|
||||
io->flag |= MM_I_HPC, io->k = 19, io->w = 5;
|
||||
mo->flag |= MM_F_ALL_CHAINS | MM_F_NO_DIAG | MM_F_NO_DUAL | MM_F_NO_LJOIN;
|
||||
mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_gap = 10000, mo->max_chain_skip = 25;
|
||||
} else if (strcmp(preset, "map10k") == 0 || strcmp(preset, "map-pb") == 0) {
|
||||
io->flag |= MM_I_HPC, io->k = 19;
|
||||
} else if (strcmp(preset, "map-ont") == 0) {
|
||||
mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_chain_skip = 25;
|
||||
mo->bw_long = mo->bw;
|
||||
mo->occ_dist = 0;
|
||||
} else if (strcmp(preset, "lr:hq") == 0 || strcmp(preset, "map-hifi") == 0 || strcmp(preset, "map-ccs") == 0) {
|
||||
io->flag = 0, io->k = 19, io->w = 19;
|
||||
mo->max_gap = 10000;
|
||||
mo->min_mid_occ = 50, mo->max_mid_occ = 500;
|
||||
if (strcmp(preset, "map-hifi") == 0 || strcmp(preset, "map-ccs") == 0) {
|
||||
mo->a = 1, mo->b = 4, mo->q = 6, mo->q2 = 26, mo->e = 2, mo->e2 = 1;
|
||||
mo->min_dp_max = 200;
|
||||
}
|
||||
} else if (strcmp(preset, "lr:hqae") == 0) { // high-quality assembly evaluation
|
||||
io->flag = 0, io->k = 25, io->w = 51;
|
||||
mo->flag |= MM_F_RMQ;
|
||||
mo->min_mid_occ = 50, mo->max_mid_occ = 500;
|
||||
mo->rmq_inner_dist = 5000;
|
||||
mo->occ_dist = 200;
|
||||
mo->best_n = 100;
|
||||
mo->chain_gap_scale = 5.0f;
|
||||
} else if (strcmp(preset, "map-iclr-prerender") == 0) {
|
||||
io->flag = 0, io->k = 15;
|
||||
} else if (strcmp(preset, "asm5") == 0) {
|
||||
mo->b = 6, mo->transition = 1;
|
||||
mo->q = 10, mo->q2 = 50;
|
||||
} else if (strcmp(preset, "map-iclr") == 0) {
|
||||
io->flag = 0, io->k = 19;
|
||||
mo->b = 6, mo->transition = 4;
|
||||
mo->q = 10, mo->q2 = 50;
|
||||
} else if (strncmp(preset, "asm", 3) == 0) {
|
||||
io->flag = 0, io->k = 19, io->w = 19;
|
||||
mo->a = 1, mo->b = 19, mo->q = 39, mo->q2 = 81, mo->e = 3, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
|
||||
mo->min_mid_occ = 100;
|
||||
mo->min_dp_max = 200;
|
||||
mo->best_n = 50;
|
||||
} else if (strcmp(preset, "asm10") == 0) {
|
||||
io->flag = 0, io->k = 19, io->w = 19;
|
||||
mo->a = 1, mo->b = 9, mo->q = 16, mo->q2 = 41, mo->e = 2, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
|
||||
mo->min_mid_occ = 100;
|
||||
mo->min_dp_max = 200;
|
||||
mo->best_n = 50;
|
||||
} else if (strcmp(preset, "asm20") == 0) {
|
||||
io->flag = 0, io->k = 19, io->w = 10;
|
||||
mo->a = 1, mo->b = 4, mo->q = 6, mo->q2 = 26, mo->e = 2, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
|
||||
mo->min_mid_occ = 100;
|
||||
mo->bw = 1000, mo->bw_long = 100000;
|
||||
mo->max_gap = 10000;
|
||||
mo->flag |= MM_F_RMQ;
|
||||
mo->min_mid_occ = 50, mo->max_mid_occ = 500;
|
||||
mo->min_dp_max = 200;
|
||||
mo->best_n = 50;
|
||||
if (strcmp(preset, "asm5") == 0) {
|
||||
mo->a = 1, mo->b = 19, mo->q = 39, mo->q2 = 81, mo->e = 3, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
|
||||
} else if (strcmp(preset, "asm10") == 0) {
|
||||
mo->a = 1, mo->b = 9, mo->q = 16, mo->q2 = 41, mo->e = 2, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
|
||||
} else if (strcmp(preset, "asm20") == 0) {
|
||||
mo->a = 1, mo->b = 4, mo->q = 6, mo->q2 = 26, mo->e = 2, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
|
||||
io->w = 10;
|
||||
} else return -1;
|
||||
} else if (strcmp(preset, "short") == 0 || strcmp(preset, "sr") == 0) {
|
||||
io->flag = 0, io->k = 21, io->w = 11;
|
||||
mo->flag |= MM_F_SR | MM_F_FRAG_MODE | MM_F_NO_PRINT_2ND | MM_F_2_IO_THREADS | MM_F_HEAP_SORT;
|
||||
@@ -116,7 +157,7 @@ int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
|
||||
mo->end_bonus = 10;
|
||||
mo->max_frag_len = 800;
|
||||
mo->max_gap = 100;
|
||||
mo->bw = 100;
|
||||
mo->bw = mo->bw_long = 100;
|
||||
mo->pri_ratio = 0.5f;
|
||||
mo->min_cnt = 2;
|
||||
mo->min_chain_score = 25;
|
||||
@@ -125,22 +166,51 @@ int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
|
||||
mo->mid_occ = 1000;
|
||||
mo->max_occ = 5000;
|
||||
mo->mini_batch_size = 50000000;
|
||||
} else if (strncmp(preset, "splice", 6) == 0 || strcmp(preset, "cdna") == 0) {
|
||||
} else if (strcmp(preset, "splice") == 0 || strcmp(preset, "splice:hq") == 0 || strcmp(preset, "splice:sr") == 0 || strcmp(preset, "cdna") == 0) {
|
||||
io->flag = 0, io->k = 15, io->w = 5;
|
||||
mo->flag |= MM_F_SPLICE | MM_F_SPLICE_FOR | MM_F_SPLICE_REV | MM_F_SPLICE_FLANK;
|
||||
mo->max_gap = 2000, mo->max_gap_ref = mo->bw = 200000;
|
||||
mo->max_sw_mat = 0;
|
||||
mo->max_gap = 2000, mo->max_gap_ref = mo->bw = mo->bw_long = 200000;
|
||||
mo->a = 1, mo->b = 2, mo->q = 2, mo->e = 1, mo->q2 = 32, mo->e2 = 0;
|
||||
mo->noncan = 9;
|
||||
mo->junc_bonus = 9;
|
||||
mo->junc_pen = 5;
|
||||
mo->zdrop = 200, mo->zdrop_inv = 100; // because mo->a is halved
|
||||
if (strcmp(preset, "splice:hq") == 0)
|
||||
mo->junc_bonus = 5, mo->b = 4, mo->q = 6, mo->q2 = 24;
|
||||
if (strcmp(preset, "splice:hq") == 0) {
|
||||
mo->noncan = 5, mo->b = 4, mo->q = 6, mo->q2 = 24;
|
||||
} else if (strcmp(preset, "splice:sr") == 0) {
|
||||
mo->flag |= MM_F_NO_PRINT_2ND | MM_F_2_IO_THREADS | MM_F_HEAP_SORT | MM_F_FRAG_MODE | MM_F_WEAK_PAIRING | MM_F_SR_RNA;
|
||||
mo->noncan = 5, mo->b = 4, mo->q = 6, mo->q2 = 24;
|
||||
mo->min_chain_score = 25;
|
||||
mo->min_dp_max = 40;
|
||||
mo->min_ksw_len = 20;
|
||||
mo->pe_ori = 0<<1|1; // FR
|
||||
mo->best_n = 10;
|
||||
mo->mini_batch_size = 100000000;
|
||||
}
|
||||
} else return -1;
|
||||
return 0;
|
||||
}
|
||||
|
||||
int mm_max_spsc_bonus(const mm_mapopt_t *mo)
