Compare commits

..
582 Commits
Author SHA1 Message Date
Heng Li 3c28777e7e Release minimap2-2.31 (r1302) 2026-05-19 18:39:04 -04:00
Heng Li d8371a403b removed duplicate check in sim2bed 2026-04-25 00:35:59 -04:00
Heng LiandClaude Opus 4.5 e5066c7976 added sim2bed to convert simulated read names to BED
Co-Authored-By: Claude Opus 4.5 <noreply@anthropic.com>
2026-04-25 00:22:26 -04:00
Heng Liandgemini-cli f8381755f1 r1299: fix wrong subchain selection
This and the last bug were both reported by Jeremy Wang.

Co-authored-by: gemini-cli <gemini-cli@users.noreply.github.com>
2026-04-24 16:17:45 -04:00
Heng Li 80d92c686f r1298: fixed out-of-bound local alignment
I believe this would not lead to memory violation; it may occasionally include
a few base beyond the intended alignment start/end.
2026-04-24 13:25:19 -04:00
Heng Li 37a650f58c output simulated identity with badread 2026-04-14 12:49:35 -04:00
Heng Li 4ca5a951ca command line help 2026-04-13 23:52:07 -04:00
Heng Li dd5b2c04b8 Merge remote-tracking branch 'remotes/origin/master' 2026-04-13 23:43:43 -04:00
Heng Li ca6f4dc5e2 convert badread output to evaluation format 2026-04-13 23:43:11 -04:00
blawrence-ont de3c6ec646 Fix use-after-free in mappy (#1345)
mm_map_aux() takes in |b._b| which can end up reallocating |km| at the
end of mm_map_frag_core(). Since the address of |km| is cached before
those calls it ends up pointing to freed memory.

This can result in a crash as seen in #1183, however it also happens to
Just Work most of the time since the new allocation often lands at the
same address as the old one. Preloading ASAN or a similar replacement
allocator that doesn't have that behaviour results in a reliable crash.
2026-02-13 12:14:56 -05:00
Heng Li e2542e6425 Merge remote-tracking branch 'remotes/origin/master' 2025-12-12 11:39:33 -05:00
Heng Li 9bb4d2bed4 r1290: support ds in Python 2025-12-12 11:39:01 -05:00
Alex Leonard 6d49eb690f convert unmapped reads in sam2paf (#1324) 2025-10-05 19:43:23 -04:00
Heng Li bd0cba5012 upgrade arm64-linux to v3 2025-09-09 13:52:16 -04:00
Heng Li 370f3f8236 add an alert about phishing 2025-09-09 11:23:09 -04:00
Heng Li 79c9cc186b Release minimap2-2.30 (r1287) 2025-06-15 17:54:11 -04:00
Heng Li ea4c8935bd added one more example
This shows STAR doesn't try to match the GTR..YAG consensus.
2025-06-03 20:22:14 -04:00
Heng Li 3187782b1a r1285: better --spsc support 2025-05-26 15:47:14 -04:00
Heng Li 005c9a1f6b exoneval may skip terminal exons in aa mode 2025-05-17 23:06:41 -04:00
Heng Li 1fd85be6e2 Release minimap2-2.29 (r1283) 2025-04-18 13:41:47 -04:00
Heng Li e616b0dacf drafted the release notes 2025-04-18 13:17:13 -04:00
Heng Li b58b97423a r1281: with --write-junc, ignore aln with low mapQ 2025-04-17 21:46:54 -04:00
Heng Li df9e650346 r1280: heuristic to avoid aligning full introns
This speeds up alignment a lot
2025-04-16 23:38:39 -04:00
Heng Li 7a540c37ca r1278: reduced --min-dp-len to 20 for splice:sr
30% reduced time at 0.01% more junction errors
2025-04-16 21:55:59 -04:00
Heng Li c19e3ccb86 r1277: don't apply rescored filtering with -P
Since v2.19-ish, minimap2 rescores base alignment based on the best alignment
of a read. This heuristic sometimes improve the mapping accuracy of the best
alignment but may too aggressively filter weaker hits.

Resolve #969
2025-04-14 22:26:47 -04:00
Heng Li 94d171b01e r1276: skip unnecessary reverse spliced alignment
for short-read RNA-seq only
2025-04-14 14:57:23 -04:00
Heng Li ff312a2957 documented 2-pass in README 2025-04-13 17:14:44 -04:00
Heng Li 01ccedd5a0 r1275: renamed --jump-pass1 to --pass1
Also documented 2-pass
2025-04-13 17:07:39 -04:00
Heng Li 819b3bf017 r1274: a little better pass-1
Also fixed a bug in jump
2025-04-13 13:55:15 -04:00
Heng Li e88110463a r1273: reading pass1 junctions works
but we need extra logic when using them. Tomorrow.
2025-04-13 00:47:28 -04:00
Heng Li fb81e150f2 r1272: support pass-1 junction processing
NOT tested yet
2025-04-12 23:15:04 -04:00
Heng Li d930ea94ad r1271: code refactoring in prep for 2-pass 2025-04-11 17:20:34 -04:00
Heng Li a832a42f6f r1270: fixed ts tag for PE reads
this also fixed the wrong --write-junc
2025-04-11 01:08:16 -04:00
Heng Li a5411fc3c0 r1269: added --write-junc
in preparation for 2-pass
2025-04-11 01:00:15 -04:00
Heng Li bd03d975fc r1268: avoid extra small introns 2025-04-07 23:32:56 -04:00
Heng Li 9c3c4b1ce8 r1267: penalize introns without signals 2025-04-07 09:51:33 -04:00
Heng Li 3542a3d153 r1266: fine tune mapq for short RNA-seq reads 2025-04-07 00:57:39 -04:00
Heng Li 75619c7b51 r1265: prefer spliced alignment
mapq needs to be elevated
2025-04-07 00:31:04 -04:00
Heng Li fbb9c0fcba r1264: added --jump-min-match, default to 3
To match STAR
2025-04-06 23:18:55 -04:00
Heng Li af094640e5 r1263: ~5-10% performance improvement
Via larger batches and more short-read heuristics. Identical alignment on 2
million reads. Short DNA-seq read alignment may be improved in corner cases.
2025-04-06 20:48:55 -04:00
Heng Li d43f356ef9 fixed minor grammar issues 2025-04-06 18:35:46 -04:00
Heng Li 38acd6617f r1261: code clean up; renamed --jump-bed to -j
Also added --pairing to replace --no-pairing and --pe-ind-chain
2025-04-06 18:32:58 -04:00
Heng Li 3d351267a0 document --jump-bed 2025-04-06 17:43:11 -04:00
Heng Li 54a4718c9b r1259: --jump-bed now functional 2025-04-06 17:12:49 -04:00
Heng Li dbc12b2838 r1258: update blen, mlen and dp_max0 2025-04-06 15:26:01 -04:00
Heng Li 2ed264db4e r1257: fixed the sorting of BED files 2025-04-06 10:53:16 -04:00
Heng Li a8094ad859 r1256: working for one example, but still buggy 2025-04-06 10:33:57 -04:00
Heng Li 1877818239 r1255: moved jump code to a separate file 2025-04-06 09:33:51 -04:00
Heng Li 9ede5c4255 backup 2025-04-06 00:07:15 -04:00
Heng Li 405511fe8d Merge branch 'master' into junc-jump 2025-04-04 16:37:39 -04:00
Heng Li dd90d9dde6 caution that the splice:sr is experimental 2025-04-04 16:34:40 -04:00
Heng Li a8c567b5e9 r1251: read junctions for jumps 2025-04-04 16:23:19 -04:00
Heng Li d9d3c0cc3f refactored --junc-bed 2025-04-03 21:02:50 -04:00
Heng Li cbe8d61ca4 r1249: remove redundant junctions in --junc-bed 2025-04-03 20:43:06 -04:00
Heng Li 9d06cef13e r1248: support --end-bonus in splice mode
but this is not enabled by default for now
2025-04-02 21:39:41 -04:00
Heng Li 924fc4d671 minor 2025-04-02 13:06:03 -04:00
Heng Li fc2d1e95b3 document splice:sr in README 2025-04-02 11:24:44 -04:00
Heng Li bbf0bb871b r1245: allow shorter hits for splice:sr 2025-04-02 00:13:37 -04:00
Heng Li 83e9b2e28c r1242: append /[12] to read name in --frag mode
Resolve #1079
2025-04-01 10:48:15 -04:00
Heng Li e816fd071c r1241: error out on unintended --score-N
Resolve #1226
2025-04-01 10:12:53 -04:00
Heng Li a955b1f31d documented zd; resolve #1108 2025-04-01 09:34:05 -04:00
Heng Li 54fa925e2e r1240: fixed wrong logging information
resolve #1192
2025-04-01 09:17:39 -04:00
Heng Li d4a396c5c3 r1239: resovled #963 2025-03-31 23:15:34 -04:00
Heng Li bdf46f5786 r1238: resolve #589 2025-03-31 23:08:37 -04:00
Heng Li f536b69b81 r1237: documented -x splice:sr 2025-03-30 21:47:47 -04:00
Heng Li 4b8b4418df r1236: support paired-end short-read RNA-seq 2025-03-30 19:30:19 -04:00
Heng Li ce30004e02 r1235: allow --splice and --frag at the same time
This seems to largely work, though the accuracy is reduced and no pairs are
proper. More investigation needed for practical uses.
2025-03-30 16:32:38 -04:00
Heng Li 54f8e5f7d6 r1234: added splice:sr for SE RNA-seq 2025-03-30 15:54:12 -04:00
Heng Li 2857de7dbd Merge remote-tracking branch 'remotes/origin/master' 2025-03-29 22:44:26 -04:00
Heng Li e18935fbad r1230: make juncevla work for paired-end SAM 2025-03-29 22:43:44 -04:00
Chang Y 74ebfb2532 fix error (#1223) 2025-03-21 18:21:15 -04:00
Martin Grigorov a0cbe2e4d2 Add CI job for Linux & Mac ARM64 too (#1205)
* Add CI job for Linux ARM64 too

Signed-off-by: Martin Tzvetanov Grigorov <mgrigorov@apache.org>

* Add build job for Mac ARM64 too

Signed-off-by: Martin Tzvetanov Grigorov <mgrigorov@apache.org>

* Pass "arm_neon=1 aarch64=1" when building on ARM64

Signed-off-by: Martin Tzvetanov Grigorov <mgrigorov@apache.org>

* change aarch64 to arm64 for the Mac ARM64 check

Signed-off-by: Martin Tzvetanov Grigorov <mgrigorov@apache.org>

---------

Signed-off-by: Martin Tzvetanov Grigorov <mgrigorov@apache.org>
2025-03-21 18:19:26 -04:00
Heng Li 618d33515e more condition on length differences 2024-11-17 19:45:46 -05:00
Heng Li a10d4f4496 merge colinear blocks 2024-11-17 15:17:13 -05:00
Heng Li 1eea2fee11 a new script to cluster similar sequences 2024-11-16 16:39:13 -05:00
Heng Li 1d346d56bc Merge remote-tracking branch 'remotes/origin/master' 2024-11-16 16:36:07 -05:00
Heng Li 46750de966 not working well and rarely used in practice 2024-11-16 16:35:24 -05:00
Leon Rauschning 7d8bbb74a8 Add sc_ambi and max_chain_skip parameters to mappy.pyx (#1240)
* add sc_ambi option to cython interface

* add max_gaplen param

* set max_chain_skip to arg instead of forcing 255
2024-11-15 08:56:36 -05:00
James Webber c6db201b38 Update README.md (#1245)
fixed documentation for paftools
2024-11-15 08:54:25 -05:00
Rob PatroandRob Patro 358a39850f Allow passing read name to mappy (#1260)
* Allow passing read name to mappy

This adds the (optional) ability to pass the read
name to the mappy `map` method.  Without the
read name, the call to `map` can sometimes give
different output than the command line version
of `minimap2` because of the way minimap uses
the hash of the read name to break ties in ordering
hits.  This can affect which / if certain
supplementary alignments are generated, and even
which / if non-primary alignments are generated.

* Pass name directly to mm_map_aux

Get rid of additional function, and always
accept the name parameter in the mm_map_aux
function (can be nullptr if not available).

---------

Co-authored-by: Rob Patro <rob@newton>
2024-11-15 08:51:10 -05:00
Heng Li fcb5d5e6eb r1221: warn about file reading errors
Resolves #1229
2024-10-15 22:44:06 -04:00
Heng Li 95807a2224 added "junc_pen" to python accordingly 2024-10-13 23:58:33 -04:00
Heng Li a4c93e9377 support X and = in mapeval 2024-10-12 23:31:17 -04:00
Heng Li 7d69334e69 Merge remote-tracking branch 'remotes/origin/master' 2024-10-12 23:28:38 -04:00
Heng Li 3e1ab2951d document --spsc 2024-10-12 23:27:46 -04:00
Heng Li 68179ed195 r1215: scoring apparently works 2024-10-12 22:29:27 -04:00
Heng Li d1f4c8d232 implemented ksw scoring; not tested 2024-10-11 23:58:18 -04:00
Heng Li 8efe83b744 fill the junction array
modifying ksw will be the next
2024-10-11 23:22:23 -04:00
Heng Li 042c8d4d71 added --junc-pen; it does nothing for now 2024-10-11 21:27:25 -04:00
Heng Li e4e1f7843b backup for spsc 2024-10-10 22:43:50 -04:00
Marcus Fedarko 69e3629916 Mention in man page that CIGAR strings in SA tags are approximate (#1213)
* Mention approx CIGAR strings in man page #724

* Fix FAQ typo
2024-05-22 15:58:33 -04:00
Heng Li 0cc3cdca27 ignore filtered SVs in sveval 2024-04-07 17:12:31 -04:00
Heng Li 8170693de3 Release minimap2-2.28 (r1209) 2024-03-27 10:57:17 -04:00
Heng Li e3d8c708ac r1208: reverted RMQ gap coefficient
Such that minimap2 can give the same alignment in other modes
2024-03-27 08:48:10 -04:00
Heng Li 119bdc6029 r1207: reduced cap_kalloc from 1G to 500M
This reduces the peak memory.
2024-03-20 15:53:12 -04:00
Heng Li 89d4d219cd r1206: enabled RMQ for lr:hqae
Also fixed a bug in determining inner_dist for RMQ. It should have no effect on
previous presets.
2024-03-20 15:29:54 -04:00
Heng Li f51ff1abac r1205: updated lr:hqae 2024-03-20 14:06:59 -04:00
Heng Li 27b254ed6f backup; DON'T USE!!! 2024-03-20 10:21:10 -04:00
Heng Li c881b14ba5 r1203: added preset lr:hqae 2024-03-20 00:25:57 -04:00
Heng Li f18dadb1c4 r1202: halved RMQ gap cost 2024-03-19 23:47:54 -04:00
Heng Li a83b8fe7cc r1201: renamed --dbg-seed-freq to --dbg-seed-occ 2024-03-19 21:53:09 -04:00
Heng Li c22bfe7722 r1200: added --rmq-inner and --dbg-seed-freq 2024-03-19 21:52:07 -04:00
Heng Li 12d441ea22 Merge remote-tracking branch 'origin/master' 2024-03-19 21:47:52 -04:00
Heng Li c7433c2811 r1197: sam2paf to output primary only 2024-03-19 21:47:31 -04:00
Joyjit Daw 5279377544 Fix MD generation check in SAM writing (#1181)
The existing logic checked for is_MD == 1, but
the function is called with a bitwise operator check
which does not evaluate to 1.
2024-03-19 19:20:21 -04:00
Heng Li acab05781e Merge remote-tracking branch 'remotes/origin/master' 2024-03-19 09:56:13 -04:00
Heng Li 98c23bc6d2 r1194: output NM in sam2paf 2024-03-19 09:55:16 -04:00
kojix2 9b0ff2418c Fix mm_mapopt_t in Mappy (#1177)
Add transition. Related to #1069
2024-03-13 22:15:46 -04:00
Heng Li b6762503a9 Release minimap2-2.27 (r1193) 2024-03-12 13:20:07 -04:00
Heng Li 9667468e89 NEWS draft 2024-03-11 22:46:47 -04:00
Heng Li ba60aac6f6 r1191: fixed wrong reverse() and revcomp()
due to k8 incompatibility. Resolves #1161
2024-03-11 22:09:01 -04:00
Heng Li fcd4df2a73 r1190: output unadjusted dp_max to ms:i
This was an oversight affecting v2.22+. The latest minimap2 ranks hits and
estimates mapping quality with an adjusted alignment score (see the minimap2
update paper). This score however is not calculated when there is only one hit.
As a result, the ms:i tag varies depends on other sequences in the reference
genome, which is confusing. This change lets minimap2 to output the unadjusted
score at ms:i. At present, the adjusted score is not outputted.

Resolves #1146
2024-03-11 17:19:13 -04:00
Heng Li 0efc886012 r1189: fixed an out-of-memory issue
Resolves #1166
2024-03-11 10:14:20 -04:00
Heng Li 940388f8e4 r1188: added --ds to output tag ds
Adapted from minigraph
2024-03-10 15:01:13 -04:00
Heng Li 23d2674c39 r1187: set stage for the ds tag; not added yet 2024-03-10 14:12:56 -04:00
Heng Li a12673611f Merge remote-tracking branch 'origin/master' 2024-03-10 13:49:30 -04:00
Heng Li 8140259974 r1183: added lr:hq; fixed transition
* Added the lr:hq preset suggested by Nanopore developers (#1127)
 * Fixed transition scoring. It did not work with presets.
 * Cleaned up preset documentation
2024-03-10 13:47:34 -04:00
blawrence-ont f3e59fc2a0 Avoid NULL pointer dereference (#1154)
If the allocated region is 0 bytes then it's unsafe to dereference it.

Fixes #1147.
2024-01-24 12:32:05 -05:00
Pesho Ivanov fc2e1607d7 Update paftools.js (#1145)
In mapeval "-Q INT" reports wrong alignments with mapQ>=INT, not with mapQ>INT
2024-01-03 09:06:08 -05:00
Heng Li bc588c0eeb r1182: improved paftools.js compatibility
Older k8/v8 can't use large memory. The previous change read large FASTA as
strings and might have problems. The new change tests k8 version.
2023-10-30 16:37:29 -04:00
Heng Li ab717023b6 reverted to the previous paftools.js 2023-10-30 16:24:18 -04:00
Heng Li 9506e7ac3f r1180: paftools.js call compatibility with k8-1.0 2023-10-28 15:54:37 -04:00
Heng Li ce03fbc275 Merge remote-tracking branch 'remotes/origin/master' 2023-10-24 09:53:51 -04:00
Heng Li 98a3aa1b39 document --secondary-seq in manpage
Resolve #1122
2023-10-24 09:52:39 -04:00
Donaim ae05f8485f Add bw_long option to mappy's Aligner class (#1124)
The Minimap2 behavior was found to handle sequences with large
deletions differently when upgraded from v2.17 to v2.26, causing
potential issues in projects mapping extensive deletions of ~1200 base
pairs. The originally suggested solution of setting `-r 500,500` was
observed to be partially non-applicable since the Python Wrapper,
`mappy`, only allowed manipulation of parameter `bw`.

In response to issue #1111, where this was originally reported,
this commit introduces a modification in the Python wrapper,
`mappy`. Until now, `mappy` only allowed manipulation of the `bw`
parameter, preventing the suggested fix of setting `-r 500,500`.

This commit introduces a modification in the Python wrapper to include
the `bw_long` option in the `Aligner` class. Consequently, both
parameters `bw` and `bw_long` can be manipulated, thereby allowing the
desired Minimap2 behavior encountered in version 2.17. As a result,
this patch ensures consistent handling of sequences containing large
deletions irrespective of the version upgrade."

Closes #1111
2023-10-24 09:23:06 -04:00
Aaron Darlingandkoadman ace990c381 Illumina Complete Long Read presets (#1069)
* Implements a transition-aware alignment scoring scheme and configuration presets for ICLR

* Fix to enable use of general scoring matrix in ksw as suggested by lh3

---------

Co-authored-by: koadman <>
2023-06-04 11:06:15 -04:00
Heng Li e28a55be86 Release minimap2-2.26 (r1175) 2023-04-29 12:21:09 -04:00
Heng Li f8d46a7a30 Revert #868 and use the old setup.py 2023-04-29 11:48:41 -04:00
Heng Li 4483f89ee5 Release minimap2-2.25 (r1173) 2023-04-25 12:44:52 -04:00
Heng Li f1b3c7ad06 added -ldl for asan on some linux 2023-04-25 11:14:15 -04:00
Heng Li 180faa3594 r1171: add operator priority explicit with ()
I can never remember the operator priority of & and &&
2023-04-21 11:09:07 -04:00
Mikhail KolmogorovandHeng Li 704fbc6f5c An option to output SEQ field for secondary alignment (#687)
* a new option --secondary-seq to output SEQ field for secondary alignments

* comments removed

* Fixed a conflict in #687

---------

Co-authored-by: Heng Li <lh3@me.com>
2023-04-21 11:06:13 -04:00
Heng Li fc24c8a348 r1169: improved kexpand compatibility 2023-04-21 10:53:23 -04:00
Chris Seymour e68d868806 use updated kalloc macros (#1051)
* use updated kalloc macros

* review

* get the reference

* store the reference

* last one
2023-04-21 10:45:53 -04:00
Alex Payne c3d461e22a mappy check index flags before mapping
mappy creates a CIGAR string by default (`-c` flag) and so is
incompatible with indexes that are created using the `--idx-no-seq`
flag.

The previous implementation of mappy did not check for the `MM_I_NO_SEQ`
flag and would seg fault when attempting to map a read or retrieve a
reference sequence from the index. This patch adds a check to both
`mappy.Aligner.seq` and `mappy.Aligner.map` and returns `None` if there
is no index sequences. I've chose `None` as this is inline with the
behaviour of mappy for reads that do not align/retreiving sequences that
aren't in the index, however it might be better to raise an exception so
that this error is distinct and can be communicated to the caller.
2023-04-19 21:49:58 -04:00
Heng Li c41518ae85 r1166: sync kalloc with miniwfa and miniprot 2023-04-19 21:38:47 -04:00
Chris Seymour 819d843e3c make mm_tbuf_t public 2023-04-19 21:32:23 -04:00
Heng Li 5e7242303c r1164: changed the syntax of -J 2023-04-07 22:54:33 -04:00
Heng Li a026c69b89 r1163: increased the default -I to 8G
To reduce accidental errors when mapping against diploid human assemblies.
2023-04-07 01:22:22 -04:00
Heng Li ea2042a577 r1162: fixed a typo; also increased splice pen
Now slightly better on ISO-seq
2023-04-07 01:19:18 -04:00
Heng Li 1834b1fd42 r1161: merged the simple and complex models 2023-04-06 23:42:50 -04:00
Heng Li 7ced0f16a0 r1160: splice model code cleanup 2023-04-06 23:32:06 -04:00
Heng Li 35732f3025 Merge branch 'master' into splice-model 2023-04-06 21:09:18 -04:00
Alberto Zeni a6fab118c5 Fixed alignment result final update when computing the exact max value 2023-04-06 21:05:24 -04:00
Chris Seymour 6ce0dd8b70 move MM_VERSION define to minimap.h 2023-03-17 20:58:43 +01:00
Nils Homer 1d3c3eef03 Add HD header ilne to SAM output
#905
2023-02-14 09:12:03 -05:00
Heng Li 01b98e8e52 r1155: fixed a bug on parsing --rmq
resolves #1010
2023-01-17 09:09:25 -05:00
Heng Li 16b8d50199 removed debugging code 2023-01-06 11:16:09 -05:00
Heng Li 226fd6114c fixed a wrong comment. Resolves #997 2022-11-30 09:22:39 -05:00
Heng Li 822ccd1733 r1152: evaluate base Sn and Sp 2022-11-01 21:58:45 -04:00
Heng Li f67849c9af r1151: added exoneval 2022-11-01 21:10:35 -04:00
Heng Li b0b199f503 r1150: the prev impl counted one less submer 2022-10-21 21:00:22 -04:00
Heng Li c2f07ff2ac r1149: implemented random open syncmer
On the mm2-update dataset, -j8 leads to sparser k-mer selection at higher
accuracy. The speed becomes a little slower. There seems a benefit but not a
big one.
2022-10-21 19:07:28 -04:00
Heng Li cefd0d9f6c removed -b0 (a typo) 2022-10-21 17:37:04 -04:00
Heng Li 2a319c89aa support ##PAF lines in GFF3 2022-10-07 19:34:25 -04:00
Heng Li 85a5260408 correctly parse ##PAF lines in GFF3 (for miniprot) 2022-10-07 19:33:27 -04:00
Heng Li 6c2cbf7903 miniprot-like splice model
slightly worse on iso-seq and slightly better on direct-RNA
2022-10-06 09:10:17 -04:00
Heng Li 5aa4355ca8 extract junctions from GFF 2022-09-21 12:57:40 -04:00
Heng Li 6ed7263670 junceval for plain junction BED as input 2022-09-10 23:18:08 -04:00
Heng Li 315795eefd skip unmapped lines 2022-09-10 08:48:57 -04:00
Heng Li fc6869a9e8 r1141: junceval to support miniprot output 2022-09-09 16:28:23 -04:00
Heng Li 6252e5e367 sync with tag changes in miniprot 2022-09-09 14:48:17 -04:00
Heng Li 843729df1e output CDS and stop_codon 2022-09-09 12:09:38 -04:00
Heng Li 195c98fa46 output dist from end instead 2022-09-08 23:35:48 -04:00
Heng Li a2e6659d9b output more info 2022-09-08 23:18:13 -04:00
Heng Li e450f161bb added paf2gff 2022-09-08 22:33:21 -04:00
Heng Li 15cade0f06 added longcs2fa 2022-07-18 22:24:48 -04:00
Heng Li 767556b6f0 clarify multi-part index in option -I (#301) 2022-06-13 15:50:15 -04:00
Heng Li 50a26a60a6 option to keep Ensembl_canonical only 2022-05-14 11:18:06 -04:00
Heng Li 31de4fd1bc r1132: document misjoin output
Also additional check of centromeric breakpoints
2022-05-11 21:39:29 -04:00
Heng Li e018caea32 added the second minimap2 paper 2022-03-01 11:05:09 -05:00
Heng Li 7c02742fa8 removed travis CI 2022-03-01 11:01:13 -05:00
Chris Wright a41f5d1eeb Fix indentation 2022-03-01 10:41:01 -05:00
Chris Wright ed3d0eb328 fix undefined variable 2022-03-01 10:41:01 -05:00
Chris Wright e6d166a314 Build mappy via Makefile and libminimap2.a 2022-03-01 10:41:01 -05:00
Heng Li 06fedaadd0 typo on simde 2021-12-26 15:38:06 -05:00
Heng Li fe35e679e9 Release minimap2-2.24 (r1122) 2021-12-26 15:14:54 -05:00
Heng Li e25aa5ee74 r1121: change bw_long to bw if bw is longer
Resolve #852
2021-12-26 14:37:31 -05:00
Heng Li 3bde3450a0 r1121: updated obsolete settings in manpage
Resolve #851
2021-12-26 14:33:14 -05:00
Heng Li 36942ff711 r1119: fixed a typo in the new chaining code
Not affecting v2.23
2021-12-25 12:46:26 -05:00
Heng Li d3a89d34d4 r1118: use -r1k,100k for asm* modes 2021-12-23 20:43:54 -05:00
Heng Li c8f0a35c40 r1117: added --no-hash-name for deterministic 2021-11-24 16:49:48 -05:00
Heng Li fcaadc22b7 r1116: cut long chains at weak points 2021-11-20 19:07:44 -05:00
Heng Li db37fc43a7 r1115: prepare for chain breaking 2021-11-20 13:42:44 -05:00
Heng Li a8f1fa8ea3 r1114: retain more candidate inversion alignments 2021-11-18 21:37:10 -05:00
Heng Li b276772890 r1112: added --print-chains for debugging 2021-11-18 21:26:41 -05:00
Heng Li d0cff3eb36 Release minimap2-2.23 (r1111) 2021-11-18 17:11:48 -05:00
Heng Li ac334639ce r1110: default --cap-kalloc=1g; test more inv
See #816 and #823
2021-10-11 14:45:15 -04:00
Heng Li 546623dcb4 r1109: disable chain_skip_scale by default
Enabling the option slows down alignment, possibly because it fragments chains
in difficult regions.
2021-10-04 21:24:35 -04:00
Heng Li 39bdd45875 r1108: fixed missing inversions for #816 and #806 2021-10-04 16:34:30 -04:00
Heng Li aefa2c0d86 added --chain-skip-scale 2021-10-01 16:58:03 -04:00
Heng Li 7ee62dae1d updated manuscript 2021-10-01 11:42:36 -04:00
Heng Li 05a8a45d44 r1105: avoid long running time occasionally (#771)
Caused by highly repetitive minimizers on a query sequence. The solution is to
filter out these query minimizers.
2021-08-15 19:43:01 -04:00
Heng Li cc14d1afdf fixed typos 2021-08-08 11:18:02 -04:00
Heng Li bb3048b2a0 removed one extra sentence 2021-08-07 16:55:02 -04:00
Heng Li 5113ca2628 improved manuscript 2021-08-07 16:01:15 -04:00
Heng Li 7358a1ead1 Release minimap2-2.22 (r1101) 2021-08-07 11:30:31 -04:00
Heng Li 32f552957e Merge remote-tracking branch 'remotes/origin/master' 2021-08-07 10:40:02 -04:00
Heng Li a05edfa5ec a different ending sentence 2021-08-07 10:38:48 -04:00
Heng Li 8e81145817 finished the first draft 2021-08-07 00:33:31 -04:00
Heng Li e37f5ffe39 finished results 2021-08-07 00:06:28 -04:00
Heng Li 8a1d52bcbe r1094: for --split-prefix update max_dp at the end 2021-08-06 21:40:43 -04:00
Heng Li f7271a7c24 expose mapQ threshold to command line of pafcmp 2021-08-06 19:41:46 -04:00
Heng Li 70393eb46e minimap2 update manuscript 2021-08-06 19:41:17 -04:00
Heng Li 9d049f0562 added pafcmp 2021-08-05 12:41:21 -04:00
Heng Li 5180b70ff3 r1090: log wall-clock time for each read 2021-08-04 17:45:09 -04:00
Heng Li 2392e54fe2 r1089: fixed an unusual memory leak (#749)
This is more apparent when there are many candidate chains. Although only a
small numbers of them are extended, they are still occupying memory. A
realloc() solves this problem. This is a long existiing issue.
2021-08-04 17:07:00 -04:00
Heng Li 629c11728e output the number of mismatches 2021-08-04 17:05:06 -04:00
Ryan Lim 59488f0271 call mm_idx_destroy at the end of loop to fix memory leak 2021-07-26 18:25:08 -04:00
Heng Li 7e33fde82b dev-r1087: added --cap-kalloc 2021-07-19 21:20:04 -04:00
Heng Li c4fe52fb07 reduced the default -l and -b 2021-07-19 17:25:11 -04:00
Heng Li ead1cfbaca output for binning 2021-07-19 14:56:33 -04:00
Heng Li 83a535f148 dev-r1084: fixed flag integer overflow 2021-07-19 11:52:18 -04:00
Heng Li f3af29a8aa don't add a new command 2021-07-19 10:57:48 -04:00
Heng Li cf7eaef367 refactor and prepare for a new command 2021-07-19 00:36:17 -04:00
Heng Li 2411887d8e rename 2021-07-19 00:30:16 -04:00
Heng Li 1a8373bb84 dev-r1080: fixed negative dp_max 2021-07-18 21:07:14 -04:00
Heng Li 161ae7ff73 dev-r1079: per-read error rate
more tuning needed
2021-07-18 20:38:53 -04:00
Heng Li 8a6edab847 dev-r1078: decoupling ranking penalty 2021-07-18 16:22:48 -04:00
Heng Li 15118dd521 output #mismatches/#dels/#ins in view 2021-07-18 15:13:40 -04:00
Heng Li 2546999639 dev-r1076: log gap penalty 2021-07-17 18:23:59 -04:00
Heng Li 52fafe0fed updated pbsim to pbsim2 2021-07-17 18:18:26 -04:00
Heng Li 5f449c5cae fixed potential integer overflows 2021-07-16 17:20:05 -04:00
Heng Li b046052d82 Merge branch 'master' into utec 2021-07-16 13:32:47 -04:00
Jason Stajich 5cc3d2239f missing target object files from Makefile.simde to fix issue #779 2021-07-07 23:07:27 -04:00
Heng Li 581f2d7123 Release minimap2-2.21 (r1071) 2021-07-06 13:18:55 -04:00
Heng Li 52dbd439bc r1080: re-versioning 2021-07-02 20:26:13 -04:00
John Marshall 260a68d232 Use #defines for CIGAR operators in C code
Give the CIGAR constants names to clarify the code. So that ksw2.h
remains self-contained, define KSW_* versions of the CIGAR operators
it needs for use within ksw2.h. Other code should in general use the
full set of MM_CIGAR_* constants in minimap.h.
2021-07-02 13:03:03 -04:00
John Marshall 177eef259d Use the full MIDNSHP=X string whenever printing CIGAR strings
Define MM_CIGAR_STR to the full string of CIGAR operators (including
the 'B' operator as well) and use it throughout the C code.

It would be possible to use it from the Cython code too, but it's easier
to keep that as a Cython string literal to avoid adding extra runtime
code to handle locale conversion.
2021-07-02 13:03:03 -04:00
Heng Li 459ce04c84 r1069: fixed a regression in comparison to v2.18
for PE short reads. An interesting omission. Resolves #776
2021-07-02 11:45:21 -04:00
Heng Li e6cce019e4 r1068: fixed a bug caused by 3f71478
Resolves #752 (again)
2021-06-30 19:20:06 -04:00
Heng Li 7025b0b941 Merge branch 'master' of github.com:lh3/minimap2 2021-06-16 10:18:40 -04:00
Heng Li fe6a0bb337 r1064: fixed another uninitialized condition
This one should also be harmless. It affects a min value, but that value is not
actually used.
2021-06-16 10:16:36 -04:00
Heng Li 3f7147864b r1063: fixed an uninitialized access (#752)
This one is harmless.
2021-06-16 09:27:30 -04:00
Torsten Houwaart c83589b9ea Update README.md
Clarification on approximate mapping
2021-06-10 09:36:39 -04:00
Heng Li ce7a59f412 Fixed a typo in README
I just hate my butterfly keyboard!
2021-05-27 15:43:04 -04:00
Heng Li 15471bd629 Release minimap2-2.20 (r1061) 2021-05-27 15:26:04 -04:00
Heng Li ca19463268 r1060: safer ways to use -rNUM1,NUM2 2021-05-27 10:55:13 -04:00
Heng Li 4f8d1bc360 r1059: with --rmq, use the larger bandwidth 2021-05-26 23:01:49 -04:00
Heng Li 1776c0c645 missing seed.c in setup.py
Ok, I am not going to re-release again...
2021-05-26 21:36:09 -04:00
Heng Li 9febf532c1 Release minimap2-2.19 (r1057) 2021-05-26 21:23:42 -04:00
Heng Li cec23131e4 fixed a python compilation error
Caused by chain.c -> lchain.c
2021-05-26 21:20:48 -04:00
Heng Li ef09ccf104 Release minimap2-2.19 (r1055) 2021-05-26 21:01:03 -04:00
Heng Li e74dfd1aa9 r1054: fixed a memory leak 2021-05-26 12:32:04 -04:00
Heng Li f31705bb4a r1053: made junceval work with PAF 2021-05-26 11:54:46 -04:00
Heng Li 41d7ccb191 r1052: default -g to 5k 2021-05-24 16:46:16 -04:00
Heng Li 34a41197d7 r1051: added two internal parameters
rmq_rescue_size and rmq_rescue_ratio
2021-05-24 16:38:45 -04:00
Heng Li 9626b3e716 r1050: -r accepts two bandwidths 2021-05-24 16:29:21 -04:00
Heng Li 379728726a r1049: removed the long-join heuristics 2021-05-24 16:21:40 -04:00
Heng Li 4f91558160 r1048: rescue long gaps 2021-05-24 16:09:09 -04:00
Heng Li ec3bc6efd7 r1047: make gap penalty proportional to k-mer
closer to the older minimap2
2021-05-24 13:18:17 -04:00
Heng Li 8ec8866100 Merge branch 'master' into dev-rmq 2021-05-23 21:01:04 -04:00
Heng Li 9e7247cff9 sync python with recent changes 2021-05-23 21:00:15 -04:00
Ariel Erijman cd66777bfb small typo 2021-05-23 13:09:55 -04:00
Heng Li 5d7d25e92d Merge remote-tracking branch 'origin/master' 2021-05-23 13:08:52 -04:00
Heng Li 2a3793bbd2 clarify that map-hifi is for HEAD only
Resolves #747
2021-05-23 13:08:15 -04:00
Heng Li f97008a10e Merge branch 'master' into dev-rmq 2021-05-20 19:36:33 -04:00
Cornelius Roemer 10502e2a78 Fixed typo in Readme.md
deltion -> deletion
2021-05-14 15:38:30 -04:00
Don Kirkby 4422c0c6f9 Typo fix in Python README.
Thanks for sharing minimap2. Here's a little fix.
2021-05-14 15:38:12 -04:00
Heng Li 42a11e1d58 Changed Travis to Github Actions in README 2021-05-10 12:58:25 -04:00
Heng Li 76df351fa8 added github action 2021-05-10 12:55:58 -04:00
Heng Li d065d3bead Merge branch 'master' into dev-rmq 2021-05-10 12:42:57 -04:00
Heng Li ac146fe7bc r1035: failed to index under the --frag=yes mode
Resolves #734
2021-05-10 12:36:48 -04:00
Heng Li 6c96078ed0 r1034: changed multiple defaults; updated manpage 2021-05-03 22:51:34 -04:00
Heng Li bbb4f97e52 support RMQ 2021-05-03 09:27:04 -04:00
Heng Li b7f4d8a0f4 removed the old minimap2 chaining 2021-05-02 18:55:37 -04:00
Heng Li e81927e7a1 prepare to backport unimap/minigraph chaining 2021-05-02 18:25:49 -04:00
Heng Li f7dc5799c5 clarify CLR when necessary 2021-05-01 15:56:33 -04:00
Heng Li 817cb81cb0 Updated README for the HiFi preset 2021-05-01 15:47:25 -04:00
Heng Li 0f5608c4a4 r1028: backport minigraph -U 2021-05-01 15:41:39 -04:00
Heng Li e8823a3709 r1027: renamed hifi to map-hifi; changed default 2021-05-01 15:22:51 -04:00
Heng Li 7edeec67b0 r1026: fixed bugs in seed sampling add hifi 2021-05-01 15:07:56 -04:00
Heng Li feb92d32ea r1025: seed rescuring 2021-04-30 17:33:16 -04:00
Heng Li cdbd96be0c a bit refactoring for future changes 2021-04-30 11:24:53 -04:00
Heng Li ba52c79024 added code of conduct 2021-04-22 17:30:30 -04:00
Heng Li cd9ccfa069 r1022: check INDEL lengths in simple cases 2021-04-11 22:07:00 -04:00
Heng Li 86b716448c larger window size for longer INDELs 2021-04-11 16:08:29 -04:00
Heng Li 9ab95be1bb update END when it is not there 2021-04-11 12:59:21 -04:00
Heng Li b51e859945 make sure ins/del match 2021-04-11 11:47:14 -04:00
Heng Li a9037dc16c r1018: scripts for SV evaluation 2021-04-11 01:08:17 -04:00
Heng Li 9729fa99ad removed mappy.c 2021-04-09 13:48:16 -04:00
Heng Li b6ff332de1 Release minimap2-2.18 (r1015) 2021-04-09 13:33:34 -04:00
Heng Li 77abafaaf3 prepare for release 2021-04-09 13:18:56 -04:00
Heng Li 507d39af15 r1013: changed to a more accurate similarity est
Based on DOI:10.1101/2021.01.15.426881. One minimap2 reviewer suggested the
right formula to me but I thought the difference would be insignificant. I was
wrong.
2021-04-08 13:57:53 -04:00
Heng Li 827ca4b461 r1012: fixed an off-by-one bug; resolves #489 2021-04-07 23:31:31 -04:00
Marcus Stoiber d3dde2fdd4 Convert from spaces to tabs. 2021-04-05 11:55:10 -04:00
Marcus Stoiber 7db2e8d21a Convert python install from build_ext to setuptools setup_requires. 2021-04-05 11:55:10 -04:00
Heng Li 0b41dd26a2 r1009: fixed a compiler warning 2021-04-05 11:43:13 -04:00
Heng Li 2b47846cd6 r1008: don't parse space in BED 2021-04-05 11:41:00 -04:00
Heng Li 67dd906a80 bump travis python version to 3.9 2021-03-23 09:12:49 -04:00
Heng Li 1b0bb7b0ba require overlap ratio when considering centromere 2021-03-11 19:11:44 -05:00
Heng Li 1c4b7e8a48 explained --junc-bed in README 2021-03-06 19:44:24 -05:00
Heng Li ecbc399fa2 improved sveval 2021-03-06 19:44:13 -05:00
Heng Li 4dfd495cc2 added sveval 2021-02-15 14:49:36 -05:00
Heng Li 194b457e79 option to print errors only 2021-02-07 12:58:03 -05:00
Heng Li 75c8933511 evaluate large-scale misjoins 2021-02-07 12:34:13 -05:00
Heng Li 1025993469 print number of errors on each read 2021-01-29 14:08:21 -05:00
Heng Li a3253d1a6b added a command for simple VCF statistics 2021-01-14 12:24:38 -05:00
Heng Li 2da649d1d7 Merge remote-tracking branch 'origin/master' 2020-11-15 18:47:15 -05:00
Heng Li f995f55610 added --mask-len for #659 2020-08-21 11:12:50 -04:00
Armin Töpfer c9874e2dc5 Initialize r->p if ez->zdropped 2020-06-12 09:22:18 -04:00
Heng Li 28a37a017a added utg error correction 2020-05-01 00:45:05 -04:00
Heng Li ccb0f7b05d added a new Makefile for simde 2020-04-25 22:43:29 -04:00
mbrcic 66db9da7d8 changed preprocessor conditionals for SIMDe 2020-04-22 19:50:59 +02:00
Heng Li cd2b19035b r987: position on for strand wrongly outputted 2020-04-22 10:31:25 -04:00
Heng Li 9c0e2c67f8 r986: don't estimate dv with --qstrand 2020-04-21 13:21:03 -04:00
Heng Li da7109fd29 r985: optionally report cs/cg on the query strand
PAF only; not well tested
2020-04-21 12:37:35 -04:00
mbrcic 2b3403f094 fix for Neon after test. 2020-04-21 02:08:21 +02:00
mbrcic 3e16e4e39d Added documentation entry for added functionality, simde and no_simd. 2020-04-21 01:36:19 +02:00
mbrcic f47e8a525e SIMDe made optional. Include paths changes for SIMDe. 2020-04-21 01:08:32 +02:00
mbrcic c172df7d2d fix for Neon 2020-04-20 21:14:15 +02:00
mbrcic 9e6fdd376b Changed sse2neon with SIMDe. Added building non-SIMD version. 2020-04-20 18:28:06 +02:00
Heng Li 29f67a1666 r982: more accurate sum; output errors 2020-04-14 16:18:53 -04:00
Heng Li adde608a42 Merge remote-tracking branch 'refs/remotes/origin/master' 2020-04-14 15:52:57 -04:00
Heng Li f10dff78dc r981: asmgene to check duplicate genes 2020-04-14 15:52:36 -04:00
Jun Aruga d97bba9f27 travis: added arm64 test. 2020-04-13 08:33:03 -04:00
Heng Li 50775362bb r980: support auNGA 2020-04-10 21:36:59 -04:00
Heng Li 0a5e386359 r979: fixed asmgene wrong report. Resolves #581. 2020-04-06 19:57:15 -04:00
Heng Li cb56fb762a Merge branch 'master' of github.com:lh3/minimap2 2020-03-22 19:17:01 -04:00
Heng Li e2451e497a r975: asmstat without CIGAR/NM 2020-03-22 19:16:43 -04:00
Jared Simpson d2de282d21 remove second definition of kstring 2020-03-02 13:18:37 -05:00
Jared Simpson 48cb80ea94 change kstring_t integer storage size
This is for compatibility with kstring_t in htslib.
2020-02-28 09:35:51 -05:00
Heng Li 6a4b9f9082 r974: more informative msg on wrong FASTQ records
Resolves #510
2020-01-21 10:56:59 -05:00
Heng Li a7a01fe5bd r973: fixed compiling errors caused 2020-01-21 10:43:31 -05:00
Heng Li 9dceae59a0 r972: renamed --alt-diff to --alt-drop 2020-01-21 10:33:39 -05:00
Heng Li 20a3987082 Merge branch 'master' into alt 2020-01-21 09:17:50 -05:00
Heng Li eb3ed6993d support ALT mapping 2020-01-21 09:17:50 -05:00
Heng Li 7996f04008 r972: fixed negative de:f caused by ambiguous base 2020-01-21 09:14:37 -05:00
Heng Li d2e14705e7 r968: allow large mini_batch; resolves #491 2020-01-18 12:24:44 -05:00
Heng Li 24f50f38e8 r967: no duplicated @SQ lines with --split-prefix
resolves #527 and #400
2020-01-18 12:01:28 -05:00
Heng Li 04e015d803 r966: minimap2 returns 1 on file failure (#532) 2020-01-18 10:58:59 -05:00
Heng Li 040f74102c r965: added --chain-gap-scale for #540 2020-01-18 10:29:33 -05:00
Heng Li cdb7857841 r963: --junc-bonus not working; resolves #513 2020-01-06 22:03:50 -05:00
Heng Li 3c0d05d272 r962: abort given wrong RG line; resolves #541 2020-01-06 21:53:21 -05:00
Heng Li 47b646acbf r961: print indexed length 2020-01-06 21:13:33 -05:00
Heng Li a79cb3e991 Merge remote-tracking branch 'origin/master' 2019-12-23 17:33:56 -05:00
Heng Li 367aed4271 added the asan and tsan targets to Makefile 2019-12-23 17:33:10 -05:00
xdudiagnoa 081df6ac7d Fix example.c seq read logic
for every idx should map all input seqs
2019-11-11 00:46:07 -05:00
Torsten Seemann a3e7a575fb Add splice:hq to --help 2019-11-11 00:45:13 -05:00
Heng Li d90583b83c r954: fixed two potential undef behaviors (#443) 2019-07-18 09:17:08 -04:00
Heng Li 7fc03b0c32 r953: krealloc is buggy
Its use in minimap2 didn't trigger the bug, so the older minimap2 is still ok.
2019-07-18 09:13:30 -04:00
John Marshall 20c104ce8d Report errno on file opening failures and I/O errors
Add the underlying operating system error (usually "No such file" or
"Out of space" respectively, but highly informative when it is not)
to these error messages.
2019-07-17 09:04:02 -04:00
Marcus Stoiber 238b6bb3ea Fix memory leak in mappy.aligner.map. 2019-07-08 09:50:54 -04:00
Heng Li e026e18439 added the description of "SA" tag. Closes #438 2019-07-01 09:18:33 -04:00
Heng Li 58c2251b18 compatibility with GenBank GTP (resolves $422) 2019-06-11 09:16:03 -04:00
Heng Li 03dc8d5d97 test if index is built for #413 2019-06-07 09:11:11 -04:00
Heng Li 5cb61f8ee6 added FAQ 2019-06-06 10:47:33 -04:00
Heng Li c16a1742a3 Er... Tavis doesn't have python 3.7. 2019-05-11 20:06:48 -04:00
Heng Li 4bd5a018c2 test python 3.7 instead of 3.6 2019-05-11 20:05:06 -04:00
Heng Li 05974c80f1 r943: allow long ref name for --split-index
Resolved #394.
2019-05-10 15:39:41 -04:00
Heng Li 7bc87b4175 Release minimap2-2.17 (r941) 2019-05-04 23:49:17 -04:00
Heng Li 6762368cf0 r940: added the splice:hq preset
for high-quality CCS/mRNA splice alignment
2019-05-04 14:00:31 -04:00
Heng Li c2aec88b84 r938: added --sam-hit-only; resolved #377 2019-04-30 22:40:36 -04:00
Heng Li 97f67a2a0a r937: enlarge mm_mapopt_t::flag to 64 bits 2019-04-30 22:30:32 -04:00
Heng Li 189555503a potentially fix issue #372
Needs someone to confirm
2019-04-30 21:49:51 -04:00
Heng Li 69af86657e r935: fixed a cigar like 5I6D7I; resolved #392 2019-04-30 21:35:24 -04:00
Heng Li 49c6d83a8e r934: --junc-bed to read BED12 2019-04-28 20:12:28 -04:00
Heng Li f64e426a5a r933: resume versioning 2019-04-28 17:05:37 -04:00
Heng Li 2bb8cbbeef updated manpage 2019-04-28 17:02:49 -04:00
Heng Li e80759c97a --junc-bed apparently working
Also fixed an issue with splice alignment in the reverse strand, though this
should have a very minor effect in practice.
2019-04-28 16:47:12 -04:00
Heng Li f4c844b143 fixed a few simple bugs and leaks 2019-04-28 16:47:12 -04:00
Heng Li be171aa2dc implemented in exts; testing is the next 2019-04-28 16:47:12 -04:00
Heng Li cdc730d573 gff2bed to output junction BED 2019-04-28 16:47:12 -04:00
Heng Li 6420acca6d BED I/O 2019-04-28 16:47:12 -04:00
John Marshall 371bc9513a SAM TLEN should be 0 when either read is unmapped
this_rid/this_pos will be copied from r_prev(=r_next)'s values when this
read is unmapped (i.e., r is NULL). In this case, we can write RNEXT as
'=' but should not calculate TLEN from these placeholder values.
Similarly when the mate is unmapped (i.e., r_next is NULL).

Fixes #365.
2019-04-05 09:36:46 -04:00
Heng Li 169216bfff manpage was wrongly marked as "dirty" 2019-02-28 15:58:12 -05:00
Heng Li 6b391e3373 Release minimap2-2.16 (r922) 2019-02-28 15:49:24 -05:00
Heng Li 55e39c2d30 r921: output unmapped reads in full PAF 2019-02-27 15:03:19 -05:00
Kevin Chan 90b7b83ec7 fix typo in command line help 2019-02-27 14:46:57 -05:00
Heng Li d431dc0181 r917: added --max-chain-iter to avoid worst case
Resolves #324
2019-02-27 14:41:01 -05:00
Heng Li ccf1680aaf make it explicit that -x is preferred for prebuilt 2019-02-27 12:43:33 -05:00
Heng Li ea84fc0a53 r917: fixed a bug in command-line parsing
Resolves #344
2019-02-27 11:22:58 -05:00
Heng Li 19208fb06b r916: support long cs in sam-to-paf conversion 2019-02-17 09:35:23 -05:00
Heng Li e02bebd96d r915: fixed a bug caused by the latest change 2019-02-14 10:04:04 -05:00
Heng Li 32ab6ce15b r914: fixed two harmless division by 0
Resolves #326
2019-02-12 19:30:49 -05:00
Heng Li 1739a260fb r913: output tag "rl", length of unseedable regs 2019-02-05 14:19:17 -05:00
Heng Li aaf3233818 added mappy.Aligner.seq_names to return seq names
Resolves #312
2019-01-29 12:53:20 -05:00
Heng Li 8b05880f73 r911: option -o to output to file (#319) 2019-01-29 10:42:20 -05:00
Heng Li eba237f39d r910: meaningful error message (#320)
when minimap2 fails to create temporary files
2019-01-29 10:29:27 -05:00
Heng Li a8e1e3cbb8 updated citation with page numbers 2019-01-26 17:59:36 -05:00
Heng Li 597212b9f3 r908: added an assertion to detect a potential bug
as in #311
2019-01-23 11:18:50 -05:00
Heng Li 30abcf3cf9 r907: copy tag "cs" in sam2paf
Resolves #310
2019-01-13 17:52:31 -05:00
Heng Li 48e230f40d r906: de tag is wrongly calculated given "N"
Resolves #309
2019-01-11 19:39:09 -05:00
Heng Li c404f49569 Release minimap2-2.15 (r905) 2019-01-10 12:34:45 -05:00
Heng Li cf2bae6e9b r904: fixed a corner-case segfault. Resolves #307. 2019-01-10 09:57:05 -05:00
Heng Li 5b2fdfff9c r895: option in asmgene to count autosomal only 2018-12-14 10:36:47 -05:00
Heng Li ea2b1c5b2a r894: added --max-qlen to filter out long query 2018-12-12 12:27:32 -05:00
Heng Li eef1cee9b7 r893: added paftools.js vcfpair 2018-12-01 18:53:03 -05:00
Heng Li 2c52364527 r892: avoid de:f:0.0000 2018-11-24 21:54:28 -05:00
Heng Li 128476efc9 r891: compute gap-compressed divergence 2018-11-24 21:50:49 -05:00
Heng Li 1b3a6a0fe5 r890: removed "register" (#261) 2018-11-19 13:57:31 -05:00
Heng Li 83a8ee7038 r888: fixed incorrect CIGAR when --eqx in use
This was caused by mm_fix_cigar() which may change query/target offset in very
rare cases. Generating EQX has to beware of this change.

Resolves #266
2018-11-18 14:22:29 -05:00
Heng Li 62bbadf668 r887: fixed a bug in asmgene 2018-11-11 21:35:19 -05:00
Heng Li 91f548b497 r886: fixed two minor typos
Resolves #264
Resolves #265
2018-11-08 12:04:14 -05:00
Heng Li cdaf46665a r885: compute dup with asmstat 2018-11-07 00:26:05 -05:00
Heng Li 6596c63dcd r884: for C++ compatibility (#261) 2018-11-06 22:07:11 -05:00
Heng Li 59f23f7579 Release minimap2-2.14 (r883) 2018-11-06 00:03:16 -05:00
Heng Li 5e55e397e9 r882: guard against -E0 (#263) 2018-11-05 23:36:12 -05:00
Heng Li 88c421e8de r881: a recent change reduces sr accuracy 2018-11-05 22:03:59 -05:00
Heng Li 3db5bfe6e5 r880: fixed false wrong FASTA/Q alert 2018-11-05 20:52:07 -05:00
Heng Li 83dfdd5f50 draft release note 2018-11-05 20:07:57 -05:00
Heng Li 8a2b1cd4c9 updated mappy for extra option max_sw_mat 2018-11-05 19:28:44 -05:00
Heng Li 1ede8ca170 r877: renamed cap-sw-mat to cap-sw-mem 2018-11-05 11:46:38 -05:00
Heng Li 13981404e2 r876: skip DP if taking too much RAM (#259) 2018-11-05 11:43:10 -05:00
Heng Li fd64dd26f6 r875: warn given incorrect FASTA/Q
resolves #252
resolves #255
2018-11-05 10:02:44 -05:00
Heng Li 24df95e4b8 r874: don't call x86_simd() so often
This takes a few percent of time in profiler.
2018-11-05 09:20:35 -05:00
Heng Li a8ee48c2ce r873: comforming to C99/C11; resolves #261 2018-11-05 08:25:07 -05:00
Heng Li 09e089c3dc r872: choose the longest isoform 2018-11-04 23:48:50 -05:00
Heng Li e46cbb7d84 r871: print erroneous genes 2018-11-04 20:37:06 -05:00
Heng Li 57ec73ec6c r870: separate <50% and <10% 2018-11-04 19:31:25 -05:00
Heng Li 9e27575387 r869: classify incomplete genes 2018-11-04 19:21:55 -05:00
Heng Li b4ad8d8bf0 added asmgene
improvements coming; not made public yet
2018-11-04 17:24:05 -05:00
Heng Li e315b9fada hidden options to control bp calculation 2018-11-04 16:36:04 -05:00
Heng Li 42baf287a4 r866: fixed a typo; resolves #262 2018-10-30 09:11:55 -04:00
Heng Li 2ceba22a7a fixed a typo in manpage 2018-10-28 11:51:02 -04:00
Heng Li 9ed56b4a25 r860: MD/cs not working with --eqx 2018-10-26 23:23:53 -04:00
Heng Li ecb6c5c36c Document --no-pairing (#256) 2018-10-23 10:00:21 -04:00
Heng Li 377c7099a8 r858: fixed a bug; resolves #254 2018-10-22 22:47:11 -04:00
Heng Li 51e2abfa60 clarify that minimap2 may miss small exons 2018-10-22 11:16:16 -04:00
Heng Li 7b0a49732e r856: wrongly reported for an unrecognized option
Resolved #250
2018-10-19 20:07:14 -04:00
Heng Li 20268a6068 updated the copyright holder 2018-10-18 11:11:17 -04:00
Heng Li d04ac068fd r852: a minor when large --end-bonus is in use
We may use a large --end-bonus to mimic end-to-end alignment. In the short-read
mode, the candidate alignment region may be out of the band, which leads to
truncated alignment.
2018-10-15 21:28:27 -04:00
Heng Li 5d5d392c02 Release minimap2-2.13 (r850) 2018-10-11 13:18:31 -04:00
Heng Li 170863e553 r849: option -P doesn't work
I don't know why I haven't found it at the beginning.
2018-10-04 16:11:59 -04:00
Heng Li 97f97306a4 r847: guard against -N0 2018-09-27 15:13:44 -04:00
Heng Li 1077b7ddc8 r846: added --hard-mask-level for #244 2018-09-27 14:46:26 -04:00
Heng Li c57b59f02f r845: log peak memory 2018-09-23 20:27:49 -04:00
Torsten Seemann 34be359e25 Add -s sample option for VCF output 2018-09-19 18:24:47 -04:00
Heng Li 8b12da8b0f removed a useless dependency (not in repo) 2018-09-17 13:59:25 -04:00
Heng Li c63a33904f r836: fixed an integer overflow
Forgot this one.
2018-09-14 23:29:31 -04:00
Heng Li 70b0fede64 r835: improved help message. Resolved #232 2018-09-14 22:29:25 -04:00
Heng Li 0b681e51e7 Merge remote-tracking branch 'remotes/origin/master' 2018-09-14 22:22:20 -04:00
Heng Li 7d80d6de4a r832: fixed outdated -L. Resolved #231 and #233 2018-09-14 22:21:33 -04:00
Chris Rands 791e89ce0f PEP8 and other minor styles changes 2018-09-12 10:58:56 -04:00
Heng Li 98c48a1c45 Fixed wrong version links in the cookbook 2018-09-03 09:07:34 -04:00
Heng Li 63d397120a removed getopt.c from MANIFEST 2018-09-01 21:30:46 -04:00
Heng Li 7998fe9906 r829: replaced musl's getopt with ketopt 2018-09-01 21:18:02 -04:00
Heng Li 3a119d606f r828: --MD to support spliced alignment 2018-08-22 10:47:45 -04:00
Heng Li a5eafb75f9 Release minimap2-2.12 (r827) 2018-08-06 12:44:39 -04:00
Heng Li 9a567e4b37 allow mappy to change scoring 2018-08-06 09:52:13 -04:00
Heng Li 8e606bcc06 added a -C5 example to Getting Started 2018-08-06 09:08:33 -04:00
Heng Li a1b7219b5d explain added parameters 2018-08-05 21:32:05 -04:00
Heng Li b0f39a1a61 r823: mappy to index a single sequence 2018-08-05 20:57:05 -04:00
Heng Li 5ab6538757 r822: added option --no-end-flt 2018-08-05 19:42:12 -04:00
Heng Li b32296e18f r821: fixed memory when -y is used 2018-07-31 15:14:37 -04:00
Heng Li 99ecdf7b5d mappy to support arm64 (#203) 2018-07-24 23:53:02 -04:00
Heng Li ff9917a1c4 r819: mappy to support cs/MD 2018-07-24 23:29:55 -04:00
Mark Bicknell 8c064a5f29 Fixed mm_idx_is_idx to return the correct result on Windows. 2018-07-17 09:16:33 -04:00
Heng Li 0e137670fc Merge branch 'split' 2018-07-15 22:24:15 -04:00
Heng Li 395c8d678a r815: fixed a memory leak 2018-07-15 22:11:32 -04:00
Heng Li 830da7fa27 r814: resumed versioning 2018-07-15 11:48:14 -04:00
Heng Li a655cbef86 print SAM header; remove tmp files 2018-07-15 11:03:18 -04:00
Heng Li 4b707aac92 working with toy examples 2018-07-15 10:55:00 -04:00
Heng Li 951c0d1d35 apparently mm_append_cigar() wastes some memory 2018-07-14 23:47:44 -04:00
Heng Li 3545e35a42 pairing in the split-idx mode 2018-07-14 23:43:34 -04:00
Heng Li f3417da838 bugfix: unmapped records are duplicated in output 2018-07-14 22:54:05 -04:00
Heng Li e5277dbf5c code backup 2018-07-14 22:52:36 -04:00
Heng Li 1a55227d5a write hits to tmp files (unfinished) 2018-07-14 12:15:10 -04:00
Heng Li 5cfa621b2d use unmapped records 2018-07-07 12:49:15 -05:00
Heng Li a609a07f8c optionally output unmapped query in PAF 2018-07-07 10:26:08 -05:00
Heng Li bcf92b3c46 compute query coverage 2018-07-06 21:52:01 -05:00
Heng Li 097378ab90 reworked break point counting 2018-07-06 09:46:26 -04:00
Heng Li 10bbbe28c5 added asmstat 2018-07-05 13:22:32 -04:00
Hyeshik Chang c92a6866f3 Release the GIL to allow native Python threading. 2018-07-05 08:00:27 -04:00
Maël Kerbiriou 6908dc59a5 --splice implied when searching for splicing sites on single strand 2018-07-05 07:41:26 -04:00
Heng Li 50dae10421 paftools call to show statistics on longer indels 2018-07-03 14:28:09 -04:00
Heng Li 0517972d02 Release minimap2-2.11 (r797) 2018-06-21 00:04:08 -04:00
Heng Li d46e68e6ad r796: don't use ssize_t 2018-06-20 12:45:27 -04:00
Heng Li 2584a4149a r295: use -r2000 for ava-ont, NOT for ava-pb 2018-06-20 12:24:43 -04:00
Heng Li 66674afd09 r794: fixed a bug in seed filtering 2018-06-20 10:26:29 -04:00
Heng Li e9ca0c9dab added __version__; resolved #165
Not sure if this is the right way. Apparently working.
2018-06-19 15:40:26 -04:00
Heng Li 7e6e8ca73f r792: fixed -Wextra warnings and resolved #184 2018-06-19 15:26:58 -04:00
Ilya Kolpakov 408e098859 fix deserialization of zero-length reference names 2018-06-19 14:46:05 -04:00
Ilya Kolpakov 57f37551f8 expose mm_idx_is_idx, mm_idx_load and mm_idx_dump 2018-06-19 14:46:05 -04:00
Ilya Kolpakov 4c66b689c3 fix serialization of empty names in mm_idx_dump 2018-06-19 14:46:05 -04:00
mvdbeek 1bde2cf076 Allow setting max_frag_len on a per alignment level 2018-06-19 14:39:30 -04:00
mvdbeek 31fc0f218a Allow setting max_frag_len parameter in Aligner class 2018-06-19 14:39:30 -04:00
Aaron Wenger 3d3bcc29a8 Fix CIGAR reallocation with --eqx
Fix the logic that calculates the number of CIGAR entries when
match "M" entries are expanded into "=" and "X".  The number
of entries depends not on the number of mismatches but rather
on the number of transitions between "=" to "X".
2018-06-19 14:37:41 -04:00
Hasindu Gamaarachchi 99dcd75f64 added support for 64 bit ARM architectures 2018-06-19 14:28:45 -04:00
Heng Li 154d2caf5b r784: support the =/X CIGAR operators (#156) 2018-05-30 16:11:22 -04:00
Heng Li a3afeec0b2 r783: reverted to r781 (#155) 2018-05-30 15:25:34 -04:00
Heng Li 3573784b4d r782: no mask a chain having long ref ovlp (#155) 2018-05-30 13:53:45 -04:00
Heng Li 872f300955 r781: fixed the buggy heapmerge (resolves #166) 2018-05-30 11:55:14 -04:00
Heng Li d7b61a039e updated citation 2018-05-30 11:11:55 -04:00
Heng Li 248158a3e1 Resolved #168: citing the manpage for cs 2018-05-30 11:03:16 -04:00
Heng Li 9f4309c376 r777: avoid skipping too many seeds 2018-05-11 10:25:18 -04:00
Heng Li 463f9309f9 Merge branch 'hot-fix' into fix-long-gap 2018-05-11 10:13:19 -04:00
Heng Li abe989e355 the previous fix on int overflow is incomplete 2018-05-11 10:12:57 -04:00
Heng Li 881b4ca3a2 r774: Merge branch 'hot-fix' into fix-long-gap 2018-05-11 10:02:17 -04:00
Heng Li 10c6dd2551 r773: fixed an integer overflow 2018-05-11 10:01:23 -04:00
Heng Li 7ec6721c44 r772: option -Y not working 2018-05-11 10:00:11 -04:00
Heng Li e61812ee55 reduced gap len to trigger bad seed filtering 2018-05-01 16:17:21 -04:00
Heng Li 734ac379bb r770: matching N bases not working properly (#155) 2018-04-30 19:55:23 -04:00
Heng Li 759f8e4ac9 r769: filter out seeds breaking long gaps 2018-04-24 15:37:37 -04:00
Heng Li aef7b0744c r768: shortened preset; added dv tag (#25)
Also added asm20 to command line help (#151)
2018-04-24 12:48:54 -04:00
Heng Li 39f836eac8 r767: don't crash when there is no "cg" (#153) 2018-04-24 12:32:37 -04:00
Heng Li cbeb86dad6 Merge remote-tracking branch 'origin/master' 2018-04-10 09:12:26 -04:00
Heng Li 372c90ceb5 r764: fixed incorrect inversion mapq (#148) 2018-04-10 09:11:49 -04:00
apregier 2e2e69107c Small bugfix for paftools.js
The bug resulted in the wrong coverage being printed in some cases.
2018-04-04 16:29:54 -04:00
Heng Li ee4cd089f7 r763: fine control long join flank len (#128) 2018-03-29 14:16:58 -04:00
Heng Li 2d7ec75d50 Release minimap2-2.10 (r761) 2018-03-27 11:45:44 -04:00
Heng Li 7938ed4893 fixed two mappy warnings 2018-03-26 15:12:54 -04:00
Heng Li 4740423afa Merge remote-tracking branch 'origin/master' 2018-03-26 14:37:17 -04:00
Heng Li 1776311a9b updated cookbook 2018-03-26 14:37:02 -04:00
Heng Li c1a3e05cb0 Merge pull request #138 from zingdle/patch-1
Fix typo in README.md
2018-03-26 07:50:39 -04:00
zingdle ecb6703d4a Update README.md
Fix typo.
TD;DR -> TL;DR
2018-03-26 14:54:52 +08:00
Heng Li 0bf97a367b r755: junceval to only evaluate chromosomes 2018-03-24 23:10:06 -04:00
Heng Li 1c504d72e4 r754: option to only change name 2018-03-23 12:27:11 -04:00
Heng Li 5ef9580b17 r753: change bandwidth in ava-ont to 2000bp 2018-03-23 10:15:23 -04:00
Heng Li 08bd2123b6 r752: option to copy comments to output (#136) 2018-03-23 10:04:33 -04:00
Heng Li 8766d286df r751: optionally output MD (#118) 2018-03-22 14:15:33 -04:00
Heng Li 623b5d9d48 r750: check puts() return (#132 & #103) 2018-03-22 11:31:58 -04:00
Heng Li 18659118cd r749: don't print version etc at low verbose 2018-03-22 11:10:55 -04:00
Heng Li d1050f4eaf r748: optionally to use system getopt() (#134) 2018-03-19 11:18:26 -04:00
Heng Li b81d45510e Revision v2 2018-03-16 11:18:06 -04:00
Heng Li d135feb1a5 response to reviewers' comments, round 2 2018-03-15 21:59:57 -04:00
Heng Li 242ff4e91d r745: junceval - recognize "-" as file name 2018-03-15 12:51:46 -04:00
Heng Li 7a0c1316ce added more examples to cookbook 2018-03-12 22:24:22 -04:00
Heng Li 77ebd479f4 r743: added VCF output to "call" 2018-03-12 21:51:31 -04:00
Heng Li e3f226a9d9 working on section "Full-Genome Alignment"
found an apparent bug in paftools.js call. To debug...
2018-03-12 16:12:18 -04:00
Heng Li bdc615c1d4 r741: added --min-occ-floor to improve #107 2018-03-12 14:32:27 -04:00
Heng Li ad1beaf255 backup; not finished 2018-03-12 13:20:25 -04:00
Heng Li de0480ac5b finished section "Read Overlap" 2018-03-12 13:05:51 -04:00
Heng Li f2866533a8 finished "mapping genomic reads" 2018-03-12 12:50:21 -04:00
Heng Li 0173850ef0 don't use bullets - they are hard to read 2018-03-12 12:42:13 -04:00
Heng Li acea3594fb updated cookbook 2018-03-12 12:39:57 -04:00
Heng Li f78a247749 Started to work on a cookbook 2018-03-12 12:00:44 -04:00
Heng Li ccaf12e1a2 r734: removed debugging print in call() 2018-03-09 23:46:21 -05:00
Heng Li 96b132c97d fixed a bug/typo in Aligner.seq() (#126) 2018-03-08 19:12:12 -05:00
Heng Li 70428ca3a8 speedup tag parsing for sam2paf 2018-03-02 10:17:55 -05:00
Heng Li 9aea79d621 faster tag parsing 2018-03-02 10:09:14 -05:00
Heng Li 1770988627 make calling work with sam2paf output 2018-03-02 10:03:06 -05:00
Heng Li 2bfdad34bb minor cleanup to last commit 2018-03-02 01:07:37 -05:00
Heng Li 953766cedd generate cs; not carefully tested 2018-03-02 00:14:55 -05:00
Heng Li dc61301d9f sam2paf cleanup 2018-03-01 21:58:12 -05:00
Heng Li 19e05a099d for clarity 2018-03-01 18:25:29 -05:00
Heng Li 0238caa8b1 clarify minimap2 not working for >2Gbp seq #129 2018-03-01 18:23:40 -05:00
Heng Li a22ebb9836 use SSE compiler flags more precisely (#127) 2018-02-26 09:51:01 -05:00
Heng Li eeb314edd6 Release minimap2-2.9 (r720) 2018-02-24 09:31:09 -05:00
Heng Li 83c57a9d98 r719: fixed bad memory access 2018-02-23 17:27:41 -05:00
Heng Li 24a4808826 r718: retrieve sequence from the index 2018-02-23 10:18:26 -05:00
Heng Li 29ed675ee5 bugfix: in-place revcomp() not working 2018-02-20 11:05:54 -05:00
Heng Li 7dc7097208 added reverse complement 2018-02-20 09:41:25 -05:00
Heng Li f434653432 added peakrss(); not used for now 2018-02-17 20:40:31 -05:00
Heng Li 090361c25b fixed a typo in mappy (#117) 2018-02-16 21:10:57 -05:00
Heng Li e1f18690f6 paftools-r713: fixed bug for cov1 regions 2018-02-16 12:20:46 -05:00
Heng Li 54a42aafe5 keep documents in sync 2018-02-15 17:21:09 -05:00
Heng Li 8fc5f8dc90 r711: assign proper mapq to primary inversions 2018-02-15 14:34:59 -05:00
Heng Li a0d62519c1 r710: fixed incorrect inversion coordinate (#112) 2018-02-15 14:23:42 -05:00
Heng Li b71c01b316 added test data for inversions 2018-02-15 11:04:27 -05:00
Heng Li 1372977a37 r708: implemented double Z-drop thresholds (#112)
When aligning long reads, we would prefer to align through low-quality
regions. This requires a large Z-drop threshold. However, to find small
inversions, we need to use a small Z-drop. This commit address this
conflict with two Z-drop thresholds. When Z-drop exceeds the smaller
threshold, we perform a local alignment to check if there is a potential
inversion. If there is one, we break the alignment; otherwise we break
the alignment only if Z-drop excess the larger threshold.

