mirror of
https://github.com/lh3/minimap2.git
synced 2026-10-06 22:28:11 +08:00
Compare commits
| Author | SHA1 | Date | |
|---|---|---|---|
|
|
1fd85be6e2 | ||
|
|
e616b0dacf | ||
|
|
b58b97423a | ||
|
|
df9e650346 | ||
|
|
7a540c37ca | ||
|
|
c19e3ccb86 | ||
|
|
94d171b01e | ||
|
|
ff312a2957 | ||
|
|
01ccedd5a0 | ||
|
|
819b3bf017 | ||
|
|
e88110463a | ||
|
|
fb81e150f2 | ||
|
|
d930ea94ad | ||
|
|
a832a42f6f | ||
|
|
a5411fc3c0 | ||
|
|
bd03d975fc | ||
|
|
9c3c4b1ce8 | ||
|
|
3542a3d153 | ||
|
|
75619c7b51 | ||
|
|
fbb9c0fcba | ||
|
|
af094640e5 | ||
|
|
d43f356ef9 | ||
|
|
38acd6617f | ||
|
|
3d351267a0 | ||
|
|
54a4718c9b | ||
|
|
dbc12b2838 | ||
|
|
2ed264db4e | ||
|
|
a8094ad859 | ||
|
|
1877818239 | ||
|
|
9ede5c4255 | ||
|
|
405511fe8d | ||
|
|
dd90d9dde6 | ||
|
|
a8c567b5e9 | ||
|
|
d9d3c0cc3f | ||
|
|
cbe8d61ca4 | ||
|
|
9d06cef13e | ||
|
|
924fc4d671 | ||
|
|
fc2d1e95b3 | ||
|
|
bbf0bb871b | ||
|
|
83e9b2e28c | ||
|
|
e816fd071c | ||
|
|
a955b1f31d | ||
|
|
54fa925e2e | ||
|
|
d4a396c5c3 | ||
|
|
bdf46f5786 | ||
|
|
f536b69b81 | ||
|
|
4b8b4418df | ||
|
|
ce30004e02 | ||
|
|
54f8e5f7d6 | ||
|
|
2857de7dbd | ||
|
|
e18935fbad | ||
|
|
74ebfb2532 | ||
|
|
a0cbe2e4d2 | ||
|
|
618d33515e | ||
|
|
a10d4f4496 | ||
|
|
1eea2fee11 | ||
|
|
1d346d56bc | ||
|
|
46750de966 | ||
|
|
7d8bbb74a8 | ||
|
|
c6db201b38 | ||
|
|
358a39850f | ||
|
|
fcb5d5e6eb | ||
|
|
95807a2224 | ||
|
|
a4c93e9377 | ||
|
|
7d69334e69 | ||
|
|
3e1ab2951d | ||
|
|
68179ed195 | ||
|
|
d1f4c8d232 | ||
|
|
8efe83b744 | ||
|
|
042c8d4d71 | ||
|
|
e4e1f7843b | ||
|
|
69e3629916 | ||
|
|
0cc3cdca27 | ||
|
|
8170693de3 | ||
|
|
e3d8c708ac | ||
|
|
119bdc6029 | ||
|
|
89d4d219cd | ||
|
|
f51ff1abac | ||
|
|
27b254ed6f | ||
|
|
c881b14ba5 | ||
|
|
f18dadb1c4 | ||
|
|
a83b8fe7cc | ||
|
|
c22bfe7722 | ||
|
|
12d441ea22 | ||
|
|
c7433c2811 | ||
|
|
5279377544 | ||
|
|
acab05781e | ||
|
|
98c23bc6d2 | ||
|
|
9b0ff2418c | ||
|
|
b6762503a9 | ||
|
|
9667468e89 | ||
|
|
ba60aac6f6 | ||
|
|
fcd4df2a73 | ||
|
|
0efc886012 | ||
|
|
940388f8e4 | ||
|
|
23d2674c39 | ||
|
|
a12673611f | ||
|
|
8140259974 | ||
|
|
f3e59fc2a0 | ||
|
|
fc2e1607d7 | ||
|
|
bc588c0eeb | ||
|
|
ab717023b6 | ||
|
|
9506e7ac3f | ||
|
|
ce03fbc275 | ||
|
|
98a3aa1b39 | ||
|
|
ae05f8485f | ||
|
|
ace990c381 | ||
|
|
e28a55be86 | ||
|
|
f8d46a7a30 | ||
|
|
4483f89ee5 | ||
|
|
f1b3c7ad06 | ||
|
|
180faa3594 | ||
|
|
704fbc6f5c | ||
|
|
fc24c8a348 | ||
|
|
e68d868806 | ||
|
|
c3d461e22a | ||
|
|
c41518ae85 | ||
|
|
819d843e3c | ||
|
|
5e7242303c | ||
|
|
a026c69b89 | ||
|
|
ea2042a577 | ||
|
|
1834b1fd42 | ||
|
|
7ced0f16a0 | ||
|
|
35732f3025 | ||
|
|
a6fab118c5 | ||
|
|
6ce0dd8b70 | ||
|
|
1d3c3eef03 | ||
|
|
01b98e8e52 | ||
|
|
16b8d50199 | ||
|
|
226fd6114c | ||
|
|
822ccd1733 | ||
|
|
f67849c9af | ||
|
|
b0b199f503 | ||
|
|
c2f07ff2ac | ||
|
|
cefd0d9f6c | ||
|
|
2a319c89aa | ||
|
|
85a5260408 | ||
|
|
6c2cbf7903 | ||
|
|
5aa4355ca8 | ||
|
|
6ed7263670 | ||
|
|
315795eefd | ||
|
|
fc6869a9e8 | ||
|
|
6252e5e367 | ||
|
|
843729df1e | ||
|
|
195c98fa46 | ||
|
|
a2e6659d9b | ||
|
|
e450f161bb | ||
|
|
15cade0f06 | ||
|
|
767556b6f0 | ||
|
|
50a26a60a6 | ||
|
|
31de4fd1bc | ||
|
|
e018caea32 | ||
|
|
7c02742fa8 | ||
|
|
a41f5d1eeb | ||
|
|
ed3d0eb328 | ||
|
|
e6d166a314 | ||
|
|
06fedaadd0 | ||
|
|
fe35e679e9 | ||
|
|
e25aa5ee74 | ||
|
|
3bde3450a0 | ||
|
|
36942ff711 | ||
|
|
d3a89d34d4 | ||
|
|
c8f0a35c40 | ||
|
|
fcaadc22b7 | ||
|
|
db37fc43a7 | ||
|
|
a8f1fa8ea3 | ||
|
|
b276772890 | ||
|
|
d0cff3eb36 | ||
|
|
ac334639ce | ||
|
|
546623dcb4 | ||
|
|
39bdd45875 | ||
|
|
aefa2c0d86 | ||
|
|
7ee62dae1d | ||
|
|
05a8a45d44 | ||
|
|
cc14d1afdf | ||
|
|
bb3048b2a0 | ||
|
|
5113ca2628 | ||
|
|
7358a1ead1 | ||
|
|
32f552957e | ||
|
|
a05edfa5ec | ||
|
|
8e81145817 | ||
|
|
e37f5ffe39 | ||
|
|
8a1d52bcbe | ||
|
|
f7271a7c24 | ||
|
|
70393eb46e | ||
|
|
9d049f0562 | ||
|
|
5180b70ff3 | ||
|
|
2392e54fe2 | ||
|
|
629c11728e | ||
|
|
59488f0271 | ||
|
|
7e33fde82b | ||
|
|
c4fe52fb07 | ||
|
|
ead1cfbaca | ||
|
|
83a535f148 | ||
|
|
f3af29a8aa | ||
|
|
cf7eaef367 | ||
|
|
2411887d8e | ||
|
|
1a8373bb84 | ||
|
|
161ae7ff73 | ||
|
|
8a6edab847 | ||
|
|
15118dd521 | ||
|
|
2546999639 | ||
|
|
52fafe0fed | ||
|
|
5f449c5cae | ||
|
|
b046052d82 | ||
|
|
5cc3d2239f | ||
|
|
581f2d7123 | ||
|
|
52dbd439bc | ||
|
|
260a68d232 | ||
|
|
177eef259d | ||
|
|
459ce04c84 | ||
|
|
e6cce019e4 | ||
|
|
7025b0b941 | ||
|
|
fe6a0bb337 | ||
|
|
3f7147864b | ||
|
|
c83589b9ea | ||
|
|
ce7a59f412 | ||
|
|
15471bd629 | ||
|
|
ca19463268 | ||
|
|
4f8d1bc360 | ||
|
|
1776c0c645 | ||
|
|
9febf532c1 | ||
|
|
cec23131e4 | ||
|
|
ef09ccf104 | ||
|
|
e74dfd1aa9 | ||
|
|
f31705bb4a | ||
|
|
41d7ccb191 | ||
|
|
34a41197d7 | ||
|
|
9626b3e716 | ||
|
|
379728726a | ||
|
|
4f91558160 | ||
|
|
ec3bc6efd7 | ||
|
|
8ec8866100 | ||
|
|
9e7247cff9 | ||
|
|
cd66777bfb | ||
|
|
5d7d25e92d | ||
|
|
2a3793bbd2 | ||
|
|
f97008a10e | ||
|
|
10502e2a78 | ||
|
|
4422c0c6f9 | ||
|
|
42a11e1d58 | ||
|
|
76df351fa8 | ||
|
|
d065d3bead | ||
|
|
ac146fe7bc | ||
|
|
6c96078ed0 | ||
|
|
bbb4f97e52 | ||
|
|
b7f4d8a0f4 | ||
|
|
e81927e7a1 | ||
|
|
f7dc5799c5 | ||
|
|
817cb81cb0 | ||
|
|
0f5608c4a4 | ||
|
|
e8823a3709 | ||
|
|
7edeec67b0 | ||
|
|
feb92d32ea | ||
|
|
cdbd96be0c | ||
|
|
ba52c79024 | ||
|
|
cd9ccfa069 | ||
|
|
86b716448c | ||
|
|
9ab95be1bb | ||
|
|
b51e859945 | ||
|
|
a9037dc16c | ||
|
|
9729fa99ad | ||
|
|
b6ff332de1 | ||
|
|
77abafaaf3 | ||
|
|
507d39af15 | ||
|
|
827ca4b461 | ||
|
|
d3dde2fdd4 | ||
|
|
7db2e8d21a | ||
|
|
0b41dd26a2 | ||
|
|
2b47846cd6 | ||
|
|
67dd906a80 | ||
|
|
1b0bb7b0ba | ||
|
|
1c4b7e8a48 | ||
|
|
ecbc399fa2 | ||
|
|
4dfd495cc2 | ||
|
|
194b457e79 | ||
|
|
75c8933511 | ||
|
|
1025993469 | ||
|
|
a3253d1a6b | ||
|
|
2da649d1d7 | ||
|
|
f995f55610 | ||
|
|
c9874e2dc5 | ||
|
|
28a37a017a | ||
|
|
ccb0f7b05d | ||
|
|
66db9da7d8 | ||
|
|
cd2b19035b | ||
|
|
9c0e2c67f8 | ||
|
|
da7109fd29 | ||
|
|
2b3403f094 | ||
|
|
3e16e4e39d | ||
|
|
f47e8a525e | ||
|
|
c172df7d2d | ||
|
|
9e6fdd376b | ||
|
|
29f67a1666 | ||
|
|
adde608a42 | ||
|
|
f10dff78dc | ||
|
|
d97bba9f27 | ||
|
|
50775362bb | ||
|
|
0a5e386359 | ||
|
|
cb56fb762a | ||
|
|
e2451e497a | ||
|
|
d2de282d21 | ||
|
|
48cb80ea94 | ||
|
|
6a4b9f9082 | ||
|
|
a7a01fe5bd | ||
|
|
9dceae59a0 | ||
|
|
20a3987082 | ||
|
|
eb3ed6993d | ||
|
|
7996f04008 | ||
|
|
d2e14705e7 | ||
|
|
24f50f38e8 | ||
|
|
04e015d803 | ||
|
|
040f74102c | ||
|
|
cdb7857841 | ||
|
|
3c0d05d272 | ||
|
|
47b646acbf | ||
|
|
a79cb3e991 | ||
|
|
367aed4271 | ||
|
|
081df6ac7d | ||
|
|
a3e7a575fb | ||
|
|
d90583b83c | ||
|
|
7fc03b0c32 | ||
|
|
20c104ce8d | ||
|
|
238b6bb3ea | ||
|
|
e026e18439 | ||
|
|
58c2251b18 | ||
|
|
03dc8d5d97 | ||
|
|
5cb61f8ee6 | ||
|
|
c16a1742a3 | ||
|
|
4bd5a018c2 | ||
|
|
05974c80f1 | ||
|
|
7bc87b4175 | ||
|
|
6762368cf0 | ||
|
|
c2aec88b84 | ||
|
|
97f67a2a0a | ||
|
|
189555503a | ||
|
|
69af86657e | ||
|
|
49c6d83a8e | ||
|
|
f64e426a5a | ||
|
|
2bb8cbbeef | ||
|
|
e80759c97a | ||
|
|
f4c844b143 | ||
|
|
be171aa2dc | ||
|
|
cdc730d573 | ||
|
|
6420acca6d | ||
|
|
371bc9513a | ||
|
|
169216bfff | ||
|
|
6b391e3373 | ||
|
|
55e39c2d30 | ||
|
|
90b7b83ec7 | ||
|
|
d431dc0181 | ||
|
|
ccf1680aaf | ||
|
|
ea84fc0a53 | ||
|
|
19208fb06b | ||
|
|
e02bebd96d | ||
|
|
32ab6ce15b | ||
|
|
1739a260fb | ||
|
|
aaf3233818 | ||
|
|
8b05880f73 | ||
|
|
eba237f39d | ||
|
|
a8e1e3cbb8 | ||
|
|
597212b9f3 | ||
|
|
30abcf3cf9 | ||
|
|
48e230f40d | ||
|
|
c404f49569 | ||
|
|
cf2bae6e9b | ||
|
|
5b2fdfff9c | ||
|
|
ea2b1c5b2a | ||
|
|
eef1cee9b7 | ||
|
|
2c52364527 | ||
|
|
128476efc9 | ||
|
|
1b3a6a0fe5 | ||
|
|
83a8ee7038 | ||
|
|
62bbadf668 | ||
|
|
91f548b497 | ||
|
|
cdaf46665a | ||
|
|
6596c63dcd | ||
|
|
59f23f7579 | ||
|
|
5e55e397e9 | ||
|
|
88c421e8de | ||
|
|
3db5bfe6e5 | ||
|
|
83dfdd5f50 | ||
|
|
8a2b1cd4c9 | ||
|
|
1ede8ca170 | ||
|
|
13981404e2 | ||
|
|
fd64dd26f6 | ||
|
|
24df95e4b8 | ||
|
|
a8ee48c2ce | ||
|
|
09e089c3dc | ||
|
|
e46cbb7d84 | ||
|
|
57ec73ec6c | ||
|
|
9e27575387 | ||
|
|
b4ad8d8bf0 | ||
|
|
e315b9fada | ||
|
|
42baf287a4 | ||
|
|
2ceba22a7a | ||
|
|
9ed56b4a25 | ||
|
|
ecb6c5c36c | ||
|
|
377c7099a8 | ||
|
|
51e2abfa60 | ||
|
|
7b0a49732e | ||
|
|
20268a6068 | ||
|
|
d04ac068fd | ||
|
|
5d5d392c02 | ||
|
|
170863e553 | ||
|
|
97f97306a4 | ||
|
|
1077b7ddc8 | ||
|
|
c57b59f02f | ||
|
|
34be359e25 | ||
|
|
8b12da8b0f | ||
|
|
c63a33904f | ||
|
|
70b0fede64 | ||
|
|
0b681e51e7 | ||
|
|
7d80d6de4a | ||
|
|
791e89ce0f | ||
|
|
98c48a1c45 | ||
|
|
63d397120a | ||
|
|
7998fe9906 | ||
|
|
3a119d606f | ||
|
|
a5eafb75f9 | ||
|
|
9a567e4b37 | ||
|
|
8e606bcc06 | ||
|
|
a1b7219b5d | ||
|
|
b0f39a1a61 | ||
|
|
5ab6538757 | ||
|
|
b32296e18f | ||
|
|
99ecdf7b5d | ||
|
|
ff9917a1c4 | ||
|
|
8c064a5f29 | ||
|
|
0e137670fc | ||
|
|
395c8d678a | ||
|
|
830da7fa27 | ||
|
|
a655cbef86 | ||
|
|
4b707aac92 | ||
|
|
951c0d1d35 | ||
|
|
3545e35a42 | ||
|
|
f3417da838 | ||
|
|
e5277dbf5c | ||
|
|
1a55227d5a | ||
|
|
5cfa621b2d | ||
|
|
a609a07f8c | ||
|
|
bcf92b3c46 | ||
|
|
097378ab90 | ||
|
|
10bbbe28c5 | ||
|
|
c92a6866f3 | ||
|
|
6908dc59a5 | ||
|
|
50dae10421 | ||
|
|
0517972d02 | ||
|
|
d46e68e6ad | ||
|
|
2584a4149a | ||
|
|
66674afd09 | ||
|
|
e9ca0c9dab | ||
|
|
7e6e8ca73f | ||
|
|
408e098859 | ||
|
|
57f37551f8 | ||
|
|
4c66b689c3 | ||
|
|
1bde2cf076 | ||
|
|
31fc0f218a | ||
|
|
3d3bcc29a8 | ||
|
|
99dcd75f64 | ||
|
|
154d2caf5b | ||
|
|
a3afeec0b2 | ||
|
|
3573784b4d | ||
|
|
872f300955 | ||
|
|
d7b61a039e | ||
|
|
248158a3e1 | ||
|
|
9f4309c376 | ||
|
|
463f9309f9 | ||
|
|
abe989e355 | ||
|
|
881b4ca3a2 | ||
|
|
10c6dd2551 | ||
|
|
7ec6721c44 | ||
|
|
e61812ee55 | ||
|
|
734ac379bb | ||
|
|
759f8e4ac9 | ||
|
|
aef7b0744c | ||
|
|
39f836eac8 | ||
|
|
cbeb86dad6 | ||
|
|
372c90ceb5 | ||
|
|
2e2e69107c | ||
|
|
ee4cd089f7 | ||
|
|
2d7ec75d50 | ||
|
|
7938ed4893 | ||
|
|
4740423afa | ||
|
|
1776311a9b | ||
|
|
c1a3e05cb0 | ||
|
|
ecb6703d4a | ||
|
|
0bf97a367b | ||
|
|
1c504d72e4 | ||
|
|
5ef9580b17 | ||
|
|
08bd2123b6 | ||
|
|
8766d286df | ||
|
|
623b5d9d48 | ||
|
|
18659118cd | ||
|
|
d1050f4eaf | ||
|
|
b81d45510e | ||
|
|
d135feb1a5 | ||
|
|
242ff4e91d | ||
|
|
7a0c1316ce | ||
|
|
77ebd479f4 | ||
|
|
e3f226a9d9 | ||
|
|
bdc615c1d4 | ||
|
|
ad1beaf255 | ||
|
|
de0480ac5b | ||
|
|
f2866533a8 | ||
|
|
0173850ef0 | ||
|
|
acea3594fb | ||
|
|
f78a247749 | ||
|
|
ccaf12e1a2 | ||
|
|
96b132c97d | ||
|
|
70428ca3a8 | ||
|
|
9aea79d621 | ||
|
|
1770988627 | ||
|
|
2bfdad34bb | ||
|
|
953766cedd | ||
|
|
dc61301d9f | ||
|
|
19e05a099d | ||
|
|
0238caa8b1 | ||
|
|
a22ebb9836 | ||
|
|
eeb314edd6 | ||
|
|
83c57a9d98 | ||
|
|
24a4808826 | ||
|
|
29ed675ee5 | ||
|
|
7dc7097208 | ||
|
|
f434653432 | ||
|
|
090361c25b | ||
|
|
e1f18690f6 | ||
|
|
54a42aafe5 | ||
|
|
8fc5f8dc90 | ||
|
|
a0d62519c1 | ||
|
|
b71c01b316 | ||
|
|
1372977a37 | ||
|
|
c0e0d5d84b | ||
|
|
b328795051 | ||
|
|
3b17d62ccd | ||
|
|
874b8c4795 | ||
|
|
7ef5490884 | ||
|
|
f66de7df59 | ||
|
|
fbbd4e0968 | ||
|
|
8c89ba005e | ||
|
|
50775a1e6f | ||
|
|
87cf650168 | ||
|
|
6e65c5e631 | ||
|
|
a58b05a61b | ||
|
|
42dab6319b | ||
|
|
8428809369 | ||
|
|
642af5591e | ||
|
|
2025a6279a | ||
|
|
3465b04724 | ||
|
|
66c5e71fa8 | ||
|
|
01560f1db0 | ||
|
|
39535565ee | ||
|
|
a8d476c6ad | ||
|
|
29b4a1786c | ||
|
|
dbf284b2d9 | ||
|
|
3df5015668 | ||
|
|
756379bf83 | ||
|
|
41fd8a966a | ||
|
|
86e4933b1a | ||
|
|
a633a744b6 | ||
|
|
ddc31f57ba | ||
|
|
35d3e064bf | ||
|
|
997ab9bb2e | ||
|
|
53ce317e59 | ||
|
|
da6947cfa3 | ||
|
|
46d6349af4 | ||
|
|
12a5a5fa3c | ||
|
|
ad18fa490d | ||
|
|
43bfa6199d | ||
|
|
72b9b0e3b6 | ||
|
|
6205fa6f21 | ||
|
|
d676a5314b | ||
|
|
dfc78b39d3 | ||
|
|
7b57c9a619 | ||
|
|
123bc1d91d | ||
|
|
dd18307e66 | ||
|
|
543fa12e68 | ||
|
|
af1a871270 | ||
|
|
2b71181a37 | ||
|
|
0454e6be91 | ||
|
|
33f8157961 | ||
|
|
eecc06086f | ||
|
|
dfea113f28 | ||
|
|
1842d7f5b5 | ||
|
|
f5cfd439ee | ||
|
|
248b43cc47 | ||
|
|
bf72969ab1 | ||
|
|
7b5a601d48 | ||
|
|
405d531100 | ||
|
|
e9607fcd9b | ||
|
|
a465a920ec | ||
|
|
b20839be77 | ||
|
|
209beb9955 | ||
|
|
cfe87f50c1 | ||
|
|
680b971bb0 | ||
|
|
6b0d3c1fa8 | ||
|
|
dc9e3dcf4a | ||
|
|
cc75c12905 | ||
|
|
f159e1c2d3 | ||
|
|
3a375d3436 | ||
|
|
626f10e0d0 | ||
|
|
b997578078 | ||
|
|
ce8a48d715 | ||
|
|
99879e9e75 | ||
|
|
c969d1a1ce | ||
|
|
fcac296c4a | ||
|
|
e420b17496 | ||
|
|
23a846c594 | ||
|
|
8995e2e078 | ||
|
|
ab345e600b | ||
|
|
d003a00d71 | ||
|
|
ae85dcde76 | ||
|
|
eb819c29e8 | ||
|
|
fb630de40a | ||
|
|
43960a8ca7 | ||
|
|
f6608fe99c | ||
|
|
98a6e52c06 | ||
|
|
824712a4ee | ||
|
|
0e42628ef6 | ||
|
|
98a999fe44 | ||
|
|
fec7bd713f | ||
|
|
2f693e8ca4 | ||
|
|
704ff9f4c6 | ||
|
|
68c63f2d68 | ||
|
|
76206f574f | ||
|
|
e575f884e1 | ||
|
|
571161d5a2 | ||
|
|
07d41efc2b | ||
|
|
984f7846c0 | ||
|
|
af1d6afba9 | ||
|
|
cbdb6c069f | ||
|
|
35b6d9f7d5 | ||
|
|
39a9666246 | ||
|
|
662d05dc02 | ||
|
|
379457c18b | ||
|
|
03169d590b | ||
|
|
8c8d446820 | ||
|
|
0ddb064f17 | ||
|
|
131cfc6938 | ||
|
|
2f463b1db0 | ||
|
|
3b518271ee | ||
|
|
481d8239e9 | ||
|
|
4f77b0c1ed | ||
|
|
d7a31e40e6 | ||
|
|
dd18cd75de | ||
|
|
99a2709913 | ||
|
|
032068a747 | ||
|
|
1cb0bf4bef | ||
|
|
422b43374e | ||
|
|
29a26e3eea | ||
|
|
a7b38f6900 | ||
|
|
e896c9ec05 | ||
|
|
98ba8928c6 | ||
|
|
bcf8462d20 | ||
|
|
c047c852ce | ||
|
|
b24d68ae9f | ||
|
|
65deedfa96 | ||
|
|
21a46ba652 | ||
|
|
1617b87ee1 | ||
|
|
2191ac58ad | ||
|
|
fa5a645ca5 | ||
|
|
c2b09356b8 | ||
|
|
a3f0aa1d5b | ||
|
|
52ffbc9e0c | ||
|
|
a9790c0f1d | ||
|
|
d0ac78ac08 | ||
|
|
22290db3e4 | ||
|
|
cd24dc8834 | ||
|
|
b8e758df0f | ||
|
|
311fa90030 | ||
|
|
fb8a1b5536 | ||
|
|
7f11f4c4d4 | ||
|
|
285eb0da05 | ||
|
|
192217a10c | ||
|
|
f22a94e868 | ||
|
|
79b0caca95 | ||
|
|
afc2f2e84b | ||
|
|
e6f66f2f3b | ||
|
|
70735098e2 | ||
|
|
d4b5dfc297 | ||
|
|
5acd709524 | ||
|
|
306e4541f8 | ||
|
|
1dd221ad82 | ||
|
|
c6b6392b70 | ||
|
|
dc37aee881 | ||
|
|
37e627aa98 | ||
|
|
beeb806829 | ||
|
|
be7f3c4ffe | ||
|
|
bd04372873 | ||
|
|
15ed0712c2 | ||
|
|
55dcbefe87 | ||
|
|
8abba332ad | ||
|
|
4683da2455 | ||
|
|
ffd953029f | ||
|
|
04cf4ebf5e | ||
|
|
25ffd72690 | ||
|
|
aa2d9d4e1b | ||
|
|
addb61bcb2 | ||
|
|
b24c9c90c7 | ||
|
|
adf6cd7f52 | ||
|
|
e6f525edaf | ||
|
|
858213d513 | ||
|
|
dea3b60918 | ||
|
|
7c555f9b7e | ||
|
|
2801ed9b4b | ||
|
|
27025c70a7 | ||
|
|
9bafbe4e70 | ||
|
|
ce06188203 | ||
|
|
9862a75cd3 | ||
|
|
3073f4a758 | ||
|
|
ba6ddda6b0 | ||
|
|
9364bc64d7 | ||
|
|
5498565157 | ||
|
|
65abdb8f3c | ||
|
|
7345621759 | ||
|
|
ca632f907b | ||
|
|
6c78a980b6 | ||
|
|
c217eecdb7 | ||
|
|
13b66aad4d | ||
|
|
46fa520db9 | ||
|
|
1e53610fb4 | ||
|
|
9396d9e11b | ||
|
|
198849a716 | ||
|
|
9fea4d16b3 | ||
|
|
f9415628a8 | ||
|
|
61e56c941d | ||
|
|
f150257a0d | ||
|
|
bf2d4f7aec | ||
|
|
47b86e765b | ||
|
|
56acf6ee28 | ||
|
|
4f6244bd4a | ||
|
|
c6384ed2c8 | ||
|
|
2833a9c255 | ||
|
|
de2fcc1bf3 | ||
|
|
e0baf1ad54 | ||
|
|
f266092699 | ||
|
|
9c5767f9ed | ||
|
|
ae2adf04d4 | ||
|
|
b839758335 | ||
|
|
f4a5d3a692 | ||
|
|
3ff6eda3a4 | ||
|
|
1a90bc8603 | ||
|
|
abf2a90363 | ||
|
|
5ab99eb26e | ||
|
|
7cc4f6f965 | ||
|
|
16e6e589a8 | ||
|
|
9aba11769c | ||
|
|
7d50e646dd | ||
|
|
1554149158 | ||
|
|
19c39e704f | ||
|
|
2581c44a21 | ||
|
|
5babf41a38 | ||
|
|
2a1e738a94 | ||
|
|
cf55c84056 | ||
|
|
841763ec24 | ||
|
|
95eb1dec36 | ||
|
|
0fd0f2aed1 | ||
|
|
ee9b2773a8 | ||
|
|
340483821e | ||
|
|
04fb2c2ec0 | ||
|
|
0d4ecd19ee | ||
|
|
0c63325985 | ||
|
|
2a554a92e9 | ||
|
|
935a6e6064 | ||
|
|
a13691d00d | ||
|
|
8301222174 | ||
|
|
9541052564 | ||
|
|
7e0d70bfd3 | ||
|
|
a349d85280 | ||
|
|
f611edf6f2 | ||
|
|
1b1dd0cd57 | ||
|
|
92ec8bd859 | ||
|
|
55d1e4f638 | ||
|
|
64c0ad6b35 | ||
|
|
9538c985aa | ||
|
|
8f25cfa36e | ||
|
|
81008dd371 | ||
|
|
3bb66e1ed3 | ||
|
|
a742f10164 | ||
|
|
f0951141a1 | ||
|
|
84bbc47152 | ||
|
|
5400191097 | ||
|
|
ef84e8b4e7 | ||
|
|
1c948e0d1d | ||
|
|
997011458c | ||
|
|
19d8eca3a1 | ||
|
|
9943e5fdd0 | ||
|
|
5b39a1b34b | ||
|
|
e3b5802b2e | ||
|
|
03d6894517 | ||
|
|
645db3350e | ||
|
|
75e6bbc9f6 | ||
|
|
7a9b4db874 | ||
|
|
4979e66ff0 | ||
|
|
a686461e83 | ||
|
|
fd14618e61 | ||
|
|
5caadc28b4 | ||
|
|
56014ba3db | ||
|
|
b99c22840f | ||
|
|
c04420698e | ||
|
|
fb1bcc0084 | ||
|
|
11081c6c27 | ||
|
|
60485790b4 |
@@ -0,0 +1,68 @@
|
||||
name: CI
|
||||
|
||||
on:
|
||||
push:
|
||||
branches:
|
||||
- master
|
||||
pull_request:
|
||||
|
||||
jobs:
|
||||
build-linux-x8664:
|
||||
name: Linux x86_64
|
||||
runs-on: ubuntu-latest
|
||||
strategy:
|
||||
matrix:
|
||||
compiler: [gcc, clang]
|
||||
|
||||
steps:
|
||||
- name: Checkout minimap2
|
||||
uses: actions/checkout@v4
|
||||
|
||||
- name: Compile with ${{ matrix.compiler }}
|
||||
run: |
|
||||
make CC=${{ matrix.compiler }}
|
||||
file minimap2 | grep x86-64
|
||||
|
||||
build-linux-aarch64:
|
||||
name: Linux aarch64
|
||||
runs-on: ubuntu-latest
|
||||
strategy:
|
||||
matrix:
|
||||
compiler: [gcc]
|
||||
|
||||
steps:
|
||||
- name: Checkout
|
||||
uses: actions/checkout@v4
|
||||
|
||||
- name: Compile with ${{ matrix.compiler }}
|
||||
uses: uraimo/run-on-arch-action@v2
|
||||
with:
|
||||
arch: aarch64
|
||||
distro: ubuntu22.04
|
||||
githubToken: ${{ github.token }}
|
||||
dockerRunArgs: |
|
||||
--volume "${PWD}:/minimap2"
|
||||
install: |
|
||||
apt-get update -q -y
|
||||
apt-get install -q -y make ${{ matrix.compiler }} zlib1g-dev file
|
||||
run: |
|
||||
cd /minimap2
|
||||
make CC=${{ matrix.compiler }} arm_neon=1 aarch64=1 -j
|
||||
file minimap2 | grep aarch64
|
||||
|
||||
build-mac-arm64:
|
||||
name: Mac ARM64
|
||||
runs-on: macos-14
|
||||
strategy:
|
||||
matrix:
|
||||
compiler: [clang]
|
||||
|
||||
steps:
|
||||
- name: Checkout minimap2
|
||||
uses: actions/checkout@v4
|
||||
|
||||
- name: Compile with ${{ matrix.compiler }}
|
||||
run: |
|
||||
make CC=${{ matrix.compiler }} arm_neon=1 aarch64=1 -j
|
||||
file minimap2 | grep arm64
|
||||
|
||||
@@ -0,0 +1,3 @@
|
||||
[submodule "lib/simde"]
|
||||
path = lib/simde
|
||||
url = https://github.com/nemequ/simde.git
|
||||
-24
@@ -1,24 +0,0 @@
|
||||
matrix:
|
||||
include:
|
||||
- language: c
|
||||
compiler: gcc
|
||||
script: make
|
||||
- language: c
|
||||
compiler: clang
|
||||
script: make
|
||||
- language: python
|
||||
python: "2.7"
|
||||
before_install: pip install cython
|
||||
script: python setup.py build_ext
|
||||
- language: python
|
||||
python: "3.3"
|
||||
before_install: pip install cython
|
||||
script: python setup.py build_ext
|
||||
- language: python
|
||||
python: "3.5"
|
||||
before_install: pip install cython
|
||||
script: python setup.py build_ext
|
||||
- language: python
|
||||
python: "3.6"
|
||||
before_install: pip install cython
|
||||
script: python setup.py build_ext
|
||||
@@ -0,0 +1,46 @@
|
||||
#### 1. Alignment different with option `-a` or `-c`?
|
||||
|
||||
Without `-a`, `-c` or `--cs`, minimap2 only finds *approximate* mapping
|
||||
locations without detailed base alignment. In particular, the start and end
|
||||
positions of the alignment are imprecise. With one of those options, minimap2
|
||||
will perform base alignment, which is generally more accurate but is much
|
||||
slower.
|
||||
|
||||
#### 2. How to map Illumina short reads to noisy long reads?
|
||||
|
||||
No good solutions. The better approach is to assemble short reads into contigs
|
||||
and then map noisy reads to contigs.
|
||||
|
||||
#### 3. The output SAM doesn't have a header.
|
||||
|
||||
By default, minimap2 indexes 4 billion reference bases (4Gb) in a batch and map
|
||||
all reads against each reference batch. Given a reference longer than 4Gb,
|
||||
minimap2 is unable to see all the sequences and thus can't produce a correct
|
||||
SAM header. In this case, minimap2 doesn't output any SAM header. There are two
|
||||
solutions to this issue. First, you may increase option `-I` to, for example,
|
||||
`-I8g` to index more reference bases in a batch. This is preferred if your
|
||||
machine has enough memory. Second, if your machines doesn't have enough memory
|
||||
to hold the reference index, you can use the `--split-prefix` option in a
|
||||
command line like:
|
||||
```sh
|
||||
minimap2 -ax map-ont --split-prefix=tmp ref.fa reads.fq
|
||||
```
|
||||
This second approach uses less memory, but it is slower and requires temporary
|
||||
disk space.
|
||||
|
||||
#### 4. The output SAM is malformatted.
|
||||
|
||||
This typically happens when you use nohup to wrap a minimap2 command line.
|
||||
Nohup is discouraged as it breaks piping. If you have to use nohup, please
|
||||
specify an output file with option `-o`.
|
||||
|
||||
#### 5. How to output one alignment per read?
|
||||
|
||||
You can use `--secondary=no` to suppress secondary alignments (aka multiple
|
||||
mappings), but you can't suppress supplementary alignment (aka split or
|
||||
chimeric alignment) this way. You can use samtools to filter out these
|
||||
alignments:
|
||||
```sh
|
||||
minimap2 -ax map-out ref.fa reads.fq | samtools view -F0x900
|
||||
```
|
||||
However, this is discouraged as supplementary alignment is informative.
|
||||
+2
-1
@@ -1,6 +1,7 @@
|
||||
The MIT License
|
||||
|
||||
Copyright (c) 2017 Broad Institute, Inc.
|
||||
Copyright (c) 2018- Dana-Farber Cancer Institute
|
||||
2017-2018 Broad Institute, Inc.
|
||||
|
||||
Permission is hereby granted, free of charge, to any person obtaining
|
||||
a copy of this software and associated documentation files (the
|
||||
|
||||
+1
-2
@@ -1,10 +1,9 @@
|
||||
include *.h
|
||||
include Makefile
|
||||
include ksw2_dispatch.c
|
||||
include getopt.c
|
||||
include main.c
|
||||
include README.md
|
||||
include python/mappy.c
|
||||
include sse2neon/emmintrin.h
|
||||
include python/cmappy.h
|
||||
include python/cmappy.pxd
|
||||
include python/mappy.pyx
|
||||
|
||||
@@ -1,17 +1,44 @@
|
||||
CFLAGS= -g -Wall -O2 -Wc++-compat
|
||||
CFLAGS= -g -Wall -O2 -Wc++-compat #-Wextra
|
||||
CPPFLAGS= -DHAVE_KALLOC
|
||||
INCLUDES=
|
||||
OBJS= kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o index.o chain.o align.o hit.o map.o format.o ksw2_ll_sse.o
|
||||
OBJS= kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o options.o index.o \
|
||||
lchain.o align.o hit.o seed.o jump.o map.o format.o pe.o esterr.o splitidx.o \
|
||||
ksw2_ll_sse.o
|
||||
PROG= minimap2
|
||||
PROG_EXTRA= sdust minimap2-lite
|
||||
LIBS= -lm -lz -lpthread
|
||||
|
||||
ifeq ($(sse2only),)
|
||||
OBJS+=ksw2_extz2_sse41.o ksw2_extd2_sse41.o ksw2_exts2_sse41.o ksw2_extz2_sse2.o ksw2_extd2_sse2.o ksw2_exts2_sse2.o ksw2_dispatch.o
|
||||
else
|
||||
OBJS+=ksw2_extz2_sse.o ksw2_extd2_sse.o ksw2_exts2_sse.o
|
||||
ifneq ($(aarch64),)
|
||||
arm_neon=1
|
||||
endif
|
||||
|
||||
ifeq ($(arm_neon),) # if arm_neon is not defined
|
||||
ifeq ($(sse2only),) # if sse2only is not defined
|
||||
OBJS+=ksw2_extz2_sse41.o ksw2_extd2_sse41.o ksw2_exts2_sse41.o ksw2_extz2_sse2.o ksw2_extd2_sse2.o ksw2_exts2_sse2.o ksw2_dispatch.o
|
||||
else # if sse2only is defined
|
||||
OBJS+=ksw2_extz2_sse.o ksw2_extd2_sse.o ksw2_exts2_sse.o
|
||||
endif
|
||||
else # if arm_neon is defined
|
||||
OBJS+=ksw2_extz2_neon.o ksw2_extd2_neon.o ksw2_exts2_neon.o
|
||||
INCLUDES+=-Isse2neon
|
||||
ifeq ($(aarch64),) #if aarch64 is not defined
|
||||
CFLAGS+=-D_FILE_OFFSET_BITS=64 -mfpu=neon -fsigned-char
|
||||
else #if aarch64 is defined
|
||||
CFLAGS+=-D_FILE_OFFSET_BITS=64 -fsigned-char
|
||||
endif
|
||||
endif
|
||||
|
||||
ifneq ($(asan),)
|
||||
CFLAGS+=-fsanitize=address
|
||||
LIBS+=-fsanitize=address -ldl
|
||||
endif
|
||||
|
||||
ifneq ($(tsan),)
|
||||
CFLAGS+=-fsanitize=thread
|
||||
LIBS+=-fsanitize=thread -ldl
|
||||
endif
|
||||
|
||||
.PHONY:all extra clean depend
|
||||
.SUFFIXES:.c .o
|
||||
|
||||
.c.o:
|
||||
@@ -21,8 +48,8 @@ all:$(PROG)
|
||||
|
||||
extra:all $(PROG_EXTRA)
|
||||
|
||||
minimap2:main.o getopt.o libminimap2.a
|
||||
$(CC) $(CFLAGS) main.o getopt.o -o $@ -L. -lminimap2 $(LIBS)
|
||||
minimap2:main.o libminimap2.a
|
||||
$(CC) $(CFLAGS) main.o -o $@ -L. -lminimap2 $(LIBS)
|
||||
|
||||
minimap2-lite:example.o libminimap2.a
|
||||
$(CC) $(CFLAGS) $< -o $@ -L. -lminimap2 $(LIBS)
|
||||
@@ -30,53 +57,81 @@ minimap2-lite:example.o libminimap2.a
|
||||
libminimap2.a:$(OBJS)
|
||||
$(AR) -csru $@ $(OBJS)
|
||||
|
||||
sdust:sdust.c getopt.o kalloc.o kalloc.h kdq.h kvec.h kseq.h sdust.h
|
||||
$(CC) -D_SDUST_MAIN $(CFLAGS) $< getopt.o kalloc.o -o $@ -lz
|
||||
sdust:sdust.c kalloc.o kalloc.h kdq.h kvec.h kseq.h ketopt.h sdust.h
|
||||
$(CC) -D_SDUST_MAIN $(CFLAGS) $< kalloc.o -o $@ -lz
|
||||
|
||||
# SSE-specific targets on x86/x86_64
|
||||
|
||||
ifeq ($(arm_neon),) # if arm_neon is defined, compile this target with the default setting (i.e. no -msse2)
|
||||
ksw2_ll_sse.o:ksw2_ll_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c $(CFLAGS) -msse2 $(CPPFLAGS) $(INCLUDES) $< -o $@
|
||||
endif
|
||||
|
||||
ksw2_extz2_sse41.o:ksw2_extz2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_extz2_sse2.o:ksw2_extz2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
|
||||
$(CC) -c $(CFLAGS) -msse2 -mno-sse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_extd2_sse41.o:ksw2_extd2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_extd2_sse2.o:ksw2_extd2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
|
||||
$(CC) -c $(CFLAGS) -msse2 -mno-sse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_exts2_sse41.o:ksw2_exts2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_exts2_sse2.o:ksw2_exts2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
|
||||
$(CC) -c $(CFLAGS) -msse2 -mno-sse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_dispatch.o:ksw2_dispatch.c ksw2.h
|
||||
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
|
||||
|
||||
# NEON-specific targets on ARM
|
||||
|
||||
ksw2_extz2_neon.o:ksw2_extz2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_SSE2_ONLY -D__SSE2__ $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_extd2_neon.o:ksw2_extd2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_SSE2_ONLY -D__SSE2__ $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_exts2_neon.o:ksw2_exts2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_SSE2_ONLY -D__SSE2__ $(INCLUDES) $< -o $@
|
||||
|
||||
# other non-file targets
|
||||
|
||||
clean:
|
||||
rm -fr gmon.out *.o a.out $(PROG) $(PROG_EXTRA) *~ *.a *.dSYM build dist mappy.so mappy.c python/mappy.c mappy.egg*
|
||||
rm -fr gmon.out *.o a.out $(PROG) $(PROG_EXTRA) *~ *.a *.dSYM build dist mappy*.so mappy.c python/mappy.c mappy.egg*
|
||||
|
||||
depend:
|
||||
(LC_ALL=C; export LC_ALL; makedepend -Y -- $(CFLAGS) $(CPPFLAGS) -- *.c)
|
||||
|
||||
# DO NOT DELETE
|
||||
|
||||
align.o: minimap.h mmpriv.h bseq.h ksw2.h kalloc.h
|
||||
bseq.o: bseq.h kseq.h
|
||||
chain.o: minimap.h mmpriv.h bseq.h kalloc.h
|
||||
align.o: minimap.h mmpriv.h bseq.h kseq.h ksw2.h kalloc.h
|
||||
bseq.o: bseq.h kvec.h kalloc.h kseq.h
|
||||
esterr.o: mmpriv.h minimap.h bseq.h kseq.h
|
||||
example.o: minimap.h kseq.h
|
||||
format.o: kalloc.h mmpriv.h minimap.h bseq.h
|
||||
getopt.o: getopt.h
|
||||
hit.o: mmpriv.h minimap.h bseq.h kalloc.h
|
||||
index.o: kthread.h bseq.h minimap.h mmpriv.h kvec.h kalloc.h khash.h
|
||||
format.o: kalloc.h mmpriv.h minimap.h bseq.h kseq.h
|
||||
hit.o: mmpriv.h minimap.h bseq.h kseq.h kalloc.h khash.h
|
||||
index.o: kthread.h bseq.h minimap.h mmpriv.h kseq.h ksw2.h kalloc.h kvec.h
|
||||
index.o: khash.h ksort.h
|
||||
jump.o: mmpriv.h minimap.h bseq.h kseq.h
|
||||
kalloc.o: kalloc.h
|
||||
ksw2_extd2_sse.o: ksw2.h kalloc.h
|
||||
ksw2_exts2_sse.o: ksw2.h kalloc.h
|
||||
ksw2_extz2_sse.o: ksw2.h kalloc.h
|
||||
ksw2_ll_sse.o: ksw2.h kalloc.h
|
||||
main.o: bseq.h minimap.h mmpriv.h getopt.h
|
||||
map.o: kthread.h kvec.h kalloc.h sdust.h mmpriv.h minimap.h bseq.h
|
||||
misc.o: minimap.h ksort.h
|
||||
kthread.o: kthread.h
|
||||
lchain.o: mmpriv.h minimap.h bseq.h kseq.h kalloc.h krmq.h
|
||||
main.o: bseq.h minimap.h mmpriv.h kseq.h ketopt.h
|
||||
map.o: kthread.h kvec.h kalloc.h sdust.h mmpriv.h minimap.h bseq.h kseq.h
|
||||
map.o: khash.h ksort.h
|
||||
misc.o: mmpriv.h minimap.h bseq.h kseq.h ksort.h
|
||||
options.o: mmpriv.h minimap.h bseq.h kseq.h
|
||||
pe.o: mmpriv.h minimap.h bseq.h kseq.h kvec.h kalloc.h ksort.h
|
||||
sdust.o: kalloc.h kdq.h kvec.h sdust.h
|
||||
sketch.o: kvec.h kalloc.h minimap.h
|
||||
seed.o: mmpriv.h minimap.h bseq.h kseq.h kalloc.h ksort.h
|
||||
sketch.o: kvec.h kalloc.h mmpriv.h minimap.h bseq.h kseq.h
|
||||
splitidx.o: mmpriv.h minimap.h bseq.h kseq.h
|
||||
|
||||
@@ -0,0 +1,97 @@
|
||||
CFLAGS= -g -Wall -O2 -Wc++-compat #-Wextra
|
||||
CPPFLAGS= -DHAVE_KALLOC -DUSE_SIMDE -DSIMDE_ENABLE_NATIVE_ALIASES
|
||||
INCLUDES= -Ilib/simde
|
||||
OBJS= kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o options.o index.o lchain.o align.o hit.o map.o format.o pe.o seed.o esterr.o splitidx.o \
|
||||
ksw2_extz2_simde.o ksw2_extd2_simde.o ksw2_exts2_simde.o ksw2_ll_simde.o
|
||||
PROG= minimap2
|
||||
PROG_EXTRA= sdust minimap2-lite
|
||||
LIBS= -lm -lz -lpthread
|
||||
|
||||
|
||||
ifneq ($(arm_neon),) # if arm_neon is defined
|
||||
ifeq ($(aarch64),) #if aarch64 is not defined
|
||||
CFLAGS+=-D_FILE_OFFSET_BITS=64 -mfpu=neon -fsigned-char
|
||||
else #if aarch64 is defined
|
||||
CFLAGS+=-D_FILE_OFFSET_BITS=64 -fsigned-char
|
||||
endif
|
||||
endif
|
||||
|
||||
ifneq ($(asan),)
|
||||
CFLAGS+=-fsanitize=address
|
||||
LIBS+=-fsanitize=address
|
||||
endif
|
||||
|
||||
ifneq ($(tsan),)
|
||||
CFLAGS+=-fsanitize=thread
|
||||
LIBS+=-fsanitize=thread
|
||||
endif
|
||||
|
||||
.PHONY:all extra clean depend
|
||||
.SUFFIXES:.c .o
|
||||
|
||||
.c.o:
|
||||
$(CC) -c $(CFLAGS) $(CPPFLAGS) $(INCLUDES) $< -o $@
|
||||
|
||||
all:$(PROG)
|
||||
|
||||
extra:all $(PROG_EXTRA)
|
||||
|
||||
minimap2:main.o libminimap2.a
|
||||
$(CC) $(CFLAGS) main.o -o $@ -L. -lminimap2 $(LIBS)
|
||||
|
||||
minimap2-lite:example.o libminimap2.a
|
||||
$(CC) $(CFLAGS) $< -o $@ -L. -lminimap2 $(LIBS)
|
||||
|
||||
libminimap2.a:$(OBJS)
|
||||
$(AR) -csru $@ $(OBJS)
|
||||
|
||||
sdust:sdust.c kalloc.o kalloc.h kdq.h kvec.h kseq.h ketopt.h sdust.h
|
||||
$(CC) -D_SDUST_MAIN $(CFLAGS) $< kalloc.o -o $@ -lz
|
||||
|
||||
ksw2_ll_simde.o:ksw2_ll_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c $(CFLAGS) -msse2 $(CPPFLAGS) $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_extz2_simde.o:ksw2_extz2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_extd2_simde.o:ksw2_extd2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) $(INCLUDES) $< -o $@
|
||||
|
||||
ksw2_exts2_simde.o:ksw2_exts2_sse.c ksw2.h kalloc.h
|
||||
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) $(INCLUDES) $< -o $@
|
||||
|
||||
# other non-file targets
|
||||
|
||||
clean:
|
||||
rm -fr gmon.out *.o a.out $(PROG) $(PROG_EXTRA) *~ *.a *.dSYM build dist mappy*.so mappy.c python/mappy.c mappy.egg*
|
||||
|
||||
depend:
|
||||
(LC_ALL=C; export LC_ALL; makedepend -Y -- $(CFLAGS) $(CPPFLAGS) -- *.c)
|
||||
|
||||
# DO NOT DELETE
|
||||
|
||||
align.o: minimap.h mmpriv.h bseq.h kseq.h ksw2.h kalloc.h
|
||||
bseq.o: bseq.h kvec.h kalloc.h kseq.h
|
||||
chain.o: minimap.h mmpriv.h bseq.h kseq.h kalloc.h
|
||||
esterr.o: mmpriv.h minimap.h bseq.h kseq.h
|
||||
example.o: minimap.h kseq.h
|
||||
format.o: kalloc.h mmpriv.h minimap.h bseq.h kseq.h
|
||||
hit.o: mmpriv.h minimap.h bseq.h kseq.h kalloc.h khash.h
|
||||
index.o: kthread.h bseq.h minimap.h mmpriv.h kseq.h kvec.h kalloc.h khash.h
|
||||
index.o: ksort.h
|
||||
kalloc.o: kalloc.h
|
||||
ksw2_extd2_sse.o: ksw2.h kalloc.h
|
||||
ksw2_exts2_sse.o: ksw2.h kalloc.h
|
||||
ksw2_extz2_sse.o: ksw2.h kalloc.h
|
||||
ksw2_ll_sse.o: ksw2.h kalloc.h
|
||||
kthread.o: kthread.h
|
||||
main.o: bseq.h minimap.h mmpriv.h kseq.h ketopt.h
|
||||
map.o: kthread.h kvec.h kalloc.h sdust.h mmpriv.h minimap.h bseq.h kseq.h
|
||||
map.o: khash.h ksort.h
|
||||
misc.o: mmpriv.h minimap.h bseq.h kseq.h ksort.h
|
||||
options.o: mmpriv.h minimap.h bseq.h kseq.h
|
||||
pe.o: mmpriv.h minimap.h bseq.h kseq.h kvec.h kalloc.h ksort.h
|
||||
sdust.o: kalloc.h kdq.h kvec.h sdust.h
|
||||
self-chain.o: minimap.h kseq.h
|
||||
sketch.o: kvec.h kalloc.h mmpriv.h minimap.h bseq.h kseq.h
|
||||
splitidx.o: mmpriv.h minimap.h bseq.h kseq.h
|
||||
@@ -1,3 +1,853 @@
|
||||
Release 2.29-r1283 (18 April 2025)
|
||||
----------------------------------
|
||||
|
||||
Notable changes to minimap2:
|
||||
|
||||
* New feature: added the `splice:sr` preset for short RNA-seq read alignment.
|
||||
Users may use `-j` to specify known gene annotation to improve spliced
|
||||
alignment close to the ends of short reads. Also added `--write-junc` and
|
||||
`--pass1` for 2-pass short-read RNA-seq alignment.
|
||||
|
||||
* Experimental feature: read splice scores from a file specified by `--spsc`
|
||||
and consider the scores during base alignment. The feature makes it possible
|
||||
to apply advanced splice models and to improve spliced alignment.
|
||||
|
||||
* Change: adjusted the mapping quality calculation for spliced alignment.
|
||||
|
||||
* Bugfixes: a) missing overlap alignment when base alignment is requested
|
||||
(#969); b) incorrect summary information for long genomes (#1192); c)
|
||||
missing parameter check for `--score-N` (#1226).
|
||||
|
||||
* Improvement: a) warn about absent junction files (#1229); b) report an error
|
||||
if a wrong preset prefixed with "splice" is specified (#589).
|
||||
|
||||
Notable changes to mappy:
|
||||
|
||||
* Improvement: allow passing read name (#1260)
|
||||
|
||||
* Improvement: exposed score for ambiguous bases (#1240)
|
||||
|
||||
Minimap2 now supports short/long genomic/RNA-seq read alignment along with
|
||||
contig alignment and all-vs-all read overlapping. It produces identical genomic
|
||||
long-read or contig alignment to v2.27. Short genomic read alignment and the
|
||||
mapping quality of long RNA-seq read alignment may slightly differ in very rare
|
||||
cases.
|
||||
|
||||
(2.29: 18 April 2025, r1283)
|
||||
|
||||
|
||||
|
||||
Release 2.28-r1209 (27 March 2024)
|
||||
----------------------------------
|
||||
|
||||
Notable changes to minimap2:
|
||||
|
||||
* Bugfix: `--MD` was not working properly due to the addition of `--ds` in the
|
||||
last release (#1181 and #1182).
|
||||
|
||||
* New feature: added an experimental preset `lq:hqae` for aligning accurate
|
||||
long reads back to their assembly. It has been observed that `map-hifi` and
|
||||
`lr:hq` may produce many wrong alignments around centromeres when accurate
|
||||
long reads (PacBio HiFi or Nanopore duplex/Q20+) are mapped to a diploid
|
||||
assembly constructed from them. This new preset produces much more accurate
|
||||
alignment. It is still experimental and may be subjective to changes in
|
||||
future.
|
||||
|
||||
* Change: reduced the default `--cap-kalloc` to 500m to lower the peak
|
||||
memory consumption (#855).
|
||||
|
||||
Notable changes to mappy:
|
||||
|
||||
* Bugfix: mappy option struct was out of sync with minimap2 (#1177).
|
||||
|
||||
Minimap2 should output identical alignments to v2.27.
|
||||
|
||||
(2.28: 27 March 2024, r1209)
|
||||
|
||||
|
||||
|
||||
Release 2.27-r1193 (12 March 2024)
|
||||
----------------------------------
|
||||
|
||||
Notable changes to minimap2:
|
||||
|
||||
* New feature: added the `lr:hq` preset for accurate long reads at ~1% error
|
||||
rate. This was suggested by Oxford Nanopore developers (#1127). It is not
|
||||
clear if this preset also works well for PacBio HiFi reads.
|
||||
|
||||
* New feature: added the `map-iclr` preset for Illumina Complete Long Reads
|
||||
(#1069), provided by Illumina developers.
|
||||
|
||||
* New feature: added option `-b` to specify mismatch penalty for base
|
||||
transitions (i.e. A-to-G or C-to-T changes).
|
||||
|
||||
* New feature: added option `--ds` to generate a new `ds:Z` tag that
|
||||
indicates uncertainty in INDEL positions. It is an extension to `cs`. The
|
||||
`mgutils-es6.js` script in minigraph parses `ds`.
|
||||
|
||||
* Bugfix: avoided a NULL pointer dereference (#1154). This would not have an
|
||||
effect on most systems but would still be good to fix.
|
||||
|
||||
* Bugfix: reverted the value of `ms:i` to pre-2.22 versions (#1146). This was
|
||||
an oversight. See fcd4df2 for details.
|
||||
|
||||
Notable changes to paftools.js and mappy:
|
||||
|
||||
* New feature: expose `bw_long` to mappy's Aligner class (#1124).
|
||||
|
||||
* Bugfix: fixed several compatibility issues with k8 v1.0 (#1161 and #1166).
|
||||
Subcommands "call", "pbsim2fq" and "mason2fq" were not working with v1.0.
|
||||
|
||||
Minimap2 should output identical alignments to v2.26, except the ms tag.
|
||||
|
||||
(2.27: 12 March 2024, r1193)
|
||||
|
||||
|
||||
|
||||
Release 2.26-r1175 (29 April 2023)
|
||||
----------------------------------
|
||||
|
||||
Fixed the broken Python package. This is the only change.
|
||||
|
||||
(2.26: 25 April 2023, r1173)
|
||||
|
||||
|
||||
|
||||
Release 2.25-r1173 (25 April 2023)
|
||||
----------------------------------
|
||||
|
||||
Notable changes:
|
||||
|
||||
* Improvement: use the miniprot splice model for RNA-seq alignment by default.
|
||||
This model considers non-GT-AG splice sites and leads to slightly higher
|
||||
(<0.1%) accuracy and sensitivity on real human data.
|
||||
|
||||
* Change: increased the default `-I` to `8G` such that minimap2 would create a
|
||||
uni-part index for a pair of mammalian genomes. This change may increase the
|
||||
memory for all-vs-all read overlap alignment given large datasets.
|
||||
|
||||
* New feature: output the sequences in secondary alignments with option
|
||||
`--secondary-seq` (#687).
|
||||
|
||||
* Bugfix: --rmq was not parsed correctly (#1010)
|
||||
|
||||
* Bugfix: possibly incorrect coordinate when applying end bonus to the target
|
||||
sequence (#1025). This is a ksw2 bug. It does not affect minimap2 as
|
||||
minimap2 is not using the affected feature.
|
||||
|
||||
* Improvement: incorporated several changes for better compatibility with
|
||||
Windows (#1051) and for minimap2 integration at Oxford Nanopore Technologies
|
||||
(#1048 and #1033).
|
||||
|
||||
* Improvement: output the HD-line in SAM output (#1019).
|
||||
|
||||
* Improvement: check minimap2 index file in mappy to prevent segmentation
|
||||
fault for certain indices (#1008).
|
||||
|
||||
For genomic sequences, minimap2 should give identical output to v2.24.
|
||||
Long-read RNA-seq alignment may occasionally differ from previous versions.
|
||||
|
||||
(2.25: 25 April 2023, r1173)
|
||||
|
||||
|
||||
|
||||
Release 2.24-r1122 (26 December 2021)
|
||||
-------------------------------------
|
||||
|
||||
This release improves alignment around long poorly aligned regions. Older
|
||||
minimap2 may chain through such regions in rare cases which may result in
|
||||
missing alignments later. The issue has become worse since the the change of
|
||||
the chaining algorithm in v2.19. v2.23 implements an incomplete remedy. This
|
||||
release provides a better solution with a X-drop-like heuristic and by enabling
|
||||
two-bandwidth chaining in the assembly mode.
|
||||
|
||||
(2.24: 26 December 2021, r1122)
|
||||
|
||||
|
||||
|
||||
Release 2.23-r1111 (18 November 2021)
|
||||
-------------------------------------
|
||||
|
||||
Notable changes:
|
||||
|
||||
* Bugfix: fixed missing alignments around long inversions (#806 and #816).
|
||||
This bug affected v2.19 through v2.22.
|
||||
|
||||
* Improvement: avoid extremely long mapping time for pathologic reads with
|
||||
highly repeated k-mers not in the reference (#771). Use --q-occ-frac=0
|
||||
to disable the new heuristic.
|
||||
|
||||
* Change: use --cap-kalloc=1g by default.
|
||||
|
||||
(2.23: 18 November 2021, r1111)
|
||||
|
||||
|
||||
|
||||
Release 2.22-r1101 (7 August 2021)
|
||||
----------------------------------
|
||||
|
||||
When choosing the best alignment, this release uses logarithm gap penalty and
|
||||
query-specific mismatch penalty. It improves the sensitivity to long INDELs in
|
||||
repetitive regions.
|
||||
|
||||
Other notable changes:
|
||||
|
||||
* Bugfix: fixed an indirect memory leak that may waste a large amount of
|
||||
memory given highly repetitive reference such as a 16S RNA database (#749).
|
||||
All versions of minimap2 have this issue.
|
||||
|
||||
* New feature: added --cap-kalloc to reduce the peak memory. This option is
|
||||
not enabled by default but may become the default in future releases.
|
||||
|
||||
Known issue:
|
||||
|
||||
* Minimap2 may take a long time to map a read (#771). So far it is not clear
|
||||
if this happens to v2.18 and earlier versions.
|
||||
|
||||
(2.22: 7 August 2021, r1101)
|
||||
|
||||
|
||||
|
||||
Release 2.21-r1071 (6 July 2021)
|
||||
--------------------------------
|
||||
|
||||
This release fixed a regression in short-read mapping introduced in v2.19
|
||||
(#776). It also fixed invalid comparisons of uninitialized variables, though
|
||||
these are harmless (#752). Long-read alignment should be identical to v2.20.
|
||||
|
||||
(2.21: 6 July 2021, r1071)
|
||||
|
||||
|
||||
|
||||
Release 2.20-r1061 (27 May 2021)
|
||||
--------------------------------
|
||||
|
||||
This release fixed a bug in the Python module and improves the command-line
|
||||
compatibiliity with v2.18. In v2.19, if `-r` is specified with an `asm*` preset,
|
||||
users would get alignments more fragmented than v2.18. This could be an issue
|
||||
for existing pipelines specifying `-r`. This release resolves this issue.
|
||||
|
||||
(2.20: 27 May 2021, r1061)
|
||||
|
||||
|
||||
|
||||
Release 2.19-r1057 (26 May 2021)
|
||||
--------------------------------
|
||||
|
||||
This release includes a few important improvements backported from unimap:
|
||||
|
||||
* Improvement: more contiguous alignment through long INDELs. This is enabled
|
||||
by the minigraph chaining algorithm. All `asm*` presets now use the new
|
||||
algorithm. They can find INDELs up to 100kb and may be faster for
|
||||
chromosome-long contigs. The default mode and `map*` presets use this
|
||||
algorithm to replace the long-join heuristic.
|
||||
|
||||
* Improvement: better alignment in highly repetitive regions by rescuing
|
||||
high-occurrence seeds. If the distance between two adjacent seeds is too
|
||||
large, attempt to choose a fraction of high-occurrence seeds in-between.
|
||||
Minimap2 now produces fewer clippings and alignment break points in long
|
||||
satellite regions.
|
||||
|
||||
* Improvement: allow to specify an interval of k-mer occurrences with `-U`.
|
||||
For repeat-rich genomes, the automatic k-mer occurrence threshold determined
|
||||
by `-f` may be too large and makes alignment impractically slow. The new
|
||||
option protects against such cases. Enabled for `asm*` and `map-hifi`.
|
||||
|
||||
* New feature: added the `map-hifi` preset for maping PacBio High-Fidelity
|
||||
(HiFi) reads.
|
||||
|
||||
* Change to the default: apply `--cap-sw-mem=100m` for genomic alignment.
|
||||
|
||||
* Bugfix: minimap2 could not generate an index file with `-xsr` (#734).
|
||||
|
||||
This release represents the most signficant algorithmic change since v2.1 in
|
||||
2017. With features backported from unimap, minimap2 now has similar power to
|
||||
unimap for contig alignment. Unimap will remain an experimental project and is
|
||||
no longer recommended over minimap2. Sorry for reverting the recommendation in
|
||||
short time.
|
||||
|
||||
(2.19: 26 May 2021, r1057)
|
||||
|
||||
|
||||
|
||||
Release 2.18-r1015 (9 April 2021)
|
||||
---------------------------------
|
||||
|
||||
This release fixes multiple rare bugs in minimap2 and adds additional
|
||||
functionality to paftools.js.
|
||||
|
||||
Changes to minimap2:
|
||||
|
||||
* Bugfix: a rare segfault caused by an off-by-one error (#489)
|
||||
|
||||
* Bugfix: minimap2 segfaulted due to an uninitilized variable (#622 and #625).
|
||||
|
||||
* Bugfix: minimap2 parsed spaces as field separators in BED (#721). This led
|
||||
to issues when the BED name column contains spaces.
|
||||
|
||||
* Bugfix: minimap2 `--split-prefix` did not work with long reference names
|
||||
(#394).
|
||||
|
||||
* Bugfix: option `--junc-bonus` didn't work (#513)
|
||||
|
||||
* Bugfix: minimap2 didn't return 1 on I/O errors (#532)
|
||||
|
||||
* Bugfix: the `de:f` tag (sequence divergence) could be negative if there were
|
||||
ambiguous bases
|
||||
|
||||
* Bugfix: fixed two undefined behaviors caused by calling memcpy() on
|
||||
zero-length blocks (#443)
|
||||
|
||||
* Bugfix: there were duplicated SAM @SQ lines if option `--split-prefix` is in
|
||||
use (#400 and #527)
|
||||
|
||||
* Bugfix: option -K had to be smaller than 2 billion (#491). This was caused
|
||||
by a 32-bit integer overflow.
|
||||
|
||||
* Improvement: optionally compile against SIMDe (#597). Minimap2 should work
|
||||
with IBM POWER CPUs, though this has not been tested. To compile with SIMDe,
|
||||
please use `make -f Makefile.simde`.
|
||||
|
||||
* Improvement: more informative error message for I/O errors (#454) and for
|
||||
FASTQ parsing errors (#510)
|
||||
|
||||
* Improvement: abort given malformatted RG line (#541)
|
||||
|
||||
* Improvement: better formula to estimate the `dv:f` tag (approximate sequence
|
||||
divergence). See DOI:10.1101/2021.01.15.426881.
|
||||
|
||||
* New feature: added the `--mask-len` option to fine control the removal of
|
||||
redundant hits (#659). The default behavior is unchanged.
|
||||
|
||||
Changes to mappy:
|
||||
|
||||
* Bugfix: mappy caused segmentation fault if the reference index is not
|
||||
present (#413).
|
||||
|
||||
* Bugfix: fixed a memory leak via 238b6bb3
|
||||
|
||||
* Change: always require Cython to compile the mappy module (#723). Older
|
||||
mappy packages at PyPI bundled the C source code generated by Cython such
|
||||
that end users did not need to install Cython to compile mappy. However, as
|
||||
Python 3.9 is breaking backward compatibility, older mappy does not work
|
||||
with Python 3.9 anymore. We have to add this Cython dependency as a
|
||||
workaround.
|
||||
|
||||
Changes to paftools.js:
|
||||
|
||||
* Bugfix: the "part10-" line from asmgene was wrong (#581)
|
||||
|
||||
* Improvement: compatibility with GTF files from GenBank (#422)
|
||||
|
||||
* New feature: asmgene also checks missing multi-copy genes
|
||||
|
||||
* New feature: added the misjoin command to evaluate large-scale misjoins and
|
||||
megabase-long inversions.
|
||||
|
||||
Although given the many bug fixes and minor improvements, the core algorithm
|
||||
stays the same. This version of minimap2 produces nearly identical alignments
|
||||
to v2.17 except very rare corner cases.
|
||||
|
||||
Now unimap is recommended over minimap2 for aligning long contigs against a
|
||||
reference genome. It often takes less wall-clock time and is much more
|
||||
sensitive to long insertions and deletions.
|
||||
|
||||
(2.18: 9 April 2021, r1015)
|
||||
|
||||
|
||||
|
||||
Release 2.17-r941 (4 May 2019)
|
||||
------------------------------
|
||||
|
||||
Changes since the last release:
|
||||
|
||||
* Fixed flawed CIGARs like `5I6D7I` (#392).
|
||||
|
||||
* Bugfix: TLEN should be 0 when either end is unmapped (#373 and #365).
|
||||
|
||||
* Bugfix: mappy is unable to write index (#372).
|
||||
|
||||
* Added option `--junc-bed` to load known gene annotations in the BED12
|
||||
format. Minimap2 prefers annotated junctions over novel junctions (#197 and
|
||||
#348). GTF can be converted to BED12 with `paftools.js gff2bed`.
|
||||
|
||||
* Added option `--sam-hit-only` to suppress unmapped hits in SAM (#377).
|
||||
|
||||
* Added preset `splice:hq` for high-quality CCS or mRNA sequences. It applies
|
||||
better scoring and improves the sensitivity to small exons. This preset may
|
||||
introduce false small introns, but the overall accuracy should be higher.
|
||||
|
||||
This version produces nearly identical alignments to v2.16, except for CIGARs
|
||||
affected by the bug mentioned above.
|
||||
|
||||
(2.17: 5 May 2019, r941)
|
||||
|
||||
|
||||
|
||||
Release 2.16-r922 (28 February 2019)
|
||||
------------------------------------
|
||||
|
||||
This release is 50% faster for mapping ultra-long nanopore reads at comparable
|
||||
accuracy. For short-read mapping, long-read overlapping and ordinary long-read
|
||||
mapping, the performance and accuracy remain similar. This speedup is achieved
|
||||
with a new heuristic to limit the number of chaining iterations (#324). Users
|
||||
can disable the heuristic by increasing a new option `--max-chain-iter` to a
|
||||
huge number.
|
||||
|
||||
Other changes to minimap2:
|
||||
|
||||
* Implemented option `--paf-no-hit` to output unmapped query sequences in PAF.
|
||||
The strand and reference name columns are both `*` at an unmapped line. The
|
||||
hidden option is available in earlier minimap2 but had a different 2-column
|
||||
output format instead of PAF.
|
||||
|
||||
* Fixed a bug that leads to wrongly calculated `de` tags when ambiguous bases
|
||||
are involved (#309). This bug only affects v2.15.
|
||||
|
||||
* Fixed a bug when parsing command-line option `--splice` (#344). This bug was
|
||||
introduced in v2.13.
|
||||
|
||||
* Fixed two division-by-zero cases (#326). They don't affect final alignments
|
||||
because the results of the divisions are not used in both case.
|
||||
|
||||
* Added an option `-o` to output alignments to a specified file. It is still
|
||||
recommended to use UNIX pipes for on-the-fly conversion or compression.
|
||||
|
||||
* Output a new `rl` tag to give the length of query regions harboring
|
||||
repetitive seeds.
|
||||
|
||||
Changes to paftool.js:
|
||||
|
||||
* Added a new option to convert the MD tag to the long form of the cs tag.
|
||||
|
||||
Changes to mappy:
|
||||
|
||||
* Added the `mappy.Aligner.seq_names` method to return sequence names (#312).
|
||||
|
||||
For NA12878 ultra-long reads, this release changes the alignments of <0.1% of
|
||||
reads in comparison to v2.15. All these reads have highly fragmented alignments
|
||||
and are likely to be problematic anyway. For shorter or well aligned reads,
|
||||
this release should produce mostly identical alignments to v2.15.
|
||||
|
||||
(2.16: 28 February 2019, r922)
|
||||
|
||||
|
||||
|
||||
Release 2.15-r905 (10 January 2019)
|
||||
-----------------------------------
|
||||
|
||||
Changes to minimap2:
|
||||
|
||||
* Fixed a rare segmentation fault when option -H is in use (#307). This may
|
||||
happen when there are very long homopolymers towards the 5'-end of a read.
|
||||
|
||||
* Fixed wrong CIGARs when option --eqx is used (#266).
|
||||
|
||||
* Fixed a typo in the base encoding table (#264). This should have no
|
||||
practical effect.
|
||||
|
||||
* Fixed a typo in the example code (#265).
|
||||
|
||||
* Improved the C++ compatibility by removing "register" (#261). However,
|
||||
minimap2 still can't be compiled in the pedantic C++ mode (#306).
|
||||
|
||||
* Output a new "de" tag for gap-compressed sequence divergence.
|
||||
|
||||
Changes to paftools.js:
|
||||
|
||||
* Added "asmgene" to evaluate the completeness of an assembly by measuring the
|
||||
uniquely mapped single-copy genes. This command learns the idea of BUSCO.
|
||||
|
||||
* Added "vcfpair" to call a phased VCF from phased whole-genome assemblies. An
|
||||
earlier version of this script is used to produce the ground truth for the
|
||||
syndip benchmark [PMID:30013044].
|
||||
|
||||
This release produces identical alignment coordinates and CIGARs in comparison
|
||||
to v2.14. Users are advised to upgrade due to the several bug fixes.
|
||||
|
||||
(2.15: 10 Janurary 2019, r905)
|
||||
|
||||
|
||||
|
||||
Release 2.14-r883 (5 November 2018)
|
||||
-----------------------------------
|
||||
|
||||
Notable changes:
|
||||
|
||||
* Fixed two minor bugs caused by typos (#254 and #266).
|
||||
|
||||
* Fixed a bug that made minimap2 abort when --eqx was used together with --MD
|
||||
or --cs (#257).
|
||||
|
||||
* Added --cap-sw-mem to cap the size of DP matrices (#259). Base alignment may
|
||||
take a lot of memory in the splicing mode. This may lead to issues when we
|
||||
run minimap2 on a cluster with a hard memory limit. The new option avoids
|
||||
unlimited memory usage at the cost of missing a few long introns.
|
||||
|
||||
* Conforming to C99 and C11 when possible (#261).
|
||||
|
||||
* Warn about malformatted FASTA or FASTQ (#252 and #255).
|
||||
|
||||
This release occasionally produces base alignments different from v2.13. The
|
||||
overall alignment accuracy remain similar.
|
||||
|
||||
(2.14: 5 November 2018, r883)
|
||||
|
||||
|
||||
|
||||
Release 2.13-r850 (11 October 2018)
|
||||
-----------------------------------
|
||||
|
||||
Changes to minimap2:
|
||||
|
||||
* Fixed wrongly formatted SAM when -L is in use (#231 and #233).
|
||||
|
||||
* Fixed an integer overflow in rare cases.
|
||||
|
||||
* Added --hard-mask-level to fine control split alignments (#244).
|
||||
|
||||
* Made --MD work with spliced alignment (#139).
|
||||
|
||||
* Replaced musl's getopt with ketopt for portability.
|
||||
|
||||
* Log peak memory usage on exit.
|
||||
|
||||
This release should produce alignments identical to v2.12 and v2.11.
|
||||
|
||||
(2.13: 11 October 2018, r850)
|
||||
|
||||
|
||||
|
||||
Release 2.12-r827 (6 August 2018)
|
||||
---------------------------------
|
||||
|
||||
Changes to minimap2:
|
||||
|
||||
* Added option --split-prefix to write proper alignments (correct mapping
|
||||
quality and clustered query sequences) given a multi-part index (#141 and
|
||||
#189; mostly by @hasindu2008).
|
||||
|
||||
* Fixed a memory leak when option -y is in use.
|
||||
|
||||
Changes to mappy:
|
||||
|
||||
* Support the MD/cs tag (#183 and #203).
|
||||
|
||||
* Allow mappy to index a single sequence, to add extra flags and to change the
|
||||
scoring system.
|
||||
|
||||
Minimap2 should produce alignments identical to v2.11.
|
||||
|
||||
(2.12: 6 August 2018, r827)
|
||||
|
||||
|
||||
|
||||
Release 2.11-r797 (20 June 2018)
|
||||
--------------------------------
|
||||
|
||||
Changes to minimap2:
|
||||
|
||||
* Improved alignment accuracy in low-complexity regions for SV calling. Thank
|
||||
@armintoepfer for multiple offline examples.
|
||||
|
||||
* Added option --eqx to encode sequence match/mismatch with the =/X CIGAR
|
||||
operators (#156, #157 and #175).
|
||||
|
||||
* When compiled with VC++, minimap2 generated wrong alignments due to a
|
||||
comparison between a signed integer and an unsigned integer (#184). Also
|
||||
fixed warnings reported by "clang -Wextra".
|
||||
|
||||
* Fixed incorrect anchor filtering due to a missing 64- to 32-bit cast.
|
||||
|
||||
* Fixed incorrect mapping quality for inversions (#148).
|
||||
|
||||
* Fixed incorrect alignment involving ambiguous bases (#155).
|
||||
|
||||
* Fixed incorrect presets: option `-r 2000` is intended to be used with
|
||||
ava-ont, not ava-pb. The bug was introduced in 2.10.
|
||||
|
||||
* Fixed a bug when --for-only/--rev-only is used together with --sr or
|
||||
--heap-sort=yes (#166).
|
||||
|
||||
* Fixed option -Y that was not working in the previous releases.
|
||||
|
||||
* Added option --lj-min-ratio to fine control the alignment of long gaps
|
||||
found by the "long-join" heuristic (#128).
|
||||
|
||||
* Exposed `mm_idx_is_idx`, `mm_idx_load` and `mm_idx_dump` C APIs (#177).
|
||||
Also fixed a bug when indexing without reference names (this feature is not
|
||||
exposed to the command line).
|
||||
|
||||
Changes to mappy:
|
||||
|
||||
* Added `__version__` (#165).
|
||||
|
||||
* Exposed the maximum fragment length parameter to mappy (#174).
|
||||
|
||||
Changes to paftools:
|
||||
|
||||
* Don't crash when there is no "cg" tag (#153).
|
||||
|
||||
* Fixed wrong coverage report by "paftools.js call" (#145).
|
||||
|
||||
This version may produce slightly different base-level alignment. The overall
|
||||
alignment statistics should remain similar.
|
||||
|
||||
(2.11: 20 June 2018, r797)
|
||||
|
||||
|
||||
|
||||
Release 2.10-r761 (27 March 2018)
|
||||
---------------------------------
|
||||
|
||||
Changes to minimap2:
|
||||
|
||||
* Optionally output the MD tag for compatibility with existing tools (#63,
|
||||
#118 and #137).
|
||||
|
||||
* Use SSE compiler flags more precisely to prevent compiling errors on certain
|
||||
machines (#127).
|
||||
|
||||
* Added option --min-occ-floor to set a minimum occurrence threshold. Presets
|
||||
intended for assembly-to-reference alignment set this option to 100. This
|
||||
option alleviates issues with regions having high copy numbers (#107).
|
||||
|
||||
* Exit with non-zero code on file writing errors (e.g. disk full; #103 and
|
||||
#132).
|
||||
|
||||
* Added option -y to copy FASTA/FASTQ comments in query sequences to the
|
||||
output (#136).
|
||||
|
||||
* Added the asm20 preset for alignments between genomes at 5-10% sequence
|
||||
divergence.
|
||||
|
||||
* Changed the band-width in the ava-ont preset from 500 to 2000. Oxford
|
||||
Nanopore reads may contain long deletion sequencing errors that break
|
||||
chaining.
|
||||
|
||||
Changes to mappy, the Python binding:
|
||||
|
||||
* Fixed a typo in Align.seq() (#126).
|
||||
|
||||
Changes to paftools.js, the companion script:
|
||||
|
||||
* Command sam2paf now converts the MD tag to cs.
|
||||
|
||||
* Support VCF output for assembly-to-reference variant calling (#109).
|
||||
|
||||
This version should produce identical alignment for read overlapping, RNA-seq
|
||||
read mapping, and genomic read mapping. We have also added a cook book to show
|
||||
the variety uses of minimap2 on real datasets. Please see cookbook.md in the
|
||||
minimap2 source code directory.
|
||||
|
||||
(2.10: 27 March 2017, r761)
|
||||
|
||||
|
||||
|
||||
Release 2.9-r720 (23 February 2018)
|
||||
-----------------------------------
|
||||
|
||||
This release fixed multiple minor bugs.
|
||||
|
||||
* Fixed two bugs that lead to incorrect inversion alignment. Also improved the
|
||||
sensitivity to small inversions by using double Z-drop cutoff (#112).
|
||||
|
||||
* Fixed an issue that may cause the end of a query sequence unmapped (#104).
|
||||
|
||||
* Added a mappy API to retrieve sequences from the index (#126) and to reverse
|
||||
complement DNA sequences. Fixed a bug where the `best_n` parameter did not
|
||||
work (#117).
|
||||
|
||||
* Avoided segmentation fault given incorrect FASTQ input (#111).
|
||||
|
||||
* Combined all auxiliary javascripts to paftools.js. Fixed several bugs in
|
||||
these scripts at the same time.
|
||||
|
||||
(2.9: 24 February 2018, r720)
|
||||
|
||||
|
||||
|
||||
Release 2.8-r672 (1 February 2018)
|
||||
----------------------------------
|
||||
|
||||
Notable changes in this release include:
|
||||
|
||||
* Speed up short-read alignment by ~10%. The overall mapping accuracy stays
|
||||
the same, but the output alignments are not always identical to v2.7 due to
|
||||
unstable sorting employed during chaining. Long-read alignment is not
|
||||
affected by this change as the speedup is short-read specific.
|
||||
|
||||
* Mappy now supports paired-end short-read alignment (#87). Please see
|
||||
python/README.rst for details.
|
||||
|
||||
* Added option --for-only and --rev-only to perform alignment against the
|
||||
forward or the reverse strand of the reference genome only (#91).
|
||||
|
||||
* Alleviated the issue with undesired diagonal alignment in the self mapping
|
||||
mode (#10). Even if the output is not ideal, it should not interfere with
|
||||
other alignments. Fully resolving the issue is intricate and may require
|
||||
additional heuristic thresholds.
|
||||
|
||||
* Enhanced error checking against incorrect input (#92 and #96).
|
||||
|
||||
For long query sequences, minimap2 should output identical alignments to v2.7.
|
||||
|
||||
(2.8: 1 February 2018, r672)
|
||||
|
||||
|
||||
|
||||
Release 2.7-r654 (9 January 2018)
|
||||
---------------------------------
|
||||
|
||||
This release fixed a bug in the splice mode and added a few minor features:
|
||||
|
||||
* Fixed a bug that occasionally takes an intron as a long deletion in the
|
||||
splice mode. This was caused by wrong backtracking at the last CIGAR
|
||||
operator. The current fix eliminates the error, but it is not optimal in
|
||||
that it often produces a wrong junction when the last operator is an intron.
|
||||
A future version of minimap2 may improve upon this.
|
||||
|
||||
* Support high-end ARM CPUs that implement the NEON instruction set (#81).
|
||||
This enables minimap2 to work on Raspberry Pi 3 and Odroid XU4.
|
||||
|
||||
* Added a C API to construct a minimizer index from a set of C strings (#80).
|
||||
|
||||
* Check scoring specified on the command line (#79). Due to the 8-bit limit,
|
||||
excessively large score penalties fail minimap2.
|
||||
|
||||
For genomic sequences, minimap2 should give identical alignments to v2.6.
|
||||
|
||||
(2.7: 9 January 2018, r654)
|
||||
|
||||
|
||||
|
||||
Release 2.6-r623 (12 December 2017)
|
||||
-----------------------------------
|
||||
|
||||
This release adds several features and fixes two minor bugs:
|
||||
|
||||
* Optionally build an index without sequences. This helps to reduce the
|
||||
peak memory for read overlapping and is automatically applied when
|
||||
base-level alignment is not requested.
|
||||
|
||||
* Approximately estimate per-base sequence divergence (i.e. 1-identity)
|
||||
without performing base-level alignment, using a MashMap-like method. The
|
||||
estimate is written to a new dv:f tag.
|
||||
|
||||
* Reduced the number of tiny terminal exons in RNA-seq alignment. The current
|
||||
setting is conservative. Increase --end-seed-pen to drop more such exons.
|
||||
|
||||
* Reduced the peak memory when aligning long query sequences.
|
||||
|
||||
* Fixed a bug that is caused by HPC minimizers longer than 256bp. This should
|
||||
have no effect in practice, but it is recommended to rebuild HPC indices if
|
||||
possible.
|
||||
|
||||
* Fixed a bug when identifying identical hits (#71). This should only affect
|
||||
artifactual reference consisting of near identical sequences.
|
||||
|
||||
For genomic sequences, minimap2 should give nearly identical alignments to
|
||||
v2.5, except the new dv:f tag.
|
||||
|
||||
(2.6: 12 December 2017, r623)
|
||||
|
||||
|
||||
|
||||
Release 2.5-r572 (11 November 2017)
|
||||
-----------------------------------
|
||||
|
||||
This release fixes several bugs and brings a couple of minor improvements:
|
||||
|
||||
* Fixed a severe bug that leads to incorrect mapping coordinates in rare
|
||||
corner cases.
|
||||
|
||||
* Fixed underestimated mapping quality for chimeric alignments when the whole
|
||||
query sequence contain many repetitive minimizers, and for chimeric
|
||||
alignments caused by Z-drop.
|
||||
|
||||
* Fixed two bugs in Python binding: incorrect strand field (#57) and incorrect
|
||||
sequence names for Python3 (#55).
|
||||
|
||||
* Improved mapping accuracy for highly overlapping paired ends.
|
||||
|
||||
* Added option -Y to use soft clipping for supplementary alignments (#56).
|
||||
|
||||
(2.5: 11 November 2017, r572)
|
||||
|
||||
|
||||
|
||||
Release 2.4-r555 (6 November 2017)
|
||||
----------------------------------
|
||||
|
||||
As is planned, this release focuses on fine tuning the base algorithm. Notable
|
||||
changes include
|
||||
|
||||
* Changed the mapping quality scale to match the scale of BWA-MEM. This makes
|
||||
minimap2 and BWA-MEM achieve similar sensitivity-specificity balance on real
|
||||
short-read data.
|
||||
|
||||
* Improved the accuracy of splice alignment by modeling one additional base
|
||||
close to the GT-AG signal. This model is used by default with `-x splice`.
|
||||
For SIRV control data, however, it is recommended to add `--splice-flank=no`
|
||||
to disable this feature as the SIRV splice signals are slightly different.
|
||||
|
||||
* Tuned the parameters for Nanopore Direct RNA reads. The recommended command
|
||||
line is `-axsplice -k14 -uf` (#46).
|
||||
|
||||
* Fixed a segmentation fault when aligning PacBio reads (#47 and #48). This
|
||||
bug is very rare but it affects all versions of minimap2. It is also
|
||||
recommended to re-index reference genomes created with `map-pb`. For human,
|
||||
two minimizers in an old index are wrong.
|
||||
|
||||
* Changed option `-L` in sync with the final decision of hts-specs: a fake
|
||||
CIGAR takes the form of `<readLen>S<refLen>N`. Note that `-L` only enables
|
||||
future tools to recognize long CIGARs. It is not possible for older tools to
|
||||
work with such alignments in BAM (#43 and #51).
|
||||
|
||||
* Fixed a tiny issue whereby minimap2 may waste 8 bytes per candidate
|
||||
alignment.
|
||||
|
||||
The minimap2 technical note hosted at arXiv has also been updated to reflect
|
||||
recent changes.
|
||||
|
||||
(2.4: 6 November 2017, r555)
|
||||
|
||||
|
||||
|
||||
Release 2.3-r531 (22 October 2017)
|
||||
----------------------------------
|
||||
|
||||
This release come with many improvements and bug fixes:
|
||||
|
||||
* The **sr** preset now supports paired-end short-read alignment. Minimap2 is
|
||||
3-4 times as fast as BWA-MEM, but is slightly less accurate on simulated
|
||||
reads.
|
||||
|
||||
* Meticulous improvements to assembly-to-assembly alignment (special thanks to
|
||||
Alexey Gurevich from the QUAST team): a) apply a small penalty to matches
|
||||
between ambiguous bases; b) reduce missing alignments due to spurious
|
||||
overlaps; c) introduce the short form of the `cs` tag, an improvement to the
|
||||
SAM MD tag.
|
||||
|
||||
* Make sure gaps are always left-aligned.
|
||||
|
||||
* Recognize `U` bases from Oxford Nanopore Direct RNA-seq (#33).
|
||||
|
||||
* Fixed slightly wrong chaining score. Fixed slightly inaccurate coordinates
|
||||
for split alignment.
|
||||
|
||||
* Fixed multiple reported bugs: 1) wrong reference name for inversion
|
||||
alignment (#30); 2) redundant SQ lines when multiple query files are
|
||||
specified (#39); 3) non-functioning option `-K` (#36).
|
||||
|
||||
This release has implemented all the major features I planned five months ago,
|
||||
with the addition of spliced long-read alignment. The next couple of releases
|
||||
will focus on fine tuning of the base algorithms.
|
||||
|
||||
(2.3: 22 October 2017, r531)
|
||||
|
||||
|
||||
|
||||
Release 2.2-r409 (17 September 2017)
|
||||
------------------------------------
|
||||
|
||||
|
||||
@@ -1,61 +1,319 @@
|
||||
[](https://github.com/lh3/minimap2/releases)
|
||||
[](https://anaconda.org/bioconda/minimap2)
|
||||
[](https://github.com/lh3/minimap2/releases)
|
||||
[](https://anaconda.org/bioconda/minimap2)
|
||||
[](https://pypi.python.org/pypi/mappy)
|
||||
[](https://pypi.python.org/pypi/mappy)
|
||||
[](LICENSE.txt)
|
||||
[](https://travis-ci.org/lh3/minimap2)
|
||||
## Getting Started
|
||||
[](https://github.com/lh3/minimap2/actions)
|
||||
## <a name="started"></a>Getting Started
|
||||
```sh
|
||||
git clone https://github.com/lh3/minimap2
|
||||
cd minimap2 && make
|
||||
# long reads against a reference genome
|
||||
./minimap2 -ax map10k test/MT-human.fa test/MT-orang.fa > test.sam
|
||||
# long sequences against a reference genome
|
||||
./minimap2 -a test/MT-human.fa test/MT-orang.fa > test.sam
|
||||
# create an index first and then map
|
||||
./minimap2 -x map10k -d MT-human.mmi test/MT-human.fa
|
||||
./minimap2 -ax map10k MT-human.mmi test/MT-orang.fa > test.sam
|
||||
# long-read overlap (no test data)
|
||||
./minimap2 -x ava-pb your-reads.fa your-reads.fa > overlaps.paf
|
||||
# spliced alignment (no test data)
|
||||
./minimap2 -ax splice ref.fa rna-seq-reads.fa > spliced.sam
|
||||
# man page
|
||||
./minimap2 -x map-ont -d MT-human-ont.mmi test/MT-human.fa
|
||||
./minimap2 -a MT-human-ont.mmi test/MT-orang.fa > test.sam
|
||||
# use presets (no test data)
|
||||
./minimap2 -ax map-pb ref.fa pacbio.fq.gz > aln.sam # PacBio CLR genomic reads
|
||||
./minimap2 -ax map-ont ref.fa ont.fq.gz > aln.sam # Oxford Nanopore genomic reads
|
||||
./minimap2 -ax map-hifi ref.fa pacbio-ccs.fq.gz > aln.sam # PacBio HiFi/CCS genomic reads (v2.19+)
|
||||
./minimap2 -ax lr:hq ref.fa ont-Q20.fq.gz > aln.sam # Nanopore Q20 genomic reads (v2.27+)
|
||||
./minimap2 -ax sr ref.fa read1.fa read2.fa > aln.sam # short genomic paired-end reads
|
||||
./minimap2 -ax splice ref.fa rna-reads.fa > aln.sam # spliced long reads (strand unknown)
|
||||
./minimap2 -ax splice -uf -k14 ref.fa reads.fa > aln.sam # noisy Nanopore direct RNA-seq
|
||||
./minimap2 -ax splice:hq -uf ref.fa query.fa > aln.sam # PacBio Kinnex/Iso-seq (RNA-seq)
|
||||
./minimap2 -ax splice --junc-bed=anno.bed12 ref.fa query.fa > aln.sam # use annotated junctions
|
||||
./minimap2 -ax splice:sr ref.fa r1.fq r2.fq > aln.sam # short-read RNA-seq (v2.29+)
|
||||
./minimap2 -ax splice:sr -j anno.bed12 ref.fa r1.fq r2.fq > aln.sam
|
||||
./minimap2 -cx asm5 asm1.fa asm2.fa > aln.paf # intra-species asm-to-asm alignment
|
||||
./minimap2 -x ava-pb reads.fa reads.fa > overlaps.paf # PacBio read overlap
|
||||
./minimap2 -x ava-ont reads.fa reads.fa > overlaps.paf # Nanopore read overlap
|
||||
# man page for detailed command line options
|
||||
man ./minimap2.1
|
||||
```
|
||||
|
||||
## Introduction
|
||||
## Table of Contents
|
||||
|
||||
Minimap2 is a fast sequence mapping and alignment program that can find
|
||||
overlaps between long noisy reads, or map long reads or their assemblies to a
|
||||
reference genome optionally with detailed alignment (i.e. CIGAR). At present,
|
||||
it works efficiently with query sequences from a few kilobases to ~100
|
||||
megabases in length at an error rate ~15%. Minimap2 outputs in the [PAF][paf] or
|
||||
the [SAM format][sam]. On limited test data sets, minimap2 is over 20 times
|
||||
faster than most other long-read aligners. It will replace BWA-MEM for long
|
||||
reads and contig alignment.
|
||||
- [Getting Started](#started)
|
||||
- [Users' Guide](#uguide)
|
||||
- [Installation](#install)
|
||||
- [General usage](#general)
|
||||
- [Use cases](#cases)
|
||||
- [Map long noisy genomic reads](#map-long-genomic)
|
||||
- [Map long mRNA/cDNA reads](#map-long-splice)
|
||||
- [Find overlaps between long reads](#long-overlap)
|
||||
- [Map short genomic reads](#short-genomic)
|
||||
- [Map short RNA-seq reads](#short-rna-seq)
|
||||
- [Full genome/assembly alignment](#full-genome)
|
||||
- [Advanced features](#advanced)
|
||||
- [Working with >65535 CIGAR operations](#long-cigar)
|
||||
- [The cs optional tag](#cs)
|
||||
- [Working with the PAF format](#paftools)
|
||||
- [Algorithm overview](#algo)
|
||||
- [Getting help](#help)
|
||||
- [Citing minimap2](#cite)
|
||||
- [Developers' Guide](#dguide)
|
||||
- [Limitations](#limit)
|
||||
|
||||
Minimap2 is the successor of [minimap][minimap]. It uses a similar
|
||||
minimizer-based indexing and seeding algorithm, and improves the original
|
||||
minimap with homopolyer-compressed k-mers (see also [SMARTdenovo][smartdenovo]
|
||||
and [longISLND][longislnd]), better chaining and the ability to produce CIGAR
|
||||
with fast extension alignment (see also [libgaba][gaba] and [ksw2][ksw2]) and
|
||||
piece-wise affine gap cost.
|
||||
## <a name="uguide"></a>Users' Guide
|
||||
|
||||
If you use minimap2 in your work, please consider to cite:
|
||||
Minimap2 is a versatile sequence alignment program that aligns DNA or mRNA
|
||||
sequences against a large reference database. Typical use cases include: (1)
|
||||
mapping PacBio or Oxford Nanopore genomic reads to the human genome; (2)
|
||||
finding overlaps between long reads with error rate up to ~15%; (3)
|
||||
splice-aware alignment of PacBio Iso-Seq or Nanopore cDNA or Direct RNA reads
|
||||
against a reference genome; (4) aligning Illumina single- or paired-end reads;
|
||||
(5) assembly-to-assembly alignment; (6) full-genome alignment between two
|
||||
closely related species with divergence below ~15%.
|
||||
|
||||
> Li, H. (2017). Minimap2: fast pairwise alignment for long DNA sequences. [arXiv:1708.01492](https://arxiv.org/abs/1708.01492).
|
||||
For ~10kb noisy reads sequences, minimap2 is tens of times faster than
|
||||
mainstream long-read mappers such as BLASR, BWA-MEM, NGMLR and GMAP. It is more
|
||||
accurate on simulated long reads and produces biologically meaningful alignment
|
||||
ready for downstream analyses. For >100bp Illumina short reads, minimap2 is
|
||||
three times as fast as BWA-MEM and Bowtie2, and as accurate on simulated data.
|
||||
Detailed evaluations are available from the [minimap2 paper][doi] or the
|
||||
[preprint][preprint].
|
||||
|
||||
## Installation
|
||||
### <a name="install"></a>Installation
|
||||
|
||||
For modern x86-64 CPUs, just type `make` in the source code directory. This
|
||||
will compile a binary `minimap2` which you can copy to your desired location.
|
||||
If you see compilation errors, try `make sse2only=1` to disable SSE4. Minimap2
|
||||
will run a little slower. At present, minimap2 does not work with non-x86 CPUs
|
||||
or ancient CPUs that do not support SSE2. SSE2 is critical to the performance
|
||||
of minimap2.
|
||||
Minimap2 is optimized for x86-64 CPUs. You can acquire precompiled binaries from
|
||||
the [release page][release] with:
|
||||
```sh
|
||||
curl -L https://github.com/lh3/minimap2/releases/download/v2.29/minimap2-2.29_x64-linux.tar.bz2 | tar -jxvf -
|
||||
./minimap2-2.29_x64-linux/minimap2
|
||||
```
|
||||
If you want to compile from the source, you need to have a C compiler, GNU make
|
||||
and zlib development files installed. Then type `make` in the source code
|
||||
directory to compile. If you see compilation errors, try `make sse2only=1`
|
||||
to disable SSE4 code, which will make minimap2 slightly slower.
|
||||
|
||||
## Algorithm Overview
|
||||
Minimap2 also works with ARM CPUs supporting the NEON instruction sets. To
|
||||
compile for 32 bit ARM architectures (such as ARMv7), use `make arm_neon=1`. To
|
||||
compile for for 64 bit ARM architectures (such as ARMv8), use `make arm_neon=1
|
||||
aarch64=1`.
|
||||
|
||||
Minimap2 can use [SIMD Everywhere (SIMDe)][simde] library for porting
|
||||
implementation to the different SIMD instruction sets. To compile using SIMDe,
|
||||
use `make -f Makefile.simde`. To compile for ARM CPUs, use `Makefile.simde`
|
||||
with the ARM related command lines given above.
|
||||
|
||||
### <a name="general"></a>General usage
|
||||
|
||||
Without any options, minimap2 takes a reference database and a query sequence
|
||||
file as input and produce approximate mapping, without base-level alignment
|
||||
(i.e. coordinates are only approximate and no CIGAR in output), in the [PAF format][paf]:
|
||||
```sh
|
||||
minimap2 ref.fa query.fq > approx-mapping.paf
|
||||
```
|
||||
You can ask minimap2 to generate CIGAR at the `cg` tag of PAF with:
|
||||
```sh
|
||||
minimap2 -c ref.fa query.fq > alignment.paf
|
||||
```
|
||||
or to output alignments in the [SAM format][sam]:
|
||||
```sh
|
||||
minimap2 -a ref.fa query.fq > alignment.sam
|
||||
```
|
||||
Minimap2 seamlessly works with gzip'd FASTA and FASTQ formats as input. You
|
||||
don't need to convert between FASTA and FASTQ or decompress gzip'd files first.
|
||||
|
||||
For the human reference genome, minimap2 takes a few minutes to generate a
|
||||
minimizer index for the reference before mapping. To reduce indexing time, you
|
||||
can optionally save the index with option **-d** and replace the reference
|
||||
sequence file with the index file on the minimap2 command line:
|
||||
```sh
|
||||
minimap2 -d ref.mmi ref.fa # indexing
|
||||
minimap2 -a ref.mmi reads.fq > alignment.sam # alignment
|
||||
```
|
||||
***Importantly***, it should be noted that once you build the index, indexing
|
||||
parameters such as **-k**, **-w**, **-H** and **-I** can't be changed during
|
||||
mapping. If you are running minimap2 for different data types, you will
|
||||
probably need to keep multiple indexes generated with different parameters.
|
||||
This makes minimap2 different from BWA which always uses the same index
|
||||
regardless of query data types.
|
||||
|
||||
### <a name="cases"></a>Use cases
|
||||
|
||||
Minimap2 uses the same base algorithm for all applications. However, due to the
|
||||
different data types it supports (e.g. short vs long reads; DNA vs mRNA reads),
|
||||
minimap2 needs to be tuned for optimal performance and accuracy. It is usually
|
||||
recommended to choose a preset with option **-x**, which sets multiple
|
||||
parameters at the same time. The default setting is the same as `map-ont`.
|
||||
|
||||
#### <a name="map-long-genomic"></a>Map long noisy genomic reads
|
||||
|
||||
```sh
|
||||
minimap2 -ax map-pb ref.fa pacbio-reads.fq > aln.sam # for PacBio CLR reads
|
||||
minimap2 -ax map-ont ref.fa ont-reads.fq > aln.sam # for Oxford Nanopore reads
|
||||
minimap2 -ax map-iclr ref.fa iclr-reads.fq > aln.sam # for Illumina Complete Long Reads
|
||||
```
|
||||
The difference between `map-pb` and `map-ont` is that `map-pb` uses
|
||||
homopolymer-compressed (HPC) minimizers as seeds, while `map-ont` uses ordinary
|
||||
minimizers as seeds. Empirical evaluation suggests HPC minimizers improve
|
||||
performance and sensitivity when aligning PacBio CLR reads, but hurt when aligning
|
||||
Nanopore reads. `map-iclr` uses an adjusted alignment scoring matrix that
|
||||
accounts for the low overall error rate in the reads, with transversion errors
|
||||
being less frequent than transitions.
|
||||
|
||||
#### <a name="map-long-splice"></a>Map long mRNA/cDNA reads
|
||||
|
||||
```sh
|
||||
minimap2 -ax splice:hq -uf ref.fa iso-seq.fq > aln.sam # PacBio Iso-seq/traditional cDNA
|
||||
minimap2 -ax splice ref.fa nanopore-cdna.fa > aln.sam # Nanopore 2D cDNA-seq
|
||||
minimap2 -ax splice -uf -k14 ref.fa direct-rna.fq > aln.sam # Nanopore Direct RNA-seq
|
||||
minimap2 -ax splice --splice-flank=no SIRV.fa SIRV-seq.fa # mapping against SIRV control
|
||||
```
|
||||
There are different long-read RNA-seq technologies, including tranditional
|
||||
full-length cDNA, EST, PacBio Iso-seq, Nanopore 2D cDNA-seq and Direct RNA-seq.
|
||||
They produce data of varying quality and properties. By default, `-x splice`
|
||||
assumes the read orientation relative to the transcript strand is unknown. It
|
||||
tries two rounds of alignment to infer the orientation and write the strand to
|
||||
the `ts` SAM/PAF tag if possible. For Iso-seq, Direct RNA-seq and tranditional
|
||||
full-length cDNAs, it would be desired to apply `-u f` to force minimap2 to
|
||||
consider the forward transcript strand only. This speeds up alignment with
|
||||
slight improvement to accuracy. For noisy Nanopore Direct RNA-seq reads, it is
|
||||
recommended to use a smaller k-mer size for increased sensitivity to the first
|
||||
or the last exons.
|
||||
|
||||
Minimap2 rates an alignment by the score of the max-scoring sub-segment,
|
||||
*excluding* introns, and marks the best alignment as primary in SAM. When a
|
||||
spliced gene also has unspliced pseudogenes, minimap2 slightly prefers
|
||||
the spliced alignment. By default, minimap2 outputs up to five secondary
|
||||
alignments (i.e. likely pseudogenes in the context of RNA-seq mapping). This
|
||||
can be tuned with option **-N**.
|
||||
|
||||
For long RNA-seq reads, minimap2 may produce chimeric alignments potentially
|
||||
caused by gene fusions/structural variations or by an intron longer than the
|
||||
max intron length **-G** (200k by default). For now, it is not recommended to
|
||||
apply an excessively large **-G** as this slows down minimap2 and sometimes
|
||||
leads to false alignments.
|
||||
|
||||
It is worth noting that by default `-x splice` prefers GT[A/G]..[C/T]AG
|
||||
over GT[C/T]..[A/G]AG, and then over other splicing signals. Considering
|
||||
one additional base improves the junction accuracy for noisy reads, but
|
||||
reduces the accuracy when aligning against the widely used SIRV control data.
|
||||
This is because SIRV does not honor the evolutionarily conservative splicing
|
||||
signal. If you are studying SIRV, you may apply `--splice-flank=no` to let
|
||||
minimap2 only model GT..AG, ignoring the additional base.
|
||||
|
||||
Since v2.17, minimap2 can optionally take annotated genes as input and
|
||||
prioritize on annotated splice junctions. To use this feature, you can
|
||||
```sh
|
||||
paftools.js gff2bed anno.gff > anno.bed
|
||||
minimap2 -ax splice --junc-bed anno.bed ref.fa query.fa > aln.sam
|
||||
```
|
||||
Here, `anno.gff` is the gene annotation in the GTF or GFF3 format (`gff2bed`
|
||||
automatically tests the format). The output of `gff2bed` is in the 12-column
|
||||
BED format, or the BED12 format. With the `--junc-bed` option, minimap2 adds a
|
||||
bonus score (tuned by `--junc-bonus`) if an aligned junction matches a junction
|
||||
in the annotation. Option `--junc-bed` also takes 5-column BED, including the
|
||||
strand field. In this case, each line indicates an oriented junction.
|
||||
|
||||
**Note:** `--junc-bed` is intended for long noisy RNA-seq reads only.
|
||||
Applying the option to short RNA-seq reads would increase run time with little
|
||||
improvement to junction accuracy.
|
||||
|
||||
#### <a name="long-overlap"></a>Find overlaps between long reads
|
||||
|
||||
```sh
|
||||
minimap2 -x ava-pb reads.fq reads.fq > ovlp.paf # PacBio CLR read overlap
|
||||
minimap2 -x ava-ont reads.fq reads.fq > ovlp.paf # Oxford Nanopore read overlap
|
||||
```
|
||||
Similarly, `ava-pb` uses HPC minimizers while `ava-ont` uses ordinary
|
||||
minimizers. It is usually not recommended to perform base-level alignment in
|
||||
the overlapping mode because it is slow and may produce false positive
|
||||
overlaps. However, if performance is not a concern, you may try to add `-a` or
|
||||
`-c` anyway.
|
||||
|
||||
#### <a name="short-genomic"></a>Map short genomic reads
|
||||
|
||||
```sh
|
||||
minimap2 -ax sr ref.fa reads-se.fq > aln.sam # single-end alignment
|
||||
minimap2 -ax sr ref.fa read1.fq read2.fq > aln.sam # paired-end alignment
|
||||
minimap2 -ax sr ref.fa reads-interleaved.fq > aln.sam # paired-end alignment
|
||||
```
|
||||
When two read files are specified, minimap2 reads from each file in turn and
|
||||
merge them into an interleaved stream internally. Two reads are considered to
|
||||
be paired if they are adjacent in the input stream and have the same name (with
|
||||
the `/[0-9]` suffix trimmed if present). Single- and paired-end reads can be
|
||||
mixed.
|
||||
|
||||
#### <a name="short-rna-seq"></a>Map short RNA-seq reads
|
||||
|
||||
```sh
|
||||
minimap2 -ax splice:sr ref.fa reads-se.fq.gz > aln.sam # single-end
|
||||
minimap2 -ax splice:sr ref.fa r1.fq.gz r2.fq.gz > aln.sam # paired-end
|
||||
minimap2 -ax splice:sr -j anno.bed ref.fa r1.fq r2.fq > aln.sam # use annotation
|
||||
# 2-pass alignment
|
||||
minimap2 -x splice:sr -j anno.bed --write-junc ref.fa r1.fq r2.fq > junc.bed
|
||||
minimap2 -ax splice:sr -j anno.bed --pass1=junc.bed ref.fa r1.fq r2.fq > aln.sam
|
||||
```
|
||||
The new preset `splice:sr` was added in v2.29. It functions similarly to `sr`
|
||||
except that it performs spliced alignment.
|
||||
|
||||
#### <a name="full-genome"></a>Full genome/assembly alignment
|
||||
|
||||
```sh
|
||||
minimap2 -ax asm5 ref.fa asm.fa > aln.sam # assembly to assembly/ref alignment
|
||||
```
|
||||
For cross-species full-genome alignment, the scoring system needs to be tuned
|
||||
according to the sequence divergence.
|
||||
|
||||
### <a name="advanced"></a>Advanced features
|
||||
|
||||
#### <a name="long-cigar"></a>Working with >65535 CIGAR operations
|
||||
|
||||
Due to a design flaw, BAM does not work with CIGAR strings with >65535
|
||||
operations (SAM and CRAM work). However, for ultra-long nanopore reads minimap2
|
||||
may align ~1% of read bases with long CIGARs beyond the capability of BAM. If
|
||||
you convert such SAM/CRAM to BAM, Picard and recent samtools will throw an
|
||||
error and abort. Older samtools and other tools may create corrupted BAM.
|
||||
|
||||
To avoid this issue, you can add option `-L` at the minimap2 command line.
|
||||
This option moves a long CIGAR to the `CG` tag and leaves a fully clipped CIGAR
|
||||
at the SAM CIGAR column. Current tools that don't read CIGAR (e.g. merging and
|
||||
sorting) still work with such BAM records; tools that read CIGAR will
|
||||
effectively ignore these records. It has been decided that future tools
|
||||
will seamlessly recognize long-cigar records generated by option `-L`.
|
||||
|
||||
**TL;DR**: if you work with ultra-long reads and use tools that only process
|
||||
BAM files, please add option `-L`.
|
||||
|
||||
#### <a name="cs"></a>The cs optional tag
|
||||
|
||||
The `cs` SAM/PAF tag encodes bases at mismatches and INDELs. It matches regular
|
||||
expression `/(:[0-9]+|\*[a-z][a-z]|[=\+\-][A-Za-z]+)+/`. Like CIGAR, `cs`
|
||||
consists of series of operations. Each leading character specifies the
|
||||
operation; the following sequence is the one involved in the operation.
|
||||
|
||||
The `cs` tag is enabled by command line option `--cs`. The following alignment,
|
||||
for example:
|
||||
```txt
|
||||
CGATCGATAAATAGAGTAG---GAATAGCA
|
||||
|||||| |||||||||| |||| |||
|
||||
CGATCG---AATAGAGTAGGTCGAATtGCA
|
||||
```
|
||||
is represented as `:6-ata:10+gtc:4*at:3`, where `:[0-9]+` represents an
|
||||
identical block, `-ata` represents a deletion, `+gtc` an insertion and `*at`
|
||||
indicates reference base `a` is substituted with a query base `t`. It is
|
||||
similar to the `MD` SAM tag but is standalone and easier to parse.
|
||||
|
||||
If `--cs=long` is used, the `cs` string also contains identical sequences in
|
||||
the alignment. The above example will become
|
||||
`=CGATCG-ata=AATAGAGTAG+gtc=GAAT*at=GCA`. The long form of `cs` encodes both
|
||||
reference and query sequences in one string. The `cs` tag also encodes intron
|
||||
positions and splicing signals (see the [minimap2 manpage][manpage-cs] for
|
||||
details).