|
||||
{
|
||||
int max_sc = (mo->q2 + 1) / 2 - 1;
|
||||
max_sc = max_sc > mo->q2 - mo->q? max_sc : mo->q2 - mo->q;
|
||||
return max_sc;
|
||||
}
|
||||
|
||||
int mm_check_opt(const mm_idxopt_t *io, const mm_mapopt_t *mo)
|
||||
{
|
||||
if (mo->bw > mo->bw_long) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "[ERROR]\033[1;31m with '-rNUM1,NUM2', NUM1 (%d) can't be larger than NUM2 (%d)\033[0m\n", mo->bw, mo->bw_long);
|
||||
return -8;
|
||||
}
|
||||
if ((mo->flag & MM_F_RMQ) && (mo->flag & (MM_F_SR|MM_F_SPLICE))) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "[ERROR]\033[1;31m --rmq doesn't work with --sr or --splice\033[0m\n");
|
||||
return -7;
|
||||
}
|
||||
if (mo->split_prefix && (mo->flag & (MM_F_OUT_CS|MM_F_OUT_MD))) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "[ERROR]\033[1;31m --cs or --MD doesn't work with --split-prefix\033[0m\n");
|
||||
@@ -183,6 +253,11 @@ int mm_check_opt(const mm_idxopt_t *io, const mm_mapopt_t *mo)
|
||||
fprintf(stderr, "[ERROR]\033[1;31m scoring system violating ({-O}+{-E})+({-O2}+{-E2}) <= 127\033[0m\n");
|
||||
return -1;
|
||||
}
|
||||
if (mo->sc_ambi < 0 || mo->sc_ambi >= mo->b) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "[ERROR]\033[1;31m --score-N should be within [0,{-B})\033[0m\n");
|
||||
return -1;
|
||||
}
|
||||
if (mo->zdrop < mo->zdrop_inv) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "[ERROR]\033[1;31m Z-drop should not be less than inversion-Z-drop\033[0m\n");
|
||||
@@ -193,5 +268,10 @@ int mm_check_opt(const mm_idxopt_t *io, const mm_mapopt_t *mo)
|
||||
fprintf(stderr, "[ERROR]\033[1;31m -X/-P and --secondary=no can't be applied at the same time\033[0m\n");
|
||||
return -5;
|
||||
}
|
||||
if ((mo->flag & MM_F_QSTRAND) && ((mo->flag & (MM_F_OUT_SAM|MM_F_SPLICE|MM_F_FRAG_MODE)) || (io->flag & MM_I_HPC))) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "[ERROR]\033[1;31m --qstrand doesn't work with -a, -H, --frag or --splice\033[0m\n");
|
||||
return -5;
|
||||
}
|
||||
return 0;
|
||||
}
|
||||
|
||||
@@ -0,0 +1,2 @@
|
||||
[build-system]
|
||||
requires = ["setuptools", "wheel", "Cython"]
|
||||
+4
-2
@@ -77,7 +77,9 @@ This constructor accepts the following arguments:
|
||||
|
||||
* **min_chain_score**: minimum chaing score
|
||||
|
||||
* **bw**: chaining and alignment band width
|
||||
* **bw**: chaining and alignment band width (initial chaining and extension)
|
||||
|
||||
* **bw_long**: chaining and alignment band width (RMQ-based rechaining and closing gaps)
|
||||
|
||||
* **best_n**: max number of alignments to return
|
||||
|
||||
@@ -144,7 +146,7 @@ properties:
|
||||
* **mlen**: length of the matching bases in the alignment, excluding ambiguous
|
||||
base matches.
|
||||
|
||||
* **NM**: number of mismatches, gaps and ambiguous poistions in the alignment
|
||||
* **NM**: number of mismatches, gaps and ambiguous positions in the alignment
|
||||
|
||||
* **trans_strand**: transcript strand. +1 if on the forward strand; -1 if on the
|
||||
reverse strand; 0 if unknown
|
||||
|
||||
+3
-3
@@ -71,13 +71,13 @@ static inline void mm_reset_timer(void)
|
||||
}
|
||||
|
||||
extern unsigned char seq_comp_table[256];
|
||||
static inline mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char *seq1, const char *seq2, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt)
|
||||
static inline mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char* seqname, const char *seq1, const char *seq2, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt)
|
||||
{
|
||||
mm_reg1_t *r;
|
||||
|
||||
Py_BEGIN_ALLOW_THREADS
|
||||
if (seq2 == 0) {
|
||||
r = mm_map(mi, strlen(seq1), seq1, n_regs, b, opt, NULL);
|
||||
r = mm_map(mi, strlen(seq1), seq1, n_regs, b, opt, seqname);
|
||||
} else {
|
||||
int _n_regs[2];
|
||||
mm_reg1_t *regs[2];
|
||||
@@ -94,7 +94,7 @@ static inline mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char *seq1, const
|
||||
seq[1][i] = seq_comp_table[t];
|
||||
}
|
||||
if (len[1]&1) seq[1][len[1]>>1] = seq_comp_table[(uint8_t)seq[1][len[1]>>1]];
|
||||
mm_map_frag(mi, 2, len, (const char**)seq, _n_regs, regs, b, opt, NULL);
|
||||
mm_map_frag(mi, 2, len, (const char**)seq, _n_regs, regs, b, opt, seqname);
|
||||
for (i = 0; i < _n_regs[1]; ++i)
|
||||
regs[1][i].rev = !regs[1][i].rev;
|
||||
*n_regs = _n_regs[0] + _n_regs[1];
|
||||
|
||||
+23
-6
@@ -13,39 +13,56 @@ cdef extern from "minimap.h":
|
||||
int64_t flag
|
||||
int seed
|
||||
int sdust_thres
|
||||
|
||||
int max_qlen
|
||||
int bw
|
||||
|
||||
int bw, bw_long
|
||||
int max_gap, max_gap_ref
|
||||
int max_frag_len
|
||||
int max_chain_skip, max_chain_iter
|
||||
int min_cnt
|
||||
int min_chain_score
|
||||
float chain_gap_scale
|
||||
float chain_skip_scale
|
||||
int rmq_size_cap, rmq_inner_dist
|
||||
int rmq_rescue_size
|
||||
float rmq_rescue_ratio
|
||||
|
||||
float mask_level
|
||||
int mask_len
|
||||
float pri_ratio
|
||||
int best_n
|
||||
int max_join_long, max_join_short
|
||||
int min_join_flank_sc
|
||||
float min_join_flank_ratio
|
||||
|
||||
float alt_drop
|
||||
|
||||
int a, b, q, e, q2, e2
|
||||
int transition
|
||||
int sc_ambi
|
||||
int noncan
|
||||
int junc_bonus
|
||||
int junc_bonus, junc_pen
|
||||
int zdrop, zdrop_inv
|
||||
int end_bonus
|
||||
int min_dp_max
|
||||
int min_ksw_len
|
||||
int anchor_ext_len, anchor_ext_shift
|
||||
float max_clip_ratio
|
||||
|
||||
int rank_min_len
|
||||
float rank_frac
|
||||
|
||||
int pe_ori, pe_bonus