This commit also fixes a bug that reported wrong coordinates when the
inversion is on the forward strand (#112).
2018-02-15 10:50:49 -05:00
Heng Li c0e0d5d84b r707: bugfix for inversions on rev strand (#112) 2018-02-14 14:09:03 -05:00
Heng Li b328795051 r706: don't segfault upon wrong FASTA/Q (#111)
The lack of robustness cost me several hours to identify.
2018-02-13 10:00:22 -05:00
Heng Li 3b17d62ccd minor doc improvements 2018-02-12 22:27:02 -05:00
Heng Li 874b8c4795 rework misc/README; progressing but unfinished 2018-02-12 22:06:05 -05:00
Heng Li 7ef5490884 r703: added --max-clip-ratio
still testing the option
2018-02-12 13:29:18 -05:00
Heng Li f66de7df59 updated paftools revision number to r702 2018-02-12 11:39:04 -05:00
Heng Li fbbd4e0968 changed output messages for clarity 2018-02-12 11:32:32 -05:00
Heng Li 8c89ba005e merged cnt-feat into paftools 2018-02-12 11:29:42 -05:00
Heng Li 50775a1e6f added liftOver
tested on a few toy examples
2018-02-12 11:12:23 -05:00
Heng Li 87cf650168 r697: fixed wrong #mapped reads in junceval 2018-02-09 18:45:57 -05:00
Heng Li 6e65c5e631 Revision 1 2018-02-09 17:39:02 -05:00
Heng Li a58b05a61b extend the section on genome alignment 2018-02-09 13:59:00 -05:00
Heng Li 42dab6319b don't call SNPs involving 'n' 2018-02-09 13:27:17 -05:00
Heng Li 8428809369 convert MUMmer's delta to PAF 2018-02-09 12:14:28 -05:00
Heng Li 642af5591e merged intron-eval into paftools 2018-02-09 11:07:14 -05:00
Heng Li 2025a6279a merged gff2bed and mapstat to paftools 2018-02-09 10:47:12 -05:00
Heng Li 3465b04724 merged a few converters to paftools 2018-02-09 10:23:30 -05:00
Heng Li 66c5e71fa8 merging scripts into one long script 2018-02-09 10:00:35 -05:00
Heng Li 01560f1db0 Revision v1, to be submitted 2018-02-07 11:07:08 -05:00
Heng Li 39535565ee first round of revision 2018-02-06 16:19:22 -05:00
Heng Li a8d476c6ad r686: end seed trimming don't go over long join 2018-02-06 11:31:32 -05:00
Heng Li 29b4a1786c r685: tune end seed filter again 2018-02-05 11:48:22 -05:00
Heng Li dbf284b2d9 r684: separate end score from min_chain_score 2018-02-05 11:40:38 -05:00
Heng Li 3df5015668 General doc improvements 2018-02-02 21:45:46 -05:00
Heng Li 756379bf83 Documented paf2diff.js (more to come later) 2018-02-02 14:43:58 -05:00
Heng Li 41fd8a966a Documented ov-eval.js 2018-02-02 14:18:18 -05:00
Heng Li 86e4933b1a Added TOC 2018-02-02 14:12:30 -05:00
Heng Li a633a744b6 more doc in misc 2018-02-02 14:07:17 -05:00
Heng Li ddc31f57ba Documented some k8 scripts; more coming 2018-02-02 13:57:08 -05:00
Heng Li 35d3e064bf r677: reduce the change of missing hits
that are close to end of alignments. It is still possible to create examples
that fail the heuristic.
2018-02-02 10:35:33 -05:00
Heng Li 997ab9bb2e Fixed the description of --dual 2018-02-01 15:11:51 -05:00
79 changed files with 11399 additions and 3590 deletions
+68
View File
@@ -0,0 +1,68 @@
name: CI
on:
push:
branches:
- master
pull_request:
jobs:
build-linux-x8664:
name: Linux x86_64
runs-on: ubuntu-latest
strategy:
matrix:
compiler: [gcc, clang]
steps:
- name: Checkout minimap2
uses: actions/checkout@v4
- name: Compile with ${{ matrix.compiler }}
run: |
make CC=${{ matrix.compiler }}
file minimap2 | grep x86-64
build-linux-aarch64:
name: Linux aarch64
runs-on: ubuntu-latest
strategy:
matrix:
compiler: [gcc]
steps:
- name: Checkout
uses: actions/checkout@v4
- name: Compile with ${{ matrix.compiler }}
uses: uraimo/run-on-arch-action@v3
with:
arch: aarch64
distro: ubuntu22.04
githubToken: ${{ github.token }}
dockerRunArgs: |
--volume "${PWD}:/minimap2"
install: |
apt-get update -q -y
apt-get install -q -y make ${{ matrix.compiler }} zlib1g-dev file
run: |
cd /minimap2
make CC=${{ matrix.compiler }} arm_neon=1 aarch64=1 -j
file minimap2 | grep aarch64
build-mac-arm64:
name: Mac ARM64
runs-on: macos-14
strategy:
matrix:
compiler: [clang]
steps:
- name: Checkout minimap2
uses: actions/checkout@v4
- name: Compile with ${{ matrix.compiler }}
run: |
make CC=${{ matrix.compiler }} arm_neon=1 aarch64=1 -j
file minimap2 | grep arm64
+3
View File
@@ -0,0 +1,3 @@
[submodule "lib/simde"]
path = lib/simde
url = https://github.com/nemequ/simde.git
-20
View File
@@ -1,20 +0,0 @@
matrix:
include:
- language: c
compiler: gcc
script: make
- language: c
compiler: clang
script: make
- language: python
python: "2.7"
before_install: pip install cython
script: python setup.py build_ext
- language: python
python: "3.5"
before_install: pip install cython
script: python setup.py build_ext
- language: python
python: "3.6"
before_install: pip install cython
script: python setup.py build_ext
+46
View File
@@ -0,0 +1,46 @@
#### 1. Alignment different with option `-a` or `-c`?
Without `-a`, `-c` or `--cs`, minimap2 only finds *approximate* mapping
locations without detailed base alignment. In particular, the start and end
positions of the alignment are imprecise. With one of those options, minimap2
will perform base alignment, which is generally more accurate but is much
slower.
#### 2. How to map Illumina short reads to noisy long reads?
No good solutions. The better approach is to assemble short reads into contigs
and then map noisy reads to contigs.
#### 3. The output SAM doesn't have a header.
By default, minimap2 indexes 4 billion reference bases (4Gb) in a batch and map
all reads against each reference batch. Given a reference longer than 4Gb,
minimap2 is unable to see all the sequences and thus can't produce a correct
SAM header. In this case, minimap2 doesn't output any SAM header. There are two
solutions to this issue. First, you may increase option `-I` to, for example,
`-I8g` to index more reference bases in a batch. This is preferred if your
machine has enough memory. Second, if your machines doesn't have enough memory
to hold the reference index, you can use the `--split-prefix` option in a
command line like:
```sh
minimap2 -ax map-ont --split-prefix=tmp ref.fa reads.fq
```
This second approach uses less memory, but it is slower and requires temporary
disk space.
#### 4. The output SAM is malformatted.
This typically happens when you use nohup to wrap a minimap2 command line.
Nohup is discouraged as it breaks piping. If you have to use nohup, please
specify an output file with option `-o`.
#### 5. How to output one alignment per read?
You can use `--secondary=no` to suppress secondary alignments (aka multiple
mappings), but you can't suppress supplementary alignment (aka split or
chimeric alignment) this way. You can use samtools to filter out these
alignments:
```sh
minimap2 -ax map-out ref.fa reads.fq | samtools view -F0x900
```
However, this is discouraged as supplementary alignment is informative.
+2 -1
View File
@@ -1,6 +1,7 @@
The MIT License
Copyright (c) 2017 Broad Institute, Inc.
Copyright (c) 2018- Dana-Farber Cancer Institute
2017-2018 Broad Institute, Inc.
Permission is hereby granted, free of charge, to any person obtaining
a copy of this software and associated documentation files (the
+1 -2
View File
@@ -1,10 +1,9 @@
include *.h
include Makefile
include ksw2_dispatch.c
include getopt.c
include main.c
include README.md
include python/mappy.c
include sse2neon/emmintrin.h
include python/cmappy.h
include python/cmappy.pxd
include python/mappy.pyx
+61 -33
View File
@@ -1,21 +1,41 @@
CFLAGS= -g -Wall -O2 -Wc++-compat
CFLAGS= -g -Wall -O2 -Wc++-compat #-Wextra
CPPFLAGS= -DHAVE_KALLOC
INCLUDES=
OBJS= kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o options.o index.o chain.o align.o hit.o map.o format.o pe.o esterr.o ksw2_ll_sse.o
OBJS= kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o options.o index.o \
lchain.o align.o hit.o seed.o jump.o map.o format.o pe.o esterr.o splitidx.o \
ksw2_ll_sse.o
PROG= minimap2
PROG_EXTRA= sdust minimap2-lite
LIBS= -lm -lz -lpthread
ifeq ($(arm_neon),)
ifeq ($(sse2only),)
ifneq ($(aarch64),)
arm_neon=1
endif
ifeq ($(arm_neon),) # if arm_neon is not defined
ifeq ($(sse2only),) # if sse2only is not defined
OBJS+=ksw2_extz2_sse41.o ksw2_extd2_sse41.o ksw2_exts2_sse41.o ksw2_extz2_sse2.o ksw2_extd2_sse2.o ksw2_exts2_sse2.o ksw2_dispatch.o
else
else # if sse2only is defined
OBJS+=ksw2_extz2_sse.o ksw2_extd2_sse.o ksw2_exts2_sse.o
endif
else
else # if arm_neon is defined
OBJS+=ksw2_extz2_neon.o ksw2_extd2_neon.o ksw2_exts2_neon.o
INCLUDES+=-Isse2neon
ifeq ($(aarch64),) #if aarch64 is not defined
CFLAGS+=-D_FILE_OFFSET_BITS=64 -mfpu=neon -fsigned-char
INCLUDES+=-I sse2neon
else #if aarch64 is defined
CFLAGS+=-D_FILE_OFFSET_BITS=64 -fsigned-char
endif
endif
ifneq ($(asan),)
CFLAGS+=-fsanitize=address
LIBS+=-fsanitize=address -ldl
endif
ifneq ($(tsan),)
CFLAGS+=-fsanitize=thread
LIBS+=-fsanitize=thread -ldl
endif
.PHONY:all extra clean depend
@@ -28,8 +48,8 @@ all:$(PROG)
extra:all $(PROG_EXTRA)
minimap2:main.o getopt.o libminimap2.a
$(CC) $(CFLAGS) main.o getopt.o -o $@ -L. -lminimap2 $(LIBS)
minimap2:main.o libminimap2.a
$(CC) $(CFLAGS) main.o -o $@ -L. -lminimap2 $(LIBS)
minimap2-lite:example.o libminimap2.a
$(CC) $(CFLAGS) $< -o $@ -L. -lminimap2 $(LIBS)
@@ -37,31 +57,36 @@ minimap2-lite:example.o libminimap2.a
libminimap2.a:$(OBJS)
$(AR) -csru $@ $(OBJS)
sdust:sdust.c getopt.o kalloc.o kalloc.h kdq.h kvec.h kseq.h sdust.h
$(CC) -D_SDUST_MAIN $(CFLAGS) $< getopt.o kalloc.o -o $@ -lz
sdust:sdust.c kalloc.o kalloc.h kdq.h kvec.h kseq.h ketopt.h sdust.h
$(CC) -D_SDUST_MAIN $(CFLAGS) $< kalloc.o -o $@ -lz
# SSE-specific targets on x86/x86_64
ifeq ($(arm_neon),) # if arm_neon is defined, compile this target with the default setting (i.e. no -msse2)
ksw2_ll_sse.o:ksw2_ll_sse.c ksw2.h kalloc.h
$(CC) -c $(CFLAGS) -msse2 $(CPPFLAGS) $(INCLUDES) $< -o $@
endif
ksw2_extz2_sse41.o:ksw2_extz2_sse.c ksw2.h kalloc.h
$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
ksw2_extz2_sse2.o:ksw2_extz2_sse.c ksw2.h kalloc.h
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
$(CC) -c $(CFLAGS) -msse2 -mno-sse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
ksw2_extd2_sse41.o:ksw2_extd2_sse.c ksw2.h kalloc.h
$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
ksw2_extd2_sse2.o:ksw2_extd2_sse.c ksw2.h kalloc.h
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
$(CC) -c $(CFLAGS) -msse2 -mno-sse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
ksw2_exts2_sse41.o:ksw2_exts2_sse.c ksw2.h kalloc.h
$(CC) -c -msse4 $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
ksw2_exts2_sse2.o:ksw2_exts2_sse.c ksw2.h kalloc.h
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
$(CC) -c $(CFLAGS) -msse2 -mno-sse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH -DKSW_SSE2_ONLY $(INCLUDES) $< -o $@
ksw2_dispatch.o:ksw2_dispatch.c ksw2.h
$(CC) -c $(CFLAGS) $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) -DKSW_CPU_DISPATCH $(INCLUDES) $< -o $@
# NEON-specific targets on ARM
@@ -77,33 +102,36 @@ ksw2_exts2_neon.o:ksw2_exts2_sse.c ksw2.h kalloc.h
# other non-file targets
clean:
rm -fr gmon.out *.o a.out $(PROG) $(PROG_EXTRA) *~ *.a *.dSYM build dist mappy*.so mappy.c python/mappy.c mappy.egg*
rm -fr gmon.out *.o a.out $(PROG) $(PROG_EXTRA) *~ *.a *.dSYM build dist mappy*.so mappy.c python/mappy.c mappy.egg* .eggs
depend:
(LC_ALL=C; export LC_ALL; makedepend -Y -- $(CFLAGS) $(CPPFLAGS) -- *.c)
# DO NOT DELETE
align.o: minimap.h mmpriv.h bseq.h ksw2.h kalloc.h
align.o: minimap.h mmpriv.h bseq.h kseq.h ksw2.h kalloc.h
bseq.o: bseq.h kvec.h kalloc.h kseq.h
chain.o: minimap.h mmpriv.h bseq.h kalloc.h
esterr.o: mmpriv.h minimap.h bseq.h
esterr.o: mmpriv.h minimap.h bseq.h kseq.h
example.o: minimap.h kseq.h
format.o: kalloc.h mmpriv.h minimap.h bseq.h
getopt.o: getopt.h
hit.o: mmpriv.h minimap.h bseq.h kalloc.h khash.h
index.o: kthread.h bseq.h minimap.h mmpriv.h kvec.h kalloc.h khash.h
format.o: kalloc.h mmpriv.h minimap.h bseq.h kseq.h
hit.o: mmpriv.h minimap.h bseq.h kseq.h kalloc.h khash.h
index.o: kthread.h bseq.h minimap.h mmpriv.h kseq.h ksw2.h kalloc.h kvec.h
index.o: khash.h ksort.h
jump.o: mmpriv.h minimap.h bseq.h kseq.h
kalloc.o: kalloc.h
ksw2_extd2_sse.o: ksw2.h kalloc.h
ksw2_exts2_sse.o: ksw2.h kalloc.h
ksw2_extz2_sse.o: ksw2.h kalloc.h
ksw2_ll_sse.o: ksw2.h kalloc.h
kthread.o: kthread.h
main.o: bseq.h minimap.h mmpriv.h getopt.h
map.o: kthread.h kvec.h kalloc.h sdust.h mmpriv.h minimap.h bseq.h khash.h
map.o: ksort.h
misc.o: mmpriv.h minimap.h bseq.h ksort.h
options.o: mmpriv.h minimap.h bseq.h
pe.o: mmpriv.h minimap.h bseq.h kvec.h kalloc.h ksort.h
lchain.o: mmpriv.h minimap.h bseq.h kseq.h kalloc.h krmq.h
main.o: bseq.h minimap.h mmpriv.h kseq.h ketopt.h
map.o: kthread.h kvec.h kalloc.h sdust.h mmpriv.h minimap.h bseq.h kseq.h
map.o: khash.h ksort.h
misc.o: mmpriv.h minimap.h bseq.h kseq.h ksort.h
options.o: mmpriv.h minimap.h bseq.h kseq.h
pe.o: mmpriv.h minimap.h bseq.h kseq.h kvec.h kalloc.h ksort.h
sdust.o: kalloc.h kdq.h kvec.h sdust.h
sketch.o: kvec.h kalloc.h mmpriv.h minimap.h bseq.h
seed.o: mmpriv.h minimap.h bseq.h kseq.h kalloc.h ksort.h
sketch.o: kvec.h kalloc.h mmpriv.h minimap.h bseq.h kseq.h
splitidx.o: mmpriv.h minimap.h bseq.h kseq.h
+97
View File
@@ -0,0 +1,97 @@
CFLAGS= -g -Wall -O2 -Wc++-compat #-Wextra
CPPFLAGS= -DHAVE_KALLOC -DUSE_SIMDE -DSIMDE_ENABLE_NATIVE_ALIASES
INCLUDES= -Ilib/simde
OBJS= kthread.o kalloc.o misc.o bseq.o sketch.o sdust.o options.o index.o lchain.o align.o hit.o map.o format.o pe.o seed.o esterr.o splitidx.o \
ksw2_extz2_simde.o ksw2_extd2_simde.o ksw2_exts2_simde.o ksw2_ll_simde.o
PROG= minimap2
PROG_EXTRA= sdust minimap2-lite
LIBS= -lm -lz -lpthread
ifneq ($(arm_neon),) # if arm_neon is defined
ifeq ($(aarch64),) #if aarch64 is not defined
CFLAGS+=-D_FILE_OFFSET_BITS=64 -mfpu=neon -fsigned-char
else #if aarch64 is defined
CFLAGS+=-D_FILE_OFFSET_BITS=64 -fsigned-char
endif
endif
ifneq ($(asan),)
CFLAGS+=-fsanitize=address
LIBS+=-fsanitize=address
endif
ifneq ($(tsan),)
CFLAGS+=-fsanitize=thread
LIBS+=-fsanitize=thread
endif
.PHONY:all extra clean depend
.SUFFIXES:.c .o
.c.o:
$(CC) -c $(CFLAGS) $(CPPFLAGS) $(INCLUDES) $< -o $@
all:$(PROG)
extra:all $(PROG_EXTRA)
minimap2:main.o libminimap2.a
$(CC) $(CFLAGS) main.o -o $@ -L. -lminimap2 $(LIBS)
minimap2-lite:example.o libminimap2.a
$(CC) $(CFLAGS) $< -o $@ -L. -lminimap2 $(LIBS)
libminimap2.a:$(OBJS)
$(AR) -csru $@ $(OBJS)
sdust:sdust.c kalloc.o kalloc.h kdq.h kvec.h kseq.h ketopt.h sdust.h
$(CC) -D_SDUST_MAIN $(CFLAGS) $< kalloc.o -o $@ -lz
ksw2_ll_simde.o:ksw2_ll_sse.c ksw2.h kalloc.h
$(CC) -c $(CFLAGS) -msse2 $(CPPFLAGS) $(INCLUDES) $< -o $@
ksw2_extz2_simde.o:ksw2_extz2_sse.c ksw2.h kalloc.h
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) $(INCLUDES) $< -o $@
ksw2_extd2_simde.o:ksw2_extd2_sse.c ksw2.h kalloc.h
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) $(INCLUDES) $< -o $@
ksw2_exts2_simde.o:ksw2_exts2_sse.c ksw2.h kalloc.h
$(CC) -c $(CFLAGS) -msse4.1 $(CPPFLAGS) $(INCLUDES) $< -o $@
# other non-file targets
clean:
rm -fr gmon.out *.o a.out $(PROG) $(PROG_EXTRA) *~ *.a *.dSYM build dist mappy*.so mappy.c python/mappy.c mappy.egg*
depend:
(LC_ALL=C; export LC_ALL; makedepend -Y -- $(CFLAGS) $(CPPFLAGS) -- *.c)
# DO NOT DELETE
align.o: minimap.h mmpriv.h bseq.h kseq.h ksw2.h kalloc.h
bseq.o: bseq.h kvec.h kalloc.h kseq.h
chain.o: minimap.h mmpriv.h bseq.h kseq.h kalloc.h
esterr.o: mmpriv.h minimap.h bseq.h kseq.h
example.o: minimap.h kseq.h
format.o: kalloc.h mmpriv.h minimap.h bseq.h kseq.h
hit.o: mmpriv.h minimap.h bseq.h kseq.h kalloc.h khash.h
index.o: kthread.h bseq.h minimap.h mmpriv.h kseq.h kvec.h kalloc.h khash.h
index.o: ksort.h
kalloc.o: kalloc.h
ksw2_extd2_sse.o: ksw2.h kalloc.h
ksw2_exts2_sse.o: ksw2.h kalloc.h
ksw2_extz2_sse.o: ksw2.h kalloc.h
ksw2_ll_sse.o: ksw2.h kalloc.h
kthread.o: kthread.h
main.o: bseq.h minimap.h mmpriv.h kseq.h ketopt.h
map.o: kthread.h kvec.h kalloc.h sdust.h mmpriv.h minimap.h bseq.h kseq.h
map.o: khash.h ksort.h
misc.o: mmpriv.h minimap.h bseq.h kseq.h ksort.h
options.o: mmpriv.h minimap.h bseq.h kseq.h
pe.o: mmpriv.h minimap.h bseq.h kseq.h kvec.h kalloc.h ksort.h
sdust.o: kalloc.h kdq.h kvec.h sdust.h
self-chain.o: minimap.h kseq.h
sketch.o: kvec.h kalloc.h mmpriv.h minimap.h bseq.h kseq.h
splitidx.o: mmpriv.h minimap.h bseq.h kseq.h
+717
View File
@@ -1,3 +1,720 @@
Release 2.31-r1302 (19 May 2026)
--------------------------------
Notable changes to minimap2:
* Bugfix: supplementary and secondary alignments were occasionally flagged
incorrectly.
* Bugfix: Smith-Waterman alignment for inversion alignment led to an
out-of-bound access in rare cases.
Changes to paftools.js:
* New feature: new `sim2bed` subcommand to get a BED file from simulated
reads.
* New feature: new `badread2fa` subcommand to format reads simulated by
the Badread simulator.
Change to the python binding:
* New feature: mappy optionally writes the `ds` tag.
* Bugfix: a use-after-free error (#1345)
The two bugs in minimap2 had existed for years. They were caught by Jeremy Wang
at UNC when he ported minimap2 to Rust. Due to the two bug fixes, this version
occasionally produces alignment different from the last version.
(2.31: 19 May 2026, r1302)
Release 2.30-r1287 (15 June 2025)
---------------------------------
Notable changes:
* Improvement: consolidated `--spsc`.
* Deprecation: subcommands `splice2bed`, `gff2bed`, `gff2junc`, `junceval` and
`exoneval` in `paftools.js` are deprecated by minigff. They will remain
indefinitely for backward compatibility.
(2.30: 15 June 2025, r1287)
Release 2.29-r1283 (18 April 2025)
----------------------------------
Notable changes to minimap2:
* New feature: added the `splice:sr` preset for short RNA-seq read alignment.
Users may use `-j` to specify known gene annotation to improve spliced
alignment close to the ends of short reads. Also added `--write-junc` and
`--pass1` for 2-pass short-read RNA-seq alignment.
* Experimental feature: read splice scores from a file specified by `--spsc`
and consider the scores during base alignment. The feature makes it possible
to apply advanced splice models and to improve spliced alignment.
* Change: adjusted the mapping quality calculation for spliced alignment.
* Bugfixes: a) missing overlap alignment when base alignment is requested
(#969); b) incorrect summary information for long genomes (#1192); c)
missing parameter check for `--score-N` (#1226).
* Improvement: a) warn about absent junction files (#1229); b) report an error
if a wrong preset prefixed with "splice" is specified (#589).
Notable changes to mappy:
* Improvement: allow passing read name (#1260)
* Improvement: exposed score for ambiguous bases (#1240)
Minimap2 now supports short/long genomic/RNA-seq read alignment along with
contig alignment and all-vs-all read overlapping. It produces identical genomic
long-read or contig alignment to v2.27. Short genomic read alignment and the
mapping quality of long RNA-seq read alignment may slightly differ in very rare
cases.
(2.29: 18 April 2025, r1283)
Release 2.28-r1209 (27 March 2024)
----------------------------------
Notable changes to minimap2:
* Bugfix: `--MD` was not working properly due to the addition of `--ds` in the
last release (#1181 and #1182).
* New feature: added an experimental preset `lq:hqae` for aligning accurate
long reads back to their assembly. It has been observed that `map-hifi` and
`lr:hq` may produce many wrong alignments around centromeres when accurate
long reads (PacBio HiFi or Nanopore duplex/Q20+) are mapped to a diploid
assembly constructed from them. This new preset produces much more accurate
alignment. It is still experimental and may be subjective to changes in
future.
* Change: reduced the default `--cap-kalloc` to 500m to lower the peak
memory consumption (#855).
Notable changes to mappy:
* Bugfix: mappy option struct was out of sync with minimap2 (#1177).
Minimap2 should output identical alignments to v2.27.
(2.28: 27 March 2024, r1209)
Release 2.27-r1193 (12 March 2024)
----------------------------------
Notable changes to minimap2:
* New feature: added the `lr:hq` preset for accurate long reads at ~1% error
rate. This was suggested by Oxford Nanopore developers (#1127). It is not
clear if this preset also works well for PacBio HiFi reads.
* New feature: added the `map-iclr` preset for Illumina Complete Long Reads
(#1069), provided by Illumina developers.
* New feature: added option `-b` to specify mismatch penalty for base
transitions (i.e. A-to-G or C-to-T changes).
* New feature: added option `--ds` to generate a new `ds:Z` tag that
indicates uncertainty in INDEL positions. It is an extension to `cs`. The
`mgutils-es6.js` script in minigraph parses `ds`.
* Bugfix: avoided a NULL pointer dereference (#1154). This would not have an
effect on most systems but would still be good to fix.
* Bugfix: reverted the value of `ms:i` to pre-2.22 versions (#1146). This was
an oversight. See fcd4df2 for details.
Notable changes to paftools.js and mappy:
* New feature: expose `bw_long` to mappy's Aligner class (#1124).
* Bugfix: fixed several compatibility issues with k8 v1.0 (#1161 and #1166).
Subcommands "call", "pbsim2fq" and "mason2fq" were not working with v1.0.
Minimap2 should output identical alignments to v2.26, except the ms tag.
(2.27: 12 March 2024, r1193)
Release 2.26-r1175 (29 April 2023)
----------------------------------
Fixed the broken Python package. This is the only change.
(2.26: 25 April 2023, r1173)
Release 2.25-r1173 (25 April 2023)
----------------------------------
Notable changes:
* Improvement: use the miniprot splice model for RNA-seq alignment by default.
This model considers non-GT-AG splice sites and leads to slightly higher
(<0.1%) accuracy and sensitivity on real human data.
* Change: increased the default `-I` to `8G` such that minimap2 would create a
uni-part index for a pair of mammalian genomes. This change may increase the
memory for all-vs-all read overlap alignment given large datasets.
* New feature: output the sequences in secondary alignments with option
`--secondary-seq` (#687).
* Bugfix: --rmq was not parsed correctly (#1010)
* Bugfix: possibly incorrect coordinate when applying end bonus to the target
sequence (#1025). This is a ksw2 bug. It does not affect minimap2 as
minimap2 is not using the affected feature.
* Improvement: incorporated several changes for better compatibility with
Windows (#1051) and for minimap2 integration at Oxford Nanopore Technologies
(#1048 and #1033).
* Improvement: output the HD-line in SAM output (#1019).
* Improvement: check minimap2 index file in mappy to prevent segmentation
fault for certain indices (#1008).
For genomic sequences, minimap2 should give identical output to v2.24.
Long-read RNA-seq alignment may occasionally differ from previous versions.
(2.25: 25 April 2023, r1173)
Release 2.24-r1122 (26 December 2021)
-------------------------------------
This release improves alignment around long poorly aligned regions. Older
minimap2 may chain through such regions in rare cases which may result in
missing alignments later. The issue has become worse since the the change of
the chaining algorithm in v2.19. v2.23 implements an incomplete remedy. This
release provides a better solution with a X-drop-like heuristic and by enabling
two-bandwidth chaining in the assembly mode.
(2.24: 26 December 2021, r1122)
Release 2.23-r1111 (18 November 2021)
-------------------------------------
Notable changes:
* Bugfix: fixed missing alignments around long inversions (#806 and #816).
This bug affected v2.19 through v2.22.
* Improvement: avoid extremely long mapping time for pathologic reads with
highly repeated k-mers not in the reference (#771). Use --q-occ-frac=0
to disable the new heuristic.
* Change: use --cap-kalloc=1g by default.
(2.23: 18 November 2021, r1111)
Release 2.22-r1101 (7 August 2021)
----------------------------------
When choosing the best alignment, this release uses logarithm gap penalty and
query-specific mismatch penalty. It improves the sensitivity to long INDELs in
repetitive regions.
Other notable changes:
* Bugfix: fixed an indirect memory leak that may waste a large amount of
memory given highly repetitive reference such as a 16S RNA database (#749).
All versions of minimap2 have this issue.
* New feature: added --cap-kalloc to reduce the peak memory. This option is
not enabled by default but may become the default in future releases.
Known issue:
* Minimap2 may take a long time to map a read (#771). So far it is not clear
if this happens to v2.18 and earlier versions.
(2.22: 7 August 2021, r1101)
Release 2.21-r1071 (6 July 2021)
--------------------------------
This release fixed a regression in short-read mapping introduced in v2.19
(#776). It also fixed invalid comparisons of uninitialized variables, though
these are harmless (#752). Long-read alignment should be identical to v2.20.
(2.21: 6 July 2021, r1071)
Release 2.20-r1061 (27 May 2021)
--------------------------------
This release fixed a bug in the Python module and improves the command-line
compatibiliity with v2.18. In v2.19, if `-r` is specified with an `asm*` preset,
users would get alignments more fragmented than v2.18. This could be an issue
for existing pipelines specifying `-r`. This release resolves this issue.
(2.20: 27 May 2021, r1061)
Release 2.19-r1057 (26 May 2021)
--------------------------------
This release includes a few important improvements backported from unimap:
* Improvement: more contiguous alignment through long INDELs. This is enabled
by the minigraph chaining algorithm. All `asm*` presets now use the new
algorithm. They can find INDELs up to 100kb and may be faster for
chromosome-long contigs. The default mode and `map*` presets use this
algorithm to replace the long-join heuristic.
* Improvement: better alignment in highly repetitive regions by rescuing
high-occurrence seeds. If the distance between two adjacent seeds is too
large, attempt to choose a fraction of high-occurrence seeds in-between.
Minimap2 now produces fewer clippings and alignment break points in long
satellite regions.
* Improvement: allow to specify an interval of k-mer occurrences with `-U`.
For repeat-rich genomes, the automatic k-mer occurrence threshold determined
by `-f` may be too large and makes alignment impractically slow. The new
option protects against such cases. Enabled for `asm*` and `map-hifi`.
* New feature: added the `map-hifi` preset for maping PacBio High-Fidelity
(HiFi) reads.
* Change to the default: apply `--cap-sw-mem=100m` for genomic alignment.
* Bugfix: minimap2 could not generate an index file with `-xsr` (#734).
This release represents the most signficant algorithmic change since v2.1 in
2017. With features backported from unimap, minimap2 now has similar power to
unimap for contig alignment. Unimap will remain an experimental project and is
no longer recommended over minimap2. Sorry for reverting the recommendation in
short time.
(2.19: 26 May 2021, r1057)
Release 2.18-r1015 (9 April 2021)
---------------------------------
This release fixes multiple rare bugs in minimap2 and adds additional
functionality to paftools.js.
Changes to minimap2:
* Bugfix: a rare segfault caused by an off-by-one error (#489)
* Bugfix: minimap2 segfaulted due to an uninitilized variable (#622 and #625).
* Bugfix: minimap2 parsed spaces as field separators in BED (#721). This led
to issues when the BED name column contains spaces.
* Bugfix: minimap2 `--split-prefix` did not work with long reference names
(#394).
* Bugfix: option `--junc-bonus` didn't work (#513)
* Bugfix: minimap2 didn't return 1 on I/O errors (#532)
* Bugfix: the `de:f` tag (sequence divergence) could be negative if there were
ambiguous bases
* Bugfix: fixed two undefined behaviors caused by calling memcpy() on
zero-length blocks (#443)
* Bugfix: there were duplicated SAM @SQ lines if option `--split-prefix` is in
use (#400 and #527)
* Bugfix: option -K had to be smaller than 2 billion (#491). This was caused
by a 32-bit integer overflow.
* Improvement: optionally compile against SIMDe (#597). Minimap2 should work
with IBM POWER CPUs, though this has not been tested. To compile with SIMDe,
please use `make -f Makefile.simde`.
* Improvement: more informative error message for I/O errors (#454) and for
FASTQ parsing errors (#510)
* Improvement: abort given malformatted RG line (#541)
* Improvement: better formula to estimate the `dv:f` tag (approximate sequence
divergence). See DOI:10.1101/2021.01.15.426881.
* New feature: added the `--mask-len` option to fine control the removal of
redundant hits (#659). The default behavior is unchanged.
Changes to mappy:
* Bugfix: mappy caused segmentation fault if the reference index is not
present (#413).
* Bugfix: fixed a memory leak via 238b6bb3
* Change: always require Cython to compile the mappy module (#723). Older
mappy packages at PyPI bundled the C source code generated by Cython such
that end users did not need to install Cython to compile mappy. However, as
Python 3.9 is breaking backward compatibility, older mappy does not work
with Python 3.9 anymore. We have to add this Cython dependency as a
workaround.
Changes to paftools.js:
* Bugfix: the "part10-" line from asmgene was wrong (#581)
* Improvement: compatibility with GTF files from GenBank (#422)
* New feature: asmgene also checks missing multi-copy genes
* New feature: added the misjoin command to evaluate large-scale misjoins and
megabase-long inversions.
Although given the many bug fixes and minor improvements, the core algorithm
stays the same. This version of minimap2 produces nearly identical alignments
to v2.17 except very rare corner cases.
Now unimap is recommended over minimap2 for aligning long contigs against a
reference genome. It often takes less wall-clock time and is much more
sensitive to long insertions and deletions.
(2.18: 9 April 2021, r1015)
Release 2.17-r941 (4 May 2019)
------------------------------
Changes since the last release:
* Fixed flawed CIGARs like `5I6D7I` (#392).
* Bugfix: TLEN should be 0 when either end is unmapped (#373 and #365).
* Bugfix: mappy is unable to write index (#372).
* Added option `--junc-bed` to load known gene annotations in the BED12
format. Minimap2 prefers annotated junctions over novel junctions (#197 and
#348). GTF can be converted to BED12 with `paftools.js gff2bed`.
* Added option `--sam-hit-only` to suppress unmapped hits in SAM (#377).
* Added preset `splice:hq` for high-quality CCS or mRNA sequences. It applies
better scoring and improves the sensitivity to small exons. This preset may
introduce false small introns, but the overall accuracy should be higher.
This version produces nearly identical alignments to v2.16, except for CIGARs
affected by the bug mentioned above.
(2.17: 5 May 2019, r941)
Release 2.16-r922 (28 February 2019)
------------------------------------
This release is 50% faster for mapping ultra-long nanopore reads at comparable
accuracy. For short-read mapping, long-read overlapping and ordinary long-read
mapping, the performance and accuracy remain similar. This speedup is achieved
with a new heuristic to limit the number of chaining iterations (#324). Users
can disable the heuristic by increasing a new option `--max-chain-iter` to a
huge number.
Other changes to minimap2:
* Implemented option `--paf-no-hit` to output unmapped query sequences in PAF.
The strand and reference name columns are both `*` at an unmapped line. The
hidden option is available in earlier minimap2 but had a different 2-column
output format instead of PAF.
* Fixed a bug that leads to wrongly calculated `de` tags when ambiguous bases
are involved (#309). This bug only affects v2.15.
* Fixed a bug when parsing command-line option `--splice` (#344). This bug was
introduced in v2.13.
* Fixed two division-by-zero cases (#326). They don't affect final alignments
because the results of the divisions are not used in both case.
* Added an option `-o` to output alignments to a specified file. It is still
recommended to use UNIX pipes for on-the-fly conversion or compression.
* Output a new `rl` tag to give the length of query regions harboring
repetitive seeds.
Changes to paftool.js:
* Added a new option to convert the MD tag to the long form of the cs tag.
Changes to mappy:
* Added the `mappy.Aligner.seq_names` method to return sequence names (#312).
For NA12878 ultra-long reads, this release changes the alignments of <0.1% of
reads in comparison to v2.15. All these reads have highly fragmented alignments
and are likely to be problematic anyway. For shorter or well aligned reads,
this release should produce mostly identical alignments to v2.15.
(2.16: 28 February 2019, r922)
Release 2.15-r905 (10 January 2019)
-----------------------------------
Changes to minimap2:
* Fixed a rare segmentation fault when option -H is in use (#307). This may
happen when there are very long homopolymers towards the 5'-end of a read.
* Fixed wrong CIGARs when option --eqx is used (#266).
* Fixed a typo in the base encoding table (#264). This should have no
practical effect.
* Fixed a typo in the example code (#265).
* Improved the C++ compatibility by removing "register" (#261). However,
minimap2 still can't be compiled in the pedantic C++ mode (#306).
* Output a new "de" tag for gap-compressed sequence divergence.
Changes to paftools.js:
* Added "asmgene" to evaluate the completeness of an assembly by measuring the
uniquely mapped single-copy genes. This command learns the idea of BUSCO.
* Added "vcfpair" to call a phased VCF from phased whole-genome assemblies. An
earlier version of this script is used to produce the ground truth for the
syndip benchmark [PMID:30013044].
This release produces identical alignment coordinates and CIGARs in comparison
to v2.14. Users are advised to upgrade due to the several bug fixes.
(2.15: 10 Janurary 2019, r905)
Release 2.14-r883 (5 November 2018)
-----------------------------------
Notable changes:
* Fixed two minor bugs caused by typos (#254 and #266).
* Fixed a bug that made minimap2 abort when --eqx was used together with --MD
or --cs (#257).
* Added --cap-sw-mem to cap the size of DP matrices (#259). Base alignment may
take a lot of memory in the splicing mode. This may lead to issues when we
run minimap2 on a cluster with a hard memory limit. The new option avoids
unlimited memory usage at the cost of missing a few long introns.
* Conforming to C99 and C11 when possible (#261).
* Warn about malformatted FASTA or FASTQ (#252 and #255).
This release occasionally produces base alignments different from v2.13. The
overall alignment accuracy remain similar.
(2.14: 5 November 2018, r883)
Release 2.13-r850 (11 October 2018)
-----------------------------------
Changes to minimap2:
* Fixed wrongly formatted SAM when -L is in use (#231 and #233).
* Fixed an integer overflow in rare cases.
* Added --hard-mask-level to fine control split alignments (#244).
* Made --MD work with spliced alignment (#139).
* Replaced musl's getopt with ketopt for portability.
* Log peak memory usage on exit.
This release should produce alignments identical to v2.12 and v2.11.
(2.13: 11 October 2018, r850)
Release 2.12-r827 (6 August 2018)
---------------------------------
Changes to minimap2:
* Added option --split-prefix to write proper alignments (correct mapping
quality and clustered query sequences) given a multi-part index (#141 and
#189; mostly by @hasindu2008).
* Fixed a memory leak when option -y is in use.
Changes to mappy:
* Support the MD/cs tag (#183 and #203).
* Allow mappy to index a single sequence, to add extra flags and to change the
scoring system.
Minimap2 should produce alignments identical to v2.11.
(2.12: 6 August 2018, r827)
Release 2.11-r797 (20 June 2018)
--------------------------------
Changes to minimap2:
* Improved alignment accuracy in low-complexity regions for SV calling. Thank
@armintoepfer for multiple offline examples.
* Added option --eqx to encode sequence match/mismatch with the =/X CIGAR
operators (#156, #157 and #175).
* When compiled with VC++, minimap2 generated wrong alignments due to a
comparison between a signed integer and an unsigned integer (#184). Also
fixed warnings reported by "clang -Wextra".
* Fixed incorrect anchor filtering due to a missing 64- to 32-bit cast.
* Fixed incorrect mapping quality for inversions (#148).
* Fixed incorrect alignment involving ambiguous bases (#155).
* Fixed incorrect presets: option `-r 2000` is intended to be used with
ava-ont, not ava-pb. The bug was introduced in 2.10.
* Fixed a bug when --for-only/--rev-only is used together with --sr or
--heap-sort=yes (#166).
* Fixed option -Y that was not working in the previous releases.
* Added option --lj-min-ratio to fine control the alignment of long gaps
found by the "long-join" heuristic (#128).
* Exposed `mm_idx_is_idx`, `mm_idx_load` and `mm_idx_dump` C APIs (#177).
Also fixed a bug when indexing without reference names (this feature is not
exposed to the command line).
Changes to mappy:
* Added `__version__` (#165).
* Exposed the maximum fragment length parameter to mappy (#174).
Changes to paftools:
* Don't crash when there is no "cg" tag (#153).
* Fixed wrong coverage report by "paftools.js call" (#145).
This version may produce slightly different base-level alignment. The overall
alignment statistics should remain similar.
(2.11: 20 June 2018, r797)
Release 2.10-r761 (27 March 2018)
---------------------------------
Changes to minimap2:
* Optionally output the MD tag for compatibility with existing tools (#63,
#118 and #137).
* Use SSE compiler flags more precisely to prevent compiling errors on certain
machines (#127).
* Added option --min-occ-floor to set a minimum occurrence threshold. Presets
intended for assembly-to-reference alignment set this option to 100. This
option alleviates issues with regions having high copy numbers (#107).
* Exit with non-zero code on file writing errors (e.g. disk full; #103 and
#132).
* Added option -y to copy FASTA/FASTQ comments in query sequences to the
output (#136).
* Added the asm20 preset for alignments between genomes at 5-10% sequence
divergence.
* Changed the band-width in the ava-ont preset from 500 to 2000. Oxford
Nanopore reads may contain long deletion sequencing errors that break
chaining.
Changes to mappy, the Python binding:
* Fixed a typo in Align.seq() (#126).
Changes to paftools.js, the companion script:
* Command sam2paf now converts the MD tag to cs.
* Support VCF output for assembly-to-reference variant calling (#109).
This version should produce identical alignment for read overlapping, RNA-seq
read mapping, and genomic read mapping. We have also added a cook book to show
the variety uses of minimap2 on real datasets. Please see cookbook.md in the
minimap2 source code directory.
(2.10: 27 March 2017, r761)
Release 2.9-r720 (23 February 2018)
-----------------------------------
This release fixed multiple minor bugs.
* Fixed two bugs that lead to incorrect inversion alignment. Also improved the
sensitivity to small inversions by using double Z-drop cutoff (#112).
* Fixed an issue that may cause the end of a query sequence unmapped (#104).
* Added a mappy API to retrieve sequences from the index (#126) and to reverse
complement DNA sequences. Fixed a bug where the `best_n` parameter did not
work (#117).
* Avoided segmentation fault given incorrect FASTQ input (#111).
* Combined all auxiliary javascripts to paftools.js. Fixed several bugs in
these scripts at the same time.
(2.9: 24 February 2018, r720)
Release 2.8-r672 (1 February 2018)
----------------------------------
+106 -54
View File
@@ -1,28 +1,36 @@
[![GitHub Downloads](https://img.shields.io/github/downloads/lh3/minimap2/total.svg?style=social&logo=github&label=Download)](https://github.com/lh3/minimap2/releases)
[![BioConda Install](https://img.shields.io/conda/dn/bioconda/minimap2.svg?style=flag&label=BioConda%20install)](https://anaconda.org/bioconda/minimap2)
[![PyPI](https://img.shields.io/pypi/v/mappy.svg?style=flat)](https://pypi.python.org/pypi/mappy)
[![Build Status](https://travis-ci.org/lh3/minimap2.svg?branch=master)](https://travis-ci.org/lh3/minimap2)
[![Build Status](https://github.com/lh3/minimap2/actions/workflows/ci.yaml/badge.svg)](https://github.com/lh3/minimap2/actions)
## <a name="started"></a>Getting Started
**ALERT:** `minimap2.com` is a [phishing site](https://github.com/lh3/minimap2/issues/1316). Please don't use anything from that website.
```sh
git clone https://github.com/lh3/minimap2
cd minimap2 && make
# long sequences against a reference genome
./minimap2 -a test/MT-human.fa test/MT-orang.fa > test.sam
# create an index first and then map
./minimap2 -d MT-human.mmi test/MT-human.fa
./minimap2 -a MT-human.mmi test/MT-orang.fa > test.sam
./minimap2 -x map-ont -d MT-human-ont.mmi test/MT-human.fa
./minimap2 -a MT-human-ont.mmi test/MT-orang.fa > test.sam
# use presets (no test data)
./minimap2 -ax map-pb ref.fa pacbio.fq.gz > aln.sam # PacBio genomic reads
./minimap2 -ax map-pb ref.fa pacbio.fq.gz > aln.sam # PacBio CLR genomic reads
./minimap2 -ax map-ont ref.fa ont.fq.gz > aln.sam # Oxford Nanopore genomic reads
./minimap2 -ax map-hifi ref.fa pacbio-ccs.fq.gz > aln.sam # PacBio HiFi/CCS genomic reads (v2.19+)
./minimap2 -ax lr:hq ref.fa ont-Q20.fq.gz > aln.sam # Nanopore Q20 genomic reads (v2.27+)
./minimap2 -ax sr ref.fa read1.fa read2.fa > aln.sam # short genomic paired-end reads
./minimap2 -ax splice ref.fa rna-reads.fa > aln.sam # spliced long reads
./minimap2 -ax splice -k14 -uf ref.fa reads.fa > aln.sam # Nanopore Direct RNA-seq
./minimap2 -ax splice ref.fa rna-reads.fa > aln.sam # spliced long reads (strand unknown)
./minimap2 -ax splice -uf -k14 ref.fa reads.fa > aln.sam # noisy Nanopore direct RNA-seq
./minimap2 -ax splice:hq -uf ref.fa query.fa > aln.sam # PacBio Kinnex/Iso-seq (RNA-seq)
./minimap2 -ax splice --junc-bed=anno.bed12 ref.fa query.fa > aln.sam # use annotated junctions
./minimap2 -ax splice:sr ref.fa r1.fq r2.fq > aln.sam # short-read RNA-seq (v2.29+)
./minimap2 -ax splice:sr -j anno.bed12 ref.fa r1.fq r2.fq > aln.sam
./minimap2 -cx asm5 asm1.fa asm2.fa > aln.paf # intra-species asm-to-asm alignment
./minimap2 -x ava-pb reads.fa reads.fa > overlaps.paf # PacBio read overlap
./minimap2 -x ava-ont reads.fa reads.fa > overlaps.paf # Nanopore read overlap
# man page for detailed command line options
man ./minimap2.1
```
## Table of Contents
- [Getting Started](#started)
@@ -33,12 +41,13 @@ man ./minimap2.1
- [Map long noisy genomic reads](#map-long-genomic)
- [Map long mRNA/cDNA reads](#map-long-splice)
- [Find overlaps between long reads](#long-overlap)
- [Map short accurate genomic reads](#short-genomic)
- [Map short genomic reads](#short-genomic)
- [Map short RNA-seq reads](#short-rna-seq)
- [Full genome/assembly alignment](#full-genome)
- [Advanced features](#advanced)
- [Working with >65535 CIGAR operations](#long-cigar)
- [The cs optional tag](#cs)
- [Evaluation scripts](#eval)
- [Working with the PAF format](#paftools)
- [Algorithm overview](#algo)
- [Getting help](#help)
- [Citing minimap2](#cite)
@@ -61,16 +70,16 @@ mainstream long-read mappers such as BLASR, BWA-MEM, NGMLR and GMAP. It is more
accurate on simulated long reads and produces biologically meaningful alignment
ready for downstream analyses. For >100bp Illumina short reads, minimap2 is
three times as fast as BWA-MEM and Bowtie2, and as accurate on simulated data.
Detailed evaluations are available from the [minimap2 preprint][preprint].
Detailed evaluations are available from the [minimap2 paper][doi] or the
[preprint][preprint].
### <a name="install"></a>Installation
Minimap2 is optimized for x86-64 CPUs. You can acquire precompiled binaries from
the [release page][release] with:
```sh
curl -L https://github.com/lh3/minimap2/releases/download/v2.8/minimap2-2.8_x64-linux.tar.bz2 \
| tar -jxvf -
./minimap2-2.8_x64-linux/minimap2
curl -L https://github.com/lh3/minimap2/releases/download/v2.31/minimap2-2.31_x64-linux.tar.bz2 | tar -jxvf -
./minimap2-2.31_x64-linux/minimap2
```
If you want to compile from the source, you need to have a C compiler, GNU make
and zlib development files installed. Then type `make` in the source code
@@ -78,13 +87,20 @@ directory to compile. If you see compilation errors, try `make sse2only=1`
to disable SSE4 code, which will make minimap2 slightly slower.
Minimap2 also works with ARM CPUs supporting the NEON instruction sets. To
compile, use `make arm_neon=1`.
compile for 32 bit ARM architectures (such as ARMv7), use `make arm_neon=1`. To
compile for for 64 bit ARM architectures (such as ARMv8), use `make arm_neon=1
aarch64=1`.
Minimap2 can use [SIMD Everywhere (SIMDe)][simde] library for porting
implementation to the different SIMD instruction sets. To compile using SIMDe,
use `make -f Makefile.simde`. To compile for ARM CPUs, use `Makefile.simde`
with the ARM related command lines given above.
### <a name="general"></a>General usage
Without any options, minimap2 takes a reference database and a query sequence
file as input and produce approximate mapping, without base-level alignment
(i.e. no CIGAR), in the [PAF format][paf]:
(i.e. coordinates are only approximate and no CIGAR in output), in the [PAF format][paf]:
```sh
minimap2 ref.fa query.fq > approx-mapping.paf
```
@@ -125,19 +141,22 @@ parameters at the same time. The default setting is the same as `map-ont`.
#### <a name="map-long-genomic"></a>Map long noisy genomic reads
```sh
minimap2 -ax map-pb ref.fa pacbio-reads.fq > aln.sam # for PacBio subreads
minimap2 -ax map-pb ref.fa pacbio-reads.fq > aln.sam # for PacBio CLR reads
minimap2 -ax map-ont ref.fa ont-reads.fq > aln.sam # for Oxford Nanopore reads
minimap2 -ax map-iclr ref.fa iclr-reads.fq > aln.sam # for Illumina Complete Long Reads
```
The difference between `map-pb` and `map-ont` is that `map-pb` uses
homopolymer-compressed (HPC) minimizers as seeds, while `map-ont` uses ordinary
minimizers as seeds. Emperical evaluation suggests HPC minimizers improve
performance and sensitivity when aligning PacBio reads, but hurt when aligning
Nanopore reads.
minimizers as seeds. Empirical evaluation suggests HPC minimizers improve
performance and sensitivity when aligning PacBio CLR reads, but hurt when aligning
Nanopore reads. `map-iclr` uses an adjusted alignment scoring matrix that
accounts for the low overall error rate in the reads, with transversion errors
being less frequent than transitions.
#### <a name="map-long-splice"></a>Map long mRNA/cDNA reads
```sh
minimap2 -ax splice -uf ref.fa iso-seq.fq > aln.sam # PacBio Iso-seq/traditional cDNA
minimap2 -ax splice:hq -uf ref.fa iso-seq.fq > aln.sam # PacBio Iso-seq/traditional cDNA
minimap2 -ax splice ref.fa nanopore-cdna.fa > aln.sam # Nanopore 2D cDNA-seq
minimap2 -ax splice -uf -k14 ref.fa direct-rna.fq > aln.sam # Nanopore Direct RNA-seq
minimap2 -ax splice --splice-flank=no SIRV.fa SIRV-seq.fa # mapping against SIRV control
@@ -156,9 +175,8 @@ or the last exons.
Minimap2 rates an alignment by the score of the max-scoring sub-segment,
*excluding* introns, and marks the best alignment as primary in SAM. When a
spliced gene also has unspliced pseudogenes, minimap2 does not intentionally
prefer spliced alignment, though in practice it more often marks the spliced
alignment as the primary. By default, minimap2 outputs up to five secondary
spliced gene also has unspliced pseudogenes, minimap2 slightly prefers
the spliced alignment. By default, minimap2 outputs up to five secondary
alignments (i.e. likely pseudogenes in the context of RNA-seq mapping). This
can be tuned with option **-N**.
@@ -176,10 +194,27 @@ This is because SIRV does not honor the evolutionarily conservative splicing
signal. If you are studying SIRV, you may apply `--splice-flank=no` to let
minimap2 only model GT..AG, ignoring the additional base.
Since v2.17, minimap2 can optionally take annotated genes as input and
prioritize on annotated splice junctions. To use this feature, you can
```sh
paftools.js gff2bed anno.gff > anno.bed
minimap2 -ax splice --junc-bed anno.bed ref.fa query.fa > aln.sam
```
Here, `anno.gff` is the gene annotation in the GTF or GFF3 format (`gff2bed`
automatically tests the format). The output of `gff2bed` is in the 12-column
BED format, or the BED12 format. With the `--junc-bed` option, minimap2 adds a
bonus score (tuned by `--junc-bonus`) if an aligned junction matches a junction
in the annotation. Option `--junc-bed` also takes 5-column BED, including the
strand field. In this case, each line indicates an oriented junction.
**Note:** `--junc-bed` is intended for long noisy RNA-seq reads only.
Applying the option to short RNA-seq reads would increase run time with little
improvement to junction accuracy.
#### <a name="long-overlap"></a>Find overlaps between long reads
```sh
minimap2 -x ava-pb reads.fq reads.fq > ovlp.paf # PacBio read overlap
minimap2 -x ava-pb reads.fq reads.fq > ovlp.paf # PacBio CLR read overlap
minimap2 -x ava-ont reads.fq reads.fq > ovlp.paf # Oxford Nanopore read overlap
```
Similarly, `ava-pb` uses HPC minimizers while `ava-ont` uses ordinary
@@ -188,7 +223,7 @@ the overlapping mode because it is slow and may produce false positive
overlaps. However, if performance is not a concern, you may try to add `-a` or
`-c` anyway.
#### <a name="short-genomic"></a>Map short accurate genomic reads
#### <a name="short-genomic"></a>Map short genomic reads
```sh
minimap2 -ax sr ref.fa reads-se.fq > aln.sam # single-end alignment
@@ -201,8 +236,18 @@ be paired if they are adjacent in the input stream and have the same name (with
the `/[0-9]` suffix trimmed if present). Single- and paired-end reads can be
mixed.
Minimap2 does not work well with short spliced reads. There are many capable
RNA-seq mappers for short reads.
#### <a name="short-rna-seq"></a>Map short RNA-seq reads
```sh
minimap2 -ax splice:sr ref.fa reads-se.fq.gz > aln.sam # single-end
minimap2 -ax splice:sr ref.fa r1.fq.gz r2.fq.gz > aln.sam # paired-end
minimap2 -ax splice:sr -j anno.bed ref.fa r1.fq r2.fq > aln.sam # use annotation
# 2-pass alignment
minimap2 -x splice:sr -j anno.bed --write-junc ref.fa r1.fq r2.fq > junc.bed
minimap2 -ax splice:sr -j anno.bed --pass1=junc.bed ref.fa r1.fq r2.fq > aln.sam
```
The new preset `splice:sr` was added in v2.29. It functions similarly to `sr`
except that it performs spliced alignment.
#### <a name="full-genome"></a>Full genome/assembly alignment
@@ -226,10 +271,10 @@ To avoid this issue, you can add option `-L` at the minimap2 command line.
This option moves a long CIGAR to the `CG` tag and leaves a fully clipped CIGAR
at the SAM CIGAR column. Current tools that don't read CIGAR (e.g. merging and
sorting) still work with such BAM records; tools that read CIGAR will
effectively ignore these records. It has been decided that future tools will
effectively ignore these records. It has been decided that future tools
will seamlessly recognize long-cigar records generated by option `-L`.
**TD;DR**: if you work with ultra-long reads and use tools that only process
**TL;DR**: if you work with ultra-long reads and use tools that only process
BAM files, please add option `-L`.
#### <a name="cs"></a>The cs optional tag
@@ -247,35 +292,24 @@ CGATCGATAAATAGAGTAG---GAATAGCA
CGATCG---AATAGAGTAGGTCGAATtGCA
```
is represented as `:6-ata:10+gtc:4*at:3`, where `:[0-9]+` represents an
identical block, `-ata` represents a deltion, `+gtc` an insertion and `*at`
identical block, `-ata` represents a deletion, `+gtc` an insertion and `*at`
indicates reference base `a` is substituted with a query base `t`. It is
similar to the `MD` SAM tag but is standalone and easier to parse.
If `--cs=long` is used, the `cs` string also contains identical sequences in
the alignment. The above example will become
`=CGATCG-ata=AATAGAGTAG+gtc=GAAT*at=GCA`. The long form of `cs` encodes both
reference and query sequences in one string.
reference and query sequences in one string. The `cs` tag also encodes intron
positions and splicing signals (see the [minimap2 manpage][manpage-cs] for
details).
#### <a name="eval"></a>Evaluation scripts
#### <a name="paftools"></a>Working with the PAF format
Minimap2 comes with several (java)scripts for evaluating the accuracy of
minimap2. These scripts require the [k8][k8] javascript shell to run.
Recent minimap2 binary release tar-balls contain a copy of k8 executable, a
single file. Here are a few examples on how to use these scripts:
```sh
# Generate reads from PBSIM alignment (truth encoded in read names)
k8 misc/sim-pbsim.js ref.fa.fai pbsim-aln.maf > pbsim-reads.fq
# Generate reads from mason2 alignment (not tested for simulated SVs)
k8 misc/sim-mason2.js mason2-aln.sam > mason2-reads.fq
# Evaluate mapping accuracy with ROC-like curve
k8 misc/sim-eval.js my-aln.sam.gz > result.txt
k8 misc/sim-eval.js my-aln.paf.gz > result.txt
# Collect alignment statistics
k8 misc/mapstat.js my-aln.sam > result.txt
# Compare spliced junctions to existing gene annotations
k8 misc/intron-eval.js anno.gtf my-spliced-aln.sam > result.txt
```
Minimap2 also comes with a (java)script [paftools.js](misc/paftools.js) that
processes alignments in the PAF format. It calls variants from
assembly-to-reference alignment, lifts over BED files based on alignment,
converts between formats and provides utilities for various evaluations. For
details, please see [misc/README.md](misc/README.md).
### <a name="algo"></a>Algorithm overview
@@ -324,15 +358,22 @@ highlighted in bold. The description may help to tune minimap2 parameters.
### <a name="help"></a>Getting help
Manpage [minimap2.1][manpage] provides detailed description of minimap2
command line options and optional tags. If you encounter bugs or have further
questions or requests, you can raise an issue at the [issue page][issue].
There is not a specific mailing list for the time being.
command line options and optional tags. The [FAQ](FAQ.md) page answers several
frequently asked questions. If you encounter bugs or have further questions or
requests, you can raise an issue at the [issue page][issue]. There is not a
specific mailing list for the time being.
### <a name="cite"></a>Citing minimap2
If you use minimap2 in your work, please consider to cite:
If you use minimap2 in your work, please cite:
> Li, H. (2017). Minimap2: fast pairwise alignment for long nucleotide sequences. [arXiv:1708.01492][preprint]
> Li, H. (2018). Minimap2: pairwise alignment for nucleotide sequences.
> *Bioinformatics*, **34**:3094-3100. [doi:10.1093/bioinformatics/bty191][doi]
and/or:
> Li, H. (2021). New strategies to improve minimap2 alignment accuracy.
> *Bioinformatics*, **37**:4572-4574. [doi:10.1093/bioinformatics/btab705][doi2]
## <a name="dguide"></a>Developers' Guide
@@ -359,6 +400,12 @@ mappy` or [from BioConda][mappyconda] via `conda install -c bioconda mappy`.
possible to add non-SIMD support, but it would make minimap2 slower by
several times.
* Minimap2 does not work with a single query or database sequence ~2
billion bases or longer (2,147,483,647 to be exact). The total length of all
sequences can well exceed this threshold.
* Minimap2 often misses small exons.
[paf]: https://github.com/lh3/miniasm/blob/master/PAF.md
@@ -375,3 +422,8 @@ mappy` or [from BioConda][mappyconda] via `conda install -c bioconda mappy`.
[issue]: https://github.com/lh3/minimap2/issues
[k8]: https://github.com/attractivechaos/k8
[manpage]: https://lh3.github.io/minimap2/minimap2.html
[manpage-cs]: https://lh3.github.io/minimap2/minimap2.html#10
[doi]: https://doi.org/10.1093/bioinformatics/bty191
[doi2]: https://doi.org/10.1093/bioinformatics/btab705
[simde]: https://github.com/nemequ/simde
[unimap]: https://github.com/lh3/unimap
+517 -117
View File
File diff suppressed because it is too large Load Diff
+41 -15
View File
@@ -15,7 +15,7 @@ unsigned char seq_comp_table[256] = {
48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63,
64, 'T', 'V', 'G', 'H', 'E', 'F', 'C', 'D', 'I', 'J', 'M', 'L', 'K', 'N', 'O',
'P', 'Q', 'Y', 'S', 'A', 'A', 'B', 'W', 'X', 'R', 'Z', 91, 92, 93, 94, 95,
64, 't', 'v', 'g', 'h', 'e', 'f', 'c', 'd', 'i', 'j', 'm', 'l', 'k', 'n', 'o',
96, 't', 'v', 'g', 'h', 'e', 'f', 'c', 'd', 'i', 'j', 'm', 'l', 'k', 'n', 'o',
'p', 'q', 'y', 's', 'a', 'a', 'b', 'w', 'x', 'r', 'z', 123, 124, 125, 126, 127,
128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143,
144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159,
@@ -39,7 +39,7 @@ mm_bseq_file_t *mm_bseq_open(const char *fn)
{
mm_bseq_file_t *fp;
gzFile f;
f = fn && strcmp(fn, "-")? gzopen(fn, "r") : gzdopen(fileno(stdin), "r");
f = fn && strcmp(fn, "-")? gzopen(fn, "r") : gzdopen(0, "r");
if (f == 0) return 0;
fp = (mm_bseq_file_t*)calloc(1, sizeof(mm_bseq_file_t));
fp->fp = f;
@@ -54,21 +54,33 @@ void mm_bseq_close(mm_bseq_file_t *fp)
free(fp);
}
static inline void kseq2bseq(kseq_t *ks, mm_bseq1_t *s, int with_qual)
static inline char *kstrdup(const kstring_t *s)
{
char *t;
t = (char*)malloc(s->l + 1);
memcpy(t, s->s, s->l + 1);
return t;
}
static inline void kseq2bseq(kseq_t *ks, mm_bseq1_t *s, int with_qual, int with_comment)
{
int i;
s->name = strdup(ks->name.s);
s->seq = strdup(ks->seq.s);
for (i = 0; i < ks->seq.l; ++i) // convert U to T
if (ks->name.l == 0)
fprintf(stderr, "[WARNING]\033[1;31m empty sequence name in the input.\033[0m\n");
s->name = kstrdup(&ks->name);
s->seq = kstrdup(&ks->seq);
for (i = 0; i < (int)ks->seq.l; ++i) // convert U to T
if (s->seq[i] == 'u' || s->seq[i] == 'U')
--s->seq[i];
s->qual = with_qual && ks->qual.l? strdup(ks->qual.s) : 0;
s->qual = with_qual && ks->qual.l? kstrdup(&ks->qual) : 0;
s->comment = with_comment && ks->comment.l? kstrdup(&ks->comment) : 0;
s->l_seq = ks->seq.l;
}
mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int frag_mode, int *n_)
mm_bseq1_t *mm_bseq_read3(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int with_comment, int frag_mode, int *n_)
{
int64_t size = 0;
int ret;
kvec_t(mm_bseq1_t) a = {0,0,0};
kseq_t *ks = fp->ks;
*n_ = 0;
@@ -78,17 +90,17 @@ mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int
size = fp->s.l_seq;
memset(&fp->s, 0, sizeof(mm_bseq1_t));
}
while (kseq_read(ks) >= 0) {
while ((ret = kseq_read(ks)) >= 0) {
mm_bseq1_t *s;
assert(ks->seq.l <= INT32_MAX);
if (a.m == 0) kv_resize(mm_bseq1_t, 0, a, 256);
kv_pushp(mm_bseq1_t, 0, a, &s);
kseq2bseq(ks, s, with_qual);
kseq2bseq(ks, s, with_qual, with_comment);
size += s->l_seq;
if (size >= chunk_size) {
if (frag_mode && a.a[a.n-1].l_seq < CHECK_PAIR_THRES) {
while (kseq_read(ks) >= 0) {
kseq2bseq(ks, &fp->s, with_qual);
while ((ret = kseq_read(ks)) >= 0) {
kseq2bseq(ks, &fp->s, with_qual, with_comment);
if (mm_qname_same(fp->s.name, a.a[a.n-1].name)) {
kv_push(mm_bseq1_t, 0, a, fp->s);
memset(&fp->s, 0, sizeof(mm_bseq1_t));
@@ -98,16 +110,25 @@ mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int
break;
}
}
if (ret < -1) {
if (a.n) fprintf(stderr, "[WARNING]\033[1;31m failed to parse the FASTA/FASTQ record next to '%s'. Continue anyway.\033[0m\n", a.a[a.n-1].name);
else fprintf(stderr, "[WARNING]\033[1;31m failed to parse the first FASTA/FASTQ record. Continue anyway.\033[0m\n");
}
*n_ = a.n;
return a.a;
}
mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int chunk_size, int with_qual, int *n_)
mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int frag_mode, int *n_)
{
return mm_bseq_read3(fp, chunk_size, with_qual, 0, frag_mode, n_);
}
mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int *n_)
{
return mm_bseq_read2(fp, chunk_size, with_qual, 0, n_);
}
mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int *n_)
mm_bseq1_t *mm_bseq_read_frag2(int n_fp, mm_bseq_file_t **fp, int64_t chunk_size, int with_qual, int with_comment, int *n_)
{
int i;
int64_t size = 0;
@@ -128,7 +149,7 @@ mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int
for (i = 0; i < n_fp; ++i) {
mm_bseq1_t *s;
kv_pushp(mm_bseq1_t, 0, a, &s);
kseq2bseq(fp[i]->ks, s, with_qual);
kseq2bseq(fp[i]->ks, s, with_qual, with_comment);
size += s->l_seq;
}
if (size >= chunk_size) break;
@@ -137,6 +158,11 @@ mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int
return a.a;
}
mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int64_t chunk_size, int with_qual, int *n_)
{
return mm_bseq_read_frag2(n_fp, fp, chunk_size, with_qual, 0, n_);
}
int mm_bseq_eof(mm_bseq_file_t *fp)
{
return (ks_eof(fp->ks->f) && fp->s.seq == 0);
+6 -4
View File
@@ -13,14 +13,16 @@ typedef struct mm_bseq_file_s mm_bseq_file_t;
typedef struct {
int l_seq, rid;
char *name, *seq, *qual;
char *name, *seq, *qual, *comment;
} mm_bseq1_t;
mm_bseq_file_t *mm_bseq_open(const char *fn);
void mm_bseq_close(mm_bseq_file_t *fp);
mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int chunk_size, int with_qual, int frag_mode, int *n_);
mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int chunk_size, int with_qual, int *n_);
mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int chunk_size, int with_qual, int *n_);
mm_bseq1_t *mm_bseq_read3(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int with_comment, int frag_mode, int *n_);
mm_bseq1_t *mm_bseq_read2(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int frag_mode, int *n_);
mm_bseq1_t *mm_bseq_read(mm_bseq_file_t *fp, int64_t chunk_size, int with_qual, int *n_);
mm_bseq1_t *mm_bseq_read_frag2(int n_fp, mm_bseq_file_t **fp, int64_t chunk_size, int with_qual, int with_comment, int *n_);
mm_bseq1_t *mm_bseq_read_frag(int n_fp, mm_bseq_file_t **fp, int64_t chunk_size, int with_qual, int *n_);
int mm_bseq_eof(mm_bseq_file_t *fp);
extern unsigned char seq_nt4_table[256];
-157
View File
@@ -1,157 +0,0 @@
#include <stdint.h>
#include <string.h>
#include <stdio.h>
#include "minimap.h"
#include "mmpriv.h"
#include "kalloc.h"
static const char LogTable256[256] = {
#define LT(n) n, n, n, n, n, n, n, n, n, n, n, n, n, n, n, n
-1, 0, 1, 1, 2, 2, 2, 2, 3, 3, 3, 3, 3, 3, 3, 3,
LT(4), LT(5), LT(5), LT(6), LT(6), LT(6), LT(6),
LT(7), LT(7), LT(7), LT(7), LT(7), LT(7), LT(7), LT(7)
};
static inline int ilog2_32(uint32_t v)
{
register uint32_t t, tt;
if ((tt = v>>16)) return (t = tt>>8) ? 24 + LogTable256[t] : 16 + LogTable256[tt];
return (t = v>>8) ? 8 + LogTable256[t] : LogTable256[v];
}
mm128_t *mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int min_cnt, int min_sc, int is_cdna, int n_segs, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km)
{ // TODO: make sure this works when n has more than 32 bits
int32_t k, *f, *p, *t, *v, n_u, n_v;
int64_t i, j, st = 0;
uint64_t *u, *u2, sum_qspan = 0;
float avg_qspan;
mm128_t *b, *w;
if (_u) *_u = 0, *n_u_ = 0;
f = (int32_t*)kmalloc(km, n * 4);
p = (int32_t*)kmalloc(km, n * 4);
t = (int32_t*)kmalloc(km, n * 4);
v = (int32_t*)kmalloc(km, n * 4);
memset(t, 0, n * 4);
for (i = 0; i < n; ++i) sum_qspan += a[i].y>>32&0xff;
avg_qspan = (float)sum_qspan / n;
// fill the score and backtrack arrays
for (i = 0; i < n; ++i) {
uint64_t ri = a[i].x;
int64_t max_j = -1;
int32_t qi = (int32_t)a[i].y, q_span = a[i].y>>32&0xff; // NB: only 8 bits of span is used!!!
int32_t max_f = q_span, n_skip = 0, min_d;
int32_t sidi = (a[i].y & MM_SEED_SEG_MASK) >> MM_SEED_SEG_SHIFT;
while (st < i && ri - a[st].x > max_dist_x) ++st;
for (j = i - 1; j >= st; --j) {
int64_t dr = ri - a[j].x;
int32_t dq = qi - (int32_t)a[j].y, dd, sc, log_dd;
int32_t sidj = (a[j].y & MM_SEED_SEG_MASK) >> MM_SEED_SEG_SHIFT;
if ((sidi == sidj && dr == 0) || dq <= 0) continue; // don't skip if an anchor is used by multiple segments; see below
if ((sidi == sidj && dq > max_dist_y) || dq > max_dist_x) continue;
dd = dr > dq? dr - dq : dq - dr;
if (sidi == sidj && dd > bw) continue;
if (n_segs > 1 && !is_cdna && sidi == sidj && dr > max_dist_y) continue;
min_d = dq < dr? dq : dr;
sc = min_d > q_span? q_span : dq < dr? dq : dr;
log_dd = dd? ilog2_32(dd) : 0;
if (is_cdna || sidi != sidj) {
int c_log, c_lin;
c_lin = (int)(dd * .01 * avg_qspan);
c_log = log_dd;
if (sidi != sidj && dr == 0) ++sc; // possibly due to overlapping paired ends; give a minor bonus
else if (dr > dq || sidi != sidj) sc -= c_lin < c_log? c_lin : c_log;
else sc -= c_lin + (c_log>>1);
} else sc -= (int)(dd * .01 * avg_qspan) + (log_dd>>1);
sc += f[j];
if (sc > max_f) {
max_f = sc, max_j = j;
if (n_skip > 0) --n_skip;
} else if (t[j] == i) {
if (++n_skip > max_skip)
break;
}
if (p[j] >= 0) t[p[j]] = i;
}
f[i] = max_f, p[i] = max_j;
v[i] = max_j >= 0 && v[max_j] > max_f? v[max_j] : max_f; // v[] keeps the peak score up to i; f[] is the score ending at i, not always the peak
}
// find the ending positions of chains
memset(t, 0, n * 4);
for (i = 0; i < n; ++i)
if (p[i] >= 0) t[p[i]] = 1;
for (i = n_u = 0; i < n; ++i)
if (t[i] == 0 && v[i] >= min_sc)
++n_u;
if (n_u == 0) {
kfree(km, a); kfree(km, f); kfree(km, p); kfree(km, t); kfree(km, v);
return 0;
}
u = (uint64_t*)kmalloc(km, n_u * 8);
for (i = n_u = 0; i < n; ++i) {
if (t[i] == 0 && v[i] >= min_sc) {
j = i;
while (j >= 0 && f[j] < v[j]) j = p[j]; // find the peak that maximizes f[]
if (j < 0) j = i; // TODO: this should really be assert(j>=0)
u[n_u++] = (uint64_t)f[j] << 32 | j;
}
}
radix_sort_64(u, u + n_u);
for (i = 0; i < n_u>>1; ++i) { // reverse, s.t. the highest scoring chain is the first
uint64_t t = u[i];
u[i] = u[n_u - i - 1], u[n_u - i - 1] = t;
}
// backtrack
memset(t, 0, n * 4);
for (i = n_v = k = 0; i < n_u; ++i) { // starting from the highest score
int32_t n_v0 = n_v, k0 = k;
j = (int32_t)u[i];
do {
v[n_v++] = j;
t[j] = 1;
j = p[j];
} while (j >= 0 && t[j] == 0);
if (j < 0) {
if (n_v - n_v0 >= min_cnt) u[k++] = u[i]>>32<<32 | (n_v - n_v0);
} else if ((int32_t)(u[i]>>32) - f[j] >= min_sc) {
if (n_v - n_v0 >= min_cnt) u[k++] = ((u[i]>>32) - f[j]) << 32 | (n_v - n_v0);
}
if (k0 == k) n_v = n_v0; // no new chain added, reset
}
*n_u_ = n_u = k, *_u = u; // NB: note that u[] may not be sorted by score here
// free temporary arrays
kfree(km, f); kfree(km, p); kfree(km, t);
// write the result to b[]
b = (mm128_t*)kmalloc(km, n_v * sizeof(mm128_t));
for (i = 0, k = 0; i < n_u; ++i) {
int32_t k0 = k, ni = (int32_t)u[i];
for (j = 0; j < ni; ++j)
b[k] = a[v[k0 + (ni - j - 1)]], ++k;
}
kfree(km, v);
// sort u[] and a[] by a[].x, such that adjacent chains may be joined (required by mm_join_long)
w = (mm128_t*)kmalloc(km, n_u * sizeof(mm128_t));
for (i = k = 0; i < n_u; ++i) {
w[i].x = b[k].x, w[i].y = (uint64_t)k<<32|i;
k += (int32_t)u[i];
}
radix_sort_128x(w, w + n_u);
u2 = (uint64_t*)kmalloc(km, n_u * 8);
for (i = k = 0; i < n_u; ++i) {
int32_t j = (int32_t)w[i].y, n = (int32_t)u[j];
u2[i] = u[j];
memcpy(&a[k], &b[w[i].y>>32], n * sizeof(mm128_t));
k += n;
}
memcpy(u, u2, n_u * 8);
memcpy(b, a, k * sizeof(mm128_t)); // write _a_ to _b_ and deallocate _a_ because _a_ is oversized, sometimes a lot
kfree(km, a); kfree(km, w); kfree(km, u2);
return b;
}
+30
View File
@@ -0,0 +1,30 @@
## Contributor Code of Conduct
As contributors and maintainers of this project, we pledge to respect all
people who contribute through reporting issues, posting feature requests,
updating documentation, submitting pull requests or patches, and other
activities.
We are committed to making participation in this project a harassment-free
experience for everyone, regardless of level of experience, gender, gender
identity and expression, sexual orientation, disability, personal appearance,
body size, race, age, or religion.
Examples of unacceptable behavior by participants include the use of sexual
language or imagery, derogatory comments or personal attacks, trolling, public
or private harassment, insults, or other unprofessional conduct.
Project maintainers have the right and responsibility to remove, edit, or
reject comments, commits, code, wiki edits, issues, and other contributions
that are not aligned to this Code of Conduct. Project maintainers or
contributors who do not follow the Code of Conduct may be removed from the
project team.
Instances of abusive, harassing, or otherwise unacceptable behavior may be
reported by opening an issue or contacting the maintainer via email.
This Code of Conduct is adapted from the [Contributor Covenant][cc], [version
1.0.0][v1].
[cc]: http://contributor-covenant.org/
[v1]: http://contributor-covenant.org/version/1/0/0/
+243
View File
@@ -0,0 +1,243 @@
## Table of Contents
- [Introduction & Installation](#intro)
- [Mapping Genomic Reads](#map-reads)
* [Mapping long reads](#map-pb)
* [Mapping Illumina paired-end reads](#map-sr)
* [Evaluating mapping accuracy with simulated reads (for developers)](#mapeval)
- [Mapping Long RNA-seq Reads](#map-rna)
* [Mapping Nanopore 2D cDNA reads](#map-ont-cdna-2d)
* [Mapping Nanopore direct-RNA reads](#map-direct-rna)