|
||||
|
||||
#### <a name="paftools"></a>Working with the PAF format
|
||||
|
||||
Minimap2 also comes with a (java)script [paftools.js](misc/paftools.js) that
|
||||
processes alignments in the PAF format. It calls variants from
|
||||
assembly-to-reference alignment, lifts over BED files based on alignment,
|
||||
converts between formats and provides utilities for various evaluations. For
|
||||
details, please see [misc/README.md](misc/README.md).
|
||||
|
||||
### <a name="algo"></a>Algorithm overview
|
||||
|
||||
In the following, minimap2 command line options have a dash ahead and are
|
||||
highlighted in bold.
|
||||
highlighted in bold. The description may help to tune minimap2 parameters.
|
||||
|
||||
1. Read **-I** [=*4G*] reference bases, extract (**-k**,**-w**)-minimizers and
|
||||
index them in a hash table.
|
||||
@@ -96,20 +354,56 @@ highlighted in bold.
|
||||
9. If there are more reference sequences, reopen the query file from the start
|
||||
and go to step 1; otherwise stop.
|
||||
|
||||
## Limitations
|
||||
### <a name="help"></a>Getting help
|
||||
|
||||
Manpage [minimap2.1][manpage] provides detailed description of minimap2
|
||||
command line options and optional tags. The [FAQ](FAQ.md) page answers several
|
||||
frequently asked questions. If you encounter bugs or have further questions or
|
||||
requests, you can raise an issue at the [issue page][issue]. There is not a
|
||||
specific mailing list for the time being.
|
||||
|
||||
### <a name="cite"></a>Citing minimap2
|
||||
|
||||
If you use minimap2 in your work, please cite:
|
||||
|
||||
> Li, H. (2018). Minimap2: pairwise alignment for nucleotide sequences.
|
||||
> *Bioinformatics*, **34**:3094-3100. [doi:10.1093/bioinformatics/bty191][doi]
|
||||
|
||||
and/or:
|
||||
|
||||
> Li, H. (2021). New strategies to improve minimap2 alignment accuracy.
|
||||
> *Bioinformatics*, **37**:4572-4574. [doi:10.1093/bioinformatics/btab705][doi2]
|
||||
|
||||
## <a name="dguide"></a>Developers' Guide
|
||||
|
||||
Minimap2 is not only a command line tool, but also a programming library.
|
||||
It provides C APIs to build/load index and to align sequences against the
|
||||
index. File [example.c](example.c) demonstrates typical uses of C APIs. Header
|
||||
file [minimap.h](minimap.h) gives more detailed API documentation. Minimap2
|
||||
aims to keep APIs in this header stable. File [mmpriv.h](mmpriv.h) contains
|
||||
additional private APIs which may be subjected to changes frequently.
|
||||
|
||||
This repository also provides Python bindings to a subset of C APIs. File
|
||||
[python/README.rst](python/README.rst) gives the full documentation;
|
||||
[python/minimap2.py](python/minimap2.py) shows an example. This Python
|
||||
extension, mappy, is also [available from PyPI][mappypypi] via `pip install
|
||||
mappy` or [from BioConda][mappyconda] via `conda install -c bioconda mappy`.
|
||||
|
||||
## <a name="limit"></a>Limitations
|
||||
|
||||
* Minimap2 may produce suboptimal alignments through long low-complexity
|
||||
regions where seed positions may be suboptimal. This should not be a big
|
||||
concern because even the optimal alignment may be wrong in such regions.
|
||||
|
||||
* Minimap2 does not work well with Illumina short reads as of now.
|
||||
* Minimap2 requires SSE2 instructions on x86 CPUs or NEON on ARM CPUs. It is
|
||||
possible to add non-SIMD support, but it would make minimap2 slower by
|
||||
several times.
|
||||
|
||||
* Minimap2 requires SSE2 instructions to compile. It is possible to add
|
||||
non-SSE2 support, but it would make minimap2 slower by several times.
|
||||
* Minimap2 does not work with a single query or database sequence ~2
|
||||
billion bases or longer (2,147,483,647 to be exact). The total length of all
|
||||
sequences can well exceed this threshold.
|
||||
|
||||
In general, minimap2 is a young project with most code written since June, 2017.
|
||||
It may have bugs and room for improvements. Bug reports and suggestions are
|
||||
warmly welcomed.
|
||||
* Minimap2 often misses small exons.
|
||||
|
||||
|
||||
|
||||
@@ -120,3 +414,15 @@ warmly welcomed.
|
||||
[longislnd]: https://www.ncbi.nlm.nih.gov/pubmed/27667791
|
||||
[gaba]: https://github.com/ocxtal/libgaba
|
||||
[ksw2]: https://github.com/lh3/ksw2
|
||||
[preprint]: https://arxiv.org/abs/1708.01492
|
||||
[release]: https://github.com/lh3/minimap2/releases
|
||||
[mappypypi]: https://pypi.python.org/pypi/mappy
|
||||
[mappyconda]: https://anaconda.org/bioconda/mappy
|
||||
[issue]: https://github.com/lh3/minimap2/issues
|
||||
[k8]: https://github.com/attractivechaos/k8
|
||||
[manpage]: https://lh3.github.io/minimap2/minimap2.html
|
||||
[manpage-cs]: https://lh3.github.io/minimap2/minimap2.html#10
|
||||
[doi]: https://doi.org/10.1093/bioinformatics/bty191
|
||||
[doi2]: https://doi.org/10.1093/bioinformatics/btab705
|
||||
[simde]: https://github.com/nemequ/simde
|
||||
[unimap]: https://github.com/lh3/unimap
|
||||
|
||||
@@ -1,22 +1,45 @@
|
||||
#include <zlib.h>
|
||||
#include <stdio.h>
|
||||
#include <stdlib.h>
|
||||
#include <string.h>
|
||||
#include <assert.h>
|
||||
#define __STDC_LIMIT_MACROS
|
||||
#include "bseq.h"
|
||||
#include "kvec.h"
|
||||
#include "kseq.h"
|
||||
KSEQ_INIT2(, gzFile, gzread)
|
||||
|
||||
unsigned char seq_comp_table[256] = {
|
||||
0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
|
||||
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,
|
||||
32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47,
|
||||
48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63,
|
||||
64, 'T', 'V', 'G', 'H', 'E', 'F', 'C', 'D', 'I', 'J', 'M', 'L', 'K', 'N', 'O',
|
||||
'P', 'Q', 'Y', 'S', 'A', 'A', 'B', 'W', 'X', 'R', 'Z', 91, 92, 93, 94, 95,
|
||||
96, 't', 'v', 'g', 'h', 'e', 'f', 'c', 'd', 'i', 'j', 'm', 'l', 'k', 'n', 'o',
|
||||
'p', 'q', 'y', 's', 'a', 'a', 'b', 'w', 'x', 'r', 'z', 123, 124, 125, 126, 127,
|
||||
128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143,
|
||||
144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159,
|
||||
160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175,
|
||||
176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191,
|
||||
192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207,
|
||||
208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223,
|
||||
224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239,
|
||||
240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255
|
||||
};
|
||||
|
||||
#define CHECK_PAIR_THRES 1000000
|
||||
|
||||
struct mm_bseq_file_s {
|
||||
gzFile fp;
|
||||
kseq_t *ks;
|
||||
mm_bseq1_t s;
|
||||
};
|
||||
|
||||
mm_bseq_file_t *mm_bseq_open(const char *fn)
|
||||
{
|
||||
mm_bseq_file_t *fp;
|
||||
gzFile f;
|
||||
f = fn && strcmp(fn, "-")? gzopen(fn, "r") : gzdopen(fileno(stdin), "r");
|
||||
f = fn && strcmp(fn, "-")? gzopen(fn, "r") : gzdopen(0, "r");
|
||||
if (f == 0) return 0;
|
||||
fp = (mm_bseq_file_t*)calloc(1, sizeof(mm_bseq_file_t));
|
||||
fp->fp = f;
|
||||
@@ -31,32 +54,116 @@ void mm_bseq_close(mm_bseq_file_t *fp)
|
||||
free(fp);
|
||||
}
|
||||
|
||||
mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int chunk_size, int with_qual, int *n_)
|
||||
static inline char *kstrdup(const kstring_t *s)
|
||||
{
|
||||
int size = 0, m, n;
|
||||
mm_bseq1_t *seqs;
|
||||
char *t;
|
||||
t = (char*)malloc(s->l + 1);
|
||||
memcpy(t, s->s, s->l + 1);
|
||||
return t;
|
||||
}
|
||||
|
||||
static inline void kseq2bseq(kseq_t *ks, mm_bseq1_t *s, int with_qual, int with_comment)
|
||||
{
|
||||
int i;
|
||||
if (ks->name.l == 0)
|
||||
fprintf(stderr, "[WARNING]\033[1;31m empty sequence name in the input.\033[0m\n");
|
||||
s->name = kstrdup(&ks->name);
|
||||
s->seq = kstrdup(&ks->seq);
|
||||
for (i = 0; i < (int)ks->seq.l; ++i) // convert U to T
|
||||
if (s->seq[i] == 'u' || s->seq[i] == 'U')
|
||||
--s->seq[i];
|
||||
s->qual = with_qual && ks->qual.l? kstrdup(&ks->qual) : 0;
|
||||
s->comment = with_comment && ks->comment.l? kstrdup(&ks->comment) : 0;
|
||||
s->l_seq = ks->seq.l;
|
||||
}
|
||||
|
||||
mm_bseq1_t *mm_bseq_read3(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int with_comment, int frag_mode, int *n_)
|
||||
{
|
||||
int64_t size = 0;
|
||||
int ret;
|
||||
kvec_t(mm_bseq1_t) a = {0,0,0};
|
||||
kseq_t *ks = fp->ks;
|
||||
m = n = 0; seqs = 0;
|
||||
while (kseq_read(ks) >= 0) {
|
||||
*n_ = 0;
|
||||
if (fp->s.seq) {
|
||||
kv_resize(mm_bseq1_t, 0, a, 256);
|
||||
kv_push(mm_bseq1_t, 0, a, fp->s);
|
||||
size = fp->s.l_seq;
|
||||
memset(&fp->s, 0, sizeof(mm_bseq1_t));
|
||||
}
|
||||
while ((ret = kseq_read(ks)) >= 0) {
|
||||
mm_bseq1_t *s;
|
||||
assert(ks->seq.l <= INT32_MAX);
|
||||
if (n >= m) {
|
||||
m = m? m<<1 : 256;
|
||||
seqs = (mm_bseq1_t*)realloc(seqs, m * sizeof(mm_bseq1_t));
|
||||
if (a.m == 0) kv_resize(mm_bseq1_t, 0, a, 256);
|
||||
kv_pushp(mm_bseq1_t, 0, a, &s);
|
||||
kseq2bseq(ks, s, with_qual, with_comment);
|
||||
size += s->l_seq;
|
||||
if (size >= chunk_size) {
|
||||
if (frag_mode && a.a[a.n-1].l_seq < CHECK_PAIR_THRES) {
|
||||
while ((ret = kseq_read(ks)) >= 0) {
|
||||
kseq2bseq(ks, &fp->s, with_qual, with_comment);
|
||||
if (mm_qname_same(fp->s.name, a.a[a.n-1].name)) {
|
||||
kv_push(mm_bseq1_t, 0, a, fp->s);
|
||||
memset(&fp->s, 0, sizeof(mm_bseq1_t));
|
||||
} else break;
|
||||
}
|
||||
}
|
||||
break;
|
||||
}
|
||||
}
|
||||
if (ret < -1) {
|
||||
if (a.n) fprintf(stderr, "[WARNING]\033[1;31m failed to parse the FASTA/FASTQ record next to '%s'. Continue anyway.\033[0m\n", a.a[a.n-1].name);
|
||||
else fprintf(stderr, "[WARNING]\033[1;31m failed to parse the first FASTA/FASTQ record. Continue anyway.\033[0m\n");
|
||||
}
|
||||
*n_ = a.n;
|
||||
return a.a;
|
||||
}
|
||||
|
||||
mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int frag_mode, int *n_)
|
||||
{
|
||||
return mm_bseq_read3(fp, chunk_size, with_qual, 0, frag_mode, n_);
|
||||
}
|
||||
|
||||
mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int *n_)
|
||||
{
|
||||
return mm_bseq_read2(fp, chunk_size, with_qual, 0, n_);
|
||||
}
|
||||
|
||||
mm_bseq1_t *mm_bseq_read_frag2(int n_fp, mm_bseq_file_t **fp, int64_t chunk_size, int with_qual, int with_comment, int *n_)
|
||||
{
|
||||
int i;
|
||||
int64_t size = 0;
|
||||
kvec_t(mm_bseq1_t) a = {0,0,0};
|
||||
*n_ = 0;
|
||||
if (n_fp < 1) return 0;
|
||||
while (1) {
|
||||
int n_read = 0;
|
||||
for (i = 0; i < n_fp; ++i)
|
||||
if (kseq_read(fp[i]->ks) >= 0)
|
||||
++n_read;
|
||||
if (n_read < n_fp) {
|
||||
if (n_read > 0)
|
||||
fprintf(stderr, "[W::%s]\033[1;31m query files have different number of records; extra records skipped.\033[0m\n", __func__);
|
||||
break; // some file reaches the end
|
||||
}
|
||||
if (a.m == 0) kv_resize(mm_bseq1_t, 0, a, 256);
|
||||
for (i = 0; i < n_fp; ++i) {
|
||||
mm_bseq1_t *s;
|
||||
kv_pushp(mm_bseq1_t, 0, a, &s);
|
||||
kseq2bseq(fp[i]->ks, s, with_qual, with_comment);
|
||||
size += s->l_seq;
|
||||
}
|
||||
s = &seqs[n];
|
||||
s->name = strdup(ks->name.s);
|
||||
s->seq = strdup(ks->seq.s);
|
||||
s->qual = with_qual && ks->qual.l? strdup(ks->qual.s) : 0;
|
||||
s->l_seq = ks->seq.l;
|
||||
size += seqs[n++].l_seq;
|
||||
if (size >= chunk_size) break;
|
||||
}
|
||||
*n_ = n;
|
||||
return seqs;
|
||||
*n_ = a.n;
|
||||
return a.a;
|
||||
}
|
||||
|
||||
mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int64_t chunk_size, int with_qual, int *n_)
|
||||
{
|
||||
return mm_bseq_read_frag2(n_fp, fp, chunk_size, with_qual, 0, n_);
|
||||
}
|
||||
|
||||
int mm_bseq_eof(mm_bseq_file_t *fp)
|
||||
{
|
||||
return ks_eof(fp->ks->f);
|
||||
return (ks_eof(fp->ks->f) && fp->s.seq == 0);
|
||||
}
|
||||
|
||||
@@ -2,6 +2,7 @@
|
||||
#define MM_BSEQ_H
|
||||
|
||||
#include <stdint.h>
|
||||
#include <string.h>
|
||||
|
||||
#ifdef __cplusplus
|
||||
extern "C" {
|
||||
@@ -12,15 +13,49 @@ typedef struct mm_bseq_file_s mm_bseq_file_t;
|
||||
|
||||
typedef struct {
|
||||
int l_seq, rid;
|
||||
char *name, *seq, *qual;
|
||||
char *name, *seq, *qual, *comment;
|
||||
} mm_bseq1_t;
|
||||
|
||||
mm_bseq_file_t *mm_bseq_open(const char *fn);
|
||||
void mm_bseq_close(mm_bseq_file_t *fp);
|
||||
mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int chunk_size, int with_qual, int *n_);
|
||||
mm_bseq1_t *mm_bseq_read3(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int with_comment, int frag_mode, int *n_);
|
||||
mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int frag_mode, int *n_);
|
||||
mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int *n_);
|
||||
mm_bseq1_t *mm_bseq_read_frag2(int n_fp, mm_bseq_file_t **fp, int64_t chunk_size, int with_qual, int with_comment, int *n_);
|
||||
mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int64_t chunk_size, int with_qual, int *n_);
|
||||
int mm_bseq_eof(mm_bseq_file_t *fp);
|
||||
|
||||
extern unsigned char seq_nt4_table[256];
|
||||
extern unsigned char seq_comp_table[256];
|
||||
|
||||
static inline int mm_qname_len(const char *s)
|
||||
{
|
||||
int l;
|
||||
l = strlen(s);
|
||||
return l >= 3 && s[l-1] >= '0' && s[l-1] <= '9' && s[l-2] == '/'? l - 2 : l;
|
||||
}
|
||||
|
||||
static inline int mm_qname_same(const char *s1, const char *s2)
|
||||
{
|
||||
int l1, l2;
|
||||
l1 = mm_qname_len(s1);
|
||||
l2 = mm_qname_len(s2);
|
||||
return (l1 == l2 && strncmp(s1, s2, l1) == 0);
|
||||
}
|
||||
|
||||
static inline void mm_revcomp_bseq(mm_bseq1_t *s)
|
||||
{
|
||||
int i, t, l = s->l_seq;
|
||||
for (i = 0; i < l>>1; ++i) {
|
||||
t = s->seq[l - i - 1];
|
||||
s->seq[l - i - 1] = seq_comp_table[(uint8_t)s->seq[i]];
|
||||
s->seq[i] = seq_comp_table[t];
|
||||
}
|
||||
if (l&1) s->seq[l>>1] = seq_comp_table[(uint8_t)s->seq[l>>1]];
|
||||
if (s->qual)
|
||||
for (i = 0; i < l>>1; ++i)
|
||||
t = s->qual[l - i - 1], s->qual[l - i - 1] = s->qual[i], s->qual[i] = t;
|
||||
}
|
||||
|
||||
#ifdef __cplusplus
|
||||
}
|
||||
|
||||
@@ -1,150 +0,0 @@
|
||||
#include <stdint.h>
|
||||
#include <string.h>
|
||||
#include <stdio.h>
|
||||
#include "minimap.h"
|
||||
#include "mmpriv.h"
|
||||
#include "kalloc.h"
|
||||
|
||||
static const char LogTable256[256] = {
|
||||
#define LT(n) n, n, n, n, n, n, n, n, n, n, n, n, n, n, n, n
|
||||
-1, 0, 1, 1, 2, 2, 2, 2, 3, 3, 3, 3, 3, 3, 3, 3,
|
||||
LT(4), LT(5), LT(5), LT(6), LT(6), LT(6), LT(6),
|
||||
LT(7), LT(7), LT(7), LT(7), LT(7), LT(7), LT(7), LT(7)
|
||||
};
|
||||
|
||||
static inline int ilog2_32(uint32_t v)
|
||||
{
|
||||
register uint32_t t, tt;
|
||||
if ((tt = v>>16)) return (t = tt>>8) ? 24 + LogTable256[t] : 16 + LogTable256[tt];
|
||||
return (t = v>>8) ? 8 + LogTable256[t] : LogTable256[v];
|
||||
}
|
||||
|
||||
int mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int min_cnt, int min_sc, int is_cdna, int64_t n, mm128_t *a, uint64_t **_u, void *km)
|
||||
{ // TODO: make sure this works when n has more than 32 bits
|
||||
int32_t st = 0, k, *f, *p, *t, *v, n_u, n_v;
|
||||
int64_t i, j;
|
||||
uint64_t *u, *u2, sum_qspan = 0;
|
||||
float avg_qspan;
|
||||
mm128_t *b, *w;
|
||||
|
||||
if (_u) *_u = 0;
|
||||
f = (int32_t*)kmalloc(km, n * 4);
|
||||
p = (int32_t*)kmalloc(km, n * 4);
|
||||
t = (int32_t*)kmalloc(km, n * 4);
|
||||
v = (int32_t*)kmalloc(km, n * 4);
|
||||
memset(t, 0, n * 4);
|
||||
|
||||
for (i = 0; i < n; ++i) sum_qspan += a[i].y>>32&0xff;
|
||||
avg_qspan = (float)sum_qspan / n;
|
||||
|
||||
// fill the score and backtrack arrays
|
||||
for (i = 0; i < n; ++i) {
|
||||
uint64_t ri = a[i].x;
|
||||
int32_t qi = (int32_t)a[i].y, q_span = a[i].y>>32&0xff; // NB: only 8 bits of span is used!!!
|
||||
int32_t max_f = q_span, max_j = -1, n_skip = 0, min_d, max_f_past = -INT32_MAX;
|
||||
while (st < i && ri - a[st].x > max_dist_x) ++st;
|
||||
for (j = i - 1; j >= st; --j) {
|
||||
int64_t dr = ri - a[j].x;
|
||||
int32_t dq = qi - (int32_t)a[j].y, dd, sc, log_dd;
|
||||
if (dr == 0 || dq <= 0 || dq > max_dist_y) continue;
|
||||
dd = dr > dq? dr - dq : dq - dr;
|
||||
if (dd > bw) continue;
|
||||
max_f_past = max_f_past > f[j]? max_f_past : f[j];
|
||||
min_d = dq < dr? dq : dr;
|
||||
sc = min_d > q_span? q_span : dq < dr? dq : dr;
|
||||
log_dd = dd? ilog2_32(dd) : 0;
|
||||
if (is_cdna) {
|
||||
int c_log, c_lin;
|
||||
c_lin = (int)(dd * .01 * avg_qspan);
|
||||
c_log = log_dd;
|
||||
if (dr > dq) sc -= c_lin < c_log? c_lin : c_log;
|
||||
else sc -= c_lin + (c_log>>1);
|
||||
} else sc -= (int)(dd * .01 * avg_qspan) + (log_dd>>1);
|
||||
sc += f[j];
|
||||
if (sc > max_f) {
|
||||
max_f = sc, max_j = j;
|
||||
if (n_skip > 0) --n_skip;
|
||||
} else if (t[j] == i) {
|
||||
if (++n_skip > max_skip)
|
||||
break;
|
||||
}
|
||||
if (p[j] >= 0) t[p[j]] = i;
|
||||
}
|
||||
f[i] = max_f, p[i] = max_j, v[i] = max_f_past; // v[] keeps the max score in the previous chain
|
||||
}
|
||||
|
||||
// find the ending positions of chains
|
||||
memset(t, 0, n * 4);
|
||||
for (i = 0; i < n; ++i)
|
||||
if (p[i] >= 0) t[p[i]] = 1;
|
||||
for (i = n_u = 0; i < n; ++i)
|
||||
if (t[i] == 0 && v[i] >= min_sc)
|
||||
++n_u;
|
||||
if (n_u == 0) {
|
||||
kfree(km, f); kfree(km, p); kfree(km, t); kfree(km, v);
|
||||
return 0;
|
||||
}
|
||||
u = (uint64_t*)kmalloc(km, n_u * 8);
|
||||
for (i = n_u = 0; i < n; ++i) {
|
||||
if (t[i] == 0 && v[i] >= min_sc) {
|
||||
j = i;
|
||||
while (j >= 0 && f[j] < v[j]) j = p[j]; // find the point that maximizes f[]
|
||||
if (j < 0) j = i; // TODO: this should really be assert(j>=0)
|
||||
u[n_u++] = (uint64_t)f[j] << 32 | j;
|
||||
}
|
||||
}
|
||||
radix_sort_64(u, u + n_u);
|
||||
for (i = 0; i < n_u>>1; ++i) { // reverse, s.t. the highest scoring chain is the first
|
||||
uint64_t t = u[i];
|
||||
u[i] = u[n_u - i - 1], u[n_u - i - 1] = t;
|
||||
}
|
||||
|
||||
// backtrack
|
||||
memset(t, 0, n * 4);
|
||||
for (i = n_v = k = 0; i < n_u; ++i) { // starting from the highest score
|
||||
int32_t n_v0 = n_v, k0 = k;
|
||||
j = (int32_t)u[i];
|
||||
do {
|
||||
v[n_v++] = j;
|
||||
t[j] = 1;
|
||||
j = p[j];
|
||||
} while (j >= 0 && t[j] == 0);
|
||||
if (j < 0) {
|
||||
if (n_v - n_v0 >= min_cnt) u[k++] = u[i]>>32<<32 | (n_v - n_v0);
|
||||
} else if ((int32_t)(u[i]>>32) - f[j] >= min_sc) {
|
||||
if (n_v - n_v0 >= min_cnt) u[k++] = ((u[i]>>32) - f[j]) << 32 | (n_v - n_v0);
|
||||
}
|
||||
if (k0 == k) n_v = n_v0; // no new chain added, reset
|
||||
}
|
||||
n_u = k, *_u = u; // NB: note that u[] may not be sorted by score here
|
||||
|
||||
// free
|
||||
kfree(km, f); kfree(km, p); kfree(km, t);
|
||||
|
||||
// write the result to b[]
|
||||
b = (mm128_t*)kmalloc(km, n_v * sizeof(mm128_t));
|
||||
for (i = 0, k = 0; i < n_u; ++i) {
|
||||
int32_t k0 = k, ni = (int32_t)u[i];
|
||||
for (j = 0; j < ni; ++j)
|
||||
b[k] = a[v[k0 + (ni - j - 1)]], ++k;
|
||||
}
|
||||
kfree(km, v);
|
||||
|
||||
// sort u[] and a[] by a[].x, such that adjacent chains may be joined (required by mm_join_long)
|
||||
w = (mm128_t*)kmalloc(km, n_u * sizeof(mm128_t));
|
||||
for (i = k = 0; i < n_u; ++i) {
|
||||
w[i].x = b[k].x, w[i].y = (uint64_t)k<<32|i;
|
||||
k += (int32_t)u[i];
|
||||
}
|
||||
radix_sort_128x(w, w + n_u);
|
||||
u2 = (uint64_t*)kmalloc(km, n_u * 8);
|
||||
for (i = k = 0; i < n_u; ++i) {
|
||||
int32_t j = (int32_t)w[i].y, n = (int32_t)u[j];
|
||||
u2[i] = u[j];
|
||||
memcpy(&a[k], &b[w[i].y>>32], n * sizeof(mm128_t));
|
||||
k += n;
|
||||
}
|
||||
memcpy(u, u2, n_u * 8);
|
||||
kfree(km, b); kfree(km, w); kfree(km, u2);
|
||||
return n_u;
|
||||
}
|
||||
@@ -0,0 +1,30 @@
|
||||
## Contributor Code of Conduct
|
||||
|
||||
As contributors and maintainers of this project, we pledge to respect all
|
||||
people who contribute through reporting issues, posting feature requests,
|
||||
updating documentation, submitting pull requests or patches, and other
|
||||
activities.
|
||||
|
||||
We are committed to making participation in this project a harassment-free
|
||||
experience for everyone, regardless of level of experience, gender, gender
|
||||
identity and expression, sexual orientation, disability, personal appearance,
|
||||
body size, race, age, or religion.
|
||||
|
||||
Examples of unacceptable behavior by participants include the use of sexual
|
||||
language or imagery, derogatory comments or personal attacks, trolling, public
|
||||
or private harassment, insults, or other unprofessional conduct.
|
||||
|
||||
Project maintainers have the right and responsibility to remove, edit, or
|
||||
reject comments, commits, code, wiki edits, issues, and other contributions
|
||||
that are not aligned to this Code of Conduct. Project maintainers or
|
||||
contributors who do not follow the Code of Conduct may be removed from the
|
||||
project team.
|
||||
|
||||
Instances of abusive, harassing, or otherwise unacceptable behavior may be
|
||||
reported by opening an issue or contacting the maintainer via email.
|
||||
|
||||
This Code of Conduct is adapted from the [Contributor Covenant][cc], [version
|
||||
1.0.0][v1].
|
||||
|
||||
[cc]: http://contributor-covenant.org/
|
||||
[v1]: http://contributor-covenant.org/version/1/0/0/
|
||||
+243
@@ -0,0 +1,243 @@
|
||||
## Table of Contents
|
||||
|
||||
- [Introduction & Installation](#intro)
|
||||
- [Mapping Genomic Reads](#map-reads)
|
||||
* [Mapping long reads](#map-pb)
|
||||
* [Mapping Illumina paired-end reads](#map-sr)
|
||||
* [Evaluating mapping accuracy with simulated reads (for developers)](#mapeval)
|
||||
- [Mapping Long RNA-seq Reads](#map-rna)
|
||||
* [Mapping Nanopore 2D cDNA reads](#map-ont-cdna-2d)
|
||||
* [Mapping Nanopore direct-RNA reads](#map-direct-rna)
|
||||
* [Mapping PacBio Iso-seq reads](#map-iso-seq)
|
||||
- [Full-Genome Alignment](#genome-aln)
|
||||
* [Intra-species assembly alignment](#asm-to-ref)
|
||||
* [Cross-species full-genome alignment](#x-species)
|
||||
* [Eyeballing alignment](#view-aln)
|
||||
* [Calling variants from assembly-to-reference alignment](#asm-var)
|
||||
* [Constructing self-homology map](#hom-map)
|
||||
* [Lift Over (for developers)](#liftover)
|
||||
- [Read Overlap](#read-overlap)
|
||||
* [Long-read overlap](#long-read-overlap)
|
||||
* [Evaluating overlap sensitivity (for developers)](#ov-eval)
|
||||
|
||||
## <a name="intro"></a>Introduction & Installation
|
||||
|
||||
This cookbook walks you through a variety of applications of minimap2 and its
|
||||
companion script `paftools.js`. All data here are freely available from the
|
||||
minimap2 release page at version tag [v2.10][v2.10]. Some examples only work
|
||||
with v2.10 or later.
|
||||
|
||||
To acquire the data used in this cookbook and to install minimap2 and paftools,
|
||||
please follow the command lines below:
|
||||
```sh
|
||||
# install minimap2 executables
|
||||
curl -L https://github.com/lh3/minimap2/releases/download/v2.29/minimap2-2.29_x64-linux.tar.bz2 | tar jxf -
|
||||
cp minimap2-2.29_x64-linux/{minimap2,k8,paftools.js} . # copy executables
|
||||
export PATH="$PATH:"`pwd` # put the current directory on PATH
|
||||
# download example datasets
|
||||
curl -L https://github.com/lh3/minimap2/releases/download/v2.10/cookbook-data.tgz | tar zxf -
|
||||
```
|
||||
|
||||
## <a name="map-reads"></a>Mapping Genomic Reads
|
||||
|
||||
### <a name="map-pb"></a>Mapping long reads
|
||||
```sh
|
||||
minimap2 -ax map-pb -t4 ecoli_ref.fa ecoli_p6_25x_canu.fa > mapped.sam
|
||||
```
|
||||
Alternatively, you can create a minimap2 index first and then map:
|
||||
```sh
|
||||
minimap2 -x map-pb -d ecoli-pb.mmi ecoli_ref.fa # create an index
|
||||
minimap2 -ax map-pb ecoli-pb.mmi ecoli_p6_25x_canu.fa > mapped.sam
|
||||
```
|
||||
This will save you a couple of minutes when you map against the human genome.
|
||||
**HOWEVER**, key algorithm parameters such as the k-mer length and window
|
||||
size can't be changed after indexing. Minimap2 will give you a warning if
|
||||
parameters used in a pre-built index doesn't match parameters on the command
|
||||
line. **Please always make sure you are using an intended pre-built index.**
|
||||
|
||||
### <a name="map-sr"></a>Mapping Illumina paired-end reads:
|
||||
```sh
|
||||
minimap2 -ax sr -t4 ecoli_ref.fa ecoli_mason_1.fq ecoli_mason_2.fq > mapped-sr.sam
|
||||
```
|
||||
|
||||
### <a name="mapeval"></a>Evaluating mapping accuracy with simulated reads (for developers)
|
||||
```sh
|
||||
minimap2 -ax sr ecoli_ref.fa ecoli_mason_1.fq ecoli_mason_2.fq | paftools.js mapeval -
|
||||
```
|
||||
The output is:
|
||||
```
|
||||
Q 60 19712 0 0.000000000 19712
|
||||
Q 0 282 219 0.010953286 19994
|
||||
U 6
|
||||
```
|
||||
where a `U`-line gives the number of unmapped reads (for SAM input only); a
|
||||
`Q`-line gives:
|
||||
|
||||
1. Mapping quality (mapQ) threshold
|
||||
2. Number of mapped reads between this threshold and the previous mapQ threshold.
|
||||
3. Number of wrong mappings in the same mapQ interval
|
||||
4. Accumulative mapping error rate
|
||||
5. Accumulative number of mappings
|
||||
|
||||
For `paftools.js mapeval` to work, you need to encode the true read positions
|
||||
in read names in the right format. For [pbsim2][pbsim] and [mason2][mason2], we
|
||||
provide scripts to generate the right format. Simulated reads in this cookbook
|
||||
were created with the following command lines:
|
||||
```sh
|
||||
# in the pbsim2 source code directory:
|
||||
src/pbsim --depth 1 --length-min 5000 --length-mean 20000 --accuracy-mean 0.95 --hmm_model data/R94.model ../ecoli_ref.fa
|
||||
paftools.js pbsim2fq ../ecoli_ref.fa.fai sd_0001.maf > ../ecoli_pbsim.fa
|
||||
|
||||
# mason2 simulation
|
||||
mason_simulator --illumina-prob-mismatch-scale 2.5 -ir ecoli_ref.fa -n 10000 -o tmp-l.fq -or tmp-r.fq -oa tmp.sam
|
||||
paftools.js mason2fq tmp.sam | seqtk seq -1 > ecoli_mason_1.fq
|
||||
paftools.js mason2fq tmp.sam | seqtk seq -2 > ecoli_mason_2.fq
|
||||
```
|
||||
|
||||
|
||||
|
||||
## <a name="map-rna"></a>Mapping Long RNA-seq Reads
|
||||
|
||||
### <a name="map-ont-cdna-2d"></a>Mapping Nanopore 2D cDNA reads
|
||||
```sh
|
||||
minimap2 -ax splice SIRV_E2.fa SIRV_ont-cdna.fa > aln.sam
|
||||
```
|
||||
You can compare the alignment to the true annotations with:
|
||||
```sh
|
||||
paftools.js junceval SIRV_E2C.gtf aln.sam
|
||||
```
|
||||
It gives the percentage of introns found in the annotation. For SIRV data, it
|
||||
is possible to achieve higher junction accuracy with
|
||||
```sh
|
||||
minimap2 -ax splice --splice-flank=no SIRV_E2.fa SIRV_ont-cdna.fa | paftools.js junceval SIRV_E2C.gtf
|
||||
```
|
||||
This is because minimap2 models one additional evolutionarily conserved base
|
||||
around a canonical junction, but SIRV doesn't honor this signal. Option
|
||||
`--splice-flank=no` asks minimap2 no to model this additional base.
|
||||
|
||||
In the output a tag `ts:A:+` indicates that the read strand is the same as the
|
||||
transcript strand; `ts:A:-` indicates the read strand is opposite to the
|
||||
transcript strand. This tag is inferred from the GT-AG signal and is thus only
|
||||
available to spliced reads.
|
||||
|
||||
### <a name="map-direct-rna"></a>Mapping Nanopore direct-RNA reads
|
||||
```sh
|
||||
minimap2 -ax splice -k14 -uf SIRV_E2.fa SIRV_ont-drna.fa > aln.sam
|
||||
```
|
||||
Direct-RNA reads are noisier, so we use a shorter k-mer for improved
|
||||
sensitivity. Here, option `-uf` forces minimap2 to map reads to the forward
|
||||
transcript strand only because direct-RNA reads are stranded. Again, applying
|
||||
`--splice-flank=no` helps junction accuracy for SIRV data.
|
||||
|
||||
### <a name="map-iso-seq"></a>Mapping PacBio Iso-seq reads
|
||||
```sh
|
||||
minimap2 -ax splice -uf -C5 SIRV_E2.fa SIRV_iso-seq.fq > aln.sam
|
||||
```
|
||||
Option `-C5` reduces the penalty on non-canonical splicing sites. It helps
|
||||
to align such sites correctly for data with low error rate such as Iso-seq
|
||||
reads and traditional cDNAs. On this example, minimap2 makes one junction
|
||||
error. Applying `--splice-flank=no` fixes this alignment error.
|
||||
|
||||
Note that the command line above is optimized for the final Iso-seq reads.
|
||||
PacBio's Iso-seq pipeline produces intermediate sequences at varying quality.
|
||||
For example, some intermediate reads are not stranded. For these reads, option
|
||||
`-uf` will lead to more errors. Please revise the minimap2 command line
|
||||
accordingly.
|
||||
|
||||
|
||||
|
||||
## <a name="genome-aln"></a>Full-Genome Alignment
|
||||
|
||||
### <a name="asm-to-ref"></a>Intra-species assembly alignment
|
||||
```sh
|
||||
# option "--cs" is recommended as paftools.js may need it
|
||||
minimap2 -cx asm5 --cs ecoli_ref.fa ecoli_canu.fa > ecoli_canu.paf
|
||||
```
|
||||
Here `ecoli_canu.fa` is the Canu assembly of `ecoli_p6_25x_canu.fa`. This
|
||||
command line outputs alignments in the [PAF format][paf]. Use `-a` instead of
|
||||
`-c` to get output in the SAM format.
|
||||
|
||||
### <a name="x-species"></a>Cross-species full-genome alignment
|
||||
```sh
|
||||
minimap2 -cx asm20 --cs ecoli_ref.fa ecoli_O104:H4.fa > ecoli_O104:H4.paf
|
||||
sort -k6,6 -k8,8n ecoli_O104:H4.paf | paftools.js call -f ecoli_ref.fa -L10000 -l1000 - > out.vcf
|
||||
```
|
||||
Minimap2 has three presets for full-genome alignment: "asm5" for sequence
|
||||
divergence below 1%, "asm10" for divergence around a couple of percent and
|
||||
"asm20" for divergence not more than 10%. In theory, with the right setting,
|
||||
minimap2 should work for sequence pairs with sequence divergence up to ~15%,
|
||||
but this has not been carefully evaluated.
|
||||
|
||||
### <a name="view-aln"></a>Eyeballing alignment
|
||||
```sh
|
||||
# option "--cs" required; minimap2-r741 or higher required for the "asm20" preset
|
||||
minimap2 -cx asm20 --cs ecoli_ref.fa ecoli_O104:H4.fa | paftools.js view - | less -S
|
||||
```
|
||||
This prints the alignment in a BLAST-like format.
|
||||
|
||||
### <a name="asm-var"></a>Calling variants from assembly-to-reference alignment
|
||||
```sh
|
||||
# don't forget the "--cs" option; otherwise it doesn't work
|
||||
minimap2 -cx asm5 --cs ecoli_ref.fa ecoli_canu.fa \
|
||||
| sort -k6,6 -k8,8n \
|
||||
| paftools.js call -f ecoli_ref.fa - > out.vcf
|
||||
```
|
||||
Without option `-f`, `paftools.js call` outputs in a custom format. In this
|
||||
format, lines starting with `R` give the regions covered by one contig only.
|
||||
This information is not available in the VCF output.
|
||||
|
||||
### <a name="hom-map"></a>Constructing self-homology map
|
||||
```sh
|
||||
minimap2 -DP -k19 -w19 -m200 ecoli_ref.fa ecoli_ref.fa > out.paf
|
||||
```
|
||||
Option `-D` asks minimap2 to ignore anchors from perfect self match and `-P`
|
||||
outputs all chains. For large nomes, we don't recommend to perform base-level
|
||||
alignment (with `-c`, `-a` or `--cs`) when `-P` is applied. This is because
|
||||
base-alignment is slow and occasionally gives wrong alignments close to the
|
||||
diagonal of a dotter plot. For E. coli, though, base-alignment is still fast.
|
||||
|
||||
### <a name="liftover"></a>Lift over (for developers)
|
||||
```sh
|
||||
minimap2 -cx asm5 --cs ecoli_ref.fa ecoli_canu.fa > ecoli_canu.paf
|
||||
echo -e 'tig00000001\t200000\t300000' | paftools.js liftover ecoli_canu.paf -
|
||||
```
|
||||
This lifts over a region on query sequences to one or multiple regions on
|
||||
reference sequences. Note that this paftools.js command may not be efficient
|
||||
enough to lift millions of regions.
|
||||
|
||||
|
||||
|
||||
## <a name="read-overlap"></a>Read Overlap
|
||||
|
||||
### <a name="long-read-overlap"></a>Long read overlap
|
||||
```sh
|
||||
# For pacbio reads:
|
||||
minimap2 -x ava-pb ecoli_p6_25x_canu.fa ecoli_p6_25x_canu.fa > overlap.paf
|
||||
# For Nanopore reads (ava-ont also works with PacBio but not as good):
|
||||
minimap2 -x ava-ont -r 10000 ecoli_p6_25x_canu.fa ecoli_p6_25x_canu.fa > overlap.paf
|
||||
# If you have miniasm installed:
|
||||
miniasm -f ecoli_p6_25x_canu.fa overlap.paf > asm.gfa
|
||||
```
|
||||
Here we explicitly applied `-r 10000`. We are considering to set this as the
|
||||
default for the `ava-ont` mode as this seems to improve the contiguity for
|
||||
nanopore read assembly (Loman, personal communication).
|
||||
|
||||
*Minimap2 doesn't work well with short-read overlap.*
|
||||
|
||||
### <a name="ov-eval"></a>Evaluating overlap sensitivity (for developers)
|
||||
|
||||
```sh
|
||||
# read to reference mapping
|
||||
minimap2 -cx map-pb ecoli_ref.fa ecoli_p6_25x_canu.fa > to-ref.paf
|
||||
# evaluate overlap sensitivity
|
||||
sort -k6,6 -k8,8n to-ref.paf | paftools.js ov-eval - overlap.paf
|
||||
```
|
||||
You can see that for PacBio reads, minimap2 achieves higher overlap sensitivity
|
||||
with `-x ava-pb` (99% vs 93% with `-x ava-ont`).
|
||||
|
||||
|
||||
|
||||
[pbsim]: https://github.com/yukiteruono/pbsim2
|
||||
[mason2]: https://github.com/seqan/seqan/tree/master/apps/mason2
|
||||
[paf]: https://github.com/lh3/miniasm/blob/master/PAF.md
|
||||
[v2.10]: https://github.com/lh3/minimap2/releases/tag/v2.10
|
||||
@@ -0,0 +1,64 @@
|
||||
#include <math.h>
|
||||
#include <stdio.h>
|
||||
#include <stdlib.h>
|
||||
#include <assert.h>
|
||||
#include "mmpriv.h"
|
||||
|
||||
static inline int32_t get_for_qpos(int32_t qlen, const mm128_t *a)
|
||||
{
|
||||
int32_t x = (int32_t)a->y;
|
||||
int32_t q_span = a->y>>32 & 0xff;
|
||||
if (a->x>>63)
|
||||
x = qlen - 1 - (x + 1 - q_span); // revert the position to the forward strand of query
|
||||
return x;
|
||||
}
|
||||
|
||||
static int get_mini_idx(int qlen, const mm128_t *a, int32_t n, const uint64_t *mini_pos)
|
||||
{
|
||||
int32_t x, L = 0, R = n - 1;
|
||||
x = get_for_qpos(qlen, a);
|
||||
while (L <= R) { // binary search
|
||||
int32_t m = ((uint64_t)L + R) >> 1;
|
||||
int32_t y = (int32_t)mini_pos[m];
|
||||
if (y < x) L = m + 1;
|
||||
else if (y > x) R = m - 1;
|
||||
else return m;
|
||||
}
|
||||
return -1;
|
||||
}
|
||||
|
||||
void mm_est_err(const mm_idx_t *mi, int qlen, int n_regs, mm_reg1_t *regs, const mm128_t *a, int32_t n, const uint64_t *mini_pos)
|
||||
{
|
||||
int i;
|
||||
uint64_t sum_k = 0;
|
||||
float avg_k;
|
||||
|
||||
if (n == 0) return;
|
||||
for (i = 0; i < n; ++i)
|
||||
sum_k += mini_pos[i] >> 32 & 0xff;
|
||||
avg_k = (float)sum_k / n;
|
||||
|
||||
for (i = 0; i < n_regs; ++i) {
|
||||
mm_reg1_t *r = ®s[i];
|
||||
int32_t st, en, j, k, n_match, n_tot, l_ref;
|
||||
r->div = -1.0f;
|
||||
if (r->cnt == 0) continue;
|
||||
st = en = get_mini_idx(qlen, r->rev? &a[r->as + r->cnt - 1] : &a[r->as], n, mini_pos);
|
||||
if (st < 0) {
|
||||
if (mm_verbose >= 2)
|
||||
fprintf(stderr, "[WARNING] logic inconsistency in mm_est_err(). Please contact the developer.\n");
|
||||
continue;
|
||||
}
|
||||
l_ref = mi->seq[r->rid].len;
|
||||
for (k = 1, j = st + 1, n_match = 1; j < n && k < r->cnt; ++j) {
|
||||
int32_t x;
|
||||
x = get_for_qpos(qlen, r->rev? &a[r->as + r->cnt - 1 - k] : &a[r->as + k]);
|
||||
if (x == (int32_t)mini_pos[j])
|
||||
++k, en = j, ++n_match;
|
||||
}
|
||||
n_tot = en - st + 1;
|
||||
if (r->qs > avg_k && r->rs > avg_k) ++n_tot;
|
||||
if (qlen - r->qs > avg_k && l_ref - r->re > avg_k) ++n_tot;
|
||||
r->div = n_match >= n_tot? 0.0f : (float)(1.0 - pow((double)n_match / n_tot, 1.0 / avg_k));
|
||||
}
|
||||
}
|
||||
@@ -35,6 +35,8 @@ int main(int argc, char *argv[])
|
||||
while ((mi = mm_idx_reader_read(r, n_threads)) != 0) { // traverse each part of the index
|
||||
mm_mapopt_update(&mopt, mi); // this sets the maximum minimizer occurrence; TODO: set a better default in mm_mapopt_init()!
|
||||
mm_tbuf_t *tbuf = mm_tbuf_init(); // thread buffer; for multi-threading, allocate one tbuf for each thread
|
||||
gzrewind(f);
|
||||
kseq_rewind(ks);
|
||||
while (kseq_read(ks) >= 0) { // each kseq_read() call reads one query sequence
|
||||
mm_reg1_t *reg;
|
||||
int j, i, n_reg;
|
||||
@@ -43,10 +45,9 @@ int main(int argc, char *argv[])
|
||||
mm_reg1_t *r = ®[j];
|
||||
assert(r->p); // with MM_F_CIGAR, this should not be NULL
|
||||
printf("%s\t%d\t%d\t%d\t%c\t", ks->name.s, ks->seq.l, r->qs, r->qe, "+-"[r->rev]);
|
||||
printf("%s\t%d\t%d\t%d\t%d\t%d\t%d\tcg:Z:", mi->seq[r->rid].name, mi->seq[r->rid].len, r->rs, r->re,
|
||||
r->p->blen - r->p->n_ambi - r->p->n_diff, r->p->blen, r->mapq);
|
||||
printf("%s\t%d\t%d\t%d\t%d\t%d\t%d\tcg:Z:", mi->seq[r->rid].name, mi->seq[r->rid].len, r->rs, r->re, r->mlen, r->blen, r->mapq);
|
||||
for (i = 0; i < r->p->n_cigar; ++i) // IMPORTANT: this gives the CIGAR in the aligned regions. NO soft/hard clippings!
|
||||
printf("%d%c", r->p->cigar[i]>>4, "MIDSHN"[r->p->cigar[i]&0xf]);
|
||||
printf("%d%c", r->p->cigar[i]>>4, MM_CIGAR_STR[r->p->cigar[i]&0xf]);
|
||||
putchar('\n');
|
||||
free(r->p);
|
||||
}
|
||||
|
||||
@@ -43,6 +43,13 @@ static void mm_sprintf_lite(kstring_t *s, const char *fmt, ...)
|
||||
if (c < 0) buf[l++] = '-';
|
||||
str_enlarge(s, l);
|
||||
for (i = l - 1; i >= 0; --i) s->s[s->l++] = buf[i];
|
||||
} else if (*p == 'u') {
|
||||
int i, l = 0;
|
||||
uint32_t x;
|
||||
x = va_arg(ap, uint32_t);
|
||||
do { buf[l++] = x%10 + '0'; x /= 10; } while (x > 0);
|
||||
str_enlarge(s, l);
|
||||
for (i = l - 1; i >= 0; --i) s->s[s->l++] = buf[i];
|
||||
} else if (*p == 's') {
|
||||
char *r = va_arg(ap, char*);
|
||||
str_copy(s, r, r + strlen(r));
|
||||
@@ -72,11 +79,11 @@ static char *mm_escape(char *s)
|
||||
return s;
|
||||
}
|
||||
|
||||
static void sam_write_rg_line(kstring_t *str, const char *s)
|
||||
static int sam_write_rg_line(kstring_t *str, const char *s)
|
||||
{
|
||||
char *p, *q, *r, *rg_line = 0;
|
||||
memset(mm_rg_id, 0, 256);
|
||||
if (s == 0) return;
|
||||
if (s == 0) return 0;
|
||||
if (strstr(s, "@RG") != s) {
|
||||
if (mm_verbose >= 1) fprintf(stderr, "[ERROR] the read group line is not started with @RG\n");
|
||||
goto err_set_rg;
|
||||
@@ -85,7 +92,8 @@ static void sam_write_rg_line(kstring_t *str, const char *s)
|
||||
if (mm_verbose >= 1) fprintf(stderr, "[ERROR] the read group line contained literal <tab> characters -- replace with escaped tabs: \\t\n");
|
||||
goto err_set_rg;
|
||||
}
|
||||
rg_line = strdup(s);
|
||||
rg_line = (char*)malloc(strlen(s) + 1);
|
||||
strcpy(rg_line, s);
|
||||
mm_escape(rg_line);
|
||||
if ((p = strstr(rg_line, "\tID:")) == 0) {
|
||||
if (mm_verbose >= 1) fprintf(stderr, "[ERROR] no ID within the read group line\n");
|
||||
@@ -100,15 +108,24 @@ static void sam_write_rg_line(kstring_t *str, const char *s)
|
||||
for (q = p, r = mm_rg_id; *q && *q != '\t' && *q != '\n'; ++q)
|
||||
*r++ = *q;
|
||||
mm_sprintf_lite(str, "%s\n", rg_line);
|
||||
return 0;
|
||||
|
||||
err_set_rg:
|
||||
free(rg_line);
|
||||
return -1;
|
||||
}
|
||||
|
||||
void mm_write_sam_hdr_no_SQ(const char *rg, const char *ver, int argc, char *argv[])
|
||||
int mm_write_sam_hdr(const mm_idx_t *idx, const char *rg, const char *ver, int argc, char *argv[])
|
||||
{
|
||||
kstring_t str = {0,0,0};
|
||||
sam_write_rg_line(&str, rg);
|
||||
int ret = 0;
|
||||
mm_sprintf_lite(&str, "@HD\tVN:1.6\tSO:unsorted\tGO:query\n");
|
||||
if (idx) {
|
||||
uint32_t i;
|
||||
for (i = 0; i < idx->n_seq; ++i)
|
||||
mm_sprintf_lite(&str, "@SQ\tSN:%s\tLN:%d\n", idx->seq[i].name, idx->seq[i].len);
|
||||
}
|
||||
if (rg) ret = sam_write_rg_line(&str, rg);
|
||||
mm_sprintf_lite(&str, "@PG\tID:minimap2\tPN:minimap2");
|
||||
if (ver) mm_sprintf_lite(&str, "\tVN:%s", ver);
|
||||
if (argc > 1) {
|
||||
@@ -117,22 +134,217 @@ void mm_write_sam_hdr_no_SQ(const char *rg, const char *ver, int argc, char *arg
|
||||
for (i = 1; i < argc; ++i)
|
||||
mm_sprintf_lite(&str, " %s", argv[i]);
|
||||
}
|
||||
mm_sprintf_lite(&str, "\n");
|
||||
fputs(str.s, stdout);
|
||||
mm_err_puts(str.s);
|
||||
free(str.s);
|
||||
return ret;
|
||||
}
|
||||
|
||||
static void write_cs(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r)
|
||||
static void write_indel_ds(kstring_t *str, int64_t len, const uint8_t *seq, int64_t ll, int64_t lr) // write an indel to ds; adapted from minigraph
|
||||
{
|
||||
int64_t i;
|
||||
if (ll + lr >= len) {
|
||||
mm_sprintf_lite(str, "[");
|
||||
for (i = 0; i < len; ++i)
|
||||
mm_sprintf_lite(str, "%c", "acgtn"[seq[i]]);
|
||||
mm_sprintf_lite(str, "]");
|
||||
} else {
|
||||
int64_t k = 0;
|
||||
if (ll > 0) {
|
||||
mm_sprintf_lite(str, "[");
|
||||
for (i = 0; i < ll; ++i)
|
||||
mm_sprintf_lite(str, "%c", "acgtn"[seq[k+i]]);
|
||||
mm_sprintf_lite(str, "]");
|
||||
k += ll;
|
||||
}
|
||||
for (i = 0; i < len - lr - ll; ++i)
|
||||
mm_sprintf_lite(str, "%c", "acgtn"[seq[k+i]]);
|
||||
k += len - lr - ll;
|
||||
if (lr > 0) {
|
||||
mm_sprintf_lite(str, "[");
|
||||
for (i = 0; i < lr; ++i)
|
||||
mm_sprintf_lite(str, "%c", "acgtn"[seq[k+i]]);
|
||||
mm_sprintf_lite(str, "]");
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
static void write_cs_ds_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq, const mm_reg1_t *r, char *tmp, int no_iden, int is_ds, int write_tag)
|
||||
{
|
||||
int i, q_off, t_off, q_len = 0, t_len = 0;
|
||||
if (write_tag) mm_sprintf_lite(s, "\t%cs:Z:", is_ds? 'd' : 'c');
|
||||
for (i = 0; i < (int)r->p->n_cigar; ++i) {
|
||||
int op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
|
||||
if (op == MM_CIGAR_MATCH || op == MM_CIGAR_EQ_MATCH || op == MM_CIGAR_X_MISMATCH)
|
||||
q_len += len, t_len += len;
|
||||
else if (op == MM_CIGAR_INS)
|
||||
q_len += len;
|
||||
else if (op == MM_CIGAR_DEL || op == MM_CIGAR_N_SKIP)
|
||||
t_len += len;
|
||||
}
|
||||
for (i = q_off = t_off = 0; i < (int)r->p->n_cigar; ++i) {
|
||||
int j, op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
|
||||
assert((op >= MM_CIGAR_MATCH && op <= MM_CIGAR_N_SKIP) || op == MM_CIGAR_EQ_MATCH || op == MM_CIGAR_X_MISMATCH);
|
||||
if (op == MM_CIGAR_MATCH || op == MM_CIGAR_EQ_MATCH || op == MM_CIGAR_X_MISMATCH) {
|
||||
int l_tmp = 0;
|
||||
for (j = 0; j < len; ++j) {
|
||||
if (qseq[q_off + j] != tseq[t_off + j]) {
|
||||
if (l_tmp > 0) {
|
||||
if (!no_iden) {
|
||||
tmp[l_tmp] = 0;
|
||||
mm_sprintf_lite(s, "=%s", tmp);
|
||||
} else mm_sprintf_lite(s, ":%d", l_tmp);
|
||||
l_tmp = 0;
|
||||
}
|
||||
mm_sprintf_lite(s, "*%c%c", "acgtn"[tseq[t_off + j]], "acgtn"[qseq[q_off + j]]);
|
||||
} else tmp[l_tmp++] = "ACGTN"[qseq[q_off + j]];
|
||||
}
|
||||
if (l_tmp > 0) {
|
||||
if (!no_iden) {
|
||||
tmp[l_tmp] = 0;
|
||||
mm_sprintf_lite(s, "=%s", tmp);
|
||||
} else mm_sprintf_lite(s, ":%d", l_tmp);
|
||||
}
|
||||
q_off += len, t_off += len;
|
||||
} else if (op == MM_CIGAR_INS) {
|
||||
if (is_ds) {
|
||||
int z, ll, lr, y = q_off;
|
||||
for (z = 1; z <= len; ++z)
|
||||
if (y - z < 0 || qseq[y + len - z] != qseq[y - z])
|
||||
break;
|
||||
lr = z - 1;
|
||||
for (z = 0; z < len; ++z)
|
||||
if (y + len + z >= q_len || qseq[y + len + z] != qseq[y + z])
|
||||
break;
|
||||
ll = z;
|
||||
mm_sprintf_lite(s, "+");
|
||||
write_indel_ds(s, len, &qseq[y], ll, lr);
|
||||
} else {
|
||||
for (j = 0, tmp[len] = 0; j < len; ++j)
|
||||
tmp[j] = "acgtn"[qseq[q_off + j]];
|
||||
mm_sprintf_lite(s, "+%s", tmp);
|
||||
}
|
||||
q_off += len;
|
||||
} else if (op == MM_CIGAR_DEL) {
|
||||
if (is_ds) {
|
||||
int z, ll, lr, x = t_off;
|
||||
for (z = 1; z <= len; ++z)
|
||||
if (x - z < 0 || tseq[x + len - z] != tseq[x - z])
|
||||
break;
|
||||
lr = z - 1;
|
||||
for (z = 0; z < len; ++z)
|
||||
if (x + len + z >= t_len || tseq[x + z] != tseq[x + len + z])
|
||||
break;
|
||||
ll = z;
|
||||
mm_sprintf_lite(s, "-");
|
||||
write_indel_ds(s, len, &tseq[x], ll, lr);
|
||||
} else {
|
||||
for (j = 0, tmp[len] = 0; j < len; ++j)
|
||||
tmp[j] = "acgtn"[tseq[t_off + j]];
|
||||
mm_sprintf_lite(s, "-%s", tmp);
|
||||
}
|
||||
t_off += len;
|
||||
} else { // intron
|
||||
assert(len >= 2);
|
||||
mm_sprintf_lite(s, "~%c%c%d%c%c", "acgtn"[tseq[t_off]], "acgtn"[tseq[t_off+1]],
|
||||
len, "acgtn"[tseq[t_off+len-2]], "acgtn"[tseq[t_off+len-1]]);
|
||||
t_off += len;
|
||||
}
|
||||
}
|
||||
assert(t_off == r->re - r->rs && q_off == r->qe - r->qs);
|
||||
}
|
||||
|
||||
static inline void revcomp_splice(uint8_t s[2])
|
||||
{
|
||||
uint8_t c = s[1] < 4? 3 - s[1] : 4;
|
||||
s[1] = s[0] < 4? 3 - s[0] : 4;
|
||||
s[0] = c;
|
||||
}
|
||||
|
||||
void mm_write_junc(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r)
|
||||
{
|
||||
int32_t i, t_off, swritten = 0;
|
||||
s->l = 0;
|
||||
if (!r->is_spliced || r->p == 0) return; // no junctions
|
||||
if (r->p->trans_strand != 1 && r->p->trans_strand != 2) return; // no preferred strand
|
||||
for (i = 0, t_off = r->rs; i < (int)r->p->n_cigar; ++i) {
|
||||
int op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
|
||||
if (op == MM_CIGAR_MATCH || op == MM_CIGAR_EQ_MATCH || op == MM_CIGAR_X_MISMATCH || op == MM_CIGAR_DEL) {
|
||||
t_off += len;
|
||||
} else if (op == MM_CIGAR_N_SKIP) { // intron
|
||||
uint8_t donor[2], acceptor[2];
|
||||
int32_t score1 = 0, score2 = 0, rev;
|
||||
assert(len >= 2);
|
||||
rev = (r->p->trans_strand == 2) ^ r->rev;
|
||||
if (!rev) {
|
||||
mm_idx_getseq(mi, r->rid, t_off, t_off + 2, donor);
|
||||
mm_idx_getseq(mi, r->rid, t_off + len - 2, t_off + len, acceptor);
|
||||
} else {
|
||||
mm_idx_getseq(mi, r->rid, t_off, t_off + 2, acceptor);
|
||||
mm_idx_getseq(mi, r->rid, t_off + len - 2, t_off + len, donor);
|
||||
revcomp_splice(donor);
|
||||
revcomp_splice(acceptor);
|
||||
}
|
||||
//fprintf(stderr, "%c%c-%c%c\n", "ACGTN"[donor[0]], "ACGTN"[donor[1]], "ACGTN"[acceptor[0]], "ACGTN"[acceptor[1]]);
|
||||
if (donor[0] == 2 && donor[1] == 3) score1 = 3;
|
||||
else if (donor[0] == 2 && donor[1] == 1) score1 = 2;
|
||||
else if (donor[0] == 0 && donor[1] == 3) score1 = 1;
|
||||
if (acceptor[0] == 0 && acceptor[1] == 2) score2 = 3;
|
||||
else if (acceptor[0] == 0 && acceptor[1] == 1) score2 = 1;
|
||||
if (swritten) mm_sprintf_lite(s, "\n");
|
||||
else swritten = 1;
|
||||
mm_sprintf_lite(s, "%s\t%d\t%d\t%s\t%d\t%c", mi->seq[r->rid].name, t_off, t_off + len, t->name, score1 + score2, "+-"[rev]);
|
||||
t_off += len;
|
||||
}
|
||||
}
|
||||
assert(t_off == r->re);
|
||||
}
|
||||
|
||||
static void write_MD_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq, const mm_reg1_t *r, char *tmp, int write_tag)
|
||||
{
|
||||
int i, q_off, t_off, l_MD = 0;
|
||||
if (write_tag) mm_sprintf_lite(s, "\tMD:Z:");
|
||||
for (i = q_off = t_off = 0; i < (int)r->p->n_cigar; ++i) {
|
||||
int j, op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
|
||||
assert((op >= MM_CIGAR_MATCH && op <= MM_CIGAR_N_SKIP) || op == MM_CIGAR_EQ_MATCH || op == MM_CIGAR_X_MISMATCH);
|
||||
if (op == MM_CIGAR_MATCH || op == MM_CIGAR_EQ_MATCH || op == MM_CIGAR_X_MISMATCH) {
|
||||
for (j = 0; j < len; ++j) {
|
||||
if (qseq[q_off + j] != tseq[t_off + j]) {
|
||||
mm_sprintf_lite(s, "%d%c", l_MD, "ACGTN"[tseq[t_off + j]]);
|
||||
l_MD = 0;
|
||||
} else ++l_MD;
|
||||
}
|
||||
q_off += len, t_off += len;
|
||||
} else if (op == MM_CIGAR_INS) {
|
||||
q_off += len;
|
||||
} else if (op == MM_CIGAR_DEL) {
|
||||
for (j = 0, tmp[len] = 0; j < len; ++j)
|
||||
tmp[j] = "ACGTN"[tseq[t_off + j]];
|
||||
mm_sprintf_lite(s, "%d^%s", l_MD, tmp);
|
||||
l_MD = 0;
|
||||
t_off += len;
|
||||
} else if (op == MM_CIGAR_N_SKIP) {
|
||||
t_off += len;
|
||||
}
|
||||
}
|
||||
if (l_MD > 0) mm_sprintf_lite(s, "%d", l_MD);
|
||||
assert(t_off == r->re - r->rs && q_off == r->qe - r->qs);
|
||||
}
|
||||
|
||||
static void write_cs_ds_or_MD(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int no_iden, int is_MD, int is_ds, int write_tag, int is_qstrand)
|
||||
{
|
||||
extern unsigned char seq_nt4_table[256];
|
||||
int i, q_off, t_off;
|
||||
int i;
|
||||
uint8_t *qseq, *tseq;
|
||||
char *tmp;
|
||||
if (r->p == 0) return;
|
||||
mm_sprintf_lite(s, "\tcs:Z:");
|
||||
qseq = (uint8_t*)kmalloc(km, r->qe - r->qs);
|
||||
tseq = (uint8_t*)kmalloc(km, r->re - r->rs);
|
||||
tmp = (char*)kmalloc(km, r->re - r->rs > r->qe - r->qs? r->re - r->rs + 1 : r->qe - r->qs + 1);
|
||||
if (is_qstrand) {
|
||||
mm_idx_getseq2(mi, r->rev, r->rid, r->rs, r->re, tseq);
|
||||
for (i = r->qs; i < r->qe; ++i)
|
||||
qseq[i - r->qs] = seq_nt4_table[(uint8_t)t->seq[i]];
|
||||
} else {
|
||||
mm_idx_getseq(mi, r->rid, r->rs, r->re, tseq);
|
||||
if (!r->rev) {
|
||||
for (i = r->qs; i < r->qe; ++i)
|
||||
@@ -143,138 +355,267 @@ static void write_cs(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_
|
||||
qseq[r->qe - i - 1] = c >= 4? 4 : 3 - c;
|
||||
}
|
||||
}
|
||||
for (i = q_off = t_off = 0; i < r->p->n_cigar; ++i) {
|
||||
int j, op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
|
||||
assert(op >= 0 && op <= 2);
|
||||
if (op == 0) {
|
||||
int l_tmp = 0;
|
||||
for (j = 0; j < len; ++j) {
|
||||
if (qseq[q_off + j] != tseq[t_off + j]) {
|
||||
if (l_tmp > 0) {
|
||||
tmp[l_tmp] = 0;
|
||||
mm_sprintf_lite(s, "=%s", tmp);
|
||||
l_tmp = 0;
|
||||
}
|
||||
mm_sprintf_lite(s, "*%c%c", "acgtn"[tseq[t_off + j]], "acgtn"[qseq[q_off + j]]);
|
||||
} else tmp[l_tmp++] = "ACGTN"[qseq[q_off + j]];
|
||||
}
|
||||
if (l_tmp > 0) {
|
||||
tmp[l_tmp] = 0;
|
||||
mm_sprintf_lite(s, "=%s", tmp);
|
||||
}
|
||||
q_off += len, t_off += len;
|
||||
} else if (op == 1) {
|
||||
for (j = 0, tmp[len] = 0; j < len; ++j)
|
||||
tmp[j] = "acgtn"[qseq[q_off + j]];
|
||||
mm_sprintf_lite(s, "+%s", tmp);
|
||||
q_off += len;
|
||||
} else if (op == 2) {
|
||||
for (j = 0, tmp[len] = 0; j < len; ++j)
|
||||
tmp[j] = "acgtn"[tseq[t_off + j]];
|
||||
mm_sprintf_lite(s, "-%s", tmp);
|
||||
t_off += len;
|
||||
}
|
||||
}
|
||||
assert(t_off == r->re - r->rs && q_off == r->qe - r->qs);
|
||||
if (is_MD) write_MD_core(s, tseq, qseq, r, tmp, write_tag);
|
||||
else write_cs_ds_core(s, tseq, qseq, r, tmp, no_iden, is_ds, write_tag);
|
||||
kfree(km, qseq); kfree(km, tseq); kfree(km, tmp);
|
||||
}
|
||||
|
||||
int mm_gen_cs_or_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int is_MD, int no_iden, int is_qstrand)
|
||||
{
|
||||
mm_bseq1_t t;
|
||||
kstring_t str;
|
||||
str.s = *buf, str.l = 0, str.m = *max_len;
|
||||
t.l_seq = strlen(seq);
|
||||
t.seq = (char*)seq;
|
||||
write_cs_ds_or_MD(km, &str, mi, &t, r, no_iden, is_MD, 0, 0, is_qstrand);
|
||||
*max_len = str.m;
|
||||
*buf = str.s;
|
||||
return str.l;
|
||||
}
|
||||
|
||||
int mm_gen_cs(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int no_iden)
|
||||
{
|
||||
return mm_gen_cs_or_MD(km, buf, max_len, mi, r, seq, 0, no_iden, 0);
|
||||
}
|
||||
|
||||
int mm_gen_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq)
|
||||
{
|
||||
return mm_gen_cs_or_MD(km, buf, max_len, mi, r, seq, 1, 0, 0);
|
||||
}
|
||||
|
||||
static inline void write_tags(kstring_t *s, const mm_reg1_t *r)
|
||||
{
|
||||
int type = r->inv? 'I' : r->id == r->parent? 'P' : 'S';
|
||||
mm_sprintf_lite(s, "\ttp:A:%c\tcm:i:%d\ts1:i:%d", type, r->cnt, r->score);
|
||||
if (r->parent == r->id) mm_sprintf_lite(s, "\ts2:i:%d", r->subsc);
|
||||
if (r->split) mm_sprintf_lite(s, "\tzd:i:%d", r->split);
|
||||
int type;
|
||||
if (r->id == r->parent) type = r->inv? 'I' : 'P';
|
||||
else type = r->inv? 'i' : 'S';
|
||||
if (r->p) {
|
||||
mm_sprintf_lite(s, "\tNM:i:%d\tms:i:%d\tAS:i:%d\tnn:i:%d", r->p->n_diff, r->p->dp_max, r->p->dp_score, r->p->n_ambi);
|
||||
mm_sprintf_lite(s, "\tNM:i:%d\tms:i:%d\tAS:i:%d\tnn:i:%d", r->blen - r->mlen + r->p->n_ambi, r->p->dp_max0, r->p->dp_score, r->p->n_ambi);
|
||||
if (r->p->trans_strand == 1 || r->p->trans_strand == 2)
|
||||
mm_sprintf_lite(s, "\tts:A:%c", "?+-?"[r->p->trans_strand]);
|
||||
}
|
||||
mm_sprintf_lite(s, "\ttp:A:%c\tcm:i:%d\ts1:i:%d", type, r->cnt, r->score);
|
||||
if (r->parent == r->id) mm_sprintf_lite(s, "\ts2:i:%d", r->subsc);
|
||||
if (r->p) {
|
||||
char buf[16];
|
||||
double div;
|
||||
div = 1.0 - mm_event_identity(r);
|
||||
if (div == 0.0) buf[0] = '0', buf[1] = 0;
|
||||
else snprintf(buf, 16, "%.4f", 1.0 - mm_event_identity(r));
|
||||
mm_sprintf_lite(s, "\tde:f:%s", buf);
|
||||
} else if (r->div >= 0.0f && r->div <= 1.0f) {
|
||||
char buf[16];
|
||||
if (r->div == 0.0f) buf[0] = '0', buf[1] = 0;
|
||||
else snprintf(buf, 16, "%.4f", r->div);
|
||||
mm_sprintf_lite(s, "\tdv:f:%s", buf);
|
||||
}
|
||||
if (r->split) mm_sprintf_lite(s, "\tzd:i:%d", r->split);
|
||||
}
|
||||
|
||||
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int opt_flag)
|
||||
void mm_write_paf4(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag, int rep_len, int n_seg, int seg_idx)
|
||||
{
|
||||
s->l = 0;
|
||||
mm_sprintf_lite(s, "%s\t%d\t%d\t%d\t%c\t", t->name, t->l_seq, r->qs, r->qe, "+-"[r->rev]);
|
||||
mm_sprintf_lite(s, "%s", t->name);
|
||||
if ((opt_flag & MM_F_FRAG_MODE) && n_seg >= 2 && seg_idx >= 0)
|
||||
mm_sprintf_lite(s, "/%d", seg_idx + 1);
|
||||
if (r == 0) {
|
||||
mm_sprintf_lite(s, "\t%d\t0\t0\t*\t*\t0\t0\t0\t0\t0\t0", t->l_seq);
|
||||
if (rep_len >= 0) mm_sprintf_lite(s, "\trl:i:%d", rep_len);
|
||||
return;
|
||||
}
|
||||
mm_sprintf_lite(s, "\t%d\t%d\t%d\t%c\t", t->l_seq, r->qs, r->qe, "+-"[r->rev]);
|
||||
if (mi->seq[r->rid].name) mm_sprintf_lite(s, "%s", mi->seq[r->rid].name);
|
||||
else mm_sprintf_lite(s, "%d", r->rid);
|
||||
mm_sprintf_lite(s, "\t%d\t%d\t%d", mi->seq[r->rid].len, r->rs, r->re);
|
||||
if (r->p) mm_sprintf_lite(s, "\t%d\t%d", r->p->blen - r->p->n_ambi - r->p->n_diff, r->p->blen);
|
||||
else mm_sprintf_lite(s, "\t%d\t%d", r->fuzzy_mlen, r->fuzzy_blen);
|
||||
mm_sprintf_lite(s, "\t%d", mi->seq[r->rid].len);
|
||||
if ((opt_flag & MM_F_QSTRAND) && r->rev)
|
||||
mm_sprintf_lite(s, "\t%d\t%d", mi->seq[r->rid].len - r->re, mi->seq[r->rid].len - r->rs);
|
||||
else
|
||||
mm_sprintf_lite(s, "\t%d\t%d", r->rs, r->re);
|
||||
mm_sprintf_lite(s, "\t%d\t%d", r->mlen, r->blen);
|
||||
mm_sprintf_lite(s, "\t%d", r->mapq);
|
||||
write_tags(s, r);
|
||||
if (rep_len >= 0) mm_sprintf_lite(s, "\trl:i:%d", rep_len);
|
||||
if (r->p && (opt_flag & MM_F_OUT_CG)) {
|
||||
uint32_t k;
|
||||
mm_sprintf_lite(s, "\tcg:Z:");
|
||||
for (k = 0; k < r->p->n_cigar; ++k)
|
||||
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDN"[r->p->cigar[k]&0xf]);
|
||||
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, MM_CIGAR_STR[r->p->cigar[k]&0xf]);
|
||||
}
|
||||
if (r->p && (opt_flag & MM_F_OUT_CS))
|
||||
write_cs(km, s, mi, t, r);
|
||||
if (r->p && (opt_flag & (MM_F_OUT_CS|MM_F_OUT_DS|MM_F_OUT_MD)))
|
||||
write_cs_ds_or_MD(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG), !!(opt_flag&MM_F_OUT_MD), !!(opt_flag&MM_F_OUT_DS), 1, !!(opt_flag&MM_F_QSTRAND));
|
||||
if ((opt_flag & MM_F_COPY_COMMENT) && t->comment)
|
||||
mm_sprintf_lite(s, "\t%s", t->comment);
|
||||
}
|
||||
|
||||
static char comp_tab[] = {
|
||||
0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15,
|
||||
16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,
|
||||
32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47,
|
||||
48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63,
|
||||
64, 'T', 'V', 'G', 'H', 'E', 'F', 'C', 'D', 'I', 'J', 'M', 'L', 'K', 'N', 'O',
|
||||
'P', 'Q', 'Y', 'S', 'A', 'A', 'B', 'W', 'X', 'R', 'Z', 91, 92, 93, 94, 95,
|
||||
64, 't', 'v', 'g', 'h', 'e', 'f', 'c', 'd', 'i', 'j', 'm', 'l', 'k', 'n', 'o',
|
||||
'p', 'q', 'y', 's', 'a', 'a', 'b', 'w', 'x', 'r', 'z', 123, 124, 125, 126, 127
|
||||
};
|
||||
|
||||
void mm_write_sam_SQ(const mm_idx_t *idx)
|
||||
void mm_write_paf3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag, int rep_len)
|
||||
{
|
||||
uint32_t i;
|
||||
for (i = 0; i < idx->n_seq; ++i)
|
||||
printf("@SQ\tSN:%s\tLN:%d\n", idx->seq[i].name, idx->seq[i].len);
|
||||
mm_write_paf4(s, mi, t, r, km, opt_flag, rep_len, 0, 0);
|
||||
}
|
||||
|
||||
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag)
|
||||
{
|
||||
mm_write_paf3(s, mi, t, r, km, opt_flag, -1);
|
||||
}
|
||||
|
||||
static void sam_write_sq(kstring_t *s, char *seq, int l, int rev, int comp)
|
||||
{
|
||||
extern unsigned char seq_comp_table[256];
|
||||
if (rev) {
|
||||
int i;
|
||||
str_enlarge(s, l);
|
||||
for (i = 0; i < l; ++i) {
|
||||
int c = seq[l - 1 - i];
|
||||
s->s[s->l + i] = c < 128 && comp? comp_tab[c] : c;
|
||||
s->s[s->l + i] = c < 128 && comp? seq_comp_table[c] : c;
|
||||
}
|
||||
s->l += l;
|
||||
} else str_copy(s, seq, seq + l);
|
||||
}
|
||||
|
||||
void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int n_regs, const mm_reg1_t *regs)
|
||||
static inline const mm_reg1_t *get_sam_pri(int n_regs, const mm_reg1_t *regs)
|
||||
{
|
||||
int flag = 0;
|
||||
int i;
|
||||
for (i = 0; i < n_regs; ++i)
|
||||
if (regs[i].sam_pri)
|
||||
return ®s[i];
|
||||
assert(n_regs == 0);
|
||||
return NULL;
|
||||
}
|
||||
|
||||
static void write_sam_cigar(kstring_t *s, int sam_flag, int in_tag, int qlen, const mm_reg1_t *r, int64_t opt_flag)
|
||||
{
|
||||
if (r->p == 0) {
|
||||
mm_sprintf_lite(s, "*");
|
||||
} else {
|
||||
uint32_t k, clip_len[2];
|
||||
clip_len[0] = r->rev? qlen - r->qe : r->qs;
|
||||
clip_len[1] = r->rev? r->qs : qlen - r->qe;
|
||||
if (in_tag) {
|
||||
int clip_char = (((sam_flag&0x800) || ((sam_flag&0x100) && (opt_flag&MM_F_SECONDARY_SEQ))) &&
|
||||
!(opt_flag&MM_F_SOFTCLIP)) ? 5 : 4;
|
||||
mm_sprintf_lite(s, "\tCG:B:I");
|
||||
if (clip_len[0]) mm_sprintf_lite(s, ",%u", clip_len[0]<<4|clip_char);
|
||||
for (k = 0; k < r->p->n_cigar; ++k)
|
||||
mm_sprintf_lite(s, ",%u", r->p->cigar[k]);
|
||||
if (clip_len[1]) mm_sprintf_lite(s, ",%u", clip_len[1]<<4|clip_char);
|
||||
} else {
|
||||
int clip_char = (((sam_flag&0x800) || ((sam_flag&0x100) && (opt_flag&MM_F_SECONDARY_SEQ))) &&
|
||||
!(opt_flag&MM_F_SOFTCLIP)) ? 'H' : 'S';
|
||||
assert(clip_len[0] < qlen && clip_len[1] < qlen);
|
||||
if (clip_len[0]) mm_sprintf_lite(s, "%d%c", clip_len[0], clip_char);
|
||||
for (k = 0; k < r->p->n_cigar; ++k)
|
||||
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, MM_CIGAR_STR[r->p->cigar[k]&0xf]);
|
||||
if (clip_len[1]) mm_sprintf_lite(s, "%d%c", clip_len[1], clip_char);
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
void mm_write_sam3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regss, const mm_reg1_t *const* regss, void *km, int64_t opt_flag, int rep_len)
|
||||
{
|
||||
const int max_bam_cigar_op = 65535;
|
||||
int flag, n_regs = n_regss[seg_idx], cigar_in_tag = 0;
|
||||
int this_rid = -1, this_pos = -1;
|
||||
const mm_reg1_t *regs = regss[seg_idx], *r_prev = NULL, *r_next;
|
||||
const mm_reg1_t *r = n_regs > 0 && reg_idx < n_regs && reg_idx >= 0? ®s[reg_idx] : NULL;
|
||||
|
||||
// find the primary of the previous and the next segments, if they are mapped
|
||||
if (n_seg > 1) {
|
||||
int i, next_sid = (seg_idx + 1) % n_seg;
|
||||
r_next = get_sam_pri(n_regss[next_sid], regss[next_sid]);
|
||||
if (n_seg > 2) {
|
||||
for (i = 1; i <= n_seg - 1; ++i) {
|
||||
int prev_sid = (seg_idx + n_seg - i) % n_seg;
|
||||
if (n_regss[prev_sid] > 0) {
|
||||
r_prev = get_sam_pri(n_regss[prev_sid], regss[prev_sid]);
|
||||
break;
|
||||
}
|
||||
}
|
||||
} else r_prev = r_next;
|
||||
} else r_prev = r_next = NULL;
|
||||
|
||||
// write QNAME
|
||||
s->l = 0;
|
||||
mm_sprintf_lite(s, "%s", t->name);
|
||||
if (n_seg > 1) s->l = mm_qname_len(t->name); // trim the suffix like /1 or /2
|
||||
|
||||
// write flag
|
||||
flag = n_seg > 1? 0x1 : 0x0;
|
||||
if (r == 0) {
|
||||
flag |= 0x4;
|
||||
} else {
|
||||
if (r->rev) flag |= 0x10;
|
||||
if (r->parent != r->id) flag |= 0x100;
|
||||
else if (!r->sam_pri) flag |= 0x800;
|
||||
}
|
||||
if (n_seg > 1) {
|
||||
if (r && r->proper_frag) flag |= 0x2; // TODO: this doesn't work when there are more than 2 segments
|
||||
if (seg_idx == 0) flag |= 0x40;
|
||||
else if (seg_idx == n_seg - 1) flag |= 0x80;
|
||||
if (r_next == NULL) flag |= 0x8;
|
||||
else if (r_next->rev) flag |= 0x20;
|
||||
}
|
||||
mm_sprintf_lite(s, "\t%d", flag);
|
||||
|
||||
// write coordinate, MAPQ and CIGAR
|
||||
if (r == 0) {
|
||||
if (r_prev) {
|
||||
this_rid = r_prev->rid, this_pos = r_prev->rs;
|
||||
mm_sprintf_lite(s, "\t%s\t%d\t0\t*", mi->seq[this_rid].name, this_pos+1);
|
||||
} else mm_sprintf_lite(s, "\t*\t0\t0\t*");
|
||||
} else {
|
||||
this_rid = r->rid, this_pos = r->rs;
|
||||
mm_sprintf_lite(s, "\t%s\t%d\t%d\t", mi->seq[r->rid].name, r->rs+1, r->mapq);
|
||||
if ((opt_flag & MM_F_LONG_CIGAR) && r->p && r->p->n_cigar > max_bam_cigar_op - 2) {
|
||||
int n_cigar = r->p->n_cigar;
|
||||
if (r->qs != 0) ++n_cigar;
|
||||
if (r->qe != t->l_seq) ++n_cigar;
|
||||
if (n_cigar > max_bam_cigar_op)
|
||||
cigar_in_tag = 1;
|
||||
}
|
||||
if (cigar_in_tag) {
|
||||
int slen;
|
||||
if ((flag & 0x900) == 0 || (opt_flag & MM_F_SOFTCLIP)) slen = t->l_seq;
|
||||
else if ((flag & 0x100) && !(opt_flag & MM_F_SECONDARY_SEQ)) slen = 0;
|
||||
else slen = r->qe - r->qs;
|
||||
mm_sprintf_lite(s, "%dS%dN", slen, r->re - r->rs);
|
||||
} else write_sam_cigar(s, flag, 0, t->l_seq, r, opt_flag);
|
||||
}
|
||||
|
||||
// write mate positions
|
||||
if (n_seg > 1) {
|
||||
int tlen = 0;
|
||||
if (this_rid >= 0 && r_next) {
|
||||
if (this_rid == r_next->rid) {
|
||||
if (r) {
|
||||
int this_pos5 = r->rev? r->re - 1 : this_pos;
|
||||
int next_pos5 = r_next->rev? r_next->re - 1 : r_next->rs;
|
||||
tlen = next_pos5 - this_pos5;
|
||||
}
|
||||
mm_sprintf_lite(s, "\t=\t");
|
||||
} else mm_sprintf_lite(s, "\t%s\t", mi->seq[r_next->rid].name);
|
||||
mm_sprintf_lite(s, "%d\t", r_next->rs + 1);
|
||||
} else if (r_next) { // && this_rid < 0
|
||||
mm_sprintf_lite(s, "\t%s\t%d\t", mi->seq[r_next->rid].name, r_next->rs + 1);
|
||||
} else if (this_rid >= 0) { // && r_next == NULL
|
||||
mm_sprintf_lite(s, "\t=\t%d\t", this_pos + 1); // next segment will take r's coordinate
|
||||
} else mm_sprintf_lite(s, "\t*\t0\t"); // neither has coordinates
|
||||
if (tlen > 0) ++tlen;
|
||||
else if (tlen < 0) --tlen;
|
||||
mm_sprintf_lite(s, "%d\t", tlen);
|
||||
} else mm_sprintf_lite(s, "\t*\t0\t0\t");
|
||||
|
||||
// write SEQ and QUAL
|
||||
if (r == 0) {
|
||||
mm_sprintf_lite(s, "%s\t4\t*\t0\t0\t*\t*\t0\t0\t", t->name);
|
||||
sam_write_sq(s, t->seq, t->l_seq, 0, 0);
|
||||
mm_sprintf_lite(s, "\t");
|
||||
if (t->qual) sam_write_sq(s, t->qual, t->l_seq, 0, 0);
|
||||
else mm_sprintf_lite(s, "*");
|
||||
} else {
|
||||
if (r->rev) flag |= 0x10;
|
||||
if (r->parent != r->id) flag |= 0x100;
|
||||
else if (!r->sam_pri) flag |= 0x800;
|
||||
mm_sprintf_lite(s, "%s\t%d\t%s\t%d\t%d\t", t->name, flag, mi->seq[r->rid].name, r->rs+1, r->mapq);
|
||||
if (r->p) { // actually this should always be true for SAM output
|
||||
uint32_t k, clip_len = r->rev? t->l_seq - r->qe : r->qs;
|
||||
int clip_char = (flag&0x800)? 'H' : 'S';
|
||||
if (clip_len) mm_sprintf_lite(s, "%d%c", clip_len, clip_char);
|
||||
for (k = 0; k < r->p->n_cigar; ++k)
|
||||
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDN"[r->p->cigar[k]&0xf]);
|
||||
clip_len = r->rev? r->qs : t->l_seq - r->qe;
|
||||
if (clip_len) mm_sprintf_lite(s, "%d%c", clip_len, clip_char);
|
||||
} else mm_sprintf_lite(s, "*");
|
||||
mm_sprintf_lite(s, "\t*\t0\t0\t");
|
||||
if ((flag & 0x900) == 0) {
|
||||
if ((flag & 0x900) == 0 || (opt_flag & MM_F_SOFTCLIP)) {
|
||||
sam_write_sq(s, t->seq, t->l_seq, r->rev, r->rev);
|
||||
mm_sprintf_lite(s, "\t");
|
||||
if (t->qual) sam_write_sq(s, t->qual, t->l_seq, r->rev, 0);
|
||||
else mm_sprintf_lite(s, "*");
|
||||
} else if (flag & 0x100) {
|
||||
} else if ((flag & 0x100) && !(opt_flag & MM_F_SECONDARY_SEQ)){
|
||||
mm_sprintf_lite(s, "*\t*");
|
||||
} else {
|
||||
sam_write_sq(s, t->seq + r->qs, r->qe - r->qs, r->rev, r->rev);
|
||||
@@ -282,8 +623,13 @@ void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const m
|
||||
if (t->qual) sam_write_sq(s, t->qual + r->qs, r->qe - r->qs, r->rev, 0);
|
||||
else mm_sprintf_lite(s, "*");
|
||||
}
|
||||
write_tags(s, r);
|
||||
}
|
||||
|
||||
// write tags
|
||||
if (mm_rg_id[0]) mm_sprintf_lite(s, "\tRG:Z:%s", mm_rg_id);
|
||||
if (n_seg > 2) mm_sprintf_lite(s, "\tFI:i:%d", seg_idx);
|
||||
if (r) {
|
||||
write_tags(s, r);
|
||||
if (r->parent == r->id && r->p && n_regs > 1 && regs && r >= regs && r - regs < n_regs) { // supplementary aln may exist
|
||||
int i, n_sa = 0; // n_sa: number of SA fields
|
||||
for (i = 0; i < n_regs; ++i)
|
||||
@@ -305,10 +651,32 @@ void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const m
|
||||
if (l_I) mm_sprintf_lite(s, "%dI", l_I);
|
||||
if (l_D) mm_sprintf_lite(s, "%dD", l_D);
|
||||
if (clip3) mm_sprintf_lite(s, "%dS", clip3);
|
||||
mm_sprintf_lite(s, ",%d,%d;", q->mapq, q->p->n_diff);
|
||||
mm_sprintf_lite(s, ",%d,%d;", q->mapq, q->blen - q->mlen + q->p->n_ambi);
|
||||
}
|
||||
}
|
||||
}
|
||||
if (r->p && (opt_flag & (MM_F_OUT_CS|MM_F_OUT_DS|MM_F_OUT_MD)))
|
||||
write_cs_ds_or_MD(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG), opt_flag&MM_F_OUT_MD, !!(opt_flag&MM_F_OUT_DS), 1, 0);
|
||||
if (cigar_in_tag)
|
||||
write_sam_cigar(s, flag, 1, t->l_seq, r, opt_flag);
|
||||
}
|
||||
if (rep_len >= 0) mm_sprintf_lite(s, "\trl:i:%d", rep_len);
|
||||
|
||||
if ((opt_flag & MM_F_COPY_COMMENT) && t->comment)
|
||||
mm_sprintf_lite(s, "\t%s", t->comment);
|
||||
|
||||
s->s[s->l] = 0; // we always have room for an extra byte (see str_enlarge)
|
||||
}
|
||||
|
||||
void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regss, const mm_reg1_t *const* regss, void *km, int64_t opt_flag)
|
||||
{
|
||||
mm_write_sam3(s, mi, t, seg_idx, reg_idx, n_seg, n_regss, regss, km, opt_flag, -1);
|
||||
}
|
||||
|
||||
void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int n_regs, const mm_reg1_t *regs)
|
||||
{
|
||||
int i;
|
||||
for (i = 0; i < n_regs; ++i)
|
||||
if (r == ®s[i]) break;
|
||||
mm_write_sam2(s, mi, t, 0, i, 1, &n_regs, ®s, NULL, 0);
|
||||
}
|
||||
|
||||
@@ -1,216 +0,0 @@
|
||||
#include <stddef.h>
|
||||
#include <stdio.h>
|
||||
#include <string.h>
|
||||
#include "getopt.h"
|
||||
|
||||
char *optarg;
|
||||
int optind=1, opterr=1, optopt, __optpos, optreset=0;
|
||||
|
||||
#define optpos __optpos
|
||||
|
||||
static void __getopt_msg(const char *a, const char *b, const char *c, size_t l)
|
||||
{
|
||||
FILE *f = stderr;
|
||||
#if !defined(WIN32) && !defined(_WIN32)
|
||||
flockfile(f);
|
||||
#endif
|
||||
fputs(a, f);
|
||||
fwrite(b, strlen(b), 1, f);
|
||||
fwrite(c, 1, l, f);
|
||||
fputc('\n', f);
|
||||
#if !defined(WIN32) && !defined(_WIN32)
|
||||
funlockfile(f);
|
||||
#endif
|
||||
}
|
||||
|
||||
int getopt(int argc, char * const argv[], const char *optstring)
|
||||
{
|
||||
int i, c, d;
|
||||
int k, l;
|
||||
char *optchar;
|
||||
|
||||
if (!optind || optreset) {
|
||||
optreset = 0;
|
||||
__optpos = 0;
|
||||
optind = 1;
|
||||
}
|
||||
|
||||
if (optind >= argc || !argv[optind])
|
||||
return -1;
|
||||
|
||||
if (argv[optind][0] != '-') {
|
||||
if (optstring[0] == '-') {
|
||||
optarg = argv[optind++];
|
||||
return 1;
|
||||
}
|
||||
return -1;
|
||||
}
|
||||
|
||||
if (!argv[optind][1])
|
||||
return -1;
|
||||
|
||||
if (argv[optind][1] == '-' && !argv[optind][2])
|
||||
return optind++, -1;
|
||||
|
||||
if (!optpos) optpos++;
|
||||
c = argv[optind][optpos], k = 1;
|
||||
optchar = argv[optind]+optpos;
|
||||
optopt = c;
|
||||
optpos += k;
|
||||
|
||||
if (!argv[optind][optpos]) {
|
||||
optind++;
|
||||
optpos = 0;
|
||||
}
|
||||
|
||||
if (optstring[0] == '-' || optstring[0] == '+')
|
||||
optstring++;
|
||||
|
||||
i = 0;
|
||||
d = 0;
|
||||
do {
|
||||
d = optstring[i], l = 1;
|
||||
if (l>0) i+=l; else i++;
|
||||
} while (l && d != c);
|
||||
|
||||
if (d != c) {
|
||||
if (optstring[0] != ':' && opterr)
|
||||
__getopt_msg(argv[0], ": unrecognized option: ", optchar, k);
|
||||
return '?';
|
||||
}
|
||||
if (optstring[i] == ':') {
|
||||
if (optstring[i+1] == ':') optarg = 0;
|
||||
else if (optind >= argc) {
|
||||
if (optstring[0] == ':') return ':';
|
||||
if (opterr) __getopt_msg(argv[0],
|
||||
": option requires an argument: ",
|
||||
optchar, k);
|
||||
return '?';
|
||||
}
|
||||
if (optstring[i+1] != ':' || optpos) {
|
||||
optarg = argv[optind++] + optpos;
|
||||
optpos = 0;
|
||||
}
|
||||
}
|
||||
return c;
|
||||
}
|
||||
|
||||
static void permute(char *const *argv, int dest, int src)
|
||||
{
|
||||
char **av = (char **)argv;
|
||||
char *tmp = av[src];
|
||||
int i;
|
||||
for (i=src; i>dest; i--)
|
||||
av[i] = av[i-1];
|
||||
av[dest] = tmp;
|
||||
}
|
||||
|
||||
static int __getopt_long_core(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx, int longonly)
|
||||
{
|
||||
optarg = 0;
|
||||
if (longopts && argv[optind][0] == '-' &&
|
||||
((longonly && argv[optind][1] && argv[optind][1] != '-') ||
|
||||
(argv[optind][1] == '-' && argv[optind][2])))
|
||||
{
|
||||
int colon = optstring[optstring[0]=='+'||optstring[0]=='-']==':';
|
||||
int i, cnt, match = -1;
|
||||
char *opt;
|
||||
for (cnt=i=0; longopts[i].name; i++) {
|
||||
const char *name = longopts[i].name;
|
||||
opt = argv[optind]+1;
|
||||
if (*opt == '-') opt++;
|
||||
for (; *name && *name == *opt; name++, opt++);
|
||||
if (*opt && *opt != '=') continue;
|
||||
match = i;
|
||||
if (!*name) {
|
||||
cnt = 1;
|
||||
break;
|
||||
}
|
||||
cnt++;
|
||||
}
|
||||
if (cnt==1) {
|
||||
i = match;
|
||||
optind++;
|
||||
optopt = longopts[i].val;
|
||||
if (*opt == '=') {
|
||||
if (!longopts[i].has_arg) {
|
||||
if (colon || !opterr)
|
||||
return '?';
|
||||
__getopt_msg(argv[0],
|
||||
": option does not take an argument: ",
|
||||
longopts[i].name,
|
||||
strlen(longopts[i].name));
|
||||
return '?';
|
||||
}
|
||||
optarg = opt+1;
|
||||
} else if (longopts[i].has_arg == required_argument) {
|
||||
if (!(optarg = argv[optind])) {
|
||||
if (colon) return ':';
|
||||
if (!opterr) return '?';
|
||||
__getopt_msg(argv[0],
|
||||
": option requires an argument: ",
|
||||
longopts[i].name,
|
||||
strlen(longopts[i].name));
|
||||
return '?';
|
||||
}
|
||||
optind++;
|
||||
}
|
||||
if (idx) *idx = i;
|
||||
if (longopts[i].flag) {
|
||||
*longopts[i].flag = longopts[i].val;
|
||||
return 0;
|
||||
}
|
||||
return longopts[i].val;
|
||||
}
|
||||
if (argv[optind][1] == '-') {
|
||||
if (!colon && opterr)
|
||||
__getopt_msg(argv[0], cnt ?
|
||||
": option is ambiguous: " :
|
||||
": unrecognized option: ",
|
||||
argv[optind]+2,
|
||||
strlen(argv[optind]+2));
|
||||
optind++;
|
||||
return '?';
|
||||
}
|
||||
}
|
||||
return getopt(argc, argv, optstring);
|
||||
}
|
||||
|
||||
static int __getopt_long(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx, int longonly)
|
||||
{
|
||||
int ret, skipped, resumed;
|
||||
if (!optind || optreset) {
|
||||
optreset = 0;
|
||||
__optpos = 0;
|
||||
optind = 1;
|
||||
}
|
||||
if (optind >= argc || !argv[optind]) return -1;
|
||||
skipped = optind;
|
||||
if (optstring[0] != '+' && optstring[0] != '-') {
|
||||
int i;
|
||||
for (i=optind; ; i++) {
|
||||
if (i >= argc || !argv[i]) return -1;
|
||||
if (argv[i][0] == '-' && argv[i][1]) break;
|
||||
}
|
||||
optind = i;
|
||||
}
|
||||
resumed = optind;
|
||||
ret = __getopt_long_core(argc, argv, optstring, longopts, idx, longonly);
|
||||
if (resumed > skipped) {
|
||||
int i, cnt = optind-resumed;
|
||||
for (i=0; i<cnt; i++)
|
||||
permute(argv, skipped, optind-1);
|
||||
optind = skipped + cnt;
|
||||
}
|
||||
return ret;
|
||||
}
|
||||
|
||||
int getopt_long(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx)
|
||||
{
|
||||
return __getopt_long(argc, argv, optstring, longopts, idx, 0);
|
||||
}
|
||||
|
||||
int getopt_long_only(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx)
|
||||
{
|
||||
return __getopt_long(argc, argv, optstring, longopts, idx, 1);
|
||||
}
|
||||
@@ -1,53 +0,0 @@
|
||||
/*
|
||||
Copyright 2005-2014 Rich Felker, et al.
|
||||
|
||||
Permission is hereby granted, free of charge, to any person obtaining
|
||||
a copy of this software and associated documentation files (the
|
||||
"Software"), to deal in the Software without restriction, including
|
||||
without limitation the rights to use, copy, modify, merge, publish,
|
||||
distribute, sublicense, and/or sell copies of the Software, and to
|
||||
permit persons to whom the Software is furnished to do so, subject to
|
||||
the following conditions:
|
||||
|
||||
The above copyright notice and this permission notice shall be
|
||||
included in all copies or substantial portions of the Software.
|
||||
|
||||
THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
|
||||
EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
|
||||
MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT.