|
||||
|
||||
int jump_min_match;
|
||||
|
||||
float mid_occ_frac
|
||||
float q_occ_frac
|
||||
int32_t min_mid_occ
|
||||
int32_t mid_occ
|
||||
int32_t max_occ
|
||||
int64_t mini_batch_size
|
||||
int64_t max_sw_mat
|
||||
int64_t cap_kalloc
|
||||
|
||||
const char *split_prefix
|
||||
|
||||
int mm_set_opt(char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
|
||||
@@ -114,7 +131,7 @@ cdef extern from "cmappy.h":
|
||||
|
||||
void mm_reg2hitpy(const mm_idx_t *mi, mm_reg1_t *r, mm_hitpy_t *h)
|
||||
void mm_free_reg1(mm_reg1_t *r)
|
||||
mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char *seq1, const char *seq2, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt)
|
||||
mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char* seqname, const char *seq1, const char *seq2, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt)
|
||||
char *mappy_fetch_seq(const mm_idx_t *mi, const char *name, int st, int en, int *l)
|
||||
mm_idx_t *mappy_idx_seq(int w, int k, int is_hpc, int bucket_bits, const char *seq, int l)
|
||||
|
||||
|
||||
+24
-8
@@ -3,7 +3,7 @@ from libc.stdlib cimport free
|
||||
cimport cmappy
|
||||
import sys
|
||||
|
||||
__version__ = '2.18'
|
||||
__version__ = '2.30'
|
||||
|
||||
cmappy.mm_reset_timer()
|
||||
|
||||
@@ -82,7 +82,7 @@ cdef class Alignment:
|
||||
|
||||
@property
|
||||
def cigar_str(self):
|
||||
return "".join(map(lambda x: str(x[0]) + 'MIDNSH'[x[1]], self._cigar))
|
||||
return "".join(map(lambda x: str(x[0]) + 'MIDNSHP=XB'[x[1]], self._cigar))
|
||||
|
||||
def __str__(self):
|
||||
if self._strand > 0: strand = '+'
|
||||
@@ -96,6 +96,7 @@ cdef class Alignment:
|
||||
a = [str(self._q_st), str(self._q_en), strand, self._ctg, str(self._ctg_len), str(self._r_st), str(self._r_en),
|
||||
str(self._mlen), str(self._blen), str(self._mapq), tp, ts, "cg:Z:" + self.cigar_str]
|
||||
if self._cs != "": a.append("cs:Z:" + self._cs)
|
||||
if self._MD != "": a.append("MD:Z:" + self._MD)
|
||||
return "\t".join(a)
|
||||
|
||||
cdef class ThreadBuffer:
|
||||
@@ -112,7 +113,7 @@ cdef class Aligner:
|
||||
cdef cmappy.mm_idxopt_t idx_opt
|
||||
cdef cmappy.mm_mapopt_t map_opt
|
||||
|
||||
def __cinit__(self, fn_idx_in=None, preset=None, k=None, w=None, min_cnt=None, min_chain_score=None, min_dp_score=None, bw=None, best_n=None, n_threads=3, fn_idx_out=None, max_frag_len=None, extra_flags=None, seq=None, scoring=None):
|
||||
def __cinit__(self, fn_idx_in=None, preset=None, k=None, w=None, min_cnt=None, min_chain_score=None, min_dp_score=None, bw=None, bw_long=None, best_n=None, n_threads=3, fn_idx_out=None, max_frag_len=None, extra_flags=None, seq=None, scoring=None, sc_ambi=None, max_chain_skip=None):
|
||||
self._idx = NULL
|
||||
cmappy.mm_set_opt(NULL, &self.idx_opt, &self.map_opt) # set the default options
|
||||
if preset is not None:
|
||||
@@ -125,6 +126,7 @@ cdef class Aligner:
|
||||
if min_chain_score is not None: self.map_opt.min_chain_score = min_chain_score
|
||||
if min_dp_score is not None: self.map_opt.min_dp_max = min_dp_score
|
||||
if bw is not None: self.map_opt.bw = bw
|
||||
if bw_long is not None: self.map_opt.bw_long = bw_long
|
||||
if best_n is not None: self.map_opt.best_n = best_n
|
||||
if max_frag_len is not None: self.map_opt.max_frag_len = max_frag_len
|
||||
if extra_flags is not None: self.map_opt.flag |= extra_flags
|
||||
@@ -136,6 +138,8 @@ cdef class Aligner:
|
||||
self.map_opt.q2, self.map_opt.e2 = scoring[4], scoring[5]
|
||||
if len(scoring) >= 7:
|
||||
self.map_opt.sc_ambi = scoring[6]
|
||||
if sc_ambi is not None: self.map_opt.sc_ambi = sc_ambi
|
||||
if max_chain_skip is not None: self.map_opt.max_chain_skip = max_chain_skip
|
||||
|
||||
cdef cmappy.mm_idx_reader_t *r;
|
||||
|
||||
@@ -161,7 +165,7 @@ cdef class Aligner:
|
||||
def __bool__(self):
|
||||
return (self._idx != NULL)
|
||||
|
||||
def map(self, seq, seq2=None, buf=None, cs=False, MD=False, max_frag_len=None, extra_flags=None):
|
||||
def map(self, seq, seq2=None, name=None, buf=None, cs=False, MD=False, max_frag_len=None, extra_flags=None):
|
||||
cdef cmappy.mm_reg1_t *regs
|
||||
cdef cmappy.mm_hitpy_t h
|
||||
cdef ThreadBuffer b
|
||||
@@ -172,6 +176,7 @@ cdef class Aligner:
|
||||
cdef cmappy.mm_mapopt_t map_opt
|
||||
|
||||
if self._idx == NULL: return
|
||||
if ((self.map_opt.flag & 4) and (self._idx.flag & 2)): return
|
||||
map_opt = self.map_opt
|
||||
if max_frag_len is not None: map_opt.max_frag_len = max_frag_len
|
||||
if extra_flags is not None: map_opt.flag |= extra_flags
|
||||
@@ -182,11 +187,20 @@ cdef class Aligner:
|
||||
km = cmappy.mm_tbuf_get_km(b._b)
|
||||
|
||||
_seq = seq if isinstance(seq, bytes) else seq.encode()
|
||||
if name is not None:
|
||||
_name = name if isinstance(name, bytes) else name.encode()
|
||||
|
||||
if seq2 is None:
|
||||
regs = cmappy.mm_map_aux(self._idx, _seq, NULL, &n_regs, b._b, &map_opt)
|
||||
if name is None:
|
||||
regs = cmappy.mm_map_aux(self._idx, NULL, _seq, NULL, &n_regs, b._b, &map_opt)
|
||||
else:
|
||||
regs = cmappy.mm_map_aux(self._idx, _name, _seq, NULL, &n_regs, b._b, &map_opt)
|
||||
else:
|
||||
_seq2 = seq2 if isinstance(seq2, bytes) else seq2.encode()
|
||||
regs = cmappy.mm_map_aux(self._idx, _seq, _seq2, &n_regs, b._b, &map_opt)
|
||||
if name is None:
|
||||
regs = cmappy.mm_map_aux(self._idx, NULL, _seq, _seq2, &n_regs, b._b, &map_opt)
|
||||
else:
|
||||
regs = cmappy.mm_map_aux(self._idx, _name, _seq, _seq2, &n_regs, b._b, &map_opt)