* [Mapping PacBio Iso-seq reads](#map-iso-seq)
- [Full-Genome Alignment](#genome-aln)
* [Intra-species assembly alignment](#asm-to-ref)
* [Cross-species full-genome alignment](#x-species)
* [Eyeballing alignment](#view-aln)
* [Calling variants from assembly-to-reference alignment](#asm-var)
* [Constructing self-homology map](#hom-map)
* [Lift Over (for developers)](#liftover)
- [Read Overlap](#read-overlap)
* [Long-read overlap](#long-read-overlap)
* [Evaluating overlap sensitivity (for developers)](#ov-eval)
## <a name="intro"></a>Introduction & Installation
This cookbook walks you through a variety of applications of minimap2 and its
companion script `paftools.js`. All data here are freely available from the
minimap2 release page at version tag [v2.10][v2.10]. Some examples only work
with v2.10 or later.
To acquire the data used in this cookbook and to install minimap2 and paftools,
please follow the command lines below:
```sh
# install minimap2 executables
curl -L https://github.com/lh3/minimap2/releases/download/v2.31/minimap2-2.31_x64-linux.tar.bz2 | tar jxf -
cp minimap2-2.31_x64-linux/{minimap2,k8,paftools.js} . # copy executables
export PATH="$PATH:"`pwd` # put the current directory on PATH
# download example datasets
curl -L https://github.com/lh3/minimap2/releases/download/v2.10/cookbook-data.tgz | tar zxf -
```
## <a name="map-reads"></a>Mapping Genomic Reads
### <a name="map-pb"></a>Mapping long reads
```sh
minimap2 -ax map-pb -t4 ecoli_ref.fa ecoli_p6_25x_canu.fa > mapped.sam
```
Alternatively, you can create a minimap2 index first and then map:
```sh
minimap2 -x map-pb -d ecoli-pb.mmi ecoli_ref.fa # create an index
minimap2 -ax map-pb ecoli-pb.mmi ecoli_p6_25x_canu.fa > mapped.sam
```
This will save you a couple of minutes when you map against the human genome.
**HOWEVER**, key algorithm parameters such as the k-mer length and window
size can't be changed after indexing. Minimap2 will give you a warning if
parameters used in a pre-built index doesn't match parameters on the command
line. **Please always make sure you are using an intended pre-built index.**
### <a name="map-sr"></a>Mapping Illumina paired-end reads:
```sh
minimap2 -ax sr -t4 ecoli_ref.fa ecoli_mason_1.fq ecoli_mason_2.fq > mapped-sr.sam
```
### <a name="mapeval"></a>Evaluating mapping accuracy with simulated reads (for developers)
```sh
minimap2 -ax sr ecoli_ref.fa ecoli_mason_1.fq ecoli_mason_2.fq | paftools.js mapeval -
```
The output is:
```
Q 60 19712 0 0.000000000 19712
Q 0 282 219 0.010953286 19994
U 6
```
where a `U`-line gives the number of unmapped reads (for SAM input only); a
`Q`-line gives:
1. Mapping quality (mapQ) threshold
2. Number of mapped reads between this threshold and the previous mapQ threshold.
3. Number of wrong mappings in the same mapQ interval
4. Accumulative mapping error rate
5. Accumulative number of mappings
For `paftools.js mapeval` to work, you need to encode the true read positions
in read names in the right format. For [pbsim2][pbsim] and [mason2][mason2], we
provide scripts to generate the right format. Simulated reads in this cookbook
were created with the following command lines:
```sh
# in the pbsim2 source code directory:
src/pbsim --depth 1 --length-min 5000 --length-mean 20000 --accuracy-mean 0.95 --hmm_model data/R94.model ../ecoli_ref.fa
paftools.js pbsim2fq ../ecoli_ref.fa.fai sd_0001.maf > ../ecoli_pbsim.fa
# mason2 simulation
mason_simulator --illumina-prob-mismatch-scale 2.5 -ir ecoli_ref.fa -n 10000 -o tmp-l.fq -or tmp-r.fq -oa tmp.sam
paftools.js mason2fq tmp.sam | seqtk seq -1 > ecoli_mason_1.fq
paftools.js mason2fq tmp.sam | seqtk seq -2 > ecoli_mason_2.fq
```
## <a name="map-rna"></a>Mapping Long RNA-seq Reads
### <a name="map-ont-cdna-2d"></a>Mapping Nanopore 2D cDNA reads
```sh
minimap2 -ax splice SIRV_E2.fa SIRV_ont-cdna.fa > aln.sam
```
You can compare the alignment to the true annotations with:
```sh
paftools.js junceval SIRV_E2C.gtf aln.sam
```
It gives the percentage of introns found in the annotation. For SIRV data, it
is possible to achieve higher junction accuracy with
```sh
minimap2 -ax splice --splice-flank=no SIRV_E2.fa SIRV_ont-cdna.fa | paftools.js junceval SIRV_E2C.gtf
```
This is because minimap2 models one additional evolutionarily conserved base
around a canonical junction, but SIRV doesn't honor this signal. Option
`--splice-flank=no` asks minimap2 no to model this additional base.
In the output a tag `ts:A:+` indicates that the read strand is the same as the
transcript strand; `ts:A:-` indicates the read strand is opposite to the
transcript strand. This tag is inferred from the GT-AG signal and is thus only
available to spliced reads.
### <a name="map-direct-rna"></a>Mapping Nanopore direct-RNA reads
```sh
minimap2 -ax splice -k14 -uf SIRV_E2.fa SIRV_ont-drna.fa > aln.sam
```
Direct-RNA reads are noisier, so we use a shorter k-mer for improved
sensitivity. Here, option `-uf` forces minimap2 to map reads to the forward
transcript strand only because direct-RNA reads are stranded. Again, applying
`--splice-flank=no` helps junction accuracy for SIRV data.
### <a name="map-iso-seq"></a>Mapping PacBio Iso-seq reads
```sh
minimap2 -ax splice -uf -C5 SIRV_E2.fa SIRV_iso-seq.fq > aln.sam
```
Option `-C5` reduces the penalty on non-canonical splicing sites. It helps
to align such sites correctly for data with low error rate such as Iso-seq
reads and traditional cDNAs. On this example, minimap2 makes one junction
error. Applying `--splice-flank=no` fixes this alignment error.
Note that the command line above is optimized for the final Iso-seq reads.
PacBio's Iso-seq pipeline produces intermediate sequences at varying quality.
For example, some intermediate reads are not stranded. For these reads, option
`-uf` will lead to more errors. Please revise the minimap2 command line
accordingly.
## <a name="genome-aln"></a>Full-Genome Alignment
### <a name="asm-to-ref"></a>Intra-species assembly alignment
```sh
# option "--cs" is recommended as paftools.js may need it
minimap2 -cx asm5 --cs ecoli_ref.fa ecoli_canu.fa > ecoli_canu.paf
```
Here `ecoli_canu.fa` is the Canu assembly of `ecoli_p6_25x_canu.fa`. This
command line outputs alignments in the [PAF format][paf]. Use `-a` instead of
`-c` to get output in the SAM format.
### <a name="x-species"></a>Cross-species full-genome alignment
```sh
minimap2 -cx asm20 --cs ecoli_ref.fa ecoli_O104:H4.fa > ecoli_O104:H4.paf
sort -k6,6 -k8,8n ecoli_O104:H4.paf | paftools.js call -f ecoli_ref.fa -L10000 -l1000 - > out.vcf
```
Minimap2 has three presets for full-genome alignment: "asm5" for sequence
divergence below 1%, "asm10" for divergence around a couple of percent and
"asm20" for divergence not more than 10%. In theory, with the right setting,
minimap2 should work for sequence pairs with sequence divergence up to ~15%,
but this has not been carefully evaluated.
### <a name="view-aln"></a>Eyeballing alignment
```sh
# option "--cs" required; minimap2-r741 or higher required for the "asm20" preset
minimap2 -cx asm20 --cs ecoli_ref.fa ecoli_O104:H4.fa | paftools.js view - | less -S
```
This prints the alignment in a BLAST-like format.
### <a name="asm-var"></a>Calling variants from assembly-to-reference alignment
```sh
# don't forget the "--cs" option; otherwise it doesn't work
minimap2 -cx asm5 --cs ecoli_ref.fa ecoli_canu.fa \
| sort -k6,6 -k8,8n \
| paftools.js call -f ecoli_ref.fa - > out.vcf
```
Without option `-f`, `paftools.js call` outputs in a custom format. In this
format, lines starting with `R` give the regions covered by one contig only.
This information is not available in the VCF output.
### <a name="hom-map"></a>Constructing self-homology map
```sh
minimap2 -DP -k19 -w19 -m200 ecoli_ref.fa ecoli_ref.fa > out.paf
```
Option `-D` asks minimap2 to ignore anchors from perfect self match and `-P`
outputs all chains. For large nomes, we don't recommend to perform base-level
alignment (with `-c`, `-a` or `--cs`) when `-P` is applied. This is because
base-alignment is slow and occasionally gives wrong alignments close to the
diagonal of a dotter plot. For E. coli, though, base-alignment is still fast.
### <a name="liftover"></a>Lift over (for developers)
```sh
minimap2 -cx asm5 --cs ecoli_ref.fa ecoli_canu.fa > ecoli_canu.paf
echo -e 'tig00000001\t200000\t300000' | paftools.js liftover ecoli_canu.paf -
```
This lifts over a region on query sequences to one or multiple regions on
reference sequences. Note that this paftools.js command may not be efficient
enough to lift millions of regions.
## <a name="read-overlap"></a>Read Overlap
### <a name="long-read-overlap"></a>Long read overlap
```sh
# For pacbio reads:
minimap2 -x ava-pb ecoli_p6_25x_canu.fa ecoli_p6_25x_canu.fa > overlap.paf
# For Nanopore reads (ava-ont also works with PacBio but not as good):
minimap2 -x ava-ont -r 10000 ecoli_p6_25x_canu.fa ecoli_p6_25x_canu.fa > overlap.paf
# If you have miniasm installed:
miniasm -f ecoli_p6_25x_canu.fa overlap.paf > asm.gfa
```
Here we explicitly applied `-r 10000`. We are considering to set this as the
default for the `ava-ont` mode as this seems to improve the contiguity for
nanopore read assembly (Loman, personal communication).
*Minimap2 doesn't work well with short-read overlap.*
### <a name="ov-eval"></a>Evaluating overlap sensitivity (for developers)
```sh
# read to reference mapping
minimap2 -cx map-pb ecoli_ref.fa ecoli_p6_25x_canu.fa > to-ref.paf
# evaluate overlap sensitivity
sort -k6,6 -k8,8n to-ref.paf | paftools.js ov-eval - overlap.paf
```
You can see that for PacBio reads, minimap2 achieves higher overlap sensitivity
with `-x ava-pb` (99% vs 93% with `-x ava-ont`).
[pbsim]: https://github.com/yukiteruono/pbsim2
[mason2]: https://github.com/seqan/seqan/tree/master/apps/mason2
[paf]: https://github.com/lh3/miniasm/blob/master/PAF.md
[v2.10]: https://github.com/lh3/minimap2/releases/tag/v2.10
+1 -1
View File
@@ -59,6 +59,6 @@ void mm_est_err(const mm_idx_t *mi, int qlen, int n_regs, mm_reg1_t *regs, const
n_tot = en - st + 1;
if (r->qs > avg_k && r->rs > avg_k) ++n_tot;
if (qlen - r->qs > avg_k && l_ref - r->re > avg_k) ++n_tot;
r->div = logf((float)n_tot / n_match) / avg_k;
r->div = n_match >= n_tot? 0.0f : (float)(1.0 - pow((double)n_match / n_tot, 1.0 / avg_k));
}
}
+3 -1
View File
@@ -35,6 +35,8 @@ int main(int argc, char *argv[])
while ((mi = mm_idx_reader_read(r, n_threads)) != 0) { // traverse each part of the index
mm_mapopt_update(&mopt, mi); // this sets the maximum minimizer occurrence; TODO: set a better default in mm_mapopt_init()!
mm_tbuf_t *tbuf = mm_tbuf_init(); // thread buffer; for multi-threading, allocate one tbuf for each thread
gzrewind(f);
kseq_rewind(ks);
while (kseq_read(ks) >= 0) { // each kseq_read() call reads one query sequence
mm_reg1_t *reg;
int j, i, n_reg;
@@ -45,7 +47,7 @@ int main(int argc, char *argv[])
printf("%s\t%d\t%d\t%d\t%c\t", ks->name.s, ks->seq.l, r->qs, r->qe, "+-"[r->rev]);
printf("%s\t%d\t%d\t%d\t%d\t%d\t%d\tcg:Z:", mi->seq[r->rid].name, mi->seq[r->rid].len, r->rs, r->re, r->mlen, r->blen, r->mapq);
for (i = 0; i < r->p->n_cigar; ++i) // IMPORTANT: this gives the CIGAR in the aligned regions. NO soft/hard clippings!
printf("%d%c", r->p->cigar[i]>>4, "MIDSHN"[r->p->cigar[i]&0xf]);
printf("%d%c", r->p->cigar[i]>>4, MM_CIGAR_STR[r->p->cigar[i]&0xf]);
putchar('\n');
free(r->p);
}
+297 -57
View File
@@ -79,11 +79,11 @@ static char *mm_escape(char *s)
return s;
}
static void sam_write_rg_line(kstring_t *str, const char *s)
static int sam_write_rg_line(kstring_t *str, const char *s)
{
char *p, *q, *r, *rg_line = 0;
memset(mm_rg_id, 0, 256);
if (s == 0) return;
if (s == 0) return 0;
if (strstr(s, "@RG") != s) {
if (mm_verbose >= 1) fprintf(stderr, "[ERROR] the read group line is not started with @RG\n");
goto err_set_rg;
@@ -92,7 +92,8 @@ static void sam_write_rg_line(kstring_t *str, const char *s)
if (mm_verbose >= 1) fprintf(stderr, "[ERROR] the read group line contained literal <tab> characters -- replace with escaped tabs: \\t\n");
goto err_set_rg;
}
rg_line = strdup(s);
rg_line = (char*)malloc(strlen(s) + 1);
strcpy(rg_line, s);
mm_escape(rg_line);
if ((p = strstr(rg_line, "\tID:")) == 0) {
if (mm_verbose >= 1) fprintf(stderr, "[ERROR] no ID within the read group line\n");
@@ -107,20 +108,24 @@ static void sam_write_rg_line(kstring_t *str, const char *s)
for (q = p, r = mm_rg_id; *q && *q != '\t' && *q != '\n'; ++q)
*r++ = *q;
mm_sprintf_lite(str, "%s\n", rg_line);
return 0;
err_set_rg:
free(rg_line);
return -1;
}
void mm_write_sam_hdr(const mm_idx_t *idx, const char *rg, const char *ver, int argc, char *argv[])
int mm_write_sam_hdr(const mm_idx_t *idx, const char *rg, const char *ver, int argc, char *argv[])
{
kstring_t str = {0,0,0};
int ret = 0;
mm_sprintf_lite(&str, "@HD\tVN:1.6\tSO:unsorted\tGO:query\n");
if (idx) {
uint32_t i;
for (i = 0; i < idx->n_seq; ++i)
printf("@SQ\tSN:%s\tLN:%d\n", idx->seq[i].name, idx->seq[i].len);
mm_sprintf_lite(&str, "@SQ\tSN:%s\tLN:%d\n", idx->seq[i].name, idx->seq[i].len);
}
if (rg) sam_write_rg_line(&str, rg);
if (rg) ret = sam_write_rg_line(&str, rg);
mm_sprintf_lite(&str, "@PG\tID:minimap2\tPN:minimap2");
if (ver) mm_sprintf_lite(&str, "\tVN:%s", ver);
if (argc > 1) {
@@ -129,36 +134,57 @@ void mm_write_sam_hdr(const mm_idx_t *idx, const char *rg, const char *ver, int
for (i = 1; i < argc; ++i)
mm_sprintf_lite(&str, " %s", argv[i]);
}
mm_sprintf_lite(&str, "\n");
fputs(str.s, stdout);
mm_err_puts(str.s);
free(str.s);
return ret;
}
static void write_cs(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int no_iden)
static void write_indel_ds(kstring_t *str, int64_t len, const uint8_t *seq, int64_t ll, int64_t lr) // write an indel to ds; adapted from minigraph
{
extern unsigned char seq_nt4_table[256];
int i, q_off, t_off;
uint8_t *qseq, *tseq;
char *tmp;
if (r->p == 0) return;
mm_sprintf_lite(s, "\tcs:Z:");
qseq = (uint8_t*)kmalloc(km, r->qe - r->qs);
tseq = (uint8_t*)kmalloc(km, r->re - r->rs);
tmp = (char*)kmalloc(km, r->re - r->rs > r->qe - r->qs? r->re - r->rs + 1 : r->qe - r->qs + 1);
mm_idx_getseq(mi, r->rid, r->rs, r->re, tseq);
if (!r->rev) {
for (i = r->qs; i < r->qe; ++i)
qseq[i - r->qs] = seq_nt4_table[(uint8_t)t->seq[i]];
int64_t i;
if (ll + lr >= len) {
mm_sprintf_lite(str, "[");
for (i = 0; i < len; ++i)
mm_sprintf_lite(str, "%c", "acgtn"[seq[i]]);
mm_sprintf_lite(str, "]");
} else {
for (i = r->qs; i < r->qe; ++i) {
uint8_t c = seq_nt4_table[(uint8_t)t->seq[i]];
qseq[r->qe - i - 1] = c >= 4? 4 : 3 - c;
int64_t k = 0;
if (ll > 0) {
mm_sprintf_lite(str, "[");
for (i = 0; i < ll; ++i)
mm_sprintf_lite(str, "%c", "acgtn"[seq[k+i]]);
mm_sprintf_lite(str, "]");
k += ll;
}
for (i = 0; i < len - lr - ll; ++i)
mm_sprintf_lite(str, "%c", "acgtn"[seq[k+i]]);
k += len - lr - ll;
if (lr > 0) {
mm_sprintf_lite(str, "[");
for (i = 0; i < lr; ++i)
mm_sprintf_lite(str, "%c", "acgtn"[seq[k+i]]);
mm_sprintf_lite(str, "]");
}
}
for (i = q_off = t_off = 0; i < r->p->n_cigar; ++i) {
}
static void write_cs_ds_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq, const mm_reg1_t *r, char *tmp, int no_iden, int is_ds, int write_tag)
{
int i, q_off, t_off, q_len = 0, t_len = 0;
if (write_tag) mm_sprintf_lite(s, "\t%cs:Z:", is_ds? 'd' : 'c');
for (i = 0; i < (int)r->p->n_cigar; ++i) {
int op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
if (op == MM_CIGAR_MATCH || op == MM_CIGAR_EQ_MATCH || op == MM_CIGAR_X_MISMATCH)
q_len += len, t_len += len;
else if (op == MM_CIGAR_INS)
q_len += len;
else if (op == MM_CIGAR_DEL || op == MM_CIGAR_N_SKIP)
t_len += len;
}
for (i = q_off = t_off = 0; i < (int)r->p->n_cigar; ++i) {
int j, op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
assert(op >= 0 && op <= 3);
if (op == 0) {
assert((op >= MM_CIGAR_MATCH && op <= MM_CIGAR_N_SKIP) || op == MM_CIGAR_EQ_MATCH || op == MM_CIGAR_X_MISMATCH);
if (op == MM_CIGAR_MATCH || op == MM_CIGAR_EQ_MATCH || op == MM_CIGAR_X_MISMATCH) {
int l_tmp = 0;
for (j = 0; j < len; ++j) {
if (qseq[q_off + j] != tseq[t_off + j]) {
@@ -179,17 +205,45 @@ static void write_cs(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_
} else mm_sprintf_lite(s, ":%d", l_tmp);
}
q_off += len, t_off += len;
} else if (op == 1) {
} else if (op == MM_CIGAR_INS) {
if (is_ds) {
int z, ll, lr, y = q_off;
for (z = 1; z <= len; ++z)
if (y - z < 0 || qseq[y + len - z] != qseq[y - z])
break;
lr = z - 1;
for (z = 0; z < len; ++z)
if (y + len + z >= q_len || qseq[y + len + z] != qseq[y + z])
break;
ll = z;
mm_sprintf_lite(s, "+");
write_indel_ds(s, len, &qseq[y], ll, lr);
} else {
for (j = 0, tmp[len] = 0; j < len; ++j)
tmp[j] = "acgtn"[qseq[q_off + j]];
mm_sprintf_lite(s, "+%s", tmp);
}
q_off += len;
} else if (op == 2) {
} else if (op == MM_CIGAR_DEL) {
if (is_ds) {
int z, ll, lr, x = t_off;
for (z = 1; z <= len; ++z)
if (x - z < 0 || tseq[x + len - z] != tseq[x - z])
break;
lr = z - 1;
for (z = 0; z < len; ++z)
if (x + len + z >= t_len || tseq[x + z] != tseq[x + len + z])
break;
ll = z;
mm_sprintf_lite(s, "-");
write_indel_ds(s, len, &tseq[x], ll, lr);
} else {
for (j = 0, tmp[len] = 0; j < len; ++j)
tmp[j] = "acgtn"[tseq[t_off + j]];
mm_sprintf_lite(s, "-%s", tmp);
}
t_off += len;
} else {
} else { // intron
assert(len >= 2);
mm_sprintf_lite(s, "~%c%c%d%c%c", "acgtn"[tseq[t_off]], "acgtn"[tseq[t_off+1]],
len, "acgtn"[tseq[t_off+len-2]], "acgtn"[tseq[t_off+len-1]]);
@@ -197,48 +251,220 @@ static void write_cs(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_
}
}
assert(t_off == r->re - r->rs && q_off == r->qe - r->qs);
}
static inline void revcomp_splice(uint8_t s[2])
{
uint8_t c = s[1] < 4? 3 - s[1] : 4;
s[1] = s[0] < 4? 3 - s[0] : 4;
s[0] = c;
}
void mm_write_junc(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r)
{
int32_t i, t_off, swritten = 0;
s->l = 0;
if (!r->is_spliced || r->p == 0) return; // no junctions
if (r->p->trans_strand != 1 && r->p->trans_strand != 2) return; // no preferred strand
for (i = 0, t_off = r->rs; i < (int)r->p->n_cigar; ++i) {
int op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
if (op == MM_CIGAR_MATCH || op == MM_CIGAR_EQ_MATCH || op == MM_CIGAR_X_MISMATCH || op == MM_CIGAR_DEL) {
t_off += len;
} else if (op == MM_CIGAR_N_SKIP) { // intron
uint8_t donor[2], acceptor[2];
int32_t score1 = 0, score2 = 0, rev;
assert(len >= 2);
rev = (r->p->trans_strand == 2) ^ r->rev;
if (!rev) {
mm_idx_getseq(mi, r->rid, t_off, t_off + 2, donor);
mm_idx_getseq(mi, r->rid, t_off + len - 2, t_off + len, acceptor);
} else {
mm_idx_getseq(mi, r->rid, t_off, t_off + 2, acceptor);
mm_idx_getseq(mi, r->rid, t_off + len - 2, t_off + len, donor);
revcomp_splice(donor);
revcomp_splice(acceptor);
}
//fprintf(stderr, "%c%c-%c%c\n", "ACGTN"[donor[0]], "ACGTN"[donor[1]], "ACGTN"[acceptor[0]], "ACGTN"[acceptor[1]]);
if (donor[0] == 2 && donor[1] == 3) score1 = 3;
else if (donor[0] == 2 && donor[1] == 1) score1 = 2;
else if (donor[0] == 0 && donor[1] == 3) score1 = 1;
if (acceptor[0] == 0 && acceptor[1] == 2) score2 = 3;
else if (acceptor[0] == 0 && acceptor[1] == 1) score2 = 1;
if (swritten) mm_sprintf_lite(s, "\n");
else swritten = 1;
mm_sprintf_lite(s, "%s\t%d\t%d\t%s\t%d\t%c", mi->seq[r->rid].name, t_off, t_off + len, t->name, score1 + score2, "+-"[rev]);
t_off += len;
}
}
assert(t_off == r->re);
}
static void write_MD_core(kstring_t *s, const uint8_t *tseq, const uint8_t *qseq, const mm_reg1_t *r, char *tmp, int write_tag)
{
int i, q_off, t_off, l_MD = 0;
if (write_tag) mm_sprintf_lite(s, "\tMD:Z:");
for (i = q_off = t_off = 0; i < (int)r->p->n_cigar; ++i) {
int j, op = r->p->cigar[i]&0xf, len = r->p->cigar[i]>>4;
assert((op >= MM_CIGAR_MATCH && op <= MM_CIGAR_N_SKIP) || op == MM_CIGAR_EQ_MATCH || op == MM_CIGAR_X_MISMATCH);
if (op == MM_CIGAR_MATCH || op == MM_CIGAR_EQ_MATCH || op == MM_CIGAR_X_MISMATCH) {
for (j = 0; j < len; ++j) {
if (qseq[q_off + j] != tseq[t_off + j]) {
mm_sprintf_lite(s, "%d%c", l_MD, "ACGTN"[tseq[t_off + j]]);
l_MD = 0;
} else ++l_MD;
}
q_off += len, t_off += len;
} else if (op == MM_CIGAR_INS) {
q_off += len;
} else if (op == MM_CIGAR_DEL) {
for (j = 0, tmp[len] = 0; j < len; ++j)
tmp[j] = "ACGTN"[tseq[t_off + j]];
mm_sprintf_lite(s, "%d^%s", l_MD, tmp);
l_MD = 0;
t_off += len;
} else if (op == MM_CIGAR_N_SKIP) {
t_off += len;
}
}
if (l_MD > 0) mm_sprintf_lite(s, "%d", l_MD);
assert(t_off == r->re - r->rs && q_off == r->qe - r->qs);
}
static void write_cs_ds_or_MD(void *km, kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int no_iden, int is_MD, int is_ds, int write_tag, int is_qstrand)
{
extern unsigned char seq_nt4_table[256];
int i;
uint8_t *qseq, *tseq;
char *tmp;
if (r->p == 0) return;
qseq = (uint8_t*)kmalloc(km, r->qe - r->qs);
tseq = (uint8_t*)kmalloc(km, r->re - r->rs);
tmp = (char*)kmalloc(km, r->re - r->rs > r->qe - r->qs? r->re - r->rs + 1 : r->qe - r->qs + 1);
if (is_qstrand) {
mm_idx_getseq2(mi, r->rev, r->rid, r->rs, r->re, tseq);
for (i = r->qs; i < r->qe; ++i)
qseq[i - r->qs] = seq_nt4_table[(uint8_t)t->seq[i]];
} else {
mm_idx_getseq(mi, r->rid, r->rs, r->re, tseq);
if (!r->rev) {
for (i = r->qs; i < r->qe; ++i)
qseq[i - r->qs] = seq_nt4_table[(uint8_t)t->seq[i]];
} else {
for (i = r->qs; i < r->qe; ++i) {
uint8_t c = seq_nt4_table[(uint8_t)t->seq[i]];
qseq[r->qe - i - 1] = c >= 4? 4 : 3 - c;
}
}
}
if (is_MD) write_MD_core(s, tseq, qseq, r, tmp, write_tag);
else write_cs_ds_core(s, tseq, qseq, r, tmp, no_iden, is_ds, write_tag);
kfree(km, qseq); kfree(km, tseq); kfree(km, tmp);
}
int mm_gen_cs_ds_or_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int is_MD, int is_ds, int no_iden, int is_qstrand)
{
mm_bseq1_t t;
kstring_t str;
str.s = *buf, str.l = 0, str.m = *max_len;
t.l_seq = strlen(seq);
t.seq = (char*)seq;
write_cs_ds_or_MD(km, &str, mi, &t, r, no_iden, is_MD, is_ds, 0, is_qstrand);
*max_len = str.m;
*buf = str.s;
return str.l;
}
int mm_gen_cs_or_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int is_MD, int no_iden, int is_qstrand)
{
return mm_gen_cs_ds_or_MD(km, buf, max_len, mi, r, seq, is_MD, 0, no_iden, is_qstrand);
}
int mm_gen_cs(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int no_iden)
{
return mm_gen_cs_or_MD(km, buf, max_len, mi, r, seq, 0, no_iden, 0);
}
int mm_gen_ds(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int no_iden)
{
return mm_gen_cs_ds_or_MD(km, buf, max_len, mi, r, seq, 0, 1, no_iden, 0);
}
int mm_gen_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq)
{
return mm_gen_cs_or_MD(km, buf, max_len, mi, r, seq, 1, 0, 0);
}
static inline void write_tags(kstring_t *s, const mm_reg1_t *r)
{
int type;
if (r->id == r->parent) type = r->inv? 'I' : 'P';
else type = r->inv? 'i' : 'S';
if (r->p) {
mm_sprintf_lite(s, "\tNM:i:%d\tms:i:%d\tAS:i:%d\tnn:i:%d", r->blen - r->mlen + r->p->n_ambi, r->p->dp_max, r->p->dp_score, r->p->n_ambi);
mm_sprintf_lite(s, "\tNM:i:%d\tms:i:%d\tAS:i:%d\tnn:i:%d", r->blen - r->mlen + r->p->n_ambi, r->p->dp_max0, r->p->dp_score, r->p->n_ambi);
if (r->p->trans_strand == 1 || r->p->trans_strand == 2)
mm_sprintf_lite(s, "\tts:A:%c", "?+-?"[r->p->trans_strand]);
}
mm_sprintf_lite(s, "\ttp:A:%c\tcm:i:%d\ts1:i:%d", type, r->cnt, r->score);
if (r->parent == r->id) mm_sprintf_lite(s, "\ts2:i:%d", r->subsc);
if (r->div >= 0.0f && r->div <= 1.0f) {
char buf[8];
if (r->p) {
char buf[16];
double div;
div = 1.0 - mm_event_identity(r);
if (div == 0.0) buf[0] = '0', buf[1] = 0;
else snprintf(buf, 16, "%.4f", 1.0 - mm_event_identity(r));
mm_sprintf_lite(s, "\tde:f:%s", buf);
} else if (r->div >= 0.0f && r->div <= 1.0f) {
char buf[16];
if (r->div == 0.0f) buf[0] = '0', buf[1] = 0;
else sprintf(buf, "%.4f", r->div);
else snprintf(buf, 16, "%.4f", r->div);
mm_sprintf_lite(s, "\tdv:f:%s", buf);
}
if (r->split) mm_sprintf_lite(s, "\tzd:i:%d", r->split);
}
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int opt_flag)
void mm_write_paf4(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag, int rep_len, int n_seg, int seg_idx)
{
s->l = 0;
mm_sprintf_lite(s, "%s\t%d\t%d\t%d\t%c\t", t->name, t->l_seq, r->qs, r->qe, "+-"[r->rev]);
mm_sprintf_lite(s, "%s", t->name);
if ((opt_flag & MM_F_FRAG_MODE) && n_seg >= 2 && seg_idx >= 0)
mm_sprintf_lite(s, "/%d", seg_idx + 1);
if (r == 0) {
mm_sprintf_lite(s, "\t%d\t0\t0\t*\t*\t0\t0\t0\t0\t0\t0", t->l_seq);
if (rep_len >= 0) mm_sprintf_lite(s, "\trl:i:%d", rep_len);
return;
}
mm_sprintf_lite(s, "\t%d\t%d\t%d\t%c\t", t->l_seq, r->qs, r->qe, "+-"[r->rev]);
if (mi->seq[r->rid].name) mm_sprintf_lite(s, "%s", mi->seq[r->rid].name);
else mm_sprintf_lite(s, "%d", r->rid);
mm_sprintf_lite(s, "\t%d\t%d\t%d", mi->seq[r->rid].len, r->rs, r->re);
mm_sprintf_lite(s, "\t%d", mi->seq[r->rid].len);
if ((opt_flag & MM_F_QSTRAND) && r->rev)
mm_sprintf_lite(s, "\t%d\t%d", mi->seq[r->rid].len - r->re, mi->seq[r->rid].len - r->rs);
else
mm_sprintf_lite(s, "\t%d\t%d", r->rs, r->re);
mm_sprintf_lite(s, "\t%d\t%d", r->mlen, r->blen);
mm_sprintf_lite(s, "\t%d", r->mapq);
write_tags(s, r);
if (rep_len >= 0) mm_sprintf_lite(s, "\trl:i:%d", rep_len);
if (r->p && (opt_flag & MM_F_OUT_CG)) {
uint32_t k;
mm_sprintf_lite(s, "\tcg:Z:");
for (k = 0; k < r->p->n_cigar; ++k)
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDN"[r->p->cigar[k]&0xf]);
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, MM_CIGAR_STR[r->p->cigar[k]&0xf]);
}
if (r->p && (opt_flag & MM_F_OUT_CS))
write_cs(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG));
if (r->p && (opt_flag & (MM_F_OUT_CS|MM_F_OUT_DS|MM_F_OUT_MD)))
write_cs_ds_or_MD(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG), !!(opt_flag&MM_F_OUT_MD), !!(opt_flag&MM_F_OUT_DS), 1, !!(opt_flag&MM_F_QSTRAND));
if ((opt_flag & MM_F_COPY_COMMENT) && t->comment)
mm_sprintf_lite(s, "\t%s", t->comment);
}
void mm_write_paf3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag, int rep_len)
{
mm_write_paf4(s, mi, t, r, km, opt_flag, rep_len, 0, 0);
}
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag)
{
mm_write_paf3(s, mi, t, r, km, opt_flag, -1);
}
static void sam_write_sq(kstring_t *s, char *seq, int l, int rev, int comp)
@@ -265,7 +491,7 @@ static inline const mm_reg1_t *get_sam_pri(int n_regs, const mm_reg1_t *regs)
return NULL;
}
static void write_sam_cigar(kstring_t *s, int sam_flag, int in_tag, int qlen, const mm_reg1_t *r, int opt_flag)
static void write_sam_cigar(kstring_t *s, int sam_flag, int in_tag, int qlen, const mm_reg1_t *r, int64_t opt_flag)
{
if (r->p == 0) {
mm_sprintf_lite(s, "*");
@@ -274,27 +500,30 @@ static void write_sam_cigar(kstring_t *s, int sam_flag, int in_tag, int qlen, co
clip_len[0] = r->rev? qlen - r->qe : r->qs;
clip_len[1] = r->rev? r->qs : qlen - r->qe;
if (in_tag) {
int clip_char = (sam_flag&0x800) && !(opt_flag&MM_F_SOFTCLIP)? 5 : 4;
int clip_char = (((sam_flag&0x800) || ((sam_flag&0x100) && (opt_flag&MM_F_SECONDARY_SEQ))) &&
!(opt_flag&MM_F_SOFTCLIP)) ? 5 : 4;
mm_sprintf_lite(s, "\tCG:B:I");
if (clip_len[0]) mm_sprintf_lite(s, ",%u", clip_len[0]<<4|clip_char);
for (k = 0; k < r->p->n_cigar; ++k)
mm_sprintf_lite(s, ",%u", r->p->cigar[k]);
if (clip_len[1]) mm_sprintf_lite(s, ",%u", clip_len[1]<<4|clip_char);
} else {
int clip_char = (sam_flag&0x800) && !(opt_flag&MM_F_SOFTCLIP)? 'H' : 'S';
int clip_char = (((sam_flag&0x800) || ((sam_flag&0x100) && (opt_flag&MM_F_SECONDARY_SEQ))) &&
!(opt_flag&MM_F_SOFTCLIP)) ? 'H' : 'S';
assert(clip_len[0] < qlen && clip_len[1] < qlen);
if (clip_len[0]) mm_sprintf_lite(s, "%d%c", clip_len[0], clip_char);
for (k = 0; k < r->p->n_cigar; ++k)
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, "MIDN"[r->p->cigar[k]&0xf]);
mm_sprintf_lite(s, "%d%c", r->p->cigar[k]>>4, MM_CIGAR_STR[r->p->cigar[k]&0xf]);
if (clip_len[1]) mm_sprintf_lite(s, "%d%c", clip_len[1], clip_char);
}
}
}
void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regss, const mm_reg1_t *const* regss, void *km, int opt_flag)
void mm_write_sam3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regss, const mm_reg1_t *const* regss, void *km, int64_t opt_flag, int rep_len)
{
const int max_bam_cigar_op = 65535;
int flag, n_regs = n_regss[seg_idx], cigar_in_tag = 0;
int this_rid = -1, this_pos = -1, this_rev = 0;
int this_rid = -1, this_pos = -1;
const mm_reg1_t *regs = regss[seg_idx], *r_prev = NULL, *r_next;
const mm_reg1_t *r = n_regs > 0 && reg_idx < n_regs && reg_idx >= 0? &regs[reg_idx] : NULL;
@@ -343,7 +572,7 @@ void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
mm_sprintf_lite(s, "\t%s\t%d\t0\t*", mi->seq[this_rid].name, this_pos+1);
} else mm_sprintf_lite(s, "\t*\t0\t0\t*");
} else {
this_rid = r->rid, this_pos = r->rs, this_rev = r->rev;
this_rid = r->rid, this_pos = r->rs;
mm_sprintf_lite(s, "\t%s\t%d\t%d\t", mi->seq[r->rid].name, r->rs+1, r->mapq);
if ((opt_flag & MM_F_LONG_CIGAR) && r->p && r->p->n_cigar > max_bam_cigar_op - 2) {
int n_cigar = r->p->n_cigar;
@@ -353,9 +582,11 @@ void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
cigar_in_tag = 1;
}
if (cigar_in_tag) {
if (flag & 0x100) mm_sprintf_lite(s, "0S"); // secondary alignment
else if (flag & 0x800) mm_sprintf_lite(s, "%dS", r->re - r->rs); // supplementary alignment
else mm_sprintf_lite(s, "%dS", t->l_seq);
int slen;
if ((flag & 0x900) == 0 || (opt_flag & MM_F_SOFTCLIP)) slen = t->l_seq;
else if ((flag & 0x100) && !(opt_flag & MM_F_SECONDARY_SEQ)) slen = 0;
else slen = r->qe - r->qs;
mm_sprintf_lite(s, "%dS%dN", slen, r->re - r->rs);
} else write_sam_cigar(s, flag, 0, t->l_seq, r, opt_flag);
}
@@ -364,17 +595,17 @@ void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
int tlen = 0;
if (this_rid >= 0 && r_next) {
if (this_rid == r_next->rid) {
int this_pos5 = r && r->rev? r->re - 1 : this_pos;
if (r) {
int this_pos5 = r->rev? r->re - 1 : this_pos;
int next_pos5 = r_next->rev? r_next->re - 1 : r_next->rs;
tlen = next_pos5 - this_pos5;
}
mm_sprintf_lite(s, "\t=\t");
} else mm_sprintf_lite(s, "\t%s\t", mi->seq[r_next->rid].name);
mm_sprintf_lite(s, "%d\t", r_next->rs + 1);
} else if (r_next) { // && this_rid < 0
mm_sprintf_lite(s, "\t%s\t%d\t", mi->seq[r_next->rid].name, r_next->rs + 1);
} else if (this_rid >= 0) { // && r_next == NULL
int this_pos5 = this_rev? r->re - 1 : this_pos; // this_rev is only true when r != NULL
tlen = this_pos - this_pos5; // next_pos5 will be this_pos
mm_sprintf_lite(s, "\t=\t%d\t", this_pos + 1); // next segment will take r's coordinate
} else mm_sprintf_lite(s, "\t*\t0\t"); // neither has coordinates
if (tlen > 0) ++tlen;
@@ -394,7 +625,7 @@ void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
mm_sprintf_lite(s, "\t");
if (t->qual) sam_write_sq(s, t->qual, t->l_seq, r->rev, 0);
else mm_sprintf_lite(s, "*");
} else if (flag & 0x100) {
} else if ((flag & 0x100) && !(opt_flag & MM_F_SECONDARY_SEQ)){
mm_sprintf_lite(s, "*\t*");
} else {
sam_write_sq(s, t->seq + r->qs, r->qe - r->qs, r->rev, r->rev);
@@ -434,15 +665,24 @@ void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int se
}
}
}
if (r->p && (opt_flag & MM_F_OUT_CS))
write_cs(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG));
if (r->p && (opt_flag & (MM_F_OUT_CS|MM_F_OUT_DS|MM_F_OUT_MD)))
write_cs_ds_or_MD(km, s, mi, t, r, !(opt_flag&MM_F_OUT_CS_LONG), opt_flag&MM_F_OUT_MD, !!(opt_flag&MM_F_OUT_DS), 1, 0);
if (cigar_in_tag)
write_sam_cigar(s, flag, 1, t->l_seq, r, opt_flag);
}
if (rep_len >= 0) mm_sprintf_lite(s, "\trl:i:%d", rep_len);
if ((opt_flag & MM_F_COPY_COMMENT) && t->comment)
mm_sprintf_lite(s, "\t%s", t->comment);
s->s[s->l] = 0; // we always have room for an extra byte (see str_enlarge)
}
void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regss, const mm_reg1_t *const* regss, void *km, int64_t opt_flag)
{
mm_write_sam3(s, mi, t, seg_idx, reg_idx, n_seg, n_regss, regss, km, opt_flag, -1);
}
void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int n_regs, const mm_reg1_t *regs)
{
int i;
-216
View File
@@ -1,216 +0,0 @@
#include <stddef.h>
#include <stdio.h>
#include <string.h>
#include "getopt.h"
char *optarg;
int optind=1, opterr=1, optopt, __optpos, optreset=0;
#define optpos __optpos
static void __getopt_msg(const char *a, const char *b, const char *c, size_t l)
{
FILE *f = stderr;
#if !defined(WIN32) && !defined(_WIN32)
flockfile(f);
#endif
fputs(a, f);
fwrite(b, strlen(b), 1, f);
fwrite(c, 1, l, f);
fputc('\n', f);
#if !defined(WIN32) && !defined(_WIN32)
funlockfile(f);
#endif
}
int getopt(int argc, char * const argv[], const char *optstring)
{
int i, c, d;
int k, l;
char *optchar;
if (!optind || optreset) {
optreset = 0;
__optpos = 0;
optind = 1;
}
if (optind >= argc || !argv[optind])
return -1;
if (argv[optind][0] != '-') {
if (optstring[0] == '-') {
optarg = argv[optind++];
return 1;
}
return -1;
}
if (!argv[optind][1])
return -1;
if (argv[optind][1] == '-' && !argv[optind][2])
return optind++, -1;
if (!optpos) optpos++;
c = argv[optind][optpos], k = 1;
optchar = argv[optind]+optpos;
optopt = c;
optpos += k;
if (!argv[optind][optpos]) {
optind++;
optpos = 0;
}
if (optstring[0] == '-' || optstring[0] == '+')
optstring++;
i = 0;
d = 0;
do {
d = optstring[i], l = 1;
if (l>0) i+=l; else i++;
} while (l && d != c);
if (d != c) {
if (optstring[0] != ':' && opterr)
__getopt_msg(argv[0], ": unrecognized option: ", optchar, k);
return '?';
}
if (optstring[i] == ':') {
if (optstring[i+1] == ':') optarg = 0;
else if (optind >= argc) {
if (optstring[0] == ':') return ':';
if (opterr) __getopt_msg(argv[0],
": option requires an argument: ",
optchar, k);
return '?';
}
if (optstring[i+1] != ':' || optpos) {
optarg = argv[optind++] + optpos;
optpos = 0;
}
}
return c;
}
static void permute(char *const *argv, int dest, int src)
{
char **av = (char **)argv;
char *tmp = av[src];
int i;
for (i=src; i>dest; i--)
av[i] = av[i-1];
av[dest] = tmp;
}
static int __getopt_long_core(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx, int longonly)
{
optarg = 0;
if (longopts && argv[optind][0] == '-' &&
((longonly && argv[optind][1] && argv[optind][1] != '-') ||
(argv[optind][1] == '-' && argv[optind][2])))
{
int colon = optstring[optstring[0]=='+'||optstring[0]=='-']==':';
int i, cnt, match = -1;
char *opt;
for (cnt=i=0; longopts[i].name; i++) {
const char *name = longopts[i].name;
opt = argv[optind]+1;
if (*opt == '-') opt++;
for (; *name && *name == *opt; name++, opt++);
if (*opt && *opt != '=') continue;
match = i;
if (!*name) {
cnt = 1;
break;
}
cnt++;
}
if (cnt==1) {
i = match;
optind++;
optopt = longopts[i].val;
if (*opt == '=') {
if (!longopts[i].has_arg) {
if (colon || !opterr)
return '?';
__getopt_msg(argv[0],
": option does not take an argument: ",
longopts[i].name,
strlen(longopts[i].name));
return '?';
}
optarg = opt+1;
} else if (longopts[i].has_arg == required_argument) {
if (!(optarg = argv[optind])) {
if (colon) return ':';
if (!opterr) return '?';
__getopt_msg(argv[0],
": option requires an argument: ",
longopts[i].name,
strlen(longopts[i].name));
return '?';
}
optind++;
}
if (idx) *idx = i;
if (longopts[i].flag) {
*longopts[i].flag = longopts[i].val;
return 0;
}
return longopts[i].val;
}
if (argv[optind][1] == '-') {
if (!colon && opterr)
__getopt_msg(argv[0], cnt ?
": option is ambiguous: " :
": unrecognized option: ",
argv[optind]+2,
strlen(argv[optind]+2));
optind++;
return '?';
}
}
return getopt(argc, argv, optstring);
}
static int __getopt_long(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx, int longonly)
{
int ret, skipped, resumed;
if (!optind || optreset) {
optreset = 0;
__optpos = 0;
optind = 1;
}
if (optind >= argc || !argv[optind]) return -1;
skipped = optind;
if (optstring[0] != '+' && optstring[0] != '-') {
int i;
for (i=optind; ; i++) {
if (i >= argc || !argv[i]) return -1;
if (argv[i][0] == '-' && argv[i][1]) break;
}
optind = i;
}
resumed = optind;
ret = __getopt_long_core(argc, argv, optstring, longopts, idx, longonly);
if (resumed > skipped) {
int i, cnt = optind-resumed;
for (i=0; i<cnt; i++)
permute(argv, skipped, optind-1);
optind = skipped + cnt;
}
return ret;
}
int getopt_long(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx)
{
return __getopt_long(argc, argv, optstring, longopts, idx, 0);
}
int getopt_long_only(int argc, char *const *argv, const char *optstring, const struct option *longopts, int *idx)
{
return __getopt_long(argc, argv, optstring, longopts, idx, 1);
}
-53
View File
@@ -1,53 +0,0 @@
/*
Copyright 2005-2014 Rich Felker, et al.
Permission is hereby granted, free of charge, to any person obtaining
a copy of this software and associated documentation files (the
"Software"), to deal in the Software without restriction, including
without limitation the rights to use, copy, modify, merge, publish,
distribute, sublicense, and/or sell copies of the Software, and to
permit persons to whom the Software is furnished to do so, subject to
the following conditions:
The above copyright notice and this permission notice shall be
included in all copies or substantial portions of the Software.
THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT.
IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY
CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT,
TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE
SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
*/
#ifndef _GETOPT_H
#define _GETOPT_H
#ifdef __cplusplus
extern "C" {
#endif
int getopt(int, char * const [], const char *);
extern char *optarg;
extern int optind, opterr, optopt, optreset;
struct option {
const char *name;
int has_arg;
int *flag;
int val;
};
int getopt_long(int, char *const *, const char *, const struct option *, int *);
int getopt_long_only(int, char *const *, const char *, const struct option *, int *);
#define no_argument 0
#define required_argument 1
#define optional_argument 2
#ifdef __cplusplus
}
#endif
#endif
+123 -90
View File
@@ -20,14 +20,14 @@ static inline void mm_cal_fuzzy_len(mm_reg1_t *r, const mm128_t *a)
}
}
static inline void mm_reg_set_coor(mm_reg1_t *r, int32_t qlen, const mm128_t *a)
static inline void mm_reg_set_coor(mm_reg1_t *r, int32_t qlen, const mm128_t *a, int is_qstrand)
{ // NB: r->as and r->cnt MUST BE set correctly for this function to work
int32_t k = r->as, q_span = (int32_t)(a[k].y>>32&0xff);
r->rev = a[k].x>>63;
r->rid = a[k].x<<1>>33;
r->rs = (int32_t)a[k].x + 1 > q_span? (int32_t)a[k].x + 1 - q_span : 0; // NB: target span may be shorter, so this test is necessary
r->re = (int32_t)a[k + r->cnt - 1].x + 1;
if (!r->rev) {
if (!r->rev || is_qstrand) {
r->qs = (int32_t)a[k].y + 1 - q_span;
r->qe = (int32_t)a[k + r->cnt - 1].y + 1;
} else {
@@ -49,13 +49,13 @@ static inline uint64_t hash64(uint64_t key)
return key;
}
mm_reg1_t *mm_gen_regs(void *km, uint32_t hash, int qlen, int n_u, uint64_t *u, mm128_t *a) // convert chains to hits
mm_reg1_t *mm_gen_regs(void *km, uint32_t hash, int qlen, int n_u, uint64_t *u, mm128_t *a, int is_qstrand) // convert chains to hits
{
mm128_t *z, tmp;
mm_reg1_t *r;
int i, k;
if (n_u == 0) return 0;
if (n_u <= 0) return 0;
// sort by score
z = (mm128_t*)kmalloc(km, n_u * 16);
@@ -81,31 +81,48 @@ mm_reg1_t *mm_gen_regs(void *km, uint32_t hash, int qlen, int n_u, uint64_t *u,
ri->cnt = (int32_t)z[i].y;
ri->as = z[i].y >> 32;
ri->div = -1.0f;
mm_reg_set_coor(ri, qlen, a);
mm_reg_set_coor(ri, qlen, a, is_qstrand);
}
kfree(km, z);
return r;
}
void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a)
void mm_mark_alt(const mm_idx_t *mi, int n, mm_reg1_t *r)
{
int i;
if (mi->n_alt == 0) return;
for (i = 0; i < n; ++i)
if (mi->seq[r[i].rid].is_alt)
r[i].is_alt = 1;
}
static inline int mm_alt_score(int score, float alt_diff_frac)
{
if (score < 0) return score;
score = (int)(score * (1.0 - alt_diff_frac) + .499);
return score > 0? score : 1;
}
void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a, int is_qstrand)
{
if (n <= 0 || n >= r->cnt) return;
*r2 = *r;
r2->id = -1;
r2->sam_pri = 0;
r2->p = 0;
r2->split_inv = 0;
r2->cnt = r->cnt - n;
r2->score = (int32_t)(r->score * ((float)r2->cnt / r->cnt) + .499);
r2->as = r->as + n;
if (r->parent == r->id) r2->parent = MM_PARENT_TMP_PRI;
mm_reg_set_coor(r2, qlen, a);
mm_reg_set_coor(r2, qlen, a, is_qstrand);
r->cnt -= r2->cnt;
r->score -= r2->score;
mm_reg_set_coor(r, qlen, a);
mm_reg_set_coor(r, qlen, a, is_qstrand);
r->split |= 1, r2->split |= 2;
}
void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r, int sub_diff) // and compute mm_reg1_t::subsc
void mm_set_parent(void *km, float mask_level, int mask_len, int n, mm_reg1_t *r, int sub_diff, int hard_mask_level, float alt_diff_frac) // and compute mm_reg1_t::subsc
{
int i, j, k, *w;
uint64_t *cov;
@@ -117,6 +134,7 @@ void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r, int sub_diff
for (i = 1, k = 1; i < n; ++i) {
mm_reg1_t *ri = &r[i];
int si = ri->qs, ei = ri->qe, n_cov = 0, uncov_len = 0;
if (hard_mask_level) goto skip_uncov;
for (j = 0; j < k; ++j) { // traverse existing primary hits to find overlapping hits
mm_reg1_t *rp = &r[w[j]];
int sj = rp->qs, ej = rp->qe;
@@ -131,25 +149,29 @@ void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r, int sub_diff
int j, x = si;
radix_sort_64(cov, cov + n_cov);
for (j = 0; j < n_cov; ++j) {
if (cov[j]>>32 > x) uncov_len += (cov[j]>>32) - x;
if ((int)(cov[j]>>32) > x) uncov_len += (cov[j]>>32) - x;
x = (int32_t)cov[j] > x? (int32_t)cov[j] : x;
}
if (ei > x) uncov_len += ei - x;
}
skip_uncov:
for (j = 0; j < k; ++j) { // traverse existing primary hits again
mm_reg1_t *rp = &r[w[j]];
int sj = rp->qs, ej = rp->qe, min, max, ol;
if (ej <= si || sj >= ei) continue; // no overlap
min = ej - sj < ei - si? ej - sj : ei - si;
max = ej - sj > ei - si? ej - sj : ei - si;
ol = si < sj? (ei < sj? 0 : ei < ej? ei - sj : ej - sj) : (ej < si? 0 : ej < ei? ej - si : ei - si); // overlap length
if ((float)ol / min - (float)uncov_len / max > mask_level) {
int cnt_sub = 0;
ol = si < sj? (ei < sj? 0 : ei < ej? ei - sj : ej - sj) : (ej < si? 0 : ej < ei? ej - si : ei - si); // overlap length; TODO: this can be simplified
if ((float)ol / min - (float)uncov_len / max > mask_level && uncov_len <= mask_len) { // then this is a secondary hit
int cnt_sub = 0, sci = ri->score;
ri->parent = rp->parent;
rp->subsc = rp->subsc > ri->score? rp->subsc : ri->score;
if (!rp->is_alt && ri->is_alt) sci = mm_alt_score(sci, alt_diff_frac);
rp->subsc = rp->subsc > sci? rp->subsc : sci;
if (ri->cnt >= rp->cnt) cnt_sub = 1;
if (rp->p && ri->p && (rp->rid != ri->rid || rp->rs != ri->rs || rp->re != ri->re || ol != min)) { // the last condition excludes identical hits after DP
rp->p->dp_max2 = rp->p->dp_max2 > ri->p->dp_max? rp->p->dp_max2 : ri->p->dp_max;
sci = ri->p->dp_max;
if (!rp->is_alt && ri->is_alt) sci = mm_alt_score(sci, alt_diff_frac);
rp->p->dp_max2 = rp->p->dp_max2 > sci? rp->p->dp_max2 : sci;
if (rp->p->dp_max - ri->p->dp_max <= sub_diff) cnt_sub = 1;
}
if (cnt_sub) ++rp->n_sub;
@@ -163,9 +185,9 @@ set_parent_test:
kfree(km, w);
}
void mm_hit_sort_by_dp(void *km, int *n_regs, mm_reg1_t *r)
void mm_hit_sort(void *km, int *n_regs, mm_reg1_t *r, float alt_diff_frac)
{
int32_t i, n_aux, n = *n_regs;
int32_t i, n_aux, n = *n_regs, has_cigar = 0, no_cigar = 0;
mm128_t *aux;
mm_reg1_t *t;
@@ -174,14 +196,18 @@ void mm_hit_sort_by_dp(void *km, int *n_regs, mm_reg1_t *r)
t = (mm_reg1_t*)kmalloc(km, n * sizeof(mm_reg1_t));
for (i = n_aux = 0; i < n; ++i) {
if (r[i].inv || r[i].cnt > 0) { // squeeze out elements with cnt==0 (soft deleted)
assert(r[i].p);
aux[n_aux].x = (uint64_t)r[i].p->dp_max << 32 | r[i].hash;
int score;
if (r[i].p) score = r[i].p->dp_max, has_cigar = 1;
else score = r[i].score, no_cigar = 1;
if (r[i].is_alt) score = mm_alt_score(score, alt_diff_frac);
aux[n_aux].x = (uint64_t)score << 32 | r[i].hash;
aux[n_aux++].y = i;
} else if (r[i].p) {
free(r[i].p);
r[i].p = 0;
}
}
assert(has_cigar + no_cigar == 1);
radix_sort_128x(aux, aux + n_aux);
for (i = n_aux - 1; i >= 0; --i)
t[n_aux - 1 - i] = r[aux[i].y];
@@ -226,35 +252,63 @@ void mm_sync_regs(void *km, int n_regs, mm_reg1_t *regs) // keep mm_reg1_t::{id,
mm_set_sam_pri(n_regs, regs);
}
void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int *n_, mm_reg1_t *r)
void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int check_strand, int min_strand_sc, int *n_, mm_reg1_t *r)
{
if (pri_ratio > 0.0f && *n_ > 0) {
int i, k, n = *n_, n_2nd = 0;
for (i = k = 0; i < n; ++i) {
uint8_t *keep = (uint8_t*)kmalloc(km, n);
for (i = 0; i < n; ++i) {
int p = r[i].parent;
keep[i] = 0;
if (p == i || r[i].inv) { // primary or inversion
r[k++] = r[i];
keep[i] = 1;
} else if ((r[i].score >= r[p].score * pri_ratio || r[i].score + min_diff >= r[p].score) && n_2nd < best_n) {
if (!(r[i].qs == r[p].qs && r[i].qe == r[p].qe && r[i].rid == r[p].rid && r[i].rs == r[p].rs && r[i].re == r[p].re)) // not identical hits
r[k++] = r[i], ++n_2nd;
else if (r[i].p) free(r[i].p);
} else if (r[i].p) free(r[i].p);
keep[i] = 1, ++n_2nd;
} else if (check_strand && n_2nd < best_n && r[i].score > min_strand_sc && r[i].rev != r[p].rev) {
r[i].strand_retained = 1;
keep[i] = 1, ++n_2nd;
}
}
for (i = k = 0; i < n; ++i) {
if (keep[i]) r[k++] = r[i];
else if (r[i].p) free(r[i].p);
}
kfree(km, keep);
if (k != n) mm_sync_regs(km, k, r); // removing hits requires sync()
*n_ = k;
}
}
void mm_filter_regs(void *km, const mm_mapopt_t *opt, int *n_regs, mm_reg1_t *regs)
int mm_filter_strand_retained(int n_regs, mm_reg1_t *r)
{
int i, k;
uint8_t *keep = (uint8_t*)malloc(n_regs);
for (i = 0; i < n_regs; ++i) {
int p = r[i].parent;
keep[i] = (!r[i].strand_retained || r[i].div < r[p].div * 5.0f || r[i].div < 0.01f);
}
for (i = k = 0; i < n_regs; ++i) {
if (keep[i]) {
if (k < i) r[k++] = r[i];
else ++k;
}
}
free(keep);
return k;
}
void mm_filter_regs(const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs)
{ // NB: after this call, mm_reg1_t::parent can be -1 if its parent filtered out
int i, k;
for (i = k = 0; i < *n_regs; ++i) {
mm_reg1_t *r = &regs[i];
int flt = 0;
if (!r->inv && !r->seg_split && r->cnt < opt->min_cnt) flt = 1;
if (r->p) {
if (r->p) { // these filters are only applied when base-alignment is available
if (r->mlen < opt->min_chain_score) flt = 1;
else if (r->p->dp_max < opt->min_dp_max) flt = 1;
else if (r->qs > qlen * opt->max_clip_ratio && qlen - r->qe > qlen * opt->max_clip_ratio) flt = 1;
if (flt) free(r->p);
}
if (!flt) {
@@ -285,63 +339,6 @@ int mm_squeeze_a(void *km, int n_regs, mm_reg1_t *regs, mm128_t *a)
return as;
}
void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs_, mm_reg1_t *regs, mm128_t *a)
{
int i, n_aux, n_regs = *n_regs_, n_drop = 0;
uint64_t *aux;
if (n_regs < 2) return; // nothing to join
mm_squeeze_a(km, n_regs, regs, a);
aux = (uint64_t*)kmalloc(km, n_regs * 8);
for (i = n_aux = 0; i < n_regs; ++i)
if (regs[i].parent == i || regs[i].parent < 0)
aux[n_aux++] = (uint64_t)regs[i].as << 32 | i;
radix_sort_64(aux, aux + n_aux);
for (i = n_aux - 1; i >= 1; --i) {
mm_reg1_t *r0 = &regs[(int32_t)aux[i-1]], *r1 = &regs[(int32_t)aux[i]];
mm128_t *a0e, *a1s;
int max_gap, min_gap, sc_thres;
// test
if (r0->as + r0->cnt != r1->as) continue; // not adjacent in a[]
if (r0->rid != r1->rid || r0->rev != r1->rev) continue; // make sure on the same target and strand
a0e = &a[r0->as + r0->cnt - 1];
a1s = &a[r1->as];
if (a1s->x <= a0e->x || (int32_t)a1s->y <= (int32_t)a0e->y) continue; // keep colinearity
max_gap = min_gap = (int32_t)a1s->y - (int32_t)a0e->y;
max_gap = max_gap > a1s->x - a0e->x? max_gap : a1s->x - a0e->x;
min_gap = min_gap < a1s->x - a0e->x? min_gap : a1s->x - a0e->x;
if (max_gap > opt->max_join_long || min_gap > opt->max_join_short) continue;
sc_thres = (int)((float)opt->min_join_flank_sc / opt->max_join_long * max_gap + .499);
if (r0->score < sc_thres || r1->score < sc_thres) continue; // require good flanking chains
if (r0->re - r0->rs < max_gap>>1 || r0->qe - r0->qs < max_gap>>1) continue; // require enough flanking length
if (r1->re - r1->rs < max_gap>>1 || r1->qe - r1->qs < max_gap>>1) continue;
// all conditions satisfied; join
a[r1->as].y |= MM_SEED_LONG_JOIN;
r0->cnt += r1->cnt, r0->score += r1->score;
mm_reg_set_coor(r0, qlen, a);
r1->cnt = 0;
r1->parent = r0->id;
++n_drop;
}
kfree(km, aux);
if (n_drop > 0) { // then fix the hits hierarchy
for (i = 0; i < n_regs; ++i) { // adjust the mm_reg1_t::parent
mm_reg1_t *r = &regs[i];
if (r->parent >= 0 && r->id != r->parent) { // fix for secondary hits only
if (regs[r->parent].parent >= 0 && regs[r->parent].parent != r->parent)
r->parent = regs[r->parent].parent;
}
}
mm_filter_regs(km, opt, n_regs_, regs);
mm_sync_regs(km, *n_regs_, regs);
}
}
mm_seg_t *mm_seg_gen(void *km, uint32_t hash, int n_segs, const int *qlens, int n_regs0, const mm_reg1_t *regs0, int *n_regs, mm_reg1_t **regs, const mm128_t *a)
{
int s, i, j, acc_qlen[MM_MAX_SEG+1], qlen_sum = 0;
@@ -388,7 +385,7 @@ mm_seg_t *mm_seg_gen(void *km, uint32_t hash, int n_segs, const int *qlens, int
}
}
for (s = 0; s < n_segs; ++s) {
regs[s] = mm_gen_regs(km, hash, qlens[s], seg[s].n_u, seg[s].u, seg[s].a);
regs[s] = mm_gen_regs(km, hash, qlens[s], seg[s].n_u, seg[s].u, seg[s].a, 0);
n_regs[s] = seg[s].n_u;
for (i = 0; i < n_regs[s]; ++i) {
regs[s][i].seg_split = 1;
@@ -406,15 +403,45 @@ void mm_seg_free(void *km, int n_segs, mm_seg_t *segs)
kfree(km, segs);
}
void mm_set_mapq(int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr)
static void mm_set_inv_mapq(void *km, int n_regs, mm_reg1_t *regs)
{
int i, n_aux;
mm128_t *aux;
if (n_regs < 3) return;
for (i = 0; i < n_regs; ++i)
if (regs[i].inv) break;
if (i == n_regs) return; // no inversion hits
aux = (mm128_t*)kmalloc(km, n_regs * 16);
for (i = n_aux = 0; i < n_regs; ++i)
if (regs[i].parent == i || regs[i].parent < 0)
aux[n_aux].y = i, aux[n_aux++].x = (uint64_t)regs[i].rid << 32 | regs[i].rs;
radix_sort_128x(aux, aux + n_aux);
for (i = 1; i < n_aux - 1; ++i) {
mm_reg1_t *inv = &regs[aux[i].y];
if (inv->inv) {
mm_reg1_t *l = &regs[aux[i-1].y];
mm_reg1_t *r = &regs[aux[i+1].y];
inv->mapq = l->mapq < r->mapq? l->mapq : r->mapq;
}
}
kfree(km, aux);
}
void mm_set_mapq2(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr, int is_splice)
{
static const float q_coef = 40.0f;
int64_t sum_sc = 0;
float uniq_ratio;
int i;
for (i = 0; i < n_regs; ++i)
int i, n_2nd_splice = 0;
if (n_regs == 0) return;
for (i = 0; i < n_regs; ++i) {
if (regs[i].parent == regs[i].id)
sum_sc += regs[i].score;
else if (regs[i].is_spliced)
++n_2nd_splice;
}
uniq_ratio = (float)sum_sc / (sum_sc + rep_len);
for (i = 0; i < n_regs; ++i) {
mm_reg1_t *r = &regs[i];
@@ -427,13 +454,18 @@ void mm_set_mapq(int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, in
pen_cm = pen_s1 < pen_cm? pen_s1 : pen_cm;
subsc = r->subsc > min_chain_sc? r->subsc : min_chain_sc;
if (r->p && r->p->dp_max2 > 0 && r->p->dp_max > 0) {
float identity = (float)r->mlen / r->blen;
float x = (float)r->p->dp_max2 * subsc / r->p->dp_max / r->score0;
float x, identity = (float)r->mlen / r->blen;
if (is_sr && is_splice)
x = (float)r->p->dp_max2 / r->p->dp_max; // ignore chaining score; for short RNA-seq reads, unspliced chaining score tends to be higher
else
x = (float)r->p->dp_max2 * subsc / r->p->dp_max / r->score0;
mapq = (int)(identity * pen_cm * q_coef * (1.0f - x * x) * logf((float)r->p->dp_max / match_sc));
if (!is_sr) {
int mapq_alt = (int)(6.02f * identity * identity * (r->p->dp_max - r->p->dp_max2) / match_sc + .499f); // BWA-MEM like mapQ, mostly for short reads
mapq = mapq < mapq_alt? mapq : mapq_alt; // in case the long-read heuristic fails
}
if (is_splice && is_sr && r->is_spliced && n_2nd_splice == 0)
mapq += 10;
} else {
float x = (float)subsc / r->score0;
if (r->p) {
@@ -449,4 +481,5 @@ void mm_set_mapq(int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, in
if (r->p && r->p->dp_max > r->p->dp_max2 && r->mapq == 0) r->mapq = 1;
} else r->mapq = 0;
}
mm_set_inv_mapq(km, n_regs, regs);
}
+555 -27
View File
@@ -12,6 +12,7 @@
#include "bseq.h"
#include "minimap.h"
#include "mmpriv.h"
#include "ksw2.h"
#include "kvec.h"
#include "khash.h"
@@ -20,6 +21,8 @@
KHASH_INIT(idx, uint64_t, uint64_t, 1, idx_hash, idx_eq)
typedef khash_t(idx) idxhash_t;
KHASH_MAP_INIT_STR(str, uint32_t)
#define kroundup64(x) (--(x), (x)|=(x)>>1, (x)|=(x)>>2, (x)|=(x)>>4, (x)|=(x)>>8, (x)|=(x)>>16, (x)|=(x)>>32, ++(x))
typedef struct mm_idx_bucket_s {
@@ -29,14 +32,20 @@ typedef struct mm_idx_bucket_s {
void *h; // hash table indexing _p_ and minimizers appearing once
} mm_idx_bucket_t;
void mm_idxopt_init(mm_idxopt_t *opt)
{
memset(opt, 0, sizeof(mm_idxopt_t));
opt->k = 15, opt->w = 10, opt->flag = 0;
opt->bucket_bits = 14;
opt->mini_batch_size = 50000000;
opt->batch_size = 4000000000ULL;
}
typedef struct {
int32_t st, en, cnt;
int32_t score:30, strand:2;
} mm_idx_intv1_t;
typedef struct mm_idx_intv_s {
int32_t n, m;
mm_idx_intv1_t *a;
} mm_idx_intv_t;
typedef struct mm_idx_jjump_s {
int32_t n, m;
mm_idx_jjump1_t *a;
} mm_idx_jjump_t;
mm_idx_t *mm_idx_init(int w, int k, int b, int flag)
{
@@ -52,13 +61,27 @@ mm_idx_t *mm_idx_init(int w, int k, int b, int flag)
void mm_idx_destroy(mm_idx_t *mi)
{
int i;
uint32_t i;
if (mi == 0) return;
for (i = 0; i < 1<<mi->b; ++i) {
if (mi->h) kh_destroy(str, (khash_t(str)*)mi->h);
if (mi->B) {
for (i = 0; i < 1U<<mi->b; ++i) {
free(mi->B[i].p);
free(mi->B[i].a.a);
kh_destroy(idx, (idxhash_t*)mi->B[i].h);
}
}
if (mi->spsc) free(mi->spsc);
if (mi->I) {
for (i = 0; i < mi->n_seq; ++i)
free(mi->I[i].a);
free(mi->I);
}
if (mi->J) {
for (i = 0; i < mi->n_seq; ++i)
free(mi->J[i].a);
free(mi->J);
}
if (!mi->km) {
for (i = 0; i < mi->n_seq; ++i)
free(mi->seq[i].name);
@@ -88,14 +111,15 @@ const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n)
void mm_idx_stat(const mm_idx_t *mi)
{
int i, n = 0, n1 = 0;
int64_t n = 0, n1 = 0;
uint32_t i;
uint64_t sum = 0, len = 0;
fprintf(stderr, "[M::%s] kmer size: %d; skip: %d; is_hpc: %d; #seq: %d\n", __func__, mi->k, mi->w, mi->flag&MM_I_HPC, mi->n_seq);
for (i = 0; i < mi->n_seq; ++i)
len += mi->seq[i].len;
for (i = 0; i < 1<<mi->b; ++i)
for (i = 0; i < 1U<<mi->b; ++i)
if (mi->B[i].h) n += kh_size((idxhash_t*)mi->B[i].h);
for (i = 0; i < 1<<mi->b; ++i) {
for (i = 0; i < 1U<<mi->b; ++i) {
idxhash_t *h = (idxhash_t*)mi->B[i].h;
khint_t k;
if (h == 0) continue;
@@ -105,8 +129,36 @@ void mm_idx_stat(const mm_idx_t *mi)
if (kh_key(h, k)&1) ++n1;
}
}
fprintf(stderr, "[M::%s::%.3f*%.2f] distinct minimizers: %d (%.2f%% are singletons); average occurrences: %.3lf; average spacing: %.3lf\n",
__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), n, 100.0*n1/n, (double)sum / n, (double)len / sum);
fprintf(stderr, "[M::%s::%.3f*%.2f] distinct minimizers: %ld (%.2f%% are singletons); average occurrences: %.3lf; average spacing: %.3lf; total length: %ld\n",
__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), (long)n, 100.0*n1/n, (double)sum / n, (double)len / sum, (long)len);
}
int mm_idx_index_name(mm_idx_t *mi)
{
khash_t(str) *h;
uint32_t i;
int has_dup = 0, absent;
if (mi->h) return 0;
h = kh_init(str);
for (i = 0; i < mi->n_seq; ++i) {
khint_t k;
k = kh_put(str, h, mi->seq[i].name, &absent);
if (absent) kh_val(h, k) = i;
else has_dup = 1;
}
mi->h = h;
if (has_dup && mm_verbose >= 2)
fprintf(stderr, "[WARNING] some database sequences have identical sequence names\n");
return has_dup;
}
int mm_idx_name2id(const mm_idx_t *mi, const char *name)
{
khash_t(str) *h = (khash_t(str)*)mi->h;
khint_t k;
if (h == 0) return -2;
k = kh_get(str, h, name);
return k == kh_end(h)? -1 : kh_val(h, k);
}
int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq)
@@ -121,6 +173,28 @@ int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, ui
return en - st;
}
int mm_idx_getseq_rev(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq)
{
uint64_t i, st1, en1;
const mm_idx_seq_t *s;
if (rid >= mi->n_seq || st >= mi->seq[rid].len) return -1;
s = &mi->seq[rid];
if (en > s->len) en = s->len;
st1 = s->offset + (s->len - en);
en1 = s->offset + (s->len - st);
for (i = st1; i < en1; ++i) {
uint8_t c = mm_seq4_get(mi->S, i);
seq[en1 - i - 1] = c < 4? 3 - c : c;
}
return en - st;
}
int mm_idx_getseq2(const mm_idx_t *mi, int is_rev, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq)
{
if (is_rev) return mm_idx_getseq_rev(mi, rid, st, en, seq);
else return mm_idx_getseq(mi, rid, st, en, seq);
}
int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f)
{
int i;
@@ -130,6 +204,7 @@ int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f)
if (f <= 0.) return INT32_MAX;
for (i = 0; i < 1<<mi->b; ++i)
if (mi->B[i].h) n += kh_size((idxhash_t*)mi->B[i].h);
if (n == 0) return INT32_MAX;
a = (uint32_t*)malloc(n * 4);
for (i = n = 0; i < 1<<mi->b; ++i) {
idxhash_t *h = (idxhash_t*)mi->B[i].h;
@@ -150,7 +225,8 @@ int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f)
static void worker_post(void *g, long i, int tid)
{
int j, start_a, start_p, n, n_keys;
int n, n_keys;
size_t j, start_a, start_p;
idxhash_t *h;
mm_idx_t *mi = (mm_idx_t*)g;
mm_idx_bucket_t *b = &mi->B[i];
@@ -178,7 +254,7 @@ static void worker_post(void *g, long i, int tid)
int absent;
mm128_t *p = &b->a.a[j-1];
itr = kh_put(idx, h, p->x>>8>>mi->b<<1, &absent);
assert(absent && j - start_a == n);
assert(absent && j == start_a + n);
if (n == 1) {
kh_key(h, itr) |= 1;
kh_val(h, itr) = p->y;
@@ -194,7 +270,7 @@ static void worker_post(void *g, long i, int tid)
} else ++n;
}
b->h = h;
assert(b->n == start_p);
assert(b->n == (int32_t)start_p);
// deallocate and clear b->a
kfree(0, b->a.a);
@@ -275,6 +351,7 @@ static void *worker_pipeline(void *shared, int step, void *in)
} else seq->name = 0;
seq->len = s->seq[i].l_seq;
seq->offset = p->sum_len;
seq->is_alt = 0;
// copy the sequence
if (!(p->mi->flag & MM_I_NO_SEQ)) {
for (j = 0; j < seq->len; ++j) { // TODO: this is not the fastest way, but let's first see if speed matters here
@@ -314,7 +391,7 @@ mm_idx_t *mm_idx_gen(mm_bseq_file_t *fp, int w, int k, int b, int flag, int mini
pipeline_t pl;
if (fp == 0 || mm_bseq_eof(fp)) return 0;
memset(&pl, 0, sizeof(pipeline_t));
pl.mini_batch_size = mini_batch_size < batch_size? mini_batch_size : batch_size;
pl.mini_batch_size = (uint64_t)mini_batch_size < batch_size? mini_batch_size : batch_size;
pl.batch_size = batch_size;
pl.fp = fp;
pl.mi = mm_idx_init(w, k, b, flag);
@@ -346,7 +423,9 @@ mm_idx_t *mm_idx_str(int w, int k, int is_hpc, int bucket_bits, int n, const cha
uint64_t sum_len = 0;
mm128_v a = {0,0,0};
mm_idx_t *mi;
khash_t(str) *h;
int i, flag = 0;
if (n <= 0) return 0;
for (i = 0; i < n; ++i) // get the total length
sum_len += strlen(seq[i]);
@@ -357,16 +436,21 @@ mm_idx_t *mm_idx_str(int w, int k, int is_hpc, int bucket_bits, int n, const cha
mi->n_seq = n;
mi->seq = (mm_idx_seq_t*)kcalloc(mi->km, n, sizeof(mm_idx_seq_t)); // ->seq is allocated from km
mi->S = (uint32_t*)calloc((sum_len + 7) / 8, 4);
mi->h = h = kh_init(str);
for (i = 0, sum_len = 0; i < n; ++i) {
const char *s = seq[i];
mm_idx_seq_t *p = &mi->seq[i];
uint32_t j;
if (name && name[i]) {
int absent;
p->name = (char*)kmalloc(mi->km, strlen(name[i]) + 1);
strcpy(p->name, name[i]);
kh_put(str, h, p->name, &absent);
assert(absent);
}
p->offset = sum_len;
p->len = strlen(s);
p->is_alt = 0;
for (j = 0; j < p->len; ++j) {
int c = seq_nt4_table[(uint8_t)s[j]];
uint64_t o = sum_len + j;
@@ -391,17 +475,20 @@ mm_idx_t *mm_idx_str(int w, int k, int is_hpc, int bucket_bits, int n, const cha
void mm_idx_dump(FILE *fp, const mm_idx_t *mi)
{
uint64_t sum_len = 0;
uint32_t x[5];
int i;
uint32_t x[5], i;
x[0] = mi->w, x[1] = mi->k, x[2] = mi->b, x[3] = mi->n_seq, x[4] = mi->flag;
fwrite(MM_IDX_MAGIC, 1, 4, fp);
fwrite(x, 4, 5, fp);
for (i = 0; i < mi->n_seq; ++i) {
uint8_t l;
l = strlen(mi->seq[i].name);
if (mi->seq[i].name) {
uint8_t l = strlen(mi->seq[i].name);
fwrite(&l, 1, 1, fp);
fwrite(mi->seq[i].name, 1, l, fp);
} else {
uint8_t l = 0;
fwrite(&l, 1, 1, fp);
}
fwrite(&mi->seq[i].len, 4, 1, fp);
sum_len += mi->seq[i].len;
}
@@ -428,9 +515,8 @@ void mm_idx_dump(FILE *fp, const mm_idx_t *mi)
mm_idx_t *mm_idx_load(FILE *fp)
{
int i;
char magic[4];
uint32_t x[5];
uint32_t x[5], i;
uint64_t sum_len = 0;
mm_idx_t *mi;
@@ -444,11 +530,14 @@ mm_idx_t *mm_idx_load(FILE *fp)
uint8_t l;
mm_idx_seq_t *s = &mi->seq[i];
fread(&l, 1, 1, fp);
if (l) {
s->name = (char*)kmalloc(mi->km, l + 1);
fread(s->name, 1, l, fp);
s->name[l] = 0;
}
fread(&s->len, 4, 1, fp);
s->offset = sum_len;
s->is_alt = 0;
sum_len += s->len;
}
for (i = 0; i < 1<<mi->b; ++i) {
@@ -482,14 +571,19 @@ mm_idx_t *mm_idx_load(FILE *fp)
int64_t mm_idx_is_idx(const char *fn)
{
int fd, is_idx = 0;
off_t ret, off_end;
int64_t ret, off_end;
char magic[4];
if (strcmp(fn, "-") == 0) return 0; // read from pipe; not an index
fd = open(fn, O_RDONLY);
if (fd < 0) return -1; // error
#ifdef WIN32
if ((off_end = _lseeki64(fd, 0, SEEK_END)) >= 4) {
_lseeki64(fd, 0, SEEK_SET);
#else
if ((off_end = lseek(fd, 0, SEEK_END)) >= 4) {
lseek(fd, 0, SEEK_SET);
#endif // WIN32
ret = read(fd, magic, 4);
if (ret == 4 && strncmp(magic, MM_IDX_MAGIC, 4) == 0)
is_idx = 1;
@@ -535,7 +629,7 @@ mm_idx_t *mm_idx_reader_read(mm_idx_reader_t *r, int n_threads)
mi = mm_idx_gen(r->fp.seq, r->opt.w, r->opt.k, r->opt.bucket_bits, r->opt.flag, r->opt.mini_batch_size, n_threads, r->opt.batch_size);
if (mi) {
if (r->fp_out) mm_idx_dump(r->fp_out, mi);
++r->n_parts;
mi->index = r->n_parts++;
}
return mi;
}
@@ -544,3 +638,437 @@ int mm_idx_reader_eof(const mm_idx_reader_t *r) // TODO: in extremely rare cases
{
return r->is_idx? (feof(r->fp.idx) || ftell(r->fp.idx) == r->idx_size) : mm_bseq_eof(r->fp.seq);
}
#include <ctype.h>
#include <zlib.h>
#include "ksort.h"
#include "kseq.h"
KSTREAM_DECLARE(gzFile, gzread)
int mm_idx_alt_read(mm_idx_t *mi, const char *fn)
{
int n_alt = 0;
gzFile fp;
kstream_t *ks;
kstring_t str = {0,0,0};
fp = fn && strcmp(fn, "-")? gzopen(fn, "r") : gzdopen(fileno(stdin), "r");
if (fp == 0) return -1;
ks = ks_init(fp);
if (mi->h == 0) mm_idx_index_name(mi);
while (ks_getuntil(ks, KS_SEP_LINE, &str, 0) >= 0) {
char *p;
int id;
for (p = str.s; *p && !isspace(*p); ++p) { }
*p = 0;
id = mm_idx_name2id(mi, str.s);
if (id >= 0) mi->seq[id].is_alt = 1, ++n_alt;
}
mi->n_alt = n_alt;
if (mm_verbose >= 3)
fprintf(stderr, "[M::%s] found %d ALT contigs\n", __func__, n_alt);
return n_alt;
}
/***************
* BED reading *
***************/
#define sort_key_bed(a) ((a).st)
KRADIX_SORT_INIT(bed, mm_idx_intv1_t, sort_key_bed, 4)
#define sort_key_end(a) ((a).en)
KRADIX_SORT_INIT(end, mm_idx_intv1_t, sort_key_end, 4)
static mm_idx_intv_t *mm_idx_bed_read_core(const mm_idx_t *mi, const char *fn, int read_junc, int min_sc)
{
gzFile fp;
kstream_t *ks;
kstring_t str = {0,0,0};
mm_idx_intv_t *I;
fp = fn && strcmp(fn, "-")? gzopen(fn, "r") : gzdopen(fileno(stdin), "r");
if (fp == 0) return 0;
I = CALLOC(mm_idx_intv_t, mi->n_seq);
ks = ks_init(fp);
while (ks_getuntil(ks, KS_SEP_LINE, &str, 0) >= 0) {
mm_idx_intv_t *r;
mm_idx_intv1_t t = {-1,-1,-1,-1,0};
char *p, *q, *bl, *bs;
int32_t i, id = -1, n_blk = 0;
for (p = q = str.s, i = 0;; ++p) {
if (*p == 0 || *p == '\t') {
int32_t c = *p;
*p = 0;
if (i == 0) { // chr
id = mm_idx_name2id(mi, q);
if (id < 0) break; // unknown name; TODO: throw a warning
} else if (i == 1) { // start
t.st = atol(q); // TODO: watch out integer overflow!
if (t.st < 0) break;
} else if (i == 2) { // end
t.en = atol(q);
if (t.en < 0) break;
} else if (i == 4) { // BED score
t.score = *q >= '0' && *q <= '9'? atol(q) : -1;
} else if (i == 5) { // strand
t.strand = *q == '+'? 1 : *q == '-'? -1 : 0;
} else if (i == 9) {
if (!isdigit(*q)) break;
n_blk = atol(q);
} else if (i == 10) {
bl = q;
} else if (i == 11) {
bs = q;
break;
}
if (c == 0) break;
++i, q = p + 1;
}
}
if (id < 0 || t.st < 0 || t.st >= t.en) continue; // contig ID not found, or other problems
if (min_sc > 0 && t.score < min_sc) continue;
r = &I[id];
if (i >= 11 && read_junc) { // BED12
int32_t st, sz, en;
st = strtol(bs, &bs, 10); ++bs;
sz = strtol(bl, &bl, 10); ++bl;
en = t.st + st + sz;
for (i = 1; i < n_blk; ++i) {
mm_idx_intv1_t s = t;
if (r->n == r->m) {
r->m = r->m? r->m + (r->m>>1) : 16;
r->a = (mm_idx_intv1_t*)realloc(r->a, sizeof(*r->a) * r->m);
}
st = strtol(bs, &bs, 10); ++bs;
sz = strtol(bl, &bl, 10); ++bl;
s.st = en, s.en = t.st + st;
en = t.st + st + sz;
if (s.en > s.st) r->a[r->n++] = s;
}
} else {
if (r->n == r->m) {
r->m = r->m? r->m + (r->m>>1) : 16;
r->a = (mm_idx_intv1_t*)realloc(r->a, sizeof(*r->a) * r->m);
}
r->a[r->n++] = t;
}
}
free(str.s);
ks_destroy(ks);
gzclose(fp);
return I;
}
static mm_idx_intv_t *mm_idx_bed_read_merge(const mm_idx_t *mi, const char *fn, int read_junc, int min_sc)
{
long n = 0, n0 = 0;
int32_t i;
mm_idx_intv_t *I;
I = mm_idx_bed_read_core(mi, fn, read_junc, min_sc);
if (I == 0) return 0;
for (i = 0; i < mi->n_seq; ++i) {
int32_t j, j0, k;
mm_idx_intv_t *intv = &I[i];
n0 += intv->n;
radix_sort_bed(intv->a, intv->a + intv->n); // sort by st
for (j = 1, j0 = 0; j <= intv->n; ++j) { // sort by st and then by end
if (j == intv->n || intv->a[j].st != intv->a[j0].st) {
radix_sort_end(intv->a + j0, intv->a + j);
j0 = j;
}
}
for (j = 1, j0 = 0, k = 0; j <= intv->n; ++j) { // merge intervals with the same (st, en)
if (j == intv->n || intv->a[j].st != intv->a[j0].st || intv->a[j].en != intv->a[j0].en) {
intv->a[k] = intv->a[j0];
intv->a[k++].cnt = j - j0;
j0 = j;
}
}
intv->a = REALLOC(mm_idx_intv1_t, intv->a, k);
intv->n = intv->m = k;
n += k;
}
if (mm_verbose >= 3)
fprintf(stderr, "[%s] read %ld introns, %ld of which are non-redundant\n", __func__, n0, n);
return I;
}
int mm_idx_bed_read(mm_idx_t *mi, const char *fn, int read_junc)
{
if (mi->h == 0) mm_idx_index_name(mi);
mi->I = mm_idx_bed_read_merge(mi, fn, read_junc, -1);
return 0;
}
int mm_idx_bed_junc(const mm_idx_t *mi, int32_t ctg, int32_t st, int32_t en, uint8_t *s)
{
int32_t i, left, right;
mm_idx_intv_t *r;
memset(s, 0, en - st);
if (mi->I == 0 || ctg < 0 || ctg >= mi->n_seq) return -1;
r = &mi->I[ctg];
left = 0, right = r->n;
while (right > left) {
int32_t mid = left + ((right - left) >> 1);
if (r->a[mid].st >= st) right = mid;
else left = mid + 1;
}
for (i = left; i < r->n; ++i) {
if (st <= r->a[i].st && en >= r->a[i].en && r->a[i].strand != 0) {
if (r->a[i].strand > 0) {
s[r->a[i].st - st] |= 1, s[r->a[i].en - 1 - st] |= 2;
} else {
s[r->a[i].st - st] |= 8, s[r->a[i].en - 1 - st] |= 4;
}
}
}
return left;
}
/*********************************
* Reading junctions for jumping *
*********************************/
#define sort_key_jj(a) ((a).off)
KRADIX_SORT_INIT(jj, mm_idx_jjump1_t, sort_key_jj, 4)
#define sort_key_jj2(a) ((a).off2)
KRADIX_SORT_INIT(jj2, mm_idx_jjump1_t, sort_key_jj2, 4)
static void sort_jjump(mm_idx_jjump_t *jj2)
{
int32_t j0, j, k;
if (jj2 == 0 || jj2->n == 0) return;
radix_sort_jj(jj2->a, jj2->a + jj2->n);
for (j0 = 0, j = 1; j <= jj2->n; ++j) {
if (j == jj2->n || jj2->a[j0].off != jj2->a[j].off) {
radix_sort_jj2(jj2->a + j0, jj2->a + j);
j0 = j;
}
}
// the actual merge
for (j0 = 0, j = 1, k = 0; j <= jj2->n; ++j) {
if (j == jj2->n || jj2->a[j0].off != jj2->a[j].off || jj2->a[j0].off2 != jj2->a[j].off2) {
int32_t t, cnt = 0;
uint16_t flag = 0;
for (t = j0; t < j; ++t) cnt += jj2->a[t].cnt, flag |= jj2->a[t].flag;
jj2->a[k] = jj2->a[j0];
jj2->a[k].cnt = cnt;
jj2->a[k++].flag = flag;
j0 = j;
}
}
jj2->n = k;
jj2->a = REALLOC(mm_idx_jjump1_t, jj2->a, k);
}
static mm_idx_jjump_t *mm_idx_bed2jjump(const mm_idx_t *mi, const mm_idx_intv_t *I, uint16_t flag)
{
int32_t i;
mm_idx_jjump_t *J;
J = CALLOC(mm_idx_jjump_t, mi->n_seq);
for (i = 0; i < mi->n_seq; ++i) {
int32_t j, k;
const mm_idx_intv_t *intv = &I[i];
mm_idx_jjump_t *jj = &J[i];
jj->n = intv->n * 2;
jj->a = CALLOC(mm_idx_jjump1_t, jj->n);
for (j = k = 0; j < intv->n; ++j) {
jj->a[k].off = intv->a[j].st, jj->a[k].off2 = intv->a[j].en, jj->a[k].cnt = intv->a[j].cnt, jj->a[k].strand = intv->a[j].strand, jj->a[k++].flag = flag;
jj->a[k].off = intv->a[j].en, jj->a[k].off2 = intv->a[j].st, jj->a[k].cnt = intv->a[j].cnt, jj->a[k].strand = intv->a[j].strand, jj->a[k++].flag = flag;
}
sort_jjump(jj);
}
return J;
}
static mm_idx_jjump_t *mm_idx_jjump_merge(const mm_idx_t *mi, const mm_idx_jjump_t *J0, const mm_idx_jjump_t *J1)
{
int32_t i;
mm_idx_jjump_t *J2;
J2 = CALLOC(mm_idx_jjump_t, mi->n_seq);
for (i = 0; i < mi->n_seq; ++i) {
int32_t j, k;
const mm_idx_jjump_t *jj0 = &J0[i], *jj1 = &J1[i];
mm_idx_jjump_t *jj2 = &J2[i];
jj2->n = jj0->n + jj1->n;
jj2->a = CALLOC(mm_idx_jjump1_t, jj2->n);
for (j = k = 0; j < jj0->n; ++j) jj2->a[k++] = jj0->a[j];
for (j = 0; j < jj1->n; ++j) jj2->a[k++] = jj1->a[j];
sort_jjump(jj2);
}
return J2;
}
int mm_idx_jjump_read(mm_idx_t *mi, const char *fn, int flag, int min_sc)
{
int32_t i, j, n_anno = 0, n_misc = 0;
mm_idx_intv_t *I;
mm_idx_jjump_t *J;
if (mi->h == 0) mm_idx_index_name(mi);
I = mm_idx_bed_read_merge(mi, fn, 1, min_sc);
J = mm_idx_bed2jjump(mi, I, flag);
for (i = 0; i < mi->n_seq; ++i) free(I[i].a);
free(I);
if (mi->J) {
mm_idx_jjump_t *J2;