|
||||
IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY
|
||||
CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT,
|
||||
TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE
|
||||
SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
|
||||
*/
|
||||
|
||||
#ifndef _GETOPT_H
|
||||
#define _GETOPT_H
|
||||
|
||||
#ifdef __cplusplus
|
||||
extern "C" {
|
||||
#endif
|
||||
|
||||
int getopt(int, char * const [], const char *);
|
||||
extern char *optarg;
|
||||
extern int optind, opterr, optopt, optreset;
|
||||
|
||||
struct option {
|
||||
const char *name;
|
||||
int has_arg;
|
||||
int *flag;
|
||||
int val;
|
||||
};
|
||||
|
||||
int getopt_long(int, char *const *, const char *, const struct option *, int *);
|
||||
int getopt_long_only(int, char *const *, const char *, const struct option *, int *);
|
||||
|
||||
#define no_argument 0
|
||||
#define required_argument 1
|
||||
#define optional_argument 2
|
||||
|
||||
#ifdef __cplusplus
|
||||
}
|
||||
#endif
|
||||
|
||||
#endif
|
||||
@@ -1,31 +1,33 @@
|
||||
#include <string.h>
|
||||
#include <stdlib.h>
|
||||
#include <math.h>
|
||||
#include "mmpriv.h"
|
||||
#include "kalloc.h"
|
||||
#include "khash.h"
|
||||
|
||||
static inline void mm_cal_fuzzy_len(mm_reg1_t *r, const mm128_t *a)
|
||||
{
|
||||
int i;
|
||||
r->fuzzy_mlen = r->fuzzy_blen = 0;
|
||||
r->mlen = r->blen = 0;
|
||||
if (r->cnt <= 0) return;
|
||||
r->fuzzy_mlen = r->fuzzy_blen = a[r->as].y>>32&0xff;
|
||||
r->mlen = r->blen = a[r->as].y>>32&0xff;
|
||||
for (i = r->as + 1; i < r->as + r->cnt; ++i) {
|
||||
int span = a[i].y>>32&0xff;
|
||||
int tl = (int32_t)a[i].x - (int32_t)a[i-1].x;
|
||||
int ql = (int32_t)a[i].y - (int32_t)a[i-1].y;
|
||||
r->fuzzy_blen += tl > ql? tl : ql;
|
||||
r->fuzzy_mlen += tl > span && ql > span? span : tl < ql? tl : ql;
|
||||
r->blen += tl > ql? tl : ql;
|
||||
r->mlen += tl > span && ql > span? span : tl < ql? tl : ql;
|
||||
}
|
||||
}
|
||||
|
||||
static inline void mm_reg_set_coor(mm_reg1_t *r, int32_t qlen, const mm128_t *a)
|
||||
static inline void mm_reg_set_coor(mm_reg1_t *r, int32_t qlen, const mm128_t *a, int is_qstrand)
|
||||
{ // NB: r->as and r->cnt MUST BE set correctly for this function to work
|
||||
int32_t k = r->as, q_span = (int32_t)(a[k].y>>32&0xff);
|
||||
r->rev = a[k].x>>63;
|
||||
r->rid = a[k].x<<1>>33;
|
||||
r->rs = (int32_t)a[k].x + 1 > q_span? (int32_t)a[k].x + 1 - q_span : 0; // NB: target span may be shorter, so this test is necessary
|
||||
r->re = (int32_t)a[k + r->cnt - 1].x + 1;
|
||||
if (!r->rev) {
|
||||
if (!r->rev || is_qstrand) {
|
||||
r->qs = (int32_t)a[k].y + 1 - q_span;
|
||||
r->qe = (int32_t)a[k + r->cnt - 1].y + 1;
|
||||
} else {
|
||||
@@ -35,18 +37,32 @@ static inline void mm_reg_set_coor(mm_reg1_t *r, int32_t qlen, const mm128_t *a)
|
||||
mm_cal_fuzzy_len(r, a);
|
||||
}
|
||||
|
||||
mm_reg1_t *mm_gen_regs(void *km, int qlen, int n_u, uint64_t *u, mm128_t *a) // convert chains to hits
|
||||
static inline uint64_t hash64(uint64_t key)
|
||||
{
|
||||
key = (~key + (key << 21));
|
||||
key = key ^ key >> 24;
|
||||
key = ((key + (key << 3)) + (key << 8));
|
||||
key = key ^ key >> 14;
|
||||
key = ((key + (key << 2)) + (key << 4));
|
||||
key = key ^ key >> 28;
|
||||
key = (key + (key << 31));
|
||||
return key;
|
||||
}
|
||||
|
||||
mm_reg1_t *mm_gen_regs(void *km, uint32_t hash, int qlen, int n_u, uint64_t *u, mm128_t *a, int is_qstrand) // convert chains to hits
|
||||
{
|
||||
mm128_t *z, tmp;
|
||||
mm_reg1_t *r;
|
||||
int i, k;
|
||||
|
||||
if (n_u == 0) return 0;
|
||||
if (n_u <= 0) return 0;
|
||||
|
||||
// sort by score
|
||||
z = (mm128_t*)kmalloc(km, n_u * 16);
|
||||
for (i = k = 0; i < n_u; ++i) {
|
||||
z[i].x = u[i] >> 32;
|
||||
uint32_t h;
|
||||
h = (uint32_t)hash64((hash64(a[k].x) + hash64(a[k].y)) ^ hash);
|
||||
z[i].x = u[i] ^ h; // u[i] -- higher 32 bits: chain score; lower 32 bits: number of seeds in the chain
|
||||
z[i].y = (uint64_t)k << 32 | (int32_t)u[i];
|
||||
k += (int32_t)u[i];
|
||||
}
|
||||
@@ -60,87 +76,141 @@ mm_reg1_t *mm_gen_regs(void *km, int qlen, int n_u, uint64_t *u, mm128_t *a) //
|
||||
mm_reg1_t *ri = &r[i];
|
||||
ri->id = i;
|
||||
ri->parent = MM_PARENT_UNSET;
|
||||
ri->score = z[i].x;
|
||||
ri->score = ri->score0 = z[i].x >> 32;
|
||||
ri->hash = (uint32_t)z[i].x;
|
||||
ri->cnt = (int32_t)z[i].y;
|
||||
ri->as = z[i].y >> 32;
|
||||
mm_reg_set_coor(ri, qlen, a);
|
||||
ri->div = -1.0f;
|
||||
mm_reg_set_coor(ri, qlen, a, is_qstrand);
|
||||
}
|
||||
kfree(km, z);
|
||||
return r;
|
||||
}
|
||||
|
||||
void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a)
|
||||
void mm_mark_alt(const mm_idx_t *mi, int n, mm_reg1_t *r)
|
||||
{
|
||||
int i;
|
||||
if (mi->n_alt == 0) return;
|
||||
for (i = 0; i < n; ++i)
|
||||
if (mi->seq[r[i].rid].is_alt)
|
||||
r[i].is_alt = 1;
|
||||
}
|
||||
|
||||
static inline int mm_alt_score(int score, float alt_diff_frac)
|
||||
{
|
||||
if (score < 0) return score;
|
||||
score = (int)(score * (1.0 - alt_diff_frac) + .499);
|
||||
return score > 0? score : 1;
|
||||
}
|
||||
|
||||
void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a, int is_qstrand)
|
||||
{
|
||||
if (n <= 0 || n >= r->cnt) return;
|
||||
*r2 = *r;
|
||||
r2->id = -1;
|
||||
r2->sam_pri = 0;
|
||||
r2->p = 0;
|
||||
r2->split_inv = 0;
|
||||
r2->cnt = r->cnt - n;
|
||||
r2->score = (int32_t)(r->score * ((float)r2->cnt / r->cnt) + .499);
|
||||
r2->as = r->as + n;
|
||||
if (r->parent == r->id) r2->parent = MM_PARENT_TMP_PRI;
|
||||
mm_reg_set_coor(r2, qlen, a);
|
||||
mm_reg_set_coor(r2, qlen, a, is_qstrand);
|
||||
r->cnt -= r2->cnt;
|
||||
r->score -= r2->score;
|
||||
mm_reg_set_coor(r, qlen, a);
|
||||
mm_reg_set_coor(r, qlen, a, is_qstrand);
|
||||
r->split |= 1, r2->split |= 2;
|
||||
}
|
||||
|
||||
void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r, int sub_diff) // and compute mm_reg1_t::subsc
|
||||
void mm_set_parent(void *km, float mask_level, int mask_len, int n, mm_reg1_t *r, int sub_diff, int hard_mask_level, float alt_diff_frac) // and compute mm_reg1_t::subsc
|
||||
{
|
||||
int i, j, k, *w;
|
||||
uint64_t *cov;
|
||||
if (n <= 0) return;
|
||||
for (i = 0; i < n; ++i) r[i].id = i;
|
||||
cov = (uint64_t*)kmalloc(km, n * sizeof(uint64_t));
|
||||
w = (int*)kmalloc(km, n * sizeof(int));
|
||||
w[0] = 0, r[0].parent = 0;
|
||||
for (i = 1, k = 1; i < n; ++i) {
|
||||
mm_reg1_t *ri = &r[i];
|
||||
int si = ri->qs, ei = ri->qe;
|
||||
for (j = 0; j < k; ++j) {
|
||||
int si = ri->qs, ei = ri->qe, n_cov = 0, uncov_len = 0;
|
||||
if (hard_mask_level) goto skip_uncov;
|
||||
for (j = 0; j < k; ++j) { // traverse existing primary hits to find overlapping hits
|
||||
mm_reg1_t *rp = &r[w[j]];
|
||||
int sj = rp->qs, ej = rp->qe;
|
||||
int min = ej - sj < ei - si? ej - sj : ei - si;
|
||||
int ol = si < sj? (ei < sj? 0 : ei < ej? ei - sj : ej - sj) : (ej < si? 0 : ej < ei? ej - si : ei - si);
|
||||
if (ol > mask_level * min) {
|
||||
int cnt_sub = 0;
|
||||
if (ej <= si || sj >= ei) continue;
|
||||
if (sj < si) sj = si;
|
||||
if (ej > ei) ej = ei;
|
||||
cov[n_cov++] = (uint64_t)sj<<32 | ej;
|
||||
}
|
||||
if (n_cov == 0) {
|
||||
goto set_parent_test; // no overlapping primary hits; then i is a new primary hit
|
||||
} else if (n_cov > 0) { // there are overlapping primary hits; find the length not covered by existing primary hits
|
||||
int j, x = si;
|
||||
radix_sort_64(cov, cov + n_cov);
|
||||
for (j = 0; j < n_cov; ++j) {
|
||||
if ((int)(cov[j]>>32) > x) uncov_len += (cov[j]>>32) - x;
|
||||
x = (int32_t)cov[j] > x? (int32_t)cov[j] : x;
|
||||
}
|
||||
if (ei > x) uncov_len += ei - x;
|
||||
}
|
||||
skip_uncov:
|
||||
for (j = 0; j < k; ++j) { // traverse existing primary hits again
|
||||
mm_reg1_t *rp = &r[w[j]];
|
||||
int sj = rp->qs, ej = rp->qe, min, max, ol;
|
||||
if (ej <= si || sj >= ei) continue; // no overlap
|
||||
min = ej - sj < ei - si? ej - sj : ei - si;
|
||||
max = ej - sj > ei - si? ej - sj : ei - si;
|
||||
ol = si < sj? (ei < sj? 0 : ei < ej? ei - sj : ej - sj) : (ej < si? 0 : ej < ei? ej - si : ei - si); // overlap length; TODO: this can be simplified
|
||||
if ((float)ol / min - (float)uncov_len / max > mask_level && uncov_len <= mask_len) { // then this is a secondary hit
|
||||
int cnt_sub = 0, sci = ri->score;
|
||||
ri->parent = rp->parent;
|
||||
rp->subsc = rp->subsc > ri->score? rp->subsc : ri->score;
|
||||
if (!rp->is_alt && ri->is_alt) sci = mm_alt_score(sci, alt_diff_frac);
|
||||
rp->subsc = rp->subsc > sci? rp->subsc : sci;
|
||||
if (ri->cnt >= rp->cnt) cnt_sub = 1;
|
||||
if (rp->p && ri->p) {
|
||||
rp->p->dp_max2 = rp->p->dp_max2 > ri->p->dp_max? rp->p->dp_max2 : ri->p->dp_max;
|
||||
if (rp->p && ri->p && (rp->rid != ri->rid || rp->rs != ri->rs || rp->re != ri->re || ol != min)) { // the last condition excludes identical hits after DP
|
||||
sci = ri->p->dp_max;
|
||||
if (!rp->is_alt && ri->is_alt) sci = mm_alt_score(sci, alt_diff_frac);
|
||||
rp->p->dp_max2 = rp->p->dp_max2 > sci? rp->p->dp_max2 : sci;
|
||||
if (rp->p->dp_max - ri->p->dp_max <= sub_diff) cnt_sub = 1;
|
||||
}
|
||||
if (cnt_sub) ++rp->n_sub;
|
||||
break;
|
||||
}
|
||||
}
|
||||
set_parent_test:
|
||||
if (j == k) w[k++] = i, ri->parent = i, ri->n_sub = 0;
|
||||
}
|
||||
kfree(km, cov);
|
||||
kfree(km, w);
|
||||
}
|
||||
|
||||
void mm_hit_sort_by_dp(void *km, int *n_regs, mm_reg1_t *r)
|
||||
void mm_hit_sort(void *km, int *n_regs, mm_reg1_t *r, float alt_diff_frac)
|
||||
{
|
||||
int32_t i, n_aux, n = *n_regs;
|
||||
uint64_t *aux;
|
||||
int32_t i, n_aux, n = *n_regs, has_cigar = 0, no_cigar = 0;
|
||||
mm128_t *aux;
|
||||
mm_reg1_t *t;
|
||||
|
||||
if (n <= 1) return;
|
||||
aux = (uint64_t*)kmalloc(km, n * 8);
|
||||
aux = (mm128_t*)kmalloc(km, n * 16);
|
||||
t = (mm_reg1_t*)kmalloc(km, n * sizeof(mm_reg1_t));
|
||||
for (i = n_aux = 0; i < n; ++i) {
|
||||
if (r[i].inv || r[i].cnt > 0) { // squeeze out elements with cnt==0 (soft deleted)
|
||||
assert(r[i].p);
|
||||
aux[n_aux++] = (uint64_t)r[i].p->dp_max << 32 | i;
|
||||
int score;
|
||||
if (r[i].p) score = r[i].p->dp_max, has_cigar = 1;
|
||||
else score = r[i].score, no_cigar = 1;
|
||||
if (r[i].is_alt) score = mm_alt_score(score, alt_diff_frac);
|
||||
aux[n_aux].x = (uint64_t)score << 32 | r[i].hash;
|
||||
aux[n_aux++].y = i;
|
||||
} else if (r[i].p) {
|
||||
free(r[i].p);
|
||||
r[i].p = 0;
|
||||
}
|
||||
}
|
||||
radix_sort_64(aux, aux + n_aux);
|
||||
assert(has_cigar + no_cigar == 1);
|
||||
radix_sort_128x(aux, aux + n_aux);
|
||||
for (i = n_aux - 1; i >= 0; --i)
|
||||
t[n_aux - 1 - i] = r[(int32_t)aux[i]];
|
||||
t[n_aux - 1 - i] = r[aux[i].y];
|
||||
memcpy(r, t, sizeof(mm_reg1_t) * n_aux);
|
||||
*n_regs = n_aux;
|
||||
kfree(km, aux);
|
||||
@@ -182,30 +252,52 @@ void mm_sync_regs(void *km, int n_regs, mm_reg1_t *regs) // keep mm_reg1_t::{id,
|
||||
mm_set_sam_pri(n_regs, regs);
|
||||
}
|
||||
|
||||
void mm_select_sub(void *km, float mask_level, float pri_ratio, int min_diff, int best_n, int *n_, mm_reg1_t *r)
|
||||
void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int check_strand, int min_strand_sc, int *n_, mm_reg1_t *r)
|
||||
{
|
||||
if (pri_ratio > 0.0f && *n_ > 0) {
|
||||
int i, k, n = *n_, n_2nd = 0;
|
||||
for (i = k = 0; i < n; ++i)
|
||||
if (r[i].parent == i) r[k++] = r[i];
|
||||
else if ((r[i].score >= r[r[i].parent].score * pri_ratio || r[i].score + min_diff >= r[r[i].parent].score) && n_2nd++ < best_n)
|
||||
for (i = k = 0; i < n; ++i) {
|
||||
int p = r[i].parent;
|
||||
if (p == i || r[i].inv) { // primary or inversion
|
||||
r[k++] = r[i];
|
||||
} else if ((r[i].score >= r[p].score * pri_ratio || r[i].score + min_diff >= r[p].score) && n_2nd < best_n) {
|
||||
if (!(r[i].qs == r[p].qs && r[i].qe == r[p].qe && r[i].rid == r[p].rid && r[i].rs == r[p].rs && r[i].re == r[p].re)) // not identical hits
|
||||
r[k++] = r[i], ++n_2nd;
|
||||
else if (r[i].p) free(r[i].p);
|
||||
} else if (check_strand && n_2nd < best_n && r[i].score > min_strand_sc && r[i].rev != r[p].rev) {
|
||||
r[i].strand_retained = 1;
|
||||
r[k++] = r[i], ++n_2nd;
|
||||
} else if (r[i].p) free(r[i].p);
|
||||
}
|
||||
if (k != n) mm_sync_regs(km, k, r); // removing hits requires sync()
|
||||
*n_ = k;
|
||||
}
|
||||
}
|
||||
|
||||
void mm_filter_regs(void *km, const mm_mapopt_t *opt, int *n_regs, mm_reg1_t *regs)
|
||||
int mm_filter_strand_retained(int n_regs, mm_reg1_t *r)
|
||||
{
|
||||
int i, k;
|
||||
for (i = k = 0; i < n_regs; ++i) {
|
||||
int p = r[i].parent;
|
||||
if (!r[i].strand_retained || r[i].div < r[p].div * 5.0f || r[i].div < 0.01f) {
|
||||
if (k < i) r[k++] = r[i];
|
||||
else ++k;
|
||||
}
|
||||
}
|
||||
return k;
|
||||
}
|
||||
|
||||
void mm_filter_regs(const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs)
|
||||
{ // NB: after this call, mm_reg1_t::parent can be -1 if its parent filtered out
|
||||
int i, k;
|
||||
for (i = k = 0; i < *n_regs; ++i) {
|
||||
mm_reg1_t *r = ®s[i];
|
||||
int flt = 0;
|
||||
if (!r->inv && r->cnt < opt->min_cnt) flt = 1;
|
||||
if (r->p) {
|
||||
if (r->p->blen - r->p->n_ambi - r->p->n_diff < opt->min_chain_score) flt = 1;
|
||||
if (!r->inv && !r->seg_split && r->cnt < opt->min_cnt) flt = 1;
|
||||
if (r->p) { // these filters are only applied when base-alignment is available
|
||||
if (r->mlen < opt->min_chain_score) flt = 1;
|
||||
else if (r->p->dp_max < opt->min_dp_max) flt = 1;
|
||||
else if (r->qs > qlen * opt->max_clip_ratio && qlen - r->qe > qlen * opt->max_clip_ratio) flt = 1;
|
||||
if (flt) free(r->p);
|
||||
}
|
||||
if (!flt) {
|
||||
@@ -236,90 +328,147 @@ int mm_squeeze_a(void *km, int n_regs, mm_reg1_t *regs, mm128_t *a)
|
||||
return as;
|
||||
}
|
||||
|
||||
void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs_, mm_reg1_t *regs, mm128_t *a)
|
||||
mm_seg_t *mm_seg_gen(void *km, uint32_t hash, int n_segs, const int *qlens, int n_regs0, const mm_reg1_t *regs0, int *n_regs, mm_reg1_t **regs, const mm128_t *a)
|
||||
{
|
||||
int i, n_aux, n_regs = *n_regs_, n_drop = 0;
|
||||
uint64_t *aux;
|
||||
int s, i, j, acc_qlen[MM_MAX_SEG+1], qlen_sum = 0;
|
||||
mm_seg_t *seg;
|
||||
|
||||
if (n_regs < 2) return; // nothing to join
|
||||
mm_squeeze_a(km, n_regs, regs, a);
|
||||
assert(n_segs <= MM_MAX_SEG);
|
||||
for (s = 1, acc_qlen[0] = 0; s < n_segs; ++s)
|
||||
acc_qlen[s] = acc_qlen[s-1] + qlens[s-1];
|
||||
qlen_sum = acc_qlen[n_segs - 1] + qlens[n_segs - 1];
|
||||
|
||||
aux = (uint64_t*)kmalloc(km, n_regs * 8);
|
||||
seg = (mm_seg_t*)kcalloc(km, n_segs, sizeof(mm_seg_t));
|
||||
for (s = 0; s < n_segs; ++s) {
|
||||
seg[s].u = (uint64_t*)kmalloc(km, n_regs0 * 8);
|
||||
for (i = 0; i < n_regs0; ++i)
|
||||
seg[s].u[i] = (uint64_t)regs0[i].score << 32;
|
||||
}
|
||||
for (i = 0; i < n_regs0; ++i) {
|
||||
const mm_reg1_t *r = ®s0[i];
|
||||
for (j = 0; j < r->cnt; ++j) {
|
||||
int sid = (a[r->as + j].y&MM_SEED_SEG_MASK)>>MM_SEED_SEG_SHIFT;
|
||||
++seg[sid].u[i];
|
||||
++seg[sid].n_a;
|
||||
}
|
||||
}
|
||||
for (s = 0; s < n_segs; ++s) {
|
||||
mm_seg_t *sr = &seg[s];
|
||||
for (i = 0, sr->n_u = 0; i < n_regs0; ++i) // squeeze out zero-length per-segment chains
|
||||
if ((int32_t)sr->u[i] != 0)
|
||||
sr->u[sr->n_u++] = sr->u[i];
|
||||
sr->a = (mm128_t*)kmalloc(km, sr->n_a * sizeof(mm128_t));
|
||||
sr->n_a = 0;
|
||||
}
|
||||
|
||||
for (i = 0; i < n_regs0; ++i) {
|
||||
const mm_reg1_t *r = ®s0[i];
|
||||
for (j = 0; j < r->cnt; ++j) {
|
||||
int sid = (a[r->as + j].y&MM_SEED_SEG_MASK)>>MM_SEED_SEG_SHIFT;
|
||||
mm128_t a1 = a[r->as + j];
|
||||
// on reverse strand, the segment position is:
|
||||
// x_for_cat = qlen_sum - 1 - (int32_t)a1.y - 1 + q_span
|
||||
// (int32_t)new_a1.y = qlens[sid] - (x_for_cat - acc_qlen[sid] + 1 - q_span) - 1 = (int32_t)a1.y - (qlen_sum - (qlens[sid] + acc_qlen[sid]))
|
||||
a1.y -= a1.x>>63? qlen_sum - (qlens[sid] + acc_qlen[sid]) : acc_qlen[sid];
|
||||
seg[sid].a[seg[sid].n_a++] = a1;
|
||||
}
|
||||
}
|
||||
for (s = 0; s < n_segs; ++s) {
|
||||
regs[s] = mm_gen_regs(km, hash, qlens[s], seg[s].n_u, seg[s].u, seg[s].a, 0);
|
||||
n_regs[s] = seg[s].n_u;
|
||||
for (i = 0; i < n_regs[s]; ++i) {
|
||||
regs[s][i].seg_split = 1;
|
||||
regs[s][i].seg_id = s;
|
||||
}
|
||||
}
|
||||
return seg;
|
||||
}
|
||||
|
||||
void mm_seg_free(void *km, int n_segs, mm_seg_t *segs)
|
||||
{
|
||||
int i;
|
||||
for (i = 0; i < n_segs; ++i) kfree(km, segs[i].u);
|
||||
for (i = 0; i < n_segs; ++i) kfree(km, segs[i].a);
|
||||
kfree(km, segs);
|
||||
}
|
||||
|
||||
static void mm_set_inv_mapq(void *km, int n_regs, mm_reg1_t *regs)
|
||||
{
|
||||
int i, n_aux;
|
||||
mm128_t *aux;
|
||||
if (n_regs < 3) return;
|
||||
for (i = 0; i < n_regs; ++i)
|
||||
if (regs[i].inv) break;
|
||||
if (i == n_regs) return; // no inversion hits
|
||||
|
||||
aux = (mm128_t*)kmalloc(km, n_regs * 16);
|
||||
for (i = n_aux = 0; i < n_regs; ++i)
|
||||
if (regs[i].parent == i || regs[i].parent < 0)
|
||||
aux[n_aux++] = (uint64_t)regs[i].as << 32 | i;
|
||||
radix_sort_64(aux, aux + n_aux);
|
||||
aux[n_aux].y = i, aux[n_aux++].x = (uint64_t)regs[i].rid << 32 | regs[i].rs;
|
||||
radix_sort_128x(aux, aux + n_aux);
|
||||
|
||||
for (i = n_aux - 1; i >= 1; --i) {
|
||||
mm_reg1_t *r0 = ®s[(int32_t)aux[i-1]], *r1 = ®s[(int32_t)aux[i]];
|
||||
mm128_t *a0e, *a1s;
|
||||
int max_gap, min_gap, sc_thres;
|
||||
|
||||
// test
|
||||
if (r0->as + r0->cnt != r1->as) continue; // not adjacent in a[]
|
||||
if (r0->rid != r1->rid || r0->rev != r1->rev) continue; // make sure on the same target and strand
|
||||
a0e = &a[r0->as + r0->cnt - 1];
|
||||
a1s = &a[r1->as];
|
||||
if (a1s->x <= a0e->x || (int32_t)a1s->y <= (int32_t)a0e->y) continue; // keep colinearity
|
||||
max_gap = min_gap = (int32_t)a1s->y - (int32_t)a0e->y;
|
||||
max_gap = max_gap > a1s->x - a0e->x? max_gap : a1s->x - a0e->x;
|
||||
min_gap = min_gap < a1s->x - a0e->x? min_gap : a1s->x - a0e->x;
|
||||
if (max_gap > opt->max_join_long || min_gap > opt->max_join_short) continue;
|
||||
sc_thres = (int)((float)opt->min_join_flank_sc / opt->max_join_long * max_gap + .499);
|
||||
if (r0->score < sc_thres || r1->score < sc_thres) continue; // require good flanking chains
|
||||
if (r0->re - r0->rs < max_gap>>1 || r0->qe - r0->qs < max_gap>>1) continue; // require enough flanking length
|
||||
if (r1->re - r1->rs < max_gap>>1 || r1->qe - r1->qs < max_gap>>1) continue;
|
||||
|
||||
// all conditions satisfied; join
|
||||
a[r1->as].y |= MM_SEED_LONG_JOIN;
|
||||
r0->cnt += r1->cnt, r0->score += r1->score;
|
||||
mm_reg_set_coor(r0, qlen, a);
|
||||
r1->cnt = 0;
|
||||
r1->parent = r0->id;
|
||||
++n_drop;
|
||||
for (i = 1; i < n_aux - 1; ++i) {
|
||||
mm_reg1_t *inv = ®s[aux[i].y];
|
||||
if (inv->inv) {
|
||||
mm_reg1_t *l = ®s[aux[i-1].y];
|
||||
mm_reg1_t *r = ®s[aux[i+1].y];
|
||||
inv->mapq = l->mapq < r->mapq? l->mapq : r->mapq;
|
||||
}
|
||||
}
|
||||
kfree(km, aux);
|
||||
|
||||
if (n_drop > 0) { // then fix the hits hierarchy
|
||||
for (i = 0; i < n_regs; ++i) { // adjust the mm_reg1_t::parent
|
||||
mm_reg1_t *r = ®s[i];
|
||||
if (r->parent >= 0 && r->id != r->parent) { // fix for secondary hits only
|
||||
if (regs[r->parent].parent >= 0 && regs[r->parent].parent != r->parent)
|
||||
r->parent = regs[r->parent].parent;
|
||||
}
|
||||
}
|
||||
mm_filter_regs(km, opt, n_regs_, regs);
|
||||
mm_sync_regs(km, *n_regs_, regs);
|
||||
}
|
||||
}
|
||||
|
||||
void mm_set_mapq(int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len)
|
||||
void mm_set_mapq2(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr, int is_splice)
|
||||
{
|
||||
static const float q_coef = 40.0f;
|
||||
int i;
|
||||
int64_t sum_sc = 0;
|
||||
float uniq_ratio;
|
||||
int i, n_2nd_splice = 0;
|
||||
if (n_regs == 0) return;
|
||||
for (i = 0; i < n_regs; ++i) {
|
||||
if (regs[i].parent == regs[i].id)
|
||||
sum_sc += regs[i].score;
|
||||
else if (regs[i].is_spliced)
|
||||
++n_2nd_splice;
|
||||
}
|
||||
uniq_ratio = (float)sum_sc / (sum_sc + rep_len);
|
||||
for (i = 0; i < n_regs; ++i) {
|
||||
mm_reg1_t *r = ®s[i];
|
||||
if (r->inv) {
|
||||
r->mapq = 0;
|
||||
} else if (r->parent == r->id) {
|
||||
int mapq, subsc;
|
||||
float pen_s1 = r->score > 100? 1.0f : 0.01f * r->score;
|
||||
float pen_s1 = (r->score > 100? 1.0f : 0.01f * r->score) * uniq_ratio;
|
||||
float pen_cm = r->cnt > 10? 1.0f : 0.1f * r->cnt;
|
||||
if (r->score <= 100 && rep_len > 0) {
|
||||
pen_s1 = 0.01f * (r->score - rep_len);
|
||||
pen_s1 = pen_s1 > 0.1f? pen_s1 : 0.1f;
|
||||
}
|
||||
pen_cm = pen_s1 < pen_cm? pen_s1 : pen_cm;
|
||||
subsc = r->subsc > min_chain_sc? r->subsc : min_chain_sc;
|
||||
if (r->p && r->p->dp_max2 > 0 && r->p->dp_max > 0) {
|
||||
float identity = (float)(r->p->blen - r->p->n_diff - r->p->n_ambi) / (r->p->blen - r->p->n_ambi);
|
||||
float x, identity = (float)r->mlen / r->blen;
|
||||
if (is_sr && is_splice)
|
||||
x = (float)r->p->dp_max2 / r->p->dp_max; // ignore chaining score; for short RNA-seq reads, unspliced chaining score tends to be higher
|
||||
else
|
||||
x = (float)r->p->dp_max2 * subsc / r->p->dp_max / r->score0;
|
||||
mapq = (int)(identity * pen_cm * q_coef * (1.0f - x * x) * logf((float)r->p->dp_max / match_sc));
|
||||
if (!is_sr) {
|
||||
int mapq_alt = (int)(6.02f * identity * identity * (r->p->dp_max - r->p->dp_max2) / match_sc + .499f); // BWA-MEM like mapQ, mostly for short reads
|
||||
mapq = (int)(identity * pen_cm * q_coef * (1. - (float)r->p->dp_max2 * subsc / r->p->dp_max / r->score) * logf(r->score)); // more for long reads
|
||||
mapq = mapq < mapq_alt? mapq : mapq_alt; // in case the long-read heuristic fails
|
||||
} else mapq = (int)(pen_cm * q_coef * (1. - (float)subsc / r->score) * logf(r->score));
|
||||
}
|
||||
if (is_splice && is_sr && r->is_spliced && n_2nd_splice == 0)
|
||||
mapq += 10;
|
||||
} else {
|
||||
float x = (float)subsc / r->score0;
|
||||
if (r->p) {
|
||||
float identity = (float)r->mlen / r->blen;
|
||||
mapq = (int)(identity * pen_cm * q_coef * (1.0f - x) * logf((float)r->p->dp_max / match_sc));
|
||||
} else {
|
||||
mapq = (int)(pen_cm * q_coef * (1.0f - x) * logf(r->score));
|
||||
}
|
||||
}
|
||||
mapq -= (int)(4.343f * logf(r->n_sub + 1) + .499f);
|
||||
mapq = mapq > 0? mapq : 0;
|
||||
r->mapq = mapq < 60? mapq : 60;
|
||||
if (r->p && r->p->dp_max > r->p->dp_max2 && r->mapq == 0) r->mapq = 1;
|
||||
} else r->mapq = 0;
|
||||
}
|
||||
mm_set_inv_mapq(km, n_regs, regs);
|
||||
}
|
||||
|
||||
@@ -7,10 +7,12 @@
|
||||
#endif
|
||||
#include <fcntl.h>
|
||||
#include <stdio.h>
|
||||
#define __STDC_LIMIT_MACROS
|
||||
#include "kthread.h"
|
||||
#include "bseq.h"
|
||||
#include "minimap.h"
|
||||
#include "mmpriv.h"
|
||||
#include "ksw2.h"
|
||||
#include "kvec.h"
|
||||
#include "khash.h"
|
||||
|
||||
@@ -19,6 +21,8 @@
|
||||
KHASH_INIT(idx, uint64_t, uint64_t, 1, idx_hash, idx_eq)
|
||||
typedef khash_t(idx) idxhash_t;
|
||||
|
||||
KHASH_MAP_INIT_STR(str, uint32_t)
|
||||
|
||||
#define kroundup64(x) (--(x), (x)|=(x)>>1, (x)|=(x)>>2, (x)|=(x)>>4, (x)|=(x)>>8, (x)|=(x)>>16, (x)|=(x)>>32, ++(x))
|
||||
|
||||
typedef struct mm_idx_bucket_s {
|
||||
@@ -28,22 +32,28 @@ typedef struct mm_idx_bucket_s {
|
||||
void *h; // hash table indexing _p_ and minimizers appearing once
|
||||
} mm_idx_bucket_t;
|
||||
|
||||
void mm_idxopt_init(mm_idxopt_t *opt)
|
||||
{
|
||||
memset(opt, 0, sizeof(mm_idxopt_t));
|
||||
opt->k = 15, opt->w = 10, opt->is_hpc = 0;
|
||||
opt->bucket_bits = 14;
|
||||
opt->mini_batch_size = 50000000;
|
||||
opt->batch_size = 4000000000ULL;
|
||||
}
|
||||
typedef struct {
|
||||
int32_t st, en, cnt;
|
||||
int32_t score:30, strand:2;
|
||||
} mm_idx_intv1_t;
|
||||
|
||||
mm_idx_t *mm_idx_init(int w, int k, int b, int is_hpc)
|
||||
typedef struct mm_idx_intv_s {
|
||||
int32_t n, m;
|
||||
mm_idx_intv1_t *a;
|
||||
} mm_idx_intv_t;
|
||||
|
||||
typedef struct mm_idx_jjump_s {
|
||||
int32_t n, m;
|
||||
mm_idx_jjump1_t *a;
|
||||
} mm_idx_jjump_t;
|
||||
|
||||
mm_idx_t *mm_idx_init(int w, int k, int b, int flag)
|
||||
{
|
||||
mm_idx_t *mi;
|
||||
if (k*2 < b) b = k * 2;
|
||||
if (w < 1) w = 1;
|
||||
mi = (mm_idx_t*)calloc(1, sizeof(mm_idx_t));
|
||||
mi->w = w, mi->k = k, mi->b = b, mi->is_hpc = is_hpc;
|
||||
mi->w = w, mi->k = k, mi->b = b, mi->flag = flag;
|
||||
mi->B = (mm_idx_bucket_t*)calloc(1<<b, sizeof(mm_idx_bucket_t));
|
||||
if (!(mm_dbg_flag & 1)) mi->km = km_init();
|
||||
return mi;
|
||||
@@ -51,13 +61,27 @@ mm_idx_t *mm_idx_init(int w, int k, int b, int is_hpc)
|
||||
|
||||
void mm_idx_destroy(mm_idx_t *mi)
|
||||
{
|
||||
int i;
|
||||
uint32_t i;
|
||||
if (mi == 0) return;
|
||||
for (i = 0; i < 1<<mi->b; ++i) {
|
||||
if (mi->h) kh_destroy(str, (khash_t(str)*)mi->h);
|
||||
if (mi->B) {
|
||||
for (i = 0; i < 1U<<mi->b; ++i) {
|
||||
free(mi->B[i].p);
|
||||
free(mi->B[i].a.a);
|
||||
kh_destroy(idx, (idxhash_t*)mi->B[i].h);
|
||||
}
|
||||
}
|
||||
if (mi->spsc) free(mi->spsc);
|
||||
if (mi->I) {
|
||||
for (i = 0; i < mi->n_seq; ++i)
|
||||
free(mi->I[i].a);
|
||||
free(mi->I);
|
||||
}
|
||||
if (mi->J) {
|
||||
for (i = 0; i < mi->n_seq; ++i)
|
||||
free(mi->J[i].a);
|
||||
free(mi->J);
|
||||
}
|
||||
if (!mi->km) {
|
||||
for (i = 0; i < mi->n_seq; ++i)
|
||||
free(mi->seq[i].name);
|
||||
@@ -87,14 +111,15 @@ const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n)
|
||||
|
||||
void mm_idx_stat(const mm_idx_t *mi)
|
||||
{
|
||||
int i, n = 0, n1 = 0;
|
||||
int64_t n = 0, n1 = 0;
|
||||
uint32_t i;
|
||||
uint64_t sum = 0, len = 0;
|
||||
fprintf(stderr, "[M::%s] kmer size: %d; skip: %d; is_HPC: %d; #seq: %d\n", __func__, mi->k, mi->w, mi->is_hpc, mi->n_seq);
|
||||
fprintf(stderr, "[M::%s] kmer size: %d; skip: %d; is_hpc: %d; #seq: %d\n", __func__, mi->k, mi->w, mi->flag&MM_I_HPC, mi->n_seq);
|
||||
for (i = 0; i < mi->n_seq; ++i)
|
||||
len += mi->seq[i].len;
|
||||
for (i = 0; i < 1<<mi->b; ++i)
|
||||
for (i = 0; i < 1U<<mi->b; ++i)
|
||||
if (mi->B[i].h) n += kh_size((idxhash_t*)mi->B[i].h);
|
||||
for (i = 0; i < 1<<mi->b; ++i) {
|
||||
for (i = 0; i < 1U<<mi->b; ++i) {
|
||||
idxhash_t *h = (idxhash_t*)mi->B[i].h;
|
||||
khint_t k;
|
||||
if (h == 0) continue;
|
||||
@@ -104,8 +129,36 @@ void mm_idx_stat(const mm_idx_t *mi)
|
||||
if (kh_key(h, k)&1) ++n1;
|
||||
}
|
||||
}
|
||||
fprintf(stderr, "[M::%s::%.3f*%.2f] distinct minimizers: %d (%.2f%% are singletons); average occurrences: %.3lf; average spacing: %.3lf\n",
|
||||
__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), n, 100.0*n1/n, (double)sum / n, (double)len / sum);
|
||||
fprintf(stderr, "[M::%s::%.3f*%.2f] distinct minimizers: %ld (%.2f%% are singletons); average occurrences: %.3lf; average spacing: %.3lf; total length: %ld\n",
|
||||
__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), (long)n, 100.0*n1/n, (double)sum / n, (double)len / sum, (long)len);
|
||||
}
|
||||
|
||||
int mm_idx_index_name(mm_idx_t *mi)
|
||||
{
|
||||
khash_t(str) *h;
|
||||
uint32_t i;
|
||||
int has_dup = 0, absent;
|
||||
if (mi->h) return 0;
|
||||
h = kh_init(str);
|
||||
for (i = 0; i < mi->n_seq; ++i) {
|
||||
khint_t k;
|
||||
k = kh_put(str, h, mi->seq[i].name, &absent);
|
||||
if (absent) kh_val(h, k) = i;
|
||||
else has_dup = 1;
|
||||
}
|
||||
mi->h = h;
|
||||
if (has_dup && mm_verbose >= 2)
|
||||
fprintf(stderr, "[WARNING] some database sequences have identical sequence names\n");
|
||||
return has_dup;
|
||||
}
|
||||
|
||||
int mm_idx_name2id(const mm_idx_t *mi, const char *name)
|
||||
{
|
||||
khash_t(str) *h = (khash_t(str)*)mi->h;
|
||||
khint_t k;
|
||||
if (h == 0) return -2;
|
||||
k = kh_get(str, h, name);
|
||||
return k == kh_end(h)? -1 : kh_val(h, k);
|
||||
}
|
||||
|
||||
int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq)
|
||||
@@ -120,6 +173,28 @@ int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, ui
|
||||
return en - st;
|
||||
}
|
||||
|
||||
int mm_idx_getseq_rev(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq)
|
||||
{
|
||||
uint64_t i, st1, en1;
|
||||
const mm_idx_seq_t *s;
|
||||
if (rid >= mi->n_seq || st >= mi->seq[rid].len) return -1;
|
||||
s = &mi->seq[rid];
|
||||
if (en > s->len) en = s->len;
|
||||
st1 = s->offset + (s->len - en);
|
||||
en1 = s->offset + (s->len - st);
|
||||
for (i = st1; i < en1; ++i) {
|
||||
uint8_t c = mm_seq4_get(mi->S, i);
|
||||
seq[en1 - i - 1] = c < 4? 3 - c : c;
|
||||
}
|
||||
return en - st;
|
||||
}
|
||||
|
||||
int mm_idx_getseq2(const mm_idx_t *mi, int is_rev, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq)
|
||||
{
|
||||
if (is_rev) return mm_idx_getseq_rev(mi, rid, st, en, seq);
|
||||
else return mm_idx_getseq(mi, rid, st, en, seq);
|
||||
}
|
||||
|
||||
int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f)
|
||||
{
|
||||
int i;
|
||||
@@ -129,6 +204,7 @@ int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f)
|
||||
if (f <= 0.) return INT32_MAX;
|
||||
for (i = 0; i < 1<<mi->b; ++i)
|
||||
if (mi->B[i].h) n += kh_size((idxhash_t*)mi->B[i].h);
|
||||
if (n == 0) return INT32_MAX;
|
||||
a = (uint32_t*)malloc(n * 4);
|
||||
for (i = n = 0; i < 1<<mi->b; ++i) {
|
||||
idxhash_t *h = (idxhash_t*)mi->B[i].h;
|
||||
@@ -149,7 +225,8 @@ int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f)
|
||||
|
||||
static void worker_post(void *g, long i, int tid)
|
||||
{
|
||||
int j, start_a, start_p, n, n_keys;
|
||||
int n, n_keys;
|
||||
size_t j, start_a, start_p;
|
||||
idxhash_t *h;
|
||||
mm_idx_t *mi = (mm_idx_t*)g;
|
||||
mm_idx_bucket_t *b = &mi->B[i];
|
||||
@@ -177,7 +254,7 @@ static void worker_post(void *g, long i, int tid)
|
||||
int absent;
|
||||
mm128_t *p = &b->a.a[j-1];
|
||||
itr = kh_put(idx, h, p->x>>8>>mi->b<<1, &absent);
|
||||
assert(absent && j - start_a == n);
|
||||
assert(absent && j == start_a + n);
|
||||
if (n == 1) {
|
||||
kh_key(h, itr) |= 1;
|
||||
kh_val(h, itr) = p->y;
|
||||
@@ -193,10 +270,10 @@ static void worker_post(void *g, long i, int tid)
|
||||
} else ++n;
|
||||
}
|
||||
b->h = h;
|
||||
assert(b->n == start_p);
|
||||
assert(b->n == (int32_t)start_p);
|
||||
|
||||
// deallocate and clear b->a
|
||||
free(b->a.a);
|
||||
kfree(0, b->a.a);
|
||||
b->a.n = b->a.m = 0, b->a.a = 0;
|
||||
}
|
||||
|
||||
@@ -214,7 +291,7 @@ static void mm_idx_post(mm_idx_t *mi, int n_threads)
|
||||
#include "bseq.h"
|
||||
|
||||
typedef struct {
|
||||
int mini_batch_size, keep_name;
|
||||
int mini_batch_size;
|
||||
uint64_t batch_size, sum_len;
|
||||
mm_bseq_file_t *fp;
|
||||
mm_idx_t *mi;
|
||||
@@ -246,7 +323,6 @@ static void *worker_pipeline(void *shared, int step, void *in)
|
||||
s->seq = mm_bseq_read(p->fp, p->mini_batch_size, 0, &s->n_seq); // read a mini-batch
|
||||
if (s->seq) {
|
||||
uint32_t old_m, m;
|
||||
uint64_t sum_len, old_max_len, max_len;
|
||||
assert((uint64_t)p->mi->n_seq + s->n_seq <= UINT32_MAX); // to prevent integer overflow
|
||||
// make room for p->mi->seq
|
||||
old_m = p->mi->n_seq, m = p->mi->n_seq + s->n_seq;
|
||||
@@ -254,6 +330,8 @@ static void *worker_pipeline(void *shared, int step, void *in)
|
||||
if (old_m != m)
|
||||
p->mi->seq = (mm_idx_seq_t*)krealloc(p->mi->km, p->mi->seq, m * sizeof(mm_idx_seq_t));
|
||||
// make room for p->mi->S
|
||||
if (!(p->mi->flag & MM_I_NO_SEQ)) {
|
||||
uint64_t sum_len, old_max_len, max_len;
|
||||
for (i = 0, sum_len = 0; i < s->n_seq; ++i) sum_len += s->seq[i].l_seq;
|
||||
old_max_len = (p->sum_len + 7) / 8;
|
||||
max_len = (p->sum_len + sum_len + 7) / 8;
|
||||
@@ -262,23 +340,26 @@ static void *worker_pipeline(void *shared, int step, void *in)
|
||||
p->mi->S = (uint32_t*)realloc(p->mi->S, max_len * 4);
|
||||
memset(&p->mi->S[old_max_len], 0, 4 * (max_len - old_max_len));
|
||||
}
|
||||
}
|
||||
// populate p->mi->seq
|
||||
for (i = 0; i < s->n_seq; ++i) {
|
||||
mm_idx_seq_t *seq = &p->mi->seq[p->mi->n_seq];
|
||||
uint32_t j;
|
||||
if (p->keep_name) {
|
||||
assert(strlen(s->seq[i].name) <= 254); // a long query name breaks BAM
|
||||
if (!(p->mi->flag & MM_I_NO_NAME)) {
|
||||
seq->name = (char*)kmalloc(p->mi->km, strlen(s->seq[i].name) + 1);
|
||||
strcpy(seq->name, s->seq[i].name);
|
||||
} else seq->name = 0;
|
||||
seq->len = s->seq[i].l_seq;
|
||||
seq->offset = p->sum_len;
|
||||
seq->is_alt = 0;
|
||||
// copy the sequence
|
||||
if (!(p->mi->flag & MM_I_NO_SEQ)) {
|
||||
for (j = 0; j < seq->len; ++j) { // TODO: this is not the fastest way, but let's first see if speed matters here
|
||||
uint64_t o = p->sum_len + j;
|
||||
int c = seq_nt4_table[(uint8_t)s->seq[i].seq[j]];
|
||||
mm_seq4_set(p->mi->S, o, c);
|
||||
}
|
||||
}
|
||||
// update p->sum_len and p->mi->n_seq
|
||||
p->sum_len += seq->len;
|
||||
s->seq[i].rid = p->mi->n_seq++;
|
||||
@@ -289,7 +370,10 @@ static void *worker_pipeline(void *shared, int step, void *in)
|
||||
step_t *s = (step_t*)in;
|
||||
for (i = 0; i < s->n_seq; ++i) {
|
||||
mm_bseq1_t *t = &s->seq[i];
|
||||
mm_sketch(0, t->seq, t->l_seq, p->mi->w, p->mi->k, t->rid, p->mi->is_hpc, &s->a);
|
||||
if (t->l_seq > 0)
|
||||
mm_sketch(0, t->seq, t->l_seq, p->mi->w, p->mi->k, t->rid, p->mi->flag&MM_I_HPC, &s->a);
|
||||
else if (mm_verbose >= 2)
|
||||
fprintf(stderr, "[WARNING] the length database sequence '%s' is 0\n", t->name);
|
||||
free(t->seq); free(t->name);
|
||||
}
|
||||
free(s->seq); s->seq = 0;
|
||||
@@ -297,21 +381,20 @@ static void *worker_pipeline(void *shared, int step, void *in)
|
||||
} else if (step == 2) { // dispatch sketch to buckets
|
||||
step_t *s = (step_t*)in;
|
||||
mm_idx_add(p->mi, s->a.n, s->a.a);
|
||||
free(s->a.a); free(s);
|
||||
kfree(0, s->a.a); free(s);
|
||||
}
|
||||
return 0;
|
||||
}
|
||||
|
||||
mm_idx_t *mm_idx_gen(mm_bseq_file_t *fp, int w, int k, int b, int is_hpc, int mini_batch_size, int n_threads, uint64_t batch_size, int keep_name)
|
||||
mm_idx_t *mm_idx_gen(mm_bseq_file_t *fp, int w, int k, int b, int flag, int mini_batch_size, int n_threads, uint64_t batch_size)
|
||||
{
|
||||
pipeline_t pl;
|
||||
if (fp == 0 || mm_bseq_eof(fp)) return 0;
|
||||
memset(&pl, 0, sizeof(pipeline_t));
|
||||
pl.mini_batch_size = mini_batch_size < batch_size? mini_batch_size : batch_size;
|
||||
pl.keep_name = keep_name;
|
||||
pl.mini_batch_size = (uint64_t)mini_batch_size < batch_size? mini_batch_size : batch_size;
|
||||
pl.batch_size = batch_size;
|
||||
pl.fp = fp;
|
||||
pl.mi = mm_idx_init(w, k, b, is_hpc);
|
||||
pl.mi = mm_idx_init(w, k, b, flag);
|
||||
|
||||
kt_pipeline(n_threads < 3? n_threads : 3, worker_pipeline, &pl, 3);
|
||||
if (mm_verbose >= 3)
|
||||
@@ -324,17 +407,67 @@ mm_idx_t *mm_idx_gen(mm_bseq_file_t *fp, int w, int k, int b, int is_hpc, int mi
|
||||
return pl.mi;
|
||||
}
|
||||
|
||||
mm_idx_t *mm_idx_build(const char *fn, int w, int k, int is_hpc, int n_threads) // a simpler interface
|
||||
mm_idx_t *mm_idx_build(const char *fn, int w, int k, int flag, int n_threads) // a simpler interface; deprecated
|
||||
{
|
||||
mm_bseq_file_t *fp;
|
||||
mm_idx_t *mi;
|
||||
fp = mm_bseq_open(fn);
|
||||
if (fp == 0) return 0;
|
||||
mi = mm_idx_gen(fp, w, k, 14, is_hpc, 1<<18, n_threads, UINT64_MAX, 1);
|
||||
mi = mm_idx_gen(fp, w, k, 14, flag, 1<<18, n_threads, UINT64_MAX);
|
||||
mm_bseq_close(fp);
|
||||
return mi;
|
||||
}
|
||||
|
||||
mm_idx_t *mm_idx_str(int w, int k, int is_hpc, int bucket_bits, int n, const char **seq, const char **name)
|
||||
{
|
||||
uint64_t sum_len = 0;
|
||||
mm128_v a = {0,0,0};
|
||||
mm_idx_t *mi;
|
||||
khash_t(str) *h;
|
||||
int i, flag = 0;
|
||||
|
||||
if (n <= 0) return 0;
|
||||
for (i = 0; i < n; ++i) // get the total length
|
||||
sum_len += strlen(seq[i]);
|
||||
if (is_hpc) flag |= MM_I_HPC;
|
||||
if (name == 0) flag |= MM_I_NO_NAME;
|
||||
if (bucket_bits < 0) bucket_bits = 14;
|
||||
mi = mm_idx_init(w, k, bucket_bits, flag);
|
||||
mi->n_seq = n;
|
||||
mi->seq = (mm_idx_seq_t*)kcalloc(mi->km, n, sizeof(mm_idx_seq_t)); // ->seq is allocated from km
|
||||
mi->S = (uint32_t*)calloc((sum_len + 7) / 8, 4);
|
||||
mi->h = h = kh_init(str);
|
||||
for (i = 0, sum_len = 0; i < n; ++i) {
|
||||
const char *s = seq[i];
|
||||
mm_idx_seq_t *p = &mi->seq[i];
|
||||
uint32_t j;
|
||||
if (name && name[i]) {
|
||||
int absent;
|
||||
p->name = (char*)kmalloc(mi->km, strlen(name[i]) + 1);
|
||||
strcpy(p->name, name[i]);
|
||||
kh_put(str, h, p->name, &absent);
|
||||
assert(absent);
|
||||
}
|
||||
p->offset = sum_len;
|
||||
p->len = strlen(s);
|
||||
p->is_alt = 0;
|
||||
for (j = 0; j < p->len; ++j) {
|
||||
int c = seq_nt4_table[(uint8_t)s[j]];
|
||||
uint64_t o = sum_len + j;
|
||||
mm_seq4_set(mi->S, o, c);
|
||||
}
|
||||
sum_len += p->len;
|
||||
if (p->len > 0) {
|
||||
a.n = 0;
|
||||
mm_sketch(0, s, p->len, w, k, i, is_hpc, &a);
|
||||
mm_idx_add(mi, a.n, a.a);
|
||||
}
|
||||
}
|
||||
free(a.a);
|
||||
mm_idx_post(mi, 1);
|
||||
return mi;
|
||||
}
|
||||
|
||||
/*************
|
||||
* index I/O *
|
||||
*************/
|
||||
@@ -342,17 +475,20 @@ mm_idx_t *mm_idx_build(const char *fn, int w, int k, int is_hpc, int n_threads)
|
||||
void mm_idx_dump(FILE *fp, const mm_idx_t *mi)
|
||||
{
|
||||
uint64_t sum_len = 0;
|
||||
uint32_t x[5];
|
||||
int i;
|
||||
uint32_t x[5], i;
|
||||
|
||||
x[0] = mi->w, x[1] = mi->k, x[2] = mi->b, x[3] = mi->n_seq, x[4] = mi->is_hpc;
|
||||
x[0] = mi->w, x[1] = mi->k, x[2] = mi->b, x[3] = mi->n_seq, x[4] = mi->flag;
|
||||
fwrite(MM_IDX_MAGIC, 1, 4, fp);
|
||||
fwrite(x, 4, 5, fp);
|
||||
for (i = 0; i < mi->n_seq; ++i) {
|
||||
uint8_t l;
|
||||
l = strlen(mi->seq[i].name);
|
||||
if (mi->seq[i].name) {
|
||||
uint8_t l = strlen(mi->seq[i].name);
|
||||
fwrite(&l, 1, 1, fp);
|
||||
fwrite(mi->seq[i].name, 1, l, fp);
|
||||
} else {
|
||||
uint8_t l = 0;
|
||||
fwrite(&l, 1, 1, fp);
|
||||
}
|
||||
fwrite(&mi->seq[i].len, 4, 1, fp);
|
||||
sum_len += mi->seq[i].len;
|
||||
}
|
||||
@@ -372,15 +508,15 @@ void mm_idx_dump(FILE *fp, const mm_idx_t *mi)
|
||||
fwrite(x, 8, 2, fp);
|
||||
}
|
||||
}
|
||||
if (!(mi->flag & MM_I_NO_SEQ))
|
||||
fwrite(mi->S, 4, (sum_len + 7) / 8, fp);
|
||||
fflush(fp);
|
||||
}
|
||||
|
||||
mm_idx_t *mm_idx_load(FILE *fp)
|
||||
{
|
||||
int i;
|
||||
char magic[4];
|
||||
uint32_t x[5];
|
||||
uint32_t x[5], i;
|
||||
uint64_t sum_len = 0;
|
||||
mm_idx_t *mi;
|
||||
|
||||
@@ -394,11 +530,14 @@ mm_idx_t *mm_idx_load(FILE *fp)
|
||||
uint8_t l;
|
||||
mm_idx_seq_t *s = &mi->seq[i];
|
||||
fread(&l, 1, 1, fp);
|
||||
if (l) {
|
||||
s->name = (char*)kmalloc(mi->km, l + 1);
|
||||
fread(s->name, 1, l, fp);
|
||||
s->name[l] = 0;
|
||||
}
|
||||
fread(&s->len, 4, 1, fp);
|
||||
s->offset = sum_len;
|
||||
s->is_alt = 0;
|
||||
sum_len += s->len;
|
||||
}
|
||||
for (i = 0; i < 1<<mi->b; ++i) {
|
||||
@@ -422,33 +561,40 @@ mm_idx_t *mm_idx_load(FILE *fp)
|
||||
kh_val(h, k) = x[1];
|
||||
}
|
||||
}
|
||||
if (!(mi->flag & MM_I_NO_SEQ)) {
|
||||
mi->S = (uint32_t*)malloc((sum_len + 7) / 8 * 4);
|
||||
fread(mi->S, 4, (sum_len + 7) / 8, fp);
|
||||
}
|
||||
return mi;
|
||||
}
|
||||
|
||||
int mm_idx_is_idx(const char *fn)
|
||||
int64_t mm_idx_is_idx(const char *fn)
|
||||
{
|
||||
int fd, is_idx = 0;
|
||||
off_t ret;
|
||||
int64_t ret, off_end;
|
||||
char magic[4];
|
||||
|
||||
if (strcmp(fn, "-") == 0) return 0; // read from pipe; not an index
|
||||
fd = open(fn, O_RDONLY);
|
||||
if (fd < 0) return -1; // error
|
||||
if ((ret = lseek(fd, 0, SEEK_END)) >= 4) {
|
||||
#ifdef WIN32
|
||||
if ((off_end = _lseeki64(fd, 0, SEEK_END)) >= 4) {
|
||||
_lseeki64(fd, 0, SEEK_SET);
|
||||
#else
|
||||
if ((off_end = lseek(fd, 0, SEEK_END)) >= 4) {
|
||||
lseek(fd, 0, SEEK_SET);
|
||||
#endif // WIN32
|
||||
ret = read(fd, magic, 4);
|
||||
if (ret == 4 && strncmp(magic, MM_IDX_MAGIC, 4) == 0)
|
||||
is_idx = 1;
|
||||
}
|
||||
close(fd);
|
||||
return is_idx;
|
||||
return is_idx? off_end : 0;
|
||||
}
|
||||
|
||||
mm_idx_reader_t *mm_idx_reader_open(const char *fn, const mm_idxopt_t *opt, const char *fn_out)
|
||||
{
|
||||
int is_idx;
|
||||
int64_t is_idx;
|
||||
mm_idx_reader_t *r;
|
||||
is_idx = mm_idx_is_idx(fn);
|
||||
if (is_idx < 0) return 0; // failed to open the index
|
||||
@@ -456,8 +602,10 @@ mm_idx_reader_t *mm_idx_reader_open(const char *fn, const mm_idxopt_t *opt, cons
|
||||
r->is_idx = is_idx;
|
||||
if (opt) r->opt = *opt;
|
||||
else mm_idxopt_init(&r->opt);
|
||||
if (r->is_idx) r->fp.idx = fopen(fn, "rb");
|
||||
else r->fp.seq = mm_bseq_open(fn);
|
||||
if (r->is_idx) {
|
||||
r->fp.idx = fopen(fn, "rb");
|
||||
r->idx_size = is_idx;
|
||||
} else r->fp.seq = mm_bseq_open(fn);
|
||||
if (fn_out) r->fp_out = fopen(fn_out, "wb");
|
||||
return r;
|
||||
}
|
||||
@@ -475,13 +623,445 @@ mm_idx_t *mm_idx_reader_read(mm_idx_reader_t *r, int n_threads)
|
||||
mm_idx_t *mi;
|
||||
if (r->is_idx) {
|
||||
mi = mm_idx_load(r->fp.idx);
|
||||
if (mi && mm_verbose >= 2 && (mi->k != r->opt.k || mi->w != r->opt.w || mi->is_hpc != r->opt.is_hpc))
|
||||
fprintf(stderr, "[WARNING] Indexing parameters (-k, -w or -H) overridden by parameters used in the prebuilt index.\n");
|
||||
if (mi && mm_verbose >= 2 && (mi->k != r->opt.k || mi->w != r->opt.w || (mi->flag&MM_I_HPC) != (r->opt.flag&MM_I_HPC)))
|
||||
fprintf(stderr, "[WARNING]\033[1;31m Indexing parameters (-k, -w or -H) overridden by parameters used in the prebuilt index.\033[0m\n");
|
||||
} else
|
||||
mi = mm_idx_gen(r->fp.seq, r->opt.w, r->opt.k, r->opt.bucket_bits, r->opt.is_hpc, r->opt.mini_batch_size, n_threads, r->opt.batch_size, 1);
|
||||
mi = mm_idx_gen(r->fp.seq, r->opt.w, r->opt.k, r->opt.bucket_bits, r->opt.flag, r->opt.mini_batch_size, n_threads, r->opt.batch_size);
|
||||
if (mi) {
|
||||
if (r->fp_out) mm_idx_dump(r->fp_out, mi);
|
||||
++r->n_parts;
|
||||
mi->index = r->n_parts++;
|
||||
}
|
||||
return mi;
|
||||
}
|
||||
|
||||
int mm_idx_reader_eof(const mm_idx_reader_t *r) // TODO: in extremely rare cases, mm_bseq_eof() might not work
|
||||
{
|
||||
return r->is_idx? (feof(r->fp.idx) || ftell(r->fp.idx) == r->idx_size) : mm_bseq_eof(r->fp.seq);
|
||||
}
|
||||
|
||||
#include <ctype.h>
|
||||
#include <zlib.h>
|
||||
#include "ksort.h"
|
||||
#include "kseq.h"
|
||||
KSTREAM_DECLARE(gzFile, gzread)
|
||||
|
||||
int mm_idx_alt_read(mm_idx_t *mi, const char *fn)
|
||||
{
|
||||
int n_alt = 0;
|
||||
gzFile fp;
|
||||
kstream_t *ks;
|
||||
kstring_t str = {0,0,0};
|
||||
fp = fn && strcmp(fn, "-")? gzopen(fn, "r") : gzdopen(fileno(stdin), "r");
|
||||
if (fp == 0) return -1;
|
||||
ks = ks_init(fp);
|
||||
if (mi->h == 0) mm_idx_index_name(mi);
|
||||
while (ks_getuntil(ks, KS_SEP_LINE, &str, 0) >= 0) {
|
||||
char *p;
|
||||
int id;
|
||||
for (p = str.s; *p && !isspace(*p); ++p) { }
|
||||
*p = 0;
|
||||
id = mm_idx_name2id(mi, str.s);
|
||||
if (id >= 0) mi->seq[id].is_alt = 1, ++n_alt;
|
||||
}
|
||||
mi->n_alt = n_alt;
|
||||
if (mm_verbose >= 3)
|
||||
fprintf(stderr, "[M::%s] found %d ALT contigs\n", __func__, n_alt);
|
||||
return n_alt;
|
||||
}
|
||||
|
||||
/***************
|
||||
* BED reading *
|
||||
***************/
|
||||
|
||||
#define sort_key_bed(a) ((a).st)
|
||||
KRADIX_SORT_INIT(bed, mm_idx_intv1_t, sort_key_bed, 4)
|
||||
|
||||
#define sort_key_end(a) ((a).en)
|
||||
KRADIX_SORT_INIT(end, mm_idx_intv1_t, sort_key_end, 4)
|
||||
|
||||
static mm_idx_intv_t *mm_idx_bed_read_core(const mm_idx_t *mi, const char *fn, int read_junc, int min_sc)
|
||||
{
|
||||
gzFile fp;
|
||||
kstream_t *ks;
|
||||
kstring_t str = {0,0,0};
|
||||
mm_idx_intv_t *I;
|
||||
|
||||
fp = fn && strcmp(fn, "-")? gzopen(fn, "r") : gzdopen(fileno(stdin), "r");
|
||||
if (fp == 0) return 0;
|
||||
I = CALLOC(mm_idx_intv_t, mi->n_seq);
|
||||
ks = ks_init(fp);
|
||||
while (ks_getuntil(ks, KS_SEP_LINE, &str, 0) >= 0) {
|
||||
mm_idx_intv_t *r;
|
||||
mm_idx_intv1_t t = {-1,-1,-1,-1,0};
|
||||
char *p, *q, *bl, *bs;
|
||||
int32_t i, id = -1, n_blk = 0;
|
||||
for (p = q = str.s, i = 0;; ++p) {
|
||||
if (*p == 0 || *p == '\t') {
|
||||
int32_t c = *p;
|
||||
*p = 0;
|
||||
if (i == 0) { // chr
|
||||
id = mm_idx_name2id(mi, q);
|
||||
if (id < 0) break; // unknown name; TODO: throw a warning
|
||||
} else if (i == 1) { // start
|
||||
t.st = atol(q); // TODO: watch out integer overflow!
|
||||
if (t.st < 0) break;
|
||||
} else if (i == 2) { // end
|
||||
t.en = atol(q);
|
||||
if (t.en < 0) break;
|
||||
} else if (i == 4) { // BED score
|
||||
t.score = *q >= '0' && *q <= '9'? atol(q) : -1;
|
||||
} else if (i == 5) { // strand
|
||||
t.strand = *q == '+'? 1 : *q == '-'? -1 : 0;
|
||||
} else if (i == 9) {
|
||||
if (!isdigit(*q)) break;
|
||||
n_blk = atol(q);
|
||||
} else if (i == 10) {
|
||||
bl = q;
|
||||
} else if (i == 11) {
|
||||
bs = q;
|
||||
break;
|
||||
}
|
||||
if (c == 0) break;
|
||||
++i, q = p + 1;
|
||||
}
|
||||
}
|
||||
if (id < 0 || t.st < 0 || t.st >= t.en) continue; // contig ID not found, or other problems
|
||||
if (min_sc > 0 && t.score < min_sc) continue;
|
||||
r = &I[id];
|
||||
if (i >= 11 && read_junc) { // BED12
|
||||
int32_t st, sz, en;
|
||||
st = strtol(bs, &bs, 10); ++bs;
|
||||
sz = strtol(bl, &bl, 10); ++bl;
|
||||
en = t.st + st + sz;
|
||||
for (i = 1; i < n_blk; ++i) {
|
||||
mm_idx_intv1_t s = t;
|
||||
if (r->n == r->m) {
|
||||
r->m = r->m? r->m + (r->m>>1) : 16;
|
||||
r->a = (mm_idx_intv1_t*)realloc(r->a, sizeof(*r->a) * r->m);
|
||||
}
|
||||
st = strtol(bs, &bs, 10); ++bs;
|
||||
sz = strtol(bl, &bl, 10); ++bl;
|
||||
s.st = en, s.en = t.st + st;
|
||||
en = t.st + st + sz;
|
||||
if (s.en > s.st) r->a[r->n++] = s;
|
||||
}
|
||||
} else {
|
||||
if (r->n == r->m) {
|
||||
r->m = r->m? r->m + (r->m>>1) : 16;
|
||||
r->a = (mm_idx_intv1_t*)realloc(r->a, sizeof(*r->a) * r->m);
|
||||
}
|
||||
r->a[r->n++] = t;
|
||||
}
|
||||
}
|
||||
free(str.s);
|
||||
ks_destroy(ks);
|
||||
gzclose(fp);
|
||||
return I;
|
||||
}
|
||||
|
||||
static mm_idx_intv_t *mm_idx_bed_read_merge(const mm_idx_t *mi, const char *fn, int read_junc, int min_sc)
|
||||
{
|
||||
long n = 0, n0 = 0;
|
||||
int32_t i;
|
||||
mm_idx_intv_t *I;
|
||||
I = mm_idx_bed_read_core(mi, fn, read_junc, min_sc);
|
||||
if (I == 0) return 0;
|
||||
for (i = 0; i < mi->n_seq; ++i) {
|
||||
int32_t j, j0, k;
|
||||
mm_idx_intv_t *intv = &I[i];
|
||||
n0 += intv->n;
|
||||
radix_sort_bed(intv->a, intv->a + intv->n); // sort by st
|
||||
for (j = 1, j0 = 0; j <= intv->n; ++j) { // sort by st and then by end
|
||||
if (j == intv->n || intv->a[j].st != intv->a[j0].st) {
|
||||
radix_sort_end(intv->a + j0, intv->a + j);
|
||||
j0 = j;
|
||||
}
|
||||
}
|
||||
for (j = 1, j0 = 0, k = 0; j <= intv->n; ++j) { // merge intervals with the same (st, en)
|
||||
if (j == intv->n || intv->a[j].st != intv->a[j0].st || intv->a[j].en != intv->a[j0].en) {
|
||||
intv->a[k] = intv->a[j0];
|
||||
intv->a[k++].cnt = j - j0;
|
||||
j0 = j;
|
||||
}
|
||||
}
|
||||
intv->a = REALLOC(mm_idx_intv1_t, intv->a, k);
|
||||
intv->n = intv->m = k;
|
||||
n += k;
|
||||
}
|
||||
if (mm_verbose >= 3)
|
||||
fprintf(stderr, "[%s] read %ld introns, %ld of which are non-redundant\n", __func__, n0, n);
|
||||
return I;
|
||||
}
|
||||
|
||||
int mm_idx_bed_read(mm_idx_t *mi, const char *fn, int read_junc)
|
||||
{
|
||||
if (mi->h == 0) mm_idx_index_name(mi);
|
||||
mi->I = mm_idx_bed_read_merge(mi, fn, read_junc, -1);
|
||||
return 0;
|
||||
}
|
||||
|
||||
int mm_idx_bed_junc(const mm_idx_t *mi, int32_t ctg, int32_t st, int32_t en, uint8_t *s)
|
||||
{
|
||||
int32_t i, left, right;
|
||||
mm_idx_intv_t *r;
|
||||
memset(s, 0, en - st);
|
||||
if (mi->I == 0 || ctg < 0 || ctg >= mi->n_seq) return -1;
|
||||
r = &mi->I[ctg];
|
||||
left = 0, right = r->n;
|
||||
while (right > left) {
|
||||
int32_t mid = left + ((right - left) >> 1);
|
||||
if (r->a[mid].st >= st) right = mid;
|
||||
else left = mid + 1;
|
||||
}
|
||||
for (i = left; i < r->n; ++i) {
|
||||
if (st <= r->a[i].st && en >= r->a[i].en && r->a[i].strand != 0) {
|
||||
if (r->a[i].strand > 0) {
|
||||
s[r->a[i].st - st] |= 1, s[r->a[i].en - 1 - st] |= 2;
|
||||
} else {
|
||||
s[r->a[i].st - st] |= 8, s[r->a[i].en - 1 - st] |= 4;
|
||||
}
|
||||
}
|
||||
}
|
||||
return left;
|
||||
}
|
||||
|
||||
/*********************************
|
||||
* Reading junctions for jumping *
|
||||
*********************************/
|
||||
|
||||
#define sort_key_jj(a) ((a).off)
|
||||
KRADIX_SORT_INIT(jj, mm_idx_jjump1_t, sort_key_jj, 4)
|
||||
|
||||
#define sort_key_jj2(a) ((a).off2)
|
||||
KRADIX_SORT_INIT(jj2, mm_idx_jjump1_t, sort_key_jj2, 4)
|
||||
|
||||
static void sort_jjump(mm_idx_jjump_t *jj2)
|
||||
{
|
||||
int32_t j0, j, k;
|
||||
if (jj2 == 0 || jj2->n == 0) return;
|
||||
radix_sort_jj(jj2->a, jj2->a + jj2->n);
|
||||
for (j0 = 0, j = 1; j <= jj2->n; ++j) {
|
||||
if (j == jj2->n || jj2->a[j0].off != jj2->a[j].off) {
|
||||
radix_sort_jj2(jj2->a + j0, jj2->a + j);
|
||||
j0 = j;
|
||||
}
|
||||
}
|
||||
// the actual merge
|
||||
for (j0 = 0, j = 1, k = 0; j <= jj2->n; ++j) {
|
||||
if (j == jj2->n || jj2->a[j0].off != jj2->a[j].off || jj2->a[j0].off2 != jj2->a[j].off2) {
|
||||
int32_t t, cnt = 0;
|
||||
uint16_t flag = 0;
|
||||
for (t = j0; t < j; ++t) cnt += jj2->a[t].cnt, flag |= jj2->a[t].flag;
|
||||
jj2->a[k] = jj2->a[j0];
|
||||
jj2->a[k].cnt = cnt;
|
||||
jj2->a[k++].flag = flag;
|
||||
j0 = j;
|
||||
}
|
||||
}
|
||||
jj2->n = k;
|
||||
jj2->a = REALLOC(mm_idx_jjump1_t, jj2->a, k);
|
||||
}
|
||||
|
||||
static mm_idx_jjump_t *mm_idx_bed2jjump(const mm_idx_t *mi, const mm_idx_intv_t *I, uint16_t flag)
|
||||
{
|
||||
int32_t i;
|
||||
mm_idx_jjump_t *J;
|
||||
J = CALLOC(mm_idx_jjump_t, mi->n_seq);
|
||||
for (i = 0; i < mi->n_seq; ++i) {
|
||||
int32_t j, k;
|
||||
const mm_idx_intv_t *intv = &I[i];
|
||||
mm_idx_jjump_t *jj = &J[i];
|
||||
jj->n = intv->n * 2;
|
||||
jj->a = CALLOC(mm_idx_jjump1_t, jj->n);
|
||||
for (j = k = 0; j < intv->n; ++j) {
|
||||
jj->a[k].off = intv->a[j].st, jj->a[k].off2 = intv->a[j].en, jj->a[k].cnt = intv->a[j].cnt, jj->a[k].strand = intv->a[j].strand, jj->a[k++].flag = flag;
|
||||
jj->a[k].off = intv->a[j].en, jj->a[k].off2 = intv->a[j].st, jj->a[k].cnt = intv->a[j].cnt, jj->a[k].strand = intv->a[j].strand, jj->a[k++].flag = flag;
|
||||
}
|
||||
sort_jjump(jj);
|
||||
}
|
||||
return J;
|
||||
}
|
||||
|
||||
static mm_idx_jjump_t *mm_idx_jjump_merge(const mm_idx_t *mi, const mm_idx_jjump_t *J0, const mm_idx_jjump_t *J1)
|
||||
{
|
||||
int32_t i;
|
||||
mm_idx_jjump_t *J2;
|
||||
J2 = CALLOC(mm_idx_jjump_t, mi->n_seq);
|
||||
for (i = 0; i < mi->n_seq; ++i) {
|
||||
int32_t j, k;
|
||||
const mm_idx_jjump_t *jj0 = &J0[i], *jj1 = &J1[i];
|
||||
mm_idx_jjump_t *jj2 = &J2[i];
|
||||
jj2->n = jj0->n + jj1->n;
|
||||
jj2->a = CALLOC(mm_idx_jjump1_t, jj2->n);
|
||||
for (j = k = 0; j < jj0->n; ++j) jj2->a[k++] = jj0->a[j];
|
||||
for (j = 0; j < jj1->n; ++j) jj2->a[k++] = jj1->a[j];
|
||||
sort_jjump(jj2);
|
||||
}
|
||||
return J2;
|
||||
}
|
||||
|
||||
int mm_idx_jjump_read(mm_idx_t *mi, const char *fn, int flag, int min_sc)
|
||||
{
|
||||
int32_t i, j, n_anno = 0, n_misc = 0;
|
||||
mm_idx_intv_t *I;
|
||||
mm_idx_jjump_t *J;
|
||||
if (mi->h == 0) mm_idx_index_name(mi);
|
||||
I = mm_idx_bed_read_merge(mi, fn, 1, min_sc);
|
||||
J = mm_idx_bed2jjump(mi, I, flag);
|
||||
for (i = 0; i < mi->n_seq; ++i) free(I[i].a);
|
||||
free(I);
|
||||
if (mi->J) {
|
||||
mm_idx_jjump_t *J2;
|
||||
J2 = mm_idx_jjump_merge(mi, mi->J, J);
|
||||
for (i = 0; i < mi->n_seq; ++i) {
|
||||
free(mi->J[i].a); free(J[i].a);
|
||||
}
|
||||
free(mi->J); free(J);
|
||||
mi->J = J2;
|
||||
} else mi->J = J;
|
||||
for (i = 0; i < mi->n_seq; ++i) {
|
||||
for (j = 0; j < mi->J[i].n; ++j)
|
||||
if (mi->J[i].a[j].flag & MM_JUNC_ANNO) ++n_anno;
|
||||
else ++n_misc;
|
||||
}
|
||||
if (mm_verbose >= 3)
|
||||
fprintf(stderr, "[%s] there are %d annotated and %d other splice positions in the index\n", __func__, n_anno, n_misc);
|
||||
return 0;
|
||||
}
|
||||
|
||||
static int32_t mm_idx_jump_get_core(int32_t n, const mm_idx_jjump1_t *a, int32_t x) // similar to mm_idx_find_intv()
|
||||
{
|
||||
int32_t s = 0, e = n;
|
||||
if (n == 0) return -1;
|
||||
if (x < a[0].off) return -1;
|
||||
while (s < e) {
|
||||
int32_t mid = s + (e - s) / 2;
|
||||
if (x >= a[mid].off && (mid + 1 >= n || x < a[mid+1].off)) return mid;
|
||||
else if (x < a[mid].off) e = mid;
|
||||
else s = mid + 1;
|
||||
}
|
||||
assert(0);
|
||||
}
|
||||
|
||||
const mm_idx_jjump1_t *mm_idx_jump_get(const mm_idx_t *db, int32_t cid, int32_t st, int32_t en, int32_t *n)
|
||||
{
|
||||
mm_idx_jjump_t *s;
|
||||
int32_t l, r;
|
||||
*n = 0;
|
||||
if (cid >= db->n_seq || cid < 0 || db->J == 0) return 0;
|
||||
if (en < 0 || en > db->seq[cid].len) en = db->seq[cid].len;
|
||||
s = &db->J[cid];
|
||||
if (s->n == 0) return 0;
|
||||
l = mm_idx_jump_get_core(s->n, s->a, st);
|
||||
r = mm_idx_jump_get_core(s->n, s->a, en);
|
||||
*n = r - l;
|
||||
return &s->a[l + 1];
|
||||
}
|
||||
|
||||
/****************
|
||||
* splice score *
|
||||
****************/
|
||||
|
||||
typedef struct mm_idx_spsc_s {
|
||||
uint32_t n, m;
|
||||
uint64_t *a; // pos<<56 | score<<1 | acceptor
|
||||
} mm_idx_spsc_t;
|
||||
|
||||
int32_t mm_idx_spsc_read(mm_idx_t *idx, const char *fn, int32_t max_sc)
|
||||
{
|
||||
gzFile fp;
|
||||
kstring_t str = {0,0,0};
|
||||
kstream_t *ks;
|
||||
int32_t dret, j;
|
||||
int64_t n_read = 0;
|
||||
|
||||
fp = fn && strcmp(fn, "-") != 0? gzopen(fn, "rb") : gzdopen(0, "rb");
|
||||
if (fp == 0) return -1;
|
||||
if (idx->h == 0) mm_idx_index_name(idx);
|
||||
if (max_sc > 63) max_sc = 63;
|
||||
idx->spsc = Kcalloc(0, mm_idx_spsc_t, idx->n_seq * 2);
|
||||
ks = ks_init(fp);
|
||||
while (ks_getuntil(ks, KS_SEP_LINE, &str, &dret) >= 0) {
|
||||
mm_idx_spsc_t *s;
|
||||
char *p, *q, *name = 0;
|
||||
int32_t i, type = -1, strand = 0, cid = -1, score = -1;
|
||||
int64_t pos = -1;
|
||||
for (i = 0, p = q = str.s;; ++p) {
|
||||
if (*p == '\t' || *p == 0) {
|
||||
int c = *p;
|
||||
*p = 0;
|
||||
if (i == 0) {
|
||||
name = q;
|
||||
} else if (i == 1) {
|
||||
pos = atol(q);
|
||||
} else if (i == 2) {
|
||||
strand = *q == '+'? 1 : '-'? -1 : 0;
|
||||
} else if (i == 3) {
|
||||
type = *q == 'D'? 0 : *q == 'A'? 1 : -1;
|
||||
} else if (i == 4) {
|
||||
score = atoi(q);
|
||||
break;
|
||||
}
|
||||
if (c == 0) break;
|
||||
q = p + 1, ++i;
|
||||
}
|
||||
}
|
||||
if (i < 4) continue; // not enough fields
|
||||
if (score > max_sc) score = max_sc;
|
||||
if (score < -max_sc) score = -max_sc;
|
||||
cid = mm_idx_name2id(idx, name);
|
||||
if (cid < 0 || type < 0 || strand == 0 || pos < 0) continue; // FIXME: give a warning!
|
||||
s = &idx->spsc[cid << 1 | (strand > 0? 0 : 1)];
|
||||
Kgrow(0, uint64_t, s->a, s->n, s->m);
|
||||
if (pos > 0 && pos < idx->seq[cid].len) { // ignore scores at the ends
|
||||
s->a[s->n++] = (uint64_t)pos << 8 | (score + KSW_SPSC_OFFSET) << 1 | type;
|
||||
++n_read;
|
||||
}
|
||||
}
|
||||
ks_destroy(ks);
|
||||
gzclose(fp);
|
||||
for (j = 0; j < idx->n_seq * 2; ++j) {
|
||||
mm_idx_spsc_t *s = &idx->spsc[j];
|
||||
if (s->n > 0)
|
||||
radix_sort_64(s->a, s->a + s->n);
|
||||
}
|
||||
if (mm_verbose >= 3)
|
||||
fprintf(stderr, "[M::%s] read %ld splice scores\n", __func__, (long)n_read);
|
||||
return 0;
|
||||
}
|
||||
|
||||
static int32_t mm_idx_find_intv(int32_t n, const uint64_t *a, int64_t x)
|
||||
{
|
||||
int32_t s = 0, e = n;
|
||||
if (n == 0) return -1;
|
||||
if (x < a[0]>>8) return -1;
|
||||
while (s < e) {
|
||||
int32_t mid = s + (e - s) / 2;
|
||||
if (x >= a[mid]>>8 && (mid + 1 >= n || x < a[mid+1]>>8)) return mid;
|
||||
else if (x < a[mid]>>8) e = mid;
|
||||
else s = mid + 1;
|
||||
}
|
||||
assert(0);
|
||||
}
|
||||
|
||||
int64_t mm_idx_spsc_get(const mm_idx_t *db, int32_t cid, int64_t st, int64_t en, int32_t rev, uint8_t *sc)
|
||||
{
|
||||
const mm_idx_spsc_t *s;
|
||||
if (cid >= db->n_seq || cid < 0 || db->spsc == 0) return -1;
|
||||
if (en < 0 || en > db->seq[cid].len) en = db->seq[cid].len;
|
||||
memset(sc, 0xff, en - st);
|
||||
s = &db->spsc[cid << 1 | (!!rev)];
|
||||
if (s->n > 0) {
|
||||
int32_t j, l, r;
|
||||
l = mm_idx_find_intv(s->n, s->a, st);
|
||||
r = mm_idx_find_intv(s->n, s->a, en);
|
||||
for (j = l + 1; j <= r; ++j) {
|
||||
int64_t x = (s->a[j]>>8) - st;
|
||||
uint8_t score = s->a[j] & 0xff;
|
||||
assert(x <= en - st);
|
||||
if (x == en - st) continue;
|
||||
if (sc[x] == 0xff || sc[x] < score) sc[x] = score;
|
||||
}
|
||||
}
|
||||
return en - st;
|
||||
}
|
||||
|
||||
@@ -0,0 +1,201 @@
|
||||
#include <stdio.h>
|
||||
#include "mmpriv.h"
|
||||
#include "kalloc.h"
|
||||
|
||||
#define MM_MIN_EXON_LEN 20
|
||||
|
||||
static int32_t mm_jump_check(void *km, const mm_idx_t *mi, int32_t qlen, const uint8_t *qseq0, const mm_reg1_t *r, int32_t ext, int32_t is_left) // TODO: check close N
|
||||
{
|
||||
int32_t clip, clen, e = !r->rev ^ !is_left; // 0 for left of the alignment; 1 for right
|
||||
uint32_t cigar;
|
||||
if (!r->p || r->p->n_cigar <= 0) return -1; // only working with CIGAR
|
||||
clip = e == 0? r->qs : qlen - r->qe;
|
||||
cigar = r->p->cigar[is_left? 0 : r->p->n_cigar - 1];
|
||||
clen = (cigar&0xf) == MM_CIGAR_MATCH? cigar>>4 : 0;
|
||||
if (clen <= ext) return -1;
|
||||
if (is_left) {
|
||||
if (clip >= r->rs) return -1; // no space to jump
|
||||
} else {
|
||||
if (clip >= mi->seq[r->rid].len - r->re) return -1; // no space to jump
|
||||
}
|
||||
return 0;
|
||||
}
|
||||
|
||||
static uint8_t *mm_jump_get_qseq_seq(void *km, int32_t qlen, const uint8_t *qseq0, const mm_reg1_t *r, int32_t is_left, int32_t ql0, uint8_t *qseq)
|
||||
{
|
||||
extern unsigned char seq_nt4_table[256];
|
||||
int32_t i, k = 0;
|
||||
if (!r->rev) {
|
||||
if (is_left)
|
||||
for (i = 0; i < ql0; ++i)
|
||||
qseq[k++] = seq_nt4_table[(uint8_t)qseq0[i]];
|
||||
else
|
||||
for (i = qlen - ql0; i < qlen; ++i)
|
||||
qseq[k++] = seq_nt4_table[(uint8_t)qseq0[i]];
|
||||
} else {
|
||||
if (is_left)
|
||||
for (i = qlen - 1; i >= qlen - ql0; --i) {
|
||||
uint8_t c = seq_nt4_table[(uint8_t)qseq0[i]];
|
||||
qseq[k++] = c >= 4? c : 3 - c;
|
||||
}
|
||||
else
|
||||
for (i = ql0 - 1; i >= 0; --i) {
|
||||
uint8_t c = seq_nt4_table[(uint8_t)qseq0[i]];
|
||||
qseq[k++] = c >= 4? c : 3 - c;
|
||||
}
|
||||
}
|
||||
return qseq;
|
||||
}
|
||||
|
||||
static void mm_jump_split_left(void *km, const mm_idx_t *mi, const mm_mapopt_t *opt, int32_t qlen, const uint8_t *qseq0, mm_reg1_t *r, int32_t ts_strand)
|
||||
{
|
||||
uint8_t *tseq = 0, *qseq = 0;
|
||||
int32_t i, n, l, i0, m, mm0;
|
||||
int32_t i0_anno = -1, n_anno = 0, mm0_anno = 0, i0_misc = -1, n_misc = 0, mm0_misc = 0;
|
||||
int32_t ext = 1 + (opt->b + opt->a - 1) / opt->a + 1;
|
||||
int32_t clip = !r->rev? r->qs : qlen - r->qe;
|
||||
int32_t extt = clip < ext? clip : ext;
|
||||
const mm_idx_jjump1_t *a;
|
||||
|
||||
if (mm_jump_check(km, mi, qlen, qseq0, r, ext + MM_MIN_EXON_LEN, 1) < 0) return;
|
||||
a = mm_idx_jump_get(mi, r->rid, r->rs - extt, r->rs + ext, &n);
|
||||
if (n == 0) return;
|
||||
|
||||
for (i = 0; i < n; ++i) { // traverse possible jumps
|
||||
const mm_idx_jjump1_t *ai = &a[i];
|
||||
int32_t tlen, tl1, j, mm1, mm2;
|
||||
assert(ai->off >= r->rs - extt && ai->off <= r->rs + ext);
|
||||
if (ts_strand * ai->strand < 0) continue; // wrong strand
|
||||
if (ai->off2 >= ai->off) continue; // wrong direction
|
||||
if (ai->off - ai->off2 < 6) continue; // intron too small
|
||||
if (ai->off2 < clip + ext) continue; // not long enough
|
||||
if (tseq == 0) {
|
||||
tseq = Kcalloc(km, uint8_t, (clip + ext) * 2); // tseq and qseq are allocated together
|
||||
qseq = tseq + clip + ext;
|
||||
mm_jump_get_qseq_seq(km, qlen, qseq0, r, 1, clip + ext, qseq);
|
||||
}
|
||||
tl1 = clip + (ai->off - r->rs);
|
||||
tlen = mm_idx_getseq2(mi, 0, r->rid, ai->off, r->rs + ext, &tseq[tl1]);
|
||||
assert(tlen == r->rs + ext - ai->off);
|
||||
tlen = mm_idx_getseq2(mi, 0, r->rid, ai->off2 - tl1, ai->off2, tseq);
|
||||
assert(tlen == tl1);
|
||||
for (j = 0, mm1 = 0; j < tl1; ++j)
|
||||
if (qseq[j] != tseq[j] || qseq[j] > 3 || tseq[j] > 3)
|
||||
++mm1;
|
||||
for (mm2 = 0; j < clip + ext; ++j)
|
||||
if (qseq[j] != tseq[j] || qseq[j] > 3 || tseq[j] > 3)
|
||||
++mm2;
|
||||
if (mm1 == 0 && mm2 <= 1) {
|
||||
if (ai->flag & MM_JUNC_ANNO)
|
||||
i0_anno = i, mm0_anno = mm1 + mm2, ++n_anno; // i0 points to the rightmost i
|
||||
else
|
||||
i0_misc = i, mm0_misc = mm1 + mm2, ++n_misc;
|
||||
}
|
||||
}
|
||||
if (n_anno > 0) m = n_anno, i0 = i0_anno, mm0 = mm0_anno;
|
||||
else m = n_misc, i0 = i0_misc, mm0 = mm0_misc;
|
||||
kfree(km, tseq);
|
||||
|
||||
l = m > 0? a[i0].off - r->rs : 0; // may be negative
|
||||
if (m == 1 && clip + l >= opt->jump_min_match) { // add one more exon
|
||||
mm_enlarge_cigar(r, 2);
|
||||
memmove(r->p->cigar + 2, r->p->cigar, r->p->n_cigar * 4);
|
||||
r->p->cigar[0] = (clip + l) << 4 | MM_CIGAR_MATCH;
|
||||
r->p->cigar[1] = (a[i0].off - a[i0].off2) << 4 | MM_CIGAR_N_SKIP;
|
||||
r->p->cigar[2] = ((r->p->cigar[2]>>4) - l) << 4 | MM_CIGAR_MATCH;
|
||||
r->p->n_cigar += 2;
|
||||
r->rs = a[i0].off2 - (clip + l);
|
||||
if (!r->rev) r->qs = 0;
|
||||
else r->qe = qlen;
|
||||
r->blen += clip, r->mlen += clip - mm0;
|
||||
r->p->dp_max0 += (clip - mm0) * opt->a - mm0 * opt->b;
|
||||
r->p->dp_max += (clip - mm0) * opt->a - mm0 * opt->b;
|
||||
if (!r->is_spliced) r->is_spliced = 1, r->p->dp_max += (opt->a + opt->b) + ((opt->a + opt->b) >> 1);
|
||||
} else if (m > 0 && a[i0].off > r->rs) { // trim by l; l is always positive
|
||||
r->p->cigar[0] -= l << 4 | MM_CIGAR_MATCH;
|
||||
r->rs += l;
|
||||
if (!r->rev) r->qs += l;
|
||||
else r->qe -= l;
|
||||
}
|
||||
}
|
||||
|
||||
static void mm_jump_split_right(void *km, const mm_idx_t *mi, const mm_mapopt_t *opt, int32_t qlen, const uint8_t *qseq0, mm_reg1_t *r, int32_t ts_strand)
|
||||
{
|
||||
uint8_t *tseq = 0, *qseq = 0;
|
||||
int32_t i, n, l, i0, m, mm0;
|
||||
int32_t i0_anno = -1, n_anno = 0, mm0_anno = 0, i0_misc = -1, n_misc = 0, mm0_misc = 0;
|
||||
int32_t ext = 1 + (opt->b + opt->a - 1) / opt->a + 1;
|
||||
int32_t clip = !r->rev? qlen - r->qe : r->qs;
|
||||
int32_t extt = clip < ext? clip : ext;
|
||||
const mm_idx_jjump1_t *a;
|
||||
|
||||
if (mm_jump_check(km, mi, qlen, qseq0, r, ext + MM_MIN_EXON_LEN, 0) < 0) return;
|
||||
a = mm_idx_jump_get(mi, r->rid, r->re - ext, r->re + extt, &n);
|
||||
if (n == 0) return;
|
||||
|
||||
for (i = 0; i < n; ++i) { // traverse possible jumps
|
||||
const mm_idx_jjump1_t *ai = &a[i];
|
||||
int32_t tlen, tl1, j, mm1, mm2;
|
||||
assert(ai->off >= r->re - ext && ai->off <= r->re + extt);
|
||||
if (ts_strand * ai->strand < 0) continue; // wrong strand
|
||||
if (ai->off2 <= ai->off) continue; // wrong direction
|
||||
if (ai->off2 - ai->off < 6) continue; // intron too small
|
||||
if (ai->off2 + clip + ext > mi->seq[r->rid].len) continue; // not long enough
|
||||
if (tseq == 0) {
|
||||
tseq = Kcalloc(km, uint8_t, (clip + ext) * 2); // tseq and qseq are allocated together
|
||||
qseq = tseq + clip + ext;
|
||||
mm_jump_get_qseq_seq(km, qlen, qseq0, r, 0, clip + ext, qseq);
|
||||
}
|
||||
tl1 = clip + (r->re - ai->off);
|
||||
tlen = mm_idx_getseq2(mi, 0, r->rid, r->re - ext, ai->off, tseq);
|
||||
assert(tlen == ai->off - (r->re - ext));
|
||||
tlen = mm_idx_getseq2(mi, 0, r->rid, ai->off2, ai->off2 + tl1, &tseq[clip + ext - tl1]);
|
||||
assert(tlen == tl1);
|
||||
for (j = 0, mm2 = 0; j < clip + ext - tl1; ++j)
|
||||
if (qseq[j] != tseq[j] || qseq[j] > 3 || tseq[j] > 3)
|
||||
++mm2;
|
||||
for (mm1 = 0; j < clip + ext; ++j)
|
||||
if (qseq[j] != tseq[j] || qseq[j] > 3 || tseq[j] > 3)
|
||||
++mm1;
|
||||
if (mm1 == 0 && mm2 <= 1) {
|
||||
if (ai->flag & MM_JUNC_ANNO) {
|
||||
if (i0_anno < 0) i0_anno = i, mm0_anno = mm1 + mm2;
|
||||
++n_anno;
|
||||
} else {
|
||||
if (i0_misc < 0) i0_misc = i, mm0_misc = mm1 + mm2;
|
||||
++n_misc;
|
||||
}
|
||||
}
|
||||
}
|
||||
if (n_anno > 0) m = n_anno, i0 = i0_anno, mm0 = mm0_anno;
|
||||
else m = n_misc, i0 = i0_misc, mm0 = mm0_misc;
|
||||
kfree(km, tseq);
|
||||
|
||||
l = m > 0? r->re - a[i0].off : 0; // may be negative
|
||||
if (m == 1 && clip + l >= opt->jump_min_match) { // add one more exon
|
||||
mm_enlarge_cigar(r, 2);
|
||||
r->p->cigar[r->p->n_cigar - 1] = ((r->p->cigar[r->p->n_cigar - 1]>>4) - l) << 4 | MM_CIGAR_MATCH;
|
||||
r->p->cigar[r->p->n_cigar] = (a[i0].off2 - a[i0].off) << 4 | MM_CIGAR_N_SKIP;
|
||||
r->p->cigar[r->p->n_cigar + 1] = (clip + l) << 4 | MM_CIGAR_MATCH;
|
||||
r->p->n_cigar += 2;
|
||||
r->re = a[i0].off2 + (clip + l);
|
||||
if (!r->rev) r->qe = qlen;
|
||||
else r->qs = 0;
|
||||
r->blen += clip, r->mlen += clip - mm0;
|
||||
r->p->dp_max0 += (clip - mm0) * opt->a - mm0 * opt->b;
|
||||
r->p->dp_max += (clip - mm0) * opt->a - mm0 * opt->b;
|
||||
if (!r->is_spliced) r->is_spliced = 1, r->p->dp_max += (opt->a + opt->b) + ((opt->a + opt->b) >> 1);
|
||||
} else if (m > 0 && r->re > a[i0].off) { // trim by l; l is always positive
|
||||
r->p->cigar[r->p->n_cigar - 1] -= l << 4 | MM_CIGAR_MATCH;
|
||||
r->re -= l;
|
||||
if (!r->rev) r->qe -= l;
|
||||
else r->qs += l;
|
||||
}
|
||||
}
|
||||
|
||||
void mm_jump_split(void *km, const mm_idx_t *mi, const mm_mapopt_t *opt, int32_t qlen, const uint8_t *qseq, mm_reg1_t *r, int32_t ts_strand)
|
||||
{
|
||||
assert((opt->flag & MM_F_EQX) == 0);
|
||||
mm_jump_split_left(km, mi, opt, qlen, qseq, r, ts_strand);
|
||||
mm_jump_split_right(km, mi, opt, qlen, qseq, r, ts_strand);
|
||||
}
|
||||
@@ -1,175 +1,152 @@
|
||||
#include <stdio.h>
|
||||
#include <stdlib.h>
|
||||
#include <string.h>
|
||||
#include <limits.h>
|
||||
#include "kalloc.h"
|
||||
|
||||
/* The whole thing is: ("@" for the kheader_t of the block, "-" for free
|
||||
* memory, and "+" for allocated memory. One char for one unit.)
|
||||
/* In kalloc, a *core* is a large chunk of contiguous memory. Each core is
|
||||
* associated with a master header, which keeps the size of the current core
|
||||
* and the pointer to next core. Kalloc allocates small *blocks* of memory from
|
||||
* the cores and organizes free memory blocks in a circular single-linked list.
|
||||
*
|
||||
* This region is core 1. This region is core 2.
|
||||
* In the following diagram, "@" stands for the header of a free block (of type
|
||||
* header_t), "#" for the header of an allocated block (of type size_t), "-"
|
||||
* for free memory, and "+" for allocated memory.
|
||||
*
|
||||
* @-------@++++++@++++++++++++@------------ @----------@++++++++++++@+++++++@------------
|
||||
* master This region is core 1. master This region is core 2.
|
||||
* | |
|
||||
* *@-------#++++++#++++++++++++@-------- *@----------#++++++++++++#+++++++@------------
|
||||
* | | | |
|
||||
* p=p->ptr->ptr->ptr->ptr p->ptr p->ptr->ptr p->ptr->ptr->ptr
|
||||
*/
|
||||
|
||||
#define PTR(p) ((size_t*)((size_t*)p)[1])
|
||||
|
||||
typedef struct _allocated_t {
|
||||
struct _allocated_t *next;
|
||||
size_t *ptr;
|
||||
} allocated_t;
|
||||
typedef struct header_t {
|
||||
size_t size;
|
||||
struct header_t *ptr;
|
||||
} header_t;
|
||||
|
||||
typedef struct {
|
||||
size_t base[2], *loop_head;
|
||||
allocated_t list_head, *list_tail;
|
||||
size_t total_allocated;
|
||||
void *par;
|
||||
size_t min_core_size;
|
||||
header_t base, *loop_head, *core_head; /* base is a zero-sized block always kept in the loop */
|
||||
} kmem_t;
|
||||
|
||||
void *km_init()
|
||||
{
|
||||
return calloc(1, sizeof(kmem_t));
|
||||
}
|
||||
|
||||
static void kerror(const char *s)
|
||||
static void panic(const char *s)
|
||||
{
|
||||
fprintf(stderr, "%s\n", s);
|
||||
exit(1);
|
||||
abort();
|
||||
}
|
||||
|
||||
static size_t *morecore(kmem_t *km, size_t nu)
|
||||
void *km_init2(void *km_par, size_t min_core_size)
|
||||
{
|
||||
size_t rnu, *up;
|
||||
|
||||
rnu = (nu + 0xfffff) & (~(size_t)0xfffff);
|
||||
up = (size_t*)malloc(rnu * sizeof(size_t));
|
||||
if (!up) { /* fail to allocate memory */
|
||||
km_stat(km);
|
||||
fprintf(stderr, "[morecore] %lu bytes requested but not available.\n", (unsigned long)rnu * sizeof(size_t));
|
||||
exit(1);
|
||||
kmem_t *km;
|
||||
km = (kmem_t*)kcalloc(km_par, 1, sizeof(kmem_t));
|
||||
km->par = km_par;
|
||||
if (km_par) km->min_core_size = min_core_size > 0? min_core_size : ((kmem_t*)km_par)->min_core_size - 2;
|
||||
else km->min_core_size = min_core_size > 0? min_core_size : 0x80000;
|
||||
return (void*)km;
|
||||
}
|
||||
/* put the pointer in km->list_head */
|
||||
if (km->list_tail == 0) km->list_tail = &km->list_head;
|
||||
km->list_tail->ptr = up;
|
||||
km->list_tail->next = (allocated_t*)calloc(1, sizeof(allocated_t));
|
||||
km->list_tail = km->list_tail->next;
|
||||
|
||||
km->total_allocated += rnu * sizeof(size_t);
|
||||
*up = rnu; /* the size of the current block, and in this case the block is the same as the new core */
|
||||
kfree(km, up + 1); /* initialize the new "core" */
|
||||
return km->loop_head;
|
||||
}
|
||||
void *km_init(void) { return km_init2(0, 0); }
|
||||
|
||||
void km_destroy(void *_km)
|
||||
{
|
||||
kmem_t *km = (kmem_t*)_km;
|
||||
allocated_t *p, *q;
|
||||
if (km == 0) return;
|
||||
p = &km->list_head;
|
||||
do {
|
||||
q = p->next;
|
||||
free(p->ptr);
|
||||
if (p != &km->list_head) free(p);
|
||||
void *km_par;
|
||||
header_t *p, *q;
|
||||
if (km == NULL) return;
|
||||
km_par = km->par;
|
||||
for (p = km->core_head; p != NULL;) {
|
||||
q = p->ptr;
|
||||
kfree(km_par, p);
|
||||
p = q;
|
||||
} while (p && p->next);
|
||||
if (p != &km->list_head) free(p);
|
||||
free(km);
|
||||
}
|
||||
kfree(km_par, km);
|
||||
}
|
||||
|
||||
void kfree(void *_km, void *ap)
|
||||
static header_t *morecore(kmem_t *km, size_t nu)
|
||||
{
|
||||
size_t *p, *q;
|
||||
header_t *q;
|
||||
size_t bytes, *p;
|
||||
nu = (nu + 1 + (km->min_core_size - 1)) / km->min_core_size * km->min_core_size; /* the first +1 for core header */
|
||||
bytes = nu * sizeof(header_t);
|
||||
q = (header_t*)kmalloc(km->par, bytes);
|
||||
if (!q) panic("[morecore] insufficient memory");
|
||||
q->ptr = km->core_head, q->size = nu, km->core_head = q;
|
||||
p = (size_t*)(q + 1);
|
||||
*p = nu - 1; /* the size of the free block; -1 because the first unit is used for the core header */
|
||||
kfree(km, p + 1); /* initialize the new "core"; NB: the core header is not looped. */
|
||||
return km->loop_head;
|
||||
}
|
||||
|
||||
void kfree(void *_km, void *ap) /* kfree() also adds a new core to the circular list */
|
||||
{
|
||||
header_t *p, *q;
|
||||
kmem_t *km = (kmem_t*)_km;
|
||||
|
||||
if (!ap) return;
|
||||
if (km == 0) {
|
||||
if (km == NULL) {
|
||||
free(ap);
|
||||
return;
|
||||
}
|
||||
p = (size_t*)ap - 1; /* *p is the size of the current block */
|
||||
p = (header_t*)((size_t*)ap - 1);
|
||||
p->size = *((size_t*)ap - 1);
|
||||
/* Find the pointer that points to the block to be freed. The following loop can stop on two conditions:
|
||||
*
|
||||
* a) "p>q && p<q->ptr": @------@++++++++@+++++++@------- @---------------@+++++++@-------
|
||||
* a) "p>q && p<q->ptr": @------#++++++++#+++++++@------- @---------------#+++++++@-------
|
||||
* (can also be in | | | -> | |
|
||||
* two cores) q p q->ptr q q->ptr
|
||||
*
|
||||
* @-------- @+++++++++@-------- @-------- @------------------
|
||||
* @-------- #+++++++++@-------- @-------- @------------------
|
||||
* | | | -> | |
|
||||
* q p q->ptr q q->ptr
|
||||
*
|
||||
* b) "q>=q->ptr && (p>q || p<q->ptr)": @-------@+++++ @--------@+++++++ @-------@+++++ @----------------
|
||||
* b) "q>=q->ptr && (p>q || p<q->ptr)": @-------#+++++ @--------#+++++++ @-------#+++++ @----------------
|
||||
* | | | -> | |
|
||||
* q->ptr q p q->ptr q
|
||||
*
|
||||
* @+++++++@----- @++++++++@------- @------------- @++++++++@-------
|
||||
* #+++++++@----- #++++++++@------- @------------- #++++++++@-------
|
||||
* | | | -> | |
|
||||
* p q->ptr q q->ptr q
|
||||
*/
|
||||
for (q = km->loop_head; !(p > q && p < PTR(q)); q = PTR(q))
|
||||
if (q >= PTR(q) && (p > q || p < PTR(q))) break;
|
||||
if (p + (*p) == PTR(q)) { /* two adjacent blocks, merge p and q->ptr (the 2nd and 4th cases) */
|
||||
*p += *PTR(q); /* this is the new q->ptr size */
|
||||
p[1] = (size_t)PTR(PTR(q)); /* this is the new q->ptr->ptr */
|
||||
/* p is actually the new q->ptr. The actual change happens a few lines below. */
|
||||
} else if (p + (*p) > PTR(q) && PTR(q) >= p) { /* the end of the allocated block is in the next free block */
|
||||
kerror("[kfree] The end of the allocated block enters a free block.");
|
||||
} else p[1] = (size_t)PTR(q); /* backup q->ptr */
|
||||
for (q = km->loop_head; !(p > q && p < q->ptr); q = q->ptr)
|
||||
if (q >= q->ptr && (p > q || p < q->ptr)) break;
|
||||
if (p + p->size == q->ptr) { /* two adjacent blocks, merge p and q->ptr (the 2nd and 4th cases) */
|
||||
p->size += q->ptr->size;
|
||||
p->ptr = q->ptr->ptr;
|
||||
} else if (p + p->size > q->ptr && q->ptr >= p) {
|
||||
panic("[kfree] The end of the allocated block enters a free block.");
|
||||
} else p->ptr = q->ptr; /* backup q->ptr */
|
||||
|
||||
if (q + (*q) == p) { /* two adjacent blocks, merge q and p (the other two cases) */
|
||||
*q += *p;
|
||||
q[1] = (size_t)PTR(p);
|
||||
if (q + q->size == p) { /* two adjacent blocks, merge q and p (the other two cases) */
|
||||
q->size += p->size;
|
||||
q->ptr = p->ptr;
|
||||
km->loop_head = q;
|
||||
} else if (q + (*q) > p && p >= q) { /* the end of a free block in the allocated block */
|
||||
kerror("[kfree] The end of a free block enters the allocated block.");
|
||||
} else km->loop_head = p, q[1] = (size_t)p; /* in two cores, cannot be merged */
|
||||
}
|
||||
|
||||
void *krealloc(void *_km, void *ap, size_t n_bytes)
|
||||
{
|
||||
kmem_t *km = (kmem_t*)_km;
|
||||
size_t n_units, *p, *q;
|
||||
|
||||
if (n_bytes == 0) {
|
||||
kfree(km, ap); return 0;
|
||||
}
|
||||
if (km == 0) return realloc(ap, n_bytes);
|
||||
if (!ap) return kmalloc(km, n_bytes);
|
||||
n_units = 1 + (n_bytes + sizeof(size_t) - 1) / sizeof(size_t);
|
||||
p = (size_t*)ap - 1;
|
||||
if (*p >= n_units) return ap; /* TODO: this prevents shrinking */
|
||||
q = (size_t*)kmalloc(km, n_bytes);
|
||||
memcpy(q, ap, (*p - 1) * sizeof(size_t));
|
||||
kfree(km, ap);
|
||||
return q;
|
||||
} else if (q + q->size > p && p >= q) {
|
||||
panic("[kfree] The end of a free block enters the allocated block.");
|
||||
} else km->loop_head = p, q->ptr = p; /* in two cores, cannot be merged; create a new block in the list */
|
||||
}
|
||||
|
||||
void *kmalloc(void *_km, size_t n_bytes)
|
||||
{
|
||||
kmem_t *km = (kmem_t*)_km;
|
||||
size_t n_units, *p, *q;
|
||||
size_t n_units;
|
||||
header_t *p, *q;
|
||||
|
||||
if (n_bytes == 0) return 0;
|
||||
if (km == 0) return malloc(n_bytes);
|
||||
/* "n_units" means the number of units. The size of one unit equals to sizeof(kheader_t).
|
||||
* "1" is the kheader_t of a block, which is always required. */
|
||||
n_units = 1 + (n_bytes + sizeof(size_t) - 1) / sizeof(size_t);
|
||||
if (n_units&1) ++n_units; /* make n_units an even number, or it will segfault if only one unit remains */
|
||||
if (km == NULL) return malloc(n_bytes);
|
||||
n_units = (n_bytes + sizeof(size_t) + sizeof(header_t) - 1) / sizeof(header_t); /* header+n_bytes requires at least this number of units */
|
||||
|
||||
if (!(q = km->loop_head)) { /* the first time when kmalloc() is called, intialization */
|
||||
km->base[1] = (size_t)(km->loop_head = q = km->base); *q = 0;
|
||||
}
|
||||
for (p = PTR(q);; q = p, p = PTR(p)) { /* search for a suitable block */
|
||||
if (*p >= n_units) { /* p->size if the size of current block. This line means the current block is large enough. */
|
||||
if (*p == n_units) q[1] = (size_t)PTR(p); /* no need to split the block */
|
||||
else { /* split the block */
|
||||
/* memory is allocated at the end of the block */
|
||||
*p -= n_units; /* reduce the size of the free block */
|
||||
p += *p; /* skip to the kheader_t of the allocated block */
|
||||
*p = n_units; /* set the size */
|
||||
if (!(q = km->loop_head)) /* the first time when kmalloc() is called, intialize it */
|
||||
q = km->loop_head = km->base.ptr = &km->base;
|
||||
for (p = q->ptr;; q = p, p = p->ptr) { /* search for a suitable block */
|
||||
if (p->size >= n_units) { /* p->size if the size of current block. This line means the current block is large enough. */
|
||||
if (p->size == n_units) q->ptr = p->ptr; /* no need to split the block */
|
||||
else { /* split the block. NB: memory is allocated at the end of the block! */
|
||||
p->size -= n_units; /* reduce the size of the free block */
|
||||
p += p->size; /* p points to the allocated block */
|
||||
*(size_t*)p = n_units; /* set the size */
|
||||
}
|
||||
km->loop_head = q; /* set the end of chain */
|
||||
return p + 1; /* skip the kheader_t */
|
||||
return (size_t*)p + 1;
|
||||
}
|
||||
if (p == km->loop_head) { /* then ask for more "cores" */
|
||||
if ((p = morecore(km, n_units)) == 0) return 0;
|
||||
@@ -182,33 +159,66 @@ void *kcalloc(void *_km, size_t count, size_t size)
|
||||
kmem_t *km = (kmem_t*)_km;
|
||||
void *p;
|
||||
if (size == 0 || count == 0) return 0;
|
||||
if (km == 0) return calloc(count, size);
|
||||
if (km == NULL) return calloc(count, size);
|
||||
p = kmalloc(km, count * size);
|
||||
memset(p, 0, count * size);
|
||||
return p;
|
||||
}
|
||||
|
||||
void km_stat(const void *_km)
|
||||
void *krealloc(void *_km, void *ap, size_t n_bytes) // TODO: this can be made more efficient in principle
|
||||
{
|
||||
kmem_t *km = (kmem_t*)_km;
|
||||
unsigned n_blocks, n_units;
|
||||
size_t max_block = 0, *p, *q;
|
||||
float frag;
|
||||
size_t cap, *p, *q;
|
||||
|
||||
if (km == 0 || !(p = km->loop_head)) return;
|
||||
n_blocks = n_units = 0;
|
||||
do {
|
||||
q = PTR(p);
|
||||
if (*p > max_block) max_block = *p;
|
||||
n_units += *p;
|
||||
if (p + (*p) > q && q > p)
|
||||
kerror("[kr_stat] The end of a free block enters another free block.");
|
||||
p = q;
|
||||
++n_blocks;
|
||||
} while (p != km->loop_head);
|
||||
if (n_bytes == 0) {
|
||||
kfree(km, ap); return 0;
|
||||
}
|
||||
if (km == NULL) return realloc(ap, n_bytes);
|
||||
if (ap == NULL) return kmalloc(km, n_bytes);
|
||||
p = (size_t*)ap - 1;
|
||||
cap = (*p) * sizeof(header_t) - sizeof(size_t);
|
||||
if (cap >= n_bytes) return ap; /* TODO: this prevents shrinking */
|
||||
q = (size_t*)kmalloc(km, n_bytes);
|
||||
memcpy(q, ap, cap);
|
||||
kfree(km, ap);
|
||||
return q;
|
||||
}
|
||||
|
||||
--n_blocks;
|
||||
frag = 1.0/1024.0 * n_units * sizeof(size_t) / n_blocks;
|
||||
fprintf(stderr, "[kr_stat] tot=%lu, free=%lu, n_block=%u, max_block=%lu, frag_len=%.3fK\n",
|
||||
(unsigned long)km->total_allocated, (unsigned long)n_units * sizeof(size_t), n_blocks, (unsigned long)max_block * sizeof(size_t), frag);
|
||||
void *krelocate(void *km, void *ap, size_t n_bytes)
|
||||
{
|
||||
void *p;
|
||||
if (km == 0 || ap == 0) return ap;
|
||||
p = kmalloc(km, n_bytes);
|
||||
memcpy(p, ap, n_bytes);
|
||||
kfree(km, ap);
|
||||
return p;
|
||||
}
|
||||
|
||||
void km_stat(const void *_km, km_stat_t *s)
|
||||
{
|
||||
kmem_t *km = (kmem_t*)_km;
|
||||
header_t *p;
|
||||
memset(s, 0, sizeof(km_stat_t));
|
||||
if (km == NULL || km->loop_head == NULL) return;
|
||||
for (p = km->loop_head;; p = p->ptr) {
|
||||
s->available += p->size * sizeof(header_t);
|
||||
if (p->size != 0) ++s->n_blocks; /* &kmem_t::base is always one of the cores. It is zero-sized. */
|
||||
if (p->ptr > p && p + p->size > p->ptr)
|
||||
panic("[km_stat] The end of a free block enters another free block.");
|
||||
if (p->ptr == km->loop_head) break;
|
||||
}
|
||||
for (p = km->core_head; p != NULL; p = p->ptr) {
|
||||
size_t size = p->size * sizeof(header_t);
|
||||
++s->n_cores;
|
||||
s->capacity += size;
|
||||
s->largest = s->largest > size? s->largest : size;
|
||||
}
|
||||
}
|
||||
|
||||
void km_stat_print(const void *km)
|
||||
{
|
||||
km_stat_t st;
|
||||
km_stat(km, &st);
|
||||
fprintf(stderr, "[km_stat] cap=%ld, avail=%ld, largest=%ld, n_core=%ld, n_block=%ld\n",
|
||||
st.capacity, st.available, st.largest, st.n_blocks, st.n_cores);
|
||||
}
|
||||
|
||||
@@ -1,26 +1,95 @@
|
||||
#ifndef _KALLOC_H_
|
||||
#define _KALLOC_H_
|
||||
|
||||
#include <stdlib.h>
|
||||
|
||||
#define km_size(x) (*(((size_t*)(x))-1) * sizeof(size_t))
|
||||
#include <stddef.h> /* for size_t */
|
||||
|
||||
#ifdef __cplusplus
|
||||
extern "C" {
|
||||
#endif
|
||||
|
||||
typedef struct {
|
||||
size_t capacity, available, n_blocks, n_cores, largest;
|
||||
} km_stat_t;
|
||||
|
||||
void *kmalloc(void *km, size_t size);
|
||||
void *krealloc(void *km, void *ptr, size_t size);
|
||||
void *krelocate(void *km, void *ap, size_t n_bytes);
|
||||
void *kcalloc(void *km, size_t count, size_t size);
|
||||
void kfree(void *km, void *ptr);
|
||||
|
||||
void *km_init(void);
|
||||
void *km_init2(void *km_par, size_t min_core_size);
|
||||
void km_destroy(void *km);
|
||||
|
||||
void km_stat(const void *km); // TODO: return numbers instead of print to stderr
|
||||
void km_stat(const void *_km, km_stat_t *s);
|
||||
void km_stat_print(const void *km);
|
||||
|
||||
#ifdef __cplusplus
|
||||
}
|
||||
#endif
|
||||
|
||||
#define Kmalloc(km, type, cnt) ((type*)kmalloc((km), (cnt) * sizeof(type)))
|
||||
#define Kcalloc(km, type, cnt) ((type*)kcalloc((km), (cnt), sizeof(type)))
|
||||
#define Krealloc(km, type, ptr, cnt) ((type*)krealloc((km), (ptr), (cnt) * sizeof(type)))
|
||||
|
||||
#define Kgrow(km, type, ptr, __i, __m) do { \
|
||||
if ((__i) >= (__m)) { \
|
||||
(__m) = (__i) + 1; \
|
||||
(__m) += ((__m)>>1) + 16; \
|
||||
(ptr) = Krealloc(km, type, ptr, (__m)); \
|
||||
} \
|
||||
} while (0)
|
||||
|
||||
#define Kexpand(km, type, a, m) do { \
|
||||
(m) = (m) >= 4? (m) + ((m)>>1) : 16; \
|
||||
(a) = Krealloc(km, type, (a), (m)); \
|
||||
} while (0)
|
||||
|
||||
#define KMALLOC(km, ptr, len) ((ptr) = (__typeof__(ptr))kmalloc((km), (len) * sizeof(*(ptr))))
|
||||
#define KCALLOC(km, ptr, len) ((ptr) = (__typeof__(ptr))kcalloc((km), (len), sizeof(*(ptr))))
|
||||
#define KREALLOC(km, ptr, len) ((ptr) = (__typeof__(ptr))krealloc((km), (ptr), (len) * sizeof(*(ptr))))
|
||||
|
||||
#define KEXPAND(km, a, m) do { \
|
||||
(m) = (m) >= 4? (m) + ((m)>>1) : 16; \
|
||||
KREALLOC((km), (a), (m)); \
|
||||
} while (0)
|
||||
|
||||
#ifndef klib_unused
|
||||
#if (defined __clang__ && __clang_major__ >= 3) || (defined __GNUC__ && __GNUC__ >= 3)
|
||||
#define klib_unused __attribute__ ((__unused__))
|
||||
#else
|
||||
#define klib_unused
|
||||
#endif
|
||||
#endif /* klib_unused */
|
||||
|
||||
#define KALLOC_POOL_INIT2(SCOPE, name, kmptype_t) \
|
||||
typedef struct { \
|
||||
size_t cnt, n, max; \
|
||||
kmptype_t **buf; \
|
||||
void *km; \
|
||||
} kmp_##name##_t; \
|
||||
SCOPE kmp_##name##_t *kmp_init_##name(void *km) { \
|
||||
kmp_##name##_t *mp; \
|
||||
mp = Kcalloc(km, kmp_##name##_t, 1); \
|
||||
mp->km = km; \
|
||||
return mp; \
|
||||
} \
|
||||
SCOPE void kmp_destroy_##name(kmp_##name##_t *mp) { \
|
||||
size_t k; \
|
||||
for (k = 0; k < mp->n; ++k) kfree(mp->km, mp->buf[k]); \
|
||||
kfree(mp->km, mp->buf); kfree(mp->km, mp); \
|
||||
} \
|
||||
SCOPE kmptype_t *kmp_alloc_##name(kmp_##name##_t *mp) { \
|
||||
++mp->cnt; \
|
||||
if (mp->n == 0) return (kmptype_t*)kcalloc(mp->km, 1, sizeof(kmptype_t)); \
|
||||
return mp->buf[--mp->n]; \
|
||||
} \
|
||||
SCOPE void kmp_free_##name(kmp_##name##_t *mp, kmptype_t *p) { \
|
||||
--mp->cnt; \
|
||||
if (mp->n == mp->max) Kexpand(mp->km, kmptype_t*, mp->buf, mp->max); \
|
||||
mp->buf[mp->n++] = p; \
|
||||
}
|
||||
|
||||
#define KALLOC_POOL_INIT(name, kmptype_t) \
|
||||
KALLOC_POOL_INIT2(static inline klib_unused, name, kmptype_t)
|
||||
|
||||
#endif
|
||||
|
||||
@@ -0,0 +1,120 @@
|
||||
#ifndef KETOPT_H
|
||||
#define KETOPT_H
|
||||
|
||||
#include <string.h> /* for strchr() and strncmp() */
|
||||
|
||||
#define ko_no_argument 0
|
||||
#define ko_required_argument 1
|
||||
#define ko_optional_argument 2
|
||||
|
||||
typedef struct {
|
||||
int ind; /* equivalent to optind */
|
||||
int opt; /* equivalent to optopt */
|
||||
char *arg; /* equivalent to optarg */
|
||||
int longidx; /* index of a long option; or -1 if short */
|
||||
/* private variables not intended for external uses */
|
||||
int i, pos, n_args;
|
||||
} ketopt_t;
|
||||
|
||||
typedef struct {
|
||||
char *name;
|
||||
int has_arg;
|
||||
int val;
|
||||
} ko_longopt_t;
|
||||
|
||||
static ketopt_t KETOPT_INIT = { 1, 0, 0, -1, 1, 0, 0 };
|
||||
|
||||
static void ketopt_permute(char *argv[], int j, int n) /* move argv[j] over n elements to the left */
|
||||
{
|
||||
int k;
|
||||
char *p = argv[j];
|
||||
for (k = 0; k < n; ++k)
|
||||
argv[j - k] = argv[j - k - 1];
|
||||
argv[j - k] = p;
|
||||
}
|
||||
|
||||
/**
|
||||
* Parse command-line options and arguments
|
||||
*
|
||||
* This fuction has a similar interface to GNU's getopt_long(). Each call
|
||||
* parses one option and returns the option name. s->arg points to the option
|
||||
* argument if present. The function returns -1 when all command-line arguments
|
||||
* are parsed. In this case, s->ind is the index of the first non-option
|
||||
* argument.