|
||||
|
||||
try:
|
||||
i = 0
|
||||
@@ -197,11 +211,12 @@ cdef class Aligner:
|
||||
c = h.cigar32[k]
|
||||
cigar.append([c>>4, c&0xf])
|
||||
if cs or MD: # generate the cs and/or the MD tag, if requested
|
||||
_cur_seq = _seq2 if h.seg_id > 0 and seq2 is not None else _seq
|
||||
if cs:
|
||||
l_cs_str = cmappy.mm_gen_cs(km, &cs_str, &m_cs_str, self._idx, ®s[i], _seq, 1)
|
||||
l_cs_str = cmappy.mm_gen_cs(km, &cs_str, &m_cs_str, self._idx, ®s[i], _cur_seq, 1)
|
||||
_cs = cs_str[:l_cs_str] if isinstance(cs_str, str) else cs_str[:l_cs_str].decode()
|
||||
if MD:
|
||||
l_cs_str = cmappy.mm_gen_MD(km, &cs_str, &m_cs_str, self._idx, ®s[i], _seq)
|
||||
l_cs_str = cmappy.mm_gen_MD(km, &cs_str, &m_cs_str, self._idx, ®s[i], _cur_seq)
|
||||
_MD = cs_str[:l_cs_str] if isinstance(cs_str, str) else cs_str[:l_cs_str].decode()
|
||||
yield Alignment(h.ctg, h.ctg_len, h.ctg_start, h.ctg_end, h.strand, h.qry_start, h.qry_end, h.mapq, cigar, h.is_primary, h.mlen, h.blen, h.NM, h.trans_strand, h.seg_id, _cs, _MD)
|
||||
cmappy.mm_free_reg1(®s[i])
|
||||
@@ -217,6 +232,7 @@ cdef class Aligner:
|
||||
cdef int l
|
||||
cdef char *s
|
||||
if self._idx == NULL: return
|
||||
if ((self.map_opt.flag & 4) and (self._idx.flag & 2)): return
|
||||
s = cmappy.mappy_fetch_seq(self._idx, name.encode(), start, end, &l)
|
||||
if l == 0: return None
|
||||
r = s[:l] if isinstance(s, str) else s[:l].decode()
|
||||
|
||||
+5
-3
@@ -5,7 +5,7 @@ import getopt
|
||||
import mappy as mp
|
||||
|
||||
def main(argv):
|
||||
opts, args = getopt.getopt(argv[1:], "x:n:m:k:w:r:c")
|
||||
opts, args = getopt.getopt(argv[1:], "x:n:m:k:w:r:cM")
|
||||
if len(args) < 2:
|
||||
print("Usage: minimap2.py [options] <ref.fa>|<ref.mmi> <query.fq>")
|
||||
print("Options:")
|
||||
@@ -16,10 +16,11 @@ def main(argv):
|
||||
print(" -w INT minimizer window length")
|
||||
print(" -r INT band width")
|
||||
print(" -c output the cs tag")
|
||||
print(" -M output the MD tag")
|
||||
sys.exit(1)
|
||||
|
||||
preset = min_cnt = min_sc = k = w = bw = None
|
||||
out_cs = False
|
||||
out_cs = out_MD = False
|
||||
for opt, arg in opts:
|
||||
if opt == '-x': preset = arg
|
||||
elif opt == '-n': min_cnt = int(arg)
|
||||
@@ -28,11 +29,12 @@ def main(argv):
|
||||
elif opt == '-k': k = int(arg)
|
||||
elif opt == '-w': w = int(arg)
|
||||
elif opt == '-c': out_cs = True
|
||||
elif opt == '-M': out_MD = True
|
||||
|
||||
a = mp.Aligner(args[0], preset=preset, min_cnt=min_cnt, min_chain_score=min_sc, k=k, w=w, bw=bw)
|
||||
if not a: raise Exception("ERROR: failed to load/build index file '{}'".format(args[0]))
|
||||
for name, seq, qual in mp.fastx_read(args[1]): # read one sequence
|
||||
for h in a.map(seq, cs=out_cs): # traverse hits
|
||||
for h in a.map(seq, cs=out_cs, MD=out_MD): # traverse hits
|
||||
print('{}\t{}\t{}'.format(name, len(seq), h))
|
||||
|
||||
if __name__ == "__main__":
|
||||
|
||||
@@ -0,0 +1,132 @@
|
||||
#include "mmpriv.h"
|
||||
#include "kalloc.h"
|
||||
#include "ksort.h"
|
||||
|
||||
void mm_seed_mz_flt(void *km, mm128_v *mv, int32_t q_occ_max, float q_occ_frac)
|
||||
{
|
||||
mm128_t *a;
|
||||
size_t i, j, st;
|
||||
if (mv->n <= q_occ_max || q_occ_frac <= 0.0f || q_occ_max <= 0) return;
|
||||
a = Kmalloc(km, mm128_t, mv->n);
|
||||
for (i = 0; i < mv->n; ++i)
|
||||
a[i].x = mv->a[i].x, a[i].y = i;
|
||||
radix_sort_128x(a, a + mv->n);
|
||||
for (st = 0, i = 1; i <= mv->n; ++i) {
|
||||
if (i == mv->n || a[i].x != a[st].x) {
|
||||
int32_t cnt = i - st;
|
||||
if (cnt > q_occ_max && cnt > mv->n * q_occ_frac)
|
||||
for (j = st; j < i; ++j)
|
||||
mv->a[a[j].y].x = 0;
|
||||
st = i;
|
||||
}
|
||||
}
|
||||
kfree(km, a);
|
||||
for (i = j = 0; i < mv->n; ++i)
|
||||
if (mv->a[i].x != 0)
|
||||
mv->a[j++] = mv->a[i];
|
||||
mv->n = j;
|
||||
}
|
||||
|
||||
mm_seed_t *mm_seed_collect_all(void *km, const mm_idx_t *mi, const mm128_v *mv, int32_t *n_m_)
|
||||
{
|
||||
mm_seed_t *m;
|
||||
size_t i;
|
||||
int32_t k;
|
||||
m = (mm_seed_t*)kmalloc(km, mv->n * sizeof(mm_seed_t));
|
||||
for (i = k = 0; i < mv->n; ++i) {
|
||||
const uint64_t *cr;
|
||||
mm_seed_t *q;
|
||||
mm128_t *p = &mv->a[i];
|
||||
uint32_t q_pos = (uint32_t)p->y, q_span = p->x & 0xff;
|
||||
int t;
|
||||
cr = mm_idx_get(mi, p->x>>8, &t);
|
||||
if (t == 0) continue;
|
||||
q = &m[k++];
|
||||
q->q_pos = q_pos, q->q_span = q_span, q->cr = cr, q->n = t, q->seg_id = p->y >> 32;
|
||||
q->is_tandem = q->flt = 0;
|
||||
if (i > 0 && p->x>>8 == mv->a[i - 1].x>>8) q->is_tandem = 1;
|
||||
if (i < mv->n - 1 && p->x>>8 == mv->a[i + 1].x>>8) q->is_tandem = 1;
|
||||
}
|
||||
*n_m_ = k;
|
||||
return m;
|
||||
}
|
||||
|
||||
#define MAX_MAX_HIGH_OCC 128
|
||||
|
||||
void mm_seed_select(int32_t n, mm_seed_t *a, int len, int max_occ, int max_max_occ, int dist)
|
||||
{ // for high-occ minimizers, choose up to max_high_occ in each high-occ streak
|
||||
extern void ks_heapdown_uint64_t(size_t i, size_t n, uint64_t*);
|
||||
extern void ks_heapmake_uint64_t(size_t n, uint64_t*);
|
||||
int32_t i, last0, m;
|
||||
uint64_t b[MAX_MAX_HIGH_OCC]; // this is to avoid a heap allocation
|
||||
|
||||
if (n == 0 || n == 1) return;
|
||||
for (i = m = 0; i < n; ++i)
|
||||
if (a[i].n > max_occ) ++m;
|
||||
if (m == 0) return; // no high-frequency k-mers; do nothing
|
||||
for (i = 0, last0 = -1; i <= n; ++i) {
|
||||
if (i == n || a[i].n <= max_occ) {
|
||||
if (i - last0 > 1) {
|
||||
int32_t ps = last0 < 0? 0 : (uint32_t)a[last0].q_pos>>1;