J2 = mm_idx_jjump_merge(mi, mi->J, J);
for (i = 0; i < mi->n_seq; ++i) {
free(mi->J[i].a); free(J[i].a);
}
free(mi->J); free(J);
mi->J = J2;
} else mi->J = J;
for (i = 0; i < mi->n_seq; ++i) {
for (j = 0; j < mi->J[i].n; ++j)
if (mi->J[i].a[j].flag & MM_JUNC_ANNO) ++n_anno;
else ++n_misc;
}
if (mm_verbose >= 3)
fprintf(stderr, "[%s] there are %d annotated and %d other splice positions in the index\n", __func__, n_anno, n_misc);
return 0;
}
static int32_t mm_idx_jump_get_core(int32_t n, const mm_idx_jjump1_t *a, int32_t x) // similar to mm_idx_find_intv()
{
int32_t s = 0, e = n;
if (n == 0) return -1;
if (x < a[0].off) return -1;
while (s < e) {
int32_t mid = s + (e - s) / 2;
if (x >= a[mid].off && (mid + 1 >= n || x < a[mid+1].off)) return mid;
else if (x < a[mid].off) e = mid;
else s = mid + 1;
}
assert(0);
}
const mm_idx_jjump1_t *mm_idx_jump_get(const mm_idx_t *db, int32_t cid, int32_t st, int32_t en, int32_t *n)
{
mm_idx_jjump_t *s;
int32_t l, r;
*n = 0;
if (cid >= db->n_seq || cid < 0 || db->J == 0) return 0;
if (en < 0 || en > db->seq[cid].len) en = db->seq[cid].len;
s = &db->J[cid];
if (s->n == 0) return 0;
l = mm_idx_jump_get_core(s->n, s->a, st);
r = mm_idx_jump_get_core(s->n, s->a, en);
*n = r - l;
return &s->a[l + 1];
}
/****************
* splice score *
****************/
typedef struct mm_idx_spsc_s {
uint32_t n, m;
uint64_t *a; // pos<<56 | score<<1 | acceptor
} mm_idx_spsc_t;
int32_t mm_idx_spsc_read2(mm_idx_t *idx, const char *fn, int32_t max_sc, float scale)
{
gzFile fp;
kstring_t str = {0,0,0};
kstream_t *ks;
int32_t dret, j;
int64_t n_read = 0;
fp = fn && strcmp(fn, "-") != 0? gzopen(fn, "rb") : gzdopen(0, "rb");
if (fp == 0) return -1;
if (idx->h == 0) mm_idx_index_name(idx);
if (max_sc > 63) max_sc = 63;
idx->spsc = Kcalloc(0, mm_idx_spsc_t, idx->n_seq * 2);
ks = ks_init(fp);
while (ks_getuntil(ks, KS_SEP_LINE, &str, &dret) >= 0) {
mm_idx_spsc_t *s;
char *p, *q, *name = 0;
int32_t i, type = -1, strand = 0, cid = -1, score = -1;
int64_t pos = -1;
for (i = 0, p = q = str.s;; ++p) {
if (*p == '\t' || *p == 0) {
int c = *p;
*p = 0;
if (i == 0) {
name = q;
} else if (i == 1) {
pos = atol(q);
} else if (i == 2) {
strand = *q == '+'? 1 : '-'? -1 : 0;
} else if (i == 3) {
type = *q == 'D'? 0 : *q == 'A'? 1 : -1;
} else if (i == 4) {
score = atoi(q);
break;
}
if (c == 0) break;
q = p + 1, ++i;
}
}
if (i < 4) continue; // not enough fields
if (scale > 0.0f && scale < 1.0f)
score = score > 0.0f? (int)(score * scale + .499) : (int)(score * scale - .499);
if (score > max_sc) score = max_sc;
if (score < -max_sc) score = -max_sc;
cid = mm_idx_name2id(idx, name);
if (cid < 0 || type < 0 || strand == 0 || pos < 0) continue; // FIXME: give a warning!
s = &idx->spsc[cid << 1 | (strand > 0? 0 : 1)];
Kgrow(0, uint64_t, s->a, s->n, s->m);
if (pos > 0 && pos < idx->seq[cid].len) { // ignore scores at the ends
s->a[s->n++] = (uint64_t)pos << 8 | (score + KSW_SPSC_OFFSET) << 1 | type;
++n_read;
}
}
ks_destroy(ks);
gzclose(fp);
for (j = 0; j < idx->n_seq * 2; ++j) {
mm_idx_spsc_t *s = &idx->spsc[j];
if (s->n > 0)
radix_sort_64(s->a, s->a + s->n);
}
if (mm_verbose >= 3)
fprintf(stderr, "[M::%s] read %ld splice scores\n", __func__, (long)n_read);
return 0;
}
int32_t mm_idx_spsc_read(mm_idx_t *idx, const char *fn, int32_t max_sc)
{
return mm_idx_spsc_read2(idx, fn, max_sc, 1.0f);
}
static int32_t mm_idx_find_intv(int32_t n, const uint64_t *a, int64_t x)
{
int32_t s = 0, e = n;
if (n == 0) return -1;
if (x < a[0]>>8) return -1;
while (s < e) {
int32_t mid = s + (e - s) / 2;
if (x >= a[mid]>>8 && (mid + 1 >= n || x < a[mid+1]>>8)) return mid;
else if (x < a[mid]>>8) e = mid;
else s = mid + 1;
}
assert(0);
}
int64_t mm_idx_spsc_get(const mm_idx_t *db, int32_t cid, int64_t st, int64_t en, int32_t rev, uint8_t *sc)
{
const mm_idx_spsc_t *s;
if (cid >= db->n_seq || cid < 0 || db->spsc == 0) return -1;
if (en < 0 || en > db->seq[cid].len) en = db->seq[cid].len;
memset(sc, 0xff, en - st);
s = &db->spsc[cid << 1 | (!!rev)];
if (s->n > 0) {
int32_t j, l, r;
l = mm_idx_find_intv(s->n, s->a, st);
r = mm_idx_find_intv(s->n, s->a, en);
for (j = l + 1; j <= r; ++j) {
int64_t x = (s->a[j]>>8) - st;
uint8_t score = s->a[j] & 0xff;
assert(x <= en - st);
if (x == en - st) continue;
if (sc[x] == 0xff || sc[x] < score) sc[x] = score;
}
}
return en - st;
}
+201
View File
@@ -0,0 +1,201 @@
#include <stdio.h>
#include "mmpriv.h"
#include "kalloc.h"
#define MM_MIN_EXON_LEN 20
static int32_t mm_jump_check(void *km, const mm_idx_t *mi, int32_t qlen, const uint8_t *qseq0, const mm_reg1_t *r, int32_t ext, int32_t is_left) // TODO: check close N
{
int32_t clip, clen, e = !r->rev ^ !is_left; // 0 for left of the alignment; 1 for right
uint32_t cigar;
if (!r->p || r->p->n_cigar <= 0) return -1; // only working with CIGAR
clip = e == 0? r->qs : qlen - r->qe;
cigar = r->p->cigar[is_left? 0 : r->p->n_cigar - 1];
clen = (cigar&0xf) == MM_CIGAR_MATCH? cigar>>4 : 0;
if (clen <= ext) return -1;
if (is_left) {
if (clip >= r->rs) return -1; // no space to jump
} else {
if (clip >= mi->seq[r->rid].len - r->re) return -1; // no space to jump
}
return 0;
}
static uint8_t *mm_jump_get_qseq_seq(void *km, int32_t qlen, const uint8_t *qseq0, const mm_reg1_t *r, int32_t is_left, int32_t ql0, uint8_t *qseq)
{
extern unsigned char seq_nt4_table[256];
int32_t i, k = 0;
if (!r->rev) {
if (is_left)
for (i = 0; i < ql0; ++i)
qseq[k++] = seq_nt4_table[(uint8_t)qseq0[i]];
else
for (i = qlen - ql0; i < qlen; ++i)
qseq[k++] = seq_nt4_table[(uint8_t)qseq0[i]];
} else {
if (is_left)
for (i = qlen - 1; i >= qlen - ql0; --i) {
uint8_t c = seq_nt4_table[(uint8_t)qseq0[i]];
qseq[k++] = c >= 4? c : 3 - c;
}
else
for (i = ql0 - 1; i >= 0; --i) {
uint8_t c = seq_nt4_table[(uint8_t)qseq0[i]];
qseq[k++] = c >= 4? c : 3 - c;
}
}
return qseq;
}
static void mm_jump_split_left(void *km, const mm_idx_t *mi, const mm_mapopt_t *opt, int32_t qlen, const uint8_t *qseq0, mm_reg1_t *r, int32_t ts_strand)
{
uint8_t *tseq = 0, *qseq = 0;
int32_t i, n, l, i0, m, mm0;
int32_t i0_anno = -1, n_anno = 0, mm0_anno = 0, i0_misc = -1, n_misc = 0, mm0_misc = 0;
int32_t ext = 1 + (opt->b + opt->a - 1) / opt->a + 1;
int32_t clip = !r->rev? r->qs : qlen - r->qe;
int32_t extt = clip < ext? clip : ext;
const mm_idx_jjump1_t *a;
if (mm_jump_check(km, mi, qlen, qseq0, r, ext + MM_MIN_EXON_LEN, 1) < 0) return;
a = mm_idx_jump_get(mi, r->rid, r->rs - extt, r->rs + ext, &n);
if (n == 0) return;
for (i = 0; i < n; ++i) { // traverse possible jumps
const mm_idx_jjump1_t *ai = &a[i];
int32_t tlen, tl1, j, mm1, mm2;
assert(ai->off >= r->rs - extt && ai->off <= r->rs + ext);
if (ts_strand * ai->strand < 0) continue; // wrong strand
if (ai->off2 >= ai->off) continue; // wrong direction
if (ai->off - ai->off2 < 6) continue; // intron too small
if (ai->off2 < clip + ext) continue; // not long enough
if (tseq == 0) {
tseq = Kcalloc(km, uint8_t, (clip + ext) * 2); // tseq and qseq are allocated together
qseq = tseq + clip + ext;
mm_jump_get_qseq_seq(km, qlen, qseq0, r, 1, clip + ext, qseq);
}
tl1 = clip + (ai->off - r->rs);
tlen = mm_idx_getseq2(mi, 0, r->rid, ai->off, r->rs + ext, &tseq[tl1]);
assert(tlen == r->rs + ext - ai->off);
tlen = mm_idx_getseq2(mi, 0, r->rid, ai->off2 - tl1, ai->off2, tseq);
assert(tlen == tl1);
for (j = 0, mm1 = 0; j < tl1; ++j)
if (qseq[j] != tseq[j] || qseq[j] > 3 || tseq[j] > 3)
++mm1;
for (mm2 = 0; j < clip + ext; ++j)
if (qseq[j] != tseq[j] || qseq[j] > 3 || tseq[j] > 3)
++mm2;
if (mm1 == 0 && mm2 <= 1) {
if (ai->flag & MM_JUNC_ANNO)
i0_anno = i, mm0_anno = mm1 + mm2, ++n_anno; // i0 points to the rightmost i
else
i0_misc = i, mm0_misc = mm1 + mm2, ++n_misc;
}
}
if (n_anno > 0) m = n_anno, i0 = i0_anno, mm0 = mm0_anno;
else m = n_misc, i0 = i0_misc, mm0 = mm0_misc;
kfree(km, tseq);
l = m > 0? a[i0].off - r->rs : 0; // may be negative
if (m == 1 && clip + l >= opt->jump_min_match) { // add one more exon
mm_enlarge_cigar(r, 2);
memmove(r->p->cigar + 2, r->p->cigar, r->p->n_cigar * 4);
r->p->cigar[0] = (clip + l) << 4 | MM_CIGAR_MATCH;
r->p->cigar[1] = (a[i0].off - a[i0].off2) << 4 | MM_CIGAR_N_SKIP;
r->p->cigar[2] = ((r->p->cigar[2]>>4) - l) << 4 | MM_CIGAR_MATCH;
r->p->n_cigar += 2;
r->rs = a[i0].off2 - (clip + l);
if (!r->rev) r->qs = 0;
else r->qe = qlen;
r->blen += clip, r->mlen += clip - mm0;
r->p->dp_max0 += (clip - mm0) * opt->a - mm0 * opt->b;
r->p->dp_max += (clip - mm0) * opt->a - mm0 * opt->b;
if (!r->is_spliced) r->is_spliced = 1, r->p->dp_max += (opt->a + opt->b) + ((opt->a + opt->b) >> 1);
} else if (m > 0 && a[i0].off > r->rs) { // trim by l; l is always positive
r->p->cigar[0] -= l << 4 | MM_CIGAR_MATCH;
r->rs += l;
if (!r->rev) r->qs += l;
else r->qe -= l;
}
}
static void mm_jump_split_right(void *km, const mm_idx_t *mi, const mm_mapopt_t *opt, int32_t qlen, const uint8_t *qseq0, mm_reg1_t *r, int32_t ts_strand)
{
uint8_t *tseq = 0, *qseq = 0;
int32_t i, n, l, i0, m, mm0;
int32_t i0_anno = -1, n_anno = 0, mm0_anno = 0, i0_misc = -1, n_misc = 0, mm0_misc = 0;
int32_t ext = 1 + (opt->b + opt->a - 1) / opt->a + 1;
int32_t clip = !r->rev? qlen - r->qe : r->qs;
int32_t extt = clip < ext? clip : ext;
const mm_idx_jjump1_t *a;
if (mm_jump_check(km, mi, qlen, qseq0, r, ext + MM_MIN_EXON_LEN, 0) < 0) return;
a = mm_idx_jump_get(mi, r->rid, r->re - ext, r->re + extt, &n);
if (n == 0) return;
for (i = 0; i < n; ++i) { // traverse possible jumps
const mm_idx_jjump1_t *ai = &a[i];
int32_t tlen, tl1, j, mm1, mm2;
assert(ai->off >= r->re - ext && ai->off <= r->re + extt);
if (ts_strand * ai->strand < 0) continue; // wrong strand
if (ai->off2 <= ai->off) continue; // wrong direction
if (ai->off2 - ai->off < 6) continue; // intron too small
if (ai->off2 + clip + ext > mi->seq[r->rid].len) continue; // not long enough
if (tseq == 0) {
tseq = Kcalloc(km, uint8_t, (clip + ext) * 2); // tseq and qseq are allocated together
qseq = tseq + clip + ext;
mm_jump_get_qseq_seq(km, qlen, qseq0, r, 0, clip + ext, qseq);
}
tl1 = clip + (r->re - ai->off);
tlen = mm_idx_getseq2(mi, 0, r->rid, r->re - ext, ai->off, tseq);
assert(tlen == ai->off - (r->re - ext));
tlen = mm_idx_getseq2(mi, 0, r->rid, ai->off2, ai->off2 + tl1, &tseq[clip + ext - tl1]);
assert(tlen == tl1);
for (j = 0, mm2 = 0; j < clip + ext - tl1; ++j)
if (qseq[j] != tseq[j] || qseq[j] > 3 || tseq[j] > 3)
++mm2;
for (mm1 = 0; j < clip + ext; ++j)
if (qseq[j] != tseq[j] || qseq[j] > 3 || tseq[j] > 3)
++mm1;
if (mm1 == 0 && mm2 <= 1) {
if (ai->flag & MM_JUNC_ANNO) {
if (i0_anno < 0) i0_anno = i, mm0_anno = mm1 + mm2;
++n_anno;
} else {
if (i0_misc < 0) i0_misc = i, mm0_misc = mm1 + mm2;
++n_misc;
}
}
}
if (n_anno > 0) m = n_anno, i0 = i0_anno, mm0 = mm0_anno;
else m = n_misc, i0 = i0_misc, mm0 = mm0_misc;
kfree(km, tseq);
l = m > 0? r->re - a[i0].off : 0; // may be negative
if (m == 1 && clip + l >= opt->jump_min_match) { // add one more exon
mm_enlarge_cigar(r, 2);
r->p->cigar[r->p->n_cigar - 1] = ((r->p->cigar[r->p->n_cigar - 1]>>4) - l) << 4 | MM_CIGAR_MATCH;
r->p->cigar[r->p->n_cigar] = (a[i0].off2 - a[i0].off) << 4 | MM_CIGAR_N_SKIP;
r->p->cigar[r->p->n_cigar + 1] = (clip + l) << 4 | MM_CIGAR_MATCH;
r->p->n_cigar += 2;
r->re = a[i0].off2 + (clip + l);
if (!r->rev) r->qe = qlen;
else r->qs = 0;
r->blen += clip, r->mlen += clip - mm0;
r->p->dp_max0 += (clip - mm0) * opt->a - mm0 * opt->b;
r->p->dp_max += (clip - mm0) * opt->a - mm0 * opt->b;
if (!r->is_spliced) r->is_spliced = 1, r->p->dp_max += (opt->a + opt->b) + ((opt->a + opt->b) >> 1);
} else if (m > 0 && r->re > a[i0].off) { // trim by l; l is always positive
r->p->cigar[r->p->n_cigar - 1] -= l << 4 | MM_CIGAR_MATCH;
r->re -= l;
if (!r->rev) r->qe -= l;
else r->qs += l;
}
}
void mm_jump_split(void *km, const mm_idx_t *mi, const mm_mapopt_t *opt, int32_t qlen, const uint8_t *qseq, mm_reg1_t *r, int32_t ts_strand)
{
assert((opt->flag & MM_F_EQX) == 0);
mm_jump_split_left(km, mi, opt, qlen, qseq, r, ts_strand);
mm_jump_split_right(km, mi, opt, qlen, qseq, r, ts_strand);
}
+40 -14
View File
@@ -18,15 +18,14 @@
* | | | |
* p=p->ptr->ptr->ptr->ptr p->ptr p->ptr->ptr p->ptr->ptr->ptr
*/
#define MIN_CORE_SIZE 0x80000
typedef struct header_t {
size_t size;
struct header_t *ptr;
} header_t;
typedef struct {
void *par;
size_t min_core_size;
header_t base, *loop_head, *core_head; /* base is a zero-sized block always kept in the loop */
} kmem_t;
@@ -36,31 +35,40 @@ static void panic(const char *s)
abort();
}
void *km_init(void)
void *km_init2(void *km_par, size_t min_core_size)
{
return calloc(1, sizeof(kmem_t));
kmem_t *km;
km = (kmem_t*)kcalloc(km_par, 1, sizeof(kmem_t));
km->par = km_par;
if (km_par) km->min_core_size = min_core_size > 0? min_core_size : ((kmem_t*)km_par)->min_core_size - 2;
else km->min_core_size = min_core_size > 0? min_core_size : 0x80000;
return (void*)km;
}
void *km_init(void) { return km_init2(0, 0); }
void km_destroy(void *_km)
{
kmem_t *km = (kmem_t*)_km;
void *km_par;
header_t *p, *q;
if (km == NULL) return;
km_par = km->par;
for (p = km->core_head; p != NULL;) {
q = p->ptr;
free(p);
kfree(km_par, p);
p = q;
}
free(km);
kfree(km_par, km);
}
static header_t *morecore(kmem_t *km, size_t nu)
{
header_t *q;
size_t bytes, *p;
nu = (nu + 1 + (MIN_CORE_SIZE - 1)) / MIN_CORE_SIZE * MIN_CORE_SIZE; /* the first +1 for core header */
nu = (nu + 1 + (km->min_core_size - 1)) / km->min_core_size * km->min_core_size; /* the first +1 for core header */
bytes = nu * sizeof(header_t);
q = (header_t*)malloc(bytes);
q = (header_t*)kmalloc(km->par, bytes);
if (!q) panic("[morecore] insufficient memory");
q->ptr = km->core_head, q->size = nu, km->core_head = q;
p = (size_t*)(q + 1);
@@ -125,7 +133,7 @@ void *kmalloc(void *_km, size_t n_bytes)
if (n_bytes == 0) return 0;
if (km == NULL) return malloc(n_bytes);
n_units = (n_bytes + sizeof(size_t) + sizeof(header_t) - 1) / sizeof(header_t) + 1;
n_units = (n_bytes + sizeof(size_t) + sizeof(header_t) - 1) / sizeof(header_t); /* header+n_bytes requires at least this number of units */
if (!(q = km->loop_head)) /* the first time when kmalloc() is called, intialize it */
q = km->loop_head = km->base.ptr = &km->base;
@@ -160,22 +168,32 @@ void *kcalloc(void *_km, size_t count, size_t size)
void *krealloc(void *_km, void *ap, size_t n_bytes) // TODO: this can be made more efficient in principle
{
kmem_t *km = (kmem_t*)_km;
size_t n_units, *p, *q;
size_t cap, *p, *q;
if (n_bytes == 0) {
kfree(km, ap); return 0;
}
if (km == NULL) return realloc(ap, n_bytes);
if (ap == NULL) return kmalloc(km, n_bytes);
n_units = (n_bytes + sizeof(size_t) + sizeof(header_t) - 1) / sizeof(header_t);
p = (size_t*)ap - 1;
if (*p >= n_units) return ap; /* TODO: this prevents shrinking */
cap = (*p) * sizeof(header_t) - sizeof(size_t);
if (cap >= n_bytes) return ap; /* TODO: this prevents shrinking */
q = (size_t*)kmalloc(km, n_bytes);
memcpy(q, ap, (*p - 1) * sizeof(header_t));
memcpy(q, ap, cap);
kfree(km, ap);
return q;
}
void *krelocate(void *km, void *ap, size_t n_bytes)
{
void *p;
if (km == 0 || ap == 0) return ap;
p = kmalloc(km, n_bytes);
memcpy(p, ap, n_bytes);
kfree(km, ap);
return p;
}
void km_stat(const void *_km, km_stat_t *s)
{
kmem_t *km = (kmem_t*)_km;
@@ -196,3 +214,11 @@ void km_stat(const void *_km, km_stat_t *s)
s->largest = s->largest > size? s->largest : size;
}
}
void km_stat_print(const void *km)
{
km_stat_t st;
km_stat(km, &st);
fprintf(stderr, "[km_stat] cap=%ld, avail=%ld, largest=%ld, n_core=%ld, n_block=%ld\n",
st.capacity, st.available, st.largest, st.n_blocks, st.n_cores);
}
+68
View File
@@ -13,15 +13,83 @@ typedef struct {
void *kmalloc(void *km, size_t size);
void *krealloc(void *km, void *ptr, size_t size);
void *krelocate(void *km, void *ap, size_t n_bytes);
void *kcalloc(void *km, size_t count, size_t size);
void kfree(void *km, void *ptr);
void *km_init(void);
void *km_init2(void *km_par, size_t min_core_size);
void km_destroy(void *km);
void km_stat(const void *_km, km_stat_t *s);
void km_stat_print(const void *km);
#ifdef __cplusplus
}
#endif
#define Kmalloc(km, type, cnt) ((type*)kmalloc((km), (cnt) * sizeof(type)))
#define Kcalloc(km, type, cnt) ((type*)kcalloc((km), (cnt), sizeof(type)))
#define Krealloc(km, type, ptr, cnt) ((type*)krealloc((km), (ptr), (cnt) * sizeof(type)))
#define Kgrow(km, type, ptr, __i, __m) do { \
if ((__i) >= (__m)) { \
(__m) = (__i) + 1; \
(__m) += ((__m)>>1) + 16; \
(ptr) = Krealloc(km, type, ptr, (__m)); \
} \
} while (0)
#define Kexpand(km, type, a, m) do { \
(m) = (m) >= 4? (m) + ((m)>>1) : 16; \
(a) = Krealloc(km, type, (a), (m)); \
} while (0)
#define KMALLOC(km, ptr, len) ((ptr) = (__typeof__(ptr))kmalloc((km), (len) * sizeof(*(ptr))))
#define KCALLOC(km, ptr, len) ((ptr) = (__typeof__(ptr))kcalloc((km), (len), sizeof(*(ptr))))
#define KREALLOC(km, ptr, len) ((ptr) = (__typeof__(ptr))krealloc((km), (ptr), (len) * sizeof(*(ptr))))
#define KEXPAND(km, a, m) do { \
(m) = (m) >= 4? (m) + ((m)>>1) : 16; \
KREALLOC((km), (a), (m)); \
} while (0)
#ifndef klib_unused
#if (defined __clang__ && __clang_major__ >= 3) || (defined __GNUC__ && __GNUC__ >= 3)
#define klib_unused __attribute__ ((__unused__))
#else
#define klib_unused
#endif
#endif /* klib_unused */
#define KALLOC_POOL_INIT2(SCOPE, name, kmptype_t) \
typedef struct { \
size_t cnt, n, max; \
kmptype_t **buf; \
void *km; \
} kmp_##name##_t; \
SCOPE kmp_##name##_t *kmp_init_##name(void *km) { \
kmp_##name##_t *mp; \
mp = Kcalloc(km, kmp_##name##_t, 1); \
mp->km = km; \
return mp; \
} \
SCOPE void kmp_destroy_##name(kmp_##name##_t *mp) { \
size_t k; \
for (k = 0; k < mp->n; ++k) kfree(mp->km, mp->buf[k]); \
kfree(mp->km, mp->buf); kfree(mp->km, mp); \
} \
SCOPE kmptype_t *kmp_alloc_##name(kmp_##name##_t *mp) { \
++mp->cnt; \
if (mp->n == 0) return (kmptype_t*)kcalloc(mp->km, 1, sizeof(kmptype_t)); \
return mp->buf[--mp->n]; \
} \
SCOPE void kmp_free_##name(kmp_##name##_t *mp, kmptype_t *p) { \
--mp->cnt; \
if (mp->n == mp->max) Kexpand(mp->km, kmptype_t*, mp->buf, mp->max); \
mp->buf[mp->n++] = p; \
}
#define KALLOC_POOL_INIT(name, kmptype_t) \
KALLOC_POOL_INIT2(static inline klib_unused, name, kmptype_t)
#endif
+120
View File
@@ -0,0 +1,120 @@
#ifndef KETOPT_H
#define KETOPT_H
#include <string.h> /* for strchr() and strncmp() */
#define ko_no_argument 0
#define ko_required_argument 1
#define ko_optional_argument 2
typedef struct {
int ind; /* equivalent to optind */
int opt; /* equivalent to optopt */
char *arg; /* equivalent to optarg */
int longidx; /* index of a long option; or -1 if short */
/* private variables not intended for external uses */
int i, pos, n_args;
} ketopt_t;
typedef struct {
char *name;
int has_arg;
int val;
} ko_longopt_t;
static ketopt_t KETOPT_INIT = { 1, 0, 0, -1, 1, 0, 0 };
static void ketopt_permute(char *argv[], int j, int n) /* move argv[j] over n elements to the left */
{
int k;
char *p = argv[j];
for (k = 0; k < n; ++k)
argv[j - k] = argv[j - k - 1];
argv[j - k] = p;
}
/**
* Parse command-line options and arguments
*
* This fuction has a similar interface to GNU's getopt_long(). Each call
* parses one option and returns the option name. s->arg points to the option
* argument if present. The function returns -1 when all command-line arguments
* are parsed. In this case, s->ind is the index of the first non-option
* argument.
*
* @param s status; shall be initialized to KETOPT_INIT on the first call
* @param argc length of argv[]
* @param argv list of command-line arguments; argv[0] is ignored
* @param permute non-zero to move options ahead of non-option arguments
* @param ostr option string
* @param longopts long options
*
* @return ASCII for a short option; ko_longopt_t::val for a long option; -1 if
* argv[] is fully processed; '?' for an unknown option or an ambiguous
* long option; ':' if an option argument is missing
*/
static int ketopt(ketopt_t *s, int argc, char *argv[], int permute, const char *ostr, const ko_longopt_t *longopts)
{
int opt = -1, i0, j;
if (permute) {
while (s->i < argc && (argv[s->i][0] != '-' || argv[s->i][1] == '\0'))
++s->i, ++s->n_args;
}
s->arg = 0, s->longidx = -1, i0 = s->i;
if (s->i >= argc || argv[s->i][0] != '-' || argv[s->i][1] == '\0') {
s->ind = s->i - s->n_args;
return -1;
}
if (argv[s->i][0] == '-' && argv[s->i][1] == '-') { /* "--" or a long option */
if (argv[s->i][2] == '\0') { /* a bare "--" */
ketopt_permute(argv, s->i, s->n_args);
++s->i, s->ind = s->i - s->n_args;
return -1;
}
s->opt = 0, opt = '?', s->pos = -1;
if (longopts) { /* parse long options */
int k, n_exact = 0, n_partial = 0;
const ko_longopt_t *o = 0, *o_exact = 0, *o_partial = 0;
for (j = 2; argv[s->i][j] != '\0' && argv[s->i][j] != '='; ++j) {} /* find the end of the option name */
for (k = 0; longopts[k].name != 0; ++k)
if (strncmp(&argv[s->i][2], longopts[k].name, j - 2) == 0) {
if (longopts[k].name[j - 2] == 0) ++n_exact, o_exact = &longopts[k];
else ++n_partial, o_partial = &longopts[k];
}
if (n_exact > 1 || (n_exact == 0 && n_partial > 1)) return '?';
o = n_exact == 1? o_exact : n_partial == 1? o_partial : 0;
if (o) {
s->opt = opt = o->val, s->longidx = o - longopts;
if (argv[s->i][j] == '=') s->arg = &argv[s->i][j + 1];
if (o->has_arg == 1 && argv[s->i][j] == '\0') {
if (s->i < argc - 1) s->arg = argv[++s->i];
else opt = ':'; /* missing option argument */
}
}
}
} else { /* a short option */
char *p;
if (s->pos == 0) s->pos = 1;
opt = s->opt = argv[s->i][s->pos++];
p = strchr((char*)ostr, opt);
if (p == 0) {
opt = '?'; /* unknown option */
} else if (p[1] == ':') {
if (argv[s->i][s->pos] == 0) {
if (s->i < argc - 1) s->arg = argv[++s->i];
else opt = ':'; /* missing option argument */
} else s->arg = &argv[s->i][s->pos];
s->pos = -1;
}
}
if (s->pos < 0 || argv[s->i][s->pos] == 0) {
++s->i, s->pos = 0;
if (s->n_args > 0) /* permute */
for (j = i0; j < s->i; ++j)
ketopt_permute(argv, j, s->n_args);
}
s->ind = s->i - s->n_args;
return opt;
}
#endif
+474
View File
@@ -0,0 +1,474 @@
/* The MIT License
Copyright (c) 2019 by Attractive Chaos <attractor@live.co.uk>
Permission is hereby granted, free of charge, to any person obtaining
a copy of this software and associated documentation files (the
"Software"), to deal in the Software without restriction, including
without limitation the rights to use, copy, modify, merge, publish,
distribute, sublicense, and/or sell copies of the Software, and to
permit persons to whom the Software is furnished to do so, subject to
the following conditions:
The above copyright notice and this permission notice shall be
included in all copies or substantial portions of the Software.
THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND,
EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF
MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND
NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS
BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN
ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN
CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
SOFTWARE.
*/
/* An example:
#include <stdio.h>
#include <string.h>
#include <stdlib.h>
#include "krmq.h"
struct my_node {
char key;
KRMQ_HEAD(struct my_node) head;
};
#define my_cmp(p, q) (((q)->key < (p)->key) - ((p)->key < (q)->key))
KRMQ_INIT(my, struct my_node, head, my_cmp)
int main(void) {
const char *str = "MNOLKQOPHIA"; // from wiki, except a duplicate
struct my_node *root = 0;
int i, l = strlen(str);
for (i = 0; i < l; ++i) { // insert in the input order
struct my_node *q, *p = malloc(sizeof(*p));
p->key = str[i];
q = krmq_insert(my, &root, p, 0);
if (p != q) free(p); // if already present, free
}
krmq_itr_t(my) itr;
krmq_itr_first(my, root, &itr); // place at first
do { // traverse
const struct my_node *p = krmq_at(&itr);
putchar(p->key);
free((void*)p); // free node
} while (krmq_itr_next(my, &itr));
putchar('\n');
return 0;
}
*/
#ifndef KRMQ_H
#define KRMQ_H
#ifdef __STRICT_ANSI__
#define inline __inline__
#endif
#define KRMQ_MAX_DEPTH 64
#define krmq_size(head, p) ((p)? (p)->head.size : 0)
#define krmq_size_child(head, q, i) ((q)->head.p[(i)]? (q)->head.p[(i)]->head.size : 0)
#define KRMQ_HEAD(__type) \
struct { \
__type *p[2], *s; \
signed char balance; /* balance factor */ \
unsigned size; /* #elements in subtree */ \
}
#define __KRMQ_FIND(suf, __scope, __type, __head, __cmp) \
__scope __type *krmq_find_##suf(const __type *root, const __type *x, unsigned *cnt_) { \
const __type *p = root; \
unsigned cnt = 0; \
while (p != 0) { \
int cmp; \
cmp = __cmp(x, p); \
if (cmp >= 0) cnt += krmq_size_child(__head, p, 0) + 1; \
if (cmp < 0) p = p->__head.p[0]; \
else if (cmp > 0) p = p->__head.p[1]; \
else break; \
} \
if (cnt_) *cnt_ = cnt; \
return (__type*)p; \
} \
__scope __type *krmq_interval_##suf(const __type *root, const __type *x, __type **lower, __type **upper) { \
const __type *p = root, *l = 0, *u = 0; \
while (p != 0) { \
int cmp; \
cmp = __cmp(x, p); \
if (cmp < 0) u = p, p = p->__head.p[0]; \
else if (cmp > 0) l = p, p = p->__head.p[1]; \
else { l = u = p; break; } \
} \
if (lower) *lower = (__type*)l; \
if (upper) *upper = (__type*)u; \
return (__type*)p; \
}
#define __KRMQ_RMQ(suf, __scope, __type, __head, __cmp, __lt2) \
__scope __type *krmq_rmq_##suf(const __type *root, const __type *lo, const __type *up) { /* CLOSED interval */ \
const __type *p = root, *path[2][KRMQ_MAX_DEPTH], *min; \
int plen[2] = {0, 0}, pcmp[2][KRMQ_MAX_DEPTH], i, cmp, lca; \
if (root == 0) return 0; \
while (p) { \
cmp = __cmp(lo, p); \
path[0][plen[0]] = p, pcmp[0][plen[0]++] = cmp; \
if (cmp < 0) p = p->__head.p[0]; \
else if (cmp > 0) p = p->__head.p[1]; \
else break; \
} \
p = root; \
while (p) { \
cmp = __cmp(up, p); \
path[1][plen[1]] = p, pcmp[1][plen[1]++] = cmp; \
if (cmp < 0) p = p->__head.p[0]; \
else if (cmp > 0) p = p->__head.p[1]; \
else break; \
} \
for (i = 0; i < plen[0] && i < plen[1]; ++i) /* find the LCA */ \
if (path[0][i] == path[1][i] && pcmp[0][i] <= 0 && pcmp[1][i] >= 0) \
break; \
if (i == plen[0] || i == plen[1]) return 0; /* no elements in the closed interval */ \
lca = i, min = path[0][lca]; \
for (i = lca + 1; i < plen[0]; ++i) { \
if (pcmp[0][i] <= 0) { \
if (__lt2(path[0][i], min)) min = path[0][i]; \
if (path[0][i]->__head.p[1] && __lt2(path[0][i]->__head.p[1]->__head.s, min)) \
min = path[0][i]->__head.p[1]->__head.s; \
} \
} \
for (i = lca + 1; i < plen[1]; ++i) { \
if (pcmp[1][i] >= 0) { \
if (__lt2(path[1][i], min)) min = path[1][i]; \
if (path[1][i]->__head.p[0] && __lt2(path[1][i]->__head.p[0]->__head.s, min)) \
min = path[1][i]->__head.p[0]->__head.s; \
} \
} \
return (__type*)min; \
}
#define __KRMQ_ROTATE(suf, __type, __head, __lt2) \
/* */ \
static inline void krmq_update_min_##suf(__type *p, const __type *q, const __type *r) { \
p->__head.s = !q || __lt2(p, q->__head.s)? p : q->__head.s; \
p->__head.s = !r || __lt2(p->__head.s, r->__head.s)? p->__head.s : r->__head.s; \
} \
/* one rotation: (a,(b,c)q)p => ((a,b)p,c)q */ \
static inline __type *krmq_rotate1_##suf(__type *p, int dir) { /* dir=0 to left; dir=1 to right */ \
int opp = 1 - dir; /* opposite direction */ \
__type *q = p->__head.p[opp], *s = p->__head.s; \
unsigned size_p = p->__head.size; \
p->__head.size -= q->__head.size - krmq_size_child(__head, q, dir); \
q->__head.size = size_p; \
krmq_update_min_##suf(p, p->__head.p[dir], q->__head.p[dir]); \
q->__head.s = s; \
p->__head.p[opp] = q->__head.p[dir]; \
q->__head.p[dir] = p; \
return q; \
} \
/* two consecutive rotations: (a,((b,c)r,d)q)p => ((a,b)p,(c,d)q)r */ \
static inline __type *krmq_rotate2_##suf(__type *p, int dir) { \
int b1, opp = 1 - dir; \
__type *q = p->__head.p[opp], *r = q->__head.p[dir], *s = p->__head.s; \
unsigned size_x_dir = krmq_size_child(__head, r, dir); \
r->__head.size = p->__head.size; \
p->__head.size -= q->__head.size - size_x_dir; \
q->__head.size -= size_x_dir + 1; \
krmq_update_min_##suf(p, p->__head.p[dir], r->__head.p[dir]); \
krmq_update_min_##suf(q, q->__head.p[opp], r->__head.p[opp]); \
r->__head.s = s; \
p->__head.p[opp] = r->__head.p[dir]; \
r->__head.p[dir] = p; \
q->__head.p[dir] = r->__head.p[opp]; \
r->__head.p[opp] = q; \
b1 = dir == 0? +1 : -1; \
if (r->__head.balance == b1) q->__head.balance = 0, p->__head.balance = -b1; \
else if (r->__head.balance == 0) q->__head.balance = p->__head.balance = 0; \
else q->__head.balance = b1, p->__head.balance = 0; \
r->__head.balance = 0; \
return r; \
}
#define __KRMQ_INSERT(suf, __scope, __type, __head, __cmp, __lt2) \
__scope __type *krmq_insert_##suf(__type **root_, __type *x, unsigned *cnt_) { \
unsigned char stack[KRMQ_MAX_DEPTH]; \
__type *path[KRMQ_MAX_DEPTH]; \
__type *bp, *bq; \
__type *p, *q, *r = 0; /* _r_ is potentially the new root */ \
int i, which = 0, top, b1, path_len; \
unsigned cnt = 0; \
bp = *root_, bq = 0; \
/* find the insertion location */ \
for (p = bp, q = bq, top = path_len = 0; p; q = p, p = p->__head.p[which]) { \
int cmp; \
cmp = __cmp(x, p); \
if (cmp >= 0) cnt += krmq_size_child(__head, p, 0) + 1; \
if (cmp == 0) { \
if (cnt_) *cnt_ = cnt; \
return p; \
} \
if (p->__head.balance != 0) \
bq = q, bp = p, top = 0; \
stack[top++] = which = (cmp > 0); \
path[path_len++] = p; \
} \
if (cnt_) *cnt_ = cnt; \
x->__head.balance = 0, x->__head.size = 1, x->__head.p[0] = x->__head.p[1] = 0, x->__head.s = x; \
if (q == 0) *root_ = x; \
else q->__head.p[which] = x; \
if (bp == 0) return x; \
for (i = 0; i < path_len; ++i) ++path[i]->__head.size; \
for (i = path_len - 1; i >= 0; --i) { \
krmq_update_min_##suf(path[i], path[i]->__head.p[0], path[i]->__head.p[1]); \
if (path[i]->__head.s != x) break; \
} \
for (p = bp, top = 0; p != x; p = p->__head.p[stack[top]], ++top) /* update balance factors */ \
if (stack[top] == 0) --p->__head.balance; \
else ++p->__head.balance; \
if (bp->__head.balance > -2 && bp->__head.balance < 2) return x; /* no re-balance needed */ \
/* re-balance */ \
which = (bp->__head.balance < 0); \
b1 = which == 0? +1 : -1; \
q = bp->__head.p[1 - which]; \
if (q->__head.balance == b1) { \
r = krmq_rotate1_##suf(bp, which); \
q->__head.balance = bp->__head.balance = 0; \
} else r = krmq_rotate2_##suf(bp, which); \
if (bq == 0) *root_ = r; \
else bq->__head.p[bp != bq->__head.p[0]] = r; \
return x; \
}
#define __KRMQ_ERASE(suf, __scope, __type, __head, __cmp, __lt2) \
__scope __type *krmq_erase_##suf(__type **root_, const __type *x, unsigned *cnt_) { \
__type *p, *path[KRMQ_MAX_DEPTH], fake; \
unsigned char dir[KRMQ_MAX_DEPTH]; \
int i, d = 0, cmp; \
unsigned cnt = 0; \
fake = **root_, fake.__head.p[0] = *root_, fake.__head.p[1] = 0; \
if (cnt_) *cnt_ = 0; \
if (x) { \
for (cmp = -1, p = &fake; cmp; cmp = __cmp(x, p)) { \
int which = (cmp > 0); \
if (cmp > 0) cnt += krmq_size_child(__head, p, 0) + 1; \
dir[d] = which; \
path[d++] = p; \
p = p->__head.p[which]; \
if (p == 0) { \
if (cnt_) *cnt_ = 0; \
return 0; \
} \
} \
cnt += krmq_size_child(__head, p, 0) + 1; /* because p==x is not counted */ \
} else { \
for (p = &fake, cnt = 1; p; p = p->__head.p[0]) \
dir[d] = 0, path[d++] = p; \
p = path[--d]; \
} \
if (cnt_) *cnt_ = cnt; \
for (i = 1; i < d; ++i) --path[i]->__head.size; \
if (p->__head.p[1] == 0) { /* ((1,.)2,3)4 => (1,3)4; p=2 */ \
path[d-1]->__head.p[dir[d-1]] = p->__head.p[0]; \
} else { \
__type *q = p->__head.p[1]; \
if (q->__head.p[0] == 0) { /* ((1,2)3,4)5 => ((1)2,4)5; p=3,q=2 */ \
q->__head.p[0] = p->__head.p[0]; \
q->__head.balance = p->__head.balance; \
path[d-1]->__head.p[dir[d-1]] = q; \
path[d] = q, dir[d++] = 1; \
q->__head.size = p->__head.size - 1; \
} else { /* ((1,((.,2)3,4)5)6,7)8 => ((1,(2,4)5)3,7)8; p=6 */ \
__type *r; \
int e = d++; /* backup _d_ */\
for (;;) { \
dir[d] = 0; \
path[d++] = q; \
r = q->__head.p[0]; \
if (r->__head.p[0] == 0) break; \
q = r; \
} \
r->__head.p[0] = p->__head.p[0]; \
q->__head.p[0] = r->__head.p[1]; \
r->__head.p[1] = p->__head.p[1]; \
r->__head.balance = p->__head.balance; \
path[e-1]->__head.p[dir[e-1]] = r; \
path[e] = r, dir[e] = 1; \
for (i = e + 1; i < d; ++i) --path[i]->__head.size; \
r->__head.size = p->__head.size - 1; \
} \
} \
for (i = d - 1; i >= 0; --i) /* not sure why adding condition "path[i]->__head.s==p" doesn't work */ \
krmq_update_min_##suf(path[i], path[i]->__head.p[0], path[i]->__head.p[1]); \
while (--d > 0) { \
__type *q = path[d]; \
int which, other, b1 = 1, b2 = 2; \
which = dir[d], other = 1 - which; \
if (which) b1 = -b1, b2 = -b2; \
q->__head.balance += b1; \
if (q->__head.balance == b1) break; \
else if (q->__head.balance == b2) { \
__type *r = q->__head.p[other]; \
if (r->__head.balance == -b1) { \
path[d-1]->__head.p[dir[d-1]] = krmq_rotate2_##suf(q, which); \
} else { \
path[d-1]->__head.p[dir[d-1]] = krmq_rotate1_##suf(q, which); \
if (r->__head.balance == 0) { \
r->__head.balance = -b1; \
q->__head.balance = b1; \
break; \
} else r->__head.balance = q->__head.balance = 0; \
} \
} \
} \
*root_ = fake.__head.p[0]; \
return p; \
}
#define krmq_free(__type, __head, __root, __free) do { \
__type *_p, *_q; \
for (_p = __root; _p; _p = _q) { \
if (_p->__head.p[0] == 0) { \
_q = _p->__head.p[1]; \
__free(_p); \
} else { \
_q = _p->__head.p[0]; \
_p->__head.p[0] = _q->__head.p[1]; \
_q->__head.p[1] = _p; \
} \
} \
} while (0)
#define __KRMQ_ITR(suf, __scope, __type, __head, __cmp) \
struct krmq_itr_##suf { \
const __type *stack[KRMQ_MAX_DEPTH], **top; \
}; \
__scope void krmq_itr_first_##suf(const __type *root, struct krmq_itr_##suf *itr) { \
const __type *p; \
for (itr->top = itr->stack - 1, p = root; p; p = p->__head.p[0]) \
*++itr->top = p; \
} \
__scope int krmq_itr_find_##suf(const __type *root, const __type *x, struct krmq_itr_##suf *itr) { \
const __type *p = root; \
itr->top = itr->stack - 1; \
while (p != 0) { \
int cmp; \
*++itr->top = p; \
cmp = __cmp(x, p); \
if (cmp < 0) p = p->__head.p[0]; \
else if (cmp > 0) p = p->__head.p[1]; \
else break; \
} \
return p? 1 : 0; \
} \
__scope int krmq_itr_next_bidir_##suf(struct krmq_itr_##suf *itr, int dir) { \
const __type *p; \
if (itr->top < itr->stack) return 0; \
dir = !!dir; \
p = (*itr->top)->__head.p[dir]; \
if (p) { /* go down */ \
for (; p; p = p->__head.p[!dir]) \
*++itr->top = p; \
return 1; \
} else { /* go up */ \
do { \
p = *itr->top--; \
} while (itr->top >= itr->stack && p == (*itr->top)->__head.p[dir]); \
return itr->top < itr->stack? 0 : 1; \
} \
} \
/**
* Insert a node to the tree
*
* @param suf name suffix used in KRMQ_INIT()
* @param proot pointer to the root of the tree (in/out: root may change)
* @param x node to insert (in)
* @param cnt number of nodes smaller than or equal to _x_; can be NULL (out)
*
* @return _x_ if not present in the tree, or the node equal to x.
*/
#define krmq_insert(suf, proot, x, cnt) krmq_insert_##suf(proot, x, cnt)
/**
* Find a node in the tree
*
* @param suf name suffix used in KRMQ_INIT()
* @param root root of the tree
* @param x node value to find (in)
* @param cnt number of nodes smaller than or equal to _x_; can be NULL (out)
*
* @return node equal to _x_ if present, or NULL if absent
*/
#define krmq_find(suf, root, x, cnt) krmq_find_##suf(root, x, cnt)
#define krmq_interval(suf, root, x, lower, upper) krmq_interval_##suf(root, x, lower, upper)
#define krmq_rmq(suf, root, lo, up) krmq_rmq_##suf(root, lo, up)
/**
* Delete a node from the tree
*
* @param suf name suffix used in KRMQ_INIT()
* @param proot pointer to the root of the tree (in/out: root may change)
* @param x node value to delete; if NULL, delete the first node (in)
*
* @return node removed from the tree if present, or NULL if absent
*/
#define krmq_erase(suf, proot, x, cnt) krmq_erase_##suf(proot, x, cnt)
#define krmq_erase_first(suf, proot) krmq_erase_##suf(proot, 0, 0)
#define krmq_itr_t(suf) struct krmq_itr_##suf
/**
* Place the iterator at the smallest object
*
* @param suf name suffix used in KRMQ_INIT()
* @param root root of the tree
* @param itr iterator
*/
#define krmq_itr_first(suf, root, itr) krmq_itr_first_##suf(root, itr)
/**
* Place the iterator at the object equal to or greater than the query
*
* @param suf name suffix used in KRMQ_INIT()
* @param root root of the tree
* @param x query (in)
* @param itr iterator (out)
*
* @return 1 if find; 0 otherwise. krmq_at(itr) is NULL if and only if query is
* larger than all objects in the tree
*/
#define krmq_itr_find(suf, root, x, itr) krmq_itr_find_##suf(root, x, itr)
/**
* Move to the next object in order
*
* @param itr iterator (modified)
*
* @return 1 if there is a next object; 0 otherwise
*/
#define krmq_itr_next(suf, itr) krmq_itr_next_bidir_##suf(itr, 1)
#define krmq_itr_prev(suf, itr) krmq_itr_next_bidir_##suf(itr, 0)
/**
* Return the pointer at the iterator
*
* @param itr iterator
*
* @return pointer if present; NULL otherwise
*/
#define krmq_at(itr) ((itr)->top < (itr)->stack? 0 : *(itr)->top)
#define KRMQ_INIT2(suf, __scope, __type, __head, __cmp, __lt2) \
__KRMQ_FIND(suf, __scope, __type, __head, __cmp) \
__KRMQ_RMQ(suf, __scope, __type, __head, __cmp, __lt2) \
__KRMQ_ROTATE(suf, __type, __head, __lt2) \
__KRMQ_INSERT(suf, __scope, __type, __head, __cmp, __lt2) \
__KRMQ_ERASE(suf, __scope, __type, __head, __cmp, __lt2) \
__KRMQ_ITR(suf, __scope, __type, __head, __cmp)
#define KRMQ_INIT(suf, __type, __head, __cmp, __lt2) \
KRMQ_INIT2(suf,, __type, __head, __cmp, __lt2)
#endif
+10 -2
View File
@@ -37,6 +37,14 @@
#define KS_SEP_LINE 2 // line separator: "\n" (Unix) or "\r\n" (Windows)
#define KS_SEP_MAX 2
#ifndef klib_unused
#if (defined __clang__ && __clang_major__ >= 3) || (defined __GNUC__ && __GNUC__ >= 3)
#define klib_unused __attribute__ ((__unused__))
#else
#define klib_unused
#endif
#endif /* klib_unused */
#define __KS_TYPE(type_t) \
typedef struct __kstream_t { \
int begin, end; \
@@ -64,7 +72,7 @@
}
#define __KS_INLINED(__read) \
static inline int ks_getc(kstream_t *ks) \
static inline klib_unused int ks_getc(kstream_t *ks) \
{ \
if (ks->is_eof && ks->begin >= ks->end) return -1; \
if (ks->begin >= ks->end) { \
@@ -81,7 +89,7 @@
#ifndef KSTRING_T
#define KSTRING_T kstring_t
typedef struct __kstring_t {
unsigned l, m;
size_t l, m;
char *s;
} kstring_t;
#endif
+1 -1
View File
@@ -37,7 +37,7 @@ typedef struct {
int depth;
} ks_isort_stack_t;
#define KSORT_SWAP(type_t, a, b) { register type_t t=(a); (a)=(b); (b)=t; }
#define KSORT_SWAP(type_t, a, b) { type_t t=(a); (a)=(b); (b)=t; }
#define KSORT_INIT(name, type_t, __sort_lt) \
void ks_heapdown_##name(size_t i, size_t n, type_t l[]) \
+20 -9
View File
@@ -15,6 +15,17 @@
#define KSW_EZ_SPLICE_FOR 0x100
#define KSW_EZ_SPLICE_REV 0x200
#define KSW_EZ_SPLICE_FLANK 0x400
#define KSW_EZ_SPLICE_CMPLX 0x800 // use the miniprot splice model
#define KSW_EZ_SPLICE_SCORE 0x1000 // use splice score
// The subset of CIGAR operators used by ksw code.
// Use MM_CIGAR_* from minimap.h if you need the full list.
#define KSW_CIGAR_MATCH 0
#define KSW_CIGAR_INS 1
#define KSW_CIGAR_DEL 2
#define KSW_CIGAR_N_SKIP 3
#define KSW_SPSC_OFFSET 64
#ifdef __cplusplus
extern "C" {
@@ -61,7 +72,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
int8_t gapo, int8_t gape, int8_t gapo2, int8_t gape2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t gapo, int8_t gape, int8_t gapo2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez);
int8_t gapo, int8_t gape, int8_t gapo2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez);
void ksw_extf2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t mch, int8_t mis, int8_t e, int w, int xdrop, ksw_extz_t *ez);
@@ -127,23 +138,23 @@ static inline void ksw_backtrack(void *km, int is_rot, int is_rev, int min_intro
r = i + j;
if (i < off[r]) force_state = 2;
if (off_end && i > off_end[r]) force_state = 1;
tmp = force_state < 0? p[r * n_col + i - off[r]] : 0;
tmp = force_state < 0? p[(size_t)r * n_col + i - off[r]] : 0;
} else {
if (j < off[i]) force_state = 2;
if (off_end && j > off_end[i]) force_state = 1;
tmp = force_state < 0? p[i * n_col + j - off[i]] : 0;
tmp = force_state < 0? p[(size_t)i * n_col + j - off[i]] : 0;
}
if (state == 0) state = tmp & 7; // if requesting the H state, find state one maximizes it.
else if (!(tmp >> (state + 2) & 1)) state = 0; // if requesting other states, _state_ stays the same if it is a continuation; otherwise, set to H
if (state == 0) state = tmp & 7; // TODO: probably this line can be merged into the "else if" line right above; not 100% sure
if (force_state >= 0) state = force_state;
if (state == 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 0, 1), --i, --j; // match
else if (state == 1 || (state == 3 && min_intron_len <= 0)) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 2, 1), --i; // deletion
else if (state == 3 && min_intron_len > 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 3, 1), --i; // intron
else cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 1, 1), --j; // insertion
if (state == 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, KSW_CIGAR_MATCH, 1), --i, --j;
else if (state == 1 || (state == 3 && min_intron_len <= 0)) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, KSW_CIGAR_DEL, 1), --i;
else if (state == 3 && min_intron_len > 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, KSW_CIGAR_N_SKIP, 1), --i;
else cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, KSW_CIGAR_INS, 1), --j;
}
if (i >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, min_intron_len > 0 && i >= min_intron_len? 3 : 2, i + 1); // first deletion
if (j >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, 1, j + 1); // first insertion
if (i >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, min_intron_len > 0 && i >= min_intron_len? KSW_CIGAR_N_SKIP : KSW_CIGAR_DEL, i + 1); // first deletion
if (j >= 0) cigar = ksw_push_cigar(km, &n_cigar, &m_cigar, cigar, KSW_CIGAR_INS, j + 1); // first insertion
if (!is_rev)
for (i = 0; i < n_cigar>>1; ++i) // reverse CIGAR
tmp = cigar[i], cigar[i] = cigar[n_cigar-1-i], cigar[n_cigar-1-i] = tmp;
+19 -20
View File
@@ -17,18 +17,20 @@
void __cpuidex(int cpuid[4], int func_id, int subfunc_id)
{
#if defined(__x86_64__)
asm volatile ("cpuid"
__asm__ volatile ("cpuid"
: "=a" (cpuid[0]), "=b" (cpuid[1]), "=c" (cpuid[2]), "=d" (cpuid[3])
: "0" (func_id), "2" (subfunc_id));
#else // on 32bit, ebx can NOT be used as PIC code
asm volatile ("xchgl %%ebx, %1; cpuid; xchgl %%ebx, %1"
__asm__ volatile ("xchgl %%ebx, %1; cpuid; xchgl %%ebx, %1"
: "=a" (cpuid[0]), "=r" (cpuid[1]), "=c" (cpuid[2]), "=d" (cpuid[3])
: "0" (func_id), "2" (subfunc_id));
#endif
}
#endif
int x86_simd(void)
static int ksw_simd = -1;
static int x86_simd(void)
{
int flag = 0, cpuid[4], max_id;
__cpuidex(cpuid, 0, 0);
@@ -54,11 +56,10 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
{
extern void ksw_extz2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
extern void ksw_extz2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat, int8_t q, int8_t e, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
unsigned simd;
simd = x86_simd();
if (simd & SIMD_SSE4_1)
if (ksw_simd < 0) ksw_simd = x86_simd();
if (ksw_simd & SIMD_SSE4_1)
ksw_extz2_sse41(km, qlen, query, tlen, target, m, mat, q, e, w, zdrop, end_bonus, flag, ez);
else if (simd & SIMD_SSE2)
else if (ksw_simd & SIMD_SSE2)
ksw_extz2_sse2(km, qlen, query, tlen, target, m, mat, q, e, w, zdrop, end_bonus, flag, ez);
else abort();
}
@@ -70,28 +71,26 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
extern void ksw_extd2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t e2, int w, int zdrop, int end_bonus, int flag, ksw_extz_t *ez);
unsigned simd;
simd = x86_simd();
if (simd & SIMD_SSE4_1)
if (ksw_simd < 0) ksw_simd = x86_simd();
if (ksw_simd & SIMD_SSE4_1)
ksw_extd2_sse41(km, qlen, query, tlen, target, m, mat, q, e, q2, e2, w, zdrop, end_bonus, flag, ez);
else if (simd & SIMD_SSE2)
else if (ksw_simd & SIMD_SSE2)
ksw_extd2_sse2(km, qlen, query, tlen, target, m, mat, q, e, q2, e2, w, zdrop, end_bonus, flag, ez);
else abort();
}
void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez)
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez)
{
extern void ksw_exts2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez);
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez);
extern void ksw_exts2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez);
unsigned simd;
simd = x86_simd();
if (simd & SIMD_SSE4_1)
ksw_exts2_sse41(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, flag, ez);
else if (simd & SIMD_SSE2)
ksw_exts2_sse2(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, flag, ez);
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez);
if (ksw_simd < 0) ksw_simd = x86_simd();
if (ksw_simd & SIMD_SSE4_1)
ksw_exts2_sse41(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, end_bonus, junc_bonus, junc_pen, flag, junc, ez);
else if (ksw_simd & SIMD_SSE2)
ksw_exts2_sse2(km, qlen, query, tlen, target, m, mat, q, e, q2, noncan, zdrop, end_bonus, junc_bonus, junc_pen, flag, junc, ez);
else abort();
}
#endif
+14 -6
View File
@@ -4,15 +4,23 @@
#include "ksw2.h"
#ifdef __SSE2__
#ifdef USE_SIMDE
#include <simde/x86/sse2.h>
#else
#include <emmintrin.h>
#endif
#ifdef KSW_SSE2_ONLY
#undef __SSE4_1__
#endif
#ifdef __SSE4_1__
#ifdef USE_SIMDE
#include <simde/x86/sse4.1.h>
#else
#include <smmintrin.h>
#endif
#endif
#ifdef KSW_CPU_DISPATCH
#ifdef __SSE4_1__
@@ -76,7 +84,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
qe2_ = _mm_set1_epi8(q2 + e2);
sc_mch_ = _mm_set1_epi8(mat[0]);
sc_mis_ = _mm_set1_epi8(mat[1]);
sc_N_ = _mm_set1_epi8(-e2);
sc_N_ = mat[m*m-1] == 0? _mm_set1_epi8(-e2) : _mm_set1_epi8(mat[m*m-1]);
m1_ = _mm_set1_epi8(m - 1); // wildcard
if (w < 0) w = tlen > qlen? tlen : qlen;
@@ -111,7 +119,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
for (t = 0; t < tlen_ * 16; ++t) H[t] = KSW_NEG_INF;
}
if (with_cigar) {
mem2 = (uint8_t*)kmalloc(km, ((qlen + tlen - 1) * n_col_ + 1) * 16);
mem2 = (uint8_t*)kmalloc(km, ((size_t)(qlen + tlen - 1) * n_col_ + 1) * 16);
p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4);
off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int) * 2);
off_end = off + qlen + tlen - 1;
@@ -218,7 +226,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
#endif
}
} else if (!(flag&KSW_EZ_RIGHT)) { // gap left-alignment
__m128i *pr = p + r * n_col_ - st_;
__m128i *pr = p + (size_t)r * n_col_ - st_;
off[r] = st, off_end[r] = en;
for (t = st_; t <= en_; ++t) {
__m128i d, z, a, b, a2, b2, xt1, x2t1, vt1, ut, tmp;
@@ -265,7 +273,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
_mm_store_si128(&pr[t], d);
}
} else { // gap right-alignment
__m128i *pr = p + r * n_col_ - st_;
__m128i *pr = p + (size_t)r * n_col_ - st_;
off[r] = st, off_end[r] = en;
for (t = st_; t <= en_; ++t) {
__m128i d, z, a, b, a2, b2, xt1, x2t1, vt1, ut, tmp;
@@ -350,7 +358,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
} else H[0] = v8[0] - qe, max_H = H[0], max_t = 0; // special casing r==0
// update ez
if (en0 == tlen - 1 && H[en0] > ez->mte)
ez->mte = H[en0], ez->mte_q = r - en;
ez->mte = H[en0], ez->mte_q = r - en0;
if (r - st0 == qlen - 1 && H[st0] > ez->mqe)
ez->mqe = H[st0], ez->mqe_t = st0;
if (ksw_apply_zdrop(ez, 1, max_H, r, max_t, zdrop, e2)) break;
@@ -382,7 +390,7 @@ void ksw_extd2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY)) {
ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
} else if (!ez->zdropped && (flag&KSW_EZ_EXTZ_ONLY) && ez->mqe + end_bonus > ez->max) {
} else if (!ez->zdropped && (flag&KSW_EZ_EXTZ_ONLY) && ez->mqe + end_bonus > (int)ez->max) {
ez->reach_end = 1;
ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, ez->mqe_t, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
} else if (ez->max_t >= 0 && ez->max_q >= 0) {
+112 -22
View File
@@ -4,27 +4,34 @@
#include "ksw2.h"
#ifdef __SSE2__
#ifdef USE_SIMDE
#include <simde/x86/sse2.h>
#else
#include <emmintrin.h>
#endif
#ifdef KSW_SSE2_ONLY
#undef __SSE4_1__
#endif
#ifdef __SSE4_1__
#ifdef USE_SIMDE
#include <simde/x86/sse4.1.h>
#else
#include <smmintrin.h>
#endif
#endif
#ifdef KSW_CPU_DISPATCH
#ifdef __SSE4_1__
void ksw_exts2_sse41(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez)
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez)
#else
void ksw_exts2_sse2(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez)
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez)
#endif
#else
void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uint8_t *target, int8_t m, const int8_t *mat,
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int flag, ksw_extz_t *ez)
int8_t q, int8_t e, int8_t q2, int8_t noncan, int zdrop, int end_bonus, int8_t junc_bonus, int8_t junc_pen, int flag, const uint8_t *junc, ksw_extz_t *ez)
#endif // ~KSW_CPU_DISPATCH
{
#define __dp_code_block1 \
@@ -64,6 +71,7 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
ksw_reset_extz(ez);
if (m <= 1 || qlen <= 0 || tlen <= 0 || q2 <= q + e) return;
assert((flag & KSW_EZ_SPLICE_FOR) == 0 || (flag & KSW_EZ_SPLICE_REV) == 0); // can't be both set
zero_ = _mm_set1_epi8(0);
q_ = _mm_set1_epi8(q);
@@ -71,7 +79,7 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
qe_ = _mm_set1_epi8(q + e);
sc_mch_ = _mm_set1_epi8(mat[0]);
sc_mis_ = _mm_set1_epi8(mat[1]);
sc_N_ = _mm_set1_epi8(-e);
sc_N_ = mat[m*m-1] == 0? _mm_set1_epi8(-e) : _mm_set1_epi8(mat[m*m-1]);
m1_ = _mm_set1_epi8(m - 1); // wildcard
tlen_ = (tlen + 15) / 16;
@@ -100,7 +108,7 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
for (t = 0; t < tlen_ * 16; ++t) H[t] = KSW_NEG_INF;
}
if (with_cigar) {
mem2 = (uint8_t*)kmalloc(km, ((qlen + tlen - 1) * n_col_ + 1) * 16);
mem2 = (uint8_t*)kmalloc(km, ((size_t)(qlen + tlen - 1) * n_col_ + 1) * 16);
p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4);
off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int) * 2);
off_end = off + qlen + tlen - 1;
@@ -111,22 +119,100 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
// set the donor and acceptor arrays. TODO: this assumes 0/1/2/3 encoding!
if (flag & (KSW_EZ_SPLICE_FOR|KSW_EZ_SPLICE_REV)) {
int semi_cost = flag&KSW_EZ_SPLICE_FLANK? -noncan/2 : 0; // GTr or yAG is worth 0.5 bit; see PMID:18688272
memset(donor, -noncan, tlen_ * 16);
const int sp0[4] = { 8, 15, 21, 30 };
int sp[4];
if (flag & KSW_EZ_SPLICE_CMPLX) {
for (t = 0; t < 4; ++t)
sp[t] = (int)((double)sp0[t] / 3. + .499);
} else {
sp[0] = flag&KSW_EZ_SPLICE_FLANK? noncan / 2 : 0;
sp[1] = sp[2] = sp[3] = noncan;
}
memset(donor, -sp[3], tlen_ * 16);
memset(acceptor, -sp[3], tlen_ * 16);
if (!(flag & KSW_EZ_REV_CIGAR)) {
for (t = 0; t < tlen - 4; ++t) {
int can_type = 0; // type of canonical site: 0=none, 1=GT/AG only, 2=GTr/yAG
if ((flag & KSW_EZ_SPLICE_FOR) && target[t+1] == 2 && target[t+2] == 3) can_type = 1; // GTr...
if ((flag & KSW_EZ_SPLICE_REV) && target[t+1] == 1 && target[t+2] == 3) can_type = 1; // CTr...
if (can_type && (target[t+3] == 0 || target[t+3] == 2)) can_type = 2;
if (can_type) ((int8_t*)donor)[t] = can_type == 2? 0 : semi_cost;
int z = 3;
if (flag & KSW_EZ_SPLICE_FOR) {
if (target[t+1] == 2 && target[t+2] == 3) // |GT.
z = target[t+3] == 0 || target[t+3] == 2? -1 : 0; // |GTr or not
else if (target[t+1] == 2 && target[t+2] == 1) z = 1; // |GC.
else if (target[t+1] == 0 && target[t+2] == 3) z = 2; // |AT.
} else if (flag & KSW_EZ_SPLICE_REV) {
if (target[t+1] == 1 && target[t+2] == 3) // |CT. (revcomp of .AG|)
z = target[t+3] == 0 || target[t+3] == 2? -1 : 0;
else if (target[t+1] == 2 && target[t+2] == 3) z = 2; // |GT. (revcomp of .AC|)
}
((int8_t*)donor)[t] = z < 0? 0 : -sp[z];
}
memset(acceptor, -noncan, tlen_ * 16);
for (t = 2; t < tlen; ++t) {
int can_type = 0;
if ((flag & KSW_EZ_SPLICE_FOR) && target[t-1] == 0 && target[t] == 2) can_type = 1; // ...yAG
if ((flag & KSW_EZ_SPLICE_REV) && target[t-1] == 0 && target[t] == 1) can_type = 1; // ...yAC
if (can_type && (target[t-2] == 1 || target[t-2] == 3)) can_type = 2;
if (can_type) ((int8_t*)acceptor)[t] = can_type == 2? 0 : semi_cost;
int z = 3;
if (flag & KSW_EZ_SPLICE_FOR) {
if (target[t-1] == 0 && target[t] == 2) // .AG|
z = target[t-2] == 1 || target[t-2] == 3? -1 : 0; // yAG| or not
else if (target[t-1] == 0 && target[t] == 1) z = 2; // .AC|
} else if (flag & KSW_EZ_SPLICE_REV) {
if (target[t-1] == 0 && target[t] == 1) // .AC| (revcomp of |GT.)
z = target[t-2] == 1 || target[t-2] == 3? -1 : 0; // yAC| or not
else if (target[t-1] == 2 && target[t] == 1) z = 1; // .GC| (revcomp of |GC.)
else if (target[t-1] == 0 && target[t] == 3) z = 2; // .AT| (revcomp of |AT.)
}
((int8_t*)acceptor)[t] = z < 0? 0 : -sp[z];
}
} else {
for (t = 0; t < tlen - 4; ++t) {
int z = 3;
if (flag & KSW_EZ_SPLICE_FOR) {
if (target[t+1] == 2 && target[t+2] == 0) // |GA. (rev of .AG|)
z = target[t+3] == 1 || target[t+3] == 3? -1 : 0;
else if (target[t+1] == 1 && target[t+2] == 0) z = 2; // |CA. (rev of .AC|)
} else if (flag & KSW_EZ_SPLICE_REV) {
if (target[t+1] == 1 && target[t+2] == 0) // |CA. (comp of |GT.)
z = target[t+3] == 1 || target[t+3] == 3? -1 : 0;
else if (target[t+1] == 1 && target[t+2] == 2) z = 1; // |CG. (comp of |GC.)
else if (target[t+1] == 3 && target[t+2] == 0) z = 2; // |TA. (comp of |AT.)
}
((int8_t*)donor)[t] = z < 0? 0 : -sp[z];
}
for (t = 2; t < tlen; ++t) {
int z = 3;
if (flag & KSW_EZ_SPLICE_FOR) {
if (target[t-1] == 3 && target[t] == 2) // .TG| (rev of |GT.)
z = target[t-2] == 0 || target[t-2] == 2? -1 : 0;
else if (target[t-1] == 1 && target[t] == 2) z = 1; // .CG| (rev of |GC.)
else if (target[t-1] == 3 && target[t] == 0) z = 2; // .TA| (rev of |AT.)
} else if (flag & KSW_EZ_SPLICE_REV) {
if (target[t-1] == 3 && target[t] == 1) // .TC| (comp of .AG|)
z = target[t-2] == 0 || target[t-2] == 2? -1 : 0;
else if (target[t-1] == 3 && target[t] == 2) z = 2; // .TG| (comp of .AC|)
}
((int8_t*)acceptor)[t] = z < 0? 0 : -sp[z];
}
}
}
if (junc && (flag & KSW_EZ_SPLICE_SCORE)) { // junc[] keeps the donor score
uint8_t donor_val = !!(flag & KSW_EZ_SPLICE_FOR) == !(flag & KSW_EZ_REV_CIGAR)? 0 : 1;
for (t = 0; t < tlen - 1; ++t)
((int8_t*)donor)[t] += junc[t+1] == 0xff || (junc[t+1]&1) != donor_val? -junc_pen : (int8_t)(junc[t+1]>>1) - (int8_t)KSW_SPSC_OFFSET;
for (t = 0; t < tlen - 1; ++t)
((int8_t*)acceptor)[t] += junc[t+1] == 0xff || (junc[t+1]&1) != !donor_val? -junc_pen : (int8_t)(junc[t+1]>>1) - (int8_t)KSW_SPSC_OFFSET;
//for (t = 0; t < tlen - 1; ++t) if (junc[t+1] != 0xff) fprintf(stderr, "Y2\t%d\t%d\t%c\t%d\n", ((int8_t*)donor)[t], ((int8_t*)acceptor)[t], "DA"[junc[t+1]&1], (int8_t)(junc[t+1]>>1) - (int8_t)KSW_SPSC_OFFSET);
} else if (junc) { // junc[] keeps the splice sites
if (!(flag & KSW_EZ_REV_CIGAR)) {
for (t = 0; t < tlen - 1; ++t)
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t+1]&1)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t+1]&8)))
((int8_t*)donor)[t] += junc_bonus;
for (t = 0; t < tlen; ++t)
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t]&2)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t]&4)))
((int8_t*)acceptor)[t] += junc_bonus;
} else {
for (t = 0; t < tlen - 1; ++t)
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t+1]&2)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t+1]&4)))
((int8_t*)donor)[t] += junc_bonus;
for (t = 0; t < tlen; ++t)
if (((flag & KSW_EZ_SPLICE_FOR) && (junc[t]&1)) || ((flag & KSW_EZ_SPLICE_REV) && (junc[t]&8)))
((int8_t*)acceptor)[t] += junc_bonus;
}
}
@@ -336,7 +422,7 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
} else H[0] = v8[0] - qe, max_H = H[0], max_t = 0; // special casing r==0
// update ez
if (en0 == tlen - 1 && H[en0] > ez->mte)
ez->mte = H[en0], ez->mte_q = r - en;
ez->mte = H[en0], ez->mte_q = r - en0;
if (r - st0 == qlen - 1 && H[st0] > ez->mqe)
ez->mqe = H[st0], ez->mqe_t = st0;
if (ksw_apply_zdrop(ez, 1, max_H, r, max_t, zdrop, 0)) break;
@@ -366,10 +452,14 @@ void ksw_exts2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
if (!approx_max) kfree(km, H);
if (with_cigar) { // backtrack
int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY))
if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY)) {
ksw_backtrack(km, 1, rev_cigar, long_thres, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
else if (ez->max_t >= 0 && ez->max_q >= 0)
} else if (!ez->zdropped && (flag&KSW_EZ_EXTZ_ONLY) && ez->mqe + end_bonus > (int)ez->max) {
ez->reach_end = 1;
ksw_backtrack(km, 1, rev_cigar, long_thres, (uint8_t*)p, off, off_end, n_col_*16, ez->mqe_t, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
} else if (ez->max_t >= 0 && ez->max_q >= 0) {
ksw_backtrack(km, 1, rev_cigar, long_thres, (uint8_t*)p, off, off_end, n_col_*16, ez->max_t, ez->max_q, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
}
kfree(km, mem2); kfree(km, off);
}
}
+14 -6
View File
@@ -3,15 +3,23 @@
#include "ksw2.h"
#ifdef __SSE2__
#ifdef USE_SIMDE
#include <simde/x86/sse2.h>
#else
#include <emmintrin.h>
#endif
#ifdef KSW_SSE2_ONLY
#undef __SSE4_1__
#endif
#ifdef __SSE4_1__
#ifdef USE_SIMDE
#include <simde/x86/sse4.1.h>
#else
#include <smmintrin.h>
#endif
#endif
#ifdef KSW_CPU_DISPATCH
#ifdef __SSE4_1__
@@ -65,7 +73,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
flag16_ = _mm_set1_epi8(0x10);
sc_mch_ = _mm_set1_epi8(mat[0]);
sc_mis_ = _mm_set1_epi8(mat[1]);
sc_N_ = _mm_set1_epi8(-e);
sc_N_ = mat[m*m-1] == 0? _mm_set1_epi8(-e) : _mm_set1_epi8(mat[m*m-1]);
m1_ = _mm_set1_epi8(m - 1); // wildcard
max_sc_ = _mm_set1_epi8(mat[0] + (q + e) * 2);
@@ -89,7 +97,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
for (t = 0; t < tlen_ * 16; ++t) H[t] = KSW_NEG_INF;
}
if (with_cigar) {
mem2 = (uint8_t*)kmalloc(km, ((qlen + tlen - 1) * n_col_ + 1) * 16);
mem2 = (uint8_t*)kmalloc(km, ((size_t)(qlen + tlen - 1) * n_col_ + 1) * 16);
p = (__m128i*)(((size_t)mem2 + 15) >> 4 << 4);
off = (int*)kmalloc(km, (qlen + tlen - 1) * sizeof(int) * 2);
off_end = off + qlen + tlen - 1;
@@ -169,7 +177,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
#endif
}
} else if (!(flag&KSW_EZ_RIGHT)) { // gap left-alignment
__m128i *pr = p + r * n_col_ - st_;
__m128i *pr = p + (size_t)r * n_col_ - st_;
off[r] = st, off_end[r] = en;
for (t = st_; t <= en_; ++t) {
__m128i d, z, a, b, xt1, vt1, ut, tmp;
@@ -195,7 +203,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
_mm_store_si128(&pr[t], d);
}
} else { // gap right-alignment
__m128i *pr = p + r * n_col_ - st_;
__m128i *pr = p + (size_t)r * n_col_ - st_;
off[r] = st, off_end[r] = en;
for (t = st_; t <= en_; ++t) {
__m128i d, z, a, b, xt1, vt1, ut, tmp;
@@ -261,7 +269,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
} else H[0] = v8[0] - qe - qe, max_H = H[0], max_t = 0; // special casing r==0
// update ez
if (en0 == tlen - 1 && H[en0] > ez->mte)
ez->mte = H[en0], ez->mte_q = r - en;
ez->mte = H[en0], ez->mte_q = r - en0;
if (r - st0 == qlen - 1 && H[st0] > ez->mqe)
ez->mqe = H[st0], ez->mqe_t = st0;
if (ksw_apply_zdrop(ez, 1, max_H, r, max_t, zdrop, e)) break;
@@ -293,7 +301,7 @@ void ksw_extz2_sse(void *km, int qlen, const uint8_t *query, int tlen, const uin
int rev_cigar = !!(flag & KSW_EZ_REV_CIGAR);
if (!ez->zdropped && !(flag&KSW_EZ_EXTZ_ONLY)) {
ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, tlen-1, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
} else if (!ez->zdropped && (flag&KSW_EZ_EXTZ_ONLY) && ez->mqe + end_bonus > ez->max) {
} else if (!ez->zdropped && (flag&KSW_EZ_EXTZ_ONLY) && ez->mqe + end_bonus > (int)ez->max) {
ez->reach_end = 1;
ksw_backtrack(km, 1, rev_cigar, 0, (uint8_t*)p, off, off_end, n_col_*16, ez->mqe_t, qlen-1, &ez->m_cigar, &ez->n_cigar, &ez->cigar);
} else if (ez->max_t >= 0 && ez->max_q >= 0) {
+8 -3
View File
@@ -1,9 +1,14 @@
#include <stdlib.h>
#include <stdint.h>
#include <string.h>
#include <emmintrin.h>
#include "ksw2.h"
#ifdef USE_SIMDE
#include <simde/x86/sse2.h>
#else
#include <emmintrin.h>
#endif
#ifdef __GNUC__
#define LIKELY(x) __builtin_expect((x),1)
#define UNLIKELY(x) __builtin_expect((x),0)
@@ -62,7 +67,7 @@ void *ksw_ll_qinit(void *km, int size, int qlen, const uint8_t *query, int m, co
const int8_t *ma = mat + a * m;
for (i = 0; i < slen; ++i)
for (k = i; k < nlen; k += slen) // p iterations
*t++ = (k >= qlen? 0 : ma[query[k]]) + q->shift;
*t++ = (k >= qlen? -1 : ma[query[k]]) + q->shift;
}
} else {
int16_t *t = (int16_t*)q->qp;
@@ -71,7 +76,7 @@ void *ksw_ll_qinit(void *km, int size, int qlen, const uint8_t *query, int m, co
const int8_t *ma = mat + a * m;
for (i = 0; i < slen; ++i)
for (k = i; k < nlen; k += slen) // p iterations
*t++ = (k >= qlen? 0 : ma[query[k]]);
*t++ = (k >= qlen? -1 : ma[query[k]]);
}
}
return q;
+368
View File
@@ -0,0 +1,368 @@
#include <stdint.h>
#include <string.h>
#include <stdio.h>
#include <assert.h>
#include "mmpriv.h"
#include "kalloc.h"
#include "krmq.h"
static int64_t mg_chain_bk_end(int32_t max_drop, const mm128_t *z, const int32_t *f, const int64_t *p, int32_t *t, int64_t k)
{
int64_t i = z[k].y, end_i = -1, max_i = i;
int32_t max_s = 0;
if (i < 0 || t[i] != 0) return i;
do {
int32_t s;
t[i] = 2;
end_i = i = p[i];
s = i < 0? z[k].x : (int32_t)z[k].x - f[i];
if (s > max_s) max_s = s, max_i = i;
else if (max_s - s > max_drop) break;
} while (i >= 0 && t[i] == 0);
for (i = z[k].y; i >= 0 && i != end_i; i = p[i]) // reset modified t[]
t[i] = 0;
return max_i;
}
uint64_t *mg_chain_backtrack(void *km, int64_t n, const int32_t *f, const int64_t *p, int32_t *v, int32_t *t, int32_t min_cnt, int32_t min_sc, int32_t max_drop, int32_t *n_u_, int32_t *n_v_)
{
mm128_t *z;
uint64_t *u;
int64_t i, k, n_z, n_v;
int32_t n_u;
*n_u_ = *n_v_ = 0;
for (i = 0, n_z = 0; i < n; ++i) // precompute n_z
if (f[i] >= min_sc) ++n_z;
if (n_z == 0) return 0;
z = Kmalloc(km, mm128_t, n_z);
for (i = 0, k = 0; i < n; ++i) // populate z[]
if (f[i] >= min_sc) z[k].x = f[i], z[k++].y = i;
radix_sort_128x(z, z + n_z);
memset(t, 0, n * 4);
for (k = n_z - 1, n_v = n_u = 0; k >= 0; --k) { // precompute n_u
if (t[z[k].y] == 0) {
int64_t n_v0 = n_v, end_i;
int32_t sc;
end_i = mg_chain_bk_end(max_drop, z, f, p, t, k);
for (i = z[k].y; i != end_i; i = p[i])
++n_v, t[i] = 1;
sc = i < 0? z[k].x : (int32_t)z[k].x - f[i];
if (sc >= min_sc && n_v > n_v0 && n_v - n_v0 >= min_cnt)
++n_u;
else n_v = n_v0;
}
}
u = Kmalloc(km, uint64_t, n_u);
memset(t, 0, n * 4);
for (k = n_z - 1, n_v = n_u = 0; k >= 0; --k) { // populate u[]
if (t[z[k].y] == 0) {
int64_t n_v0 = n_v, end_i;
int32_t sc;
end_i = mg_chain_bk_end(max_drop, z, f, p, t, k);
for (i = z[k].y; i != end_i; i = p[i])
v[n_v++] = i, t[i] = 1;
sc = i < 0? z[k].x : (int32_t)z[k].x - f[i];
if (sc >= min_sc && n_v > n_v0 && n_v - n_v0 >= min_cnt)
u[n_u++] = (uint64_t)sc << 32 | (n_v - n_v0);
else n_v = n_v0;
}
}
kfree(km, z);
assert(n_v < INT32_MAX);
*n_u_ = n_u, *n_v_ = n_v;
return u;
}
static mm128_t *compact_a(void *km, int32_t n_u, uint64_t *u, int32_t n_v, int32_t *v, mm128_t *a)
{
mm128_t *b, *w;
uint64_t *u2;
int64_t i, j, k;
// write the result to b[]
b = Kmalloc(km, mm128_t, n_v);
for (i = 0, k = 0; i < n_u; ++i) {
int32_t k0 = k, ni = (int32_t)u[i];
for (j = 0; j < ni; ++j)
b[k++] = a[v[k0 + (ni - j - 1)]];
}
kfree(km, v);
// sort u[] and a[] by the target position, such that adjacent chains may be joined
w = Kmalloc(km, mm128_t, n_u);
for (i = k = 0; i < n_u; ++i) {
w[i].x = b[k].x, w[i].y = (uint64_t)k<<32|i;
k += (int32_t)u[i];
}
radix_sort_128x(w, w + n_u);
u2 = Kmalloc(km, uint64_t, n_u);
for (i = k = 0; i < n_u; ++i) {
int32_t j = (int32_t)w[i].y, n = (int32_t)u[j];
u2[i] = u[j];
memcpy(&a[k], &b[w[i].y>>32], n * sizeof(mm128_t));
k += n;
}
memcpy(u, u2, n_u * 8);
memcpy(b, a, k * sizeof(mm128_t)); // write _a_ to _b_ and deallocate _a_ because _a_ is oversized, sometimes a lot
kfree(km, a); kfree(km, w); kfree(km, u2);
return b;
}
static inline int32_t comput_sc(const mm128_t *ai, const mm128_t *aj, int32_t max_dist_x, int32_t max_dist_y, int32_t bw, float chn_pen_gap, float chn_pen_skip, int is_cdna, int n_seg)
{
int32_t dq = (int32_t)ai->y - (int32_t)aj->y, dr, dd, dg, q_span, sc;
int32_t sidi = (ai->y & MM_SEED_SEG_MASK) >> MM_SEED_SEG_SHIFT;
int32_t sidj = (aj->y & MM_SEED_SEG_MASK) >> MM_SEED_SEG_SHIFT;
if (dq <= 0 || dq > max_dist_x) return INT32_MIN;
dr = (int32_t)(ai->x - aj->x);
if (sidi == sidj && (dr == 0 || dq > max_dist_y)) return INT32_MIN;
dd = dr > dq? dr - dq : dq - dr;
if (sidi == sidj && dd > bw) return INT32_MIN;
if (n_seg > 1 && !is_cdna && sidi == sidj && dr > max_dist_y) return INT32_MIN;
dg = dr < dq? dr : dq;
q_span = aj->y>>32&0xff;
sc = q_span < dg? q_span : dg;
if (dd || dg > q_span) {
float lin_pen, log_pen;
lin_pen = chn_pen_gap * (float)dd + chn_pen_skip * (float)dg;
log_pen = dd >= 1? mg_log2(dd + 1) : 0.0f; // mg_log2() only works for dd>=2
if (is_cdna || sidi != sidj) {
if (sidi != sidj && dr == 0) ++sc; // possibly due to overlapping paired ends; give a minor bonus
else if (dr > dq || sidi != sidj) sc -= (int)(lin_pen < log_pen? lin_pen : log_pen); // deletion or jump between paired ends
else sc -= (int)(lin_pen + .5f * log_pen);
} else sc -= (int)(lin_pen + .5f * log_pen);
}
return sc;
}
/* Input:
* a[].x: rev<<63 | tid<<32 | tpos
* a[].y: flags<<40 | q_span<<32 | q_pos
* Output:
* n_u: #chains
* u[]: score<<32 | #anchors (sum of lower 32 bits of u[] is the returned length of a[])
* input a[] is deallocated on return
*/
mm128_t *mg_lchain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int max_iter, int min_cnt, int min_sc, float chn_pen_gap, float chn_pen_skip,
int is_cdna, int n_seg, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km)
{ // TODO: make sure this works when n has more than 32 bits
int32_t *f, *t, *v, n_u, n_v, mmax_f = 0, max_drop = bw;
int64_t *p, i, j, max_ii, st = 0;
uint64_t *u;
if (_u) *_u = 0, *n_u_ = 0;
if (n == 0 || a == 0) {
kfree(km, a);
return 0;
}
if (max_dist_x < bw) max_dist_x = bw;
if (max_dist_y < bw && !is_cdna) max_dist_y = bw;
if (is_cdna) max_drop = INT32_MAX;
p = Kmalloc(km, int64_t, n);
f = Kmalloc(km, int32_t, n);
v = Kmalloc(km, int32_t, n);
t = Kcalloc(km, int32_t, n);
// fill the score and backtrack arrays
for (i = 0, max_ii = -1; i < n; ++i) {
int64_t max_j = -1, end_j;
int32_t max_f = a[i].y>>32&0xff, n_skip = 0;
while (st < i && (a[i].x>>32 != a[st].x>>32 || a[i].x > a[st].x + max_dist_x)) ++st;
if (i - st > max_iter) st = i - max_iter;
for (j = i - 1; j >= st; --j) {
int32_t sc;
sc = comput_sc(&a[i], &a[j], max_dist_x, max_dist_y, bw, chn_pen_gap, chn_pen_skip, is_cdna, n_seg);
if (sc == INT32_MIN) continue;
sc += f[j];
if (sc > max_f) {
max_f = sc, max_j = j;
if (n_skip > 0) --n_skip;
} else if (t[j] == (int32_t)i) {
if (++n_skip > max_skip)
break;
}
if (p[j] >= 0) t[p[j]] = i;
}
end_j = j;
if (max_ii < 0 || a[i].x - a[max_ii].x > (int64_t)max_dist_x) {
int32_t max = INT32_MIN;
max_ii = -1;
for (j = i - 1; j >= st; --j)
if (max < f[j]) max = f[j], max_ii = j;
}
if (max_ii >= 0 && max_ii < end_j) {
int32_t tmp;
tmp = comput_sc(&a[i], &a[max_ii], max_dist_x, max_dist_y, bw, chn_pen_gap, chn_pen_skip, is_cdna, n_seg);
if (tmp != INT32_MIN && max_f < tmp + f[max_ii])
max_f = tmp + f[max_ii], max_j = max_ii;
}
f[i] = max_f, p[i] = max_j;
v[i] = max_j >= 0 && v[max_j] > max_f? v[max_j] : max_f; // v[] keeps the peak score up to i; f[] is the score ending at i, not always the peak
if (max_ii < 0 || (a[i].x - a[max_ii].x <= (int64_t)max_dist_x && f[max_ii] < f[i]))
max_ii = i;
if (mmax_f < max_f) mmax_f = max_f;
//fprintf(stderr, "X1\t%ld\t%ld:%d\t%ld\t%ld:%d\t%ld\t%ld\n", (long)i, (long)(a[i].x>>32), (int32_t)a[i].x, (long)max_j, max_j<0?-1L:(long)(a[max_j].x>>32), max_j<0?-1:(int32_t)a[max_j].x, (long)max_f, (long)v[i]);
}
u = mg_chain_backtrack(km, n, f, p, v, t, min_cnt, min_sc, max_drop, &n_u, &n_v);
*n_u_ = n_u, *_u = u; // NB: note that u[] may not be sorted by score here
kfree(km, p); kfree(km, f); kfree(km, t);
if (n_u == 0) {
kfree(km, a); kfree(km, v);
return 0;
}
return compact_a(km, n_u, u, n_v, v, a);
}
typedef struct lc_elem_s {
int32_t y;
int64_t i;
double pri;
KRMQ_HEAD(struct lc_elem_s) head;
} lc_elem_t;
#define lc_elem_cmp(a, b) ((a)->y < (b)->y? -1 : (a)->y > (b)->y? 1 : ((a)->i > (b)->i) - ((a)->i < (b)->i))
#define lc_elem_lt2(a, b) ((a)->pri < (b)->pri)
KRMQ_INIT(lc_elem, lc_elem_t, head, lc_elem_cmp, lc_elem_lt2)
KALLOC_POOL_INIT(rmq, lc_elem_t)
static inline int32_t comput_sc_simple(const mm128_t *ai, const mm128_t *aj, float chn_pen_gap, float chn_pen_skip, int32_t *exact, int32_t *width)
{
int32_t dq = (int32_t)ai->y - (int32_t)aj->y, dr, dd, dg, q_span, sc;
dr = (int32_t)(ai->x - aj->x);
*width = dd = dr > dq? dr - dq : dq - dr;
dg = dr < dq? dr : dq;
q_span = aj->y>>32&0xff;
sc = q_span < dg? q_span : dg;
if (exact) *exact = (dd == 0 && dg <= q_span);
if (dd || dq > q_span) {
float lin_pen, log_pen;
lin_pen = chn_pen_gap * (float)dd + chn_pen_skip * (float)dg;
log_pen = dd >= 1? mg_log2(dd + 1) : 0.0f; // mg_log2() only works for dd>=2
sc -= (int)(lin_pen + .5f * log_pen);
}
return sc;
}