|
||||
*
|
||||
* @param s status; shall be initialized to KETOPT_INIT on the first call
|
||||
* @param argc length of argv[]
|
||||
* @param argv list of command-line arguments; argv[0] is ignored
|
||||
* @param permute non-zero to move options ahead of non-option arguments
|
||||
* @param ostr option string
|
||||
* @param longopts long options
|
||||
*
|
||||
* @return ASCII for a short option; ko_longopt_t::val for a long option; -1 if
|
||||
* argv[] is fully processed; '?' for an unknown option or an ambiguous
|
||||
* long option; ':' if an option argument is missing
|
||||
*/
|
||||
static int ketopt(ketopt_t *s, int argc, char *argv[], int permute, const char *ostr, const ko_longopt_t *longopts)
|
||||
{
|
||||
int opt = -1, i0, j;
|
||||
if (permute) {
|
||||
while (s->i < argc && (argv[s->i][0] != '-' || argv[s->i][1] == '\0'))
|
||||
++s->i, ++s->n_args;
|
||||
}
|
||||
s->arg = 0, s->longidx = -1, i0 = s->i;
|
||||
if (s->i >= argc || argv[s->i][0] != '-' || argv[s->i][1] == '\0') {
|
||||
s->ind = s->i - s->n_args;
|
||||
return -1;
|
||||
}
|
||||
if (argv[s->i][0] == '-' && argv[s->i][1] == '-') { /* "--" or a long option */
|
||||
if (argv[s->i][2] == '\0') { /* a bare "--" */
|
||||
ketopt_permute(argv, s->i, s->n_args);
|
||||
++s->i, s->ind = s->i - s->n_args;
|
||||
return -1;
|
||||
}
|
||||
s->opt = 0, opt = '?', s->pos = -1;
|
||||
if (longopts) { /* parse long options */
|
||||
int k, n_exact = 0, n_partial = 0;
|
||||
const ko_longopt_t *o = 0, *o_exact = 0, *o_partial = 0;
|
||||
for (j = 2; argv[s->i][j] != '\0' && argv[s->i][j] != '='; ++j) {} /* find the end of the option name */
|
||||
for (k = 0; longopts[k].name != 0; ++k)
|
||||
if (strncmp(&argv[s->i][2], longopts[k].name, j - 2) == 0) {
|
||||
if (longopts[k].name[j - 2] == 0) ++n_exact, o_exact = &longopts[k];
|
||||
else ++n_partial, o_partial = &longopts[k];
|
||||
}
|
||||
if (n_exact > 1 || (n_exact == 0 && n_partial > 1)) return '?';
|
||||
o = n_exact == 1? o_exact : n_partial == 1? o_partial : 0;
|
||||
if (o) {
|
||||
s->opt = opt = o->val, s->longidx = o - longopts;
|
||||
if (argv[s->i][j] == '=') s->arg = &argv[s->i][j + 1];
|
||||
if (o->has_arg == 1 && argv[s->i][j] == '\0') {
|
||||
if (s->i < argc - 1) s->arg = argv[++s->i];
|
||||
else opt = ':'; /* missing option argument */
|
||||
}
|
||||
}
|
||||
}
|
||||
} else { /* a short option */
|
||||
char *p;
|
||||
if (s->pos == 0) s->pos = 1;
|
||||
opt = s->opt = argv[s->i][s->pos++];
|
||||
p = strchr((char*)ostr, opt);
|
||||
if (p == 0) {
|
||||
opt = '?'; /* unknown option */
|
||||
} else if (p[1] == ':') {
|
||||
if (argv[s->i][s->pos] == 0) {
|
||||
if (s->i < argc - 1) s->arg = argv[++s->i];
|
||||
else opt = ':'; /* missing option argument */
|
||||
} else s->arg = &argv[s->i][s->pos];
|
||||
s->pos = -1;
|
||||
}
|
||||
}
|
||||
if (s->pos < 0 || argv[s->i][s->pos] == 0) {
|
||||
++s->i, s->pos = 0;
|
||||
if (s->n_args > 0) /* permute */
|
||||
for (j = i0; j < s->i; ++j)
|
||||
ketopt_permute(argv, j, s->n_args);
|
||||
}
|
||||
s->ind = s->i - s->n_args;
|
||||
return opt;
|
||||
}
|
||||
|
||||
#endif
|
||||
@@ -0,0 +1,474 @@
|
||||
/* The MIT License
|
||||
|
||||
Copyright (c) 2019 by Attractive Chaos <attractor@live.co.uk>
|
||||
|
||||
Permission is hereby granted, free of charge, to any person obtaining
|
||||
a copy of this software and associated documentation files (the
|
||||
"Software"), to deal in the Software without restriction, including
|
||||
without limitation the rights to use, copy, modify, merge, publish,
|
||||
distribute, sublicense, and/or sell copies of the Software, and to
|
||||
permit persons to whom the Software is furnished to do so, subject to
|
||||
the following conditions:
|
||||
|
||||
The above copyright notice and this permission notice shall be
|
||||
included in all copies or substantial portions of the Software.
|
||||
|
||||
THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
|
||||
EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
|
||||
MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
|
||||
NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS
|
||||
BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN
|
||||
ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN
|
||||
CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
|
||||
SOFTWARE.
|
||||
*/
|
||||
|
||||
/* An example:
|
||||
|
||||
#include <stdio.h>
|
||||
#include <string.h>
|
||||
#include <stdlib.h>
|
||||
#include "krmq.h"
|
||||
|
||||
struct my_node {
|
||||
char key;
|
||||
KRMQ_HEAD(struct my_node) head;
|
||||
};
|
||||
#define my_cmp(p, q) (((q)->key < (p)->key) - ((p)->key < (q)->key))
|
||||
KRMQ_INIT(my, struct my_node, head, my_cmp)
|
||||
|
||||
int main(void) {
|
||||
const char *str = "MNOLKQOPHIA"; // from wiki, except a duplicate
|
||||
struct my_node *root = 0;
|
||||
int i, l = strlen(str);
|
||||
for (i = 0; i < l; ++i) { // insert in the input order
|
||||
struct my_node *q, *p = malloc(sizeof(*p));
|
||||
p->key = str[i];
|
||||
q = krmq_insert(my, &root, p, 0);
|
||||
if (p != q) free(p); // if already present, free
|
||||
}
|
||||
krmq_itr_t(my) itr;
|
||||
krmq_itr_first(my, root, &itr); // place at first
|
||||
do { // traverse
|
||||
const struct my_node *p = krmq_at(&itr);
|
||||
putchar(p->key);
|
||||
free((void*)p); // free node
|
||||
} while (krmq_itr_next(my, &itr));
|
||||
putchar('\n');
|
||||
return 0;
|
||||
}
|
||||
*/
|
||||
|
||||
#ifndef KRMQ_H
|
||||
#define KRMQ_H
|
||||
|
||||
#ifdef __STRICT_ANSI__
|
||||
#define inline __inline__
|
||||
#endif
|
||||
|
||||
#define KRMQ_MAX_DEPTH 64
|
||||
|
||||
#define krmq_size(head, p) ((p)? (p)->head.size : 0)
|
||||
#define krmq_size_child(head, q, i) ((q)->head.p[(i)]? (q)->head.p[(i)]->head.size : 0)
|
||||
|
||||
#define KRMQ_HEAD(__type) \
|
||||
struct { \
|
||||
__type *p[2], *s; \
|
||||
signed char balance; /* balance factor */ \
|
||||
unsigned size; /* #elements in subtree */ \
|
||||
}
|
||||
|
||||
#define __KRMQ_FIND(suf, __scope, __type, __head, __cmp) \
|
||||
__scope __type *krmq_find_##suf(const __type *root, const __type *x, unsigned *cnt_) { \
|
||||
const __type *p = root; \
|
||||
unsigned cnt = 0; \
|
||||
while (p != 0) { \
|
||||
int cmp; \
|
||||
cmp = __cmp(x, p); \
|
||||
if (cmp >= 0) cnt += krmq_size_child(__head, p, 0) + 1; \
|
||||
if (cmp < 0) p = p->__head.p[0]; \
|
||||
else if (cmp > 0) p = p->__head.p[1]; \
|
||||
else break; \
|
||||
} \
|
||||
if (cnt_) *cnt_ = cnt; \
|
||||
return (__type*)p; \
|
||||
} \
|
||||
__scope __type *krmq_interval_##suf(const __type *root, const __type *x, __type **lower, __type **upper) { \
|
||||
const __type *p = root, *l = 0, *u = 0; \
|
||||
while (p != 0) { \
|
||||
int cmp; \
|
||||
cmp = __cmp(x, p); \
|
||||
if (cmp < 0) u = p, p = p->__head.p[0]; \
|
||||
else if (cmp > 0) l = p, p = p->__head.p[1]; \
|
||||
else { l = u = p; break; } \
|
||||
} \
|
||||
if (lower) *lower = (__type*)l; \
|
||||
if (upper) *upper = (__type*)u; \
|
||||
return (__type*)p; \
|
||||
}
|
||||
|
||||
#define __KRMQ_RMQ(suf, __scope, __type, __head, __cmp, __lt2) \
|
||||
__scope __type *krmq_rmq_##suf(const __type *root, const __type *lo, const __type *up) { /* CLOSED interval */ \
|
||||
const __type *p = root, *path[2][KRMQ_MAX_DEPTH], *min; \
|
||||
int plen[2] = {0, 0}, pcmp[2][KRMQ_MAX_DEPTH], i, cmp, lca; \
|
||||
if (root == 0) return 0; \
|
||||
while (p) { \
|
||||
cmp = __cmp(lo, p); \
|
||||
path[0][plen[0]] = p, pcmp[0][plen[0]++] = cmp; \
|
||||
if (cmp < 0) p = p->__head.p[0]; \
|
||||
else if (cmp > 0) p = p->__head.p[1]; \
|
||||
else break; \
|
||||
} \
|
||||
p = root; \
|
||||
while (p) { \
|
||||
cmp = __cmp(up, p); \
|
||||
path[1][plen[1]] = p, pcmp[1][plen[1]++] = cmp; \
|
||||
if (cmp < 0) p = p->__head.p[0]; \
|
||||
else if (cmp > 0) p = p->__head.p[1]; \
|
||||
else break; \
|
||||
} \
|
||||
for (i = 0; i < plen[0] && i < plen[1]; ++i) /* find the LCA */ \
|
||||
if (path[0][i] == path[1][i] && pcmp[0][i] <= 0 && pcmp[1][i] >= 0) \
|
||||
break; \
|
||||
if (i == plen[0] || i == plen[1]) return 0; /* no elements in the closed interval */ \
|
||||
lca = i, min = path[0][lca]; \
|
||||
for (i = lca + 1; i < plen[0]; ++i) { \
|
||||
if (pcmp[0][i] <= 0) { \
|
||||
if (__lt2(path[0][i], min)) min = path[0][i]; \
|
||||
if (path[0][i]->__head.p[1] && __lt2(path[0][i]->__head.p[1]->__head.s, min)) \
|
||||
min = path[0][i]->__head.p[1]->__head.s; \
|
||||
} \
|
||||
} \
|
||||
for (i = lca + 1; i < plen[1]; ++i) { \
|
||||
if (pcmp[1][i] >= 0) { \
|
||||
if (__lt2(path[1][i], min)) min = path[1][i]; \
|
||||
if (path[1][i]->__head.p[0] && __lt2(path[1][i]->__head.p[0]->__head.s, min)) \
|
||||
min = path[1][i]->__head.p[0]->__head.s; \
|
||||
} \
|
||||
} \
|
||||
return (__type*)min; \
|
||||
}
|
||||
|
||||
#define __KRMQ_ROTATE(suf, __type, __head, __lt2) \
|
||||
/* */ \
|
||||
static inline void krmq_update_min_##suf(__type *p, const __type *q, const __type *r) { \
|
||||
p->__head.s = !q || __lt2(p, q->__head.s)? p : q->__head.s; \
|
||||
p->__head.s = !r || __lt2(p->__head.s, r->__head.s)? p->__head.s : r->__head.s; \
|
||||
} \
|
||||
/* one rotation: (a,(b,c)q)p => ((a,b)p,c)q */ \
|
||||
static inline __type *krmq_rotate1_##suf(__type *p, int dir) { /* dir=0 to left; dir=1 to right */ \
|
||||
int opp = 1 - dir; /* opposite direction */ \
|
||||
__type *q = p->__head.p[opp], *s = p->__head.s; \
|
||||
unsigned size_p = p->__head.size; \
|
||||
p->__head.size -= q->__head.size - krmq_size_child(__head, q, dir); \
|
||||
q->__head.size = size_p; \
|
||||
krmq_update_min_##suf(p, p->__head.p[dir], q->__head.p[dir]); \
|
||||
q->__head.s = s; \
|
||||
p->__head.p[opp] = q->__head.p[dir]; \
|
||||
q->__head.p[dir] = p; \
|
||||
return q; \
|
||||
} \
|
||||
/* two consecutive rotations: (a,((b,c)r,d)q)p => ((a,b)p,(c,d)q)r */ \
|
||||
static inline __type *krmq_rotate2_##suf(__type *p, int dir) { \
|
||||
int b1, opp = 1 - dir; \
|
||||
__type *q = p->__head.p[opp], *r = q->__head.p[dir], *s = p->__head.s; \
|
||||
unsigned size_x_dir = krmq_size_child(__head, r, dir); \
|
||||
r->__head.size = p->__head.size; \
|
||||
p->__head.size -= q->__head.size - size_x_dir; \
|
||||
q->__head.size -= size_x_dir + 1; \
|
||||
krmq_update_min_##suf(p, p->__head.p[dir], r->__head.p[dir]); \
|
||||
krmq_update_min_##suf(q, q->__head.p[opp], r->__head.p[opp]); \
|
||||
r->__head.s = s; \
|
||||
p->__head.p[opp] = r->__head.p[dir]; \
|
||||
r->__head.p[dir] = p; \
|
||||
q->__head.p[dir] = r->__head.p[opp]; \
|
||||
r->__head.p[opp] = q; \
|
||||
b1 = dir == 0? +1 : -1; \
|
||||
if (r->__head.balance == b1) q->__head.balance = 0, p->__head.balance = -b1; \
|
||||
else if (r->__head.balance == 0) q->__head.balance = p->__head.balance = 0; \
|
||||
else q->__head.balance = b1, p->__head.balance = 0; \
|
||||
r->__head.balance = 0; \
|
||||
return r; \
|
||||
}
|
||||
|
||||
#define __KRMQ_INSERT(suf, __scope, __type, __head, __cmp, __lt2) \
|
||||
__scope __type *krmq_insert_##suf(__type **root_, __type *x, unsigned *cnt_) { \
|
||||
unsigned char stack[KRMQ_MAX_DEPTH]; \
|
||||
__type *path[KRMQ_MAX_DEPTH]; \
|
||||
__type *bp, *bq; \
|
||||
__type *p, *q, *r = 0; /* _r_ is potentially the new root */ \
|
||||
int i, which = 0, top, b1, path_len; \
|
||||
unsigned cnt = 0; \
|
||||
bp = *root_, bq = 0; \
|
||||
/* find the insertion location */ \
|
||||
for (p = bp, q = bq, top = path_len = 0; p; q = p, p = p->__head.p[which]) { \
|
||||
int cmp; \
|
||||
cmp = __cmp(x, p); \
|
||||
if (cmp >= 0) cnt += krmq_size_child(__head, p, 0) + 1; \
|
||||
if (cmp == 0) { \
|
||||
if (cnt_) *cnt_ = cnt; \
|
||||
return p; \
|
||||
} \
|
||||
if (p->__head.balance != 0) \
|
||||
bq = q, bp = p, top = 0; \
|
||||
stack[top++] = which = (cmp > 0); \
|
||||
path[path_len++] = p; \
|
||||
} \
|
||||
if (cnt_) *cnt_ = cnt; \
|
||||
x->__head.balance = 0, x->__head.size = 1, x->__head.p[0] = x->__head.p[1] = 0, x->__head.s = x; \
|
||||
if (q == 0) *root_ = x; \
|
||||
else q->__head.p[which] = x; \
|
||||
if (bp == 0) return x; \
|
||||
for (i = 0; i < path_len; ++i) ++path[i]->__head.size; \
|
||||
for (i = path_len - 1; i >= 0; --i) { \
|
||||
krmq_update_min_##suf(path[i], path[i]->__head.p[0], path[i]->__head.p[1]); \
|
||||
if (path[i]->__head.s != x) break; \
|
||||
} \
|
||||
for (p = bp, top = 0; p != x; p = p->__head.p[stack[top]], ++top) /* update balance factors */ \
|
||||
if (stack[top] == 0) --p->__head.balance; \
|
||||
else ++p->__head.balance; \
|
||||
if (bp->__head.balance > -2 && bp->__head.balance < 2) return x; /* no re-balance needed */ \
|
||||
/* re-balance */ \
|
||||
which = (bp->__head.balance < 0); \
|
||||
b1 = which == 0? +1 : -1; \
|
||||
q = bp->__head.p[1 - which]; \
|
||||
if (q->__head.balance == b1) { \
|
||||
r = krmq_rotate1_##suf(bp, which); \
|
||||
q->__head.balance = bp->__head.balance = 0; \
|
||||
} else r = krmq_rotate2_##suf(bp, which); \
|
||||
if (bq == 0) *root_ = r; \
|
||||
else bq->__head.p[bp != bq->__head.p[0]] = r; \
|
||||
return x; \
|
||||
}
|
||||
|
||||
#define __KRMQ_ERASE(suf, __scope, __type, __head, __cmp, __lt2) \
|
||||
__scope __type *krmq_erase_##suf(__type **root_, const __type *x, unsigned *cnt_) { \
|
||||
__type *p, *path[KRMQ_MAX_DEPTH], fake; \
|
||||
unsigned char dir[KRMQ_MAX_DEPTH]; \
|
||||
int i, d = 0, cmp; \
|
||||
unsigned cnt = 0; \
|
||||
fake = **root_, fake.__head.p[0] = *root_, fake.__head.p[1] = 0; \
|
||||
if (cnt_) *cnt_ = 0; \
|
||||
if (x) { \
|
||||
for (cmp = -1, p = &fake; cmp; cmp = __cmp(x, p)) { \
|
||||
int which = (cmp > 0); \
|
||||
if (cmp > 0) cnt += krmq_size_child(__head, p, 0) + 1; \
|
||||
dir[d] = which; \
|
||||
path[d++] = p; \
|
||||
p = p->__head.p[which]; \
|
||||
if (p == 0) { \
|
||||
if (cnt_) *cnt_ = 0; \
|
||||
return 0; \
|
||||
} \
|
||||
} \
|
||||
cnt += krmq_size_child(__head, p, 0) + 1; /* because p==x is not counted */ \
|
||||
} else { \
|
||||
for (p = &fake, cnt = 1; p; p = p->__head.p[0]) \
|
||||
dir[d] = 0, path[d++] = p; \
|
||||
p = path[--d]; \
|
||||
} \
|
||||
if (cnt_) *cnt_ = cnt; \
|
||||
for (i = 1; i < d; ++i) --path[i]->__head.size; \
|
||||
if (p->__head.p[1] == 0) { /* ((1,.)2,3)4 => (1,3)4; p=2 */ \
|
||||
path[d-1]->__head.p[dir[d-1]] = p->__head.p[0]; \
|
||||
} else { \
|
||||
__type *q = p->__head.p[1]; \
|
||||
if (q->__head.p[0] == 0) { /* ((1,2)3,4)5 => ((1)2,4)5; p=3,q=2 */ \
|
||||
q->__head.p[0] = p->__head.p[0]; \
|
||||
q->__head.balance = p->__head.balance; \
|
||||
path[d-1]->__head.p[dir[d-1]] = q; \
|
||||
path[d] = q, dir[d++] = 1; \
|
||||
q->__head.size = p->__head.size - 1; \
|
||||
} else { /* ((1,((.,2)3,4)5)6,7)8 => ((1,(2,4)5)3,7)8; p=6 */ \
|
||||
__type *r; \
|
||||
int e = d++; /* backup _d_ */\
|
||||
for (;;) { \
|
||||
dir[d] = 0; \
|
||||
path[d++] = q; \
|
||||
r = q->__head.p[0]; \
|
||||
if (r->__head.p[0] == 0) break; \
|
||||
q = r; \
|
||||
} \
|
||||
r->__head.p[0] = p->__head.p[0]; \
|
||||
q->__head.p[0] = r->__head.p[1]; \
|
||||
r->__head.p[1] = p->__head.p[1]; \
|
||||
r->__head.balance = p->__head.balance; \
|
||||
path[e-1]->__head.p[dir[e-1]] = r; \
|
||||
path[e] = r, dir[e] = 1; \
|
||||
for (i = e + 1; i < d; ++i) --path[i]->__head.size; \
|
||||
r->__head.size = p->__head.size - 1; \
|
||||
} \
|
||||
} \
|
||||
for (i = d - 1; i >= 0; --i) /* not sure why adding condition "path[i]->__head.s==p" doesn't work */ \
|
||||
krmq_update_min_##suf(path[i], path[i]->__head.p[0], path[i]->__head.p[1]); \
|
||||
while (--d > 0) { \
|
||||
__type *q = path[d]; \
|
||||
int which, other, b1 = 1, b2 = 2; \
|
||||
which = dir[d], other = 1 - which; \
|
||||
if (which) b1 = -b1, b2 = -b2; \
|
||||
q->__head.balance += b1; \
|
||||
if (q->__head.balance == b1) break; \
|
||||
else if (q->__head.balance == b2) { \
|
||||
__type *r = q->__head.p[other]; \
|
||||
if (r->__head.balance == -b1) { \
|
||||
path[d-1]->__head.p[dir[d-1]] = krmq_rotate2_##suf(q, which); \
|
||||
} else { \
|
||||
path[d-1]->__head.p[dir[d-1]] = krmq_rotate1_##suf(q, which); \
|
||||
if (r->__head.balance == 0) { \
|
||||
r->__head.balance = -b1; \
|
||||
q->__head.balance = b1; \
|
||||
break; \
|
||||
} else r->__head.balance = q->__head.balance = 0; \
|
||||
} \
|
||||
} \
|
||||
} \
|
||||
*root_ = fake.__head.p[0]; \
|
||||
return p; \
|
||||
}
|
||||
|
||||
#define krmq_free(__type, __head, __root, __free) do { \
|
||||
__type *_p, *_q; \
|
||||
for (_p = __root; _p; _p = _q) { \
|
||||
if (_p->__head.p[0] == 0) { \
|
||||
_q = _p->__head.p[1]; \
|
||||
__free(_p); \
|
||||
} else { \
|
||||
_q = _p->__head.p[0]; \
|
||||
_p->__head.p[0] = _q->__head.p[1]; \
|
||||
_q->__head.p[1] = _p; \
|
||||
} \
|
||||
} \
|
||||
} while (0)
|
||||
|
||||
#define __KRMQ_ITR(suf, __scope, __type, __head, __cmp) \
|
||||
struct krmq_itr_##suf { \
|
||||
const __type *stack[KRMQ_MAX_DEPTH], **top; \
|
||||
}; \
|
||||
__scope void krmq_itr_first_##suf(const __type *root, struct krmq_itr_##suf *itr) { \
|
||||
const __type *p; \
|
||||
for (itr->top = itr->stack - 1, p = root; p; p = p->__head.p[0]) \
|
||||
*++itr->top = p; \
|
||||
} \
|
||||
__scope int krmq_itr_find_##suf(const __type *root, const __type *x, struct krmq_itr_##suf *itr) { \
|
||||
const __type *p = root; \
|
||||
itr->top = itr->stack - 1; \
|
||||
while (p != 0) { \
|
||||
int cmp; \
|
||||
*++itr->top = p; \
|
||||
cmp = __cmp(x, p); \
|
||||
if (cmp < 0) p = p->__head.p[0]; \
|
||||
else if (cmp > 0) p = p->__head.p[1]; \
|
||||
else break; \
|
||||
} \
|
||||
return p? 1 : 0; \
|
||||
} \
|
||||
__scope int krmq_itr_next_bidir_##suf(struct krmq_itr_##suf *itr, int dir) { \
|
||||
const __type *p; \
|
||||
if (itr->top < itr->stack) return 0; \
|
||||
dir = !!dir; \
|
||||
p = (*itr->top)->__head.p[dir]; \
|
||||
if (p) { /* go down */ \
|
||||
for (; p; p = p->__head.p[!dir]) \
|
||||
*++itr->top = p; \
|
||||
return 1; \
|
||||
} else { /* go up */ \
|
||||
do { \
|
||||
p = *itr->top--; \
|
||||
} while (itr->top >= itr->stack && p == (*itr->top)->__head.p[dir]); \
|
||||
return itr->top < itr->stack? 0 : 1; \
|
||||
} \
|
||||
} \
|
||||
|
||||
/**
|
||||
* Insert a node to the tree
|
||||
*
|
||||
* @param suf name suffix used in KRMQ_INIT()
|
||||
* @param proot pointer to the root of the tree (in/out: root may change)
|
||||
* @param x node to insert (in)
|
||||
* @param cnt number of nodes smaller than or equal to _x_; can be NULL (out)
|
||||
*
|
||||
* @return _x_ if not present in the tree, or the node equal to x.
|
||||
*/
|
||||
#define krmq_insert(suf, proot, x, cnt) krmq_insert_##suf(proot, x, cnt)
|
||||
|
||||
/**
|
||||
* Find a node in the tree
|
||||
*
|
||||
* @param suf name suffix used in KRMQ_INIT()
|
||||
* @param root root of the tree
|
||||
* @param x node value to find (in)
|
||||
* @param cnt number of nodes smaller than or equal to _x_; can be NULL (out)
|
||||
*
|
||||
* @return node equal to _x_ if present, or NULL if absent
|
||||
*/
|
||||
#define krmq_find(suf, root, x, cnt) krmq_find_##suf(root, x, cnt)
|
||||
#define krmq_interval(suf, root, x, lower, upper) krmq_interval_##suf(root, x, lower, upper)
|
||||
#define krmq_rmq(suf, root, lo, up) krmq_rmq_##suf(root, lo, up)
|
||||
|
||||
/**
|
||||
* Delete a node from the tree
|
||||
*
|
||||
* @param suf name suffix used in KRMQ_INIT()
|
||||
* @param proot pointer to the root of the tree (in/out: root may change)
|
||||
* @param x node value to delete; if NULL, delete the first node (in)
|
||||
*
|
||||
* @return node removed from the tree if present, or NULL if absent
|
||||
*/
|
||||
#define krmq_erase(suf, proot, x, cnt) krmq_erase_##suf(proot, x, cnt)
|
||||
#define krmq_erase_first(suf, proot) krmq_erase_##suf(proot, 0, 0)
|
||||
|
||||
#define krmq_itr_t(suf) struct krmq_itr_##suf
|
||||
|
||||
/**
|
||||
* Place the iterator at the smallest object
|
||||
*
|
||||
* @param suf name suffix used in KRMQ_INIT()
|
||||
* @param root root of the tree
|
||||
* @param itr iterator
|
||||
*/
|
||||
#define krmq_itr_first(suf, root, itr) krmq_itr_first_##suf(root, itr)
|
||||
|
||||
/**
|
||||
* Place the iterator at the object equal to or greater than the query
|
||||
*
|
||||
* @param suf name suffix used in KRMQ_INIT()
|
||||
* @param root root of the tree
|
||||
* @param x query (in)
|
||||
* @param itr iterator (out)
|
||||
*
|
||||
* @return 1 if find; 0 otherwise. krmq_at(itr) is NULL if and only if query is
|
||||
* larger than all objects in the tree
|
||||
*/
|
||||
#define krmq_itr_find(suf, root, x, itr) krmq_itr_find_##suf(root, x, itr)
|
||||
|
||||
/**
|
||||
* Move to the next object in order
|
||||
*
|
||||
* @param itr iterator (modified)
|
||||
*
|
||||
* @return 1 if there is a next object; 0 otherwise
|
||||
*/
|
||||
#define krmq_itr_next(suf, itr) krmq_itr_next_bidir_##suf(itr, 1)
|
||||
#define krmq_itr_prev(suf, itr) krmq_itr_next_bidir_##suf(itr, 0)
|
||||
|
||||
/**
|
||||
* Return the pointer at the iterator
|
||||
*
|
||||
* @param itr iterator
|
||||
*
|
||||
* @return pointer if present; NULL otherwise
|
||||
*/
|
||||
#define krmq_at(itr) ((itr)->top < (itr)->stack? 0 : *(itr)->top)
|
||||
|
||||
#define KRMQ_INIT2(suf, __scope, __type, __head, __cmp, __lt2) \
|
||||
__KRMQ_FIND(suf, __scope, __type, __head, __cmp) \
|
||||
__KRMQ_RMQ(suf, __scope, __type, __head, __cmp, __lt2) \
|
||||
__KRMQ_ROTATE(suf, __type, __head, __lt2) \
|
||||
__KRMQ_INSERT(suf, __scope, __type, __head, __cmp, __lt2) \
|
||||
__KRMQ_ERASE(suf, __scope, __type, __head, __cmp, __lt2) \
|
||||
__KRMQ_ITR(suf, __scope, __type, __head, __cmp)
|
||||
|
||||
#define KRMQ_INIT(suf, __type, __head, __cmp, __lt2) \
|
||||
KRMQ_INIT2(suf,, __type, __head, __cmp, __lt2)
|
||||
|
||||
#endif
|
||||
@@ -37,6 +37,14 @@
|
||||
#define KS_SEP_LINE 2 // line separator: "\n" (Unix) or "\r\n" (Windows)
|
||||
#define KS_SEP_MAX 2
|
||||
|
||||
#ifndef klib_unused
|
||||
#if (defined __clang__ && __clang_major__ >= 3) || (defined __GNUC__ && __GNUC__ >= 3)
|
||||
#define klib_unused __attribute__ ((__unused__))
|
||||
#else
|
||||
#define klib_unused
|
||||
#endif
|
||||
#endif /* klib_unused */
|
||||
|
||||
#define __KS_TYPE(type_t) \
|
||||
typedef struct __kstream_t { \
|
||||
int begin, end; \
|
||||
@@ -64,7 +72,7 @@
|
||||
}
|
||||
|
||||
#define __KS_INLINED(__read) \
|
||||
static inline int ks_getc(kstream_t *ks) \
|
||||
static inline klib_unused int ks_getc(kstream_t *ks) \
|
||||
{ \
|
||||
if (ks->is_eof && ks->begin >= ks->end) return -1; \
|
||||
if (ks->begin >= ks->end) { \
|
||||
@@ -81,7 +89,7 @@
|
||||
#ifndef KSTRING_T
|
||||
#define KSTRING_T kstring_t
|
||||
typedef struct __kstring_t {
|
||||
unsigned l, m;
|
||||
size_t l, m;
|
||||
char *s;
|
||||
} kstring_t;
|
||||
#endif
|
||||
|
||||
@@ -37,9 +37,26 @@ typedef struct {
|
||||
int depth;
|
||||
} ks_isort_stack_t;
|
||||
|
||||
#define KSORT_SWAP(type_t, a, b) { register type_t t=(a); (a)=(b); (b)=t; }
|
||||
#define KSORT_SWAP(type_t, a, b) { type_t t=(a); (a)=(b); (b)=t; }
|
||||
|
||||
#define KSORT_INIT(name, type_t, __sort_lt) \
|
||||
void ks_heapdown_##name(size_t i, size_t n, type_t l[]) \
|
||||
{ \
|
||||
size_t k = i; \
|
||||
type_t tmp = l[i]; \
|
||||
while ((k = (k << 1) + 1) < n) { \
|
||||
if (k != n - 1 && __sort_lt(l[k], l[k+1])) ++k; \
|
||||
if (__sort_lt(l[k], tmp)) break; \
|
||||
l[i] = l[k]; i = k; \
|
||||
} \
|
||||
l[i] = tmp; \
|
||||
} \
|
||||
void ks_heapmake_##name(size_t lsize, type_t l[]) \
|
||||
{ \
|
||||
size_t i; \
|
||||
for (i = (lsize >> 1) - 1; i != (size_t)(-1); --i) \
|
||||
ks_heapdown_##name(i, lsize, l); \
|
||||
} \
|
||||
type_t ks_ksmall_##name(size_t n, type_t arr[], size_t kk) \
|
||||
{ \
|
||||
type_t *low, *high, *k, *ll, *hh, *mid; \
|
||||
|
||||
@@ -14,6 +14,18 @@
|
||||
#define KSW_EZ_REV_CIGAR 0x80 // reverse CIGAR in the output
|
||||
#define KSW_EZ_SPLICE_FOR 0x100
|
||||
#define KSW_EZ_SPLICE_REV 0x200
|
||||
#define KSW_EZ_SPLICE_FLANK 0x400
|
||||
#define KSW_EZ_SPLICE_CMPLX 0x800 // use the miniprot splice model
|
||||
#define KSW_EZ_SPLICE_SCORE 0x1000 // use splice score
|
||||
|
||||
// The subset of CIGAR operators used by ksw code.
|
||||
// Use MM_CIGAR_* from minimap.h if you need the full list.
|
||||
#define KSW_CIGAR_MATCH 0
|
||||
#define KSW_CIGAR_INS 1
|
||||
#define KSW_CIGAR_DEL 2
|
||||
#define KSW_CIGAR_N_SKIP 3
|
||||
|
||||
#define KSW_SPSC_OFFSET 64
|
||||
|
||||
#ifdef __cplusplus
|
||||
extern "C" {
|
||||
@@ -26,6 +38,7 @@ typedef struct {
|
||||
int mte, mte_q; // max score when reaching the end of target
|
||||
int score; // max score reaching both ends; may be KSW_NEG_INF
|
||||
int m_cigar, n_cigar;
|
||||
int reach_end;
|
||||
uint32_t *cigar;
|
||||
} ksw_extz_t;
|
||||
|
||||
@@ -46,17 +59,20 @@ typedef struct {
|
||||
* @param flag flag (see KSW_EZ_* macros)
|
||||
* @param ez (out) scores and cigar
|
||||
*/
|
||||
void ksw_extz(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int flag, ksw_extz_t *ez);
|
||||
void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int flag, ksw_extz_t *ez);
|
||||
void ksw_extz(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int w, int zdrop, int flag, ksw_extz_t *ez);
|
||||
|
||||
void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
|
||||
|
||||
void ksw_extd(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t gapo, int8_t gape, int8_t gapo2, int8_t gape2, int w, int zdrop, int flag, ksw_extz_t *ez);
|
||||
|
||||
void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t gapo, int8_t gape, int8_t gapo2, int8_t gape2, int w, int zdrop, int flag, ksw_extz_t *ez);
|
||||
int8_t gapo, int8_t gape, int8_t gapo2, int8_t gape2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
|
||||
|
||||
void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t gapo, int8_t gape, int8_t gapo2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez);
|
||||
int8_t gapo, int8_t gape, int8_t gapo2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez);
|
||||
|
||||
void ksw_extf2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t mch, int8_t mis, int8_t e, int w, int xdrop, ksw_extz_t *ez);
|
||||
|
||||
@@ -111,7 +127,7 @@ static inline uint32_t *ksw_push_cigar(void *km, int *n_cigar, int *m_cigar, uin
|
||||
// bit 0-2: which type gets the max - 0 for H, 1 for E, 2 for F, 3 for \tilde{E} and 4 for \tilde{F}
|
||||
// bit 3/0x08: 1 if a continuation on the E state (bit 5/0x20 for a continuation on \tilde{E})
|
||||
// bit 4/0x10: 1 if a continuation on the F state (bit 6/0x40 for a continuation on \tilde{F})
|
||||
static inline void ksw_backtrack(void *km, int is_rot, int is_rev, int with_N, const uint8_t *p, const int *off, const int *off_end, int n_col, int i0, int j0,
|
||||
static inline void ksw_backtrack(void *km, int is_rot, int is_rev, int min_intron_len, const uint8_t *p, const int *off, const int *off_end, int n_col, int i0, int j0,
|
||||
int *m_cigar_, int *n_cigar_, uint32_t **cigar_)
|
||||
{ // p[] - lower 3 bits: which type gets the max; bit
|
||||
int n_cigar = 0, m_cigar = *m_cigar_, i = i0, j = j0, r, state = 0;
|
||||
@@ -122,23 +138,23 @@ static inline void ksw_backtrack(void *km, int is_rot, int is_rev, int with_N, c
|
||||
r = i + j;
|
||||
if (i < off[r]) force_state = 2;
|
||||
if (off_end && i > off_end[r]) force_state = 1;
|
||||
tmp = force_state < 0? p[r * n_col + i - off[r]] : 0;
|
||||
tmp = force_state < 0? p[(size_t)r * n_col + i - off[r]] : 0;
|
||||
} else {
|
||||
if (j < off[i]) force_state = 2;
|
||||
if (off_end && j > off_end[i]) force_state = 1;
|
||||
tmp = force_state < 0? p[i * n_col + j - off[i]] : 0;
|
||||
tmp = force_state < 0? p[(size_t)i * n_col + j - off[i]] : 0;
|
||||
}
|
||||
if (state == 0) state = tmp & 7; // if requesting the H state, find state one maximizes it.
|
||||
else if (!(tmp >> (state + 2) & 1)) state = 0; // if requesting other states, _state_ stays the same if it is a continuation; otherwise, set to H
|
||||
if (state == 0) state = tmp & 7; // TODO: probably this line can be merged into the "else if" line right above; not 100% sure
|
||||
if (force_state >= 0) state = force_state;
|
||||
if (state == 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 0, 1), --i, --j; // match
|
||||
else if (state == 1 || (state == 3 && !with_N)) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 2, 1), --i; // deletion
|
||||
else if (state == 3 && with_N) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 3, 1), --i; // intron
|
||||
else cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 1, 1), --j; // insertion
|
||||
if (state == 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, KSW_CIGAR_MATCH, 1), --i, --j;
|
||||
else if (state == 1 || (state == 3 && min_intron_len <= 0)) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, KSW_CIGAR_DEL, 1), --i;
|
||||
else if (state == 3 && min_intron_len > 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, KSW_CIGAR_N_SKIP, 1), --i;
|
||||
else cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, KSW_CIGAR_INS, 1), --j;
|
||||
}
|
||||
if (i >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 2, i + 1); // first deletion
|
||||
if (j >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 1, j + 1); // first insertion
|
||||
if (i >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, min_intron_len > 0 && i >= min_intron_len? KSW_CIGAR_N_SKIP : KSW_CIGAR_DEL, i + 1); // first deletion
|
||||
if (j >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, KSW_CIGAR_INS, j + 1); // first insertion
|
||||
if (!is_rev)
|
||||
for (i = 0; i < n_cigar>>1; ++i) // reverse CIGAR
|
||||
tmp = cigar[i], cigar[i] = cigar[n_cigar-1-i], cigar[n_cigar-1-i] = tmp;
|
||||
@@ -149,7 +165,7 @@ static inline void ksw_reset_extz(ksw_extz_t *ez)
|
||||
{
|
||||
ez->max_q = ez->max_t = ez->mqe_t = ez->mte_q = -1;
|
||||
ez->max = 0, ez->score = ez->mqe = ez->mte = KSW_NEG_INF;
|
||||
ez->n_cigar = 0, ez->zdropped = 0;
|
||||
ez->n_cigar = 0, ez->zdropped = 0, ez->reach_end = 0;
|
||||
}
|
||||
|
||||
static inline int ksw_apply_zdrop(ksw_extz_t *ez, int is_rot, int32_t H, int a, int b, int zdrop, int8_t e)
|
||||
|
||||
+29
-30
@@ -17,18 +17,20 @@
|
||||
void __cpuidex(int cpuid[4], int func_id, int subfunc_id)
|
||||
{
|
||||
#if defined(__x86_64__)
|
||||
asm volatile ("cpuid"
|
||||
__asm__ volatile ("cpuid"
|
||||
: "=a" (cpuid[0]), "=b" (cpuid[1]), "=c" (cpuid[2]), "=d" (cpuid[3])
|
||||
: "0" (func_id), "2" (subfunc_id));
|
||||
#else // on 32bit, ebx can NOT be used as PIC code
|
||||
asm volatile ("xchgl %%ebx, %1; cpuid; xchgl %%ebx, %1"
|
||||
__asm__ volatile ("xchgl %%ebx, %1; cpuid; xchgl %%ebx, %1"
|
||||
: "=a" (cpuid[0]), "=r" (cpuid[1]), "=c" (cpuid[2]), "=d" (cpuid[3])
|
||||
: "0" (func_id), "2" (subfunc_id));
|
||||
#endif
|
||||
}
|
||||
#endif
|
||||
|
||||
int x86_simd(void)
|
||||
static int ksw_simd = -1;
|
||||
|
||||
static int x86_simd(void)
|
||||
{
|
||||
int flag = 0, cpuid[4], max_id;
|
||||
__cpuidex(cpuid, 0, 0);
|
||||
@@ -50,48 +52,45 @@ int x86_simd(void)
|
||||
return flag;
|
||||
}
|
||||
|
||||
void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int flag, ksw_extz_t *ez)
|
||||
void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez)
|
||||
{
|
||||
extern void ksw_extz2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int flag, ksw_extz_t *ez);
|
||||
extern void ksw_extz2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int flag, ksw_extz_t *ez);
|
||||
unsigned simd;
|
||||
simd = x86_simd();
|
||||
if (simd & SIMD_SSE4_1)
|
||||
ksw_extz2_sse41(km, qlen, query, tlen, target, m, mat, q, e, w, zdrop, flag, ez);
|
||||
else if (simd & SIMD_SSE2)
|
||||
ksw_extz2_sse2(km, qlen, query, tlen, target, m, mat, q, e, w, zdrop, flag, ez);
|
||||
extern void ksw_extz2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
|
||||
extern void ksw_extz2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
|
||||
if (ksw_simd < 0) ksw_simd = x86_simd();
|
||||
if (ksw_simd & SIMD_SSE4_1)
|
||||
ksw_extz2_sse41(km, qlen, query, tlen, target, m, mat, q, e, w, zdrop, end_bonus, flag, ez);
|
||||
else if (ksw_simd & SIMD_SSE2)
|
||||
ksw_extz2_sse2(km, qlen, query, tlen, target, m, mat, q, e, w, zdrop, end_bonus, flag, ez);
|
||||
else abort();
|
||||
}
|
||||
|
||||
void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int flag, ksw_extz_t *ez)
|
||||
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez)
|
||||
{
|
||||
extern void ksw_extd2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int flag, ksw_extz_t *ez);
|
||||
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
|
||||
extern void ksw_extd2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int flag, ksw_extz_t *ez);
|
||||
unsigned simd;
|
||||
simd = x86_simd();
|
||||
if (simd & SIMD_SSE4_1)
|
||||
ksw_extd2_sse41(km, qlen, query, tlen, target, m, mat, q, e, q2, e2, w, zdrop, flag, ez);
|
||||
else if (simd & SIMD_SSE2)
|
||||
ksw_extd2_sse2(km, qlen, query, tlen, target, m, mat, q, e, q2, e2, w, zdrop, flag, ez);
|
||||
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
|
||||
if (ksw_simd < 0) ksw_simd = x86_simd();
|
||||
if (ksw_simd & SIMD_SSE4_1)
|
||||
ksw_extd2_sse41(km, qlen, query, tlen, target, m, mat, q, e, q2, e2, w, zdrop, end_bonus, flag, ez);
|
||||
else if (ksw_simd & SIMD_SSE2)
|
||||
ksw_extd2_sse2(km, qlen, query, tlen, target, m, mat, q, e, q2, e2, w, zdrop, end_bonus, flag, ez);
|
||||
else abort();
|
||||
}
|
||||
|
||||
void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez)
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez)
|
||||
{
|
||||
extern void ksw_exts2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez);
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez);
|
||||
extern void ksw_exts2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez);
|
||||
unsigned simd;
|
||||
simd = x86_simd();
|
||||
if (simd & SIMD_SSE4_1)
|
||||
ksw_exts2_sse41(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, flag, ez);
|
||||
else if (simd & SIMD_SSE2)
|
||||
ksw_exts2_sse2(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, flag, ez);
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez);
|
||||
if (ksw_simd < 0) ksw_simd = x86_simd();
|
||||
if (ksw_simd & SIMD_SSE4_1)
|
||||
ksw_exts2_sse41(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, end_bonus, junc_bonus, junc_pen, flag, junc, ez);
|
||||
else if (ksw_simd & SIMD_SSE2)
|
||||
ksw_exts2_sse2(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, end_bonus, junc_bonus, junc_pen, flag, junc, ez);
|
||||
else abort();
|
||||
}
|
||||
#endif
|
||||
|
||||
+25
-11
@@ -4,27 +4,35 @@
|
||||
#include "ksw2.h"
|
||||
|
||||
#ifdef __SSE2__
|
||||
#ifdef USE_SIMDE
|
||||
#include <simde/x86/sse2.h>
|
||||
#else
|
||||
#include <emmintrin.h>
|
||||
#endif
|
||||
|
||||
#ifdef KSW_SSE2_ONLY
|
||||
#undef __SSE4_1__
|
||||
#endif
|
||||
|
||||
#ifdef __SSE4_1__
|
||||
#ifdef USE_SIMDE
|
||||
#include <simde/x86/sse4.1.h>
|
||||
#else
|
||||
#include <smmintrin.h>
|
||||
#endif
|
||||
#endif
|
||||
|
||||
#ifdef KSW_CPU_DISPATCH
|
||||
#ifdef __SSE4_1__
|
||||
void ksw_extd2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int flag, ksw_extz_t *ez)
|
||||
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez)
|
||||
#else
|
||||
void ksw_extd2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int flag, ksw_extz_t *ez)
|
||||
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez)
|
||||
#endif
|
||||
#else
|
||||
void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int flag, ksw_extz_t *ez)
|
||||
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez)
|
||||
#endif // ~KSW_CPU_DISPATCH
|
||||
{
|
||||
#define __dp_code_block1 \
|
||||
@@ -61,7 +69,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
int with_cigar = !(flag&KSW_EZ_SCORE_ONLY), approx_max = !!(flag&KSW_EZ_APPROX_MAX);
|
||||
int32_t *H = 0, H0 = 0, last_H0_t = 0;
|
||||
uint8_t *qr, *sf, *mem, *mem2 = 0;
|
||||
__m128i q_, q2_, qe_, qe2_, zero_, sc_mch_, sc_mis_, m1_;
|
||||
__m128i q_, q2_, qe_, qe2_, zero_, sc_mch_, sc_mis_, m1_, sc_N_;
|
||||
__m128i *u, *v, *x, *y, *x2, *y2, *s, *p = 0;
|
||||
|
||||
ksw_reset_extz(ez);
|
||||
@@ -76,6 +84,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
qe2_ = _mm_set1_epi8(q2 + e2);
|
||||
sc_mch_ = _mm_set1_epi8(mat[0]);
|
||||
sc_mis_ = _mm_set1_epi8(mat[1]);
|
||||
sc_N_ = mat[m*m-1] == 0? _mm_set1_epi8(-e2) : _mm_set1_epi8(mat[m*m-1]);
|
||||
m1_ = _mm_set1_epi8(m - 1); // wildcard
|
||||
|
||||
if (w < 0) w = tlen > qlen? tlen : qlen;
|
||||
@@ -110,7 +119,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
for (t = 0; t < tlen_ * 16; ++t) H[t] = KSW_NEG_INF;
|
||||
}
|
||||
if (with_cigar) {
|
||||
mem2 = (uint8_t*)kmalloc(km, ((qlen + tlen - 1) * n_col_ + 1) * 16);
|
||||
mem2 = (uint8_t*)kmalloc(km, ((size_t)(qlen + tlen - 1) * n_col_ + 1) * 16);
|
||||
p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4);
|
||||
off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int) * 2);
|
||||
off_end = off + qlen + tlen - 1;
|
||||
@@ -162,10 +171,11 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
tmp = _mm_cmpeq_epi8(sq, st);
|
||||
#ifdef __SSE4_1__
|
||||
tmp = _mm_blendv_epi8(sc_mis_, sc_mch_, tmp);
|
||||
tmp = _mm_blendv_epi8(tmp, sc_N_, mask);
|
||||
#else
|
||||
tmp = _mm_or_si128(_mm_andnot_si128(tmp, sc_mis_), _mm_and_si128(tmp, sc_mch_));
|
||||
tmp = _mm_or_si128(_mm_andnot_si128(mask, tmp), _mm_and_si128(mask, sc_N_));
|
||||
#endif
|
||||
tmp = _mm_andnot_si128(mask, tmp);
|
||||
_mm_storeu_si128((__m128i*)((int8_t*)s + t), tmp);
|
||||
}
|
||||
} else {
|
||||
@@ -216,7 +226,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
#endif
|
||||
}
|
||||
} else if (!(flag&KSW_EZ_RIGHT)) { // gap left-alignment
|
||||
__m128i *pr = p + r * n_col_ - st_;
|
||||
__m128i *pr = p + (size_t)r * n_col_ - st_;
|
||||
off[r] = st, off_end[r] = en;
|
||||
for (t = st_; t <= en_; ++t) {
|
||||
__m128i d, z, a, b, a2, b2, xt1, x2t1, vt1, ut, tmp;
|
||||
@@ -263,7 +273,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
_mm_store_si128(&pr[t], d);
|
||||
}
|
||||
} else { // gap right-alignment
|
||||
__m128i *pr = p + r * n_col_ - st_;
|
||||
__m128i *pr = p + (size_t)r * n_col_ - st_;
|
||||
off[r] = st, off_end[r] = en;
|
||||
for (t = st_; t <= en_; ++t) {
|
||||
__m128i d, z, a, b, a2, b2, xt1, x2t1, vt1, ut, tmp;
|
||||
@@ -348,7 +358,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
} else H[0] = v8[0] - qe, max_H = H[0], max_t = 0; // special casing r==0
|
||||
// update ez
|
||||
if (en0 == tlen - 1 && H[en0] > ez->mte)
|
||||
ez->mte = H[en0], ez->mte_q = r - en;
|
||||
ez->mte = H[en0], ez->mte_q = r - en0;
|
||||
if (r - st0 == qlen - 1 && H[st0] > ez->mqe)
|
||||
ez->mqe = H[st0], ez->mqe_t = st0;
|
||||
if (ksw_apply_zdrop(ez, 1, max_H, r, max_t, zdrop, e2)) break;
|
||||
@@ -378,10 +388,14 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
if (!approx_max) kfree(km, H);
|
||||
if (with_cigar) { // backtrack
|
||||
int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
|
||||
if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY))
|
||||
if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY)) {
|
||||
ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||
else if (ez->max_t >= 0 && ez->max_q >= 0)
|
||||
} else if (!ez->zdropped && (flag&KSW_EZ_EXTZ_ONLY) && ez->mqe + end_bonus > (int)ez->max) {
|
||||
ez->reach_end = 1;
|
||||
ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, ez->mqe_t, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||
} else if (ez->max_t >= 0 && ez->max_q >= 0) {
|
||||
ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||
}
|
||||
kfree(km, mem2); kfree(km, off);
|
||||
}
|
||||
}
|
||||
|
||||
+118
-23
@@ -4,27 +4,34 @@
|
||||
#include "ksw2.h"
|
||||
|
||||
#ifdef __SSE2__
|
||||
#ifdef USE_SIMDE
|
||||
#include <simde/x86/sse2.h>
|
||||
#else
|
||||
#include <emmintrin.h>
|
||||
|
||||
#endif
|
||||
#ifdef KSW_SSE2_ONLY
|
||||
#undef __SSE4_1__
|
||||
#endif
|
||||
|
||||
#ifdef __SSE4_1__
|
||||
#ifdef USE_SIMDE
|
||||
#include <simde/x86/sse4.1.h>
|
||||
#else
|
||||
#include <smmintrin.h>
|
||||
#endif
|
||||
#endif
|
||||
|
||||
#ifdef KSW_CPU_DISPATCH
|
||||
#ifdef __SSE4_1__
|
||||
void ksw_exts2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez)
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez)
|
||||
#else
|
||||
void ksw_exts2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez)
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez)
|
||||
#endif
|
||||
#else
|
||||
void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez)
|
||||
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez)
|
||||
#endif // ~KSW_CPU_DISPATCH
|
||||
{
|
||||
#define __dp_code_block1 \
|
||||
@@ -59,11 +66,12 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
int with_cigar = !(flag&KSW_EZ_SCORE_ONLY), approx_max = !!(flag&KSW_EZ_APPROX_MAX);
|
||||
int32_t *H = 0, H0 = 0, last_H0_t = 0;
|
||||
uint8_t *qr, *sf, *mem, *mem2 = 0;
|
||||
__m128i q_, q2_, qe_, zero_, sc_mch_, sc_mis_, m1_;
|
||||
__m128i q_, q2_, qe_, zero_, sc_mch_, sc_mis_, sc_N_, m1_;
|
||||
__m128i *u, *v, *x, *y, *x2, *s, *p = 0, *donor, *acceptor;
|
||||
|
||||
ksw_reset_extz(ez);
|
||||
if (m <= 1 || qlen <= 0 || tlen <= 0 || q2 <= q + e) return;
|
||||
assert((flag & KSW_EZ_SPLICE_FOR) == 0 || (flag & KSW_EZ_SPLICE_REV) == 0); // can't be both set
|
||||
|
||||
zero_ = _mm_set1_epi8(0);
|
||||
q_ = _mm_set1_epi8(q);
|
||||
@@ -71,6 +79,7 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
qe_ = _mm_set1_epi8(q + e);
|
||||
sc_mch_ = _mm_set1_epi8(mat[0]);
|
||||
sc_mis_ = _mm_set1_epi8(mat[1]);
|
||||
sc_N_ = mat[m*m-1] == 0? _mm_set1_epi8(-e) : _mm_set1_epi8(mat[m*m-1]);
|
||||
m1_ = _mm_set1_epi8(m - 1); // wildcard
|
||||
|
||||
tlen_ = (tlen + 15) / 16;
|
||||
@@ -99,7 +108,7 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
for (t = 0; t < tlen_ * 16; ++t) H[t] = KSW_NEG_INF;
|
||||
}
|
||||
if (with_cigar) {
|
||||
mem2 = (uint8_t*)kmalloc(km, ((qlen + tlen - 1) * n_col_ + 1) * 16);
|
||||
mem2 = (uint8_t*)kmalloc(km, ((size_t)(qlen + tlen - 1) * n_col_ + 1) * 16);
|
||||
p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4);
|
||||
off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int) * 2);
|
||||
off_end = off + qlen + tlen - 1;
|
||||
@@ -110,19 +119,100 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
|
||||
// set the donor and acceptor arrays. TODO: this assumes 0/1/2/3 encoding!
|
||||
if (flag & (KSW_EZ_SPLICE_FOR|KSW_EZ_SPLICE_REV)) {
|
||||
memset(donor, -noncan, tlen_ * 16);
|
||||
for (t = 0; t < tlen - 2; ++t) {
|
||||
int is_can = 0; // is a canonical site
|
||||
if ((flag & KSW_EZ_SPLICE_FOR) && target[t+1] == 2 && target[t+2] == 3) is_can = 1;
|
||||
if ((flag & KSW_EZ_SPLICE_REV) && target[t+1] == 1 && target[t+2] == 3) is_can = 1;
|
||||
if (is_can) ((int8_t*)donor)[t] = 0;
|
||||
const int sp0[4] = { 8, 15, 21, 30 };
|
||||
int sp[4];
|
||||
if (flag & KSW_EZ_SPLICE_CMPLX) {
|
||||
for (t = 0; t < 4; ++t)
|
||||
sp[t] = (int)((double)sp0[t] / 3. + .499);
|
||||
} else {
|
||||
sp[0] = flag&KSW_EZ_SPLICE_FLANK? noncan / 2 : 0;
|
||||
sp[1] = sp[2] = sp[3] = noncan;
|
||||
}
|
||||
memset(donor, -sp[3], tlen_ * 16);
|
||||
memset(acceptor, -sp[3], tlen_ * 16);
|
||||
if (!(flag & KSW_EZ_REV_CIGAR)) {
|
||||
for (t = 0; t < tlen - 4; ++t) {
|
||||
int z = 3;
|
||||
if (flag & KSW_EZ_SPLICE_FOR) {
|
||||
if (target[t+1] == 2 && target[t+2] == 3) // |GT.
|
||||
z = target[t+3] == 0 || target[t+3] == 2? -1 : 0; // |GTr or not
|
||||
else if (target[t+1] == 2 && target[t+2] == 1) z = 1; // |GC.
|
||||
else if (target[t+1] == 0 && target[t+2] == 3) z = 2; // |AT.
|
||||
} else if (flag & KSW_EZ_SPLICE_REV) {
|
||||
if (target[t+1] == 1 && target[t+2] == 3) // |CT. (revcomp of .AG|)
|
||||
z = target[t+3] == 0 || target[t+3] == 2? -1 : 0;
|
||||
else if (target[t+1] == 2 && target[t+2] == 3) z = 2; // |GT. (revcomp of .AC|)
|
||||
}
|
||||
((int8_t*)donor)[t] = z < 0? 0 : -sp[z];
|
||||
}
|
||||
memset(acceptor, -noncan, tlen_ * 16);
|
||||
for (t = 2; t < tlen; ++t) {
|
||||
int is_can = 0;
|
||||
if ((flag & KSW_EZ_SPLICE_FOR) && target[t-1] == 0 && target[t] == 2) is_can = 1;
|
||||
if ((flag & KSW_EZ_SPLICE_REV) && target[t-1] == 0 && target[t] == 1) is_can = 1;
|
||||
if (is_can) ((int8_t*)acceptor)[t] = 0;
|
||||
int z = 3;
|
||||
if (flag & KSW_EZ_SPLICE_FOR) {
|
||||
if (target[t-1] == 0 && target[t] == 2) // .AG|
|
||||
z = target[t-2] == 1 || target[t-2] == 3? -1 : 0; // yAG| or not
|
||||
else if (target[t-1] == 0 && target[t] == 1) z = 2; // .AC|
|
||||
} else if (flag & KSW_EZ_SPLICE_REV) {
|
||||
if (target[t-1] == 0 && target[t] == 1) // .AC| (revcomp of |GT.)
|
||||
z = target[t-2] == 1 || target[t-2] == 3? -1 : 0; // yAC| or not
|
||||
else if (target[t-1] == 2 && target[t] == 1) z = 1; // .GC| (revcomp of |GC.)
|
||||
else if (target[t-1] == 0 && target[t] == 3) z = 2; // .AT| (revcomp of |AT.)
|
||||
}
|
||||
((int8_t*)acceptor)[t] = z < 0? 0 : -sp[z];
|
||||
}
|
||||
} else {
|
||||
for (t = 0; t < tlen - 4; ++t) {
|
||||
int z = 3;
|
||||
if (flag & KSW_EZ_SPLICE_FOR) {
|
||||
if (target[t+1] == 2 && target[t+2] == 0) // |GA. (rev of .AG|)
|
||||
z = target[t+3] == 1 || target[t+3] == 3? -1 : 0;
|
||||
else if (target[t+1] == 1 && target[t+2] == 0) z = 2; // |CA. (rev of .AC|)
|
||||
} else if (flag & KSW_EZ_SPLICE_REV) {
|
||||
if (target[t+1] == 1 && target[t+2] == 0) // |CA. (comp of |GT.)
|
||||
z = target[t+3] == 1 || target[t+3] == 3? -1 : 0;
|
||||
else if (target[t+1] == 1 && target[t+2] == 2) z = 1; // |CG. (comp of |GC.)
|
||||
else if (target[t+1] == 3 && target[t+2] == 0) z = 2; // |TA. (comp of |AT.)
|
||||
}
|
||||
((int8_t*)donor)[t] = z < 0? 0 : -sp[z];
|
||||
}
|
||||
for (t = 2; t < tlen; ++t) {
|
||||
int z = 3;
|
||||
if (flag & KSW_EZ_SPLICE_FOR) {
|
||||
if (target[t-1] == 3 && target[t] == 2) // .TG| (rev of |GT.)
|
||||
z = target[t-2] == 0 || target[t-2] == 2? -1 : 0;
|
||||
else if (target[t-1] == 1 && target[t] == 2) z = 1; // .CG| (rev of |GC.)
|
||||
else if (target[t-1] == 3 && target[t] == 0) z = 2; // .TA| (rev of |AT.)
|
||||
} else if (flag & KSW_EZ_SPLICE_REV) {
|
||||
if (target[t-1] == 3 && target[t] == 1) // .TC| (comp of .AG|)
|
||||
z = target[t-2] == 0 || target[t-2] == 2? -1 : 0;
|
||||
else if (target[t-1] == 3 && target[t] == 2) z = 2; // .TG| (comp of .AC|)
|
||||
}
|
||||
((int8_t*)acceptor)[t] = z < 0? 0 : -sp[z];
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
if (junc && (flag & KSW_EZ_SPLICE_SCORE)) { // junc[] keeps the donor score
|
||||
uint8_t donor_val = !!(flag & KSW_EZ_SPLICE_FOR) == !(flag & KSW_EZ_REV_CIGAR)? 0 : 1;
|
||||
for (t = 0; t < tlen - 1; ++t)
|
||||
((int8_t*)donor)[t] += junc[t+1] == 0xff || (junc[t+1]&1) != donor_val? -junc_pen : (int8_t)(junc[t+1]>>1) - (int8_t)KSW_SPSC_OFFSET;
|
||||
for (t = 0; t < tlen - 1; ++t)
|
||||
((int8_t*)acceptor)[t] += junc[t+1] == 0xff || (junc[t+1]&1) != !donor_val? -junc_pen : (int8_t)(junc[t+1]>>1) - (int8_t)KSW_SPSC_OFFSET;
|
||||
//for (t = 0; t < tlen - 1; ++t) if (junc[t+1] != 0xff) fprintf(stderr, "Y2\t%d\t%d\t%c\t%d\n", ((int8_t*)donor)[t], ((int8_t*)acceptor)[t], "DA"[junc[t+1]&1], (int8_t)(junc[t+1]>>1) - (int8_t)KSW_SPSC_OFFSET);
|
||||
} else if (junc) { // junc[] keeps the splice sites
|
||||
if (!(flag & KSW_EZ_REV_CIGAR)) {
|
||||
for (t = 0; t < tlen - 1; ++t)
|
||||
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t+1]&1)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t+1]&8)))
|
||||
((int8_t*)donor)[t] += junc_bonus;
|
||||
for (t = 0; t < tlen; ++t)
|
||||
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t]&2)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t]&4)))
|
||||
((int8_t*)acceptor)[t] += junc_bonus;
|
||||
} else {
|
||||
for (t = 0; t < tlen - 1; ++t)
|
||||
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t+1]&2)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t+1]&4)))
|
||||
((int8_t*)donor)[t] += junc_bonus;
|
||||
for (t = 0; t < tlen; ++t)
|
||||
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t]&1)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t]&8)))
|
||||
((int8_t*)acceptor)[t] += junc_bonus;
|
||||
}
|
||||
}
|
||||
|
||||
@@ -159,10 +249,11 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
tmp = _mm_cmpeq_epi8(sq, st);
|
||||
#ifdef __SSE4_1__
|
||||
tmp = _mm_blendv_epi8(sc_mis_, sc_mch_, tmp);
|
||||
tmp = _mm_blendv_epi8(tmp, sc_N_, mask);
|
||||
#else
|
||||
tmp = _mm_or_si128(_mm_andnot_si128(tmp, sc_mis_), _mm_and_si128(tmp, sc_mch_));
|
||||
tmp = _mm_or_si128(_mm_andnot_si128(mask, tmp), _mm_and_si128(mask, sc_N_));
|
||||
#endif
|
||||
tmp = _mm_andnot_si128(mask, tmp);
|
||||
_mm_storeu_si128((__m128i*)((int8_t*)s + t), tmp);
|
||||
}
|
||||
} else {
|
||||
@@ -331,7 +422,7 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
} else H[0] = v8[0] - qe, max_H = H[0], max_t = 0; // special casing r==0
|
||||
// update ez
|
||||
if (en0 == tlen - 1 && H[en0] > ez->mte)
|
||||
ez->mte = H[en0], ez->mte_q = r - en;
|
||||
ez->mte = H[en0], ez->mte_q = r - en0;
|
||||
if (r - st0 == qlen - 1 && H[st0] > ez->mqe)
|
||||
ez->mqe = H[st0], ez->mqe_t = st0;
|
||||
if (ksw_apply_zdrop(ez, 1, max_H, r, max_t, zdrop, 0)) break;
|
||||
@@ -361,10 +452,14 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
if (!approx_max) kfree(km, H);
|
||||
if (with_cigar) { // backtrack
|
||||
int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
|
||||
if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY))
|
||||
ksw_backtrack(km, 1, rev_cigar, 1, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||
else if (ez->max_t >= 0 && ez->max_q >= 0)
|
||||
ksw_backtrack(km, 1, rev_cigar, 1, (uint8_t*)p, off, off_end, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||
if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY)) {
|
||||
ksw_backtrack(km, 1, rev_cigar, long_thres, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||
} else if (!ez->zdropped && (flag&KSW_EZ_EXTZ_ONLY) && ez->mqe + end_bonus > (int)ez->max) {
|
||||
ez->reach_end = 1;
|
||||
ksw_backtrack(km, 1, rev_cigar, long_thres, (uint8_t*)p, off, off_end, n_col_*16, ez->mqe_t, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||
} else if (ez->max_t >= 0 && ez->max_q >= 0) {
|
||||
ksw_backtrack(km, 1, rev_cigar, long_thres, (uint8_t*)p, off, off_end, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||
}
|
||||
kfree(km, mem2); kfree(km, off);
|
||||
}
|
||||
}
|
||||
|
||||
+25
-11
@@ -3,24 +3,32 @@
|
||||
#include "ksw2.h"
|
||||
|
||||
#ifdef __SSE2__
|
||||
#ifdef USE_SIMDE
|
||||
#include <simde/x86/sse2.h>
|
||||
#else
|
||||
#include <emmintrin.h>
|
||||
#endif
|
||||
|
||||
#ifdef KSW_SSE2_ONLY
|
||||
#undef __SSE4_1__
|
||||
#endif
|
||||
|
||||
#ifdef __SSE4_1__
|
||||
#ifdef USE_SIMDE
|
||||
#include <simde/x86/sse4.1.h>
|
||||
#else
|
||||
#include <smmintrin.h>
|
||||
#endif
|
||||
#endif
|
||||
|
||||
#ifdef KSW_CPU_DISPATCH
|
||||
#ifdef __SSE4_1__
|
||||
void ksw_extz2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int flag, ksw_extz_t *ez)
|
||||
void ksw_extz2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez)
|
||||
#else
|
||||
void ksw_extz2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int flag, ksw_extz_t *ez)
|
||||
void ksw_extz2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez)
|
||||
#endif
|
||||
#else
|
||||
void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int flag, ksw_extz_t *ez)
|
||||
void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez)
|
||||
#endif // ~KSW_CPU_DISPATCH
|
||||
{
|
||||
#define __dp_code_block1 \
|
||||
@@ -50,7 +58,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
int with_cigar = !(flag&KSW_EZ_SCORE_ONLY), approx_max = !!(flag&KSW_EZ_APPROX_MAX);
|
||||
int32_t *H = 0, H0 = 0, last_H0_t = 0;
|
||||
uint8_t *qr, *sf, *mem, *mem2 = 0;
|
||||
__m128i q_, qe2_, zero_, flag1_, flag2_, flag8_, flag16_, sc_mch_, sc_mis_, m1_, max_sc_;
|
||||
__m128i q_, qe2_, zero_, flag1_, flag2_, flag8_, flag16_, sc_mch_, sc_mis_, sc_N_, m1_, max_sc_;
|
||||
__m128i *u, *v, *x, *y, *s, *p = 0;
|
||||
|
||||
ksw_reset_extz(ez);
|
||||
@@ -65,6 +73,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
flag16_ = _mm_set1_epi8(0x10);
|
||||
sc_mch_ = _mm_set1_epi8(mat[0]);
|
||||
sc_mis_ = _mm_set1_epi8(mat[1]);
|
||||
sc_N_ = mat[m*m-1] == 0? _mm_set1_epi8(-e) : _mm_set1_epi8(mat[m*m-1]);
|
||||
m1_ = _mm_set1_epi8(m - 1); // wildcard
|
||||
max_sc_ = _mm_set1_epi8(mat[0] + (q + e) * 2);
|
||||
|
||||
@@ -88,7 +97,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
for (t = 0; t < tlen_ * 16; ++t) H[t] = KSW_NEG_INF;
|
||||
}
|
||||
if (with_cigar) {
|
||||
mem2 = (uint8_t*)kmalloc(km, ((qlen + tlen - 1) * n_col_ + 1) * 16);
|
||||
mem2 = (uint8_t*)kmalloc(km, ((size_t)(qlen + tlen - 1) * n_col_ + 1) * 16);
|
||||
p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4);
|
||||
off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int) * 2);
|
||||
off_end = off + qlen + tlen - 1;
|
||||
@@ -130,10 +139,11 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
tmp = _mm_cmpeq_epi8(sq, st);
|
||||
#ifdef __SSE4_1__
|
||||
tmp = _mm_blendv_epi8(sc_mis_, sc_mch_, tmp);
|
||||
tmp = _mm_blendv_epi8(tmp, sc_N_, mask);
|
||||
#else
|
||||
tmp = _mm_or_si128(_mm_andnot_si128(tmp, sc_mis_), _mm_and_si128(tmp, sc_mch_));
|
||||
tmp = _mm_or_si128(_mm_andnot_si128(mask, tmp), _mm_and_si128(mask, sc_N_));
|
||||
#endif
|
||||
tmp = _mm_andnot_si128(mask, tmp);
|
||||
_mm_storeu_si128((__m128i*)((uint8_t*)s + t), tmp);
|
||||
}
|
||||
} else {
|
||||
@@ -167,7 +177,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
#endif
|
||||
}
|
||||
} else if (!(flag&KSW_EZ_RIGHT)) { // gap left-alignment
|
||||
__m128i *pr = p + r * n_col_ - st_;
|
||||
__m128i *pr = p + (size_t)r * n_col_ - st_;
|
||||
off[r] = st, off_end[r] = en;
|
||||
for (t = st_; t <= en_; ++t) {
|
||||
__m128i d, z, a, b, xt1, vt1, ut, tmp;
|
||||
@@ -193,7 +203,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
_mm_store_si128(&pr[t], d);
|
||||
}
|
||||
} else { // gap right-alignment
|
||||
__m128i *pr = p + r * n_col_ - st_;
|
||||
__m128i *pr = p + (size_t)r * n_col_ - st_;
|
||||
off[r] = st, off_end[r] = en;
|
||||
for (t = st_; t <= en_; ++t) {
|
||||
__m128i d, z, a, b, xt1, vt1, ut, tmp;
|
||||
@@ -259,7 +269,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
} else H[0] = v8[0] - qe - qe, max_H = H[0], max_t = 0; // special casing r==0
|
||||
// update ez
|
||||
if (en0 == tlen - 1 && H[en0] > ez->mte)
|
||||
ez->mte = H[en0], ez->mte_q = r - en;
|
||||
ez->mte = H[en0], ez->mte_q = r - en0;
|
||||
if (r - st0 == qlen - 1 && H[st0] > ez->mqe)
|
||||
ez->mqe = H[st0], ez->mqe_t = st0;
|
||||
if (ksw_apply_zdrop(ez, 1, max_H, r, max_t, zdrop, e)) break;
|
||||
@@ -289,10 +299,14 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
|
||||
if (!approx_max) kfree(km, H);
|
||||
if (with_cigar) { // backtrack
|
||||
int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
|
||||
if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY))
|
||||
if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY)) {
|
||||
ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||
else if (ez->max_t >= 0 && ez->max_q >= 0)
|
||||
} else if (!ez->zdropped && (flag&KSW_EZ_EXTZ_ONLY) && ez->mqe + end_bonus > (int)ez->max) {
|
||||
ez->reach_end = 1;
|
||||
ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, ez->mqe_t, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||
} else if (ez->max_t >= 0 && ez->max_q >= 0) {
|
||||
ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
|
||||
}
|
||||
kfree(km, mem2); kfree(km, off);
|
||||
}
|
||||
}
|
||||
|
||||
+7
-2
@@ -1,9 +1,14 @@
|
||||
#include <stdlib.h>
|
||||
#include <stdint.h>
|
||||
#include <string.h>
|
||||
#include <emmintrin.h>
|
||||
#include "ksw2.h"
|
||||
|
||||
#ifdef USE_SIMDE
|
||||
#include <simde/x86/sse2.h>
|
||||
#else
|
||||
#include <emmintrin.h>
|
||||
#endif
|
||||
|
||||
#ifdef __GNUC__
|
||||
#define LIKELY(x) __builtin_expect((x),1)
|
||||
#define UNLIKELY(x) __builtin_expect((x),0)
|
||||
@@ -122,7 +127,7 @@ int ksw_ll_i16(void *q_, int tlen, const uint8_t *target, int _gapo, int _gape,
|
||||
f = _mm_max_epi16(f, h);
|
||||
h = _mm_load_si128(H0 + j);
|
||||
}
|
||||
for (k = 0; LIKELY(k < 16); ++k) {
|
||||
for (k = 0; LIKELY(k < 8); ++k) {
|
||||
f = _mm_slli_si128(f, 2);
|
||||
for (j = 0; LIKELY(j < slen); ++j) {
|
||||
h = _mm_load_si128(H1 + j);
|
||||
|
||||
@@ -2,6 +2,7 @@
|
||||
#include <stdlib.h>
|
||||
#include <limits.h>
|
||||
#include <stdint.h>
|
||||
#include "kthread.h"
|
||||
|
||||
#if (defined(WIN32) || defined(_WIN32)) && defined(_MSC_VER)
|
||||
#define __sync_fetch_and_add(ptr, addend) _InterlockedExchangeAdd((void*)ptr, addend)
|
||||
|
||||
@@ -0,0 +1,368 @@
|
||||
#include <stdint.h>
|
||||
#include <string.h>
|
||||
#include <stdio.h>
|
||||
#include <assert.h>
|
||||
#include "mmpriv.h"
|
||||
#include "kalloc.h"
|
||||
#include "krmq.h"
|
||||
|
||||
static int64_t mg_chain_bk_end(int32_t max_drop, const mm128_t *z, const int32_t *f, const int64_t *p, int32_t *t, int64_t k)
|
||||
{
|
||||
int64_t i = z[k].y, end_i = -1, max_i = i;
|
||||
int32_t max_s = 0;
|
||||
if (i < 0 || t[i] != 0) return i;
|
||||
do {
|
||||
int32_t s;
|
||||
t[i] = 2;
|
||||
end_i = i = p[i];
|
||||
s = i < 0? z[k].x : (int32_t)z[k].x - f[i];
|
||||
if (s > max_s) max_s = s, max_i = i;
|
||||
else if (max_s - s > max_drop) break;
|
||||
} while (i >= 0 && t[i] == 0);
|
||||
for (i = z[k].y; i >= 0 && i != end_i; i = p[i]) // reset modified t[]
|
||||
t[i] = 0;
|
||||
return max_i;
|
||||
}
|
||||
|
||||
uint64_t *mg_chain_backtrack(void *km, int64_t n, const int32_t *f, const int64_t *p, int32_t *v, int32_t *t, int32_t min_cnt, int32_t min_sc, int32_t max_drop, int32_t *n_u_, int32_t *n_v_)
|
||||
{
|
||||
mm128_t *z;
|
||||
uint64_t *u;
|
||||
int64_t i, k, n_z, n_v;
|
||||
int32_t n_u;
|
||||
|
||||
*n_u_ = *n_v_ = 0;
|
||||
for (i = 0, n_z = 0; i < n; ++i) // precompute n_z
|
||||
if (f[i] >= min_sc) ++n_z;
|
||||
if (n_z == 0) return 0;
|
||||
z = Kmalloc(km, mm128_t, n_z);
|
||||
for (i = 0, k = 0; i < n; ++i) // populate z[]
|
||||
if (f[i] >= min_sc) z[k].x = f[i], z[k++].y = i;
|
||||
radix_sort_128x(z, z + n_z);
|
||||
|
||||
memset(t, 0, n * 4);
|
||||
for (k = n_z - 1, n_v = n_u = 0; k >= 0; --k) { // precompute n_u
|
||||
if (t[z[k].y] == 0) {
|
||||
int64_t n_v0 = n_v, end_i;
|
||||
int32_t sc;
|
||||
end_i = mg_chain_bk_end(max_drop, z, f, p, t, k);
|
||||
for (i = z[k].y; i != end_i; i = p[i])
|
||||
++n_v, t[i] = 1;
|
||||
sc = i < 0? z[k].x : (int32_t)z[k].x - f[i];
|
||||
if (sc >= min_sc && n_v > n_v0 && n_v - n_v0 >= min_cnt)
|
||||
++n_u;
|
||||
else n_v = n_v0;
|
||||
}
|
||||
}
|
||||
u = Kmalloc(km, uint64_t, n_u);
|
||||
memset(t, 0, n * 4);
|
||||
for (k = n_z - 1, n_v = n_u = 0; k >= 0; --k) { // populate u[]
|
||||
if (t[z[k].y] == 0) {
|
||||
int64_t n_v0 = n_v, end_i;
|
||||
int32_t sc;
|
||||
end_i = mg_chain_bk_end(max_drop, z, f, p, t, k);
|
||||
for (i = z[k].y; i != end_i; i = p[i])
|
||||
v[n_v++] = i, t[i] = 1;
|
||||
sc = i < 0? z[k].x : (int32_t)z[k].x - f[i];
|
||||
if (sc >= min_sc && n_v > n_v0 && n_v - n_v0 >= min_cnt)
|
||||
u[n_u++] = (uint64_t)sc << 32 | (n_v - n_v0);
|
||||
else n_v = n_v0;
|
||||
}
|
||||
}
|
||||
kfree(km, z);
|
||||
assert(n_v < INT32_MAX);
|
||||
*n_u_ = n_u, *n_v_ = n_v;
|
||||
return u;
|
||||
}
|
||||
|
||||
static mm128_t *compact_a(void *km, int32_t n_u, uint64_t *u, int32_t n_v, int32_t *v, mm128_t *a)
|
||||
{
|
||||
mm128_t *b, *w;
|
||||
uint64_t *u2;
|
||||
int64_t i, j, k;
|
||||
|
||||
// write the result to b[]
|
||||
b = Kmalloc(km, mm128_t, n_v);
|
||||
for (i = 0, k = 0; i < n_u; ++i) {
|
||||
int32_t k0 = k, ni = (int32_t)u[i];
|
||||
for (j = 0; j < ni; ++j)
|
||||
b[k++] = a[v[k0 + (ni - j - 1)]];
|
||||
}
|
||||
kfree(km, v);
|
||||
|
||||
// sort u[] and a[] by the target position, such that adjacent chains may be joined
|
||||
w = Kmalloc(km, mm128_t, n_u);
|
||||
for (i = k = 0; i < n_u; ++i) {
|
||||
w[i].x = b[k].x, w[i].y = (uint64_t)k<<32|i;
|
||||
k += (int32_t)u[i];
|
||||
}
|
||||
radix_sort_128x(w, w + n_u);
|
||||
u2 = Kmalloc(km, uint64_t, n_u);
|
||||
for (i = k = 0; i < n_u; ++i) {
|
||||
int32_t j = (int32_t)w[i].y, n = (int32_t)u[j];
|
||||
u2[i] = u[j];
|
||||
memcpy(&a[k], &b[w[i].y>>32], n * sizeof(mm128_t));
|
||||
k += n;
|
||||
}
|
||||
memcpy(u, u2, n_u * 8);
|
||||
memcpy(b, a, k * sizeof(mm128_t)); // write _a_ to _b_ and deallocate _a_ because _a_ is oversized, sometimes a lot
|
||||
kfree(km, a); kfree(km, w); kfree(km, u2);
|
||||
return b;
|
||||
}
|
||||
|
||||
static inline int32_t comput_sc(const mm128_t *ai, const mm128_t *aj, int32_t max_dist_x, int32_t max_dist_y, int32_t bw, float chn_pen_gap, float chn_pen_skip, int is_cdna, int n_seg)
|
||||
{
|
||||
int32_t dq = (int32_t)ai->y - (int32_t)aj->y, dr, dd, dg, q_span, sc;
|
||||
int32_t sidi = (ai->y & MM_SEED_SEG_MASK) >> MM_SEED_SEG_SHIFT;
|
||||
int32_t sidj = (aj->y & MM_SEED_SEG_MASK) >> MM_SEED_SEG_SHIFT;
|
||||
if (dq <= 0 || dq > max_dist_x) return INT32_MIN;
|
||||
dr = (int32_t)(ai->x - aj->x);
|
||||
if (sidi == sidj && (dr == 0 || dq > max_dist_y)) return INT32_MIN;
|
||||
dd = dr > dq? dr - dq : dq - dr;
|
||||
if (sidi == sidj && dd > bw) return INT32_MIN;
|
||||
if (n_seg > 1 && !is_cdna && sidi == sidj && dr > max_dist_y) return INT32_MIN;
|
||||
dg = dr < dq? dr : dq;
|
||||
q_span = aj->y>>32&0xff;
|
||||
sc = q_span < dg? q_span : dg;
|
||||
if (dd || dg > q_span) {
|
||||
float lin_pen, log_pen;
|
||||
lin_pen = chn_pen_gap * (float)dd + chn_pen_skip * (float)dg;
|
||||
log_pen = dd >= 1? mg_log2(dd + 1) : 0.0f; // mg_log2() only works for dd>=2
|
||||
if (is_cdna || sidi != sidj) {
|
||||
if (sidi != sidj && dr == 0) ++sc; // possibly due to overlapping paired ends; give a minor bonus
|
||||
else if (dr > dq || sidi != sidj) sc -= (int)(lin_pen < log_pen? lin_pen : log_pen); // deletion or jump between paired ends
|
||||
else sc -= (int)(lin_pen + .5f * log_pen);
|
||||
} else sc -= (int)(lin_pen + .5f * log_pen);
|
||||
}
|
||||
return sc;
|
||||
}
|
||||
|
||||
/* Input:
|
||||
* a[].x: rev<<63 | tid<<32 | tpos
|
||||
* a[].y: flags<<40 | q_span<<32 | q_pos
|
||||
* Output:
|
||||
* n_u: #chains
|
||||
* u[]: score<<32 | #anchors (sum of lower 32 bits of u[] is the returned length of a[])
|
||||
* input a[] is deallocated on return
|
||||
*/
|
||||
mm128_t *mg_lchain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int max_iter, int min_cnt, int min_sc, float chn_pen_gap, float chn_pen_skip,
|
||||
int is_cdna, int n_seg, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km)
|
||||
{ // TODO: make sure this works when n has more than 32 bits
|
||||
int32_t *f, *t, *v, n_u, n_v, mmax_f = 0, max_drop = bw;
|
||||
int64_t *p, i, j, max_ii, st = 0;
|
||||
uint64_t *u;
|
||||
|
||||
if (_u) *_u = 0, *n_u_ = 0;
|
||||
if (n == 0 || a == 0) {
|
||||
kfree(km, a);
|
||||
return 0;
|
||||
}
|
||||
if (max_dist_x < bw) max_dist_x = bw;
|
||||
if (max_dist_y < bw && !is_cdna) max_dist_y = bw;
|
||||
if (is_cdna) max_drop = INT32_MAX;
|
||||
p = Kmalloc(km, int64_t, n);
|
||||
f = Kmalloc(km, int32_t, n);
|
||||
v = Kmalloc(km, int32_t, n);
|
||||
t = Kcalloc(km, int32_t, n);
|
||||
|
||||
// fill the score and backtrack arrays
|
||||
for (i = 0, max_ii = -1; i < n; ++i) {
|
||||
int64_t max_j = -1, end_j;
|
||||
int32_t max_f = a[i].y>>32&0xff, n_skip = 0;
|
||||
while (st < i && (a[i].x>>32 != a[st].x>>32 || a[i].x > a[st].x + max_dist_x)) ++st;
|
||||
if (i - st > max_iter) st = i - max_iter;
|
||||
for (j = i - 1; j >= st; --j) {
|
||||
int32_t sc;
|
||||
sc = comput_sc(&a[i], &a[j], max_dist_x, max_dist_y, bw, chn_pen_gap, chn_pen_skip, is_cdna, n_seg);
|
||||
if (sc == INT32_MIN) continue;
|
||||
sc += f[j];
|
||||
if (sc > max_f) {
|
||||
max_f = sc, max_j = j;
|
||||
if (n_skip > 0) --n_skip;
|
||||
} else if (t[j] == (int32_t)i) {
|
||||
if (++n_skip > max_skip)
|
||||
break;
|
||||
}
|
||||
if (p[j] >= 0) t[p[j]] = i;
|
||||
}
|
||||
end_j = j;
|
||||
if (max_ii < 0 || a[i].x - a[max_ii].x > (int64_t)max_dist_x) {
|
||||
int32_t max = INT32_MIN;
|
||||
max_ii = -1;
|
||||
for (j = i - 1; j >= st; --j)
|
||||
if (max < f[j]) max = f[j], max_ii = j;
|
||||
}
|
||||
if (max_ii >= 0 && max_ii < end_j) {
|
||||
int32_t tmp;
|
||||
tmp = comput_sc(&a[i], &a[max_ii], max_dist_x, max_dist_y, bw, chn_pen_gap, chn_pen_skip, is_cdna, n_seg);
|
||||
if (tmp != INT32_MIN && max_f < tmp + f[max_ii])
|
||||
max_f = tmp + f[max_ii], max_j = max_ii;
|
||||
}
|
||||
f[i] = max_f, p[i] = max_j;
|
||||
v[i] = max_j >= 0 && v[max_j] > max_f? v[max_j] : max_f; // v[] keeps the peak score up to i; f[] is the score ending at i, not always the peak
|
||||
if (max_ii < 0 || (a[i].x - a[max_ii].x <= (int64_t)max_dist_x && f[max_ii] < f[i]))
|
||||
max_ii = i;
|
||||
if (mmax_f < max_f) mmax_f = max_f;
|
||||
//fprintf(stderr, "X1\t%ld\t%ld:%d\t%ld\t%ld:%d\t%ld\t%ld\n", (long)i, (long)(a[i].x>>32), (int32_t)a[i].x, (long)max_j, max_j<0?-1L:(long)(a[max_j].x>>32), max_j<0?-1:(int32_t)a[max_j].x, (long)max_f, (long)v[i]);
|
||||
}
|
||||
|
||||
u = mg_chain_backtrack(km, n, f, p, v, t, min_cnt, min_sc, max_drop, &n_u, &n_v);
|
||||
*n_u_ = n_u, *_u = u; // NB: note that u[] may not be sorted by score here
|
||||
kfree(km, p); kfree(km, f); kfree(km, t);
|
||||
if (n_u == 0) {
|
||||
kfree(km, a); kfree(km, v);
|
||||
return 0;
|
||||
}
|
||||
return compact_a(km, n_u, u, n_v, v, a);
|
||||
}
|
||||
|
||||
typedef struct lc_elem_s {
|
||||
int32_t y;
|
||||
int64_t i;
|
||||
double pri;
|
||||
KRMQ_HEAD(struct lc_elem_s) head;
|
||||
} lc_elem_t;
|
||||
|
||||
#define lc_elem_cmp(a, b) ((a)->y < (b)->y? -1 : (a)->y > (b)->y? 1 : ((a)->i > (b)->i) - ((a)->i < (b)->i))
|
||||
#define lc_elem_lt2(a, b) ((a)->pri < (b)->pri)
|
||||
KRMQ_INIT(lc_elem, lc_elem_t, head, lc_elem_cmp, lc_elem_lt2)
|
||||
|
||||
KALLOC_POOL_INIT(rmq, lc_elem_t)
|
||||
|
||||
static inline int32_t comput_sc_simple(const mm128_t *ai, const mm128_t *aj, float chn_pen_gap, float chn_pen_skip, int32_t *exact, int32_t *width)
|
||||
{
|
||||
int32_t dq = (int32_t)ai->y - (int32_t)aj->y, dr, dd, dg, q_span, sc;
|
||||
dr = (int32_t)(ai->x - aj->x);
|
||||
*width = dd = dr > dq? dr - dq : dq - dr;
|
||||
dg = dr < dq? dr : dq;
|
||||
q_span = aj->y>>32&0xff;
|
||||
sc = q_span < dg? q_span : dg;
|
||||
if (exact) *exact = (dd == 0 && dg <= q_span);
|
||||
if (dd || dq > q_span) {
|
||||
float lin_pen, log_pen;
|
||||
lin_pen = chn_pen_gap * (float)dd + chn_pen_skip * (float)dg;
|
||||
log_pen = dd >= 1? mg_log2(dd + 1) : 0.0f; // mg_log2() only works for dd>=2
|
||||
sc -= (int)(lin_pen + .5f * log_pen);
|
||||
}
|
||||
return sc;
|
||||
}
|
||||
|
||||
mm128_t *mg_lchain_rmq(int max_dist, int max_dist_inner, int bw, int max_chn_skip, int cap_rmq_size, int min_cnt, int min_sc, float chn_pen_gap, float chn_pen_skip,
|
||||
int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km)
|
||||
{
|
||||
int32_t *f,*t, *v, n_u, n_v, mmax_f = 0, max_rmq_size = 0, max_drop = bw;
|
||||
int64_t *p, i, i0, st = 0, st_inner = 0;
|
||||
uint64_t *u;
|
||||
lc_elem_t *root = 0, *root_inner = 0;
|
||||
void *mem_mp = 0;
|
||||
kmp_rmq_t *mp;
|
||||
|
||||
if (_u) *_u = 0, *n_u_ = 0;
|
||||
if (n == 0 || a == 0) {
|
||||
kfree(km, a);
|
||||
return 0;
|
||||
}
|
||||
if (max_dist < bw) max_dist = bw;
|
||||
if (max_dist_inner < 0) max_dist_inner = 0;
|
||||
if (max_dist_inner > max_dist) max_dist_inner = max_dist;
|
||||
p = Kmalloc(km, int64_t, n);
|
||||
f = Kmalloc(km, int32_t, n);
|
||||
t = Kcalloc(km, int32_t, n);
|
||||
v = Kmalloc(km, int32_t, n);
|
||||
mem_mp = km_init2(km, 0x10000);
|
||||
mp = kmp_init_rmq(mem_mp);
|
||||
|
||||
// fill the score and backtrack arrays
|
||||
for (i = i0 = 0; i < n; ++i) {
|
||||
int64_t max_j = -1;
|
||||
int32_t q_span = a[i].y>>32&0xff, max_f = q_span;
|
||||
lc_elem_t s, *q, *r, lo, hi;
|
||||
// add in-range anchors
|
||||
if (i0 < i && a[i0].x != a[i].x) {
|
||||
int64_t j;
|
||||
for (j = i0; j < i; ++j) {
|
||||
q = kmp_alloc_rmq(mp);
|
||||
q->y = (int32_t)a[j].y, q->i = j, q->pri = -(f[j] + 0.5 * chn_pen_gap * ((int32_t)a[j].x + (int32_t)a[j].y));
|
||||
krmq_insert(lc_elem, &root, q, 0);
|
||||
if (max_dist_inner > 0) {
|
||||
r = kmp_alloc_rmq(mp);
|
||||
*r = *q;
|
||||
krmq_insert(lc_elem, &root_inner, r, 0);
|
||||
}
|
||||
}
|
||||
i0 = i;
|
||||
}
|
||||
// get rid of active chains out of range
|
||||
while (st < i && (a[i].x>>32 != a[st].x>>32 || a[i].x > a[st].x + max_dist || krmq_size(head, root) > cap_rmq_size)) {
|
||||
s.y = (int32_t)a[st].y, s.i = st;
|
||||
if ((q = krmq_find(lc_elem, root, &s, 0)) != 0) {
|
||||
q = krmq_erase(lc_elem, &root, q, 0);
|
||||
kmp_free_rmq(mp, q);
|
||||
}
|
||||
++st;
|
||||
}
|
||||
if (max_dist_inner > 0) { // similar to the block above, but applied to the inner tree
|
||||
while (st_inner < i && (a[i].x>>32 != a[st_inner].x>>32 || a[i].x > a[st_inner].x + max_dist_inner || krmq_size(head, root_inner) > cap_rmq_size)) {
|
||||
s.y = (int32_t)a[st_inner].y, s.i = st_inner;
|
||||
if ((q = krmq_find(lc_elem, root_inner, &s, 0)) != 0) {
|
||||
q = krmq_erase(lc_elem, &root_inner, q, 0);
|
||||
kmp_free_rmq(mp, q);
|
||||
}
|
||||
++st_inner;
|
||||
}
|
||||
}
|
||||
// RMQ
|
||||
lo.i = INT32_MAX, lo.y = (int32_t)a[i].y - max_dist;
|
||||
hi.i = 0, hi.y = (int32_t)a[i].y;
|
||||
if ((q = krmq_rmq(lc_elem, root, &lo, &hi)) != 0) {
|
||||
int32_t sc, exact, width, n_skip = 0;
|
||||
int64_t j = q->i;
|
||||
assert(q->y >= lo.y && q->y <= hi.y);
|
||||
sc = f[j] + comput_sc_simple(&a[i], &a[j], chn_pen_gap, chn_pen_skip, &exact, &width);
|
||||
if (width <= bw && sc > max_f) max_f = sc, max_j = j;
|
||||
if (!exact && root_inner && (int32_t)a[i].y > 0) {
|
||||
lc_elem_t *lo, *hi;
|
||||
s.y = (int32_t)a[i].y - 1, s.i = n;
|
||||
krmq_interval(lc_elem, root_inner, &s, &lo, &hi);
|
||||
if (lo) {
|
||||
const lc_elem_t *q;
|
||||
int32_t width;
|
||||
krmq_itr_t(lc_elem) itr;
|
||||
krmq_itr_find(lc_elem, root_inner, lo, &itr);
|
||||
while ((q = krmq_at(&itr)) != 0) {
|
||||
if (q->y < (int32_t)a[i].y - max_dist_inner) break;
|
||||
j = q->i;
|
||||
sc = f[j] + comput_sc_simple(&a[i], &a[j], chn_pen_gap, chn_pen_skip, 0, &width);
|
||||
if (width <= bw) {
|
||||
if (sc > max_f) {
|
||||
max_f = sc, max_j = j;
|
||||
if (n_skip > 0) --n_skip;
|
||||
} else if (t[j] == (int32_t)i) {
|
||||
if (++n_skip > max_chn_skip)
|
||||
break;
|
||||
}
|
||||
if (p[j] >= 0) t[p[j]] = i;
|
||||
}
|
||||
if (!krmq_itr_prev(lc_elem, &itr)) break;
|
||||
}
|
||||
}
|
||||
}
|
||||
}
|
||||
// set max
|
||||
assert(max_j < 0 || (a[max_j].x < a[i].x && (int32_t)a[max_j].y < (int32_t)a[i].y));
|
||||
f[i] = max_f, p[i] = max_j;
|
||||
v[i] = max_j >= 0 && v[max_j] > max_f? v[max_j] : max_f; // v[] keeps the peak score up to i; f[] is the score ending at i, not always the peak
|
||||
if (mmax_f < max_f) mmax_f = max_f;
|
||||
if (max_rmq_size < krmq_size(head, root)) max_rmq_size = krmq_size(head, root);
|
||||
}
|
||||
km_destroy(mem_mp);
|
||||
|
||||
u = mg_chain_backtrack(km, n, f, p, v, t, min_cnt, min_sc, max_drop, &n_u, &n_v);
|
||||
*n_u_ = n_u, *_u = u; // NB: note that u[] may not be sorted by score here
|
||||
kfree(km, p); kfree(km, f); kfree(km, t);
|
||||
if (n_u == 0) {
|
||||
kfree(km, a); kfree(km, v);
|
||||
return 0;
|
||||
}
|
||||
return compact_a(km, n_u, u, n_v, v, a);
|
||||
}
|
||||
Submodule
+1
Submodule lib/simde added at b30129b3b4
@@ -1,12 +1,11 @@
|
||||
#include <stdlib.h>
|
||||
#include <stdio.h>
|
||||
#include <string.h>
|
||||
#include <errno.h>
|
||||
#include "bseq.h"
|
||||
#include "minimap.h"
|
||||
#include "mmpriv.h"
|
||||
#include "getopt.h"
|
||||
|
||||
#define MM_VERSION "2.2-r409"
|
||||
#include "ketopt.h"
|
||||
|
||||
#ifdef __linux__
|
||||
#include <sys/resource.h>
|
||||
@@ -22,49 +21,120 @@ void liftrlimit()
|
||||
void liftrlimit() {}
|
||||
#endif
|
||||
|
||||
static struct option long_options[] = {
|
||||
{ "bucket-bits", required_argument, 0, 0 },
|
||||
{ "mb-size", required_argument, 0, 'K' },
|
||||
{ "int-rname", no_argument, 0, 0 }, // obsolete; kept as a placeholder
|
||||
{ "no-kalloc", no_argument, 0, 0 },
|
||||
{ "print-qname", no_argument, 0, 0 },
|
||||
{ "no-self", no_argument, 0, 0 },
|
||||
{ "print-seeds", no_argument, 0, 0 },
|
||||
{ "max-chain-skip", required_argument, 0, 0 },
|
||||
{ "min-dp-len", required_argument, 0, 0 },
|
||||
{ "print-aln-seq", no_argument, 0, 0 },
|
||||
{ "splice", no_argument, 0, 0 },
|
||||
{ "cost-non-gt-ag", required_argument, 0, 0 },
|
||||
{ "no-sam-sq", no_argument, 0, 0 },
|
||||
{ "approx-ext", no_argument, 0, 0 },
|
||||
{ "help", no_argument, 0, 'h' },
|
||||
{ "max-intron-len", required_argument, 0, 'G' },
|
||||
{ "version", no_argument, 0, 'V' },
|
||||
{ "min-count", required_argument, 0, 'n' },
|
||||
{ "min-chain-score",required_argument, 0, 'm' },
|
||||
{ "mask-level", required_argument, 0, 'M' },
|
||||
{ "min-dp-score", required_argument, 0, 's' },
|
||||
{ "sam", no_argument, 0, 'a' },
|
||||
{ 0, 0, 0, 0}
|
||||
static ko_longopt_t long_options[] = {
|
||||
{ "bucket-bits", ko_required_argument, 300 },
|
||||
{ "mb-size", ko_required_argument, 'K' },
|
||||
{ "seed", ko_required_argument, 302 },
|
||||
{ "no-kalloc", ko_no_argument, 303 },
|
||||
{ "print-qname", ko_no_argument, 304 },
|
||||
{ "no-self", ko_no_argument, 'D' },
|
||||
{ "print-seeds", ko_no_argument, 306 },
|
||||
{ "max-chain-skip", ko_required_argument, 307 },
|
||||
{ "min-dp-len", ko_required_argument, 308 },
|
||||
{ "print-aln-seq", ko_no_argument, 309 },
|
||||
{ "splice", ko_no_argument, 310 },
|
||||
{ "cost-non-gt-ag", ko_required_argument, 'C' },
|
||||
{ "no-long-join", ko_no_argument, 312 },
|
||||
{ "sr", ko_optional_argument, 313 },
|
||||
{ "frag", ko_required_argument, 314 },
|
||||
{ "secondary", ko_required_argument, 315 },
|
||||
{ "cs", ko_optional_argument, 316 },
|
||||
{ "end-bonus", ko_required_argument, 317 },
|
||||
{ "no-pairing", ko_no_argument, 318 }, // deprecated but reserved for backward compatibility
|
||||
{ "splice-flank", ko_required_argument, 319 },
|
||||
{ "idx-no-seq", ko_no_argument, 320 },
|
||||
{ "end-seed-pen", ko_required_argument, 321 },
|
||||
{ "for-only", ko_no_argument, 322 },
|
||||
{ "rev-only", ko_no_argument, 323 },
|
||||
{ "heap-sort", ko_required_argument, 324 },
|
||||
{ "all-chain", ko_no_argument, 'P' },
|
||||
{ "dual", ko_required_argument, 326 },
|
||||
{ "max-clip-ratio", ko_required_argument, 327 },
|
||||
{ "min-occ-floor", ko_required_argument, 328 },
|
||||
{ "MD", ko_no_argument, 329 },
|
||||
{ "lj-min-ratio", ko_required_argument, 330 },
|
||||
{ "score-N", ko_required_argument, 331 },
|
||||
{ "eqx", ko_no_argument, 332 },
|
||||
{ "paf-no-hit", ko_no_argument, 333 },
|
||||
{ "split-prefix", ko_required_argument, 334 },
|
||||
{ "no-end-flt", ko_no_argument, 335 },
|
||||
{ "hard-mask-level",ko_no_argument, 336 },
|
||||
{ "cap-sw-mem", ko_required_argument, 337 },
|
||||
{ "max-qlen", ko_required_argument, 338 },
|
||||
{ "max-chain-iter", ko_required_argument, 339 },
|
||||
{ "junc-bed", ko_required_argument, 340 },
|
||||
{ "junc-bonus", ko_required_argument, 341 },
|
||||
{ "sam-hit-only", ko_no_argument, 342 },
|
||||
{ "chain-gap-scale",ko_required_argument, 343 },
|
||||
{ "alt", ko_required_argument, 344 },
|
||||
{ "alt-drop", ko_required_argument, 345 },
|
||||
{ "mask-len", ko_required_argument, 346 },
|
||||
{ "rmq", ko_optional_argument, 347 },
|
||||
{ "qstrand", ko_no_argument, 348 },
|
||||
{ "cap-kalloc", ko_required_argument, 349 },
|
||||
{ "q-occ-frac", ko_required_argument, 350 },
|
||||
{ "chain-skip-scale",ko_required_argument,351 },
|
||||
{ "print-chains", ko_no_argument, 352 },
|
||||
{ "no-hash-name", ko_no_argument, 353 },
|
||||
{ "secondary-seq", ko_no_argument, 354 },
|
||||
{ "ds", ko_no_argument, 355 },
|
||||
{ "rmq-inner", ko_required_argument, 356 },
|
||||
{ "spsc", ko_required_argument, 357 },
|
||||
{ "junc-pen", ko_required_argument, 358 },
|
||||
{ "pairing", ko_required_argument, 359 },
|
||||
{ "jump-min-match", ko_required_argument, 360 },
|
||||
{ "write-junc", ko_no_argument, 361 },
|
||||
{ "pass1", ko_required_argument, 362 },
|
||||
{ "dbg-seed-occ", ko_no_argument, 501 },
|
||||
{ "help", ko_no_argument, 'h' },
|
||||
{ "max-intron-len", ko_required_argument, 'G' },
|
||||
{ "version", ko_no_argument, 'V' },
|
||||
{ "min-count", ko_required_argument, 'n' },
|
||||
{ "min-chain-score",ko_required_argument, 'm' },
|
||||
{ "mask-level", ko_required_argument, 'M' },
|
||||
{ "min-dp-score", ko_required_argument, 's' },
|
||||
{ "sam", ko_no_argument, 'a' },
|
||||
{ 0, 0, 0 }
|
||||
};
|
||||
|
||||
static inline int64_t mm_parse_num(const char *str)
|
||||
static inline int64_t mm_parse_num2(const char *str, char **q)
|
||||
{
|
||||
double x;
|
||||
char *p;
|
||||
x = strtod(optarg, &p);
|
||||
if (*p == 'G' || *p == 'g') x *= 1e9;
|
||||
else if (*p == 'M' || *p == 'm') x *= 1e6;
|
||||
else if (*p == 'K' || *p == 'k') x *= 1e3;
|
||||
x = strtod(str, &p);
|
||||
if (*p == 'G' || *p == 'g') x *= 1e9, ++p;
|
||||
else if (*p == 'M' || *p == 'm') x *= 1e6, ++p;
|
||||
else if (*p == 'K' || *p == 'k') x *= 1e3, ++p;
|
||||
if (q) *q = p;
|
||||
return (int64_t)(x + .499);
|
||||
}
|
||||
|
||||
static inline int64_t mm_parse_num(const char *str)
|
||||
{
|
||||
return mm_parse_num2(str, 0);
|
||||
}
|
||||
|
||||
static inline void yes_or_no(mm_mapopt_t *opt, int64_t flag, int long_idx, const char *arg, int yes_to_set)
|
||||
{
|
||||
if (yes_to_set) {
|
||||
if (strcmp(arg, "yes") == 0 || strcmp(arg, "y") == 0) opt->flag |= flag;
|
||||
else if (strcmp(arg, "no") == 0 || strcmp(arg, "n") == 0) opt->flag &= ~flag;
|
||||
else fprintf(stderr, "[WARNING]\033[1;31m option '--%s' only accepts 'yes' or 'no'.\033[0m\n", long_options[long_idx].name);
|
||||
} else {
|
||||
if (strcmp(arg, "yes") == 0 || strcmp(arg, "y") == 0) opt->flag &= ~flag;
|
||||
else if (strcmp(arg, "no") == 0 || strcmp(arg, "n") == 0) opt->flag |= flag;
|
||||
else fprintf(stderr, "[WARNING]\033[1;31m option '--%s' only accepts 'yes' or 'no'.\033[0m\n", long_options[long_idx].name);
|
||||
}
|
||||
}
|
||||
|
||||
int main(int argc, char *argv[])
|
||||
{
|
||||
const char *opt_str = "2aSDw:k:K:t:r:f:Vv:g:G:I:d:XT:s:x:Hcp:M:n:z:A:B:b:O:E:m:N:Qu:R:hF:LC:yYPo:e:U:J:j:";
|
||||
ketopt_t o = KETOPT_INIT;
|
||||
mm_mapopt_t opt;
|
||||
mm_idxopt_t ipt;
|
||||
int i, c, n_threads = 3, long_idx, max_intron_len = 0;
|
||||
char *fnw = 0, *rg = 0, *s;
|
||||
int i, c, n_threads = 3, n_parts, old_best_n = -1;
|
||||
char *fnw = 0, *rg = 0, *fn_bed_junc = 0, *fn_bed_jump = 0, *fn_bed_pass1 = 0, *fn_spsc = 0, *s, *alt_list = 0;
|
||||
FILE *fp_help = stderr;
|
||||
mm_idx_reader_t *idx_rdr;
|
||||
mm_idx_t *mi;
|
||||
@@ -74,162 +144,379 @@ int main(int argc, char *argv[])
|
||||
mm_realtime0 = realtime();
|
||||
mm_set_opt(0, &ipt, &opt);
|
||||
|
||||
while ((c = getopt_long(argc, argv, "aSw:k:K:t:r:f:Vv:g:G:I:d:XT:s:x:Hcp:M:n:z:A:B:O:E:m:N:Qu:R:h", long_options, &long_idx)) >= 0) {
|
||||
if (c == 'w') ipt.w = atoi(optarg);
|
||||
else if (c == 'k') ipt.k = atoi(optarg);
|
||||
else if (c == 'H') ipt.is_hpc = 1;
|
||||
else if (c == 'd') fnw = optarg; // the above are indexing related options, except -I
|
||||
else if (c == 'r') opt.bw = (int)mm_parse_num(optarg);
|
||||
else if (c == 't') n_threads = atoi(optarg);
|
||||
else if (c == 'v') mm_verbose = atoi(optarg);
|
||||
else if (c == 'g') opt.max_gap = (int)mm_parse_num(optarg);
|
||||
else if (c == 'G') max_intron_len = (int)mm_parse_num(optarg);
|
||||
else if (c == 'N') opt.best_n = atoi(optarg);
|
||||
else if (c == 'p') opt.pri_ratio = atof(optarg);
|
||||
else if (c == 'M') opt.mask_level = atof(optarg);
|
||||
while ((c = ketopt(&o, argc, argv, 1, opt_str, long_options)) >= 0) { // test command line options and apply option -x/preset first
|
||||
if (c == 'x') {
|
||||
if (mm_set_opt(o.arg, &ipt, &opt) < 0) {
|
||||
fprintf(stderr, "[ERROR] unknown preset '%s'\n", o.arg);
|
||||
return 1;
|
||||
}
|
||||
} else if (c == ':') {
|
||||
fprintf(stderr, "[ERROR] missing option argument\n");