|
||||
int32_t pe = i == n? len : (uint32_t)a[i].q_pos>>1;
|
||||
int32_t j, k, st = last0 + 1, en = i;
|
||||
int32_t max_high_occ = (int32_t)((double)(pe - ps) / dist + .499);
|
||||
if (max_high_occ > 0) {
|
||||
if (max_high_occ > MAX_MAX_HIGH_OCC)
|
||||
max_high_occ = MAX_MAX_HIGH_OCC;
|
||||
for (j = st, k = 0; j < en && k < max_high_occ; ++j, ++k)
|
||||
b[k] = (uint64_t)a[j].n<<32 | j;
|
||||
ks_heapmake_uint64_t(k, b); // initialize the binomial heap
|
||||
for (; j < en; ++j) { // if there are more, choose top max_high_occ
|
||||
if (a[j].n < (int32_t)(b[0]>>32)) { // then update the heap
|
||||
b[0] = (uint64_t)a[j].n<<32 | j;
|
||||
ks_heapdown_uint64_t(0, k, b);
|
||||
}
|
||||
}
|
||||
for (j = 0; j < k; ++j) a[(uint32_t)b[j]].flt = 1;
|
||||
}
|
||||
for (j = st; j < en; ++j) a[j].flt ^= 1;
|
||||
for (j = st; j < en; ++j)
|
||||
if (a[j].n > max_max_occ)
|
||||
a[j].flt = 1;
|
||||
}
|
||||
last0 = i;
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
mm_seed_t *mm_collect_matches(void *km, int *_n_m, int qlen, int max_occ, int max_max_occ, int dist, const mm_idx_t *mi, const mm128_v *mv, int64_t *n_a, int *rep_len, int *n_mini_pos, uint64_t **mini_pos)
|
||||
{
|
||||
int rep_st = 0, rep_en = 0, n_m, n_m0;
|
||||
size_t i;
|
||||
mm_seed_t *m;
|
||||
*n_mini_pos = 0;
|
||||
*mini_pos = (uint64_t*)kmalloc(km, mv->n * sizeof(uint64_t));
|
||||
m = mm_seed_collect_all(km, mi, mv, &n_m0);
|
||||
if (dist > 0 && max_max_occ > max_occ) {
|
||||
mm_seed_select(n_m0, m, qlen, max_occ, max_max_occ, dist);
|
||||
} else {
|
||||
for (i = 0; i < n_m0; ++i)
|
||||
if (m[i].n > max_occ)
|
||||
m[i].flt = 1;
|
||||
}
|
||||
for (i = 0, n_m = 0, *rep_len = 0, *n_a = 0; i < n_m0; ++i) {
|
||||
mm_seed_t *q = &m[i];
|
||||
if (mm_dbg_flag & MM_DBG_SEED_FREQ)
|
||||
fprintf(stderr, "SF\t%d\t%d\t%d\n", q->q_pos>>1, q->n, q->flt);
|
||||
if (q->flt) {
|
||||
int en = (q->q_pos >> 1) + 1, st = en - q->q_span;
|
||||
if (st > rep_en) {
|
||||
*rep_len += rep_en - rep_st;
|
||||
rep_st = st, rep_en = en;
|
||||
} else rep_en = en;
|
||||
} else {
|
||||
*n_a += q->n;
|
||||
(*mini_pos)[(*n_mini_pos)++] = (uint64_t)q->q_span<<32 | q->q_pos>>1;
|
||||
m[n_m++] = *q;
|
||||
}
|
||||
}
|
||||
*rep_len += rep_en - rep_st;
|
||||
*_n_m = n_m;
|
||||
return m;
|
||||
}
|
||||
@@ -23,7 +23,7 @@ def readme():
|
||||
|
||||
setup(
|
||||
name = 'mappy',
|
||||
version = '2.18',
|
||||
version = '2.30',
|
||||
url = 'https://github.com/lh3/minimap2',
|
||||
description = 'Minimap2 python binding',
|
||||
long_description = readme(),
|
||||
@@ -33,7 +33,7 @@ setup(
|
||||
keywords = 'sequence-alignment',
|
||||
scripts = ['python/minimap2.py'],
|
||||
ext_modules = [Extension('mappy',
|
||||
sources = ['python/mappy.pyx', 'align.c', 'bseq.c', 'chain.c', 'format.c', 'hit.c', 'index.c', 'pe.c', 'options.c',
|
||||
sources = ['python/mappy.pyx', 'align.c', 'bseq.c', 'lchain.c', 'seed.c', 'format.c', 'hit.c', 'index.c', 'pe.c', 'jump.c', 'options.c',
|
||||
'ksw2_extd2_sse.c', 'ksw2_exts2_sse.c', 'ksw2_extz2_sse.c', 'ksw2_ll_sse.c',
|
||||
'kalloc.c', 'kthread.c', 'map.c', 'misc.c', 'sdust.c', 'sketch.c', 'esterr.c', 'splitidx.c'],
|
||||
depends = ['minimap.h', 'bseq.h', 'kalloc.h', 'kdq.h', 'khash.h', 'kseq.h', 'ksort.h',
|
||||
|
||||
@@ -0,0 +1,5 @@
|
||||
mm2: TGTTATCCCTAGGGTAACTTGTTCCGTTGGTCAAGTTATTGGATCAATTGAGTATAGTAGTGCACTCAC......................................................................................................................................CACTTGGAGCCATTCATACAGGTCCCTATTTAAGGAACAAGTGATTATGCTACCTTTGCACGGTT
|
||||
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
||||
ref: TGTTATCCCTAGGGTAACTTGTTCCGTTGGTCAAGTTATTGGATCAATTGAGTATAGTAGTGCACTCACctGCTTCGCTTTGACTGGTGAAGTCTTAGCATGTACTGCTCGGAGGTTGGGTTCTGCTCCGAGGTCGCCCCAACCGAAATTTTTAATGCAGGTTTGGTAGTTTAGGACCTGTGGGTTTGTTAGGCTAACCTCacCACTTGGAGCCATTCATACAGGTCCCTATTTAAGGAACAAGTGATTATGCTACCTTTGCACGGTT
|
||||
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
||||
sta: TGTTATCCCTAGGGTAACTTGTTCCGTTGGTCAAGTTATTGGATCAATTGAGTATAGTAGTGCA......................................................................................................................................CTCACCACTTGGAGCCATTCATACAGGTCCCTATTTAAGGAACAAGTGATTATGCTACCTTTGCACGGTT
|
||||
@@ -0,0 +1,5 @@
|
||||
>query
|
||||
AACCGTGCAAAGGTAGCATAATCACTTGTTCCTTAAATAGGGACCTGTATGAATGGCTCC
|
||||
AAGTG
|
||||
GTGAGTGCA
|
||||
CTACTATACTCAATTGATCCAATAACTTGACCAACGGAACAAGTTACCCTAGGGATAACA
|
||||
@@ -0,0 +1,10 @@
|
||||
>ref
|
||||
TGATCCAACATCGAGGTCGTAAACCCTATTGTTGATATGGACTCTAGAATAGGATTGCGC
|
||||
TGTTATCCCTAGGGTAACTTGTTCCGTTGGTCAAGTTATTGGATCAATTGAGTATAGTAG
|
||||
TGCACTCAC
|
||||
ctGCTTCGCTTTGACTGGTGAAGTCTTAGCATGTACTGCTCGGAGGTTGGGTTCTGCTCC
|
||||
GAGGTCGCCCCAACCGAAATTTTTAATGCAGGTTTGGTAGTTTAGGACCTGTGGGTTTGT
|
||||
TAGGCTAACCTCac
|
||||
CACTTGGAGCCATTCATACAGGTCCCTATTTAAGGAACAAGTGATTATGCTACCTTTGCA
|
||||
CGGTTAGGGTACCGCGGCCGTTAAACATGTGTCACTGGGCAGGCGGTGCCTCTAATACTG
|
||||
GTGAT
|
||||
@@ -338,3 +338,123 @@
|
||||
Title = {Introducing difference recurrence relations for faster semi-global alignment of long sequences},
|
||||
Volume = {19},
|
||||
Year = {2018}}
|
||||
|
||||
@article{Li:2018ab,
|
||||
Author = {Li, Heng},
|
||||
Journal = {Bioinformatics},
|
||||
Pages = {3094-3100},
|
||||
Title = {Minimap2: pairwise alignment for nucleotide sequences},
|
||||
Volume = {34},
|
||||
Year = {2018}}
|
||||
|
||||
@article{Jain:2020aa,
|
||||
Author = {Jain, Chirag and others},
|
||||
Journal = {Bioinformatics},