mm128_t *mg_lchain_rmq(int max_dist, int max_dist_inner, int bw, int max_chn_skip, int cap_rmq_size, int min_cnt, int min_sc, float chn_pen_gap, float chn_pen_skip,
int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km)
{
int32_t *f,*t, *v, n_u, n_v, mmax_f = 0, max_rmq_size = 0, max_drop = bw;
int64_t *p, i, i0, st = 0, st_inner = 0;
uint64_t *u;
lc_elem_t *root = 0, *root_inner = 0;
void *mem_mp = 0;
kmp_rmq_t *mp;
if (_u) *_u = 0, *n_u_ = 0;
if (n == 0 || a == 0) {
kfree(km, a);
return 0;
}
if (max_dist < bw) max_dist = bw;
if (max_dist_inner < 0) max_dist_inner = 0;
if (max_dist_inner > max_dist) max_dist_inner = max_dist;
p = Kmalloc(km, int64_t, n);
f = Kmalloc(km, int32_t, n);
t = Kcalloc(km, int32_t, n);
v = Kmalloc(km, int32_t, n);
mem_mp = km_init2(km, 0x10000);
mp = kmp_init_rmq(mem_mp);
// fill the score and backtrack arrays
for (i = i0 = 0; i < n; ++i) {
int64_t max_j = -1;
int32_t q_span = a[i].y>>32&0xff, max_f = q_span;
lc_elem_t s, *q, *r, lo, hi;
// add in-range anchors
if (i0 < i && a[i0].x != a[i].x) {
int64_t j;
for (j = i0; j < i; ++j) {
q = kmp_alloc_rmq(mp);
q->y = (int32_t)a[j].y, q->i = j, q->pri = -(f[j] + 0.5 * chn_pen_gap * ((int32_t)a[j].x + (int32_t)a[j].y));
krmq_insert(lc_elem, &root, q, 0);
if (max_dist_inner > 0) {
r = kmp_alloc_rmq(mp);
*r = *q;
krmq_insert(lc_elem, &root_inner, r, 0);
}
}
i0 = i;
}
// get rid of active chains out of range
while (st < i && (a[i].x>>32 != a[st].x>>32 || a[i].x > a[st].x + max_dist || krmq_size(head, root) > cap_rmq_size)) {
s.y = (int32_t)a[st].y, s.i = st;
if ((q = krmq_find(lc_elem, root, &s, 0)) != 0) {
q = krmq_erase(lc_elem, &root, q, 0);
kmp_free_rmq(mp, q);
}
++st;
}
if (max_dist_inner > 0) { // similar to the block above, but applied to the inner tree
while (st_inner < i && (a[i].x>>32 != a[st_inner].x>>32 || a[i].x > a[st_inner].x + max_dist_inner || krmq_size(head, root_inner) > cap_rmq_size)) {
s.y = (int32_t)a[st_inner].y, s.i = st_inner;
if ((q = krmq_find(lc_elem, root_inner, &s, 0)) != 0) {
q = krmq_erase(lc_elem, &root_inner, q, 0);
kmp_free_rmq(mp, q);
}
++st_inner;
}
}
// RMQ
lo.i = INT32_MAX, lo.y = (int32_t)a[i].y - max_dist;
hi.i = 0, hi.y = (int32_t)a[i].y;
if ((q = krmq_rmq(lc_elem, root, &lo, &hi)) != 0) {
int32_t sc, exact, width, n_skip = 0;
int64_t j = q->i;
assert(q->y >= lo.y && q->y <= hi.y);
sc = f[j] + comput_sc_simple(&a[i], &a[j], chn_pen_gap, chn_pen_skip, &exact, &width);
if (width <= bw && sc > max_f) max_f = sc, max_j = j;
if (!exact && root_inner && (int32_t)a[i].y > 0) {
lc_elem_t *lo, *hi;
s.y = (int32_t)a[i].y - 1, s.i = n;
krmq_interval(lc_elem, root_inner, &s, &lo, &hi);
if (lo) {
const lc_elem_t *q;
int32_t width;
krmq_itr_t(lc_elem) itr;
krmq_itr_find(lc_elem, root_inner, lo, &itr);
while ((q = krmq_at(&itr)) != 0) {
if (q->y < (int32_t)a[i].y - max_dist_inner) break;
j = q->i;
sc = f[j] + comput_sc_simple(&a[i], &a[j], chn_pen_gap, chn_pen_skip, 0, &width);
if (width <= bw) {
if (sc > max_f) {
max_f = sc, max_j = j;
if (n_skip > 0) --n_skip;
} else if (t[j] == (int32_t)i) {
if (++n_skip > max_chn_skip)
break;
}
if (p[j] >= 0) t[p[j]] = i;
}
if (!krmq_itr_prev(lc_elem, &itr)) break;
}
}
}
}
// set max
assert(max_j < 0 || (a[max_j].x < a[i].x && (int32_t)a[max_j].y < (int32_t)a[i].y));
f[i] = max_f, p[i] = max_j;
v[i] = max_j >= 0 && v[max_j] > max_f? v[max_j] : max_f; // v[] keeps the peak score up to i; f[] is the score ending at i, not always the peak
if (mmax_f < max_f) mmax_f = max_f;
if (max_rmq_size < krmq_size(head, root)) max_rmq_size = krmq_size(head, root);
}
km_destroy(mem_mp);
u = mg_chain_backtrack(km, n, f, p, v, t, min_cnt, min_sc, max_drop, &n_u, &n_v);
*n_u_ = n_u, *_u = u; // NB: note that u[] may not be sorted by score here
kfree(km, p); kfree(km, f); kfree(km, t);
if (n_u == 0) {
kfree(km, a); kfree(km, v);
return 0;
}
return compact_a(km, n_u, u, n_v, v, a);
}
+342 -151
View File
@@ -1,12 +1,11 @@
#include <stdlib.h>
#include <stdio.h>
#include <string.h>
#include <errno.h>
#include "bseq.h"
#include "minimap.h"
#include "mmpriv.h"
#include "getopt.h"
#define MM_VERSION "2.8-r672"
#include "ketopt.h"
#ifdef __linux__
#include <sys/resource.h>
@@ -22,57 +21,102 @@ void liftrlimit()
void liftrlimit() {}
#endif
static struct option long_options[] = {
{ "bucket-bits", required_argument, 0, 0 },
{ "mb-size", required_argument, 0, 'K' },
{ "seed", required_argument, 0, 0 },
{ "no-kalloc", no_argument, 0, 0 },
{ "print-qname", no_argument, 0, 0 },
{ "no-self", no_argument, 0, 'D' },
{ "print-seeds", no_argument, 0, 0 },
{ "max-chain-skip", required_argument, 0, 0 },
{ "min-dp-len", required_argument, 0, 0 },
{ "print-aln-seq", no_argument, 0, 0 },
{ "splice", no_argument, 0, 0 },
{ "cost-non-gt-ag", required_argument, 0, 'C' },
{ "no-long-join", no_argument, 0, 0 },
{ "sr", no_argument, 0, 0 },
{ "frag", required_argument, 0, 0 },
{ "secondary", required_argument, 0, 0 },
{ "cs", optional_argument, 0, 0 },
{ "end-bonus", required_argument, 0, 0 },
{ "no-pairing", no_argument, 0, 0 },
{ "splice-flank", required_argument, 0, 0 },
{ "idx-no-seq", no_argument, 0, 0 },
{ "end-seed-pen", required_argument, 0, 0 }, // 21
{ "for-only", no_argument, 0, 0 }, // 22
{ "rev-only", no_argument, 0, 0 }, // 23
{ "heap-sort", required_argument, 0, 0 }, // 24
{ "all-chain", no_argument, 0, 'P' },
{ "dual", required_argument, 0, 0 }, // 26
{ "help", no_argument, 0, 'h' },
{ "max-intron-len", required_argument, 0, 'G' },
{ "version", no_argument, 0, 'V' },
{ "min-count", required_argument, 0, 'n' },
{ "min-chain-score",required_argument, 0, 'm' },
{ "mask-level", required_argument, 0, 'M' },
{ "min-dp-score", required_argument, 0, 's' },
{ "sam", no_argument, 0, 'a' },
{ 0, 0, 0, 0}
static ko_longopt_t long_options[] = {
{ "bucket-bits", ko_required_argument, 300 },
{ "mb-size", ko_required_argument, 'K' },
{ "seed", ko_required_argument, 302 },
{ "no-kalloc", ko_no_argument, 303 },
{ "print-qname", ko_no_argument, 304 },
{ "no-self", ko_no_argument, 'D' },
{ "print-seeds", ko_no_argument, 306 },
{ "max-chain-skip", ko_required_argument, 307 },
{ "min-dp-len", ko_required_argument, 308 },
{ "print-aln-seq", ko_no_argument, 309 },
{ "splice", ko_no_argument, 310 },
{ "cost-non-gt-ag", ko_required_argument, 'C' },
{ "no-long-join", ko_no_argument, 312 },
{ "sr", ko_optional_argument, 313 },
{ "frag", ko_required_argument, 314 },
{ "secondary", ko_required_argument, 315 },
{ "cs", ko_optional_argument, 316 },
{ "end-bonus", ko_required_argument, 317 },
{ "no-pairing", ko_no_argument, 318 }, // deprecated but reserved for backward compatibility
{ "splice-flank", ko_required_argument, 319 },
{ "idx-no-seq", ko_no_argument, 320 },
{ "end-seed-pen", ko_required_argument, 321 },
{ "for-only", ko_no_argument, 322 },
{ "rev-only", ko_no_argument, 323 },
{ "heap-sort", ko_required_argument, 324 },
{ "all-chain", ko_no_argument, 'P' },
{ "dual", ko_required_argument, 326 },
{ "max-clip-ratio", ko_required_argument, 327 },
{ "min-occ-floor", ko_required_argument, 328 },
{ "MD", ko_no_argument, 329 },
{ "lj-min-ratio", ko_required_argument, 330 },
{ "score-N", ko_required_argument, 331 },
{ "eqx", ko_no_argument, 332 },
{ "paf-no-hit", ko_no_argument, 333 },
{ "split-prefix", ko_required_argument, 334 },
{ "no-end-flt", ko_no_argument, 335 },
{ "hard-mask-level",ko_no_argument, 336 },
{ "cap-sw-mem", ko_required_argument, 337 },
{ "max-qlen", ko_required_argument, 338 },
{ "max-chain-iter", ko_required_argument, 339 },
{ "junc-bed", ko_required_argument, 340 },
{ "junc-bonus", ko_required_argument, 341 },
{ "sam-hit-only", ko_no_argument, 342 },
{ "chain-gap-scale",ko_required_argument, 343 },
{ "alt", ko_required_argument, 344 },
{ "alt-drop", ko_required_argument, 345 },
{ "mask-len", ko_required_argument, 346 },
{ "rmq", ko_optional_argument, 347 },
{ "qstrand", ko_no_argument, 348 },
{ "cap-kalloc", ko_required_argument, 349 },
{ "q-occ-frac", ko_required_argument, 350 },
{ "chain-skip-scale",ko_required_argument,351 },
{ "print-chains", ko_no_argument, 352 },
{ "no-hash-name", ko_no_argument, 353 },
{ "secondary-seq", ko_no_argument, 354 },
{ "ds", ko_no_argument, 355 },
{ "rmq-inner", ko_required_argument, 356 },
{ "spsc", ko_required_argument, 357 },
{ "junc-pen", ko_required_argument, 358 },
{ "pairing", ko_required_argument, 359 },
{ "jump-min-match", ko_required_argument, 360 },
{ "write-junc", ko_no_argument, 361 },
{ "pass1", ko_required_argument, 362 },
{ "spsc-scale", ko_required_argument, 363 },
{ "spsc0", ko_required_argument, 364 },
{ "dbg-seed-occ", ko_no_argument, 501 },
{ "help", ko_no_argument, 'h' },
{ "max-intron-len", ko_required_argument, 'G' },
{ "version", ko_no_argument, 'V' },
{ "min-count", ko_required_argument, 'n' },
{ "min-chain-score",ko_required_argument, 'm' },
{ "mask-level", ko_required_argument, 'M' },
{ "min-dp-score", ko_required_argument, 's' },
{ "sam", ko_no_argument, 'a' },
{ 0, 0, 0 }
};
static inline int64_t mm_parse_num(const char *str)
static inline int64_t mm_parse_num2(const char *str, char **q)
{
double x;
char *p;
x = strtod(optarg, &p);
if (*p == 'G' || *p == 'g') x *= 1e9;
else if (*p == 'M' || *p == 'm') x *= 1e6;
else if (*p == 'K' || *p == 'k') x *= 1e3;
x = strtod(str, &p);
if (*p == 'G' || *p == 'g') x *= 1e9, ++p;
else if (*p == 'M' || *p == 'm') x *= 1e6, ++p;
else if (*p == 'K' || *p == 'k') x *= 1e3, ++p;
if (q) *q = p;
return (int64_t)(x + .499);
}
static inline void yes_or_no(mm_mapopt_t *opt, int flag, int long_idx, const char *arg, int yes_to_set)
static inline int64_t mm_parse_num(const char *str)
{
return mm_parse_num2(str, 0);
}
static inline void yes_or_no(mm_mapopt_t *opt, int64_t flag, int long_idx, const char *arg, int yes_to_set)
{
if (yes_to_set) {
if (strcmp(arg, "yes") == 0 || strcmp(arg, "y") == 0) opt->flag |= flag;
@@ -87,11 +131,13 @@ static inline void yes_or_no(mm_mapopt_t *opt, int flag, int long_idx, const cha
int main(int argc, char *argv[])
{
const char *opt_str = "2aSDw:k:K:t:r:f:Vv:g:G:I:d:XT:s:x:Hcp:M:n:z:A:B:O:E:m:N:Qu:R:hF:LC:";
const char *opt_str = "2aSDw:k:K:t:r:f:Vv:g:G:I:d:XT:s:x:Hcp:M:n:z:A:B:b:O:E:m:N:Qu:R:hF:LC:yYPo:e:U:J:j:";
ketopt_t o = KETOPT_INIT;
mm_mapopt_t opt;
mm_idxopt_t ipt;
int i, c, n_threads = 3, long_idx;
char *fnw = 0, *rg = 0, *s;
int i, c, n_threads = 3, n_parts, old_best_n = -1;
float spsc_scale = 0.7f;
char *fnw = 0, *rg = 0, *fn_bed_junc = 0, *fn_bed_jump = 0, *fn_bed_pass1 = 0, *fn_spsc = 0, *s, *alt_list = 0;
FILE *fp_help = stderr;
mm_idx_reader_t *idx_rdr;
mm_idx_t *mi;
@@ -101,30 +147,35 @@ int main(int argc, char *argv[])
mm_realtime0 = realtime();
mm_set_opt(0, &ipt, &opt);
while ((c = getopt_long(argc, argv, opt_str, long_options, &long_idx)) >= 0) // apply option -x/preset first
while ((c = ketopt(&o, argc, argv, 1, opt_str, long_options)) >= 0) { // test command line options and apply option -x/preset first
if (c == 'x') {
if (mm_set_opt(optarg, &ipt, &opt) < 0) {
fprintf(stderr, "[ERROR] unknown preset '%s'\n", optarg);
if (mm_set_opt(o.arg, &ipt, &opt) < 0) {
fprintf(stderr, "[ERROR] unknown preset '%s'\n", o.arg);
return 1;
}
break;
} else if (c == ':') {
fprintf(stderr, "[ERROR] missing option argument\n");
return 1;
} else if (c == '?') {
fprintf(stderr, "[ERROR] unknown option in \"%s\"\n", argv[o.i - 1]);
return 1;
}
optreset = 1;
}
o = KETOPT_INIT;
while ((c = getopt_long(argc, argv, opt_str, long_options, &long_idx)) >= 0) {
if (c == 'w') ipt.w = atoi(optarg);
else if (c == 'k') ipt.k = atoi(optarg);
while ((c = ketopt(&o, argc, argv, 1, opt_str, long_options)) >= 0) {
if (c == 'w') ipt.w = atoi(o.arg);
else if (c == 'k') ipt.k = atoi(o.arg);
else if (c == 'H') ipt.flag |= MM_I_HPC;
else if (c == 'd') fnw = optarg; // the above are indexing related options, except -I
else if (c == 'r') opt.bw = (int)mm_parse_num(optarg);
else if (c == 't') n_threads = atoi(optarg);
else if (c == 'v') mm_verbose = atoi(optarg);
else if (c == 'g') opt.max_gap = (int)mm_parse_num(optarg);
else if (c == 'G') mm_mapopt_max_intron_len(&opt, (int)mm_parse_num(optarg));
else if (c == 'F') opt.max_frag_len = (int)mm_parse_num(optarg);
else if (c == 'N') opt.best_n = atoi(optarg);
else if (c == 'p') opt.pri_ratio = atof(optarg);
else if (c == 'M') opt.mask_level = atof(optarg);
else if (c == 'd') fnw = o.arg; // the above are indexing related options, except -I
else if (c == 't') n_threads = atoi(o.arg);
else if (c == 'v') mm_verbose = atoi(o.arg);
else if (c == 'g') opt.max_gap = (int)mm_parse_num(o.arg);
else if (c == 'G') mm_mapopt_max_intron_len(&opt, (int)mm_parse_num(o.arg));
else if (c == 'F') opt.max_frag_len = (int)mm_parse_num(o.arg);
else if (c == 'N') old_best_n = opt.best_n, opt.best_n = atoi(o.arg);
else if (c == 'p') opt.pri_ratio = atof(o.arg);
else if (c == 'M') opt.mask_level = atof(o.arg);
else if (c == 'c') opt.flag |= MM_F_OUT_CG | MM_F_CIGAR;
else if (c == 'D') opt.flag |= MM_F_NO_DIAG;
else if (c == 'P') opt.flag |= MM_F_ALL_CHAINS;
@@ -133,57 +184,131 @@ int main(int argc, char *argv[])
else if (c == 'Q') opt.flag |= MM_F_NO_QUAL;
else if (c == 'Y') opt.flag |= MM_F_SOFTCLIP;
else if (c == 'L') opt.flag |= MM_F_LONG_CIGAR;
else if (c == 'T') opt.sdust_thres = atoi(optarg);
else if (c == 'n') opt.min_cnt = atoi(optarg);
else if (c == 'm') opt.min_chain_score = atoi(optarg);
else if (c == 'A') opt.a = atoi(optarg);
else if (c == 'B') opt.b = atoi(optarg);
else if (c == 'z') opt.zdrop = atoi(optarg);
else if (c == 's') opt.min_dp_max = atoi(optarg);
else if (c == 'C') opt.noncan = atoi(optarg);
else if (c == 'I') ipt.batch_size = mm_parse_num(optarg);
else if (c == 'K') opt.mini_batch_size = (int)mm_parse_num(optarg);
else if (c == 'R') rg = optarg;
else if (c == 'y') opt.flag |= MM_F_COPY_COMMENT;
else if (c == 'T') opt.sdust_thres = atoi(o.arg);
else if (c == 'n') opt.min_cnt = atoi(o.arg);
else if (c == 'm') opt.min_chain_score = atoi(o.arg);
else if (c == 'A') opt.a = atoi(o.arg);
else if (c == 'B') opt.b = atoi(o.arg);
else if (c == 'b') opt.transition = atoi(o.arg);
else if (c == 's') opt.min_dp_max = atoi(o.arg);
else if (c == 'C') opt.noncan = atoi(o.arg);
else if (c == 'I') ipt.batch_size = mm_parse_num(o.arg);
else if (c == 'K') opt.mini_batch_size = mm_parse_num(o.arg);
else if (c == 'e') opt.occ_dist = mm_parse_num(o.arg);
else if (c == 'R') rg = o.arg;
else if (c == 'h') fp_help = stdout;
else if (c == '2') opt.flag |= MM_F_2_IO_THREADS;
else if (c == 0 && long_idx == 0) ipt.bucket_bits = atoi(optarg); // --bucket-bits
else if (c == 0 && long_idx == 2) opt.seed = atoi(optarg); // --seed
else if (c == 0 && long_idx == 3) mm_dbg_flag |= MM_DBG_NO_KALLOC; // --no-kalloc
else if (c == 0 && long_idx == 4) mm_dbg_flag |= MM_DBG_PRINT_QNAME; // --print-qname
else if (c == 0 && long_idx == 6) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_SEED, n_threads = 1; // --print-seed
else if (c == 0 && long_idx == 7) opt.max_chain_skip = atoi(optarg); // --max-chain-skip
else if (c == 0 && long_idx == 8) opt.min_ksw_len = atoi(optarg); // --min-dp-len
else if (c == 0 && long_idx == 9) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_ALN_SEQ, n_threads = 1; // --print-aln-seq
else if (c == 0 && long_idx ==10) opt.flag |= MM_F_SPLICE; // --splice
else if (c == 0 && long_idx ==12) opt.flag |= MM_F_NO_LJOIN; // --no-long-join
else if (c == 0 && long_idx ==13) opt.flag |= MM_F_SR; // --sr
else if (c == 0 && long_idx ==17) opt.end_bonus = atoi(optarg); // --end-bonus
else if (c == 0 && long_idx ==18) opt.flag |= MM_F_INDEPEND_SEG; // --no-pairing
else if (c == 0 && long_idx ==20) ipt.flag |= MM_I_NO_SEQ; // --idx-no-seq
else if (c == 0 && long_idx ==21) opt.anchor_ext_shift = atoi(optarg); // --end-seed-pen
else if (c == 0 && long_idx ==22) opt.flag |= MM_F_FOR_ONLY; // --for-only
else if (c == 0 && long_idx ==23) opt.flag |= MM_F_REV_ONLY; // --rev-only
else if (c == 0 && long_idx == 14) { // --frag
yes_or_no(&opt, MM_F_FRAG_MODE, long_idx, optarg, 1);
} else if (c == 0 && long_idx == 15) { // --secondary
yes_or_no(&opt, MM_F_NO_PRINT_2ND, long_idx, optarg, 0);
} else if (c == 0 && long_idx == 16) { // --cs
else if (c == 'j') fn_bed_jump = o.arg;
else if (c == 'J') {
int t;
t = atoi(o.arg);
if (t == 0) opt.flag |= MM_F_SPLICE_OLD;
else if (t == 1) opt.flag &= ~MM_F_SPLICE_OLD;
} else if (c == 'o') {
if (strcmp(o.arg, "-") != 0) {
if (freopen(o.arg, "wb", stdout) == NULL) {
fprintf(stderr, "[ERROR]\033[1;31m failed to write the output to file '%s'\033[0m: %s\n", o.arg, strerror(errno));
exit(1);
}
}
}
else if (c == 300) ipt.bucket_bits = atoi(o.arg); // --bucket-bits
else if (c == 302) opt.seed = atoi(o.arg); // --seed
else if (c == 303) mm_dbg_flag |= MM_DBG_NO_KALLOC; // --no-kalloc
else if (c == 304) mm_dbg_flag |= MM_DBG_PRINT_QNAME; // --print-qname
else if (c == 306) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_SEED, n_threads = 1; // --print-seed
else if (c == 307) opt.max_chain_skip = atoi(o.arg); // --max-chain-skip
else if (c == 339) opt.max_chain_iter = atoi(o.arg); // --max-chain-iter
else if (c == 308) opt.min_ksw_len = atoi(o.arg); // --min-dp-len
else if (c == 309) mm_dbg_flag |= MM_DBG_PRINT_QNAME | MM_DBG_PRINT_ALN_SEQ, n_threads = 1; // --print-aln-seq
else if (c == 310) opt.flag |= MM_F_SPLICE; // --splice
else if (c == 312) opt.flag |= MM_F_NO_LJOIN; // --no-long-join
else if (c == 317) opt.end_bonus = atoi(o.arg); // --end-bonus
else if (c == 318) opt.flag |= MM_F_INDEPEND_SEG; // --no-pairing (deprecated)
else if (c == 320) ipt.flag |= MM_I_NO_SEQ; // --idx-no-seq
else if (c == 321) opt.anchor_ext_shift = atoi(o.arg); // --end-seed-pen
else if (c == 322) opt.flag |= MM_F_FOR_ONLY; // --for-only
else if (c == 323) opt.flag |= MM_F_REV_ONLY; // --rev-only
else if (c == 327) opt.max_clip_ratio = atof(o.arg); // --max-clip-ratio
else if (c == 328) opt.min_mid_occ = atoi(o.arg); // --min-occ-floor
else if (c == 329) opt.flag |= MM_F_OUT_MD; // --MD
else if (c == 331) opt.sc_ambi = atoi(o.arg); // --score-N
else if (c == 332) opt.flag |= MM_F_EQX; // --eqx
else if (c == 333) opt.flag |= MM_F_PAF_NO_HIT; // --paf-no-hit
else if (c == 334) opt.split_prefix = o.arg; // --split-prefix
else if (c == 335) opt.flag |= MM_F_NO_END_FLT; // --no-end-flt
else if (c == 336) opt.flag |= MM_F_HARD_MLEVEL; // --hard-mask-level
else if (c == 337) opt.max_sw_mat = mm_parse_num(o.arg); // --cap-sw-mat
else if (c == 338) opt.max_qlen = mm_parse_num(o.arg); // --max-qlen
else if (c == 340) fn_bed_junc = o.arg; // --junc-bed
else if (c == 341) opt.junc_bonus = atoi(o.arg); // --junc-bonus
else if (c == 342) opt.flag |= MM_F_SAM_HIT_ONLY; // --sam-hit-only
else if (c == 343) opt.chain_gap_scale = atof(o.arg); // --chain-gap-scale
else if (c == 351) opt.chain_skip_scale = atof(o.arg); // --chain-skip-scale
else if (c == 344) alt_list = o.arg; // --alt
else if (c == 345) opt.alt_drop = atof(o.arg); // --alt-drop
else if (c == 346) opt.mask_len = mm_parse_num(o.arg); // --mask-len
else if (c == 348) opt.flag |= MM_F_QSTRAND | MM_F_NO_INV; // --qstrand
else if (c == 349) opt.cap_kalloc = mm_parse_num(o.arg); // --cap-kalloc
else if (c == 350) opt.q_occ_frac = atof(o.arg); // --q-occ-frac
else if (c == 352) mm_dbg_flag |= MM_DBG_PRINT_CHAIN; // --print-chains
else if (c == 353) opt.flag |= MM_F_NO_HASH_NAME; // --no-hash-name
else if (c == 354) opt.flag |= MM_F_SECONDARY_SEQ; // --secondary-seq
else if (c == 355) opt.flag |= MM_F_OUT_DS; // --ds
else if (c == 356) opt.rmq_inner_dist = mm_parse_num(o.arg); // --rmq-inner
else if (c == 357) fn_spsc = o.arg; // --spsc
else if (c == 360) opt.jump_min_match = mm_parse_num(o.arg); // --jump-min-match
else if (c == 361) opt.flag |= MM_F_OUT_JUNC | MM_F_CIGAR; // --write-junc
else if (c == 362) fn_bed_pass1 = o.arg; // --jump-pass1
else if (c == 501) mm_dbg_flag |= MM_DBG_SEED_FREQ; // --dbg-seed-occ
else if (c == 363) spsc_scale = atof(o.arg); // --spsc-scale
else if (c == 358 || c == 364) opt.junc_pen = atoi(o.arg); // --junc-pen or --spsc0
else if (c == 330) {
fprintf(stderr, "[WARNING] \033[1;31m --lj-min-ratio has been deprecated.\033[0m\n");
} else if (c == 313) { // --sr
if (o.arg == 0 || strcmp(o.arg, "dna") == 0) {
opt.flag |= MM_F_SR;
} else if (strcmp(o.arg, "rna") == 0) {
opt.flag |= MM_F_SR_RNA;
} else if (strcmp(o.arg, "no") == 0) {
opt.flag &= ~(uint64_t)(MM_F_SR|MM_F_SR_RNA);
} else if (mm_verbose >= 2) {
opt.flag |= MM_F_SR;
fprintf(stderr, "[WARNING]\033[1;31m --sr only takes 'dna' or 'rna'. Invalid values are assumed to be 'dna'.\033[0m\n");
}
} else if (c == 314) { // --frag
yes_or_no(&opt, MM_F_FRAG_MODE, o.longidx, o.arg, 1);
} else if (c == 315) { // --secondary
yes_or_no(&opt, MM_F_NO_PRINT_2ND, o.longidx, o.arg, 0);
} else if (c == 316) { // --cs
opt.flag |= MM_F_OUT_CS | MM_F_CIGAR;
if (optarg == 0 || strcmp(optarg, "short") == 0) {
if (o.arg == 0 || strcmp(o.arg, "short") == 0) {
opt.flag &= ~MM_F_OUT_CS_LONG;
} else if (strcmp(optarg, "long") == 0) {
} else if (strcmp(o.arg, "long") == 0) {
opt.flag |= MM_F_OUT_CS_LONG;
} else if (strcmp(optarg, "none") == 0) {
} else if (strcmp(o.arg, "none") == 0) {
opt.flag &= ~MM_F_OUT_CS;
} else if (mm_verbose >= 2) {
fprintf(stderr, "[WARNING]\033[1;31m --cs only takes 'short' or 'long'. Invalid values are assumed to be 'short'.\033[0m\n");
}
} else if (c == 0 && long_idx == 19) { // --splice-flank
yes_or_no(&opt, MM_F_SPLICE_FLANK, long_idx, optarg, 1);
} else if (c == 0 && long_idx == 24) { // --heap-sort
yes_or_no(&opt, MM_F_HEAP_SORT, long_idx, optarg, 1);
} else if (c == 0 && long_idx == 26) { // --dual
yes_or_no(&opt, MM_F_NO_DUAL, long_idx, optarg, 0);
} else if (c == 319) { // --splice-flank
yes_or_no(&opt, MM_F_SPLICE_FLANK, o.longidx, o.arg, 1);
} else if (c == 324) { // --heap-sort
yes_or_no(&opt, MM_F_HEAP_SORT, o.longidx, o.arg, 1);
} else if (c == 326) { // --dual
yes_or_no(&opt, MM_F_NO_DUAL, o.longidx, o.arg, 0);
} else if (c == 347) { // --rmq
if (o.arg) yes_or_no(&opt, MM_F_RMQ, o.longidx, o.arg, 1);
else opt.flag |= MM_F_RMQ;
} else if (c == 359) { // --pairing
if (strcmp(o.arg, "no") == 0) opt.flag |= MM_F_INDEPEND_SEG;
else if (strcmp(o.arg, "weak") == 0) opt.flag |= MM_F_WEAK_PAIRING, opt.flag &= ~(uint64_t)MM_F_INDEPEND_SEG;
else {
if (strcmp(o.arg, "strong") != 0 && mm_verbose >= 2)
fprintf(stderr, "[WARNING]\033[1;31m unrecognized argument for --pairing; assuming 'strong'.\033[0m\n");
opt.flag &= ~(uint64_t)(MM_F_INDEPEND_SEG|MM_F_WEAK_PAIRING);
}
} else if (c == 'S') {
opt.flag |= MM_F_OUT_CS | MM_F_CIGAR | MM_F_OUT_CS_LONG;
if (mm_verbose >= 2)
@@ -191,54 +316,63 @@ int main(int argc, char *argv[])
} else if (c == 'V') {
puts(MM_VERSION);
return 0;
} else if (c == 'r') {
opt.bw = (int)mm_parse_num2(o.arg, &s);
if (*s == ',') opt.bw_long = (int)mm_parse_num2(s + 1, &s);
} else if (c == 'U') {
opt.min_mid_occ = strtol(o.arg, &s, 10);
if (*s == ',') opt.max_mid_occ = strtol(s + 1, &s, 10);
} else if (c == 'f') {
double x;
char *p;
x = strtod(optarg, &p);
x = strtod(o.arg, &p);
if (x < 1.0) opt.mid_occ_frac = x, opt.mid_occ = 0;
else opt.mid_occ = (int)(x + .499);
if (*p == ',') opt.max_occ = (int)(strtod(p+1, &p) + .499);
} else if (c == 'u') {
if (*optarg == 'b') opt.flag |= MM_F_SPLICE_FOR|MM_F_SPLICE_REV; // both strands
else if (*optarg == 'f') opt.flag |= MM_F_SPLICE_FOR, opt.flag &= ~MM_F_SPLICE_REV; // match GT-AG
else if (*optarg == 'r') opt.flag |= MM_F_SPLICE_REV, opt.flag &= ~MM_F_SPLICE_FOR; // match CT-AC (reverse complement of GT-AG)
else if (*optarg == 'n') opt.flag &= ~(MM_F_SPLICE_FOR|MM_F_SPLICE_REV); // don't try to match the GT-AG signal
if (*o.arg == 'b') opt.flag |= MM_F_SPLICE_FOR|MM_F_SPLICE_REV; // both strands
else if (*o.arg == 'f') opt.flag |= MM_F_SPLICE_FOR, opt.flag &= ~MM_F_SPLICE_REV; // match GT-AG
else if (*o.arg == 'r') opt.flag |= MM_F_SPLICE_REV, opt.flag &= ~MM_F_SPLICE_FOR; // match CT-AC (reverse complement of GT-AG)
else if (*o.arg == 'n') opt.flag &= ~(MM_F_SPLICE_FOR|MM_F_SPLICE_REV); // don't try to match the GT-AG signal
else {
fprintf(stderr, "[ERROR]\033[1;31m unrecognized cDNA direction\033[0m\n");
return 1;
}
} else if (c == 'z') {
opt.zdrop = opt.zdrop_inv = strtol(o.arg, &s, 10);
if (*s == ',') opt.zdrop_inv = strtol(s + 1, &s, 10);
} else if (c == 'O') {
opt.q = opt.q2 = strtol(optarg, &s, 10);
opt.q = opt.q2 = strtol(o.arg, &s, 10);
if (*s == ',') opt.q2 = strtol(s + 1, &s, 10);
} else if (c == 'E') {
opt.e = opt.e2 = strtol(optarg, &s, 10);
opt.e = opt.e2 = strtol(o.arg, &s, 10);
if (*s == ',') opt.e2 = strtol(s + 1, &s, 10);
}
}
if ((opt.flag & MM_F_SPLICE) && (opt.flag & MM_F_FRAG_MODE)) {
fprintf(stderr, "[ERROR]\033[1;31m --splice and --frag should not be specified at the same time.\033[0m\n");
return 1;
}
if (!fnw && !(opt.flag&MM_F_CIGAR))
ipt.flag |= MM_I_NO_SEQ;
if (mm_check_opt(&ipt, &opt) < 0)
return 1;
if (opt.best_n == 0) {
fprintf(stderr, "[WARNING]\033[1;31m changed '-N 0' to '-N %d --secondary=no'.\033[0m\n", old_best_n);
opt.best_n = old_best_n, opt.flag |= MM_F_NO_PRINT_2ND;
}
if (argc == optind || fp_help == stdout) {
if (argc == o.ind || fp_help == stdout) {
fprintf(fp_help, "Usage: minimap2 [options] <target.fa>|<target.idx> [query.fa] [...]\n");
fprintf(fp_help, "Options:\n");
fprintf(fp_help, " Indexing:\n");
fprintf(fp_help, " -H use homopolymer-compressed k-mer\n");
fprintf(fp_help, " -H use homopolymer-compressed k-mer (preferrable for PacBio)\n");
fprintf(fp_help, " -k INT k-mer size (no larger than 28) [%d]\n", ipt.k);
fprintf(fp_help, " -w INT minizer window size [%d]\n", ipt.w);
fprintf(fp_help, " -I NUM split index for every ~NUM input bases [4G]\n");
fprintf(fp_help, " -w INT minimizer window size [%d]\n", ipt.w);
fprintf(fp_help, " -I NUM split index for every ~NUM input bases [8G]\n");
fprintf(fp_help, " -d FILE dump index to FILE []\n");
fprintf(fp_help, " Mapping:\n");
fprintf(fp_help, " -f FLOAT filter out top FLOAT fraction of repetitive minimizers [%g]\n", opt.mid_occ_frac);
fprintf(fp_help, " -g NUM stop chain enlongation if there are no minimizers in INT-bp [%d]\n", opt.max_gap);
fprintf(fp_help, " -G NUM max intron length (effective with -xsplice; changing -r) [200k]\n");
fprintf(fp_help, " -F NUM max fragment length (effective with -xsr or in the fragment mode) [800]\n");
fprintf(fp_help, " -r NUM bandwidth used in chaining and DP-based alignment [%d]\n", opt.bw);
fprintf(fp_help, " -r NUM[,NUM] chaining/alignment bandwidth and long-join bandwidth [%d,%d]\n", opt.bw, opt.bw_long);
fprintf(fp_help, " -n INT minimal number of minimizers on a chain [%d]\n", opt.min_cnt);
fprintf(fp_help, " -m INT minimal chaining score (matching bases minus log gap penalty) [%d]\n", opt.min_chain_score);
// fprintf(fp_help, " -T INT SDUST threshold; 0 to disable SDUST [%d]\n", opt.sdust_thres); // TODO: this option is never used; might be buggy
@@ -247,48 +381,53 @@ int main(int argc, char *argv[])
fprintf(fp_help, " -N INT retain at most INT secondary alignments [%d]\n", opt.best_n);
fprintf(fp_help, " Alignment:\n");
fprintf(fp_help, " -A INT matching score [%d]\n", opt.a);
fprintf(fp_help, " -B INT mismatch penalty [%d]\n", opt.b);
fprintf(fp_help, " -B INT mismatch penalty (larger value for lower divergence) [%d]\n", opt.b);
fprintf(fp_help, " -O INT[,INT] gap open penalty [%d,%d]\n", opt.q, opt.q2);
fprintf(fp_help, " -E INT[,INT] gap extension penalty; a k-long gap costs min{O1+k*E1,O2+k*E2} [%d,%d]\n", opt.e, opt.e2);
fprintf(fp_help, " -z INT Z-drop score [%d]\n", opt.zdrop);
fprintf(fp_help, " -z INT[,INT] Z-drop score and inversion Z-drop score [%d,%d]\n", opt.zdrop, opt.zdrop_inv);
fprintf(fp_help, " -s INT minimal peak DP alignment score [%d]\n", opt.min_dp_max);
fprintf(fp_help, " -u CHAR how to find GT-AG. f:transcript strand, b:both strands, n:don't match GT-AG [n]\n");
fprintf(fp_help, " -J INT splice mode. 0: original minimap2 model; 1: miniprot model [1]\n");
fprintf(fp_help, " -j FILE junctions in BED12 to extend *short* RNA-seq alignment []\n");
fprintf(fp_help, " Input/Output:\n");
fprintf(fp_help, " -a output in the SAM format (PAF by default)\n");
fprintf(fp_help, " -Q don't output base quality in SAM\n");
fprintf(fp_help, " -o FILE output alignments to FILE [stdout]\n");
fprintf(fp_help, " -L write CIGAR with >65535 ops at the CG tag\n");
fprintf(fp_help, " -R STR SAM read group line in a format like '@RG\\tID:foo\\tSM:bar' []\n");
fprintf(fp_help, " -c output CIGAR in PAF\n");
fprintf(fp_help, " --cs[=STR] output the cs tag; STR is 'short' (if absent) or 'long' [none]\n");
fprintf(fp_help, " --ds output the ds tag, which is an extension to cs\n");
fprintf(fp_help, " --MD output the MD tag\n");
fprintf(fp_help, " --eqx write =/X CIGAR operators\n");
fprintf(fp_help, " -Y use soft clipping for supplementary alignments\n");
fprintf(fp_help, " -y copy FASTA/Q comments to output SAM\n");
fprintf(fp_help, " -t INT number of threads [%d]\n", n_threads);
fprintf(fp_help, " -K NUM minibatch size for mapping [500M]\n");
// fprintf(fp_help, " -v INT verbose level [%d]\n", mm_verbose);
fprintf(fp_help, " --version show version number\n");
fprintf(fp_help, " Preset:\n");
fprintf(fp_help, " -x STR preset (always applied before other options) []\n");
fprintf(fp_help, " map-pb: -Hk19 (PacBio vs reference mapping)\n");
fprintf(fp_help, " map-ont: -k15 (Oxford Nanopore vs reference mapping)\n");
fprintf(fp_help, " asm5: -k19 -w19 -A1 -B19 -O39,81 -E3,1 -s200 -z200 (asm to ref mapping; break at 5%% div.)\n");
fprintf(fp_help, " asm10: -k19 -w19 -A1 -B9 -O16,41 -E2,1 -s200 -z200 (asm to ref mapping; break at 10%% div.)\n");
fprintf(fp_help, " ava-pb: -Hk19 -Xw5 -m100 -g10000 --max-chain-skip 25 (PacBio read overlap)\n");
fprintf(fp_help, " ava-ont: -k15 -Xw5 -m100 -g10000 --max-chain-skip 25 (ONT read overlap)\n");
fprintf(fp_help, " splice: long-read spliced alignment (see minimap2.1 for details)\n");
fprintf(fp_help, " sr: short single-end reads without splicing (see minimap2.1 for details)\n");
fprintf(fp_help, "\nSee `man ./minimap2.1' for detailed description of command-line options.\n");
fprintf(fp_help, " -x STR preset (always applied before other options; see minimap2.1 for details) []\n");
fprintf(fp_help, " - lr:hq - accurate long reads (error rate <1%%) against a reference genome\n");
fprintf(fp_help, " - splice/splice:hq - spliced alignment for long reads/accurate long reads\n");
fprintf(fp_help, " - splice:sr - spliced alignment for short RNA-seq reads\n");
fprintf(fp_help, " - asm5/asm10/asm20 - asm-to-ref mapping, for ~0.1/1/5%% sequence divergence\n");
fprintf(fp_help, " - sr - short reads against a reference\n");
fprintf(fp_help, " - map-pb/map-hifi/map-ont/map-iclr - CLR/HiFi/Nanopore/ICLR vs reference mapping\n");
fprintf(fp_help, " - ava-pb/ava-ont - PacBio CLR/Nanopore read overlap\n");
fprintf(fp_help, "\nSee `man ./minimap2.1' for detailed description of these and other advanced command-line options.\n");
return fp_help == stdout? 0 : 1;
}
if ((opt.flag & MM_F_SR) && argc - optind > 3) {
if ((opt.flag & MM_F_SR) && argc - o.ind > 3) {
fprintf(stderr, "[ERROR] incorrect input: in the sr mode, please specify no more than two query files.\n");
return 1;
}
idx_rdr = mm_idx_reader_open(argv[optind], &ipt, fnw);
idx_rdr = mm_idx_reader_open(argv[o.ind], &ipt, fnw);
if (idx_rdr == 0) {
fprintf(stderr, "[ERROR] failed to open file '%s'\n", argv[optind]);
fprintf(stderr, "[ERROR] failed to open file '%s': %s\n", argv[o.ind], strerror(errno));
return 1;
}
if (!idx_rdr->is_idx && fnw == 0 && argc - optind < 2) {
if (!idx_rdr->is_idx && fnw == 0 && argc - o.ind < 2) {
fprintf(stderr, "[ERROR] missing input: please specify a query file to map or option -d to keep the index\n");
mm_idx_reader_close(idx_rdr);
return 1;
@@ -296,6 +435,7 @@ int main(int argc, char *argv[])
if (opt.best_n == 0 && (opt.flag&MM_F_CIGAR) && mm_verbose >= 2)
fprintf(stderr, "[WARNING]\033[1;31m `-N 0' reduces alignment accuracy. Please use --secondary=no to suppress secondary alignments.\033[0m\n");
while ((mi = mm_idx_reader_read(idx_rdr, n_threads)) != 0) {
int ret;
if ((opt.flag & MM_F_CIGAR) && (mi->flag & MM_I_NO_SEQ)) {
fprintf(stderr, "[ERROR] the prebuilt index doesn't contain sequences.\n");
mm_idx_destroy(mi);
@@ -304,32 +444,83 @@ int main(int argc, char *argv[])
}
if ((opt.flag & MM_F_OUT_SAM) && idx_rdr->n_parts == 1) {
if (mm_idx_reader_eof(idx_rdr)) {
mm_write_sam_hdr(mi, rg, MM_VERSION, argc, argv);
if (opt.split_prefix == 0)
ret = mm_write_sam_hdr(mi, rg, MM_VERSION, argc, argv);
else
ret = mm_write_sam_hdr(0, rg, MM_VERSION, argc, argv);
} else {
mm_write_sam_hdr(0, rg, MM_VERSION, argc, argv);
if (mm_verbose >= 2)
fprintf(stderr, "[WARNING]\033[1;31m For a multi-part index, no @SQ lines will be outputted.\033[0m\n");
ret = mm_write_sam_hdr(0, rg, MM_VERSION, argc, argv);
if (opt.split_prefix == 0 && mm_verbose >= 2)
fprintf(stderr, "[WARNING]\033[1;31m For a multi-part index, no @SQ lines will be outputted. Please use --split-prefix.\033[0m\n");
}
if (ret != 0) {
mm_idx_destroy(mi);
mm_idx_reader_close(idx_rdr);
return 1;
}
}
if (mm_verbose >= 3)
fprintf(stderr, "[M::%s::%.3f*%.2f] loaded/built the index for %d target sequence(s)\n",
__func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), mi->n_seq);
if (argc != optind + 1) mm_mapopt_update(&opt, mi);
if (argc != o.ind + 1) mm_mapopt_update(&opt, mi);
if (mm_verbose >= 3) mm_idx_stat(mi);
if (fn_bed_junc) {
mm_idx_bed_read(mi, fn_bed_junc, 1);
if (mi->I == 0 && mm_verbose >= 2)
fprintf(stderr, "[WARNING] failed to load the junction BED file\n");
}
if (fn_bed_jump) {
mm_idx_jjump_read(mi, fn_bed_jump, MM_JUNC_ANNO, -1);
if (mi->J == 0 && mm_verbose >= 2)
fprintf(stderr, "[WARNING] failed to load the jump BED file\n");
}
if (fn_bed_pass1) {
mm_idx_jjump_read(mi, fn_bed_pass1, MM_JUNC_MISC, 5);
if (mi->J == 0 && mm_verbose >= 2)
fprintf(stderr, "[WARNING] failed to load the pass-1 jump BED file\n");
}
if (fn_spsc) {
mm_idx_spsc_read2(mi, fn_spsc, mm_max_spsc_bonus(&opt), spsc_scale);
if (mi->spsc == 0 && mm_verbose >= 2)
fprintf(stderr, "[WARNING] failed to load the splice score file\n");
}
if (alt_list) mm_idx_alt_read(mi, alt_list);
if (argc - (o.ind + 1) == 0) {
mm_idx_destroy(mi);
continue; // no query files
}
ret = 0;
if (!(opt.flag & MM_F_FRAG_MODE)) {
for (i = optind + 1; i < argc; ++i)
mm_map_file(mi, argv[i], &opt, n_threads);
for (i = o.ind + 1; i < argc; ++i) {
ret = mm_map_file(mi, argv[i], &opt, n_threads);
if (ret < 0) break;
}
} else {
mm_map_file_frag(mi, argc - (optind + 1), (const char**)&argv[optind + 1], &opt, n_threads);
ret = mm_map_file_frag(mi, argc - (o.ind + 1), (const char**)&argv[o.ind + 1], &opt, n_threads);
}
mm_idx_destroy(mi);
if (ret < 0) {
fprintf(stderr, "ERROR: failed to map the query file\n");
exit(EXIT_FAILURE);
}
}
n_parts = idx_rdr->n_parts;
mm_idx_reader_close(idx_rdr);
if (opt.split_prefix)
mm_split_merge(argc - (o.ind + 1), (const char**)&argv[o.ind + 1], &opt, n_parts);
if (fflush(stdout) == EOF) {
perror("[ERROR] failed to write the results");
exit(EXIT_FAILURE);
}
if (mm_verbose >= 3) {
fprintf(stderr, "[M::%s] Version: %s\n", __func__, MM_VERSION);
fprintf(stderr, "[M::%s] CMD:", __func__);
for (i = 0; i < argc; ++i)
fprintf(stderr, " %s", argv[i]);
fprintf(stderr, "\n[M::%s] Real time: %.3f sec; CPU: %.3f sec\n", __func__, realtime() - mm_realtime0, cputime());
fprintf(stderr, "\n[M::%s] Real time: %.3f sec; CPU: %.3f sec; Peak RSS: %.3f GB\n", __func__, realtime() - mm_realtime0, cputime(), peakrss() / 1024.0 / 1024.0 / 1024.0);
}
return 0;
}
+300 -113
View File
@@ -1,6 +1,7 @@
#include <stdlib.h>
#include <string.h>
#include <assert.h>
#include <errno.h>
#include "kthread.h"
#include "kvec.h"
#include "kalloc.h"
@@ -9,10 +10,6 @@
#include "bseq.h"
#include "khash.h"
struct mm_tbuf_s {
void *km;
};
mm_tbuf_t *mm_tbuf_init(void)
{
mm_tbuf_t *b;
@@ -28,6 +25,11 @@ void mm_tbuf_destroy(mm_tbuf_t *b)
free(b);
}
void *mm_tbuf_get_km(mm_tbuf_t *b)
{
return b->km;
}
static int mm_dust_minier(void *km, int n, mm128_t *a, int l_seq, const char *seq, int sdust_thres)
{
int n_dreg, j, k, u = 0;
@@ -39,12 +41,12 @@ static int mm_dust_minier(void *km, int n, mm128_t *a, int l_seq, const char *se
for (j = k = 0; j < n; ++j) { // squeeze out minimizers that significantly overlap with LCRs
int32_t qpos = (uint32_t)a[j].y>>1, span = a[j].x&0xff;
int32_t s = qpos - (span - 1), e = s + span;
while (u < n_dreg && (uint32_t)dreg[u] <= s) ++u;
if (u < n_dreg && dreg[u]>>32 < e) {
while (u < n_dreg && (int32_t)dreg[u] <= s) ++u;
if (u < n_dreg && (int32_t)(dreg[u]>>32) < e) {
int v, l = 0;
for (v = u; v < n_dreg && dreg[v]>>32 < e; ++v) { // iterate over LCRs overlapping this minimizer
int ss = s > dreg[v]>>32? s : dreg[v]>>32;
int ee = e < (uint32_t)dreg[v]? e : (uint32_t)dreg[v];
for (v = u; v < n_dreg && (int32_t)(dreg[v]>>32) < e; ++v) { // iterate over LCRs overlapping this minimizer
int ss = s > (int32_t)(dreg[v]>>32)? s : dreg[v]>>32;
int ee = e < (int32_t)dreg[v]? e : (uint32_t)dreg[v];
l += ee - ss;
}
if (l <= span>>1) a[k++] = a[j]; // keep the minimizer if less than half of it falls in masked region
@@ -56,9 +58,10 @@ static int mm_dust_minier(void *km, int n, mm128_t *a, int l_seq, const char *se
static void collect_minimizers(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, mm128_v *mv)
{
int i, j, n, sum = 0;
int i, n, sum = 0;
mv->n = 0;
for (i = n = 0; i < n_segs; ++i) {
size_t j;
mm_sketch(km, seqs[i], qlens[i], mi->w, mi->k, i, mi->flag&MM_I_HPC, mv);
for (j = n; j < mv->n; ++j)
mv->a[j].y += sum << 1;
@@ -72,55 +75,14 @@ static void collect_minimizers(void *km, const mm_mapopt_t *opt, const mm_idx_t
#define heap_lt(a, b) ((a).x > (b).x)
KSORT_INIT(heap, mm128_t, heap_lt)
typedef struct {
uint32_t n;
uint32_t q_pos, q_span;
uint32_t seg_id:31, is_tandem:1;
const uint64_t *cr;
} mm_match_t;
static mm_match_t *collect_matches(void *km, int *_n_m, int max_occ, const mm_idx_t *mi, const mm128_v *mv, int64_t *n_a, int *rep_len, int *n_mini_pos, uint64_t **mini_pos)
{
int i, rep_st = 0, rep_en = 0, n_m;
mm_match_t *m;
*n_mini_pos = 0;
*mini_pos = (uint64_t*)kmalloc(km, mv->n * sizeof(uint64_t));
m = (mm_match_t*)kmalloc(km, mv->n * sizeof(mm_match_t));
for (i = n_m = 0, *rep_len = 0, *n_a = 0; i < mv->n; ++i) {
const uint64_t *cr;
mm128_t *p = &mv->a[i];
uint32_t q_pos = (uint32_t)p->y, q_span = p->x & 0xff;
int t;
cr = mm_idx_get(mi, p->x>>8, &t);
if (t >= max_occ) {
int en = (q_pos >> 1) + 1, st = en - q_span;
if (st > rep_en) {
*rep_len += rep_en - rep_st;
rep_st = st, rep_en = en;
} else rep_en = en;
} else {
mm_match_t *q = &m[n_m++];
q->q_pos = q_pos, q->q_span = q_span, q->cr = cr, q->n = t, q->seg_id = p->y >> 32;
q->is_tandem = 0;
if (i > 0 && p->x>>8 == mv->a[i - 1].x>>8) q->is_tandem = 1;
if (i < mv->n - 1 && p->x>>8 == mv->a[i + 1].x>>8) q->is_tandem = 1;
*n_a += q->n;
(*mini_pos)[(*n_mini_pos)++] = (uint64_t)q_span<<32 | q_pos>>1;
}
}
*rep_len += rep_en - rep_st;
*_n_m = n_m;
return m;
}
static inline int skip_seed(int flag, uint64_t r, const mm_match_t *q, const char *qname, int qlen, const mm_idx_t *mi, int *is_self)
static inline int skip_seed(int flag, uint64_t r, const mm_seed_t *q, const char *qname, int qlen, const mm_idx_t *mi, int *is_self)
{
*is_self = 0;
if (qname && (flag & (MM_F_NO_DIAG|MM_F_NO_DUAL))) {
const mm_idx_seq_t *s = &mi->seq[r>>32];
int cmp;
cmp = strcmp(qname, s->name);
if ((flag&MM_F_NO_DIAG) && cmp == 0 && s->len == qlen) {
if ((flag&MM_F_NO_DIAG) && cmp == 0 && (int)s->len == qlen) {
if ((uint32_t)r>>1 == (q->q_pos>>1)) return 1; // avoid the diagnonal anchors
if ((r&1) == (q->q_pos&1)) *is_self = 1; // this flag is used to avoid spurious extension on self chain
}
@@ -142,10 +104,10 @@ static mm128_t *collect_seed_hits_heap(void *km, const mm_mapopt_t *opt, int max
{
int i, n_m, heap_size = 0;
int64_t j, n_for = 0, n_rev = 0;
mm_match_t *m;
mm_seed_t *m;
mm128_t *a, *heap;
m = collect_matches(km, &n_m, max_occ, mi, mv, n_a, rep_len, n_mini_pos, mini_pos);
m = mm_collect_matches(km, &n_m, qlen, max_occ, opt->max_max_occ, opt->occ_dist, mi, mv, n_a, rep_len, n_mini_pos, mini_pos);
heap = (mm128_t*)kmalloc(km, n_m * sizeof(mm128_t));
a = (mm128_t*)kmalloc(km, *n_a * sizeof(mm128_t));
@@ -159,11 +121,11 @@ static mm128_t *collect_seed_hits_heap(void *km, const mm_mapopt_t *opt, int max
}
ks_heapmake_heap(heap_size, heap);
while (heap_size > 0) {
mm_match_t *q = &m[heap->y>>32];
mm_seed_t *q = &m[heap->y>>32];
mm128_t *p;
uint64_t r = heap->x;
int32_t is_self, rpos = (uint32_t)r >> 1;
if (skip_seed(opt->flag, r, q, qname, qlen, mi, &is_self)) continue;
if (!skip_seed(opt->flag, r, q, qname, qlen, mi, &is_self)) {
if ((r&1) == (q->q_pos&1)) { // forward strand
p = &a[n_for++];
p->x = (r&0xffffffff00000000ULL) | rpos;
@@ -176,6 +138,7 @@ static mm128_t *collect_seed_hits_heap(void *km, const mm_mapopt_t *opt, int max
p->y |= (uint64_t)q->seg_id << MM_SEED_SEG_SHIFT;
if (q->is_tandem) p->y |= MM_SEED_TANDEM;
if (is_self) p->y |= MM_SEED_SELF;
}
// update the heap
if ((uint32_t)heap->y < q->n - 1) {
++heap[0].y;
@@ -205,14 +168,15 @@ static mm128_t *collect_seed_hits_heap(void *km, const mm_mapopt_t *opt, int max
static mm128_t *collect_seed_hits(void *km, const mm_mapopt_t *opt, int max_occ, const mm_idx_t *mi, const char *qname, const mm128_v *mv, int qlen, int64_t *n_a, int *rep_len,
int *n_mini_pos, uint64_t **mini_pos)
{
int i, k, n_m;
mm_match_t *m;
int i, n_m;
mm_seed_t *m;
mm128_t *a;
m = collect_matches(km, &n_m, max_occ, mi, mv, n_a, rep_len, n_mini_pos, mini_pos);
m = mm_collect_matches(km, &n_m, qlen, max_occ, opt->max_max_occ, opt->occ_dist, mi, mv, n_a, rep_len, n_mini_pos, mini_pos);
a = (mm128_t*)kmalloc(km, *n_a * sizeof(mm128_t));
for (i = 0, *n_a = 0; i < n_m; ++i) {
mm_match_t *q = &m[i];
mm_seed_t *q = &m[i];
const uint64_t *r = q->cr;
uint32_t k;
for (k = 0; k < q->n; ++k) {
int32_t is_self, rpos = (uint32_t)r[k] >> 1;
mm128_t *p;
@@ -221,9 +185,13 @@ static mm128_t *collect_seed_hits(void *km, const mm_mapopt_t *opt, int max_occ,
if ((r[k]&1) == (q->q_pos&1)) { // forward strand
p->x = (r[k]&0xffffffff00000000ULL) | rpos;
p->y = (uint64_t)q->q_span << 32 | q->q_pos >> 1;
} else { // reverse strand
} else if (!(opt->flag & MM_F_QSTRAND)) { // reverse strand and not in the query-strand mode
p->x = 1ULL<<63 | (r[k]&0xffffffff00000000ULL) | rpos;
p->y = (uint64_t)q->q_span << 32 | (qlen - ((q->q_pos>>1) + 1 - q->q_span) - 1);
} else { // reverse strand; query-strand
int32_t len = mi->seq[r[k]>>32].len;
p->x = 1ULL<<63 | (r[k]&0xffffffff00000000ULL) | (len - (rpos + 1 - q->q_span) - 1); // coordinate only accurate for non-HPC seeds
p->y = (uint64_t)q->q_span << 32 | q->q_pos >> 1;
}
p->y |= (uint64_t)q->seg_id << MM_SEED_SEG_SHIFT;
if (q->is_tandem) p->y |= MM_SEED_TANDEM;
@@ -238,11 +206,9 @@ static mm128_t *collect_seed_hits(void *km, const mm_mapopt_t *opt, int max_occ,
static void chain_post(const mm_mapopt_t *opt, int max_chain_gap_ref, const mm_idx_t *mi, void *km, int qlen, int n_segs, const int *qlens, int *n_regs, mm_reg1_t *regs, mm128_t *a)
{
if (!(opt->flag & MM_F_ALL_CHAINS)) { // don't choose primary mapping(s)
mm_set_parent(km, opt->mask_level, *n_regs, regs, opt->a * 2 + opt->b);
if (n_segs <= 1) mm_select_sub(km, opt->pri_ratio, mi->k*2, opt->best_n, n_regs, regs);
mm_set_parent(km, opt->mask_level, opt->mask_len, *n_regs, regs, opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL, opt->alt_drop);
if (n_segs <= 1) mm_select_sub(km, opt->pri_ratio, mi->k*2, opt->best_n, 1, opt->max_gap * 0.8, n_regs, regs);
else mm_select_sub_multi(km, opt->pri_ratio, 0.2f, 0.7f, max_chain_gap_ref, mi->k*2, opt->best_n, n_segs, qlens, n_regs, regs);
if (!(opt->flag & (MM_F_SPLICE|MM_F_SR|MM_F_NO_LJOIN))) // long join not working well without primary chains
mm_join_long(km, opt, qlen, n_regs, regs, a);
}
}
@@ -251,17 +217,17 @@ static mm_reg1_t *align_regs(const mm_mapopt_t *opt, const mm_idx_t *mi, void *k
if (!(opt->flag & MM_F_CIGAR)) return regs;
regs = mm_align_skeleton(km, opt, mi, qlen, seq, n_regs, regs, a); // this calls mm_filter_regs()
if (!(opt->flag & MM_F_ALL_CHAINS)) { // don't choose primary mapping(s)
mm_set_parent(km, opt->mask_level, *n_regs, regs, opt->a * 2 + opt->b);
mm_select_sub(km, opt->pri_ratio, mi->k*2, opt->best_n, n_regs, regs);
mm_set_parent(km, opt->mask_level, opt->mask_len, *n_regs, regs, opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL, opt->alt_drop);
mm_select_sub(km, opt->pri_ratio, mi->k*2, opt->best_n, 0, opt->max_gap * 0.8, n_regs, regs);
mm_set_sam_pri(*n_regs, regs);
}
return regs;
}
void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, int *n_regs, mm_reg1_t **regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname)
void mm_map_frag_core(const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, int *n_regs, mm_reg1_t **regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname)
{
int i, j, rep_len, qlen_sum, n_regs0, n_mini_pos;
int max_chain_gap_qry, max_chain_gap_ref, is_splice = !!(opt->flag & MM_F_SPLICE), is_sr = !!(opt->flag & MM_F_SR);
int max_chain_gap_qry, max_chain_gap_ref, is_splice = !!(opt->flag & MM_F_SPLICE), is_sr = !!(opt->flag & MM_F_SR), is_sr_rna = !!(opt->flag & MM_F_SR_RNA);
uint32_t hash;
int64_t n_a;
uint64_t *u, *mini_pos;
@@ -269,17 +235,20 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
mm128_v mv = {0,0,0};
mm_reg1_t *regs0;
km_stat_t kmst;
float chn_pen_gap, chn_pen_skip;
for (i = 0, qlen_sum = 0; i < n_segs; ++i)
qlen_sum += qlens[i], n_regs[i] = 0, regs[i] = 0;
if (qlen_sum == 0 || n_segs <= 0 || n_segs > MM_MAX_SEG) return;
if (opt->max_qlen > 0 && qlen_sum > opt->max_qlen) return;
hash = qname? __ac_X31_hash_string(qname) : 0;
hash = qname && !(opt->flag & MM_F_NO_HASH_NAME)? __ac_X31_hash_string(qname) : 0;
hash ^= __ac_Wang_hash(qlen_sum) + __ac_Wang_hash(opt->seed);
hash = __ac_Wang_hash(hash);
collect_minimizers(b->km, opt, mi, n_segs, qlens, seqs, &mv);
if (opt->q_occ_frac > 0.0f) mm_seed_mz_flt(b->km, &mv, opt->mid_occ, opt->q_occ_frac);
if (opt->flag & MM_F_HEAP_SORT) a = collect_seed_hits_heap(b->km, opt, opt->mid_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
else a = collect_seed_hits(b->km, opt, opt->mid_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
@@ -301,17 +270,35 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
if (max_chain_gap_ref < opt->max_gap) max_chain_gap_ref = opt->max_gap;
} else max_chain_gap_ref = opt->max_gap;
a = mm_chain_dp(max_chain_gap_ref, max_chain_gap_qry, opt->bw, opt->max_chain_skip, opt->min_cnt, opt->min_chain_score, is_splice, n_segs, n_a, a, &n_regs0, &u, b->km);
chn_pen_gap = opt->chain_gap_scale * 0.01 * mi->k;
chn_pen_skip = opt->chain_skip_scale * 0.01 * mi->k;
if (opt->flag & MM_F_RMQ) {
a = mg_lchain_rmq(opt->max_gap, opt->rmq_inner_dist, opt->bw, opt->max_chain_skip, opt->rmq_size_cap, opt->min_cnt, opt->min_chain_score,
chn_pen_gap, chn_pen_skip, n_a, a, &n_regs0, &u, b->km);
} else {
a = mg_lchain_dp(max_chain_gap_ref, max_chain_gap_qry, opt->bw, opt->max_chain_skip, opt->max_chain_iter, opt->min_cnt, opt->min_chain_score,
chn_pen_gap, chn_pen_skip, is_splice, n_segs, n_a, a, &n_regs0, &u, b->km);
}
if (opt->max_occ > opt->mid_occ && rep_len > 0) {
if (opt->bw_long > opt->bw && (opt->flag & (MM_F_SPLICE|MM_F_SR|MM_F_NO_LJOIN)) == 0 && n_segs == 1 && n_regs0 > 1) { // re-chain/long-join for long sequences
int32_t st = (int32_t)a[0].y, en = (int32_t)a[(int32_t)u[0] - 1].y;
if (qlen_sum - (en - st) > opt->rmq_rescue_size || en - st > qlen_sum * opt->rmq_rescue_ratio) {
int32_t i;
for (i = 0, n_a = 0; i < n_regs0; ++i) n_a += (int32_t)u[i];
kfree(b->km, u);
radix_sort_128x(a, a + n_a);
a = mg_lchain_rmq(opt->max_gap, opt->rmq_inner_dist, opt->bw_long, opt->max_chain_skip, opt->rmq_size_cap, opt->min_cnt, opt->min_chain_score,
chn_pen_gap, chn_pen_skip, n_a, a, &n_regs0, &u, b->km);
}
} else if (opt->max_occ > opt->mid_occ && rep_len > 0 && !(opt->flag & MM_F_RMQ)) { // re-chain, mostly for short reads
int rechain = 0;
if (n_regs0 > 0) { // test if the best chain has all the segments
int n_chained_segs = 1, max = 0, max_i = -1, max_off = -1, off = 0;
for (i = 0; i < n_regs0; ++i) { // find the best chain
if (max < u[i]>>32) max = u[i]>>32, max_i = i, max_off = off;
if (max < (int)(u[i]>>32)) max = u[i]>>32, max_i = i, max_off = off;
off += (uint32_t)u[i];
}
for (i = 1; i < (uint32_t)u[max_i]; ++i) // count the number of segments in the best chain
for (i = 1; i < (int32_t)u[max_i]; ++i) // count the number of segments in the best chain
if ((a[max_off+i].y&MM_SEED_SEG_MASK) != (a[max_off+i-1].y&MM_SEED_SEG_MASK))
++n_chained_segs;
if (n_chained_segs < n_segs)
@@ -323,33 +310,44 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
kfree(b->km, mini_pos);
if (opt->flag & MM_F_HEAP_SORT) a = collect_seed_hits_heap(b->km, opt, opt->max_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
else a = collect_seed_hits(b->km, opt, opt->max_occ, mi, qname, &mv, qlen_sum, &n_a, &rep_len, &n_mini_pos, &mini_pos);
a = mm_chain_dp(max_chain_gap_ref, max_chain_gap_qry, opt->bw, opt->max_chain_skip, opt->min_cnt, opt->min_chain_score, is_splice, n_segs, n_a, a, &n_regs0, &u, b->km);
a = mg_lchain_dp(max_chain_gap_ref, max_chain_gap_qry, opt->bw, opt->max_chain_skip, opt->max_chain_iter, opt->min_cnt, opt->min_chain_score,
chn_pen_gap, chn_pen_skip, is_splice, n_segs, n_a, a, &n_regs0, &u, b->km);
}
}
b->frag_gap = max_chain_gap_ref;
b->rep_len = rep_len;
regs0 = mm_gen_regs(b->km, hash, qlen_sum, n_regs0, u, a);
regs0 = mm_gen_regs(b->km, hash, qlen_sum, n_regs0, u, a, !!(opt->flag&MM_F_QSTRAND));
if (mi->n_alt) {
mm_mark_alt(mi, n_regs0, regs0);
mm_hit_sort(b->km, &n_regs0, regs0, opt->alt_drop); // this step can be merged into mm_gen_regs(); will do if this shows up in profile
}
if (mm_dbg_flag & MM_DBG_PRINT_SEED)
if (mm_dbg_flag & (MM_DBG_PRINT_SEED|MM_DBG_PRINT_CHAIN))
for (j = 0; j < n_regs0; ++j)
for (i = regs0[j].as; i < regs0[j].as + regs0[j].cnt; ++i)
fprintf(stderr, "CN\t%d\t%s\t%d\t%c\t%d\t%d\t%d\n", j, mi->seq[a[i].x<<1>>33].name, (int32_t)a[i].x, "+-"[a[i].x>>63], (int32_t)a[i].y, (int32_t)(a[i].y>>32&0xff),
i == regs0[j].as? 0 : ((int32_t)a[i].y - (int32_t)a[i-1].y) - ((int32_t)a[i].x - (int32_t)a[i-1].x));
chain_post(opt, max_chain_gap_ref, mi, b->km, qlen_sum, n_segs, qlens, &n_regs0, regs0, a);
if (!is_sr) mm_est_err(mi, qlen_sum, n_regs0, regs0, a, n_mini_pos, mini_pos);
if (!is_sr && !(opt->flag&MM_F_QSTRAND)) {
mm_est_err(mi, qlen_sum, n_regs0, regs0, a, n_mini_pos, mini_pos);
n_regs0 = mm_filter_strand_retained(n_regs0, regs0);
}
if (n_segs == 1) { // uni-segment
regs0 = align_regs(opt, mi, b->km, qlens[0], seqs[0], &n_regs0, regs0, a);
mm_set_mapq(n_regs0, regs0, opt->min_chain_score, opt->a, rep_len, is_sr);
regs0 = (mm_reg1_t*)realloc(regs0, sizeof(*regs0) * n_regs0);
mm_set_mapq2(b->km, n_regs0, regs0, opt->min_chain_score, opt->a, rep_len, is_sr || is_sr_rna, is_splice);
n_regs[0] = n_regs0, regs[0] = regs0;
} else { // multi-segment
mm_seg_t *seg;
seg = mm_seg_gen(b->km, hash, n_segs, qlens, n_regs0, regs0, n_regs, regs, a); // split fragment chain to separate segment chains
free(regs0);
for (i = 0; i < n_segs; ++i) {
mm_set_parent(b->km, opt->mask_level, n_regs[i], regs[i], opt->a * 2 + opt->b); // update mm_reg1_t::parent
mm_set_parent(b->km, opt->mask_level, opt->mask_len, n_regs[i], regs[i], opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL, opt->alt_drop); // update mm_reg1_t::parent
regs[i] = align_regs(opt, mi, b->km, qlens[i], seqs[i], &n_regs[i], regs[i], seg[i].a);
mm_set_mapq(n_regs[i], regs[i], opt->min_chain_score, opt->a, rep_len, is_sr);
mm_set_mapq2(b->km, n_regs[i], regs[i], opt->min_chain_score, opt->a, rep_len, is_sr || is_sr_rna, is_splice);
}
mm_seg_free(b->km, n_segs, seg);
if (n_segs == 2 && opt->pe_ori >= 0 && (opt->flag&MM_F_CIGAR))
@@ -361,18 +359,36 @@ void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **
kfree(b->km, u);
kfree(b->km, mini_pos);
if (mi->J && n_segs == 1 && is_splice)
for (i = 0; i < n_regs0; ++i)
mm_jump_split(b->km, mi, opt, qlens[0], (const uint8_t*)seqs[0], &regs0[i], 0);
if (b->km) {
km_stat(b->km, &kmst);
if (mm_dbg_flag & MM_DBG_PRINT_QNAME)
fprintf(stderr, "QM\t%s\t%d\tcap=%ld,nCore=%ld,largest=%ld\n", qname, qlen_sum, kmst.capacity, kmst.n_cores, kmst.largest);
assert(kmst.n_blocks == kmst.n_cores); // otherwise, there is a memory leak
if (kmst.largest > 1U<<28) {
if (kmst.largest > 1U<<28 || (opt->cap_kalloc > 0 && kmst.capacity > opt->cap_kalloc)) {
if (mm_dbg_flag & MM_DBG_PRINT_QNAME)
fprintf(stderr, "[W::%s] reset thread-local memory after read %s\n", __func__, qname);
km_destroy(b->km);
b->km = km_init();
}
}
}
void mm_map_frag(const mm_idx_t *mi, int n_segs, const int *qlens, const char **seqs, int *n_regs, mm_reg1_t **regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname)
{
if ((opt->flag & MM_F_WEAK_PAIRING) && n_segs == 2 && opt->pe_ori >= 0 && (opt->flag&MM_F_CIGAR)) {
int i;
for (i = 0; i < n_segs; ++i)
mm_map_frag_core(mi, 1, &qlens[i], &seqs[i], &n_regs[i], &regs[i], b, opt, qname);
mm_pair(b->km, opt->max_gap_ref, opt->pe_bonus, opt->a * 2 + opt->b, opt->a, qlens, n_regs, regs);
} else {
mm_map_frag_core(mi, n_segs, qlens, seqs, n_regs, regs, b, opt, qname);
}
}
mm_reg1_t *mm_map(const mm_idx_t *mi, int qlen, const char *seq, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt, const char *qname)
{
mm_reg1_t *regs;
@@ -385,18 +401,23 @@ mm_reg1_t *mm_map(const mm_idx_t *mi, int qlen, const char *seq, int *n_regs, mm
**************************/
typedef struct {
int mini_batch_size, n_processed, n_threads, n_fp;
int n_processed, n_threads, n_fp;
int64_t mini_batch_size;
const mm_mapopt_t *opt;
mm_bseq_file_t **fp;
const mm_idx_t *mi;
kstring_t str;
int n_parts;
uint32_t *rid_shift;
FILE *fp_split, **fp_parts;
} pipeline_t;
typedef struct {
const pipeline_t *p;
int n_seq, n_frag;
mm_bseq1_t *seq;
int *n_reg, *seg_off, *n_seg;
int *n_reg, *seg_off, *n_seg, *rep_len, *frag_gap;
mm_reg1_t **reg;
mm_tbuf_t **buf;
} step_t;
@@ -406,10 +427,13 @@ static void worker_for(void *_data, long i, int tid) // kt_for() callback
step_t *s = (step_t*)_data;
int qlens[MM_MAX_SEG], j, off = s->seg_off[i], pe_ori = s->p->opt->pe_ori;
const char *qseqs[MM_MAX_SEG];
double t = 0.0;
mm_tbuf_t *b = s->buf[tid];
assert(s->n_seg[i] <= MM_MAX_SEG);
if (mm_dbg_flag & MM_DBG_PRINT_QNAME)
if (mm_dbg_flag & MM_DBG_PRINT_QNAME) {
fprintf(stderr, "QR\t%s\t%d\t%d\n", s->seq[off].name, tid, s->seq[off].l_seq);
t = realtime();
}
for (j = 0; j < s->n_seg[i]; ++j) {
if (s->n_seg[i] == 2 && ((j == 0 && (pe_ori>>1&1)) || (j == 1 && (pe_ori&1))))
mm_revcomp_bseq(&s->seq[off + j]);
@@ -417,10 +441,17 @@ static void worker_for(void *_data, long i, int tid) // kt_for() callback
qseqs[j] = s->seq[off + j].seq;
}
if (s->p->opt->flag & MM_F_INDEPEND_SEG) {
for (j = 0; j < s->n_seg[i]; ++j)
for (j = 0; j < s->n_seg[i]; ++j) {
mm_map_frag(s->p->mi, 1, &qlens[j], &qseqs[j], &s->n_reg[off+j], &s->reg[off+j], b, s->p->opt, s->seq[off+j].name);
s->rep_len[off + j] = b->rep_len;
s->frag_gap[off + j] = b->frag_gap;
}
} else {
mm_map_frag(s->p->mi, s->n_seg[i], qlens, qseqs, &s->n_reg[off], &s->reg[off], b, s->p->opt, s->seq[off].name);
for (j = 0; j < s->n_seg[i]; ++j) {
s->rep_len[off + j] = b->rep_len;
s->frag_gap[off + j] = b->frag_gap;
}
}
for (j = 0; j < s->n_seg[i]; ++j) // flip the query strand and coordinate to the original read strand
if (s->n_seg[i] == 2 && ((j == 0 && (pe_ori>>1&1)) || (j == 1 && (pe_ori&1)))) {
@@ -432,8 +463,79 @@ static void worker_for(void *_data, long i, int tid) // kt_for() callback
r->qs = qlens[j] - r->qe;
r->qe = qlens[j] - t;
r->rev = !r->rev;
if (r->p) {
if (r->p->trans_strand == 1) r->p->trans_strand = 2;
else if (r->p->trans_strand == 2) r->p->trans_strand = 1;
}
}
}
if (mm_dbg_flag & MM_DBG_PRINT_QNAME)
fprintf(stderr, "QT\t%s\t%d\t%.6f\n", s->seq[off].name, tid, realtime() - t);
}
static void merge_hits(step_t *s)
{
int f, i, k0, k, max_seg = 0, *n_reg_part, *rep_len_part, *frag_gap_part, *qlens;
void *km;
FILE **fp = s->p->fp_parts;
const mm_mapopt_t *opt = s->p->opt;
km = km_init();
for (f = 0; f < s->n_frag; ++f)
max_seg = max_seg > s->n_seg[f]? max_seg : s->n_seg[f];
qlens = CALLOC(int, max_seg + s->p->n_parts * 3);
n_reg_part = qlens + max_seg;
rep_len_part = n_reg_part + s->p->n_parts;
frag_gap_part = rep_len_part + s->p->n_parts;
for (f = 0, k = k0 = 0; f < s->n_frag; ++f) {
k0 = k;
for (i = 0; i < s->n_seg[f]; ++i, ++k) {
int j, l, t, rep_len = 0;
qlens[i] = s->seq[k].l_seq;
for (j = 0, s->n_reg[k] = 0; j < s->p->n_parts; ++j) {
mm_err_fread(&n_reg_part[j], sizeof(int), 1, fp[j]);
mm_err_fread(&rep_len_part[j], sizeof(int), 1, fp[j]);
mm_err_fread(&frag_gap_part[j], sizeof(int), 1, fp[j]);
s->n_reg[k] += n_reg_part[j];
if (rep_len < rep_len_part[j])
rep_len = rep_len_part[j];
}
s->reg[k] = CALLOC(mm_reg1_t, s->n_reg[k]);
for (j = 0, l = 0; j < s->p->n_parts; ++j) {
for (t = 0; t < n_reg_part[j]; ++t, ++l) {
mm_reg1_t *r = &s->reg[k][l];
uint32_t capacity;
mm_err_fread(r, sizeof(mm_reg1_t), 1, fp[j]);
r->rid += s->p->rid_shift[j];
if (opt->flag & MM_F_CIGAR) {
mm_err_fread(&capacity, 4, 1, fp[j]);
r->p = (mm_extra_t*)calloc(capacity, 4);
r->p->capacity = capacity;
mm_err_fread(r->p, r->p->capacity, 4, fp[j]);
}
}
}
if (!(opt->flag&MM_F_SR) && s->seq[k].l_seq >= opt->rank_min_len)
mm_update_dp_max(s->seq[k].l_seq, s->n_reg[k], s->reg[k], opt->rank_frac, opt->a, opt->b);
for (j = 0; j < s->n_reg[k]; ++j) {
mm_reg1_t *r = &s->reg[k][j];
if (r->p) r->p->dp_max2 = 0; // reset ->dp_max2 as mm_set_parent() doesn't clear it; necessary with mm_update_dp_max()
r->subsc = 0; // this may not be necessary
r->n_sub = 0; // n_sub will be an underestimate as we don't see all the chains now, but it can't be accurate anyway
}
mm_hit_sort(km, &s->n_reg[k], s->reg[k], opt->alt_drop);
mm_set_parent(km, opt->mask_level, opt->mask_len, s->n_reg[k], s->reg[k], opt->a * 2 + opt->b, opt->flag&MM_F_HARD_MLEVEL, opt->alt_drop);
if (!(opt->flag & MM_F_ALL_CHAINS)) {
mm_select_sub(km, opt->pri_ratio, s->p->mi->k*2, opt->best_n, 0, opt->max_gap * 0.8, &s->n_reg[k], s->reg[k]);
mm_set_sam_pri(s->n_reg[k], s->reg[k]);
}
mm_set_mapq2(km, s->n_reg[k], s->reg[k], opt->min_chain_score, opt->a, rep_len, !!(opt->flag & (MM_F_SR|MM_F_SR_RNA)), !!(opt->flag & MM_F_SPLICE));
}
if (s->n_seg[f] == 2 && opt->pe_ori >= 0 && (opt->flag&MM_F_CIGAR))
mm_pair(km, frag_gap_part[0], opt->pe_bonus, opt->a * 2 + opt->b, opt->a, qlens, &s->n_reg[k0], &s->reg[k0]);
}
free(qlens);
km_destroy(km);
}
static void *worker_pipeline(void *shared, int step, void *in)
@@ -442,11 +544,12 @@ static void *worker_pipeline(void *shared, int step, void *in)
pipeline_t *p = (pipeline_t*)shared;
if (step == 0) { // step 0: read sequences
int with_qual = (!!(p->opt->flag & MM_F_OUT_SAM) && !(p->opt->flag & MM_F_NO_QUAL));
int with_comment = !!(p->opt->flag & MM_F_COPY_COMMENT);
int frag_mode = (p->n_fp > 1 || !!(p->opt->flag & MM_F_FRAG_MODE));
step_t *s;
s = (step_t*)calloc(1, sizeof(step_t));
if (p->n_fp > 1) s->seq = mm_bseq_read_frag(p->n_fp, p->fp, p->mini_batch_size, with_qual, &s->n_seq);
else s->seq = mm_bseq_read2(p->fp[0], p->mini_batch_size, with_qual, frag_mode, &s->n_seq);
if (p->n_fp > 1) s->seq = mm_bseq_read_frag2(p->n_fp, p->fp, p->mini_batch_size, with_qual, with_comment, &s->n_seq);
else s->seq = mm_bseq_read3(p->fp[0], p->mini_batch_size, with_qual, with_comment, frag_mode, &s->n_seq);
if (s->seq) {
s->p = p;
for (i = 0; i < s->n_seq; ++i)
@@ -454,9 +557,11 @@ static void *worker_pipeline(void *shared, int step, void *in)
s->buf = (mm_tbuf_t**)calloc(p->n_threads, sizeof(mm_tbuf_t*));
for (i = 0; i < p->n_threads; ++i)
s->buf[i] = mm_tbuf_init();
s->n_reg = (int*)calloc(3 * s->n_seq, sizeof(int));
s->seg_off = s->n_reg + s->n_seq; // seg_off and n_seg are allocated together with n_reg
s->n_reg = (int*)calloc(5 * s->n_seq, sizeof(int));
s->seg_off = s->n_reg + s->n_seq; // seg_off, n_seg, rep_len and frag_gap are allocated together with n_reg
s->n_seg = s->seg_off + s->n_seq;
s->rep_len = s->n_seg + s->n_seq;
s->frag_gap = s->rep_len + s->n_seq;
s->reg = (mm_reg1_t**)calloc(s->n_seq, sizeof(mm_reg1_t*));
for (i = 1, j = 0; i <= s->n_seq; ++i)
if (i == s->n_seq || !frag_mode || !mm_qname_same(s->seq[i-1].name, s->seq[i].name)) {
@@ -467,7 +572,8 @@ static void *worker_pipeline(void *shared, int step, void *in)
return s;
} else free(s);
} else if (step == 1) { // step 1: map
kt_for(p->n_threads, worker_for, in, ((step_t*)in)->n_frag);
if (p->n_parts > 0) merge_hits((step_t*)in);
else kt_for(p->n_threads, worker_for, in, ((step_t*)in)->n_frag);
return in;
} else if (step == 2) { // step 2: output
void *km = 0;
@@ -480,20 +586,43 @@ static void *worker_pipeline(void *shared, int step, void *in)
int seg_st = s->seg_off[k], seg_en = s->seg_off[k] + s->n_seg[k];
for (i = seg_st; i < seg_en; ++i) {
mm_bseq1_t *t = &s->seq[i];
if (p->opt->split_prefix && p->n_parts == 0) { // then write to temporary files
mm_err_fwrite(&s->n_reg[i], sizeof(int), 1, p->fp_split);
mm_err_fwrite(&s->rep_len[i], sizeof(int), 1, p->fp_split);
mm_err_fwrite(&s->frag_gap[i], sizeof(int), 1, p->fp_split);
for (j = 0; j < s->n_reg[i]; ++j) {
mm_reg1_t *r = &s->reg[i][j];
mm_err_fwrite(r, sizeof(mm_reg1_t), 1, p->fp_split);
if (p->opt->flag & MM_F_CIGAR) {
mm_err_fwrite(&r->p->capacity, 4, 1, p->fp_split);
mm_err_fwrite(r->p, r->p->capacity, 4, p->fp_split);
}
}
} else if (p->opt->flag & MM_F_OUT_JUNC) { // extra logic for --write-junc
for (j = 0; j < s->n_reg[i]; ++j) {
const mm_reg1_t *r = &s->reg[i][j];
if (r->id != r->parent || r->mapq < 10) continue;
mm_write_junc(&p->str, mi, t, r);
if (p->str.l > 0) mm_err_puts(p->str.s);
}
} else if (s->n_reg[i] > 0) { // the query has at least one hit
for (j = 0; j < s->n_reg[i]; ++j) {
const mm_reg1_t *r = &s->reg[i][j];
assert(!r->sam_pri || r->id == r->parent);
if ((p->opt->flag & MM_F_NO_PRINT_2ND) && r->id != r->parent)
continue;
if (p->opt->flag & MM_F_OUT_SAM)
mm_write_sam2(&p->str, mi, t, i - seg_st, j, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag);
mm_write_sam3(&p->str, mi, t, i - seg_st, j, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag, s->rep_len[i]);
else
mm_write_paf(&p->str, mi, t, r, km, p->opt->flag);
puts(p->str.s);
mm_write_paf4(&p->str, mi, t, r, km, p->opt->flag, s->rep_len[i], s->n_seg[k], i - seg_st);
mm_err_puts(p->str.s);
}
if (s->n_reg[i] == 0 && (p->opt->flag & MM_F_OUT_SAM)) {
mm_write_sam2(&p->str, mi, t, i - seg_st, -1, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag);
puts(p->str.s);
} else if ((p->opt->flag & MM_F_PAF_NO_HIT) || ((p->opt->flag & MM_F_OUT_SAM) && !(p->opt->flag & MM_F_SAM_HIT_ONLY))) { // output an empty hit, if requested
if (p->opt->flag & MM_F_OUT_SAM)
mm_write_sam3(&p->str, mi, t, i - seg_st, -1, s->n_seg[k], &s->n_reg[seg_st], (const mm_reg1_t*const*)&s->reg[seg_st], km, p->opt->flag, s->rep_len[i]);
else
mm_write_paf4(&p->str, mi, t, 0, 0, p->opt->flag, s->rep_len[i], s->n_seg[k], i - seg_st);
mm_err_puts(p->str.s);
}
}
for (i = seg_st; i < seg_en; ++i) {
@@ -501,9 +630,10 @@ static void *worker_pipeline(void *shared, int step, void *in)
free(s->reg[i]);
free(s->seq[i].seq); free(s->seq[i].name);
if (s->seq[i].qual) free(s->seq[i].qual);
if (s->seq[i].comment) free(s->seq[i].comment);
}
}
free(s->reg); free(s->n_reg); free(s->seq); // seg_off and n_seg were allocated with reg; no memory leak here
free(s->reg); free(s->n_reg); free(s->seq); // seg_off, n_seg, rep_len and frag_gap were allocated with reg; no memory leak here
km_destroy(km);
if (mm_verbose >= 3)
fprintf(stderr, "[M::%s::%.3f*%.2f] mapped %d sequences\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), s->n_seq);
@@ -512,32 +642,44 @@ static void *worker_pipeline(void *shared, int step, void *in)
return 0;
}
static mm_bseq_file_t **open_bseqs(int n, const char **fn)
{
mm_bseq_file_t **fp;
int i, j;
fp = (mm_bseq_file_t**)calloc(n, sizeof(mm_bseq_file_t*));
for (i = 0; i < n; ++i) {
if ((fp[i] = mm_bseq_open(fn[i])) == 0) {
if (mm_verbose >= 1)
fprintf(stderr, "ERROR: failed to open file '%s': %s\n", fn[i], strerror(errno));
for (j = 0; j < i; ++j)
mm_bseq_close(fp[j]);
free(fp);
return 0;
}
}
return fp;
}
int mm_map_file_frag(const mm_idx_t *idx, int n_segs, const char **fn, const mm_mapopt_t *opt, int n_threads)
{
int i, j, pl_threads;
int i, pl_threads;
pipeline_t pl;
if (n_segs < 1) return -1;
memset(&pl, 0, sizeof(pipeline_t));
pl.n_fp = n_segs;
pl.fp = (mm_bseq_file_t**)calloc(n_segs, sizeof(mm_bseq_file_t*));
for (i = 0; i < n_segs; ++i) {
pl.fp[i] = mm_bseq_open(fn[i]);
if (pl.fp[i] == 0) {
if (mm_verbose >= 1)
fprintf(stderr, "ERROR: failed to open file '%s'\n", fn[i]);
for (j = 0; j < i; ++j)
mm_bseq_close(pl.fp[j]);
free(pl.fp);
return -1;
}
}
pl.fp = open_bseqs(pl.n_fp, fn);
if (pl.fp == 0) return -1;
pl.opt = opt, pl.mi = idx;
pl.n_threads = n_threads > 1? n_threads : 1;
pl.mini_batch_size = opt->mini_batch_size;
if (opt->split_prefix)
pl.fp_split = mm_split_init(opt->split_prefix, idx);
pl_threads = n_threads == 1? 1 : (opt->flag&MM_F_2_IO_THREADS)? 3 : 2;
kt_pipeline(pl_threads, worker_pipeline, &pl, 3);
free(pl.str.s);
for (i = 0; i < n_segs; ++i)
if (pl.fp_split) fclose(pl.fp_split);
for (i = 0; i < pl.n_fp; ++i)
mm_bseq_close(pl.fp[i]);
free(pl.fp);
return 0;
@@ -547,3 +689,48 @@ int mm_map_file(const mm_idx_t *idx, const char *fn, const mm_mapopt_t *opt, int
{
return mm_map_file_frag(idx, 1, &fn, opt, n_threads);
}
int mm_split_merge(int n_segs, const char **fn, const mm_mapopt_t *opt, int n_split_idx)
{
int i;
pipeline_t pl;
mm_idx_t *mi;
if (n_segs < 1 || n_split_idx < 1) return -1;
memset(&pl, 0, sizeof(pipeline_t));
pl.n_fp = n_segs;
pl.fp = open_bseqs(pl.n_fp, fn);
if (pl.fp == 0) return -1;
pl.opt = opt;
pl.mini_batch_size = opt->mini_batch_size;
pl.n_parts = n_split_idx;
pl.fp_parts = CALLOC(FILE*, pl.n_parts);
pl.rid_shift = CALLOC(uint32_t, pl.n_parts);
pl.mi = mi = mm_split_merge_prep(opt->split_prefix, n_split_idx, pl.fp_parts, pl.rid_shift);
if (pl.mi == 0) {
free(pl.fp_parts);
free(pl.rid_shift);
return -1;
}
for (i = n_split_idx - 1; i > 0; --i)
pl.rid_shift[i] = pl.rid_shift[i - 1];
for (pl.rid_shift[0] = 0, i = 1; i < n_split_idx; ++i)
pl.rid_shift[i] += pl.rid_shift[i - 1];
if (opt->flag & MM_F_OUT_SAM)
for (i = 0; i < (int32_t)pl.mi->n_seq; ++i)
printf("@SQ\tSN:%s\tLN:%d\n", pl.mi->seq[i].name, pl.mi->seq[i].len);
kt_pipeline(2, worker_pipeline, &pl, 3);
free(pl.str.s);
mm_idx_destroy(mi);
free(pl.rid_shift);
for (i = 0; i < n_split_idx; ++i)
fclose(pl.fp_parts[i]);
free(pl.fp_parts);
for (i = 0; i < pl.n_fp; ++i)
mm_bseq_close(pl.fp[i]);
free(pl.fp);
mm_split_rm_tmp(opt->split_prefix, n_split_idx);
return 0;
}
+164 -35
View File
@@ -5,30 +5,49 @@
#include <stdio.h>
#include <sys/types.h>
#define MM_F_NO_DIAG 0x001 // no exact diagonal hit
#define MM_F_NO_DUAL 0x002 // skip pairs where query name is lexicographically larger than target name
#define MM_F_CIGAR 0x004
#define MM_F_OUT_SAM 0x008
#define MM_F_NO_QUAL 0x010
#define MM_F_OUT_CG 0x020
#define MM_F_OUT_CS 0x040
#define MM_F_SPLICE 0x080 // splice mode
#define MM_F_SPLICE_FOR 0x100 // match GT-AG
#define MM_F_SPLICE_REV 0x200 // match CT-AC, the reverse complement of GT-AG
#define MM_F_NO_LJOIN 0x400
#define MM_F_OUT_CS_LONG 0x800
#define MM_F_SR 0x1000
#define MM_F_FRAG_MODE 0x2000
#define MM_F_NO_PRINT_2ND 0x4000
#define MM_F_2_IO_THREADS 0x8000
#define MM_F_LONG_CIGAR 0x10000
#define MM_F_INDEPEND_SEG 0x20000
#define MM_F_SPLICE_FLANK 0x40000
#define MM_F_SOFTCLIP 0x80000
#define MM_F_FOR_ONLY 0x100000
#define MM_F_REV_ONLY 0x200000
#define MM_F_HEAP_SORT 0x400000
#define MM_F_ALL_CHAINS 0x800000
#define MM_VERSION "2.31-r1302"
#define MM_F_NO_DIAG (0x001LL) // no exact diagonal hit
#define MM_F_NO_DUAL (0x002LL) // skip pairs where query name is lexicographically larger than target name
#define MM_F_CIGAR (0x004LL)
#define MM_F_OUT_SAM (0x008LL)
#define MM_F_NO_QUAL (0x010LL)
#define MM_F_OUT_CG (0x020LL)
#define MM_F_OUT_CS (0x040LL)
#define MM_F_SPLICE (0x080LL) // splice mode
#define MM_F_SPLICE_FOR (0x100LL) // match GT-AG
#define MM_F_SPLICE_REV (0x200LL) // match CT-AC, the reverse complement of GT-AG
#define MM_F_NO_LJOIN (0x400LL)
#define MM_F_OUT_CS_LONG (0x800LL)
#define MM_F_SR (0x1000LL)
#define MM_F_FRAG_MODE (0x2000LL)
#define MM_F_NO_PRINT_2ND (0x4000LL)
#define MM_F_2_IO_THREADS (0x8000LL)
#define MM_F_LONG_CIGAR (0x10000LL)
#define MM_F_INDEPEND_SEG (0x20000LL)
#define MM_F_SPLICE_FLANK (0x40000LL)
#define MM_F_SOFTCLIP (0x80000LL)
#define MM_F_FOR_ONLY (0x100000LL)
#define MM_F_REV_ONLY (0x200000LL)
#define MM_F_HEAP_SORT (0x400000LL)
#define MM_F_ALL_CHAINS (0x800000LL)
#define MM_F_OUT_MD (0x1000000LL)
#define MM_F_COPY_COMMENT (0x2000000LL)