|
||||
return 1;
|
||||
} else if (c == '?') {
|
||||
fprintf(stderr, "[ERROR] unknown option in \"%s\"\n", argv[o.i - 1]);
|
||||
return 1;
|
||||
}
|
||||
}
|
||||
o = KETOPT_INIT;
|
||||
|
||||
while ((c = ketopt(&o, argc, argv, 1, opt_str, long_options)) >= 0) {
|
||||
if (c == 'w') ipt.w = atoi(o.arg);
|
||||
else if (c == 'k') ipt.k = atoi(o.arg);
|
||||
else if (c == 'H') ipt.flag |= MM_I_HPC;
|
||||
else if (c == 'd') fnw = o.arg; // the above are indexing related options, except -I
|
||||
else if (c == 't') n_threads = atoi(o.arg);
|
||||
else if (c == 'v') mm_verbose = atoi(o.arg);
|
||||
else if (c == 'g') opt.max_gap = (int)mm_parse_num(o.arg);
|
||||
else if (c == 'G') mm_mapopt_max_intron_len(&opt, (int)mm_parse_num(o.arg));
|
||||
else if (c == 'F') opt.max_frag_len = (int)mm_parse_num(o.arg);
|
||||
else if (c == 'N') old_best_n = opt.best_n, opt.best_n = atoi(o.arg);
|
||||
else if (c == 'p') opt.pri_ratio = atof(o.arg);
|
||||
else if (c == 'M') opt.mask_level = atof(o.arg);
|
||||
else if (c == 'c') opt.flag |= MM_F_OUT_CG | MM_F_CIGAR;
|
||||
else if (c == 'S') opt.flag |= MM_F_OUT_CS | MM_F_CIGAR;
|
||||
else if (c == 'X') opt.flag |= MM_F_AVA | MM_F_NO_SELF;
|
||||
else if (c == 'D') opt.flag |= MM_F_NO_DIAG;
|
||||
else if (c == 'P') opt.flag |= MM_F_ALL_CHAINS;
|
||||
else if (c == 'X') opt.flag |= MM_F_ALL_CHAINS | MM_F_NO_DIAG | MM_F_NO_DUAL | MM_F_NO_LJOIN; // -D -P --no-long-join --dual=no
|
||||
else if (c == 'a') opt.flag |= MM_F_OUT_SAM | MM_F_CIGAR;
|
||||
else if (c == 'Q') opt.flag |= MM_F_NO_QUAL;
|
||||
else if (c == 'T') opt.sdust_thres = atoi(optarg);
|
||||
else if (c == 'n') opt.min_cnt = atoi(optarg);
|
||||
else if (c == 'm') opt.min_chain_score = atoi(optarg);
|
||||
else if (c == 'A') opt.a = atoi(optarg);
|
||||
else if (c == 'B') opt.b = atoi(optarg);
|
||||
else if (c == 'z') opt.zdrop = atoi(optarg);
|
||||
else if (c == 's') opt.min_dp_max = atoi(optarg);
|
||||
else if (c == 'I') ipt.batch_size = mm_parse_num(optarg);
|
||||
else if (c == 'K') ipt.mini_batch_size = (int)mm_parse_num(optarg);
|
||||
else if (c == 'R') rg = optarg;
|
||||
else if (c == 'Y') opt.flag |= MM_F_SOFTCLIP;
|
||||
else if (c == 'L') opt.flag |= MM_F_LONG_CIGAR;
|
||||
else if (c == 'y') opt.flag |= MM_F_COPY_COMMENT;
|
||||
else if (c == 'T') opt.sdust_thres = atoi(o.arg);
|
||||
else if (c == 'n') opt.min_cnt = atoi(o.arg);
|
||||
else if (c == 'm') opt.min_chain_score = atoi(o.arg);
|
||||
else if (c == 'A') opt.a = atoi(o.arg);
|
||||
else if (c == 'B') opt.b = atoi(o.arg);
|
||||
else if (c == 'b') opt.transition = atoi(o.arg);
|
||||
else if (c == 's') opt.min_dp_max = atoi(o.arg);
|
||||
else if (c == 'C') opt.noncan = atoi(o.arg);
|
||||
else if (c == 'I') ipt.batch_size = mm_parse_num(o.arg);
|
||||
else if (c == 'K') opt.mini_batch_size = mm_parse_num(o.arg);
|
||||
else if (c == 'e') opt.occ_dist = mm_parse_num(o.arg);
|
||||
else if (c == 'R') rg = o.arg;
|
||||
else if (c == 'h') fp_help = stdout;
|
||||
else if (c == 0 && long_idx == 0) ipt.bucket_bits = atoi(optarg); // --bucket-bits
|
||||
else if (c == 0 && long_idx == 3) mm_dbg_flag |= MM_DBG_NO_KALLOC; // --no-kalloc
|
||||
else if (c == 0 && long_idx == 4) mm_dbg_flag |= MM_DBG_PRINT_QNAME; // --print-qname
|
||||
else if (c == 0 && long_idx == 5) opt.flag |= MM_F_NO_SELF; // --no-self
|
||||
else if (c == 0 && long_idx == 6) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_SEED; // --print-seed
|
||||
else if (c == 0 && long_idx == 7) opt.max_chain_skip = atoi(optarg); // --max-chain-skip
|
||||
else if (c == 0 && long_idx == 8) opt.min_ksw_len = atoi(optarg); // --min-dp-len
|
||||
else if (c == 0 && long_idx == 9) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_ALN_SEQ; // --print-aln-seq
|
||||
else if (c == 0 && long_idx ==10) opt.flag |= MM_F_SPLICE; // --splice
|
||||
else if (c == 0 && long_idx ==11) opt.noncan = atoi(optarg); // --cost-non-gt-ag
|
||||
else if (c == 0 && long_idx ==12) opt.flag |= MM_F_NO_SAM_SQ; // --no-sam-sq
|
||||
else if (c == 0 && long_idx ==13) opt.flag |= MM_F_APPROX_EXT; // --approx-ext
|
||||
else if (c == 'V') {
|
||||
else if (c == '2') opt.flag |= MM_F_2_IO_THREADS;
|
||||
else if (c == 'j') fn_bed_jump = o.arg;
|
||||
else if (c == 'J') {
|
||||
int t;
|
||||
t = atoi(o.arg);
|
||||
if (t == 0) opt.flag |= MM_F_SPLICE_OLD;
|
||||
else if (t == 1) opt.flag &= ~MM_F_SPLICE_OLD;
|
||||
} else if (c == 'o') {
|
||||
if (strcmp(o.arg, "-") != 0) {
|
||||
if (freopen(o.arg, "wb", stdout) == NULL) {
|
||||
fprintf(stderr, "[ERROR]\033[1;31m failed to write the output to file '%s'\033[0m: %s\n", o.arg, strerror(errno));
|
||||
exit(1);
|
||||
}
|
||||
}
|
||||
}
|
||||
else if (c == 300) ipt.bucket_bits = atoi(o.arg); // --bucket-bits
|
||||
else if (c == 302) opt.seed = atoi(o.arg); // --seed
|
||||
else if (c == 303) mm_dbg_flag |= MM_DBG_NO_KALLOC; // --no-kalloc
|
||||
else if (c == 304) mm_dbg_flag |= MM_DBG_PRINT_QNAME; // --print-qname
|
||||
else if (c == 306) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_SEED, n_threads = 1; // --print-seed
|
||||
else if (c == 307) opt.max_chain_skip = atoi(o.arg); // --max-chain-skip
|
||||
else if (c == 339) opt.max_chain_iter = atoi(o.arg); // --max-chain-iter
|
||||
else if (c == 308) opt.min_ksw_len = atoi(o.arg); // --min-dp-len
|
||||
else if (c == 309) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_ALN_SEQ, n_threads = 1; // --print-aln-seq
|
||||
else if (c == 310) opt.flag |= MM_F_SPLICE; // --splice
|
||||
else if (c == 312) opt.flag |= MM_F_NO_LJOIN; // --no-long-join
|
||||
else if (c == 317) opt.end_bonus = atoi(o.arg); // --end-bonus
|
||||
else if (c == 318) opt.flag |= MM_F_INDEPEND_SEG; // --no-pairing (deprecated)
|
||||
else if (c == 320) ipt.flag |= MM_I_NO_SEQ; // --idx-no-seq
|
||||
else if (c == 321) opt.anchor_ext_shift = atoi(o.arg); // --end-seed-pen
|
||||
else if (c == 322) opt.flag |= MM_F_FOR_ONLY; // --for-only
|
||||
else if (c == 323) opt.flag |= MM_F_REV_ONLY; // --rev-only
|
||||
else if (c == 327) opt.max_clip_ratio = atof(o.arg); // --max-clip-ratio
|
||||
else if (c == 328) opt.min_mid_occ = atoi(o.arg); // --min-occ-floor
|
||||
else if (c == 329) opt.flag |= MM_F_OUT_MD; // --MD
|
||||
else if (c == 331) opt.sc_ambi = atoi(o.arg); // --score-N
|
||||
else if (c == 332) opt.flag |= MM_F_EQX; // --eqx
|
||||
else if (c == 333) opt.flag |= MM_F_PAF_NO_HIT; // --paf-no-hit
|
||||
else if (c == 334) opt.split_prefix = o.arg; // --split-prefix
|
||||
else if (c == 335) opt.flag |= MM_F_NO_END_FLT; // --no-end-flt
|
||||
else if (c == 336) opt.flag |= MM_F_HARD_MLEVEL; // --hard-mask-level
|
||||
else if (c == 337) opt.max_sw_mat = mm_parse_num(o.arg); // --cap-sw-mat
|
||||
else if (c == 338) opt.max_qlen = mm_parse_num(o.arg); // --max-qlen
|
||||
else if (c == 340) fn_bed_junc = o.arg; // --junc-bed
|
||||
else if (c == 341) opt.junc_bonus = atoi(o.arg); // --junc-bonus
|
||||
else if (c == 358) opt.junc_pen = atoi(o.arg); // --junc-pen
|
||||
else if (c == 342) opt.flag |= MM_F_SAM_HIT_ONLY; // --sam-hit-only
|
||||
else if (c == 343) opt.chain_gap_scale = atof(o.arg); // --chain-gap-scale
|
||||
else if (c == 351) opt.chain_skip_scale = atof(o.arg); // --chain-skip-scale
|
||||
else if (c == 344) alt_list = o.arg; // --alt
|
||||
else if (c == 345) opt.alt_drop = atof(o.arg); // --alt-drop
|
||||
else if (c == 346) opt.mask_len = mm_parse_num(o.arg); // --mask-len
|
||||
else if (c == 348) opt.flag |= MM_F_QSTRAND | MM_F_NO_INV; // --qstrand
|
||||
else if (c == 349) opt.cap_kalloc = mm_parse_num(o.arg); // --cap-kalloc
|
||||
else if (c == 350) opt.q_occ_frac = atof(o.arg); // --q-occ-frac
|
||||
else if (c == 352) mm_dbg_flag |= MM_DBG_PRINT_CHAIN; // --print-chains
|
||||
else if (c == 353) opt.flag |= MM_F_NO_HASH_NAME; // --no-hash-name
|
||||
else if (c == 354) opt.flag |= MM_F_SECONDARY_SEQ; // --secondary-seq
|
||||
else if (c == 355) opt.flag |= MM_F_OUT_DS; // --ds
|
||||
else if (c == 356) opt.rmq_inner_dist = mm_parse_num(o.arg); // --rmq-inner
|
||||
else if (c == 357) fn_spsc = o.arg; // --spsc
|
||||
else if (c == 360) opt.jump_min_match = mm_parse_num(o.arg); // --jump-min-match
|
||||
else if (c == 361) opt.flag |= MM_F_OUT_JUNC | MM_F_CIGAR; // --write-junc
|
||||
else if (c == 362) fn_bed_pass1 = o.arg; // --jump-pass1
|
||||
else if (c == 501) mm_dbg_flag |= MM_DBG_SEED_FREQ; // --dbg-seed-occ
|
||||
else if (c == 330) {
|
||||
fprintf(stderr, "[WARNING] \033[1;31m --lj-min-ratio has been deprecated.\033[0m\n");
|
||||
} else if (c == 313) { // --sr
|
||||
if (o.arg == 0 || strcmp(o.arg, "dna") == 0) {
|
||||
opt.flag |= MM_F_SR;
|
||||
} else if (strcmp(o.arg, "rna") == 0) {
|
||||
opt.flag |= MM_F_SR_RNA;
|
||||
} else if (strcmp(o.arg, "no") == 0) {
|
||||
opt.flag &= ~(uint64_t)(MM_F_SR|MM_F_SR_RNA);
|
||||
} else if (mm_verbose >= 2) {
|
||||
opt.flag |= MM_F_SR;
|
||||
fprintf(stderr, "[WARNING]\033[1;31m --sr only takes 'dna' or 'rna'. Invalid values are assumed to be 'dna'.\033[0m\n");
|
||||
}
|
||||
} else if (c == 314) { // --frag
|
||||
yes_or_no(&opt, MM_F_FRAG_MODE, o.longidx, o.arg, 1);
|
||||
} else if (c == 315) { // --secondary
|
||||
yes_or_no(&opt, MM_F_NO_PRINT_2ND, o.longidx, o.arg, 0);
|
||||
} else if (c == 316) { // --cs
|
||||
opt.flag |= MM_F_OUT_CS | MM_F_CIGAR;
|
||||
if (o.arg == 0 || strcmp(o.arg, "short") == 0) {
|
||||
opt.flag &= ~MM_F_OUT_CS_LONG;
|
||||
} else if (strcmp(o.arg, "long") == 0) {
|
||||
opt.flag |= MM_F_OUT_CS_LONG;
|
||||
} else if (strcmp(o.arg, "none") == 0) {
|
||||
opt.flag &= ~MM_F_OUT_CS;
|
||||
} else if (mm_verbose >= 2) {
|
||||
fprintf(stderr, "[WARNING]\033[1;31m --cs only takes 'short' or 'long'. Invalid values are assumed to be 'short'.\033[0m\n");
|
||||
}
|
||||
} else if (c == 319) { // --splice-flank
|
||||
yes_or_no(&opt, MM_F_SPLICE_FLANK, o.longidx, o.arg, 1);
|
||||
} else if (c == 324) { // --heap-sort
|
||||
yes_or_no(&opt, MM_F_HEAP_SORT, o.longidx, o.arg, 1);
|
||||
} else if (c == 326) { // --dual
|
||||
yes_or_no(&opt, MM_F_NO_DUAL, o.longidx, o.arg, 0);
|
||||
} else if (c == 347) { // --rmq
|
||||
if (o.arg) yes_or_no(&opt, MM_F_RMQ, o.longidx, o.arg, 1);
|
||||
else opt.flag |= MM_F_RMQ;
|
||||
} else if (c == 359) { // --pairing
|
||||
if (strcmp(o.arg, "no") == 0) opt.flag |= MM_F_INDEPEND_SEG;
|
||||
else if (strcmp(o.arg, "weak") == 0) opt.flag |= MM_F_WEAK_PAIRING, opt.flag &= ~(uint64_t)MM_F_INDEPEND_SEG;
|
||||
else {
|
||||
if (strcmp(o.arg, "strong") != 0 && mm_verbose >= 2)
|
||||
fprintf(stderr, "[WARNING]\033[1;31m unrecognized argument for --pairing; assuming 'strong'.\033[0m\n");
|
||||
opt.flag &= ~(uint64_t)(MM_F_INDEPEND_SEG|MM_F_WEAK_PAIRING);
|
||||
}
|
||||
} else if (c == 'S') {
|
||||
opt.flag |= MM_F_OUT_CS | MM_F_CIGAR | MM_F_OUT_CS_LONG;
|
||||
if (mm_verbose >= 2)
|
||||
fprintf(stderr, "[WARNING]\033[1;31m option -S is deprecated and may be removed in future. Please use --cs=long instead.\033[0m\n");
|
||||
} else if (c == 'V') {
|
||||
puts(MM_VERSION);
|
||||
return 0;
|
||||
} else if (c == 'r') {
|
||||
opt.bw = (int)mm_parse_num2(o.arg, &s);
|
||||
if (*s == ',') opt.bw_long = (int)mm_parse_num2(s + 1, &s);
|
||||
} else if (c == 'U') {
|
||||
opt.min_mid_occ = strtol(o.arg, &s, 10);
|
||||
if (*s == ',') opt.max_mid_occ = strtol(s + 1, &s, 10);
|
||||
} else if (c == 'f') {
|
||||
double x;
|
||||
x = atof(optarg);
|
||||
char *p;
|
||||
x = strtod(o.arg, &p);
|
||||
if (x < 1.0) opt.mid_occ_frac = x, opt.mid_occ = 0;
|
||||
else opt.mid_occ = (int)(x + .499);
|
||||
if (*p == ',') opt.max_occ = (int)(strtod(p+1, &p) + .499);
|
||||
} else if (c == 'u') {
|
||||
if (*optarg == 'b') opt.flag |= MM_F_SPLICE_FOR|MM_F_SPLICE_REV;
|
||||
else if (*optarg == 'B') opt.flag |= MM_F_SPLICE_BOTH;
|
||||
else if (*optarg == 'f') opt.flag |= MM_F_SPLICE_FOR, opt.flag &= ~MM_F_SPLICE_REV;
|
||||
else if (*optarg == 'r') opt.flag |= MM_F_SPLICE_REV, opt.flag &= ~MM_F_SPLICE_FOR;
|
||||
else if (*optarg == 'n') opt.flag &= ~(MM_F_SPLICE_FOR|MM_F_SPLICE_REV);
|
||||
if (*o.arg == 'b') opt.flag |= MM_F_SPLICE_FOR|MM_F_SPLICE_REV; // both strands
|
||||
else if (*o.arg == 'f') opt.flag |= MM_F_SPLICE_FOR, opt.flag &= ~MM_F_SPLICE_REV; // match GT-AG
|
||||
else if (*o.arg == 'r') opt.flag |= MM_F_SPLICE_REV, opt.flag &= ~MM_F_SPLICE_FOR; // match CT-AC (reverse complement of GT-AG)
|
||||
else if (*o.arg == 'n') opt.flag &= ~(MM_F_SPLICE_FOR|MM_F_SPLICE_REV); // don't try to match the GT-AG signal
|
||||
else {
|
||||
fprintf(stderr, "[E::%s] unrecognized cDNA direction\n", __func__);
|
||||
fprintf(stderr, "[ERROR]\033[1;31m unrecognized cDNA direction\033[0m\n");
|
||||
return 1;
|
||||
}
|
||||
} else if (c == 'z') {
|
||||
opt.zdrop = opt.zdrop_inv = strtol(o.arg, &s, 10);
|
||||
if (*s == ',') opt.zdrop_inv = strtol(s + 1, &s, 10);
|
||||
} else if (c == 'O') {
|
||||
opt.q = opt.q2 = strtol(optarg, &s, 10);
|
||||
opt.q = opt.q2 = strtol(o.arg, &s, 10);
|
||||
if (*s == ',') opt.q2 = strtol(s + 1, &s, 10);
|
||||
} else if (c == 'E') {
|
||||
opt.e = opt.e2 = strtol(optarg, &s, 10);
|
||||
opt.e = opt.e2 = strtol(o.arg, &s, 10);
|
||||
if (*s == ',') opt.e2 = strtol(s + 1, &s, 10);
|
||||
} else if (c == 'x') {
|
||||
if (mm_set_opt(optarg, &ipt, &opt) < 0) {
|
||||
fprintf(stderr, "[E::%s] unknown preset '%s'\n", __func__, optarg);
|
||||
}
|
||||
}
|
||||
if (!fnw && !(opt.flag&MM_F_CIGAR))
|
||||
ipt.flag |= MM_I_NO_SEQ;
|
||||
if (mm_check_opt(&ipt, &opt) < 0)
|
||||
return 1;
|
||||
if (opt.best_n == 0) {
|
||||
fprintf(stderr, "[WARNING]\033[1;31m changed '-N 0' to '-N %d --secondary=no'.\033[0m\n", old_best_n);
|
||||
opt.best_n = old_best_n, opt.flag |= MM_F_NO_PRINT_2ND;
|
||||
}
|
||||
}
|
||||
}
|
||||
if ((opt.flag & MM_F_SPLICE) && max_intron_len > 0)
|
||||
opt.max_gap_ref = opt.bw = max_intron_len;
|
||||
|
||||
if (argc == optind || fp_help == stdout) {
|
||||
if (argc == o.ind || fp_help == stdout) {
|
||||
fprintf(fp_help, "Usage: minimap2 [options] <target.fa>|<target.idx> [query.fa] [...]\n");
|
||||
fprintf(fp_help, "Options:\n");
|
||||
fprintf(fp_help, " Indexing:\n");
|
||||
fprintf(fp_help, " -H use homopolymer-compressed k-mer\n");
|
||||
fprintf(fp_help, " -H use homopolymer-compressed k-mer (preferrable for PacBio)\n");
|
||||
fprintf(fp_help, " -k INT k-mer size (no larger than 28) [%d]\n", ipt.k);
|
||||
fprintf(fp_help, " -w INT minizer window size [%d]\n", ipt.w);
|
||||
fprintf(fp_help, " -I NUM split index for every ~NUM input bases [4G]\n");
|
||||
fprintf(fp_help, " -w INT minimizer window size [%d]\n", ipt.w);
|
||||
fprintf(fp_help, " -I NUM split index for every ~NUM input bases [8G]\n");
|
||||
fprintf(fp_help, " -d FILE dump index to FILE []\n");
|
||||
fprintf(fp_help, " Mapping:\n");
|
||||
fprintf(fp_help, " -f FLOAT filter out top FLOAT fraction of repetitive minimizers [%g]\n", opt.mid_occ_frac);
|
||||
fprintf(fp_help, " -g INT stop chain enlongation if there are no minimizers in INT-bp [%d]\n", opt.max_gap);
|
||||
fprintf(fp_help, " -r INT bandwidth used in chaining and DP-based alignment [%d]\n", opt.bw);
|
||||
fprintf(fp_help, " -g NUM stop chain enlongation if there are no minimizers in INT-bp [%d]\n", opt.max_gap);
|
||||
fprintf(fp_help, " -G NUM max intron length (effective with -xsplice; changing -r) [200k]\n");
|
||||
fprintf(fp_help, " -F NUM max fragment length (effective with -xsr or in the fragment mode) [800]\n");
|
||||
fprintf(fp_help, " -r NUM[,NUM] chaining/alignment bandwidth and long-join bandwidth [%d,%d]\n", opt.bw, opt.bw_long);
|
||||
fprintf(fp_help, " -n INT minimal number of minimizers on a chain [%d]\n", opt.min_cnt);
|
||||
fprintf(fp_help, " -m INT minimal chaining score (matching bases minus log gap penalty) [%d]\n", opt.min_chain_score);
|
||||
// fprintf(fp_help, " -T INT SDUST threshold; 0 to disable SDUST [%d]\n", opt.sdust_thres); // TODO: this option is never used; might be buggy
|
||||
fprintf(fp_help, " -X skip self and dual mappings (for the all-vs-all mode)\n");
|
||||
fprintf(fp_help, " -p FLOAT min secondary-to-primary score ratio [%g]\n", opt.pri_ratio);
|
||||
fprintf(fp_help, " -N INT retain at most INT secondary alignments [%d]\n", opt.best_n);
|
||||
fprintf(fp_help, " -G NUM max intron length (only effective following -x splice) [200k]\n");
|
||||
fprintf(fp_help, " Alignment:\n");
|
||||
fprintf(fp_help, " -A INT matching score [%d]\n", opt.a);
|
||||
fprintf(fp_help, " -B INT mismatch penalty [%d]\n", opt.b);
|
||||
fprintf(fp_help, " -B INT mismatch penalty (larger value for lower divergence) [%d]\n", opt.b);
|
||||
fprintf(fp_help, " -O INT[,INT] gap open penalty [%d,%d]\n", opt.q, opt.q2);
|
||||
fprintf(fp_help, " -E INT[,INT] gap extension penalty; a k-long gap costs min{O1+k*E1,O2+k*E2} [%d,%d]\n", opt.e, opt.e2);
|
||||
fprintf(fp_help, " -z INT Z-drop score [%d]\n", opt.zdrop);
|
||||
fprintf(fp_help, " -z INT[,INT] Z-drop score and inversion Z-drop score [%d,%d]\n", opt.zdrop, opt.zdrop_inv);
|
||||
fprintf(fp_help, " -s INT minimal peak DP alignment score [%d]\n", opt.min_dp_max);
|
||||
fprintf(fp_help, " -u CHAR how to find GT-AG. f:transcript strand, b:both strands, n:don't match GT-AG [n]\n");
|
||||
fprintf(fp_help, " -J INT splice mode. 0: original minimap2 model; 1: miniprot model [1]\n");
|
||||
fprintf(fp_help, " -j FILE junctions in BED12 to extend *short* RNA-seq alignment []\n");
|
||||
fprintf(fp_help, " Input/Output:\n");
|
||||
fprintf(fp_help, " -a output in the SAM format (PAF by default)\n");
|
||||
fprintf(fp_help, " -Q don't output base quality in SAM\n");
|
||||
fprintf(fp_help, " -o FILE output alignments to FILE [stdout]\n");
|
||||
fprintf(fp_help, " -L write CIGAR with >65535 ops at the CG tag\n");
|
||||
fprintf(fp_help, " -R STR SAM read group line in a format like '@RG\\tID:foo\\tSM:bar' []\n");
|
||||
fprintf(fp_help, " -c output CIGAR in PAF\n");
|
||||
fprintf(fp_help, " -S output the cs tag in PAF (cs encodes both query and ref sequences)\n");
|
||||
fprintf(fp_help, " --cs[=STR] output the cs tag; STR is 'short' (if absent) or 'long' [none]\n");
|
||||
fprintf(fp_help, " --ds output the ds tag, which is an extension to cs\n");
|
||||
fprintf(fp_help, " --MD output the MD tag\n");
|
||||
fprintf(fp_help, " --eqx write =/X CIGAR operators\n");
|
||||
fprintf(fp_help, " -Y use soft clipping for supplementary alignments\n");
|
||||
fprintf(fp_help, " -y copy FASTA/Q comments to output SAM\n");
|
||||
fprintf(fp_help, " -t INT number of threads [%d]\n", n_threads);
|
||||
fprintf(fp_help, " -K NUM minibatch size for mapping [200M]\n");
|
||||
fprintf(fp_help, " -K NUM minibatch size for mapping [500M]\n");
|
||||
// fprintf(fp_help, " -v INT verbose level [%d]\n", mm_verbose);
|
||||
fprintf(fp_help, " --version show version number\n");
|
||||
fprintf(fp_help, " Preset:\n");
|
||||
fprintf(fp_help, " -x STR preset (recommended to be applied before other options) []\n");
|
||||
fprintf(fp_help, " map10k/map-pb: -Hk19 (PacBio/ONT vs reference mapping)\n");
|
||||
fprintf(fp_help, " map-ont: -k15 (slightly more sensitive than 'map10k' for ONT vs reference)\n");
|
||||
fprintf(fp_help, " asm5: -k19 -w19 -A1 -B19 -O39,81 -E3,1 -s200 -z200 (asm to ref mapping; break at 5%% div.)\n");
|
||||
fprintf(fp_help, " asm10: -k19 -w19 -A1 -B9 -O16,41 -E2,1 -s200 -z200 (asm to ref mapping; break at 10%% div.)\n");
|
||||
fprintf(fp_help, " ava-pb: -Hk19 -w5 -Xp0 -m100 -g10000 -K500m --max-chain-skip 25 (PacBio read overlap)\n");
|
||||
fprintf(fp_help, " ava-ont: -k15 -w5 -Xp0 -m100 -g10000 -K500m --max-chain-skip 25 (ONT read overlap)\n");
|
||||
fprintf(fp_help, " splice: long-read spliced alignment (see minimap2.1 for details)\n");
|
||||
fprintf(fp_help, " sr: short single-end reads without splicing (see minimap2.1 for details)\n");
|
||||
fprintf(fp_help, "\nSee `man ./minimap2.1' for detailed description of command-line options.\n");
|
||||
fprintf(fp_help, " -x STR preset (always applied before other options; see minimap2.1 for details) []\n");
|
||||
fprintf(fp_help, " - lr:hq - accurate long reads (error rate <1%%) against a reference genome\n");
|
||||
fprintf(fp_help, " - splice/splice:hq - spliced alignment for long reads/accurate long reads\n");
|
||||
fprintf(fp_help, " - splice:sr - spliced alignment for short RNA-seq reads\n");
|
||||
fprintf(fp_help, " - asm5/asm10/asm20 - asm-to-ref mapping, for ~0.1/1/5%% sequence divergence\n");
|
||||
fprintf(fp_help, " - sr - short reads against a reference\n");
|
||||
fprintf(fp_help, " - map-pb/map-hifi/map-ont/map-iclr - CLR/HiFi/Nanopore/ICLR vs reference mapping\n");
|
||||
fprintf(fp_help, " - ava-pb/ava-ont - PacBio CLR/Nanopore read overlap\n");
|
||||
fprintf(fp_help, "\nSee `man ./minimap2.1' for detailed description of these and other advanced command-line options.\n");
|
||||
return fp_help == stdout? 0 : 1;
|
||||
}
|
||||
|
||||
idx_rdr = mm_idx_reader_open(argv[optind], &ipt, fnw);
|
||||
if ((opt.flag & MM_F_SR) && argc - o.ind > 3) {
|
||||
fprintf(stderr, "[ERROR] incorrect input: in the sr mode, please specify no more than two query files.\n");
|
||||
return 1;
|
||||
}
|
||||
idx_rdr = mm_idx_reader_open(argv[o.ind], &ipt, fnw);
|
||||
if (idx_rdr == 0) {
|
||||
fprintf(stderr, "[ERROR] failed to open file '%s'\n", argv[optind]);
|
||||
fprintf(stderr, "[ERROR] failed to open file '%s': %s\n", argv[o.ind], strerror(errno));
|
||||
return 1;
|
||||
}
|
||||
if (!idx_rdr->is_idx && fnw == 0 && argc - optind < 2) {
|
||||
if (!idx_rdr->is_idx && fnw == 0 && argc - o.ind < 2) {
|
||||
fprintf(stderr, "[ERROR] missing input: please specify a query file to map or option -d to keep the index\n");
|
||||
mm_idx_reader_close(idx_rdr);
|
||||
return 1;
|
||||
}
|
||||
if (opt.flag & MM_F_OUT_SAM)
|
||||
mm_write_sam_hdr_no_SQ(rg, MM_VERSION, argc, argv);
|
||||
if (opt.best_n == 0 && (opt.flag&MM_F_CIGAR) && mm_verbose >= 2)
|
||||
fprintf(stderr, "[WARNING]\033[1;31m `-N 0' reduces alignment accuracy. Please use --secondary=no to suppress secondary alignments.\033[0m\n");
|
||||
while ((mi = mm_idx_reader_read(idx_rdr, n_threads)) != 0) {
|
||||
if (mm_verbose >= 2 && idx_rdr->n_parts > 1 && (opt.flag&MM_F_OUT_SAM) && !(opt.flag&MM_F_NO_SAM_SQ))
|
||||
fprintf(stderr, "[WARNING] \033[1;31mSAM output is malformated due to internal @SQ lines. Please add option --no-sam-sq or filter afterwards.\033[0m\n");
|
||||
int ret;
|
||||
if ((opt.flag & MM_F_CIGAR) && (mi->flag & MM_I_NO_SEQ)) {
|
||||
fprintf(stderr, "[ERROR] the prebuilt index doesn't contain sequences.\n");
|
||||
mm_idx_destroy(mi);
|
||||
mm_idx_reader_close(idx_rdr);
|
||||
return 1;
|
||||
}
|
||||
if ((opt.flag & MM_F_OUT_SAM) && idx_rdr->n_parts == 1) {
|
||||
if (mm_idx_reader_eof(idx_rdr)) {
|
||||
if (opt.split_prefix == 0)
|
||||
ret = mm_write_sam_hdr(mi, rg, MM_VERSION, argc, argv);
|
||||
else
|
||||
ret = mm_write_sam_hdr(0, rg, MM_VERSION, argc, argv);
|
||||
} else {
|
||||
ret = mm_write_sam_hdr(0, rg, MM_VERSION, argc, argv);
|
||||
if (opt.split_prefix == 0 && mm_verbose >= 2)
|
||||
fprintf(stderr, "[WARNING]\033[1;31m For a multi-part index, no @SQ lines will be outputted. Please use --split-prefix.\033[0m\n");
|
||||
}
|
||||
if (ret != 0) {
|
||||
mm_idx_destroy(mi);
|
||||
mm_idx_reader_close(idx_rdr);
|
||||
return 1;
|
||||
}
|
||||
}
|
||||
if (mm_verbose >= 3)
|
||||
fprintf(stderr, "[M::%s::%.3f*%.2f] loaded/built the index for %d target sequence(s)\n",
|
||||
__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), mi->n_seq);
|
||||
if (argc != optind + 1) mm_mapopt_update(&opt, mi);
|
||||
if (argc != o.ind + 1) mm_mapopt_update(&opt, mi);
|
||||
if (mm_verbose >= 3) mm_idx_stat(mi);
|
||||
for (i = optind + 1; i < argc; ++i)
|
||||
mm_map_file(mi, argv[i], &opt, n_threads);
|
||||
mm_idx_destroy(mi);
|
||||
if (fn_bed_junc) {
|
||||
mm_idx_bed_read(mi, fn_bed_junc, 1);
|
||||
if (mi->I == 0 && mm_verbose >= 2)
|
||||
fprintf(stderr, "[WARNING] failed to load the junction BED file\n");
|
||||
}
|
||||
if (fn_bed_jump) {
|
||||
mm_idx_jjump_read(mi, fn_bed_jump, MM_JUNC_ANNO, -1);
|
||||
if (mi->J == 0 && mm_verbose >= 2)
|
||||
fprintf(stderr, "[WARNING] failed to load the jump BED file\n");
|
||||
}
|
||||
if (fn_bed_pass1) {
|
||||
mm_idx_jjump_read(mi, fn_bed_pass1, MM_JUNC_MISC, 5);
|
||||
if (mi->J == 0 && mm_verbose >= 2)
|
||||
fprintf(stderr, "[WARNING] failed to load the pass-1 jump BED file\n");
|
||||
}
|
||||
if (fn_spsc) {
|
||||
mm_idx_spsc_read(mi, fn_spsc, mm_max_spsc_bonus(&opt));
|
||||
if (mi->spsc == 0 && mm_verbose >= 2)
|
||||
fprintf(stderr, "[WARNING] failed to load the splice score file\n");
|
||||
}
|
||||
if (alt_list) mm_idx_alt_read(mi, alt_list);
|
||||
if (argc - (o.ind + 1) == 0) {
|
||||
mm_idx_destroy(mi);
|
||||
continue; // no query files
|
||||
}
|
||||
ret = 0;
|
||||
if (!(opt.flag & MM_F_FRAG_MODE)) {
|
||||
for (i = o.ind + 1; i < argc; ++i) {
|
||||
ret = mm_map_file(mi, argv[i], &opt, n_threads);
|
||||
if (ret < 0) break;
|
||||
}
|
||||
} else {
|
||||
ret = mm_map_file_frag(mi, argc - (o.ind + 1), (const char**)&argv[o.ind + 1], &opt, n_threads);
|
||||
}
|
||||
mm_idx_destroy(mi);
|
||||
if (ret < 0) {
|
||||
fprintf(stderr, "ERROR: failed to map the query file\n");
|
||||
exit(EXIT_FAILURE);
|
||||
}
|
||||
}
|
||||
n_parts = idx_rdr->n_parts;
|
||||
mm_idx_reader_close(idx_rdr);
|
||||
|
||||
if (opt.split_prefix)
|
||||
mm_split_merge(argc - (o.ind + 1), (const char**)&argv[o.ind + 1], &opt, n_parts);
|
||||
|
||||
if (fflush(stdout) == EOF) {
|
||||
perror("[ERROR] failed to write the results");
|
||||
exit(EXIT_FAILURE);
|
||||
}
|
||||
|
||||
if (mm_verbose >= 3) {
|
||||
fprintf(stderr, "[M::%s] Version: %s\n", __func__, MM_VERSION);
|
||||
fprintf(stderr, "[M::%s] CMD:", __func__);
|
||||
for (i = 0; i < argc; ++i)
|
||||
fprintf(stderr, " %s", argv[i]);
|
||||
fprintf(stderr, "\n[M::%s] Real time: %.3f sec; CPU: %.3f sec\n", __func__, realtime() - mm_realtime0, cputime());
|
||||
fprintf(stderr, "\n[M::%s] Real time: %.3f sec; CPU: %.3f sec; Peak RSS: %.3f GB\n", __func__, realtime() - mm_realtime0, cputime(), peakrss() / 1024.0 / 1024.0 / 1024.0);
|
||||
}
|
||||
return 0;
|
||||
}
|
||||
|
||||
@@ -1,229 +1,256 @@
|
||||
#include <stdlib.h>
|
||||
#include <string.h>
|
||||
#include <assert.h>
|
||||
#include <errno.h>
|
||||
#include "kthread.h"
|
||||
#include "kvec.h"
|
||||
#include "kalloc.h"
|
||||
#include "sdust.h"
|
||||
#include "mmpriv.h"
|
||||
#include "bseq.h"
|
||||
|
||||
void mm_mapopt_init(mm_mapopt_t *opt)
|
||||
{
|
||||
memset(opt, 0, sizeof(mm_mapopt_t));
|
||||
opt->mid_occ_frac = 2e-4f;
|
||||
opt->sdust_thres = 0;
|
||||
|
||||
opt->min_cnt = 3;
|
||||
opt->min_chain_score = 40;
|
||||
opt->bw = 500;
|
||||
opt->max_gap = 5000;
|
||||
opt->max_gap_ref = -1;
|
||||
opt->max_chain_skip = 25;
|
||||
|
||||
opt->mask_level = 0.5f;
|
||||
opt->pri_ratio = 0.8f;
|
||||
opt->best_n = 5;
|
||||
|
||||
opt->max_join_long = 20000;
|
||||
opt->max_join_short = 2000;
|
||||
opt->min_join_flank_sc = 1000;
|
||||
|
||||
opt->a = 2, opt->b = 4, opt->q = 4, opt->e = 2, opt->q2 = 24, opt->e2 = 1;
|
||||
opt->zdrop = 400;
|
||||
opt->min_dp_max = opt->min_chain_score * opt->a;
|
||||
opt->min_ksw_len = 200;
|
||||
opt->mini_batch_size = 200000000;
|
||||
}
|
||||
|
||||
void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
|
||||
{
|
||||
if (opt->flag & MM_F_SPLICE_BOTH)
|
||||
opt->flag &= ~(MM_F_SPLICE_FOR|MM_F_SPLICE_REV);
|
||||
if (opt->mid_occ <= 0)
|
||||
opt->mid_occ = mm_idx_cal_max_occ(mi, opt->mid_occ_frac);
|
||||
if (mm_verbose >= 3)
|
||||
fprintf(stderr, "[M::%s::%.3f*%.2f] mid_occ = %d\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), opt->mid_occ);
|
||||
}
|
||||
|
||||
int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
|
||||
{
|
||||
if (preset == 0) {
|
||||
mm_idxopt_init(io);
|
||||
mm_mapopt_init(mo);
|
||||
} else if (strcmp(preset, "ava-ont") == 0) {
|
||||
io->is_hpc = 0, io->k = 15, io->w = 5;
|
||||
mo->flag |= MM_F_AVA | MM_F_NO_SELF;
|
||||
mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_gap = 10000, mo->max_chain_skip = 25;
|
||||
mo->mini_batch_size = 500000000;
|
||||
} else if (strcmp(preset, "ava-pb") == 0) {
|
||||
io->is_hpc = 1, io->k = 19, io->w = 5;
|
||||
mo->flag |= MM_F_AVA | MM_F_NO_SELF;
|
||||
mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_gap = 10000, mo->max_chain_skip = 25;
|
||||
mo->mini_batch_size = 500000000;
|
||||
} else if (strcmp(preset, "map10k") == 0 || strcmp(preset, "map-pb") == 0) {
|
||||
io->is_hpc = 1, io->k = 19;
|
||||
} else if (strcmp(preset, "map-ont") == 0) {
|
||||
io->is_hpc = 0, io->k = 15;
|
||||
} else if (strcmp(preset, "asm5") == 0) {
|
||||
io->is_hpc = 0, io->k = 19, io->w = 19;
|
||||
mo->a = 1, mo->b = 19, mo->q = 39, mo->q2 = 81, mo->e = 3, mo->e2 = 1, mo->zdrop = 200;
|
||||
mo->min_dp_max = 200;
|
||||
} else if (strcmp(preset, "asm10") == 0) {
|
||||
io->is_hpc = 0, io->k = 19, io->w = 19;
|
||||
mo->a = 1, mo->b = 9, mo->q = 16, mo->q2 = 41, mo->e = 2, mo->e2 = 1, mo->zdrop = 200;
|
||||
mo->min_dp_max = 200;
|
||||
} else if (strcmp(preset, "short") == 0 || strcmp(preset, "sr") == 0) {
|
||||
io->is_hpc = 0, io->k = 21, io->w = 11;
|
||||
mo->flag |= MM_F_APPROX_EXT;
|
||||
mo->a = 2, mo->b = 8, mo->q = 12, mo->e = 2, mo->q2 = 32, mo->e2 = 1;
|
||||
mo->max_gap = 100;
|
||||
mo->pri_ratio = 0.5f;
|
||||
mo->min_cnt = 2;
|
||||
mo->min_chain_score = 20;
|
||||
mo->min_dp_max = 40;
|
||||
mo->best_n = 20;
|
||||
mo->bw = 50;
|
||||
mo->mid_occ = 1000;
|
||||
mo->mini_batch_size = 50000000;
|
||||
} else if (strcmp(preset, "splice") == 0 || strcmp(preset, "cdna") == 0) {
|
||||
io->is_hpc = 0, io->k = 15, io->w = 5;
|
||||
mo->flag |= MM_F_SPLICE | MM_F_SPLICE_FOR | MM_F_SPLICE_REV;
|
||||
mo->max_gap = 2000, mo->max_gap_ref = mo->bw = 200000;
|
||||
mo->a = 1, mo->b = 2, mo->q = 2, mo->e = 1, mo->q2 = 32, mo->e2 = 0;
|
||||
mo->noncan = 5;
|
||||
mo->zdrop = 200;
|
||||
} else return -1;
|
||||
return 0;
|
||||
}
|
||||
|
||||
typedef struct {
|
||||
uint32_t n;
|
||||
uint32_t qpos;
|
||||
union {
|
||||
const uint64_t *cr;
|
||||
uint64_t *r;
|
||||
} x;
|
||||
} mm_match_t;
|
||||
|
||||
struct mm_tbuf_s {
|
||||
sdust_buf_t *sdb;
|
||||
mm128_v mini;
|
||||
void *km;
|
||||
};
|
||||
#include "khash.h"
|
||||
|
||||
mm_tbuf_t *mm_tbuf_init(void)
|
||||
{
|
||||
mm_tbuf_t *b;
|
||||
b = (mm_tbuf_t*)calloc(1, sizeof(mm_tbuf_t));
|
||||
if (!(mm_dbg_flag & 1)) b->km = km_init();
|
||||
b->sdb = sdust_buf_init(b->km);
|
||||
return b;
|
||||
}
|
||||
|
||||
void mm_tbuf_destroy(mm_tbuf_t *b)
|
||||
{
|
||||
if (b == 0) return;
|
||||
kfree(b->km, b->mini.a);
|
||||
sdust_buf_destroy(b->sdb);
|
||||
km_destroy(b->km);
|
||||
free(b);
|
||||
}
|
||||
|
||||
static void mm_dust_minier(mm128_v *mini, int l_seq, const char *seq, int sdust_thres, sdust_buf_t *sdb)
|
||||
void *mm_tbuf_get_km(mm_tbuf_t *b)
|
||||
{
|
||||
return b->km;
|
||||
}
|
||||
|
||||
static int mm_dust_minier(void *km, int n, mm128_t *a, int l_seq, const char *seq, int sdust_thres)
|
||||
{
|
||||
int n_dreg, j, k, u = 0;
|
||||
const uint64_t *dreg;
|
||||
if (sdust_thres <= 0 || sdb == 0) return;
|
||||
sdust_buf_t *sdb;
|
||||
if (sdust_thres <= 0) return n;
|
||||
sdb = sdust_buf_init(km);
|
||||
dreg = sdust_core((const uint8_t*)seq, l_seq, sdust_thres, 64, &n_dreg, sdb);
|
||||
for (j = k = 0; j < mini->n; ++j) { // squeeze out minimizers that significantly overlap with LCRs
|
||||
int32_t qpos = (uint32_t)mini->a[j].y>>1, span = mini->a[j].x&0xff;
|
||||
for (j = k = 0; j < n; ++j) { // squeeze out minimizers that significantly overlap with LCRs
|
||||
int32_t qpos = (uint32_t)a[j].y>>1, span = a[j].x&0xff;
|
||||
int32_t s = qpos - (span - 1), e = s + span;
|
||||
while (u < n_dreg && (uint32_t)dreg[u] <= s) ++u;
|
||||
if (u < n_dreg && dreg[u]>>32 < e) {
|
||||
while (u < n_dreg && (int32_t)dreg[u] <= s) ++u;
|
||||
if (u < n_dreg && (int32_t)(dreg[u]>>32) < e) {
|
||||
int v, l = 0;
|
||||
for (v = u; v < n_dreg && dreg[v]>>32 < e; ++v) { // iterate over LCRs overlapping this minimizer
|
||||
int ss = s > dreg[v]>>32? s : dreg[v]>>32;
|
||||
int ee = e < (uint32_t)dreg[v]? e : (uint32_t)dreg[v];
|
||||
for (v = u; v < n_dreg && (int32_t)(dreg[v]>>32) < e; ++v) { // iterate over LCRs overlapping this minimizer
|
||||
int ss = s > (int32_t)(dreg[v]>>32)? s : dreg[v]>>32;
|
||||
int ee = e < (int32_t)dreg[v]? e : (uint32_t)dreg[v];
|
||||
l += ee - ss;
|
||||
}
|
||||
if (l <= span>>1) mini->a[k++] = mini->a[j]; // keep the minimizer if less than half of it falls in masked region
|
||||
if (l <= span>>1) a[k++] = a[j]; // keep the minimizer if less than half of it falls in masked region
|
||||
} else a[k++] = a[j];
|
||||
}
|
||||
}
|
||||
mini->n = k;
|
||||
sdust_buf_destroy(sdb);
|
||||
return k; // the new size
|
||||
}
|
||||
|
||||
mm_reg1_t *mm_map(const mm_idx_t *mi, int qlen, const char *seq, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname)
|
||||
static void collect_minimizers(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, mm128_v *mv)
|
||||
{
|
||||
int i, n, j, n_u, max_gap_ref, rep_st = 0, rep_en = 0, rep_len = 0;
|
||||
int64_t n_a;
|
||||
uint64_t *u;
|
||||
mm_match_t *m;
|
||||
mm128_t *a;
|
||||
mm_reg1_t *regs;
|
||||
|
||||
// collect minimizers
|
||||
b->mini.n = 0;
|
||||
mm_sketch(b->km, seq, qlen, mi->w, mi->k, 0, mi->is_hpc, &b->mini);
|
||||
n = b->mini.n;
|
||||
|
||||
if (opt->sdust_thres > 0)
|
||||
mm_dust_minier(&b->mini, qlen, seq, opt->sdust_thres, b->sdb);
|
||||
|
||||
// convert to local representation
|
||||
m = (mm_match_t*)kmalloc(b->km, n * sizeof(mm_match_t));
|
||||
for (i = 0; i < n; ++i) {
|
||||
int t;
|
||||
mm128_t *p = &b->mini.a[i];
|
||||
m[i].qpos = (uint32_t)p->y;
|
||||
m[i].x.cr = mm_idx_get(mi, p->x>>8, &t);
|
||||
m[i].n = t;
|
||||
int i, n, sum = 0;
|
||||
mv->n = 0;
|
||||
for (i = n = 0; i < n_segs; ++i) {
|
||||
size_t j;
|
||||
mm_sketch(km, seqs[i], qlens[i], mi->w, mi->k, i, mi->flag&MM_I_HPC, mv);
|
||||
for (j = n; j < mv->n; ++j)
|
||||
mv->a[j].y += sum << 1;
|
||||
if (opt->sdust_thres > 0) // mask low-complexity minimizers
|
||||
mv->n = n + mm_dust_minier(km, mv->n - n, mv->a + n, qlens[i], seqs[i], opt->sdust_thres);
|
||||
sum += qlens[i], n = mv->n;
|
||||
}
|
||||
}
|
||||
|
||||
// fill the _a_ array
|
||||
for (i = 0, n_a = 0; i < n; ++i) // find the length of a[]
|
||||
if (m[i].n < opt->mid_occ) n_a += m[i].n;
|
||||
a = (mm128_t*)kmalloc(b->km, n_a * sizeof(mm128_t));
|
||||
for (i = j = 0; i < n; ++i) {
|
||||
mm128_t *p = &b->mini.a[i];
|
||||
mm_match_t *q = &m[i];
|
||||
const uint64_t *r = q->x.cr;
|
||||
int k, q_span = p->x & 0xff, is_tandem = 0;
|
||||
if (q->n >= opt->mid_occ) {
|
||||
int en = (q->qpos>>1) + 1, st = en - q_span;
|
||||
if (st > rep_en) {
|
||||
rep_len += rep_en - rep_st;
|
||||
rep_st = st, rep_en = en;
|
||||
} else rep_en = en;
|
||||
continue;
|
||||
#include "ksort.h"
|
||||
#define heap_lt(a, b) ((a).x > (b).x)
|
||||
KSORT_INIT(heap, mm128_t, heap_lt)
|
||||
|
||||
static inline int skip_seed(int flag, uint64_t r, const mm_seed_t *q, const char *qname, int qlen, const mm_idx_t *mi, int *is_self)
|
||||
{
|
||||
*is_self = 0;
|
||||
if (qname && (flag & (MM_F_NO_DIAG|MM_F_NO_DUAL))) {
|
||||
const mm_idx_seq_t *s = &mi->seq[r>>32];
|
||||
int cmp;
|
||||
cmp = strcmp(qname, s->name);
|
||||
if ((flag&MM_F_NO_DIAG) && cmp == 0 && (int)s->len == qlen) {
|
||||
if ((uint32_t)r>>1 == (q->q_pos>>1)) return 1; // avoid the diagnonal anchors
|
||||
if ((r&1) == (q->q_pos&1)) *is_self = 1; // this flag is used to avoid spurious extension on self chain
|
||||
}
|
||||
if (i > 0 && p->x>>8 == b->mini.a[i - 1].x>>8) is_tandem = 1;
|
||||
if (i < n - 1 && p->x>>8 == b->mini.a[i + 1].x>>8) is_tandem = 1;
|
||||
for (k = 0; k < q->n; ++k) {
|
||||
int32_t rpos = (uint32_t)r[k] >> 1;
|
||||
if ((flag&MM_F_NO_DUAL) && cmp > 0) // all-vs-all mode: map once
|
||||
return 1;
|
||||
}
|
||||
if (flag & (MM_F_FOR_ONLY|MM_F_REV_ONLY)) {
|
||||
if ((r&1) == (q->q_pos&1)) { // forward strand
|
||||
if (flag & MM_F_REV_ONLY) return 1;
|
||||
} else {
|
||||
if (flag & MM_F_FOR_ONLY) return 1;
|
||||
}
|
||||
}
|
||||
return 0;
|
||||
}
|
||||
|
||||
static mm128_t *collect_seed_hits_heap(void *km, const mm_mapopt_t *opt, int max_occ, const mm_idx_t *mi, const char *qname, const mm128_v *mv, int qlen, int64_t *n_a, int *rep_len,
|
||||
int *n_mini_pos, uint64_t **mini_pos)
|
||||
{
|
||||
int i, n_m, heap_size = 0;
|
||||
int64_t j, n_for = 0, n_rev = 0;
|
||||
mm_seed_t *m;
|
||||
mm128_t *a, *heap;
|
||||
|
||||
m = mm_collect_matches(km, &n_m, qlen, max_occ, opt->max_max_occ, opt->occ_dist, mi, mv, n_a, rep_len, n_mini_pos, mini_pos);
|
||||
|
||||
heap = (mm128_t*)kmalloc(km, n_m * sizeof(mm128_t));
|
||||
a = (mm128_t*)kmalloc(km, *n_a * sizeof(mm128_t));
|
||||
|
||||
for (i = 0, heap_size = 0; i < n_m; ++i) {
|
||||
if (m[i].n > 0) {
|
||||
heap[heap_size].x = m[i].cr[0];
|
||||
heap[heap_size].y = (uint64_t)i<<32;
|
||||
++heap_size;
|
||||
}
|
||||
}
|
||||
ks_heapmake_heap(heap_size, heap);
|
||||
while (heap_size > 0) {
|
||||
mm_seed_t *q = &m[heap->y>>32];
|
||||
mm128_t *p;
|
||||
if (qname && (opt->flag&(MM_F_NO_SELF|MM_F_AVA))) {
|
||||
const char *tname = mi->seq[r[k]>>32].name;
|
||||
if ((opt->flag&MM_F_NO_SELF) && strcmp(qname, tname) == 0 && rpos == (q->qpos>>1)) // avoid the diagonal
|
||||
continue;
|
||||
if ((opt->flag&MM_F_AVA) && strcmp(qname, tname) > 0) // all-vs-all mode: map once
|
||||
continue;
|
||||
}
|
||||
p = &a[j++];
|
||||
if ((r[k]&1) == (q->qpos&1)) { // forward strand
|
||||
p->x = (r[k]&0xffffffff00000000ULL) | rpos;
|
||||
p->y = (uint64_t)q_span << 32 | q->qpos >> 1;
|
||||
uint64_t r = heap->x;
|
||||
int32_t is_self, rpos = (uint32_t)r >> 1;
|
||||
if (!skip_seed(opt->flag, r, q, qname, qlen, mi, &is_self)) {
|
||||
if ((r&1) == (q->q_pos&1)) { // forward strand
|
||||
p = &a[n_for++];
|
||||
p->x = (r&0xffffffff00000000ULL) | rpos;
|
||||
p->y = (uint64_t)q->q_span << 32 | q->q_pos >> 1;
|
||||
} else { // reverse strand
|
||||
p = &a[(*n_a) - (++n_rev)];
|
||||
p->x = 1ULL<<63 | (r&0xffffffff00000000ULL) | rpos;
|
||||
p->y = (uint64_t)q->q_span << 32 | (qlen - ((q->q_pos>>1) + 1 - q->q_span) - 1);
|
||||
}
|
||||
p->y |= (uint64_t)q->seg_id << MM_SEED_SEG_SHIFT;
|
||||
if (q->is_tandem) p->y |= MM_SEED_TANDEM;
|
||||
if (is_self) p->y |= MM_SEED_SELF;
|
||||
}
|
||||
// update the heap
|
||||
if ((uint32_t)heap->y < q->n - 1) {
|
||||
++heap[0].y;
|
||||
heap[0].x = m[heap[0].y>>32].cr[(uint32_t)heap[0].y];
|
||||
} else {
|
||||
heap[0] = heap[heap_size - 1];
|
||||
--heap_size;
|
||||
}
|
||||
ks_heapdown_heap(0, heap_size, heap);
|
||||
}
|
||||
kfree(km, m);
|
||||
kfree(km, heap);
|
||||
|
||||
// reverse anchors on the reverse strand, as they are in the descending order
|
||||
for (j = 0; j < n_rev>>1; ++j) {
|
||||
mm128_t t = a[(*n_a) - 1 - j];
|
||||
a[(*n_a) - 1 - j] = a[(*n_a) - (n_rev - j)];
|
||||
a[(*n_a) - (n_rev - j)] = t;
|
||||
}
|
||||
if (*n_a > n_for + n_rev) {
|
||||
memmove(a + n_for, a + (*n_a) - n_rev, n_rev * sizeof(mm128_t));
|
||||
*n_a = n_for + n_rev;
|
||||
}
|
||||
return a;
|
||||
}
|
||||
|
||||
static mm128_t *collect_seed_hits(void *km, const mm_mapopt_t *opt, int max_occ, const mm_idx_t *mi, const char *qname, const mm128_v *mv, int qlen, int64_t *n_a, int *rep_len,
|
||||
int *n_mini_pos, uint64_t **mini_pos)
|
||||
{
|
||||
int i, n_m;
|
||||
mm_seed_t *m;
|
||||
mm128_t *a;
|
||||
m = mm_collect_matches(km, &n_m, qlen, max_occ, opt->max_max_occ, opt->occ_dist, mi, mv, n_a, rep_len, n_mini_pos, mini_pos);
|
||||
a = (mm128_t*)kmalloc(km, *n_a * sizeof(mm128_t));
|
||||
for (i = 0, *n_a = 0; i < n_m; ++i) {
|
||||
mm_seed_t *q = &m[i];
|
||||
const uint64_t *r = q->cr;
|
||||
uint32_t k;
|
||||
for (k = 0; k < q->n; ++k) {
|
||||
int32_t is_self, rpos = (uint32_t)r[k] >> 1;
|
||||
mm128_t *p;
|
||||
if (skip_seed(opt->flag, r[k], q, qname, qlen, mi, &is_self)) continue;
|
||||
p = &a[(*n_a)++];
|
||||
if ((r[k]&1) == (q->q_pos&1)) { // forward strand
|
||||
p->x = (r[k]&0xffffffff00000000ULL) | rpos;
|
||||
p->y = (uint64_t)q->q_span << 32 | q->q_pos >> 1;
|
||||
} else if (!(opt->flag & MM_F_QSTRAND)) { // reverse strand and not in the query-strand mode
|
||||
p->x = 1ULL<<63 | (r[k]&0xffffffff00000000ULL) | rpos;
|
||||
p->y = (uint64_t)q_span << 32 | (qlen - ((q->qpos>>1) + 1 - q_span) - 1);
|
||||
p->y = (uint64_t)q->q_span << 32 | (qlen - ((q->q_pos>>1) + 1 - q->q_span) - 1);
|
||||
} else { // reverse strand; query-strand
|
||||
int32_t len = mi->seq[r[k]>>32].len;
|
||||
p->x = 1ULL<<63 | (r[k]&0xffffffff00000000ULL) | (len - (rpos + 1 - q->q_span) - 1); // coordinate only accurate for non-HPC seeds
|
||||
p->y = (uint64_t)q->q_span << 32 | q->q_pos >> 1;
|
||||
}
|
||||
if (is_tandem) p->y |= MM_SEED_TANDEM;
|
||||
p->y |= (uint64_t)q->seg_id << MM_SEED_SEG_SHIFT;
|
||||
if (q->is_tandem) p->y |= MM_SEED_TANDEM;
|
||||
if (is_self) p->y |= MM_SEED_SELF;
|
||||
}
|
||||
}
|
||||
rep_len += rep_en - rep_st;
|
||||
n_a = j;
|
||||
radix_sort_128x(a, a + n_a);
|
||||
kfree(b->km, m);
|
||||
kfree(km, m);
|
||||
radix_sort_128x(a, a + (*n_a));
|
||||
return a;
|
||||
}
|
||||
|
||||
static void chain_post(const mm_mapopt_t *opt, int max_chain_gap_ref, const mm_idx_t *mi, void *km, int qlen, int n_segs, const int *qlens, int *n_regs, mm_reg1_t *regs, mm128_t *a)
|
||||
{
|
||||
if (!(opt->flag & MM_F_ALL_CHAINS)) { // don't choose primary mapping(s)
|
||||
mm_set_parent(km, opt->mask_level, opt->mask_len, *n_regs, regs, opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL, opt->alt_drop);
|
||||
if (n_segs <= 1) mm_select_sub(km, opt->pri_ratio, mi->k*2, opt->best_n, 1, opt->max_gap * 0.8, n_regs, regs);
|
||||
else mm_select_sub_multi(km, opt->pri_ratio, 0.2f, 0.7f, max_chain_gap_ref, mi->k*2, opt->best_n, n_segs, qlens, n_regs, regs);
|
||||
}
|
||||
}
|
||||
|
||||
static mm_reg1_t *align_regs(const mm_mapopt_t *opt, const mm_idx_t *mi, void *km, int qlen, const char *seq, int *n_regs, mm_reg1_t *regs, mm128_t *a)
|
||||
{
|
||||
if (!(opt->flag & MM_F_CIGAR)) return regs;
|
||||
regs = mm_align_skeleton(km, opt, mi, qlen, seq, n_regs, regs, a); // this calls mm_filter_regs()
|
||||
if (!(opt->flag & MM_F_ALL_CHAINS)) { // don't choose primary mapping(s)
|
||||
mm_set_parent(km, opt->mask_level, opt->mask_len, *n_regs, regs, opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL, opt->alt_drop);
|
||||
mm_select_sub(km, opt->pri_ratio, mi->k*2, opt->best_n, 0, opt->max_gap * 0.8, n_regs, regs);
|
||||
mm_set_sam_pri(*n_regs, regs);
|
||||
}
|
||||
return regs;
|
||||
}
|
||||
|
||||
void mm_map_frag_core(const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, int *n_regs, mm_reg1_t **regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname)
|
||||
{
|
||||
int i, j, rep_len, qlen_sum, n_regs0, n_mini_pos;
|
||||
int max_chain_gap_qry, max_chain_gap_ref, is_splice = !!(opt->flag & MM_F_SPLICE), is_sr = !!(opt->flag & MM_F_SR), is_sr_rna = !!(opt->flag & MM_F_SR_RNA);
|
||||
uint32_t hash;
|
||||
int64_t n_a;
|
||||
uint64_t *u, *mini_pos;
|
||||
mm128_t *a;
|
||||
mm128_v mv = {0,0,0};
|
||||
mm_reg1_t *regs0;
|
||||
km_stat_t kmst;
|
||||
float chn_pen_gap, chn_pen_skip;
|
||||
|
||||
for (i = 0, qlen_sum = 0; i < n_segs; ++i)
|
||||
qlen_sum += qlens[i], n_regs[i] = 0, regs[i] = 0;
|
||||
|
||||
if (qlen_sum == 0 || n_segs <= 0 || n_segs > MM_MAX_SEG) return;
|
||||
if (opt->max_qlen > 0 && qlen_sum > opt->max_qlen) return;
|
||||
|
||||
hash = qname && !(opt->flag & MM_F_NO_HASH_NAME)? __ac_X31_hash_string(qname) : 0;
|
||||
hash ^= __ac_Wang_hash(qlen_sum) + __ac_Wang_hash(opt->seed);
|
||||
hash = __ac_Wang_hash(hash);
|
||||
|
||||
collect_minimizers(b->km, opt, mi, n_segs, qlens, seqs, &mv);
|
||||
if (opt->q_occ_frac > 0.0f) mm_seed_mz_flt(b->km, &mv, opt->mid_occ, opt->q_occ_frac);
|
||||
if (opt->flag & MM_F_HEAP_SORT) a = collect_seed_hits_heap(b->km, opt, opt->mid_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
|
||||
else a = collect_seed_hits(b->km, opt, opt->mid_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
|
||||
|
||||
if (mm_dbg_flag & MM_DBG_PRINT_SEED) {
|
||||
fprintf(stderr, "RS\t%d\n", rep_len);
|
||||
@@ -232,36 +259,140 @@ mm_reg1_t *mm_map(const mm_idx_t *mi, int qlen, const char *seq, int *n_regs, mm
|
||||
i == 0? 0 : ((int32_t)a[i].y - (int32_t)a[i-1].y) - ((int32_t)a[i].x - (int32_t)a[i-1].x));
|
||||
}
|
||||
|
||||
max_gap_ref = opt->max_gap_ref >= 0? opt->max_gap_ref : opt->max_gap;
|
||||
n_u = mm_chain_dp(max_gap_ref, opt->max_gap, opt->bw, opt->max_chain_skip, opt->min_cnt, opt->min_chain_score, !!(opt->flag&MM_F_SPLICE), n_a, a, &u, b->km);
|
||||
regs = mm_gen_regs(b->km, qlen, n_u, u, a);
|
||||
*n_regs = n_u;
|
||||
// set max chaining gap on the query and the reference sequence
|
||||
if (is_sr)
|
||||
max_chain_gap_qry = qlen_sum > opt->max_gap? qlen_sum : opt->max_gap;
|
||||
else max_chain_gap_qry = opt->max_gap;
|
||||
if (opt->max_gap_ref > 0) {
|
||||
max_chain_gap_ref = opt->max_gap_ref; // always honor mm_mapopt_t::max_gap_ref if set
|
||||
} else if (opt->max_frag_len > 0) {
|
||||
max_chain_gap_ref = opt->max_frag_len - qlen_sum;
|
||||
if (max_chain_gap_ref < opt->max_gap) max_chain_gap_ref = opt->max_gap;
|
||||
} else max_chain_gap_ref = opt->max_gap;
|
||||
|
||||
if (mm_dbg_flag & MM_DBG_PRINT_SEED)
|
||||
for (j = 0; j < n_u; ++j)
|
||||
for (i = regs[j].as; i < regs[j].as + regs[j].cnt; ++i)
|
||||
fprintf(stderr, "CN\t%d\t%s\t%d\t%c\t%d\t%d\t%d\n", j, mi->seq[a[i].x<<1>>33].name, (int32_t)a[i].x, "+-"[a[i].x>>63], (int32_t)a[i].y, (int32_t)(a[i].y>>32&0xff),
|
||||
i == regs[j].as? 0 : ((int32_t)a[i].y - (int32_t)a[i-1].y) - ((int32_t)a[i].x - (int32_t)a[i-1].x));
|
||||
chn_pen_gap = opt->chain_gap_scale * 0.01 * mi->k;
|
||||
chn_pen_skip = opt->chain_skip_scale * 0.01 * mi->k;
|
||||
if (opt->flag & MM_F_RMQ) {
|
||||
a = mg_lchain_rmq(opt->max_gap, opt->rmq_inner_dist, opt->bw, opt->max_chain_skip, opt->rmq_size_cap, opt->min_cnt, opt->min_chain_score,
|
||||
chn_pen_gap, chn_pen_skip, n_a, a, &n_regs0, &u, b->km);
|
||||
} else {
|
||||
a = mg_lchain_dp(max_chain_gap_ref, max_chain_gap_qry, opt->bw, opt->max_chain_skip, opt->max_chain_iter, opt->min_cnt, opt->min_chain_score,
|
||||
chn_pen_gap, chn_pen_skip, is_splice, n_segs, n_a, a, &n_regs0, &u, b->km);
|
||||
}
|
||||
|
||||
if (!(opt->flag & MM_F_AVA)) { // don't choose primary mapping(s) for read overlap
|
||||
mm_set_parent(b->km, opt->mask_level, *n_regs, regs, opt->a * 2 + opt->b);
|
||||
mm_select_sub(b->km, opt->mask_level, opt->pri_ratio, mi->k*2, opt->best_n, n_regs, regs);
|
||||
if (!(opt->flag & MM_F_SPLICE))
|
||||
mm_join_long(b->km, opt, qlen, n_regs, regs, a); // TODO: this can be applied to all-vs-all in principle
|
||||
if (opt->bw_long > opt->bw && (opt->flag & (MM_F_SPLICE|MM_F_SR|MM_F_NO_LJOIN)) == 0 && n_segs == 1 && n_regs0 > 1) { // re-chain/long-join for long sequences
|
||||
int32_t st = (int32_t)a[0].y, en = (int32_t)a[(int32_t)u[0] - 1].y;
|
||||
if (qlen_sum - (en - st) > opt->rmq_rescue_size || en - st > qlen_sum * opt->rmq_rescue_ratio) {
|
||||
int32_t i;
|
||||
for (i = 0, n_a = 0; i < n_regs0; ++i) n_a += (int32_t)u[i];
|
||||
kfree(b->km, u);
|
||||
radix_sort_128x(a, a + n_a);
|
||||
a = mg_lchain_rmq(opt->max_gap, opt->rmq_inner_dist, opt->bw_long, opt->max_chain_skip, opt->rmq_size_cap, opt->min_cnt, opt->min_chain_score,
|
||||
chn_pen_gap, chn_pen_skip, n_a, a, &n_regs0, &u, b->km);
|
||||
}
|
||||
if (opt->flag & MM_F_CIGAR) {
|
||||
regs = mm_align_skeleton(b->km, opt, mi, qlen, seq, n_regs, regs, a); // this calls mm_filter_regs()
|
||||
if (!(opt->flag & MM_F_AVA)) {
|
||||
mm_set_parent(b->km, opt->mask_level, *n_regs, regs, opt->a * 2 + opt->b);
|
||||
mm_select_sub(b->km, opt->mask_level, opt->pri_ratio, mi->k*2, opt->best_n, n_regs, regs);
|
||||
mm_set_sam_pri(*n_regs, regs);
|
||||
} else if (opt->max_occ > opt->mid_occ && rep_len > 0 && !(opt->flag & MM_F_RMQ)) { // re-chain, mostly for short reads
|
||||
int rechain = 0;
|
||||
if (n_regs0 > 0) { // test if the best chain has all the segments
|
||||
int n_chained_segs = 1, max = 0, max_i = -1, max_off = -1, off = 0;
|
||||
for (i = 0; i < n_regs0; ++i) { // find the best chain
|
||||
if (max < (int)(u[i]>>32)) max = u[i]>>32, max_i = i, max_off = off;
|
||||
off += (uint32_t)u[i];
|
||||
}
|
||||
}
|
||||
mm_set_mapq(*n_regs, regs, opt->min_chain_score, opt->a, rep_len);
|
||||
|
||||
// free
|
||||
for (i = 1; i < (int32_t)u[max_i]; ++i) // count the number of segments in the best chain
|
||||
if ((a[max_off+i].y&MM_SEED_SEG_MASK) != (a[max_off+i-1].y&MM_SEED_SEG_MASK))
|
||||
++n_chained_segs;
|
||||
if (n_chained_segs < n_segs)
|
||||
rechain = 1;
|
||||
} else rechain = 1;
|
||||
if (rechain) { // redo chaining with a higher max_occ threshold
|
||||
kfree(b->km, a);
|
||||
kfree(b->km, u);
|
||||
kfree(b->km, mini_pos);
|
||||
if (opt->flag & MM_F_HEAP_SORT) a = collect_seed_hits_heap(b->km, opt, opt->max_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
|
||||
else a = collect_seed_hits(b->km, opt, opt->max_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
|
||||
a = mg_lchain_dp(max_chain_gap_ref, max_chain_gap_qry, opt->bw, opt->max_chain_skip, opt->max_chain_iter, opt->min_cnt, opt->min_chain_score,
|
||||
chn_pen_gap, chn_pen_skip, is_splice, n_segs, n_a, a, &n_regs0, &u, b->km);
|
||||
}
|
||||
}
|
||||
b->frag_gap = max_chain_gap_ref;
|
||||
b->rep_len = rep_len;
|
||||
|
||||
regs0 = mm_gen_regs(b->km, hash, qlen_sum, n_regs0, u, a, !!(opt->flag&MM_F_QSTRAND));
|
||||
if (mi->n_alt) {
|
||||
mm_mark_alt(mi, n_regs0, regs0);
|
||||
mm_hit_sort(b->km, &n_regs0, regs0, opt->alt_drop); // this step can be merged into mm_gen_regs(); will do if this shows up in profile
|
||||
}
|
||||
|
||||
if (mm_dbg_flag & (MM_DBG_PRINT_SEED|MM_DBG_PRINT_CHAIN))
|
||||
for (j = 0; j < n_regs0; ++j)
|
||||
for (i = regs0[j].as; i < regs0[j].as + regs0[j].cnt; ++i)
|
||||
fprintf(stderr, "CN\t%d\t%s\t%d\t%c\t%d\t%d\t%d\n", j, mi->seq[a[i].x<<1>>33].name, (int32_t)a[i].x, "+-"[a[i].x>>63], (int32_t)a[i].y, (int32_t)(a[i].y>>32&0xff),
|
||||
i == regs0[j].as? 0 : ((int32_t)a[i].y - (int32_t)a[i-1].y) - ((int32_t)a[i].x - (int32_t)a[i-1].x));
|
||||
|
||||
chain_post(opt, max_chain_gap_ref, mi, b->km, qlen_sum, n_segs, qlens, &n_regs0, regs0, a);
|
||||
if (!is_sr && !(opt->flag&MM_F_QSTRAND)) {
|
||||
mm_est_err(mi, qlen_sum, n_regs0, regs0, a, n_mini_pos, mini_pos);
|
||||
n_regs0 = mm_filter_strand_retained(n_regs0, regs0);
|
||||
}
|
||||
|
||||
if (n_segs == 1) { // uni-segment
|
||||
regs0 = align_regs(opt, mi, b->km, qlens[0], seqs[0], &n_regs0, regs0, a);
|
||||
regs0 = (mm_reg1_t*)realloc(regs0, sizeof(*regs0) * n_regs0);
|
||||
mm_set_mapq2(b->km, n_regs0, regs0, opt->min_chain_score, opt->a, rep_len, is_sr || is_sr_rna, is_splice);
|
||||
n_regs[0] = n_regs0, regs[0] = regs0;
|
||||
} else { // multi-segment
|
||||
mm_seg_t *seg;
|
||||
seg = mm_seg_gen(b->km, hash, n_segs, qlens, n_regs0, regs0, n_regs, regs, a); // split fragment chain to separate segment chains
|
||||
free(regs0);
|
||||
for (i = 0; i < n_segs; ++i) {
|
||||
mm_set_parent(b->km, opt->mask_level, opt->mask_len, n_regs[i], regs[i], opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL, opt->alt_drop); // update mm_reg1_t::parent
|
||||
regs[i] = align_regs(opt, mi, b->km, qlens[i], seqs[i], &n_regs[i], regs[i], seg[i].a);
|
||||
mm_set_mapq2(b->km, n_regs[i], regs[i], opt->min_chain_score, opt->a, rep_len, is_sr || is_sr_rna, is_splice);
|
||||
}
|
||||
mm_seg_free(b->km, n_segs, seg);
|
||||
if (n_segs == 2 && opt->pe_ori >= 0 && (opt->flag&MM_F_CIGAR))
|
||||
mm_pair(b->km, max_chain_gap_ref, opt->pe_bonus, opt->a * 2 + opt->b, opt->a, qlens, n_regs, regs); // pairing
|
||||
}
|
||||
|
||||
kfree(b->km, mv.a);
|
||||
kfree(b->km, a);
|
||||
kfree(b->km, u);
|
||||
kfree(b->km, mini_pos);
|
||||
|
||||
if (mi->J && n_segs == 1 && is_splice)
|
||||
for (i = 0; i < n_regs0; ++i)
|
||||
mm_jump_split(b->km, mi, opt, qlens[0], (const uint8_t*)seqs[0], ®s0[i], 0);
|
||||
|
||||
if (b->km) {
|
||||
km_stat(b->km, &kmst);
|
||||
if (mm_dbg_flag & MM_DBG_PRINT_QNAME)
|
||||
fprintf(stderr, "QM\t%s\t%d\tcap=%ld,nCore=%ld,largest=%ld\n", qname, qlen_sum, kmst.capacity, kmst.n_cores, kmst.largest);
|
||||
assert(kmst.n_blocks == kmst.n_cores); // otherwise, there is a memory leak
|
||||
if (kmst.largest > 1U<<28 || (opt->cap_kalloc > 0 && kmst.capacity > opt->cap_kalloc)) {
|
||||
if (mm_dbg_flag & MM_DBG_PRINT_QNAME)
|
||||
fprintf(stderr, "[W::%s] reset thread-local memory after read %s\n", __func__, qname);
|
||||
km_destroy(b->km);
|
||||
b->km = km_init();
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, int *n_regs, mm_reg1_t **regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname)
|
||||
{
|
||||
if ((opt->flag & MM_F_WEAK_PAIRING) && n_segs == 2 && opt->pe_ori >= 0 && (opt->flag&MM_F_CIGAR)) {
|
||||
int i;
|
||||
for (i = 0; i < n_segs; ++i)
|
||||
mm_map_frag_core(mi, 1, &qlens[i], &seqs[i], &n_regs[i], ®s[i], b, opt, qname);
|
||||
mm_pair(b->km, opt->max_gap_ref, opt->pe_bonus, opt->a * 2 + opt->b, opt->a, qlens, n_regs, regs);
|
||||
} else {
|
||||
mm_map_frag_core(mi, n_segs, qlens, seqs, n_regs, regs, b, opt, qname);
|
||||
}
|
||||
}
|
||||
|
||||
mm_reg1_t *mm_map(const mm_idx_t *mi, int qlen, const char *seq, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname)
|
||||
{
|
||||
mm_reg1_t *regs;
|
||||
mm_map_frag(mi, 1, &qlen, &seq, n_regs, ®s, b, opt, qname);
|
||||
return regs;
|
||||
}
|
||||
|
||||
@@ -270,39 +401,155 @@ mm_reg1_t *mm_map(const mm_idx_t *mi, int qlen, const char *seq, int *n_regs, mm
|
||||
**************************/
|
||||
|
||||
typedef struct {
|
||||
int mini_batch_size, n_processed, n_threads;
|
||||
int n_processed, n_threads, n_fp;
|
||||
int64_t mini_batch_size;
|
||||
const mm_mapopt_t *opt;
|
||||
mm_bseq_file_t *fp;
|
||||
mm_bseq_file_t **fp;
|
||||
const mm_idx_t *mi;
|
||||
kstring_t str;
|
||||
|
||||
int n_parts;
|
||||
uint32_t *rid_shift;
|
||||
FILE *fp_split, **fp_parts;
|
||||
} pipeline_t;
|
||||
|
||||
typedef struct {
|
||||
const pipeline_t *p;
|
||||
int n_seq;
|
||||
int n_seq, n_frag;
|
||||
mm_bseq1_t *seq;
|
||||
int *n_reg;
|
||||
int *n_reg, *seg_off, *n_seg, *rep_len, *frag_gap;
|
||||
mm_reg1_t **reg;
|
||||
mm_tbuf_t **buf;
|
||||
} step_t;
|
||||
|
||||
static void worker_for(void *_data, long i, int tid) // kt_for() callback
|
||||
{
|
||||
step_t *step = (step_t*)_data;
|
||||
step_t *s = (step_t*)_data;
|
||||
int qlens[MM_MAX_SEG], j, off = s->seg_off[i], pe_ori = s->p->opt->pe_ori;
|
||||
const char *qseqs[MM_MAX_SEG];
|
||||
double t = 0.0;
|
||||
mm_tbuf_t *b = s->buf[tid];
|
||||
assert(s->n_seg[i] <= MM_MAX_SEG);
|
||||
if (mm_dbg_flag & MM_DBG_PRINT_QNAME) {
|
||||
fprintf(stderr, "QR\t%s\t%d\t%d\n", s->seq[off].name, tid, s->seq[off].l_seq);
|
||||
t = realtime();
|
||||
}
|
||||
for (j = 0; j < s->n_seg[i]; ++j) {
|
||||
if (s->n_seg[i] == 2 && ((j == 0 && (pe_ori>>1&1)) || (j == 1 && (pe_ori&1))))
|
||||
mm_revcomp_bseq(&s->seq[off + j]);
|
||||
qlens[j] = s->seq[off + j].l_seq;
|
||||
qseqs[j] = s->seq[off + j].seq;
|
||||
}
|
||||
if (s->p->opt->flag & MM_F_INDEPEND_SEG) {
|
||||
for (j = 0; j < s->n_seg[i]; ++j) {
|
||||
mm_map_frag(s->p->mi, 1, &qlens[j], &qseqs[j], &s->n_reg[off+j], &s->reg[off+j], b, s->p->opt, s->seq[off+j].name);
|
||||
s->rep_len[off + j] = b->rep_len;
|
||||
s->frag_gap[off + j] = b->frag_gap;
|
||||
}
|
||||
} else {
|
||||
mm_map_frag(s->p->mi, s->n_seg[i], qlens, qseqs, &s->n_reg[off], &s->reg[off], b, s->p->opt, s->seq[off].name);
|
||||
for (j = 0; j < s->n_seg[i]; ++j) {
|
||||
s->rep_len[off + j] = b->rep_len;
|
||||
s->frag_gap[off + j] = b->frag_gap;
|
||||
}
|
||||
}
|
||||
for (j = 0; j < s->n_seg[i]; ++j) // flip the query strand and coordinate to the original read strand
|
||||
if (s->n_seg[i] == 2 && ((j == 0 && (pe_ori>>1&1)) || (j == 1 && (pe_ori&1)))) {
|
||||
int k, t;
|
||||
mm_revcomp_bseq(&s->seq[off + j]);
|
||||
for (k = 0; k < s->n_reg[off + j]; ++k) {
|
||||
mm_reg1_t *r = &s->reg[off + j][k];
|
||||
t = r->qs;
|
||||
r->qs = qlens[j] - r->qe;
|
||||
r->qe = qlens[j] - t;
|
||||
r->rev = !r->rev;
|
||||
if (r->p) {
|
||||
if (r->p->trans_strand == 1) r->p->trans_strand = 2;
|
||||
else if (r->p->trans_strand == 2) r->p->trans_strand = 1;
|
||||
}
|
||||
}
|
||||
}
|
||||
if (mm_dbg_flag & MM_DBG_PRINT_QNAME)
|
||||
fprintf(stderr, "QR\t%s\t%d\n", step->seq[i].name, tid);
|
||||
step->reg[i] = mm_map(step->p->mi, step->seq[i].l_seq, step->seq[i].seq, &step->n_reg[i], step->buf[tid], step->p->opt, step->seq[i].name);
|
||||
fprintf(stderr, "QT\t%s\t%d\t%.6f\n", s->seq[off].name, tid, realtime() - t);
|
||||
}
|
||||
|
||||
static void merge_hits(step_t *s)
|
||||
{
|
||||
int f, i, k0, k, max_seg = 0, *n_reg_part, *rep_len_part, *frag_gap_part, *qlens;
|
||||
void *km;
|
||||
FILE **fp = s->p->fp_parts;
|
||||
const mm_mapopt_t *opt = s->p->opt;
|
||||
|
||||
km = km_init();
|
||||
for (f = 0; f < s->n_frag; ++f)
|
||||
max_seg = max_seg > s->n_seg[f]? max_seg : s->n_seg[f];
|
||||
qlens = CALLOC(int, max_seg + s->p->n_parts * 3);
|
||||
n_reg_part = qlens + max_seg;
|
||||
rep_len_part = n_reg_part + s->p->n_parts;
|
||||
frag_gap_part = rep_len_part + s->p->n_parts;
|
||||
for (f = 0, k = k0 = 0; f < s->n_frag; ++f) {
|
||||
k0 = k;
|
||||
for (i = 0; i < s->n_seg[f]; ++i, ++k) {
|
||||
int j, l, t, rep_len = 0;
|
||||
qlens[i] = s->seq[k].l_seq;
|
||||
for (j = 0, s->n_reg[k] = 0; j < s->p->n_parts; ++j) {
|
||||
mm_err_fread(&n_reg_part[j], sizeof(int), 1, fp[j]);
|
||||
mm_err_fread(&rep_len_part[j], sizeof(int), 1, fp[j]);
|
||||
mm_err_fread(&frag_gap_part[j], sizeof(int), 1, fp[j]);
|
||||
s->n_reg[k] += n_reg_part[j];
|
||||
if (rep_len < rep_len_part[j])
|
||||
rep_len = rep_len_part[j];
|
||||
}
|
||||
s->reg[k] = CALLOC(mm_reg1_t, s->n_reg[k]);
|
||||
for (j = 0, l = 0; j < s->p->n_parts; ++j) {
|
||||
for (t = 0; t < n_reg_part[j]; ++t, ++l) {
|
||||
mm_reg1_t *r = &s->reg[k][l];
|
||||
uint32_t capacity;
|
||||
mm_err_fread(r, sizeof(mm_reg1_t), 1, fp[j]);
|
||||
r->rid += s->p->rid_shift[j];
|
||||
if (opt->flag & MM_F_CIGAR) {
|
||||
mm_err_fread(&capacity, 4, 1, fp[j]);
|
||||
r->p = (mm_extra_t*)calloc(capacity, 4);
|
||||
r->p->capacity = capacity;
|
||||
mm_err_fread(r->p, r->p->capacity, 4, fp[j]);
|
||||
}
|
||||
}
|
||||
}
|
||||
if (!(opt->flag&MM_F_SR) && s->seq[k].l_seq >= opt->rank_min_len)
|
||||
mm_update_dp_max(s->seq[k].l_seq, s->n_reg[k], s->reg[k], opt->rank_frac, opt->a, opt->b);
|
||||
for (j = 0; j < s->n_reg[k]; ++j) {
|
||||
mm_reg1_t *r = &s->reg[k][j];
|
||||
if (r->p) r->p->dp_max2 = 0; // reset ->dp_max2 as mm_set_parent() doesn't clear it; necessary with mm_update_dp_max()
|
||||
r->subsc = 0; // this may not be necessary
|
||||
r->n_sub = 0; // n_sub will be an underestimate as we don't see all the chains now, but it can't be accurate anyway
|
||||
}
|
||||
mm_hit_sort(km, &s->n_reg[k], s->reg[k], opt->alt_drop);
|
||||
mm_set_parent(km, opt->mask_level, opt->mask_len, s->n_reg[k], s->reg[k], opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL, opt->alt_drop);
|
||||
if (!(opt->flag & MM_F_ALL_CHAINS)) {
|
||||
mm_select_sub(km, opt->pri_ratio, s->p->mi->k*2, opt->best_n, 0, opt->max_gap * 0.8, &s->n_reg[k], s->reg[k]);
|
||||
mm_set_sam_pri(s->n_reg[k], s->reg[k]);
|
||||
}
|
||||
mm_set_mapq2(km, s->n_reg[k], s->reg[k], opt->min_chain_score, opt->a, rep_len, !!(opt->flag & (MM_F_SR|MM_F_SR_RNA)), !!(opt->flag & MM_F_SPLICE));
|
||||
}
|
||||
if (s->n_seg[f] == 2 && opt->pe_ori >= 0 && (opt->flag&MM_F_CIGAR))
|
||||
mm_pair(km, frag_gap_part[0], opt->pe_bonus, opt->a * 2 + opt->b, opt->a, qlens, &s->n_reg[k0], &s->reg[k0]);
|
||||
}
|
||||
free(qlens);
|
||||
km_destroy(km);
|
||||
}
|
||||
|
||||
static void *worker_pipeline(void *shared, int step, void *in)
|
||||
{
|
||||
int i, j;
|
||||
int i, j, k;
|
||||
pipeline_t *p = (pipeline_t*)shared;
|
||||
if (step == 0) { // step 0: read sequences
|
||||
int with_qual = (!!(p->opt->flag & MM_F_OUT_SAM) && !(p->opt->flag & MM_F_NO_QUAL));
|
||||
int with_comment = !!(p->opt->flag & MM_F_COPY_COMMENT);
|
||||
int frag_mode = (p->n_fp > 1 || !!(p->opt->flag & MM_F_FRAG_MODE));
|
||||
step_t *s;
|
||||
s = (step_t*)calloc(1, sizeof(step_t));
|
||||
s->seq = mm_bseq_read(p->fp, p->mini_batch_size, with_qual, &s->n_seq);
|
||||
if (p->n_fp > 1) s->seq = mm_bseq_read_frag2(p->n_fp, p->fp, p->mini_batch_size, with_qual, with_comment, &s->n_seq);
|
||||
else s->seq = mm_bseq_read3(p->fp[0], p->mini_batch_size, with_qual, with_comment, frag_mode, &s->n_seq);
|
||||
if (s->seq) {
|
||||
s->p = p;
|
||||
for (i = 0; i < s->n_seq; ++i)
|
||||
@@ -310,12 +557,23 @@ static void *worker_pipeline(void *shared, int step, void *in)
|
||||
s->buf = (mm_tbuf_t**)calloc(p->n_threads, sizeof(mm_tbuf_t*));
|
||||
for (i = 0; i < p->n_threads; ++i)
|
||||
s->buf[i] = mm_tbuf_init();
|
||||
s->n_reg = (int*)calloc(s->n_seq, sizeof(int));
|
||||
s->n_reg = (int*)calloc(5 * s->n_seq, sizeof(int));
|
||||
s->seg_off = s->n_reg + s->n_seq; // seg_off, n_seg, rep_len and frag_gap are allocated together with n_reg
|
||||
s->n_seg = s->seg_off + s->n_seq;
|
||||
s->rep_len = s->n_seg + s->n_seq;
|
||||
s->frag_gap = s->rep_len + s->n_seq;
|
||||
s->reg = (mm_reg1_t**)calloc(s->n_seq, sizeof(mm_reg1_t*));
|
||||
for (i = 1, j = 0; i <= s->n_seq; ++i)
|
||||
if (i == s->n_seq || !frag_mode || !mm_qname_same(s->seq[i-1].name, s->seq[i].name)) {
|
||||
s->n_seg[s->n_frag] = i - j;
|
||||
s->seg_off[s->n_frag++] = j;
|
||||
j = i;
|
||||
}
|
||||
return s;
|
||||
} else free(s);
|
||||
} else if (step == 1) { // step 1: map
|
||||
kt_for(p->n_threads, worker_for, in, ((step_t*)in)->n_seq);
|
||||
if (p->n_parts > 0) merge_hits((step_t*)in);
|
||||
else kt_for(p->n_threads, worker_for, in, ((step_t*)in)->n_frag);
|
||||
return in;
|
||||
} else if (step == 2) { // step 2: output
|
||||
void *km = 0;
|
||||
@@ -324,26 +582,58 @@ static void *worker_pipeline(void *shared, int step, void *in)
|
||||
for (i = 0; i < p->n_threads; ++i) mm_tbuf_destroy(s->buf[i]);
|
||||
free(s->buf);
|
||||
if ((p->opt->flag & MM_F_OUT_CS) && !(mm_dbg_flag & MM_DBG_NO_KALLOC)) km = km_init();
|
||||
for (i = 0; i < s->n_seq; ++i) {
|
||||
for (k = 0; k < s->n_frag; ++k) {
|
||||
int seg_st = s->seg_off[k], seg_en = s->seg_off[k] + s->n_seg[k];
|
||||
for (i = seg_st; i < seg_en; ++i) {
|
||||
mm_bseq1_t *t = &s->seq[i];
|
||||
if (p->opt->split_prefix && p->n_parts == 0) { // then write to temporary files
|
||||
mm_err_fwrite(&s->n_reg[i], sizeof(int), 1, p->fp_split);
|
||||
mm_err_fwrite(&s->rep_len[i], sizeof(int), 1, p->fp_split);
|
||||
mm_err_fwrite(&s->frag_gap[i], sizeof(int), 1, p->fp_split);
|
||||
for (j = 0; j < s->n_reg[i]; ++j) {
|
||||
mm_reg1_t *r = &s->reg[i][j];
|
||||
mm_err_fwrite(r, sizeof(mm_reg1_t), 1, p->fp_split);
|
||||
if (p->opt->flag & MM_F_CIGAR) {
|
||||
mm_err_fwrite(&r->p->capacity, 4, 1, p->fp_split);
|
||||
mm_err_fwrite(r->p, r->p->capacity, 4, p->fp_split);
|
||||
}
|
||||
}
|
||||
} else if (p->opt->flag & MM_F_OUT_JUNC) { // extra logic for --write-junc
|
||||
for (j = 0; j < s->n_reg[i]; ++j) {
|
||||
const mm_reg1_t *r = &s->reg[i][j];
|
||||
if (r->id != r->parent || r->mapq < 10) continue;
|
||||
mm_write_junc(&p->str, mi, t, r);
|
||||
if (p->str.l > 0) mm_err_puts(p->str.s);
|
||||
}
|
||||
} else if (s->n_reg[i] > 0) { // the query has at least one hit
|
||||
for (j = 0; j < s->n_reg[i]; ++j) {
|
||||
const mm_reg1_t *r = &s->reg[i][j];
|
||||
assert(!r->sam_pri || r->id == r->parent);
|
||||
if ((p->opt->flag & MM_F_NO_PRINT_2ND) && r->id != r->parent)
|
||||
continue;
|
||||
if (p->opt->flag & MM_F_OUT_SAM)
|
||||
mm_write_sam(&p->str, mi, t, r, s->n_reg[i], s->reg[i]);
|
||||
mm_write_sam3(&p->str, mi, t, i - seg_st, j, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag, s->rep_len[i]);
|
||||
else
|
||||
mm_write_paf(&p->str, mi, t, r, km, p->opt->flag);
|
||||
puts(p->str.s);
|
||||
mm_write_paf4(&p->str, mi, t, r, km, p->opt->flag, s->rep_len[i], s->n_seg[k], i - seg_st);
|
||||
mm_err_puts(p->str.s);
|
||||
}
|
||||
if (s->n_reg[i] == 0 && (p->opt->flag & MM_F_OUT_SAM)) {
|
||||
mm_write_sam(&p->str, 0, t, 0, 0, 0);
|
||||
puts(p->str.s);
|
||||
} else if ((p->opt->flag & MM_F_PAF_NO_HIT) || ((p->opt->flag & MM_F_OUT_SAM) && !(p->opt->flag & MM_F_SAM_HIT_ONLY))) { // output an empty hit, if requested
|
||||
if (p->opt->flag & MM_F_OUT_SAM)
|
||||
mm_write_sam3(&p->str, mi, t, i - seg_st, -1, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag, s->rep_len[i]);
|
||||
else
|
||||
mm_write_paf4(&p->str, mi, t, 0, 0, p->opt->flag, s->rep_len[i], s->n_seg[k], i - seg_st);
|
||||
mm_err_puts(p->str.s);
|
||||
}
|
||||
}
|
||||
for (i = seg_st; i < seg_en; ++i) {
|
||||
for (j = 0; j < s->n_reg[i]; ++j) free(s->reg[i][j].p);
|
||||
free(s->reg[i]);
|
||||
free(s->seq[i].seq); free(s->seq[i].name);
|
||||
if (s->seq[i].qual) free(s->seq[i].qual);
|
||||
if (s->seq[i].comment) free(s->seq[i].comment);
|
||||
}
|
||||
free(s->reg); free(s->n_reg); free(s->seq);
|
||||
}
|
||||
free(s->reg); free(s->n_reg); free(s->seq); // seg_off, n_seg, rep_len and frag_gap were allocated with reg; no memory leak here
|
||||
km_destroy(km);
|
||||
if (mm_verbose >= 3)
|
||||
fprintf(stderr, "[M::%s::%.3f*%.2f] mapped %d sequences\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), s->n_seq);
|
||||
@@ -352,22 +642,95 @@ static void *worker_pipeline(void *shared, int step, void *in)
|
||||
return 0;
|
||||
}
|
||||
|
||||
int mm_map_file(const mm_idx_t *idx, const char *fn, const mm_mapopt_t *opt, int n_threads)
|
||||
static mm_bseq_file_t **open_bseqs(int n, const char **fn)
|
||||
{
|
||||
pipeline_t pl;
|
||||
memset(&pl, 0, sizeof(pipeline_t));
|
||||
pl.fp = mm_bseq_open(fn);
|
||||
if (pl.fp == 0) {
|
||||
mm_bseq_file_t **fp;
|
||||
int i, j;
|
||||
fp = (mm_bseq_file_t**)calloc(n, sizeof(mm_bseq_file_t*));
|
||||
for (i = 0; i < n; ++i) {
|
||||
if ((fp[i] = mm_bseq_open(fn[i])) == 0) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "ERROR: failed to open file '%s'\n", fn);
|
||||
fprintf(stderr, "ERROR: failed to open file '%s': %s\n", fn[i], strerror(errno));
|
||||
for (j = 0; j < i; ++j)
|
||||
mm_bseq_close(fp[j]);
|
||||
free(fp);
|
||||
return 0;
|
||||
}
|
||||
}
|
||||
return fp;
|
||||
}
|
||||
|
||||
int mm_map_file_frag(const mm_idx_t *idx, int n_segs, const char **fn, const mm_mapopt_t *opt, int n_threads)
|
||||
{
|
||||
int i, pl_threads;
|
||||
pipeline_t pl;
|
||||
if (n_segs < 1) return -1;
|
||||
memset(&pl, 0, sizeof(pipeline_t));
|
||||
pl.n_fp = n_segs;
|
||||
pl.fp = open_bseqs(pl.n_fp, fn);
|
||||
if (pl.fp == 0) return -1;
|
||||
pl.opt = opt, pl.mi = idx;
|
||||
pl.n_threads = n_threads > 1? n_threads : 1;
|
||||
pl.mini_batch_size = opt->mini_batch_size;
|
||||
if (opt->split_prefix)
|
||||
pl.fp_split = mm_split_init(opt->split_prefix, idx);
|
||||
pl_threads = n_threads == 1? 1 : (opt->flag&MM_F_2_IO_THREADS)? 3 : 2;
|
||||
kt_pipeline(pl_threads, worker_pipeline, &pl, 3);
|
||||
|
||||
free(pl.str.s);
|
||||
if (pl.fp_split) fclose(pl.fp_split);
|
||||
for (i = 0; i < pl.n_fp; ++i)
|
||||
mm_bseq_close(pl.fp[i]);
|
||||
free(pl.fp);
|
||||
return 0;
|
||||
}
|
||||
|
||||
int mm_map_file(const mm_idx_t *idx, const char *fn, const mm_mapopt_t *opt, int n_threads)
|
||||
{
|
||||
return mm_map_file_frag(idx, 1, &fn, opt, n_threads);
|
||||
}
|
||||
|
||||
int mm_split_merge(int n_segs, const char **fn, const mm_mapopt_t *opt, int n_split_idx)
|
||||
{
|
||||
int i;
|
||||
pipeline_t pl;
|
||||
mm_idx_t *mi;
|
||||
if (n_segs < 1 || n_split_idx < 1) return -1;
|
||||
memset(&pl, 0, sizeof(pipeline_t));
|
||||
pl.n_fp = n_segs;
|
||||
pl.fp = open_bseqs(pl.n_fp, fn);
|
||||
if (pl.fp == 0) return -1;
|
||||
pl.opt = opt;
|
||||
pl.mini_batch_size = opt->mini_batch_size;
|
||||
|
||||
pl.n_parts = n_split_idx;
|
||||
pl.fp_parts = CALLOC(FILE*, pl.n_parts);
|
||||
pl.rid_shift = CALLOC(uint32_t, pl.n_parts);
|
||||
pl.mi = mi = mm_split_merge_prep(opt->split_prefix, n_split_idx, pl.fp_parts, pl.rid_shift);
|
||||
if (pl.mi == 0) {
|
||||
free(pl.fp_parts);
|
||||
free(pl.rid_shift);
|
||||
return -1;
|
||||
}
|
||||
pl.opt = opt, pl.mi = idx;
|
||||
pl.n_threads = n_threads, pl.mini_batch_size = opt->mini_batch_size;
|
||||
if ((opt->flag & MM_F_OUT_SAM) && !(opt->flag & MM_F_NO_SAM_SQ))
|
||||
mm_write_sam_SQ(idx);
|
||||
kt_pipeline(n_threads == 1? 1 : 2, worker_pipeline, &pl, 3);
|
||||
for (i = n_split_idx - 1; i > 0; --i)
|
||||
pl.rid_shift[i] = pl.rid_shift[i - 1];
|
||||
for (pl.rid_shift[0] = 0, i = 1; i < n_split_idx; ++i)
|
||||
pl.rid_shift[i] += pl.rid_shift[i - 1];
|
||||
if (opt->flag & MM_F_OUT_SAM)
|
||||
for (i = 0; i < (int32_t)pl.mi->n_seq; ++i)
|
||||
printf("@SQ\tSN:%s\tLN:%d\n", pl.mi->seq[i].name, pl.mi->seq[i].len);
|
||||
|
||||
kt_pipeline(2, worker_pipeline, &pl, 3);
|
||||
|
||||
free(pl.str.s);
|
||||
mm_bseq_close(pl.fp);
|
||||
mm_idx_destroy(mi);
|
||||
free(pl.rid_shift);
|
||||
for (i = 0; i < n_split_idx; ++i)
|
||||
fclose(pl.fp_parts[i]);
|
||||
free(pl.fp_parts);
|
||||
for (i = 0; i < pl.n_fp; ++i)
|
||||
mm_bseq_close(pl.fp[i]);
|
||||
free(pl.fp);
|
||||
mm_split_rm_tmp(opt->split_prefix, n_split_idx);
|
||||
return 0;
|
||||
}
|
||||
|
||||
@@ -5,22 +5,70 @@
|
||||
#include <stdio.h>
|
||||
#include <sys/types.h>
|
||||
|
||||
#define MM_F_NO_SELF 0x001
|
||||
#define MM_F_AVA 0x002
|
||||
#define MM_F_CIGAR 0x004
|
||||
#define MM_F_OUT_SAM 0x008
|
||||
#define MM_F_NO_QUAL 0x010
|
||||
#define MM_F_OUT_CG 0x020
|
||||
#define MM_F_OUT_CS 0x040
|
||||
#define MM_F_SPLICE 0x080
|
||||
#define MM_F_SPLICE_FOR 0x100
|
||||
#define MM_F_SPLICE_REV 0x200
|
||||
#define MM_F_SPLICE_BOTH 0x400
|
||||
#define MM_F_NO_SAM_SQ 0x800
|
||||
#define MM_F_APPROX_EXT 0x1000
|
||||
#define MM_VERSION "2.29-r1283"
|
||||
|
||||
#define MM_F_NO_DIAG (0x001LL) // no exact diagonal hit
|
||||
#define MM_F_NO_DUAL (0x002LL) // skip pairs where query name is lexicographically larger than target name
|
||||
#define MM_F_CIGAR (0x004LL)
|
||||
#define MM_F_OUT_SAM (0x008LL)
|
||||
#define MM_F_NO_QUAL (0x010LL)
|
||||
#define MM_F_OUT_CG (0x020LL)
|
||||
#define MM_F_OUT_CS (0x040LL)
|
||||
#define MM_F_SPLICE (0x080LL) // splice mode
|
||||
#define MM_F_SPLICE_FOR (0x100LL) // match GT-AG
|
||||
#define MM_F_SPLICE_REV (0x200LL) // match CT-AC, the reverse complement of GT-AG
|
||||
#define MM_F_NO_LJOIN (0x400LL)
|
||||
#define MM_F_OUT_CS_LONG (0x800LL)
|
||||
#define MM_F_SR (0x1000LL)
|
||||
#define MM_F_FRAG_MODE (0x2000LL)
|
||||
#define MM_F_NO_PRINT_2ND (0x4000LL)
|
||||
#define MM_F_2_IO_THREADS (0x8000LL)
|
||||
#define MM_F_LONG_CIGAR (0x10000LL)
|
||||
#define MM_F_INDEPEND_SEG (0x20000LL)
|
||||
#define MM_F_SPLICE_FLANK (0x40000LL)
|
||||
#define MM_F_SOFTCLIP (0x80000LL)
|
||||
#define MM_F_FOR_ONLY (0x100000LL)
|
||||
#define MM_F_REV_ONLY (0x200000LL)
|
||||
#define MM_F_HEAP_SORT (0x400000LL)
|
||||
#define MM_F_ALL_CHAINS (0x800000LL)
|
||||
#define MM_F_OUT_MD (0x1000000LL)
|
||||
#define MM_F_COPY_COMMENT (0x2000000LL)
|
||||
#define MM_F_EQX (0x4000000LL) // use =/X instead of M
|
||||
#define MM_F_PAF_NO_HIT (0x8000000LL) // output unmapped reads to PAF
|
||||
#define MM_F_NO_END_FLT (0x10000000LL)
|
||||
#define MM_F_HARD_MLEVEL (0x20000000LL)
|
||||
#define MM_F_SAM_HIT_ONLY (0x40000000LL)
|
||||
#define MM_F_RMQ (0x80000000LL)
|
||||
#define MM_F_QSTRAND (0x100000000LL)
|
||||
#define MM_F_NO_INV (0x200000000LL)
|
||||
#define MM_F_NO_HASH_NAME (0x400000000LL)
|
||||
#define MM_F_SPLICE_OLD (0x800000000LL)
|
||||
#define MM_F_SECONDARY_SEQ (0x1000000000LL) //output SEQ field for seqondary alignments using hard clipping
|
||||
#define MM_F_OUT_DS (0x2000000000LL)
|
||||
#define MM_F_WEAK_PAIRING (0x4000000000LL)
|
||||
#define MM_F_SR_RNA (0x8000000000LL)
|
||||
#define MM_F_OUT_JUNC (0x10000000000LL)
|
||||
|
||||
#define MM_I_HPC 0x1
|
||||
#define MM_I_NO_SEQ 0x2
|
||||
#define MM_I_NO_NAME 0x4
|
||||
|
||||
#define MM_IDX_MAGIC "MMI\2"
|
||||
|
||||
#define MM_MAX_SEG 255
|
||||
|
||||
#define MM_CIGAR_MATCH 0
|
||||
#define MM_CIGAR_INS 1
|
||||
#define MM_CIGAR_DEL 2
|
||||
#define MM_CIGAR_N_SKIP 3
|
||||
#define MM_CIGAR_SOFTCLIP 4
|
||||
#define MM_CIGAR_HARDCLIP 5
|
||||
#define MM_CIGAR_PADDING 6
|
||||
#define MM_CIGAR_EQ_MATCH 7
|
||||
#define MM_CIGAR_X_MISMATCH 8
|
||||
|
||||
#define MM_CIGAR_STR "MIDNSHP=XB"
|
||||
|
||||
#ifdef __cplusplus
|
||||
extern "C" {
|
||||
#endif
|
||||
@@ -34,23 +82,28 @@ typedef struct {
|
||||
char *name; // name of the db sequence
|
||||
uint64_t offset; // offset in mm_idx_t::S
|
||||
uint32_t len; // length
|
||||
uint32_t is_alt;
|
||||
} mm_idx_seq_t;
|
||||
|
||||
typedef struct {
|
||||
int32_t b, w, k, is_hpc;
|
||||
int32_t b, w, k, flag;
|
||||
uint32_t n_seq; // number of reference sequences
|
||||
int32_t index;
|
||||
int32_t n_alt;
|
||||
mm_idx_seq_t *seq; // sequence name, length and offset
|
||||
uint32_t *S; // 4-bit packed sequence
|
||||
struct mm_idx_bucket_s *B; // index (hidden)
|
||||
void *km;
|
||||
struct mm_idx_intv_s *I; // intervals (hidden)
|
||||
struct mm_idx_spsc_s *spsc;// splice score (hidden)
|
||||
struct mm_idx_jjump_s *J; // junctions to create jumps (hidden)
|
||||
void *km, *h;
|
||||
} mm_idx_t;
|
||||
|
||||
// minimap2 alignment
|
||||
typedef struct {
|
||||
uint32_t capacity; // the capacity of cigar[]
|
||||
int32_t dp_score, dp_max, dp_max2; // DP score; score of the max-scoring segment; score of the best alternate mappings
|
||||
uint32_t blen; // block length
|
||||
uint32_t n_diff; // number of differences, including ambiguous bases
|
||||
int32_t dp_max0; // DP score before mm_update_dp_max() adjustment
|
||||
uint32_t n_ambi:30, trans_strand:2; // number of ambiguous bases; transcript strand: 0 for unknown, 1 for +, 2 for -
|
||||
uint32_t n_cigar; // number of cigar operations in cigar[]
|
||||
uint32_t cigar[];
|
||||
@@ -58,55 +111,89 @@ typedef struct {
|
||||
|
||||
typedef struct {
|
||||
int32_t id; // ID for internal uses (see also parent below)
|
||||
uint32_t cnt:31, rev:1; // number of minimizers; if on the reverse strand
|
||||
uint32_t rid:31, inv:1; // reference index; if this is an alignment from inversion rescue
|
||||
int32_t cnt; // number of minimizers; if on the reverse strand
|
||||
int32_t rid; // reference index; if this is an alignment from inversion rescue
|
||||
int32_t score; // DP alignment score
|
||||
int32_t qs, qe, rs, re; // query start and end; reference start and end
|
||||
int32_t parent, subsc; // parent==id if primary; best alternate mapping score
|
||||
int32_t as; // offset in the a[] array (for internal uses only)
|
||||
int32_t fuzzy_mlen, fuzzy_blen; // seeded exact match length; seeded alignment block length (approximate)
|
||||
uint32_t mapq:8, split:2, sam_pri:1, n_sub:21; // mapQ; split pattern; if SAM primary; number of suboptimal mappings
|
||||
int32_t mlen, blen; // seeded exact match length; seeded alignment block length
|
||||
int32_t n_sub; // number of suboptimal mappings
|
||||
int32_t score0; // initial chaining score (before chain merging/spliting)
|
||||
uint32_t mapq:8, split:2, rev:1, inv:1, sam_pri:1, proper_frag:1, pe_thru:1, seg_split:1, seg_id:8, split_inv:1, is_alt:1, strand_retained:1, is_spliced:1, dummy:4;
|
||||
uint32_t hash;
|
||||
float div;
|
||||
mm_extra_t *p;
|
||||
} mm_reg1_t;
|
||||
|
||||
// indexing and mapping options
|
||||
typedef struct {
|
||||
short k, w, is_hpc, bucket_bits;
|
||||
int mini_batch_size;
|
||||
short k, w, flag, bucket_bits;
|
||||
int64_t mini_batch_size;
|
||||
uint64_t batch_size;
|
||||
} mm_idxopt_t;
|
||||
|
||||
typedef struct {
|
||||
int64_t flag; // see MM_F_* macros
|
||||
int seed;
|
||||
int sdust_thres; // score threshold for SDUST; 0 to disable
|
||||
int flag; // see MM_F_* macros
|
||||
|
||||
int bw; // bandwidth
|
||||
int max_qlen; // max query length
|
||||
|
||||
int bw, bw_long; // bandwidth
|
||||
int max_gap, max_gap_ref; // break a chain if there are no minimizers in a max_gap window
|
||||
int max_chain_skip;
|
||||
int max_frag_len;
|
||||
int max_chain_skip, max_chain_iter;
|
||||
int min_cnt; // min number of minimizers on each chain
|
||||
int min_chain_score; // min chaining score
|
||||
float chain_gap_scale;
|
||||
float chain_skip_scale;
|
||||
int rmq_size_cap, rmq_inner_dist;
|
||||
int rmq_rescue_size;
|
||||
float rmq_rescue_ratio;
|
||||
|
||||
float mask_level;
|
||||
int mask_len;
|
||||
float pri_ratio;
|
||||
int best_n; // top best_n chains are subjected to DP alignment
|
||||
|
||||
int max_join_long, max_join_short;
|
||||
int min_join_flank_sc;
|
||||
float alt_drop;
|
||||
|
||||
int a, b, q, e, q2, e2; // matching score, mismatch, gap-open and gap-ext penalties
|
||||
int transition; // transition mismatch score (A:G, C:T)
|
||||
int sc_ambi; // score when one or both bases are "N"
|
||||
int noncan; // cost of non-canonical splicing sites
|
||||
int zdrop; // break alignment if alignment score drops too fast along the diagonal
|
||||
int junc_bonus, junc_pen;
|
||||
int zdrop, zdrop_inv; // break alignment if alignment score drops too fast along the diagonal
|
||||
int end_bonus;
|
||||
int min_dp_max; // drop an alignment if the score of the max scoring segment is below this threshold
|
||||
int min_ksw_len;
|
||||
int anchor_ext_len, anchor_ext_shift;
|
||||
float max_clip_ratio; // drop an alignment if BOTH ends are clipped above this ratio
|
||||
|
||||
int rank_min_len;
|
||||
float rank_frac;
|
||||
|
||||
int pe_ori, pe_bonus;
|
||||
|
||||
int32_t jump_min_match;
|
||||
|
||||
float mid_occ_frac; // only used by mm_mapopt_update(); see below
|
||||
float q_occ_frac;
|
||||
int32_t min_mid_occ, max_mid_occ;
|
||||
int32_t mid_occ; // ignore seeds with occurrences above this threshold
|
||||
int mini_batch_size; // size of a batch of query bases to process in parallel
|
||||
int32_t max_occ, max_max_occ, occ_dist;
|
||||
int64_t mini_batch_size; // size of a batch of query bases to process in parallel
|
||||
int64_t max_sw_mat;
|
||||
int64_t cap_kalloc;
|
||||
|
||||
const char *split_prefix;
|
||||
} mm_mapopt_t;
|
||||
|
||||
// index reader
|
||||
typedef struct {
|
||||
int is_idx, n_parts;
|
||||
int64_t idx_size;
|
||||
mm_idxopt_t opt;
|
||||
FILE *fp_out;
|
||||
union {
|
||||
@@ -116,6 +203,11 @@ typedef struct {
|
||||
} mm_idx_reader_t;
|
||||
|
||||
// memory buffer for thread-local storage during mapping
|
||||
struct mm_tbuf_s {
|
||||
void *km;
|
||||
int rep_len, frag_gap;
|
||||
};
|
||||
|
||||
typedef struct mm_tbuf_s mm_tbuf_t;
|
||||
|
||||
// global variables
|
||||
@@ -132,6 +224,7 @@ extern double mm_realtime0; // wall-clock timer
|
||||
* @return 0 if success; -1 if _present_ unknown
|
||||
*/
|
||||
int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo);
|
||||
int mm_check_opt(const mm_idxopt_t *io, const mm_mapopt_t *mo);
|
||||
|
||||
/**
|
||||
* Update mm_mapopt_t::mid_occ via mm_mapopt_t::mid_occ_frac
|
||||
@@ -145,6 +238,8 @@ int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo);
|
||||
*/
|
||||
void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi);
|
||||
|
||||
void mm_mapopt_max_intron_len(mm_mapopt_t *opt, int max_intron_len);
|
||||
|
||||
/**
|
||||
* Initialize an index reader
|
||||
*
|
||||
@@ -180,6 +275,53 @@ mm_idx_t *mm_idx_reader_read(mm_idx_reader_t *r, int n_threads);
|
||||
*/
|
||||
void mm_idx_reader_close(mm_idx_reader_t *r);
|
||||
|
||||
int mm_idx_reader_eof(const mm_idx_reader_t *r);
|
||||
|
||||
/**
|
||||
* Check whether the file contains a minimap2 index
|
||||
*
|
||||
* @param fn file name
|
||||
*
|
||||
* @return the file size if fn is an index file; 0 if fn is not.
|
||||
*/
|
||||
int64_t mm_idx_is_idx(const char *fn);
|
||||
|
||||
/**
|
||||
* Load a part of an index
|
||||
*
|
||||
* Given a uni-part index, this function loads the entire index into memory.
|
||||
* Given a multi-part index, it loads one part only and places the file pointer
|
||||
* at the end of that part.