|
||||
Pages = {i111-i118},
|
||||
Title = {Weighted minimizer sampling improves long read mapping},
|
||||
Volume = {36},
|
||||
Year = {2020}}
|
||||
|
||||
@article{Miga:2020aa,
|
||||
Author = {Miga, Karen H and others},
|
||||
Journal = {Nature},
|
||||
Pages = {79-84},
|
||||
Title = {Telomere-to-telomere assembly of a complete human {X} chromosome},
|
||||
Volume = {585},
|
||||
Year = {2020}}
|
||||
|
||||
@article {Jain2020.11.01.363887,
|
||||
author = {Jain, Chirag and others},
|
||||
title = {A long read mapping method for highly repetitive reference sequences},
|
||||
elocation-id = {2020.11.01.363887},
|
||||
year = {2020},
|
||||
doi = {10.1101/2020.11.01.363887},
|
||||
publisher = {Cold Spring Harbor Laboratory},
|
||||
URL = {https://www.biorxiv.org/content/early/2020/11/02/2020.11.01.363887},
|
||||
eprint = {https://www.biorxiv.org/content/early/2020/11/02/2020.11.01.363887.full.pdf},
|
||||
journal = {bioRxiv}
|
||||
}
|
||||
|
||||
@article{Li:2020aa,
|
||||
Author = {Li, Heng and others},
|
||||
Journal = {Genome Biol},
|
||||
Pages = {265},
|
||||
Title = {The design and construction of reference pangenome graphs with minigraph},
|
||||
Volume = {21},
|
||||
Year = {2020}}
|
||||
|
||||
@article{Ren:2021aa,
|
||||
Author = {Ren, Jingwen and Chaisson, Mark J P},
|
||||
Journal = {PLoS Comput Biol},
|
||||
Pages = {e1009078},
|
||||
Title = {lra: A long read aligner for sequences and contigs},
|
||||
Volume = {17},
|
||||
Year = {2021}}
|
||||
|
||||
@inproceedings{DBLP:conf/wabi/AbouelhodaO03,
|
||||
Author = {Mohamed Ibrahim Abouelhoda and Enno Ohlebusch},
|
||||
Booktitle = {Algorithms in Bioinformatics, Third International Workshop, {WABI} 2003, Budapest, Hungary, September 15-20, 2003, Proceedings},
|
||||
Crossref = {DBLP:conf/wabi/2003},
|
||||
Pages = {1--16},
|
||||
Title = {A Local Chaining Algorithm and Its Applications in Comparative Genomics},
|
||||
Year = {2003}}
|
||||
|
||||
@article{Ono:2021aa,
|
||||
Author = {Ono, Yukiteru and others},
|
||||
Journal = {Bioinformatics},
|
||||
Pages = {589-595},
|
||||
Title = {{PBSIM2}: a simulator for long-read sequencers with a novel generative model of quality scores},
|
||||
Volume = {37},
|
||||
Year = {2021}}
|
||||
|
||||
@article{Sedlazeck:2018ab,
|
||||
Author = {Sedlazeck, Fritz J and others},
|
||||
Journal = {Nat Methods},
|
||||
Pages = {461-468},
|
||||
Title = {Accurate detection of complex structural variations using single-molecule sequencing},
|
||||
Volume = {15},
|
||||
Year = {2018}}
|
||||
|
||||
@article{Jeffares:2017aa,
|
||||
Author = {Jeffares, Daniel C and others},
|
||||
Journal = {Nat Commun},
|
||||
Pages = {14061},
|
||||
Title = {Transient structural variations have strong effects on quantitative traits and reproductive isolation in fission yeast},
|
||||
Volume = {8},
|
||||
Year = {2017}}
|
||||
|
||||
@article{Zook:2020aa,
|
||||
Author = {Zook, Justin M and others},
|
||||
Journal = {Nat Biotechnol},
|
||||
Pages = {1347-1355},
|
||||
Title = {A robust benchmark for detection of germline large deletions and insertions},
|
||||
Volume = {38},
|
||||
Year = {2020}}
|
||||
|
||||
@article{Harpak:2017aa,
|
||||
Author = {Harpak, Arbel and others},
|
||||
Journal = {Proc Natl Acad Sci U S A},
|
||||
Pages = {12779-12784},
|
||||
Title = {Frequent nonallelic gene conversion on the human lineage and its effect on the divergence of gene duplicates},
|
||||
Volume = {114},
|
||||
Year = {2017}}
|
||||
|
||||
@article{Li:2018aa,
|
||||
Author = {Li, Heng and others},
|
||||
Journal = {Nat Methods},
|
||||
Month = {Aug},
|
||||
Number = {8},
|
||||
Pages = {595-597},
|
||||
Title = {A synthetic-diploid benchmark for accurate variant-calling evaluation},
|
||||
Volume = {15},
|
||||
Year = {2018}}
|
||||
|
||||
@article{Gu:1995wt,
|
||||
author = {Gu, X and Li, W H},
|
||||
journal = {J Mol Evol},
|
||||
month = {Apr},
|
||||
number = {4},
|
||||
pages = {464-73},
|
||||
title = {The size distribution of insertions and deletions in human and rodent pseudogenes suggests the logarithmic gap penalty for sequence alignment},
|
||||
volume = {40},
|
||||
year = {1995}}
|
||||
|
||||
@@ -0,0 +1,240 @@
|
||||
\documentclass{bioinfo}
|
||||
\copyrightyear{2021}
|
||||
\pubyear{2021}
|
||||
|
||||
\usepackage{graphicx}
|
||||
\usepackage{hyperref}
|
||||
\usepackage{url}
|
||||
\usepackage{amsmath}
|
||||
\usepackage[ruled,vlined]{algorithm2e}
|
||||
\newcommand\mycommfont[1]{\footnotesize\rmfamily{\it #1}}
|
||||
\SetCommentSty{mycommfont}
|
||||
\SetKwComment{Comment}{$\triangleright$\ }{}
|
||||
|
||||
\usepackage{natbib}
|
||||
\bibliographystyle{apalike}
|
||||
|
||||
\DeclareMathOperator*{\argmax}{argmax}
|
||||
|
||||
\begin{document}
|
||||
\firstpage{1}
|
||||
|
||||
\title[Improvements to minimap2]{New strategies to improve minimap2 alignment accuracy}
|
||||
\author[Li]{Heng Li$^{1,2}$}
|
||||
\address{$^1$Dana-Farber Cancer Institute, 450 Brookline Ave, Boston, MA 02215, USA,
|
||||
$^2$Harvard Medical School, 10 Shattuck St, Boston, MA 02215, USA}
|
||||
|
||||
\maketitle
|
||||
|
||||
\begin{abstract}
|
||||
|
||||
\section{Summary:} We present several recent improvements to minimap2, a
|
||||
versatile pairwise aligner for nucleotide sequences. Now minimap2 v2.22 can
|
||||
more accurately map long reads to highly repetitive regions and align through
|
||||
insertions or deletions up to 100kb by default, addressing major weakness in
|
||||
minimap2 v2.18 or earlier.