#define MM_F_EQX (0x4000000LL) // use =/X instead of M
#define MM_F_PAF_NO_HIT (0x8000000LL) // output unmapped reads to PAF
#define MM_F_NO_END_FLT (0x10000000LL)
#define MM_F_HARD_MLEVEL (0x20000000LL)
#define MM_F_SAM_HIT_ONLY (0x40000000LL)
#define MM_F_RMQ (0x80000000LL)
#define MM_F_QSTRAND (0x100000000LL)
#define MM_F_NO_INV (0x200000000LL)
#define MM_F_NO_HASH_NAME (0x400000000LL)
#define MM_F_SPLICE_OLD (0x800000000LL)
#define MM_F_SECONDARY_SEQ (0x1000000000LL) //output SEQ field for seqondary alignments using hard clipping
#define MM_F_OUT_DS (0x2000000000LL)
#define MM_F_WEAK_PAIRING (0x4000000000LL)
#define MM_F_SR_RNA (0x8000000000LL)
#define MM_F_OUT_JUNC (0x10000000000LL)
#define MM_I_HPC 0x1
#define MM_I_NO_SEQ 0x2
@@ -38,6 +57,18 @@
#define MM_MAX_SEG 255
#define MM_CIGAR_MATCH 0
#define MM_CIGAR_INS 1
#define MM_CIGAR_DEL 2
#define MM_CIGAR_N_SKIP 3
#define MM_CIGAR_SOFTCLIP 4
#define MM_CIGAR_HARDCLIP 5
#define MM_CIGAR_PADDING 6
#define MM_CIGAR_EQ_MATCH 7
#define MM_CIGAR_X_MISMATCH 8
#define MM_CIGAR_STR "MIDNSHP=XB"
#ifdef __cplusplus
extern "C" {
#endif
@@ -51,21 +82,28 @@ typedef struct {
char *name; // name of the db sequence
uint64_t offset; // offset in mm_idx_t::S
uint32_t len; // length
uint32_t is_alt;
} mm_idx_seq_t;
typedef struct {
int32_t b, w, k, flag;
uint32_t n_seq; // number of reference sequences
int32_t index;
int32_t n_alt;
mm_idx_seq_t *seq; // sequence name, length and offset
uint32_t *S; // 4-bit packed sequence
struct mm_idx_bucket_s *B; // index (hidden)
void *km;
struct mm_idx_intv_s *I; // intervals (hidden)
struct mm_idx_spsc_s *spsc;// splice score (hidden)
struct mm_idx_jjump_s *J; // junctions to create jumps (hidden)
void *km, *h;
} mm_idx_t;
// minimap2 alignment
typedef struct {
uint32_t capacity; // the capacity of cigar[]
int32_t dp_score, dp_max, dp_max2; // DP score; score of the max-scoring segment; score of the best alternate mappings
int32_t dp_max0; // DP score before mm_update_dp_max() adjustment
uint32_t n_ambi:30, trans_strand:2; // number of ambiguous bases; transcript strand: 0 for unknown, 1 for +, 2 for -
uint32_t n_cigar; // number of cigar operations in cigar[]
uint32_t cigar[];
@@ -82,7 +120,7 @@ typedef struct {
int32_t mlen, blen; // seeded exact match length; seeded alignment block length
int32_t n_sub; // number of suboptimal mappings
int32_t score0; // initial chaining score (before chain merging/spliting)
uint32_t mapq:8, split:2, rev:1, inv:1, sam_pri:1, proper_frag:1, pe_thru:1, seg_split:1, seg_id:8, dummy:8;
uint32_t mapq:8, split:2, rev:1, inv:1, sam_pri:1, proper_frag:1, pe_thru:1, seg_split:1, seg_id:8, split_inv:1, is_alt:1, strand_retained:1, is_spliced:1, dummy:4;
uint32_t hash;
float div;
mm_extra_t *p;
@@ -91,43 +129,66 @@ typedef struct {
// indexing and mapping options
typedef struct {
short k, w, flag, bucket_bits;
int mini_batch_size;
int64_t mini_batch_size;
uint64_t batch_size;
} mm_idxopt_t;
typedef struct {
int64_t flag; // see MM_F_* macros
int seed;
int sdust_thres; // score threshold for SDUST; 0 to disable
int flag; // see MM_F_* macros
int bw; // bandwidth
int max_qlen; // max query length
int bw, bw_long; // bandwidth
int max_gap, max_gap_ref; // break a chain if there are no minimizers in a max_gap window
int max_frag_len;
int max_chain_skip;
int max_chain_skip, max_chain_iter;
int min_cnt; // min number of minimizers on each chain
int min_chain_score; // min chaining score
float chain_gap_scale;
float chain_skip_scale;
int rmq_size_cap, rmq_inner_dist;
int rmq_rescue_size;
float rmq_rescue_ratio;
float mask_level;
int mask_len;
float pri_ratio;
int best_n; // top best_n chains are subjected to DP alignment
int max_join_long, max_join_short;
int min_join_flank_sc;
float alt_drop;
int a, b, q, e, q2, e2; // matching score, mismatch, gap-open and gap-ext penalties
int transition; // transition mismatch score (A:G, C:T)
int sc_ambi; // score when one or both bases are "N"
int noncan; // cost of non-canonical splicing sites
int zdrop; // break alignment if alignment score drops too fast along the diagonal
int junc_bonus; // bonus for a splice site in annotation
int junc_pen; // penalty for GT- or -AG not scored in --spsc
int zdrop, zdrop_inv; // break alignment if alignment score drops too fast along the diagonal
int end_bonus;
int min_dp_max; // drop an alignment if the score of the max scoring segment is below this threshold
int min_ksw_len;
int anchor_ext_len, anchor_ext_shift;
float max_clip_ratio; // drop an alignment if BOTH ends are clipped above this ratio
int rank_min_len;
float rank_frac;
int pe_ori, pe_bonus;
int32_t jump_min_match;
float mid_occ_frac; // only used by mm_mapopt_update(); see below
float q_occ_frac;
int32_t min_mid_occ, max_mid_occ;
int32_t mid_occ; // ignore seeds with occurrences above this threshold
int32_t max_occ;
int mini_batch_size; // size of a batch of query bases to process in parallel
int32_t max_occ, max_max_occ, occ_dist;
int64_t mini_batch_size; // size of a batch of query bases to process in parallel
int64_t max_sw_mat;
int64_t cap_kalloc;
const char *split_prefix;
} mm_mapopt_t;
// index reader
@@ -143,6 +204,11 @@ typedef struct {
} mm_idx_reader_t;
// memory buffer for thread-local storage during mapping
struct mm_tbuf_s {
void *km;
int rep_len, frag_gap;
};
typedef struct mm_tbuf_s mm_tbuf_t;
// global variables
@@ -212,6 +278,36 @@ void mm_idx_reader_close(mm_idx_reader_t *r);
int mm_idx_reader_eof(const mm_idx_reader_t *r);
/**
* Check whether the file contains a minimap2 index
*
* @param fn file name
*
* @return the file size if fn is an index file; 0 if fn is not.
*/
int64_t mm_idx_is_idx(const char *fn);
/**
* Load a part of an index
*
* Given a uni-part index, this function loads the entire index into memory.
* Given a multi-part index, it loads one part only and places the file pointer
* at the end of that part.
*
* @param fp pointer to FILE object
*
* @return minimap2 index read from fp
*/
mm_idx_t *mm_idx_load(FILE *fp);
/**
* Append an index (or one part of a full index) to file
*
* @param fp pointer to FILE object
* @param mi minimap2 index
*/
void mm_idx_dump(FILE *fp, const mm_idx_t *mi);
/**
* Create an index from strings in memory
*
@@ -260,6 +356,8 @@ mm_tbuf_t *mm_tbuf_init(void);
*/
void mm_tbuf_destroy(mm_tbuf_t *b);
void *mm_tbuf_get_km(mm_tbuf_t *b);
/**
* Align a query sequence against an index
*
@@ -296,6 +394,37 @@ int mm_map_file(const mm_idx_t *idx, const char *fn, const mm_mapopt_t *opt, int
int mm_map_file_frag(const mm_idx_t *idx, int n_segs, const char **fn, const mm_mapopt_t *opt, int n_threads);
/**
* Generate the cs tag (new in 2.12)
*
* @param km memory blocks; set to NULL if unsure
* @param buf buffer to write the cs/MD tag; typicall NULL on the first call
* @param max_len max length of the buffer; typically set to 0 on the first call
* @param mi index
* @param r alignment
* @param seq query sequence
* @param no_iden true to use : instead of =
*
* @return the length of cs
*/
int mm_gen_cs(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int no_iden);
int mm_gen_ds(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int no_iden);
int mm_gen_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq);
// query sequence name and sequence in the minimap2 index
int mm_idx_index_name(mm_idx_t *mi);
int mm_idx_name2id(const mm_idx_t *mi, const char *name);
int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq);
int mm_idx_alt_read(mm_idx_t *mi, const char *fn);
int mm_idx_bed_read(mm_idx_t *mi, const char *fn, int read_junc);
int mm_idx_bed_junc(const mm_idx_t *mi, int32_t ctg, int32_t st, int32_t en, uint8_t *s);
int mm_max_spsc_bonus(const mm_mapopt_t *mo);
int32_t mm_idx_spsc_read(mm_idx_t *idx, const char *fn, int32_t max_sc);
int32_t mm_idx_spsc_read2(mm_idx_t *idx, const char *fn, int32_t max_sc, float scale);
int64_t mm_idx_spsc_get(const mm_idx_t *db, int32_t cid, int64_t st0, int64_t en0, int32_t rev, uint8_t *sc);
// deprecated APIs for backward compatibility
void mm_mapopt_init(mm_mapopt_t *opt);
mm_idx_t *mm_idx_build(const char *fn, int w, int k, int flag, int n_threads);
+357 -78
View File
@@ -1,4 +1,4 @@
.TH minimap2 1 "1 February 2018" "minimap2-2.8 (r672)" "Bioinformatics tools"
.TH minimap2 1 "19 May 2026" "minimap2-2.31 (r1302)" "Bioinformatics tools"
.SH NAME
.PP
minimap2 - mapping and alignment between collections of DNA sequences
@@ -77,7 +77,7 @@ SAM format.
Minimizer k-mer length [15]
.TP
.BI -w \ INT
Minimizer window size [2/3 of k-mer length]. A minimizer is the smallest k-mer
Minimizer window size [10]. A minimizer is the smallest k-mer
in a window of w consecutive k-mers.
.TP
.B -H
@@ -88,16 +88,17 @@ on the HPC sequence.
.BI -I \ NUM
Load at most
.I NUM
target bases into RAM for indexing [4G]. If there are more than
target bases into RAM for indexing [8G]. If there are more than
.I NUM
bases in
.IR target.fa ,
minimap2 needs to read
.I query.fa
multiple times to map it against each batch of target sequences.
multiple times to map it against each batch of target sequences. This would create a multi-part index.
.I NUM
may be ending with k/K/m/M/g/G. NB: mapping quality is incorrect given a
multi-part index.
multi-part index. See also option
.BR --split-prefix .
.TP
.B --idx-no-seq
Don't store target sequences in the index. It saves disk space and memory but
@@ -121,21 +122,62 @@ provided as the target sequences, options
.BR -w ,
.B -I
will be effectively overridden by the options stored in the index file.
.TP
.BI --alt \ FILE
List of ALT contigs [null]
.TP
.BI --alt-drop \ FLOAT
Drop ALT hits by
.I FLOAT
fraction when ranking and computing mapping quality [0.15]
.SS Mapping options
.TP 10
.BI -f \ FLOAT
Ignore top
.BI -f \ FLOAT | INT1 [, INT2 ]
If fraction, ignore top
.I FLOAT
fraction of most frequent minimizers [0.0002]
fraction of most frequent minimizers [0.0002]. If integer,
ignore minimizers occuring more than
.I INT1
times.
.I INT2
is only effective in the
.B --sr
or
.B -xsr
mode, which sets the threshold for a second round of seeding.
.TP
.BI -g \ INT
.BI -U \ INT1 [, INT2 ]
Lower and upper bounds of k-mer occurrences [10,1000000]. The final k-mer occurrence threshold is
.RI max{ INT1 ,\ min{ INT2 ,
.BR -f }}.
This option prevents excessively small or large
.B -f
estimated from the input reference. Available since r1034 and deprecating
.B --min-occ-floor
in earlier versions of minimap2.
.TP
.BI --q-occ-frac \ FLOAT
Discard a query minimizer if its occurrence is higher than
.I FLOAT
fraction of query minimizers and than the reference occurrence threshold
[0.01]. Set 0 to disable. Available since r1105.
.TP
.BI -e \ INT
Sample a high-frequency minimizer every
.I INT
basepairs [500].
.TP
.BI -g \ NUM
Stop chain enlongation if there are no minimizers within
.IR INT -bp
[10000].
.IR NUM -bp
[10k].
.TP
.BI -r \ INT
Bandwidth used in chaining and DP-based alignment [500]. This option
approximately controls the maximum gap size.
.BI -r \ NUM1 [, NUM2 ]
Bandwidth for chaining and base alignment [500,20k].
.I NUM1
is used for initial chaining and alignment extension;
.I NUM2
for RMQ-based re-chaining and closing gaps in alignments.
.TP
.BI -n \ INT
Discard chains consisting of
@@ -161,8 +203,10 @@ and
have no effect when this option is in use.
.TP
.BR --dual = yes | no
During chaining, whether to skip pairs wherein the query name is
lexicographically greater than the target name [yes]
If
.BR no ,
skip query-target pairs wherein the query name is lexicographically greater
than the target name [yes]
.TP
.B -X
Equivalent to
@@ -174,7 +218,7 @@ Primarily used for all-vs-all read overlapping.
.BI -p \ FLOAT
Minimal secondary-to-primary score ratio to output secondary mappings [0.8].
Between two chains overlaping over half of the shorter chain (controlled by
.BR --mask-level ),
.BR -M ),
the chain with a lower score is secondary to the chain with a higher score.
If the ratio of the scores is below
.IR FLOAT ,
@@ -207,14 +251,44 @@ Mark as secondary a chain that overlaps with a better chain by
.I FLOAT
or more of the shorter chain [0.5]
.TP
.BR --rmq = no | yes
Use the minigraph chaining algorithm [no]. The minigraph algorithm is better
for aligning contigs through long INDELs.
.TP
.BI --rmq-inner \ NUM
Apply full dynamic programming for anchors within distance
.I NUM
[1000].
.TP
.B --hard-mask-level
Honor option
.B -M
and disable a heurstic to save unmapped subsequences and disables
.BR --mask-len .
.TP
.BI --mask-len \ NUM
Keep an alignment if dropping it leaves an unaligned region on query longer than
.IR INT
[inf]. Effective without
.BR --hard-mask-level .
.TP
.BI --max-chain-skip \ INT
A heuristics that stops chaining early [50]. Minimap2 uses dynamic programming
A heuristics that stops chaining early [25]. Minimap2 uses dynamic programming
for chaining. The time complexity is quadratic in the number of seeds. This
option makes minimap2 exits the inner loop if it repeatedly sees seeds already
on chains. Set
.I INT
to a large number to switch off this heurstics.
.TP
.BI --max-chain-iter \ INT
Check up to
.I INT
partial chains during chaining [5000]. This is a heuristic to avoid quadratic
time complexity in the worst case.
.TP
.BI --chain-gap-scale \ FLOAT
Scale of gap cost during chaining [1.0]
.TP
.B --no-long-join
Disable the long gap patching heuristic. When this option is applied, the
maximum alignment gap is mostly controlled by
@@ -223,11 +297,16 @@ maximum alignment gap is mostly controlled by
.B --splice
Enable the splice alignment mode.
.TP
.B --sr
Enable short-read alignment heuristics. In the short-read mode, minimap2
applies a second round of chaining with a higher minimizer occurrence threshold
if no good chain is found. In addition, minimap2 attempts to patch gaps between
seeds with ungapped alignment.
.BR --sr [= no | dna | rna ]
Enable short-read alignment heuristics [no]. If this option is used with no argument,
.RB ` dna '
is set. In the DNA short-read mode, minimap2 applies a second round of chaining
with a higher minimizer occurrence threshold if no good chain is found. In
addition, minimap2 attempts to patch gaps between seeds with ungapped
alignment.
.TP
.BI --split-prefix \ STR
Prefix to create temporary files. Typically used for a multi-part index.
.TP
.BR --frag = no | yes
Whether to enable the fragment mode [no]
@@ -243,6 +322,9 @@ Only map to the reverse complement strand of the reference sequences.
.BR --heap-sort = no | yes
If yes, sort anchors with heap merge, instead of radix sort. Heap merge is
faster for short reads, but slower for long reads. [no]
.TP
.B --no-hash-name
Produce the same alignment for identical sequences regardless of their sequence names.
.SS Alignment options
.TP 10
.BI -A \ INT
@@ -251,6 +333,10 @@ Matching score [2]
.BI -B \ INT
Mismatching penalty [4]
.TP
.BI -b \ INT
Mismatching penalty for transitions [same as
.BR -B ].
.TP
.BI -O \ INT1[,INT2]
Gap open penalty [4,24]. If
.I INT2
@@ -264,16 +350,45 @@ costs
.RI min{ O1 + k * E1 , O2 + k * E2 }.
In the splice mode, the second gap penalties are not used.
.TP
.BI -J \ INT
Splice model [1]. 0 for the original minimap2 splice model that always penalizes non-GT-AG splicing;
1 for the miniprot model that considers non-GT-AG. Option
.B -C
has no effect with the default
.BR -J1 .
.TP
.BR -j \ FILE
Junctions used to extend alignment towards ends of reads [].
.I FILE
can be gene annotations in the BED12 format (aka 12-column BED), or intron
positions in 5-column BED with the strand column required. BED12 file can be
converted from GTF/GFF3 with `paftools.js gff2bed anno.gtf'. This option is
intended for short RNA-seq reads, while
.B --junc-bed
for long noisy RNA-seq reads.
.TP
.BI -C \ INT
Cost for a non-canonical GT-AG splicing (effective with
.BR --splice )
[0]
.B --splice
.BR -J0 )
[0].
.TP
.BI -z \ INT
Break an alignment if the running score drops too quickly along the diagonal of
the DP matrix (diagonal X-drop, or Z-drop) [400]. Increasing the value improves
the contiguity of the alignment at the cost of poor alignment in the middle
(e.g. caused by a long inversion).
.BI -z \ INT1[,INT2]
Truncate an alignment if the running alignment score drops too quickly along
the diagonal of the DP matrix (diagonal X-drop, or Z-drop) [400,200]. If the
drop of score is above
.IR INT2 ,
minimap2 will reverse complement the query in the related region and align
again to test small inversions. Minimap2 truncates alignment if there is an
inversion or the drop of score is greater than
.IR INT1 .
Decrease
.I INT2
to find small inversions at the cost of performance and false positives.
Increase
.I INT1
to improves the contiguity of alignment at the cost of poor alignment in the
middle.
.TP
.BI -s \ INT
Minimal peak DP alignment score to output [40]. The peak score is computed from
@@ -292,6 +407,18 @@ no attempt to match GT-AG [n]
.BI --end-bonus \ INT
Score bonus when alignment extends to the end of the query sequence [0].
.TP
.BI --score-N \ INT
Penalty of a mismatch involving ambiguous bases [1].
.TP
.BR --pairing = strong | weak | no
How to pair paired-end reads [strong].
.RB ` no '
for aligning the two ends in a pair independently with no `properly paired' set.
.RB ` weak '
for aligning the two ends independently and then pairing the hits.
.RB ` strong '
for jointly aligning and pairing the two ends.
.TP
.BR --splice-flank = yes | no
Assume the next base to a
.B GT
@@ -309,6 +436,50 @@ on SIRV data, please add
.B --splice-flank=no
to the command line.
.TP
.BR --spsc \ FILE
Splice scores []. Each line consists of five fields: 1) contig, 2) offset, 3) `+' or `-', 4) `D' or `A', and 5) score,
where offset is the number of bases before a splice junction, `D' indicates the
line corresponds to a donor site and `A' for an acceptor site.
A positive score suggests the junction is preferred and a negative score
suggests the junction is not preferred.
.TP
.BR --spsc0 \ INT
Penalty for positions not in
.I FILE
specified by
.B --spsc
[5]. Effective with
.B --spsc
but not
.BR --junc-bed .
.TP
.BR --spsc-scale \ FLOAT
Scale splice scores in
.B --spsc
by
.IR FLOAT
rounded to the nearest integer [0.7].
.TP
.BR --junc-bed \ FILE
Junctions to prefer during base alignment [].
Same format as
.BR -j .
It is
.I NOT
recommended to apply this option to short RNA-seq reads. This would increase
run time with little improvement to junction accuracy.
.TP
.BR --junc-bonus \ INT
Score bonus for a splice donor or acceptor found in annotation [9]. Effective with
.B --junc-bed
but not
.BR --spsc .
.TP
.BR --jump-min-match \ INT
Minimum matching length to create a jump [3]. Equivalent to
.B STAR
.BR --alignSJDBoverhangMin .
.TP
.BI --end-seed-pen \ INT
Drop a terminal anchor if
.IR s <log( g )+ INT ,
@@ -320,12 +491,31 @@ the length of the terminal gap in the chain. This option is only effective
with
.BR --splice .
It helps to avoid tiny terminal exons. [6]
.TP
.B --no-end-flt
Don't filter seeds towards the ends of chains before performing base-level
alignment.
.TP
.BI --cap-sw-mem \ NUM
Skip alignment if the DP matrix size is above
.IR NUM .
Set 0 to disable [100m].
.TP
.BI --cap-kalloc \ NUM
Free thread-local kalloc memory reservoir if after the alignment the size of the reservoir above
.IR NUM .
Set 0 to disable [500m].
.SS Input/output options
.TP 10
.B -a
Generate CIGAR and output alignments in the SAM format. Minimap2 outputs in PAF
by default.
.TP
.BI -o \ FILE
Output alignments to
.I FILE
[stdout].
.TP
.B -Q
Ignore base quality in the input file.
.TP
@@ -340,27 +530,52 @@ SAM read group line in a format like
.B @RG\\\\tID:foo\\\\tSM:bar
[].
.TP
.B -y
Copy input FASTA/Q comments to output.
.TP
.B -c
Generate CIGAR. In PAF, the CIGAR is written to the `cg' custom tag.
.TP
.BI --cs[= STR ]
.BR --cs [= short | long ]
Output the
.B cs
tag.
.I STR
can be either
.I short
or
.IR long .
If no
.I STR
is given,
.I short
is assumed. [none]
If no argument is given,
.RB ` short '
is set. [none]
.TP
.B --MD
Output the MD tag (see the SAM spec).
.TP
.B --eqx
Output =/X CIGAR operators for sequence match/mismatch.
.TP
.B -Y
In SAM output, use soft clipping for supplementary alignments.
.TP
.B --secondary-seq
In SAM output, show query sequences for secondary alignments.
.TP
.B --write-junc
Output splice junctions in 6-column BED: contig name, start, end,
read name, score and strand. Score is the sum of donor and acceptor scores,
where GT gets 3, GC gets 2 and AT gets 1 at donor sites,
while AG gets 3 and AC gets 1 at acceptor sites.
Alignments with mapping quality below 10 are ignored.
.TP
.BI --pass1 \ FILE
Junctions BED file outputted by
.B --write-junc
[]. Rows with scores lower than 5 are ignored. When both
.B -j
and
.B --pass1
are present, junctions in
.B -j
are preferred over in
.BR --pass1
when there is ambiguity.
.TP
.BI --seed \ INT
Integer seed for randomizing equally best hits. Minimap2 hashes
.I INT
@@ -391,6 +606,18 @@ memory.
.BR --secondary = yes | no
Whether to output secondary alignments [yes]
.TP
.BI --max-qlen \ NUM
Filter out query sequences longer than
.IR NUM .
.TP
.B --paf-no-hit
In PAF, output unmapped queries; the strand and the reference name fields are
set to `*'. Warning: some paftools.js commands may not work with such output
for the moment.
.TP
.B --sam-hit-only
In SAM, don't output unmapped reads.
.TP
.B --version
Print version number to stdout
.SS Preset options
@@ -404,53 +631,75 @@ Available
.I STR
are:
.RS
.TP 8
.B map-pb
PacBio/Oxford Nanopore read to reference mapping
.RB ( -Hk19 )
.TP
.TP 10
.B map-ont
Slightly more sensitive for Oxford Nanopore to reference mapping
.RB ( -k15 ).
For PacBio reads, HPC minimizers consistently leads to faster performance and
more sensitive results in comparison to normal minimizers. For Oxford Nanopore
data, normal minimizers are better, though not much. The effectiveness of HPC
is determined by the sequencing error mode.
Align noisy long reads of ~10% error rate to a reference genome. This is the
default mode.
.TP
.B lr:hq
Align accurate long reads (error rate <1%) to a reference genome
.RB ( -k19
.B -w19 -U50,500
.BR -g10k ).
This was recommended by ONT developers for recent Nanopore reads
produced with chemistry v14 that can reach ~99% in accuracy.
It was shown to work better for accurate Nanopore reads
than
.BR map-hifi .
.TP
.B map-hifi
Align PacBio high-fidelity (HiFi) reads to a reference genome
.RB ( -xlr:hq
.B -A1 -B4 -O6,26 -E2,1
.BR -s200 ).
It differs from
.B lr:hq
only in scoring. It has not been tested whether
.B lr:hq
would work better for PacBio HiFi reads.
.TP
.B map-pb
Align older PacBio continuous long (CLR) reads to a reference genome
.RB ( -Hk19 ).
Note that this data type is effectively deprecated by HiFi.
Unless you work on very old data, you probably want to use
.B map-hifi
or
.BR lr:hq .
.TP
.B map-iclr
Align Illumina Complete Long Reads (ICLR) to a reference genome
.RB ( -k19
.B -B6 -b4
.BR -O10,50 ).
This was recommended by Illumina developers.
.TP
.B asm5
Long assembly to reference mapping
.RB ( -k19
.B -w19 -A1 -B19 -O39,81 -E3,1 -s200
.BR -z200 ).
.B -w19 -U50,500 --rmq -r1k,100k -g10k -A1 -B19 -O39,81 -E3,1 -s200 -z200
.BR -N50 ).
Typically, the alignment will not extend to regions with 5% or higher sequence
divergence. Only use this preset if the average divergence is far below 5%.
divergence. Use this preset if the average divergence is not much higher than 0.1%.
.TP
.B asm10
Long assembly to reference mapping
.RB ( -k19
.B -w19 -A1 -B9 -O16,41 -E2,1 -s200
.BR -z200 ).
Up to 10% sequence divergence.
.B -w19 -U50,500 --rmq -r1k,100k -g10k -A1 -B9 -O16,41 -E2,1 -s200 -z200
.BR -N50 ).
Use this if the average divergence is around 1%.
.TP
.B ava-pb
PacBio all-vs-all overlap mapping
.RB ( -Hk19
.B -Xw5 -m100 -g10000 --max-chain-skip
.BR 25 ).
.TP
.B ava-ont
Oxford Nanopore all-vs-all overlap mapping
.RB ( -k15
.B -Xw5 -m100 -g10000 --max-chain-skip
.BR 25 ).
Similarly, the major difference from
.B ava-pb
is that this preset is not using HPC minimizers.
.B asm20
Long assembly to reference mapping
.RB ( -k19
.B -w10 -U50,500 --rmq -r1k,100k -g10k -A1 -B4 -O6,26 -E2,1 -s200 -z200
.BR -N50 ).
Use this if the average divergence is around several percent.
.TP
.B splice
Long-read spliced alignment
.RB ( -k15
.B -w5 --splice -g2000 -G200k -A1 -B2 -O2,32 -E1,0 -C9 -z200 -ub
.B -w5 --splice -g2k -G200k -A1 -B2 -O2,32 -E1,0 -C9 -z200 -ub --junc-bonus=9 --cap-sw-mem=0
.BR --splice-flank=yes ).
In the splice mode, 1) long deletions are taken as introns and represented as
the
@@ -460,12 +709,36 @@ costs are different during chaining; 4) the computation of the
.RB ` ms '
tag ignores introns to demote hits to pseudogenes.
.TP
.B sr
Short single-end reads without splicing
.RB ( -k21
.B -w11 --sr --frag=yes -A2 -B8 -O12,32 -E2,1 -r50 -p.5 -N20 -f1000,5000 -n2 -m20
.B -s40 -g200 -2K50m --heap-sort=yes
.B splice:hq
Spliced alignment for accurate long RNA-seq reads such as PacBio iso-seq
.RB ( -xsplice
.B -C5 -O6,24
.BR -B4 ).
.TP
.B splice:sr
Spliced alignment for short RNA-seq reads
.RB ( -xsplice:hq
.B --frag=yes -m25 -s40 -2K100m --heap-sort=yes --pairing=weak --sr=rna --min-dp-len=20
.BR --secondary=no ).
.TP
.B sr
Short-read alignment without splicing
.RB ( -k21
.B -w11 --sr --frag=yes -A2 -B8 -O12,32 -E2,1 -r100 -p.5 -N20 -f1000,5000 -n2 -m25
.B -s40 -g100 -2K50m --heap-sort=yes
.BR --secondary=no ).
.TP
.B ava-pb
PacBio CLR all-vs-all overlap mapping
.RB ( -Hk19
.B -Xw5 -e0
.BR -m100 ).
.TP
.B ava-ont
Oxford Nanopore all-vs-all overlap mapping
.RB ( -k15
.B -Xw5 -e0 -m100
.BR -r2k ).
.RE
.SS Miscellaneous options
.TP 10
@@ -522,12 +795,18 @@ cm i Number of minimizers on the chain
s1 i Chaining score
s2 i Chaining score of the best secondary chain
NM i Total number of mismatches and gaps in the alignment
MD Z To generate the ref sequence in the alignment
AS i DP alignment score
SA Z List of other supplementary alignments (with approximate CIGAR strings)
ms i DP score of the max scoring segment in the alignment
nn i Number of ambiguous bases in the alignment
ts A Transcript strand (splice mode only)
cg Z CIGAR string (only in PAF)
cs Z Difference string
dv f Approximate per-base sequence divergence
de f Gap-compressed per-base sequence divergence
rl i Length of query regions harboring repetitive seeds
zd i Alignment broken due to Z-drop; bit 1: left broken; bit 2: right broken
.TE
.PP
+47 -2
View File
@@ -1,3 +1,4 @@
#include <stdlib.h>
#include "mmpriv.h"
int mm_verbose = 1;
@@ -86,6 +87,8 @@ double cputime()
return kernelModeTime + userModeTime;
}
long peakrss(void) { return 0; }
#else
#include <sys/resource.h>
#include <sys/time.h>
@@ -96,16 +99,57 @@ double cputime(void)
getrusage(RUSAGE_SELF, &r);
return r.ru_utime.tv_sec + r.ru_stime.tv_sec + 1e-6 * (r.ru_utime.tv_usec + r.ru_stime.tv_usec);
}
long peakrss(void)
{
struct rusage r;
getrusage(RUSAGE_SELF, &r);
#ifdef __linux__
return r.ru_maxrss * 1024;
#else
return r.ru_maxrss;
#endif
}
#endif /* WIN32 || _WIN32 */
double realtime(void)
{
struct timeval tp;
struct timezone tzp;
gettimeofday(&tp, &tzp);
gettimeofday(&tp, NULL);
return tp.tv_sec + tp.tv_usec * 1e-6;
}
void mm_err_puts(const char *str)
{
int ret;
ret = puts(str);
if (ret == EOF) {
perror("[ERROR] failed to write the results");
exit(EXIT_FAILURE);
}
}
void mm_err_fwrite(const void *p, size_t size, size_t nitems, FILE *fp)
{
int ret;
ret = fwrite(p, size, nitems, fp);
if (ret == EOF) {
perror("[ERROR] failed to write data");
exit(EXIT_FAILURE);
}
}
void mm_err_fread(void *p, size_t size, size_t nitems, FILE *fp)
{
int ret;
ret = fread(p, size, nitems, fp);
if (ret == EOF) {
perror("[ERROR] failed to read data");
exit(EXIT_FAILURE);
}
}
#include "ksort.h"
#define sort_key_128x(a) ((a).x)
@@ -115,3 +159,4 @@ KRADIX_SORT_INIT(128x, mm128_t, sort_key_128x, 8)
KRADIX_SORT_INIT(64, uint64_t, sort_key_64, 8)
KSORT_INIT_GENERIC(uint32_t)
KSORT_INIT_GENERIC(uint64_t)
+171 -19
View File
@@ -1,28 +1,180 @@
The [K8 Javascript shell][k8] is needed to run Javascripts in this directory.
Precompiled k8 binaries for Mac and Linux can be found at the [K8 release
page][k8bin].
## <a name="started"></a>Getting Started
* [paf2aln.js](paf2aln.js): convert PAF to [MAF][maf] or BLAST-like output for
eyeballing. PAF has to be generated with minimap2 option `-S`, which writes
the aligned sequences to the `cs` tag. An example:
```sh
../minimap2 -S ../test/MT-*.fa | k8 paf2aln.js /dev/stdin
```
```sh
# install minimap2
git clone https://github.com/lh3/minimap2
cd minimap2 && make
# install the k8 javascript shell
curl -L https://github.com/attractivechaos/k8/releases/download/v0.2.4/k8-0.2.4.tar.bz2 | tar -jxf -
cp k8-0.2.4/k8-`uname -s` k8 # or copy it to a directory on your $PATH
# export PATH="$PATH:`pwd`:`pwd`/misc" # run this if k8, minimap2 or paftools.js not on your $PATH
minimap2 --cs test/MT-human.fa test/MT-orang.fa | paftools.js view - # view alignment
minimap2 -c test/MT-human.fa test/MT-orang.fa | paftools.js stat - # basic alignment statistics
minimap2 -c --cs test/MT-human.fa test/MT-orang.fa \
| sort -k6,6 -k8,8n | paftools.js call -L15000 - # calling variants from asm-to-ref alignment
minimap2 -c test/MT-human.fa test/MT-orang.fa \
| paftools.js liftover -l10000 - <(echo -e "MT_orang\t2000\t5000") # liftOver
# no test data for the following examples
paftools.js junceval -e anno.gtf splice.sam > out.txt # compare splice junctions to annotations
paftools.js splice2bed splice.sam > splice.bed # convert PAF/SAM to BED12
paftools.js gff2bed anno.gtf > anno.bed # convert GTF/GFF3 to BED12
```
* [mapstat.js](mapstat.js): output basic statistics such as the number of
non-redundant mapped bases, number of split and secondary alignments and
number of long gaps. This scripts seamlessly works with both SAM and PAF.
## Table of Contents
* [sim-pbsim.js](sim-pbsim.js): convert reads simulated with [PBSIM][pbsim] to
FASTA and encode the true mapping positions to read names in a format like
`S1_33!chr1!225258409!225267761!-`.
- [Getting Started](#started)
- [Introduction](#intro)
- [Evaluation](#eval)
- [Evaluating mapping accuracy with simulated reads](#mapeval)
- [Evaluating read overlap sensitivity](#oveval)
- [Calling Variants from Assemblies](#asmvar)
* [sim-eval.js](sim-eval.js): evaluate mapping accuracy for FASTA generated
with [sim-pbsim.js](sim-pbsim.js) or [sim-mason2.js](sim-mason2.js).
## <a name="intro"></a>Introduction
* [sam2paf.js](sam2paf.js): convert SAM to PAF.
paftools.js is a script that processes alignments in the [PAF format][paf],
such as converting between formats, evaluating mapping accuracy, lifting over
BED files based on alignment, and calling variants from assembly-to-assembly
alignment. This script *requires* the [k8 Javascript shell][k8] to run. On
Linux or Mac, you can download the precompiled k8 binary with:
```sh
curl -L https://github.com/attractivechaos/k8/releases/download/v0.2.4/k8-0.2.4.tar.bz2 | tar -jxf -
cp k8-0.2.4/k8-`uname -s` $HOME/bin/k8 # assuming $HOME/bin in your $PATH
```
It is highly recommended to copy the executable `k8` to a directory on your
`$PATH` such as `/usr/bin/env` can find it. Like python scripts, once you
install `k8`, you can launch paftools.js in one of the two ways:
```sh
path/to/paftools.js # only if k8 is on your $PATH
k8 path/to/paftools.js
```
In a nutshell, paftools.js has the following commands:
```
Usage: paftools.js <command> [arguments]
Commands:
view convert PAF to BLAST-like (for eyeballing) or MAF
splice2bed convert spliced alignment in PAF/SAM to BED12
sam2paf convert SAM to PAF
delta2paf convert MUMmer's delta to PAF
gff2bed convert GTF/GFF3 to BED12
stat collect basic mapping information in PAF/SAM
liftover simplistic liftOver
call call variants from asm-to-ref alignment with the cs tag
bedcov compute the number of bases covered
mapeval evaluate mapping accuracy using mason2/PBSIM-simulated FASTQ
mason2fq convert mason2-simulated SAM to FASTQ
pbsim2fq convert PBSIM-simulated MAF to FASTQ
junceval evaluate splice junction consistency with known annotations
ov-eval evaluate read overlap sensitivity using read-to-ref mapping
```
paftools.js seamlessly reads both plain text files and gzip'd text files.
## <a name="eval"></a>Evaluation
### <a name="mapeval"></a>Evaluating mapping accuracy with simulated reads
The **pbsim2fq** command of paftools.js converts the MAF output of [pbsim][pbsim]
to FASTQ and encodes the true mapping position in the read name in a format like
`S1_33!chr1!225258409!225267761!-`. Similarly, the **mason2fq** command
converts [mason2][mason2] simulated SAM to FASTQ.
Command **mapeval** evaluates mapped SAM/PAF. Here is example output:
```
Q 60 32478 0 0.000000000 32478
Q 22 16 1 0.000030775 32494
Q 21 43 1 0.000061468 32537
Q 19 73 1 0.000091996 32610
Q 14 66 1 0.000122414 32676
Q 10 27 3 0.000214048 32703
Q 8 14 1 0.000244521 32717
Q 7 13 2 0.000305530 32730
Q 6 46 1 0.000335611 32776
Q 3 10 1 0.000366010 32786
Q 2 20 2 0.000426751 32806
Q 1 248 94 0.003267381 33054
Q 0 31 17 0.003778147 33085
U 3
```
where each Q-line gives the quality threshold, the number of reads mapped with
mapping quality equal to or greater than the threshold, number of wrong
mappings, accumulative mapping error rate and the accumulative number of
mapped reads. The U-line, if present, gives the number of unmapped reads if
they are present in the SAM file.
Suppose the reported mapping coordinate overlap with the true coordinate like
the following:
```
truth: --------------------
mapper: ----------------------
|<- l1 ->|<-- o -->|<-- l2 -->|
```
Let `r=o/(l1+o+l2)`. The reported mapping is considered correct if `r>0.1` by
default.
### <a name="oveval"></a>Evaluating read overlap sensitivity
Command **ov-eval** takes *sorted* read-to-reference alignment and read
overlaps in PAF as input, and evaluates the sensitivity. For example:
```sh
minimap2 -cx map-pb ref.fa reads.fq.gz | sort -k6,6 -k8,8n > reads-to-ref.paf
minimap2 -x ava-pb reads.fq.gz reads.fq.gz > ovlp.paf
k8 ov-eval.js reads-to-ref.paf ovlp.paf
```
## <a name="asmvar"></a>Calling Variants from Haploid Assemblies
The **call** command of paftools.js calls variants from coordinate-sorted
assembly-to-reference alignment. It calls variants from the [cs tag][cs] and
identifies confident/callable regions as those covered by exactly one contig.
Here are example command lines:
```sh
minimap2 -cx asm5 -t8 --cs ref.fa asm.fa > asm.paf # keeping this file is recommended; --cs required!
sort -k6,6 -k8,8n asm.paf > asm.srt.paf # sort by reference start coordinate
k8 paftools.js call asm.srt.paf > asm.var.txt
```
Here is sample output:
```
V chr1 2276040 2276041 1 60 c g LJII01000171.1 1217409 1217410 +
V chr1 2280409 2280410 1 60 a g LJII01000171.1 1221778 1221779 +
V chr1 2280504 2280505 1 60 a g LJII01000171.1 1221873 1221874 +
R chr1 2325140 2436340
V chr1 2325287 2325287 1 60 - ct LJII01000171.1 1272894 1272896 +
V chr1 2325642 2325644 1 60 tt - LJII01000171.1 1273251 1273251 +
V chr1 2326051 2326052 1 60 c t LJII01000171.1 1273658 1273659 +
V chr1 2326287 2326288 1 60 c t LJII01000171.1 1273894 1273895 +
```
where a line starting with `R` gives regions covered by one query contig, and a
V-line encodes a variant in the following format: chr, start, end, query depth,
mapping quality, REF allele, ALT allele, query name, query start, end and the
query orientation. Generally, you should only look at variants where column 5
is one.
By default, when calling variants, "paftools.js call" ignores alignments 50kb
or shorter; when deriving callable regions, it ignores alignments 10kb or
shorter. It uses two thresholds to avoid edge effects. These defaults are
designed for long-read assemblies. For short reads, both should be reduced.
[paf]: https://github.com/lh3/miniasm/blob/master/PAF.md
[cs]: https://github.com/lh3/minimap2#cs
[k8]: https://github.com/attractivechaos/k8
[k8bin]: https://github.com/attractivechaos/k8/releases
[maf]: https://genome.ucsc.edu/FAQ/FAQformat#format5
[pbsim]: https://github.com/pfaucon/PBSIM-PacBio-Simulator
[mason2]: https://github.com/seqan/seqan/tree/master/apps/mason2
-258
View File
@@ -1,258 +0,0 @@
/*******************************
* Command line option parsing *
*******************************/
var getopt = function(args, ostr) {
var oli; // option letter list index
if (typeof(getopt.place) == 'undefined')
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
if (getopt.place == -1) { // update scanning pointer
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
getopt.place = -1;
return null;
}
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
++getopt.ind;
getopt.place = -1;
return null;
}
}
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
if (getopt.place < 0) ++getopt.ind;
return '?';
}
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
getopt.arg = null;
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
} else { // need an argument
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
getopt.arg = args[getopt.ind].substr(getopt.place);
else if (args.length <= ++getopt.ind) { // no arg
getopt.place = -1;
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
return '?';
} else getopt.arg = args[getopt.ind]; // white space
getopt.place = -1;
++getopt.ind;
}
return optopt;
}
/***********************
* Interval operations *
***********************/
Interval = {};
Interval.sort = function(a)
{
if (typeof a[0] == 'number')
a.sort(function(x, y) { return x - y });
else a.sort(function(x, y) { return x[0] != y[0]? x[0] - y[0] : x[1] - y[1] });
}
Interval.merge = function(a, sorted)
{
if (typeof sorted == 'undefined') sorted = true;
if (!sorted) Interval.sort(a);
var k = 0;
for (var i = 1; i < a.length; ++i) {
if (a[k][1] >= a[i][0])
a[k][1] = a[k][1] > a[i][1]? a[k][1] : a[i][1];
else a[++k] = a[i].slice(0);
}
a.length = k + 1;
}
Interval.dedup = function(a, sorted)
{
if (typeof sorted == 'undefined') sorted = true;
if (!sorted) Interval.sort(a);
var k = 0;
for (var i = 1; i < a.length; ++i)
if (a[k][0] != a[i][0] || a[k][1] != a[i][1])
a[++k] = a[i].slice(0);
a.length = k + 1;
}
Interval.index_end = function(a, sorted)
{
if (a.length == 0) return;
if (typeof sorted == 'undefined') sorted = true;
if (!sorted) Interval.sort(a);
a[0].push(0);
var k = 0, k_en = a[0][1];
for (var i = 1; i < a.length; ++i) {
if (k_en <= a[i][0]) {
for (++k; k < i; ++k)
if (a[k][1] > a[i][0])
break;
k_en = a[k][1];
}
a[i].push(k);
}
}
Interval.find_intv = function(a, x)
{
var left = -1, right = a.length;
if (typeof a[0] == 'number') {
while (right - left > 1) {
var mid = left + ((right - left) >> 1);
if (a[mid] > x) right = mid;
else if (a[mid] < x) left = mid;
else return mid;
}
} else {
while (right - left > 1) {
var mid = left + ((right - left) >> 1);
if (a[mid][0] > x) right = mid;
else if (a[mid][0] < x) left = mid;
else return mid;
}
}
return left;
}
Interval.find_ovlp = function(a, st, en)
{
if (a.length == 0 || st >= en) return [];
var l = Interval.find_intv(a, st);
var k = l < 0? 0 : a[l][a[l].length - 1];
var b = [];
for (var i = k; i < a.length; ++i) {
if (a[i][0] >= en) break;
else if (st < a[i][1])
b.push(a[i]);
}
return b;
}
/*****************
* Main function *
*****************/
function read_bed(fn, to_merge, to_dedup)
{
var file = new File(fn);
var buf = new Bytes();
var h = {};
while (file.readline(buf) >= 0) {
var t = buf.toString().split("\t");
if (h[t[0]] == null)
h[t[0]] = [];
var bst = parseInt(t[1]);
var ben = parseInt(t[2]);
if (t.length >= 12 && /^\d+$/.test(t[9])) {
t[9] = parseInt(t[9]);
var sz = t[10].split(",");
var st = t[11].split(",");
for (var i = 0; i < t[9]; ++i) {
st[i] = parseInt(st[i]);
sz[i] = parseInt(sz[i]);
h[t[0]].push([bst + st[i], bst + st[i] + sz[i], 0, 0, 0]);
}
} else {
h[t[0]].push([bst, ben, 0, 0, 0]);
}
}
buf.destroy();
file.close();
for (var chr in h) {
if (to_merge) Interval.merge(h[chr], false);
else if (to_dedup) Interval.dedup(h[chr], false);
else Interval.sort(h[chr]);
Interval.index_end(h[chr]);
}
return h;
}
function main(args)
{
var c, print_len = false, to_merge = true, to_dedup = false, fn_excl = null;
while ((c = getopt(args, "pde:")) != null) {
if (c == 'p') print_len = true;
else if (c == 'd') to_dedup = true, to_merge = false;
else if (c == 'e') fn_excl = getopt.arg;
}
if (args.length - getopt.ind < 2) {
print("Usage: k8 cnt-feat.js [options] <target.bed> <feature.bed>");
print("Options:");
print(" -e FILE exclude features overlapping regions in BED FILE []");
print(" -p print number of covered bases for each feature");
exit(1);
}
var excl = fn_excl != null? read_bed(fn_excl, true, false) : null;
var target = read_bed(args[getopt.ind], to_merge, to_dedup);
var file, buf = new Bytes();
var tot_len = 0, hit_len = 0;
file = args[getopt.ind+1] != '-'? new File(args[getopt.ind+1]) : new File();
while (file.readline(buf) >= 0) {
var t = buf.toString().split("\t");
var a = [];
var bst = parseInt(t[1]);
var ben = parseInt(t[2]);
if (t.length >= 12 && /^\d+$/.test(t[9])) { // BED12
t[9] = parseInt(t[9]);
var sz = t[10].split(",");
var st = t[11].split(",");
for (var i = 0; i < t[9]; ++i) {
st[i] = parseInt(st[i]);
sz[i] = parseInt(sz[i]);
a.push([bst + st[i], bst + st[i] + sz[i], false]);
}
} else a.push([bst, ben, false]); // 3-column BED
var feat_len = 0;
for (var i = 0; i < a.length; ++i) {
if (excl != null && excl[t[0]] != null) {
var oe = Interval.find_ovlp(excl[t[0]], a[i][0], a[i][1]);
if (oe.length > 0)
continue;
}
a[i][2] = true;
feat_len += a[i][1] - a[i][0];
}
tot_len += feat_len;
if (target[t[0]] == null) continue;
var b = [];
for (var i = 0; i < a.length; ++i) {
if (!a[i][2]) continue;
var o = Interval.find_ovlp(target[t[0]], a[i][0], a[i][1]);
for (var j = 0; j < o.length; ++j) {
var max_st = o[j][0] > a[i][0]? o[j][0] : a[i][0];
var min_en = o[j][1] < a[i][1]? o[j][1] : a[i][1];
b.push([max_st, min_en]);
o[j][2] += min_en - max_st;
++o[j][3];
if (max_st == o[j][0] && min_en == o[j][1])
++o[j][4];
}
}
// find the length covered
var feat_hit_len = 0;
if (b.length > 0) {
b.sort(function(a,b) {return a[0]-b[0]});
var st = b[0][0], en = b[0][1];
for (var i = 1; i < b.length; ++i) {
if (b[i][0] <= en) en = en > b[i][1]? en : b[i][1];
else feat_hit_len += en - st, st = b[i][0], en = b[i][1];
}
feat_hit_len += en - st;
}
hit_len += feat_hit_len;
if (print_len) print('F', t.slice(0, 4).join("\t"), feat_len, feat_hit_len);
}
file.close();
buf.destroy();
warn("# feature bases: " + tot_len);
warn("# feature bases overlapping targets: " + hit_len + ' (' + (100.0 * hit_len / tot_len).toFixed(2) + '%)');
}
main(arguments);
-150
View File
@@ -1,150 +0,0 @@
var getopt = function(args, ostr) {
var oli; // option letter list index
if (typeof(getopt.place) == 'undefined')
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
if (getopt.place == -1) { // update scanning pointer
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
getopt.place = -1;
return null;
}
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
++getopt.ind;
getopt.place = -1;
return null;
}
}
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
if (getopt.place < 0) ++getopt.ind;
return '?';
}
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
getopt.arg = null;
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
} else { // need an argument
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
getopt.arg = args[getopt.ind].substr(getopt.place);
else if (args.length <= ++getopt.ind) { // no arg
getopt.place = -1;
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
return '?';
} else getopt.arg = args[getopt.ind]; // white space
getopt.place = -1;
++getopt.ind;
}
return optopt;
}
var c, fn_ucsc_fai = null, is_short = false;
while ((c = getopt(arguments, "u:s")) != null) {
if (c == 'u') fn_ucsc_fai = getopt.arg;
else if (c == 's') is_short = true;
}
if (getopt.ind == arguments.length) {
print("Usage: k8 gff2bed.js [-u ucsc-genome.fa.fai] <in.gff>");
exit(1);
}
var ens2ucsc = {};
if (fn_ucsc_fai != null) {
var buf = new Bytes();
var file = new File(fn_ucsc_fai);
while (file.readline(buf) >= 0) {
var t = buf.toString().split("\t");
var s = t[0];
if (/_(random|alt|decoy)$/.test(s)) {
s = s.replace(/_(random|alt|decoy)$/, '');
s = s.replace(/^chr\S+_/, '');
} else {
s = s.replace(/^chrUn_/, '');
}
s = s.replace(/v(\d+)/, ".$1");
if (s != t[0]) ens2ucsc[s] = t[0];
}
file.close();
buf.destroy();
}
var colors = {
'protein_coding':'0,128,255',
'lincRNA':'0,192,0',
'snRNA':'0,192,0',
'miRNA':'0,192,0',
'misc_RNA':'0,192,0'
};
function print_bed12(exons, cds_st, cds_en, is_short)
{
if (exons.length == 0) return;
var name = is_short? exons[0][7] + "|" + exons[0][5] : exons[0].slice(4, 7).join("|");
var a = exons.sort(function(a,b) {return a[1]-b[1]});
var sizes = [], starts = [], st, en;
st = a[0][1];
en = a[a.length - 1][2];
if (cds_st == 1<<30) cds_st = st;
if (cds_en == 0) cds_en = en;
if (cds_st < st || cds_en > en)
throw Error("inconsistent thick start or end for transcript " + a[0][4]);
for (var i = 0; i < a.length; ++i) {
sizes.push(a[i][2] - a[i][1]);
starts.push(a[i][1] - st);
}
var color = colors[a[0][5]];
if (color == null) color = '196,196,196';
print(a[0][0], st, en, name, 1000, a[0][3], cds_st, cds_en, color, a.length, sizes.join(",") + ",", starts.join(",") + ",");
}
var re_gtf = /(transcript_id|transcript_type|transcript_biotype|gene_name|transcript_name) "([^"]+)";/g;
var re_gff3 = /(transcript_id|transcript_type|transcript_biotype|gene_name|transcript_name)=([^;]+)/g;
var buf = new Bytes();
var file = new File(arguments[getopt.ind]);
var exons = [], cds_st = 1<<30, cds_en = 0, last_id = null;
while (file.readline(buf) >= 0) {
var t = buf.toString().split("\t");
if (t[0].charAt(0) == '#') continue;
if (t[2] != "CDS" && t[2] != "exon") continue;
t[3] = parseInt(t[3]) - 1;
t[4] = parseInt(t[4]);
var id = null, type = "", gname = "N/A", biotype = "", m, tname = "N/A";
while ((m = re_gtf.exec(t[8])) != null) {
if (m[1] == "transcript_id") id = m[2];
else if (m[1] == "transcript_type") type = m[2];
else if (m[1] == "transcript_biotype") biotype = m[2];
else if (m[1] == "gene_name") name = m[2];
else if (m[1] == "transcript_name") tname = m[2];
}
while ((m = re_gff3.exec(t[8])) != null) {
if (m[1] == "transcript_id") id = m[2];
else if (m[1] == "transcript_type") type = m[2];
else if (m[1] == "transcript_biotype") biotype = m[2];
else if (m[1] == "gene_name") name = m[2];
else if (m[1] == "transcript_name") tname = m[2];
}
if (type == "" && biotype != "") type = biotype;
if (id == null) throw Error("No transcript_id");
if (id != last_id) {
print_bed12(exons, cds_st, cds_en, is_short);
exons = [], cds_st = 1<<30, cds_en = 0;
last_id = id;
}
if (t[2] == "CDS") {
cds_st = cds_st < t[3]? cds_st : t[3];
cds_en = cds_en > t[4]? cds_en : t[4];
} else if (t[2] == "exon") {
if (fn_ucsc_fai != null) {
if (ens2ucsc[t[0]] != null)
t[0] = ens2ucsc[t[0]];
else if (/^[A-Z]+\d+\.\d+$/.test(t[0]))
t[0] = t[0].replace(/([A-Z]+\d+)\.(\d+)/, "chrUn_$1v$2");
}
exons.push([t[0], t[3], t[4], t[6], id, type, name, tname]);
}
}
if (last_id != null)
print_bed12(exons, cds_st, cds_en, is_short);
file.close();
buf.destroy();
-267
View File
@@ -1,267 +0,0 @@
/*******************************
* Command line option parsing *
*******************************/
var getopt = function(args, ostr) {
var oli; // option letter list index
if (typeof(getopt.place) == 'undefined')
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
if (getopt.place == -1) { // update scanning pointer
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
getopt.place = -1;
return null;
}
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
++getopt.ind;
getopt.place = -1;
return null;
}
}
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
if (getopt.place < 0) ++getopt.ind;
return '?';
}
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
getopt.arg = null;
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
} else { // need an argument
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
getopt.arg = args[getopt.ind].substr(getopt.place);
else if (args.length <= ++getopt.ind) { // no arg
getopt.place = -1;
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
return '?';
} else getopt.arg = args[getopt.ind]; // white space
getopt.place = -1;
++getopt.ind;
}
return optopt;
}
/***********************
* Interval operations *
***********************/
Interval = {};
Interval.sort = function(a)
{
if (typeof a[0] == 'number')
a.sort(function(x, y) { return x - y });
else a.sort(function(x, y) { return x[0] != y[0]? x[0] - y[0] : x[1] - y[1] });
}
Interval.merge = function(a, sorted)
{
if (typeof sorted == 'undefined') sorted = true;
if (!sorted) Interval.sort(a);
var k = 0;
for (var i = 1; i < a.length; ++i) {
if (a[k][1] >= a[i][0])
a[k][1] = a[k][1] > a[i][1]? a[k][1] : a[i][1];
else a[++k] = a[i].slice(0);
}
a.length = k + 1;
}
Interval.index_end = function(a, sorted)
{
if (a.length == 0) return;
if (typeof sorted == 'undefined') sorted = true;
if (!sorted) Interval.sort(a);
a[0].push(0);
var k = 0, k_en = a[0][1];
for (var i = 1; i < a.length; ++i) {
if (k_en <= a[i][0]) {
for (++k; k < i; ++k)
if (a[k][1] > a[i][0])
break;
k_en = a[k][1];
}
a[i].push(k);
}
}
Interval.find_intv = function(a, x)
{
var left = -1, right = a.length;
if (typeof a[0] == 'number') {
while (right - left > 1) {
var mid = left + ((right - left) >> 1);
if (a[mid] > x) right = mid;
else if (a[mid] < x) left = mid;
else return mid;
}
} else {
while (right - left > 1) {
var mid = left + ((right - left) >> 1);
if (a[mid][0] > x) right = mid;
else if (a[mid][0] < x) left = mid;
else return mid;
}
}
return left;
}
Interval.find_ovlp = function(a, st, en)
{
if (a.length == 0 || st >= en) return [];
var l = Interval.find_intv(a, st);
var k = l < 0? 0 : a[l][a[l].length - 1];
var b = [];
for (var i = k; i < a.length; ++i) {
if (a[i][0] >= en) break;
else if (st < a[i][1])
b.push(a[i]);
}
return b;
}
/*****************
* Main function *
*****************/
var c, l_fuzzy = 0, print_ovlp = false, print_err_only = false, first_only = false;
while ((c = getopt(arguments, "l:ep")) != null) {
if (c == 'l') l_fuzzy = parseInt(getopt.arg);
else if (c == 'e') print_err_only = print_ovlp = true;
else if (c == 'p') print_ovlp = true;
}
if (arguments.length - getopt.ind < 2) {
print("Usage: k8 intron-eval.js [options] <gene.gtf> <aln.sam>");
exit(1);
}
var file, buf = new Bytes();
var tr = {};
file = new File(arguments[getopt.ind]);
while (file.readline(buf) >= 0) {
var m, t = buf.toString().split("\t");
if (t[0].charAt(0) == '#') continue;
if (t[2] != 'exon') continue;
var st = parseInt(t[3]) - 1;
var en = parseInt(t[4]);
if ((m = /transcript_id "(\S+)"/.exec(t[8])) == null) continue;
var tid = m[1];
if (tr[tid] == null) tr[tid] = [t[0], t[6], 0, 0, []];
tr[tid][4].push([st, en]);
}
file.close();
var anno = {};
for (var tid in tr) {
var t = tr[tid];
Interval.sort(t[4]);
t[2] = t[4][0][0];
t[3] = t[4][t[4].length - 1][1];
if (anno[t[0]] == null) anno[t[0]] = [];
var s = t[4];
for (var i = 0; i < s.length - 1; ++i) {
if (s[i][1] >= s[i+1][0])
warn("WARNING: incorrect annotation for transcript "+tid+" ("+s[i][1]+" >= "+s[i+1][0]+")")
anno[t[0]].push([s[i][1], s[i+1][0]]);
}
}
tr = null;
for (var chr in anno) {
var e = anno[chr];
if (e.length == 0) continue;
Interval.sort(e);
var k = 0;
for (var i = 1; i < e.length; ++i) // dedup
if (e[i][0] != e[k][0] || e[i][1] != e[k][1])
e[++k] = e[i].slice(0);
e.length = k + 1;
Interval.index_end(e);
}
var n_pri = 0, n_unmapped = 0, n_mapped = 0;
var n_sgl = 0, n_splice = 0, n_splice_hit = 0, n_splice_novel = 0;
file = new File(arguments[getopt.ind+1]);
var last_qname = null;
var re_cigar = /(\d+)([MIDNSHX=])/g;
while (file.readline(buf) >= 0) {
var m, t = buf.toString().split("\t");
if (t[0].charAt(0) == '@') continue;
var flag = parseInt(t[1]);
if (flag&0x100) continue;
if (first_only && last_qname == t[0]) continue;
if (t[2] == '*') {
++n_unmapped;
continue;
} else {
++n_pri;
if (last_qname != t[0]) ++n_mapped;
}
var pos = parseInt(t[3]) - 1, intron = [];
while ((m = re_cigar.exec(t[5])) != null) {
var len = parseInt(m[1]), op = m[2];
if (op == 'N') {
intron.push([pos, pos + len]);
pos += len;
} else if (op == 'M' || op == 'X' || op == '=' || op == 'D') pos += len;
}
if (intron.length == 0) {
++n_sgl;
continue;
}
n_splice += intron.length;
var chr = anno[t[2]];
if (chr != null) {
for (var i = 0; i < intron.length; ++i) {
var o = Interval.find_ovlp(chr, intron[i][0], intron[i][1]);
if (o.length > 0) {
var hit = false;
for (var j = 0; j < o.length; ++j) {
var st_diff = intron[i][0] - o[j][0];
var en_diff = intron[i][1] - o[j][1];
if (st_diff < 0) st_diff = -st_diff;
if (en_diff < 0) en_diff = -en_diff;
if (st_diff <= l_fuzzy && en_diff <= l_fuzzy)
++n_splice_hit, hit = true;
if (hit) break;
}
if (print_ovlp) {
var type = hit? 'C' : 'P';
if (hit && print_err_only) continue;
var x = '[';
for (var j = 0; j < o.length; ++j) {
if (j) x += ', ';
x += '(' + o[j][0] + "," + o[j][1] + ')';
}
x += ']';
print(type, t[0], i+1, t[2], intron[i][0], intron[i][1], x);
}
} else {
++n_splice_novel;
if (print_ovlp)
print('N', t[0], i+1, t[2], intron[i][0], intron[i][1]);
}
}
} else {
n_splice_novel += intron.length;
}
last_qname = t[0];
}
file.close();
buf.destroy();
if (!print_ovlp) {
print("# unmapped reads: " + n_unmapped);
print("# mapped reads: " + n_mapped);
print("# primary alignments: " + n_pri);
print("# singletons: " + n_sgl);
print("# predicted introns: " + n_splice);
print("# non-overlapping introns: " + n_splice_novel);
print("# correct introns: " + n_splice_hit + " (" + (n_splice_hit / n_splice * 100).toFixed(2) + "%)");
}
-183
View File
@@ -1,183 +0,0 @@
var getopt = function(args, ostr) {
var oli; // option letter list index
if (typeof(getopt.place) == 'undefined')
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
if (getopt.place == -1) { // update scanning pointer
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
getopt.place = -1;
return null;
}
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
++getopt.ind;
getopt.place = -1;
return null;
}
}
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
if (getopt.place < 0) ++getopt.ind;
return '?';
}
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
getopt.arg = null;
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
} else { // need an argument
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
getopt.arg = args[getopt.ind].substr(getopt.place);
else if (args.length <= ++getopt.ind) { // no arg
getopt.place = -1;
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
return '?';
} else getopt.arg = args[getopt.ind]; // white space
getopt.place = -1;
++getopt.ind;
}
return optopt;
}
var c, gap_out_len = null;
while ((c = getopt(arguments, "l:")) != null)
if (c == 'l') gap_out_len = parseInt(getopt.arg);
if (getopt.ind == arguments.length) {
print("Usage: k8 mapstat.js [-l gapOutLen] <in.sam>|<in.paf>");
exit(1);
}
var buf = new Bytes();
var file = new File(arguments[getopt.ind]);
var re = /(\d+)([MIDSHNX=])/g;
var lineno = 0, n_pri = 0, n_2nd = 0, n_seq = 0, n_cigar_64k = 0, l_tot = 0, l_cov = 0;
var n_gap = [[0, 0, 0, 0, 0, 0], [0, 0, 0, 0, 0, 0]];
function cov_len(regs)
{
regs.sort(function(a,b) {return a[0]-b[0]});
var st = regs[0][0], en = regs[0][1], l = 0;
for (var i = 1; i < regs.length; ++i) {
if (regs[i][0] < en)
en = en > regs[i][1]? en : regs[i][1];
else l += en - st, st = regs[i][0], en = regs[i][1];
}
l += en - st;
return l;
}
var last = null, last_qlen = null, regs = [];
while (file.readline(buf) >= 0) {
var line = buf.toString();
++lineno;
if (line.charAt(0) != '@') {
var t = line.split("\t", 12);
var m, rs, cigar = null, is_pri = false, is_sam = false, is_rev = false, tname = null;
var atlen = null, aqlen, qs, qe, mapq, ori_qlen;
if (t[4] == '+' || t[4] == '-') { // PAF
if (!/\ts2:i:\d+/.test(line)) {
++n_2nd;
continue;
}
if ((m = /\tcg:Z:(\S+)/.exec(line)) != null)
cigar = m[1];
if (cigar == null) {
warn("WARNING: no CIGAR at line " + lineno);
continue;
}
tname = t[5];
qs = parseInt(t[2]), qe = parseInt(t[3]);
aqlen = qe - qs;
is_rev = t[4] == '+'? false : true;
rs = parseInt(t[7]);
atlen = parseInt(t[8]) - rs;
mapq = parseInt(t[11]);
ori_qlen = parseInt(t[1]);
} else { // SAM
var flag = parseInt(t[1]);
if ((flag & 4) || t[2] == '*' || t[5] == '*') continue;
if (flag & 0x100) {
++n_2nd;
continue;
}
cigar = t[5];
tname = t[2];
rs = parseInt(t[3]) - 1;
mapq = parseInt(t[4]);
aqlen = t[9].length;
is_sam = true;
is_rev = !!(flag&0x10);
}
++n_pri;
if (last != t[0]) {
if (last != null) {
l_tot += last_qlen;
l_cov += cov_len(regs);
}
regs = [];
++n_seq, last = t[0];
}
var M = 0, tl = 0, ql = 0, clip = [0, 0], n_cigar = 0, sclip = 0;
while ((m = re.exec(cigar)) != null) {
var l = parseInt(m[1]);
++n_cigar;
if (m[2] == 'M' || m[2] == '=' || m[2] == 'X') {
tl += l, ql += l, M += l;
} else if (m[2] == 'I' || m[2] == 'D') {
var type;
if (l < 50) type = 0;
else if (l < 100) type = 1;
else if (l < 300) type = 2;
else if (l < 400) type = 3;
else if (l < 1000) type = 4;
else type = 5;
if (m[2] == 'I') ql += l, ++n_gap[0][type];
else tl += l, ++n_gap[1][type];
if (gap_out_len != null && l >= gap_out_len)
print(t[0], ql, is_rev? '-' : '+', tname, rs + tl, m[2], l);
} else if (m[2] == 'N') {
tl += l;
} else if (m[2] == 'S') {
clip[M == 0? 0 : 1] = l, sclip += l;
} else if (m[2] == 'H') {
clip[M == 0? 0 : 1] = l;
}
}
if (n_cigar > 65535) ++n_cigar_64k;
if (ql + sclip != aqlen)
warn("WARNING: aligned query length is inconsistent with CIGAR at line " + lineno + " (" + (ql+sclip) + " != " + aqlen + ")");
if (atlen != null && atlen != tl)
warn("WARNING: aligned reference length is inconsistent with CIGAR at line " + lineno);
if (is_sam) {
qs = clip[is_rev? 1 : 0], qe = qs + ql;
ori_qlen = clip[0] + ql + clip[1];
}
regs.push([qs, qe]);
last_qlen = ori_qlen;
}
}
l_tot += last_qlen;
l_cov += cov_len(regs);
file.close();
buf.destroy();
if (gap_out_len == null) {
print("Number of mapped sequences: " + n_seq);
print("Number of primary alignments: " + n_pri);
print("Number of secondary alignments: " + n_2nd);
print("Number of primary alignments with >65535 CIGAR operations: " + n_cigar_64k);
print("Number of bases in mapped sequences: " + l_tot);
print("Number of mapped bases: " + l_cov);
print("Number of insertions in [0,50): " + n_gap[0][0]);
print("Number of insertions in [50,100): " + n_gap[0][1]);
print("Number of insertions in [100,300): " + n_gap[0][2]);
print("Number of insertions in [300,400): " + n_gap[0][3]);
print("Number of insertions in [400,1000): " + n_gap[0][4]);
print("Number of insertions in [1000,inf): " + n_gap[0][5]);
print("Number of deletions in [0,50): " + n_gap[1][0]);
print("Number of deletions in [50,100): " + n_gap[1][1]);
print("Number of deletions in [100,300): " + n_gap[1][2]);
print("Number of deletions in [300,400): " + n_gap[1][3]);
print("Number of deletions in [400,1000): " + n_gap[1][4]);
print("Number of deletions in [1000,inf): " + n_gap[1][5]);
}
-105
View File
@@ -1,105 +0,0 @@
var getopt = function(args, ostr) {
var oli; // option letter list index
if (typeof(getopt.place) == 'undefined')
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
if (getopt.place == -1) { // update scanning pointer
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
getopt.place = -1;
return null;
}
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
++getopt.ind;
getopt.place = -1;
return null;
}
}
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
if (getopt.place < 0) ++getopt.ind;
return '?';
}
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
getopt.arg = null;
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
} else { // need an argument
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
getopt.arg = args[getopt.ind].substr(getopt.place);
else if (args.length <= ++getopt.ind) { // no arg
getopt.place = -1;
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
return '?';
} else getopt.arg = args[getopt.ind]; // white space
getopt.place = -1;
++getopt.ind;
}
return optopt;
}
var c, min_ovlp = 2000, min_frac = 0.95, min_mapq = 10;
while ((c = getopt(arguments, "q:l:f:")) != null) {
if (c == 'q') min_mapq = parseInt(getopt.arg);
else if (c == 'l') min_ovlp = parseInt(getopt.arg);
else if (c == 'f') min_frac = parseFloat(getopt.arg);
}
if (arguments.length - getopt.ind < 2) {
print("Usage: sort -k6,6 -k8,8n to-ref.paf | k8 ov-eval.js [options] - <ovlp.paf>");
print("Options:");
print(" -l INT min overlap length [2000]");
print(" -q INT min mapping quality [10]");
print(" -f FLOAT min fraction of mapped length [0.95]");
exit(1);
}
var buf = new Bytes();
var file = arguments[getopt.ind] == '-'? new File() : new File(arguments[getopt.ind]);
var a = [], h = {};
while (file.readline(buf) >= 0) {
var t = buf.toString().split("\t");
var is_pri = false;
if (parseInt(t[11]) < min_mapq) continue;
for (var i = 12; i < t.length; ++i)
if (t[i] == 'tp:A:P')
is_pri = true;
if (!is_pri) continue;
for (var i = 1; i <= 3; ++i)
t[i] = parseInt(t[i]);
for (var i = 6; i <= 8; ++i)
t[i] = parseInt(t[i]);
if (t[3] - t[2] < min_ovlp || t[8] - t[7] < min_ovlp || (t[3] - t[2]) / t[1] < min_frac)
continue;
var ctg = t[5], st = t[7], en = t[8];
while (a.length > 0) {
if (a[0][0] == ctg && a[0][2] > st)
break;
else a.shift();
}
for (var j = 0; j < a.length; ++j) {
if (a[j][3] == t[0]) continue;
var len = (en > a[j][2]? a[j][2] : en) - st;
if (len >= min_ovlp) {
var key = a[j][3] < t[0]? a[j][3] + "\t" + t[0] : t[0] + "\t" + a[j][3];
h[key] = len;
}
}
a.push([ctg, st, en, t[0]]);
}
file.close();
file = new File(arguments[getopt.ind + 1]);
while (file.readline(buf) >= 0) {
var t = buf.toString().split("\t");
var key = t[0] < t[5]? t[0] + "\t" + t[5] : t[5] + "\t" + t[0];
if (h[key] > 0) h[key] = -h[key];
}
file.close();
buf.destroy();
var n_ovlp = 0, n_missing = 0;
for (var key in h) {
++n_ovlp;
if (h[key] > 0) ++n_missing;
}
print(n_ovlp + " overlaps inferred from the reference mapping");
print(n_missing + " missed by the read overlapper");
print((100 * (1 - n_missing / n_ovlp)).toFixed(2) + "% sensitivity");
-196
View File
@@ -1,196 +0,0 @@
var getopt = function(args, ostr) {
var oli; // option letter list index
if (typeof(getopt.place) == 'undefined')
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
if (getopt.place == -1) { // update scanning pointer
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
getopt.place = -1;
return null;
}
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
++getopt.ind;
getopt.place = -1;
return null;
}
}
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
if (getopt.place < 0) ++getopt.ind;
return '?';
}
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
getopt.arg = null;
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
} else { // need an argument
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
getopt.arg = args[getopt.ind].substr(getopt.place);
else if (args.length <= ++getopt.ind) { // no arg
getopt.place = -1;
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
return '?';
} else getopt.arg = args[getopt.ind]; // white space
getopt.place = -1;
++getopt.ind;
}
return optopt;
}
var c, line_len = 80, fmt = "aln";
while ((c = getopt(arguments, "f:l:")) != null) {
if (c == 'f') {
fmt = getopt.arg;
if (fmt != "aln" && fmt != "lastz-cigar" && fmt != "maf")
throw Error("format must be one of aln, lastz-cigar and maf");
} else if (c == 'l') line_len = parseInt(getopt.arg);
}
if (line_len == 0) line_len = 0x7fffffff;
if (getopt.ind == arguments.length) {
print("Usage: k8 paf2aln.js [options] <in.paf>");
print("Options:");
print(" -f STR output format: aln (BLAST-like), maf or lastz-cigar [aln]");
print(" -l INT line length in BLAST-like output [80]");
exit(1);
}
function padding_str(x, len, right)
{
var s = x.toString();
if (s.length < len) {
if (right) s += Array(len - s.length + 1).join(" ");
else s = Array(len - s.length + 1).join(" ") + s;
}
return s;
}
function update_aln(s_ref, s_qry, s_mid, type, seq, slen)
{
var l = type == '*'? 1 : seq.length;
if (type == '=' || type == ':') {
s_ref.set(seq);
s_qry.set(seq);
s_mid.set(Array(l+1).join("|"));
slen[0] += l, slen[1] += l;
} else if (type == '*') {
s_ref.set(seq.charAt(0));
s_qry.set(seq.charAt(1));
s_mid.set(' ');
slen[0] += 1, slen[1] += 1;
} else if (type == '+') {
s_ref.set(Array(l+1).join("-"));
s_qry.set(seq);
s_mid.set(Array(l+1).join(" "));
slen[1] += l;
} else if (type == '-') {
s_ref.set(seq);
s_qry.set(Array(l+1).join("-"));
s_mid.set(Array(l+1).join(" "));
slen[0] += l;
}
}
function print_aln(rs, qs, strand, slen, elen, s_ref, s_qry, s_mid)
{
print(["Ref+:", padding_str(rs + slen[0] + 1, 10, false), s_ref.toString(), padding_str(rs + elen[0], 10, true)].join(" "));
print(" " + s_mid.toString());
var st, en;
if (strand == '+') st = qs + slen[1] + 1, en = qs + elen[1];
else st = qs - slen[1], en = qs - elen[1] + 1;
print(["Qry" + strand + ":", padding_str(st, 10, false), s_qry.toString(), padding_str(en, 10, true)].join(" "));
}
var s_ref = new Bytes(), s_qry = new Bytes(), s_mid = new Bytes(); // these are used to show padded alignment
var re_cs = /([:=\-\+\*])(\d+|[A-Za-z]+)/g;
var re_cg = /(\d+)([MIDNSH])/g;
var buf = new Bytes();
var file = arguments[getopt.ind] == "-"? new File() : new File(arguments[getopt.ind]);
var lineno = 0;
if (fmt == "maf") print("##maf version=1\n");
while (file.readline(buf) >= 0) {
var m, line = buf.toString();
var t = line.split("\t", 12);
++lineno;
s_ref.length = s_qry.length = s_mid.length = 0;
var slen = [0, 0], elen = [0, 0];
if (fmt == "lastz-cigar") { // LASTZ-cigar output
var cg = (m = /\tcg:Z:(\S+)/.exec(line)) != null? m[1] : null;
if (cg == null) {
warn("WARNING: converting to LASTZ-cigar format requires the 'cg' tag, which is absent on line " + lineno);
continue;
}
var score = (m = /\tAS:i:(\d+)/.exec(line)) != null? m[1] : 0;
var out = ['cigar:', t[0], t[2], t[3], t[4], t[5], t[7], t[8], '+', score];
while ((m = re_cg.exec(cg)) != null)
out.push(m[2], m[1]);
print(out.join(" "));
} else if (fmt == "maf") { // MAF output
var cs = (m = /\tcs:Z:(\S+)/.exec(line)) != null? m[1] : null;
if (cs == null) {
warn("WARNING: converting to MAF requires the 'cs' tag, which is absent on line " + lineno);
continue;
}
while ((m = re_cs.exec(cs)) != null) {
if (m[1] == ':')
throw Error("converting to MAF only works with 'minimap2 --cs=long'");
update_aln(s_ref, s_qry, s_mid, m[1], m[2], elen);
}
var score = (m = /\tAS:i:(\d+)/.exec(line)) != null? parseInt(m[1]) : 0;
var len = t[0].length > t[5].length? t[0].length : t[5].length;
print("a " + score);
print(["s", padding_str(t[5], len, true), padding_str(t[7], 10, false), padding_str(parseInt(t[8]) - parseInt(t[7]), 10, false),
"+", padding_str(t[6], 10, false), s_ref.toString()].join(" "));
var qs, qe, ql = parseInt(t[1]);
if (t[4] == '+') {
qs = parseInt(t[2]);
qe = parseInt(t[3]);
} else {
qs = ql - parseInt(t[3]);
qe = ql - parseInt(t[2]);
}
print(["s", padding_str(t[0], len, true), padding_str(qs, 10, false), padding_str(qe - qs, 10, false),
t[4], padding_str(ql, 10, false), s_qry.toString()].join(" "));
print("");
} else { // BLAST-like output
var cs = (m = /\tcs:Z:(\S+)/.exec(line)) != null? m[1] : null;
if (cs == null) {
warn("WARNING: converting to BLAST-like alignment requires the 'cs' tag, which is absent on line " + lineno);
continue;
}
line = line.replace(/\tc[sg]:Z:\S+/g, ""); // get rid of cs or cg tags
print('>' + line);
var rs = parseInt(t[7]), qs = t[4] == '+'? parseInt(t[2]) : parseInt(t[3]);
var n_blocks = 0;
while ((m = re_cs.exec(cs)) != null) {
if (m[1] == ':') m[2] = Array(parseInt(m[2]) + 1).join("=");
var start = 0, rest = m[1] == '*'? 1 : m[2].length;
while (rest > 0) {
var l_proc;
if (s_ref.length + rest >= line_len) {
l_proc = line_len - s_ref.length;
update_aln(s_ref, s_qry, s_mid, m[1], m[1] == '*'? m[2] : m[2].substr(start, l_proc), elen);
if (n_blocks > 0) print("");
print_aln(rs, qs, t[4], slen, elen, s_ref, s_qry, s_mid);
++n_blocks;
s_ref.length = s_qry.length = s_mid.length = 0;
slen[0] = elen[0], slen[1] = elen[1];
} else {
l_proc = rest;
update_aln(s_ref, s_qry, s_mid, m[1], m[1] == '*'? m[2] : m[2].substr(start, l_proc), elen);
}
rest -= l_proc, start += l_proc;
}
}
if (s_ref.length > 0) {
if (n_blocks > 0) print("");
print_aln(rs, qs, t[4], slen, elen, s_ref, s_qry, s_mid);
++n_blocks;
}
print("//");
}
}
file.close();
buf.destroy();
s_ref.destroy(); s_qry.destroy(); s_mid.destroy();
-188
View File
@@ -1,188 +0,0 @@
var getopt = function(args, ostr) {
var oli; // option letter list index
if (typeof(getopt.place) == 'undefined')
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