|
||||
*
|
||||
* @param fp pointer to FILE object
|
||||
*
|
||||
* @return minimap2 index read from fp
|
||||
*/
|
||||
mm_idx_t *mm_idx_load(FILE *fp);
|
||||
|
||||
/**
|
||||
* Append an index (or one part of a full index) to file
|
||||
*
|
||||
* @param fp pointer to FILE object
|
||||
* @param mi minimap2 index
|
||||
*/
|
||||
void mm_idx_dump(FILE *fp, const mm_idx_t *mi);
|
||||
|
||||
/**
|
||||
* Create an index from strings in memory
|
||||
*
|
||||
* @param w minimizer window size
|
||||
* @param k minimizer k-mer size
|
||||
* @param is_hpc use HPC k-mer if true
|
||||
* @param bucket_bits number of bits for the first level of the hash table
|
||||
* @param n number of sequences
|
||||
* @param seq sequences in A/C/G/T
|
||||
* @param name sequence names; could be NULL
|
||||
*
|
||||
* @return minimap2 index
|
||||
*/
|
||||
mm_idx_t *mm_idx_str(int w, int k, int is_hpc, int bucket_bits, int n, const char **seq, const char **name);
|
||||
|
||||
/**
|
||||
* Print index statistics to stderr
|
||||
*
|
||||
@@ -213,6 +355,8 @@ mm_tbuf_t *mm_tbuf_init(void);
|
||||
*/
|
||||
void mm_tbuf_destroy(mm_tbuf_t *b);
|
||||
|
||||
void *mm_tbuf_get_km(mm_tbuf_t *b);
|
||||
|
||||
/**
|
||||
* Align a query sequence against an index
|
||||
*
|
||||
@@ -233,6 +377,8 @@ void mm_tbuf_destroy(mm_tbuf_t *b);
|
||||
*/
|
||||
mm_reg1_t *mm_map(const mm_idx_t *mi, int l_seq, const char *seq, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *name);
|
||||
|
||||
void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, int *n_regs, mm_reg1_t **regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname);
|
||||
|
||||
/**
|
||||
* Align a fasta/fastq file and print alignments to stdout
|
||||
*
|
||||
@@ -245,9 +391,40 @@ mm_reg1_t *mm_map(const mm_idx_t *mi, int l_seq, const char *seq, int *n_regs, m
|
||||
*/
|
||||
int mm_map_file(const mm_idx_t *idx, const char *fn, const mm_mapopt_t *opt, int n_threads);
|
||||
|
||||
int mm_map_file_frag(const mm_idx_t *idx, int n_segs, const char **fn, const mm_mapopt_t *opt, int n_threads);
|
||||
|
||||
/**
|
||||
* Generate the cs tag (new in 2.12)
|
||||
*
|
||||
* @param km memory blocks; set to NULL if unsure
|
||||
* @param buf buffer to write the cs/MD tag; typicall NULL on the first call
|
||||
* @param max_len max length of the buffer; typically set to 0 on the first call
|
||||
* @param mi index
|
||||
* @param r alignment
|
||||
* @param seq query sequence
|
||||
* @param no_iden true to use : instead of =
|
||||
*
|
||||
* @return the length of cs
|
||||
*/
|
||||
int mm_gen_cs(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int no_iden);
|
||||
int mm_gen_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq);
|
||||
|
||||
// query sequence name and sequence in the minimap2 index
|
||||
int mm_idx_index_name(mm_idx_t *mi);
|
||||
int mm_idx_name2id(const mm_idx_t *mi, const char *name);
|
||||
int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq);
|
||||
|
||||
int mm_idx_alt_read(mm_idx_t *mi, const char *fn);
|
||||
int mm_idx_bed_read(mm_idx_t *mi, const char *fn, int read_junc);
|
||||
int mm_idx_bed_junc(const mm_idx_t *mi, int32_t ctg, int32_t st, int32_t en, uint8_t *s);
|
||||
|
||||
int mm_max_spsc_bonus(const mm_mapopt_t *mo);
|
||||
int32_t mm_idx_spsc_read(mm_idx_t *idx, const char *fn, int32_t max_sc);
|
||||
int64_t mm_idx_spsc_get(const mm_idx_t *db, int32_t cid, int64_t st0, int64_t en0, int32_t rev, uint8_t *sc);
|
||||
|
||||
// deprecated APIs for backward compatibility
|
||||
void mm_mapopt_init(mm_mapopt_t *opt);
|
||||
mm_idx_t *mm_idx_build(const char *fn, int w, int k, int is_hpc, int n_threads);
|
||||
mm_idx_t *mm_idx_build(const char *fn, int w, int k, int flag, int n_threads);
|
||||
|
||||
#ifdef __cplusplus
|
||||
}
|
||||
|
||||
+507
-92
@@ -1,4 +1,4 @@
|
||||
.TH minimap2 1 "17 September 2017" "minimap2-2.2 (r409)" "Bioinformatics tools"
|
||||
.TH minimap2 1 "18 April 2025" "minimap2-2.29 (r1283)" "Bioinformatics tools"
|
||||
.SH NAME
|
||||
.PP
|
||||
minimap2 - mapping and alignment between collections of DNA sequences
|
||||
@@ -77,7 +77,7 @@ SAM format.
|
||||
Minimizer k-mer length [15]
|
||||
.TP
|
||||
.BI -w \ INT
|
||||
Minimizer window size [2/3 of k-mer length]. A minimizer is the smallest k-mer
|
||||
Minimizer window size [10]. A minimizer is the smallest k-mer
|
||||
in a window of w consecutive k-mers.
|
||||
.TP
|
||||
.B -H
|
||||
@@ -88,16 +88,25 @@ on the HPC sequence.
|
||||
.BI -I \ NUM
|
||||
Load at most
|
||||
.I NUM
|
||||
target bases into RAM for indexing [4G]. If there are more than
|
||||
target bases into RAM for indexing [8G]. If there are more than
|
||||
.I NUM
|
||||
bases in
|
||||
.IR target.fa ,
|
||||
minimap2 needs to read
|
||||
.I query.fa
|
||||
multiple times to map it against each batch of target sequences.
|
||||
multiple times to map it against each batch of target sequences. This would create a multi-part index.
|
||||
.I NUM
|
||||
may be ending with k/K/m/M/g/G. NB: mapping quality is incorrect given a
|
||||
multi-part index.
|
||||
multi-part index. See also option
|
||||
.BR --split-prefix .
|
||||
.TP
|
||||
.B --idx-no-seq
|
||||
Don't store target sequences in the index. It saves disk space and memory but
|
||||
the index generated with this option will not work with
|
||||
.B -a
|
||||
or
|
||||
.BR -c .
|
||||
When base-level alignment is not requested, this option is automatically applied.
|
||||
.TP
|
||||
.BI -d \ FILE
|
||||
Save the minimizer index of
|
||||
@@ -113,21 +122,62 @@ provided as the target sequences, options
|
||||
.BR -w ,
|
||||
.B -I
|
||||
will be effectively overridden by the options stored in the index file.
|
||||
.TP
|
||||
.BI --alt \ FILE
|
||||
List of ALT contigs [null]
|
||||
.TP
|
||||
.BI --alt-drop \ FLOAT
|
||||
Drop ALT hits by
|
||||
.I FLOAT
|
||||
fraction when ranking and computing mapping quality [0.15]
|
||||
.SS Mapping options
|
||||
.TP 10
|
||||
.BI -f \ FLOAT
|
||||
Ignore top
|
||||
.BI -f \ FLOAT | INT1 [, INT2 ]
|
||||
If fraction, ignore top
|
||||
.I FLOAT
|
||||
fraction of most frequent minimizers [0.0002]
|
||||
fraction of most frequent minimizers [0.0002]. If integer,
|
||||
ignore minimizers occuring more than
|
||||
.I INT1
|
||||
times.
|
||||
.I INT2
|
||||
is only effective in the
|
||||
.B --sr
|
||||
or
|
||||
.B -xsr
|
||||
mode, which sets the threshold for a second round of seeding.
|
||||
.TP
|
||||
.BI -g \ INT
|
||||
Stop chain enlongation if there are no minimizers in
|
||||
.IR INT -bp
|
||||
[10000].
|
||||
.BI -U \ INT1 [, INT2 ]
|
||||
Lower and upper bounds of k-mer occurrences [10,1000000]. The final k-mer occurrence threshold is
|
||||
.RI max{ INT1 ,\ min{ INT2 ,
|
||||
.BR -f }}.
|
||||
This option prevents excessively small or large
|
||||
.B -f
|
||||
estimated from the input reference. Available since r1034 and deprecating
|
||||
.B --min-occ-floor
|
||||
in earlier versions of minimap2.
|
||||
.TP
|
||||
.BI -r \ INT
|
||||
Bandwidth used in chaining and DP-based alignment [1000]. This option
|
||||
approximately controls the maximum gap size.
|
||||
.BI --q-occ-frac \ FLOAT
|
||||
Discard a query minimizer if its occurrence is higher than
|
||||
.I FLOAT
|
||||
fraction of query minimizers and than the reference occurrence threshold
|
||||
[0.01]. Set 0 to disable. Available since r1105.
|
||||
.TP
|
||||
.BI -e \ INT
|
||||
Sample a high-frequency minimizer every
|
||||
.I INT
|
||||
basepairs [500].
|
||||
.TP
|
||||
.BI -g \ NUM
|
||||
Stop chain enlongation if there are no minimizers within
|
||||
.IR NUM -bp
|
||||
[10k].
|
||||
.TP
|
||||
.BI -r \ NUM1 [, NUM2 ]
|
||||
Bandwidth for chaining and base alignment [500,20k].
|
||||
.I NUM1
|
||||
is used for initial chaining and alignment extension;
|
||||
.I NUM2
|
||||
for RMQ-based re-chaining and closing gaps in alignments.
|
||||
.TP
|
||||
.BI -n \ INT
|
||||
Discard chains consisting of
|
||||
@@ -140,20 +190,42 @@ Discard chains with chaining score
|
||||
[40]. Chaining score equals the approximate number of matching bases minus a
|
||||
concave gap penalty. It is computed with dynamic programming.
|
||||
.TP
|
||||
.B -D
|
||||
If query sequence name/length are identical to the target name/length, ignore
|
||||
diagonal anchors. This option also reduces DP-based extension along the
|
||||
diagonal.
|
||||
.TP
|
||||
.B -P
|
||||
Retain all chains and don't attempt to set primary chains. Options
|
||||
.B -p
|
||||
and
|
||||
.B -N
|
||||
have no effect when this option is in use.
|
||||
.TP
|
||||
.BR --dual = yes | no
|
||||
If
|
||||
.BR no ,
|
||||
skip query-target pairs wherein the query name is lexicographically greater
|
||||
than the target name [yes]
|
||||
.TP
|
||||
.B -X
|
||||
Perform all-vs-all mapping. In this mode, if the query sequence name is
|
||||
lexicographically larger than the target sequence name, the hits between them
|
||||
will be suppressed; if the query sequence name is the same as the target name,
|
||||
diagonal minimizer hits will also be suppressed.
|
||||
Equivalent to
|
||||
.RB ' -DP
|
||||
.BR --dual = no
|
||||
.BR --no-long-join '.
|
||||
Primarily used for all-vs-all read overlapping.
|
||||
.TP
|
||||
.BI -p \ FLOAT
|
||||
Minimal secondary-to-primary score ratio to output secondary mappings [0.8].
|
||||
Between two chains overlaping over half of the shorter chain (controled by
|
||||
.BR --mask-level ),
|
||||
Between two chains overlaping over half of the shorter chain (controlled by
|
||||
.BR -M ),
|
||||
the chain with a lower score is secondary to the chain with a higher score.
|
||||
If the ratio of the scores is below
|
||||
.IR FLOAT ,
|
||||
the secondary chain will not be outputted or extended with DP alignment later.
|
||||
This option has no effect when
|
||||
.B -X
|
||||
is applied.
|
||||
.TP
|
||||
.BI -N \ INT
|
||||
Output at most
|
||||
@@ -163,18 +235,96 @@ secondary alignments [5]. This option has no effect when
|
||||
is applied.
|
||||
.TP
|
||||
.BI -G \ NUM
|
||||
Maximal intron length in the splice mode [200k]. This option also changes the
|
||||
bandwidth to
|
||||
Maximum gap on the reference (effective with
|
||||
.BR -xsplice / --splice ).
|
||||
This option also changes the chaining and alignment band width to
|
||||
.IR NUM .
|
||||
Increasing this option slows down spliced alignment.
|
||||
Increasing this option slows down spliced alignment. [200k]
|
||||
.TP
|
||||
.BI -F \ NUM
|
||||
Maximum fragment length (aka insert size; effective with
|
||||
.BR -xsr / --frag = yes )
|
||||
[800]
|
||||
.TP
|
||||
.BI -M \ FLOAT
|
||||
Mark as secondary a chain that overlaps with a better chain by
|
||||
.I FLOAT
|
||||
or more of the shorter chain [0.5]
|
||||
.TP
|
||||
.BR --rmq = no | yes
|
||||
Use the minigraph chaining algorithm [no]. The minigraph algorithm is better
|
||||
for aligning contigs through long INDELs.
|
||||
.TP
|
||||
.BI --rmq-inner \ NUM
|
||||
Apply full dynamic programming for anchors within distance
|
||||
.I NUM
|
||||
[1000].
|
||||
.TP
|
||||
.B --hard-mask-level
|
||||
Honor option
|
||||
.B -M
|
||||
and disable a heurstic to save unmapped subsequences and disables
|
||||
.BR --mask-len .
|
||||
.TP
|
||||
.BI --mask-len \ NUM
|
||||
Keep an alignment if dropping it leaves an unaligned region on query longer than
|
||||
.IR INT
|
||||
[inf]. Effective without
|
||||
.BR --hard-mask-level .
|
||||
.TP
|
||||
.BI --max-chain-skip \ INT
|
||||
A heuristics that stops chaining early [50]. Minimap2 uses dynamic programming
|
||||
A heuristics that stops chaining early [25]. Minimap2 uses dynamic programming
|
||||
for chaining. The time complexity is quadratic in the number of seeds. This
|
||||
option makes minimap2 exits the inner loop if it repeatedly sees seeds already
|
||||
on chains. Set
|
||||
.I INT
|
||||
to a large number to switch off this heurstics.
|
||||
.TP
|
||||
.BI --max-chain-iter \ INT
|
||||
Check up to
|
||||
.I INT
|
||||
partial chains during chaining [5000]. This is a heuristic to avoid quadratic
|
||||
time complexity in the worst case.
|
||||
.TP
|
||||
.BI --chain-gap-scale \ FLOAT
|
||||
Scale of gap cost during chaining [1.0]
|
||||
.TP
|
||||
.B --no-long-join
|
||||
Disable the long gap patching heuristic. When this option is applied, the
|
||||
maximum alignment gap is mostly controlled by
|
||||
.BR -r .
|
||||
.TP
|
||||
.B --splice
|
||||
Enable the splice alignment mode.
|
||||
.TP
|
||||
.BR --sr [= no | dna | rna ]
|
||||
Enable short-read alignment heuristics [no]. If this option is used with no argument,
|
||||
.RB ` dna '
|
||||
is set. In the DNA short-read mode, minimap2 applies a second round of chaining
|
||||
with a higher minimizer occurrence threshold if no good chain is found. In
|
||||
addition, minimap2 attempts to patch gaps between seeds with ungapped
|
||||
alignment.
|
||||
.TP
|
||||
.BI --split-prefix \ STR
|
||||
Prefix to create temporary files. Typically used for a multi-part index.
|
||||
.TP
|
||||
.BR --frag = no | yes
|
||||
Whether to enable the fragment mode [no]
|
||||
.TP
|
||||
.B --for-only
|
||||
Only map to the forward strand of the reference sequences. For paired-end
|
||||
reads in the forward-reverse orientation, the first read is mapped to forward
|
||||
strand of the reference and the second read to the reverse stand.
|
||||
.TP
|
||||
.B --rev-only
|
||||
Only map to the reverse complement strand of the reference sequences.
|
||||
.TP
|
||||
.BR --heap-sort = no | yes
|
||||
If yes, sort anchors with heap merge, instead of radix sort. Heap merge is
|
||||
faster for short reads, but slower for long reads. [no]
|
||||
.TP
|
||||
.B --no-hash-name
|
||||
Produce the same alignment for identical sequences regardless of their sequence names.
|
||||
.SS Alignment options
|
||||
.TP 10
|
||||
.BI -A \ INT
|
||||
@@ -183,6 +333,10 @@ Matching score [2]
|
||||
.BI -B \ INT
|
||||
Mismatching penalty [4]
|
||||
.TP
|
||||
.BI -b \ INT
|
||||
Mismatching penalty for transitions [same as
|
||||
.BR -B ].
|
||||
.TP
|
||||
.BI -O \ INT1[,INT2]
|
||||
Gap open penalty [4,24]. If
|
||||
.I INT2
|
||||
@@ -194,12 +348,47 @@ Gap extension penalty [2,1]. A gap of length
|
||||
.I k
|
||||
costs
|
||||
.RI min{ O1 + k * E1 , O2 + k * E2 }.
|
||||
In the splice mode, the second gap penalties are not used.
|
||||
.TP
|
||||
.BI -z \ INT
|
||||
Break an alignment if the running score drops too quickly along the diagonal of
|
||||
the DP matrix (diagonal X-drop, or Z-drop) [400]. Increasing the value improves
|
||||
the contiguity of the alignment at the cost of poor alignment in the middle
|
||||
(e.g. caused by a long inversion).
|
||||
.BI -J \ INT
|
||||
Splice model [1]. 0 for the original minimap2 splice model that always penalizes non-GT-AG splicing;
|
||||
1 for the miniprot model that considers non-GT-AG. Option
|
||||
.B -C
|
||||
has no effect with the default
|
||||
.BR -J1 .
|
||||
.TP
|
||||
.BR -j \ FILE
|
||||
Junctions used to extend alignment towards ends of reads [].
|
||||
.I FILE
|
||||
can be gene annotations in the BED12 format (aka 12-column BED), or intron
|
||||
positions in 5-column BED with the strand column required. BED12 file can be
|
||||
converted from GTF/GFF3 with `paftools.js gff2bed anno.gtf'. This option is
|
||||
intended for short RNA-seq reads, while
|
||||
.B --junc-bed
|
||||
for long noisy RNA-seq reads.
|
||||
.TP
|
||||
.BI -C \ INT
|
||||
Cost for a non-canonical GT-AG splicing (effective with
|
||||
.B --splice
|
||||
.BR -J0 )
|
||||
[0].
|
||||
.TP
|
||||
.BI -z \ INT1[,INT2]
|
||||
Truncate an alignment if the running alignment score drops too quickly along
|
||||
the diagonal of the DP matrix (diagonal X-drop, or Z-drop) [400,200]. If the
|
||||
drop of score is above
|
||||
.IR INT2 ,
|
||||
minimap2 will reverse complement the query in the related region and align
|
||||
again to test small inversions. Minimap2 truncates alignment if there is an
|
||||
inversion or the drop of score is greater than
|
||||
.IR INT1 .
|
||||
Decrease
|
||||
.I INT2
|
||||
to find small inversions at the cost of performance and false positives.
|
||||
Increase
|
||||
.I INT1
|
||||
to improves the contiguity of alignment at the cost of poor alignment in the
|
||||
middle.
|
||||
.TP
|
||||
.BI -s \ INT
|
||||
Minimal peak DP alignment score to output [40]. The peak score is computed from
|
||||
@@ -215,25 +404,174 @@ both strands;
|
||||
.BR n :
|
||||
no attempt to match GT-AG [n]
|
||||
.TP
|
||||
.BI --cost-non-gt-ag \ INT
|
||||
Cost of non-canonical splicing sites [0].
|
||||
.BI --end-bonus \ INT
|
||||
Score bonus when alignment extends to the end of the query sequence [0].
|
||||
.TP
|
||||
.BI --score-N \ INT
|
||||
Penalty of a mismatch involving ambiguous bases [1].
|
||||
.TP
|
||||
.BR --pairing = strong | weak | no
|
||||
How to pair paired-end reads [strong].
|
||||
.RB ` no '
|
||||
for aligning the two ends in a pair independently with no `properly paired' set.
|
||||
.RB ` weak '
|
||||
for aligning the two ends independently and then pairing the hits.
|
||||
.RB ` strong '
|
||||
for jointly aligning and pairing the two ends.
|
||||
.TP
|
||||
.BR --splice-flank = yes | no
|
||||
Assume the next base to a
|
||||
.B GT
|
||||
donor site tends to be A/G (91% in human and 92% in mouse) and the preceding
|
||||
base to a
|
||||
.B AG
|
||||
acceptor tends to be C/T [no].
|
||||
This trend is evolutionarily conservative, all the way to S. cerevisiae
|
||||
(PMID:18688272). Specifying this option generally leads to higher junction
|
||||
accuracy by several percents, so it is applied by default with
|
||||
.BR --splice .
|
||||
However, the SIRV control does not honor this trend
|
||||
(only ~60%). This option reduces accuracy. If you are benchmarking minimap2
|
||||
on SIRV data, please add
|
||||
.B --splice-flank=no
|
||||
to the command line.
|
||||
.TP
|
||||
.BR --spsc \ FILE
|
||||
Splice scores []. Each line consists of five fields: 1) contig, 2) offset, 3) `+' or `-', 4) `D' or `A', and 5) score,
|
||||
where offset is the number of bases before a splice junction, `D' indicates the
|
||||
line corresponds to a donor site and `A' for an acceptor site.
|
||||
A positive score suggests the junction is preferred and a negative score
|
||||
suggests the junction is not preferred.
|
||||
.TP
|
||||
.BR --junc-pen \ INT
|
||||
Penalty for a position not in FILE specified by
|
||||
.B --spsc
|
||||
[5]. Effective with
|
||||
.B --spsc
|
||||
but not
|
||||
.BR --junc-bed .
|
||||
.TP
|
||||
.BR --junc-bed \ FILE
|
||||
Junctions to prefer during base alignment [].
|
||||
Same format as
|
||||
.BR -j .
|
||||
It is
|
||||
.I NOT
|
||||
recommended to apply this option to short RNA-seq reads. This would increase
|
||||
run time with little improvement to junction accuracy.
|
||||
.TP
|
||||
.BR --junc-bonus \ INT
|
||||
Score bonus for a splice donor or acceptor found in annotation [9]. Effective with
|
||||
.B --junc-bed
|
||||
but not
|
||||
.BR --spsc .
|
||||
.TP
|
||||
.BR --jump-min-match \ INT
|
||||
Minimum matching length to create a jump [3]. Equivalent to
|
||||
.B STAR
|
||||
.BR --alignSJDBoverhangMin .
|
||||
.TP
|
||||
.BI --end-seed-pen \ INT
|
||||
Drop a terminal anchor if
|
||||
.IR s <log( g )+ INT ,
|
||||
where
|
||||
.I s
|
||||
is the local alignment score around the anchor and
|
||||
.I g
|
||||
the length of the terminal gap in the chain. This option is only effective
|
||||
with
|
||||
.BR --splice .
|
||||
It helps to avoid tiny terminal exons. [6]
|
||||
.TP
|
||||
.B --no-end-flt
|
||||
Don't filter seeds towards the ends of chains before performing base-level
|
||||
alignment.
|
||||
.TP
|
||||
.BI --cap-sw-mem \ NUM
|
||||
Skip alignment if the DP matrix size is above
|
||||
.IR NUM .
|
||||
Set 0 to disable [100m].
|
||||
.TP
|
||||
.BI --cap-kalloc \ NUM
|
||||
Free thread-local kalloc memory reservoir if after the alignment the size of the reservoir above
|
||||
.IR NUM .
|
||||
Set 0 to disable [500m].
|
||||
.SS Input/output options
|
||||
.TP 10
|
||||
.B -a
|
||||
Generate CIGAR and output alignments in the SAM format. Minimap2 outputs in PAF
|
||||
by default.
|
||||
.TP
|
||||
.BI -o \ FILE
|
||||
Output alignments to
|
||||
.I FILE
|
||||
[stdout].
|
||||
.TP
|
||||
.B -Q
|
||||
Ignore base quality in the input file.
|
||||
.TP
|
||||
.B -L
|
||||
Write CIGAR with >65535 operators at the CG tag. Older tools are unable to
|
||||
convert alignments with >65535 CIGAR ops to BAM. This option makes minimap2 SAM
|
||||
compatible with older tools. Newer tools recognizes this tag and reconstruct
|
||||
the real CIGAR in memory.
|
||||
.TP
|
||||
.BI -R \ STR
|
||||
SAM read group line in a format like
|
||||
.B @RG\\\\tID:foo\\\\tSM:bar
|
||||
[].
|
||||
.TP
|
||||
.B -y
|
||||
Copy input FASTA/Q comments to output.
|
||||
.TP
|
||||
.B -c
|
||||
Generate CIGAR. In PAF, the CIGAR is written to the `cg' custom tag.
|
||||
.TP
|
||||
.BR --cs [= short | long ]
|
||||
Output the
|
||||
.B cs
|
||||
tag.
|
||||
If no argument is given,
|
||||
.RB ` short '
|
||||
is set. [none]
|
||||
.TP
|
||||
.B --MD
|
||||
Output the MD tag (see the SAM spec).
|
||||
.TP
|
||||
.B --eqx
|
||||
Output =/X CIGAR operators for sequence match/mismatch.
|
||||
.TP
|
||||
.B -Y
|
||||
In SAM output, use soft clipping for supplementary alignments.
|
||||
.TP
|
||||
.B --secondary-seq
|
||||
In SAM output, show query sequences for secondary alignments.
|
||||
.TP
|
||||
.B --write-junc
|
||||
Output splice junctions in 6-column BED: contig name, start, end,
|
||||
read name, score and strand. Score is the sum of donor and acceptor scores,
|
||||
where GT gets 3, GC gets 2 and AT gets 1 at donor sites,
|
||||
while AG gets 3 and AC gets 1 at acceptor sites.
|
||||
Alignments with mapping quality below 10 are ignored.
|
||||
.TP
|
||||
.BI --pass1 \ FILE
|
||||
Junctions BED file outputted by
|
||||
.B --write-junc
|
||||
[]. Rows with scores lower than 5 are ignored. When both
|
||||
.B -j
|
||||
and
|
||||
.B --pass1
|
||||
are present, junctions in
|
||||
.B -j
|
||||
are preferred over in
|
||||
.BR --pass1
|
||||
when there is ambiguity.
|
||||
.TP
|
||||
.BI --seed \ INT
|
||||
Integer seed for randomizing equally best hits. Minimap2 hashes
|
||||
.I INT
|
||||
and read name when choosing between equally best hits. [11]
|
||||
.TP
|
||||
.BI -t \ INT
|
||||
Number of threads [3]. Minimap2 uses at most three threads when indexing target
|
||||
sequences, and uses up to
|
||||
@@ -241,27 +579,38 @@ sequences, and uses up to
|
||||
threads when mapping (the extra thread is for I/O, which is frequently idle and
|
||||
takes little CPU time).
|
||||
.TP
|
||||
.B -2
|
||||
Use two I/O threads during mapping. By default, minimap2 uses one I/O thread.
|
||||
When I/O is slow (e.g. piping to gzip, or reading from a slow pipe), the I/O
|
||||
thread may become the bottleneck. Apply this option to use one thread for input
|
||||
and another thread for output, at the cost of increased peak RAM.
|
||||
.TP
|
||||
.BI -K \ NUM
|
||||
Number of bases loaded into memory to process in a mini-batch [200M].
|
||||
Number of bases loaded into memory to process in a mini-batch [500M].
|
||||
Similar to option
|
||||
.BR -I ,
|
||||
K/M/G/k/m/g suffix is accepted. A large
|
||||
.I NUM
|
||||
helps load balancing in the multi-threading mode, at the cost of increased
|
||||
memory. Preset
|
||||
.B ava-pb
|
||||
and
|
||||
.B ava-ont
|
||||
use
|
||||
.BR -K500m .
|
||||
memory.
|
||||
.TP
|
||||
.BR --secondary = yes | no
|
||||
Whether to output secondary alignments [yes]
|
||||
.TP
|
||||
.BI --max-qlen \ NUM
|
||||
Filter out query sequences longer than
|
||||
.IR NUM .
|
||||
.TP
|
||||
.B --paf-no-hit
|
||||
In PAF, output unmapped queries; the strand and the reference name fields are
|
||||
set to `*'. Warning: some paftools.js commands may not work with such output
|
||||
for the moment.
|
||||
.TP
|
||||
.B --sam-hit-only
|
||||
In SAM, don't output unmapped reads.
|
||||
.TP
|
||||
.B --version
|
||||
Print version number to stdout
|
||||
.TP
|
||||
.B --no-sam-hdr
|
||||
Don't output SAM header lines. Use this option if the index consists of
|
||||
multiple parts; otherwise the SAM output is malformated due to internal header
|
||||
lines.
|
||||
.SS Preset options
|
||||
.TP 10
|
||||
.BI -x \ STR
|
||||
@@ -273,59 +622,76 @@ Available
|
||||
.I STR
|
||||
are:
|
||||
.RS
|
||||
.TP 8
|
||||
.B map-pb
|
||||
PacBio/Oxford Nanopore read to reference mapping
|
||||
.RB ( -Hk19 )
|
||||
.TP
|
||||
.B map10k
|
||||
The same as
|
||||
.B map-pb
|
||||
.RB ( -Hk19 )
|
||||
.TP
|
||||
.TP 10
|
||||
.B map-ont
|
||||
Slightly more sensitive for Oxford Nanopore to reference mapping
|
||||
.RB ( -k15 ).
|
||||
For PacBio reads, HPC minimizers consistently leads to faster performance and
|
||||
more sensitive results in comparison to normal minimizers. For Oxford Nanopore
|
||||
data, normal minimizers are better, though not much. The effectiveness of HPC
|
||||
is determined by the sequencing error mode.
|
||||
Align noisy long reads of ~10% error rate to a reference genome. This is the
|
||||
default mode.
|
||||
.TP
|
||||
.B lr:hq
|
||||
Align accurate long reads (error rate <1%) to a reference genome
|
||||
.RB ( -k19
|
||||
.B -w19 -U50,500
|
||||
.BR -g10k ).
|
||||
This was recommended by ONT developers for recent Nanopore reads
|
||||
produced with chemistry v14 that can reach ~99% in accuracy.
|
||||
It was shown to work better for accurate Nanopore reads
|
||||
than
|
||||
.BR map-hifi .
|
||||
.TP
|
||||
.B map-hifi
|
||||
Align PacBio high-fidelity (HiFi) reads to a reference genome
|
||||
.RB ( -xlr:hq
|
||||
.B -A1 -B4 -O6,26 -E2,1
|
||||
.BR -s200 ).
|
||||
It differs from
|
||||
.B lr:hq
|
||||
only in scoring. It has not been tested whether
|
||||
.B lr:hq
|
||||
would work better for PacBio HiFi reads.
|
||||
.TP
|
||||
.B map-pb
|
||||
Align older PacBio continuous long (CLR) reads to a reference genome
|
||||
.RB ( -Hk19 ).
|
||||
Note that this data type is effectively deprecated by HiFi.
|
||||
Unless you work on very old data, you probably want to use
|
||||
.B map-hifi
|
||||
or
|
||||
.BR lr:hq .
|
||||
.TP
|
||||
.B map-iclr
|
||||
Align Illumina Complete Long Reads (ICLR) to a reference genome
|
||||
.RB ( -k19
|
||||
.B -B6 -b4
|
||||
.BR -O10,50 ).
|
||||
This was recommended by Illumina developers.
|
||||
.TP
|
||||
.B asm5
|
||||
Long assembly to reference mapping
|
||||
.RB ( -k19
|
||||
.B -w19 -A1 -B19 -O39,81 -E3,1 -s200
|
||||
.BR -z200 ).
|
||||
.B -w19 -U50,500 --rmq -r1k,100k -g10k -A1 -B19 -O39,81 -E3,1 -s200 -z200
|
||||
.BR -N50 ).
|
||||
Typically, the alignment will not extend to regions with 5% or higher sequence
|
||||
divergence. Only use this preset if the average divergence is far below 5%.
|
||||
divergence. Use this preset if the average divergence is not much higher than 0.1%.
|
||||
.TP
|
||||
.B asm10
|
||||
Long assembly to reference mapping
|
||||
.RB ( -k19
|
||||
.B -w19 -A1 -B9 -O16,41 -E2,1 -s200
|
||||
.BR -z200 ).
|
||||
Up to 10% sequence divergence.
|
||||
.B -w19 -U50,500 --rmq -r1k,100k -g10k -A1 -B9 -O16,41 -E2,1 -s200 -z200
|
||||
.BR -N50 ).
|
||||
Use this if the average divergence is around 1%.
|
||||
.TP
|
||||
.B ava-pb
|
||||
PacBio all-vs-all overlap mapping
|
||||
.RB ( -Hk19
|
||||
.B -w5 -Xp0 -m100 -K500m -g10000 --max-chain-skip
|
||||
.BR 25 ).
|
||||
.TP
|
||||
.B ava-ont
|
||||
Oxford Nanopore all-vs-all overlap mapping
|
||||
.RB ( -k15
|
||||
.B -w5 -Xp0 -m100 -K500m -g10000 --max-chain-skip
|
||||
.BR 25 ).
|
||||
Similarly, the major difference from
|
||||
.B ava-pb
|
||||
is that this preset is not using HPC minimizers.
|
||||
.B asm20
|
||||
Long assembly to reference mapping
|
||||
.RB ( -k19
|
||||
.B -w10 -U50,500 --rmq -r1k,100k -g10k -A1 -B4 -O6,26 -E2,1 -s200 -z200
|
||||
.BR -N50 ).
|
||||
Use this if the average divergence is around several percent.
|
||||
.TP
|
||||
.B splice
|
||||
Long-read spliced alignment
|
||||
.RB ( -k15
|
||||
.B -w5 --splice -g2000 -G200k -A1 -B2 -O2,32 -E1,0 -z200 -ub --cost-non-gt-ag
|
||||
.BR 5 ).
|
||||
.B -w5 --splice -g2k -G200k -A1 -B2 -O2,32 -E1,0 -C9 -z200 -ub --junc-bonus=9 --cap-sw-mem=0
|
||||
.BR --splice-flank=yes ).
|
||||
In the splice mode, 1) long deletions are taken as introns and represented as
|
||||
the
|
||||
.RB ` N '
|
||||
@@ -334,11 +700,36 @@ costs are different during chaining; 4) the computation of the
|
||||
.RB ` ms '
|
||||
tag ignores introns to demote hits to pseudogenes.
|
||||
.TP
|
||||
.B splice:hq
|
||||
Spliced alignment for accurate long RNA-seq reads such as PacBio iso-seq
|
||||
.RB ( -xsplice
|
||||
.B -C5 -O6,24
|
||||
.BR -B4 ).
|
||||
.TP
|
||||
.B splice:sr
|
||||
Spliced alignment for short RNA-seq reads
|
||||
.RB ( -xsplice:hq
|
||||
.B --frag=yes -m25 -s40 -2K100m --heap-sort=yes --pairing=weak --sr=rna --min-dp-len=20
|
||||
.BR --secondary=no ).
|
||||
.TP
|
||||
.B sr
|
||||
Short single-end reads without splicing
|
||||
Short-read alignment without splicing
|
||||
.RB ( -k21
|
||||
.B -w11 -A2 -B8 -O12,32 -E2,1 -r50 -p.5 -N20 -f1000 -n2 -m20 -s40 -g100 -K50m
|
||||
.BR --approx-ext ).
|
||||
.B -w11 --sr --frag=yes -A2 -B8 -O12,32 -E2,1 -r100 -p.5 -N20 -f1000,5000 -n2 -m25
|
||||
.B -s40 -g100 -2K50m --heap-sort=yes
|
||||
.BR --secondary=no ).
|
||||
.TP
|
||||
.B ava-pb
|
||||
PacBio CLR all-vs-all overlap mapping
|
||||
.RB ( -Hk19
|
||||
.B -Xw5 -e0
|
||||
.BR -m100 ).
|
||||
.TP
|
||||
.B ava-ont
|
||||
Oxford Nanopore all-vs-all overlap mapping
|
||||
.RB ( -k15
|
||||
.B -Xw5 -e0 -m100
|
||||
.BR -r2k ).
|
||||
.RE
|
||||
.SS Miscellaneous options
|
||||
.TP 10
|
||||
@@ -351,7 +742,7 @@ multi-threading mode.
|
||||
.B --print-qname
|
||||
Print query names to stderr, mostly to see which query is crashing minimap2.
|
||||
.TP
|
||||
.B --print-seed
|
||||
.B --print-seeds
|
||||
Print seed positions to stderr, for debugging only.
|
||||
.SH OUTPUT FORMAT
|
||||
.PP
|
||||
@@ -390,16 +781,43 @@ cb | cb | cb
|
||||
r | c | l .
|
||||
Tag Type Description
|
||||
_
|
||||
tp A Type of aln: P/primary, S/secondary and I/inversion
|
||||
tp A Type of aln: P/primary, S/secondary and I,i/inversion
|
||||
cm i Number of minimizers on the chain
|
||||
s1 i Chaining score
|
||||
s2 i Chaining score of the best secondary chain
|
||||
NM i Total number of mismatches and gaps in the alignment
|
||||
MD Z To generate the ref sequence in the alignment
|
||||
AS i DP alignment score
|
||||
SA Z List of other supplementary alignments (with approximate CIGAR strings)
|
||||
ms i DP score of the max scoring segment in the alignment
|
||||
nn i Number of ambiguous bases in the alignment
|
||||
ts A Transcript strand (splice mode only)
|
||||
cg Z CIGAR string (only in PAF)
|
||||
cs Z Difference string
|
||||
dv f Approximate per-base sequence divergence
|
||||
de f Gap-compressed per-base sequence divergence
|
||||
rl i Length of query regions harboring repetitive seeds
|
||||
zd i Alignment broken due to Z-drop; bit 1: left broken; bit 2: right broken
|
||||
.TE
|
||||
|
||||
.PP
|
||||
The
|
||||
.B cs
|
||||
tag encodes difference sequences in the short form or the entire query
|
||||
.I AND
|
||||
reference sequences in the long form. It consists of a series of operations:
|
||||
.TS
|
||||
center box;
|
||||
cb | cb |cb
|
||||
r | l | l .
|
||||
Op Regex Description
|
||||
_
|
||||
= [ACGTN]+ Identical sequence (long form)
|
||||
: [0-9]+ Identical sequence length
|
||||
* [acgtn][acgtn] Substitution: ref to query
|
||||
+ [acgtn]+ Insertion to the reference
|
||||
- [acgtn]+ Deletion from the reference
|
||||
~ [acgtn]{2}[0-9]+[acgtn]{2} Intron length and splice signal
|
||||
.TE
|
||||
|
||||
.SH LIMITATIONS
|
||||
@@ -410,11 +828,8 @@ where seed positions may be suboptimal. This should not be a big concern
|
||||
because even the optimal alignment may be wrong in such regions.
|
||||
.TP
|
||||
*
|
||||
Minimap2 does not work well with Illumina short reads as of now.
|
||||
.TP
|
||||
*
|
||||
Minimap2 requires SSE2 instructions to compile. It is possible to add
|
||||
non-SSE2 support, but it would make minimap2 slower by several times.
|
||||
Minimap2 requires SSE2 or NEON instructions to compile. It is possible to add
|
||||
non-SSE2/NEON support, but it would make minimap2 slower by several times.
|
||||
.SH SEE ALSO
|
||||
.PP
|
||||
miniasm(1), minimap(1), bwa(1).
|
||||
|
||||
@@ -1,4 +1,5 @@
|
||||
#include "minimap.h"
|
||||
#include <stdlib.h>
|
||||
#include "mmpriv.h"
|
||||
|
||||
int mm_verbose = 1;
|
||||
int mm_dbg_flag = 0;
|
||||
@@ -86,6 +87,8 @@ double cputime()
|
||||
|
||||
return kernelModeTime + userModeTime;
|
||||
}
|
||||
|
||||
long peakrss(void) { return 0; }
|
||||
#else
|
||||
#include <sys/resource.h>
|
||||
#include <sys/time.h>
|
||||
@@ -96,16 +99,57 @@ double cputime(void)
|
||||
getrusage(RUSAGE_SELF, &r);
|
||||
return r.ru_utime.tv_sec + r.ru_stime.tv_sec + 1e-6 * (r.ru_utime.tv_usec + r.ru_stime.tv_usec);
|
||||
}
|
||||
|
||||
long peakrss(void)
|
||||
{
|
||||
struct rusage r;
|
||||
getrusage(RUSAGE_SELF, &r);
|
||||
#ifdef __linux__
|
||||
return r.ru_maxrss * 1024;
|
||||
#else
|
||||
return r.ru_maxrss;
|
||||
#endif
|
||||
}
|
||||
|
||||
#endif /* WIN32 || _WIN32 */
|
||||
|
||||
double realtime(void)
|
||||
{
|
||||
struct timeval tp;
|
||||
struct timezone tzp;
|
||||
gettimeofday(&tp, &tzp);
|
||||
gettimeofday(&tp, NULL);
|
||||
return tp.tv_sec + tp.tv_usec * 1e-6;
|
||||
}
|
||||
|
||||
void mm_err_puts(const char *str)
|
||||
{
|
||||
int ret;
|
||||
ret = puts(str);
|
||||
if (ret == EOF) {
|
||||
perror("[ERROR] failed to write the results");
|
||||
exit(EXIT_FAILURE);
|
||||
}
|
||||
}
|
||||
|
||||
void mm_err_fwrite(const void *p, size_t size, size_t nitems, FILE *fp)
|
||||
{
|
||||
int ret;
|
||||
ret = fwrite(p, size, nitems, fp);
|
||||
if (ret == EOF) {
|
||||
perror("[ERROR] failed to write data");
|
||||
exit(EXIT_FAILURE);
|
||||
}
|
||||
}
|
||||
|
||||
void mm_err_fread(void *p, size_t size, size_t nitems, FILE *fp)
|
||||
{
|
||||
int ret;
|
||||
ret = fread(p, size, nitems, fp);
|
||||
if (ret == EOF) {
|
||||
perror("[ERROR] failed to read data");
|
||||
exit(EXIT_FAILURE);
|
||||
}
|
||||
}
|
||||
|
||||
#include "ksort.h"
|
||||
|
||||
#define sort_key_128x(a) ((a).x)
|
||||
@@ -115,3 +159,4 @@ KRADIX_SORT_INIT(128x, mm128_t, sort_key_128x, 8)
|
||||
KRADIX_SORT_INIT(64, uint64_t, sort_key_64, 8)
|
||||
|
||||
KSORT_INIT_GENERIC(uint32_t)
|
||||
KSORT_INIT_GENERIC(uint64_t)
|
||||
|
||||
+169
-17
@@ -1,28 +1,180 @@
|
||||
The [K8 Javascript shell][k8] is needed to run Javascripts in this directory.
|
||||
Precompiled k8 binaries for Mac and Linux can be found at the [K8 release
|
||||
page][k8bin].
|
||||
## <a name="started"></a>Getting Started
|
||||
|
||||
* [paf2aln.js](paf2aln.js): convert PAF to [MAF][maf] or BLAST-like output for
|
||||
eyeballing. PAF has to be generated with minimap2 option `-S`, which writes
|
||||
the aligned sequences to the `cs` tag. An example:
|
||||
```sh
|
||||
../minimap2 -S ../test/MT-*.fa | k8 paf2aln.js /dev/stdin
|
||||
# install minimap2
|
||||
git clone https://github.com/lh3/minimap2
|
||||
cd minimap2 && make
|
||||
# install the k8 javascript shell
|
||||
curl -L https://github.com/attractivechaos/k8/releases/download/v0.2.4/k8-0.2.4.tar.bz2 | tar -jxf -
|
||||
cp k8-0.2.4/k8-`uname -s` k8 # or copy it to a directory on your $PATH
|
||||
# export PATH="$PATH:`pwd`:`pwd`/misc" # run this if k8, minimap2 or paftools.js not on your $PATH
|
||||
minimap2 --cs test/MT-human.fa test/MT-orang.fa | paftools.js view - # view alignment
|
||||
minimap2 -c test/MT-human.fa test/MT-orang.fa | paftools.js stat - # basic alignment statistics
|
||||
minimap2 -c --cs test/MT-human.fa test/MT-orang.fa \
|
||||
| sort -k6,6 -k8,8n | paftools.js call -L15000 - # calling variants from asm-to-ref alignment
|
||||
minimap2 -c test/MT-human.fa test/MT-orang.fa \
|
||||
| paftools.js liftover -l10000 - <(echo -e "MT_orang\t2000\t5000") # liftOver
|
||||
# no test data for the following examples
|
||||
paftools.js junceval -e anno.gtf splice.sam > out.txt # compare splice junctions to annotations
|
||||
paftools.js splice2bed splice.sam > splice.bed # convert PAF/SAM to BED12
|
||||
paftools.js gff2bed anno.gtf > anno.bed # convert GTF/GFF3 to BED12
|
||||
```
|
||||
|
||||
* [mapstat.js](mapstat.js): output basic statistics such as the number of
|
||||
non-redundant mapped bases, number of split and secondary alignments and
|
||||
number of long gaps. This scripts seamlessly works with both SAM and PAF.
|
||||
## Table of Contents
|
||||
|
||||
* [sim-pbsim.js](sim-pbsim.js): convert reads simulated with [PBSIM][pbsim] to
|
||||
FASTA and encode the true mapping positions to read names in a format like
|
||||
`S1_33!chr1!225258409!225267761!-`.
|
||||
- [Getting Started](#started)
|
||||
- [Introduction](#intro)
|
||||
- [Evaluation](#eval)
|
||||
- [Evaluating mapping accuracy with simulated reads](#mapeval)
|
||||
- [Evaluating read overlap sensitivity](#oveval)
|
||||
- [Calling Variants from Assemblies](#asmvar)
|
||||
|
||||
* [sim-eval.js](sim-eval.js): evaluate mapping accuracy for FASTA generated
|
||||
with [sim-pbsim.js](sim-pbsim.js) or [sim-mason2.js](sim-mason2.js).
|
||||
## <a name="intro"></a>Introduction
|
||||
|
||||
* [sam2paf.js](sam2paf.js): convert SAM to PAF.
|
||||
paftools.js is a script that processes alignments in the [PAF format][paf],
|
||||
such as converting between formats, evaluating mapping accuracy, lifting over
|
||||
BED files based on alignment, and calling variants from assembly-to-assembly
|
||||
alignment. This script *requires* the [k8 Javascript shell][k8] to run. On
|
||||
Linux or Mac, you can download the precompiled k8 binary with:
|
||||
|
||||
```sh
|
||||
curl -L https://github.com/attractivechaos/k8/releases/download/v0.2.4/k8-0.2.4.tar.bz2 | tar -jxf -
|
||||
cp k8-0.2.4/k8-`uname -s` $HOME/bin/k8 # assuming $HOME/bin in your $PATH
|
||||
```
|
||||
|
||||
It is highly recommended to copy the executable `k8` to a directory on your
|
||||
`$PATH` such as `/usr/bin/env` can find it. Like python scripts, once you
|
||||
install `k8`, you can launch paftools.js in one of the two ways:
|
||||
|
||||
```sh
|
||||
path/to/paftools.js # only if k8 is on your $PATH
|
||||
k8 path/to/paftools.js
|
||||
```
|
||||
|
||||
In a nutshell, paftools.js has the following commands:
|
||||
|
||||
```
|
||||
Usage: paftools.js <command> [arguments]
|
||||
Commands:
|
||||
view convert PAF to BLAST-like (for eyeballing) or MAF
|
||||
splice2bed convert spliced alignment in PAF/SAM to BED12
|
||||
sam2paf convert SAM to PAF
|
||||
delta2paf convert MUMmer's delta to PAF
|
||||
gff2bed convert GTF/GFF3 to BED12
|
||||
|
||||
stat collect basic mapping information in PAF/SAM
|
||||
liftover simplistic liftOver
|
||||
call call variants from asm-to-ref alignment with the cs tag
|
||||
bedcov compute the number of bases covered
|
||||
|
||||
mapeval evaluate mapping accuracy using mason2/PBSIM-simulated FASTQ
|
||||
mason2fq convert mason2-simulated SAM to FASTQ
|
||||
pbsim2fq convert PBSIM-simulated MAF to FASTQ
|
||||
junceval evaluate splice junction consistency with known annotations
|
||||
ov-eval evaluate read overlap sensitivity using read-to-ref mapping
|
||||
```
|
||||
|
||||
paftools.js seamlessly reads both plain text files and gzip'd text files.
|
||||
|
||||
## <a name="eval"></a>Evaluation
|
||||
|
||||
### <a name="mapeval"></a>Evaluating mapping accuracy with simulated reads
|
||||
|
||||
The **pbsim2fq** command of paftools.js converts the MAF output of [pbsim][pbsim]
|
||||
to FASTQ and encodes the true mapping position in the read name in a format like
|
||||
`S1_33!chr1!225258409!225267761!-`. Similarly, the **mason2fq** command
|
||||
converts [mason2][mason2] simulated SAM to FASTQ.
|
||||
|
||||
Command **mapeval** evaluates mapped SAM/PAF. Here is example output:
|
||||
|
||||
```
|
||||
Q 60 32478 0 0.000000000 32478
|
||||
Q 22 16 1 0.000030775 32494
|
||||
Q 21 43 1 0.000061468 32537
|
||||
Q 19 73 1 0.000091996 32610
|
||||
Q 14 66 1 0.000122414 32676
|
||||
Q 10 27 3 0.000214048 32703
|
||||
Q 8 14 1 0.000244521 32717
|
||||
Q 7 13 2 0.000305530 32730
|
||||
Q 6 46 1 0.000335611 32776
|
||||
Q 3 10 1 0.000366010 32786
|
||||
Q 2 20 2 0.000426751 32806
|
||||
Q 1 248 94 0.003267381 33054
|
||||
Q 0 31 17 0.003778147 33085
|
||||
U 3
|
||||
```
|
||||
|
||||
where each Q-line gives the quality threshold, the number of reads mapped with
|
||||
mapping quality equal to or greater than the threshold, number of wrong
|
||||
mappings, accumulative mapping error rate and the accumulative number of
|
||||
mapped reads. The U-line, if present, gives the number of unmapped reads if
|
||||
they are present in the SAM file.
|
||||
|
||||
Suppose the reported mapping coordinate overlap with the true coordinate like
|
||||
the following:
|
||||
|
||||
```
|
||||
truth: --------------------
|
||||
mapper: ----------------------
|
||||
|<- l1 ->|<-- o -->|<-- l2 -->|
|
||||
```
|
||||
|
||||
Let `r=o/(l1+o+l2)`. The reported mapping is considered correct if `r>0.1` by
|
||||
default.
|
||||
|
||||
### <a name="oveval"></a>Evaluating read overlap sensitivity
|
||||
|
||||
Command **ov-eval** takes *sorted* read-to-reference alignment and read
|
||||
overlaps in PAF as input, and evaluates the sensitivity. For example:
|
||||
|
||||
```sh
|
||||
minimap2 -cx map-pb ref.fa reads.fq.gz | sort -k6,6 -k8,8n > reads-to-ref.paf
|
||||
minimap2 -x ava-pb reads.fq.gz reads.fq.gz > ovlp.paf
|
||||
k8 ov-eval.js reads-to-ref.paf ovlp.paf
|
||||
```
|
||||
|
||||
## <a name="asmvar"></a>Calling Variants from Haploid Assemblies
|
||||
|
||||
The **call** command of paftools.js calls variants from coordinate-sorted
|
||||
assembly-to-reference alignment. It calls variants from the [cs tag][cs] and
|
||||
identifies confident/callable regions as those covered by exactly one contig.
|
||||
Here are example command lines:
|
||||
|
||||
```sh
|
||||
minimap2 -cx asm5 -t8 --cs ref.fa asm.fa > asm.paf # keeping this file is recommended; --cs required!
|
||||
sort -k6,6 -k8,8n asm.paf > asm.srt.paf # sort by reference start coordinate
|
||||
k8 paftools.js call asm.srt.paf > asm.var.txt
|
||||
```
|
||||
|
||||
Here is sample output:
|
||||
|
||||
```
|
||||
V chr1 2276040 2276041 1 60 c g LJII01000171.1 1217409 1217410 +
|
||||
V chr1 2280409 2280410 1 60 a g LJII01000171.1 1221778 1221779 +
|
||||
V chr1 2280504 2280505 1 60 a g LJII01000171.1 1221873 1221874 +
|
||||
R chr1 2325140 2436340
|
||||
V chr1 2325287 2325287 1 60 - ct LJII01000171.1 1272894 1272896 +
|
||||
V chr1 2325642 2325644 1 60 tt - LJII01000171.1 1273251 1273251 +
|
||||
V chr1 2326051 2326052 1 60 c t LJII01000171.1 1273658 1273659 +
|
||||
V chr1 2326287 2326288 1 60 c t LJII01000171.1 1273894 1273895 +
|
||||
```
|
||||
|
||||
where a line starting with `R` gives regions covered by one query contig, and a
|
||||
V-line encodes a variant in the following format: chr, start, end, query depth,
|
||||
mapping quality, REF allele, ALT allele, query name, query start, end and the
|
||||
query orientation. Generally, you should only look at variants where column 5
|
||||
is one.
|
||||
|
||||
By default, when calling variants, "paftools.js call" ignores alignments 50kb
|
||||
or shorter; when deriving callable regions, it ignores alignments 10kb or
|
||||
shorter. It uses two thresholds to avoid edge effects. These defaults are
|
||||
designed for long-read assemblies. For short reads, both should be reduced.
|
||||
|
||||
|
||||
|
||||
[paf]: https://github.com/lh3/miniasm/blob/master/PAF.md
|
||||
[cs]: https://github.com/lh3/minimap2#cs
|
||||
[k8]: https://github.com/attractivechaos/k8
|
||||
[k8bin]: https://github.com/attractivechaos/k8/releases
|
||||
[maf]: https://genome.ucsc.edu/FAQ/FAQformat#format5
|
||||
[pbsim]: https://github.com/pfaucon/PBSIM-PacBio-Simulator
|
||||
[mason2]: https://github.com/seqan/seqan/tree/master/apps/mason2
|
||||
|
||||
@@ -1,266 +0,0 @@
|
||||
/*******************************
|
||||
* Command line option parsing *
|
||||
*******************************/
|
||||
|
||||
var getopt = function(args, ostr) {
|
||||
var oli; // option letter list index
|
||||
if (typeof(getopt.place) == 'undefined')
|
||||
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
|
||||
if (getopt.place == -1) { // update scanning pointer
|
||||
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
|
||||
getopt.place = -1;
|
||||
return null;
|
||||
}
|
||||
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
|
||||
++getopt.ind;
|
||||
getopt.place = -1;
|
||||
return null;
|
||||
}
|
||||
}
|
||||
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
|
||||
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
|
||||
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
|
||||
if (getopt.place < 0) ++getopt.ind;
|
||||
return '?';
|
||||
}
|
||||
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
|
||||
getopt.arg = null;
|
||||
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
|
||||
} else { // need an argument
|
||||
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
|
||||
getopt.arg = args[getopt.ind].substr(getopt.place);
|
||||
else if (args.length <= ++getopt.ind) { // no arg
|
||||
getopt.place = -1;
|
||||
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
|
||||
return '?';
|
||||
} else getopt.arg = args[getopt.ind]; // white space
|
||||
getopt.place = -1;
|
||||
++getopt.ind;
|
||||
}
|
||||
return optopt;
|
||||
}
|
||||
|
||||
/***********************
|
||||
* Interval operations *
|
||||
***********************/
|
||||
|
||||
Interval = {};
|
||||
|
||||
Interval.sort = function(a)
|
||||
{
|
||||
if (typeof a[0] == 'number')
|
||||
a.sort(function(x, y) { return x - y });
|
||||
else a.sort(function(x, y) { return x[0] != y[0]? x[0] - y[0] : x[1] - y[1] });
|
||||
}
|
||||
|
||||
Interval.merge = function(a, sorted)
|
||||
{
|
||||
if (typeof sorted == 'undefined') sorted = true;
|
||||
if (!sorted) Interval.sort(a);
|
||||
var k = 0;
|
||||
for (var i = 1; i < a.length; ++i) {
|
||||
if (a[k][1] >= a[i][0])
|
||||
a[k][1] = a[k][1] > a[i][1]? a[k][1] : a[i][1];
|
||||
else a[++k] = a[i].slice(0);
|
||||
}
|
||||
a.length = k + 1;
|
||||
}
|
||||
|
||||
Interval.index_end = function(a, sorted)
|
||||
{
|
||||
if (a.length == 0) return;
|
||||
if (typeof sorted == 'undefined') sorted = true;
|
||||
if (!sorted) Interval.sort(a);
|
||||
a[0].push(0);
|
||||
var k = 0, k_en = a[0][1];
|
||||
for (var i = 1; i < a.length; ++i) {
|
||||
if (k_en <= a[i][0]) {
|
||||
for (++k; k < i; ++k)
|
||||
if (a[k][1] > a[i][0])
|
||||
break;
|
||||
k_en = a[k][1];
|
||||
}
|
||||
a[i].push(k);
|
||||
}
|
||||
}
|
||||
|
||||
Interval.find_intv = function(a, x)
|
||||
{
|
||||
var left = -1, right = a.length;
|
||||
if (typeof a[0] == 'number') {
|
||||
while (right - left > 1) {
|
||||
var mid = left + ((right - left) >> 1);
|
||||
if (a[mid] > x) right = mid;
|
||||
else if (a[mid] < x) left = mid;
|
||||
else return mid;
|
||||
}
|
||||
} else {
|
||||
while (right - left > 1) {
|
||||
var mid = left + ((right - left) >> 1);
|
||||
if (a[mid][0] > x) right = mid;
|
||||
else if (a[mid][0] < x) left = mid;
|
||||
else return mid;
|
||||
}
|
||||
}
|
||||
return left;
|
||||
}
|
||||
|
||||
Interval.find_ovlp = function(a, st, en)
|
||||
{
|
||||
if (a.length == 0 || st >= en) return [];
|
||||
var l = Interval.find_intv(a, st);
|
||||
var k = l < 0? 0 : a[l][a[l].length - 1];
|
||||
var b = [];
|
||||
for (var i = k; i < a.length; ++i) {
|
||||
if (a[i][0] >= en) break;
|
||||
else if (st < a[i][1])
|
||||
b.push(a[i]);
|
||||
}
|
||||
return b;
|
||||
}
|
||||
|
||||
/*****************
|
||||
* Main function *
|
||||
*****************/
|
||||
|
||||
var c, l_fuzzy = 0, print_ovlp = false, print_err_only = false, first_only = false;
|
||||
while ((c = getopt(arguments, "l:ep")) != null) {
|
||||
if (c == 'l') l_fuzzy = parseInt(getopt.arg);
|
||||
else if (c == 'e') print_err_only = print_ovlp = true;
|
||||
else if (c == 'p') print_ovlp = true;
|
||||
}
|
||||
|
||||
if (arguments.length - getopt.ind < 2) {
|
||||
print("Usage: k8 intron-eval.js [options] <gene.gtf> <aln.sam>");
|
||||
exit(1);
|
||||
}
|
||||
|
||||
var file, buf = new Bytes();
|
||||
|
||||
var tr = {};
|
||||
file = new File(arguments[getopt.ind]);
|
||||
while (file.readline(buf) >= 0) {
|
||||
var m, t = buf.toString().split("\t");
|
||||
if (t[0].charAt(0) == '#') continue;
|
||||
if (t[2] != 'exon') continue;
|
||||
var st = parseInt(t[3]) - 1;
|
||||
var en = parseInt(t[4]);
|
||||
if ((m = /transcript_id "(\S+)"/.exec(t[8])) == null) continue;
|
||||
var tid = m[1];
|
||||
if (tr[tid] == null) tr[tid] = [t[0], t[6], 0, 0, []];
|
||||
tr[tid][4].push([st, en]);
|
||||
}
|
||||
file.close();
|
||||
|
||||
var anno = {};
|
||||
for (var tid in tr) {
|
||||
var t = tr[tid];
|
||||
Interval.sort(t[4]);
|
||||
t[2] = t[4][0][0];
|
||||
t[3] = t[4][t[4].length - 1][1];
|
||||
if (anno[t[0]] == null) anno[t[0]] = [];
|
||||
var s = t[4];
|
||||
for (var i = 0; i < s.length - 1; ++i) {
|
||||
if (s[i][1] >= s[i+1][0]) throw Error("ERROR: wrong annotation!");
|
||||
anno[t[0]].push([s[i][1], s[i+1][0]]);
|
||||
}
|
||||
}
|
||||
tr = null;
|
||||
|
||||
for (var chr in anno) {
|
||||
var e = anno[chr];
|
||||
if (e.length == 0) continue;
|
||||
Interval.sort(e);
|
||||
var k = 0;
|
||||
for (var i = 1; i < e.length; ++i) // dedup
|
||||
if (e[i][0] != e[k][0] || e[i][1] != e[k][1])
|
||||
e[++k] = e[i].slice(0);
|
||||
e.length = k + 1;
|
||||
Interval.index_end(e);
|
||||
}
|
||||
|
||||
var n_pri = 0, n_unmapped = 0, n_mapped = 0;
|
||||
var n_sgl = 0, n_splice = 0, n_splice_hit = 0, n_splice_novel = 0;
|
||||
|
||||
file = new File(arguments[getopt.ind+1]);
|
||||
var last_qname = null;
|
||||
var re_cigar = /(\d+)([MIDNSHX=])/g;
|
||||
while (file.readline(buf) >= 0) {
|
||||
var m, t = buf.toString().split("\t");
|
||||
|
||||
if (t[0].charAt(0) == '@') continue;
|
||||
var flag = parseInt(t[1]);
|
||||
if (flag&0x100) continue;
|
||||
if (first_only && last_qname == t[0]) continue;
|
||||
if (t[2] == '*') {
|
||||
++n_unmapped;
|
||||
continue;
|
||||
} else {
|
||||
++n_pri;
|
||||
if (last_qname != t[0]) ++n_mapped;
|
||||
}
|
||||
|
||||
var pos = parseInt(t[3]) - 1, intron = [];
|
||||
while ((m = re_cigar.exec(t[5])) != null) {
|
||||
var len = parseInt(m[1]), op = m[2];
|
||||
if (op == 'N') {
|
||||
intron.push([pos, pos + len]);
|
||||
pos += len;
|
||||
} else if (op == 'M' || op == 'X' || op == '=' || op == 'D') pos += len;
|
||||
}
|
||||
if (intron.length == 0) {
|
||||
++n_sgl;
|
||||
continue;
|
||||
}
|
||||
n_splice += intron.length;
|
||||
|
||||
var chr = anno[t[2]];
|
||||
if (chr != null) {
|
||||
for (var i = 0; i < intron.length; ++i) {
|
||||
var o = Interval.find_ovlp(chr, intron[i][0], intron[i][1]);
|
||||
if (o.length > 0) {
|
||||
var hit = false;
|
||||
for (var j = 0; j < o.length; ++j) {
|
||||
var st_diff = intron[i][0] - o[j][0];
|
||||
var en_diff = intron[i][1] - o[j][1];
|
||||
if (st_diff < 0) st_diff = -st_diff;
|
||||
if (en_diff < 0) en_diff = -en_diff;
|
||||
if (st_diff <= l_fuzzy && en_diff <= l_fuzzy)
|
||||
++n_splice_hit, hit = true;
|
||||
if (hit) break;
|
||||
}
|
||||
if (print_ovlp) {
|
||||
var type = hit? 'C' : 'P';
|
||||
if (hit && print_err_only) continue;
|
||||
var x = '[';
|
||||
for (var j = 0; j < o.length; ++j) {
|
||||
if (j) x += ', ';
|
||||
x += '(' + o[j][0] + "," + o[j][1] + ')';
|
||||
}
|
||||
x += ']';
|
||||
print(type, t[0], i+1, t[2], intron[i][0], intron[i][1], x);
|
||||
}
|
||||
} else {
|
||||
++n_splice_novel;
|
||||
if (print_ovlp)
|
||||
print('N', t[0], i+1, t[2], intron[i][0], intron[i][1]);
|
||||
}
|
||||
}
|
||||
} else {
|
||||
n_splice_novel += intron.length;
|
||||
}
|
||||
last_qname = t[0];
|
||||
}
|
||||
file.close();
|
||||
|
||||
buf.destroy();
|
||||
|
||||
if (!print_ovlp) {
|
||||
print("# unmapped reads: " + n_unmapped);
|
||||
print("# mapped reads: " + n_mapped);
|
||||
print("# primary alignments: " + n_pri);
|
||||
print("# singletons: " + n_sgl);
|
||||
print("# predicted introns: " + n_splice);
|
||||
print("# non-overlapping introns: " + n_splice_novel);
|
||||
print("# correct introns: " + n_splice_hit + " (" + (n_splice_hit / n_splice * 100).toFixed(2) + "%)");
|
||||
}
|
||||
-183
@@ -1,183 +0,0 @@
|
||||
var getopt = function(args, ostr) {
|
||||
var oli; // option letter list index
|
||||
if (typeof(getopt.place) == 'undefined')
|
||||
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
|
||||
if (getopt.place == -1) { // update scanning pointer
|
||||
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
|
||||
getopt.place = -1;
|
||||
return null;
|
||||
}
|
||||
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
|
||||
++getopt.ind;
|
||||
getopt.place = -1;
|
||||
return null;
|
||||
}
|
||||
}
|
||||
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
|
||||
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
|
||||
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
|
||||
if (getopt.place < 0) ++getopt.ind;
|
||||
return '?';
|
||||
}
|
||||
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
|
||||
getopt.arg = null;
|
||||
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
|
||||
} else { // need an argument
|
||||
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
|
||||
getopt.arg = args[getopt.ind].substr(getopt.place);
|
||||
else if (args.length <= ++getopt.ind) { // no arg
|
||||
getopt.place = -1;
|
||||
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
|
||||
return '?';
|
||||
} else getopt.arg = args[getopt.ind]; // white space
|
||||
getopt.place = -1;
|
||||
++getopt.ind;
|
||||
}
|
||||
return optopt;
|
||||
}
|
||||
|
||||
var c, gap_out_len = null;
|
||||
while ((c = getopt(arguments, "l:")) != null)
|
||||
if (c == 'l') gap_out_len = parseInt(getopt.arg);
|
||||
|
||||
if (getopt.ind == arguments.length) {
|
||||
print("Usage: k8 mapstat.js [-l gapOutLen] <in.sam>|<in.paf>");
|
||||
exit(1);
|
||||
}
|
||||
|
||||
var buf = new Bytes();
|
||||
var file = new File(arguments[getopt.ind]);
|
||||
var re = /(\d+)([MIDSHNX=])/g;
|
||||
|
||||
var lineno = 0, n_pri = 0, n_2nd = 0, n_seq = 0, n_cigar_64k = 0, l_tot = 0, l_cov = 0;
|
||||
var n_gap = [[0, 0, 0, 0, 0, 0], [0, 0, 0, 0, 0, 0]];
|
||||
|
||||
function cov_len(regs)
|
||||
{
|
||||
regs.sort(function(a,b) {return a[0]-b[0]});
|
||||
var st = regs[0][0], en = regs[0][1], l = 0;
|
||||
for (var i = 1; i < regs.length; ++i) {
|
||||
if (regs[i][0] < en)
|
||||
en = en > regs[i][1]? en : regs[i][1];
|
||||
else l += en - st, st = regs[i][0], en = regs[i][1];
|
||||
}
|
||||
l += en - st;
|
||||
return l;
|
||||
}
|
||||
|
||||
var last = null, last_qlen = null, regs = [];
|
||||
while (file.readline(buf) >= 0) {
|
||||
var line = buf.toString();
|
||||
++lineno;
|
||||
if (line.charAt(0) != '@') {
|
||||
var t = line.split("\t", 12);
|
||||
var m, rs, cigar = null, is_pri = false, is_sam = false, is_rev = false, tname = null;
|
||||
var atlen = null, aqlen, qs, qe, mapq, ori_qlen;
|
||||
if (t[4] == '+' || t[4] == '-') { // PAF
|
||||
if (!/\ts2:i:\d+/.test(line)) {
|
||||
++n_2nd;
|
||||
continue;
|
||||
}
|
||||
if ((m = /\tcg:Z:(\S+)/.exec(line)) != null)
|
||||
cigar = m[1];
|
||||
if (cigar == null) {
|
||||
warn("WARNING: no CIGAR at line " + lineno);
|
||||
continue;
|
||||
}
|
||||
tname = t[5];
|
||||
qs = parseInt(t[2]), qe = parseInt(t[3]);
|
||||
aqlen = qe - qs;
|
||||
is_rev = t[4] == '+'? false : true;
|
||||
rs = parseInt(t[7]);
|
||||
atlen = parseInt(t[8]) - rs;
|
||||
mapq = parseInt(t[11]);
|
||||
ori_qlen = parseInt(t[1]);
|
||||
} else { // SAM
|
||||
var flag = parseInt(t[1]);
|
||||
if ((flag & 4) || t[2] == '*' || t[5] == '*') continue;
|
||||
if (flag & 0x100) {
|
||||
++n_2nd;
|
||||
continue;
|
||||
}
|
||||
cigar = t[5];
|
||||
tname = t[2];
|
||||
rs = parseInt(t[3]) - 1;
|
||||
mapq = parseInt(t[4]);
|
||||
aqlen = t[9].length;
|
||||
is_sam = true;
|
||||
is_rev = !!(flag&0x10);
|
||||
}
|
||||
++n_pri;
|
||||
if (last != t[0]) {
|
||||
if (last != null) {
|
||||
l_tot += last_qlen;
|
||||
l_cov += cov_len(regs);
|
||||
}
|
||||
regs = [];
|
||||
++n_seq, last = t[0];
|
||||
}
|
||||
var M = 0, tl = 0, ql = 0, clip = [0, 0], n_cigar = 0, sclip = 0;
|
||||
while ((m = re.exec(cigar)) != null) {
|
||||
var l = parseInt(m[1]);
|
||||
++n_cigar;
|
||||
if (m[2] == 'M' || m[2] == '=' || m[2] == 'X') {
|
||||
tl += l, ql += l, M += l;
|
||||
} else if (m[2] == 'I' || m[2] == 'D') {
|
||||
var type;
|
||||
if (l < 50) type = 0;
|
||||
else if (l < 100) type = 1;
|
||||
else if (l < 300) type = 2;
|
||||
else if (l < 400) type = 3;
|
||||
else if (l < 1000) type = 4;
|
||||
else type = 5;
|
||||
if (m[2] == 'I') ql += l, ++n_gap[0][type];
|
||||
else tl += l, ++n_gap[1][type];
|
||||
if (gap_out_len != null && l >= gap_out_len)
|
||||
print(t[0], ql, is_rev? '-' : '+', tname, rs + tl, m[2], l);
|
||||
} else if (m[2] == 'N') {
|
||||
tl += l;
|
||||
} else if (m[2] == 'S') {
|
||||
clip[M == 0? 0 : 1] = l, sclip += l;
|
||||
} else if (m[2] == 'H') {
|
||||
clip[M == 0? 0 : 1] = l;
|
||||
}
|
||||
}
|
||||
if (n_cigar > 65535) ++n_cigar_64k;
|
||||
if (ql + sclip != aqlen)
|
||||
warn("WARNING: aligned query length is inconsistent with CIGAR at line " + lineno + " (" + (ql+sclip) + " != " + aqlen + ")");
|
||||
if (atlen != null && atlen != tl)
|
||||
warn("WARNING: aligned reference length is inconsistent with CIGAR at line " + lineno);
|
||||
if (is_sam) {
|
||||
qs = clip[is_rev? 1 : 0], qe = qs + ql;
|
||||
ori_qlen = clip[0] + ql + clip[1];
|
||||
}
|
||||
regs.push([qs, qe]);
|
||||
last_qlen = ori_qlen;
|
||||
}
|
||||
}
|
||||
l_tot += last_qlen;
|
||||
l_cov += cov_len(regs);
|
||||
|
||||
file.close();
|
||||
buf.destroy();
|
||||
|
||||
if (gap_out_len == null) {
|
||||
print("Number of mapped sequences: " + n_seq);
|
||||
print("Number of primary alignments: " + n_pri);
|
||||
print("Number of secondary alignments: " + n_2nd);
|
||||
print("Number of primary alignments with >65535 CIGAR operations: " + n_cigar_64k);
|
||||
print("Number of bases in mapped sequences: " + l_tot);
|
||||
print("Number of mapped bases: " + l_cov);
|
||||
print("Number of insertions in [0,50): " + n_gap[0][0]);
|
||||
print("Number of insertions in [50,100): " + n_gap[0][1]);
|
||||
print("Number of insertions in [100,300): " + n_gap[0][2]);
|
||||
print("Number of insertions in [300,400): " + n_gap[0][3]);
|
||||
print("Number of insertions in [400,1000): " + n_gap[0][4]);
|
||||
print("Number of insertions in [1000,inf): " + n_gap[0][5]);
|
||||
print("Number of deletions in [0,50): " + n_gap[1][0]);
|
||||
print("Number of deletions in [50,100): " + n_gap[1][1]);
|
||||
print("Number of deletions in [100,300): " + n_gap[1][2]);
|
||||
print("Number of deletions in [300,400): " + n_gap[1][3]);
|
||||
print("Number of deletions in [400,1000): " + n_gap[1][4]);
|
||||
print("Number of deletions in [1000,inf): " + n_gap[1][5]);
|
||||
}
|
||||
-171
@@ -1,171 +0,0 @@
|
||||
var getopt = function(args, ostr) {
|
||||
var oli; // option letter list index
|
||||
if (typeof(getopt.place) == 'undefined')
|
||||
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
|
||||
if (getopt.place == -1) { // update scanning pointer
|
||||
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
|
||||
getopt.place = -1;
|
||||
return null;
|
||||
}
|
||||
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
|
||||
++getopt.ind;
|
||||
getopt.place = -1;
|
||||
return null;
|
||||
}
|
||||
}
|
||||
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
|
||||
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
|
||||
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
|
||||
if (getopt.place < 0) ++getopt.ind;
|
||||
return '?';
|
||||
}
|
||||
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
|
||||
getopt.arg = null;
|
||||
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
|
||||
} else { // need an argument
|
||||
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
|
||||
getopt.arg = args[getopt.ind].substr(getopt.place);
|
||||
else if (args.length <= ++getopt.ind) { // no arg
|
||||
getopt.place = -1;
|
||||
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
|
||||
return '?';
|
||||
} else getopt.arg = args[getopt.ind]; // white space
|
||||
getopt.place = -1;
|
||||
++getopt.ind;
|
||||
}
|
||||
return optopt;
|
||||
}
|
||||
|
||||
var c, maf_out = false, line_len = 80;
|
||||
while ((c = getopt(arguments, "ml:")) != null) {
|
||||
if (c == 'm') maf_out = true;
|
||||
else if (c == 'l') line_len = parseInt(getopt.arg); // TODO: not implemented yet
|
||||
}
|
||||
if (line_len == 0) line_len = 0x7fffffff;
|
||||
|
||||
if (getopt.ind == arguments.length) {
|
||||
print("Usage: k8 paf2aln.js [options] <with-cs.paf>");
|
||||
print("Options:");
|
||||
print(" -m MAF output (BLAST-like output by default)");
|
||||
print(" -l INT line length in BLAST-like output [80]");
|
||||
print("");
|
||||
print("Note: this script only works when minimap2 is run with option '-S'");
|
||||
exit(1);
|
||||
}
|
||||
|
||||
function padding_str(x, len, right)
|
||||
{
|
||||
var s = x.toString();
|
||||
if (s.length < len) {
|
||||
if (right) s += Array(len - s.length + 1).join(" ");
|
||||
else s = Array(len - s.length + 1).join(" ") + s;
|
||||
}
|
||||
return s;
|
||||
}
|
||||
|
||||
function update_aln(s_ref, s_qry, s_mid, type, seq, slen)
|
||||
{
|
||||
var l = type == '*'? 1 : seq.length;
|
||||
if (type == '=') {
|
||||
s_ref.set(seq);
|
||||
s_qry.set(seq);
|
||||
s_mid.set(Array(l+1).join("|"));
|
||||
slen[0] += l, slen[1] += l;
|
||||
} else if (type == '*') {
|
||||
s_ref.set(seq.charAt(0));
|
||||
s_qry.set(seq.charAt(1));
|
||||
s_mid.set(' ');
|
||||
slen[0] += 1, slen[1] += 1;
|
||||
} else if (type == '+') {
|
||||
s_ref.set(Array(l+1).join("-"));
|
||||
s_qry.set(seq);
|
||||
s_mid.set(Array(l+1).join(" "));
|
||||
slen[1] += l;
|
||||
} else if (type == '-') {
|
||||
s_ref.set(seq);
|
||||
s_qry.set(Array(l+1).join("-"));
|
||||
s_mid.set(Array(l+1).join(" "));
|
||||
slen[0] += l;
|
||||
}
|
||||
}
|
||||
|
||||
function print_aln(rs, qs, strand, slen, elen, s_ref, s_qry, s_mid)
|
||||
{
|
||||
print(["Ref+:", padding_str(rs + slen[0] + 1, 10, false), s_ref.toString(), padding_str(rs + elen[0], 10, true)].join(" "));
|
||||
print(" " + s_mid.toString());
|
||||
var st, en;
|
||||
if (strand == '+') st = qs + slen[1] + 1, en = qs + elen[1];
|
||||
else st = qs - slen[1], en = qs - elen[1] + 1;
|
||||
print(["Qry" + strand + ":", padding_str(st, 10, false), s_qry.toString(), padding_str(en , 10, true)].join(" "));
|
||||
}
|
||||
|
||||
var s_ref = new Bytes(), s_qry = new Bytes(), s_mid = new Bytes();
|
||||
var re = /([=\-\+\*])([A-Za-z]+)/g;
|
||||
|
||||
var buf = new Bytes();
|
||||
var file = new File(arguments[getopt.ind]);
|
||||
if (maf_out) print("##maf version=1\n");
|
||||
while (file.readline(buf) >= 0) {
|
||||
var m, line = buf.toString();
|
||||
var t = line.split("\t", 12);
|
||||
if ((m = /\tcs:Z:(\S+)/.exec(line)) == null) continue;
|
||||
var cs = m[1];
|
||||
s_ref.length = s_qry.length = s_mid.length = 0;
|
||||
var slen = [0, 0], elen = [0, 0];
|
||||
if (maf_out) {
|
||||
while ((m = re.exec(cs)) != null)
|
||||
update_aln(s_ref, s_qry, s_mid, m[1], m[2], elen);
|
||||
if (maf_out) {
|
||||
var score = (m = /\tAS:i:(\d+)/.exec(line)) != null? parseInt(m[1]) : 0;
|
||||
var len = t[0].length > t[5].length? t[0].length : t[5].length;
|
||||
print("a " + score);
|
||||
print(["s", padding_str(t[5], len, true), padding_str(t[7], 10, false), padding_str(parseInt(t[8]) - parseInt(t[7]), 10, false),
|
||||
"+", padding_str(t[6], 10, false), s_ref.toString()].join(" "));
|
||||
var qs, qe, ql = parseInt(t[1]);
|
||||
if (t[4] == '+') {
|
||||
qs = parseInt(t[2]);
|
||||
qe = parseInt(t[3]);
|
||||
} else {
|
||||
qs = ql - parseInt(t[3]);
|
||||
qe = ql - parseInt(t[2]);
|
||||
}
|
||||
print(["s", padding_str(t[0], len, true), padding_str(qs, 10, false), padding_str(qe - qs, 10, false),
|
||||
t[4], padding_str(ql, 10, false), s_qry.toString()].join(" "));
|
||||
print("");
|
||||
}
|
||||
} else {
|
||||
line = line.replace(/\tc[sg]:Z:\S+/g, "");
|
||||
print('>' + line);
|
||||
var rs = parseInt(t[7]), qs = t[4] == '+'? parseInt(t[2]) : parseInt(t[3]);
|
||||
var n_blocks = 0;
|
||||
while ((m = re.exec(cs)) != null) {
|
||||
var start = 0, rest = m[1] == '*'? 1 : m[2].length;
|
||||
while (rest > 0) {
|
||||
var l_proc;
|
||||
if (s_ref.length + rest >= line_len) {
|
||||
l_proc = line_len - s_ref.length;
|
||||
update_aln(s_ref, s_qry, s_mid, m[1], m[1] == '*'? m[2] : m[2].substr(start, l_proc), elen);
|
||||
if (n_blocks > 0) print("");
|
||||
print_aln(rs, qs, t[4], slen, elen, s_ref, s_qry, s_mid);
|
||||
++n_blocks;
|
||||
s_ref.length = s_qry.length = s_mid.length = 0;
|
||||
slen[0] = elen[0], slen[1] = elen[1];
|
||||
} else {
|
||||
l_proc = rest;
|
||||
update_aln(s_ref, s_qry, s_mid, m[1], m[1] == '*'? m[2] : m[2].substr(start, l_proc), elen);
|
||||
}
|
||||
rest -= l_proc, start += l_proc;
|
||||
}
|
||||
}
|
||||
if (s_ref.length > 0) {
|
||||
if (n_blocks > 0) print("");
|
||||
print_aln(rs, qs, t[4], slen, elen, s_ref, s_qry, s_mid);
|
||||
++n_blocks;
|
||||
}
|
||||
print("//");
|
||||
}
|
||||
}
|
||||
file.close();
|
||||
buf.destroy();
|
||||
|
||||
s_ref.destroy(); s_qry.destroy(); s_mid.destroy();
|
||||
Executable
+241
@@ -0,0 +1,241 @@
|
||||
#!/usr/bin/env k8
|
||||
|
||||
"use strict";
|
||||
|
||||
Array.prototype.delete_at = function(i) {
|
||||
for (let j = i; j < this.length - 1; ++j)
|
||||
this[j] = this[j + 1];
|
||||
--this.length;
|
||||
}
|
||||
|
||||
function* getopt(argv, ostr, longopts) {
|
||||
if (argv.length == 0) return;
|
||||
let pos = 0, cur = 0;
|
||||
while (cur < argv.length) {
|
||||
let lopt = "", opt = "?", arg = "";
|
||||
while (cur < argv.length) { // skip non-option arguments
|
||||
if (argv[cur][0] == "-" && argv[cur].length > 1) {
|
||||
if (argv[cur] == "--") cur = argv.length;
|
||||
break;
|
||||
} else ++cur;
|
||||
}
|
||||
if (cur == argv.length) break;
|
||||
let a = argv[cur];
|
||||
if (a[0] == "-" && a[1] == "-") { // a long option
|
||||
pos = -1;
|
||||
let c = 0, k = -1, tmp = "", o;
|
||||
const pos_eq = a.indexOf("=");
|
||||
if (pos_eq > 0) {
|
||||
o = a.substring(2, pos_eq);
|
||||
arg = a.substring(pos_eq + 1);
|
||||
} else o = a.substring(2);
|
||||
for (let i = 0; i < longopts.length; ++i) {
|
||||
let y = longopts[i];
|
||||
if (y[y.length - 1] == "=") y = y.substring(0, y.length - 1);
|
||||
if (o.length <= y.length && o == y.substring(0, o.length)) {
|
||||
k = i, tmp = y;
|
||||
++c; // c is the number of matches
|
||||
if (o == y) { // exact match
|
||||
c = 1;
|
||||
break;
|
||||
}
|
||||
}
|
||||
}
|
||||
if (c == 1) { // find a unique match
|
||||
lopt = tmp;
|
||||
if (pos_eq < 0 && longopts[k][longopts[k].length-1] == "=" && cur + 1 < argv.length) {
|
||||
arg = argv[cur+1];
|
||||
argv.delete_at(cur + 1);
|
||||
}
|
||||
}
|
||||
} else { // a short option
|
||||
if (pos == 0) pos = 1;
|
||||
opt = a[pos++];
|
||||
let k = ostr.indexOf(opt);
|
||||
if (k < 0) {
|
||||
opt = "?";
|
||||
} else if (k + 1 < ostr.length && ostr[k+1] == ":") { // requiring an argument
|
||||
if (pos >= a.length) {
|
||||
arg = argv[cur+1];
|
||||
argv.delete_at(cur + 1);
|
||||
} else arg = a.substring(pos);
|
||||
pos = -1;
|
||||
}
|
||||
}
|
||||
if (pos < 0 || pos >= argv[cur].length) {
|
||||
argv.delete_at(cur);
|
||||
pos = 0;
|
||||
}
|
||||
if (lopt != "") yield { opt: `--${lopt}`, arg: arg };
|
||||
else if (opt != "?") yield { opt: `-${opt}`, arg: arg };
|
||||
else yield { opt: "?", arg: "" };
|
||||
}
|
||||
}
|
||||
|
||||
function* k8_readline(fn) {
|
||||
let buf = new Bytes();
|
||||
let file = new File(fn);
|
||||
while (file.readline(buf) >= 0) {
|
||||
yield buf.toString();
|
||||
}
|
||||
file.close();
|
||||
buf.destroy();
|
||||
}
|
||||
|
||||
function merge_hits(b) {
|
||||
if (b.length == 1)
|
||||
return { name1:b[0].name1, name2:b[0].name2, len1:b[0].len1, len2:b[0].len2, min_cov:b[0].min_cov, max_cov:b[0].max_cov, cov1:b[0].cov1, cov2:b[0].cov2, s1:b[0].s1, dv:b[0].dv };
|
||||
b.sort(function(x, y) { return x.st1 - y.st1 });
|
||||
let f = [], bt = [];
|
||||
for (let i = 0; i < b.length; ++i)
|
||||
f[i] = b[i].s1, bt[i] = -1;
|
||||
for (let i = 0; i < b.length; ++i) {
|
||||
for (let j = 0; j < i; ++j) {
|
||||
if (b[j].st2 < b[i].st2) {
|
||||
if (b[j].en1 >= b[i].en1) continue;
|
||||
if (b[j].en2 >= b[i].en2) continue;
|
||||
const ov1 = b[j].en1 <= b[i].st1? 0 : b[i].st1 - b[j].en1;
|
||||
const li1 = b[i].en1 - b[i].st1;
|
||||
const s11 = b[i].s1 / li1 * (li1 - ov1);
|
||||
const ov2 = b[j].en2 <= b[i].st2? 0 : b[i].st2 - b[j].en2;
|
||||
const li2 = b[i].en2 - b[i].st2;
|
||||
const s12 = b[i].s1 / li2 * (li2 - ov2);
|
||||
const s1 = s11 < s12? s11 : s12;
|
||||
if (f[i] < f[j] + s1)
|
||||
f[i] = f[j] + s1, bt[i] = j;
|
||||
}
|
||||
}
|
||||
}
|
||||
let max_i = -1, max_f = 0, d = [];
|
||||
for (let i = 0; i < b.length; ++i)
|
||||
if (max_f < f[i])
|
||||
max_f = f[i], max_i = i;
|
||||
for (let k = max_i; k >= 0; k = bt[k])
|
||||
d.push(k);
|
||||
d = d.reverse();
|
||||
let dv = 0, tot = 0, cov1 = 0, cov2 = 0, st1 = 0, en1 = 0, st2 = 0, en2 = 0;
|
||||
for (let k = 0; k < d.length; ++k) {
|
||||
const i = d[k];
|
||||
tot += b[i].blen;
|
||||
dv += b[i].dv * b[i].blen;
|
||||
if (b[i].st1 > en1) {
|
||||
cov1 += en1 - st1;
|
||||
st1 = b[i].st1, en1 = b[i].en1;
|
||||
} else en1 = en1 > b[i].en1? en1 : b[i].en1;
|
||||
if (b[i].st2 > en2) {
|
||||
cov2 += en2 - st2;
|
||||
st2 = b[i].st2, en2 = b[i].en2;
|
||||
} else en2 = en2 > b[i].en2? en2 : b[i].en2;
|
||||
}
|
||||
dv /= tot;
|
||||
cov1 = (cov1 + (en1 - st1)) / b[0].len1;
|
||||
cov2 = (cov2 + (en2 - st2)) / b[0].len2;
|
||||
const min_cov = cov1 < cov2? cov1 : cov2;
|
||||
const max_cov = cov1 > cov2? cov1 : cov2;
|
||||
//warn(d.length, b[0].name1, b[0].name2, min_cov, max_cov);
|
||||
return { name1:b[0].name1, name2:b[0].name2, len1:b[0].len1, len2:b[0].len2, min_cov:min_cov, max_cov:max_cov, cov1:cov1, cov2:cov2, s1:max_f, dv:dv };
|
||||
}
|
||||
|
||||
function main(args) {
|
||||
let opt = { min_cov:.9, max_dv:.015, max_diff:20000 };
|
||||
for (const o of getopt(args, "c:d:e:", [])) {
|
||||
if (o.opt == '-c') opt.min_cov = parseFloat(o.arg);
|
||||
else if (o.opt == '-d') opt.max_dv = parseFloat(o.arg);
|
||||
else if (o.opt == '-e') opt.max_diff = parseFloat(o.arg);
|
||||
}
|
||||
if (args.length == 0) {
|
||||
print("Usage: pafcluster.js [options] <ava.paf>");
|
||||
print("Options:");
|
||||
print(` -c FLOAT min coverage [${opt.min_cov}]`);
|
||||
print(` -d FLOAT max divergence [${opt.max_dv}]`);
|
||||
print(` -e FLOAT max difference [${opt.max_diff}]`);
|
||||
return;
|
||||
}
|
||||
|
||||
// read
|
||||
let a = [], len = {}, name2len = {};
|
||||
for (const line of k8_readline(args[0])) {
|
||||
let m, t = line.split("\t");
|
||||
if (t[4] != "+") continue;
|
||||
for (let i = 1; i < 4; ++i) t[i] = parseInt(t[i]);
|
||||
for (let i = 6; i < 11; ++i) t[i] = parseInt(t[i]);
|
||||
const len1 = t[1], len2 = t[6];
|
||||
let s1 = -1, dv = -1.0;
|
||||
for (let i = 12; i < t.length; ++i) {
|
||||
if ((m = /^(s1|dv):\S:(\S+)/.exec(t[i])) != null) {
|
||||
if (m[1] == "s1") s1 = parseInt(m[2]);
|
||||
else if (m[1] == "dv") dv = parseFloat(m[2]);
|
||||
}
|
||||
}
|
||||
if (s1 < 0 || dv < 0) continue;
|
||||
const cov1 = (parseInt(t[3]) - parseInt(t[2])) / len1;
|
||||
const cov2 = (parseInt(t[8]) - parseInt(t[7])) / len2;
|
||||
const min_cov = cov1 < cov2? cov1 : cov2;
|
||||
const max_cov = cov1 > cov2? cov1 : cov2;
|
||||
name2len[t[0]] = len1;
|
||||
name2len[t[5]] = len2;
|
||||
a.push({ name1:t[0], name2:t[5], len1:len1, len2:len2, min_cov:min_cov, max_cov:max_cov, s1:s1, dv:dv, cov1:cov1, cov2:cov2, st1:t[2], en1:t[3], st2:t[7], en2:t[8], blen:t[10] });
|
||||
len[t[0]] = len1, len[t[5]] = len2;
|
||||
}
|
||||
warn(`Read ${a.length} hits`);
|
||||
|
||||
// merge duplicated hits
|
||||
let h = {};
|
||||
for (let i = 0; i < a.length; ++i) {
|
||||
const key = `${a[i].name1}\t${a[i].name2}`;
|
||||
if (h[key] == null) h[key] = [];
|
||||
h[key].push(a[i]);
|
||||
}
|
||||
a = [];
|
||||
for (const key in h)
|
||||
a.push(merge_hits(h[key]));
|
||||
|
||||
// core loop
|
||||
while (a.length > 1) {
|
||||
// select the sequence with the highest sum of s1
|
||||
let h = {};
|
||||
for (let i = 0; i < a.length; ++i) {
|
||||
if (h[a[i].name1] == null) h[a[i].name1] = 0;
|
||||
h[a[i].name1] += a[i].s1;
|
||||
}
|
||||
let max_s1 = 0, max_name = "";
|
||||
for (const name in h)
|
||||
if (max_s1 < h[name])
|
||||
max_s1 = h[name], max_name = name;
|
||||
// find contigs in the same group
|
||||
h = {};
|
||||
h[max_name] = 1;
|
||||
for (let i = 0; i < a.length; ++i) {
|
||||
if (a[i].name1 != max_name && a[i].name2 != max_name)
|
||||
continue;
|
||||
const diff1 = a[i].len1 * (1.0 - a[i].cov1);
|
||||
const diff2 = a[i].len2 * (1.0 - a[i].cov2);
|
||||
if (a[i].min_cov >= opt.min_cov && a[i].dv <= opt.max_dv && diff1 <= opt.max_diff && diff2 <= opt.max_diff)
|
||||
h[a[i].name1] = h[a[i].name2] = 1;
|
||||
}
|
||||
let n = 0;
|
||||
for (const key in h) {
|
||||
++n;
|
||||
delete name2len[key];
|
||||
}
|
||||
print(`SD\t${max_name}\t${n}`);
|
||||
for (const key in h) print(`CL\t${key}\t${len[key]}`);
|
||||
print("//");
|
||||
// filter out redundant hits
|
||||
let b = [];
|
||||
for (let i = 0; i < a.length; ++i)
|
||||
if (h[a[i].name1] == null && h[a[i].name2] == null)
|
||||
b.push(a[i]);
|
||||
warn(`Reduced the number of hits from ${a.length} to ${b.length}`);
|
||||
a = b;
|
||||
}
|
||||
|
||||
// output remaining singletons
|
||||
for (const key in name2len) {
|
||||
print(`SD\t${key}\t1`);
|
||||
print(`CL\t${key}\t${name2len[key]}`);
|
||||
print(`//`);
|
||||
}
|
||||
}
|
||||
|
||||
main(arguments);
|
||||
Executable
+3727
File diff suppressed because it is too large
Load Diff
-111
@@ -1,111 +0,0 @@
|
||||
var getopt = function(args, ostr) {
|
||||
var oli; // option letter list index
|
||||
if (typeof(getopt.place) == 'undefined')
|
||||
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
|
||||
if (getopt.place == -1) { // update scanning pointer
|
||||
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
|
||||
getopt.place = -1;
|
||||
return null;
|
||||
}
|
||||
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
|
||||
++getopt.ind;
|
||||
getopt.place = -1;
|
||||
return null;
|
||||
}
|
||||
}
|
||||
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
|
||||
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
|
||||
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
|
||||
if (getopt.place < 0) ++getopt.ind;
|
||||
return '?';
|
||||
}
|
||||
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
|
||||
getopt.arg = null;
|
||||
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
|
||||
} else { // need an argument
|
||||
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
|
||||
getopt.arg = args[getopt.ind].substr(getopt.place);
|
||||
else if (args.length <= ++getopt.ind) { // no arg
|
||||
getopt.place = -1;
|
||||
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
|
||||
return '?';
|
||||
} else getopt.arg = args[getopt.ind]; // white space
|
||||
getopt.place = -1;
|
||||
++getopt.ind;
|
||||
}
|
||||
return optopt;
|
||||
}
|
||||
|
||||
var c, pri_only = false;
|
||||
while ((c = getopt(arguments, "p")) != null)
|
||||
if (c == 'p') pri_only = true;
|
||||
|
||||
var file = arguments.length == getopt.ind? new File() : new File(arguments[getopt.ind]);
|
||||
var buf = new Bytes();
|
||||
var re = /(\d+)([MIDSHNX=])/g;
|
||||
|
||||
var len = {}, lineno = 0;
|
||||
while (file.readline(buf) >= 0) {
|
||||
var m, n_cigar = 0, line = buf.toString();
|
||||
++lineno;
|
||||
if (line.charAt(0) == '@') {
|
||||
if (/^@SQ/.test(line)) {
|
||||
var name = (m = /\tSN:(\S+)/.exec(line)) != null? m[1] : null;
|
||||
var l = (m = /\tLN:(\d+)/.exec(line)) != null? parseInt(m[1]) : null;
|
||||
if (name != null && l != null) len[name] = l;
|
||||
}
|
||||
continue;
|
||||
}
|
||||
var t = line.split("\t");
|
||||
var flag = parseInt(t[1]);
|
||||
if (t[9] != '*' && t[10] != '*' && t[9].length != t[10].length) throw Error("ERROR at line " + lineno + ": inconsistent SEQ and QUAL lengths - " + t[9].length + " != " + t[10].length);
|
||||
if (t[2] == '*' || (flag&4)) continue;
|
||||
if (pri_only && (flag&0x100)) continue;
|
||||
var tlen = len[t[2]];
|
||||
if (tlen == null) throw Error("ERROR at line " + lineno + ": can't find the length of contig " + t[2]);
|
||||
var nn = (m = /\tnn:i:(\d+)/.exec(line)) != null? parseInt(m[1]) : 0;
|
||||
var NM = (m = /\tNM:i:(\d+)/.exec(line)) != null? parseInt(m[1]) : null;
|
||||
var have_NM = NM == null? false : true;
|
||||
NM += nn;
|
||||
var clip = [0, 0], I = [0, 0], D = [0, 0], M = 0, N = 0, ql = 0, tl = 0, mm = 0, ext_cigar = false;
|
||||
while ((m = re.exec(t[5])) != null) {
|
||||
var l = parseInt(m[1]);
|
||||
if (m[2] == 'M') M += l, ql += l, tl += l, ext_cigar = false;
|
||||
else if (m[2] == 'I') ++I[0], I[1] += l, ql += l;
|
||||
else if (m[2] == 'D') ++D[0], D[1] += l, tl += l;
|
||||
else if (m[2] == 'N') N += l, tl += l;
|
||||
else if (m[2] == 'S') clip[M == 0? 0 : 1] = l, ql += l;
|
||||
else if (m[2] == 'H') clip[M == 0? 0 : 1] = l;
|
||||
else if (m[2] == '=') M += l, ql += l, tl += l, ext_cigar = true;
|
||||
else if (m[2] == 'X') M += l, ql += l, tl += l, mm += l, ext_cigar = true;
|
||||
++n_cigar;
|
||||
}
|
||||
if (n_cigar > 65535)
|
||||
warn("WARNING at line " + lineno + ": " + n_cigar + " CIGAR operations");
|
||||
if (tl + parseInt(t[3]) - 1 > tlen) {
|
||||
warn("WARNING at line " + lineno + ": alignment end position larger than ref length; skipped");
|
||||
continue;
|
||||
}
|
||||
if (t[9] != '*' && t[9].length != ql) {
|
||||
warn("WARNING at line " + lineno + ": SEQ length inconsistent with CIGAR (" + t[9].length + " != " + ql + "); skipped");