|
||||
|
||||
\section{Availability and implementation:}
|
||||
\href{https://github.com/lh3/minimap2}{https://github.com/lh3/minimap2}
|
||||
|
||||
\section{Contact:} hli@ds.dfci.harvard.edu
|
||||
\end{abstract}
|
||||
|
||||
\section{Introduction}
|
||||
Minimap2~\citep{Li:2018ab} is widely used for maping long sequence
|
||||
reads and assembly contigs. \citet{Jain:2020aa} found minimap2 v2.18 or earlier occasionally
|
||||
misaligned reads from highly repetitive regions as minimap2 ignored seeds of
|
||||
high occurrence. They also noticed minimap2 may misplace reads with structural
|
||||
variations (SVs) in such regions~\citep{Jain2020.11.01.363887}. These
|
||||
misalignments have become a pressing issue in the advent of
|
||||
temolere-to-telomore human assembly~\citep{Miga:2020aa}. Meanwhile, old minimap2
|
||||
was unable to efficiently align long insertions/deletions (INDELs) and often
|
||||
breaks an alignment around variable-number tandem repeats (VNTRs). This has
|
||||
inspired new chaining algorithms~\citep{Li:2020aa,Ren:2021aa} which are not
|
||||
integrated into minimap2. Here we will describe recent efforts implemented
|
||||
in v2.19 through v2.22 to improve mapping results.
|
||||
|
||||
\begin{methods}
|
||||
\section{Methods}
|
||||
|
||||
\subsection{Rescuing high-occurrence $k$-mers}\label{sec:high-occ}
|
||||
Minimap2 keeps all $k$-mer minimizers~\citep{Roberts:2004fv} during indexing. Its original
|
||||
implementation only selected low-occurrence minimizers during mapping. The
|
||||
cutoff is a few hundred for mapping long reads against a human genome. If a
|
||||
read habors only a few or even no low-occurrence minimizers, it will fail
|
||||
chaining due to insufficient anchors.
|
||||
|
||||
To resolve this issue, we implemented a new heuristic to add additional
|
||||
minimizers. Suppose we are looking at two adjacent low-occurence $k$-mers
|
||||
located at position $x_1$ and $x_2$, respectively. If $|x_1-x_2|\ge L$,
|
||||
minimap2 v2.22 additionally selects $\lfloor|x_1-x_2|/L\rfloor$ minimizers
|
||||
of the lowest occurrence among minimizers between $x_1$ and $x_2$. Here
|
||||
parameter $L$ controls the frequency of sampling. It defaults to 500.
|
||||
This strategy adds necessary anchors at the cost of increasing total alignment
|
||||
time by a few percent on real data.
|
||||
|
||||
\subsection{Aligning through longer INDELs}
|
||||
The original minimap2 may fail to align long INDELs due to its chaining
|
||||
heuristics. Briefly, minimap2 applies dynamic programming (DP) to chain
|
||||
minimizer anchors. This is a quadratic algorithm, slow for chaining
|
||||
contigs. For acceptable performance, the original minimap2 uses a 500bp band by
|
||||
default, which means a gap longer than 500bp will stop chaining.
|
||||
To align through longer gaps, older minimap2 implemented a long-join heurstic as follows.
|
||||
If there is an INDEL longer than 500bp and the two chains around the INDEL
|
||||
have no overlaps on either the query or the reference sequence, minimap2 may
|
||||
join the two short chains later.
|
||||
This heuristic may fail around VNTRs because short chains
|
||||
often have overlaps in VNTRs. More subtly, minimap2 may escape the inner DP
|
||||
loop early, again for performance, if the chaining result is not improved for
|
||||
50 iterations. When there is a copy number change in a long segmental
|
||||
duplication, the early escape may break around the event even if users
|
||||
specify a large band.
|
||||
|
||||
In minigraph~\citep{Li:2020aa}, we developed a new chaining algorithm that
|
||||
finds up to 1kb INDELs with DP-based chaining and goes through longer INDELs with a
|
||||
subquadratic algorithm~\citep{DBLP:conf/wabi/AbouelhodaO03}. We ported the same
|
||||
algorithm to minimap2 for contig mapping. For long-read mapping, the minigraph
|
||||
algorithm is slower. Minimap2 v2.22 still uses the DP-based algorithm to
|
||||
find short chains and then invokes the minigraph algorithm to rechain anchors in
|
||||
these short chains. The rechaining step achieves the same goal as long-join
|
||||
but is more reliable because it can resolve overlaps between short chains. The old
|
||||
long-join heuristic has since been removed.
|
||||
|
||||
\subsection{Properly mapping long reads with SVs}
|
||||
The original minimap2 ranks an alignment by its Smith-Waterman score and
|
||||
outputs the best scoring alignment. However, when there are SVs on the read,
|
||||
the best scoring alignment is sometimes not the correct alignment.
|
||||
\citet{Jain2020.11.01.363887} resolved this dilemma by altering the mapping
|
||||
algorithm.
|
||||
|
||||
In our view, this problem is rooted in inapropriate scoring: affine-gap penalty
|
||||
over-penalizes a long INDEL that was often evolutionarily created in one event.
|
||||
We should not penalize a SV by a function linear in the SV length. Minimap2 v2.22 instead rescores
|
||||
an alignment with the following scoring function. Suppose an alignment consists
|
||||
of $M$ matching bases, $N$ substitutions and $G$ gap opens, we empirically
|
||||
score the alignment with
|
||||
$$
|
||||
S=M-\frac{N+G}{2d}-\sum_{i=1}^G\log_2(1+g_i)
|
||||
$$
|
||||
where $g_i\ge1$ is the length of the $i$-th gap and
|
||||
$$
|
||||
d=\max\left\{\frac{N+G}{M+N+G},0.02\right\}
|
||||
$$
|
||||
It approximates per-base sequence divergence except with the smallest value set
|
||||
to 2\%. As an analogy to affine-gap scoring, the matching score in our scheme
|
||||
is 1, the mismatch and gap open penalties are both $1/2d$ and the gap extension
|
||||
penalty is a logarithm function of the gap length~\citep{Gu:1995wt}. Our scoring gives a long SV
|
||||
a much milder penalty. In terms of time complexity, scoring an alignment is
|
||||
linear in the length of the alignment. The time spent on rescoring is negligible in
|
||||
practice.
|
||||
|
||||
%If we assume sequences evolve under a duplication-mutation model, we may have a
|
||||
%better way to choose the best alignment. If a long read can be mapped to $n$
|
||||
%loci, we can take the read as the template and build a
|
||||
%pseudo-multi-sequence-alignment (pMSA) of $n+1$ sequences. In this pMSA, we say
|
||||
%a site on the read is informative if the $n$ reference subsequences differ at
|
||||
%the position.