if (getopt.place == -1) { // update scanning pointer
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
getopt.place = -1;
return null;
}
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
++getopt.ind;
getopt.place = -1;
return null;
}
}
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
if (getopt.place < 0) ++getopt.ind;
return '?';
}
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
getopt.arg = null;
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
} else { // need an argument
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
getopt.arg = args[getopt.ind].substr(getopt.place);
else if (args.length <= ++getopt.ind) { // no arg
getopt.place = -1;
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
return '?';
} else getopt.arg = args[getopt.ind]; // white space
getopt.place = -1;
++getopt.ind;
}
return optopt;
}
var re_cs = /([:=*+-])(\d+|[A-Za-z]+)/g;
var c, min_cov_len = 10000, min_var_len = 50000, gap_thres = 50, min_mapq = 5;
while ((c = getopt(arguments, "l:L:g:q:")) != null) {
if (c == 'l') min_cov_len = parseInt(getopt.arg);
else if (c == 'L') min_var_len = parseInt(getopt.arg);
else if (c == 'g') gap_thres = parseInt(getopt.arg);
else if (c == 'q') min_mapq = parseInt(getopt.arg);
}
if (arguments.length == getopt.ind) {
print("Usage: k8 paf2diff.js [options] <with-cs.paf>");
print("Options:");
print(" -l INT min alignment length to compute coverage ["+min_cov_len+"]");
print(" -L INT min alignment length to call variants ["+min_var_len+"]");
print(" -q INT min mapping quality ["+min_mapq+"]");
print(" -g INT short/long gap threshold (for statistics only) ["+gap_thres+"]");
exit(1);
}
var file = arguments[getopt.ind] == '-'? new File() : new File(arguments[getopt.ind]);
var buf = new Bytes();
var tot_len = 0, n_sub = [0, 0, 0], n_ins = [0, 0, 0, 0], n_del = [0, 0, 0, 0];
function count_var(o)
{
if (o[3] > 1) return;
if (o[5] == '-' && o[6] == '-') return;
if (o[5] == '-') { // insertion
var l = o[6].length;
if (l == 1) ++n_ins[0];
else if (l == 2) ++n_ins[1];
else if (l < gap_thres) ++n_ins[2];
else ++n_ins[3];
} else if (o[6] == '-') { // deletion
var l = o[5].length;
if (l == 1) ++n_del[0];
else if (l == 2) ++n_del[1];
else if (l < gap_thres) ++n_del[2];
else ++n_del[3];
} else {
++n_sub[0];
var s = o[5] + o[6];
if (s == 'ag' || s == 'ga' || s == 'ct' || s == 'tc')
++n_sub[1];
else ++n_sub[2];
}
}
var a = [], out = [];
var c1_ctg = null, c1_start = 0, c1_end = 0, c1_counted = false, c1_len = 0;
while (file.readline(buf) >= 0) {
var line = buf.toString();
if (!/\ts2:i:/.test(line)) continue; // skip secondary alignments
var m, t = line.split("\t", 12);
for (var i = 6; i <= 11; ++i)
t[i] = parseInt(t[i]);
if (t[10] < min_cov_len || t[11] < min_mapq) continue;
var ctg = t[5], x = t[7], end = t[8];
// compute regions covered by 1 contig
if (ctg != c1_ctg || x >= c1_end) {
if (c1_counted && c1_end > c1_start) {
c1_len += c1_end - c1_start;
print('R', c1_ctg, c1_start, c1_end);
}
c1_ctg = ctg, c1_start = x, c1_end = end;
c1_counted = (t[10] >= min_var_len);
} else if (end > c1_end) { // overlap
if (c1_counted && x > c1_start) {
c1_len += x - c1_start;
print('R', c1_ctg, c1_start, x);
}
c1_start = c1_end, c1_end = end;
c1_counted = (t[10] >= min_var_len);
} else { // contained
if (c1_counted && x > c1_start) {
c1_len += x - c1_start;
print('R', c1_ctg, c1_start, x);
}
c1_start = end;
}
// output variants ahead of this alignment
while (out.length) {
if (out[0][0] != ctg || out[0][2] <= x) {
count_var(out[0]);
print('V', out[0].join("\t"));
out.shift();
} else break;
}
// update coverage
for (var i = 0; i < out.length; ++i)
if (out[i][1] >= x && out[i][2] <= end)
++out[i][3];
// drop alignments that don't overlap with the current one
var k = 0;
for (var i = 0; i < a.length; ++i)
if (a[0][0] == ctg && a[0][2] > x)
a[k++] = a[i];
a.length = k;
// core loop
if (t[10] >= min_var_len) {
if ((m = /\tcs:Z:(\S+)/.exec(line)) == null) continue; // no cs tag
var cs = m[1];
var blen = 0, n_diff = 0;
tot_len += t[10];
while ((m = re_cs.exec(cs)) != null) {
var cov = 1;
if (m[1] == '*' || m[1] == '+' || m[1] == '-')
for (var i = 0; i < a.length; ++i)
if (a[0][2] > x) ++cov;
if (m[1] == '=' || m[1] == ':') {
var l = m[1] == '='? m[2].length : parseInt(m[2]);
x += l, blen += l;
} else if (m[1] == '*') {
out.push([t[5], x, x+1, cov, t[11], m[2].charAt(0), m[2].charAt(1)]);
++x, ++blen, ++n_diff;
} else if (m[1] == '+') {
out.push([t[5], x, x, cov, t[11], '-', m[2]]);
++blen, ++n_diff;
} else if (m[1] == '-') {
out.push([t[5], x, x + m[2].length, cov, t[11], m[2], '-']);
x += m[2].length, ++blen, ++n_diff;
}
}
}
a.push([t[5], t[7], t[8]]);
}
if (c1_counted && c1_end > c1_start) {
c1_len += c1_end - c1_start;
print('R', c1_ctg, c1_start, c1_end);
}
while (out.length) {
count_var(out[0]);
print('V', out[0].join("\t"));
out.shift();
}
//warn(tot_len + " alignment columns considered in calling");
warn(c1_len + " reference bases covered by exactly one contig");
warn(n_sub[0] + " substitutions; ts/tv = " + (n_sub[1]/n_sub[2]).toFixed(3));
warn(n_del[0] + " 1bp deletions");
warn(n_ins[0] + " 1bp insertions");
warn(n_del[1] + " 2bp deletions");
warn(n_ins[1] + " 2bp insertions");
warn(n_del[2] + " [3,"+gap_thres+") deletions");
warn(n_ins[2] + " [3,"+gap_thres+") insertions");
warn(n_del[3] + " >="+gap_thres+" deletions");
warn(n_ins[3] + " >="+gap_thres+" insertions");
buf.destroy();
file.close();
+241
View File
@@ -0,0 +1,241 @@
#!/usr/bin/env k8
"use strict";
Array.prototype.delete_at = function(i) {
for (let j = i; j < this.length - 1; ++j)
this[j] = this[j + 1];
--this.length;
}
function* getopt(argv, ostr, longopts) {
if (argv.length == 0) return;
let pos = 0, cur = 0;
while (cur < argv.length) {
let lopt = "", opt = "?", arg = "";
while (cur < argv.length) { // skip non-option arguments
if (argv[cur][0] == "-" && argv[cur].length > 1) {
if (argv[cur] == "--") cur = argv.length;
break;
} else ++cur;
}
if (cur == argv.length) break;
let a = argv[cur];
if (a[0] == "-" && a[1] == "-") { // a long option
pos = -1;
let c = 0, k = -1, tmp = "", o;
const pos_eq = a.indexOf("=");
if (pos_eq > 0) {
o = a.substring(2, pos_eq);
arg = a.substring(pos_eq + 1);
} else o = a.substring(2);
for (let i = 0; i < longopts.length; ++i) {
let y = longopts[i];
if (y[y.length - 1] == "=") y = y.substring(0, y.length - 1);
if (o.length <= y.length && o == y.substring(0, o.length)) {
k = i, tmp = y;
++c; // c is the number of matches
if (o == y) { // exact match
c = 1;
break;
}
}
}
if (c == 1) { // find a unique match
lopt = tmp;
if (pos_eq < 0 && longopts[k][longopts[k].length-1] == "=" && cur + 1 < argv.length) {
arg = argv[cur+1];
argv.delete_at(cur + 1);
}
}
} else { // a short option
if (pos == 0) pos = 1;
opt = a[pos++];
let k = ostr.indexOf(opt);
if (k < 0) {
opt = "?";
} else if (k + 1 < ostr.length && ostr[k+1] == ":") { // requiring an argument
if (pos >= a.length) {
arg = argv[cur+1];
argv.delete_at(cur + 1);
} else arg = a.substring(pos);
pos = -1;
}
}
if (pos < 0 || pos >= argv[cur].length) {
argv.delete_at(cur);
pos = 0;
}
if (lopt != "") yield { opt: `--${lopt}`, arg: arg };
else if (opt != "?") yield { opt: `-${opt}`, arg: arg };
else yield { opt: "?", arg: "" };
}
}
function* k8_readline(fn) {
let buf = new Bytes();
let file = new File(fn);
while (file.readline(buf) >= 0) {
yield buf.toString();
}
file.close();
buf.destroy();
}
function merge_hits(b) {
if (b.length == 1)
return { name1:b[0].name1, name2:b[0].name2, len1:b[0].len1, len2:b[0].len2, min_cov:b[0].min_cov, max_cov:b[0].max_cov, cov1:b[0].cov1, cov2:b[0].cov2, s1:b[0].s1, dv:b[0].dv };
b.sort(function(x, y) { return x.st1 - y.st1 });
let f = [], bt = [];
for (let i = 0; i < b.length; ++i)
f[i] = b[i].s1, bt[i] = -1;
for (let i = 0; i < b.length; ++i) {
for (let j = 0; j < i; ++j) {
if (b[j].st2 < b[i].st2) {
if (b[j].en1 >= b[i].en1) continue;
if (b[j].en2 >= b[i].en2) continue;
const ov1 = b[j].en1 <= b[i].st1? 0 : b[i].st1 - b[j].en1;
const li1 = b[i].en1 - b[i].st1;
const s11 = b[i].s1 / li1 * (li1 - ov1);
const ov2 = b[j].en2 <= b[i].st2? 0 : b[i].st2 - b[j].en2;
const li2 = b[i].en2 - b[i].st2;
const s12 = b[i].s1 / li2 * (li2 - ov2);
const s1 = s11 < s12? s11 : s12;
if (f[i] < f[j] + s1)
f[i] = f[j] + s1, bt[i] = j;
}
}
}
let max_i = -1, max_f = 0, d = [];
for (let i = 0; i < b.length; ++i)
if (max_f < f[i])
max_f = f[i], max_i = i;
for (let k = max_i; k >= 0; k = bt[k])
d.push(k);
d = d.reverse();
let dv = 0, tot = 0, cov1 = 0, cov2 = 0, st1 = 0, en1 = 0, st2 = 0, en2 = 0;
for (let k = 0; k < d.length; ++k) {
const i = d[k];
tot += b[i].blen;
dv += b[i].dv * b[i].blen;
if (b[i].st1 > en1) {
cov1 += en1 - st1;
st1 = b[i].st1, en1 = b[i].en1;
} else en1 = en1 > b[i].en1? en1 : b[i].en1;
if (b[i].st2 > en2) {
cov2 += en2 - st2;
st2 = b[i].st2, en2 = b[i].en2;
} else en2 = en2 > b[i].en2? en2 : b[i].en2;
}
dv /= tot;
cov1 = (cov1 + (en1 - st1)) / b[0].len1;
cov2 = (cov2 + (en2 - st2)) / b[0].len2;
const min_cov = cov1 < cov2? cov1 : cov2;
const max_cov = cov1 > cov2? cov1 : cov2;
//warn(d.length, b[0].name1, b[0].name2, min_cov, max_cov);
return { name1:b[0].name1, name2:b[0].name2, len1:b[0].len1, len2:b[0].len2, min_cov:min_cov, max_cov:max_cov, cov1:cov1, cov2:cov2, s1:max_f, dv:dv };
}
function main(args) {
let opt = { min_cov:.9, max_dv:.015, max_diff:20000 };
for (const o of getopt(args, "c:d:e:", [])) {
if (o.opt == '-c') opt.min_cov = parseFloat(o.arg);
else if (o.opt == '-d') opt.max_dv = parseFloat(o.arg);
else if (o.opt == '-e') opt.max_diff = parseFloat(o.arg);
}
if (args.length == 0) {
print("Usage: pafcluster.js [options] <ava.paf>");
print("Options:");
print(` -c FLOAT min coverage [${opt.min_cov}]`);
print(` -d FLOAT max divergence [${opt.max_dv}]`);
print(` -e FLOAT max difference [${opt.max_diff}]`);
return;
}
// read
let a = [], len = {}, name2len = {};
for (const line of k8_readline(args[0])) {
let m, t = line.split("\t");
if (t[4] != "+") continue;
for (let i = 1; i < 4; ++i) t[i] = parseInt(t[i]);
for (let i = 6; i < 11; ++i) t[i] = parseInt(t[i]);
const len1 = t[1], len2 = t[6];
let s1 = -1, dv = -1.0;
for (let i = 12; i < t.length; ++i) {
if ((m = /^(s1|dv):\S:(\S+)/.exec(t[i])) != null) {
if (m[1] == "s1") s1 = parseInt(m[2]);
else if (m[1] == "dv") dv = parseFloat(m[2]);
}
}
if (s1 < 0 || dv < 0) continue;
const cov1 = (parseInt(t[3]) - parseInt(t[2])) / len1;
const cov2 = (parseInt(t[8]) - parseInt(t[7])) / len2;
const min_cov = cov1 < cov2? cov1 : cov2;
const max_cov = cov1 > cov2? cov1 : cov2;
name2len[t[0]] = len1;
name2len[t[5]] = len2;
a.push({ name1:t[0], name2:t[5], len1:len1, len2:len2, min_cov:min_cov, max_cov:max_cov, s1:s1, dv:dv, cov1:cov1, cov2:cov2, st1:t[2], en1:t[3], st2:t[7], en2:t[8], blen:t[10] });
len[t[0]] = len1, len[t[5]] = len2;
}
warn(`Read ${a.length} hits`);
// merge duplicated hits
let h = {};
for (let i = 0; i < a.length; ++i) {
const key = `${a[i].name1}\t${a[i].name2}`;
if (h[key] == null) h[key] = [];
h[key].push(a[i]);
}
a = [];
for (const key in h)
a.push(merge_hits(h[key]));
// core loop
while (a.length > 1) {
// select the sequence with the highest sum of s1
let h = {};
for (let i = 0; i < a.length; ++i) {
if (h[a[i].name1] == null) h[a[i].name1] = 0;
h[a[i].name1] += a[i].s1;
}
let max_s1 = 0, max_name = "";
for (const name in h)
if (max_s1 < h[name])
max_s1 = h[name], max_name = name;
// find contigs in the same group
h = {};
h[max_name] = 1;
for (let i = 0; i < a.length; ++i) {
if (a[i].name1 != max_name && a[i].name2 != max_name)
continue;
const diff1 = a[i].len1 * (1.0 - a[i].cov1);
const diff2 = a[i].len2 * (1.0 - a[i].cov2);
if (a[i].min_cov >= opt.min_cov && a[i].dv <= opt.max_dv && diff1 <= opt.max_diff && diff2 <= opt.max_diff)
h[a[i].name1] = h[a[i].name2] = 1;
}
let n = 0;
for (const key in h) {
++n;
delete name2len[key];
}
print(`SD\t${max_name}\t${n}`);
for (const key in h) print(`CL\t${key}\t${len[key]}`);
print("//");
// filter out redundant hits
let b = [];
for (let i = 0; i < a.length; ++i)
if (h[a[i].name1] == null && h[a[i].name2] == null)
b.push(a[i]);
warn(`Reduced the number of hits from ${a.length} to ${b.length}`);
a = b;
}
// output remaining singletons
for (const key in name2len) {
print(`SD\t${key}\t1`);
print(`CL\t${key}\t${name2len[key]}`);
print(`//`);
}
}
main(arguments);
+3830
View File
File diff suppressed because it is too large Load Diff
-114
View File
@@ -1,114 +0,0 @@
var getopt = function(args, ostr) {
var oli; // option letter list index
if (typeof(getopt.place) == 'undefined')
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
if (getopt.place == -1) { // update scanning pointer
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
getopt.place = -1;
return null;
}
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
++getopt.ind;
getopt.place = -1;
return null;
}
}
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
if (getopt.place < 0) ++getopt.ind;
return '?';
}
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
getopt.arg = null;
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
} else { // need an argument
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
getopt.arg = args[getopt.ind].substr(getopt.place);
else if (args.length <= ++getopt.ind) { // no arg
getopt.place = -1;
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
return '?';
} else getopt.arg = args[getopt.ind]; // white space
getopt.place = -1;
++getopt.ind;
}
return optopt;
}
var c, pri_only = false;
while ((c = getopt(arguments, "p")) != null)
if (c == 'p') pri_only = true;
var file = arguments.length == getopt.ind? new File() : new File(arguments[getopt.ind]);
var buf = new Bytes();
var re = /(\d+)([MIDSHNX=])/g;
var len = {}, lineno = 0;
while (file.readline(buf) >= 0) {
var m, n_cigar = 0, line = buf.toString();
++lineno;
if (line.charAt(0) == '@') {
if (/^@SQ/.test(line)) {
var name = (m = /\tSN:(\S+)/.exec(line)) != null? m[1] : null;
var l = (m = /\tLN:(\d+)/.exec(line)) != null? parseInt(m[1]) : null;
if (name != null && l != null) len[name] = l;
}
continue;
}
var t = line.split("\t");
var flag = parseInt(t[1]);
if (t[9] != '*' && t[10] != '*' && t[9].length != t[10].length) throw Error("ERROR at line " + lineno + ": inconsistent SEQ and QUAL lengths - " + t[9].length + " != " + t[10].length);
if (t[2] == '*' || (flag&4)) continue;
if (pri_only && (flag&0x100)) continue;
var tlen = len[t[2]];
if (tlen == null) throw Error("ERROR at line " + lineno + ": can't find the length of contig " + t[2]);
var nn = (m = /\tnn:i:(\d+)/.exec(line)) != null? parseInt(m[1]) : 0;
var NM = (m = /\tNM:i:(\d+)/.exec(line)) != null? parseInt(m[1]) : null;
var have_NM = NM == null? false : true;
NM += nn;
var clip = [0, 0], I = [0, 0], D = [0, 0], M = 0, N = 0, ql = 0, tl = 0, mm = 0, ext_cigar = false;
while ((m = re.exec(t[5])) != null) {
var l = parseInt(m[1]);
if (m[2] == 'M') M += l, ql += l, tl += l, ext_cigar = false;
else if (m[2] == 'I') ++I[0], I[1] += l, ql += l;
else if (m[2] == 'D') ++D[0], D[1] += l, tl += l;
else if (m[2] == 'N') N += l, tl += l;
else if (m[2] == 'S') clip[M == 0? 0 : 1] = l, ql += l;
else if (m[2] == 'H') clip[M == 0? 0 : 1] = l;
else if (m[2] == '=') M += l, ql += l, tl += l, ext_cigar = true;
else if (m[2] == 'X') M += l, ql += l, tl += l, mm += l, ext_cigar = true;
++n_cigar;
}
if (n_cigar > 65535)
warn("WARNING at line " + lineno + ": " + n_cigar + " CIGAR operations");
if (tl + parseInt(t[3]) - 1 > tlen) {
warn("WARNING at line " + lineno + ": alignment end position larger than ref length; skipped");
continue;
}
if (t[9] != '*' && t[9].length != ql) {
warn("WARNING at line " + lineno + ": SEQ length inconsistent with CIGAR (" + t[9].length + " != " + ql + "); skipped");
continue;
}
if (!have_NM || ext_cigar) NM = I[1] + D[1] + mm;
if (NM < I[1] + D[1] + mm) {
warn("WARNING at line " + lineno + ": NM is less than the total number of gaps (" + NM + " < " + (I[1]+D[1]+mm) + ")");
NM = I[1] + D[1] + mm;
}
var extra = ["mm:i:"+(NM-I[1]-D[1]), "io:i:"+I[0], "in:i:"+I[1], "do:i:"+D[0], "dn:i:"+D[1]];
var match = M - (NM - I[1] - D[1]);
var blen = M + I[1] + D[1];
var qlen = M + I[1] + clip[0] + clip[1];
var qs, qe;
if (flag&16) qs = clip[1], qe = qlen - clip[0];
else qs = clip[0], qe = qlen - clip[1];
var ts = parseInt(t[3]) - 1, te = ts + M + D[1] + N;
var qname = t[0];
if ((flag&1) && (flag&0x40)) qname += '/1';
if ((flag&1) && (flag&0x80)) qname += '/2';
var a = [qname, qlen, qs, qe, flag&16? '-' : '+', t[2], tlen, ts, te, match, blen, t[4]];
print(a.join("\t"), extra.join("\t"));
}
buf.destroy();
file.close();
-193
View File
@@ -1,193 +0,0 @@
var getopt = function(args, ostr) {
var oli; // option letter list index
if (typeof(getopt.place) == 'undefined')
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
if (getopt.place == -1) { // update scanning pointer
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
getopt.place = -1;
return null;
}
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
++getopt.ind;
getopt.place = -1;
return null;
}
}
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
if (getopt.place < 0) ++getopt.ind;
return '?';
}
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
getopt.arg = null;
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
} else { // need an argument
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
getopt.arg = args[getopt.ind].substr(getopt.place);
else if (args.length <= ++getopt.ind) { // no arg
getopt.place = -1;
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
return '?';
} else getopt.arg = args[getopt.ind]; // white space
getopt.place = -1;
++getopt.ind;
}
return optopt;
}
var c, max_mapq = 60, mode = 0, err_out_q = 256, print_err = false, ovlp_ratio = 0.1, cap_short_mapq = false;
while ((c = getopt(arguments, "Q:r:m:c")) != null) {
if (c == 'Q') err_out_q = parseInt(getopt.arg), print_err = true;
else if (c == 'r') ovlp_ratio = parseFloat(getopt.arg);
else if (c == 'm') mode = parseInt(getopt.arg);
else if (c == 'c') cap_short_mapq = true;
}
var file = arguments.length == getopt.ind? new File() : new File(arguments[getopt.ind]);
var buf = new Bytes();
var tot = [], err = [];
for (var q = 0; q <= max_mapq; ++q)
tot[q] = err[q] = 0;
function is_correct(s, b)
{
if (s[0] != b[0] || s[3] != b[3]) return false;
var o, l;
if (s[1] < b[1]) {
if (s[2] <= b[1]) return false;
o = (s[2] < b[2]? s[2] : b[2]) - b[1];
l = (s[2] > b[2]? s[2] : b[2]) - s[1];
} else {
if (b[2] <= s[1]) return false;
o = (s[2] < b[2]? s[2] : b[2]) - s[1];
l = (s[2] > b[2]? s[2] : b[2]) - b[1];
}
return o/l > ovlp_ratio? true : false;
}
function count_err(qname, a, tot, err, mode)
{
if (a.length == 0) return;
var m, s;
if ((m = /^(\S+)!(\S+)!(\d+)!(\d+)!([\+\-])$/.exec(qname)) != null) { // pbsim single-end reads
s = [m[1], m[2], parseInt(m[3]), parseInt(m[4]), m[5]];
} else if ((m = /^(\S+)!(\S+)!(\d+)_(\d+)!(\d+)_(\d+)!([\+\-])([\+\-])\/([12])$/.exec(qname)) != null) { // mason2 paired-end reads
if (m[9] == '1') {
s = [m[1], m[2], parseInt(m[3]), parseInt(m[5]), m[7]];
} else {
s = [m[1], m[2], parseInt(m[4]), parseInt(m[6]), m[8]];
}
} else throw Error("Failed to parse simulated read names '" + qname + "'");
s.shift(); // skip the orginal read name
if (mode == 0 || mode == 1) { // longest only or first only
var max_i = 0;
if (mode == 0) { // longest only
var max = 0;
for (var i = 0; i < a.length; ++i)
if (a[i][5] > max)
max = a[i][5], max_i = i;
}
var mapq = a[max_i][4];
++tot[mapq];
if (!is_correct(s, a[max_i])) {
if (mapq >= err_out_q)
print('E', qname, a[max_i].join("\t"));
++err[mapq];
}
} else if (mode == 2) { // all primary mode
var max_err_mapq = -1, max_mapq = 0, max_err_i = -1;
if (cap_short_mapq) {
var max = 0, max_q = 0;
for (var i = 0; i < a.length; ++i)
if (a[i][5] > max)
max = a[i][5], max_q = a[i][4];
for (var i = 0; i < a.length; ++i)
a[i][4] = max_q < a[i][4]? max_q : a[i][4];
}
for (var i = 0; i < a.length; ++i) {
max_mapq = max_mapq > a[i][4]? max_mapq : a[i][4];
if (!is_correct(s, a[i]))
if (a[i][4] > max_err_mapq)
max_err_mapq = a[i][4], max_err_i = i;
}
if (max_err_mapq >= 0) {
++tot[max_err_mapq], ++err[max_err_mapq];
if (max_err_mapq >= err_out_q)
print('E', qname, a[max_err_i].join("\t"));
} else ++tot[max_mapq];
}
}
var lineno = 0, last = null, a = [], n_unmapped = null;
var re_cigar = /(\d+)([MIDSHN])/g;
while (file.readline(buf) >= 0) {
var m, line = buf.toString();
++lineno;
if (line[0] != '@') {
var t = line.split("\t");
if (t[4] == '+' || t[4] == '-') { // PAF
if (last != t[0]) {
if (last != null) count_err(last, a, tot, err, mode);
a = [], last = t[0];
}
if (/\ts1:i:\d+/.test(line) && !/\ts2:i:\d+/.test(line)) // secondary alignment in minimap2 PAF
continue;
var mapq = parseInt(t[11]);
if (mapq > max_mapq) mapq = max_mapq;
a.push([t[5], parseInt(t[7]), parseInt(t[8]), t[4], mapq, parseInt(t[9])]);
} else { // SAM
var flag = parseInt(t[1]);
var read_no = flag>>6&0x3;
var qname = t[0];
if (!/\/[12]$/.test(qname))
qname = read_no == 1 || read_no == 2? t[0] + '/' + read_no : t[0];
if (last != qname) {
if (last != null) count_err(last, a, tot, err, mode);
a = [], last = qname;
}
if (flag&0x100) continue; // secondary alignment
if ((flag&0x4) || t[2] == '*') { // unmapped
if (n_unmapped == null) n_unmapped = 0;
++n_unmapped;
continue;
}
var mapq = parseInt(t[4]);
if (mapq > max_mapq) mapq = max_mapq;
var pos = parseInt(t[3]) - 1, pos_end = pos;
var n_gap = 0, mlen = 0;
while ((m = re_cigar.exec(t[5])) != null) {
var len = parseInt(m[1]);
if (m[2] == 'M') pos_end += len, mlen += len;
else if (m[2] == 'I') n_gap += len;
else if (m[2] == 'D') n_gap += len, pos_end += len;
}
var score = pos_end - pos;
if ((m = /\tNM:i:(\d+)/.exec(line)) != null) {
var NM = parseInt(m[1]);
if (NM >= n_gap) score = mlen - (NM - n_gap);
}
a.push([t[2], pos, pos_end, (flag&16)? '-' : '+', mapq, score]);
}
}
}
if (last != null) count_err(last, a, tot, err, mode);
buf.destroy();
file.close();
var sum_tot = 0, sum_err = 0, q_out = -1, sum_tot2 = 0, sum_err2 = 0;
for (var q = max_mapq; q >= 0; --q) {
if (tot[q] == 0) continue;
if (q_out < 0 || err[q] > 0) {
if (q_out >= 0) print('Q', q_out, sum_tot, sum_err, (sum_err2/sum_tot2).toFixed(9), sum_tot2);
sum_tot = sum_err = 0, q_out = q;
}
sum_tot += tot[q], sum_err += err[q];
sum_tot2 += tot[q], sum_err2 += err[q];
}
print('Q', q_out, sum_tot, sum_err, (sum_err2/sum_tot2).toFixed(9), sum_tot2);
if (n_unmapped != null) print('U', n_unmapped);
-105
View File
@@ -1,105 +0,0 @@
Bytes.prototype.reverse = function()
{
for (var i = 0; i < this.length>>1; ++i) {
var tmp = this[i];
this[i] = this[this.length - i - 1];
this[this.length - i - 1] = tmp;
}
}
// reverse complement a DNA string
Bytes.prototype.revcomp = function()
{
if (Bytes.rctab == null) {
var s1 = 'WSATUGCYRKMBDHVNwsatugcyrkmbdhvn';
var s2 = 'WSTAACGRYMKVHDBNwstaacgrymkvhdbn';
Bytes.rctab = [];
for (var i = 0; i < 256; ++i) Bytes.rctab[i] = 0;
for (var i = 0; i < s1.length; ++i)
Bytes.rctab[s1.charCodeAt(i)] = s2.charCodeAt(i);
}
for (var i = 0; i < this.length>>1; ++i) {
var tmp = this[this.length - i - 1];
this[this.length - i - 1] = Bytes.rctab[this[i]];
this[i] = Bytes.rctab[tmp];
}
if (this.length&1)
this[this.length>>1] = Bytes.rctab[this[this.length>>1]];
}
if (arguments.length == 0) {
print("Usage: k8 sim-mason2.js <mason.sam>");
exit(1);
}
function print_se(a)
{
print('@' + a.slice(0, 5).join("!") + " " + a[8]);
print(a[5]);
print("+");
print(a[6]);
}
var buf = new Bytes(), buf2 = new Bytes();
var file = new File(arguments[0]);
var re = /(\d+)([MIDSHN])/g;
var last = null;
while (file.readline(buf) >= 0) {
var t = buf.toString().split("\t");
if (t[0].charAt(0) == '@') continue;
var m, l_ref = 0;
while ((m = re.exec(t[5])) != null)
if (m[2] == 'D' || m[2] == 'M' || m[2] == 'N')
l_ref += parseInt(m[1]);
var flag = parseInt(t[1]);
var rev = !!(flag&16);
var seq, qual;
if (rev) {
buf2.length = 0;
buf2.set(t[9], 0);
buf2.revcomp();
seq = buf2.toString();
buf2.set(t[10], 0);
buf2.reverse();
qual = buf2.toString();
} else seq = t[9], qual = t[10];
var qname = t[0];
qname = qname.replace(/^simulated./, "");
var chr = t[2];
var pos = parseInt(t[3]) - 1;
var strand = (flag&16)? '-' : '+';
var read_no = flag&0xc0;
if (read_no == 0x40) read_no = 1;
else if (read_no == 0x80) read_no = 2;
else read_no = 0;
var err = 0, snp = 0, indel = 0;
for (var i = 11; i < t.length; ++i) {
if ((m = /^XE:i:(\d+)/.exec(t[i])) != null) err = m[1];
else if ((m = /^XS:i:(\d+)/.exec(t[i])) != null) snp = m[1];
else if ((m = /^XI:i:(\d+)/.exec(t[i])) != null) indel = m[1];
}
var comment = [err, snp, indel].join(":");
if (last == null) {
last = [qname, chr, pos, pos + l_ref, strand, seq, qual, read_no, comment];
} else if (last[0] != qname) {
print_se(last);
last = [qname, chr, pos, pos + l_ref, strand, seq, qual, read_no, comment];
} else {
if (read_no == 2) { // last[] is the first read
if (last[7] != 1) throw Error("ERROR: can't find read1");
var name = [qname, chr, last[2] + "_" + pos, last[3] + "_" + (pos + l_ref), last[4] + strand].join("!");
print('@' + name + '/1' + ' ' + last[8]); print(last[5]); print("+"); print(last[6]);
print('@' + name + '/2' + ' ' + comment); print(seq); print("+"); print(qual);
} else {
if (last[7] != 2) throw Error("ERROR: can't find read2");
var name = [qname, chr, pos + "_" + last[2], (pos + l_ref) + "_" + last[3], strand + last[4]].join("!");
print('@' + name + '/1' + ' ' + comment); print(seq); print("+"); print(qual);
print('@' + name + '/2' + ' ' + last[8]); print(last[5]); print("+"); print(last[6]);
}
last = null;
}
}
if (last != null) print_se(last);
file.close();
buf.destroy();
buf2.destroy();
-81
View File
@@ -1,81 +0,0 @@
Bytes.prototype.reverse = function()
{
for (var i = 0; i < this.length>>1; ++i) {
var tmp = this[i];
this[i] = this[this.length - i - 1];
this[this.length - i - 1] = tmp;
}
}
// reverse complement a DNA string
Bytes.prototype.revcomp = function()
{
if (Bytes.rctab == null) {
var s1 = 'WSATUGCYRKMBDHVNwsatugcyrkmbdhvn';
var s2 = 'WSTAACGRYMKVHDBNwstaacgrymkvhdbn';
Bytes.rctab = [];
for (var i = 0; i < 256; ++i) Bytes.rctab[i] = 0;
for (var i = 0; i < s1.length; ++i)
Bytes.rctab[s1.charCodeAt(i)] = s2.charCodeAt(i);
}
for (var i = 0; i < this.length>>1; ++i) {
var tmp = this[this.length - i - 1];
this[this.length - i - 1] = Bytes.rctab[this[i]];
this[i] = Bytes.rctab[tmp];
}
if (this.length&1)
this[this.length>>1] = Bytes.rctab[this[this.length>>1]];
}
if (arguments.length < 2) {
print("Usage: k8 sim-pbsim.js <ref.fa.fai> <pbsim1.maf> [[pbsim2.maf] ...]");
exit(1);
}
var file, buf = new Bytes(), buf2 = new Bytes();
file = new File(arguments[0]);
var chr_list = [];
while (file.readline(buf) >= 0) {
var t = buf.toString().split(/\s+/);
chr_list.push(t[0]);
}
file.close();
for (var k = 1; k < arguments.length; ++k) {
var fn = arguments[k];
file = new File(fn);
var state = 0, reg;
while (file.readline(buf) >= 0) {
var line = buf.toString();
if (state == 0 && line.charAt(0) == 'a') {
state = 1;
} else if (state == 1 && line.charAt(0) == 's') {
var t = line.split(/\s+/);
var st = parseInt(t[2]);
reg = [st, st + parseInt(t[3])];
state = 2;
} else if (state == 2 && line.charAt(0) == 's') {
var m, t = line.split(/\s+/);
if ((m = /S(\d+)_\d+/.exec(t[1])) == null) throw Error("Failed to parse the read name");
var chr_id = parseInt(m[1]) - 1;
if (chr_id >= chr_list.length) throw Error("Index outside the chr list");
var name = [t[1], chr_list[chr_id], reg[0], reg[1], t[4]].join("!");
var seq = t[6].replace(/\-/g, "");
if (seq.length != parseInt(t[5])) throw Error("Inconsistent read length");
if (seq.indexOf("NN") < 0) {
if (t[4] == '-') {
buf2.set(seq, 0);
buf2.length = seq.length;
buf2.revcomp();
seq = buf2.toString();
}
print(">" + name);
print(seq);
}
state = 0;
}
}
file.close();
}
buf.destroy();
buf2.destroy();
-148
View File
@@ -1,148 +0,0 @@
var getopt = function(args, ostr) {
var oli; // option letter list index
if (typeof(getopt.place) == 'undefined')
getopt.ind = 0, getopt.arg = null, getopt.place = -1;
if (getopt.place == -1) { // update scanning pointer
if (getopt.ind >= args.length || args[getopt.ind].charAt(getopt.place = 0) != '-') {
getopt.place = -1;
return null;
}
if (getopt.place + 1 < args[getopt.ind].length && args[getopt.ind].charAt(++getopt.place) == '-') { // found "--"
++getopt.ind;
getopt.place = -1;
return null;
}
}
var optopt = args[getopt.ind].charAt(getopt.place++); // character checked for validity
if (optopt == ':' || (oli = ostr.indexOf(optopt)) < 0) {
if (optopt == '-') return null; // if the user didn't specify '-' as an option, assume it means null.
if (getopt.place < 0) ++getopt.ind;
return '?';
}
if (oli+1 >= ostr.length || ostr.charAt(++oli) != ':') { // don't need argument
getopt.arg = null;
if (getopt.place < 0 || getopt.place >= args[getopt.ind].length) ++getopt.ind, getopt.place = -1;
} else { // need an argument
if (getopt.place >= 0 && getopt.place < args[getopt.ind].length)
getopt.arg = args[getopt.ind].substr(getopt.place);
else if (args.length <= ++getopt.ind) { // no arg
getopt.place = -1;
if (ostr.length > 0 && ostr.charAt(0) == ':') return ':';
return '?';
} else getopt.arg = args[getopt.ind]; // white space
getopt.place = -1;
++getopt.ind;
}
return optopt;
}
var colors = ["0,128,255", "255,0,0", "0,192,0"];
function print_lines(a, fmt) {
if (a.length == 0) return;
if (fmt == "bed") {
var n_pri = 0;
for (var i = 0; i < a.length; ++i)
if (a[i][8] == 0) ++n_pri;
if (n_pri > 1) {
for (var i = 0; i < a.length; ++i)
if (a[i][8] == 0) a[i][8] = 1;
} else if (n_pri == 0) {
warn("Warning: " + a[0][3] + " doesn't have a primary alignment");
}
for (var i = 0; i < a.length; ++i) {
a[i][8] = colors[a[i][8]];
print(a[i].join("\t"));
}
}
a.length = 0;
}
function main(args) {
var re = /(\d+)([MIDNSH])/g;
var c, fmt = "bed", fn_name_conv = null;
while ((c = getopt(args, "f:n:")) != null) {
if (c == 'f') fmt = getopt.arg;
else if (c == 'n') fn_name_conv = getopt.arg;
}
if (getopt.ind == args.length) {
warn("Usage: k8 splice2bed.js <in.paf>");
exit(1);
}
var conv = null;
if (fn_name_conv != null) {
conv = new Map();
var file = new File(fn_name_conv);
var buf = new Bytes();
while (file.readline(buf) >= 0) {
var t = buf.toString().split("\t");
conv.put(t[0], t[1]);
}
buf.destroy();
file.close();
}
var file = new File(args[getopt.ind]);
var buf = new Bytes();
var a = [];
while (file.readline(buf) >= 0) {
var line = buf.toString();
if (line.charAt(0) == '@') continue; // skip SAM header lines
var t = line.split("\t");
var is_pri = false, cigar = null, a1;
var qname = conv != null? conv.get(t[0]) : null;
if (qname != null) t[0] = qname;
if (t.length >= 10 && t[4] != '+' && t[4] != '-' && /^\d+/.test(t[1])) { // SAM
var flag = parseInt(t[1]);
if (flag&1) t[0] += '/' + (flag>>6&3);
}
if (a.length && a[0][3] != t[0]) {
print_lines(a, fmt);
a = [];
}
if (t.length >= 12 && (t[4] == '+' || t[4] == '-')) { // PAF
for (var i = 12; i < t.length; ++i) {
if (t[i].substr(0, 5) == 'cg:Z:') {
cigar = t[i].substr(5);
} else if (t[i].substr(0, 5) == 's2:i:') {
is_pri = true;
}
}
a1 = [t[5], t[7], t[8], t[0], Math.floor(t[9]/t[10]*1000), t[4]];
} else if (t.length >= 10) { // SAM
var flag = parseInt(t[1]);
if ((flag&4) || a[2] == '*') continue;
cigar = t[5];
is_pri = (flag&0x100)? false : true;
a1 = [t[2], parseInt(t[3])-1, null, t[0], 1000, (flag&16)? '-' : '+'];
} else {
throw Error("unrecognized input format");
}
if (cigar == null) throw Error("missing CIGAR");
var m, x0 = 0, x = 0, bs = [], bl = [];
while ((m = re.exec(cigar)) != null) {
if (m[2] == 'M' || m[2] == 'D') {
x += parseInt(m[1]);
} else if (m[2] == 'N') {
bs.push(x0);
bl.push(x - x0);
x += parseInt(m[1]);
x0 = x;
}
}
bs.push(x0);
bl.push(x - x0);
// write the BED12 line
if (a1[2] == null) a1[2] = a1[1] + x;
a1.push(a1[1], a1[2]); // thick start/end is the same as start/end
a1.push(is_pri? 0 : 2, bs.length, bl.join(",")+",", bs.join(",")+",");
a.push(a1);
}
print_lines(a, fmt);
buf.destroy();
file.close();
if (conv != null) conv.destroy();
}
main(arguments);
+82 -22
View File
@@ -4,6 +4,7 @@
#include <assert.h>
#include "minimap.h"
#include "bseq.h"
#include "kseq.h"
#define MM_PARENT_UNSET (-1)
#define MM_PARENT_TMP_PRI (-2)
@@ -12,6 +13,8 @@
#define MM_DBG_PRINT_QNAME 0x2
#define MM_DBG_PRINT_SEED 0x4
#define MM_DBG_PRINT_ALN_SEQ 0x8
#define MM_DBG_PRINT_CHAIN 0x10
#define MM_DBG_SEED_FREQ 0x20
#define MM_SEED_LONG_JOIN (1ULL<<40)
#define MM_SEED_IGNORE (1ULL<<41)
@@ -21,6 +24,9 @@
#define MM_SEED_SEG_SHIFT 48
#define MM_SEED_SEG_MASK (0xffULL<<(MM_SEED_SEG_SHIFT))
#define MM_JUNC_ANNO 0x1
#define MM_JUNC_MISC 0x2
#ifndef kroundup32
#define kroundup32(x) (--(x), (x)|=(x)>>1, (x)|=(x)>>2, (x)|=(x)>>4, (x)|=(x)>>8, (x)|=(x)>>16, ++(x))
#endif
@@ -28,17 +34,21 @@
#define mm_seq4_set(s, i, c) ((s)[(i)>>3] |= (uint32_t)(c) << (((i)&7)<<2))
#define mm_seq4_get(s, i) ((s)[(i)>>3] >> (((i)&7)<<2) & 0xf)
#define MALLOC(type, len) ((type*)malloc((len) * sizeof(type)))
#define CALLOC(type, len) ((type*)calloc((len), sizeof(type)))
#define REALLOC(type, ptr, cnt) ((type*)realloc((ptr), (cnt) * sizeof(type)))
#ifdef __cplusplus
extern "C" {
#endif
#ifndef KSTRING_T
#define KSTRING_T kstring_t
typedef struct __kstring_t {
unsigned l, m;
char *s;
} kstring_t;
#endif
typedef struct {
uint32_t n;
uint32_t q_pos;
uint32_t q_span:31, flt:1;
uint32_t seg_id:31, is_tandem:1;
const uint64_t *cr;
} mm_seed_t;
typedef struct {
int n_u, n_a;
@@ -46,8 +56,15 @@ typedef struct {
mm128_t *a;
} mm_seg_t;
typedef struct {
int32_t off, off2, cnt;
int16_t strand;
uint16_t flag;
} mm_idx_jjump1_t;
double cputime(void);
double realtime(void);
long peakrss(void);
void radix_sort_128x(mm128_t *beg, mm128_t *end);
void radix_sort_64(uint64_t *beg, uint64_t *end);
@@ -55,30 +72,52 @@ uint32_t ks_ksmall_uint32_t(size_t n, uint32_t arr[], size_t kk);
void mm_sketch(void *km, const char *str, int len, int w, int k, uint32_t rid, int is_hpc, mm128_v *p);
void mm_write_sam_hdr(const mm_idx_t *mi, const char *rg, const char *ver, int argc, char *argv[]);
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int opt_flag);
void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int n_regs, const mm_reg1_t *regs);
void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regs, const mm_reg1_t *const* regs, void *km, int opt_flag);
mm_seed_t *mm_collect_matches(void *km, int *_n_m, int qlen, int max_occ, int max_max_occ, int dist, const mm_idx_t *mi, const mm128_v *mv, int64_t *n_a, int *rep_len, int *n_mini_pos, uint64_t **mini_pos);
void mm_seed_mz_flt(void *km, mm128_v *mv, int32_t q_occ_max, float q_occ_frac);
double mm_event_identity(const mm_reg1_t *r);
int mm_write_sam_hdr(const mm_idx_t *mi, const char *rg, const char *ver, int argc, char *argv[]);
void mm_write_paf(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag);
void mm_write_paf3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag, int rep_len);
void mm_write_paf4(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, void *km, int64_t opt_flag, int rep_len, int n_seg, int seg_idx);
void mm_write_sam(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r, int n_regs, const mm_reg1_t *regs);
void mm_write_sam2(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regs, const mm_reg1_t *const* regs, void *km, int64_t opt_flag);
void mm_write_sam3(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, int seg_idx, int reg_idx, int n_seg, const int *n_regss, const mm_reg1_t *const* regss, void *km, int64_t opt_flag, int rep_len);
void mm_write_junc(kstring_t *s, const mm_idx_t *mi, const mm_bseq1_t *t, const mm_reg1_t *r);
// indexing related in index.c
void mm_idxopt_init(mm_idxopt_t *opt);
const uint64_t *mm_idx_get(const mm_idx_t *mi, uint64_t minier, int *n);
int mm_idx_getseq(const mm_idx_t *mi, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq);
int32_t mm_idx_cal_max_occ(const mm_idx_t *mi, float f);
mm128_t *mm_chain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int min_cnt, int min_sc, int is_cdna, int n_segs, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km);
mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a);
int mm_idx_getseq2(const mm_idx_t *mi, int is_rev, uint32_t rid, uint32_t st, uint32_t en, uint8_t *seq);
mm_reg1_t *mm_gen_regs(void *km, uint32_t hash, int qlen, int n_u, uint64_t *u, mm128_t *a, int is_qstrand);
int mm_idx_bed_read(mm_idx_t *mi, const char *fn, int read_junc);
int mm_idx_jjump_read(mm_idx_t *mi, const char *fn, int flag, int min_sc);
const mm_idx_jjump1_t *mm_idx_jump_get(const mm_idx_t *db, int32_t cid, int32_t st, int32_t en, int32_t *n);
mm_reg1_t *mm_gen_regs(void *km, uint32_t hash, int qlen, int n_u, uint64_t *u, mm128_t *a);
void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a);
// chaining in lchain.c
mm128_t *mg_lchain_dp(int max_dist_x, int max_dist_y, int bw, int max_skip, int max_iter, int min_cnt, int min_sc, float chn_pen_gap, float chn_pen_skip,
int is_cdna, int n_segs, int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km);
mm128_t *mg_lchain_rmq(int max_dist, int max_dist_inner, int bw, int max_chn_skip, int cap_rmq_size, int min_cnt, int min_sc, float chn_pen_gap, float chn_pen_skip,
int64_t n, mm128_t *a, int *n_u_, uint64_t **_u, void *km);
void mm_mark_alt(const mm_idx_t *mi, int n, mm_reg1_t *r);
void mm_split_reg(mm_reg1_t *r, mm_reg1_t *r2, int n, int qlen, mm128_t *a, int is_qstrand);
void mm_sync_regs(void *km, int n_regs, mm_reg1_t *regs);
int mm_squeeze_a(void *km, int n_regs, mm_reg1_t *regs, mm128_t *a);
int mm_set_sam_pri(int n, mm_reg1_t *r);
void mm_set_parent(void *km, float mask_level, int n, mm_reg1_t *r, int sub_diff);
void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int *n_, mm_reg1_t *r);
void mm_set_parent(void *km, float mask_level, int mask_len, int n, mm_reg1_t *r, int sub_diff, int hard_mask_level, float alt_diff_frac);
void mm_select_sub(void *km, float pri_ratio, int min_diff, int best_n, int check_strand, int min_strand_sc, int *n_, mm_reg1_t *r);
void mm_select_sub_multi(void *km, float pri_ratio, float pri1, float pri2, int max_gap_ref, int min_diff, int best_n, int n_segs, const int *qlens, int *n_, mm_reg1_t *r);
void mm_filter_regs(void *km, const mm_mapopt_t *opt, int *n_regs, mm_reg1_t *regs);
void mm_join_long(void *km, const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs, mm128_t *a);
void mm_hit_sort_by_dp(void *km, int *n_regs, mm_reg1_t *r);
void mm_set_mapq(int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr);
int mm_filter_strand_retained(int n_regs, mm_reg1_t *r);
void mm_filter_regs(const mm_mapopt_t *opt, int qlen, int *n_regs, mm_reg1_t *regs);
void mm_hit_sort(void *km, int *n_regs, mm_reg1_t *r, float alt_diff_frac);
void mm_set_mapq2(void *km, int n_regs, mm_reg1_t *regs, int min_chain_sc, int match_sc, int rep_len, int is_sr, int is_splice);
void mm_update_dp_max(int qlen, int n_regs, mm_reg1_t *regs, float frac, int a, int b);
void mm_jump_split(void *km, const mm_idx_t *mi, const mm_mapopt_t *opt, int32_t qlen, const uint8_t *qseq, mm_reg1_t *r, int32_t ts_strand);
mm_reg1_t *mm_align_skeleton(void *km, const mm_mapopt_t *opt, const mm_idx_t *mi, int qlen, const char *qstr, int *n_regs_, mm_reg1_t *regs, mm128_t *a);
void mm_enlarge_cigar(mm_reg1_t *r, uint32_t n_cigar);
void mm_est_err(const mm_idx_t *mi, int qlen, int n_regs, mm_reg1_t *regs, const mm128_t *a, int32_t n, const uint64_t *mini_pos);
@@ -86,6 +125,27 @@ mm_seg_t *mm_seg_gen(void *km, uint32_t hash, int n_segs, const int *qlens, int
void mm_seg_free(void *km, int n_segs, mm_seg_t *segs);
void mm_pair(void *km, int max_gap_ref, int dp_bonus, int sub_diff, int match_sc, const int *qlens, int *n_regs, mm_reg1_t **regs);
void mm_jump_split(void *km, const mm_idx_t *mi, const mm_mapopt_t *opt, int32_t qlen, const uint8_t *qseq, mm_reg1_t *r, int32_t ts_strand);
FILE *mm_split_init(const char *prefix, const mm_idx_t *mi);
mm_idx_t *mm_split_merge_prep(const char *prefix, int n_splits, FILE **fp, uint32_t *n_seq_part);
int mm_split_merge(int n_segs, const char **fn, const mm_mapopt_t *opt, int n_split_idx);
void mm_split_rm_tmp(const char *prefix, int n_splits);
void mm_err_puts(const char *str);
void mm_err_fwrite(const void *p, size_t size, size_t nitems, FILE *fp);
void mm_err_fread(void *p, size_t size, size_t nitems, FILE *fp);
static inline float mg_log2(float x) // NB: this doesn't work when x<2
{
union { float f; uint32_t i; } z = { x };
float log_2 = ((z.i >> 23) & 255) - 128;
z.i &= ~(255 << 23);
z.i += 127 << 23;
log_2 += (-0.34484843f * z.f + 2.02466578f) * z.f - 0.67487759f;
return log_2;
}
#ifdef __cplusplus
}
#endif
+161 -24
View File
@@ -1,46 +1,83 @@
#include <stdio.h>
#include <limits.h>
#include "mmpriv.h"
void mm_idxopt_init(mm_idxopt_t *opt)
{
memset(opt, 0, sizeof(mm_idxopt_t));
opt->k = 15, opt->w = 10, opt->flag = 0;
opt->bucket_bits = 14;
opt->mini_batch_size = 50000000;
opt->batch_size = 8000000000ULL;
}
void mm_mapopt_init(mm_mapopt_t *opt)
{
memset(opt, 0, sizeof(mm_mapopt_t));
opt->seed = 11;
opt->mid_occ_frac = 2e-4f;
opt->min_mid_occ = 10;
opt->max_mid_occ = 1000000;
opt->sdust_thres = 0; // no SDUST masking
opt->q_occ_frac = 0.01f;
opt->min_cnt = 3;
opt->min_chain_score = 40;
opt->bw = 500;
opt->bw = 500, opt->bw_long = 20000;
opt->max_gap = 5000;
opt->max_gap_ref = -1;
opt->max_chain_skip = 25;
opt->max_chain_iter = 5000;
opt->rmq_inner_dist = 1000;
opt->rmq_size_cap = 100000;
opt->rmq_rescue_size = 1000;
opt->rmq_rescue_ratio = 0.1f;
opt->chain_gap_scale = 0.8f;
opt->chain_skip_scale = 0.0f;
opt->max_max_occ = 4095;
opt->occ_dist = 500;
opt->mask_level = 0.5f;
opt->mask_len = INT_MAX;
opt->pri_ratio = 0.8f;
opt->best_n = 5;
opt->max_join_long = 20000;
opt->max_join_short = 2000;
opt->min_join_flank_sc = 1000;
opt->alt_drop = 0.15f;
opt->a = 2, opt->b = 4, opt->q = 4, opt->e = 2, opt->q2 = 24, opt->e2 = 1;
opt->zdrop = 400;
opt->transition = 0;
opt->sc_ambi = 1;
opt->zdrop = 400, opt->zdrop_inv = 200;
opt->end_bonus = -1;
opt->min_dp_max = opt->min_chain_score * opt->a;
opt->min_ksw_len = 200;
opt->anchor_ext_len = 20, opt->anchor_ext_shift = 6;
opt->max_clip_ratio = 1.0f;
opt->mini_batch_size = 500000000;
opt->max_sw_mat = 100000000;
opt->cap_kalloc = 500000000;
opt->rank_min_len = 500;
opt->rank_frac = 0.9f;
opt->pe_ori = 0; // FF
opt->pe_bonus = 33;
opt->jump_min_match = 3;
}
void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
{
if ((opt->flag & MM_F_SPLICE_FOR) && (opt->flag & MM_F_SPLICE_REV))
if ((opt->flag & MM_F_SPLICE_FOR) || (opt->flag & MM_F_SPLICE_REV))
opt->flag |= MM_F_SPLICE;
if (opt->mid_occ <= 0)
if (opt->mid_occ <= 0) {
opt->mid_occ = mm_idx_cal_max_occ(mi, opt->mid_occ_frac);
if (opt->mid_occ < opt->min_mid_occ)
opt->mid_occ = opt->min_mid_occ;
if (opt->max_mid_occ > opt->min_mid_occ && opt->mid_occ > opt->max_mid_occ)
opt->mid_occ = opt->max_mid_occ;
}
if (opt->bw_long < opt->bw) opt->bw_long = opt->bw;
if (mm_verbose >= 3)
fprintf(stderr, "[M::%s::%.3f*%.2f] mid_occ = %d\n", __func__, realtime() - mm_realtime0, cputime() / (realtime() - mm_realtime0), opt->mid_occ);
}
@@ -48,7 +85,7 @@ void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
void mm_mapopt_max_intron_len(mm_mapopt_t *opt, int max_intron_len)
{
if ((opt->flag & MM_F_SPLICE) && max_intron_len > 0)
opt->max_gap_ref = opt->bw = max_intron_len;
opt->max_gap_ref = opt->bw = opt->bw_long = max_intron_len;
}
int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
@@ -56,38 +93,71 @@ int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
if (preset == 0) {
mm_idxopt_init(io);
mm_mapopt_init(mo);
} else if (strcmp(preset, "lr") == 0 || strcmp(preset, "map-ont") == 0) { // this is the same as the default
} else if (strcmp(preset, "ava-ont") == 0) {
io->flag = 0, io->k = 15, io->w = 5;
mo->flag |= MM_F_ALL_CHAINS | MM_F_NO_DIAG | MM_F_NO_DUAL | MM_F_NO_LJOIN;
mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_gap = 10000, mo->max_chain_skip = 25;
mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_chain_skip = 25;
mo->bw = mo->bw_long = 2000;
mo->occ_dist = 0;
} else if (strcmp(preset, "map10k") == 0 || strcmp(preset, "map-pb") == 0) {
io->flag |= MM_I_HPC, io->k = 19;
} else if (strcmp(preset, "ava-pb") == 0) {
io->flag |= MM_I_HPC, io->k = 19, io->w = 5;
mo->flag |= MM_F_ALL_CHAINS | MM_F_NO_DIAG | MM_F_NO_DUAL | MM_F_NO_LJOIN;
mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_gap = 10000, mo->max_chain_skip = 25;
} else if (strcmp(preset, "map10k") == 0 || strcmp(preset, "map-pb") == 0) {
io->flag |= MM_I_HPC, io->k = 19;
} else if (strcmp(preset, "map-ont") == 0) {
mo->min_chain_score = 100, mo->pri_ratio = 0.0f, mo->max_chain_skip = 25;
mo->bw_long = mo->bw;
mo->occ_dist = 0;
} else if (strcmp(preset, "lr:hq") == 0 || strcmp(preset, "map-hifi") == 0 || strcmp(preset, "map-ccs") == 0) {
io->flag = 0, io->k = 19, io->w = 19;
mo->max_gap = 10000;
mo->min_mid_occ = 50, mo->max_mid_occ = 500;
if (strcmp(preset, "map-hifi") == 0 || strcmp(preset, "map-ccs") == 0) {
mo->a = 1, mo->b = 4, mo->q = 6, mo->q2 = 26, mo->e = 2, mo->e2 = 1;
mo->min_dp_max = 200;
}
} else if (strcmp(preset, "lr:hqae") == 0) { // high-quality assembly evaluation
io->flag = 0, io->k = 25, io->w = 51;
mo->flag |= MM_F_RMQ;
mo->min_mid_occ = 50, mo->max_mid_occ = 500;
mo->rmq_inner_dist = 5000;
mo->occ_dist = 200;
mo->best_n = 100;
mo->chain_gap_scale = 5.0f;
} else if (strcmp(preset, "map-iclr-prerender") == 0) {
io->flag = 0, io->k = 15;
} else if (strcmp(preset, "asm5") == 0) {
mo->b = 6, mo->transition = 1;
mo->q = 10, mo->q2 = 50;
} else if (strcmp(preset, "map-iclr") == 0) {
io->flag = 0, io->k = 19;
mo->b = 6, mo->transition = 4;
mo->q = 10, mo->q2 = 50;
} else if (strncmp(preset, "asm", 3) == 0) {
io->flag = 0, io->k = 19, io->w = 19;
mo->a = 1, mo->b = 19, mo->q = 39, mo->q2 = 81, mo->e = 3, mo->e2 = 1, mo->zdrop = 200;
mo->bw = 1000, mo->bw_long = 100000;
mo->max_gap = 10000;
mo->flag |= MM_F_RMQ;
mo->min_mid_occ = 50, mo->max_mid_occ = 500;
mo->min_dp_max = 200;
mo->best_n = 50;
if (strcmp(preset, "asm5") == 0) {
mo->a = 1, mo->b = 19, mo->q = 39, mo->q2 = 81, mo->e = 3, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
} else if (strcmp(preset, "asm10") == 0) {
io->flag = 0, io->k = 19, io->w = 19;
mo->a = 1, mo->b = 9, mo->q = 16, mo->q2 = 41, mo->e = 2, mo->e2 = 1, mo->zdrop = 200;
mo->min_dp_max = 200;
mo->best_n = 50;
mo->a = 1, mo->b = 9, mo->q = 16, mo->q2 = 41, mo->e = 2, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
} else if (strcmp(preset, "asm20") == 0) {
mo->a = 1, mo->b = 4, mo->q = 6, mo->q2 = 26, mo->e = 2, mo->e2 = 1, mo->zdrop = mo->zdrop_inv = 200;
io->w = 10;
} else return -1;
} else if (strcmp(preset, "short") == 0 || strcmp(preset, "sr") == 0) {
io->flag = 0, io->k = 21, io->w = 11;
mo->flag |= MM_F_SR | MM_F_FRAG_MODE | MM_F_NO_PRINT_2ND | MM_F_2_IO_THREADS | MM_F_HEAP_SORT;
mo->pe_ori = 0<<1|1; // FR
mo->a = 2, mo->b = 8, mo->q = 12, mo->e = 2, mo->q2 = 24, mo->e2 = 1;
mo->zdrop = 100;
mo->zdrop = mo->zdrop_inv = 100;
mo->end_bonus = 10;
mo->max_frag_len = 800;
mo->max_gap = 100;
mo->bw = 100;
mo->bw = mo->bw_long = 100;
mo->pri_ratio = 0.5f;
mo->min_cnt = 2;
mo->min_chain_score = 25;
@@ -96,19 +166,61 @@ int mm_set_opt(const char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
mo->mid_occ = 1000;
mo->max_occ = 5000;
mo->mini_batch_size = 50000000;
} else if (strcmp(preset, "splice") == 0 || strcmp(preset, "cdna") == 0) {
} else if (strcmp(preset, "splice") == 0 || strcmp(preset, "splice:hq") == 0 || strcmp(preset, "splice:sr") == 0 || strcmp(preset, "cdna") == 0) {
io->flag = 0, io->k = 15, io->w = 5;
mo->flag |= MM_F_SPLICE | MM_F_SPLICE_FOR | MM_F_SPLICE_REV | MM_F_SPLICE_FLANK;
mo->max_gap = 2000, mo->max_gap_ref = mo->bw = 200000;
mo->max_sw_mat = 0;
mo->max_gap = 2000, mo->max_gap_ref = mo->bw = mo->bw_long = 200000;
mo->a = 1, mo->b = 2, mo->q = 2, mo->e = 1, mo->q2 = 32, mo->e2 = 0;
mo->noncan = 9;
mo->zdrop = 200;
mo->junc_bonus = 9;
mo->junc_pen = 5;
mo->zdrop = 200, mo->zdrop_inv = 100; // because mo->a is halved
if (strcmp(preset, "splice:hq") == 0) {
mo->noncan = 5, mo->b = 4, mo->q = 6, mo->q2 = 24;
} else if (strcmp(preset, "splice:sr") == 0) {
mo->flag |= MM_F_NO_PRINT_2ND | MM_F_2_IO_THREADS | MM_F_HEAP_SORT | MM_F_FRAG_MODE | MM_F_WEAK_PAIRING | MM_F_SR_RNA;
mo->noncan = 5, mo->b = 4, mo->q = 6, mo->q2 = 24;
mo->min_chain_score = 25;
mo->min_dp_max = 40;
mo->min_ksw_len = 20;
mo->pe_ori = 0<<1|1; // FR
mo->best_n = 10;
mo->mini_batch_size = 100000000;
}
} else return -1;
return 0;
}
int mm_max_spsc_bonus(const mm_mapopt_t *mo)
{
int max_sc = (mo->q2 + 1) / 2 - 1;
max_sc = max_sc > mo->q2 - mo->q? max_sc : mo->q2 - mo->q;
return max_sc;
}
int mm_check_opt(const mm_idxopt_t *io, const mm_mapopt_t *mo)
{
if (mo->bw > mo->bw_long) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m with '-rNUM1,NUM2', NUM1 (%d) can't be larger than NUM2 (%d)\033[0m\n", mo->bw, mo->bw_long);
return -8;
}
if ((mo->flag & MM_F_RMQ) && (mo->flag & (MM_F_SR|MM_F_SPLICE))) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m --rmq doesn't work with --sr or --splice\033[0m\n");
return -7;
}
if (mo->split_prefix && (mo->flag & (MM_F_OUT_CS|MM_F_OUT_MD))) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m --cs or --MD doesn't work with --split-prefix\033[0m\n");
return -6;
}
if (io->k <= 0 || io->w <= 0) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m -k and -w must be positive\033[0m\n");
return -5;
}
if (mo->best_n < 0) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m -N must be no less than 0\033[0m\n");
@@ -126,6 +238,11 @@ int mm_check_opt(const mm_idxopt_t *io, const mm_mapopt_t *mo)
fprintf(stderr, "[ERROR]\033[1;31m --for-only and --rev-only can't be applied at the same time\033[0m\n");
return -3;
}
if (mo->e <= 0 || mo->q <= 0) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m -O and -E must be positive\033[0m\n");
return -1;
}
if ((mo->q != mo->q2 || mo->e != mo->e2) && !(mo->e > mo->e2 && mo->q + mo->e < mo->q2 + mo->e2)) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m dual gap penalties violating E1>E2 and O1+E1<O2+E2\033[0m\n");
@@ -136,5 +253,25 @@ int mm_check_opt(const mm_idxopt_t *io, const mm_mapopt_t *mo)
fprintf(stderr, "[ERROR]\033[1;31m scoring system violating ({-O}+{-E})+({-O2}+{-E2}) <= 127\033[0m\n");
return -1;
}
if (mo->sc_ambi < 0 || mo->sc_ambi >= mo->b) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m --score-N should be within [0,{-B})\033[0m\n");
return -1;
}
if (mo->zdrop < mo->zdrop_inv) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m Z-drop should not be less than inversion-Z-drop\033[0m\n");
return -5;
}
if ((mo->flag & MM_F_NO_PRINT_2ND) && (mo->flag & MM_F_ALL_CHAINS)) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m -X/-P and --secondary=no can't be applied at the same time\033[0m\n");
return -5;
}
if ((mo->flag & MM_F_QSTRAND) && ((mo->flag & (MM_F_OUT_SAM|MM_F_SPLICE|MM_F_FRAG_MODE)) || (io->flag & MM_I_HPC))) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m --qstrand doesn't work with -a, -H, --frag or --splice\033[0m\n");
return -5;
}
return 0;
}
+12 -7
View File
@@ -8,7 +8,8 @@ void mm_select_sub_multi(void *km, float pri_ratio, float pri1, float pri2, int
if (pri_ratio > 0.0f && *n_ > 0) {
int i, k, n = *n_, n_2nd = 0;
int max_dist = n_segs == 2? qlens[0] + qlens[1] + max_gap_ref : 0;
for (i = k = 0; i < n; ++i) {
uint8_t *keep = (uint8_t*)kmalloc(km, n);
for (i = 0; i < n; ++i) {
int to_keep = 0;
if (r[i].parent == i) { // primary
to_keep = 1;
@@ -34,9 +35,13 @@ void mm_select_sub_multi(void *km, float pri_ratio, float pri1, float pri2, int
if (to_keep && r[i].parent != i) {
if (n_2nd++ >= best_n) to_keep = 0; // don't keep if there are too many secondary hits
}
if (to_keep) r[k++] = r[i];
keep[i] = to_keep;
}
for (i = k = 0; i < n; ++i) {
if (keep[i]) r[k++] = r[i];
else if (r[i].p) free(r[i].p);
}
kfree(km, keep);
if (k != n) mm_sync_regs(km, k, r); // removing hits requires sync()
*n_ = k;
}
@@ -54,7 +59,7 @@ void mm_set_pe_thru(const int *qlens, int *n_regs, mm_reg1_t **regs)
if (n_pri[0] == 1 && n_pri[1] == 1) {
mm_reg1_t *p = &regs[0][pri[0]];
mm_reg1_t *q = &regs[1][pri[1]];
if (p->rid == q->rid && p->rev == q->rev && abs(p->rs - q->rs) < 3 && abs(p->re - p->re) < 3
if (p->rid == q->rid && p->rev == q->rev && abs(p->rs - q->rs) < 3 && abs(p->re - q->re) < 3
&& ((p->qs == 0 && qlens[1] - q->qe == 0) || (q->qs == 0 && qlens[0] - p->qe == 0)))
{
p->pe_thru = q->pe_thru = 1;
@@ -105,7 +110,7 @@ void mm_pair(void *km, int max_gap_ref, int pe_bonus, int sub_diff, int match_sc
max = -1;
max_idx[0] = max_idx[1] = -1;
last[0] = last[1] = -1;
kv_resize(uint64_t, km, sc, n);
kv_resize(uint64_t, km, sc, (size_t)n);
for (i = 0; i < n; ++i) {
if (a[i].key & 1) { // reverse first read or forward second read
mm_reg1_t *q, *r;
@@ -151,8 +156,8 @@ void mm_pair(void *km, int max_gap_ref, int pe_bonus, int sub_diff, int match_sc
}
}
mapq_pe = r[0]->mapq > r[1]->mapq? r[0]->mapq : r[1]->mapq;
for (i = 0; i < sc.n; ++i)
if ((sc.a[i]>>32) + sub_diff >= max>>32)
for (i = 0; i < (int)sc.n; ++i)
if ((sc.a[i]>>32) + sub_diff >= (uint64_t)max>>32)
++n_sub;
if (sc.n > 1) {
int mapq_pe_alt;
@@ -164,7 +169,7 @@ void mm_pair(void *km, int max_gap_ref, int pe_bonus, int sub_diff, int match_sc
if (sc.n == 1) {
if (r[0]->mapq < 2) r[0]->mapq = 2;
if (r[1]->mapq < 2) r[1]->mapq = 2;
} else if (max>>32 > sc.a[sc.n - 2]>>32) {
} else if ((uint64_t)max>>32 > sc.a[sc.n - 2]>>32) {
if (r[0]->mapq < 1) r[0]->mapq = 1;
if (r[1]->mapq < 1) r[1]->mapq = 1;
}
+2
View File
@@ -0,0 +1,2 @@
[build-system]
requires = ["setuptools", "wheel", "Cython"]
+59 -12
View File
@@ -34,6 +34,8 @@ The following Python script demonstrates the key functionality of mappy:
import mappy as mp
a = mp.Aligner("test/MT-human.fa") # load or build index
if not a: raise Exception("ERROR: failed to load/build index")
s = a.seq("MT_human", 100, 200) # retrieve a subsequence from the index
print(mp.revcomp(s)) # reverse complement
for name, seq, qual in mp.fastx_read("test/MT-orang.fa"): # read a fasta/q sequence
for hit in a.map(seq): # traverse alignments
print("{}\t{}\t{}\t{}".format(hit.ctg, hit.r_st, hit.r_en, hit.cigar_str))
@@ -41,20 +43,24 @@ The following Python script demonstrates the key functionality of mappy:
APIs
----
Mappy implements two classes and one global function.
Mappy implements two classes and two global function.
Class mappy.Aligner
~~~~~~~~~~~~~~~~~~~
.. code:: python
mappy.Aligner(fn_idx_in, preset=None, ...)
mappy.Aligner(fn_idx_in=None, preset=None, ...)
This constructor accepts the following arguments:
* **fn_idx_in**: index or sequence file name. Minimap2 automatically tests the
file type. If a sequence file is provided, minimap2 builds an index. The
sequence file can be optionally gzip'd.
sequence file can be optionally gzip'd. This option has no effect if **seq**
is set.
* **seq**: a single sequence to index. The sequence name will be set to
:code:`N/A`.
* **preset**: minimap2 preset. Currently, minimap2 supports the following
presets: **sr** for single-end short reads; **map-pb** for PacBio
@@ -71,23 +77,50 @@ This constructor accepts the following arguments:
* **min_chain_score**: minimum chaing score
* **bw**: chaining and alignment band width
* **bw**: chaining and alignment band width (initial chaining and extension)
* **bw_long**: chaining and alignment band width (RMQ-based rechaining and closing gaps)
* **best_n**: max number of alignments to return
* **n_threads**: number of indexing threads; 3 by default
* **fn_idx_out**: name of file to which the index is written
* **extra_flags**: additional flags defined in minimap.h
* **fn_idx_out**: name of file to which the index is written. This parameter
has no effect if **seq** is set.
* **scoring**: scoring system. It is a tuple/list consisting of 4, 6 or 7
positive integers. The first 4 elements specify match scoring, mismatch
penalty, gap open and gap extension penalty. The 5th and 6th elements, if
present, set long-gap open and long-gap extension penalty. The 7th sets a
mismatch penalty involving ambiguous bases.
.. code:: python
mappy.Aligner.map(seq, seq2=None)
mappy.Aligner.map(seq, seq2=None, cs=False, MD=False)
This method aligns :code:`seq` against the index. It is a generator, *yielding*
a series of :code:`mappy.Alignment` objects. If :code:`seq2` is present, mappy
performs paired-end alignment, assuming the two ends are in the FR orientation.
Alignments of the two ends can be distinguished by the :code:`read_num` field
(see below).
(see Class mappy.Alignment below). Argument :code:`cs` asks mappy to generate
the :code:`cs` tag; :code:`MD` is similar. These two arguments might slightly
degrade performance and are not enabled by default.
.. code:: python
mappy.Aligner.seq(name, start=0, end=0x7fffffff)
This method retrieves a (sub)sequence from the index and returns it as a Python
string. :code:`None` is returned if :code:`name` is not present in the index or
the start/end coordinates are invalid.
.. code:: python
mappy.Aligner.seq_names
This property gives the array of sequence names in the index.
Class mappy.Alignment
~~~~~~~~~~~~~~~~~~~~~
@@ -113,7 +146,7 @@ properties:
* **mlen**: length of the matching bases in the alignment, excluding ambiguous
base matches.
* **NM**: number of mismatches, gaps and ambiguous poistions in the alignment
* **NM**: number of mismatches, gaps and ambiguous positions in the alignment
* **trans_strand**: transcript strand. +1 if on the forward strand; -1 if on the
reverse strand; 0 if unknown
@@ -129,6 +162,11 @@ properties:
* **cigar**: CIGAR returned as an array of shape :code:`(n_cigar,2)`. The two
numbers give the length and the operator of each CIGAR operation.
* **MD**: the :code:`MD` tag as in the SAM format. It is an empty string unless
the :code:`MD` argument is applied when calling :code:`mappy.Aligner.map()`.
* **cs**: the :code:`cs` tag.
An :code:`Alignment` object can be converted to a string with :code:`str()` in
the following format:
@@ -139,13 +177,22 @@ the following format:
It is effectively the PAF format without the QueryName and QueryLength columns
(the first two columns in PAF).
Function mappy.fastx_read
~~~~~~~~~~~~~~~~~~~~~~~~~
Miscellaneous Functions
~~~~~~~~~~~~~~~~~~~~~~~
.. code:: python
mappy.fastx_read(fn)
mappy.fastx_read(fn, read_comment=False)
This generator function opens a FASTA/FASTQ file and *yields* a
:code:`(name,seq,qual)` tuple for each sequence entry. The input file may be
optionally gzip'd.
optionally gzip'd. If :code:`read_comment` is True, this generator yields
a :code:`(name,seq,qual,comment)` tuple instead.
.. code:: python
mappy.revcomp(seq)
Return the reverse complement of DNA string :code:`seq`. This function
recognizes IUB code and preserves the letter cases. Uracil :code:`U` is
complemented to :code:`A`.
+52 -4
View File
@@ -71,15 +71,19 @@ static inline void mm_reset_timer(void)
}
extern unsigned char seq_comp_table[256];
static inline mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char *seq1, const char *seq2, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt)
static inline mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char* seqname, const char *seq1, const char *seq2, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt)
{
mm_reg1_t *r;
Py_BEGIN_ALLOW_THREADS
if (seq2 == 0) {
return mm_map(mi, strlen(seq1), seq1, n_regs, b, opt, NULL);
r = mm_map(mi, strlen(seq1), seq1, n_regs, b, opt, seqname);
} else {
int _n_regs[2];
mm_reg1_t *regs[2];
char *seq[2];
int i, len[2];
len[0] = strlen(seq1);
len[1] = strlen(seq2);
seq[0] = (char*)seq1;
@@ -90,15 +94,59 @@ static inline mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char *seq1, const
seq[1][i] = seq_comp_table[t];
}
if (len[1]&1) seq[1][len[1]>>1] = seq_comp_table[(uint8_t)seq[1][len[1]>>1]];
mm_map_frag(mi, 2, len, (const char**)seq, _n_regs, regs, b, opt, NULL);
mm_map_frag(mi, 2, len, (const char**)seq, _n_regs, regs, b, opt, seqname);
for (i = 0; i < _n_regs[1]; ++i)
regs[1][i].rev = !regs[1][i].rev;
*n_regs = _n_regs[0] + _n_regs[1];
regs[0] = (mm_reg1_t*)realloc(regs[0], sizeof(mm_reg1_t) * (*n_regs));
memcpy(&regs[0][_n_regs[0]], regs[1], _n_regs[1] * sizeof(mm_reg1_t));
free(regs[1]);
return regs[0];
r = regs[0];
}
Py_END_ALLOW_THREADS
return r;
}
static inline char *mappy_revcomp(int len, const uint8_t *seq)
{
int i;
char *rev;
rev = (char*)malloc(len + 1);
for (i = 0; i < len; ++i)
rev[len - i - 1] = seq_comp_table[seq[i]];
rev[len] = 0;
return rev;
}
static char *mappy_fetch_seq(const mm_idx_t *mi, const char *name, int st, int en, int *len)
{
int i, rid;
char *s;
*len = 0;
rid = mm_idx_name2id(mi, name);
if (rid < 0) return 0;
if ((uint32_t)st >= mi->seq[rid].len || st >= en) return 0;
if (en < 0 || (uint32_t)en > mi->seq[rid].len)
en = mi->seq[rid].len;
s = (char*)malloc(en - st + 1);
*len = mm_idx_getseq(mi, rid, st, en, (uint8_t*)s);
for (i = 0; i < *len; ++i)
s[i] = "ACGTN"[(uint8_t)s[i]];
s[*len] = 0;
return s;
}
static mm_idx_t *mappy_idx_seq(int w, int k, int is_hpc, int bucket_bits, const char *seq, int len)
{
const char *fake_name = "N/A";
char *s;
mm_idx_t *mi;
s = (char*)calloc(len + 1, 1);
memcpy(s, seq, len);
mi = mm_idx_str(w, k, is_hpc, bucket_bits, 1, (const char**)&s, (const char**)&fake_name);
free(s);
return mi;
}
#endif
+47 -9
View File
@@ -6,36 +6,64 @@ cdef extern from "minimap.h":
#
ctypedef struct mm_idxopt_t:
short k, w, flag, bucket_bits
int mini_batch_size
int64_t mini_batch_size
uint64_t batch_size
ctypedef struct mm_mapopt_t:
int64_t flag
int seed
int sdust_thres
int flag
int bw
int max_qlen
int bw, bw_long
int max_gap, max_gap_ref
int max_frag_len
int max_chain_skip
int max_chain_skip, max_chain_iter
int min_cnt
int min_chain_score
float chain_gap_scale
float chain_skip_scale
int rmq_size_cap, rmq_inner_dist
int rmq_rescue_size
float rmq_rescue_ratio
float mask_level
int mask_len
float pri_ratio
int best_n
int max_join_long, max_join_short
int min_join_flank_sc
float alt_drop
int a, b, q, e, q2, e2
int transition
int sc_ambi
int noncan
int zdrop
int junc_bonus, junc_pen
int zdrop, zdrop_inv
int end_bonus
int min_dp_max
int min_ksw_len
int anchor_ext_len, anchor_ext_shift
float max_clip_ratio
int rank_min_len
float rank_frac
int pe_ori, pe_bonus
int jump_min_match;
float mid_occ_frac
float q_occ_frac
int32_t min_mid_occ
int32_t mid_occ
int32_t max_occ
int mini_batch_size
int64_t mini_batch_size
int64_t max_sw_mat
int64_t cap_kalloc
const char *split_prefix
int mm_set_opt(char *preset, mm_idxopt_t *io, mm_mapopt_t *mo)
int mm_verbose
@@ -58,6 +86,7 @@ cdef extern from "minimap.h":
uint32_t *S
mm_idx_bucket_t *B
void *km
void *h
ctypedef struct mm_idx_reader_t:
pass
@@ -68,6 +97,8 @@ cdef extern from "minimap.h":
void mm_idx_destroy(mm_idx_t *mi)
void mm_mapopt_update(mm_mapopt_t *opt, const mm_idx_t *mi)
int mm_idx_index_name(mm_idx_t *mi)
#
# Mapping (key struct defined in cmappy.h below)
#
@@ -79,6 +110,10 @@ cdef extern from "minimap.h":
mm_tbuf_t *mm_tbuf_init()
void mm_tbuf_destroy(mm_tbuf_t *b)
void *mm_tbuf_get_km(mm_tbuf_t *b)
int mm_gen_cs(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int no_iden)
int mm_gen_ds(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq, int no_iden)
int mm_gen_MD(void *km, char **buf, int *max_len, const mm_idx_t *mi, const mm_reg1_t *r, const char *seq)
#
# Helper header (because it is hard to expose mm_reg1_t with Cython)
@@ -97,7 +132,9 @@ cdef extern from "cmappy.h":
void mm_reg2hitpy(const mm_idx_t *mi, mm_reg1_t *r, mm_hitpy_t *h)
void mm_free_reg1(mm_reg1_t *r)
mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char *seq1, const char *seq2, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt)
mm_reg1_t *mm_map_aux(const mm_idx_t *mi, const char* seqname, const char *seq1, const char *seq2, int *n_regs, mm_tbuf_t *b, const mm_mapopt_t *opt)
char *mappy_fetch_seq(const mm_idx_t *mi, const char *name, int st, int en, int *l)
mm_idx_t *mappy_idx_seq(int w, int k, int is_hpc, int bucket_bits, const char *seq, int l)
ctypedef struct kstring_t:
unsigned l, m
@@ -115,5 +152,6 @@ cdef extern from "cmappy.h":
void mm_fastx_close(kseq_t *ks)
int kseq_read(kseq_t *seq)
char *mappy_revcomp(int l, const uint8_t *seq)
int mm_verbose_level(int v)
void mm_reset_timer()
+144 -16
View File
@@ -1,6 +1,9 @@
from libc.stdint cimport uint8_t, int8_t
from libc.stdlib cimport free
cimport cmappy
import sys
__version__ = '2.31'
cmappy.mm_reset_timer()
@@ -11,9 +14,9 @@ cdef class Alignment:
cdef int8_t _strand, _trans_strand
cdef uint8_t _mapq, _is_primary
cdef int _seg_id
cdef _ctg, _cigar # these are python objects
cdef _ctg, _cigar, _cs, _ds, _MD # these are python objects
def __cinit__(self, ctg, cl, cs, ce, strand, qs, qe, mapq, cigar, is_primary, mlen, blen, NM, trans_strand, seg_id):
def __cinit__(self, ctg, cl, cs, ce, strand, qs, qe, mapq, cigar, is_primary, mlen, blen, NM, trans_strand, seg_id, cs_str, ds_str, MD_str):
self._ctg = ctg if isinstance(ctg, str) else ctg.decode()
self._ctg_len, self._r_st, self._r_en = cl, cs, ce
self._strand, self._q_st, self._q_en = strand, qs, qe
@@ -23,6 +26,9 @@ cdef class Alignment:
self._is_primary = is_primary
self._trans_strand = trans_strand
self._seg_id = seg_id
self._cs = cs_str
self._ds = ds_str
self._MD = MD_str
@property
def ctg(self): return self._ctg
@@ -69,9 +75,18 @@ cdef class Alignment:
@property
def read_num(self): return self._seg_id + 1
@property
def cs(self): return self._cs
@property
def ds(self): return self._ds
@property
def MD(self): return self._MD
@property
def cigar_str(self):
return "".join(map(lambda x: str(x[0]) + 'MIDNSH'[x[1]], self._cigar))
return "".join(map(lambda x: str(x[0]) + 'MIDNSHP=XB'[x[1]], self._cigar))
def __str__(self):
if self._strand > 0: strand = '+'
@@ -82,8 +97,12 @@ cdef class Alignment:
if self._trans_strand > 0: ts = 'ts:A:+'
elif self._trans_strand < 0: ts = 'ts:A:-'
else: ts = 'ts:A:.'
return "\t".join([str(self._q_st), str(self._q_en), strand, self._ctg, str(self._ctg_len), str(self._r_st), str(self._r_en),
str(self._mlen), str(self._blen), str(self._mapq), tp, ts, "cg:Z:" + self.cigar_str])
a = [str(self._q_st), str(self._q_en), strand, self._ctg, str(self._ctg_len), str(self._r_st), str(self._r_en),
str(self._mlen), str(self._blen), str(self._mapq), tp, ts, "cg:Z:" + self.cigar_str]
if self._cs != "": a.append("cs:Z:" + self._cs)
if self._ds != "": a.append("ds:Z:" + self._ds)
if self._MD != "": a.append("MD:Z:" + self._MD)
return "\t".join(a)
cdef class ThreadBuffer:
cdef cmappy.mm_tbuf_t *_b
@@ -99,7 +118,8 @@ cdef class Aligner:
cdef cmappy.mm_idxopt_t idx_opt
cdef cmappy.mm_mapopt_t map_opt
def __cinit__(self, fn_idx_in, preset=None, k=None, w=None, min_cnt=None, min_chain_score=None, min_dp_score=None, bw=None, best_n=None, n_threads=3, fn_idx_out=None):
def __cinit__(self, fn_idx_in=None, preset=None, k=None, w=None, min_cnt=None, min_chain_score=None, min_dp_score=None, bw=None, bw_long=None, best_n=None, n_threads=3, fn_idx_out=None, max_frag_len=None, extra_flags=None, seq=None, scoring=None, sc_ambi=None, max_chain_skip=None):
self._idx = NULL
cmappy.mm_set_opt(NULL, &self.idx_opt, &self.map_opt) # set the default options
if preset is not None:
cmappy.mm_set_opt(str.encode(preset), &self.idx_opt, &self.map_opt) # apply preset
@@ -111,17 +131,37 @@ cdef class Aligner:
if min_chain_score is not None: self.map_opt.min_chain_score = min_chain_score
if min_dp_score is not None: self.map_opt.min_dp_max = min_dp_score
if bw is not None: self.map_opt.bw = bw
if best_n is not None: self.best_n = best_n
if bw_long is not None: self.map_opt.bw_long = bw_long
if best_n is not None: self.map_opt.best_n = best_n
if max_frag_len is not None: self.map_opt.max_frag_len = max_frag_len
if extra_flags is not None: self.map_opt.flag |= extra_flags
if scoring is not None and len(scoring) >= 4:
self.map_opt.a, self.map_opt.b = scoring[0], scoring[1]
self.map_opt.q, self.map_opt.e = scoring[2], scoring[3]
self.map_opt.q2, self.map_opt.e2 = self.map_opt.q, self.map_opt.e
if len(scoring) >= 6:
self.map_opt.q2, self.map_opt.e2 = scoring[4], scoring[5]
if len(scoring) >= 7:
self.map_opt.sc_ambi = scoring[6]
if sc_ambi is not None: self.map_opt.sc_ambi = sc_ambi
if max_chain_skip is not None: self.map_opt.max_chain_skip = max_chain_skip
cdef cmappy.mm_idx_reader_t *r;
if seq is None:
if fn_idx_out is None:
r = cmappy.mm_idx_reader_open(str.encode(fn_idx_in), &self.idx_opt, NULL)
else:
r = cmappy.mm_idx_reader_open(str.encode(fn_idx_in), &self.idx_opt, fn_idx_out)
r = cmappy.mm_idx_reader_open(str.encode(fn_idx_in), &self.idx_opt, str.encode(fn_idx_out))
if r is not NULL:
self._idx = cmappy.mm_idx_reader_read(r, n_threads) # NB: ONLY read the first part