|
||||
continue;
|
||||
}
|
||||
if (!have_NM || ext_cigar) NM = I[1] + D[1] + mm;
|
||||
if (NM < I[1] + D[1] + mm) {
|
||||
warn("WARNING at line " + lineno + ": NM is less than the total number of gaps (" + NM + " < " + (I[1]+D[1]+mm) + ")");
|
||||
NM = I[1] + D[1] + mm;
|
||||
}
|
||||
var extra = ["mm:i:"+(NM-I[1]-D[1]), "io:i:"+I[0], "in:i:"+I[1], "do:i:"+D[0], "dn:i:"+D[1]];
|
||||
var match = M - (NM - I[1] - D[1]);
|
||||
var blen = M + I[1] + D[1];
|
||||
var qlen = M + I[1] + clip[0] + clip[1];
|
||||
var qs, qe;
|
||||
if (flag&16) qs = clip[1], qe = qlen - clip[0];
|
||||
else qs = clip[0], qe = qlen - clip[1];
|
||||
var ts = parseInt(t[3]) - 1, te = ts + M + D[1] + N;
|
||||
var a = [t[0], qlen, qs, qe, flag&16? '-' : '+', t[2], tlen, ts, te, match, blen, t[4]];
|
||||
print(a.join("\t"), extra.join("\t"));
|
||||
}
|
||||
|
||||
buf.destroy();
|
||||
file.close();
|
||||
@@ -1,191 +0,0 @@
|
||||
var getopt = function(args, ostr) {
|
||||
var oli; // option letter list index
|
||||
if (typeof(getopt.place) == 'undefined')
|
||||
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
|
||||
if (getopt.place == -1) { // update scanning pointer
|
||||
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
|
||||
getopt.place = -1;
|
||||
return null;
|
||||
}
|
||||
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
|
||||
++getopt.ind;
|
||||
getopt.place = -1;
|
||||
return null;
|
||||
}
|
||||
}
|
||||
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
|
||||
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
|
||||
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
|
||||
if (getopt.place < 0) ++getopt.ind;
|
||||
return '?';
|
||||
}
|
||||
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
|
||||
getopt.arg = null;
|
||||
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
|
||||
} else { // need an argument
|
||||
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
|
||||
getopt.arg = args[getopt.ind].substr(getopt.place);
|
||||
else if (args.length <= ++getopt.ind) { // no arg
|
||||
getopt.place = -1;
|
||||
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
|
||||
return '?';
|
||||
} else getopt.arg = args[getopt.ind]; // white space
|
||||
getopt.place = -1;
|
||||
++getopt.ind;
|
||||
}
|
||||
return optopt;
|
||||
}
|
||||
|
||||
var c, max_mapq = 60, mode = 0, err_out_q = 256, print_err = false, ovlp_ratio = 0.1, cap_short_mapq = false;
|
||||
while ((c = getopt(arguments, "Q:r:m:c")) != null) {
|
||||
if (c == 'Q') err_out_q = parseInt(getopt.arg), print_err = true;
|
||||
else if (c == 'r') ovlp_ratio = parseFloat(getopt.arg);
|
||||
else if (c == 'm') mode = parseInt(getopt.arg);
|
||||
else if (c == 'c') cap_short_mapq = true;
|
||||
}
|
||||
|
||||
var file = arguments.length == getopt.ind? new File() : new File(arguments[getopt.ind]);
|
||||
var buf = new Bytes();
|
||||
|
||||
var tot = [], err = [];
|
||||
for (var q = 0; q <= max_mapq; ++q)
|
||||
tot[q] = err[q] = 0;
|
||||
|
||||
function is_correct(s, b)
|
||||
{
|
||||
if (s[0] != b[0] || s[3] != b[3]) return false;
|
||||
var o, l;
|
||||
if (s[1] < b[1]) {
|
||||
if (s[2] <= b[1]) return false;
|
||||
o = (s[2] < b[2]? s[2] : b[2]) - b[1];
|
||||
l = (s[2] > b[2]? s[2] : b[2]) - s[1];
|
||||
} else {
|
||||
if (b[2] <= s[1]) return false;
|
||||
o = (s[2] < b[2]? s[2] : b[2]) - s[1];
|
||||
l = (s[2] > b[2]? s[2] : b[2]) - b[1];
|
||||
}
|
||||
return o/l > ovlp_ratio? true : false;
|
||||
}
|
||||
|
||||
function count_err(qname, a, tot, err, mode)
|
||||
{
|
||||
if (a.length == 0) return;
|
||||
|
||||
var m, s;
|
||||
if ((m = /^(\S+)!(\S+)!(\d+)!(\d+)!([\+\-])$/.exec(qname)) != null) { // pbsim single-end reads
|
||||
s = [m[1], m[2], parseInt(m[3]), parseInt(m[4]), m[5]];
|
||||
} else if ((m = /^(\S+)!(\S+)!(\d+)_(\d+)!(\d+)_(\d+)!([\+\-])([\+\-])\/([12])$/.exec(qname)) != null) { // mason2 paired-end reads
|
||||
if (m[9] == '1') {
|
||||
s = [m[1], m[2], parseInt(m[3]), parseInt(m[5]), m[7]];
|
||||
} else {
|
||||
s = [m[1], m[2], parseInt(m[4]), parseInt(m[6]), m[8]];
|
||||
}
|
||||
} else throw Error("Failed to parse simulated read names '" + qname + "'");
|
||||
s.shift(); // skip the orginal read name
|
||||
|
||||
if (mode == 0 || mode == 1) { // longest only or first only
|
||||
var max_i = 0;
|
||||
if (mode == 0) { // longest only
|
||||
var max = 0;
|
||||
for (var i = 0; i < a.length; ++i)
|
||||
if (a[i][5] > max)
|
||||
max = a[i][5], max_i = i;
|
||||
}
|
||||
var mapq = a[max_i][4];
|
||||
++tot[mapq];
|
||||
if (!is_correct(s, a[max_i])) {
|
||||
if (mapq >= err_out_q)
|
||||
print('E', qname, a[max_i].join("\t"));
|
||||
++err[mapq];
|
||||
}
|
||||
} else if (mode == 2) { // all primary mode
|
||||
var max_err_mapq = -1, max_mapq = 0, max_err_i = -1;
|
||||
if (cap_short_mapq) {
|
||||
var max = 0, max_q = 0;
|
||||
for (var i = 0; i < a.length; ++i)
|
||||
if (a[i][5] > max)
|
||||
max = a[i][5], max_q = a[i][4];
|
||||
for (var i = 0; i < a.length; ++i)
|
||||
a[i][4] = max_q < a[i][4]? max_q : a[i][4];
|
||||
}
|
||||
for (var i = 0; i < a.length; ++i) {
|
||||
max_mapq = max_mapq > a[i][4]? max_mapq : a[i][4];
|
||||
if (!is_correct(s, a[i]))
|
||||
if (a[i][4] > max_err_mapq)
|
||||
max_err_mapq = a[i][4], max_err_i = i;
|
||||
}
|
||||
if (max_err_mapq >= 0) {
|
||||
++tot[max_err_mapq], ++err[max_err_mapq];
|
||||
if (max_err_mapq >= err_out_q)
|
||||
print('E', qname, a[max_err_i].join("\t"));
|
||||
} else ++tot[max_mapq];
|
||||
}
|
||||
}
|
||||
|
||||
var lineno = 0, last = null, a = [], n_unmapped = null;
|
||||
var re_cigar = /(\d+)([MIDSHN])/g;
|
||||
while (file.readline(buf) >= 0) {
|
||||
var m, line = buf.toString();
|
||||
++lineno;
|
||||
if (line[0] != '@') {
|
||||
var t = line.split("\t");
|
||||
if (t[4] == '+' || t[4] == '-') { // PAF
|
||||
if (last != t[0]) {
|
||||
if (last != null) count_err(last, a, tot, err, mode);
|
||||
a = [], last = t[0];
|
||||
}
|
||||
if (/\ts1:i:\d+/.test(line) && !/\ts2:i:\d+/.test(line)) // secondary alignment in minimap2 PAF
|
||||
continue;
|
||||
var mapq = parseInt(t[11]);
|
||||
if (mapq > max_mapq) mapq = max_mapq;
|
||||
a.push([t[5], parseInt(t[7]), parseInt(t[8]), t[4], mapq, parseInt(t[9])]);
|
||||
} else { // SAM
|
||||
var flag = parseInt(t[1]);
|
||||
var read_no = flag>>6&0x3;
|
||||
var qname = read_no == 1 || read_no == 2? t[0] + '/' + read_no : t[0];
|
||||
if (last != qname) {
|
||||
if (last != null) count_err(last, a, tot, err, mode);
|
||||
a = [], last = qname;
|
||||
}
|
||||
if (flag&0x100) continue; // secondary alignment
|
||||
if ((flag&0x4) || t[2] == '*') { // unmapped
|
||||
if (n_unmapped == null) n_unmapped = 0;
|
||||
++n_unmapped;
|
||||
continue;
|
||||
}
|
||||
var mapq = parseInt(t[4]);
|
||||
if (mapq > max_mapq) mapq = max_mapq;
|
||||
var pos = parseInt(t[3]) - 1, pos_end = pos;
|
||||
var n_gap = 0, mlen = 0;
|
||||
while ((m = re_cigar.exec(t[5])) != null) {
|
||||
var len = parseInt(m[1]);
|
||||
if (m[2] == 'M') pos_end += len, mlen += len;
|
||||
else if (m[2] == 'I') n_gap += len;
|
||||
else if (m[2] == 'D') n_gap += len, pos_end += len;
|
||||
}
|
||||
var score = pos_end - pos;
|
||||
if ((m = /\tNM:i:(\d+)/.exec(line)) != null) {
|
||||
var NM = parseInt(m[1]);
|
||||
if (NM >= n_gap) score = mlen - (NM - n_gap);
|
||||
}
|
||||
a.push([t[2], pos, pos_end, (flag&16)? '-' : '+', mapq, score]);
|
||||
}
|
||||
}
|
||||
}
|
||||
if (last != null) count_err(last, a, tot, err, mode);
|
||||
|
||||
buf.destroy();
|
||||
file.close();
|
||||
|
||||
var sum_tot = 0, sum_err = 0, q_out = -1, sum_tot2 = 0, sum_err2 = 0;
|
||||
for (var q = max_mapq; q >= 0; --q) {
|
||||
if (tot[q] == 0) continue;
|
||||
if (q_out < 0 || err[q] > 0) {
|
||||
if (q_out >= 0) print('Q', q_out, sum_tot, sum_err, (sum_err2/sum_tot2).toFixed(9), sum_tot2);
|
||||
sum_tot = sum_err = 0, q_out = q;
|
||||
}
|
||||
sum_tot += tot[q], sum_err += err[q];
|
||||
sum_tot2 += tot[q], sum_err2 += err[q];
|
||||
}
|
||||
print('Q', q_out, sum_tot, sum_err, (sum_err2/sum_tot2).toFixed(9), sum_tot2);
|
||||
if (n_unmapped != null) print('U', n_unmapped);
|
||||
@@ -1,105 +0,0 @@
|
||||
Bytes.prototype.reverse = function()
|
||||
{
|
||||
for (var i = 0; i < this.length>>1; ++i) {
|
||||
var tmp = this[i];
|
||||
this[i] = this[this.length - i - 1];
|
||||
this[this.length - i - 1] = tmp;
|
||||
}
|
||||
}
|
||||
|
||||
// reverse complement a DNA string
|
||||
Bytes.prototype.revcomp = function()
|
||||
{
|
||||
if (Bytes.rctab == null) {
|
||||
var s1 = 'WSATUGCYRKMBDHVNwsatugcyrkmbdhvn';
|
||||
var s2 = 'WSTAACGRYMKVHDBNwstaacgrymkvhdbn';
|
||||
Bytes.rctab = [];
|
||||
for (var i = 0; i < 256; ++i) Bytes.rctab[i] = 0;
|
||||
for (var i = 0; i < s1.length; ++i)
|
||||
Bytes.rctab[s1.charCodeAt(i)] = s2.charCodeAt(i);
|
||||
}
|
||||
for (var i = 0; i < this.length>>1; ++i) {
|
||||
var tmp = this[this.length - i - 1];
|
||||
this[this.length - i - 1] = Bytes.rctab[this[i]];
|
||||
this[i] = Bytes.rctab[tmp];
|
||||
}
|
||||
if (this.length&1)
|
||||
this[this.length>>1] = Bytes.rctab[this[this.length>>1]];
|
||||
}
|
||||
|
||||
if (arguments.length == 0) {
|
||||
print("Usage: k8 sim-mason2.js <mason.sam>");
|
||||
exit(1);
|
||||
}
|
||||
|
||||
function print_se(a)
|
||||
{
|
||||
print('@' + a.slice(0, 5).join("!") + " " + a[8]);
|
||||
print(a[5]);
|
||||
print("+");
|
||||
print(a[6]);
|
||||
}
|
||||
|
||||
var buf = new Bytes(), buf2 = new Bytes();
|
||||
var file = new File(arguments[0]);
|
||||
var re = /(\d+)([MIDSHN])/g;
|
||||
var last = null;
|
||||
while (file.readline(buf) >= 0) {
|
||||
var t = buf.toString().split("\t");
|
||||
if (t[0].charAt(0) == '@') continue;
|
||||
var m, l_ref = 0;
|
||||
while ((m = re.exec(t[5])) != null)
|
||||
if (m[2] == 'D' || m[2] == 'M' || m[2] == 'N')
|
||||
l_ref += parseInt(m[1]);
|
||||
var flag = parseInt(t[1]);
|
||||
var rev = !!(flag&16);
|
||||
var seq, qual;
|
||||
if (rev) {
|
||||
buf2.length = 0;
|
||||
buf2.set(t[9], 0);
|
||||
buf2.revcomp();
|
||||
seq = buf2.toString();
|
||||
buf2.set(t[10], 0);
|
||||
buf2.reverse();
|
||||
qual = buf2.toString();
|
||||
} else seq = t[9], qual = t[10];
|
||||
var qname = t[0];
|
||||
qname = qname.replace(/^simulated./, "");
|
||||
var chr = t[2];
|
||||
var pos = parseInt(t[3]) - 1;
|
||||
var strand = (flag&16)? '-' : '+';
|
||||
var read_no = flag&0xc0;
|
||||
if (read_no == 0x40) read_no = 1;
|
||||
else if (read_no == 0x80) read_no = 2;
|
||||
else read_no = 0;
|
||||
var err = 0, snp = 0, indel = 0;
|
||||
for (var i = 11; i < t.length; ++i) {
|
||||
if ((m = /^XE:i:(\d+)/.exec(t[i])) != null) err = m[1];
|
||||
else if ((m = /^XS:i:(\d+)/.exec(t[i])) != null) snp = m[1];
|
||||
else if ((m = /^XI:i:(\d+)/.exec(t[i])) != null) indel = m[1];
|
||||
}
|
||||
var comment = [err, snp, indel].join(":");
|
||||
if (last == null) {
|
||||
last = [qname, chr, pos, pos + l_ref, strand, seq, qual, read_no, comment];
|
||||
} else if (last[0] != qname) {
|
||||
print_se(last);
|
||||
last = [qname, chr, pos, pos + l_ref, strand, seq, qual, read_no, comment];
|
||||
} else {
|
||||
if (read_no == 2) { // last[] is the first read
|
||||
if (last[7] != 1) throw Error("ERROR: can't find read1");
|
||||
var name = [qname, chr, last[2] + "_" + pos, last[3] + "_" + (pos + l_ref), last[4] + strand].join("!");
|
||||
print('@' + name + '/1' + ' ' + last[8]); print(last[5]); print("+"); print(last[6]);
|
||||
print('@' + name + '/2' + ' ' + comment); print(seq); print("+"); print(qual);
|
||||
} else {
|
||||
if (last[7] != 2) throw Error("ERROR: can't find read2");
|
||||
var name = [qname, chr, pos + "_" + last[2], (pos + l_ref) + "_" + last[3], strand + last[4]].join("!");
|
||||
print('@' + name + '/1' + ' ' + comment); print(seq); print("+"); print(qual);
|
||||
print('@' + name + '/2' + ' ' + last[8]); print(last[5]); print("+"); print(last[6]);
|
||||
}
|
||||
last = null;
|
||||
}
|
||||
}
|
||||
if (last != null) print_se(last);
|
||||
file.close();
|
||||
buf.destroy();
|
||||
buf2.destroy();
|
||||
@@ -1,81 +0,0 @@
|
||||
Bytes.prototype.reverse = function()
|
||||
{
|
||||
for (var i = 0; i < this.length>>1; ++i) {
|
||||
var tmp = this[i];
|
||||
this[i] = this[this.length - i - 1];
|
||||
this[this.length - i - 1] = tmp;
|
||||
}
|
||||
}
|
||||
|
||||
// reverse complement a DNA string
|
||||
Bytes.prototype.revcomp = function()
|
||||
{
|
||||
if (Bytes.rctab == null) {
|
||||
var s1 = 'WSATUGCYRKMBDHVNwsatugcyrkmbdhvn';
|
||||
var s2 = 'WSTAACGRYMKVHDBNwstaacgrymkvhdbn';
|
||||
Bytes.rctab = [];
|
||||
for (var i = 0; i < 256; ++i) Bytes.rctab[i] = 0;
|
||||
for (var i = 0; i < s1.length; ++i)
|
||||
Bytes.rctab[s1.charCodeAt(i)] = s2.charCodeAt(i);
|
||||
}
|
||||
for (var i = 0; i < this.length>>1; ++i) {
|
||||
var tmp = this[this.length - i - 1];
|
||||
this[this.length - i - 1] = Bytes.rctab[this[i]];
|
||||
this[i] = Bytes.rctab[tmp];
|
||||
}
|
||||
if (this.length&1)
|
||||
this[this.length>>1] = Bytes.rctab[this[this.length>>1]];
|
||||
}
|
||||
|
||||
if (arguments.length < 2) {
|
||||
print("Usage: k8 sim-pbsim.js <ref.fa.fai> <pbsim1.maf> [[pbsim2.maf] ...]");
|
||||
exit(1);
|
||||
}
|
||||
|
||||
var file, buf = new Bytes(), buf2 = new Bytes();
|
||||
file = new File(arguments[0]);
|
||||
var chr_list = [];
|
||||
while (file.readline(buf) >= 0) {
|
||||
var t = buf.toString().split(/\s+/);
|
||||
chr_list.push(t[0]);
|
||||
}
|
||||
file.close();
|
||||
|
||||
for (var k = 1; k < arguments.length; ++k) {
|
||||
var fn = arguments[k];
|
||||
file = new File(fn);
|
||||
var state = 0, reg;
|
||||
while (file.readline(buf) >= 0) {
|
||||
var line = buf.toString();
|
||||
if (state == 0 && line.charAt(0) == 'a') {
|
||||
state = 1;
|
||||
} else if (state == 1 && line.charAt(0) == 's') {
|
||||
var t = line.split(/\s+/);
|
||||
var st = parseInt(t[2]);
|
||||
reg = [st, st + parseInt(t[3])];
|
||||
state = 2;
|
||||
} else if (state == 2 && line.charAt(0) == 's') {
|
||||
var m, t = line.split(/\s+/);
|
||||
if ((m = /S(\d+)_\d+/.exec(t[1])) == null) throw Error("Failed to parse the read name");
|
||||
var chr_id = parseInt(m[1]) - 1;
|
||||
if (chr_id >= chr_list.length) throw Error("Index outside the chr list");
|
||||
var name = [t[1], chr_list[chr_id], reg[0], reg[1], t[4]].join("!");
|
||||
var seq = t[6].replace(/\-/g, "");
|
||||
if (seq.length != parseInt(t[5])) throw Error("Inconsistent read length");
|
||||
if (seq.indexOf("NN") < 0) {
|
||||
if (t[4] == '-') {
|
||||
buf2.set(seq, 0);
|
||||
buf2.length = seq.length;
|
||||
buf2.revcomp();
|
||||
seq = buf2.toString();
|
||||
}
|
||||
print(">" + name);
|
||||
print(seq);
|
||||
}
|
||||
state = 0;
|
||||
}
|
||||
}
|
||||
file.close();
|
||||
}
|
||||
buf.destroy();
|
||||
buf2.destroy();
|
||||
@@ -4,6 +4,7 @@
|
||||
#include <assert.h>
|
||||
#include "minimap.h"
|
||||
#include "bseq.h"
|
||||
#include "kseq.h"
|
||||
|
||||
#define MM_PARENT_UNSET (-1)
|
||||
#define MM_PARENT_TMP_PRI (-2)
|
||||
@@ -12,10 +13,19 @@
|
||||
#define MM_DBG_PRINT_QNAME 0x2
|
||||
#define MM_DBG_PRINT_SEED 0x4
|
||||
#define MM_DBG_PRINT_ALN_SEQ 0x8
|
||||
#define MM_DBG_PRINT_CHAIN 0x10
|
||||
#define MM_DBG_SEED_FREQ 0x20
|
||||
|
||||
#define MM_SEED_LONG_JOIN (1ULL<<40)
|
||||
#define MM_SEED_IGNORE (1ULL<<41)
|
||||
#define MM_SEED_TANDEM (1ULL<<42)
|
||||
#define MM_SEED_SELF (1ULL<<43)
|
||||
|
||||
#define MM_SEED_SEG_SHIFT 48
|
||||
#define MM_SEED_SEG_MASK (0xffULL<<(MM_SEED_SEG_SHIFT))
|
||||
|
||||
#define MM_JUNC_ANNO 0x1
|
||||
#define MM_JUNC_MISC 0x2
|
||||
|
||||
#ifndef kroundup32
|
||||
#define kroundup32(x) (--(x), (x)|=(x)>>1, (x)|=(x)>>2, (x)|=(x)>>4, (x)|=(x)>>8, (x)|=(x)>>16, ++(x))
|
||||
@@ -24,20 +34,37 @@
|
||||
#define mm_seq4_set(s, i, c) ((s)[(i)>>3] |= (uint32_t)(c) << (((i)&7)<<2))
|
||||
#define mm_seq4_get(s, i) ((s)[(i)>>3] >> (((i)&7)<<2) & 0xf)
|
||||
|
||||
#define MALLOC(type, len) ((type*)malloc((len) * sizeof(type)))
|
||||
#define CALLOC(type, len) ((type*)calloc((len), sizeof(type)))
|
||||
#define REALLOC(type, ptr, cnt) ((type*)realloc((ptr), (cnt) * sizeof(type)))
|
||||
|
||||
#ifdef __cplusplus
|
||||
extern "C" {
|
||||
#endif
|
||||
|
||||
#ifndef KSTRING_T
|
||||
#define KSTRING_T kstring_t
|
||||
typedef struct __kstring_t {
|
||||
unsigned l, m;
|
||||
char *s;
|
||||
} kstring_t;
|
||||
#endif
|
||||
typedef struct {
|
||||
uint32_t n;
|
||||
uint32_t q_pos;
|
||||
uint32_t q_span:31, flt:1;
|
||||
uint32_t seg_id:31, is_tandem:1;
|
||||
const uint64_t *cr;
|
||||
} mm_seed_t;
|
||||
|
||||
typedef struct {
|
||||
int n_u, n_a;
|
||||
uint64_t *u;
|
||||
mm128_t *a;
|
||||
} mm_seg_t;
|
||||
|
||||
typedef struct {
|
||||
int32_t off, off2, cnt;
|
||||
int16_t strand;
|
||||
uint16_t flag;
|
||||
} mm_idx_jjump1_t;
|
||||
|
||||
double cputime(void);
|
||||
double realtime(void);
|
||||
long peakrss(void);
|
||||
|
||||
void radix_sort_128x(mm128_t *beg, mm128_t *end);
|
||||
void radix_sort_64(uint64_t *beg, uint64_t *end);
|
||||
@@ -45,28 +72,79 @@ uint32_t ks_ksmall_uint32_t(size_t n, uint32_t arr[], size_t kk);
|
||||
|
||||
void mm_sketch(void *km, const char *str, int len, int w, int k, uint32_t rid, int is_hpc, mm128_v *p);
|
||||
|
||||
void mm_write_sam_SQ(const mm_idx_t *idx);
|
||||
void mm_write_sam_hdr_no_SQ(const char *rg, const char *ver, int argc, char *argv[]);
|
||||
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int opt_flag);
|
||||
void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int n_regs, const mm_reg1_t *regs);
|
||||
mm_seed_t *mm_collect_matches(void *km, int *_n_m, int qlen, int max_occ, int max_max_occ, int dist, const mm_idx_t *mi, const mm128_v *mv, int64_t *n_a, int *rep_len, int *n_mini_pos, uint64_t **mini_pos);
|
||||
void mm_seed_mz_flt(void *km, mm128_v *mv, int32_t q_occ_max, float q_occ_frac);
|
||||
|
||||
double mm_event_identity(const mm_reg1_t *r);
|
||||
int mm_write_sam_hdr(const mm_idx_t *mi, const char *rg, const char *ver, int argc, char *argv[]);
|
||||
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag);
|
||||
void mm_write_paf3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag, int rep_len);
|
||||
void mm_write_paf4(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag, int rep_len, int n_seg, int seg_idx);
|
||||
void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int n_regs, const mm_reg1_t *regs);
|
||||
void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regs, const mm_reg1_t *const* regs, void *km, int64_t opt_flag);
|
||||
void mm_write_sam3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regss, const mm_reg1_t *const* regss, void *km, int64_t opt_flag, int rep_len);
|
||||
void mm_write_junc(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r);
|
||||
|
||||
// indexing related in index.c
|
||||
void mm_idxopt_init(mm_idxopt_t *opt);
|
||||
const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n);
|
||||
int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq);
|
||||
int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f);
|
||||
int mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int min_cnt, int min_sc, int is_cdna, int64_t n, mm128_t *a, uint64_t **_u, void *km);
|
||||
mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a);
|
||||
int mm_idx_getseq2(const mm_idx_t *mi, int is_rev, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq);
|
||||
mm_reg1_t *mm_gen_regs(void *km, uint32_t hash, int qlen, int n_u, uint64_t *u, mm128_t *a, int is_qstrand);
|
||||
int mm_idx_bed_read(mm_idx_t *mi, const char *fn, int read_junc);
|
||||
int mm_idx_jjump_read(mm_idx_t *mi, const char *fn, int flag, int min_sc);
|
||||
const mm_idx_jjump1_t *mm_idx_jump_get(const mm_idx_t *db, int32_t cid, int32_t st, int32_t en, int32_t *n);
|
||||
|
||||
mm_reg1_t *mm_gen_regs(void *km, int qlen, int n_u, uint64_t *u, mm128_t *a);
|
||||
void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a);
|
||||
// chaining in lchain.c
|
||||
mm128_t *mg_lchain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int max_iter, int min_cnt, int min_sc, float chn_pen_gap, float chn_pen_skip,
|
||||
int is_cdna, int n_segs, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km);
|
||||
mm128_t *mg_lchain_rmq(int max_dist, int max_dist_inner, int bw, int max_chn_skip, int cap_rmq_size, int min_cnt, int min_sc, float chn_pen_gap, float chn_pen_skip,
|
||||
int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km);
|
||||
|
||||
void mm_mark_alt(const mm_idx_t *mi, int n, mm_reg1_t *r);
|
||||
void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a, int is_qstrand);
|
||||
void mm_sync_regs(void *km, int n_regs, mm_reg1_t *regs);
|
||||
int mm_squeeze_a(void *km, int n_regs, mm_reg1_t *regs, mm128_t *a);
|
||||
int mm_set_sam_pri(int n, mm_reg1_t *r);
|
||||
void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r, int sub_diff);
|
||||
void mm_select_sub(void *km, float mask_level, float pri_ratio, int min_diff, int best_n, int *n_, mm_reg1_t *r);
|
||||
void mm_filter_regs(void *km, const mm_mapopt_t *opt, int *n_regs, mm_reg1_t *regs);
|
||||
void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs, mm128_t *a);
|
||||
void mm_hit_sort_by_dp(void *km, int *n_regs, mm_reg1_t *r);
|
||||
void mm_set_mapq(int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len);
|
||||
void mm_set_parent(void *km, float mask_level, int mask_len, int n, mm_reg1_t *r, int sub_diff, int hard_mask_level, float alt_diff_frac);
|
||||
void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int check_strand, int min_strand_sc, int *n_, mm_reg1_t *r);
|
||||
void mm_select_sub_multi(void *km, float pri_ratio, float pri1, float pri2, int max_gap_ref, int min_diff, int best_n, int n_segs, const int *qlens, int *n_, mm_reg1_t *r);
|
||||
int mm_filter_strand_retained(int n_regs, mm_reg1_t *r);
|
||||
void mm_filter_regs(const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs);
|
||||
void mm_hit_sort(void *km, int *n_regs, mm_reg1_t *r, float alt_diff_frac);
|
||||
void mm_set_mapq2(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr, int is_splice);
|
||||
void mm_update_dp_max(int qlen, int n_regs, mm_reg1_t *regs, float frac, int a, int b);
|
||||
void mm_jump_split(void *km, const mm_idx_t *mi, const mm_mapopt_t *opt, int32_t qlen, const uint8_t *qseq, mm_reg1_t *r, int32_t ts_strand);
|
||||
|
||||
mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a);
|
||||
void mm_enlarge_cigar(mm_reg1_t *r, uint32_t n_cigar);
|
||||
|
||||
void mm_est_err(const mm_idx_t *mi, int qlen, int n_regs, mm_reg1_t *regs, const mm128_t *a, int32_t n, const uint64_t *mini_pos);
|
||||
|
||||
mm_seg_t *mm_seg_gen(void *km, uint32_t hash, int n_segs, const int *qlens, int n_regs0, const mm_reg1_t *regs0, int *n_regs, mm_reg1_t **regs, const mm128_t *a);
|
||||
void mm_seg_free(void *km, int n_segs, mm_seg_t *segs);
|
||||
void mm_pair(void *km, int max_gap_ref, int dp_bonus, int sub_diff, int match_sc, const int *qlens, int *n_regs, mm_reg1_t **regs);
|
||||
|
||||
void mm_jump_split(void *km, const mm_idx_t *mi, const mm_mapopt_t *opt, int32_t qlen, const uint8_t *qseq, mm_reg1_t *r, int32_t ts_strand);
|
||||
|
||||
FILE *mm_split_init(const char *prefix, const mm_idx_t *mi);
|
||||
mm_idx_t *mm_split_merge_prep(const char *prefix, int n_splits, FILE **fp, uint32_t *n_seq_part);
|
||||
int mm_split_merge(int n_segs, const char **fn, const mm_mapopt_t *opt, int n_split_idx);
|
||||
void mm_split_rm_tmp(const char *prefix, int n_splits);
|
||||
|
||||
void mm_err_puts(const char *str);
|
||||
void mm_err_fwrite(const void *p, size_t size, size_t nitems, FILE *fp);
|
||||
void mm_err_fread(void *p, size_t size, size_t nitems, FILE *fp);
|
||||
|
||||
static inline float mg_log2(float x) // NB: this doesn't work when x<2
|
||||
{
|
||||
union { float f; uint32_t i; } z = { x };
|
||||
float log_2 = ((z.i >> 23) & 255) - 128;
|
||||
z.i &= ~(255 << 23);
|
||||
z.i += 127 << 23;
|
||||
log_2 += (-0.34484843f * z.f + 2.02466578f) * z.f - 0.67487759f;
|
||||
return log_2;
|
||||
}
|
||||
|
||||
#ifdef __cplusplus
|
||||
}
|
||||
|
||||
@@ -0,0 +1,277 @@
|
||||
#include <stdio.h>
|
||||
#include <limits.h>
|
||||
#include "mmpriv.h"
|
||||
|
||||
void mm_idxopt_init(mm_idxopt_t *opt)
|
||||
{
|
||||
memset(opt, 0, sizeof(mm_idxopt_t));
|
||||
opt->k = 15, opt->w = 10, opt->flag = 0;
|
||||
opt->bucket_bits = 14;
|
||||
opt->mini_batch_size = 50000000;
|
||||
opt->batch_size = 8000000000ULL;
|
||||
}
|
||||
|
||||
void mm_mapopt_init(mm_mapopt_t *opt)
|
||||
{
|
||||
memset(opt, 0, sizeof(mm_mapopt_t));
|
||||
opt->seed = 11;
|
||||
opt->mid_occ_frac = 2e-4f;
|
||||
opt->min_mid_occ = 10;
|
||||
opt->max_mid_occ = 1000000;
|
||||
opt->sdust_thres = 0; // no SDUST masking
|
||||
opt->q_occ_frac = 0.01f;
|
||||
|
||||
opt->min_cnt = 3;
|
||||
opt->min_chain_score = 40;
|
||||
opt->bw = 500, opt->bw_long = 20000;
|
||||
opt->max_gap = 5000;
|
||||
opt->max_gap_ref = -1;
|
||||
opt->max_chain_skip = 25;
|
||||
opt->max_chain_iter = 5000;
|
||||
opt->rmq_inner_dist = 1000;
|
||||
opt->rmq_size_cap = 100000;
|
||||
opt->rmq_rescue_size = 1000;
|
||||
opt->rmq_rescue_ratio = 0.1f;
|
||||
opt->chain_gap_scale = 0.8f;
|
||||
opt->chain_skip_scale = 0.0f;
|
||||
opt->max_max_occ = 4095;
|
||||
opt->occ_dist = 500;
|
||||
|
||||
opt->mask_level = 0.5f;
|
||||
opt->mask_len = INT_MAX;
|
||||
opt->pri_ratio = 0.8f;
|
||||
opt->best_n = 5;
|
||||
|
||||
opt->alt_drop = 0.15f;
|
||||
|
||||
opt->a = 2, opt->b = 4, opt->q = 4, opt->e = 2, opt->q2 = 24, opt->e2 = 1;
|
||||
opt->transition = 0;
|
||||
opt->sc_ambi = 1;
|
||||
opt->zdrop = 400, opt->zdrop_inv = 200;
|
||||
opt->end_bonus = -1;
|
||||
opt->min_dp_max = opt->min_chain_score * opt->a;
|
||||
opt->min_ksw_len = 200;
|
||||
opt->anchor_ext_len = 20, opt->anchor_ext_shift = 6;
|
||||
opt->max_clip_ratio = 1.0f;
|
||||
opt->mini_batch_size = 500000000;
|
||||
opt->max_sw_mat = 100000000;
|
||||
opt->cap_kalloc = 500000000;
|
||||
|
||||
opt->rank_min_len = 500;
|
||||
opt->rank_frac = 0.9f;
|
||||
|
||||
opt->pe_ori = 0; // FF
|
||||
opt->pe_bonus = 33;
|
||||
|
||||
opt->jump_min_match = 3;
|
||||
}
|
||||
|
||||
void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
|
||||
{
|
||||
if ((opt->flag & MM_F_SPLICE_FOR) || (opt->flag & MM_F_SPLICE_REV))
|
||||
opt->flag |= MM_F_SPLICE;
|
||||
if (opt->mid_occ <= 0) {
|
||||
opt->mid_occ = mm_idx_cal_max_occ(mi, opt->mid_occ_frac);
|
||||
if (opt->mid_occ < opt->min_mid_occ)
|
||||
opt->mid_occ = opt->min_mid_occ;
|
||||
if (opt->max_mid_occ > opt->min_mid_occ && opt->mid_occ > opt->max_mid_occ)
|
||||
opt->mid_occ = opt->max_mid_occ;
|
||||
}
|
||||
if (opt->bw_long < opt->bw) opt->bw_long = opt->bw;
|
||||
if (mm_verbose >= 3)
|
||||
fprintf(stderr, "[M::%s::%.3f*%.2f] mid_occ = %d\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), opt->mid_occ);
|
||||
}
|
||||
|
||||
void mm_mapopt_max_intron_len(mm_mapopt_t *opt, int max_intron_len)
|
||||
{
|
||||
if ((opt->flag & MM_F_SPLICE) && max_intron_len > 0)
|
||||
opt->max_gap_ref = opt->bw = opt->bw_long = max_intron_len;
|
||||
}
|
||||
|
||||
int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
|
||||
{
|
||||
if (preset == 0) {
|
||||
mm_idxopt_init(io);
|
||||
mm_mapopt_init(mo);
|
||||
} else if (strcmp(preset, "lr") == 0 || strcmp(preset, "map-ont") == 0) { // this is the same as the default
|
||||
} else if (strcmp(preset, "ava-ont") == 0) {
|
||||
io->flag = 0, io->k = 15, io->w = 5;
|
||||
mo->flag |= MM_F_ALL_CHAINS | MM_F_NO_DIAG | MM_F_NO_DUAL | MM_F_NO_LJOIN;
|
||||
mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_chain_skip = 25;
|
||||
mo->bw = mo->bw_long = 2000;
|
||||
mo->occ_dist = 0;
|
||||
} else if (strcmp(preset, "map10k") == 0 || strcmp(preset, "map-pb") == 0) {
|
||||
io->flag |= MM_I_HPC, io->k = 19;
|
||||
} else if (strcmp(preset, "ava-pb") == 0) {
|
||||
io->flag |= MM_I_HPC, io->k = 19, io->w = 5;
|
||||
mo->flag |= MM_F_ALL_CHAINS | MM_F_NO_DIAG | MM_F_NO_DUAL | MM_F_NO_LJOIN;
|
||||
mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_chain_skip = 25;
|
||||
mo->bw_long = mo->bw;
|
||||
mo->occ_dist = 0;
|
||||
} else if (strcmp(preset, "lr:hq") == 0 || strcmp(preset, "map-hifi") == 0 || strcmp(preset, "map-ccs") == 0) {
|
||||
io->flag = 0, io->k = 19, io->w = 19;
|
||||
mo->max_gap = 10000;
|
||||
mo->min_mid_occ = 50, mo->max_mid_occ = 500;
|
||||
if (strcmp(preset, "map-hifi") == 0 || strcmp(preset, "map-ccs") == 0) {
|
||||
mo->a = 1, mo->b = 4, mo->q = 6, mo->q2 = 26, mo->e = 2, mo->e2 = 1;
|
||||
mo->min_dp_max = 200;
|
||||
}
|
||||
} else if (strcmp(preset, "lr:hqae") == 0) { // high-quality assembly evaluation
|
||||
io->flag = 0, io->k = 25, io->w = 51;
|
||||
mo->flag |= MM_F_RMQ;
|
||||
mo->min_mid_occ = 50, mo->max_mid_occ = 500;
|
||||
mo->rmq_inner_dist = 5000;
|
||||
mo->occ_dist = 200;
|
||||
mo->best_n = 100;
|
||||
mo->chain_gap_scale = 5.0f;
|
||||
} else if (strcmp(preset, "map-iclr-prerender") == 0) {
|
||||
io->flag = 0, io->k = 15;
|
||||
mo->b = 6, mo->transition = 1;
|
||||
mo->q = 10, mo->q2 = 50;
|
||||
} else if (strcmp(preset, "map-iclr") == 0) {
|
||||
io->flag = 0, io->k = 19;
|
||||
mo->b = 6, mo->transition = 4;
|
||||
mo->q = 10, mo->q2 = 50;
|
||||
} else if (strncmp(preset, "asm", 3) == 0) {
|
||||
io->flag = 0, io->k = 19, io->w = 19;
|
||||
mo->bw = 1000, mo->bw_long = 100000;
|
||||
mo->max_gap = 10000;
|
||||
mo->flag |= MM_F_RMQ;
|
||||
mo->min_mid_occ = 50, mo->max_mid_occ = 500;
|
||||
mo->min_dp_max = 200;
|
||||
mo->best_n = 50;
|
||||
if (strcmp(preset, "asm5") == 0) {
|
||||
mo->a = 1, mo->b = 19, mo->q = 39, mo->q2 = 81, mo->e = 3, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
|
||||
} else if (strcmp(preset, "asm10") == 0) {
|
||||
mo->a = 1, mo->b = 9, mo->q = 16, mo->q2 = 41, mo->e = 2, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
|
||||
} else if (strcmp(preset, "asm20") == 0) {
|
||||
mo->a = 1, mo->b = 4, mo->q = 6, mo->q2 = 26, mo->e = 2, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
|
||||
io->w = 10;
|
||||
} else return -1;
|
||||
} else if (strcmp(preset, "short") == 0 || strcmp(preset, "sr") == 0) {
|
||||
io->flag = 0, io->k = 21, io->w = 11;
|
||||
mo->flag |= MM_F_SR | MM_F_FRAG_MODE | MM_F_NO_PRINT_2ND | MM_F_2_IO_THREADS | MM_F_HEAP_SORT;
|
||||
mo->pe_ori = 0<<1|1; // FR
|
||||
mo->a = 2, mo->b = 8, mo->q = 12, mo->e = 2, mo->q2 = 24, mo->e2 = 1;
|
||||
mo->zdrop = mo->zdrop_inv = 100;
|
||||
mo->end_bonus = 10;
|
||||
mo->max_frag_len = 800;
|
||||
mo->max_gap = 100;
|
||||
mo->bw = mo->bw_long = 100;
|
||||
mo->pri_ratio = 0.5f;
|
||||
mo->min_cnt = 2;
|
||||
mo->min_chain_score = 25;
|
||||
mo->min_dp_max = 40;
|
||||
mo->best_n = 20;
|
||||
mo->mid_occ = 1000;
|
||||
mo->max_occ = 5000;
|
||||
mo->mini_batch_size = 50000000;
|
||||
} else if (strcmp(preset, "splice") == 0 || strcmp(preset, "splice:hq") == 0 || strcmp(preset, "splice:sr") == 0 || strcmp(preset, "cdna") == 0) {
|
||||
io->flag = 0, io->k = 15, io->w = 5;
|
||||
mo->flag |= MM_F_SPLICE | MM_F_SPLICE_FOR | MM_F_SPLICE_REV | MM_F_SPLICE_FLANK;
|
||||
mo->max_sw_mat = 0;
|
||||
mo->max_gap = 2000, mo->max_gap_ref = mo->bw = mo->bw_long = 200000;
|
||||
mo->a = 1, mo->b = 2, mo->q = 2, mo->e = 1, mo->q2 = 32, mo->e2 = 0;
|
||||
mo->noncan = 9;
|
||||
mo->junc_bonus = 9;
|
||||
mo->junc_pen = 5;
|
||||
mo->zdrop = 200, mo->zdrop_inv = 100; // because mo->a is halved
|
||||
if (strcmp(preset, "splice:hq") == 0) {
|
||||
mo->noncan = 5, mo->b = 4, mo->q = 6, mo->q2 = 24;
|
||||
} else if (strcmp(preset, "splice:sr") == 0) {
|
||||
mo->flag |= MM_F_NO_PRINT_2ND | MM_F_2_IO_THREADS | MM_F_HEAP_SORT | MM_F_FRAG_MODE | MM_F_WEAK_PAIRING | MM_F_SR_RNA;
|
||||
mo->noncan = 5, mo->b = 4, mo->q = 6, mo->q2 = 24;
|
||||
mo->min_chain_score = 25;
|
||||
mo->min_dp_max = 40;
|
||||
mo->min_ksw_len = 20;
|
||||
mo->pe_ori = 0<<1|1; // FR
|
||||
mo->best_n = 10;
|
||||
mo->mini_batch_size = 100000000;
|
||||
}
|
||||
} else return -1;
|
||||
return 0;
|
||||
}
|
||||
|
||||
int mm_max_spsc_bonus(const mm_mapopt_t *mo)
|
||||
{
|
||||
int max_sc = (mo->q2 + 1) / 2 - 1;
|
||||
max_sc = max_sc > mo->q2 - mo->q? max_sc : mo->q2 - mo->q;
|
||||
return max_sc;
|
||||
}
|
||||
|
||||
int mm_check_opt(const mm_idxopt_t *io, const mm_mapopt_t *mo)
|
||||
{
|
||||
if (mo->bw > mo->bw_long) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "[ERROR]\033[1;31m with '-rNUM1,NUM2', NUM1 (%d) can't be larger than NUM2 (%d)\033[0m\n", mo->bw, mo->bw_long);
|
||||
return -8;
|
||||
}
|
||||
if ((mo->flag & MM_F_RMQ) && (mo->flag & (MM_F_SR|MM_F_SPLICE))) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "[ERROR]\033[1;31m --rmq doesn't work with --sr or --splice\033[0m\n");
|
||||
return -7;
|
||||
}
|
||||
if (mo->split_prefix && (mo->flag & (MM_F_OUT_CS|MM_F_OUT_MD))) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "[ERROR]\033[1;31m --cs or --MD doesn't work with --split-prefix\033[0m\n");
|
||||
return -6;
|
||||
}
|
||||
if (io->k <= 0 || io->w <= 0) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "[ERROR]\033[1;31m -k and -w must be positive\033[0m\n");
|
||||
return -5;
|
||||
}
|
||||
if (mo->best_n < 0) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "[ERROR]\033[1;31m -N must be no less than 0\033[0m\n");
|
||||
return -4;
|
||||
}
|
||||
if (mo->best_n == 0 && mm_verbose >= 2)
|
||||
fprintf(stderr, "[WARNING]\033[1;31m '-N 0' reduces mapping accuracy. Please use '--secondary=no' instead.\033[0m\n");
|
||||
if (mo->pri_ratio < 0.0f || mo->pri_ratio > 1.0f) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "[ERROR]\033[1;31m -p must be within 0 and 1 (including 0 and 1)\033[0m\n");
|
||||
return -4;
|
||||
}
|
||||
if ((mo->flag & MM_F_FOR_ONLY) && (mo->flag & MM_F_REV_ONLY)) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "[ERROR]\033[1;31m --for-only and --rev-only can't be applied at the same time\033[0m\n");
|
||||
return -3;
|
||||
}
|
||||
if (mo->e <= 0 || mo->q <= 0) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "[ERROR]\033[1;31m -O and -E must be positive\033[0m\n");
|
||||
return -1;
|
||||
}
|
||||
if ((mo->q != mo->q2 || mo->e != mo->e2) && !(mo->e > mo->e2 && mo->q + mo->e < mo->q2 + mo->e2)) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "[ERROR]\033[1;31m dual gap penalties violating E1>E2 and O1+E1<O2+E2\033[0m\n");
|
||||
return -2;
|
||||
}
|
||||
if ((mo->q + mo->e) + (mo->q2 + mo->e2) > 127) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "[ERROR]\033[1;31m scoring system violating ({-O}+{-E})+({-O2}+{-E2}) <= 127\033[0m\n");
|
||||
return -1;
|
||||
}
|
||||
if (mo->sc_ambi < 0 || mo->sc_ambi >= mo->b) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "[ERROR]\033[1;31m --score-N should be within [0,{-B})\033[0m\n");
|
||||
return -1;
|
||||
}
|
||||
if (mo->zdrop < mo->zdrop_inv) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "[ERROR]\033[1;31m Z-drop should not be less than inversion-Z-drop\033[0m\n");
|
||||
return -5;
|
||||
}
|
||||
if ((mo->flag & MM_F_NO_PRINT_2ND) && (mo->flag & MM_F_ALL_CHAINS)) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "[ERROR]\033[1;31m -X/-P and --secondary=no can't be applied at the same time\033[0m\n");
|
||||
return -5;
|
||||
}
|
||||
if ((mo->flag & MM_F_QSTRAND) && ((mo->flag & (MM_F_OUT_SAM|MM_F_SPLICE|MM_F_FRAG_MODE)) || (io->flag & MM_I_HPC))) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "[ERROR]\033[1;31m --qstrand doesn't work with -a, -H, --frag or --splice\033[0m\n");
|
||||
return -5;
|
||||
}
|
||||
return 0;
|
||||
}
|
||||
@@ -0,0 +1,177 @@
|
||||
#include <stdlib.h>
|
||||
#include <math.h>
|
||||
#include "mmpriv.h"
|
||||
#include "kvec.h"
|
||||
|
||||
void mm_select_sub_multi(void *km, float pri_ratio, float pri1, float pri2, int max_gap_ref, int min_diff, int best_n, int n_segs, const int *qlens, int *n_, mm_reg1_t *r)
|
||||
{
|
||||
if (pri_ratio > 0.0f && *n_ > 0) {
|
||||
int i, k, n = *n_, n_2nd = 0;
|
||||
int max_dist = n_segs == 2? qlens[0] + qlens[1] + max_gap_ref : 0;
|
||||
for (i = k = 0; i < n; ++i) {
|
||||
int to_keep = 0;
|
||||
if (r[i].parent == i) { // primary
|
||||
to_keep = 1;
|
||||
} else if (r[i].score + min_diff >= r[r[i].parent].score) {
|
||||
to_keep = 1;
|
||||
} else {
|
||||
mm_reg1_t *p = &r[r[i].parent], *q = &r[i];
|
||||
if (p->rev == q->rev && p->rid == q->rid && q->re - p->rs < max_dist && p->re - q->rs < max_dist) { // child and parent are close on the ref
|
||||
if (q->score >= p->score * pri1)
|
||||
to_keep = 1;
|
||||
} else {
|
||||
int is_par_both = (n_segs == 2 && p->qs < qlens[0] && p->qe > qlens[0]);
|
||||
int is_chi_both = (n_segs == 2 && q->qs < qlens[0] && q->qe > qlens[0]);
|
||||
if (is_chi_both || is_chi_both == is_par_both) {
|
||||
if (q->score >= p->score * pri_ratio)
|
||||
to_keep = 1;
|
||||
} else { // the remaining case: is_chi_both == 0 && is_par_both == 1
|
||||
if (q->score >= p->score * pri2)
|
||||
to_keep = 1;
|
||||
}
|
||||
}
|
||||
}
|
||||
if (to_keep && r[i].parent != i) {
|
||||
if (n_2nd++ >= best_n) to_keep = 0; // don't keep if there are too many secondary hits
|
||||
}
|
||||
if (to_keep) r[k++] = r[i];
|
||||
else if (r[i].p) free(r[i].p);
|
||||
}
|
||||
if (k != n) mm_sync_regs(km, k, r); // removing hits requires sync()
|
||||
*n_ = k;
|
||||
}
|
||||
}
|
||||
|
||||
void mm_set_pe_thru(const int *qlens, int *n_regs, mm_reg1_t **regs)
|
||||
{
|
||||
int s, i, n_pri[2], pri[2];
|
||||
n_pri[0] = n_pri[1] = 0;
|
||||
pri[0] = pri[1] = -1;
|
||||
for (s = 0; s < 2; ++s)
|
||||
for (i = 0; i < n_regs[s]; ++i)
|
||||
if (regs[s][i].id == regs[s][i].parent)
|
||||
++n_pri[s], pri[s] = i;
|
||||
if (n_pri[0] == 1 && n_pri[1] == 1) {
|
||||
mm_reg1_t *p = ®s[0][pri[0]];
|
||||
mm_reg1_t *q = ®s[1][pri[1]];
|
||||
if (p->rid == q->rid && p->rev == q->rev && abs(p->rs - q->rs) < 3 && abs(p->re - q->re) < 3
|
||||
&& ((p->qs == 0 && qlens[1] - q->qe == 0) || (q->qs == 0 && qlens[0] - p->qe == 0)))
|
||||
{
|
||||
p->pe_thru = q->pe_thru = 1;
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
#include "ksort.h"
|
||||
|
||||
typedef struct {
|
||||
int s, rev;
|
||||
uint64_t key;
|
||||
mm_reg1_t *r;
|
||||
} pair_arr_t;
|
||||
|
||||
#define sort_key_pair(a) ((a).key)
|
||||
KRADIX_SORT_INIT(pair, pair_arr_t, sort_key_pair, 8)
|
||||
|
||||
void mm_pair(void *km, int max_gap_ref, int pe_bonus, int sub_diff, int match_sc, const int *qlens, int *n_regs, mm_reg1_t **regs)
|
||||
{
|
||||
int i, j, s, n, last[2], dp_thres, segs = 0, max_idx[2];
|
||||
int64_t max;
|
||||
pair_arr_t *a;
|
||||
kvec_t(uint64_t) sc = {0,0,0};
|
||||
|
||||
a = (pair_arr_t*)kmalloc(km, (n_regs[0] + n_regs[1]) * sizeof(pair_arr_t));
|
||||
for (s = n = 0, dp_thres = 0; s < 2; ++s) {
|
||||
int max = 0;
|
||||
for (i = 0; i < n_regs[s]; ++i) {
|
||||
a[n].s = s;
|
||||
a[n].r = ®s[s][i];
|
||||
a[n].rev = a[n].r->rev;
|
||||
a[n].key = (uint64_t)a[n].r->rid << 32 | a[n].r->rs<<1 | (s^a[n].rev);
|
||||
max = max > a[n].r->p->dp_max? max : a[n].r->p->dp_max;
|
||||
++n;
|
||||
segs |= 1<<s;
|
||||
}
|
||||
dp_thres += max;
|
||||
}
|
||||
if (segs != 3) {
|
||||
kfree(km, a); // only one end is mapped
|
||||
return;
|
||||
}
|
||||
dp_thres -= pe_bonus;
|
||||
if (dp_thres < 0) dp_thres = 0;
|
||||
radix_sort_pair(a, a + n);
|
||||
|
||||
max = -1;
|
||||
max_idx[0] = max_idx[1] = -1;
|
||||
last[0] = last[1] = -1;
|
||||
kv_resize(uint64_t, km, sc, (size_t)n);
|
||||
for (i = 0; i < n; ++i) {
|
||||
if (a[i].key & 1) { // reverse first read or forward second read
|
||||
mm_reg1_t *q, *r;
|
||||
if (last[a[i].rev] < 0) continue;
|
||||
r = a[i].r;
|
||||
q = a[last[a[i].rev]].r;
|
||||
if (r->rid != q->rid || r->rs - q->re > max_gap_ref) continue;
|
||||
for (j = last[a[i].rev]; j >= 0; --j) {
|
||||
int64_t score;
|
||||
if (a[j].rev != a[i].rev || a[j].s == a[i].s) continue;
|
||||
q = a[j].r;
|
||||
if (r->rid != q->rid || r->rs - q->re > max_gap_ref) break;
|
||||
if (r->p->dp_max + q->p->dp_max < dp_thres) continue;
|
||||
score = (int64_t)(r->p->dp_max + q->p->dp_max) << 32 | (r->hash + q->hash);
|
||||
if (score > max)
|
||||
max = score, max_idx[a[j].s] = j, max_idx[a[i].s] = i;
|
||||
kv_push(uint64_t, km, sc, score);
|
||||
}
|
||||
} else { // forward first read or reverse second read
|
||||
last[a[i].rev] = i;
|
||||
}
|
||||
}
|
||||
if (sc.n > 1)
|
||||
radix_sort_64(sc.a, sc.a + sc.n);
|
||||
|
||||
if (sc.n > 0 && max > 0) { // found at least one pair
|
||||
int n_sub = 0, mapq_pe;
|
||||
mm_reg1_t *r[2];
|
||||
r[0] = a[max_idx[0]].r, r[1] = a[max_idx[1]].r;
|
||||
r[0]->proper_frag = r[1]->proper_frag = 1;
|
||||
for (s = 0; s < 2; ++s) {
|
||||
if (r[s]->id != r[s]->parent) { // then lift to primary and update parent
|
||||
mm_reg1_t *p = ®s[s][r[s]->parent];
|
||||
for (i = 0; i < n_regs[s]; ++i)
|
||||
if (regs[s][i].parent == p->id)
|
||||
regs[s][i].parent = r[s]->id;
|
||||
p->mapq = 0;
|
||||
}
|
||||
if (!r[s]->sam_pri) { // then sync sam_pri
|
||||
for (i = 0; i < n_regs[s]; ++i)
|
||||
regs[s][i].sam_pri = 0;
|
||||
r[s]->sam_pri = 1;
|
||||
}
|
||||
}
|
||||
mapq_pe = r[0]->mapq > r[1]->mapq? r[0]->mapq : r[1]->mapq;
|
||||
for (i = 0; i < (int)sc.n; ++i)
|
||||
if ((sc.a[i]>>32) + sub_diff >= (uint64_t)max>>32)
|
||||
++n_sub;
|
||||
if (sc.n > 1) {
|
||||
int mapq_pe_alt;
|
||||
mapq_pe_alt = (int)(6.02f * ((max>>32) - (sc.a[sc.n - 2]>>32)) / match_sc - 4.343f * logf(n_sub)); // n_sub > 0 because it counts the optimal, too
|
||||
mapq_pe = mapq_pe < mapq_pe_alt? mapq_pe : mapq_pe_alt;
|
||||
}
|
||||
if (r[0]->mapq < mapq_pe) r[0]->mapq = (int)(.2f * r[0]->mapq + .8f * mapq_pe + .499f);
|
||||
if (r[1]->mapq < mapq_pe) r[1]->mapq = (int)(.2f * r[1]->mapq + .8f * mapq_pe + .499f);
|
||||
if (sc.n == 1) {
|
||||
if (r[0]->mapq < 2) r[0]->mapq = 2;
|
||||
if (r[1]->mapq < 2) r[1]->mapq = 2;
|
||||
} else if ((uint64_t)max>>32 > sc.a[sc.n - 2]>>32) {
|
||||
if (r[0]->mapq < 1) r[0]->mapq = 1;
|
||||
if (r[1]->mapq < 1) r[1]->mapq = 1;
|
||||
}
|
||||
}
|
||||
|
||||
kfree(km, a);
|
||||
kfree(km, sc.a);
|
||||
|
||||
mm_set_pe_thru(qlens, n_regs, regs);
|
||||
}
|
||||
@@ -0,0 +1,2 @@
|
||||
[build-system]
|
||||
requires = ["setuptools", "wheel", "Cython"]
|
||||
+71
-14
@@ -34,6 +34,8 @@ The following Python script demonstrates the key functionality of mappy:
|
||||
import mappy as mp
|
||||
a = mp.Aligner("test/MT-human.fa") # load or build index
|
||||
if not a: raise Exception("ERROR: failed to load/build index")
|
||||
s = a.seq("MT_human", 100, 200) # retrieve a subsequence from the index
|
||||
print(mp.revcomp(s)) # reverse complement
|
||||
for name, seq, qual in mp.fastx_read("test/MT-orang.fa"): # read a fasta/q sequence
|
||||
for hit in a.map(seq): # traverse alignments
|
||||
print("{}\t{}\t{}\t{}".format(hit.ctg, hit.r_st, hit.r_en, hit.cigar_str))
|
||||
@@ -41,20 +43,24 @@ The following Python script demonstrates the key functionality of mappy:
|
||||
APIs
|
||||
----
|
||||
|
||||
Mappy implements two classes and one global function.
|
||||
Mappy implements two classes and two global function.
|
||||
|
||||
Class mappy.Aligner
|
||||
~~~~~~~~~~~~~~~~~~~
|
||||
|
||||
.. code:: python
|
||||
|
||||
mappy.Aligner(fn_idx_in, preset=None, ...)
|
||||
mappy.Aligner(fn_idx_in=None, preset=None, ...)
|
||||
|
||||
This constructor accepts the following arguments:
|
||||
|
||||
* **fn_idx_in**: index or sequence file name. Minimap2 automatically tests the
|
||||
file type. If a sequence file is provided, minimap2 builds an index. The
|
||||
sequence file can be optionally gzip'd.
|
||||
sequence file can be optionally gzip'd. This option has no effect if **seq**
|
||||
is set.
|
||||
|
||||
* **seq**: a single sequence to index. The sequence name will be set to
|
||||
:code:`N/A`.
|
||||
|
||||
* **preset**: minimap2 preset. Currently, minimap2 supports the following
|
||||
presets: **sr** for single-end short reads; **map-pb** for PacBio
|
||||
@@ -71,20 +77,50 @@ This constructor accepts the following arguments:
|
||||
|
||||
* **min_chain_score**: minimum chaing score
|
||||
|
||||
* **bw**: chaining and alignment band width
|
||||
* **bw**: chaining and alignment band width (initial chaining and extension)
|
||||
|
||||
* **bw_long**: chaining and alignment band width (RMQ-based rechaining and closing gaps)
|
||||
|
||||
* **best_n**: max number of alignments to return
|
||||
|
||||
* **n_threads**: number of indexing threads; 3 by default
|
||||
|
||||
* **fn_idx_out**: name of file to which the index is written
|
||||
* **extra_flags**: additional flags defined in minimap.h
|
||||
|
||||
* **fn_idx_out**: name of file to which the index is written. This parameter
|
||||
has no effect if **seq** is set.
|
||||
|
||||
* **scoring**: scoring system. It is a tuple/list consisting of 4, 6 or 7
|
||||
positive integers. The first 4 elements specify match scoring, mismatch
|
||||
penalty, gap open and gap extension penalty. The 5th and 6th elements, if
|
||||
present, set long-gap open and long-gap extension penalty. The 7th sets a
|
||||
mismatch penalty involving ambiguous bases.
|
||||
|
||||
.. code:: python
|
||||
|
||||
mappy.Aligner.map(seq)
|
||||
mappy.Aligner.map(seq, seq2=None, cs=False, MD=False)
|
||||
|
||||
This method aligns :code:`seq` against the index. It is a generator, *yielding*
|
||||
a series of :code:`mappy.Alignment` objects.
|
||||
a series of :code:`mappy.Alignment` objects. If :code:`seq2` is present, mappy
|
||||
performs paired-end alignment, assuming the two ends are in the FR orientation.
|
||||
Alignments of the two ends can be distinguished by the :code:`read_num` field
|
||||
(see Class mappy.Alignment below). Argument :code:`cs` asks mappy to generate
|
||||
the :code:`cs` tag; :code:`MD` is similar. These two arguments might slightly
|
||||
degrade performance and are not enabled by default.
|
||||
|
||||
.. code:: python
|
||||
|
||||
mappy.Aligner.seq(name, start=0, end=0x7fffffff)
|
||||
|
||||
This method retrieves a (sub)sequence from the index and returns it as a Python
|
||||
string. :code:`None` is returned if :code:`name` is not present in the index or
|
||||
the start/end coordinates are invalid.
|
||||
|
||||
.. code:: python
|
||||
|
||||
mappy.Aligner.seq_names
|
||||
|
||||
This property gives the array of sequence names in the index.
|
||||
|
||||
Class mappy.Alignment
|
||||
~~~~~~~~~~~~~~~~~~~~~
|
||||
@@ -104,9 +140,13 @@ properties:
|
||||
|
||||
* **mapq**: mapping quality
|
||||
|
||||
* **NM**: number of mismatches and gaps in the alignment
|
||||
|
||||
* **blen**: length of the alignment, including both alignment matches and gaps
|
||||
but excluding ambiguous bases.
|
||||
|
||||
* **mlen**: length of the matching bases in the alignment, excluding ambiguous
|
||||
base matches.
|
||||
|
||||
* **NM**: number of mismatches, gaps and ambiguous positions in the alignment
|
||||
|
||||
* **trans_strand**: transcript strand. +1 if on the forward strand; -1 if on the
|
||||
reverse strand; 0 if unknown
|
||||
@@ -114,28 +154,45 @@ properties:
|
||||
* **is_primary**: if the alignment is primary (typically the best and the first
|
||||
to generate)
|
||||
|
||||
* **read_num**: read number that the alignment corresponds to; 1 for the first
|
||||
read and 2 for the second read
|
||||
|
||||
* **cigar_str**: CIGAR string
|
||||
|
||||
* **cigar**: CIGAR returned as an array of shape :code:`(n_cigar,2)`. The two
|
||||
numbers give the length and the operator of each CIGAR operation.
|
||||
|
||||
* **MD**: the :code:`MD` tag as in the SAM format. It is an empty string unless
|
||||
the :code:`MD` argument is applied when calling :code:`mappy.Aligner.map()`.
|
||||
|
||||
* **cs**: the :code:`cs` tag.
|
||||
|
||||
An :code:`Alignment` object can be converted to a string with :code:`str()` in
|
||||
the following format:
|
||||
|
||||
::
|
||||
|
||||
q_st q_en strand ctg ctg_len r_st r_en blen-NM blen mapq cg:Z:cigar_str
|
||||
q_st q_en strand ctg ctg_len r_st r_en mlen blen mapq cg:Z:cigar_str
|
||||
|
||||
It is effectively the PAF format without the QueryName and QueryLength columns
|
||||
(the first two columns in PAF).
|
||||
|
||||
Function mappy.fastx_read
|
||||
~~~~~~~~~~~~~~~~~~~~~~~~~
|
||||
Miscellaneous Functions
|
||||
~~~~~~~~~~~~~~~~~~~~~~~
|
||||
|
||||
.. code:: python
|
||||
|
||||
mappy.fastx_read(fn)
|
||||
mappy.fastx_read(fn, read_comment=False)
|
||||
|
||||
This generator function opens a FASTA/FASTQ file and *yields* a
|
||||
:code:`(name,seq,qual)` tuple for each sequence entry. The input file may be
|
||||
optionally gzip'd.
|
||||
optionally gzip'd. If :code:`read_comment` is True, this generator yields
|
||||
a :code:`(name,seq,qual,comment)` tuple instead.
|
||||
|
||||
.. code:: python
|
||||
|
||||
mappy.revcomp(seq)
|
||||
|
||||
Return the reverse complement of DNA string :code:`seq`. This function
|
||||
recognizes IUB code and preserves the letter cases. Uracil :code:`U` is
|
||||
complemented to :code:`A`.
|
||||
|
||||
+85
-3
@@ -12,9 +12,10 @@ typedef struct {
|
||||
const char *ctg;
|
||||
int32_t ctg_start, ctg_end;
|
||||
int32_t qry_start, qry_end;
|
||||
int32_t blen, NM, ctg_len;
|
||||
int32_t blen, mlen, NM, ctg_len;
|
||||
uint8_t mapq, is_primary;
|
||||
int8_t strand, trans_strand;
|
||||
int32_t seg_id;
|
||||
int32_t n_cigar32;
|
||||
uint32_t *cigar32;
|
||||
} mm_hitpy_t;
|
||||
@@ -27,10 +28,12 @@ static inline void mm_reg2hitpy(const mm_idx_t *mi, mm_reg1_t *r, mm_hitpy_t *h)
|
||||
h->qry_start = r->qs, h->qry_end = r->qe;
|
||||
h->strand = r->rev? -1 : 1;
|
||||
h->mapq = r->mapq;
|
||||
h->blen = r->p->blen;
|
||||
h->NM = r->p->n_diff;
|
||||
h->mlen = r->mlen;
|
||||
h->blen = r->blen;
|
||||
h->NM = r->blen - r->mlen + r->p->n_ambi;
|
||||
h->trans_strand = r->p->trans_strand == 1? 1 : r->p->trans_strand == 2? -1 : 0;
|
||||
h->is_primary = (r->id == r->parent);
|
||||
h->seg_id = r->seg_id;
|
||||
h->n_cigar32 = r->p->n_cigar;
|
||||
h->cigar32 = r->p->cigar;
|
||||
}
|
||||
@@ -67,4 +70,83 @@ static inline void mm_reset_timer(void)
|
||||
mm_realtime0 = realtime();
|
||||
}
|
||||
|
||||
extern unsigned char seq_comp_table[256];
|
||||
static inline mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char* seqname, const char *seq1, const char *seq2, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt)
|
||||
{
|
||||
mm_reg1_t *r;
|
||||
|
||||
Py_BEGIN_ALLOW_THREADS
|
||||
if (seq2 == 0) {
|
||||
r = mm_map(mi, strlen(seq1), seq1, n_regs, b, opt, seqname);
|
||||
} else {
|
||||
int _n_regs[2];
|
||||
mm_reg1_t *regs[2];
|
||||
char *seq[2];
|
||||
int i, len[2];
|
||||
|
||||
len[0] = strlen(seq1);
|
||||
len[1] = strlen(seq2);
|
||||
seq[0] = (char*)seq1;
|
||||
seq[1] = strdup(seq2);
|
||||
for (i = 0; i < len[1]>>1; ++i) {
|
||||
int t = seq[1][len[1] - i - 1];
|
||||
seq[1][len[1] - i - 1] = seq_comp_table[(uint8_t)seq[1][i]];
|
||||
seq[1][i] = seq_comp_table[t];
|
||||
}
|
||||
if (len[1]&1) seq[1][len[1]>>1] = seq_comp_table[(uint8_t)seq[1][len[1]>>1]];
|
||||
mm_map_frag(mi, 2, len, (const char**)seq, _n_regs, regs, b, opt, seqname);
|
||||
for (i = 0; i < _n_regs[1]; ++i)
|
||||
regs[1][i].rev = !regs[1][i].rev;
|
||||
*n_regs = _n_regs[0] + _n_regs[1];
|
||||
regs[0] = (mm_reg1_t*)realloc(regs[0], sizeof(mm_reg1_t) * (*n_regs));
|
||||
memcpy(®s[0][_n_regs[0]], regs[1], _n_regs[1] * sizeof(mm_reg1_t));
|
||||
free(regs[1]);
|
||||
r = regs[0];
|
||||
}
|
||||
Py_END_ALLOW_THREADS
|
||||
|
||||
return r;
|
||||
}
|
||||
|
||||
static inline char *mappy_revcomp(int len, const uint8_t *seq)
|
||||
{
|
||||
int i;
|
||||
char *rev;
|
||||
rev = (char*)malloc(len + 1);
|
||||
for (i = 0; i < len; ++i)
|
||||
rev[len - i - 1] = seq_comp_table[seq[i]];
|
||||
rev[len] = 0;
|
||||
return rev;
|
||||
}
|
||||
|
||||
static char *mappy_fetch_seq(const mm_idx_t *mi, const char *name, int st, int en, int *len)
|
||||
{
|
||||
int i, rid;
|
||||
char *s;
|
||||
*len = 0;
|
||||
rid = mm_idx_name2id(mi, name);
|
||||
if (rid < 0) return 0;
|
||||
if ((uint32_t)st >= mi->seq[rid].len || st >= en) return 0;
|
||||
if (en < 0 || (uint32_t)en > mi->seq[rid].len)
|
||||
en = mi->seq[rid].len;
|
||||
s = (char*)malloc(en - st + 1);
|
||||
*len = mm_idx_getseq(mi, rid, st, en, (uint8_t*)s);
|
||||
for (i = 0; i < *len; ++i)
|
||||
s[i] = "ACGTN"[(uint8_t)s[i]];
|
||||
s[*len] = 0;
|
||||
return s;
|
||||
}
|
||||
|
||||
static mm_idx_t *mappy_idx_seq(int w, int k, int is_hpc, int bucket_bits, const char *seq, int len)
|
||||
{
|
||||
const char *fake_name = "N/A";
|
||||
char *s;
|
||||
mm_idx_t *mi;
|
||||
s = (char*)calloc(len + 1, 1);
|
||||
memcpy(s, seq, len);
|
||||
mi = mm_idx_str(w, k, is_hpc, bucket_bits, 1, (const char**)&s, (const char**)&fake_name);
|
||||
free(s);
|
||||
return mi;
|
||||
}
|
||||
|
||||
#endif
|
||||
|
||||
+56
-12
@@ -5,31 +5,65 @@ cdef extern from "minimap.h":
|
||||
# Options
|
||||
#
|
||||
ctypedef struct mm_idxopt_t:
|
||||
short k, w, is_hpc, bucket_bits
|
||||
int mini_batch_size
|
||||
short k, w, flag, bucket_bits
|
||||
int64_t mini_batch_size
|
||||
uint64_t batch_size
|
||||
|
||||
ctypedef struct mm_mapopt_t:
|
||||
int64_t flag
|
||||
int seed
|
||||
int sdust_thres
|
||||
int flag
|
||||
int bw
|
||||
|
||||
int max_qlen
|
||||
|
||||
int bw, bw_long
|
||||
int max_gap, max_gap_ref
|
||||
int max_chain_skip
|
||||
int max_frag_len
|
||||
int max_chain_skip, max_chain_iter
|
||||
int min_cnt
|
||||
int min_chain_score
|
||||
float chain_gap_scale
|
||||
float chain_skip_scale
|
||||
int rmq_size_cap, rmq_inner_dist
|
||||
int rmq_rescue_size
|
||||
float rmq_rescue_ratio
|
||||
|
||||
float mask_level
|
||||
int mask_len
|
||||
float pri_ratio
|
||||
int best_n
|
||||
int max_join_long, max_join_short
|
||||
int min_join_flank_sc
|
||||
|
||||
float alt_drop
|
||||
|
||||
int a, b, q, e, q2, e2
|
||||
int transition
|
||||
int sc_ambi
|
||||
int noncan
|
||||
int zdrop
|
||||
int junc_bonus, junc_pen
|
||||
int zdrop, zdrop_inv
|
||||
int end_bonus
|
||||
int min_dp_max
|
||||
int min_ksw_len
|
||||
int anchor_ext_len, anchor_ext_shift
|
||||
float max_clip_ratio
|
||||
|
||||
int rank_min_len
|
||||
float rank_frac
|
||||
|
||||
int pe_ori, pe_bonus
|
||||
|
||||
int jump_min_match;
|
||||
|
||||
float mid_occ_frac
|
||||
float q_occ_frac
|
||||
int32_t min_mid_occ
|
||||
int32_t mid_occ
|
||||
int mini_batch_size
|
||||
int32_t max_occ
|
||||
int64_t mini_batch_size
|
||||
int64_t max_sw_mat
|
||||
int64_t cap_kalloc
|
||||
|
||||
const char *split_prefix
|
||||
|
||||
int mm_set_opt(char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
|
||||
int mm_verbose
|
||||
@@ -46,12 +80,13 @@ cdef extern from "minimap.h":
|
||||
pass
|
||||
|
||||
ctypedef struct mm_idx_t:
|
||||
int32_t b, w, k, is_hpc
|
||||
int32_t b, w, k, flag
|
||||
uint32_t n_seq
|
||||
mm_idx_seq_t *seq
|
||||
uint32_t *S
|
||||
mm_idx_bucket_t *B
|
||||
void *km
|
||||
void *h
|
||||
|
||||
ctypedef struct mm_idx_reader_t:
|
||||
pass
|
||||
@@ -62,6 +97,8 @@ cdef extern from "minimap.h":
|
||||
void mm_idx_destroy(mm_idx_t *mi)
|
||||
void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
|
||||
|
||||
int mm_idx_index_name(mm_idx_t *mi)
|
||||
|
||||
#
|
||||
# Mapping (key struct defined in cmappy.h below)
|
||||
#
|
||||
@@ -73,7 +110,9 @@ cdef extern from "minimap.h":
|
||||
|
||||
mm_tbuf_t *mm_tbuf_init()
|
||||
void mm_tbuf_destroy(mm_tbuf_t *b)
|
||||
mm_reg1_t *mm_map(const mm_idx_t *mi, int l_seq, const char *seq, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *name)
|
||||
void *mm_tbuf_get_km(mm_tbuf_t *b)
|
||||
int mm_gen_cs(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int no_iden)
|
||||
int mm_gen_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq)
|
||||
|
||||
#
|
||||
# Helper header (because it is hard to expose mm_reg1_t with Cython)
|
||||
@@ -83,14 +122,18 @@ cdef extern from "cmappy.h":
|
||||
const char *ctg
|
||||
int32_t ctg_start, ctg_end
|
||||
int32_t qry_start, qry_end
|
||||
int32_t blen, NM, ctg_len
|
||||
int32_t blen, mlen, NM, ctg_len
|
||||
uint8_t mapq, is_primary
|
||||
int8_t strand, trans_strand
|
||||
int32_t seg_id
|
||||
int32_t n_cigar32
|
||||
uint32_t *cigar32
|
||||
|
||||
void mm_reg2hitpy(const mm_idx_t *mi, mm_reg1_t *r, mm_hitpy_t *h)
|
||||
void mm_free_reg1(mm_reg1_t *r)
|
||||
mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char* seqname, const char *seq1, const char *seq2, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt)
|
||||
char *mappy_fetch_seq(const mm_idx_t *mi, const char *name, int st, int en, int *l)
|
||||
mm_idx_t *mappy_idx_seq(int w, int k, int is_hpc, int bucket_bits, const char *seq, int l)
|
||||
|
||||
ctypedef struct kstring_t:
|
||||
unsigned l, m
|
||||
@@ -108,5 +151,6 @@ cdef extern from "cmappy.h":
|
||||
void mm_fastx_close(kseq_t *ks)
|
||||
int kseq_read(kseq_t *seq)
|
||||
|
||||
char *mappy_revcomp(int l, const uint8_t *seq)
|
||||
int mm_verbose_level(int v)
|
||||
void mm_reset_timer()
|
||||
|
||||
+156
-21
@@ -1,25 +1,33 @@
|
||||
from libc.stdint cimport uint8_t, int8_t
|
||||
from libc.stdlib cimport free
|
||||
cimport cmappy
|
||||
import sys
|
||||
|
||||
__version__ = '2.29'
|
||||
|
||||
cmappy.mm_reset_timer()
|
||||
|
||||
cdef class Alignment:
|
||||
cdef int _ctg_len, _r_st, _r_en
|
||||
cdef int _q_st, _q_en
|
||||
cdef int _NM, _blen
|
||||
cdef int _NM, _mlen, _blen
|
||||
cdef int8_t _strand, _trans_strand
|
||||
cdef uint8_t _mapq, _is_primary
|
||||
cdef _ctg, _cigar # these are python objects
|
||||
cdef int _seg_id
|
||||
cdef _ctg, _cigar, _cs, _MD # these are python objects
|
||||
|
||||
def __cinit__(self, ctg, cl, cs, ce, strand, qs, qe, mapq, cigar, is_primary, blen, NM, trans_strand):
|
||||
self._ctg, self._ctg_len, self._r_st, self._r_en = str(ctg), cl, cs, ce
|
||||
def __cinit__(self, ctg, cl, cs, ce, strand, qs, qe, mapq, cigar, is_primary, mlen, blen, NM, trans_strand, seg_id, cs_str, MD_str):
|
||||
self._ctg = ctg if isinstance(ctg, str) else ctg.decode()
|
||||
self._ctg_len, self._r_st, self._r_en = cl, cs, ce
|
||||
self._strand, self._q_st, self._q_en = strand, qs, qe
|
||||
self._NM, self._blen = NM, blen
|
||||
self._NM, self._mlen, self._blen = NM, mlen, blen
|
||||
self._mapq = mapq
|
||||
self._cigar = cigar
|
||||
self._is_primary = is_primary
|
||||
self._trans_strand = trans_strand
|
||||
self._seg_id = seg_id
|
||||
self._cs = cs_str
|
||||
self._MD = MD_str
|
||||
|
||||
@property
|
||||
def ctg(self): return self._ctg
|
||||
@@ -34,11 +42,17 @@ cdef class Alignment:
|
||||
def r_en(self): return self._r_en
|
||||
|
||||
@property
|
||||
def strand(self): return self.strand
|
||||
def strand(self): return self._strand
|
||||
|
||||
@property
|
||||
def trans_strand(self): return self._trans_strand
|
||||
|
||||
@property
|
||||
def blen(self): return self._blen
|
||||
|
||||
@property
|
||||
def mlen(self): return self._mlen
|
||||
|
||||
@property
|
||||
def NM(self): return self._NM
|
||||
|
||||
@@ -57,9 +71,18 @@ cdef class Alignment:
|
||||
@property
|
||||
def cigar(self): return self._cigar
|
||||
|
||||
@property
|
||||
def read_num(self): return self._seg_id + 1
|
||||
|
||||
@property
|
||||
def cs(self): return self._cs
|
||||
|
||||
@property
|
||||
def MD(self): return self._MD
|
||||
|
||||
@property
|
||||
def cigar_str(self):
|
||||
return "".join(map(lambda x: str(x[0]) + 'MIDNSH'[x[1]], self._cigar))
|
||||
return "".join(map(lambda x: str(x[0]) + 'MIDNSHP=XB'[x[1]], self._cigar))
|
||||
|
||||
def __str__(self):
|
||||
if self._strand > 0: strand = '+'
|
||||
@@ -70,8 +93,11 @@ cdef class Alignment:
|
||||
if self._trans_strand > 0: ts = 'ts:A:+'
|
||||
elif self._trans_strand < 0: ts = 'ts:A:-'
|
||||
else: ts = 'ts:A:.'
|
||||
return "\t".join([str(self._q_st), str(self._q_en), strand, self._ctg, str(self._ctg_len), str(self._r_st), str(self._r_en),
|
||||
str(self._blen - self._NM), str(self._blen), str(self._mapq), tp, ts, "cg:Z:" + self.cigar_str])
|
||||
a = [str(self._q_st), str(self._q_en), strand, self._ctg, str(self._ctg_len), str(self._r_st), str(self._r_en),
|
||||
str(self._mlen), str(self._blen), str(self._mapq), tp, ts, "cg:Z:" + self.cigar_str]
|
||||
if self._cs != "": a.append("cs:Z:" + self._cs)
|
||||
if self._MD != "": a.append("MD:Z:" + self._MD)
|
||||
return "\t".join(a)
|
||||
|
||||
cdef class ThreadBuffer:
|
||||
cdef cmappy.mm_tbuf_t *_b
|
||||
@@ -87,7 +113,8 @@ cdef class Aligner:
|
||||
cdef cmappy.mm_idxopt_t idx_opt
|
||||
cdef cmappy.mm_mapopt_t map_opt
|
||||
|
||||
def __cinit__(self, fn_idx_in, preset=None, k=None, w=None, min_cnt=None, min_chain_score=None, min_dp_score=None, bw=None, best_n=None, n_threads=3, fn_idx_out=None):
|
||||
def __cinit__(self, fn_idx_in=None, preset=None, k=None, w=None, min_cnt=None, min_chain_score=None, min_dp_score=None, bw=None, bw_long=None, best_n=None, n_threads=3, fn_idx_out=None, max_frag_len=None, extra_flags=None, seq=None, scoring=None, sc_ambi=None, max_chain_skip=None):
|
||||
self._idx = NULL
|
||||
cmappy.mm_set_opt(NULL, &self.idx_opt, &self.map_opt) # set the default options
|
||||
if preset is not None:
|
||||
cmappy.mm_set_opt(str.encode(preset), &self.idx_opt, &self.map_opt) # apply preset
|
||||
@@ -99,17 +126,37 @@ cdef class Aligner:
|
||||
if min_chain_score is not None: self.map_opt.min_chain_score = min_chain_score
|
||||
if min_dp_score is not None: self.map_opt.min_dp_max = min_dp_score
|
||||
if bw is not None: self.map_opt.bw = bw
|
||||
if best_n is not None: self.best_n = best_n
|
||||
if bw_long is not None: self.map_opt.bw_long = bw_long
|
||||
if best_n is not None: self.map_opt.best_n = best_n
|
||||
if max_frag_len is not None: self.map_opt.max_frag_len = max_frag_len
|
||||
if extra_flags is not None: self.map_opt.flag |= extra_flags
|
||||
if scoring is not None and len(scoring) >= 4:
|
||||
self.map_opt.a, self.map_opt.b = scoring[0], scoring[1]
|
||||
self.map_opt.q, self.map_opt.e = scoring[2], scoring[3]
|
||||
self.map_opt.q2, self.map_opt.e2 = self.map_opt.q, self.map_opt.e
|
||||
if len(scoring) >= 6:
|
||||
self.map_opt.q2, self.map_opt.e2 = scoring[4], scoring[5]
|
||||
if len(scoring) >= 7:
|
||||
self.map_opt.sc_ambi = scoring[6]
|
||||
if sc_ambi is not None: self.map_opt.sc_ambi = sc_ambi
|
||||
if max_chain_skip is not None: self.map_opt.max_chain_skip = max_chain_skip
|
||||
|
||||
cdef cmappy.mm_idx_reader_t *r;
|
||||
|
||||
if seq is None:
|
||||
if fn_idx_out is None:
|
||||
r = cmappy.mm_idx_reader_open(str.encode(fn_idx_in), &self.idx_opt, NULL)
|
||||
else:
|
||||
r = cmappy.mm_idx_reader_open(str.encode(fn_idx_in), &self.idx_opt, fn_idx_out)
|
||||
r = cmappy.mm_idx_reader_open(str.encode(fn_idx_in), &self.idx_opt, str.encode(fn_idx_out))
|
||||
if r is not NULL:
|
||||
self._idx = cmappy.mm_idx_reader_read(r, n_threads) # NB: ONLY read the first part
|
||||
cmappy.mm_idx_reader_close(r)
|
||||
cmappy.mm_mapopt_update(&self.map_opt, self._idx)
|
||||
cmappy.mm_idx_index_name(self._idx)
|
||||
else:
|
||||
self._idx = cmappy.mappy_idx_seq(self.idx_opt.w, self.idx_opt.k, self.idx_opt.flag&1, self.idx_opt.bucket_bits, str.encode(seq), len(seq))
|
||||
cmappy.mm_mapopt_update(&self.map_opt, self._idx)
|
||||
self.map_opt.mid_occ = 1000 # don't filter high-occ seeds
|
||||
|
||||
def __dealloc__(self):
|
||||
if self._idx is not NULL:
|
||||
@@ -118,37 +165,125 @@ cdef class Aligner:
|
||||
def __bool__(self):
|
||||
return (self._idx != NULL)
|
||||
|
||||
def map(self, seq, buf=None):
|
||||
def map(self, seq, seq2=None, name=None, buf=None, cs=False, MD=False, max_frag_len=None, extra_flags=None):
|
||||
cdef cmappy.mm_reg1_t *regs
|
||||
cdef cmappy.mm_hitpy_t h
|
||||
cdef ThreadBuffer b
|
||||
cdef int n_regs
|
||||
cdef char *cs_str = NULL
|
||||
cdef int l_cs_str, m_cs_str = 0
|
||||
cdef void *km
|
||||
cdef cmappy.mm_mapopt_t map_opt
|
||||
|
||||
if self._idx == NULL: return
|
||||
if ((self.map_opt.flag & 4) and (self._idx.flag & 2)): return
|
||||
map_opt = self.map_opt
|
||||
if max_frag_len is not None: map_opt.max_frag_len = max_frag_len
|
||||
if extra_flags is not None: map_opt.flag |= extra_flags
|
||||
|
||||
if self._idx is NULL: return None
|
||||
if buf is None: b = ThreadBuffer()
|
||||
else: b = buf
|
||||
regs = cmappy.mm_map(self._idx, len(seq), str.encode(seq), &n_regs, b._b, &self.map_opt, NULL)
|
||||
km = cmappy.mm_tbuf_get_km(b._b)
|
||||
|
||||
for i in range(n_regs):
|
||||
_seq = seq if isinstance(seq, bytes) else seq.encode()
|
||||
if name is not None:
|
||||
_name = name if isinstance(name, bytes) else name.encode()
|
||||
|
||||
if seq2 is None:
|
||||
if name is None:
|
||||
regs = cmappy.mm_map_aux(self._idx, NULL, _seq, NULL, &n_regs, b._b, &map_opt)
|
||||
else:
|
||||
regs = cmappy.mm_map_aux(self._idx, _name, _seq, NULL, &n_regs, b._b, &map_opt)
|
||||
else:
|
||||
_seq2 = seq2 if isinstance(seq2, bytes) else seq2.encode()
|
||||
if name is None:
|
||||
regs = cmappy.mm_map_aux(self._idx, NULL, _seq, _seq2, &n_regs, b._b, &map_opt)
|
||||
else:
|
||||
regs = cmappy.mm_map_aux(self._idx, _name, _seq, _seq2, &n_regs, b._b, &map_opt)
|
||||
|
||||
try:
|
||||
i = 0
|
||||
while i < n_regs:
|
||||
cmappy.mm_reg2hitpy(self._idx, ®s[i], &h)
|
||||
cigar = []
|
||||
for k in range(h.n_cigar32):
|
||||
cigar, _cs, _MD = [], '', ''
|
||||
for k in range(h.n_cigar32): # convert the 32-bit CIGAR encoding to Python array
|
||||
c = h.cigar32[k]
|
||||
cigar.append([c>>4, c&0xf])
|
||||
yield Alignment(h.ctg, h.ctg_len, h.ctg_start, h.ctg_end, h.strand, h.qry_start, h.qry_end, h.mapq, cigar, h.is_primary, h.blen, h.NM, h.trans_strand)
|
||||
if cs or MD: # generate the cs and/or the MD tag, if requested
|
||||
_cur_seq = _seq2 if h.seg_id > 0 and seq2 is not None else _seq
|
||||
if cs:
|
||||
l_cs_str = cmappy.mm_gen_cs(km, &cs_str, &m_cs_str, self._idx, ®s[i], _cur_seq, 1)
|
||||
_cs = cs_str[:l_cs_str] if isinstance(cs_str, str) else cs_str[:l_cs_str].decode()
|
||||
if MD:
|
||||
l_cs_str = cmappy.mm_gen_MD(km, &cs_str, &m_cs_str, self._idx, ®s[i], _cur_seq)
|
||||
_MD = cs_str[:l_cs_str] if isinstance(cs_str, str) else cs_str[:l_cs_str].decode()
|
||||
yield Alignment(h.ctg, h.ctg_len, h.ctg_start, h.ctg_end, h.strand, h.qry_start, h.qry_end, h.mapq, cigar, h.is_primary, h.mlen, h.blen, h.NM, h.trans_strand, h.seg_id, _cs, _MD)
|
||||
cmappy.mm_free_reg1(®s[i])
|
||||
i += 1
|
||||
finally:
|
||||
while i < n_regs:
|
||||
cmappy.mm_free_reg1(®s[i])
|
||||
i += 1
|
||||
free(regs)
|
||||
free(cs_str)
|
||||
|
||||
def fastx_read(fn):
|
||||
def seq(self, str name, int start=0, int end=0x7fffffff):
|
||||
cdef int l
|
||||
cdef char *s
|
||||
if self._idx == NULL: return
|
||||
if ((self.map_opt.flag & 4) and (self._idx.flag & 2)): return
|
||||
s = cmappy.mappy_fetch_seq(self._idx, name.encode(), start, end, &l)
|
||||
if l == 0: return None
|
||||
r = s[:l] if isinstance(s, str) else s[:l].decode()
|
||||
free(s)
|
||||
return r
|
||||
|
||||
@property
|
||||
def k(self): return self._idx.k
|
||||
|
||||
@property
|
||||
def w(self): return self._idx.w
|
||||
|
||||
@property
|
||||
def n_seq(self): return self._idx.n_seq
|
||||
|
||||
@property
|
||||
def seq_names(self):
|
||||
cdef char *p
|
||||
if self._idx == NULL: return
|
||||
sn = []
|
||||
for i in range(self._idx.n_seq):
|
||||
p = self._idx.seq[i].name
|
||||
s = p if isinstance(p, str) else p.decode()
|
||||
sn.append(s)
|
||||
return sn
|
||||
|
||||
def fastx_read(fn, read_comment=False):
|
||||
cdef cmappy.kseq_t *ks
|
||||
ks = cmappy.mm_fastx_open(str.encode(fn))
|
||||
if ks is NULL: return None
|
||||
while cmappy.kseq_read(ks) >= 0:
|
||||
if ks.qual.l > 0: qual = str(ks.qual.s)
|
||||
if ks.qual.l > 0: qual = ks.qual.s if isinstance(ks.qual.s, str) else ks.qual.s.decode()
|
||||
else: qual = None
|
||||
yield str(ks.name.s), str(ks.seq.s), qual
|
||||
name = ks.name.s if isinstance(ks.name.s, str) else ks.name.s.decode()
|
||||
seq = ks.seq.s if isinstance(ks.seq.s, str) else ks.seq.s.decode()
|
||||
if read_comment:
|
||||
if ks.comment.l > 0: comment = ks.comment.s if isinstance(ks.comment.s, str) else ks.comment.s.decode()
|
||||
else: comment = None
|
||||
yield name, seq, qual, comment
|
||||
else:
|
||||
yield name, seq, qual
|
||||
cmappy.mm_fastx_close(ks)
|
||||
|
||||
def revcomp(seq):
|
||||
l = len(seq)
|
||||
bseq = seq if isinstance(seq, bytes) else seq.encode()
|
||||
cdef char *s = cmappy.mappy_revcomp(l, bseq)
|
||||
r = s[:l] if isinstance(s, str) else s[:l].decode()
|
||||
free(s)
|
||||
return r
|
||||
|
||||
def verbose(v=None):
|
||||
if v is None: v = -1
|
||||
return cmappy.mm_verbose_level(v)
|
||||
|
||||
+10
-4
@@ -1,10 +1,11 @@
|
||||
#!/usr/bin/env python
|
||||
|
||||
import sys, getopt
|
||||
import sys
|
||||
import getopt
|
||||
import mappy as mp
|
||||
|
||||
def main(argv):
|
||||
opts, args = getopt.getopt(argv[1:], "x:n:m:k:w:r:")
|
||||
opts, args = getopt.getopt(argv[1:], "x:n:m:k:w:r:cM")
|
||||
if len(args) < 2:
|
||||
print("Usage: minimap2.py [options] <ref.fa>|<ref.mmi> <query.fq>")
|
||||
print("Options:")
|
||||
@@ -14,9 +15,12 @@ def main(argv):
|
||||
print(" -k INT k-mer length")
|
||||
print(" -w INT minimizer window length")
|
||||
print(" -r INT band width")
|
||||
print(" -c output the cs tag")
|
||||
print(" -M output the MD tag")
|
||||
sys.exit(1)
|
||||
|
||||
preset, min_cnt, min_sc, k, w, bw = None, None, None, None, None, None
|
||||
preset = min_cnt = min_sc = k = w = bw = None
|
||||
out_cs = out_MD = False
|
||||
for opt, arg in opts:
|
||||
if opt == '-x': preset = arg
|
||||
elif opt == '-n': min_cnt = int(arg)
|
||||
@@ -24,11 +28,13 @@ def main(argv):
|
||||
elif opt == '-r': bw = int(arg)
|
||||
elif opt == '-k': k = int(arg)
|
||||
elif opt == '-w': w = int(arg)
|
||||
elif opt == '-c': out_cs = True
|
||||
elif opt == '-M': out_MD = True
|
||||
|
||||
a = mp.Aligner(args[0], preset=preset, min_cnt=min_cnt, min_chain_score=min_sc, k=k, w=w, bw=bw)
|
||||
if not a: raise Exception("ERROR: failed to load/build index file '{}'".format(args[0]))
|
||||
for name, seq, qual in mp.fastx_read(args[1]): # read one sequence
|
||||
for h in a.map(seq): # traverse hits
|
||||
for h in a.map(seq, cs=out_cs, MD=out_MD): # traverse hits
|
||||
print('{}\t{}\t{}'.format(name, len(seq), h))
|
||||
|
||||
if __name__ == "__main__":
|
||||
|
||||
@@ -56,6 +56,7 @@ sdust_buf_t *sdust_buf_init(void *km)
|
||||
buf = (sdust_buf_t*)kcalloc(km, 1, sizeof(sdust_buf_t));
|
||||
buf->km = km;
|
||||
buf->w = kdq_init(int, buf->km);
|
||||
kdq_resize(int, buf->w, 8);
|
||||
return buf;
|
||||
}
|
||||
|
||||
@@ -69,10 +70,10 @@ void sdust_buf_destroy(sdust_buf_t *buf)
|
||||
static inline void shift_window(int t, kdq_t(int) *w, int T, int W, int *L, int *rw, int *rv, int *cw, int *cv)
|
||||
{
|
||||
int s;
|
||||
if (kdq_size(w) >= W - SD_WLEN + 1) { // TODO: is this right for SD_WLEN!=3?
|
||||
if ((int)kdq_size(w) >= W - SD_WLEN + 1) { // TODO: is this right for SD_WLEN!=3?
|
||||
s = *kdq_shift(int, w);
|
||||
*rw -= --cw[s];
|
||||
if (*L > kdq_size(w))
|
||||
if (*L > (int)kdq_size(w))
|
||||
--*L, *rv -= --cv[s];
|
||||
}
|
||||
kdq_push(int, w, t);
|
||||
@@ -113,7 +114,7 @@ static void find_perfect(void *km, perf_intv_v *P, const kdq_t(int) *w, int T, i
|
||||
r += c[t]++;
|
||||
new_r = r, new_l = kdq_size(w) - i - 1;
|
||||
if (new_r * 10 > T * new_l) {
|
||||
for (j = 0; j < P->n && P->a[j].start >= i + start; ++j) { // find insertion position
|
||||
for (j = 0; j < (int)P->n && P->a[j].start >= i + start; ++j) { // find insertion position
|
||||
perf_intv_t *p = &P->a[j];
|
||||
if (max_r == 0 || p->r * max_l > max_r * p->l)
|
||||
max_r = p->r, max_l = p->l;
|
||||
@@ -176,7 +177,7 @@ uint64_t *sdust(void *km, const uint8_t *seq, int l_seq, int T, int W, int *n)
|
||||
#ifdef _SDUST_MAIN
|
||||
#include <zlib.h>
|
||||
#include <stdio.h>
|
||||
#include "getopt.h"
|
||||
#include "ketopt.h"
|
||||
#include "kseq.h"
|
||||
KSEQ_INIT(gzFile, gzread)
|
||||
|
||||
@@ -185,16 +186,17 @@ int main(int argc, char *argv[])
|
||||
gzFile fp;
|
||||
kseq_t *ks;
|
||||
int W = 64, T = 20, c;
|
||||
ketopt_t o = KETOPT_INIT;
|
||||
|
||||
while ((c = getopt(argc, argv, "w:t:")) >= 0) {
|
||||
if (c == 'w') W = atoi(optarg);
|
||||
else if (c == 't') T = atoi(optarg);
|
||||
while ((c = ketopt(&o, argc, argv, 1, "w:t:", 0)) >= 0) {
|
||||
if (c == 'w') W = atoi(o.arg);
|
||||
else if (c == 't') T = atoi(o.arg);
|
||||
}
|
||||
if (optind == argc) {
|
||||
if (o.ind == argc) {
|
||||
fprintf(stderr, "Usage: sdust [-w %d] [-t %d] <in.fa>\n", W, T);
|
||||
return 1;
|
||||
}
|
||||
fp = strcmp(argv[optind], "-")? gzopen(argv[optind], "r") : gzdopen(fileno(stdin), "r");
|
||||
fp = strcmp(argv[o.ind], "-")? gzopen(argv[o.ind], "r") : gzdopen(fileno(stdin), "r");
|
||||
ks = kseq_init(fp);
|
||||
while (kseq_read(ks) >= 0) {
|
||||
uint64_t *r;
|
||||
|
||||
@@ -0,0 +1,132 @@
|
||||
#include "mmpriv.h"
|
||||
#include "kalloc.h"
|
||||
#include "ksort.h"
|
||||
|
||||
void mm_seed_mz_flt(void *km, mm128_v *mv, int32_t q_occ_max, float q_occ_frac)
|
||||
{
|
||||
mm128_t *a;
|
||||
size_t i, j, st;
|
||||
if (mv->n <= q_occ_max || q_occ_frac <= 0.0f || q_occ_max <= 0) return;
|
||||
a = Kmalloc(km, mm128_t, mv->n);
|
||||
for (i = 0; i < mv->n; ++i)
|
||||
a[i].x = mv->a[i].x, a[i].y = i;
|
||||
radix_sort_128x(a, a + mv->n);
|
||||
for (st = 0, i = 1; i <= mv->n; ++i) {
|
||||
if (i == mv->n || a[i].x != a[st].x) {
|
||||
int32_t cnt = i - st;
|
||||
if (cnt > q_occ_max && cnt > mv->n * q_occ_frac)
|
||||
for (j = st; j < i; ++j)
|
||||
mv->a[a[j].y].x = 0;
|
||||
st = i;
|
||||
}
|
||||
}
|
||||
kfree(km, a);
|
||||
for (i = j = 0; i < mv->n; ++i)
|
||||
if (mv->a[i].x != 0)
|
||||
mv->a[j++] = mv->a[i];
|
||||
mv->n = j;
|
||||
}
|
||||
|
||||
mm_seed_t *mm_seed_collect_all(void *km, const mm_idx_t *mi, const mm128_v *mv, int32_t *n_m_)
|
||||
{
|
||||
mm_seed_t *m;
|
||||
size_t i;
|
||||
int32_t k;
|
||||
m = (mm_seed_t*)kmalloc(km, mv->n * sizeof(mm_seed_t));
|
||||
for (i = k = 0; i < mv->n; ++i) {
|
||||
const uint64_t *cr;
|
||||
mm_seed_t *q;
|
||||
mm128_t *p = &mv->a[i];
|
||||
uint32_t q_pos = (uint32_t)p->y, q_span = p->x & 0xff;
|
||||
int t;
|
||||
cr = mm_idx_get(mi, p->x>>8, &t);
|
||||
if (t == 0) continue;
|
||||
q = &m[k++];
|
||||
q->q_pos = q_pos, q->q_span = q_span, q->cr = cr, q->n = t, q->seg_id = p->y >> 32;
|
||||
q->is_tandem = q->flt = 0;
|
||||
if (i > 0 && p->x>>8 == mv->a[i - 1].x>>8) q->is_tandem = 1;
|
||||
if (i < mv->n - 1 && p->x>>8 == mv->a[i + 1].x>>8) q->is_tandem = 1;
|
||||
}
|
||||
*n_m_ = k;
|
||||
return m;
|
||||
}
|
||||
|
||||
#define MAX_MAX_HIGH_OCC 128
|
||||
|
||||
void mm_seed_select(int32_t n, mm_seed_t *a, int len, int max_occ, int max_max_occ, int dist)
|
||||
{ // for high-occ minimizers, choose up to max_high_occ in each high-occ streak
|
||||
extern void ks_heapdown_uint64_t(size_t i, size_t n, uint64_t*);
|
||||
extern void ks_heapmake_uint64_t(size_t n, uint64_t*);
|
||||
int32_t i, last0, m;
|
||||
uint64_t b[MAX_MAX_HIGH_OCC]; // this is to avoid a heap allocation
|
||||
|
||||
if (n == 0 || n == 1) return;
|
||||
for (i = m = 0; i < n; ++i)
|
||||
if (a[i].n > max_occ) ++m;
|
||||
if (m == 0) return; // no high-frequency k-mers; do nothing
|
||||
for (i = 0, last0 = -1; i <= n; ++i) {
|
||||
if (i == n || a[i].n <= max_occ) {
|
||||
if (i - last0 > 1) {
|
||||
int32_t ps = last0 < 0? 0 : (uint32_t)a[last0].q_pos>>1;
|
||||
int32_t pe = i == n? len : (uint32_t)a[i].q_pos>>1;
|
||||
int32_t j, k, st = last0 + 1, en = i;
|
||||
int32_t max_high_occ = (int32_t)((double)(pe - ps) / dist + .499);
|
||||
if (max_high_occ > 0) {
|
||||
if (max_high_occ > MAX_MAX_HIGH_OCC)
|
||||
max_high_occ = MAX_MAX_HIGH_OCC;
|
||||
for (j = st, k = 0; j < en && k < max_high_occ; ++j, ++k)
|
||||
b[k] = (uint64_t)a[j].n<<32 | j;
|
||||
ks_heapmake_uint64_t(k, b); // initialize the binomial heap
|
||||
for (; j < en; ++j) { // if there are more, choose top max_high_occ
|
||||
if (a[j].n < (int32_t)(b[0]>>32)) { // then update the heap
|
||||
b[0] = (uint64_t)a[j].n<<32 | j;
|
||||
ks_heapdown_uint64_t(0, k, b);
|
||||
}
|
||||
}
|
||||
for (j = 0; j < k; ++j) a[(uint32_t)b[j]].flt = 1;
|
||||
}
|
||||
for (j = st; j < en; ++j) a[j].flt ^= 1;
|
||||
for (j = st; j < en; ++j)
|
||||
if (a[j].n > max_max_occ)
|
||||
a[j].flt = 1;
|
||||
}
|
||||
last0 = i;
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
mm_seed_t *mm_collect_matches(void *km, int *_n_m, int qlen, int max_occ, int max_max_occ, int dist, const mm_idx_t *mi, const mm128_v *mv, int64_t *n_a, int *rep_len, int *n_mini_pos, uint64_t **mini_pos)
|
||||
{
|
||||
int rep_st = 0, rep_en = 0, n_m, n_m0;
|
||||
size_t i;
|
||||
mm_seed_t *m;
|
||||
*n_mini_pos = 0;
|
||||
*mini_pos = (uint64_t*)kmalloc(km, mv->n * sizeof(uint64_t));
|
||||
m = mm_seed_collect_all(km, mi, mv, &n_m0);
|
||||
if (dist > 0 && max_max_occ > max_occ) {
|
||||
mm_seed_select(n_m0, m, qlen, max_occ, max_max_occ, dist);
|
||||
} else {
|
||||
for (i = 0; i < n_m0; ++i)
|
||||
if (m[i].n > max_occ)
|
||||
m[i].flt = 1;
|
||||
}
|
||||
for (i = 0, n_m = 0, *rep_len = 0, *n_a = 0; i < n_m0; ++i) {
|
||||
mm_seed_t *q = &m[i];
|
||||
if (mm_dbg_flag & MM_DBG_SEED_FREQ)
|
||||
fprintf(stderr, "SF\t%d\t%d\t%d\n", q->q_pos>>1, q->n, q->flt);
|
||||
if (q->flt) {
|
||||
int en = (q->q_pos >> 1) + 1, st = en - q->q_span;
|
||||
if (st > rep_en) {
|
||||
*rep_len += rep_en - rep_st;
|
||||
rep_st = st, rep_en = en;
|
||||
} else rep_en = en;
|
||||
} else {
|
||||
*n_a += q->n;
|
||||
(*mini_pos)[(*n_mini_pos)++] = (uint64_t)q->q_span<<32 | q->q_pos>>1;
|
||||
m[n_m++] = *q;
|
||||
}
|
||||
}
|
||||
*rep_len += rep_en - rep_st;
|
||||
*_n_m = n_m;
|
||||
return m;
|
||||
}
|
||||
@@ -4,26 +4,26 @@ except ImportError:
|
||||
from distutils.core import setup
|
||||
from distutils.extension import Extension
|
||||
|
||||
cmdclass = {}
|
||||
import sys, platform
|
||||
|
||||
try:
|
||||
from Cython.Build import build_ext
|
||||
except ImportError: # without Cython
|
||||
module_src = 'python/mappy.c'
|
||||
else: # with Cython
|
||||
module_src = 'python/mappy.pyx'
|
||||
cmdclass['build_ext'] = build_ext
|
||||
|
||||
import sys
|
||||
sys.path.append('python')
|
||||
|
||||
extra_compile_args = ['-DHAVE_KALLOC']
|
||||
include_dirs = ["."]