|
||||
|
||||
\end{methods}
|
||||
|
||||
\section{Results}
|
||||
|
||||
\begin{table}
|
||||
\processtable{Evaluation of minimap2 v2.22}
|
||||
{\footnotesize\label{tab:1}\begin{tabular}{p{4.2cm}rrrr}
|
||||
\toprule
|
||||
$[$Benchmark$]$ Metric & v2.22 & v2.18 & Winno & lra \\
|
||||
\midrule
|
||||
$[$sim-map$]$ \% mapped reads at Q10 & 97.9 & 97.6 & {\bf 99.0}& 97.3 \\
|
||||
$[$sim-map$]$ err. rate at Q10 (phredQ) & {\bf 52} & {\bf 52} & 38 & 24 \\
|
||||
$[$winno-cmp$]$ rate of diff. (phredQ) & {\bf 41} & 37 & truth & 18 \\
|
||||
$[$winno-cmp$]$ CPU time (hour) & {\bf 5.0} & 5.3 & 71.8 & 13.1 \\
|
||||
$[$winno-cmp$]$ peak RAM (Gb) & 17.1 & 14.4 & {\bf 9.6} & 12.4 \\
|
||||
$[$sim-sv$]$ \% false negative rate & {\bf 0.5} & 2.0 & {\bf 0.5} & 1.4 \\
|
||||
$[$sim-sv$]$ \% false discovery rate & {\bf 0.0} & 0.1 & {\bf 0.0} & 0.1 \\
|
||||
$[$real-sv-1k$]$ \% false negative rate & {\bf 7.3} & 20.0 & 13.0 & N/A \\
|
||||
$[$real-sv-1k$]$ \% false discovery rate & 2.7 & {\bf 2.4} & 2.7 & N/A \\
|
||||
\botrule
|
||||
\end{tabular}}
|
||||
{In $[$sim-map$]$, 152,713 reads were simulated from the CHM13 telomere-to-telomere assembly v1.1
|
||||
(AC: GCA\_009914755.3) with pbsim2~\citep{Ono:2021aa}: ``pbsim2 -{}-hmm\_model R94.model -{}-length-min
|
||||
5000 -{}-length-mean 20000 -{}-accuracy-mean 0.95''. Alignments of mapping quality
|
||||
10 or higher were evaluated by ``paftools.js mapeval''. The mapping error rate
|
||||
is measured in the phred scale: if the error rate is $e$, $-10\log_{10}e$ is
|
||||
reported in the table. In $[$winno-cmp$]$, 1.39 million CHM13 HiFi reads from
|
||||
SRR11292121 were mapped against the same CHM13 assembly. 99.3\% of them were mapped by Winnowmap2
|
||||
at mapping quality 10 or higher and were taken as ground truth to evaluate
|
||||
minimap2 and lra with ``paftools.js pafcmp''. $[$sim-sv$]$ simulated 1,000
|
||||
50bp to 1000bp INDELs from chr8 in CHM13 using SURVIVOR~\citep{Jeffares:2017aa} and simulated Nanopore
|
||||
reads at 30-fold coverage with the same pbsim2 command line. SVs were called with
|
||||
``sniffles -q 10''~\citep{Sedlazeck:2018ab} and compared to the simulated truth with ``SURVIVOR eval
|
||||
call.vcf truth.bed 50''. In $[$real-sv-1k$]$, small and long variants were
|
||||
called by dipcall-0.3~\citep{Li:2018aa} for HG002 assemblies (AC: GCA\_018852605.1 and
|
||||
GCA\_018852615.1) and compared to the GIAB truth~\citep{Zook:2020aa} using ``truvari -r 2000 -s
|
||||
1000 -S 400 -{}-multimatch -{}-passonly'' which sets the minimum INDEL size to 1kb in evaluation. }
|
||||
\end{table}
|
||||
|
||||
We evaluated minimap2 v2.22 along with v2.18, Winnowmap2 v2.03 and lra v1.3.2
|
||||
(Table~\ref{tab:1}), using the default setting of each mapper according to the input data types.
|
||||
Both versions of minimap2 achieved high mapping accuracy on
|
||||
simulated Nanopore reads (sim-map). Winnowmap2 aligned more reads at mapping
|
||||
quality 10 or higher (mapQ10). However, it may occasionally assign a high mapping
|
||||
quality to a read with multiple identical best alignments. This reduced its
|
||||
mapping accuracy.
|
||||
|
||||
In lack of groud truth for real data, we took Winnowmap2 mapping as ground
|
||||
truth to evaluate other mappers (winno-cmp in Table~\ref{tab:1}). Out of 1,378,092 reads with mapQ10
|
||||
alignments by Winnowmap2, minimap2 v2.22 could map all of them. 118 reads, less
|
||||
than 0.01\% of all reads, were mapped differently by v2.22. 51 of them have
|
||||
multiple identical best alignments. We believe these are more likely to be
|
||||
Winnowmap2 errors. Most of the remaining 67 (=118-51) reads have multiple
|
||||
highly similar but not identical alignments.
|
||||
Minimap2 v2.18 is less consistent with 275 differences including 30 unmapped
|
||||
reads mappable by both Winnowmap2 and v2.22.
|
||||
|
||||
For the minimizer rescuing parameter $L$ in Section~\ref{sec:high-occ},
|
||||
we set its default to 500 such that v2.22 has comparable performance to v2.18 given simulated PacBio and Nanopore human reads.
|
||||
To see the effect of this parameter on real data, we tried several different $L$ values.
|
||||
v2.22 gave 99 mapping differences at $L=200$,
|
||||
118 at $L=500$ (default), 167 at $L=750$ and 224 differences at $L=1000$ in comparison to Winnowmap2.
|
||||
$L=200$ is 28\% slower than the default while $L=1000$ is 9\% faster.
|
||||
Changing the default minimizer window size (option ``-w'')
|
||||
and the initial minimizer occurrence cutoff (option ``-f'')
|
||||
also affects performance and accuracy to a similar magnitude.
|
||||
|
||||
The two benchmarks above only evaluate read mappings when there are no variations between the reads and the reference.
|
||||
To measure the mapping accuracy in the presence of SVs (sim-sv), we reproduced
|
||||
the results by~\citep{Jain2020.11.01.363887}. Minimap2 v2.22 is as good as
|
||||
Winnowmap2 now. Note that we were setting the Sniffles mapping quality
|
||||
threshold to 10 in consistent with the benchmarks above. If we used the
|
||||
default threshold 20, v2.22 would miss additional five SVs (accounting for
|
||||
0.5\% of simulated SVs). For four out of these five missing SVs, minimap2 v2.22
|
||||
mapped more variant reads than Winnowmap2. Sniffles did not call these SVs
|
||||
because minimap2 tended to give them conservative mapping quality. It is worth
|
||||
noting that the simulation here only considers a simple scenario in evolution.
|
||||
Non-allelic gene conversions, which happen often in segmental
|
||||
duplications~\citep{Harpak:2017aa}, would obscure the optimal mapping
|
||||
strategies. How much such simple SV simulation informs real-world SV calling
|
||||
remains a question.
|
||||
|
||||
To see if minimap2 v2.22 could improve long INDEL alignment, we ran dipcall on
|
||||
contig-to-reference alignments and focused on INDELs longer than 1kb
|
||||
(real-sv-1k). v2.22 is more sensitive at comparable specificity, confirming its
|
||||
advantage in more contiguous alignment. We could not get dipcall to work well with lra,
|
||||
so did not report the numbers.
|
||||
|
||||
Minimap2 spends most computing time on base alignment. As recent improvements
|
||||
in v2.22 incur little additional computing and do not change the base alignment
|
||||
algorithm, the new version has similar performance to older versions. It is
|
||||
consistently faster than Winnowmap2 by several times. Sometimes simple
|
||||
heuristics can be as effective as more sophisticated yet slower solutions.
|
||||
|
||||
\section*{Acknowledgements}
|
||||
We thank Arang Rhie and Chirag Jain for providing motivating examples for which
|
||||
older minimap2 underperforms.
|
||||
|
||||
\paragraph{Funding\textcolon} This work is funded by NHGRI grant R01HG010040.
|
||||
|
||||
\bibliography{minimap2}
|
||||
|
||||
\end{document}
|
||||
Reference in New Issue
Block a user