cmappy.mm_idx_reader_close(r)
cmappy.mm_mapopt_update(&self.map_opt, self._idx)
cmappy.mm_idx_index_name(self._idx)
else:
self._idx = cmappy.mappy_idx_seq(self.idx_opt.w, self.idx_opt.k, self.idx_opt.flag&1, self.idx_opt.bucket_bits, str.encode(seq), len(seq))
cmappy.mm_mapopt_update(&self.map_opt, self._idx)
self.map_opt.mid_occ = 1000 # don't filter high-occ seeds
def __dealloc__(self):
if self._idx is not NULL:
@@ -130,29 +170,104 @@ cdef class Aligner:
def __bool__(self):
return (self._idx != NULL)
def map(self, seq, seq2=None, buf=None):
def map(self, seq, seq2=None, name=None, buf=None, cs=False, ds=False, MD=False, max_frag_len=None, extra_flags=None):
cdef cmappy.mm_reg1_t *regs
cdef cmappy.mm_hitpy_t h
cdef ThreadBuffer b
cdef int n_regs
cdef char *cs_str = NULL
cdef int l_cs_str, m_cs_str = 0
cdef void *km
cdef cmappy.mm_mapopt_t map_opt
if self._idx == NULL: return
if ((self.map_opt.flag & 4) and (self._idx.flag & 2)): return
map_opt = self.map_opt
if max_frag_len is not None: map_opt.max_frag_len = max_frag_len
if extra_flags is not None: map_opt.flag |= extra_flags
if self._idx is NULL: return None
if buf is None: b = ThreadBuffer()
else: b = buf
if seq2 is None: regs = cmappy.mm_map_aux(self._idx, str.encode(seq), NULL, &n_regs, b._b, &self.map_opt)
else: regs = cmappy.mm_map_aux(self._idx, str.encode(seq), str.encode(seq2), &n_regs, b._b, &self.map_opt)
for i in range(n_regs):
_seq = seq if isinstance(seq, bytes) else seq.encode()
if name is not None:
_name = name if isinstance(name, bytes) else name.encode()
if seq2 is None:
if name is None:
regs = cmappy.mm_map_aux(self._idx, NULL, _seq, NULL, &n_regs, b._b, &map_opt)
else:
regs = cmappy.mm_map_aux(self._idx, _name, _seq, NULL, &n_regs, b._b, &map_opt)
else:
_seq2 = seq2 if isinstance(seq2, bytes) else seq2.encode()
if name is None:
regs = cmappy.mm_map_aux(self._idx, NULL, _seq, _seq2, &n_regs, b._b, &map_opt)
else:
regs = cmappy.mm_map_aux(self._idx, _name, _seq, _seq2, &n_regs, b._b, &map_opt)
try:
i = 0
while i < n_regs:
cmappy.mm_reg2hitpy(self._idx, &regs[i], &h)
cigar = []
for k in range(h.n_cigar32):
cigar, _cs, _ds, _MD = [], '', '', ''
for k in range(h.n_cigar32): # convert the 32-bit CIGAR encoding to Python array
c = h.cigar32[k]
cigar.append([c>>4, c&0xf])
yield Alignment(h.ctg, h.ctg_len, h.ctg_start, h.ctg_end, h.strand, h.qry_start, h.qry_end, h.mapq, cigar, h.is_primary, h.mlen, h.blen, h.NM, h.trans_strand, h.seg_id)
if cs or ds or MD: # generate the cs/ds and/or the MD tag, if requested
km = cmappy.mm_tbuf_get_km(b._b)
_cur_seq = _seq2 if h.seg_id > 0 and seq2 is not None else _seq
if cs:
l_cs_str = cmappy.mm_gen_cs(km, &cs_str, &m_cs_str, self._idx, &regs[i], _cur_seq, 1)
_cs = cs_str[:l_cs_str] if isinstance(cs_str, str) else cs_str[:l_cs_str].decode()
if ds:
l_cs_str = cmappy.mm_gen_ds(km, &cs_str, &m_cs_str, self._idx, &regs[i], _cur_seq, 1)
_ds = cs_str[:l_cs_str] if isinstance(cs_str, str) else cs_str[:l_cs_str].decode()
if MD:
l_cs_str = cmappy.mm_gen_MD(km, &cs_str, &m_cs_str, self._idx, &regs[i], _cur_seq)
_MD = cs_str[:l_cs_str] if isinstance(cs_str, str) else cs_str[:l_cs_str].decode()
yield Alignment(h.ctg, h.ctg_len, h.ctg_start, h.ctg_end, h.strand, h.qry_start, h.qry_end, h.mapq, cigar, h.is_primary, h.mlen, h.blen, h.NM, h.trans_strand, h.seg_id, _cs, _ds, _MD)
cmappy.mm_free_reg1(&regs[i])
i += 1
finally:
while i < n_regs:
cmappy.mm_free_reg1(&regs[i])
i += 1
free(regs)
free(cs_str)
def fastx_read(fn):
def seq(self, str name, int start=0, int end=0x7fffffff):
cdef int l
cdef char *s
if self._idx == NULL: return
if ((self.map_opt.flag & 4) and (self._idx.flag & 2)): return
s = cmappy.mappy_fetch_seq(self._idx, name.encode(), start, end, &l)
if l == 0: return None
r = s[:l] if isinstance(s, str) else s[:l].decode()
free(s)
return r
@property
def k(self): return self._idx.k
@property
def w(self): return self._idx.w
@property
def n_seq(self): return self._idx.n_seq
@property
def seq_names(self):
cdef char *p
if self._idx == NULL: return
sn = []
for i in range(self._idx.n_seq):
p = self._idx.seq[i].name
s = p if isinstance(p, str) else p.decode()
sn.append(s)
return sn
def fastx_read(fn, read_comment=False):
cdef cmappy.kseq_t *ks
ks = cmappy.mm_fastx_open(str.encode(fn))
if ks is NULL: return None
@@ -161,9 +276,22 @@ def fastx_read(fn):
else: qual = None
name = ks.name.s if isinstance(ks.name.s, str) else ks.name.s.decode()
seq = ks.seq.s if isinstance(ks.seq.s, str) else ks.seq.s.decode()
if read_comment:
if ks.comment.l > 0: comment = ks.comment.s if isinstance(ks.comment.s, str) else ks.comment.s.decode()
else: comment = None
yield name, seq, qual, comment
else:
yield name, seq, qual
cmappy.mm_fastx_close(ks)
def revcomp(seq):
l = len(seq)
bseq = seq if isinstance(seq, bytes) else seq.encode()
cdef char *s = cmappy.mappy_revcomp(l, bseq)
r = s[:l] if isinstance(s, str) else s[:l].decode()
free(s)
return r
def verbose(v=None):
if v is None: v = -1
return cmappy.mm_verbose_level(v)
+12 -4
View File
@@ -1,10 +1,11 @@
#!/usr/bin/env python
import sys, getopt
import sys
import getopt
import mappy as mp
def main(argv):
opts, args = getopt.getopt(argv[1:], "x:n:m:k:w:r:")
opts, args = getopt.getopt(argv[1:], "x:n:m:k:w:r:cdM")
if len(args) < 2:
print("Usage: minimap2.py [options] <ref.fa>|<ref.mmi> <query.fq>")
print("Options:")
@@ -14,9 +15,13 @@ def main(argv):
print(" -k INT k-mer length")
print(" -w INT minimizer window length")
print(" -r INT band width")
print(" -c output the cs tag")
print(" -d output the ds tag")
print(" -M output the MD tag")
sys.exit(1)
preset, min_cnt, min_sc, k, w, bw = None, None, None, None, None, None
preset = min_cnt = min_sc = k = w = bw = None
out_cs = out_ds = out_MD = False
for opt, arg in opts:
if opt == '-x': preset = arg
elif opt == '-n': min_cnt = int(arg)
@@ -24,11 +29,14 @@ def main(argv):
elif opt == '-r': bw = int(arg)
elif opt == '-k': k = int(arg)
elif opt == '-w': w = int(arg)
elif opt == '-c': out_cs = True
elif opt == '-d': out_ds = True
elif opt == '-M': out_MD = True
a = mp.Aligner(args[0], preset=preset, min_cnt=min_cnt, min_chain_score=min_sc, k=k, w=w, bw=bw)
if not a: raise Exception("ERROR: failed to load/build index file '{}'".format(args[0]))
for name, seq, qual in mp.fastx_read(args[1]): # read one sequence
for h in a.map(seq): # traverse hits
for h in a.map(seq, cs=out_cs, ds=out_ds, MD=out_MD): # traverse hits
print('{}\t{}\t{}'.format(name, len(seq), h))
if __name__ == "__main__":
+10 -9
View File
@@ -70,10 +70,10 @@ void sdust_buf_destroy(sdust_buf_t *buf)
static inline void shift_window(int t, kdq_t(int) *w, int T, int W, int *L, int *rw, int *rv, int *cw, int *cv)
{
int s;
if (kdq_size(w) >= W - SD_WLEN + 1) { // TODO: is this right for SD_WLEN!=3?
if ((int)kdq_size(w) >= W - SD_WLEN + 1) { // TODO: is this right for SD_WLEN!=3?
s = *kdq_shift(int, w);
*rw -= --cw[s];
if (*L > kdq_size(w))
if (*L > (int)kdq_size(w))
--*L, *rv -= --cv[s];
}
kdq_push(int, w, t);
@@ -114,7 +114,7 @@ static void find_perfect(void *km, perf_intv_v *P, const kdq_t(int) *w, int T, i
r += c[t]++;
new_r = r, new_l = kdq_size(w) - i - 1;
if (new_r * 10 > T * new_l) {
for (j = 0; j < P->n && P->a[j].start >= i + start; ++j) { // find insertion position
for (j = 0; j < (int)P->n && P->a[j].start >= i + start; ++j) { // find insertion position
perf_intv_t *p = &P->a[j];
if (max_r == 0 || p->r * max_l > max_r * p->l)
max_r = p->r, max_l = p->l;
@@ -177,7 +177,7 @@ uint64_t *sdust(void *km, const uint8_t *seq, int l_seq, int T, int W, int *n)
#ifdef _SDUST_MAIN
#include <zlib.h>
#include <stdio.h>
#include "getopt.h"
#include "ketopt.h"
#include "kseq.h"
KSEQ_INIT(gzFile, gzread)
@@ -186,16 +186,17 @@ int main(int argc, char *argv[])
gzFile fp;
kseq_t *ks;
int W = 64, T = 20, c;
ketopt_t o = KETOPT_INIT;
while ((c = getopt(argc, argv, "w:t:")) >= 0) {
if (c == 'w') W = atoi(optarg);
else if (c == 't') T = atoi(optarg);
while ((c = ketopt(&o, argc, argv, 1, "w:t:", 0)) >= 0) {
if (c == 'w') W = atoi(o.arg);
else if (c == 't') T = atoi(o.arg);
}
if (optind == argc) {
if (o.ind == argc) {
fprintf(stderr, "Usage: sdust [-w %d] [-t %d] <in.fa>\n", W, T);
return 1;
}
fp = strcmp(argv[optind], "-")? gzopen(argv[optind], "r") : gzdopen(fileno(stdin), "r");
fp = strcmp(argv[o.ind], "-")? gzopen(argv[o.ind], "r") : gzdopen(fileno(stdin), "r");
ks = kseq_init(fp);
while (kseq_read(ks) >= 0) {
uint64_t *r;
+132
View File
@@ -0,0 +1,132 @@
#include "mmpriv.h"
#include "kalloc.h"
#include "ksort.h"
void mm_seed_mz_flt(void *km, mm128_v *mv, int32_t q_occ_max, float q_occ_frac)
{
mm128_t *a;
size_t i, j, st;
if (mv->n <= q_occ_max || q_occ_frac <= 0.0f || q_occ_max <= 0) return;
a = Kmalloc(km, mm128_t, mv->n);
for (i = 0; i < mv->n; ++i)
a[i].x = mv->a[i].x, a[i].y = i;
radix_sort_128x(a, a + mv->n);
for (st = 0, i = 1; i <= mv->n; ++i) {
if (i == mv->n || a[i].x != a[st].x) {
int32_t cnt = i - st;
if (cnt > q_occ_max && cnt > mv->n * q_occ_frac)
for (j = st; j < i; ++j)
mv->a[a[j].y].x = 0;
st = i;
}
}
kfree(km, a);
for (i = j = 0; i < mv->n; ++i)
if (mv->a[i].x != 0)
mv->a[j++] = mv->a[i];
mv->n = j;
}
mm_seed_t *mm_seed_collect_all(void *km, const mm_idx_t *mi, const mm128_v *mv, int32_t *n_m_)
{
mm_seed_t *m;
size_t i;
int32_t k;
m = (mm_seed_t*)kmalloc(km, mv->n * sizeof(mm_seed_t));
for (i = k = 0; i < mv->n; ++i) {
const uint64_t *cr;
mm_seed_t *q;
mm128_t *p = &mv->a[i];
uint32_t q_pos = (uint32_t)p->y, q_span = p->x & 0xff;
int t;
cr = mm_idx_get(mi, p->x>>8, &t);
if (t == 0) continue;
q = &m[k++];
q->q_pos = q_pos, q->q_span = q_span, q->cr = cr, q->n = t, q->seg_id = p->y >> 32;
q->is_tandem = q->flt = 0;
if (i > 0 && p->x>>8 == mv->a[i - 1].x>>8) q->is_tandem = 1;
if (i < mv->n - 1 && p->x>>8 == mv->a[i + 1].x>>8) q->is_tandem = 1;
}
*n_m_ = k;
return m;
}
#define MAX_MAX_HIGH_OCC 128
void mm_seed_select(int32_t n, mm_seed_t *a, int len, int max_occ, int max_max_occ, int dist)
{ // for high-occ minimizers, choose up to max_high_occ in each high-occ streak
extern void ks_heapdown_uint64_t(size_t i, size_t n, uint64_t*);
extern void ks_heapmake_uint64_t(size_t n, uint64_t*);
int32_t i, last0, m;
uint64_t b[MAX_MAX_HIGH_OCC]; // this is to avoid a heap allocation
if (n == 0 || n == 1) return;
for (i = m = 0; i < n; ++i)
if (a[i].n > max_occ) ++m;
if (m == 0) return; // no high-frequency k-mers; do nothing
for (i = 0, last0 = -1; i <= n; ++i) {
if (i == n || a[i].n <= max_occ) {
if (i - last0 > 1) {
int32_t ps = last0 < 0? 0 : (uint32_t)a[last0].q_pos>>1;
int32_t pe = i == n? len : (uint32_t)a[i].q_pos>>1;
int32_t j, k, st = last0 + 1, en = i;
int32_t max_high_occ = (int32_t)((double)(pe - ps) / dist + .499);
if (max_high_occ > 0) {
if (max_high_occ > MAX_MAX_HIGH_OCC)
max_high_occ = MAX_MAX_HIGH_OCC;
for (j = st, k = 0; j < en && k < max_high_occ; ++j, ++k)
b[k] = (uint64_t)a[j].n<<32 | j;
ks_heapmake_uint64_t(k, b); // initialize the binomial heap
for (; j < en; ++j) { // if there are more, choose top max_high_occ
if (a[j].n < (int32_t)(b[0]>>32)) { // then update the heap
b[0] = (uint64_t)a[j].n<<32 | j;
ks_heapdown_uint64_t(0, k, b);
}
}
for (j = 0; j < k; ++j) a[(uint32_t)b[j]].flt = 1;
}
for (j = st; j < en; ++j) a[j].flt ^= 1;
for (j = st; j < en; ++j)
if (a[j].n > max_max_occ)
a[j].flt = 1;
}
last0 = i;
}
}
}
mm_seed_t *mm_collect_matches(void *km, int *_n_m, int qlen, int max_occ, int max_max_occ, int dist, const mm_idx_t *mi, const mm128_v *mv, int64_t *n_a, int *rep_len, int *n_mini_pos, uint64_t **mini_pos)
{
int rep_st = 0, rep_en = 0, n_m, n_m0;
size_t i;
mm_seed_t *m;
*n_mini_pos = 0;
*mini_pos = (uint64_t*)kmalloc(km, mv->n * sizeof(uint64_t));
m = mm_seed_collect_all(km, mi, mv, &n_m0);
if (dist > 0 && max_max_occ > max_occ) {
mm_seed_select(n_m0, m, qlen, max_occ, max_max_occ, dist);
} else {
for (i = 0; i < n_m0; ++i)
if (m[i].n > max_occ)
m[i].flt = 1;
}
for (i = 0, n_m = 0, *rep_len = 0, *n_a = 0; i < n_m0; ++i) {
mm_seed_t *q = &m[i];
if (mm_dbg_flag & MM_DBG_SEED_FREQ)
fprintf(stderr, "SF\t%d\t%d\t%d\n", q->q_pos>>1, q->n, q->flt);
if (q->flt) {
int en = (q->q_pos >> 1) + 1, st = en - q->q_span;
if (st > rep_en) {
*rep_len += rep_en - rep_st;
rep_st = st, rep_en = en;
} else rep_en = en;
} else {
*n_a += q->n;
(*mini_pos)[(*n_mini_pos)++] = (uint64_t)q->q_span<<32 | q->q_pos>>1;
m[n_m++] = *q;
}
}
*rep_len += rep_en - rep_st;
*_n_m = n_m;
return m;
}
+17 -17
View File
@@ -4,26 +4,26 @@ except ImportError:
from distutils.core import setup
from distutils.extension import Extension
cmdclass = {}
import sys, platform
try:
from Cython.Build import build_ext
except ImportError: # without Cython
module_src = 'python/mappy.c'
else: # with Cython
module_src = 'python/mappy.pyx'
cmdclass['build_ext'] = build_ext
import sys
sys.path.append('python')
extra_compile_args = ['-DHAVE_KALLOC']
include_dirs = ["."]
if platform.machine() in ["aarch64", "arm64"]:
include_dirs.append("sse2neon/")
extra_compile_args.extend(['-ftree-vectorize', '-DKSW_SSE2_ONLY', '-D__SSE2__'])
else:
extra_compile_args.append('-msse4.1') # WARNING: ancient x86_64 CPUs don't have SSE4
def readme():
with open('python/README.rst') as f:
return f.read()
setup(
name = 'mappy',
version = '2.8',
version = '2.31',
url = 'https://github.com/lh3/minimap2',
description = 'Minimap2 python binding',
long_description = readme(),
@@ -33,17 +33,17 @@ setup(
keywords = 'sequence-alignment',
scripts = ['python/minimap2.py'],
ext_modules = [Extension('mappy',
sources = [module_src, 'align.c', 'bseq.c', 'chain.c', 'format.c', 'hit.c', 'index.c', 'pe.c', 'options.c',
sources = ['python/mappy.pyx', 'align.c', 'bseq.c', 'lchain.c', 'seed.c', 'format.c', 'hit.c', 'index.c', 'pe.c', 'jump.c', 'options.c',
'ksw2_extd2_sse.c', 'ksw2_exts2_sse.c', 'ksw2_extz2_sse.c', 'ksw2_ll_sse.c',
'kalloc.c', 'kthread.c', 'map.c', 'misc.c', 'sdust.c', 'sketch.c', 'esterr.c'],
'kalloc.c', 'kthread.c', 'map.c', 'misc.c', 'sdust.c', 'sketch.c', 'esterr.c', 'splitidx.c'],
depends = ['minimap.h', 'bseq.h', 'kalloc.h', 'kdq.h', 'khash.h', 'kseq.h', 'ksort.h',
'ksw2.h', 'kthread.h', 'kvec.h', 'mmpriv.h', 'sdust.h',
'python/cmappy.h', 'python/cmappy.pxd'],
extra_compile_args = ['-DHAVE_KALLOC', '-msse4'], # WARNING: ancient x86_64 CPUs don't have SSE4
include_dirs = ['.'],
extra_compile_args = extra_compile_args,
include_dirs = include_dirs,
libraries = ['z', 'm', 'pthread'])],
classifiers = [
'Development Status :: 4 - Beta',
'Development Status :: 5 - Production/Stable',
'License :: OSI Approved :: MIT License',
'Operating System :: POSIX',
'Programming Language :: C',
@@ -52,4 +52,4 @@ setup(
'Programming Language :: Python :: 3',
'Intended Audience :: Science/Research',
'Topic :: Scientific/Engineering :: Bio-Informatics'],
cmdclass = cmdclass)
setup_requires=["cython"])
+84
View File
@@ -0,0 +1,84 @@
#include <string.h>
#include <assert.h>
#include <stdlib.h>
#include <stdio.h>
#include <errno.h>
#include "mmpriv.h"
FILE *mm_split_init(const char *prefix, const mm_idx_t *mi)
{
char *fn;
FILE *fp;
uint32_t i, k = mi->k;
fn = (char*)calloc(strlen(prefix) + 10, 1);
sprintf(fn, "%s.%.4d.tmp", prefix, mi->index);
if ((fp = fopen(fn, "wb")) == NULL) {
if (mm_verbose >= 1)
fprintf(stderr, "[ERROR]\033[1;31m failed to write to temporary file '%s'\033[0m: %s\n", fn, strerror(errno));
exit(1);
}
mm_err_fwrite(&k, 4, 1, fp);
mm_err_fwrite(&mi->n_seq, 4, 1, fp);
for (i = 0; i < mi->n_seq; ++i) {
uint32_t l;
l = strlen(mi->seq[i].name);
mm_err_fwrite(&l, 1, 4, fp);
mm_err_fwrite(mi->seq[i].name, 1, l, fp);
mm_err_fwrite(&mi->seq[i].len, 4, 1, fp);
}
free(fn);
return fp;
}
mm_idx_t *mm_split_merge_prep(const char *prefix, int n_splits, FILE **fp, uint32_t *n_seq_part)
{
mm_idx_t *mi = 0;
char *fn;
int i, j;
if (n_splits < 1) return 0;
fn = CALLOC(char, strlen(prefix) + 10);
for (i = 0; i < n_splits; ++i) {
sprintf(fn, "%s.%.4d.tmp", prefix, i);
if ((fp[i] = fopen(fn, "rb")) == 0) {
if (mm_verbose >= 1)
fprintf(stderr, "ERROR: failed to open temporary file '%s': %s\n", fn, strerror(errno));
for (j = 0; j < i; ++j)
fclose(fp[j]);
free(fn);
return 0;
}
}
free(fn);
mi = CALLOC(mm_idx_t, 1);
for (i = 0; i < n_splits; ++i) {
mm_err_fread(&mi->k, 4, 1, fp[i]); // TODO: check if k is all the same
mm_err_fread(&n_seq_part[i], 4, 1, fp[i]);
mi->n_seq += n_seq_part[i];
}
mi->seq = CALLOC(mm_idx_seq_t, mi->n_seq);
for (i = j = 0; i < n_splits; ++i) {
uint32_t k;
for (k = 0; k < n_seq_part[i]; ++k, ++j) {
uint32_t l;
mm_err_fread(&l, 1, 4, fp[i]);
mi->seq[j].name = (char*)calloc(l + 1, 1);
mm_err_fread(mi->seq[j].name, 1, l, fp[i]);
mm_err_fread(&mi->seq[j].len, 4, 1, fp[i]);
}
}
return mi;
}
void mm_split_rm_tmp(const char *prefix, int n_splits)
{
int i;
char *fn;
fn = CALLOC(char, strlen(prefix) + 10);
for (i = 0; i < n_splits; ++i) {
sprintf(fn, "%s.%.4d.tmp", prefix, i);
remove(fn);
}
free(fn);
}
+1 -1
View File
@@ -1,4 +1,4 @@
>MT_orang
>MT_orang co:Z:comment
GTTTATGTAGCTTATTCTATCCAAAGCAATGCACTGAAAATGTCTCGACGGGCCCACACG
CCCCATAAACAAATAGGTTTGGTCCTAGCCTTTCTATTAGCTCTTAGTGAGGTTACACAT
GCAAGCATCCCCGCCCCAGTGAGTCGCCCTCCAAGTCACTCTGACTAAGAGGAGCAAGCA
+4
View File
File diff suppressed because one or more lines are too long
+127
View File
@@ -0,0 +1,127 @@
>ref
TGCGGAGGCTGAAGCAACTCCATCTTGGAAGCTAATCTACCATGTTGGCTTCTGATTAAC
ATCAGTTCTGGGAAGGCTTGTAAGATTTCCTGTTTGTCTATTATTTCCTAGGTAAGAGCA
GATACTTACTGTAAATCCTGCCCCTAGATTAAACAACCTTGGTGTTATCGTACTTCCATT
GTCCTATACATCCCTTCGGAATCCCCCTTTCCCTATGGTCCTCAAGCCCTTGGTCTGGGG
AGTAACAGCATAGGGATCAACCATCTCGTCTTGCCACTGCCCGAAATACAGACATGGCTT
CTGTTCCTAAGTCCCTATTCAACTTTTCTTTCTAAGAAACTGGATTTGTCAGCCTCTTTC
TTCACCTCTCAGCTTCCTTGGACTTTGGGGGTAGGTTTGCGTAGACATGCTCACCACAGA
CACAATATCAGCTTCATTCTACAGATGAGGAAGGCAAGCCTTGGGGAGCTTAACCAACTT
GTCGAGACTCATGTATATACCAACACTGAAAAGCAGATATTCCAGACTCCCAGTCATGCC
ACAGGCACACCCCTCAGTGAGAGGTGGGGTTTGTAGTTGAGGCTATTTCCTGCCCAGGGA
GCAGGGAGGCACTCTAGCTTCCCTGAGCTAACGTGGTTCTGCTTGTGTCTGACTTCCAGG
TCTCTGCCCTTTCCAAGCTCACTAGGATGGGCTTCGGGTGTGTCAAATGCCTCAGACAGT
ACAGATCCACACAGAATGGGCATATGCAACCAATCAGTGTCATAAAAAAGAAGGAAATGA
CTCGGGCCCCCTGTGTGTTCAACATGTCGAAGGTATCTGTGCAGCAGAAGAAAGAGGGGC
AAAAGCCCCCAGTGCCACAGGCCAGAGGCAGCAGCTTGGGCCCATGTGGGAGGGTTTGCT
TTCCCCTGCCAAAGTGATGGGCTGCTGCAGCCTGGGGCTTGTGGGAATCCTTCCTGGGCC
TGTGTGGGAAGTGTAGGCAGGGAGAGTGCTGCTTTCCCAAGCTCATCCCAGCTACAGCTA
CCTTTGTGCTCTGGGATTCAGGACCCCCGAGGGGGCTGGCAGGAGAGTCTCTGTTCTCGG
ATGGGTTGTCACCAGGGCATACATGGGAAGTGGGCTCTCTGGAGTCACCCTCCAGGGGAC
AATGCCAATTCCAGACACATTTACTGGAACCCCTACACTGATGACCTTTTGTTGAGGGTT
GAATTATGTCCCCAAAAAAGATACATTGAAGTCCAAACCTCTGGTGTCTATAAATGTGAT
TTTATTTGAAAATGAGGTTTCTATGGACTAAATTGTGTCCCTCCCAAATTCATATTTTGA
AGCCCTAGCCCCCAGTGTGACTATACCTAGAGACAGAGATCTTTAGGAGGTAATTAAGGT
TCAATGAGGTCAGGTGGGTGGGGCCCTAAACCAACAGGAAGGACTGTGGCCTTACTAGAA
AAGGAAGAAAAAGCATTTCCTCTCTTCTAGTATAAAAGGACACAGAAAGAAGGCAGATAT
CTACAAGCCACGAAGAGAGACGTCACTGAGAACTGAATTTGTGTACATTGATCTGGAACT
TCCAGCCTCCAGAACTTGAGAAATACATTTCTGTTGTTTATTTTTTTTTCATGTAATCAA
TTCATTTATCATATATTTATTGAGTGCCTACTATGTGCCAGAGGATACAGCAGTAACAAA
ACTAGGCAAAAATTGTGCCTAAAAGAGGGAAGATGACTTTTCTTAAAGTGTGGAATAAAG
AAAAGTAAGATAGCGGATAGAAGCTTGAAGTGAAAGCAGGTTCACAGGAAGTTTCTTTGG
TCATTTGTTTTGTTTTTAAATAGTGGAAAGATGTATATGTTTATGGAGAAAGATTGCCTT
GAAGATGCAAGAGGAAGAGATGATCAAAATTCAAGAAGAAGCAGAAAGTGATAGAATAAA
GAGCACAAGTGGAGAATTAGTGTTAATGAAAAGAAGGATGCTTCCTTTGATATGAAGTGA
AGGAAGAGAGAATGAGTAAAGACCAAGACTTGAAGTCCCTAGTTTAATAGAGGGAGATTT
CTTCTTTTGATAGCAACAATGGTATTCTGAATTATTTGAAGACATGTCATATTTCTCTTG
TGCCATTTTCCTCCCAGTTTAAACATTCTCATAACCTCTATTCCTCACATGATGTTTTTC
CAGGTCCTTTATTCTTTGGCACTCTCTTCTCTGGACACATTGTATTCTGTCATTGGTCCT
AAAATTTAGATACCCACAATTGAACATACTCCTCTAGATATGGTCTAGCTAATGCAAAAG
AACTGCTGCCTTCCAACTTGTTCAGACATCATATGTTTGTTGTCAAACGCTAAGTTGAGT
TGTTATCTTTTAAGTTTTGTTTTTGTTTTTTTTTTTTTTTTTTAATTCCAAGAGGTGCCC
ACGTTGGCTAAGTACCAAACAGGGTACTAGGGAATTTTACTTCTGAGTTAAATGCCATTC
TAGTTGTTTTTTCTTCATCTCCAGTAAGGTTATCTTTATTCACCAGTTGTTACAATAGCT
GTGGGTCTTGCTTCTCACAGTTTTATGCTGTCTGTGCTATTTTCTCTACTGATCATCACC
ACAATCATTATTGCTTATCATAATTGTTATCTTTATTTTCTCCTTTAATCAAGAATCAGT
CTTCCTTTATCTCATTATTCTCTTTTGCAGGCTTCAGGATAATTATGGTTGGAGTGCACT
GGGGGAACCAGTGCAGCTAAGCTCTGACATCTTTGCATCCCTTTTCCATCTGCTGTTTTG
GCACTCTGGTAGAATAGATAACCTAAAAACGACTTTAAAACATCTAGAAATTTTGGATAA
AATATAACAAACATCCCTTTAAATGCACAACTGATCTTCCATGGAAGTCACAGAAATATA
TAACGCCAAAAAGAAGGGAAGCTGAAACCCAGGGCTGTAAACATGAACATCATCTTCTCT
CCCTTTTTCTTGTGACTTATCTTGTTTTTCTCAGCTTTGGTGCTACCAAGGCTTGACTTT
AATAGGCATTTCCAATCAATGAGAGAATTTCTTTTGCTTTCATCAACAATTCAGTTATTG
ATGTTAACATATATATCATTTGAGTACTTTTCTTTTTTTTATTATTATTATACTTTAAGT
TTTAGGGTCCATGTGCACAATGTGCAGGTTAGTTACGTATGTATACATGTGCCATGCTGG
TGTGCTGCACCCATTAACTCATCATTTAGCATTAGGTATATCTCCTAATGCTATCCCTTC
CCCCTCTCCCCACCCCACAACAGTCCCCAGAGTGTTCCCCTTCCTGTGTCCATGTGTTCT
CATTGTTCAATCCCCATCTATGAGTGAGAACATGCGGTGTTTGGTTTTTTGTCCTTGCAA
TAGTTTACTGAGAATGATGATTTCTAATTTCATCCATGTCCCTAAAGAGCTTCTGCACAG
CAAAAGAAACTACCATCAGAGTGAACAGGCAACCTACAAAATGGGAGAAAATTTTCACAA
CCTGCTCATCTGACAAAGGGCTAATATCCAGAATCTACAATGAACTCAAACAAATTTACA
AGAAAAAAACAAACAACCCCATCAAAAAGTGGGCAAAGGATATGAACAGACACTTCTCAA
AAGAAGACATTTATGCAGCCAAAAGACACATGAAAAAATGCTCATCATCACTGGCCATCA
GAGAAATGCAAACCAAAACCACAATGAGATACCATCTCACACCAGTTAAAATGGCAATCA
TTAAAAAGTCAGGAAACAACAGGTGCTGGAGAGGATGTGGAGAAACAGGAACACTTTTAC
ACTGTTGGTGGGACTGTAAACTAGTTCAACCATTGTGGAAGTCAGTGTGCTGATTCCTCA
GGGATCTAGAACTAGAAATACCATTTGACCCAGCCATCCCATTACTGGGTATATACCCAA
AGGACTATAAATCATGCTGCTATAAAGACACATGCACACGTATGTTTATTGCGGCACTAT
TCACAATAGCAAAGACTTGGAACCAACCCAAATGTCCAACAATGATAGACTGGATTAAGA
AAATGTGGCACATATACACCACGGAATACTGTGCAGCCATAAAAAATGATGAGTTCATGT
CCTTTGTAGGGACACGGATGAAATTGGAAATCATTTCTGTTGTTTAAACCACGAAGTCTA
TGGTATCTGGTTATGACAACCTGAGAATACTAACTCAAGGGTCTTTCGCAGATGTCATTA
AGTTGTTAAAGTGAGGTCATTATGGTGGGTCCTAATCCAAGAGAAGAGATGCATGGACAG
ACGTGCACAACGGGAGGACCAAGCCAAGACACACAGGGAGAATGGCCATGGGAAGATGGA
GGCAGAGATCAAAGTGAGGCACCCACAAGCCAAGAAATGGCAGGAGCTACCAGCAGCTGG
AAGATGCAGAGAAGCATTCCTTCTTAGAGGTTTCAGAGAGAGTATGGTGCTACTGACACC
TTGATTTTGAACTTCTAGTCTCCAGAACTATGAGAGAATAAATTTCTGTTGGTTAAGCCA
TCGAGTTTGTGTAAGTTTGTTATAAGAGCCCTAGGAAATAAACATATCCATTTATTCAGG
AAAGCCTGCTAGAGTGCAAATATTTGGAAAAGATACTACTATGCAAATGTTTGAAAAAGA
TATTGCTCTTGATTCTGCCTTATGGGTTTTTCATTTCTGTAAGCTATTCTCAAAGTTTTG
TTCTTGGACTACTATTGGTAATTAAGACTGCAACATGTTTGGCAACATCAGTTGAGAACT
GTTGCTCTGGGAACGTTTTCGGCAAGCCTCAGCCCTTCTTTTCCCTTGGCTTGCATTGAG
GAGTTAGGTGATACTCTGCTGCTCAGGCCCAGCACCTTTATGGACCGTATTCCCCTGGTG
GAATGACCATCTCTGCTTGCTCTGATTGGCTGTTGGGGTTTTCTAGCATGCCCTATTTAA
TATGTATGATTTATCTCTTACTTCAGTTGGAAGGTACAGTTGCTCTGTAGTTGGCATGCA
GTCATGGTGACTATGAAAATATAAAATAATGTTTTGGTTTACAGACACTTAGAAATAAGT
TGTGTCTCAAAATTGGGTGACTATTCTAGTTATCTGCTACTCAATATCCTTGTGCGAGCC
CTCTTTACCCAGAATCAAACTAAACCATGAGGGGCACTATAGAATGTCACCCCTGGGTCC
AGGATACTATGGGGACTCAGAAGCCAAGCTCCCACTGGGGGATCTAGGGCATGCCCCCAA
GGTAAGATTCCCACCTCTTTGTTCAGCAGGAAGCACCCATCACACAAGGAGGTAGGAATA
AACAAGCATTCGTCAAGAACAAAAGATACAGATGTTCTGCTGGAGCTTGGATACATAGCA
TAAGAGGGAACAGTTCTCACAGGTAAGAGTAAGTTTTCCTCTGGTGGTGACAGTGGGACC
TGTGGGGGAGAGAATTGGGAGTACTGACAGGAAGGCAGAGTGGCTGTCCAAATGAACGGA
TTGTTTGCACATGGCCTTTAGGGCACGTTGTGTTAGCCTTCCATTGCTGCTTATATTAGT
CTGTTTTCACACTGCCCATAAATGCATACCTGAGACTGGATAATTTATAAAGAAAAAGAG
CCTTAATGTACTCATAGTTGCATGTGGCTGGGGAGGCCTCACAATCATGGCAGAAGGTGA
AAGGCACATCTTACATGGAAGCAGACAAGAGAGAATTGAGGACCAAGTGAAAGGGGTTTC
CCCTTATAAAACCATCAGATCACATGAGACTTTTTCACCACCATGAGAACAGTAAGGGGA
AAACTATGCTCATGATTCAATTGTCTCCCACTGGATTCCTCCCACAACACATAGGAATTA
TGGGAGCTAAAATTCAAGATGAGATTTGGGTGAGGACACAGCCAAACCCTATCACTGCTG
TAATCAATTCCCACCAACTTAGTGGCTCGAAACATCACAGATTTATGATCTTATGACGGT
GGAGGTCCCCAAATGGATCTTCTAGGTCTAGAATCAAGGTATCAGCAGACCACTTCTTTT
GGAGGCTCTGGTGGAGAAACCATTTCCTCGCCTTTTCCAGCTTCTAGAGGCTGCCCTTCT
CATTCCTTGGTTCACGGCCACACTCATTTCCATCTCTGCTTCCACTGTGACAACTTCTCT
GCCTCAGACCCTCCTGCTTTGCCTTTGTAAGGACCCTTGTGATGAGATCAGGCCCATCCA
GGATTATCCCTCATCTCAAGACCTTTACCTTAATCACATTTGCAAGGTCTCTTCCACTGT
GTCAGGTAACATTTTCACAGGTTCCAGGGATTAGGGTGTGGACATCTTGGGGAGCTGGAG
GATATTATTTCATCTACCACACACATCTCTACCTTGTACAGGCAAGCACTTGCAAAGTGC
AATGTGATCCTCTGGAGCCACTGTCCTCCCAGAGCTTATATATACTCTGAAAGTCAACTC
TCAGACCACAGCCTCCTGTCCATGCACCACTCTCATCAACACCCCCACCCGAAACACTTT
CACTCCACCCTCTTTGTCCCCTAACTCATGGAGAAGAAAATCTAATTAGTAGGAGTGGAA
TTTGGCTTTCATCTTTACCAGTACTAGAAATATGGTGTGTGTCTTTTTGTAAAAATTCTC
TCAACTAAATTGTTTTTATTAATTTCTGCAAAATGTGAACATCAACTCCCTTCATGTGAA
TGTCAATAAGATTAAATGAGCTGTCTCAGCTCCTAGCCTGTGCAAGCTAACAGCTCAGGA
GATGTTTATTTCTTTCCCTCTTCTTTCCTTAATGAAGCCCTCTCCTTTGACATCTTCAAT
TCTGGAGCGCTTCTTTTCTGAGGCCTTGGCTCCCCCACATTGCCCACCCTTTTCCTGCTC
GTCCACATTTCTGGCTTCTATTCTCTTGTCTTTACCATCTCCCTGAACAATGTTATCCGT
TCCAATGACTTCAACAGTCTCTCCGCTTACATATGATGCCTCTCAAACTCTGATCTCCAA
CTCTTCCAAAGAGCTCTGGACCTTTGTTCCAATTACCTGAAAAACATCTTCTTGGATGTC
CCATTAGCACTGTTAAATCAAACAAGAATTTCCCTCCCTCCTGCCTTGCTGTAGTTCCCC
TAGGGATTCGGTTGTGTGGGAAGATGTGTGGAGAGCTCTTAGTTGACTCCCTTCTCTGCA
GTTCTACCTCTCTAGAGACTTGGAGGACCCACTGTTTCCGCCTCGCTTTTTCAGGCCTAG
AGATTGCTCGCTCCTGGGCTGGCTGCTTCATAATTCCTTATTAGTAGTTTCCCAAGCTTA
CATATCTGTAAATATTTACTTTAGTTAAATTCTCCCCAATTTCCACAATATGTTGGCTGC
ACATGCTTTCTACTAGGAGTCACACAACTATGATAAGAACCAAGAAATATTAGTAAACGT
TTTTTACCATTATTGGCCTATACCCTGGAATAGCCAACAATAACCTAGAACCTATGCAAC
AAGAATATCCAACAAGAACCTAGAGACCTGTCAGTCTATAGGTGGGAACTACAGGATGAG
A
+5
View File
@@ -0,0 +1,5 @@
mm2: TGTTATCCCTAGGGTAACTTGTTCCGTTGGTCAAGTTATTGGATCAATTGAGTATAGTAGTGCACTCAC......................................................................................................................................CACTTGGAGCCATTCATACAGGTCCCTATTTAAGGAACAAGTGATTATGCTACCTTTGCACGGTT
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
ref: TGTTATCCCTAGGGTAACTTGTTCCGTTGGTCAAGTTATTGGATCAATTGAGTATAGTAGTGCACTCACctGCTTCGCTTTGACTGGTGAAGTCTTAGCATGTACTGCTCGGAGGTTGGGTTCTGCTCCGAGGTCGCCCCAACCGAAATTTTTAATGCAGGTTTGGTAGTTTAGGACCTGTGGGTTTGTTAGGCTAACCTCacCACTTGGAGCCATTCATACAGGTCCCTATTTAAGGAACAAGTGATTATGCTACCTTTGCACGGTT
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
sta: TGTTATCCCTAGGGTAACTTGTTCCGTTGGTCAAGTTATTGGATCAATTGAGTATAGTAGTGCA......................................................................................................................................CTCACCACTTGGAGCCATTCATACAGGTCCCTATTTAAGGAACAAGTGATTATGCTACCTTTGCACGGTT
+5
View File
@@ -0,0 +1,5 @@
>query
AACCGTGCAAAGGTAGCATAATCACTTGTTCCTTAAATAGGGACCTGTATGAATGGCTCC
AAGTG
GTGAGTGCA
CTACTATACTCAATTGATCCAATAACTTGACCAACGGAACAAGTTACCCTAGGGATAACA
+10
View File
@@ -0,0 +1,10 @@
>ref
TGATCCAACATCGAGGTCGTAAACCCTATTGTTGATATGGACTCTAGAATAGGATTGCGC
TGTTATCCCTAGGGTAACTTGTTCCGTTGGTCAAGTTATTGGATCAATTGAGTATAGTAG
TGCACTCAC
ctGCTTCGCTTTGACTGGTGAAGTCTTAGCATGTACTGCTCGGAGGTTGGGTTCTGCTCC
GAGGTCGCCCCAACCGAAATTTTTAATGCAGGTTTGGTAGTTTAGGACCTGTGGGTTTGT
TAGGCTAACCTCac
CACTTGGAGCCATTCATACAGGTCCCTATTTAAGGAACAAGTGATTATGCTACCTTTGCA
CGGTTAGGGTACCGCGGCCGTTAAACATGTGTCACTGGGCAGGCGGTGCCTCTAATACTG
GTGAT
+160 -15
View File
@@ -61,13 +61,6 @@
Volume = {32},
Year = {2016}}
@misc{Suzuki:2016,
title = {Fast and accurate alignment tool for PacBio and Nanopore long reads},
author = {Hajime Suzuki},
journal = {Unpublished},
howpublished = {\href{https://github.com/ocxtal/minialign}{https://github.com/ocxtal/minialign}},
year = {2016}}
@misc{Ruan:2016,
title = {Ultra-fast de novo assembler using long noisy reads},
author = {Jue Ruan},
@@ -172,14 +165,6 @@
Volume = {29},
Year = {2011}}
@article {Suzuki130633,
author = {Suzuki, Hajime and Kasahara, Masahiro},
title = {Acceleration Of Nucleotide Semi-Global Alignment With Adaptive Banded Dynamic Programming},
year = {2017},
note = {doi:10.1101/130633},
publisher = {Cold Spring Harbor Labs Journals},
journal = {bioRxiv}}
@article{Gotoh:1982aa,
Author = {Gotoh, O},
Journal = {J Mol Biol},
@@ -313,3 +298,163 @@
Title = {Assembling large genomes with single-molecule sequencing and locality-sensitive hashing},
Volume = {33},
Year = {2015}}
@article{Gurevich:2013aa,
Author = {Gurevich, Alexey and others},
Journal = {Bioinformatics},
Pages = {1072-5},
Title = {{QUAST}: quality assessment tool for genome assemblies},
Volume = {29},
Year = {2013}}
@article{Li:2010fk,
Author = {Li, Heng and Durbin, Richard},
Journal = {Bioinformatics},
Pages = {589-95},
Title = {Fast and accurate long-read alignment with {Burrows-Wheeler} transform},
Volume = {26},
Year = {2010}}
@article{Marcais:2018aa,
Author = {Mar{\c c}ais, Guillaume and others},
Journal = {PLoS Comput Biol},
Pages = {e1005944},
Title = {{MUMmer4}: A fast and versatile genome alignment system},
Volume = {14},
Year = {2018}}
@article{Li:2009ys,
Author = {Li, Heng and others},
Journal = {Bioinformatics},
Pages = {2078-9},
Title = {The {Sequence Alignment/Map format and SAMtools}},
Volume = {25},
Year = {2009}}
@article{Suzuki:2018aa,
Author = {Suzuki, Hajime and Kasahara, Masahiro},
Journal = {BMC Bioinformatics},
Pages = {45},
Title = {Introducing difference recurrence relations for faster semi-global alignment of long sequences},
Volume = {19},
Year = {2018}}
@article{Li:2018ab,
Author = {Li, Heng},
Journal = {Bioinformatics},
Pages = {3094-3100},
Title = {Minimap2: pairwise alignment for nucleotide sequences},
Volume = {34},
Year = {2018}}
@article{Jain:2020aa,
Author = {Jain, Chirag and others},
Journal = {Bioinformatics},
Pages = {i111-i118},
Title = {Weighted minimizer sampling improves long read mapping},
Volume = {36},
Year = {2020}}
@article{Miga:2020aa,
Author = {Miga, Karen H and others},
Journal = {Nature},
Pages = {79-84},
Title = {Telomere-to-telomere assembly of a complete human {X} chromosome},
Volume = {585},
Year = {2020}}
@article {Jain2020.11.01.363887,
author = {Jain, Chirag and others},
title = {A long read mapping method for highly repetitive reference sequences},
elocation-id = {2020.11.01.363887},
year = {2020},
doi = {10.1101/2020.11.01.363887},
publisher = {Cold Spring Harbor Laboratory},
URL = {https://www.biorxiv.org/content/early/2020/11/02/2020.11.01.363887},
eprint = {https://www.biorxiv.org/content/early/2020/11/02/2020.11.01.363887.full.pdf},
journal = {bioRxiv}
}
@article{Li:2020aa,
Author = {Li, Heng and others},
Journal = {Genome Biol},
Pages = {265},
Title = {The design and construction of reference pangenome graphs with minigraph},
Volume = {21},
Year = {2020}}
@article{Ren:2021aa,
Author = {Ren, Jingwen and Chaisson, Mark J P},
Journal = {PLoS Comput Biol},
Pages = {e1009078},
Title = {lra: A long read aligner for sequences and contigs},
Volume = {17},
Year = {2021}}
@inproceedings{DBLP:conf/wabi/AbouelhodaO03,
Author = {Mohamed Ibrahim Abouelhoda and Enno Ohlebusch},
Booktitle = {Algorithms in Bioinformatics, Third International Workshop, {WABI} 2003, Budapest, Hungary, September 15-20, 2003, Proceedings},
Crossref = {DBLP:conf/wabi/2003},
Pages = {1--16},
Title = {A Local Chaining Algorithm and Its Applications in Comparative Genomics},
Year = {2003}}
@article{Ono:2021aa,
Author = {Ono, Yukiteru and others},
Journal = {Bioinformatics},
Pages = {589-595},
Title = {{PBSIM2}: a simulator for long-read sequencers with a novel generative model of quality scores},
Volume = {37},
Year = {2021}}
@article{Sedlazeck:2018ab,
Author = {Sedlazeck, Fritz J and others},
Journal = {Nat Methods},
Pages = {461-468},
Title = {Accurate detection of complex structural variations using single-molecule sequencing},
Volume = {15},
Year = {2018}}
@article{Jeffares:2017aa,
Author = {Jeffares, Daniel C and others},
Journal = {Nat Commun},
Pages = {14061},
Title = {Transient structural variations have strong effects on quantitative traits and reproductive isolation in fission yeast},
Volume = {8},
Year = {2017}}
@article{Zook:2020aa,
Author = {Zook, Justin M and others},
Journal = {Nat Biotechnol},
Pages = {1347-1355},
Title = {A robust benchmark for detection of germline large deletions and insertions},
Volume = {38},
Year = {2020}}
@article{Harpak:2017aa,
Author = {Harpak, Arbel and others},
Journal = {Proc Natl Acad Sci U S A},
Pages = {12779-12784},
Title = {Frequent nonallelic gene conversion on the human lineage and its effect on the divergence of gene duplicates},
Volume = {114},
Year = {2017}}
@article{Li:2018aa,
Author = {Li, Heng and others},
Journal = {Nat Methods},
Month = {Aug},
Number = {8},
Pages = {595-597},
Title = {A synthetic-diploid benchmark for accurate variant-calling evaluation},
Volume = {15},
Year = {2018}}
@article{Gu:1995wt,
author = {Gu, X and Li, W H},
journal = {J Mol Evol},
month = {Apr},
number = {4},
pages = {464-73},
title = {The size distribution of insertions and deletions in human and rodent pseudogenes suggests the logarithmic gap penalty for sequence alignment},
volume = {40},
year = {1995}}
+123 -61
View File
@@ -1,6 +1,6 @@
\documentclass{bioinfo}
\copyrightyear{2017}
\pubyear{2017}
\copyrightyear{2018}
\pubyear{2018}
\usepackage{graphicx}
\usepackage{hyperref}
@@ -19,7 +19,7 @@
\begin{document}
\firstpage{1}
\title[Aligning nucleotide sequences with minimap2]{Minimap2: versatile pairwise alignment for nucleotide sequences}
\title[Aligning nucleotide sequences with minimap2]{Minimap2: pairwise alignment for nucleotide sequences}
\author[Li]{Heng Li}
\address{Broad Institute, 415 Main Street, Cambridge, MA 02142, USA}
@@ -40,9 +40,10 @@ full-length noisy Direct RNA or cDNA reads, and assembly contigs or closely
related full chromosomes of hundreds of megabases in length. Minimap2 does
split-read alignment, employs concave gap cost for long insertions and
deletions (INDELs) and introduces new heuristics to reduce spurious alignments.
It is 3--4 times faster than mainstream short-read mappers at comparable
accuracy and $\ge$30 times faster at higher accuracy for both genomic and mRNA
reads, surpassing most aligners specialized in one type of alignment.
It is 3--4 times as fast as mainstream short-read mappers at comparable
accuracy, and is $\ge$30 times faster than long-read genomic or cDNA
mappers at higher accuracy, surpassing most aligners specialized in one type of
alignment.
\section{Availability and implementation:}
\href{https://github.com/lh3/minimap2}{https://github.com/lh3/minimap2}
@@ -63,7 +64,7 @@ the thought that 10kb long sequences should be easier to map than 100bp reads
because we can more effectively skip repetitive regions, which are often the
bottleneck of short-read alignment. We confirmed our speculation by achieving
approximate mapping 50 times faster than BWA-MEM~\citep{Li:2016aa}.
\citet{Suzuki130633} extended our work with a fast and novel algorithm on
\citet{Suzuki:2018aa} extended our work with a fast and novel algorithm on
generating base-level alignment, which in turn inspired us to develop minimap2
with added functionality.
@@ -87,12 +88,14 @@ the versatility of minimap2.
Minimap2 follows a typical seed-chain-align procedure as is used by most
full-genome aligners. It collects minimizers~\citep{Roberts:2004fv} of the
reference sequences and indexes them in a hash table. Then for each query
sequence, minimap2 takes query minimizers as \emph{seeds}, finds matches to the
reference, and identifies sets of colinear seeds, which are called
reference sequences and indexes them in a hash table, with the key being the
hash of a minimizer and the value being a list of locations of the minimizer
copies. Then for each query
sequence, minimap2 takes query minimizers as \emph{seeds}, finds exact matches
(i.e. \emph{anchors}) to the reference, and identifies sets of colinear anchors as
\emph{chains}. If base-level alignment is requested, minimap2 applies dynamic
programming (DP) to extend from the ends of chains and to close unseeded
regions between adjacent seeds in chains.
programming (DP) to extend from the ends of chains and to close
regions between adjacent anchors in chains.
Minimap2 uses indexing and seeding algorithms similar to
minimap~\citep{Li:2016aa}, and furthers the predecessor with more accurate
@@ -119,10 +122,13 @@ distance between two anchors is too large); otherwise
\end{equation}
In implementation, a gap of length $l$ costs
\[
\gamma_c(l)=0.01\cdot \bar{w}\cdot|l|+0.5\log_2|l|
\gamma_c(l)=\left\{\begin{array}{ll}
0.01\cdot \bar{w}\cdot|l|+0.5\log_2|l| & (l\not=0) \\
0 & (l=0)
\end{array}\right.
\]
where $\bar{w}$ is the average seed length. For $m$ anchors, directly computing all $f(\cdot)$ with
Eq.~(\ref{eq:chain}) takes $O(m^2)$ time. Although theoretically faster
where $\bar{w}$ is the average seed length. For $N$ anchors, directly computing all $f(\cdot)$ with
Eq.~(\ref{eq:chain}) takes $O(N^2)$ time. Although theoretically faster
chaining algorithms exist~\citep{Abouelhoda:2005aa}, they
are inapplicable to generic gap cost, complex to implement and usually
associated with a large constant. We introduced a simple heuristic to
@@ -132,7 +138,7 @@ We note that if anchor $i$ is chained to $j$, chaining $i$ to a predecessor
of $j$ is likely to yield a lower score. When evaluating Eq.~(\ref{eq:chain}),
we start from anchor $i-1$ and stop the process if we cannot find a better
score after up to $h$ iterations. This approach reduces the average time to
$O(h\cdot m)$. In practice, we can almost always find the optimal chain with
$O(hN)$. In practice, we can almost always find the optimal chain with
$h=50$; even if the heuristic fails, the optimal chain is often close.
\subsubsection{Backtracking}
@@ -146,9 +152,11 @@ in more than one chains.
\subsubsection{Identifying primary chains}\label{sec:primary}
In the absence of copy number changes, each query segment should not be mapped
to two places in the reference. However, chains found at the previous step may
have significant or complete overlaps due to repeats in the reference.
have significant or complete overlaps due to repeats in the reference~\citep{Li:2010fk}.
Minimap2 used the following procedure to identify \emph{primary chains} that do
not greatly overlap on the query. Let $Q$ be an empty set initially. For each
not greatly overlap on the query.
Let $Q$ be an empty set initially. For each
chain from the best to the worst according to their chaining scores: if on the
query, the chain overlaps with a chain in $Q$ by 50\% or higher percentage of
the shorter chain, mark the chain as secondary to the chain in $Q$; otherwise,
@@ -156,6 +164,16 @@ add the chain to $Q$. In the end, $Q$ contains all the primary chains. We did
not choose a more sophisticated data structure (e.g. range tree or k-d tree)
because this step is not the performance bottleneck.
For each primary chain, minimap2 estimates its mapping quality with an
empirical formula:
\[
{\rm mapQ}=40\cdot (1-f_2/f_1)\cdot\min\{1,m/10\}\cdot\log f_1
\]
where $\log$ denotes natural logarithm, $m$ is the number of anchors on the primary chain, $f_1$ is the chaining
score, and $f_2\le f_1$ is the score of the best chain that is secondary to the
primary chain. Intuitively, a chain is assigned to a higher mapping quality if
it is long and its best secondary chain is weak.
\subsubsection{Estimating per-base sequence divergence}
Suppose a query sequence harbors $n$ seeds of length $k$, $m$ of which are
present in a chain. We want to estimate the sequence divergence $\epsilon$
@@ -186,7 +204,7 @@ $0.9$.
\subsubsection{Indexing with homopolymer compressed $k$-mers}
SmartDenovo
(\href{https://github.com/ruanjue/smartdenovo}{https://github.com/ruanjue/smartdenovo};
J Ruan, personal communication) indexes reads with homopolymer-compressed (HPC)
J. Ruan, personal communication) indexes reads with homopolymer-compressed (HPC)
$k$-mers and finds the strategy improves overlap sensitivity for SMRT reads.
Minimap2 adopts the same heuristic.
@@ -199,9 +217,9 @@ To demonstrate the effectiveness of HPC $k$-mers, we performed read overlapping
for the example {\it E. coli} SMRT reads from PBcR~\citep{Berlin:2015xy}, using
different types of $k$-mers. With normal 15bp minimizers per 5bp window,
minimap2 finds 90.9\% of $\ge$2kb overlaps inferred from the read-to-reference
alignment. With HPC 19-mers, minimap2 finds 97.4\% of overlaps. It achieves this
alignment. With HPC 19-mers per 5bp window, minimap2 finds 97.4\% of overlaps. It achieves this
higher sensitivity by indexing 1/3 fewer minimizers, which further helps
performance. HPC-based indexing reduces the sensitivity for ONT reads, though.
performance. HPC-based indexing reduces the sensitivity for current ONT reads, though.
\subsection{Aligning genomic DNA}\label{sec:genomic}
@@ -240,14 +258,14 @@ performance of minimap2. Traditional SSE implementations~\citep{Farrar:2007hs}
based on Eq.~(\ref{eq:ae86}) can achieve 16-way parallelization for short
sequences, but only 4-way parallelization when the peak alignment score reaches
32767. Long sequence alignment may exceed this threshold. Inspired by
\citet{Wu:1996aa} and the following work, \citet{Suzuki130633} proposed a
\citet{Wu:1996aa} and the following work, \citet{Suzuki:2018aa} proposed a
difference-based formulation that lifted this limitation.
In case of 2-piece gap cost, define
\[
\left\{\begin{array}{ll}
u_{ij}\triangleq H_{ij}-H_{i-1,j} & v_{ij}\triangleq H_{ij}-H_{i,j-1} \\
x_{ij}\triangleq E_{i+1,j}-H_{ij} & \tilde{x}_{ij}\triangleq \tilde{E}_{i+1,j}-\tilde{H}_{ij} \\
y_{ij}\triangleq F_{i,j+1}-H_{ij} & \tilde{y}_{ij}\triangleq \tilde{F}_{i,j+1}-\tilde{H}_{ij}
x_{ij}\triangleq E_{i+1,j}-H_{ij} & \tilde{x}_{ij}\triangleq \tilde{E}_{i+1,j}-H_{ij} \\
y_{ij}\triangleq F_{i,j+1}-H_{ij} & \tilde{y}_{ij}\triangleq \tilde{F}_{i,j+1}-H_{ij}
\end{array}\right.
\]
We can transform Eq.~(\ref{eq:ae86}) to
@@ -307,11 +325,11 @@ y_{rt}&=&\max\{0,y_{r-1,t}+u_{r-1,t}-z_{rt}+q\}-q-e\\
\end{equation*}
In this formulation, cells with the same diagonal index $r$ are independent of
each other. This allows us to fully vectorize the computation of all cells on
the same anti-diagonal in one inner loop. It also simplifies banded alignment,
the same anti-diagonal in one inner loop. It also simplifies banded alignment (500bp band width by default),
which would be difficult with striped vectorization~\citep{Farrar:2007hs}.
On the condition that $q+e<\tilde{q}+\tilde{e}$ and $e>\tilde{e}$, the initial
values in the diagonal-antidiagonal formuation is
values in the diagonal-antidiagonal formuation are
\[
\left\{\begin{array}{l}
x_{r-1,-1}=y_{r-1,r}=-q-e\\
@@ -330,12 +348,19 @@ r\cdot(e-\tilde{e})-(\tilde{q}-q)-\tilde{e} & (r=\lceil\frac{\tilde{q}-q}{e-\til
\]
These can be derived from the initial values for Eq.~(\ref{eq:ae86}).
When performing global alignment, we do not need to compute $H_{rt}$ in each cell.
We use 16-way vectorization throughout the alignment process. When extending
alignments from ends of chains, we need to find the cell $(r,t)$ where $H_{rt}$
reaches the maximum. We resort to 4-way vectorization to compute
$H_{rt}=H_{r-1,t}+u_{rt}$. Because this computation is simple,
Eq.~(\ref{eq:suzuki}) is still the dominant performance bottleneck.
In practice, our 16-way vectorized implementation of global alignment is three
times as fast as Parasail's 4-way vectorization~\citep{Daily:2016aa}. Without
banding, our implementation is slower than Edlib~\citep{Sosic:2017aa}, but with
a 1000bp band, it is considerably faster. When performing global alignment
between anchors, we expect the alignment to stay close to the diagonal of the
DP matrix. Banding is applicable most of time.
DP matrix. Banding is applicable most of the time.
\subsubsection{The Z-drop heuristic}
@@ -359,6 +384,16 @@ alignment between the two subsequences involved in the global alignment, but
this time with the one subsequence reverse complemented. This additional
alignment step may identify short inversions that are missed during chaining.
\subsubsection{Filtering out misplaced anchors}
Due to sequencing errors and local homology, some anchors in a chain may be
wrong. If we blindly align regions between two misplaced anchors, we will
produce a suboptimal alignment. To reduce this artifact, we filter out
anchors that lead to a $>$10bp insertion and a $>$10bp deletion at the same
time, and filter out terminal anchors that lead to a long gap towards the ends
of a chain. These heuristics greatly alleviate the issues with misplaced
anchors, but they are unable to fix all such errors. Local misalignment is a
limitation of minimap2 which we hope to address in future.
\subsection{Aligning spliced sequences}
The algorithm described above can be adapted to spliced alignment. In this
@@ -397,7 +432,7 @@ p/2 & \mbox{if $T[i+1,i+3]$ is ${\tt GTC}$ or ${\tt GTT}$} \\
p & \mbox{otherwise}
\end{array}\right.\]
where $T[i,j]$ extracts a substring of $T$ between $i$ and $j$ inclusively.
$d(i)$ penalizes non-canonical donor sites with $p$ and less frequent Eukayotic
$d(i)$ penalizes non-canonical donor sites with $p$ and less frequent Eukaryotic
splicing signal ${\tt GT[C/T]}$ with $p/2$~\citep{Irimia:2008aa}. Similarly,
\[a(i)=\left\{\begin{array}{ll}
0 & \mbox{if $T[i-2,i]$ is ${\tt CAG}$ or ${\tt TAG}$} \\
@@ -424,13 +459,13 @@ alignment.
\subsection{Aligning short paired-end reads}
During chainging, minimap2 takes a pair of reads as one fragment with a gap of
During chaining, minimap2 takes a pair of reads as one fragment with a gap of
unknown length in the middle. It applies a normal gap cost between seeds on the
same read but is a more permissive gap cost between seeds on different reads.
More precisely, the gap cost during chaining is:
More precisely, the gap cost during chaining is ($l\not=0$):
\[
\gamma_c(l)=\left\{\begin{array}{ll}
0.01\cdot\bar{w}\cdot l+0.5\log_2 l & \mbox{if two seeds on the same read} \\
0.01\cdot\bar{w}\cdot |l|+0.5\log_2 |l| & \mbox{if two seeds on the same read} \\
\min\{0.01\cdot\bar{w}\cdot|l|,\log_2|l|\} & \mbox{otherwise}
\end{array}\right.
\]
@@ -443,6 +478,17 @@ consistent paired-end alignments.
\section{Results}
Minimap2 is implemented in the C programming language and comes with APIs in
both C and Python. It is distributed under the MIT license, free to both
commercial and academic uses. Minimap2 uses the same base algorithm for all
applications, but it has to apply different sets of parameters depending on
input data types. Similar to BWA-MEM, minimap2 introduces `presets' that
modify multiple parameters with a simple invocation. Detailed settings
and command-line options can be found in the minimap2 manpage. In addition to
the applications evaluated in the following sections, minimap2 also retains
minimap's functionality to find overlaps between long reads and to search
against large multi-species databases such as \emph{nt} from NCBI.
\subsection{Aligning long genomic reads}\label{sec:long-genomic}
\begin{figure}[!tb]
@@ -450,19 +496,22 @@ consistent paired-end alignments.
\includegraphics[width=.5\textwidth]{roc-color.pdf}
\caption{Evaluation on aligning simulated reads. Simulated reads were mapped
to the primary assembly of human genome GRCh38. A read is considered correctly
mapped if the true position overlaps with the best mapping position by 10\% of
the read length. Read alignments are sorted by mapping quality in the
descending order. For each mapping quality threshold, the fraction of
alignments with mapping quality above the threshold and their error rate are
mapped if its longest alignment overlaps with the true interval, and the
overlap length is $\ge$10\% of the true interval length. Read alignments are
sorted by mapping quality in the descending order. For each mapping quality
threshold, the fraction of alignments (out of the number of input reads) with
mapping quality above the threshold and their error rate are
plotted along the curve. (a) long-read alignment evaluation. 33,088 $\ge$1000bp
reads were simulated using pbsim~\citep{Ono:2013aa} with error profile sampled
from file `m131017\_060208\_42213\_*.1.*' downloaded at
\href{http://bit.ly/chm1p5c3}{http://bit.ly/chm1p5c3}. The N50 read length is
11,628. Aligners were run under the default setting for SMRT reads.
(b) short-read alignment evaluation. 10 million pairs of 150bp reads were
simulated using mason2~\citep{Holtgrewe:2010aa} with option
`\mbox{--illumina-prob-mismatch-scale 2.5}'. Short-read aligners were run under the
default setting except for changing the maximum fragment length to
Kart outputted all alignments at mapping quality 60, so is not shown in the
figure. It mapped nearly all reads with 4.1\% of alignments being wrong, less
accurate than others. (b) short-read alignment evaluation. 10 million pairs of
150bp reads were simulated using mason2~\citep{Holtgrewe:2010aa} with option
`\mbox{--illumina-prob-mismatch-scale 2.5}'. Short-read aligners were run under
the default setting except for changing the maximum fragment length to
800bp.}\label{fig:eval}
\end{figure}
@@ -471,7 +520,7 @@ BLASR~(v1.MC.rc64; \citealp{Chaisson:2012aa}),
BWA-MEM~(v0.7.15; \citealp{Li:2013aa}),
GraphMap~(v0.5.2; \citealp{Sovic:2016aa}),
Kart~(v2.2.5; \citealp{Lin:2017aa}),
minialign~(v0.5.3; \citealp{Suzuki:2016}) and
minialign~(v0.5.3; \href{https://github.com/ocxtal/minialign}{https://github.com/ocxtal/minialign}) and
NGMLR~(v0.2.5; \citealp{Sedlazeck169557}). We excluded rHAT~\citep{Liu:2016ab}
and LAMSA~\citep{Liu:2017aa} because they either
crashed or produced malformatted output. In this evaluation, minimap2 has
@@ -480,11 +529,11 @@ higher mapping accuracy (Fig.~\ref{fig:eval}a). Minimap2 and
NGMLR provide better mapping quality estimate: they rarely give repetitive hits
high mapping quality. Apparently, other aligners may
occasionally miss close suboptimal hits and be overconfident in wrong mappings.
On run time, minialign is slightly faster than minimap2 and Kart. They are over
30 times faster than the rest. Minimap2 consumed 6.1GB memory at the peak,
more than BWA-MEM but less than others.
On run time, minimap2 took 200 CPU seconds, comparable to minialign and Kart, and is over
30 times faster than the rest. Minimap2 consumed 6.8GB memory at the peak,
more than BWA-MEM (5.4GB), similar to NGMLR and less than others.
On real human SMRT reads, the relative performance and sensitivity of
On real human SMRT reads, the relative performance and fraction of mapped reads reported by
these aligners are broadly similar to the metrics on simulated data. We are
unable to provide a good estimate of mapping error rate due to the lack of the
truth. On ONT $\sim$100kb human reads~\citep{Jain128835}, BWA-MEM failed.
@@ -526,7 +575,7 @@ Peak RAM (GByte) & 8.9 & 14.5 & 3.2 & 29.2\vspace{1em}\\
\% approx. introns & 91.8\% & 96.9\% & 92.5\% & 82.4\% \\
\botrule
\end{tabular}
}{Mouse reads (AC:SRR5286960) were mapped to the primary assembly of mouse
}{Mouse cDNA reads (AC:SRR5286960; R9.4 chemistry) were mapped to the primary assembly of mouse
genome GRCm38 with the following tools and command options: minimap2 (`-ax
splice'); GMAP (`-n 0 --min-intronlength 30 --cross-species'); SpAln (`-Q7 -LS
-S3'); STARlong (according to
@@ -535,7 +584,7 @@ compared to the EnsEMBL gene annotation, release 89. A predicted intron
is \emph{novel} if it has no overlaps with any annotated introns. An intron
is \emph{exact} if it is identical to an annotated intron. An intron is
\emph{approximate} if both its 5'- and 3'-end are within 10bp around the ends
of an annotated intron.}
of an annotated intron. Chimeric alignments are defined in the SAM spec~\citep{Li:2009ys}.}
\end{table}
We next aligned real mouse reads~\citep{Byrne:2017aa} with GMAP~(v2017-06-20;
@@ -592,7 +641,7 @@ simulated data set than Bowtie2 and SNAP but less accurate than BWA-MEM
(Fig.~\ref{fig:eval}b). Closer investigation reveals that BWA-MEM achieves
a higher accuracy partly because it tries to locally align a read in a small
region close to its mate. If we disable this feature, BWA-MEM becomes slightly
less accurate than minimap2. We might consider to implement a similar heuristic
less accurate than minimap2. We might implement a similar heuristic
in minimap2 in future.
To evaluate the accuracy of minimap2 on real data, we aligned human reads
@@ -603,19 +652,29 @@ across the whole genome and have been \emph{de novo} assembled with SMRT reads
to high quality. This allowed us to construct an independent truth variant
dataset~\citep{Li223297} for
ERR1341796. In this evaluation, minimap2 has higher SNP false negative rate
(FNR; 2.5\% of minimap2 vs 2.2\% of BWA-MEM), but fewer false positive SNPs per
million bases (FPPM; 3.0 vs 3.9), lower 2--50bp INDEL FNR (7.3\% vs 7.5\%) and
similar INDEL FPPM (both 1.0). Minimap2 is broadly similar to BWA-MEM in the
(FNR; 2.6\% of minimap2 vs 2.3\% of BWA-MEM), but fewer false positive SNPs per
million bases (FPPM; 7.0 vs 8.8), similar INDEL FNR (11.2\% vs 11.3\%) and
similar INDEL FPPM (6.4 vs 6.5). Minimap2 is broadly comparable to BWA-MEM in the
context of small variant calling.
\subsection{Other applications}
\subsection{Aligning long-read assemblies}
Minimap2 retains minimap's functionality to find overlaps between long reads
and to search against large multi-species databases such as \emph{nt} from
NCBI. Minimap2 can also align similar genomes or different assemblies of the
same species. It took 7 wall-clock minutes over 8 CPU cores to align a human
SMRT assembly (AC:GCA\_001297185.1) to GRCh38, over 20 times faster
MUMmer4~\citep{Kurtz:2004zr}.
Minimap2 can align a SMRT assembly (AC:GCA\_001297185.1) against GRCh38 in 7
minutes using 8 CPU cores, over 20 times faster than nucmer from
MUMmer4~\citep{Marcais:2018aa}. With the paftools.js script from the minimap2
package, we called 2.67 million single-base substitutions out of 2.78Gbp
genomic regions. The transition-to-transversion ratio (ts/tv) is 2.01. In
comparison, using MUMmer4's dnadiff pipeline, we called 2.86 million
substitutions in 2.83Gbp at ts/tv=1.87. Given that ts/tv averaged across the
human genome is about 2 but ts/tv averaged over random errors is 0.5, the
minimap2 callset arguably has higher precision at lower sensitivity.
The sample being assembled is a female. Minimap2 still called 201 substitutions
on the Y chromosome. These substitutions all come from one contig aligned at
96.8\% sequence identity. The contig could be a segmental duplication
absent from GRCh38. In constrast, dnadiff called 9070 substitutions on the Y
chromosome across 73 SMRT contigs. This again implies our minimap2-based
pipeline has higher precision.
\section{Discussions}
@@ -633,9 +692,9 @@ involving $>$100kb introns, which was impractically slow ten years ago. The
minimap2 chaining algorithm is fast and highly accurate by itself. In fact,
chaining alone is more accurate than all the other long-read mappers in
Fig.~\ref{fig:eval}a (data not shown). This accuracy helps to reduce downstream
base-level alignment of candidate chains, which is still times slower than
base-level alignment of candidate chains, which is still several times slower than
chaining even with the Suzuki-Kasahara improvement. In addition, taking a
general form, minimap2 chaining can be adapted to non-typical data types such
general form, minimap2 chaining can be adapted to non-typical data types such as
spliced reads and multiple reads per fragment. This gives us the opportunity to
extend the same base algorithm to a variety of use cases.
@@ -647,8 +706,9 @@ k-mers with a hash table instead. Such fixed-length seeds are inferior to
variable-length seeds in theory, but can be computed much more efficiently in
practice. When a query sequence has multiple seed hits, we can afford to skip
highly repetitive seeds without affecting the final accuracy. This further
alleviates the concern with the uniqueness of seeds. Hash table is the ideal
data structure for mapping long query sequences.
alleviates the concern with the seeding uniqueness. At the same time, at low
sequence identity, it is rare to see long seeds anyway. Hash table is the ideal
data structure for mapping long noisy sequences.
\section*{Acknowledgements}
We owe a debt of gratitude to H. Suzuki and M. Kasahara for releasing their
@@ -657,6 +717,8 @@ Schatz, P. Rescheneder and F. Sedlazeck for pointing out the limitation of
BWA-MEM. We are also grateful to minimap2 users who have greatly helped to
suggest features and to fix various issues.
\paragraph{Funding\textcolon} NHGRI 1R01HG010040-01
\bibliography{minimap2}
\end{document}
+240
View File
@@ -0,0 +1,240 @@
\documentclass{bioinfo}
\copyrightyear{2021}
\pubyear{2021}
\usepackage{graphicx}
\usepackage{hyperref}
\usepackage{url}
\usepackage{amsmath}
\usepackage[ruled,vlined]{algorithm2e}
\newcommand\mycommfont[1]{\footnotesize\rmfamily{\it #1}}
\SetCommentSty{mycommfont}
\SetKwComment{Comment}{$\triangleright$\ }{}
\usepackage{natbib}
\bibliographystyle{apalike}
\DeclareMathOperator*{\argmax}{argmax}
\begin{document}
\firstpage{1}
\title[Improvements to minimap2]{New strategies to improve minimap2 alignment accuracy}
\author[Li]{Heng Li$^{1,2}$}
\address{$^1$Dana-Farber Cancer Institute, 450 Brookline Ave, Boston, MA 02215, USA,
$^2$Harvard Medical School, 10 Shattuck St, Boston, MA 02215, USA}
\maketitle
\begin{abstract}
\section{Summary:} We present several recent improvements to minimap2, a
versatile pairwise aligner for nucleotide sequences. Now minimap2 v2.22 can
more accurately map long reads to highly repetitive regions and align through
insertions or deletions up to 100kb by default, addressing major weakness in
minimap2 v2.18 or earlier.
\section{Availability and implementation:}
\href{https://github.com/lh3/minimap2}{https://github.com/lh3/minimap2}
\section{Contact:} hli@ds.dfci.harvard.edu
\end{abstract}
\section{Introduction}
Minimap2~\citep{Li:2018ab} is widely used for maping long sequence
reads and assembly contigs. \citet{Jain:2020aa} found minimap2 v2.18 or earlier occasionally
misaligned reads from highly repetitive regions as minimap2 ignored seeds of
high occurrence. They also noticed minimap2 may misplace reads with structural
variations (SVs) in such regions~\citep{Jain2020.11.01.363887}. These
misalignments have become a pressing issue in the advent of
temolere-to-telomore human assembly~\citep{Miga:2020aa}. Meanwhile, old minimap2
was unable to efficiently align long insertions/deletions (INDELs) and often
breaks an alignment around variable-number tandem repeats (VNTRs). This has
inspired new chaining algorithms~\citep{Li:2020aa,Ren:2021aa} which are not
integrated into minimap2. Here we will describe recent efforts implemented
in v2.19 through v2.22 to improve mapping results.
\begin{methods}
\section{Methods}
\subsection{Rescuing high-occurrence $k$-mers}\label{sec:high-occ}
Minimap2 keeps all $k$-mer minimizers~\citep{Roberts:2004fv} during indexing. Its original
implementation only selected low-occurrence minimizers during mapping. The
cutoff is a few hundred for mapping long reads against a human genome. If a
read habors only a few or even no low-occurrence minimizers, it will fail
chaining due to insufficient anchors.
To resolve this issue, we implemented a new heuristic to add additional
minimizers. Suppose we are looking at two adjacent low-occurence $k$-mers
located at position $x_1$ and $x_2$, respectively. If $|x_1-x_2|\ge L$,
minimap2 v2.22 additionally selects $\lfloor|x_1-x_2|/L\rfloor$ minimizers
of the lowest occurrence among minimizers between $x_1$ and $x_2$. Here
parameter $L$ controls the frequency of sampling. It defaults to 500.
This strategy adds necessary anchors at the cost of increasing total alignment
time by a few percent on real data.
\subsection{Aligning through longer INDELs}
The original minimap2 may fail to align long INDELs due to its chaining
heuristics. Briefly, minimap2 applies dynamic programming (DP) to chain
minimizer anchors. This is a quadratic algorithm, slow for chaining
contigs. For acceptable performance, the original minimap2 uses a 500bp band by
default, which means a gap longer than 500bp will stop chaining.
To align through longer gaps, older minimap2 implemented a long-join heurstic as follows.
If there is an INDEL longer than 500bp and the two chains around the INDEL
have no overlaps on either the query or the reference sequence, minimap2 may
join the two short chains later.
This heuristic may fail around VNTRs because short chains
often have overlaps in VNTRs. More subtly, minimap2 may escape the inner DP
loop early, again for performance, if the chaining result is not improved for
50 iterations. When there is a copy number change in a long segmental
duplication, the early escape may break around the event even if users
specify a large band.
In minigraph~\citep{Li:2020aa}, we developed a new chaining algorithm that
finds up to 1kb INDELs with DP-based chaining and goes through longer INDELs with a
subquadratic algorithm~\citep{DBLP:conf/wabi/AbouelhodaO03}. We ported the same
algorithm to minimap2 for contig mapping. For long-read mapping, the minigraph
algorithm is slower. Minimap2 v2.22 still uses the DP-based algorithm to
find short chains and then invokes the minigraph algorithm to rechain anchors in
these short chains. The rechaining step achieves the same goal as long-join
but is more reliable because it can resolve overlaps between short chains. The old
long-join heuristic has since been removed.
\subsection{Properly mapping long reads with SVs}
The original minimap2 ranks an alignment by its Smith-Waterman score and
outputs the best scoring alignment. However, when there are SVs on the read,
the best scoring alignment is sometimes not the correct alignment.
\citet{Jain2020.11.01.363887} resolved this dilemma by altering the mapping
algorithm.
In our view, this problem is rooted in inapropriate scoring: affine-gap penalty
over-penalizes a long INDEL that was often evolutionarily created in one event.
We should not penalize a SV by a function linear in the SV length. Minimap2 v2.22 instead rescores
an alignment with the following scoring function. Suppose an alignment consists
of $M$ matching bases, $N$ substitutions and $G$ gap opens, we empirically
score the alignment with
$$
S=M-\frac{N+G}{2d}-\sum_{i=1}^G\log_2(1+g_i)
$$
where $g_i\ge1$ is the length of the $i$-th gap and
$$
d=\max\left\{\frac{N+G}{M+N+G},0.02\right\}
$$
It approximates per-base sequence divergence except with the smallest value set
to 2\%. As an analogy to affine-gap scoring, the matching score in our scheme
is 1, the mismatch and gap open penalties are both $1/2d$ and the gap extension
penalty is a logarithm function of the gap length~\citep{Gu:1995wt}. Our scoring gives a long SV
a much milder penalty. In terms of time complexity, scoring an alignment is
linear in the length of the alignment. The time spent on rescoring is negligible in
practice.
%If we assume sequences evolve under a duplication-mutation model, we may have a
%better way to choose the best alignment. If a long read can be mapped to $n$
%loci, we can take the read as the template and build a
%pseudo-multi-sequence-alignment (pMSA) of $n+1$ sequences. In this pMSA, we say
%a site on the read is informative if the $n$ reference subsequences differ at
%the position.
\end{methods}
\section{Results}
\begin{table}
\processtable{Evaluation of minimap2 v2.22}
{\footnotesize\label{tab:1}\begin{tabular}{p{4.2cm}rrrr}
\toprule
$[$Benchmark$]$ Metric & v2.22 & v2.18 & Winno & lra \\
\midrule
$[$sim-map$]$ \% mapped reads at Q10 & 97.9 & 97.6 & {\bf 99.0}& 97.3 \\
$[$sim-map$]$ err. rate at Q10 (phredQ) & {\bf 52} & {\bf 52} & 38 & 24 \\
$[$winno-cmp$]$ rate of diff. (phredQ) & {\bf 41} & 37 & truth & 18 \\
$[$winno-cmp$]$ CPU time (hour) & {\bf 5.0} & 5.3 & 71.8 & 13.1 \\
$[$winno-cmp$]$ peak RAM (Gb) & 17.1 & 14.4 & {\bf 9.6} & 12.4 \\
$[$sim-sv$]$ \% false negative rate & {\bf 0.5} & 2.0 & {\bf 0.5} & 1.4 \\
$[$sim-sv$]$ \% false discovery rate & {\bf 0.0} & 0.1 & {\bf 0.0} & 0.1 \\
$[$real-sv-1k$]$ \% false negative rate & {\bf 7.3} & 20.0 & 13.0 & N/A \\
$[$real-sv-1k$]$ \% false discovery rate & 2.7 & {\bf 2.4} & 2.7 & N/A \\
\botrule
\end{tabular}}
{In $[$sim-map$]$, 152,713 reads were simulated from the CHM13 telomere-to-telomere assembly v1.1
(AC: GCA\_009914755.3) with pbsim2~\citep{Ono:2021aa}: ``pbsim2 -{}-hmm\_model R94.model -{}-length-min
5000 -{}-length-mean 20000 -{}-accuracy-mean 0.95''. Alignments of mapping quality
10 or higher were evaluated by ``paftools.js mapeval''. The mapping error rate
is measured in the phred scale: if the error rate is $e$, $-10\log_{10}e$ is
reported in the table. In $[$winno-cmp$]$, 1.39 million CHM13 HiFi reads from
SRR11292121 were mapped against the same CHM13 assembly. 99.3\% of them were mapped by Winnowmap2
at mapping quality 10 or higher and were taken as ground truth to evaluate
minimap2 and lra with ``paftools.js pafcmp''. $[$sim-sv$]$ simulated 1,000
50bp to 1000bp INDELs from chr8 in CHM13 using SURVIVOR~\citep{Jeffares:2017aa} and simulated Nanopore
reads at 30-fold coverage with the same pbsim2 command line. SVs were called with
``sniffles -q 10''~\citep{Sedlazeck:2018ab} and compared to the simulated truth with ``SURVIVOR eval
call.vcf truth.bed 50''. In $[$real-sv-1k$]$, small and long variants were
called by dipcall-0.3~\citep{Li:2018aa} for HG002 assemblies (AC: GCA\_018852605.1 and
GCA\_018852615.1) and compared to the GIAB truth~\citep{Zook:2020aa} using ``truvari -r 2000 -s
1000 -S 400 -{}-multimatch -{}-passonly'' which sets the minimum INDEL size to 1kb in evaluation. }
\end{table}
We evaluated minimap2 v2.22 along with v2.18, Winnowmap2 v2.03 and lra v1.3.2
(Table~\ref{tab:1}), using the default setting of each mapper according to the input data types.
Both versions of minimap2 achieved high mapping accuracy on
simulated Nanopore reads (sim-map). Winnowmap2 aligned more reads at mapping
quality 10 or higher (mapQ10). However, it may occasionally assign a high mapping
quality to a read with multiple identical best alignments. This reduced its
mapping accuracy.
In lack of groud truth for real data, we took Winnowmap2 mapping as ground
truth to evaluate other mappers (winno-cmp in Table~\ref{tab:1}). Out of 1,378,092 reads with mapQ10
alignments by Winnowmap2, minimap2 v2.22 could map all of them. 118 reads, less
than 0.01\% of all reads, were mapped differently by v2.22. 51 of them have
multiple identical best alignments. We believe these are more likely to be
Winnowmap2 errors. Most of the remaining 67 (=118-51) reads have multiple
highly similar but not identical alignments.
Minimap2 v2.18 is less consistent with 275 differences including 30 unmapped
reads mappable by both Winnowmap2 and v2.22.
For the minimizer rescuing parameter $L$ in Section~\ref{sec:high-occ},
we set its default to 500 such that v2.22 has comparable performance to v2.18 given simulated PacBio and Nanopore human reads.
To see the effect of this parameter on real data, we tried several different $L$ values.
v2.22 gave 99 mapping differences at $L=200$,
118 at $L=500$ (default), 167 at $L=750$ and 224 differences at $L=1000$ in comparison to Winnowmap2.
$L=200$ is 28\% slower than the default while $L=1000$ is 9\% faster.
Changing the default minimizer window size (option ``-w'')
and the initial minimizer occurrence cutoff (option ``-f'')
also affects performance and accuracy to a similar magnitude.
The two benchmarks above only evaluate read mappings when there are no variations between the reads and the reference.
To measure the mapping accuracy in the presence of SVs (sim-sv), we reproduced
the results by~\citep{Jain2020.11.01.363887}. Minimap2 v2.22 is as good as
Winnowmap2 now. Note that we were setting the Sniffles mapping quality
threshold to 10 in consistent with the benchmarks above. If we used the
default threshold 20, v2.22 would miss additional five SVs (accounting for
0.5\% of simulated SVs). For four out of these five missing SVs, minimap2 v2.22
mapped more variant reads than Winnowmap2. Sniffles did not call these SVs
because minimap2 tended to give them conservative mapping quality. It is worth
noting that the simulation here only considers a simple scenario in evolution.
Non-allelic gene conversions, which happen often in segmental
duplications~\citep{Harpak:2017aa}, would obscure the optimal mapping
strategies. How much such simple SV simulation informs real-world SV calling
remains a question.
To see if minimap2 v2.22 could improve long INDEL alignment, we ran dipcall on
contig-to-reference alignments and focused on INDELs longer than 1kb
(real-sv-1k). v2.22 is more sensitive at comparable specificity, confirming its
advantage in more contiguous alignment. We could not get dipcall to work well with lra,
so did not report the numbers.
Minimap2 spends most computing time on base alignment. As recent improvements
in v2.22 incur little additional computing and do not change the base alignment
algorithm, the new version has similar performance to older versions. It is
consistently faster than Winnowmap2 by several times. Sometimes simple
heuristics can be as effective as more sophisticated yet slower solutions.
\section*{Acknowledgements}
We thank Arang Rhie and Chirag Jain for providing motivating examples for which
older minimap2 underperforms.
\paragraph{Funding\textcolon} This work is funded by NHGRI grant R01HG010040.
\bibliography{minimap2}
\end{document}