|
||||
|
||||
if platform.machine() in ["aarch64", "arm64"]:
|
||||
include_dirs.append("sse2neon/")
|
||||
extra_compile_args.extend(['-ftree-vectorize', '-DKSW_SSE2_ONLY', '-D__SSE2__'])
|
||||
else:
|
||||
extra_compile_args.append('-msse4.1') # WARNING: ancient x86_64 CPUs don't have SSE4
|
||||
|
||||
def readme():
|
||||
with open('python/README.rst') as f:
|
||||
return f.read()
|
||||
|
||||
setup(
|
||||
name = 'mappy',
|
||||
version = '2.2',
|
||||
version = '2.29',
|
||||
url = 'https://github.com/lh3/minimap2',
|
||||
description = 'Minimap2 python binding',
|
||||
long_description = readme(),
|
||||
@@ -33,17 +33,17 @@ setup(
|
||||
keywords = 'sequence-alignment',
|
||||
scripts = ['python/minimap2.py'],
|
||||
ext_modules = [Extension('mappy',
|
||||
sources = [module_src, 'align.c', 'bseq.c', 'chain.c', 'format.c', 'hit.c', 'index.c',
|
||||
sources = ['python/mappy.pyx', 'align.c', 'bseq.c', 'lchain.c', 'seed.c', 'format.c', 'hit.c', 'index.c', 'pe.c', 'jump.c', 'options.c',
|
||||
'ksw2_extd2_sse.c', 'ksw2_exts2_sse.c', 'ksw2_extz2_sse.c', 'ksw2_ll_sse.c',
|
||||
'kalloc.c', 'kthread.c', 'map.c', 'misc.c', 'sdust.c', 'sketch.c'],
|
||||
'kalloc.c', 'kthread.c', 'map.c', 'misc.c', 'sdust.c', 'sketch.c', 'esterr.c', 'splitidx.c'],
|
||||
depends = ['minimap.h', 'bseq.h', 'kalloc.h', 'kdq.h', 'khash.h', 'kseq.h', 'ksort.h',
|
||||
'ksw2.h', 'kthread.h', 'kvec.h', 'mmpriv.h', 'sdust.h',
|
||||
'python/cmappy.h', 'python/cmappy.pxd'],
|
||||
extra_compile_args = ['-msse4'], # WARNING: ancient x86_64 CPUs don't have SSE4
|
||||
include_dirs = ['.'],
|
||||
extra_compile_args = extra_compile_args,
|
||||
include_dirs = include_dirs,
|
||||
libraries = ['z', 'm', 'pthread'])],
|
||||
classifiers = [
|
||||
'Development Status :: 4 - Beta',
|
||||
'Development Status :: 5 - Production/Stable',
|
||||
'License :: OSI Approved :: MIT License',
|
||||
'Operating System :: POSIX',
|
||||
'Programming Language :: C',
|
||||
@@ -52,4 +52,4 @@ setup(
|
||||
'Programming Language :: Python :: 3',
|
||||
'Intended Audience :: Science/Research',
|
||||
'Topic :: Scientific/Engineering :: Bio-Informatics'],
|
||||
cmdclass = cmdclass)
|
||||
setup_requires=["cython"])
|
||||
|
||||
@@ -2,8 +2,9 @@
|
||||
#include <stdlib.h>
|
||||
#include <assert.h>
|
||||
#include <string.h>
|
||||
#define __STDC_LIMIT_MACROS
|
||||
#include "kvec.h"
|
||||
#include "minimap.h"
|
||||
#include "mmpriv.h"
|
||||
|
||||
unsigned char seq_nt4_table[256] = {
|
||||
0, 1, 2, 3, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
|
||||
@@ -11,9 +12,9 @@ unsigned char seq_nt4_table[256] = {
|
||||
4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
|
||||
4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
|
||||
4, 0, 4, 1, 4, 4, 4, 2, 4, 4, 4, 4, 4, 4, 4, 4,
|
||||
4, 4, 4, 4, 3, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
|
||||
4, 4, 4, 4, 3, 3, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
|
||||
4, 0, 4, 1, 4, 4, 4, 2, 4, 4, 4, 4, 4, 4, 4, 4,
|
||||
4, 4, 4, 4, 3, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
|
||||
4, 4, 4, 4, 3, 3, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
|
||||
4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
|
||||
4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
|
||||
4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
|
||||
@@ -101,34 +102,34 @@ void mm_sketch(void *km, const char *str, int len, int w, int k, uint32_t rid, i
|
||||
tq_push(&tq, skip_len);
|
||||
kmer_span += skip_len;
|
||||
if (tq.count > k) kmer_span -= tq_shift(&tq);
|
||||
if (kmer_span >= 256) continue; // make sure $kmer_span does not take more than 8 bits
|
||||
} else kmer_span = l + 1 < k? l + 1 : k;
|
||||
kmer[0] = (kmer[0] << 2 | c) & mask; // forward k-mer
|
||||
kmer[1] = (kmer[1] >> 2) | (3ULL^c) << shift1; // reverse k-mer
|
||||
if (kmer[0] == kmer[1]) continue; // skip "symmetric k-mers" as we don't know it strand
|
||||
z = kmer[0] < kmer[1]? 0 : 1; // strand
|
||||
if (++l >= k) {
|
||||
++l;
|
||||
if (l >= k && kmer_span < 256) {
|
||||
info.x = hash64(kmer[z], mask) << 8 | kmer_span;
|
||||
info.y = (uint64_t)rid<<32 | (uint32_t)i<<1 | z;
|
||||
}
|
||||
} else l = 0, tq.count = tq.front = 0, kmer_span = 0;
|
||||
buf[buf_pos] = info; // need to do this here as appropriate buf_pos and buf[buf_pos] are needed below
|
||||
if (l == w + k - 1) { // special case for the first window - because identical k-mers are not stored yet
|
||||
if (l == w + k - 1 && min.x != UINT64_MAX) { // special case for the first window - because identical k-mers are not stored yet
|
||||
for (j = buf_pos + 1; j < w; ++j)
|
||||
if (min.x == buf[j].x && buf[j].y != min.y) kv_push(mm128_t, km, *p, buf[j]);
|
||||
for (j = 0; j < buf_pos; ++j)
|
||||
if (min.x == buf[j].x && buf[j].y != min.y) kv_push(mm128_t, km, *p, buf[j]);
|
||||
}
|
||||
if (info.x <= min.x) { // a new minimum; then write the old min
|
||||
if (l >= w + k) kv_push(mm128_t, km, *p, min);
|
||||
if (l >= w + k && min.x != UINT64_MAX) kv_push(mm128_t, km, *p, min);
|
||||
min = info, min_pos = buf_pos;
|
||||
} else if (buf_pos == min_pos) { // old min has moved outside the window
|
||||
if (l >= w + k - 1) kv_push(mm128_t, km, *p, min);
|
||||
if (l >= w + k - 1 && min.x != UINT64_MAX) kv_push(mm128_t, km, *p, min);
|
||||
for (j = buf_pos + 1, min.x = UINT64_MAX; j < w; ++j) // the two loops are necessary when there are identical k-mers
|
||||
if (min.x >= buf[j].x) min = buf[j], min_pos = j; // >= is important s.t. min is always the closest k-mer
|
||||
for (j = 0; j <= buf_pos; ++j)
|
||||
if (min.x >= buf[j].x) min = buf[j], min_pos = j;
|
||||
if (l >= w + k - 1) { // write identical k-mers
|
||||
if (l >= w + k - 1 && min.x != UINT64_MAX) { // write identical k-mers
|
||||
for (j = buf_pos + 1; j < w; ++j) // these two loops make sure the output is sorted
|
||||
if (min.x == buf[j].x && min.y != buf[j].y) kv_push(mm128_t, km, *p, buf[j]);
|
||||
for (j = 0; j <= buf_pos; ++j)
|
||||
|
||||
+84
@@ -0,0 +1,84 @@
|
||||
#include <string.h>
|
||||
#include <assert.h>
|
||||
#include <stdlib.h>
|
||||
#include <stdio.h>
|
||||
#include <errno.h>
|
||||
#include "mmpriv.h"
|
||||
|
||||
FILE *mm_split_init(const char *prefix, const mm_idx_t *mi)
|
||||
{
|
||||
char *fn;
|
||||
FILE *fp;
|
||||
uint32_t i, k = mi->k;
|
||||
fn = (char*)calloc(strlen(prefix) + 10, 1);
|
||||
sprintf(fn, "%s.%.4d.tmp", prefix, mi->index);
|
||||
if ((fp = fopen(fn, "wb")) == NULL) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "[ERROR]\033[1;31m failed to write to temporary file '%s'\033[0m: %s\n", fn, strerror(errno));
|
||||
exit(1);
|
||||
}
|
||||
mm_err_fwrite(&k, 4, 1, fp);
|
||||
mm_err_fwrite(&mi->n_seq, 4, 1, fp);
|
||||
for (i = 0; i < mi->n_seq; ++i) {
|
||||
uint32_t l;
|
||||
l = strlen(mi->seq[i].name);
|
||||
mm_err_fwrite(&l, 1, 4, fp);
|
||||
mm_err_fwrite(mi->seq[i].name, 1, l, fp);
|
||||
mm_err_fwrite(&mi->seq[i].len, 4, 1, fp);
|
||||
}
|
||||
free(fn);
|
||||
return fp;
|
||||
}
|
||||
|
||||
mm_idx_t *mm_split_merge_prep(const char *prefix, int n_splits, FILE **fp, uint32_t *n_seq_part)
|
||||
{
|
||||
mm_idx_t *mi = 0;
|
||||
char *fn;
|
||||
int i, j;
|
||||
|
||||
if (n_splits < 1) return 0;
|
||||
fn = CALLOC(char, strlen(prefix) + 10);
|
||||
for (i = 0; i < n_splits; ++i) {
|
||||
sprintf(fn, "%s.%.4d.tmp", prefix, i);
|
||||
if ((fp[i] = fopen(fn, "rb")) == 0) {
|
||||
if (mm_verbose >= 1)
|
||||
fprintf(stderr, "ERROR: failed to open temporary file '%s': %s\n", fn, strerror(errno));
|
||||
for (j = 0; j < i; ++j)
|
||||
fclose(fp[j]);
|
||||
free(fn);
|
||||
return 0;
|
||||
}
|
||||
}
|
||||
free(fn);
|
||||
|
||||
mi = CALLOC(mm_idx_t, 1);
|
||||
for (i = 0; i < n_splits; ++i) {
|
||||
mm_err_fread(&mi->k, 4, 1, fp[i]); // TODO: check if k is all the same
|
||||
mm_err_fread(&n_seq_part[i], 4, 1, fp[i]);
|
||||
mi->n_seq += n_seq_part[i];
|
||||
}
|
||||
mi->seq = CALLOC(mm_idx_seq_t, mi->n_seq);
|
||||
for (i = j = 0; i < n_splits; ++i) {
|
||||
uint32_t k;
|
||||
for (k = 0; k < n_seq_part[i]; ++k, ++j) {
|
||||
uint32_t l;
|
||||
mm_err_fread(&l, 1, 4, fp[i]);
|
||||
mi->seq[j].name = (char*)calloc(l + 1, 1);
|
||||
mm_err_fread(mi->seq[j].name, 1, l, fp[i]);
|
||||
mm_err_fread(&mi->seq[j].len, 4, 1, fp[i]);
|
||||
}
|
||||
}
|
||||
return mi;
|
||||
}
|
||||
|
||||
void mm_split_rm_tmp(const char *prefix, int n_splits)
|
||||
{
|
||||
int i;
|
||||
char *fn;
|
||||
fn = CALLOC(char, strlen(prefix) + 10);
|
||||
for (i = 0; i < n_splits; ++i) {
|
||||
sprintf(fn, "%s.%.4d.tmp", prefix, i);
|
||||
remove(fn);
|
||||
}
|
||||
free(fn);
|
||||
}
|
||||
File diff suppressed because it is too large
Load Diff
+1
-1
@@ -1,4 +1,4 @@
|
||||
>MT_orang
|
||||
>MT_orang co:Z:comment
|
||||
GTTTATGTAGCTTATTCTATCCAAAGCAATGCACTGAAAATGTCTCGACGGGCCCACACG
|
||||
CCCCATAAACAAATAGGTTTGGTCCTAGCCTTTCTATTAGCTCTTAGTGAGGTTACACAT
|
||||
GCAAGCATCCCCGCCCCAGTGAGTCGCCCTCCAAGTCACTCTGACTAAGAGGAGCAAGCA
|
||||
|
||||
File diff suppressed because one or more lines are too long
+127
@@ -0,0 +1,127 @@
|
||||
>ref
|
||||
TGCGGAGGCTGAAGCAACTCCATCTTGGAAGCTAATCTACCATGTTGGCTTCTGATTAAC
|
||||
ATCAGTTCTGGGAAGGCTTGTAAGATTTCCTGTTTGTCTATTATTTCCTAGGTAAGAGCA
|
||||
GATACTTACTGTAAATCCTGCCCCTAGATTAAACAACCTTGGTGTTATCGTACTTCCATT
|
||||
GTCCTATACATCCCTTCGGAATCCCCCTTTCCCTATGGTCCTCAAGCCCTTGGTCTGGGG
|
||||
AGTAACAGCATAGGGATCAACCATCTCGTCTTGCCACTGCCCGAAATACAGACATGGCTT
|
||||
CTGTTCCTAAGTCCCTATTCAACTTTTCTTTCTAAGAAACTGGATTTGTCAGCCTCTTTC
|
||||
TTCACCTCTCAGCTTCCTTGGACTTTGGGGGTAGGTTTGCGTAGACATGCTCACCACAGA
|
||||
CACAATATCAGCTTCATTCTACAGATGAGGAAGGCAAGCCTTGGGGAGCTTAACCAACTT
|
||||
GTCGAGACTCATGTATATACCAACACTGAAAAGCAGATATTCCAGACTCCCAGTCATGCC
|
||||
ACAGGCACACCCCTCAGTGAGAGGTGGGGTTTGTAGTTGAGGCTATTTCCTGCCCAGGGA
|
||||
GCAGGGAGGCACTCTAGCTTCCCTGAGCTAACGTGGTTCTGCTTGTGTCTGACTTCCAGG
|
||||
TCTCTGCCCTTTCCAAGCTCACTAGGATGGGCTTCGGGTGTGTCAAATGCCTCAGACAGT
|
||||
ACAGATCCACACAGAATGGGCATATGCAACCAATCAGTGTCATAAAAAAGAAGGAAATGA
|
||||
CTCGGGCCCCCTGTGTGTTCAACATGTCGAAGGTATCTGTGCAGCAGAAGAAAGAGGGGC
|
||||
AAAAGCCCCCAGTGCCACAGGCCAGAGGCAGCAGCTTGGGCCCATGTGGGAGGGTTTGCT
|
||||
TTCCCCTGCCAAAGTGATGGGCTGCTGCAGCCTGGGGCTTGTGGGAATCCTTCCTGGGCC
|
||||
TGTGTGGGAAGTGTAGGCAGGGAGAGTGCTGCTTTCCCAAGCTCATCCCAGCTACAGCTA
|
||||
CCTTTGTGCTCTGGGATTCAGGACCCCCGAGGGGGCTGGCAGGAGAGTCTCTGTTCTCGG
|
||||
ATGGGTTGTCACCAGGGCATACATGGGAAGTGGGCTCTCTGGAGTCACCCTCCAGGGGAC
|
||||
AATGCCAATTCCAGACACATTTACTGGAACCCCTACACTGATGACCTTTTGTTGAGGGTT
|
||||
GAATTATGTCCCCAAAAAAGATACATTGAAGTCCAAACCTCTGGTGTCTATAAATGTGAT
|
||||
TTTATTTGAAAATGAGGTTTCTATGGACTAAATTGTGTCCCTCCCAAATTCATATTTTGA
|
||||
AGCCCTAGCCCCCAGTGTGACTATACCTAGAGACAGAGATCTTTAGGAGGTAATTAAGGT
|
||||
TCAATGAGGTCAGGTGGGTGGGGCCCTAAACCAACAGGAAGGACTGTGGCCTTACTAGAA
|
||||
AAGGAAGAAAAAGCATTTCCTCTCTTCTAGTATAAAAGGACACAGAAAGAAGGCAGATAT
|
||||
CTACAAGCCACGAAGAGAGACGTCACTGAGAACTGAATTTGTGTACATTGATCTGGAACT
|
||||
TCCAGCCTCCAGAACTTGAGAAATACATTTCTGTTGTTTATTTTTTTTTCATGTAATCAA
|
||||
TTCATTTATCATATATTTATTGAGTGCCTACTATGTGCCAGAGGATACAGCAGTAACAAA
|
||||
ACTAGGCAAAAATTGTGCCTAAAAGAGGGAAGATGACTTTTCTTAAAGTGTGGAATAAAG
|
||||
AAAAGTAAGATAGCGGATAGAAGCTTGAAGTGAAAGCAGGTTCACAGGAAGTTTCTTTGG
|
||||
TCATTTGTTTTGTTTTTAAATAGTGGAAAGATGTATATGTTTATGGAGAAAGATTGCCTT
|
||||
GAAGATGCAAGAGGAAGAGATGATCAAAATTCAAGAAGAAGCAGAAAGTGATAGAATAAA
|
||||
GAGCACAAGTGGAGAATTAGTGTTAATGAAAAGAAGGATGCTTCCTTTGATATGAAGTGA
|
||||
AGGAAGAGAGAATGAGTAAAGACCAAGACTTGAAGTCCCTAGTTTAATAGAGGGAGATTT
|
||||
CTTCTTTTGATAGCAACAATGGTATTCTGAATTATTTGAAGACATGTCATATTTCTCTTG
|
||||
TGCCATTTTCCTCCCAGTTTAAACATTCTCATAACCTCTATTCCTCACATGATGTTTTTC
|
||||
CAGGTCCTTTATTCTTTGGCACTCTCTTCTCTGGACACATTGTATTCTGTCATTGGTCCT
|
||||
AAAATTTAGATACCCACAATTGAACATACTCCTCTAGATATGGTCTAGCTAATGCAAAAG
|
||||
AACTGCTGCCTTCCAACTTGTTCAGACATCATATGTTTGTTGTCAAACGCTAAGTTGAGT
|
||||
TGTTATCTTTTAAGTTTTGTTTTTGTTTTTTTTTTTTTTTTTTAATTCCAAGAGGTGCCC
|
||||
ACGTTGGCTAAGTACCAAACAGGGTACTAGGGAATTTTACTTCTGAGTTAAATGCCATTC
|
||||
TAGTTGTTTTTTCTTCATCTCCAGTAAGGTTATCTTTATTCACCAGTTGTTACAATAGCT
|
||||
GTGGGTCTTGCTTCTCACAGTTTTATGCTGTCTGTGCTATTTTCTCTACTGATCATCACC
|
||||
ACAATCATTATTGCTTATCATAATTGTTATCTTTATTTTCTCCTTTAATCAAGAATCAGT
|
||||
CTTCCTTTATCTCATTATTCTCTTTTGCAGGCTTCAGGATAATTATGGTTGGAGTGCACT
|
||||
GGGGGAACCAGTGCAGCTAAGCTCTGACATCTTTGCATCCCTTTTCCATCTGCTGTTTTG
|
||||
GCACTCTGGTAGAATAGATAACCTAAAAACGACTTTAAAACATCTAGAAATTTTGGATAA
|
||||
AATATAACAAACATCCCTTTAAATGCACAACTGATCTTCCATGGAAGTCACAGAAATATA
|
||||
TAACGCCAAAAAGAAGGGAAGCTGAAACCCAGGGCTGTAAACATGAACATCATCTTCTCT
|
||||
CCCTTTTTCTTGTGACTTATCTTGTTTTTCTCAGCTTTGGTGCTACCAAGGCTTGACTTT
|
||||
AATAGGCATTTCCAATCAATGAGAGAATTTCTTTTGCTTTCATCAACAATTCAGTTATTG
|
||||
ATGTTAACATATATATCATTTGAGTACTTTTCTTTTTTTTATTATTATTATACTTTAAGT
|
||||
TTTAGGGTCCATGTGCACAATGTGCAGGTTAGTTACGTATGTATACATGTGCCATGCTGG
|
||||
TGTGCTGCACCCATTAACTCATCATTTAGCATTAGGTATATCTCCTAATGCTATCCCTTC
|
||||
CCCCTCTCCCCACCCCACAACAGTCCCCAGAGTGTTCCCCTTCCTGTGTCCATGTGTTCT
|
||||
CATTGTTCAATCCCCATCTATGAGTGAGAACATGCGGTGTTTGGTTTTTTGTCCTTGCAA
|
||||
TAGTTTACTGAGAATGATGATTTCTAATTTCATCCATGTCCCTAAAGAGCTTCTGCACAG
|
||||
CAAAAGAAACTACCATCAGAGTGAACAGGCAACCTACAAAATGGGAGAAAATTTTCACAA
|
||||
CCTGCTCATCTGACAAAGGGCTAATATCCAGAATCTACAATGAACTCAAACAAATTTACA
|
||||
AGAAAAAAACAAACAACCCCATCAAAAAGTGGGCAAAGGATATGAACAGACACTTCTCAA
|
||||
AAGAAGACATTTATGCAGCCAAAAGACACATGAAAAAATGCTCATCATCACTGGCCATCA
|
||||
GAGAAATGCAAACCAAAACCACAATGAGATACCATCTCACACCAGTTAAAATGGCAATCA
|
||||
TTAAAAAGTCAGGAAACAACAGGTGCTGGAGAGGATGTGGAGAAACAGGAACACTTTTAC
|
||||
ACTGTTGGTGGGACTGTAAACTAGTTCAACCATTGTGGAAGTCAGTGTGCTGATTCCTCA
|
||||
GGGATCTAGAACTAGAAATACCATTTGACCCAGCCATCCCATTACTGGGTATATACCCAA
|
||||
AGGACTATAAATCATGCTGCTATAAAGACACATGCACACGTATGTTTATTGCGGCACTAT
|
||||
TCACAATAGCAAAGACTTGGAACCAACCCAAATGTCCAACAATGATAGACTGGATTAAGA
|
||||
AAATGTGGCACATATACACCACGGAATACTGTGCAGCCATAAAAAATGATGAGTTCATGT
|
||||
CCTTTGTAGGGACACGGATGAAATTGGAAATCATTTCTGTTGTTTAAACCACGAAGTCTA
|
||||
TGGTATCTGGTTATGACAACCTGAGAATACTAACTCAAGGGTCTTTCGCAGATGTCATTA
|
||||
AGTTGTTAAAGTGAGGTCATTATGGTGGGTCCTAATCCAAGAGAAGAGATGCATGGACAG
|
||||
ACGTGCACAACGGGAGGACCAAGCCAAGACACACAGGGAGAATGGCCATGGGAAGATGGA
|
||||
GGCAGAGATCAAAGTGAGGCACCCACAAGCCAAGAAATGGCAGGAGCTACCAGCAGCTGG
|
||||
AAGATGCAGAGAAGCATTCCTTCTTAGAGGTTTCAGAGAGAGTATGGTGCTACTGACACC
|
||||
TTGATTTTGAACTTCTAGTCTCCAGAACTATGAGAGAATAAATTTCTGTTGGTTAAGCCA
|
||||
TCGAGTTTGTGTAAGTTTGTTATAAGAGCCCTAGGAAATAAACATATCCATTTATTCAGG
|
||||
AAAGCCTGCTAGAGTGCAAATATTTGGAAAAGATACTACTATGCAAATGTTTGAAAAAGA
|
||||
TATTGCTCTTGATTCTGCCTTATGGGTTTTTCATTTCTGTAAGCTATTCTCAAAGTTTTG
|
||||
TTCTTGGACTACTATTGGTAATTAAGACTGCAACATGTTTGGCAACATCAGTTGAGAACT
|
||||
GTTGCTCTGGGAACGTTTTCGGCAAGCCTCAGCCCTTCTTTTCCCTTGGCTTGCATTGAG
|
||||
GAGTTAGGTGATACTCTGCTGCTCAGGCCCAGCACCTTTATGGACCGTATTCCCCTGGTG
|
||||
GAATGACCATCTCTGCTTGCTCTGATTGGCTGTTGGGGTTTTCTAGCATGCCCTATTTAA
|
||||
TATGTATGATTTATCTCTTACTTCAGTTGGAAGGTACAGTTGCTCTGTAGTTGGCATGCA
|
||||
GTCATGGTGACTATGAAAATATAAAATAATGTTTTGGTTTACAGACACTTAGAAATAAGT
|
||||
TGTGTCTCAAAATTGGGTGACTATTCTAGTTATCTGCTACTCAATATCCTTGTGCGAGCC
|
||||
CTCTTTACCCAGAATCAAACTAAACCATGAGGGGCACTATAGAATGTCACCCCTGGGTCC
|
||||
AGGATACTATGGGGACTCAGAAGCCAAGCTCCCACTGGGGGATCTAGGGCATGCCCCCAA
|
||||
GGTAAGATTCCCACCTCTTTGTTCAGCAGGAAGCACCCATCACACAAGGAGGTAGGAATA
|
||||
AACAAGCATTCGTCAAGAACAAAAGATACAGATGTTCTGCTGGAGCTTGGATACATAGCA
|
||||
TAAGAGGGAACAGTTCTCACAGGTAAGAGTAAGTTTTCCTCTGGTGGTGACAGTGGGACC
|
||||
TGTGGGGGAGAGAATTGGGAGTACTGACAGGAAGGCAGAGTGGCTGTCCAAATGAACGGA
|
||||
TTGTTTGCACATGGCCTTTAGGGCACGTTGTGTTAGCCTTCCATTGCTGCTTATATTAGT
|
||||
CTGTTTTCACACTGCCCATAAATGCATACCTGAGACTGGATAATTTATAAAGAAAAAGAG
|
||||
CCTTAATGTACTCATAGTTGCATGTGGCTGGGGAGGCCTCACAATCATGGCAGAAGGTGA
|
||||
AAGGCACATCTTACATGGAAGCAGACAAGAGAGAATTGAGGACCAAGTGAAAGGGGTTTC
|
||||
CCCTTATAAAACCATCAGATCACATGAGACTTTTTCACCACCATGAGAACAGTAAGGGGA
|
||||
AAACTATGCTCATGATTCAATTGTCTCCCACTGGATTCCTCCCACAACACATAGGAATTA
|
||||
TGGGAGCTAAAATTCAAGATGAGATTTGGGTGAGGACACAGCCAAACCCTATCACTGCTG
|
||||
TAATCAATTCCCACCAACTTAGTGGCTCGAAACATCACAGATTTATGATCTTATGACGGT
|
||||
GGAGGTCCCCAAATGGATCTTCTAGGTCTAGAATCAAGGTATCAGCAGACCACTTCTTTT
|
||||
GGAGGCTCTGGTGGAGAAACCATTTCCTCGCCTTTTCCAGCTTCTAGAGGCTGCCCTTCT
|
||||
CATTCCTTGGTTCACGGCCACACTCATTTCCATCTCTGCTTCCACTGTGACAACTTCTCT
|
||||
GCCTCAGACCCTCCTGCTTTGCCTTTGTAAGGACCCTTGTGATGAGATCAGGCCCATCCA
|
||||
GGATTATCCCTCATCTCAAGACCTTTACCTTAATCACATTTGCAAGGTCTCTTCCACTGT
|
||||
GTCAGGTAACATTTTCACAGGTTCCAGGGATTAGGGTGTGGACATCTTGGGGAGCTGGAG
|
||||
GATATTATTTCATCTACCACACACATCTCTACCTTGTACAGGCAAGCACTTGCAAAGTGC
|
||||
AATGTGATCCTCTGGAGCCACTGTCCTCCCAGAGCTTATATATACTCTGAAAGTCAACTC
|
||||
TCAGACCACAGCCTCCTGTCCATGCACCACTCTCATCAACACCCCCACCCGAAACACTTT
|
||||
CACTCCACCCTCTTTGTCCCCTAACTCATGGAGAAGAAAATCTAATTAGTAGGAGTGGAA
|
||||
TTTGGCTTTCATCTTTACCAGTACTAGAAATATGGTGTGTGTCTTTTTGTAAAAATTCTC
|
||||
TCAACTAAATTGTTTTTATTAATTTCTGCAAAATGTGAACATCAACTCCCTTCATGTGAA
|
||||
TGTCAATAAGATTAAATGAGCTGTCTCAGCTCCTAGCCTGTGCAAGCTAACAGCTCAGGA
|
||||
GATGTTTATTTCTTTCCCTCTTCTTTCCTTAATGAAGCCCTCTCCTTTGACATCTTCAAT
|
||||
TCTGGAGCGCTTCTTTTCTGAGGCCTTGGCTCCCCCACATTGCCCACCCTTTTCCTGCTC
|
||||
GTCCACATTTCTGGCTTCTATTCTCTTGTCTTTACCATCTCCCTGAACAATGTTATCCGT
|
||||
TCCAATGACTTCAACAGTCTCTCCGCTTACATATGATGCCTCTCAAACTCTGATCTCCAA
|
||||
CTCTTCCAAAGAGCTCTGGACCTTTGTTCCAATTACCTGAAAAACATCTTCTTGGATGTC
|
||||
CCATTAGCACTGTTAAATCAAACAAGAATTTCCCTCCCTCCTGCCTTGCTGTAGTTCCCC
|
||||
TAGGGATTCGGTTGTGTGGGAAGATGTGTGGAGAGCTCTTAGTTGACTCCCTTCTCTGCA
|
||||
GTTCTACCTCTCTAGAGACTTGGAGGACCCACTGTTTCCGCCTCGCTTTTTCAGGCCTAG
|
||||
AGATTGCTCGCTCCTGGGCTGGCTGCTTCATAATTCCTTATTAGTAGTTTCCCAAGCTTA
|
||||
CATATCTGTAAATATTTACTTTAGTTAAATTCTCCCCAATTTCCACAATATGTTGGCTGC
|
||||
ACATGCTTTCTACTAGGAGTCACACAACTATGATAAGAACCAAGAAATATTAGTAAACGT
|
||||
TTTTTACCATTATTGGCCTATACCCTGGAATAGCCAACAATAACCTAGAACCTATGCAAC
|
||||
AAGAATATCCAACAAGAACCTAGAGACCTGTCAGTCTATAGGTGGGAACTACAGGATGAG
|
||||
A
|
||||
@@ -0,0 +1,28 @@
|
||||
Q 42 16872292 669 0.000039651 16872292
|
||||
Q 40 835329 636 0.000073697 17707621
|
||||
Q 31 6544 2 0.000073783 17714165
|
||||
Q 30 8882 6 0.000074084 17723047
|
||||
Q 27 68499 9 0.000074305 17791546
|
||||
Q 26 132041 81 0.000078277 17923587
|
||||
Q 25 129378 96 0.000083033 18052965
|
||||
Q 24 92056 382 0.000103665 18145021
|
||||
Q 23 14341 402 0.000125720 18159362
|
||||
Q 22 132838 146 0.000132789 18292200
|
||||
Q 21 122274 124 0.000138641 18414474
|
||||
Q 18 112183 103 0.000143361 18526657
|
||||
Q 17 126981 213 0.000153804 18653638
|
||||
Q 16 16356 208 0.000164810 18669994
|
||||
Q 15 42804 782 0.000206223 18712798
|
||||
Q 14 16026 318 0.000223025 18728824
|
||||
Q 12 170250 814 0.000264087 18899074
|
||||
Q 11 48351 1409 0.000337777 18947425
|
||||
Q 8 1843 311 0.000354156 18949268
|
||||
Q 7 62266 4435 0.000586276 19011534
|
||||
Q 6 413997 50057 0.003150647 19425531
|
||||
Q 5 404 58 0.003153568 19425935
|
||||
Q 4 704 154 0.003161381 19426639
|
||||
Q 3 1473 681 0.003196193 19428112
|
||||
Q 2 17541 16462 0.004039875 19445653
|
||||
Q 1 534344 354879 0.021693547 19979997
|
||||
Q 0 11939 9917 0.022176642 19991936
|
||||
U 8064
|
||||
@@ -0,0 +1,52 @@
|
||||
Q 60 18784147 3 0.000000160 18784147
|
||||
Q 52 19002 1 0.000000213 18803149
|
||||
Q 50 7152 2 0.000000319 18810301
|
||||
Q 49 6797 1 0.000000372 18817098
|
||||
Q 48 52188 2 0.000000477 18869286
|
||||
Q 47 48775 3 0.000000634 18918061
|
||||
Q 46 19447 2 0.000000739 18937508
|
||||
Q 45 25983 3 0.000000896 18963491
|
||||
Q 44 13455 1 0.000000949 18976946
|
||||
Q 43 14573 2 0.000001053 18991519
|
||||
Q 42 8697 4 0.000001263 19000216
|
||||
Q 41 8645 2 0.000001368 19008861
|
||||
Q 40 176603 75 0.000005264 19185464
|
||||
Q 38 2503 2 0.000005368 19187967
|
||||
Q 37 4117 3 0.000005523 19192084
|
||||
Q 36 2924 16 0.000006356 19195008
|
||||
Q 35 2323 8 0.000006772 19197331
|
||||
Q 34 2344 10 0.000007292 19199675
|
||||
Q 33 4279 6 0.000007603 19203954
|
||||
Q 32 2092 4 0.000007810 19206046
|
||||
Q 31 2625 11 0.000008382 19208671
|
||||
Q 30 2828 13 0.000009057 19211499
|
||||
Q 29 1581 1 0.000009108 19213080
|
||||
Q 28 1543 6 0.000009420 19214623
|
||||
Q 27 70916 223 0.000020948 19285539
|
||||
Q 26 1288 16 0.000021777 19286827
|
||||
Q 25 25551 122 0.000028065 19312378
|
||||
Q 24 14345 84 0.000032390 19326723
|
||||
Q 23 7308 87 0.000036878 19334031
|
||||
Q 22 8358 125 0.000043325 19342389
|
||||
Q 21 4836 71 0.000046983 19347225
|
||||
Q 20 5888 123 0.000053325 19353113
|
||||
Q 19 4656 83 0.000057600 19357769
|
||||
Q 18 3948 87 0.000062081 19361717
|
||||
Q 17 4418 114 0.000067954 19366135
|
||||
Q 16 4226 131 0.000074702 19370361
|
||||
Q 15 5760 164 0.000083144 19376121
|
||||
Q 14 4697 257 0.000096384 19380818
|
||||
Q 13 5246 313 0.000112503 19386064
|
||||
Q 12 4170 241 0.000124908 19390234
|
||||
Q 11 4095 304 0.000140557 19394329
|
||||
Q 10 3857 360 0.000159087 19398186
|
||||
Q 9 5300 438 0.000181617 19403486
|
||||
Q 8 4206 572 0.000211050 19407692
|
||||
Q 7 4676 787 0.000251541 19412368
|
||||
Q 6 3923 688 0.000286924 19416291
|
||||
Q 5 3294 708 0.000323333 19419585
|
||||
Q 4 2936 693 0.000358965 19422521
|
||||
Q 3 3928 816 0.000400897 19426449
|
||||
Q 2 2613 810 0.000442533 19429062
|
||||
Q 1 3515 1188 0.000503587 19432577
|
||||
Q 0 567423 376636 0.019321100 20000000
|
||||
@@ -2,3 +2,9 @@
|
||||
|
||||
bin/mason_variator -ir hs38.fa -s 1 -ov hs38-s1.vcf --snp-rate 1e-3 --small-indel-rate 2e-4 --sv-indel-rate 0 --sv-inversion-rate 0 --sv-translocation-rate 0 --sv-duplication-rate 0 --max-small-indel-size 10
|
||||
bin/mason_simulator -ir hs38.fa -iv hs38-s1.vcf -n 1000000 --seed 1 -o s1_1.fq -or s1_2.fq -oa s1.sam --illumina-prob-mismatch-scale 2.5
|
||||
|
||||
bin/mason_variator -ir hs38.fa -s 2 -ov hs38-s2.vcf --snp-rate 1e-3 --small-indel-rate 2e-4 --sv-indel-rate 0 --sv-inversion-rate 0 --sv-translocation-rate 0 --sv-duplication-rate 0 --max-small-indel-size 10
|
||||
bin/mason_simulator -ir hs38.fa -iv hs38-s2.vcf -n 1000000 --seed 2 -o mason-s2_1.fq -or mason-s2_2.fq -oa mason-s2.sam --illumina-prob-mismatch-scale 2.5 --illumina-read-length 150
|
||||
|
||||
bin/mason_variator -ir hs38.fa -s 3 -ov hs38-s3.vcf --snp-rate 1e-3 --small-indel-rate 2e-4 --sv-indel-rate 0 --sv-inversion-rate 0 --sv-translocation-rate 0 --sv-duplication-rate 0 --max-small-indel-size 10
|
||||
bin/mason_simulator -ir hs38.fa -iv hs38-s3.vcf -n 10000000 --seed 3 -o mason-s3_1.fq -or mason-s3_2.fq -oa mason-s3.sam --illumina-prob-mismatch-scale 2.5 --illumina-read-length 150
|
||||
|
||||
+214
-15
@@ -61,13 +61,6 @@
|
||||
Volume = {32},
|
||||
Year = {2016}}
|
||||
|
||||
@misc{Suzuki:2016,
|
||||
title = {Fast and accurate alignment tool for PacBio and Nanopore long reads},
|
||||
author = {Hajime Suzuki},
|
||||
journal = {Unpublished},
|
||||
howpublished = {\href{https://github.com/ocxtal/minialign}{https://github.com/ocxtal/minialign}},
|
||||
year = {2016}}
|
||||
|
||||
@misc{Ruan:2016,
|
||||
title = {Ultra-fast de novo assembler using long noisy reads},
|
||||
author = {Jue Ruan},
|
||||
@@ -172,14 +165,6 @@
|
||||
Volume = {29},
|
||||
Year = {2011}}
|
||||
|
||||
@article {Suzuki130633,
|
||||
author = {Suzuki, Hajime and Kasahara, Masahiro},
|
||||
title = {Acceleration Of Nucleotide Semi-Global Alignment With Adaptive Banded Dynamic Programming},
|
||||
year = {2017},
|
||||
note = {doi:10.1101/130633},
|
||||
publisher = {Cold Spring Harbor Labs Journals},
|
||||
journal = {bioRxiv}}
|
||||
|
||||
@article{Gotoh:1982aa,
|
||||
Author = {Gotoh, O},
|
||||
Journal = {J Mol Biol},
|
||||
@@ -259,3 +244,217 @@
|
||||
Title = {{Striped Smith-Waterman speeds database searches six times over other SIMD implementations}},
|
||||
Volume = {23},
|
||||
Year = {2007}}
|
||||
|
||||
@techreport{Holtgrewe:2010aa,
|
||||
Address = {Freie Universit{\"a}t Berlin},
|
||||
Author = {Holtgrewe, M.},
|
||||
Institution = {Institut f{\"u}r Mathematik und Informatik},
|
||||
Number = {TR-B-10-06},
|
||||
Title = {Mason -- a read simulator for second generation sequencing data},
|
||||
Year = {2010}}
|
||||
|
||||
@article{Zaharia:2011aa,
|
||||
Author = {Zaharia, Matei and others},
|
||||
Journal = {arXiv:1111:5572},
|
||||
Title = {Faster and More Accurate Sequence Alignment with {SNAP}},
|
||||
Year = {2011}}
|
||||
|
||||
@article{Irimia:2008aa,
|
||||
Author = {Irimia, Manuel and Roy, Scott William},
|
||||
Journal = {PLoS Genet},
|
||||
Pages = {e1000148},
|
||||
Title = {Evolutionary convergence on highly-conserved 3' intron structures in intron-poor eukaryotes and insights into the ancestral eukaryotic genome},
|
||||
Volume = {4},
|
||||
Year = {2008}}
|
||||
|
||||
@article{Depristo:2011vn,
|
||||
Author = {Depristo, Mark A and others},
|
||||
Journal = {Nat Genet},
|
||||
Pages = {491-8},
|
||||
Title = {A framework for variation discovery and genotyping using next-generation {DNA} sequencing data},
|
||||
Volume = {43},
|
||||
Year = {2011}}
|
||||
|
||||
@article{Kurtz:2004zr,
|
||||
Author = {Kurtz, Stefan and others},
|
||||
Journal = {Genome Biol},
|
||||
Pages = {R12},
|
||||
Title = {Versatile and open software for comparing large genomes},
|
||||
Volume = {5},
|
||||
Year = {2004}}
|
||||
|
||||
@article {Li223297,
|
||||
author = {Li, Heng and others},
|
||||
title = {New synthetic-diploid benchmark for accurate variant calling evaluation},
|
||||
year = {2017},
|
||||
note = {doi:10.1101/223297},
|
||||
journal = {bioRxiv}
|
||||
}
|
||||
|
||||
@article{Berlin:2015xy,
|
||||
Author = {Berlin, Konstantin and others},
|
||||
Journal = {Nat Biotechnol},
|
||||
Pages = {623-30},
|
||||
Title = {Assembling large genomes with single-molecule sequencing and locality-sensitive hashing},
|
||||
Volume = {33},
|
||||
Year = {2015}}
|
||||
|
||||
@article{Gurevich:2013aa,
|
||||
Author = {Gurevich, Alexey and others},
|
||||
Journal = {Bioinformatics},
|
||||
Pages = {1072-5},
|
||||
Title = {{QUAST}: quality assessment tool for genome assemblies},
|
||||
Volume = {29},
|
||||
Year = {2013}}
|
||||
|
||||
@article{Li:2010fk,
|
||||
Author = {Li, Heng and Durbin, Richard},
|
||||
Journal = {Bioinformatics},
|
||||
Pages = {589-95},
|
||||
Title = {Fast and accurate long-read alignment with {Burrows-Wheeler} transform},
|
||||
Volume = {26},
|
||||
Year = {2010}}
|
||||
|
||||
@article{Marcais:2018aa,
|
||||
Author = {Mar{\c c}ais, Guillaume and others},
|
||||
Journal = {PLoS Comput Biol},
|
||||
Pages = {e1005944},
|
||||
Title = {{MUMmer4}: A fast and versatile genome alignment system},
|
||||
Volume = {14},
|
||||
Year = {2018}}
|
||||
|
||||
@article{Li:2009ys,
|
||||
Author = {Li, Heng and others},
|
||||
Journal = {Bioinformatics},
|
||||
Pages = {2078-9},
|
||||
Title = {The {Sequence Alignment/Map format and SAMtools}},
|
||||
Volume = {25},
|
||||
Year = {2009}}
|
||||
|
||||
@article{Suzuki:2018aa,
|
||||
Author = {Suzuki, Hajime and Kasahara, Masahiro},
|
||||
Journal = {BMC Bioinformatics},
|
||||
Pages = {45},
|
||||
Title = {Introducing difference recurrence relations for faster semi-global alignment of long sequences},
|
||||
Volume = {19},
|
||||
Year = {2018}}
|
||||
|
||||
@article{Li:2018ab,
|
||||
Author = {Li, Heng},
|
||||
Journal = {Bioinformatics},
|
||||
Pages = {3094-3100},
|
||||
Title = {Minimap2: pairwise alignment for nucleotide sequences},
|
||||
Volume = {34},
|
||||
Year = {2018}}
|
||||
|
||||
@article{Jain:2020aa,
|
||||
Author = {Jain, Chirag and others},
|
||||
Journal = {Bioinformatics},
|
||||
Pages = {i111-i118},
|
||||
Title = {Weighted minimizer sampling improves long read mapping},
|
||||
Volume = {36},
|
||||
Year = {2020}}
|
||||
|
||||
@article{Miga:2020aa,
|
||||
Author = {Miga, Karen H and others},
|
||||
Journal = {Nature},
|
||||
Pages = {79-84},
|
||||
Title = {Telomere-to-telomere assembly of a complete human {X} chromosome},
|
||||
Volume = {585},
|
||||
Year = {2020}}
|
||||
|
||||
@article {Jain2020.11.01.363887,
|
||||
author = {Jain, Chirag and others},
|
||||
title = {A long read mapping method for highly repetitive reference sequences},
|
||||
elocation-id = {2020.11.01.363887},
|
||||
year = {2020},
|
||||
doi = {10.1101/2020.11.01.363887},
|
||||
publisher = {Cold Spring Harbor Laboratory},
|
||||
URL = {https://www.biorxiv.org/content/early/2020/11/02/2020.11.01.363887},
|
||||
eprint = {https://www.biorxiv.org/content/early/2020/11/02/2020.11.01.363887.full.pdf},
|
||||
journal = {bioRxiv}
|
||||
}
|
||||
|
||||
@article{Li:2020aa,
|
||||
Author = {Li, Heng and others},
|
||||
Journal = {Genome Biol},
|
||||
Pages = {265},
|
||||
Title = {The design and construction of reference pangenome graphs with minigraph},
|
||||
Volume = {21},
|
||||
Year = {2020}}
|
||||
|
||||
@article{Ren:2021aa,
|
||||
Author = {Ren, Jingwen and Chaisson, Mark J P},
|
||||
Journal = {PLoS Comput Biol},
|
||||
Pages = {e1009078},
|
||||
Title = {lra: A long read aligner for sequences and contigs},
|
||||
Volume = {17},
|
||||
Year = {2021}}
|
||||
|
||||
@inproceedings{DBLP:conf/wabi/AbouelhodaO03,
|
||||
Author = {Mohamed Ibrahim Abouelhoda and Enno Ohlebusch},
|
||||
Booktitle = {Algorithms in Bioinformatics, Third International Workshop, {WABI} 2003, Budapest, Hungary, September 15-20, 2003, Proceedings},
|
||||
Crossref = {DBLP:conf/wabi/2003},
|
||||
Pages = {1--16},
|
||||
Title = {A Local Chaining Algorithm and Its Applications in Comparative Genomics},
|
||||
Year = {2003}}
|
||||
|
||||
@article{Ono:2021aa,
|
||||
Author = {Ono, Yukiteru and others},
|
||||
Journal = {Bioinformatics},
|
||||
Pages = {589-595},
|
||||
Title = {{PBSIM2}: a simulator for long-read sequencers with a novel generative model of quality scores},
|
||||
Volume = {37},
|
||||
Year = {2021}}
|
||||
|
||||
@article{Sedlazeck:2018ab,
|
||||
Author = {Sedlazeck, Fritz J and others},
|
||||
Journal = {Nat Methods},
|
||||
Pages = {461-468},
|
||||
Title = {Accurate detection of complex structural variations using single-molecule sequencing},
|
||||
Volume = {15},
|
||||
Year = {2018}}
|
||||
|
||||
@article{Jeffares:2017aa,
|
||||
Author = {Jeffares, Daniel C and others},
|
||||
Journal = {Nat Commun},
|
||||
Pages = {14061},
|
||||
Title = {Transient structural variations have strong effects on quantitative traits and reproductive isolation in fission yeast},
|
||||
Volume = {8},
|
||||
Year = {2017}}
|
||||
|
||||
@article{Zook:2020aa,
|
||||
Author = {Zook, Justin M and others},
|
||||
Journal = {Nat Biotechnol},
|
||||
Pages = {1347-1355},
|
||||
Title = {A robust benchmark for detection of germline large deletions and insertions},
|
||||
Volume = {38},
|
||||
Year = {2020}}
|
||||
|
||||
@article{Harpak:2017aa,
|
||||
Author = {Harpak, Arbel and others},
|
||||
Journal = {Proc Natl Acad Sci U S A},
|
||||
Pages = {12779-12784},
|
||||
Title = {Frequent nonallelic gene conversion on the human lineage and its effect on the divergence of gene duplicates},
|
||||
Volume = {114},
|
||||
Year = {2017}}
|
||||
|
||||
@article{Li:2018aa,
|
||||
Author = {Li, Heng and others},
|
||||
Journal = {Nat Methods},
|
||||
Month = {Aug},
|
||||
Number = {8},
|
||||
Pages = {595-597},
|
||||
Title = {A synthetic-diploid benchmark for accurate variant-calling evaluation},
|
||||
Volume = {15},
|
||||
Year = {2018}}
|
||||
|
||||
@article{Gu:1995wt,
|
||||
author = {Gu, X and Li, W H},
|
||||
journal = {J Mol Evol},
|
||||
month = {Apr},
|
||||
number = {4},
|
||||
pages = {464-73},
|
||||
title = {The size distribution of insertions and deletions in human and rodent pseudogenes suggests the logarithmic gap penalty for sequence alignment},
|
||||
volume = {40},
|
||||
year = {1995}}
|
||||
|
||||
+335
-120
@@ -1,6 +1,6 @@
|
||||
\documentclass{bioinfo}
|
||||
\copyrightyear{2017}
|
||||
\pubyear{2017}
|
||||
\copyrightyear{2018}
|
||||
\pubyear{2018}
|
||||
|
||||
\usepackage{graphicx}
|
||||
\usepackage{hyperref}
|
||||
@@ -13,29 +13,37 @@
|
||||
|
||||
\usepackage{natbib}
|
||||
\bibliographystyle{apalike}
|
||||
\usepackage{hyperref}
|
||||
|
||||
\DeclareMathOperator*{\argmax}{argmax}
|
||||
|
||||
\begin{document}
|
||||
\firstpage{1}
|
||||
|
||||
\title[Aligning long nucleotide sequences with minimap2]{Minimap2: fast pairwise alignment for long nucleotide sequences}
|
||||
\title[Aligning nucleotide sequences with minimap2]{Minimap2: pairwise alignment for nucleotide sequences}
|
||||
\author[Li]{Heng Li}
|
||||
\address{Broad Institute, 415 Main Street, Cambridge, MA 02142, USA}
|
||||
|
||||
\maketitle
|
||||
|
||||
\begin{abstract}
|
||||
\section{Summary:} Minimap2 is a general-purpose mapper to align long noisy DNA
|
||||
or mRNA sequences against a large reference database. It targets query
|
||||
sequences of 1kb--100Mb in length with per-base divergence typically below
|
||||
25\%. For DNA sequence reads, minimap2 is $\sim$30 times faster than many
|
||||
mainstream long-read aligners and achieves higher accuracy on simulated data.
|
||||
It also employs concave gap cost and rescues inversions for improved alignment
|
||||
around potential structural variations. For real long RNA-seq reads, minimap2
|
||||
is $\sim$40 times faster than peers and produces alignment more consistent with
|
||||
existing gene annotations.
|
||||
|
||||
\section{Motivation:} Recent advances in sequencing technologies promise
|
||||
ultra-long reads of $\sim$100 kilo bases (kb) in average, full-length mRNA or
|
||||
cDNA reads in high throughput and genomic contigs over 100 mega bases (Mb) in
|
||||
length. Existing alignment programs are unable or inefficient to process such data
|
||||
at scale, which presses for the development of new alignment algorithms.
|
||||
|
||||
\section{Results:} Minimap2 is a general-purpose alignment program to map DNA or long
|
||||
mRNA sequences against a large reference database. It works with accurate short
|
||||
reads of $\ge$100bp in length, $\ge$1kb genomic reads at error rate $\sim$15\%,
|
||||
full-length noisy Direct RNA or cDNA reads, and assembly contigs or closely
|
||||
related full chromosomes of hundreds of megabases in length. Minimap2 does
|
||||
split-read alignment, employs concave gap cost for long insertions and
|
||||
deletions (INDELs) and introduces new heuristics to reduce spurious alignments.
|
||||
It is 3--4 times as fast as mainstream short-read mappers at comparable
|
||||
accuracy, and is $\ge$30 times faster than long-read genomic or cDNA
|
||||
mappers at higher accuracy, surpassing most aligners specialized in one type of
|
||||
alignment.
|
||||
|
||||
\section{Availability and implementation:}
|
||||
\href{https://github.com/lh3/minimap2}{https://github.com/lh3/minimap2}
|
||||
@@ -56,29 +64,38 @@ the thought that 10kb long sequences should be easier to map than 100bp reads
|
||||
because we can more effectively skip repetitive regions, which are often the
|
||||
bottleneck of short-read alignment. We confirmed our speculation by achieving
|
||||
approximate mapping 50 times faster than BWA-MEM~\citep{Li:2016aa}.
|
||||
\citet{Suzuki:2016} extended our work with a fast and novel algorithm on
|
||||
\citet{Suzuki:2018aa} extended our work with a fast and novel algorithm on
|
||||
generating base-level alignment, which in turn inspired us to develop minimap2
|
||||
towards higher accuracy and more practical functionality.
|
||||
with added functionality.
|
||||
|
||||
Both SMRT and ONT have been applied to sequence spliced mRNAs (RNA-seq). While
|
||||
Both SMRT and ONT have been applied to the sequencing of spliced mRNAs (RNA-seq). While
|
||||
traditional mRNA aligners work~\citep{Wu:2005vn,Iwata:2012aa}, they are not
|
||||
optimized for long noisy sequence reads and are tens of times slower than
|
||||
dedicated long-read aligners. When developing minimap2 initially for aligning
|
||||
genomic DNA only, we realized minor modifications could make it competitive for
|
||||
aligning mRNAs as well. Minimap2 is a first RNA-seq aligner specifically
|
||||
designed for long noisy reads.
|
||||
genomic DNA only, we realized minor modifications could enable the base
|
||||
algorithm to map mRNAs as well. Minimap2 becomes a first RNA-seq aligner
|
||||
specifically designed for long noisy reads. We have also extended the original
|
||||
algorithm to map short reads at a speed faster than several mainstream
|
||||
short-read mappers.
|
||||
|
||||
In this article, we will describe the minimap2 algorithm and its applications
|
||||
to different types of input sequences. We will evaluate the performance and
|
||||
accuracy of minimap2 on several simulated and real data sets and demonstrate
|
||||
the versatility of minimap2.
|
||||
|
||||
\begin{methods}
|
||||
\section{Methods}
|
||||
|
||||
Minimap2 follows a typical seed-chain-align procedure as is used by most
|
||||
full-genome aligners. It collects minimizers~\citep{Roberts:2004fv} of the
|
||||
reference sequences and indexes them in a hash table. Then for each query
|
||||
sequence, minimap2 takes query minimizers as \emph{seeds}, finds matches to the
|
||||
reference, and identifies sets of colinear seeds, which are called
|
||||
reference sequences and indexes them in a hash table, with the key being the
|
||||
hash of a minimizer and the value being a list of locations of the minimizer
|
||||
copies. Then for each query
|
||||
sequence, minimap2 takes query minimizers as \emph{seeds}, finds exact matches
|
||||
(i.e. \emph{anchors}) to the reference, and identifies sets of colinear anchors as
|
||||
\emph{chains}. If base-level alignment is requested, minimap2 applies dynamic
|
||||
programming (DP) to extend from the ends of chains and to close unseeded
|
||||
regions between adjacent seeds in chains.
|
||||
programming (DP) to extend from the ends of chains and to close
|
||||
regions between adjacent anchors in chains.
|
||||
|
||||
Minimap2 uses indexing and seeding algorithms similar to
|
||||
minimap~\citep{Li:2016aa}, and furthers the predecessor with more accurate
|
||||
@@ -103,9 +120,15 @@ distance between two anchors is too large); otherwise
|
||||
\begin{equation}\label{eq:chain-gap}
|
||||
\beta(j,i)=\gamma_c\big((y_i-y_j)-(x_i-x_j)\big)
|
||||
\end{equation}
|
||||
In implementation, a gap of length $l$ costs $\gamma_c(l)=0.01\cdot \bar{w}\cdot
|
||||
|l|+0.5\log_2|l|$, where $\bar{w}$ is the average seed length. For $m$ anchors, directly computing all $f(\cdot)$ with
|
||||
Eq.~(\ref{eq:chain}) takes $O(m^2)$ time. Although theoretically faster
|
||||
In implementation, a gap of length $l$ costs
|
||||
\[
|
||||
\gamma_c(l)=\left\{\begin{array}{ll}
|
||||
0.01\cdot \bar{w}\cdot|l|+0.5\log_2|l| & (l\not=0) \\
|
||||
0 & (l=0)
|
||||
\end{array}\right.
|
||||
\]
|
||||
where $\bar{w}$ is the average seed length. For $N$ anchors, directly computing all $f(\cdot)$ with
|
||||
Eq.~(\ref{eq:chain}) takes $O(N^2)$ time. Although theoretically faster
|
||||
chaining algorithms exist~\citep{Abouelhoda:2005aa}, they
|
||||
are inapplicable to generic gap cost, complex to implement and usually
|
||||
associated with a large constant. We introduced a simple heuristic to
|
||||
@@ -115,23 +138,25 @@ We note that if anchor $i$ is chained to $j$, chaining $i$ to a predecessor
|
||||
of $j$ is likely to yield a lower score. When evaluating Eq.~(\ref{eq:chain}),
|
||||
we start from anchor $i-1$ and stop the process if we cannot find a better
|
||||
score after up to $h$ iterations. This approach reduces the average time to
|
||||
$O(h\cdot m)$. In practice, we can almost always find the optimal chain with
|
||||
$O(hN)$. In practice, we can almost always find the optimal chain with
|
||||
$h=50$; even if the heuristic fails, the optimal chain is often close.
|
||||
|
||||
\subsubsection{Backtracking}
|
||||
Let $P(i)$ be the index of the best predecessor of anchor $i$. It equals 0 if
|
||||
$f(i)=w_i$ or $\argmax_j\{f(j)+\eta(j,i)-\gamma(j,i)\}$ otherwise. For each
|
||||
$f(i)=w_i$ or $\argmax_j\{f(j)+\alpha(j,i)-\beta(j,i)\}$ otherwise. For each
|
||||
anchor $i$ in the descending order of $f(i)$, we apply $P(\cdot)$ repeatedly to
|
||||
find its predecessor and mark each visited $i$ as `used', until $P(i)=0$ or we
|
||||
reach an already `used' $i$. This way we find all chains with no anchors used
|
||||
in more than one chains.
|
||||
|
||||
\subsubsection{Identifying primary chains}
|
||||
\subsubsection{Identifying primary chains}\label{sec:primary}
|
||||
In the absence of copy number changes, each query segment should not be mapped
|
||||
to two places in the reference. However, chains found at the previous step may
|
||||
have significant or complete overlaps due to repeats in the reference.
|
||||
have significant or complete overlaps due to repeats in the reference~\citep{Li:2010fk}.
|
||||
Minimap2 used the following procedure to identify \emph{primary chains} that do
|
||||
not greatly overlap on the query. Let $Q$ be an empty set initially. For each
|
||||
not greatly overlap on the query.
|
||||
|
||||
Let $Q$ be an empty set initially. For each
|
||||
chain from the best to the worst according to their chaining scores: if on the
|
||||
query, the chain overlaps with a chain in $Q$ by 50\% or higher percentage of
|
||||
the shorter chain, mark the chain as secondary to the chain in $Q$; otherwise,
|
||||
@@ -139,7 +164,64 @@ add the chain to $Q$. In the end, $Q$ contains all the primary chains. We did
|
||||
not choose a more sophisticated data structure (e.g. range tree or k-d tree)
|
||||
because this step is not the performance bottleneck.
|
||||
|
||||
\subsection{Aligning genomic DNA}
|
||||
For each primary chain, minimap2 estimates its mapping quality with an
|
||||
empirical formula:
|
||||
\[
|
||||
{\rm mapQ}=40\cdot (1-f_2/f_1)\cdot\min\{1,m/10\}\cdot\log f_1
|
||||
\]
|
||||
where $\log$ denotes natural logarithm, $m$ is the number of anchors on the primary chain, $f_1$ is the chaining
|
||||
score, and $f_2\le f_1$ is the score of the best chain that is secondary to the
|
||||
primary chain. Intuitively, a chain is assigned to a higher mapping quality if
|
||||
it is long and its best secondary chain is weak.
|
||||
|
||||
\subsubsection{Estimating per-base sequence divergence}
|
||||
Suppose a query sequence harbors $n$ seeds of length $k$, $m$ of which are
|
||||
present in a chain. We want to estimate the sequence divergence $\epsilon$
|
||||
between the query and the reference sequences in the chain. This is useful
|
||||
when base-level alignment is too expensive to perform.
|
||||
|
||||
If we model substitutions with a homogeneous Poisson process along the query
|
||||
sequence, the probablity of seeing $k$ consecutive bases without substitutions
|
||||
is $e^{-k\epsilon}$. On the assumption that all $k$-mers are independent of
|
||||
each other, the likelihood function of $\epsilon$ is
|
||||
\[
|
||||
\mathcal{L}(\epsilon|n,m,k)=e^{-m\cdot k\epsilon}(1-e^{-k\epsilon})^{n-m}
|
||||
\]
|
||||
The maximum likelihood estimate of $\epsilon$ is
|
||||
\[
|
||||
\hat{\epsilon}=\frac{1}{k}\log\frac{n}{m}
|
||||
\]
|
||||
In reality, sequencing errors are sometimes clustered and $k$-mers are not
|
||||
independent of each other, especially when we take minimizers as seeds. These
|
||||
violate the assumptions in the derivation above. As a result, $\hat{\epsilon}$
|
||||
is only approximate and can be biased. It also ignores long deletions from the
|
||||
reference sequence. In practice, fortunately, $\hat{\epsilon}$ is often close
|
||||
to and strongly correlated with the sequence divergence estimated from
|
||||
base-level alignments. On the several datasets used in
|
||||
Section~\ref{sec:long-genomic}, the Spearman correlation coefficient is around
|
||||
$0.9$.
|
||||
|
||||
\subsubsection{Indexing with homopolymer compressed $k$-mers}
|
||||
SmartDenovo
|
||||
(\href{https://github.com/ruanjue/smartdenovo}{https://github.com/ruanjue/smartdenovo};
|
||||
J. Ruan, personal communication) indexes reads with homopolymer-compressed (HPC)
|
||||
$k$-mers and finds the strategy improves overlap sensitivity for SMRT reads.
|
||||
Minimap2 adopts the same heuristic.
|
||||
|
||||
The HPC string of a string $s$, denoted by ${\rm HPC}(s)$, is constructed by
|
||||
contracting homopolymers in $s$ to a single base. An HPC $k$-mer of $s$ is a
|
||||
$k$-long substring of ${\rm HPC}(s)$. For example, suppose $s={\tt GGATTTTCCA}$,
|
||||
${\rm HPC}(s)={\tt GATCA}$ and the first HPC 4-mer is ${\tt GATC}$.
|
||||
|
||||
To demonstrate the effectiveness of HPC $k$-mers, we performed read overlapping
|
||||
for the example {\it E. coli} SMRT reads from PBcR~\citep{Berlin:2015xy}, using
|
||||
different types of $k$-mers. With normal 15bp minimizers per 5bp window,
|
||||
minimap2 finds 90.9\% of $\ge$2kb overlaps inferred from the read-to-reference
|
||||
alignment. With HPC 19-mers per 5bp window, minimap2 finds 97.4\% of overlaps. It achieves this
|
||||
higher sensitivity by indexing 1/3 fewer minimizers, which further helps
|
||||
performance. HPC-based indexing reduces the sensitivity for current ONT reads, though.
|
||||
|
||||
\subsection{Aligning genomic DNA}\label{sec:genomic}
|
||||
|
||||
\subsubsection{Alignment with 2-piece affine gap cost}
|
||||
|
||||
@@ -168,7 +250,7 @@ where $s(i,j)$ is the score between the $i$-th reference base and $j$-th query
|
||||
base. Eq.~(\ref{eq:ae86}) is a natural extension to the equation under affine
|
||||
gap cost~\citep{Gotoh:1982aa,Altschul:1986aa}.
|
||||
|
||||
\subsubsection{Suzuki's formulation}
|
||||
\subsubsection{The Suzuki-Kasahara formulation}
|
||||
|
||||
When we allow gaps longer than several hundred base pairs, nucleotide-level
|
||||
alignment is much slower than chaining. SSE acceleration is critical to the
|
||||
@@ -176,14 +258,14 @@ performance of minimap2. Traditional SSE implementations~\citep{Farrar:2007hs}
|
||||
based on Eq.~(\ref{eq:ae86}) can achieve 16-way parallelization for short
|
||||
sequences, but only 4-way parallelization when the peak alignment score reaches
|
||||
32767. Long sequence alignment may exceed this threshold. Inspired by
|
||||
\citet{Wu:1996aa} and the following work, \citet{Suzuki:2016} proposed a
|
||||
\citet{Wu:1996aa} and the following work, \citet{Suzuki:2018aa} proposed a
|
||||
difference-based formulation that lifted this limitation.
|
||||
In case of 2-piece gap cost, define
|
||||
\[
|
||||
\left\{\begin{array}{ll}
|
||||
u_{ij}\triangleq H_{ij}-H_{i-1,j} & v_{ij}\triangleq H_{ij}-H_{i,j-1} \\
|
||||
x_{ij}\triangleq E_{i+1,j}-H_{ij} & \tilde{x}_{ij}\triangleq \tilde{E}_{i+1,j}-\tilde{H}_{ij} \\
|
||||
y_{ij}\triangleq F_{i,j+1}-H_{ij} & \tilde{y}_{ij}\triangleq \tilde{F}_{i,j+1}-\tilde{H}_{ij}
|
||||
x_{ij}\triangleq E_{i+1,j}-H_{ij} & \tilde{x}_{ij}\triangleq \tilde{E}_{i+1,j}-H_{ij} \\
|
||||
y_{ij}\triangleq F_{i,j+1}-H_{ij} & \tilde{y}_{ij}\triangleq \tilde{F}_{i,j+1}-H_{ij}
|
||||
\end{array}\right.
|
||||
\]
|
||||
We can transform Eq.~(\ref{eq:ae86}) to
|
||||
@@ -243,11 +325,11 @@ y_{rt}&=&\max\{0,y_{r-1,t}+u_{r-1,t}-z_{rt}+q\}-q-e\\
|
||||
\end{equation*}
|
||||
In this formulation, cells with the same diagonal index $r$ are independent of
|
||||
each other. This allows us to fully vectorize the computation of all cells on
|
||||
the same anti-diagonal in one inner loop. It also simplifies banded alignment,
|
||||
the same anti-diagonal in one inner loop. It also simplifies banded alignment (500bp band width by default),
|
||||
which would be difficult with striped vectorization~\citep{Farrar:2007hs}.
|
||||
|
||||
On the condition that $q+e<\tilde{q}+\tilde{e}$ and $e>\tilde{e}$, the initial
|
||||
values in the diagonal-antidiagonal formuation is
|
||||
values in the diagonal-antidiagonal formuation are
|
||||
\[
|
||||
\left\{\begin{array}{l}
|
||||
x_{r-1,-1}=y_{r-1,r}=-q-e\\
|
||||
@@ -266,12 +348,19 @@ r\cdot(e-\tilde{e})-(\tilde{q}-q)-\tilde{e} & (r=\lceil\frac{\tilde{q}-q}{e-\til
|
||||
\]
|
||||
These can be derived from the initial values for Eq.~(\ref{eq:ae86}).
|
||||
|
||||
When performing global alignment, we do not need to compute $H_{rt}$ in each cell.
|
||||
We use 16-way vectorization throughout the alignment process. When extending
|
||||
alignments from ends of chains, we need to find the cell $(r,t)$ where $H_{rt}$
|
||||
reaches the maximum. We resort to 4-way vectorization to compute
|
||||
$H_{rt}=H_{r-1,t}+u_{rt}$. Because this computation is simple,
|
||||
Eq.~(\ref{eq:suzuki}) is still the dominant performance bottleneck.
|
||||
|
||||
In practice, our 16-way vectorized implementation of global alignment is three
|
||||
times as fast as Parasail's 4-way vectorization~\citep{Daily:2016aa}. Without
|
||||
banding, our implementation is slower than Edlib~\citep{Sosic:2017aa}, but with
|
||||
a 1000bp band, it is considerably faster. When performing global alignment
|
||||
between anchors, we expect the alignment to stay close to the diagonal of the
|
||||
DP matrix. Banding is applicable most of time.
|
||||
DP matrix. Banding is applicable most of the time.
|
||||
|
||||
\subsubsection{The Z-drop heuristic}
|
||||
|
||||
@@ -295,6 +384,16 @@ alignment between the two subsequences involved in the global alignment, but
|
||||
this time with the one subsequence reverse complemented. This additional
|
||||
alignment step may identify short inversions that are missed during chaining.
|
||||
|
||||
\subsubsection{Filtering out misplaced anchors}
|
||||
Due to sequencing errors and local homology, some anchors in a chain may be
|
||||
wrong. If we blindly align regions between two misplaced anchors, we will
|
||||
produce a suboptimal alignment. To reduce this artifact, we filter out
|
||||
anchors that lead to a $>$10bp insertion and a $>$10bp deletion at the same
|
||||
time, and filter out terminal anchors that lead to a long gap towards the ends
|
||||
of a chain. These heuristics greatly alleviate the issues with misplaced
|
||||
anchors, but they are unable to fix all such errors. Local misalignment is a
|
||||
limitation of minimap2 which we hope to address in future.
|
||||
|
||||
\subsection{Aligning spliced sequences}
|
||||
|
||||
The algorithm described above can be adapted to spliced alignment. In this
|
||||
@@ -326,18 +425,24 @@ F_{i,j+1}= \max\{H_{ij}-q,F_{ij}\}-e\\
|
||||
\tilde{E}_{i+1,j}= \max\{H_{ij}-d(i)-\tilde{q},\tilde{E}_{ij}\}\\
|
||||
\end{array}\right.
|
||||
\end{equation}
|
||||
Let $T$ be the reference sequence. $d(i)$ is the cost of a non-canonical donor
|
||||
site, which takes 0 if $T[i+1,i+2]={\tt GT}$, or a positive number $p$
|
||||
otherwise. Similarly, $a(i)$ is the cost of a non-canonical acceptor site, which
|
||||
takes 0 if $T[i-1,i]={\tt AG}$, or $p$ otherwise. Eq.~(\ref{eq:splice}) is
|
||||
almost equivalent to the equation used by EXALIN~\citep{Zhang:2006aa} except
|
||||
that we allow insertions immediately followed by deletions and vice versa; in
|
||||
addition, we use Suzuki's diagonal formulation in actual implementation.
|
||||
|
||||
%Given that $d_i$ and $a_i$
|
||||
%are a function of the reference sequence, it is possible to incorporate
|
||||
%splicing signals with more sophisticated models, such as positional weight
|
||||
%matrices. We have not tried this approach.
|
||||
Let $T$ be the reference sequence. $d(i)$ is computed as
|
||||
\[d(i)=\left\{\begin{array}{ll}
|
||||
0 & \mbox{if $T[i+1,i+3]$ is ${\tt GTA}$ or ${\tt GTG}$} \\
|
||||
p/2 & \mbox{if $T[i+1,i+3]$ is ${\tt GTC}$ or ${\tt GTT}$} \\
|
||||
p & \mbox{otherwise}
|
||||
\end{array}\right.\]
|
||||
where $T[i,j]$ extracts a substring of $T$ between $i$ and $j$ inclusively.
|
||||
$d(i)$ penalizes non-canonical donor sites with $p$ and less frequent Eukaryotic
|
||||
splicing signal ${\tt GT[C/T]}$ with $p/2$~\citep{Irimia:2008aa}. Similarly,
|
||||
\[a(i)=\left\{\begin{array}{ll}
|
||||
0 & \mbox{if $T[i-2,i]$ is ${\tt CAG}$ or ${\tt TAG}$} \\
|
||||
p/2 & \mbox{if $T[i-2,i]$ is ${\tt AAG}$ or ${\tt GAG}$} \\
|
||||
p & \mbox{otherwise}
|
||||
\end{array}\right.\]
|
||||
models the acceptor signal. Eq.~(\ref{eq:splice}) is close to an equation in
|
||||
\citet{Zhang:2006aa} except that we allow insertions immediately followed by
|
||||
deletions and vice versa; in addition, we use the Suzuki-Kasahara diagonal
|
||||
formulation in actual implementation.
|
||||
|
||||
If RNA-seq reads are not sequenced from stranded libraries, the read strand
|
||||
relative to the underlying transcript is unknown. By default, minimap2 aligns
|
||||
@@ -349,31 +454,65 @@ reads that span canonical splicing sites.
|
||||
|
||||
In the spliced alignment mode, minimap2 further increases the density of
|
||||
minimizers and disables banded alignment. Together with the two-round DP-based
|
||||
alignment, spliced alignment is several times slower than DNA sequence
|
||||
alignment, spliced alignment is several times slower than genomic DNA
|
||||
alignment.
|
||||
|
||||
\subsection{Aligning short paired-end reads}
|
||||
|
||||
During chaining, minimap2 takes a pair of reads as one fragment with a gap of
|
||||
unknown length in the middle. It applies a normal gap cost between seeds on the
|
||||
same read but is a more permissive gap cost between seeds on different reads.
|
||||
More precisely, the gap cost during chaining is ($l\not=0$):
|
||||
\[
|
||||
\gamma_c(l)=\left\{\begin{array}{ll}
|
||||
0.01\cdot\bar{w}\cdot |l|+0.5\log_2 |l| & \mbox{if two seeds on the same read} \\
|
||||
\min\{0.01\cdot\bar{w}\cdot|l|,\log_2|l|\} & \mbox{otherwise}
|
||||
\end{array}\right.
|
||||
\]
|
||||
After identifying primary chains (Section~\ref{sec:primary}), we split each
|
||||
fragment chain into two read chains and perform alignment for each read as in
|
||||
Section~\ref{sec:genomic}. Finally, we pair hits of each read end to find
|
||||
consistent paired-end alignments.
|
||||
|
||||
\end{methods}
|
||||
|
||||
\section{Results}
|
||||
|
||||
\subsection{Aligning genomic reads}
|
||||
Minimap2 is implemented in the C programming language and comes with APIs in
|
||||
both C and Python. It is distributed under the MIT license, free to both
|
||||
commercial and academic uses. Minimap2 uses the same base algorithm for all
|
||||
applications, but it has to apply different sets of parameters depending on
|
||||
input data types. Similar to BWA-MEM, minimap2 introduces `presets' that
|
||||
modify multiple parameters with a simple invocation. Detailed settings
|
||||
and command-line options can be found in the minimap2 manpage. In addition to
|
||||
the applications evaluated in the following sections, minimap2 also retains
|
||||
minimap's functionality to find overlaps between long reads and to search
|
||||
against large multi-species databases such as \emph{nt} from NCBI.
|
||||
|
||||
\subsection{Aligning long genomic reads}\label{sec:long-genomic}
|
||||
|
||||
\begin{figure}[!tb]
|
||||
\centering
|
||||
\includegraphics[width=.5\textwidth]{roc-color.pdf}
|
||||
\caption{Evaluation on simulated SMRT reads aligned against human genome
|
||||
GRCh38. 33,088 $\ge$1000bp reads were simulated using pbsim~\citep{Ono:2013aa}
|
||||
with error profile sampled from file `m131017\_060208\_42213\_*.1.*' downloaded
|
||||
at \href{http://bit.ly/chm1p5c3}{http://bit.ly/chm1p5c3}. The N50 read length
|
||||
is 11,628. A read is considered correctly mapped if the true position overlaps
|
||||
with the best mapping position by 10\% of the read length. All aligners were
|
||||
run under the default setting for SMRT reads. (a) ROC-like curve. Alignments
|
||||
are sorted by mapping quality in the descending order. For each mapping quality
|
||||
threshold, the fraction of alignments with mapping quality above the threshold
|
||||
and their error rate are plotted. Kart outputted all alignments at mapping
|
||||
quality 60, so is not shown in the figure. It mapped nearly all reads with
|
||||
4.1\% of alignments being wrong, less accurate than others. (b) Accumulative
|
||||
mapping error rate as a function of mapping quality.}\label{fig:eval}
|
||||
\caption{Evaluation on aligning simulated reads. Simulated reads were mapped
|
||||
to the primary assembly of human genome GRCh38. A read is considered correctly
|
||||
mapped if its longest alignment overlaps with the true interval, and the
|
||||
overlap length is $\ge$10\% of the true interval length. Read alignments are
|
||||
sorted by mapping quality in the descending order. For each mapping quality
|
||||
threshold, the fraction of alignments (out of the number of input reads) with
|
||||
mapping quality above the threshold and their error rate are
|
||||
plotted along the curve. (a) long-read alignment evaluation. 33,088 $\ge$1000bp
|
||||
reads were simulated using pbsim~\citep{Ono:2013aa} with error profile sampled
|
||||
from file `m131017\_060208\_42213\_*.1.*' downloaded at
|
||||
\href{http://bit.ly/chm1p5c3}{http://bit.ly/chm1p5c3}. The N50 read length is
|
||||
11,628. Aligners were run under the default setting for SMRT reads.
|
||||
Kart outputted all alignments at mapping quality 60, so is not shown in the
|
||||
figure. It mapped nearly all reads with 4.1\% of alignments being wrong, less
|
||||
accurate than others. (b) short-read alignment evaluation. 10 million pairs of
|
||||
150bp reads were simulated using mason2~\citep{Holtgrewe:2010aa} with option
|
||||
`\mbox{--illumina-prob-mismatch-scale 2.5}'. Short-read aligners were run under
|
||||
the default setting except for changing the maximum fragment length to
|
||||
800bp.}\label{fig:eval}
|
||||
\end{figure}
|
||||
|
||||
As a sanity check, we evaluated minimap2 on simulated human reads along with
|
||||
@@ -381,22 +520,20 @@ BLASR~(v1.MC.rc64; \citealp{Chaisson:2012aa}),
|
||||
BWA-MEM~(v0.7.15; \citealp{Li:2013aa}),
|
||||
GraphMap~(v0.5.2; \citealp{Sovic:2016aa}),
|
||||
Kart~(v2.2.5; \citealp{Lin:2017aa}),
|
||||
minialign~(v0.5.3; \citealp{Suzuki:2016}) and
|
||||
minialign~(v0.5.3; \href{https://github.com/ocxtal/minialign}{https://github.com/ocxtal/minialign}) and
|
||||
NGMLR~(v0.2.5; \citealp{Sedlazeck169557}). We excluded rHAT~\citep{Liu:2016ab}
|
||||
and LAMSA~\citep{Liu:2017aa} because they either
|
||||
crashed or produced malformatted output. In this evaluation, minimap2 has
|
||||
higher power to distinguish unique and repetitive hits, and achieves overall
|
||||
higher mapping accuracy (Fig.~\ref{fig:eval}a). It is still the most accurate
|
||||
even if we skip DP-based alignment (data not shown), confirming chaining alone
|
||||
is sufficient to achieve high accuracy for approximate mapping. Minimap2 and
|
||||
higher mapping accuracy (Fig.~\ref{fig:eval}a). Minimap2 and
|
||||
NGMLR provide better mapping quality estimate: they rarely give repetitive hits
|
||||
high mapping quality (Fig.~\ref{fig:eval}b). Apparently, other aligners may
|
||||
high mapping quality. Apparently, other aligners may
|
||||
occasionally miss close suboptimal hits and be overconfident in wrong mappings.
|
||||
On run time, minialign is slightly faster than minimap2 and Kart. They are over
|
||||
30 times faster than the rest. Minimap2 consumed 6.1GB memory at the peak,
|
||||
more than BWA-MEM but less than others.
|
||||
On run time, minimap2 took 200 CPU seconds, comparable to minialign and Kart, and is over
|
||||
30 times faster than the rest. Minimap2 consumed 6.8GB memory at the peak,
|
||||
more than BWA-MEM (5.4GB), similar to NGMLR and less than others.
|
||||
|
||||
On real human SMRT reads, the relative performance and sensitivity of
|
||||
On real human SMRT reads, the relative performance and fraction of mapped reads reported by
|
||||
these aligners are broadly similar to the metrics on simulated data. We are
|
||||
unable to provide a good estimate of mapping error rate due to the lack of the
|
||||
truth. On ONT $\sim$100kb human reads~\citep{Jain128835}, BWA-MEM failed.
|
||||
@@ -406,19 +543,19 @@ confirm the observation by~\citet{Sedlazeck169557} that BWA-MEM often breaks
|
||||
them into shorter gaps. The issue is much alleviated with minimap2, thanks
|
||||
to the 2-piece affine gap cost.
|
||||
|
||||
\subsection{Aligning spliced reads}
|
||||
\subsection{Aligning long spliced reads}
|
||||
|
||||
We evaluated minimap2 on SIRV control data~(AC:SRR5286959;
|
||||
\citealp{Byrne:2017aa}) where the truth is known. Minimap2 predicted 59\,916
|
||||
introns from 11\,017 reads. 93.0\% of splice juctions are precise. We examined
|
||||
\citealp{Byrne:2017aa}) where the truth is known. Minimap2 predicted 59\,918
|
||||
introns from 11\,018 reads. 93.8\% of splice juctions are precise. We examined
|
||||
wrongly predicted junctions and found the majority were caused by clustered
|
||||
splicing signals (e.g. two adjacent ${\tt GT}$ sites). When INDEL sequencing
|
||||
errors are frequent, it is difficult to find precise splicing sites in this
|
||||
case. If we allow up to 10bp distance from true splicing sites, 98.4\% of
|
||||
aligned introns are approximately correct. Given this observation, we might be
|
||||
able to improve boundary detection by initializing $d(\cdot)$ and $a(\cdot)$ in
|
||||
Eq.~(\ref{eq:splice}) with position-specific scoring matrices or more
|
||||
sophisticated models. We have not tried this approach.
|
||||
aligned introns are approximately correct. It is worth noting that for SIRV, we
|
||||
asked minimap2 to model the ${\tt GT..AG}$ splicing signal only without extra
|
||||
bases. This is because SIRV does not honor the evolutionarily prevalent signal
|
||||
${\tt GT[A/G]..[C/T]AG}$~\citep{Irimia:2008aa}.
|
||||
|
||||
\begin{table}[!tb]
|
||||
\processtable{Evaluation of junction accuracy on 2D ONT reads}
|
||||
@@ -427,18 +564,18 @@ sophisticated models. We have not tried this approach.
|
||||
\toprule
|
||||
& GMAP & minimap2 & SpAln & STAR\\
|
||||
\midrule
|
||||
Run time (CPU min) & 631 & 15.5 & 2\,076 & 33.9 \\
|
||||
Run time (CPU min) & 631 & 15.9 & 2\,076 & 33.9 \\
|
||||
Peak RAM (GByte) & 8.9 & 14.5 & 3.2 & 29.2\vspace{1em}\\
|
||||
\# aligned reads & 103\,669 & 103\,917 & 103\,711 & 26\,479\\
|
||||
\# chimeric alignments & 1\,904 & 1\,671 & 0 & 0\\
|
||||
\# non-spliced alignments & 15\,854 & 14\,483 & 17\,033 & 10\,545\vspace{1em}\\
|
||||
\# aligned introns & 692\,275 & 694\,237 & 692\,945 & 78\,603 \\
|
||||
\# novel introns & 11\,239 & 3\,217 & 8\,550 & 1\,214 \\
|
||||
\% exact introns & 83.8\% & 91.8\% & 87.9\% & 55.2\% \\
|
||||
\% approx. introns & 91.8\% & 96.5\% & 92.5\% & 82.4\% \\
|
||||
\# aligned reads & 103\,669 & 104\,199 & 103\,711 & 26\,479 \\
|
||||
\# chimeric alignments & 1\,904 & 1\,488 & 0 & 0 \\
|
||||
\# non-spliced alignments & 15\,854 & 14\,798 & 17\,033 & 10\,545\vspace{1em}\\
|
||||
\# aligned introns & 692\,275 & 693\,553 & 692\,945 & 78\,603 \\
|
||||
\# novel introns & 11\,239 & 3\,113 & 8\,550 & 1\,214 \\
|
||||
\% exact introns & 83.8\% & 94.0\% & 87.9\% & 55.2\% \\
|
||||
\% approx. introns & 91.8\% & 96.9\% & 92.5\% & 82.4\% \\
|
||||
\botrule
|
||||
\end{tabular}
|
||||
}{Mouse reads (AC:SRR5286960) were mapped to the primary assembly of mouse
|
||||
}{Mouse cDNA reads (AC:SRR5286960; R9.4 chemistry) were mapped to the primary assembly of mouse
|
||||
genome GRCm38 with the following tools and command options: minimap2 (`-ax
|
||||
splice'); GMAP (`-n 0 --min-intronlength 30 --cross-species'); SpAln (`-Q7 -LS
|
||||
-S3'); STARlong (according to
|
||||
@@ -447,7 +584,7 @@ compared to the EnsEMBL gene annotation, release 89. A predicted intron
|
||||
is \emph{novel} if it has no overlaps with any annotated introns. An intron
|
||||
is \emph{exact} if it is identical to an annotated intron. An intron is
|
||||
\emph{approximate} if both its 5'- and 3'-end are within 10bp around the ends
|
||||
of an annotated intron.}
|
||||
of an annotated intron. Chimeric alignments are defined in the SAM spec~\citep{Li:2009ys}.}
|
||||
\end{table}
|
||||
|
||||
We next aligned real mouse reads~\citep{Byrne:2017aa} with GMAP~(v2017-06-20;
|
||||
@@ -456,10 +593,20 @@ STAR~(v2.5.3a; \citealp{Dobin:2013kx}). In general, minimap2 is more
|
||||
consistent with existing annotations (Table~\ref{tab:intron}): it finds
|
||||
more junctions with a higher percentage being exactly or approximately correct.
|
||||
Minimap2 is over 40 times faster than GMAP and SpAln. While STAR is close to
|
||||
minimap2 in speed, it does not work well with noisy reads. We have also
|
||||
evaluated spliced aligners on public Iso-Seq data (human Alzheimer brain
|
||||
from \href{http://bit.ly/isoseqpub}{http://bit.ly/isoseqpub}). The observation
|
||||
is similar: minimap2 is faster at higher junction accuracy.
|
||||
minimap2 in speed, it does not work well with noisy reads.
|
||||
|
||||
We have also evaluated spliced aligners on a human Nanopore Direct RNA-seq
|
||||
dataset (\href{http://bit.ly/na12878ont}{http://bit.ly/na12878ont}). Minimap2
|
||||
aligned 10 million reads in $<$1 wall-clock hour using 16 CPU cores. 94.2\% of
|
||||
aligned splice junctions consistent with gene annotations. In comparison,
|
||||
GMAP under option `-k 14 -n 0 --min-intronlength 30 --cross-species' is 160
|
||||
times slower; 68.7\% of GMAP junctions are found in known gene annotations. The
|
||||
percentage increases to 84.1\% if an aligned junction within 10bp from an
|
||||
annotated junction is considered to be correct. On a public Iso-Seq dataset
|
||||
(human Alzheimer brain from
|
||||
\href{http://bit.ly/isoseqpub}{http://bit.ly/isoseqpub}), minimap2 is also
|
||||
faster at higher junction accuracy in comparison to other aligners in
|
||||
Table~\ref{tab:intron}.
|
||||
|
||||
We noted that GMAP and SpAln have not been optimized for noisy reads. We are
|
||||
showing the best setting we have experimented, but their developers should be
|
||||
@@ -470,39 +617,107 @@ able to improve their accuracy further.
|
||||
%{\footnotesize
|
||||
%\begin{tabular}{lrrrr}
|
||||
%\toprule
|
||||
%& GMAP & minimap2 & SpAln & STAR\\
|
||||
% & GMAP & minimap2 & SpAln & STAR \\ % one GMAP thread took 14 days to align a tiny fraction of reads
|
||||
%\midrule
|
||||
%Run time (CPU min) & & 243 & 2\,352 & 1\,647 \\
|
||||
%\# aligned reads & & 1\,123\,025 & 1\,094\,092 & 682\,452\\
|
||||
%\# chimeric alignments & & 33\,091 & 0 & 0\\
|
||||
%\# non-spliced alignments & & 339\,081 & 291\,447 & 272\,536\vspace{1em}\\
|
||||
%\# aligned introns & & 9\,071\,755 & 9\,208\,564 & 3\,029\,121 \\
|
||||
%\# novel introns & & 42\,773 & 82\,230 & 17\,791 \\
|
||||
%\% exact introns & & 94.9\% & 91.7\% & 84.7\% \\
|
||||
%\% approx. introns&& 96.9\% & 93.4\% & 93.8\% \\
|
||||
%Run time (CPU min) & - & 243 & 2,352 & 1,647 \\
|
||||
%\# aligned reads & 1,113,502 & 1,123,025 & 1,094,092 & 682,452 \\
|
||||
%\# chimeric alignments & 48,927 & 33,091 & 0 & 0 \\
|
||||
%\# non-spliced alignments & 334,097 & 339,081 & 291,447 & 272,536 \vspace{1em}\\
|
||||
%\# aligned introns & 8,922,221 & 9,071,755 & 9,208,564 & 3,029,121 \\
|
||||
%\# novel introns & 48,927 & 42,773 & 82,230 & 17,791 \\
|
||||
%\% exact introns & 90.6\% & 94.9\% & 91.7\% & 84.7\% \\
|
||||
%\% approx. introns & 94.0\% & 96.9\% & 93.4\% & 93.8\% \\
|
||||
%\botrule
|
||||
%\end{tabular}
|
||||
%}{}
|
||||
%\end{table}
|
||||
|
||||
\subsection{Aligning short genomic reads}
|
||||
|
||||
\section{Conclusion}
|
||||
We evaluated minimap2 along with Bowtie2~(v2.3.3; \citealt{Langmead:2012fk}), BWA-MEM and
|
||||
SNAP (v1.0beta23; \citealt{Zaharia:2011aa}). Minimap2 is 3--4 times as fast as Bowtie2 and
|
||||
BWA-MEM, but is 1.3 times slower than SNAP. Minimap2 is more accurate on this
|
||||
simulated data set than Bowtie2 and SNAP but less accurate than BWA-MEM
|
||||
(Fig.~\ref{fig:eval}b). Closer investigation reveals that BWA-MEM achieves
|
||||
a higher accuracy partly because it tries to locally align a read in a small
|
||||
region close to its mate. If we disable this feature, BWA-MEM becomes slightly
|
||||
less accurate than minimap2. We might implement a similar heuristic
|
||||
in minimap2 in future.
|
||||
|
||||
Minimap2 is a fast, accurate and versatile aligner for long nucleotide
|
||||
sequences. In addition to reference-based read mapping, minimap2 inherits
|
||||
minimap's functionality to search against huge multi-species databases and to
|
||||
find read overlaps. On a few test data sets, minimap2 appears to yield slightly
|
||||
better miniasm assembly~\citep{Li:2016aa}. Minimap2 can also align similar
|
||||
genomes or different assemblies of the same species. However, full-genome
|
||||
alignment is an intricate research topic. More thorough evaluations would be
|
||||
necessary to justify the use of minimap2 for such applications.
|
||||
To evaluate the accuracy of minimap2 on real data, we aligned human reads
|
||||
(AC:ERR1341796) with BWA-MEM and minimap2, and called SNPs and small INDELs
|
||||
with GATK HaplotypeCaller v3.5~\citep{Depristo:2011vn}. This run was sequenced
|
||||
from experimentally mixed CHM1 and CHM13 cell lines. Both of them are homozygous
|
||||
across the whole genome and have been \emph{de novo} assembled with SMRT reads
|
||||
to high quality. This allowed us to construct an independent truth variant
|
||||
dataset~\citep{Li223297} for
|
||||
ERR1341796. In this evaluation, minimap2 has higher SNP false negative rate
|
||||
(FNR; 2.6\% of minimap2 vs 2.3\% of BWA-MEM), but fewer false positive SNPs per
|
||||
million bases (FPPM; 7.0 vs 8.8), similar INDEL FNR (11.2\% vs 11.3\%) and
|
||||
similar INDEL FPPM (6.4 vs 6.5). Minimap2 is broadly comparable to BWA-MEM in the
|
||||
context of small variant calling.
|
||||
|
||||
\subsection{Aligning long-read assemblies}
|
||||
|
||||
Minimap2 can align a SMRT assembly (AC:GCA\_001297185.1) against GRCh38 in 7
|
||||
minutes using 8 CPU cores, over 20 times faster than nucmer from
|
||||
MUMmer4~\citep{Marcais:2018aa}. With the paftools.js script from the minimap2
|
||||
package, we called 2.67 million single-base substitutions out of 2.78Gbp
|
||||
genomic regions. The transition-to-transversion ratio (ts/tv) is 2.01. In
|
||||
comparison, using MUMmer4's dnadiff pipeline, we called 2.86 million
|
||||
substitutions in 2.83Gbp at ts/tv=1.87. Given that ts/tv averaged across the
|
||||
human genome is about 2 but ts/tv averaged over random errors is 0.5, the
|
||||
minimap2 callset arguably has higher precision at lower sensitivity.
|
||||
|
||||
The sample being assembled is a female. Minimap2 still called 201 substitutions
|
||||
on the Y chromosome. These substitutions all come from one contig aligned at
|
||||
96.8\% sequence identity. The contig could be a segmental duplication
|
||||
absent from GRCh38. In constrast, dnadiff called 9070 substitutions on the Y
|
||||
chromosome across 73 SMRT contigs. This again implies our minimap2-based
|
||||
pipeline has higher precision.
|
||||
|
||||
\section{Discussions}
|
||||
|
||||
Minimap2 is a versatile mapper and pairwise aligner for nucleotide sequences.
|
||||
It works with short reads, assembly contigs and long noisy genomic and RNA-seq
|
||||
reads, and can be used as a read mapper, long-read overlapper or a full-genome
|
||||
aligner. Minimap2 is also accurate and efficient, often outperforming other
|
||||
domain-specific alignment tools in terms of both speed and accuracy.
|
||||
|
||||
The capability of minimap2 comes from a fast base-level alignment algorithm and
|
||||
an accurate chaining algorithm. When aligning long query sequences, base-level
|
||||
alignment is often the performance bottleneck. The Suzuki-Kasahara algorithm
|
||||
greatly alleviates the bottleneck and enables DP-based splice alignment
|
||||
involving $>$100kb introns, which was impractically slow ten years ago. The
|
||||
minimap2 chaining algorithm is fast and highly accurate by itself. In fact,
|
||||
chaining alone is more accurate than all the other long-read mappers in
|
||||
Fig.~\ref{fig:eval}a (data not shown). This accuracy helps to reduce downstream
|
||||
base-level alignment of candidate chains, which is still several times slower than
|
||||
chaining even with the Suzuki-Kasahara improvement. In addition, taking a
|
||||
general form, minimap2 chaining can be adapted to non-typical data types such as
|
||||
spliced reads and multiple reads per fragment. This gives us the opportunity to
|
||||
extend the same base algorithm to a variety of use cases.
|
||||
|
||||
Modern mainstream aligners often use a full-text index, such as suffix array or
|
||||
FM-index, to index reference sequences. An advantage of this approach is that
|
||||
we can use exact seeds of arbitrary lengths, which helps to increase seed
|
||||
uniqueness and reduce unsuccessful extensions. Minimap2 indexes reference
|
||||
k-mers with a hash table instead. Such fixed-length seeds are inferior to
|
||||
variable-length seeds in theory, but can be computed much more efficiently in
|
||||
practice. When a query sequence has multiple seed hits, we can afford to skip
|
||||
highly repetitive seeds without affecting the final accuracy. This further
|
||||
alleviates the concern with the seeding uniqueness. At the same time, at low
|
||||
sequence identity, it is rare to see long seeds anyway. Hash table is the ideal
|
||||
data structure for mapping long noisy sequences.
|
||||
|
||||
\section*{Acknowledgements}
|
||||
We owe a debt of gratitude to Hajime Suzuki for releasing his masterpiece and
|
||||
insightful notes before formal publication. We thank M. Schatz, P. Rescheneder
|
||||
and F. Sedlazeck for pointing out the limitation of BWA-MEM. We are also
|
||||
grateful to early minimap2 testers who have greatly helped to suggest features
|
||||
and to fix various issues.
|
||||
We owe a debt of gratitude to H. Suzuki and M. Kasahara for releasing their
|
||||
masterpiece and insightful notes before formal publication. We thank M.
|
||||
Schatz, P. Rescheneder and F. Sedlazeck for pointing out the limitation of
|
||||
BWA-MEM. We are also grateful to minimap2 users who have greatly helped to
|
||||
suggest features and to fix various issues.
|
||||
|
||||
\paragraph{Funding\textcolon} NHGRI 1R01HG010040-01
|
||||
|
||||
\bibliography{minimap2}
|
||||
|
||||
|
||||
@@ -0,0 +1,62 @@
|
||||
Q 60 18579866 27 0.000001453 18579866
|
||||
Q 59 27087 4 0.000001666 18606953
|
||||
Q 58 21435 1 0.000001718 18628388
|
||||
Q 57 45663 3 0.000001874 18674051
|
||||
Q 56 36031 2 0.000001978 18710082
|
||||
Q 55 18499 2 0.000002082 18728581
|
||||
Q 54 14754 2 0.000002187 18743335
|
||||
Q 53 25541 2 0.000002291 18768876
|
||||
Q 52 26397 5 0.000002554 18795273
|
||||
Q 51 15090 3 0.000002711 18810363
|
||||
Q 50 13425 11 0.000003294 18823788
|
||||
Q 49 15175 2 0.000003397 18838963
|
||||
Q 48 19407 4 0.000003606 18858370
|
||||
Q 47 11538 16 0.000004452 18869908
|
||||
Q 46 12558 17 0.000005349 18882466
|
||||
Q 45 40362 28 0.000006817 18922828
|
||||
Q 44 10465 13 0.000007500 18933293
|
||||
Q 43 10098 20 0.000008552 18943391
|
||||
Q 42 10682 19 0.000009549 18954073
|
||||
Q 41 9823 11 0.000010125 18963896
|
||||
Q 40 9685 16 0.000010963 18973581
|
||||
Q 39 10273 18 0.000011905 18983854
|
||||
Q 38 9515 18 0.000012847 18993369
|
||||
Q 37 9474 27 0.000014261 19002843
|
||||
Q 36 10430 25 0.000015568 19013273
|
||||
Q 35 9241 34 0.000017348 19022514
|
||||
Q 34 9162 31 0.000018968 19031676
|
||||
Q 33 10164 49 0.000021532 19041840
|
||||
Q 32 9152 55 0.000024408 19050992
|
||||
Q 31 9252 35 0.000026233 19060244
|
||||
Q 30 9872 55 0.000029103 19070116
|
||||
Q 29 8938 65 0.000032496 19079054
|
||||
Q 28 8951 73 0.000036306 19088005
|
||||
Q 27 9949 95 0.000041261 19097954
|
||||
Q 26 9784 97 0.000046316 19107738
|
||||
Q 25 10126 97 0.000051366 19117864
|
||||
Q 24 11260 123 0.000057765 19129124
|
||||
Q 23 10047 114 0.000063691 19139171
|
||||
Q 22 9661 123 0.000070083 19148832
|
||||
Q 21 10339 168 0.000078813 19159171
|
||||
Q 20 17928 193 0.000088804 19177099
|
||||
Q 19 9842 193 0.000098817 19186941
|
||||
Q 18 14737 247 0.000111605 19201678
|
||||
Q 17 10218 238 0.000123934 19211896
|
||||
Q 16 10271 242 0.000136457 19222167
|
||||
Q 15 12241 333 0.000153683 19234408
|
||||
Q 14 9189 336 0.000171070 19243597
|
||||
Q 13 9493 515 0.000197734 19253090
|
||||
Q 12 11502 743 0.000236185 19264592
|
||||
Q 11 8211 507 0.000262390 19272803
|
||||
Q 10 9133 606 0.000293695 19281936
|
||||
Q 9 10014 931 0.000341801 19291950
|
||||
Q 8 8436 698 0.000377816 19300386
|
||||
Q 7 8443 705 0.000414163 19308829
|
||||
Q 6 10203 944 0.000462808 19319032
|
||||
Q 5 6936 756 0.000501760 19325968
|
||||
Q 4 6732 843 0.000545190 19332700
|
||||
Q 3 8215 1104 0.000602040 19340915
|
||||
Q 2 21201 5440 0.000882342 19362116
|
||||
Q 1 82328 22186 0.002019600 19444444
|
||||
Q 0 553853 371953 0.020562901 19998297
|
||||
U 1703
|
||||
@@ -0,0 +1,240 @@
|
||||
\documentclass{bioinfo}
|
||||
\copyrightyear{2021}
|
||||
\pubyear{2021}
|
||||
|
||||
\usepackage{graphicx}
|
||||
\usepackage{hyperref}
|
||||
\usepackage{url}
|
||||
\usepackage{amsmath}
|
||||
\usepackage[ruled,vlined]{algorithm2e}
|
||||
\newcommand\mycommfont[1]{\footnotesize\rmfamily{\it #1}}
|
||||
\SetCommentSty{mycommfont}
|
||||
\SetKwComment{Comment}{$\triangleright$\ }{}
|
||||
|
||||
\usepackage{natbib}
|
||||
\bibliographystyle{apalike}
|
||||
|
||||
\DeclareMathOperator*{\argmax}{argmax}
|
||||
|
||||
\begin{document}
|
||||
\firstpage{1}
|
||||
|
||||
\title[Improvements to minimap2]{New strategies to improve minimap2 alignment accuracy}
|
||||
\author[Li]{Heng Li$^{1,2}$}
|
||||
\address{$^1$Dana-Farber Cancer Institute, 450 Brookline Ave, Boston, MA 02215, USA,
|
||||
$^2$Harvard Medical School, 10 Shattuck St, Boston, MA 02215, USA}
|
||||
|
||||
\maketitle
|
||||
|
||||
\begin{abstract}
|
||||
|
||||
\section{Summary:} We present several recent improvements to minimap2, a
|
||||
versatile pairwise aligner for nucleotide sequences. Now minimap2 v2.22 can
|
||||
more accurately map long reads to highly repetitive regions and align through
|
||||
insertions or deletions up to 100kb by default, addressing major weakness in
|
||||
minimap2 v2.18 or earlier.
|
||||
|
||||
\section{Availability and implementation:}
|
||||
\href{https://github.com/lh3/minimap2}{https://github.com/lh3/minimap2}
|
||||
|
||||
\section{Contact:} hli@ds.dfci.harvard.edu
|
||||
\end{abstract}
|
||||
|
||||
\section{Introduction}
|
||||
Minimap2~\citep{Li:2018ab} is widely used for maping long sequence
|
||||
reads and assembly contigs. \citet{Jain:2020aa} found minimap2 v2.18 or earlier occasionally
|
||||
misaligned reads from highly repetitive regions as minimap2 ignored seeds of
|
||||
high occurrence. They also noticed minimap2 may misplace reads with structural
|
||||
variations (SVs) in such regions~\citep{Jain2020.11.01.363887}. These
|
||||
misalignments have become a pressing issue in the advent of
|
||||
temolere-to-telomore human assembly~\citep{Miga:2020aa}. Meanwhile, old minimap2
|
||||
was unable to efficiently align long insertions/deletions (INDELs) and often
|
||||
breaks an alignment around variable-number tandem repeats (VNTRs). This has
|
||||
inspired new chaining algorithms~\citep{Li:2020aa,Ren:2021aa} which are not
|
||||
integrated into minimap2. Here we will describe recent efforts implemented
|
||||
in v2.19 through v2.22 to improve mapping results.
|
||||
|
||||
\begin{methods}
|
||||
\section{Methods}
|
||||
|
||||
\subsection{Rescuing high-occurrence $k$-mers}\label{sec:high-occ}
|
||||
Minimap2 keeps all $k$-mer minimizers~\citep{Roberts:2004fv} during indexing. Its original
|
||||
implementation only selected low-occurrence minimizers during mapping. The
|
||||
cutoff is a few hundred for mapping long reads against a human genome. If a
|
||||
read habors only a few or even no low-occurrence minimizers, it will fail
|
||||
chaining due to insufficient anchors.
|
||||
|
||||
To resolve this issue, we implemented a new heuristic to add additional
|
||||
minimizers. Suppose we are looking at two adjacent low-occurence $k$-mers
|
||||
located at position $x_1$ and $x_2$, respectively. If $|x_1-x_2|\ge L$,
|
||||
minimap2 v2.22 additionally selects $\lfloor|x_1-x_2|/L\rfloor$ minimizers
|
||||
of the lowest occurrence among minimizers between $x_1$ and $x_2$. Here
|
||||
parameter $L$ controls the frequency of sampling. It defaults to 500.
|
||||
This strategy adds necessary anchors at the cost of increasing total alignment
|
||||
time by a few percent on real data.
|
||||
|
||||
\subsection{Aligning through longer INDELs}
|
||||
The original minimap2 may fail to align long INDELs due to its chaining
|
||||
heuristics. Briefly, minimap2 applies dynamic programming (DP) to chain
|
||||
minimizer anchors. This is a quadratic algorithm, slow for chaining
|
||||
contigs. For acceptable performance, the original minimap2 uses a 500bp band by
|
||||
default, which means a gap longer than 500bp will stop chaining.
|
||||
To align through longer gaps, older minimap2 implemented a long-join heurstic as follows.
|
||||
If there is an INDEL longer than 500bp and the two chains around the INDEL
|
||||
have no overlaps on either the query or the reference sequence, minimap2 may
|
||||
join the two short chains later.
|
||||
This heuristic may fail around VNTRs because short chains
|
||||
often have overlaps in VNTRs. More subtly, minimap2 may escape the inner DP
|
||||
loop early, again for performance, if the chaining result is not improved for
|
||||
50 iterations. When there is a copy number change in a long segmental
|
||||
duplication, the early escape may break around the event even if users
|
||||
specify a large band.
|
||||
|
||||
In minigraph~\citep{Li:2020aa}, we developed a new chaining algorithm that
|
||||
finds up to 1kb INDELs with DP-based chaining and goes through longer INDELs with a
|
||||
subquadratic algorithm~\citep{DBLP:conf/wabi/AbouelhodaO03}. We ported the same
|
||||
algorithm to minimap2 for contig mapping. For long-read mapping, the minigraph
|
||||
algorithm is slower. Minimap2 v2.22 still uses the DP-based algorithm to
|
||||
find short chains and then invokes the minigraph algorithm to rechain anchors in
|
||||
these short chains. The rechaining step achieves the same goal as long-join
|
||||
but is more reliable because it can resolve overlaps between short chains. The old
|
||||
long-join heuristic has since been removed.
|
||||
|
||||
\subsection{Properly mapping long reads with SVs}
|
||||
The original minimap2 ranks an alignment by its Smith-Waterman score and
|
||||
outputs the best scoring alignment. However, when there are SVs on the read,
|
||||
the best scoring alignment is sometimes not the correct alignment.
|
||||
\citet{Jain2020.11.01.363887} resolved this dilemma by altering the mapping
|
||||
algorithm.
|
||||
|
||||
In our view, this problem is rooted in inapropriate scoring: affine-gap penalty
|
||||
over-penalizes a long INDEL that was often evolutionarily created in one event.
|
||||
We should not penalize a SV by a function linear in the SV length. Minimap2 v2.22 instead rescores
|
||||
an alignment with the following scoring function. Suppose an alignment consists
|
||||
of $M$ matching bases, $N$ substitutions and $G$ gap opens, we empirically
|
||||
score the alignment with
|
||||
$$
|
||||
S=M-\frac{N+G}{2d}-\sum_{i=1}^G\log_2(1+g_i)
|
||||
$$
|
||||
where $g_i\ge1$ is the length of the $i$-th gap and
|
||||
$$
|
||||
d=\max\left\{\frac{N+G}{M+N+G},0.02\right\}
|
||||
$$
|
||||
It approximates per-base sequence divergence except with the smallest value set
|
||||
to 2\%. As an analogy to affine-gap scoring, the matching score in our scheme
|
||||
is 1, the mismatch and gap open penalties are both $1/2d$ and the gap extension
|
||||
penalty is a logarithm function of the gap length~\citep{Gu:1995wt}. Our scoring gives a long SV
|
||||
a much milder penalty. In terms of time complexity, scoring an alignment is
|
||||
linear in the length of the alignment. The time spent on rescoring is negligible in
|
||||
practice.
|
||||
|
||||
%If we assume sequences evolve under a duplication-mutation model, we may have a
|
||||
%better way to choose the best alignment. If a long read can be mapped to $n$
|
||||
%loci, we can take the read as the template and build a
|
||||
%pseudo-multi-sequence-alignment (pMSA) of $n+1$ sequences. In this pMSA, we say
|
||||
%a site on the read is informative if the $n$ reference subsequences differ at
|
||||
%the position.
|
||||
|
||||
\end{methods}
|
||||
|
||||
\section{Results}
|
||||
|
||||
\begin{table}
|
||||
\processtable{Evaluation of minimap2 v2.22}
|
||||
{\footnotesize\label{tab:1}\begin{tabular}{p{4.2cm}rrrr}
|
||||
\toprule
|
||||
$[$Benchmark$]$ Metric & v2.22 & v2.18 & Winno & lra \\
|
||||
\midrule
|
||||
$[$sim-map$]$ \% mapped reads at Q10 & 97.9 & 97.6 & {\bf 99.0}& 97.3 \\
|
||||
$[$sim-map$]$ err. rate at Q10 (phredQ) & {\bf 52} & {\bf 52} & 38 & 24 \\
|
||||
$[$winno-cmp$]$ rate of diff. (phredQ) & {\bf 41} & 37 & truth & 18 \\
|
||||
$[$winno-cmp$]$ CPU time (hour) & {\bf 5.0} & 5.3 & 71.8 & 13.1 \\
|
||||
$[$winno-cmp$]$ peak RAM (Gb) & 17.1 & 14.4 & {\bf 9.6} & 12.4 \\
|
||||
$[$sim-sv$]$ \% false negative rate & {\bf 0.5} & 2.0 & {\bf 0.5} & 1.4 \\
|
||||
$[$sim-sv$]$ \% false discovery rate & {\bf 0.0} & 0.1 & {\bf 0.0} & 0.1 \\
|
||||
$[$real-sv-1k$]$ \% false negative rate & {\bf 7.3} & 20.0 & 13.0 & N/A \\
|
||||
$[$real-sv-1k$]$ \% false discovery rate & 2.7 & {\bf 2.4} & 2.7 & N/A \\
|
||||
\botrule
|
||||
\end{tabular}}
|
||||
{In $[$sim-map$]$, 152,713 reads were simulated from the CHM13 telomere-to-telomere assembly v1.1
|
||||
(AC: GCA\_009914755.3) with pbsim2~\citep{Ono:2021aa}: ``pbsim2 -{}-hmm\_model R94.model -{}-length-min
|
||||
5000 -{}-length-mean 20000 -{}-accuracy-mean 0.95''. Alignments of mapping quality
|
||||
10 or higher were evaluated by ``paftools.js mapeval''. The mapping error rate
|
||||
is measured in the phred scale: if the error rate is $e$, $-10\log_{10}e$ is
|
||||
reported in the table. In $[$winno-cmp$]$, 1.39 million CHM13 HiFi reads from
|
||||
SRR11292121 were mapped against the same CHM13 assembly. 99.3\% of them were mapped by Winnowmap2
|
||||
at mapping quality 10 or higher and were taken as ground truth to evaluate
|
||||
minimap2 and lra with ``paftools.js pafcmp''. $[$sim-sv$]$ simulated 1,000
|
||||
50bp to 1000bp INDELs from chr8 in CHM13 using SURVIVOR~\citep{Jeffares:2017aa} and simulated Nanopore
|
||||
reads at 30-fold coverage with the same pbsim2 command line. SVs were called with
|
||||
``sniffles -q 10''~\citep{Sedlazeck:2018ab} and compared to the simulated truth with ``SURVIVOR eval
|
||||
call.vcf truth.bed 50''. In $[$real-sv-1k$]$, small and long variants were
|
||||
called by dipcall-0.3~\citep{Li:2018aa} for HG002 assemblies (AC: GCA\_018852605.1 and
|
||||
GCA\_018852615.1) and compared to the GIAB truth~\citep{Zook:2020aa} using ``truvari -r 2000 -s
|
||||
1000 -S 400 -{}-multimatch -{}-passonly'' which sets the minimum INDEL size to 1kb in evaluation. }
|
||||
\end{table}
|
||||
|
||||
We evaluated minimap2 v2.22 along with v2.18, Winnowmap2 v2.03 and lra v1.3.2
|
||||
(Table~\ref{tab:1}), using the default setting of each mapper according to the input data types.
|
||||
Both versions of minimap2 achieved high mapping accuracy on
|
||||
simulated Nanopore reads (sim-map). Winnowmap2 aligned more reads at mapping
|
||||
quality 10 or higher (mapQ10). However, it may occasionally assign a high mapping
|
||||
quality to a read with multiple identical best alignments. This reduced its
|
||||
mapping accuracy.
|
||||
|
||||
In lack of groud truth for real data, we took Winnowmap2 mapping as ground
|
||||
truth to evaluate other mappers (winno-cmp in Table~\ref{tab:1}). Out of 1,378,092 reads with mapQ10
|
||||
alignments by Winnowmap2, minimap2 v2.22 could map all of them. 118 reads, less
|
||||
than 0.01\% of all reads, were mapped differently by v2.22. 51 of them have
|
||||
multiple identical best alignments. We believe these are more likely to be
|
||||
Winnowmap2 errors. Most of the remaining 67 (=118-51) reads have multiple
|
||||
highly similar but not identical alignments.
|
||||
Minimap2 v2.18 is less consistent with 275 differences including 30 unmapped
|
||||
reads mappable by both Winnowmap2 and v2.22.
|
||||
|
||||
For the minimizer rescuing parameter $L$ in Section~\ref{sec:high-occ},
|
||||
we set its default to 500 such that v2.22 has comparable performance to v2.18 given simulated PacBio and Nanopore human reads.
|
||||
To see the effect of this parameter on real data, we tried several different $L$ values.
|
||||
v2.22 gave 99 mapping differences at $L=200$,
|
||||
118 at $L=500$ (default), 167 at $L=750$ and 224 differences at $L=1000$ in comparison to Winnowmap2.
|
||||
$L=200$ is 28\% slower than the default while $L=1000$ is 9\% faster.
|
||||
Changing the default minimizer window size (option ``-w'')
|
||||
and the initial minimizer occurrence cutoff (option ``-f'')
|
||||
also affects performance and accuracy to a similar magnitude.
|
||||
|
||||
The two benchmarks above only evaluate read mappings when there are no variations between the reads and the reference.
|
||||
To measure the mapping accuracy in the presence of SVs (sim-sv), we reproduced
|
||||
the results by~\citep{Jain2020.11.01.363887}. Minimap2 v2.22 is as good as
|
||||
Winnowmap2 now. Note that we were setting the Sniffles mapping quality
|
||||
threshold to 10 in consistent with the benchmarks above. If we used the
|
||||
default threshold 20, v2.22 would miss additional five SVs (accounting for
|
||||
0.5\% of simulated SVs). For four out of these five missing SVs, minimap2 v2.22
|
||||
mapped more variant reads than Winnowmap2. Sniffles did not call these SVs
|
||||
because minimap2 tended to give them conservative mapping quality. It is worth
|
||||
noting that the simulation here only considers a simple scenario in evolution.
|
||||
Non-allelic gene conversions, which happen often in segmental
|
||||
duplications~\citep{Harpak:2017aa}, would obscure the optimal mapping
|
||||
strategies. How much such simple SV simulation informs real-world SV calling
|
||||
remains a question.
|
||||
|
||||
To see if minimap2 v2.22 could improve long INDEL alignment, we ran dipcall on
|
||||
contig-to-reference alignments and focused on INDELs longer than 1kb
|
||||
(real-sv-1k). v2.22 is more sensitive at comparable specificity, confirming its
|
||||
advantage in more contiguous alignment. We could not get dipcall to work well with lra,
|
||||
so did not report the numbers.
|
||||
|
||||
Minimap2 spends most computing time on base alignment. As recent improvements
|
||||
in v2.22 incur little additional computing and do not change the base alignment
|
||||
algorithm, the new version has similar performance to older versions. It is
|
||||
consistently faster than Winnowmap2 by several times. Sometimes simple
|
||||
heuristics can be as effective as more sophisticated yet slower solutions.
|
||||
|
||||
\section*{Acknowledgements}
|
||||
We thank Arang Rhie and Chirag Jain for providing motivating examples for which
|
||||
older minimap2 underperforms.
|
||||
|
||||
\paragraph{Funding\textcolon} This work is funded by NHGRI grant R01HG010040.
|
||||
|
||||
\bibliography{minimap2}
|
||||
|
||||
\end{document}
|
||||
+12
-30
@@ -1,30 +1,12 @@
|
||||
Q 60 32066 0 0.000000000
|
||||
Q 40 32 1 0.000031155
|
||||
Q 38 19 1 0.000062272
|
||||
Q 36 11 1 0.000093376
|
||||
Q 35 32 1 0.000124378
|
||||
Q 33 15 1 0.000155400
|
||||
Q 32 58 1 0.000186145
|
||||
Q 27 11 1 0.000217095
|
||||
Q 26 80 1 0.000247494
|
||||
Q 21 19 2 0.000309186
|
||||
Q 20 16 1 0.000339936
|
||||
Q 19 19 1 0.000370622
|
||||
Q 18 22 2 0.000432099
|
||||
Q 17 37 5 0.000585751
|
||||
Q 15 24 2 0.000646930
|
||||
Q 14 18 3 0.000738939
|
||||
Q 13 30 6 0.000922821
|
||||
Q 12 18 1 0.000953054
|
||||
Q 11 29 2 0.001013638
|
||||
Q 10 30 1 0.001043393
|
||||
Q 9 20 5 0.001196099
|
||||
Q 8 25 8 0.001440348
|
||||
Q 7 28 6 0.001622830
|
||||
Q 6 35 12 0.001988132
|
||||
Q 5 34 12 0.002352725
|
||||
Q 4 29 8 0.002594865
|
||||
Q 3 36 14 0.003018937
|
||||
Q 2 46 15 0.003471482
|
||||
Q 1 69 36 0.004558162
|
||||
Q 0 167 94 0.007377173
|
||||
Q 60 32084 0 0.000000000 32084
|
||||
Q 24 318 2 0.000061725 32402
|
||||
Q 11 98 2 0.000123077 32500
|
||||
Q 8 37 2 0.000184405 32537
|
||||
Q 7 37 3 0.000276294 32574
|
||||
Q 6 40 3 0.000367940 32614
|
||||
Q 5 34 2 0.000428816 32648
|
||||
Q 4 37 5 0.000581306 32685
|
||||
Q 3 28 6 0.000764222 32713
|
||||
Q 2 38 6 0.000946536 32751
|
||||
Q 1 50 21 0.001585318 32801
|
||||
Q 0 286 150 0.006105117 33087
|
||||
|
||||
+13
-17
@@ -1,17 +1,13 @@
|
||||
Q 60 32072 0 0.000000000
|
||||
Q 43 206 1 0.000030981
|
||||
Q 27 201 1 0.000061578
|
||||
Q 15 59 1 0.000092200
|
||||
Q 12 25 1 0.000122839
|
||||
Q 11 16 1 0.000153473
|
||||
Q 10 24 1 0.000184032
|
||||
Q 9 17 2 0.000245248
|
||||
Q 8 27 3 0.000336938
|
||||
Q 7 23 1 0.000367309
|
||||
Q 6 20 1 0.000397675
|
||||
Q 5 18 4 0.000519751
|
||||
Q 4 17 1 0.000550038
|
||||
Q 3 29 5 0.000702204
|
||||
Q 2 32 4 0.000823522
|
||||
Q 1 54 6 0.001004872
|
||||
Q 0 234 106 0.004202697
|
||||
Q 60 32477 0 0.000000000 32477
|
||||
Q 22 16 1 0.000030776 32493
|
||||
Q 21 44 1 0.000061468 32537
|
||||
Q 19 73 1 0.000091996 32610
|
||||
Q 14 66 1 0.000122414 32676
|
||||
Q 10 26 3 0.000214054 32702
|
||||
Q 8 14 1 0.000244529 32716
|
||||
Q 7 13 2 0.000305539 32729
|
||||
Q 6 47 1 0.000335611 32776
|
||||
Q 3 10 1 0.000366010 32786
|
||||
Q 2 20 2 0.000426751 32806
|
||||
Q 1 248 94 0.003267381 33054
|
||||
Q 0 31 17 0.003778147 33085
|
||||
|
||||
+25
-17
@@ -14,7 +14,7 @@ set size 1.59,1.04
|
||||
set multiplot layout 1,2
|
||||
|
||||
set label "(a)" at graph -0.245,1.06 font "Helvetica-bold,40"
|
||||
set xlab "Error rate of mapped reads"
|
||||
set xlab "Error rate of mapped PacBio reads"
|
||||
set ylab "Fraction of mapped reads" off +1.8
|
||||
set ytics 0.02
|
||||
set yran [0.9:1]
|
||||
@@ -34,19 +34,27 @@ unset label
|
||||
set origin 0.8,0
|
||||
set size 0.79,1
|
||||
set label "(b)" at graph -0.245,1.06 font "Helvetica-bold,40"
|
||||
unset log
|
||||
unset format
|
||||
unset key
|
||||
set log y
|
||||
set ylab "Accumulative mapping error rate" off +0
|
||||
set xlab "Mapping quality"
|
||||
set yran [1e-5:0.1]
|
||||
set ytics 1e-5,0.1
|
||||
set format y "10^{%L}"
|
||||
set xran [60:0] reverse
|
||||
plot "<./eval2roc.pl blasr-mc.eval" u 1:2 w lp ls 4, \
|
||||
"<./eval2roc.pl bwa.eval" u 1:2 t "bwa-mem" w lp ls 2, \
|
||||
"<./eval2roc.pl graphmap.eval" u 1:2 t "graphmap" w lp ls 3, \
|
||||
"<./eval2roc.pl minialign.eval" u 1:2 t "minialign" w lp ls 1, \
|
||||
"<./eval2roc.pl mm2.eval" u 1:2 t "minimap2" w lp ls 6, \
|
||||
"<./eval2roc.pl ngmlr.eval" u 1:2 t "ngm-lr" w lp ls 5
|
||||
set xlab "Error rate of mapped short reads"
|
||||
|
||||
set key top left
|
||||
plot "<./eval2roc.pl -n2e7 bowtie2-s3.sam.eval" u 2:3 t "bowtie2" w lp ls 5, \
|
||||
"<./eval2roc.pl -n2e7 bwa-s3.sam.eval" u 2:3 t "bwa-mem" w lp ls 2, \
|
||||
"<./eval2roc.pl -n2e7 mm2-s3.sam.eval" u 2:3 t "minimap2" w lp ls 6, \
|
||||
"<./eval2roc.pl -n2e7 snap-s3.sam.eval" u 2:3 t "snap" w lp ls 3
|
||||
|
||||
#unset log
|
||||
#unset format
|
||||
#unset key
|
||||
#set log y
|
||||
#set ylab "Accumulative mapping error rate" off +0
|
||||
#set xlab "Mapping quality"
|
||||
#set yran [1e-5:0.1]
|
||||
#set ytics 1e-5,0.1
|
||||
#set format y "10^{%L}"
|
||||
#set xran [60:0] reverse
|
||||
#plot "<./eval2roc.pl blasr-mc.eval" u 1:2 w lp ls 4, \
|
||||
# "<./eval2roc.pl bwa.eval" u 1:2 t "bwa-mem" w lp ls 2, \
|
||||
# "<./eval2roc.pl graphmap.eval" u 1:2 t "graphmap" w lp ls 3, \
|
||||
# "<./eval2roc.pl minialign.eval" u 1:2 t "minialign" w lp ls 1, \
|
||||
# "<./eval2roc.pl mm2.eval" u 1:2 t "minimap2" w lp ls 6, \
|
||||
# "<./eval2roc.pl ngmlr.eval" u 1:2 t "ngm-lr" w lp ls 5
|
||||
|
||||
@@ -0,0 +1,62 @@
|
||||
Q 60 18993268 10320 0.000543350 18993268
|
||||
Q 59 33156 216 0.000553756 19026424
|
||||
Q 58 29982 295 0.000568365 19056406
|
||||
Q 57 9412 278 0.000582666 19065818
|
||||
Q 56 11012 228 0.000594281 19076830
|
||||
Q 55 9968 235 0.000606283 19086798
|
||||
Q 54 8602 292 0.000621301 19095400
|
||||
Q 53 6094 259 0.000634662 19101494
|
||||
Q 52 5026 257 0.000647946 19106520
|
||||
Q 51 4278 224 0.000659522 19110798
|
||||
Q 50 3682 178 0.000668708 19114480
|
||||
Q 49 2750 156 0.000676772 19117230
|
||||
Q 48 2314 112 0.000682548 19119544
|
||||
Q 47 2056 96 0.000687495 19121600
|
||||
Q 46 1658 62 0.000690677 19123258
|
||||
Q 45 1492 74 0.000694493 19124750
|
||||
Q 44 1150 56 0.000697379 19125900
|
||||
Q 43 1062 48 0.000699850 19126962
|
||||
Q 42 976 60 0.000702951 19127938
|
||||
Q 41 884 36 0.000704800 19128822
|
||||
Q 40 708 52 0.000707493 19129530
|
||||
Q 39 870 26 0.000708819 19130400
|
||||
Q 38 598 26 0.000710156 19130998
|
||||
Q 37 542 34 0.000711913 19131540
|
||||
Q 36 846 50 0.000714495 19132386
|
||||
Q 35 590 50 0.000717087 19132976
|
||||
Q 34 550 42 0.000719261 19133526
|
||||
Q 33 2174 66 0.000722628 19135700
|
||||
Q 32 876 86 0.000727089 19136576
|
||||
Q 31 638 104 0.000732500 19137214
|
||||
Q 30 1718 196 0.000742675 19138932
|
||||
Q 29 91022 968 0.000789497 19229954
|
||||
Q 28 12864 781 0.000829556 19242818
|
||||
Q 27 5806 427 0.000851489 19248624
|
||||
Q 26 25274 728 0.000888144 19273898
|
||||
Q 25 7418 680 0.000923070 19281316
|
||||
Q 24 11800 701 0.000958839 19293116
|
||||
Q 23 57328 3933 0.001159250 19350444
|
||||
Q 22 7662 846 0.001202494 19358106
|
||||
Q 21 5924 617 0.001233989 19364030
|
||||
Q 20 4623 574 0.001263330 19368653
|
||||
Q 19 4988 942 0.001311627 19373641
|
||||
Q 18 3968 793 0.001352282 19377609
|
||||
Q 17 3630 681 0.001387166 19381239
|
||||
Q 16 2921 513 0.001413422 19384160
|
||||
Q 15 2716 424 0.001435095 19386876
|
||||
Q 14 2366 365 0.001453744 19389242
|
||||
Q 13 2169 412 0.001474828 19391411
|
||||
Q 12 2077 360 0.001493233 19393488
|
||||
Q 11 2016 441 0.001515815 19395504
|
||||
Q 10 2292 738 0.001553682 19397796
|
||||
Q 9 4165 1832 0.001647772 19401961
|
||||
Q 8 3963 1862 0.001743385 19405924
|
||||
Q 7 3927 1793 0.001835408 19409851
|
||||
Q 6 3572 1639 0.001919497 19413423
|
||||
Q 5 3270 1533 0.001998126 19416693
|
||||
Q 4 3046 1610 0.002080718 19419739
|
||||
Q 3 251447 125550 0.008436553 19671186
|
||||
Q 2 24390 13537 0.009113417 19695576
|
||||
Q 1 124406 86780 0.013434624 19819982
|
||||
Q 0 171254 153874 0.021016609 19991236
|
||||
U 8764
|
||||
Reference in New Issue
Block a user